
PMC:3589482 / 16997-17232
Annnotations
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8897 | 234-235 | . | denotes | . |
T8896 | 208-233 | CD | denotes | TTCTTGGAAAGCTGGCACTGTGTG3 |
T8895 | 207-208 | NN | denotes | ′ |
T8894 | 206-207 | CD | denotes | 5 |
T8893 | 204-205 | -RRB- | denotes | ) |
T8892 | 201-204 | CD | denotes | +19 |
T8891 | 200-201 | CD | denotes | / |
T8890 | 199-200 | CD | denotes | 5 |
T8889 | 198-199 | FW | denotes | − |
T8888 | 197-198 | -LRB- | denotes | ( |
T8887 | 189-196 | NN | denotes | reverse |
T8886 | 187-188 | : | denotes | ; |
T8885 | 161-186 | NNP | denotes | AAGACTCCCACAGATGGTGGCTGT3 |
T8884 | 160-161 | CD | denotes | ′ |
T8883 | 159-160 | CD | denotes | 5 |
T8882 | 157-158 | -RRB- | denotes | ) |
T8881 | 154-157 | CD | denotes | 315 |
T8880 | 153-154 | NN | denotes | − |
T8879 | 152-153 | CD | denotes | / |
T8878 | 149-152 | CD | denotes | 338 |
T8877 | 148-149 | FW | denotes | − |
T8876 | 147-148 | -LRB- | denotes | ( |
T8875 | 139-146 | RB | denotes | forward |
T8874 | 137-138 | : | denotes | : |
T8873 | 129-137 | NN | denotes | promoter |
T8872 | 120-128 | JJ | denotes | proximal |
T8871 | 111-119 | NNP | denotes | SerpinB2 |
T8870 | 107-110 | DT | denotes | the |
T8869 | 103-106 | IN | denotes | for |
T8868 | 94-102 | JJ | denotes | specific |
T8867 | 86-93 | NNS | denotes | primers |
T8866 | 82-85 | CC | denotes | and |
T8865 | 75-81 | NN | denotes | method |
T8864 | 69-74 | JJ | denotes | green |
T8863 | 64-68 | NNP | denotes | SYBR |
T8862 | 60-63 | DT | denotes | the |
T8861 | 54-59 | VBG | denotes | using |
T8860 | 49-53 | NNP | denotes | qPCR |
T8859 | 46-48 | IN | denotes | by |
T8858 | 43-45 | CC | denotes | or |
T8857 | 39-42 | NNP | denotes | PCR |
T8856 | 21-38 | JJ | denotes | semi-quantitative |
T8855 | 18-20 | IN | denotes | by |
T8854 | 8-17 | VBN | denotes | amplified |
T8853 | 4-7 | VBD | denotes | was |
T8852 | 0-3 | NNP | denotes | DNA |
R6471 | T8852 | T8854 | nsubjpass | DNA,amplified |
R6472 | T8853 | T8854 | auxpass | was,amplified |
R6473 | T8854 | T8854 | ROOT | amplified,amplified |
R6474 | T8855 | T8854 | agent | by,amplified |
R6475 | T8856 | T8857 | compound | semi-quantitative,PCR |
R6476 | T8857 | T8855 | pobj | PCR,by |
R6477 | T8858 | T8855 | cc | or,by |
R6478 | T8859 | T8855 | conj | by,by |
R6479 | T8860 | T8859 | pobj | qPCR,by |
R6480 | T8861 | T8854 | advcl | using,amplified |
R6481 | T8862 | T8865 | det | the,method |
R6482 | T8863 | T8865 | nmod | SYBR,method |
R6483 | T8864 | T8865 | amod | green,method |
R6484 | T8865 | T8861 | dobj | method,using |
R6485 | T8866 | T8865 | cc | and,method |
R6486 | T8867 | T8865 | conj | primers,method |
R6487 | T8868 | T8861 | oprd | specific,using |
R6488 | T8869 | T8868 | prep | for,specific |
R6489 | T8870 | T8873 | det | the,promoter |
R6490 | T8871 | T8873 | nmod | SerpinB2,promoter |
R6491 | T8872 | T8873 | amod | proximal,promoter |
R6492 | T8873 | T8869 | pobj | promoter,for |
R6493 | T8874 | T8854 | punct | :,amplified |
R6494 | T8875 | T8875 | ROOT | forward,forward |
R6495 | T8876 | T8880 | punct | (,− |
R6496 | T8877 | T8880 | nmod | −,− |
R6497 | T8878 | T8880 | nummod | 338,− |
R6498 | T8879 | T8880 | nummod | /,− |
R6499 | T8880 | T8880 | ROOT | −,− |
R6500 | T8881 | T8880 | nummod | 315,− |
R6501 | T8882 | T8880 | punct | ),− |
R6502 | T8883 | T8880 | nummod | 5,− |
R6503 | T8884 | T8885 | nummod | ′,AAGACTCCCACAGATGGTGGCTGT3 |
R6504 | T8885 | T8880 | appos | AAGACTCCCACAGATGGTGGCTGT3,− |
R6505 | T8886 | T8887 | punct | ;,reverse |
R6506 | T8887 | T8895 | nmod | reverse,′ |
R6507 | T8888 | T8887 | punct | (,reverse |
R6508 | T8889 | T8892 | nmod | −,+19 |
R6509 | T8890 | T8892 | nummod | 5,+19 |
R6510 | T8891 | T8892 | punct | /,+19 |
R6511 | T8892 | T8887 | appos | +19,reverse |
R6512 | T8893 | T8887 | punct | ),reverse |
R6513 | T8894 | T8895 | nummod | 5,′ |
R6514 | T8895 | T8880 | appos | ′,− |
R6515 | T8896 | T8895 | nummod | TTCTTGGAAAGCTGGCACTGTGTG3,′ |
R6516 | T8897 | T8854 | punct | .,amplified |
pmc-enju-pas
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8554 | 206-234 | NN | denotes | 5′TTCTTGGAAAGCTGGCACTGTGTG3’ |
T8553 | 204-205 | -RRB- | denotes | ) |
T8552 | 198-204 | CD | denotes | −5/+19 |
T8551 | 197-198 | -LRB- | denotes | ( |
T8550 | 189-196 | JJ | denotes | reverse |
T8549 | 187-188 | -COLON- | denotes | ; |
T8548 | 159-187 | NN | denotes | 5′AAGACTCCCACAGATGGTGGCTGT3’ |
T8547 | 157-158 | -RRB- | denotes | ) |
T8546 | 148-157 | CD | denotes | −338/−315 |
T8545 | 147-148 | -LRB- | denotes | ( |
T8544 | 139-146 | RB | denotes | forward |
T8543 | 137-138 | -COLON- | denotes | : |
T8542 | 129-137 | NN | denotes | promoter |
T8541 | 120-128 | JJ | denotes | proximal |
T8540 | 111-119 | NN | denotes | SerpinB2 |
T8539 | 107-110 | DT | denotes | the |
T8538 | 103-106 | IN | denotes | for |
T8537 | 94-102 | JJ | denotes | specific |
T8536 | 86-93 | NN | denotes | primers |
T8535 | 82-85 | CC | denotes | and |
T8534 | 75-81 | NN | denotes | method |
T8533 | 69-74 | JJ | denotes | green |
T8532 | 64-68 | NN | denotes | SYBR |
T8531 | 60-63 | DT | denotes | the |
T8530 | 54-59 | VB | denotes | using |
T8529 | 49-53 | NN | denotes | qPCR |
T8528 | 46-48 | IN | denotes | by |
T8527 | 43-45 | CC | denotes | or |
T8526 | 39-42 | NN | denotes | PCR |
T8525 | 21-38 | JJ | denotes | semi-quantitative |
T8524 | 18-20 | IN | denotes | by |
T8523 | 8-17 | VB | denotes | amplified |
T8522 | 4-7 | VB | denotes | was |
T8521 | 0-3 | NN | denotes | DNA |
R6198 | T8521 | T8522 | arg1Of | DNA,was |
R6199 | T8521 | T8523 | arg2Of | DNA,amplified |
R6200 | T8521 | T8530 | arg1Of | DNA,using |
R6201 | T8523 | T8522 | arg2Of | amplified,was |
R6202 | T8523 | T8524 | arg1Of | amplified,by |
R6203 | T8523 | T8528 | arg1Of | amplified,by |
R6204 | T8523 | T8530 | modOf | amplified,using |
R6205 | T8524 | T8527 | arg1Of | by,or |
R6206 | T8526 | T8524 | arg2Of | PCR,by |
R6207 | T8526 | T8525 | arg1Of | PCR,semi-quantitative |
R6208 | T8528 | T8527 | arg2Of | by,or |
R6209 | T8529 | T8528 | arg2Of | qPCR,by |
R6210 | T8534 | T8535 | arg1Of | method,and |
R6211 | T8535 | T8530 | arg2Of | and,using |
R6212 | T8535 | T8531 | arg1Of | and,the |
R6213 | T8535 | T8532 | arg1Of | and,SYBR |
R6214 | T8535 | T8533 | arg1Of | and,green |
R6215 | T8535 | T8537 | arg1Of | and,specific |
R6216 | T8535 | T8543 | arg1Of | and,: |
R6217 | T8535 | T8549 | arg1Of | and,; |
R6218 | T8536 | T8535 | arg2Of | primers,and |
R6219 | T8537 | T8538 | arg1Of | specific,for |
R6220 | T8542 | T8538 | arg2Of | promoter,for |
R6221 | T8542 | T8539 | arg1Of | promoter,the |
R6222 | T8542 | T8540 | arg1Of | promoter,SerpinB2 |
R6223 | T8542 | T8541 | arg1Of | promoter,proximal |
R6224 | T8544 | T8545 | arg1Of | forward,( |
R6225 | T8546 | T8545 | arg2Of | −338/−315,( |
R6226 | T8547 | T8545 | arg3Of | ),( |
R6227 | T8548 | T8543 | arg2Of | 5′AAGACTCCCACAGATGGTGGCTGT3’,: |
R6228 | T8548 | T8544 | arg1Of | 5′AAGACTCCCACAGATGGTGGCTGT3’,forward |
R6229 | T8550 | T8551 | arg1Of | reverse,( |
R6230 | T8552 | T8551 | arg2Of | −5/+19,( |
R6231 | T8553 | T8551 | arg3Of | ),( |
R6232 | T8554 | T8549 | arg2Of | 5′TTCTTGGAAAGCTGGCACTGTGTG3’,; |
R6233 | T8554 | T8550 | arg1Of | 5′TTCTTGGAAAGCTGGCACTGTGTG3’,reverse |
bionlp-st-ge-2016-test-proteins
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8281 | 111-119 | Protein | denotes | SerpinB2 |
bionlp-st-ge-2016-uniprot
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8560 | 111-119 | http://www.uniprot.org/uniprot/P05120 | denotes | SerpinB2 |
GO-BP
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8286 | 0-17 | http://purl.obolibrary.org/obo/GO_0006277 | denotes | DNA was amplified |
sentences
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8275 | 0-235 | Sentence | denotes | DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’. |
T107 | 0-235 | Sentence | denotes | DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’. |
simple1
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8304 | 111-119 | Protein | denotes | SerpinB2 |
BioNLP16_DUT
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8557 | 111-119 | Protein | denotes | SerpinB2 |
BioNLP16_Messiy
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8569 | 111-119 | Protein | denotes | SerpinB2 |
DLUT931
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8563 | 111-119 | Protein | denotes | SerpinB2 |
bionlp-st-ge-2016-test-ihmc
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8617 | 21-42 | Protein | denotes | semi-quantitative PCR |
T8601 | 107-137 | Entity | denotes | the SerpinB2 proximal promoter |
T8600 | 0-3 | Entity | denotes | DNA |
T8598 | 49-53 | Protein | denotes | qPCR |
T8590 | 111-119 | Protein | denotes | SerpinB2 |
R6237 | T8601 | T8590 | partOf | the SerpinB2 proximal promoter,SerpinB2 |
bionlp-st-ge-2016-test-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8579 | 111-137 | Protein | denotes | SerpinB2 proximal promoter |
testone
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8260 | 111-119 | Protein | denotes | SerpinB2 |
test3
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T8266 | 111-119 | Protein | denotes | SerpinB2 |
T8263 | 111-119 | Protein | denotes | SerpinB2 |