| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T7621 |
856-857 |
. |
denotes |
. |
| T7620 |
855-856 |
-RRB- |
denotes |
] |
| T7619 |
853-855 |
CD |
denotes |
22 |
| T7618 |
852-853 |
-LRB- |
denotes |
[ |
| T7617 |
842-851 |
VBN |
denotes |
described |
| T7616 |
839-841 |
IN |
denotes |
as |
| T7615 |
829-838 |
VBN |
denotes |
sequenced |
| T7614 |
825-828 |
CC |
denotes |
and |
| T7613 |
813-815 |
PRP |
denotes |
we |
| T7612 |
816-824 |
VBN |
denotes |
purified |
| T7611 |
800-803 |
NN |
denotes |
PCR |
| T7610 |
804-812 |
NNS |
denotes |
products |
| T7609 |
796-799 |
DT |
denotes |
The |
| T7608 |
795-857 |
sentence |
denotes |
The PCR products we purified and sequenced as described [22]. |
| T7607 |
794-795 |
. |
denotes |
. |
| T7606 |
793-794 |
-RRB- |
denotes |
) |
| T7605 |
790-793 |
NN |
denotes |
min |
| T7604 |
788-789 |
CD |
denotes |
2 |
| T7603 |
784-787 |
IN |
denotes |
for |
| T7602 |
780-782 |
CD |
denotes |
72 |
| T7601 |
778-780 |
, |
denotes |
, |
| T7600 |
775-778 |
NN |
denotes |
min |
| T7599 |
773-774 |
CD |
denotes |
1 |
| T7598 |
769-772 |
IN |
denotes |
for |
| T7597 |
767-768 |
NNS |
denotes |
° |
| T7596 |
765-767 |
CD |
denotes |
57 |
| T7595 |
763-765 |
, |
denotes |
, |
| T7594 |
760-763 |
NN |
denotes |
sec |
| T7593 |
757-759 |
CD |
denotes |
40 |
| T7592 |
753-756 |
IN |
denotes |
for |
| T7591 |
751-752 |
NNS |
denotes |
° |
| T7590 |
749-751 |
CD |
denotes |
94 |
| T7589 |
782-783 |
NNS |
denotes |
° |
| T7588 |
748-749 |
-LRB- |
denotes |
( |
| T7587 |
746-747 |
-RRB- |
denotes |
) |
| T7586 |
744-746 |
JJ |
denotes |
MA |
| T7585 |
742-744 |
, |
denotes |
, |
| T7584 |
731-733 |
NNP |
denotes |
MJ |
| T7583 |
734-742 |
NNP |
denotes |
Research |
| T7582 |
730-731 |
-LRB- |
denotes |
( |
| T7581 |
715-722 |
NNP |
denotes |
Thermal |
| T7580 |
711-714 |
NNP |
denotes |
PTC |
| T7579 |
723-729 |
NNP |
denotes |
Cycler |
| T7578 |
709-710 |
DT |
denotes |
a |
| T7577 |
706-708 |
IN |
denotes |
in |
| T7576 |
695-705 |
NN |
denotes |
polymerase |
| T7575 |
685-690 |
NNP |
denotes |
Elmer |
| T7574 |
684-685 |
HYPH |
denotes |
- |
| T7573 |
691-694 |
NNP |
denotes |
Taq |
| T7572 |
678-684 |
NNP |
denotes |
Perkin |
| T7571 |
673-677 |
IN |
denotes |
with |
| T7570 |
659-672 |
NN |
denotes |
amplification |
| T7569 |
656-658 |
IN |
denotes |
of |
| T7568 |
649-655 |
NNS |
denotes |
cycles |
| T7567 |
646-648 |
CD |
denotes |
30 |
| T7566 |
636-645 |
VBD |
denotes |
underwent |
| T7565 |
628-635 |
NNS |
denotes |
Samples |
| T7564 |
627-795 |
sentence |
denotes |
Samples underwent 30 cycles of amplification with Perkin-Elmer Taq polymerase in a PTC Thermal Cycler (MJ Research, MA) (94° for 40 sec, 57° for 1 min, 72° for 2 min). |
| T7563 |
626-627 |
SYM |
denotes |
' |
| T7562 |
625-626 |
CD |
denotes |
3 |
| T7561 |
624-625 |
HYPH |
denotes |
- |
| T7560 |
601-602 |
HYPH |
denotes |
- |
| T7559 |
600-601 |
SYM |
denotes |
' |
| T7558 |
602-624 |
NN |
denotes |
tcttctggaaagttctcctgca |
| T7557 |
599-600 |
CD |
denotes |
5 |
| T7556 |
595-598 |
CC |
denotes |
and |
| T7555 |
593-594 |
'' |
denotes |
' |
| T7554 |
592-593 |
CD |
denotes |
3 |
| T7553 |
591-592 |
HYPH |
denotes |
- |
| T7552 |
567-568 |
HYPH |
denotes |
- |
| T7551 |
566-567 |
SYM |
denotes |
' |
| T7550 |
568-591 |
NN |
denotes |
tctgaggatgttcacaggtttat |
| T7549 |
565-566 |
CD |
denotes |
5 |
| T7548 |
564-627 |
sentence |
denotes |
5'-tctgaggatgttcacaggtttat-3' and 5'-tcttctggaaagttctcctgca-3' |
| T7547 |
563-564 |
SYM |
denotes |
' |
| T7546 |
562-563 |
CD |
denotes |
3 |
| T7545 |
561-562 |
HYPH |
denotes |
- |
| T7544 |
539-540 |
HYPH |
denotes |
- |
| T7543 |
538-539 |
SYM |
denotes |
' |
| T7542 |
540-561 |
NN |
denotes |
ttcactggaccagcataagga |
| T7541 |
537-538 |
CD |
denotes |
5 |
| T7540 |
533-536 |
CC |
denotes |
and |
| T7539 |
531-532 |
'' |
denotes |
' |
| T7538 |
530-531 |
CD |
denotes |
3 |
| T7537 |
529-530 |
HYPH |
denotes |
- |
| T7536 |
505-506 |
HYPH |
denotes |
- |
| T7535 |
504-505 |
SYM |
denotes |
' |
| T7534 |
503-504 |
CD |
denotes |
5 |
| T7533 |
501-503 |
: |
denotes |
: |
| T7532 |
506-529 |
NN |
denotes |
taggagaagtctcattatactgc |
| T7531 |
493-501 |
NN |
denotes |
Promoter |
| T7530 |
492-564 |
sentence |
denotes |
Promoter: 5'-taggagaagtctcattatactgc-3' and 5'-ttcactggaccagcataagga-3' |
| T7529 |
491-492 |
SYM |
denotes |
' |
| T7528 |
490-491 |
CD |
denotes |
3 |
| T7527 |
489-490 |
HYPH |
denotes |
- |
| T7526 |
467-468 |
HYPH |
denotes |
- |
| T7525 |
466-467 |
SYM |
denotes |
' |
| T7524 |
468-489 |
NN |
denotes |
cggaacttcaccttttctggc |
| T7523 |
465-466 |
CD |
denotes |
5 |
| T7522 |
461-464 |
CC |
denotes |
and |
| T7521 |
459-460 |
SYM |
denotes |
' |
| T7520 |
458-459 |
CD |
denotes |
3 |
| T7519 |
457-458 |
HYPH |
denotes |
- |
| T7518 |
434-435 |
HYPH |
denotes |
- |
| T7517 |
433-434 |
SYM |
denotes |
' |
| T7516 |
435-457 |
NN |
denotes |
agacattgacttagctgtggat |
| T7515 |
432-433 |
CD |
denotes |
5 |
| T7514 |
431-492 |
sentence |
denotes |
5'-agacattgacttagctgtggat-3' and 5'-cggaacttcaccttttctggc-3' |
| T7513 |
430-431 |
SYM |
denotes |
' |
| T7512 |
429-430 |
CD |
denotes |
3 |
| T7511 |
428-429 |
HYPH |
denotes |
- |
| T7496 |
286-287 |
SYM |
denotes |
' |
| T7495 |
285-286 |
CD |
denotes |
3 |
| T7491 |
262-263 |
HYPH |
denotes |
- |
| T7488 |
260-261 |
CD |
denotes |
5 |
| T7486 |
254-255 |
SYM |
denotes |
' |
| T7485 |
253-254 |
CD |
denotes |
3 |
| T7484 |
252-253 |
HYPH |
denotes |
- |
| T7483 |
228-229 |
HYPH |
denotes |
- |
| T7482 |
227-228 |
SYM |
denotes |
' |
| T7481 |
392-393 |
CD |
denotes |
3 |
| T7480 |
391-392 |
HYPH |
denotes |
- |
| T7479 |
369-370 |
HYPH |
denotes |
- |
| T7478 |
229-252 |
NN |
denotes |
gaccagctggagacccaaaccag |
| T7477 |
368-369 |
SYM |
denotes |
' |
| T7476 |
226-227 |
CD |
denotes |
5 |
| T7475 |
225-287 |
sentence |
denotes |
5'-gaccagctggagacccaaaccag-3' and 5'-gctcagatccactgacctaaa-3' |
| T7474 |
367-368 |
CD |
denotes |
5 |
| T7435 |
116-119 |
DT |
denotes |
the |
| T7434 |
110-115 |
VBG |
denotes |
using |
| T7433 |
98-105 |
JJ |
denotes |
genomic |
| T7432 |
106-109 |
NN |
denotes |
DNA |
| T7431 |
92-97 |
NN |
denotes |
mouse |
| T7430 |
87-91 |
IN |
denotes |
from |
| T7429 |
72-76 |
VBD |
denotes |
were |
| T7428 |
62-66 |
NN |
denotes |
Myoc |
| T7427 |
56-61 |
NN |
denotes |
mouse |
| T7426 |
67-71 |
NN |
denotes |
gene |
| T7425 |
52-55 |
DT |
denotes |
the |
| T7424 |
49-51 |
IN |
denotes |
of |
| T7423 |
31-39 |
JJ |
denotes |
proximal |
| T7422 |
40-48 |
NN |
denotes |
promoter |
| T7421 |
27-30 |
DT |
denotes |
the |
| T7420 |
23-26 |
CC |
denotes |
and |
| T7419 |
77-86 |
VBN |
denotes |
amplified |
| T7418 |
17-22 |
NNS |
denotes |
Exons |
| T7417 |
16-154 |
sentence |
denotes |
Exons and the proximal promoter of the mouse Myoc gene were amplified from mouse genomic DNA using the following combinations of primers: |
| T7416 |
12-16 |
NN |
denotes |
Myoc |
| T7415 |
9-11 |
IN |
denotes |
of |
| T7414 |
0-8 |
NN |
denotes |
Analysis |
| T7446 |
163-164 |
CD |
denotes |
5 |
| T7445 |
161-163 |
: |
denotes |
: |
| T7444 |
160-161 |
CD |
denotes |
1 |
| T7443 |
166-188 |
NN |
denotes |
cttgcaggagaactttccagaa |
| T7442 |
155-159 |
NN |
denotes |
Exon |
| T7441 |
154-225 |
sentence |
denotes |
Exon 1: 5'-cttgcaggagaactttccagaa-3' and 5'-atctcgaaggagattgttatagg-3' |
| T7440 |
153-154 |
: |
denotes |
: |
| T7439 |
146-153 |
NNS |
denotes |
primers |
| T7438 |
143-145 |
IN |
denotes |
of |
| T7437 |
120-129 |
JJ |
denotes |
following |
| T7436 |
130-142 |
NNS |
denotes |
combinations |
| T7448 |
324-325 |
SYM |
denotes |
' |
| T7447 |
164-165 |
SYM |
denotes |
' |
| T7449 |
326-329 |
CC |
denotes |
and |
| T7450 |
330-331 |
CD |
denotes |
5 |
| T7451 |
333-355 |
NN |
denotes |
caaaagggagaagtctaacttc |
| T7452 |
331-332 |
SYM |
denotes |
' |
| T7453 |
165-166 |
HYPH |
denotes |
- |
| T7454 |
188-189 |
HYPH |
denotes |
- |
| T7456 |
332-333 |
HYPH |
denotes |
- |
| T7455 |
189-190 |
CD |
denotes |
3 |
| T7457 |
355-356 |
HYPH |
denotes |
- |
| T7458 |
190-191 |
SYM |
denotes |
' |
| T7460 |
356-357 |
CD |
denotes |
3 |
| T7459 |
192-195 |
CC |
denotes |
and |
| T7461 |
357-358 |
SYM |
denotes |
' |
| T7462 |
196-197 |
CD |
denotes |
5 |
| T7463 |
199-222 |
NN |
denotes |
atctcgaaggagattgttatagg |
| T7465 |
358-431 |
sentence |
denotes |
Exon 3: 5'-agtcaaggctcacagagctaa-3' and 5'-aagagtagctgctcaccgtgtacaag-3' |
| T7464 |
197-198 |
SYM |
denotes |
' |
| T7466 |
198-199 |
HYPH |
denotes |
- |
| T7467 |
222-223 |
HYPH |
denotes |
- |
| T7468 |
359-363 |
NN |
denotes |
Exon |
| T7469 |
370-391 |
NN |
denotes |
agtcaaggctcacagagctaa |
| T7471 |
364-365 |
CD |
denotes |
3 |
| T7470 |
223-224 |
CD |
denotes |
3 |
| T7473 |
365-367 |
: |
denotes |
: |
| T7472 |
224-225 |
SYM |
denotes |
' |
| T7487 |
256-259 |
CC |
denotes |
and |
| T7489 |
263-284 |
NN |
denotes |
gctcagatccactgacctaaa |
| T7490 |
261-262 |
SYM |
denotes |
' |
| T7493 |
393-394 |
SYM |
denotes |
' |
| T7492 |
284-285 |
HYPH |
denotes |
- |
| T7494 |
395-398 |
CC |
denotes |
and |
| T7497 |
287-358 |
sentence |
denotes |
Exon 2: 5'-tgaagccatactttaccaaccat-3' and 5'-caaaagggagaagtctaacttc-3' |
| T7499 |
399-400 |
CD |
denotes |
5 |
| T7498 |
288-292 |
NN |
denotes |
Exon |
| T7500 |
402-428 |
NN |
denotes |
aagagtagctgctcaccgtgtacaag |
| T7501 |
400-401 |
SYM |
denotes |
' |
| T7502 |
401-402 |
HYPH |
denotes |
- |
| T7510 |
323-324 |
CD |
denotes |
3 |
| T7509 |
322-323 |
HYPH |
denotes |
- |
| T7508 |
298-299 |
HYPH |
denotes |
- |
| T7507 |
297-298 |
SYM |
denotes |
' |
| T7506 |
296-297 |
CD |
denotes |
5 |
| T7505 |
294-296 |
: |
denotes |
: |
| T7504 |
293-294 |
CD |
denotes |
2 |
| T7503 |
299-322 |
NN |
denotes |
tgaagccatactttaccaaccat |
| R5750 |
T7415 |
T7414 |
prep |
of,Analysis |
| R5751 |
T7416 |
T7415 |
pobj |
Myoc,of |
| R5752 |
T7418 |
T7419 |
nsubjpass |
Exons,amplified |
| R5753 |
T7420 |
T7418 |
cc |
and,Exons |
| R5754 |
T7421 |
T7422 |
det |
the,promoter |
| R5755 |
T7422 |
T7418 |
conj |
promoter,Exons |
| R5756 |
T7423 |
T7422 |
amod |
proximal,promoter |
| R5757 |
T7424 |
T7422 |
prep |
of,promoter |
| R5758 |
T7425 |
T7426 |
det |
the,gene |
| R5759 |
T7426 |
T7424 |
pobj |
gene,of |
| R5760 |
T7427 |
T7426 |
compound |
mouse,gene |
| R5761 |
T7428 |
T7426 |
compound |
Myoc,gene |
| R5762 |
T7429 |
T7419 |
auxpass |
were,amplified |
| R5763 |
T7430 |
T7419 |
prep |
from,amplified |
| R5764 |
T7431 |
T7432 |
nmod |
mouse,DNA |
| R5765 |
T7432 |
T7430 |
pobj |
DNA,from |
| R5766 |
T7433 |
T7432 |
amod |
genomic,DNA |
| R5767 |
T7434 |
T7419 |
advcl |
using,amplified |
| R5768 |
T7435 |
T7436 |
det |
the,combinations |
| R5769 |
T7436 |
T7434 |
dobj |
combinations,using |
| R5770 |
T7437 |
T7436 |
amod |
following,combinations |
| R5771 |
T7438 |
T7436 |
prep |
of,combinations |
| R5772 |
T7439 |
T7438 |
pobj |
primers,of |
| R5773 |
T7440 |
T7419 |
punct |
:,amplified |
| R5774 |
T7442 |
T7443 |
dep |
Exon,cttgcaggagaactttccagaa |
| R5775 |
T7444 |
T7442 |
nummod |
1,Exon |
| R5776 |
T7445 |
T7443 |
punct |
: ,cttgcaggagaactttccagaa |
| R5777 |
T7446 |
T7443 |
nummod |
5,cttgcaggagaactttccagaa |
| R5778 |
T7447 |
T7446 |
punct |
',5 |
| R5779 |
T7448 |
T7503 |
punct |
',tgaagccatactttaccaaccat |
| R5780 |
T7449 |
T7503 |
cc |
and,tgaagccatactttaccaaccat |
| R5781 |
T7450 |
T7451 |
nummod |
5,caaaagggagaagtctaacttc |
| R5782 |
T7451 |
T7503 |
conj |
caaaagggagaagtctaacttc,tgaagccatactttaccaaccat |
| R5783 |
T7452 |
T7450 |
punct |
',5 |
| R5784 |
T7453 |
T7443 |
punct |
-,cttgcaggagaactttccagaa |
| R5785 |
T7454 |
T7443 |
punct |
-,cttgcaggagaactttccagaa |
| R5786 |
T7455 |
T7443 |
nummod |
3,cttgcaggagaactttccagaa |
| R5787 |
T7456 |
T7451 |
punct |
-,caaaagggagaagtctaacttc |
| R5788 |
T7457 |
T7451 |
punct |
-,caaaagggagaagtctaacttc |
| R5789 |
T7458 |
T7443 |
punct |
',cttgcaggagaactttccagaa |
| R5790 |
T7459 |
T7443 |
cc |
and,cttgcaggagaactttccagaa |
| R5791 |
T7460 |
T7451 |
nummod |
3,caaaagggagaagtctaacttc |
| R5792 |
T7461 |
T7451 |
punct |
',caaaagggagaagtctaacttc |
| R5793 |
T7462 |
T7463 |
nummod |
5,atctcgaaggagattgttatagg |
| R5794 |
T7463 |
T7443 |
conj |
atctcgaaggagattgttatagg,cttgcaggagaactttccagaa |
| R5795 |
T7464 |
T7462 |
punct |
',5 |
| R5796 |
T7466 |
T7463 |
punct |
-,atctcgaaggagattgttatagg |
| R5797 |
T7467 |
T7463 |
punct |
-,atctcgaaggagattgttatagg |
| R5798 |
T7468 |
T7469 |
dep |
Exon,agtcaaggctcacagagctaa |
| R5799 |
T7470 |
T7463 |
nummod |
3,atctcgaaggagattgttatagg |
| R5800 |
T7471 |
T7468 |
nummod |
3,Exon |
| R5801 |
T7472 |
T7463 |
punct |
',atctcgaaggagattgttatagg |
| R5802 |
T7473 |
T7469 |
punct |
: ,agtcaaggctcacagagctaa |
| R5803 |
T7474 |
T7469 |
nummod |
5,agtcaaggctcacagagctaa |
| R5804 |
T7476 |
T7478 |
nummod |
5,gaccagctggagacccaaaccag |
| R5805 |
T7477 |
T7474 |
punct |
',5 |
| R5806 |
T7479 |
T7469 |
punct |
-,agtcaaggctcacagagctaa |
| R5807 |
T7480 |
T7469 |
punct |
-,agtcaaggctcacagagctaa |
| R5808 |
T7481 |
T7469 |
nummod |
3,agtcaaggctcacagagctaa |
| R5809 |
T7482 |
T7476 |
punct |
',5 |
| R5810 |
T7483 |
T7478 |
punct |
-,gaccagctggagacccaaaccag |
| R5811 |
T7484 |
T7478 |
punct |
-,gaccagctggagacccaaaccag |
| R5812 |
T7485 |
T7478 |
nummod |
3,gaccagctggagacccaaaccag |
| R5813 |
T7486 |
T7478 |
punct |
',gaccagctggagacccaaaccag |
| R5814 |
T7487 |
T7478 |
cc |
and,gaccagctggagacccaaaccag |
| R5815 |
T7488 |
T7489 |
nummod |
5,gctcagatccactgacctaaa |
| R5816 |
T7489 |
T7478 |
conj |
gctcagatccactgacctaaa,gaccagctggagacccaaaccag |
| R5817 |
T7490 |
T7488 |
punct |
',5 |
| R5818 |
T7491 |
T7489 |
punct |
-,gctcagatccactgacctaaa |
| R5819 |
T7492 |
T7489 |
punct |
-,gctcagatccactgacctaaa |
| R5820 |
T7493 |
T7469 |
punct |
',agtcaaggctcacagagctaa |
| R5821 |
T7494 |
T7469 |
cc |
and,agtcaaggctcacagagctaa |
| R5822 |
T7495 |
T7489 |
nummod |
3,gctcagatccactgacctaaa |
| R5823 |
T7496 |
T7489 |
punct |
',gctcagatccactgacctaaa |
| R5824 |
T7498 |
T7503 |
dep |
Exon,tgaagccatactttaccaaccat |
| R5825 |
T7499 |
T7500 |
nummod |
5,aagagtagctgctcaccgtgtacaag |
| R5826 |
T7500 |
T7469 |
conj |
aagagtagctgctcaccgtgtacaag,agtcaaggctcacagagctaa |
| R5827 |
T7501 |
T7499 |
punct |
',5 |
| R5828 |
T7502 |
T7500 |
punct |
-,aagagtagctgctcaccgtgtacaag |
| R5829 |
T7504 |
T7498 |
nummod |
2,Exon |
| R5830 |
T7505 |
T7503 |
punct |
: ,tgaagccatactttaccaaccat |
| R5831 |
T7506 |
T7503 |
nummod |
5,tgaagccatactttaccaaccat |
| R5832 |
T7507 |
T7506 |
punct |
',5 |
| R5833 |
T7508 |
T7503 |
punct |
-,tgaagccatactttaccaaccat |
| R5834 |
T7509 |
T7503 |
punct |
-,tgaagccatactttaccaaccat |
| R5835 |
T7510 |
T7503 |
nummod |
3,tgaagccatactttaccaaccat |
| R5836 |
T7511 |
T7500 |
punct |
-,aagagtagctgctcaccgtgtacaag |
| R5837 |
T7512 |
T7500 |
nummod |
3,aagagtagctgctcaccgtgtacaag |
| R5838 |
T7513 |
T7500 |
punct |
',aagagtagctgctcaccgtgtacaag |
| R5839 |
T7515 |
T7516 |
nummod |
5,agacattgacttagctgtggat |
| R5840 |
T7517 |
T7515 |
punct |
',5 |
| R5841 |
T7518 |
T7516 |
punct |
-,agacattgacttagctgtggat |
| R5842 |
T7519 |
T7516 |
punct |
-,agacattgacttagctgtggat |
| R5843 |
T7520 |
T7516 |
nummod |
3,agacattgacttagctgtggat |
| R5844 |
T7521 |
T7516 |
punct |
',agacattgacttagctgtggat |
| R5845 |
T7522 |
T7516 |
cc |
and,agacattgacttagctgtggat |
| R5846 |
T7523 |
T7524 |
nummod |
5,cggaacttcaccttttctggc |
| R5847 |
T7524 |
T7516 |
conj |
cggaacttcaccttttctggc,agacattgacttagctgtggat |
| R5848 |
T7525 |
T7523 |
punct |
',5 |
| R5849 |
T7526 |
T7524 |
punct |
-,cggaacttcaccttttctggc |
| R5850 |
T7527 |
T7524 |
punct |
-,cggaacttcaccttttctggc |
| R5851 |
T7528 |
T7524 |
nummod |
3,cggaacttcaccttttctggc |
| R5852 |
T7529 |
T7524 |
punct |
',cggaacttcaccttttctggc |
| R5853 |
T7531 |
T7532 |
dep |
Promoter,taggagaagtctcattatactgc |
| R5854 |
T7533 |
T7532 |
punct |
: ,taggagaagtctcattatactgc |
| R5855 |
T7534 |
T7532 |
nummod |
5,taggagaagtctcattatactgc |
| R5856 |
T7535 |
T7534 |
punct |
',5 |
| R5857 |
T7536 |
T7532 |
punct |
-,taggagaagtctcattatactgc |
| R5858 |
T7537 |
T7532 |
punct |
-,taggagaagtctcattatactgc |
| R5859 |
T7538 |
T7532 |
nummod |
3,taggagaagtctcattatactgc |
| R5860 |
T7539 |
T7532 |
punct |
',taggagaagtctcattatactgc |
| R5861 |
T7540 |
T7532 |
cc |
and,taggagaagtctcattatactgc |
| R5862 |
T7541 |
T7542 |
nummod |
5,ttcactggaccagcataagga |
| R5863 |
T7542 |
T7532 |
conj |
ttcactggaccagcataagga,taggagaagtctcattatactgc |
| R5864 |
T7543 |
T7542 |
punct |
',ttcactggaccagcataagga |
| R5865 |
T7544 |
T7542 |
punct |
-,ttcactggaccagcataagga |
| R5866 |
T7545 |
T7542 |
punct |
-,ttcactggaccagcataagga |
| R5867 |
T7546 |
T7542 |
nummod |
3,ttcactggaccagcataagga |
| R5868 |
T7547 |
T7542 |
punct |
',ttcactggaccagcataagga |
| R5869 |
T7549 |
T7550 |
nummod |
5,tctgaggatgttcacaggtttat |
| R5870 |
T7551 |
T7549 |
punct |
',5 |
| R5871 |
T7552 |
T7550 |
punct |
-,tctgaggatgttcacaggtttat |
| R5872 |
T7553 |
T7550 |
punct |
-,tctgaggatgttcacaggtttat |
| R5873 |
T7554 |
T7550 |
nummod |
3,tctgaggatgttcacaggtttat |
| R5874 |
T7555 |
T7550 |
punct |
',tctgaggatgttcacaggtttat |
| R5875 |
T7556 |
T7550 |
cc |
and,tctgaggatgttcacaggtttat |
| R5876 |
T7557 |
T7558 |
nummod |
5,tcttctggaaagttctcctgca |
| R5877 |
T7558 |
T7550 |
conj |
tcttctggaaagttctcctgca,tctgaggatgttcacaggtttat |
| R5878 |
T7559 |
T7557 |
punct |
',5 |
| R5879 |
T7560 |
T7558 |
punct |
-,tcttctggaaagttctcctgca |
| R5880 |
T7561 |
T7558 |
punct |
-,tcttctggaaagttctcctgca |
| R5881 |
T7562 |
T7558 |
nummod |
3,tcttctggaaagttctcctgca |
| R5882 |
T7563 |
T7558 |
punct |
',tcttctggaaagttctcctgca |
| R5883 |
T7565 |
T7566 |
nsubj |
Samples,underwent |
| R5884 |
T7567 |
T7568 |
nummod |
30,cycles |
| R5885 |
T7568 |
T7566 |
dobj |
cycles,underwent |
| R5886 |
T7569 |
T7568 |
prep |
of,cycles |
| R5887 |
T7570 |
T7569 |
pobj |
amplification,of |
| R5888 |
T7571 |
T7568 |
prep |
with,cycles |
| R5889 |
T7572 |
T7573 |
compound |
Perkin,Taq |
| R5890 |
T7573 |
T7576 |
compound |
Taq,polymerase |
| R5891 |
T7574 |
T7573 |
punct |
-,Taq |
| R5892 |
T7575 |
T7573 |
compound |
Elmer,Taq |
| R5893 |
T7576 |
T7571 |
pobj |
polymerase,with |
| R5894 |
T7577 |
T7576 |
prep |
in,polymerase |
| R5895 |
T7578 |
T7579 |
det |
a,Cycler |
| R5896 |
T7579 |
T7577 |
pobj |
Cycler,in |
| R5897 |
T7580 |
T7579 |
compound |
PTC,Cycler |
| R5898 |
T7581 |
T7579 |
compound |
Thermal,Cycler |
| R5899 |
T7582 |
T7583 |
punct |
(,Research |
| R5900 |
T7583 |
T7576 |
parataxis |
Research,polymerase |
| R5901 |
T7584 |
T7583 |
compound |
MJ,Research |
| R5902 |
T7585 |
T7583 |
punct |
", ",Research |
| R5903 |
T7586 |
T7583 |
npadvmod |
MA,Research |
| R5904 |
T7587 |
T7583 |
punct |
),Research |
| R5905 |
T7588 |
T7589 |
punct |
(,° |
| R5906 |
T7589 |
T7576 |
parataxis |
°,polymerase |
| R5907 |
T7590 |
T7591 |
nummod |
94,° |
| R5908 |
T7591 |
T7589 |
dep |
°,° |
| R5909 |
T7592 |
T7591 |
prep |
for,° |
| R5910 |
T7593 |
T7594 |
nummod |
40,sec |
| R5911 |
T7594 |
T7592 |
pobj |
sec,for |
| R5912 |
T7595 |
T7589 |
punct |
", ",° |
| R5913 |
T7596 |
T7597 |
nummod |
57,° |
| R5914 |
T7597 |
T7589 |
dep |
°,° |
| R5915 |
T7598 |
T7597 |
prep |
for,° |
| R5916 |
T7599 |
T7600 |
nummod |
1,min |
| R5917 |
T7600 |
T7598 |
pobj |
min,for |
| R5918 |
T7601 |
T7589 |
punct |
", ",° |
| R5919 |
T7602 |
T7589 |
nummod |
72,° |
| R5920 |
T7603 |
T7589 |
prep |
for,° |
| R5921 |
T7604 |
T7605 |
nummod |
2,min |
| R5922 |
T7605 |
T7603 |
pobj |
min,for |
| R5923 |
T7606 |
T7589 |
punct |
),° |
| R5924 |
T7607 |
T7566 |
punct |
.,underwent |
| R5925 |
T7609 |
T7610 |
det |
The,products |
| R5926 |
T7610 |
T7612 |
dep |
products,purified |
| R5927 |
T7611 |
T7610 |
compound |
PCR,products |
| R5928 |
T7613 |
T7612 |
nsubj |
we,purified |
| R5929 |
T7614 |
T7612 |
cc |
and,purified |
| R5930 |
T7615 |
T7612 |
conj |
sequenced,purified |
| R5931 |
T7616 |
T7617 |
mark |
as,described |
| R5932 |
T7617 |
T7612 |
advcl |
described,purified |
| R5933 |
T7618 |
T7619 |
punct |
[,22 |
| R5934 |
T7619 |
T7612 |
parataxis |
22,purified |
| R5935 |
T7620 |
T7619 |
punct |
],22 |
| R5936 |
T7621 |
T7612 |
punct |
.,purified |