> top > docs > PMC:3589482 > annotations

PMC:3589482 JSONTXT

Annnotations TAB JSON ListView MergeView

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T26996 38348-38349 . denotes .
T26995 38347-38348 -RRB- denotes )
T26994 38342-38347 NNP denotes ANOVA
T26993 38334-38341 JJ denotes one-way
T26992 38332-38333 , denotes ,
T26991 38328-38332 CD denotes 0.05
T26990 38327-38328 RB denotes <
T26989 38326-38327 VB denotes p
T26988 38324-38325 , denotes ,
T26987 38323-38324 SYM denotes *
T26986 38322-38323 -LRB- denotes (
T26985 38320-38321 . denotes .
T26984 38310-38320 NN denotes triplicate
T26983 38307-38309 IN denotes in
T26982 38297-38306 VBN denotes performed
T26981 38285-38296 NNS denotes experiments
T26980 38273-38284 JJ denotes independent
T26979 38267-38272 CD denotes three
T26978 38261-38266 JJS denotes least
T26977 38258-38260 IN denotes at
T26976 38255-38257 IN denotes of
T26975 38251-38254 NNP denotes SEM
T26974 38247-38250 CC denotes and
T26973 38242-38246 NN denotes mean
T26972 38238-38241 DT denotes the
T26971 38228-38237 VBP denotes represent
T26970 38220-38227 NNS denotes results
T26969 38216-38219 DT denotes The
T26968 38214-38215 . denotes .
T26967 38213-38214 NN denotes β
T26966 38212-38213 : denotes -
T26965 38207-38212 NNP denotes C/EBP
T26964 38204-38206 IN denotes of
T26963 38195-38203 NNS denotes isoforms
T26962 38191-38194 NN denotes kDa
T26961 38188-38190 CD denotes 35
T26960 38184-38187 CC denotes and
T26959 38180-38183 NN denotes kDa
T26958 38177-38179 CD denotes 38
T26957 38173-38176 DT denotes the
T26956 38168-38172 DT denotes both
T26955 38160-38167 VBP denotes express
T26954 38155-38159 NNS denotes MEFs
T26953 38143-38154 VBN denotes transfected
T26952 38142-38143 : denotes -
T26951 38135-38141 SYM denotes βT217A
T26950 38134-38135 : denotes -
T26949 38129-38134 NNP denotes C/EBP
T26948 38125-38128 DT denotes The
T26947 38123-38124 . denotes .
T26946 38116-38123 NNS denotes mutants
T26945 38099-38115 NN denotes phospho-acceptor
T26944 38097-38098 NN denotes β
T26943 38096-38097 : denotes -
T26942 38091-38096 NNP denotes C/EBP
T26941 38080-38090 JJ denotes respective
T26940 38076-38079 DT denotes the
T26939 38073-38075 IN denotes of
T26938 38062-38072 NN denotes expression
T26937 38058-38061 DT denotes the
T26936 38049-38057 VBZ denotes confirms
T26935 38047-38048 -RRB- denotes )
T26934 38041-38047 NNS denotes graphs
T26933 38037-38040 DT denotes the
T26932 38031-38036 IN denotes below
T26931 38030-38031 -LRB- denotes (
T26930 38025-38029 NN denotes blot
T26929 38017-38024 JJ denotes western
T26928 38013-38016 DT denotes The
T26927 38011-38012 . denotes .
T26926 38003-38011 NN denotes activity
T26925 37987-38002 JJ denotes β-galactosidase
T26924 37984-37986 TO denotes to
T26923 37973-37983 VBN denotes normalized
T26922 37969-37972 CC denotes and
T26921 37958-37968 VBN denotes quantified
T26920 37954-37957 VBD denotes was
T26919 37945-37953 NN denotes activity
T26918 37934-37944 JJ denotes Luciferase
T26917 37932-37933 . denotes .
T26916 37929-37932 NNS denotes hrs
T26915 37927-37928 CD denotes 4
T26914 37923-37926 IN denotes for
T26913 37919-37922 NNP denotes LPS
T26912 37914-37918 IN denotes with
T26911 37903-37913 VBN denotes stimulated
T26910 37899-37902 CC denotes and
T26909 37897-37898 , denotes ,
T26908 37889-37897 NNS denotes plasmids
T26907 37880-37888 NN denotes reporter
T26906 37864-37879 JJ denotes β-galactosidase
T26905 37860-37863 CC denotes and
T26904 37851-37859 NN denotes reporter
T26903 37831-37850 JJ denotes promoter-luciferase
T26902 37822-37830 NNP denotes SerpinB2
T26901 37812-37821 NNP denotes pGLmP-539
T26900 37808-37811 DT denotes the
T26899 37803-37807 IN denotes with
T26898 37797-37802 IN denotes along
T26897 37795-37796 , denotes ,
T26896 37788-37795 NNS denotes mutants
T26895 37771-37787 NN denotes phospho-acceptor
T26894 37769-37770 NN denotes β
T26893 37768-37769 : denotes -
T26892 37763-37768 NNP denotes C/EBP
T26891 37753-37762 VBN denotes indicated
T26890 37749-37752 DT denotes the
T26889 37746-37748 CC denotes or
T26888 37744-37745 NN denotes β
T26887 37743-37744 : denotes -
T26886 37738-37743 NNP denotes C/EBP
T26885 37728-37737 JJ denotes wild-type
T26884 37719-37727 VBG denotes encoding
T26883 37710-37718 NNS denotes plasmids
T26882 37699-37709 NN denotes expression
T26881 37694-37698 IN denotes with
T26880 37679-37693 VBN denotes co-transfected
T26879 37674-37678 VBD denotes were
T26878 37669-37673 NNS denotes MEFs
T26877 37667-37668 CD denotes −
T26876 37666-37667 VBD denotes /
T26875 37665-37666 NNP denotes −
T26874 37660-37665 NNP denotes Cebpb
T26873 37658-37659 . denotes .
T26872 37650-37658 NN denotes activity
T26871 37641-37649 NN denotes promoter
T26870 37632-37640 CD denotes SerpinB2
T26869 37617-37631 JJ denotes LPS-stimulated
T26868 37607-37616 VBZ denotes regulates
T26867 37596-37606 RB denotes negatively
T26866 37593-37595 CD denotes 64
T26865 37586-37592 NNP denotes Serine
T26864 37583-37585 IN denotes at
T26863 37581-37582 NN denotes β
T26862 37580-37581 : denotes -
T26861 37575-37580 NNP denotes C/EBP
T26860 37572-37574 IN denotes of
T26859 37556-37571 NNP denotes Phosphorylation
T26858 37554-37555 -RRB- denotes )
T26857 37553-37554 NNP denotes C
T26856 37552-37553 -LRB- denotes (
T26855 37550-37551 . denotes .
T26854 37545-37550 NNS denotes sites
T26853 37528-37544 NN denotes phospho-acceptor
T26852 37524-37527 CC denotes and
T26851 37514-37523 NN denotes structure
T26850 37509-37513 NN denotes gene
T26849 37499-37508 VBG denotes depicting
T26848 37489-37498 JJ denotes schematic
T26847 37484-37488 NN denotes gene
T26846 37482-37483 NN denotes β
T26845 37481-37482 : denotes -
T26844 37476-37481 SYM denotes C/EBP
T26843 37474-37475 -RRB- denotes )
T26842 37473-37474 NNP denotes B
T26841 37472-37473 -LRB- denotes (
T26840 37470-37471 . denotes .
T26839 37462-37470 NN denotes activity
T26838 37446-37461 JJ denotes β-galactosidase
T26837 37443-37445 TO denotes to
T26836 37432-37442 VBD denotes normalized
T26835 37426-37431 NNS denotes units
T26834 37415-37425 NN denotes luciferase
T26833 37411-37414 CC denotes and
T26832 37409-37410 , denotes ,
T26831 37401-37409 NNS denotes plasmids
T26830 37392-37400 NN denotes reporter
T26829 37376-37391 JJ denotes β-galactosidase
T26828 37372-37375 CC denotes and
T26827 37363-37371 NN denotes reporter
T26826 37343-37362 JJ denotes promoter-luciferase
T26825 37334-37342 NNP denotes SerpinB2
T26824 37324-37333 NNP denotes pGLmP-539
T26823 37320-37323 DT denotes the
T26822 37315-37319 IN denotes with
T26821 37300-37314 VBN denotes co-transfected
T26820 37295-37299 VBD denotes were
T26819 37289-37294 NNS denotes Cells
T26818 37287-37288 . denotes .
T26817 37286-37287 -RRB- denotes )
T26816 37281-37286 NNP denotes ng/mL
T26815 37277-37280 CD denotes 100
T26814 37276-37277 -LRB- denotes (
T26813 37272-37275 NNP denotes LPS
T26812 37269-37271 IN denotes of
T26811 37261-37268 NN denotes absence
T26810 37258-37260 CC denotes or
T26809 37249-37257 NN denotes presence
T26808 37245-37248 DT denotes the
T26807 37242-37244 IN denotes in
T26806 37233-37241 NN denotes reporter
T26805 37213-37232 JJ denotes promoter-luciferase
T26804 37204-37212 NNP denotes SerpinB2
T26803 37194-37203 NNP denotes pGLmP-539
T26802 37190-37193 DT denotes the
T26801 37179-37189 VBG denotes expressing
T26800 37174-37178 NNS denotes MEFs
T26799 37172-37173 CD denotes −
T26798 37171-37172 CD denotes /
T26797 37170-37171 VBP denotes −
T26796 37165-37170 NNP denotes Cebpb
T26795 37161-37164 CC denotes and
T26794 37159-37160 CD denotes +
T26793 37158-37159 VBD denotes /
T26792 37157-37158 NNP denotes +
T26791 37152-37157 NNP denotes Cebpb
T26790 37149-37151 IN denotes in
T26789 37140-37148 VBN denotes measured
T26788 37131-37139 NN denotes activity
T26787 37122-37130 NN denotes promoter
T26786 37117-37121 NN denotes gene
T26785 37108-37116 NNP denotes SerpinB2
T26750 36927-36929 VBZ denotes is
T26749 36925-36926 NN denotes β
T26748 36924-36925 : denotes -
T26747 36919-36924 SYM denotes C/EBP
T765 18-24 NNP denotes Factor
T766 25-30 NNP denotes C/EBP
T767 30-31 : denotes -
T768 31-32 NN denotes β
T769 33-41 NNP denotes Mediates
T770 42-54 NNP denotes Constitutive
T771 55-58 CC denotes and
T772 59-72 JJ denotes LPS-Inducible
T773 73-86 NN denotes Transcription
T774 87-89 IN denotes of
T775 90-96 NNP denotes Murine
T776 97-105 NNP denotes SerpinB2
T10330 20358-20359 . denotes .
T22241 46872-46875 CD denotes 195
T26784 37101-37107 NNP denotes Murine
T26783 37099-37100 . denotes .
T26782 37095-37099 NNS denotes MEFs
T26781 37093-37094 CD denotes −
T26780 37092-37093 VBD denotes /
T26779 37091-37092 NNP denotes −
T26778 37086-37091 NNP denotes Cebpb
T26777 37083-37085 IN denotes in
T26776 37079-37082 RB denotes not
T26775 37075-37078 CC denotes and
T26774 37070-37074 NNS denotes MEFs
T26773 37068-37069 CD denotes +
T26772 37067-37068 VBD denotes /
T26771 37066-37067 NNP denotes +
T26770 37061-37066 NNP denotes Cebpb
T26769 37046-37060 JJ denotes LPS-stimulated
T26768 37043-37045 IN denotes in
T26767 37033-37042 VBN denotes activated
T26766 37019-37032 RB denotes significantly
T26765 37016-37018 VBZ denotes is
T26764 37007-37015 NN denotes promoter
T26763 36998-37006 JJ denotes proximal
T26762 36989-36997 JJ denotes SerpinB2
T26761 36985-36988 DT denotes The
T26760 36983-36984 -RRB- denotes )
T26759 36982-36983 NNP denotes A
T26758 36981-36982 -LRB- denotes (
T26757 36979-36980 . denotes .
T26756 36971-36979 NN denotes activity
T26755 36962-36970 NN denotes promoter
T26754 36953-36961 JJ denotes proximal
T26753 36944-36952 NNP denotes SerpinB2
T26752 36940-36943 IN denotes for
T26751 36930-36939 JJ denotes necessary
T25957 36069-36070 . denotes .
T25956 36063-36069 NN denotes method
T25955 36056-36062 JJ denotes 2-ΔΔCt
T25954 36052-36055 DT denotes the
T25953 36046-36051 VBG denotes using
T25952 36039-36045 NN denotes signal
T25951 36034-36038 NNP denotes rIgG
T25950 36031-36033 TO denotes to
T25949 36022-36030 JJ denotes relative
T25948 36010-36021 VBN denotes represented
T25947 36006-36009 VBP denotes are
T25946 36001-36005 NNS denotes data
T25945 35997-36000 DT denotes The
T25944 35995-35996 . denotes .
T25943 35988-35995 NN denotes control
T25942 35983-35987 NNP denotes rIgG
T25941 35979-35982 DT denotes the
T25940 35975-35978 CC denotes and
T25939 35973-35974 , denotes ,
T25938 35972-35973 -RRB- denotes )
T25937 35968-35972 CD denotes T217
T25936 35967-35968 -LRB- denotes (
T25935 35965-35966 NN denotes β
T25934 35964-35965 : denotes -
T25933 35957-35964 NNP denotes p-C/EBP
T25932 35955-35956 , denotes ,
T25931 35954-35955 NN denotes β
T25915 35859-35863 NNP denotes ChIP
T25914 35855-35858 DT denotes the
T25913 35852-35854 IN denotes of
T25912 35840-35851 NN denotes specificity
T25911 35836-35839 DT denotes the
T25910 35833-35835 IN denotes of
T25909 35822-35832 JJ denotes indicative
T25908 35820-35821 , denotes ,
T25907 35813-35820 NN denotes control
T25906 35809-35812 NNP denotes IgG
T25905 35802-35808 NN denotes rabbit
T25904 35798-35801 DT denotes the
T25903 35792-35797 VBG denotes using
T25902 35783-35791 VBN denotes detected
T25901 35779-35782 VBD denotes was
T25900 35768-35778 NN denotes background
T25899 35760-35767 JJ denotes Minimal
T25898 35758-35759 . denotes .
T25897 35747-35758 NN denotes stimulation
T25896 35743-35746 NNP denotes LPS
T25895 35733-35742 VBG denotes following
T25894 35719-35732 NN denotes transcription
T25893 35712-35718 JJ denotes active
T25892 35703-35711 VBZ denotes suggests
T25891 35694-35702 NN denotes promoter
T25890 35685-35693 NNP denotes SerpinB2
T25889 35681-35684 DT denotes the
T25888 35678-35680 TO denotes to
T25887 35671-35677 NNP denotes RNAPII
T25886 35668-35670 IN denotes of
T25885 35656-35667 NN denotes Recruitment
T25884 35654-35655 . denotes .
T25883 35651-35654 NN denotes top
T25882 35648-35650 IN denotes in
T25881 35637-35647 VBN denotes diagrammed
T25880 35634-35636 IN denotes as
T25879 35632-35633 , denotes ,
T25878 35629-35632 CD denotes +19
T25877 35628-35629 NN denotes /
T25876 35627-35628 CD denotes 5
T25875 35626-35627 CD denotes −
T25874 35622-35625 CC denotes and
T25873 35618-35621 CD denotes 315
T25872 35617-35618 NN denotes −
T25871 35616-35617 CD denotes /
T25870 35613-35616 CD denotes 338
T25869 35611-35612 , denotes ,
T25868 35604-35611 NNS denotes primers
T25867 35586-35603 JJ denotes promoter-specific
T25866 35577-35585 JJ denotes proximal
T25865 35568-35576 JJ denotes SerpinB2
T25864 35561-35567 JJ denotes murine
T25863 35555-35560 VBG denotes using
T25862 35548-35554 NNS denotes assays
T25861 35543-35547 NNP denotes ChIP
T25860 35540-35542 IN denotes in
T25859 35531-35539 VBN denotes obtained
T25858 35523-35530 NN denotes pattern
T25857 35519-35522 NNP denotes PCR
T25856 35511-35518 JJ denotes Typical
T25855 35509-35510 -RRB- denotes )
T25854 35508-35509 NNP denotes A
T25853 35507-35508 -LRB- denotes (
T25852 35505-35506 . denotes .
T25851 35498-35505 NN denotes control
T25850 35496-35497 -RRB- denotes )
T25849 35492-35496 NNP denotes rIgG
T25778 35145-35150 NN denotes assay
T25848 35491-35492 -LRB- denotes (
T25847 35487-35490 NNP denotes IgG
T25846 35480-35486 NN denotes rabbit
T25845 35478-35479 DT denotes a
T25844 35475-35477 CC denotes or
T25843 35473-35474 , denotes ,
T25842 35472-35473 -RRB- denotes )
T25841 35466-35472 NNP denotes RNAPII
T25840 35465-35466 -LRB- denotes (
T25839 35462-35464 NNP denotes II
T25838 35451-35461 NNP denotes Polymerase
T25837 35447-35450 NNP denotes RNA
T25836 35445-35446 , denotes ,
T25835 35444-35445 -RRB- denotes )
T25834 35440-35444 CD denotes T217
T25833 35439-35440 -LRB- denotes (
T25832 35437-35438 NN denotes β
T25831 35436-35437 : denotes -
T25830 35429-35436 NNP denotes p-C/EBP
T25829 35427-35428 , denotes ,
T25828 35426-35427 NN denotes β
T25827 35425-35426 : denotes -
T25826 35420-35425 NNP denotes C/EBP
T25825 35412-35419 IN denotes against
T25824 35401-35411 NNS denotes antibodies
T25823 35396-35400 IN denotes with
T25822 35377-35395 VBN denotes immunoprecipitated
T25821 35373-35376 VBD denotes was
T25820 35371-35372 -RRB- denotes )
T25819 35369-35371 NN denotes ng
T25818 35365-35368 CD denotes 700
T25817 35361-35364 CD denotes 600
T25816 35360-35361 -LRB- denotes (
T25815 35350-35359 NN denotes chromatin
T25814 35342-35349 JJ denotes Soluble
T25813 35340-35341 . denotes .
T25812 35339-35340 -RRB- denotes )
T25811 35335-35339 CD denotes T217
T25810 35334-35335 -LRB- denotes (
T25809 35332-35333 NN denotes β
T25808 35331-35332 : denotes -
T25807 35324-35331 NN denotes p-C/EBP
T25806 35321-35323 CC denotes or
T25805 35319-35320 NN denotes β
T25804 35318-35319 : denotes -
T25803 35313-35318 NNP denotes C/EBP
T25802 35305-35312 IN denotes against
T25801 35294-35304 NNS denotes antibodies
T25800 35288-35293 VBG denotes using
T25799 35278-35287 VBN denotes performed
T25798 35258-35277 NN denotes immunoprecipitation
T25797 35248-35257 NN denotes chromatin
T25796 35244-35247 CC denotes and
T25795 35238-35243 NNS denotes times
T25794 35228-35237 JJ denotes indicated
T25793 35224-35227 DT denotes the
T25792 35220-35223 IN denotes for
T25791 35216-35219 NNP denotes LPS
T25790 35213-35215 IN denotes of
T25789 35205-35212 NN denotes absence
T25788 35202-35204 CC denotes or
T25787 35193-35201 NN denotes presence
T25786 35189-35192 DT denotes the
T25785 35186-35188 IN denotes in
T25784 35178-35185 VBN denotes treated
T25783 35173-35177 VBD denotes were
T25782 35161-35172 NNS denotes macrophages
T25780 35152-35158 CD denotes RAW264
T25779 35150-35151 . denotes .
T25777 35143-35144 -RRB- denotes )
T25776 35139-35143 NNP denotes ChIP
T25775 35138-35139 -LRB- denotes (
T25774 35118-35137 NN denotes immunoprecipitation
T25773 35108-35117 NN denotes chromatin
T25772 35105-35107 IN denotes by
T25771 35094-35104 VBN denotes determined
T25770 35090-35093 VBD denotes was
T25769 35085-35089 NN denotes vivo
T25768 35082-35084 IN denotes in
T25767 35073-35081 NN denotes promoter
T25766 35064-35072 JJ denotes proximal
T25765 35055-35063 NNP denotes SerpinB2
T25764 35051-35054 DT denotes the
T25763 35048-35050 IN denotes on
T25762 35038-35047 NN denotes occupancy
T25761 35031-35037 NN denotes factor
T25760 35017-35030 NNP denotes Transcription
T25759 35015-35016 . denotes .
T25758 35011-35015 NN denotes vivo
T25757 35008-35010 IN denotes in
T25756 34999-35007 NN denotes promoter
T25755 34990-34998 NNP denotes SerpinB2
T25754 34983-34989 NN denotes murine
T25753 34979-34982 DT denotes the
T25752 34976-34978 TO denotes to
T25751 34970-34975 NNP denotes βT217
T25750 34969-34970 : denotes -
T25749 34964-34969 NNP denotes C/EBP
T25748 34960-34963 CC denotes and
T25747 34958-34959 NN denotes β
T25746 34957-34958 : denotes -
T25745 34952-34957 NNP denotes C/EBP
T25744 34949-34951 IN denotes of
T25743 34937-34948 NN denotes recruitment
T25742 34924-34936 NNP denotes Differential
T25930 35953-35954 : denotes -
T25929 35948-35953 NNP denotes C/EBP
T25928 35940-35947 IN denotes against
T25927 35929-35939 NNS denotes antibodies
T25926 35924-35928 IN denotes with
T25925 35905-35923 VBN denotes immunoprecipitated
T25924 35895-35904 NN denotes chromatin
T25923 35892-35894 IN denotes of
T25922 35883-35891 NN denotes analysis
T25921 35878-35882 NNP denotes qPCR
T25920 35876-35877 -RRB- denotes )
T25919 35875-35876 NNP denotes B
T25918 35874-35875 -LRB- denotes (
T25917 35872-35873 . denotes .
T25916 35864-35872 NN denotes reaction
T25250 33223-33224 . denotes .
T25249 33222-33223 -RRB- denotes )
T25248 33217-33222 NNP denotes ANOVA
T25247 33209-33216 JJ denotes two-way
T25246 33207-33208 , denotes ,
T25245 33203-33207 CD denotes 0.05
T25244 33202-33203 RB denotes <
T25243 33201-33202 VB denotes p
T25242 33199-33200 , denotes ,
T25241 33198-33199 SYM denotes *
T25240 33197-33198 -LRB- denotes (
T25239 33195-33196 . denotes .
T25238 33185-33195 VBP denotes triplicate
T25237 33182-33184 CC denotes or
T25236 33172-33181 VBP denotes duplicate
T25235 33169-33171 IN denotes in
T25234 33159-33168 VBN denotes performed
T25233 33147-33158 NNS denotes experiments
T25232 33135-33146 JJ denotes independent
T25231 33131-33134 CD denotes two
T25230 33128-33130 IN denotes of
T25229 33124-33127 NNP denotes SEM
T25228 33120-33123 CC denotes and
T25227 33115-33119 NN denotes mean
T25226 33111-33114 DT denotes the
T25225 33101-33110 VBP denotes represent
T25224 33093-33100 NNS denotes results
T25223 33089-33092 DT denotes The
T25222 33087-33088 . denotes .
T25221 33076-33087 NNS denotes macrophages
T25220 33065-33075 JJ denotes peritoneal
T25219 33054-33064 JJ denotes transduced
T25218 33043-33053 JJ denotes lentiviral
T25217 33039-33042 DT denotes the
T25216 33036-33038 IN denotes in
T25215 33025-33035 NN denotes expression
T25214 33020-33024 NNP denotes mRNA
T25213 33011-33019 NNP denotes SerpinB2
T25212 33004-33010 JJ denotes murine
T25211 33001-33003 IN denotes of
T25210 32992-33000 NN denotes analysis
T25209 32987-32991 JJ denotes qPCR
T25208 32985-32986 : denotes :
T25207 32980-32985 RB denotes Right
T25206 32978-32979 . denotes .
T25205 32973-32978 NNP denotes shRNA
T25204 32967-32972 NNP denotes CEBPB
T25203 32961-32966 JJ denotes human
T25202 32957-32960 RB denotes not
T25201 32953-32956 CC denotes and
T25200 32947-32952 NNP denotes shRNA
T25199 32941-32946 NNP denotes Cebpb
T25198 32934-32940 JJ denotes murine
T25197 32929-32933 IN denotes with
T25196 32919-32928 NN denotes infection
T25195 32909-32918 VBG denotes following
T24494 29543-29544 . denotes .
T24493 29534-29543 NN denotes arrowhead
T24492 29531-29533 DT denotes an
T24491 29526-29530 IN denotes with
T24490 29516-29525 VBN denotes indicated
T24489 29513-29515 VBZ denotes is
T24488 29505-29512 NN denotes complex
T24487 29491-29504 JJ denotes LPS-inducible
T24486 29487-29490 DT denotes The
T24485 29485-29486 . denotes .
T24484 29477-29485 NN denotes antibody
T25194 32907-32908 NN denotes β
T25193 32906-32907 : denotes -
T25192 32901-32906 NNP denotes C/EBP
T25191 32890-32900 JJ denotes endogenous
T25190 32887-32889 IN denotes of
T25189 32877-32886 NN denotes knockdown
T25188 32867-32876 JJ denotes effective
T25187 32861-32866 VBZ denotes shows
T25186 32852-32860 NN denotes analysis
T25185 32847-32851 NN denotes blot
T25184 32839-32846 JJ denotes Western
T25183 32837-32838 : denotes :
T25182 32833-32837 VBN denotes Left
T25174 32810-32811 -LRB- denotes (
T25173 32806-32809 NNP denotes LPS
T25172 32801-32805 IN denotes with
T25171 32790-32800 VBN denotes stimulated
T25170 32785-32789 VBD denotes were
T25169 32773-32784 NNS denotes macrophages
T25168 32762-32772 VBD denotes transduced
T25167 32751-32761 NNP denotes Lentiviral
T25166 32749-32750 . denotes .
T25165 32748-32749 NNP denotes ]
T25164 32746-32748 CD denotes 38
T25163 32745-32746 NNP denotes [
T25162 32736-32744 NN denotes sequence
T25161 32730-32735 NNP denotes Cebpb
T25160 32723-32729 NN denotes murine
T25159 32719-32722 DT denotes the
T25158 32712-32718 VB denotes target
T25157 32708-32711 RB denotes not
T25156 32703-32707 VBZ denotes does
T25155 32700-32702 PRP denotes it
T25154 32694-32699 IN denotes since
T25153 32686-32693 NN denotes control
T25152 32672-32685 JJ denotes non-silencing
T25151 32668-32671 DT denotes the
T25150 32665-32667 IN denotes as
T25149 32658-32664 VBZ denotes serves
T25148 32652-32657 NNP denotes shRNA
T25147 32646-32651 NNP denotes CEBPB
T25146 32640-32645 NNP denotes Human
T25145 32638-32639 . denotes .
T25144 32632-32638 NNS denotes shRNAs
T25143 32621-32631 JJ denotes lentiviral
T25142 32612-32620 JJ denotes specific
T25141 32605-32611 JJ denotes murine
T25140 32601-32604 CC denotes and
T25139 32595-32600 JJ denotes human
T25138 32590-32594 IN denotes with
T25137 32581-32589 VBN denotes infected
T25136 32576-32580 VBD denotes were
T25135 32574-32575 -RRB- denotes )
T25134 32570-32574 NNS denotes macs
T25133 32567-32569 NNP denotes TG
T25132 32566-32567 -LRB- denotes (
T25131 32554-32565 NNS denotes macrophages
T25130 32543-32553 JJ denotes peritoneal
T25129 32519-32542 JJ denotes Thioglycollate-elicited
T25128 32517-32518 . denotes .
T25127 32506-32517 NNS denotes macrophages
T25126 32493-32505 JJ denotes inflammatory
T25125 32481-32492 JJ denotes β-deficient
T25124 32480-32481 : denotes -
T25123 32475-32480 NNP denotes C/EBP
T25122 32472-32474 IN denotes in
T25121 32462-32471 VBN denotes abrogated
T25120 32459-32461 VBZ denotes is
T25119 32448-32458 NN denotes expression
T25118 32439-32447 NNP denotes SerpinB2
T25117 32428-32438 NNP denotes Endogenous
T25116 32426-32427 -RRB- denotes )
T25115 32425-32426 NNP denotes B
T25114 32424-32425 -LRB- denotes (
T25113 32422-32423 . denotes .
T25112 32417-32422 NNS denotes times
T25111 32407-32416 JJ denotes indicated
T25110 32403-32406 DT denotes the
T25109 32399-32402 IN denotes for
T25108 32397-32398 -RRB- denotes )
T25107 32392-32397 NN denotes ng/ml
T25106 32388-32391 CD denotes 100
T25105 32387-32388 -LRB- denotes (
T25104 32383-32386 NNP denotes LPS
T25103 32378-32382 IN denotes with
T25102 32367-32377 NN denotes simulation
T25101 32361-32366 IN denotes after
T25100 32357-32360 CC denotes and
T25099 32355-32356 , denotes ,
T25098 32351-32355 NNS denotes MEFs
T25097 32349-32350 CD denotes −
T25096 32348-32349 CD denotes /
T25095 32347-32348 VBP denotes −
T25094 32342-32347 NNP denotes Cebpb
T25093 32338-32341 CC denotes and
T25092 32336-32337 NN denotes +
T25091 32335-32336 NN denotes /
T25090 32334-32335 NN denotes +
T25089 32329-32334 NNP denotes Cebpb
T25088 32319-32328 JJ denotes untreated
T25087 32316-32318 IN denotes in
T25086 32305-32315 NN denotes expression
T25085 32300-32304 NNP denotes mRNA
T25084 32291-32299 NNP denotes SerpinB2
T25083 32284-32290 JJ denotes murine
T25082 32281-32283 IN denotes of
T25081 32272-32280 NN denotes analysis
T25080 32267-32271 NNP denotes qPCR
T25079 32265-32266 . denotes .
T25078 32262-32265 NNP denotes LPS
T25077 32259-32261 IN denotes of
T25076 32250-32258 NN denotes presence
T25075 32246-32249 CC denotes and
T25074 32238-32245 NN denotes absence
T25073 32234-32237 DT denotes the
T25072 32231-32233 IN denotes in
T25071 32226-32230 NNS denotes MEFs
T25070 32224-32225 CD denotes +
T25069 32223-32224 VBD denotes /
T25068 32222-32223 NNP denotes +
T25067 32217-32222 NNP denotes Cebpb
T25066 32214-32216 TO denotes to
T25065 32205-32213 VBN denotes compared
T25064 32200-32204 NNS denotes MEFs
T25063 32198-32199 CD denotes −
T25062 32197-32198 VBD denotes /
T25061 32196-32197 NNP denotes −
T25060 32191-32196 NNP denotes Cebpb
T25059 32188-32190 IN denotes in
T25058 32178-32187 VBN denotes abrogated
T25057 32175-32177 VBZ denotes is
T25056 32164-32174 NN denotes expression
T25055 32159-32163 NNP denotes mRNA
T25054 32150-32158 NNP denotes SerpinB2
T25053 32139-32149 NNP denotes Endogenous
T25052 32137-32138 -RRB- denotes )
T25051 32136-32137 NNP denotes A
T25050 32135-32136 -LRB- denotes (
T25049 32133-32134 . denotes .
T25048 32123-32133 NN denotes expression
T25047 32118-32122 NNP denotes mRNA
T25046 32109-32117 NNP denotes SerpinB2
T25045 32097-32108 JJ denotes LPS-induced
T25044 32093-32096 CC denotes and
T25043 32080-32092 JJ denotes constitutive
T25042 32076-32079 IN denotes for
T25041 32066-32075 JJ denotes essential
T25040 32063-32065 VBZ denotes is
T25039 32061-32062 NN denotes β
T25038 32060-32061 : denotes -
T25037 32055-32060 SYM denotes C/EBP
T24483 29471-29476 NNP denotes C/EBP
T24482 29462-29470 JJ denotes specific
T24481 29452-29461 VBN denotes indicated
T24480 29448-29451 DT denotes the
T24479 29443-29447 IN denotes with
T24478 29429-29442 NN denotes preincubation
T24477 29423-29428 IN denotes after
T24476 29420-29422 IN denotes by
T24475 29414-29419 NN denotes probe
T24474 29410-29413 CD denotes 185
T24473 29409-29410 NN denotes −
T24472 29408-29409 CD denotes /
T24471 29405-29408 CD denotes 212
T24470 29404-29405 NN denotes −
T24469 29400-29403 DT denotes the
T24468 29395-29399 IN denotes with
T24467 29385-29394 VBN denotes performed
T24466 29380-29384 VBD denotes were
T24465 29373-29379 NNS denotes assays
T24464 29362-29372 NNP denotes Supershift
T24463 29360-29361 -RRB- denotes )
T24462 29359-29360 NNP denotes C
T24461 29358-29359 -LRB- denotes (
T24460 29356-29357 . denotes .
T24459 29347-29356 NNS denotes complexes
T24458 29335-29346 JJ denotes DNA-protein
T24452 29298-29299 -RRB- denotes )
T24451 29297-29298 NNP denotes A
T24450 29296-29297 -LRB- denotes (
T24449 29293-29295 IN denotes in
T24448 29283-29292 VBN denotes described
T24447 29266-29282 NNS denotes oligonucleotides
T24446 29257-29265 VBD denotes stranded
T24445 29250-29256 JJ denotes double
T24444 29246-29249 DT denotes the
T24443 29243-29245 IN denotes of
T24442 29238-29242 DT denotes each
T24441 29235-29237 IN denotes of
T24440 29228-29234 NN denotes excess
T24439 29222-29227 NN denotes molar
T24438 29213-29221 JJ denotes 100-fold
T24437 29211-29212 DT denotes a
T24436 29207-29210 CC denotes and
T24435 29201-29206 NN denotes probe
T24434 29197-29200 CD denotes 185
T24433 29196-29197 NN denotes −
T24432 29195-29196 CD denotes /
T24431 29192-29195 CD denotes 212
T24430 29191-29192 NN denotes −
T24429 29182-29190 NN denotes promoter
T24428 29173-29181 NNP denotes SerpinB2
T24427 29166-29172 NN denotes murine
T24426 29152-29165 VBN denotes radiolabelled
T24425 29148-29151 DT denotes the
T24424 29143-29147 IN denotes with
T24423 29133-29142 VBN denotes performed
T24422 29127-29132 NNS denotes EMSAs
T24421 29115-29126 NN denotes competition
T24420 29110-29114 NNP denotes Cold
T24419 29108-29109 -RRB- denotes )
T24418 29107-29108 NNP denotes B
T24417 29106-29107 -LRB- denotes (
T24416 29104-29105 . denotes .
T24415 29099-29104 NN denotes probe
T24414 29097-29098 -RRB- denotes )
T24413 29092-29097 NNP denotes C/EBP
T24412 29084-29091 NN denotes albumin
T24411 29080-29083 NN denotes rat
T24410 29079-29080 -LRB- denotes (
T24409 29073-29078 NNP denotes C/EBP
T24408 29066-29072 NN denotes region
T24407 29062-29065 NNP denotes DEI
T24406 29053-29061 NN denotes promoter
T24405 29045-29052 NN denotes albumin
T24404 29041-29044 NN denotes rat
T24403 29037-29040 DT denotes the
T24402 29032-29036 IN denotes with
T24401 29029-29031 CC denotes or
T24400 29024-29028 NN denotes site
T24399 29018-29023 NNP denotes C/EBP
T24398 29016-29017 -RRB- denotes )
T24397 29011-29016 NNP denotes C/EBP
T24396 29004-29010 JJ denotes mutant
T24395 29003-29004 -LRB- denotes (
T24394 28995-29002 VBN denotes mutated
T24393 28992-28994 CC denotes or
T24392 28990-28991 -RRB- denotes )
T24391 28985-28990 NNP denotes C/EBP
T24390 28976-28984 CD denotes SerpinB2
T24389 28975-28976 -LRB- denotes (
T24388 28968-28974 JJ denotes intact
T24387 28965-28967 DT denotes an
T24386 28954-28964 VBG denotes containing
T24385 28948-28953 NN denotes probe
T24384 28944-28947 CD denotes 185
T24383 28943-28944 NN denotes −
T24382 28942-28943 CD denotes /
T24381 28939-28942 CD denotes 212
T24380 28938-28939 NN denotes −
T24379 28929-28937 NN denotes promoter
T24378 28920-28928 NNP denotes SerpinB2
T24377 28913-28919 NN denotes murine
T24376 28909-28912 DT denotes the
T24375 28902-28908 CC denotes either
T24374 28897-28901 IN denotes with
T24373 28887-28896 VBN denotes incubated
T24372 28881-28886 NNS denotes cells
T24371 28875-28880 CD denotes 264.7
T24370 28871-28874 NNP denotes RAW
T24369 28869-28870 -RRB- denotes )
T24368 28866-28869 NNP denotes LPS
T24367 28865-28866 -LRB- denotes (
T24366 28857-28864 VBD denotes treated
T24365 28853-28856 NNP denotes LPS
T24364 28850-28852 NN denotes hr
T24363 28847-28849 CD denotes 10
T24362 28843-28846 CC denotes and
T24361 28841-28842 -RRB- denotes )
T24360 28839-28841 NNP denotes UN
T24359 28838-28839 -LRB- denotes (
T24358 28828-28837 JJ denotes untreated
T24357 28823-28827 IN denotes from
T24356 28814-28822 NNS denotes extracts
T24355 28806-28813 JJ denotes nuclear
T24354 28801-28805 IN denotes with
T24353 28796-28800 NNP denotes EMSA
T24352 28794-28795 -RRB- denotes )
T24351 28793-28794 NNP denotes A
T24350 28792-28793 -LRB- denotes (
T24349 28790-28791 . denotes .
T24348 28789-28790 NN denotes β
T24347 28788-28789 : denotes -
T24346 28783-28788 NNP denotes C/EBP
T24345 28774-28782 VBZ denotes contains
T24344 28769-28773 NN denotes site
T24343 28763-28768 NNP denotes C/EBP
T24342 28754-28762 NN denotes promoter
T24341 28745-28753 JJ denotes proximal
T24340 28736-28744 NNP denotes SerpinB2
T24339 28729-28735 NN denotes murine
T24338 28725-28728 DT denotes the
T24337 28717-28724 JJ denotes binding
T24336 28710-28716 NN denotes factor
T24335 28702-28709 JJ denotes nuclear
T24334 28688-28701 JJ denotes LPS-inducible
T24333 28684-28687 DT denotes The
T25181 32831-32832 . denotes .
T25180 32828-32831 NNS denotes hrs
T25179 32826-32827 CD denotes 4
T25178 32822-32825 IN denotes for
T25177 32820-32821 -RRB- denotes )
T25176 32815-32820 NN denotes ng/ml
T25175 32811-32814 CD denotes 100
T24139 26412-26413 . denotes .
T24138 26401-26412 NNS denotes experiments
T24137 26389-26400 JJ denotes independent
T24136 26387-26388 CD denotes 7
T24135 26385-26386 CD denotes 4
T24134 26382-26384 IN denotes of
T24133 26378-26381 NNP denotes SEM
T24132 26374-26377 CC denotes and
T24071 26026-26027 , denotes ,
T24070 26019-26026 NNS denotes primers
T24069 26001-26018 JJ denotes promoter-specific
T24131 26369-26373 NN denotes mean
T24130 26365-26368 DT denotes the
T24129 26355-26364 VB denotes represent
T24128 26351-26354 CC denotes and
T24127 26341-26350 NN denotes treatment
T24126 26337-26340 NNP denotes LPS
T24125 26327-26336 VBG denotes following
T24124 26318-26326 NN denotes activity
T24123 26307-26317 NN denotes luciferase
T24122 26298-26306 JJ denotes relative
T24121 26293-26297 VBP denotes show
T24120 26285-26292 NNS denotes results
T24119 26281-26284 DT denotes The
T24118 26279-26280 . denotes .
T24117 26276-26279 NNS denotes hrs
T24116 26273-26275 CD denotes 16
T24115 26269-26272 IN denotes for
T24114 26265-26268 NNP denotes LPS
T24113 26259-26264 JJ denotes ng/ml
T24112 26255-26258 CD denotes 100
T24111 26250-26254 IN denotes with
T24110 26242-26249 VBN denotes treated
T24109 26239-26241 CC denotes or
T24108 26229-26238 JJ denotes untreated
T24107 26224-26228 VBD denotes left
T24106 26217-26223 RB denotes either
T24105 26213-26216 CC denotes and
T24104 26202-26212 NNS denotes constructs
T24103 26193-26201 NN denotes reporter
T24102 26173-26192 JJ denotes promoter-luciferase
T24101 26164-26172 NNP denotes SerpinB2
T24100 26157-26163 NN denotes murine
T24099 26147-26156 VBN denotes indicated
T24098 26143-26146 DT denotes the
T24097 26138-26142 IN denotes with
T24096 26126-26137 VBN denotes transfected
T24095 26114-26125 RB denotes transiently
T24094 26109-26113 VBD denotes were
T24093 26097-26108 NNS denotes macrophages
T24092 26091-26096 CD denotes 264.7
T24091 26087-26090 NNP denotes RAW
T24090 26085-26086 -RRB- denotes )
T24089 26084-26085 NNP denotes B
T24088 26083-26084 -LRB- denotes (
T24087 26081-26082 . denotes .
T24086 26072-26081 VBN denotes indicated
T24085 26068-26071 VBP denotes are
T24084 26061-26067 NNS denotes assays
T24083 26056-26060 NNP denotes ChIP
T24082 26053-26055 IN denotes in
T24081 26048-26052 VBN denotes used
T24080 26044-26047 CD denotes +19
T24079 26043-26044 NN denotes /
T24078 26042-26043 CD denotes 5
T24077 26041-26042 CD denotes −
T24076 26037-26040 CC denotes and
T24075 26033-26036 CD denotes 315
T24074 26032-26033 NN denotes −
T24073 26031-26032 CD denotes /
T24072 26028-26031 CD denotes 338
T24068 25992-26000 JJ denotes proximal
T24067 25983-25991 CD denotes SerpinB2
T24066 25976-25982 NN denotes murine
T24065 25973-25975 IN denotes of
T24064 25963-25972 NNS denotes Positions
T24063 25961-25962 . denotes .
T24062 25956-25961 VBN denotes shown
T24061 25951-25955 RB denotes also
T24060 25948-25950 VBZ denotes is
T24059 25937-25947 NNS denotes constructs
T24058 25928-25936 NN denotes reporter
T24057 25925-25927 CD denotes 87
T24056 25924-25925 CD denotes −
T24055 25920-25923 CC denotes and
T24054 25916-25919 CD denotes 189
T24053 25915-25916 CD denotes −
T24052 25913-25914 , denotes ,
T24051 25910-25913 CD denotes 539
T24050 25909-25910 NN denotes −
T24049 25905-25908 DT denotes the
T24048 25902-25904 IN denotes of
T24047 25897-25901 NNS denotes ends
T24046 25895-25896 NN denotes ′
T24045 25894-25895 CD denotes 5
T24044 25890-25893 DT denotes the
T24043 25887-25889 IN denotes of
T24042 25878-25886 NN denotes location
T24041 25874-25877 DT denotes The
T24040 25872-25873 . denotes .
T24039 25867-25872 NNS denotes boxes
T24038 25862-25866 IN denotes with
T24037 25852-25861 VBD denotes indicated
T24036 25843-25851 NNS denotes elements
T24035 25832-25842 JJ denotes regulatory
T24034 25821-25831 JJ denotes cis-acting
T24033 25811-25820 NN denotes candidate
T24032 25808-25810 IN denotes of
T24031 25799-25807 NN denotes location
T24030 25795-25798 DT denotes the
T24029 25790-25794 IN denotes with
T24028 25781-25789 NN denotes promoter
T24027 25772-25780 NNP denotes SerpinB2
T24026 25765-25771 NN denotes murine
T24025 25761-25764 DT denotes the
T24024 25758-25760 IN denotes of
T24023 25751-25757 NN denotes region
T24022 25747-25750 CD denotes +92
T24021 25746-25747 NN denotes /
T24020 25743-25746 CD denotes 539
T24019 25742-25743 NN denotes −
T24018 25738-25741 DT denotes the
T24017 25735-25737 IN denotes of
T24016 25720-25734 NN denotes representation
T24015 25710-25719 JJ denotes Schematic
T24014 25708-25709 -RRB- denotes )
T24013 25707-25708 NN denotes A
T24012 25706-25707 -LRB- denotes (
T24011 25704-25705 . denotes .
T24010 25696-25704 NN denotes promoter
T24009 25687-25695 NNP denotes SerpinB2
T24008 25680-25686 NN denotes murine
T24007 25676-25679 DT denotes the
T24006 25673-25675 IN denotes of
T24005 25654-25672 NN denotes LPS-responsiveness
T24004 25650-25653 DT denotes the
T24003 25646-25649 IN denotes for
T24002 25637-25645 VBN denotes required
T24001 25628-25636 NNS denotes elements
T24000 25617-25627 JJ denotes cis-acting
T23999 25614-25616 IN denotes of
T23998 25599-25613 NN denotes Identification
T24457 29331-29334 DT denotes the
T24456 29328-29330 IN denotes of
T24455 29316-29327 NN denotes specificity
T24454 29312-29315 DT denotes the
T24453 29300-29311 VBP denotes demonstrate
T23695 24279-24280 : denotes ;
T23694 24272-24279 NN denotes element
T23693 24263-24271 NN denotes response
T23692 24258-24262 NNP denotes cAMP
T23691 24256-24257 SYM denotes =
T23690 24252-24255 NNP denotes CRE
T23689 24250-24251 : denotes ;
T23688 24243-24250 NN denotes protein
T23687 24235-24242 JJ denotes binding
T23686 24226-24234 NN denotes enhancer
T23685 24220-24225 NNP denotes CCAAT
T23684 24217-24218 SYM denotes =
T23683 24211-24216 NNP denotes C/EBP
T23682 24209-24210 : denotes ;
T23681 24208-24209 CD denotes 1
T23680 24200-24207 NN denotes protein
T23679 24190-24199 NN denotes activator
T23678 24187-24188 SYM denotes =
T23677 24182-24186 CD denotes AP-1
T23676 24180-24181 . denotes .
T23675 24173-24180 VBN denotes labeled
T23674 24169-24172 CC denotes and
T23673 24163-24168 VBN denotes boxed
T23672 24159-24162 VBP denotes are
T23671 24149-24158 NNS denotes promoters
T23670 24140-24148 NNP denotes SerpinB2
T23669 24133-24139 JJ denotes murine
T23668 24129-24132 CC denotes and
T23667 24123-24128 JJ denotes human
T23666 24119-24122 DT denotes the
T23665 24111-24118 IN denotes between
T23664 24101-24110 VBD denotes conserved
T23663 24092-24100 NNS denotes elements
T23662 24081-24091 JJ denotes Cis-acting
T23661 24079-24080 . denotes .
T23660 24071-24079 NN denotes software
T23659 24069-24070 NNP denotes W
T23658 24061-24068 JJ denotes Clustal
T23657 24055-24060 VBG denotes using
T23656 24047-24054 VBN denotes aligned
T23655 24042-24046 VBD denotes were
T23654 24032-24041 NNS denotes sequences
T23653 24021-24031 NN denotes nucleotide
T23652 24015-24020 JJ denotes human
T23651 24011-24014 CC denotes and
T23650 24005-24010 NNP denotes Mouse
T23649 24003-24004 . denotes .
T23648 24002-24003 CD denotes 1
T23647 24001-24002 NN denotes −
T23646 24000-24001 CD denotes /
T23645 23997-24000 CD denotes 563
T23644 23996-23997 NN denotes −
T23643 23987-23995 NN denotes promoter
T23642 23978-23986 NNP denotes SerpinB2
T23641 23971-23977 NN denotes murine
T23640 23967-23970 DT denotes the
T23639 23964-23966 IN denotes of
T23638 23957-23963 NN denotes region
T23637 23946-23956 JJ denotes responsive
T23636 23942-23945 NNP denotes LPS
T23635 23938-23941 DT denotes the
T23634 23935-23937 IN denotes in
T23633 23926-23934 NNS denotes elements
T23632 23915-23925 JJ denotes regulatory
T23631 23904-23914 JJ denotes cis-acting
T23630 23894-23903 JJ denotes Potential
T23752 24554-24555 . denotes .
T23751 24549-24554 VBN denotes shown
T23750 24544-24548 RB denotes also
T23749 24540-24543 VBP denotes are
T23748 24529-24539 NNS denotes constructs
T23747 24520-24528 NN denotes reporter
T23746 24517-24519 CD denotes 87
T23745 24516-24517 CD denotes −
T23744 24512-24515 CC denotes and
T23743 24508-24511 CD denotes 189
T23742 24507-24508 CD denotes −
T23741 24505-24506 , denotes ,
T23740 24502-24505 CD denotes 539
T23739 24501-24502 NN denotes −
T23738 24497-24500 DT denotes the
T23737 24494-24496 IN denotes of
T23736 24489-24493 NNS denotes ends
T23735 24487-24488 '' denotes '
T23734 24486-24487 CD denotes 5
T23733 24482-24485 DT denotes the
T23732 24479-24481 IN denotes of
T23731 24470-24478 NN denotes location
T23730 24466-24469 DT denotes The
T23729 24464-24465 . denotes .
T23728 24455-24464 NN denotes uppercase
T23727 24452-24454 IN denotes in
T23726 24442-24451 VBN denotes presented
T23725 24439-24441 VBZ denotes is
T23724 24437-24438 CD denotes 1
T23723 24432-24436 VB denotes exon
T23722 24428-24431 CC denotes and
T23721 24418-24427 VBN denotes indicated
T23720 24415-24417 VBZ denotes is
T23719 24413-24414 -RRB- denotes )
T23718 24410-24413 FW denotes tis
T23717 24409-24410 -LRB- denotes (
T23716 24404-24408 NN denotes site
T23715 24393-24403 NN denotes initiation
T23714 24379-24392 NN denotes transcription
T23713 24370-24378 JJ denotes putative
T23712 24366-24369 DT denotes The
T23711 24364-24365 . denotes .
T23710 24363-24364 CD denotes 1
T23709 24355-24362 NN denotes protein
T23708 24347-24354 JJ denotes binding
T23707 24343-24346 NN denotes box
T23706 24336-24342 VB denotes purine
T23705 24333-24334 SYM denotes =
T23704 24330-24332 CD denotes .1
T23703 24328-24330 NNP denotes PU
T23702 24326-24327 : denotes ;
T23701 24318-24326 NNP denotes 1/POU2F1
T23700 24311-24317 NN denotes factor
T23699 24297-24310 NN denotes transcription
T23698 24289-24296 JJR denotes octamer
T23697 24286-24287 SYM denotes =
T23696 24281-24285 NNP denotes Oct1
T22652 18619-18620 . denotes .
T22651 18612-18619 NN denotes control
T22650 18604-18611 VBG denotes loading
T22649 18602-18603 DT denotes a
T22648 18599-18601 IN denotes as
T22647 18593-18598 NNP denotes GAPDH
T23359 21918-21919 . denotes .
T23358 21914-21918 NN denotes site
T23357 21903-21913 NN denotes initiation
T23356 21889-21902 NN denotes transcription
T23355 21887-21888 SYM denotes =
T23354 21883-21886 FW denotes tis
T23353 21881-21882 , denotes ,
T23352 21875-21881 NN denotes repeat
T23351 21859-21874 NN denotes tetranucleotide
T23350 21854-21858 NNP denotes TATG
T23349 21852-21853 SYM denotes =
T23348 21850-21851 VBP denotes n
T23347 21849-21850 -RRB- denotes )
T23346 21845-21849 NNP denotes TATG
T23345 21844-21845 -LRB- denotes (
T23344 21842-21843 , denotes ,
T23343 21841-21842 -RRB- denotes )
T23342 21838-21841 NNP denotes LTR
T23341 21837-21838 -LRB- denotes (
T23340 21830-21836 NN denotes repeat
T23339 21821-21829 NN denotes terminal
T23338 21816-21820 JJ denotes long
T23337 21810-21815 CD denotes MLT1L
T23336 21808-21809 SYM denotes =
T23335 21802-21807 NNP denotes MLT1L
T23334 21800-21801 , denotes ,
T23333 21796-21800 NNP denotes SINE
T23332 21792-21795 NNP denotes MIR
T23331 21790-21791 SYM denotes =
T23330 21786-21789 NNP denotes MIR
T23329 21784-21785 , denotes ,
T23328 21780-21784 NNP denotes LINE
T23327 21777-21779 CD denotes L2
T23326 21774-21775 SYM denotes =
T23325 21771-21773 NNP denotes L2
T23324 21769-21770 , denotes ,
T23323 21768-21769 -RRB- denotes )
T23322 21764-21768 NNP denotes LINE
T23321 21763-21764 -LRB- denotes (
T23320 21755-21762 NN denotes element
T23319 21747-21754 JJ denotes nuclear
T23318 21734-21746 VBN denotes interspersed
T23317 21729-21733 JJ denotes long
T23316 21726-21728 CD denotes L1
T23315 21723-21724 SYM denotes =
T23314 21720-21722 NNP denotes L1
T23313 21718-21719 , denotes ,
T23312 21717-21718 -RRB- denotes )
T23311 21713-21717 NNP denotes SINE
T23310 21712-21713 -LRB- denotes (
T23309 21705-21711 NN denotes repeat
T23308 21697-21704 JJ denotes nuclear
T23307 21684-21696 VBN denotes interspersed
T23306 21678-21683 JJ denotes short
T23305 21674-21677 CD denotes ID4
T23304 21671-21672 SYM denotes =
T23303 21667-21670 NNP denotes ID4
T23302 21665-21666 , denotes ,
T23301 21659-21665 NN denotes repeat
T23300 21655-21658 NNP denotes Alu
T23299 21653-21654 SYM denotes =
T23298 21649-21652 NNP denotes Alu
T23297 21647-21648 . denotes .
T23296 21640-21647 NNS denotes regions
T23295 21631-21639 NN denotes flanking
T23294 21629-21630 NN denotes ′
T23293 21628-21629 CD denotes 5
T23292 21623-21627 DT denotes both
T23291 21620-21622 IN denotes in
T23290 21611-21619 NNS denotes elements
T23289 21602-21610 NN denotes sequence
T23288 21591-21601 JJ denotes repetitive
T23287 21588-21590 IN denotes by
T23286 21576-21587 VBN denotes interrupted
T23285 21572-21575 VBP denotes are
T23284 21564-21571 NNS denotes regions
T23283 21553-21563 JJ denotes Homologous
T23282 21551-21552 . denotes .
T23281 21546-21551 NNS denotes boxes
T23280 21538-21545 VBN denotes colored
T23279 21533-21537 JJ denotes same
T23278 21529-21532 DT denotes the
T23277 21526-21528 IN denotes by
T23276 21516-21525 VBN denotes indicated
T23275 21507-21515 NN denotes identity
T23274 21498-21506 NN denotes sequence
T23273 21487-21497 NN denotes nucleotide
T23272 21484-21486 IN denotes of
T23271 21476-21483 NNS denotes regions
T23270 21471-21475 IN denotes with
T23269 21463-21470 NNS denotes regions
T23268 21454-21462 NN denotes flanking
T23267 21452-21453 NN denotes ′
T23266 21451-21452 CD denotes 5
T23265 21442-21450 NN denotes SerpinB2
T23264 21435-21441 JJ denotes murine
T23263 21431-21434 CC denotes and
T23262 21425-21430 JJ denotes human
T23261 21421-21424 DT denotes the
T23260 21418-21420 IN denotes of
T23259 21403-21417 NN denotes representation
T23258 21393-21402 JJ denotes Schematic
T23257 21391-21392 . denotes .
T23256 21384-21391 NNS denotes regions
T23255 21375-21383 NN denotes flanking
T23247 21334-21341 IN denotes between
T23246 21321-21333 NN denotes conservation
T23245 21312-21320 NN denotes sequence
T23244 21308-21311 NNP denotes DNA
T23243 21306-21307 -RRB- denotes )
T23242 21305-21306 NNP denotes C
T23241 21304-21305 -LRB- denotes (
T23240 21302-21303 . denotes .
T23239 21291-21302 NNS denotes experiments
T23238 21279-21290 JJ denotes independent
T23237 21274-21278 CD denotes four
T23236 21271-21273 IN denotes of
T23235 21267-21270 NNP denotes SEM
T23234 21263-21266 CC denotes and
T23233 21258-21262 NN denotes mean
T23232 21254-21257 DT denotes the
T23231 21244-21253 VBP denotes represent
T23230 21236-21243 NNS denotes results
T23229 21232-21235 DT denotes The
T23228 21230-21231 . denotes .
T23227 21221-21230 NN denotes treatment
T23226 21211-21220 VBG denotes following
T23225 21202-21210 NN denotes activity
T23224 21197-21201 NN denotes gene
T23223 21188-21196 NN denotes reporter
T23222 21177-21187 NN denotes luciferase
T23221 21168-21176 JJ denotes relative
T23220 21164-21167 DT denotes the
T23219 21161-21163 VBZ denotes is
T23218 21155-21160 VBN denotes Shown
T23217 21153-21154 . denotes .
T23216 21150-21153 NNS denotes hrs
T23215 21147-21149 CD denotes 16
T23214 21143-21146 IN denotes for
T23213 21139-21142 NNP denotes PMA
T23212 21133-21138 JJ denotes ng/ml
T23211 21130-21132 CD denotes 40
T23210 21127-21129 CC denotes or
T23209 21123-21126 NNP denotes LPS
T23208 21117-21122 JJ denotes ng/ml
T23207 21113-21116 CD denotes 100
T23206 21108-21112 IN denotes with
T23205 21100-21107 VBN denotes treated
T23204 21097-21099 CC denotes or
T23203 21087-21096 JJ denotes untreated
T23202 21082-21086 VBN denotes left
T23201 21075-21081 RB denotes either
T23200 21070-21074 VBD denotes were
T23199 21064-21069 NNS denotes Cells
T23198 21062-21063 . denotes .
T23197 21054-21062 NNS denotes plasmids
T23196 21046-21053 NN denotes control
T23195 21042-21045 CC denotes and
T23194 21031-21041 NNS denotes constructs
T23193 21022-21030 NN denotes reporter
T23192 21002-21021 JJ denotes promoter-luciferase
T23191 20993-21001 NNP denotes SerpinB2
T23190 20986-20992 NN denotes murine
T23189 20976-20985 VBN denotes indicated
T23188 20972-20975 DT denotes the
T23187 20967-20971 IN denotes with
T23186 20955-20966 VBN denotes transfected
T23185 20943-20954 RB denotes transiently
T23184 20938-20942 VBD denotes were
T23183 20926-20937 NNS denotes macrophages
T23182 20920-20925 CD denotes 264.7
T23181 20916-20919 NNP denotes RAW
T23180 20914-20915 -RRB- denotes )
T23179 20913-20914 NNP denotes B
T23178 20912-20913 -LRB- denotes (
T23177 20910-20911 . denotes .
T23176 20902-20910 NN denotes sequence
T23175 20893-20901 NN denotes flanking
T23174 20891-20892 NN denotes ′
T23173 20890-20891 CD denotes 5
T23172 20881-20889 CD denotes SerpinB2
T23171 20874-20880 NN denotes murine
T23170 20871-20873 IN denotes of
T23169 20860-20870 NN denotes nucleotide
T23168 20858-20859 NN denotes ′
T23167 20857-20858 CD denotes 5
T23166 20852-20856 RBS denotes most
T23165 20848-20851 DT denotes the
T23164 20839-20847 VBP denotes indicate
T23163 20833-20838 NNS denotes names
T23162 20823-20832 VB denotes Construct
T23161 20821-20822 . denotes .
T23160 20814-20821 NNS denotes primers
T23159 20810-20813 NNP denotes PCR
T23158 20794-20809 NN denotes oligonucleotide
T23157 20785-20793 JJ denotes specific
T23156 20780-20784 IN denotes with
T23155 20777-20779 CC denotes or
T23154 20771-20776 NNS denotes sites
T23153 20764-20770 NN denotes enzyme
T23152 20752-20763 NN denotes restriction
T23151 20746-20751 VBG denotes using
T23150 20736-20745 VBN denotes generated
T23149 20731-20735 VBD denotes were
T23148 20721-20730 NNS denotes deletions
T23147 20719-20720 NN denotes ′
T23146 20718-20719 CD denotes 5
T23145 20714-20717 CC denotes and
T23144 20709-20713 NN denotes gene
T23143 20700-20708 NN denotes reporter
T23142 20689-20699 NN denotes luciferase
T23141 20685-20688 DT denotes the
T23140 20682-20684 IN denotes of
T23139 20673-20681 RB denotes upstream
T23138 20664-20672 VBN denotes inserted
T23137 20660-20663 VBD denotes was
T23136 20656-20659 CD denotes +92
T23135 20653-20655 TO denotes to
T23134 20648-20652 CD denotes 4480
T23133 20647-20648 CD denotes −
T23132 20642-20646 IN denotes from
T23131 20635-20641 NN denotes region
T23130 20626-20634 NN denotes flanking
T23129 20624-20625 NN denotes ′
T23128 20623-20624 CD denotes 5
T23127 20616-20622 NN denotes murine
T23126 20612-20615 DT denotes The
T23125 20610-20611 . denotes .
T23124 20600-20610 NNS denotes constructs
T23123 20591-20599 NN denotes reporter
T23122 20580-20590 NN denotes luciferase
T23121 20571-20579 NN denotes deletion
T23120 20569-20570 NN denotes ′
T23119 20568-20569 CD denotes 5
T23118 20564-20567 CC denotes and
T23117 20555-20563 NN denotes promoter
T23116 20546-20554 NNP denotes SerpinB2
T23115 20539-20545 NN denotes murine
T23114 20535-20538 DT denotes the
T23113 20532-20534 IN denotes of
T23112 20517-20531 NN denotes representation
T23111 20507-20516 JJ denotes Schematic
T23110 20505-20506 -RRB- denotes )
T23109 20504-20505 NN denotes A
T23108 20503-20504 -LRB- denotes (
T23107 20501-20502 . denotes .
T23106 20493-20501 NN denotes promoter
T23105 20484-20492 NNP denotes SerpinB2
T23104 20477-20483 NN denotes murine
T23103 20473-20476 DT denotes the
T23102 20470-20472 IN denotes in
T23101 20462-20469 NNS denotes regions
T23100 20447-20461 JJ denotes PMA-responsive
T23099 20443-20446 CC denotes and
T23098 20439-20442 NNP denotes LPS
T23097 20436-20438 IN denotes of
T23096 20427-20435 NN denotes analysis
T23095 20422-20426 NN denotes gene
T23094 20413-20421 NN denotes reporter
T23093 20404-20412 NN denotes Deletion
T22646 18589-18592 IN denotes for
T22645 18580-18588 VBN denotes reprobed
T22644 18576-18579 VBD denotes was
T22643 18571-18575 NNP denotes Blot
T22642 18569-18570 . denotes .
T22641 18562-18569 VBZ denotes lysates
T22640 18557-18561 NN denotes cell
T22639 18551-18556 JJ denotes whole
T22638 18548-18550 IN denotes in
T22637 18537-18547 NN denotes expression
T22636 18529-18536 NN denotes protein
T22635 18520-18528 CD denotes SerpinB2
T22634 18517-18519 IN denotes of
T22633 18508-18516 NN denotes analysis
T22632 18497-18507 NNP denotes Immunoblot
T22631 18495-18496 -RRB- denotes )
T22630 18494-18495 NNP denotes B
T22629 18493-18494 -LRB- denotes (
T22628 18491-18492 . denotes .
T22627 18481-18491 NN denotes triplicate
T22626 18478-18480 IN denotes in
T22625 18468-18477 VBN denotes performed
T22624 18456-18467 NNS denotes experiments
T22623 18444-18455 JJ denotes independent
T22622 18440-18443 CD denotes two
T22621 18434-18439 JJS denotes least
T22596 18315-18318 CD denotes 100
T22595 18310-18314 IN denotes with
T22594 18304-18309 NNS denotes times
T22593 18294-18303 JJ denotes indicated
T22592 18290-18293 DT denotes the
T22591 18286-18289 IN denotes for
T22590 18278-18285 VBN denotes treated
T22589 18273-18277 VBD denotes were
T22588 18261-18272 NNS denotes macrophages
T22587 18258-18260 CD denotes .7
T22586 18252-18258 CD denotes RAW264
T22585 18250-18251 . denotes .
T22584 18245-18250 NNS denotes cells
T22583 18234-18244 NN denotes macrophage
T22582 18227-18233 JJ denotes murine
T22581 18224-18226 IN denotes in
T22580 18213-18223 NN denotes expression
T22579 18205-18212 NN denotes protein
T22578 18201-18204 CC denotes and
T22577 18196-18200 NNP denotes mRNA
T22576 18187-18195 NNP denotes SerpinB2
T22575 18184-18186 IN denotes of
T22574 18174-18183 NN denotes induction
T22573 18170-18173 NNP denotes LPS
T23254 21373-21374 NN denotes ′
T23253 21372-21373 CD denotes 5
T23252 21363-21371 NN denotes SerpinB2
T23251 21356-21362 JJ denotes murine
T23250 21352-21355 CC denotes and
T23249 21346-21351 JJ denotes human
T23248 21342-21345 DT denotes the
T22270 47052-47059 JJ denotes unknown
T22269 47041-47051 RB denotes previously
T22268 47039-47040 DT denotes a
T22267 47031-47038 VB denotes uncover
T22266 47028-47030 TO denotes to
T22265 47023-47027 JJ denotes able
T22264 47018-47022 VBD denotes were
T22263 47015-47017 PRP denotes we
T22262 47013-47014 , denotes ,
T22261 47002-47013 RB denotes Importantly
T22260 47000-47001 . denotes .
T22259 46990-47000 NN denotes expression
T22258 46985-46989 NN denotes gene
T22257 46976-46984 JJ denotes SerpinB2
T22256 46964-46975 JJ denotes LPS-induced
T22255 46960-46963 CC denotes and
T22254 46947-46959 JJ denotes constitutive
T22253 46942-46946 DT denotes both
T22252 46934-46941 VB denotes support
T22251 46931-46933 TO denotes to
T22250 46921-46930 JJ denotes necessary
T22249 46918-46920 VBZ denotes is
T22248 46909-46917 NN denotes promoter
T22247 46900-46908 JJ denotes proximal
T22246 46891-46899 NNP denotes SerpinB2
T22245 46884-46890 NN denotes murine
T22244 46880-46883 DT denotes the
T22243 46877-46879 IN denotes in
T22242 46875-46876 -RRB- denotes )
T22240 46871-46872 NN denotes −
T22239 46870-46871 CD denotes /
T22238 46867-46870 CD denotes 203
T22237 46866-46867 FW denotes −
T22236 46865-46866 -LRB- denotes (
T22235 46860-46864 NN denotes site
T22234 46854-46859 NNP denotes C/EBP
T22233 46850-46853 DT denotes the
T22232 46845-46849 IN denotes that
T22231 46840-46844 VBP denotes show
T22230 46832-46839 NNS denotes studies
T22229 46828-46831 PRP$ denotes our
T22228 46826-46827 , denotes ,
T22227 46819-46826 NN denotes summary
T22226 46816-46818 IN denotes In
T22225 46814-46815 . denotes .
T22224 46798-46814 NN denotes microenvironment
T22223 46792-46797 NN denotes tumor
T22222 46788-46791 DT denotes the
T22221 46785-46787 IN denotes in
T22220 46779-46784 NNS denotes cells
T22219 46772-46778 JJ denotes immune
T22218 46759-46771 VBG denotes infiltrating
T22217 46756-46758 IN denotes of
T22216 46746-46755 NN denotes phenotype
T22215 46733-46745 JJ denotes inflammatory
T22214 46729-46732 DT denotes the
T22213 46725-46728 IN denotes for
T22212 46712-46724 NNS denotes implications
T22211 46707-46711 VB denotes have
T22210 46703-46706 MD denotes may
T22209 46697-46702 WDT denotes which
T22208 46695-46696 , denotes ,
T22207 46691-46695 NN denotes gene
T22206 46682-46690 NNP denotes SerpinB2
T22205 46678-46681 DT denotes the
T22204 46675-46677 IN denotes of
T22203 46661-46674 NN denotes transcription
T22202 46649-46660 JJ denotes LPS-induced
T22201 46645-46648 CC denotes and
T22200 46632-46644 JJ denotes constitutive
T22199 46627-46631 DT denotes both
T22198 46617-46626 VBG denotes mediating
T22197 46614-46616 IN denotes in
T22196 46609-46613 NN denotes role
T22195 46599-46608 JJ denotes important
T22194 46596-46598 DT denotes an
T22193 46590-46595 VBZ denotes plays
T22192 46588-46589 NN denotes β
T22191 46587-46588 : denotes -
T22190 46582-46587 NNP denotes C/EBP
T22189 46577-46581 IN denotes that
T22188 46564-46576 VBN denotes demonstrated
T22187 46560-46563 VBZ denotes has
T22186 46554-46559 NN denotes study
T22185 46550-46553 PRP$ denotes Our
T22184 46548-46549 . denotes .
T22183 46547-46548 NNP denotes ]
T22182 46545-46547 CD denotes 81
T22181 46544-46545 NNP denotes [
T22180 46542-46543 NNP denotes ]
T22179 46540-46542 CD denotes 79
T22178 46539-46540 NNP denotes [
T22177 46537-46538 : denotes ;
T22176 46536-46537 NNP denotes ]
T22175 46534-46536 CD denotes 27
T22174 46533-46534 NNP denotes [
T22173 46523-46532 NN denotes phenotype
T22172 46517-46522 PRP$ denotes their
T22171 46507-46516 VBG denotes modifying
T22170 46499-46506 RB denotes thereby
T22169 46497-46498 , denotes ,
T22168 46492-46497 NNS denotes cells
T22167 46485-46491 JJ denotes immune
T22166 46480-46484 IN denotes from
T22165 46470-46479 NN denotes secretion
T22164 46461-46469 JJ denotes cytokine
T22163 46452-46460 VB denotes modulate
T22162 46449-46451 TO denotes to
T22161 46443-46448 VBN denotes shown
T22160 46438-46442 VBN denotes been
T22159 46433-46437 RB denotes also
T22158 46429-46432 VBZ denotes has
T22157 46427-46428 NN denotes β
T22156 46426-46427 : denotes -
T22155 46421-46426 SYM denotes C/EBP
T22154 46407-46420 RB denotes Interestingly
T22153 46405-46406 . denotes .
T22152 46404-46405 NNP denotes ]
T22151 46402-46404 CD denotes 78
T22150 46401-46402 NNP denotes [
T22149 46399-46400 : denotes ;
T22148 46398-46399 NNP denotes ]
T22147 46396-46398 CD denotes 77
T22146 46395-46396 NNP denotes [
T22145 46393-46394 : denotes ;
T22143 46390-46392 CD denotes 28
T22142 46389-46390 NNP denotes [
T22141 46387-46388 : denotes ;
T22140 46386-46387 NNP denotes ]
T22139 46384-46386 CD denotes 27
T22138 46383-46384 NNP denotes [
T22137 46370-46382 NN denotes polarization
T22136 46365-46369 NN denotes cell
T22135 46358-46364 JJ denotes immune
T22134 46351-46357 VB denotes affect
T22133 46347-46350 MD denotes can
T22132 46341-46346 WDT denotes which
T22131 46332-46340 NNS denotes profiles
T22130 46323-46331 JJ denotes cytokine
T22129 46314-46322 VB denotes modulate
T22128 46311-46313 TO denotes to
T22127 46305-46310 VBN denotes shown
T22126 46300-46304 VBN denotes been
T22125 46296-46299 VBZ denotes has
T22124 46287-46295 NNP denotes SerpinB2
T22123 46284-46286 IN denotes of
T22122 46275-46283 NN denotes presence
T22121 46271-46274 DT denotes The
T22120 46269-46270 . denotes .
T22119 46268-46269 NNP denotes ]
T22118 46266-46268 CD denotes 77
T22117 46265-46266 NNP denotes [
T22116 46260-46264 NN denotes type
T22115 46253-46259 NN denotes cancer
T22114 46250-46252 IN denotes on
T22113 46240-46249 VBG denotes depending
T22112 46230-46239 NN denotes indicator
T22111 46219-46229 JJ denotes prognostic
T22110 46207-46218 JJ denotes unfavorable
T22109 46204-46206 CC denotes or
T22108 46194-46203 JJ denotes favorable
T22107 46192-46193 DT denotes a
T22106 46189-46191 VBZ denotes is
T22105 46185-46188 CC denotes and
T22104 46183-46184 , denotes ,
T22103 46177-46183 NN denotes cancer
T22102 46173-46176 CC denotes and
T22101 46160-46172 NN denotes inflammation
T22100 46155-46159 DT denotes both
T22099 46150-46154 IN denotes with
T22098 46139-46149 VBN denotes associated
T22097 46134-46138 VBN denotes been
T22096 46130-46133 VBZ denotes has
T22095 46119-46129 NN denotes expression
T22094 46110-46118 CD denotes SerpinB2
T22093 46108-46109 . denotes .
T22092 46107-46108 NNP denotes ]
T22091 46105-46107 CD denotes 76
T22090 46104-46105 NNP denotes [
T22089 46102-46103 NNP denotes ]
T22088 46100-46102 CD denotes 74
T22087 46099-46100 NNP denotes [
T22086 46097-46098 : denotes ;
T22085 46096-46097 NNP denotes ]
T22084 46095-46096 CD denotes 2
T22083 46094-46095 NNP denotes [
T22082 46082-46093 NN denotes progression
T22081 46075-46081 NN denotes cancer
T22620 18431-18433 IN denotes at
T22619 18428-18430 IN denotes of
T22618 18413-18427 NN denotes representative
T22617 18410-18412 VBZ denotes is
T22616 18405-18409 NN denotes plot
T22615 18401-18404 DT denotes The
T22614 18399-18400 . denotes .
T22613 18392-18399 VB denotes β-actin
T22612 18389-18391 TO denotes to
T22611 18380-18388 JJ denotes relative
T22610 18378-18379 , denotes ,
T22609 18372-18378 NNS denotes levels
T22608 18367-18371 NNP denotes mRNA
T22607 18358-18366 NNP denotes SerpinB2
T22606 18351-18357 JJ denotes murine
T22605 18348-18350 IN denotes of
T22604 18339-18347 NN denotes analysis
T22603 18334-18338 NNP denotes qPCR
T22602 18332-18333 -RRB- denotes )
T22601 18331-18332 NNP denotes A
T22600 18330-18331 -LRB- denotes (
T22599 18328-18329 . denotes .
T22598 18325-18328 NNP denotes LPS
T22597 18319-18324 JJ denotes ng/ml
T22080 46065-46074 VB denotes attenuate
T22079 46062-46064 CC denotes or
T22078 46054-46061 VB denotes promote
T22077 46047-46053 RB denotes either
T22076 46043-46046 MD denotes can
T22075 46031-46042 NNS denotes macrophages
T22074 46028-46030 IN denotes as
T22073 46023-46027 JJ denotes such
T22072 46017-46022 NNS denotes cells
T22071 46010-46016 JJ denotes immune
T22070 46006-46009 CC denotes and
T22069 46004-46005 , denotes ,
T22068 45998-46004 NN denotes cancer
T22067 45994-45997 CC denotes and
T22066 45981-45993 NN denotes inflammation
T22065 45973-45980 JJ denotes chronic
T22064 45970-45972 TO denotes to
T22063 45963-45969 VBN denotes linked
T22062 45952-45962 RB denotes integrally
T22061 45949-45951 VBZ denotes is
T22060 45939-45948 NN denotes infection
T22059 45928-45938 JJ denotes persistent
T22058 45923-45927 IN denotes that
T22057 45914-45922 JJ denotes apparent
T22056 45907-45913 VBN denotes become
T22055 45903-45906 VBZ denotes has
T22039 45799-45810 JJ denotes MLK3-driven
T22038 45794-45798 IN denotes that
T22037 45786-45793 VBP denotes suggest
T22036 45781-45785 NNS denotes data
T22035 45777-45780 PRP$ denotes Our
T22034 45775-45776 . denotes .
T22033 45774-45775 NNP denotes ]
T22032 45772-45774 CD denotes 73
T22031 45771-45772 NNP denotes [
T22030 45762-45770 NNS denotes pathways
T22029 45752-45761 VBG denotes signaling
T22028 45737-45751 JJ denotes IFNγ-regulated
T22027 45733-45736 IN denotes for
T22026 45723-45732 JJ denotes important
T22025 45719-45722 VBD denotes was
T22024 45715-45718 NNP denotes S64
T22023 45713-45714 NN denotes β
T22022 45712-45713 : denotes -
T22021 45707-45712 NNP denotes C/EBP
T22020 45704-45706 IN denotes of
T22019 45686-45703 NN denotes dephosphorylation
T22018 45679-45685 VBN denotes driven
T22017 45678-45679 : denotes -
T22016 45677-45678 -RRB- denotes )
T22015 45673-45677 CD denotes MLK3
T22014 45672-45673 -LRB- denotes (
T22013 45663-45671 JJ denotes kinase-3
T22012 45655-45662 NN denotes lineage
T22011 45649-45654 JJ denotes Mixed
T22010 45644-45648 IN denotes that
T22009 45631-45643 VBD denotes demonstrated
T22008 45620-45630 NNS denotes colleagues
T22007 45616-45619 CC denotes and
T22006 45612-45615 NNP denotes Roy
T22005 45610-45611 . denotes .
T22004 45602-45610 NN denotes activity
T22003 45593-45601 NN denotes promoter
T22002 45589-45592 PRP$ denotes its
T22001 45580-45588 VB denotes increase
T22000 45577-45579 TO denotes to
T21999 45568-45576 CD denotes SerpinB2
T21998 45565-45567 IN denotes of
T21997 45551-45564 NN denotes transcription
T21996 45539-45550 JJ denotes LPS-induced
T21995 45532-45538 IN denotes during
T21994 45526-45531 NN denotes event
T21993 45517-45525 JJ denotes critical
T21992 45515-45516 DT denotes a
T21991 45512-45514 VB denotes be
T21990 45508-45511 MD denotes may
T21989 45503-45507 NN denotes site
T21988 45498-45502 DT denotes this
T21987 45495-45497 IN denotes at
T21986 45477-45494 NN denotes dephosphorylation
T21985 45472-45476 IN denotes that
T21984 45465-45471 JJ denotes likely
T21983 45462-45464 VBZ denotes is
T21982 45459-45461 PRP denotes it
T21981 45457-45458 , denotes ,
T21980 45456-45457 NNP denotes ]
T21979 45454-45456 CD denotes 73
T21978 45453-45454 NNP denotes [
T21977 45448-45452 NNS denotes MEFs
T21976 45444-45447 CC denotes and
T21975 45438-45443 NNS denotes cells
T21974 45435-45437 CD denotes .7
T21973 45429-45435 NNP denotes RAW264
T21972 45424-45428 DT denotes both
T21971 45421-45423 IN denotes in
T21970 45406-45420 VBN denotes phosphorylated
T21969 45391-45405 RB denotes constitutively
T21968 45388-45390 VBZ denotes is
T21967 45384-45387 NNP denotes S64
T21966 45382-45383 NN denotes β
T21965 45381-45382 : denotes -
T21964 45376-45381 NNP denotes C/EBP
T21963 45370-45375 IN denotes Since
T21962 45368-45369 . denotes .
T21961 45360-45368 NN denotes activity
T21960 45351-45359 NN denotes promoter
T21959 45342-45350 CD denotes SerpinB2
T21958 45330-45341 JJ denotes LPS-induced
T21957 45320-45329 VBZ denotes regulates
T21956 45309-45319 RB denotes negatively
T21955 45305-45308 CD denotes S64
T21954 45302-45304 IN denotes at
T21953 45300-45301 NN denotes β
T21952 45299-45300 : denotes -
T21951 45294-45299 NNP denotes C/EBP
T21950 45291-45293 IN denotes of
T21949 45275-45290 NN denotes phosphorylation
T21948 45270-45274 IN denotes that
T21947 45259-45269 VBG denotes indicating
T21946 45257-45258 , denotes ,
T21945 45249-45257 NN denotes activity
T21944 45240-45248 NN denotes promoter
T21943 45231-45239 NN denotes SerpinB2
T21942 45219-45230 JJ denotes LPS-induced
T21941 45210-45218 JJ denotes enhanced
T21940 45196-45209 RB denotes significantly
T21939 45190-45195 JJ denotes βS64A
T21938 45189-45190 : denotes -
T21937 45184-45189 NNP denotes C/EBP
T21936 45181-45183 IN denotes of
T21935 45170-45180 NN denotes expression
T21934 45168-45169 , denotes ,
T21933 45160-45168 NN denotes contrast
T21932 45157-45159 IN denotes In
T21931 45155-45156 . denotes .
T21930 45146-45155 JJ denotes wild-type
T21929 45143-45145 IN denotes of
T21928 45138-45142 DT denotes that
T21927 45133-45137 IN denotes from
T21926 45121-45132 RB denotes differently
T21925 45112-45120 NN denotes activity
T21924 45103-45111 NN denotes promoter
T21923 45094-45102 JJ denotes SerpinB2
T21922 45087-45093 VB denotes affect
T21921 45083-45086 RB denotes not
T21920 45079-45082 VBD denotes did
T21919 45077-45078 , denotes ,
T21918 45071-45077 NNP denotes βT188A
T21917 45070-45071 : denotes -
T21916 45065-45070 NNP denotes C/EBP
T21915 45063-45064 , denotes ,
T21914 45057-45063 JJ denotes mutant
T21913 45052-45056 NN denotes site
T21912 45035-45051 NN denotes phospho-acceptor
T21911 45033-45034 NN denotes β
T21910 45032-45033 : denotes -
T21909 45027-45032 NNP denotes C/EBP
T21908 45023-45026 DT denotes the
T21907 45020-45022 IN denotes of
T21906 45009-45019 NN denotes expression
T21905 45007-45008 , denotes ,
T21904 44998-45007 RB denotes Similarly
T21903 44996-44997 . denotes .
T21902 44986-44996 NN denotes expression
T21901 44981-44985 NN denotes gene
T21900 44972-44980 NNP denotes SerpinB2
T21899 44969-44971 IN denotes of
T21898 44958-44968 NN denotes regulation
T21897 44954-44957 DT denotes the
T21896 44950-44953 IN denotes for
T21895 44940-44949 JJ denotes important
T21894 44936-44939 RB denotes not
T21893 44933-44935 VBZ denotes is
T21892 44928-44932 NN denotes site
T21891 44911-44927 NN denotes phospho-acceptor
T21890 44906-44910 NNP denotes T217
T21889 44902-44905 DT denotes the
T21888 44897-44901 IN denotes that
T21887 44888-44896 VBP denotes indicate
T21886 44883-44887 NNS denotes data
T21885 44877-44882 DT denotes These
T21884 44875-44876 . denotes .
T21883 44870-44875 NNS denotes cells
T21882 44867-44869 CD denotes .7
T21881 44861-44867 NNP denotes RAW264
T21880 44858-44860 IN denotes of
T21879 44846-44857 NN denotes stimulation
T21878 44842-44845 NNP denotes LPS
T21877 44832-44841 VBG denotes following
T21876 44823-44831 VB denotes decrease
T21875 44820-44822 TO denotes to
T21874 44811-44819 VBN denotes observed
T21873 44807-44810 VBD denotes was
T21872 44798-44806 NN denotes promoter
T21871 44789-44797 NNP denotes SerpinB2
T21870 44785-44788 DT denotes the
T21869 44782-44784 TO denotes to
T21868 44776-44781 NNP denotes βT217
T21867 44775-44776 : denotes -
T21866 44770-44775 NNP denotes C/EBP
T21865 44767-44769 IN denotes of
T21864 44755-44766 NN denotes recruitment
T21863 44748-44754 IN denotes though
T21862 44743-44747 RB denotes even
T21861 44741-44742 , denotes ,
T21860 44740-44741 NN denotes β
T21859 44739-44740 : denotes -
T21858 44734-44739 NNP denotes C/EBP
T21857 44724-44733 JJ denotes wild-type
T21856 44721-44723 IN denotes of
T21855 44716-44720 DT denotes that
T21854 44711-44715 IN denotes over
T21853 44702-44710 NN denotes activity
T21852 44693-44701 NN denotes promoter
T21851 44684-44692 JJ denotes proximal
T21850 44675-44683 NNP denotes SerpinB2
T22298 47250-47251 . denotes .
T22297 47240-47250 NN denotes expression
T22296 47235-47239 NN denotes gene
T22295 47226-47234 NNP denotes SerpinB2
T22294 47202-47225 JJ denotes inflammation-associated
T22293 47199-47201 IN denotes of
T22292 47188-47198 NN denotes regulation
T22291 47184-47187 DT denotes the
T22290 47179-47183 IN denotes into
T22289 47171-47178 NN denotes insight
T22288 47167-47170 JJ denotes new
T22287 47159-47166 VBP denotes provide
T22286 47154-47158 NNS denotes data
T22285 47148-47153 DT denotes these
T22284 47139-47147 RB denotes together
T22283 47133-47138 VBN denotes Taken
T22282 47131-47132 . denotes .
T22281 47123-47131 NN denotes activity
T22280 47114-47122 NN denotes promoter
T22279 47105-47113 JJ denotes SerpinB2
T22278 47094-47104 VBG denotes regulating
T22277 47083-47093 RB denotes negatively
T22276 47080-47082 IN denotes in
T22275 47075-47079 NN denotes βS64
T22274 47074-47075 : denotes -
T22273 47069-47074 NNP denotes C/EBP
T22272 47065-47068 IN denotes for
T22271 47060-47064 NN denotes role
T21849 44666-44674 VB denotes increase
T21848 44662-44665 RB denotes not
T21847 44658-44661 VBD denotes did
T21846 44653-44657 NNS denotes MEFs
T21845 44651-44652 CD denotes −
T21844 44650-44651 VBD denotes /
T21843 44649-44650 NNP denotes −
T21842 44644-44649 NNP denotes Cebpb
T21841 44641-44643 IN denotes in
T21840 44639-44640 , denotes ,
T21839 44633-44639 NNP denotes βT217A
T21838 44628-44633 NNP denotes C/EBP
T21837 44626-44627 , denotes ,
T21836 44620-44626 JJ denotes mutant
T21835 44615-44619 NN denotes site
T21834 44598-44614 NN denotes phospho-acceptor
T21833 44596-44597 NN denotes β
T21832 44595-44596 : denotes -
T21831 44590-44595 NNP denotes C/EBP
T21830 44588-44589 DT denotes a
T21829 44585-44587 IN denotes of
T21828 44574-44584 NN denotes expression
T21827 44572-44573 , denotes ,
T21826 44565-44572 RB denotes However
T21825 44563-44564 . denotes .
T21824 44562-44563 NNP denotes ]
T21730 44095-44097 CD denotes 14
T21729 44094-44095 NNP denotes [
T21728 44088-44093 NN denotes death
T21727 44083-44087 NN denotes cell
T21726 44069-44082 JJ denotes viral-induced
T21725 44065-44068 CC denotes and
T21724 44055-44064 JJ denotes bacterial
T21723 44050-44054 IN denotes from
T21722 44042-44049 VB denotes protect
T21721 44039-44041 TO denotes to
T21720 44026-44038 VBN denotes demonstrated
T21719 44021-44025 VBN denotes been
T21718 44017-44020 VBZ denotes has
T21717 44008-44016 NNP denotes SerpinB2
T21716 44004-44007 CC denotes and
T21715 44002-44003 NNP denotes ]
T21714 44000-44002 CD denotes 70
T21713 43999-44000 NNP denotes [
T21712 43997-43998 : denotes ;
T21711 43996-43997 NNP denotes ]
T21710 43994-43996 CD denotes 69
T21709 43993-43994 NNP denotes [
T21708 43983-43992 NN denotes infection
T21707 43973-43982 JJ denotes bacterial
T21706 43970-43972 TO denotes to
T21705 43958-43969 JJ denotes susceptible
T21704 43954-43957 VBP denotes are
T21703 43949-43953 NNS denotes mice
T21702 43942-43948 JJ denotes β-null
T21701 43941-43942 : denotes -
T21700 43936-43941 NNP denotes C/EBP
T21699 43934-43935 , denotes ,
T21698 43923-43934 RB denotes Furthermore
T21697 43921-43922 . denotes .
T21696 43920-43921 NNP denotes ]
T21695 43918-43920 CD denotes 62
T21694 43917-43918 NNP denotes [
T21693 43915-43916 : denotes ;
T21692 43914-43915 NNP denotes ]
T21691 43912-43914 CD denotes 59
T21690 43911-43912 NNP denotes [
T21689 43901-43910 NNS denotes cytokines
T21688 43888-43900 JJ denotes inflammatory
T21687 43882-43887 JJ denotes other
T21686 43879-43881 IN denotes of
T21685 43874-43878 NN denotes host
T21684 43872-43873 DT denotes a
T21683 43868-43871 CC denotes and
T21682 43864-43867 NNP denotes LPS
T21681 43861-43863 IN denotes by
T21680 43849-43860 VBN denotes upregulated
T21679 43846-43848 VBZ denotes is
T21678 43843-43845 PRP denotes it
T21677 43840-43842 IN denotes as
T21676 43838-43839 , denotes ,
T21675 43826-43838 NN denotes inflammation
T21674 43823-43825 IN denotes in
T21673 43818-43822 NN denotes role
T21672 43808-43817 JJ denotes important
T21671 43805-43807 DT denotes an
T21670 43799-43804 VBZ denotes plays
T21669 43797-43798 , denotes ,
T21668 43789-43797 NNP denotes SerpinB2
T21667 43784-43788 IN denotes like
T21666 43782-43783 , denotes ,
T21665 43781-43782 NN denotes β
T21664 43780-43781 : denotes -
T21663 43775-43780 SYM denotes C/EBP
T21662 43773-43774 . denotes .
T21661 43763-43773 NN denotes expression
T21660 43758-43762 NN denotes gene
T21659 43749-43757 NNP denotes SerpinB2
T21658 43737-43748 JJ denotes LPS-induced
T21657 43734-43736 IN denotes in
T21656 43732-43733 NN denotes β
T21655 43731-43732 : denotes -
T21654 43726-43731 NNP denotes C/EBP
T21653 43722-43725 IN denotes for
T21652 43717-43721 NN denotes role
T21651 43705-43716 JJ denotes predominant
T21650 43703-43704 DT denotes a
T21649 43692-43702 VBG denotes suggesting
T21648 43690-43691 , denotes ,
T21647 43683-43690 NN denotes element
T21646 43674-43682 NN denotes response
T21645 43668-43673 NNP denotes C/EBP
T21644 43659-43667 NNP denotes SerpinB2
T21643 43655-43658 DT denotes the
T21642 43650-43654 NN denotes bind
T21641 43647-43649 TO denotes to
T21640 43639-43646 NN denotes isoform
T21639 43633-43638 NNP denotes C/EBP
T21638 43619-43632 JJ denotes LPS-inducible
T21637 43614-43618 JJ denotes only
T21636 43610-43613 DT denotes the
T21635 43607-43609 IN denotes as
T21634 43605-43606 NN denotes β
T21633 43604-43605 : denotes -
T21632 43599-43604 NNP denotes C/EBP
T21631 43588-43598 VBD denotes identified
T21630 43585-43587 PRP denotes we
T21629 43583-43584 , denotes ,
T21628 43582-43583 NNP denotes ]
T21627 43580-43582 CD denotes 63
T21626 43579-43580 NNP denotes [
T21625 43566-43578 NNS denotes heterodimers
T21624 43563-43565 CC denotes or
T21623 43552-43562 NNS denotes homodimers
T21622 43545-43551 DT denotes either
T21621 43542-43544 IN denotes as
T21620 43538-43541 VB denotes act
T21619 43534-43537 MD denotes can
T21618 43525-43533 NNS denotes proteins
T21617 43519-43524 NNP denotes C/EBP
T21616 43513-43518 IN denotes While
T21615 43511-43512 . denotes .
T21614 43498-43511 NN denotes transcription
T21613 43493-43497 NN denotes gene
T21612 43484-43492 JJ denotes SerpinB2
T21611 43480-43483 CC denotes and
T21610 43478-43479 NN denotes β
T21609 43477-43478 : denotes -
T21608 43472-43477 NNP denotes C/EBP
T21607 43464-43471 IN denotes between
T21606 43459-43463 NN denotes link
T21605 43455-43458 DT denotes the
T21604 43443-43454 VBG denotes emphasizing
T21603 43441-43442 , denotes ,
T21602 43430-43441 NNS denotes macrophages
T21601 43419-43429 JJ denotes peritoneal
T21600 43408-43418 VBD denotes transduced
T21599 43400-43407 NNP denotes β-shRNA
T21598 43399-43400 : denotes -
T21597 43394-43399 NNP denotes C/EBP
T21596 43391-43393 IN denotes in
T21595 43381-43390 VBN denotes abrogated
T21594 43367-43380 RB denotes significantly
T21593 43364-43366 VBZ denotes is
T21592 43353-43363 NN denotes expression
T21591 43348-43352 NNP denotes mRNA
T21590 43339-43347 NNP denotes SerpinB2
T21589 43325-43338 JJ denotes LPS-inducible
T21588 43321-43324 CC denotes and
T21587 43308-43320 JJ denotes constitutive
T21586 43303-43307 DT denotes both
T21585 43298-43302 IN denotes that
T21584 43292-43297 VBD denotes found
T21583 43289-43291 PRP denotes we
T21582 43286-43288 IN denotes as
T21581 43284-43285 , denotes ,
T21580 43277-43284 NN denotes finding
T21579 43272-43276 DT denotes this
T21578 43263-43271 VBP denotes validate
T21577 43255-43262 NNS denotes results
T21576 43250-43254 JJ denotes qPCR
T21575 43246-43249 PRP$ denotes Our
T21574 43244-43245 . denotes .
T21573 43243-43244 NNP denotes ]
T21572 43241-43243 CD denotes 68
T21571 43240-43241 NNP denotes [
T21570 43228-43239 NNS denotes macrophages
T21569 43218-43227 JJ denotes wild-type
T21568 43215-43217 TO denotes to
T21567 43206-43214 VBN denotes compared
T21566 43197-43205 VBN denotes impaired
T21565 43188-43196 RB denotes severely
T21564 43184-43187 VBD denotes was
T21563 43179-43183 NNP denotes IFNγ
T21562 43175-43178 CC denotes and
T21561 43171-43174 NNP denotes LPS
T21560 43168-43170 IN denotes by
T21559 43156-43167 NNS denotes macrophages
T21558 43145-43155 JJ denotes peritoneal
T21557 43133-43144 JJ denotes β-deficient
T21556 43132-43133 : denotes -
T21555 43127-43132 NNP denotes C/EBP
T21554 43124-43126 IN denotes in
T21553 43114-43123 NN denotes induction
T21552 43108-43113 WP$ denotes whose
T21551 43103-43107 NN denotes gene
T21550 43100-43102 IN denotes as
T21549 43089-43099 VBN denotes identified
T21548 43085-43088 VBD denotes was
T21547 43076-43084 NNP denotes SerpinB2
T21546 43074-43075 , denotes ,
T21545 43069-43074 NN denotes study
T21544 43059-43068 VBG denotes profiling
T21543 43048-43058 NN denotes expression
T21542 43037-43047 NN denotes microarray
T21541 43028-43036 JJ denotes previous
T22054 45900-45902 PRP denotes it
T22053 45894-45899 NNS denotes years
T22052 45887-45893 JJ denotes recent
T22051 45884-45886 IN denotes In
T22050 45882-45883 . denotes .
T22049 45874-45882 NNS denotes pathways
T22048 45860-45873 JJ denotes LPS-signaling
T22047 45857-45859 IN denotes in
T22046 45848-45856 VBN denotes involved
T22045 45845-45847 VB denotes be
T22044 45840-45844 RB denotes also
T22043 45836-45839 MD denotes may
T22042 45832-45835 CD denotes S64
T22041 45829-45831 IN denotes of
T22040 45811-45828 NN denotes dephosphorylation
T21540 43026-43027 DT denotes a
T21539 43023-43025 IN denotes In
T21538 43021-43022 . denotes .
T21537 43008-43021 NN denotes transcription
T21536 43003-43007 NN denotes gene
T21535 42994-43002 JJ denotes SerpinB2
T21534 42982-42993 JJ denotes LPS-induced
T21533 42978-42981 CC denotes and
T21532 42965-42977 JJ denotes constitutive
T21531 42960-42964 DT denotes both
T21530 42956-42959 IN denotes for
T21529 42944-42955 NN denotes requirement
T21528 42938-42943 JJ denotes major
T21527 42936-42937 DT denotes a
T21526 42933-42935 VB denotes be
T21525 42930-42932 TO denotes to
T21524 42924-42929 VBN denotes found
T21523 42920-42923 VBD denotes was
T21522 42918-42919 NN denotes β
T21521 42917-42918 : denotes -
T21520 42912-42917 NNP denotes C/EBP
T21519 42910-42911 , denotes ,
T21518 42905-42910 NN denotes study
T21517 42900-42904 DT denotes this
T21516 42897-42899 IN denotes In
T21515 42895-42896 . denotes .
T21440 42544-42546 IN denotes Of
T21439 42542-42543 . denotes .
T21438 42534-42542 JJ denotes critical
T21437 42528-42533 VBG denotes being
T21436 42523-42527 RB denotes also
T21435 42514-42522 NNS denotes elements
T21434 42504-42513 JJ denotes AP-1-like
T21433 42500-42503 CC denotes and
T21432 42496-42499 NNP denotes CRE
T21431 42485-42495 JJ denotes downstream
T21430 42481-42484 DT denotes the
T21429 42476-42480 IN denotes with
T21428 42474-42475 , denotes ,
T21427 42471-42474 CD denotes 539
T21426 42470-42471 CD denotes −
T21425 42466-42469 CC denotes and
T21424 42462-42465 CD denotes 189
T21423 42461-42462 VBP denotes −
T21422 42449-42460 NNS denotes nucleotides
T21421 42441-42448 IN denotes between
T21420 42434-42440 NN denotes region
T21419 42430-42433 DT denotes the
T21418 42427-42429 IN denotes in
T21417 42419-42426 VBN denotes located
T21416 42414-42418 NN denotes site
T21415 42406-42413 JJ denotes binding
T21414 42400-42405 NNP denotes C/EBP
T21413 42396-42399 DT denotes the
T21412 42387-42395 VBN denotes required
T21411 42376-42386 RB denotes absolutely
T21410 42361-42375 VBZ denotes responsiveness
T21409 42357-42360 NNP denotes LPS
T21408 42355-42356 . denotes .
T21407 42352-42355 CD denotes 539
T21406 42351-42352 CD denotes −
T21405 42347-42350 CC denotes and
T21404 42343-42346 CD denotes 189
T21403 42342-42343 VBP denotes −
T21402 42330-42341 NNS denotes nucleotides
T21401 42322-42329 IN denotes between
T21400 42315-42321 NN denotes region
T21399 42311-42314 DT denotes the
T21398 42308-42310 IN denotes in
T21397 42298-42307 NNS denotes sequences
T21396 42287-42297 JJ denotes regulatory
T21395 42276-42286 JJ denotes cis-acting
T21394 42271-42275 IN denotes upon
T21393 42261-42270 JJ denotes dependent
T21392 42258-42260 VBZ denotes is
T21391 42249-42257 NN denotes response
T21390 42235-42248 JJ denotes LPS-inducible
T21389 42231-42234 DT denotes the
T21388 42228-42230 IN denotes of
T21387 42223-42227 JJS denotes most
T21386 42221-42222 , denotes ,
T21385 42216-42221 NNS denotes sites
T21384 42210-42215 DT denotes these
T21383 42199-42209 VBG denotes containing
T21382 42190-42198 NN denotes promoter
T21381 42181-42189 NNP denotes SerpinB2
T21380 42174-42180 NN denotes murine
T21379 42170-42173 DT denotes the
T21378 42167-42169 IN denotes of
T21377 42159-42166 NNS denotes regions
T21376 42156-42158 IN denotes by
T21375 42146-42155 VBN denotes conferred
T21374 42137-42145 NN denotes activity
T21373 42121-42136 JJ denotes transcriptional
T21372 42109-42120 JJ denotes PMA-induced
T21371 42106-42108 IN denotes in
T21370 42096-42105 NNS denotes increases
T21369 42084-42095 JJ denotes incremental
T21368 42081-42083 IN denotes of
T21367 42073-42080 NN denotes pattern
T21366 42069-42072 DT denotes the
T21365 42066-42068 TO denotes to
T21364 42057-42065 NN denotes contrast
T21363 42054-42056 IN denotes In
T21362 42052-42053 . denotes .
T21361 42048-42052 NN denotes gene
T21360 42039-42047 NNP denotes SerpinB2
T21359 42032-42038 NN denotes murine
T21358 42028-42031 DT denotes the
T21357 42025-42027 IN denotes of
T21356 42011-42024 NN denotes transcription
T21355 41997-42010 JJ denotes PMA-inducible
T21354 41987-41996 VBG denotes mediating
T21353 41984-41986 IN denotes in
T21352 41979-41983 NN denotes role
T21351 41977-41978 DT denotes a
T21350 41972-41976 VB denotes play
T21349 41967-41971 RB denotes also
T21348 41957-41966 RB denotes therefore
T21347 41953-41956 MD denotes may
T21346 41947-41952 NNS denotes sites
T21345 41941-41946 DT denotes These
T21344 41939-41940 . denotes .
T21343 41937-41939 CD denotes 87
T21342 41936-41937 CD denotes −
T21341 41932-41935 CC denotes and
T21340 41928-41931 CD denotes 189
T21339 41927-41928 VBP denotes −
T21338 41915-41926 NNS denotes nucleotides
T21337 41907-41914 IN denotes between
T21336 41898-41906 NN denotes promoter
T21335 41889-41897 JJ denotes proximal
T21334 41880-41888 NNP denotes SerpinB2
T21333 41873-41879 NN denotes murine
T21332 41869-41872 DT denotes the
T21331 41866-41868 IN denotes in
T21330 41858-41865 JJ denotes present
T21329 41854-41857 VBP denotes are
T21328 41849-41853 RB denotes also
T21327 41847-41848 , denotes ,
T21326 41846-41847 NNP denotes ]
T21325 41844-41846 CD denotes 37
T21324 41843-41844 NNP denotes [
T21323 41838-41842 NN denotes gene
T21322 41829-41837 NNP denotes SERPINB2
T21321 41823-41828 JJ denotes human
T21320 41819-41822 DT denotes the
T21319 41816-41818 IN denotes of
T21318 41802-41815 NN denotes transcription
T21317 41787-41801 JJ denotes PMA-stimulated
T21316 41779-41786 VB denotes mediate
T21315 41776-41778 TO denotes to
T21314 41763-41775 VBD denotes demonstrated
T21313 41761-41762 , denotes ,
T21312 41753-41761 NNS denotes elements
T21311 41743-41752 JJ denotes AP-1-like
T21310 41739-41742 CD denotes two
T21309 41735-41738 CC denotes and
T21308 41731-41734 NNP denotes CRE
T21307 41729-41730 DT denotes a
T21306 41724-41728 IN denotes that
T21305 41718-41723 VBZ denotes shows
T21304 41709-41717 NN denotes sequence
T21303 41700-41708 NN denotes promoter
T21302 41691-41699 JJ denotes proximal
T21301 41682-41690 NNP denotes SerpinB2
T21300 41675-41681 NN denotes murine
T21299 41671-41674 DT denotes the
T21298 41668-41670 IN denotes of
T21297 41657-41667 NNP denotes Inspection
T21296 41655-41656 . denotes .
T21295 41652-41655 NNP denotes LPS
T21294 41649-41651 IN denotes by
T21293 41644-41648 DT denotes that
T21292 41639-41643 IN denotes than
T21291 41629-41638 JJ denotes transient
T21290 41624-41628 RBR denotes more
T21289 41620-41623 CC denotes and
T21288 41612-41619 JJ denotes intense
T21287 41607-41611 JJR denotes less
T21286 41601-41606 VBG denotes being
T21285 41597-41600 NNP denotes PMA
T21284 41594-41596 IN denotes by
T21283 41584-41593 NN denotes induction
T21282 41579-41583 IN denotes with
T21281 41577-41578 , denotes ,
T21280 41564-41577 NN denotes transcription
T21279 41559-41563 NN denotes gene
T21278 41545-41558 JJ denotes LPS-inducible
T21277 41541-41544 CC denotes and
T21276 41539-41540 : denotes -
T21275 41536-41539 NNP denotes PMA
T21274 41531-41535 DT denotes both
T21273 41522-41530 VBN denotes mediated
T21272 41518-41521 CD denotes +92
T21271 41514-41517 CC denotes and
T21270 41509-41513 CD denotes -539
T21269 41497-41508 NNS denotes nucleotides
T21268 41489-41496 IN denotes between
T21267 41482-41488 NN denotes region
T21266 41473-41481 NN denotes promoter
T21265 41464-41472 JJ denotes proximal
T21264 41455-41463 NNP denotes SerpinB2
T21263 41448-41454 NN denotes murine
T21262 41444-41447 DT denotes The
T21261 41442-41443 . denotes .
T21260 41439-41442 NNP denotes LPS
T21259 41436-41438 TO denotes to
T21258 41427-41435 NN denotes response
T21257 41423-41426 DT denotes the
T21256 41419-41422 CC denotes and
T21255 41405-41418 NN denotes transcription
T21254 41400-41404 NN denotes gene
T21253 41391-41399 NNP denotes SerpinB2
T21252 41378-41390 JJ denotes constitutive
T21251 41368-41377 VBZ denotes abrogates
T21823 44560-44562 CD denotes 16
T21822 44559-44560 NNP denotes [
T21821 44550-44558 NNP denotes SerpinB2
T21820 44547-44549 TO denotes to
T21819 44536-44546 VBN denotes attributed
T21818 44531-44535 VBN denotes been
T21817 44526-44530 RB denotes also
T21816 44522-44525 VBZ denotes has
T21815 44517-44521 WDT denotes that
T21814 44508-44516 NN denotes activity
T21813 44505-44507 DT denotes an
T21812 44503-44504 , denotes ,
T21811 44502-44503 NNP denotes ]
T21810 44500-44502 CD denotes 65
T21809 44499-44500 NNP denotes [
T21808 44497-44498 -RRB- denotes )
T21807 44495-44497 NNP denotes LT
T21806 44494-44495 -LRB- denotes (
T21805 44488-44493 NN denotes toxin
T21804 44481-44487 JJ denotes lethal
T21803 44471-44480 NNS denotes anthracis
T21802 44462-44470 NN denotes Bacillus
T21801 44459-44461 IN denotes by
T21800 44451-44458 VBN denotes induced
T21799 44441-44450 NN denotes apoptosis
T21798 44436-44440 IN denotes from
T21797 44424-44435 NNS denotes macrophages
T21796 44417-44423 VB denotes rescue
T21795 44414-44416 TO denotes to
T21794 44405-44413 VBN denotes reported
T21793 44400-44404 VBN denotes been
T21792 44396-44399 VBZ denotes has
T21791 44391-44395 NNP denotes T217
T21790 44388-44390 IN denotes on
T21789 44373-44387 VBN denotes phosphorylated
T21788 44371-44372 NN denotes β
T21787 44370-44371 : denotes -
T21786 44365-44370 SYM denotes C/EBP
T21785 44363-44364 . denotes .
T21784 44361-44362 : denotes ;
T21783 44360-44361 NNP denotes ]
T21782 44358-44360 CD denotes 63
T21781 44357-44358 NNP denotes [
T21780 44351-44356 NNS denotes genes
T21779 44344-44350 NN denotes target
T21778 44340-44343 PRP$ denotes its
T21777 44337-44339 IN denotes of
T21776 44321-44336 NN denotes transactivation
T21775 44312-44320 VB denotes modulate
T21774 44309-44311 TO denotes to
T21773 44303-44308 VBN denotes shown
T21772 44298-44302 VBN denotes been
T21771 44294-44297 VBZ denotes has
T21770 44285-44293 NNS denotes residues
T21769 44280-44284 NN denotes acid
T21768 44274-44279 JJ denotes amino
T21767 44264-44273 JJ denotes different
T21766 44256-44263 JJ denotes several
T21765 44253-44255 IN denotes at
T21764 44251-44252 NN denotes β
T21763 44250-44251 : denotes -
T21762 44245-44250 NNP denotes C/EBP
T21761 44242-44244 IN denotes of
T21760 44226-44241 NNP denotes Phosphorylation
T21759 44224-44225 . denotes .
T21758 44212-44224 NN denotes inflammation
T21757 44209-44211 IN denotes in
T21756 44204-44208 NN denotes role
T21755 44193-44203 JJ denotes functional
T21754 44189-44192 PRP$ denotes its
T21753 44184-44188 IN denotes with
T21752 44173-44183 JJ denotes consistent
T21751 44170-44172 VBZ denotes is
T21750 44168-44169 NN denotes β
T21749 44167-44168 : denotes -
T21748 44162-44167 NNP denotes C/EBP
T21747 44159-44161 IN denotes by
T21746 44148-44158 NN denotes expression
T21745 44143-44147 NN denotes gene
T21744 44134-44142 NNP denotes SerpinB2
T21743 44131-44133 IN denotes of
T21742 44120-44130 NN denotes regulation
T21741 44116-44119 DT denotes the
T21740 44111-44115 RB denotes Thus
T21739 44109-44110 . denotes .
T21738 44108-44109 NNP denotes ]
T21737 44106-44108 CD denotes 25
T21736 44105-44106 NNP denotes [
T21735 44103-44104 : denotes ;
T21734 44102-44103 NNP denotes ]
T21733 44100-44102 CD denotes 16
T21732 44099-44100 NNP denotes [
T21731 44097-44098 NNP denotes ]
T21250 41366-41367 NN denotes β
T21249 41365-41366 : denotes -
T21248 41360-41365 NNP denotes C/EBP
T21247 41357-41359 IN denotes of
T21246 41352-41356 NN denotes loss
T21245 41348-41351 CC denotes and
T21244 41346-41347 , denotes ,
T21243 41342-41346 NN denotes vivo
T21242 41339-41341 IN denotes in
T21241 41335-41338 CC denotes and
T21240 41329-41334 NN denotes vitro
T21239 41326-41328 IN denotes in
T21238 41317-41325 NN denotes promoter
T21237 41308-41316 JJ denotes proximal
T21236 41299-41307 NNP denotes SerpinB2
T21235 41295-41298 DT denotes the
T21234 41292-41294 IN denotes in
T21233 41284-41291 NN denotes element
T21232 41275-41283 NN denotes response
T21231 41269-41274 NNP denotes C/EBP
T21230 41265-41268 DT denotes the
T21229 41260-41264 NN denotes bind
T21228 41247-41259 RB denotes specifically
T21227 41244-41246 TO denotes to
T21226 41238-41243 VBN denotes shown
T21225 41234-41237 VBD denotes was
T21170 40931-40939 CD denotes SerpinB2
T21169 40929-40930 . denotes .
T21168 40921-40929 NNP denotes SerpinB2
T21167 40914-40920 NN denotes factor
T21166 40901-40913 JJ denotes pro-survival
T21165 40897-40900 DT denotes the
T21164 40894-40896 IN denotes of
T21163 40884-40893 NN denotes induction
T21162 40876-40883 JJ denotes massive
T21161 40867-40875 VBZ denotes involves
T21160 40861-40866 WDT denotes which
T21159 40852-40860 NN denotes response
T21158 40836-40851 JJ denotes anti-pathogenic
T21157 40833-40835 DT denotes an
T21156 40827-40832 VB denotes mount
T21155 40824-40826 TO denotes to
T21154 40812-40823 NNS denotes macrophages
T21153 40802-40811 VBP denotes stimulate
T21152 40800-40801 , denotes ,
T21151 40797-40800 NNP denotes LPS
T21150 40787-40796 NN denotes endotoxin
T21149 40777-40786 JJ denotes bacterial
T21148 40773-40776 DT denotes the
T21147 40770-40772 IN denotes as
T21146 40765-40769 JJ denotes such
T21145 40763-40764 , denotes ,
T21144 40756-40763 NNS denotes stimuli
T21143 40739-40755 JJ denotes Pro-inflammatory
T21142 40737-40738 . denotes .
T21141 40728-40737 NNS denotes pathogens
T21140 40720-40727 IN denotes against
T21139 40712-40719 NN denotes defense
T21138 40709-40711 IN denotes of
T21137 40704-40708 NN denotes line
T21136 40698-40703 JJ denotes first
T21135 40694-40697 DT denotes the
T21134 40686-40693 VB denotes provide
T21133 40673-40685 RB denotes consequently
T21132 40669-40672 CC denotes and
T21131 40667-40668 , denotes ,
T21130 40659-40667 NN denotes response
T21129 40652-40658 JJ denotes immune
T21128 40645-40651 NN denotes innate
T21127 40641-40644 DT denotes the
T21126 40638-40640 IN denotes of
T21125 40628-40637 NNS denotes mediators
T21124 40624-40627 JJ denotes key
T21123 40620-40623 VBP denotes are
T21122 40608-40619 NNS denotes Macrophages
T21514 42894-42895 NNP denotes ]
T21513 42892-42894 CD denotes 67
T21512 42891-42892 NNP denotes [
T21511 42886-42890 NN denotes gene
T21510 42884-42885 NN denotes β
T21509 42883-42884 : denotes -
T21508 42878-42883 NNP denotes C/EBP
T21507 42874-42877 DT denotes the
T21506 42871-42873 IN denotes of
T21505 42857-42870 NN denotes transcription
T21504 42849-42856 VB denotes control
T21503 42846-42848 TO denotes to
T21502 42840-42845 VBN denotes shown
T21501 42835-42839 VBN denotes been
T21500 42831-42834 VBZ denotes has
T21499 42826-42830 NNP denotes CREB
T21498 42824-42825 , denotes ,
T21497 42812-42824 RB denotes Additionally
T21496 42810-42811 . denotes .
T21495 42809-42810 NNP denotes ]
T21494 42807-42809 CD denotes 66
T21493 42806-42807 NNP denotes [
T21492 42804-42805 : denotes ;
T21491 42803-42804 NNP denotes ]
T21490 42801-42803 CD denotes 63
T21489 42800-42801 NNP denotes [
T21488 42790-42799 NNS denotes mediators
T21487 42777-42789 JJ denotes inflammatory
T21486 42774-42776 IN denotes of
T21485 42763-42773 NN denotes expression
T21484 42758-42762 NN denotes gene
T21483 42750-42757 VB denotes promote
T21482 42747-42749 TO denotes to
T21481 42741-42746 NNP denotes NF-κB
T21480 42737-42740 CC denotes and
T21479 42735-42736 , denotes ,
T21478 42731-42735 NNP denotes AP-1
T21477 42726-42730 IN denotes with
T21476 42717-42725 VB denotes interact
T21475 42706-42716 RB denotes physically
T21474 42703-42705 TO denotes to
T21473 42694-42702 VBN denotes reported
T21472 42689-42693 VBN denotes been
T21471 42685-42688 VBZ denotes has
T21470 42683-42684 NN denotes β
T21469 42682-42683 : denotes -
T21468 42677-42682 NNP denotes C/EBP
T21467 42673-42676 CC denotes and
T21466 42671-42672 , denotes ,
T21465 42670-42671 NNP denotes ]
T21464 42668-42670 CD denotes 63
T21463 42667-42668 NNP denotes [
T21462 42662-42666 NNP denotes AP-1
T21461 42658-42661 CC denotes and
T21460 42656-42657 -RRB- denotes )
T21459 42652-42656 NNP denotes CREB
T21458 42651-42652 -LRB- denotes (
T21457 42642-42650 NNS denotes proteins
T21456 42634-42641 JJ denotes binding
T21455 42630-42633 NNP denotes CRE
T21454 42626-42629 CC denotes and
T21453 42624-42625 NN denotes β
T21452 42623-42624 : denotes -
T21451 42618-42623 NNP denotes C/EBP
T21450 42610-42617 IN denotes between
T21449 42597-42609 NNS denotes interactions
T21448 42583-42596 JJ denotes combinatorial
T21447 42580-42582 IN denotes of
T21446 42572-42579 NNS denotes reports
T21445 42563-42571 JJ denotes previous
T21444 42559-42562 VBP denotes are
T21443 42553-42558 EX denotes there
T21442 42551-42552 , denotes ,
T21441 42547-42551 NN denotes note
T21224 41232-41233 NN denotes β
T21223 41231-41232 : denotes -
T21222 41226-41231 NNP denotes C/EBP
T21221 41214-41225 JJ denotes LPS-induced
T21220 41212-41213 . denotes .
T21219 41211-41212 NN denotes β
T21218 41210-41211 : denotes -
T21217 41205-41210 NNP denotes C/EBP
T21216 41200-41204 IN denotes upon
T21215 41190-41199 JJ denotes dependent
T21214 41182-41189 RB denotes greatly
T21213 41179-41181 VBZ denotes is
T21212 41175-41178 CC denotes and
T21211 41166-41174 NN denotes promoter
T21210 41157-41165 JJ denotes proximal
T21209 41148-41156 NNP denotes SerpinB2
T21208 41144-41147 DT denotes the
T21207 41141-41143 IN denotes by
T21206 41131-41140 VBN denotes conferred
T21205 41128-41130 VBZ denotes is
T21204 41124-41127 NNP denotes LPS
T21203 41121-41123 TO denotes to
T21202 41112-41120 NN denotes response
T21201 41109-41111 IN denotes in
T21200 41095-41108 NN denotes transcription
T21199 41090-41094 NN denotes gene
T21198 41081-41089 CD denotes SerpinB2
T21197 41076-41080 IN denotes that
T21196 41069-41075 VBP denotes report
T21195 41066-41068 PRP denotes we
T21194 41061-41065 RB denotes Here
T21193 41059-41060 . denotes .
T21192 41058-41059 NNP denotes ]
T21191 41056-41058 CD denotes 16
T21190 41055-41056 NNP denotes [
T21189 41051-41054 NNP denotes LPS
T21188 41048-41050 TO denotes to
T21187 41039-41047 NN denotes response
T21186 41036-41038 IN denotes in
T21185 41028-41035 NNS denotes modules
T21184 41018-41027 VBG denotes signaling
T21183 41010-41017 NNP denotes p38MAPK
T21182 41006-41009 CC denotes and
T21181 41000-41005 NNP denotes NF-κB
T21180 40999-41000 NNP denotes /
T21179 40995-40999 NNP denotes IKKβ
T21178 40991-40994 DT denotes the
T21177 40983-40990 IN denotes between
T21176 40978-40982 NN denotes talk
T21175 40972-40977 NN denotes cross
T21174 40969-40971 IN denotes by
T21173 40961-40968 VBN denotes induced
T21172 40943-40960 RB denotes transcriptionally
T21171 40940-40942 VBZ denotes is
T17689 38593-38597 WDT denotes that
T17688 38587-38592 NNS denotes sites
T17687 38571-38586 NN denotes phosphorylation
T17686 38569-38570 NN denotes β
T17685 38568-38569 : denotes -
T17684 38563-38568 NNP denotes C/EBP
T17683 38551-38562 VB denotes investigate
T17682 38548-38550 TO denotes To
T17681 38546-38547 . denotes .
T17680 38545-38546 NNP denotes ]
T17679 38543-38545 CD denotes 63
T17678 38542-38543 NNP denotes [
T17677 38532-38541 JJ denotes potential
T17676 38516-38531 NN denotes transactivation
T17675 38512-38515 PRP$ denotes its
T17674 38503-38511 VB denotes modulate
T17673 38500-38502 TO denotes to
T17672 38489-38499 VBN denotes recognized
T17671 38484-38488 RB denotes well
T17670 38481-38483 VBZ denotes is
T17669 38479-38480 NN denotes β
T17668 38478-38479 : denotes -
T17667 38473-38478 NNP denotes C/EBP
T17666 38470-38472 IN denotes of
T17665 38454-38469 NNP denotes Phosphorylation
T17664 38445-38453 NNP denotes Activity
T17663 38436-38444 NNP denotes Promoter
T17662 38427-38435 NNP denotes SerpinB2
T17661 38412-38426 JJ denotes LPS-stimulated
T17660 38402-38411 VBZ denotes Regulates
T17659 38391-38401 RB denotes negatively
T17658 38388-38390 CD denotes 64
T17657 38381-38387 NNP denotes Serine
T17656 38378-38380 IN denotes at
T17655 38376-38377 NN denotes β
T17654 38375-38376 : denotes -
T17653 38370-38375 NNP denotes C/EBP
T17652 38367-38369 IN denotes of
T17651 38351-38366 NNP denotes Phosphorylation
T17879 39592-39602 VBG denotes modulating
T17878 39589-39591 IN denotes in
T17877 39580-39588 VBN denotes involved
T17876 39577-39579 VB denotes be
T17875 39573-39576 MD denotes may
T17874 39567-39572 WDT denotes which
T17873 39565-39566 , denotes ,
T17872 39564-39565 -RRB- denotes )
T17871 39562-39564 NNP denotes 8B
T17870 39557-39561 NNP denotes Fig.
T17869 39556-39557 -LRB- denotes (
T17868 39551-39555 NNP denotes βS64
T17867 39550-39551 : denotes -
T17866 39545-39550 NNP denotes C/EBP
T17865 39541-39544 CC denotes and
T17864 39535-39540 NNP denotes βT188
T17863 39534-39535 : denotes -
T17862 39529-39534 NNP denotes C/EBP
T17861 39527-39528 , denotes ,
T17860 39522-39527 NNS denotes sites
T17859 39506-39521 NN denotes phosphorylation
T17858 39495-39505 JJ denotes additional
T17857 39486-39494 VBZ denotes contains
T17856 39484-39485 NN denotes β
T17855 39483-39484 : denotes -
T17854 39478-39483 SYM denotes C/EBP
T17853 39476-39477 . denotes .
T17852 39473-39476 NNP denotes LPS
T17851 39470-39472 TO denotes to
T17850 39461-39469 NN denotes response
T17849 39458-39460 IN denotes in
T17848 39449-39457 NN denotes activity
T17847 39440-39448 NN denotes promoter
T17846 39431-39439 NNP denotes SerpinB2
T17845 39428-39430 IN denotes of
T17844 39417-39427 NN denotes regulation
T17843 39413-39416 DT denotes the
T17842 39410-39412 IN denotes in
T17841 39403-39409 NN denotes factor
T17840 39397-39402 JJ denotes major
T17839 39395-39396 DT denotes a
T17838 39391-39394 RB denotes not
T17837 39388-39390 VBZ denotes is
T17836 39383-39387 CD denotes T217
T17835 39380-39382 IN denotes at
T17834 39378-39379 NN denotes β
T17833 39377-39378 : denotes -
T17832 39372-39377 NNP denotes C/EBP
T17831 39369-39371 IN denotes of
T17830 39353-39368 NN denotes phosphorylation
T17829 39348-39352 IN denotes that
T17828 39337-39347 VBG denotes confirming
T17827 39335-39336 : denotes ;
T17826 39334-39335 -RRB- denotes )
T17825 39329-39334 NN denotes right
T17824 39327-39328 , denotes ,
T17823 39325-39327 NNP denotes 8C
T17822 39320-39324 NNP denotes Fig.
T17821 39319-39320 -LRB- denotes (
T17820 39317-39318 NN denotes β
T17819 39316-39317 : denotes -
T17818 39311-39316 NNP denotes C/EBP
T17817 39301-39310 JJ denotes wild-type
T17816 39298-39300 IN denotes of
T17815 39293-39297 DT denotes that
T17814 39287-39292 IN denotes above
T17813 39278-39286 NN denotes activity
T17812 39269-39277 NN denotes promoter
T17811 39260-39268 JJ denotes SerpinB2
T17810 39251-39259 VB denotes increase
T17809 39237-39250 RB denotes significantly
T17808 39233-39236 RB denotes not
T17807 39229-39232 VBD denotes did
T17806 39224-39228 NNS denotes MEFs
T17805 39222-39223 CD denotes −
T17804 39221-39222 VBD denotes /
T17803 39220-39221 NNP denotes −
T17802 39215-39220 NNP denotes Cebpb
T17801 39212-39214 IN denotes in
T17800 39210-39211 , denotes ,
T17799 39204-39210 NNP denotes βT217A
T17798 39199-39204 NNP denotes C/EBP
T17797 39197-39198 , denotes ,
T17796 39191-39197 JJ denotes mutant
T17795 39174-39190 NN denotes phospho-acceptor
T17794 39172-39173 NN denotes β
T17793 39171-39172 : denotes -
T17792 39166-39171 NNP denotes C/EBP
T17791 39162-39165 DT denotes the
T17790 39159-39161 IN denotes of
T17789 39148-39158 NN denotes Expression
T17788 39146-39147 . denotes .
T17787 39133-39146 NN denotes transcription
T17786 39128-39132 NN denotes gene
T17785 39119-39127 NNP denotes SerpinB2
T17784 39107-39118 JJ denotes LPS-induced
T17783 39104-39106 TO denotes to
T17782 39102-39103 NN denotes β
T17781 39101-39102 : denotes -
T17780 39096-39101 NNP denotes C/EBP
T17779 39093-39095 IN denotes of
T17778 39082-39092 NN denotes importance
T17777 39078-39081 DT denotes the
T17776 39067-39077 VBG denotes confirming
T17775 39065-39066 , denotes ,
T17774 39064-39065 -RRB- denotes )
T17773 39060-39064 VBD denotes left
T17772 39058-39059 , denotes ,
T17771 39056-39058 NNP denotes 8C
T17770 39051-39055 NNP denotes Fig.
T17769 39050-39051 -LRB- denotes (
T17768 39045-39049 VBP denotes fold
T17767 39043-39044 CD denotes 3
T17766 39042-39043 NN denotes ∼
T17765 39039-39041 IN denotes by
T17764 39035-39038 NNP denotes LPS
T17763 39032-39034 IN denotes of
T17762 39023-39031 NN denotes presence
T17761 39019-39022 DT denotes the
T17760 39016-39018 IN denotes in
T17759 39005-39015 NN denotes expression
T17758 39000-39004 NN denotes gene
T17757 38991-38999 NN denotes reporter
T17756 38980-38990 NN denotes luciferase
T17755 38971-38979 NNP denotes SerpinB2
T17754 38960-38970 VBD denotes stimulated
T17753 38946-38959 RB denotes significantly
T17752 38941-38945 NNS denotes MEFs
T17751 38939-38940 CD denotes −
T17750 38938-38939 VBD denotes /
T17749 38937-38938 NNP denotes −
T17748 38932-38937 NNP denotes Cebpb
T17747 38929-38931 IN denotes in
T17746 38927-38928 NN denotes β
T17745 38926-38927 : denotes -
T17744 38921-38926 NNP denotes C/EBP
T17743 38911-38920 JJ denotes wild-type
T17742 38908-38910 IN denotes of
T17741 38894-38907 NN denotes Re-expression
T17740 38892-38893 . denotes .
T17739 38888-38892 NNS denotes MEFs
T17738 38886-38887 CD denotes −
T17737 38885-38886 VBD denotes /
T17736 38884-38885 NNP denotes −
T17735 38879-38884 NNP denotes Cebpb
T17734 38876-38878 IN denotes in
T17733 38867-38875 NN denotes reporter
T17732 38856-38866 NN denotes luciferase
T17731 38847-38855 NNP denotes SerpinB2
T17730 38840-38846 NN denotes murine
T17729 38830-38839 JJ denotes pGLmP-539
T17728 38826-38829 DT denotes the
T17727 38821-38825 IN denotes with
T17726 38815-38820 IN denotes along
T17725 38813-38814 , denotes ,
T17724 38806-38813 NN denotes alanine
T17723 38803-38805 DT denotes an
T17722 38800-38802 TO denotes to
T17721 38792-38799 VBN denotes mutated
T17720 38788-38791 VBD denotes was
T17719 38780-38787 NN denotes residue
T17718 38773-38779 NN denotes serine
T17717 38770-38772 CC denotes or
T17716 38760-38769 NN denotes threonine
T17715 38751-38759 JJ denotes critical
T17714 38747-38750 DT denotes the
T17713 38741-38746 WDT denotes which
T17712 38738-38740 IN denotes in
T17711 38730-38737 NNS denotes mutants
T17710 38713-38729 NN denotes phospho-acceptor
T17709 38711-38712 NN denotes β
T17708 38710-38711 : denotes -
T17707 38705-38710 NNP denotes C/EBP
T17706 38697-38704 JJ denotes several
T17705 38684-38696 VBD denotes co-expressed
T17704 38681-38683 PRP denotes we
T17703 38679-38680 , denotes ,
T17702 38678-38679 -RRB- denotes )
T17701 38676-38678 NNP denotes 8B
T17700 38671-38675 NNP denotes Fig.
T17699 38670-38671 -LRB- denotes (
T17698 38661-38669 NN denotes activity
T17697 38652-38660 NN denotes promoter
T17696 38643-38651 JJ denotes proximal
T17695 38634-38642 JJ denotes SerpinB2
T17694 38619-38633 JJ denotes LPS-stimulated
T17693 38615-38618 IN denotes for
T17692 38605-38614 JJ denotes important
T17691 38602-38604 VB denotes be
T17690 38598-38601 MD denotes may
T17982 40163-40168 DT denotes these
T17981 40155-40162 IN denotes whether
T17980 40142-40154 VBD denotes investigated
T17979 40139-40141 PRP denotes we
T17978 40137-40138 , denotes ,
T17977 40129-40137 NNP denotes SerpinB2
T17976 40125-40128 CC denotes and
T17975 40123-40124 NN denotes β
T17974 40122-40123 : denotes -
T17973 40117-40122 NNP denotes C/EBP
T17972 40114-40116 IN denotes of
T17971 40105-40113 NNS denotes isoforms
T17970 40088-40104 JJ denotes phospho-specific
T17969 40082-40087 DT denotes these
T17968 40079-40081 IN denotes of
T17967 40066-40078 NN denotes significance
T17966 40055-40065 JJ denotes functional
T17965 40051-40054 DT denotes the
T17964 40048-40050 IN denotes in
T17963 40035-40047 NNS denotes similarities
T17962 40031-40034 DT denotes the
T17961 40025-40030 VBN denotes Given
T17960 40023-40024 . denotes .
T17959 40022-40023 NNP denotes ]
T17958 40020-40022 CD denotes 29
T17957 40019-40020 NNP denotes [
T17956 40009-40018 NNS denotes cytokines
T17955 40006-40008 TO denotes to
T17954 39998-40005 JJ denotes similar
T17953 39991-39997 NN denotes manner
T17952 39989-39990 DT denotes a
T17951 39986-39988 IN denotes in
T17950 39976-39985 VBN denotes regulated
T17949 39972-39975 CC denotes and
T17948 39968-39971 NNP denotes LPS
T17947 39965-39967 IN denotes by
T17946 39957-39964 VBN denotes induced
T17945 39954-39956 VBZ denotes is
T17944 39945-39953 NNP denotes SerpinB2
T17943 39943-39944 , denotes ,
T17942 39934-39943 RB denotes Similarly
T17941 39932-39933 . denotes .
T17940 39931-39932 NNP denotes ]
T17939 39929-39931 CD denotes 64
T17938 39928-39929 NNP denotes [
T17937 39922-39927 NNP denotes MCP-1
T17936 39918-39921 CC denotes and
T17935 39913-39917 NNP denotes IL-6
T17934 39903-39912 NNS denotes cytokines
T17933 39899-39902 DT denotes the
T17932 39896-39898 IN denotes of
T17931 39882-39895 NN denotes transcription
T17930 39870-39881 JJ denotes LPS-induced
T17929 39866-39869 IN denotes for
T17928 39856-39865 JJ denotes important
T17927 39853-39855 VBZ denotes is
T17926 39848-39852 NN denotes βS64
T17925 39847-39848 : denotes -
T17924 39842-39847 SYM denotes C/EBP
T17923 39840-39841 . denotes .
T17922 39839-39840 NNP denotes ]
T17921 39837-39839 CD denotes 17
T17920 39836-39837 NNP denotes [
T17919 39825-39835 VBN denotes associated
T17918 39820-39824 VBN denotes been
T17917 39815-39819 RB denotes also
T17916 39811-39814 VBZ denotes has
T17915 39802-39810 NNP denotes SerpinB2
T17914 39796-39801 WDT denotes which
T17913 39791-39795 IN denotes with
T17912 39781-39790 VBZ denotes processes
T17911 39779-39780 , denotes ,
T17910 39778-39779 NNP denotes ]
T17909 39776-39778 CD denotes 38
T17908 39775-39776 NNP denotes [
T17907 39765-39774 NN denotes apoptosis
T17906 39761-39764 CC denotes and
T17905 39755-39760 NN denotes cycle
T17904 39750-39754 NN denotes cell
T17903 39747-39749 IN denotes of
T17902 39736-39746 NN denotes regulation
T17901 39732-39735 DT denotes the
T17900 39729-39731 IN denotes in
T17899 39720-39728 VBN denotes involved
T17898 39715-39719 NN denotes gene
T17897 39700-39714 JJ denotes IFNγ-inducible
T17896 39697-39699 DT denotes an
T17895 39695-39696 , denotes ,
T17894 39690-39695 NNP denotes DAPK1
T17893 39679-39689 VBG denotes regulating
T17892 39676-39678 IN denotes in
T17891 39665-39675 VBN denotes implicated
T17890 39662-39664 VBZ denotes is
T17889 39656-39661 NN denotes βT188
T17888 39655-39656 : denotes -
T17887 39650-39655 SYM denotes C/EBP
T17886 39648-39649 . denotes .
T17885 39635-39648 NN denotes transcription
T17884 39630-39634 NN denotes gene
T17883 39621-39629 JJ denotes SerpinB2
T17882 39609-39620 JJ denotes β-dependent
T17881 39608-39609 : denotes -
T17880 39603-39608 NNP denotes C/EBP
T18053 40594-40595 . denotes .
T18052 40586-40594 NN denotes activity
T18051 40577-40585 NN denotes promoter
T18050 40568-40576 JJ denotes proximal
T18049 40559-40567 NNP denotes SerpinB2
T18048 40550-40558 VB denotes regulate
T18047 40539-40549 RB denotes negatively
T18046 40536-40538 TO denotes to
T18045 40531-40535 NNS denotes acts
T18044 40527-40530 CD denotes S64
T18043 40524-40526 IN denotes at
T18042 40522-40523 NN denotes β
T18041 40521-40522 : denotes -
T18040 40516-40521 NNP denotes C/EBP
T18039 40513-40515 IN denotes of
T18038 40497-40512 NN denotes phosphorylation
T18037 40492-40496 IN denotes that
T18036 40484-40491 VBP denotes suggest
T18035 40479-40483 NNS denotes data
T18034 40473-40478 DT denotes These
T18033 40471-40472 . denotes .
T18032 40470-40471 -RRB- denotes )
T18031 40465-40470 NN denotes right
T18030 40463-40464 , denotes ,
T18029 40461-40463 NNP denotes 8C
T18028 40456-40460 NNP denotes Fig.
T18027 40455-40456 -LRB- denotes (
T18026 40451-40454 NNP denotes LPS
T18025 40448-40450 TO denotes to
T18024 40439-40447 NN denotes response
T18023 40436-40438 IN denotes in
T18022 40427-40435 NN denotes activity
T18021 40418-40426 NN denotes promoter
T18020 40409-40417 CD denotes SerpinB2
T18019 40397-40408 VBD denotes potentiated
T18018 40391-40396 NNP denotes βS64A
T18017 40390-40391 : denotes -
T18016 40385-40390 NNP denotes C/EBP
T18015 40382-40384 IN denotes of
T18014 40371-40381 NN denotes expression
T18013 40367-40370 DT denotes the
T18012 40359-40366 IN denotes whereas
T18011 40357-40358 , denotes ,
T18010 40353-40357 NNS denotes MEFs
T18009 40339-40352 JJ denotes β-transfected
T18008 40338-40339 : denotes -
T18007 40333-40338 NNP denotes C/EBP
T18006 40323-40332 JJ denotes wild-type
T18005 40320-40322 IN denotes of
T18004 40315-40319 DT denotes that
T18003 40312-40314 TO denotes to
T18002 40304-40311 JJ denotes similar
T18001 40295-40303 NN denotes activity
T18000 40286-40294 NN denotes promoter
T17999 40277-40285 CD denotes SerpinB2
T17998 40267-40276 VBD denotes exhibited
T17997 40262-40266 NNS denotes MEFs
T17996 40243-40261 JJ denotes βT188A-transfected
T17995 40242-40243 : denotes -
T17994 40237-40242 SYM denotes C/EBP
T17993 40235-40236 . denotes .
T17992 40225-40235 NN denotes expression
T17991 40220-40224 NN denotes gene
T17990 40211-40219 NNP denotes SerpinB2
T17989 40208-40210 IN denotes in
T17988 40203-40207 NN denotes role
T17987 40201-40202 DT denotes a
T17986 40196-40200 VB denotes play
T17985 40192-40195 MD denotes may
T17984 40186-40191 NNS denotes sites
T17983 40169-40185 JJ denotes phospho-acceptor
T16214 36706-36715 VBN denotes increased
T16213 36692-36705 RB denotes significantly
T16212 36688-36691 VBD denotes was
T16211 36679-36687 NN denotes activity
T16210 36670-36678 NN denotes promoter
T16209 36661-36669 JJ denotes SerpinB2
T16208 36646-36660 JJ denotes LPS-stimulated
T16207 36641-36645 IN denotes that
T16206 36635-36640 VBD denotes found
T16205 36632-36634 PRP denotes We
T16204 36630-36631 . denotes .
T16203 36626-36630 NNS denotes MEFs
T16202 36624-36625 CD denotes −
T16201 36623-36624 CD denotes /
T16200 36622-36623 VBP denotes −
T16199 36617-36622 NNP denotes Cebpb
T16198 36613-36616 CC denotes and
T16197 36611-36612 CD denotes +
T16196 36610-36611 VBD denotes /
T16195 36609-36610 NNP denotes +
T16194 36604-36609 NNP denotes Cebpb
T16193 36599-36603 IN denotes into
T16192 36589-36598 VBP denotes construct
T16191 36580-36588 NN denotes reporter
T16190 36569-36579 NN denotes luciferase
T16189 36560-36568 NNP denotes SerpinB2
T16188 36553-36559 NN denotes murine
T16187 36543-36552 JJ denotes pGLmP-539
T16186 36539-36542 DT denotes the
T16185 36536-36538 IN denotes of
T16184 36523-36535 NN denotes transfection
T16183 36520-36522 IN denotes by
T16182 36511-36519 VBN denotes examined
T16181 36507-36510 VBD denotes was
T16180 36498-36506 NN denotes promoter
T16179 36489-36497 JJ denotes proximal
T16178 36480-36488 NNP denotes SerpinB2
T16177 36476-36479 DT denotes the
T16176 36471-36475 IN denotes from
T16175 36457-36470 NN denotes transcription
T16174 36450-36456 VB denotes direct
T16173 36447-36449 TO denotes to
T16172 36445-36446 NN denotes β
T16171 36444-36445 : denotes -
T16170 36439-36444 NNP denotes C/EBP
T16169 36428-36438 JJ denotes endogenous
T16168 36425-36427 IN denotes of
T16167 36417-36424 NN denotes ability
T16166 36413-36416 DT denotes The
T16165 36411-36412 . denotes .
T16164 36408-36411 NNP denotes LPS
T16163 36405-36407 TO denotes to
T16162 36396-36404 NN denotes response
T16161 36393-36395 IN denotes in
T16160 36387-36392 NNS denotes cells
T16159 36384-36386 IN denotes in
T16158 36375-36383 NN denotes promoter
T16157 36366-36374 NNP denotes SerpinB2
T16156 36362-36365 DT denotes the
T16155 36357-36361 IN denotes from
T16154 36343-36356 NN denotes transcription
T16153 36335-36342 VBG denotes driving
T16152 36331-36334 IN denotes for
T16151 36324-36330 NN denotes factor
T16150 36314-36323 JJ denotes essential
T16149 36311-36313 DT denotes an
T16148 36307-36310 VBD denotes was
T16147 36305-36306 NN denotes β
T16146 36304-36305 : denotes -
T16145 36299-36304 NNP denotes C/EBP
T16144 36291-36298 IN denotes whether
T16143 36288-36290 IN denotes of
T16142 36279-36287 NN denotes question
T16141 36275-36278 DT denotes the
T16140 36267-36274 VB denotes address
T16139 36264-36266 TO denotes to
T16138 36257-36263 VBD denotes wanted
T16137 36254-36256 PRP denotes we
T16136 36252-36253 , denotes ,
T16135 36248-36252 NN denotes vivo
T16134 36245-36247 IN denotes in
T16133 36241-36244 CC denotes and
T16132 36235-36240 NN denotes vitro
T16131 36232-36234 IN denotes in
T16130 36227-36231 DT denotes both
T16129 36220-36226 NN denotes manner
T16128 36206-36219 JJ denotes LPS-inducible
T16127 36203-36205 DT denotes an
T16126 36200-36202 IN denotes in
T16125 36191-36199 NN denotes promoter
T16124 36182-36190 JJ denotes proximal
T16123 36173-36181 NNP denotes SerpinB2
T16122 36169-36172 DT denotes the
T16121 36166-36168 TO denotes to
T16120 36160-36165 NNS denotes binds
T16119 36158-36159 NN denotes β
T16118 36157-36158 : denotes -
T16117 36152-36157 NNP denotes C/EBP
T16116 36146-36151 IN denotes Since
T16115 36137-36145 NNP denotes Activity
T16114 36128-36136 NNP denotes Promoter
T16113 36119-36127 NNP denotes Proximal
T16112 36110-36118 NNP denotes SerpinB2
T16111 36103-36109 NNP denotes Murine
T16110 36089-36102 JJ denotes LPS-inducible
T16109 36080-36088 VBZ denotes Promotes
T16108 36078-36079 NN denotes β
T16107 36077-36078 : denotes -
T16248 36873-36874 . denotes .
T16247 36865-36873 NN denotes activity
T16246 36856-36864 NN denotes promoter
T16245 36847-36855 JJ denotes proximal
T16244 36838-36846 JJ denotes SerpinB2
T16243 36826-36837 JJ denotes LPS-induced
T16242 36822-36825 IN denotes for
T16241 36813-36821 VBN denotes required
T16240 36810-36812 VBZ denotes is
T16239 36808-36809 NN denotes β
T16238 36807-36808 : denotes -
T16237 36802-36807 NNP denotes C/EBP
T16236 36791-36801 JJ denotes endogenous
T16235 36786-36790 IN denotes that
T16234 36775-36785 VBG denotes indicating
T16233 36773-36774 , denotes ,
T16232 36772-36773 -RRB- denotes )
T16231 36770-36772 NNP denotes 8A
T16230 36765-36769 NNP denotes Fig.
T16229 36764-36765 -LRB- denotes (
T16228 36759-36763 NNS denotes MEFs
T16227 36757-36758 CD denotes −
T16226 36756-36757 VBD denotes /
T16225 36755-36756 NNP denotes −
T16224 36750-36755 NNP denotes Cebpb
T16223 36747-36749 IN denotes in
T16222 36737-36746 VBD denotes abrogated
T16221 36733-36736 CC denotes and
T16220 36728-36732 NNS denotes MEFs
T16219 36726-36727 CD denotes +
T16218 36725-36726 VBD denotes /
T16217 36724-36725 NNP denotes +
T16216 36719-36724 NNP denotes Cebpb
T16215 36716-36718 IN denotes in
T15631 34878-34879 . denotes .
T15630 34875-34878 NNP denotes LPS
T15629 34872-34874 TO denotes to
T15628 34863-34871 NN denotes response
T15627 34860-34862 IN denotes in
T15626 34851-34859 NN denotes promoter
T15625 34842-34850 NNP denotes SerpinB2
T15624 34838-34841 DT denotes the
T15623 34833-34837 IN denotes from
T15622 34819-34832 NN denotes transcription
T15621 34809-34818 VBN denotes increased
T15620 34805-34808 IN denotes for
T15619 34793-34804 JJ denotes responsible
T15618 34790-34792 VB denotes be
T15617 34786-34789 RB denotes not
T15616 34782-34785 MD denotes may
T15615 34780-34781 NN denotes β
T15614 34779-34780 : denotes -
T15613 34774-34779 NNP denotes C/EBP
T15612 34754-34773 JJ denotes T217-phosphorylated
T15611 34749-34753 IN denotes that
T15610 34740-34748 VBP denotes indicate
T15609 34736-34739 CC denotes and
T15608 34734-34735 , denotes ,
T15607 34723-34734 NN denotes recruitment
T15606 34717-34722 NNP denotes βT217
T15605 34716-34717 : denotes -
T15604 34709-34716 NN denotes p-C/EBP
T15603 34705-34708 CC denotes and
T15602 34703-34704 NN denotes β
T15601 34702-34703 : denotes -
T15600 34697-34702 NNP denotes C/EBP
T15599 34689-34696 IN denotes between
T15598 34676-34688 NN denotes relationship
T15597 34668-34675 JJ denotes inverse
T15596 34665-34667 DT denotes an
T15595 34660-34664 VBP denotes show
T15594 34655-34659 NNS denotes data
T15593 34649-34654 DT denotes These
T15592 34647-34648 . denotes .
T15591 34646-34647 -RRB- denotes )
T15590 34645-34646 CD denotes 7
T15589 34640-34644 NN denotes Fig.
T15588 34639-34640 -LRB- denotes (
T15587 34638-34639 -RRB- denotes )
T15586 34635-34638 NNS denotes hrs
T15585 34633-34634 CD denotes 8
T15584 34629-34632 CC denotes and
T15583 34627-34628 CD denotes 4
T15582 34626-34627 -LRB- denotes (
T15581 34615-34625 NNS denotes timepoints
T15580 34609-34614 JJ denotes later
T15579 34606-34608 IN denotes at
T15578 34594-34605 NN denotes stimulation
T15577 34590-34593 NNP denotes LPS
T15576 34585-34589 IN denotes with
T15575 34574-34584 VBN denotes diminished
T15574 34565-34573 NN denotes promoter
T15573 34556-34564 JJ denotes proximal
T15572 34547-34555 NNP denotes SerpinB2
T15571 34543-34546 DT denotes the
T15570 34539-34542 IN denotes for
T15569 34533-34538 NNP denotes βT217
T15568 34532-34533 : denotes -
T15567 34525-34532 NNP denotes p-C/EBP
T15566 34522-34524 IN denotes of
T15565 34513-34521 NN denotes affinity
T15564 34505-34512 JJ denotes binding
T15563 34501-34504 DT denotes the
T15562 34499-34500 , denotes ,
T15561 34498-34499 NN denotes β
T15560 34497-34498 : denotes -
T15559 34492-34497 NNP denotes C/EBP
T15558 34486-34491 JJ denotes total
T15557 34483-34485 TO denotes to
T15556 34474-34482 NN denotes contrast
T15555 34471-34473 IN denotes In
T15554 34469-34470 . denotes .
T15553 34468-34469 -RRB- denotes )
T15552 34467-34468 CD denotes 7
T15551 34462-34466 NN denotes Fig.
T15550 34461-34462 -LRB- denotes (
T15549 34449-34460 NN denotes stimulation
T15548 34445-34448 NNP denotes LPS
T15547 34442-34444 IN denotes of
T15546 34439-34441 NN denotes hr
T15545 34437-34438 CD denotes 1
T15544 34431-34436 IN denotes after
T15543 34423-34430 JJ denotes present
T15542 34418-34422 RB denotes also
T15541 34414-34417 CC denotes and
T15540 34405-34413 NN denotes promoter
T15539 34396-34404 JJ denotes proximal
T15538 34387-34395 NNP denotes SerpinB2
T15537 34383-34386 DT denotes the
T15536 34380-34382 TO denotes to
T15535 34374-34379 VBN denotes bound
T15534 34359-34373 RB denotes constitutively
T15533 34355-34358 VBD denotes was
T15532 34349-34354 NNP denotes βT217
T15531 34348-34349 : denotes -
T15530 34341-34348 SYM denotes p-C/EBP
T15529 34339-34340 . denotes .
T15528 34338-34339 NNP denotes ]
T15527 34336-34338 CD denotes 65
T15526 34335-34336 NNP denotes [
T15525 34326-34334 NN denotes survival
T15524 34321-34325 NN denotes cell
T15523 34316-34320 IN denotes with
T15522 34305-34315 VBN denotes associated
T15521 34300-34304 VBN denotes been
T15520 34296-34299 VBZ denotes has
T15519 34290-34295 WDT denotes which
T15518 34288-34289 , denotes ,
T15517 34287-34288 -RRB- denotes )
T15516 34282-34287 NNP denotes βT217
T15515 34281-34282 : denotes -
T15514 34274-34281 SYM denotes p-C/EBP
T15513 34273-34274 -LRB- denotes (
T15512 34265-34272 NN denotes isoform
T15511 34263-34264 NN denotes β
T15510 34262-34263 : denotes -
T15509 34257-34262 NNP denotes C/EBP
T15508 34242-34256 VBD denotes phosphorylated
T15507 34237-34241 NNP denotes T217
T15506 34233-34236 DT denotes the
T15505 34230-34232 IN denotes of
T15504 34221-34229 NN denotes promoter
T15503 34212-34220 JJ denotes proximal
T15502 34203-34211 NNP denotes SerpinB2
T15501 34199-34202 DT denotes the
T15500 34196-34198 TO denotes to
T15499 34184-34195 NN denotes recruitment
T15498 34171-34183 VBD denotes investigated
T15497 34168-34170 PRP denotes we
T15496 34166-34167 , denotes ,
T15495 34165-34166 NNP denotes ]
T15494 34163-34165 CD denotes 64
T15493 34162-34163 NNP denotes [
T15492 34160-34161 : denotes ;
T15491 34159-34160 NNP denotes ]
T15490 34157-34159 CD denotes 63
T15489 34156-34157 NNP denotes [
T15488 34154-34155 : denotes ;
T15487 34153-34154 NNP denotes ]
T15486 34151-34153 CD denotes 38
T15485 34150-34151 NNP denotes [
T15484 34144-34149 NNS denotes genes
T15483 34137-34143 NN denotes target
T15482 34123-34136 VB denotes transactivate
T15481 34120-34122 TO denotes to
T15480 34112-34119 NN denotes ability
T15479 34108-34109 NN denotes β
T15478 34107-34108 : denotes -
T15398 33627-33635 JJ denotes enriched
T15397 33623-33626 DT denotes the
T15396 33619-33622 CC denotes and
T15395 33617-33618 , denotes ,
T15394 33609-33617 NNS denotes proteins
T15393 33601-33608 JJ denotes binding
T15392 33597-33600 NNP denotes DNA
T15391 33589-33596 IN denotes against
T15390 33578-33588 NNS denotes antibodies
T15389 33573-33577 IN denotes with
T15388 33554-33572 VBN denotes immunoprecipitated
T15387 33550-33553 VBD denotes was
T15386 33540-33549 NN denotes chromatin
T15385 33532-33539 JJ denotes soluble
T15384 33530-33531 , denotes ,
T15383 33527-33530 NNS denotes hrs
T15382 33525-33526 CD denotes 8
T15381 33522-33524 TO denotes to
T15380 33519-33521 RB denotes up
T15379 33515-33518 IN denotes for
T15378 33511-33514 NNP denotes LPS
T15377 33506-33510 IN denotes with
T15376 33495-33505 VBN denotes stimulated
T15375 33490-33494 VBD denotes were
T15374 33484-33489 NNS denotes cells
T15373 33478-33483 CD denotes 264.7
T15372 33474-33477 NNP denotes RAW
T15371 33472-33473 . denotes .
T15370 33471-33472 -RRB- denotes )
T15369 33467-33471 NNP denotes ChIP
T15368 33466-33467 -LRB- denotes (
T15367 33446-33465 NN denotes immunoprecipitation
T15366 33436-33445 NN denotes chromatin
T15365 33433-33435 IN denotes by
T15364 33428-33432 NN denotes vivo
T15363 33425-33427 IN denotes in
T15362 33421-33424 NNP denotes LPS
T15361 33418-33420 TO denotes to
T15360 33409-33417 NN denotes response
T15359 33406-33408 IN denotes in
T15358 33397-33405 NN denotes promoter
T15357 33388-33396 NNP denotes SerpinB2
T15356 33381-33387 NN denotes murine
T15355 33377-33380 DT denotes the
T15354 33374-33376 TO denotes to
T15353 33362-33373 NN denotes recruitment
T15352 33360-33361 NN denotes β
T15351 33359-33360 : denotes -
T15350 33354-33359 NNP denotes C/EBP
T15349 33351-33353 IN denotes of
T15348 33342-33350 NNS denotes dynamics
T15347 33333-33341 JJ denotes temporal
T15346 33329-33332 DT denotes the
T15345 33316-33328 VBD denotes investigated
T15344 33313-33315 PRP denotes We
T15343 33306-33312 NNP denotes Manner
T15342 33292-33305 JJ denotes LPS-inducible
T15341 33289-33291 DT denotes an
T15340 33286-33288 IN denotes in
T15339 33281-33285 NN denotes vivo
T15338 33278-33280 IN denotes in
T15337 33269-33277 NNP denotes Promoter
T15336 33260-33268 NNP denotes Proximal
T15335 33251-33259 NNP denotes SerpinB2
T15334 33244-33250 NNP denotes Murine
T15333 33240-33243 DT denotes the
T15332 33234-33239 VBZ denotes Binds
T15331 33232-33233 NN denotes β
T15330 33231-33232 : denotes -
T15329 33226-33231 SYM denotes C/EBP
T15477 34102-34107 NNP denotes C/EBP
T15476 34095-34101 VB denotes affect
T15475 34091-34094 MD denotes can
T15474 34084-34090 NNS denotes states
T15473 34068-34083 NN denotes phosphorylation
T15472 34066-34067 NN denotes β
T15471 34065-34066 : denotes -
T15470 34060-34065 NNP denotes C/EBP
T15469 34057-34059 IN denotes in
T15468 34049-34056 NNS denotes changes
T15467 34043-34048 IN denotes Since
T15466 34041-34042 . denotes .
T15465 34040-34041 -RRB- denotes )
T15464 34039-34040 CD denotes 7
T15463 34034-34038 NN denotes Fig.
T15462 34033-34034 -LRB- denotes (
T15461 34029-34032 NNS denotes hrs
T15460 34027-34028 CD denotes 8
T15459 34021-34026 IN denotes after
T15458 34015-34020 NNS denotes cells
T15457 34002-34014 JJ denotes unstimulated
T15456 33997-34001 IN denotes over
T15455 33989-33996 JJ denotes 10-fold
T15454 33986-33988 IN denotes as
T15453 33981-33985 RB denotes much
T15452 33978-33980 RB denotes as
T15451 33969-33977 VBG denotes reaching
T15450 33965-33968 NNP denotes LPS
T15449 33962-33964 TO denotes to
T15448 33953-33961 NN denotes response
T15447 33950-33952 IN denotes in
T15446 33939-33949 RB denotes temporally
T15445 33929-33938 VBD denotes increased
T15444 33925-33928 CC denotes and
T15443 33913-33924 NNS denotes macrophages
T15442 33900-33912 JJ denotes unstimulated
T15441 33897-33899 IN denotes in
T15440 33888-33896 NN denotes promoter
T15439 33884-33887 DT denotes the
T15438 33879-33883 IN denotes with
T15437 33867-33878 NN denotes association
T15436 33863-33866 PRP$ denotes its
T15435 33860-33862 IN denotes by
T15434 33847-33859 VBN denotes demonstrated
T15433 33844-33846 IN denotes as
T15432 33835-33843 NN denotes promoter
T15431 33826-33834 NNP denotes SerpinB2
T15430 33822-33825 DT denotes the
T15429 33819-33821 IN denotes at
T15428 33811-33818 JJ denotes present
T15427 33796-33810 RB denotes constitutively
T15426 33793-33795 VBZ denotes is
T15425 33791-33792 NN denotes β
T15424 33790-33791 : denotes -
T15423 33785-33790 NNP denotes C/EBP
T15422 33780-33784 IN denotes that
T15421 33773-33779 VBD denotes showed
T15420 33765-33772 NNS denotes results
T15419 33761-33764 DT denotes The
T15418 33759-33760 . denotes .
T15417 33758-33759 -RRB- denotes )
T15416 33756-33758 NN denotes 4A
T15415 33751-33755 JJ denotes fig.
T15414 33748-33750 IN denotes in
T15413 33736-33747 VBN denotes illustrated
T15412 33735-33736 -LRB- denotes (
T15411 33727-33734 NNS denotes primers
T15410 33718-33726 JJ denotes specific
T15409 33709-33717 NN denotes promoter
T15408 33700-33708 JJ denotes proximal
T15407 33691-33699 CD denotes SerpinB2
T15406 33685-33690 VBG denotes using
T15405 33680-33684 JJ denotes qPCR
T15404 33676-33679 CC denotes and
T15403 33658-33675 JJ denotes semi-quantitative
T15402 33653-33657 DT denotes both
T15401 33650-33652 IN denotes by
T15400 33640-33649 VBN denotes amplified
T15399 33636-33639 NN denotes DNA
T14758 32009-32010 . denotes .
T14757 32005-32009 NNP denotes mRNA
T14756 31996-32004 NNP denotes SerpinB2
T14755 31985-31995 JJ denotes endogenous
T14754 31982-31984 IN denotes of
T14753 31968-31981 NN denotes transcription
T14752 31954-31967 JJ denotes LPS-inducible
T14751 31950-31953 CC denotes and
T14750 31937-31949 JJ denotes constitutive
T14749 31927-31936 VBG denotes mediating
T14748 31923-31926 IN denotes for
T14747 31914-31922 JJ denotes critical
T14746 31911-31913 VBZ denotes is
T14745 31909-31910 NN denotes β
T14744 31908-31909 : denotes -
T14743 31903-31908 NNP denotes C/EBP
T14742 31898-31902 IN denotes that
T14741 31893-31897 VBP denotes show
T14740 31888-31892 NNS denotes data
T14739 31882-31887 DT denotes These
T14738 31880-31881 . denotes .
T14737 31879-31880 -RRB- denotes )
T14736 31874-31879 NN denotes right
T14735 31872-31873 , denotes ,
T14734 31870-31872 NNP denotes 6B
T14733 31865-31869 NNP denotes Fig.
T14732 31864-31865 -LRB- denotes (
T14731 31852-31863 NNS denotes macrophages
T14730 31839-31851 JJ denotes inflammatory
T14729 31827-31838 JJ denotes β-deficient
T14728 31826-31827 : denotes -
T14727 31821-31826 NNP denotes C/EBP
T14726 31818-31820 IN denotes in
T14725 31808-31817 VBN denotes decreased
T14724 31794-31807 RB denotes significantly
T14723 31790-31793 VBD denotes was
T14722 31779-31789 NN denotes expression
T14721 31774-31778 NNP denotes mRNA
T14720 31765-31773 NNP denotes SerpinB2
T14719 31753-31764 JJ denotes LPS-induced
T14718 31749-31752 CC denotes and
T14717 31736-31748 JJ denotes constitutive
T14716 31731-31735 DT denotes both
T14715 31729-31730 , denotes ,
T14714 31725-31729 NNS denotes MEFs
T14713 31722-31724 IN denotes in
T14712 31713-31721 VBN denotes observed
T14711 31709-31712 VBD denotes was
T14710 31706-31708 IN denotes As
T14709 31704-31705 . denotes .
T14708 31703-31704 -RRB- denotes )
T14707 31699-31703 VBD denotes left
T14706 31697-31698 , denotes ,
T14705 31695-31697 NNP denotes 6B
T14704 31690-31694 NNP denotes Fig.
T14703 31689-31690 -LRB- denotes (
T14702 31682-31688 NNS denotes shRNAs
T14701 31671-31681 JJ denotes lentiviral
T14700 31654-31670 JJ denotes species-specific
T14699 31648-31653 VBG denotes using
T14698 31643-31647 RP denotes down
T14697 31635-31642 VBN denotes knocked
T14696 31631-31634 VBD denotes was
T14695 31620-31630 NN denotes expression
T14694 31618-31619 NN denotes β
T14693 31617-31618 : denotes -
T14692 31612-31617 NNP denotes C/EBP
T14691 31606-31611 WDT denotes which
T14690 31603-31605 IN denotes in
T14689 31591-31602 NNS denotes macrophages
T14688 31578-31590 JJ denotes inflammatory
T14687 31554-31577 JJ denotes thioglycollate-elicited
T14686 31551-31553 IN denotes in
T14685 31546-31550 VBN denotes seen
T14684 31543-31545 VB denotes be
T14683 31537-31542 MD denotes could
T14682 31529-31536 NNS denotes effects
T14681 31521-31528 JJ denotes similar
T14680 31518-31520 IN denotes if
T14679 31511-31517 VBN denotes tested
T14678 31506-31510 JJ denotes next
T14677 31503-31505 PRP denotes We
T14676 31501-31502 . denotes .
T14675 31492-31501 JJ denotes wild-type
T14674 31489-31491 TO denotes to
T14673 31480-31488 VBN denotes compared
T14672 31477-31479 IN denotes as
T14671 31472-31476 NNS denotes MEFs
T14670 31470-31471 CD denotes −
T14669 31469-31470 VBD denotes /
T14668 31468-31469 NNP denotes −
T14667 31463-31468 NNP denotes Cebpb
T14666 31460-31462 IN denotes in
T14665 31451-31459 VBN denotes dampened
T14664 31437-31450 RB denotes significantly
T14663 31433-31436 VBD denotes was
T14662 31422-31432 NN denotes expression
T14661 31417-31421 NNP denotes mRNA
T14660 31408-31416 NNP denotes SerpinB2
T14659 31393-31407 JJ denotes LPS-stimulated
T14658 31385-31392 IN denotes whereas
T14657 31383-31384 , denotes ,
T14656 31382-31383 -RRB- denotes )
T14655 31380-31382 NNP denotes 6A
T14654 31375-31379 NNP denotes Fig.
T14653 31374-31375 -LRB- denotes (
T14652 31369-31373 NNS denotes MEFs
T14651 31359-31368 JJ denotes wild-type
T14650 31356-31358 IN denotes in
T14649 31345-31355 NN denotes expression
T14648 31340-31344 NNP denotes mRNA
T14647 31331-31339 NNP denotes SerpinB2
T14646 31328-31330 IN denotes in
T14645 31319-31327 NN denotes increase
T14644 31316-31318 DT denotes an
T14643 31305-31315 VBD denotes stimulated
T14642 31301-31304 NNP denotes LPS
T14641 31299-31300 . denotes .
T14640 31289-31299 NN denotes expression
T14639 31284-31288 NNP denotes mRNA
T14638 31275-31283 NNP denotes SerpinB2
T14637 31264-31274 JJ denotes endogenous
T14636 31253-31263 VBD denotes attenuated
T14635 31251-31252 NN denotes β
T14634 31250-31251 : denotes -
T14633 31245-31250 NNP denotes C/EBP
T14632 31242-31244 IN denotes of
T14631 31234-31241 NN denotes absence
T14630 31230-31233 DT denotes the
T14629 31226-31229 CC denotes and
T14628 31217-31225 NNP denotes SerpinB2
T14627 31206-31216 JJ denotes endogenous
T14626 31203-31205 IN denotes of
T14625 31196-31202 NNS denotes levels
T14624 31192-31195 JJ denotes low
T14623 31184-31191 VB denotes express
T14622 31179-31183 NNS denotes MEFs
T14621 31169-31178 JJ denotes Wild-type
T14620 31167-31168 . denotes .
T14619 31166-31167 NN denotes β
T14618 31165-31166 : denotes -
T14617 31160-31165 NNP denotes C/EBP
T14616 31149-31159 JJ denotes endogenous
T14615 31141-31148 VBP denotes express
T14614 31126-31140 RB denotes constitutively
T14613 31120-31125 NNS denotes cells
T14612 31117-31119 CD denotes .7
T14611 31111-31117 NNP denotes RAW264
T14610 31105-31110 IN denotes since
T14609 31103-31104 , denotes ,
T14608 31102-31103 -RRB- denotes )
T14607 31101-31102 NNP denotes +
T14606 31100-31101 NNP denotes /
T14605 31099-31100 NNP denotes +
T14604 31094-31099 NNP denotes Cebpb
T14603 31093-31094 -LRB- denotes (
T14602 31088-31092 NNS denotes MEFs
T14601 31078-31087 JJ denotes wild-type
T14600 31074-31077 CC denotes and
T14599 31072-31073 -RRB- denotes )
T14598 31071-31072 NNP denotes −
T14597 31070-31071 NNP denotes /
T14596 31069-31070 NNP denotes −
T14595 31063-31068 NNP denotes Cebpb
T14594 31062-31063 -LRB- denotes (
T14593 31055-31061 NN denotes β-null
T14592 31054-31055 : denotes -
T14591 31049-31054 NNP denotes C/EBP
T14590 31040-31048 VBD denotes utilized
T14589 31037-31039 PRP denotes we
T14588 31035-31036 , denotes ,
T14587 31032-31035 NNP denotes LPS
T14586 31029-31031 TO denotes to
T14585 31020-31028 NN denotes response
T14584 31017-31019 IN denotes in
T14583 31006-31016 NN denotes expression
T14582 31001-31005 NNP denotes mRNA
T14581 30992-31000 NNP denotes SerpinB2
T14580 30981-30991 JJ denotes endogenous
T14579 30978-30980 TO denotes to
T14578 30976-30977 NN denotes β
T14577 30975-30976 : denotes -
T14576 30970-30975 NNP denotes C/EBP
T14575 30967-30969 IN denotes of
T14574 30956-30966 NN denotes importance
T14573 30952-30955 DT denotes the
T14572 30940-30951 VB denotes investigate
T14571 30937-30939 TO denotes To
T14570 30925-30936 NNPS denotes Macrophages
T14569 30917-30924 JJ denotes Primary
T14568 30904-30916 NNP denotes Inflammatory
T14567 30900-30903 CC denotes and
T14566 30895-30899 NNP denotes MEFs
T14565 30892-30894 IN denotes in
T14564 30881-30891 NNP denotes Expression
T14563 30876-30880 NNP denotes mRNA
T14562 30867-30875 NNP denotes SerpinB2
T14561 30855-30866 JJ denotes LPS-induced
T14560 30851-30854 CC denotes and
T14559 30838-30850 NNP denotes Constitutive
T14558 30833-30837 DT denotes both
T14557 30824-30832 NNPS denotes Mediates
T14556 30822-30823 SYM denotes β
T14555 30821-30822 : denotes -
T14554 30816-30821 SYM denotes C/EBP
T13773 30560-30568 VBN denotes expected
T13772 30557-30559 VBZ denotes is
T13771 30549-30556 VB denotes extract
T13770 30541-30548 JJ denotes nuclear
T13769 30536-30540 IN denotes with
T13768 30527-30535 NN denotes antibody
T13767 30524-30526 IN denotes of
T13766 30509-30523 NN denotes pre-incubation
T13765 30504-30508 IN denotes that
T13764 30501-30503 RB denotes so
T13763 30499-30500 , denotes ,
T13762 30492-30499 NN denotes protein
T13761 30481-30491 JJ denotes respective
T13760 30477-30480 DT denotes the
T13759 30474-30476 IN denotes of
T13758 30467-30473 NN denotes region
T13757 30455-30466 JJ denotes DNA-binding
T13756 30438-30454 JJ denotes carboxy-terminal
T13755 30434-30437 DT denotes the
T13754 30426-30433 VBZ denotes detects
T13753 30417-30425 NN denotes antibody
T13752 30412-30416 DT denotes Each
T13751 30410-30411 . denotes .
T13750 30409-30410 NN denotes ε
T13749 30408-30409 : denotes -
T13748 30403-30408 NNP denotes C/EBP
T13747 30399-30402 CC denotes and
T13746 30397-30398 NN denotes δ
T13745 30396-30397 : denotes -
T13744 30391-30396 NNP denotes C/EBP
T13743 30389-30390 , denotes ,
T13742 30388-30389 NN denotes β
T13741 30387-30388 : denotes -
T13740 30382-30387 NNP denotes C/EBP
T13739 30380-30381 , denotes ,
T13738 30379-30380 NN denotes α
T13737 30378-30379 : denotes -
T13736 30373-30378 NNP denotes C/EBP
T13735 30369-30372 IN denotes for
T13734 30360-30368 JJ denotes specific
T13733 30349-30359 NNS denotes antibodies
T13732 30344-30348 IN denotes with
T13731 30334-30343 NNS denotes complexes
T13730 30319-30333 JJ denotes nucleo-protein
T13729 30315-30318 DT denotes the
T13728 30304-30314 VBG denotes incubating
T13727 30298-30303 IN denotes after
T13726 30288-30297 VBN denotes performed
T13725 30284-30287 VBD denotes was
T13724 30279-30283 NNP denotes EMSA
T13723 30277-30278 , denotes ,
T13722 30270-30277 NN denotes complex
T13721 30256-30269 JJ denotes LPS-inducible
T13720 30252-30255 DT denotes the
T13719 30249-30251 IN denotes of
T13718 30236-30248 RB denotes particularly
T13717 30232-30235 CC denotes and
T13716 30230-30231 , denotes ,
T13715 30221-30230 NNS denotes complexes
T13714 30206-30220 NN denotes nucleo-protein
T13713 30196-30205 JJ denotes different
T13712 30192-30195 DT denotes the
T13711 30189-30191 IN denotes of
T13710 30179-30188 NN denotes formation
T13709 30175-30178 DT denotes the
T13708 30172-30174 IN denotes in
T13707 30163-30171 VBN denotes involved
T13706 30158-30162 VBD denotes were
T13705 30149-30157 NNS denotes proteins
T13704 30143-30148 NNP denotes C/EBP
T13703 30137-30142 WDT denotes which
T13702 30127-30136 VB denotes determine
T13701 30124-30126 TO denotes To
T13700 30122-30123 . denotes .
T13699 30121-30122 NNP denotes ]
T13698 30119-30121 CD denotes 61
T13697 30118-30119 NNP denotes [
T13696 30106-30117 NN denotes environment
T13695 30092-30105 JJ denotes extracellular
T13694 30088-30091 DT denotes the
T13693 30085-30087 IN denotes on
T13692 30075-30084 VBG denotes depending
T13691 30069-30074 NNS denotes cells
T13690 30061-30068 JJ denotes myeloid
T13689 30045-30060 VBG denotes differentiating
T13688 30042-30044 IN denotes in
T13687 30036-30041 NNS denotes roles
T13686 30026-30035 JJ denotes different
T13685 30021-30025 VB denotes play
T13684 30017-30020 CC denotes and
T13683 30011-30016 NNS denotes cells
T13682 30003-30010 JJ denotes myeloid
T13681 30000-30002 IN denotes in
T13680 29992-29999 JJ denotes present
T13679 29988-29991 VBP denotes are
T13678 29986-29987 , denotes ,
T13677 29985-29986 NN denotes ε
T13676 29984-29985 : denotes -
T13675 29979-29984 NNP denotes C/EBP
T13674 29975-29978 CC denotes and
T13673 29973-29974 NN denotes δ
T13672 29972-29973 : denotes -
T13671 29967-29972 NNP denotes C/EBP
T13670 29965-29966 , denotes ,
T13669 29964-29965 NN denotes β
T13668 29963-29964 : denotes -
T13667 29958-29963 NNP denotes C/EBP
T13666 29956-29957 , denotes ,
T13665 29955-29956 NN denotes α
T13664 29954-29955 : denotes -
T13663 29949-29954 NNP denotes C/EBP
T13662 29947-29948 , denotes ,
T13661 29940-29947 NNS denotes members
T13660 29933-29939 NN denotes family
T13659 29928-29932 NNP denotes Four
T13658 29926-29927 . denotes .
T13657 29925-29926 NNP denotes ]
T13656 29923-29925 CD denotes 60
T13655 29922-29923 NNP denotes [
T13654 29908-29921 NNS denotes specificities
T13653 29900-29907 JJ denotes binding
T13652 29896-29899 NNP denotes DNA
T13651 29888-29895 JJ denotes similar
T13650 29880-29887 NN denotes display
T13649 29876-29879 CC denotes and
T13648 29861-29875 NN denotes heterodimerize
T13647 29860-29861 CD denotes /
T13646 29859-29860 CD denotes −
T13645 29855-29859 VB denotes homo
T13644 29851-29854 MD denotes can
T13643 29843-29850 NNS denotes factors
T13642 29829-29842 NN denotes transcription
T13641 29823-29828 NNP denotes C/EBP
T13640 29819-29822 DT denotes the
T13639 29817-29818 , denotes ,
T13638 29810-29817 NNS denotes members
T13637 29806-29809 CD denotes six
T13636 29803-29805 IN denotes of
T13635 29792-29802 VBG denotes Consisting
T13634 29790-29791 . denotes .
T13633 29789-29790 NNP denotes ]
T13632 29787-29789 CD denotes 59
T13631 29786-29787 NNP denotes [
T13630 29773-29785 NN denotes inflammation
T13629 29769-29772 CC denotes and
T13628 29753-29768 NN denotes differentiation
T13627 29744-29752 JJ denotes cellular
T13626 29741-29743 IN denotes in
T13625 29735-29740 NNS denotes roles
T13624 29729-29734 PRP$ denotes their
T13623 29725-29728 IN denotes for
T13622 29719-29724 VBN denotes known
T13621 29715-29718 VBP denotes are
T13620 29707-29714 NNS denotes factors
T13619 29693-29706 NN denotes transcription
T13618 29686-29692 NN denotes zipper
T13617 29678-29685 NN denotes leucine
T13616 29672-29677 JJ denotes basic
T13615 29669-29671 IN denotes of
T13614 29662-29668 NN denotes family
T13613 29656-29661 NNP denotes C/EBP
T13612 29652-29655 NNP denotes The
T13611 29643-29651 NNP denotes Promoter
T13610 29634-29642 NNP denotes Proximal
T13609 29625-29633 NNP denotes SerpinB2
T13608 29621-29624 DT denotes the
T13607 29618-29620 IN denotes of
T13606 29610-29617 NNP denotes Element
T13605 29604-29609 NNP denotes C/EBP
T13604 29600-29603 DT denotes the
T13603 29597-29599 TO denotes to
T13602 29591-29596 VBZ denotes Binds
T13601 29586-29590 WDT denotes that
T13600 29579-29585 NNP denotes Factor
T13599 29571-29578 NNP denotes Nuclear
T13598 29559-29570 JJ denotes LPS-induced
T13597 29557-29558 DT denotes a
T13596 29554-29556 VBZ denotes is
T13595 29552-29553 NN denotes β
T13594 29551-29552 : denotes -
T13593 29546-29551 SYM denotes C/EBP
T13826 30813-30814 . denotes .
T13825 30812-30813 NN denotes β
T13824 30811-30812 : denotes -
T13823 30806-30811 NNP denotes C/EBP
T13822 30797-30805 VBZ denotes contains
T13821 30795-30796 -RRB- denotes )
T13820 30792-30795 CD denotes 192
T13819 30791-30792 NN denotes −
T13818 30790-30791 CD denotes /
T13817 30787-30790 CD denotes 203
T13816 30786-30787 FW denotes −
T13815 30785-30786 -LRB- denotes (
T13814 30777-30784 NN denotes element
T13813 30771-30776 NNP denotes C/EBP
T13812 30767-30770 DT denotes the
T13811 30762-30766 IN denotes with
T13810 30754-30761 NN denotes complex
T13809 30742-30753 JJ denotes LPS-induced
T13808 30738-30741 DT denotes the
T13807 30733-30737 IN denotes that
T13806 30728-30732 VBP denotes show
T13805 30723-30727 NNS denotes data
T13804 30717-30722 DT denotes these
T13803 30708-30716 RB denotes together
T13802 30702-30707 VBN denotes Taken
T13801 30700-30701 . denotes .
T13800 30699-30700 -RRB- denotes )
T13799 30697-30699 NNP denotes 5C
T13798 30692-30696 NNP denotes Fig.
T13797 30691-30692 -LRB- denotes (
T13796 30683-30690 NN denotes complex
T13795 30669-30682 JJ denotes LPS-inducible
T13794 30665-30668 DT denotes the
T13793 30662-30664 IN denotes of
T13792 30652-30661 NN denotes formation
T13791 30648-30651 DT denotes the
T13790 30638-30647 VBD denotes abolished
T13789 30636-30637 NN denotes β
T13788 30635-30636 : denotes -
T13787 30630-30635 NNP denotes C/EBP
T13786 30622-30629 IN denotes against
T13785 30611-30621 NNS denotes antibodies
T13784 30606-30610 RB denotes Only
T13783 30604-30605 . denotes .
T13782 30603-30604 NNP denotes ]
T13781 30601-30603 CD denotes 62
T13780 30600-30601 NNP denotes [
T13779 30595-30599 NNP denotes EMSA
T13778 30592-30594 IN denotes by
T13777 30584-30591 JJ denotes binding
T13776 30580-30583 NNP denotes DNA
T13775 30572-30579 VB denotes abolish
T13774 30569-30571 TO denotes to
T13080 28638-28639 . denotes .
T13079 28631-28638 NNS denotes factors
T13078 28617-28630 NN denotes transcription
T13077 28614-28616 IN denotes of
T12297 26818-26819 CD denotes −
T12296 26815-26817 IN denotes at
T12295 26811-26814 NNP denotes CRE
T12294 26807-26810 DT denotes the
T12293 26804-26806 IN denotes of
T12292 26795-26803 NN denotes mutation
T12291 26793-26794 , denotes ,
T12290 26791-26793 NNP denotes 4B
T12289 26786-26790 NNP denotes Fig.
T12288 26783-26785 IN denotes in
T12287 26777-26782 VBN denotes shown
T12286 26774-26776 IN denotes As
T12285 26772-26773 . denotes .
T12284 26764-26772 NN denotes promoter
T12283 26755-26763 NNP denotes SerpinB2
T12282 26748-26754 NN denotes murine
T12281 26744-26747 DT denotes the
T12280 26741-26743 IN denotes of
T12279 26732-26740 NN denotes response
T12278 26728-26731 NNP denotes LPS
T12277 26724-26727 DT denotes the
T12276 26721-26723 IN denotes in
T12275 26716-26720 NN denotes role
T12274 26714-26715 DT denotes a
T12273 26707-26713 VBD denotes played
T12272 26702-26706 PRP denotes they
T12271 26694-26701 IN denotes whether
T12270 26682-26693 VB denotes investigate
T12269 26679-26681 TO denotes to
T12268 26666-26678 NN denotes substitution
T12267 26655-26665 NN denotes nucleotide
T12266 26652-26654 IN denotes by
T12265 26644-26651 VBN denotes mutated
T12264 26639-26643 RB denotes also
T12263 26634-26638 VBD denotes were
T12262 26628-26633 NNS denotes sites
T12261 26622-26627 DT denotes these
T12260 26620-26621 , denotes ,
T12259 26619-26620 NNP denotes ]
T12258 26617-26619 CD denotes 37
T12257 26616-26617 NNP denotes [
T12256 26607-26615 NN denotes promoter
T12255 26598-26606 NNP denotes SERPINB2
T12254 26592-26597 JJ denotes human
T12253 26588-26591 DT denotes the
T12252 26585-26587 IN denotes of
T12251 26566-26584 NN denotes PMA-responsiveness
T12250 26562-26565 DT denotes the
T12249 26559-26561 IN denotes in
T12248 26547-26558 NN denotes involvement
T12247 26534-26546 VBN denotes demonstrated
T12246 26528-26533 PRP$ denotes their
T12245 26524-26527 CC denotes and
T12244 26515-26523 NN denotes promoter
T12243 26506-26514 NNP denotes SerpinB2
T12242 26499-26505 NN denotes murine
T12241 26495-26498 DT denotes the
T12240 26492-26494 IN denotes in
T12239 26486-26491 NNS denotes sites
T12238 26481-26485 JJ denotes AP-1
T12237 26477-26480 CD denotes two
T12236 26473-26476 CC denotes and
T12235 26469-26472 NNP denotes CRE
T12234 26465-26468 DT denotes the
T12233 26462-26464 IN denotes of
T12232 26453-26461 NN denotes position
T12231 26449-26452 CC denotes and
T12230 26440-26448 NN denotes sequence
T12229 26430-26439 JJ denotes conserved
T12228 26426-26429 DT denotes the
T12227 26414-26425 VBG denotes Considering
T12226 25553-25554 . denotes .
T12225 25552-25553 NNP denotes ]
T12224 25550-25552 CD denotes 58
T12223 25549-25550 NNP denotes [
T12222 25544-25548 NN denotes gene
T12221 25535-25543 NNP denotes SerpinB2
T12220 25531-25534 DT denotes the
T12219 25528-25530 IN denotes of
T12218 25517-25527 NN denotes activation
T12217 25505-25516 JJ denotes LPS-induced
T12216 25502-25504 IN denotes in
T12215 25497-25501 NN denotes site
T12214 25491-25496 NNP denotes C/EBP
T12213 25486-25490 DT denotes this
T12212 25475-25485 VBN denotes implicated
T12211 25466-25474 RB denotes recently
T12210 25461-25465 RB denotes also
T12209 25456-25460 VBP denotes have
T12208 25449-25455 NNS denotes Others
T12207 25447-25448 . denotes .
T12206 25438-25447 VBP denotes construct
T12205 25429-25437 NN denotes deletion
T12204 25420-25428 NN denotes promoter
T12203 25411-25419 CD denotes SerpinB2
T12202 25407-25410 CD denotes 189
T12201 25406-25407 NN denotes −
T12200 25402-25405 DT denotes the
T12199 25398-25401 IN denotes for
T12198 25389-25397 VBD denotes observed
T12197 25382-25388 NNS denotes levels
T12196 25378-25381 DT denotes the
T12195 25375-25377 TO denotes to
T12194 25367-25374 JJ denotes similar
T12193 25365-25366 , denotes ,
T12192 25357-25365 NN denotes activity
T12191 25348-25356 NN denotes promoter
T12190 25337-25347 VBN denotes eliminated
T12189 25326-25336 RB denotes completely
T12188 25324-25325 -RRB- denotes )
T12187 25321-25324 CD denotes 192
T12186 25320-25321 NN denotes −
T12185 25319-25320 CD denotes /
T12184 25316-25319 CD denotes 203
T12183 25315-25316 FW denotes −
T12182 25314-25315 -LRB- denotes (
T12181 25309-25313 NN denotes site
T12180 25303-25308 NNP denotes C/EBP
T12179 25299-25302 DT denotes the
T12178 25296-25298 IN denotes of
T12177 25287-25295 NN denotes mutation
T12176 25285-25286 , denotes ,
T12175 25277-25285 NN denotes contrast
T12174 25274-25276 IN denotes In
T12173 25272-25273 . denotes .
T12172 25264-25272 NN denotes activity
T12171 25255-25263 NN denotes promoter
T12170 25243-25254 JJ denotes LPS-induced
T12169 25234-25242 VB denotes decrease
T12168 25230-25233 RB denotes not
T12167 25226-25229 VBD denotes did
T12166 25221-25225 NN denotes site
T12165 25219-25220 -RRB- denotes )
T12164 25216-25219 CD denotes 288
T12163 25215-25216 NN denotes −
T12162 25214-25215 CD denotes /
T12161 25211-25214 CD denotes 296
T12160 25210-25211 FW denotes −
T12159 25209-25210 -LRB- denotes (
T12158 25203-25208 NN denotes Oct-1
T12157 25195-25202 JJ denotes variant
T12156 25191-25194 DT denotes the
T12155 25188-25190 CC denotes or
T12154 25186-25187 , denotes ,
T12153 25185-25186 -RRB- denotes )
T12152 25182-25185 CD denotes 407
T12151 25181-25182 NN denotes −
T12150 25180-25181 CD denotes /
T12149 25177-25180 CD denotes 412
T12148 25176-25177 NN denotes −
T12147 25175-25176 -LRB- denotes (
T12146 25172-25174 CD denotes .1
T12145 25170-25172 NNP denotes PU
T12144 25168-25169 , denotes ,
T12143 25167-25168 -RRB- denotes )
T12142 25164-25167 CD denotes 533
T12141 25163-25164 NN denotes −
T12140 25162-25163 CD denotes /
T12139 25159-25162 CD denotes 538
T12138 25158-25159 FW denotes −
T12137 25157-25158 -LRB- denotes (
T12136 25153-25156 NN denotes box
T12135 25151-25152 NNP denotes E
T12134 25141-25150 NN denotes consensus
T12133 25137-25140 DT denotes the
T12132 25134-25136 IN denotes of
T12131 25125-25133 NN denotes mutation
T12130 25123-25124 , denotes ,
T12129 25121-25123 NNP denotes 4B
T12128 25116-25120 NNP denotes Fig.
T12127 25113-25115 IN denotes in
T12126 25107-25112 VBN denotes shown
T12125 25104-25106 IN denotes As
T12124 25102-25103 . denotes .
T12123 25101-25102 -RRB- denotes )
T12122 25099-25101 NNP denotes 4A
T12121 25094-25098 NNP denotes Fig.
T12120 25093-25094 -LRB- denotes (
T12119 25083-25092 VBP denotes construct
T12118 25078-25082 NN denotes gene
T12117 25069-25077 NN denotes reporter
T12116 25049-25068 JJ denotes promoter-luciferase
T12115 25040-25048 NNP denotes SerpinB2
T12114 25033-25039 NN denotes murine
T12113 25023-25032 JJ denotes pGLmP-539
T12112 25019-25022 DT denotes the
T12111 25016-25018 TO denotes to
T12110 25008-25015 JJ denotes binding
T12109 25001-25007 NN denotes factor
T12108 24987-25000 NN denotes transcription
T13076 28607-28613 NN denotes family
T13075 28601-28606 NNP denotes C/EBP
T13074 28597-28600 DT denotes the
T13073 28594-28596 IN denotes of
T13072 28587-28593 NN denotes member
T13071 28585-28586 DT denotes a
T12855 27508-27514 NNS denotes probes
T12854 27492-27507 NN denotes oligonucleotide
T12853 27483-27491 VBN denotes stranded
T12852 27476-27482 JJ denotes double
T12851 27466-27475 JJ denotes different
T12850 27460-27465 CD denotes Three
T12849 27458-27459 . denotes .
T12848 27447-27458 NNS denotes macrophages
T12847 27441-27446 CD denotes 264.7
T12846 27437-27440 NNP denotes RAW
T12845 27425-27436 JJ denotes LPS-treated
T12844 27421-27424 CC denotes and
T12843 27411-27420 JJ denotes untreated
T12842 27406-27410 IN denotes from
T12841 27397-27405 NNS denotes extracts
T12840 27389-27396 JJ denotes nuclear
T12839 27383-27388 VBG denotes using
T12838 27381-27382 -RRB- denotes )
T12837 27377-27381 NNP denotes EMSA
T12836 27376-27377 -LRB- denotes (
T12835 27370-27375 NN denotes assay
T12834 27364-27369 NN denotes shift
T12833 27355-27363 NN denotes mobility
T12832 27339-27354 JJ denotes electrophoretic
T12831 27336-27338 IN denotes by
T12830 27323-27335 VBN denotes investigated
T12829 27319-27322 VBD denotes was
T12828 27317-27318 -RRB- denotes )
T12827 27314-27317 CD denotes 192
T12826 27313-27314 NN denotes −
T12825 27312-27313 CD denotes /
T12824 27309-27312 CD denotes 203
T12823 27308-27309 FW denotes −
T12822 27307-27308 -LRB- denotes (
T12821 27299-27306 NN denotes element
T12820 27293-27298 NNP denotes C/EBP
T12819 27284-27292 JJ denotes putative
T12818 27280-27283 DT denotes the
T12817 27277-27279 TO denotes to
T12816 27269-27276 JJ denotes binding
T12815 27262-27268 NN denotes factor
T12814 27254-27261 NNP denotes Nuclear
T12813 27242-27253 NNP denotes Macrophages
T12812 27236-27241 CD denotes 264.7
T12811 27232-27235 NNP denotes RAW
T12810 27227-27231 IN denotes from
T12809 27220-27226 NNP denotes Factor
T12808 27212-27219 NNP denotes Nuclear
T12807 27200-27211 JJ denotes LPS-induced
T12806 27197-27199 DT denotes an
T12805 27194-27196 IN denotes by
T12804 27188-27193 VBN denotes Bound
T12803 27185-27187 VBZ denotes is
T12802 27177-27184 NNP denotes Element
T12801 27171-27176 NNP denotes C/EBP
T12800 27167-27170 DT denotes The
T12107 24979-24986 VB denotes disrupt
T12106 24976-24978 TO denotes to
T12105 24967-24975 VBN denotes designed
T12104 24954-24966 NN denotes substitution
T12103 24943-24953 NN denotes nucleotide
T12102 24940-24942 IN denotes by
T12101 24931-24939 VBN denotes targeted
T12100 24926-24930 VBD denotes were
T12099 24924-24925 NNP denotes ]
T12098 24922-24924 CD denotes 57
T12097 24921-24922 NNP denotes [
T12096 24915-24920 NNS denotes genes
T12095 24909-24914 JJ denotes other
T12094 24906-24908 IN denotes in
T12093 24892-24905 NN denotes transcription
T12092 24878-24891 JJ denotes LPS-inducible
T12091 24870-24877 VB denotes mediate
T12090 24867-24869 TO denotes to
T12089 24858-24866 VBD denotes reported
T12088 24847-24857 RB denotes previously
T12087 24839-24846 NNS denotes factors
T12086 24825-24838 NN denotes transcription
T12085 24821-24824 IN denotes for
T12084 24815-24820 NNS denotes sites
T12083 24807-24814 JJ denotes binding
T12082 24797-24806 NN denotes candidate
T13070 28577-28584 VB denotes contain
T13069 28574-28576 TO denotes to
T13068 28567-28573 JJ denotes likely
T13067 28564-28566 VBZ denotes is
T13066 28559-28563 WDT denotes that
T13065 28551-28558 NN denotes complex
T13064 28537-28550 JJ denotes LPS-inducible
T13063 28535-28536 DT denotes a
T13062 28529-28534 VBZ denotes binds
T13061 28525-28528 CD denotes 192
T13060 28524-28525 NN denotes −
T13059 28523-28524 NN denotes /
T13058 28520-28523 CD denotes 203
T13057 28519-28520 CD denotes −
T13056 28516-28518 IN denotes at
T13055 28511-28515 NN denotes site
T13054 28505-28510 NNP denotes C/EBP
T13053 28496-28504 NNP denotes SerpinB2
T13052 28487-28495 JJ denotes putative
T13051 28483-28486 DT denotes the
T13050 28478-28482 IN denotes that
T13049 28469-28477 VBP denotes indicate
T13048 28464-28468 NNS denotes data
T13047 28458-28463 DT denotes these
T13046 28449-28457 RB denotes Together
T13045 28447-28448 . denotes .
T13044 28446-28447 -RRB- denotes )
T13043 28445-28446 CD denotes 7
T13042 28441-28444 CC denotes and
T13041 28439-28440 CD denotes 6
T13040 28433-28438 NNS denotes lanes
T13039 28431-28432 , denotes ,
T13038 28429-28431 NNP denotes 5B
T13037 28424-28428 NNP denotes Fig.
T13036 28423-28424 -LRB- denotes (
T13035 28407-28422 NN denotes oligonucleotide
T13034 28399-28406 VBN denotes mutated
T13033 28395-28398 DT denotes the
T13032 28392-28394 IN denotes by
T13031 28388-28391 RB denotes not
T13030 28384-28387 CC denotes but
T13029 28382-28383 , denotes ,
T13028 28381-28382 -RRB- denotes )
T13027 28380-28381 CD denotes 9
T13026 28376-28379 CC denotes and
T13025 28374-28375 CD denotes 8
T13024 28368-28373 NNS denotes lanes
T13023 28366-28367 , denotes ,
T13022 28364-28366 NNP denotes 5B
T13021 28359-28363 NNP denotes Fig.
T13020 28358-28359 -LRB- denotes (
T13019 28349-28357 NN denotes promoter
T13018 28341-28348 NN denotes albumin
T13017 28337-28340 NN denotes rat
T13016 28333-28336 DT denotes the
T13015 28328-28332 IN denotes from
T13014 28323-28327 NN denotes site
T13013 28315-28322 JJ denotes binding
T13012 28309-28314 NNP denotes C/EBP
T13011 28303-28308 VBN denotes known
T13010 28301-28302 DT denotes a
T13009 28298-28300 IN denotes of
T13008 28289-28297 NN denotes sequence
T13007 28285-28288 DT denotes the
T13006 28282-28284 CC denotes or
T13005 28280-28281 -RRB- denotes )
T13004 28279-28280 CD denotes 5
T13003 28275-28278 CC denotes and
T13002 28273-28274 CD denotes 4
T13001 28267-28272 NNS denotes lanes
T13000 28265-28266 , denotes ,
T12999 28263-28265 NNP denotes 5B
T12998 28258-28262 NNP denotes Fig.
T12997 28257-28258 -LRB- denotes (
T12996 28248-28256 NN denotes sequence
T12995 28243-28247 JJ denotes same
T12994 28239-28242 DT denotes the
T12993 28232-28238 CC denotes either
T12992 28223-28231 VBG denotes carrying
T12991 28221-28222 , denotes ,
T12990 28206-28221 NN denotes oligonucleotide
T12989 28190-28205 JJ denotes double-stranded
T12988 28180-28189 JJ denotes unlabeled
T12987 28177-28179 IN denotes of
T12986 28170-28176 NN denotes excess
T12985 28167-28169 DT denotes an
T12984 28164-28166 IN denotes by
T12983 28154-28163 VBN denotes abolished
T12982 28151-28153 VB denotes be
T12981 28145-28150 MD denotes could
T12980 28141-28144 CC denotes and
T12979 28135-28140 NN denotes probe
T12978 28119-28134 NN denotes oligonucleotide
T12977 28113-28118 NNP denotes C/EBP
T12976 28106-28112 JJ denotes mutant
T12975 28102-28105 DT denotes the
T12974 28096-28101 VBG denotes using
T12973 28087-28095 VBN denotes detected
T12972 28083-28086 RB denotes not
T12971 28079-28082 VBD denotes was
T12970 28071-28078 NN denotes complex
T12969 28057-28070 JJ denotes LPS-inducible
T12968 28053-28056 DT denotes The
T12967 28051-28052 . denotes .
T12966 28048-28051 NNP denotes LPS
T12965 28045-28047 IN denotes by
T12964 28037-28044 VBN denotes induced
T12963 28033-28036 VBD denotes was
T12962 28025-28032 NN denotes complex
T12961 28023-28024 -RRB- denotes )
T12960 28014-28023 NN denotes migrating
T12959 28006-28013 JJS denotes slowest
T12958 28005-28006 -LRB- denotes (
T12957 27995-28004 NN denotes uppermost
T12956 27991-27994 DT denotes the
T12955 27985-27990 IN denotes while
T12954 27983-27984 -RRB- denotes )
T12953 27981-27983 NNP denotes 5A
T12952 27976-27980 NNP denotes Fig.
T12951 27975-27976 -LRB- denotes (
T12950 27971-27974 NNP denotes DNA
T12949 27962-27970 VBD denotes stranded
T12948 27955-27961 JJ denotes single
T12947 27950-27954 IN denotes with
T12946 27940-27949 NNS denotes complexes
T12945 27930-27939 VBP denotes represent
T12944 27928-27929 -RRB- denotes )
T12943 27925-27928 NNP denotes III
T12942 27923-27924 , denotes ,
T12941 27921-27923 NNP denotes II
T12940 27919-27920 , denotes ,
T12939 27918-27919 PRP denotes I
T12938 27917-27918 -LRB- denotes (
T12937 27911-27916 NNS denotes bands
T12936 27905-27910 DT denotes these
T12935 27902-27904 IN denotes of
T12934 27896-27901 CD denotes Three
T12933 27894-27895 . denotes .
T12932 27893-27894 -RRB- denotes )
T12893 27678-27681 NNP denotes EBP
T12892 27677-27678 NN denotes /
T12891 27666-27677 NN denotes pGLmP-539mC
T12890 27663-27665 IN denotes in
T12889 27660-27662 IN denotes as
T12888 27651-27659 NN denotes mutation
T12887 27646-27650 JJ denotes same
T12886 27642-27645 DT denotes the
T12885 27631-27641 VBG denotes containing
T12884 27623-27630 NN denotes element
T12883 27614-27622 NNP denotes SerpinB2
T12882 27607-27613 JJ denotes mutant
T12881 27605-27606 DT denotes a
T12880 27603-27604 -RRB- denotes )
T12879 27602-27603 LS denotes 2
T12878 27601-27602 -LRB- denotes (
T12877 27599-27600 , denotes ,
T12876 27598-27599 -RRB- denotes )
T12875 27595-27598 CD denotes 192
T12874 27594-27595 NN denotes −
T12873 27593-27594 CD denotes /
T12872 27590-27593 CD denotes 203
T12871 27589-27590 FW denotes −
T12870 27588-27589 -LRB- denotes (
T12869 27580-27587 NN denotes element
T12868 27574-27579 NNP denotes C/EBP
T12867 27565-27573 NNP denotes SerpinB2
T12866 27556-27564 JJ denotes putative
T12865 27552-27555 DT denotes the
T12864 27550-27551 -RRB- denotes )
T12863 27549-27550 CD denotes 1
T12862 27548-27549 -LRB- denotes (
T12861 27535-27547 VBG denotes representing
T12860 27533-27534 , denotes ,
T12859 27529-27533 NNP denotes EMSA
T12858 27525-27528 IN denotes for
T12857 27520-27524 VBN denotes used
T12856 27515-27519 VBD denotes were
T12363 27164-27165 . denotes .
T12362 27156-27164 NN denotes promoter
T12361 27147-27155 JJ denotes proximal
T12360 27138-27146 NNP denotes SerpinB2
T12359 27134-27137 DT denotes the
T12358 27129-27133 IN denotes from
T12357 27115-27128 NN denotes transcription
T12356 27101-27114 JJ denotes LPS-inducible
T12355 27097-27100 IN denotes for
T12354 27088-27096 JJ denotes critical
T12353 27084-27087 VBP denotes are
T12352 27075-27083 NNS denotes elements
T12351 27064-27074 JJ denotes cis-acting
T12350 27059-27063 JJ denotes AP-1
T12349 27054-27058 DT denotes both
T12348 27050-27053 CC denotes and
T12347 27046-27049 NNP denotes CRE
T12346 27042-27045 DT denotes the
T12345 27039-27041 IN denotes as
T12344 27034-27038 RB denotes well
T12343 27031-27033 RB denotes as
T12342 27029-27030 , denotes ,
T12341 27022-27029 NN denotes element
T12340 27016-27021 NNP denotes C/EBP
T12339 27012-27015 DT denotes the
T12338 27007-27011 IN denotes that
T12337 27002-27006 VBP denotes show
T12336 26997-27001 NNS denotes data
T12335 26991-26996 DT denotes These
T12334 26989-26990 . denotes .
T12333 26981-26989 NN denotes promoter
T12332 26972-26980 NNP denotes SerpinB2
T12331 26965-26971 NN denotes murine
T12330 26961-26964 DT denotes the
T12329 26956-26960 IN denotes from
T12328 26947-26955 NN denotes activity
T12327 26936-26946 NN denotes luciferase
T12326 26922-26935 JJ denotes LPS-inducible
T12325 26914-26921 VBN denotes reduced
T12324 26900-26913 RB denotes significantly
T12323 26897-26899 CC denotes or
T12322 26886-26896 RB denotes completely
T12321 26884-26885 , denotes ,
T12320 26882-26884 CD denotes 88
T12319 26881-26882 NN denotes −
T12318 26880-26881 NN denotes /
T12317 26878-26880 CD denotes 94
T12316 26877-26878 CD denotes −
T12315 26873-26876 CC denotes and
T12314 26869-26872 CD denotes 100
T12313 26868-26869 NN denotes −
T12312 26867-26868 NN denotes /
T12311 26864-26867 CD denotes 106
T12310 26863-26864 CD denotes −
T12309 26860-26862 IN denotes at
T12308 26854-26859 NNS denotes sites
T12307 26849-26853 JJ denotes AP-1
T12306 26845-26848 CD denotes two
T12305 26841-26844 DT denotes the
T12304 26838-26840 IN denotes of
T12303 26831-26837 DT denotes either
T12302 26828-26830 CC denotes or
T12301 26824-26827 CD denotes 172
T12300 26823-26824 NN denotes −
T12299 26822-26823 NN denotes /
T12298 26819-26822 CD denotes 177
T11381 23848-23849 . denotes .
T11380 23847-23848 NNP denotes ]
T11379 23845-23847 CD denotes 56
T11378 23844-23845 NNP denotes [
T11377 23842-23843 : denotes ;
T11376 23841-23842 NNP denotes ]
T11375 23839-23841 CD denotes 30
T11374 23838-23839 NNP denotes [
T11373 23836-23837 : denotes ;
T11372 23835-23836 NNP denotes ]
T11371 23833-23835 CD denotes 16
T11370 23832-23833 NNP denotes [
T11369 23822-23831 VBN denotes conserved
T11368 23817-23821 RB denotes well
T11367 23812-23816 RB denotes also
T11366 23808-23811 VBP denotes are
T11365 23806-23807 -RRB- denotes )
T12931 27891-27893 NNP denotes 5A
T12930 27886-27890 NNP denotes Fig.
T12929 27885-27886 -LRB- denotes (
T12928 27876-27884 VBN denotes detected
T12927 27871-27875 VBD denotes were
T12926 27861-27870 NNS denotes complexes
T12925 27853-27860 NN denotes protein
T12924 27841-27852 JJ denotes DNA-nuclear
T12923 27828-27840 VBG denotes representing
T12922 27826-27827 , denotes ,
T12921 27816-27826 NNS denotes mobilities
T12920 27806-27815 JJ denotes different
T12919 27803-27805 IN denotes of
T12918 27797-27802 NNS denotes bands
T12917 27792-27796 CD denotes Four
T12898 27690-27693 DT denotes the
T12897 27688-27689 -RRB- denotes )
T12896 27687-27688 LS denotes 3
T12895 27686-27687 -LRB- denotes (
T12894 27682-27685 CC denotes and
T12081 24789-24796 JJ denotes several
T12080 24787-24788 , denotes ,
T12079 24774-24787 NN denotes transcription
T12078 24760-24773 JJ denotes LPS-inducible
T12077 24756-24759 IN denotes for
T12076 24746-24755 JJ denotes essential
T12075 24742-24745 CD denotes 189
T12074 24741-24742 CD denotes −
T12073 24737-24740 CC denotes and
T12072 24733-24736 CD denotes 539
T12071 24732-24733 CD denotes −
T12070 24724-24731 IN denotes between
T12069 24715-24723 NNS denotes elements
T12068 24704-24714 JJ denotes regulatory
T12067 24692-24703 VB denotes investigate
T12066 24689-24691 TO denotes To
T12065 24675-24688 NNP denotes Transcription
T12064 24661-24674 NNP denotes LPS-inducible
T12063 24653-24660 NNP denotes Optimal
T12062 24649-24652 IN denotes for
T12061 24639-24648 JJ denotes Essential
T12060 24635-24638 VBP denotes are
T12059 24626-24634 NNP denotes Promoter
T12058 24617-24625 NNP denotes Proximal
T12057 24612-24616 NNP denotes Gene
T12056 24603-24611 NNP denotes SerpinB2
T12055 24596-24602 NNP denotes Murine
T12054 24592-24595 DT denotes the
T12053 24589-24591 IN denotes in
T12052 24583-24588 NNS denotes Sites
T12051 24578-24582 JJ denotes AP-1
T12050 24574-24577 CD denotes Two
T12049 24570-24573 CC denotes and
T12048 24566-24569 NNP denotes CRE
T12047 24564-24565 , denotes ,
T12046 24559-24564 NNP denotes C/EBP
T12045 24557-24558 DT denotes A
T11364 23804-23806 CD denotes S2
T11363 23802-23803 . denotes .
T11362 23799-23802 NN denotes Fig
T11361 23798-23799 -LRB- denotes (
T11360 23793-23797 CD denotes 1351
T11359 23792-23793 NN denotes −
T11358 23791-23792 NN denotes /
T11357 23787-23791 CD denotes 1342
T11356 23786-23787 CD denotes −
T11355 23783-23785 IN denotes at
T11354 23778-23782 NN denotes site
T11353 23770-23777 JJ denotes binding
T11352 23766-23769 CD denotes p65
T11351 23760-23765 NNP denotes NF-κB
T11350 23758-23759 DT denotes a
T11349 23754-23757 CC denotes and
T11348 23749-23753 CD denotes 1528
T11347 23748-23749 NN denotes −
T11346 23747-23748 NN denotes /
T11345 23743-23747 CD denotes 1540
T11344 23742-23743 CD denotes −
T11343 23739-23741 IN denotes at
T11342 23731-23738 NN denotes element
T11341 23722-23730 NN denotes silencer
T11340 23714-23721 NN denotes PAUSE-1
T11339 23712-23713 DT denotes a
T11317 23627-23633 NN denotes region
T11316 23618-23626 NN denotes promoter
T11315 23609-23617 JJ denotes proximal
T11314 23605-23608 DT denotes the
T11313 23598-23604 IN denotes within
T11312 23587-23597 VBN denotes identified
T11311 23582-23586 RB denotes also
T11310 23577-23581 VBD denotes were
T11309 23575-23576 -RRB- denotes )
T11308 23572-23575 CD denotes 288
T11307 23571-23572 NN denotes −
T11306 23570-23571 CD denotes /
T11305 23567-23570 CD denotes 296
T11304 23566-23567 FW denotes −
T11303 23565-23566 -LRB- denotes (
T11302 23559-23564 NNP denotes Oct-1
T11301 23555-23558 CC denotes and
T11300 23553-23554 -RRB- denotes )
T11299 23550-23553 CD denotes 407
T11298 23549-23550 NN denotes −
T11297 23548-23549 CD denotes /
T11296 23545-23548 CD denotes 412
T11295 23544-23545 NN denotes −
T11294 23543-23544 -LRB- denotes (
T11293 23540-23542 CD denotes .1
T11292 23538-23540 NNP denotes PU
T11291 23534-23537 IN denotes for
T11290 23528-23533 NNS denotes sites
T11289 23520-23527 JJ denotes binding
T11288 23510-23519 JJ denotes potential
T11287 23507-23509 IN denotes as
T11286 23502-23506 RB denotes well
T11285 23499-23501 RB denotes as
T11284 23497-23498 , denotes ,
T11283 23496-23497 -RRB- denotes )
T11282 23493-23496 CD denotes 533
T11281 23492-23493 NN denotes −
T11280 23491-23492 CD denotes /
T11279 23488-23491 CD denotes 538
T11278 23487-23488 FW denotes −
T11277 23486-23487 -LRB- denotes (
T11276 23482-23485 NN denotes box
T11275 23480-23481 NNP denotes E
T11274 23470-23479 NN denotes consensus
T11273 23468-23469 DT denotes A
T11272 23466-23467 . denotes .
T11271 23465-23466 NNP denotes ]
T11270 23463-23465 CD denotes 55
T11269 23462-23463 NNP denotes [
T11268 23460-23461 : denotes ;
T11267 23459-23460 NNP denotes ]
T11266 23457-23459 CD denotes 37
T11265 23456-23457 NNP denotes [
T11264 23445-23455 NN denotes nucleotide
T11263 23437-23444 JJ denotes central
T11262 23430-23436 JJ denotes single
T11261 23428-23429 DT denotes a
T11260 23425-23427 IN denotes of
T11259 23416-23424 NN denotes identity
T11258 23412-23415 DT denotes the
T11257 23409-23411 IN denotes in
T11256 23401-23408 VBZ denotes differs
T11255 23397-23400 NNP denotes CRE
T11254 23393-23396 DT denotes the
T11253 23389-23392 CC denotes and
T11252 23387-23388 , denotes ,
T11251 23379-23387 NN denotes promoter
T11250 23370-23378 NNP denotes SERPINB2
T11249 23364-23369 JJ denotes human
T11248 23360-23363 DT denotes the
T11247 23357-23359 IN denotes in
T11246 23346-23356 VBN denotes identified
T11245 23340-23345 DT denotes those
T11244 23337-23339 TO denotes to
T11243 23328-23336 NN denotes sequence
T11242 23325-23327 IN denotes in
T11241 23315-23324 JJ denotes identical
T11240 23311-23314 VBP denotes are
T11239 23305-23310 NNS denotes sites
T11238 23300-23304 JJ denotes AP-1
T11237 23296-23299 DT denotes the
T11236 23293-23295 IN denotes of
T11235 23288-23292 DT denotes Both
T11234 23286-23287 . denotes .
T11233 23283-23286 CD denotes 177
T11232 23282-23283 CD denotes −
T11231 23281-23282 NN denotes /
T11230 23278-23281 CD denotes 172
T11229 23277-23278 CD denotes −
T11228 23274-23276 IN denotes at
T11227 23266-23273 JJ denotes present
T11226 23263-23265 VBZ denotes is
T11225 23261-23262 -RRB- denotes )
T11224 23258-23261 NNP denotes CRE
T11223 23257-23258 -LRB- denotes (
T11222 23249-23256 NN denotes element
T11221 23240-23248 NN denotes response
T11220 23236-23239 NNP denotes AMP
T11219 23229-23235 JJ denotes cyclic
T11218 23220-23228 JJ denotes putative
T11217 23218-23219 DT denotes a
T11216 23214-23217 CC denotes and
T11215 23212-23213 , denotes ,
T11214 23209-23212 CD denotes 106
T11213 23208-23209 NN denotes −
T11212 23207-23208 CD denotes /
T11211 23204-23207 CD denotes 100
T11210 23203-23204 CD denotes −
T11209 23199-23202 CC denotes and
T11208 23196-23198 CD denotes 94
T11207 23195-23196 NN denotes −
T11206 23194-23195 CD denotes /
T11205 23192-23194 CD denotes 88
T11204 23191-23192 VBP denotes −
T11203 23179-23190 NNS denotes nucleotides
T11202 23176-23178 IN denotes at
T11201 23170-23175 VBN denotes found
T11200 23166-23169 VBP denotes are
T11199 23160-23165 NNS denotes sites
T11198 23152-23159 JJ denotes binding
T11197 23150-23151 -RRB- denotes )
T11196 23146-23150 NN denotes AP-1
T11195 23145-23146 -LRB- denotes (
T11194 23143-23144 CD denotes 1
T11193 23135-23142 NN denotes protein
T11192 23125-23134 NN denotes activator
T11191 23115-23124 JJ denotes potential
T11190 23111-23114 CD denotes two
T11189 23109-23110 , denotes ,
T11188 23106-23109 CD denotes 203
T11187 23105-23106 NN denotes −
T11186 23104-23105 NN denotes /
T11185 23101-23104 CD denotes 192
T11184 23100-23101 CD denotes −
T11183 23097-23099 IN denotes at
T11182 23089-23096 JJ denotes present
T11181 23086-23088 VBZ denotes is
T11180 23081-23085 NN denotes site
T11179 23079-23080 -RRB- denotes )
T11178 23074-23079 NNP denotes C/EBP
T11177 23073-23074 -LRB- denotes (
T11176 23065-23072 NN denotes protein
T11175 23057-23064 JJ denotes binding
T11174 23048-23056 NN denotes enhancer
T11173 23042-23047 NNP denotes CCAAT
T11172 23033-23041 JJ denotes putative
T11171 23031-23032 DT denotes A
T11170 23029-23030 . denotes .
T11169 23028-23029 NNP denotes ]
T11168 23026-23028 CD denotes 54
T11167 23025-23026 NNP denotes [
T11166 23023-23024 : denotes ;
T11165 23022-23023 NNP denotes ]
T11164 23020-23022 CD denotes 53
T11163 23019-23020 NNP denotes [
T11162 23014-23018 NN denotes gene
T11161 23005-23013 NNP denotes SERPINB2
T11160 22999-23004 JJ denotes human
T11159 22995-22998 DT denotes the
T11158 22992-22994 IN denotes of
T11157 22988-22991 NN denotes box
T11156 22983-22987 NNP denotes TATA
T11155 22979-22982 DT denotes the
T11154 22976-22978 IN denotes of
T11153 22967-22975 NN denotes position
T11152 22963-22966 DT denotes the
T11151 22960-22962 TO denotes to
T11150 22952-22959 JJ denotes similar
T11149 22950-22951 , denotes ,
T11148 22946-22950 NN denotes site
T11147 22935-22945 NN denotes initiation
T11146 22921-22934 NN denotes transcription
T11145 22917-22920 DT denotes the
T11144 22912-22916 IN denotes from
T11143 22903-22911 RB denotes upstream
T11142 22898-22902 CD denotes 29bp
T11141 22895-22897 TO denotes to
T11140 22892-22894 CD denotes 23
T11139 22884-22891 VBN denotes located
T11138 22881-22883 VBZ denotes is
T11137 22872-22880 NN denotes sequence
T11136 22862-22871 NN denotes consensus
T11135 22857-22861 NNP denotes TATA
T11134 22855-22856 DT denotes a
T11133 22853-22854 , denotes ,
T11132 22841-22853 RB denotes Specifically
T11131 22839-22840 . denotes .
T11130 22838-22839 -RRB- denotes )
T11129 22837-22838 LS denotes 3
T11128 22832-22836 FW denotes Fig.
T12916 27790-27791 . denotes .
T12915 27786-27790 NN denotes site
T12914 27778-27785 JJ denotes binding
T12913 27772-27777 NNP denotes C/EBP
T12912 27763-27771 NN denotes affinity
T12911 27758-27762 JJ denotes high
T12910 27756-27757 DT denotes a
T12909 27745-27755 VBG denotes containing
T12908 27738-27744 NN denotes region
T12907 27736-27737 -RRB- denotes )
T12906 27733-27736 NNP denotes DEI
T12905 27732-27733 -LRB- denotes (
T12904 27730-27731 CD denotes 1
T12903 27722-27729 NN denotes element
T12902 27715-27721 JJ denotes distal
T12901 27706-27714 NN denotes promoter
T12900 27698-27705 NN denotes albumin
T12899 27694-27697 NN denotes rat
T11127 22831-22832 -LRB- denotes (
T11126 22822-22830 NN denotes promoter
T11125 22813-22821 NNP denotes SerpinB2
T11124 22806-22812 NN denotes murine
T11123 22802-22805 DT denotes the
T11122 22799-22801 IN denotes in
T11121 22789-22798 VBN denotes conserved
T11120 22785-22788 VBP denotes are
T11119 22776-22784 NN denotes promoter
T11118 22767-22775 NN denotes proximal
T11117 22758-22766 NNP denotes SerpinB2
T11116 22752-22757 JJ denotes human
T11115 22748-22751 DT denotes the
T11114 22745-22747 IN denotes in
T11113 22737-22744 VBN denotes defined
T11112 22728-22736 NNS denotes elements
T11111 22717-22727 JJ denotes regulatory
T11110 22706-22716 JJ denotes cis-acting
T11109 22702-22705 DT denotes the
T11108 22699-22701 IN denotes of
T11107 22691-22698 JJ denotes several
T11106 22686-22690 IN denotes that
T11105 22677-22685 VBD denotes revealed
T11104 22675-22676 NNP denotes E
T11103 22668-22674 NNP denotes Region
T11102 22665-22667 IN denotes of
T11076 22525-22527 NNP denotes 2C
T11075 22520-22524 NNP denotes Fig.
T11074 22519-22520 -LRB- denotes (
T11073 22509-22518 NNS denotes promoters
T11072 22502-22508 JJ denotes murine
T11071 22498-22501 CC denotes and
T11070 22492-22497 JJ denotes human
T11069 22488-22491 DT denotes the
T11068 22480-22487 IN denotes between
T11067 22478-22479 -RRB- denotes )
T11066 22475-22478 NNP denotes A-E
T11065 22474-22475 -LRB- denotes (
T11064 22466-22473 NNS denotes regions
T11063 22455-22465 RB denotes homologous
T11062 22447-22454 RB denotes broadly
T11061 22442-22446 CD denotes five
T11060 22431-22441 VBD denotes delineated
T11059 22422-22430 NNS denotes elements
T11058 22413-22421 NN denotes sequence
T11057 22402-22412 JJ denotes repetitive
T11056 22394-22401 JJ denotes several
T11055 22391-22393 IN denotes of
T11054 22382-22390 NN denotes presence
T11053 22378-22381 DT denotes The
T11052 22376-22377 . denotes .
T11051 22375-22376 NNP denotes ]
T11050 22373-22375 CD denotes 52
T11049 22372-22373 NNP denotes [
T11048 22361-22371 NN denotes expression
T11047 22356-22360 NN denotes gene
T11046 22347-22355 NNP denotes SerpinB2
T11045 22344-22346 IN denotes of
T11044 22333-22343 NN denotes regulation
T11043 22329-22332 DT denotes the
T11042 22326-22328 IN denotes in
T11041 22321-22325 NN denotes role
T11040 22319-22320 DT denotes a
T11039 22314-22318 VB denotes play
T11038 22308-22313 MD denotes might
T11037 22301-22307 NN denotes region
T11036 22296-22300 DT denotes this
T11035 22293-22295 IN denotes in
T11034 22287-22292 NNS denotes sites
T11033 22279-22286 JJ denotes binding
T11032 22272-22278 NN denotes factor
T11031 22258-22271 NN denotes transcription
T11030 22248-22257 JJ denotes potential
T11029 22246-22247 , denotes ,
T11028 22237-22246 VBN denotes conserved
T11027 22222-22236 RB denotes evolutionarily
T11026 22219-22221 IN denotes of
T11025 22210-22218 NN denotes presence
T11024 22206-22209 DT denotes the
T11023 22201-22205 IN denotes that
T11022 22192-22200 VBD denotes reasoned
T11021 22189-22191 PRP denotes We
T11020 22187-22188 . denotes .
T11019 22180-22187 NNS denotes regions
T11018 22171-22179 NN denotes flanking
T11017 22169-22170 NN denotes ′
T11016 22168-22169 CD denotes 5
T11015 22159-22167 NN denotes SerpinB2
T11014 22153-22158 JJ denotes human
T11013 22149-22152 CC denotes and
T11012 22142-22148 NN denotes murine
T11011 22138-22141 DT denotes the
T11010 22130-22137 VBD denotes aligned
T11009 22127-22129 PRP denotes we
T11008 22125-22126 , denotes ,
T11007 22122-22125 NNP denotes LPS
T11006 22119-22121 TO denotes to
T11005 22110-22118 NN denotes response
T11004 22106-22109 DT denotes the
T11003 22102-22105 CC denotes and
T11002 22097-22101 NN denotes gene
T11001 22088-22096 NNP denotes SerpinB2
T11000 22081-22087 NN denotes murine
T10999 22077-22080 DT denotes the
T10998 22074-22076 IN denotes of
T10997 22060-22073 NN denotes transcription
T10996 22052-22059 VB denotes mediate
T10995 22046-22051 MD denotes might
T10994 22041-22045 WDT denotes that
T10993 22032-22040 NNS denotes elements
T10992 22021-22031 JJ denotes cis-acting
T10991 22011-22020 JJ denotes potential
T10990 22007-22010 IN denotes for
T10989 22002-22006 VB denotes look
T10988 21999-22001 TO denotes To
T10987 21989-21998 NNP denotes Promoters
T10986 21980-21988 NNP denotes Proximal
T10985 21971-21979 NNP denotes SerpinB2
T10984 21964-21970 NNP denotes Murine
T10983 21960-21963 CC denotes and
T10982 21954-21959 NNP denotes Human
T10981 21950-21953 DT denotes the
T10980 21943-21949 IN denotes within
T10979 21930-21942 NNP denotes Conservation
T10978 21921-21929 NN denotes Sequence
T11338 23710-23711 , denotes ,
T11337 23706-23710 CD denotes 1340
T11336 23705-23706 NN denotes −
T11335 23704-23705 NN denotes /
T11334 23700-23704 CD denotes 1349
T11333 23699-23700 CD denotes −
T11332 23696-23698 IN denotes at
T11331 23688-23695 NN denotes element
T11330 23679-23687 NN denotes response
T11329 23674-23678 NN denotes acid
T11328 23665-23673 JJ denotes retinoic
T11327 23663-23664 DT denotes a
T11326 23661-23662 , denotes ,
T11325 23653-23661 JJ denotes upstream
T11324 23645-23652 JJ denotes Further
T11323 23643-23644 . denotes .
T11322 23642-23643 -RRB- denotes )
T11321 23640-23642 CD denotes S2
T11320 23638-23639 . denotes .
T11319 23635-23638 NNP denotes Fig
T11318 23634-23635 -LRB- denotes (
T11101 22656-22664 NN denotes analysis
T11100 22648-22655 JJ denotes Further
T11099 22646-22647 . denotes .
T11098 22638-22646 NN denotes homology
T11097 22629-22637 JJS denotes greatest
T11096 22625-22628 DT denotes the
T11095 22615-22624 VBD denotes exhibited
T11094 22613-22614 , denotes ,
T11093 22606-22613 NN denotes element
T11092 22597-22605 NN denotes response
T11091 22593-22596 NNP denotes LPS
T11090 22583-22592 JJ denotes essential
T11089 22579-22582 DT denotes the
T11088 22570-22578 VBZ denotes contains
T11087 22564-22569 WDT denotes which
T11086 22562-22563 , denotes ,
T11085 22561-22562 -RRB- denotes )
T11084 22560-22561 NNP denotes E
T11083 22553-22559 NNP denotes Region
T11082 22552-22553 -LRB- denotes (
T11081 22543-22551 NN denotes promoter
T11080 22534-22542 JJ denotes proximal
T11079 22530-22533 DT denotes The
T11078 22528-22529 . denotes .
T11077 22527-22528 -RRB- denotes )
T10329 20356-20358 CD denotes 87
T10328 20355-20356 NN denotes −
T10327 20344-20354 NN denotes nucleotide
T10326 20341-20343 IN denotes of
T10325 20330-20340 JJ denotes downstream
T10324 20326-20329 VBP denotes lie
T10323 20321-20325 RB denotes also
T10322 20317-20320 NNP denotes PMA
T10321 20314-20316 TO denotes to
T10320 20305-20313 NN denotes promoter
T10319 20296-20304 NNP denotes SerpinB2
T10318 20289-20295 NN denotes murine
T10317 20285-20288 DT denotes the
T10316 20282-20284 IN denotes of
T10315 20273-20281 NN denotes response
T10314 20269-20272 DT denotes the
T10313 20259-20268 VBG denotes mediating
T10312 20250-20258 NNS denotes elements
T10311 20239-20249 JJ denotes cis-acting
T10310 20234-20238 IN denotes that
T10309 20223-20233 VBG denotes indicating
T10308 20221-20222 , denotes ,
T10307 20218-20221 NNP denotes PMA
T10306 20215-20217 TO denotes to
T10305 20204-20214 JJ denotes responsive
T10304 20194-20203 RB denotes partially
T10303 20188-20193 RB denotes still
T10302 20184-20187 VBD denotes was
T10301 20174-20183 VBP denotes construct
T10300 20165-20173 NN denotes promoter
T10174 19456-19460 IN denotes from
T10173 19449-19455 NN denotes region
T10172 19440-19448 NN denotes flanking
T10171 19438-19439 NN denotes ′
T10170 19437-19438 CD denotes 5
T10169 19428-19436 CD denotes SerpinB2
T10168 19424-19427 DT denotes the
T10167 19422-19423 , denotes ,
T10166 19420-19422 NNP denotes 2B
T10165 19415-19419 NNP denotes Fig.
T10164 19412-19414 IN denotes in
T10163 19406-19411 VBN denotes shown
T10162 19403-19405 IN denotes As
T10161 19401-19402 . denotes .
T10160 19400-19401 NNP denotes ]
T10159 19398-19400 CD denotes 51
T10158 19397-19398 NNP denotes [
T10157 19395-19396 NNP denotes ]
T10156 19393-19395 CD denotes 47
T10155 19392-19393 NNP denotes [
T10154 19390-19391 : denotes ;
T10153 19389-19390 NNP denotes ]
T10152 19387-19389 CD denotes 37
T10151 19386-19387 NNP denotes [
T10150 19384-19385 : denotes ;
T10149 19383-19384 NNP denotes ]
T10148 19381-19383 CD denotes 30
T10147 19380-19381 NNP denotes [
T10146 19371-19379 NNS denotes elements
T10145 19360-19370 JJ denotes responsive
T10144 19355-19359 NN denotes AP-1
T10143 19348-19354 JJ denotes distal
T10142 19344-19347 CC denotes and
T10141 19335-19343 JJ denotes proximal
T10140 19327-19334 JJ denotes several
T10139 19319-19326 IN denotes through
T10138 19313-19318 VB denotes occur
T10137 19310-19312 TO denotes to
T10136 19304-19309 VBN denotes shown
T10135 19299-19303 VBN denotes been
T10134 19295-19298 VBZ denotes has
T10133 19291-19294 CC denotes and
T10132 19289-19290 , denotes ,
T10131 19288-19289 NNP denotes ]
T10130 19286-19288 CD denotes 47
T10129 19285-19286 NNP denotes [
T10128 19283-19284 NNP denotes ]
T10127 19281-19283 CD denotes 45
T10126 19280-19281 NNP denotes [
T10125 19274-19279 NNS denotes lines
T10124 19269-19273 NN denotes cell
T10123 19258-19268 NN denotes macrophage
T10122 19252-19257 JJ denotes human
T10121 19249-19251 IN denotes in
T10120 19241-19248 VBN denotes studied
T10119 19229-19240 RB denotes extensively
T10118 19224-19228 VBN denotes been
T10117 19220-19223 VBZ denotes has
T10116 19209-19219 NN denotes regulation
T10115 19204-19208 NN denotes gene
T10114 19195-19203 NNP denotes SerpinB2
T10113 19183-19194 JJ denotes PMA-induced
T10112 19181-19182 . denotes .
T10111 19171-19181 NN denotes comparison
T10110 19167-19170 IN denotes for
T10109 19165-19166 , denotes ,
T10108 19162-19165 NNP denotes PMA
T10107 19159-19161 CC denotes or
T10106 19155-19158 NNP denotes LPS
T10105 19152-19154 IN denotes of
T10104 19144-19151 NN denotes absence
T10103 19140-19143 CC denotes and
T10102 19131-19139 NN denotes presence
T10101 19127-19130 DT denotes the
T10100 19124-19126 IN denotes in
T10099 19115-19123 NN denotes activity
T10098 19104-19114 NN denotes luciferase
T10097 19100-19103 IN denotes for
T10096 19092-19099 VBN denotes assayed
T10095 19088-19091 CC denotes and
T10094 19076-19087 NNS denotes macrophages
T10093 19073-19075 CD denotes .7
T10092 19067-19073 NNP denotes RAW264
T10091 19053-19066 JJ denotes sub-confluent
T10090 19048-19052 IN denotes into
T10089 19036-19047 VBN denotes transfected
T10088 19024-19035 RB denotes transiently
T10087 19019-19023 RB denotes then
T10086 19014-19018 VBD denotes were
T10085 19003-19013 NNS denotes constructs
T10084 18994-19002 NN denotes reporter
T10083 18990-18993 DT denotes The
T10082 18988-18989 . denotes .
T10081 18987-18988 -RRB- denotes )
T10080 18985-18987 NNP denotes 2A
T10079 18980-18984 NNP denotes Fig.
T10078 18979-18980 -LRB- denotes (
T10077 18977-18978 -RRB- denotes )
T10076 18972-18977 JJ denotes Basic
T10075 18967-18971 JJ denotes pGL3
T10074 18966-18967 -LRB- denotes (
T10073 18961-18965 NN denotes gene
T10072 18952-18960 NN denotes reporter
T10071 18941-18951 NN denotes luciferase
T10070 18933-18940 JJ denotes firefly
T10069 18919-18932 JJ denotes promoter-less
T10068 18917-18918 DT denotes a
T10067 18914-18916 IN denotes of
T10066 18905-18913 RB denotes upstream
T10065 18898-18904 VBN denotes cloned
T10064 18893-18897 VBD denotes were
T10063 18886-18892 NN denotes region
T10062 18877-18885 NN denotes flanking
T10061 18875-18876 NN denotes ′
T10060 18874-18875 CD denotes 5
T10059 18870-18873 DT denotes the
T10058 18867-18869 IN denotes of
T10057 18859-18866 NNS denotes mutants
T10056 18850-18858 NN denotes deletion
T10055 18840-18849 VBN denotes generated
T10054 18837-18839 IN denotes of
T10053 18830-18836 NN denotes series
T10052 18828-18829 DT denotes a
T10051 18824-18827 CC denotes and
T10050 18820-18823 CD denotes +92
T10049 18817-18819 TO denotes to
T10048 18812-18816 CD denotes 4480
T10047 18811-18812 VBP denotes −
T10046 18799-18810 NNS denotes nucleotides
T10045 18797-18798 , denotes ,
T10044 18793-18797 NN denotes gene
T10043 18784-18792 NNP denotes SerpinB2
T10042 18777-18783 NN denotes murine
T10041 18773-18776 DT denotes the
T10040 18770-18772 IN denotes of
T10039 18763-18769 NN denotes region
T10038 18754-18762 NN denotes flanking
T10037 18752-18753 NN denotes ′
T10036 18751-18752 CD denotes 5
T10035 18747-18750 DT denotes the
T10034 18744-18746 IN denotes in
T10033 18740-18743 NNP denotes LPS
T10032 18737-18739 TO denotes to
T10031 18726-18736 JJ denotes responsive
T10030 18717-18725 NNS denotes elements
T10029 18706-18716 JJ denotes regulatory
T10028 18695-18705 JJ denotes cis-acting
T10027 18683-18694 VB denotes investigate
T10026 18680-18682 TO denotes To
T10025 18665-18679 NNP denotes Responsiveness
T10024 18661-18664 NNP denotes LPS
T10023 18653-18660 VBZ denotes Confers
T10022 18644-18652 NNP denotes Promoter
T10021 18635-18643 NNP denotes Proximal
T10020 18626-18634 NNP denotes SerpinB2
T10299 20156-20164 NNP denotes SerpinB2
T10298 20149-20155 NN denotes murine
T10297 20146-20148 CD denotes 87
T10296 20145-20146 NN denotes −
T10295 20141-20144 DT denotes the
T10294 20139-20140 , denotes ,
T10293 20131-20139 NN denotes response
T10292 20127-20130 NNP denotes PMA
T10291 20123-20126 DT denotes the
T10290 20115-20122 VBD denotes reduced
T10289 20104-20114 RB denotes marginally
T10288 20100-20103 CC denotes and
T10287 20091-20099 NN denotes response
T10286 20087-20090 NNP denotes LPS
T10285 20083-20086 DT denotes the
T10284 20072-20082 VBD denotes eliminated
T10283 20069-20071 CD denotes 87
T10282 20068-20069 CD denotes −
T10281 20065-20067 TO denotes to
T10280 20061-20064 CD denotes 189
T10279 20060-20061 CD denotes −
T10278 20055-20059 IN denotes from
T10277 20046-20054 NN denotes promoter
T10276 20037-20045 NNP denotes SerpinB2
T10275 20033-20036 DT denotes the
T10274 20030-20032 IN denotes of
T10273 20021-20029 NN denotes deletion
T10272 20015-20020 IN denotes While
T10271 20013-20014 . denotes .
T10270 20005-20013 NN denotes deletion
T10269 20000-20004 DT denotes this
T10268 19997-19999 IN denotes by
T10267 19988-19996 VBN denotes affected
T10266 19983-19987 RBR denotes less
T10265 19980-19982 VBZ denotes is
T10264 19976-19979 NNP denotes PMA
T10263 19973-19975 TO denotes to
T10262 19964-19972 NN denotes promoter
T10261 19955-19963 NNP denotes SerpinB2
T10260 19948-19954 NN denotes murine
T10259 19944-19947 DT denotes the
T10258 19941-19943 IN denotes of
T10257 19932-19940 NN denotes response
T10256 19928-19931 DT denotes the
T10255 19926-19927 , denotes ,
T10254 19919-19926 RB denotes however
T10253 19917-19918 : denotes ;
T10252 19914-19917 CD denotes 189
T10251 19913-19914 CD denotes −
T10250 19909-19912 CC denotes and
T10249 19905-19908 CD denotes 539
T10248 19904-19905 CD denotes −
T10247 19896-19903 IN denotes between
T10246 19889-19895 NN denotes region
T10245 19885-19888 DT denotes the
T10244 19882-19884 IN denotes in
T10243 19874-19881 NN denotes element
T10242 19865-19873 NN denotes response
T10241 19861-19864 NNP denotes LPS
T10240 19851-19860 JJ denotes essential
T10239 19848-19850 DT denotes an
T10238 19845-19847 IN denotes of
T10237 19836-19844 NN denotes presence
T10236 19832-19835 DT denotes the
T10235 19821-19831 VBG denotes indicating
T10234 19819-19820 , denotes ,
T10233 19811-19819 NN denotes promoter
T10232 19807-19810 DT denotes the
T10231 19804-19806 IN denotes of
T10230 19791-19803 NN denotes LPS-response
T10229 19787-19790 DT denotes the
T10228 19777-19786 VBD denotes abolished
T10227 19773-19776 CD denotes 539
T10226 19772-19773 CD denotes −
T10225 19765-19771 IN denotes beyond
T10224 19756-19764 NN denotes deletion
T10223 19748-19755 JJ denotes Further
T10222 19746-19747 . denotes .
T10221 19740-19746 NN denotes region
T10220 19735-19739 DT denotes this
T10219 19732-19734 IN denotes in
T10218 19724-19731 NN denotes element
T10217 19715-19723 NN denotes silencer
T10216 19713-19714 DT denotes a
T10215 19710-19712 IN denotes of
T10214 19701-19709 NN denotes presence
T10213 19697-19700 DT denotes the
T10212 19686-19696 VBG denotes indicating
T10211 19684-19685 , denotes ,
T10210 19677-19684 JJ denotes 16-fold
T10209 19663-19676 RB denotes approximately
T10208 19660-19662 TO denotes to
T10207 19643-19659 NN denotes LPS-inducibility
T10206 19633-19642 VBD denotes increased
T10205 19628-19632 CD denotes 1341
T10204 19627-19628 CD denotes −
T10203 19624-19626 TO denotes to
T10202 19619-19623 CD denotes 1686
T10201 19618-19619 CD denotes −
T10200 19613-19617 IN denotes from
T10199 19604-19612 NN denotes promoter
T10198 19595-19603 NNP denotes SerpinB2
T10197 19588-19594 NN denotes murine
T10196 19584-19587 DT denotes the
T10195 19581-19583 IN denotes of
T10194 19572-19580 NN denotes Deletion
T10193 19570-19571 . denotes .
T10192 19558-19570 RB denotes respectively
T10191 19556-19557 , denotes ,
T10190 19550-19556 JJ denotes 7-fold
T10189 19546-19549 CC denotes and
T10188 19539-19545 JJ denotes 2-fold
T10187 19525-19538 RB denotes approximately
T10186 19523-19524 , denotes ,
T10185 19510-19523 NN denotes transcription
T10184 19496-19509 JJ denotes LPS-inducible
T10183 19492-19495 CC denotes and
T10182 19490-19491 : denotes -
T10181 19487-19490 NNP denotes PMA
T10180 19482-19486 DT denotes both
T10179 19474-19481 VBZ denotes directs
T10178 19470-19473 CD denotes +92
T10177 19467-19469 TO denotes to
T10176 19462-19466 CD denotes 4480
T10175 19461-19462 CD denotes −
T9415 18124-18125 . denotes .
T9414 18123-18124 -RRB- denotes )
T9413 18122-18123 LS denotes 1
T9412 18117-18121 FW denotes Fig.
T9411 18116-18117 -LRB- denotes (
T9410 18106-18115 NN denotes treatment
T9409 18102-18105 NNP denotes LPS
T9408 18099-18101 IN denotes of
T9407 18095-18098 NNS denotes hrs
T9406 18093-18094 CD denotes 8
T9405 18087-18092 IN denotes after
T9404 18076-18086 JJ denotes detectable
T9403 18072-18075 CC denotes and
T9402 18070-18071 , denotes ,
T9401 18069-18070 NNP denotes ]
T9400 18067-18069 CD denotes 31
T9399 18066-18067 NNP denotes [
T9398 18060-18065 NNS denotes types
T9397 18055-18059 NN denotes cell
T9396 18049-18054 JJ denotes other
T9395 18046-18048 IN denotes in
T9394 18037-18045 VBN denotes reported
T9393 18032-18036 VBN denotes been
T9392 18028-18031 VBZ denotes has
T9391 18025-18027 IN denotes as
T9390 18017-18024 VBN denotes induced
T9389 18012-18016 RB denotes also
T9388 18008-18011 VBD denotes was
T9387 17997-18007 NN denotes expression
T9386 17989-17996 NN denotes protein
T9385 17980-17988 CD denotes SerpinB2
T9384 17978-17979 . denotes .
T9383 17977-17978 NNP denotes ]
T9382 17975-17977 CD denotes 44
T9381 17974-17975 NNP denotes [
T9380 17972-17973 NNP denotes ]
T9379 17970-17972 CD denotes 42
T9378 17969-17970 NNP denotes [
T9377 17967-17968 : denotes ;
T9376 17966-17967 NNP denotes ]
T9375 17964-17966 CD denotes 29
T9374 17963-17964 NNP denotes [
T9373 17961-17962 : denotes ;
T9372 17960-17961 NNP denotes ]
T9371 17959-17960 CD denotes 5
T9370 17958-17959 NNP denotes [
T9369 17953-17957 NNP denotes mRNA
T9368 17949-17952 DT denotes the
T9367 17946-17948 IN denotes of
T9366 17932-17945 NN denotes stabilization
T9365 17928-17931 CC denotes and
T9364 17914-17927 NN denotes transcription
T9363 17909-17913 NN denotes gene
T9362 17906-17908 IN denotes in
T9361 17897-17905 NN denotes increase
T9360 17894-17896 DT denotes an
T9359 17889-17893 DT denotes both
T9358 17880-17888 VBZ denotes involves
T9357 17869-17879 NN denotes expression
T9356 17860-17868 JJ denotes SerpinB2
T9355 17848-17859 JJ denotes LPS-induced
T9354 17846-17847 . denotes .
T9353 17845-17846 NNP denotes ]
T9352 17843-17845 CD denotes 32
T9351 17842-17843 NNP denotes [
T9350 17840-17841 : denotes ;
T9349 17839-17840 NNP denotes ]
T9348 17838-17839 CD denotes 4
T9347 17837-17838 VBP denotes [
T9346 17831-17836 NNS denotes cells
T9345 17819-17830 NN denotes mononuclear
T9344 17813-17818 NN denotes blood
T9343 17802-17812 JJ denotes peripheral
T9342 17796-17801 JJ denotes human
T9341 17792-17795 CC denotes and
T9340 17780-17791 NNS denotes macrophages
T9339 17769-17779 JJ denotes peritoneal
T9338 17762-17768 JJ denotes murine
T9337 17759-17761 IN denotes in
T9336 17748-17758 RB denotes previously
T9335 17739-17747 VBN denotes reported
T9334 17734-17738 VBN denotes been
T9333 17730-17733 VBZ denotes has
T9332 17719-17729 NN denotes expression
T9331 17714-17718 NNP denotes mRNA
T9330 17705-17713 NNP denotes SerpinB2
T9329 17691-17704 JJ denotes LPS-inducible
T9328 17688-17690 IN denotes of
T9327 17678-17687 NN denotes induction
T9326 17671-17677 JJ denotes strong
T9325 17663-17670 JJ denotes similar
T9324 17661-17662 DT denotes A
T9323 17659-17660 . denotes .
T9322 17658-17659 -RRB- denotes )
T9321 17656-17658 NNP denotes 1A
T9320 17651-17655 NNP denotes Fig.
T9319 17650-17651 -LRB- denotes (
T9318 17646-17649 NNS denotes hrs
T9317 17643-17645 CD denotes 24
T9316 17640-17642 IN denotes at
T9315 17633-17639 NNS denotes levels
T9314 17625-17632 JJ denotes maximal
T9313 17616-17624 VBG denotes reaching
T9312 17614-17615 , denotes ,
T9311 17605-17614 NN denotes challenge
T9310 17601-17604 NNP denotes LPS
T9309 17591-17600 VBG denotes following
T9308 17587-17590 NN denotes min
T9307 17584-17586 CD denotes 30
T9306 17581-17583 IN denotes as
T9305 17575-17580 JJ denotes early
T9304 17572-17574 IN denotes as
T9303 17561-17571 JJ denotes detectable
T9302 17557-17560 VBD denotes was
T9301 17552-17556 NNP denotes mRNA
T9300 17543-17551 NNP denotes SerpinB2
T9299 17541-17542 , denotes ,
T9298 17538-17541 NNP denotes LPS
T9297 17535-17537 TO denotes to
T9296 17527-17534 VBN denotes exposed
T9295 17522-17526 VBD denotes were
T9294 17510-17521 NNS denotes macrophages
T9293 17507-17509 CD denotes .7
T9292 17501-17507 NNP denotes RAW264
T9291 17496-17500 WRB denotes When
T9290 17492-17495 NNP denotes LPS
T9289 17489-17491 TO denotes to
T9288 17478-17488 NNP denotes Responsive
T9287 17471-17477 NNP denotes Highly
T9286 17468-17470 VBZ denotes is
T9285 17463-17467 NNP denotes Gene
T9284 17454-17462 NNP denotes SerpinB2
T9283 17450-17453 DT denotes The
T8966 17373-17374 JJ denotes t
T8965 17363-17370 NN denotes Student
T8964 17360-17362 CC denotes or
T8963 17358-17359 -RRB- denotes )
T8962 17353-17358 NNP denotes ANOVA
T8961 17352-17353 -LRB- denotes (
T8960 17343-17351 NN denotes variance
T8959 17340-17342 IN denotes of
T8958 17331-17339 NN denotes analysis
T8957 17327-17330 DT denotes the
T8956 17321-17326 VBG denotes using
T8955 17312-17320 VBN denotes analyzed
T8954 17307-17311 VBD denotes were
T8953 17299-17306 NNS denotes Results
T8952 17297-17298 . denotes .
T8951 17292-17297 NN denotes group
T8950 17288-17291 IN denotes per
T8949 17284-17287 NNP denotes SEM
T8948 17282-17283 NN denotes ±
T8947 17277-17281 JJ denotes mean
T8946 17274-17276 IN denotes as
T8945 17264-17273 VBN denotes presented
T8944 17260-17263 VBP denotes are
T8943 17255-17259 NNP denotes Data
T8942 17246-17254 NNP denotes Analysis
T8941 17234-17245 NNP denotes Statistical
T8897 17231-17232 . denotes .
T8896 17205-17230 CD denotes TTCTTGGAAAGCTGGCACTGTGTG3
T8895 17204-17205 NN denotes ′
T8894 17203-17204 CD denotes 5
T8893 17201-17202 -RRB- denotes )
T8892 17198-17201 CD denotes +19
T8891 17197-17198 CD denotes /
T8890 17196-17197 CD denotes 5
T8889 17195-17196 FW denotes −
T8888 17194-17195 -LRB- denotes (
T8887 17186-17193 NN denotes reverse
T8886 17184-17185 : denotes ;
T8885 17158-17183 NNP denotes AAGACTCCCACAGATGGTGGCTGT3
T8884 17157-17158 CD denotes ′
T8883 17156-17157 CD denotes 5
T8882 17154-17155 -RRB- denotes )
T8881 17151-17154 CD denotes 315
T8880 17150-17151 NN denotes −
T8879 17149-17150 CD denotes /
T8878 17146-17149 CD denotes 338
T8877 17145-17146 FW denotes −
T8876 17144-17145 -LRB- denotes (
T8875 17136-17143 RB denotes forward
T8874 17134-17135 : denotes :
T8873 17126-17134 NN denotes promoter
T8872 17117-17125 JJ denotes proximal
T8871 17108-17116 NNP denotes SerpinB2
T8870 17104-17107 DT denotes the
T8869 17100-17103 IN denotes for
T8868 17091-17099 JJ denotes specific
T8867 17083-17090 NNS denotes primers
T8866 17079-17082 CC denotes and
T8865 17072-17078 NN denotes method
T8864 17066-17071 JJ denotes green
T8863 17061-17065 NNP denotes SYBR
T8862 17057-17060 DT denotes the
T8861 17051-17056 VBG denotes using
T8860 17046-17050 NNP denotes qPCR
T8859 17043-17045 IN denotes by
T8858 17040-17042 CC denotes or
T8857 17036-17039 NNP denotes PCR
T8856 17018-17035 JJ denotes semi-quantitative
T8855 17015-17017 IN denotes by
T8854 17005-17014 VBN denotes amplified
T8853 17001-17004 VBD denotes was
T8852 16997-17000 NNP denotes DNA
T8851 16995-16996 . denotes .
T8850 16994-16995 -RRB- denotes )
T8849 16988-16994 NNP denotes Qiagen
T8848 16987-16988 -LRB- denotes (
T8847 16983-16986 NNP denotes Kit
T8846 16970-16982 NNP denotes Purification
T8845 16966-16969 NNP denotes PCR
T8844 16957-16965 NNP denotes QIAquick
T8843 16953-16956 DT denotes the
T8842 16947-16952 VBG denotes using
T8841 16938-16946 VBN denotes purified
T8840 16933-16937 RB denotes then
T8839 16929-16932 VBD denotes was
T8838 16925-16928 NNP denotes DNA
T8837 16921-16924 DT denotes The
T8836 16919-16920 . denotes .
T8835 16918-16919 NNP denotes C
T8834 16917-16918 CD denotes °
T8833 16915-16917 CD denotes 62
T8832 16912-16914 IN denotes at
T8831 16908-16911 NNS denotes hrs
T8830 16906-16907 CD denotes 2
T8829 16902-16905 IN denotes for
T8828 16900-16901 NNP denotes K
T8827 16889-16899 NNP denotes Proteinase
T8826 16884-16888 IN denotes with
T8825 16875-16883 VBN denotes digested
T8824 16870-16874 VBD denotes were
T8823 16861-16869 NNS denotes proteins
T8822 16857-16860 DT denotes the
T8821 16853-16856 CC denotes and
T8820 16851-16852 -RRB- denotes )
T8819 16842-16851 NNP denotes Millipore
T8818 16841-16842 -LRB- denotes (
T8817 16834-16840 NNP denotes Buffer
T8816 16826-16833 NNP denotes Elution
T8815 16821-16825 NNP denotes ChIP
T8814 16818-16820 IN denotes in
T8813 16811-16817 VBN denotes eluted
T8812 16807-16810 VBD denotes was
T8811 16797-16806 NN denotes chromatin
T8810 16791-16796 VBN denotes bound
T8809 16787-16790 DT denotes the
T8808 16785-16786 , denotes ,
T8807 16779-16785 VBN denotes washed
T8806 16774-16778 VBD denotes were
T8805 16768-16773 NNS denotes beads
T8804 16764-16767 DT denotes The
T8803 16762-16763 . denotes .
T8802 16761-16762 -RRB- denotes )
T8801 16752-16761 NNP denotes Millipore
T8800 16751-16752 -LRB- denotes (
T8799 16745-16750 NNS denotes beads
T8798 16736-16744 JJ denotes magnetic
T8797 16729-16735 VBD denotes coated
T8796 16727-16728 NNP denotes G
T8795 16719-16726 NNP denotes Protein
T8794 16714-16718 IN denotes with
T8793 16703-16713 NN denotes incubation
T8792 16697-16702 IN denotes after
T8791 16687-16696 VBN denotes collected
T8790 16682-16686 VBD denotes were
T8789 16673-16681 NNS denotes products
T8788 16654-16672 JJ denotes Immunoprecipitated
T8787 16652-16653 . denotes .
T8786 16651-16652 -RRB- denotes )
T8785 16642-16651 NNP denotes Millipore
T8784 16641-16642 -LRB- denotes (
T8783 16640-16641 -RRB- denotes )
T8782 16634-16640 NNP denotes CTD4H8
T8781 16628-16633 NNP denotes Clone
T8780 16627-16628 -LRB- denotes (
T8779 16624-16626 NNP denotes II
T8778 16613-16623 NN denotes polymerase
T8777 16609-16612 NNP denotes RNA
T8776 16605-16608 CC denotes and
T8775 16603-16604 -RRB- denotes )
T8774 16588-16603 NNPS denotes Biotechnologies
T8773 16583-16587 NNP denotes Cruz
T8772 16577-16582 NNP denotes Santa
T8771 16576-16577 -LRB- denotes (
T8770 16575-16576 -RRB- denotes )
T8769 16568-16575 JJ denotes sc-2027
T8768 16567-16568 -LRB- denotes (
T8767 16563-16566 NNP denotes IgG
T8766 16556-16562 NN denotes rabbit
T8765 16549-16555 JJ denotes normal
T8764 16547-16548 , denotes ,
T8763 16546-16547 -RRB- denotes )
T8762 16537-16546 NN denotes sc-16993X
T8761 16536-16537 -LRB- denotes (
T8760 16534-16535 -RRB- denotes )
T8759 16530-16534 CD denotes T217
T8758 16529-16530 -LRB- denotes (
T8757 16527-16528 NN denotes β
T8756 16526-16527 : denotes -
T8755 16519-16526 NNP denotes p-C/EBP
T8754 16517-16518 , denotes ,
T8753 16516-16517 -RRB- denotes )
T8752 16509-16516 NN denotes sc-150X
T8751 16508-16509 -LRB- denotes (
T8971 17396-17404 NNS denotes P-values
T8970 17394-17395 . denotes .
T8969 17386-17394 JJ denotes relevant
T8968 17380-17385 WRB denotes where
T8967 17375-17379 NN denotes test
T8253 15778-15779 . denotes .
T8252 15777-15778 -RRB- denotes )
T8251 15771-15777 JJ denotes sc-158
T8250 15770-15771 -LRB- denotes (
T8249 15768-15769 NN denotes ε
T8248 15767-15768 : denotes -
T8247 15757-15767 JJ denotes anti-C/EBP
T8246 15753-15756 CC denotes and
T8245 15751-15752 -RRB- denotes )
T8244 15745-15751 JJ denotes sc-151
T8243 15744-15745 -LRB- denotes (
T8242 15742-15743 NN denotes δ
T8241 15741-15742 : denotes -
T8240 15731-15741 JJ denotes anti-C/EBP
T8239 15729-15730 , denotes ,
T8238 15728-15729 -RRB- denotes )
T8237 15722-15728 JJ denotes sc-150
T8236 15721-15722 -LRB- denotes (
T8235 15719-15720 NN denotes β
T8234 15718-15719 : denotes -
T8233 15708-15718 JJ denotes anti-C/EBP
T8232 15706-15707 , denotes ,
T8231 15705-15706 -RRB- denotes )
T8230 15700-15705 JJ denotes sc-61
T8229 15699-15700 -LRB- denotes (
T8228 15697-15698 NN denotes α
T8227 15696-15697 : denotes -
T8226 15686-15696 JJ denotes anti-C/EBP
T8225 15684-15685 : denotes :
T8224 15680-15684 NNP denotes Cruz
T8223 15674-15679 NNP denotes Santa
T8222 15669-15673 IN denotes from
T8221 15659-15668 VBN denotes purchased
T8220 15654-15658 VBD denotes were
T8219 15643-15653 NNS denotes Antibodies
T8218 15641-15642 . denotes .
T8217 15633-15641 NN denotes antibody
T8216 15627-15632 NNP denotes C/EBP
T8215 15618-15626 JJ denotes specific
T8214 15615-15617 IN denotes of
T8213 15612-15614 NN denotes µg
T8212 15610-15611 CD denotes 4
T8211 15605-15609 IN denotes with
T8210 15601-15604 NN denotes ice
T8209 15598-15600 IN denotes on
T8208 15594-15597 NNS denotes hrs
T8207 15592-15593 CD denotes 2
T8206 15578-15591 JJ denotes pre-incubated
T8205 15573-15577 VBD denotes were
T8204 15564-15572 NNS denotes extracts
T8203 15556-15563 JJ denotes nuclear
T8202 15554-15555 , denotes ,
T8201 15548-15554 NNS denotes assays
T8200 15537-15547 JJ denotes supershift
T8199 15533-15536 IN denotes For
T8198 15531-15532 . denotes .
T8197 15525-15531 NNP denotes 10V/cm
T8196 15522-15524 IN denotes at
T8195 15518-15521 NNP denotes TBE
T8194 15515-15517 CD denotes 1x
T8193 15512-15514 IN denotes in
T8192 15510-15511 -RRB- denotes )
T8191 15509-15510 -RRB- denotes )
T8190 15502-15509 NNP denotes Bio-Rad
T8189 15501-15502 -LRB- denotes (
T8188 15486-15500 NN denotes bis-acrylamide
T8187 15485-15486 : denotes :
T8186 15475-15485 NN denotes acrylamide
T8185 15473-15474 CD denotes 1
T8184 15472-15473 NN denotes ∶
T8183 15470-15472 CD denotes 29
T8182 15469-15470 -LRB- denotes (
T8181 15464-15468 NNS denotes gels
T8180 15449-15463 NN denotes polyacrylamide
T8179 15447-15448 NN denotes %
T8178 15446-15447 CD denotes 5
T8177 15443-15445 IN denotes on
T8176 15431-15442 NN denotes temperature
T8175 15426-15430 NN denotes room
T8174 15423-15425 IN denotes at
T8173 15407-15422 NN denotes electrophoresis
T8172 15404-15406 IN denotes by
T8171 15395-15403 VBN denotes resolved
T8170 15390-15394 VBD denotes were
T8169 15381-15389 NNS denotes products
T8168 15372-15380 NN denotes reaction
T8167 15364-15371 VBG denotes Binding
T8166 15362-15363 . denotes .
T8165 15351-15362 NN denotes temperature
T8750 16506-16507 NN denotes β
T8749 16505-16506 : denotes -
T8748 16500-16505 SYM denotes C/EBP
T8747 16498-16499 : denotes :
T8746 16488-16498 NNS denotes antibodies
T8745 16478-16487 VBG denotes following
T8744 16474-16477 DT denotes the
T8743 16471-16473 IN denotes of
T8742 16468-16470 NN denotes µg
T8741 16466-16467 CD denotes 1
T8740 16460-16465 JJS denotes least
T8739 16457-16459 IN denotes at
T8738 16452-16456 IN denotes with
T8737 16442-16451 JJ denotes overnight
T8736 16440-16441 NNP denotes C
T8735 16439-16440 CD denotes °
T8734 16438-16439 CD denotes 4
T8733 16435-16437 IN denotes at
T8732 16416-16434 VBN denotes immunoprecipitated
T8731 16412-16415 VBD denotes was
T8730 16402-16411 NN denotes chromatin
T8729 16399-16401 IN denotes of
T8728 16392-16398 NN denotes amount
T8727 16386-16391 JJ denotes equal
T8726 16383-16385 DT denotes An
T8725 16381-16382 . denotes .
T8724 16380-16381 -RRB- denotes )
T8723 16374-16380 NNP denotes Fisher
T8722 16373-16374 -LRB- denotes (
T8721 16360-16372 NNP denotes Dismembrator
T8720 16354-16359 NNP denotes Sonic
T8719 16352-16353 DT denotes a
T8718 16346-16351 VBG denotes using
T8717 16342-16345 NN denotes ice
T8716 16339-16341 IN denotes on
T8715 16329-16338 NNS denotes intervals
T8714 16325-16328 NN denotes min
T8713 16323-16324 CD denotes 1
T8712 16318-16322 IN denotes with
T8711 16314-16317 NN denotes sec
T8710 16311-16313 CD denotes 15
T8709 16307-16310 IN denotes for
T8708 16301-16306 NNS denotes times
T8707 16299-16300 CD denotes 5
T8706 16289-16298 VBN denotes sonicated
T8705 16284-16288 VBD denotes were
T8704 16276-16283 VBZ denotes lysates
T8703 16268-16275 NNP denotes Nuclear
T8702 16266-16267 . denotes .
T8701 16265-16266 -RRB- denotes )
T8700 16256-16265 NNP denotes Millipore
T8699 16255-16256 -LRB- denotes (
T8698 16251-16254 NN denotes kit
T8697 16241-16250 JJ denotes available
T8696 16228-16240 RB denotes commercially
T8695 16226-16227 DT denotes a
T8694 16220-16225 VBG denotes using
T8693 16211-16219 JJ denotes prepared
T8692 16206-16210 VBD denotes were
T8691 16197-16205 NNS denotes extracts
T8690 16191-16196 NNS denotes Cells
T8689 16189-16190 . denotes .
T8688 16186-16189 NN denotes ice
T8687 16183-16185 IN denotes on
T8686 16173-16182 VBN denotes collected
T8685 16169-16172 CC denotes and
T8684 16161-16168 VBD denotes scraped
T8683 16159-16160 , denotes ,
T8682 16156-16159 NNP denotes PBS
T8681 16151-16155 JJ denotes cold
T8680 16146-16150 IN denotes with
T8679 16139-16145 VBN denotes washed
T8678 16134-16138 VBD denotes were
T8677 16128-16133 NNS denotes cells
T8676 16126-16127 , denotes ,
T8675 16115-16126 NN denotes temperature
T8674 16110-16114 NN denotes room
T8673 16107-16109 IN denotes at
T8672 16103-16106 NN denotes min
T8671 16101-16102 CD denotes 5
T8670 16097-16100 IN denotes for
T8669 16089-16096 NN denotes glycine
T8668 16084-16088 IN denotes with
T8667 16071-16083 VBG denotes neutralizing
T8666 16067-16070 CC denotes and
T8665 16063-16066 NN denotes min
T8664 16060-16062 CD denotes 10
T8663 16056-16059 IN denotes for
T8662 16044-16055 NN denotes temperature
T8661 16039-16043 NN denotes room
T8660 16036-16038 IN denotes at
T8659 16023-16035 NN denotes formaldehyde
T8658 16021-16022 NN denotes %
T8657 16020-16021 CD denotes 1
T8656 16015-16019 IN denotes with
T8655 16005-16014 NN denotes chromatin
T8654 16001-16004 DT denotes the
T8653 15988-16000 VBG denotes crosslinking
T8652 15982-15987 IN denotes after
T8651 15980-15981 , denotes ,
T8650 15973-15980 RB denotes Briefly
T8649 15971-15972 . denotes .
T8648 15958-15971 NNS denotes modifications
T8647 15952-15957 JJ denotes minor
T8646 15947-15951 IN denotes with
T8645 15945-15946 , denotes ,
T8644 15933-15945 NN denotes manufacturer
T8643 15929-15932 DT denotes the
T8642 15926-15928 IN denotes by
T8641 15914-15925 VBN denotes recommended
T8640 15911-15913 IN denotes as
T8639 15909-15910 , denotes ,
T8638 15908-15909 -RRB- denotes )
T8637 15899-15908 NNP denotes Millipore
T8636 15898-15899 -LRB- denotes (
T8635 15894-15897 NN denotes kit
T8634 15892-15893 NN denotes ™
T8633 15882-15892 NNP denotes Magna-ChIP
T8632 15872-15881 JJ denotes available
T8631 15859-15871 RB denotes commercially
T8630 15857-15858 DT denotes a
T8629 15851-15856 VBG denotes using
T8628 15841-15850 VBN denotes performed
T8627 15836-15840 VBD denotes were
T8626 15829-15835 NNS denotes assays
T8625 15824-15828 NNP denotes ChIP
T8624 15818-15823 NNP denotes Assay
T8623 15816-15817 -RRB- denotes )
T8622 15812-15816 NNP denotes ChIP
T8621 15811-15812 -LRB- denotes (
T8620 15791-15810 NNP denotes Immunoprecipitation
T8619 15781-15790 NNP denotes Chromatin
T8164 15346-15350 NN denotes room
T8163 15343-15345 IN denotes at
T8162 15335-15342 NNS denotes minutes
T8161 15332-15334 CD denotes 20
T8160 15328-15331 IN denotes for
T8159 15318-15327 VBN denotes performed
T8158 15313-15317 VBD denotes were
T8157 15307-15312 NN denotes probe
T8156 15293-15306 VBN denotes radiolabelled
T8155 15290-15292 IN denotes of
T8154 15288-15289 -RRB- denotes )
T8153 15286-15288 NN denotes ng
T8152 15282-15285 CD denotes 0.2
T8151 15279-15281 TO denotes to
T8150 15274-15278 CD denotes 0.05
T8149 15273-15274 -LRB- denotes (
T8148 15269-15272 NN denotes cpm
T8147 15262-15268 CD denotes 20,000
T8146 15259-15261 TO denotes to
T8145 15252-15258 CD denotes 10,000
T8144 15248-15251 CC denotes and
T8143 15239-15247 NNS denotes extracts
T8142 15231-15238 JJ denotes nuclear
T8141 15228-15230 IN denotes of
T8140 15225-15227 NN denotes µg
T8139 15223-15224 CD denotes 6
T8107 15119-15129 VBG denotes containing
T8106 15117-15118 -RRB- denotes )
T8105 15115-15117 NN denotes µl
T8104 15112-15114 CD denotes 25
T8103 15111-15112 -LRB- denotes (
T8102 15101-15110 NNS denotes reactions
T8101 15093-15100 JJ denotes binding
T8100 15089-15092 NNP denotes DNA
T8099 15087-15088 . denotes .
T8098 15086-15087 NNP denotes ]
T8097 15084-15086 CD denotes 41
T8096 15083-15084 NNP denotes [
T8095 15076-15082 NN denotes method
T8094 15070-15075 NN denotes lysis
T8093 15060-15069 NN denotes detergent
T8092 15056-15059 DT denotes the
T8091 15053-15055 IN denotes by
T8090 15044-15052 VBN denotes prepared
T8089 15039-15043 VBD denotes were
T8088 15030-15038 NNS denotes extracts
T8087 15022-15029 JJ denotes nuclear
T8086 15016-15021 CD denotes 264.7
T8085 15012-15015 NNP denotes RAW
T8084 15010-15011 . denotes .
T8083 15007-15010 NNP denotes ATP
T8082 15006-15007 : denotes -
T8081 15005-15006 NNP denotes ]
T8080 15000-15005 NNP denotes γ-32P
T8079 14999-15000 NNP denotes [
T8078 14995-14998 CC denotes and
T8077 14988-14994 NN denotes kinase
T8076 14973-14987 NN denotes polynucleotide
T8075 14970-14972 CD denotes T4
T8074 14964-14969 VBG denotes using
T8073 14955-14963 JJ denotes prepared
T8072 14950-14954 VBD denotes were
T8071 14943-14949 NNS denotes assays
T8070 14937-14942 NN denotes shift
T8069 14933-14936 NN denotes gel
T8068 14929-14932 IN denotes for
T8067 14922-14928 NNS denotes probes
T8066 14906-14921 NN denotes oligonucleotide
T8065 14890-14905 JJ denotes double-stranded
T8064 14888-14889 , denotes ,
T8063 14875-14888 NNP denotes Radiolabelled
T8062 14868-14874 NNP denotes Assays
T8061 14862-14867 NNP denotes Shift
T8060 14853-14861 NNP denotes Mobility
T8059 14837-14852 NNP denotes Electrophoretic
T7797 14834-14835 . denotes .
T7796 14830-14834 NN denotes blot
T7795 14822-14829 JJ denotes western
T7794 14819-14821 IN denotes by
T7793 14808-14818 NN denotes expression
T7792 14802-14807 JJ denotes equal
T7791 14798-14801 IN denotes for
T7790 14790-14797 VBN denotes checked
T7789 14786-14789 VBD denotes was
T7788 14777-14785 NNS denotes proteins
T7787 14770-14776 JJ denotes mutant
T7786 14753-14769 NN denotes phospho-acceptor
T7785 14751-14752 NN denotes β
T7784 14750-14751 : denotes -
T7783 14745-14750 NNP denotes C/EBP
T7782 14741-14744 DT denotes the
T7781 14738-14740 IN denotes of
T7780 14727-14737 NN denotes Expression
T7779 14725-14726 . denotes .
T7778 14719-14725 NN denotes sample
T7777 14714-14718 DT denotes each
T7776 14710-14713 IN denotes for
T7775 14701-14709 VBN denotes employed
T7774 14696-14700 VBD denotes were
T7773 14688-14695 NNS denotes samples
T7772 14677-14687 NN denotes triplicate
T7771 14673-14676 CC denotes and
T7770 14671-14672 , denotes ,
T7769 14666-14671 NNS denotes times
T7768 14660-14665 CD denotes three
T7767 14654-14659 JJS denotes least
T7766 14651-14653 IN denotes at
T7765 14642-14650 VBN denotes repeated
T7764 14638-14641 VBD denotes was
T7763 14627-14637 NN denotes experiment
T7762 14622-14626 DT denotes Each
T7761 14620-14621 . denotes .
T7760 14619-14620 -RRB- denotes )
T7759 14612-14619 NNP denotes Promega
T7758 14611-14612 -LRB- denotes (
T7757 14598-14610 RB denotes respectively
T7756 14596-14597 , denotes ,
T7755 14592-14596 NNPS denotes Kits
T7754 14585-14591 NNP denotes System
T7753 14579-14584 NNP denotes Assay
T7752 14572-14578 NNP denotes Enzyme
T7751 14556-14571 NNP denotes β-Galactosidase
T7750 14552-14555 CC denotes and
T7749 14545-14551 NNP denotes System
T7748 14539-14544 NNP denotes Assay
T7747 14528-14538 NNP denotes Luciferase
T7746 14524-14527 DT denotes the
T7745 14518-14523 VBG denotes using
T7744 14516-14517 NNP denotes ]
T7743 14514-14516 CD denotes 38
T7742 14513-14514 NNP denotes [
T7741 14497-14512 JJ denotes β-galactosidase
T7740 14494-14496 IN denotes of
T7739 14489-14493 DT denotes that
T7738 14486-14488 TO denotes to
T7737 14475-14485 VBN denotes normalized
T7736 14471-14474 CC denotes and
T7735 14460-14470 VBN denotes determined
T7734 14456-14459 VBD denotes was
T7733 14447-14455 NN denotes activity
T7732 14436-14446 JJ denotes Luciferase
T7731 14434-14435 . denotes .
T7730 14433-14434 -RRB- denotes )
T7729 14430-14433 NN denotes DNA
T7728 14424-14429 JJ denotes total
T7727 14421-14423 NN denotes µg
T7726 14417-14420 CD denotes 1.0
T7725 14413-14416 CD denotes 0.6
T7724 14412-14413 -LRB- denotes (
T7723 14397-14411 VBN denotes co-transfected
T7722 14392-14396 VBD denotes were
T7721 14385-14391 NN denotes vector
T7720 14377-14384 VB denotes control
T7719 14374-14376 CC denotes or
T7718 14372-14373 NNP denotes ]
T7717 14370-14372 CD denotes 40
T7716 14369-14370 NNP denotes [
T7715 14367-14368 NNP denotes ]
T7714 14365-14367 CD denotes 38
T7713 14364-14365 NNP denotes [
T7712 14362-14363 -RRB- denotes )
T7711 14358-14362 NNP denotes S64A
T7710 14356-14357 , denotes ,
T7709 14351-14356 CD denotes T217A
T7708 14349-14350 , denotes ,
T7707 14344-14349 CD denotes T188A
T7706 14343-14344 -LRB- denotes (
T7705 14335-14342 NNS denotes mutants
T7704 14318-14334 NN denotes phospho-acceptor
T7703 14316-14317 NN denotes β
T7702 14315-14316 : denotes -
T7701 14310-14315 SYM denotes C/EBP
T7700 14307-14309 CC denotes or
T7699 14305-14306 NN denotes β
T7698 14304-14305 : denotes -
T7697 14299-14304 NNP denotes C/EBP
T7696 14290-14298 VBG denotes encoding
T7695 14281-14289 NNS denotes plasmids
T7694 14279-14280 , denotes ,
T7693 14268-14279 NNS denotes experiments
T7692 14263-14267 DT denotes some
T7691 14260-14262 IN denotes In
T7690 14258-14259 . denotes .
T7689 14249-14258 VBN denotes indicated
T7688 14243-14248 WRB denotes where
T7687 14239-14242 NNS denotes hrs
T7686 14237-14238 CD denotes 4
T7685 14233-14236 IN denotes for
T7684 14231-14232 -RRB- denotes )
T7683 14226-14231 NN denotes ng/ml
T7682 14222-14225 CD denotes 100
T7681 14221-14222 -LRB- denotes (
T7680 14217-14220 NNP denotes LPS
T7679 14212-14216 IN denotes with
T7678 14201-14211 NN denotes incubation
T7677 14198-14200 TO denotes to
T7676 14192-14197 RB denotes prior
T7675 14188-14191 NNS denotes hrs
T7674 14185-14187 CD denotes 48
T7673 14181-14184 IN denotes for
T7672 14171-14180 VBN denotes incubated
T7671 14167-14170 CC denotes and
T7670 14160-14166 VBZ denotes plates
T7669 14155-14159 RB denotes well
T7668 14152-14154 CD denotes 24
T7667 14149-14151 IN denotes in
T7666 14143-14148 NNS denotes media
T7665 14132-14142 JJ denotes pre-warmed
T7664 14129-14131 TO denotes to
T7663 14117-14128 VBN denotes transferred
T7662 14112-14116 VBD denotes were
T7661 14106-14111 NNS denotes cells
T7660 14094-14105 JJ denotes Transfected
T7659 14092-14093 . denotes .
T7658 14091-14092 -RRB- denotes )
T7657 14087-14091 NN denotes msec
T7656 14084-14086 CD denotes 30
T7655 14082-14083 , denotes ,
T7654 14081-14082 NNP denotes V
T7653 14076-14080 CD denotes 1350
T7652 14074-14075 , denotes ,
T7651 14069-14074 NN denotes pulse
T7650 14067-14068 CD denotes 1
T7649 14066-14067 -LRB- denotes (
T7648 14059-14065 NN denotes system
T7647 14057-14058 NN denotes ™
T7646 14053-14057 NNP denotes Neon
T7645 14042-14052 NNP denotes Invitrogen
T7644 14038-14041 DT denotes the
T8138 15221-15222 , denotes ,
T8137 15220-15221 -RRB- denotes )
T8136 15215-15220 JJ denotes dI-dC
T8135 15214-15215 -LRB- denotes (
T8134 15209-15213 NN denotes poly
T8133 15206-15208 NN denotes µg
T8132 15204-15205 CD denotes 1
T8131 15202-15203 , denotes ,
T8130 15192-15202 NN denotes Ficoll-400
T8129 15190-15191 NN denotes %
T8128 15188-15190 CD denotes 20
T8127 15186-15187 , denotes ,
T8126 15178-15186 NN denotes glycerol
T8125 15176-15177 NN denotes %
T8124 15174-15176 CD denotes 30
T8123 15172-15173 , denotes ,
T8122 15169-15172 NNP denotes DTT
T8121 15166-15168 NNP denotes mM
T8120 15164-15165 CD denotes 2
T8119 15162-15163 , denotes ,
T8118 15159-15162 NNP denotes BSA
T8117 15156-15158 NN denotes ml
T8116 15155-15156 NN denotes /
T8115 15153-15155 NN denotes µg
T8114 15150-15152 CD denotes 10
T8113 15148-15149 , denotes ,
T8112 15145-15148 CD denotes 7.9
T8111 15142-15144 NNP denotes pH
T8110 15136-15141 NNP denotes HEPES
T8109 15133-15135 NNP denotes mM
T8108 15130-15132 CD denotes 10
T7643 14032-14037 VBG denotes using
T7642 14016-14031 NN denotes electroporation
T7641 14013-14015 IN denotes by
T7640 14011-14012 -RRB- denotes )
T7639 14009-14011 NN denotes ng
T7638 14005-14008 CD denotes 200
T7637 14004-14005 -LRB- denotes (
T7636 13996-14003 NN denotes plasmid
T7635 13987-13995 NN denotes reporter
T7634 13963-13986 JJ denotes β-actin-β-galactosidase
T7633 13961-13962 DT denotes a
T7632 13956-13960 IN denotes with
T7631 13950-13955 IN denotes along
T7630 13948-13949 -RRB- denotes )
T7629 13946-13948 NN denotes ng
T7628 13942-13945 CD denotes 400
T7627 13941-13942 -LRB- denotes (
T7626 13933-13940 NN denotes plasmid
T7625 13924-13932 NN denotes reporter
T7624 13913-13923 NN denotes luciferase
T7623 13903-13912 VBN denotes indicated
T7622 13899-13902 DT denotes the
T7621 13894-13898 IN denotes with
T7620 13882-13893 VBN denotes transfected
T7619 13877-13881 VBD denotes were
T7618 13875-13876 NNP denotes ]
T7602 11318-11319 -LRB- denotes (
T7601 11311-11317 NNP denotes Assays
T7600 11300-11310 NNP denotes Luciferase
T7599 11296-11299 CC denotes and
T7598 11283-11295 NNP denotes Transfection
T7597 11273-11282 NNP denotes Transient
T7141 13789-13790 . denotes .
T7140 13781-13789 NN denotes analysis
T7139 13776-13780 NN denotes blot
T7138 13768-13775 JJ denotes western
T7137 13765-13767 IN denotes by
T7136 13755-13764 VBN denotes confirmed
T7135 13751-13754 VBD denotes was
T7134 13741-13750 NN denotes knockdown
T7133 13739-13740 NN denotes β
T7132 13738-13739 : denotes -
T7131 13733-13738 SYM denotes C/EBP
T7130 13731-13732 . denotes .
T7129 13722-13731 NN denotes knockdown
T7128 13717-13721 NN denotes gene
T7127 13707-13716 JJ denotes effective
T7126 13703-13706 IN denotes for
T7125 13697-13702 VB denotes allow
T7124 13694-13696 TO denotes to
T7123 13690-13693 NNS denotes hrs
T7122 13687-13689 CD denotes 72
T7121 13683-13686 IN denotes for
T7120 13675-13682 RBR denotes further
T7119 13665-13674 VBD denotes incubated
T7118 13661-13664 CC denotes and
T7117 13655-13660 NNS denotes media
T7116 13648-13654 NN denotes growth
T7115 13642-13647 JJ denotes fresh
T7114 13637-13641 IN denotes with
T7113 13628-13636 VBN denotes replaced
T7112 13624-13627 VBD denotes was
T7111 13612-13623 NN denotes supernatant
T7110 13601-13611 JJ denotes lentiviral
T7109 13597-13600 DT denotes The
T7108 13595-13596 . denotes .
T7107 13592-13595 NNS denotes hrs
T7106 13589-13591 CD denotes 24
T7105 13585-13588 IN denotes for
T7104 13583-13584 -RRB- denotes )
T7103 13570-13583 NNP denotes Bioanalytical
T7102 13561-13569 NNP denotes American
T7101 13560-13561 -LRB- denotes (
T7100 13550-13559 NNP denotes Polybrene
T7099 13547-13549 NN denotes ml
T7098 13546-13547 NN denotes /
T7097 13544-13546 NN denotes µg
T7096 13542-13543 CD denotes 8
T7095 13538-13541 CC denotes and
T7094 13526-13537 NN denotes supernatant
T7093 13515-13525 JJ denotes lentiviral
T7092 13511-13514 DT denotes the
T7091 13506-13510 IN denotes with
T7090 13498-13505 VBN denotes treated
T7089 13493-13497 VBD denotes were
T7088 13487-13492 NNS denotes cells
T7087 13480-13486 NN denotes target
T7086 13476-13479 DT denotes The
T7085 13474-13475 . denotes .
T7084 13468-13474 NN denotes filter
T7083 13465-13467 NN denotes µm
T7082 13460-13464 CD denotes 0.45
T7081 13458-13459 DT denotes a
T7080 13450-13457 IN denotes through
T7079 13443-13449 VBN denotes passed
T7078 13439-13442 CC denotes and
T7077 13434-13438 NNS denotes mins
T7076 13431-13433 CD denotes 10
T7075 13427-13430 IN denotes for
T7074 13425-13426 NN denotes g
T7073 13419-13424 CD denotes 2,000
T7072 13416-13418 IN denotes at
T7071 13401-13415 NN denotes centrifugation
T7070 13398-13400 IN denotes by
T7069 13390-13397 VBN denotes cleared
T7068 13388-13389 , denotes ,
T7067 13376-13388 NN denotes transfection
T7066 13370-13375 IN denotes after
T7065 13366-13369 NNS denotes hrs
T7064 13363-13365 CD denotes 48
T7063 13353-13362 VBN denotes collected
T7062 13349-13352 VBD denotes was
T7061 13337-13348 NN denotes supernatant
T7060 13326-13336 JJ denotes lentiviral
T7059 13322-13325 DT denotes The
T7058 13320-13321 . denotes .
T7057 13319-13320 -RRB- denotes )
T7056 13309-13319 NNP denotes Invitrogen
T7055 13308-13309 -LRB- denotes (
T7054 13300-13307 NN denotes reagent
T7617 13873-13875 CD denotes 34
T7616 13872-13873 NNP denotes [
T7615 13870-13871 -RRB- denotes )
T7614 13867-13870 CD denotes 105
T7613 13866-13867 CD denotes ×
T7612 13865-13866 CD denotes 1
T7611 13864-13865 -LRB- denotes (
T7610 13859-13863 NNS denotes MEFs
T7609 13857-13858 CD denotes −
T7608 13856-13857 VBD denotes /
T7607 13855-13856 NNP denotes −
T7606 13849-13854 NNP denotes Cebpb
T7605 13847-13848 -RRB- denotes )
T7604 13842-13847 NNPS denotes Cells
T7603 13838-13841 NNP denotes MEF
T7053 13295-13299 CD denotes 2000
T7052 13281-13294 NNP denotes Lipofectamine
T7051 13275-13280 VBG denotes using
T7050 13273-13274 -RRB- denotes )
T7049 13271-13273 NN denotes µg
T7048 13266-13270 CD denotes 0.25
T7047 13265-13266 -LRB- denotes (
T7046 13257-13264 NN denotes plasmid
T7045 13248-13256 NN denotes envelope
T7044 13237-13247 NNP denotes pCMV-VSV-G
T7043 13233-13236 CC denotes and
T7042 13231-13232 , denotes ,
T7041 13230-13231 -RRB- denotes )
T7040 13228-13230 NN denotes µg
T7039 13223-13227 CD denotes 0.75
T7038 13222-13223 -LRB- denotes (
T7037 13214-13221 NN denotes plasmid
T7036 13204-13213 NN denotes packaging
T7035 13199-13203 NN denotes dvpr
T7034 13197-13199 CD denotes .2
T7033 13189-13197 JJ denotes pCMV-ΔR8
T7032 13187-13188 , denotes ,
T7031 13186-13187 -RRB- denotes )
T7030 13184-13186 NN denotes µg
T7029 13182-13183 CD denotes 1
T7028 13181-13182 -LRB- denotes (
T6999 13017-13024 NN denotes control
T6998 13015-13016 DT denotes a
T6997 13012-13014 IN denotes as
T6996 13006-13011 NNP denotes shRNA
T6995 13000-13005 NNP denotes CEBPB
T6994 12994-12999 JJ denotes human
T6993 12990-12993 DT denotes the
T6992 12985-12989 VBD denotes used
T6991 12982-12984 PRP denotes we
T6990 12972-12981 RB denotes therefore
T6989 12970-12971 : denotes ;
T6988 12963-12970 NNS denotes species
T6987 12957-12962 JJ denotes other
T6986 12953-12956 DT denotes the
T6985 12950-12952 IN denotes of
T6984 12944-12949 NNS denotes cells
T6983 12941-12943 IN denotes on
T6982 12936-12940 VBN denotes used
T6981 12931-12935 WRB denotes when
T6980 12929-12930 NN denotes β
T6979 12928-12929 : denotes -
T6978 12923-12928 NNP denotes C/EBP
T6977 12912-12922 JJ denotes endogenous
T6976 12909-12911 IN denotes of
T6975 12898-12908 NN denotes expression
T6974 12888-12897 VB denotes knockdown
T6973 12884-12887 RB denotes not
T6972 12881-12884 MD denotes can
T6971 12874-12880 NNS denotes shRNAs
T6970 12857-12873 JJ denotes species-specific
T6969 12851-12856 DT denotes these
T6968 12849-12850 , denotes ,
T6967 12840-12849 JJ denotes identical
T6966 12836-12839 RB denotes not
T6965 12832-12835 VBP denotes are
T6964 12824-12831 NNS denotes regions
T6963 12811-12823 JJ denotes untranslated
T6962 12809-12810 NN denotes ′
T6961 12808-12809 CD denotes 3
T6960 12802-12807 NN denotes cebpb
T6959 12796-12801 NN denotes mouse
T6958 12792-12795 CC denotes and
T6957 12786-12791 JJ denotes human
T6956 12782-12785 DT denotes the
T6955 12774-12781 IN denotes Because
T6954 12772-12773 . denotes .
T6953 12765-12772 NNS denotes studies
T6952 12759-12764 DT denotes these
T6951 12756-12758 IN denotes in
T6950 12751-12755 VBN denotes used
T6949 12746-12750 VBD denotes were
T6948 12740-12745 NN denotes cebpb
T6947 12734-12739 NN denotes mouse
T6946 12730-12733 CC denotes and
T6945 12724-12729 JJ denotes human
T6944 12720-12723 IN denotes for
T6943 12711-12719 NN denotes specific
T6942 12709-12710 -RRB- denotes )
T6941 12704-12709 NNP denotes shRNA
T6940 12703-12704 -LRB- denotes (
T6939 12698-12702 NNS denotes RNAs
T6938 12690-12697 NN denotes hairpin
T6937 12684-12689 JJ denotes short
T6936 12675-12683 VBG denotes carrying
T6935 12667-12674 NNS denotes vectors
T6934 12656-12666 JJ denotes lentiviral
T6933 12644-12655 NN denotes pLKO.1-puro
T6932 12631-12643 NNP denotes Transduction
T6931 12627-12630 CC denotes and
T6930 12617-12626 NN denotes Packaging
T6929 12615-12616 , denotes ,
T6928 12609-12615 NNP denotes shRNAs
T6927 12598-12608 NNP denotes Lentiviral
T6597 12595-12596 . denotes .
T6596 12588-12595 NN denotes reagent
T6595 12577-12587 NN denotes microassay
T6594 12569-12576 NN denotes protein
T6593 12561-12568 NNP denotes Bio-Rad
T6592 12557-12560 DT denotes the
T6591 12551-12556 VBG denotes using
T6590 12540-12550 VBN denotes determined
T6589 12536-12539 VBD denotes was
T6588 12522-12535 NN denotes concentration
T6587 12514-12521 NN denotes Protein
T6586 12512-12513 . denotes .
T6585 12511-12512 -RRB- denotes )
T6584 12503-12511 NN denotes activity
T6583 12496-12502 JJ denotes pRL-TK
T6582 12487-12495 VBD denotes affected
T6581 12483-12486 NNP denotes LPS
T6580 12480-12482 CC denotes or
T6579 12478-12479 NN denotes β
T6578 12477-12478 : denotes -
T6577 12472-12477 NNP denotes C/EBP
T6576 12457-12471 JJ denotes co-transfected
T6575 12451-12456 WRB denotes where
T6574 12450-12451 -LRB- denotes (
T6573 12436-12449 NN denotes concentration
T6572 12428-12435 NN denotes protein
T6571 12419-12427 JJ denotes cellular
T6570 12416-12418 TO denotes to
T6569 12413-12415 CC denotes or
T6568 12407-12412 NNS denotes units
T6567 12401-12406 JJ denotes light
T6566 12390-12400 NN denotes luciferase
T6565 12382-12389 NN denotes renilla
T6564 12375-12381 JJ denotes pRL-TK
T6563 12372-12374 TO denotes to
T6562 12365-12371 RB denotes either
T6561 12354-12364 VBD denotes normalized
T6560 12348-12353 NNS denotes units
T6559 12342-12347 JJ denotes light
T6558 12331-12341 JJ denotes luciferase
T6557 12323-12330 RB denotes firefly
T6556 12320-12322 IN denotes of
T6555 12313-12319 NN denotes number
T6554 12309-12312 DT denotes the
T6553 12306-12308 IN denotes as
T6552 12296-12305 VBN denotes expressed
T6551 12293-12295 VBZ denotes is
T6550 12284-12292 NN denotes activity
T6549 12275-12283 NN denotes Promoter
T6548 12273-12274 . denotes .
T6547 12262-12273 NNS denotes experiments
T6546 12250-12261 JJ denotes independent
T6545 12244-12249 CD denotes three
T6544 12238-12243 JJS denotes least
T6543 12235-12237 IN denotes at
T6542 12232-12234 IN denotes of
T6541 12224-12231 NNS denotes results
T6540 12220-12223 DT denotes the
T6539 12210-12219 VBP denotes represent
T6538 12197-12209 NNS denotes Measurements
T6537 12195-12196 . denotes .
T6536 12194-12195 -RRB- denotes )
T6535 12187-12194 NNP denotes Promega
T6534 12186-12187 -LRB- denotes (
T6533 12182-12185 NN denotes kit
T6532 12175-12181 NNP denotes System
T6531 12169-12174 NNP denotes Assay
T6530 12160-12168 NNP denotes Reporter
T6529 12144-12159 NNP denotes Dual-Luciferase
T6528 12142-12143 DT denotes a
T6527 12136-12141 VBG denotes using
T6526 12127-12135 VBN denotes measured
T6525 12123-12126 VBD denotes was
T6524 12114-12122 NN denotes activity
T6523 12103-12113 JJ denotes Luciferase
T6522 12101-12102 . denotes .
T6521 12098-12101 NNP denotes LPS
T6520 12092-12097 JJ denotes ng/ml
T6519 12088-12091 CD denotes 100
T6518 12085-12087 IN denotes of
T6517 12077-12084 NN denotes absence
T6516 12074-12076 CC denotes or
T6515 12065-12073 NN denotes presence
T6514 12061-12064 DT denotes the
T6513 12058-12060 IN denotes in
T6512 12051-12057 CC denotes either
T6511 12049-12050 NNP denotes C
T6510 12048-12049 CD denotes °
T6509 12046-12048 CD denotes 37
T6508 12043-12045 IN denotes at
T6507 12032-12042 NN denotes atmosphere
T6506 12028-12031 NN denotes air
T6505 12017-12027 JJ denotes humidified
T6504 12015-12016 NN denotes %
T6503 12013-12015 CD denotes 95
T6502 12009-12012 CC denotes and
T6501 12005-12008 CD denotes CO2
T6500 12003-12004 NN denotes %
T6499 12002-12003 CD denotes 5
T6498 12000-12001 DT denotes a
T6497 11997-11999 IN denotes in
T7027 13173-13180 NN denotes plasmid
T7026 13162-13172 NN denotes expression
T7025 13156-13161 NN denotes shRNA
T7024 13151-13155 DT denotes each
T7023 13149-13150 : denotes :
T7022 13141-13149 NNS denotes plasmids
T7021 13138-13140 IN denotes of
T7020 13130-13137 NN denotes mixture
T7019 13128-13129 DT denotes a
T7018 13123-13127 IN denotes with
T7017 13111-13122 VBN denotes transfected
T7016 13106-13110 VBD denotes were
T7015 13100-13105 NNS denotes cells
T7014 13091-13099 JJ denotes HEK-293T
T7013 13089-13090 , denotes ,
T7012 13080-13089 NNS denotes particles
T7011 13069-13079 JJ denotes lentiviral
T7010 13061-13068 VB denotes produce
T7009 13058-13060 TO denotes To
T7008 13056-13057 . denotes .
T7007 13055-13056 NNP denotes ]
T7006 13053-13055 CD denotes 38
T7005 13052-13053 NNP denotes [
T7004 13049-13051 IN denotes in
T7003 13046-13048 IN denotes as
T7002 13034-13045 NNS denotes experiments
T7001 13028-13033 DT denotes these
T7000 13025-13027 IN denotes in
T6496 11993-11996 NNS denotes hrs
T6495 11990-11992 CD denotes 16
T6494 11980-11989 VBD denotes incubated
T6493 11976-11979 CC denotes and
T6492 11970-11975 NNS denotes pools
T6491 11965-11969 NN denotes cell
T6490 11955-11964 JJ denotes identical
T6489 11951-11954 CD denotes two
T6488 11946-11950 IN denotes into
T6487 11938-11945 VBN denotes divided
T6486 11936-11937 , denotes ,
T6485 11930-11936 VBZ denotes plates
T6484 11922-11929 NN denotes culture
T6483 11915-11921 NN denotes tissue
T6482 11908-11914 JJ denotes 6-well
T6481 11905-11907 IN denotes in
T6480 11899-11904 NNS denotes media
T6479 11888-11898 JJ denotes pre-warmed
T6478 11885-11887 IN denotes of
T6477 11882-11884 NN denotes ml
T6476 11879-11881 CD denotes 10
T6475 11876-11878 TO denotes to
T6474 11864-11875 VBN denotes transferred
T6473 11859-11863 VBD denotes were
T6472 11853-11858 NNS denotes cells
T6471 11841-11852 JJ denotes Transfected
T6451 11715-11723 VBN denotes included
T6450 11711-11714 VBD denotes was
T6449 11702-11710 NN denotes enhancer
T6448 11698-11701 CC denotes and
T6447 11689-11697 NN denotes promoter
T6446 11684-11688 NNP denotes SV40
T6445 11680-11683 DT denotes the
T6444 11672-11679 VBZ denotes encodes
T6443 11666-11671 WDT denotes which
T6442 11658-11665 NN denotes plasmid
T6441 11650-11657 NN denotes control
T6440 11645-11649 JJ denotes pGL3
T6439 11643-11644 . denotes .
T6438 11642-11643 -RRB- denotes )
T6437 11639-11642 NNP denotes µFd
T6436 11635-11638 CD denotes 960
T6435 11633-11634 , denotes ,
T6434 11631-11633 NNP denotes kV
T6433 11626-11630 CD denotes 0.25
T6432 11625-11626 -LRB- denotes (
T6431 11616-11624 NNP denotes Extender
T6430 11604-11615 NNP denotes Capacitance
T6429 11602-11603 DT denotes a
T6428 11597-11601 IN denotes with
T6427 11590-11596 NNP denotes Pulser
T6426 11585-11589 NNP denotes Gene
T6425 11577-11584 NNP denotes Bio-Rad
T6424 11575-11576 DT denotes a
T6423 11569-11574 VBG denotes using
T6422 11553-11568 NN denotes electroporation
T6421 11550-11552 IN denotes by
T6420 11548-11549 -RRB- denotes )
T6419 11546-11548 NN denotes µg
T6418 11544-11545 CD denotes 2
T6417 11543-11544 -LRB- denotes (
T6416 11535-11542 NN denotes plasmid
T6415 11526-11534 NN denotes reporter
T6414 11518-11525 NN denotes control
T6413 11509-11517 JJ denotes internal
T6412 11507-11508 -RRB- denotes )
T6411 11500-11507 NNP denotes Promega
T6410 11499-11500 -LRB- denotes (
T6409 11497-11498 -RRB- denotes )
T6408 11495-11497 NNP denotes TK
T6407 11494-11495 -LRB- denotes (
T6406 11487-11493 NN denotes kinase
T6405 11473-11486 JJ denotes pRL-thymidine
T6404 11469-11472 DT denotes the
T6403 11464-11468 IN denotes with
T6402 11458-11463 IN denotes along
T6401 11456-11457 -RRB- denotes )
T6400 11454-11456 NN denotes µg
T6399 11451-11453 CD denotes 20
T6398 11450-11451 -LRB- denotes (
T6397 11442-11449 NN denotes plasmid
T6396 11433-11441 NN denotes reporter
T6395 11422-11432 NN denotes luciferase
T6394 11412-11421 VBN denotes indicated
T6393 11408-11411 DT denotes the
T6392 11403-11407 IN denotes with
T6391 11391-11402 VBN denotes transfected
T6390 11386-11390 VBD denotes were
T6389 11380-11385 NN denotes phase
T6388 11376-11379 VB denotes log
T6387 11373-11375 IN denotes in
T6386 11365-11372 VBG denotes growing
T6385 11363-11364 -RRB- denotes )
T6384 11360-11363 CD denotes 107
T6383 11359-11360 CD denotes ×
T6382 11358-11359 CD denotes 2
T6381 11357-11358 -LRB- denotes (
T6380 11351-11356 NNS denotes cells
T6379 11345-11350 CD denotes 264.7
T6378 11341-11344 NNP denotes RAW
T6377 11339-11340 -RRB- denotes )
T6376 11328-11339 NNP denotes Macrophages
T6375 11325-11327 CD denotes .7
T6374 11319-11325 NNP denotes RAW264
T6373 11318-11319 -LRB- denotes (
T6372 11311-11317 NNP denotes Assays
T6371 11300-11310 NNP denotes Luciferase
T6370 11296-11299 CC denotes and
T6369 11283-11295 NNP denotes Transfection
T6368 11273-11282 NNP denotes Transient
T6470 11839-11840 . denotes .
T6469 11829-11839 NNS denotes activities
T6468 11820-11828 NN denotes enhancer
T6467 11816-11819 CC denotes and
T6466 11807-11815 NN denotes promoter
T6465 11803-11806 IN denotes for
T6464 11794-11802 NN denotes standard
T6463 11785-11793 JJ denotes internal
T6462 11782-11784 DT denotes an
T6461 11779-11781 IN denotes as
T6460 11775-11778 CC denotes and
T6459 11773-11774 , denotes ,
T6458 11763-11773 NN denotes efficiency
T6457 11750-11762 NN denotes transfection
T6456 11746-11749 IN denotes for
T6455 11738-11745 NN denotes control
T6454 11729-11737 JJ denotes positive
T6453 11727-11728 DT denotes a
T6452 11724-11726 IN denotes as
T5894 11270-11271 . denotes .
T5893 11259-11270 NNS denotes experiments
T5892 11255-11258 DT denotes the
T5891 11252-11254 IN denotes in
T5890 11247-11251 VBN denotes used
T5889 11242-11246 VBD denotes were
T5888 11231-11241 NNS denotes constructs
T5887 11222-11230 VBD denotes verified
T5886 11213-11221 NN denotes Sequence
T5885 11211-11212 . denotes .
T5884 11203-11211 NN denotes promoter
T5883 11194-11202 NNP denotes SerpinB2
T5882 11187-11193 NN denotes murine
T5881 11177-11186 JJ denotes wild-type
T5880 11173-11176 DT denotes the
T5879 11170-11172 IN denotes of
T5878 11163-11169 NN denotes region
T5877 11159-11162 CD denotes +92
T5876 11158-11159 NN denotes /
T5875 11155-11158 CD denotes 539
T5874 11154-11155 NN denotes −
T5873 11150-11153 DT denotes the
T5872 11147-11149 IN denotes of
T5871 11141-11146 NN denotes place
T5870 11138-11140 IN denotes in
T5869 11128-11137 NN denotes pGLmP-539
T5868 11125-11127 IN denotes of
T5867 11119-11124 NNS denotes sites
T5866 11107-11118 NN denotes restriction
T5865 11105-11106 PRP denotes I
T5864 11101-11104 NNP denotes Xho
T5863 11097-11100 CC denotes and
T5862 11095-11096 PRP denotes I
T5861 11090-11094 NNP denotes EcoR
T5860 11086-11089 DT denotes the
T5859 11078-11085 IN denotes between
T5858 11071-11077 VBN denotes cloned
T5857 11067-11070 CC denotes and
T5856 11065-11066 PRP denotes I
T5855 11061-11064 NNP denotes Xho
T5854 11057-11060 CC denotes and
T5853 11055-11056 PRP denotes I
T5852 11050-11054 NNP denotes EcoR
T5851 11045-11049 IN denotes with
T5850 11036-11044 VBN denotes digested
T5849 11031-11035 VBD denotes were
T5848 11022-11030 NNS denotes products
T5847 11018-11021 NN denotes PCR
T5846 11006-11017 JJ denotes Recombinant
T5845 11004-11005 . denotes .
T5844 11000-11004 NN denotes case
T5843 10995-10999 DT denotes each
T5842 10992-10994 IN denotes in
T5841 10983-10991 NN denotes template
T5840 10979-10982 DT denotes the
T5839 10976-10978 IN denotes as
T5838 10971-10975 VBN denotes used
T5837 10967-10970 VBD denotes was
T5836 10957-10966 NN denotes pGLmP-539
T5835 10955-10956 . denotes .
T5834 10954-10955 -RRB- denotes )
T5833 10947-10954 NNP denotes Promega
T5832 10946-10947 -LRB- denotes (
T5831 10936-10945 NNP denotes GLprimer2
T5830 10932-10935 CC denotes and
T5829 10930-10931 -RRB- denotes )
T5828 10923-10930 NNP denotes Promega
T5827 10922-10923 -LRB- denotes (
T5826 10912-10921 JJ denotes RVprimer3
T5825 10907-10911 VBD denotes were
T5824 10899-10906 NNS denotes primers
T5823 10895-10898 NNP denotes PCR
T5822 10879-10894 NN denotes oligonucleotide
T5821 10870-10878 NN denotes flanking
T5820 10866-10869 DT denotes The
T5819 10864-10865 . denotes .
T5818 10863-10864 NNP denotes ]
T5817 10861-10863 CD denotes 37
T5816 10860-10861 NNP denotes [
T5815 10849-10859 RB denotes previously
T5814 10840-10848 VBN denotes reported
T5813 10835-10839 VBD denotes were
T5812 10819-10834 NN denotes pGLmP-539mAP-1b
T5811 10815-10818 CC denotes and
T5810 10813-10814 , denotes ,
T5809 10798-10813 NN denotes pGLmP-539mAP-1a
T5808 10796-10797 , denotes ,
T5807 10783-10796 NN denotes pGLmP-539mCRE
T5806 10781-10782 , denotes ,
T5805 10774-10781 NNS denotes mutants
T5804 10765-10773 VB denotes generate
T5803 10762-10764 TO denotes to
T5802 10757-10761 VBD denotes used
T5801 10749-10756 NNS denotes primers
T5800 10745-10748 NNP denotes PCR
T5799 10729-10744 NN denotes oligonucleotide
T5798 10725-10728 DT denotes The
T5797 10723-10724 . denotes .
T5796 10712-10723 NNS denotes mPAI2mCEBPb
T5795 10708-10711 CC denotes and
T5794 10696-10707 NNS denotes mPAI2mCEBPa
T5793 10694-10695 : denotes :
T5792 10691-10694 NNP denotes EBP
T5791 10690-10691 NNP denotes /
T5790 10679-10690 NNP denotes pGLmP-539mC
T5789 10677-10678 : denotes ;
T5788 10665-10677 NN denotes mPAI2mOct-2b
T5787 10661-10664 CC denotes and
T5786 10648-10660 NN denotes mPAI2mOct-2a
T5707 10200-10210 NNP denotes Luciferase
T5706 10198-10199 . denotes .
T5705 10197-10198 -RRB- denotes )
T5704 10190-10197 NNP denotes Promega
T5703 10189-10190 -LRB- denotes (
T5702 10183-10188 JJ denotes Basic
T5701 10178-10182 JJ denotes pGL3
T5700 10174-10177 VBD denotes was
T5699 10167-10173 NN denotes vector
T5698 10161-10166 JJ denotes empty
T5697 10153-10160 NN denotes control
T5696 10149-10152 DT denotes The
T5695 10147-10148 . denotes .
T5694 10139-10147 NNP denotes pGLmP-87
T5693 10131-10138 VB denotes produce
T5692 10128-10130 TO denotes to
T5691 10122-10127 JJ denotes Basic
T5690 10117-10121 JJ denotes pGL3
T5689 10114-10116 IN denotes of
T5688 10108-10113 NNS denotes sites
T5687 10096-10107 NN denotes restriction
T5686 10085-10095 VBP denotes polylinker
T5685 10083-10084 PRP denotes I
T5684 10077-10082 NNP denotes I/Xho
T5683 10073-10076 NNP denotes Kpn
T5682 10069-10072 DT denotes the
T5681 10064-10068 IN denotes into
T5680 10060-10063 CD denotes +92
T5679 10057-10059 TO denotes to
T5678 10054-10056 CD denotes 87
T5677 10053-10054 VBP denotes −
T5676 10045-10052 NNS denotes regions
T5675 10036-10044 NN denotes promoter
T5674 10027-10035 NNP denotes SerpinB2
T5673 10020-10026 NN denotes murine
T5672 10016-10019 DT denotes the
T5671 10007-10015 VB denotes subclone
T5670 10004-10006 TO denotes to
T5669 9999-10003 VBN denotes used
T5668 9994-9998 VBD denotes were
T5667 9990-9993 NNP denotes LUC
T5666 9986-9989 NNP denotes DW3
T5665 9982-9985 CC denotes and
T5664 9975-9981 NNP denotes BSPCR2
T5663 9967-9974 NNS denotes primers
T5662 9963-9966 NNP denotes PCR
T5661 9959-9962 DT denotes The
T5660 9957-9958 . denotes .
T5659 9951-9957 NN denotes ligase
T5658 9947-9950 NNP denotes DNA
T5657 9944-9946 CD denotes T4
T5656 9939-9943 IN denotes with
T5655 9934-9938 VBZ denotes ends
T5654 9927-9933 NN denotes vector
T5653 9923-9926 DT denotes the
T5652 9911-9922 VBG denotes re-ligating
T5651 9907-9910 CC denotes and
T5650 9905-9906 -RRB- denotes )
T5649 9902-9905 NNP denotes NEB
T5648 9901-9902 -LRB- denotes (
T5647 9890-9900 NN denotes polymerase
T5646 9886-9889 NNP denotes DNA
T5645 9883-9885 CD denotes T4
T5644 9878-9882 IN denotes with
T5643 9868-9877 NNS denotes overhangs
T5642 9866-9867 NN denotes ′
T5641 9865-9866 CD denotes 3
T5640 9862-9864 CC denotes or
T5639 9860-9861 NN denotes ′
T5638 9859-9860 CD denotes 5
T5637 9849-9858 JJ denotes resultant
T5636 9845-9848 DT denotes the
T5635 9838-9844 VBG denotes ending
T5634 9832-9837 JJ denotes blunt
T5633 9830-9831 , denotes ,
T5632 9829-9830 -RRB- denotes )
T5631 9817-9829 RB denotes respectively
T5630 9815-9816 PRP denotes I
T5629 9811-9814 NNP denotes Apo
T5628 9807-9810 CC denotes and
T5627 9803-9806 NNP denotes III
T5626 9799-9802 NNP denotes Hae
T5625 9797-9798 , denotes ,
T5624 9796-9797 PRP denotes I
T5623 9792-9795 NNP denotes Pac
T5622 9790-9791 , denotes ,
T5621 9789-9790 PRP denotes I
T5620 9783-9788 NNP denotes Bsu36
T5619 9781-9782 , denotes ,
T5618 9780-9781 PRP denotes I
T5617 9775-9779 NNP denotes BstX
T5616 9773-9774 , denotes ,
T5615 9772-9773 PRP denotes I
T5614 9768-9771 NNP denotes Apa
T5613 9766-9767 , denotes ,
T5612 9765-9766 PRP denotes I
T5611 9761-9764 FW denotes Sfi
T5610 9760-9761 -LRB- denotes (
T5609 9753-9759 NN denotes enzyme
T5608 9741-9752 NN denotes restriction
T5607 9734-9740 JJ denotes second
T5606 9732-9733 DT denotes a
T5605 9728-9731 CC denotes and
T5604 9726-9727 PRP denotes I
T5603 9721-9725 NNP denotes EcoR
T5602 9716-9720 IN denotes with
T5601 9705-9715 NN denotes pGLmP-3261
T5600 9695-9704 VBG denotes digesting
T5599 9692-9694 IN denotes by
T5598 9682-9691 VBN denotes generated
T5597 9677-9681 VBD denotes were
T5596 9675-9676 -RRB- denotes )
T5595 9666-9675 NN denotes pGLmP-189
T5594 9662-9665 CC denotes and
T5593 9652-9661 NN denotes pGLmP-539
T5592 9650-9651 , denotes ,
T5591 9641-9650 NN denotes pGLmP-694
T5590 9639-9640 , denotes ,
T5589 9629-9639 NN denotes pGLmP-1341
T5588 9627-9628 , denotes ,
T5587 9617-9627 NN denotes pGLmP-1686
T5586 9615-9616 , denotes ,
T5585 9605-9615 NN denotes pGLmP-2614
T5584 9603-9604 , denotes ,
T5583 9593-9603 NN denotes pGLmP-2751
T5582 9592-9593 -LRB- denotes (
T5581 9581-9591 NNS denotes constructs
T5580 9572-9580 NN denotes reporter
T5579 9561-9571 NN denotes luciferase
T5578 9552-9560 NNP denotes SerpinB2
T5577 9545-9551 NN denotes murine
T5576 9534-9544 JJ denotes Additional
T5575 9532-9533 . denotes .
T5574 9522-9532 NN denotes pGLmP-4480
T5573 9514-9521 VB denotes produce
T5572 9511-9513 TO denotes to
T5571 9500-9510 NN denotes pGLmP-3261
T5570 9497-9499 IN denotes of
T5569 9495-9496 -RRB- denotes )
T5568 9491-9495 CD denotes 3261
T5567 9490-9491 FW denotes −
T5566 9489-9490 -LRB- denotes (
T5565 9484-9488 NN denotes site
T5564 9482-9483 PRP denotes I
T5563 9477-9481 NNP denotes EcoR
T5562 9468-9476 NN denotes promoter
T5561 9459-9467 NNP denotes SerpinB2
T5560 9455-9458 DT denotes the
T5559 9452-9454 IN denotes of
T5558 9443-9451 RB denotes upstream
T5557 9431-9442 RB denotes immediately
T5556 9420-9430 JJ denotes sub-cloned
T5555 9416-9419 VBD denotes was
T5554 9405-9415 NN denotes pDB9402-42
T5553 9402-9404 IN denotes of
T5552 9395-9401 VBP denotes insert
T5551 9393-9394 PRP denotes I
T5550 9388-9392 NNP denotes EcoR
T5549 9384-9387 DT denotes The
T5548 9382-9383 . denotes .
T5547 9372-9382 NN denotes pGLmP-3261
T5546 9364-9371 VB denotes produce
T5545 9361-9363 TO denotes to
T5544 9359-9360 -RRB- denotes )
T5543 9352-9359 NNP denotes Promega
T5542 9351-9352 -LRB- denotes (
T5541 9345-9350 NNP denotes Basic
T5540 9340-9344 NNP denotes pGL3
T5539 9337-9339 IN denotes of
T5538 9331-9336 NNS denotes sites
T5537 9319-9330 NN denotes restriction
T5536 9308-9318 VBP denotes polylinker
T5535 9306-9307 PRP denotes I
T5534 9300-9305 NNP denotes I/Xho
T5533 9296-9299 NNP denotes Kpn
T5532 9292-9295 DT denotes the
T5531 9287-9291 IN denotes into
T5530 9279-9286 NNP denotes pDB9406
T5529 9274-9278 IN denotes from
T5528 9272-9273 -RRB- denotes )
T5527 9269-9272 CD denotes +92
T5526 9266-9268 TO denotes to
T5525 9261-9265 CD denotes 3261
T5524 9260-9261 FW denotes −
T5523 9259-9260 -LRB- denotes (
T5522 9250-9258 NN denotes promoter
T5521 9241-9249 NNP denotes SerpinB2
T5520 9237-9240 DT denotes the
T5519 9231-9236 VB denotes clone
T5518 9227-9230 CC denotes and
T5517 9219-9226 VB denotes amplify
T5516 9215-9218 NNP denotes PCR
T5515 9212-9214 TO denotes to
T5514 9207-9211 VBN denotes used
T5513 9202-9206 VBD denotes were
T5512 9200-9201 , denotes ,
T5511 9196-9200 NN denotes site
T5510 9184-9195 NN denotes restriction
T5509 9182-9183 PRP denotes I
T5508 9178-9181 NNP denotes Xho
T5507 9175-9177 DT denotes an
T5506 9164-9174 VBG denotes containing
T5505 9162-9163 , denotes ,
T5504 9159-9162 NNP denotes LUC
T5503 9155-9158 NNP denotes DW3
T5502 9151-9154 CC denotes and
T5501 9149-9150 , denotes ,
T5500 9145-9149 NN denotes site
T5499 9133-9144 NN denotes restriction
T5498 9131-9132 PRP denotes I
T5497 9127-9130 NNP denotes Kpn
T5496 9125-9126 DT denotes a
T5495 9114-9124 VBG denotes containing
T5494 9112-9113 , denotes ,
T5493 9109-9112 NNP denotes LUC
T5492 9105-9108 NNP denotes DW5
T5485 9057-9065 NNP denotes SerpinB2
T5484 9054-9056 IN denotes of
T5483 9041-9053 NN denotes Construction
T5785 10646-10647 : denotes :
T5784 10633-10646 NN denotes pGLmP-539mOct
T5783 10631-10632 : denotes ;
T5782 10630-10631 NN denotes b
T5781 10628-10630 CD denotes .1
T5780 10620-10628 NNP denotes mPAI2mPU
T5779 10616-10619 CC denotes and
T5778 10614-10615 DT denotes a
T5777 10612-10614 CD denotes .1
T5776 10604-10612 JJ denotes mPAI2mPU
T5775 10602-10603 : denotes :
T5774 10600-10602 CD denotes .1
T5773 10588-10600 NNP denotes pGLmP-539mPU
T5772 10586-10587 : denotes ;
T5771 10575-10586 NNP denotes mPAI2mEboxb
T5770 10571-10574 CC denotes and
T5769 10559-10570 NNS denotes mPAI2mEboxa
T5768 10557-10558 : denotes :
T5767 10543-10557 NN denotes pGLmP-539mEbox
T5766 10541-10542 : denotes :
T5765 10534-10541 VBZ denotes follows
T5764 10531-10533 IN denotes as
T5763 10526-10530 VBN denotes used
T5762 10521-10525 VBD denotes were
T5761 10517-10520 CC denotes and
T5760 10515-10516 , denotes ,
T5759 10513-10515 CD denotes S1
T5758 10511-10512 . denotes .
T5757 10508-10511 NNP denotes Fig
T5756 10505-10507 IN denotes in
T5755 10496-10504 VBN denotes provided
T5754 10492-10495 VBP denotes are
T5753 10482-10491 NNS denotes sequences
T5752 10475-10481 NN denotes primer
T5751 10471-10474 NNP denotes PCR
T5750 10455-10470 NN denotes oligonucleotide
T5749 10448-10454 JJ denotes mutant
T5748 10444-10447 DT denotes The
T5747 10442-10443 . denotes .
T5746 10441-10442 NNP denotes ]
T5745 10439-10441 CD denotes 36
T5744 10438-10439 NNP denotes [
T5743 10428-10437 VBN denotes described
T5742 10425-10427 IN denotes as
T5741 10415-10424 VBN denotes generated
T5740 10410-10414 VBD denotes were
T5739 10408-10409 -RRB- denotes )
T5738 10396-10408 RB denotes respectively
T5737 10392-10395 NNP denotes EBP
T5736 10391-10392 NN denotes /
T5735 10380-10391 JJ denotes pGLmP-539mC
T5734 10376-10379 CC denotes and
T5733 10362-10375 JJ denotes pGLmP-539mOct
T5732 10360-10361 , denotes ,
T5731 10358-10360 CD denotes .1
T5730 10346-10358 NNP denotes pGLmP-539mPU
T5729 10344-10345 , denotes ,
T5728 10330-10344 NNP denotes pGLmP-539mEbox
T5727 10329-10330 -LRB- denotes (
T5726 10323-10328 NNP denotes C/EBP
T5725 10319-10322 CC denotes and
T5724 10313-10318 NN denotes Oct-1
T5723 10311-10312 , denotes ,
T5722 10309-10311 CD denotes .1
T5721 10307-10309 NNP denotes PU
T5720 10305-10306 , denotes ,
T5719 10302-10305 NN denotes box
T5718 10300-10301 NNP denotes E
T5717 10292-10299 NNS denotes regions
T5716 10277-10291 JJ denotes LPS-responsive
T5715 10268-10276 NN denotes promoter
T5714 10259-10267 NNP denotes SerpinB2
T5713 10255-10258 DT denotes the
T5712 10252-10254 IN denotes in
T5711 10242-10251 NNS denotes mutations
T5710 10231-10241 VBG denotes containing
T5709 10220-10230 VBZ denotes constructs
T5708 10211-10219 NN denotes reporter
T5491 9097-9104 VBZ denotes primers
T5490 9093-9096 NNP denotes PCR
T5489 9089-9092 NNP denotes The
T5488 9080-9088 NNP denotes Plasmids
T5487 9075-9079 NNP denotes Gene
T5486 9066-9074 NNP denotes Reporter
T4651 9038-9039 . denotes .
T4650 9037-9038 -RRB- denotes )
T4649 9033-9037 NNP denotes Inc.
T4648 9031-9032 , denotes ,
T4647 9021-9031 NNP denotes Technology
T4646 9011-9020 NNP denotes Signaling
T4645 9006-9010 NNP denotes Cell
T4644 9005-9006 -LRB- denotes (
T4643 8997-9004 NN denotes tubulin
T4551 8484-8485 -RRB- denotes )
T4550 8474-8484 NNP denotes Invitrogen
T4549 8473-8474 -LRB- denotes (
T4548 8468-8472 NNS denotes gels
T4547 8461-8467 NNP denotes NuPAGE
T4546 8452-8460 NNP denotes Bis-Tris
T4545 8450-8451 NN denotes %
T4544 8448-8450 CD denotes 12
T4543 8446-8447 CD denotes 4
T4542 8443-8445 IN denotes on
T4541 8433-8442 VBN denotes separated
T4540 8428-8432 VBD denotes were
T4539 8419-8427 NNS denotes proteins
T4538 8417-8418 , denotes ,
T4537 8416-8417 -RRB- denotes )
T4536 8413-8416 NNP denotes SDS
T4535 8411-8412 NN denotes %
T4534 8408-8411 CD denotes 0.1
T4533 8406-8407 , denotes ,
T4532 8394-8406 NN denotes deoxycholate
T4531 8392-8393 NN denotes %
T4530 8389-8392 CD denotes 0.5
T4529 8387-8388 , denotes ,
T4528 8382-8387 NN denotes NP-40
T4527 8380-8381 NN denotes %
T4526 8377-8380 CD denotes 0.5
T4525 8375-8376 , denotes ,
T4524 8370-8375 NNP denotes X-100
T4523 8363-8369 NNP denotes Triton
T4522 8362-8363 NN denotes %
T4521 8361-8362 CD denotes 1
T4520 8359-8360 , denotes ,
T4519 8355-8359 NNP denotes NaCl
T4518 8352-8354 NNP denotes mM
T4517 8348-8351 CD denotes 150
T4516 8346-8347 , denotes ,
T4515 8342-8346 NNP denotes Tris
T4514 8339-8341 NNP denotes mM
T4513 8336-8338 CD denotes 10
T4512 8335-8336 -LRB- denotes (
T4511 8328-8334 NN denotes buffer
T4510 8323-8327 NNP denotes RIPA
T4509 8320-8322 IN denotes in
T4508 8311-8319 VBN denotes prepared
T4239 8264-8265 . denotes .
T4238 8256-8264 CD denotes AF339731
T4237 8254-8255 . denotes .
T4236 8252-8254 NNP denotes No
T4235 8242-8251 NNP denotes Accession
T4234 8237-8241 IN denotes with
T4233 8232-8236 NNP denotes Bank
T4232 8227-8231 NNP denotes Data
T4231 8209-8226 NNP denotes GenBank/EMBL/DDBJ
T4230 8206-8208 IN denotes in
T4229 8196-8205 VBN denotes deposited
T4228 8192-8195 VBD denotes was
T4227 8183-8191 NN denotes sequence
T4226 8178-8182 DT denotes This
T4225 8176-8177 . denotes .
T4224 8175-8176 -RRB- denotes )
T4223 8163-8175 NNP denotes Perkin-Elmer
T4222 8162-8163 -LRB- denotes (
T4221 8152-8161 NN denotes sequencer
T4220 8147-8151 NNP denotes 373A
T4219 8144-8146 NNP denotes PE
T4218 8142-8143 DT denotes a
T4217 8138-8141 CC denotes and
T4216 8136-8137 -RRB- denotes )
T4215 8124-8136 NNP denotes Perkin-Elmer
T4214 8123-8124 -LRB- denotes (
T4213 8119-8122 NN denotes kit
T4212 8110-8118 NN denotes reaction
T4211 8104-8109 JJ denotes ready
T4210 8093-8103 VBG denotes sequencing
T4209 8087-8092 NN denotes cycle
T4208 8076-8086 NN denotes terminator
T4207 8072-8075 NN denotes dye
T4206 8066-8071 NNP denotes PRISM
T4205 8062-8065 NNP denotes ABI
T4204 8058-8061 DT denotes the
T4203 8052-8057 VBG denotes using
T4202 8041-8051 VBN denotes determined
T4201 8037-8040 VBD denotes was
T4200 8030-8036 NN denotes region
T4199 8021-8029 NN denotes flanking
T4198 8019-8020 NN denotes ′
T4197 8018-8019 CD denotes 5
T4196 8013-8017 NN denotes gene
T4195 8004-8012 NNP denotes SerpinB2
T4194 7997-8003 NN denotes murine
T4193 7994-7996 NN denotes bp
T4192 7989-7993 CD denotes 4480
T4191 7985-7988 DT denotes the
T4190 7982-7984 IN denotes of
T4189 7973-7981 NN denotes sequence
T4188 7962-7972 NN denotes nucleotide
T4187 7958-7961 DT denotes The
T4186 7956-7957 . denotes .
T4185 7946-7956 NN denotes sequencing
T4184 7942-7945 NN denotes DNA
T4183 7938-7941 CC denotes and
T4182 7928-7937 NN denotes digestion
T4181 7921-7927 NN denotes enzyme
T4180 7909-7920 NN denotes restriction
T4179 7906-7908 IN denotes by
T4178 7897-7905 VBN denotes verified
T4177 7892-7896 VBD denotes were
T4176 7884-7891 NNS denotes inserts
T4175 7874-7883 VBN denotes Subcloned
T4174 7872-7873 . denotes .
T4173 7860-7872 NNS denotes orientations
T4172 7851-7859 JJ denotes opposite
T4171 7848-7850 IN denotes in
T4170 7841-7847 VBN denotes cloned
T4169 7839-7840 , denotes ,
T4168 7831-7839 NN denotes fragment
T4167 7825-7830 NNP denotes EcoRI
T4166 7817-7824 NNP denotes pDB9406
T4165 7813-7816 DT denotes the
T4164 7810-7812 IN denotes of
T4163 7801-7809 RB denotes upstream
T4162 7789-7800 RB denotes immediately
T4161 7781-7788 VBN denotes located
T4160 7779-7780 , denotes ,
T4159 7771-7779 NN denotes fragment
T4158 7763-7770 JJ denotes genomic
T4157 7757-7762 NNP denotes EcoRI
T4156 7754-7756 NN denotes kb
T4155 7750-7753 CD denotes 1.2
T4154 7748-7749 DT denotes a
T4153 7740-7747 VBP denotes contain
T4152 7729-7739 NN denotes pDB9402-42
T4151 7725-7728 CC denotes and
T4150 7714-7724 NN denotes pDB9402-41
T4149 7712-7713 : denotes ;
T4148 7708-7712 NN denotes site
T4147 7697-7707 NN denotes initiation
T4146 7683-7696 NN denotes transcription
T4145 7679-7682 DT denotes the
T4144 7670-7678 VBG denotes spanning
T4143 7661-7669 NN denotes fragment
T4142 7653-7660 JJ denotes genomic
T4141 7642-7652 NNP denotes EcoRI/SpeI
T4140 7639-7641 NN denotes kb
T4139 7635-7638 CD denotes 4.4
T4138 7633-7634 DT denotes a
T4137 7624-7632 VBZ denotes contains
T4136 7616-7623 JJ denotes pDB9406
T4135 7614-7615 . denotes .
T4134 7608-7614 NNP denotes Geneva
T4133 7605-7607 IN denotes of
T4132 7594-7604 NNP denotes University
T4131 7592-7593 , denotes ,
T4130 7587-7592 NNP denotes Belin
T4129 7577-7586 NNP denotes Dominique
T4128 7573-7576 NNP denotes Dr.
T4127 7570-7572 IN denotes by
T4126 7561-7569 VBN denotes provided
T4125 7554-7560 RB denotes kindly
T4124 7549-7553 VBD denotes were
T4123 7547-7548 , denotes ,
T4122 7541-7547 NN denotes strain
T4121 7535-7540 NN denotes mouse
T4642 8995-8996 FW denotes β
T4641 8994-8995 FW denotes /
T4640 8993-8994 VB denotes α
T4639 8989-8992 CC denotes and
T4638 8987-8988 -RRB- denotes )
T4637 8982-8987 NNP denotes GAPDH
T4636 8981-8982 -LRB- denotes (
T4635 8967-8980 NN denotes dehydrogenase
T4634 8940-8966 JJ denotes glyceraldehyde-3-phosphate
T4633 8938-8939 , denotes ,
T4632 8937-8938 -RRB- denotes )
T4631 8922-8937 NNPS denotes Biotechnologies
T4630 8917-8921 NNP denotes Cruz
T4629 8911-8916 NNP denotes Santa
T4628 8910-8911 -LRB- denotes (
T4627 8908-8909 -RRB- denotes )
T4626 8902-8908 JJ denotes sc-150
T4625 8901-8902 -LRB- denotes (
T4624 8899-8900 NN denotes β
T4623 8898-8899 : denotes -
T4622 8893-8898 SYM denotes C/EBP
T4621 8891-8892 : denotes :
T4620 8884-8891 VBP denotes include
T4619 8877-8883 NNS denotes assays
T4618 8872-8876 NN denotes blot
T4617 8864-8871 JJ denotes western
T4616 8860-8863 IN denotes for
T4615 8855-8859 VBN denotes used
T4614 8844-8854 NNS denotes antibodies
T4613 8838-8843 JJ denotes Other
T4612 8836-8837 . denotes .
T4611 8835-8836 NNP denotes ]
T4610 8833-8835 CD denotes 35
T4609 8832-8833 NNP denotes [
T4608 8829-8831 IN denotes in
T4607 8826-8828 IN denotes as
T4606 8821-8825 NNS denotes coli
T4605 8818-8820 NNP denotes E.
T4604 8815-8817 IN denotes in
T4603 8806-8814 VBN denotes produced
T4602 8798-8805 NN denotes protein
T4601 8791-8797 NN denotes fusion
T4600 8782-8790 NNP denotes SerpinB2
T4599 8771-8781 NNP denotes GST-murine
T4598 8759-8770 JJ denotes recombinant
T4597 8750-8758 JJ denotes purified
T4596 8748-8749 DT denotes a
T4595 8743-8747 IN denotes with
T4594 8730-8742 NN denotes immunization
T4593 8724-8729 IN denotes after
T4592 8715-8723 VBN denotes prepared
T4591 8710-8714 VBD denotes were
T4590 8699-8709 NNS denotes antibodies
T4589 8690-8698 NNP denotes SerpinB2
T4588 8679-8689 JJ denotes anti-mouse
T4587 8672-8678 NN denotes rabbit
T4586 8663-8671 VBD denotes purified
T4585 8654-8662 NNP denotes Affinity
T4584 8652-8653 . denotes .
T4583 8643-8652 JJ denotes overnight
T4582 8632-8642 NNS denotes antibodies
T4581 8624-8631 JJ denotes primary
T4580 8619-8623 IN denotes with
T4579 8609-8618 VBN denotes incubated
T4578 8605-8608 CC denotes and
T4577 8603-8604 , denotes ,
T4576 8602-8603 -RRB- denotes )
T4575 8594-8602 NN denotes Tween-20
T4574 8592-8593 NN denotes %
T4573 8589-8592 CD denotes 0.1
T4572 8587-8588 , denotes ,
T4571 8584-8587 NNP denotes PBS
T4570 8581-8583 NNP denotes 1X
T4569 8580-8581 -LRB- denotes (
T4568 8574-8579 NNP denotes PBS-T
T4567 8571-8573 IN denotes in
T4566 8566-8570 NN denotes milk
T4565 8564-8565 NN denotes %
T4564 8563-8564 CD denotes 5
T4563 8558-8562 IN denotes with
T4562 8550-8557 VBN denotes blocked
T4561 8537-8549 RB denotes subsequently
T4560 8532-8536 VBD denotes were
T4559 8522-8531 NNS denotes Membranes
T4558 8520-8521 . denotes .
T4557 8511-8520 NNS denotes membranes
T4556 8506-8510 NNP denotes PVDF
T4555 8503-8505 TO denotes to
T4554 8491-8502 VBD denotes transferred
T4553 8487-8490 CC denotes and
T4552 8485-8486 , denotes ,
T4120 7531-7534 CD denotes 129
T4119 7529-7530 DT denotes a
T4118 7524-7528 IN denotes from
T4117 7515-7523 VBN denotes prepared
T4116 7507-7514 NN denotes library
T4115 7499-7506 JJ denotes genomic
T4114 7497-7498 -RRB- denotes )
T4113 7487-7497 NNP denotes Stratagene
T4112 7486-7487 -LRB- denotes (
T4111 7479-7485 NNP denotes λFIXII
T4110 7477-7478 DT denotes a
T4109 7472-7476 IN denotes from
T4108 7463-7471 VBD denotes isolated
T4107 7459-7462 NNP denotes DNA
T4106 7451-7458 JJ denotes genomic
T4105 7440-7450 VBG denotes containing
T4104 7429-7439 NNP denotes pDB9402-42
T4103 7425-7428 CC denotes and
T4102 7414-7424 NNP denotes pDB9402-41
T4101 7412-7413 , denotes ,
T4100 7405-7412 NNP denotes pDB9406
T4099 7396-7404 NNP denotes Plasmids
T4098 7394-7395 . denotes .
T4097 7385-7394 NN denotes digestion
T4096 7381-7384 NNP denotes III
T4095 7369-7380 NN denotes exonuclease
T4063 7141-7149 NN denotes sequence
T4062 7137-7140 NNP denotes DNA
T4061 7133-7136 NNP denotes The
T4060 7124-7132 NNP denotes Analysis
T4059 7115-7123 NNP denotes Sequence
T3794 7108-7109 . denotes .
T3793 7107-7108 -RRB- denotes )
T3792 7097-7107 NNPS denotes Biosystems
T3791 7089-7096 NNP denotes Applied
T3790 7088-7089 -LRB- denotes (
T3789 7086-7087 -RRB- denotes )
T3788 7073-7086 NNP denotes Mm00607939_s1
T3787 7072-7073 -LRB- denotes (
T3786 7064-7071 JJ denotes β-actin
T3785 7060-7063 CC denotes and
T3784 7058-7059 -RRB- denotes )
T3783 7045-7058 NNP denotes Mm00843434_s1
T3782 7044-7045 -LRB- denotes (
T3781 7038-7043 NNP denotes Cebpb
T3780 7036-7037 , denotes ,
T3779 7035-7036 -RRB- denotes )
T3778 7022-7035 NNP denotes Mm00440905_m1
T3777 7021-7022 -LRB- denotes (
T3776 7003-7020 NNP denotes Serpinb2/SerpinB2
T3775 6999-7002 IN denotes for
T3774 6991-6998 NNS denotes primers
T3773 6987-6990 NNP denotes 20X
T3772 6976-6986 NNP denotes Expression
T3771 6971-6975 NNP denotes Gene
T3770 6969-6970 NNP denotes ®
T3769 6963-6969 NNP denotes TaqMan
T3768 6957-6962 VBG denotes using
T3767 6947-6956 VBN denotes performed
T3766 6943-6946 VBD denotes was
T3765 6938-6942 NNP denotes qPCR
T3764 6936-6937 . denotes .
T3763 6935-6936 -RRB- denotes )
T3762 6925-6935 NNPS denotes Biosystems
T3761 6917-6924 NNP denotes Applied
T3760 6916-6917 -LRB- denotes (
T3759 6907-6915 NNP denotes Reagents
T3758 6893-6906 NNP denotes Transcription
T3757 6885-6892 VB denotes Reverse
T3756 6883-6884 NNP denotes ®
T3755 6877-6883 NNP denotes TaqMan
T3754 6871-6876 VBG denotes using
T3753 6859-6870 VBN denotes transcribed
T3752 6851-6858 JJ denotes reverse
T3751 6847-6850 VBD denotes was
T3750 6843-6846 NNP denotes RNA
T3749 6837-6842 JJ denotes total
T3748 6834-6836 IN denotes of
T3747 6831-6833 NN denotes µg
T3746 6829-6830 CD denotes 1
T3745 6827-6828 , denotes ,
T3744 6818-6827 NN denotes synthesis
T3743 6813-6817 NNP denotes cDNA
T3742 6809-6812 IN denotes For
T3741 6807-6808 . denotes .
T3740 6802-6807 NNS denotes cells
T3739 6797-6801 IN denotes from
T3738 6793-6796 NNP denotes RNA
T3737 6787-6792 JJ denotes total
T3736 6779-6786 VB denotes isolate
T3735 6776-6778 TO denotes to
T3734 6771-6775 VBN denotes used
T3733 6767-6770 VBD denotes was
T3732 6765-6766 -RRB- denotes )
T3731 6759-6765 NNP denotes Qiagen
T3730 6758-6759 -LRB- denotes (
T3729 6754-6757 NNP denotes Kit
T3728 6749-6753 NNP denotes Mini
T3727 6742-6748 NNP denotes RNeasy
T3726 6738-6741 DT denotes The
T3725 6736-6737 -RRB- denotes )
T3724 6732-6736 NNP denotes qPCR
T3723 6731-6732 -LRB- denotes (
T3722 6727-6730 NNP denotes PCR
T3721 6714-6726 JJ denotes Quantitative
T3720 6704-6713 JJ denotes Real-time
T4094 7366-7368 IN denotes by
T4093 7355-7365 VBN denotes introduced
T4092 7345-7354 NNS denotes deletions
T4091 7334-7344 VBG denotes containing
T4090 7323-7333 NN denotes pDB9402-42
T4089 7319-7322 CC denotes and
T4088 7308-7318 NN denotes pDB9402-41
T4087 7303-7307 IN denotes from
T4086 7294-7302 VBN denotes prepared
T4085 7285-7293 NNS denotes plasmids
T4084 7282-7284 TO denotes to
T4083 7273-7281 NN denotes addition
T4082 7270-7272 IN denotes in
T4081 7268-7269 , denotes ,
T4080 7258-7268 NNP denotes pDB9402-42
T4079 7254-7257 CC denotes and
T4078 7243-7253 NNP denotes pDB9402-41
T4077 7241-7242 , denotes ,
T4076 7234-7241 NNP denotes pDB9406
T4075 7225-7233 NNS denotes plasmids
T4074 7215-7224 JJ denotes pUC-based
T4073 7211-7214 DT denotes the
T4072 7200-7210 VBG denotes sequencing
T4071 7197-7199 IN denotes by
T4070 7186-7196 VBN denotes determined
T4069 7182-7185 VBD denotes was
T4068 7173-7181 NN denotes promoter
T4067 7164-7172 NNP denotes SerpinB2
T4066 7157-7163 NN denotes murine
T4065 7153-7156 DT denotes the
T4064 7150-7152 IN denotes of
T3121 5357-5358 . denotes .
T3120 5353-5357 NN denotes gene
T3119 5344-5352 NNP denotes SerpinB2
T3118 5340-5343 DT denotes the
T3117 5337-5339 IN denotes of
T3116 5326-5336 NN denotes regulation
T3115 5310-5325 JJ denotes transcriptional
T3114 5306-5309 DT denotes the
T3113 5301-5305 IN denotes into
T3112 5293-5300 NN denotes insight
T3111 5289-5292 JJ denotes new
T3110 5281-5288 VBP denotes provide
T3109 5272-5280 NNS denotes findings
T3108 5266-5271 DT denotes these
T3107 5264-5265 , denotes ,
T3106 5256-5264 RB denotes Together
T3105 5254-5255 . denotes .
T3104 5246-5254 NN denotes activity
T3103 5237-5245 NN denotes promoter
T3102 5228-5236 JJ denotes SerpinB2
T3101 5216-5227 JJ denotes LPS-induced
T3100 5207-5215 VB denotes regulate
T3099 5196-5206 RB denotes negatively
T3098 5193-5195 TO denotes to
T3097 5187-5192 VBN denotes found
T3096 5183-5186 VBD denotes was
T3095 5178-5182 NN denotes site
T3094 5161-5177 NN denotes phospho-acceptor
T3093 5159-5160 NN denotes β
T3092 5158-5159 : denotes -
T3091 5153-5158 NNP denotes C/EBP
T3090 5151-5152 DT denotes a
T3089 5149-5150 , denotes ,
T3088 5138-5149 RB denotes Importantly
T3087 5136-5137 . denotes .
T3086 5133-5136 NNP denotes LPS
T3085 5130-5132 IN denotes by
T3084 5120-5129 NN denotes induction
T3083 5111-5119 JJ denotes SerpinB2
T3082 5107-5110 CC denotes and
T3081 5096-5106 NN denotes expression
T3080 5087-5095 NNP denotes SerpinB2
T3079 5074-5086 JJ denotes constitutive
T3078 5064-5073 VBD denotes abrogated
T3077 5053-5063 NN denotes deficiency
T3076 5049-5052 PRP$ denotes its
T3075 5045-5048 CC denotes and
T3074 5040-5044 NN denotes vivo
T3073 5037-5039 IN denotes in
T3072 5032-5036 NN denotes site
T2980 4492-4495 CC denotes and
T2979 4483-4491 NN denotes response
T2978 4478-4482 NN denotes dose
T2977 4474-4477 NNP denotes LPS
T2976 4472-4473 , denotes ,
T2975 4464-4472 NNS denotes kinetics
T2974 4461-4463 IN denotes of
T2973 4455-4460 NNS denotes terms
T2972 4452-4454 IN denotes in
T2971 4446-4451 NNS denotes genes
T2970 4432-4445 JJ denotes LPS-inducible
T2969 4426-4431 JJ denotes other
T2968 4421-4425 IN denotes from
T2967 4411-4420 VBN denotes regulated
T2966 4400-4410 RB denotes distinctly
T2965 4397-4399 VBZ denotes is
T2964 4388-4396 NNP denotes SerpinB2
T2963 4383-4387 IN denotes that
T2962 4373-4382 VBD denotes indicated
T2961 4368-4372 NNS denotes data
T2960 4358-4367 VBN denotes published
T2959 4347-4357 RB denotes previously
T2958 4343-4346 PRP$ denotes Our
T2957 4341-4342 . denotes .
T2956 4340-4341 NNP denotes ]
T2955 4338-4340 CD denotes 16
T2954 4337-4338 NNP denotes [
T2953 4328-4336 NNS denotes pathways
T2952 4318-4327 NNP denotes MAPK/CREB
T2951 4314-4317 CD denotes p38
T2950 4310-4313 CC denotes and
T2949 4304-4309 NNP denotes NF-κB
T2948 4303-4304 NNP denotes /
T2947 4299-4303 NNP denotes IKKβ
T2946 4295-4298 DT denotes the
T2945 4292-4294 IN denotes of
T2944 4280-4291 NN denotes cooperation
T2943 4277-4279 IN denotes by
T2942 4265-4276 VBN denotes upregulated
T2941 4261-4264 VBD denotes was
T2940 4250-4260 NN denotes expression
T2939 4244-4249 WP$ denotes whose
T2938 4237-4243 NN denotes factor
T2937 4235-4236 DT denotes a
T2936 4232-4234 IN denotes as
T2935 4221-4231 VBN denotes identified
T2934 4217-4220 VBD denotes was
T2933 4208-4216 NNP denotes SerpinB2
T2932 4206-4207 , denotes ,
T2931 4202-4206 NNP denotes MAPK
T2930 4198-4201 CD denotes p38
T2929 4195-4197 IN denotes of
T2928 4184-4194 JJ denotes downstream
T2927 4176-4183 NNS denotes factors
T2926 4163-4175 JJ denotes pro-survival
T2925 4149-4162 JJ denotes LPS-inducible
T2924 4137-4148 VBG denotes identifying
T2923 4134-4136 IN denotes at
T2922 4128-4133 VBN denotes aimed
T2921 4120-4127 NNS denotes studies
T2920 4117-4119 IN denotes In
T2919 4115-4116 . denotes .
T2918 4114-4115 NNP denotes ]
T2917 4112-4114 CD denotes 33
T2916 4111-4112 NNP denotes [
T2915 4102-4110 NNS denotes pathways
T2914 4095-4101 NN denotes kinase
T2913 4094-4095 : denotes -
T2912 4093-4094 -RRB- denotes )
T2911 4090-4093 NN denotes PI3
T2910 4089-4090 -LRB- denotes (
T2909 4088-4089 CD denotes 3
T2908 4071-4087 NN denotes phosphoinositide
T2907 4064-4070 CC denotes and/or
T2906 4062-4063 -RRB- denotes )
T2905 4058-4062 NNP denotes MAPK
T2904 4057-4058 -LRB- denotes (
T2903 4050-4056 NN denotes kinase
T2902 4042-4049 NN denotes protein
T2901 4024-4041 JJ denotes mitogen-activated
T2900 4022-4023 , denotes ,
T2899 4021-4022 -RRB- denotes )
T2898 4016-4021 NNP denotes NF-κB
T2897 4015-4016 -LRB- denotes (
T2896 4005-4014 NNP denotes factor-κB
T2895 3997-4004 JJ denotes nuclear
T2894 3993-3996 DT denotes the
T2893 3990-3992 TO denotes to
T2892 3982-3989 NNS denotes signals
T2891 3971-3981 VBG denotes generating
T2890 3969-3970 , denotes ,
T2889 3962-3969 NNS denotes kinases
T2888 3954-3961 NN denotes protein
T2887 3951-3953 IN denotes of
T2886 3940-3950 NN denotes activation
T2885 3936-3939 DT denotes the
T2884 3932-3935 CC denotes and
T2883 3922-3931 NNS denotes molecules
T2882 3914-3921 NN denotes adaptor
T2881 3911-3913 IN denotes of
T2880 3899-3910 NN denotes recruitment
T2879 3895-3898 DT denotes the
T2878 3892-3894 TO denotes to
T2877 3886-3891 VBZ denotes leads
T2876 3874-3885 NNS denotes macrophages
T2875 3871-3873 IN denotes of
T2874 3863-3870 NN denotes surface
T2873 3859-3862 DT denotes the
T2872 3856-3858 IN denotes on
T2871 3851-3855 CD denotes TLR4
T2870 3848-3850 TO denotes to
T2869 3844-3847 NNP denotes LPS
T2868 3841-3843 IN denotes of
T2867 3833-3840 JJ denotes binding
T2866 3829-3832 DT denotes The
T2865 3827-3828 . denotes .
T2864 3820-3827 NN denotes release
T2863 3811-3819 NN denotes cytokine
T2862 3801-3810 VBG denotes including
T2861 3799-3800 , denotes ,
T2860 3790-3799 NNS denotes responses
T2859 3783-3789 JJ denotes immune
T2858 3776-3782 NN denotes innate
T2857 3773-3775 IN denotes of
T2856 3762-3772 NN denotes initiation
T2855 3758-3761 DT denotes the
T2854 3755-3757 IN denotes in
T2853 3750-3754 NN denotes role
T2852 3742-3749 JJ denotes central
T2851 3740-3741 DT denotes a
T2850 3734-3739 VBZ denotes plays
T2849 3730-3733 CC denotes and
T2848 3721-3729 NNS denotes products
T2847 3711-3720 JJ denotes microbial
T2846 3705-3710 JJ denotes other
T2845 3701-3704 CC denotes and
T2844 3697-3700 NNP denotes LPS
T2843 3694-3696 IN denotes of
T2842 3682-3693 NN denotes recognition
T2841 3678-3681 DT denotes the
T2840 3674-3677 IN denotes for
T2839 3662-3673 JJ denotes responsible
T2838 3659-3661 VBZ denotes is
T2837 3657-3658 -RRB- denotes )
T2836 3653-3657 CD denotes TLR4
T2835 3652-3653 -LRB- denotes (
T2834 3650-3651 CD denotes 4
T2833 3641-3649 NN denotes receptor
T2832 3631-3640 JJ denotes toll-like
T2831 3627-3630 DT denotes The
T2830 3625-3626 . denotes .
T2829 3617-3625 NNS denotes pathways
T2828 3606-3616 JJ denotes signalling
T2827 3597-3605 JJ denotes multiple
T2826 3589-3596 IN denotes through
T2825 3579-3588 NNS denotes responses
T2824 3572-3578 JJ denotes immune
T2823 3562-3571 VBZ denotes activates
T2822 3558-3561 NNP denotes LPS
T2821 3556-3557 . denotes .
T2820 3555-3556 NNP denotes ]
T2819 3554-3555 CD denotes 9
T2818 3553-3554 VBP denotes [
T2817 3543-3552 NNS denotes mediators
T2816 3530-3542 JJ denotes inflammatory
T2815 3527-3529 IN denotes of
T2814 3521-3526 NN denotes range
T2813 3519-3520 DT denotes a
T2812 3516-3518 IN denotes by
T2811 3503-3515 JJ denotes up-regulated
T2810 3500-3502 VBZ denotes is
T2809 3496-3499 CC denotes and
T2808 3494-3495 , denotes ,
T2807 3493-3494 NNP denotes ]
T2806 3491-3493 CD denotes 32
T2805 3490-3491 NNP denotes [
T2804 3488-3489 NNP denotes ]
T2803 3486-3488 CD denotes 31
T2802 3485-3486 NNP denotes [
T2801 3481-3484 NNP denotes LPS
T2800 3478-3480 IN denotes by
T2799 3468-3477 JJ denotes 1000-fold
T2798 3463-3467 IN denotes over
T2797 3455-3462 VBN denotes induced
T2796 3452-3454 VB denotes be
T2795 3448-3451 MD denotes can
T2794 3444-3447 CC denotes and
T2793 3442-3443 , denotes ,
T2792 3441-3442 NNP denotes ]
T2791 3439-3441 CD denotes 31
T3561 6701-6702 . denotes .
T3560 6696-6701 NNP denotes Sigma
T3559 6691-6695 IN denotes from
T3558 6682-6690 VBN denotes obtained
T3557 6678-6681 VBD denotes was
T3556 6676-6677 -RRB- denotes )
T3555 6671-6676 NNP denotes Re595
T3554 6664-6670 NNP denotes Strain
T3553 6654-6663 NN denotes minnesota
T3552 6643-6653 NN denotes Salmonella
T3551 6642-6643 -LRB- denotes (
T3550 6640-6641 -RRB- denotes )
T3549 6637-6640 NNP denotes LPS
T3548 6636-6637 -LRB- denotes (
T3547 6617-6635 NN denotes lipopolysaccharide
T3546 6607-6616 JJ denotes Bacterial
T3545 6605-6606 . denotes .
T3544 6604-6605 -RRB- denotes )
T3543 6599-6604 NNP denotes Lonza
T3542 6598-6599 -LRB- denotes (
T3541 6594-6597 NNP denotes Kit
T3540 6584-6593 NNP denotes Detection
T3539 6574-6583 NNP denotes MycoAlert
T3538 6570-6573 DT denotes the
T3537 6566-6569 CC denotes and
T3536 6564-6565 -RRB- denotes )
T3535 6559-6564 NNP denotes Sigma
T3534 6558-6559 -LRB- denotes (
T3533 6552-6557 CD denotes 33258
T3532 6546-6551 VB denotes stain
T3531 6538-6545 NNP denotes Hoechst
T3530 6532-6537 VBG denotes using
T3529 6523-6531 NN denotes staining
T3528 6515-6522 JJ denotes nuclear
T3527 6512-6514 IN denotes by
T3526 6502-6511 NN denotes infection
T3525 6491-6501 NNP denotes Mycoplasma
T3524 6483-6490 VB denotes exclude
T3523 6480-6482 TO denotes to
T3522 6472-6479 VBN denotes checked
T3521 6462-6471 RB denotes routinely
T3520 6457-6461 VBD denotes were
T3519 6448-6456 NNS denotes cultures
T3518 6444-6447 DT denotes All
T3517 6442-6443 . denotes .
T3516 6436-6442 NN denotes method
T3515 6426-6435 NN denotes exclusion
T3514 6422-6425 NN denotes dye
T3513 6420-6421 -RRB- denotes )
T3512 6415-6420 NNP denotes Sigma
T3511 6414-6415 -LRB- denotes (
T3477 6198-6203 NNS denotes media
T3476 6189-6197 CD denotes DMEM/F12
T3475 6187-6188 NN denotes %
T3474 6185-6187 CD denotes 50
T3473 6182-6184 IN denotes in
T3472 6171-6181 VBD denotes maintained
T3471 6167-6170 CC denotes and
T3470 6165-6166 , denotes ,
T3469 6160-6165 RB denotes later
T3468 6155-6159 NNS denotes days
T3467 6153-6154 CD denotes 5
T3466 6151-6152 CD denotes 3
T3465 6144-6150 NN denotes lavage
T3464 6133-6143 JJ denotes peritoneal
T3463 6130-6132 IN denotes by
T3462 6121-6129 VBN denotes followed
T3461 6115-6120 NN denotes broth
T3460 6100-6114 NN denotes thioglycollate
T3459 6098-6099 NN denotes %
T3458 6097-6098 CD denotes 3
T3457 6092-6096 IN denotes with
T3456 6087-6091 NNS denotes mice
T3455 6079-6086 NNP denotes C57BL/6
T3454 6069-6078 VBG denotes injecting
T3453 6066-6068 IN denotes by
T3452 6057-6065 VBN denotes obtained
T3451 6052-6056 VBD denotes were
T3450 6040-6051 NNS denotes macrophages
T3449 6029-6039 JJ denotes peritoneal
T3448 6021-6028 JJ denotes Primary
T3447 6019-6020 . denotes .
T3446 6018-6019 -RRB- denotes )
T3445 6011-6018 NNP denotes Cellgro
T3444 6010-6011 -LRB- denotes (
T3443 6001-6009 NN denotes solution
T3442 5967-6000 JJ denotes penicillin/streptomycin/glutamate
T3441 5965-5966 NN denotes %
T3440 5964-5965 CD denotes 1
T3439 5960-5963 CC denotes and
T3438 5954-5959 NN denotes serum
T3437 5947-5953 JJ denotes bovine
T3436 5941-5946 JJ denotes fetal
T3435 5939-5940 NN denotes %
T3434 5937-5939 CD denotes 10
T3433 5932-5936 IN denotes with
T3432 5919-5931 VBN denotes supplemented
T3431 5917-5918 -RRB- denotes )
T3430 5907-5917 NNP denotes Invitrogen
T3429 5906-5907 -LRB- denotes (
T3428 5899-5905 NN denotes medium
T3427 5896-5898 POS denotes 's
T3426 5891-5896 NNP denotes Eagle
T3425 5882-5890 VBN denotes modified
T3424 5879-5881 POS denotes 's
T3423 5871-5879 NNP denotes Dulbecco
T3422 5868-5870 IN denotes in
T3421 5862-5867 VBN denotes grown
T3420 5857-5861 VBD denotes were
T3419 5855-5856 NNP denotes ]
T3418 5853-5855 CD denotes 34
T3417 5852-5853 NNP denotes [
T3416 5850-5851 -RRB- denotes )
T3415 5846-5850 NNS denotes MEFs
T3414 5845-5846 -LRB- denotes (
T3413 5833-5844 NNS denotes fibroblasts
T3412 5823-5832 JJ denotes embryonic
T3411 5817-5822 NN denotes mouse
T3410 5815-5816 -RRB- denotes )
T3409 5814-5815 NN denotes −
T3408 5813-5814 CD denotes /
T3407 5812-5813 VBD denotes −
T3406 5807-5812 NNP denotes Cebpb
T3405 5806-5807 -LRB- denotes (
T3404 5797-5805 NN denotes knockout
T3403 5793-5796 CC denotes and
T3402 5791-5792 -RRB- denotes )
T3401 5790-5791 NNP denotes +
T3400 5789-5790 NNP denotes /
T3399 5788-5789 NNP denotes +
T3398 5783-5788 NNP denotes Cebpb
T3397 5782-5783 -LRB- denotes (
T3396 5772-5781 NNP denotes Wild-type
T3395 5769-5771 NNP denotes C.
T3394 5768-5769 NN denotes °
T3393 5766-5768 CD denotes 37
T3392 5763-5765 IN denotes at
T3391 5752-5762 NN denotes atmosphere
T3390 5748-5751 NN denotes air
T3389 5737-5747 JJ denotes humidified
T3388 5735-5736 NN denotes %
T3387 5733-5735 CD denotes 95
T3386 5729-5732 CC denotes and
T3385 5725-5728 CD denotes CO2
T3384 5723-5724 NN denotes %
T3383 5722-5723 CD denotes 5
T3382 5719-5721 IN denotes in
T3381 5717-5718 , denotes ,
T3380 5706-5717 NN denotes bicarbonate
T3379 5699-5705 NN denotes sodium
T3378 5696-5698 NN denotes mM
T3377 5693-5695 CD denotes 25
T3376 5689-5692 CC denotes and
T3375 5687-5688 -RRB- denotes )
T3374 5682-5687 NNS denotes HEPES
T3373 5681-5682 -LRB- denotes (
T3372 5676-5680 NN denotes acid
T3371 5666-5675 JJ denotes sulphonic
T3370 5628-5665 NNP denotes N-2-hydroxyethylpiperazine-N-2-ethane
T3369 5625-5627 NNP denotes mM
T3368 5622-5624 CD denotes 25
T3367 5620-5621 , denotes ,
T3366 5608-5620 NN denotes streptomycin
T3365 5605-5607 NN denotes ml
T3364 5604-5605 NN denotes /
T3363 5602-5604 NN denotes µg
T3362 5598-5601 CD denotes 100
T3361 5596-5597 , denotes ,
T3360 5586-5596 NN denotes penicillin
T3359 5583-5585 NN denotes ml
T3358 5582-5583 NN denotes /
T3357 5580-5582 NN denotes µg
T3356 5576-5579 CD denotes 200
T3355 5574-5575 , denotes ,
T3354 5573-5574 -RRB- denotes )
T3353 5561-5573 NNP denotes BioWhittaker
T3352 5560-5561 -LRB- denotes (
T3351 5552-5559 NN denotes supreme
T3350 5546-5551 NN denotes serum
T3349 5544-5545 NN denotes %
T3348 5542-5544 CD denotes 10
T3347 5540-5541 , denotes ,
T3346 5539-5540 -RRB- denotes )
T3345 5536-5539 NNP denotes BRL
T3344 5530-5535 NNP denotes Gibco
T3343 5529-5530 -LRB- denotes (
T3342 5517-5528 NNP denotes L-glutamine
T3341 5514-5516 NNP denotes mM
T3340 5512-5513 CD denotes 2
T3339 5507-5511 IN denotes with
T3338 5494-5506 VBN denotes supplemented
T3337 5492-5493 , denotes ,
T3336 5491-5492 -RRB- denotes )
T3335 5488-5491 NNP denotes BRL
T3334 5482-5487 NNP denotes Gibco
T3333 5481-5482 -LRB- denotes (
T3332 5475-5480 NNS denotes media
T3331 5470-5474 CD denotes 1640
T3330 5465-5469 NNP denotes RPMI
T3329 5462-5464 IN denotes in
T3328 5451-5461 VBN denotes maintained
T3327 5446-5450 VBD denotes were
T3326 5444-5445 -RRB- denotes )
T3325 5438-5444 CD denotes TIB-71
T3324 5433-5437 NNP denotes ATCC
T3323 5432-5433 -LRB- denotes (
T3322 5426-5431 NNS denotes cells
T3321 5420-5425 CD denotes 264.7
T3320 5416-5419 NNP denotes RAW
T3319 5405-5415 NN denotes macrophage
T3318 5398-5404 NNP denotes Murine
T3317 5390-5397 NNP denotes Culture
T3316 5385-5389 NNP denotes Cell
T2790 3438-3439 NNP denotes [
T2789 3432-3437 VBN denotes known
T2788 3426-3431 NNS denotes genes
T2787 3415-3425 JJ denotes responsive
T2786 3410-3414 RBS denotes most
T2785 3406-3409 DT denotes the
T2784 3403-3405 IN denotes of
T2783 3399-3402 CD denotes one
T2782 3396-3398 VBZ denotes is
T2781 3393-3395 PRP denotes It
T2780 3391-3392 . denotes .
T2779 3390-3391 NNP denotes ]
T2778 3388-3390 CD denotes 30
T2777 3387-3388 NNP denotes [
T2776 3385-3386 : denotes ;
T2775 3384-3385 NNP denotes ]
T2774 3382-3384 CD denotes 29
T2773 3381-3382 NNP denotes [
T2772 3371-3380 NNS denotes oncogenes
T2771 3367-3370 CC denotes and
T2770 3357-3366 NNS denotes cytokines
T2769 3354-3356 IN denotes of
T2768 3349-3353 DT denotes that
T2767 3346-3348 TO denotes to
T2766 3336-3345 JJ denotes analogous
T2765 3329-3335 NN denotes manner
T3510 6409-6413 NN denotes blue
T3509 6402-6408 NN denotes trypan
T3508 6398-6401 DT denotes the
T3507 6392-6397 VBG denotes using
T3506 6381-6391 VBN denotes determined
T3505 6377-6380 VBD denotes was
T3504 6367-6376 NN denotes viability
T3503 6362-6366 NNP denotes Cell
T3502 6360-6361 . denotes .
T3501 6355-6360 NN denotes serum
T3500 6346-6354 JJ denotes LPS-free
T3499 6336-6345 VBN denotes certified
T3498 6333-6335 IN denotes of
T3497 6329-6332 NN denotes use
T3496 6325-6328 DT denotes the
T3495 6317-6324 IN denotes through
T3494 6308-6316 NNS denotes cultures
T3493 6303-6307 NN denotes cell
T3492 6299-6302 DT denotes all
T3491 6294-6298 IN denotes from
T3490 6280-6293 NN denotes contamination
T3489 6261-6279 NN denotes lipopolysaccharide
T3488 6251-6260 JJ denotes bacterial
T3487 6243-6250 VB denotes exclude
T3486 6240-6242 TO denotes to
T3481 6214-6215 -RRB- denotes )
T3480 6211-6214 NNP denotes BRL
T3479 6205-6210 NNP denotes Gibco
T3478 6204-6205 -LRB- denotes (
T3071 5027-5031 DT denotes this
T3070 5024-5026 TO denotes to
T3069 5018-5023 VBN denotes bound
T3068 5009-5017 RB denotes directly
T3067 5007-5008 NN denotes β
T3066 5006-5007 : denotes -
T3065 5001-5006 SYM denotes C/EBP
T3064 4999-5000 . denotes .
T3063 4996-4999 CD denotes 195
T3062 4995-4996 NN denotes −
T3061 4994-4995 NN denotes /
T3060 4991-4994 CD denotes 203
T3059 4990-4991 CD denotes −
T3058 4987-4989 IN denotes at
T3057 4982-4986 NN denotes site
T3056 4974-4981 JJ denotes binding
T3055 4968-4973 NNP denotes C/EBP
T3054 4966-4967 DT denotes a
T3053 4961-4965 IN denotes upon
T3052 4951-4960 JJ denotes dependent
T3051 4940-4950 RB denotes critically
T3050 4937-4939 VBZ denotes is
T3049 4933-4936 CC denotes and
T3048 4931-4932 , denotes ,
T3047 4923-4931 NN denotes promoter
T3046 4914-4922 NNP denotes SerpinB2
T3045 4907-4913 NN denotes murine
T3044 4903-4906 DT denotes the
T3043 4900-4902 IN denotes of
T3042 4896-4899 CD denotes 539
T3041 4895-4896 CD denotes −
T3040 4891-4894 CC denotes and
T3039 4887-4890 CD denotes 189
T3038 4886-4887 VBP denotes −
T3037 4874-4885 NNS denotes nucleotides
T3036 4866-4873 IN denotes between
T3035 4859-4865 NN denotes region
T3034 4855-4858 DT denotes the
T3033 4852-4854 IN denotes in
T3032 4842-4851 NNS denotes sequences
T3031 4831-4841 JJ denotes regulatory
T3030 4820-4830 JJ denotes cis-acting
T3029 4815-4819 IN denotes upon
T3028 4805-4814 JJ denotes dependent
T3027 4802-4804 VBZ denotes is
T3026 4793-4801 NNP denotes SerpinB2
T3025 4790-4792 IN denotes of
T3024 4780-4789 NN denotes induction
T3023 4776-4779 NNP denotes LPS
T3022 4771-4775 IN denotes that
T3021 4766-4770 VBP denotes show
T3020 4763-4765 PRP denotes we
T3019 4758-4762 RB denotes Here
T3018 4756-4757 . denotes .
T3017 4749-4756 VBN denotes defined
T3016 4745-4748 RB denotes not
T3015 4740-4744 VBD denotes were
T3014 4731-4739 NN denotes promoter
T3013 4722-4730 NNP denotes SerpinB2
T3012 4718-4721 DT denotes the
T3011 4713-4717 NN denotes bind
T3010 4708-4712 WDT denotes that
T3009 4700-4707 NNS denotes factors
T3008 4686-4699 NN denotes transcription
T3007 4671-4685 JJ denotes LPS-responsive
T3006 4662-4670 JJ denotes specific
T3005 4658-4661 DT denotes the
T3004 4654-4657 CC denotes and
T3003 4642-4653 NNS denotes macrophages
T3002 4639-4641 IN denotes in
T3001 4625-4638 NN denotes transcription
T3000 4611-4624 JJ denotes LPS-dependent
T2999 4607-4610 IN denotes for
T2998 4595-4606 JJ denotes responsible
T2997 4586-4594 NN denotes promoter
T2996 4577-4585 NNP denotes SerpinB2
T2995 4573-4576 DT denotes the
T2994 4570-4572 IN denotes in
T2993 4561-4569 NNS denotes elements
T2992 4550-4560 JJ denotes cis-acting
T2991 4546-4549 DT denotes the
T2990 4544-4545 , denotes ,
T2989 4537-4544 RB denotes however
T2988 4535-4536 : denotes ;
T2987 4534-4535 NNP denotes ]
T2986 4533-4534 CD denotes 4
T2985 4532-4533 NN denotes [
T2984 4517-4531 NN denotes co-stimulation
T2983 4511-4516 JJ denotes IFN-γ
T2982 4508-4510 TO denotes to
T2981 4496-4507 NN denotes sensitivity
T2764 3320-3328 JJ denotes specific
T2763 3315-3319 NN denotes type
T2762 3310-3314 NN denotes cell
T2761 3308-3309 DT denotes a
T2760 3305-3307 IN denotes in
T2759 3295-3304 VBN denotes regulated
T2758 3288-3294 RB denotes highly
T2757 3285-3287 VBZ denotes is
T2756 3280-3284 NN denotes gene
T2519 2015-2017 TO denotes to
T2518 2010-2014 VB denotes lead
T2517 2006-2009 MD denotes may
T2516 2003-2005 PRP denotes it
T2515 2001-2002 , denotes ,
T2514 1989-2001 NNP denotes Uncontrolled
T2513 1987-1988 . denotes .
T2512 1983-1987 NN denotes body
T2511 1979-1982 DT denotes the
T2510 1974-1978 IN denotes from
T2509 1964-1973 NNS denotes pathogens
T2508 1955-1963 VBG denotes invading
T2507 1951-1954 CC denotes and
T2506 1941-1950 NNS denotes molecules
T2505 1933-1940 JJ denotes foreign
T2504 1930-1932 IN denotes of
T2503 1921-1929 NN denotes clearing
T2502 1917-1920 DT denotes the
T2501 1914-1916 IN denotes in
T2500 1906-1913 VBZ denotes results
T2499 1903-1905 PRP denotes it
T2498 1901-1902 , denotes ,
T2497 1889-1901 VBN denotes orchestrated
T2496 1880-1888 RB denotes Properly
T2495 1878-1879 . denotes .
T2494 1873-1878 NN denotes sword
T2493 1860-1872 JJ denotes double-edged
T2492 1858-1859 DT denotes a
T2491 1855-1857 VBZ denotes is
T2490 1846-1854 NN denotes response
T2489 1833-1845 JJ denotes inflammatory
T2488 1829-1832 DT denotes The
T2755 3271-3279 NNP denotes SerpinB2
T2754 3267-3270 DT denotes The
T2753 3265-3266 . denotes .
T2752 3256-3265 VBN denotes described
T2751 3251-3255 VBN denotes been
T2750 3246-3250 VBP denotes have
T2749 3244-3245 , denotes ,
T2748 3243-3244 NNP denotes ]
T2747 3241-3243 CD denotes 28
T2746 3240-3241 NNP denotes [
T2745 3238-3239 NNP denotes ]
T2744 3236-3238 CD denotes 24
T2743 3235-3236 NNP denotes [
T2742 3226-3234 NN denotes immunity
T2741 3219-3225 JJ denotes innate
T2740 3215-3218 CC denotes and
T2739 3213-3214 NNP denotes ]
T2738 3211-3213 CD denotes 23
T2737 3210-3211 NNP denotes [
T2736 3208-3209 : denotes ;
T2735 3207-3208 NNP denotes ]
T2734 3205-3207 CD denotes 22
T2733 3204-3205 NNP denotes [
T2732 3202-3203 : denotes ;
T2731 3201-3202 NNP denotes ]
T2730 3199-3201 CD denotes 15
T2729 3198-3199 NNP denotes [
T2728 3185-3197 NN denotes transduction
T2727 3178-3184 NN denotes signal
T2726 3176-3177 , denotes ,
T2725 3175-3176 NNP denotes ]
T2724 3173-3175 CD denotes 21
T2723 3172-3173 NNP denotes [
T2722 3170-3171 NNP denotes ]
T2721 3168-3170 CD denotes 18
T2720 3167-3168 NNP denotes [
T2719 3151-3166 NN denotes differentiation
T2718 3147-3150 CC denotes and
T2717 3133-3146 NN denotes proliferation
T2716 3131-3132 , denotes ,
T2715 3130-3131 NNP denotes ]
T2714 3128-3130 CD denotes 17
T2713 3127-3128 NNP denotes [
T2712 3125-3126 NNP denotes ]
T2711 3123-3125 CD denotes 11
T2710 3122-3123 NNP denotes [
T2679 2942-2944 TO denotes to
T2678 2933-2941 CD denotes SerpinB2
T2677 2924-2932 VBZ denotes requires
T2676 2915-2923 NN denotes function
T2675 2910-2914 JJ denotes Such
T2674 2908-2909 . denotes .
T2673 2907-2908 NNP denotes ]
T2672 2906-2907 CD denotes 9
T2671 2905-2906 NNP denotes [
T2670 2903-2904 : denotes ;
T2669 2902-2903 NNP denotes ]
T2668 2901-2902 CD denotes 7
T2667 2900-2901 NN denotes [
T2666 2888-2899 NN denotes plasminogen
T2665 2885-2887 IN denotes of
T2664 2874-2884 NN denotes activation
T2663 2870-2873 DT denotes the
T2662 2862-2869 IN denotes through
T2661 2855-2861 NN denotes matrix
T2660 2841-2854 JJ denotes extracellular
T2659 2837-2840 DT denotes the
T2658 2834-2836 IN denotes of
T2657 2825-2833 NN denotes turnover
T2656 2821-2824 CC denotes and
T2655 2809-2820 NN denotes degradation
T2654 2805-2808 DT denotes the
T2653 2802-2804 IN denotes in
T2652 2793-2801 VBN denotes involved
T2651 2784-2792 NN denotes protease
T2650 2777-2783 NN denotes serine
T2649 2775-2776 DT denotes a
T2648 2773-2774 , denotes ,
T2647 2772-2773 NNP denotes ]
T2646 2771-2772 CD denotes 8
T2645 2770-2771 NN denotes [
T2644 2768-2769 NNP denotes ]
T2643 2767-2768 CD denotes 6
T2642 2766-2767 NNP denotes [
T2641 2765-2766 -RRB- denotes )
T2640 2762-2765 NNP denotes uPA
T2639 2761-2762 -LRB- denotes (
T2638 2751-2760 NN denotes activator
T2637 2739-2750 NN denotes plasminogen
T2636 2724-2738 JJ denotes urokinase-type
T2635 2721-2723 IN denotes of
T2634 2711-2720 NN denotes inhibitor
T2633 2708-2710 DT denotes an
T2632 2705-2707 IN denotes as
T2631 2694-2704 VBN denotes identified
T2630 2688-2693 RB denotes first
T2629 2684-2687 VBD denotes was
T2628 2675-2683 CD denotes SerpinB2
T2627 2673-2674 . denotes .
T2626 2672-2673 NNP denotes ]
T2625 2671-2672 CD denotes 5
T2624 2670-2671 NNP denotes [
T2623 2668-2669 : denotes ;
T2622 2667-2668 NNP denotes ]
T2621 2666-2667 CD denotes 4
T2620 2665-2666 NNP denotes [
T2619 2658-2664 NN denotes factor
T2618 2649-2657 NN denotes survival
T2617 2638-2648 NN denotes macrophage
T2616 2627-2637 VBN denotes recognized
T2615 2620-2626 RB denotes widely
T2614 2618-2619 DT denotes a
T2613 2616-2617 , denotes ,
T2612 2608-2616 NNP denotes SerpinB2
T2611 2606-2607 -RRB- denotes )
T2610 2597-2606 JJ denotes ov-serpin
T2609 2596-2597 -LRB- denotes (
T2608 2586-2595 NN denotes inhibitor
T2607 2577-2585 NN denotes protease
T2606 2570-2576 NN denotes serine
T2605 2555-2569 JJ denotes ovalbumin-like
T2604 2551-2554 DT denotes the
T2603 2548-2550 VBZ denotes is
T2602 2542-2547 VBN denotes known
T2601 2533-2541 NNS denotes products
T2600 2528-2532 NN denotes gene
T2599 2517-2527 NN denotes macrophage
T2598 2503-2516 JJ denotes LPS-inducible
T2597 2498-2502 RBS denotes most
T2596 2494-2497 DT denotes the
T2595 2491-2493 IN denotes of
T2594 2487-2490 CD denotes One
T2593 2485-2486 . denotes .
T2592 2476-2485 NNS denotes responses
T2591 2469-2475 JJ denotes immune
T2590 2460-2468 JJ denotes adaptive
T2589 2457-2459 IN denotes of
T2588 2445-2456 NN denotes development
T2587 2434-2444 JJ denotes subsequent
T2586 2430-2433 CC denotes and
T2585 2415-2429 NN denotes neutralization
T2584 2406-2414 NN denotes pathogen
T2583 2398-2405 JJ denotes initial
T2582 2394-2397 IN denotes for
T2581 2385-2393 JJ denotes critical
T2580 2382-2384 VBZ denotes is
T2579 2373-2381 NN denotes survival
T2578 2367-2372 PRP$ denotes their
T2577 2365-2366 , denotes ,
T2576 2356-2365 NNS denotes responses
T2575 2349-2355 JJ denotes immune
T2574 2342-2348 NN denotes innate
T2573 2325-2341 JJ denotes pathogen-induced
T2572 2322-2324 IN denotes of
T2571 2312-2321 NNS denotes effectors
T2570 2308-2311 JJ denotes key
T2569 2304-2307 VBP denotes are
T2568 2292-2303 NNS denotes macrophages
T2567 2289-2291 IN denotes As
T2566 2287-2288 . denotes .
T2565 2284-2287 NNP denotes LPS
T2564 2274-2283 NN denotes component
T2563 2269-2273 NN denotes wall
T2562 2264-2268 NN denotes cell
T2561 2254-2263 JJ denotes bacterial
T2560 2240-2253 JJ denotes gram-negative
T2559 2236-2239 DT denotes the
T2558 2233-2235 TO denotes to
T2557 2224-2232 NN denotes exposure
T2556 2219-2223 IN denotes upon
T2555 2207-2218 NNS denotes macrophages
T2554 2204-2206 IN denotes by
T2553 2194-2203 VBN denotes expressed
T2552 2185-2193 NNS denotes products
T2551 2180-2184 NN denotes gene
T2550 2170-2179 JJ denotes inducible
T2549 2164-2169 JJ denotes other
T2548 2160-2163 CC denotes and
T2547 2150-2159 NNS denotes cytokines
T2546 2147-2149 IN denotes by
T2545 2138-2146 VBN denotes mediated
T2544 2134-2137 VBP denotes are
T2543 2125-2133 NN denotes response
T2542 2112-2124 JJ denotes inflammatory
T2541 2108-2111 DT denotes the
T2540 2105-2107 IN denotes of
T2539 2090-2104 NNS denotes manifestations
T2538 2077-2089 JJ denotes pathological
T2537 2073-2076 DT denotes the
T2536 2070-2072 IN denotes of
T2535 2065-2069 JJ denotes Many
T2534 2063-2064 . denotes .
T2533 2062-2063 NNP denotes ]
T2532 2061-2062 CD denotes 3
T2531 2060-2061 NN denotes [
T2530 2058-2059 NNP denotes ]
T2529 2057-2058 CD denotes 1
T2528 2056-2057 NNP denotes [
T2527 2049-2055 NN denotes cancer
T2526 2044-2048 RB denotes even
T2525 2040-2043 CC denotes and
T2524 2038-2039 , denotes ,
T2523 2032-2038 NN denotes sepsis
T2522 2030-2031 , denotes ,
T2521 2024-2030 NN denotes damage
T2520 2018-2023 NN denotes organ
T2689 3001-3003 IN denotes as
T2688 2991-3000 RB denotes primarily
T2687 2984-2990 VBZ denotes exists
T2686 2975-2983 JJ denotes SerpinB2
T2685 2971-2974 RB denotes yet
T2684 2966-2970 NN denotes cell
T2683 2962-2965 DT denotes the
T2682 2957-2961 IN denotes from
T2681 2948-2956 VBN denotes secreted
T2680 2945-2947 VB denotes be
T1048 1813-1814 . denotes .
T1047 1803-1813 NN denotes expression
T1046 1794-1802 NNP denotes SerpinB2
T1045 1770-1793 JJ denotes inflammation-associated
T1044 1767-1769 IN denotes of
T1043 1756-1766 NN denotes regulation
T1042 1744-1755 JJ denotes β-dependent
T1041 1743-1744 : denotes -
T1040 1738-1743 NNP denotes C/EBP
T1039 1733-1737 IN denotes into
T2709 3113-3121 NN denotes survival
T2708 3108-3112 NN denotes cell
T2707 3105-3107 IN denotes in
T2706 3096-3104 NNP denotes SerpinB2
T2705 3092-3095 IN denotes for
T2704 3086-3091 NNS denotes roles
T2703 3072-3085 JJ denotes intracellular
T2702 3070-3071 , denotes ,
T2701 3064-3070 NN denotes decade
T2700 3059-3063 JJ denotes past
T2699 3055-3058 DT denotes the
T2698 3050-3054 IN denotes Over
T2697 3048-3049 . denotes .
T2696 3047-3048 NNP denotes ]
T2695 3045-3047 CD denotes 10
T2694 3044-3045 NNP denotes [
T2693 3036-3043 NN denotes protein
T2692 3022-3035 JJ denotes intracellular
T2691 3006-3021 JJ denotes nonglycosylated
T2690 3004-3005 DT denotes a
T1038 1725-1732 NN denotes insight
T1037 1721-1724 JJ denotes new
T1036 1713-1720 VBP denotes provide
T1035 1708-1712 NNS denotes data
T1034 1702-1707 DT denotes these
T1033 1700-1701 , denotes ,
T1032 1692-1700 RB denotes Together
T1031 1690-1691 . denotes .
T1030 1679-1690 NNS denotes macrophages
T1029 1668-1678 JJ denotes peritoneal
T1028 1656-1667 JJ denotes β-deficient
T1027 1655-1656 : denotes -
T1026 1650-1655 NNP denotes C/EBP
T1025 1642-1649 JJ denotes primary
T1024 1638-1641 CC denotes and
T1023 1636-1637 -RRB- denotes )
T1022 1632-1636 NNS denotes MEFs
T1021 1631-1632 -LRB- denotes (
T1020 1619-1630 NNS denotes fibroblasts
T1019 1609-1618 JJ denotes embryonic
T1018 1603-1608 NN denotes mouse
T1017 1596-1602 JJ denotes β-null
T1016 1595-1596 : denotes -
T1015 1590-1595 NNP denotes C/EBP
T1014 1587-1589 IN denotes in
T1013 1577-1586 VBN denotes abrogated
T856 617-625 NN denotes promoter
T855 608-616 CD denotes SerpinB2
T854 594-607 JJ denotes LPS-regulated
T853 590-593 DT denotes the
T852 586-589 VB denotes map
T851 583-585 TO denotes To
T850 581-582 . denotes .
T849 570-581 NNS denotes macrophages
T848 563-569 JJ denotes murine
T847 560-562 IN denotes in
T846 556-559 NNS denotes hrs
T845 553-555 CD denotes 24
T844 550-552 IN denotes of
T843 543-549 NN denotes period
T842 541-542 DT denotes a
T841 536-540 IN denotes over
T840 526-535 JJ denotes 1000-fold
T839 525-526 CD denotes ∼
T838 522-524 IN denotes by
T837 520-521 -RRB- denotes )
T836 516-520 CD denotes TLR4
T835 515-516 -LRB- denotes (
T834 513-514 CD denotes 4
T833 504-512 NN denotes receptor
T832 494-503 JJ denotes toll-like
T831 490-493 DT denotes the
T830 486-489 IN denotes via
T829 475-485 NN denotes expression
T828 466-474 NNP denotes SerpinB2
T827 459-465 VB denotes induce
T826 455-458 MD denotes can
T825 453-454 , denotes ,
T824 444-453 NN denotes endotoxin
T823 434-443 JJ denotes bacterial
T822 427-433 JJ denotes potent
T821 425-426 DT denotes a
T820 423-424 , denotes ,
T819 422-423 -RRB- denotes )
T818 419-422 NNP denotes LPS
T817 418-419 -LRB- denotes (
T816 399-417 NNP denotes Lipopolysaccharide
T815 397-398 . denotes .
T814 387-397 NNS denotes activators
T813 375-386 NN denotes plasminogen
T812 372-374 IN denotes of
T811 361-371 NN denotes inhibition
T810 357-360 CC denotes and
T809 355-356 , denotes ,
T808 347-355 NN denotes survival
T807 336-346 NN denotes macrophage
T806 334-335 , denotes ,
T805 326-334 NN denotes immunity
T804 319-325 NN denotes innate
T803 316-318 IN denotes of
T802 305-315 NN denotes modulation
T801 301-304 DT denotes the
T800 298-300 TO denotes to
T799 291-297 VBN denotes linked
T798 288-290 VBZ denotes is
T797 284-287 CC denotes and
T796 276-283 NNS denotes stimuli
T795 263-275 JJ denotes inflammatory
T794 260-262 TO denotes to
T793 251-259 NN denotes response
T792 248-250 IN denotes in
T791 236-247 NNS denotes macrophages
T790 233-235 IN denotes in
T789 225-232 VBN denotes induced
T788 218-224 RB denotes highly
T787 215-217 VBZ denotes is
T786 213-214 -RRB- denotes )
T785 208-213 NN denotes PAI-2
T784 207-208 -LRB- denotes (
T783 205-206 CD denotes 2
T782 200-204 NN denotes type
T781 190-199 NN denotes inhibitor
T780 180-189 NN denotes activator
T779 168-179 NN denotes plasminogen
T778 165-167 CC denotes or
T777 156-164 NNP denotes SerpinB2
T1012 1568-1576 RB denotes severely
T1011 1564-1567 VBD denotes was
T1010 1553-1563 NN denotes expression
T1009 1544-1552 JJ denotes SerpinB2
T1008 1532-1543 JJ denotes LPS-induced
T1007 1528-1531 CC denotes and
T1006 1515-1527 JJ denotes constitutive
T1005 1510-1514 DT denotes both
T1004 1508-1509 , denotes ,
T1003 1497-1508 RB denotes Importantly
T1002 1495-1496 . denotes .
T1001 1487-1495 NN denotes promoter
T1000 1478-1486 NNP denotes SerpinB2
T999 1474-1477 DT denotes the
T998 1469-1473 IN denotes with
T997 1459-1468 NNS denotes complexes
T996 1448-1458 VBG denotes containing
T995 1446-1447 NN denotes β
T994 1445-1446 : denotes -
T993 1440-1445 NNP denotes C/EBP
T992 1437-1439 IN denotes of
T991 1427-1436 NN denotes formation
T990 1423-1426 DT denotes the
T989 1415-1422 VBZ denotes induces
T988 1411-1414 NNP denotes LPS
T987 1406-1410 IN denotes that
T986 1393-1405 VBD denotes demonstrated
T985 1386-1392 NNS denotes assays
T984 1384-1385 -RRB- denotes )
T983 1380-1384 NNP denotes ChIP
T982 1379-1380 -LRB- denotes (
T981 1359-1378 NN denotes immunoprecipitation
T980 1349-1358 NN denotes chromatin
T979 1345-1348 CC denotes and
T978 1343-1344 -RRB- denotes )
T977 1339-1343 NNP denotes EMSA
T976 1338-1339 -LRB- denotes (
T975 1332-1337 NN denotes shift
T974 1323-1331 NN denotes mobility
T973 1307-1322 JJ denotes Electrophoretic
T972 1305-1306 . denotes .
T971 1289-1305 NN denotes LPS-inducibility
T970 1281-1288 JJ denotes optimal
T969 1277-1280 IN denotes for
T968 1267-1276 JJ denotes essential
T967 1263-1266 VBP denotes are
T966 1254-1262 NN denotes promoter
T965 1245-1253 JJ denotes proximal
T964 1236-1244 NNP denotes SerpinB2
T963 1229-1235 NN denotes murine
T962 1225-1228 DT denotes the
T961 1222-1224 IN denotes in
T960 1213-1221 NNS denotes elements
T959 1204-1212 NN denotes response
T958 1202-1203 -RRB- denotes )
T957 1198-1202 NN denotes AP-1
T956 1197-1198 -LRB- denotes (
T955 1195-1196 CD denotes 1
T954 1187-1194 NN denotes protein
T953 1177-1186 NN denotes activator
T952 1173-1176 CD denotes two
T951 1169-1172 CC denotes and
T950 1167-1168 -RRB- denotes )
T949 1164-1167 NNP denotes CRE
T948 1163-1164 -LRB- denotes (
T947 1155-1162 NN denotes element
T946 1146-1154 NN denotes response
T945 1142-1145 NNP denotes AMP
T944 1135-1141 JJ denotes cyclic
T943 1133-1134 DT denotes a
T942 1131-1132 , denotes ,
T941 1124-1131 NN denotes element
T940 1122-1123 -RRB- denotes )
T939 1117-1122 NNP denotes C/EBP
T938 1116-1117 -LRB- denotes (
T937 1108-1115 JJ denotes binding
T936 1099-1107 NN denotes enhancer
T935 1093-1098 NNP denotes CCAAT
T934 1091-1092 DT denotes a
T933 1086-1090 IN denotes that
T932 1077-1085 VBD denotes revealed
T931 1068-1076 NNS denotes analyses
T930 1059-1067 NN denotes Mutation
T929 1057-1058 . denotes .
T928 1052-1057 NN denotes mouse
T927 1048-1051 DT denotes the
T926 1045-1047 IN denotes in
T925 1035-1044 VBD denotes conserved
T924 1026-1034 NN denotes promoter
T923 1017-1025 NNP denotes SERPINB2
T922 1011-1016 JJ denotes human
T921 1007-1010 DT denotes the
T920 1004-1006 IN denotes in
T919 995-1003 NNS denotes elements
T918 984-994 JJ denotes cis-acting
T917 973-983 JJ denotes regulatory
T916 965-972 JJ denotes several
T915 954-964 VBD denotes identified
T914 950-953 CC denotes and
T913 941-949 NNS denotes elements
T912 930-940 JJ denotes regulatory
T911 919-929 JJ denotes functional
T910 908-918 RB denotes homologous
T909 904-907 IN denotes for
T908 899-903 NN denotes gene
T907 893-898 JJ denotes human
T906 889-892 DT denotes the
T905 886-888 IN denotes of
T904 877-885 NN denotes sequence
T903 873-876 DT denotes the
T902 868-872 IN denotes with
T901 859-867 NN denotes sequence
T900 850-858 NN denotes flanking
T899 848-849 NN denotes ′
T898 847-848 CD denotes 5
T897 840-846 NN denotes murine
T896 836-839 DT denotes the
T895 833-835 IN denotes of
T894 824-832 NN denotes sequence
T893 820-823 NNP denotes DNA
T892 816-819 DT denotes the
T891 807-815 VBD denotes compared
T890 804-806 PRP denotes we
T889 802-803 , denotes ,
T888 794-802 NN denotes addition
T887 791-793 IN denotes In
T886 789-790 . denotes .
T885 778-789 NNS denotes macrophages
T884 771-777 JJ denotes murine
T883 766-770 IN denotes into
T882 758-765 NNS denotes mutants
T881 749-757 NN denotes deletion
T880 741-748 JJ denotes several
T879 737-740 CC denotes and
T878 732-736 NN denotes gene
T877 723-731 NNP denotes SerpinB2
T876 716-722 NN denotes murine
T875 712-715 DT denotes the
T874 709-711 IN denotes of
T873 702-708 NN denotes region
T872 693-701 VBG denotes flanking
T871 692-693 : denotes -
T870 691-692 '' denotes '
T869 690-691 CD denotes 5
T868 687-689 NN denotes kb
T867 685-686 CD denotes 5
T866 684-685 NN denotes ∼
T865 680-683 DT denotes the
T864 677-679 IN denotes by
T863 670-676 VBN denotes driven
T862 659-669 NNS denotes constructs
T861 650-658 NN denotes reporter
T860 638-649 VBD denotes transfected
T859 635-637 PRP denotes we
T858 633-634 , denotes ,
T857 626-633 NNS denotes regions
T4507 8306-8310 VBD denotes were
T4506 8298-8305 NNS denotes lysates
T4505 8293-8297 NN denotes cell
T4504 8287-8292 NNP denotes Whole
T4503 8280-8286 NNP denotes Assays
T4502 8275-8279 NNP denotes Blot
T4501 8267-8274 JJ denotes Western
T4058 7111-7114 NNP denotes DNA
T22144 46392-46393 NNP denotes ]
T25781 35158-35160 CD denotes .7
T10019 18622-18625 DT denotes The
T16106 36072-36077 SYM denotes C/EBP
T3485 6234-6239 VBN denotes taken
T3484 6229-6233 VBD denotes were
T3483 6217-6228 NNS denotes Precautions
T3482 6215-6216 . denotes .
T763 0-3 DT denotes The
T764 4-17 NNP denotes Transcription
T8977 17438-17439 . denotes .
T8976 17427-17438 JJ denotes significant
T8975 17416-17426 VBN denotes considered
T8974 17411-17415 VBD denotes were
T8973 17406-17410 CD denotes 0.05
T8972 17405-17406 VBP denotes <
R352 T765 T770 nmod Factor,Constitutive
R353 T766 T768 compound C/EBP,β
R354 T767 T768 punct -,β
R355 T768 T770 compound β,Constitutive
R356 T769 T770 compound Mediates,Constitutive
R357 T770 T773 nmod Constitutive,Transcription
R358 T771 T770 cc and,Constitutive
R359 T772 T770 conj LPS-Inducible,Constitutive
R360 T773 T789 nsubjpass Transcription,induced
R361 T774 T773 prep of,Transcription
R362 T775 T777 compound Murine,SerpinB2
R363 T776 T777 compound SerpinB2,SerpinB2
R364 T777 T774 pobj SerpinB2,of
R365 T778 T777 cc or,SerpinB2
R366 T779 T773 conj plasminogen,Transcription
R367 T780 T781 amod activator,inhibitor
R368 T781 T782 compound inhibitor,type
R369 T782 T773 appos type,Transcription
R370 T783 T782 nummod 2,type
R371 T784 T782 punct (,type
R372 T785 T782 appos PAI-2,type
R373 T786 T782 punct ),type
R374 T787 T789 auxpass is,induced
R375 T788 T789 advmod highly,induced
R376 T789 T789 ROOT induced,induced
R377 T790 T789 prep in,induced
R378 T791 T790 pobj macrophages,in
R379 T792 T789 prep in,induced
R380 T793 T792 pobj response,in
R381 T794 T793 prep to,response
R382 T795 T796 amod inflammatory,stimuli
R383 T796 T794 pobj stimuli,to
R384 T797 T789 cc and,induced
R385 T798 T799 auxpass is,linked
R386 T799 T789 conj linked,induced
R387 T800 T799 prep to,linked
R388 T801 T802 det the,modulation
R389 T802 T800 pobj modulation,to
R390 T803 T802 prep of,modulation
R391 T804 T805 amod innate,immunity
R392 T805 T803 pobj immunity,of
R393 T806 T802 punct ",",modulation
R394 T807 T808 compound macrophage,survival
R395 T808 T802 conj survival,modulation
R396 T809 T808 punct ",",survival
R397 T810 T808 cc and,survival
R398 T811 T808 conj inhibition,survival
R399 T812 T811 prep of,inhibition
R400 T813 T814 compound plasminogen,activators
R401 T814 T812 pobj activators,of
R402 T815 T789 punct .,induced
R403 T816 T827 npadvmod Lipopolysaccharide,induce
R404 T817 T818 punct (,LPS
R405 T818 T816 appos LPS,Lipopolysaccharide
R406 T819 T816 punct ),Lipopolysaccharide
R407 T820 T816 punct ",",Lipopolysaccharide
R408 T821 T824 det a,endotoxin
R409 T822 T824 amod potent,endotoxin
R410 T823 T824 amod bacterial,endotoxin
R411 T824 T816 appos endotoxin,Lipopolysaccharide
R412 T825 T827 punct ",",induce
R413 T826 T827 aux can,induce
R414 T827 T827 ROOT induce,induce
R415 T828 T829 compound SerpinB2,expression
R416 T829 T827 dobj expression,induce
R417 T830 T827 prep via,induce
R418 T831 T833 det the,receptor
R419 T832 T833 amod toll-like,receptor
R420 T833 T830 pobj receptor,via
R421 T834 T833 nummod 4,receptor
R422 T835 T833 punct (,receptor
R423 T836 T833 appos TLR4,receptor
R424 T837 T833 punct ),receptor
R425 T838 T827 prep by,induce
R426 T839 T838 pobj ∼,by
R427 T840 T827 advcl 1000-fold,induce
R428 T841 T840 prep over,1000-fold
R429 T842 T843 det a,period
R430 T843 T841 pobj period,over
R431 T844 T843 prep of,period
R432 T845 T846 nummod 24,hrs
R433 T846 T844 pobj hrs,of
R434 T847 T846 prep in,hrs
R435 T848 T849 amod murine,macrophages
R436 T849 T847 pobj macrophages,in
R437 T850 T827 punct .,induce
R438 T851 T852 aux To,map
R439 T852 T860 advcl map,transfected
R440 T853 T857 det the,regions
R441 T854 T857 amod LPS-regulated,regions
R442 T855 T857 nummod SerpinB2,regions
R443 T856 T857 compound promoter,regions
R444 T857 T852 dobj regions,map
R445 T858 T860 punct ",",transfected
R446 T859 T860 nsubj we,transfected
R447 T860 T860 ROOT transfected,transfected
R448 T861 T862 compound reporter,constructs
R449 T862 T860 dobj constructs,transfected
R450 T863 T862 acl driven,constructs
R451 T864 T863 agent by,driven
R452 T865 T873 det the,region
R453 T866 T868 nmod ∼,kb
R454 T867 T866 nummod 5,∼
R455 T868 T872 meta kb,flanking
R456 T869 T868 nummod 5,kb
R457 T870 T869 punct ',5
R458 T871 T872 punct -,flanking
R459 T872 T873 amod flanking,region
R460 T873 T864 pobj region,by
R461 T874 T873 prep of,region
R462 T875 T878 det the,gene
R463 T876 T878 compound murine,gene
R464 T877 T878 compound SerpinB2,gene
R465 T878 T874 pobj gene,of
R466 T879 T878 cc and,gene
R467 T880 T882 amod several,mutants
R468 T881 T882 compound deletion,mutants
R469 T882 T878 conj mutants,gene
R470 T883 T863 prep into,driven
R471 T884 T885 amod murine,macrophages
R472 T885 T883 pobj macrophages,into
R473 T886 T860 punct .,transfected
R474 T887 T891 prep In,compared
R475 T888 T887 pobj addition,In
R476 T889 T891 punct ",",compared
R477 T890 T891 nsubj we,compared
R478 T891 T891 ROOT compared,compared
R479 T892 T894 det the,sequence
R480 T893 T894 compound DNA,sequence
R481 T894 T891 dobj sequence,compared
R482 T895 T894 prep of,sequence
R483 T896 T901 det the,sequence
R484 T897 T901 nmod murine,sequence
R485 T898 T897 nummod 5,murine
R486 T899 T901 compound ′,sequence
R487 T900 T901 compound flanking,sequence
R488 T901 T895 pobj sequence,of
R489 T902 T891 prep with,compared
R490 T903 T904 det the,sequence
R491 T904 T902 pobj sequence,with
R492 T905 T904 prep of,sequence
R493 T906 T908 det the,gene
R494 T907 T908 amod human,gene
R495 T908 T905 pobj gene,of
R496 T909 T908 prep for,gene
R497 T910 T911 advmod homologous,functional
R498 T911 T913 amod functional,elements
R499 T912 T913 amod regulatory,elements
R500 T913 T909 pobj elements,for
R501 T914 T891 cc and,compared
R502 T915 T891 conj identified,compared
R503 T916 T919 amod several,elements
R504 T917 T919 amod regulatory,elements
R505 T918 T919 amod cis-acting,elements
R506 T919 T915 dobj elements,identified
R507 T920 T919 prep in,elements
R508 T921 T924 det the,promoter
R509 T922 T924 amod human,promoter
R510 T923 T924 compound SERPINB2,promoter
R511 T924 T920 pobj promoter,in
R512 T925 T919 acl conserved,elements
R513 T926 T925 prep in,conserved
R514 T927 T928 det the,mouse
R515 T928 T926 pobj mouse,in
R516 T929 T891 punct .,compared
R517 T930 T931 compound Mutation,analyses
R518 T931 T932 nsubj analyses,revealed
R519 T932 T932 ROOT revealed,revealed
R520 T933 T967 mark that,are
R521 T934 T936 det a,enhancer
R522 T935 T936 compound CCAAT,enhancer
R523 T936 T937 compound enhancer,binding
R524 T937 T967 nsubj binding,are
R525 T938 T941 punct (,element
R526 T939 T941 nmod C/EBP,element
R527 T940 T941 punct ),element
R528 T941 T937 appos element,binding
R529 T942 T941 punct ",",element
R530 T943 T947 det a,element
R531 T944 T947 amod cyclic,element
R532 T945 T947 compound AMP,element
R533 T946 T947 compound response,element
R534 T947 T937 appos element,binding
R535 T948 T949 punct (,CRE
R536 T949 T947 appos CRE,element
R537 T950 T949 punct ),CRE
R538 T951 T947 cc and,element
R539 T952 T954 nummod two,protein
R540 T953 T954 compound activator,protein
R541 T954 T937 appos protein,binding
R542 T955 T957 nummod 1,AP-1
R543 T956 T957 punct (,AP-1
R544 T957 T954 appos AP-1,protein
R545 T958 T957 punct ),AP-1
R546 T959 T960 compound response,elements
R547 T960 T967 nsubj elements,are
R548 T961 T960 prep in,elements
R549 T962 T966 det the,promoter
R550 T963 T966 nmod murine,promoter
R551 T964 T966 nmod SerpinB2,promoter
R552 T965 T966 amod proximal,promoter
R553 T966 T961 pobj promoter,in
R554 T967 T932 ccomp are,revealed
R555 T968 T967 acomp essential,are
R556 T969 T968 prep for,essential
R557 T970 T971 amod optimal,LPS-inducibility
R558 T971 T969 pobj LPS-inducibility,for
R559 T972 T932 punct .,revealed
R560 T973 T975 amod Electrophoretic,shift
R561 T974 T975 compound mobility,shift
R562 T975 T985 nmod shift,assays
R563 T976 T977 punct (,EMSA
R564 T977 T975 appos EMSA,shift
R565 T978 T977 punct ),EMSA
R566 T979 T975 cc and,shift
R567 T980 T981 compound chromatin,immunoprecipitation
R568 T981 T975 conj immunoprecipitation,shift
R569 T982 T981 punct (,immunoprecipitation
R570 T983 T981 appos ChIP,immunoprecipitation
R571 T984 T981 punct ),immunoprecipitation
R572 T985 T986 nsubj assays,demonstrated
R573 T986 T986 ROOT demonstrated,demonstrated
R574 T987 T989 mark that,induces
R575 T988 T989 nsubj LPS,induces
R576 T989 T986 ccomp induces,demonstrated
R577 T990 T991 det the,formation
R578 T991 T989 dobj formation,induces
R579 T992 T991 prep of,formation
R580 T993 T995 compound C/EBP,β
R581 T994 T995 punct -,β
R582 T995 T992 pobj β,of
R583 T996 T995 acl containing,β
R584 T997 T996 dobj complexes,containing
R585 T998 T997 prep with,complexes
R586 T999 T1001 det the,promoter
R587 T1000 T1001 compound SerpinB2,promoter
R588 T1001 T998 pobj promoter,with
R589 T1002 T986 punct .,demonstrated
R590 T1003 T1013 advmod Importantly,abrogated
R591 T1004 T1013 punct ",",abrogated
R592 T1005 T1006 preconj both,constitutive
R593 T1006 T1010 amod constitutive,expression
R594 T1007 T1006 cc and,constitutive
R595 T1008 T1006 conj LPS-induced,constitutive
R596 T1009 T1010 amod SerpinB2,expression
R597 T1010 T1013 nsubjpass expression,abrogated
R598 T1011 T1013 auxpass was,abrogated
R599 T1012 T1013 advmod severely,abrogated
R600 T1013 T1013 ROOT abrogated,abrogated
R601 T1014 T1013 prep in,abrogated
R602 T1015 T1014 pobj C/EBP,in
R603 T1016 T1013 punct -,abrogated
R604 T1017 T1013 advcl β-null,abrogated
R605 T1018 T1020 nmod mouse,fibroblasts
R606 T1019 T1020 amod embryonic,fibroblasts
R607 T1020 T1017 appos fibroblasts,β-null
R608 T1021 T1022 punct (,MEFs
R609 T1022 T1020 appos MEFs,fibroblasts
R610 T1023 T1020 punct ),fibroblasts
R611 T1024 T1020 cc and,fibroblasts
R612 T1025 T1030 amod primary,macrophages
R613 T1026 T1030 nmod C/EBP,macrophages
R614 T1027 T1028 punct -,β-deficient
R615 T1028 T1030 amod β-deficient,macrophages
R616 T1029 T1030 amod peritoneal,macrophages
R617 T1030 T1020 conj macrophages,fibroblasts
R618 T1031 T1013 punct .,abrogated
R619 T1032 T1036 advmod Together,provide
R620 T1033 T1036 punct ",",provide
R621 T1034 T1035 det these,data
R622 T1035 T1036 nsubj data,provide
R623 T1036 T1036 ROOT provide,provide
R624 T1037 T1038 amod new,insight
R625 T1038 T1036 dobj insight,provide
R626 T1039 T1038 prep into,insight
R627 T1040 T1043 amod C/EBP,regulation
R628 T1041 T1042 punct -,β-dependent
R629 T1042 T1043 amod β-dependent,regulation
R630 T1043 T1039 pobj regulation,into
R631 T1044 T1043 prep of,regulation
R632 T1045 T1047 amod inflammation-associated,expression
R633 T1046 T1047 compound SerpinB2,expression
R634 T1047 T1044 pobj expression,of
R635 T1048 T1036 punct .,provide
R738 T763 T773 det The,Transcription
R739 T764 T770 nmod Transcription,Constitutive
R1605 T2488 T2490 det The,response
R1612 T2489 T2490 amod inflammatory,response
R1614 T2490 T2491 nsubj response,is
R1616 T2491 T2491 ROOT is,is
R1617 T2492 T2494 det a,sword
R1622 T2493 T2494 amod double-edged,sword
R1623 T2494 T2491 attr sword,is
R1624 T2495 T2491 punct .,is
R1626 T2496 T2497 advmod Properly,orchestrated
R1628 T2497 T2500 advcl orchestrated,results
R1629 T2498 T2500 punct ",",results
R1631 T2499 T2500 nsubj it,results
R1633 T2500 T2500 ROOT results,results
R1635 T2501 T2500 prep in,results
R1638 T2502 T2503 det the,clearing
R1639 T2503 T2501 pobj clearing,in
R1642 T2504 T2503 prep of,clearing
R1643 T2505 T2506 amod foreign,molecules
R1645 T2506 T2504 pobj molecules,of
R1647 T2507 T2503 cc and,clearing
R1648 T2508 T2503 conj invading,clearing
R1650 T2509 T2508 dobj pathogens,invading
R1652 T2510 T2508 prep from,invading
R1653 T2511 T2512 det the,body
R1654 T2512 T2510 pobj body,from
R1655 T2513 T2500 punct .,results
R1656 T2539 T2536 pobj manifestations,of
R1657 T2540 T2539 prep of,manifestations
R1658 T2514 T2518 advmod Uncontrolled,lead
R1659 T2541 T2543 det the,response
R1660 T2542 T2543 amod inflammatory,response
R1661 T2543 T2540 pobj response,of
R1662 T2515 T2518 punct ",",lead
R1663 T2544 T2545 auxpass are,mediated
R1664 T2545 T2545 ROOT mediated,mediated
R1665 T2546 T2545 agent by,mediated
R1666 T2516 T2518 nsubj it,lead
R1667 T2547 T2546 pobj cytokines,by
R1668 T2548 T2547 cc and,cytokines
R1669 T2517 T2518 aux may,lead
R1670 T2549 T2552 amod other,products
R1671 T2550 T2552 amod inducible,products
R1672 T2518 T2518 ROOT lead,lead
R1673 T2519 T2518 prep to,lead
R1674 T2551 T2552 compound gene,products
R1675 T2552 T2547 conj products,cytokines
R1676 T2520 T2521 compound organ,damage
R1677 T2553 T2552 acl expressed,products
R1678 T2554 T2553 agent by,expressed
R1679 T2555 T2554 pobj macrophages,by
R1680 T2521 T2519 pobj damage,to
R1681 T2556 T2553 prep upon,expressed
R1682 T2557 T2556 pobj exposure,upon
R1683 T2522 T2521 punct ",",damage
R1684 T2558 T2557 prep to,exposure
R1685 T2559 T2564 det the,component
R1686 T2523 T2521 conj sepsis,damage
R1687 T2560 T2563 amod gram-negative,wall
R1688 T2561 T2563 amod bacterial,wall
R1689 T2524 T2523 punct ",",sepsis
R1690 T2562 T2563 compound cell,wall
R1691 T2563 T2564 compound wall,component
R1692 T2564 T2558 pobj component,to
R1693 T2525 T2523 cc and,sepsis
R1694 T2565 T2564 dobj LPS,component
R1695 T2566 T2545 punct .,mediated
R1696 T2567 T2569 mark As,are
R1697 T2526 T2527 advmod even,cancer
R1698 T2568 T2569 nsubj macrophages,are
R1699 T2569 T2580 advcl are,is
R1700 T2570 T2571 amod key,effectors
R1701 T2527 T2531 dep cancer,[
R1702 T2571 T2569 attr effectors,are
R1703 T2572 T2571 prep of,effectors
R1704 T2573 T2576 amod pathogen-induced,responses
R1705 T2574 T2576 amod innate,responses
R1706 T2575 T2576 amod immune,responses
R1707 T2576 T2572 pobj responses,of
R1708 T2577 T2580 punct ",",is
R1709 T2528 T2530 nmod [,]
R1710 T2578 T2579 poss their,survival
R1711 T2579 T2580 nsubj survival,is
R1712 T2580 T2580 ROOT is,is
R1713 T2529 T2530 nummod 1,]
R1714 T2581 T2580 acomp critical,is
R1715 T2582 T2581 prep for,critical
R1716 T2583 T2585 amod initial,neutralization
R1717 T2530 T2531 nmod ],[
R1718 T2584 T2585 compound pathogen,neutralization
R1719 T2585 T2582 pobj neutralization,for
R1720 T2586 T2585 cc and,neutralization
R1721 T2531 T2518 dobj [,lead
R1722 T2587 T2588 amod subsequent,development
R1723 T2588 T2585 conj development,neutralization
R1724 T2589 T2585 prep of,neutralization
R1725 T2532 T2533 nummod 3,]
R1726 T2590 T2592 amod adaptive,responses
R1727 T2591 T2592 amod immune,responses
R1728 T2592 T2589 pobj responses,of
R1729 T2533 T2531 appos ],[
R1730 T2593 T2580 punct .,is
R1731 T2534 T2518 punct .,lead
R1732 T2594 T2603 nsubj One,is
R1733 T2595 T2594 prep of,One
R1734 T2596 T2601 det the,products
R1735 T2535 T2545 nsubjpass Many,mediated
R1736 T2597 T2598 advmod most,LPS-inducible
R1737 T2598 T2601 amod LPS-inducible,products
R1738 T2599 T2601 amod macrophage,products
R1739 T2600 T2601 compound gene,products
R1740 T2536 T2535 prep of,Many
R1741 T2601 T2595 pobj products,of
R1742 T2602 T2601 acl known,products
R1743 T2603 T2603 ROOT is,is
R1744 T2537 T2539 det the,manifestations
R1745 T2604 T2608 det the,inhibitor
R1746 T2605 T2608 amod ovalbumin-like,inhibitor
R1747 T2538 T2539 amod pathological,manifestations
R1748 T2606 T2608 nmod serine,inhibitor
R1749 T2607 T2608 compound protease,inhibitor
R1750 T2608 T2603 attr inhibitor,is
R1751 T2609 T2608 punct (,inhibitor
R1752 T2636 T2637 amod urokinase-type,plasminogen
R1753 T2610 T2608 appos ov-serpin,inhibitor
R1754 T2611 T2608 punct ),inhibitor
R1755 T2612 T2608 appos SerpinB2,inhibitor
R1756 T2613 T2612 punct ",",SerpinB2
R1757 T2614 T2619 det a,factor
R1758 T2615 T2616 advmod widely,recognized
R1759 T2637 T2635 pobj plasminogen,of
R1760 T2616 T2619 amod recognized,factor
R1761 T2617 T2619 compound macrophage,factor
R1762 T2638 T2634 conj activator,inhibitor
R1763 T2618 T2619 compound survival,factor
R1764 T2619 T2608 appos factor,inhibitor
R1765 T2620 T2622 nmod [,]
R1766 T2639 T2634 punct (,inhibitor
R1767 T2621 T2622 nummod 4,]
R1768 T2622 T2619 appos ],factor
R1769 T2623 T2603 punct ;,is
R1770 T2624 T2624 ROOT [,[
R1771 T2625 T2626 nummod 5,]
R1772 T2640 T2634 appos uPA,inhibitor
R1773 T2626 T2624 dobj ],[
R1774 T2627 T2624 punct .,[
R1775 T2628 T2631 nsubjpass SerpinB2,identified
R1776 T2629 T2631 auxpass was,identified
R1777 T2641 T2631 punct ),identified
R1778 T2630 T2631 advmod first,identified
R1779 T2642 T2644 compound [,]
R1780 T2631 T2631 ROOT identified,identified
R1781 T2643 T2644 compound 6,]
R1782 T2632 T2631 prep as,identified
R1783 T2633 T2634 det an,inhibitor
R1784 T2634 T2632 pobj inhibitor,as
R1785 T2644 T2644 ROOT ],]
R1786 T2635 T2634 prep of,inhibitor
R1787 T2645 T2647 nmod [,]
R1788 T2646 T2647 nummod 8,]
R1789 T2647 T2647 ROOT ],]
R1790 T2648 T2647 punct ",",]
R1791 T2733 T2722 conj [,]
R1792 T2734 T2735 nummod 22,]
R1793 T2649 T2651 det a,protease
R1794 T2735 T2722 conj ],]
R1795 T2736 T2715 punct ;,]
R1796 T2737 T2739 nmod [,]
R1797 T2650 T2651 compound serine,protease
R1798 T2738 T2739 nummod 23,]
R1799 T2739 T2715 conj ],]
R1800 T2740 T2739 cc and,]
R1801 T2651 T2647 appos protease,]
R1802 T2741 T2742 amod innate,immunity
R1803 T2742 T2739 conj immunity,]
R1804 T2743 T2745 nmod [,]
R1805 T2652 T2651 amod involved,protease
R1806 T2744 T2745 nummod 24,]
R1807 T2745 T2742 appos ],immunity
R1808 T2746 T2748 compound [,]
R1809 T2747 T2748 compound 28,]
R1810 T2748 T2745 appos ],]
R1811 T2749 T2752 punct ",",described
R1812 T2653 T2652 prep in,involved
R1813 T2750 T2752 aux have,described
R1814 T2751 T2752 auxpass been,described
R1815 T2752 T2752 ROOT described,described
R1816 T2654 T2655 det the,degradation
R1817 T2753 T2752 punct .,described
R1818 T2754 T2756 det The,gene
R1819 T2755 T2756 compound SerpinB2,gene
R1820 T2655 T2653 pobj degradation,in
R1821 T2756 T2759 nsubjpass gene,regulated
R1822 T2757 T2759 auxpass is,regulated
R1823 T2758 T2759 advmod highly,regulated
R1824 T2656 T2655 cc and,degradation
R1825 T2759 T2759 ROOT regulated,regulated
R1826 T2760 T2759 prep in,regulated
R1827 T2761 T2765 det a,manner
R1828 T2657 T2655 conj turnover,degradation
R1829 T2762 T2763 compound cell,type
R1830 T2763 T2765 nmod type,manner
R1831 T2764 T2765 amod specific,manner
R1832 T2658 T2655 prep of,degradation
R1833 T2765 T2760 pobj manner,in
R1834 T2766 T2765 amod analogous,manner
R1835 T2659 T2661 det the,matrix
R1836 T2767 T2766 prep to,analogous
R1837 T2768 T2767 pobj that,to
R1838 T2769 T2768 prep of,that
R1839 T2660 T2661 amod extracellular,matrix
R1840 T2770 T2769 pobj cytokines,of
R1841 T2771 T2770 cc and,cytokines
R1842 T2772 T2770 conj oncogenes,cytokines
R1843 T2773 T2775 nmod [,]
R1844 T2661 T2658 pobj matrix,of
R1845 T2774 T2775 nummod 29,]
R1846 T2775 T2768 appos ],that
R1847 T2662 T2652 prep through,involved
R1848 T2776 T2775 punct ;,]
R1849 T2777 T2779 nmod [,]
R1850 T2778 T2779 nummod 30,]
R1851 T2779 T2775 appos ],]
R1852 T2663 T2664 det the,activation
R1853 T2780 T2759 punct .,regulated
R1854 T2781 T2782 nsubj It,is
R1855 T2782 T2782 ROOT is,is
R1856 T2783 T2782 attr one,is
R1857 T2784 T2783 prep of,one
R1858 T2785 T2788 det the,genes
R1859 T2664 T2662 pobj activation,through
R1860 T2786 T2787 advmod most,responsive
R1861 T2787 T2788 amod responsive,genes
R1862 T2788 T2784 pobj genes,of
R1863 T2665 T2664 prep of,activation
R1864 T2666 T2665 pobj plasminogen,of
R1865 T2789 T2788 acl known,genes
R1866 T2667 T2664 conj [,activation
R1867 T2790 T2792 nmod [,]
R1868 T2791 T2792 nummod 31,]
R1869 T2668 T2667 nummod 7,[
R1870 T2792 T2789 dobj ],known
R1871 T2793 T2782 punct ",",is
R1872 T2669 T2667 conj ],[
R1873 T2794 T2782 cc and,is
R1874 T2795 T2797 aux can,induced
R1875 T2796 T2797 auxpass be,induced
R1876 T2670 T2647 punct ;,]
R1877 T2797 T2782 conj induced,is
R1878 T2798 T2797 prep over,induced
R1879 T2799 T2798 pobj 1000-fold,over
R1880 T2671 T2673 nmod [,]
R1881 T2800 T2797 agent by,induced
R1882 T2801 T2804 nmod LPS,]
R1883 T2672 T2673 nummod 9,]
R1884 T2802 T2804 nmod [,]
R1885 T2803 T2804 nummod 31,]
R1886 T2804 T2800 pobj ],by
R1887 T2673 T2647 appos ],]
R1888 T2805 T2807 nmod [,]
R1889 T2806 T2807 nummod 32,]
R1890 T2807 T2804 conj ],]
R1891 T2674 T2644 punct .,]
R1892 T2808 T2807 punct ",",]
R1893 T2809 T2797 cc and,induced
R1894 T2810 T2797 conj is,induced
R1895 T2675 T2676 amod Such,function
R1896 T2811 T2810 acomp up-regulated,is
R1897 T2812 T2811 prep by,up-regulated
R1898 T2813 T2814 det a,range
R1899 T2676 T2677 nsubj function,requires
R1900 T2814 T2812 pobj range,by
R1901 T2815 T2814 prep of,range
R1902 T2816 T2817 amod inflammatory,mediators
R1903 T2677 T2677 ROOT requires,requires
R1904 T2817 T2815 pobj mediators,of
R1905 T2818 T2820 nmod [,]
R1906 T2678 T2677 dobj SerpinB2,requires
R1907 T2819 T2820 nummod 9,]
R1908 T2820 T2810 npadvmod ],is
R1909 T2821 T2810 punct .,is
R1910 T2822 T2823 nsubj LPS,activates
R1911 T2823 T2823 ROOT activates,activates
R1912 T2824 T2825 amod immune,responses
R1913 T2825 T2823 dobj responses,activates
R1914 T2679 T2681 aux to,secreted
R1915 T2826 T2823 prep through,activates
R1916 T2827 T2829 amod multiple,pathways
R1917 T2828 T2829 amod signalling,pathways
R1918 T2680 T2681 auxpass be,secreted
R1919 T2829 T2826 pobj pathways,through
R1920 T2681 T2677 xcomp secreted,requires
R1921 T2682 T2681 prep from,secreted
R1922 T2683 T2684 det the,cell
R1923 T2830 T2823 punct .,activates
R1924 T2831 T2838 det The,is
R1925 T2832 T2833 amod toll-like,receptor
R1926 T2684 T2682 pobj cell,from
R1927 T2833 T2838 nsubj receptor,is
R1928 T2834 T2833 nummod 4,receptor
R1929 T2685 T2681 advmod yet,secreted
R1930 T2835 T2833 punct (,receptor
R1931 T2836 T2833 appos TLR4,receptor
R1932 T2837 T2833 punct ),receptor
R1933 T2686 T2687 nsubj SerpinB2,exists
R1934 T2838 T2838 ROOT is,is
R1935 T2839 T2838 acomp responsible,is
R1936 T2840 T2839 prep for,responsible
R1937 T2687 T2677 conj exists,requires
R1938 T2841 T2842 det the,recognition
R1939 T2842 T2840 pobj recognition,for
R1940 T2688 T2687 advmod primarily,exists
R1941 T2843 T2842 prep of,recognition
R1942 T2844 T2843 pobj LPS,of
R1943 T2845 T2844 cc and,LPS
R1944 T2689 T2687 prep as,exists
R1945 T2846 T2848 amod other,products
R1946 T2847 T2848 amod microbial,products
R1947 T2848 T2844 conj products,LPS
R1948 T2690 T2693 det a,protein
R1949 T2849 T2848 cc and,products
R1950 T2850 T2838 conj plays,is
R1951 T2691 T2693 amod nonglycosylated,protein
R1952 T2851 T2853 det a,role
R1953 T2852 T2853 amod central,role
R1954 T2853 T2850 dobj role,plays
R1955 T2692 T2693 compound intracellular,protein
R1956 T2854 T2853 prep in,role
R1957 T2855 T2856 det the,initiation
R1958 T2856 T2854 pobj initiation,in
R1959 T2857 T2856 prep of,initiation
R1960 T2858 T2860 amod innate,responses
R1961 T2859 T2860 amod immune,responses
R1962 T2693 T2689 pobj protein,as
R1963 T2860 T2857 pobj responses,of
R1964 T2861 T2860 punct ",",responses
R1965 T2862 T2860 prep including,responses
R1966 T2863 T2864 compound cytokine,release
R1967 T2694 T2696 nmod [,]
R1968 T2864 T2862 pobj release,including
R1969 T2865 T2838 punct .,is
R1970 T2866 T2867 det The,binding
R1971 T2695 T2696 nummod 10,]
R1972 T2867 T2877 nsubj binding,leads
R1973 T2696 T2693 appos ],protein
R1974 T2868 T2867 prep of,binding
R1975 T2697 T2687 punct .,exists
R1976 T2869 T2868 pobj LPS,of
R1977 T2870 T2867 prep to,binding
R1978 T2871 T2870 pobj TLR4,to
R1979 T2698 T2752 prep Over,described
R1980 T2872 T2867 prep on,binding
R1981 T2873 T2874 det the,surface
R1982 T2874 T2872 pobj surface,on
R1983 T2699 T2701 det the,decade
R1984 T2875 T2874 prep of,surface
R1985 T2876 T2875 pobj macrophages,of
R1986 T2877 T2877 ROOT leads,leads
R1987 T2878 T2877 prep to,leads
R1988 T2700 T2701 amod past,decade
R1989 T2879 T2880 det the,recruitment
R1990 T2880 T2878 pobj recruitment,to
R1991 T2881 T2880 prep of,recruitment
R1992 T2701 T2698 pobj decade,Over
R1993 T2882 T2883 compound adaptor,molecules
R1994 T2883 T2881 pobj molecules,of
R1995 T2702 T2752 punct ",",described
R1996 T2884 T2883 cc and,molecules
R1997 T2885 T2886 det the,activation
R1998 T2886 T2880 conj activation,recruitment
R1999 T2887 T2886 prep of,activation
R2000 T2703 T2704 amod intracellular,roles
R2001 T2888 T2889 compound protein,kinases
R2002 T2889 T2887 pobj kinases,of
R2003 T2704 T2752 nsubjpass roles,described
R2004 T2890 T2877 punct ",",leads
R2005 T2891 T2877 advcl generating,leads
R2006 T2892 T2891 dobj signals,generating
R2007 T2705 T2704 prep for,roles
R2008 T2893 T2892 prep to,signals
R2009 T2894 T2896 det the,factor-κB
R2010 T2895 T2896 amod nuclear,factor-κB
R2011 T2896 T2893 pobj factor-κB,to
R2012 T2897 T2896 punct (,factor-κB
R2013 T2898 T2896 appos NF-κB,factor-κB
R2014 T2706 T2705 pobj SerpinB2,for
R2015 T2899 T2896 punct ),factor-κB
R2016 T2900 T2896 punct ",",factor-κB
R2017 T2901 T2902 amod mitogen-activated,protein
R2018 T2902 T2903 compound protein,kinase
R2019 T2707 T2704 prep in,roles
R2020 T2903 T2915 nmod kinase,pathways
R2021 T2904 T2903 punct (,kinase
R2022 T2708 T2709 compound cell,survival
R2023 T2905 T2903 appos MAPK,kinase
R2024 T2906 T2905 punct ),MAPK
R2025 T2907 T2903 cc and/or,kinase
R2026 T2709 T2707 pobj survival,in
R2027 T2908 T2903 conj phosphoinositide,kinase
R2028 T2909 T2908 nummod 3,phosphoinositide
R2029 T2910 T2908 punct (,phosphoinositide
R2030 T2911 T2908 appos PI3,phosphoinositide
R2031 T2710 T2712 nmod [,]
R2032 T2912 T2908 punct ),phosphoinositide
R2033 T2913 T2914 punct -,kinase
R2034 T2914 T2915 compound kinase,pathways
R2035 T2711 T2712 nummod 11,]
R2036 T2915 T2892 appos pathways,signals
R2037 T2916 T2918 nmod [,]
R2038 T2917 T2918 nummod 33,]
R2039 T2712 T2713 meta ],[
R2040 T2918 T2915 appos ],pathways
R2041 T2919 T2877 punct .,leads
R2042 T2920 T2935 prep In,identified
R2043 T2713 T2715 nmod [,]
R2044 T2921 T2920 pobj studies,In
R2045 T2922 T2921 acl aimed,studies
R2046 T2923 T2922 prep at,aimed
R2047 T2714 T2715 nummod 17,]
R2048 T2924 T2923 pcomp identifying,at
R2049 T2925 T2927 amod LPS-inducible,factors
R2050 T2926 T2927 amod pro-survival,factors
R2051 T2715 T2752 nsubj ],described
R2052 T2716 T2715 punct ",",]
R2053 T2717 T2715 conj proliferation,]
R2054 T2927 T2924 dobj factors,identifying
R2055 T2928 T2927 amod downstream,factors
R2056 T2929 T2928 prep of,downstream
R2057 T2718 T2717 cc and,proliferation
R2058 T2930 T2931 nummod p38,MAPK
R2059 T2931 T2929 pobj MAPK,of
R2060 T2932 T2935 punct ",",identified
R2061 T2933 T2935 nsubjpass SerpinB2,identified
R2062 T2934 T2935 auxpass was,identified
R2063 T2719 T2717 conj differentiation,proliferation
R2064 T2935 T2935 ROOT identified,identified
R2065 T2936 T2935 prep as,identified
R2066 T2937 T2938 det a,factor
R2067 T2938 T2936 pobj factor,as
R2068 T2720 T2722 nmod [,]
R2069 T2939 T2940 poss whose,expression
R2070 T2940 T2942 nsubjpass expression,upregulated
R2071 T2941 T2942 auxpass was,upregulated
R2072 T2721 T2722 nummod 18,]
R2073 T2942 T2935 advcl upregulated,identified
R2074 T2943 T2942 agent by,upregulated
R2075 T2944 T2943 pobj cooperation,by
R2076 T2722 T2719 appos ],differentiation
R2077 T2945 T2944 prep of,cooperation
R2078 T2946 T2949 det the,NF-κB
R2079 T2723 T2725 nmod [,]
R2080 T2947 T2949 compound IKKβ,NF-κB
R2081 T2948 T2949 compound /,NF-κB
R2082 T2724 T2725 nummod 21,]
R2083 T2949 T2945 pobj NF-κB,of
R2084 T2950 T2949 cc and,NF-κB
R2085 T2951 T2953 nummod p38,pathways
R2086 T2952 T2953 compound MAPK/CREB,pathways
R2087 T2725 T2722 conj ],]
R2088 T2953 T2944 conj pathways,cooperation
R2089 T2954 T2956 nmod [,]
R2090 T2726 T2725 punct ",",]
R2091 T2955 T2956 nummod 16,]
R2092 T2956 T2953 appos ],pathways
R2093 T2957 T2935 punct .,identified
R2094 T2727 T2728 compound signal,transduction
R2095 T2958 T2961 poss Our,data
R2096 T2959 T2960 advmod previously,published
R2097 T2960 T2961 amod published,data
R2098 T2728 T2729 compound transduction,[
R2099 T2961 T2962 nsubj data,indicated
R2100 T2962 T2962 ROOT indicated,indicated
R2101 T2963 T2967 mark that,regulated
R2102 T2729 T2725 conj [,]
R2103 T2964 T2967 nsubjpass SerpinB2,regulated
R2104 T2965 T2967 auxpass is,regulated
R2105 T2966 T2967 advmod distinctly,regulated
R2106 T2967 T2962 ccomp regulated,indicated
R2107 T2730 T2731 nummod 15,]
R2108 T2968 T2967 prep from,regulated
R2109 T2969 T2971 amod other,genes
R2110 T2970 T2971 amod LPS-inducible,genes
R2111 T2971 T2968 pobj genes,from
R2112 T2972 T2967 prep in,regulated
R2113 T2731 T2729 conj ],[
R2114 T2973 T2972 pobj terms,in
R2115 T2974 T2973 prep of,terms
R2116 T2975 T2974 pobj kinetics,of
R2117 T2976 T2967 punct ",",regulated
R2118 T2732 T2722 punct ;,]
R2119 T2977 T2979 nmod LPS,response
R2120 T2978 T2979 compound dose,response
R2121 T2979 T2998 nsubjpass response,responsible
R2122 T3024 T3027 nsubj induction,is
R2123 T2980 T2979 cc and,response
R2124 T2981 T2979 conj sensitivity,response
R2125 T2982 T2981 prep to,sensitivity
R2126 T2983 T2985 amod IFN-γ,[
R2127 T3025 T3024 prep of,induction
R2128 T2984 T2985 compound co-stimulation,[
R2129 T2985 T2982 pobj [,to
R2130 T2986 T2987 nummod 4,]
R2131 T3026 T3025 pobj SerpinB2,of
R2132 T2987 T2982 pobj ],to
R2133 T2988 T2998 punct ;,responsible
R2134 T2989 T2998 advmod however,responsible
R2135 T3027 T3021 ccomp is,show
R2136 T2990 T2998 punct ",",responsible
R2137 T2991 T2993 det the,elements
R2138 T2992 T2993 amod cis-acting,elements
R2139 T2993 T2998 nsubj elements,responsible
R2140 T3028 T3027 acomp dependent,is
R2141 T2994 T2993 prep in,elements
R2142 T2995 T2997 det the,promoter
R2143 T2996 T2997 compound SerpinB2,promoter
R2144 T3029 T3028 prep upon,dependent
R2145 T2997 T2994 pobj promoter,in
R2146 T2998 T2962 ccomp responsible,indicated
R2147 T3030 T3032 amod cis-acting,sequences
R2148 T2999 T2998 prep for,responsible
R2149 T3000 T3001 amod LPS-dependent,transcription
R2150 T3001 T2999 pobj transcription,for
R2151 T3031 T3032 amod regulatory,sequences
R2152 T3002 T3001 prep in,transcription
R2153 T3003 T3002 pobj macrophages,in
R2154 T3004 T3003 cc and,macrophages
R2155 T3032 T3029 pobj sequences,upon
R2156 T3005 T3009 det the,factors
R2157 T3006 T3009 amod specific,factors
R2158 T3007 T3009 amod LPS-responsive,factors
R2159 T3008 T3009 compound transcription,factors
R2160 T3009 T2998 dobj factors,responsible
R2161 T3010 T3011 nsubj that,bind
R2162 T3033 T3032 prep in,sequences
R2163 T3011 T3017 nsubjpass bind,defined
R2164 T3012 T3014 det the,promoter
R2165 T3013 T3014 compound SerpinB2,promoter
R2166 T3014 T3017 nsubjpass promoter,defined
R2167 T3034 T3035 det the,region
R2168 T3015 T3017 auxpass were,defined
R2169 T3016 T3017 neg not,defined
R2170 T3017 T2962 conj defined,indicated
R2171 T3018 T3017 punct .,defined
R2172 T3035 T3033 pobj region,in
R2173 T3019 T3021 advmod Here,show
R2174 T3020 T3021 nsubj we,show
R2175 T3021 T3021 ROOT show,show
R2176 T3036 T3027 prep between,is
R2177 T3022 T3027 mark that,is
R2178 T3023 T3024 compound LPS,induction
R2179 T3037 T3036 pobj nucleotides,between
R2180 T3038 T3021 conj −,show
R2181 T3039 T3038 dobj 189,−
R2182 T3040 T3039 cc and,189
R2183 T3121 T3110 punct .,provide
R2184 T3041 T3039 conj −,189
R2185 T3042 T3039 conj 539,189
R2186 T3043 T3042 prep of,539
R2187 T3044 T3047 det the,promoter
R2188 T3045 T3047 compound murine,promoter
R2189 T3046 T3047 compound SerpinB2,promoter
R2190 T3047 T3043 pobj promoter,of
R2191 T3048 T3021 punct ",",show
R2192 T3049 T3021 cc and,show
R2193 T3050 T3021 conj is,show
R2194 T3051 T3052 advmod critically,dependent
R2195 T3052 T3050 acomp dependent,is
R2196 T3053 T3052 prep upon,dependent
R2197 T3054 T3057 det a,site
R2198 T3055 T3057 nmod C/EBP,site
R2199 T3056 T3057 amod binding,site
R2200 T3057 T3053 pobj site,upon
R2201 T3058 T3050 prep at,is
R2202 T3059 T3063 nummod −,195
R2203 T3060 T3062 nummod 203,−
R2204 T3061 T3062 compound /,−
R2205 T3062 T3063 nummod −,195
R2206 T3063 T3058 pobj 195,at
R2207 T3064 T3021 punct .,show
R2208 T3065 T3067 punct C/EBP,β
R2209 T3066 T3067 punct -,β
R2210 T3067 T3078 nsubj β,abrogated
R2211 T3068 T3069 advmod directly,bound
R2212 T3069 T3067 acl bound,β
R2213 T3070 T3069 prep to,bound
R2214 T3071 T3072 det this,site
R2215 T3072 T3070 pobj site,to
R2216 T3073 T3072 prep in,site
R2217 T3074 T3073 pobj vivo,in
R2218 T3075 T3074 cc and,vivo
R2219 T3076 T3077 poss its,deficiency
R2220 T3077 T3074 conj deficiency,vivo
R2221 T3078 T3078 ROOT abrogated,abrogated
R2222 T3079 T3081 amod constitutive,expression
R2223 T3080 T3081 compound SerpinB2,expression
R2224 T3081 T3078 dobj expression,abrogated
R2225 T3082 T3081 cc and,expression
R2226 T3083 T3084 amod SerpinB2,induction
R2227 T3084 T3081 conj induction,expression
R2228 T3085 T3078 prep by,abrogated
R2229 T3086 T3085 pobj LPS,by
R2230 T3087 T3078 punct .,abrogated
R2231 T3088 T3097 advmod Importantly,found
R2232 T3089 T3097 punct ",",found
R2233 T3090 T3095 det a,site
R2234 T3091 T3095 nmod C/EBP,site
R2235 T3092 T3093 punct -,β
R2236 T3093 T3095 nmod β,site
R2237 T3094 T3095 compound phospho-acceptor,site
R2238 T3095 T3097 nsubjpass site,found
R2239 T3096 T3097 auxpass was,found
R2240 T3097 T3097 ROOT found,found
R2241 T3098 T3100 aux to,regulate
R2242 T3099 T3100 advmod negatively,regulate
R2243 T3100 T3097 advcl regulate,found
R2244 T3101 T3104 amod LPS-induced,activity
R2245 T3102 T3104 amod SerpinB2,activity
R2246 T3103 T3104 compound promoter,activity
R2247 T3104 T3100 dobj activity,regulate
R2248 T3105 T3097 punct .,found
R2249 T3106 T3110 advmod Together,provide
R2250 T3107 T3110 punct ",",provide
R2251 T3108 T3109 det these,findings
R2252 T3109 T3110 nsubj findings,provide
R2253 T3110 T3110 ROOT provide,provide
R2254 T3111 T3112 amod new,insight
R2255 T3112 T3110 dobj insight,provide
R2256 T3113 T3112 prep into,insight
R2257 T3114 T3116 det the,regulation
R2258 T3115 T3116 amod transcriptional,regulation
R2259 T3116 T3113 pobj regulation,into
R2260 T3117 T3116 prep of,regulation
R2261 T3118 T3120 det the,gene
R2262 T3119 T3120 compound SerpinB2,gene
R2263 T3120 T3117 pobj gene,of
R2376 T3316 T3320 compound Cell,RAW
R2377 T3317 T3318 compound Culture,Murine
R2378 T3318 T3320 compound Murine,RAW
R2379 T3319 T3320 compound macrophage,RAW
R2380 T3320 T3328 nsubjpass RAW,maintained
R2381 T3321 T3322 nummod 264.7,cells
R2382 T3322 T3320 appos cells,RAW
R2383 T3323 T3320 punct (,RAW
R2384 T3324 T3320 appos ATCC,RAW
R2385 T3325 T3324 nummod TIB-71,ATCC
R2386 T3326 T3320 punct ),RAW
R2387 T3327 T3328 auxpass were,maintained
R2388 T3328 T3328 ROOT maintained,maintained
R2389 T3329 T3328 prep in,maintained
R2390 T3330 T3332 nmod RPMI,media
R2391 T3331 T3332 compound 1640,media
R2392 T3332 T3329 pobj media,in
R2393 T3333 T3335 punct (,BRL
R2394 T3334 T3335 compound Gibco,BRL
R2395 T3335 T3332 appos BRL,media
R2396 T3336 T3332 punct ),media
R2397 T3337 T3328 punct ",",maintained
R2398 T3338 T3328 conj supplemented,maintained
R2399 T3339 T3338 prep with,supplemented
R2400 T3340 T3342 nummod 2,L-glutamine
R2401 T3341 T3342 compound mM,L-glutamine
R2402 T3342 T3339 pobj L-glutamine,with
R2403 T3343 T3342 punct (,L-glutamine
R2404 T3344 T3345 compound Gibco,BRL
R2405 T3345 T3342 appos BRL,L-glutamine
R2406 T3346 T3342 punct ),L-glutamine
R2407 T3347 T3342 punct ",",L-glutamine
R2408 T3348 T3349 nummod 10,%
R2409 T3349 T3351 compound %,supreme
R2410 T3350 T3351 compound serum,supreme
R2411 T3351 T3342 appos supreme,L-glutamine
R2412 T3352 T3353 punct (,BioWhittaker
R2413 T3353 T3351 appos BioWhittaker,supreme
R2414 T3354 T3353 punct ),BioWhittaker
R2415 T3355 T3351 punct ",",supreme
R2416 T3356 T3360 nummod 200,penicillin
R2417 T3357 T3360 compound µg,penicillin
R2418 T3358 T3360 compound /,penicillin
R2419 T3359 T3360 compound ml,penicillin
R2420 T3360 T3351 conj penicillin,supreme
R2421 T3361 T3360 punct ",",penicillin
R2422 T3362 T3363 nummod 100,µg
R2423 T3363 T3366 nmod µg,streptomycin
R2424 T3364 T3366 nmod /,streptomycin
R2425 T3365 T3366 compound ml,streptomycin
R2426 T3366 T3360 conj streptomycin,penicillin
R2427 T3367 T3366 punct ",",streptomycin
R2428 T3368 T3372 nummod 25,acid
R2429 T3369 T3372 nmod mM,acid
R2430 T3370 T3372 nmod N-2-hydroxyethylpiperazine-N-2-ethane,acid
R2431 T3371 T3372 amod sulphonic,acid
R2432 T3372 T3380 nmod acid,bicarbonate
R2433 T3373 T3374 punct (,HEPES
R2434 T3374 T3372 appos HEPES,acid
R2435 T3375 T3374 punct ),HEPES
R2436 T3376 T3374 cc and,HEPES
R2437 T3377 T3380 nummod 25,bicarbonate
R2438 T3378 T3380 compound mM,bicarbonate
R2439 T3379 T3380 compound sodium,bicarbonate
R2440 T3380 T3366 conj bicarbonate,streptomycin
R2441 T3381 T3342 punct ",",L-glutamine
R2442 T3382 T3338 prep in,supplemented
R2443 T3383 T3384 nummod 5,%
R2444 T3384 T3382 pobj %,in
R2445 T3385 T3391 nummod CO2,atmosphere
R2446 T3386 T3385 cc and,CO2
R2447 T3387 T3388 nummod 95,%
R2448 T3388 T3391 nmod %,atmosphere
R2449 T3389 T3391 amod humidified,atmosphere
R2450 T3390 T3391 compound air,atmosphere
R2451 T3391 T3391 ROOT atmosphere,atmosphere
R2452 T3392 T3391 prep at,atmosphere
R2453 T3393 T3394 nummod 37,°
R2454 T3394 T3396 compound °,Wild-type
R2455 T3395 T3396 compound C.,Wild-type
R2456 T3396 T3392 pobj Wild-type,at
R2457 T3397 T3396 punct (,Wild-type
R2458 T3398 T3401 compound Cebpb,+
R2459 T3399 T3401 compound +,+
R2460 T3400 T3401 compound /,+
R2461 T3401 T3396 appos +,Wild-type
R2462 T3402 T3396 punct ),Wild-type
R2463 T3403 T3391 cc and,atmosphere
R2464 T3404 T3391 conj knockout,atmosphere
R2465 T3405 T3391 punct (,atmosphere
R2466 T3406 T3407 nsubj Cebpb,−
R2467 T3407 T3391 appos −,atmosphere
R2468 T3408 T3409 nummod /,−
R2469 T3409 T3407 appos −,−
R2470 T3410 T3407 punct ),−
R2471 T3411 T3413 nmod mouse,fibroblasts
R2472 T3412 T3413 amod embryonic,fibroblasts
R2473 T3413 T3391 appos fibroblasts,atmosphere
R2474 T3414 T3413 punct (,fibroblasts
R2475 T3415 T3413 appos MEFs,fibroblasts
R2476 T3416 T3413 punct ),fibroblasts
R2477 T3417 T3419 nmod [,]
R2478 T3418 T3419 nummod 34,]
R2479 T3419 T3421 nsubjpass ],grown
R2480 T3420 T3421 auxpass were,grown
R2481 T3421 T3421 ROOT grown,grown
R2482 T3422 T3421 prep in,grown
R2483 T3423 T3428 poss Dulbecco,medium
R2484 T3424 T3423 case 's,Dulbecco
R2485 T3425 T3428 amod modified,medium
R2486 T3426 T3428 poss Eagle,medium
R2487 T3427 T3426 case 's,Eagle
R2488 T3428 T3422 pobj medium,in
R2489 T3429 T3428 punct (,medium
R2490 T3430 T3428 appos Invitrogen,medium
R2491 T3431 T3428 punct ),medium
R2492 T3432 T3421 conj supplemented,grown
R2493 T3433 T3432 prep with,supplemented
R2494 T3434 T3435 nummod 10,%
R2495 T3435 T3438 nmod %,serum
R2496 T3436 T3438 amod fetal,serum
R2497 T3437 T3438 amod bovine,serum
R2498 T3438 T3433 pobj serum,with
R2499 T3439 T3438 cc and,serum
R2500 T3440 T3441 nummod 1,%
R2501 T3441 T3443 nmod %,solution
R2502 T3442 T3443 amod penicillin/streptomycin/glutamate,solution
R2503 T3443 T3438 conj solution,serum
R2504 T3444 T3445 punct (,Cellgro
R2505 T3445 T3443 appos Cellgro,solution
R2506 T3446 T3445 punct ),Cellgro
R2507 T3447 T3421 punct .,grown
R2508 T3448 T3450 amod Primary,macrophages
R2509 T3449 T3450 amod peritoneal,macrophages
R2510 T3450 T3452 nsubjpass macrophages,obtained
R2511 T3451 T3452 auxpass were,obtained
R2512 T3452 T3452 ROOT obtained,obtained
R2513 T3453 T3452 prep by,obtained
R2514 T3454 T3453 pcomp injecting,by
R2515 T3455 T3456 compound C57BL/6,mice
R2516 T3456 T3454 dobj mice,injecting
R2517 T3457 T3454 prep with,injecting
R2518 T3458 T3459 nummod 3,%
R2519 T3459 T3461 nmod %,broth
R2520 T3460 T3461 compound thioglycollate,broth
R2521 T3461 T3457 pobj broth,with
R2522 T3462 T3461 acl followed,broth
R2523 T3463 T3462 agent by,followed
R2524 T3464 T3465 amod peritoneal,lavage
R2525 T3465 T3463 pobj lavage,by
R2526 T3466 T3465 nummod 3,lavage
R2527 T3467 T3468 nummod 5,days
R2528 T3468 T3469 npadvmod days,later
R2529 T3469 T3462 advmod later,followed
R2530 T3470 T3452 punct ",",obtained
R2531 T3471 T3452 cc and,obtained
R2532 T3472 T3452 conj maintained,obtained
R2533 T3473 T3472 prep in,maintained
R2534 T3474 T3475 nummod 50,%
R2535 T3475 T3473 pobj %,in
R2536 T3476 T3477 nummod DMEM/F12,media
R2537 T3477 T3473 pobj media,in
R2538 T3478 T3480 punct (,BRL
R2539 T3479 T3480 compound Gibco,BRL
R2540 T3480 T3472 appos BRL,maintained
R2541 T3481 T3480 punct ),BRL
R2542 T3482 T3452 punct .,obtained
R2543 T3483 T3485 nsubjpass Precautions,taken
R2544 T3484 T3485 auxpass were,taken
R2545 T3485 T3485 ROOT taken,taken
R2546 T3486 T3487 aux to,exclude
R2547 T3487 T3485 advcl exclude,taken
R2548 T3488 T3490 amod bacterial,contamination
R2549 T3489 T3490 compound lipopolysaccharide,contamination
R2550 T3490 T3487 dobj contamination,exclude
R2551 T3491 T3490 prep from,contamination
R2552 T3492 T3494 det all,cultures
R2553 T3493 T3494 compound cell,cultures
R2554 T3494 T3491 pobj cultures,from
R2555 T3495 T3487 prep through,exclude
R2556 T3496 T3497 det the,use
R2557 T3497 T3495 pobj use,through
R2558 T3498 T3497 prep of,use
R2559 T3499 T3501 amod certified,serum
R2560 T3500 T3501 amod LPS-free,serum
R2561 T3501 T3498 pobj serum,of
R2562 T3502 T3485 punct .,taken
R2563 T3503 T3504 compound Cell,viability
R2564 T3504 T3506 nsubjpass viability,determined
R2565 T3505 T3506 auxpass was,determined
R2566 T3506 T3506 ROOT determined,determined
R2567 T3507 T3506 advcl using,determined
R2568 T3508 T3510 det the,blue
R2569 T3509 T3510 compound trypan,blue
R2570 T3510 T3516 nmod blue,method
R2571 T3511 T3510 punct (,blue
R2572 T3512 T3510 appos Sigma,blue
R2573 T3513 T3510 punct ),blue
R2574 T3514 T3515 compound dye,exclusion
R2575 T3515 T3516 compound exclusion,method
R2576 T3516 T3507 dobj method,using
R2577 T3517 T3506 punct .,determined
R2578 T3518 T3519 det All,cultures
R2579 T3519 T3522 nsubjpass cultures,checked
R2580 T3520 T3522 auxpass were,checked
R2581 T3521 T3522 advmod routinely,checked
R2582 T3522 T3522 ROOT checked,checked
R2583 T3523 T3524 aux to,exclude
R2584 T3524 T3522 xcomp exclude,checked
R2585 T3525 T3526 compound Mycoplasma,infection
R2586 T3526 T3524 dobj infection,exclude
R2587 T3527 T3526 prep by,infection
R2588 T3528 T3529 amod nuclear,staining
R2589 T3529 T3527 pobj staining,by
R2590 T3530 T3524 advcl using,exclude
R2591 T3531 T3532 nsubj Hoechst,stain
R2592 T3532 T3530 xcomp stain,using
R2593 T3533 T3535 nummod 33258,Sigma
R2594 T3534 T3535 punct (,Sigma
R2595 T3535 T3524 npadvmod Sigma,exclude
R2596 T3536 T3535 punct ),Sigma
R2597 T3537 T3535 cc and,Sigma
R2598 T3538 T3541 det the,Kit
R2599 T3539 T3541 compound MycoAlert,Kit
R2600 T3540 T3541 compound Detection,Kit
R2601 T3541 T3535 conj Kit,Sigma
R2602 T3542 T3541 punct (,Kit
R2603 T3543 T3541 appos Lonza,Kit
R2604 T3544 T3541 punct ),Kit
R2605 T3545 T3522 punct .,checked
R2606 T3546 T3547 amod Bacterial,lipopolysaccharide
R2607 T3547 T3558 nsubjpass lipopolysaccharide,obtained
R2608 T3548 T3549 punct (,LPS
R2609 T3549 T3547 appos LPS,lipopolysaccharide
R2610 T3550 T3547 punct ),lipopolysaccharide
R2611 T3551 T3555 punct (,Re595
R2612 T3552 T3555 compound Salmonella,Re595
R2613 T3553 T3555 compound minnesota,Re595
R2614 T3554 T3555 compound Strain,Re595
R2615 T3555 T3547 appos Re595,lipopolysaccharide
R2616 T3556 T3555 punct ),Re595
R2617 T3557 T3558 auxpass was,obtained
R2618 T3558 T3558 ROOT obtained,obtained
R2619 T3559 T3558 prep from,obtained
R2620 T3560 T3559 pobj Sigma,from
R2621 T3561 T3558 punct .,obtained
R2699 T3720 T3722 amod Real-time,PCR
R2700 T3721 T3722 compound Quantitative,PCR
R2701 T3722 T3722 ROOT PCR,PCR
R2702 T3723 T3724 punct (,qPCR
R2703 T3724 T3722 appos qPCR,PCR
R2704 T3725 T3722 punct ),PCR
R2705 T3726 T3729 det The,Kit
R2706 T3727 T3729 compound RNeasy,Kit
R2707 T3728 T3729 compound Mini,Kit
R2708 T3729 T3734 nsubjpass Kit,used
R2709 T3730 T3729 punct (,Kit
R2710 T3731 T3729 appos Qiagen,Kit
R2711 T3732 T3729 punct ),Kit
R2712 T3733 T3734 auxpass was,used
R2713 T3734 T3734 ROOT used,used
R2714 T3735 T3736 aux to,isolate
R2715 T3736 T3734 xcomp isolate,used
R2716 T3737 T3738 amod total,RNA
R2717 T3738 T3736 dobj RNA,isolate
R2718 T3739 T3736 prep from,isolate
R2719 T3740 T3739 pobj cells,from
R2720 T3741 T3734 punct .,used
R2721 T3742 T3751 prep For,was
R2722 T3743 T3744 compound cDNA,synthesis
R2723 T3744 T3742 pobj synthesis,For
R2724 T3745 T3751 punct ",",was
R2725 T3746 T3747 nummod 1,µg
R2726 T3747 T3751 nsubj µg,was
R2727 T3748 T3747 prep of,µg
R2728 T3749 T3750 amod total,RNA
R2729 T3750 T3748 pobj RNA,of
R2730 T3751 T3751 ROOT was,was
R2731 T3752 T3753 advmod reverse,transcribed
R2732 T3753 T3751 conj transcribed,was
R2733 T3754 T3753 advcl using,transcribed
R2734 T3755 T3756 compound TaqMan,®
R2735 T3756 T3757 nsubj ®,Reverse
R2736 T3757 T3754 xcomp Reverse,using
R2737 T3758 T3759 compound Transcription,Reagents
R2738 T3759 T3757 dobj Reagents,Reverse
R2739 T3760 T3762 punct (,Biosystems
R2740 T3761 T3762 compound Applied,Biosystems
R2741 T3762 T3759 appos Biosystems,Reagents
R2742 T3763 T3762 punct ),Biosystems
R2743 T3764 T3757 punct .,Reverse
R2744 T3765 T3767 nsubjpass qPCR,performed
R2745 T3766 T3767 auxpass was,performed
R2746 T3767 T3767 ROOT performed,performed
R2747 T3768 T3767 advcl using,performed
R2748 T3769 T3773 compound TaqMan,20X
R2749 T3770 T3773 compound ®,20X
R2750 T3771 T3773 compound Gene,20X
R2751 T3772 T3773 compound Expression,20X
R2752 T3773 T3774 compound 20X,primers
R2753 T3774 T3768 dobj primers,using
R2754 T3775 T3768 prep for,using
R2755 T3776 T3775 pobj Serpinb2/SerpinB2,for
R2756 T3777 T3778 punct (,Mm00440905_m1
R2757 T3778 T3776 appos Mm00440905_m1,Serpinb2/SerpinB2
R2758 T3779 T3776 punct ),Serpinb2/SerpinB2
R2759 T3780 T3776 punct ",",Serpinb2/SerpinB2
R2760 T3781 T3776 conj Cebpb,Serpinb2/SerpinB2
R2761 T3782 T3783 punct (,Mm00843434_s1
R2762 T3783 T3781 appos Mm00843434_s1,Cebpb
R2763 T3784 T3783 punct ),Mm00843434_s1
R2764 T3785 T3781 cc and,Cebpb
R2765 T3786 T3781 conj β-actin,Cebpb
R2766 T3787 T3786 punct (,β-actin
R2767 T3788 T3786 appos Mm00607939_s1,β-actin
R2768 T3789 T3786 punct ),β-actin
R2769 T3790 T3792 punct (,Biosystems
R2770 T3791 T3792 compound Applied,Biosystems
R2771 T3792 T3786 appos Biosystems,β-actin
R2772 T3793 T3767 punct ),performed
R2773 T3794 T3767 punct .,performed
R2952 T4058 T4060 compound DNA,Analysis
R2953 T4059 T4060 compound Sequence,Analysis
R2954 T4060 T4070 nsubjpass Analysis,determined
R2955 T4061 T4063 det The,sequence
R2956 T4062 T4063 compound DNA,sequence
R2957 T4063 T4060 appos sequence,Analysis
R2958 T4064 T4063 prep of,sequence
R2959 T4065 T4068 det the,promoter
R2960 T4066 T4068 compound murine,promoter
R2961 T4067 T4068 compound SerpinB2,promoter
R2962 T4068 T4064 pobj promoter,of
R2963 T4069 T4070 auxpass was,determined
R2964 T4070 T4070 ROOT determined,determined
R2965 T4071 T4070 prep by,determined
R2966 T4072 T4071 pcomp sequencing,by
R2967 T4073 T4075 det the,plasmids
R2968 T4074 T4075 amod pUC-based,plasmids
R2969 T4075 T4072 dobj plasmids,sequencing
R2970 T4076 T4072 npadvmod pDB9406,sequencing
R2971 T4077 T4076 punct ",",pDB9406
R2972 T4078 T4076 conj pDB9402-41,pDB9406
R2973 T4079 T4078 cc and,pDB9402-41
R2974 T4080 T4078 conj pDB9402-42,pDB9402-41
R2975 T4081 T4072 punct ",",sequencing
R2976 T4082 T4072 prep in,sequencing
R2977 T4083 T4082 pobj addition,in
R2978 T4084 T4083 prep to,addition
R2979 T4085 T4084 pobj plasmids,to
R2980 T4086 T4085 acl prepared,plasmids
R2981 T4087 T4086 prep from,prepared
R2982 T4088 T4087 pobj pDB9402-41,from
R2983 T4089 T4088 cc and,pDB9402-41
R2984 T4090 T4088 conj pDB9402-42,pDB9402-41
R2985 T4091 T4085 prep containing,plasmids
R2986 T4092 T4091 dobj deletions,containing
R2987 T4093 T4092 acl introduced,deletions
R2988 T4094 T4093 agent by,introduced
R2989 T4095 T4097 amod exonuclease,digestion
R2990 T4096 T4097 compound III,digestion
R2991 T4097 T4094 pobj digestion,by
R2992 T4098 T4070 punct .,determined
R2993 T4099 T4100 compound Plasmids,pDB9406
R2994 T4100 T4100 ROOT pDB9406,pDB9406
R2995 T4101 T4100 punct ",",pDB9406
R2996 T4102 T4100 conj pDB9402-41,pDB9406
R2997 T4103 T4102 cc and,pDB9402-41
R2998 T4104 T4102 conj pDB9402-42,pDB9402-41
R2999 T4105 T4108 prep containing,isolated
R3000 T4106 T4107 compound genomic,DNA
R3001 T4107 T4108 nsubj DNA,isolated
R3002 T4108 T4108 ROOT isolated,isolated
R3003 T4109 T4108 prep from,isolated
R3004 T4110 T4111 det a,λFIXII
R3005 T4111 T4116 nmod λFIXII,library
R3006 T4112 T4111 punct (,λFIXII
R3007 T4113 T4111 appos Stratagene,λFIXII
R3008 T4114 T4111 punct ),λFIXII
R3009 T4115 T4116 amod genomic,library
R3010 T4116 T4109 pobj library,from
R3011 T4117 T4108 advcl prepared,isolated
R3012 T4118 T4117 prep from,prepared
R3013 T4119 T4122 det a,strain
R3014 T4120 T4122 nummod 129,strain
R3015 T4121 T4122 compound mouse,strain
R3016 T4122 T4118 pobj strain,from
R3017 T4123 T4108 punct ",",isolated
R3018 T4124 T4126 auxpass were,provided
R3019 T4125 T4126 advmod kindly,provided
R3020 T4126 T4108 advcl provided,isolated
R3021 T4127 T4126 agent by,provided
R3022 T4128 T4130 compound Dr.,Belin
R3023 T4129 T4130 compound Dominique,Belin
R3024 T4130 T4127 pobj Belin,by
R3025 T4131 T4130 punct ",",Belin
R3026 T4132 T4130 conj University,Belin
R3027 T4133 T4132 prep of,University
R3028 T4134 T4133 pobj Geneva,of
R3029 T4135 T4108 punct .,isolated
R3030 T4136 T4137 nsubj pDB9406,contains
R3031 T4137 T4153 ccomp contains,contain
R3032 T4138 T4143 det a,fragment
R3033 T4139 T4140 nummod 4.4,kb
R3034 T4140 T4143 nmod kb,fragment
R3035 T4141 T4143 nmod EcoRI/SpeI,fragment
R3036 T4142 T4143 compound genomic,fragment
R3037 T4143 T4137 dobj fragment,contains
R3038 T4144 T4143 acl spanning,fragment
R3039 T4145 T4148 det the,site
R3040 T4146 T4147 compound transcription,initiation
R3041 T4147 T4148 compound initiation,site
R3042 T4148 T4144 dobj site,spanning
R3043 T4149 T4153 punct ;,contain
R3044 T4150 T4153 nsubj pDB9402-41,contain
R3045 T4151 T4150 cc and,pDB9402-41
R3046 T4152 T4150 conj pDB9402-42,pDB9402-41
R3047 T4153 T4153 ROOT contain,contain
R3048 T4154 T4159 det a,fragment
R3049 T4155 T4156 nummod 1.2,kb
R3050 T4156 T4159 nmod kb,fragment
R3051 T4157 T4159 nmod EcoRI,fragment
R3052 T4158 T4159 compound genomic,fragment
R3053 T4159 T4153 dobj fragment,contain
R3054 T4160 T4159 punct ",",fragment
R3055 T4161 T4159 acl located,fragment
R3056 T4162 T4163 advmod immediately,upstream
R3057 T4163 T4161 advmod upstream,located
R3058 T4164 T4163 prep of,upstream
R3059 T4165 T4168 det the,fragment
R3060 T4166 T4167 compound pDB9406,EcoRI
R3061 T4167 T4168 compound EcoRI,fragment
R3062 T4168 T4164 pobj fragment,of
R3063 T4169 T4161 punct ",",located
R3064 T4170 T4159 acl cloned,fragment
R3065 T4171 T4170 prep in,cloned
R3066 T4172 T4173 amod opposite,orientations
R3067 T4173 T4171 pobj orientations,in
R3068 T4174 T4153 punct .,contain
R3069 T4175 T4176 amod Subcloned,inserts
R3070 T4176 T4178 nsubjpass inserts,verified
R3071 T4177 T4178 auxpass were,verified
R3072 T4178 T4178 ROOT verified,verified
R3073 T4179 T4178 agent by,verified
R3074 T4180 T4181 compound restriction,enzyme
R3075 T4181 T4182 compound enzyme,digestion
R3076 T4182 T4179 pobj digestion,by
R3077 T4183 T4182 cc and,digestion
R3078 T4184 T4185 compound DNA,sequencing
R3079 T4185 T4182 conj sequencing,digestion
R3080 T4186 T4178 punct .,verified
R3081 T4187 T4189 det The,sequence
R3082 T4188 T4189 compound nucleotide,sequence
R3083 T4189 T4202 nsubjpass sequence,determined
R3084 T4190 T4189 prep of,sequence
R3085 T4191 T4196 det the,gene
R3086 T4192 T4196 nummod 4480,gene
R3087 T4193 T4196 nmod bp,gene
R3088 T4194 T4196 compound murine,gene
R3089 T4195 T4196 compound SerpinB2,gene
R3090 T4196 T4200 nmod gene,region
R3091 T4197 T4198 nummod 5,′
R3092 T4198 T4200 amod ′,region
R3093 T4199 T4200 amod flanking,region
R3094 T4200 T4190 pobj region,of
R3095 T4201 T4202 auxpass was,determined
R3096 T4202 T4202 ROOT determined,determined
R3097 T4203 T4202 advcl using,determined
R3098 T4204 T4209 det the,cycle
R3099 T4205 T4209 compound ABI,cycle
R3100 T4206 T4209 compound PRISM,cycle
R3101 T4207 T4208 compound dye,terminator
R3102 T4208 T4209 compound terminator,cycle
R3103 T4209 T4203 dobj cycle,using
R3104 T4210 T4203 conj sequencing,using
R3105 T4211 T4213 amod ready,kit
R3106 T4212 T4213 compound reaction,kit
R3107 T4213 T4210 dobj kit,sequencing
R3108 T4214 T4213 punct (,kit
R3109 T4215 T4210 conj Perkin-Elmer,sequencing
R3110 T4216 T4215 punct ),Perkin-Elmer
R3111 T4217 T4210 cc and,sequencing
R3112 T4218 T4221 det a,sequencer
R3113 T4219 T4221 compound PE,sequencer
R3114 T4220 T4221 compound 373A,sequencer
R3115 T4221 T4210 conj sequencer,sequencing
R3116 T4222 T4221 punct (,sequencer
R3117 T4223 T4221 appos Perkin-Elmer,sequencer
R3118 T4224 T4221 punct ),sequencer
R3119 T4225 T4202 punct .,determined
R3120 T4226 T4227 det This,sequence
R3121 T4227 T4229 nsubjpass sequence,deposited
R3122 T4228 T4229 auxpass was,deposited
R3123 T4229 T4229 ROOT deposited,deposited
R3124 T4230 T4229 prep in,deposited
R3125 T4231 T4233 compound GenBank/EMBL/DDBJ,Bank
R3126 T4232 T4233 compound Data,Bank
R3127 T4233 T4230 pobj Bank,in
R3128 T4234 T4229 prep with,deposited
R3129 T4235 T4236 compound Accession,No
R3130 T4236 T4234 pobj No,with
R3131 T4237 T4229 punct .,deposited
R3132 T4238 T4238 ROOT AF339731,AF339731
R3133 T4239 T4238 punct .,AF339731
R3322 T4532 T4528 appos deoxycholate,NP-40
R3323 T4533 T4532 punct ",",deoxycholate
R3324 T4534 T4535 nummod 0.1,%
R3325 T4535 T4536 compound %,SDS
R3326 T4536 T4532 appos SDS,deoxycholate
R3327 T4537 T4536 punct ),SDS
R3328 T4538 T4541 punct ",",separated
R3329 T4539 T4541 nsubjpass proteins,separated
R3330 T4540 T4541 auxpass were,separated
R3331 T4541 T4541 ROOT separated,separated
R3332 T4542 T4541 prep on,separated
R3333 T4543 T4542 pobj 4,on
R3334 T4544 T4545 nummod 12,%
R3335 T4545 T4548 compound %,gels
R3336 T4546 T4547 compound Bis-Tris,NuPAGE
R3337 T4547 T4548 compound NuPAGE,gels
R3338 T4548 T4541 appos gels,separated
R3339 T4549 T4550 punct (,Invitrogen
R3340 T4550 T4548 appos Invitrogen,gels
R3341 T4551 T4548 punct ),gels
R3342 T4552 T4541 punct ",",separated
R3343 T4553 T4541 cc and,separated
R3344 T4554 T4541 conj transferred,separated
R3345 T4555 T4554 prep to,transferred
R3346 T4556 T4557 compound PVDF,membranes
R3347 T4557 T4555 pobj membranes,to
R3348 T4558 T4541 punct .,separated
R3349 T4559 T4562 nsubjpass Membranes,blocked
R3350 T4560 T4562 auxpass were,blocked
R3351 T4561 T4562 advmod subsequently,blocked
R3352 T4562 T4562 ROOT blocked,blocked
R3353 T4563 T4562 prep with,blocked
R3354 T4564 T4565 nummod 5,%
R3355 T4565 T4566 compound %,milk
R3356 T4566 T4563 pobj milk,with
R3357 T4567 T4566 prep in,milk
R3358 T4568 T4567 pobj PBS-T,in
R3359 T4569 T4568 punct (,PBS-T
R3360 T4570 T4571 compound 1X,PBS
R3361 T4571 T4568 appos PBS,PBS-T
R3362 T4572 T4568 punct ",",PBS-T
R3363 T4573 T4574 nummod 0.1,%
R3364 T4574 T4575 compound %,Tween-20
R3365 T4575 T4568 appos Tween-20,PBS-T
R3366 T4576 T4568 punct ),PBS-T
R3367 T4577 T4562 punct ",",blocked
R3368 T4578 T4562 cc and,blocked
R3369 T4579 T4562 conj incubated,blocked
R3370 T4580 T4579 prep with,incubated
R3371 T4581 T4582 amod primary,antibodies
R3372 T4582 T4580 pobj antibodies,with
R3373 T4583 T4579 advmod overnight,incubated
R3374 T4584 T4562 punct .,blocked
R3375 T4585 T4586 nsubj Affinity,purified
R3376 T4586 T4586 ROOT purified,purified
R3377 T4587 T4590 compound rabbit,antibodies
R3378 T4588 T4589 compound anti-mouse,SerpinB2
R3379 T4589 T4590 compound SerpinB2,antibodies
R3380 T4590 T4592 nsubjpass antibodies,prepared
R3381 T4591 T4592 auxpass were,prepared
R3382 T4592 T4586 ccomp prepared,purified
R3383 T4593 T4592 prep after,prepared
R3384 T4594 T4593 pobj immunization,after
R3385 T4595 T4594 prep with,immunization
R3386 T4596 T4602 det a,protein
R3387 T4597 T4602 amod purified,protein
R3388 T4598 T4602 amod recombinant,protein
R3389 T4599 T4600 compound GST-murine,SerpinB2
R3390 T4600 T4602 compound SerpinB2,protein
R3391 T4601 T4602 compound fusion,protein
R3392 T4602 T4595 pobj protein,with
R3393 T4603 T4602 acl produced,protein
R3394 T4604 T4603 prep in,produced
R3395 T4605 T4606 compound E.,coli
R3396 T4606 T4604 pobj coli,in
R3397 T4607 T4603 prep as,produced
R3398 T4608 T4607 prep in,as
R3399 T4609 T4611 nmod [,]
R3400 T4610 T4611 nummod 35,]
R3401 T4611 T4608 pobj ],in
R3402 T4612 T4586 punct .,purified
R3403 T4613 T4614 amod Other,antibodies
R3404 T4614 T4620 nsubj antibodies,include
R3405 T4615 T4614 acl used,antibodies
R3406 T4616 T4615 prep for,used
R3407 T4617 T4619 amod western,assays
R3408 T4618 T4619 compound blot,assays
R3409 T4619 T4616 pobj assays,for
R3410 T4620 T4620 ROOT include,include
R3411 T4621 T4620 punct :,include
R3412 T4622 T4624 punct C/EBP,β
R3413 T4623 T4624 punct -,β
R3414 T4624 T4620 dobj β,include
R3415 T4625 T4624 punct (,β
R3416 T4626 T4624 appos sc-150,β
R3417 T4627 T4624 punct ),β
R3418 T4628 T4631 punct (,Biotechnologies
R3419 T4629 T4631 compound Santa,Biotechnologies
R3420 T4630 T4631 compound Cruz,Biotechnologies
R3421 T4631 T4624 parataxis Biotechnologies,β
R3422 T4632 T4631 punct ),Biotechnologies
R3423 T4633 T4631 punct ",",Biotechnologies
R3424 T4634 T4635 amod glyceraldehyde-3-phosphate,dehydrogenase
R3425 T4635 T4631 appos dehydrogenase,Biotechnologies
R3426 T4636 T4637 punct (,GAPDH
R3427 T4637 T4635 appos GAPDH,dehydrogenase
R3428 T4638 T4637 punct ),GAPDH
R3429 T4639 T4635 cc and,dehydrogenase
R3430 T4640 T4643 amod α,tubulin
R3431 T4641 T4643 compound /,tubulin
R3432 T4642 T4643 compound β,tubulin
R3433 T4643 T4635 conj tubulin,dehydrogenase
R3434 T4644 T4649 punct (,Inc.
R3435 T4645 T4649 nmod Cell,Inc.
R3436 T4646 T4649 nmod Signaling,Inc.
R3437 T4647 T4646 pobj Technology,Signaling
R3438 T4648 T4649 punct ",",Inc.
R3439 T4649 T4643 parataxis Inc.,tubulin
R3440 T4650 T4649 punct ),Inc.
R3441 T4651 T4620 punct .,include
R3844 T5483 T5483 ROOT Construction,Construction
R3845 T5484 T5483 prep of,Construction
R3846 T5485 T5486 compound SerpinB2,Reporter
R3847 T5486 T5488 compound Reporter,Plasmids
R3848 T5487 T5488 compound Gene,Plasmids
R3849 T5488 T5484 pobj Plasmids,of
R3850 T5489 T5490 det The,PCR
R3851 T5490 T5491 nsubj PCR,primers
R3852 T5491 T5491 ROOT primers,primers
R3853 T5492 T5493 poss DW5,LUC
R3854 T5493 T5491 dobj LUC,primers
R3855 T5494 T5491 punct ",",primers
R3856 T5495 T5491 advcl containing,primers
R3857 T5496 T5497 det a,Kpn
R3858 T5497 T5500 compound Kpn,site
R3859 T5498 T5500 compound I,site
R3860 T5499 T5500 compound restriction,site
R3861 T5500 T5495 dobj site,containing
R3862 T5501 T5491 punct ",",primers
R3863 T5502 T5491 cc and,primers
R3864 T5503 T5504 poss DW3,LUC
R3865 T5504 T5514 nsubj LUC,used
R3866 T5505 T5514 punct ",",used
R3867 T5506 T5514 advcl containing,used
R3868 T5507 T5508 det an,Xho
R3869 T5508 T5511 compound Xho,site
R3870 T5509 T5511 compound I,site
R3871 T5510 T5511 compound restriction,site
R3872 T5511 T5506 dobj site,containing
R3873 T5512 T5514 punct ",",used
R3874 T5513 T5514 auxpass were,used
R3875 T5514 T5491 conj used,primers
R3876 T5515 T5517 aux to,amplify
R3877 T5516 T5517 nsubj PCR,amplify
R3878 T5517 T5514 xcomp amplify,used
R3879 T5518 T5517 cc and,amplify
R3880 T5519 T5517 conj clone,amplify
R3881 T5520 T5522 det the,promoter
R3882 T5521 T5522 compound SerpinB2,promoter
R3883 T5522 T5519 dobj promoter,clone
R3884 T5523 T5522 punct (,promoter
R3885 T5524 T5522 appos −,promoter
R3886 T5525 T5522 appos 3261,promoter
R3887 T5526 T5525 prep to,3261
R3888 T5527 T5526 pobj +92,to
R3889 T5528 T5525 punct ),3261
R3890 T5529 T5519 prep from,clone
R3891 T5530 T5529 pobj pDB9406,from
R3892 T5531 T5519 prep into,clone
R3893 T5532 T5534 det the,I/Xho
R3894 T5533 T5534 compound Kpn,I/Xho
R3895 T5534 T5531 pobj I/Xho,into
R3896 T5535 T5536 nsubj I,polylinker
R3897 T5536 T5514 conj polylinker,used
R3898 T5537 T5538 compound restriction,sites
R3899 T5538 T5536 dobj sites,polylinker
R3900 T5539 T5538 prep of,sites
R3901 T5540 T5541 compound pGL3,Basic
R3902 T5541 T5539 pobj Basic,of
R3903 T5542 T5541 punct (,Basic
R3904 T5543 T5541 appos Promega,Basic
R3905 T5544 T5541 punct ),Basic
R3906 T5545 T5546 aux to,produce
R3907 T5546 T5536 advcl produce,polylinker
R3908 T5547 T5546 dobj pGLmP-3261,produce
R3909 T5548 T5536 punct .,polylinker
R3910 T5549 T5550 det The,EcoR
R3911 T5550 T5555 nsubj EcoR,was
R3912 T5551 T5552 nsubj I,insert
R3913 T5552 T5550 relcl insert,EcoR
R3914 T5553 T5552 prep of,insert
R3915 T5554 T5553 pobj pDB9402-42,of
R3916 T5555 T5555 ROOT was,was
R3917 T5556 T5555 acomp sub-cloned,was
R3918 T5557 T5558 advmod immediately,upstream
R3919 T5558 T5555 prep upstream,was
R3920 T5559 T5558 prep of,upstream
R3921 T5560 T5562 det the,promoter
R3922 T5561 T5562 compound SerpinB2,promoter
R3923 T5562 T5565 compound promoter,site
R3924 T5563 T5565 compound EcoR,site
R3925 T5564 T5565 compound I,site
R3926 T5565 T5559 pobj site,of
R3927 T5566 T5567 punct (,−
R3928 T5567 T5568 nmod −,3261
R3929 T5568 T5565 appos 3261,site
R3930 T5569 T5565 punct ),site
R3931 T5570 T5565 prep of,site
R3932 T5571 T5570 pobj pGLmP-3261,of
R3933 T5572 T5573 aux to,produce
R3934 T5573 T5555 advcl produce,was
R3935 T5574 T5573 dobj pGLmP-4480,produce
R3936 T5575 T5555 punct .,was
R3937 T5576 T5581 amod Additional,constructs
R3938 T5577 T5580 amod murine,reporter
R3939 T5578 T5580 compound SerpinB2,reporter
R3940 T5579 T5580 compound luciferase,reporter
R3941 T5580 T5581 compound reporter,constructs
R3942 T5581 T5598 nsubjpass constructs,generated
R3943 T5582 T5581 punct (,constructs
R3944 T5583 T5581 appos pGLmP-2751,constructs
R3945 T5584 T5583 punct ",",pGLmP-2751
R3946 T5585 T5583 conj pGLmP-2614,pGLmP-2751
R3947 T5586 T5585 punct ",",pGLmP-2614
R3948 T5587 T5585 conj pGLmP-1686,pGLmP-2614
R3949 T5588 T5587 punct ",",pGLmP-1686
R3950 T5589 T5587 conj pGLmP-1341,pGLmP-1686
R3951 T5590 T5589 punct ",",pGLmP-1341
R3952 T5591 T5589 conj pGLmP-694,pGLmP-1341
R3953 T5592 T5591 punct ",",pGLmP-694
R3954 T5593 T5591 conj pGLmP-539,pGLmP-694
R3955 T5594 T5593 cc and,pGLmP-539
R3956 T5595 T5593 conj pGLmP-189,pGLmP-539
R3957 T5596 T5581 punct ),constructs
R3958 T5597 T5598 auxpass were,generated
R3959 T5598 T5598 ROOT generated,generated
R3960 T5599 T5598 prep by,generated
R3961 T5600 T5599 pcomp digesting,by
R3962 T5601 T5600 dobj pGLmP-3261,digesting
R3963 T5602 T5600 prep with,digesting
R3964 T5603 T5602 pobj EcoR,with
R3965 T5604 T5614 dep I,Apa
R3966 T5605 T5604 cc and,I
R3967 T5606 T5609 det a,enzyme
R3968 T5607 T5608 amod second,restriction
R3969 T5608 T5609 compound restriction,enzyme
R3970 T5609 T5604 conj enzyme,I
R3971 T5610 T5609 punct (,enzyme
R3972 T5611 T5609 parataxis Sfi,enzyme
R3973 T5612 T5614 nsubj I,Apa
R3974 T5613 T5614 punct ",",Apa
R3975 T5614 T5614 ROOT Apa,Apa
R3976 T5615 T5617 nsubj I,BstX
R3977 T5616 T5615 punct ",",I
R3978 T5617 T5617 ROOT BstX,BstX
R3979 T5618 T5620 nsubj I,Bsu36
R3980 T5619 T5618 punct ",",I
R3981 T5620 T5620 ROOT Bsu36,Bsu36
R3982 T5621 T5623 nsubj I,Pac
R3983 T5622 T5621 punct ",",I
R3984 T5623 T5623 ROOT Pac,Pac
R3985 T5624 T5624 ROOT I,I
R3986 T5625 T5624 punct ",",I
R3987 T5626 T5627 compound Hae,III
R3988 T5627 T5624 appos III,I
R3989 T5628 T5627 cc and,III
R3990 T5629 T5627 conj Apo,III
R3991 T5630 T5624 appos I,I
R3992 T5631 T5624 appos respectively,I
R3993 T5632 T5624 punct ),I
R3994 T5633 T5652 punct ",",re-ligating
R3995 T5634 T5652 dep blunt,re-ligating
R3996 T5635 T5634 acl ending,blunt
R3997 T5636 T5639 det the,′
R3998 T5637 T5639 amod resultant,′
R3999 T5638 T5639 nummod 5,′
R4000 T5639 T5635 dobj ′,ending
R4001 T5640 T5639 cc or,′
R4002 T5641 T5642 nummod 3,′
R4003 T5642 T5643 compound ′,overhangs
R4004 T5643 T5639 conj overhangs,′
R4005 T5644 T5643 prep with,overhangs
R4006 T5645 T5647 amod T4,polymerase
R4007 T5646 T5647 compound DNA,polymerase
R4008 T5647 T5644 pobj polymerase,with
R4009 T5648 T5647 punct (,polymerase
R4010 T5649 T5647 appos NEB,polymerase
R4011 T5650 T5647 punct ),polymerase
R4012 T5651 T5643 cc and,overhangs
R4013 T5652 T5652 ROOT re-ligating,re-ligating
R4014 T5653 T5654 det the,vector
R4015 T5654 T5652 dobj vector,re-ligating
R4016 T5655 T5652 dep ends,re-ligating
R4017 T5656 T5655 prep with,ends
R4018 T5657 T5659 amod T4,ligase
R4019 T5658 T5659 compound DNA,ligase
R4020 T5659 T5656 pobj ligase,with
R4021 T5660 T5652 punct .,re-ligating
R4022 T5661 T5663 det The,primers
R4023 T5662 T5663 compound PCR,primers
R4024 T5663 T5669 nsubjpass primers,used
R4025 T5664 T5663 appos BSPCR2,primers
R4026 T5665 T5664 cc and,BSPCR2
R4027 T5666 T5667 poss DW3,LUC
R4028 T5667 T5664 conj LUC,BSPCR2
R4029 T5668 T5669 auxpass were,used
R4030 T5669 T5669 ROOT used,used
R4031 T5670 T5671 aux to,subclone
R4032 T5671 T5669 xcomp subclone,used
R4033 T5672 T5676 det the,regions
R4034 T5673 T5676 amod murine,regions
R4035 T5674 T5675 compound SerpinB2,promoter
R4036 T5675 T5676 compound promoter,regions
R4037 T5676 T5671 dobj regions,subclone
R4038 T5677 T5671 conj −,subclone
R4039 T5678 T5680 quantmod 87,+92
R4040 T5679 T5680 quantmod to,+92
R4041 T5680 T5677 dobj +92,−
R4042 T5681 T5677 prep into,−
R4043 T5682 T5684 det the,I/Xho
R4044 T5683 T5684 compound Kpn,I/Xho
R4045 T5684 T5681 pobj I/Xho,into
R4046 T5685 T5686 nsubj I,polylinker
R4047 T5686 T5669 conj polylinker,used
R4048 T5687 T5688 compound restriction,sites
R4049 T5688 T5686 dobj sites,polylinker
R4050 T5689 T5688 prep of,sites
R4051 T5690 T5691 amod pGL3,Basic
R4052 T5691 T5689 pobj Basic,of
R4053 T5692 T5693 aux to,produce
R4054 T5693 T5686 advcl produce,polylinker
R4055 T5694 T5693 dobj pGLmP-87,produce
R4056 T5695 T5686 punct .,polylinker
R4057 T5696 T5699 det The,vector
R4058 T5697 T5699 nmod control,vector
R4059 T5698 T5699 amod empty,vector
R4060 T5699 T5700 nsubj vector,was
R4061 T5700 T5700 ROOT was,was
R4062 T5701 T5702 amod pGL3,Basic
R4063 T5702 T5700 attr Basic,was
R4064 T5703 T5704 punct (,Promega
R4065 T5704 T5702 appos Promega,Basic
R4066 T5705 T5704 punct ),Promega
R4067 T5706 T5700 punct .,was
R4068 T5707 T5708 compound Luciferase,reporter
R4069 T5708 T5709 nsubj reporter,constructs
R4070 T5709 T5709 ROOT constructs,constructs
R4071 T5710 T5710 ROOT containing,containing
R4072 T5711 T5710 dobj mutations,containing
R4073 T5712 T5711 prep in,mutations
R4074 T5713 T5715 det the,promoter
R4075 T5714 T5715 compound SerpinB2,promoter
R4076 T5715 T5719 compound promoter,box
R4077 T5716 T5717 amod LPS-responsive,regions
R4078 T5717 T5719 compound regions,box
R4079 T5718 T5719 compound E,box
R4080 T5719 T5712 pobj box,in
R4081 T5720 T5710 punct ",",containing
R4082 T5721 T5722 compound PU,.1
R4083 T5722 T5724 nummod .1,Oct-1
R4084 T5723 T5722 punct ",",.1
R4085 T5724 T5710 appos Oct-1,containing
R4086 T5725 T5724 cc and,Oct-1
R4087 T5726 T5724 conj C/EBP,Oct-1
R4088 T5727 T5728 punct (,pGLmP-539mEbox
R4089 T5728 T5726 appos pGLmP-539mEbox,C/EBP
R4090 T5729 T5728 punct ",",pGLmP-539mEbox
R4091 T5730 T5726 conj pGLmP-539mPU,C/EBP
R4092 T5731 T5730 nummod .1,pGLmP-539mPU
R4093 T5732 T5730 punct ",",pGLmP-539mPU
R4094 T5733 T5730 conj pGLmP-539mOct,pGLmP-539mPU
R4095 T5734 T5733 cc and,pGLmP-539mOct
R4096 T5735 T5733 conj pGLmP-539mC,pGLmP-539mOct
R4097 T5736 T5737 compound /,EBP
R4098 T5737 T5741 nsubjpass EBP,generated
R4099 T5738 T5737 advmod respectively,EBP
R4100 T5739 T5741 punct ),generated
R4101 T5740 T5741 auxpass were,generated
R4102 T5741 T5709 ccomp generated,constructs
R4103 T5742 T5743 mark as,described
R4104 T5743 T5741 advcl described,generated
R4105 T5744 T5746 nmod [,]
R4106 T5745 T5746 nummod 36,]
R4107 T5746 T5743 dobj ],described
R4108 T5747 T5709 punct .,constructs
R4109 T5748 T5753 det The,sequences
R4110 T5749 T5753 amod mutant,sequences
R4111 T5750 T5753 compound oligonucleotide,sequences
R4112 T5751 T5752 compound PCR,primer
R4113 T5752 T5753 compound primer,sequences
R4114 T5753 T5755 nsubjpass sequences,provided
R4115 T5754 T5755 auxpass are,provided
R4116 T5755 T5755 ROOT provided,provided
R4117 T5756 T5755 prep in,provided
R4118 T5757 T5756 pobj Fig,in
R4119 T5758 T5755 punct .,provided
R4120 T5759 T5763 nsubjpass S1,used
R4121 T5760 T5759 punct ",",S1
R4122 T5761 T5759 cc and,S1
R4123 T5762 T5763 auxpass were,used
R4124 T5763 T5763 ROOT used,used
R4125 T5764 T5765 mark as,follows
R4126 T5765 T5763 advcl follows,used
R4127 T5766 T5767 punct :,pGLmP-539mEbox
R4128 T5767 T5767 ROOT pGLmP-539mEbox,pGLmP-539mEbox
R4129 T5768 T5767 punct :,pGLmP-539mEbox
R4130 T5769 T5767 appos mPAI2mEboxa,pGLmP-539mEbox
R4131 T5770 T5769 cc and,mPAI2mEboxa
R4132 T5771 T5769 conj mPAI2mEboxb,mPAI2mEboxa
R4133 T5772 T5767 punct ;,pGLmP-539mEbox
R4134 T5773 T5767 conj pGLmP-539mPU,pGLmP-539mEbox
R4135 T5774 T5773 nummod .1,pGLmP-539mPU
R4136 T5775 T5777 punct :,.1
R4137 T5776 T5777 compound mPAI2mPU,.1
R4138 T5777 T5767 appos .1,pGLmP-539mEbox
R4139 T5778 T5782 det a,b
R4140 T5779 T5778 cc and,a
R4141 T5780 T5782 nmod mPAI2mPU,b
R4142 T5781 T5782 nummod .1,b
R4143 T5782 T5777 appos b,.1
R4144 T5783 T5784 punct ;,pGLmP-539mOct
R4145 T5784 T5767 appos pGLmP-539mOct,pGLmP-539mEbox
R4146 T5785 T5784 punct :,pGLmP-539mOct
R4147 T5786 T5784 appos mPAI2mOct-2a,pGLmP-539mOct
R4148 T5787 T5786 cc and,mPAI2mOct-2a
R4149 T5788 T5786 conj mPAI2mOct-2b,mPAI2mOct-2a
R4150 T5789 T5792 punct ;,EBP
R4151 T5790 T5792 compound pGLmP-539mC,EBP
R4152 T5791 T5792 compound /,EBP
R4153 T5792 T5784 conj EBP,pGLmP-539mOct
R4154 T5793 T5792 punct :,EBP
R4155 T5794 T5792 appos mPAI2mCEBPa,EBP
R4156 T5795 T5794 cc and,mPAI2mCEBPa
R4157 T5796 T5794 conj mPAI2mCEBPb,mPAI2mCEBPa
R4158 T5797 T5792 punct .,EBP
R4159 T5798 T5801 det The,primers
R4160 T5799 T5801 compound oligonucleotide,primers
R4161 T5800 T5801 compound PCR,primers
R4162 T5801 T5802 nsubj primers,used
R4163 T5802 T5802 ROOT used,used
R4164 T5803 T5804 aux to,generate
R4165 T5804 T5802 xcomp generate,used
R4166 T5805 T5804 dobj mutants,generate
R4167 T5806 T5805 punct ",",mutants
R4168 T5807 T5805 appos pGLmP-539mCRE,mutants
R4169 T5808 T5807 punct ",",pGLmP-539mCRE
R4170 T5809 T5807 conj pGLmP-539mAP-1a,pGLmP-539mCRE
R4171 T5810 T5809 punct ",",pGLmP-539mAP-1a
R4172 T5811 T5809 cc and,pGLmP-539mAP-1a
R4173 T5812 T5809 conj pGLmP-539mAP-1b,pGLmP-539mAP-1a
R4174 T5813 T5814 auxpass were,reported
R4175 T5814 T5802 conj reported,used
R4176 T5815 T5814 advmod previously,reported
R4177 T5816 T5818 nmod [,]
R4178 T5817 T5818 nummod 37,]
R4179 T5818 T5814 dobj ],reported
R4180 T5819 T5802 punct .,used
R4181 T5820 T5824 det The,primers
R4182 T5821 T5824 amod flanking,primers
R4183 T5822 T5823 compound oligonucleotide,PCR
R4184 T5823 T5824 compound PCR,primers
R4185 T5824 T5825 nsubj primers,were
R4186 T5825 T5825 ROOT were,were
R4187 T5826 T5825 acomp RVprimer3,were
R4188 T5827 T5828 punct (,Promega
R4189 T5828 T5826 appos Promega,RVprimer3
R4190 T5829 T5828 punct ),Promega
R4191 T5830 T5826 cc and,RVprimer3
R4192 T5831 T5826 conj GLprimer2,RVprimer3
R4193 T5832 T5831 punct (,GLprimer2
R4194 T5833 T5831 appos Promega,GLprimer2
R4195 T5834 T5831 punct ),GLprimer2
R4196 T5835 T5825 punct .,were
R4197 T5836 T5838 nsubjpass pGLmP-539,used
R4198 T5837 T5838 auxpass was,used
R4199 T5838 T5838 ROOT used,used
R4200 T5839 T5838 prep as,used
R4201 T5840 T5841 det the,template
R4202 T5841 T5839 pobj template,as
R4203 T5842 T5838 prep in,used
R4204 T5843 T5844 det each,case
R4205 T5844 T5842 pobj case,in
R4206 T5845 T5838 punct .,used
R4207 T5846 T5848 amod Recombinant,products
R4208 T5847 T5848 compound PCR,products
R4209 T5848 T5850 nsubjpass products,digested
R4210 T5849 T5850 auxpass were,digested
R4211 T5850 T5850 ROOT digested,digested
R4212 T5851 T5850 prep with,digested
R4213 T5852 T5851 pobj EcoR,with
R4214 T5853 T5850 advcl I,digested
R4215 T5854 T5853 cc and,I
R4216 T5855 T5853 conj Xho,I
R4217 T5856 T5853 conj I,I
R4218 T5857 T5856 cc and,I
R4219 T5858 T5856 conj cloned,I
R4220 T5859 T5858 prep between,cloned
R4221 T5860 T5861 det the,EcoR
R4222 T5861 T5859 pobj EcoR,between
R4223 T5862 T5861 nummod I,EcoR
R4224 T5863 T5862 cc and,I
R4225 T5864 T5862 conj Xho,I
R4226 T5865 T5866 nsubj I,restriction
R4227 T5866 T5862 conj restriction,I
R4228 T5867 T5866 dobj sites,restriction
R4229 T5868 T5867 prep of,sites
R4230 T5869 T5868 pobj pGLmP-539,of
R4231 T5870 T5866 prep in,restriction
R4232 T5871 T5870 pobj place,in
R4233 T5872 T5871 prep of,place
R4234 T5873 T5878 det the,region
R4235 T5874 T5878 nmod −,region
R4236 T5875 T5874 nummod 539,−
R4237 T5876 T5878 amod /,region
R4238 T5877 T5878 nummod +92,region
R4239 T5878 T5872 pobj region,of
R4240 T5879 T5878 prep of,region
R4241 T5880 T5884 det the,promoter
R4242 T5881 T5884 amod wild-type,promoter
R4243 T5882 T5883 compound murine,SerpinB2
R4244 T5883 T5884 compound SerpinB2,promoter
R4245 T5884 T5879 pobj promoter,of
R4246 T5885 T5866 punct .,restriction
R4247 T5886 T5887 nsubj Sequence,verified
R4248 T5887 T5887 ROOT verified,verified
R4249 T5888 T5890 nsubjpass constructs,used
R4250 T5889 T5890 auxpass were,used
R4251 T5890 T5887 ccomp used,verified
R4252 T5891 T5890 prep in,used
R4253 T5892 T5893 det the,experiments
R4254 T5893 T5891 pobj experiments,in
R4255 T5894 T5887 punct .,verified
R4506 T6368 T6369 compound Transient,Transfection
R4507 T6369 T6386 nsubj Transfection,growing
R4508 T6370 T6369 cc and,Transfection
R4509 T6371 T6372 compound Luciferase,Assays
R4510 T6372 T6369 conj Assays,Transfection
R4511 T6373 T6376 punct (,Macrophages
R4512 T6374 T6376 nmod RAW264,Macrophages
R4513 T6375 T6376 nummod .7,Macrophages
R4514 T6376 T6372 appos Macrophages,Assays
R4515 T6377 T6376 punct ),Macrophages
R4516 T6378 T6372 conj RAW,Assays
R4517 T6379 T6378 nummod 264.7,RAW
R4518 T6380 T6369 appos cells,Transfection
R4519 T6381 T6380 punct (,cells
R4520 T6382 T6384 nummod 2,107
R4521 T6383 T6384 nummod ×,107
R4522 T6384 T6380 appos 107,cells
R4523 T6385 T6380 punct ),cells
R4524 T6386 T6386 ROOT growing,growing
R4525 T6387 T6386 prep in,growing
R4526 T6388 T6389 compound log,phase
R4527 T6389 T6387 pobj phase,in
R4528 T6390 T6391 auxpass were,transfected
R4529 T6391 T6386 conj transfected,growing
R4530 T6392 T6391 prep with,transfected
R4531 T6393 T6397 det the,plasmid
R4532 T6394 T6397 amod indicated,plasmid
R4533 T6395 T6397 compound luciferase,plasmid
R4534 T6396 T6397 compound reporter,plasmid
R4535 T6397 T6392 pobj plasmid,with
R4536 T6398 T6397 punct (,plasmid
R4537 T6399 T6400 nummod 20,µg
R4538 T6400 T6397 appos µg,plasmid
R4539 T6401 T6397 punct ),plasmid
R4540 T6402 T6391 prep along,transfected
R4541 T6403 T6402 prep with,along
R4542 T6404 T6406 det the,kinase
R4543 T6405 T6406 amod pRL-thymidine,kinase
R4544 T6406 T6403 pobj kinase,with
R4545 T6407 T6406 punct (,kinase
R4546 T6408 T6406 appos TK,kinase
R4547 T6409 T6406 punct ),kinase
R4548 T6410 T6411 punct (,Promega
R4549 T6411 T6406 appos Promega,kinase
R4550 T6412 T6411 punct ),Promega
R4551 T6413 T6414 amod internal,control
R4552 T6414 T6416 compound control,plasmid
R4553 T6415 T6416 compound reporter,plasmid
R4554 T6416 T6406 appos plasmid,kinase
R4555 T6417 T6419 punct (,µg
R4556 T6418 T6419 nummod 2,µg
R4557 T6419 T6416 appos µg,plasmid
R4558 T6420 T6406 punct ),kinase
R4559 T6421 T6391 agent by,transfected
R4560 T6422 T6421 pobj electroporation,by
R4561 T6423 T6391 advcl using,transfected
R4562 T6424 T6427 det a,Pulser
R4563 T6425 T6427 compound Bio-Rad,Pulser
R4564 T6426 T6427 compound Gene,Pulser
R4565 T6427 T6423 dobj Pulser,using
R4566 T6428 T6423 prep with,using
R4567 T6429 T6431 det a,Extender
R4568 T6430 T6431 compound Capacitance,Extender
R4569 T6431 T6428 pobj Extender,with
R4570 T6432 T6434 punct (,kV
R4571 T6433 T6434 nummod 0.25,kV
R4572 T6434 T6437 npadvmod kV,µFd
R4573 T6435 T6437 punct ",",µFd
R4574 T6436 T6437 nummod 960,µFd
R4575 T6437 T6437 ROOT µFd,µFd
R4576 T6438 T6437 punct ),µFd
R4577 T6439 T6386 punct .,growing
R4578 T6440 T6442 amod pGL3,plasmid
R4579 T6441 T6442 compound control,plasmid
R4580 T6442 T6451 nsubjpass plasmid,included
R4581 T6443 T6444 nsubj which,encodes
R4582 T6444 T6442 relcl encodes,plasmid
R4583 T6445 T6447 det the,promoter
R4584 T6446 T6447 compound SV40,promoter
R4585 T6447 T6444 dobj promoter,encodes
R4586 T6448 T6447 cc and,promoter
R4587 T6449 T6447 conj enhancer,promoter
R4588 T6450 T6451 auxpass was,included
R4589 T6451 T6451 ROOT included,included
R4590 T6452 T6451 prep as,included
R4591 T6453 T6455 det a,control
R4592 T6454 T6455 amod positive,control
R4593 T6455 T6452 pobj control,as
R4594 T6456 T6455 prep for,control
R4595 T6457 T6458 compound transfection,efficiency
R4596 T6458 T6456 pobj efficiency,for
R4597 T6459 T6451 punct ",",included
R4598 T6460 T6451 cc and,included
R4599 T6461 T6451 prep as,included
R4600 T6462 T6464 det an,standard
R4601 T6463 T6464 amod internal,standard
R4602 T6464 T6461 pobj standard,as
R4603 T6465 T6464 prep for,standard
R4604 T6466 T6469 nmod promoter,activities
R4605 T6467 T6466 cc and,promoter
R4606 T6468 T6466 conj enhancer,promoter
R4607 T6469 T6465 pobj activities,for
R4608 T6470 T6451 punct .,included
R4609 T6471 T6472 amod Transfected,cells
R4610 T6472 T6474 nsubjpass cells,transferred
R4611 T6473 T6474 auxpass were,transferred
R4612 T6474 T6474 ROOT transferred,transferred
R4613 T6475 T6474 prep to,transferred
R4614 T6476 T6477 nummod 10,ml
R4615 T6477 T6475 pobj ml,to
R4616 T6478 T6477 prep of,ml
R4617 T6479 T6480 amod pre-warmed,media
R4618 T6480 T6478 pobj media,of
R4619 T6481 T6477 prep in,ml
R4620 T6482 T6484 amod 6-well,culture
R4621 T6483 T6484 compound tissue,culture
R4622 T6484 T6485 compound culture,plates
R4623 T6485 T6481 pobj plates,in
R4624 T6486 T6485 punct ",",plates
R4625 T6487 T6474 conj divided,transferred
R4626 T6488 T6487 prep into,divided
R4627 T6489 T6492 nummod two,pools
R4628 T6490 T6492 amod identical,pools
R4629 T6491 T6492 compound cell,pools
R4630 T6492 T6488 pobj pools,into
R4631 T6493 T6487 cc and,divided
R4632 T6494 T6487 conj incubated,divided
R4633 T6495 T6496 nummod 16,hrs
R4634 T6496 T6494 dobj hrs,incubated
R4635 T6497 T6494 prep in,incubated
R4636 T6498 T6507 det a,atmosphere
R4637 T6499 T6500 nummod 5,%
R4638 T6500 T6507 nmod %,atmosphere
R4639 T6501 T6504 nummod CO2,%
R4640 T6502 T6501 cc and,CO2
R4641 T6503 T6504 nummod 95,%
R4642 T6504 T6507 nmod %,atmosphere
R4643 T6505 T6507 amod humidified,atmosphere
R4644 T6506 T6507 compound air,atmosphere
R4645 T6507 T6497 pobj atmosphere,in
R4646 T6508 T6494 prep at,incubated
R4647 T6509 T6510 nummod 37,°
R4648 T6510 T6508 pobj °,at
R4649 T6511 T6494 conj C,incubated
R4650 T6512 T6513 preconj either,in
R4651 T6513 T6494 prep in,incubated
R4652 T6514 T6515 det the,presence
R4653 T6515 T6513 pobj presence,in
R4654 T6516 T6515 cc or,presence
R4655 T6517 T6515 conj absence,presence
R4656 T6518 T6517 prep of,absence
R4657 T6519 T6521 nummod 100,LPS
R4658 T6520 T6521 amod ng/ml,LPS
R4659 T6521 T6518 pobj LPS,of
R4660 T6522 T6474 punct .,transferred
R4661 T6523 T6524 amod Luciferase,activity
R4662 T6524 T6526 nsubjpass activity,measured
R4663 T6525 T6526 auxpass was,measured
R4664 T6526 T6526 ROOT measured,measured
R4665 T6527 T6526 advcl using,measured
R4666 T6528 T6533 det a,kit
R4667 T6529 T6532 compound Dual-Luciferase,System
R4668 T6530 T6532 compound Reporter,System
R4669 T6531 T6532 compound Assay,System
R4670 T6532 T6533 compound System,kit
R4671 T6533 T6527 dobj kit,using
R4672 T6534 T6533 punct (,kit
R4673 T6535 T6533 appos Promega,kit
R4674 T6536 T6533 punct ),kit
R4675 T6537 T6526 punct .,measured
R4676 T6538 T6539 nsubj Measurements,represent
R4677 T6539 T6539 ROOT represent,represent
R4678 T6540 T6541 det the,results
R4679 T6541 T6539 dobj results,represent
R4680 T6542 T6541 prep of,results
R4681 T6543 T6544 advmod at,least
R4682 T6544 T6545 advmod least,three
R4683 T6545 T6547 nummod three,experiments
R4684 T6546 T6547 amod independent,experiments
R4685 T6547 T6542 pobj experiments,of
R4686 T6548 T6539 punct .,represent
R4687 T6549 T6550 compound Promoter,activity
R4688 T6550 T6552 nsubjpass activity,expressed
R4689 T6551 T6552 auxpass is,expressed
R4690 T6552 T6552 ROOT expressed,expressed
R4691 T6553 T6552 prep as,expressed
R4692 T6554 T6555 det the,number
R4693 T6555 T6553 pobj number,as
R4694 T6556 T6555 prep of,number
R4695 T6557 T6558 advmod firefly,luciferase
R4696 T6558 T6560 amod luciferase,units
R4697 T6559 T6560 amod light,units
R4698 T6560 T6556 pobj units,of
R4699 T6561 T6552 conj normalized,expressed
R4700 T6562 T6561 advmod either,normalized
R4701 T6563 T6564 aux to,pRL-TK
R4702 T6564 T6562 xcomp pRL-TK,either
R4703 T6565 T6566 compound renilla,luciferase
R4704 T6566 T6568 amod luciferase,units
R4705 T6567 T6568 amod light,units
R4706 T6568 T6564 dobj units,pRL-TK
R4707 T6569 T6564 cc or,pRL-TK
R4708 T6570 T6564 conj to,pRL-TK
R4709 T6571 T6573 amod cellular,concentration
R4710 T6572 T6573 compound protein,concentration
R4711 T6573 T6570 pobj concentration,to
R4712 T6574 T6573 punct (,concentration
R4713 T6575 T6582 advmod where,affected
R4714 T6576 T6582 nsubj co-transfected,affected
R4715 T6577 T6579 compound C/EBP,β
R4716 T6578 T6579 punct -,β
R4717 T6579 T6582 nsubj β,affected
R4718 T6580 T6579 cc or,β
R4719 T6581 T6579 conj LPS,β
R4720 T6582 T6573 relcl affected,concentration
R4721 T6583 T6584 amod pRL-TK,activity
R4722 T6584 T6582 dobj activity,affected
R4723 T6585 T6573 punct ),concentration
R4724 T6586 T6552 punct .,expressed
R4725 T6587 T6588 compound Protein,concentration
R4726 T6588 T6590 nsubjpass concentration,determined
R4727 T6589 T6590 auxpass was,determined
R4728 T6590 T6590 ROOT determined,determined
R4729 T6591 T6590 advcl using,determined
R4730 T6592 T6594 det the,protein
R4731 T6593 T6594 compound Bio-Rad,protein
R4732 T6594 T6591 dobj protein,using
R4733 T6595 T6596 compound microassay,reagent
R4734 T6596 T6594 appos reagent,protein
R4735 T6597 T6590 punct .,determined
R4969 T6927 T6928 compound Lentiviral,shRNAs
R4970 T6928 T6950 nsubjpass shRNAs,used
R4971 T6929 T6928 punct ",",shRNAs
R4972 T6930 T6935 nmod Packaging,vectors
R4973 T6931 T6930 cc and,Packaging
R4974 T6932 T6933 compound Transduction,pLKO.1-puro
R4975 T6933 T6930 conj pLKO.1-puro,Packaging
R4976 T6934 T6935 amod lentiviral,vectors
R4977 T6935 T6928 appos vectors,shRNAs
R4978 T6936 T6935 acl carrying,vectors
R4979 T6937 T6939 amod short,RNAs
R4980 T6938 T6939 compound hairpin,RNAs
R4981 T6939 T6936 dobj RNAs,carrying
R4982 T6940 T6939 punct (,RNAs
R4983 T6941 T6939 appos shRNA,RNAs
R4984 T6942 T6939 punct ),RNAs
R4985 T6943 T6935 conj specific,vectors
R4986 T6944 T6943 prep for,specific
R4987 T6945 T6948 amod human,cebpb
R4988 T6946 T6945 cc and,human
R4989 T6947 T6945 conj mouse,human
R4990 T6948 T6944 pobj cebpb,for
R4991 T6949 T6950 auxpass were,used
R4992 T6950 T6950 ROOT used,used
R4993 T6951 T6950 prep in,used
R4994 T6952 T6953 det these,studies
R4995 T6953 T6951 pobj studies,in
R4996 T6954 T6950 punct .,used
R4997 T6955 T6965 mark Because,are
R4998 T6956 T6964 det the,regions
R4999 T6957 T6960 amod human,cebpb
R5000 T6958 T6957 cc and,human
R5001 T6959 T6957 conj mouse,human
R5002 T6960 T6964 nmod cebpb,regions
R5003 T6961 T6962 nummod 3,′
R5004 T6962 T6964 compound ′,regions
R5005 T6963 T6964 compound untranslated,regions
R5006 T6964 T6965 nsubj regions,are
R5007 T6965 T6974 advcl are,knockdown
R5008 T6966 T6965 neg not,are
R5009 T6967 T6965 acomp identical,are
R5010 T6968 T6974 punct ",",knockdown
R5011 T6969 T6971 det these,shRNAs
R5012 T6970 T6971 amod species-specific,shRNAs
R5013 T6971 T6974 nsubj shRNAs,knockdown
R5014 T6972 T6974 aux can,knockdown
R5015 T6973 T6974 neg not,knockdown
R5016 T6974 T6992 ccomp knockdown,used
R5017 T6975 T6974 dobj expression,knockdown
R5018 T6976 T6975 prep of,expression
R5019 T6977 T6980 amod endogenous,β
R5020 T6978 T6980 compound C/EBP,β
R5021 T6979 T6980 punct -,β
R5022 T6980 T6976 pobj β,of
R5023 T6981 T6982 advmod when,used
R5024 T6982 T6974 advcl used,knockdown
R5025 T6983 T6982 prep on,used
R5026 T6984 T6983 pobj cells,on
R5027 T6985 T6984 prep of,cells
R5028 T6986 T6988 det the,species
R5029 T6987 T6988 amod other,species
R5030 T6988 T6985 pobj species,of
R5031 T6989 T6992 punct ;,used
R5032 T6990 T6992 advmod therefore,used
R5033 T6991 T6992 nsubj we,used
R5034 T6992 T6992 ROOT used,used
R5035 T6993 T6996 det the,shRNA
R5036 T6994 T6996 amod human,shRNA
R5037 T6995 T6996 compound CEBPB,shRNA
R5038 T6996 T6992 dobj shRNA,used
R5039 T6997 T6992 prep as,used
R5040 T6998 T6999 det a,control
R5041 T6999 T6997 pobj control,as
R5042 T7000 T6999 prep in,control
R5043 T7001 T7002 det these,experiments
R5044 T7002 T7000 pobj experiments,in
R5045 T7003 T6999 prep as,control
R5046 T7004 T7003 prep in,as
R5047 T7005 T7004 pobj [,in
R5048 T7006 T7007 nummod 38,]
R5049 T7007 T7003 pobj ],as
R5050 T7008 T6992 punct .,used
R5051 T7009 T7010 aux To,produce
R5052 T7010 T7017 advcl produce,transfected
R5053 T7011 T7012 amod lentiviral,particles
R5054 T7012 T7010 dobj particles,produce
R5055 T7013 T7017 punct ",",transfected
R5056 T7014 T7015 amod HEK-293T,cells
R5057 T7015 T7017 nsubjpass cells,transfected
R5058 T7016 T7017 auxpass were,transfected
R5059 T7017 T7017 ROOT transfected,transfected
R5060 T7018 T7017 prep with,transfected
R5061 T7019 T7020 det a,mixture
R5062 T7020 T7018 pobj mixture,with
R5063 T7021 T7020 prep of,mixture
R5064 T7022 T7021 pobj plasmids,of
R5065 T7023 T7017 punct :,transfected
R5066 T7024 T7027 det each,plasmid
R5067 T7025 T7027 amod shRNA,plasmid
R5068 T7026 T7027 compound expression,plasmid
R5069 T7027 T7027 ROOT plasmid,plasmid
R5070 T7028 T7030 punct (,µg
R5071 T7029 T7030 nummod 1,µg
R5072 T7030 T7027 appos µg,plasmid
R5073 T7031 T7027 punct ),plasmid
R5074 T7032 T7027 punct ",",plasmid
R5075 T7033 T7037 amod pCMV-ΔR8,plasmid
R5076 T7034 T7037 nummod .2,plasmid
R5077 T7035 T7037 compound dvpr,plasmid
R5078 T7036 T7037 compound packaging,plasmid
R5079 T7037 T7027 conj plasmid,plasmid
R5080 T7038 T7037 punct (,plasmid
R5081 T7039 T7040 nummod 0.75,µg
R5082 T7040 T7037 appos µg,plasmid
R5083 T7041 T7037 punct ),plasmid
R5084 T7042 T7037 punct ",",plasmid
R5085 T7043 T7017 cc and,transfected
R5086 T7044 T7046 compound pCMV-VSV-G,plasmid
R5087 T7045 T7046 compound envelope,plasmid
R5088 T7046 T7046 ROOT plasmid,plasmid
R5089 T7047 T7046 punct (,plasmid
R5090 T7048 T7049 nummod 0.25,µg
R5091 T7049 T7046 appos µg,plasmid
R5092 T7050 T7046 punct ),plasmid
R5093 T7051 T7017 advcl using,transfected
R5094 T7052 T7054 nmod Lipofectamine,reagent
R5095 T7053 T7054 nummod 2000,reagent
R5096 T7054 T7051 dobj reagent,using
R5097 T7055 T7054 punct (,reagent
R5098 T7056 T7054 appos Invitrogen,reagent
R5099 T7057 T7054 punct ),reagent
R5100 T7058 T7017 punct .,transfected
R5101 T7059 T7061 det The,supernatant
R5102 T7060 T7061 amod lentiviral,supernatant
R5103 T7061 T7063 nsubjpass supernatant,collected
R5104 T7062 T7063 auxpass was,collected
R5105 T7063 T7063 ROOT collected,collected
R5106 T7064 T7065 nummod 48,hrs
R5107 T7065 T7063 dobj hrs,collected
R5108 T7066 T7063 prep after,collected
R5109 T7067 T7066 pobj transfection,after
R5110 T7068 T7066 punct ",",after
R5111 T7069 T7063 conj cleared,collected
R5112 T7070 T7069 agent by,cleared
R5113 T7071 T7070 pobj centrifugation,by
R5114 T7072 T7069 prep at,cleared
R5115 T7073 T7074 nummod "2,000",g
R5116 T7074 T7072 pobj g,at
R5117 T7075 T7069 prep for,cleared
R5118 T7076 T7077 nummod 10,mins
R5119 T7077 T7075 pobj mins,for
R5120 T7078 T7069 cc and,cleared
R5121 T7079 T7069 conj passed,cleared
R5122 T7080 T7079 prep through,passed
R5123 T7081 T7084 det a,filter
R5124 T7082 T7084 nummod 0.45,filter
R5125 T7083 T7084 compound µm,filter
R5126 T7084 T7080 pobj filter,through
R5127 T7085 T7063 punct .,collected
R5128 T7086 T7088 det The,cells
R5129 T7087 T7088 compound target,cells
R5130 T7088 T7090 nsubjpass cells,treated
R5131 T7089 T7090 auxpass were,treated
R5132 T7090 T7090 ROOT treated,treated
R5133 T7091 T7090 prep with,treated
R5134 T7092 T7094 det the,supernatant
R5135 T7093 T7094 amod lentiviral,supernatant
R5136 T7094 T7091 pobj supernatant,with
R5137 T7095 T7094 cc and,supernatant
R5138 T7096 T7097 nummod 8,µg
R5139 T7097 T7100 compound µg,Polybrene
R5140 T7098 T7100 compound /,Polybrene
R5141 T7099 T7100 compound ml,Polybrene
R5142 T7100 T7094 conj Polybrene,supernatant
R5143 T7101 T7100 punct (,Polybrene
R5144 T7102 T7103 compound American,Bioanalytical
R5145 T7103 T7100 appos Bioanalytical,Polybrene
R5146 T7104 T7100 punct ),Polybrene
R5147 T7105 T7100 prep for,Polybrene
R5148 T7106 T7107 nummod 24,hrs
R5149 T7107 T7105 pobj hrs,for
R5150 T7108 T7090 punct .,treated
R5151 T7109 T7111 det The,supernatant
R5152 T7110 T7111 amod lentiviral,supernatant
R5153 T7111 T7113 nsubjpass supernatant,replaced
R5154 T7112 T7113 auxpass was,replaced
R5155 T7113 T7113 ROOT replaced,replaced
R5156 T7114 T7113 prep with,replaced
R5157 T7115 T7117 amod fresh,media
R5158 T7116 T7117 compound growth,media
R5159 T7117 T7114 pobj media,with
R5160 T7118 T7113 cc and,replaced
R5161 T7119 T7113 conj incubated,replaced
R5162 T7120 T7119 advmod further,incubated
R5163 T7121 T7125 mark for,allow
R5164 T7122 T7123 nummod 72,hrs
R5165 T7123 T7125 nsubj hrs,allow
R5166 T7124 T7125 aux to,allow
R5167 T7125 T7119 advcl allow,incubated
R5168 T7126 T7125 prep for,allow
R5169 T7127 T7129 amod effective,knockdown
R5170 T7128 T7129 compound gene,knockdown
R5171 T7129 T7126 pobj knockdown,for
R5172 T7130 T7113 punct .,replaced
R5173 T7131 T7113 punct C/EBP,replaced
R5174 T7132 T7133 punct -,β
R5175 T7133 T7134 compound β,knockdown
R5176 T7134 T7136 nsubjpass knockdown,confirmed
R5177 T7135 T7136 auxpass was,confirmed
R5178 T7136 T7136 ROOT confirmed,confirmed
R5179 T7137 T7136 agent by,confirmed
R5180 T7138 T7140 amod western,analysis
R5181 T7139 T7140 compound blot,analysis
R5182 T7140 T7137 pobj analysis,by
R5183 T7141 T7136 punct .,confirmed
R5403 T7597 T7598 compound Transient,Transfection
R5404 T7598 T7598 ROOT Transfection,Transfection
R5405 T7599 T7598 cc and,Transfection
R5406 T7600 T7601 compound Luciferase,Assays
R5407 T7601 T7598 conj Assays,Transfection
R5408 T7602 T7604 punct (,Cells
R5409 T7603 T7604 compound MEF,Cells
R5410 T7604 T7601 appos Cells,Assays
R5411 T7605 T7601 punct ),Assays
R5412 T7606 T7607 compound Cebpb,−
R5413 T7607 T7608 nsubj −,/
R5414 T7608 T7608 ROOT /,/
R5415 T7609 T7610 nummod −,MEFs
R5416 T7610 T7608 dobj MEFs,/
R5417 T7611 T7610 punct (,MEFs
R5418 T7612 T7614 nummod 1,105
R5419 T7613 T7614 nummod ×,105
R5420 T7614 T7610 appos 105,MEFs
R5421 T7615 T7610 punct ),MEFs
R5422 T7616 T7618 nmod [,]
R5423 T7617 T7618 nummod 34,]
R5424 T7618 T7620 nsubjpass ],transfected
R5425 T7619 T7620 auxpass were,transfected
R5426 T7620 T7620 ROOT transfected,transfected
R5427 T7621 T7620 prep with,transfected
R5428 T7622 T7626 det the,plasmid
R5429 T7623 T7626 amod indicated,plasmid
R5430 T7624 T7626 compound luciferase,plasmid
R5431 T7625 T7626 compound reporter,plasmid
R5432 T7626 T7621 pobj plasmid,with
R5433 T7627 T7626 punct (,plasmid
R5434 T7628 T7629 nummod 400,ng
R5435 T7629 T7626 appos ng,plasmid
R5436 T7630 T7626 punct ),plasmid
R5437 T7631 T7620 prep along,transfected
R5438 T7632 T7631 prep with,along
R5439 T7633 T7635 det a,reporter
R5440 T7634 T7635 amod β-actin-β-galactosidase,reporter
R5441 T7635 T7636 compound reporter,plasmid
R5442 T7636 T7632 pobj plasmid,with
R5443 T7637 T7636 punct (,plasmid
R5444 T7638 T7639 nummod 200,ng
R5445 T7639 T7636 appos ng,plasmid
R5446 T7640 T7636 punct ),plasmid
R5447 T7641 T7620 agent by,transfected
R5448 T7642 T7641 pobj electroporation,by
R5449 T7643 T7620 advcl using,transfected
R5450 T7644 T7648 det the,system
R5451 T7645 T7648 compound Invitrogen,system
R5452 T7646 T7648 compound Neon,system
R5453 T7647 T7648 compound ™,system
R5454 T7648 T7643 dobj system,using
R5455 T7649 T7648 punct (,system
R5456 T7650 T7651 nummod 1,pulse
R5457 T7651 T7648 appos pulse,system
R5458 T7652 T7648 punct ",",system
R5459 T7653 T7654 nummod 1350,V
R5460 T7654 T7648 conj V,system
R5461 T7655 T7654 punct ",",V
R5462 T7656 T7657 nummod 30,msec
R5463 T7657 T7654 appos msec,V
R5464 T7658 T7657 punct ),msec
R5465 T7659 T7620 punct .,transfected
R5466 T7660 T7661 amod Transfected,cells
R5467 T7661 T7663 nsubjpass cells,transferred
R5468 T7662 T7663 auxpass were,transferred
R5469 T7663 T7663 ROOT transferred,transferred
R5470 T7664 T7663 prep to,transferred
R5471 T7665 T7666 amod pre-warmed,media
R5472 T7666 T7664 pobj media,to
R5473 T7667 T7663 prep in,transferred
R5474 T7668 T7670 nummod 24,plates
R5475 T7669 T7670 intj well,plates
R5476 T7670 T7667 pobj plates,in
R5477 T7671 T7670 cc and,plates
R5478 T7672 T7663 advcl incubated,transferred
R5479 T7673 T7672 prep for,incubated
R5480 T7674 T7675 nummod 48,hrs
R5481 T7675 T7673 pobj hrs,for
R5482 T7676 T7672 advmod prior,incubated
R5483 T7677 T7676 prep to,prior
R5484 T7678 T7677 pobj incubation,to
R5485 T7679 T7672 prep with,incubated
R5486 T7680 T7679 pobj LPS,with
R5487 T7681 T7680 punct (,LPS
R5488 T7682 T7683 nummod 100,ng/ml
R5489 T7683 T7680 appos ng/ml,LPS
R5490 T7684 T7680 punct ),LPS
R5491 T7685 T7672 prep for,incubated
R5492 T7686 T7687 nummod 4,hrs
R5493 T7687 T7685 pobj hrs,for
R5494 T7688 T7689 advmod where,indicated
R5495 T7689 T7687 relcl indicated,hrs
R5496 T7690 T7663 punct .,transferred
R5497 T7691 T7691 ROOT In,In
R5498 T7692 T7693 det some,experiments
R5499 T7693 T7691 pobj experiments,In
R5500 T7694 T7693 punct ",",experiments
R5501 T7695 T7699 nmod plasmids,β
R5502 T7696 T7695 acl encoding,plasmids
R5503 T7697 T7699 compound C/EBP,β
R5504 T7698 T7699 punct -,β
R5505 T7699 T7694 dative β,","
R5506 T7700 T7699 cc or,β
R5507 T7701 T7703 punct C/EBP,β
R5508 T7702 T7703 punct -,β
R5509 T7703 T7705 nmod β,mutants
R5510 T7704 T7705 compound phospho-acceptor,mutants
R5511 T7705 T7699 conj mutants,β
R5512 T7706 T7705 punct (,mutants
R5513 T7707 T7705 appos T188A,mutants
R5514 T7708 T7707 punct ",",T188A
R5515 T7709 T7707 appos T217A,T188A
R5516 T7710 T7705 punct ",",mutants
R5517 T7711 T7705 appos S64A,mutants
R5518 T7712 T7705 punct ),mutants
R5519 T7713 T7715 nmod [,]
R5520 T7714 T7715 nummod 38,]
R5521 T7715 T7723 nsubjpass ],co-transfected
R5522 T7716 T7715 appos [,]
R5523 T7717 T7718 nummod 40,]
R5524 T7718 T7716 dobj ],[
R5525 T7719 T7716 cc or,[
R5526 T7720 T7721 amod control,vector
R5527 T7721 T7716 conj vector,[
R5528 T7722 T7723 auxpass were,co-transfected
R5529 T7723 T7723 ROOT co-transfected,co-transfected
R5530 T7724 T7723 punct (,co-transfected
R5531 T7725 T7727 nummod 0.6,µg
R5532 T7726 T7727 nummod 1.0,µg
R5533 T7727 T7723 appos µg,co-transfected
R5534 T7728 T7729 amod total,DNA
R5535 T7729 T7727 appos DNA,µg
R5536 T7730 T7727 punct ),µg
R5537 T7731 T7723 punct .,co-transfected
R5538 T7732 T7733 amod Luciferase,activity
R5539 T7733 T7735 nsubjpass activity,determined
R5540 T7734 T7735 auxpass was,determined
R5541 T7735 T7735 ROOT determined,determined
R5542 T7736 T7735 cc and,determined
R5543 T7737 T7735 conj normalized,determined
R5544 T7738 T7737 prep to,normalized
R5545 T7739 T7738 pobj that,to
R5546 T7740 T7739 prep of,that
R5547 T7741 T7742 compound β-galactosidase,[
R5548 T7742 T7740 pobj [,of
R5549 T7743 T7744 nummod 38,]
R5550 T7744 T7745 nsubj ],using
R5551 T7745 T7735 advcl using,determined
R5552 T7746 T7749 det the,System
R5553 T7747 T7749 compound Luciferase,System
R5554 T7748 T7749 compound Assay,System
R5555 T7749 T7745 dobj System,using
R5556 T7750 T7749 cc and,System
R5557 T7751 T7754 compound β-Galactosidase,System
R5558 T7752 T7754 compound Enzyme,System
R5559 T7753 T7754 compound Assay,System
R5560 T7754 T7749 conj System,System
R5561 T7755 T7749 conj Kits,System
R5562 T7756 T7745 punct ",",using
R5563 T7757 T7745 advmod respectively,using
R5564 T7758 T7759 punct (,Promega
R5565 T7759 T7757 appos Promega,respectively
R5566 T7760 T7759 punct ),Promega
R5567 T7761 T7735 punct .,determined
R5568 T7762 T7763 det Each,experiment
R5569 T7763 T7765 nsubjpass experiment,repeated
R5570 T7764 T7765 auxpass was,repeated
R5571 T7765 T7765 ROOT repeated,repeated
R5572 T7766 T7767 advmod at,least
R5573 T7767 T7768 advmod least,three
R5574 T7768 T7769 nummod three,times
R5575 T7769 T7765 npadvmod times,repeated
R5576 T7770 T7765 punct ",",repeated
R5577 T7771 T7765 cc and,repeated
R5578 T7772 T7773 compound triplicate,samples
R5579 T7773 T7775 nsubjpass samples,employed
R5580 T7774 T7775 auxpass were,employed
R5581 T7775 T7765 conj employed,repeated
R5582 T7776 T7775 prep for,employed
R5583 T7777 T7778 det each,sample
R5584 T7778 T7776 pobj sample,for
R5585 T7779 T7775 punct .,employed
R5586 T7780 T7788 nmod Expression,proteins
R5587 T7781 T7780 prep of,Expression
R5588 T7782 T7783 det the,C/EBP
R5589 T7783 T7781 pobj C/EBP,of
R5590 T7784 T7785 punct -,β
R5591 T7785 T7788 amod β,proteins
R5592 T7786 T7788 amod phospho-acceptor,proteins
R5593 T7787 T7788 amod mutant,proteins
R5594 T7788 T7790 nsubjpass proteins,checked
R5595 T7789 T7790 auxpass was,checked
R5596 T7790 T7790 ROOT checked,checked
R5597 T7791 T7790 prep for,checked
R5598 T7792 T7793 amod equal,expression
R5599 T7793 T7791 pobj expression,for
R5600 T7794 T7793 prep by,expression
R5601 T7795 T7796 amod western,blot
R5602 T7796 T7794 pobj blot,by
R5603 T7797 T7790 punct .,checked
R5781 T8059 T8063 compound Electrophoretic,Radiolabelled
R5782 T8060 T8061 compound Mobility,Shift
R5783 T8061 T8063 compound Shift,Radiolabelled
R5784 T8062 T8063 compound Assays,Radiolabelled
R5785 T8063 T8063 ROOT Radiolabelled,Radiolabelled
R5786 T8064 T8063 punct ",",Radiolabelled
R5787 T8065 T8067 amod double-stranded,probes
R5788 T8066 T8067 compound oligonucleotide,probes
R5789 T8067 T8073 nsubjpass probes,prepared
R5790 T8068 T8067 prep for,probes
R5791 T8069 T8070 compound gel,shift
R5792 T8070 T8071 compound shift,assays
R5793 T8071 T8068 pobj assays,for
R5794 T8072 T8073 auxpass were,prepared
R5795 T8073 T8063 npadvmod prepared,Radiolabelled
R5796 T8074 T8073 advcl using,prepared
R5797 T8075 T8077 nummod T4,kinase
R5798 T8076 T8077 compound polynucleotide,kinase
R5799 T8077 T8074 dobj kinase,using
R5800 T8078 T8077 cc and,kinase
R5801 T8079 T8083 compound [,ATP
R5802 T8080 T8083 compound γ-32P,ATP
R5803 T8081 T8083 compound ],ATP
R5804 T8082 T8083 punct -,ATP
R5805 T8083 T8077 conj ATP,kinase
R5806 T8084 T8073 punct .,prepared
R5807 T8085 T8090 nsubjpass RAW,prepared
R5808 T8086 T8088 nummod 264.7,extracts
R5809 T8087 T8088 amod nuclear,extracts
R5810 T8088 T8090 nsubjpass extracts,prepared
R5811 T8089 T8090 auxpass were,prepared
R5812 T8090 T8090 ROOT prepared,prepared
R5813 T8091 T8090 agent by,prepared
R5814 T8092 T8095 det the,method
R5815 T8093 T8094 compound detergent,lysis
R5816 T8094 T8095 compound lysis,method
R5817 T8095 T8091 pobj method,by
R5818 T8096 T8098 nmod [,]
R5819 T8097 T8098 nummod 41,]
R5820 T8098 T8095 appos ],method
R5821 T8099 T8090 punct .,prepared
R5822 T8100 T8159 nsubjpass DNA,performed
R5823 T8101 T8102 amod binding,reactions
R5824 T8102 T8100 dobj reactions,DNA
R5825 T8103 T8102 punct (,reactions
R5826 T8104 T8105 nummod 25,µl
R5827 T8105 T8102 appos µl,reactions
R5828 T8106 T8105 punct ),µl
R5829 T8107 T8105 acl containing,µl
R5830 T8108 T8111 nummod 10,pH
R5831 T8109 T8111 compound mM,pH
R5832 T8110 T8111 compound HEPES,pH
R5833 T8111 T8107 dobj pH,containing
R5834 T8112 T8111 nummod 7.9,pH
R5835 T8113 T8111 punct ",",pH
R5836 T8114 T8118 nummod 10,BSA
R5837 T8115 T8118 amod µg,BSA
R5838 T8116 T8118 nmod /,BSA
R5839 T8117 T8118 compound ml,BSA
R5840 T8118 T8111 appos BSA,pH
R5841 T8119 T8111 punct ",",pH
R5842 T8120 T8122 nummod 2,DTT
R5843 T8121 T8122 compound mM,DTT
R5844 T8122 T8111 conj DTT,pH
R5845 T8123 T8122 punct ",",DTT
R5846 T8124 T8125 nummod 30,%
R5847 T8125 T8126 compound %,glycerol
R5848 T8126 T8122 conj glycerol,DTT
R5849 T8127 T8126 punct ",",glycerol
R5850 T8128 T8129 nummod 20,%
R5851 T8129 T8130 compound %,Ficoll-400
R5852 T8130 T8126 appos Ficoll-400,glycerol
R5853 T8131 T8130 punct ",",Ficoll-400
R5854 T8132 T8134 nummod 1,poly
R5855 T8133 T8134 compound µg,poly
R5856 T8134 T8159 nsubjpass poly,performed
R5857 T8135 T8136 punct (,dI-dC
R5858 T8136 T8134 appos dI-dC,poly
R5859 T8137 T8136 punct ),dI-dC
R5860 T8138 T8134 punct ",",poly
R5861 T8139 T8140 nummod 6,µg
R5862 T8140 T8134 appos µg,poly
R5863 T8141 T8140 prep of,µg
R5864 T8142 T8143 amod nuclear,extracts
R5865 T8143 T8141 pobj extracts,of
R5866 T8144 T8140 cc and,µg
R5867 T8145 T8147 quantmod "10,000","20,000"
R5868 T8146 T8147 quantmod to,"20,000"
R5869 T8147 T8148 nummod "20,000",cpm
R5870 T8148 T8140 conj cpm,µg
R5871 T8149 T8153 punct (,ng
R5872 T8150 T8152 quantmod 0.05,0.2
R5873 T8151 T8152 quantmod to,0.2
R5874 T8152 T8153 nummod 0.2,ng
R5875 T8153 T8148 appos ng,cpm
R5876 T8154 T8153 punct ),ng
R5877 T8155 T8148 prep of,cpm
R5878 T8156 T8157 amod radiolabelled,probe
R5879 T8157 T8155 pobj probe,of
R5880 T8158 T8159 auxpass were,performed
R5881 T8159 T8159 ROOT performed,performed
R5882 T8160 T8159 prep for,performed
R5883 T8161 T8162 nummod 20,minutes
R5884 T8162 T8160 pobj minutes,for
R5885 T8163 T8162 prep at,minutes
R5886 T8164 T8165 compound room,temperature
R5887 T8165 T8163 pobj temperature,at
R5888 T8166 T8159 punct .,performed
R5889 T8167 T8169 amod Binding,products
R5890 T8168 T8169 compound reaction,products
R5891 T8169 T8171 nsubjpass products,resolved
R5892 T8170 T8171 auxpass were,resolved
R5893 T8171 T8171 ROOT resolved,resolved
R5894 T8172 T8171 agent by,resolved
R5895 T8173 T8172 pobj electrophoresis,by
R5896 T8174 T8171 prep at,resolved
R5897 T8175 T8176 compound room,temperature
R5898 T8176 T8174 pobj temperature,at
R5899 T8177 T8171 prep on,resolved
R5900 T8178 T8179 nummod 5,%
R5901 T8179 T8181 compound %,gels
R5902 T8180 T8181 compound polyacrylamide,gels
R5903 T8181 T8177 pobj gels,on
R5904 T8182 T8181 punct (,gels
R5905 T8183 T8184 nummod 29,∶
R5906 T8184 T8181 appos ∶,gels
R5907 T8185 T8184 nummod 1,∶
R5908 T8186 T8186 ROOT acrylamide,acrylamide
R5909 T8187 T8186 punct :,acrylamide
R5910 T8188 T8186 appos bis-acrylamide,acrylamide
R5911 T8189 T8190 punct (,Bio-Rad
R5912 T8190 T8188 appos Bio-Rad,bis-acrylamide
R5913 T8191 T8188 punct ),bis-acrylamide
R5914 T8192 T8186 punct ),acrylamide
R5915 T8193 T8186 prep in,acrylamide
R5916 T8194 T8195 nummod 1x,TBE
R5917 T8195 T8193 pobj TBE,in
R5918 T8196 T8186 prep at,acrylamide
R5919 T8197 T8196 pobj 10V/cm,at
R5920 T8198 T8186 punct .,acrylamide
R5921 T8199 T8205 prep For,were
R5922 T8200 T8201 amod supershift,assays
R5923 T8201 T8199 pobj assays,For
R5924 T8202 T8205 punct ",",were
R5925 T8203 T8204 amod nuclear,extracts
R5926 T8204 T8205 nsubj extracts,were
R5927 T8205 T8205 ROOT were,were
R5928 T8206 T8205 acomp pre-incubated,were
R5929 T8207 T8208 nummod 2,hrs
R5930 T8208 T8206 dobj hrs,pre-incubated
R5931 T8209 T8206 prep on,pre-incubated
R5932 T8210 T8209 pobj ice,on
R5933 T8211 T8206 prep with,pre-incubated
R5934 T8212 T8213 nummod 4,µg
R5935 T8213 T8211 pobj µg,with
R5936 T8214 T8213 prep of,µg
R5937 T8215 T8217 amod specific,antibody
R5938 T8216 T8217 compound C/EBP,antibody
R5939 T8217 T8214 pobj antibody,of
R5940 T8218 T8205 punct .,were
R5941 T8219 T8221 nsubjpass Antibodies,purchased
R5942 T8220 T8221 auxpass were,purchased
R5943 T8221 T8221 ROOT purchased,purchased
R5944 T8222 T8221 prep from,purchased
R5945 T8223 T8224 compound Santa,Cruz
R5946 T8224 T8222 pobj Cruz,from
R5947 T8225 T8228 punct :,α
R5948 T8226 T8228 amod anti-C/EBP,α
R5949 T8227 T8228 punct -,α
R5950 T8228 T8249 nmod α,ε
R5951 T8229 T8230 punct (,sc-61
R5952 T8230 T8228 parataxis sc-61,α
R5953 T8231 T8230 punct ),sc-61
R5954 T8232 T8228 punct ",",α
R5955 T8233 T8235 amod anti-C/EBP,β
R5956 T8234 T8235 punct -,β
R5957 T8235 T8228 appos β,α
R5958 T8236 T8237 punct (,sc-150
R5959 T8237 T8235 appos sc-150,β
R5960 T8238 T8237 punct ),sc-150
R5961 T8239 T8235 punct ",",β
R5962 T8240 T8242 amod anti-C/EBP,δ
R5963 T8241 T8242 punct -,δ
R5964 T8242 T8228 appos δ,α
R5965 T8243 T8244 punct (,sc-151
R5966 T8244 T8242 appos sc-151,δ
R5967 T8245 T8244 punct ),sc-151
R5968 T8246 T8244 cc and,sc-151
R5969 T8247 T8249 amod anti-C/EBP,ε
R5970 T8248 T8249 punct -,ε
R5971 T8249 T8221 npadvmod ε,purchased
R5972 T8250 T8251 punct (,sc-158
R5973 T8251 T8249 appos sc-158,ε
R5974 T8252 T8251 punct ),sc-158
R5975 T8253 T8221 punct .,purchased
R6238 T8619 T8620 compound Chromatin,Immunoprecipitation
R6239 T8620 T8620 ROOT Immunoprecipitation,Immunoprecipitation
R6240 T8621 T8622 punct (,ChIP
R6241 T8622 T8620 appos ChIP,Immunoprecipitation
R6242 T8623 T8620 punct ),Immunoprecipitation
R6243 T8624 T8625 compound Assay,ChIP
R6244 T8625 T8626 compound ChIP,assays
R6245 T8626 T8628 nsubjpass assays,performed
R6246 T8627 T8628 auxpass were,performed
R6247 T8628 T8628 ROOT performed,performed
R6248 T8629 T8628 advcl using,performed
R6249 T8630 T8635 det a,kit
R6250 T8631 T8632 advmod commercially,available
R6251 T8632 T8635 amod available,kit
R6252 T8633 T8635 nmod Magna-ChIP,kit
R6253 T8634 T8635 compound ™,kit
R6254 T8635 T8629 dobj kit,using
R6255 T8636 T8635 punct (,kit
R6256 T8637 T8635 appos Millipore,kit
R6257 T8638 T8635 punct ),kit
R6258 T8639 T8628 punct ",",performed
R6259 T8640 T8641 mark as,recommended
R6260 T8641 T8628 advcl recommended,performed
R6261 T8642 T8641 agent by,recommended
R6262 T8643 T8644 det the,manufacturer
R6263 T8644 T8642 pobj manufacturer,by
R6264 T8645 T8641 punct ",",recommended
R6265 T8646 T8641 prep with,recommended
R6266 T8647 T8648 amod minor,modifications
R6267 T8648 T8646 pobj modifications,with
R6268 T8649 T8628 punct .,performed
R6269 T8650 T8679 advmod Briefly,washed
R6270 T8651 T8679 punct ",",washed
R6271 T8652 T8679 prep after,washed
R6272 T8653 T8652 pcomp crosslinking,after
R6273 T8654 T8655 det the,chromatin
R6274 T8655 T8653 dobj chromatin,crosslinking
R6275 T8656 T8653 prep with,crosslinking
R6276 T8657 T8658 nummod 1,%
R6277 T8658 T8659 compound %,formaldehyde
R6278 T8659 T8656 pobj formaldehyde,with
R6279 T8660 T8659 prep at,formaldehyde
R6280 T8661 T8662 compound room,temperature
R6281 T8662 T8660 pobj temperature,at
R6282 T8663 T8653 prep for,crosslinking
R6283 T8664 T8665 nummod 10,min
R6284 T8665 T8663 pobj min,for
R6285 T8666 T8653 cc and,crosslinking
R6286 T8667 T8653 conj neutralizing,crosslinking
R6287 T8668 T8667 prep with,neutralizing
R6288 T8669 T8668 pobj glycine,with
R6289 T8670 T8667 prep for,neutralizing
R6290 T8671 T8672 nummod 5,min
R6291 T8672 T8670 pobj min,for
R6292 T8673 T8672 prep at,min
R6293 T8674 T8675 compound room,temperature
R6294 T8675 T8673 pobj temperature,at
R6295 T8676 T8679 punct ",",washed
R6296 T8677 T8679 nsubjpass cells,washed
R6297 T8678 T8679 auxpass were,washed
R6298 T8679 T8679 ROOT washed,washed
R6299 T8680 T8679 prep with,washed
R6300 T8681 T8682 amod cold,PBS
R6301 T8682 T8680 pobj PBS,with
R6302 T8683 T8679 punct ",",washed
R6303 T8684 T8679 conj scraped,washed
R6304 T8685 T8684 cc and,scraped
R6305 T8686 T8684 conj collected,scraped
R6306 T8687 T8686 prep on,collected
R6307 T8688 T8687 pobj ice,on
R6308 T8689 T8679 punct .,washed
R6309 T8690 T8691 compound Cells,extracts
R6310 T8691 T8692 nsubj extracts,were
R6311 T8692 T8692 ROOT were,were
R6312 T8693 T8692 acomp prepared,were
R6313 T8694 T8693 xcomp using,prepared
R6314 T8695 T8698 det a,kit
R6315 T8696 T8697 advmod commercially,available
R6316 T8697 T8698 amod available,kit
R6317 T8698 T8694 dobj kit,using
R6318 T8699 T8698 punct (,kit
R6319 T8700 T8698 appos Millipore,kit
R6320 T8701 T8698 punct ),kit
R6321 T8702 T8692 punct .,were
R6322 T8703 T8704 compound Nuclear,lysates
R6323 T8704 T8706 nsubjpass lysates,sonicated
R6324 T8705 T8706 auxpass were,sonicated
R6325 T8706 T8706 ROOT sonicated,sonicated
R6326 T8707 T8708 nummod 5,times
R6327 T8708 T8706 npadvmod times,sonicated
R6328 T8709 T8708 prep for,times
R6329 T8710 T8711 nummod 15,sec
R6330 T8711 T8709 pobj sec,for
R6331 T8712 T8706 prep with,sonicated
R6332 T8713 T8715 nummod 1,intervals
R6333 T8714 T8715 compound min,intervals
R6334 T8715 T8712 pobj intervals,with
R6335 T8716 T8715 prep on,intervals
R6336 T8717 T8716 pobj ice,on
R6337 T8718 T8706 advcl using,sonicated
R6338 T8719 T8721 det a,Dismembrator
R6339 T8720 T8721 compound Sonic,Dismembrator
R6340 T8721 T8718 dobj Dismembrator,using
R6341 T8722 T8721 punct (,Dismembrator
R6342 T8723 T8721 appos Fisher,Dismembrator
R6343 T8724 T8721 punct ),Dismembrator
R6344 T8725 T8706 punct .,sonicated
R6345 T8726 T8728 det An,amount
R6346 T8727 T8728 amod equal,amount
R6347 T8728 T8732 nsubjpass amount,immunoprecipitated
R6348 T8729 T8728 prep of,amount
R6349 T8730 T8729 pobj chromatin,of
R6350 T8731 T8732 auxpass was,immunoprecipitated
R6351 T8732 T8732 ROOT immunoprecipitated,immunoprecipitated
R6352 T8733 T8732 prep at,immunoprecipitated
R6353 T8734 T8735 nummod 4,°
R6354 T8735 T8736 nummod °,C
R6355 T8736 T8737 compound C,overnight
R6356 T8737 T8733 pobj overnight,at
R6357 T8738 T8737 prep with,overnight
R6358 T8739 T8740 advmod at,least
R6359 T8740 T8741 advmod least,1
R6360 T8741 T8742 nummod 1,µg
R6361 T8742 T8738 pobj µg,with
R6362 T8743 T8742 prep of,µg
R6363 T8744 T8746 det the,antibodies
R6364 T8745 T8746 amod following,antibodies
R6365 T8746 T8743 pobj antibodies,of
R6366 T8747 T8742 punct :,µg
R6367 T8748 T8750 punct C/EBP,β
R6368 T8749 T8750 punct -,β
R6369 T8750 T8742 appos β,µg
R6370 T8751 T8752 punct (,sc-150X
R6371 T8752 T8750 appos sc-150X,β
R6372 T8753 T8752 punct ),sc-150X
R6373 T8754 T8750 punct ",",β
R6374 T8755 T8757 compound p-C/EBP,β
R6375 T8756 T8757 punct -,β
R6376 T8757 T8750 appos β,β
R6377 T8758 T8757 punct (,β
R6378 T8759 T8757 appos T217,β
R6379 T8760 T8757 punct ),β
R6380 T8761 T8762 punct (,sc-16993X
R6381 T8762 T8757 appos sc-16993X,β
R6382 T8763 T8757 punct ),β
R6383 T8764 T8757 punct ",",β
R6384 T8765 T8766 amod normal,rabbit
R6385 T8766 T8779 compound rabbit,II
R6386 T8767 T8779 nmod IgG,II
R6387 T8768 T8769 punct (,sc-2027
R6388 T8769 T8767 appos sc-2027,IgG
R6389 T8770 T8769 punct ),sc-2027
R6390 T8771 T8774 punct (,Biotechnologies
R6391 T8772 T8774 compound Santa,Biotechnologies
R6392 T8773 T8774 compound Cruz,Biotechnologies
R6393 T8774 T8769 appos Biotechnologies,sc-2027
R6394 T8775 T8774 punct ),Biotechnologies
R6395 T8776 T8774 cc and,Biotechnologies
R6396 T8777 T8779 compound RNA,II
R6397 T8778 T8779 compound polymerase,II
R6398 T8779 T8750 conj II,β
R6399 T8780 T8779 punct (,II
R6400 T8781 T8782 compound Clone,CTD4H8
R6401 T8782 T8779 appos CTD4H8,II
R6402 T8783 T8779 punct ),II
R6403 T8784 T8779 punct (,II
R6404 T8785 T8779 appos Millipore,II
R6405 T8786 T8779 punct ),II
R6406 T8787 T8732 punct .,immunoprecipitated
R6407 T8788 T8789 amod Immunoprecipitated,products
R6408 T8789 T8791 nsubjpass products,collected
R6409 T8790 T8791 auxpass were,collected
R6410 T8791 T8791 ROOT collected,collected
R6411 T8792 T8791 prep after,collected
R6412 T8793 T8792 pobj incubation,after
R6413 T8794 T8791 prep with,collected
R6414 T8795 T8796 compound Protein,G
R6415 T8796 T8799 nmod G,beads
R6416 T8797 T8799 amod coated,beads
R6417 T8798 T8799 amod magnetic,beads
R6418 T8799 T8794 pobj beads,with
R6419 T8800 T8801 punct (,Millipore
R6420 T8801 T8799 appos Millipore,beads
R6421 T8802 T8799 punct ),beads
R6422 T8803 T8791 punct .,collected
R6423 T8804 T8805 det The,beads
R6424 T8805 T8807 nsubjpass beads,washed
R6425 T8806 T8807 auxpass were,washed
R6426 T8807 T8807 ROOT washed,washed
R6427 T8808 T8807 punct ",",washed
R6428 T8809 T8811 det the,chromatin
R6429 T8810 T8811 amod bound,chromatin
R6430 T8811 T8813 nsubjpass chromatin,eluted
R6431 T8812 T8813 auxpass was,eluted
R6432 T8813 T8807 conj eluted,washed
R6433 T8814 T8813 prep in,eluted
R6434 T8815 T8817 compound ChIP,Buffer
R6435 T8816 T8817 compound Elution,Buffer
R6436 T8817 T8814 pobj Buffer,in
R6437 T8818 T8817 punct (,Buffer
R6438 T8819 T8817 appos Millipore,Buffer
R6439 T8820 T8817 punct ),Buffer
R6440 T8821 T8813 cc and,eluted
R6441 T8822 T8823 det the,proteins
R6442 T8823 T8825 nsubjpass proteins,digested
R6443 T8824 T8825 auxpass were,digested
R6444 T8825 T8813 conj digested,eluted
R6445 T8826 T8825 prep with,digested
R6446 T8827 T8828 compound Proteinase,K
R6447 T8828 T8826 pobj K,with
R6448 T8829 T8825 prep for,digested
R6449 T8830 T8831 nummod 2,hrs
R6450 T8831 T8829 pobj hrs,for
R6451 T8832 T8825 prep at,digested
R6452 T8833 T8835 nummod 62,C
R6453 T8834 T8835 nummod °,C
R6454 T8835 T8832 pobj C,at
R6455 T8836 T8825 punct .,digested
R6456 T8837 T8838 det The,DNA
R6457 T8838 T8841 nsubjpass DNA,purified
R6458 T8839 T8841 auxpass was,purified
R6459 T8840 T8841 advmod then,purified
R6460 T8841 T8841 ROOT purified,purified
R6461 T8842 T8841 advcl using,purified
R6462 T8843 T8847 det the,Kit
R6463 T8844 T8847 compound QIAquick,Kit
R6464 T8845 T8847 compound PCR,Kit
R6465 T8846 T8847 compound Purification,Kit
R6466 T8847 T8842 dobj Kit,using
R6467 T8848 T8847 punct (,Kit
R6468 T8849 T8847 appos Qiagen,Kit
R6469 T8850 T8847 punct ),Kit
R6470 T8851 T8841 punct .,purified
R6471 T8852 T8854 nsubjpass DNA,amplified
R6472 T8853 T8854 auxpass was,amplified
R6473 T8854 T8854 ROOT amplified,amplified
R6474 T8855 T8854 agent by,amplified
R6475 T8856 T8857 compound semi-quantitative,PCR
R6476 T8857 T8855 pobj PCR,by
R6477 T8858 T8855 cc or,by
R6478 T8859 T8855 conj by,by
R6479 T8860 T8859 pobj qPCR,by
R6480 T8861 T8854 advcl using,amplified
R6481 T8862 T8865 det the,method
R6482 T8863 T8865 nmod SYBR,method
R6483 T8864 T8865 amod green,method
R6484 T8865 T8861 dobj method,using
R6485 T8866 T8865 cc and,method
R6486 T8867 T8865 conj primers,method
R6487 T8868 T8861 oprd specific,using
R6488 T8869 T8868 prep for,specific
R6489 T8870 T8873 det the,promoter
R6490 T8871 T8873 nmod SerpinB2,promoter
R6491 T8872 T8873 amod proximal,promoter
R6492 T8873 T8869 pobj promoter,for
R6493 T8874 T8854 punct :,amplified
R6494 T8875 T8875 ROOT forward,forward
R6495 T8876 T8880 punct (,−
R6496 T8877 T8880 nmod −,−
R6497 T8878 T8880 nummod 338,−
R6498 T8879 T8880 nummod /,−
R6499 T8880 T8880 ROOT −,−
R6500 T8881 T8880 nummod 315,−
R6501 T8882 T8880 punct ),−
R6502 T8883 T8880 nummod 5,−
R6503 T8884 T8885 nummod ′,AAGACTCCCACAGATGGTGGCTGT3
R6504 T8885 T8880 appos AAGACTCCCACAGATGGTGGCTGT3,−
R6505 T8886 T8887 punct ;,reverse
R6506 T8887 T8895 nmod reverse,′
R6507 T8888 T8887 punct (,reverse
R6508 T8889 T8892 nmod −,+19
R6509 T8890 T8892 nummod 5,+19
R6510 T8891 T8892 punct /,+19
R6511 T8892 T8887 appos +19,reverse
R6512 T8893 T8887 punct ),reverse
R6513 T8894 T8895 nummod 5,′
R6514 T8895 T8880 appos ′,−
R6515 T8896 T8895 nummod TTCTTGGAAAGCTGGCACTGTGTG3,′
R6516 T8897 T8854 punct .,amplified
R6551 T8941 T8942 compound Statistical,Analysis
R6552 T8942 T8943 compound Analysis,Data
R6553 T8943 T8945 nsubjpass Data,presented
R6554 T8944 T8945 auxpass are,presented
R6555 T8945 T8945 ROOT presented,presented
R6556 T8946 T8945 prep as,presented
R6557 T8947 T8949 amod mean,SEM
R6558 T8948 T8949 compound ±,SEM
R6559 T8949 T8946 pobj SEM,as
R6560 T8950 T8949 prep per,SEM
R6561 T8951 T8950 pobj group,per
R6562 T8952 T8945 punct .,presented
R6563 T8953 T8955 nsubjpass Results,analyzed
R6564 T8954 T8955 auxpass were,analyzed
R6565 T8955 T8955 ROOT analyzed,analyzed
R6566 T8956 T8955 advcl using,analyzed
R6567 T8957 T8958 det the,analysis
R6568 T8958 T8956 dobj analysis,using
R6569 T8959 T8958 prep of,analysis
R6570 T8960 T8959 pobj variance,of
R6571 T8961 T8962 punct (,ANOVA
R6572 T8962 T8960 appos ANOVA,variance
R6573 T8963 T8962 punct ),ANOVA
R6574 T8964 T8960 cc or,variance
R6575 T8965 T8967 poss Student,test
R6576 T8966 T8967 compound t,test
R6577 T8967 T8960 conj test,variance
R6578 T8968 T8969 advmod where,relevant
R6579 T8969 T8956 advcl relevant,using
R6580 T8970 T8955 punct .,analyzed
R6581 T8971 T8972 nsubj P-values,<
R6582 T8972 T8972 ROOT <,<
R6583 T8973 T8975 nsubjpass 0.05,considered
R6584 T8974 T8975 auxpass were,considered
R6585 T8975 T8972 ccomp considered,<
R6586 T8976 T8975 oprd significant,considered
R6587 T8977 T8972 punct .,<
R6785 T9283 T9285 det The,Gene
R6786 T9284 T9285 compound SerpinB2,Gene
R6787 T9285 T9286 nsubj Gene,is
R6788 T9286 T9286 ROOT is,is
R6789 T9287 T9288 compound Highly,Responsive
R6790 T9288 T9286 attr Responsive,is
R6791 T9289 T9288 prep to,Responsive
R6792 T9290 T9289 pobj LPS,to
R6793 T9291 T9296 advmod When,exposed
R6794 T9292 T9296 nsubjpass RAW264,exposed
R6795 T9293 T9292 nummod .7,RAW264
R6796 T9294 T9296 nsubjpass macrophages,exposed
R6797 T9295 T9296 auxpass were,exposed
R6798 T9296 T9302 advcl exposed,was
R6799 T9297 T9296 prep to,exposed
R6800 T9298 T9297 pobj LPS,to
R6801 T9299 T9298 punct ",",LPS
R6802 T9300 T9301 compound SerpinB2,mRNA
R6803 T9301 T9298 appos mRNA,LPS
R6804 T9302 T9286 conj was,is
R6805 T9303 T9302 acomp detectable,was
R6806 T9304 T9305 advmod as,early
R6807 T9305 T9303 advmod early,detectable
R6808 T9306 T9305 prep as,early
R6809 T9307 T9308 nummod 30,min
R6810 T9308 T9306 pobj min,as
R6811 T9309 T9308 prep following,min
R6812 T9310 T9311 compound LPS,challenge
R6813 T9311 T9309 pobj challenge,following
R6814 T9312 T9308 punct ",",min
R6815 T9313 T9302 advcl reaching,was
R6816 T9314 T9315 amod maximal,levels
R6817 T9315 T9313 dobj levels,reaching
R6818 T9316 T9315 prep at,levels
R6819 T9317 T9318 nummod 24,hrs
R6820 T9318 T9316 pobj hrs,at
R6821 T9319 T9318 punct (,hrs
R6822 T9320 T9321 compound Fig.,1A
R6823 T9321 T9318 appos 1A,hrs
R6824 T9322 T9318 punct ),hrs
R6825 T9323 T9302 punct .,was
R6826 T9324 T9327 det A,induction
R6827 T9325 T9327 amod similar,induction
R6828 T9326 T9327 amod strong,induction
R6829 T9327 T9335 nsubjpass induction,reported
R6830 T9328 T9327 prep of,induction
R6831 T9329 T9332 amod LPS-inducible,expression
R6832 T9330 T9331 compound SerpinB2,mRNA
R6833 T9331 T9332 compound mRNA,expression
R6834 T9332 T9328 pobj expression,of
R6835 T9333 T9335 aux has,reported
R6836 T9334 T9335 auxpass been,reported
R6837 T9335 T9335 ROOT reported,reported
R6838 T9336 T9335 advmod previously,reported
R6839 T9337 T9335 prep in,reported
R6840 T9338 T9340 amod murine,macrophages
R6841 T9339 T9340 amod peritoneal,macrophages
R6842 T9340 T9337 pobj macrophages,in
R6843 T9341 T9340 cc and,macrophages
R6844 T9342 T9344 amod human,blood
R6845 T9343 T9344 compound peripheral,blood
R6846 T9344 T9346 compound blood,cells
R6847 T9345 T9346 compound mononuclear,cells
R6848 T9346 T9340 conj cells,macrophages
R6849 T9347 T9349 nmod [,]
R6850 T9348 T9349 nummod 4,]
R6851 T9349 T9335 npadvmod ],reported
R6852 T9350 T9349 punct ;,]
R6853 T9351 T9349 conj [,]
R6854 T9352 T9353 nummod 32,]
R6855 T9353 T9349 conj ],]
R6856 T9354 T9335 punct .,reported
R6857 T9355 T9357 amod LPS-induced,expression
R6858 T9356 T9357 amod SerpinB2,expression
R6859 T9357 T9358 nsubj expression,involves
R6860 T9358 T9358 ROOT involves,involves
R6861 T9359 T9361 nsubj both,increase
R6862 T9360 T9361 det an,increase
R6863 T9361 T9358 dobj increase,involves
R6864 T9362 T9361 prep in,increase
R6865 T9363 T9364 compound gene,transcription
R6866 T9364 T9362 pobj transcription,in
R6867 T9365 T9364 cc and,transcription
R6868 T9366 T9364 conj stabilization,transcription
R6869 T9367 T9366 prep of,stabilization
R6870 T9368 T9372 det the,]
R6871 T9369 T9370 compound mRNA,[
R6872 T9370 T9372 nmod [,]
R6873 T9371 T9372 nummod 5,]
R6874 T9372 T9367 pobj ],of
R6875 T9373 T9358 punct ;,involves
R6876 T9374 T9376 compound [,]
R6877 T9375 T9376 compound 29,]
R6878 T9376 T9358 dep ],involves
R6879 T9377 T9376 punct ;,]
R6880 T9378 T9380 nmod [,]
R6881 T9379 T9380 nummod 42,]
R6882 T9380 T9381 meta ],[
R6883 T9381 T9376 appos [,]
R6884 T9382 T9383 nummod 44,]
R6885 T9383 T9381 dobj ],[
R6886 T9384 T9381 punct .,[
R6887 T9385 T9387 nummod SerpinB2,expression
R6888 T9386 T9387 compound protein,expression
R6889 T9387 T9390 nsubjpass expression,induced
R6890 T9388 T9390 auxpass was,induced
R6891 T9389 T9390 advmod also,induced
R6892 T9390 T9390 ROOT induced,induced
R6893 T9391 T9394 mark as,reported
R6894 T9392 T9394 aux has,reported
R6895 T9393 T9394 auxpass been,reported
R6896 T9394 T9390 advcl reported,induced
R6897 T9395 T9394 prep in,reported
R6898 T9396 T9398 amod other,types
R6899 T9397 T9398 compound cell,types
R6900 T9398 T9395 pobj types,in
R6901 T9399 T9401 nmod [,]
R6902 T9400 T9401 nummod 31,]
R6903 T9401 T9394 dobj ],reported
R6904 T9402 T9401 punct ",",]
R6905 T9403 T9401 cc and,]
R6906 T9404 T9405 amod detectable,after
R6907 T9405 T9394 prep after,reported
R6908 T9406 T9407 nummod 8,hrs
R6909 T9407 T9405 pobj hrs,after
R6910 T9408 T9407 prep of,hrs
R6911 T9409 T9410 compound LPS,treatment
R6912 T9410 T9408 pobj treatment,of
R6913 T9411 T9413 punct (,1
R6914 T9412 T9413 nmod Fig.,1
R6915 T9413 T9407 dep 1,hrs
R6916 T9414 T9413 punct ),1
R6917 T9415 T9390 punct .,induced
R7306 T10019 T10022 det The,Promoter
R7307 T10020 T10022 compound SerpinB2,Promoter
R7308 T10021 T10022 compound Proximal,Promoter
R7309 T10022 T10023 nsubj Promoter,Confers
R7310 T10023 T10023 ROOT Confers,Confers
R7311 T10024 T10025 compound LPS,Responsiveness
R7312 T10025 T10023 dobj Responsiveness,Confers
R7313 T10026 T10027 aux To,investigate
R7314 T10027 T10023 advcl investigate,Confers
R7315 T10028 T10030 amod cis-acting,elements
R7316 T10029 T10030 amod regulatory,elements
R7317 T10030 T10027 dobj elements,investigate
R7318 T10031 T10030 acl responsive,elements
R7319 T10032 T10031 prep to,responsive
R7320 T10033 T10032 pobj LPS,to
R7321 T10034 T10027 prep in,investigate
R7322 T10035 T10039 det the,region
R7323 T10036 T10037 nummod 5,′
R7324 T10037 T10039 compound ′,region
R7325 T10038 T10039 compound flanking,region
R7326 T10039 T10034 pobj region,in
R7327 T10040 T10039 prep of,region
R7328 T10041 T10044 det the,gene
R7329 T10042 T10044 compound murine,gene
R7330 T10043 T10044 compound SerpinB2,gene
R7331 T10044 T10040 pobj gene,of
R7332 T10045 T10047 punct ",",−
R7333 T10046 T10047 nsubj nucleotides,−
R7334 T10047 T10065 ccomp −,cloned
R7335 T10048 T10065 nsubjpass 4480,cloned
R7336 T10049 T10048 prep to,4480
R7337 T10050 T10049 pobj +92,to
R7338 T10051 T10048 cc and,4480
R7339 T10052 T10053 det a,series
R7340 T10053 T10065 nsubjpass series,cloned
R7341 T10054 T10053 prep of,series
R7342 T10055 T10057 amod generated,mutants
R7343 T10056 T10057 compound deletion,mutants
R7344 T10057 T10054 pobj mutants,of
R7345 T10058 T10057 prep of,mutants
R7346 T10059 T10063 det the,region
R7347 T10060 T10061 nummod 5,′
R7348 T10061 T10063 amod ′,region
R7349 T10062 T10063 amod flanking,region
R7350 T10063 T10058 pobj region,of
R7351 T10064 T10065 auxpass were,cloned
R7352 T10065 T10065 ROOT cloned,cloned
R7353 T10066 T10065 dobj upstream,cloned
R7354 T10067 T10066 prep of,upstream
R7355 T10068 T10073 det a,gene
R7356 T10069 T10073 amod promoter-less,gene
R7357 T10070 T10073 amod firefly,gene
R7358 T10071 T10073 compound luciferase,gene
R7359 T10072 T10073 compound reporter,gene
R7360 T10073 T10067 pobj gene,of
R7361 T10074 T10076 punct (,Basic
R7362 T10075 T10076 compound pGL3,Basic
R7363 T10076 T10073 appos Basic,gene
R7364 T10077 T10065 punct ),cloned
R7365 T10078 T10065 punct (,cloned
R7366 T10079 T10080 compound Fig.,2A
R7367 T10080 T10065 appos 2A,cloned
R7368 T10081 T10065 punct ),cloned
R7369 T10082 T10023 punct .,Confers
R7370 T10083 T10084 det The,reporter
R7371 T10084 T10085 compound reporter,constructs
R7372 T10085 T10086 nsubj constructs,were
R7373 T10086 T10089 auxpass were,transfected
R7374 T10087 T10089 advmod then,transfected
R7375 T10088 T10089 advmod transiently,transfected
R7376 T10089 T10089 ROOT transfected,transfected
R7377 T10090 T10089 prep into,transfected
R7378 T10091 T10092 compound sub-confluent,RAW264
R7379 T10092 T10090 pobj RAW264,into
R7380 T10093 T10092 nummod .7,RAW264
R7381 T10094 T10090 pobj macrophages,into
R7382 T10095 T10089 cc and,transfected
R7383 T10096 T10089 conj assayed,transfected
R7384 T10097 T10096 prep for,assayed
R7385 T10098 T10099 compound luciferase,activity
R7386 T10099 T10097 pobj activity,for
R7387 T10100 T10099 prep in,activity
R7388 T10101 T10102 det the,presence
R7389 T10102 T10100 pobj presence,in
R7390 T10103 T10102 cc and,presence
R7391 T10104 T10102 conj absence,presence
R7392 T10105 T10104 prep of,absence
R7393 T10106 T10105 pobj LPS,of
R7394 T10107 T10106 cc or,LPS
R7395 T10108 T10106 conj PMA,LPS
R7396 T10109 T10096 punct ",",assayed
R7397 T10110 T10096 prep for,assayed
R7398 T10111 T10110 pobj comparison,for
R7399 T10112 T10089 punct .,transfected
R7400 T10113 T10116 amod PMA-induced,regulation
R7401 T10114 T10116 compound SerpinB2,regulation
R7402 T10115 T10116 compound gene,regulation
R7403 T10116 T10120 nsubjpass regulation,studied
R7404 T10117 T10120 aux has,studied
R7405 T10118 T10120 auxpass been,studied
R7406 T10119 T10120 advmod extensively,studied
R7407 T10120 T10120 ROOT studied,studied
R7408 T10121 T10120 prep in,studied
R7409 T10122 T10124 amod human,cell
R7410 T10123 T10124 compound macrophage,cell
R7411 T10124 T10125 compound cell,lines
R7412 T10125 T10121 pobj lines,in
R7413 T10126 T10128 nmod [,]
R7414 T10127 T10128 nummod 45,]
R7415 T10128 T10125 appos ],lines
R7416 T10129 T10131 nmod [,]
R7417 T10130 T10131 nummod 47,]
R7418 T10131 T10128 conj ],]
R7419 T10132 T10131 punct ",",]
R7420 T10133 T10120 cc and,studied
R7421 T10134 T10136 aux has,shown
R7422 T10135 T10136 auxpass been,shown
R7423 T10136 T10120 conj shown,studied
R7424 T10137 T10138 aux to,occur
R7425 T10138 T10136 xcomp occur,shown
R7426 T10139 T10138 prep through,occur
R7427 T10140 T10146 amod several,elements
R7428 T10141 T10146 amod proximal,elements
R7429 T10142 T10141 cc and,proximal
R7430 T10143 T10141 conj distal,proximal
R7431 T10144 T10146 amod AP-1,elements
R7432 T10145 T10146 amod responsive,elements
R7433 T10146 T10139 pobj elements,through
R7434 T10147 T10149 nmod [,]
R7435 T10148 T10149 nummod 30,]
R7436 T10149 T10146 appos ],elements
R7437 T10150 T10149 punct ;,]
R7438 T10151 T10153 nmod [,]
R7439 T10152 T10153 nummod 37,]
R7440 T10153 T10149 conj ],]
R7441 T10154 T10149 punct ;,]
R7442 T10155 T10149 conj [,]
R7443 T10156 T10157 nummod 47,]
R7444 T10157 T10149 conj ],]
R7445 T10158 T10146 appos [,elements
R7446 T10159 T10160 nummod 51,]
R7447 T10160 T10158 appos ],[
R7448 T10161 T10120 punct .,studied
R7449 T10162 T10163 mark As,shown
R7450 T10163 T10179 advcl shown,directs
R7451 T10164 T10163 prep in,shown
R7452 T10165 T10166 compound Fig.,2B
R7453 T10166 T10164 pobj 2B,in
R7454 T10167 T10166 punct ",",2B
R7455 T10168 T10173 det the,region
R7456 T10169 T10173 nummod SerpinB2,region
R7457 T10170 T10171 nummod 5,′
R7458 T10171 T10173 amod ′,region
R7459 T10172 T10173 amod flanking,region
R7460 T10173 T10166 appos region,2B
R7461 T10174 T10163 prep from,shown
R7462 T10175 T10178 nummod −,+92
R7463 T10176 T10178 nummod 4480,+92
R7464 T10177 T10178 quantmod to,+92
R7465 T10178 T10174 pobj +92,from
R7466 T10179 T10179 ROOT directs,directs
R7467 T10180 T10181 det both,PMA
R7468 T10181 T10179 dobj PMA,directs
R7469 T10182 T10181 punct -,PMA
R7470 T10183 T10181 cc and,PMA
R7471 T10184 T10185 compound LPS-inducible,transcription
R7472 T10185 T10181 conj transcription,PMA
R7473 T10186 T10185 punct ",",transcription
R7474 T10187 T10188 advmod approximately,2-fold
R7475 T10188 T10185 conj 2-fold,transcription
R7476 T10189 T10188 cc and,2-fold
R7477 T10190 T10188 conj 7-fold,2-fold
R7478 T10191 T10190 punct ",",7-fold
R7479 T10192 T10190 conj respectively,7-fold
R7480 T10193 T10179 punct .,directs
R7481 T10194 T10194 ROOT Deletion,Deletion
R7482 T10195 T10194 prep of,Deletion
R7483 T10196 T10199 det the,promoter
R7484 T10197 T10199 compound murine,promoter
R7485 T10198 T10199 compound SerpinB2,promoter
R7486 T10199 T10195 pobj promoter,of
R7487 T10200 T10194 prep from,Deletion
R7488 T10201 T10202 nummod −,1686
R7489 T10202 T10200 pobj 1686,from
R7490 T10203 T10194 prep to,Deletion
R7491 T10204 T10203 pobj −,to
R7492 T10205 T10207 nummod 1341,LPS-inducibility
R7493 T10206 T10207 amod increased,LPS-inducibility
R7494 T10207 T10203 pobj LPS-inducibility,to
R7495 T10208 T10194 prep to,Deletion
R7496 T10209 T10210 advmod approximately,16-fold
R7497 T10210 T10208 pobj 16-fold,to
R7498 T10211 T10194 punct ",",Deletion
R7499 T10212 T10194 acl indicating,Deletion
R7500 T10213 T10214 det the,presence
R7501 T10214 T10212 dobj presence,indicating
R7502 T10215 T10214 prep of,presence
R7503 T10216 T10218 det a,element
R7504 T10217 T10218 compound silencer,element
R7505 T10218 T10215 pobj element,of
R7506 T10219 T10218 prep in,element
R7507 T10220 T10221 det this,region
R7508 T10221 T10219 pobj region,in
R7509 T10222 T10194 punct .,Deletion
R7510 T10223 T10224 amod Further,deletion
R7511 T10224 T10228 nsubj deletion,abolished
R7512 T10225 T10224 prep beyond,deletion
R7513 T10226 T10225 pobj −,beyond
R7514 T10227 T10228 nsubj 539,abolished
R7515 T10228 T10265 ccomp abolished,is
R7516 T10229 T10230 det the,LPS-response
R7517 T10230 T10228 dobj LPS-response,abolished
R7518 T10231 T10230 prep of,LPS-response
R7519 T10232 T10233 det the,promoter
R7520 T10233 T10231 pobj promoter,of
R7521 T10234 T10228 punct ",",abolished
R7522 T10235 T10228 advcl indicating,abolished
R7523 T10236 T10237 det the,presence
R7524 T10237 T10235 dobj presence,indicating
R7525 T10238 T10237 prep of,presence
R7526 T10239 T10243 det an,element
R7527 T10240 T10243 amod essential,element
R7528 T10241 T10243 compound LPS,element
R7529 T10242 T10243 compound response,element
R7530 T10243 T10238 pobj element,of
R7531 T10244 T10243 prep in,element
R7532 T10245 T10246 det the,region
R7533 T10246 T10244 pobj region,in
R7534 T10247 T10237 prep between,presence
R7535 T10248 T10249 nummod −,539
R7536 T10249 T10247 pobj 539,between
R7537 T10250 T10249 cc and,539
R7538 T10251 T10249 conj −,539
R7539 T10252 T10249 conj 189,539
R7540 T10253 T10265 punct ;,is
R7541 T10254 T10265 advmod however,is
R7542 T10255 T10265 punct ",",is
R7543 T10256 T10257 det the,response
R7544 T10257 T10265 nsubj response,is
R7545 T10258 T10257 prep of,response
R7546 T10259 T10262 det the,promoter
R7547 T10260 T10262 compound murine,promoter
R7548 T10261 T10262 compound SerpinB2,promoter
R7549 T10262 T10258 pobj promoter,of
R7550 T10263 T10257 prep to,response
R7551 T10264 T10263 pobj PMA,to
R7552 T10265 T10265 ROOT is,is
R7553 T10266 T10267 advmod less,affected
R7554 T10267 T10265 acomp affected,is
R7555 T10268 T10267 prep by,affected
R7556 T10269 T10270 det this,deletion
R7557 T10270 T10268 pobj deletion,by
R7558 T10271 T10265 punct .,is
R7559 T10272 T10284 mark While,eliminated
R7560 T10273 T10284 nsubj deletion,eliminated
R7561 T10274 T10273 prep of,deletion
R7562 T10275 T10277 det the,promoter
R7563 T10276 T10277 compound SerpinB2,promoter
R7564 T10277 T10274 pobj promoter,of
R7565 T10278 T10273 prep from,deletion
R7566 T10279 T10284 dep −,eliminated
R7567 T10280 T10284 dep 189,eliminated
R7568 T10281 T10284 prep to,eliminated
R7569 T10282 T10281 pobj −,to
R7570 T10283 T10284 nsubj 87,eliminated
R7571 T10284 T10302 advcl eliminated,was
R7572 T10285 T10287 det the,response
R7573 T10286 T10287 compound LPS,response
R7574 T10287 T10284 dobj response,eliminated
R7575 T10288 T10287 cc and,response
R7576 T10289 T10290 advmod marginally,reduced
R7577 T10290 T10284 conj reduced,eliminated
R7578 T10291 T10293 det the,response
R7579 T10292 T10293 compound PMA,response
R7580 T10293 T10290 dobj response,reduced
R7581 T10294 T10301 punct ",",construct
R7582 T10295 T10300 det the,promoter
R7583 T10296 T10300 nmod −,promoter
R7584 T10297 T10298 nummod 87,murine
R7585 T10298 T10300 compound murine,promoter
R7586 T10299 T10300 compound SerpinB2,promoter
R7587 T10300 T10301 compound promoter,construct
R7588 T10301 T10302 nsubj construct,was
R7589 T10302 T10302 ROOT was,was
R7590 T10303 T10302 advmod still,was
R7591 T10304 T10305 advmod partially,responsive
R7592 T10305 T10302 acomp responsive,was
R7593 T10306 T10305 prep to,responsive
R7594 T10307 T10306 pobj PMA,to
R7595 T10308 T10302 punct ",",was
R7596 T10309 T10302 advcl indicating,was
R7597 T10310 T10324 mark that,lie
R7598 T10311 T10312 amod cis-acting,elements
R7599 T10312 T10324 nsubj elements,lie
R7600 T10313 T10312 acl mediating,elements
R7601 T10314 T10315 det the,response
R7602 T10315 T10313 dobj response,mediating
R7603 T10316 T10315 prep of,response
R7604 T10317 T10320 det the,promoter
R7605 T10318 T10320 amod murine,promoter
R7606 T10319 T10320 compound SerpinB2,promoter
R7607 T10320 T10316 pobj promoter,of
R7608 T10321 T10324 aux to,lie
R7609 T10322 T10321 pobj PMA,to
R7610 T10323 T10324 advmod also,lie
R7611 T10324 T10309 ccomp lie,indicating
R7612 T10325 T10324 dobj downstream,lie
R7613 T10326 T10325 prep of,downstream
R7614 T10327 T10328 compound nucleotide,−
R7615 T10328 T10326 pobj −,of
R7616 T10329 T10328 nummod 87,−
R7617 T10330 T10302 punct .,was
R8024 T10978 T10979 compound Sequence,Conservation
R8025 T10979 T10989 nsubj Conservation,look
R8026 T10980 T10979 prep within,Conservation
R8027 T10981 T10982 det the,Human
R8028 T10982 T10980 pobj Human,within
R8029 T10983 T10982 cc and,Human
R8030 T10984 T10987 compound Murine,Promoters
R8031 T10985 T10986 compound SerpinB2,Proximal
R8032 T10986 T10987 compound Proximal,Promoters
R8033 T10987 T10979 appos Promoters,Conservation
R8034 T10988 T10989 aux To,look
R8035 T10989 T11010 advcl look,aligned
R8036 T10990 T10989 prep for,look
R8037 T10991 T10993 amod potential,elements
R8038 T10992 T10993 amod cis-acting,elements
R8039 T10993 T10990 pobj elements,for
R8040 T10994 T10996 nsubj that,mediate
R8041 T10995 T10996 aux might,mediate
R8042 T10996 T10993 relcl mediate,elements
R8043 T10997 T10996 dobj transcription,mediate
R8044 T10998 T10997 prep of,transcription
R8045 T10999 T11002 det the,gene
R8046 T11000 T11002 compound murine,gene
R8047 T11001 T11002 compound SerpinB2,gene
R8048 T11002 T10998 pobj gene,of
R8049 T11003 T10997 cc and,transcription
R8050 T11004 T11005 det the,response
R8051 T11005 T10997 conj response,transcription
R8052 T11006 T11005 prep to,response
R8053 T11007 T11006 pobj LPS,to
R8054 T11008 T11010 punct ",",aligned
R8055 T11009 T11010 nsubj we,aligned
R8056 T11010 T11010 ROOT aligned,aligned
R8057 T11011 T11012 det the,murine
R8058 T11012 T11019 nmod murine,regions
R8059 T11013 T11012 cc and,murine
R8060 T11014 T11015 amod human,SerpinB2
R8061 T11015 T11012 conj SerpinB2,murine
R8062 T11016 T11019 nummod 5,regions
R8063 T11017 T11019 compound ′,regions
R8064 T11018 T11019 compound flanking,regions
R8065 T11019 T11010 dobj regions,aligned
R8066 T11020 T11010 punct .,aligned
R8067 T11021 T11022 nsubj We,reasoned
R8068 T11022 T11022 ROOT reasoned,reasoned
R8069 T11023 T11039 mark that,play
R8070 T11024 T11025 det the,presence
R8071 T11025 T11039 nsubj presence,play
R8072 T11026 T11025 prep of,presence
R8073 T11027 T11028 advmod evolutionarily,conserved
R8074 T11028 T11039 advcl conserved,play
R8075 T11029 T11039 punct ",",play
R8076 T11030 T11032 amod potential,factor
R8077 T11031 T11032 compound transcription,factor
R8078 T11032 T11039 nsubj factor,play
R8079 T11033 T11034 amod binding,sites
R8080 T11034 T11032 dobj sites,factor
R8081 T11035 T11034 prep in,sites
R8082 T11036 T11037 det this,region
R8083 T11037 T11035 pobj region,in
R8084 T11038 T11039 aux might,play
R8085 T11039 T11022 ccomp play,reasoned
R8086 T11040 T11041 det a,role
R8087 T11041 T11039 dobj role,play
R8088 T11042 T11041 prep in,role
R8089 T11043 T11044 det the,regulation
R8090 T11044 T11042 pobj regulation,in
R8091 T11045 T11044 prep of,regulation
R8092 T11046 T11048 compound SerpinB2,expression
R8093 T11047 T11048 compound gene,expression
R8094 T11048 T11045 pobj expression,of
R8095 T11049 T11051 nmod [,]
R8096 T11050 T11051 nummod 52,]
R8097 T11051 T11044 appos ],regulation
R8098 T11052 T11022 punct .,reasoned
R8099 T11053 T11054 det The,presence
R8100 T11054 T11060 nsubj presence,delineated
R8101 T11055 T11054 prep of,presence
R8102 T11056 T11059 amod several,elements
R8103 T11057 T11059 amod repetitive,elements
R8104 T11058 T11059 compound sequence,elements
R8105 T11059 T11055 pobj elements,of
R8106 T11060 T11060 ROOT delineated,delineated
R8107 T11061 T11060 dobj five,delineated
R8108 T11062 T11063 advmod broadly,homologous
R8109 T11063 T11064 amod homologous,regions
R8110 T11064 T11060 dobj regions,delineated
R8111 T11065 T11064 punct (,regions
R8112 T11066 T11064 appos A-E,regions
R8113 T11067 T11064 punct ),regions
R8114 T11068 T11064 prep between,regions
R8115 T11069 T11073 det the,promoters
R8116 T11070 T11073 amod human,promoters
R8117 T11071 T11070 cc and,human
R8118 T11072 T11070 conj murine,human
R8119 T11073 T11068 pobj promoters,between
R8120 T11074 T11064 punct (,regions
R8121 T11075 T11076 compound Fig.,2C
R8122 T11076 T11064 appos 2C,regions
R8123 T11077 T11064 punct ),regions
R8124 T11078 T11060 punct .,delineated
R8125 T11079 T11081 det The,promoter
R8126 T11080 T11081 amod proximal,promoter
R8127 T11081 T11095 nsubj promoter,exhibited
R8128 T11082 T11084 punct (,E
R8129 T11083 T11084 compound Region,E
R8130 T11084 T11081 appos E,promoter
R8131 T11085 T11084 punct ),E
R8132 T11086 T11081 punct ",",promoter
R8133 T11087 T11088 nsubj which,contains
R8134 T11088 T11081 relcl contains,promoter
R8135 T11089 T11093 det the,element
R8136 T11090 T11093 amod essential,element
R8137 T11091 T11093 compound LPS,element
R8138 T11092 T11093 compound response,element
R8139 T11093 T11088 dobj element,contains
R8140 T11094 T11081 punct ",",promoter
R8141 T11095 T11095 ROOT exhibited,exhibited
R8142 T11096 T11098 det the,homology
R8143 T11097 T11098 amod greatest,homology
R8144 T11098 T11095 dobj homology,exhibited
R8145 T11099 T11095 punct .,exhibited
R8146 T11100 T11101 amod Further,analysis
R8147 T11101 T11105 nsubj analysis,revealed
R8148 T11102 T11101 prep of,analysis
R8149 T11103 T11104 compound Region,E
R8150 T11104 T11102 pobj E,of
R8151 T11105 T11105 ROOT revealed,revealed
R8152 T11106 T11121 mark that,conserved
R8153 T11107 T11121 nsubjpass several,conserved
R8154 T11108 T11107 prep of,several
R8155 T11109 T11112 det the,elements
R8156 T11110 T11112 amod cis-acting,elements
R8157 T11111 T11112 amod regulatory,elements
R8158 T11112 T11108 pobj elements,of
R8159 T11113 T11112 acl defined,elements
R8160 T11114 T11113 prep in,defined
R8161 T11115 T11119 det the,promoter
R8162 T11116 T11119 amod human,promoter
R8163 T11117 T11119 compound SerpinB2,promoter
R8164 T11118 T11119 compound proximal,promoter
R8165 T11119 T11114 pobj promoter,in
R8166 T11120 T11121 auxpass are,conserved
R8167 T11121 T11105 ccomp conserved,revealed
R8168 T11122 T11121 prep in,conserved
R8169 T11123 T11126 det the,promoter
R8170 T11124 T11126 compound murine,promoter
R8171 T11125 T11126 compound SerpinB2,promoter
R8172 T11126 T11122 pobj promoter,in
R8173 T11127 T11126 punct (,promoter
R8174 T11128 T11129 nmod Fig.,3
R8175 T11129 T11126 appos 3,promoter
R8176 T11130 T11129 punct ),3
R8177 T11131 T11105 punct .,revealed
R8178 T11132 T11139 advmod Specifically,located
R8179 T11133 T11139 punct ",",located
R8180 T11134 T11137 det a,sequence
R8181 T11135 T11136 compound TATA,consensus
R8182 T11136 T11137 compound consensus,sequence
R8183 T11137 T11139 nsubjpass sequence,located
R8184 T11138 T11139 auxpass is,located
R8185 T11139 T11139 ROOT located,located
R8186 T11140 T11139 dobj 23,located
R8187 T11141 T11140 prep to,23
R8188 T11142 T11141 pobj 29bp,to
R8189 T11143 T11142 advmod upstream,29bp
R8190 T11144 T11143 prep from,upstream
R8191 T11145 T11148 det the,site
R8192 T11146 T11147 compound transcription,initiation
R8193 T11147 T11148 compound initiation,site
R8194 T11148 T11144 pobj site,from
R8195 T11149 T11148 punct ",",site
R8196 T11150 T11148 amod similar,site
R8197 T11151 T11150 prep to,similar
R8198 T11152 T11153 det the,position
R8199 T11153 T11151 pobj position,to
R8200 T11154 T11153 prep of,position
R8201 T11155 T11157 det the,box
R8202 T11156 T11157 compound TATA,box
R8203 T11157 T11154 pobj box,of
R8204 T11158 T11157 prep of,box
R8205 T11159 T11162 det the,gene
R8206 T11160 T11162 amod human,gene
R8207 T11161 T11162 compound SERPINB2,gene
R8208 T11162 T11158 pobj gene,of
R8209 T11163 T11165 nmod [,]
R8210 T11164 T11165 nummod 53,]
R8211 T11165 T11150 appos ],similar
R8212 T11166 T11165 punct ;,]
R8213 T11167 T11165 conj [,]
R8214 T11168 T11169 nummod 54,]
R8215 T11169 T11165 conj ],]
R8216 T11170 T11139 punct .,located
R8217 T11171 T11176 det A,protein
R8218 T11172 T11174 amod putative,enhancer
R8219 T11173 T11174 compound CCAAT,enhancer
R8220 T11174 T11176 nmod enhancer,protein
R8221 T11175 T11176 amod binding,protein
R8222 T11176 T11181 nsubj protein,is
R8223 T11177 T11176 punct (,protein
R8224 T11178 T11180 compound C/EBP,site
R8225 T11179 T11180 punct ),site
R8226 T11180 T11176 appos site,protein
R8227 T11181 T11181 ROOT is,is
R8228 T11182 T11181 acomp present,is
R8229 T11183 T11181 prep at,is
R8230 T11184 T11201 nsubjpass −,found
R8231 T11185 T11187 nummod 192,−
R8232 T11186 T11187 compound /,−
R8233 T11187 T11201 npadvmod −,found
R8234 T11188 T11187 nummod 203,−
R8235 T11189 T11201 punct ",",found
R8236 T11190 T11199 nummod two,sites
R8237 T11191 T11193 amod potential,protein
R8238 T11192 T11193 compound activator,protein
R8239 T11193 T11199 nmod protein,sites
R8240 T11194 T11193 nummod 1,protein
R8241 T11195 T11196 punct (,AP-1
R8242 T11196 T11193 appos AP-1,protein
R8243 T11197 T11193 punct ),protein
R8244 T11198 T11199 amod binding,sites
R8245 T11199 T11201 nsubjpass sites,found
R8246 T11200 T11201 auxpass are,found
R8247 T11201 T11181 advcl found,is
R8248 T11202 T11201 prep at,found
R8249 T11203 T11202 pobj nucleotides,at
R8250 T11204 T11207 meta −,−
R8251 T11205 T11206 compound 88,/
R8252 T11206 T11207 nummod /,−
R8253 T11207 T11226 nsubj −,is
R8254 T11208 T11207 nummod 94,−
R8255 T11209 T11207 cc and,−
R8256 T11210 T11213 nummod −,−
R8257 T11211 T11213 nummod 100,−
R8258 T11212 T11213 nummod /,−
R8259 T11213 T11207 conj −,−
R8260 T11214 T11213 nummod 106,−
R8261 T11215 T11213 punct ",",−
R8262 T11216 T11213 cc and,−
R8263 T11217 T11222 det a,element
R8264 T11218 T11222 amod putative,element
R8265 T11219 T11222 amod cyclic,element
R8266 T11220 T11222 compound AMP,element
R8267 T11221 T11222 compound response,element
R8268 T11222 T11213 conj element,−
R8269 T11223 T11224 punct (,CRE
R8270 T11224 T11222 appos CRE,element
R8271 T11225 T11222 punct ),element
R8272 T11226 T11181 conj is,is
R8273 T11227 T11226 acomp present,is
R8274 T11228 T11227 prep at,present
R8275 T11229 T11232 nummod −,−
R8276 T11230 T11232 nummod 172,−
R8277 T11231 T11232 punct /,−
R8278 T11232 T11228 pobj −,at
R8279 T11233 T11226 npadvmod 177,is
R8280 T11234 T11226 punct .,is
R8281 T11235 T11240 nsubj Both,are
R8282 T11236 T11235 prep of,Both
R8283 T11237 T11239 det the,sites
R8284 T11238 T11239 amod AP-1,sites
R8285 T11239 T11236 pobj sites,of
R8286 T11240 T11269 ccomp are,[
R8287 T11241 T11240 acomp identical,are
R8288 T11242 T11241 prep in,identical
R8289 T11243 T11242 pobj sequence,in
R8290 T11244 T11241 prep to,identical
R8291 T11245 T11244 pobj those,to
R8292 T11246 T11245 acl identified,those
R8293 T11247 T11246 prep in,identified
R8294 T11248 T11251 det the,promoter
R8295 T11249 T11251 amod human,promoter
R8296 T11250 T11251 compound SERPINB2,promoter
R8297 T11251 T11247 pobj promoter,in
R8298 T11252 T11240 punct ",",are
R8299 T11253 T11240 cc and,are
R8300 T11254 T11255 det the,CRE
R8301 T11255 T11256 nsubj CRE,differs
R8302 T11256 T11269 ccomp differs,[
R8303 T11257 T11256 prep in,differs
R8304 T11258 T11259 det the,identity
R8305 T11259 T11257 pobj identity,in
R8306 T11260 T11259 prep of,identity
R8307 T11261 T11264 det a,nucleotide
R8308 T11262 T11264 amod single,nucleotide
R8309 T11263 T11264 amod central,nucleotide
R8310 T11264 T11260 pobj nucleotide,of
R8311 T11265 T11267 nmod [,]
R8312 T11266 T11267 nummod 37,]
R8313 T11267 T11256 dobj ],differs
R8314 T11268 T11269 punct ;,[
R8315 T11269 T11269 ROOT [,[
R8316 T11270 T11271 nummod 55,]
R8317 T11271 T11269 dobj ],[
R8318 T11272 T11269 punct .,[
R8319 T11273 T11276 det A,box
R8320 T11274 T11276 compound consensus,box
R8321 T11275 T11276 compound E,box
R8322 T11276 T11276 ROOT box,box
R8323 T11277 T11276 punct (,box
R8324 T11278 T11312 advmod −,identified
R8325 T11279 T11312 npadvmod 538,identified
R8326 T11280 T11312 nsubjpass /,identified
R8327 T11281 T11312 nsubjpass −,identified
R8328 T11282 T11281 nummod 533,−
R8329 T11283 T11281 punct ),−
R8330 T11284 T11281 punct ",",−
R8331 T11285 T11287 advmod as,as
R8332 T11286 T11287 advmod well,as
R8333 T11287 T11281 cc as,−
R8334 T11288 T11290 amod potential,sites
R8335 T11289 T11290 amod binding,sites
R8336 T11290 T11281 conj sites,−
R8337 T11291 T11290 prep for,sites
R8338 T11292 T11312 nsubjpass PU,identified
R8339 T11293 T11292 nummod .1,PU
R8340 T11294 T11295 punct (,−
R8341 T11295 T11312 amod −,identified
R8342 T11296 T11297 compound 412,/
R8343 T11297 T11312 nsubjpass /,identified
R8344 T11298 T11312 oprd −,identified
R8345 T11299 T11298 nummod 407,−
R8346 T11300 T11298 punct ),−
R8347 T11301 T11298 cc and,−
R8348 T11302 T11298 conj Oct-1,−
R8349 T11303 T11304 punct (,−
R8350 T11304 T11312 csubjpass −,identified
R8351 T11305 T11306 compound 296,/
R8352 T11306 T11312 nsubjpass /,identified
R8353 T11307 T11312 nsubjpass −,identified
R8354 T11308 T11307 nummod 288,−
R8355 T11309 T11307 punct ),−
R8356 T11310 T11312 auxpass were,identified
R8357 T11311 T11312 advmod also,identified
R8358 T11312 T11276 acl identified,box
R8359 T11313 T11312 prep within,identified
R8360 T11314 T11317 det the,region
R8361 T11315 T11317 amod proximal,region
R8362 T11316 T11317 compound promoter,region
R8363 T11317 T11313 pobj region,within
R8364 T11318 T11319 punct (,Fig
R8365 T11319 T11317 appos Fig,region
R8366 T11320 T11321 punct .,S2
R8367 T11321 T11312 npadvmod S2,identified
R8368 T11322 T11321 punct ),S2
R8369 T11323 T11312 punct .,identified
R8370 T11324 T11325 amod Further,upstream
R8371 T11325 T11325 ROOT upstream,upstream
R8372 T11326 T11325 punct ",",upstream
R8373 T11327 T11331 det a,element
R8374 T11328 T11331 amod retinoic,element
R8375 T11329 T11330 compound acid,response
R8376 T11330 T11331 compound response,element
R8377 T11331 T11325 appos element,upstream
R8378 T11332 T11331 prep at,element
R8379 T11333 T11334 nummod −,1349
R8380 T11334 T11332 pobj 1349,at
R8381 T11335 T11336 compound /,−
R8382 T11336 T11331 nmod −,element
R8383 T11337 T11336 appos 1340,−
R8384 T11338 T11336 punct ",",−
R8385 T11339 T11342 det a,element
R8386 T11340 T11342 compound PAUSE-1,element
R8387 T11341 T11342 compound silencer,element
R8388 T11342 T11336 appos element,−
R8389 T11343 T11342 prep at,element
R8390 T11344 T11345 nummod −,1540
R8391 T11345 T11343 pobj 1540,at
R8392 T11346 T11347 compound /,−
R8393 T11347 T11342 nmod −,element
R8394 T11348 T11347 nummod 1528,−
R8395 T11349 T11347 cc and,−
R8396 T11350 T11354 det a,site
R8397 T11351 T11354 nmod NF-κB,site
R8398 T11352 T11354 nummod p65,site
R8399 T11353 T11354 amod binding,site
R8400 T11354 T11347 conj site,−
R8401 T11355 T11354 prep at,site
R8402 T11356 T11360 nummod −,1351
R8403 T11357 T11358 nummod 1342,/
R8404 T11358 T11359 compound /,−
R8405 T11359 T11360 compound −,1351
R8406 T11360 T11355 pobj 1351,at
R8407 T11361 T11362 punct (,Fig
R8408 T11362 T11354 appos Fig,site
R8409 T11363 T11362 punct .,Fig
R8410 T11364 T11362 nummod S2,Fig
R8411 T11365 T11362 punct ),Fig
R8412 T11366 T11369 auxpass are,conserved
R8413 T11367 T11369 advmod also,conserved
R8414 T11368 T11369 advmod well,conserved
R8415 T11369 T11325 conj conserved,upstream
R8416 T11370 T11372 nmod [,]
R8417 T11371 T11372 nummod 16,]
R8418 T11372 T11369 dobj ],conserved
R8419 T11373 T11372 punct ;,]
R8420 T11374 T11376 nmod [,]
R8421 T11375 T11376 nummod 30,]
R8422 T11376 T11372 conj ],]
R8423 T11377 T11376 punct ;,]
R8424 T11378 T11376 conj [,]
R8425 T11379 T11380 nummod 56,]
R8426 T11380 T11376 conj ],]
R8427 T11381 T11369 punct .,conserved
R8845 T12045 T12052 det A,Sites
R8846 T12046 T12052 nmod C/EBP,Sites
R8847 T12047 T12046 punct ",",C/EBP
R8848 T12048 T12046 conj CRE,C/EBP
R8849 T12049 T12048 cc and,CRE
R8850 T12050 T12052 nummod Two,Sites
R8851 T12051 T12052 amod AP-1,Sites
R8852 T12052 T12052 ROOT Sites,Sites
R8853 T12053 T12052 prep in,Sites
R8854 T12054 T12056 det the,SerpinB2
R8855 T12055 T12056 compound Murine,SerpinB2
R8856 T12056 T12053 pobj SerpinB2,in
R8857 T12057 T12058 compound Gene,Proximal
R8858 T12058 T12056 appos Proximal,SerpinB2
R8859 T12059 T12060 nsubj Promoter,are
R8860 T12060 T12060 ROOT are,are
R8861 T12061 T12060 acomp Essential,are
R8862 T12062 T12067 mark for,investigate
R8863 T12063 T12065 compound Optimal,Transcription
R8864 T12064 T12065 compound LPS-inducible,Transcription
R8865 T12065 T12067 nsubj Transcription,investigate
R8866 T12066 T12067 aux To,investigate
R8867 T12067 T12101 advcl investigate,targeted
R8868 T12068 T12069 amod regulatory,elements
R8869 T12069 T12067 dobj elements,investigate
R8870 T12070 T12069 prep between,elements
R8871 T12071 T12070 pobj −,between
R8872 T12072 T12071 conj 539,−
R8873 T12073 T12072 cc and,539
R8874 T12074 T12072 conj −,539
R8875 T12075 T12076 nummod 189,essential
R8876 T12076 T12071 conj essential,−
R8877 T12077 T12076 prep for,essential
R8878 T12078 T12079 amod LPS-inducible,transcription
R8879 T12079 T12077 pobj transcription,for
R8880 T12080 T12069 punct ",",elements
R8881 T12081 T12084 amod several,sites
R8882 T12082 T12084 nmod candidate,sites
R8883 T12083 T12084 amod binding,sites
R8884 T12084 T12069 conj sites,elements
R8885 T12085 T12084 prep for,sites
R8886 T12086 T12087 compound transcription,factors
R8887 T12087 T12085 pobj factors,for
R8888 T12088 T12089 advmod previously,reported
R8889 T12089 T12067 conj reported,investigate
R8890 T12090 T12091 aux to,mediate
R8891 T12091 T12089 xcomp mediate,reported
R8892 T12092 T12093 compound LPS-inducible,transcription
R8893 T12093 T12091 dobj transcription,mediate
R8894 T12094 T12093 prep in,transcription
R8895 T12095 T12096 amod other,genes
R8896 T12096 T12094 pobj genes,in
R8897 T12097 T12099 nmod [,]
R8898 T12098 T12099 nummod 57,]
R8899 T12099 T12101 nsubjpass ],targeted
R8900 T12100 T12101 auxpass were,targeted
R8901 T12101 T12101 ROOT targeted,targeted
R8902 T12102 T12101 agent by,targeted
R8903 T12103 T12104 compound nucleotide,substitution
R8904 T12104 T12102 pobj substitution,by
R8905 T12105 T12104 acl designed,substitution
R8906 T12106 T12107 aux to,disrupt
R8907 T12107 T12105 xcomp disrupt,designed
R8908 T12108 T12109 compound transcription,factor
R8909 T12109 T12107 dobj factor,disrupt
R8910 T12110 T12107 advmod binding,disrupt
R8911 T12111 T12110 prep to,binding
R8912 T12112 T12118 det the,gene
R8913 T12113 T12118 amod pGLmP-539,gene
R8914 T12114 T12118 nmod murine,gene
R8915 T12115 T12118 nmod SerpinB2,gene
R8916 T12116 T12118 amod promoter-luciferase,gene
R8917 T12117 T12118 compound reporter,gene
R8918 T12118 T12111 pobj gene,to
R8919 T12119 T12101 csubj construct,targeted
R8920 T12120 T12101 punct (,targeted
R8921 T12121 T12122 compound Fig.,4A
R8922 T12122 T12101 appos 4A,targeted
R8923 T12123 T12101 punct ),targeted
R8924 T12124 T12060 punct .,are
R8925 T12125 T12126 mark As,shown
R8926 T12126 T12169 advcl shown,decrease
R8927 T12127 T12126 prep in,shown
R8928 T12128 T12129 compound Fig.,4B
R8929 T12129 T12127 pobj 4B,in
R8930 T12130 T12129 punct ",",4B
R8931 T12131 T12129 appos mutation,4B
R8932 T12132 T12131 prep of,mutation
R8933 T12133 T12136 det the,box
R8934 T12134 T12136 compound consensus,box
R8935 T12135 T12136 compound E,box
R8936 T12136 T12132 pobj box,of
R8937 T12137 T12136 punct (,box
R8938 T12138 T12169 dep −,decrease
R8939 T12139 T12169 dep 538,decrease
R8940 T12140 T12169 dep /,decrease
R8941 T12141 T12169 dep −,decrease
R8942 T12142 T12141 nummod 533,−
R8943 T12143 T12141 punct ),−
R8944 T12144 T12146 punct ",",.1
R8945 T12145 T12146 compound PU,.1
R8946 T12146 T12141 appos .1,−
R8947 T12147 T12169 punct (,decrease
R8948 T12148 T12169 nsubj −,decrease
R8949 T12149 T12169 dep 412,decrease
R8950 T12150 T12169 dep /,decrease
R8951 T12151 T12169 nsubj −,decrease
R8952 T12152 T12151 nummod 407,−
R8953 T12153 T12151 punct ),−
R8954 T12154 T12151 punct ",",−
R8955 T12155 T12151 cc or,−
R8956 T12156 T12158 det the,Oct-1
R8957 T12157 T12158 compound variant,Oct-1
R8958 T12158 T12151 conj Oct-1,−
R8959 T12159 T12158 punct (,Oct-1
R8960 T12160 T12166 nmod −,site
R8961 T12161 T12162 compound 296,/
R8962 T12162 T12166 nummod /,site
R8963 T12163 T12166 nmod −,site
R8964 T12164 T12163 nummod 288,−
R8965 T12165 T12163 punct ),−
R8966 T12166 T12158 appos site,Oct-1
R8967 T12167 T12169 aux did,decrease
R8968 T12168 T12169 neg not,decrease
R8969 T12169 T12169 ROOT decrease,decrease
R8970 T12170 T12172 amod LPS-induced,activity
R8971 T12171 T12172 compound promoter,activity
R8972 T12172 T12169 dobj activity,decrease
R8973 T12173 T12169 punct .,decrease
R8974 T12174 T12206 prep In,construct
R8975 T12175 T12174 pobj contrast,In
R8976 T12176 T12206 punct ",",construct
R8977 T12177 T12206 nsubj mutation,construct
R8978 T12178 T12177 prep of,mutation
R8979 T12179 T12181 det the,site
R8980 T12180 T12181 compound C/EBP,site
R8981 T12181 T12178 pobj site,of
R8982 T12182 T12181 punct (,site
R8983 T12183 T12206 dep −,construct
R8984 T12184 T12206 nummod 203,construct
R8985 T12185 T12206 nummod /,construct
R8986 T12186 T12206 npadvmod −,construct
R8987 T12187 T12186 nummod 192,−
R8988 T12188 T12186 punct ),−
R8989 T12189 T12190 advmod completely,eliminated
R8990 T12190 T12206 amod eliminated,construct
R8991 T12191 T12192 compound promoter,activity
R8992 T12192 T12190 dobj activity,eliminated
R8993 T12193 T12192 punct ",",activity
R8994 T12194 T12192 amod similar,activity
R8995 T12195 T12194 prep to,similar
R8996 T12196 T12197 det the,levels
R8997 T12197 T12195 pobj levels,to
R8998 T12198 T12197 acl observed,levels
R8999 T12199 T12198 prep for,observed
R9000 T12200 T12205 det the,deletion
R9001 T12201 T12205 nmod −,deletion
R9002 T12202 T12201 nummod 189,−
R9003 T12203 T12205 nummod SerpinB2,deletion
R9004 T12204 T12205 compound promoter,deletion
R9005 T12205 T12199 pobj deletion,for
R9006 T12206 T12206 ROOT construct,construct
R9007 T12207 T12206 punct .,construct
R9008 T12208 T12212 nsubj Others,implicated
R9009 T12209 T12212 aux have,implicated
R9010 T12210 T12212 advmod also,implicated
R9011 T12211 T12212 advmod recently,implicated
R9012 T12212 T12212 ROOT implicated,implicated
R9013 T12213 T12215 det this,site
R9014 T12214 T12215 compound C/EBP,site
R9015 T12215 T12212 dobj site,implicated
R9016 T12216 T12212 prep in,implicated
R9017 T12217 T12218 amod LPS-induced,activation
R9018 T12218 T12216 pobj activation,in
R9019 T12219 T12218 prep of,activation
R9020 T12220 T12222 det the,gene
R9021 T12221 T12222 compound SerpinB2,gene
R9022 T12222 T12219 pobj gene,of
R9023 T12223 T12225 nmod [,]
R9024 T12224 T12225 nummod 58,]
R9025 T12225 T12212 npadvmod ],implicated
R9026 T12226 T12212 punct .,implicated
R9027 T12227 T12265 advcl Considering,mutated
R9028 T12228 T12230 det the,sequence
R9029 T12229 T12230 amod conserved,sequence
R9030 T12230 T12227 dobj sequence,Considering
R9031 T12231 T12230 cc and,sequence
R9032 T12232 T12230 conj position,sequence
R9033 T12233 T12232 prep of,position
R9034 T12234 T12235 det the,CRE
R9035 T12235 T12233 pobj CRE,of
R9036 T12236 T12232 cc and,position
R9037 T12237 T12239 nummod two,sites
R9038 T12238 T12239 amod AP-1,sites
R9039 T12239 T12232 conj sites,position
R9040 T12240 T12239 prep in,sites
R9041 T12241 T12244 det the,promoter
R9042 T12242 T12244 compound murine,promoter
R9043 T12243 T12244 compound SerpinB2,promoter
R9044 T12244 T12240 pobj promoter,in
R9045 T12245 T12244 cc and,promoter
R9046 T12246 T12248 poss their,involvement
R9047 T12247 T12248 amod demonstrated,involvement
R9048 T12248 T12232 conj involvement,position
R9049 T12249 T12248 prep in,involvement
R9050 T12250 T12251 det the,PMA-responsiveness
R9051 T12251 T12249 pobj PMA-responsiveness,in
R9052 T12252 T12251 prep of,PMA-responsiveness
R9053 T12253 T12256 det the,promoter
R9054 T12254 T12256 amod human,promoter
R9055 T12255 T12256 compound SERPINB2,promoter
R9056 T12256 T12252 pobj promoter,of
R9057 T12257 T12256 appos [,promoter
R9058 T12258 T12259 nummod 37,]
R9059 T12259 T12256 appos ],promoter
R9060 T12260 T12265 punct ",",mutated
R9061 T12261 T12262 det these,sites
R9062 T12262 T12265 nsubjpass sites,mutated
R9063 T12263 T12265 auxpass were,mutated
R9064 T12264 T12265 advmod also,mutated
R9065 T12265 T12265 ROOT mutated,mutated
R9066 T12266 T12265 agent by,mutated
R9067 T12267 T12268 compound nucleotide,substitution
R9068 T12268 T12266 pobj substitution,by
R9069 T12269 T12270 aux to,investigate
R9070 T12270 T12265 advcl investigate,mutated
R9071 T12271 T12273 mark whether,played
R9072 T12272 T12273 nsubj they,played
R9073 T12273 T12270 ccomp played,investigate
R9074 T12274 T12275 det a,role
R9075 T12275 T12273 dobj role,played
R9076 T12276 T12275 prep in,role
R9077 T12277 T12279 det the,response
R9078 T12278 T12279 compound LPS,response
R9079 T12279 T12276 pobj response,in
R9080 T12280 T12279 prep of,response
R9081 T12281 T12284 det the,promoter
R9082 T12282 T12284 compound murine,promoter
R9083 T12283 T12284 compound SerpinB2,promoter
R9084 T12284 T12280 pobj promoter,of
R9085 T12285 T12265 punct .,mutated
R9086 T12286 T12287 mark As,shown
R9087 T12287 T12325 advcl shown,reduced
R9088 T12288 T12287 prep in,shown
R9089 T12289 T12290 compound Fig.,4B
R9090 T12290 T12288 pobj 4B,in
R9091 T12291 T12290 punct ",",4B
R9092 T12292 T12290 appos mutation,4B
R9093 T12293 T12292 prep of,mutation
R9094 T12294 T12295 det the,CRE
R9095 T12295 T12293 pobj CRE,of
R9096 T12296 T12292 prep at,mutation
R9097 T12297 T12301 nummod −,172
R9098 T12298 T12300 nummod 177,−
R9099 T12299 T12300 compound /,−
R9100 T12300 T12301 nummod −,172
R9101 T12301 T12296 pobj 172,at
R9102 T12302 T12301 cc or,172
R9103 T12303 T12301 conj either,172
R9104 T12304 T12303 prep of,either
R9105 T12305 T12308 det the,sites
R9106 T12306 T12308 nummod two,sites
R9107 T12307 T12308 amod AP-1,sites
R9108 T12308 T12304 pobj sites,of
R9109 T12309 T12303 prep at,either
R9110 T12310 T12325 punct −,reduced
R9111 T12311 T12313 nummod 106,−
R9112 T12312 T12313 compound /,−
R9113 T12313 T12325 nsubj −,reduced
R9114 T12314 T12313 nummod 100,−
R9115 T12315 T12313 cc and,−
R9116 T12316 T12319 meta −,−
R9117 T12317 T12319 nummod 94,−
R9118 T12318 T12319 compound /,−
R9119 T12319 T12313 conj −,−
R9120 T12320 T12319 nummod 88,−
R9121 T12321 T12319 punct ",",−
R9122 T12322 T12325 advmod completely,reduced
R9123 T12323 T12322 cc or,completely
R9124 T12324 T12322 conj significantly,completely
R9125 T12325 T12325 ROOT reduced,reduced
R9126 T12326 T12328 amod LPS-inducible,activity
R9127 T12327 T12328 compound luciferase,activity
R9128 T12328 T12325 dobj activity,reduced
R9129 T12329 T12325 prep from,reduced
R9130 T12330 T12333 det the,promoter
R9131 T12331 T12333 compound murine,promoter
R9132 T12332 T12333 compound SerpinB2,promoter
R9133 T12333 T12329 pobj promoter,from
R9134 T12334 T12325 punct .,reduced
R9135 T12335 T12336 det These,data
R9136 T12336 T12337 nsubj data,show
R9137 T12337 T12337 ROOT show,show
R9138 T12338 T12353 mark that,are
R9139 T12339 T12341 det the,element
R9140 T12340 T12341 compound C/EBP,element
R9141 T12341 T12353 nsubj element,are
R9142 T12342 T12341 punct ",",element
R9143 T12343 T12345 advmod as,as
R9144 T12344 T12345 advmod well,as
R9145 T12345 T12341 cc as,element
R9146 T12346 T12347 det the,CRE
R9147 T12347 T12341 conj CRE,element
R9148 T12348 T12347 cc and,CRE
R9149 T12349 T12352 det both,elements
R9150 T12350 T12352 amod AP-1,elements
R9151 T12351 T12352 amod cis-acting,elements
R9152 T12352 T12347 conj elements,CRE
R9153 T12353 T12337 ccomp are,show
R9154 T12354 T12353 acomp critical,are
R9155 T12355 T12354 prep for,critical
R9156 T12356 T12357 amod LPS-inducible,transcription
R9157 T12357 T12355 pobj transcription,for
R9158 T12358 T12357 prep from,transcription
R9159 T12359 T12362 det the,promoter
R9160 T12360 T12362 nmod SerpinB2,promoter
R9161 T12361 T12362 amod proximal,promoter
R9162 T12362 T12358 pobj promoter,from
R9163 T12363 T12337 punct .,show
R9464 T12800 T12802 det The,Element
R9465 T12801 T12802 compound C/EBP,Element
R9466 T12802 T12804 nsubjpass Element,Bound
R9467 T12803 T12804 auxpass is,Bound
R9468 T12804 T12804 ROOT Bound,Bound
R9469 T12805 T12804 agent by,Bound
R9470 T12806 T12809 det an,Factor
R9471 T12807 T12809 compound LPS-induced,Factor
R9472 T12808 T12809 compound Nuclear,Factor
R9473 T12809 T12805 pobj Factor,by
R9474 T12810 T12809 prep from,Factor
R9475 T12811 T12815 nmod RAW,factor
R9476 T12812 T12811 nummod 264.7,RAW
R9477 T12813 T12815 compound Macrophages,factor
R9478 T12814 T12815 compound Nuclear,factor
R9479 T12815 T12810 pobj factor,from
R9480 T12816 T12804 oprd binding,Bound
R9481 T12817 T12816 prep to,binding
R9482 T12818 T12821 det the,element
R9483 T12819 T12821 amod putative,element
R9484 T12820 T12821 compound C/EBP,element
R9485 T12821 T12817 pobj element,to
R9486 T12822 T12830 punct (,investigated
R9487 T12823 T12830 dep −,investigated
R9488 T12824 T12830 nsubjpass 203,investigated
R9489 T12825 T12830 nsubjpass /,investigated
R9490 T12826 T12830 nsubjpass −,investigated
R9491 T12827 T12826 nummod 192,−
R9492 T12828 T12826 punct ),−
R9493 T12829 T12830 auxpass was,investigated
R9494 T12830 T12821 acl investigated,element
R9495 T12831 T12830 agent by,investigated
R9496 T12832 T12835 amod electrophoretic,assay
R9497 T12833 T12834 compound mobility,shift
R9498 T12834 T12835 compound shift,assay
R9499 T12835 T12831 pobj assay,by
R9500 T12836 T12835 punct (,assay
R9501 T12837 T12839 nmod EMSA,using
R9502 T12838 T12839 punct ),using
R9503 T12839 T12835 parataxis using,assay
R9504 T12840 T12841 amod nuclear,extracts
R9505 T12841 T12839 dobj extracts,using
R9506 T12842 T12839 prep from,using
R9507 T12843 T12846 amod untreated,RAW
R9508 T12844 T12843 cc and,untreated
R9509 T12845 T12843 conj LPS-treated,untreated
R9510 T12846 T12842 pobj RAW,from
R9511 T12847 T12848 nummod 264.7,macrophages
R9512 T12848 T12842 pobj macrophages,from
R9513 T12849 T12804 punct .,Bound
R9514 T12850 T12855 nummod Three,probes
R9515 T12851 T12855 amod different,probes
R9516 T12852 T12853 amod double,stranded
R9517 T12853 T12855 amod stranded,probes
R9518 T12854 T12855 compound oligonucleotide,probes
R9519 T12855 T12857 nsubjpass probes,used
R9520 T12856 T12857 auxpass were,used
R9521 T12857 T12857 ROOT used,used
R9522 T12858 T12857 prep for,used
R9523 T12859 T12858 pobj EMSA,for
R9524 T12860 T12857 punct ",",used
R9525 T12861 T12857 advcl representing,used
R9526 T12862 T12863 punct (,1
R9527 T12863 T12869 nummod 1,element
R9528 T12864 T12863 punct ),1
R9529 T12865 T12869 det the,element
R9530 T12866 T12869 amod putative,element
R9531 T12867 T12868 compound SerpinB2,C/EBP
R9532 T12868 T12869 compound C/EBP,element
R9533 T12869 T12861 dobj element,representing
R9534 T12870 T12884 punct (,element
R9535 T12871 T12884 nmod −,element
R9536 T12872 T12884 nummod 203,element
R9537 T12873 T12884 nummod /,element
R9538 T12874 T12884 nmod −,element
R9539 T12875 T12874 nummod 192,−
R9540 T12876 T12874 punct ),−
R9541 T12877 T12879 punct ",",2
R9542 T12878 T12879 punct (,2
R9543 T12879 T12884 meta 2,element
R9544 T12880 T12879 punct ),2
R9545 T12881 T12884 det a,element
R9546 T12882 T12884 amod mutant,element
R9547 T12883 T12884 compound SerpinB2,element
R9548 T12884 T12869 appos element,element
R9549 T12885 T12884 acl containing,element
R9550 T12886 T12888 det the,mutation
R9551 T12887 T12888 amod same,mutation
R9552 T12888 T12885 dobj mutation,containing
R9553 T12889 T12888 prep as,mutation
R9554 T12890 T12889 prep in,as
R9555 T12891 T12893 compound pGLmP-539mC,EBP
R9556 T12892 T12893 compound /,EBP
R9557 T12893 T12890 pobj EBP,in
R9558 T12894 T12893 cc and,EBP
R9559 T12895 T12896 punct (,3
R9560 T12896 T12903 meta 3,element
R9561 T12897 T12896 punct ),3
R9562 T12898 T12903 det the,element
R9563 T12899 T12903 nsubj rat,element
R9564 T12900 T12903 nmod albumin,element
R9565 T12901 T12903 nmod promoter,element
R9566 T12902 T12903 compound distal,element
R9567 T12903 T12908 amod element,region
R9568 T12904 T12903 nummod 1,element
R9569 T12905 T12903 punct (,element
R9570 T12906 T12903 appos DEI,element
R9571 T12907 T12903 punct ),element
R9572 T12908 T12888 conj region,mutation
R9573 T12909 T12908 acl containing,region
R9574 T12910 T12915 det a,site
R9575 T12911 T12912 amod high,affinity
R9576 T12912 T12915 nmod affinity,site
R9577 T12913 T12915 nmod C/EBP,site
R9578 T12914 T12915 amod binding,site
R9579 T12915 T12909 dobj site,containing
R9580 T12916 T12857 punct .,used
R9581 T12917 T12918 nummod Four,bands
R9582 T12918 T12928 nsubjpass bands,detected
R9583 T12919 T12918 prep of,bands
R9584 T12920 T12921 amod different,mobilities
R9585 T12921 T12919 pobj mobilities,of
R9586 T12922 T12918 punct ",",bands
R9587 T12923 T12918 acl representing,bands
R9588 T12924 T12926 amod DNA-nuclear,complexes
R9589 T12925 T12926 compound protein,complexes
R9590 T12926 T12923 dobj complexes,representing
R9591 T12927 T12928 auxpass were,detected
R9592 T12928 T12928 ROOT detected,detected
R9593 T12929 T12928 punct (,detected
R9594 T12930 T12931 compound Fig.,5A
R9595 T12931 T12928 npadvmod 5A,detected
R9596 T12932 T12928 punct ),detected
R9597 T12933 T12928 punct .,detected
R9598 T12934 T12934 ROOT Three,Three
R9599 T12935 T12934 prep of,Three
R9600 T12936 T12937 det these,bands
R9601 T12937 T12935 pobj bands,of
R9602 T12938 T12945 punct (,represent
R9603 T12939 T12945 nsubj I,represent
R9604 T12940 T12939 punct ",",I
R9605 T12941 T12939 appos II,I
R9606 T12942 T12943 punct ",",III
R9607 T12943 T12941 conj III,II
R9608 T12944 T12945 punct ),represent
R9609 T12945 T12934 parataxis represent,Three
R9610 T12946 T12945 dobj complexes,represent
R9611 T12947 T12946 prep with,complexes
R9612 T12948 T12950 amod single,DNA
R9613 T12949 T12950 amod stranded,DNA
R9614 T12950 T12947 pobj DNA,with
R9615 T12951 T12950 punct (,DNA
R9616 T12952 T12953 compound Fig.,5A
R9617 T12953 T12950 appos 5A,DNA
R9618 T12954 T12950 punct ),DNA
R9619 T12955 T12964 mark while,induced
R9620 T12956 T12957 det the,uppermost
R9621 T12957 T12962 nmod uppermost,complex
R9622 T12958 T12960 punct (,migrating
R9623 T12959 T12960 amod slowest,migrating
R9624 T12960 T12957 appos migrating,uppermost
R9625 T12961 T12957 punct ),uppermost
R9626 T12962 T12964 nsubjpass complex,induced
R9627 T12963 T12964 auxpass was,induced
R9628 T12964 T12945 advcl induced,represent
R9629 T12965 T12964 agent by,induced
R9630 T12966 T12965 pobj LPS,by
R9631 T12967 T12945 punct .,represent
R9632 T12968 T12970 det The,complex
R9633 T12969 T12970 amod LPS-inducible,complex
R9634 T12970 T12973 nsubjpass complex,detected
R9635 T12971 T12973 auxpass was,detected
R9636 T12972 T12973 neg not,detected
R9637 T12973 T12973 ROOT detected,detected
R9638 T12974 T12973 advcl using,detected
R9639 T12975 T12979 det the,probe
R9640 T12976 T12979 amod mutant,probe
R9641 T12977 T12979 compound C/EBP,probe
R9642 T12978 T12979 compound oligonucleotide,probe
R9643 T12979 T12974 dobj probe,using
R9644 T12980 T12973 cc and,detected
R9645 T12981 T12983 aux could,abolished
R9646 T12982 T12983 auxpass be,abolished
R9647 T12983 T12973 conj abolished,detected
R9648 T12984 T12983 agent by,abolished
R9649 T12985 T12986 det an,excess
R9650 T12986 T12984 pobj excess,by
R9651 T12987 T12986 prep of,excess
R9652 T12988 T12990 amod unlabeled,oligonucleotide
R9653 T12989 T12990 amod double-stranded,oligonucleotide
R9654 T12990 T12987 pobj oligonucleotide,of
R9655 T12991 T12983 punct ",",abolished
R9656 T12992 T12983 advcl carrying,abolished
R9657 T12993 T12996 preconj either,sequence
R9658 T12994 T12996 det the,sequence
R9659 T12995 T12996 amod same,sequence
R9660 T12996 T12992 dobj sequence,carrying
R9661 T12997 T12996 punct (,sequence
R9662 T12998 T12999 compound Fig.,5B
R9663 T12999 T12996 appos 5B,sequence
R9664 T13000 T12999 punct ",",5B
R9665 T13001 T12996 parataxis lanes,sequence
R9666 T13002 T13001 nummod 4,lanes
R9667 T13003 T13002 cc and,4
R9668 T13004 T13002 conj 5,4
R9669 T13005 T13004 punct ),5
R9670 T13006 T13002 cc or,4
R9671 T13007 T13008 det the,sequence
R9672 T13008 T13002 conj sequence,4
R9673 T13009 T13008 prep of,sequence
R9674 T13010 T13014 det a,site
R9675 T13011 T13014 amod known,site
R9676 T13012 T13014 nmod C/EBP,site
R9677 T13013 T13014 amod binding,site
R9678 T13014 T13009 pobj site,of
R9679 T13015 T12992 prep from,carrying
R9680 T13016 T13019 det the,promoter
R9681 T13017 T13019 compound rat,promoter
R9682 T13018 T13019 compound albumin,promoter
R9683 T13019 T13015 pobj promoter,from
R9684 T13020 T13019 punct (,promoter
R9685 T13021 T13022 compound Fig.,5B
R9686 T13022 T13019 appos 5B,promoter
R9687 T13023 T13019 punct ",",promoter
R9688 T13024 T13025 nmod lanes,8
R9689 T13025 T12992 npadvmod 8,carrying
R9690 T13026 T13025 cc and,8
R9691 T13027 T13025 conj 9,8
R9692 T13028 T12983 punct ),abolished
R9693 T13029 T12983 punct ",",abolished
R9694 T13030 T12983 cc but,abolished
R9695 T13031 T13032 neg not,by
R9696 T13032 T12983 conj by,abolished
R9697 T13033 T13035 det the,oligonucleotide
R9698 T13034 T13035 amod mutated,oligonucleotide
R9699 T13035 T13032 pobj oligonucleotide,by
R9700 T13036 T13038 punct (,5B
R9701 T13037 T13038 compound Fig.,5B
R9702 T13038 T13035 appos 5B,oligonucleotide
R9703 T13039 T13038 punct ",",5B
R9704 T13040 T13035 conj lanes,oligonucleotide
R9705 T13041 T13040 nummod 6,lanes
R9706 T13042 T13041 cc and,6
R9707 T13043 T13041 conj 7,6
R9708 T13044 T12983 punct ),abolished
R9709 T13045 T12973 punct .,detected
R9710 T13046 T13049 advmod Together,indicate
R9711 T13047 T13048 det these,data
R9712 T13048 T13049 nsubj data,indicate
R9713 T13049 T13049 ROOT indicate,indicate
R9714 T13050 T13062 mark that,binds
R9715 T13051 T13055 det the,site
R9716 T13052 T13055 amod putative,site
R9717 T13053 T13054 compound SerpinB2,C/EBP
R9718 T13054 T13055 compound C/EBP,site
R9719 T13055 T13062 nsubj site,binds
R9720 T13056 T13055 prep at,site
R9721 T13057 T13062 nummod −,binds
R9722 T13058 T13059 nummod 203,/
R9723 T13059 T13060 compound /,−
R9724 T13060 T13062 nsubj −,binds
R9725 T13061 T13060 nummod 192,−
R9726 T13062 T13049 ccomp binds,indicate
R9727 T13063 T13065 det a,complex
R9728 T13064 T13065 amod LPS-inducible,complex
R9729 T13065 T13062 dobj complex,binds
R9730 T13066 T13067 nsubj that,is
R9731 T13067 T13065 relcl is,complex
R9732 T13068 T13067 acomp likely,is
R9733 T13069 T13070 aux to,contain
R9734 T13070 T13068 xcomp contain,likely
R9735 T13071 T13072 det a,member
R9736 T13072 T13070 dobj member,contain
R9737 T13073 T13072 prep of,member
R9738 T13074 T13076 det the,family
R9739 T13075 T13076 compound C/EBP,family
R9740 T13076 T13073 pobj family,of
R9741 T13077 T13076 prep of,family
R9742 T13078 T13079 compound transcription,factors
R9743 T13079 T13077 pobj factors,of
R9744 T13080 T13049 punct .,indicate
R10013 T13593 T13595 amod C/EBP,β
R10014 T13594 T13595 punct -,β
R10015 T13595 T13596 nsubj β,is
R10016 T13596 T13596 ROOT is,is
R10017 T13597 T13600 det a,Factor
R10018 T13598 T13600 amod LPS-induced,Factor
R10019 T13599 T13600 compound Nuclear,Factor
R10020 T13600 T13622 nsubjpass Factor,known
R10021 T13601 T13602 nsubj that,Binds
R10022 T13602 T13600 relcl Binds,Factor
R10023 T13603 T13602 prep to,Binds
R10024 T13604 T13606 det the,Element
R10025 T13605 T13606 compound C/EBP,Element
R10026 T13606 T13603 pobj Element,to
R10027 T13607 T13606 prep of,Element
R10028 T13608 T13610 det the,Proximal
R10029 T13609 T13610 compound SerpinB2,Proximal
R10030 T13610 T13607 pobj Proximal,of
R10031 T13611 T13610 prep Promoter,Proximal
R10032 T13612 T13614 det The,family
R10033 T13613 T13614 compound C/EBP,family
R10034 T13614 T13606 appos family,Element
R10035 T13615 T13614 prep of,family
R10036 T13616 T13620 amod basic,factors
R10037 T13617 T13620 amod leucine,factors
R10038 T13618 T13619 compound zipper,transcription
R10039 T13619 T13620 compound transcription,factors
R10040 T13620 T13615 pobj factors,of
R10041 T13621 T13622 auxpass are,known
R10042 T13622 T13596 ccomp known,is
R10043 T13623 T13622 prep for,known
R10044 T13624 T13625 poss their,roles
R10045 T13625 T13623 pobj roles,for
R10046 T13626 T13622 prep in,known
R10047 T13627 T13628 amod cellular,differentiation
R10048 T13628 T13626 pobj differentiation,in
R10049 T13629 T13628 cc and,differentiation
R10050 T13630 T13628 conj inflammation,differentiation
R10051 T13631 T13633 nmod [,]
R10052 T13632 T13633 nummod 59,]
R10053 T13633 T13622 npadvmod ],known
R10054 T13634 T13596 punct .,is
R10055 T13635 T13645 advcl Consisting,homo
R10056 T13636 T13635 prep of,Consisting
R10057 T13637 T13638 nummod six,members
R10058 T13638 T13636 pobj members,of
R10059 T13639 T13645 punct ",",homo
R10060 T13640 T13643 det the,factors
R10061 T13641 T13643 compound C/EBP,factors
R10062 T13642 T13643 compound transcription,factors
R10063 T13643 T13645 nsubj factors,homo
R10064 T13644 T13645 aux can,homo
R10065 T13645 T13645 ROOT homo,homo
R10066 T13646 T13645 dobj −,homo
R10067 T13647 T13648 nummod /,heterodimerize
R10068 T13648 T13646 appos heterodimerize,−
R10069 T13649 T13648 cc and,heterodimerize
R10070 T13650 T13648 conj display,heterodimerize
R10071 T13651 T13655 amod similar,[
R10072 T13652 T13655 compound DNA,[
R10073 T13653 T13654 amod binding,specificities
R10074 T13654 T13655 nsubj specificities,[
R10075 T13655 T13650 dobj [,display
R10076 T13656 T13657 nummod 60,]
R10077 T13657 T13648 conj ],heterodimerize
R10078 T13658 T13645 punct .,homo
R10079 T13659 T13661 nummod Four,members
R10080 T13660 T13661 compound family,members
R10081 T13661 T13679 nsubj members,are
R10082 T13662 T13661 punct ",",members
R10083 T13663 T13665 compound C/EBP,α
R10084 T13664 T13665 punct -,α
R10085 T13665 T13679 nsubj α,are
R10086 T13666 T13665 punct ",",α
R10087 T13667 T13669 compound C/EBP,β
R10088 T13668 T13669 punct -,β
R10089 T13669 T13665 appos β,α
R10090 T13670 T13669 punct ",",β
R10091 T13671 T13673 compound C/EBP,δ
R10092 T13672 T13673 punct -,δ
R10093 T13673 T13669 appos δ,β
R10094 T13674 T13673 cc and,δ
R10095 T13675 T13677 compound C/EBP,ε
R10096 T13676 T13677 punct -,ε
R10097 T13677 T13673 conj ε,δ
R10098 T13678 T13679 punct ",",are
R10099 T13679 T13679 ROOT are,are
R10100 T13680 T13679 acomp present,are
R10101 T13681 T13680 prep in,present
R10102 T13682 T13683 amod myeloid,cells
R10103 T13683 T13681 pobj cells,in
R10104 T13684 T13679 cc and,are
R10105 T13685 T13679 conj play,are
R10106 T13686 T13687 amod different,roles
R10107 T13687 T13685 dobj roles,play
R10108 T13688 T13685 prep in,play
R10109 T13689 T13688 pcomp differentiating,in
R10110 T13690 T13691 amod myeloid,cells
R10111 T13691 T13689 dobj cells,differentiating
R10112 T13692 T13689 prep depending,differentiating
R10113 T13693 T13692 prep on,depending
R10114 T13694 T13696 det the,environment
R10115 T13695 T13696 amod extracellular,environment
R10116 T13696 T13693 pobj environment,on
R10117 T13697 T13699 nmod [,]
R10118 T13698 T13699 nummod 61,]
R10119 T13699 T13696 appos ],environment
R10120 T13700 T13679 punct .,are
R10121 T13701 T13702 aux To,determine
R10122 T13702 T13707 advcl determine,involved
R10123 T13703 T13705 det which,proteins
R10124 T13704 T13705 compound C/EBP,proteins
R10125 T13705 T13707 nsubjpass proteins,involved
R10126 T13706 T13707 auxpass were,involved
R10127 T13707 T13707 ROOT involved,involved
R10128 T13708 T13707 prep in,involved
R10129 T13709 T13710 det the,formation
R10130 T13710 T13708 pobj formation,in
R10131 T13711 T13710 prep of,formation
R10132 T13712 T13715 det the,complexes
R10133 T13713 T13715 amod different,complexes
R10134 T13714 T13715 compound nucleo-protein,complexes
R10135 T13715 T13711 pobj complexes,of
R10136 T13716 T13707 punct ",",involved
R10137 T13717 T13707 cc and,involved
R10138 T13718 T13719 advmod particularly,of
R10139 T13719 T13726 prep of,performed
R10140 T13720 T13722 det the,complex
R10141 T13721 T13722 compound LPS-inducible,complex
R10142 T13722 T13719 pobj complex,of
R10143 T13723 T13726 punct ",",performed
R10144 T13724 T13726 nsubjpass EMSA,performed
R10145 T13725 T13726 auxpass was,performed
R10146 T13726 T13707 conj performed,involved
R10147 T13727 T13726 prep after,performed
R10148 T13728 T13727 pcomp incubating,after
R10149 T13729 T13731 det the,complexes
R10150 T13730 T13731 amod nucleo-protein,complexes
R10151 T13731 T13728 dobj complexes,incubating
R10152 T13732 T13731 prep with,complexes
R10153 T13733 T13732 pobj antibodies,with
R10154 T13734 T13733 amod specific,antibodies
R10155 T13735 T13734 prep for,specific
R10156 T13736 T13735 pobj C/EBP,for
R10157 T13737 T13738 punct -,α
R10158 T13738 T13727 dep α,after
R10159 T13739 T13738 punct ",",α
R10160 T13740 T13742 compound C/EBP,β
R10161 T13741 T13742 punct -,β
R10162 T13742 T13738 conj β,α
R10163 T13743 T13742 punct ",",β
R10164 T13744 T13746 compound C/EBP,δ
R10165 T13745 T13746 punct -,δ
R10166 T13746 T13742 appos δ,β
R10167 T13747 T13746 cc and,δ
R10168 T13748 T13750 compound C/EBP,ε
R10169 T13749 T13750 punct -,ε
R10170 T13750 T13746 conj ε,δ
R10171 T13751 T13726 punct .,performed
R10172 T13752 T13753 det Each,antibody
R10173 T13753 T13754 nsubj antibody,detects
R10174 T13754 T13754 ROOT detects,detects
R10175 T13755 T13758 det the,region
R10176 T13756 T13758 amod carboxy-terminal,region
R10177 T13757 T13758 amod DNA-binding,region
R10178 T13758 T13754 dobj region,detects
R10179 T13759 T13758 prep of,region
R10180 T13760 T13762 det the,protein
R10181 T13761 T13762 amod respective,protein
R10182 T13762 T13759 pobj protein,of
R10183 T13763 T13754 punct ",",detects
R10184 T13764 T13773 mark so,expected
R10185 T13765 T13773 mark that,expected
R10186 T13766 T13773 nsubjpass pre-incubation,expected
R10187 T13767 T13766 prep of,pre-incubation
R10188 T13768 T13767 pobj antibody,of
R10189 T13769 T13766 prep with,pre-incubation
R10190 T13770 T13771 amod nuclear,extract
R10191 T13771 T13773 csubjpass extract,expected
R10192 T13772 T13773 auxpass is,expected
R10193 T13773 T13754 advcl expected,detects
R10194 T13774 T13775 aux to,abolish
R10195 T13775 T13773 xcomp abolish,expected
R10196 T13776 T13775 dobj DNA,abolish
R10197 T13777 T13775 oprd binding,abolish
R10198 T13778 T13775 prep by,abolish
R10199 T13779 T13780 compound EMSA,[
R10200 T13780 T13778 pobj [,by
R10201 T13781 T13782 nummod 62,]
R10202 T13782 T13780 appos ],[
R10203 T13783 T13754 punct .,detects
R10204 T13784 T13785 amod Only,antibodies
R10205 T13785 T13790 nsubj antibodies,abolished
R10206 T13786 T13785 prep against,antibodies
R10207 T13787 T13786 pobj C/EBP,against
R10208 T13788 T13790 punct -,abolished
R10209 T13789 T13790 nsubj β,abolished
R10210 T13790 T13790 ROOT abolished,abolished
R10211 T13791 T13792 det the,formation
R10212 T13792 T13790 dobj formation,abolished
R10213 T13793 T13792 prep of,formation
R10214 T13794 T13796 det the,complex
R10215 T13795 T13796 compound LPS-inducible,complex
R10216 T13796 T13793 pobj complex,of
R10217 T13797 T13799 punct (,5C
R10218 T13798 T13799 compound Fig.,5C
R10219 T13799 T13796 appos 5C,complex
R10220 T13800 T13799 punct ),5C
R10221 T13801 T13790 punct .,abolished
R10222 T13802 T13806 advcl Taken,show
R10223 T13803 T13802 advmod together,Taken
R10224 T13804 T13805 det these,data
R10225 T13805 T13806 nsubj data,show
R10226 T13806 T13806 ROOT show,show
R10227 T13807 T13822 mark that,contains
R10228 T13808 T13810 det the,complex
R10229 T13809 T13810 compound LPS-induced,complex
R10230 T13810 T13822 nsubj complex,contains
R10231 T13811 T13810 prep with,complex
R10232 T13812 T13814 det the,element
R10233 T13813 T13814 compound C/EBP,element
R10234 T13814 T13811 pobj element,with
R10235 T13815 T13814 punct (,element
R10236 T13816 T13822 preconj −,contains
R10237 T13817 T13822 dep 203,contains
R10238 T13818 T13822 dep /,contains
R10239 T13819 T13822 nsubj −,contains
R10240 T13820 T13819 nummod 192,−
R10241 T13821 T13819 punct ),−
R10242 T13822 T13806 ccomp contains,show
R10243 T13823 T13825 compound C/EBP,β
R10244 T13824 T13825 punct -,β
R10245 T13825 T13822 dobj β,contains
R10246 T13826 T13806 punct .,show
R10686 T14554 T14570 punct C/EBP,Macrophages
R10687 T14555 T14570 punct -,Macrophages
R10688 T14556 T14570 punct β,Macrophages
R10689 T14557 T14559 compound Mediates,Constitutive
R10690 T14558 T14559 preconj both,Constitutive
R10691 T14559 T14570 nmod Constitutive,Macrophages
R10692 T14560 T14559 cc and,Constitutive
R10693 T14561 T14564 amod LPS-induced,Expression
R10694 T14562 T14564 compound SerpinB2,Expression
R10695 T14563 T14564 compound mRNA,Expression
R10696 T14564 T14559 conj Expression,Constitutive
R10697 T14565 T14564 prep in,Expression
R10698 T14566 T14565 pobj MEFs,in
R10699 T14567 T14566 cc and,MEFs
R10700 T14568 T14566 conj Inflammatory,MEFs
R10701 T14569 T14570 compound Primary,Macrophages
R10702 T14570 T14572 nsubj Macrophages,investigate
R10703 T14571 T14572 aux To,investigate
R10704 T14572 T14590 advcl investigate,utilized
R10705 T14573 T14574 det the,importance
R10706 T14574 T14572 dobj importance,investigate
R10707 T14575 T14574 prep of,importance
R10708 T14576 T14578 compound C/EBP,β
R10709 T14577 T14578 punct -,β
R10710 T14578 T14575 pobj β,of
R10711 T14579 T14580 aux to,endogenous
R10712 T14580 T14583 amod endogenous,expression
R10713 T14581 T14582 compound SerpinB2,mRNA
R10714 T14582 T14583 compound mRNA,expression
R10715 T14583 T14572 dobj expression,investigate
R10716 T14584 T14572 prep in,investigate
R10717 T14585 T14584 pobj response,in
R10718 T14586 T14585 prep to,response
R10719 T14587 T14586 pobj LPS,to
R10720 T14588 T14590 punct ",",utilized
R10721 T14589 T14590 nsubj we,utilized
R10722 T14590 T14590 ROOT utilized,utilized
R10723 T14591 T14590 dobj C/EBP,utilized
R10724 T14592 T14591 punct -,C/EBP
R10725 T14593 T14591 appos β-null,C/EBP
R10726 T14594 T14598 punct (,−
R10727 T14595 T14598 compound Cebpb,−
R10728 T14596 T14598 compound −,−
R10729 T14597 T14598 compound /,−
R10730 T14598 T14593 appos −,β-null
R10731 T14599 T14598 punct ),−
R10732 T14600 T14593 cc and,β-null
R10733 T14601 T14602 amod wild-type,MEFs
R10734 T14602 T14593 conj MEFs,β-null
R10735 T14603 T14607 punct (,+
R10736 T14604 T14607 compound Cebpb,+
R10737 T14605 T14607 compound +,+
R10738 T14606 T14607 compound /,+
R10739 T14607 T14591 appos +,C/EBP
R10740 T14608 T14591 punct ),C/EBP
R10741 T14609 T14590 punct ",",utilized
R10742 T14610 T14615 mark since,express
R10743 T14611 T14615 nsubj RAW264,express
R10744 T14612 T14613 nummod .7,cells
R10745 T14613 T14615 nsubj cells,express
R10746 T14614 T14615 advmod constitutively,express
R10747 T14615 T14590 advcl express,utilized
R10748 T14616 T14619 amod endogenous,β
R10749 T14617 T14619 compound C/EBP,β
R10750 T14618 T14619 punct -,β
R10751 T14619 T14615 dobj β,express
R10752 T14620 T14590 punct .,utilized
R10753 T14621 T14623 advmod Wild-type,express
R10754 T14622 T14623 nsubj MEFs,express
R10755 T14623 T14623 ROOT express,express
R10756 T14624 T14625 amod low,levels
R10757 T14625 T14623 dobj levels,express
R10758 T14626 T14625 prep of,levels
R10759 T14627 T14628 compound endogenous,SerpinB2
R10760 T14628 T14626 pobj SerpinB2,of
R10761 T14629 T14628 cc and,SerpinB2
R10762 T14630 T14631 det the,absence
R10763 T14631 T14628 conj absence,SerpinB2
R10764 T14632 T14631 prep of,absence
R10765 T14633 T14635 compound C/EBP,β
R10766 T14634 T14635 punct -,β
R10767 T14635 T14632 pobj β,of
R10768 T14636 T14640 amod attenuated,expression
R10769 T14637 T14640 amod endogenous,expression
R10770 T14638 T14639 compound SerpinB2,mRNA
R10771 T14639 T14640 compound mRNA,expression
R10772 T14640 T14623 dobj expression,express
R10773 T14641 T14623 punct .,express
R10774 T14642 T14643 nsubj LPS,stimulated
R10775 T14643 T14643 ROOT stimulated,stimulated
R10776 T14644 T14645 det an,increase
R10777 T14645 T14643 dobj increase,stimulated
R10778 T14646 T14645 prep in,increase
R10779 T14647 T14648 compound SerpinB2,mRNA
R10780 T14648 T14649 compound mRNA,expression
R10781 T14649 T14646 pobj expression,in
R10782 T14650 T14649 prep in,expression
R10783 T14651 T14652 amod wild-type,MEFs
R10784 T14652 T14650 pobj MEFs,in
R10785 T14653 T14655 punct (,6A
R10786 T14654 T14655 compound Fig.,6A
R10787 T14655 T14645 appos 6A,increase
R10788 T14656 T14655 punct ),6A
R10789 T14657 T14643 punct ",",stimulated
R10790 T14658 T14665 mark whereas,dampened
R10791 T14659 T14662 amod LPS-stimulated,expression
R10792 T14660 T14661 compound SerpinB2,mRNA
R10793 T14661 T14662 compound mRNA,expression
R10794 T14662 T14665 nsubjpass expression,dampened
R10795 T14663 T14665 auxpass was,dampened
R10796 T14664 T14665 advmod significantly,dampened
R10797 T14665 T14643 advcl dampened,stimulated
R10798 T14666 T14665 prep in,dampened
R10799 T14667 T14668 compound Cebpb,−
R10800 T14668 T14666 pobj −,in
R10801 T14669 T14643 conj /,stimulated
R10802 T14670 T14671 nummod −,MEFs
R10803 T14671 T14669 dobj MEFs,/
R10804 T14672 T14669 prep as,/
R10805 T14673 T14672 prep compared,as
R10806 T14674 T14675 aux to,wild-type
R10807 T14675 T14673 xcomp wild-type,compared
R10808 T14676 T14643 punct .,stimulated
R10809 T14677 T14679 nsubj We,tested
R10810 T14678 T14679 advmod next,tested
R10811 T14679 T14679 ROOT tested,tested
R10812 T14680 T14685 mark if,seen
R10813 T14681 T14682 amod similar,effects
R10814 T14682 T14685 nsubjpass effects,seen
R10815 T14683 T14685 aux could,seen
R10816 T14684 T14685 auxpass be,seen
R10817 T14685 T14679 advcl seen,tested
R10818 T14686 T14685 prep in,seen
R10819 T14687 T14689 amod thioglycollate-elicited,macrophages
R10820 T14688 T14689 amod inflammatory,macrophages
R10821 T14689 T14686 pobj macrophages,in
R10822 T14690 T14697 prep in,knocked
R10823 T14691 T14690 pobj which,in
R10824 T14692 T14695 compound C/EBP,expression
R10825 T14693 T14694 punct -,β
R10826 T14694 T14695 compound β,expression
R10827 T14695 T14697 nsubjpass expression,knocked
R10828 T14696 T14697 auxpass was,knocked
R10829 T14697 T14679 conj knocked,tested
R10830 T14698 T14697 prt down,knocked
R10831 T14699 T14697 advcl using,knocked
R10832 T14700 T14702 nmod species-specific,shRNAs
R10833 T14701 T14702 amod lentiviral,shRNAs
R10834 T14702 T14699 dobj shRNAs,using
R10835 T14703 T14702 punct (,shRNAs
R10836 T14704 T14705 compound Fig.,6B
R10837 T14705 T14702 appos 6B,shRNAs
R10838 T14706 T14707 punct ",",left
R10839 T14707 T14702 parataxis left,shRNAs
R10840 T14708 T14702 punct ),shRNAs
R10841 T14709 T14697 punct .,knocked
R10842 T14710 T14712 mark As,observed
R10843 T14711 T14712 auxpass was,observed
R10844 T14712 T14725 advcl observed,decreased
R10845 T14713 T14712 prep in,observed
R10846 T14714 T14713 pobj MEFs,in
R10847 T14715 T14712 punct ",",observed
R10848 T14716 T14717 preconj both,constitutive
R10849 T14717 T14722 amod constitutive,expression
R10850 T14718 T14717 cc and,constitutive
R10851 T14719 T14717 conj LPS-induced,constitutive
R10852 T14720 T14722 compound SerpinB2,expression
R10853 T14721 T14722 compound mRNA,expression
R10854 T14722 T14725 nsubjpass expression,decreased
R10855 T14723 T14725 auxpass was,decreased
R10856 T14724 T14725 advmod significantly,decreased
R10857 T14725 T14725 ROOT decreased,decreased
R10858 T14726 T14725 prep in,decreased
R10859 T14727 T14726 pobj C/EBP,in
R10860 T14728 T14729 punct -,β-deficient
R10861 T14729 T14731 amod β-deficient,macrophages
R10862 T14730 T14731 amod inflammatory,macrophages
R10863 T14731 T14725 npadvmod macrophages,decreased
R10864 T14732 T14734 punct (,6B
R10865 T14733 T14734 compound Fig.,6B
R10866 T14734 T14731 appos 6B,macrophages
R10867 T14735 T14736 punct ",",right
R10868 T14736 T14734 appos right,6B
R10869 T14737 T14734 punct ),6B
R10870 T14738 T14725 punct .,decreased
R10871 T14739 T14740 det These,data
R10872 T14740 T14741 nsubj data,show
R10873 T14741 T14741 ROOT show,show
R10874 T14742 T14746 mark that,is
R10875 T14743 T14745 compound C/EBP,β
R10876 T14744 T14745 punct -,β
R10877 T14745 T14746 nsubj β,is
R10878 T14746 T14741 ccomp is,show
R10879 T14747 T14746 acomp critical,is
R10880 T14748 T14747 prep for,critical
R10881 T14749 T14748 pcomp mediating,for
R10882 T14750 T14753 amod constitutive,transcription
R10883 T14751 T14750 cc and,constitutive
R10884 T14752 T14750 conj LPS-inducible,constitutive
R10885 T14753 T14749 dobj transcription,mediating
R10886 T14754 T14753 prep of,transcription
R10887 T14755 T14757 amod endogenous,mRNA
R10888 T14756 T14757 compound SerpinB2,mRNA
R10889 T14757 T14754 pobj mRNA,of
R10890 T14758 T14741 punct .,show
R11277 T15329 T15332 punct C/EBP,Binds
R11278 T15330 T15331 punct -,β
R11279 T15331 T15332 nsubj β,Binds
R11280 T15332 T15332 ROOT Binds,Binds
R11281 T15333 T15336 det the,Proximal
R11282 T15334 T15336 compound Murine,Proximal
R11283 T15335 T15336 compound SerpinB2,Proximal
R11284 T15336 T15337 compound Proximal,Promoter
R11285 T15337 T15332 dobj Promoter,Binds
R11286 T15338 T15337 prep in,Promoter
R11287 T15339 T15338 pobj vivo,in
R11288 T15340 T15337 prep in,Promoter
R11289 T15341 T15343 det an,Manner
R11290 T15342 T15343 compound LPS-inducible,Manner
R11291 T15343 T15340 pobj Manner,in
R11292 T15344 T15345 nsubj We,investigated
R11293 T15345 T15337 relcl investigated,Promoter
R11294 T15346 T15348 det the,dynamics
R11295 T15347 T15348 amod temporal,dynamics
R11296 T15348 T15345 dobj dynamics,investigated
R11297 T15349 T15348 prep of,dynamics
R11298 T15350 T15353 compound C/EBP,recruitment
R11299 T15351 T15352 punct -,β
R11300 T15352 T15353 compound β,recruitment
R11301 T15353 T15349 pobj recruitment,of
R11302 T15354 T15345 prep to,investigated
R11303 T15355 T15358 det the,promoter
R11304 T15356 T15358 compound murine,promoter
R11305 T15357 T15358 compound SerpinB2,promoter
R11306 T15358 T15354 pobj promoter,to
R11307 T15359 T15345 prep in,investigated
R11308 T15360 T15359 pobj response,in
R11309 T15361 T15360 prep to,response
R11310 T15362 T15361 pobj LPS,to
R11311 T15363 T15362 prep in,LPS
R11312 T15364 T15363 pobj vivo,in
R11313 T15365 T15345 prep by,investigated
R11314 T15366 T15367 compound chromatin,immunoprecipitation
R11315 T15367 T15365 pobj immunoprecipitation,by
R11316 T15368 T15369 punct (,ChIP
R11317 T15369 T15367 appos ChIP,immunoprecipitation
R11318 T15370 T15369 punct ),ChIP
R11319 T15371 T15332 punct .,Binds
R11320 T15372 T15376 nsubjpass RAW,stimulated
R11321 T15373 T15374 nummod 264.7,cells
R11322 T15374 T15376 nsubjpass cells,stimulated
R11323 T15375 T15376 auxpass were,stimulated
R11324 T15376 T15376 ROOT stimulated,stimulated
R11325 T15377 T15376 prep with,stimulated
R11326 T15378 T15377 pobj LPS,with
R11327 T15379 T15376 prep for,stimulated
R11328 T15380 T15382 quantmod up,8
R11329 T15381 T15382 quantmod to,8
R11330 T15382 T15383 nummod 8,hrs
R11331 T15383 T15379 pobj hrs,for
R11332 T15384 T15387 punct ",",was
R11333 T15385 T15386 amod soluble,chromatin
R11334 T15386 T15387 nsubj chromatin,was
R11335 T15387 T15388 auxpass was,immunoprecipitated
R11336 T15388 T15376 conj immunoprecipitated,stimulated
R11337 T15389 T15388 prep with,immunoprecipitated
R11338 T15390 T15389 pobj antibodies,with
R11339 T15391 T15390 prep against,antibodies
R11340 T15392 T15394 amod DNA,proteins
R11341 T15393 T15394 amod binding,proteins
R11342 T15394 T15391 pobj proteins,against
R11343 T15395 T15388 punct ",",immunoprecipitated
R11344 T15396 T15388 cc and,immunoprecipitated
R11345 T15397 T15399 det the,DNA
R11346 T15398 T15399 amod enriched,DNA
R11347 T15399 T15406 nsubj DNA,using
R11348 T15400 T15399 acl amplified,DNA
R11349 T15401 T15400 agent by,amplified
R11350 T15402 T15403 preconj both,semi-quantitative
R11351 T15403 T15406 amod semi-quantitative,using
R11352 T15404 T15403 cc and,semi-quantitative
R11353 T15405 T15403 conj qPCR,semi-quantitative
R11354 T15406 T15388 conj using,immunoprecipitated
R11355 T15407 T15411 nummod SerpinB2,primers
R11356 T15408 T15409 amod proximal,promoter
R11357 T15409 T15411 nmod promoter,primers
R11358 T15410 T15411 amod specific,primers
R11359 T15411 T15406 dobj primers,using
R11360 T15412 T15411 punct (,primers
R11361 T15413 T15411 acl illustrated,primers
R11362 T15414 T15413 prep in,illustrated
R11363 T15415 T15416 amod fig.,4A
R11364 T15416 T15414 pobj 4A,in
R11365 T15417 T15411 punct ),primers
R11366 T15418 T15376 punct .,stimulated
R11367 T15419 T15420 det The,results
R11368 T15420 T15421 nsubj results,showed
R11369 T15421 T15421 ROOT showed,showed
R11370 T15422 T15426 mark that,is
R11371 T15423 T15425 compound C/EBP,β
R11372 T15424 T15425 punct -,β
R11373 T15425 T15426 nsubj β,is
R11374 T15426 T15421 ccomp is,showed
R11375 T15427 T15428 advmod constitutively,present
R11376 T15428 T15426 acomp present,is
R11377 T15429 T15428 prep at,present
R11378 T15430 T15432 det the,promoter
R11379 T15431 T15432 compound SerpinB2,promoter
R11380 T15432 T15429 pobj promoter,at
R11381 T15433 T15434 mark as,demonstrated
R11382 T15434 T15426 advcl demonstrated,is
R11383 T15435 T15434 agent by,demonstrated
R11384 T15436 T15437 poss its,association
R11385 T15437 T15435 pobj association,by
R11386 T15438 T15437 prep with,association
R11387 T15439 T15440 det the,promoter
R11388 T15440 T15438 pobj promoter,with
R11389 T15441 T15440 prep in,promoter
R11390 T15442 T15443 amod unstimulated,macrophages
R11391 T15443 T15441 pobj macrophages,in
R11392 T15444 T15434 cc and,demonstrated
R11393 T15445 T15434 conj increased,demonstrated
R11394 T15446 T15445 advmod temporally,increased
R11395 T15447 T15445 prep in,increased
R11396 T15448 T15447 pobj response,in
R11397 T15449 T15448 prep to,response
R11398 T15450 T15449 pobj LPS,to
R11399 T15451 T15445 advcl reaching,increased
R11400 T15452 T15451 prep as,reaching
R11401 T15453 T15455 amod much,10-fold
R11402 T15454 T15455 quantmod as,10-fold
R11403 T15455 T15452 pobj 10-fold,as
R11404 T15456 T15455 prep over,10-fold
R11405 T15457 T15458 amod unstimulated,cells
R11406 T15458 T15456 pobj cells,over
R11407 T15459 T15455 prep after,10-fold
R11408 T15460 T15461 nummod 8,hrs
R11409 T15461 T15459 pobj hrs,after
R11410 T15462 T15461 punct (,hrs
R11411 T15463 T15461 appos Fig.,hrs
R11412 T15464 T15463 nummod 7,Fig.
R11413 T15465 T15461 punct ),hrs
R11414 T15466 T15421 punct .,showed
R11415 T15467 T15476 mark Since,affect
R11416 T15468 T15476 nsubj changes,affect
R11417 T15469 T15468 prep in,changes
R11418 T15470 T15474 nmod C/EBP,states
R11419 T15471 T15472 punct -,β
R11420 T15472 T15474 nmod β,states
R11421 T15473 T15474 compound phosphorylation,states
R11422 T15474 T15469 pobj states,in
R11423 T15475 T15476 aux can,affect
R11424 T15476 T15498 advcl affect,investigated
R11425 T15477 T15479 compound C/EBP,β
R11426 T15478 T15479 punct -,β
R11427 T15479 T15480 poss β,ability
R11428 T15480 T15476 dobj ability,affect
R11429 T15481 T15482 aux to,transactivate
R11430 T15482 T15480 acl transactivate,ability
R11431 T15483 T15484 compound target,genes
R11432 T15484 T15482 dobj genes,transactivate
R11433 T15485 T15487 nmod [,]
R11434 T15486 T15487 nummod 38,]
R11435 T15487 T15482 dep ],transactivate
R11436 T15488 T15498 punct ;,investigated
R11437 T15489 T15498 advcl [,investigated
R11438 T15490 T15491 nummod 63,]
R11439 T15491 T15489 dobj ],[
R11440 T15492 T15491 punct ;,]
R11441 T15493 T15491 conj [,]
R11442 T15494 T15495 nummod 64,]
R11443 T15495 T15491 npadvmod ],]
R11444 T15496 T15498 punct ",",investigated
R11445 T15497 T15498 nsubj we,investigated
R11446 T15498 T15498 ROOT investigated,investigated
R11447 T15499 T15498 dobj recruitment,investigated
R11448 T15500 T15498 prep to,investigated
R11449 T15501 T15504 det the,promoter
R11450 T15502 T15504 nmod SerpinB2,promoter
R11451 T15503 T15504 amod proximal,promoter
R11452 T15504 T15500 pobj promoter,to
R11453 T15505 T15504 prep of,promoter
R11454 T15506 T15507 det the,T217
R11455 T15507 T15505 pobj T217,of
R11456 T15508 T15512 amod phosphorylated,isoform
R11457 T15509 T15512 compound C/EBP,isoform
R11458 T15510 T15511 punct -,β
R11459 T15511 T15512 compound β,isoform
R11460 T15512 T15498 dep isoform,investigated
R11461 T15513 T15516 punct (,βT217
R11462 T15514 T15516 punct p-C/EBP,βT217
R11463 T15515 T15516 punct -,βT217
R11464 T15516 T15512 appos βT217,isoform
R11465 T15517 T15516 punct ),βT217
R11466 T15518 T15512 punct ",",isoform
R11467 T15519 T15522 nsubjpass which,associated
R11468 T15520 T15522 aux has,associated
R11469 T15521 T15522 auxpass been,associated
R11470 T15522 T15512 relcl associated,isoform
R11471 T15523 T15522 prep with,associated
R11472 T15524 T15525 compound cell,survival
R11473 T15525 T15523 pobj survival,with
R11474 T15526 T15528 nmod [,]
R11475 T15527 T15528 nummod 65,]
R11476 T15528 T15525 appos ],survival
R11477 T15529 T15498 punct .,investigated
R11478 T15530 T15535 punct p-C/EBP,bound
R11479 T15531 T15532 punct -,βT217
R11480 T15532 T15535 nsubjpass βT217,bound
R11481 T15533 T15535 auxpass was,bound
R11482 T15534 T15535 advmod constitutively,bound
R11483 T15535 T15535 ROOT bound,bound
R11484 T15536 T15535 prep to,bound
R11485 T15537 T15540 det the,promoter
R11486 T15538 T15540 compound SerpinB2,promoter
R11487 T15539 T15540 compound proximal,promoter
R11488 T15540 T15536 pobj promoter,to
R11489 T15541 T15540 cc and,promoter
R11490 T15542 T15543 compound also,present
R11491 T15543 T15535 conj present,bound
R11492 T15544 T15543 prep after,present
R11493 T15545 T15546 nummod 1,hr
R11494 T15546 T15544 pobj hr,after
R11495 T15547 T15546 prep of,hr
R11496 T15548 T15549 compound LPS,stimulation
R11497 T15549 T15547 pobj stimulation,of
R11498 T15550 T15551 punct (,Fig.
R11499 T15551 T15546 appos Fig.,hr
R11500 T15552 T15551 nummod 7,Fig.
R11501 T15553 T15551 punct ),Fig.
R11502 T15554 T15498 punct .,investigated
R11503 T15555 T15555 ROOT In,In
R11504 T15556 T15555 pobj contrast,In
R11505 T15557 T15556 prep to,contrast
R11506 T15558 T15561 amod total,β
R11507 T15559 T15561 compound C/EBP,β
R11508 T15560 T15561 punct -,β
R11509 T15561 T15557 pobj β,to
R11510 T15562 T15561 punct ",",β
R11511 T15563 T15565 det the,affinity
R11512 T15564 T15565 amod binding,affinity
R11513 T15565 T15561 appos affinity,β
R11514 T15566 T15565 prep of,affinity
R11515 T15567 T15569 compound p-C/EBP,βT217
R11516 T15568 T15569 punct -,βT217
R11517 T15569 T15566 pobj βT217,of
R11518 T15570 T15565 prep for,affinity
R11519 T15571 T15574 det the,promoter
R11520 T15572 T15574 nmod SerpinB2,promoter
R11521 T15573 T15574 amod proximal,promoter
R11522 T15574 T15570 pobj promoter,for
R11523 T15575 T15574 acl diminished,promoter
R11524 T15576 T15575 prep with,diminished
R11525 T15577 T15578 compound LPS,stimulation
R11526 T15578 T15576 pobj stimulation,with
R11527 T15579 T15575 prep at,diminished
R11528 T15580 T15581 amod later,timepoints
R11529 T15581 T15579 pobj timepoints,at
R11530 T15582 T15581 punct (,timepoints
R11531 T15583 T15586 nummod 4,hrs
R11532 T15584 T15583 cc and,4
R11533 T15585 T15583 conj 8,4
R11534 T15586 T15581 appos hrs,timepoints
R11535 T15587 T15581 punct ),timepoints
R11536 T15588 T15589 punct (,Fig.
R11537 T15589 T15581 appos Fig.,timepoints
R11538 T15590 T15589 nummod 7,Fig.
R11539 T15591 T15589 punct ),Fig.
R11540 T15592 T15555 punct .,In
R11541 T15593 T15594 det These,data
R11542 T15594 T15595 nsubj data,show
R11543 T15595 T15595 ROOT show,show
R11544 T15596 T15598 det an,relationship
R11545 T15597 T15598 compound inverse,relationship
R11546 T15598 T15595 dobj relationship,show
R11547 T15599 T15598 prep between,relationship
R11548 T15600 T15599 pobj C/EBP,between
R11549 T15601 T15602 punct -,β
R11550 T15602 T15598 appos β,relationship
R11551 T15603 T15602 cc and,β
R11552 T15604 T15602 conj p-C/EBP,β
R11553 T15605 T15607 punct -,recruitment
R11554 T15606 T15607 compound βT217,recruitment
R11555 T15607 T15598 conj recruitment,relationship
R11556 T15608 T15607 punct ",",recruitment
R11557 T15609 T15607 cc and,recruitment
R11558 T15610 T15595 advcl indicate,show
R11559 T15611 T15618 mark that,be
R11560 T15612 T15615 amod T217-phosphorylated,β
R11561 T15613 T15615 compound C/EBP,β
R11562 T15614 T15615 punct -,β
R11563 T15615 T15618 nsubj β,be
R11564 T15616 T15618 aux may,be
R11565 T15617 T15618 neg not,be
R11566 T15618 T15610 ccomp be,indicate
R11567 T15619 T15618 acomp responsible,be
R11568 T15620 T15619 prep for,responsible
R11569 T15621 T15622 amod increased,transcription
R11570 T15622 T15620 pobj transcription,for
R11571 T15623 T15622 prep from,transcription
R11572 T15624 T15626 det the,promoter
R11573 T15625 T15626 compound SerpinB2,promoter
R11574 T15626 T15623 pobj promoter,from
R11575 T15627 T15618 prep in,be
R11576 T15628 T15627 pobj response,in
R11577 T15629 T15628 prep to,response
R11578 T15630 T15629 pobj LPS,to
R11579 T15631 T15595 punct .,show
R11807 T16106 T16106 ROOT C/EBP,C/EBP
R11808 T16107 T16109 punct -,Promotes
R11809 T16108 T16109 nsubj β,Promotes
R11810 T16109 T16109 ROOT Promotes,Promotes
R11811 T16110 T16115 amod LPS-inducible,Activity
R11812 T16111 T16113 compound Murine,Proximal
R11813 T16112 T16113 compound SerpinB2,Proximal
R11814 T16113 T16115 compound Proximal,Activity
R11815 T16114 T16115 compound Promoter,Activity
R11816 T16115 T16109 dobj Activity,Promotes
R11817 T16116 T16115 prep Since,Activity
R11818 T16117 T16119 compound C/EBP,β
R11819 T16118 T16119 punct -,β
R11820 T16119 T16120 compound β,binds
R11821 T16120 T16116 pobj binds,Since
R11822 T16121 T16109 prep to,Promotes
R11823 T16122 T16125 det the,promoter
R11824 T16123 T16125 nmod SerpinB2,promoter
R11825 T16124 T16125 amod proximal,promoter
R11826 T16125 T16121 pobj promoter,to
R11827 T16126 T16125 prep in,promoter
R11828 T16127 T16129 det an,manner
R11829 T16128 T16129 amod LPS-inducible,manner
R11830 T16129 T16126 pobj manner,in
R11831 T16130 T16131 preconj both,in
R11832 T16131 T16109 prep in,Promotes
R11833 T16132 T16131 pobj vitro,in
R11834 T16133 T16131 cc and,in
R11835 T16134 T16131 conj in,in
R11836 T16135 T16134 pobj vivo,in
R11837 T16136 T16138 punct ",",wanted
R11838 T16137 T16138 nsubj we,wanted
R11839 T16138 T16138 ROOT wanted,wanted
R11840 T16139 T16140 aux to,address
R11841 T16140 T16138 xcomp address,wanted
R11842 T16141 T16142 det the,question
R11843 T16142 T16140 dobj question,address
R11844 T16143 T16142 prep of,question
R11845 T16144 T16148 mark whether,was
R11846 T16145 T16147 compound C/EBP,β
R11847 T16146 T16147 punct -,β
R11848 T16147 T16148 nsubj β,was
R11849 T16148 T16143 pcomp was,of
R11850 T16149 T16151 det an,factor
R11851 T16150 T16151 amod essential,factor
R11852 T16151 T16148 attr factor,was
R11853 T16152 T16151 prep for,factor
R11854 T16153 T16152 pcomp driving,for
R11855 T16154 T16153 dobj transcription,driving
R11856 T16155 T16153 prep from,driving
R11857 T16156 T16158 det the,promoter
R11858 T16157 T16158 compound SerpinB2,promoter
R11859 T16158 T16155 pobj promoter,from
R11860 T16159 T16158 prep in,promoter
R11861 T16160 T16159 pobj cells,in
R11862 T16161 T16153 prep in,driving
R11863 T16162 T16161 pobj response,in
R11864 T16163 T16162 prep to,response
R11865 T16164 T16163 pobj LPS,to
R11866 T16165 T16138 punct .,wanted
R11867 T16166 T16167 det The,ability
R11868 T16167 T16182 nsubjpass ability,examined
R11869 T16168 T16167 prep of,ability
R11870 T16169 T16172 amod endogenous,β
R11871 T16170 T16172 compound C/EBP,β
R11872 T16171 T16172 punct -,β
R11873 T16172 T16168 pobj β,of
R11874 T16173 T16174 aux to,direct
R11875 T16174 T16167 acl direct,ability
R11876 T16175 T16174 dobj transcription,direct
R11877 T16176 T16174 prep from,direct
R11878 T16177 T16180 det the,promoter
R11879 T16178 T16180 nmod SerpinB2,promoter
R11880 T16179 T16180 amod proximal,promoter
R11881 T16180 T16176 pobj promoter,from
R11882 T16181 T16182 auxpass was,examined
R11883 T16182 T16182 ROOT examined,examined
R11884 T16183 T16182 agent by,examined
R11885 T16184 T16183 pobj transfection,by
R11886 T16185 T16184 prep of,transfection
R11887 T16186 T16191 det the,reporter
R11888 T16187 T16191 amod pGLmP-539,reporter
R11889 T16188 T16191 compound murine,reporter
R11890 T16189 T16191 compound SerpinB2,reporter
R11891 T16190 T16191 compound luciferase,reporter
R11892 T16191 T16185 pobj reporter,of
R11893 T16192 T16182 xcomp construct,examined
R11894 T16193 T16192 prep into,construct
R11895 T16194 T16195 compound Cebpb,+
R11896 T16195 T16193 pobj +,into
R11897 T16196 T16182 conj /,examined
R11898 T16197 T16196 dobj +,/
R11899 T16198 T16196 cc and,/
R11900 T16199 T16200 nsubj Cebpb,−
R11901 T16200 T16196 conj −,/
R11902 T16201 T16203 nummod /,MEFs
R11903 T16202 T16203 nummod −,MEFs
R11904 T16203 T16200 dobj MEFs,−
R11905 T16204 T16200 punct .,−
R11906 T16205 T16206 nsubj We,found
R11907 T16206 T16206 ROOT found,found
R11908 T16207 T16214 mark that,increased
R11909 T16208 T16211 amod LPS-stimulated,activity
R11910 T16209 T16211 amod SerpinB2,activity
R11911 T16210 T16211 compound promoter,activity
R11912 T16211 T16214 nsubjpass activity,increased
R11913 T16212 T16214 auxpass was,increased
R11914 T16213 T16214 advmod significantly,increased
R11915 T16214 T16206 ccomp increased,found
R11916 T16215 T16214 prep in,increased
R11917 T16216 T16217 compound Cebpb,+
R11918 T16217 T16215 pobj +,in
R11919 T16218 T16214 advcl /,increased
R11920 T16219 T16220 nummod +,MEFs
R11921 T16220 T16218 dobj MEFs,/
R11922 T16221 T16218 cc and,/
R11923 T16222 T16218 conj abrogated,/
R11924 T16223 T16222 prep in,abrogated
R11925 T16224 T16225 compound Cebpb,−
R11926 T16225 T16223 pobj −,in
R11927 T16226 T16218 conj /,/
R11928 T16227 T16228 nummod −,MEFs
R11929 T16228 T16226 dobj MEFs,/
R11930 T16229 T16228 punct (,MEFs
R11931 T16230 T16231 compound Fig.,8A
R11932 T16231 T16228 appos 8A,MEFs
R11933 T16232 T16228 punct ),MEFs
R11934 T16233 T16226 punct ",",/
R11935 T16234 T16226 advcl indicating,/
R11936 T16235 T16241 mark that,required
R11937 T16236 T16239 amod endogenous,β
R11938 T16237 T16239 compound C/EBP,β
R11939 T16238 T16239 punct -,β
R11940 T16239 T16241 nsubjpass β,required
R11941 T16240 T16241 auxpass is,required
R11942 T16241 T16234 ccomp required,indicating
R11943 T16242 T16241 prep for,required
R11944 T16243 T16247 amod LPS-induced,activity
R11945 T16244 T16247 amod SerpinB2,activity
R11946 T16245 T16247 amod proximal,activity
R11947 T16246 T16247 compound promoter,activity
R11948 T16247 T16242 pobj activity,for
R11949 T16248 T16206 punct .,found
R12706 T17651 T17660 nsubj Phosphorylation,Regulates
R12707 T17652 T17651 prep of,Phosphorylation
R12708 T17653 T17652 pobj C/EBP,of
R12709 T17654 T17655 punct -,β
R12710 T17655 T17651 conj β,Phosphorylation
R12711 T17656 T17655 prep at,β
R12712 T17657 T17656 pobj Serine,at
R12713 T17658 T17657 nummod 64,Serine
R12714 T17659 T17660 advmod negatively,Regulates
R12715 T17660 T17660 ROOT Regulates,Regulates
R12716 T17661 T17665 compound LPS-stimulated,Phosphorylation
R12717 T17662 T17665 compound SerpinB2,Phosphorylation
R12718 T17663 T17664 compound Promoter,Activity
R12719 T17664 T17665 compound Activity,Phosphorylation
R12720 T17665 T17660 dobj Phosphorylation,Regulates
R12721 T17666 T17665 prep of,Phosphorylation
R12722 T17667 T17666 pobj C/EBP,of
R12723 T17668 T17669 punct -,β
R12724 T17669 T17672 nsubjpass β,recognized
R12725 T17670 T17672 auxpass is,recognized
R12726 T17671 T17672 advmod well,recognized
R12727 T17672 T17660 conj recognized,Regulates
R12728 T17673 T17674 aux to,modulate
R12729 T17674 T17672 xcomp modulate,recognized
R12730 T17675 T17677 poss its,potential
R12731 T17676 T17677 compound transactivation,potential
R12732 T17677 T17674 dobj potential,modulate
R12733 T17678 T17680 nmod [,]
R12734 T17679 T17680 nummod 63,]
R12735 T17680 T17677 appos ],potential
R12736 T17681 T17660 punct .,Regulates
R12737 T17682 T17683 aux To,investigate
R12738 T17683 T17705 advcl investigate,co-expressed
R12739 T17684 T17688 nmod C/EBP,sites
R12740 T17685 T17686 punct -,β
R12741 T17686 T17688 nmod β,sites
R12742 T17687 T17688 compound phosphorylation,sites
R12743 T17688 T17683 dobj sites,investigate
R12744 T17689 T17691 nsubj that,be
R12745 T17690 T17691 aux may,be
R12746 T17691 T17688 relcl be,sites
R12747 T17692 T17691 acomp important,be
R12748 T17693 T17692 prep for,important
R12749 T17694 T17698 amod LPS-stimulated,activity
R12750 T17695 T17698 amod SerpinB2,activity
R12751 T17696 T17698 amod proximal,activity
R12752 T17697 T17698 compound promoter,activity
R12753 T17698 T17693 pobj activity,for
R12754 T17699 T17701 punct (,8B
R12755 T17700 T17701 compound Fig.,8B
R12756 T17701 T17688 appos 8B,sites
R12757 T17702 T17688 punct ),sites
R12758 T17703 T17705 punct ",",co-expressed
R12759 T17704 T17705 nsubj we,co-expressed
R12760 T17705 T17705 ROOT co-expressed,co-expressed
R12761 T17706 T17711 amod several,mutants
R12762 T17707 T17711 nmod C/EBP,mutants
R12763 T17708 T17709 punct -,β
R12764 T17709 T17711 nmod β,mutants
R12765 T17710 T17711 compound phospho-acceptor,mutants
R12766 T17711 T17705 dobj mutants,co-expressed
R12767 T17712 T17721 prep in,mutated
R12768 T17713 T17712 pobj which,in
R12769 T17714 T17716 det the,threonine
R12770 T17715 T17716 amod critical,threonine
R12771 T17716 T17719 poss threonine,residue
R12772 T17717 T17716 cc or,threonine
R12773 T17718 T17719 compound serine,residue
R12774 T17719 T17721 nsubjpass residue,mutated
R12775 T17720 T17721 auxpass was,mutated
R12776 T17721 T17711 relcl mutated,mutants
R12777 T17722 T17721 prep to,mutated
R12778 T17723 T17724 det an,alanine
R12779 T17724 T17722 pobj alanine,to
R12780 T17725 T17721 punct ",",mutated
R12781 T17726 T17721 prep along,mutated
R12782 T17727 T17726 prep with,along
R12783 T17728 T17733 det the,reporter
R12784 T17729 T17733 amod pGLmP-539,reporter
R12785 T17730 T17733 compound murine,reporter
R12786 T17731 T17733 compound SerpinB2,reporter
R12787 T17732 T17733 compound luciferase,reporter
R12788 T17733 T17727 pobj reporter,with
R12789 T17734 T17733 prep in,reporter
R12790 T17735 T17736 compound Cebpb,−
R12791 T17736 T17734 pobj −,in
R12792 T17737 T17721 advcl /,mutated
R12793 T17738 T17739 nummod −,MEFs
R12794 T17739 T17737 dobj MEFs,/
R12795 T17740 T17705 punct .,co-expressed
R12796 T17741 T17750 nsubj Re-expression,/
R12797 T17742 T17741 prep of,Re-expression
R12798 T17743 T17746 amod wild-type,β
R12799 T17744 T17746 compound C/EBP,β
R12800 T17745 T17746 punct -,β
R12801 T17746 T17742 pobj β,of
R12802 T17747 T17746 prep in,β
R12803 T17748 T17749 compound Cebpb,−
R12804 T17749 T17747 pobj −,in
R12805 T17750 T17750 ROOT /,/
R12806 T17751 T17752 nummod −,MEFs
R12807 T17752 T17750 dobj MEFs,/
R12808 T17753 T17754 advmod significantly,stimulated
R12809 T17754 T17750 conj stimulated,/
R12810 T17755 T17759 compound SerpinB2,expression
R12811 T17756 T17758 compound luciferase,gene
R12812 T17757 T17758 compound reporter,gene
R12813 T17758 T17759 compound gene,expression
R12814 T17759 T17754 dobj expression,stimulated
R12815 T17760 T17754 prep in,stimulated
R12816 T17761 T17762 det the,presence
R12817 T17762 T17760 pobj presence,in
R12818 T17763 T17762 prep of,presence
R12819 T17764 T17763 pobj LPS,of
R12820 T17765 T17754 prep by,stimulated
R12821 T17766 T17768 nmod ∼,fold
R12822 T17767 T17766 nummod 3,∼
R12823 T17768 T17765 pobj fold,by
R12824 T17769 T17768 punct (,fold
R12825 T17770 T17771 compound Fig.,8C
R12826 T17771 T17768 appos 8C,fold
R12827 T17772 T17773 punct ",",left
R12828 T17773 T17750 conj left,/
R12829 T17774 T17773 punct ),left
R12830 T17775 T17773 punct ",",left
R12831 T17776 T17773 advcl confirming,left
R12832 T17777 T17778 det the,importance
R12833 T17778 T17776 dobj importance,confirming
R12834 T17779 T17778 prep of,importance
R12835 T17780 T17782 compound C/EBP,β
R12836 T17781 T17782 punct -,β
R12837 T17782 T17779 pobj β,of
R12838 T17783 T17784 aux to,LPS-induced
R12839 T17784 T17782 relcl LPS-induced,β
R12840 T17785 T17787 compound SerpinB2,transcription
R12841 T17786 T17787 compound gene,transcription
R12842 T17787 T17784 dobj transcription,LPS-induced
R12843 T17788 T17773 punct .,left
R12844 T17789 T17804 nsubj Expression,/
R12845 T17790 T17789 prep of,Expression
R12846 T17791 T17792 det the,C/EBP
R12847 T17792 T17790 pobj C/EBP,of
R12848 T17793 T17794 punct -,β
R12849 T17794 T17796 amod β,mutant
R12850 T17795 T17796 compound phospho-acceptor,mutant
R12851 T17796 T17789 appos mutant,Expression
R12852 T17797 T17789 punct ",",Expression
R12853 T17798 T17799 compound C/EBP,βT217A
R12854 T17799 T17789 appos βT217A,Expression
R12855 T17800 T17789 punct ",",Expression
R12856 T17801 T17789 prep in,Expression
R12857 T17802 T17803 compound Cebpb,−
R12858 T17803 T17801 pobj −,in
R12859 T17804 T17804 ROOT /,/
R12860 T17805 T17806 nummod −,MEFs
R12861 T17806 T17810 nsubj MEFs,increase
R12862 T17807 T17810 aux did,increase
R12863 T17808 T17810 neg not,increase
R12864 T17809 T17810 advmod significantly,increase
R12865 T17810 T17804 ccomp increase,/
R12866 T17811 T17813 amod SerpinB2,activity
R12867 T17812 T17813 compound promoter,activity
R12868 T17813 T17810 dobj activity,increase
R12869 T17814 T17813 prep above,activity
R12870 T17815 T17814 pobj that,above
R12871 T17816 T17815 prep of,that
R12872 T17817 T17820 amod wild-type,β
R12873 T17818 T17820 compound C/EBP,β
R12874 T17819 T17820 punct -,β
R12875 T17820 T17816 pobj β,of
R12876 T17821 T17823 punct (,8C
R12877 T17822 T17823 compound Fig.,8C
R12878 T17823 T17810 npadvmod 8C,increase
R12879 T17824 T17823 punct ",",8C
R12880 T17825 T17823 appos right,8C
R12881 T17826 T17823 punct ),8C
R12882 T17827 T17810 punct ;,increase
R12883 T17828 T17810 advcl confirming,increase
R12884 T17829 T17837 mark that,is
R12885 T17830 T17837 nsubj phosphorylation,is
R12886 T17831 T17830 prep of,phosphorylation
R12887 T17832 T17831 pobj C/EBP,of
R12888 T17833 T17834 punct -,β
R12889 T17834 T17830 conj β,phosphorylation
R12890 T17835 T17830 prep at,phosphorylation
R12891 T17836 T17835 pobj T217,at
R12892 T17837 T17828 ccomp is,confirming
R12893 T17838 T17837 neg not,is
R12894 T17839 T17841 det a,factor
R12895 T17840 T17841 amod major,factor
R12896 T17841 T17837 attr factor,is
R12897 T17842 T17841 prep in,factor
R12898 T17843 T17844 det the,regulation
R12899 T17844 T17842 pobj regulation,in
R12900 T17845 T17844 prep of,regulation
R12901 T17846 T17848 compound SerpinB2,activity
R12902 T17847 T17848 compound promoter,activity
R12903 T17848 T17845 pobj activity,of
R12904 T17849 T17841 prep in,factor
R12905 T17850 T17849 pobj response,in
R12906 T17851 T17850 prep to,response
R12907 T17852 T17851 pobj LPS,to
R12908 T17853 T17804 punct .,/
R12909 T17854 T17857 punct C/EBP,contains
R12910 T17855 T17856 punct -,β
R12911 T17856 T17857 nsubj β,contains
R12912 T17857 T17857 ROOT contains,contains
R12913 T17858 T17860 amod additional,sites
R12914 T17859 T17860 amod phosphorylation,sites
R12915 T17860 T17857 dobj sites,contains
R12916 T17861 T17860 punct ",",sites
R12917 T17862 T17864 compound C/EBP,βT188
R12918 T17863 T17864 punct -,βT188
R12919 T17864 T17860 appos βT188,sites
R12920 T17865 T17864 cc and,βT188
R12921 T17866 T17864 conj C/EBP,βT188
R12922 T17867 T17864 punct -,βT188
R12923 T17868 T17864 conj βS64,βT188
R12924 T17869 T17868 punct (,βS64
R12925 T17870 T17871 compound Fig.,8B
R12926 T17871 T17868 appos 8B,βS64
R12927 T17872 T17868 punct ),βS64
R12928 T17873 T17864 punct ",",βT188
R12929 T17874 T17877 nsubjpass which,involved
R12930 T17875 T17877 aux may,involved
R12931 T17876 T17877 auxpass be,involved
R12932 T17877 T17864 relcl involved,βT188
R12933 T17878 T17877 prep in,involved
R12934 T17879 T17878 pcomp modulating,in
R12935 T17880 T17879 dobj C/EBP,modulating
R12936 T17881 T17880 punct -,C/EBP
R12937 T17882 T17885 amod β-dependent,transcription
R12938 T17883 T17885 compound SerpinB2,transcription
R12939 T17884 T17885 compound gene,transcription
R12940 T17885 T17880 appos transcription,C/EBP
R12941 T17886 T17857 punct .,contains
R12942 T17887 T17891 punct C/EBP,implicated
R12943 T17888 T17889 punct -,βT188
R12944 T17889 T17891 nsubjpass βT188,implicated
R12945 T17890 T17891 auxpass is,implicated
R12946 T17891 T17891 ROOT implicated,implicated
R12947 T17892 T17891 prep in,implicated
R12948 T17893 T17892 pcomp regulating,in
R12949 T17894 T17893 dobj DAPK1,regulating
R12950 T17895 T17894 punct ",",DAPK1
R12951 T17896 T17898 det an,gene
R12952 T17897 T17898 amod IFNγ-inducible,gene
R12953 T17898 T17894 appos gene,DAPK1
R12954 T17899 T17898 acl involved,gene
R12955 T17900 T17899 prep in,involved
R12956 T17901 T17902 det the,regulation
R12957 T17902 T17900 pobj regulation,in
R12958 T17903 T17902 prep of,regulation
R12959 T17904 T17905 compound cell,cycle
R12960 T17905 T17903 pobj cycle,of
R12961 T17906 T17902 cc and,regulation
R12962 T17907 T17908 compound apoptosis,[
R12963 T17908 T17910 nmod [,]
R12964 T17909 T17910 nummod 38,]
R12965 T17910 T17898 appos ],gene
R12966 T17911 T17912 punct ",",processes
R12967 T17912 T17912 ROOT processes,processes
R12968 T17913 T17919 prep with,associated
R12969 T17914 T17913 pobj which,with
R12970 T17915 T17919 nsubj SerpinB2,associated
R12971 T17916 T17919 aux has,associated
R12972 T17917 T17919 advmod also,associated
R12973 T17918 T17919 auxpass been,associated
R12974 T17919 T17912 relcl associated,processes
R12975 T17920 T17922 nmod [,]
R12976 T17921 T17922 nummod 17,]
R12977 T17922 T17919 dobj ],associated
R12978 T17923 T17912 punct .,processes
R12979 T17924 T17926 punct C/EBP,βS64
R12980 T17925 T17926 punct -,βS64
R12981 T17926 T17927 nsubj βS64,is
R12982 T17927 T17927 ROOT is,is
R12983 T17928 T17927 acomp important,is
R12984 T17929 T17928 prep for,important
R12985 T17930 T17931 amod LPS-induced,transcription
R12986 T17931 T17929 pobj transcription,for
R12987 T17932 T17931 prep of,transcription
R12988 T17933 T17934 det the,cytokines
R12989 T17934 T17935 compound cytokines,IL-6
R12990 T17935 T17932 pobj IL-6,of
R12991 T17936 T17935 cc and,IL-6
R12992 T17937 T17938 compound MCP-1,[
R12993 T17938 T17935 conj [,IL-6
R12994 T17939 T17940 nummod 64,]
R12995 T17940 T17935 conj ],IL-6
R12996 T17941 T17927 punct .,is
R12997 T17942 T17946 advmod Similarly,induced
R12998 T17943 T17946 punct ",",induced
R12999 T17944 T17946 nsubjpass SerpinB2,induced
R13000 T17945 T17946 auxpass is,induced
R13001 T17946 T17946 ROOT induced,induced
R13002 T17947 T17946 agent by,induced
R13003 T17948 T17947 pobj LPS,by
R13004 T17949 T17946 cc and,induced
R13005 T17950 T17946 conj regulated,induced
R13006 T17951 T17950 prep in,regulated
R13007 T17952 T17953 det a,manner
R13008 T17953 T17951 pobj manner,in
R13009 T17954 T17953 amod similar,manner
R13010 T17955 T17954 prep to,similar
R13011 T17956 T17955 pobj cytokines,to
R13012 T17957 T17959 nmod [,]
R13013 T17958 T17959 nummod 29,]
R13014 T17959 T17955 pobj ],to
R13015 T17960 T17946 punct .,induced
R13016 T17961 T17980 prep Given,investigated
R13017 T17962 T17963 det the,similarities
R13018 T17963 T17961 pobj similarities,Given
R13019 T17964 T17963 prep in,similarities
R13020 T17965 T17967 det the,significance
R13021 T17966 T17967 amod functional,significance
R13022 T17967 T17964 pobj significance,in
R13023 T17968 T17967 prep of,significance
R13024 T17969 T17971 det these,isoforms
R13025 T17970 T17971 amod phospho-specific,isoforms
R13026 T17971 T17968 pobj isoforms,of
R13027 T17972 T17971 prep of,isoforms
R13028 T17973 T17975 compound C/EBP,β
R13029 T17974 T17975 punct -,β
R13030 T17975 T17963 appos β,similarities
R13031 T17976 T17975 cc and,β
R13032 T17977 T17975 conj SerpinB2,β
R13033 T17978 T17980 punct ",",investigated
R13034 T17979 T17980 nsubj we,investigated
R13035 T17980 T17980 ROOT investigated,investigated
R13036 T17981 T17986 mark whether,play
R13037 T17982 T17984 det these,sites
R13038 T17983 T17984 amod phospho-acceptor,sites
R13039 T17984 T17986 nsubj sites,play
R13040 T17985 T17986 aux may,play
R13041 T17986 T17980 ccomp play,investigated
R13042 T17987 T17988 det a,role
R13043 T17988 T17986 dobj role,play
R13044 T17989 T17988 prep in,role
R13045 T17990 T17992 compound SerpinB2,expression
R13046 T17991 T17992 compound gene,expression
R13047 T17992 T17989 pobj expression,in
R13048 T17993 T17980 punct .,investigated
R13049 T17994 T17996 punct C/EBP,βT188A-transfected
R13050 T17995 T17996 punct -,βT188A-transfected
R13051 T17996 T17997 compound βT188A-transfected,MEFs
R13052 T17997 T17998 nsubj MEFs,exhibited
R13053 T17998 T17998 ROOT exhibited,exhibited
R13054 T17999 T18001 nummod SerpinB2,activity
R13055 T18000 T18001 compound promoter,activity
R13056 T18001 T17998 dobj activity,exhibited
R13057 T18002 T18001 amod similar,activity
R13058 T18003 T18002 prep to,similar
R13059 T18004 T18003 pobj that,to
R13060 T18005 T18004 prep of,that
R13061 T18006 T18010 amod wild-type,MEFs
R13062 T18007 T18009 amod C/EBP,β-transfected
R13063 T18008 T18009 punct -,β-transfected
R13064 T18009 T18010 amod β-transfected,MEFs
R13065 T18010 T18005 pobj MEFs,of
R13066 T18011 T17998 punct ",",exhibited
R13067 T18012 T18019 mark whereas,potentiated
R13068 T18013 T18014 det the,expression
R13069 T18014 T18019 nsubj expression,potentiated
R13070 T18015 T18014 prep of,expression
R13071 T18016 T18015 pobj C/EBP,of
R13072 T18017 T18018 punct -,βS64A
R13073 T18018 T18014 appos βS64A,expression
R13074 T18019 T17998 advcl potentiated,exhibited
R13075 T18020 T18022 nummod SerpinB2,activity
R13076 T18021 T18022 compound promoter,activity
R13077 T18022 T18019 dobj activity,potentiated
R13078 T18023 T18019 prep in,potentiated
R13079 T18024 T18023 pobj response,in
R13080 T18025 T18024 prep to,response
R13081 T18026 T18025 pobj LPS,to
R13082 T18027 T18029 punct (,8C
R13083 T18028 T18029 compound Fig.,8C
R13084 T18029 T18026 appos 8C,LPS
R13085 T18030 T18026 punct ",",LPS
R13086 T18031 T18026 appos right,LPS
R13087 T18032 T18026 punct ),LPS
R13088 T18033 T17998 punct .,exhibited
R13089 T18034 T18035 det These,data
R13090 T18035 T18036 nsubj data,suggest
R13091 T18036 T18036 ROOT suggest,suggest
R13092 T18037 T18048 mark that,regulate
R13093 T18038 T18048 nsubj phosphorylation,regulate
R13094 T18039 T18038 prep of,phosphorylation
R13095 T18040 T18039 pobj C/EBP,of
R13096 T18041 T18042 punct -,β
R13097 T18042 T18038 conj β,phosphorylation
R13098 T18043 T18038 prep at,phosphorylation
R13099 T18044 T18045 nummod S64,acts
R13100 T18045 T18043 pobj acts,at
R13101 T18046 T18048 aux to,regulate
R13102 T18047 T18048 advmod negatively,regulate
R13103 T18048 T18036 ccomp regulate,suggest
R13104 T18049 T18052 nmod SerpinB2,activity
R13105 T18050 T18052 amod proximal,activity
R13106 T18051 T18052 compound promoter,activity
R13107 T18052 T18048 dobj activity,regulate
R13108 T18053 T18036 punct .,suggest
R14983 T21122 T21123 nsubj Macrophages,are
R14984 T21123 T21123 ROOT are,are
R14985 T21124 T21125 amod key,mediators
R14986 T21125 T21123 attr mediators,are
R14987 T21126 T21125 prep of,mediators
R14988 T21127 T21130 det the,response
R14989 T21128 T21130 amod innate,response
R14990 T21129 T21130 amod immune,response
R14991 T21130 T21126 pobj response,of
R14992 T21131 T21123 punct ",",are
R14993 T21132 T21123 cc and,are
R14994 T21133 T21134 advmod consequently,provide
R14995 T21134 T21123 conj provide,are
R14996 T21135 T21137 det the,line
R14997 T21136 T21137 amod first,line
R14998 T21137 T21134 dobj line,provide
R14999 T21138 T21137 prep of,line
R15000 T21139 T21138 pobj defense,of
R15001 T21140 T21137 prep against,line
R15002 T21141 T21140 pobj pathogens,against
R15003 T21142 T21123 punct .,are
R15004 T21143 T21144 amod Pro-inflammatory,stimuli
R15005 T21144 T21153 nsubj stimuli,stimulate
R15006 T21145 T21144 punct ",",stimuli
R15007 T21146 T21147 amod such,as
R15008 T21147 T21144 prep as,stimuli
R15009 T21148 T21151 det the,LPS
R15010 T21149 T21151 amod bacterial,LPS
R15011 T21150 T21151 compound endotoxin,LPS
R15012 T21151 T21147 pobj LPS,as
R15013 T21152 T21144 punct ",",stimuli
R15014 T21153 T21153 ROOT stimulate,stimulate
R15015 T21154 T21153 dobj macrophages,stimulate
R15016 T21155 T21156 aux to,mount
R15017 T21156 T21153 advcl mount,stimulate
R15018 T21157 T21159 det an,response
R15019 T21158 T21159 amod anti-pathogenic,response
R15020 T21159 T21156 dobj response,mount
R15021 T21160 T21161 nsubj which,involves
R15022 T21161 T21159 relcl involves,response
R15023 T21162 T21163 amod massive,induction
R15024 T21163 T21161 dobj induction,involves
R15025 T21164 T21163 prep of,induction
R15026 T21165 T21167 det the,factor
R15027 T21166 T21167 amod pro-survival,factor
R15028 T21167 T21164 pobj factor,of
R15029 T21168 T21163 conj SerpinB2,induction
R15030 T21169 T21153 punct .,stimulate
R15031 T21170 T21173 nsubjpass SerpinB2,induced
R15032 T21171 T21173 auxpass is,induced
R15033 T21172 T21173 advmod transcriptionally,induced
R15034 T21173 T21173 ROOT induced,induced
R15035 T21174 T21173 agent by,induced
R15036 T21175 T21176 compound cross,talk
R15037 T21176 T21174 pobj talk,by
R15038 T21177 T21176 prep between,talk
R15039 T21178 T21181 det the,NF-κB
R15040 T21179 T21181 compound IKKβ,NF-κB
R15041 T21180 T21181 compound /,NF-κB
R15042 T21181 T21177 pobj NF-κB,between
R15043 T21182 T21181 cc and,NF-κB
R15044 T21183 T21181 conj p38MAPK,NF-κB
R15045 T21184 T21176 acl signaling,talk
R15046 T21185 T21184 dobj modules,signaling
R15047 T21186 T21184 prep in,signaling
R15048 T21187 T21186 pobj response,in
R15049 T21188 T21187 prep to,response
R15050 T21189 T21188 pobj LPS,to
R15051 T21190 T21192 nmod [,]
R15052 T21191 T21192 nummod 16,]
R15053 T21192 T21189 appos ],LPS
R15054 T21193 T21173 punct .,induced
R15055 T21194 T21196 advmod Here,report
R15056 T21195 T21196 nsubj we,report
R15057 T21196 T21196 ROOT report,report
R15058 T21197 T21206 mark that,conferred
R15059 T21198 T21200 nummod SerpinB2,transcription
R15060 T21199 T21200 compound gene,transcription
R15061 T21200 T21206 nsubjpass transcription,conferred
R15062 T21201 T21200 prep in,transcription
R15063 T21202 T21201 pobj response,in
R15064 T21203 T21202 prep to,response
R15065 T21204 T21203 pobj LPS,to
R15066 T21205 T21206 auxpass is,conferred
R15067 T21206 T21196 ccomp conferred,report
R15068 T21207 T21206 agent by,conferred
R15069 T21208 T21211 det the,promoter
R15070 T21209 T21211 nmod SerpinB2,promoter
R15071 T21210 T21211 amod proximal,promoter
R15072 T21211 T21207 pobj promoter,by
R15073 T21212 T21206 cc and,conferred
R15074 T21213 T21206 conj is,conferred
R15075 T21214 T21215 advmod greatly,dependent
R15076 T21215 T21213 acomp dependent,is
R15077 T21216 T21215 prep upon,dependent
R15078 T21217 T21216 pobj C/EBP,upon
R15079 T21218 T21219 punct -,β
R15080 T21219 T21213 npadvmod β,is
R15081 T21220 T21196 punct .,report
R15082 T21221 T21224 amod LPS-induced,β
R15083 T21222 T21224 compound C/EBP,β
R15084 T21223 T21224 punct -,β
R15085 T21224 T21226 nsubjpass β,shown
R15086 T21225 T21226 auxpass was,shown
R15087 T21226 T21226 ROOT shown,shown
R15088 T21227 T21229 aux to,bind
R15089 T21228 T21229 advmod specifically,bind
R15090 T21229 T21226 xcomp bind,shown
R15091 T21230 T21233 det the,element
R15092 T21231 T21233 compound C/EBP,element
R15093 T21232 T21233 compound response,element
R15094 T21233 T21229 dobj element,bind
R15095 T21234 T21233 prep in,element
R15096 T21235 T21238 det the,promoter
R15097 T21236 T21238 nmod SerpinB2,promoter
R15098 T21237 T21238 amod proximal,promoter
R15099 T21238 T21234 pobj promoter,in
R15100 T21239 T21233 prep in,element
R15101 T21240 T21239 pobj vitro,in
R15102 T21241 T21239 cc and,in
R15103 T21242 T21239 conj in,in
R15104 T21243 T21242 pobj vivo,in
R15105 T21244 T21242 punct ",",in
R15106 T21245 T21242 cc and,in
R15107 T21246 T21242 conj loss,in
R15108 T21247 T21246 prep of,loss
R15109 T21248 T21250 compound C/EBP,β
R15110 T21249 T21250 punct -,β
R15111 T21250 T21251 compound β,abrogates
R15112 T21251 T21229 dobj abrogates,bind
R15113 T21252 T21255 amod constitutive,transcription
R15114 T21253 T21255 compound SerpinB2,transcription
R15115 T21254 T21255 compound gene,transcription
R15116 T21255 T21251 dobj transcription,abrogates
R15117 T21256 T21255 cc and,transcription
R15118 T21257 T21258 det the,response
R15119 T21258 T21255 conj response,transcription
R15120 T21259 T21258 prep to,response
R15121 T21260 T21259 pobj LPS,to
R15122 T21261 T21226 punct .,shown
R15123 T21262 T21267 det The,region
R15124 T21263 T21267 amod murine,region
R15125 T21264 T21267 nmod SerpinB2,region
R15126 T21265 T21267 amod proximal,region
R15127 T21266 T21267 compound promoter,region
R15128 T21267 T21273 nsubj region,mediated
R15129 T21268 T21267 prep between,region
R15130 T21269 T21268 pobj nucleotides,between
R15131 T21270 T21269 conj -539,nucleotides
R15132 T21271 T21270 cc and,-539
R15133 T21272 T21270 conj +92,-539
R15134 T21273 T21273 ROOT mediated,mediated
R15135 T21274 T21280 det both,transcription
R15136 T21275 T21280 nmod PMA,transcription
R15137 T21276 T21275 punct -,PMA
R15138 T21277 T21275 cc and,PMA
R15139 T21278 T21280 compound LPS-inducible,transcription
R15140 T21279 T21280 compound gene,transcription
R15141 T21280 T21273 dobj transcription,mediated
R15142 T21281 T21273 punct ",",mediated
R15143 T21282 T21273 prep with,mediated
R15144 T21283 T21286 nsubj induction,being
R15145 T21284 T21283 prep by,induction
R15146 T21285 T21286 nsubj PMA,being
R15147 T21286 T21282 pcomp being,with
R15148 T21287 T21288 advmod less,intense
R15149 T21288 T21286 acomp intense,being
R15150 T21289 T21288 cc and,intense
R15151 T21290 T21291 advmod more,transient
R15152 T21291 T21288 conj transient,intense
R15153 T21292 T21291 prep than,transient
R15154 T21293 T21292 pobj that,than
R15155 T21294 T21286 prep by,being
R15156 T21295 T21294 pobj LPS,by
R15157 T21296 T21273 punct .,mediated
R15158 T21297 T21305 nsubj Inspection,shows
R15159 T21298 T21297 prep of,Inspection
R15160 T21299 T21304 det the,sequence
R15161 T21300 T21304 nmod murine,sequence
R15162 T21301 T21304 nmod SerpinB2,sequence
R15163 T21302 T21304 amod proximal,sequence
R15164 T21303 T21304 compound promoter,sequence
R15165 T21304 T21298 pobj sequence,of
R15166 T21305 T21305 ROOT shows,shows
R15167 T21306 T21314 mark that,demonstrated
R15168 T21307 T21308 det a,CRE
R15169 T21308 T21314 nsubj CRE,demonstrated
R15170 T21309 T21308 cc and,CRE
R15171 T21310 T21312 nummod two,elements
R15172 T21311 T21312 amod AP-1-like,elements
R15173 T21312 T21308 conj elements,CRE
R15174 T21313 T21314 punct ",",demonstrated
R15175 T21314 T21305 ccomp demonstrated,shows
R15176 T21315 T21316 aux to,mediate
R15177 T21316 T21314 xcomp mediate,demonstrated
R15178 T21317 T21318 amod PMA-stimulated,transcription
R15179 T21318 T21316 dobj transcription,mediate
R15180 T21319 T21318 prep of,transcription
R15181 T21320 T21323 det the,gene
R15182 T21321 T21323 amod human,gene
R15183 T21322 T21323 compound SERPINB2,gene
R15184 T21323 T21319 pobj gene,of
R15185 T21324 T21326 nmod [,]
R15186 T21325 T21326 nummod 37,]
R15187 T21326 T21318 appos ],transcription
R15188 T21327 T21329 punct ",",are
R15189 T21328 T21329 advmod also,are
R15190 T21329 T21305 conj are,shows
R15191 T21330 T21329 acomp present,are
R15192 T21331 T21330 prep in,present
R15193 T21332 T21336 det the,promoter
R15194 T21333 T21336 nmod murine,promoter
R15195 T21334 T21336 nmod SerpinB2,promoter
R15196 T21335 T21336 amod proximal,promoter
R15197 T21336 T21331 pobj promoter,in
R15198 T21337 T21336 prep between,promoter
R15199 T21338 T21337 pobj nucleotides,between
R15200 T21339 T21329 conj −,are
R15201 T21340 T21339 dobj 189,−
R15202 T21341 T21340 cc and,189
R15203 T21342 T21340 conj −,189
R15204 T21343 T21340 conj 87,189
R15205 T21344 T21329 punct .,are
R15206 T21345 T21346 det These,sites
R15207 T21346 T21350 nsubj sites,play
R15208 T21347 T21350 aux may,play
R15209 T21348 T21350 advmod therefore,play
R15210 T21349 T21350 advmod also,play
R15211 T21350 T21350 ROOT play,play
R15212 T21351 T21352 det a,role
R15213 T21352 T21350 dobj role,play
R15214 T21353 T21352 prep in,role
R15215 T21354 T21353 pcomp mediating,in
R15216 T21355 T21356 amod PMA-inducible,transcription
R15217 T21356 T21354 dobj transcription,mediating
R15218 T21357 T21356 prep of,transcription
R15219 T21358 T21361 det the,gene
R15220 T21359 T21361 compound murine,gene
R15221 T21360 T21361 compound SerpinB2,gene
R15222 T21361 T21357 pobj gene,of
R15223 T21362 T21350 punct .,play
R15224 T21363 T21403 prep In,−
R15225 T21364 T21363 pobj contrast,In
R15226 T21365 T21364 prep to,contrast
R15227 T21366 T21367 det the,pattern
R15228 T21367 T21365 pobj pattern,to
R15229 T21368 T21367 prep of,pattern
R15230 T21369 T21370 amod incremental,increases
R15231 T21370 T21368 pobj increases,of
R15232 T21371 T21370 prep in,increases
R15233 T21372 T21374 amod PMA-induced,activity
R15234 T21373 T21374 amod transcriptional,activity
R15235 T21374 T21371 pobj activity,in
R15236 T21375 T21370 acl conferred,increases
R15237 T21376 T21375 agent by,conferred
R15238 T21377 T21376 pobj regions,by
R15239 T21378 T21377 prep of,regions
R15240 T21379 T21382 det the,promoter
R15241 T21380 T21382 compound murine,promoter
R15242 T21381 T21382 compound SerpinB2,promoter
R15243 T21382 T21378 pobj promoter,of
R15244 T21383 T21382 acl containing,promoter
R15245 T21384 T21385 det these,sites
R15246 T21385 T21383 dobj sites,containing
R15247 T21386 T21385 punct ",",sites
R15248 T21387 T21393 nsubjpass most,dependent
R15249 T21388 T21387 prep of,most
R15250 T21389 T21391 det the,response
R15251 T21390 T21391 amod LPS-inducible,response
R15252 T21391 T21388 pobj response,of
R15253 T21392 T21393 auxpass is,dependent
R15254 T21393 T21367 amod dependent,pattern
R15255 T21394 T21393 prep upon,dependent
R15256 T21395 T21397 amod cis-acting,sequences
R15257 T21396 T21397 amod regulatory,sequences
R15258 T21397 T21394 pobj sequences,upon
R15259 T21398 T21397 prep in,sequences
R15260 T21399 T21400 det the,region
R15261 T21400 T21398 pobj region,in
R15262 T21401 T21403 mark between,−
R15263 T21402 T21403 nsubj nucleotides,−
R15264 T21403 T21403 ROOT −,−
R15265 T21404 T21403 dobj 189,−
R15266 T21405 T21404 cc and,189
R15267 T21406 T21404 conj −,189
R15268 T21407 T21404 conj 539,189
R15269 T21408 T21403 punct .,−
R15270 T21409 T21412 nsubj LPS,required
R15271 T21410 T21412 nsubj responsiveness,required
R15272 T21411 T21412 advmod absolutely,required
R15273 T21412 T21412 ROOT required,required
R15274 T21413 T21416 det the,site
R15275 T21414 T21416 nmod C/EBP,site
R15276 T21415 T21416 amod binding,site
R15277 T21416 T21412 dobj site,required
R15278 T21417 T21416 acl located,site
R15279 T21418 T21417 prep in,located
R15280 T21419 T21420 det the,region
R15281 T21420 T21418 pobj region,in
R15282 T21421 T21416 prep between,site
R15283 T21422 T21421 pobj nucleotides,between
R15284 T21423 T21412 dobj −,required
R15285 T21424 T21423 nummod 189,−
R15286 T21425 T21424 cc and,189
R15287 T21426 T21424 conj −,189
R15288 T21427 T21424 conj 539,189
R15289 T21428 T21423 punct ",",−
R15290 T21429 T21423 prep with,−
R15291 T21430 T21432 det the,CRE
R15292 T21431 T21432 amod downstream,CRE
R15293 T21432 T21437 nsubj CRE,being
R15294 T21433 T21432 cc and,CRE
R15295 T21434 T21435 amod AP-1-like,elements
R15296 T21435 T21432 conj elements,CRE
R15297 T21436 T21437 advmod also,being
R15298 T21437 T21429 pcomp being,with
R15299 T21438 T21437 acomp critical,being
R15300 T21439 T21412 punct .,required
R15301 T21440 T21444 prep Of,are
R15302 T21441 T21440 pobj note,Of
R15303 T21442 T21444 punct ",",are
R15304 T21443 T21444 expl there,are
R15305 T21444 T21444 ROOT are,are
R15306 T21445 T21446 amod previous,reports
R15307 T21446 T21444 attr reports,are
R15308 T21447 T21446 prep of,reports
R15309 T21448 T21449 amod combinatorial,interactions
R15310 T21449 T21447 pobj interactions,of
R15311 T21450 T21449 prep between,interactions
R15312 T21451 T21450 pobj C/EBP,between
R15313 T21452 T21451 punct -,C/EBP
R15314 T21453 T21451 conj β,C/EBP
R15315 T21454 T21453 cc and,β
R15316 T21455 T21457 nmod CRE,proteins
R15317 T21456 T21457 amod binding,proteins
R15318 T21457 T21453 conj proteins,β
R15319 T21458 T21459 punct (,CREB
R15320 T21459 T21457 appos CREB,proteins
R15321 T21460 T21459 punct ),CREB
R15322 T21461 T21459 cc and,CREB
R15323 T21462 T21463 compound AP-1,[
R15324 T21463 T21459 conj [,CREB
R15325 T21464 T21465 nummod 63,]
R15326 T21465 T21459 conj ],CREB
R15327 T21466 T21465 punct ",",]
R15328 T21467 T21465 cc and,]
R15329 T21468 T21470 compound C/EBP,β
R15330 T21469 T21470 punct -,β
R15331 T21470 T21473 nsubjpass β,reported
R15332 T21471 T21473 aux has,reported
R15333 T21472 T21473 auxpass been,reported
R15334 T21473 T21444 conj reported,are
R15335 T21474 T21476 aux to,interact
R15336 T21475 T21476 advmod physically,interact
R15337 T21476 T21473 xcomp interact,reported
R15338 T21477 T21476 prep with,interact
R15339 T21478 T21477 pobj AP-1,with
R15340 T21479 T21473 punct ",",reported
R15341 T21480 T21473 cc and,reported
R15342 T21481 T21473 conj NF-κB,reported
R15343 T21482 T21483 aux to,promote
R15344 T21483 T21473 advcl promote,reported
R15345 T21484 T21485 compound gene,expression
R15346 T21485 T21483 dobj expression,promote
R15347 T21486 T21485 prep of,expression
R15348 T21487 T21488 amod inflammatory,mediators
R15349 T21488 T21486 pobj mediators,of
R15350 T21489 T21491 nmod [,]
R15351 T21490 T21491 nummod 63,]
R15352 T21491 T21495 nmod ],]
R15353 T21492 T21491 punct ;,]
R15354 T21493 T21491 conj [,]
R15355 T21494 T21495 nummod 66,]
R15356 T21495 T21485 appos ],expression
R15357 T21496 T21473 punct .,reported
R15358 T21497 T21502 advmod Additionally,shown
R15359 T21498 T21502 punct ",",shown
R15360 T21499 T21502 nsubjpass CREB,shown
R15361 T21500 T21502 aux has,shown
R15362 T21501 T21502 auxpass been,shown
R15363 T21502 T21502 ROOT shown,shown
R15364 T21503 T21504 aux to,control
R15365 T21504 T21502 xcomp control,shown
R15366 T21505 T21504 dobj transcription,control
R15367 T21506 T21505 prep of,transcription
R15368 T21507 T21511 det the,gene
R15369 T21508 T21511 compound C/EBP,gene
R15370 T21509 T21510 punct -,β
R15371 T21510 T21511 compound β,gene
R15372 T21511 T21506 pobj gene,of
R15373 T21512 T21514 nmod [,]
R15374 T21513 T21514 nummod 67,]
R15375 T21514 T21511 appos ],gene
R15376 T21515 T21502 punct .,shown
R15377 T21516 T21524 prep In,found
R15378 T21517 T21518 det this,study
R15379 T21518 T21516 pobj study,In
R15380 T21519 T21524 punct ",",found
R15381 T21520 T21522 compound C/EBP,β
R15382 T21521 T21522 punct -,β
R15383 T21522 T21524 nsubjpass β,found
R15384 T21523 T21524 auxpass was,found
R15385 T21524 T21524 ROOT found,found
R15386 T21525 T21526 aux to,be
R15387 T21526 T21524 xcomp be,found
R15388 T21527 T21529 det a,requirement
R15389 T21528 T21529 amod major,requirement
R15390 T21529 T21526 attr requirement,be
R15391 T21530 T21529 prep for,requirement
R15392 T21531 T21532 preconj both,constitutive
R15393 T21532 T21537 nmod constitutive,transcription
R15394 T21533 T21532 cc and,constitutive
R15395 T21534 T21532 conj LPS-induced,constitutive
R15396 T21535 T21537 amod SerpinB2,transcription
R15397 T21536 T21537 compound gene,transcription
R15398 T21537 T21530 pobj transcription,for
R15399 T21538 T21524 punct .,found
R15400 T21539 T21549 prep In,identified
R15401 T21540 T21543 det a,expression
R15402 T21541 T21543 amod previous,expression
R15403 T21542 T21543 compound microarray,expression
R15404 T21543 T21539 pobj expression,In
R15405 T21544 T21543 acl profiling,expression
R15406 T21545 T21544 dobj study,profiling
R15407 T21546 T21549 punct ",",identified
R15408 T21561 T21560 pobj LPS,by
R15409 T21547 T21549 nsubjpass SerpinB2,identified
R15410 T21562 T21561 cc and,LPS
R15411 T21548 T21549 auxpass was,identified
R15412 T21563 T21561 conj IFNγ,LPS
R15413 T21564 T21566 auxpass was,impaired
R15414 T21549 T21549 ROOT identified,identified
R15415 T21550 T21549 prep as,identified
R15416 T21565 T21566 advmod severely,impaired
R15417 T21551 T21550 pobj gene,as
R15418 T21566 T21549 conj impaired,identified
R15419 T21567 T21566 prep compared,impaired
R15420 T21552 T21553 poss whose,induction
R15421 T21568 T21567 prep to,compared
R15422 T21569 T21570 amod wild-type,macrophages
R15423 T21570 T21568 pobj macrophages,to
R15424 T21553 T21566 nsubjpass induction,impaired
R15425 T21571 T21573 nmod [,]
R15426 T21572 T21573 nummod 68,]
R15427 T21554 T21553 prep in,induction
R15428 T21573 T21570 appos ],macrophages
R15429 T21574 T21566 punct .,impaired
R15430 T21575 T21577 poss Our,results
R15431 T21555 T21554 pobj C/EBP,in
R15432 T21576 T21577 amod qPCR,results
R15433 T21577 T21578 nsubj results,validate
R15434 T21578 T21578 ROOT validate,validate
R15435 T21556 T21557 punct -,β-deficient
R15436 T21579 T21580 det this,finding
R15437 T21580 T21578 dobj finding,validate
R15438 T21557 T21559 amod β-deficient,macrophages
R15439 T21581 T21578 punct ",",validate
R15440 T21582 T21584 mark as,found
R15441 T21583 T21584 nsubj we,found
R15442 T21584 T21600 advcl found,transduced
R15443 T21585 T21595 mark that,abrogated
R15444 T21586 T21587 preconj both,constitutive
R15445 T21558 T21559 amod peritoneal,macrophages
R15446 T21587 T21592 amod constitutive,expression
R15447 T21588 T21587 cc and,constitutive
R15448 T21559 T21553 conj macrophages,induction
R15449 T21589 T21587 conj LPS-inducible,constitutive
R15450 T21560 T21553 prep by,induction
R15451 T21590 T21592 compound SerpinB2,expression
R15452 T21591 T21592 compound mRNA,expression
R15453 T21592 T21595 nsubjpass expression,abrogated
R15454 T21658 T21661 amod LPS-induced,expression
R15455 T21593 T21595 auxpass is,abrogated
R15456 T21594 T21595 advmod significantly,abrogated
R15457 T21595 T21584 ccomp abrogated,found
R15458 T21596 T21595 prep in,abrogated
R15459 T21659 T21661 compound SerpinB2,expression
R15460 T21597 T21596 pobj C/EBP,in
R15461 T21598 T21595 punct -,abrogated
R15462 T21599 T21600 nsubj β-shRNA,transduced
R15463 T21660 T21661 compound gene,expression
R15464 T21600 T21578 advcl transduced,validate
R15465 T21601 T21602 amod peritoneal,macrophages
R15466 T21661 T21657 pobj expression,in
R15467 T21602 T21600 dobj macrophages,transduced
R15468 T21603 T21600 punct ",",transduced
R15469 T21604 T21600 advcl emphasizing,transduced
R15470 T21662 T21631 punct .,identified
R15471 T21605 T21606 det the,link
R15472 T21606 T21604 dobj link,emphasizing
R15473 T21663 T21665 punct C/EBP,β
R15474 T21607 T21606 prep between,link
R15475 T21608 T21610 compound C/EBP,β
R15476 T21609 T21610 punct -,β
R15477 T21664 T21665 punct -,β
R15478 T21610 T21607 pobj β,between
R15479 T21611 T21610 cc and,β
R15480 T21612 T21614 amod SerpinB2,transcription
R15481 T21665 T21670 nsubj β,plays
R15482 T21613 T21614 compound gene,transcription
R15483 T21614 T21610 conj transcription,β
R15484 T21666 T21670 punct ",",plays
R15485 T21615 T21578 punct .,validate
R15486 T21616 T21620 mark While,act
R15487 T21617 T21618 compound C/EBP,proteins
R15488 T21667 T21670 prep like,plays
R15489 T21618 T21620 nsubj proteins,act
R15490 T21619 T21620 aux can,act
R15491 T21620 T21631 advcl act,identified
R15492 T21621 T21620 prep as,act
R15493 T21622 T21623 det either,homodimers
R15494 T21623 T21621 pobj homodimers,as
R15495 T21668 T21667 pobj SerpinB2,like
R15496 T21624 T21623 cc or,homodimers
R15497 T21625 T21623 conj heterodimers,homodimers
R15498 T21626 T21628 nmod [,]
R15499 T21669 T21670 punct ",",plays
R15500 T21627 T21628 nummod 63,]
R15501 T21628 T21623 conj ],homodimers
R15502 T21629 T21631 punct ",",identified
R15503 T21670 T21694 ccomp plays,[
R15504 T21630 T21631 nsubj we,identified
R15505 T21631 T21631 ROOT identified,identified
R15506 T21632 T21634 compound C/EBP,β
R15507 T21671 T21673 det an,role
R15508 T21633 T21634 punct -,β
R15509 T21634 T21631 dobj β,identified
R15510 T21635 T21631 prep as,identified
R15511 T21672 T21673 amod important,role
R15512 T21636 T21640 det the,isoform
R15513 T21637 T21640 amod only,isoform
R15514 T21638 T21640 amod LPS-inducible,isoform
R15515 T21673 T21670 dobj role,plays
R15516 T21639 T21640 compound C/EBP,isoform
R15517 T21640 T21635 pobj isoform,as
R15518 T21641 T21642 aux to,bind
R15519 T21674 T21673 prep in,role
R15520 T21642 T21631 advcl bind,identified
R15521 T21643 T21647 det the,element
R15522 T21644 T21645 compound SerpinB2,C/EBP
R15523 T21675 T21674 pobj inflammation,in
R15524 T21645 T21647 compound C/EBP,element
R15525 T21646 T21647 compound response,element
R15526 T21647 T21642 dobj element,bind
R15527 T21676 T21670 punct ",",plays
R15528 T21648 T21631 punct ",",identified
R15529 T21649 T21631 advcl suggesting,identified
R15530 T21650 T21652 det a,role
R15531 T21677 T21680 mark as,upregulated
R15532 T21651 T21652 amod predominant,role
R15533 T21652 T21649 dobj role,suggesting
R15534 T21678 T21680 nsubjpass it,upregulated
R15535 T21653 T21652 prep for,role
R15536 T21654 T21656 compound C/EBP,β
R15537 T21655 T21656 punct -,β
R15538 T21679 T21680 auxpass is,upregulated
R15539 T21656 T21653 pobj β,for
R15540 T21657 T21656 prep in,β
R15541 T21680 T21670 advcl upregulated,plays
R15542 T21681 T21680 agent by,upregulated
R15543 T21682 T21681 pobj LPS,by
R15544 T21683 T21682 cc and,LPS
R15545 T21684 T21685 det a,host
R15546 T21755 T21756 amod functional,role
R15547 T21756 T21753 pobj role,with
R15548 T21685 T21682 conj host,LPS
R15549 T21757 T21756 prep in,role
R15550 T21686 T21685 prep of,host
R15551 T21758 T21757 pobj inflammation,in
R15552 T21759 T21751 punct .,is
R15553 T21760 T21773 nsubjpass Phosphorylation,shown
R15554 T21687 T21689 amod other,cytokines
R15555 T21761 T21760 prep of,Phosphorylation
R15556 T21762 T21761 pobj C/EBP,of
R15557 T21688 T21689 amod inflammatory,cytokines
R15558 T21763 T21764 punct -,β
R15559 T21764 T21760 conj β,Phosphorylation
R15560 T21689 T21686 pobj cytokines,of
R15561 T21765 T21764 prep at,β
R15562 T21766 T21770 amod several,residues
R15563 T21767 T21770 amod different,residues
R15564 T21690 T21692 nmod [,]
R15565 T21768 T21769 compound amino,acid
R15566 T21769 T21770 compound acid,residues
R15567 T21691 T21692 nummod 59,]
R15568 T21770 T21765 pobj residues,at
R15569 T21771 T21773 aux has,shown
R15570 T21772 T21773 auxpass been,shown
R15571 T21692 T21685 appos ],host
R15572 T21773 T21773 ROOT shown,shown
R15573 T21774 T21775 aux to,modulate
R15574 T21775 T21773 xcomp modulate,shown
R15575 T21693 T21694 punct ;,[
R15576 T21776 T21775 dobj transactivation,modulate
R15577 T21777 T21776 prep of,transactivation
R15578 T21778 T21780 poss its,genes
R15579 T21694 T21694 ROOT [,[
R15580 T21779 T21780 compound target,genes
R15581 T21780 T21777 pobj genes,of
R15582 T21695 T21696 nummod 62,]
R15583 T21781 T21783 nmod [,]
R15584 T21782 T21783 nummod 63,]
R15585 T21783 T21776 conj ],transactivation
R15586 T21696 T21694 dobj ],[
R15587 T21784 T21773 punct ;,shown
R15588 T21785 T21773 punct .,shown
R15589 T21697 T21631 punct .,identified
R15590 T21786 T21788 meta C/EBP,β
R15591 T21787 T21788 punct -,β
R15592 T21788 T21789 compound β,phosphorylated
R15593 T21789 T21794 nsubjpass phosphorylated,reported
R15594 T21790 T21789 prep on,phosphorylated
R15595 T21791 T21790 pobj T217,on
R15596 T21698 T21704 advmod Furthermore,are
R15597 T21792 T21794 aux has,reported
R15598 T21793 T21794 auxpass been,reported
R15599 T21794 T21794 ROOT reported,reported
R15600 T21795 T21796 aux to,rescue
R15601 T21699 T21704 punct ",",are
R15602 T21796 T21794 xcomp rescue,reported
R15603 T21797 T21796 dobj macrophages,rescue
R15604 T21700 T21703 nmod C/EBP,mice
R15605 T21798 T21796 prep from,rescue
R15606 T21799 T21798 pobj apoptosis,from
R15607 T21701 T21702 punct -,β-null
R15608 T21702 T21703 amod β-null,mice
R15609 T21800 T21794 conj induced,reported
R15610 T21801 T21800 agent by,induced
R15611 T21703 T21704 nsubj mice,are
R15612 T21802 T21803 compound Bacillus,anthracis
R15613 T21803 T21801 pobj anthracis,by
R15614 T21704 T21704 ROOT are,are
R15615 T21804 T21805 amod lethal,toxin
R15616 T21805 T21803 appos toxin,anthracis
R15617 T21806 T21807 punct (,LT
R15618 T21705 T21704 acomp susceptible,are
R15619 T21807 T21805 appos LT,toxin
R15620 T21808 T21794 punct ),reported
R15621 T21809 T21811 nmod [,]
R15622 T21706 T21705 prep to,susceptible
R15623 T21810 T21811 nummod 65,]
R15624 T21811 T21811 ROOT ],]
R15625 T21812 T21811 punct ",",]
R15626 T21707 T21708 amod bacterial,infection
R15627 T21813 T21814 det an,activity
R15628 T21814 T21811 appos activity,]
R15629 T21815 T21819 nsubj that,attributed
R15630 T21708 T21706 pobj infection,to
R15631 T21816 T21819 aux has,attributed
R15632 T21817 T21819 advmod also,attributed
R15633 T21709 T21711 nmod [,]
R15634 T21818 T21819 auxpass been,attributed
R15635 T21819 T21814 relcl attributed,activity
R15636 T21820 T21819 prep to,attributed
R15637 T21710 T21711 nummod 69,]
R15638 T21821 T21822 compound SerpinB2,[
R15639 T21822 T21820 pobj [,to
R15640 T21823 T21824 nummod 16,]
R15641 T21711 T21706 dep ],to
R15642 T21824 T21822 dobj ],[
R15643 T21825 T21811 punct .,]
R15644 T21826 T21844 advmod However,/
R15645 T21827 T21844 punct ",",/
R15646 T21712 T21711 punct ;,]
R15647 T21713 T21715 nmod [,]
R15648 T21828 T21844 nsubj expression,/
R15649 T21829 T21828 prep of,expression
R15650 T21714 T21715 nummod 70,]
R15651 T21830 T21835 det a,site
R15652 T21831 T21835 nmod C/EBP,site
R15653 T21715 T21711 conj ],]
R15654 T21832 T21833 punct -,β
R15655 T21833 T21835 nmod β,site
R15656 T21716 T21715 cc and,]
R15657 T21834 T21835 compound phospho-acceptor,site
R15658 T21835 T21829 pobj site,of
R15659 T21836 T21835 amod mutant,site
R15660 T21717 T21715 conj SerpinB2,]
R15661 T21837 T21839 punct ",",βT217A
R15662 T21838 T21839 compound C/EBP,βT217A
R15663 T21718 T21720 aux has,demonstrated
R15664 T21839 T21828 appos βT217A,expression
R15665 T21840 T21839 punct ",",βT217A
R15666 T21719 T21720 auxpass been,demonstrated
R15667 T21841 T21839 prep in,βT217A
R15668 T21842 T21843 compound Cebpb,−
R15669 T21843 T21841 pobj −,in
R15670 T21720 T21704 conj demonstrated,are
R15671 T21844 T21844 ROOT /,/
R15672 T21845 T21846 nummod −,MEFs
R15673 T21721 T21722 aux to,protect
R15674 T21846 T21849 nsubj MEFs,increase
R15675 T21847 T21849 aux did,increase
R15676 T21848 T21849 neg not,increase
R15677 T21722 T21720 xcomp protect,demonstrated
R15678 T21849 T21844 ccomp increase,/
R15679 T21850 T21853 nmod SerpinB2,activity
R15680 T21723 T21722 prep from,protect
R15681 T21851 T21853 amod proximal,activity
R15682 T21724 T21728 amod bacterial,death
R15683 T21725 T21724 cc and,bacterial
R15684 T21726 T21724 conj viral-induced,bacterial
R15685 T21852 T21853 compound promoter,activity
R15686 T21853 T21849 dobj activity,increase
R15687 T21854 T21853 prep over,activity
R15688 T21727 T21728 compound cell,death
R15689 T21855 T21854 pobj that,over
R15690 T21856 T21855 prep of,that
R15691 T21728 T21731 compound death,]
R15692 T21857 T21860 amod wild-type,β
R15693 T21858 T21860 compound C/EBP,β
R15694 T21859 T21860 punct -,β
R15695 T21860 T21856 pobj β,of
R15696 T21861 T21849 punct ",",increase
R15697 T21862 T21874 advmod even,observed
R15698 T21863 T21874 mark though,observed
R15699 T21729 T21731 nmod [,]
R15700 T21864 T21868 nsubj recruitment,βT217
R15701 T21865 T21864 prep of,recruitment
R15702 T21730 T21731 nummod 14,]
R15703 T21866 T21865 pobj C/EBP,of
R15704 T21867 T21868 punct -,βT217
R15705 T21868 T21874 nsubjpass βT217,observed
R15706 T21731 T21723 pobj ],from
R15707 T21869 T21868 prep to,βT217
R15708 T21870 T21872 det the,promoter
R15709 T21732 T21734 nmod [,]
R15710 T21871 T21872 compound SerpinB2,promoter
R15711 T21872 T21869 pobj promoter,to
R15712 T21873 T21874 auxpass was,observed
R15713 T21733 T21734 nummod 16,]
R15714 T21874 T21849 advcl observed,increase
R15715 T21875 T21876 aux to,decrease
R15716 T21734 T21731 appos ],]
R15717 T21876 T21874 xcomp decrease,observed
R15718 T21877 T21874 prep following,observed
R15719 T21735 T21731 punct ;,]
R15720 T21878 T21879 compound LPS,stimulation
R15721 T21879 T21877 pobj stimulation,following
R15722 T21880 T21879 prep of,stimulation
R15723 T21881 T21883 nmod RAW264,cells
R15724 T21736 T21738 nmod [,]
R15725 T21882 T21883 nummod .7,cells
R15726 T21883 T21880 pobj cells,of
R15727 T21884 T21844 punct .,/
R15728 T21737 T21738 nummod 25,]
R15729 T21885 T21886 det These,data
R15730 T21886 T21887 nsubj data,indicate
R15731 T21887 T21887 ROOT indicate,indicate
R15732 T21888 T21893 mark that,is
R15733 T21738 T21731 appos ],]
R15734 T21889 T21892 det the,site
R15735 T21890 T21892 compound T217,site
R15736 T21739 T21704 punct .,are
R15737 T21891 T21892 compound phospho-acceptor,site
R15738 T21892 T21893 nsubj site,is
R15739 T21893 T21887 ccomp is,indicate
R15740 T21894 T21893 neg not,is
R15741 T21740 T21751 advmod Thus,is
R15742 T21895 T21893 acomp important,is
R15743 T21896 T21895 prep for,important
R15744 T21897 T21898 det the,regulation
R15745 T21898 T21896 pobj regulation,for
R15746 T21899 T21898 prep of,regulation
R15747 T21741 T21742 det the,regulation
R15748 T21900 T21902 compound SerpinB2,expression
R15749 T21901 T21902 compound gene,expression
R15750 T21902 T21899 pobj expression,of
R15751 T21742 T21751 nsubj regulation,is
R15752 T21903 T21887 punct .,indicate
R15753 T21904 T21922 advmod Similarly,affect
R15754 T21905 T21906 punct ",",expression
R15755 T21743 T21742 prep of,regulation
R15756 T21744 T21746 compound SerpinB2,expression
R15757 T21906 T21922 nsubj expression,affect
R15758 T21907 T21906 prep of,expression
R15759 T21745 T21746 compound gene,expression
R15760 T21908 T21913 det the,site
R15761 T21909 T21913 nmod C/EBP,site
R15762 T21746 T21743 pobj expression,of
R15763 T21910 T21911 punct -,β
R15764 T21911 T21913 nmod β,site
R15765 T21912 T21913 compound phospho-acceptor,site
R15766 T21913 T21907 pobj site,of
R15767 T21747 T21742 prep by,regulation
R15768 T21914 T21922 nsubj mutant,affect
R15769 T21748 T21747 pobj C/EBP,by
R15770 T21915 T21914 punct ",",mutant
R15771 T21916 T21918 compound C/EBP,βT188A
R15772 T21917 T21918 punct -,βT188A
R15773 T21749 T21750 punct -,β
R15774 T21918 T21922 nsubj βT188A,affect
R15775 T21919 T21918 punct ",",βT188A
R15776 T21920 T21922 aux did,affect
R15777 T21750 T21751 nsubj β,is
R15778 T21921 T21922 neg not,affect
R15779 T21922 T21922 ROOT affect,affect
R15780 T21751 T21751 ROOT is,is
R15781 T21923 T21925 amod SerpinB2,activity
R15782 T21924 T21925 compound promoter,activity
R15783 T21752 T21751 acomp consistent,is
R15784 T21925 T21922 dobj activity,affect
R15785 T21926 T21922 advmod differently,affect
R15786 T21927 T21922 prep from,affect
R15787 T21753 T21752 prep with,consistent
R15788 T21928 T21927 pobj that,from
R15789 T21929 T21928 prep of,that
R15790 T21930 T21929 pobj wild-type,of
R15791 T21754 T21756 poss its,role
R15792 T21931 T21922 punct .,affect
R15793 T21932 T21947 prep In,indicating
R15794 T21933 T21932 pobj contrast,In
R15795 T21934 T21945 punct ",",activity
R15796 T21935 T21945 nmod expression,activity
R15797 T21949 T21957 nsubj phosphorylation,regulates
R15798 T21936 T21935 prep of,expression
R15799 T21937 T21936 pobj C/EBP,of
R15800 T21938 T21939 punct -,βS64A
R15801 T21939 T21945 amod βS64A,activity
R15802 T21950 T21949 prep of,phosphorylation
R15803 T21940 T21941 advmod significantly,enhanced
R15804 T21941 T21945 amod enhanced,activity
R15805 T21942 T21945 amod LPS-induced,activity
R15806 T21943 T21945 compound SerpinB2,activity
R15807 T21951 T21950 pobj C/EBP,of
R15808 T21944 T21945 compound promoter,activity
R15809 T21945 T21947 nsubj activity,indicating
R15810 T21952 T21953 punct -,β
R15811 T21946 T21947 punct ",",indicating
R15812 T21947 T21947 ROOT indicating,indicating
R15813 T21948 T21957 mark that,regulates
R15814 T21953 T21949 conj β,phosphorylation
R15815 T21954 T21949 prep at,phosphorylation
R15816 T21955 T21954 pobj S64,at
R15817 T22046 T22045 acomp involved,be
R15818 T22047 T22046 prep in,involved
R15819 T21956 T21957 advmod negatively,regulates
R15820 T22048 T22049 amod LPS-signaling,pathways
R15821 T22049 T22047 pobj pathways,in
R15822 T21957 T21947 ccomp regulates,indicating
R15823 T22050 T22037 punct .,suggest
R15824 T22051 T22056 prep In,become
R15825 T21958 T21961 amod LPS-induced,activity
R15826 T22052 T22053 amod recent,years
R15827 T22053 T22051 pobj years,In
R15828 T22054 T22056 nsubj it,become
R15829 T21959 T21961 nummod SerpinB2,activity
R15830 T22055 T22056 aux has,become
R15831 T22056 T22056 ROOT become,become
R15832 T21960 T21961 compound promoter,activity
R15833 T22057 T22056 acomp apparent,become
R15834 T22058 T22063 mark that,linked
R15835 T22059 T22060 amod persistent,infection
R15836 T21961 T21957 dobj activity,regulates
R15837 T22060 T22063 nsubjpass infection,linked
R15838 T22061 T22063 auxpass is,linked
R15839 T21962 T21947 punct .,indicating
R15840 T22062 T22063 advmod integrally,linked
R15841 T21963 T21970 mark Since,phosphorylated
R15842 T22063 T22056 ccomp linked,become
R15843 T22064 T22063 prep to,linked
R15844 T22065 T22066 amod chronic,inflammation
R15845 T21964 T21966 compound C/EBP,β
R15846 T22066 T22064 pobj inflammation,to
R15847 T22067 T22066 cc and,inflammation
R15848 T22068 T22066 conj cancer,inflammation
R15849 T21965 T21966 punct -,β
R15850 T22069 T22068 punct ",",cancer
R15851 T22070 T22068 cc and,cancer
R15852 T22071 T22072 amod immune,cells
R15853 T21966 T21967 compound β,S64
R15854 T22072 T22068 conj cells,cancer
R15855 T22073 T22074 amod such,as
R15856 T21967 T21970 nsubjpass S64,phosphorylated
R15857 T22074 T22072 prep as,cells
R15858 T22075 T22074 pobj macrophages,as
R15859 T21968 T21970 auxpass is,phosphorylated
R15860 T22076 T22078 aux can,promote
R15861 T22077 T22078 preconj either,promote
R15862 T21969 T21970 advmod constitutively,phosphorylated
R15863 T21970 T21970 ROOT phosphorylated,phosphorylated
R15864 T21971 T21970 prep in,phosphorylated
R15865 T22078 T22056 conj promote,become
R15866 T21972 T21975 det both,cells
R15867 T22079 T22078 cc or,promote
R15868 T22080 T22078 conj attenuate,promote
R15869 T21973 T21975 nmod RAW264,cells
R15870 T22081 T22082 compound cancer,progression
R15871 T22082 T22080 dobj progression,attenuate
R15872 T22083 T22085 nmod [,]
R15873 T21974 T21975 nummod .7,cells
R15874 T22084 T22085 nummod 2,]
R15875 T22085 T22080 conj ],attenuate
R15876 T21975 T21971 pobj cells,in
R15877 T22086 T22085 punct ;,]
R15878 T22087 T22085 conj [,]
R15879 T22088 T22089 nummod 74,]
R15880 T21976 T21975 cc and,cells
R15881 T22089 T22085 conj ],]
R15882 T22090 T22085 appos [,]
R15883 T21977 T21975 conj MEFs,cells
R15884 T22091 T22092 nummod 76,]
R15885 T22092 T22085 conj ],]
R15886 T21978 T21980 nmod [,]
R15887 T22093 T22056 punct .,become
R15888 T22094 T22095 nummod SerpinB2,expression
R15889 T21979 T21980 nummod 73,]
R15890 T22095 T22098 nsubjpass expression,associated
R15891 T22096 T22098 aux has,associated
R15892 T22097 T22098 auxpass been,associated
R15893 T21980 T21983 npadvmod ],is
R15894 T22098 T22098 ROOT associated,associated
R15895 T22099 T22098 prep with,associated
R15896 T22100 T22101 preconj both,inflammation
R15897 T22101 T22099 pobj inflammation,with
R15898 T21981 T21983 punct ",",is
R15899 T21982 T21983 nsubj it,is
R15900 T22102 T22101 cc and,inflammation
R15901 T21983 T21983 ROOT is,is
R15902 T22103 T22101 conj cancer,inflammation
R15903 T22104 T22098 punct ",",associated
R15904 T21984 T21983 acomp likely,is
R15905 T22105 T22098 cc and,associated
R15906 T22106 T22098 conj is,associated
R15907 T22107 T22112 det a,indicator
R15908 T21985 T21991 mark that,be
R15909 T22108 T22112 amod favorable,indicator
R15910 T22109 T22108 cc or,favorable
R15911 T21986 T21991 nsubj dephosphorylation,be
R15912 T22110 T22108 conj unfavorable,favorable
R15913 T22111 T22112 amod prognostic,indicator
R15914 T22112 T22106 attr indicator,is
R15915 T21987 T21986 prep at,dephosphorylation
R15916 T21988 T21989 det this,site
R15917 T22113 T22112 acl depending,indicator
R15918 T22114 T22113 prep on,depending
R15919 T21989 T21987 pobj site,at
R15920 T22115 T22116 compound cancer,type
R15921 T22116 T22114 pobj type,on
R15922 T22117 T22119 nmod [,]
R15923 T21990 T21991 aux may,be
R15924 T22118 T22119 nummod 77,]
R15925 T22119 T22112 appos ],indicator
R15926 T21991 T21984 ccomp be,likely
R15927 T22120 T22106 punct .,is
R15928 T22121 T22122 det The,presence
R15929 T22122 T22127 nsubjpass presence,shown
R15930 T21992 T21994 det a,event
R15931 T22123 T22122 prep of,presence
R15932 T22124 T22123 pobj SerpinB2,of
R15933 T22125 T22127 aux has,shown
R15934 T21993 T21994 amod critical,event
R15935 T22126 T22127 auxpass been,shown
R15936 T22127 T22127 ROOT shown,shown
R15937 T22128 T22129 aux to,modulate
R15938 T21994 T21991 attr event,be
R15939 T22129 T22127 xcomp modulate,shown
R15940 T22130 T22131 amod cytokine,profiles
R15941 T21995 T21994 prep during,event
R15942 T22131 T22129 dobj profiles,modulate
R15943 T22132 T22134 nsubj which,affect
R15944 T22133 T22134 aux can,affect
R15945 T22134 T22131 relcl affect,profiles
R15946 T22135 T22137 amod immune,polarization
R15947 T22136 T22137 compound cell,polarization
R15948 T21996 T21997 amod LPS-induced,transcription
R15949 T22137 T22134 dobj polarization,affect
R15950 T22138 T22140 nmod [,]
R15951 T22139 T22140 nummod 27,]
R15952 T21997 T21995 pobj transcription,during
R15953 T22140 T22137 nmod ],polarization
R15954 T22141 T22140 punct ;,]
R15955 T21998 T21997 prep of,transcription
R15956 T22142 T22144 compound [,]
R15957 T22143 T22144 compound 28,]
R15958 T21999 T21998 pobj SerpinB2,of
R15959 T22000 T22001 aux to,increase
R15960 T22001 T21994 acl increase,event
R15961 T22144 T22140 conj ],]
R15962 T22002 T22004 poss its,activity
R15963 T22145 T22144 punct ;,]
R15964 T22146 T22144 conj [,]
R15965 T22147 T22148 nummod 77,]
R15966 T22003 T22004 compound promoter,activity
R15967 T22148 T22144 conj ],]
R15968 T22149 T22140 punct ;,]
R15969 T22004 T22001 dobj activity,increase
R15970 T22150 T22152 nmod [,]
R15971 T22151 T22152 nummod 78,]
R15972 T22005 T21983 punct .,is
R15973 T22152 T22140 conj ],]
R15974 T22153 T22127 punct .,shown
R15975 T22006 T22009 nsubj Roy,demonstrated
R15976 T22154 T22161 advmod Interestingly,shown
R15977 T22155 T22157 compound C/EBP,β
R15978 T22156 T22157 punct -,β
R15979 T22007 T22006 cc and,Roy
R15980 T22157 T22161 nsubjpass β,shown
R15981 T22158 T22161 aux has,shown
R15982 T22008 T22006 conj colleagues,Roy
R15983 T22159 T22161 advmod also,shown
R15984 T22160 T22161 auxpass been,shown
R15985 T22161 T22161 ROOT shown,shown
R15986 T22162 T22163 aux to,modulate
R15987 T22009 T22009 ROOT demonstrated,demonstrated
R15988 T22163 T22161 xcomp modulate,shown
R15989 T22164 T22165 amod cytokine,secretion
R15990 T22010 T22025 mark that,was
R15991 T22165 T22163 dobj secretion,modulate
R15992 T22166 T22163 prep from,modulate
R15993 T22167 T22168 amod immune,cells
R15994 T22011 T22012 amod Mixed,lineage
R15995 T22168 T22166 pobj cells,from
R15996 T22169 T22163 punct ",",modulate
R15997 T22170 T22171 advmod thereby,modifying
R15998 T22171 T22161 advcl modifying,shown
R15999 T22172 T22178 ccomp their,[
R16000 T22012 T22018 npadvmod lineage,driven
R16001 T22173 T22178 ccomp phenotype,[
R16002 T22174 T22176 nmod [,]
R16003 T22013 T22012 amod kinase-3,lineage
R16004 T22014 T22013 punct (,kinase-3
R16005 T22175 T22176 nummod 27,]
R16006 T22015 T22013 appos MLK3,kinase-3
R16007 T22176 T22173 appos ],phenotype
R16008 T22177 T22178 punct ;,[
R16009 T22178 T22181 nmod [,[
R16010 T22016 T22013 punct ),kinase-3
R16011 T22179 T22180 nummod 79,]
R16012 T22180 T22181 nmod ],[
R16013 T22017 T22018 punct -,driven
R16014 T22181 T22171 dobj [,modifying
R16015 T22182 T22183 nummod 81,]
R16016 T22183 T22181 appos ],[
R16017 T22018 T22019 amod driven,dephosphorylation
R16018 T22184 T22161 punct .,shown
R16019 T22185 T22186 poss Our,study
R16020 T22019 T22025 nsubj dephosphorylation,was
R16021 T22186 T22188 nsubj study,demonstrated
R16022 T22187 T22188 aux has,demonstrated
R16023 T22188 T22188 ROOT demonstrated,demonstrated
R16024 T22020 T22019 prep of,dephosphorylation
R16025 T22189 T22193 mark that,plays
R16026 T22190 T22192 compound C/EBP,β
R16027 T22021 T22020 pobj C/EBP,of
R16028 T22191 T22192 punct -,β
R16029 T22192 T22193 nsubj β,plays
R16030 T22193 T22188 ccomp plays,demonstrated
R16031 T22022 T22023 punct -,β
R16032 T22194 T22196 det an,role
R16033 T22195 T22196 amod important,role
R16034 T22196 T22193 dobj role,plays
R16035 T22023 T22024 compound β,S64
R16036 T22197 T22196 prep in,role
R16037 T22198 T22197 pcomp mediating,in
R16038 T22024 T22019 appos S64,dephosphorylation
R16039 T22199 T22200 preconj both,constitutive
R16040 T22200 T22203 nmod constitutive,transcription
R16041 T22201 T22200 cc and,constitutive
R16042 T22025 T22009 ccomp was,demonstrated
R16043 T22202 T22200 conj LPS-induced,constitutive
R16044 T22203 T22198 dobj transcription,mediating
R16045 T22204 T22203 prep of,transcription
R16046 T22205 T22207 det the,gene
R16047 T22206 T22207 compound SerpinB2,gene
R16048 T22026 T22025 acomp important,was
R16049 T22207 T22204 pobj gene,of
R16050 T22208 T22207 punct ",",gene
R16051 T22209 T22211 nsubj which,have
R16052 T22210 T22211 aux may,have
R16053 T22027 T22026 prep for,important
R16054 T22211 T22207 relcl have,gene
R16055 T22212 T22211 dobj implications,have
R16056 T22028 T22030 amod IFNγ-regulated,pathways
R16057 T22213 T22212 prep for,implications
R16058 T22214 T22216 det the,phenotype
R16059 T22215 T22216 amod inflammatory,phenotype
R16060 T22029 T22030 compound signaling,pathways
R16061 T22216 T22213 pobj phenotype,for
R16062 T22217 T22216 prep of,phenotype
R16063 T22218 T22217 pcomp infiltrating,of
R16064 T22030 T22027 pobj pathways,for
R16065 T22219 T22220 amod immune,cells
R16066 T22031 T22033 nmod [,]
R16067 T22220 T22218 dobj cells,infiltrating
R16068 T22032 T22033 nummod 73,]
R16069 T22221 T22218 prep in,infiltrating
R16070 T22033 T22030 appos ],pathways
R16071 T22222 T22224 det the,microenvironment
R16072 T22223 T22224 compound tumor,microenvironment
R16073 T22034 T22009 punct .,demonstrated
R16074 T22224 T22221 pobj microenvironment,in
R16075 T22225 T22188 punct .,demonstrated
R16076 T22035 T22036 poss Our,data
R16077 T22226 T22231 prep In,show
R16078 T22227 T22226 pobj summary,In
R16079 T22036 T22037 nsubj data,suggest
R16080 T22228 T22231 punct ",",show
R16081 T22229 T22230 poss our,studies
R16082 T22037 T22037 ROOT suggest,suggest
R16083 T22230 T22231 nsubj studies,show
R16084 T22231 T22231 ROOT show,show
R16085 T22232 T22231 dobj that,show
R16086 T22038 T22045 mark that,be
R16087 T22233 T22235 det the,site
R16088 T22234 T22235 compound C/EBP,site
R16089 T22235 T22232 nsubj site,that
R16090 T22039 T22040 amod MLK3-driven,dephosphorylation
R16091 T22236 T22249 punct (,is
R16092 T22237 T22239 nummod −,/
R16093 T22040 T22045 nsubj dephosphorylation,be
R16094 T22238 T22239 nummod 203,/
R16095 T22239 T22249 nsubj /,is
R16096 T22240 T22249 nsubj −,is
R16097 T22041 T22040 prep of,dephosphorylation
R16098 T22042 T22041 pobj S64,of
R16099 T22043 T22045 aux may,be
R16100 T22241 T22240 nummod 195,−
R16101 T22242 T22240 punct ),−
R16102 T22243 T22240 prep in,−
R16103 T22244 T22248 det the,promoter
R16104 T22044 T22045 advmod also,be
R16105 T22245 T22248 amod murine,promoter
R16106 T22246 T22248 nmod SerpinB2,promoter
R16107 T22247 T22248 amod proximal,promoter
R16108 T22045 T22037 ccomp be,suggest
R16109 T22248 T22243 pobj promoter,in
R16110 T22249 T22235 parataxis is,site
R16111 T22250 T22249 acomp necessary,is
R16112 T22251 T22252 aux to,support
R16113 T22252 T22249 xcomp support,is
R16114 T22253 T22254 preconj both,constitutive
R16115 T22254 T22259 nmod constitutive,expression
R16116 T22255 T22254 cc and,constitutive
R16117 T22256 T22254 conj LPS-induced,constitutive
R16118 T22257 T22259 amod SerpinB2,expression
R16119 T22258 T22259 compound gene,expression
R16120 T22259 T22252 dobj expression,support
R16121 T22260 T22249 punct .,is
R16122 T22261 T22264 advmod Importantly,were
R16123 T22262 T22264 punct ",",were
R16124 T22263 T22264 nsubj we,were
R16125 T22264 T22264 ROOT were,were
R16126 T22265 T22264 acomp able,were
R16127 T22266 T22267 aux to,uncover
R16128 T22267 T22265 xcomp uncover,able
R16129 T22268 T22271 det a,role
R16130 T22269 T22270 advmod previously,unknown
R16131 T22270 T22271 amod unknown,role
R16132 T22271 T22267 dobj role,uncover
R16133 T22272 T22271 prep for,role
R16134 T22273 T22275 compound C/EBP,βS64
R16135 T22274 T22275 punct -,βS64
R16136 T22275 T22272 pobj βS64,for
R16137 T22276 T22275 prep in,βS64
R16138 T22277 T22278 advmod negatively,regulating
R16139 T22278 T22276 pcomp regulating,in
R16140 T22279 T22281 amod SerpinB2,activity
R16141 T22280 T22281 compound promoter,activity
R16142 T22281 T22278 dobj activity,regulating
R16143 T22282 T22264 punct .,were
R16144 T22283 T22287 advcl Taken,provide
R16145 T22284 T22283 advmod together,Taken
R16146 T22285 T22286 det these,data
R16147 T22286 T22287 nsubj data,provide
R16148 T22287 T22287 ROOT provide,provide
R16149 T22288 T22289 amod new,insight
R16150 T22289 T22287 dobj insight,provide
R16151 T22290 T22289 prep into,insight
R16152 T22291 T22292 det the,regulation
R16153 T22292 T22290 pobj regulation,into
R16154 T22293 T22292 prep of,regulation
R16155 T22294 T22297 amod inflammation-associated,expression
R16156 T22295 T22297 compound SerpinB2,expression
R16157 T22296 T22297 compound gene,expression
R16158 T22297 T22293 pobj expression,of
R16159 T22298 T22287 punct .,provide
R16266 T22573 T22574 compound LPS,induction
R16267 T22574 T22580 nmod induction,expression
R16268 T22575 T22574 prep of,induction
R16269 T22576 T22577 compound SerpinB2,mRNA
R16270 T22577 T22575 pobj mRNA,of
R16271 T22578 T22577 cc and,mRNA
R16272 T22579 T22580 compound protein,expression
R16273 T22580 T22580 ROOT expression,expression
R16274 T22581 T22580 prep in,expression
R16275 T22582 T22584 amod murine,cells
R16276 T22583 T22584 compound macrophage,cells
R16277 T22584 T22581 pobj cells,in
R16278 T22585 T22580 punct .,expression
R16279 T22586 T22588 nummod RAW264,macrophages
R16280 T22587 T22588 nummod .7,macrophages
R16281 T22588 T22590 nsubjpass macrophages,treated
R16282 T22589 T22590 auxpass were,treated
R16283 T22590 T22590 ROOT treated,treated
R16284 T22591 T22590 prep for,treated
R16285 T22592 T22594 det the,times
R16286 T22593 T22594 amod indicated,times
R16287 T22594 T22591 pobj times,for
R16288 T22595 T22590 prep with,treated
R16289 T22596 T22598 nummod 100,LPS
R16290 T22597 T22598 amod ng/ml,LPS
R16291 T22598 T22595 pobj LPS,with
R16292 T22599 T22590 punct .,treated
R16293 T22600 T22604 punct (,analysis
R16294 T22601 T22604 det A,analysis
R16295 T22602 T22603 punct ),qPCR
R16296 T22603 T22604 compound qPCR,analysis
R16297 T22604 T22604 ROOT analysis,analysis
R16298 T22605 T22604 prep of,analysis
R16299 T22606 T22609 amod murine,levels
R16300 T22607 T22608 compound SerpinB2,mRNA
R16301 T22608 T22609 compound mRNA,levels
R16302 T22609 T22605 pobj levels,of
R16303 T22610 T22604 punct ",",analysis
R16304 T22611 T22604 amod relative,analysis
R16305 T22612 T22611 prep to,relative
R16306 T22613 T22612 pobj β-actin,to
R16307 T22614 T22604 punct .,analysis
R16308 T22615 T22616 det The,plot
R16309 T22616 T22617 nsubj plot,is
R16310 T22617 T22617 ROOT is,is
R16311 T22618 T22617 attr representative,is
R16312 T22619 T22618 prep of,representative
R16313 T22620 T22621 advmod at,least
R16314 T22621 T22622 advmod least,two
R16315 T22622 T22624 nummod two,experiments
R16316 T22623 T22624 amod independent,experiments
R16317 T22624 T22619 pobj experiments,of
R16318 T22625 T22624 acl performed,experiments
R16319 T22626 T22625 prep in,performed
R16320 T22627 T22626 pobj triplicate,in
R16321 T22628 T22617 punct .,is
R16322 T22629 T22633 punct (,analysis
R16323 T22630 T22633 nmod B,analysis
R16324 T22631 T22630 punct ),B
R16325 T22632 T22633 compound Immunoblot,analysis
R16326 T22633 T22641 nsubj analysis,lysates
R16327 T22634 T22633 prep of,analysis
R16328 T22635 T22637 nummod SerpinB2,expression
R16329 T22636 T22637 compound protein,expression
R16330 T22637 T22634 pobj expression,of
R16331 T22638 T22637 prep in,expression
R16332 T22639 T22640 amod whole,cell
R16333 T22640 T22641 compound cell,lysates
R16334 T22641 T22641 ROOT lysates,lysates
R16335 T22642 T22641 punct .,lysates
R16336 T22643 T22645 nsubjpass Blot,reprobed
R16337 T22644 T22645 auxpass was,reprobed
R16338 T22645 T22645 ROOT reprobed,reprobed
R16339 T22646 T22645 prep for,reprobed
R16340 T22647 T22646 pobj GAPDH,for
R16341 T22648 T22645 prep as,reprobed
R16342 T22649 T22651 det a,control
R16343 T22650 T22651 compound loading,control
R16344 T22651 T22648 pobj control,as
R16345 T22652 T22645 punct .,reprobed
R16592 T23093 T23096 compound Deletion,analysis
R16593 T23094 T23096 compound reporter,analysis
R16594 T23095 T23096 compound gene,analysis
R16595 T23096 T23096 ROOT analysis,analysis
R16596 T23097 T23096 prep of,analysis
R16597 T23098 T23097 pobj LPS,of
R16598 T23099 T23098 cc and,LPS
R16599 T23100 T23101 amod PMA-responsive,regions
R16600 T23101 T23098 conj regions,LPS
R16601 T23102 T23096 prep in,analysis
R16602 T23103 T23106 det the,promoter
R16603 T23104 T23106 compound murine,promoter
R16604 T23105 T23106 compound SerpinB2,promoter
R16605 T23106 T23102 pobj promoter,in
R16606 T23107 T23096 punct .,analysis
R16607 T23108 T23109 punct (,A
R16608 T23109 T23112 nmod A,representation
R16609 T23110 T23109 punct ),A
R16610 T23111 T23112 amod Schematic,representation
R16611 T23112 T23112 ROOT representation,representation
R16612 T23113 T23112 prep of,representation
R16613 T23114 T23117 det the,promoter
R16614 T23115 T23117 compound murine,promoter
R16615 T23116 T23117 compound SerpinB2,promoter
R16616 T23117 T23113 pobj promoter,of
R16617 T23118 T23112 cc and,representation
R16618 T23119 T23120 nummod 5,′
R16619 T23120 T23121 npadvmod ′,deletion
R16620 T23121 T23124 nmod deletion,constructs
R16621 T23122 T23124 compound luciferase,constructs
R16622 T23123 T23124 compound reporter,constructs
R16623 T23124 T23112 conj constructs,representation
R16624 T23125 T23112 punct .,representation
R16625 T23126 T23131 det The,region
R16626 T23127 T23131 amod murine,region
R16627 T23128 T23129 nummod 5,′
R16628 T23129 T23131 compound ′,region
R16629 T23130 T23131 compound flanking,region
R16630 T23131 T23138 nsubjpass region,inserted
R16631 T23132 T23131 prep from,region
R16632 T23133 T23132 pobj −,from
R16633 T23134 T23138 nsubjpass 4480,inserted
R16634 T23135 T23138 prep to,inserted
R16635 T23136 T23135 pobj +92,to
R16636 T23137 T23138 auxpass was,inserted
R16637 T23138 T23138 ROOT inserted,inserted
R16638 T23139 T23138 advmod upstream,inserted
R16639 T23140 T23139 prep of,upstream
R16640 T23141 T23144 det the,gene
R16641 T23142 T23144 compound luciferase,gene
R16642 T23143 T23144 compound reporter,gene
R16643 T23144 T23140 pobj gene,of
R16644 T23145 T23139 cc and,upstream
R16645 T23146 T23148 nummod 5,deletions
R16646 T23147 T23148 compound ′,deletions
R16647 T23148 T23150 nsubjpass deletions,generated
R16648 T23149 T23150 auxpass were,generated
R16649 T23150 T23138 conj generated,inserted
R16650 T23151 T23150 advcl using,generated
R16651 T23152 T23154 compound restriction,sites
R16652 T23153 T23154 compound enzyme,sites
R16653 T23154 T23151 dobj sites,using
R16654 T23155 T23151 cc or,using
R16655 T23156 T23150 prep with,generated
R16656 T23157 T23160 amod specific,primers
R16657 T23158 T23160 amod oligonucleotide,primers
R16658 T23159 T23160 compound PCR,primers
R16659 T23160 T23156 pobj primers,with
R16660 T23161 T23150 punct .,generated
R16661 T23162 T23163 amod Construct,names
R16662 T23163 T23164 nsubj names,indicate
R16663 T23164 T23164 ROOT indicate,indicate
R16664 T23165 T23169 det the,nucleotide
R16665 T23166 T23167 advmod most,5
R16666 T23167 T23168 nummod 5,′
R16667 T23168 T23169 compound ′,nucleotide
R16668 T23169 T23164 dobj nucleotide,indicate
R16669 T23170 T23169 prep of,nucleotide
R16670 T23171 T23176 nmod murine,sequence
R16671 T23172 T23171 nummod SerpinB2,murine
R16672 T23173 T23174 nummod 5,′
R16673 T23174 T23176 compound ′,sequence
R16674 T23175 T23176 compound flanking,sequence
R16675 T23176 T23170 pobj sequence,of
R16676 T23177 T23164 punct .,indicate
R16677 T23178 T23181 punct (,RAW
R16678 T23179 T23181 nmod B,RAW
R16679 T23180 T23181 punct ),RAW
R16680 T23181 T23186 intj RAW,transfected
R16681 T23182 T23181 nummod 264.7,RAW
R16682 T23183 T23186 nsubjpass macrophages,transfected
R16683 T23184 T23186 auxpass were,transfected
R16684 T23185 T23186 advmod transiently,transfected
R16685 T23186 T23186 ROOT transfected,transfected
R16686 T23187 T23186 prep with,transfected
R16687 T23188 T23194 det the,constructs
R16688 T23189 T23190 amod indicated,murine
R16689 T23190 T23194 compound murine,constructs
R16690 T23191 T23193 nmod SerpinB2,reporter
R16691 T23192 T23193 amod promoter-luciferase,reporter
R16692 T23193 T23194 compound reporter,constructs
R16693 T23194 T23187 pobj constructs,with
R16694 T23195 T23194 cc and,constructs
R16695 T23196 T23197 compound control,plasmids
R16696 T23197 T23194 conj plasmids,constructs
R16697 T23198 T23186 punct .,transfected
R16698 T23199 T23202 nsubjpass Cells,left
R16699 T23200 T23202 auxpass were,left
R16700 T23201 T23202 preconj either,left
R16701 T23202 T23202 ROOT left,left
R16702 T23203 T23202 oprd untreated,left
R16703 T23204 T23202 cc or,left
R16704 T23205 T23202 conj treated,left
R16705 T23206 T23205 prep with,treated
R16706 T23207 T23209 nummod 100,LPS
R16707 T23208 T23209 compound ng/ml,LPS
R16708 T23209 T23206 pobj LPS,with
R16709 T23210 T23209 cc or,LPS
R16710 T23211 T23213 nummod 40,PMA
R16711 T23212 T23213 compound ng/ml,PMA
R16712 T23213 T23209 conj PMA,LPS
R16713 T23214 T23205 prep for,treated
R16714 T23215 T23216 nummod 16,hrs
R16715 T23216 T23214 pobj hrs,for
R16716 T23217 T23202 punct .,left
R16717 T23218 T23218 ROOT Shown,Shown
R16718 T23219 T23218 auxpass is,Shown
R16719 T23220 T23225 det the,activity
R16720 T23221 T23225 amod relative,activity
R16721 T23222 T23225 compound luciferase,activity
R16722 T23223 T23225 compound reporter,activity
R16723 T23224 T23225 compound gene,activity
R16724 T23225 T23218 nsubjpass activity,Shown
R16725 T23226 T23225 prep following,activity
R16726 T23227 T23226 dobj treatment,following
R16727 T23228 T23218 punct .,Shown
R16728 T23229 T23230 det The,results
R16729 T23230 T23231 nsubj results,represent
R16730 T23231 T23231 ROOT represent,represent
R16731 T23232 T23233 det the,mean
R16732 T23233 T23231 dobj mean,represent
R16733 T23234 T23233 cc and,mean
R16734 T23235 T23233 conj SEM,mean
R16735 T23236 T23235 prep of,SEM
R16736 T23237 T23239 nummod four,experiments
R16737 T23238 T23239 amod independent,experiments
R16738 T23239 T23236 pobj experiments,of
R16739 T23240 T23231 punct .,represent
R16740 T23241 T23246 punct (,conservation
R16741 T23242 T23246 nmod C,conservation
R16742 T23243 T23242 punct ),C
R16743 T23244 T23245 compound DNA,sequence
R16744 T23245 T23246 compound sequence,conservation
R16745 T23246 T23246 ROOT conservation,conservation
R16746 T23247 T23246 prep between,conservation
R16747 T23248 T23256 det the,regions
R16748 T23249 T23252 amod human,SerpinB2
R16749 T23250 T23249 cc and,human
R16750 T23251 T23249 conj murine,human
R16751 T23252 T23256 nmod SerpinB2,regions
R16752 T23253 T23252 nummod 5,SerpinB2
R16753 T23254 T23256 compound ′,regions
R16754 T23255 T23256 compound flanking,regions
R16755 T23256 T23247 pobj regions,between
R16756 T23257 T23246 punct .,conservation
R16757 T23258 T23259 amod Schematic,representation
R16758 T23259 T23259 ROOT representation,representation
R16759 T23260 T23259 prep of,representation
R16760 T23261 T23269 det the,regions
R16761 T23262 T23265 amod human,SerpinB2
R16762 T23263 T23262 cc and,human
R16763 T23264 T23262 conj murine,human
R16764 T23265 T23269 nmod SerpinB2,regions
R16765 T23266 T23267 nummod 5,′
R16766 T23267 T23269 compound ′,regions
R16767 T23268 T23269 compound flanking,regions
R16768 T23269 T23260 pobj regions,of
R16769 T23270 T23269 prep with,regions
R16770 T23271 T23270 pobj regions,with
R16771 T23272 T23271 prep of,regions
R16772 T23273 T23275 amod nucleotide,identity
R16773 T23274 T23275 compound sequence,identity
R16774 T23275 T23272 pobj identity,of
R16775 T23276 T23259 acl indicated,representation
R16776 T23277 T23276 agent by,indicated
R16777 T23278 T23281 det the,boxes
R16778 T23279 T23281 amod same,boxes
R16779 T23280 T23281 amod colored,boxes
R16780 T23281 T23277 pobj boxes,by
R16781 T23282 T23259 punct .,representation
R16782 T23283 T23284 amod Homologous,regions
R16783 T23284 T23286 nsubjpass regions,interrupted
R16784 T23285 T23286 auxpass are,interrupted
R16785 T23286 T23286 ROOT interrupted,interrupted
R16786 T23287 T23286 agent by,interrupted
R16787 T23288 T23290 amod repetitive,elements
R16788 T23289 T23290 compound sequence,elements
R16789 T23290 T23287 pobj elements,by
R16790 T23291 T23290 prep in,elements
R16791 T23292 T23296 det both,regions
R16792 T23293 T23294 nummod 5,′
R16793 T23294 T23296 compound ′,regions
R16794 T23295 T23296 compound flanking,regions
R16795 T23296 T23291 pobj regions,in
R16796 T23297 T23286 punct .,interrupted
R16797 T23298 T23301 compound Alu,repeat
R16798 T23299 T23300 punct =,Alu
R16799 T23300 T23301 compound Alu,repeat
R16800 T23301 T23301 ROOT repeat,repeat
R16801 T23302 T23301 punct ",",repeat
R16802 T23303 T23305 quantmod ID4,ID4
R16803 T23304 T23305 punct =,ID4
R16804 T23305 T23309 nummod ID4,repeat
R16805 T23306 T23307 advmod short,interspersed
R16806 T23307 T23309 amod interspersed,repeat
R16807 T23308 T23309 amod nuclear,repeat
R16808 T23309 T23301 appos repeat,repeat
R16809 T23310 T23309 punct (,repeat
R16810 T23311 T23309 appos SINE,repeat
R16811 T23312 T23309 punct ),repeat
R16812 T23313 T23309 punct ",",repeat
R16813 T23314 T23320 nmod L1,element
R16814 T23315 T23316 punct =,L1
R16815 T23316 T23320 nummod L1,element
R16816 T23317 T23318 advmod long,interspersed
R16817 T23318 T23320 amod interspersed,element
R16818 T23319 T23320 amod nuclear,element
R16819 T23320 T23301 appos element,repeat
R16820 T23321 T23322 punct (,LINE
R16821 T23322 T23320 appos LINE,element
R16822 T23323 T23322 punct ),LINE
R16823 T23324 T23320 punct ",",element
R16824 T23325 T23328 compound L2,LINE
R16825 T23326 T23327 punct =,L2
R16826 T23327 T23328 compound L2,LINE
R16827 T23328 T23320 appos LINE,element
R16828 T23329 T23328 punct ",",LINE
R16829 T23330 T23333 compound MIR,SINE
R16830 T23331 T23330 punct =,MIR
R16831 T23332 T23333 compound MIR,SINE
R16832 T23333 T23328 appos SINE,LINE
R16833 T23334 T23333 punct ",",SINE
R16834 T23335 T23340 nmod MLT1L,repeat
R16835 T23336 T23337 punct =,MLT1L
R16836 T23337 T23340 nummod MLT1L,repeat
R16837 T23338 T23339 amod long,terminal
R16838 T23339 T23340 compound terminal,repeat
R16839 T23340 T23333 appos repeat,SINE
R16840 T23341 T23342 punct (,LTR
R16841 T23342 T23340 appos LTR,repeat
R16842 T23343 T23342 punct ),LTR
R16843 T23344 T23333 punct ",",SINE
R16844 T23345 T23346 punct (,TATG
R16845 T23346 T23333 appos TATG,SINE
R16846 T23347 T23333 punct ),SINE
R16847 T23348 T23352 nmod n,repeat
R16848 T23349 T23352 punct =,repeat
R16849 T23350 T23352 compound TATG,repeat
R16850 T23351 T23352 compound tetranucleotide,repeat
R16851 T23352 T23358 nmod repeat,site
R16852 T23353 T23352 punct ",",repeat
R16853 T23354 T23358 compound tis,site
R16854 T23355 T23356 punct =,transcription
R16855 T23356 T23357 compound transcription,initiation
R16856 T23357 T23358 compound initiation,site
R16857 T23358 T23301 appos site,repeat
R16858 T23359 T23301 punct .,repeat
R16983 T23630 T23633 amod Potential,elements
R16984 T23631 T23633 amod cis-acting,elements
R16985 T23632 T23633 amod regulatory,elements
R16986 T23633 T23633 ROOT elements,elements
R16987 T23634 T23633 prep in,elements
R16988 T23635 T23638 det the,region
R16989 T23636 T23638 nmod LPS,region
R16990 T23637 T23638 amod responsive,region
R16991 T23638 T23634 pobj region,in
R16992 T23639 T23638 prep of,region
R16993 T23640 T23643 det the,promoter
R16994 T23641 T23643 compound murine,promoter
R16995 T23642 T23643 compound SerpinB2,promoter
R16996 T23643 T23639 pobj promoter,of
R16997 T23644 T23648 nmod −,1
R16998 T23645 T23644 nummod 563,−
R16999 T23646 T23648 nummod /,1
R17000 T23647 T23648 compound −,1
R17001 T23648 T23643 appos 1,promoter
R17002 T23649 T23633 punct .,elements
R17003 T23650 T23656 nsubjpass Mouse,aligned
R17004 T23651 T23650 cc and,Mouse
R17005 T23652 T23654 amod human,sequences
R17006 T23653 T23654 compound nucleotide,sequences
R17007 T23654 T23650 conj sequences,Mouse
R17008 T23655 T23656 auxpass were,aligned
R17009 T23656 T23656 ROOT aligned,aligned
R17010 T23657 T23656 advcl using,aligned
R17011 T23658 T23660 amod Clustal,software
R17012 T23659 T23660 compound W,software
R17013 T23660 T23657 dobj software,using
R17014 T23661 T23656 punct .,aligned
R17015 T23662 T23663 amod Cis-acting,elements
R17016 T23663 T23664 nsubj elements,conserved
R17017 T23664 T23664 ROOT conserved,conserved
R17018 T23665 T23664 prep between,conserved
R17019 T23666 T23671 det the,promoters
R17020 T23667 T23671 amod human,promoters
R17021 T23668 T23667 cc and,human
R17022 T23669 T23667 conj murine,human
R17023 T23670 T23671 compound SerpinB2,promoters
R17024 T23671 T23665 pobj promoters,between
R17025 T23672 T23673 auxpass are,boxed
R17026 T23673 T23664 conj boxed,conserved
R17027 T23674 T23673 cc and,boxed
R17028 T23675 T23673 conj labeled,boxed
R17029 T23676 T23664 punct .,conserved
R17030 T23677 T23680 nummod AP-1,protein
R17031 T23678 T23679 punct =,activator
R17032 T23679 T23680 compound activator,protein
R17033 T23680 T23680 ROOT protein,protein
R17034 T23681 T23680 nummod 1,protein
R17035 T23682 T23686 punct ;,enhancer
R17036 T23683 T23686 compound C/EBP,enhancer
R17037 T23684 T23685 punct =,CCAAT
R17038 T23685 T23686 compound CCAAT,enhancer
R17039 T23686 T23680 appos enhancer,protein
R17040 T23687 T23688 amod binding,protein
R17041 T23688 T23686 appos protein,enhancer
R17042 T23689 T23686 punct ;,enhancer
R17043 T23690 T23692 nmod CRE,cAMP
R17044 T23691 T23692 punct =,cAMP
R17045 T23692 T23694 compound cAMP,element
R17046 T23693 T23694 compound response,element
R17047 T23694 T23686 appos element,enhancer
R17048 T23695 T23701 punct ;,1/POU2F1
R17049 T23696 T23701 compound Oct1,1/POU2F1
R17050 T23697 T23698 punct =,octamer
R17051 T23698 T23700 amod octamer,factor
R17052 T23699 T23700 compound transcription,factor
R17053 T23700 T23701 compound factor,1/POU2F1
R17054 T23701 T23686 appos 1/POU2F1,enhancer
R17055 T23702 T23701 punct ;,1/POU2F1
R17056 T23703 T23707 nmod PU,box
R17057 T23704 T23703 nummod .1,PU
R17058 T23705 T23706 punct =,purine
R17059 T23706 T23707 compound purine,box
R17060 T23707 T23709 compound box,protein
R17061 T23708 T23709 amod binding,protein
R17062 T23709 T23701 appos protein,1/POU2F1
R17063 T23710 T23709 nummod 1,protein
R17064 T23711 T23686 punct .,enhancer
R17065 T23712 T23716 det The,site
R17066 T23713 T23716 amod putative,site
R17067 T23714 T23715 compound transcription,initiation
R17068 T23715 T23716 compound initiation,site
R17069 T23716 T23721 nsubjpass site,indicated
R17070 T23717 T23716 punct (,site
R17071 T23718 T23716 appos tis,site
R17072 T23719 T23716 punct ),site
R17073 T23720 T23721 auxpass is,indicated
R17074 T23721 T23721 ROOT indicated,indicated
R17075 T23722 T23721 cc and,indicated
R17076 T23723 T23726 nsubjpass exon,presented
R17077 T23724 T23723 nummod 1,exon
R17078 T23725 T23726 auxpass is,presented
R17079 T23726 T23721 conj presented,indicated
R17080 T23727 T23726 prep in,presented
R17081 T23728 T23727 pobj uppercase,in
R17082 T23729 T23726 punct .,presented
R17083 T23730 T23731 det The,location
R17084 T23731 T23736 nsubj location,ends
R17085 T23732 T23731 prep of,location
R17086 T23733 T23734 det the,5
R17087 T23734 T23732 pobj 5,of
R17088 T23735 T23736 punct ',ends
R17089 T23736 T23751 nsubjpass ends,shown
R17090 T23737 T23736 prep of,ends
R17091 T23738 T23739 det the,−
R17092 T23739 T23737 pobj −,of
R17093 T23740 T23739 nummod 539,−
R17094 T23741 T23739 punct ",",−
R17095 T23742 T23743 nummod −,189
R17096 T23743 T23739 conj 189,−
R17097 T23744 T23743 cc and,189
R17098 T23745 T23748 nmod −,constructs
R17099 T23746 T23748 nummod 87,constructs
R17100 T23747 T23748 compound reporter,constructs
R17101 T23748 T23736 conj constructs,ends
R17102 T23749 T23751 auxpass are,shown
R17103 T23750 T23751 advmod also,shown
R17104 T23751 T23751 ROOT shown,shown
R17105 T23752 T23751 punct .,shown
R17240 T23998 T23998 ROOT Identification,Identification
R17241 T23999 T23998 prep of,Identification
R17242 T24000 T24001 amod cis-acting,elements
R17243 T24001 T23999 pobj elements,of
R17244 T24002 T24001 acl required,elements
R17245 T24003 T24002 prep for,required
R17246 T24004 T24005 det the,LPS-responsiveness
R17247 T24005 T24003 pobj LPS-responsiveness,for
R17248 T24006 T24005 prep of,LPS-responsiveness
R17249 T24007 T24010 det the,promoter
R17250 T24008 T24010 compound murine,promoter
R17251 T24009 T24010 compound SerpinB2,promoter
R17252 T24010 T24006 pobj promoter,of
R17253 T24011 T23998 punct .,Identification
R17254 T24012 T24013 punct (,A
R17255 T24013 T24016 nmod A,representation
R17256 T24014 T24013 punct ),A
R17257 T24015 T24016 amod Schematic,representation
R17258 T24016 T24037 nsubj representation,indicated
R17259 T24017 T24016 prep of,representation
R17260 T24018 T24023 det the,region
R17261 T24019 T24023 nmod −,region
R17262 T24020 T24019 nummod 539,−
R17263 T24021 T24023 amod /,region
R17264 T24022 T24023 nummod +92,region
R17265 T24023 T24017 pobj region,of
R17266 T24024 T24023 prep of,region
R17267 T24025 T24028 det the,promoter
R17268 T24026 T24028 compound murine,promoter
R17269 T24027 T24028 compound SerpinB2,promoter
R17270 T24028 T24024 pobj promoter,of
R17271 T24029 T24028 prep with,promoter
R17272 T24030 T24031 det the,location
R17273 T24031 T24029 pobj location,with
R17274 T24032 T24031 prep of,location
R17275 T24033 T24036 nmod candidate,elements
R17276 T24034 T24036 amod cis-acting,elements
R17277 T24035 T24036 amod regulatory,elements
R17278 T24036 T24032 pobj elements,of
R17279 T24037 T24037 ROOT indicated,indicated
R17280 T24038 T24037 prep with,indicated
R17281 T24039 T24038 pobj boxes,with
R17282 T24040 T24037 punct .,indicated
R17283 T24041 T24042 det The,location
R17284 T24042 T24062 nsubjpass location,shown
R17285 T24043 T24042 prep of,location
R17286 T24044 T24047 det the,ends
R17287 T24045 T24046 nummod 5,′
R17288 T24046 T24047 compound ′,ends
R17289 T24047 T24043 pobj ends,of
R17290 T24048 T24047 prep of,ends
R17291 T24049 T24050 det the,−
R17292 T24050 T24048 pobj −,of
R17293 T24051 T24050 nummod 539,−
R17294 T24052 T24042 punct ",",location
R17295 T24053 T24054 nummod −,189
R17296 T24054 T24042 conj 189,location
R17297 T24055 T24054 cc and,189
R17298 T24056 T24054 conj −,189
R17299 T24057 T24059 nummod 87,constructs
R17300 T24058 T24059 compound reporter,constructs
R17301 T24059 T24042 appos constructs,location
R17302 T24060 T24062 auxpass is,shown
R17303 T24061 T24062 advmod also,shown
R17304 T24062 T24062 ROOT shown,shown
R17305 T24063 T24062 punct .,shown
R17306 T24064 T24086 nsubjpass Positions,indicated
R17307 T24065 T24064 prep of,Positions
R17308 T24066 T24070 nmod murine,primers
R17309 T24067 T24066 nummod SerpinB2,murine
R17310 T24068 T24070 amod proximal,primers
R17311 T24069 T24070 amod promoter-specific,primers
R17312 T24070 T24065 pobj primers,of
R17313 T24071 T24086 punct ",",indicated
R17314 T24072 T24086 nsubjpass 338,indicated
R17315 T24073 T24086 nsubjpass /,indicated
R17316 T24074 T24086 nsubjpass −,indicated
R17317 T24075 T24074 nummod 315,−
R17318 T24076 T24074 cc and,−
R17319 T24077 T24080 nummod −,+19
R17320 T24078 T24079 nummod 5,/
R17321 T24079 T24080 compound /,+19
R17322 T24080 T24074 conj +19,−
R17323 T24081 T24080 acl used,+19
R17324 T24082 T24081 prep in,used
R17325 T24083 T24084 compound ChIP,assays
R17326 T24084 T24082 pobj assays,in
R17327 T24085 T24086 auxpass are,indicated
R17328 T24086 T24086 ROOT indicated,indicated
R17329 T24087 T24086 punct .,indicated
R17330 T24088 T24091 punct (,RAW
R17331 T24089 T24091 nmod B,RAW
R17332 T24090 T24091 punct ),RAW
R17333 T24091 T24096 nsubjpass RAW,transfected
R17334 T24092 T24091 nummod 264.7,RAW
R17335 T24093 T24096 nsubjpass macrophages,transfected
R17336 T24094 T24096 auxpass were,transfected
R17337 T24095 T24096 advmod transiently,transfected
R17338 T24096 T24096 ROOT transfected,transfected
R17339 T24097 T24096 prep with,transfected
R17340 T24098 T24104 det the,constructs
R17341 T24099 T24100 amod indicated,murine
R17342 T24100 T24104 compound murine,constructs
R17343 T24101 T24103 nmod SerpinB2,reporter
R17344 T24102 T24103 amod promoter-luciferase,reporter
R17345 T24103 T24104 compound reporter,constructs
R17346 T24104 T24097 pobj constructs,with
R17347 T24105 T24096 cc and,transfected
R17348 T24106 T24107 preconj either,left
R17349 T24107 T24096 conj left,transfected
R17350 T24108 T24107 oprd untreated,left
R17351 T24109 T24108 cc or,untreated
R17352 T24110 T24108 conj treated,untreated
R17353 T24111 T24110 prep with,treated
R17354 T24112 T24114 nummod 100,LPS
R17355 T24113 T24114 compound ng/ml,LPS
R17356 T24114 T24111 pobj LPS,with
R17357 T24115 T24110 prep for,treated
R17358 T24116 T24117 nummod 16,hrs
R17359 T24117 T24115 pobj hrs,for
R17360 T24118 T24096 punct .,transfected
R17361 T24119 T24120 det The,results
R17362 T24120 T24121 nsubj results,show
R17363 T24121 T24121 ROOT show,show
R17364 T24122 T24124 amod relative,activity
R17365 T24123 T24124 compound luciferase,activity
R17366 T24124 T24121 dobj activity,show
R17367 T24125 T24124 prep following,activity
R17368 T24126 T24127 compound LPS,treatment
R17369 T24127 T24125 pobj treatment,following
R17370 T24128 T24121 cc and,show
R17371 T24129 T24121 conj represent,show
R17372 T24130 T24131 det the,mean
R17373 T24131 T24129 dobj mean,represent
R17374 T24132 T24131 cc and,mean
R17375 T24133 T24131 conj SEM,mean
R17376 T24134 T24133 prep of,SEM
R17377 T24135 T24134 pobj 4,of
R17378 T24136 T24138 nummod 7,experiments
R17379 T24137 T24138 amod independent,experiments
R17380 T24138 T24133 appos experiments,SEM
R17381 T24139 T24121 punct .,show
R17429 T24333 T24336 det The,factor
R17430 T24334 T24336 amod LPS-inducible,factor
R17431 T24335 T24336 amod nuclear,factor
R17432 T24336 T24337 nsubj factor,binding
R17433 T24337 T24337 ROOT binding,binding
R17434 T24338 T24344 det the,site
R17435 T24339 T24344 amod murine,site
R17436 T24340 T24342 nmod SerpinB2,promoter
R17437 T24341 T24342 amod proximal,promoter
R17438 T24342 T24344 compound promoter,site
R17439 T24343 T24344 compound C/EBP,site
R17440 T24344 T24345 nsubj site,contains
R17441 T24345 T24337 ccomp contains,binding
R17442 T24346 T24348 compound C/EBP,β
R17443 T24347 T24348 punct -,β
R17444 T24348 T24345 dobj β,contains
R17445 T24349 T24337 punct .,binding
R17446 T24350 T24353 punct (,EMSA
R17447 T24351 T24353 nmod A,EMSA
R17448 T24352 T24353 punct ),EMSA
R17449 T24353 T24366 nsubj EMSA,treated
R17450 T24354 T24353 prep with,EMSA
R17451 T24355 T24356 amod nuclear,extracts
R17452 T24356 T24354 pobj extracts,with
R17453 T24357 T24356 prep from,extracts
R17454 T24358 T24360 amod untreated,UN
R17455 T24359 T24360 punct (,UN
R17456 T24360 T24357 pobj UN,from
R17457 T24361 T24360 punct ),UN
R17458 T24362 T24360 cc and,UN
R17459 T24363 T24365 nummod 10,LPS
R17460 T24364 T24365 compound hr,LPS
R17461 T24365 T24360 conj LPS,UN
R17462 T24366 T24366 ROOT treated,treated
R17463 T24367 T24370 punct (,RAW
R17464 T24368 T24370 nmod LPS,RAW
R17465 T24369 T24370 punct ),RAW
R17466 T24370 T24372 nmod RAW,cells
R17467 T24371 T24370 nummod 264.7,RAW
R17468 T24372 T24366 dobj cells,treated
R17469 T24373 T24372 acl incubated,cells
R17470 T24374 T24373 prep with,incubated
R17471 T24375 T24385 preconj either,probe
R17472 T24376 T24385 det the,probe
R17473 T24377 T24385 nmod murine,probe
R17474 T24378 T24379 compound SerpinB2,promoter
R17475 T24379 T24385 nmod promoter,probe
R17476 T24380 T24385 nmod −,probe
R17477 T24381 T24385 nummod 212,probe
R17478 T24382 T24385 nummod /,probe
R17479 T24383 T24385 nmod −,probe
R17480 T24384 T24385 nummod 185,probe
R17481 T24385 T24374 pobj probe,with
R17482 T24386 T24385 acl containing,probe
R17483 T24387 T24400 det an,site
R17484 T24388 T24400 amod intact,site
R17485 T24389 T24391 punct (,C/EBP
R17486 T24390 T24391 nummod SerpinB2,C/EBP
R17487 T24391 T24388 appos C/EBP,intact
R17488 T24392 T24391 punct ),C/EBP
R17489 T24393 T24388 cc or,intact
R17490 T24394 T24388 conj mutated,intact
R17491 T24395 T24397 punct (,C/EBP
R17492 T24396 T24397 amod mutant,C/EBP
R17493 T24397 T24400 meta C/EBP,site
R17494 T24398 T24397 punct ),C/EBP
R17495 T24399 T24400 compound C/EBP,site
R17496 T24400 T24386 dobj site,containing
R17497 T24401 T24374 cc or,with
R17498 T24402 T24374 conj with,with
R17499 T24403 T24404 det the,rat
R17500 T24404 T24415 nsubj rat,probe
R17501 T24405 T24409 compound albumin,C/EBP
R17502 T24406 T24409 compound promoter,C/EBP
R17503 T24407 T24408 compound DEI,region
R17504 T24408 T24409 compound region,C/EBP
R17505 T24409 T24415 punct C/EBP,probe
R17506 T24410 T24412 punct (,albumin
R17507 T24411 T24412 compound rat,albumin
R17508 T24412 T24409 parataxis albumin,C/EBP
R17509 T24413 T24415 compound C/EBP,probe
R17510 T24414 T24415 punct ),probe
R17511 T24415 T24402 pobj probe,with
R17512 T24416 T24366 punct .,treated
R17513 T24417 T24417 ROOT (,(
R17514 T24418 T24417 dep B,(
R17515 T24419 T24418 punct ),B
R17516 T24420 T24422 compound Cold,EMSAs
R17517 T24421 T24422 compound competition,EMSAs
R17518 T24422 T24448 nsubj EMSAs,described
R17519 T24423 T24422 acl performed,EMSAs
R17520 T24424 T24423 prep with,performed
R17521 T24425 T24447 det the,oligonucleotides
R17522 T24426 T24427 amod radiolabelled,murine
R17523 T24427 T24447 nmod murine,oligonucleotides
R17524 T24428 T24429 compound SerpinB2,promoter
R17525 T24429 T24447 nmod promoter,oligonucleotides
R17526 T24430 T24447 nmod −,oligonucleotides
R17527 T24431 T24447 nummod 212,oligonucleotides
R17528 T24432 T24447 nummod /,oligonucleotides
R17529 T24433 T24446 npadvmod −,stranded
R17530 T24434 T24435 nummod 185,probe
R17531 T24435 T24433 appos probe,−
R17532 T24436 T24435 cc and,probe
R17533 T24437 T24440 det a,excess
R17534 T24438 T24440 amod 100-fold,excess
R17535 T24439 T24440 compound molar,excess
R17536 T24440 T24435 conj excess,probe
R17537 T24441 T24440 prep of,excess
R17538 T24442 T24441 pobj each,of
R17539 T24443 T24442 prep of,each
R17540 T24444 T24445 det the,double
R17541 T24445 T24443 pobj double,of
R17542 T24446 T24447 amod stranded,oligonucleotides
R17543 T24447 T24448 nsubj oligonucleotides,described
R17544 T24448 T24448 ROOT described,described
R17545 T24449 T24448 prep in,described
R17546 T24450 T24451 punct (,A
R17547 T24451 T24449 pobj A,in
R17548 T24452 T24448 punct ),described
R17549 T24453 T24453 ROOT demonstrate,demonstrate
R17550 T24454 T24455 det the,specificity
R17551 T24455 T24453 dobj specificity,demonstrate
R17552 T24456 T24455 prep of,specificity
R17553 T24457 T24459 det the,complexes
R17554 T24458 T24459 amod DNA-protein,complexes
R17555 T24459 T24456 pobj complexes,of
R17556 T24460 T24453 punct .,demonstrate
R17557 T24461 T24467 punct (,performed
R17558 T24462 T24465 nmod C,assays
R17559 T24463 T24462 punct ),C
R17560 T24464 T24465 compound Supershift,assays
R17561 T24465 T24467 nsubjpass assays,performed
R17562 T24466 T24467 auxpass were,performed
R17563 T24467 T24467 ROOT performed,performed
R17564 T24468 T24467 prep with,performed
R17565 T24469 T24470 det the,−
R17566 T24470 T24468 pobj −,with
R17567 T24471 T24473 nummod 212,−
R17568 T24472 T24473 nummod /,−
R17569 T24473 T24470 appos −,−
R17570 T24474 T24475 nummod 185,probe
R17571 T24475 T24473 appos probe,−
R17572 T24476 T24475 prep by,probe
R17573 T24477 T24475 prep after,probe
R17574 T24478 T24477 pobj preincubation,after
R17575 T24479 T24478 prep with,preincubation
R17576 T24480 T24484 det the,antibody
R17577 T24481 T24484 amod indicated,antibody
R17578 T24482 T24484 amod specific,antibody
R17579 T24483 T24484 compound C/EBP,antibody
R17580 T24484 T24479 pobj antibody,with
R17581 T24485 T24473 punct .,−
R17582 T24486 T24488 det The,complex
R17583 T24487 T24488 amod LPS-inducible,complex
R17584 T24488 T24490 nsubjpass complex,indicated
R17585 T24489 T24490 auxpass is,indicated
R17586 T24490 T24490 ROOT indicated,indicated
R17587 T24491 T24490 prep with,indicated
R17588 T24492 T24493 det an,arrowhead
R17589 T24493 T24491 pobj arrowhead,with
R17590 T24494 T24490 punct .,indicated
R17904 T25037 T25040 dep C/EBP,is
R17905 T25038 T25040 punct -,is
R17906 T25039 T25040 nsubj β,is
R17907 T25040 T25040 ROOT is,is
R17908 T25041 T25040 acomp essential,is
R17909 T25042 T25041 prep for,essential
R17910 T25043 T25048 amod constitutive,expression
R17911 T25044 T25043 cc and,constitutive
R17912 T25045 T25043 conj LPS-induced,constitutive
R17913 T25046 T25047 compound SerpinB2,mRNA
R17914 T25047 T25048 compound mRNA,expression
R17915 T25048 T25042 pobj expression,for
R17916 T25049 T25040 punct .,is
R17917 T25050 T25050 ROOT (,(
R17918 T25051 T25050 dep A,(
R17919 T25052 T25051 punct ),A
R17920 T25053 T25055 compound Endogenous,mRNA
R17921 T25054 T25055 compound SerpinB2,mRNA
R17922 T25055 T25056 compound mRNA,expression
R17923 T25056 T25058 nsubjpass expression,abrogated
R17924 T25057 T25058 auxpass is,abrogated
R17925 T25058 T25058 ROOT abrogated,abrogated
R17926 T25059 T25058 prep in,abrogated
R17927 T25060 T25061 compound Cebpb,−
R17928 T25061 T25059 pobj −,in
R17929 T25062 T25058 conj /,abrogated
R17930 T25063 T25064 nummod −,MEFs
R17931 T25064 T25062 dobj MEFs,/
R17932 T25065 T25062 prep compared,/
R17933 T25066 T25065 prep to,compared
R17934 T25067 T25068 compound Cebpb,+
R17935 T25068 T25069 compound +,/
R17936 T25069 T25066 pobj /,to
R17937 T25070 T25071 nummod +,MEFs
R17938 T25071 T25069 dobj MEFs,/
R17939 T25072 T25069 prep in,/
R17940 T25073 T25074 det the,absence
R17941 T25074 T25072 pobj absence,in
R17942 T25075 T25074 cc and,absence
R17943 T25076 T25074 conj presence,absence
R17944 T25077 T25074 prep of,absence
R17945 T25078 T25077 pobj LPS,of
R17946 T25079 T25058 punct .,abrogated
R17947 T25080 T25081 compound qPCR,analysis
R17948 T25081 T25095 nsubj analysis,−
R17949 T25082 T25081 prep of,analysis
R17950 T25083 T25086 amod murine,expression
R17951 T25084 T25085 compound SerpinB2,mRNA
R17952 T25085 T25086 compound mRNA,expression
R17953 T25086 T25082 pobj expression,of
R17954 T25087 T25086 prep in,expression
R17955 T25088 T25092 amod untreated,+
R17956 T25089 T25092 compound Cebpb,+
R17957 T25090 T25091 compound +,/
R17958 T25091 T25092 compound /,+
R17959 T25092 T25087 pobj +,in
R17960 T25093 T25092 cc and,+
R17961 T25094 T25095 compound Cebpb,−
R17962 T25095 T25095 ROOT −,−
R17963 T25096 T25098 nummod /,MEFs
R17964 T25097 T25098 nummod −,MEFs
R17965 T25098 T25095 dobj MEFs,−
R17966 T25099 T25095 punct ",",−
R17967 T25100 T25095 cc and,−
R17968 T25101 T25095 conj after,−
R17969 T25102 T25101 pobj simulation,after
R17970 T25103 T25102 prep with,simulation
R17971 T25104 T25103 pobj LPS,with
R17972 T25105 T25107 punct (,ng/ml
R17973 T25106 T25107 nummod 100,ng/ml
R17974 T25107 T25104 appos ng/ml,LPS
R17975 T25108 T25095 punct ),−
R17976 T25109 T25095 prep for,−
R17977 T25110 T25112 det the,times
R17978 T25111 T25112 amod indicated,times
R17979 T25112 T25109 pobj times,for
R17980 T25113 T25095 punct .,−
R17981 T25114 T25119 punct (,expression
R17982 T25115 T25119 nmod B,expression
R17983 T25116 T25119 punct ),expression
R17984 T25117 T25119 compound Endogenous,expression
R17985 T25118 T25119 compound SerpinB2,expression
R17986 T25119 T25121 nsubjpass expression,abrogated
R17987 T25120 T25121 auxpass is,abrogated
R17988 T25121 T25121 ROOT abrogated,abrogated
R17989 T25122 T25121 prep in,abrogated
R17990 T25123 T25122 pobj C/EBP,in
R17991 T25124 T25125 punct -,β-deficient
R17992 T25125 T25127 amod β-deficient,macrophages
R17993 T25126 T25127 amod inflammatory,macrophages
R17994 T25127 T25121 conj macrophages,abrogated
R17995 T25128 T25121 punct .,abrogated
R17996 T25129 T25131 amod Thioglycollate-elicited,macrophages
R17997 T25130 T25131 amod peritoneal,macrophages
R17998 T25131 T25137 nsubjpass macrophages,infected
R17999 T25132 T25131 punct (,macrophages
R18000 T25133 T25134 compound TG,macs
R18001 T25134 T25131 appos macs,macrophages
R18002 T25135 T25131 punct ),macrophages
R18003 T25136 T25137 auxpass were,infected
R18004 T25137 T25137 ROOT infected,infected
R18005 T25138 T25137 prep with,infected
R18006 T25139 T25144 amod human,shRNAs
R18007 T25140 T25139 cc and,human
R18008 T25141 T25139 conj murine,human
R18009 T25142 T25144 amod specific,shRNAs
R18010 T25143 T25144 amod lentiviral,shRNAs
R18011 T25144 T25138 pobj shRNAs,with
R18012 T25145 T25137 punct .,infected
R18013 T25146 T25148 compound Human,shRNA
R18014 T25147 T25148 compound CEBPB,shRNA
R18015 T25148 T25149 nsubj shRNA,serves
R18016 T25149 T25149 ROOT serves,serves
R18017 T25150 T25149 prep as,serves
R18018 T25151 T25153 det the,control
R18019 T25152 T25153 amod non-silencing,control
R18020 T25153 T25150 pobj control,as
R18021 T25154 T25158 mark since,target
R18022 T25155 T25158 nsubj it,target
R18023 T25156 T25158 aux does,target
R18024 T25157 T25158 neg not,target
R18025 T25158 T25149 advcl target,serves
R18026 T25159 T25162 det the,sequence
R18027 T25160 T25162 compound murine,sequence
R18028 T25161 T25162 compound Cebpb,sequence
R18029 T25162 T25158 dobj sequence,target
R18030 T25163 T25165 nmod [,]
R18031 T25164 T25165 nummod 38,]
R18032 T25165 T25158 npadvmod ],target
R18033 T25166 T25149 punct .,serves
R18034 T25167 T25168 nsubj Lentiviral,transduced
R18035 T25168 T25168 ROOT transduced,transduced
R18036 T25169 T25171 nsubjpass macrophages,stimulated
R18037 T25170 T25171 auxpass were,stimulated
R18038 T25171 T25168 ccomp stimulated,transduced
R18039 T25172 T25171 prep with,stimulated
R18040 T25173 T25172 pobj LPS,with
R18041 T25174 T25173 punct (,LPS
R18042 T25175 T25176 nummod 100,ng/ml
R18043 T25176 T25173 appos ng/ml,LPS
R18044 T25177 T25173 punct ),LPS
R18045 T25178 T25171 prep for,stimulated
R18046 T25179 T25180 nummod 4,hrs
R18047 T25180 T25178 pobj hrs,for
R18048 T25181 T25171 punct .,stimulated
R18049 T25182 T25187 advcl Left,shows
R18050 T25183 T25187 punct :,shows
R18051 T25184 T25186 amod Western,analysis
R18052 T25185 T25186 compound blot,analysis
R18053 T25186 T25187 nsubj analysis,shows
R18054 T25187 T25187 ROOT shows,shows
R18055 T25188 T25189 amod effective,knockdown
R18056 T25189 T25187 dobj knockdown,shows
R18057 T25190 T25189 prep of,knockdown
R18058 T25191 T25194 amod endogenous,β
R18059 T25192 T25194 compound C/EBP,β
R18060 T25193 T25194 punct -,β
R18061 T25194 T25190 pobj β,of
R18062 T25195 T25189 prep following,knockdown
R18063 T25196 T25195 pobj infection,following
R18064 T25197 T25196 prep with,infection
R18065 T25198 T25200 compound murine,shRNA
R18066 T25199 T25200 compound Cebpb,shRNA
R18067 T25200 T25197 pobj shRNA,with
R18068 T25201 T25200 cc and,shRNA
R18069 T25202 T25203 neg not,human
R18070 T25203 T25205 amod human,shRNA
R18071 T25204 T25205 compound CEBPB,shRNA
R18072 T25205 T25200 conj shRNA,shRNA
R18073 T25206 T25187 punct .,shows
R18074 T25207 T25210 amod Right,analysis
R18075 T25208 T25207 punct :,Right
R18076 T25209 T25210 amod qPCR,analysis
R18077 T25210 T25210 ROOT analysis,analysis
R18078 T25211 T25210 prep of,analysis
R18079 T25212 T25215 amod murine,expression
R18080 T25213 T25214 compound SerpinB2,mRNA
R18081 T25214 T25215 compound mRNA,expression
R18082 T25215 T25211 pobj expression,of
R18083 T25216 T25210 prep in,analysis
R18084 T25217 T25221 det the,macrophages
R18085 T25218 T25221 amod lentiviral,macrophages
R18086 T25219 T25221 amod transduced,macrophages
R18087 T25220 T25221 amod peritoneal,macrophages
R18088 T25221 T25216 pobj macrophages,in
R18089 T25222 T25210 punct .,analysis
R18090 T25223 T25224 det The,results
R18091 T25224 T25225 nsubj results,represent
R18092 T25225 T25225 ROOT represent,represent
R18093 T25226 T25227 det the,mean
R18094 T25227 T25225 dobj mean,represent
R18095 T25228 T25227 cc and,mean
R18096 T25229 T25227 conj SEM,mean
R18097 T25230 T25229 prep of,SEM
R18098 T25231 T25233 nummod two,experiments
R18099 T25232 T25233 amod independent,experiments
R18100 T25233 T25230 pobj experiments,of
R18101 T25234 T25233 acl performed,experiments
R18102 T25235 T25234 prep in,performed
R18103 T25236 T25235 pobj duplicate,in
R18104 T25237 T25236 cc or,duplicate
R18105 T25238 T25236 conj triplicate,duplicate
R18106 T25239 T25225 punct .,represent
R18107 T25240 T25243 punct (,p
R18108 T25241 T25243 punct *,p
R18109 T25242 T25243 punct ",",p
R18110 T25243 T25243 ROOT p,p
R18111 T25244 T25245 compound <,0.05
R18112 T25245 T25243 dobj 0.05,p
R18113 T25246 T25248 punct ",",ANOVA
R18114 T25247 T25248 amod two-way,ANOVA
R18115 T25248 T25243 npadvmod ANOVA,p
R18116 T25249 T25243 punct ),p
R18117 T25250 T25243 punct .,p
R18341 T25742 T25743 compound Differential,recruitment
R18342 T25743 T25743 ROOT recruitment,recruitment
R18343 T25744 T25743 prep of,recruitment
R18344 T25745 T25744 pobj C/EBP,of
R18345 T25746 T25743 punct -,recruitment
R18346 T25747 T25743 conj β,recruitment
R18347 T25748 T25747 cc and,β
R18348 T25749 T25751 compound C/EBP,βT217
R18349 T25750 T25751 punct -,βT217
R18350 T25751 T25751 ROOT βT217,βT217
R18351 T25752 T25751 prep to,βT217
R18352 T25753 T25756 det the,promoter
R18353 T25754 T25756 compound murine,promoter
R18354 T25755 T25756 compound SerpinB2,promoter
R18355 T25756 T25752 pobj promoter,to
R18356 T25757 T25756 prep in,promoter
R18357 T25758 T25757 pobj vivo,in
R18358 T25759 T25751 punct .,βT217
R18359 T25760 T25761 compound Transcription,factor
R18360 T25761 T25762 compound factor,occupancy
R18361 T25762 T25771 nsubjpass occupancy,determined
R18362 T25763 T25762 prep on,occupancy
R18363 T25764 T25767 det the,promoter
R18364 T25765 T25767 nmod SerpinB2,promoter
R18365 T25766 T25767 amod proximal,promoter
R18366 T25767 T25763 pobj promoter,on
R18367 T25768 T25767 prep in,promoter
R18368 T25769 T25768 pobj vivo,in
R18369 T25770 T25771 auxpass was,determined
R18370 T25771 T25771 ROOT determined,determined
R18371 T25772 T25771 agent by,determined
R18372 T25773 T25774 compound chromatin,immunoprecipitation
R18373 T25774 T25772 pobj immunoprecipitation,by
R18374 T25775 T25776 punct (,ChIP
R18375 T25776 T25774 appos ChIP,immunoprecipitation
R18376 T25777 T25776 punct ),ChIP
R18377 T25778 T25774 conj assay,immunoprecipitation
R18378 T25779 T25771 punct .,determined
R18379 T25780 T25782 nummod RAW264,macrophages
R18380 T25781 T25782 nummod .7,macrophages
R18381 T25782 T25784 nsubjpass macrophages,treated
R18382 T25783 T25784 auxpass were,treated
R18383 T25784 T25784 ROOT treated,treated
R18384 T25785 T25784 prep in,treated
R18385 T25786 T25787 det the,presence
R18386 T25787 T25785 pobj presence,in
R18387 T25788 T25787 cc or,presence
R18388 T25789 T25787 conj absence,presence
R18389 T25790 T25789 prep of,absence
R18390 T25791 T25790 pobj LPS,of
R18391 T25792 T25784 prep for,treated
R18392 T25793 T25795 det the,times
R18393 T25794 T25795 amod indicated,times
R18394 T25795 T25792 pobj times,for
R18395 T25796 T25795 cc and,times
R18396 T25797 T25798 compound chromatin,immunoprecipitation
R18397 T25798 T25799 nsubj immunoprecipitation,performed
R18398 T25799 T25784 advcl performed,treated
R18399 T25800 T25799 advcl using,performed
R18400 T25801 T25800 dobj antibodies,using
R18401 T25802 T25800 prep against,using
R18402 T25803 T25802 pobj C/EBP,against
R18403 T25804 T25805 punct -,β
R18404 T25805 T25800 conj β,using
R18405 T25806 T25805 cc or,β
R18406 T25807 T25805 conj p-C/EBP,β
R18407 T25808 T25809 punct -,β
R18408 T25809 T25805 appos β,β
R18409 T25810 T25809 punct (,β
R18410 T25811 T25809 appos T217,β
R18411 T25812 T25809 punct ),β
R18412 T25813 T25784 punct .,treated
R18413 T25814 T25815 amod Soluble,chromatin
R18414 T25815 T25822 nsubjpass chromatin,immunoprecipitated
R18415 T25816 T25819 punct (,ng
R18416 T25817 T25818 dep 600,700
R18417 T25818 T25819 nummod 700,ng
R18418 T25819 T25815 appos ng,chromatin
R18419 T25820 T25819 punct ),ng
R18420 T25821 T25822 auxpass was,immunoprecipitated
R18421 T25822 T25822 ROOT immunoprecipitated,immunoprecipitated
R18422 T25823 T25822 prep with,immunoprecipitated
R18423 T25824 T25823 pobj antibodies,with
R18424 T25825 T25824 prep against,antibodies
R18425 T25826 T25825 pobj C/EBP,against
R18426 T25827 T25828 punct -,β
R18427 T25828 T25822 advcl β,immunoprecipitated
R18428 T25829 T25828 punct ",",β
R18429 T25830 T25832 compound p-C/EBP,β
R18430 T25831 T25832 punct -,β
R18431 T25832 T25828 appos β,β
R18432 T25833 T25832 punct (,β
R18433 T25834 T25832 appos T217,β
R18434 T25835 T25832 punct ),β
R18435 T25836 T25832 punct ",",β
R18436 T25837 T25839 compound RNA,II
R18437 T25838 T25839 compound Polymerase,II
R18438 T25839 T25832 appos II,β
R18439 T25840 T25839 punct (,II
R18440 T25841 T25839 appos RNAPII,II
R18441 T25842 T25839 punct ),II
R18442 T25843 T25839 punct ",",II
R18443 T25844 T25832 cc or,β
R18444 T25845 T25846 det a,rabbit
R18445 T25846 T25851 compound rabbit,control
R18446 T25847 T25851 compound IgG,control
R18447 T25848 T25849 punct (,rIgG
R18448 T25849 T25847 appos rIgG,IgG
R18449 T25850 T25849 punct ),rIgG
R18450 T25851 T25832 conj control,β
R18451 T25852 T25822 punct .,immunoprecipitated
R18452 T25853 T25854 punct (,A
R18453 T25854 T25854 ROOT A,A
R18454 T25855 T25854 punct ),A
R18455 T25856 T25858 amod Typical,pattern
R18456 T25857 T25858 compound PCR,pattern
R18457 T25858 T25859 nsubj pattern,obtained
R18458 T25859 T25859 ROOT obtained,obtained
R18459 T25860 T25859 prep in,obtained
R18460 T25861 T25862 compound ChIP,assays
R18461 T25862 T25860 pobj assays,in
R18462 T25863 T25859 advcl using,obtained
R18463 T25864 T25868 amod murine,primers
R18464 T25865 T25868 amod SerpinB2,primers
R18465 T25866 T25868 amod proximal,primers
R18466 T25867 T25868 amod promoter-specific,primers
R18467 T25868 T25863 dobj primers,using
R18468 T25869 T25872 punct ",",−
R18469 T25870 T25871 compound 338,/
R18470 T25871 T25872 nsubj /,−
R18471 T25872 T25872 ROOT −,−
R18472 T25873 T25872 nummod 315,−
R18473 T25874 T25872 cc and,−
R18474 T25875 T25877 meta −,/
R18475 T25876 T25877 nummod 5,/
R18476 T25877 T25872 conj /,−
R18477 T25878 T25877 nummod +19,/
R18478 T25879 T25877 punct ",",/
R18479 T25880 T25881 mark as,diagrammed
R18480 T25881 T25872 amod diagrammed,−
R18481 T25882 T25881 prep in,diagrammed
R18482 T25883 T25882 pobj top,in
R18483 T25884 T25859 punct .,obtained
R18484 T25885 T25892 nsubj Recruitment,suggests
R18485 T25886 T25885 prep of,Recruitment
R18486 T25887 T25886 pobj RNAPII,of
R18487 T25888 T25885 prep to,Recruitment
R18488 T25889 T25891 det the,promoter
R18489 T25890 T25891 compound SerpinB2,promoter
R18490 T25891 T25888 pobj promoter,to
R18491 T25892 T25892 ROOT suggests,suggests
R18492 T25893 T25894 amod active,transcription
R18493 T25894 T25892 dobj transcription,suggests
R18494 T25895 T25894 acl following,transcription
R18495 T25896 T25897 compound LPS,stimulation
R18496 T25897 T25895 dobj stimulation,following
R18497 T25898 T25892 punct .,suggests
R18498 T25899 T25900 amod Minimal,background
R18499 T25900 T25902 nsubjpass background,detected
R18500 T25901 T25902 auxpass was,detected
R18501 T25902 T25902 ROOT detected,detected
R18502 T25903 T25902 advcl using,detected
R18503 T25904 T25907 det the,control
R18504 T25905 T25907 compound rabbit,control
R18505 T25906 T25907 compound IgG,control
R18506 T25907 T25903 dobj control,using
R18507 T25908 T25902 punct ",",detected
R18508 T25909 T25902 advcl indicative,detected
R18509 T25910 T25909 prep of,indicative
R18510 T25911 T25912 det the,specificity
R18511 T25912 T25910 pobj specificity,of
R18512 T25913 T25912 prep of,specificity
R18513 T25914 T25916 det the,reaction
R18514 T25915 T25916 compound ChIP,reaction
R18515 T25916 T25913 pobj reaction,of
R18516 T25917 T25902 punct .,detected
R18517 T25918 T25922 punct (,analysis
R18518 T25919 T25922 nmod B,analysis
R18519 T25920 T25919 punct ),B
R18520 T25921 T25922 compound qPCR,analysis
R18521 T25922 T25922 ROOT analysis,analysis
R18522 T25923 T25922 prep of,analysis
R18523 T25924 T25923 pobj chromatin,of
R18524 T25925 T25922 dep immunoprecipitated,analysis
R18525 T25926 T25925 prep with,immunoprecipitated
R18526 T25927 T25926 pobj antibodies,with
R18527 T25928 T25927 prep against,antibodies
R18528 T25929 T25928 pobj C/EBP,against
R18529 T25930 T25931 punct -,β
R18530 T25931 T25922 appos β,analysis
R18531 T25932 T25931 punct ",",β
R18532 T25933 T25935 compound p-C/EBP,β
R18533 T25934 T25935 punct -,β
R18534 T25935 T25931 appos β,β
R18535 T25936 T25935 punct (,β
R18536 T25937 T25935 appos T217,β
R18537 T25938 T25935 punct ),β
R18538 T25939 T25931 punct ",",β
R18539 T25940 T25931 cc and,β
R18540 T25941 T25943 det the,control
R18541 T25942 T25943 compound rIgG,control
R18542 T25943 T25931 conj control,β
R18543 T25944 T25922 punct .,analysis
R18544 T25945 T25946 det The,data
R18545 T25946 T25948 nsubjpass data,represented
R18546 T25947 T25948 auxpass are,represented
R18547 T25948 T25948 ROOT represented,represented
R18548 T25949 T25948 oprd relative,represented
R18549 T25950 T25948 prep to,represented
R18550 T25951 T25952 compound rIgG,signal
R18551 T25952 T25950 pobj signal,to
R18552 T25953 T25948 advcl using,represented
R18553 T25954 T25956 det the,method
R18554 T25955 T25956 amod 2-ΔΔCt,method
R18555 T25956 T25953 dobj method,using
R18556 T25957 T25948 punct .,represented
R18885 T26747 T26749 amod C/EBP,β
R18886 T26748 T26749 punct -,β
R18887 T26749 T26750 nsubj β,is
R18888 T26750 T26750 ROOT is,is
R18889 T26751 T26750 acomp necessary,is
R18890 T26752 T26750 prep for,is
R18891 T26753 T26756 nmod SerpinB2,activity
R18892 T26754 T26756 amod proximal,activity
R18893 T26755 T26756 compound promoter,activity
R18894 T26756 T26752 pobj activity,for
R18895 T26757 T26750 punct .,is
R18896 T26758 T26759 punct (,A
R18897 T26759 T26759 ROOT A,A
R18898 T26760 T26759 punct ),A
R18899 T26761 T26764 det The,promoter
R18900 T26762 T26764 amod SerpinB2,promoter
R18901 T26763 T26764 amod proximal,promoter
R18902 T26764 T26767 nsubjpass promoter,activated
R18903 T26765 T26767 auxpass is,activated
R18904 T26766 T26767 advmod significantly,activated
R18905 T26767 T26767 ROOT activated,activated
R18906 T26768 T26767 prep in,activated
R18907 T26769 T26771 amod LPS-stimulated,+
R18908 T26770 T26771 compound Cebpb,+
R18909 T26771 T26780 compound +,/
R18910 T26772 T26780 dep /,/
R18911 T26773 T26774 nummod +,MEFs
R18912 T26774 T26772 dobj MEFs,/
R18913 T26775 T26774 cc and,MEFs
R18914 T26776 T26777 neg not,in
R18915 T26777 T26772 prep in,/
R18929 T26791 T26792 compound Cebpb,+
R18930 T26792 T26793 compound +,/
R18931 T26793 T26793 ROOT /,/
R18932 T26794 T26793 dobj +,/
R18933 T26795 T26793 cc and,/
R18934 T26796 T26797 nsubj Cebpb,−
R18935 T26797 T26793 conj −,/
R18936 T26798 T26800 nummod /,MEFs
R18937 T26799 T26800 nummod −,MEFs
R18938 T26800 T26797 dobj MEFs,−
R18939 T26801 T26800 acl expressing,MEFs
R18940 T26802 T26806 det the,reporter
R18941 T26803 T26804 compound pGLmP-539,SerpinB2
R18942 T26804 T26806 nmod SerpinB2,reporter
R18943 T26805 T26806 amod promoter-luciferase,reporter
R18944 T26806 T26801 dobj reporter,expressing
R18945 T26807 T26801 prep in,expressing
R18946 T26808 T26809 det the,presence
R18947 T26809 T26807 pobj presence,in
R18948 T26810 T26809 cc or,presence
R18949 T26811 T26809 conj absence,presence
R18950 T26812 T26811 prep of,absence
R18951 T26813 T26812 pobj LPS,of
R18952 T26814 T26816 punct (,ng/mL
R18953 T26815 T26816 nummod 100,ng/mL
R18954 T26816 T26813 appos ng/mL,LPS
R18955 T26817 T26797 punct ),−
R18956 T26818 T26793 punct .,/
R18957 T26819 T26821 nsubjpass Cells,co-transfected
R18958 T26820 T26821 auxpass were,co-transfected
R18959 T26821 T26821 ROOT co-transfected,co-transfected
R18960 T26822 T26821 prep with,co-transfected
R18961 T26823 T26827 det the,reporter
R18962 T26824 T26827 nmod pGLmP-539,reporter
R18963 T26825 T26827 nmod SerpinB2,reporter
R18964 T26826 T26827 amod promoter-luciferase,reporter
R18965 T26827 T26822 pobj reporter,with
R18966 T26828 T26827 cc and,reporter
R18967 T26829 T26830 amod β-galactosidase,reporter
R18968 T26830 T26827 conj reporter,reporter
R18969 T26831 T26827 conj plasmids,reporter
R18970 T26832 T26831 punct ",",plasmids
R18971 T26833 T26831 cc and,plasmids
R18972 T26834 T26835 compound luciferase,units
R18973 T26835 T26831 conj units,plasmids
R18974 T26836 T26821 conj normalized,co-transfected
R18975 T26837 T26836 prep to,normalized
R18976 T26838 T26839 amod β-galactosidase,activity
R18977 T26839 T26837 pobj activity,to
R18978 T26840 T26821 punct .,co-transfected
R18979 T26841 T26842 punct (,B
R18980 T26842 T26848 nmod B,schematic
R18981 T26843 T26842 punct ),B
R18982 T26844 T26846 punct C/EBP,β
R18983 T26845 T26846 punct -,β
R18984 T26846 T26847 compound β,gene
R18985 T26847 T26848 compound gene,schematic
R18986 T26848 T26848 ROOT schematic,schematic
R18987 T26849 T26848 xcomp depicting,schematic
R18988 T26850 T26851 compound gene,structure
R18989 T26851 T26849 dobj structure,depicting
R18990 T26852 T26851 cc and,structure
R18991 T26853 T26854 compound phospho-acceptor,sites
R18992 T26854 T26851 conj sites,structure
R18993 T26855 T26848 punct .,schematic
R18994 T26856 T26859 punct (,Phosphorylation
R18995 T26857 T26859 nmod C,Phosphorylation
R18996 T26858 T26859 punct ),Phosphorylation
R18997 T26859 T26868 nsubj Phosphorylation,regulates
R18998 T26860 T26859 prep of,Phosphorylation
R18999 T26861 T26860 pobj C/EBP,of
R19000 T26862 T26863 punct -,β
R19001 T26863 T26859 appos β,Phosphorylation
R19002 T26864 T26863 prep at,β
R19003 T26865 T26864 pobj Serine,at
R19004 T26866 T26865 nummod 64,Serine
R19005 T26867 T26868 advmod negatively,regulates
R19006 T26868 T26868 ROOT regulates,regulates
R19007 T26869 T26872 amod LPS-stimulated,activity
R19008 T26870 T26872 nummod SerpinB2,activity
R19009 T26871 T26872 compound promoter,activity
R19010 T26872 T26868 dobj activity,regulates
R19011 T26873 T26868 punct .,regulates
R19012 T26874 T26875 compound Cebpb,−
R19013 T26875 T26876 nsubj −,/
R19014 T26876 T26876 ROOT /,/
R19015 T26877 T26878 nummod −,MEFs
R19016 T26878 T26880 nsubjpass MEFs,co-transfected
R19017 T26879 T26880 auxpass were,co-transfected
R19018 T26880 T26876 ccomp co-transfected,/
R19019 T26881 T26880 prep with,co-transfected
R19020 T26882 T26883 compound expression,plasmids
R19021 T26883 T26884 nsubj plasmids,encoding
R19022 T26884 T26881 pcomp encoding,with
R19023 T26885 T26888 amod wild-type,β
R19024 T26886 T26888 compound C/EBP,β
R19025 T26887 T26888 punct -,β
R19026 T26888 T26884 dobj β,encoding
R19027 T26889 T26888 cc or,β
R19028 T26890 T26896 det the,mutants
R19029 T26891 T26896 amod indicated,mutants
R19030 T26892 T26896 nmod C/EBP,mutants
R19031 T26893 T26894 punct -,β
R19032 T26894 T26896 nmod β,mutants
R19033 T26895 T26896 compound phospho-acceptor,mutants
R19034 T26896 T26888 conj mutants,β
R19035 T26897 T26896 punct ",",mutants
R19036 T26898 T26884 prep along,encoding
R19037 T26899 T26898 prep with,along
R19038 T26900 T26904 det the,reporter
R19039 T26901 T26902 compound pGLmP-539,SerpinB2
R19040 T26902 T26904 nmod SerpinB2,reporter
R19041 T26903 T26904 amod promoter-luciferase,reporter
R19042 T26904 T26899 pobj reporter,with
R19043 T26905 T26904 cc and,reporter
R19044 T26906 T26907 amod β-galactosidase,reporter
R19045 T26907 T26904 conj reporter,reporter
R19046 T26908 T26904 conj plasmids,reporter
R19047 T26909 T26908 punct ",",plasmids
R19048 T26910 T26880 cc and,co-transfected
R19049 T26911 T26880 conj stimulated,co-transfected
R19050 T26912 T26911 prep with,stimulated
R19051 T26913 T26912 pobj LPS,with
R19052 T26914 T26911 prep for,stimulated
R19053 T26915 T26916 nummod 4,hrs
R19054 T26916 T26914 pobj hrs,for
R19055 T26917 T26876 punct .,/
R19056 T26918 T26919 amod Luciferase,activity
R19057 T26919 T26921 nsubjpass activity,quantified
R19058 T26920 T26921 auxpass was,quantified
R19059 T26921 T26921 ROOT quantified,quantified
R19060 T26922 T26921 cc and,quantified
R19061 T26923 T26921 conj normalized,quantified
R19062 T26924 T26923 prep to,normalized
R19063 T26925 T26926 amod β-galactosidase,activity
R19064 T26926 T26924 pobj activity,to
R19065 T26927 T26921 punct .,quantified
R19066 T26928 T26930 det The,blot
R19067 T26929 T26930 amod western,blot
R19068 T26930 T26936 nsubj blot,confirms
R19069 T26931 T26932 punct (,below
R19070 T26932 T26930 prep below,blot
R19071 T26933 T26934 det the,graphs
R19072 T26934 T26932 pobj graphs,below
R19073 T26935 T26930 punct ),blot
R19074 T26936 T26936 ROOT confirms,confirms
R19075 T26937 T26938 det the,expression
R19076 T26938 T26936 dobj expression,confirms
R19077 T26939 T26938 prep of,expression
R19078 T26940 T26946 det the,mutants
R19079 T26941 T26946 amod respective,mutants
R19080 T26942 T26946 nmod C/EBP,mutants
R19081 T26943 T26944 punct -,β
R19082 T26944 T26946 nmod β,mutants
R19083 T26945 T26946 compound phospho-acceptor,mutants
R19084 T26946 T26939 pobj mutants,of
R19085 T26947 T26936 punct .,confirms
R19086 T26948 T26955 det The,express
R19087 T26949 T26955 nsubj C/EBP,express
R19088 T26950 T26951 punct -,βT217A
R19089 T26951 T26953 punct βT217A,transfected
R19090 T26952 T26953 punct -,transfected
R19091 T26953 T26954 amod transfected,MEFs
R19092 T26954 T26955 nsubj MEFs,express
R19093 T26955 T26955 ROOT express,express
R19094 T26956 T26959 preconj both,kDa
R19095 T26957 T26959 det the,kDa
R19096 T26958 T26959 nummod 38,kDa
R19097 T26959 T26955 dobj kDa,express
R19098 T26960 T26959 cc and,kDa
R19099 T26961 T26963 nummod 35,isoforms
R19100 T26962 T26963 compound kDa,isoforms
R19101 T26963 T26959 conj isoforms,kDa
R19102 T26964 T26963 prep of,isoforms
R19103 T26965 T26967 compound C/EBP,β
R19104 T26966 T26967 punct -,β
R19105 T26967 T26964 pobj β,of
R19106 T26968 T26955 punct .,express
R19107 T26969 T26970 det The,results
R19108 T26970 T26971 nsubj results,represent
R19109 T26971 T26971 ROOT represent,represent
R19110 T26972 T26973 det the,mean
R19111 T26973 T26971 dobj mean,represent
R19112 T26974 T26973 cc and,mean
R19113 T26975 T26973 conj SEM,mean
R19114 T26976 T26975 prep of,SEM
R19115 T26977 T26978 advmod at,least
R19116 T26978 T26979 advmod least,three
R19117 T26979 T26981 nummod three,experiments
R19118 T26980 T26981 amod independent,experiments
R19119 T26981 T26976 pobj experiments,of
R19120 T26982 T26981 acl performed,experiments
R19121 T26983 T26982 prep in,performed
R19122 T26984 T26983 pobj triplicate,in
R19123 T26985 T26971 punct .,represent
R19124 T26986 T26989 punct (,p
R19125 T26987 T26989 punct *,p
R19126 T26988 T26989 punct ",",p
R19127 T26989 T26989 ROOT p,p
R19128 T26990 T26991 compound <,0.05
R19129 T26991 T26989 dobj 0.05,p
R19130 T26992 T26991 punct ",",0.05
R19131 T26993 T26994 amod one-way,ANOVA
R19132 T26994 T26989 npadvmod ANOVA,p
R19133 T26995 T26989 punct ),p
R19134 T26996 T26989 punct .,p
R18916 T26778 T26779 compound Cebpb,−
R18917 T26779 T26777 pobj −,in
R18918 T26780 T26767 advcl /,activated
R18919 T26781 T26782 nummod −,MEFs
R18920 T26782 T26780 dobj MEFs,/
R18921 T26783 T26767 punct .,activated
R18922 T26784 T26788 compound Murine,activity
R18923 T26785 T26788 compound SerpinB2,activity
R18924 T26786 T26787 compound gene,promoter
R18925 T26787 T26788 compound promoter,activity
R18926 T26788 T26788 ROOT activity,activity
R18927 T26789 T26788 acl measured,activity
R18928 T26790 T26789 prep in,measured
R3291 T4501 T4506 amod Western,lysates
R3292 T4502 T4506 compound Blot,lysates
R3293 T4503 T4506 compound Assays,lysates
R3294 T4504 T4506 compound Whole,lysates
R3295 T4505 T4506 compound cell,lysates
R3296 T4506 T4508 nsubjpass lysates,prepared
R3297 T4507 T4508 auxpass were,prepared
R3298 T4508 T4541 ccomp prepared,separated
R3299 T4509 T4508 prep in,prepared
R3300 T4510 T4511 compound RIPA,buffer
R3301 T4511 T4509 pobj buffer,in
R3302 T4512 T4515 punct (,Tris
R3303 T4513 T4515 nummod 10,Tris
R3304 T4514 T4515 compound mM,Tris
R3305 T4515 T4541 nsubjpass Tris,separated
R3306 T4516 T4515 punct ",",Tris
R3307 T4517 T4519 nummod 150,NaCl
R3308 T4518 T4519 compound mM,NaCl
R3309 T4519 T4515 appos NaCl,Tris
R3310 T4520 T4519 punct ",",NaCl
R3311 T4521 T4522 nummod 1,%
R3312 T4522 T4524 compound %,X-100
R3313 T4523 T4524 compound Triton,X-100
R3314 T4524 T4519 conj X-100,NaCl
R3315 T4525 T4524 punct ",",X-100
R3316 T4526 T4527 nummod 0.5,%
R3317 T4527 T4528 compound %,NP-40
R3318 T4528 T4524 appos NP-40,X-100
R3319 T4529 T4528 punct ",",NP-40
R3320 T4530 T4531 nummod 0.5,%
R3321 T4531 T4532 compound %,deoxycholate

2_test

Id Subject Object Predicate Lexical cue
23472114-12490963-87899165 2057-2058 12490963 denotes 1
23472114-3257578-87899166 2767-2768 3257578 denotes 6
23472114-1833420-87899167 2901-2902 1833420 denotes 7
23472114-7492756-87899168 2906-2907 7492756 denotes 9
23472114-8916932-87899169 3388-3390 8916932 denotes 30
23472114-11001915-87899170 3491-3493 11001915 denotes 32
23472114-7492756-87899171 3554-3555 7492756 denotes 9
23472114-12048245-87899172 5853-5855 12048245 denotes 34
23472114-9892694-87899173 8833-8835 9892694 denotes 35
23472114-2744487-87899174 10439-10441 2744487 denotes 36
23472114-12048245-87899175 13873-13875 12048245 denotes 34
23472114-11001915-87899176 17843-17845 11001915 denotes 32
23472114-1354603-87899177 19281-19283 1354603 denotes 45
23472114-8916932-87899178 19381-19383 8916932 denotes 30
23472114-8262378-87899179 19398-19400 8262378 denotes 51
23472114-2303256-87899180 23026-23028 2303256 denotes 54
23472114-8916932-87899181 23839-23841 8916932 denotes 30
23472114-21257317-87899182 34157-34159 21257317 denotes 63
23472114-17433708-87899183 34163-34165 17433708 denotes 64
23472114-17855774-87899184 34336-34338 17855774 denotes 65
23472114-21257317-87899185 38543-38545 21257317 denotes 63
23472114-17433708-87899186 39929-39931 17433708 denotes 64
23472114-21257317-87899187 42668-42670 21257317 denotes 63
23472114-21257317-87899188 42801-42803 21257317 denotes 63
23472114-8234276-87899189 42807-42809 8234276 denotes 66
23472114-21257317-87899190 43580-43582 21257317 denotes 63
23472114-7530603-87899191 43994-43996 7530603 denotes 69
23472114-21257317-87899192 44358-44360 21257317 denotes 63
23472114-17855774-87899193 44500-44502 17855774 denotes 65
23472114-20303878-87899194 46095-46096 20303878 denotes 2
23472114-16497591-87899195 46100-46102 16497591 denotes 74
23472114-18548086-87899196 46266-46268 18548086 denotes 77
23472114-18548086-87899197 46396-46398 18548086 denotes 77
23472114-17803913-87899198 46540-46542 17803913 denotes 79
T69199 2057-2058 12490963 denotes 1
T63054 2767-2768 3257578 denotes 6
T46167 2901-2902 1833420 denotes 7
T62789 2906-2907 7492756 denotes 9
T82770 3388-3390 8916932 denotes 30
T53126 3491-3493 11001915 denotes 32
T12750 3554-3555 7492756 denotes 9
T60199 5853-5855 12048245 denotes 34
T16742 8833-8835 9892694 denotes 35
T12110 10439-10441 2744487 denotes 36
T93715 13873-13875 12048245 denotes 34
T57168 17843-17845 11001915 denotes 32
T40363 19281-19283 1354603 denotes 45
T4480 19381-19383 8916932 denotes 30
T43659 19398-19400 8262378 denotes 51
T35910 23026-23028 2303256 denotes 54
T61298 23839-23841 8916932 denotes 30
T26631 34157-34159 21257317 denotes 63
T90386 34163-34165 17433708 denotes 64
T54308 34336-34338 17855774 denotes 65
T93262 38543-38545 21257317 denotes 63
T18108 39929-39931 17433708 denotes 64
T48334 42668-42670 21257317 denotes 63
T11049 42801-42803 21257317 denotes 63
T41507 42807-42809 8234276 denotes 66
T63857 43580-43582 21257317 denotes 63
T13678 43994-43996 7530603 denotes 69
T94337 44358-44360 21257317 denotes 63
T63905 44500-44502 17855774 denotes 65
T96736 46095-46096 20303878 denotes 2
T95677 46100-46102 16497591 denotes 74
T55278 46266-46268 18548086 denotes 77
T40452 46396-46398 18548086 denotes 77
T35828 46540-46542 17803913 denotes 79

pmc-enju-pas

Id Subject Object Predicate Lexical cue
T26385 38125-38128 DT denotes The
T26384 38116-38123 NN denotes mutants
T26383 38099-38115 NN denotes phospho-acceptor
T26382 38091-38098 NN denotes C/EBP-β
T26381 38080-38090 JJ denotes respective
T26380 38076-38079 DT denotes the
T26379 38073-38075 IN denotes of
T26378 38062-38072 NN denotes expression
T26377 38058-38061 DT denotes the
T26376 38049-38057 VB denotes confirms
T26375 38047-38048 -RRB- denotes )
T26374 38041-38047 NN denotes graphs
T26373 38037-38040 DT denotes the
T26372 38031-38036 IN denotes below
T26371 38030-38031 -LRB- denotes (
T26370 38025-38029 NN denotes blot
T26369 38017-38024 JJ denotes western
T26368 38013-38016 DT denotes The
T26367 38003-38011 NN denotes activity
T26366 37987-38002 JJ denotes β-galactosidase
T26365 37984-37986 TO denotes to
T26364 37973-37983 VB denotes normalized
T26363 37969-37972 CC denotes and
T26362 37958-37968 VB denotes quantified
T26361 37954-37957 VB denotes was
T26360 37945-37953 NN denotes activity
T26359 37934-37944 NN denotes Luciferase
T26358 37929-37932 NN denotes hrs
T26357 37927-37928 CD denotes 4
T26356 37923-37926 IN denotes for
T26355 37919-37922 NN denotes LPS
T26354 37914-37918 IN denotes with
T26353 37903-37913 VB denotes stimulated
T26352 37899-37902 CC denotes and
T26351 37897-37898 -COMMA- denotes ,
T26350 37889-37897 NN denotes plasmids
T26349 37880-37888 NN denotes reporter
T26348 37864-37879 JJ denotes β-galactosidase
T26347 37860-37863 CC denotes and
T26346 37851-37859 NN denotes reporter
T26345 37831-37850 NN denotes promoter-luciferase
T26344 37822-37830 NN denotes SerpinB2
T26343 37812-37821 NN denotes pGLmP-539
T26342 37808-37811 DT denotes the
T26341 37803-37807 IN denotes with
T26340 37797-37802 IN denotes along
T26339 37795-37796 -COMMA- denotes ,
T26338 37788-37795 NN denotes mutants
T26337 37771-37787 NN denotes phospho-acceptor
T26336 37763-37770 NN denotes C/EBP-β
T26335 37753-37762 VB denotes indicated
T26334 37749-37752 DT denotes the
T26333 37746-37748 CC denotes or
T26332 37738-37745 NN denotes C/EBP-β
T26331 37728-37737 JJ denotes wild-type
T26330 37719-37727 VB denotes encoding
T26329 37710-37718 NN denotes plasmids
T26328 37699-37709 NN denotes expression
T26327 37694-37698 IN denotes with
T26326 37679-37693 VB denotes co-transfected
T26325 37674-37678 VB denotes were
T26324 37669-37673 NN denotes MEFs
T26323 37660-37668 NN denotes Cebpb−/−
T26322 37650-37658 NN denotes activity
T26321 37641-37649 NN denotes promoter
T26320 37632-37640 NN denotes SerpinB2
T26319 37617-37631 JJ denotes LPS-stimulated
T26318 37607-37616 VB denotes regulates
T26317 37596-37606 RB denotes negatively
T26316 37593-37595 CD denotes 64
T26315 37586-37592 NN denotes Serine
T26314 37583-37585 IN denotes at
T26313 37575-37582 NN denotes C/EBP-β
T26312 37572-37574 IN denotes of
T26311 37556-37571 NN denotes Phosphorylation
T239 90-96 NNP denotes Murine
T240 97-105 NN denotes SerpinB2
T1863 4237-4243 NN denotes factor
T8519 16988-16994 NN denotes Qiagen
T15036 34265-34272 NN denotes isoform
T26310 37554-37555 -RRB- denotes )
T26309 37553-37554 NN denotes C
T26308 37552-37553 -LRB- denotes (
T26307 37545-37551 NN denotes sites.
T26306 37528-37544 NN denotes phospho-acceptor
T26305 37524-37527 CC denotes and
T26304 37514-37523 NN denotes structure
T26303 37509-37513 NN denotes gene
T26302 37499-37508 VB denotes depicting
T26301 37489-37498 JJ denotes schematic
T26300 37484-37488 NN denotes gene
T26299 37476-37483 NN denotes C/EBP-β
T26298 37474-37475 -RRB- denotes )
T26297 37473-37474 NN denotes B
T26296 37472-37473 -LRB- denotes (
T26295 37462-37471 NN denotes activity.
T26294 37446-37461 JJ denotes β-galactosidase
T26293 37443-37445 TO denotes to
T26292 37432-37442 VB denotes normalized
T26291 37426-37431 NN denotes units
T26290 37415-37425 NN denotes luciferase
T26289 37411-37414 CC denotes and
T26288 37409-37410 -COMMA- denotes ,
T26287 37401-37409 NN denotes plasmids
T26286 37392-37400 NN denotes reporter
T26285 37376-37391 JJ denotes β-galactosidase
T26284 37372-37375 CC denotes and
T26283 37363-37371 NN denotes reporter
T26282 37343-37362 NN denotes promoter-luciferase
T26281 37334-37342 NN denotes SerpinB2
T26280 37324-37333 NN denotes pGLmP-539
T26279 37320-37323 DT denotes the
T26278 37315-37319 IN denotes with
T26277 37300-37314 VB denotes co-transfected
T26276 37295-37299 VB denotes were
T26275 37289-37294 NN denotes Cells
T26274 37286-37287 -RRB- denotes )
T26273 37281-37286 NN denotes ng/mL
T26272 37277-37280 CD denotes 100
T26271 37276-37277 -LRB- denotes (
T26270 37272-37275 NN denotes LPS
T26269 37269-37271 IN denotes of
T26268 37261-37268 NN denotes absence
T26267 37258-37260 CC denotes or
T26266 37249-37257 NN denotes presence
T26265 37245-37248 DT denotes the
T26264 37242-37244 IN denotes in
T26263 37233-37241 NN denotes reporter
T26262 37213-37232 NN denotes promoter-luciferase
T26261 37204-37212 NN denotes SerpinB2
T26260 37194-37203 NN denotes pGLmP-539
T26259 37190-37193 DT denotes the
T26258 37179-37189 VB denotes expressing
T26257 37174-37178 NN denotes MEFs
T26256 37165-37173 NNP denotes Cebpb−/−
T26255 37161-37164 CC denotes and
T26254 37152-37160 JJ denotes Cebpb+/+
T26253 37149-37151 IN denotes in
T26252 37140-37148 VB denotes measured
T26251 37131-37139 NN denotes activity
T26250 37122-37130 NN denotes promoter
T26249 37117-37121 NN denotes gene
T26248 37108-37116 NN denotes SerpinB2
T26247 37101-37107 JJ denotes Murine
T26246 37095-37099 NN denotes MEFs
T26245 37086-37094 NN denotes Cebpb−/−
T26244 37083-37085 IN denotes in
T26243 37079-37082 RB denotes not
T26242 37075-37078 CC denotes and
T26241 37070-37074 NN denotes MEFs
T26240 37061-37069 JJ denotes Cebpb+/+
T26239 37046-37060 JJ denotes LPS-stimulated
T26238 37043-37045 IN denotes in
T26237 37033-37042 VB denotes activated
T26236 37019-37032 RB denotes significantly
T26235 37016-37018 VB denotes is
T26234 37007-37015 NN denotes promoter
T26233 36998-37006 JJ denotes proximal
T26232 36989-36997 NN denotes SerpinB2
T26231 36985-36988 DT denotes The
T26230 36983-36984 -RRB- denotes )
T26229 36982-36983 NN denotes A
T26228 36981-36982 -LRB- denotes (
T26227 36971-36979 NN denotes activity
T26226 36962-36970 NN denotes promoter
T26225 36953-36961 JJ denotes proximal
T26224 36944-36952 NN denotes SerpinB2
T26223 36940-36943 IN denotes for
T26222 36930-36939 JJ denotes necessary
T26221 36927-36929 VB denotes is
T26220 36919-36926 NN denotes C/EBP-β
T26425 38347-38348 -RRB- denotes )
T26424 38342-38347 NN denotes ANOVA
T26423 38334-38341 JJ denotes one-way
T26422 38332-38333 -COMMA- denotes ,
T26421 38328-38332 CD denotes 0.05
T26420 38327-38328 SYM denotes <
T26419 38326-38327 NN denotes p
T26418 38324-38325 -COMMA- denotes ,
T26417 38323-38324 SYM denotes *
T26416 38322-38323 -LRB- denotes (
T26415 38310-38321 FW denotes triplicate.
T26414 38307-38309 IN denotes in
T26413 38297-38306 VB denotes performed
T26412 38285-38296 NN denotes experiments
T26411 38273-38284 JJ denotes independent
T26410 38267-38272 CD denotes three
T26409 38261-38266 JJ denotes least
T26408 38258-38260 IN denotes at
T26407 38255-38257 IN denotes of
T26406 38251-38254 NN denotes SEM
T26405 38247-38250 CC denotes and
T26404 38242-38246 NN denotes mean
T26403 38238-38241 DT denotes the
T26402 38228-38237 VB denotes represent
T26401 38220-38227 NN denotes results
T26400 38216-38219 DT denotes The
T26399 38207-38214 NN denotes C/EBP-β
T26398 38204-38206 IN denotes of
T26397 38195-38203 NN denotes isoforms
T26396 38191-38194 NN denotes kDa
T26395 38188-38190 CD denotes 35
T26394 38184-38187 CC denotes and
T26393 38180-38183 NN denotes kDa
T26392 38177-38179 CD denotes 38
T26391 38173-38176 DT denotes the
T26390 38168-38172 CC denotes both
T26389 38160-38167 VB denotes express
T26388 38155-38159 NN denotes MEFs
T26387 38142-38154 JJ denotes -transfected
T26386 38129-38141 NN denotes C/EBP-βT217A
T25577 36063-36069 NN denotes method
T25576 36056-36062 NN denotes 2-ΔΔCt
T25575 36052-36055 DT denotes the
T25574 36046-36051 VB denotes using
T25573 36039-36045 NN denotes signal
T25572 36034-36038 NN denotes rIgG
T25571 36031-36033 TO denotes to
T25570 36022-36030 JJ denotes relative
T25569 36010-36021 VB denotes represented
T25568 36006-36009 VB denotes are
T25567 36001-36005 NN denotes data
T25566 35997-36000 DT denotes The
T25565 35988-35995 NN denotes control
T25564 35983-35987 NN denotes rIgG
T25563 35979-35982 DT denotes the
T25562 35975-35978 CC denotes and
T25561 35973-35974 -COMMA- denotes ,
T25560 35972-35973 -RRB- denotes )
T25559 35968-35972 NN denotes T217
T25558 35967-35968 -LRB- denotes (
T25557 35957-35966 NN denotes p-C/EBP-β
T25556 35955-35956 -COMMA- denotes ,
T25555 35948-35955 NN denotes C/EBP-β
T25554 35940-35947 IN denotes against
T25553 35929-35939 NN denotes antibodies
T25552 35924-35928 IN denotes with
T25551 35905-35923 VB denotes immunoprecipitated
T25550 35895-35904 NN denotes chromatin
T25549 35892-35894 IN denotes of
T25548 35883-35891 NN denotes analysis
T25547 35878-35882 NN denotes qPCR
T25546 35876-35877 -RRB- denotes )
T25545 35875-35876 NN denotes B
T25544 35874-35875 -LRB- denotes (
T25543 35864-35873 NN denotes reaction.
T25542 35859-35863 NN denotes ChIP
T25541 35855-35858 DT denotes the
T25540 35852-35854 IN denotes of
T25539 35840-35851 NN denotes specificity
T25538 35836-35839 DT denotes the
T25537 35833-35835 IN denotes of
T25536 35822-35832 JJ denotes indicative
T25535 35820-35821 -COMMA- denotes ,
T25534 35813-35820 NN denotes control
T25533 35809-35812 NN denotes IgG
T25532 35802-35808 NN denotes rabbit
T25531 35798-35801 DT denotes the
T25530 35792-35797 VB denotes using
T25529 35783-35791 VB denotes detected
T25528 35779-35782 VB denotes was
T25527 35768-35778 NN denotes background
T25526 35760-35767 JJ denotes Minimal
T25525 35747-35758 NN denotes stimulation
T25524 35743-35746 NN denotes LPS
T25523 35733-35742 VB denotes following
T25522 35719-35732 NN denotes transcription
T25521 35712-35718 JJ denotes active
T25520 35703-35711 VB denotes suggests
T25519 35694-35702 NN denotes promoter
T25518 35685-35693 NN denotes SerpinB2
T25517 35681-35684 DT denotes the
T25516 35678-35680 TO denotes to
T25515 35671-35677 NN denotes RNAPII
T25514 35668-35670 IN denotes of
T25513 35656-35667 NN denotes Recruitment
T25512 35651-35654 NN denotes top
T25511 35648-35650 IN denotes in
T25510 35637-35647 VB denotes diagrammed
T25509 35634-35636 IN denotes as
T25508 35632-35633 -COMMA- denotes ,
T25507 35626-35632 CD denotes −5/+19
T25506 35622-35625 CC denotes and
T25505 35613-35621 CD denotes 338/−315
T25504 35611-35612 -COMMA- denotes ,
T25503 35604-35611 NN denotes primers
T25502 35586-35603 JJ denotes promoter-specific
T25501 35577-35585 JJ denotes proximal
T25500 35568-35576 NN denotes SerpinB2
T25499 35561-35567 JJ denotes murine
T25498 35555-35560 VB denotes using
T25497 35548-35554 NN denotes assays
T25496 35543-35547 NN denotes ChIP
T25495 35540-35542 IN denotes in
T25494 35531-35539 VB denotes obtained
T25493 35523-35530 NN denotes pattern
T25492 35519-35522 NN denotes PCR
T25491 35511-35518 JJ denotes Typical
T25490 35509-35510 -RRB- denotes )
T25489 35508-35509 NN denotes A
T25488 35507-35508 -LRB- denotes (
T25487 35498-35506 NN denotes control.
T25486 35496-35497 -RRB- denotes )
T25485 35492-35496 NN denotes rIgG
T25484 35491-35492 -LRB- denotes (
T25483 35487-35490 NN denotes IgG
T25482 35480-35486 NN denotes rabbit
T25481 35478-35479 DT denotes a
T25480 35475-35477 CC denotes or
T25479 35473-35474 -COMMA- denotes ,
T25478 35472-35473 -RRB- denotes )
T25477 35466-35472 NN denotes RNAPII
T25476 35465-35466 -LRB- denotes (
T25475 35462-35464 CD denotes II
T25474 35451-35461 NN denotes Polymerase
T25473 35447-35450 NN denotes RNA
T25472 35445-35446 -COMMA- denotes ,
T25471 35444-35445 -RRB- denotes )
T25470 35440-35444 NN denotes T217
T25469 35439-35440 -LRB- denotes (
T25468 35429-35438 NN denotes p-C/EBP-β
T25467 35427-35428 -COMMA- denotes ,
T25466 35420-35427 NN denotes C/EBP-β
T25465 35412-35419 IN denotes against
T25464 35401-35411 NN denotes antibodies
T25463 35396-35400 IN denotes with
T25462 35377-35395 VB denotes immunoprecipitated
T25461 35373-35376 VB denotes was
T25460 35371-35372 -RRB- denotes )
T25459 35369-35371 NN denotes ng
T25458 35361-35368 CD denotes 600–700
T25457 35360-35361 -LRB- denotes (
T25456 35350-35359 NN denotes chromatin
T25455 35342-35349 JJ denotes Soluble
T25454 35339-35340 -RRB- denotes )
T25453 35335-35339 NN denotes T217
T25452 35334-35335 -LRB- denotes (
T25451 35324-35333 NN denotes p-C/EBP-β
T25450 35321-35323 CC denotes or
T25449 35313-35320 NN denotes C/EBP-β
T25448 35305-35312 IN denotes against
T25447 35294-35304 NN denotes antibodies
T25446 35288-35293 VB denotes using
T25445 35278-35287 VB denotes performed
T25444 35258-35277 NN denotes immunoprecipitation
T25443 35248-35257 NN denotes chromatin
T25442 35244-35247 CC denotes and
T25441 35238-35243 NN denotes times
T25440 35228-35237 VB denotes indicated
T25439 35224-35227 DT denotes the
T25438 35220-35223 IN denotes for
T25437 35216-35219 NN denotes LPS
T25436 35213-35215 IN denotes of
T25435 35205-35212 NN denotes absence
T25434 35202-35204 CC denotes or
T25433 35193-35201 NN denotes presence
T25432 35189-35192 DT denotes the
T25431 35186-35188 IN denotes in
T25430 35178-35185 VB denotes treated
T25429 35173-35177 VB denotes were
T25428 35161-35172 NN denotes macrophages
T25427 35152-35160 NN denotes RAW264.7
T25426 35145-35150 NN denotes assay
T25425 35143-35144 -RRB- denotes )
T25424 35139-35143 NN denotes ChIP
T25423 35138-35139 -LRB- denotes (
T25422 35118-35137 NN denotes immunoprecipitation
T25421 35108-35117 NN denotes chromatin
T25420 35105-35107 IN denotes by
T25419 35094-35104 VB denotes determined
T25418 35090-35093 VB denotes was
T25417 35085-35089 FW denotes vivo
T25416 35082-35084 FW denotes in
T25415 35073-35081 NN denotes promoter
T25414 35064-35072 JJ denotes proximal
T25410 35038-35047 NN denotes occupancy
T25409 35031-35037 NN denotes factor
T25408 35017-35030 NN denotes Transcription
T25407 35011-35015 FW denotes vivo
T25406 35008-35010 FW denotes in
T25405 34999-35007 NN denotes promoter
T25404 34990-34998 NN denotes SerpinB2
T25403 34983-34989 JJ denotes murine
T25402 34979-34982 DT denotes the
T25401 34976-34978 TO denotes to
T25400 34964-34975 NN denotes C/EBP-βT217
T25399 34960-34963 CC denotes and
T25398 34952-34959 NN denotes C/EBP-β
T25397 34949-34951 IN denotes of
T25396 34937-34948 NN denotes recruitment
T25395 34924-34936 JJ denotes Differential
T24814 33222-33223 -RRB- denotes )
T24813 33217-33222 NN denotes ANOVA
T24812 33209-33216 JJ denotes two-way
T24811 33207-33208 -COMMA- denotes ,
T24810 33203-33207 CD denotes 0.05
T24809 33202-33203 SYM denotes <
T24808 33201-33202 NN denotes p
T24807 33199-33200 -COMMA- denotes ,
T24806 33198-33199 SYM denotes *
T24805 33197-33198 -LRB- denotes (
T24804 33185-33196 FW denotes triplicate.
T24803 33182-33184 CC denotes or
T24802 33172-33181 NN denotes duplicate
T24801 33169-33171 IN denotes in
T24800 33159-33168 VB denotes performed
T24799 33147-33158 NN denotes experiments
T24798 33135-33146 JJ denotes independent
T24797 33131-33134 CD denotes two
T24796 33128-33130 IN denotes of
T24795 33124-33127 NN denotes SEM
T25413 35055-35063 NN denotes SerpinB2
T25412 35051-35054 DT denotes the
T25411 35048-35050 IN denotes on
T24794 33120-33123 CC denotes and
T24793 33115-33119 NN denotes mean
T24792 33111-33114 DT denotes the
T24791 33101-33110 VB denotes represent
T24790 33093-33100 NN denotes results
T24789 33089-33092 DT denotes The
T24788 33076-33087 NN denotes macrophages
T24787 33065-33075 JJ denotes peritoneal
T24786 33054-33064 VB denotes transduced
T24785 33043-33053 JJ denotes lentiviral
T24784 33039-33042 DT denotes the
T24783 33036-33038 IN denotes in
T24782 33025-33035 NN denotes expression
T24781 33020-33024 NN denotes mRNA
T24780 33011-33019 NN denotes SerpinB2
T24779 33004-33010 JJ denotes murine
T24778 33001-33003 IN denotes of
T24777 32992-33000 NN denotes analysis
T24776 32987-32991 NN denotes qPCR
T24775 32985-32986 -COLON- denotes :
T24774 32980-32985 RB denotes Right
T24773 32973-32978 NN denotes shRNA
T24772 32967-32972 NN denotes CEBPB
T24771 32961-32966 JJ denotes human
T24770 32957-32960 RB denotes not
T24769 32953-32956 CC denotes and
T24673 32338-32341 CC denotes and
T24672 32329-32337 NN denotes Cebpb+/+
T24671 32319-32328 JJ denotes untreated
T24670 32316-32318 IN denotes in
T24669 32305-32315 NN denotes expression
T24668 32300-32304 NN denotes mRNA
T24667 32291-32299 NN denotes SerpinB2
T24666 32284-32290 JJ denotes murine
T24665 32281-32283 IN denotes of
T24664 32272-32280 NN denotes analysis
T24663 32267-32271 NN denotes qPCR
T24662 32262-32266 NN denotes LPS.
T24661 32259-32261 IN denotes of
T24660 32250-32258 NN denotes presence
T24659 32246-32249 CC denotes and
T24658 32238-32245 NN denotes absence
T24657 32234-32237 DT denotes the
T24656 32231-32233 IN denotes in
T24655 32226-32230 NN denotes MEFs
T24654 32217-32225 JJ denotes Cebpb+/+
T24653 32214-32216 TO denotes to
T24652 32205-32213 VB denotes compared
T24651 32200-32204 NN denotes MEFs
T24650 32191-32199 NN denotes Cebpb−/−
T24649 32188-32190 IN denotes in
T24648 32178-32187 VB denotes abrogated
T24647 32175-32177 VB denotes is
T24646 32164-32174 NN denotes expression
T24645 32159-32163 NN denotes mRNA
T24644 32150-32158 NN denotes SerpinB2
T24643 32139-32149 JJ denotes Endogenous
T24642 32137-32138 -RRB- denotes )
T24641 32136-32137 NN denotes A
T24640 32135-32136 -LRB- denotes (
T24639 32123-32133 NN denotes expression
T24638 32118-32122 NN denotes mRNA
T24637 32109-32117 NN denotes SerpinB2
T24636 32097-32108 JJ denotes LPS-induced
T24635 32093-32096 CC denotes and
T24634 32080-32092 JJ denotes constitutive
T24633 32076-32079 IN denotes for
T24632 32066-32075 JJ denotes essential
T24631 32063-32065 VB denotes is
T24630 32055-32062 NN denotes C/EBP-β
T24768 32947-32952 NN denotes shRNA
T24767 32941-32946 NN denotes Cebpb
T24766 32934-32940 JJ denotes murine
T24765 32929-32933 IN denotes with
T24764 32919-32928 NN denotes infection
T24763 32909-32918 VB denotes following
T24762 32901-32908 NN denotes C/EBP-β
T24761 32890-32900 JJ denotes endogenous
T24760 32887-32889 IN denotes of
T24759 32877-32886 NN denotes knockdown
T24758 32867-32876 JJ denotes effective
T24757 32861-32866 VB denotes shows
T24756 32852-32860 NN denotes analysis
T24755 32847-32851 NN denotes blot
T24754 32839-32846 NN denotes Western
T24753 32837-32838 -COLON- denotes :
T24752 32833-32837 NNP denotes Left
T24751 32828-32831 NN denotes hrs
T24750 32826-32827 CD denotes 4
T24749 32822-32825 IN denotes for
T24748 32820-32821 -RRB- denotes )
T24747 32815-32820 NN denotes ng/ml
T24746 32811-32814 CD denotes 100
T24745 32810-32811 -LRB- denotes (
T24744 32806-32809 NN denotes LPS
T24743 32801-32805 IN denotes with
T24742 32790-32800 VB denotes stimulated
T24741 32785-32789 VB denotes were
T24740 32773-32784 NN denotes macrophages
T24739 32762-32772 VB denotes transduced
T24738 32751-32761 JJ denotes Lentiviral
T24737 32748-32749 -RRB- denotes ]
T24736 32746-32748 CD denotes 38
T24735 32745-32746 -LRB- denotes [
T24734 32736-32744 NN denotes sequence
T24733 32730-32735 NN denotes Cebpb
T24732 32723-32729 JJ denotes murine
T24731 32719-32722 DT denotes the
T24730 32712-32718 VB denotes target
T24729 32708-32711 RB denotes not
T24728 32703-32707 VB denotes does
T24727 32700-32702 PRP denotes it
T24726 32694-32699 IN denotes since
T24725 32686-32693 NN denotes control
T24724 32672-32685 JJ denotes non-silencing
T24723 32668-32671 DT denotes the
T24722 32665-32667 IN denotes as
T24721 32658-32664 VB denotes serves
T24720 32652-32657 NN denotes shRNA
T24719 32646-32651 NN denotes CEBPB
T24718 32640-32645 JJ denotes Human
T24717 32632-32638 NN denotes shRNAs
T24716 32621-32631 JJ denotes lentiviral
T24715 32612-32620 JJ denotes specific
T24714 32605-32611 JJ denotes murine
T24713 32601-32604 CC denotes and
T24712 32595-32600 JJ denotes human
T24711 32590-32594 IN denotes with
T24710 32581-32589 VB denotes infected
T24709 32576-32580 VB denotes were
T24708 32574-32575 -RRB- denotes )
T24707 32570-32574 NN denotes macs
T24706 32567-32569 NN denotes TG
T24705 32566-32567 -LRB- denotes (
T24704 32554-32565 NN denotes macrophages
T24703 32543-32553 JJ denotes peritoneal
T24702 32519-32542 JJ denotes Thioglycollate-elicited
T24701 32506-32517 NN denotes macrophages
T24700 32493-32505 JJ denotes inflammatory
T24699 32475-32492 JJ denotes C/EBP-β-deficient
T24698 32472-32474 IN denotes in
T24697 32462-32471 VB denotes abrogated
T24696 32459-32461 VB denotes is
T24695 32448-32458 NN denotes expression
T24694 32439-32447 NN denotes SerpinB2
T24693 32428-32438 JJ denotes Endogenous
T24692 32426-32427 -RRB- denotes )
T24691 32425-32426 NN denotes B
T24690 32424-32425 -LRB- denotes (
T24689 32417-32423 NN denotes times.
T24688 32407-32416 VB denotes indicated
T24687 32403-32406 DT denotes the
T24686 32399-32402 IN denotes for
T24685 32397-32398 -RRB- denotes )
T24684 32392-32397 NN denotes ng/ml
T24683 32388-32391 CD denotes 100
T24682 32387-32388 -LRB- denotes (
T24681 32383-32386 NN denotes LPS
T24680 32378-32382 IN denotes with
T24679 32367-32377 NN denotes simulation
T24678 32361-32366 IN denotes after
T24677 32357-32360 CC denotes and
T24676 32355-32356 -COMMA- denotes ,
T24675 32351-32355 NN denotes MEFs
T24674 32342-32350 NNP denotes Cebpb−/−
T23936 26401-26412 NN denotes experiments
T23935 26389-26400 JJ denotes independent
T23934 26385-26388 CD denotes 4–7
T23933 26382-26384 IN denotes of
T23932 26378-26381 NN denotes SEM
T23931 26374-26377 CC denotes and
T23930 26369-26373 NN denotes mean
T23929 26365-26368 DT denotes the
T23538 24549-24554 VB denotes shown
T23537 24544-24548 RB denotes also
T23536 24540-24543 VB denotes are
T23535 24529-24539 NN denotes constructs
T23534 24520-24528 NN denotes reporter
T23533 24516-24519 CD denotes −87
T23532 24512-24515 CC denotes and
T23531 24507-24511 CD denotes −189
T23530 24505-24506 -COMMA- denotes ,
T23529 24501-24505 CD denotes −539
T23528 24497-24500 DT denotes the
T23527 24494-24496 IN denotes of
T23526 24489-24493 NN denotes ends
T23525 24487-24488 SYM denotes '
T23524 24486-24487 CD denotes 5
T23523 24482-24485 DT denotes the
T23522 24479-24481 IN denotes of
T23521 24470-24478 NN denotes location
T23520 24466-24469 DT denotes The
T23519 24455-24464 NN denotes uppercase
T23518 24452-24454 IN denotes in
T23517 24442-24451 VB denotes presented
T23516 24439-24441 VB denotes is
T23515 24437-24438 CD denotes 1
T23514 24432-24436 NN denotes exon
T23513 24428-24431 CC denotes and
T23512 24418-24427 VB denotes indicated
T23511 24415-24417 VB denotes is
T23510 24413-24414 -RRB- denotes )
T23509 24410-24413 NN denotes tis
T23508 24409-24410 -LRB- denotes (
T23507 24404-24408 NN denotes site
T23506 24393-24403 NN denotes initiation
T24222 28763-28768 NN denotes C/EBP
T24221 28754-28762 NN denotes promoter
T24220 28745-28753 JJ denotes proximal
T24219 28736-28744 NN denotes SerpinB2
T24218 28729-28735 JJ denotes murine
T24217 28725-28728 DT denotes the
T24216 28717-28724 VB denotes binding
T24215 28710-28716 NN denotes factor
T24214 28702-28709 JJ denotes nuclear
T24213 28688-28701 JJ denotes LPS-inducible
T24212 28684-28687 DT denotes The
T23505 24379-24392 NN denotes transcription
T23504 24370-24378 JJ denotes putative
T23503 24366-24369 DT denotes The
T23502 24363-24364 CD denotes 1
T23501 24355-24362 NN denotes protein
T23500 24347-24354 NN denotes binding
T23499 24343-24346 NN denotes box
T23498 24336-24342 NN denotes purine
T23497 24328-24335 NN denotes PU.1 = 
T23496 24326-24327 -COLON- denotes ;
T23495 24318-24326 NN denotes 1/POU2F1
T23494 24311-24317 NN denotes factor
T23493 24297-24310 NN denotes transcription
T23492 24289-24296 NN denotes octamer
T23491 24281-24288 NN denotes Oct1 = 
T23490 24279-24280 -COLON- denotes ;
T23489 24272-24279 NN denotes element
T23488 24263-24271 NN denotes response
T23487 24252-24262 NN denotes CRE = cAMP
T23486 24250-24251 -COLON- denotes ;
T23485 24243-24250 NN denotes protein
T23484 24235-24242 NN denotes binding
T23483 24226-24234 NN denotes enhancer
T23482 24220-24225 NN denotes CCAAT
T23481 24211-24219 NN denotes C/EBP = 
T23480 24209-24210 -COLON- denotes ;
T22960 21914-21918 NN denotes site
T22959 21903-21913 NN denotes initiation
T22958 21883-21902 NN denotes tis = transcription
T22957 21881-21882 -COMMA- denotes ,
T22956 21875-21881 NN denotes repeat
T22955 21859-21874 NN denotes tetranucleotide
T22954 21850-21858 NN denotes n = TATG
T22953 21849-21850 -RRB- denotes )
T22952 21845-21849 NN denotes TATG
T22951 21844-21845 -LRB- denotes (
T22950 21842-21843 -COMMA- denotes ,
T22949 21841-21842 -RRB- denotes )
T22948 21838-21841 NN denotes LTR
T22947 21837-21838 -LRB- denotes (
T22946 21830-21836 NN denotes repeat
T22945 21821-21829 JJ denotes terminal
T22944 21816-21820 JJ denotes long
T22943 21802-21815 NN denotes MLT1L = MLT1L
T22942 21800-21801 -COMMA- denotes ,
T22941 21796-21800 NNP denotes SINE
T22940 21786-21795 NNP denotes MIR = MIR
T22939 21784-21785 -COMMA- denotes ,
T22938 21780-21784 NNP denotes LINE
T22937 21777-21779 NNP denotes L2
T22936 21771-21776 NN denotes L2 = 
T22935 21769-21770 -COMMA- denotes ,
T22934 21768-21769 -RRB- denotes )
T22933 21764-21768 NN denotes LINE
T22932 21763-21764 -LRB- denotes (
T22931 21755-21762 NN denotes element
T22930 21747-21754 JJ denotes nuclear
T22929 21734-21746 JJ denotes interspersed
T22928 21729-21733 JJ denotes long
T22927 21726-21728 NN denotes L1
T22926 21720-21725 NN denotes L1 = 
T22925 21718-21719 -COMMA- denotes ,
T22924 21717-21718 -RRB- denotes )
T22923 21713-21717 NN denotes SINE
T22922 21712-21713 -LRB- denotes (
T22921 21705-21711 NN denotes repeat
T22920 21697-21704 JJ denotes nuclear
T22919 21684-21696 JJ denotes interspersed
T22918 21678-21683 JJ denotes short
T22917 21674-21677 NN denotes ID4
T22916 21667-21673 NN denotes ID4 = 
T22915 21665-21666 -COMMA- denotes ,
T22914 21659-21665 NN denotes repeat
T22913 21649-21658 NN denotes Alu = Alu
T22912 21640-21647 NN denotes regions
T22911 21631-21639 NN denotes flanking
T22910 21628-21630 CD denotes 5′
T22909 21623-21627 CC denotes both
T22908 21620-21622 IN denotes in
T22907 21611-21619 NN denotes elements
T22906 21602-21610 NN denotes sequence
T22905 21591-21601 JJ denotes repetitive
T22904 21588-21590 IN denotes by
T22903 21576-21587 VB denotes interrupted
T22902 21572-21575 VB denotes are
T22901 21564-21571 NN denotes regions
T22900 21553-21563 JJ denotes Homologous
T22899 21546-21551 NN denotes boxes
T22898 21538-21545 VB denotes colored
T22897 21533-21537 JJ denotes same
T22896 21529-21532 DT denotes the
T22895 21526-21528 IN denotes by
T22894 21516-21525 VB denotes indicated
T22893 21507-21515 NN denotes identity
T22892 21498-21506 NN denotes sequence
T22891 21487-21497 NN denotes nucleotide
T22890 21484-21486 IN denotes of
T22889 21476-21483 NN denotes regions
T22888 21471-21475 IN denotes with
T22887 21463-21470 NN denotes regions
T22886 21454-21462 NN denotes flanking
T22885 21451-21453 NN denotes 5′
T22884 21442-21450 NN denotes SerpinB2
T22883 21435-21441 JJ denotes murine
T22882 21431-21434 CC denotes and
T22881 21425-21430 JJ denotes human
T22880 21421-21424 DT denotes the
T22879 21418-21420 IN denotes of
T22878 21403-21417 NN denotes representation
T22877 21393-21402 JJ denotes Schematic
T22876 21384-21391 NN denotes regions
T22875 21375-21383 NN denotes flanking
T22874 21372-21374 NN denotes 5′
T22873 21363-21371 NN denotes SerpinB2
T22872 21356-21362 JJ denotes murine
T22871 21352-21355 CC denotes and
T22870 21346-21351 JJ denotes human
T22869 21342-21345 DT denotes the
T22868 21334-21341 IN denotes between
T23928 26355-26364 VB denotes represent
T23927 26351-26354 CC denotes and
T23926 26341-26350 NN denotes treatment
T23925 26337-26340 NN denotes LPS
T23924 26327-26336 VB denotes following
T23923 26318-26326 NN denotes activity
T23922 26307-26317 NN denotes luciferase
T23921 26298-26306 JJ denotes relative
T23920 26293-26297 VB denotes show
T23919 26285-26292 NN denotes results
T23918 26281-26284 DT denotes The
T23917 26276-26279 NN denotes hrs
T23916 26273-26275 CD denotes 16
T23915 26269-26272 IN denotes for
T23914 26265-26268 NN denotes LPS
T23913 26259-26264 NN denotes ng/ml
T23912 26255-26258 CD denotes 100
T23911 26250-26254 IN denotes with
T23910 26242-26249 VB denotes treated
T23909 26239-26241 CC denotes or
T23908 26229-26238 JJ denotes untreated
T23907 26224-26228 JJ denotes left
T23906 26217-26223 CC denotes either
T23905 26213-26216 CC denotes and
T23904 26202-26212 NN denotes constructs
T23903 26193-26201 NN denotes reporter
T23902 26173-26192 NN denotes promoter-luciferase
T23901 26164-26172 NN denotes SerpinB2
T23885 26061-26067 NN denotes assays
T23884 26056-26060 NN denotes ChIP
T23883 26053-26055 IN denotes in
T23882 26048-26052 VB denotes used
T23881 26041-26047 CD denotes −5/+19
T23880 26037-26040 CC denotes and
T23879 26028-26036 CD denotes 338/−315
T23878 26026-26027 -COMMA- denotes ,
T23877 26019-26026 NN denotes primers
T23876 26001-26018 JJ denotes promoter-specific
T23875 25992-26000 JJ denotes proximal
T23874 25983-25991 NN denotes SerpinB2
T23873 25976-25982 JJ denotes murine
T23872 25973-25975 IN denotes of
T23871 25963-25972 NN denotes Positions
T23870 25956-25961 VB denotes shown
T23869 25951-25955 RB denotes also
T23868 25948-25950 VB denotes is
T23867 25937-25947 NN denotes constructs
T23866 25928-25936 NN denotes reporter
T23865 25924-25927 CD denotes −87
T23864 25920-25923 CC denotes and
T23863 25915-25919 CD denotes −189
T23862 25913-25914 -COMMA- denotes ,
T23861 25909-25913 CD denotes −539
T23860 25905-25908 DT denotes the
T23859 25902-25904 IN denotes of
T23858 25897-25901 NN denotes ends
T23857 25894-25896 CD denotes 5′
T23856 25890-25893 DT denotes the
T23855 25887-25889 IN denotes of
T23854 25878-25886 NN denotes location
T23853 25874-25877 DT denotes The
T23852 25867-25872 NN denotes boxes
T23851 25862-25866 IN denotes with
T23850 25852-25861 VB denotes indicated
T23849 25843-25851 NN denotes elements
T23848 25832-25842 JJ denotes regulatory
T23847 25821-25831 JJ denotes cis-acting
T23846 25811-25820 NN denotes candidate
T23845 25808-25810 IN denotes of
T23844 25799-25807 NN denotes location
T23843 25795-25798 DT denotes the
T23842 25790-25794 IN denotes with
T23841 25781-25789 NN denotes promoter
T23840 25772-25780 NN denotes SerpinB2
T23839 25765-25771 JJ denotes murine
T23838 25761-25764 DT denotes the
T23837 25758-25760 IN denotes of
T23836 25751-25757 NN denotes region
T23835 25742-25750 NN denotes −539/+92
T23834 25738-25741 DT denotes the
T23833 25735-25737 IN denotes of
T23832 25720-25734 NN denotes representation
T23831 25710-25719 JJ denotes Schematic
T23830 25708-25709 -RRB- denotes )
T23829 25707-25708 NN denotes A
T23828 25706-25707 -LRB- denotes (
T23827 25696-25704 NN denotes promoter
T23826 25687-25695 NN denotes SerpinB2
T23825 25680-25686 JJ denotes murine
T23824 25676-25679 DT denotes the
T23823 25673-25675 IN denotes of
T23822 25654-25672 NN denotes LPS-responsiveness
T23821 25650-25653 DT denotes the
T23820 25646-25649 IN denotes for
T23819 25637-25645 VB denotes required
T23818 25628-25636 NN denotes elements
T23817 25617-25627 JJ denotes cis-acting
T23816 25614-25616 IN denotes of
T23815 25599-25613 NN denotes Identification
T22867 21321-21333 NN denotes conservation
T22866 21312-21320 NN denotes sequence
T22865 21308-21311 NN denotes DNA
T22864 21306-21307 -RRB- denotes )
T22863 21305-21306 NN denotes C
T22862 21304-21305 -LRB- denotes (
T22861 21291-21303 NN denotes experiments.
T22860 21279-21290 JJ denotes independent
T22859 21274-21278 CD denotes four
T22858 21271-21273 IN denotes of
T22857 21267-21270 NN denotes SEM
T22856 21263-21266 CC denotes and
T22855 21258-21262 NN denotes mean
T22854 21254-21257 DT denotes the
T22853 21244-21253 VB denotes represent
T22852 21236-21243 NN denotes results
T22851 21232-21235 DT denotes The
T22850 21221-21230 NN denotes treatment
T22849 21211-21220 VB denotes following
T22848 21202-21210 NN denotes activity
T22847 21197-21201 NN denotes gene
T22846 21188-21196 NN denotes reporter
T22845 21177-21187 NN denotes luciferase
T22844 21168-21176 JJ denotes relative
T22843 21164-21167 DT denotes the
T22842 21161-21163 VB denotes is
T22836 21133-21138 NN denotes ng/ml
T22835 21130-21132 CD denotes 40
T22834 21127-21129 CC denotes or
T22833 21123-21126 NN denotes LPS
T22832 21117-21122 NN denotes ng/ml
T22831 21113-21116 CD denotes 100
T22830 21108-21112 IN denotes with
T22829 21100-21107 VB denotes treated
T22828 21097-21099 CC denotes or
T22827 21087-21096 JJ denotes untreated
T22826 21082-21086 JJ denotes left
T22825 21075-21081 CC denotes either
T22824 21070-21074 VB denotes were
T22823 21064-21069 NN denotes Cells
T22822 21054-21062 NN denotes plasmids
T22821 21046-21053 NN denotes control
T22820 21042-21045 CC denotes and
T22819 21031-21041 NN denotes constructs
T22818 21022-21030 NN denotes reporter
T22817 21002-21021 NN denotes promoter-luciferase
T22816 20993-21001 NN denotes SerpinB2
T22815 20986-20992 JJ denotes murine
T22814 20976-20985 VB denotes indicated
T22813 20972-20975 DT denotes the
T22812 20967-20971 IN denotes with
T22811 20955-20966 VB denotes transfected
T22810 20943-20954 RB denotes transiently
T22809 20938-20942 VB denotes were
T22808 20926-20937 NN denotes macrophages
T22807 20920-20925 CD denotes 264.7
T22806 20916-20919 NN denotes RAW
T22805 20914-20915 -RRB- denotes )
T22804 20913-20914 NN denotes B
T22803 20912-20913 -LRB- denotes (
T22802 20902-20911 NN denotes sequence.
T22801 20893-20901 NN denotes flanking
T22800 20890-20892 NN denotes 5′
T22799 20881-20889 NN denotes SerpinB2
T22798 20874-20880 JJ denotes murine
T22797 20871-20873 IN denotes of
T22796 20860-20870 NN denotes nucleotide
T22795 20857-20859 JJ denotes 5′
T22794 20852-20856 RB denotes most
T22793 20848-20851 DT denotes the
T22792 20839-20847 VB denotes indicate
T22791 20833-20838 NN denotes names
T22790 20823-20832 NN denotes Construct
T22789 20814-20821 NN denotes primers
T22788 20810-20813 NN denotes PCR
T22787 20794-20809 NN denotes oligonucleotide
T22786 20785-20793 JJ denotes specific
T22785 20780-20784 IN denotes with
T22784 20777-20779 CC denotes or
T22783 20771-20776 NN denotes sites
T22782 20764-20770 NN denotes enzyme
T22781 20752-20763 NN denotes restriction
T22780 20746-20751 VB denotes using
T22779 20736-20745 VB denotes generated
T22778 20731-20735 VB denotes were
T22777 20721-20730 NN denotes deletions
T22776 20718-20720 NN denotes 5′
T22775 20714-20717 CC denotes and
T22774 20709-20713 NN denotes gene
T22773 20700-20708 NN denotes reporter
T22772 20689-20699 NN denotes luciferase
T22771 20685-20688 DT denotes the
T22770 20682-20684 IN denotes of
T22769 20673-20681 RB denotes upstream
T22768 20664-20672 VB denotes inserted
T22767 20660-20663 VB denotes was
T22766 20656-20659 CD denotes +92
T22765 20653-20655 TO denotes to
T22764 20647-20652 CD denotes −4480
T22763 20642-20646 IN denotes from
T22762 20635-20641 NN denotes region
T22761 20626-20634 NN denotes flanking
T22760 20623-20625 NN denotes 5′
T22759 20616-20622 JJ denotes murine
T22758 20612-20615 DT denotes The
T22757 20600-20610 NN denotes constructs
T22756 20591-20599 NN denotes reporter
T22755 20580-20590 NN denotes luciferase
T22754 20571-20579 NN denotes deletion
T22753 20568-20570 NN denotes 5′
T22752 20564-20567 CC denotes and
T22751 20555-20563 NN denotes promoter
T22750 20546-20554 NN denotes SerpinB2
T22749 20539-20545 JJ denotes murine
T22748 20535-20538 DT denotes the
T22747 20532-20534 IN denotes of
T22746 20517-20531 NN denotes representation
T22745 20507-20516 JJ denotes Schematic
T22744 20505-20506 -RRB- denotes )
T22743 20504-20505 NN denotes A
T22742 20503-20504 -LRB- denotes (
T22741 20493-20501 NN denotes promoter
T22740 20484-20492 NN denotes SerpinB2
T22739 20477-20483 JJ denotes murine
T22738 20473-20476 DT denotes the
T22737 20470-20472 IN denotes in
T22736 20462-20469 NN denotes regions
T22735 20447-20461 JJ denotes PMA-responsive
T22734 20443-20446 CC denotes and
T22733 20439-20442 NN denotes LPS
T22732 20436-20438 IN denotes of
T22731 20427-20435 NN denotes analysis
T22730 20422-20426 NN denotes gene
T22729 20413-20421 NN denotes reporter
T22728 20404-20412 NN denotes Deletion
T23470 24140-24148 NN denotes SerpinB2
T23469 24133-24139 JJ denotes murine
T23468 24129-24132 CC denotes and
T23467 24123-24128 JJ denotes human
T23466 24119-24122 DT denotes the
T23465 24111-24118 IN denotes between
T23464 24101-24110 VB denotes conserved
T23463 24092-24100 NN denotes elements
T23462 24081-24091 JJ denotes Cis-acting
T23461 24071-24079 NN denotes software
T23460 24069-24070 NNP denotes W
T23459 24061-24068 NNP denotes Clustal
T23458 24055-24060 VB denotes using
T23457 24047-24054 VB denotes aligned
T23456 24042-24046 VB denotes were
T23455 24032-24041 NN denotes sequences
T23454 24021-24031 NN denotes nucleotide
T23453 24015-24020 JJ denotes human
T23452 24011-24014 CC denotes and
T23451 24005-24010 NN denotes Mouse
T23450 23996-24003 LS denotes −563/−1
T23449 23987-23995 NN denotes promoter
T23448 23978-23986 NN denotes SerpinB2
T23447 23971-23977 JJ denotes murine
T23446 23967-23970 DT denotes the
T23445 23964-23966 IN denotes of
T23444 23957-23963 NN denotes region
T23443 23946-23956 JJ denotes responsive
T23442 23942-23945 NN denotes LPS
T23441 23938-23941 DT denotes the
T23440 23935-23937 IN denotes in
T23439 23926-23934 NN denotes elements
T23438 23915-23925 JJ denotes regulatory
T23437 23904-23914 JJ denotes cis-acting
T23436 23894-23903 JJ denotes Potential
T23900 26157-26163 JJ denotes murine
T23899 26147-26156 VB denotes indicated
T23898 26143-26146 DT denotes the
T23897 26138-26142 IN denotes with
T23896 26126-26137 VB denotes transfected
T23895 26114-26125 RB denotes transiently
T23894 26109-26113 VB denotes were
T23893 26097-26108 NN denotes macrophages
T23892 26091-26096 CD denotes 264.7
T23891 26087-26090 NN denotes RAW
T23890 26085-26086 -RRB- denotes )
T23889 26084-26085 NN denotes B
T23888 26083-26084 -LRB- denotes (
T23887 26072-26082 VB denotes indicated.
T23886 26068-26071 VB denotes are
T23479 24208-24209 CD denotes 1
T23478 24200-24207 NN denotes protein
T23477 24190-24199 NN denotes activator
T23476 24182-24189 NN denotes AP-1 = 
T23475 24173-24180 VB denotes labeled
T23474 24169-24172 CC denotes and
T23473 24163-24168 VB denotes boxed
T23472 24159-24162 VB denotes are
T23471 24149-24158 NN denotes promoters
T22492 18612-18619 NN denotes control
T22491 18604-18611 NN denotes loading
T22490 18602-18603 DT denotes a
T22489 18599-18601 IN denotes as
T22488 18593-18598 NN denotes GAPDH
T22487 18589-18592 IN denotes for
T22486 18580-18588 VB denotes reprobed
T22485 18576-18579 VB denotes was
T22484 18571-18575 NN denotes Blot
T22483 18562-18569 NN denotes lysates
T22482 18557-18561 NN denotes cell
T22481 18551-18556 JJ denotes whole
T22480 18548-18550 IN denotes in
T22479 18537-18547 NN denotes expression
T22478 18529-18536 NN denotes protein
T22477 18520-18528 NN denotes SerpinB2
T22476 18517-18519 IN denotes of
T22475 18508-18516 NN denotes analysis
T22474 18497-18507 NN denotes Immunoblot
T22473 18495-18496 -RRB- denotes )
T22472 18494-18495 NN denotes B
T22471 18493-18494 -LRB- denotes (
T22470 18481-18492 FW denotes triplicate.
T22469 18478-18480 IN denotes in
T22468 18468-18477 VB denotes performed
T22467 18456-18467 NN denotes experiments
T22466 18444-18455 JJ denotes independent
T22465 18440-18443 CD denotes two
T22464 18434-18439 JJ denotes least
T22463 18431-18433 IN denotes at
T22462 18428-18430 IN denotes of
T22461 18413-18427 JJ denotes representative
T22460 18410-18412 VB denotes is
T22459 18405-18409 NN denotes plot
T22458 18401-18404 DT denotes The
T22457 18392-18399 NN denotes β-actin
T22456 18389-18391 TO denotes to
T22455 18380-18388 JJ denotes relative
T22454 18378-18379 -COMMA- denotes ,
T22453 18372-18378 NN denotes levels
T22452 18367-18371 NN denotes mRNA
T22451 18358-18366 NN denotes SerpinB2
T22450 18351-18357 JJ denotes murine
T22449 18348-18350 IN denotes of
T22448 18339-18347 NN denotes analysis
T22447 18334-18338 NN denotes qPCR
T22446 18332-18333 -RRB- denotes )
T22445 18331-18332 NN denotes A
T22444 18330-18331 -LRB- denotes (
T22443 18325-18329 NN denotes LPS.
T22442 18319-18324 NN denotes ng/ml
T22441 18315-18318 CD denotes 100
T22440 18310-18314 IN denotes with
T22439 18304-18309 NN denotes times
T22438 18294-18303 VB denotes indicated
T22437 18290-18293 DT denotes the
T22436 18286-18289 IN denotes for
T22435 18278-18285 VB denotes treated
T22434 18273-18277 VB denotes were
T22433 18261-18272 NN denotes macrophages
T22432 18252-18260 NN denotes RAW264.7
T22431 18245-18250 NN denotes cells
T22430 18234-18244 NN denotes macrophage
T22429 18227-18233 JJ denotes murine
T22428 18224-18226 IN denotes in
T22427 18213-18223 NN denotes expression
T22426 18205-18212 NN denotes protein
T22425 18201-18204 CC denotes and
T22424 18196-18200 NN denotes mRNA
T22423 18187-18195 NN denotes SerpinB2
T22422 18184-18186 IN denotes of
T22421 18174-18183 NN denotes induction
T22420 18170-18173 NN denotes LPS
T22841 21155-21160 NNP denotes Shown
T22840 21150-21153 NN denotes hrs
T22839 21147-21149 CD denotes 16
T22838 21143-21146 IN denotes for
T22837 21139-21142 NN denotes PMA
T19990 47240-47250 NN denotes expression
T19989 47235-47239 NN denotes gene
T19988 47226-47234 NN denotes SerpinB2
T19987 47202-47225 JJ denotes inflammation-associated
T19986 47199-47201 IN denotes of
T19985 47188-47198 NN denotes regulation
T19984 47184-47187 DT denotes the
T19983 47179-47183 IN denotes into
T19982 47171-47178 NN denotes insight
T19981 47167-47170 JJ denotes new
T19980 47159-47166 VB denotes provide
T19979 47154-47158 NN denotes data
T19978 47148-47153 DT denotes these
T19977 47139-47147 RB denotes together
T19976 47133-47138 VB denotes Taken
T19975 47123-47131 NN denotes activity
T19974 47114-47122 NN denotes promoter
T19973 47105-47113 NN denotes SerpinB2
T19972 47094-47104 VB denotes regulating
T19971 47083-47093 RB denotes negatively
T19970 47080-47082 IN denotes in
T19969 47069-47079 NN denotes C/EBP-βS64
T19968 47065-47068 IN denotes for
T19967 47060-47064 NN denotes role
T19966 47052-47059 JJ denotes unknown
T19965 47041-47051 RB denotes previously
T19964 47039-47040 DT denotes a
T19963 47031-47038 VB denotes uncover
T19962 47028-47030 TO denotes to
T19961 47023-47027 JJ denotes able
T19960 47018-47022 VB denotes were
T19959 47015-47017 PRP denotes we
T19958 47013-47014 -COMMA- denotes ,
T19957 47002-47013 RB denotes Importantly
T19956 46990-47000 NN denotes expression
T19955 46985-46989 NN denotes gene
T19954 46976-46984 NN denotes SerpinB2
T19953 46964-46975 JJ denotes LPS-induced
T19952 46960-46963 CC denotes and
T19951 46947-46959 JJ denotes constitutive
T19950 46942-46946 CC denotes both
T19949 46934-46941 VB denotes support
T19948 46931-46933 TO denotes to
T19947 46921-46930 JJ denotes necessary
T19946 46918-46920 VB denotes is
T19945 46909-46917 NN denotes promoter
T19944 46900-46908 JJ denotes proximal
T19943 46891-46899 NN denotes SerpinB2
T19942 46884-46890 JJ denotes murine
T19941 46880-46883 DT denotes the
T19940 46877-46879 IN denotes in
T19939 46875-46876 -RRB- denotes )
T19938 46866-46875 CD denotes −203/−195
T19937 46865-46866 -LRB- denotes (
T19936 46860-46864 NN denotes site
T19935 46854-46859 NN denotes C/EBP
T19934 46850-46853 DT denotes the
T19933 46845-46849 IN denotes that
T19932 46840-46844 VB denotes show
T19931 46832-46839 NN denotes studies
T19930 46828-46831 PRP-DOLLAR- denotes our
T19929 46826-46827 -COMMA- denotes ,
T19928 46819-46826 NN denotes summary
T19927 46816-46818 IN denotes In
T19926 46798-46814 NN denotes microenvironment
T19925 46792-46797 NN denotes tumor
T19924 46788-46791 DT denotes the
T19923 46785-46787 IN denotes in
T19922 46779-46784 NN denotes cells
T19921 46772-46778 JJ denotes immune
T19920 46759-46771 VB denotes infiltrating
T19919 46756-46758 IN denotes of
T19918 46746-46755 NN denotes phenotype
T19917 46733-46745 JJ denotes inflammatory
T19916 46729-46732 DT denotes the
T19915 46725-46728 IN denotes for
T19914 46712-46724 NN denotes implications
T19913 46707-46711 VB denotes have
T19912 46703-46706 MD denotes may
T19911 46697-46702 WDT denotes which
T19910 46695-46696 -COMMA- denotes ,
T19909 46691-46695 NN denotes gene
T19908 46682-46690 NN denotes SerpinB2
T19907 46678-46681 DT denotes the
T19906 46675-46677 IN denotes of
T19905 46661-46674 NN denotes transcription
T19904 46649-46660 JJ denotes LPS-induced
T19903 46645-46648 CC denotes and
T19902 46632-46644 JJ denotes constitutive
T19901 46627-46631 CC denotes both
T19900 46617-46626 VB denotes mediating
T19899 46614-46616 IN denotes in
T19898 46609-46613 NN denotes role
T19897 46599-46608 JJ denotes important
T19896 46596-46598 DT denotes an
T19895 46590-46595 VB denotes plays
T19894 46582-46589 NN denotes C/EBP-β
T19893 46577-46581 IN denotes that
T19892 46564-46576 VB denotes demonstrated
T19891 46560-46563 VB denotes has
T19890 46554-46559 NN denotes study
T19889 46550-46553 PRP-DOLLAR- denotes Our
T19888 46547-46548 -RRB- denotes ]
T19887 46545-46547 CD denotes 81
T19886 46544-46545 -LRB- denotes [
T19885 46543-46544 CD denotes –
T19884 46542-46543 -RRB- denotes ]
T19883 46540-46542 CD denotes 79
T19882 46539-46540 -LRB- denotes [
T19881 46537-46538 -COLON- denotes ;
T19880 46536-46537 -RRB- denotes ]
T19879 46534-46536 CD denotes 27
T19878 46533-46534 -LRB- denotes [
T19877 46523-46532 NN denotes phenotype
T19876 46517-46522 PRP-DOLLAR- denotes their
T19875 46507-46516 VB denotes modifying
T19874 46499-46506 RB denotes thereby
T19770 45952-45962 RB denotes integrally
T19769 45949-45951 VB denotes is
T19768 45939-45948 NN denotes infection
T19767 45928-45938 JJ denotes persistent
T19766 45923-45927 IN denotes that
T19765 45914-45922 JJ denotes apparent
T19764 45907-45913 VB denotes become
T19763 45903-45906 VB denotes has
T19762 45900-45902 PRP denotes it
T19761 45894-45899 NN denotes years
T19760 45887-45893 JJ denotes recent
T19759 45884-45886 IN denotes In
T19758 45874-45882 NN denotes pathways
T19757 45860-45873 JJ denotes LPS-signaling
T19756 45857-45859 IN denotes in
T19755 45848-45856 VB denotes involved
T19754 45845-45847 VB denotes be
T19753 45840-45844 RB denotes also
T19752 45836-45839 MD denotes may
T19751 45832-45835 NN denotes S64
T19750 45829-45831 IN denotes of
T19749 45811-45828 NN denotes dephosphorylation
T19748 45799-45810 JJ denotes MLK3-driven
T19747 45794-45798 IN denotes that
T19746 45786-45793 VB denotes suggest
T19745 45781-45785 NN denotes data
T19744 45777-45780 PRP-DOLLAR- denotes Our
T19743 45774-45775 -RRB- denotes ]
T19742 45772-45774 CD denotes 73
T19741 45771-45772 -LRB- denotes [
T19740 45762-45770 NN denotes pathways
T19739 45752-45761 NN denotes signaling
T19738 45737-45751 JJ denotes IFNγ-regulated
T19737 45733-45736 IN denotes for
T19736 45723-45732 JJ denotes important
T19735 45719-45722 VB denotes was
T19734 45715-45718 NN denotes S64
T19733 45707-45714 NN denotes C/EBP-β
T19732 45704-45706 IN denotes of
T19731 45686-45703 NN denotes dephosphorylation
T19730 45678-45685 JJ denotes -driven
T19729 45677-45678 -RRB- denotes )
T19728 45673-45677 NN denotes MLK3
T19727 45672-45673 -LRB- denotes (
T19726 45663-45671 NN denotes kinase-3
T19725 45655-45662 NN denotes lineage
T19724 45649-45654 JJ denotes Mixed
T19723 45644-45648 IN denotes that
T19722 45631-45643 VB denotes demonstrated
T19721 45620-45630 NN denotes colleagues
T19720 45616-45619 CC denotes and
T19719 45612-45615 NNP denotes Roy
T19718 45602-45610 NN denotes activity
T19717 45593-45601 NN denotes promoter
T19716 45589-45592 PRP-DOLLAR- denotes its
T19715 45580-45588 VB denotes increase
T19714 45577-45579 TO denotes to
T19713 45568-45576 NN denotes SerpinB2
T19712 45565-45567 IN denotes of
T19711 45551-45564 NN denotes transcription
T19710 45539-45550 JJ denotes LPS-induced
T19709 45532-45538 IN denotes during
T19708 45526-45531 NN denotes event
T19707 45517-45525 JJ denotes critical
T19706 45515-45516 DT denotes a
T19705 45512-45514 VB denotes be
T19704 45508-45511 MD denotes may
T19703 45503-45507 NN denotes site
T19702 45498-45502 DT denotes this
T19701 45495-45497 IN denotes at
T19700 45477-45494 NN denotes dephosphorylation
T19699 45472-45476 IN denotes that
T19698 45465-45471 JJ denotes likely
T19697 45462-45464 VB denotes is
T19696 45459-45461 PRP denotes it
T19695 45457-45458 -COMMA- denotes ,
T19694 45456-45457 -RRB- denotes ]
T19693 45454-45456 CD denotes 73
T19692 45453-45454 -LRB- denotes [
T19691 45448-45452 NN denotes MEFs
T19690 45444-45447 CC denotes and
T19689 45438-45443 NN denotes cells
T19688 45429-45437 NN denotes RAW264.7
T19687 45424-45428 CC denotes both
T19686 45421-45423 IN denotes in
T19685 45406-45420 VB denotes phosphorylated
T19684 45391-45405 RB denotes constitutively
T19683 45388-45390 VB denotes is
T19682 45384-45387 NN denotes S64
T19681 45376-45383 NN denotes C/EBP-β
T19680 45370-45375 IN denotes Since
T19679 45360-45368 NN denotes activity
T19678 45351-45359 NN denotes promoter
T19677 45342-45350 NN denotes SerpinB2
T19676 45330-45341 JJ denotes LPS-induced
T19675 45320-45329 VB denotes regulates
T19674 45309-45319 RB denotes negatively
T19673 45305-45308 NN denotes S64
T19672 45302-45304 IN denotes at
T19671 45294-45301 NN denotes C/EBP-β
T19670 45291-45293 IN denotes of
T19669 45275-45290 NN denotes phosphorylation
T19668 45270-45274 IN denotes that
T19667 45259-45269 VB denotes indicating
T19666 45257-45258 -COMMA- denotes ,
T19665 45249-45257 NN denotes activity
T19664 45240-45248 NN denotes promoter
T19663 45231-45239 NN denotes SerpinB2
T19662 45219-45230 JJ denotes LPS-induced
T19661 45210-45218 VB denotes enhanced
T19660 45196-45209 RB denotes significantly
T19659 45184-45195 NN denotes C/EBP-βS64A
T19658 45181-45183 IN denotes of
T19657 45170-45180 NN denotes expression
T19656 45168-45169 -COMMA- denotes ,
T19655 45160-45168 NN denotes contrast
T19654 45157-45159 IN denotes In
T19653 45146-45155 JJ denotes wild-type
T19652 45143-45145 IN denotes of
T19651 45138-45142 DT denotes that
T19650 45133-45137 IN denotes from
T19649 45121-45132 RB denotes differently
T19648 45112-45120 NN denotes activity
T19647 45103-45111 NN denotes promoter
T19646 45094-45102 NN denotes SerpinB2
T19645 45087-45093 VB denotes affect
T19644 45083-45086 RB denotes not
T19643 45079-45082 VB denotes did
T19642 45077-45078 -COMMA- denotes ,
T19641 45065-45077 NN denotes C/EBP-βT188A
T19640 45063-45064 -COMMA- denotes ,
T19639 45057-45063 JJ denotes mutant
T19638 45052-45056 NN denotes site
T19637 45035-45051 NN denotes phospho-acceptor
T19636 45027-45034 NN denotes C/EBP-β
T19635 45023-45026 DT denotes the
T19634 45020-45022 IN denotes of
T19633 45009-45019 NN denotes expression
T19632 45007-45008 -COMMA- denotes ,
T19631 44998-45007 RB denotes Similarly
T19630 44986-44996 NN denotes expression
T19629 44981-44985 NN denotes gene
T19628 44972-44980 NN denotes SerpinB2
T19627 44969-44971 IN denotes of
T19626 44958-44968 NN denotes regulation
T19625 44954-44957 DT denotes the
T19624 44950-44953 IN denotes for
T19623 44940-44949 JJ denotes important
T19622 44936-44939 RB denotes not
T19621 44933-44935 VB denotes is
T19620 44928-44932 NN denotes site
T19619 44911-44927 NN denotes phospho-acceptor
T19618 44906-44910 NN denotes T217
T19617 44902-44905 DT denotes the
T19616 44897-44901 IN denotes that
T19615 44888-44896 VB denotes indicate
T19614 44883-44887 NN denotes data
T19613 44877-44882 DT denotes These
T19612 44870-44875 NN denotes cells
T19611 44861-44869 NN denotes RAW264.7
T19610 44858-44860 IN denotes of
T19609 44846-44857 NN denotes stimulation
T19608 44842-44845 NN denotes LPS
T19607 44832-44841 VB denotes following
T19606 44823-44831 VB denotes decrease
T19605 44820-44822 TO denotes to
T19604 44811-44819 VB denotes observed
T19603 44807-44810 VB denotes was
T19602 44798-44806 NN denotes promoter
T19601 44789-44797 NN denotes SerpinB2
T19600 44785-44788 DT denotes the
T19599 44782-44784 TO denotes to
T19598 44770-44781 NN denotes C/EBP-βT217
T19597 44767-44769 IN denotes of
T19596 44755-44766 NN denotes recruitment
T19595 44748-44754 IN denotes though
T19594 44743-44747 RB denotes even
T19593 44741-44742 -COMMA- denotes ,
T19592 44734-44741 NN denotes C/EBP-β
T19591 44724-44733 JJ denotes wild-type
T19590 44721-44723 IN denotes of
T19589 44716-44720 DT denotes that
T19588 44711-44715 IN denotes over
T19587 44702-44710 NN denotes activity
T19586 44693-44701 NN denotes promoter
T19585 44684-44692 JJ denotes proximal
T19584 44675-44683 NN denotes SerpinB2
T19583 44666-44674 VB denotes increase
T19582 44662-44665 RB denotes not
T19581 44658-44661 VB denotes did
T19580 44653-44657 NN denotes MEFs
T19579 44644-44652 NNP denotes Cebpb−/−
T19578 44641-44643 IN denotes in
T19577 44639-44640 -COMMA- denotes ,
T19576 44628-44639 NN denotes C/EBPβT217A
T19575 44626-44627 -COMMA- denotes ,
T19574 44620-44626 JJ denotes mutant
T19573 44615-44619 NN denotes site
T19572 44598-44614 NN denotes phospho-acceptor
T19571 44590-44597 JJ denotes C/EBP-β
T19570 44588-44589 DT denotes a
T19569 44585-44587 IN denotes of
T19568 44574-44584 NN denotes expression
T19567 44572-44573 -COMMA- denotes ,
T19566 44565-44572 RB denotes However
T19565 44562-44563 -RRB- denotes ]
T19564 44560-44562 CD denotes 16
T19563 44559-44560 -LRB- denotes [
T19562 44550-44558 NN denotes SerpinB2
T19561 44547-44549 TO denotes to
T19560 44536-44546 VB denotes attributed
T19559 44531-44535 VB denotes been
T19558 44526-44530 RB denotes also
T19557 44522-44525 VB denotes has
T19556 44517-44521 WDT denotes that
T19555 44508-44516 NN denotes activity
T19546 44488-44493 NN denotes toxin
T19545 44481-44487 JJ denotes lethal
T19544 44471-44480 NN denotes anthracis
T19543 44462-44470 NN denotes Bacillus
T19542 44459-44461 IN denotes by
T19541 44451-44458 VB denotes induced
T19540 44441-44450 NN denotes apoptosis
T19539 44436-44440 IN denotes from
T19538 44424-44435 NN denotes macrophages
T19537 44417-44423 VB denotes rescue
T19536 44414-44416 TO denotes to
T19535 44405-44413 VB denotes reported
T19534 44400-44404 VB denotes been
T19533 44396-44399 VB denotes has
T19532 44391-44395 NN denotes T217
T19531 44388-44390 IN denotes on
T19530 44373-44387 VB denotes phosphorylated
T19529 44365-44372 NN denotes C/EBP-β
T19528 44361-44362 -COLON- denotes ;
T19527 44360-44361 -RRB- denotes ]
T19526 44358-44360 CD denotes 63
T19525 44357-44358 -LRB- denotes [
T19524 44351-44356 NN denotes genes
T19523 44344-44350 NN denotes target
T19522 44340-44343 PRP-DOLLAR- denotes its
T19521 44337-44339 IN denotes of
T19520 44321-44336 NN denotes transactivation
T19519 44312-44320 VB denotes modulate
T19518 44309-44311 TO denotes to
T19517 44303-44308 VB denotes shown
T19516 44298-44302 VB denotes been
T19515 44294-44297 VB denotes has
T19514 44285-44293 NN denotes residues
T19513 44280-44284 NN denotes acid
T19512 44274-44279 NN denotes amino
T19511 44264-44273 JJ denotes different
T19510 44256-44263 JJ denotes several
T19509 44253-44255 IN denotes at
T19508 44245-44252 NN denotes C/EBP-β
T19507 44242-44244 IN denotes of
T19506 44226-44241 NN denotes Phosphorylation
T19505 44212-44224 NN denotes inflammation
T19504 44209-44211 IN denotes in
T19503 44204-44208 NN denotes role
T19502 44193-44203 JJ denotes functional
T19501 44189-44192 PRP-DOLLAR- denotes its
T19500 44184-44188 IN denotes with
T19499 44173-44183 JJ denotes consistent
T19498 44170-44172 VB denotes is
T19497 44162-44169 NN denotes C/EBP-β
T19496 44159-44161 IN denotes by
T19495 44148-44158 NN denotes expression
T19494 44143-44147 NN denotes gene
T19493 44134-44142 NN denotes SerpinB2
T19492 44131-44133 IN denotes of
T19491 44120-44130 NN denotes regulation
T19490 44116-44119 DT denotes the
T19489 44111-44115 RB denotes Thus
T19488 44108-44109 -RRB- denotes ]
T19487 44106-44108 CD denotes 25
T19486 44105-44106 -LRB- denotes [
T19485 44103-44104 -COLON- denotes ;
T19484 44102-44103 -RRB- denotes ]
T19483 44100-44102 CD denotes 16
T19482 44099-44100 -LRB- denotes [
T19481 44098-44099 CD denotes –
T19480 44097-44098 -RRB- denotes ]
T19479 44095-44097 CD denotes 14
T19478 44094-44095 -LRB- denotes [
T19477 44088-44093 NN denotes death
T19476 44083-44087 NN denotes cell
T19475 44069-44082 JJ denotes viral-induced
T19474 44065-44068 CC denotes and
T19473 44055-44064 JJ denotes bacterial
T19472 44050-44054 IN denotes from
T19471 44042-44049 VB denotes protect
T19470 44039-44041 TO denotes to
T19469 44026-44038 VB denotes demonstrated
T19468 44021-44025 VB denotes been
T19467 44017-44020 VB denotes has
T19466 44008-44016 NN denotes SerpinB2
T19465 44004-44007 CC denotes and
T19464 44002-44003 -RRB- denotes ]
T19463 44000-44002 CD denotes 70
T19462 43999-44000 -LRB- denotes [
T19461 43997-43998 -COLON- denotes ;
T19460 43996-43997 -RRB- denotes ]
T19459 43994-43996 CD denotes 69
T19458 43993-43994 -LRB- denotes [
T19457 43983-43992 NN denotes infection
T19456 43973-43982 JJ denotes bacterial
T19455 43970-43972 TO denotes to
T19454 43958-43969 JJ denotes susceptible
T19453 43954-43957 VB denotes are
T19452 43949-43953 NN denotes mice
T19451 43936-43948 JJ denotes C/EBP-β-null
T19450 43934-43935 -COMMA- denotes ,
T19449 43923-43934 RB denotes Furthermore
T19448 43920-43921 -RRB- denotes ]
T19447 43918-43920 CD denotes 62
T19446 43917-43918 -LRB- denotes [
T19445 43915-43916 -COLON- denotes ;
T19444 43914-43915 -RRB- denotes ]
T19443 43912-43914 CD denotes 59
T19442 43911-43912 -LRB- denotes [
T19441 43901-43910 NN denotes cytokines
T19440 43888-43900 JJ denotes inflammatory
T19439 43882-43887 JJ denotes other
T19438 43879-43881 IN denotes of
T19437 43874-43878 NN denotes host
T19436 43872-43873 DT denotes a
T19435 43868-43871 CC denotes and
T19434 43864-43867 NN denotes LPS
T19433 43861-43863 IN denotes by
T19432 43849-43860 VB denotes upregulated
T19431 43846-43848 VB denotes is
T19430 43843-43845 PRP denotes it
T19429 43840-43842 IN denotes as
T19428 43838-43839 -COMMA- denotes ,
T19427 43826-43838 NN denotes inflammation
T19426 43823-43825 IN denotes in
T19425 43818-43822 NN denotes role
T19424 43808-43817 JJ denotes important
T19423 43805-43807 DT denotes an
T19422 43799-43804 VB denotes plays
T19421 43797-43798 -COMMA- denotes ,
T19420 43789-43797 NN denotes SerpinB2
T19419 43784-43788 IN denotes like
T19418 43782-43783 -COMMA- denotes ,
T19417 43775-43782 NN denotes C/EBP-β
T19416 43763-43773 NN denotes expression
T19415 43758-43762 NN denotes gene
T19414 43749-43757 NN denotes SerpinB2
T19413 43737-43748 JJ denotes LPS-induced
T19412 43734-43736 IN denotes in
T19411 43726-43733 NN denotes C/EBP-β
T19410 43722-43725 IN denotes for
T19409 43717-43721 NN denotes role
T19408 43705-43716 JJ denotes predominant
T19407 43703-43704 DT denotes a
T19406 43692-43702 VB denotes suggesting
T19405 43690-43691 -COMMA- denotes ,
T19404 43683-43690 NN denotes element
T19403 43674-43682 NN denotes response
T19402 43668-43673 NN denotes C/EBP
T19401 43659-43667 NN denotes SerpinB2
T19400 43655-43658 DT denotes the
T19399 43650-43654 VB denotes bind
T19398 43647-43649 TO denotes to
T19397 43639-43646 NN denotes isoform
T19396 43633-43638 NN denotes C/EBP
T19395 43619-43632 JJ denotes LPS-inducible
T19394 43614-43618 JJ denotes only
T19393 43610-43613 DT denotes the
T19392 43607-43609 IN denotes as
T19391 43599-43606 NN denotes C/EBP-β
T19390 43588-43598 VB denotes identified
T19389 43585-43587 PRP denotes we
T19388 43583-43584 -COMMA- denotes ,
T19387 43582-43583 -RRB- denotes ]
T19386 43580-43582 CD denotes 63
T19385 43579-43580 -LRB- denotes [
T19384 43566-43578 NN denotes heterodimers
T19383 43563-43565 CC denotes or
T19382 43552-43562 NN denotes homodimers
T19381 43545-43551 CC denotes either
T19380 43542-43544 IN denotes as
T19379 43538-43541 VB denotes act
T19378 43534-43537 MD denotes can
T19377 43525-43533 NN denotes proteins
T19376 43519-43524 NN denotes C/EBP
T19375 43513-43518 IN denotes While
T19374 43498-43511 NN denotes transcription
T19373 43493-43497 NN denotes gene
T19372 43484-43492 NN denotes SerpinB2
T19371 43480-43483 CC denotes and
T19370 43472-43479 NN denotes C/EBP-β
T19369 43464-43471 IN denotes between
T19368 43459-43463 NN denotes link
T19367 43455-43458 DT denotes the
T19366 43443-43454 VB denotes emphasizing
T19365 43441-43442 -COMMA- denotes ,
T19364 43430-43441 NN denotes macrophages
T19363 43419-43429 JJ denotes peritoneal
T19362 43408-43418 VB denotes transduced
T19361 43394-43407 NN denotes C/EBP-β-shRNA
T19360 43391-43393 IN denotes in
T19359 43381-43390 VB denotes abrogated
T19358 43367-43380 RB denotes significantly
T19357 43364-43366 VB denotes is
T19873 46497-46498 -COMMA- denotes ,
T19872 46492-46497 NN denotes cells
T19871 46485-46491 JJ denotes immune
T19870 46480-46484 IN denotes from
T19869 46470-46479 NN denotes secretion
T19868 46461-46469 NN denotes cytokine
T19867 46452-46460 VB denotes modulate
T19866 46449-46451 TO denotes to
T19865 46443-46448 VB denotes shown
T19864 46438-46442 VB denotes been
T19863 46433-46437 RB denotes also
T19862 46429-46432 VB denotes has
T19861 46421-46428 NN denotes C/EBP-β
T19860 46407-46420 RB denotes Interestingly
T19859 46404-46405 -RRB- denotes ]
T19858 46402-46404 CD denotes 78
T19857 46401-46402 -LRB- denotes [
T19856 46399-46400 -COLON- denotes ;
T19855 46398-46399 -RRB- denotes ]
T19854 46396-46398 CD denotes 77
T19853 46395-46396 -LRB- denotes [
T19852 46393-46394 -COLON- denotes ;
T19851 46392-46393 -RRB- denotes ]
T19850 46390-46392 CD denotes 28
T19849 46389-46390 -LRB- denotes [
T19848 46387-46388 -COLON- denotes ;
T19847 46386-46387 -RRB- denotes ]
T19846 46384-46386 CD denotes 27
T19845 46383-46384 -LRB- denotes [
T19844 46370-46382 NN denotes polarization
T19843 46365-46369 NN denotes cell
T19842 46358-46364 JJ denotes immune
T19841 46351-46357 VB denotes affect
T19840 46347-46350 MD denotes can
T19839 46341-46346 WDT denotes which
T19838 46332-46340 NN denotes profiles
T19837 46323-46331 NN denotes cytokine
T19836 46314-46322 VB denotes modulate
T19835 46311-46313 TO denotes to
T19834 46305-46310 VB denotes shown
T19833 46300-46304 VB denotes been
T19832 46296-46299 VB denotes has
T19831 46287-46295 NN denotes SerpinB2
T19830 46284-46286 IN denotes of
T19829 46275-46283 NN denotes presence
T19828 46271-46274 DT denotes The
T19827 46268-46269 -RRB- denotes ]
T19826 46266-46268 CD denotes 77
T19825 46265-46266 -LRB- denotes [
T19824 46260-46264 NN denotes type
T19823 46253-46259 NN denotes cancer
T19822 46250-46252 IN denotes on
T19821 46240-46249 VB denotes depending
T19820 46230-46239 NN denotes indicator
T19819 46219-46229 JJ denotes prognostic
T19818 46207-46218 JJ denotes unfavorable
T19817 46204-46206 CC denotes or
T19816 46194-46203 JJ denotes favorable
T19815 46192-46193 DT denotes a
T19814 46189-46191 VB denotes is
T19813 46185-46188 CC denotes and
T19812 46183-46184 -COMMA- denotes ,
T19811 46177-46183 NN denotes cancer
T19810 46173-46176 CC denotes and
T19809 46160-46172 NN denotes inflammation
T19808 46155-46159 CC denotes both
T19807 46150-46154 IN denotes with
T19806 46139-46149 VB denotes associated
T19805 46134-46138 VB denotes been
T19804 46130-46133 VB denotes has
T19803 46119-46129 NN denotes expression
T19802 46110-46118 NN denotes SerpinB2
T19801 46107-46108 -RRB- denotes ]
T19800 46105-46107 CD denotes 76
T19799 46104-46105 -LRB- denotes [
T19798 46103-46104 CD denotes –
T19797 46102-46103 -RRB- denotes ]
T19796 46100-46102 CD denotes 74
T19795 46099-46100 -LRB- denotes [
T19794 46097-46098 -COLON- denotes ;
T19793 46096-46097 -RRB- denotes ]
T19792 46095-46096 CD denotes 2
T19791 46094-46095 -LRB- denotes [
T19790 46082-46093 NN denotes progression
T19789 46075-46081 NN denotes cancer
T19788 46065-46074 VB denotes attenuate
T19787 46062-46064 CC denotes or
T19786 46054-46061 VB denotes promote
T19785 46047-46053 CC denotes either
T19784 46043-46046 MD denotes can
T19783 46031-46042 NN denotes macrophages
T19782 46028-46030 IN denotes as
T19781 46023-46027 JJ denotes such
T19780 46017-46022 NN denotes cells
T19779 46010-46016 JJ denotes immune
T19778 46006-46009 CC denotes and
T19777 46004-46005 -COMMA- denotes ,
T19776 45998-46004 NN denotes cancer
T19775 45994-45997 CC denotes and
T19774 45981-45993 NN denotes inflammation
T19773 45973-45980 JJ denotes chronic
T19772 45970-45972 TO denotes to
T19771 45963-45969 VB denotes linked
T19356 43353-43363 NN denotes expression
T19355 43348-43352 NN denotes mRNA
T19354 43339-43347 NN denotes SerpinB2
T19353 43325-43338 JJ denotes LPS-inducible
T19352 43321-43324 CC denotes and
T19351 43308-43320 JJ denotes constitutive
T19350 43303-43307 CC denotes both
T19349 43298-43302 IN denotes that
T19348 43292-43297 VB denotes found
T19347 43289-43291 PRP denotes we
T19346 43286-43288 IN denotes as
T19345 43284-43285 -COMMA- denotes ,
T19344 43277-43284 NN denotes finding
T19343 43272-43276 DT denotes this
T19342 43263-43271 VB denotes validate
T19341 43255-43262 NN denotes results
T19340 43250-43254 NN denotes qPCR
T19339 43246-43249 PRP-DOLLAR- denotes Our
T19338 43243-43244 -RRB- denotes ]
T19337 43241-43243 CD denotes 68
T19336 43240-43241 -LRB- denotes [
T19335 43228-43239 NN denotes macrophages
T19334 43218-43227 JJ denotes wild-type
T19333 43215-43217 TO denotes to
T19332 43206-43214 VB denotes compared
T19331 43197-43205 JJ denotes impaired
T19301 42978-42981 CC denotes and
T19300 42965-42977 JJ denotes constitutive
T19299 42960-42964 CC denotes both
T19298 42956-42959 IN denotes for
T19297 42944-42955 NN denotes requirement
T19296 42938-42943 JJ denotes major
T19295 42936-42937 DT denotes a
T19294 42933-42935 VB denotes be
T19293 42930-42932 TO denotes to
T19292 42924-42929 VB denotes found
T19291 42920-42923 VB denotes was
T19290 42912-42919 NN denotes C/EBP-β
T19289 42910-42911 -COMMA- denotes ,
T19288 42905-42910 NN denotes study
T19287 42900-42904 DT denotes this
T19286 42897-42899 IN denotes In
T19285 42894-42895 -RRB- denotes ]
T19284 42892-42894 CD denotes 67
T19283 42891-42892 -LRB- denotes [
T19282 42886-42890 NN denotes gene
T19281 42878-42885 NN denotes C/EBP-β
T19280 42874-42877 DT denotes the
T19279 42871-42873 IN denotes of
T19278 42857-42870 NN denotes transcription
T19277 42849-42856 VB denotes control
T19276 42846-42848 TO denotes to
T19275 42840-42845 VB denotes shown
T19274 42835-42839 VB denotes been
T19273 42831-42834 VB denotes has
T19272 42826-42830 NN denotes CREB
T19271 42824-42825 -COMMA- denotes ,
T19270 42812-42824 RB denotes Additionally
T19269 42809-42810 -RRB- denotes ]
T19268 42807-42809 CD denotes 66
T19267 42806-42807 -LRB- denotes [
T19266 42804-42805 -COLON- denotes ;
T19265 42803-42804 -RRB- denotes ]
T19264 42801-42803 CD denotes 63
T19263 42800-42801 -LRB- denotes [
T19262 42790-42799 NN denotes mediators
T19261 42777-42789 JJ denotes inflammatory
T19260 42774-42776 IN denotes of
T19259 42763-42773 NN denotes expression
T19258 42758-42762 NN denotes gene
T19257 42750-42757 VB denotes promote
T19256 42747-42749 TO denotes to
T19255 42741-42746 NN denotes NF-κB
T19254 42737-42740 CC denotes and
T19253 42735-42736 -COMMA- denotes ,
T19252 42731-42735 NN denotes AP-1
T19251 42726-42730 IN denotes with
T19250 42717-42725 VB denotes interact
T19249 42706-42716 RB denotes physically
T19248 42703-42705 TO denotes to
T19247 42694-42702 VB denotes reported
T19246 42689-42693 VB denotes been
T19245 42685-42688 VB denotes has
T19244 42677-42684 NN denotes C/EBP-β
T19243 42673-42676 CC denotes and
T19242 42671-42672 -COMMA- denotes ,
T19241 42670-42671 -RRB- denotes ]
T19240 42668-42670 CD denotes 63
T19239 42667-42668 -LRB- denotes [
T19238 42662-42666 NN denotes AP-1
T19237 42658-42661 CC denotes and
T19236 42656-42657 -RRB- denotes )
T19235 42652-42656 NN denotes CREB
T19234 42651-42652 -LRB- denotes (
T19233 42642-42650 NN denotes proteins
T19232 42634-42641 NN denotes binding
T19231 42630-42633 NN denotes CRE
T19230 42626-42629 CC denotes and
T19229 42618-42625 NN denotes C/EBP-β
T19228 42610-42617 IN denotes between
T19227 42597-42609 NN denotes interactions
T19226 42583-42596 JJ denotes combinatorial
T19225 42580-42582 IN denotes of
T19224 42572-42579 NN denotes reports
T19223 42563-42571 JJ denotes previous
T19222 42559-42562 VB denotes are
T19221 42553-42558 EX denotes there
T19220 42551-42552 -COMMA- denotes ,
T19219 42547-42551 NN denotes note
T19218 42544-42546 IN denotes Of
T19217 42534-42542 JJ denotes critical
T19216 42528-42533 VB denotes being
T19215 42523-42527 RB denotes also
T19214 42514-42522 NN denotes elements
T19213 42504-42513 JJ denotes AP-1-like
T19212 42500-42503 CC denotes and
T19211 42496-42499 NN denotes CRE
T19210 42485-42495 JJ denotes downstream
T19209 42481-42484 DT denotes the
T19208 42476-42480 IN denotes with
T19207 42474-42475 -COMMA- denotes ,
T19206 42470-42474 CD denotes −539
T19205 42466-42469 CC denotes and
T19204 42461-42465 CD denotes −189
T19203 42449-42460 NN denotes nucleotides
T19202 42441-42448 IN denotes between
T19201 42434-42440 NN denotes region
T19200 42430-42433 DT denotes the
T19199 42427-42429 IN denotes in
T19198 42419-42426 JJ denotes located
T19197 42414-42418 NN denotes site
T19196 42406-42413 NN denotes binding
T19195 42400-42405 NN denotes C/EBP
T19194 42396-42399 DT denotes the
T19193 42387-42395 VB denotes required
T19192 42376-42386 RB denotes absolutely
T19191 42361-42375 NN denotes responsiveness
T19190 42357-42360 NN denotes LPS
T19189 42351-42355 CD denotes −539
T19188 42347-42350 CC denotes and
T19187 42342-42346 CD denotes −189
T19186 42330-42341 NN denotes nucleotides
T19185 42322-42329 IN denotes between
T19184 42315-42321 NN denotes region
T19183 42311-42314 DT denotes the
T19182 42308-42310 IN denotes in
T19181 42298-42307 NN denotes sequences
T19180 42287-42297 JJ denotes regulatory
T19179 42276-42286 JJ denotes cis-acting
T19178 42271-42275 IN denotes upon
T19177 42261-42270 JJ denotes dependent
T19176 42258-42260 VB denotes is
T19175 42249-42257 NN denotes response
T19174 42235-42248 JJ denotes LPS-inducible
T19173 42231-42234 DT denotes the
T19172 42228-42230 IN denotes of
T19171 42223-42227 JJ denotes most
T19170 42221-42222 -COMMA- denotes ,
T19169 42216-42221 NN denotes sites
T19168 42210-42215 DT denotes these
T19167 42199-42209 VB denotes containing
T19166 42190-42198 NN denotes promoter
T19165 42181-42189 NN denotes SerpinB2
T19164 42174-42180 JJ denotes murine
T19163 42170-42173 DT denotes the
T19162 42167-42169 IN denotes of
T19161 42159-42166 NN denotes regions
T19160 42156-42158 IN denotes by
T19159 42146-42155 VB denotes conferred
T19158 42137-42145 NN denotes activity
T19157 42121-42136 JJ denotes transcriptional
T19156 42109-42120 JJ denotes PMA-induced
T19155 42106-42108 IN denotes in
T19154 42096-42105 NN denotes increases
T19153 42084-42095 JJ denotes incremental
T19152 42081-42083 IN denotes of
T19151 42073-42080 NN denotes pattern
T19150 42069-42072 DT denotes the
T19149 42066-42068 TO denotes to
T19148 42057-42065 NN denotes contrast
T19147 42054-42056 IN denotes In
T19146 42048-42052 NN denotes gene
T19145 42039-42047 NN denotes SerpinB2
T19144 42032-42038 JJ denotes murine
T19143 42028-42031 DT denotes the
T19142 42025-42027 IN denotes of
T19141 42011-42024 NN denotes transcription
T19140 41997-42010 JJ denotes PMA-inducible
T19139 41987-41996 VB denotes mediating
T19138 41984-41986 IN denotes in
T19137 41979-41983 NN denotes role
T19136 41977-41978 DT denotes a
T19135 41972-41976 VB denotes play
T19134 41967-41971 RB denotes also
T19133 41957-41966 RB denotes therefore
T19132 41953-41956 MD denotes may
T19131 41947-41952 NN denotes sites
T19130 41941-41946 DT denotes These
T19129 41936-41939 CD denotes −87
T19128 41932-41935 CC denotes and
T19127 41927-41931 CD denotes −189
T19126 41915-41926 NN denotes nucleotides
T19125 41907-41914 IN denotes between
T19124 41898-41906 NN denotes promoter
T19123 41889-41897 JJ denotes proximal
T19122 41880-41888 NN denotes SerpinB2
T19121 41873-41879 JJ denotes murine
T19120 41869-41872 DT denotes the
T19119 41866-41868 IN denotes in
T19118 41858-41865 JJ denotes present
T19117 41854-41857 VB denotes are
T19116 41849-41853 RB denotes also
T19115 41847-41848 -COMMA- denotes ,
T19114 41846-41847 -RRB- denotes ]
T19113 41844-41846 CD denotes 37
T19112 41843-41844 -LRB- denotes [
T19554 44505-44507 DT denotes an
T19553 44503-44504 -COMMA- denotes ,
T19552 44502-44503 -RRB- denotes ]
T19551 44500-44502 CD denotes 65
T19550 44499-44500 -LRB- denotes [
T19549 44497-44498 -RRB- denotes )
T19548 44495-44497 NN denotes LT
T19547 44494-44495 -LRB- denotes (
T19111 41838-41842 NN denotes gene
T19110 41829-41837 NN denotes SERPINB2
T19109 41823-41828 JJ denotes human
T19108 41819-41822 DT denotes the
T19107 41816-41818 IN denotes of
T19106 41802-41815 NN denotes transcription
T19105 41787-41801 JJ denotes PMA-stimulated
T19104 41779-41786 VB denotes mediate
T19103 41776-41778 TO denotes to
T19102 41763-41775 VB denotes demonstrated
T19101 41761-41762 -COMMA- denotes ,
T19100 41753-41761 NN denotes elements
T19099 41743-41752 JJ denotes AP-1-like
T19098 41739-41742 CD denotes two
T19097 41735-41738 CC denotes and
T19096 41731-41734 NN denotes CRE
T19095 41729-41730 DT denotes a
T19094 41724-41728 IN denotes that
T19093 41718-41723 VB denotes shows
T19092 41709-41717 NN denotes sequence
T19091 41700-41708 NN denotes promoter
T19090 41691-41699 JJ denotes proximal
T19089 41682-41690 NN denotes SerpinB2
T19088 41675-41681 JJ denotes murine
T19087 41671-41674 DT denotes the
T19086 41668-41670 IN denotes of
T19051 41439-41442 NN denotes LPS
T19050 41436-41438 TO denotes to
T19049 41427-41435 NN denotes response
T19048 41423-41426 DT denotes the
T19047 41419-41422 CC denotes and
T19046 41405-41418 NN denotes transcription
T19045 41400-41404 NN denotes gene
T19044 41391-41399 NN denotes SerpinB2
T19043 41378-41390 JJ denotes constitutive
T19042 41368-41377 VB denotes abrogates
T19041 41360-41367 NN denotes C/EBP-β
T19040 41357-41359 IN denotes of
T19039 41352-41356 NN denotes loss
T19038 41348-41351 CC denotes and
T19037 41346-41347 -COMMA- denotes ,
T19036 41342-41346 FW denotes vivo
T19035 41339-41341 FW denotes in
T19034 41335-41338 CC denotes and
T19033 41329-41334 FW denotes vitro
T19032 41326-41328 FW denotes in
T19031 41317-41325 NN denotes promoter
T19030 41308-41316 JJ denotes proximal
T19029 41299-41307 NN denotes SerpinB2
T19028 41295-41298 DT denotes the
T19027 41292-41294 IN denotes in
T19026 41284-41291 NN denotes element
T19025 41275-41283 NN denotes response
T19024 41269-41274 NN denotes C/EBP
T19023 41265-41268 DT denotes the
T19022 41260-41264 VB denotes bind
T19021 41247-41259 RB denotes specifically
T19020 41244-41246 TO denotes to
T19019 41238-41243 VB denotes shown
T19018 41234-41237 VB denotes was
T19017 41226-41233 NN denotes C/EBP-β
T19016 41214-41225 JJ denotes LPS-induced
T19015 41205-41212 NN denotes C/EBP-β
T19014 41200-41204 IN denotes upon
T19013 41190-41199 JJ denotes dependent
T19012 41182-41189 RB denotes greatly
T19011 41179-41181 VB denotes is
T19010 41175-41178 CC denotes and
T19009 41166-41174 NN denotes promoter
T19008 41157-41165 JJ denotes proximal
T19007 41148-41156 NN denotes SerpinB2
T19006 41144-41147 DT denotes the
T19005 41141-41143 IN denotes by
T19004 41131-41140 VB denotes conferred
T19003 41128-41130 VB denotes is
T19002 41124-41127 NN denotes LPS
T19001 41121-41123 TO denotes to
T19000 41112-41120 NN denotes response
T18999 41109-41111 IN denotes in
T18998 41095-41108 NN denotes transcription
T18997 41090-41094 NN denotes gene
T18996 41081-41089 NN denotes SerpinB2
T18995 41076-41080 IN denotes that
T18994 41069-41075 VB denotes report
T18993 41066-41068 PRP denotes we
T18992 41061-41065 RB denotes Here
T18991 41058-41059 -RRB- denotes ]
T18990 41056-41058 CD denotes 16
T18989 41055-41056 -LRB- denotes [
T18988 41051-41054 NN denotes LPS
T18987 41048-41050 TO denotes to
T18986 41039-41047 NN denotes response
T18985 41036-41038 IN denotes in
T18984 41028-41035 NN denotes modules
T18983 41018-41027 NN denotes signaling
T18982 41010-41017 NN denotes p38MAPK
T18981 41006-41009 CC denotes and
T18980 40995-41005 NN denotes IKKβ/NF-κB
T18979 40991-40994 DT denotes the
T18978 40983-40990 IN denotes between
T18977 40978-40982 NN denotes talk
T18976 40972-40977 NN denotes cross
T18975 40969-40971 IN denotes by
T18974 40961-40968 VB denotes induced
T18973 40943-40960 RB denotes transcriptionally
T18972 40940-40942 VB denotes is
T18971 40931-40939 NN denotes SerpinB2
T18970 40921-40929 NN denotes SerpinB2
T18969 40914-40920 NN denotes factor
T18968 40901-40913 JJ denotes pro-survival
T18967 40897-40900 DT denotes the
T18966 40894-40896 IN denotes of
T18965 40884-40893 NN denotes induction
T18964 40876-40883 JJ denotes massive
T18963 40867-40875 VB denotes involves
T18962 40861-40866 WDT denotes which
T18961 40852-40860 NN denotes response
T18960 40836-40851 JJ denotes anti-pathogenic
T18959 40833-40835 DT denotes an
T18958 40827-40832 VB denotes mount
T18957 40824-40826 TO denotes to
T18956 40812-40823 NN denotes macrophages
T18955 40802-40811 VB denotes stimulate
T18954 40800-40801 -COMMA- denotes ,
T18953 40797-40800 NN denotes LPS
T18952 40787-40796 NN denotes endotoxin
T18951 40777-40786 JJ denotes bacterial
T18950 40773-40776 DT denotes the
T18949 40770-40772 IN denotes as
T18948 40765-40769 JJ denotes such
T18947 40763-40764 -COMMA- denotes ,
T18946 40756-40763 NN denotes stimuli
T18945 40739-40755 JJ denotes Pro-inflammatory
T18944 40728-40737 NN denotes pathogens
T18943 40720-40727 IN denotes against
T18942 40712-40719 NN denotes defense
T18941 40709-40711 IN denotes of
T18940 40704-40708 NN denotes line
T18939 40698-40703 JJ denotes first
T18938 40694-40697 DT denotes the
T18937 40686-40693 VB denotes provide
T18936 40673-40685 RB denotes consequently
T18935 40669-40672 CC denotes and
T18934 40667-40668 -COMMA- denotes ,
T18933 40659-40667 NN denotes response
T18932 40652-40658 JJ denotes immune
T18931 40645-40651 JJ denotes innate
T18930 40641-40644 DT denotes the
T18929 40638-40640 IN denotes of
T18928 40628-40637 NN denotes mediators
T18927 40624-40627 JJ denotes key
T18926 40620-40623 VB denotes are
T18925 40608-40619 NN denotes Macrophages
T19330 43188-43196 RB denotes severely
T19329 43184-43187 VB denotes was
T19328 43179-43183 NN denotes IFNγ
T19327 43175-43178 CC denotes and
T19326 43171-43174 NN denotes LPS
T19325 43168-43170 IN denotes by
T19324 43156-43167 NN denotes macrophages
T19323 43145-43155 JJ denotes peritoneal
T19322 43127-43144 JJ denotes C/EBP-β-deficient
T19321 43124-43126 IN denotes in
T19320 43114-43123 NN denotes induction
T19319 43108-43113 WP-DOLLAR- denotes whose
T19318 43103-43107 NN denotes gene
T19317 43100-43102 IN denotes as
T19316 43089-43099 VB denotes identified
T19315 43085-43088 VB denotes was
T19314 43076-43084 NN denotes SerpinB2
T19313 43074-43075 -COMMA- denotes ,
T19312 43069-43074 NN denotes study
T19311 43059-43068 NN denotes profiling
T19310 43048-43058 NN denotes expression
T19309 43037-43047 NN denotes microarray
T19308 43028-43036 JJ denotes previous
T19307 43026-43027 DT denotes a
T19306 43023-43025 IN denotes In
T19305 43008-43021 NN denotes transcription
T19304 43003-43007 NN denotes gene
T19303 42994-43002 NN denotes SerpinB2
T19302 42982-42993 JJ denotes LPS-induced
T19085 41657-41667 NN denotes Inspection
T19084 41652-41655 NN denotes LPS
T19083 41649-41651 IN denotes by
T19082 41644-41648 DT denotes that
T19081 41639-41643 IN denotes than
T19080 41629-41638 JJ denotes transient
T19079 41624-41628 RB denotes more
T19078 41620-41623 CC denotes and
T19077 41612-41619 JJ denotes intense
T19076 41607-41611 RB denotes less
T19075 41601-41606 VB denotes being
T19074 41597-41600 NN denotes PMA
T19073 41594-41596 IN denotes by
T19072 41584-41593 NN denotes induction
T19071 41579-41583 IN denotes with
T19070 41577-41578 -COMMA- denotes ,
T19069 41564-41577 NN denotes transcription
T19068 41559-41563 NN denotes gene
T19067 41545-41558 JJ denotes LPS-inducible
T19066 41541-41544 CC denotes and
T19065 41536-41540 NN denotes PMA-
T19064 41531-41535 CC denotes both
T19063 41522-41530 VB denotes mediated
T19062 41518-41521 CD denotes +92
T19061 41514-41517 CC denotes and
T19060 41509-41513 CD denotes -539
T19059 41497-41508 NN denotes nucleotides
T19058 41489-41496 IN denotes between
T19057 41482-41488 NN denotes region
T19056 41473-41481 NN denotes promoter
T19055 41464-41472 JJ denotes proximal
T19054 41455-41463 NN denotes SerpinB2
T19053 41448-41454 JJ denotes murine
T19052 41444-41447 DT denotes The
T17064 40586-40594 NN denotes activity
T17063 40577-40585 NN denotes promoter
T17062 40568-40576 JJ denotes proximal
T17061 40559-40567 NN denotes SerpinB2
T17060 40550-40558 VB denotes regulate
T17059 40539-40549 RB denotes negatively
T17058 40536-40538 TO denotes to
T17057 40531-40535 VB denotes acts
T17056 40527-40530 NN denotes S64
T17055 40524-40526 IN denotes at
T17054 40516-40523 NN denotes C/EBP-β
T17053 40513-40515 IN denotes of
T17052 40497-40512 NN denotes phosphorylation
T17051 40492-40496 IN denotes that
T17050 40484-40491 VB denotes suggest
T17049 40479-40483 NN denotes data
T17048 40473-40478 DT denotes These
T17047 40470-40471 -RRB- denotes )
T17046 40465-40470 JJ denotes right
T17045 40463-40464 -COMMA- denotes ,
T17044 40461-40463 NNP denotes 8C
T17043 40456-40460 NNP denotes Fig.
T17042 40455-40456 -LRB- denotes (
T17041 40451-40454 NN denotes LPS
T17040 40448-40450 TO denotes to
T17039 40439-40447 NN denotes response
T17038 40436-40438 IN denotes in
T17037 40427-40435 NN denotes activity
T17036 40418-40426 NN denotes promoter
T17035 40409-40417 NN denotes SerpinB2
T17034 40397-40408 VB denotes potentiated
T17033 40385-40396 NN denotes C/EBP-βS64A
T17032 40382-40384 IN denotes of
T17031 40371-40381 NN denotes expression
T17030 40367-40370 DT denotes the
T17029 40359-40366 IN denotes whereas
T17028 40357-40358 -COMMA- denotes ,
T17027 40353-40357 NN denotes MEFs
T17026 40333-40352 JJ denotes C/EBP-β-transfected
T17025 40323-40332 JJ denotes wild-type
T17024 40320-40322 IN denotes of
T17023 40315-40319 DT denotes that
T17022 40312-40314 TO denotes to
T17021 40304-40311 JJ denotes similar
T17020 40295-40303 NN denotes activity
T17019 40286-40294 NN denotes promoter
T17018 40277-40285 NN denotes SerpinB2
T17017 40267-40276 VB denotes exhibited
T17016 40262-40266 NN denotes MEFs
T17015 40237-40261 JJ denotes C/EBP-βT188A-transfected
T17014 40225-40235 NN denotes expression
T17013 40220-40224 NN denotes gene
T17012 40211-40219 NN denotes SerpinB2
T17011 40208-40210 IN denotes in
T17010 40203-40207 NN denotes role
T17009 40201-40202 DT denotes a
T17008 40196-40200 VB denotes play
T17007 40192-40195 MD denotes may
T17006 40186-40191 NN denotes sites
T17005 40169-40185 NN denotes phospho-acceptor
T17004 40163-40168 DT denotes these
T17003 40155-40162 IN denotes whether
T17002 40142-40154 VB denotes investigated
T17001 40139-40141 PRP denotes we
T17000 40137-40138 -COMMA- denotes ,
T16999 40129-40137 NN denotes SerpinB2
T16998 40125-40128 CC denotes and
T16997 40117-40124 NN denotes C/EBP-β
T16996 40114-40116 IN denotes of
T16995 40105-40113 NN denotes isoforms
T16994 40088-40104 JJ denotes phospho-specific
T16993 40082-40087 DT denotes these
T16992 40079-40081 IN denotes of
T16991 40066-40078 NN denotes significance
T16990 40055-40065 JJ denotes functional
T16989 40051-40054 DT denotes the
T16988 40048-40050 IN denotes in
T16987 40035-40047 NN denotes similarities
T16986 40031-40034 DT denotes the
T16985 40025-40030 VB denotes Given
T16984 40022-40023 -RRB- denotes ]
T16983 40020-40022 CD denotes 29
T16982 40019-40020 -LRB- denotes [
T16981 40009-40018 NN denotes cytokines
T16980 40006-40008 TO denotes to
T16979 39998-40005 JJ denotes similar
T16978 39991-39997 NN denotes manner
T16977 39989-39990 DT denotes a
T16976 39986-39988 IN denotes in
T16975 39976-39985 VB denotes regulated
T16974 39972-39975 CC denotes and
T16973 39968-39971 NN denotes LPS
T16972 39965-39967 IN denotes by
T16971 39957-39964 VB denotes induced
T16970 39954-39956 VB denotes is
T16969 39945-39953 NN denotes SerpinB2
T16968 39943-39944 -COMMA- denotes ,
T16967 39934-39943 RB denotes Similarly
T16966 39931-39932 -RRB- denotes ]
T16965 39929-39931 CD denotes 64
T16964 39928-39929 -LRB- denotes [
T16963 39922-39927 NN denotes MCP-1
T16962 39918-39921 CC denotes and
T16961 39913-39917 NN denotes IL-6
T16960 39903-39912 NN denotes cytokines
T16959 39899-39902 DT denotes the
T16958 39896-39898 IN denotes of
T16957 39882-39895 NN denotes transcription
T16956 39870-39881 JJ denotes LPS-induced
T16955 39866-39869 IN denotes for
T16954 39856-39865 JJ denotes important
T16953 39853-39855 VB denotes is
T16952 39842-39852 NN denotes C/EBP-βS64
T16951 39839-39840 -RRB- denotes ]
T16950 39837-39839 CD denotes 17
T16949 39836-39837 -LRB- denotes [
T16948 39825-39835 VB denotes associated
T16947 39820-39824 VB denotes been
T16946 39815-39819 RB denotes also
T16945 39811-39814 VB denotes has
T16944 39802-39810 NN denotes SerpinB2
T16943 39796-39801 WDT denotes which
T16942 39791-39795 IN denotes with
T16941 39781-39790 NN denotes processes
T16940 39779-39780 -COMMA- denotes ,
T16939 39778-39779 -RRB- denotes ]
T16938 39776-39778 CD denotes 38
T16937 39775-39776 -LRB- denotes [
T16936 39765-39774 NN denotes apoptosis
T16935 39761-39764 CC denotes and
T16934 39755-39760 NN denotes cycle
T16933 39750-39754 NN denotes cell
T16932 39747-39749 IN denotes of
T16931 39736-39746 NN denotes regulation
T16930 39732-39735 DT denotes the
T16929 39729-39731 IN denotes in
T16928 39720-39728 VB denotes involved
T16927 39715-39719 NN denotes gene
T16926 39700-39714 JJ denotes IFNγ-inducible
T16925 39697-39699 DT denotes an
T16924 39695-39696 -COMMA- denotes ,
T16923 39690-39695 NN denotes DAPK1
T16922 39679-39689 VB denotes regulating
T16921 39676-39678 IN denotes in
T16920 39665-39675 VB denotes implicated
T16919 39662-39664 VB denotes is
T16918 39650-39661 NN denotes C/EBP-βT188
T16917 39635-39648 NN denotes transcription
T16916 39630-39634 NN denotes gene
T16915 39621-39629 NN denotes SerpinB2
T16914 39603-39620 JJ denotes C/EBP-β-dependent
T16913 39592-39602 VB denotes modulating
T16912 39589-39591 IN denotes in
T16911 39580-39588 VB denotes involved
T16910 39577-39579 VB denotes be
T16909 39573-39576 MD denotes may
T16908 39567-39572 WDT denotes which
T16907 39565-39566 -COMMA- denotes ,
T16906 39564-39565 -RRB- denotes )
T16905 39562-39564 NN denotes 8B
T16904 39557-39561 NN denotes Fig.
T16903 39556-39557 -LRB- denotes (
T16902 39545-39555 NN denotes C/EBP-βS64
T16901 39541-39544 CC denotes and
T16900 39529-39540 NN denotes C/EBP-βT188
T16899 39527-39528 -COMMA- denotes ,
T16898 39522-39527 NN denotes sites
T16897 39506-39521 NN denotes phosphorylation
T16896 39495-39505 JJ denotes additional
T16762 38643-38651 JJ denotes proximal
T16761 38634-38642 NN denotes SerpinB2
T16760 38619-38633 JJ denotes LPS-stimulated
T16759 38615-38618 IN denotes for
T16758 38605-38614 JJ denotes important
T16757 38602-38604 VB denotes be
T16756 38598-38601 MD denotes may
T16755 38593-38597 WDT denotes that
T16754 38587-38592 NN denotes sites
T16753 38571-38586 NN denotes phosphorylation
T16752 38563-38570 JJ denotes C/EBP-β
T16751 38551-38562 VB denotes investigate
T16750 38548-38550 TO denotes To
T16749 38545-38546 -RRB- denotes ]
T16748 38543-38545 CD denotes 63
T16747 38542-38543 -LRB- denotes [
T16746 38532-38541 NN denotes potential
T16745 38516-38531 NN denotes transactivation
T16744 38512-38515 PRP-DOLLAR- denotes its
T16743 38503-38511 VB denotes modulate
T16742 38500-38502 TO denotes to
T16741 38489-38499 VB denotes recognized
T16740 38484-38488 RB denotes well
T16739 38481-38483 VB denotes is
T16738 38473-38480 NN denotes C/EBP-β
T16737 38470-38472 IN denotes of
T16736 38454-38469 NN denotes Phosphorylation
T16735 38445-38453 NN denotes Activity
T16734 38436-38444 NN denotes Promoter
T16733 38427-38435 NN denotes SerpinB2
T16732 38412-38426 JJ denotes LPS-stimulated
T16731 38402-38411 VB denotes Regulates
T16730 38391-38401 RB denotes negatively
T16729 38388-38390 CD denotes 64
T16728 38381-38387 NN denotes Serine
T16727 38378-38380 IN denotes at
T16726 38370-38377 NN denotes C/EBP-β
T16725 38367-38369 IN denotes of
T16724 38351-38366 NN denotes Phosphorylation
T16895 39486-39494 VB denotes contains
T16894 39478-39485 NN denotes C/EBP-β
T16893 39473-39476 NN denotes LPS
T16892 39470-39472 TO denotes to
T16891 39461-39469 NN denotes response
T16890 39458-39460 IN denotes in
T16889 39449-39457 NN denotes activity
T16888 39440-39448 NN denotes promoter
T16887 39431-39439 NN denotes SerpinB2
T16886 39428-39430 IN denotes of
T16885 39417-39427 NN denotes regulation
T16884 39413-39416 DT denotes the
T16883 39410-39412 IN denotes in
T16882 39403-39409 NN denotes factor
T16881 39397-39402 JJ denotes major
T16880 39395-39396 DT denotes a
T16879 39391-39394 RB denotes not
T16878 39388-39390 VB denotes is
T16877 39383-39387 NN denotes T217
T16876 39380-39382 IN denotes at
T16875 39372-39379 NN denotes C/EBP-β
T16874 39369-39371 IN denotes of
T16873 39353-39368 NN denotes phosphorylation
T16872 39348-39352 IN denotes that
T16871 39337-39347 VB denotes confirming
T16870 39335-39336 -COLON- denotes ;
T16869 39334-39335 -RRB- denotes )
T16868 39329-39334 JJ denotes right
T16867 39327-39328 -COMMA- denotes ,
T16866 39325-39327 NNP denotes 8C
T16865 39320-39324 NNP denotes Fig.
T16864 39319-39320 -LRB- denotes (
T16863 39311-39318 NN denotes C/EBP-β
T16862 39301-39310 JJ denotes wild-type
T16861 39298-39300 IN denotes of
T16860 39293-39297 DT denotes that
T16859 39287-39292 IN denotes above
T16858 39278-39286 NN denotes activity
T16857 39269-39277 NN denotes promoter
T16856 39260-39268 NN denotes SerpinB2
T16855 39251-39259 VB denotes increase
T16854 39237-39250 RB denotes significantly
T16853 39233-39236 RB denotes not
T16852 39229-39232 VB denotes did
T16851 39224-39228 NN denotes MEFs
T16850 39215-39223 NNP denotes Cebpb−/−
T16849 39212-39214 IN denotes in
T16848 39210-39211 -COMMA- denotes ,
T16847 39199-39210 NN denotes C/EBPβT217A
T16846 39197-39198 -COMMA- denotes ,
T16845 39191-39197 NN denotes mutant
T16844 39174-39190 NN denotes phospho-acceptor
T16843 39166-39173 NN denotes C/EBP-β
T16842 39162-39165 DT denotes the
T16841 39159-39161 IN denotes of
T16840 39148-39158 NN denotes Expression
T16839 39133-39146 NN denotes transcription
T16838 39128-39132 NN denotes gene
T16837 39119-39127 NN denotes SerpinB2
T16836 39107-39118 JJ denotes LPS-induced
T16835 39104-39106 TO denotes to
T16834 39096-39103 NN denotes C/EBP-β
T16833 39093-39095 IN denotes of
T16832 39082-39092 NN denotes importance
T16831 39078-39081 DT denotes the
T16830 39067-39077 VB denotes confirming
T16829 39065-39066 -COMMA- denotes ,
T16828 39064-39065 -RRB- denotes )
T16827 39060-39064 JJ denotes left
T16826 39058-39059 -COMMA- denotes ,
T16825 39056-39058 NNP denotes 8C
T16824 39051-39055 NNP denotes Fig.
T16823 39050-39051 -LRB- denotes (
T16822 39045-39049 JJ denotes fold
T16821 39042-39044 CD denotes ∼3
T16820 39039-39041 IN denotes by
T16819 39035-39038 NN denotes LPS
T16818 39032-39034 IN denotes of
T16817 39023-39031 NN denotes presence
T16816 39019-39022 DT denotes the
T16815 39016-39018 IN denotes in
T16814 39005-39015 NN denotes expression
T16813 39000-39004 NN denotes gene
T16812 38991-38999 NN denotes reporter
T16811 38980-38990 NN denotes luciferase
T16810 38971-38979 NN denotes SerpinB2
T16809 38960-38970 VB denotes stimulated
T16808 38946-38959 RB denotes significantly
T16807 38941-38945 NN denotes MEFs
T16806 38932-38940 NNP denotes Cebpb−/−
T16805 38929-38931 IN denotes in
T16804 38921-38928 NN denotes C/EBP-β
T16803 38911-38920 JJ denotes wild-type
T16802 38908-38910 IN denotes of
T16801 38894-38907 NN denotes Re-expression
T16800 38888-38892 NN denotes MEFs
T16799 38879-38887 NNP denotes Cebpb−/−
T16798 38876-38878 IN denotes in
T16797 38867-38875 NN denotes reporter
T16796 38856-38866 NN denotes luciferase
T16795 38847-38855 NN denotes SerpinB2
T16794 38840-38846 JJ denotes murine
T16793 38830-38839 NN denotes pGLmP-539
T16792 38826-38829 DT denotes the
T16791 38821-38825 IN denotes with
T16790 38815-38820 IN denotes along
T16789 38813-38814 -COMMA- denotes ,
T16788 38806-38813 NN denotes alanine
T16787 38803-38805 DT denotes an
T16786 38800-38802 TO denotes to
T16785 38792-38799 VB denotes mutated
T16784 38788-38791 VB denotes was
T16783 38780-38787 NN denotes residue
T16782 38773-38779 NN denotes serine
T16781 38770-38772 CC denotes or
T16780 38760-38769 NN denotes threonine
T16779 38751-38759 JJ denotes critical
T16778 38747-38750 DT denotes the
T16777 38741-38746 WDT denotes which
T16776 38738-38740 IN denotes in
T16775 38730-38737 NN denotes mutants
T16774 38713-38729 NN denotes phospho-acceptor
T16773 38705-38712 JJ denotes C/EBP-β
T16772 38697-38704 JJ denotes several
T16771 38684-38696 VB denotes co-expressed
T16770 38681-38683 PRP denotes we
T16769 38679-38680 -COMMA- denotes ,
T16768 38678-38679 -RRB- denotes )
T16767 38676-38678 NN denotes 8B
T16766 38671-38675 NN denotes Fig.
T16765 38670-38671 -LRB- denotes (
T16764 38661-38669 NN denotes activity
T16763 38652-38660 NN denotes promoter
T15906 36865-36873 NN denotes activity
T15905 36856-36864 NN denotes promoter
T15904 36847-36855 JJ denotes proximal
T15903 36838-36846 NN denotes SerpinB2
T15902 36826-36837 JJ denotes LPS-induced
T15901 36822-36825 IN denotes for
T15900 36813-36821 VB denotes required
T15899 36810-36812 VB denotes is
T15898 36802-36809 NN denotes C/EBP-β
T15897 36791-36801 JJ denotes endogenous
T15896 36786-36790 IN denotes that
T15895 36775-36785 VB denotes indicating
T15894 36773-36774 -COMMA- denotes ,
T15893 36772-36773 -RRB- denotes )
T15892 36770-36772 NN denotes 8A
T15891 36765-36769 NNP denotes Fig.
T15890 36764-36765 -LRB- denotes (
T15889 36759-36763 NN denotes MEFs
T15888 36750-36758 NN denotes Cebpb−/−
T15887 36747-36749 IN denotes in
T15886 36737-36746 VB denotes abrogated
T15885 36733-36736 CC denotes and
T15884 36728-36732 NN denotes MEFs
T15883 36719-36727 JJ denotes Cebpb+/+
T15882 36716-36718 IN denotes in
T15881 36706-36715 VB denotes increased
T15880 36692-36705 RB denotes significantly
T15879 36688-36691 VB denotes was
T15878 36679-36687 NN denotes activity
T15877 36670-36678 NN denotes promoter
T15876 36661-36669 NN denotes SerpinB2
T15875 36646-36660 JJ denotes LPS-stimulated
T15874 36641-36645 IN denotes that
T15873 36635-36640 VB denotes found
T15872 36632-36634 PRP denotes We
T15871 36626-36630 NN denotes MEFs
T15870 36617-36625 NNP denotes Cebpb−/−
T15869 36613-36616 CC denotes and
T15868 36604-36612 NNP denotes Cebpb+/+
T15867 36599-36603 IN denotes into
T15866 36589-36598 NN denotes construct
T15865 36580-36588 NN denotes reporter
T15864 36569-36579 NN denotes luciferase
T15863 36560-36568 NN denotes SerpinB2
T15862 36553-36559 JJ denotes murine
T15861 36543-36552 NN denotes pGLmP-539
T15860 36539-36542 DT denotes the
T15859 36536-36538 IN denotes of
T15858 36523-36535 NN denotes transfection
T15857 36520-36522 IN denotes by
T15856 36511-36519 VB denotes examined
T15855 36507-36510 VB denotes was
T15854 36498-36506 NN denotes promoter
T15853 36489-36497 JJ denotes proximal
T15852 36480-36488 NN denotes SerpinB2
T15851 36476-36479 DT denotes the
T15850 36471-36475 IN denotes from
T15849 36457-36470 NN denotes transcription
T15848 36450-36456 VB denotes direct
T15847 36447-36449 TO denotes to
T15846 36439-36446 NN denotes C/EBP-β
T15845 36428-36438 JJ denotes endogenous
T15844 36425-36427 IN denotes of
T15843 36417-36424 NN denotes ability
T15842 36413-36416 DT denotes The
T15841 36408-36411 NN denotes LPS
T15840 36405-36407 TO denotes to
T15839 36396-36404 NN denotes response
T15838 36393-36395 IN denotes in
T15837 36387-36392 NN denotes cells
T15836 36384-36386 IN denotes in
T15835 36375-36383 NN denotes promoter
T15834 36366-36374 NN denotes SerpinB2
T15833 36362-36365 DT denotes the
T15832 36357-36361 IN denotes from
T15831 36343-36356 NN denotes transcription
T15830 36335-36342 VB denotes driving
T15829 36331-36334 IN denotes for
T15828 36324-36330 NN denotes factor
T15827 36314-36323 JJ denotes essential
T15826 36311-36313 DT denotes an
T15825 36307-36310 VB denotes was
T15824 36299-36306 NN denotes C/EBP-β
T15823 36291-36298 IN denotes whether
T15822 36288-36290 IN denotes of
T15821 36279-36287 NN denotes question
T15820 36275-36278 DT denotes the
T15819 36267-36274 VB denotes address
T15818 36264-36266 TO denotes to
T15817 36257-36263 VB denotes wanted
T15816 36254-36256 PRP denotes we
T15815 36252-36253 -COMMA- denotes ,
T15814 36248-36252 FW denotes vivo
T15813 36245-36247 FW denotes in
T15812 36241-36244 CC denotes and
T15811 36235-36240 FW denotes vitro
T15810 36232-36234 FW denotes in
T15809 36227-36231 CC denotes both
T15808 36220-36226 NN denotes manner
T15807 36206-36219 JJ denotes LPS-inducible
T15806 36203-36205 DT denotes an
T15805 36200-36202 IN denotes in
T15804 36191-36199 NN denotes promoter
T15803 36182-36190 JJ denotes proximal
T15802 36173-36181 NN denotes SerpinB2
T15801 36169-36172 DT denotes the
T15800 36166-36168 TO denotes to
T15799 36160-36165 VB denotes binds
T15798 36152-36159 NN denotes C/EBP-β
T15797 36146-36151 IN denotes Since
T15796 36137-36145 NN denotes Activity
T15795 36128-36136 NN denotes Promoter
T15794 36119-36127 JJ denotes Proximal
T15793 36110-36118 NN denotes SerpinB2
T15792 36103-36109 NNP denotes Murine
T15791 36089-36102 JJ denotes LPS-inducible
T15790 36080-36088 VB denotes Promotes
T15789 36072-36079 NN denotes C/EBP-β
T15137 34875-34878 NN denotes LPS
T15136 34872-34874 TO denotes to
T15135 34863-34871 NN denotes response
T15134 34860-34862 IN denotes in
T15133 34851-34859 NN denotes promoter
T15132 34842-34850 NN denotes SerpinB2
T15131 34838-34841 DT denotes the
T15130 34833-34837 IN denotes from
T15129 34819-34832 NN denotes transcription
T15128 34809-34818 VB denotes increased
T15127 34805-34808 IN denotes for
T15126 34793-34804 JJ denotes responsible
T15125 34790-34792 VB denotes be
T15124 34786-34789 RB denotes not
T15123 34782-34785 MD denotes may
T15122 34774-34781 NN denotes C/EBP-β
T15121 34754-34773 JJ denotes T217-phosphorylated
T15120 34749-34753 IN denotes that
T15119 34740-34748 VB denotes indicate
T15118 34736-34739 CC denotes and
T15117 34734-34735 -COMMA- denotes ,
T15116 34723-34734 NN denotes recruitment
T15115 34709-34722 NN denotes p-C/EBP-βT217
T15114 34705-34708 CC denotes and
T15113 34697-34704 NN denotes C/EBP-β
T15112 34689-34696 IN denotes between
T15111 34676-34688 NN denotes relationship
T15110 34668-34675 JJ denotes inverse
T15109 34665-34667 DT denotes an
T15108 34660-34664 VB denotes show
T15107 34655-34659 NN denotes data
T15106 34649-34654 DT denotes These
T15105 34646-34647 -RRB- denotes )
T15104 34645-34646 CD denotes 7
T15103 34640-34644 NN denotes Fig.
T15102 34639-34640 -LRB- denotes (
T15101 34638-34639 -RRB- denotes )
T15100 34635-34638 NN denotes hrs
T15099 34633-34634 CD denotes 8
T15098 34629-34632 CC denotes and
T15097 34627-34628 CD denotes 4
T15096 34626-34627 -LRB- denotes (
T15095 34615-34625 NN denotes timepoints
T15094 34609-34614 JJ denotes later
T15093 34606-34608 IN denotes at
T15092 34594-34605 NN denotes stimulation
T15091 34590-34593 NN denotes LPS
T15090 34585-34589 IN denotes with
T15089 34574-34584 VB denotes diminished
T15088 34565-34573 NN denotes promoter
T15087 34556-34564 JJ denotes proximal
T15086 34547-34555 NN denotes SerpinB2
T15085 34543-34546 DT denotes the
T15084 34539-34542 IN denotes for
T15083 34525-34538 NN denotes p-C/EBP-βT217
T15082 34522-34524 IN denotes of
T15081 34513-34521 NN denotes affinity
T15080 34505-34512 NN denotes binding
T15079 34501-34504 DT denotes the
T15078 34499-34500 -COMMA- denotes ,
T15077 34492-34499 NN denotes C/EBP-β
T15076 34486-34491 JJ denotes total
T15075 34483-34485 TO denotes to
T15074 34474-34482 NN denotes contrast
T15073 34471-34473 IN denotes In
T15072 34450-34451 -RRB- denotes t
T15071 34449-34450 CD denotes s
T15070 34445-34449 NN denotes LPS
T15069 34443-34444 -LRB- denotes f
T15068 34432-34443 NN denotes fter 1 hr o
T15067 34429-34432 NN denotes t a
T15066 34427-34429 IN denotes en
T15065 34425-34427 NN denotes es
T15064 34424-34425 CD denotes r
T15063 34419-34424 IN denotes lso p
T15062 34412-34419 JJ denotes r and a
T15061 34408-34412 RB denotes mote
T15060 34405-34408 CC denotes pro
T15059 34396-34404 NN denotes proximal
T15058 34388-34396 JJ denotes erpinB2
T15057 34380-34388 NN denotes to the S
T15056 34376-34379 DT denotes und
T15055 34374-34376 TO denotes bo
T15054 34369-34374 VB denotes vely
T15053 34355-34369 RB denotes was constituti
T15052 34352-34355 VB denotes 17
T15051 34339-34352 NN denotes . p-C/EBP-βT2
T15050 34338-34339 -RRB- denotes ]
T15049 34336-34338 CD denotes 65
T15048 34335-34336 -LRB- denotes [
T15047 34326-34334 NN denotes survival
T15046 34321-34325 NN denotes cell
T15045 34316-34320 IN denotes with
T15044 34305-34315 VB denotes associated
T15043 34300-34304 VB denotes been
T15042 34296-34299 VB denotes has
T15041 34290-34295 WDT denotes which
T15040 34288-34289 -COMMA- denotes ,
T15039 34287-34288 -RRB- denotes )
T15038 34274-34287 NN denotes p-C/EBP-βT217
T15037 34273-34274 -LRB- denotes (
T15035 34257-34264 NN denotes C/EBP-β
T15034 34242-34256 VB denotes phosphorylated
T15033 34237-34241 NN denotes T217
T15032 34233-34236 DT denotes the
T15031 34230-34232 IN denotes of
T15030 34221-34229 NN denotes promoter
T15029 34212-34220 JJ denotes proximal
T15028 34203-34211 NN denotes SerpinB2
T15027 34199-34202 DT denotes the
T15026 34196-34198 TO denotes to
T15025 34184-34195 NN denotes recruitment
T15024 34171-34183 VB denotes investigated
T15023 34168-34170 PRP denotes we
T15022 34166-34167 -COMMA- denotes ,
T15021 34165-34166 -RRB- denotes ]
T15020 34163-34165 CD denotes 64
T15019 34162-34163 -LRB- denotes [
T15018 34160-34161 -COLON- denotes ;
T15017 34159-34160 -RRB- denotes ]
T15016 34157-34159 CD denotes 63
T15015 34156-34157 -LRB- denotes [
T15014 34154-34155 -COLON- denotes ;
T15013 34153-34154 -RRB- denotes ]
T15012 34151-34153 CD denotes 38
T15011 34150-34151 -LRB- denotes [
T15010 34144-34149 NN denotes genes
T15009 34137-34143 NN denotes target
T15008 34123-34136 VB denotes transactivate
T15007 34120-34122 TO denotes to
T15006 34112-34119 NN denotes ability
T15005 34102-34111 JJ denotes C/EBP-β’s
T15004 34095-34101 VB denotes affect
T15003 34091-34094 MD denotes can
T15002 34084-34090 NN denotes states
T15001 34068-34083 NN denotes phosphorylation
T15000 34060-34067 NN denotes C/EBP-β
T14999 34057-34059 IN denotes in
T14998 34049-34056 NN denotes changes
T14997 34043-34048 IN denotes Since
T14996 34040-34041 -RRB- denotes )
T14995 34039-34040 CD denotes 7
T14994 34034-34038 NNP denotes Fig.
T14993 34033-34034 -LRB- denotes (
T14992 34029-34032 NN denotes hrs
T14991 34027-34028 CD denotes 8
T14990 34021-34026 IN denotes after
T14989 34015-34020 NN denotes cells
T14988 34002-34014 JJ denotes unstimulated
T14987 33997-34001 IN denotes over
T14986 33989-33996 RB denotes 10-fold
T14985 33986-33988 IN denotes as
T14984 33981-33985 RB denotes much
T14983 33978-33980 RB denotes as
T14982 33969-33977 VB denotes reaching
T14981 33965-33968 NN denotes LPS
T14980 33962-33964 TO denotes to
T14979 33953-33961 NN denotes response
T14978 33950-33952 IN denotes in
T14977 33939-33949 RB denotes temporally
T14976 33929-33938 VB denotes increased
T14975 33925-33928 CC denotes and
T14974 33913-33924 NN denotes macrophages
T14973 33900-33912 JJ denotes unstimulated
T14972 33897-33899 IN denotes in
T14971 33888-33896 NN denotes promoter
T14970 33884-33887 DT denotes the
T14969 33879-33883 IN denotes with
T14968 33867-33878 NN denotes association
T14967 33863-33866 PRP-DOLLAR- denotes its
T14966 33860-33862 IN denotes by
T14965 33847-33859 VB denotes demonstrated
T14964 33844-33846 IN denotes as
T14963 33835-33843 NN denotes promoter
T14962 33826-33834 NN denotes SerpinB2
T14961 33822-33825 DT denotes the
T14960 33819-33821 IN denotes at
T14959 33811-33818 JJ denotes present
T14958 33796-33810 RB denotes constitutively
T14957 33793-33795 VB denotes is
T14956 33785-33792 NN denotes C/EBP-β
T14955 33780-33784 IN denotes that
T14954 33773-33779 VB denotes showed
T14953 33765-33772 NN denotes results
T14952 33761-33764 DT denotes The
T14951 33758-33759 -RRB- denotes )
T14950 33756-33758 NN denotes 4A
T14949 33751-33754 NN denotes fig
T14948 33748-33750 IN denotes in
T14947 33736-33747 VB denotes illustrated
T14946 33735-33736 -LRB- denotes (
T14945 33727-33734 NN denotes primers
T14944 33718-33726 JJ denotes specific
T14943 33709-33717 NN denotes promoter
T14942 33700-33708 JJ denotes proximal
T14941 33691-33699 NN denotes SerpinB2
T14940 33685-33690 VB denotes using
T14939 33680-33684 NN denotes qPCR
T14938 33676-33679 CC denotes and
T14937 33658-33675 JJ denotes semi-quantitative
T14936 33653-33657 CC denotes both
T14935 33650-33652 IN denotes by
T14934 33640-33649 VB denotes amplified
T14933 33636-33639 NN denotes DNA
T14932 33627-33635 VB denotes enriched
T14931 33623-33626 DT denotes the
T14930 33619-33622 CC denotes and
T14929 33617-33618 -COMMA- denotes ,
T14928 33609-33617 NN denotes proteins
T14927 33601-33608 NN denotes binding
T14926 33597-33600 NN denotes DNA
T14925 33589-33596 IN denotes against
T14924 33578-33588 NN denotes antibodies
T14923 33573-33577 IN denotes with
T14922 33554-33572 VB denotes immunoprecipitated
T14921 33550-33553 VB denotes was
T14920 33540-33549 NN denotes chromatin
T14919 33532-33539 JJ denotes soluble
T14918 33530-33531 -COMMA- denotes ,
T14917 33527-33530 NN denotes hrs
T14916 33525-33526 CD denotes 8
T14915 33522-33524 TO denotes to
T14914 33519-33521 RB denotes up
T14913 33515-33518 IN denotes for
T14912 33511-33514 NN denotes LPS
T14911 33506-33510 IN denotes with
T14910 33495-33505 VB denotes stimulated
T14909 33490-33494 VB denotes were
T14908 33484-33489 NN denotes cells
T14907 33478-33483 CD denotes 264.7
T14906 33474-33477 NN denotes RAW
T14905 33471-33472 -RRB- denotes )
T14904 33467-33471 NN denotes ChIP
T14903 33466-33467 -LRB- denotes (
T14902 33446-33465 NN denotes immunoprecipitation
T14901 33436-33445 NN denotes chromatin
T14900 33433-33435 IN denotes by
T14899 33428-33432 FW denotes vivo
T14898 33425-33427 FW denotes in
T14897 33421-33424 NN denotes LPS
T14896 33418-33420 TO denotes to
T14895 33409-33417 NN denotes response
T14894 33406-33408 IN denotes in
T14893 33397-33405 NN denotes promoter
T14892 33388-33396 NN denotes SerpinB2
T14891 33381-33387 JJ denotes murine
T14890 33377-33380 DT denotes the
T14889 33374-33376 TO denotes to
T14888 33362-33373 NN denotes recruitment
T14887 33354-33361 NN denotes C/EBP-β
T14886 33351-33353 IN denotes of
T14885 33342-33350 NN denotes dynamics
T14884 33333-33341 JJ denotes temporal
T14883 33329-33332 DT denotes the
T14882 33316-33328 VB denotes investigated
T14881 33313-33315 PRP denotes We
T14880 33306-33312 NN denotes Manner
T14879 33292-33305 JJ denotes LPS-inducible
T14878 33289-33291 DT denotes an
T14877 33286-33288 IN denotes in
T14876 33281-33285 FW denotes vivo
T14875 33278-33280 FW denotes in
T14874 33269-33277 NN denotes Promoter
T14873 33260-33268 JJ denotes Proximal
T14872 33251-33259 NN denotes SerpinB2
T14871 33244-33250 NNP denotes Murine
T14870 33240-33243 DT denotes the
T14869 33234-33239 VB denotes Binds
T14868 33226-33233 NN denotes C/EBP-β
T14231 32005-32009 NN denotes mRNA
T14230 31996-32004 NN denotes SerpinB2
T14229 31985-31995 JJ denotes endogenous
T14228 31982-31984 IN denotes of
T14227 31968-31981 NN denotes transcription
T14226 31954-31967 JJ denotes LPS-inducible
T14225 31950-31953 CC denotes and
T14224 31937-31949 JJ denotes constitutive
T14223 31927-31936 VB denotes mediating
T14222 31923-31926 IN denotes for
T14221 31914-31922 JJ denotes critical
T14220 31911-31913 VB denotes is
T14219 31903-31910 NN denotes C/EBP-β
T14218 31898-31902 IN denotes that
T14217 31893-31897 VB denotes show
T14216 31888-31892 NN denotes data
T14215 31882-31887 DT denotes These
T14214 31879-31880 -RRB- denotes )
T14213 31874-31879 JJ denotes right
T14212 31872-31873 -COMMA- denotes ,
T14211 31870-31872 NN denotes 6B
T14210 31865-31869 NNP denotes Fig.
T14209 31864-31865 -LRB- denotes (
T14208 31852-31863 NN denotes macrophages
T14207 31839-31851 JJ denotes inflammatory
T14206 31821-31838 JJ denotes C/EBP-β-deficient
T14205 31818-31820 IN denotes in
T14204 31808-31817 VB denotes decreased
T14203 31794-31807 RB denotes significantly
T14202 31790-31793 VB denotes was
T14201 31779-31789 NN denotes expression
T14200 31774-31778 NN denotes mRNA
T14199 31765-31773 NN denotes SerpinB2
T14198 31753-31764 JJ denotes LPS-induced
T14197 31749-31752 CC denotes and
T14196 31736-31748 JJ denotes constitutive
T14195 31731-31735 CC denotes both
T14194 31729-31730 -COMMA- denotes ,
T14193 31725-31729 NN denotes MEFs
T14192 31722-31724 IN denotes in
T14191 31713-31721 VB denotes observed
T14190 31709-31712 VB denotes was
T14189 31706-31708 IN denotes As
T14188 31703-31704 -RRB- denotes )
T14187 31699-31703 JJ denotes left
T14186 31697-31698 -COMMA- denotes ,
T14185 31695-31697 NN denotes 6B
T14184 31690-31694 NNP denotes Fig.
T14183 31689-31690 -LRB- denotes (
T14182 31682-31688 NN denotes shRNAs
T14181 31671-31681 JJ denotes lentiviral
T14180 31654-31670 JJ denotes species-specific
T14179 31648-31653 VB denotes using
T14178 31643-31647 RP denotes down
T14177 31635-31642 VB denotes knocked
T14176 31631-31634 VB denotes was
T14175 31620-31630 NN denotes expression
T14174 31612-31619 NN denotes C/EBP-β
T14173 31606-31611 WDT denotes which
T14172 31603-31605 IN denotes in
T14171 31591-31602 NN denotes macrophages
T14170 31578-31590 JJ denotes inflammatory
T14169 31554-31577 JJ denotes thioglycollate-elicited
T14168 31551-31553 IN denotes in
T14167 31546-31550 VB denotes seen
T14166 31543-31545 VB denotes be
T14165 31537-31542 MD denotes could
T14164 31529-31536 NN denotes effects
T14163 31521-31528 JJ denotes similar
T14162 31518-31520 IN denotes if
T14161 31511-31517 VB denotes tested
T14160 31506-31510 RB denotes next
T14159 31503-31505 PRP denotes We
T14158 31492-31501 JJ denotes wild-type
T14157 31489-31491 TO denotes to
T14156 31480-31488 VB denotes compared
T14155 31477-31479 IN denotes as
T14154 31472-31476 NN denotes MEFs
T14153 31463-31471 NNP denotes Cebpb−/−
T14152 31460-31462 IN denotes in
T14151 31451-31459 VB denotes dampened
T14150 31437-31450 RB denotes significantly
T14149 31433-31436 VB denotes was
T14148 31422-31432 NN denotes expression
T14147 31417-31421 NN denotes mRNA
T14146 31408-31416 NN denotes SerpinB2
T14145 31393-31407 JJ denotes LPS-stimulated
T14144 31385-31392 IN denotes whereas
T14143 31383-31384 -COMMA- denotes ,
T14142 31382-31383 -RRB- denotes )
T14141 31380-31382 NN denotes 6A
T14140 31375-31379 NNP denotes Fig.
T14139 31374-31375 -LRB- denotes (
T14138 31369-31373 NN denotes MEFs
T14137 31359-31368 JJ denotes wild-type
T14136 31356-31358 IN denotes in
T14135 31345-31355 NN denotes expression
T14134 31340-31344 NN denotes mRNA
T14133 31331-31339 NN denotes SerpinB2
T14132 31328-31330 IN denotes in
T14131 31319-31327 NN denotes increase
T14130 31316-31318 DT denotes an
T14129 31305-31315 VB denotes stimulated
T14128 31301-31304 NN denotes LPS
T14127 31289-31299 NN denotes expression
T14126 31284-31288 NN denotes mRNA
T14125 31275-31283 NN denotes SerpinB2
T14124 31264-31274 JJ denotes endogenous
T14123 31253-31263 VB denotes attenuated
T14122 31245-31252 NN denotes C/EBP-β
T14121 31242-31244 IN denotes of
T14120 31234-31241 NN denotes absence
T14119 31230-31233 DT denotes the
T14118 31226-31229 CC denotes and
T14117 31217-31225 NN denotes SerpinB2
T14116 31206-31216 JJ denotes endogenous
T14115 31203-31205 IN denotes of
T14114 31196-31202 NN denotes levels
T14113 31192-31195 JJ denotes low
T14112 31184-31191 VB denotes express
T14111 31179-31183 NN denotes MEFs
T14110 31169-31178 JJ denotes Wild-type
T14109 31160-31167 NN denotes C/EBP-β
T14108 31149-31159 JJ denotes endogenous
T14107 31141-31148 VB denotes express
T14106 31126-31140 RB denotes constitutively
T14105 31120-31125 NN denotes cells
T14104 31111-31119 NN denotes RAW264.7
T14103 31105-31110 IN denotes since
T14102 31103-31104 -COMMA- denotes ,
T14101 31102-31103 -RRB- denotes )
T14100 31094-31102 JJ denotes Cebpb+/+
T14099 31093-31094 -LRB- denotes (
T14098 31088-31092 NN denotes MEFs
T14097 31078-31087 JJ denotes wild-type
T14096 31074-31077 CC denotes and
T14095 31072-31073 -RRB- denotes )
T14094 31063-31072 NN denotes Cebpb −/−
T14093 31062-31063 -LRB- denotes (
T14092 31049-31061 JJ denotes C/EBP-β-null
T14091 31040-31048 VB denotes utilized
T14090 31037-31039 PRP denotes we
T14089 31035-31036 -COMMA- denotes ,
T14088 31032-31035 NN denotes LPS
T14087 31029-31031 TO denotes to
T14086 31020-31028 NN denotes response
T14085 31017-31019 IN denotes in
T14059 30816-30823 NN denotes C/EBP-β
T14084 31006-31016 NN denotes expression
T14083 31001-31005 NN denotes mRNA
T14082 30992-31000 NN denotes SerpinB2
T14081 30981-30991 JJ denotes endogenous
T14080 30978-30980 TO denotes to
T14079 30970-30977 NN denotes C/EBP-β
T14078 30967-30969 IN denotes of
T14077 30956-30966 NN denotes importance
T14076 30952-30955 DT denotes the
T14075 30940-30951 VB denotes investigate
T14074 30937-30939 TO denotes To
T14073 30925-30936 NN denotes Macrophages
T14072 30917-30924 JJ denotes Primary
T14071 30904-30916 JJ denotes Inflammatory
T14070 30900-30903 CC denotes and
T14069 30895-30899 NN denotes MEFs
T14068 30892-30894 IN denotes in
T14067 30881-30891 NN denotes Expression
T14066 30876-30880 NN denotes mRNA
T14065 30867-30875 NN denotes SerpinB2
T14064 30855-30866 JJ denotes LPS-induced
T14063 30851-30854 CC denotes and
T14062 30838-30850 JJ denotes Constitutive
T14061 30833-30837 CC denotes both
T14060 30824-30832 NN denotes Mediates
T13451 30806-30813 NN denotes C/EBP-β
T13450 30797-30805 VB denotes contains
T13449 30795-30796 -RRB- denotes )
T13448 30786-30795 NN denotes −203/−192
T13447 30785-30786 -LRB- denotes (
T13446 30777-30784 NN denotes element
T13445 30771-30776 NN denotes C/EBP
T13444 30767-30770 DT denotes the
T13443 30762-30766 IN denotes with
T13442 30754-30761 NN denotes complex
T13441 30742-30753 JJ denotes LPS-induced
T13440 30738-30741 DT denotes the
T13439 30733-30737 IN denotes that
T13438 30728-30732 VB denotes show
T13437 30723-30727 NN denotes data
T13436 30717-30722 DT denotes these
T13435 30708-30716 RB denotes together
T13434 30702-30707 VB denotes Taken
T13433 30699-30700 -RRB- denotes )
T13432 30697-30699 NN denotes 5C
T13431 30692-30696 NN denotes Fig.
T13430 30691-30692 -LRB- denotes (
T13429 30683-30690 NN denotes complex
T13428 30669-30682 JJ denotes LPS-inducible
T13427 30665-30668 DT denotes the
T13426 30662-30664 IN denotes of
T13425 30652-30661 NN denotes formation
T13424 30648-30651 DT denotes the
T13423 30638-30647 VB denotes abolished
T13422 30630-30637 NN denotes C/EBP-β
T13421 30622-30629 IN denotes against
T13420 30611-30621 NN denotes antibodies
T13419 30606-30610 JJ denotes Only
T13418 30603-30604 -RRB- denotes ]
T13417 30601-30603 CD denotes 62
T13416 30600-30601 -LRB- denotes [
T13415 30595-30599 NN denotes EMSA
T13414 30592-30594 IN denotes by
T13413 30584-30591 NN denotes binding
T13412 30580-30583 NN denotes DNA
T13411 30572-30579 VB denotes abolish
T13410 30569-30571 TO denotes to
T13409 30560-30568 VB denotes expected
T13408 30557-30559 VB denotes is
T13407 30549-30556 NN denotes extract
T13406 30541-30548 JJ denotes nuclear
T13405 30536-30540 IN denotes with
T13404 30527-30535 NN denotes antibody
T13403 30524-30526 IN denotes of
T13402 30509-30523 NN denotes pre-incubation
T13401 30504-30508 IN denotes that
T13400 30501-30503 IN denotes so
T13399 30499-30500 -COMMA- denotes ,
T13398 30492-30499 NN denotes protein
T13397 30481-30491 JJ denotes respective
T13396 30477-30480 DT denotes the
T13395 30474-30476 IN denotes of
T13394 30467-30473 NN denotes region
T13393 30455-30466 JJ denotes DNA-binding
T13392 30438-30454 JJ denotes carboxy-terminal
T13391 30434-30437 DT denotes the
T13390 30426-30433 VB denotes detects
T13389 30417-30425 NN denotes antibody
T13388 30412-30416 DT denotes Each
T13387 30403-30410 NN denotes C/EBP-ε
T13386 30399-30402 CC denotes and
T13385 30391-30398 NN denotes C/EBP-δ
T13384 30389-30390 -COMMA- denotes ,
T13383 30382-30389 NN denotes C/EBP-β
T13382 30380-30381 -COMMA- denotes ,
T13381 30373-30380 NN denotes C/EBP-α
T13380 30369-30372 IN denotes for
T13379 30360-30368 JJ denotes specific
T13378 30349-30359 NN denotes antibodies
T13377 30344-30348 IN denotes with
T13376 30334-30343 NN denotes complexes
T13375 30319-30333 JJ denotes nucleo-protein
T13374 30315-30318 DT denotes the
T13373 30304-30314 VB denotes incubating
T13372 30298-30303 IN denotes after
T13371 30288-30297 VB denotes performed
T13370 30284-30287 VB denotes was
T13369 30279-30283 NN denotes EMSA
T13368 30277-30278 -COMMA- denotes ,
T13367 30270-30277 NN denotes complex
T13366 30256-30269 JJ denotes LPS-inducible
T13365 30252-30255 DT denotes the
T13364 30249-30251 IN denotes of
T13363 30236-30248 RB denotes particularly
T13362 30232-30235 CC denotes and
T13361 30230-30231 -COMMA- denotes ,
T13360 30221-30230 NN denotes complexes
T13359 30206-30220 JJ denotes nucleo-protein
T13358 30196-30205 JJ denotes different
T13357 30192-30195 DT denotes the
T13356 30189-30191 IN denotes of
T13355 30179-30188 NN denotes formation
T13354 30175-30178 DT denotes the
T13353 30172-30174 IN denotes in
T13352 30163-30171 VB denotes involved
T13351 30158-30162 VB denotes were
T13350 30149-30157 NN denotes proteins
T13349 30143-30148 NN denotes C/EBP
T13348 30137-30142 WDT denotes which
T13347 30127-30136 VB denotes determine
T13346 30124-30126 TO denotes To
T13345 30121-30122 -RRB- denotes ]
T13344 30119-30121 CD denotes 61
T13343 30118-30119 -LRB- denotes [
T13342 30106-30117 NN denotes environment
T13341 30092-30105 JJ denotes extracellular
T13340 30088-30091 DT denotes the
T13339 30085-30087 IN denotes on
T13338 30075-30084 VB denotes depending
T13337 30069-30074 NN denotes cells
T13336 30061-30068 JJ denotes myeloid
T13335 30045-30060 VB denotes differentiating
T13334 30042-30044 IN denotes in
T13333 30036-30041 NN denotes roles
T13332 30026-30035 JJ denotes different
T13331 30021-30025 VB denotes play
T13330 30017-30020 CC denotes and
T13329 30011-30016 NN denotes cells
T13328 30003-30010 JJ denotes myeloid
T13327 30000-30002 IN denotes in
T13326 29992-29999 JJ denotes present
T13325 29988-29991 VB denotes are
T13324 29986-29987 -COMMA- denotes ,
T13323 29979-29986 NN denotes C/EBP-ε
T13322 29975-29978 CC denotes and
T13321 29967-29974 NN denotes C/EBP-δ
T13320 29965-29966 -COMMA- denotes ,
T13319 29958-29965 NN denotes C/EBP-β
T13318 29956-29957 -COMMA- denotes ,
T13317 29949-29956 NN denotes C/EBP-α
T13316 29947-29948 -COMMA- denotes ,
T13315 29940-29947 NN denotes members
T13314 29933-29939 NN denotes family
T13313 29928-29932 CD denotes Four
T13312 29925-29926 -RRB- denotes ]
T13311 29923-29925 CD denotes 60
T13310 29922-29923 -LRB- denotes [
T13309 29908-29921 NN denotes specificities
T13308 29900-29907 NN denotes binding
T13307 29896-29899 NN denotes DNA
T13306 29888-29895 JJ denotes similar
T13305 29880-29887 VB denotes display
T13304 29876-29879 CC denotes and
T13303 29855-29875 VB denotes homo−/heterodimerize
T13302 29851-29854 MD denotes can
T13301 29843-29850 NN denotes factors
T13300 29829-29842 NN denotes transcription
T13299 29823-29828 NN denotes C/EBP
T13298 29819-29822 DT denotes the
T13297 29817-29818 -COMMA- denotes ,
T13296 29810-29817 NN denotes members
T13292 29789-29790 -RRB- denotes ]
T13291 29787-29789 CD denotes 59
T13290 29786-29787 -LRB- denotes [
T13289 29773-29785 NN denotes inflammation
T13288 29769-29772 CC denotes and
T13287 29753-29768 NN denotes differentiation
T13286 29744-29752 JJ denotes cellular
T13285 29741-29743 IN denotes in
T13284 29735-29740 NN denotes roles
T13283 29729-29734 PRP-DOLLAR- denotes their
T13282 29725-29728 IN denotes for
T13281 29719-29724 VB denotes known
T13280 29715-29718 VB denotes are
T13279 29707-29714 NN denotes factors
T13278 29693-29706 NN denotes transcription
T13277 29686-29692 NN denotes zipper
T13276 29678-29685 NN denotes leucine
T13275 29672-29677 JJ denotes basic
T13274 29669-29671 IN denotes of
T13273 29662-29668 NN denotes family
T13272 29656-29661 NN denotes C/EBP
T13271 29652-29655 DT denotes The
T13270 29643-29651 NN denotes Promoter
T13269 29634-29642 JJ denotes Proximal
T13268 29625-29633 NN denotes SerpinB2
T13267 29621-29624 DT denotes the
T13266 29618-29620 IN denotes of
T13265 29610-29617 NN denotes Element
T13264 29604-29609 NN denotes C/EBP
T13263 29600-29603 DT denotes the
T13262 29597-29599 TO denotes to
T13261 29591-29596 VB denotes Binds
T13260 29586-29590 WDT denotes that
T13259 29579-29585 NN denotes Factor
T13258 29571-29578 JJ denotes Nuclear
T13257 29559-29570 JJ denotes LPS-induced
T13256 29557-29558 DT denotes a
T13255 29554-29556 VB denotes is
T13254 29546-29553 NN denotes C/EBP-β
T12665 28458-28463 DT denotes these
T12664 28449-28457 RB denotes Together
T12663 28446-28447 -RRB- denotes )
T12662 28445-28446 CD denotes 7
T12661 28441-28444 CC denotes and
T12660 28439-28440 CD denotes 6
T12659 28433-28438 NN denotes lanes
T12658 28431-28432 -COMMA- denotes ,
T12657 28429-28431 NN denotes 5B
T12656 28424-28428 NNP denotes Fig.
T12655 28423-28424 -LRB- denotes (
T12654 28407-28422 NN denotes oligonucleotide
T12653 28399-28406 VB denotes mutated
T12652 28395-28398 DT denotes the
T12651 28392-28394 IN denotes by
T12650 28388-28391 RB denotes not
T12649 28384-28387 CC denotes but
T12648 28382-28383 -COMMA- denotes ,
T12647 28381-28382 -RRB- denotes )
T12646 28380-28381 CD denotes 9
T12645 28376-28379 CC denotes and
T12644 28374-28375 CD denotes 8
T12643 28368-28373 NN denotes lanes
T12642 28366-28367 -COMMA- denotes ,
T12641 28364-28366 NN denotes 5B
T12640 28359-28363 NNP denotes Fig.
T12639 28358-28359 -LRB- denotes (
T12638 28349-28357 NN denotes promoter
T12637 28341-28348 NN denotes albumin
T12636 28337-28340 NN denotes rat
T12635 28333-28336 DT denotes the
T12634 28328-28332 IN denotes from
T12633 28323-28327 NN denotes site
T12632 28315-28322 NN denotes binding
T12631 28309-28314 NN denotes C/EBP
T12630 28303-28308 VB denotes known
T12629 28301-28302 DT denotes a
T12628 28298-28300 IN denotes of
T12627 28289-28297 NN denotes sequence
T12626 28285-28288 DT denotes the
T12625 28282-28284 CC denotes or
T12624 28280-28281 -RRB- denotes )
T12623 28279-28280 CD denotes 5
T12622 28275-28278 CC denotes and
T12621 28273-28274 CD denotes 4
T12620 28267-28272 NN denotes lanes
T12619 28265-28266 -COMMA- denotes ,
T12618 28263-28265 NN denotes 5B
T12617 28258-28262 NNP denotes Fig.
T12616 28257-28258 -LRB- denotes (
T12615 28248-28256 NN denotes sequence
T12614 28243-28247 JJ denotes same
T12613 28239-28242 DT denotes the
T12612 28232-28238 CC denotes either
T12611 28223-28231 VB denotes carrying
T12610 28221-28222 -COMMA- denotes ,
T12609 28206-28221 NN denotes oligonucleotide
T12608 28190-28205 JJ denotes double-stranded
T12607 28180-28189 JJ denotes unlabeled
T12606 28177-28179 IN denotes of
T12605 28170-28176 NN denotes excess
T12604 28167-28169 DT denotes an
T12603 28164-28166 IN denotes by
T12602 28154-28163 VB denotes abolished
T12601 28151-28153 VB denotes be
T12600 28145-28150 MD denotes could
T12599 28141-28144 CC denotes and
T12598 28135-28140 NN denotes probe
T12597 28119-28134 NN denotes oligonucleotide
T12596 28113-28118 NN denotes C/EBP
T12595 28106-28112 JJ denotes mutant
T12594 28102-28105 DT denotes the
T12593 28096-28101 VB denotes using
T12592 28087-28095 VB denotes detected
T12591 28083-28086 RB denotes not
T12590 28079-28082 VB denotes was
T12589 28071-28078 NN denotes complex
T12588 28057-28070 JJ denotes LPS-inducible
T12587 28053-28056 DT denotes The
T12586 28048-28051 NN denotes LPS
T12585 28045-28047 IN denotes by
T12584 28037-28044 VB denotes induced
T12583 28033-28036 VB denotes was
T12582 28025-28032 NN denotes complex
T12581 28023-28024 -RRB- denotes )
T12580 28014-28023 VB denotes migrating
T12579 28006-28013 JJ denotes slowest
T12578 28005-28006 -LRB- denotes (
T12577 27995-28004 JJ denotes uppermost
T12576 27991-27994 DT denotes the
T12575 27985-27990 IN denotes while
T12574 27983-27984 -RRB- denotes )
T12573 27981-27983 NN denotes 5A
T12572 27976-27980 NN denotes Fig.
T12571 27975-27976 -LRB- denotes (
T12570 27971-27974 NN denotes DNA
T12569 27962-27970 JJ denotes stranded
T12568 27955-27961 JJ denotes single
T12567 27950-27954 IN denotes with
T12566 27940-27949 NN denotes complexes
T12565 27930-27939 VB denotes represent
T12564 27928-27929 -RRB- denotes )
T12563 27925-27928 CD denotes III
T12562 27923-27924 -COMMA- denotes ,
T12561 27921-27923 CD denotes II
T12560 27919-27920 -COMMA- denotes ,
T12559 27918-27919 CD denotes I
T12558 27917-27918 -LRB- denotes (
T12557 27911-27916 NN denotes bands
T12556 27905-27910 DT denotes these
T12555 27902-27904 IN denotes of
T12554 27896-27901 CD denotes Three
T12553 27893-27894 -RRB- denotes )
T12552 27891-27893 NN denotes 5A
T12551 27886-27890 NNP denotes Fig.
T12550 27885-27886 -LRB- denotes (
T12549 27876-27884 VB denotes detected
T12548 27871-27875 VB denotes were
T12547 27861-27870 NN denotes complexes
T12546 27853-27860 NN denotes protein
T12545 27841-27852 JJ denotes DNA-nuclear
T12544 27828-27840 VB denotes representing
T12543 27826-27827 -COMMA- denotes ,
T12542 27816-27826 NN denotes mobilities
T12541 27806-27815 JJ denotes different
T12540 27803-27805 IN denotes of
T12539 27797-27802 NN denotes bands
T12538 27792-27796 CD denotes Four
T12537 27786-27790 NN denotes site
T12536 27778-27785 NN denotes binding
T12535 27772-27777 NN denotes C/EBP
T12534 27763-27771 NN denotes affinity
T12533 27758-27762 JJ denotes high
T12532 27756-27757 DT denotes a
T12531 27745-27755 VB denotes containing
T12530 27738-27744 NN denotes region
T12529 27736-27737 -RRB- denotes )
T12528 27733-27736 NN denotes DEI
T12527 27732-27733 -LRB- denotes (
T12526 27730-27731 CD denotes 1
T12525 27722-27729 NN denotes element
T12524 27715-27721 JJ denotes distal
T12523 27706-27714 NN denotes promoter
T12522 27698-27705 NN denotes albumin
T12521 27694-27697 NN denotes rat
T12520 27690-27693 DT denotes the
T12519 27688-27689 -RRB- denotes )
T12518 27687-27688 LS denotes 3
T12517 27686-27687 -LRB- denotes (
T12516 27682-27685 CC denotes and
T12515 27666-27681 NN denotes pGLmP-539mC/EBP
T12514 27663-27665 IN denotes in
T12513 27660-27662 IN denotes as
T12512 27651-27659 NN denotes mutation
T12511 27646-27650 JJ denotes same
T12510 27642-27645 DT denotes the
T12509 27631-27641 VB denotes containing
T12508 27623-27630 NN denotes element
T12507 27614-27622 NN denotes SerpinB2
T12506 27607-27613 JJ denotes mutant
T12505 27605-27606 DT denotes a
T12504 27603-27604 -RRB- denotes )
T12503 27602-27603 LS denotes 2
T12502 27601-27602 -LRB- denotes (
T12501 27599-27600 -COMMA- denotes ,
T12500 27598-27599 -RRB- denotes )
T12499 27589-27598 CD denotes −203/−192
T12498 27588-27589 -LRB- denotes (
T12497 27580-27587 NN denotes element
T12496 27574-27579 NN denotes C/EBP
T12495 27565-27573 NN denotes SerpinB2
T12494 27556-27564 JJ denotes putative
T12493 27552-27555 DT denotes the
T12492 27550-27551 -RRB- denotes )
T12491 27549-27550 LS denotes 1
T12490 27548-27549 -LRB- denotes (
T12489 27535-27547 VB denotes representing
T12488 27533-27534 -COMMA- denotes ,
T12487 27529-27533 NN denotes EMSA
T12486 27525-27528 IN denotes for
T12485 27520-27524 VB denotes used
T12484 27515-27519 VB denotes were
T12483 27508-27514 NN denotes probes
T12482 27492-27507 NN denotes oligonucleotide
T12481 27483-27491 JJ denotes stranded
T12480 27476-27482 JJ denotes double
T12479 27466-27475 JJ denotes different
T12478 27460-27465 CD denotes Three
T12477 27447-27458 NN denotes macrophages
T12476 27441-27446 CD denotes 264.7
T13295 29806-29809 CD denotes six
T13294 29803-29805 IN denotes of
T13293 29792-29802 VB denotes Consisting
T12475 27437-27440 NN denotes RAW
T12474 27425-27436 JJ denotes LPS-treated
T12473 27421-27424 CC denotes and
T12472 27411-27420 JJ denotes untreated
T12471 27406-27410 IN denotes from
T12470 27397-27405 NN denotes extracts
T12469 27389-27396 JJ denotes nuclear
T12468 27383-27388 VB denotes using
T12467 27381-27382 -RRB- denotes )
T12466 27377-27381 NN denotes EMSA
T12465 27376-27377 -LRB- denotes (
T12464 27370-27375 NN denotes assay
T12463 27364-27369 NN denotes shift
T12462 27355-27363 NN denotes mobility
T12461 27339-27354 JJ denotes electrophoretic
T12460 27336-27338 IN denotes by
T12459 27323-27335 VB denotes investigated
T12458 27319-27322 VB denotes was
T12457 27317-27318 -RRB- denotes )
T12456 27308-27317 NN denotes −203/−192
T12455 27307-27308 -LRB- denotes (
T12454 27299-27306 NN denotes element
T12453 27293-27298 NN denotes C/EBP
T12452 27284-27292 JJ denotes putative
T12451 27280-27283 DT denotes the
T12450 27277-27279 TO denotes to
T12693 28631-28638 NN denotes factors
T12692 28617-28630 NN denotes transcription
T12691 28614-28616 IN denotes of
T12690 28607-28613 NN denotes family
T12689 28601-28606 NN denotes C/EBP
T12688 28597-28600 DT denotes the
T12687 28594-28596 IN denotes of
T12686 28587-28593 NN denotes member
T12685 28585-28586 DT denotes a
T12684 28577-28584 VB denotes contain
T12683 28574-28576 TO denotes to
T12682 28567-28573 JJ denotes likely
T12681 28564-28566 VB denotes is
T12680 28559-28563 WDT denotes that
T12679 28551-28558 NN denotes complex
T12678 28537-28550 JJ denotes LPS-inducible
T12677 28535-28536 DT denotes a
T12676 28529-28534 VB denotes binds
T12675 28519-28528 NN denotes −203/−192
T12674 28516-28518 IN denotes at
T12673 28511-28515 NN denotes site
T12672 28505-28510 NN denotes C/EBP
T12671 28496-28504 NN denotes SerpinB2
T12670 28487-28495 JJ denotes putative
T12669 28483-28486 DT denotes the
T12668 28478-28482 IN denotes that
T12667 28469-28477 VB denotes indicate
T12666 28464-28468 NN denotes data
T11843 27156-27164 NN denotes promoter
T11842 27147-27155 JJ denotes proximal
T11841 27138-27146 NN denotes SerpinB2
T11840 27134-27137 DT denotes the
T11839 27129-27133 IN denotes from
T11838 27115-27128 NN denotes transcription
T11837 27101-27114 JJ denotes LPS-inducible
T11836 27097-27100 IN denotes for
T11835 27088-27096 JJ denotes critical
T11834 27084-27087 VB denotes are
T11833 27075-27083 NN denotes elements
T11832 27064-27074 JJ denotes cis-acting
T11831 27059-27063 NN denotes AP-1
T11830 27054-27058 DT denotes both
T11829 27050-27053 CC denotes and
T11828 27046-27049 NN denotes CRE
T11827 27042-27045 DT denotes the
T11826 27039-27041 IN denotes as
T11825 27034-27038 RB denotes well
T11824 27031-27033 RB denotes as
T11823 27029-27030 -COMMA- denotes ,
T11822 27022-27029 NN denotes element
T11821 27016-27021 NN denotes C/EBP
T11820 27012-27015 DT denotes the
T11819 27007-27011 IN denotes that
T11818 27002-27006 VB denotes show
T11817 26997-27001 NN denotes data
T11816 26991-26996 DT denotes These
T11815 26981-26989 NN denotes promoter
T11814 26972-26980 NN denotes SerpinB2
T11813 26965-26971 JJ denotes murine
T11812 26961-26964 DT denotes the
T11811 26956-26960 IN denotes from
T11810 26947-26955 NN denotes activity
T11809 26936-26946 NN denotes luciferase
T11808 26922-26935 JJ denotes LPS-inducible
T11807 26914-26921 VB denotes reduced
T11806 26900-26913 RB denotes significantly
T11805 26897-26899 CC denotes or
T11804 26886-26896 RB denotes completely
T11803 26884-26885 -COMMA- denotes ,
T11802 26877-26884 CD denotes −94/−88
T11801 26873-26876 CC denotes and
T11800 26863-26872 CD denotes −106/−100
T11799 26860-26862 IN denotes at
T11798 26854-26859 NN denotes sites
T11797 26849-26853 NN denotes AP-1
T11796 26845-26848 CD denotes two
T11795 26841-26844 DT denotes the
T11794 26838-26840 IN denotes of
T11793 26831-26837 DT denotes either
T11792 26828-26830 CC denotes or
T11791 26818-26827 CD denotes −177/−172
T11790 26815-26817 IN denotes at
T11789 26811-26814 NN denotes CRE
T11788 26807-26810 DT denotes the
T11787 26804-26806 IN denotes of
T11786 26795-26803 NN denotes mutation
T11785 26793-26794 -COMMA- denotes ,
T11784 26791-26793 NN denotes 4B
T11783 26786-26790 NNP denotes Fig.
T11782 26783-26785 IN denotes in
T11781 26777-26782 VB denotes shown
T11780 26774-26776 IN denotes As
T11779 26764-26772 NN denotes promoter
T11778 26755-26763 NN denotes SerpinB2
T11777 26748-26754 JJ denotes murine
T11776 26744-26747 DT denotes the
T11775 26741-26743 IN denotes of
T11774 26732-26740 NN denotes response
T11773 26728-26731 NN denotes LPS
T11772 26724-26727 DT denotes the
T11771 26721-26723 IN denotes in
T11770 26716-26720 NN denotes role
T11769 26714-26715 DT denotes a
T11768 26707-26713 VB denotes played
T11767 26702-26706 PRP denotes they
T11766 26694-26701 IN denotes whether
T11765 26682-26693 VB denotes investigate
T11764 26679-26681 TO denotes to
T11763 26666-26678 NN denotes substitution
T11762 26655-26665 NN denotes nucleotide
T11761 26652-26654 IN denotes by
T11760 26644-26651 VB denotes mutated
T11759 26639-26643 RB denotes also
T11758 26634-26638 VB denotes were
T11757 26628-26633 NN denotes sites
T11756 26622-26627 DT denotes these
T11755 26620-26621 -COMMA- denotes ,
T11754 26619-26620 -RRB- denotes ]
T11753 26617-26619 CD denotes 37
T11752 26616-26617 -LRB- denotes [
T11751 26607-26615 NN denotes promoter
T11750 26598-26606 NN denotes SERPINB2
T11749 26592-26597 JJ denotes human
T11748 26588-26591 DT denotes the
T11747 26585-26587 IN denotes of
T11746 26566-26584 NN denotes PMA-responsiveness
T11745 26562-26565 DT denotes the
T11744 26559-26561 IN denotes in
T11743 26547-26558 NN denotes involvement
T11742 26534-26546 VB denotes demonstrated
T11741 26528-26533 PRP-DOLLAR- denotes their
T11740 26524-26527 CC denotes and
T11739 26515-26523 NN denotes promoter
T11738 26506-26514 NN denotes SerpinB2
T11737 26499-26505 JJ denotes murine
T11736 26495-26498 DT denotes the
T11735 26492-26494 IN denotes in
T11734 26486-26491 NN denotes sites
T11733 26481-26485 NN denotes AP-1
T11732 26477-26480 CD denotes two
T11731 26473-26476 CC denotes and
T11730 26469-26472 NN denotes CRE
T11729 26465-26468 DT denotes the
T11728 26462-26464 IN denotes of
T11727 26453-26461 NN denotes position
T11726 26449-26452 CC denotes and
T11725 26440-26448 NN denotes sequence
T11724 26430-26439 VB denotes conserved
T11723 26426-26429 DT denotes the
T11722 26414-26425 VB denotes Considering
T11721 25552-25553 -RRB- denotes ]
T11720 25550-25552 CD denotes 58
T11719 25549-25550 -LRB- denotes [
T11718 25544-25548 NN denotes gene
T11717 25535-25543 NN denotes SerpinB2
T11716 25531-25534 DT denotes the
T11715 25528-25530 IN denotes of
T11714 25517-25527 NN denotes activation
T11713 25505-25516 JJ denotes LPS-induced
T11712 25502-25504 IN denotes in
T11711 25497-25501 NN denotes site
T11710 25491-25496 NN denotes C/EBP
T11709 25486-25490 DT denotes this
T11708 25475-25485 VB denotes implicated
T11707 25466-25474 RB denotes recently
T12449 27269-27276 VB denotes binding
T12448 27262-27268 NN denotes factor
T12447 27254-27261 JJ denotes Nuclear
T12446 27242-27253 NN denotes Macrophages
T12445 27236-27241 CD denotes 264.7
T12444 27232-27235 NN denotes RAW
T12443 27227-27231 IN denotes from
T12442 27220-27226 NN denotes Factor
T12441 27212-27219 JJ denotes Nuclear
T12440 27200-27211 JJ denotes LPS-induced
T12439 27197-27199 DT denotes an
T12438 27194-27196 IN denotes by
T12437 27188-27193 VB denotes Bound
T12436 27185-27187 VB denotes is
T12435 27177-27184 NN denotes Element
T12434 27171-27176 NN denotes C/EBP
T12433 27167-27170 DT denotes The
T11706 25461-25465 RB denotes also
T11705 25456-25460 VB denotes have
T11704 25449-25455 NN denotes Others
T11703 25438-25447 NN denotes construct
T11702 25429-25437 NN denotes deletion
T11701 25420-25428 NN denotes promoter
T11700 25411-25419 NN denotes SerpinB2
T11699 25406-25410 CD denotes −189
T11698 25402-25405 DT denotes the
T11697 25398-25401 IN denotes for
T11696 25389-25397 VB denotes observed
T11695 25382-25388 NN denotes levels
T11694 25378-25381 DT denotes the
T11693 25375-25377 TO denotes to
T11692 25367-25374 JJ denotes similar
T11691 25365-25366 -COMMA- denotes ,
T11690 25357-25365 NN denotes activity
T11689 25348-25356 NN denotes promoter
T11688 25337-25347 VB denotes eliminated
T11687 25326-25336 RB denotes completely
T11686 25324-25325 -RRB- denotes )
T11685 25315-25324 NN denotes −203/−192
T11684 25314-25315 -LRB- denotes (
T11683 25309-25313 NN denotes site
T11682 25303-25308 NN denotes C/EBP
T11681 25299-25302 DT denotes the
T11680 25296-25298 IN denotes of
T11679 25287-25295 NN denotes mutation
T11678 25285-25286 -COMMA- denotes ,
T11677 25277-25285 NN denotes contrast
T11676 25274-25276 IN denotes In
T11675 25264-25272 NN denotes activity
T11674 25255-25263 NN denotes promoter
T11673 25243-25254 JJ denotes LPS-induced
T11672 25234-25242 VB denotes decrease
T11671 25230-25233 RB denotes not
T11670 25226-25229 VB denotes did
T11669 25221-25225 NN denotes site
T11668 25219-25220 -RRB- denotes )
T11667 25210-25219 CD denotes −296/−288
T11666 25209-25210 -LRB- denotes (
T11665 25203-25208 NN denotes Oct-1
T11664 25195-25202 JJ denotes variant
T11663 25191-25194 DT denotes the
T11662 25188-25190 CC denotes or
T11661 25186-25187 -COMMA- denotes ,
T11660 25185-25186 -RRB- denotes )
T11659 25176-25185 CD denotes −412/−407
T11658 25175-25176 -LRB- denotes (
T11657 25170-25174 NN denotes PU.1
T11656 25168-25169 -COMMA- denotes ,
T11655 25167-25168 -RRB- denotes )
T11654 25158-25167 CD denotes −538/−533
T11653 25157-25158 -LRB- denotes (
T11652 25153-25156 NN denotes box
T11651 25151-25152 NN denotes E
T11650 25141-25150 NN denotes consensus
T11649 25137-25140 DT denotes the
T11648 25134-25136 IN denotes of
T11647 25125-25133 NN denotes mutation
T11646 25123-25124 -COMMA- denotes ,
T11645 25121-25123 NN denotes 4B
T11644 25116-25120 NNP denotes Fig.
T11643 25113-25115 IN denotes in
T11642 25107-25112 VB denotes shown
T11641 25104-25106 IN denotes As
T11640 25101-25102 -RRB- denotes )
T11639 25099-25101 NN denotes 4A
T11638 25094-25098 NN denotes Fig.
T11637 25093-25094 -LRB- denotes (
T11636 25083-25092 NN denotes construct
T11635 25078-25082 NN denotes gene
T11634 25069-25077 NN denotes reporter
T11633 25049-25068 NN denotes promoter-luciferase
T11632 25040-25048 NN denotes SerpinB2
T11631 25033-25039 JJ denotes murine
T11630 25023-25032 NN denotes pGLmP-539
T11629 25019-25022 DT denotes the
T11628 25016-25018 TO denotes to
T11627 25008-25015 VB denotes binding
T11626 25001-25007 NN denotes factor
T11625 24987-25000 NN denotes transcription
T11624 24979-24986 VB denotes disrupt
T11623 24976-24978 TO denotes to
T11622 24967-24975 VB denotes designed
T11621 24954-24966 NN denotes substitution
T11620 24943-24953 NN denotes nucleotide
T11619 24940-24942 IN denotes by
T11618 24931-24939 VB denotes targeted
T11617 24926-24930 VB denotes were
T11616 24924-24925 -RRB- denotes ]
T11615 24922-24924 CD denotes 57
T11614 24921-24922 -LRB- denotes [
T11613 24915-24920 NN denotes genes
T11612 24909-24914 JJ denotes other
T11611 24906-24908 IN denotes in
T11610 24892-24905 NN denotes transcription
T11609 24878-24891 JJ denotes LPS-inducible
T11608 24870-24877 VB denotes mediate
T11607 24867-24869 TO denotes to
T11606 24858-24866 VB denotes reported
T11605 24847-24857 RB denotes previously
T11604 24839-24846 NN denotes factors
T11603 24825-24838 NN denotes transcription
T11602 24821-24824 IN denotes for
T11601 24815-24820 NN denotes sites
T11600 24807-24814 NN denotes binding
T11599 24797-24806 NN denotes candidate
T11598 24789-24796 JJ denotes several
T11597 24787-24788 -COMMA- denotes ,
T11596 24774-24787 NN denotes transcription
T11595 24760-24773 JJ denotes LPS-inducible
T11594 24756-24759 IN denotes for
T11593 24746-24755 JJ denotes essential
T11592 24741-24745 CD denotes −189
T11591 24737-24740 CC denotes and
T11590 24732-24736 CD denotes −539
T11589 24724-24731 IN denotes between
T11588 24715-24723 NN denotes elements
T11587 24704-24714 JJ denotes regulatory
T11586 24692-24703 VB denotes investigate
T11585 24689-24691 TO denotes To
T11584 24675-24688 NN denotes Transcription
T11583 24661-24674 JJ denotes LPS-inducible
T11582 24653-24660 JJ denotes Optimal
T11581 24649-24652 IN denotes for
T11580 24639-24648 JJ denotes Essential
T11579 24635-24638 VB denotes are
T11578 24626-24634 NNP denotes Promoter
T11577 24617-24625 NNP denotes Proximal
T11576 24612-24616 NNP denotes Gene
T11575 24603-24611 NNP denotes SerpinB2
T11574 24596-24602 NNP denotes Murine
T11573 24592-24595 DT denotes the
T11572 24589-24591 IN denotes in
T11571 24583-24588 NN denotes Sites
T11570 24578-24582 NN denotes AP-1
T11569 24574-24577 CD denotes Two
T11568 24570-24573 CC denotes and
T11567 24566-24569 NN denotes CRE
T11566 24564-24565 -COMMA- denotes ,
T11565 24559-24564 NN denotes C/EBP
T11564 24557-24558 DT denotes A
T10739 23496-23497 -RRB- denotes )
T10738 23487-23496 CD denotes −538/−533
T10737 23486-23487 -LRB- denotes (
T10736 23482-23485 NN denotes box
T10735 23480-23481 NN denotes E
T10734 23470-23479 NN denotes consensus
T10733 23468-23469 DT denotes A
T10732 23465-23466 -RRB- denotes ]
T10731 23463-23465 CD denotes 55
T10730 23462-23463 -LRB- denotes [
T10729 23460-23461 -COLON- denotes ;
T10728 23459-23460 -RRB- denotes ]
T10727 23457-23459 CD denotes 37
T10726 23456-23457 -LRB- denotes [
T10725 23445-23455 NN denotes nucleotide
T10724 23437-23444 JJ denotes central
T10723 23430-23436 JJ denotes single
T10722 23428-23429 DT denotes a
T10721 23425-23427 IN denotes of
T10720 23416-23424 NN denotes identity
T10719 23412-23415 DT denotes the
T10718 23409-23411 IN denotes in
T10717 23401-23408 VB denotes differs
T10716 23397-23400 NN denotes CRE
T10715 23393-23396 DT denotes the
T10714 23389-23392 CC denotes and
T10713 23387-23388 -COMMA- denotes ,
T10712 23379-23387 NN denotes promoter
T10711 23370-23378 NN denotes SERPINB2
T10710 23364-23369 JJ denotes human
T10709 23360-23363 DT denotes the
T10708 23357-23359 IN denotes in
T10707 23346-23356 VB denotes identified
T10706 23340-23345 DT denotes those
T10705 23337-23339 TO denotes to
T10704 23328-23336 NN denotes sequence
T10703 23325-23327 IN denotes in
T10702 23315-23324 JJ denotes identical
T10701 23311-23314 VB denotes are
T10700 23305-23310 NN denotes sites
T10699 23300-23304 NN denotes AP-1
T10698 23296-23299 DT denotes the
T10697 23293-23295 IN denotes of
T10696 23288-23292 DT denotes Both
T10695 23277-23286 CD denotes −172/−177
T10694 23274-23276 IN denotes at
T10693 23266-23273 JJ denotes present
T10692 23263-23265 VB denotes is
T10691 23261-23262 -RRB- denotes )
T10690 23258-23261 NN denotes CRE
T10689 23257-23258 -LRB- denotes (
T10688 23249-23256 NN denotes element
T10687 23240-23248 NN denotes response
T10686 23236-23239 NN denotes AMP
T10685 23229-23235 JJ denotes cyclic
T10684 23220-23228 JJ denotes putative
T10683 23218-23219 DT denotes a
T10682 23214-23217 CC denotes and
T10681 23212-23213 -COMMA- denotes ,
T10680 23203-23212 CD denotes −100/−106
T10679 23199-23202 CC denotes and
T10678 23191-23198 CD denotes −88/−94
T10677 23179-23190 NN denotes nucleotides
T10676 23176-23178 IN denotes at
T10675 23170-23175 VB denotes found
T10674 23166-23169 VB denotes are
T10673 23160-23165 NN denotes sites
T10672 23152-23159 NN denotes binding
T10671 23150-23151 -RRB- denotes )
T10670 23146-23150 NN denotes AP-1
T10669 23145-23146 -LRB- denotes (
T10668 23143-23144 CD denotes 1
T10667 23135-23142 NN denotes protein
T10666 23125-23134 NN denotes activator
T10665 23115-23124 JJ denotes potential
T10664 23111-23114 CD denotes two
T10663 23109-23110 -COMMA- denotes ,
T10662 23100-23109 CD denotes −192/−203
T10661 23097-23099 IN denotes at
T10660 23089-23096 JJ denotes present
T10659 23086-23088 VB denotes is
T10658 23081-23085 NN denotes site
T10657 23079-23080 -RRB- denotes )
T10656 23074-23079 NN denotes C/EBP
T10655 23073-23074 -LRB- denotes (
T10654 23065-23072 NN denotes protein
T10653 23057-23064 NN denotes binding
T10652 23048-23056 NN denotes enhancer
T10651 23042-23047 NN denotes CCAAT
T10650 23033-23041 JJ denotes putative
T10649 23031-23032 DT denotes A
T10648 23028-23029 -RRB- denotes ]
T10647 23026-23028 CD denotes 54
T10646 23025-23026 -LRB- denotes [
T10645 23023-23024 -COLON- denotes ;
T10644 23022-23023 -RRB- denotes ]
T10643 23020-23022 CD denotes 53
T10642 23019-23020 -LRB- denotes [
T10641 23014-23018 NN denotes gene
T10640 23005-23013 NN denotes SERPINB2
T10639 22999-23004 JJ denotes human
T10638 22995-22998 DT denotes the
T10637 22992-22994 IN denotes of
T10636 22988-22991 NN denotes box
T10635 22983-22987 NN denotes TATA
T10634 22979-22982 DT denotes the
T10633 22976-22978 IN denotes of
T10632 22967-22975 NN denotes position
T10631 22963-22966 DT denotes the
T10630 22960-22962 TO denotes to
T10629 22952-22959 JJ denotes similar
T10628 22950-22951 -COMMA- denotes ,
T10627 22946-22950 NN denotes site
T10626 22935-22945 NN denotes initiation
T10625 22921-22934 NN denotes transcription
T10624 22917-22920 DT denotes the
T10623 22912-22916 IN denotes from
T10622 22903-22911 RB denotes upstream
T10621 22898-22902 VB denotes 29bp
T10620 22895-22897 TO denotes to
T10619 22892-22894 CD denotes 23
T10618 22884-22891 JJ denotes located
T10617 22881-22883 VB denotes is
T10616 22872-22880 NN denotes sequence
T10615 22862-22871 NN denotes consensus
T10614 22857-22861 NN denotes TATA
T10613 22855-22856 DT denotes a
T10612 22853-22854 -COMMA- denotes ,
T10611 22841-22853 RB denotes Specifically
T10610 22838-22839 -RRB- denotes )
T10609 22837-22838 CD denotes 3
T10608 22832-22836 NN denotes Fig.
T10607 22831-22832 -LRB- denotes (
T10606 22822-22830 NN denotes promoter
T10605 22813-22821 NN denotes SerpinB2
T10604 22806-22812 JJ denotes murine
T10603 22802-22805 DT denotes the
T10602 22799-22801 IN denotes in
T10601 22789-22798 VB denotes conserved
T10600 22785-22788 VB denotes are
T10599 22776-22784 NN denotes promoter
T10598 22767-22775 JJ denotes proximal
T10597 22758-22766 NN denotes SerpinB2
T10596 22752-22757 JJ denotes human
T10595 22748-22751 DT denotes the
T10594 22745-22747 IN denotes in
T10593 22737-22744 VB denotes defined
T10592 22728-22736 NN denotes elements
T10591 22717-22727 JJ denotes regulatory
T10590 22706-22716 JJ denotes cis-acting
T10589 22702-22705 DT denotes the
T10588 22699-22701 IN denotes of
T10587 22691-22698 JJ denotes several
T10586 22686-22690 IN denotes that
T10585 22677-22685 VB denotes revealed
T10584 22675-22676 NN denotes E
T10583 22668-22674 NN denotes Region
T10582 22665-22667 IN denotes of
T10581 22656-22664 NN denotes analysis
T10580 22648-22655 JJ denotes Further
T10579 22638-22646 NN denotes homology
T10578 22629-22637 JJ denotes greatest
T10577 22625-22628 DT denotes the
T10576 22615-22624 VB denotes exhibited
T10575 22613-22614 -COMMA- denotes ,
T10574 22606-22613 NN denotes element
T10573 22597-22605 NN denotes response
T10572 22593-22596 NN denotes LPS
T10571 22583-22592 JJ denotes essential
T10570 22579-22582 DT denotes the
T10569 22570-22578 VB denotes contains
T10568 22564-22569 WDT denotes which
T10567 22562-22563 -COMMA- denotes ,
T10566 22561-22562 -RRB- denotes )
T10565 22560-22561 NN denotes E
T10564 22553-22559 NN denotes Region
T10563 22552-22553 -LRB- denotes (
T10562 22543-22551 NN denotes promoter
T10561 22534-22542 JJ denotes proximal
T10560 22530-22533 DT denotes The
T10559 22527-22528 -RRB- denotes )
T10558 22525-22527 NN denotes 2C
T10557 22520-22524 NN denotes Fig.
T10556 22519-22520 -LRB- denotes (
T10555 22509-22518 NN denotes promoters
T10554 22502-22508 JJ denotes murine
T10553 22498-22501 CC denotes and
T10552 22492-22497 JJ denotes human
T10551 22488-22491 DT denotes the
T10550 22480-22487 IN denotes between
T10549 22478-22479 -RRB- denotes )
T10548 22475-22478 NN denotes A-E
T10547 22474-22475 -LRB- denotes (
T10546 22466-22473 NN denotes regions
T10545 22455-22465 JJ denotes homologous
T10544 22447-22454 RB denotes broadly
T10543 22442-22446 CD denotes five
T10542 22431-22441 JJ denotes delineated
T10541 22422-22430 NN denotes elements
T10540 22413-22421 NN denotes sequence
T10539 22402-22412 JJ denotes repetitive
T10538 22394-22401 JJ denotes several
T10537 22391-22393 IN denotes of
T10536 22382-22390 NN denotes presence
T10535 22378-22381 DT denotes The
T10534 22375-22376 -RRB- denotes ]
T10533 22373-22375 CD denotes 52
T10532 22372-22373 -LRB- denotes [
T10531 22361-22371 NN denotes expression
T10530 22356-22360 NN denotes gene
T10529 22347-22355 NN denotes SerpinB2
T10528 22344-22346 IN denotes of
T10527 22333-22343 NN denotes regulation
T10526 22329-22332 DT denotes the
T10525 22326-22328 IN denotes in
T10524 22321-22325 NN denotes role
T10515 22272-22278 NN denotes factor
T10514 22258-22271 NN denotes transcription
T10513 22248-22257 JJ denotes potential
T10512 22246-22247 -COMMA- denotes ,
T10511 22237-22246 VB denotes conserved
T10510 22222-22236 RB denotes evolutionarily
T10509 22219-22221 IN denotes of
T10508 22210-22218 NN denotes presence
T10507 22206-22209 DT denotes the
T10506 22201-22205 IN denotes that
T10505 22192-22200 VB denotes reasoned
T10504 22189-22191 PRP denotes We
T10503 22180-22187 NN denotes regions
T10502 22171-22179 NN denotes flanking
T10501 22168-22170 NN denotes 5′
T10500 22159-22167 NN denotes SerpinB2
T10499 22153-22158 JJ denotes human
T10498 22149-22152 CC denotes and
T10497 22142-22148 JJ denotes murine
T10496 22138-22141 DT denotes the
T10495 22130-22137 VB denotes aligned
T10494 22127-22129 PRP denotes we
T10493 22125-22126 -COMMA- denotes ,
T10492 22122-22125 NN denotes LPS
T10491 22119-22121 TO denotes to
T10490 22110-22118 NN denotes response
T10489 22106-22109 DT denotes the
T10488 22102-22105 CC denotes and
T10487 22097-22101 NN denotes gene
T10486 22088-22096 NN denotes SerpinB2
T10485 22081-22087 JJ denotes murine
T10484 22077-22080 DT denotes the
T10483 22074-22076 IN denotes of
T10482 22060-22073 NN denotes transcription
T10481 22052-22059 VB denotes mediate
T10480 22046-22051 MD denotes might
T10479 22041-22045 WDT denotes that
T10478 22032-22040 NN denotes elements
T10477 22021-22031 JJ denotes cis-acting
T10476 22011-22020 JJ denotes potential
T10475 22007-22010 IN denotes for
T10474 22002-22006 VB denotes look
T10473 21999-22001 TO denotes To
T10472 21989-21998 NN denotes Promoters
T10471 21980-21988 JJ denotes Proximal
T10470 21971-21979 NN denotes SerpinB2
T10469 21964-21970 NNP denotes Murine
T10468 21960-21963 CC denotes and
T10467 21954-21959 JJ denotes Human
T10466 21950-21953 DT denotes the
T10465 21943-21949 IN denotes within
T10464 21930-21942 NN denotes Conservation
T10463 21921-21929 NN denotes Sequence
T10812 23847-23848 -RRB- denotes ]
T10811 23845-23847 CD denotes 56
T10810 23844-23845 -LRB- denotes [
T10809 23842-23843 -COLON- denotes ;
T10808 23841-23842 -RRB- denotes ]
T10807 23839-23841 CD denotes 30
T10806 23838-23839 -LRB- denotes [
T10805 23836-23837 -COLON- denotes ;
T10804 23835-23836 -RRB- denotes ]
T10803 23833-23835 CD denotes 16
T10802 23832-23833 -LRB- denotes [
T10801 23822-23831 VB denotes conserved
T10800 23817-23821 RB denotes well
T10799 23812-23816 RB denotes also
T10798 23808-23811 VB denotes are
T10797 23806-23807 -RRB- denotes )
T10796 23804-23806 NN denotes S2
T10795 23799-23803 NNP denotes Fig.
T10794 23798-23799 -LRB- denotes (
T10793 23786-23797 CD denotes −1342/−1351
T10792 23783-23785 IN denotes at
T10791 23778-23782 NN denotes site
T10790 23770-23777 NN denotes binding
T10789 23766-23769 NN denotes p65
T10788 23760-23765 NN denotes NF-κB
T10787 23758-23759 DT denotes a
T10786 23754-23757 CC denotes and
T10785 23742-23753 CD denotes −1540/−1528
T10784 23739-23741 IN denotes at
T10783 23731-23738 NN denotes element
T10782 23722-23730 NN denotes silencer
T10781 23714-23721 NN denotes PAUSE-1
T10780 23712-23713 DT denotes a
T10779 23710-23711 -COMMA- denotes ,
T10778 23699-23710 CD denotes −1349/−1340
T10777 23696-23698 IN denotes at
T10776 23688-23695 NN denotes element
T10775 23679-23687 NN denotes response
T10774 23674-23678 NN denotes acid
T10773 23665-23673 JJ denotes retinoic
T10772 23663-23664 DT denotes a
T10771 23661-23662 -COMMA- denotes ,
T10770 23653-23661 RB denotes upstream
T10769 23645-23652 RB denotes Further
T10768 23642-23643 -RRB- denotes )
T10767 23640-23642 NN denotes S2
T10766 23635-23639 NN denotes Fig.
T10765 23634-23635 -LRB- denotes (
T10764 23627-23633 NN denotes region
T10763 23618-23626 NN denotes promoter
T10762 23609-23617 JJ denotes proximal
T10761 23605-23608 DT denotes the
T10760 23598-23604 IN denotes within
T10759 23587-23597 VB denotes identified
T10758 23582-23586 RB denotes also
T10757 23577-23581 VB denotes were
T10756 23575-23576 -RRB- denotes )
T10755 23566-23575 CD denotes −296/−288
T10754 23565-23566 -LRB- denotes (
T10753 23559-23564 NN denotes Oct-1
T10752 23555-23558 CC denotes and
T10751 23553-23554 -RRB- denotes )
T10750 23544-23553 CD denotes −412/−407
T10749 23543-23544 -LRB- denotes (
T10748 23538-23542 NN denotes PU.1
T10747 23534-23537 IN denotes for
T10746 23528-23533 NN denotes sites
T10745 23520-23527 VB denotes binding
T10744 23510-23519 JJ denotes potential
T10743 23507-23509 IN denotes as
T10742 23502-23506 RB denotes well
T10741 23499-23501 RB denotes as
T10740 23497-23498 -COMMA- denotes ,
T10523 22319-22320 DT denotes a
T10522 22314-22318 VB denotes play
T10521 22308-22313 MD denotes might
T10520 22301-22307 NN denotes region
T10519 22296-22300 DT denotes this
T10518 22293-22295 IN denotes in
T10517 22287-22292 NN denotes sites
T10516 22279-22286 NN denotes binding
T9723 19510-19523 NN denotes transcription
T9722 19496-19509 JJ denotes LPS-inducible
T9721 19492-19495 CC denotes and
T9720 19487-19491 NN denotes PMA-
T9719 19482-19486 CC denotes both
T9718 19474-19481 NN denotes directs
T9717 19470-19473 CD denotes +92
T9716 19467-19469 TO denotes to
T9715 19461-19466 CD denotes −4480
T9714 19456-19460 IN denotes from
T9713 19449-19455 NN denotes region
T9712 19440-19448 NN denotes flanking
T9711 19437-19439 NN denotes 5′
T9710 19428-19436 NN denotes SerpinB2
T9709 19424-19427 DT denotes the
T9708 19422-19423 -COMMA- denotes ,
T9707 19420-19422 NN denotes 2B
T9706 19415-19419 NNP denotes Fig.
T9705 19412-19414 IN denotes in
T9704 19406-19411 VB denotes shown
T9703 19403-19405 IN denotes As
T9702 19400-19401 -RRB- denotes ]
T9701 19398-19400 CD denotes 51
T9700 19397-19398 -LRB- denotes [
T9699 19396-19397 CD denotes –
T9698 19395-19396 -RRB- denotes ]
T9697 19393-19395 CD denotes 47
T9696 19392-19393 -LRB- denotes [
T9695 19390-19391 -COLON- denotes ;
T9694 19389-19390 -RRB- denotes ]
T9693 19387-19389 CD denotes 37
T9692 19386-19387 -LRB- denotes [
T9691 19384-19385 -COLON- denotes ;
T9690 19383-19384 -RRB- denotes ]
T9689 19381-19383 CD denotes 30
T9688 19380-19381 -LRB- denotes [
T9687 19371-19379 NN denotes elements
T9686 19360-19370 JJ denotes responsive
T9685 19355-19359 NN denotes AP-1
T9684 19348-19354 JJ denotes distal
T9683 19344-19347 CC denotes and
T9682 19335-19343 JJ denotes proximal
T9681 19327-19334 JJ denotes several
T9680 19319-19326 IN denotes through
T9679 19313-19318 VB denotes occur
T9678 19310-19312 TO denotes to
T9677 19304-19309 VB denotes shown
T9676 19299-19303 VB denotes been
T9675 19295-19298 VB denotes has
T9674 19291-19294 CC denotes and
T9673 19289-19290 -COMMA- denotes ,
T9672 19288-19289 -RRB- denotes ]
T9671 19286-19288 CD denotes 47
T9670 19285-19286 -LRB- denotes [
T9669 19284-19285 CD denotes –
T9668 19283-19284 -RRB- denotes ]
T9667 19281-19283 CD denotes 45
T9666 19280-19281 -LRB- denotes [
T9665 19274-19279 NN denotes lines
T9664 19269-19273 NN denotes cell
T9663 19258-19268 NN denotes macrophage
T9662 19252-19257 JJ denotes human
T9661 19249-19251 IN denotes in
T9660 19241-19248 VB denotes studied
T9659 19229-19240 RB denotes extensively
T9658 19224-19228 VB denotes been
T9657 19220-19223 VB denotes has
T9656 19209-19219 NN denotes regulation
T9655 19204-19208 NN denotes gene
T9654 19195-19203 NN denotes SerpinB2
T9653 19183-19194 JJ denotes PMA-induced
T9652 19171-19181 NN denotes comparison
T9651 19167-19170 IN denotes for
T9650 19165-19166 -COMMA- denotes ,
T9649 19162-19165 NN denotes PMA
T9648 19159-19161 CC denotes or
T9647 19155-19158 NN denotes LPS
T9646 19152-19154 IN denotes of
T9645 19144-19151 NN denotes absence
T9644 19140-19143 CC denotes and
T9643 19131-19139 NN denotes presence
T9642 19127-19130 DT denotes the
T9641 19124-19126 IN denotes in
T9640 19115-19123 NN denotes activity
T9639 19104-19114 NN denotes luciferase
T9638 19100-19103 IN denotes for
T9637 19092-19099 VB denotes assayed
T9636 19088-19091 CC denotes and
T9635 19076-19087 NN denotes macrophages
T9634 19067-19075 NN denotes RAW264.7
T9633 19053-19066 JJ denotes sub-confluent
T9632 19048-19052 IN denotes into
T9631 19036-19047 VB denotes transfected
T9630 19024-19035 RB denotes transiently
T9629 19019-19023 RB denotes then
T9628 19014-19018 VB denotes were
T9627 19003-19013 NN denotes constructs
T9626 18994-19002 NN denotes reporter
T9625 18990-18993 DT denotes The
T9624 18987-18988 -RRB- denotes )
T9623 18985-18987 NN denotes 2A
T9622 18980-18984 NN denotes Fig.
T9621 18979-18980 -LRB- denotes (
T9620 18977-18978 -RRB- denotes )
T9619 18972-18977 JJ denotes Basic
T9618 18967-18971 NN denotes pGL3
T9617 18966-18967 -LRB- denotes (
T9616 18961-18965 NN denotes gene
T9615 18952-18960 NN denotes reporter
T9614 18941-18951 NN denotes luciferase
T9613 18933-18940 NN denotes firefly
T9612 18919-18932 JJ denotes promoter-less
T9611 18917-18918 DT denotes a
T9610 18914-18916 IN denotes of
T9609 18905-18913 RB denotes upstream
T9608 18898-18904 VB denotes cloned
T9607 18893-18897 VB denotes were
T9606 18886-18892 NN denotes region
T9605 18877-18885 NN denotes flanking
T9604 18874-18876 NN denotes 5′
T9603 18870-18873 DT denotes the
T9602 18867-18869 IN denotes of
T9601 18859-18866 NN denotes mutants
T9600 18850-18858 NN denotes deletion
T9599 18840-18849 VB denotes generated
T9598 18837-18839 IN denotes of
T9597 18830-18836 NN denotes series
T9596 18828-18829 DT denotes a
T9595 18824-18827 CC denotes and
T9594 18820-18823 CD denotes +92
T9593 18817-18819 TO denotes to
T9592 18811-18816 CD denotes −4480
T9591 18799-18810 NN denotes nucleotides
T9590 18797-18798 -COMMA- denotes ,
T9589 18793-18797 NN denotes gene
T9588 18784-18792 NN denotes SerpinB2
T9587 18777-18783 JJ denotes murine
T9586 18773-18776 DT denotes the
T9585 18770-18772 IN denotes of
T9584 18763-18769 NN denotes region
T9583 18754-18762 NN denotes flanking
T9582 18751-18753 CD denotes 5′
T9581 18747-18750 DT denotes the
T9580 18744-18746 IN denotes in
T9579 18740-18743 NN denotes LPS
T9578 18737-18739 TO denotes to
T9577 18726-18736 JJ denotes responsive
T9576 18717-18725 NN denotes elements
T9575 18706-18716 JJ denotes regulatory
T9574 18695-18705 JJ denotes cis-acting
T9573 18683-18694 VB denotes investigate
T9572 18680-18682 TO denotes To
T9571 18665-18679 NN denotes Responsiveness
T9570 18661-18664 NN denotes LPS
T9569 18653-18660 NNP denotes Confers
T9568 18644-18652 NNP denotes Promoter
T9567 18635-18643 NNP denotes Proximal
T9566 18626-18634 NN denotes SerpinB2
T9565 18622-18625 DT denotes The
T9855 20355-20358 CD denotes −87
T9854 20344-20354 NN denotes nucleotide
T9853 20341-20343 IN denotes of
T9852 20330-20340 JJ denotes downstream
T9851 20326-20329 VB denotes lie
T9850 20321-20325 RB denotes also
T9849 20317-20320 NN denotes PMA
T9848 20314-20316 TO denotes to
T9847 20305-20313 NN denotes promoter
T9846 20296-20304 NN denotes SerpinB2
T9845 20289-20295 JJ denotes murine
T9844 20285-20288 DT denotes the
T9843 20282-20284 IN denotes of
T9842 20273-20281 NN denotes response
T9841 20269-20272 DT denotes the
T9840 20259-20268 VB denotes mediating
T9839 20250-20258 NN denotes elements
T9838 20239-20249 JJ denotes cis-acting
T9837 20234-20238 IN denotes that
T9836 20223-20233 VB denotes indicating
T9835 20221-20222 -COMMA- denotes ,
T9834 20218-20221 NN denotes PMA
T9833 20215-20217 TO denotes to
T9832 20204-20214 JJ denotes responsive
T9831 20194-20203 RB denotes partially
T9830 20188-20193 RB denotes still
T9829 20184-20187 VB denotes was
T9828 20174-20183 NN denotes construct
T9827 20165-20173 NN denotes promoter
T9826 20156-20164 NN denotes SerpinB2
T9825 20149-20155 JJ denotes murine
T9824 20145-20148 CD denotes −87
T9823 20141-20144 DT denotes the
T9822 20139-20140 -COMMA- denotes ,
T9821 20131-20139 NN denotes response
T9820 20127-20130 NN denotes PMA
T9819 20123-20126 DT denotes the
T9818 20115-20122 VB denotes reduced
T9817 20104-20114 RB denotes marginally
T9816 20100-20103 CC denotes and
T9815 20091-20099 NN denotes response
T9814 20087-20090 NN denotes LPS
T9813 20083-20086 DT denotes the
T9812 20072-20082 VB denotes eliminated
T9811 20068-20071 CD denotes −87
T9810 20065-20067 TO denotes to
T9809 20060-20064 CD denotes −189
T9808 20055-20059 IN denotes from
T9807 20046-20054 NN denotes promoter
T9806 20037-20045 NN denotes SerpinB2
T9805 20033-20036 DT denotes the
T9804 20030-20032 IN denotes of
T9803 20021-20029 NN denotes deletion
T9802 20015-20020 IN denotes While
T9801 20005-20013 NN denotes deletion
T9800 20000-20004 DT denotes this
T9799 19997-19999 IN denotes by
T9798 19988-19996 VB denotes affected
T9797 19983-19987 RB denotes less
T9796 19980-19982 VB denotes is
T9795 19976-19979 NN denotes PMA
T9794 19973-19975 TO denotes to
T9793 19964-19972 NN denotes promoter
T9792 19955-19963 NN denotes SerpinB2
T9791 19948-19954 JJ denotes murine
T9790 19944-19947 DT denotes the
T9789 19941-19943 IN denotes of
T9788 19932-19940 NN denotes response
T9787 19928-19931 DT denotes the
T9786 19926-19927 -COMMA- denotes ,
T9785 19919-19926 RB denotes however
T9784 19917-19918 -COLON- denotes ;
T9783 19913-19917 CD denotes −189
T9782 19909-19912 CC denotes and
T9781 19904-19908 CD denotes −539
T9780 19896-19903 IN denotes between
T9779 19889-19895 NN denotes region
T9778 19885-19888 DT denotes the
T9777 19882-19884 IN denotes in
T9776 19874-19881 NN denotes element
T9775 19865-19873 NN denotes response
T9774 19861-19864 NN denotes LPS
T9773 19851-19860 JJ denotes essential
T9772 19848-19850 DT denotes an
T9771 19845-19847 IN denotes of
T9770 19836-19844 NN denotes presence
T9769 19832-19835 DT denotes the
T9768 19821-19831 VB denotes indicating
T9767 19819-19820 -COMMA- denotes ,
T9766 19811-19819 NN denotes promoter
T9765 19807-19810 DT denotes the
T9764 19804-19806 IN denotes of
T9763 19791-19803 NN denotes LPS-response
T9762 19787-19790 DT denotes the
T9761 19777-19786 VB denotes abolished
T9760 19772-19776 CD denotes −539
T9759 19765-19771 IN denotes beyond
T9758 19756-19764 NN denotes deletion
T9757 19748-19755 JJ denotes Further
T9756 19740-19746 NN denotes region
T9755 19735-19739 DT denotes this
T9754 19732-19734 IN denotes in
T9753 19724-19731 NN denotes element
T9752 19715-19723 NN denotes silencer
T9751 19713-19714 DT denotes a
T9750 19710-19712 IN denotes of
T9749 19701-19709 NN denotes presence
T9748 19697-19700 DT denotes the
T9747 19686-19696 VB denotes indicating
T9746 19684-19685 -COMMA- denotes ,
T9745 19677-19684 RB denotes 16-fold
T9744 19663-19676 RB denotes approximately
T9743 19660-19662 TO denotes to
T9742 19643-19659 NN denotes LPS-inducibility
T9741 19633-19642 VB denotes increased
T9740 19627-19632 CD denotes −1341
T9739 19624-19626 TO denotes to
T9738 19618-19623 CD denotes −1686
T9737 19613-19617 IN denotes from
T9736 19604-19612 NN denotes promoter
T9735 19595-19603 NN denotes SerpinB2
T9734 19588-19594 JJ denotes murine
T9733 19584-19587 DT denotes the
T9732 19581-19583 IN denotes of
T9731 19572-19580 NN denotes Deletion
T9730 19558-19570 RB denotes respectively
T9729 19556-19557 -COMMA- denotes ,
T9728 19550-19556 RB denotes 7-fold
T9727 19546-19549 CC denotes and
T9726 19539-19545 RB denotes 2-fold
T9725 19525-19538 RB denotes approximately
T9724 19523-19524 -COMMA- denotes ,
T9180 18123-18124 -RRB- denotes )
T9179 18122-18123 CD denotes 1
T9178 18117-18121 NN denotes Fig.
T9177 18116-18117 -LRB- denotes (
T9176 18106-18115 NN denotes treatment
T9175 18102-18105 NN denotes LPS
T9174 18099-18101 IN denotes of
T9173 18095-18098 NN denotes hrs
T9172 18093-18094 CD denotes 8
T9171 18087-18092 IN denotes after
T9170 18076-18086 JJ denotes detectable
T9169 18072-18075 CC denotes and
T9168 18070-18071 -COMMA- denotes ,
T9167 18069-18070 -RRB- denotes ]
T9166 18067-18069 CD denotes 31
T9165 18066-18067 -LRB- denotes [
T9164 18060-18065 NN denotes types
T9163 18055-18059 NN denotes cell
T9162 18049-18054 JJ denotes other
T9161 18046-18048 IN denotes in
T9160 18037-18045 VB denotes reported
T9159 18032-18036 VB denotes been
T9158 18028-18031 VB denotes has
T9157 18025-18027 IN denotes as
T9156 18017-18024 VB denotes induced
T9155 18012-18016 RB denotes also
T9154 18008-18011 VB denotes was
T9153 17997-18007 NN denotes expression
T9152 17989-17996 NN denotes protein
T9151 17980-17988 NN denotes SerpinB2
T9150 17977-17978 -RRB- denotes ]
T9149 17975-17977 CD denotes 44
T9148 17974-17975 -LRB- denotes [
T9147 17973-17974 NN denotes –
T9146 17972-17973 -RRB- denotes ]
T9145 17970-17972 CD denotes 42
T9144 17969-17970 -LRB- denotes [
T9143 17967-17968 -COLON- denotes ;
T9142 17966-17967 -RRB- denotes ]
T9141 17964-17966 CD denotes 29
T9140 17963-17964 -LRB- denotes [
T9139 17961-17962 -COLON- denotes ;
T9138 17960-17961 -RRB- denotes ]
T9137 17959-17960 CD denotes 5
T9136 17958-17959 -LRB- denotes [
T9135 17953-17957 NN denotes mRNA
T9134 17949-17952 DT denotes the
T9133 17946-17948 IN denotes of
T9132 17932-17945 NN denotes stabilization
T9131 17928-17931 CC denotes and
T9130 17914-17927 NN denotes transcription
T9129 17909-17913 NN denotes gene
T9128 17906-17908 IN denotes in
T9127 17897-17905 NN denotes increase
T9126 17894-17896 DT denotes an
T9125 17889-17893 CC denotes both
T9124 17880-17888 VB denotes involves
T9123 17869-17879 NN denotes expression
T9122 17860-17868 NN denotes SerpinB2
T9121 17848-17859 JJ denotes LPS-induced
T9120 17845-17846 -RRB- denotes ]
T9119 17843-17845 CD denotes 32
T9118 17842-17843 -LRB- denotes [
T9117 17840-17841 -COLON- denotes ;
T9116 17839-17840 -RRB- denotes ]
T9115 17838-17839 CD denotes 4
T9114 17837-17838 -LRB- denotes [
T9113 17831-17836 NN denotes cells
T9112 17819-17830 JJ denotes mononuclear
T9111 17813-17818 NN denotes blood
T9110 17802-17812 JJ denotes peripheral
T9109 17796-17801 JJ denotes human
T9108 17792-17795 CC denotes and
T9107 17780-17791 NN denotes macrophages
T9106 17769-17779 JJ denotes peritoneal
T9105 17762-17768 JJ denotes murine
T9104 17759-17761 IN denotes in
T9103 17748-17758 RB denotes previously
T9102 17739-17747 VB denotes reported
T9101 17734-17738 VB denotes been
T9100 17730-17733 VB denotes has
T9099 17719-17729 NN denotes expression
T9098 17714-17718 NN denotes mRNA
T9097 17705-17713 NN denotes SerpinB2
T9096 17691-17704 JJ denotes LPS-inducible
T9095 17688-17690 IN denotes of
T9094 17678-17687 NN denotes induction
T9093 17671-17677 JJ denotes strong
T9092 17663-17670 JJ denotes similar
T9091 17661-17662 DT denotes A
T9090 17658-17659 -RRB- denotes )
T9089 17656-17658 NN denotes 1A
T9088 17651-17655 NNP denotes Fig.
T9087 17650-17651 -LRB- denotes (
T9086 17646-17649 NN denotes hrs
T9085 17643-17645 CD denotes 24
T9084 17640-17642 IN denotes at
T9083 17633-17639 NN denotes levels
T9082 17625-17632 JJ denotes maximal
T9081 17616-17624 VB denotes reaching
T9080 17614-17615 -COMMA- denotes ,
T9079 17605-17614 NN denotes challenge
T9078 17601-17604 NN denotes LPS
T9077 17591-17600 VB denotes following
T9076 17587-17590 NN denotes min
T9075 17584-17586 CD denotes 30
T9074 17581-17583 IN denotes as
T9073 17575-17580 RB denotes early
T9072 17572-17574 RB denotes as
T9071 17561-17571 JJ denotes detectable
T9070 17557-17560 VB denotes was
T9069 17552-17556 NN denotes mRNA
T9068 17543-17551 NN denotes SerpinB2
T9067 17541-17542 -COMMA- denotes ,
T9066 17538-17541 NN denotes LPS
T9065 17535-17537 TO denotes to
T9064 17527-17534 VB denotes exposed
T9063 17522-17526 VB denotes were
T9062 17510-17521 NN denotes macrophages
T9061 17501-17509 NN denotes RAW264.7
T9060 17496-17500 WRB denotes When
T9059 17492-17495 NN denotes LPS
T9058 17489-17491 TO denotes to
T9057 17478-17488 JJ denotes Responsive
T9056 17471-17477 RB denotes Highly
T9055 17468-17470 VB denotes is
T9054 17463-17467 NN denotes Gene
T9053 17454-17462 NN denotes SerpinB2
T9052 17450-17453 DT denotes The
T8938 17427-17438 JJ denotes significant
T8937 17416-17426 VB denotes considered
T8936 17411-17415 VB denotes were
T8935 17406-17410 CD denotes 0.05
T8934 17405-17406 SYM denotes <
T8933 17396-17404 NN denotes P-values
T8932 17386-17394 JJ denotes relevant
T8931 17380-17385 WRB denotes where
T8930 17375-17379 NN denotes test
T8929 17373-17374 NN denotes t
T8928 17363-17372 NN denotes Student’s
T8927 17360-17362 CC denotes or
T8926 17358-17359 -RRB- denotes )
T8925 17353-17358 NN denotes ANOVA
T8924 17352-17353 -LRB- denotes (
T8923 17343-17351 NN denotes variance
T8922 17340-17342 IN denotes of
T8921 17331-17339 NN denotes analysis
T8920 17327-17330 DT denotes the
T8919 17321-17326 VB denotes using
T8918 17312-17320 VB denotes analyzed
T8917 17307-17311 VB denotes were
T8916 17299-17306 NN denotes Results
T8915 17292-17297 NN denotes group
T8914 17288-17291 IN denotes per
T8913 17284-17287 NN denotes SEM
T8912 17282-17283 JJ denotes ±
T8911 17277-17281 JJ denotes mean
T8910 17274-17276 IN denotes as
T8909 17264-17273 VB denotes presented
T8908 17260-17263 VB denotes are
T8907 17255-17259 NN denotes Data
T8906 17246-17254 NN denotes Analysis
T8905 17234-17245 JJ denotes Statistical
T8554 17203-17231 NN denotes 5′TTCTTGGAAAGCTGGCACTGTGTG3’
T8553 17201-17202 -RRB- denotes )
T8552 17195-17201 CD denotes −5/+19
T8551 17194-17195 -LRB- denotes (
T8550 17186-17193 JJ denotes reverse
T8549 17184-17185 -COLON- denotes ;
T8548 17156-17184 NN denotes 5′AAGACTCCCACAGATGGTGGCTGT3’
T8547 17154-17155 -RRB- denotes )
T8546 17145-17154 CD denotes −338/−315
T8545 17144-17145 -LRB- denotes (
T8544 17136-17143 RB denotes forward
T8543 17134-17135 -COLON- denotes :
T8542 17126-17134 NN denotes promoter
T8541 17117-17125 JJ denotes proximal
T8540 17108-17116 NN denotes SerpinB2
T8539 17104-17107 DT denotes the
T8538 17100-17103 IN denotes for
T8537 17091-17099 JJ denotes specific
T8536 17083-17090 NN denotes primers
T8535 17079-17082 CC denotes and
T8534 17072-17078 NN denotes method
T8533 17066-17071 JJ denotes green
T8532 17061-17065 NN denotes SYBR
T8531 17057-17060 DT denotes the
T8530 17051-17056 VB denotes using
T8529 17046-17050 NN denotes qPCR
T8528 17043-17045 IN denotes by
T8527 17040-17042 CC denotes or
T8526 17036-17039 NN denotes PCR
T8525 17018-17035 JJ denotes semi-quantitative
T8524 17015-17017 IN denotes by
T8523 17005-17014 VB denotes amplified
T8522 17001-17004 VB denotes was
T8521 16997-17000 NN denotes DNA
T8520 16994-16995 -RRB- denotes )
T8518 16987-16988 -LRB- denotes (
T8517 16983-16986 NN denotes Kit
T8516 16970-16982 NN denotes Purification
T8515 16966-16969 NN denotes PCR
T8514 16957-16965 NNP denotes QIAquick
T8513 16953-16956 DT denotes the
T8512 16947-16952 VB denotes using
T8511 16938-16946 VB denotes purified
T8510 16933-16937 RB denotes then
T8509 16929-16932 VB denotes was
T8508 16925-16928 NN denotes DNA
T8507 16921-16924 DT denotes The
T8506 16915-16920 NNP denotes 62°C.
T8505 16912-16914 IN denotes at
T8504 16908-16911 NN denotes hrs
T8503 16906-16907 CD denotes 2
T8502 16902-16905 IN denotes for
T8501 16900-16901 NN denotes K
T8500 16889-16899 NN denotes Proteinase
T8499 16884-16888 IN denotes with
T8498 16875-16883 VB denotes digested
T8497 16870-16874 VB denotes were
T8496 16861-16869 NN denotes proteins
T8495 16857-16860 DT denotes the
T8494 16853-16856 CC denotes and
T8493 16851-16852 -RRB- denotes )
T8492 16842-16851 NNP denotes Millipore
T8491 16841-16842 -LRB- denotes (
T8490 16834-16840 NNP denotes Buffer
T8489 16826-16833 NNP denotes Elution
T8488 16821-16825 NNP denotes ChIP
T8487 16818-16820 IN denotes in
T8486 16811-16817 VB denotes eluted
T8485 16807-16810 VB denotes was
T8484 16797-16806 NN denotes chromatin
T8483 16791-16796 VB denotes bound
T8482 16787-16790 DT denotes the
T8481 16785-16786 -COMMA- denotes ,
T8480 16779-16785 VB denotes washed
T8479 16774-16778 VB denotes were
T8478 16768-16773 NN denotes beads
T8477 16764-16767 DT denotes The
T8476 16761-16762 -RRB- denotes )
T8475 16752-16761 NNP denotes Millipore
T8474 16751-16752 -LRB- denotes (
T8473 16745-16750 NN denotes beads
T8472 16736-16744 JJ denotes magnetic
T8471 16729-16735 VB denotes coated
T8470 16727-16728 NN denotes G
T8469 16719-16726 NN denotes Protein
T8468 16714-16718 IN denotes with
T8467 16703-16713 NN denotes incubation
T8466 16697-16702 IN denotes after
T8465 16687-16696 VB denotes collected
T8464 16682-16686 VB denotes were
T8463 16673-16681 NN denotes products
T8462 16654-16672 VB denotes Immunoprecipitated
T8461 16651-16652 -RRB- denotes )
T8460 16642-16651 NN denotes Millipore
T8459 16641-16642 -LRB- denotes (
T8458 16640-16641 -RRB- denotes )
T8457 16634-16640 NN denotes CTD4H8
T8456 16628-16633 NN denotes Clone
T8455 16627-16628 -LRB- denotes (
T8454 16624-16626 CD denotes II
T8453 16613-16623 NN denotes polymerase
T8452 16609-16612 NN denotes RNA
T8451 16605-16608 CC denotes and
T8450 16603-16604 -RRB- denotes )
T8449 16588-16603 NNP denotes Biotechnologies
T8448 16583-16587 NNP denotes Cruz
T8447 16577-16582 NNP denotes Santa
T8446 16576-16577 -LRB- denotes (
T8445 16575-16576 -RRB- denotes )
T8444 16568-16575 NN denotes sc-2027
T8443 16567-16568 -LRB- denotes (
T8442 16563-16566 NN denotes IgG
T8441 16556-16562 NN denotes rabbit
T8440 16549-16555 JJ denotes normal
T8439 16547-16548 -COMMA- denotes ,
T8438 16546-16547 -RRB- denotes )
T8437 16537-16546 NN denotes sc-16993X
T8436 16536-16537 -LRB- denotes (
T8435 16534-16535 -RRB- denotes )
T8434 16530-16534 NN denotes T217
T8433 16529-16530 -LRB- denotes (
T8432 16519-16528 NN denotes p-C/EBP-β
T8431 16517-16518 -COMMA- denotes ,
T8430 16516-16517 -RRB- denotes )
T8429 16509-16516 NN denotes sc-150X
T8428 16508-16509 -LRB- denotes (
T8427 16500-16507 NN denotes C/EBP-β
T8426 16498-16499 -COLON- denotes :
T8425 16488-16498 NN denotes antibodies
T8424 16478-16487 JJ denotes following
T8423 16474-16477 DT denotes the
T8422 16471-16473 IN denotes of
T8421 16468-16470 NN denotes µg
T8420 16466-16467 CD denotes 1
T8419 16460-16465 JJ denotes least
T8418 16457-16459 IN denotes at
T8417 16452-16456 IN denotes with
T8416 16442-16451 RB denotes overnight
T8415 16438-16441 NN denotes 4°C
T8414 16435-16437 IN denotes at
T8413 16416-16434 VB denotes immunoprecipitated
T8412 16412-16415 VB denotes was
T8411 16402-16411 NN denotes chromatin
T8410 16399-16401 IN denotes of
T8409 16392-16398 NN denotes amount
T8408 16386-16391 JJ denotes equal
T8407 16383-16385 DT denotes An
T8406 16380-16381 -RRB- denotes )
T8405 16374-16380 NNP denotes Fisher
T8404 16373-16374 -LRB- denotes (
T8403 16360-16372 NN denotes Dismembrator
T8402 16354-16359 JJ denotes Sonic
T8401 16352-16353 DT denotes a
T8400 16346-16351 VB denotes using
T8399 16342-16345 NN denotes ice
T8398 16339-16341 IN denotes on
T8397 16329-16338 NN denotes intervals
T8396 16325-16328 NN denotes min
T8395 16323-16324 CD denotes 1
T8394 16318-16322 IN denotes with
T8393 16314-16317 NN denotes sec
T8392 16311-16313 CD denotes 15
T8391 16307-16310 IN denotes for
T8390 16301-16306 NN denotes times
T8389 16299-16300 CD denotes 5
T8388 16289-16298 VB denotes sonicated
T8387 16284-16288 VB denotes were
T8386 16276-16283 NN denotes lysates
T8385 16268-16275 JJ denotes Nuclear
T8384 16265-16266 -RRB- denotes )
T8383 16256-16265 NN denotes Millipore
T8382 16255-16256 -LRB- denotes (
T8381 16251-16254 NN denotes kit
T8380 16241-16250 JJ denotes available
T8379 16228-16240 RB denotes commercially
T8378 16226-16227 DT denotes a
T8377 16220-16225 VB denotes using
T8376 16211-16219 VB denotes prepared
T8375 16206-16210 VB denotes were
T8374 16197-16205 NN denotes extracts
T8373 16191-16196 NN denotes Cells
T8372 16186-16189 NN denotes ice
T8371 16183-16185 IN denotes on
T8354 16097-16100 IN denotes for
T8353 16089-16096 NN denotes glycine
T8352 16084-16088 IN denotes with
T8351 16071-16083 VB denotes neutralizing
T8350 16067-16070 CC denotes and
T8349 16063-16066 NN denotes min
T8348 16060-16062 CD denotes 10
T8347 16056-16059 IN denotes for
T8346 16044-16055 NN denotes temperature
T8345 16039-16043 NN denotes room
T8344 16036-16038 IN denotes at
T8343 16023-16035 NN denotes formaldehyde
T8342 16021-16022 NN denotes %
T8341 16020-16021 CD denotes 1
T8340 16015-16019 IN denotes with
T8339 16005-16014 NN denotes chromatin
T8338 16001-16004 DT denotes the
T8337 15988-16000 VB denotes crosslinking
T8336 15982-15987 IN denotes after
T8335 15980-15981 -COMMA- denotes ,
T8334 15973-15980 RB denotes Briefly
T8333 15958-15971 NN denotes modifications
T8332 15952-15957 JJ denotes minor
T8331 15947-15951 IN denotes with
T8330 15945-15946 -COMMA- denotes ,
T8329 15933-15945 NN denotes manufacturer
T8328 15929-15932 DT denotes the
T8327 15926-15928 IN denotes by
T8326 15914-15925 VB denotes recommended
T8325 15911-15913 IN denotes as
T8324 15909-15910 -COMMA- denotes ,
T8323 15908-15909 -RRB- denotes )
T8322 15899-15908 NN denotes Millipore
T8321 15898-15899 -LRB- denotes (
T8320 15894-15897 NN denotes kit
T8319 15882-15893 JJ denotes Magna-ChIP™
T8318 15872-15881 JJ denotes available
T8317 15859-15871 RB denotes commercially
T8316 15857-15858 DT denotes a
T8315 15851-15856 VB denotes using
T8314 15841-15850 VB denotes performed
T8313 15836-15840 VB denotes were
T8312 15829-15835 NN denotes assays
T8311 15824-15828 NN denotes ChIP
T8310 15818-15823 NN denotes Assay
T8309 15816-15817 -RRB- denotes )
T8308 15812-15816 NN denotes ChIP
T8307 15811-15812 -LRB- denotes (
T8306 15791-15810 NN denotes Immunoprecipitation
T8305 15781-15790 NN denotes Chromatin
T8010 15777-15778 -RRB- denotes )
T8009 15771-15777 NN denotes sc-158
T8008 15770-15771 -LRB- denotes (
T8007 15757-15769 JJ denotes anti-C/EBP-ε
T8006 15753-15756 CC denotes and
T8005 15751-15752 -RRB- denotes )
T8004 15745-15751 NN denotes sc-151
T8003 15744-15745 -LRB- denotes (
T8002 15731-15743 JJ denotes anti-C/EBP-δ
T8001 15729-15730 -COMMA- denotes ,
T8000 15728-15729 -RRB- denotes )
T7999 15722-15728 NN denotes sc-150
T7998 15721-15722 -LRB- denotes (
T7997 15708-15720 JJ denotes anti-C/EBP-β
T7996 15706-15707 -COMMA- denotes ,
T7995 15705-15706 -RRB- denotes )
T7994 15700-15705 NN denotes sc-61
T7993 15699-15700 -LRB- denotes (
T7992 15686-15698 JJ denotes anti-C/EBP-α
T7991 15684-15685 -COLON- denotes :
T7990 15680-15684 NNP denotes Cruz
T7989 15674-15679 NNP denotes Santa
T7988 15669-15673 IN denotes from
T7987 15659-15668 VB denotes purchased
T7986 15654-15658 VB denotes were
T7985 15643-15653 NN denotes Antibodies
T7984 15633-15641 NN denotes antibody
T7983 15627-15632 NN denotes C/EBP
T7982 15618-15626 JJ denotes specific
T7981 15615-15617 IN denotes of
T7980 15612-15614 NN denotes µg
T7979 15610-15611 CD denotes 4
T7978 15605-15609 IN denotes with
T7977 15601-15604 NN denotes ice
T7976 15598-15600 IN denotes on
T7975 15594-15597 NN denotes hrs
T7974 15592-15593 CD denotes 2
T7973 15578-15591 JJ denotes pre-incubated
T7972 15573-15577 VB denotes were
T7971 15564-15572 NN denotes extracts
T7970 15556-15563 JJ denotes nuclear
T7969 15554-15555 -COMMA- denotes ,
T7968 15548-15554 NN denotes assays
T7967 15537-15547 NN denotes supershift
T7966 15533-15536 IN denotes For
T7965 15525-15531 NN denotes 10V/cm
T7964 15522-15524 IN denotes at
T7963 15518-15521 NN denotes TBE
T7962 15515-15517 NN denotes 1x
T7961 15512-15514 IN denotes in
T7960 15510-15511 -RRB- denotes )
T7959 15509-15510 -RRB- denotes )
T7958 15502-15509 NN denotes Bio-Rad
T7957 15501-15502 -LRB- denotes (
T7956 15486-15500 NN denotes bis-acrylamide
T7955 15485-15486 -COLON- denotes :
T7954 15475-15485 NN denotes acrylamide
T7953 15470-15474 CD denotes 29∶1
T7952 15469-15470 -LRB- denotes (
T7951 15464-15468 NN denotes gels
T7950 15449-15463 NN denotes polyacrylamide
T7949 15447-15448 NN denotes %
T7948 15446-15447 CD denotes 5
T7947 15443-15445 IN denotes on
T7946 15431-15442 NN denotes temperature
T7945 15426-15430 NN denotes room
T7944 15423-15425 IN denotes at
T7943 15407-15422 NN denotes electrophoresis
T7942 15404-15406 IN denotes by
T7941 15395-15403 VB denotes resolved
T7940 15390-15394 VB denotes were
T7939 15381-15389 NN denotes products
T7938 15372-15380 NN denotes reaction
T7937 15364-15371 NN denotes Binding
T7936 15351-15362 NN denotes temperature
T7935 15346-15350 NN denotes room
T7934 15343-15345 IN denotes at
T7933 15335-15342 NN denotes minutes
T7932 15332-15334 CD denotes 20
T7931 15328-15331 IN denotes for
T7930 15318-15327 VB denotes performed
T7929 15313-15317 VB denotes were
T7928 15307-15312 NN denotes probe
T7927 15293-15306 VB denotes radiolabelled
T7926 15290-15292 IN denotes of
T7925 15288-15289 -RRB- denotes )
T7924 15286-15288 NN denotes ng
T7923 15282-15285 CD denotes 0.2
T7922 15279-15281 TO denotes to
T7921 15274-15278 CD denotes 0.05
T7920 15273-15274 -LRB- denotes (
T7919 15269-15272 NN denotes cpm
T7918 15262-15268 CD denotes 20,000
T8370 16173-16182 VB denotes collected
T8369 16169-16172 CC denotes and
T8368 16161-16168 VB denotes scraped
T8367 16159-16160 -COMMA- denotes ,
T8366 16156-16159 NNP denotes PBS
T8365 16151-16155 JJ denotes cold
T8364 16146-16150 IN denotes with
T8363 16139-16145 VB denotes washed
T8362 16134-16138 VB denotes were
T8361 16128-16133 NN denotes cells
T8360 16126-16127 -COMMA- denotes ,
T8359 16115-16126 NN denotes temperature
T8358 16110-16114 NN denotes room
T8357 16107-16109 IN denotes at
T8356 16103-16106 NN denotes min
T8355 16101-16102 CD denotes 5
T7917 15259-15261 TO denotes to
T7916 15252-15258 CD denotes 10,000
T7915 15248-15251 CC denotes and
T7914 15239-15247 NN denotes extracts
T7913 15231-15238 JJ denotes nuclear
T7912 15228-15230 IN denotes of
T7911 15225-15227 NN denotes µg
T7910 15223-15224 CD denotes 6
T7909 15221-15222 -COMMA- denotes ,
T7908 15220-15221 -RRB- denotes )
T7907 15215-15220 NN denotes dI-dC
T7906 15214-15215 -LRB- denotes (
T7905 15209-15213 NN denotes poly
T7904 15206-15208 NN denotes µg
T7903 15204-15205 CD denotes 1
T7902 15202-15203 -COMMA- denotes ,
T7901 15192-15202 NN denotes Ficoll-400
T7900 15190-15191 NN denotes %
T7899 15188-15190 CD denotes 20
T7898 15186-15187 -COMMA- denotes ,
T7897 15178-15186 NN denotes glycerol
T7896 15176-15177 NN denotes %
T7895 15174-15176 CD denotes 30
T7894 15172-15173 -COMMA- denotes ,
T7893 15169-15172 NN denotes DTT
T7892 15166-15168 NN denotes mM
T7456 14830-14834 NN denotes blot
T7455 14822-14829 JJ denotes western
T7454 14819-14821 IN denotes by
T7453 14808-14818 NN denotes expression
T7452 14802-14807 JJ denotes equal
T7451 14798-14801 IN denotes for
T7450 14790-14797 VB denotes checked
T7449 14786-14789 VB denotes was
T7448 14777-14785 NN denotes proteins
T7447 14770-14776 JJ denotes mutant
T7446 14753-14769 NN denotes phospho-acceptor
T7445 14745-14752 NN denotes C/EBP-β
T7444 14741-14744 DT denotes the
T7443 14738-14740 IN denotes of
T7442 14727-14737 NN denotes Expression
T7441 14719-14725 NN denotes sample
T7440 14714-14718 DT denotes each
T7439 14710-14713 IN denotes for
T7438 14701-14709 VB denotes employed
T7437 14696-14700 VB denotes were
T7436 14688-14695 NN denotes samples
T7435 14677-14687 VB denotes triplicate
T7434 14673-14676 CC denotes and
T7433 14671-14672 -COMMA- denotes ,
T7432 14666-14671 NN denotes times
T7431 14660-14665 CD denotes three
T7430 14654-14659 JJ denotes least
T7429 14651-14653 IN denotes at
T7428 14642-14650 VB denotes repeated
T7427 14638-14641 VB denotes was
T7426 14627-14637 NN denotes experiment
T7425 14622-14626 DT denotes Each
T7424 14619-14620 -RRB- denotes )
T7423 14612-14619 NNP denotes Promega
T7422 14611-14612 -LRB- denotes (
T7421 14598-14610 RB denotes respectively
T7420 14596-14597 -COMMA- denotes ,
T7419 14592-14596 NNP denotes Kits
T7418 14585-14591 NNP denotes System
T7417 14579-14584 NNP denotes Assay
T7416 14572-14578 NNP denotes Enzyme
T7415 14556-14571 NNP denotes β-Galactosidase
T7414 14552-14555 CC denotes and
T7413 14545-14551 NNP denotes System
T7891 15164-15165 CD denotes 2
T7890 15162-15163 -COMMA- denotes ,
T7889 15159-15162 NNP denotes BSA
T7888 15153-15158 NN denotes µg/ml
T7887 15150-15152 CD denotes 10
T7886 15148-15149 -COMMA- denotes ,
T7885 15145-15148 CD denotes 7.9
T7884 15142-15144 NN denotes pH
T7883 15136-15141 NN denotes HEPES
T7882 15133-15135 NN denotes mM
T7881 15130-15132 CD denotes 10
T7880 15119-15129 VB denotes containing
T7879 15117-15118 -RRB- denotes )
T7878 15115-15117 NN denotes µl
T7877 15112-15114 CD denotes 25
T7876 15111-15112 -LRB- denotes (
T7875 15101-15110 NN denotes reactions
T7874 15093-15100 NN denotes binding
T7873 15089-15092 NN denotes DNA
T7872 15086-15087 -RRB- denotes ]
T7871 15084-15086 CD denotes 41
T7870 15083-15084 -LRB- denotes [
T7869 15076-15082 NN denotes method
T7868 15070-15075 NN denotes lysis
T7867 15060-15069 JJ denotes detergent
T7866 15056-15059 DT denotes the
T7865 15053-15055 IN denotes by
T7864 15044-15052 VB denotes prepared
T7863 15039-15043 VB denotes were
T7862 15030-15038 NN denotes extracts
T7861 15022-15029 JJ denotes nuclear
T7860 15016-15021 CD denotes 264.7
T7859 15012-15015 NN denotes RAW
T7858 15006-15010 NN denotes -ATP
T7857 15005-15006 -RRB- denotes ]
T7856 15000-15005 NN denotes γ-32P
T7855 14999-15000 -LRB- denotes [
T7854 14995-14998 CC denotes and
T7853 14988-14994 NN denotes kinase
T7852 14973-14987 NN denotes polynucleotide
T7851 14970-14972 NN denotes T4
T7850 14964-14969 VB denotes using
T7849 14955-14963 VB denotes prepared
T7848 14950-14954 VB denotes were
T7847 14943-14949 NN denotes assays
T7846 14937-14942 NN denotes shift
T7845 14933-14936 NN denotes gel
T7844 14929-14932 IN denotes for
T7843 14922-14928 NN denotes probes
T7842 14906-14921 NN denotes oligonucleotide
T7841 14890-14905 JJ denotes double-stranded
T7840 14888-14889 -COMMA- denotes ,
T7839 14875-14888 VB denotes Radiolabelled
T7838 14868-14874 NN denotes Assays
T7837 14862-14867 NN denotes Shift
T7836 14853-14861 NN denotes Mobility
T7835 14837-14852 JJ denotes Electrophoretic
T7412 14539-14544 NNP denotes Assay
T7411 14528-14538 NNP denotes Luciferase
T7410 14524-14527 DT denotes the
T7409 14518-14523 VB denotes using
T7408 14516-14517 -RRB- denotes ]
T7407 14514-14516 CD denotes 38
T7406 14513-14514 -LRB- denotes [
T7405 14497-14512 NN denotes β-galactosidase
T7404 14494-14496 IN denotes of
T7403 14489-14493 DT denotes that
T7402 14486-14488 TO denotes to
T7401 14475-14485 VB denotes normalized
T7400 14471-14474 CC denotes and
T7399 14460-14470 VB denotes determined
T7398 14456-14459 VB denotes was
T7397 14447-14455 NN denotes activity
T7396 14436-14446 NN denotes Luciferase
T7395 14433-14434 -RRB- denotes )
T7394 14430-14433 NN denotes DNA
T7393 14424-14429 JJ denotes total
T7392 14421-14423 NN denotes µg
T7391 14413-14420 CD denotes 0.6–1.0
T7390 14412-14413 -LRB- denotes (
T7389 14397-14411 VB denotes co-transfected
T7388 14392-14396 VB denotes were
T7387 14385-14391 NN denotes vector
T6863 13781-13789 NN denotes analysis
T6862 13776-13780 NN denotes blot
T6861 13768-13775 JJ denotes western
T6860 13765-13767 IN denotes by
T6859 13755-13764 VB denotes confirmed
T6858 13751-13754 VB denotes was
T6857 13741-13750 NN denotes knockdown
T6856 13733-13740 NN denotes C/EBP-β
T6855 13722-13731 NN denotes knockdown
T6854 13717-13721 NN denotes gene
T6853 13707-13716 JJ denotes effective
T6852 13703-13706 IN denotes for
T6851 13697-13702 VB denotes allow
T6850 13694-13696 TO denotes to
T6849 13690-13693 NN denotes hrs
T6848 13687-13689 CD denotes 72
T6847 13683-13686 IN denotes for
T6846 13675-13682 RB denotes further
T6845 13665-13674 VB denotes incubated
T6844 13661-13664 CC denotes and
T6843 13655-13660 NN denotes media
T6842 13648-13654 NN denotes growth
T6841 13642-13647 JJ denotes fresh
T6840 13637-13641 IN denotes with
T6839 13628-13636 VB denotes replaced
T6838 13624-13627 VB denotes was
T6837 13612-13623 NN denotes supernatant
T6836 13601-13611 JJ denotes lentiviral
T6835 13597-13600 DT denotes The
T6834 13592-13595 NN denotes hrs
T6833 13589-13591 CD denotes 24
T6832 13585-13588 IN denotes for
T6831 13583-13584 -RRB- denotes )
T6830 13570-13583 NNP denotes Bioanalytical
T6829 13561-13569 NNP denotes American
T6828 13560-13561 -LRB- denotes (
T6827 13550-13559 NN denotes Polybrene
T6826 13544-13549 NN denotes µg/ml
T6825 13542-13543 CD denotes 8
T6824 13538-13541 CC denotes and
T6823 13526-13537 NN denotes supernatant
T6822 13515-13525 JJ denotes lentiviral
T6821 13511-13514 DT denotes the
T6820 13506-13510 IN denotes with
T6819 13498-13505 VB denotes treated
T6818 13493-13497 VB denotes were
T6817 13487-13492 NN denotes cells
T6816 13480-13486 NN denotes target
T6815 13476-13479 DT denotes The
T6814 13468-13474 NN denotes filter
T6813 13465-13467 NN denotes µm
T6812 13460-13464 CD denotes 0.45
T6811 13458-13459 DT denotes a
T6810 13450-13457 IN denotes through
T7386 14377-14384 NN denotes control
T7385 14374-14376 CC denotes or
T7384 14372-14373 -RRB- denotes ]
T7383 14370-14372 CD denotes 40
T7382 14369-14370 -LRB- denotes [
T7381 14368-14369 CD denotes –
T7380 14367-14368 -RRB- denotes ]
T7379 14365-14367 CD denotes 38
T7378 14364-14365 -LRB- denotes [
T7377 14362-14363 -RRB- denotes )
T7376 14358-14362 NN denotes S64A
T7375 14356-14357 -COMMA- denotes ,
T7374 14351-14356 NN denotes T217A
T7373 14349-14350 -COMMA- denotes ,
T7372 14344-14349 NN denotes T188A
T7371 14343-14344 -LRB- denotes (
T7370 14335-14342 NN denotes mutants
T7369 14318-14334 NN denotes phospho-acceptor
T7368 14310-14317 JJ denotes C/EBP-β
T7367 14307-14309 CC denotes or
T7366 14299-14306 NN denotes C/EBP-β
T7365 14290-14298 VB denotes encoding
T7364 14281-14289 NN denotes plasmids
T7363 14279-14280 -COMMA- denotes ,
T7362 14268-14279 NN denotes experiments
T7361 14263-14267 DT denotes some
T7360 14260-14262 IN denotes In
T7359 14249-14258 VB denotes indicated
T7358 14243-14248 WRB denotes where
T7357 14239-14242 NN denotes hrs
T7356 14237-14238 CD denotes 4
T7355 14233-14236 IN denotes for
T7354 14231-14232 -RRB- denotes )
T7353 14226-14231 NN denotes ng/ml
T7352 14222-14225 CD denotes 100
T7351 14221-14222 -LRB- denotes (
T7350 14217-14220 NN denotes LPS
T7349 14212-14216 IN denotes with
T7348 14201-14211 NN denotes incubation
T7347 14198-14200 TO denotes to
T7346 14192-14197 RB denotes prior
T7345 14188-14191 NN denotes hrs
T7344 14185-14187 CD denotes 48
T7343 14181-14184 IN denotes for
T7342 14171-14180 VB denotes incubated
T7341 14167-14170 CC denotes and
T7340 14160-14166 VB denotes plates
T7339 14155-14159 RB denotes well
T7338 14152-14154 CD denotes 24
T7337 14149-14151 IN denotes in
T7336 14143-14148 NN denotes media
T7335 14132-14142 JJ denotes pre-warmed
T7334 14129-14131 TO denotes to
T7333 14117-14128 VB denotes transferred
T7332 14112-14116 VB denotes were
T7331 14106-14111 NN denotes cells
T7330 14094-14105 VB denotes Transfected
T7329 14091-14092 -RRB- denotes )
T7328 14087-14091 NN denotes msec
T7327 14084-14086 CD denotes 30
T7326 14082-14083 -COMMA- denotes ,
T7325 14081-14082 NN denotes V
T7324 14076-14080 CD denotes 1350
T7323 14074-14075 -COMMA- denotes ,
T7322 14069-14074 NN denotes pulse
T7321 14067-14068 CD denotes 1
T7320 14066-14067 -LRB- denotes (
T7319 14059-14065 NN denotes system
T7318 14053-14058 NNP denotes Neon™
T7317 14042-14052 NNP denotes Invitrogen
T7316 14038-14041 DT denotes the
T7315 14032-14037 VB denotes using
T7314 14016-14031 NN denotes electroporation
T7313 14013-14015 IN denotes by
T7312 14011-14012 -RRB- denotes )
T7311 14009-14011 NN denotes ng
T7310 14005-14008 CD denotes 200
T7309 14004-14005 -LRB- denotes (
T7308 13996-14003 NN denotes plasmid
T7307 13987-13995 NN denotes reporter
T7306 13963-13986 JJ denotes β-actin-β-galactosidase
T7305 13961-13962 DT denotes a
T7304 13956-13960 IN denotes with
T7303 13950-13955 IN denotes along
T7302 13948-13949 -RRB- denotes )
T7301 13946-13948 NN denotes ng
T7300 13942-13945 CD denotes 400
T7299 13941-13942 -LRB- denotes (
T7298 13933-13940 NN denotes plasmid
T7297 13924-13932 NN denotes reporter
T7296 13913-13923 NN denotes luciferase
T7295 13903-13912 VB denotes indicated
T7294 13899-13902 DT denotes the
T7293 13894-13898 IN denotes with
T7292 13882-13893 VB denotes transfected
T7291 13877-13881 VB denotes were
T7290 13875-13876 -RRB- denotes ]
T7289 13873-13875 CD denotes 34
T7288 13872-13873 -LRB- denotes [
T7287 13870-13871 -RRB- denotes )
T7286 13865-13870 CD denotes 1×105
T7285 13864-13865 -LRB- denotes (
T7284 13859-13863 NN denotes MEFs
T7283 13849-13858 NN denotes Cebpb −/−
T7282 13847-13848 -RRB- denotes )
T7281 13842-13847 NN denotes Cells
T7280 13838-13841 NN denotes MEF
T7279 11318-11319 -LRB- denotes (
T7278 11311-11317 NN denotes Assays
T7277 11300-11310 NN denotes Luciferase
T7276 11296-11299 CC denotes and
T7275 11283-11295 NN denotes Transfection
T7274 11273-11282 JJ denotes Transient
T6809 13443-13449 VB denotes passed
T6808 13439-13442 CC denotes and
T6807 13434-13438 NN denotes mins
T6806 13431-13433 CD denotes 10
T6805 13427-13430 IN denotes for
T6804 13425-13426 NN denotes g
T6803 13419-13424 CD denotes 2,000
T6802 13416-13418 IN denotes at
T6801 13401-13415 NN denotes centrifugation
T6800 13398-13400 IN denotes by
T6799 13390-13397 VB denotes cleared
T6798 13388-13389 -COMMA- denotes ,
T6797 13376-13388 NN denotes transfection
T6796 13370-13375 IN denotes after
T6795 13366-13369 NN denotes hrs
T6794 13363-13365 CD denotes 48
T6793 13353-13362 VB denotes collected
T6792 13349-13352 VB denotes was
T6791 13337-13348 NN denotes supernatant
T6790 13326-13336 JJ denotes lentiviral
T6789 13322-13325 DT denotes The
T6788 13319-13320 -RRB- denotes )
T6787 13309-13319 NN denotes Invitrogen
T6786 13308-13309 -LRB- denotes (
T6785 13300-13307 NN denotes reagent
T6784 13295-13299 CD denotes 2000
T6686 12740-12745 NN denotes cebpb
T6685 12734-12739 NN denotes mouse
T6684 12730-12733 CC denotes and
T6683 12724-12729 JJ denotes human
T6682 12720-12723 IN denotes for
T6681 12711-12719 JJ denotes specific
T6680 12709-12710 -RRB- denotes )
T6679 12704-12709 NN denotes shRNA
T6678 12703-12704 -LRB- denotes (
T6677 12698-12702 NN denotes RNAs
T6676 12690-12697 NN denotes hairpin
T6675 12684-12689 JJ denotes short
T6674 12675-12683 VB denotes carrying
T6673 12667-12674 NN denotes vectors
T6672 12656-12666 NN denotes lentiviral
T6671 12644-12655 NN denotes pLKO.1-puro
T6670 12631-12643 NN denotes Transduction
T6669 12627-12630 CC denotes and
T6668 12617-12626 NN denotes Packaging
T6667 12615-12616 -COMMA- denotes ,
T6666 12609-12615 NN denotes shRNAs
T6665 12598-12608 JJ denotes Lentiviral
T6783 13281-13294 NN denotes Lipofectamine
T6782 13275-13280 VB denotes using
T6781 13273-13274 -RRB- denotes )
T6780 13271-13273 NN denotes µg
T6779 13266-13270 CD denotes 0.25
T6778 13265-13266 -LRB- denotes (
T6777 13257-13264 NN denotes plasmid
T6776 13248-13256 NN denotes envelope
T6775 13237-13247 NN denotes pCMV-VSV-G
T6774 13233-13236 CC denotes and
T6773 13231-13232 -COMMA- denotes ,
T6772 13230-13231 -RRB- denotes )
T6771 13228-13230 NN denotes µg
T6770 13223-13227 CD denotes 0.75
T6769 13222-13223 -LRB- denotes (
T6768 13214-13221 NN denotes plasmid
T6767 13204-13213 NN denotes packaging
T6766 13189-13203 NN denotes pCMV-ΔR8.2dvpr
T6765 13187-13188 -COMMA- denotes ,
T6764 13186-13187 -RRB- denotes )
T6763 13184-13186 NN denotes µg
T6762 13182-13183 CD denotes 1
T6761 13181-13182 -LRB- denotes (
T6760 13173-13180 NN denotes plasmid
T6759 13162-13172 NN denotes expression
T6758 13156-13161 NN denotes shRNA
T6757 13151-13155 DT denotes each
T6756 13149-13150 -COLON- denotes :
T6755 13141-13149 NN denotes plasmids
T6754 13138-13140 IN denotes of
T6753 13130-13137 NN denotes mixture
T6752 13128-13129 DT denotes a
T6751 13123-13127 IN denotes with
T6750 13111-13122 VB denotes transfected
T6749 13106-13110 VB denotes were
T6748 13100-13105 NN denotes cells
T6747 13091-13099 NN denotes HEK-293T
T6746 13089-13090 -COMMA- denotes ,
T6745 13080-13089 NN denotes particles
T6744 13069-13079 JJ denotes lentiviral
T6743 13061-13068 VB denotes produce
T6742 13058-13060 TO denotes To
T6741 13055-13056 -RRB- denotes ]
T6740 13053-13055 CD denotes 38
T6739 13052-13053 -LRB- denotes [
T6738 13049-13051 IN denotes in
T6737 13046-13048 IN denotes as
T6736 13034-13045 NN denotes experiments
T6735 13028-13033 DT denotes these
T6734 13025-13027 IN denotes in
T6733 13017-13024 NN denotes control
T6732 13015-13016 DT denotes a
T6731 13012-13014 IN denotes as
T6730 13006-13011 NN denotes shRNA
T6729 13000-13005 NN denotes CEBPB
T6728 12994-12999 JJ denotes human
T6727 12990-12993 DT denotes the
T6726 12985-12989 VB denotes used
T6725 12982-12984 PRP denotes we
T6724 12972-12981 RB denotes therefore
T6723 12970-12971 -COLON- denotes ;
T6722 12963-12970 NN denotes species
T6721 12957-12962 JJ denotes other
T6720 12953-12956 DT denotes the
T6719 12950-12952 IN denotes of
T6718 12944-12949 NN denotes cells
T6717 12941-12943 IN denotes on
T6716 12936-12940 VB denotes used
T6715 12931-12935 WRB denotes when
T6714 12923-12930 NN denotes C/EBP-β
T6713 12912-12922 JJ denotes endogenous
T6712 12909-12911 IN denotes of
T6711 12898-12908 NN denotes expression
T6710 12888-12897 VB denotes knockdown
T6709 12884-12887 RB denotes not
T6708 12881-12884 MD denotes can
T6707 12874-12880 NN denotes shRNAs
T6706 12857-12873 JJ denotes species-specific
T6705 12851-12856 DT denotes these
T6704 12849-12850 -COMMA- denotes ,
T6703 12840-12849 JJ denotes identical
T6702 12836-12839 RB denotes not
T6701 12832-12835 VB denotes are
T6700 12824-12831 NN denotes regions
T6699 12811-12823 JJ denotes untranslated
T6698 12808-12810 CD denotes 3′
T6697 12802-12807 NN denotes cebpb
T6696 12796-12801 NN denotes mouse
T6695 12792-12795 CC denotes and
T6694 12786-12791 JJ denotes human
T6693 12782-12785 DT denotes the
T6692 12774-12781 IN denotes Because
T6691 12765-12772 NN denotes studies
T6690 12759-12764 DT denotes these
T6689 12756-12758 IN denotes in
T6688 12751-12755 VB denotes used
T6687 12746-12750 VB denotes were
T6246 12588-12595 NN denotes reagent
T6245 12577-12587 NN denotes microassay
T6244 12569-12576 NN denotes protein
T6243 12561-12568 JJ denotes Bio-Rad
T6242 12557-12560 DT denotes the
T6241 12551-12556 VB denotes using
T6240 12540-12550 VB denotes determined
T6239 12536-12539 VB denotes was
T6238 12522-12535 NN denotes concentration
T6237 12514-12521 NN denotes Protein
T6236 12511-12512 -RRB- denotes )
T6225 12428-12435 NN denotes protein
T6224 12419-12427 JJ denotes cellular
T6223 12416-12418 TO denotes to
T6222 12413-12415 CC denotes or
T6221 12407-12412 NN denotes units
T6220 12401-12406 JJ denotes light
T6219 12390-12400 NN denotes luciferase
T6218 12382-12389 NN denotes renilla
T6217 12375-12381 NN denotes pRL-TK
T6216 12372-12374 TO denotes to
T6215 12365-12371 CC denotes either
T6214 12354-12364 VB denotes normalized
T6213 12348-12353 NN denotes units
T6212 12342-12347 JJ denotes light
T6211 12331-12341 NN denotes luciferase
T6210 12323-12330 JJ denotes firefly
T6209 12320-12322 IN denotes of
T6208 12313-12319 NN denotes number
T6207 12309-12312 DT denotes the
T6206 12306-12308 IN denotes as
T6205 12296-12305 VB denotes expressed
T6204 12293-12295 VB denotes is
T6203 12284-12292 NN denotes activity
T6202 12275-12283 NN denotes Promoter
T6201 12262-12273 NN denotes experiments
T6200 12250-12261 JJ denotes independent
T6199 12244-12249 CD denotes three
T6198 12238-12243 JJ denotes least
T6197 12235-12237 IN denotes at
T6196 12232-12234 IN denotes of
T6195 12224-12231 NN denotes results
T6194 12220-12223 DT denotes the
T6193 12210-12219 VB denotes represent
T6192 12197-12209 NN denotes Measurements
T6191 12194-12195 -RRB- denotes )
T6190 12187-12194 NN denotes Promega
T6189 12186-12187 -LRB- denotes (
T6188 12182-12185 NN denotes kit
T6187 12175-12181 NN denotes System
T6186 12169-12174 NNP denotes Assay
T6185 12160-12168 NNP denotes Reporter
T6184 12144-12159 NNP denotes Dual-Luciferase
T6183 12142-12143 DT denotes a
T6182 12136-12141 VB denotes using
T6181 12127-12135 VB denotes measured
T6180 12123-12126 VB denotes was
T6179 12114-12122 NN denotes activity
T6178 12103-12113 NN denotes Luciferase
T6177 12098-12101 NN denotes LPS
T6176 12092-12097 NN denotes ng/ml
T6175 12088-12091 CD denotes 100
T6174 12085-12087 IN denotes of
T6173 12077-12084 NN denotes absence
T6172 12074-12076 CC denotes or
T6171 12065-12073 NN denotes presence
T6170 12061-12064 DT denotes the
T6169 12058-12060 IN denotes in
T6168 12051-12057 CC denotes either
T6167 12046-12050 NN denotes 37°C
T6166 12043-12045 IN denotes at
T6165 12032-12042 NN denotes atmosphere
T6164 12028-12031 NN denotes air
T6163 12017-12027 VB denotes humidified
T6162 12015-12016 NN denotes %
T6161 12013-12015 CD denotes 95
T6160 12009-12012 CC denotes and
T6159 12005-12008 NN denotes CO2
T6158 12003-12004 NN denotes %
T6157 12002-12003 CD denotes 5
T6156 12000-12001 DT denotes a
T6155 11997-11999 IN denotes in
T6154 11993-11996 NN denotes hrs
T6153 11990-11992 CD denotes 16
T6152 11980-11989 VB denotes incubated
T6151 11976-11979 CC denotes and
T6150 11970-11975 NN denotes pools
T6149 11965-11969 NN denotes cell
T6148 11955-11964 JJ denotes identical
T6147 11951-11954 CD denotes two
T6146 11946-11950 IN denotes into
T6145 11938-11945 VB denotes divided
T6144 11936-11937 -COMMA- denotes ,
T6143 11930-11936 NN denotes plates
T6142 11922-11929 NN denotes culture
T6141 11915-11921 NN denotes tissue
T6140 11908-11914 JJ denotes 6-well
T6139 11905-11907 IN denotes in
T6138 11899-11904 NN denotes media
T6137 11888-11898 JJ denotes pre-warmed
T6136 11885-11887 IN denotes of
T6135 11882-11884 NN denotes ml
T6134 11879-11881 CD denotes 10
T6133 11876-11878 TO denotes to
T6132 11864-11875 VB denotes transferred
T6131 11859-11863 VB denotes were
T6130 11853-11858 NN denotes cells
T6129 11841-11852 VB denotes Transfected
T6128 11805-11815 NN denotes r promoter
T6127 11797-11805 NN denotes ndard fo
T6126 11794-11797 CC denotes sta
T6125 11785-11793 NN denotes internal
T6124 11782-11785 IN denotes an
T6123 11773-11781 NN denotes , and as
T6122 11765-11773 JJ denotes ficiency
T6121 11763-11765 DT denotes ef
T6120 11760-11762 IN denotes on
T6119 11757-11760 CC denotes cti
T6118 11756-11757 -COMMA- denotes e
T6117 11746-11756 NN denotes for transf
T6116 11734-11746 NN denotes ive control
T6115 11731-11734 IN denotes sit
T6114 11724-11731 NN denotes as a po
T6113 11715-11723 JJ denotes included
T6112 11713-11714 DT denotes s
T6111 11711-11713 IN denotes wa
T6110 11703-11711 VB denotes nhancer
T6109 11700-11703 VB denotes d e
T6108 11692-11700 NN denotes moter an
T6107 11689-11692 CC denotes pro
T6106 11680-11688 NN denotes the SV40
T6105 11676-11680 NN denotes des
T6104 11673-11676 DT denotes nco
T6103 11666-11673 VB denotes which e
T6102 11661-11666 WDT denotes smid
T6101 11654-11661 NN denotes rol pla
T6100 11647-11654 NN denotes L3 cont
T6099 11643-11647 NN denotes . pG
T6098 11642-11643 -RRB- denotes )
T6097 11639-11642 NNP denotes µFd
T6096 11635-11638 CD denotes 960
T6095 11633-11634 -COMMA- denotes ,
T6094 11631-11633 NN denotes kV
T6093 11626-11630 CD denotes 0.25
T6092 11625-11626 -LRB- denotes (
T6091 11616-11624 NNP denotes Extender
T6090 11604-11615 NNP denotes Capacitance
T6089 11602-11603 DT denotes a
T6088 11597-11601 IN denotes with
T6087 11590-11596 NNP denotes Pulser
T6086 11585-11589 NNP denotes Gene
T6085 11577-11584 NNP denotes Bio-Rad
T6084 11575-11576 DT denotes a
T6083 11569-11574 VB denotes using
T6082 11553-11568 NN denotes electroporation
T6081 11550-11552 IN denotes by
T6080 11548-11549 -RRB- denotes )
T6079 11546-11548 NN denotes µg
T6078 11544-11545 CD denotes 2
T6077 11543-11544 -LRB- denotes (
T6076 11535-11542 NN denotes plasmid
T6075 11526-11534 NN denotes reporter
T6074 11518-11525 NN denotes control
T6073 11509-11517 JJ denotes internal
T6072 11507-11508 -RRB- denotes )
T6071 11500-11507 NN denotes Promega
T6070 11499-11500 -LRB- denotes (
T6069 11497-11498 -RRB- denotes )
T6068 11495-11497 NN denotes TK
T6067 11494-11495 -LRB- denotes (
T6066 11487-11493 NN denotes kinase
T6065 11473-11486 NN denotes pRL-thymidine
T6064 11469-11472 DT denotes the
T6063 11464-11468 IN denotes with
T6062 11458-11463 IN denotes along
T6061 11456-11457 -RRB- denotes )
T6060 11454-11456 NN denotes µg
T6059 11451-11453 CD denotes 20
T6058 11450-11451 -LRB- denotes (
T6057 11442-11449 NN denotes plasmid
T6056 11433-11441 NN denotes reporter
T6055 11422-11432 NN denotes luciferase
T6054 11412-11421 VB denotes indicated
T6053 11408-11411 DT denotes the
T6052 11403-11407 IN denotes with
T6051 11391-11402 VB denotes transfected
T6050 11386-11390 VB denotes were
T6049 11380-11385 NN denotes phase
T6048 11376-11379 NN denotes log
T6047 11373-11375 IN denotes in
T6046 11365-11372 VB denotes growing
T6045 11363-11364 -RRB- denotes )
T6044 11358-11363 CD denotes 2×107
T6043 11357-11358 -LRB- denotes (
T6042 11351-11356 NN denotes cells
T6041 11345-11350 CD denotes 264.7
T6040 11341-11344 NN denotes RAW
T6039 11339-11340 -RRB- denotes )
T6038 11328-11339 NN denotes Macrophages
T6037 11319-11327 NN denotes RAW264.7
T6036 11318-11319 -LRB- denotes (
T6035 11311-11317 NN denotes Assays
T6034 11300-11310 NN denotes Luciferase
T6033 11296-11299 CC denotes and
T6032 11283-11295 NN denotes Transfection
T6031 11273-11282 JJ denotes Transient
T6235 12503-12511 NN denotes activity
T6234 12496-12502 NN denotes pRL-TK
T6233 12487-12495 VB denotes affected
T6232 12483-12486 NN denotes LPS
T6231 12480-12482 CC denotes or
T6230 12472-12479 NN denotes C/EBP-β
T6229 12457-12471 VB denotes co-transfected
T6228 12451-12456 WRB denotes where
T6227 12450-12451 -LRB- denotes (
T6226 12436-12449 NN denotes concentration
T5100 10648-10660 NN denotes mPAI2mOct-2a
T5099 10646-10647 -COLON- denotes :
T5098 10633-10646 NN denotes pGLmP-539mOct
T5097 10631-10632 -COLON- denotes ;
T5096 10620-10631 NN denotes mPAI2mPU.1b
T5095 10616-10619 CC denotes and
T5094 10604-10615 NN denotes mPAI2mPU.1a
T5093 10602-10603 -COLON- denotes :
T5092 10588-10602 NN denotes pGLmP-539mPU.1
T5091 10586-10587 -COLON- denotes ;
T5090 10575-10586 NN denotes mPAI2mEboxb
T5089 10571-10574 CC denotes and
T5088 10559-10570 NN denotes mPAI2mEboxa
T5087 10557-10558 -COLON- denotes :
T5086 10543-10557 NN denotes pGLmP-539mEbox
T5085 10541-10542 -COLON- denotes :
T5084 10534-10541 VB denotes follows
T5083 10531-10533 IN denotes as
T5082 10526-10530 VB denotes used
T5081 10521-10525 VB denotes were
T5080 10517-10520 CC denotes and
T5079 10515-10516 -COMMA- denotes ,
T5078 10513-10515 NN denotes S1
T5077 10508-10512 NNP denotes Fig.
T5076 10505-10507 IN denotes in
T5075 10496-10504 VB denotes provided
T5074 10492-10495 VB denotes are
T5073 10482-10491 NN denotes sequences
T5072 10475-10481 NN denotes primer
T5071 10471-10474 NN denotes PCR
T5070 10455-10470 NN denotes oligonucleotide
T5069 10448-10454 JJ denotes mutant
T5068 10444-10447 DT denotes The
T5067 10441-10442 -RRB- denotes ]
T5066 10439-10441 CD denotes 36
T5065 10438-10439 -LRB- denotes [
T5064 10428-10437 VB denotes described
T5063 10425-10427 IN denotes as
T5062 10415-10424 VB denotes generated
T5061 10410-10414 VB denotes were
T5060 10408-10409 -RRB- denotes )
T5059 10396-10408 RB denotes respectively
T5058 10380-10395 NN denotes pGLmP-539mC/EBP
T5057 10376-10379 CC denotes and
T5056 10362-10375 NN denotes pGLmP-539mOct
T5055 10360-10361 -COMMA- denotes ,
T5054 10346-10360 NN denotes pGLmP-539mPU.1
T5053 10344-10345 -COMMA- denotes ,
T5052 10330-10344 NN denotes pGLmP-539mEbox
T5051 10329-10330 -LRB- denotes (
T5050 10323-10328 NN denotes C/EBP
T5049 10319-10322 CC denotes and
T5048 10313-10318 NN denotes Oct-1
T5047 10311-10312 -COMMA- denotes ,
T5046 10307-10311 NN denotes PU.1
T5045 10305-10306 -COMMA- denotes ,
T5044 10302-10305 NN denotes box
T5043 10300-10301 NN denotes E
T5042 10292-10299 NN denotes regions
T5041 10277-10291 JJ denotes LPS-responsive
T5040 10268-10276 NN denotes promoter
T5039 10259-10267 NN denotes SerpinB2
T5038 10255-10258 DT denotes the
T5037 10252-10254 IN denotes in
T5036 10242-10251 NN denotes mutations
T5035 10231-10241 VB denotes containing
T5034 10220-10230 NN denotes constructs
T5033 10211-10219 NN denotes reporter
T5032 10200-10210 NN denotes Luciferase
T5031 10197-10198 -RRB- denotes )
T5030 10190-10197 NNP denotes Promega
T5029 10189-10190 -LRB- denotes (
T5028 10183-10188 JJ denotes Basic
T5027 10178-10182 NN denotes pGL3
T5026 10174-10177 VB denotes was
T5025 10167-10173 NN denotes vector
T5024 10161-10166 JJ denotes empty
T5023 10153-10160 NN denotes control
T5022 10149-10152 DT denotes The
T5021 10139-10147 NN denotes pGLmP-87
T5020 10131-10138 VB denotes produce
T5019 10128-10130 TO denotes to
T5018 10122-10127 JJ denotes Basic
T5017 10117-10121 NN denotes pGL3
T5016 10114-10116 IN denotes of
T5015 10108-10113 NN denotes sites
T5014 10096-10107 NN denotes restriction
T5013 10085-10095 NN denotes polylinker
T5012 10083-10084 NNP denotes I
T5011 10077-10082 NNP denotes I/Xho
T5010 10073-10076 NNP denotes Kpn
T5009 10069-10072 DT denotes the
T5008 10064-10068 IN denotes into
T5007 10060-10063 CD denotes +92
T5006 10057-10059 TO denotes to
T5005 10053-10056 CD denotes −87
T5004 10045-10052 NN denotes regions
T5003 10036-10044 NN denotes promoter
T5002 10027-10035 NN denotes SerpinB2
T5001 10020-10026 JJ denotes murine
T5000 10016-10019 DT denotes the
T4999 10007-10015 VB denotes subclone
T4998 10004-10006 TO denotes to
T4997 9999-10003 VB denotes used
T4996 9994-9998 VB denotes were
T4995 9986-9993 NN denotes DW3’LUC
T4994 9982-9985 CC denotes and
T4993 9975-9981 NN denotes BSPCR2
T4992 9967-9974 NN denotes primers
T4991 9963-9966 NN denotes PCR
T4990 9959-9962 DT denotes The
T4989 9951-9957 NN denotes ligase
T4988 9947-9950 NN denotes DNA
T4987 9944-9946 NN denotes T4
T4986 9939-9943 IN denotes with
T4985 9934-9938 VB denotes ends
T4984 9927-9933 NN denotes vector
T4983 9923-9926 DT denotes the
T4982 9911-9922 VB denotes re-ligating
T4981 9907-9910 CC denotes and
T4980 9905-9906 -RRB- denotes )
T4979 9902-9905 NN denotes NEB
T4978 9901-9902 -LRB- denotes (
T4977 9890-9900 NN denotes polymerase
T4976 9886-9889 NN denotes DNA
T4975 9883-9885 NN denotes T4
T4974 9878-9882 IN denotes with
T4973 9868-9877 NN denotes overhangs
T4972 9865-9867 CD denotes 3′
T4971 9862-9864 CC denotes or
T4970 9859-9861 CD denotes 5′
T4969 9849-9858 JJ denotes resultant
T4968 9845-9848 DT denotes the
T4967 9838-9844 VB denotes ending
T4966 9832-9837 NN denotes blunt
T4965 9830-9831 -COMMA- denotes ,
T4964 9829-9830 -RRB- denotes )
T4963 9817-9829 RB denotes respectively
T4962 9815-9816 PRP denotes I
T4961 9811-9814 NNP denotes Apo
T4960 9807-9810 CC denotes and
T4959 9803-9806 NNP denotes III
T4958 9799-9802 NNP denotes Hae
T4957 9797-9798 -COMMA- denotes ,
T4956 9796-9797 NNP denotes I
T4955 9792-9795 NNP denotes Pac
T4954 9790-9791 -COMMA- denotes ,
T4953 9789-9790 NNP denotes I
T4952 9783-9788 NN denotes Bsu36
T4951 9781-9782 -COMMA- denotes ,
T4950 9780-9781 NNP denotes I
T4949 9775-9779 NNP denotes BstX
T4948 9773-9774 -COMMA- denotes ,
T4947 9772-9773 NNP denotes I
T4946 9768-9771 NNP denotes Apa
T4945 9766-9767 -COMMA- denotes ,
T4944 9765-9766 NNP denotes I
T4943 9761-9764 NNP denotes Sfi
T4942 9760-9761 -LRB- denotes (
T4941 9753-9759 NN denotes enzyme
T4940 9741-9752 NN denotes restriction
T4939 9734-9740 JJ denotes second
T4938 9732-9733 DT denotes a
T4937 9728-9731 CC denotes and
T4936 9726-9727 CD denotes I
T4935 9721-9725 NN denotes EcoR
T4934 9716-9720 IN denotes with
T4933 9705-9715 NN denotes pGLmP-3261
T4932 9695-9704 VB denotes digesting
T4931 9692-9694 IN denotes by
T4930 9682-9691 VB denotes generated
T4929 9677-9681 VB denotes were
T4928 9675-9676 -RRB- denotes )
T4927 9666-9675 NN denotes pGLmP-189
T4926 9662-9665 CC denotes and
T4925 9652-9661 NN denotes pGLmP-539
T4924 9650-9651 -COMMA- denotes ,
T4923 9641-9650 NN denotes pGLmP-694
T4922 9639-9640 -COMMA- denotes ,
T4921 9629-9639 NN denotes pGLmP-1341
T4920 9627-9628 -COMMA- denotes ,
T4919 9617-9627 NN denotes pGLmP-1686
T4918 9615-9616 -COMMA- denotes ,
T4917 9605-9615 NN denotes pGLmP-2614
T4916 9603-9604 -COMMA- denotes ,
T4915 9593-9603 NN denotes pGLmP-2751
T4914 9592-9593 -LRB- denotes (
T4913 9581-9591 NN denotes constructs
T4912 9572-9580 NN denotes reporter
T4911 9561-9571 NN denotes luciferase
T4910 9552-9560 NN denotes SerpinB2
T4909 9545-9551 JJ denotes murine
T4908 9534-9544 JJ denotes Additional
T4907 9522-9532 NN denotes pGLmP-4480
T4906 9514-9521 VB denotes produce
T4905 9511-9513 TO denotes to
T4904 9500-9510 NN denotes pGLmP-3261
T4903 9497-9499 IN denotes of
T4902 9495-9496 -RRB- denotes )
T4901 9490-9495 NN denotes −3261
T4900 9489-9490 -LRB- denotes (
T4899 9484-9488 NN denotes site
T4898 9482-9483 NN denotes I
T4897 9477-9481 NN denotes EcoR
T4896 9468-9476 NN denotes promoter
T4895 9459-9467 NN denotes SerpinB2
T4894 9455-9458 DT denotes the
T4893 9452-9454 IN denotes of
T4892 9443-9451 JJ denotes upstream
T4891 9431-9442 RB denotes immediately
T4890 9420-9430 VB denotes sub-cloned
T4889 9416-9419 VB denotes was
T4888 9405-9415 NN denotes pDB9402-42
T4887 9402-9404 IN denotes of
T4886 9395-9401 NN denotes insert
T4885 9393-9394 CD denotes I
T4858 9250-9258 NN denotes promoter
T4857 9241-9249 NN denotes SerpinB2
T4856 9237-9240 DT denotes the
T4855 9231-9236 VB denotes clone
T4854 9227-9230 CC denotes and
T4853 9219-9226 VB denotes amplify
T4852 9215-9218 NN denotes PCR
T4851 9212-9214 TO denotes to
T4850 9207-9211 VB denotes used
T4849 9202-9206 VB denotes were
T4848 9200-9201 -COMMA- denotes ,
T4847 9196-9200 NN denotes site
T4846 9184-9195 NN denotes restriction
T4845 9182-9183 CD denotes I
T4844 9178-9181 NN denotes Xho
T4843 9175-9177 DT denotes an
T4842 9164-9174 VB denotes containing
T4841 9162-9163 -COMMA- denotes ,
T4840 9155-9162 NN denotes DW3’LUC
T4839 9151-9154 CC denotes and
T4838 9149-9150 -COMMA- denotes ,
T4837 9145-9149 NN denotes site
T4836 9133-9144 NN denotes restriction
T4835 9131-9132 NN denotes I
T4834 9127-9130 NN denotes Kpn
T4833 9125-9126 DT denotes a
T4832 9114-9124 VB denotes containing
T4831 9112-9113 -COMMA- denotes ,
T4830 9105-9112 NN denotes DW5’LUC
T4829 9097-9104 NN denotes primers
T4828 9093-9096 NN denotes PCR
T4827 9089-9092 DT denotes The
T4826 9080-9088 NN denotes Plasmids
T4825 9075-9079 NNP denotes Gene
T4824 9066-9074 NNP denotes Reporter
T4823 9057-9065 NN denotes SerpinB2
T4822 9054-9056 IN denotes of
T4821 9041-9053 NN denotes Construction
T5197 11259-11270 NN denotes experiments
T5196 11255-11258 DT denotes the
T5195 11252-11254 IN denotes in
T5194 11247-11251 VB denotes used
T5193 11242-11246 VB denotes were
T5192 11231-11241 NN denotes constructs
T5191 11222-11230 VB denotes verified
T5190 11213-11221 NN denotes Sequence
T5189 11203-11211 NN denotes promoter
T5188 11194-11202 NN denotes SerpinB2
T5187 11187-11193 JJ denotes murine
T5186 11177-11186 JJ denotes wild-type
T5185 11173-11176 DT denotes the
T5184 11170-11172 IN denotes of
T5183 11163-11169 NN denotes region
T5182 11154-11162 NN denotes −539/+92
T5181 11150-11153 DT denotes the
T5180 11147-11149 IN denotes of
T5179 11141-11146 NN denotes place
T5178 11138-11140 IN denotes in
T5177 11128-11137 NN denotes pGLmP-539
T5176 11125-11127 IN denotes of
T5175 11119-11124 NN denotes sites
T5174 11107-11118 NN denotes restriction
T5173 11105-11106 CD denotes I
T5172 11101-11104 NN denotes Xho
T5171 11097-11100 CC denotes and
T5170 11095-11096 CD denotes I
T5169 11090-11094 NN denotes EcoR
T5168 11086-11089 DT denotes the
T5167 11078-11085 IN denotes between
T5166 11071-11077 VB denotes cloned
T5165 11067-11070 CC denotes and
T5164 11065-11066 NNP denotes I
T5163 11061-11064 NNP denotes Xho
T5162 11057-11060 CC denotes and
T5161 11055-11056 CD denotes I
T5160 11050-11054 NN denotes EcoR
T5159 11045-11049 IN denotes with
T5158 11036-11044 VB denotes digested
T5157 11031-11035 VB denotes were
T5156 11022-11030 NN denotes products
T5155 11018-11021 NN denotes PCR
T5154 11006-11017 JJ denotes Recombinant
T5153 10990-10994 NN denotes e in
T5152 10986-10990 DT denotes plat
T5151 10984-10986 IN denotes em
T5150 10976-10984 NN denotes as the t
T5149 10973-10976 DT denotes ed
T5148 10971-10973 IN denotes us
T5147 10967-10971 VB denotes was
T5146 10964-10967 VB denotes 39
T5145 10955-10964 NN denotes . pGLmP-5
T5144 10954-10955 -RRB- denotes )
T5143 10947-10954 NN denotes Promega
T5142 10946-10947 -LRB- denotes (
T5141 10936-10945 NN denotes GLprimer2
T5140 10932-10935 CC denotes and
T5139 10930-10931 -RRB- denotes )
T5138 10923-10930 NN denotes Promega
T5137 10922-10923 -LRB- denotes (
T5136 10912-10921 NN denotes RVprimer3
T5135 10907-10911 VB denotes were
T5134 10899-10906 NN denotes primers
T5133 10895-10898 NN denotes PCR
T5132 10879-10894 NN denotes oligonucleotide
T5131 10870-10878 NN denotes flanking
T5130 10866-10869 DT denotes The
T5129 10863-10864 -RRB- denotes ]
T5128 10861-10863 CD denotes 37
T5127 10860-10861 -LRB- denotes [
T5126 10849-10859 RB denotes previously
T5125 10840-10848 VB denotes reported
T5124 10835-10839 VB denotes were
T5123 10819-10834 NN denotes pGLmP-539mAP-1b
T5122 10815-10818 CC denotes and
T5121 10813-10814 -COMMA- denotes ,
T5120 10798-10813 NN denotes pGLmP-539mAP-1a
T5119 10796-10797 -COMMA- denotes ,
T5118 10783-10796 NN denotes pGLmP-539mCRE
T5117 10781-10782 -COMMA- denotes ,
T5116 10774-10781 NN denotes mutants
T5115 10765-10773 VB denotes generate
T5114 10762-10764 TO denotes to
T5113 10757-10761 VB denotes used
T5112 10749-10756 NN denotes primers
T5111 10745-10748 NN denotes PCR
T5110 10729-10744 NN denotes oligonucleotide
T5109 10725-10728 DT denotes The
T5108 10712-10723 NN denotes mPAI2mCEBPb
T5107 10708-10711 CC denotes and
T5106 10696-10707 NN denotes mPAI2mCEBPa
T5105 10694-10695 -COLON- denotes :
T5104 10679-10694 NN denotes pGLmP-539mC/EBP
T5103 10677-10678 -COLON- denotes ;
T5102 10665-10677 NN denotes mPAI2mOct-2b
T5101 10661-10664 CC denotes and
T4435 9037-9038 -RRB- denotes )
T4434 9033-9037 NNP denotes Inc.
T4433 9031-9032 -COMMA- denotes ,
T4432 9021-9031 NNP denotes Technology
T4431 9011-9020 NNP denotes Signaling
T4430 9006-9010 NNP denotes Cell
T4429 9005-9006 -LRB- denotes (
T4428 8997-9004 NN denotes tubulin
T4427 8993-8996 NN denotes α/β
T4426 8989-8992 CC denotes and
T4425 8987-8988 -RRB- denotes )
T4424 8982-8987 NN denotes GAPDH
T4423 8981-8982 -LRB- denotes (
T4422 8967-8980 NN denotes dehydrogenase
T4421 8940-8966 NN denotes glyceraldehyde-3-phosphate
T4420 8938-8939 -COMMA- denotes ,
T4419 8937-8938 -RRB- denotes )
T4418 8922-8937 NNP denotes Biotechnologies
T4417 8917-8921 NNP denotes Cruz
T4416 8911-8916 NNP denotes Santa
T4415 8910-8911 -LRB- denotes (
T4414 8908-8909 -RRB- denotes )
T4413 8902-8908 NN denotes sc-150
T4412 8901-8902 -LRB- denotes (
T4411 8893-8900 NN denotes C/EBP-β
T4410 8891-8892 -COLON- denotes :
T4409 8884-8891 VB denotes include
T4408 8877-8883 NN denotes assays
T4407 8872-8876 NN denotes blot
T4406 8864-8871 JJ denotes western
T4405 8860-8863 IN denotes for
T4404 8855-8859 VB denotes used
T4403 8844-8854 NN denotes antibodies
T4402 8838-8843 JJ denotes Other
T4401 8835-8836 -RRB- denotes ]
T4400 8833-8835 CD denotes 35
T4399 8832-8833 -LRB- denotes [
T4398 8829-8831 IN denotes in
T4397 8826-8828 IN denotes as
T4396 8821-8825 FW denotes coli
T4395 8818-8820 FW denotes E.
T4394 8815-8817 IN denotes in
T4393 8806-8814 VB denotes produced
T4392 8798-8805 NN denotes protein
T4391 8791-8797 NN denotes fusion
T4390 8782-8790 NN denotes SerpinB2
T4389 8771-8781 NN denotes GST-murine
T4388 8759-8770 JJ denotes recombinant
T4387 8750-8758 VB denotes purified
T4386 8748-8749 DT denotes a
T4385 8743-8747 IN denotes with
T4384 8730-8742 NN denotes immunization
T4383 8724-8729 IN denotes after
T4382 8715-8723 VB denotes prepared
T4381 8710-8714 VB denotes were
T4380 8699-8709 NN denotes antibodies
T4379 8690-8698 NN denotes SerpinB2
T4378 8679-8689 JJ denotes anti-mouse
T4377 8672-8678 NN denotes rabbit
T4376 8663-8671 VB denotes purified
T4375 8654-8662 NN denotes Affinity
T4374 8643-8652 RB denotes overnight
T4373 8632-8642 NN denotes antibodies
T4372 8624-8631 JJ denotes primary
T4371 8619-8623 IN denotes with
T4370 8609-8618 VB denotes incubated
T4369 8605-8608 CC denotes and
T4368 8603-8604 -COMMA- denotes ,
T4367 8602-8603 -RRB- denotes )
T4366 8594-8602 CD denotes Tween-20
T4365 8592-8593 NN denotes %
T4364 8589-8592 CD denotes 0.1
T4363 8587-8588 -COMMA- denotes ,
T4362 8584-8587 NNP denotes PBS
T4884 9388-9392 NN denotes EcoR
T4883 9384-9387 DT denotes The
T4882 9372-9382 NN denotes pGLmP-3261
T4881 9364-9371 VB denotes produce
T4880 9361-9363 TO denotes to
T4879 9359-9360 -RRB- denotes )
T4878 9352-9359 NNP denotes Promega
T4877 9351-9352 -LRB- denotes (
T4876 9345-9350 JJ denotes Basic
T4875 9340-9344 NN denotes pGL3
T4874 9337-9339 IN denotes of
T4873 9331-9336 NN denotes sites
T4872 9319-9330 NN denotes restriction
T4871 9308-9318 NN denotes polylinker
T4870 9306-9307 NNP denotes I
T4869 9300-9305 NNP denotes I/Xho
T4868 9296-9299 NNP denotes Kpn
T4867 9292-9295 DT denotes the
T4866 9287-9291 IN denotes into
T4865 9279-9286 NN denotes pDB9406
T4864 9274-9278 IN denotes from
T4863 9272-9273 -RRB- denotes )
T4862 9269-9272 CD denotes +92
T4861 9266-9268 TO denotes to
T4860 9260-9265 CD denotes −3261
T4859 9259-9260 -LRB- denotes (
T4361 8581-8583 NN denotes 1X
T4360 8580-8581 -LRB- denotes (
T4359 8574-8579 NN denotes PBS-T
T4358 8571-8573 IN denotes in
T4357 8566-8570 NN denotes milk
T4356 8564-8565 NN denotes %
T4355 8563-8564 CD denotes 5
T4354 8558-8562 IN denotes with
T4353 8550-8557 VB denotes blocked
T4352 8537-8549 RB denotes subsequently
T4351 8532-8536 VB denotes were
T4350 8522-8531 NN denotes Membranes
T4349 8511-8520 NN denotes membranes
T4348 8506-8510 NN denotes PVDF
T4347 8503-8505 TO denotes to
T4346 8491-8502 VB denotes transferred
T4345 8487-8490 CC denotes and
T4344 8485-8486 -COMMA- denotes ,
T4343 8484-8485 -RRB- denotes )
T4342 8474-8484 NN denotes Invitrogen
T4341 8473-8474 -LRB- denotes (
T4340 8468-8472 NN denotes gels
T4339 8461-8467 NN denotes NuPAGE
T4338 8452-8460 JJ denotes Bis-Tris
T4337 8450-8451 NN denotes %
T4336 8446-8450 CD denotes 4–12
T4310 8348-8351 CD denotes 150
T4309 8346-8347 -COMMA- denotes ,
T4308 8342-8346 NNP denotes Tris
T4307 8339-8341 NN denotes mM
T4306 8336-8338 CD denotes 10
T4305 8335-8336 -LRB- denotes (
T4304 8328-8334 NN denotes buffer
T4303 8323-8327 NN denotes RIPA
T4302 8320-8322 IN denotes in
T4301 8311-8319 VB denotes prepared
T4300 8306-8310 VB denotes were
T4299 8298-8305 NN denotes lysates
T4298 8293-8297 NN denotes cell
T4297 8287-8292 JJ denotes Whole
T4296 8280-8286 NN denotes Assays
T4295 8275-8279 NNP denotes Blot
T4294 8267-8274 NNP denotes Western
T4008 8256-8264 NN denotes AF339731
T4007 8252-8255 NNP denotes No.
T4006 8242-8251 NNP denotes Accession
T4005 8237-8241 IN denotes with
T4004 8232-8236 NNP denotes Bank
T4003 8227-8231 NNP denotes Data
T4002 8209-8226 NNP denotes GenBank/EMBL/DDBJ
T4001 8206-8208 IN denotes in
T4000 8196-8205 VB denotes deposited
T3999 8192-8195 VB denotes was
T3998 8183-8191 NN denotes sequence
T3997 8178-8182 DT denotes This
T3996 8175-8176 -RRB- denotes )
T3995 8163-8175 NN denotes Perkin-Elmer
T3994 8162-8163 -LRB- denotes (
T3993 8152-8161 NN denotes sequencer
T3992 8147-8151 NN denotes 373A
T3991 8144-8146 NN denotes PE
T3990 8142-8143 DT denotes a
T3989 8138-8141 CC denotes and
T3988 8136-8137 -RRB- denotes )
T3987 8124-8136 NN denotes Perkin-Elmer
T3986 8123-8124 -LRB- denotes (
T3985 8119-8122 NN denotes kit
T3984 8110-8118 NN denotes reaction
T3983 8104-8109 JJ denotes ready
T3982 8093-8103 NN denotes sequencing
T3981 8087-8092 NN denotes cycle
T3980 8076-8086 NN denotes terminator
T3979 8072-8075 NN denotes dye
T3978 8066-8071 NNP denotes PRISM
T3977 8062-8065 NNP denotes ABI
T3976 8058-8061 DT denotes the
T3975 8052-8057 VB denotes using
T3974 8041-8051 VB denotes determined
T3973 8037-8040 VB denotes was
T3972 8030-8036 NN denotes region
T3971 8021-8029 NN denotes flanking
T3970 8018-8020 NN denotes 5′
T3969 8013-8017 NN denotes gene
T3968 8004-8012 NN denotes SerpinB2
T3967 7997-8003 JJ denotes murine
T3966 7994-7996 NN denotes bp
T3965 7989-7993 CD denotes 4480
T3964 7985-7988 DT denotes the
T3963 7982-7984 IN denotes of
T3962 7973-7981 NN denotes sequence
T3961 7962-7972 NN denotes nucleotide
T3960 7958-7961 DT denotes The
T3959 7946-7956 NN denotes sequencing
T3958 7942-7945 NN denotes DNA
T3957 7938-7941 CC denotes and
T3956 7928-7937 NN denotes digestion
T3955 7921-7927 NN denotes enzyme
T3954 7909-7920 NN denotes restriction
T3953 7906-7908 IN denotes by
T3952 7897-7905 VB denotes verified
T3951 7892-7896 VB denotes were
T3950 7884-7891 NN denotes inserts
T3949 7874-7883 VB denotes Subcloned
T3948 7860-7872 NN denotes orientations
T3947 7851-7859 JJ denotes opposite
T3946 7848-7850 IN denotes in
T3945 7841-7847 VB denotes cloned
T3944 7839-7840 -COMMA- denotes ,
T3943 7831-7839 NN denotes fragment
T3942 7825-7830 NN denotes EcoRI
T3941 7817-7824 NN denotes pDB9406
T3940 7813-7816 DT denotes the
T3939 7810-7812 IN denotes of
T3938 7801-7809 RB denotes upstream
T3937 7789-7800 RB denotes immediately
T3936 7781-7788 JJ denotes located
T3935 7779-7780 -COMMA- denotes ,
T3934 7771-7779 NN denotes fragment
T3933 7763-7770 JJ denotes genomic
T3932 7757-7762 NN denotes EcoRI
T3931 7754-7756 NN denotes kb
T3930 7750-7753 CD denotes 1.2
T3929 7748-7749 DT denotes a
T3928 7740-7747 VB denotes contain
T3927 7729-7739 NN denotes pDB9402-42
T3926 7725-7728 CC denotes and
T3925 7714-7724 NN denotes pDB9402-41
T3924 7712-7713 -COLON- denotes ;
T3923 7708-7712 NN denotes site
T3922 7697-7707 NN denotes initiation
T3921 7683-7696 NN denotes transcription
T3920 7679-7682 DT denotes the
T3919 7670-7678 VB denotes spanning
T3918 7661-7669 NN denotes fragment
T3917 7653-7660 JJ denotes genomic
T3916 7642-7652 NN denotes EcoRI/SpeI
T3915 7639-7641 NN denotes kb
T3914 7635-7638 CD denotes 4.4
T3913 7633-7634 DT denotes a
T3912 7624-7632 VB denotes contains
T3911 7616-7623 NN denotes pDB9406
T3910 7608-7615 NNP denotes Geneva.
T3909 7605-7607 IN denotes of
T3908 7594-7604 NNP denotes University
T3907 7592-7593 -COMMA- denotes ,
T3906 7587-7592 NNP denotes Belin
T3905 7577-7586 NNP denotes Dominique
T3904 7573-7576 NNP denotes Dr.
T3903 7570-7572 IN denotes by
T3902 7561-7569 VB denotes provided
T3901 7554-7560 RB denotes kindly
T3900 7549-7553 VB denotes were
T3899 7547-7548 -COMMA- denotes ,
T3898 7541-7547 NN denotes strain
T3897 7535-7540 NN denotes mouse
T3896 7531-7534 CD denotes 129
T3895 7529-7530 DT denotes a
T3894 7524-7528 IN denotes from
T3893 7515-7523 VB denotes prepared
T3892 7507-7514 NN denotes library
T3891 7499-7506 JJ denotes genomic
T3890 7497-7498 -RRB- denotes )
T3889 7487-7497 NN denotes Stratagene
T3888 7486-7487 -LRB- denotes (
T3887 7479-7485 NN denotes λFIXII
T3886 7477-7478 DT denotes a
T3885 7472-7476 IN denotes from
T3884 7463-7471 VB denotes isolated
T3883 7459-7462 NN denotes DNA
T3882 7451-7458 JJ denotes genomic
T3881 7440-7450 VB denotes containing
T3880 7429-7439 NN denotes pDB9402-42
T3879 7425-7428 CC denotes and
T3878 7414-7424 NN denotes pDB9402-41
T3877 7412-7413 -COMMA- denotes ,
T3876 7405-7412 NN denotes pDB9406
T3875 7396-7404 NN denotes Plasmids
T3874 7385-7394 NN denotes digestion
T4335 8443-8445 IN denotes on
T4334 8433-8442 VB denotes separated
T4333 8428-8432 VB denotes were
T4332 8419-8427 NN denotes proteins
T4331 8417-8418 -COMMA- denotes ,
T4330 8416-8417 -RRB- denotes )
T4329 8413-8416 NN denotes SDS
T4328 8411-8412 NN denotes %
T4327 8408-8411 CD denotes 0.1
T4326 8406-8407 -COMMA- denotes ,
T4325 8394-8406 NN denotes deoxycholate
T4324 8392-8393 NN denotes %
T4323 8389-8392 CD denotes 0.5
T4322 8387-8388 -COMMA- denotes ,
T4321 8382-8387 NN denotes NP-40
T4320 8380-8381 NN denotes %
T4319 8377-8380 CD denotes 0.5
T4318 8375-8376 -COMMA- denotes ,
T4317 8370-8375 NN denotes X-100
T4316 8363-8369 NN denotes Triton
T4315 8362-8363 NN denotes %
T4314 8361-8362 CD denotes 1
T4313 8359-8360 -COMMA- denotes ,
T4312 8355-8359 NN denotes NaCl
T4311 8352-8354 NN denotes mM
T3873 7381-7384 CD denotes III
T3872 7369-7380 NN denotes exonuclease
T3871 7366-7368 IN denotes by
T3870 7355-7365 VB denotes introduced
T3869 7345-7354 NN denotes deletions
T3868 7334-7344 VB denotes containing
T3867 7323-7333 NN denotes pDB9402-42
T3866 7319-7322 CC denotes and
T3865 7308-7318 NN denotes pDB9402-41
T3864 7303-7307 IN denotes from
T3863 7294-7302 VB denotes prepared
T3862 7285-7293 NN denotes plasmids
T3861 7282-7284 TO denotes to
T3860 7273-7281 NN denotes addition
T3859 7270-7272 IN denotes in
T3858 7268-7269 -COMMA- denotes ,
T3857 7258-7268 NN denotes pDB9402-42
T3856 7254-7257 CC denotes and
T3855 7243-7253 NN denotes pDB9402-41
T3854 7241-7242 -COMMA- denotes ,
T3853 7234-7241 NN denotes pDB9406
T3852 7225-7233 NN denotes plasmids
T3851 7215-7224 JJ denotes pUC-based
T3850 7211-7214 DT denotes the
T3849 7200-7210 VB denotes sequencing
T3848 7197-7199 IN denotes by
T3673 7089-7090 -RRB- denotes A
T3672 7079-7089 NNP denotes 7939_s1) (
T3671 7072-7079 NNP denotes (Mm0060
T3670 7070-7071 -LRB- denotes n
T3669 7069-7070 -RRB- denotes i
T3668 7056-7069 NN denotes s1) and β-act
T3667 7055-7056 -LRB- denotes _
T3666 7048-7055 NN denotes 0843434
T3665 7045-7048 CC denotes Mm0
T3664 7044-7045 -RRB- denotes (
T3663 7030-7043 NN denotes 05_m1), Cebpb
T3662 7029-7030 -LRB- denotes 9
T3661 7024-7029 NN denotes 00440
T3660 7023-7024 -COMMA- denotes m
T3659 7022-7023 -RRB- denotes M
T3658 7009-7022 NN denotes b2/SerpinB2 (
T3657 7008-7009 -LRB- denotes n
T3656 6991-7008 NN denotes primers for Serpi
T3655 6988-6991 IN denotes 0X
T3654 6981-6988 NN denotes ssion 2
T3653 6978-6981 NN denotes pre
T3652 6968-6978 NN denotes n® Gene Ex
T3651 6964-6968 NNP denotes aqMa
T3650 6957-6964 NNP denotes using T
T3649 6952-6957 VB denotes rmed
T3648 6943-6952 VB denotes was perfo
T3647 6940-6943 VB denotes CR
T3646 6936-6940 NN denotes . qP
T3645 6935-6936 -RRB- denotes )
T3644 6925-6935 NNP denotes Biosystems
T3643 6917-6924 NNP denotes Applied
T3642 6916-6917 -LRB- denotes (
T3641 6907-6915 NN denotes Reagents
T3640 6893-6906 NN denotes Transcription
T3639 6885-6892 NNP denotes Reverse
T3638 6877-6884 NNP denotes TaqMan®
T3637 6871-6876 VB denotes using
T3636 6859-6870 VB denotes transcribed
T3635 6851-6858 RB denotes reverse
T3634 6847-6850 VB denotes was
T3633 6843-6846 NN denotes RNA
T3632 6837-6842 JJ denotes total
T3631 6834-6836 IN denotes of
T3630 6831-6833 NN denotes µg
T3629 6829-6830 CD denotes 1
T3628 6827-6828 -COMMA- denotes ,
T3627 6818-6827 NN denotes synthesis
T3626 6813-6817 NN denotes cDNA
T3625 6809-6812 IN denotes For
T3624 6802-6807 NN denotes cells
T3623 6797-6801 IN denotes from
T3622 6793-6796 NN denotes RNA
T3621 6787-6792 JJ denotes total
T3620 6779-6786 VB denotes isolate
T3619 6776-6778 TO denotes to
T3618 6771-6775 VB denotes used
T3617 6767-6770 VB denotes was
T3616 6765-6766 -RRB- denotes )
T3615 6759-6765 NN denotes Qiagen
T3614 6758-6759 -LRB- denotes (
T3613 6754-6757 NNP denotes Kit
T3612 6749-6753 NNP denotes Mini
T3611 6742-6748 NNP denotes RNeasy
T3610 6738-6741 DT denotes The
T3609 6736-6737 -RRB- denotes )
T3608 6732-6736 NN denotes qPCR
T3607 6731-6732 -LRB- denotes (
T3606 6727-6730 NN denotes PCR
T3605 6714-6726 JJ denotes Quantitative
T3287 6696-6701 NNP denotes Sigma
T3286 6691-6695 IN denotes from
T3285 6682-6690 VB denotes obtained
T3284 6678-6681 VB denotes was
T3283 6676-6677 -RRB- denotes )
T3282 6671-6676 NN denotes Re595
T3281 6664-6670 NN denotes Strain
T3280 6654-6663 NN denotes minnesota
T3279 6643-6653 NN denotes Salmonella
T3278 6642-6643 -LRB- denotes (
T3277 6640-6641 -RRB- denotes )
T3276 6637-6640 NN denotes LPS
T3275 6636-6637 -LRB- denotes (
T3274 6617-6635 NN denotes lipopolysaccharide
T3273 6607-6616 JJ denotes Bacterial
T3272 6604-6605 -RRB- denotes )
T3271 6599-6604 NN denotes Lonza
T3270 6598-6599 -LRB- denotes (
T3269 6594-6597 NN denotes Kit
T3268 6584-6593 NNP denotes Detection
T3267 6574-6583 NNP denotes MycoAlert
T3266 6570-6573 DT denotes the
T3265 6566-6569 CC denotes and
T3264 6564-6565 -RRB- denotes )
T3263 6559-6564 NN denotes Sigma
T3262 6558-6559 -LRB- denotes (
T3261 6552-6557 CD denotes 33258
T3260 6546-6551 NN denotes stain
T3259 6538-6545 NNP denotes Hoechst
T3258 6532-6537 VB denotes using
T3257 6523-6531 NN denotes staining
T3256 6515-6522 JJ denotes nuclear
T3255 6512-6514 IN denotes by
T3254 6502-6511 NN denotes infection
T3253 6491-6501 NN denotes Mycoplasma
T3252 6483-6490 VB denotes exclude
T3251 6480-6482 TO denotes to
T3250 6472-6479 VB denotes checked
T3249 6462-6471 RB denotes routinely
T3248 6457-6461 VB denotes were
T3247 6448-6456 NN denotes cultures
T3246 6444-6447 DT denotes All
T3245 6436-6442 NN denotes method
T3244 6426-6435 NN denotes exclusion
T3243 6422-6425 NN denotes dye
T3242 6420-6421 -RRB- denotes )
T3241 6415-6420 NN denotes Sigma
T3240 6414-6415 -LRB- denotes (
T3239 6409-6413 JJ denotes blue
T3238 6402-6408 NN denotes trypan
T3237 6398-6401 DT denotes the
T3236 6392-6397 VB denotes using
T3235 6381-6391 VB denotes determined
T3234 6377-6380 VB denotes was
T3233 6367-6376 NN denotes viability
T3232 6362-6366 NN denotes Cell
T3231 6355-6360 NN denotes serum
T3230 6346-6354 JJ denotes LPS-free
T3229 6336-6345 VB denotes certified
T3228 6333-6335 IN denotes of
T3227 6329-6332 NN denotes use
T3226 6325-6328 DT denotes the
T3225 6317-6324 IN denotes through
T3224 6308-6316 NN denotes cultures
T3223 6303-6307 NN denotes cell
T3222 6299-6302 DT denotes all
T3221 6294-6298 IN denotes from
T3220 6280-6293 NN denotes contamination
T3219 6261-6279 NN denotes lipopolysaccharide
T3218 6251-6260 JJ denotes bacterial
T3217 6243-6250 VB denotes exclude
T3216 6240-6242 TO denotes to
T3215 6234-6239 VB denotes taken
T3214 6229-6233 VB denotes were
T3213 6217-6228 NN denotes Precautions
T3212 6214-6215 -RRB- denotes )
T3211 6211-6214 NNP denotes BRL
T3210 6205-6210 NNP denotes Gibco
T3209 6204-6205 -LRB- denotes (
T3208 6198-6203 NN denotes media
T3207 6189-6197 NN denotes DMEM/F12
T3206 6187-6188 NN denotes %
T3205 6185-6187 CD denotes 50
T3204 6182-6184 IN denotes in
T3203 6171-6181 VB denotes maintained
T3202 6167-6170 CC denotes and
T3201 6165-6166 -COMMA- denotes ,
T3200 6160-6165 RB denotes later
T3199 6155-6159 NN denotes days
T3198 6151-6154 CD denotes 3–5
T3197 6144-6150 NN denotes lavage
T3196 6133-6143 JJ denotes peritoneal
T3195 6130-6132 IN denotes by
T3194 6121-6129 VB denotes followed
T3193 6115-6120 NN denotes broth
T3192 6100-6114 NN denotes thioglycollate
T3191 6098-6099 NN denotes %
T3190 6097-6098 CD denotes 3
T3189 6092-6096 IN denotes with
T3188 6087-6091 NN denotes mice
T3187 6079-6086 NN denotes C57BL/6
T3186 6069-6078 VB denotes injecting
T3185 6066-6068 IN denotes by
T3184 6057-6065 VB denotes obtained
T3183 6052-6056 VB denotes were
T3182 6040-6051 NN denotes macrophages
T3181 6029-6039 JJ denotes peritoneal
T3180 6021-6028 JJ denotes Primary
T3179 5390-5397 NNP denotes Culture
T3178 5385-5389 NNP denotes Cell
T3847 7186-7196 VB denotes determined
T3846 7182-7185 VB denotes was
T3845 7173-7181 NN denotes promoter
T3844 7164-7172 NN denotes SerpinB2
T3843 7157-7163 JJ denotes murine
T3842 7153-7156 DT denotes the
T3841 7150-7152 IN denotes of
T3840 7141-7149 NN denotes sequence
T3839 7137-7140 NN denotes DNA
T3838 7133-7136 DT denotes The
T3837 7124-7132 NN denotes Analysis
T3836 7115-7123 NN denotes Sequence
T3835 7111-7114 NN denotes DNA
T1980 5009-5017 RB denotes directly
T2028 5353-5357 NN denotes gene
T2027 5344-5352 NN denotes SerpinB2
T2026 5340-5343 DT denotes the
T2025 5337-5339 IN denotes of
T2024 5326-5336 NN denotes regulation
T2023 5310-5325 JJ denotes transcriptional
T2022 5306-5309 DT denotes the
T2021 5301-5305 IN denotes into
T2020 5293-5300 NN denotes insight
T2019 5289-5292 JJ denotes new
T2018 5281-5288 VB denotes provide
T2017 5272-5280 NN denotes findings
T2016 5266-5271 DT denotes these
T2015 5264-5265 -COMMA- denotes ,
T2014 5256-5264 RB denotes Together
T2013 5246-5254 NN denotes activity
T2012 5237-5245 NN denotes promoter
T2011 5228-5236 NN denotes SerpinB2
T2010 5216-5227 JJ denotes LPS-induced
T2009 5207-5215 VB denotes regulate
T2008 5196-5206 RB denotes negatively
T2007 5193-5195 TO denotes to
T2006 5187-5192 VB denotes found
T2005 5183-5186 VB denotes was
T2004 5178-5182 NN denotes site
T2003 5161-5177 NN denotes phospho-acceptor
T2002 5153-5160 JJ denotes C/EBP-β
T2001 5151-5152 DT denotes a
T2000 5149-5150 -COMMA- denotes ,
T1999 5138-5149 RB denotes Importantly
T1998 5133-5136 NN denotes LPS
T1997 5130-5132 IN denotes by
T1996 5120-5129 NN denotes induction
T1995 5111-5119 NN denotes SerpinB2
T1994 5107-5110 CC denotes and
T1993 5096-5106 NN denotes expression
T1992 5087-5095 NN denotes SerpinB2
T1991 5074-5086 JJ denotes constitutive
T1990 5064-5073 VB denotes abrogated
T1989 5053-5063 NN denotes deficiency
T1988 5049-5052 PRP-DOLLAR- denotes its
T1987 5045-5048 CC denotes and
T1986 5040-5044 FW denotes vivo
T1985 5037-5039 FW denotes in
T1984 5032-5036 NN denotes site
T1983 5027-5031 DT denotes this
T1982 5024-5026 TO denotes to
T1981 5018-5023 VB denotes bound
T1979 5001-5008 NN denotes C/EBP-β
T1978 4990-4999 CD denotes −203/−195
T1977 4987-4989 IN denotes at
T1976 4982-4986 NN denotes site
T1975 4974-4981 NN denotes binding
T1974 4968-4973 NN denotes C/EBP
T1973 4966-4967 DT denotes a
T1972 4961-4965 IN denotes upon
T1971 4951-4960 JJ denotes dependent
T1970 4940-4950 RB denotes critically
T1969 4937-4939 VB denotes is
T1968 4933-4936 CC denotes and
T1967 4931-4932 -COMMA- denotes ,
T1966 4923-4931 NN denotes promoter
T1965 4914-4922 NN denotes SerpinB2
T1964 4907-4913 JJ denotes murine
T1963 4903-4906 DT denotes the
T1962 4900-4902 IN denotes of
T1961 4895-4899 CD denotes −539
T1960 4891-4894 CC denotes and
T1959 4886-4890 CD denotes −189
T1958 4874-4885 NN denotes nucleotides
T1957 4866-4873 IN denotes between
T1956 4859-4865 NN denotes region
T1955 4855-4858 DT denotes the
T1954 4852-4854 IN denotes in
T1953 4842-4851 NN denotes sequences
T1952 4831-4841 JJ denotes regulatory
T1951 4820-4830 JJ denotes cis-acting
T1950 4815-4819 IN denotes upon
T1949 4805-4814 JJ denotes dependent
T1948 4802-4804 VB denotes is
T1947 4793-4801 NN denotes SerpinB2
T1946 4790-4792 IN denotes of
T1945 4780-4789 NN denotes induction
T1944 4776-4779 NN denotes LPS
T1943 4771-4775 IN denotes that
T1942 4766-4770 VB denotes show
T1941 4763-4765 PRP denotes we
T1940 4758-4762 RB denotes Here
T1939 4749-4756 VB denotes defined
T1938 4745-4748 RB denotes not
T1937 4740-4744 VB denotes were
T1936 4731-4739 NN denotes promoter
T1935 4722-4730 NN denotes SerpinB2
T1934 4718-4721 DT denotes the
T1933 4713-4717 VB denotes bind
T1932 4708-4712 WDT denotes that
T1931 4700-4707 NN denotes factors
T1930 4686-4699 NN denotes transcription
T1929 4671-4685 JJ denotes LPS-responsive
T1928 4662-4670 JJ denotes specific
T1927 4658-4661 DT denotes the
T1926 4654-4657 CC denotes and
T1925 4642-4653 NN denotes macrophages
T1924 4639-4641 IN denotes in
T1923 4625-4638 NN denotes transcription
T1922 4611-4624 JJ denotes LPS-dependent
T1921 4607-4610 IN denotes for
T1920 4595-4606 JJ denotes responsible
T1919 4586-4594 NN denotes promoter
T1918 4577-4585 NN denotes SerpinB2
T1917 4573-4576 DT denotes the
T1916 4570-4572 IN denotes in
T1915 4561-4569 NN denotes elements
T1914 4550-4560 JJ denotes cis-acting
T1913 4546-4549 DT denotes the
T1912 4544-4545 -COMMA- denotes ,
T1911 4537-4544 RB denotes however
T1910 4535-4536 -COLON- denotes ;
T1909 4534-4535 -RRB- denotes ]
T1908 4533-4534 CD denotes 4
T1907 4532-4533 -LRB- denotes [
T1906 4517-4531 NN denotes co-stimulation
T1905 4511-4516 NN denotes IFN-γ
T1904 4508-4510 TO denotes to
T1903 4496-4507 NN denotes sensitivity
T1902 4492-4495 CC denotes and
T1901 4483-4491 NN denotes response
T1900 4478-4482 NN denotes dose
T1899 4474-4477 NN denotes LPS
T1898 4472-4473 -COMMA- denotes ,
T1897 4464-4472 NN denotes kinetics
T1896 4461-4463 IN denotes of
T1895 4455-4460 NN denotes terms
T1894 4452-4454 IN denotes in
T1893 4446-4451 NN denotes genes
T1892 4432-4445 JJ denotes LPS-inducible
T1891 4426-4431 JJ denotes other
T1890 4421-4425 IN denotes from
T1889 4411-4420 VB denotes regulated
T1888 4400-4410 RB denotes distinctly
T1887 4397-4399 VB denotes is
T1886 4388-4396 NN denotes SerpinB2
T1885 4383-4387 IN denotes that
T1884 4373-4382 VB denotes indicated
T1883 4368-4372 NN denotes data
T1882 4358-4367 VB denotes published
T1881 4347-4357 RB denotes previously
T1880 4343-4346 PRP-DOLLAR- denotes Our
T1879 4340-4341 -RRB- denotes ]
T1878 4338-4340 CD denotes 16
T1877 4337-4338 -LRB- denotes [
T1876 4328-4336 NN denotes pathways
T1875 4318-4327 NN denotes MAPK/CREB
T1874 4314-4317 NN denotes p38
T1873 4310-4313 CC denotes and
T1872 4299-4309 NN denotes IKKβ/NF-κB
T1871 4295-4298 DT denotes the
T1870 4292-4294 IN denotes of
T1869 4280-4291 NN denotes cooperation
T1868 4277-4279 IN denotes by
T1687 3285-3287 VB denotes is
T1686 3280-3284 NN denotes gene
T1685 3271-3279 NN denotes SerpinB2
T1684 3267-3270 DT denotes The
T1683 3256-3265 VB denotes described
T1682 3251-3255 VB denotes been
T1681 3246-3250 VB denotes have
T1680 3244-3245 -COMMA- denotes ,
T1679 3243-3244 -RRB- denotes ]
T1678 3241-3243 CD denotes 28
T1677 3240-3241 -LRB- denotes [
T1676 3239-3240 CD denotes –
T1675 3238-3239 -RRB- denotes ]
T1674 3236-3238 CD denotes 24
T1673 3235-3236 -LRB- denotes [
T1672 3226-3234 NN denotes immunity
T1671 3219-3225 JJ denotes innate
T1670 3215-3218 CC denotes and
T1669 3213-3214 -RRB- denotes ]
T1668 3211-3213 CD denotes 23
T1667 3210-3211 -LRB- denotes [
T1666 3208-3209 -COLON- denotes ;
T1665 3207-3208 -RRB- denotes ]
T1664 3205-3207 CD denotes 22
T1663 3204-3205 -LRB- denotes [
T1662 3202-3203 -COLON- denotes ;
T1661 3201-3202 -RRB- denotes ]
T1660 3199-3201 CD denotes 15
T1659 3198-3199 -LRB- denotes [
T1658 3185-3197 NN denotes transduction
T1657 3178-3184 NN denotes signal
T1656 3176-3177 -COMMA- denotes ,
T1655 3175-3176 -RRB- denotes ]
T1654 3173-3175 CD denotes 21
T1653 3172-3173 -LRB- denotes [
T1652 3171-3172 CD denotes –
T1651 3170-3171 -RRB- denotes ]
T1650 3168-3170 CD denotes 18
T1649 3167-3168 -LRB- denotes [
T1648 3151-3166 NN denotes differentiation
T1647 3147-3150 CC denotes and
T1646 3133-3146 NN denotes proliferation
T1645 3131-3132 -COMMA- denotes ,
T1644 3130-3131 -RRB- denotes ]
T1643 3128-3130 CD denotes 17
T1642 3127-3128 -LRB- denotes [
T1641 3126-3127 CD denotes –
T1640 3125-3126 -RRB- denotes ]
T1639 3123-3125 CD denotes 11
T1638 3122-3123 -LRB- denotes [
T1637 3113-3121 NN denotes survival
T1636 3108-3112 NN denotes cell
T1635 3105-3107 IN denotes in
T1634 3096-3104 NN denotes SerpinB2
T1633 3092-3095 IN denotes for
T1632 3086-3091 NN denotes roles
T1631 3072-3085 JJ denotes intracellular
T1630 3070-3071 -COMMA- denotes ,
T1629 3064-3070 NN denotes decade
T1628 3059-3063 JJ denotes past
T1627 3055-3058 DT denotes the
T1626 3050-3054 IN denotes Over
T1625 3047-3048 -RRB- denotes ]
T1624 3045-3047 CD denotes 10
T1623 3044-3045 -LRB- denotes [
T1622 3036-3043 NN denotes protein
T1621 3022-3035 JJ denotes intracellular
T1620 3006-3021 JJ denotes nonglycosylated
T1619 3004-3005 DT denotes a
T1618 3001-3003 IN denotes as
T1617 2991-3000 RB denotes primarily
T1616 2984-2990 VB denotes exists
T1615 2975-2983 NN denotes SerpinB2
T1614 2971-2974 RB denotes yet
T1613 2966-2970 NN denotes cell
T1612 2962-2965 DT denotes the
T1611 2957-2961 IN denotes from
T1610 2948-2956 VB denotes secreted
T1609 2945-2947 VB denotes be
T1608 2942-2944 TO denotes to
T1607 2933-2941 NN denotes SerpinB2
T1606 2924-2932 VB denotes requires
T1605 2915-2923 NN denotes function
T1604 2910-2914 JJ denotes Such
T1603 2891-2892 -RRB- denotes s
T1602 2890-2891 CD denotes a
T1601 2889-2890 -LRB- denotes l
T1600 2888-2889 -COLON- denotes p
T1599 2886-2887 -RRB- denotes f
T1598 2885-2886 CD denotes o
T1597 2883-2884 -LRB- denotes n
T1596 2872-2883 NN denotes e activatio
T1595 2870-2872 IN denotes th
T1594 2859-2869 NN denotes ix through
T1593 2856-2859 DT denotes atr
T1592 2849-2856 IN denotes lular m
T1591 2843-2849 NN denotes tracel
T1590 2830-2843 JJ denotes ver of the ex
T1589 2827-2830 DT denotes rno
T1588 2825-2827 IN denotes tu
T1587 2816-2824 NN denotes tion and
T1586 2813-2816 CC denotes ada
T1585 2802-2813 NN denotes in the degr
T1584 2799-2802 DT denotes ed
T1583 2797-2799 IN denotes lv
T1582 2789-2797 VB denotes ase invo
T1581 2781-2789 NN denotes ne prote
T1580 2775-2781 NN denotes a seri
T1579 2773-2774 DT denotes ,
T1578 2772-2773 -COMMA- denotes ]
T1577 2771-2772 -RRB- denotes 8
T1576 2770-2771 CD denotes [
T1575 2769-2770 -LRB- denotes –
T1574 2768-2769 -RRB- denotes ]
T1573 2767-2768 CD denotes 6
T1572 2766-2767 -LRB- denotes [
T1571 2765-2766 -RRB- denotes )
T1570 2762-2765 NN denotes uPA
T1569 2761-2762 -LRB- denotes (
T1568 2751-2760 NN denotes activator
T1567 2739-2750 NN denotes plasminogen
T1566 2724-2738 JJ denotes urokinase-type
T1565 2721-2723 IN denotes of
T1564 2711-2720 NN denotes inhibitor
T1563 2708-2710 DT denotes an
T1562 2705-2707 IN denotes as
T1561 2694-2704 VB denotes identified
T1560 2688-2693 RB denotes first
T1559 2684-2687 VB denotes was
T1558 2675-2683 NN denotes SerpinB2
T1557 2672-2673 -RRB- denotes ]
T1556 2671-2672 CD denotes 5
T1555 2670-2671 -LRB- denotes [
T1554 2668-2669 -COLON- denotes ;
T1553 2667-2668 -RRB- denotes ]
T1552 2666-2667 CD denotes 4
T1551 2665-2666 -LRB- denotes [
T1550 2658-2664 NN denotes factor
T1549 2649-2657 NN denotes survival
T1548 2638-2648 NN denotes macrophage
T1547 2627-2637 VB denotes recognized
T1546 2620-2626 RB denotes widely
T1545 2618-2619 DT denotes a
T1544 2616-2617 -COMMA- denotes ,
T1543 2608-2616 NN denotes SerpinB2
T1542 2606-2607 -RRB- denotes )
T1541 2597-2606 NN denotes ov-serpin
T1540 2596-2597 -LRB- denotes (
T1539 2586-2595 NN denotes inhibitor
T1538 2577-2585 NN denotes protease
T1537 2570-2576 NN denotes serine
T1536 2555-2569 JJ denotes ovalbumin-like
T1535 2551-2554 DT denotes the
T1534 2548-2550 VB denotes is
T1533 2542-2547 VB denotes known
T1532 2533-2541 NN denotes products
T1531 2528-2532 NN denotes gene
T1530 2517-2527 NN denotes macrophage
T1529 2503-2516 JJ denotes LPS-inducible
T1528 2498-2502 RB denotes most
T1527 2494-2497 DT denotes the
T1526 2491-2493 IN denotes of
T1525 2487-2490 CD denotes One
T1524 2476-2485 NN denotes responses
T1523 2469-2475 JJ denotes immune
T1522 2460-2468 JJ denotes adaptive
T1521 2457-2459 IN denotes of
T1520 2445-2456 NN denotes development
T1519 2434-2444 JJ denotes subsequent
T1518 2430-2433 CC denotes and
T1517 2415-2429 NN denotes neutralization
T1516 2406-2414 NN denotes pathogen
T1515 2398-2405 JJ denotes initial
T1514 2394-2397 IN denotes for
T1513 2385-2393 JJ denotes critical
T1512 2382-2384 VB denotes is
T1511 2373-2381 NN denotes survival
T1510 2367-2372 PRP-DOLLAR- denotes their
T1509 2365-2366 -COMMA- denotes ,
T1508 2356-2365 NN denotes responses
T1507 2349-2355 JJ denotes immune
T1506 2342-2348 JJ denotes innate
T1505 2325-2341 JJ denotes pathogen-induced
T1504 2322-2324 IN denotes of
T1503 2312-2321 NN denotes effectors
T1502 2308-2311 JJ denotes key
T1501 2304-2307 VB denotes are
T1500 2292-2303 NN denotes macrophages
T1499 2289-2291 IN denotes As
T1498 2284-2287 NN denotes LPS
T1497 2274-2283 NN denotes component
T1496 2269-2273 NN denotes wall
T1495 2264-2268 NN denotes cell
T1494 2254-2263 JJ denotes bacterial
T1493 2240-2253 JJ denotes gram-negative
T1492 2236-2239 DT denotes the
T1491 2233-2235 TO denotes to
T1490 2224-2232 NN denotes exposure
T1489 2219-2223 IN denotes upon
T1488 2207-2218 NN denotes macrophages
T1487 2204-2206 IN denotes by
T1486 2194-2203 VB denotes expressed
T1485 2185-2193 NN denotes products
T1484 2180-2184 NN denotes gene
T1483 2170-2179 JJ denotes inducible
T1482 2164-2169 JJ denotes other
T1481 2160-2163 CC denotes and
T1480 2150-2159 NN denotes cytokines
T1479 2147-2149 IN denotes by
T1478 2138-2146 VB denotes mediated
T1477 2134-2137 VB denotes are
T1476 2125-2133 NN denotes response
T1475 2112-2124 JJ denotes inflammatory
T1474 2108-2111 DT denotes the
T1473 2105-2107 IN denotes of
T1472 2090-2104 NN denotes manifestations
T1460 2049-2055 NN denotes cancer
T1459 2044-2048 RB denotes even
T1458 2040-2043 CC denotes and
T1457 2038-2039 -COMMA- denotes ,
T1456 2032-2038 NN denotes sepsis
T1455 2030-2031 -COMMA- denotes ,
T1454 2024-2030 NN denotes damage
T1453 2018-2023 NN denotes organ
T1452 2015-2017 TO denotes to
T1451 2010-2014 VB denotes lead
T1450 2006-2009 MD denotes may
T1449 2003-2005 PRP denotes it
T1448 2001-2002 -COMMA- denotes ,
T1447 1989-2001 JJ denotes Uncontrolled
T1446 1983-1987 NN denotes body
T1445 1979-1982 DT denotes the
T1444 1974-1978 IN denotes from
T1443 1964-1973 NN denotes pathogens
T1442 1955-1963 VB denotes invading
T1441 1951-1954 CC denotes and
T1440 1941-1950 NN denotes molecules
T1439 1933-1940 JJ denotes foreign
T1438 1930-1932 IN denotes of
T1437 1921-1929 NN denotes clearing
T1436 1917-1920 DT denotes the
T1435 1914-1916 IN denotes in
T1434 1906-1913 VB denotes results
T1433 1903-1905 PRP denotes it
T1432 1901-1902 -COMMA- denotes ,
T1431 1889-1901 VB denotes orchestrated
T1430 1880-1888 RB denotes Properly
T1429 1873-1878 NN denotes sword
T1428 1860-1872 JJ denotes double-edged
T1427 1858-1859 DT denotes a
T1426 1855-1857 VB denotes is
T1425 1846-1854 NN denotes response
T1424 1833-1845 JJ denotes inflammatory
T1423 1829-1832 DT denotes The
T1867 4265-4276 VB denotes upregulated
T1866 4261-4264 VB denotes was
T1865 4250-4260 NN denotes expression
T1864 4244-4249 WP-DOLLAR- denotes whose
T1862 4235-4236 DT denotes a
T1861 4232-4234 IN denotes as
T1860 4221-4231 VB denotes identified
T1859 4217-4220 VB denotes was
T1858 4208-4216 NN denotes SerpinB2
T1857 4206-4207 -COMMA- denotes ,
T1856 4202-4206 NN denotes MAPK
T1855 4198-4201 NN denotes p38
T1854 4195-4197 IN denotes of
T1853 4184-4194 RB denotes downstream
T1852 4176-4183 NN denotes factors
T1851 4163-4175 JJ denotes pro-survival
T1850 4149-4162 JJ denotes LPS-inducible
T1849 4137-4148 VB denotes identifying
T1848 4134-4136 IN denotes at
T1847 4128-4133 VB denotes aimed
T1846 4120-4127 NN denotes studies
T1845 4117-4119 IN denotes In
T1844 4114-4115 -RRB- denotes ]
T1843 4112-4114 CD denotes 33
T1842 4111-4112 -LRB- denotes [
T1841 4102-4110 NN denotes pathways
T1840 4094-4101 NN denotes -kinase
T1839 4093-4094 -RRB- denotes )
T1838 4090-4093 NN denotes PI3
T1837 4089-4090 -LRB- denotes (
T1836 4088-4089 CD denotes 3
T1835 4071-4087 NN denotes phosphoinositide
T1834 4064-4070 CC denotes and/or
T1833 4062-4063 -RRB- denotes )
T1832 4058-4062 NN denotes MAPK
T1831 4057-4058 -LRB- denotes (
T1830 4050-4056 NN denotes kinase
T1829 4042-4049 NN denotes protein
T1828 4024-4041 JJ denotes mitogen-activated
T1827 4022-4023 -COMMA- denotes ,
T1826 4021-4022 -RRB- denotes )
T1825 4016-4021 NN denotes NF-κB
T1824 4015-4016 -LRB- denotes (
T1823 4005-4014 NN denotes factor-κB
T1822 3997-4004 JJ denotes nuclear
T1821 3993-3996 DT denotes the
T1820 3990-3992 TO denotes to
T1819 3982-3989 NN denotes signals
T1818 3971-3981 VB denotes generating
T1817 3969-3970 -COMMA- denotes ,
T1816 3962-3969 NN denotes kinases
T1815 3954-3961 NN denotes protein
T1814 3951-3953 IN denotes of
T1813 3940-3950 NN denotes activation
T1812 3936-3939 DT denotes the
T1811 3932-3935 CC denotes and
T1810 3922-3931 NN denotes molecules
T1809 3914-3921 NN denotes adaptor
T1808 3911-3913 IN denotes of
T1807 3899-3910 NN denotes recruitment
T1806 3895-3898 DT denotes the
T1805 3892-3894 TO denotes to
T1804 3886-3891 VB denotes leads
T1803 3874-3885 NN denotes macrophages
T1802 3871-3873 IN denotes of
T1801 3863-3870 NN denotes surface
T1800 3859-3862 DT denotes the
T1799 3856-3858 IN denotes on
T1798 3851-3855 NN denotes TLR4
T1797 3848-3850 TO denotes to
T1796 3844-3847 NN denotes LPS
T1795 3841-3843 IN denotes of
T1794 3833-3840 NN denotes binding
T1793 3829-3832 DT denotes The
T1792 3820-3827 NN denotes release
T1791 3811-3819 NN denotes cytokine
T1790 3801-3810 VB denotes including
T1789 3799-3800 -COMMA- denotes ,
T1788 3790-3799 NN denotes responses
T1787 3783-3789 JJ denotes immune
T1786 3776-3782 JJ denotes innate
T1785 3773-3775 IN denotes of
T1784 3762-3772 NN denotes initiation
T1783 3758-3761 DT denotes the
T1782 3755-3757 IN denotes in
T1781 3750-3754 NN denotes role
T1780 3742-3749 JJ denotes central
T1779 3740-3741 DT denotes a
T1778 3734-3739 VB denotes plays
T1777 3730-3733 CC denotes and
T1776 3721-3729 NN denotes products
T1775 3711-3720 JJ denotes microbial
T1774 3705-3710 JJ denotes other
T1773 3701-3704 CC denotes and
T1772 3697-3700 NN denotes LPS
T1771 3694-3696 IN denotes of
T1770 3682-3693 NN denotes recognition
T1769 3678-3681 DT denotes the
T1768 3674-3677 IN denotes for
T1767 3662-3673 JJ denotes responsible
T1766 3659-3661 VB denotes is
T1765 3657-3658 -RRB- denotes )
T1764 3653-3657 NN denotes TLR4
T1763 3652-3653 -LRB- denotes (
T1762 3650-3651 CD denotes 4
T1761 3641-3649 NN denotes receptor
T1760 3631-3640 JJ denotes toll-like
T1759 3627-3630 DT denotes The
T1758 3617-3625 NN denotes pathways
T1757 3606-3616 NN denotes signalling
T1756 3597-3605 JJ denotes multiple
T1755 3589-3596 IN denotes through
T1754 3579-3588 NN denotes responses
T1753 3572-3578 JJ denotes immune
T1752 3562-3571 VB denotes activates
T1751 3558-3561 NN denotes LPS
T1750 3555-3556 -RRB- denotes ]
T1749 3554-3555 CD denotes 9
T1748 3553-3554 -LRB- denotes [
T1747 3543-3552 NN denotes mediators
T1746 3530-3542 JJ denotes inflammatory
T1745 3527-3529 IN denotes of
T1744 3521-3526 NN denotes range
T1743 3519-3520 DT denotes a
T1742 3516-3518 IN denotes by
T1741 3503-3515 VB denotes up-regulated
T1740 3500-3502 VB denotes is
T1739 3496-3499 CC denotes and
T1738 3494-3495 -COMMA- denotes ,
T1737 3493-3494 -RRB- denotes ]
T1736 3491-3493 CD denotes 32
T1735 3490-3491 -LRB- denotes [
T1734 3489-3490 CD denotes –
T1733 3488-3489 -RRB- denotes ]
T1732 3486-3488 CD denotes 31
T1731 3485-3486 -LRB- denotes [
T1730 3481-3484 NN denotes LPS
T1729 3478-3480 IN denotes by
T1728 3468-3477 RB denotes 1000-fold
T1727 3463-3467 IN denotes over
T1726 3455-3462 VB denotes induced
T1725 3452-3454 VB denotes be
T1724 3448-3451 MD denotes can
T1723 3444-3447 CC denotes and
T1722 3442-3443 -COMMA- denotes ,
T1721 3441-3442 -RRB- denotes ]
T1720 3439-3441 CD denotes 31
T1719 3438-3439 -LRB- denotes [
T1718 3432-3437 VB denotes known
T1717 3426-3431 NN denotes genes
T1716 3415-3425 JJ denotes responsive
T1715 3410-3414 RB denotes most
T1714 3406-3409 DT denotes the
T1713 3403-3405 IN denotes of
T1712 3399-3402 CD denotes one
T1711 3396-3398 VB denotes is
T1710 3393-3395 PRP denotes It
T1709 3390-3391 -RRB- denotes ]
T1708 3388-3390 CD denotes 30
T1707 3387-3388 -LRB- denotes [
T1706 3385-3386 -COLON- denotes ;
T1705 3384-3385 -RRB- denotes ]
T1704 3382-3384 CD denotes 29
T1703 3381-3382 -LRB- denotes [
T1702 3371-3380 NN denotes oncogenes
T1701 3367-3370 CC denotes and
T1700 3357-3366 NN denotes cytokines
T1699 3354-3356 IN denotes of
T1698 3349-3353 DT denotes that
T1697 3346-3348 TO denotes to
T1696 3336-3345 JJ denotes analogous
T1695 3329-3335 NN denotes manner
T1694 3320-3328 JJ denotes specific
T1693 3315-3319 NN denotes type
T1692 3310-3314 NN denotes cell
T1691 3308-3309 DT denotes a
T1690 3305-3307 IN denotes in
T1689 3295-3304 VB denotes regulated
T1688 3288-3294 RB denotes highly
T1471 2077-2089 JJ denotes pathological
T1470 2073-2076 DT denotes the
T1469 2070-2072 IN denotes of
T1468 2065-2069 JJ denotes Many
T1467 2062-2063 -RRB- denotes ]
T1466 2061-2062 CD denotes 3
T1465 2060-2061 -LRB- denotes [
T1464 2059-2060 -DQE- denotes –
T1463 2058-2059 -RRB- denotes ]
T1462 2057-2058 CD denotes 1
T1461 2056-2057 -LRB- denotes [
T490 1803-1813 NN denotes expression
T489 1794-1802 NN denotes SerpinB2
T488 1770-1793 JJ denotes inflammation-associated
T487 1767-1769 IN denotes of
T486 1756-1766 NN denotes regulation
T485 1738-1755 JJ denotes C/EBP-β-dependent
T484 1733-1737 IN denotes into
T483 1725-1732 NN denotes insight
T482 1721-1724 JJ denotes new
T481 1713-1720 VB denotes provide
T480 1708-1712 NN denotes data
T479 1702-1707 DT denotes these
T478 1700-1701 -COMMA- denotes ,
T477 1692-1700 RB denotes Together
T476 1679-1690 NN denotes macrophages
T475 1668-1678 JJ denotes peritoneal
T474 1650-1667 JJ denotes C/EBP-β-deficient
T267 316-318 IN denotes of
T266 305-315 NN denotes modulation
T265 301-304 DT denotes the
T264 298-300 TO denotes to
T263 291-297 VB denotes linked
T262 288-290 VB denotes is
T261 284-287 CC denotes and
T260 276-283 NN denotes stimuli
T259 263-275 JJ denotes inflammatory
T258 260-262 TO denotes to
T257 251-259 NN denotes response
T256 248-250 IN denotes in
T255 236-247 NN denotes macrophages
T254 233-235 IN denotes in
T253 225-232 VB denotes induced
T252 218-224 RB denotes highly
T251 215-217 VB denotes is
T250 213-214 -RRB- denotes )
T249 208-213 NN denotes PAI-2
T248 207-208 -LRB- denotes (
T247 205-206 CD denotes 2
T246 200-204 NN denotes type
T245 190-199 NN denotes inhibitor
T244 180-189 NN denotes activator
T243 168-179 NN denotes plasminogen
T242 165-167 CC denotes or
T241 156-164 NN denotes SerpinB2
T473 1642-1649 JJ denotes primary
T472 1638-1641 CC denotes and
T471 1636-1637 -RRB- denotes )
T470 1632-1636 NN denotes MEFs
T469 1631-1632 -LRB- denotes (
T468 1619-1630 NN denotes fibroblasts
T467 1609-1618 JJ denotes embryonic
T466 1603-1608 NN denotes mouse
T465 1590-1602 JJ denotes C/EBP-β-null
T464 1587-1589 IN denotes in
T463 1577-1586 VB denotes abrogated
T462 1568-1576 RB denotes severely
T461 1564-1567 VB denotes was
T460 1553-1563 NN denotes expression
T459 1544-1552 NN denotes SerpinB2
T458 1532-1543 JJ denotes LPS-induced
T457 1528-1531 CC denotes and
T456 1515-1527 JJ denotes constitutive
T455 1510-1514 CC denotes both
T454 1508-1509 -COMMA- denotes ,
T453 1497-1508 RB denotes Importantly
T452 1487-1495 NN denotes promoter
T451 1478-1486 NN denotes SerpinB2
T450 1474-1477 DT denotes the
T449 1469-1473 IN denotes with
T448 1459-1468 NN denotes complexes
T447 1448-1458 VB denotes containing
T446 1440-1447 NN denotes C/EBP-β
T445 1437-1439 IN denotes of
T444 1427-1436 NN denotes formation
T443 1423-1426 DT denotes the
T442 1415-1422 VB denotes induces
T441 1411-1414 NN denotes LPS
T440 1406-1410 IN denotes that
T439 1393-1405 VB denotes demonstrated
T438 1386-1392 NN denotes assays
T437 1384-1385 -RRB- denotes )
T436 1380-1384 NN denotes ChIP
T435 1379-1380 -LRB- denotes (
T434 1359-1378 NN denotes immunoprecipitation
T433 1349-1358 NN denotes chromatin
T432 1345-1348 CC denotes and
T431 1343-1344 -RRB- denotes )
T430 1339-1343 NN denotes EMSA
T429 1338-1339 -LRB- denotes (
T428 1332-1337 NN denotes shift
T427 1323-1331 NN denotes mobility
T426 1307-1322 JJ denotes Electrophoretic
T425 1289-1305 NN denotes LPS-inducibility
T424 1281-1288 JJ denotes optimal
T423 1277-1280 IN denotes for
T422 1267-1276 JJ denotes essential
T421 1263-1266 VB denotes are
T420 1254-1262 NN denotes promoter
T419 1245-1253 JJ denotes proximal
T418 1236-1244 NN denotes SerpinB2
T417 1229-1235 JJ denotes murine
T416 1225-1228 DT denotes the
T415 1222-1224 IN denotes in
T414 1213-1221 NN denotes elements
T413 1204-1212 NN denotes response
T412 1202-1203 -RRB- denotes )
T411 1198-1202 NN denotes AP-1
T410 1197-1198 -LRB- denotes (
T409 1195-1196 CD denotes 1
T408 1187-1194 NN denotes protein
T407 1177-1186 NN denotes activator
T406 1173-1176 CD denotes two
T405 1169-1172 CC denotes and
T404 1167-1168 -RRB- denotes )
T403 1164-1167 NN denotes CRE
T307 553-555 CD denotes 24
T306 550-552 IN denotes of
T305 543-549 NN denotes period
T304 541-542 DT denotes a
T303 536-540 IN denotes over
T302 525-535 RB denotes ∼1000-fold
T301 522-524 IN denotes by
T300 520-521 -RRB- denotes )
T299 516-520 NN denotes TLR4
T298 515-516 -LRB- denotes (
T297 513-514 CD denotes 4
T296 504-512 NN denotes receptor
T295 494-503 JJ denotes toll-like
T294 490-493 DT denotes the
T293 486-489 IN denotes via
T292 475-485 NN denotes expression
T291 466-474 NN denotes SerpinB2
T290 459-465 VB denotes induce
T289 455-458 MD denotes can
T288 453-454 -COMMA- denotes ,
T287 444-453 NN denotes endotoxin
T286 434-443 JJ denotes bacterial
T285 427-433 JJ denotes potent
T284 425-426 DT denotes a
T283 423-424 -COMMA- denotes ,
T282 422-423 -RRB- denotes )
T281 419-422 NN denotes LPS
T280 418-419 -LRB- denotes (
T279 399-417 NN denotes Lipopolysaccharide
T278 387-397 NN denotes activators
T277 375-386 NN denotes plasminogen
T276 372-374 IN denotes of
T275 361-371 NN denotes inhibition
T274 357-360 CC denotes and
T273 355-356 -COMMA- denotes ,
T272 347-355 NN denotes survival
T271 336-346 NN denotes macrophage
T270 334-335 -COMMA- denotes ,
T269 326-334 NN denotes immunity
T268 319-325 JJ denotes innate
T347 807-815 VB denotes compared
T346 804-806 PRP denotes we
T345 802-803 -COMMA- denotes ,
T344 794-802 NN denotes addition
T343 791-793 IN denotes In
T342 778-789 NN denotes macrophages
T341 771-777 JJ denotes murine
T340 766-770 IN denotes into
T339 758-765 NN denotes mutants
T338 749-757 NN denotes deletion
T337 741-748 JJ denotes several
T336 737-740 CC denotes and
T335 732-736 NN denotes gene
T334 723-731 NN denotes SerpinB2
T333 716-722 JJ denotes murine
T332 712-715 DT denotes the
T331 709-711 IN denotes of
T330 702-708 NN denotes region
T329 690-701 JJ denotes 5'-flanking
T328 687-689 NN denotes kb
T327 684-686 CD denotes ∼5
T326 680-683 DT denotes the
T325 677-679 IN denotes by
T324 670-676 VB denotes driven
T323 659-669 NN denotes constructs
T322 650-658 NN denotes reporter
T321 638-649 VB denotes transfected
T320 635-637 PRP denotes we
T319 633-634 -COMMA- denotes ,
T318 626-633 NN denotes regions
T317 617-625 NN denotes promoter
T316 608-616 NN denotes SerpinB2
T315 594-607 JJ denotes LPS-regulated
T314 590-593 DT denotes the
T313 586-589 VB denotes map
T312 583-585 TO denotes To
T311 570-581 NN denotes macrophages
T310 563-569 JJ denotes murine
T309 560-562 IN denotes in
T308 556-559 NN denotes hrs
T402 1163-1164 -LRB- denotes (
T401 1155-1162 NN denotes element
T400 1146-1154 NN denotes response
T399 1142-1145 NN denotes AMP
T398 1135-1141 JJ denotes cyclic
T397 1133-1134 DT denotes a
T396 1131-1132 -COMMA- denotes ,
T395 1124-1131 NN denotes element
T394 1122-1123 -RRB- denotes )
T393 1117-1122 NN denotes C/EBP
T392 1116-1117 -LRB- denotes (
T391 1108-1115 NN denotes binding
T390 1099-1107 NN denotes enhancer
T389 1093-1098 NN denotes CCAAT
T388 1091-1092 DT denotes a
T387 1086-1090 IN denotes that
T386 1077-1085 VB denotes revealed
T385 1068-1076 NN denotes analyses
T384 1059-1067 NN denotes Mutation
T383 1052-1057 NN denotes mouse
T382 1048-1051 DT denotes the
T381 1045-1047 IN denotes in
T380 1035-1044 VB denotes conserved
T379 1026-1034 NN denotes promoter
T378 1017-1025 NN denotes SERPINB2
T377 1011-1016 JJ denotes human
T376 1007-1010 DT denotes the
T375 1004-1006 IN denotes in
T374 995-1003 NN denotes elements
T373 984-994 JJ denotes cis-acting
T372 973-983 JJ denotes regulatory
T371 965-972 JJ denotes several
T370 954-964 VB denotes identified
T369 950-953 CC denotes and
T368 941-949 NN denotes elements
T367 930-940 JJ denotes regulatory
T366 919-929 JJ denotes functional
T365 908-918 JJ denotes homologous
T364 904-907 IN denotes for
T363 899-903 NN denotes gene
T362 893-898 JJ denotes human
T361 889-892 DT denotes the
T360 886-888 IN denotes of
T359 877-885 NN denotes sequence
T358 873-876 DT denotes the
T357 868-872 IN denotes with
T356 859-867 NN denotes sequence
T355 850-858 NN denotes flanking
T354 847-849 NN denotes 5′
T353 840-846 JJ denotes murine
T352 836-839 DT denotes the
T351 833-835 IN denotes of
T350 824-832 NN denotes sequence
T349 820-823 NN denotes DNA
T348 816-819 DT denotes the
T229 0-3 DT denotes The
T230 4-17 NNP denotes Transcription
T231 18-24 NNP denotes Factor
T232 25-32 NNP denotes C/EBP-β
T233 33-41 NNP denotes Mediates
T234 42-54 NNP denotes Constitutive
T235 55-58 CC denotes and
T236 59-72 JJ denotes LPS-Inducible
T237 73-86 NN denotes Transcription
T238 87-89 IN denotes of
T3604 6704-6713 JJ denotes Real-time
T24233 29534-29543 NN denotes arrowhead
T24232 29531-29533 DT denotes an
T24231 29526-29530 IN denotes with
T24230 29516-29525 VB denotes indicated
T24229 29513-29515 VB denotes is
T24228 29505-29512 NN denotes complex
T24227 29491-29504 JJ denotes LPS-inducible
T24226 29487-29490 DT denotes The
T24225 28783-28790 NN denotes C/EBP-β
T24224 28774-28782 VB denotes contains
T24223 28769-28773 NN denotes site
R47 T240 T238 arg2Of SerpinB2,of
R48 T240 T239 arg1Of SerpinB2,Murine
R49 T241 T242 arg1Of SerpinB2,or
R50 T243 T242 arg2Of plasminogen,or
R51 T246 T241 arg1Of type,SerpinB2
R52 T246 T243 arg1Of type,plasminogen
R53 T246 T244 arg1Of type,activator
R54 T246 T245 arg1Of type,inhibitor
R55 T246 T247 arg1Of type,2
R56 T246 T248 arg1Of type,(
R57 T246 T251 arg1Of type,is
R58 T246 T253 arg2Of type,induced
R59 T246 T262 arg1Of type,is
R60 T246 T263 arg2Of type,linked
R61 T249 T248 arg2Of PAI-2,(
R62 T250 T248 arg3Of ),(
R63 T253 T251 arg2Of induced,is
R64 T253 T252 arg1Of induced,highly
R65 T253 T254 arg1Of induced,in
R66 T253 T256 arg1Of induced,in
R67 T253 T261 arg1Of induced,and
R68 T255 T254 arg2Of macrophages,in
R69 T257 T256 arg2Of response,in
R70 T257 T258 arg1Of response,to
R71 T260 T258 arg2Of stimuli,to
R72 T260 T259 arg1Of stimuli,inflammatory
R73 T263 T261 arg2Of linked,and
R74 T263 T262 arg2Of linked,is
R75 T263 T264 arg1Of linked,to
R76 T266 T264 arg2Of modulation,to
R77 T266 T265 arg1Of modulation,the
R78 T266 T267 arg1Of modulation,of
R79 T269 T268 arg1Of immunity,innate
R80 T269 T270 arg1Of immunity,","
R81 T270 T274 arg1Of ",",and
R82 T272 T270 arg2Of survival,","
R83 T272 T271 arg1Of survival,macrophage
R84 T274 T267 arg2Of and,of
R85 T274 T273 arg1Of and,","
R86 T275 T274 arg2Of inhibition,and
R87 T275 T276 arg1Of inhibition,of
R88 T278 T276 arg2Of activators,of
R89 T278 T277 arg1Of activators,plasminogen
R90 T279 T280 arg1Of Lipopolysaccharide,(
R91 T279 T283 arg1Of Lipopolysaccharide,","
R92 T279 T289 arg1Of Lipopolysaccharide,can
R93 T279 T290 arg1Of Lipopolysaccharide,induce
R94 T281 T280 arg2Of LPS,(
R95 T282 T280 arg3Of ),(
R96 T287 T283 arg2Of endotoxin,","
R97 T287 T284 arg1Of endotoxin,a
R98 T287 T285 arg1Of endotoxin,potent
R99 T287 T286 arg1Of endotoxin,bacterial
R100 T290 T288 arg1Of induce,","
R101 T290 T289 arg2Of induce,can
R102 T290 T293 arg1Of induce,via
R103 T290 T301 arg1Of induce,by
R104 T290 T303 arg1Of induce,over
R105 T292 T290 arg2Of expression,induce
R106 T292 T291 arg1Of expression,SerpinB2
R107 T296 T293 arg2Of receptor,via
R108 T296 T294 arg1Of receptor,the
R109 T296 T295 arg1Of receptor,toll-like
R110 T296 T297 arg1Of receptor,4
R111 T296 T298 arg1Of receptor,(
R112 T299 T298 arg2Of TLR4,(
R113 T300 T298 arg3Of ),(
R114 T302 T301 arg2Of ∼1000-fold,by
R115 T305 T303 arg2Of period,over
R116 T305 T304 arg1Of period,a
R117 T305 T306 arg1Of period,of
R118 T305 T309 arg1Of period,in
R119 T308 T306 arg2Of hrs,of
R120 T308 T307 arg1Of hrs,24
R121 T311 T309 arg2Of macrophages,in
R122 T311 T310 arg1Of macrophages,murine
R123 T313 T312 arg1Of map,To
R124 T318 T313 arg2Of regions,map
R125 T318 T314 arg1Of regions,the
R126 T318 T315 arg1Of regions,LPS-regulated
R127 T318 T316 arg1Of regions,SerpinB2
R128 T318 T317 arg1Of regions,promoter
R129 T320 T313 arg1Of we,map
R130 T320 T321 arg1Of we,transfected
R131 T321 T312 modOf transfected,To
R132 T321 T319 arg1Of transfected,","
R133 T323 T321 arg2Of constructs,transfected
R134 T323 T322 arg1Of constructs,reporter
R135 T323 T324 arg2Of constructs,driven
R136 T330 T324 arg1Of region,driven
R137 T330 T325 arg2Of region,by
R138 T330 T326 arg1Of region,the
R139 T330 T327 arg1Of region,∼5
R140 T330 T328 arg1Of region,kb
R141 T330 T329 arg1Of region,5'-flanking
R142 T330 T331 arg1Of region,of
R143 T330 T340 arg1Of region,into
R144 T335 T332 arg1Of gene,the
R145 T335 T333 arg1Of gene,murine
R146 T335 T334 arg1Of gene,SerpinB2
R147 T335 T336 arg1Of gene,and
R148 T336 T331 arg2Of and,of
R149 T339 T336 arg2Of mutants,and
R150 T339 T337 arg1Of mutants,several
R151 T339 T338 arg1Of mutants,deletion
R152 T342 T340 arg2Of macrophages,into
R153 T342 T341 arg1Of macrophages,murine
R154 T344 T343 arg2Of addition,In
R155 T346 T347 arg1Of we,compared
R156 T346 T370 arg1Of we,identified
R157 T347 T369 arg1Of compared,and
R158 T350 T347 arg2Of sequence,compared
R159 T350 T348 arg1Of sequence,the
R160 T350 T349 arg1Of sequence,DNA
R161 T350 T351 arg1Of sequence,of
R162 T350 T357 arg1Of sequence,with
R163 T356 T351 arg2Of sequence,of
R164 T356 T352 arg1Of sequence,the
R165 T356 T353 arg1Of sequence,murine
R166 T356 T354 arg1Of sequence,5′
R167 T356 T355 arg1Of sequence,flanking
R168 T359 T357 arg2Of sequence,with
R169 T359 T358 arg1Of sequence,the
R170 T359 T360 arg1Of sequence,of
R171 T359 T364 arg1Of sequence,for
R172 T363 T360 arg2Of gene,of
R173 T363 T361 arg1Of gene,the
R174 T363 T362 arg1Of gene,human
R175 T368 T364 arg2Of elements,for
R176 T368 T365 arg1Of elements,homologous
R177 T368 T366 arg1Of elements,functional
R178 T368 T367 arg1Of elements,regulatory
R179 T369 T343 arg1Of and,In
R180 T369 T345 arg1Of and,","
R181 T370 T369 arg2Of identified,and
R182 T374 T370 arg2Of elements,identified
R183 T374 T371 arg1Of elements,several
R184 T374 T372 arg1Of elements,regulatory
R185 T374 T373 arg1Of elements,cis-acting
R186 T374 T375 arg1Of elements,in
R187 T379 T375 arg2Of promoter,in
R188 T379 T376 arg1Of promoter,the
R189 T379 T377 arg1Of promoter,human
R190 T379 T378 arg1Of promoter,SERPINB2
R191 T379 T380 arg2Of promoter,conserved
R192 T380 T381 arg1Of conserved,in
R193 T383 T381 arg2Of mouse,in
R194 T383 T382 arg1Of mouse,the
R195 T385 T384 arg1Of analyses,Mutation
R196 T385 T386 arg1Of analyses,revealed
R197 T393 T392 arg2Of C/EBP,(
R198 T394 T392 arg3Of ),(
R199 T395 T388 arg1Of element,a
R200 T395 T389 arg1Of element,CCAAT
R201 T395 T390 arg1Of element,enhancer
R202 T395 T391 arg1Of element,binding
R203 T395 T392 arg1Of element,(
R204 T395 T396 arg1Of element,","
R205 T395 T405 arg1Of element,and
R206 T401 T396 arg2Of element,","
R207 T401 T397 arg1Of element,a
R208 T401 T398 arg1Of element,cyclic
R209 T401 T399 arg1Of element,AMP
R210 T401 T400 arg1Of element,response
R211 T401 T402 arg1Of element,(
R212 T403 T402 arg2Of CRE,(
R213 T404 T402 arg3Of ),(
R214 T405 T421 arg1Of and,are
R215 T405 T422 arg1Of and,essential
R216 T407 T406 arg1Of activator,two
R217 T408 T409 arg1Of protein,1
R218 T411 T410 arg2Of AP-1,(
R219 T412 T410 arg3Of ),(
R220 T414 T405 arg2Of elements,and
R221 T414 T407 arg1Of elements,activator
R222 T414 T408 arg1Of elements,protein
R223 T414 T410 arg1Of elements,(
R224 T414 T413 arg1Of elements,response
R225 T414 T415 arg1Of elements,in
R226 T420 T415 arg2Of promoter,in
R227 T420 T416 arg1Of promoter,the
R228 T420 T417 arg1Of promoter,murine
R229 T420 T418 arg1Of promoter,SerpinB2
R230 T420 T419 arg1Of promoter,proximal
R231 T421 T386 arg2Of are,revealed
R232 T421 T387 arg1Of are,that
R233 T422 T421 arg2Of essential,are
R234 T422 T423 arg1Of essential,for
R235 T425 T423 arg2Of LPS-inducibility,for
R236 T425 T424 arg1Of LPS-inducibility,optimal
R237 T428 T426 arg1Of shift,Electrophoretic
R238 T428 T427 arg1Of shift,mobility
R239 T428 T429 arg1Of shift,(
R240 T428 T432 arg1Of shift,and
R241 T430 T429 arg2Of EMSA,(
R242 T431 T429 arg3Of ),(
R243 T434 T432 arg2Of immunoprecipitation,and
R244 T434 T433 arg1Of immunoprecipitation,chromatin
R245 T434 T435 arg1Of immunoprecipitation,(
R246 T436 T435 arg2Of ChIP,(
R247 T437 T435 arg3Of ),(
R248 T438 T428 arg1Of assays,shift
R249 T438 T434 arg1Of assays,immunoprecipitation
R250 T438 T439 arg1Of assays,demonstrated
R251 T441 T442 arg1Of LPS,induces
R252 T442 T439 arg2Of induces,demonstrated
R253 T442 T440 arg1Of induces,that
R254 T444 T442 arg2Of formation,induces
R255 T444 T443 arg1Of formation,the
R256 T444 T445 arg1Of formation,of
R257 T446 T445 arg2Of C/EBP-β,of
R258 T446 T447 arg1Of C/EBP-β,containing
R259 T448 T447 arg2Of complexes,containing
R260 T448 T449 arg1Of complexes,with
R261 T452 T449 arg2Of promoter,with
R262 T452 T450 arg1Of promoter,the
R263 T452 T451 arg1Of promoter,SerpinB2
R264 T456 T457 arg1Of constitutive,and
R265 T458 T457 arg2Of LPS-induced,and
R266 T460 T455 arg1Of expression,both
R267 T460 T456 arg1Of expression,constitutive
R268 T460 T458 arg1Of expression,LPS-induced
R269 T460 T459 arg1Of expression,SerpinB2
R270 T460 T461 arg1Of expression,was
R271 T460 T463 arg2Of expression,abrogated
R272 T463 T453 arg1Of abrogated,Importantly
R273 T463 T454 arg1Of abrogated,","
R274 T463 T461 arg2Of abrogated,was
R275 T463 T462 arg1Of abrogated,severely
R276 T463 T464 arg1Of abrogated,in
R277 T468 T465 arg1Of fibroblasts,C/EBP-β-null
R278 T468 T466 arg1Of fibroblasts,mouse
R279 T468 T467 arg1Of fibroblasts,embryonic
R280 T468 T469 arg1Of fibroblasts,(
R281 T468 T472 arg1Of fibroblasts,and
R282 T470 T469 arg2Of MEFs,(
R283 T471 T469 arg3Of ),(
R284 T472 T464 arg2Of and,in
R285 T476 T472 arg2Of macrophages,and
R286 T476 T473 arg1Of macrophages,primary
R287 T476 T474 arg1Of macrophages,C/EBP-β-deficient
R288 T476 T475 arg1Of macrophages,peritoneal
R289 T480 T479 arg1Of data,these
R290 T480 T481 arg1Of data,provide
R291 T481 T477 arg1Of provide,Together
R292 T481 T478 arg1Of provide,","
R293 T483 T481 arg2Of insight,provide
R294 T483 T482 arg1Of insight,new
R295 T483 T484 arg1Of insight,into
R296 T486 T484 arg2Of regulation,into
R297 T486 T485 arg1Of regulation,C/EBP-β-dependent
R298 T486 T487 arg1Of regulation,of
R299 T490 T487 arg2Of expression,of
R300 T490 T488 arg1Of expression,inflammation-associated
R301 T490 T489 arg1Of expression,SerpinB2
R667 T234 T231 arg1Of Constitutive,Factor
R668 T234 T232 arg1Of Constitutive,C/EBP-β
R669 T234 T233 arg1Of Constitutive,Mediates
R670 T234 T235 arg1Of Constitutive,and
R671 T236 T235 arg2Of LPS-Inducible,and
R673 T237 T234 arg1Of Transcription,Constitutive
R674 T237 T236 arg1Of Transcription,LPS-Inducible
R675 T237 T238 arg1Of Transcription,of
R825 T1425 T1423 arg1Of response,The
R826 T1425 T1424 arg1Of response,inflammatory
R827 T1425 T1426 arg1Of response,is
R828 T1429 T1426 arg2Of sword,is
R829 T1429 T1427 arg1Of sword,a
R830 T1429 T1428 arg1Of sword,double-edged
R831 T1431 T1430 arg1Of orchestrated,Properly
R832 T1433 T1431 arg1Of it,orchestrated
R833 T1433 T1434 arg1Of it,results
R834 T1434 T1431 modOf results,orchestrated
R835 T1434 T1432 arg1Of results,","
R836 T1434 T1435 arg1Of results,in
R837 T1437 T1435 arg2Of clearing,in
R838 T1437 T1436 arg1Of clearing,the
R839 T1437 T1438 arg1Of clearing,of
R840 T1437 T1444 arg1Of clearing,from
R841 T1440 T1439 arg1Of molecules,foreign
R842 T1440 T1441 arg1Of molecules,and
R843 T1441 T1438 arg2Of and,of
R844 T1443 T1441 arg2Of pathogens,and
R845 T1443 T1442 arg1Of pathogens,invading
R846 T1446 T1444 arg2Of body,from
R847 T1446 T1445 arg1Of body,the
R848 T1449 T1450 arg1Of it,may
R849 T1449 T1451 arg1Of it,lead
R850 T1451 T1447 arg1Of lead,Uncontrolled
R851 T1451 T1448 arg1Of lead,","
R852 T1451 T1450 arg2Of lead,may
R853 T1451 T1452 arg1Of lead,to
R854 T1451 T1465 arg1Of lead,[
R855 T1454 T1453 arg1Of damage,organ
R856 T1454 T1455 arg1Of damage,","
R857 T1455 T1458 arg1Of ",",and
R858 T1456 T1455 arg2Of sepsis,","
R859 T1458 T1452 arg2Of and,to
R860 T1458 T1457 arg1Of and,","
R861 T1458 T1464 arg1Of and,–
R862 T1460 T1458 arg2Of cancer,and
R863 T1460 T1459 arg1Of cancer,even
R864 T1460 T1461 arg1Of cancer,[
R865 T1462 T1461 arg2Of 1,[
R866 T1463 T1461 arg3Of ],[
R867 T1466 T1465 arg2Of 3,[
R868 T1467 T1465 arg3Of ],[
R869 T1468 T1469 arg1Of Many,of
R870 T1468 T1477 arg1Of Many,are
R871 T1468 T1478 arg2Of Many,mediated
R872 T1472 T1469 arg2Of manifestations,of
R873 T1472 T1470 arg1Of manifestations,the
R874 T1472 T1471 arg1Of manifestations,pathological
R875 T1472 T1473 arg1Of manifestations,of
R876 T1476 T1473 arg2Of response,of
R877 T1476 T1474 arg1Of response,the
R878 T1476 T1475 arg1Of response,inflammatory
R879 T1478 T1477 arg2Of mediated,are
R880 T1480 T1481 arg1Of cytokines,and
R881 T1481 T1478 arg1Of and,mediated
R882 T1481 T1479 arg2Of and,by
R883 T1481 T1486 arg2Of and,expressed
R884 T1485 T1481 arg2Of products,and
R885 T1485 T1482 arg1Of products,other
R886 T1485 T1483 arg1Of products,inducible
R887 T1485 T1484 arg1Of products,gene
R888 T1486 T1489 arg1Of expressed,upon
R889 T1488 T1486 arg1Of macrophages,expressed
R890 T1488 T1487 arg2Of macrophages,by
R891 T1490 T1489 arg2Of exposure,upon
R892 T1490 T1491 arg1Of exposure,to
R893 T1498 T1491 arg2Of LPS,to
R894 T1498 T1492 arg1Of LPS,the
R895 T1498 T1493 arg1Of LPS,gram-negative
R896 T1498 T1494 arg1Of LPS,bacterial
R897 T1498 T1495 arg1Of LPS,cell
R898 T1498 T1496 arg1Of LPS,wall
R899 T1498 T1497 arg1Of LPS,component
R900 T1500 T1501 arg1Of macrophages,are
R901 T1501 T1499 arg2Of are,As
R902 T1503 T1501 arg2Of effectors,are
R903 T1503 T1502 arg1Of effectors,key
R904 T1503 T1504 arg1Of effectors,of
R905 T1508 T1504 arg2Of responses,of
R906 T1508 T1505 arg1Of responses,pathogen-induced
R907 T1508 T1506 arg1Of responses,innate
R908 T1508 T1507 arg1Of responses,immune
R909 T1511 T1510 arg1Of survival,their
R910 T1511 T1512 arg1Of survival,is
R911 T1511 T1513 arg1Of survival,critical
R912 T1512 T1499 arg1Of is,As
R913 T1512 T1509 arg1Of is,","
R914 T1513 T1512 arg2Of critical,is
R915 T1513 T1514 arg1Of critical,for
R916 T1517 T1515 arg1Of neutralization,initial
R917 T1517 T1516 arg1Of neutralization,pathogen
R918 T1517 T1518 arg1Of neutralization,and
R919 T1518 T1514 arg2Of and,for
R920 T1520 T1518 arg2Of development,and
R921 T1520 T1519 arg1Of development,subsequent
R922 T1520 T1521 arg1Of development,of
R923 T1524 T1521 arg2Of responses,of
R924 T1524 T1522 arg1Of responses,adaptive
R925 T1524 T1523 arg1Of responses,immune
R926 T1525 T1526 arg1Of One,of
R927 T1525 T1534 arg1Of One,is
R928 T1529 T1528 arg1Of LPS-inducible,most
R929 T1532 T1526 arg2Of products,of
R930 T1532 T1527 arg1Of products,the
R931 T1532 T1529 arg1Of products,LPS-inducible
R932 T1532 T1530 arg1Of products,macrophage
R933 T1532 T1531 arg1Of products,gene
R934 T1532 T1533 arg2Of products,known
R935 T1534 T1551 arg1Of is,[
R936 T1534 T1554 arg1Of is,;
R937 T1534 T1555 arg1Of is,[
R938 T1541 T1540 arg2Of ov-serpin,(
R939 T1542 T1540 arg3Of ),(
R940 T1543 T1534 arg2Of SerpinB2,is
R941 T1543 T1535 arg1Of SerpinB2,the
R942 T1543 T1536 arg1Of SerpinB2,ovalbumin-like
R943 T1543 T1537 arg1Of SerpinB2,serine
R944 T1543 T1538 arg1Of SerpinB2,protease
R945 T1543 T1539 arg1Of SerpinB2,inhibitor
R946 T1543 T1540 arg1Of SerpinB2,(
R947 T1543 T1544 arg1Of SerpinB2,","
R948 T1547 T1546 arg1Of recognized,widely
R949 T1550 T1544 arg2Of factor,","
R950 T1550 T1545 arg1Of factor,a
R951 T1550 T1547 arg1Of factor,recognized
R952 T1550 T1548 arg1Of factor,macrophage
R953 T1550 T1549 arg1Of factor,survival
R954 T1552 T1551 arg2Of 4,[
R955 T1553 T1551 arg3Of ],[
R956 T1556 T1555 arg2Of 5,[
R957 T1557 T1555 arg3Of ],[
R958 T1558 T1559 arg1Of SerpinB2,was
R959 T1558 T1561 arg2Of SerpinB2,identified
R960 T1561 T1559 arg2Of identified,was
R961 T1561 T1560 arg1Of identified,first
R962 T1561 T1562 arg1Of identified,as
R963 T1561 T1597 arg1Of identified,n
R964 T1561 T1600 arg1Of identified,p
R965 T1561 T1601 arg1Of identified,l
R966 T1564 T1562 arg2Of inhibitor,as
R967 T1564 T1563 arg1Of inhibitor,an
R968 T1564 T1565 arg1Of inhibitor,of
R969 T1564 T1572 arg1Of inhibitor,[
R970 T1564 T1575 arg1Of inhibitor,–
R971 T1564 T1578 arg1Of inhibitor,]
R972 T1568 T1565 arg2Of activator,of
R973 T1568 T1566 arg1Of activator,urokinase-type
R974 T1568 T1567 arg1Of activator,plasminogen
R975 T1568 T1569 arg1Of activator,(
R976 T1570 T1569 arg2Of uPA,(
R977 T1571 T1569 arg3Of ),(
R978 T1573 T1572 arg2Of 6,[
R979 T1574 T1572 arg3Of ],[
R980 T1576 T1575 arg2Of [,–
R981 T1577 T1575 arg3Of 8,–
R982 T1581 T1578 arg2Of ne prote,]
R983 T1581 T1579 arg1Of ne prote,","
R984 T1581 T1580 arg1Of ne prote,a seri
R985 T1581 T1582 arg2Of ne prote,ase invo
R986 T1582 T1583 arg1Of ase invo,lv
R987 T1585 T1586 arg1Of in the degr,ada
R988 T1586 T1583 arg2Of ada,lv
R989 T1586 T1584 arg1Of ada,ed
R990 T1586 T1588 arg1Of ada,tu
R991 T1586 T1592 arg1Of ada,lular m
R992 T1587 T1586 arg2Of tion and,ada
R993 T1591 T1588 arg2Of tracel,tu
R994 T1591 T1589 arg1Of tracel,rno
R995 T1591 T1590 arg1Of tracel,ver of the ex
R996 T1594 T1592 arg2Of ix through,lular m
R997 T1594 T1593 arg1Of ix through,atr
R998 T1594 T1595 arg1Of ix through,th
R999 T1596 T1595 arg2Of e activatio,th
R1000 T1598 T1597 arg2Of o,n
R1001 T1599 T1597 arg3Of f,n
R1002 T1602 T1601 arg2Of a,l
R1003 T1603 T1601 arg3Of s,l
R1004 T1605 T1604 arg1Of function,Such
R1005 T1605 T1606 arg1Of function,requires
R1006 T1607 T1608 modOf SerpinB2,to
R1007 T1607 T1609 arg1Of SerpinB2,be
R1008 T1607 T1610 arg2Of SerpinB2,secreted
R1009 T1607 T1616 arg1Of SerpinB2,exists
R1010 T1610 T1608 arg1Of secreted,to
R1011 T1610 T1609 arg2Of secreted,be
R1012 T1610 T1611 arg1Of secreted,from
R1013 T1615 T1611 arg2Of SerpinB2,from
R1014 T1615 T1612 arg1Of SerpinB2,the
R1015 T1615 T1613 arg1Of SerpinB2,cell
R1016 T1615 T1614 arg1Of SerpinB2,yet
R1017 T1616 T1606 arg2Of exists,requires
R1018 T1616 T1617 arg1Of exists,primarily
R1019 T1616 T1618 arg1Of exists,as
R1020 T1622 T1618 arg2Of protein,as
R1021 T1622 T1619 arg1Of protein,a
R1022 T1622 T1620 arg1Of protein,nonglycosylated
R1023 T1622 T1621 arg1Of protein,intracellular
R1024 T1622 T1623 arg1Of protein,[
R1025 T1624 T1623 arg2Of 10,[
R1026 T1625 T1623 arg3Of ],[
R1027 T1629 T1626 arg2Of decade,Over
R1028 T1629 T1627 arg1Of decade,the
R1029 T1629 T1628 arg1Of decade,past
R1030 T1632 T1631 arg1Of roles,intracellular
R1031 T1632 T1633 arg1Of roles,for
R1032 T1632 T1681 arg1Of roles,have
R1033 T1632 T1682 arg1Of roles,been
R1034 T1632 T1683 arg2Of roles,described
R1035 T1634 T1633 arg2Of SerpinB2,for
R1036 T1634 T1635 arg1Of SerpinB2,in
R1037 T1639 T1638 arg2Of 11,[
R1038 T1640 T1638 arg3Of ],[
R1039 T1641 T1636 arg1Of –,cell
R1040 T1641 T1637 arg1Of –,survival
R1041 T1641 T1638 arg1Of –,[
R1042 T1641 T1642 arg1Of –,[
R1043 T1641 T1645 arg1Of –,","
R1044 T1643 T1642 arg2Of 17,[
R1045 T1644 T1642 arg3Of ],[
R1046 T1645 T1647 arg1Of ",",and
R1047 T1646 T1645 arg2Of proliferation,","
R1048 T1647 T1656 arg1Of and,","
R1049 T1650 T1649 arg2Of 18,[
R1050 T1651 T1649 arg3Of ],[
R1051 T1652 T1647 arg2Of –,and
R1052 T1652 T1648 arg1Of –,differentiation
R1053 T1652 T1649 arg1Of –,[
R1054 T1652 T1653 arg1Of –,[
R1055 T1654 T1653 arg2Of 21,[
R1056 T1655 T1653 arg3Of ],[
R1057 T1656 T1662 arg1Of ",",;
R1058 T1656 T1663 arg1Of ",",[
R1059 T1656 T1666 arg1Of ",",;
R1060 T1656 T1667 arg1Of ",",[
R1061 T1656 T1670 arg1Of ",",and
R1062 T1658 T1656 arg2Of transduction,","
R1063 T1658 T1657 arg1Of transduction,signal
R1064 T1658 T1659 arg1Of transduction,[
R1065 T1660 T1659 arg2Of 15,[
R1066 T1661 T1659 arg3Of ],[
R1067 T1664 T1663 arg2Of 22,[
R1068 T1665 T1663 arg3Of ],[
R1069 T1668 T1667 arg2Of 23,[
R1070 T1669 T1667 arg3Of ],[
R1071 T1670 T1635 arg2Of and,in
R1072 T1674 T1673 arg2Of 24,[
R1073 T1675 T1673 arg3Of ],[
R1074 T1676 T1670 arg2Of –,and
R1075 T1676 T1671 arg1Of –,innate
R1076 T1676 T1672 arg1Of –,immunity
R1077 T1676 T1673 arg1Of –,[
R1078 T1676 T1677 arg1Of –,[
R1079 T1678 T1677 arg2Of 28,[
R1080 T1679 T1677 arg3Of ],[
R1081 T1683 T1626 arg1Of described,Over
R1082 T1683 T1630 arg1Of described,","
R1083 T1683 T1680 arg1Of described,","
R1084 T1683 T1681 arg2Of described,have
R1085 T1683 T1682 arg2Of described,been
R1086 T1686 T1684 arg1Of gene,The
R1087 T1686 T1685 arg1Of gene,SerpinB2
R1088 T1686 T1687 arg1Of gene,is
R1089 T1686 T1689 arg2Of gene,regulated
R1090 T1689 T1687 arg2Of regulated,is
R1091 T1689 T1688 arg1Of regulated,highly
R1092 T1689 T1690 arg1Of regulated,in
R1093 T1689 T1706 arg1Of regulated,;
R1094 T1689 T1707 arg1Of regulated,[
R1095 T1695 T1690 arg2Of manner,in
R1096 T1695 T1691 arg1Of manner,a
R1097 T1695 T1692 arg1Of manner,cell
R1098 T1695 T1693 arg1Of manner,type
R1099 T1695 T1694 arg1Of manner,specific
R1100 T1695 T1696 arg1Of manner,analogous
R1101 T1696 T1697 arg1Of analogous,to
R1102 T1698 T1697 arg2Of that,to
R1103 T1698 T1699 arg1Of that,of
R1104 T1700 T1701 arg1Of cytokines,and
R1105 T1701 T1699 arg2Of and,of
R1106 T1701 T1703 arg1Of and,[
R1107 T1702 T1701 arg2Of oncogenes,and
R1108 T1704 T1703 arg2Of 29,[
R1109 T1705 T1703 arg3Of ],[
R1110 T1708 T1707 arg2Of 30,[
R1111 T1709 T1707 arg3Of ],[
R1112 T1710 T1711 arg1Of It,is
R1113 T1710 T1724 arg1Of It,can
R1114 T1710 T1725 arg1Of It,be
R1115 T1710 T1726 arg2Of It,induced
R1116 T1710 T1740 arg1Of It,is
R1117 T1710 T1741 arg2Of It,up-regulated
R1118 T1711 T1723 arg1Of is,and
R1119 T1712 T1711 arg2Of one,is
R1120 T1712 T1713 arg1Of one,of
R1121 T1716 T1715 arg1Of responsive,most
R1122 T1717 T1713 arg2Of genes,of
R1123 T1717 T1714 arg1Of genes,the
R1124 T1717 T1716 arg1Of genes,responsive
R1125 T1717 T1718 arg2Of genes,known
R1126 T1718 T1719 arg1Of known,[
R1127 T1720 T1719 arg2Of 31,[
R1128 T1721 T1719 arg3Of ],[
R1129 T1723 T1722 arg1Of and,","
R1130 T1726 T1724 arg2Of induced,can
R1131 T1726 T1725 arg2Of induced,be
R1132 T1726 T1727 arg1Of induced,over
R1133 T1726 T1729 arg1Of induced,by
R1134 T1726 T1739 arg1Of induced,and
R1135 T1728 T1727 arg2Of 1000-fold,over
R1136 T1732 T1731 arg2Of 31,[
R1137 T1733 T1731 arg3Of ],[
R1138 T1734 T1729 arg2Of –,by
R1139 T1734 T1730 arg1Of –,LPS
R1140 T1734 T1731 arg1Of –,[
R1141 T1734 T1735 arg1Of –,[
R1142 T1736 T1735 arg2Of 32,[
R1143 T1737 T1735 arg3Of ],[
R1144 T1739 T1723 arg2Of and,and
R1145 T1739 T1738 arg1Of and,","
R1146 T1741 T1739 arg2Of up-regulated,and
R1147 T1741 T1740 arg2Of up-regulated,is
R1148 T1744 T1741 arg1Of range,up-regulated
R1149 T1744 T1742 arg2Of range,by
R1150 T1744 T1743 arg1Of range,a
R1151 T1744 T1745 arg1Of range,of
R1152 T1747 T1745 arg2Of mediators,of
R1153 T1747 T1746 arg1Of mediators,inflammatory
R1154 T1747 T1748 arg1Of mediators,[
R1155 T1749 T1748 arg2Of 9,[
R1156 T1750 T1748 arg3Of ],[
R1157 T1751 T1752 arg1Of LPS,activates
R1158 T1752 T1755 arg1Of activates,through
R1159 T1754 T1752 arg2Of responses,activates
R1160 T1754 T1753 arg1Of responses,immune
R1161 T1758 T1755 arg2Of pathways,through
R1162 T1758 T1756 arg1Of pathways,multiple
R1163 T1758 T1757 arg1Of pathways,signalling
R1164 T1761 T1759 arg1Of receptor,The
R1165 T1761 T1760 arg1Of receptor,toll-like
R1166 T1761 T1762 arg1Of receptor,4
R1167 T1761 T1763 arg1Of receptor,(
R1168 T1761 T1766 arg1Of receptor,is
R1169 T1761 T1767 arg1Of receptor,responsible
R1170 T1761 T1778 arg1Of receptor,plays
R1171 T1764 T1763 arg2Of TLR4,(
R1172 T1765 T1763 arg3Of ),(
R1173 T1766 T1777 arg1Of is,and
R1174 T1767 T1766 arg2Of responsible,is
R1175 T1767 T1768 arg1Of responsible,for
R1176 T1770 T1768 arg2Of recognition,for
R1177 T1770 T1769 arg1Of recognition,the
R1178 T1770 T1771 arg1Of recognition,of
R1179 T1772 T1773 arg1Of LPS,and
R1180 T1773 T1771 arg2Of and,of
R1181 T1776 T1773 arg2Of products,and
R1182 T1776 T1774 arg1Of products,other
R1183 T1776 T1775 arg1Of products,microbial
R1184 T1778 T1777 arg2Of plays,and
R1185 T1778 T1782 arg1Of plays,in
R1186 T1781 T1778 arg2Of role,plays
R1187 T1781 T1779 arg1Of role,a
R1188 T1781 T1780 arg1Of role,central
R1189 T1784 T1782 arg2Of initiation,in
R1190 T1784 T1783 arg1Of initiation,the
R1191 T1784 T1785 arg1Of initiation,of
R1192 T1788 T1785 arg2Of responses,of
R1193 T1788 T1786 arg1Of responses,innate
R1194 T1788 T1787 arg1Of responses,immune
R1195 T1788 T1789 arg1Of responses,","
R1196 T1788 T1790 arg1Of responses,including
R1197 T1792 T1790 arg2Of release,including
R1198 T1792 T1791 arg1Of release,cytokine
R1199 T1794 T1793 arg1Of binding,The
R1200 T1794 T1795 arg1Of binding,of
R1201 T1794 T1797 arg1Of binding,to
R1202 T1794 T1799 arg1Of binding,on
R1203 T1794 T1804 arg1Of binding,leads
R1204 T1796 T1795 arg2Of LPS,of
R1205 T1798 T1797 arg2Of TLR4,to
R1206 T1801 T1799 arg2Of surface,on
R1207 T1801 T1800 arg1Of surface,the
R1208 T1801 T1802 arg1Of surface,of
R1209 T1803 T1802 arg2Of macrophages,of
R1210 T1804 T1805 arg1Of leads,to
R1211 T1804 T1842 arg1Of leads,[
R1212 T1807 T1806 arg1Of recruitment,the
R1213 T1807 T1808 arg1Of recruitment,of
R1214 T1807 T1811 arg1Of recruitment,and
R1215 T1810 T1808 arg2Of molecules,of
R1216 T1810 T1809 arg1Of molecules,adaptor
R1217 T1811 T1827 arg1Of and,","
R1218 T1813 T1811 arg2Of activation,and
R1219 T1813 T1812 arg1Of activation,the
R1220 T1813 T1814 arg1Of activation,of
R1221 T1816 T1814 arg2Of kinases,of
R1222 T1816 T1815 arg1Of kinases,protein
R1223 T1816 T1817 arg1Of kinases,","
R1224 T1816 T1818 arg1Of kinases,generating
R1225 T1818 T1820 arg1Of generating,to
R1226 T1819 T1818 arg2Of signals,generating
R1227 T1823 T1820 arg2Of factor-κB,to
R1228 T1823 T1821 arg1Of factor-κB,the
R1229 T1823 T1822 arg1Of factor-κB,nuclear
R1230 T1823 T1824 arg1Of factor-κB,(
R1231 T1825 T1824 arg2Of NF-κB,(
R1232 T1826 T1824 arg3Of ),(
R1233 T1827 T1805 arg2Of ",",to
R1234 T1830 T1828 arg1Of kinase,mitogen-activated
R1235 T1830 T1829 arg1Of kinase,protein
R1236 T1830 T1831 arg1Of kinase,(
R1237 T1830 T1834 arg1Of kinase,and/or
R1238 T1832 T1831 arg2Of MAPK,(
R1239 T1833 T1831 arg3Of ),(
R1240 T1835 T1834 arg2Of phosphoinositide,and/or
R1241 T1835 T1836 arg1Of phosphoinositide,3
R1242 T1838 T1837 arg2Of PI3,(
R1243 T1839 T1837 arg3Of ),(
R1244 T1841 T1827 arg2Of pathways,","
R1245 T1841 T1830 arg1Of pathways,kinase
R1246 T1841 T1835 arg1Of pathways,phosphoinositide
R1247 T1841 T1837 arg1Of pathways,(
R1248 T1841 T1840 arg1Of pathways,-kinase
R1249 T1843 T1842 arg2Of 33,[
R1250 T1844 T1842 arg3Of ],[
R1251 T1846 T1845 arg2Of studies,In
R1252 T1846 T1847 arg2Of studies,aimed
R1253 T1847 T1848 arg1Of aimed,at
R1254 T1849 T1848 arg2Of identifying,at
R1255 T1852 T1849 arg2Of factors,identifying
R1256 T1852 T1850 arg1Of factors,LPS-inducible
R1257 T1852 T1851 arg1Of factors,pro-survival
R1258 T1852 T1853 arg1Of factors,downstream
R1259 T1853 T1854 arg1Of downstream,of
R1260 T1856 T1854 arg2Of MAPK,of
R1261 T1856 T1855 arg1Of MAPK,p38
R1262 T1858 T1859 arg1Of SerpinB2,was
R1263 T1858 T1860 arg2Of SerpinB2,identified
R1264 T1860 T1845 arg1Of identified,In
R1265 T1860 T1857 arg1Of identified,","
R1266 T1860 T1859 arg2Of identified,was
R1267 T1860 T1861 arg1Of identified,as
R1268 T1863 T1861 arg2Of factor,as
R1269 T1863 T1862 arg1Of factor,a
R1270 T1863 T1864 arg2Of factor,whose
R1271 T1865 T1864 arg1Of expression,whose
R1272 T1865 T1866 arg1Of expression,was
R1273 T1865 T1867 arg2Of expression,upregulated
R1274 T1867 T1866 arg2Of upregulated,was
R1275 T1869 T1867 arg1Of cooperation,upregulated
R1276 T1869 T1868 arg2Of cooperation,by
R1277 T1869 T1870 arg1Of cooperation,of
R1278 T1872 T1873 arg1Of IKKβ/NF-κB,and
R1279 T1874 T1873 arg2Of p38,and
R1280 T1876 T1870 arg2Of pathways,of
R1281 T1876 T1871 arg1Of pathways,the
R1282 T1876 T1872 arg1Of pathways,IKKβ/NF-κB
R1283 T1876 T1874 arg1Of pathways,p38
R1284 T1876 T1875 arg1Of pathways,MAPK/CREB
R1285 T1876 T1877 arg1Of pathways,[
R1286 T1878 T1877 arg2Of 16,[
R1287 T1879 T1877 arg3Of ],[
R1288 T1882 T1881 arg1Of published,previously
R1289 T1883 T1880 arg1Of data,Our
R1290 T1883 T1882 arg1Of data,published
R1291 T1883 T1884 arg1Of data,indicated
R1292 T1886 T1887 arg1Of SerpinB2,is
R1293 T1886 T1889 arg2Of SerpinB2,regulated
R1294 T1889 T1884 arg2Of regulated,indicated
R1295 T1889 T1885 arg1Of regulated,that
R1296 T1889 T1887 arg2Of regulated,is
R1297 T1889 T1888 arg1Of regulated,distinctly
R1298 T1889 T1890 arg1Of regulated,from
R1299 T1889 T1907 arg1Of regulated,[
R1300 T1889 T1910 arg1Of regulated,;
R1301 T1893 T1890 arg2Of genes,from
R1302 T1893 T1891 arg1Of genes,other
R1303 T1893 T1892 arg1Of genes,LPS-inducible
R1304 T1893 T1894 arg1Of genes,in
R1305 T1895 T1894 arg2Of terms,in
R1306 T1895 T1896 arg1Of terms,of
R1307 T1897 T1898 arg1Of kinetics,","
R1308 T1898 T1902 arg1Of ",",and
R1309 T1901 T1898 arg2Of response,","
R1310 T1901 T1899 arg1Of response,LPS
R1311 T1901 T1900 arg1Of response,dose
R1312 T1902 T1896 arg2Of and,of
R1313 T1903 T1902 arg2Of sensitivity,and
R1314 T1903 T1904 arg1Of sensitivity,to
R1315 T1906 T1904 arg2Of co-stimulation,to
R1316 T1906 T1905 arg1Of co-stimulation,IFN-γ
R1317 T1908 T1907 arg2Of 4,[
R1318 T1909 T1907 arg3Of ],[
R1319 T1915 T1913 arg1Of elements,the
R1320 T1915 T1914 arg1Of elements,cis-acting
R1321 T1915 T1916 arg1Of elements,in
R1322 T1915 T1920 arg1Of elements,responsible
R1323 T1915 T1926 arg1Of elements,and
R1324 T1919 T1916 arg2Of promoter,in
R1325 T1919 T1917 arg1Of promoter,the
R1326 T1919 T1918 arg1Of promoter,SerpinB2
R1327 T1920 T1921 arg1Of responsible,for
R1328 T1923 T1921 arg2Of transcription,for
R1329 T1923 T1922 arg1Of transcription,LPS-dependent
R1330 T1923 T1924 arg1Of transcription,in
R1331 T1925 T1924 arg2Of macrophages,in
R1332 T1926 T1937 arg1Of and,were
R1333 T1926 T1939 arg2Of and,defined
R1334 T1931 T1926 arg2Of factors,and
R1335 T1931 T1927 arg1Of factors,the
R1336 T1931 T1928 arg1Of factors,specific
R1337 T1931 T1929 arg1Of factors,LPS-responsive
R1338 T1931 T1930 arg1Of factors,transcription
R1339 T1931 T1932 arg1Of factors,that
R1340 T1931 T1933 arg1Of factors,bind
R1341 T1936 T1933 arg2Of promoter,bind
R1342 T1936 T1934 arg1Of promoter,the
R1343 T1936 T1935 arg1Of promoter,SerpinB2
R1344 T1939 T1910 arg2Of defined,;
R1345 T1939 T1911 arg1Of defined,however
R1346 T1939 T1912 arg1Of defined,","
R1347 T1939 T1937 arg2Of defined,were
R1348 T1939 T1938 arg1Of defined,not
R1349 T1941 T1942 arg1Of we,show
R1350 T1942 T1940 arg1Of show,Here
R1351 T1945 T1944 arg1Of induction,LPS
R1352 T1945 T1946 arg1Of induction,of
R1353 T1945 T1948 arg1Of induction,is
R1354 T1945 T1949 arg1Of induction,dependent
R1355 T1945 T1969 arg1Of induction,is
R1356 T1945 T1971 arg1Of induction,dependent
R1357 T1947 T1946 arg2Of SerpinB2,of
R1358 T1948 T1968 arg1Of is,and
R1359 T1949 T1948 arg2Of dependent,is
R1360 T1949 T1950 arg1Of dependent,upon
R1361 T1953 T1950 arg2Of sequences,upon
R1362 T1953 T1951 arg1Of sequences,cis-acting
R1363 T1953 T1952 arg1Of sequences,regulatory
R1364 T1953 T1954 arg1Of sequences,in
R1365 T1956 T1954 arg2Of region,in
R1366 T1956 T1955 arg1Of region,the
R1367 T1956 T1957 arg1Of region,between
R1368 T1959 T1960 arg1Of −189,and
R1369 T1960 T1957 arg2Of and,between
R1370 T1960 T1958 arg1Of and,nucleotides
R1371 T1960 T1962 arg1Of and,of
R1372 T1961 T1960 arg2Of −539,and
R1373 T1966 T1962 arg2Of promoter,of
R1374 T1966 T1963 arg1Of promoter,the
R1375 T1966 T1964 arg1Of promoter,murine
R1376 T1966 T1965 arg1Of promoter,SerpinB2
R1377 T1968 T1942 arg2Of and,show
R1378 T1968 T1943 arg1Of and,that
R1379 T1968 T1967 arg1Of and,","
R1380 T1969 T1968 arg2Of is,and
R1381 T1969 T1970 arg1Of is,critically
R1382 T1971 T1969 arg2Of dependent,is
R1383 T1971 T1972 arg1Of dependent,upon
R1384 T1976 T1972 arg2Of site,upon
R1385 T1976 T1973 arg1Of site,a
R1386 T1976 T1974 arg1Of site,C/EBP
R1387 T1976 T1975 arg1Of site,binding
R1388 T1976 T1977 arg1Of site,at
R1389 T1978 T1977 arg2Of −203/−195,at
R1390 T1979 T1981 arg1Of C/EBP-β,bound
R1391 T1981 T1980 arg1Of bound,directly
R1392 T1981 T1982 arg1Of bound,to
R1393 T1981 T1986 arg1Of bound,vivo
R1394 T1981 T1987 arg1Of bound,and
R1395 T1984 T1982 arg2Of site,to
R1396 T1984 T1983 arg1Of site,this
R1397 T1986 T1985 arg1Of vivo,in
R1398 T1989 T1988 arg1Of deficiency,its
R1399 T1989 T1990 arg1Of deficiency,abrogated
R1400 T1990 T1987 arg2Of abrogated,and
R1401 T1993 T1991 arg1Of expression,constitutive
R1402 T1993 T1992 arg1Of expression,SerpinB2
R1403 T1993 T1994 arg1Of expression,and
R1404 T1994 T1990 arg2Of and,abrogated
R1405 T1994 T1997 arg1Of and,by
R1406 T1996 T1994 arg2Of induction,and
R1407 T1996 T1995 arg1Of induction,SerpinB2
R1408 T1998 T1997 arg2Of LPS,by
R1409 T2004 T2001 arg1Of site,a
R1410 T2004 T2002 arg1Of site,C/EBP-β
R1411 T2004 T2003 arg1Of site,phospho-acceptor
R1412 T2004 T2005 arg1Of site,was
R1413 T2004 T2006 arg2Of site,found
R1414 T2004 T2009 arg1Of site,regulate
R1415 T2006 T1999 arg1Of found,Importantly
R1416 T2006 T2000 arg1Of found,","
R1417 T2006 T2005 arg2Of found,was
R1418 T2009 T2006 arg3Of regulate,found
R1419 T2009 T2007 arg1Of regulate,to
R1420 T2009 T2008 arg1Of regulate,negatively
R1421 T2013 T2009 arg2Of activity,regulate
R1422 T2013 T2010 arg1Of activity,LPS-induced
R1423 T2013 T2011 arg1Of activity,SerpinB2
R1424 T2013 T2012 arg1Of activity,promoter
R1425 T2017 T2016 arg1Of findings,these
R1426 T2017 T2018 arg1Of findings,provide
R1427 T2018 T2014 arg1Of provide,Together
R1428 T2018 T2015 arg1Of provide,","
R1429 T2020 T2018 arg2Of insight,provide
R1430 T2020 T2019 arg1Of insight,new
R1431 T2020 T2021 arg1Of insight,into
R1432 T2024 T2021 arg2Of regulation,into
R1433 T2024 T2022 arg1Of regulation,the
R1434 T2024 T2023 arg1Of regulation,transcriptional
R1435 T2024 T2025 arg1Of regulation,of
R1436 T2028 T2025 arg2Of gene,of
R1437 T2028 T2026 arg1Of gene,the
R1438 T2028 T2027 arg1Of gene,SerpinB2
R2265 T3179 T3178 arg1Of Culture,Cell
R2266 T3182 T3180 arg1Of macrophages,Primary
R2267 T3182 T3181 arg1Of macrophages,peritoneal
R2268 T3182 T3183 arg1Of macrophages,were
R2269 T3182 T3184 arg2Of macrophages,obtained
R2270 T3182 T3203 arg1Of macrophages,maintained
R2271 T3184 T3183 arg2Of obtained,were
R2272 T3184 T3185 arg1Of obtained,by
R2273 T3184 T3202 arg1Of obtained,and
R2274 T3186 T3185 arg2Of injecting,by
R2275 T3188 T3186 arg2Of mice,injecting
R2276 T3188 T3187 arg1Of mice,C57BL/6
R2277 T3188 T3189 arg1Of mice,with
R2278 T3190 T3191 arg1Of 3,%
R2279 T3193 T3189 arg2Of broth,with
R2280 T3193 T3190 arg1Of broth,3
R2281 T3193 T3192 arg1Of broth,thioglycollate
R2282 T3193 T3194 arg2Of broth,followed
R2283 T3194 T3200 arg1Of followed,later
R2284 T3197 T3194 arg1Of lavage,followed
R2285 T3197 T3195 arg2Of lavage,by
R2286 T3197 T3196 arg1Of lavage,peritoneal
R2287 T3199 T3198 arg1Of days,3–5
R2288 T3200 T3199 arg1Of later,days
R2289 T3202 T3201 arg1Of and,","
R2290 T3203 T3202 arg2Of maintained,and
R2291 T3203 T3204 arg1Of maintained,in
R2292 T3205 T3206 arg1Of 50,%
R2293 T3208 T3204 arg2Of media,in
R2294 T3208 T3205 arg1Of media,50
R2295 T3208 T3207 arg1Of media,DMEM/F12
R2296 T3208 T3209 arg1Of media,(
R2297 T3211 T3209 arg2Of BRL,(
R2298 T3211 T3210 arg1Of BRL,Gibco
R2299 T3212 T3209 arg3Of ),(
R2300 T3213 T3214 arg1Of Precautions,were
R2301 T3213 T3215 arg2Of Precautions,taken
R2302 T3213 T3217 arg1Of Precautions,exclude
R2303 T3215 T3214 arg2Of taken,were
R2304 T3217 T3215 arg3Of exclude,taken
R2305 T3217 T3216 arg1Of exclude,to
R2306 T3217 T3225 arg1Of exclude,through
R2307 T3220 T3217 arg2Of contamination,exclude
R2308 T3220 T3218 arg1Of contamination,bacterial
R2309 T3220 T3219 arg1Of contamination,lipopolysaccharide
R2310 T3220 T3221 arg1Of contamination,from
R2311 T3224 T3221 arg2Of cultures,from
R2312 T3224 T3222 arg1Of cultures,all
R2313 T3224 T3223 arg1Of cultures,cell
R2314 T3227 T3225 arg2Of use,through
R2315 T3227 T3226 arg1Of use,the
R2316 T3227 T3228 arg1Of use,of
R2317 T3231 T3228 arg2Of serum,of
R2318 T3231 T3229 arg2Of serum,certified
R2319 T3231 T3230 arg1Of serum,LPS-free
R2320 T3233 T3232 arg1Of viability,Cell
R2321 T3233 T3234 arg1Of viability,was
R2322 T3233 T3235 arg2Of viability,determined
R2323 T3235 T3234 arg2Of determined,was
R2324 T3236 T3235 arg3Of using,determined
R2325 T3241 T3240 arg2Of Sigma,(
R2326 T3242 T3240 arg3Of ),(
R2327 T3245 T3236 arg2Of method,using
R2328 T3245 T3237 arg1Of method,the
R2329 T3245 T3238 arg1Of method,trypan
R2330 T3245 T3239 arg1Of method,blue
R2331 T3245 T3240 arg1Of method,(
R2332 T3245 T3243 arg1Of method,dye
R2333 T3245 T3244 arg1Of method,exclusion
R2334 T3247 T3246 arg1Of cultures,All
R2335 T3247 T3248 arg1Of cultures,were
R2336 T3247 T3250 arg2Of cultures,checked
R2337 T3250 T3248 arg2Of checked,were
R2338 T3250 T3249 arg1Of checked,routinely
R2339 T3250 T3251 modOf checked,to
R2340 T3252 T3251 arg1Of exclude,to
R2341 T3254 T3252 arg2Of infection,exclude
R2342 T3254 T3253 arg1Of infection,Mycoplasma
R2343 T3254 T3255 arg1Of infection,by
R2344 T3257 T3256 arg1Of staining,nuclear
R2345 T3257 T3258 arg1Of staining,using
R2346 T3257 T3265 arg1Of staining,and
R2347 T3260 T3258 arg2Of stain,using
R2348 T3260 T3259 arg1Of stain,Hoechst
R2349 T3260 T3261 arg1Of stain,33258
R2350 T3260 T3262 arg1Of stain,(
R2351 T3263 T3262 arg2Of Sigma,(
R2352 T3264 T3262 arg3Of ),(
R2353 T3265 T3255 arg2Of and,by
R2354 T3268 T3267 arg1Of Detection,MycoAlert
R2355 T3269 T3265 arg2Of Kit,and
R2356 T3269 T3266 arg1Of Kit,the
R2357 T3269 T3268 arg1Of Kit,Detection
R2358 T3269 T3270 arg1Of Kit,(
R2359 T3271 T3270 arg2Of Lonza,(
R2360 T3272 T3270 arg3Of ),(
R2361 T3274 T3273 arg1Of lipopolysaccharide,Bacterial
R2362 T3274 T3275 arg1Of lipopolysaccharide,(
R2363 T3274 T3278 arg1Of lipopolysaccharide,(
R2364 T3274 T3284 arg1Of lipopolysaccharide,was
R2365 T3274 T3285 arg2Of lipopolysaccharide,obtained
R2366 T3276 T3275 arg2Of LPS,(
R2367 T3277 T3275 arg3Of ),(
R2368 T3282 T3278 arg2Of Re595,(
R2369 T3282 T3279 arg1Of Re595,Salmonella
R2370 T3282 T3280 arg1Of Re595,minnesota
R2371 T3282 T3281 arg1Of Re595,Strain
R2372 T3283 T3278 arg3Of ),(
R2373 T3285 T3284 arg2Of obtained,was
R2374 T3285 T3286 arg1Of obtained,from
R2375 T3287 T3286 arg2Of Sigma,from
R2630 T3613 T3614 arg1Of Kit,(
R2632 T3613 T3618 arg2Of Kit,used
R2633 T3613 T3620 arg1Of Kit,isolate
R2634 T3615 T3614 arg2Of Qiagen,(
R2637 T3620 T3618 arg3Of isolate,used
R2638 T3620 T3619 arg1Of isolate,to
R2639 T3620 T3623 arg1Of isolate,from
R2640 T3622 T3620 arg2Of RNA,isolate
R2641 T3622 T3621 arg1Of RNA,total
R2642 T3624 T3623 arg2Of cells,from
R2643 T3627 T3625 arg2Of synthesis,For
R2644 T3627 T3626 arg1Of synthesis,cDNA
R2645 T3630 T3629 arg1Of µg,1
R2646 T3630 T3631 arg1Of µg,of
R2647 T3630 T3634 arg1Of µg,was
R2648 T3630 T3636 arg2Of µg,transcribed
R2649 T3630 T3637 arg1Of µg,using
R2650 T3633 T3631 arg2Of RNA,of
R2651 T3633 T3632 arg1Of RNA,total
R2652 T3636 T3625 arg1Of transcribed,For
R2653 T3636 T3628 arg1Of transcribed,","
R2654 T3636 T3634 arg2Of transcribed,was
R2655 T3636 T3635 arg1Of transcribed,reverse
R2656 T3636 T3637 modOf transcribed,using
R2657 T3639 T3638 arg1Of Reverse,TaqMan®
R2658 T3641 T3637 arg2Of Reagents,using
R2659 T3641 T3639 arg1Of Reagents,Reverse
R2660 T3641 T3640 arg1Of Reagents,Transcription
R2661 T3641 T3642 arg1Of Reagents,(
R2662 T3641 T3647 modOf Reagents,CR
R2663 T3644 T3642 arg2Of Biosystems,(
R2664 T3644 T3643 arg1Of Biosystems,Applied
R2665 T3645 T3642 arg3Of ),(
R2666 T3646 T3647 arg1Of . qP,CR
R2667 T3646 T3648 arg2Of . qP,was perfo
R2668 T3648 T3647 arg2Of was perfo,CR
R2669 T3649 T3648 arg3Of rmed ,was perfo
R2670 T3651 T3650 arg1Of aqMa,using T
R2671 T3654 T3649 arg2Of ssion 2,rmed
R2672 T3654 T3651 arg1Of ssion 2,aqMa
R2673 T3654 T3652 arg1Of ssion 2,n® Gene Ex
R2674 T3654 T3653 arg1Of ssion 2,pre
R2675 T3654 T3655 arg1Of ssion 2,0X
R2676 T3654 T3670 arg1Of ssion 2,n
R2677 T3656 T3657 arg1Of primers for Serpi,n
R2678 T3656 T3660 arg1Of primers for Serpi,m
R2679 T3658 T3657 arg2Of b2/SerpinB2 (,n
R2680 T3659 T3657 arg3Of M,n
R2681 T3660 T3665 arg1Of m,Mm0
R2682 T3661 T3660 arg2Of 00440,m
R2683 T3661 T3662 arg1Of 00440,9
R2684 T3663 T3662 arg2Of "05_m1), Cebpb",9
R2685 T3664 T3662 arg3Of (,9
R2686 T3665 T3655 arg2Of Mm0,0X
R2687 T3666 T3665 arg2Of 0843434,Mm0
R2688 T3666 T3667 arg1Of 0843434,_
R2689 T3668 T3667 arg2Of s1) and β-act,_
R2690 T3669 T3667 arg3Of i,_
R2691 T3672 T3670 arg2Of 7939_s1) (,n
R2692 T3672 T3671 arg1Of 7939_s1) (,(Mm0060
R2693 T3673 T3670 arg3Of A,n
R2778 T3837 T3835 arg1Of Analysis,DNA
R2779 T3837 T3836 arg1Of Analysis,Sequence
R2780 T3840 T3838 arg1Of sequence,The
R2781 T3840 T3839 arg1Of sequence,DNA
R2782 T3840 T3841 arg1Of sequence,of
R2783 T3840 T3846 arg1Of sequence,was
R2784 T3840 T3847 arg2Of sequence,determined
R2785 T3845 T3841 arg2Of promoter,of
R2786 T3845 T3842 arg1Of promoter,the
R2787 T3845 T3843 arg1Of promoter,murine
R2788 T3845 T3844 arg1Of promoter,SerpinB2
R2789 T3847 T3846 arg2Of determined,was
R2790 T3847 T3848 arg1Of determined,by
R2791 T3849 T3848 arg2Of sequencing,by
R2792 T3849 T3858 arg1Of sequencing,","
R2793 T3849 T3859 arg1Of sequencing,in
R2794 T3853 T3854 arg1Of pDB9406,","
R2795 T3854 T3856 arg1Of ",",and
R2796 T3855 T3854 arg2Of pDB9402-41,","
R2797 T3856 T3849 arg2Of and,sequencing
R2798 T3856 T3850 arg1Of and,the
R2799 T3856 T3851 arg1Of and,pUC-based
R2800 T3856 T3852 arg1Of and,plasmids
R2801 T3857 T3856 arg2Of pDB9402-42,and
R2803 T3860 T3861 arg1Of addition,to
R2804 T3862 T3861 arg2Of plasmids,to
R2805 T3862 T3863 arg2Of plasmids,prepared
R2806 T3863 T3864 arg1Of prepared,from
R2807 T3865 T3866 arg1Of pDB9402-41,and
R2808 T3866 T3864 arg2Of and,from
R2809 T3866 T3868 arg1Of and,containing
R2810 T3867 T3866 arg2Of pDB9402-42,and
R2811 T3869 T3868 arg2Of deletions,containing
R2812 T3869 T3870 arg2Of deletions,introduced
R2813 T3874 T3870 arg1Of digestion,introduced
R2814 T3874 T3871 arg2Of digestion,by
R2815 T3874 T3872 arg1Of digestion,exonuclease
R2816 T3874 T3873 arg1Of digestion,III
R2817 T3876 T3877 arg1Of pDB9406,","
R2818 T3877 T3879 arg1Of ",",and
R2819 T3878 T3877 arg2Of pDB9402-41,","
R2820 T3879 T3875 arg1Of and,Plasmids
R2821 T3879 T3881 arg1Of and,containing
R2822 T3879 T3900 arg1Of and,were
R2823 T3879 T3902 arg2Of and,provided
R2824 T3880 T3879 arg2Of pDB9402-42,and
R2825 T3883 T3881 arg2Of DNA,containing
R2826 T3883 T3882 arg1Of DNA,genomic
R2827 T3883 T3884 arg2Of DNA,isolated
R2828 T3884 T3885 arg1Of isolated,from
R2829 T3889 T3888 arg2Of Stratagene,(
R2830 T3890 T3888 arg3Of ),(
R2831 T3892 T3885 arg2Of library,from
R2832 T3892 T3886 arg1Of library,a
R2833 T3892 T3887 arg1Of library,λFIXII
R2834 T3892 T3888 arg1Of library,(
R2835 T3892 T3891 arg1Of library,genomic
R2836 T3892 T3893 arg2Of library,prepared
R2837 T3893 T3894 arg1Of prepared,from
R2838 T3898 T3894 arg2Of strain,from
R2839 T3898 T3895 arg1Of strain,a
R2840 T3898 T3896 arg1Of strain,129
R2841 T3898 T3897 arg1Of strain,mouse
R2842 T3902 T3899 arg1Of provided,","
R2843 T3902 T3900 arg2Of provided,were
R2844 T3902 T3901 arg1Of provided,kindly
R2845 T3902 T3907 arg1Of provided,","
R2846 T3906 T3902 arg1Of Belin,provided
R2847 T3906 T3903 arg2Of Belin,by
R2848 T3906 T3904 arg1Of Belin,Dr.
R2849 T3906 T3905 arg1Of Belin,Dominique
R2850 T3908 T3909 arg1Of University,of
R2851 T3910 T3909 arg2Of Geneva.,of
R2852 T3911 T3908 arg1Of pDB9406,University
R2853 T3911 T3912 arg1Of pDB9406,contains
R2854 T3912 T3907 arg2Of contains,","
R2855 T3912 T3924 arg1Of contains,;
R2856 T3918 T3912 arg2Of fragment,contains
R2857 T3918 T3913 arg1Of fragment,a
R2858 T3918 T3914 arg1Of fragment,4.4
R2859 T3918 T3915 arg1Of fragment,kb
R2860 T3918 T3916 arg1Of fragment,EcoRI/SpeI
R2861 T3918 T3917 arg1Of fragment,genomic
R2862 T3918 T3919 arg1Of fragment,spanning
R2863 T3923 T3919 arg2Of site,spanning
R2864 T3923 T3920 arg1Of site,the
R2865 T3923 T3921 arg1Of site,transcription
R2866 T3923 T3922 arg1Of site,initiation
R2867 T3925 T3926 arg1Of pDB9402-41,and
R2868 T3926 T3928 arg1Of and,contain
R2869 T3927 T3926 arg2Of pDB9402-42,and
R2870 T3928 T3924 arg2Of contain,;
R2871 T3934 T3928 arg2Of fragment,contain
R2872 T3934 T3929 arg1Of fragment,a
R2873 T3934 T3930 arg1Of fragment,1.2
R2874 T3934 T3931 arg1Of fragment,kb
R2875 T3934 T3932 arg1Of fragment,EcoRI
R2876 T3934 T3933 arg1Of fragment,genomic
R2877 T3934 T3935 arg1Of fragment,","
R2878 T3934 T3936 arg1Of fragment,located
R2879 T3934 T3944 arg1Of fragment,","
R2880 T3934 T3945 arg2Of fragment,cloned
R2881 T3936 T3938 arg1Of located,upstream
R2882 T3938 T3937 arg1Of upstream,immediately
R2883 T3938 T3939 arg1Of upstream,of
R2884 T3943 T3939 arg2Of fragment,of
R2885 T3943 T3940 arg1Of fragment,the
R2886 T3943 T3941 arg1Of fragment,pDB9406
R2887 T3943 T3942 arg1Of fragment,EcoRI
R2888 T3945 T3946 arg1Of cloned,in
R2889 T3948 T3946 arg2Of orientations,in
R2890 T3948 T3947 arg1Of orientations,opposite
R2891 T3950 T3949 arg2Of inserts,Subcloned
R2892 T3950 T3951 arg1Of inserts,were
R2893 T3950 T3952 arg2Of inserts,verified
R2894 T3952 T3951 arg2Of verified,were
R2895 T3956 T3954 arg1Of digestion,restriction
R2896 T3956 T3955 arg1Of digestion,enzyme
R2897 T3956 T3957 arg1Of digestion,and
R2898 T3957 T3952 arg1Of and,verified
R2899 T3957 T3953 arg2Of and,by
R2900 T3959 T3957 arg2Of sequencing,and
R2901 T3959 T3958 arg1Of sequencing,DNA
R2902 T3962 T3960 arg1Of sequence,The
R2903 T3962 T3961 arg1Of sequence,nucleotide
R2904 T3962 T3963 arg1Of sequence,of
R2905 T3962 T3973 arg1Of sequence,was
R2906 T3962 T3974 arg2Of sequence,determined
R2907 T3972 T3963 arg2Of region,of
R2908 T3972 T3964 arg1Of region,the
R2909 T3972 T3965 arg1Of region,4480
R2910 T3972 T3966 arg1Of region,bp
R2911 T3972 T3967 arg1Of region,murine
R2912 T3972 T3968 arg1Of region,SerpinB2
R2913 T3972 T3969 arg1Of region,gene
R2914 T3972 T3970 arg1Of region,5′
R2915 T3972 T3971 arg1Of region,flanking
R2916 T3974 T3973 arg2Of determined,was
R2917 T3975 T3974 arg3Of using,determined
R2918 T3978 T3977 arg1Of PRISM,ABI
R2919 T3985 T3976 arg1Of kit,the
R2920 T3985 T3978 arg1Of kit,PRISM
R2921 T3985 T3979 arg1Of kit,dye
R2922 T3985 T3980 arg1Of kit,terminator
R2923 T3985 T3981 arg1Of kit,cycle
R2924 T3985 T3982 arg1Of kit,sequencing
R2925 T3985 T3983 arg1Of kit,ready
R2926 T3985 T3984 arg1Of kit,reaction
R2927 T3985 T3986 arg1Of kit,(
R2928 T3985 T3989 arg1Of kit,and
R2929 T3987 T3986 arg2Of Perkin-Elmer,(
R2930 T3988 T3986 arg3Of ),(
R2931 T3989 T3975 arg2Of and,using
R2932 T3993 T3989 arg2Of sequencer,and
R2933 T3993 T3990 arg1Of sequencer,a
R2934 T3993 T3991 arg1Of sequencer,PE
R2935 T3993 T3992 arg1Of sequencer,373A
R2936 T3993 T3994 arg1Of sequencer,(
R2937 T3995 T3994 arg2Of Perkin-Elmer,(
R2938 T3996 T3994 arg3Of ),(
R2939 T3998 T3997 arg1Of sequence,This
R2940 T3998 T3999 arg1Of sequence,was
R2941 T3998 T4000 arg2Of sequence,deposited
R2942 T4000 T3999 arg2Of deposited,was
R2943 T4000 T4001 arg1Of deposited,in
R2944 T4007 T4002 arg1Of No.,GenBank/EMBL/DDBJ
R2945 T4007 T4003 arg1Of No.,Data
R2946 T4007 T4004 arg1Of No.,Bank
R2947 T4007 T4005 arg1Of No.,with
R2948 T4007 T4006 arg1Of No.,Accession
R2949 T4008 T4001 arg2Of AF339731,in
R2950 T4008 T4007 arg1Of AF339731,No.
R3138 T4295 T4294 arg1Of Blot,Western
R3139 T4296 T4295 arg1Of Assays,Blot
R3140 T4299 T4297 arg1Of lysates,Whole
R3141 T4299 T4298 arg1Of lysates,cell
R3142 T4299 T4300 arg1Of lysates,were
R3143 T4299 T4301 arg2Of lysates,prepared
R3144 T4301 T4300 arg2Of prepared,were
R3145 T4301 T4302 arg1Of prepared,in
R3146 T4301 T4305 arg1Of prepared,(
R3147 T4304 T4302 arg2Of buffer,in
R3148 T4304 T4303 arg1Of buffer,RIPA
R3149 T4308 T4305 arg2Of Tris,(
R3150 T4308 T4306 arg1Of Tris,10
R3151 T4308 T4307 arg1Of Tris,mM
R3152 T4308 T4309 arg1Of Tris,","
R3153 T4308 T4326 arg1Of Tris,","
R3154 T4310 T4311 arg1Of 150,mM
R3155 T4312 T4310 arg1Of NaCl,150
R3156 T4312 T4313 arg1Of NaCl,","
R3157 T4313 T4318 arg1Of ",",","
R3158 T4314 T4315 arg1Of 1,%
R3159 T4317 T4313 arg2Of X-100,","
R3160 T4317 T4314 arg1Of X-100,1
R3161 T4317 T4316 arg1Of X-100,Triton
R3162 T4318 T4322 arg1Of ",",","
R3163 T4319 T4320 arg1Of 0.5,%
R3164 T4321 T4318 arg2Of NP-40,","
R3165 T4321 T4319 arg1Of NP-40,0.5
R3166 T4322 T4309 arg2Of ",",","
R3167 T4323 T4324 arg1Of 0.5,%
R3168 T4325 T4322 arg2Of deoxycholate,","
R3169 T4325 T4323 arg1Of deoxycholate,0.5
R3170 T4327 T4328 arg1Of 0.1,%
R3171 T4329 T4326 arg2Of SDS,","
R3172 T4329 T4327 arg1Of SDS,0.1
R3173 T4330 T4305 arg3Of ),(
R3174 T4332 T4333 arg1Of proteins,were
R3175 T4332 T4334 arg2Of proteins,separated
R3176 T4332 T4346 arg2Of proteins,transferred
R3177 T4334 T4335 arg1Of separated,on
R3178 T4334 T4345 arg1Of separated,and
R3179 T4336 T4337 arg1Of 4–12,%
R3180 T4340 T4335 arg2Of gels,on
R3181 T4340 T4336 arg1Of gels,4–12
R3182 T4340 T4338 arg1Of gels,Bis-Tris
R3183 T4340 T4339 arg1Of gels,NuPAGE
R3184 T4340 T4341 arg1Of gels,(
R3185 T4342 T4341 arg2Of Invitrogen,(
R3186 T4343 T4341 arg3Of ),(
R3187 T4345 T4300 modOf and,were
R3188 T4345 T4331 arg1Of and,","
R3189 T4345 T4333 arg2Of and,were
R3190 T4345 T4344 arg1Of and,","
R3191 T4346 T4345 arg2Of transferred,and
R3192 T4346 T4347 arg1Of transferred,to
R3193 T4349 T4347 arg2Of membranes,to
R3194 T4349 T4348 arg1Of membranes,PVDF
R3195 T4350 T4351 arg1Of Membranes,were
R3196 T4350 T4353 arg2Of Membranes,blocked
R3197 T4350 T4370 arg2Of Membranes,incubated
R3198 T4353 T4354 arg1Of blocked,with
R3199 T4353 T4369 arg1Of blocked,and
R3200 T4355 T4356 arg1Of 5,%
R3201 T4357 T4354 arg2Of milk,with
R3202 T4357 T4355 arg1Of milk,5
R3203 T4357 T4358 arg1Of milk,in
R3204 T4359 T4358 arg2Of PBS-T,in
R3205 T4359 T4360 arg1Of PBS-T,(
R3206 T4362 T4360 arg2Of PBS,(
R3207 T4362 T4361 arg1Of PBS,1X
R3208 T4362 T4363 arg1Of PBS,","
R3209 T4365 T4364 arg1Of %,0.1
R3210 T4366 T4363 arg2Of Tween-20,","
R3211 T4366 T4365 arg1Of Tween-20,%
R3212 T4367 T4360 arg3Of ),(
R3213 T4369 T4351 arg2Of and,were
R3214 T4369 T4352 arg1Of and,subsequently
R3215 T4369 T4368 arg1Of and,","
R3216 T4370 T4369 arg2Of incubated,and
R3217 T4370 T4371 arg1Of incubated,with
R3218 T4370 T4374 arg1Of incubated,overnight
R3219 T4373 T4371 arg2Of antibodies,with
R3220 T4373 T4372 arg1Of antibodies,primary
R3221 T4380 T4375 arg1Of antibodies,Affinity
R3222 T4380 T4376 arg2Of antibodies,purified
R3223 T4380 T4377 arg1Of antibodies,rabbit
R3224 T4380 T4378 arg1Of antibodies,anti-mouse
R3225 T4380 T4379 arg1Of antibodies,SerpinB2
R3226 T4380 T4381 arg1Of antibodies,were
R3227 T4380 T4382 arg2Of antibodies,prepared
R3228 T4382 T4381 arg2Of prepared,were
R3229 T4382 T4383 arg1Of prepared,after
R3230 T4384 T4383 arg2Of immunization,after
R3231 T4384 T4385 arg1Of immunization,with
R3232 T4392 T4385 arg2Of protein,with
R3233 T4392 T4386 arg1Of protein,a
R3234 T4392 T4387 arg2Of protein,purified
R3235 T4392 T4388 arg1Of protein,recombinant
R3236 T4392 T4389 arg1Of protein,GST-murine
R3237 T4392 T4390 arg1Of protein,SerpinB2
R3238 T4392 T4391 arg1Of protein,fusion
R3239 T4392 T4393 arg2Of protein,produced
R3240 T4393 T4394 arg1Of produced,in
R3241 T4393 T4398 arg1Of produced,in
R3242 T4393 T4399 arg1Of produced,[
R3243 T4396 T4394 arg2Of coli,in
R3244 T4396 T4395 arg1Of coli,E.
R3245 T4398 T4397 arg1Of in,as
R3246 T4400 T4399 arg2Of 35,[
R3247 T4401 T4399 arg3Of ],[
R3248 T4403 T4402 arg1Of antibodies,Other
R3249 T4403 T4404 arg2Of antibodies,used
R3250 T4403 T4409 arg1Of antibodies,include
R3251 T4404 T4405 arg1Of used,for
R3252 T4408 T4405 arg2Of assays,for
R3253 T4408 T4406 arg1Of assays,western
R3254 T4408 T4407 arg1Of assays,blot
R3255 T4409 T4410 arg1Of include,:
R3256 T4411 T4412 arg1Of C/EBP-β,(
R3257 T4411 T4415 arg1Of C/EBP-β,(
R3258 T4411 T4420 arg1Of C/EBP-β,","
R3259 T4413 T4412 arg2Of sc-150,(
R3260 T4414 T4412 arg3Of ),(
R3261 T4418 T4415 arg2Of Biotechnologies,(
R3262 T4418 T4416 arg1Of Biotechnologies,Santa
R3263 T4418 T4417 arg1Of Biotechnologies,Cruz
R3264 T4419 T4415 arg3Of ),(
R3265 T4420 T4426 arg1Of ",",and
R3266 T4422 T4420 arg2Of dehydrogenase,","
R3267 T4422 T4421 arg1Of dehydrogenase,glyceraldehyde-3-phosphate
R3268 T4422 T4423 arg1Of dehydrogenase,(
R3269 T4424 T4423 arg2Of GAPDH,(
R3270 T4425 T4423 arg3Of ),(
R3271 T4426 T4409 arg2Of and,include
R3272 T4428 T4426 arg2Of tubulin,and
R3273 T4428 T4427 arg1Of tubulin,α/β
R3274 T4428 T4429 arg1Of tubulin,(
R3275 T4432 T4429 arg2Of Technology,(
R3276 T4432 T4430 arg1Of Technology,Cell
R3277 T4432 T4431 arg1Of Technology,Signaling
R3278 T4432 T4433 arg1Of Technology,","
R3279 T4434 T4433 arg2Of Inc.,","
R3280 T4435 T4429 arg3Of ),(
R3450 T4821 T4822 arg1Of Construction,of
R3451 T4825 T4824 arg1Of Gene,Reporter
R3452 T4826 T4822 arg2Of Plasmids,of
R3453 T4826 T4823 arg1Of Plasmids,SerpinB2
R3454 T4826 T4825 arg1Of Plasmids,Gene
R3455 T4829 T4827 arg1Of primers,The
R3456 T4829 T4828 arg1Of primers,PCR
R3457 T4829 T4853 arg1Of primers,amplify
R3458 T4829 T4855 arg1Of primers,clone
R3459 T4830 T4831 arg1Of DW5’LUC,","
R3460 T4830 T4832 arg1Of DW5’LUC,containing
R3461 T4830 T4839 arg1Of DW5’LUC,and
R3462 T4837 T4832 arg2Of site,containing
R3463 T4837 T4833 arg1Of site,a
R3464 T4837 T4834 arg1Of site,Kpn
R3465 T4837 T4835 arg1Of site,I
R3466 T4837 T4836 arg1Of site,restriction
R3467 T4839 T4838 arg1Of and,","
R3468 T4839 T4841 arg1Of and,","
R3469 T4839 T4842 arg1Of and,containing
R3470 T4839 T4849 arg1Of and,were
R3471 T4839 T4850 arg2Of and,used
R3472 T4840 T4839 arg2Of DW3’LUC,and
R3473 T4847 T4842 arg2Of site,containing
R3474 T4847 T4843 arg1Of site,an
R3475 T4847 T4844 arg1Of site,Xho
R3476 T4847 T4845 arg1Of site,I
R3477 T4847 T4846 arg1Of site,restriction
R3478 T4850 T4848 arg1Of used,","
R3479 T4850 T4849 arg2Of used,were
R3480 T4850 T4851 arg1Of used,to
R3481 T4852 T4851 arg2Of PCR,to
R3482 T4853 T4854 arg1Of amplify,and
R3483 T4854 T4849 modOf and,were
R3484 T4854 T4880 modOf and,to
R3485 T4855 T4854 arg2Of clone,and
R3486 T4858 T4853 arg2Of promoter,amplify
R3487 T4858 T4855 arg2Of promoter,clone
R3488 T4858 T4856 arg1Of promoter,the
R3489 T4858 T4857 arg1Of promoter,SerpinB2
R3490 T4858 T4859 arg1Of promoter,(
R3491 T4858 T4864 arg1Of promoter,from
R3492 T4858 T4866 arg1Of promoter,into
R3493 T4862 T4859 arg2Of +92,(
R3494 T4862 T4860 arg1Of +92,−3261
R3495 T4862 T4861 arg1Of +92,to
R3496 T4863 T4859 arg3Of ),(
R3497 T4865 T4864 arg2Of pDB9406,from
R3498 T4870 T4868 arg1Of I,Kpn
R3499 T4870 T4869 arg1Of I,I/Xho
R3500 T4873 T4866 arg2Of sites,into
R3501 T4873 T4867 arg1Of sites,the
R3502 T4873 T4870 arg1Of sites,I
R3503 T4873 T4871 arg1Of sites,polylinker
R3504 T4873 T4872 arg1Of sites,restriction
R3505 T4873 T4874 arg1Of sites,of
R3506 T4876 T4875 arg1Of Basic,pGL3
R3507 T4878 T4874 arg2Of Promega,of
R3508 T4878 T4876 arg1Of Promega,Basic
R3509 T4878 T4877 arg2Of Promega,(
R3510 T4879 T4877 arg3Of ),(
R3511 T4881 T4880 arg1Of produce,to
R3512 T4882 T4881 arg2Of pGLmP-3261,produce
R3513 T4886 T4883 arg1Of insert,The
R3514 T4886 T4884 arg1Of insert,EcoR
R3515 T4886 T4885 arg1Of insert,I
R3516 T4886 T4887 arg1Of insert,of
R3517 T4886 T4889 arg1Of insert,was
R3518 T4886 T4890 arg2Of insert,sub-cloned
R3519 T4886 T4892 arg1Of insert,upstream
R3520 T4888 T4887 arg2Of pDB9402-42,of
R3521 T4890 T4889 arg2Of sub-cloned,was
R3522 T4892 T4890 arg3Of upstream,sub-cloned
R3523 T4892 T4891 arg1Of upstream,immediately
R3524 T4892 T4893 arg1Of upstream,of
R3525 T4899 T4893 arg2Of site,of
R3526 T4899 T4894 arg1Of site,the
R3527 T4899 T4895 arg1Of site,SerpinB2
R3528 T4899 T4896 arg1Of site,promoter
R3529 T4899 T4897 arg1Of site,EcoR
R3530 T4899 T4898 arg1Of site,I
R3531 T4899 T4900 arg1Of site,(
R3532 T4899 T4903 arg1Of site,of
R3533 T4899 T4905 modOf site,to
R3534 T4901 T4900 arg2Of −3261,(
R3535 T4902 T4900 arg3Of ),(
R3536 T4904 T4903 arg2Of pGLmP-3261,of
R3537 T4906 T4905 arg1Of produce,to
R3538 T4907 T4906 arg2Of pGLmP-4480,produce
R3539 T4913 T4908 arg1Of constructs,Additional
R3540 T4913 T4909 arg1Of constructs,murine
R3541 T4913 T4910 arg1Of constructs,SerpinB2
R3542 T4913 T4911 arg1Of constructs,luciferase
R3543 T4913 T4912 arg1Of constructs,reporter
R3544 T4913 T4914 arg1Of constructs,(
R3545 T4913 T4929 arg1Of constructs,were
R3546 T4913 T4930 arg2Of constructs,generated
R3547 T4915 T4916 arg1Of pGLmP-2751,","
R3548 T4916 T4918 arg1Of ",",","
R3549 T4917 T4916 arg2Of pGLmP-2614,","
R3550 T4918 T4920 arg1Of ",",","
R3551 T4919 T4918 arg2Of pGLmP-1686,","
R3552 T4920 T4922 arg1Of ",",","
R3553 T4921 T4920 arg2Of pGLmP-1341,","
R3554 T4922 T4924 arg1Of ",",","
R3555 T4923 T4922 arg2Of pGLmP-694,","
R3556 T4924 T4926 arg1Of ",",and
R3557 T4925 T4924 arg2Of pGLmP-539,","
R3558 T4926 T4914 arg2Of and,(
R3559 T4927 T4926 arg2Of pGLmP-189,and
R3560 T4928 T4914 arg3Of ),(
R3561 T4930 T4929 arg2Of generated,were
R3562 T4930 T4931 arg1Of generated,by
R3563 T4930 T4965 arg1Of generated,","
R3564 T4932 T4931 arg2Of digesting,by
R3565 T4932 T4942 arg1Of digesting,(
R3566 T4933 T4934 arg1Of pGLmP-3261,with
R3567 T4933 T4937 arg1Of pGLmP-3261,and
R3568 T4935 T4934 arg2Of EcoR,with
R3569 T4935 T4936 arg1Of EcoR,I
R3570 T4937 T4932 arg2Of and,digesting
R3571 T4941 T4937 arg2Of enzyme,and
R3572 T4941 T4938 arg1Of enzyme,a
R3573 T4941 T4939 arg1Of enzyme,second
R3574 T4941 T4940 arg1Of enzyme,restriction
R3575 T4944 T4943 arg1Of I,Sfi
R3576 T4944 T4945 arg1Of I,","
R3577 T4945 T4948 arg1Of ",",","
R3578 T4947 T4945 arg2Of I,","
R3579 T4947 T4946 arg1Of I,Apa
R3580 T4948 T4951 arg1Of ",",","
R3581 T4950 T4948 arg2Of I,","
R3582 T4950 T4949 arg1Of I,BstX
R3583 T4951 T4954 arg1Of ",",","
R3584 T4953 T4951 arg2Of I,","
R3585 T4953 T4952 arg1Of I,Bsu36
R3586 T4954 T4957 arg1Of ",",","
R3587 T4956 T4954 arg2Of I,","
R3588 T4956 T4955 arg1Of I,Pac
R3589 T4957 T4960 arg1Of ",",and
R3590 T4959 T4957 arg2Of III,","
R3591 T4959 T4958 arg1Of III,Hae
R3592 T4960 T4942 arg2Of and,(
R3593 T4962 T4960 arg2Of I,and
R3594 T4962 T4961 arg1Of I,Apo
R3595 T4962 T4963 arg1Of I,respectively
R3596 T4964 T4942 arg3Of ),(
R3597 T4966 T4967 arg1Of blunt,ending
R3598 T4966 T4982 arg1Of blunt,re-ligating
R3599 T4966 T4985 arg1Of blunt,ends
R3600 T4967 T4981 arg1Of ending,and
R3601 T4970 T4971 arg1Of 5′,or
R3602 T4972 T4971 arg2Of 3′,or
R3603 T4973 T4967 arg2Of overhangs,ending
R3604 T4973 T4968 arg1Of overhangs,the
R3605 T4973 T4969 arg1Of overhangs,resultant
R3606 T4973 T4970 arg1Of overhangs,5′
R3607 T4973 T4972 arg1Of overhangs,3′
R3608 T4973 T4974 arg1Of overhangs,with
R3609 T4977 T4974 arg2Of polymerase,with
R3610 T4977 T4975 arg1Of polymerase,T4
R3611 T4977 T4976 arg1Of polymerase,DNA
R3612 T4977 T4978 arg1Of polymerase,(
R3613 T4979 T4978 arg2Of NEB,(
R3614 T4980 T4978 arg3Of ),(
R3615 T4982 T4981 arg2Of re-ligating,and
R3616 T4984 T4982 arg2Of vector,re-ligating
R3617 T4984 T4983 arg1Of vector,the
R3618 T4985 T4965 arg2Of ends,","
R3619 T4985 T4986 arg1Of ends,with
R3620 T4989 T4986 arg2Of ligase,with
R3621 T4989 T4987 arg1Of ligase,T4
R3622 T4989 T4988 arg1Of ligase,DNA
R3623 T4993 T4994 arg1Of BSPCR2,and
R3624 T4994 T4990 arg1Of and,The
R3625 T4994 T4991 arg1Of and,PCR
R3626 T4994 T4992 arg1Of and,primers
R3627 T4994 T4996 arg1Of and,were
R3628 T4994 T4997 arg2Of and,used
R3629 T4995 T4994 arg2Of DW3’LUC,and
R3630 T4997 T4996 arg2Of used,were
R3631 T4999 T4997 arg3Of subclone,used
R3632 T4999 T4998 arg1Of subclone,to
R3633 T4999 T5006 arg1Of subclone,to
R3634 T4999 T5008 arg1Of subclone,into
R3635 T5004 T4999 arg2Of regions,subclone
R3636 T5004 T5000 arg1Of regions,the
R3637 T5004 T5001 arg1Of regions,murine
R3638 T5004 T5002 arg1Of regions,SerpinB2
R3639 T5004 T5003 arg1Of regions,promoter
R3640 T5004 T5005 arg1Of regions,−87
R3641 T5007 T5006 arg2Of +92,to
R3642 T5012 T5010 arg1Of I,Kpn
R3643 T5012 T5011 arg1Of I,I/Xho
R3644 T5015 T5013 arg1Of sites,polylinker
R3645 T5015 T5014 arg1Of sites,restriction
R3646 T5015 T5016 arg1Of sites,of
R3647 T5015 T5020 arg2Of sites,produce
R3648 T5017 T5016 arg2Of pGL3,of
R3649 T5018 T5019 modOf Basic,to
R3650 T5020 T5019 arg1Of produce,to
R3651 T5021 T5008 arg2Of pGLmP-87,into
R3652 T5021 T5009 arg1Of pGLmP-87,the
R3653 T5021 T5012 arg1Of pGLmP-87,I
R3654 T5021 T5018 arg1Of pGLmP-87,Basic
R3655 T5025 T5022 arg1Of vector,The
R3656 T5025 T5023 arg1Of vector,control
R3657 T5025 T5024 arg1Of vector,empty
R3658 T5025 T5026 arg1Of vector,was
R3659 T5028 T5027 arg1Of Basic,pGL3
R3660 T5030 T5026 arg2Of Promega,was
R3661 T5030 T5028 arg1Of Promega,Basic
R3662 T5030 T5029 arg2Of Promega,(
R3663 T5031 T5029 arg3Of ),(
R3664 T5034 T5032 arg1Of constructs,Luciferase
R3665 T5034 T5033 arg1Of constructs,reporter
R3666 T5034 T5035 arg1Of constructs,containing
R3667 T5034 T5051 arg1Of constructs,(
R3668 T5034 T5061 arg1Of constructs,were
R3669 T5034 T5062 arg2Of constructs,generated
R3670 T5036 T5035 arg2Of mutations,containing
R3671 T5036 T5037 arg1Of mutations,in
R3672 T5036 T5045 arg1Of mutations,","
R3673 T5044 T5037 arg2Of box,in
R3674 T5044 T5038 arg1Of box,the
R3675 T5044 T5039 arg1Of box,SerpinB2
R3676 T5044 T5040 arg1Of box,promoter
R3677 T5044 T5041 arg1Of box,LPS-responsive
R3678 T5044 T5042 arg1Of box,regions
R3679 T5044 T5043 arg1Of box,E
R3680 T5046 T5047 arg1Of PU.1,","
R3681 T5047 T5049 arg1Of ",",and
R3682 T5048 T5047 arg2Of Oct-1,","
R3683 T5049 T5045 arg2Of and,","
R3684 T5050 T5049 arg2Of C/EBP,and
R3685 T5052 T5053 arg1Of pGLmP-539mEbox,","
R3686 T5053 T5055 arg1Of ",",","
R3687 T5054 T5053 arg2Of pGLmP-539mPU.1,","
R3688 T5055 T5057 arg1Of ",",and
R3689 T5056 T5055 arg2Of pGLmP-539mOct,","
R3690 T5057 T5051 arg2Of and,(
R3691 T5057 T5059 arg1Of and,respectively
R3692 T5058 T5057 arg2Of pGLmP-539mC/EBP,and
R3693 T5060 T5051 arg3Of ),(
R3694 T5062 T5061 arg2Of generated,were
R3695 T5062 T5063 arg1Of generated,as
R3696 T5064 T5063 arg2Of described,as
R3697 T5064 T5065 arg1Of described,[
R3698 T5066 T5065 arg2Of 36,[
R3699 T5067 T5065 arg3Of ],[
R3700 T5073 T5068 arg1Of sequences,The
R3701 T5073 T5069 arg1Of sequences,mutant
R3702 T5073 T5070 arg1Of sequences,oligonucleotide
R3703 T5073 T5071 arg1Of sequences,PCR
R3704 T5073 T5072 arg1Of sequences,primer
R3705 T5073 T5074 arg1Of sequences,are
R3706 T5073 T5075 arg2Of sequences,provided
R3707 T5073 T5081 arg1Of sequences,were
R3708 T5073 T5082 arg2Of sequences,used
R3709 T5075 T5074 arg2Of provided,are
R3710 T5075 T5076 arg1Of provided,in
R3711 T5075 T5080 arg1Of provided,and
R3712 T5078 T5076 arg2Of S1,in
R3713 T5078 T5077 arg1Of S1,Fig.
R3714 T5080 T5079 arg1Of and,","
R3715 T5082 T5080 arg2Of used,and
R3716 T5082 T5081 arg2Of used,were
R3717 T5083 T5082 arg3Of as,used
R3718 T5084 T5083 arg2Of follows,as
R3719 T5084 T5085 arg1Of follows,:
R3720 T5086 T5084 arg2Of pGLmP-539mEbox,follows
R3721 T5086 T5087 arg1Of pGLmP-539mEbox,:
R3722 T5086 T5093 arg1Of pGLmP-539mEbox,:
R3723 T5086 T5097 arg1Of pGLmP-539mEbox,;
R3724 T5086 T5099 arg1Of pGLmP-539mEbox,:
R3725 T5086 T5103 arg1Of pGLmP-539mEbox,;
R3726 T5086 T5105 arg1Of pGLmP-539mEbox,:
R3727 T5088 T5089 arg1Of mPAI2mEboxa,and
R3728 T5089 T5087 arg2Of and,:
R3729 T5089 T5091 arg1Of and,;
R3730 T5090 T5089 arg2Of mPAI2mEboxb,and
R3731 T5092 T5091 arg2Of pGLmP-539mPU.1,;
R3732 T5094 T5095 arg1Of mPAI2mPU.1a,and
R3733 T5095 T5093 arg2Of and,:
R3734 T5096 T5095 arg2Of mPAI2mPU.1b,and
R3735 T5098 T5097 arg2Of pGLmP-539mOct,;
R3736 T5100 T5101 arg1Of mPAI2mOct-2a,and
R3737 T5101 T5099 arg2Of and,:
R3738 T5102 T5101 arg2Of mPAI2mOct-2b,and
R3739 T5104 T5103 arg2Of pGLmP-539mC/EBP,;
R3740 T5106 T5107 arg1Of mPAI2mCEBPa,and
R3741 T5107 T5105 arg2Of and,:
R3742 T5108 T5107 arg2Of mPAI2mCEBPb,and
R3743 T5112 T5109 arg1Of primers,The
R3744 T5112 T5110 arg1Of primers,oligonucleotide
R3745 T5112 T5111 arg1Of primers,PCR
R3746 T5112 T5113 arg2Of primers,used
R3747 T5112 T5115 arg1Of primers,generate
R3748 T5112 T5117 arg1Of primers,","
R3749 T5112 T5124 arg1Of primers,were
R3750 T5112 T5125 arg2Of primers,reported
R3751 T5115 T5113 arg3Of generate,used
R3752 T5115 T5114 arg1Of generate,to
R3753 T5116 T5115 arg2Of mutants,generate
R3754 T5118 T5119 arg1Of pGLmP-539mCRE,","
R3755 T5119 T5122 arg1Of ",",and
R3756 T5120 T5119 arg2Of pGLmP-539mAP-1a,","
R3757 T5122 T5117 arg2Of and,","
R3758 T5122 T5121 arg1Of and,","
R3759 T5123 T5122 arg2Of pGLmP-539mAP-1b,and
R3760 T5125 T5124 arg2Of reported,were
R3761 T5125 T5126 arg1Of reported,previously
R3762 T5125 T5127 arg1Of reported,[
R3763 T5128 T5127 arg2Of 37,[
R3764 T5129 T5127 arg3Of ],[
R3765 T5134 T5130 arg1Of primers,The
R3766 T5134 T5131 arg1Of primers,flanking
R3767 T5134 T5132 arg1Of primers,oligonucleotide
R3768 T5134 T5133 arg1Of primers,PCR
R3769 T5134 T5135 arg1Of primers,were
R3770 T5136 T5137 arg1Of RVprimer3,(
R3771 T5136 T5140 arg1Of RVprimer3,and
R3772 T5138 T5137 arg2Of Promega,(
R3773 T5139 T5137 arg3Of ),(
R3774 T5140 T5135 arg2Of and,were
R3775 T5140 T5146 modOf and,39
R3776 T5141 T5140 arg2Of GLprimer2,and
R3777 T5141 T5142 arg1Of GLprimer2,(
R3778 T5143 T5142 arg2Of Promega,(
R3779 T5144 T5142 arg3Of ),(
R3780 T5145 T5146 arg1Of . pGLmP-5,39
R3781 T5145 T5147 arg2Of . pGLmP-5,was
R3782 T5147 T5146 arg2Of was ,39
R3783 T5147 T5148 arg1Of was ,us
R3784 T5150 T5148 arg2Of as the t,us
R3785 T5150 T5149 arg1Of as the t,ed
R3786 T5150 T5151 arg1Of as the t,em
R3787 T5153 T5151 arg2Of e in,em
R3788 T5153 T5152 arg1Of e in,plat
R3789 T5156 T5154 arg1Of products,Recombinant
R3790 T5156 T5155 arg1Of products,PCR
R3791 T5156 T5157 arg1Of products,were
R3792 T5156 T5158 arg2Of products,digested
R3793 T5156 T5166 arg2Of products,cloned
R3794 T5158 T5159 arg1Of digested,with
R3795 T5158 T5165 arg1Of digested,and
R3796 T5160 T5161 arg1Of EcoR,I
R3797 T5160 T5162 arg1Of EcoR,and
R3798 T5162 T5159 arg2Of and,with
R3799 T5164 T5162 arg2Of I,and
R3800 T5164 T5163 arg1Of I,Xho
R3801 T5165 T5157 arg2Of and,were
R3802 T5166 T5165 arg2Of cloned,and
R3803 T5166 T5167 arg1Of cloned,between
R3804 T5166 T5178 arg1Of cloned,in
R3805 T5170 T5171 arg1Of I,and
R3806 T5172 T5171 arg2Of Xho,and
R3807 T5175 T5167 arg2Of sites,between
R3808 T5175 T5168 arg1Of sites,the
R3809 T5175 T5169 arg1Of sites,EcoR
R3810 T5175 T5170 arg1Of sites,I
R3811 T5175 T5172 arg1Of sites,Xho
R3812 T5175 T5173 arg1Of sites,I
R3813 T5175 T5174 arg1Of sites,restriction
R3814 T5175 T5176 arg1Of sites,of
R3815 T5177 T5176 arg2Of pGLmP-539,of
R3816 T5179 T5178 arg2Of place,in
R3817 T5179 T5180 arg1Of place,of
R3818 T5183 T5180 arg2Of region,of
R3819 T5183 T5181 arg1Of region,the
R3820 T5183 T5182 arg1Of region,−539/+92
R3821 T5183 T5184 arg1Of region,of
R3822 T5189 T5184 arg2Of promoter,of
R3823 T5189 T5185 arg1Of promoter,the
R3824 T5189 T5186 arg1Of promoter,wild-type
R3825 T5189 T5187 arg1Of promoter,murine
R3826 T5189 T5188 arg1Of promoter,SerpinB2
R3827 T5190 T5191 arg1Of Sequence,verified
R3828 T5192 T5193 arg1Of constructs,were
R3829 T5192 T5194 arg2Of constructs,used
R3830 T5194 T5191 arg2Of used,verified
R3831 T5194 T5193 arg2Of used,were
R3832 T5194 T5195 arg1Of used,in
R3833 T5197 T5195 arg2Of experiments,in
R3834 T5197 T5196 arg1Of experiments,the
R4268 T6032 T6033 arg1Of Transfection,and
R4269 T6034 T6033 arg2Of Luciferase,and
R4270 T6035 T6031 arg1Of Assays,Transient
R4271 T6035 T6032 arg1Of Assays,Transfection
R4272 T6035 T6034 arg1Of Assays,Luciferase
R4273 T6035 T6036 arg1Of Assays,(
R4274 T6038 T6036 arg2Of Macrophages,(
R4275 T6038 T6037 arg1Of Macrophages,RAW264.7
R4276 T6039 T6036 arg3Of ),(
R4277 T6042 T6040 arg1Of cells,RAW
R4278 T6042 T6041 arg1Of cells,264.7
R4279 T6042 T6043 arg1Of cells,(
R4280 T6042 T6046 arg1Of cells,growing
R4281 T6042 T6050 arg1Of cells,were
R4282 T6042 T6051 arg2Of cells,transfected
R4283 T6044 T6043 arg2Of 2×107,(
R4284 T6045 T6043 arg3Of ),(
R4285 T6046 T6047 arg1Of growing,in
R4286 T6049 T6047 arg2Of phase,in
R4287 T6049 T6048 arg1Of phase,log
R4288 T6051 T6050 arg2Of transfected,were
R4289 T6051 T6052 arg1Of transfected,with
R4290 T6051 T6062 arg1Of transfected,along
R4291 T6051 T6107 arg1Of transfected,pro
R4292 T6057 T6052 arg2Of plasmid,with
R4293 T6057 T6053 arg1Of plasmid,the
R4294 T6057 T6054 arg2Of plasmid,indicated
R4295 T6057 T6055 arg1Of plasmid,luciferase
R4296 T6057 T6056 arg1Of plasmid,reporter
R4297 T6057 T6058 arg1Of plasmid,(
R4298 T6060 T6058 arg2Of µg,(
R4299 T6060 T6059 arg1Of µg,20
R4300 T6061 T6058 arg3Of ),(
R4301 T6062 T6063 arg1Of along,with
R4302 T6066 T6065 arg1Of kinase,pRL-thymidine
R4303 T6066 T6067 arg1Of kinase,(
R4304 T6068 T6067 arg2Of TK,(
R4305 T6069 T6067 arg3Of ),(
R4306 T6071 T6070 arg2Of Promega,(
R4307 T6072 T6070 arg3Of ),(
R4308 T6076 T6063 arg2Of plasmid,with
R4309 T6076 T6064 arg1Of plasmid,the
R4310 T6076 T6066 arg1Of plasmid,kinase
R4311 T6076 T6070 arg1Of plasmid,(
R4312 T6076 T6073 arg1Of plasmid,internal
R4313 T6076 T6074 arg1Of plasmid,control
R4314 T6076 T6075 arg1Of plasmid,reporter
R4315 T6076 T6077 arg1Of plasmid,(
R4316 T6076 T6081 arg1Of plasmid,by
R4317 T6079 T6077 arg2Of µg,(
R4318 T6079 T6078 arg1Of µg,2
R4319 T6080 T6077 arg3Of ),(
R4320 T6082 T6081 arg2Of electroporation,by
R4321 T6082 T6083 arg1Of electroporation,using
R4322 T6083 T6088 arg1Of using,with
R4323 T6087 T6083 arg2Of Pulser,using
R4324 T6087 T6084 arg1Of Pulser,a
R4325 T6087 T6085 arg1Of Pulser,Bio-Rad
R4326 T6087 T6086 arg1Of Pulser,Gene
R4327 T6091 T6090 arg1Of Extender,Capacitance
R4328 T6091 T6092 arg1Of Extender,(
R4329 T6094 T6092 arg2Of kV,(
R4330 T6094 T6093 arg1Of kV,0.25
R4331 T6094 T6095 arg1Of kV,","
R4332 T6094 T6097 arg1Of kV,µFd
R4333 T6096 T6095 arg2Of 960,","
R4334 T6098 T6092 arg3Of ),(
R4335 T6101 T6088 arg2Of rol pla,with
R4336 T6101 T6089 arg1Of rol pla,a
R4337 T6101 T6091 arg1Of rol pla,Extender
R4338 T6101 T6099 arg1Of rol pla,. pG
R4339 T6101 T6100 arg1Of rol pla,L3 cont
R4340 T6101 T6102 arg1Of rol pla,smid
R4341 T6101 T6103 arg1Of rol pla,which e
R4342 T6106 T6103 arg2Of the SV40,which e
R4343 T6106 T6104 arg1Of the SV40,nco
R4344 T6106 T6105 arg1Of the SV40,des
R4345 T6108 T6109 arg1Of moter an,d e
R4346 T6108 T6110 arg2Of moter an,nhancer
R4347 T6110 T6107 arg2Of nhancer ,pro
R4348 T6110 T6109 arg2Of nhancer ,d e
R4349 T6110 T6111 arg1Of nhancer ,wa
R4350 T6110 T6120 arg1Of nhancer ,on
R4351 T6111 T6119 arg1Of wa,cti
R4352 T6114 T6111 arg2Of as a po,wa
R4353 T6114 T6112 arg1Of as a po,s
R4354 T6114 T6113 arg1Of as a po,included
R4355 T6114 T6115 arg1Of as a po,sit
R4356 T6117 T6115 arg2Of for transf,sit
R4357 T6117 T6116 arg1Of for transf,ive control
R4358 T6119 T6118 arg1Of cti,e
R4359 T6120 T6119 arg2Of on,cti
R4360 T6123 T6120 arg2Of ", and as",on
R4361 T6123 T6121 arg1Of ", and as",ef
R4362 T6123 T6122 arg1Of ", and as",ficiency
R4363 T6123 T6124 arg1Of ", and as",an
R4364 T6125 T6126 arg1Of internal,sta
R4365 T6127 T6126 arg2Of ndard fo,sta
R4366 T6128 T6124 arg2Of r promoter,an
R4367 T6128 T6125 arg1Of r promoter,internal
R4368 T6128 T6127 arg1Of r promoter,ndard fo
R4369 T6130 T6129 arg2Of cells,Transfected
R4370 T6130 T6131 arg1Of cells,were
R4371 T6130 T6132 arg2Of cells,transferred
R4372 T6132 T6131 arg2Of transferred,were
R4373 T6132 T6133 arg1Of transferred,to
R4374 T6132 T6160 arg1Of transferred,and
R4375 T6135 T6133 arg2Of ml,to
R4376 T6135 T6134 arg1Of ml,10
R4377 T6135 T6136 arg1Of ml,of
R4378 T6135 T6139 arg1Of ml,in
R4379 T6135 T6144 arg1Of ml,","
R4380 T6135 T6145 arg2Of ml,divided
R4381 T6138 T6136 arg2Of media,of
R4382 T6138 T6137 arg1Of media,pre-warmed
R4383 T6143 T6139 arg2Of plates,in
R4384 T6143 T6140 arg1Of plates,6-well
R4385 T6143 T6141 arg1Of plates,tissue
R4386 T6143 T6142 arg1Of plates,culture
R4387 T6145 T6146 arg1Of divided,into
R4388 T6145 T6155 arg1Of divided,in
R4389 T6150 T6147 arg1Of pools,two
R4390 T6150 T6148 arg1Of pools,identical
R4391 T6150 T6149 arg1Of pools,cell
R4392 T6150 T6151 arg1Of pools,and
R4393 T6151 T6146 arg2Of and,into
R4394 T6154 T6151 arg2Of hrs,and
R4395 T6154 T6152 arg2Of hrs,incubated
R4396 T6154 T6153 arg1Of hrs,16
R4397 T6157 T6158 arg1Of 5,%
R4398 T6159 T6155 arg2Of CO2,in
R4399 T6159 T6156 arg1Of CO2,a
R4400 T6159 T6157 arg1Of CO2,5
R4401 T6162 T6161 arg1Of %,95
R4402 T6162 T6163 arg1Of %,humidified
R4403 T6163 T6160 arg2Of humidified,and
R4404 T6163 T6166 arg1Of humidified,at
R4405 T6163 T6169 arg1Of humidified,in
R4406 T6165 T6163 arg2Of atmosphere,humidified
R4407 T6165 T6164 arg1Of atmosphere,air
R4408 T6167 T6166 arg2Of 37°C,at
R4409 T6169 T6168 arg1Of in,either
R4410 T6171 T6172 arg1Of presence,or
R4411 T6172 T6169 arg2Of or,in
R4412 T6172 T6170 arg1Of or,the
R4413 T6172 T6174 arg1Of or,of
R4414 T6173 T6172 arg2Of absence,or
R4415 T6175 T6176 arg1Of 100,ng/ml
R4416 T6177 T6174 arg2Of LPS,of
R4417 T6177 T6175 arg1Of LPS,100
R4418 T6179 T6178 arg1Of activity,Luciferase
R4419 T6179 T6180 arg1Of activity,was
R4420 T6179 T6181 arg2Of activity,measured
R4421 T6181 T6180 arg2Of measured,was
R4422 T6182 T6181 arg3Of using,measured
R4423 T6186 T6184 arg1Of Assay,Dual-Luciferase
R4424 T6186 T6185 arg1Of Assay,Reporter
R4425 T6188 T6182 arg2Of kit,using
R4426 T6188 T6183 arg1Of kit,a
R4427 T6188 T6186 arg1Of kit,Assay
R4428 T6188 T6187 arg1Of kit,System
R4429 T6188 T6189 arg1Of kit,(
R4430 T6190 T6189 arg2Of Promega,(
R4431 T6191 T6189 arg3Of ),(
R4432 T6192 T6193 arg1Of Measurements,represent
R4433 T6195 T6193 arg2Of results,represent
R4434 T6195 T6194 arg1Of results,the
R4435 T6195 T6196 arg1Of results,of
R4436 T6199 T6197 arg1Of three,at
R4437 T6199 T6198 arg1Of three,least
R4438 T6201 T6196 arg2Of experiments,of
R4439 T6201 T6199 arg1Of experiments,three
R4440 T6201 T6200 arg1Of experiments,independent
R4441 T6203 T6202 arg1Of activity,Promoter
R4442 T6203 T6204 arg1Of activity,is
R4443 T6203 T6205 arg2Of activity,expressed
R4444 T6205 T6204 arg2Of expressed,is
R4445 T6205 T6206 arg1Of expressed,as
R4446 T6205 T6223 arg1Of expressed,to
R4447 T6206 T6222 arg1Of as,or
R4448 T6208 T6206 arg2Of number,as
R4449 T6208 T6207 arg1Of number,the
R4450 T6208 T6209 arg1Of number,of
R4451 T6213 T6209 arg2Of units,of
R4452 T6213 T6210 arg1Of units,firefly
R4453 T6213 T6211 arg1Of units,luciferase
R4454 T6213 T6212 arg1Of units,light
R4455 T6213 T6214 arg2Of units,normalized
R4456 T6214 T6216 arg1Of normalized,to
R4457 T6216 T6215 arg1Of to,either
R4458 T6221 T6216 arg2Of units,to
R4459 T6221 T6217 arg1Of units,pRL-TK
R4460 T6221 T6218 arg1Of units,renilla
R4461 T6221 T6219 arg1Of units,luciferase
R4462 T6221 T6220 arg1Of units,light
R4463 T6223 T6222 arg2Of to,or
R4464 T6226 T6223 arg2Of concentration,to
R4465 T6226 T6224 arg1Of concentration,cellular
R4466 T6226 T6225 arg1Of concentration,protein
R4467 T6226 T6227 arg1Of concentration,(
R4468 T6228 T6227 arg2Of where,(
R4469 T6230 T6231 arg1Of C/EBP-β,or
R4470 T6231 T6229 arg2Of or,co-transfected
R4471 T6231 T6233 arg1Of or,affected
R4472 T6232 T6231 arg2Of LPS,or
R4473 T6233 T6228 arg1Of affected,where
R4474 T6235 T6233 arg2Of activity,affected
R4475 T6235 T6234 arg1Of activity,pRL-TK
R4476 T6236 T6227 arg3Of ),(
R4477 T6238 T6237 arg1Of concentration,Protein
R4478 T6238 T6239 arg1Of concentration,was
R4479 T6238 T6240 arg2Of concentration,determined
R4480 T6240 T6239 arg2Of determined,was
R4481 T6241 T6240 arg3Of using,determined
R4482 T6246 T6241 arg2Of reagent,using
R4483 T6246 T6242 arg1Of reagent,the
R4484 T6246 T6243 arg1Of reagent,Bio-Rad
R4485 T6246 T6244 arg1Of reagent,protein
R4486 T6246 T6245 arg1Of reagent,microassay
R4745 T6666 T6665 arg1Of shRNAs,Lentiviral
R4746 T6666 T6667 arg1Of shRNAs,","
R4747 T6668 T6669 arg1Of Packaging,and
R4748 T6669 T6667 arg2Of and,","
R4749 T6670 T6669 arg2Of Transduction,and
R4750 T6673 T6671 arg1Of vectors,pLKO.1-puro
R4751 T6673 T6672 arg1Of vectors,lentiviral
R4752 T6673 T6674 arg1Of vectors,carrying
R4753 T6673 T6687 arg1Of vectors,were
R4754 T6673 T6688 arg2Of vectors,used
R4755 T6677 T6674 arg2Of RNAs,carrying
R4756 T6677 T6675 arg1Of RNAs,short
R4757 T6677 T6676 arg1Of RNAs,hairpin
R4758 T6677 T6678 arg1Of RNAs,(
R4759 T6677 T6681 arg1Of RNAs,specific
R4760 T6679 T6678 arg2Of shRNA,(
R4761 T6680 T6678 arg3Of ),(
R4762 T6681 T6682 arg1Of specific,for
R4763 T6686 T6682 arg2Of cebpb,for
R4764 T6686 T6683 arg1Of cebpb,human
R4765 T6686 T6684 arg1Of cebpb,and
R4766 T6686 T6685 arg1Of cebpb,mouse
R4767 T6688 T6687 arg2Of used,were
R4768 T6688 T6689 arg1Of used,in
R4769 T6691 T6689 arg2Of studies,in
R4770 T6691 T6690 arg1Of studies,these
R4771 T6700 T6693 arg1Of regions,the
R4772 T6700 T6694 arg1Of regions,human
R4773 T6700 T6695 arg1Of regions,and
R4774 T6700 T6696 arg1Of regions,mouse
R4775 T6700 T6697 arg1Of regions,cebpb
R4776 T6700 T6698 arg1Of regions,3′
R4777 T6700 T6699 arg1Of regions,untranslated
R4778 T6700 T6701 arg1Of regions,are
R4779 T6700 T6703 arg1Of regions,identical
R4780 T6701 T6692 arg2Of are,Because
R4781 T6701 T6702 arg1Of are,not
R4782 T6703 T6701 arg2Of identical,are
R4783 T6707 T6705 arg1Of shRNAs,these
R4784 T6707 T6706 arg1Of shRNAs,species-specific
R4785 T6707 T6708 arg1Of shRNAs,can
R4786 T6707 T6710 arg1Of shRNAs,knockdown
R4787 T6707 T6716 arg1Of shRNAs,used
R4788 T6710 T6692 arg1Of knockdown,Because
R4789 T6710 T6704 arg1Of knockdown,","
R4790 T6710 T6708 arg2Of knockdown,can
R4791 T6710 T6709 arg1Of knockdown,not
R4792 T6710 T6715 arg1Of knockdown,when
R4793 T6710 T6723 arg1Of knockdown,;
R4794 T6711 T6710 arg2Of expression,knockdown
R4795 T6711 T6712 arg1Of expression,of
R4796 T6714 T6712 arg2Of C/EBP-β,of
R4797 T6714 T6713 arg1Of C/EBP-β,endogenous
R4798 T6716 T6715 arg2Of used,when
R4799 T6716 T6717 arg1Of used,on
R4800 T6718 T6717 arg2Of cells,on
R4801 T6718 T6719 arg1Of cells,of
R4802 T6722 T6719 arg2Of species,of
R4803 T6722 T6720 arg1Of species,the
R4804 T6722 T6721 arg1Of species,other
R4805 T6725 T6726 arg1Of we,used
R4806 T6726 T6723 arg2Of used,;
R4807 T6726 T6724 arg1Of used,therefore
R4808 T6726 T6731 arg1Of used,as
R4809 T6730 T6726 arg2Of shRNA,used
R4810 T6730 T6727 arg1Of shRNA,the
R4811 T6730 T6728 arg1Of shRNA,human
R4812 T6730 T6729 arg1Of shRNA,CEBPB
R4813 T6733 T6731 arg2Of control,as
R4814 T6733 T6732 arg1Of control,a
R4815 T6733 T6734 arg1Of control,in
R4816 T6736 T6734 arg2Of experiments,in
R4817 T6736 T6735 arg1Of experiments,these
R4818 T6736 T6737 arg1Of experiments,as
R4819 T6737 T6738 arg1Of as,in
R4820 T6740 T6738 arg2Of 38,in
R4821 T6740 T6739 arg2Of 38,[
R4822 T6741 T6739 arg3Of ],[
R4823 T6743 T6742 arg1Of produce,To
R4824 T6745 T6743 arg2Of particles,produce
R4825 T6745 T6744 arg1Of particles,lentiviral
R4826 T6748 T6743 arg1Of cells,produce
R4827 T6748 T6747 arg1Of cells,HEK-293T
R4828 T6748 T6749 arg1Of cells,were
R4829 T6748 T6750 arg2Of cells,transfected
R4830 T6748 T6782 arg1Of cells,using
R4831 T6750 T6742 modOf transfected,To
R4832 T6750 T6746 arg1Of transfected,","
R4833 T6750 T6749 arg2Of transfected,were
R4834 T6750 T6751 arg1Of transfected,with
R4835 T6750 T6782 modOf transfected,using
R4836 T6753 T6751 arg2Of mixture,with
R4837 T6753 T6752 arg1Of mixture,a
R4838 T6753 T6754 arg1Of mixture,of
R4839 T6753 T6756 arg1Of mixture,:
R4840 T6755 T6754 arg2Of plasmids,of
R4841 T6760 T6758 arg1Of plasmid,shRNA
R4842 T6760 T6759 arg1Of plasmid,expression
R4843 T6760 T6761 arg1Of plasmid,(
R4844 T6760 T6765 arg1Of plasmid,","
R4845 T6763 T6761 arg2Of µg,(
R4846 T6763 T6762 arg1Of µg,1
R4847 T6764 T6761 arg3Of ),(
R4848 T6765 T6774 arg1Of ",",and
R4849 T6768 T6765 arg2Of plasmid,","
R4850 T6768 T6766 arg1Of plasmid,pCMV-ΔR8.2dvpr
R4851 T6768 T6767 arg1Of plasmid,packaging
R4852 T6768 T6769 arg1Of plasmid,(
R4853 T6771 T6769 arg2Of µg,(
R4854 T6771 T6770 arg1Of µg,0.75
R4855 T6772 T6769 arg3Of ),(
R4856 T6774 T6756 arg2Of and,:
R4857 T6774 T6757 arg1Of and,each
R4858 T6774 T6773 arg1Of and,","
R4859 T6777 T6774 arg2Of plasmid,and
R4860 T6777 T6775 arg1Of plasmid,pCMV-VSV-G
R4861 T6777 T6776 arg1Of plasmid,envelope
R4862 T6777 T6778 arg1Of plasmid,(
R4863 T6780 T6778 arg2Of µg,(
R4864 T6780 T6779 arg1Of µg,0.25
R4865 T6781 T6778 arg3Of ),(
R4866 T6785 T6782 arg2Of reagent,using
R4867 T6785 T6783 arg1Of reagent,Lipofectamine
R4868 T6785 T6784 arg1Of reagent,2000
R4869 T6785 T6786 arg1Of reagent,(
R4870 T6787 T6786 arg2Of Invitrogen,(
R4871 T6788 T6786 arg3Of ),(
R4872 T6791 T6789 arg1Of supernatant,The
R4873 T6791 T6790 arg1Of supernatant,lentiviral
R4874 T6791 T6792 arg1Of supernatant,was
R4875 T6795 T6792 arg2Of hrs,was
R4876 T6795 T6793 arg2Of hrs,collected
R4877 T6795 T6794 arg1Of hrs,48
R4878 T6795 T6796 arg1Of hrs,after
R4879 T6795 T6798 arg1Of hrs,","
R4880 T6795 T6799 arg2Of hrs,cleared
R4881 T6795 T6809 arg2Of hrs,passed
R4882 T6797 T6796 arg2Of transfection,after
R4883 T6799 T6802 arg1Of cleared,at
R4884 T6799 T6808 arg1Of cleared,and
R4885 T6801 T6799 arg1Of centrifugation,cleared
R4886 T6801 T6800 arg2Of centrifugation,by
R4887 T6804 T6802 arg2Of g,at
R4888 T6804 T6803 arg1Of g,"2,000"
R4889 T6804 T6805 arg1Of g,for
R4890 T6807 T6805 arg2Of mins,for
R4891 T6807 T6806 arg1Of mins,10
R4892 T6809 T6808 arg2Of passed,and
R4893 T6809 T6810 arg1Of passed,through
R4894 T6812 T6813 arg1Of 0.45,µm
R4895 T6814 T6810 arg2Of filter,through
R4896 T6814 T6811 arg1Of filter,a
R4897 T6814 T6812 arg1Of filter,0.45
R4898 T6817 T6815 arg1Of cells,The
R4899 T6817 T6816 arg1Of cells,target
R4900 T6817 T6818 arg1Of cells,were
R4901 T6817 T6819 arg2Of cells,treated
R4902 T6819 T6818 arg2Of treated,were
R4903 T6819 T6820 arg1Of treated,with
R4904 T6823 T6824 arg1Of supernatant,and
R4905 T6825 T6824 arg2Of 8,and
R4906 T6827 T6820 arg2Of Polybrene,with
R4907 T6827 T6821 arg1Of Polybrene,the
R4908 T6827 T6822 arg1Of Polybrene,lentiviral
R4909 T6827 T6823 arg1Of Polybrene,supernatant
R4910 T6827 T6825 arg1Of Polybrene,8
R4911 T6827 T6826 arg1Of Polybrene,µg/ml
R4912 T6827 T6828 arg1Of Polybrene,(
R4913 T6827 T6832 arg1Of Polybrene,for
R4914 T6830 T6828 arg2Of Bioanalytical,(
R4915 T6830 T6829 arg1Of Bioanalytical,American
R4916 T6831 T6828 arg3Of ),(
R4917 T6834 T6832 arg2Of hrs,for
R4918 T6834 T6833 arg1Of hrs,24
R4919 T6837 T6835 arg1Of supernatant,The
R4920 T6837 T6836 arg1Of supernatant,lentiviral
R4921 T6837 T6838 arg1Of supernatant,was
R4922 T6837 T6839 arg2Of supernatant,replaced
R4923 T6837 T6845 arg2Of supernatant,incubated
R4924 T6837 T6851 arg1Of supernatant,allow
R4925 T6839 T6840 arg1Of replaced,with
R4926 T6839 T6844 arg1Of replaced,and
R4927 T6843 T6840 arg2Of media,with
R4928 T6843 T6841 arg1Of media,fresh
R4929 T6843 T6842 arg1Of media,growth
R4930 T6844 T6838 arg2Of and,was
R4931 T6845 T6844 arg2Of incubated,and
R4932 T6845 T6846 arg1Of incubated,further
R4933 T6845 T6847 arg1Of incubated,for
R4934 T6845 T6850 modOf incubated,to
R4935 T6849 T6847 arg2Of hrs,for
R4936 T6849 T6848 arg1Of hrs,72
R4937 T6851 T6850 arg1Of allow,to
R4938 T6851 T6852 arg1Of allow,for
R4939 T6855 T6852 arg2Of knockdown,for
R4940 T6855 T6853 arg1Of knockdown,effective
R4941 T6855 T6854 arg1Of knockdown,gene
R4942 T6857 T6856 arg1Of knockdown,C/EBP-β
R4943 T6857 T6858 arg1Of knockdown,was
R4944 T6857 T6859 arg2Of knockdown,confirmed
R4945 T6859 T6858 arg2Of confirmed,was
R4946 T6863 T6859 arg1Of analysis,confirmed
R4947 T6863 T6860 arg2Of analysis,by
R4948 T6863 T6861 arg1Of analysis,western
R4949 T6863 T6862 arg1Of analysis,blot
R5191 T7275 T7276 arg1Of Transfection,and
R5192 T7277 T7276 arg2Of Luciferase,and
R5193 T7278 T7274 arg1Of Assays,Transient
R5194 T7278 T7275 arg1Of Assays,Transfection
R5195 T7278 T7277 arg1Of Assays,Luciferase
R5196 T7278 T7279 arg1Of Assays,(
R5197 T7281 T7279 arg2Of Cells,(
R5198 T7281 T7280 arg1Of Cells,MEF
R5199 T7282 T7279 arg3Of ),(
R5200 T7284 T7283 arg1Of MEFs,Cebpb −/−
R5201 T7284 T7285 arg1Of MEFs,(
R5202 T7284 T7288 arg1Of MEFs,[
R5203 T7284 T7291 arg1Of MEFs,were
R5204 T7284 T7292 arg2Of MEFs,transfected
R5205 T7286 T7285 arg2Of 1×105,(
R5206 T7287 T7285 arg3Of ),(
R5207 T7289 T7288 arg2Of 34,[
R5208 T7290 T7288 arg3Of ],[
R5209 T7292 T7291 arg2Of transfected,were
R5210 T7292 T7293 arg1Of transfected,with
R5211 T7298 T7293 arg2Of plasmid,with
R5212 T7298 T7294 arg1Of plasmid,the
R5213 T7298 T7295 arg2Of plasmid,indicated
R5214 T7298 T7296 arg1Of plasmid,luciferase
R5215 T7298 T7297 arg1Of plasmid,reporter
R5216 T7298 T7299 arg1Of plasmid,(
R5217 T7298 T7303 arg1Of plasmid,along
R5218 T7298 T7315 arg1Of plasmid,using
R5219 T7298 T7320 arg1Of plasmid,(
R5220 T7301 T7299 arg2Of ng,(
R5221 T7301 T7300 arg1Of ng,400
R5222 T7302 T7299 arg3Of ),(
R5223 T7303 T7304 arg1Of along,with
R5224 T7308 T7304 arg2Of plasmid,with
R5225 T7308 T7305 arg1Of plasmid,a
R5226 T7308 T7306 arg1Of plasmid,β-actin-β-galactosidase
R5227 T7308 T7307 arg1Of plasmid,reporter
R5228 T7308 T7309 arg1Of plasmid,(
R5229 T7308 T7313 arg1Of plasmid,by
R5230 T7311 T7309 arg2Of ng,(
R5231 T7311 T7310 arg1Of ng,200
R5232 T7312 T7309 arg3Of ),(
R5233 T7314 T7313 arg2Of electroporation,by
R5234 T7318 T7317 arg1Of Neon™,Invitrogen
R5235 T7319 T7315 arg2Of system,using
R5236 T7319 T7316 arg1Of system,the
R5237 T7319 T7318 arg1Of system,Neon™
R5238 T7322 T7320 arg2Of pulse,(
R5239 T7322 T7321 arg1Of pulse,1
R5240 T7322 T7323 arg1Of pulse,","
R5241 T7322 T7326 arg1Of pulse,","
R5242 T7325 T7323 arg2Of V,","
R5243 T7325 T7324 arg1Of V,1350
R5244 T7328 T7326 arg2Of msec,","
R5245 T7328 T7327 arg1Of msec,30
R5246 T7329 T7320 arg3Of ),(
R5247 T7331 T7330 arg2Of cells,Transfected
R5248 T7331 T7332 arg1Of cells,were
R5249 T7331 T7333 arg2Of cells,transferred
R5250 T7331 T7342 arg2Of cells,incubated
R5251 T7333 T7334 arg1Of transferred,to
R5252 T7333 T7341 arg1Of transferred,and
R5253 T7336 T7334 arg2Of media,to
R5254 T7336 T7335 arg1Of media,pre-warmed
R5255 T7336 T7337 arg1Of media,in
R5256 T7340 T7337 arg2Of plates,in
R5257 T7340 T7338 arg1Of plates,24
R5258 T7340 T7339 arg1Of plates,well
R5259 T7341 T7332 arg2Of and,were
R5260 T7341 T7355 arg1Of and,for
R5261 T7342 T7341 arg2Of incubated,and
R5262 T7342 T7343 arg1Of incubated,for
R5263 T7345 T7343 arg2Of hrs,for
R5264 T7345 T7344 arg1Of hrs,48
R5265 T7345 T7349 arg1Of hrs,with
R5266 T7346 T7347 arg1Of prior,to
R5267 T7348 T7347 arg2Of incubation,to
R5268 T7349 T7346 arg1Of with,prior
R5269 T7350 T7349 arg2Of LPS,with
R5270 T7350 T7351 arg1Of LPS,(
R5271 T7353 T7351 arg2Of ng/ml,(
R5272 T7353 T7352 arg1Of ng/ml,100
R5273 T7354 T7351 arg3Of ),(
R5274 T7357 T7355 arg2Of hrs,for
R5275 T7357 T7356 arg1Of hrs,4
R5276 T7357 T7359 arg2Of hrs,indicated
R5277 T7359 T7358 arg1Of indicated,where
R5278 T7362 T7360 arg2Of experiments,In
R5279 T7362 T7361 arg1Of experiments,some
R5280 T7364 T7365 arg1Of plasmids,encoding
R5281 T7364 T7381 arg1Of plasmids,–
R5282 T7364 T7382 arg1Of plasmids,[
R5283 T7364 T7385 arg1Of plasmids,or
R5284 T7365 T7378 arg1Of encoding,[
R5285 T7370 T7365 arg2Of mutants,encoding
R5286 T7370 T7366 arg1Of mutants,C/EBP-β
R5287 T7370 T7367 arg1Of mutants,or
R5288 T7370 T7368 arg1Of mutants,C/EBP-β
R5289 T7370 T7369 arg1Of mutants,phospho-acceptor
R5290 T7370 T7371 arg1Of mutants,(
R5291 T7372 T7371 arg2Of T188A,(
R5292 T7372 T7373 arg1Of T188A,","
R5293 T7372 T7375 arg1Of T188A,","
R5294 T7374 T7373 arg2Of T217A,","
R5295 T7376 T7375 arg2Of S64A,","
R5296 T7377 T7371 arg3Of ),(
R5297 T7379 T7378 arg2Of 38,[
R5298 T7380 T7378 arg3Of ],[
R5299 T7383 T7382 arg2Of 40,[
R5300 T7384 T7382 arg3Of ],[
R5301 T7385 T7388 arg1Of or,were
R5302 T7385 T7389 arg2Of or,co-transfected
R5303 T7387 T7385 arg2Of vector,or
R5304 T7387 T7386 arg1Of vector,control
R5305 T7389 T7360 arg1Of co-transfected,In
R5306 T7389 T7363 arg1Of co-transfected,","
R5307 T7389 T7388 arg2Of co-transfected,were
R5308 T7389 T7390 arg1Of co-transfected,(
R5309 T7394 T7390 arg2Of DNA,(
R5310 T7394 T7391 arg1Of DNA,0.6–1.0
R5311 T7394 T7392 arg1Of DNA,µg
R5312 T7394 T7393 arg1Of DNA,total
R5313 T7395 T7390 arg3Of ),(
R5314 T7397 T7396 arg1Of activity,Luciferase
R5315 T7397 T7398 arg1Of activity,was
R5316 T7397 T7399 arg2Of activity,determined
R5317 T7397 T7401 arg2Of activity,normalized
R5318 T7397 T7409 arg1Of activity,using
R5319 T7399 T7400 arg1Of determined,and
R5320 T7400 T7398 arg2Of and,was
R5321 T7400 T7420 arg1Of and,","
R5322 T7400 T7421 arg1Of and,respectively
R5323 T7400 T7422 arg1Of and,(
R5324 T7401 T7400 arg2Of normalized,and
R5325 T7401 T7402 arg1Of normalized,to
R5326 T7401 T7406 arg1Of normalized,[
R5327 T7401 T7409 modOf normalized,using
R5328 T7403 T7402 arg2Of that,to
R5329 T7403 T7404 arg1Of that,of
R5330 T7405 T7404 arg2Of β-galactosidase,of
R5331 T7407 T7406 arg2Of 38,[
R5332 T7408 T7406 arg3Of ],[
R5333 T7413 T7410 arg1Of System,the
R5334 T7413 T7411 arg1Of System,Luciferase
R5335 T7413 T7412 arg1Of System,Assay
R5336 T7413 T7414 arg1Of System,and
R5337 T7414 T7409 arg2Of and,using
R5338 T7419 T7414 arg2Of Kits,and
R5339 T7419 T7415 arg1Of Kits,β-Galactosidase
R5340 T7419 T7416 arg1Of Kits,Enzyme
R5341 T7419 T7417 arg1Of Kits,Assay
R5342 T7419 T7418 arg1Of Kits,System
R5343 T7423 T7422 arg2Of Promega,(
R5344 T7424 T7422 arg3Of ),(
R5345 T7426 T7425 arg1Of experiment,Each
R5346 T7426 T7427 arg1Of experiment,was
R5347 T7426 T7428 arg2Of experiment,repeated
R5348 T7428 T7427 arg2Of repeated,was
R5349 T7428 T7432 arg1Of repeated,times
R5350 T7428 T7434 arg1Of repeated,and
R5351 T7431 T7429 arg1Of three,at
R5352 T7431 T7430 arg1Of three,least
R5353 T7432 T7431 arg1Of times,three
R5354 T7434 T7433 arg1Of and,","
R5355 T7436 T7435 arg1Of samples,triplicate
R5356 T7436 T7437 arg1Of samples,were
R5357 T7436 T7438 arg2Of samples,employed
R5358 T7438 T7434 arg2Of employed,and
R5359 T7438 T7437 arg2Of employed,were
R5360 T7438 T7439 arg1Of employed,for
R5361 T7441 T7439 arg2Of sample,for
R5362 T7441 T7440 arg1Of sample,each
R5363 T7442 T7443 arg1Of Expression,of
R5364 T7442 T7449 arg1Of Expression,was
R5365 T7442 T7450 arg2Of Expression,checked
R5366 T7448 T7443 arg2Of proteins,of
R5367 T7448 T7444 arg1Of proteins,the
R5368 T7448 T7445 arg1Of proteins,C/EBP-β
R5369 T7448 T7446 arg1Of proteins,phospho-acceptor
R5370 T7448 T7447 arg1Of proteins,mutant
R5371 T7450 T7449 arg2Of checked,was
R5372 T7450 T7451 arg1Of checked,for
R5373 T7453 T7451 arg2Of expression,for
R5374 T7453 T7452 arg1Of expression,equal
R5375 T7456 T7450 arg1Of blot,checked
R5376 T7456 T7454 arg2Of blot,by
R5377 T7456 T7455 arg1Of blot,western
R5604 T7838 T7835 arg1Of Assays,Electrophoretic
R5605 T7838 T7836 arg1Of Assays,Mobility
R5606 T7838 T7837 arg1Of Assays,Shift
R5607 T7843 T7839 arg1Of probes,Radiolabelled
R5608 T7843 T7841 arg1Of probes,double-stranded
R5609 T7843 T7842 arg1Of probes,oligonucleotide
R5610 T7843 T7844 arg1Of probes,for
R5611 T7843 T7848 arg1Of probes,were
R5612 T7843 T7849 arg2Of probes,prepared
R5613 T7847 T7844 arg2Of assays,for
R5614 T7847 T7845 arg1Of assays,gel
R5615 T7847 T7846 arg1Of assays,shift
R5616 T7849 T7839 modOf prepared,Radiolabelled
R5617 T7849 T7840 arg1Of prepared,","
R5618 T7849 T7848 arg2Of prepared,were
R5619 T7849 T7850 modOf prepared,using
R5620 T7853 T7851 arg1Of kinase,T4
R5621 T7853 T7852 arg1Of kinase,polynucleotide
R5622 T7853 T7854 arg1Of kinase,and
R5623 T7854 T7850 arg2Of and,using
R5624 T7856 T7855 arg2Of γ-32P,[
R5625 T7857 T7855 arg3Of ],[
R5626 T7858 T7854 arg2Of -ATP,and
R5627 T7858 T7855 arg1Of -ATP,[
R5628 T7862 T7859 arg1Of extracts,RAW
R5629 T7862 T7860 arg1Of extracts,264.7
R5630 T7862 T7861 arg1Of extracts,nuclear
R5631 T7862 T7863 arg1Of extracts,were
R5632 T7862 T7864 arg2Of extracts,prepared
R5633 T7864 T7863 arg2Of prepared,were
R5634 T7864 T7870 arg1Of prepared,[
R5635 T7869 T7864 arg1Of method,prepared
R5636 T7869 T7865 arg2Of method,by
R5637 T7869 T7866 arg1Of method,the
R5638 T7869 T7867 arg1Of method,detergent
R5639 T7869 T7868 arg1Of method,lysis
R5640 T7871 T7870 arg2Of 41,[
R5641 T7872 T7870 arg3Of ],[
R5642 T7875 T7873 arg1Of reactions,DNA
R5643 T7875 T7874 arg1Of reactions,binding
R5644 T7875 T7876 arg1Of reactions,(
R5645 T7875 T7880 arg1Of reactions,containing
R5646 T7875 T7890 arg1Of reactions,","
R5647 T7875 T7909 arg1Of reactions,","
R5648 T7878 T7876 arg2Of µl,(
R5649 T7878 T7877 arg1Of µl,25
R5650 T7879 T7876 arg3Of ),(
R5651 T7881 T7882 arg1Of 10,mM
R5652 T7885 T7886 arg1Of 7.9,","
R5653 T7888 T7886 arg2Of µg/ml,","
R5654 T7888 T7887 arg1Of µg/ml,10
R5655 T7889 T7880 arg2Of BSA,containing
R5656 T7889 T7881 arg1Of BSA,10
R5657 T7889 T7883 arg1Of BSA,HEPES
R5658 T7889 T7884 arg1Of BSA,pH
R5659 T7889 T7885 arg1Of BSA,7.9
R5660 T7889 T7888 arg1Of BSA,µg/ml
R5661 T7891 T7892 arg1Of 2,mM
R5662 T7893 T7891 arg1Of DTT,2
R5663 T7893 T7894 arg1Of DTT,","
R5664 T7894 T7898 arg1Of ",",","
R5665 T7895 T7896 arg1Of 30,%
R5666 T7897 T7894 arg2Of glycerol,","
R5667 T7897 T7895 arg1Of glycerol,30
R5668 T7898 T7902 arg1Of ",",","
R5669 T7899 T7900 arg1Of 20,%
R5670 T7901 T7898 arg2Of Ficoll-400,","
R5671 T7901 T7899 arg1Of Ficoll-400,20
R5672 T7902 T7890 arg2Of ",",","
R5673 T7905 T7902 arg2Of poly,","
R5674 T7905 T7903 arg1Of poly,1
R5675 T7905 T7904 arg1Of poly,µg
R5676 T7905 T7906 arg1Of poly,(
R5677 T7907 T7906 arg2Of dI-dC,(
R5678 T7908 T7906 arg3Of ),(
R5679 T7909 T7929 arg1Of ",",were
R5680 T7909 T7930 arg2Of ",",performed
R5681 T7911 T7910 arg1Of µg,6
R5682 T7911 T7912 arg1Of µg,of
R5683 T7911 T7915 arg1Of µg,and
R5684 T7914 T7912 arg2Of extracts,of
R5685 T7914 T7913 arg1Of extracts,nuclear
R5686 T7915 T7909 arg2Of and,","
R5687 T7915 T7926 arg1Of and,of
R5688 T7916 T7917 arg1Of "10,000",to
R5689 T7918 T7917 arg2Of "20,000",to
R5690 T7919 T7915 arg2Of cpm,and
R5691 T7919 T7916 arg1Of cpm,"10,000"
R5692 T7919 T7920 arg1Of cpm,(
R5693 T7921 T7922 arg1Of 0.05,to
R5694 T7923 T7922 arg2Of 0.2,to
R5695 T7924 T7920 arg2Of ng,(
R5696 T7924 T7921 arg1Of ng,0.05
R5697 T7925 T7920 arg3Of ),(
R5698 T7928 T7926 arg2Of probe,of
R5699 T7928 T7927 arg2Of probe,radiolabelled
R5700 T7930 T7929 arg2Of performed,were
R5701 T7930 T7931 arg1Of performed,for
R5702 T7933 T7931 arg2Of minutes,for
R5703 T7933 T7932 arg1Of minutes,20
R5704 T7933 T7934 arg1Of minutes,at
R5705 T7936 T7934 arg2Of temperature,at
R5706 T7936 T7935 arg1Of temperature,room
R5707 T7939 T7937 arg1Of products,Binding
R5708 T7939 T7938 arg1Of products,reaction
R5709 T7939 T7940 arg1Of products,were
R5710 T7939 T7941 arg2Of products,resolved
R5711 T7941 T7940 arg2Of resolved,were
R5712 T7941 T7942 arg1Of resolved,by
R5713 T7943 T7942 arg2Of electrophoresis,by
R5714 T7943 T7944 arg1Of electrophoresis,at
R5715 T7946 T7944 arg2Of temperature,at
R5716 T7946 T7945 arg1Of temperature,room
R5717 T7946 T7947 arg1Of temperature,on
R5718 T7946 T7961 arg1Of temperature,in
R5719 T7948 T7949 arg1Of 5,%
R5720 T7951 T7947 arg2Of gels,on
R5721 T7951 T7948 arg1Of gels,5
R5722 T7951 T7950 arg1Of gels,polyacrylamide
R5723 T7951 T7952 arg1Of gels,(
R5724 T7954 T7953 arg1Of acrylamide,29∶1
R5725 T7954 T7955 arg1Of acrylamide,:
R5726 T7955 T7952 arg2Of :,(
R5727 T7956 T7955 arg2Of bis-acrylamide,:
R5728 T7956 T7957 arg1Of bis-acrylamide,(
R5729 T7958 T7957 arg2Of Bio-Rad,(
R5730 T7959 T7957 arg3Of ),(
R5731 T7960 T7952 arg3Of ),(
R5732 T7963 T7961 arg2Of TBE,in
R5733 T7963 T7962 arg1Of TBE,1x
R5734 T7963 T7964 arg1Of TBE,at
R5735 T7965 T7964 arg2Of 10V/cm,at
R5736 T7968 T7966 arg2Of assays,For
R5737 T7968 T7967 arg1Of assays,supershift
R5738 T7971 T7970 arg1Of extracts,nuclear
R5739 T7971 T7972 arg1Of extracts,were
R5740 T7972 T7966 arg1Of were,For
R5741 T7972 T7969 arg1Of were,","
R5742 T7974 T7973 arg1Of 2,pre-incubated
R5743 T7975 T7972 arg2Of hrs,were
R5744 T7975 T7974 arg1Of hrs,2
R5745 T7975 T7976 arg1Of hrs,on
R5746 T7977 T7976 arg2Of ice,on
R5747 T7977 T7978 arg1Of ice,with
R5748 T7980 T7978 arg2Of µg,with
R5749 T7980 T7979 arg1Of µg,4
R5750 T7980 T7981 arg1Of µg,of
R5751 T7984 T7981 arg2Of antibody,of
R5752 T7984 T7982 arg1Of antibody,specific
R5753 T7984 T7983 arg1Of antibody,C/EBP
R5754 T7985 T7986 arg1Of Antibodies,were
R5755 T7985 T7987 arg2Of Antibodies,purchased
R5756 T7987 T7986 arg2Of purchased,were
R5757 T7987 T7988 arg1Of purchased,from
R5758 T7990 T7988 arg2Of Cruz,from
R5759 T7990 T7989 arg1Of Cruz,Santa
R5760 T7990 T7991 arg1Of Cruz,:
R5761 T7992 T7993 arg1Of anti-C/EBP-α,(
R5762 T7992 T7996 arg1Of anti-C/EBP-α,","
R5763 T7994 T7993 arg2Of sc-61,(
R5764 T7995 T7993 arg3Of ),(
R5765 T7996 T8001 arg1Of ",",","
R5766 T7997 T7996 arg2Of anti-C/EBP-β,","
R5767 T7997 T7998 arg1Of anti-C/EBP-β,(
R5768 T7999 T7998 arg2Of sc-150,(
R5769 T8000 T7998 arg3Of ),(
R5770 T8001 T7991 arg2Of ",",:
R5771 T8002 T8003 arg1Of anti-C/EBP-δ,(
R5772 T8002 T8006 arg1Of anti-C/EBP-δ,and
R5773 T8004 T8003 arg2Of sc-151,(
R5774 T8005 T8003 arg3Of ),(
R5775 T8006 T8001 arg2Of and,","
R5776 T8007 T8006 arg2Of anti-C/EBP-ε,and
R5777 T8007 T8008 arg1Of anti-C/EBP-ε,(
R5778 T8009 T8008 arg2Of sc-158,(
R5779 T8010 T8008 arg3Of ),(
R5976 T8306 T8305 arg1Of Immunoprecipitation,Chromatin
R5977 T8306 T8307 arg1Of Immunoprecipitation,(
R5978 T8308 T8307 arg2Of ChIP,(
R5979 T8309 T8307 arg3Of ),(
R5980 T8310 T8306 arg1Of Assay,Immunoprecipitation
R5981 T8312 T8311 arg1Of assays,ChIP
R5982 T8312 T8313 arg1Of assays,were
R5983 T8312 T8314 arg2Of assays,performed
R5984 T8314 T8313 arg2Of performed,were
R5985 T8314 T8330 arg1Of performed,","
R5986 T8314 T8331 arg1Of performed,with
R5987 T8315 T8314 arg3Of using,performed
R5988 T8315 T8324 arg1Of using,","
R5989 T8315 T8325 arg1Of using,as
R5990 T8320 T8315 arg2Of kit,using
R5991 T8320 T8316 arg1Of kit,a
R5992 T8320 T8317 arg1Of kit,commercially
R5993 T8320 T8318 arg1Of kit,available
R5994 T8320 T8319 arg1Of kit,Magna-ChIP™
R5995 T8320 T8321 arg1Of kit,(
R5996 T8322 T8321 arg2Of Millipore,(
R5997 T8323 T8321 arg3Of ),(
R5998 T8326 T8325 arg2Of recommended,as
R5999 T8329 T8326 arg1Of manufacturer,recommended
R6000 T8329 T8327 arg2Of manufacturer,by
R6001 T8329 T8328 arg1Of manufacturer,the
R6002 T8333 T8331 arg2Of modifications,with
R6003 T8333 T8332 arg1Of modifications,minor
R6004 T8337 T8350 arg1Of crosslinking,and
R6005 T8339 T8337 arg2Of chromatin,crosslinking
R6006 T8339 T8338 arg1Of chromatin,the
R6007 T8339 T8340 arg1Of chromatin,with
R6008 T8339 T8347 arg1Of chromatin,for
R6009 T8341 T8342 arg1Of 1,%
R6010 T8343 T8340 arg2Of formaldehyde,with
R6011 T8343 T8341 arg1Of formaldehyde,1
R6012 T8343 T8344 arg1Of formaldehyde,at
R6013 T8346 T8344 arg2Of temperature,at
R6014 T8346 T8345 arg1Of temperature,room
R6015 T8349 T8347 arg2Of min,for
R6016 T8349 T8348 arg1Of min,10
R6017 T8350 T8336 arg2Of and,after
R6018 T8351 T8350 arg2Of neutralizing,and
R6019 T8351 T8352 arg1Of neutralizing,with
R6020 T8351 T8354 arg1Of neutralizing,for
R6021 T8353 T8352 arg2Of glycine,with
R6022 T8356 T8354 arg2Of min,for
R6023 T8356 T8355 arg1Of min,5
R6024 T8356 T8357 arg1Of min,at
R6025 T8359 T8357 arg2Of temperature,at
R6026 T8359 T8358 arg1Of temperature,room
R6027 T8361 T8337 arg1Of cells,crosslinking
R6028 T8361 T8351 arg1Of cells,neutralizing
R6029 T8361 T8362 arg1Of cells,were
R6030 T8361 T8363 arg2Of cells,washed
R6031 T8361 T8368 arg2Of cells,scraped
R6032 T8361 T8370 arg2Of cells,collected
R6033 T8363 T8364 arg1Of washed,with
R6034 T8363 T8367 arg1Of washed,","
R6035 T8366 T8364 arg2Of PBS,with
R6036 T8366 T8365 arg1Of PBS,cold
R6037 T8367 T8369 arg1Of ",",and
R6038 T8368 T8367 arg2Of scraped,","
R6039 T8369 T8334 arg1Of and,Briefly
R6040 T8369 T8335 arg1Of and,","
R6041 T8369 T8336 arg1Of and,after
R6042 T8369 T8360 arg1Of and,","
R6043 T8369 T8362 arg2Of and,were
R6044 T8370 T8369 arg2Of collected,and
R6045 T8370 T8371 arg1Of collected,on
R6046 T8372 T8371 arg2Of ice,on
R6047 T8374 T8373 arg1Of extracts,Cells
R6048 T8374 T8375 arg1Of extracts,were
R6049 T8374 T8376 arg2Of extracts,prepared
R6050 T8376 T8375 arg2Of prepared,were
R6051 T8376 T8377 modOf prepared,using
R6052 T8380 T8379 arg1Of available,commercially
R6053 T8381 T8377 arg2Of kit,using
R6054 T8381 T8378 arg1Of kit,a
R6055 T8381 T8380 arg1Of kit,available
R6056 T8381 T8382 arg1Of kit,(
R6057 T8383 T8382 arg2Of Millipore,(
R6058 T8384 T8382 arg3Of ),(
R6059 T8386 T8385 arg1Of lysates,Nuclear
R6060 T8386 T8387 arg1Of lysates,were
R6061 T8386 T8388 arg2Of lysates,sonicated
R6062 T8388 T8387 arg2Of sonicated,were
R6063 T8388 T8390 arg1Of sonicated,times
R6064 T8388 T8391 arg1Of sonicated,for
R6065 T8388 T8394 arg1Of sonicated,with
R6066 T8390 T8389 arg1Of times,5
R6067 T8393 T8391 arg2Of sec,for
R6068 T8393 T8392 arg1Of sec,15
R6069 T8397 T8394 arg2Of intervals,with
R6070 T8397 T8395 arg1Of intervals,1
R6071 T8397 T8396 arg1Of intervals,min
R6072 T8397 T8398 arg1Of intervals,on
R6073 T8397 T8400 arg1Of intervals,using
R6074 T8399 T8398 arg2Of ice,on
R6075 T8403 T8400 arg2Of Dismembrator,using
R6076 T8403 T8401 arg1Of Dismembrator,a
R6077 T8403 T8402 arg1Of Dismembrator,Sonic
R6078 T8403 T8404 arg1Of Dismembrator,(
R6079 T8405 T8404 arg2Of Fisher,(
R6080 T8406 T8404 arg3Of ),(
R6081 T8409 T8407 arg1Of amount,An
R6082 T8409 T8408 arg1Of amount,equal
R6083 T8409 T8410 arg1Of amount,of
R6084 T8409 T8412 arg1Of amount,was
R6085 T8409 T8413 arg2Of amount,immunoprecipitated
R6086 T8411 T8410 arg2Of chromatin,of
R6087 T8413 T8412 arg2Of immunoprecipitated,was
R6088 T8413 T8414 arg1Of immunoprecipitated,at
R6089 T8413 T8417 arg1Of immunoprecipitated,with
R6090 T8415 T8414 arg2Of 4°C,at
R6091 T8417 T8416 arg1Of with,overnight
R6092 T8420 T8418 arg1Of 1,at
R6093 T8420 T8419 arg1Of 1,least
R6094 T8421 T8417 arg2Of µg,with
R6095 T8421 T8420 arg1Of µg,1
R6096 T8421 T8422 arg1Of µg,of
R6097 T8421 T8426 arg1Of µg,:
R6098 T8425 T8422 arg2Of antibodies,of
R6099 T8425 T8423 arg1Of antibodies,the
R6100 T8425 T8424 arg1Of antibodies,following
R6101 T8427 T8426 arg2Of C/EBP-β,:
R6102 T8427 T8428 arg1Of C/EBP-β,(
R6103 T8427 T8431 arg1Of C/EBP-β,","
R6104 T8427 T8439 arg1Of C/EBP-β,","
R6105 T8429 T8428 arg2Of sc-150X,(
R6106 T8430 T8428 arg3Of ),(
R6107 T8432 T8431 arg2Of p-C/EBP-β,","
R6108 T8432 T8433 arg1Of p-C/EBP-β,(
R6109 T8432 T8436 arg1Of p-C/EBP-β,(
R6110 T8434 T8433 arg2Of T217,(
R6111 T8435 T8433 arg3Of ),(
R6112 T8437 T8436 arg2Of sc-16993X,(
R6113 T8438 T8436 arg3Of ),(
R6114 T8442 T8440 arg1Of IgG,normal
R6115 T8442 T8441 arg1Of IgG,rabbit
R6116 T8442 T8443 arg1Of IgG,(
R6117 T8442 T8446 arg1Of IgG,(
R6118 T8442 T8451 arg1Of IgG,and
R6119 T8444 T8443 arg2Of sc-2027,(
R6120 T8445 T8443 arg3Of ),(
R6121 T8449 T8446 arg2Of Biotechnologies,(
R6122 T8449 T8447 arg1Of Biotechnologies,Santa
R6123 T8449 T8448 arg1Of Biotechnologies,Cruz
R6124 T8450 T8446 arg3Of ),(
R6125 T8451 T8439 arg2Of and,","
R6126 T8451 T8459 arg1Of and,(
R6127 T8453 T8451 arg2Of polymerase,and
R6128 T8453 T8452 arg1Of polymerase,RNA
R6129 T8453 T8454 arg1Of polymerase,II
R6130 T8453 T8455 arg1Of polymerase,(
R6131 T8456 T8455 arg2Of Clone,(
R6132 T8456 T8457 arg1Of Clone,CTD4H8
R6133 T8458 T8455 arg3Of ),(
R6134 T8460 T8459 arg2Of Millipore,(
R6135 T8461 T8459 arg3Of ),(
R6136 T8463 T8462 arg2Of products,Immunoprecipitated
R6137 T8463 T8464 arg1Of products,were
R6138 T8463 T8465 arg2Of products,collected
R6139 T8465 T8464 arg2Of collected,were
R6140 T8465 T8466 arg1Of collected,after
R6141 T8467 T8466 arg2Of incubation,after
R6142 T8467 T8468 arg1Of incubation,with
R6143 T8471 T8470 arg1Of coated,G
R6144 T8473 T8468 arg2Of beads,with
R6145 T8473 T8469 arg1Of beads,Protein
R6146 T8473 T8471 arg1Of beads,coated
R6147 T8473 T8472 arg1Of beads,magnetic
R6148 T8473 T8474 arg1Of beads,(
R6149 T8475 T8474 arg2Of Millipore,(
R6150 T8476 T8474 arg3Of ),(
R6151 T8478 T8477 arg1Of beads,The
R6152 T8478 T8479 arg1Of beads,were
R6153 T8478 T8480 arg2Of beads,washed
R6154 T8480 T8479 arg2Of washed,were
R6155 T8484 T8482 arg1Of chromatin,the
R6156 T8484 T8483 arg2Of chromatin,bound
R6157 T8484 T8485 arg1Of chromatin,was
R6158 T8484 T8486 arg2Of chromatin,eluted
R6159 T8486 T8479 modOf eluted,were
R6160 T8486 T8481 arg1Of eluted,","
R6161 T8486 T8485 arg2Of eluted,was
R6162 T8486 T8487 arg1Of eluted,in
R6163 T8486 T8494 arg1Of eluted,and
R6164 T8490 T8487 arg2Of Buffer,in
R6165 T8490 T8488 arg1Of Buffer,ChIP
R6166 T8490 T8489 arg1Of Buffer,Elution
R6167 T8490 T8491 arg1Of Buffer,(
R6168 T8492 T8491 arg2Of Millipore,(
R6169 T8493 T8491 arg3Of ),(
R6170 T8496 T8495 arg1Of proteins,the
R6171 T8496 T8497 arg1Of proteins,were
R6172 T8496 T8498 arg2Of proteins,digested
R6173 T8498 T8497 arg2Of digested,were
R6174 T8498 T8499 arg1Of digested,with
R6175 T8501 T8499 arg2Of K,with
R6176 T8501 T8500 arg1Of K,Proteinase
R6177 T8501 T8502 arg1Of K,for
R6178 T8501 T8505 arg1Of K,at
R6179 T8504 T8502 arg2Of hrs,for
R6180 T8504 T8503 arg1Of hrs,2
R6181 T8506 T8505 arg2Of 62°C.,at
R6182 T8508 T8507 arg1Of DNA,The
R6183 T8508 T8509 arg1Of DNA,was
R6184 T8508 T8511 arg2Of DNA,purified
R6185 T8511 T8494 arg2Of purified,and
R6186 T8511 T8497 modOf purified,were
R6187 T8511 T8509 arg2Of purified,was
R6188 T8511 T8510 arg1Of purified,then
R6189 T8511 T8512 modOf purified,using
R6190 T8517 T8512 arg2Of Kit,using
R6191 T8517 T8513 arg1Of Kit,the
R6192 T8517 T8514 arg1Of Kit,QIAquick
R6193 T8517 T8515 arg1Of Kit,PCR
R6194 T8517 T8516 arg1Of Kit,Purification
R6195 T8517 T8518 arg1Of Kit,(
R6196 T8519 T8518 arg2Of Qiagen,(
R6197 T8520 T8518 arg3Of ),(
R6198 T8521 T8522 arg1Of DNA,was
R6199 T8521 T8523 arg2Of DNA,amplified
R6200 T8521 T8530 arg1Of DNA,using
R6201 T8523 T8522 arg2Of amplified,was
R6202 T8523 T8524 arg1Of amplified,by
R6203 T8523 T8528 arg1Of amplified,by
R6204 T8523 T8530 modOf amplified,using
R6205 T8524 T8527 arg1Of by,or
R6206 T8526 T8524 arg2Of PCR,by
R6207 T8526 T8525 arg1Of PCR,semi-quantitative
R6208 T8528 T8527 arg2Of by,or
R6209 T8529 T8528 arg2Of qPCR,by
R6210 T8534 T8535 arg1Of method,and
R6211 T8535 T8530 arg2Of and,using
R6212 T8535 T8531 arg1Of and,the
R6213 T8535 T8532 arg1Of and,SYBR
R6214 T8535 T8533 arg1Of and,green
R6215 T8535 T8537 arg1Of and,specific
R6216 T8535 T8543 arg1Of and,:
R6217 T8535 T8549 arg1Of and,;
R6218 T8536 T8535 arg2Of primers,and
R6219 T8537 T8538 arg1Of specific,for
R6220 T8542 T8538 arg2Of promoter,for
R6221 T8542 T8539 arg1Of promoter,the
R6222 T8542 T8540 arg1Of promoter,SerpinB2
R6223 T8542 T8541 arg1Of promoter,proximal
R6224 T8544 T8545 arg1Of forward,(
R6225 T8546 T8545 arg2Of −338/−315,(
R6226 T8547 T8545 arg3Of ),(
R6227 T8548 T8543 arg2Of 5′AAGACTCCCACAGATGGTGGCTGT3’,:
R6228 T8548 T8544 arg1Of 5′AAGACTCCCACAGATGGTGGCTGT3’,forward
R6229 T8550 T8551 arg1Of reverse,(
R6230 T8552 T8551 arg2Of −5/+19,(
R6231 T8553 T8551 arg3Of ),(
R6232 T8554 T8549 arg2Of 5′TTCTTGGAAAGCTGGCACTGTGTG3’,;
R6233 T8554 T8550 arg1Of 5′TTCTTGGAAAGCTGGCACTGTGTG3’,reverse
R6517 T8906 T8905 arg1Of Analysis,Statistical
R6518 T8907 T8908 arg1Of Data,are
R6519 T8907 T8909 arg2Of Data,presented
R6520 T8909 T8908 arg2Of presented,are
R6521 T8909 T8910 arg1Of presented,as
R6522 T8913 T8910 arg2Of SEM,as
R6523 T8913 T8911 arg1Of SEM,mean
R6524 T8913 T8912 arg1Of SEM,±
R6525 T8913 T8914 arg1Of SEM,per
R6526 T8915 T8914 arg2Of group,per
R6527 T8916 T8917 arg1Of Results,were
R6528 T8916 T8918 arg2Of Results,analyzed
R6529 T8918 T8917 arg2Of analyzed,were
R6530 T8919 T8918 arg3Of using,analyzed
R6531 T8921 T8919 arg2Of analysis,using
R6532 T8921 T8920 arg1Of analysis,the
R6533 T8921 T8922 arg1Of analysis,of
R6534 T8923 T8924 arg1Of variance,(
R6535 T8923 T8927 arg1Of variance,or
R6536 T8925 T8924 arg2Of ANOVA,(
R6537 T8926 T8924 arg3Of ),(
R6538 T8927 T8922 arg2Of or,of
R6539 T8932 T8927 arg2Of relevant,or
R6540 T8932 T8928 arg1Of relevant,Student’s
R6541 T8932 T8929 arg1Of relevant,t
R6542 T8932 T8930 arg1Of relevant,test
R6543 T8932 T8931 arg1Of relevant,where
R6544 T8933 T8936 arg1Of P-values,were
R6545 T8933 T8937 arg2Of P-values,considered
R6546 T8933 T8938 arg1Of P-values,significant
R6547 T8934 T8935 arg1Of <,0.05
R6548 T8937 T8934 arg1Of considered,<
R6549 T8937 T8936 arg2Of considered,were
R6550 T8938 T8937 arg3Of significant,considered
R6609 T9054 T9052 arg1Of Gene,The
R6610 T9054 T9053 arg1Of Gene,SerpinB2
R6611 T9054 T9055 arg1Of Gene,is
R6612 T9054 T9057 arg1Of Gene,Responsive
R6613 T9057 T9055 arg2Of Responsive,is
R6614 T9057 T9056 arg1Of Responsive,Highly
R6615 T9057 T9058 arg1Of Responsive,to
R6616 T9059 T9058 arg2Of LPS,to
R6617 T9062 T9061 arg1Of macrophages,RAW264.7
R6618 T9062 T9063 arg1Of macrophages,were
R6619 T9062 T9064 arg2Of macrophages,exposed
R6620 T9064 T9060 arg2Of exposed,When
R6621 T9064 T9063 arg2Of exposed,were
R6622 T9064 T9065 arg1Of exposed,to
R6623 T9066 T9065 arg2Of LPS,to
R6624 T9069 T9068 arg1Of mRNA,SerpinB2
R6625 T9069 T9070 arg1Of mRNA,was
R6626 T9069 T9071 arg1Of mRNA,detectable
R6627 T9070 T9060 arg1Of was,When
R6628 T9070 T9067 arg1Of was,","
R6629 T9070 T9077 arg1Of was,following
R6630 T9070 T9080 arg1Of was,","
R6631 T9071 T9070 arg2Of detectable,was
R6632 T9071 T9073 arg1Of detectable,early
R6633 T9073 T9072 arg1Of early,as
R6634 T9073 T9074 arg1Of early,as
R6635 T9076 T9074 arg2Of min,as
R6636 T9076 T9075 arg1Of min,30
R6637 T9079 T9077 arg2Of challenge,following
R6638 T9079 T9078 arg1Of challenge,LPS
R6639 T9081 T9070 arg3Of reaching,was
R6640 T9081 T9084 arg1Of reaching,at
R6641 T9083 T9081 arg2Of levels,reaching
R6642 T9083 T9082 arg1Of levels,maximal
R6643 T9086 T9084 arg2Of hrs,at
R6644 T9086 T9085 arg1Of hrs,24
R6645 T9086 T9087 arg1Of hrs,(
R6646 T9089 T9087 arg2Of 1A,(
R6647 T9089 T9088 arg1Of 1A,Fig.
R6648 T9090 T9087 arg3Of ),(
R6649 T9094 T9091 arg1Of induction,A
R6650 T9094 T9092 arg1Of induction,similar
R6651 T9094 T9093 arg1Of induction,strong
R6652 T9094 T9095 arg1Of induction,of
R6653 T9094 T9100 arg1Of induction,has
R6654 T9094 T9101 arg1Of induction,been
R6655 T9094 T9102 arg2Of induction,reported
R6656 T9099 T9095 arg2Of expression,of
R6657 T9099 T9096 arg1Of expression,LPS-inducible
R6658 T9099 T9097 arg1Of expression,SerpinB2
R6659 T9099 T9098 arg1Of expression,mRNA
R6660 T9102 T9100 arg2Of reported,has
R6661 T9102 T9101 arg2Of reported,been
R6662 T9102 T9103 arg1Of reported,previously
R6663 T9102 T9104 arg1Of reported,in
R6664 T9102 T9114 arg1Of reported,[
R6665 T9102 T9117 arg1Of reported,;
R6666 T9102 T9118 arg1Of reported,[
R6667 T9107 T9105 arg1Of macrophages,murine
R6668 T9107 T9106 arg1Of macrophages,peritoneal
R6669 T9107 T9108 arg1Of macrophages,and
R6670 T9108 T9104 arg2Of and,in
R6671 T9113 T9108 arg2Of cells,and
R6672 T9113 T9109 arg1Of cells,human
R6673 T9113 T9110 arg1Of cells,peripheral
R6674 T9113 T9111 arg1Of cells,blood
R6675 T9113 T9112 arg1Of cells,mononuclear
R6676 T9115 T9114 arg2Of 4,[
R6677 T9116 T9114 arg3Of ],[
R6678 T9119 T9118 arg2Of 32,[
R6679 T9120 T9118 arg3Of ],[
R6680 T9123 T9121 arg1Of expression,LPS-induced
R6681 T9123 T9122 arg1Of expression,SerpinB2
R6682 T9123 T9124 arg1Of expression,involves
R6683 T9124 T9148 arg1Of involves,[
R6684 T9127 T9124 arg2Of increase,involves
R6685 T9127 T9125 arg1Of increase,both
R6686 T9127 T9126 arg1Of increase,an
R6687 T9127 T9128 arg1Of increase,in
R6688 T9127 T9139 arg1Of increase,;
R6689 T9127 T9140 arg1Of increase,[
R6690 T9127 T9143 arg1Of increase,;
R6691 T9130 T9131 arg1Of transcription,and
R6692 T9131 T9128 arg2Of and,in
R6693 T9131 T9129 arg1Of and,gene
R6694 T9131 T9133 arg1Of and,of
R6695 T9131 T9136 arg1Of and,[
R6696 T9132 T9131 arg2Of stabilization,and
R6697 T9135 T9133 arg2Of mRNA,of
R6698 T9135 T9134 arg1Of mRNA,the
R6699 T9137 T9136 arg2Of 5,[
R6700 T9138 T9136 arg3Of ],[
R6701 T9141 T9140 arg2Of 29,[
R6702 T9142 T9140 arg3Of ],[
R6703 T9145 T9144 arg2Of 42,[
R6704 T9146 T9144 arg3Of ],[
R6705 T9147 T9143 arg2Of –,;
R6706 T9147 T9144 arg1Of –,[
R6707 T9149 T9148 arg2Of 44,[
R6708 T9150 T9148 arg3Of ],[
R6709 T9153 T9151 arg1Of expression,SerpinB2
R6710 T9153 T9152 arg1Of expression,protein
R6711 T9153 T9154 arg1Of expression,was
R6712 T9153 T9156 arg2Of expression,induced
R6713 T9153 T9170 arg1Of expression,detectable
R6714 T9156 T9157 arg1Of induced,as
R6715 T9156 T9169 arg1Of induced,and
R6716 T9160 T9157 arg2Of reported,as
R6717 T9160 T9158 arg2Of reported,has
R6718 T9160 T9159 arg2Of reported,been
R6719 T9160 T9161 arg1Of reported,in
R6720 T9164 T9161 arg2Of types,in
R6721 T9164 T9162 arg1Of types,other
R6722 T9164 T9163 arg1Of types,cell
R6723 T9164 T9165 arg1Of types,[
R6724 T9166 T9165 arg2Of 31,[
R6725 T9167 T9165 arg3Of ],[
R6726 T9169 T9154 arg2Of and,was
R6727 T9169 T9155 arg1Of and,also
R6728 T9169 T9168 arg1Of and,","
R6729 T9169 T9171 arg1Of and,after
R6730 T9170 T9169 arg2Of detectable,and
R6731 T9173 T9171 arg2Of hrs,after
R6732 T9173 T9172 arg1Of hrs,8
R6733 T9173 T9174 arg1Of hrs,of
R6734 T9176 T9174 arg2Of treatment,of
R6735 T9176 T9175 arg1Of treatment,LPS
R6736 T9176 T9177 arg1Of treatment,(
R6737 T9178 T9177 arg2Of Fig.,(
R6738 T9178 T9179 arg1Of Fig.,1
R6739 T9180 T9177 arg3Of ),(
R6962 T9569 T9566 arg1Of Confers,SerpinB2
R6963 T9569 T9567 arg1Of Confers,Proximal
R6964 T9569 T9568 arg1Of Confers,Promoter
R6965 T9571 T9565 arg1Of Responsiveness,The
R6966 T9571 T9569 arg1Of Responsiveness,Confers
R6967 T9571 T9570 arg1Of Responsiveness,LPS
R6968 T9573 T9572 arg1Of investigate,To
R6969 T9576 T9573 arg2Of elements,investigate
R6970 T9576 T9574 arg1Of elements,cis-acting
R6971 T9576 T9575 arg1Of elements,regulatory
R6972 T9576 T9577 arg1Of elements,responsive
R6973 T9577 T9578 arg1Of responsive,to
R6974 T9579 T9578 arg2Of LPS,to
R6975 T9579 T9580 arg1Of LPS,in
R6976 T9584 T9580 arg2Of region,in
R6977 T9584 T9581 arg1Of region,the
R6978 T9584 T9582 arg1Of region,5′
R6979 T9584 T9583 arg1Of region,flanking
R6980 T9584 T9585 arg1Of region,of
R6981 T9584 T9590 arg1Of region,","
R6982 T9589 T9585 arg2Of gene,of
R6983 T9589 T9586 arg1Of gene,the
R6984 T9589 T9587 arg1Of gene,murine
R6985 T9589 T9588 arg1Of gene,SerpinB2
R6986 T9591 T9590 arg2Of nucleotides,","
R6987 T9591 T9592 arg1Of nucleotides,−4480
R6988 T9591 T9593 arg1Of nucleotides,to
R6989 T9594 T9595 arg1Of +92,and
R6990 T9595 T9573 arg1Of and,investigate
R6991 T9595 T9607 arg1Of and,were
R6992 T9595 T9608 arg2Of and,cloned
R6993 T9597 T9595 arg2Of series,and
R6994 T9597 T9596 arg1Of series,a
R6995 T9597 T9598 arg1Of series,of
R6996 T9601 T9598 arg2Of mutants,of
R6997 T9601 T9599 arg2Of mutants,generated
R6998 T9601 T9600 arg1Of mutants,deletion
R6999 T9601 T9602 arg1Of mutants,of
R7000 T9606 T9602 arg2Of region,of
R7001 T9606 T9603 arg1Of region,the
R7002 T9606 T9604 arg1Of region,5′
R7003 T9606 T9605 arg1Of region,flanking
R7004 T9608 T9572 modOf cloned,To
R7005 T9608 T9607 arg2Of cloned,were
R7006 T9608 T9609 arg1Of cloned,upstream
R7007 T9609 T9610 arg1Of upstream,of
R7008 T9616 T9610 arg2Of gene,of
R7009 T9616 T9611 arg1Of gene,a
R7010 T9616 T9612 arg1Of gene,promoter-less
R7011 T9616 T9613 arg1Of gene,firefly
R7012 T9616 T9614 arg1Of gene,luciferase
R7013 T9616 T9615 arg1Of gene,reporter
R7014 T9616 T9617 arg1Of gene,(
R7015 T9619 T9618 arg1Of Basic,pGL3
R7016 T9623 T9617 arg2Of 2A,(
R7017 T9623 T9619 arg1Of 2A,Basic
R7018 T9623 T9620 arg1Of 2A,)
R7019 T9623 T9621 arg1Of 2A,(
R7020 T9623 T9622 arg1Of 2A,Fig.
R7021 T9624 T9617 arg3Of ),(
R7022 T9627 T9625 arg1Of constructs,The
R7023 T9627 T9626 arg1Of constructs,reporter
R7024 T9627 T9628 arg1Of constructs,were
R7025 T9627 T9631 arg2Of constructs,transfected
R7026 T9627 T9637 arg2Of constructs,assayed
R7027 T9631 T9632 arg1Of transfected,into
R7028 T9631 T9636 arg1Of transfected,and
R7029 T9635 T9632 arg2Of macrophages,into
R7030 T9635 T9633 arg1Of macrophages,sub-confluent
R7031 T9635 T9634 arg1Of macrophages,RAW264.7
R7032 T9636 T9628 arg2Of and,were
R7033 T9636 T9629 arg1Of and,then
R7034 T9636 T9630 arg1Of and,transiently
R7035 T9636 T9650 arg1Of and,","
R7036 T9636 T9651 arg1Of and,for
R7037 T9637 T9636 arg2Of assayed,and
R7038 T9637 T9638 arg1Of assayed,for
R7039 T9637 T9641 arg1Of assayed,in
R7040 T9640 T9638 arg2Of activity,for
R7041 T9640 T9639 arg1Of activity,luciferase
R7042 T9643 T9644 arg1Of presence,and
R7043 T9644 T9641 arg2Of and,in
R7044 T9644 T9642 arg1Of and,the
R7045 T9644 T9646 arg1Of and,of
R7046 T9645 T9644 arg2Of absence,and
R7047 T9647 T9648 arg1Of LPS,or
R7048 T9648 T9646 arg2Of or,of
R7049 T9649 T9648 arg2Of PMA,or
R7050 T9652 T9651 arg2Of comparison,for
R7051 T9656 T9653 arg1Of regulation,PMA-induced
R7052 T9656 T9654 arg1Of regulation,SerpinB2
R7053 T9656 T9655 arg1Of regulation,gene
R7054 T9656 T9657 arg1Of regulation,has
R7055 T9656 T9658 arg1Of regulation,been
R7056 T9656 T9660 arg2Of regulation,studied
R7057 T9656 T9675 arg1Of regulation,has
R7058 T9656 T9676 arg1Of regulation,been
R7059 T9656 T9677 arg2Of regulation,shown
R7060 T9656 T9679 arg1Of regulation,occur
R7061 T9660 T9657 arg2Of studied,has
R7062 T9660 T9658 arg2Of studied,been
R7063 T9660 T9659 arg1Of studied,extensively
R7064 T9660 T9661 arg1Of studied,in
R7065 T9660 T9674 arg1Of studied,and
R7066 T9665 T9661 arg2Of lines,in
R7067 T9665 T9662 arg1Of lines,human
R7068 T9665 T9663 arg1Of lines,macrophage
R7069 T9665 T9664 arg1Of lines,cell
R7070 T9665 T9666 arg1Of lines,[
R7071 T9665 T9669 arg1Of lines,–
R7072 T9665 T9670 arg1Of lines,[
R7073 T9667 T9666 arg2Of 45,[
R7074 T9668 T9666 arg3Of ],[
R7075 T9671 T9670 arg2Of 47,[
R7076 T9672 T9670 arg3Of ],[
R7077 T9674 T9673 arg1Of and,","
R7078 T9674 T9688 arg1Of and,[
R7079 T9674 T9691 arg1Of and,;
R7080 T9674 T9692 arg1Of and,[
R7081 T9674 T9695 arg1Of and,;
R7082 T9674 T9696 arg1Of and,[
R7083 T9674 T9699 arg1Of and,–
R7084 T9674 T9700 arg1Of and,[
R7085 T9677 T9674 arg2Of shown,and
R7086 T9677 T9675 arg2Of shown,has
R7087 T9677 T9676 arg2Of shown,been
R7088 T9679 T9677 arg3Of occur,shown
R7089 T9679 T9678 arg1Of occur,to
R7090 T9679 T9680 arg1Of occur,through
R7091 T9682 T9683 arg1Of proximal,and
R7092 T9684 T9683 arg2Of distal,and
R7093 T9687 T9680 arg2Of elements,through
R7094 T9687 T9681 arg1Of elements,several
R7095 T9687 T9682 arg1Of elements,proximal
R7096 T9687 T9684 arg1Of elements,distal
R7097 T9687 T9685 arg1Of elements,AP-1
R7098 T9687 T9686 arg1Of elements,responsive
R7099 T9689 T9688 arg2Of 30,[
R7100 T9690 T9688 arg3Of ],[
R7101 T9693 T9692 arg2Of 37,[
R7102 T9694 T9692 arg3Of ],[
R7103 T9697 T9696 arg2Of 47,[
R7104 T9698 T9696 arg3Of ],[
R7105 T9701 T9700 arg2Of 51,[
R7106 T9702 T9700 arg3Of ],[
R7107 T9704 T9703 arg2Of shown,As
R7108 T9704 T9705 arg1Of shown,in
R7109 T9707 T9705 arg2Of 2B,in
R7110 T9707 T9706 arg1Of 2B,Fig.
R7111 T9713 T9709 arg1Of region,the
R7112 T9713 T9710 arg1Of region,SerpinB2
R7113 T9713 T9711 arg1Of region,5′
R7114 T9713 T9712 arg1Of region,flanking
R7115 T9713 T9714 arg1Of region,from
R7116 T9713 T9718 arg1Of region,directs
R7117 T9717 T9714 arg2Of +92,from
R7118 T9717 T9715 arg1Of +92,−4480
R7119 T9717 T9716 arg1Of +92,to
R7120 T9718 T9703 arg1Of directs,As
R7121 T9718 T9708 arg1Of directs,","
R7122 T9718 T9724 arg1Of directs,","
R7123 T9718 T9726 arg1Of directs,2-fold
R7124 T9718 T9728 arg1Of directs,7-fold
R7125 T9718 T9729 arg1Of directs,","
R7126 T9718 T9730 arg1Of directs,respectively
R7127 T9720 T9721 arg1Of PMA-,and
R7128 T9721 T9719 arg1Of and,both
R7129 T9722 T9721 arg2Of LPS-inducible,and
R7130 T9723 T9718 arg2Of transcription,directs
R7131 T9723 T9720 arg1Of transcription,PMA-
R7132 T9723 T9722 arg1Of transcription,LPS-inducible
R7133 T9726 T9727 arg1Of 2-fold,and
R7134 T9727 T9725 arg1Of and,approximately
R7135 T9728 T9727 arg2Of 7-fold,and
R7136 T9731 T9732 arg1Of Deletion,of
R7137 T9731 T9737 arg1Of Deletion,from
R7138 T9731 T9741 arg1Of Deletion,increased
R7139 T9736 T9732 arg2Of promoter,of
R7140 T9736 T9733 arg1Of promoter,the
R7141 T9736 T9734 arg1Of promoter,murine
R7142 T9736 T9735 arg1Of promoter,SerpinB2
R7143 T9740 T9737 arg2Of −1341,from
R7144 T9740 T9738 arg1Of −1341,−1686
R7145 T9740 T9739 arg1Of −1341,to
R7146 T9741 T9746 arg1Of increased,","
R7147 T9741 T9747 modOf increased,indicating
R7148 T9742 T9741 arg3Of LPS-inducibility,increased
R7149 T9745 T9741 arg2Of 16-fold,increased
R7150 T9745 T9743 arg2Of 16-fold,to
R7151 T9745 T9744 arg1Of 16-fold,approximately
R7152 T9749 T9747 arg2Of presence,indicating
R7153 T9749 T9748 arg1Of presence,the
R7154 T9749 T9750 arg1Of presence,of
R7155 T9753 T9750 arg2Of element,of
R7156 T9753 T9751 arg1Of element,a
R7157 T9753 T9752 arg1Of element,silencer
R7158 T9753 T9754 arg1Of element,in
R7159 T9756 T9754 arg2Of region,in
R7160 T9756 T9755 arg1Of region,this
R7161 T9758 T9757 arg1Of deletion,Further
R7162 T9758 T9759 arg1Of deletion,beyond
R7163 T9758 T9761 arg1Of deletion,abolished
R7164 T9760 T9759 arg2Of −539,beyond
R7165 T9761 T9767 arg1Of abolished,","
R7166 T9761 T9768 modOf abolished,indicating
R7167 T9761 T9784 arg1Of abolished,;
R7168 T9763 T9761 arg2Of LPS-response,abolished
R7169 T9763 T9762 arg1Of LPS-response,the
R7170 T9763 T9764 arg1Of LPS-response,of
R7171 T9766 T9764 arg2Of promoter,of
R7172 T9766 T9765 arg1Of promoter,the
R7173 T9770 T9768 arg2Of presence,indicating
R7174 T9770 T9769 arg1Of presence,the
R7175 T9770 T9771 arg1Of presence,of
R7176 T9776 T9771 arg2Of element,of
R7177 T9776 T9772 arg1Of element,an
R7178 T9776 T9773 arg1Of element,essential
R7179 T9776 T9774 arg1Of element,LPS
R7180 T9776 T9775 arg1Of element,response
R7181 T9776 T9777 arg1Of element,in
R7182 T9779 T9777 arg2Of region,in
R7183 T9779 T9778 arg1Of region,the
R7184 T9779 T9780 arg1Of region,between
R7185 T9781 T9782 arg1Of −539,and
R7186 T9782 T9780 arg2Of and,between
R7187 T9783 T9782 arg2Of −189,and
R7188 T9788 T9787 arg1Of response,the
R7189 T9788 T9789 arg1Of response,of
R7190 T9788 T9794 arg1Of response,to
R7191 T9788 T9796 arg1Of response,is
R7192 T9788 T9798 arg1Of response,affected
R7193 T9793 T9789 arg2Of promoter,of
R7194 T9793 T9790 arg1Of promoter,the
R7195 T9793 T9791 arg1Of promoter,murine
R7196 T9793 T9792 arg1Of promoter,SerpinB2
R7197 T9795 T9794 arg2Of PMA,to
R7198 T9796 T9784 arg2Of is,;
R7199 T9796 T9785 arg1Of is,however
R7200 T9796 T9786 arg1Of is,","
R7201 T9798 T9796 arg2Of affected,is
R7202 T9798 T9797 arg1Of affected,less
R7203 T9798 T9799 arg1Of affected,by
R7204 T9801 T9799 arg2Of deletion,by
R7205 T9801 T9800 arg1Of deletion,this
R7206 T9803 T9804 arg1Of deletion,of
R7207 T9803 T9810 arg1Of deletion,to
R7208 T9803 T9812 arg1Of deletion,eliminated
R7209 T9803 T9818 arg1Of deletion,reduced
R7210 T9807 T9804 arg2Of promoter,of
R7211 T9807 T9805 arg1Of promoter,the
R7212 T9807 T9806 arg1Of promoter,SerpinB2
R7213 T9807 T9808 arg1Of promoter,from
R7214 T9809 T9808 arg2Of −189,from
R7215 T9811 T9810 arg2Of −87,to
R7216 T9812 T9816 arg1Of eliminated,and
R7217 T9815 T9812 arg2Of response,eliminated
R7218 T9815 T9813 arg1Of response,the
R7219 T9815 T9814 arg1Of response,LPS
R7220 T9816 T9802 arg2Of and,While
R7221 T9818 T9816 arg2Of reduced,and
R7222 T9818 T9817 arg1Of reduced,marginally
R7223 T9821 T9818 arg2Of response,reduced
R7224 T9821 T9819 arg1Of response,the
R7225 T9821 T9820 arg1Of response,PMA
R7226 T9828 T9823 arg1Of construct,the
R7227 T9828 T9824 arg1Of construct,−87
R7228 T9828 T9825 arg1Of construct,murine
R7229 T9828 T9826 arg1Of construct,SerpinB2
R7230 T9828 T9827 arg1Of construct,promoter
R7231 T9828 T9829 arg1Of construct,was
R7232 T9828 T9832 arg1Of construct,responsive
R7233 T9829 T9802 arg1Of was,While
R7234 T9829 T9822 arg1Of was,","
R7235 T9829 T9830 arg1Of was,still
R7236 T9829 T9835 arg1Of was,","
R7237 T9829 T9836 modOf was,indicating
R7238 T9832 T9829 arg2Of responsive,was
R7239 T9832 T9831 arg1Of responsive,partially
R7240 T9832 T9833 arg1Of responsive,to
R7241 T9834 T9833 arg2Of PMA,to
R7242 T9839 T9838 arg1Of elements,cis-acting
R7243 T9839 T9840 arg1Of elements,mediating
R7244 T9839 T9851 arg1Of elements,lie
R7245 T9842 T9840 arg2Of response,mediating
R7246 T9842 T9841 arg1Of response,the
R7247 T9842 T9843 arg1Of response,of
R7248 T9842 T9848 arg1Of response,to
R7249 T9847 T9843 arg2Of promoter,of
R7250 T9847 T9844 arg1Of promoter,the
R7251 T9847 T9845 arg1Of promoter,murine
R7252 T9847 T9846 arg1Of promoter,SerpinB2
R7253 T9849 T9848 arg2Of PMA,to
R7254 T9851 T9836 arg2Of lie,indicating
R7255 T9851 T9837 arg1Of lie,that
R7256 T9851 T9850 arg1Of lie,also
R7257 T9851 T9852 arg1Of lie,downstream
R7258 T9852 T9853 arg1Of downstream,of
R7259 T9854 T9853 arg2Of nucleotide,of
R7260 T9854 T9855 arg1Of nucleotide,−87
R7630 T10464 T10463 arg1Of Conservation,Sequence
R7631 T10464 T10465 arg1Of Conservation,within
R7632 T10467 T10468 arg1Of Human,and
R7633 T10469 T10468 arg2Of Murine,and
R7634 T10472 T10465 arg2Of Promoters,within
R7635 T10472 T10466 arg1Of Promoters,the
R7636 T10472 T10467 arg1Of Promoters,Human
R7637 T10472 T10469 arg1Of Promoters,Murine
R7638 T10472 T10470 arg1Of Promoters,SerpinB2
R7639 T10472 T10471 arg1Of Promoters,Proximal
R7640 T10474 T10473 arg1Of look,To
R7641 T10474 T10475 arg1Of look,for
R7642 T10478 T10475 arg2Of elements,for
R7643 T10478 T10476 arg1Of elements,potential
R7644 T10478 T10477 arg1Of elements,cis-acting
R7645 T10478 T10479 arg1Of elements,that
R7646 T10478 T10480 arg1Of elements,might
R7647 T10478 T10481 arg1Of elements,mediate
R7648 T10481 T10480 arg2Of mediate,might
R7649 T10482 T10483 arg1Of transcription,of
R7650 T10482 T10488 arg1Of transcription,and
R7651 T10487 T10483 arg2Of gene,of
R7652 T10487 T10484 arg1Of gene,the
R7653 T10487 T10485 arg1Of gene,murine
R7654 T10487 T10486 arg1Of gene,SerpinB2
R7655 T10488 T10481 arg2Of and,mediate
R7656 T10490 T10488 arg2Of response,and
R7657 T10490 T10489 arg1Of response,the
R7658 T10490 T10491 arg1Of response,to
R7659 T10492 T10491 arg2Of LPS,to
R7660 T10494 T10474 arg1Of we,look
R7661 T10494 T10495 arg1Of we,aligned
R7662 T10495 T10473 modOf aligned,To
R7663 T10495 T10493 arg1Of aligned,","
R7664 T10497 T10498 arg1Of murine,and
R7665 T10499 T10498 arg2Of human,and
R7666 T10503 T10495 arg2Of regions,aligned
R7667 T10503 T10496 arg1Of regions,the
R7668 T10503 T10497 arg1Of regions,murine
R7669 T10503 T10499 arg1Of regions,human
R7670 T10503 T10500 arg1Of regions,SerpinB2
R7671 T10503 T10501 arg1Of regions,5′
R7672 T10503 T10502 arg1Of regions,flanking
R7673 T10504 T10505 arg1Of We,reasoned
R7674 T10508 T10507 arg1Of presence,the
R7675 T10508 T10509 arg1Of presence,of
R7676 T10508 T10518 arg1Of presence,in
R7677 T10508 T10521 arg1Of presence,might
R7678 T10508 T10522 arg1Of presence,play
R7679 T10511 T10510 arg1Of conserved,evolutionarily
R7680 T10517 T10509 arg2Of sites,of
R7681 T10517 T10511 arg1Of sites,conserved
R7682 T10517 T10512 arg1Of sites,","
R7683 T10517 T10513 arg1Of sites,potential
R7684 T10517 T10514 arg1Of sites,transcription
R7685 T10517 T10515 arg1Of sites,factor
R7686 T10517 T10516 arg1Of sites,binding
R7687 T10520 T10518 arg2Of region,in
R7688 T10520 T10519 arg1Of region,this
R7689 T10522 T10505 arg2Of play,reasoned
R7690 T10522 T10506 arg1Of play,that
R7691 T10522 T10521 arg2Of play,might
R7692 T10522 T10525 arg1Of play,in
R7693 T10524 T10522 arg2Of role,play
R7694 T10524 T10523 arg1Of role,a
R7695 T10527 T10525 arg2Of regulation,in
R7696 T10527 T10526 arg1Of regulation,the
R7697 T10527 T10528 arg1Of regulation,of
R7698 T10531 T10528 arg2Of expression,of
R7699 T10531 T10529 arg1Of expression,SerpinB2
R7700 T10531 T10530 arg1Of expression,gene
R7701 T10531 T10532 arg1Of expression,[
R7702 T10533 T10532 arg2Of 52,[
R7703 T10534 T10532 arg3Of ],[
R7704 T10536 T10535 arg1Of presence,The
R7705 T10536 T10537 arg1Of presence,of
R7706 T10536 T10542 arg1Of presence,delineated
R7707 T10541 T10537 arg2Of elements,of
R7708 T10541 T10538 arg1Of elements,several
R7709 T10541 T10539 arg1Of elements,repetitive
R7710 T10541 T10540 arg1Of elements,sequence
R7711 T10542 T10550 arg1Of delineated,between
R7712 T10546 T10542 arg2Of regions,delineated
R7713 T10546 T10543 arg1Of regions,five
R7714 T10546 T10544 arg1Of regions,broadly
R7715 T10546 T10545 arg1Of regions,homologous
R7716 T10546 T10547 arg1Of regions,(
R7717 T10548 T10547 arg2Of A-E,(
R7718 T10549 T10547 arg3Of ),(
R7719 T10552 T10553 arg1Of human,and
R7720 T10554 T10553 arg2Of murine,and
R7721 T10555 T10550 arg2Of promoters,between
R7722 T10555 T10551 arg1Of promoters,the
R7723 T10555 T10552 arg1Of promoters,human
R7724 T10555 T10554 arg1Of promoters,murine
R7725 T10555 T10556 arg1Of promoters,(
R7726 T10558 T10556 arg2Of 2C,(
R7727 T10558 T10557 arg1Of 2C,Fig.
R7728 T10559 T10556 arg3Of ),(
R7729 T10562 T10560 arg1Of promoter,The
R7730 T10562 T10561 arg1Of promoter,proximal
R7731 T10562 T10563 arg1Of promoter,(
R7732 T10562 T10567 arg1Of promoter,","
R7733 T10562 T10568 arg1Of promoter,which
R7734 T10562 T10569 arg1Of promoter,contains
R7735 T10562 T10576 arg1Of promoter,exhibited
R7736 T10565 T10563 arg2Of E,(
R7737 T10565 T10564 arg1Of E,Region
R7738 T10566 T10563 arg3Of ),(
R7739 T10574 T10569 arg2Of element,contains
R7740 T10574 T10570 arg1Of element,the
R7741 T10574 T10571 arg1Of element,essential
R7742 T10574 T10572 arg1Of element,LPS
R7743 T10574 T10573 arg1Of element,response
R7744 T10576 T10575 arg1Of exhibited,","
R7745 T10579 T10576 arg2Of homology,exhibited
R7746 T10579 T10577 arg1Of homology,the
R7747 T10579 T10578 arg1Of homology,greatest
R7748 T10581 T10580 arg1Of analysis,Further
R7749 T10581 T10582 arg1Of analysis,of
R7750 T10581 T10585 arg1Of analysis,revealed
R7751 T10584 T10582 arg2Of E,of
R7752 T10584 T10583 arg1Of E,Region
R7753 T10587 T10588 arg1Of several,of
R7754 T10587 T10600 arg1Of several,are
R7755 T10587 T10601 arg2Of several,conserved
R7756 T10592 T10588 arg2Of elements,of
R7757 T10592 T10589 arg1Of elements,the
R7758 T10592 T10590 arg1Of elements,cis-acting
R7759 T10592 T10591 arg1Of elements,regulatory
R7760 T10592 T10593 arg2Of elements,defined
R7761 T10593 T10594 arg1Of defined,in
R7762 T10599 T10594 arg2Of promoter,in
R7763 T10599 T10595 arg1Of promoter,the
R7764 T10599 T10596 arg1Of promoter,human
R7765 T10599 T10597 arg1Of promoter,SerpinB2
R7766 T10599 T10598 arg1Of promoter,proximal
R7767 T10601 T10585 arg2Of conserved,revealed
R7768 T10601 T10586 arg1Of conserved,that
R7769 T10601 T10600 arg2Of conserved,are
R7770 T10601 T10602 arg1Of conserved,in
R7771 T10606 T10602 arg2Of promoter,in
R7772 T10606 T10603 arg1Of promoter,the
R7773 T10606 T10604 arg1Of promoter,murine
R7774 T10606 T10605 arg1Of promoter,SerpinB2
R7775 T10606 T10607 arg1Of promoter,(
R7776 T10608 T10607 arg2Of Fig.,(
R7777 T10608 T10609 arg1Of Fig.,3
R7778 T10610 T10607 arg3Of ),(
R7779 T10616 T10613 arg1Of sequence,a
R7780 T10616 T10614 arg1Of sequence,TATA
R7781 T10616 T10615 arg1Of sequence,consensus
R7782 T10616 T10617 arg1Of sequence,is
R7783 T10616 T10618 arg1Of sequence,located
R7784 T10617 T10611 arg1Of is,Specifically
R7785 T10617 T10612 arg1Of is,","
R7786 T10617 T10642 arg1Of is,[
R7787 T10617 T10645 arg1Of is,;
R7788 T10617 T10646 arg1Of is,[
R7789 T10618 T10617 arg2Of located,is
R7790 T10618 T10619 arg1Of located,23
R7791 T10619 T10620 modOf 23,to
R7792 T10619 T10621 arg1Of 23,29bp
R7793 T10619 T10637 arg1Of 23,of
R7794 T10621 T10620 arg1Of 29bp,to
R7795 T10621 T10622 arg1Of 29bp,upstream
R7796 T10621 T10623 arg1Of 29bp,from
R7797 T10627 T10623 arg2Of site,from
R7798 T10627 T10624 arg1Of site,the
R7799 T10627 T10625 arg1Of site,transcription
R7800 T10627 T10626 arg1Of site,initiation
R7801 T10627 T10628 arg1Of site,","
R7802 T10627 T10629 arg1Of site,similar
R7803 T10629 T10630 arg1Of similar,to
R7804 T10632 T10630 arg2Of position,to
R7805 T10632 T10631 arg1Of position,the
R7806 T10632 T10633 arg1Of position,of
R7807 T10636 T10633 arg2Of box,of
R7808 T10636 T10634 arg1Of box,the
R7809 T10636 T10635 arg1Of box,TATA
R7810 T10641 T10637 arg2Of gene,of
R7811 T10641 T10638 arg1Of gene,the
R7812 T10641 T10639 arg1Of gene,human
R7813 T10641 T10640 arg1Of gene,SERPINB2
R7814 T10643 T10642 arg2Of 53,[
R7815 T10644 T10642 arg3Of ],[
R7816 T10647 T10646 arg2Of 54,[
R7817 T10648 T10646 arg3Of ],[
R7818 T10656 T10655 arg2Of C/EBP,(
R7819 T10657 T10655 arg3Of ),(
R7820 T10658 T10649 arg1Of site,A
R7821 T10658 T10650 arg1Of site,putative
R7822 T10658 T10651 arg1Of site,CCAAT
R7823 T10658 T10652 arg1Of site,enhancer
R7824 T10658 T10653 arg1Of site,binding
R7825 T10658 T10654 arg1Of site,protein
R7826 T10658 T10655 arg1Of site,(
R7827 T10658 T10659 arg1Of site,is
R7828 T10658 T10660 arg1Of site,present
R7829 T10660 T10659 arg2Of present,is
R7830 T10660 T10661 arg1Of present,at
R7831 T10662 T10661 arg2Of −192/−203,at
R7832 T10670 T10669 arg2Of AP-1,(
R7833 T10671 T10669 arg3Of ),(
R7834 T10673 T10664 arg1Of sites,two
R7835 T10673 T10665 arg1Of sites,potential
R7836 T10673 T10666 arg1Of sites,activator
R7837 T10673 T10667 arg1Of sites,protein
R7838 T10673 T10668 arg1Of sites,1
R7839 T10673 T10669 arg1Of sites,(
R7840 T10673 T10672 arg1Of sites,binding
R7841 T10673 T10674 arg1Of sites,are
R7842 T10673 T10675 arg2Of sites,found
R7843 T10675 T10674 arg2Of found,are
R7844 T10675 T10676 arg1Of found,at
R7845 T10675 T10682 arg1Of found,and
R7846 T10678 T10679 arg1Of −88/−94,and
R7847 T10679 T10676 arg2Of and,at
R7848 T10679 T10677 arg1Of and,nucleotides
R7849 T10680 T10679 arg2Of −100/−106,and
R7850 T10682 T10659 arg3Of and,is
R7851 T10682 T10663 arg1Of and,","
R7852 T10682 T10681 arg1Of and,","
R7853 T10688 T10683 arg1Of element,a
R7854 T10688 T10684 arg1Of element,putative
R7855 T10688 T10685 arg1Of element,cyclic
R7856 T10688 T10686 arg1Of element,AMP
R7857 T10688 T10687 arg1Of element,response
R7858 T10688 T10689 arg1Of element,(
R7859 T10688 T10692 arg1Of element,is
R7860 T10688 T10693 arg1Of element,present
R7861 T10690 T10689 arg2Of CRE,(
R7862 T10691 T10689 arg3Of ),(
R7863 T10692 T10682 arg2Of is,and
R7864 T10693 T10692 arg2Of present,is
R7865 T10693 T10694 arg1Of present,at
R7866 T10695 T10694 arg2Of −172/−177,at
R7867 T10696 T10697 arg1Of Both,of
R7868 T10696 T10701 arg1Of Both,are
R7869 T10696 T10702 arg1Of Both,identical
R7870 T10700 T10697 arg2Of sites,of
R7871 T10700 T10698 arg1Of sites,the
R7872 T10700 T10699 arg1Of sites,AP-1
R7873 T10701 T10714 arg1Of are,and
R7874 T10702 T10701 arg2Of identical,are
R7875 T10702 T10703 arg1Of identical,in
R7876 T10702 T10705 arg1Of identical,to
R7877 T10704 T10703 arg2Of sequence,in
R7878 T10706 T10705 arg2Of those,to
R7879 T10706 T10707 arg2Of those,identified
R7880 T10707 T10708 arg1Of identified,in
R7881 T10712 T10708 arg2Of promoter,in
R7882 T10712 T10709 arg1Of promoter,the
R7883 T10712 T10710 arg1Of promoter,human
R7884 T10712 T10711 arg1Of promoter,SERPINB2
R7885 T10714 T10713 arg1Of and,","
R7886 T10716 T10715 arg1Of CRE,the
R7887 T10716 T10717 arg1Of CRE,differs
R7888 T10717 T10714 arg2Of differs,and
R7889 T10717 T10718 arg1Of differs,in
R7890 T10717 T10729 arg1Of differs,;
R7891 T10717 T10730 arg1Of differs,[
R7892 T10720 T10718 arg2Of identity,in
R7893 T10720 T10719 arg1Of identity,the
R7894 T10720 T10721 arg1Of identity,of
R7895 T10725 T10721 arg2Of nucleotide,of
R7896 T10725 T10722 arg1Of nucleotide,a
R7897 T10725 T10723 arg1Of nucleotide,single
R7898 T10725 T10724 arg1Of nucleotide,central
R7899 T10725 T10726 arg1Of nucleotide,[
R7900 T10727 T10726 arg2Of 37,[
R7901 T10728 T10726 arg3Of ],[
R7902 T10731 T10730 arg2Of 55,[
R7903 T10732 T10730 arg3Of ],[
R7904 T10736 T10734 arg1Of box,consensus
R7905 T10736 T10735 arg1Of box,E
R7906 T10736 T10737 arg1Of box,(
R7907 T10736 T10743 arg1Of box,as
R7908 T10738 T10737 arg2Of −538/−533,(
R7909 T10739 T10737 arg3Of ),(
R7910 T10743 T10733 arg1Of as,A
R7911 T10743 T10740 arg1Of as,","
R7912 T10743 T10741 arg1Of as,as
R7913 T10743 T10742 arg1Of as,well
R7914 T10743 T10757 arg1Of as,were
R7915 T10743 T10759 arg2Of as,identified
R7916 T10746 T10743 arg2Of sites,as
R7917 T10746 T10744 arg1Of sites,potential
R7918 T10746 T10745 arg1Of sites,binding
R7919 T10746 T10747 arg1Of sites,for
R7920 T10748 T10749 arg1Of PU.1,(
R7921 T10748 T10752 arg1Of PU.1,and
R7922 T10750 T10749 arg2Of −412/−407,(
R7923 T10751 T10749 arg3Of ),(
R7924 T10752 T10747 arg2Of and,for
R7925 T10753 T10752 arg2Of Oct-1,and
R7926 T10753 T10754 arg1Of Oct-1,(
R7927 T10755 T10754 arg2Of −296/−288,(
R7928 T10756 T10754 arg3Of ),(
R7929 T10759 T10757 arg2Of identified,were
R7930 T10759 T10758 arg1Of identified,also
R7931 T10759 T10760 arg1Of identified,within
R7932 T10764 T10760 arg2Of region,within
R7933 T10764 T10761 arg1Of region,the
R7934 T10764 T10762 arg1Of region,proximal
R7935 T10764 T10763 arg1Of region,promoter
R7936 T10764 T10765 arg1Of region,(
R7937 T10767 T10765 arg2Of S2,(
R7938 T10767 T10766 arg1Of S2,Fig.
R7939 T10768 T10765 arg3Of ),(
R7940 T10770 T10771 arg1Of upstream,","
R7941 T10776 T10771 arg2Of element,","
R7942 T10776 T10772 arg1Of element,a
R7943 T10776 T10773 arg1Of element,retinoic
R7944 T10776 T10774 arg1Of element,acid
R7945 T10776 T10775 arg1Of element,response
R7946 T10777 T10770 arg1Of at,upstream
R7947 T10778 T10777 arg2Of −1349/−1340,at
R7948 T10783 T10780 arg1Of element,a
R7949 T10783 T10781 arg1Of element,PAUSE-1
R7950 T10783 T10782 arg1Of element,silencer
R7951 T10783 T10784 arg1Of element,at
R7952 T10783 T10786 arg1Of element,and
R7953 T10785 T10784 arg2Of −1540/−1528,at
R7954 T10786 T10798 arg1Of and,are
R7955 T10786 T10801 arg2Of and,conserved
R7956 T10791 T10786 arg2Of site,and
R7957 T10791 T10787 arg1Of site,a
R7958 T10791 T10788 arg1Of site,NF-κB
R7959 T10791 T10789 arg1Of site,p65
R7960 T10791 T10790 arg1Of site,binding
R7961 T10791 T10792 arg1Of site,at
R7962 T10793 T10792 arg2Of −1342/−1351,at
R7963 T10793 T10794 arg1Of −1342/−1351,(
R7964 T10796 T10794 arg2Of S2,(
R7965 T10796 T10795 arg1Of S2,Fig.
R7966 T10797 T10794 arg3Of ),(
R7967 T10801 T10769 arg1Of conserved,Further
R7968 T10801 T10777 arg1Of conserved,at
R7969 T10801 T10779 arg1Of conserved,","
R7970 T10801 T10798 arg2Of conserved,are
R7971 T10801 T10799 arg1Of conserved,also
R7972 T10801 T10800 arg1Of conserved,well
R7973 T10801 T10802 arg1Of conserved,[
R7974 T10801 T10805 arg1Of conserved,;
R7975 T10801 T10806 arg1Of conserved,[
R7976 T10801 T10809 arg1Of conserved,;
R7977 T10801 T10810 arg1Of conserved,[
R7978 T10803 T10802 arg2Of 16,[
R7979 T10804 T10802 arg3Of ],[
R7980 T10807 T10806 arg2Of 30,[
R7981 T10808 T10806 arg3Of ],[
R7982 T10811 T10810 arg2Of 56,[
R7983 T10812 T10810 arg3Of ],[
R8509 T11565 T11566 arg1Of C/EBP,","
R8510 T11566 T11568 arg1Of ",",and
R8511 T11567 T11566 arg2Of CRE,","
R8512 T11569 T11568 arg2Of Two,and
R8513 T11571 T11564 arg1Of Sites,A
R8514 T11571 T11565 arg1Of Sites,C/EBP
R8515 T11571 T11567 arg1Of Sites,CRE
R8516 T11571 T11569 arg1Of Sites,Two
R8517 T11571 T11570 arg1Of Sites,AP-1
R8518 T11571 T11572 arg1Of Sites,in
R8519 T11571 T11579 arg1Of Sites,are
R8520 T11571 T11580 arg1Of Sites,Essential
R8521 T11578 T11572 arg2Of Promoter,in
R8522 T11578 T11573 arg1Of Promoter,the
R8523 T11578 T11574 arg1Of Promoter,Murine
R8524 T11578 T11575 arg1Of Promoter,SerpinB2
R8525 T11578 T11576 arg1Of Promoter,Gene
R8526 T11578 T11577 arg1Of Promoter,Proximal
R8527 T11580 T11579 arg2Of Essential,are
R8528 T11580 T11581 arg1Of Essential,for
R8529 T11584 T11581 arg2Of Transcription,for
R8530 T11584 T11582 arg1Of Transcription,Optimal
R8531 T11584 T11583 arg1Of Transcription,LPS-inducible
R8532 T11586 T11585 arg1Of investigate,To
R8533 T11588 T11586 arg2Of elements,investigate
R8534 T11588 T11587 arg1Of elements,regulatory
R8535 T11588 T11589 arg1Of elements,between
R8536 T11590 T11591 arg1Of −539,and
R8537 T11591 T11589 arg2Of and,between
R8538 T11591 T11593 arg1Of and,essential
R8539 T11592 T11591 arg2Of −189,and
R8540 T11593 T11594 arg1Of essential,for
R8541 T11596 T11594 arg2Of transcription,for
R8542 T11596 T11595 arg1Of transcription,LPS-inducible
R8543 T11601 T11598 arg1Of sites,several
R8544 T11601 T11599 arg1Of sites,candidate
R8545 T11601 T11600 arg1Of sites,binding
R8546 T11601 T11602 arg1Of sites,for
R8547 T11601 T11617 arg1Of sites,were
R8548 T11601 T11618 arg2Of sites,targeted
R8549 T11604 T11602 arg2Of factors,for
R8550 T11604 T11603 arg1Of factors,transcription
R8551 T11604 T11606 arg2Of factors,reported
R8552 T11604 T11608 arg1Of factors,mediate
R8553 T11606 T11605 arg1Of reported,previously
R8554 T11608 T11606 arg3Of mediate,reported
R8555 T11608 T11607 arg1Of mediate,to
R8556 T11608 T11614 arg1Of mediate,[
R8557 T11610 T11608 arg2Of transcription,mediate
R8558 T11610 T11609 arg1Of transcription,LPS-inducible
R8559 T11610 T11611 arg1Of transcription,in
R8560 T11613 T11611 arg2Of genes,in
R8561 T11613 T11612 arg1Of genes,other
R8562 T11615 T11614 arg2Of 57,[
R8563 T11616 T11614 arg3Of ],[
R8564 T11618 T11585 modOf targeted,To
R8565 T11618 T11597 arg1Of targeted,","
R8566 T11618 T11617 arg2Of targeted,were
R8567 T11621 T11618 arg1Of substitution,targeted
R8568 T11621 T11619 arg2Of substitution,by
R8569 T11621 T11620 arg1Of substitution,nucleotide
R8570 T11621 T11622 arg2Of substitution,designed
R8571 T11622 T11623 modOf designed,to
R8572 T11624 T11623 arg1Of disrupt,to
R8573 T11626 T11624 arg2Of factor,disrupt
R8574 T11626 T11625 arg1Of factor,transcription
R8575 T11626 T11627 arg1Of factor,binding
R8576 T11627 T11628 arg1Of binding,to
R8577 T11636 T11628 arg2Of construct,to
R8578 T11636 T11629 arg1Of construct,the
R8579 T11636 T11630 arg1Of construct,pGLmP-539
R8580 T11636 T11631 arg1Of construct,murine
R8581 T11636 T11632 arg1Of construct,SerpinB2
R8582 T11636 T11633 arg1Of construct,promoter-luciferase
R8583 T11636 T11634 arg1Of construct,reporter
R8584 T11636 T11635 arg1Of construct,gene
R8585 T11636 T11637 arg1Of construct,(
R8586 T11639 T11637 arg2Of 4A,(
R8587 T11639 T11638 arg1Of 4A,Fig.
R8588 T11640 T11637 arg3Of ),(
R8589 T11642 T11641 arg2Of shown,As
R8590 T11642 T11643 arg1Of shown,in
R8591 T11645 T11643 arg2Of 4B,in
R8592 T11645 T11644 arg1Of 4B,Fig.
R8593 T11647 T11648 arg1Of mutation,of
R8594 T11647 T11656 arg1Of mutation,","
R8595 T11652 T11648 arg2Of box,of
R8596 T11652 T11649 arg1Of box,the
R8597 T11652 T11650 arg1Of box,consensus
R8598 T11652 T11651 arg1Of box,E
R8599 T11652 T11653 arg1Of box,(
R8600 T11654 T11653 arg2Of −538/−533,(
R8601 T11655 T11653 arg3Of ),(
R8602 T11656 T11662 arg1Of ",",or
R8603 T11657 T11656 arg2Of PU.1,","
R8604 T11657 T11658 arg1Of PU.1,(
R8605 T11659 T11658 arg2Of −412/−407,(
R8606 T11660 T11658 arg3Of ),(
R8607 T11662 T11661 arg1Of or,","
R8608 T11662 T11670 arg1Of or,did
R8609 T11662 T11672 arg1Of or,decrease
R8610 T11665 T11663 arg1Of Oct-1,the
R8611 T11665 T11664 arg1Of Oct-1,variant
R8612 T11665 T11666 arg1Of Oct-1,(
R8613 T11667 T11666 arg2Of −296/−288,(
R8614 T11668 T11666 arg3Of ),(
R8615 T11669 T11662 arg2Of site,or
R8616 T11669 T11665 arg1Of site,Oct-1
R8617 T11672 T11641 arg1Of decrease,As
R8618 T11672 T11646 arg1Of decrease,","
R8619 T11672 T11670 arg2Of decrease,did
R8620 T11672 T11671 arg1Of decrease,not
R8621 T11675 T11672 arg2Of activity,decrease
R8622 T11675 T11673 arg1Of activity,LPS-induced
R8623 T11675 T11674 arg1Of activity,promoter
R8624 T11677 T11676 arg2Of contrast,In
R8625 T11679 T11680 arg1Of mutation,of
R8626 T11679 T11688 arg1Of mutation,eliminated
R8627 T11683 T11680 arg2Of site,of
R8628 T11683 T11681 arg1Of site,the
R8629 T11683 T11682 arg1Of site,C/EBP
R8630 T11683 T11684 arg1Of site,(
R8631 T11685 T11684 arg2Of −203/−192,(
R8632 T11686 T11684 arg3Of ),(
R8633 T11688 T11676 arg1Of eliminated,In
R8634 T11688 T11678 arg1Of eliminated,","
R8635 T11688 T11687 arg1Of eliminated,completely
R8636 T11690 T11688 arg2Of activity,eliminated
R8637 T11690 T11689 arg1Of activity,promoter
R8638 T11690 T11691 arg1Of activity,","
R8639 T11690 T11692 arg1Of activity,similar
R8640 T11692 T11693 arg1Of similar,to
R8641 T11695 T11693 arg2Of levels,to
R8642 T11695 T11694 arg1Of levels,the
R8643 T11695 T11696 arg2Of levels,observed
R8644 T11696 T11697 arg1Of observed,for
R8645 T11703 T11697 arg2Of construct,for
R8646 T11703 T11698 arg1Of construct,the
R8647 T11703 T11699 arg1Of construct,−189
R8648 T11703 T11700 arg1Of construct,SerpinB2
R8649 T11703 T11701 arg1Of construct,promoter
R8650 T11703 T11702 arg1Of construct,deletion
R8651 T11704 T11705 arg1Of Others,have
R8652 T11704 T11708 arg1Of Others,implicated
R8653 T11708 T11705 arg2Of implicated,have
R8654 T11708 T11706 arg1Of implicated,also
R8655 T11708 T11707 arg1Of implicated,recently
R8656 T11708 T11719 arg1Of implicated,[
R8657 T11711 T11708 arg2Of site,implicated
R8658 T11711 T11709 arg1Of site,this
R8659 T11711 T11710 arg1Of site,C/EBP
R8660 T11711 T11712 arg1Of site,in
R8661 T11714 T11712 arg2Of activation,in
R8662 T11714 T11713 arg1Of activation,LPS-induced
R8663 T11714 T11715 arg1Of activation,of
R8664 T11718 T11715 arg2Of gene,of
R8665 T11718 T11716 arg1Of gene,the
R8666 T11718 T11717 arg1Of gene,SerpinB2
R8667 T11720 T11719 arg2Of 58,[
R8668 T11721 T11719 arg3Of ],[
R8669 T11725 T11726 arg1Of sequence,and
R8670 T11726 T11722 arg2Of and,Considering
R8671 T11726 T11723 arg1Of and,the
R8672 T11726 T11724 arg2Of and,conserved
R8673 T11726 T11728 arg1Of and,of
R8674 T11726 T11744 arg1Of and,in
R8675 T11727 T11726 arg2Of position,and
R8676 T11730 T11731 arg1Of CRE,and
R8677 T11732 T11731 arg2Of two,and
R8678 T11734 T11728 arg2Of sites,of
R8679 T11734 T11729 arg1Of sites,the
R8680 T11734 T11730 arg1Of sites,CRE
R8681 T11734 T11732 arg1Of sites,two
R8682 T11734 T11733 arg1Of sites,AP-1
R8683 T11734 T11735 arg1Of sites,in
R8684 T11739 T11736 arg1Of promoter,the
R8685 T11739 T11737 arg1Of promoter,murine
R8686 T11739 T11738 arg1Of promoter,SerpinB2
R8687 T11739 T11740 arg1Of promoter,and
R8688 T11740 T11735 arg2Of and,in
R8689 T11743 T11740 arg2Of involvement,and
R8690 T11743 T11741 arg1Of involvement,their
R8691 T11743 T11742 arg2Of involvement,demonstrated
R8692 T11746 T11744 arg2Of PMA-responsiveness,in
R8693 T11746 T11745 arg1Of PMA-responsiveness,the
R8694 T11746 T11747 arg1Of PMA-responsiveness,of
R8695 T11751 T11747 arg2Of promoter,of
R8696 T11751 T11748 arg1Of promoter,the
R8697 T11751 T11749 arg1Of promoter,human
R8698 T11751 T11750 arg1Of promoter,SERPINB2
R8699 T11751 T11752 arg1Of promoter,[
R8700 T11753 T11752 arg2Of 37,[
R8701 T11754 T11752 arg3Of ],[
R8702 T11757 T11756 arg1Of sites,these
R8703 T11757 T11758 arg1Of sites,were
R8704 T11757 T11760 arg2Of sites,mutated
R8705 T11757 T11765 arg1Of sites,investigate
R8706 T11760 T11722 modOf mutated,Considering
R8707 T11760 T11755 arg1Of mutated,","
R8708 T11760 T11758 arg2Of mutated,were
R8709 T11760 T11759 arg1Of mutated,also
R8710 T11760 T11764 modOf mutated,to
R8711 T11763 T11760 arg1Of substitution,mutated
R8712 T11763 T11761 arg2Of substitution,by
R8713 T11763 T11762 arg1Of substitution,nucleotide
R8714 T11765 T11764 arg1Of investigate,to
R8715 T11767 T11768 arg1Of they,played
R8716 T11768 T11765 arg2Of played,investigate
R8717 T11768 T11766 arg1Of played,whether
R8718 T11768 T11771 arg1Of played,in
R8719 T11770 T11768 arg2Of role,played
R8720 T11770 T11769 arg1Of role,a
R8721 T11774 T11771 arg2Of response,in
R8722 T11774 T11772 arg1Of response,the
R8723 T11774 T11773 arg1Of response,LPS
R8724 T11774 T11775 arg1Of response,of
R8725 T11779 T11775 arg2Of promoter,of
R8726 T11779 T11776 arg1Of promoter,the
R8727 T11779 T11777 arg1Of promoter,murine
R8728 T11779 T11778 arg1Of promoter,SerpinB2
R8729 T11781 T11780 arg2Of shown,As
R8730 T11781 T11782 arg1Of shown,in
R8731 T11784 T11782 arg2Of 4B,in
R8732 T11784 T11783 arg1Of 4B,Fig.
R8733 T11786 T11787 arg1Of mutation,of
R8734 T11786 T11790 arg1Of mutation,at
R8735 T11786 T11803 arg1Of mutation,","
R8736 T11786 T11807 arg1Of mutation,reduced
R8737 T11789 T11787 arg2Of CRE,of
R8738 T11789 T11788 arg1Of CRE,the
R8739 T11793 T11790 arg2Of either,at
R8740 T11793 T11791 arg1Of either,−177/−172
R8741 T11793 T11792 arg1Of either,or
R8742 T11793 T11794 arg1Of either,of
R8743 T11798 T11794 arg2Of sites,of
R8744 T11798 T11795 arg1Of sites,the
R8745 T11798 T11796 arg1Of sites,two
R8746 T11798 T11797 arg1Of sites,AP-1
R8747 T11798 T11799 arg1Of sites,at
R8748 T11800 T11801 arg1Of −106/−100,and
R8749 T11801 T11799 arg2Of and,at
R8750 T11802 T11801 arg2Of −94/−88,and
R8751 T11804 T11805 arg1Of completely,or
R8752 T11806 T11805 arg2Of significantly,or
R8753 T11807 T11780 arg1Of reduced,As
R8754 T11807 T11785 arg1Of reduced,","
R8755 T11807 T11804 arg1Of reduced,completely
R8756 T11807 T11806 arg1Of reduced,significantly
R8757 T11810 T11807 arg2Of activity,reduced
R8758 T11810 T11808 arg1Of activity,LPS-inducible
R8759 T11810 T11809 arg1Of activity,luciferase
R8760 T11810 T11811 arg1Of activity,from
R8761 T11815 T11811 arg2Of promoter,from
R8762 T11815 T11812 arg1Of promoter,the
R8763 T11815 T11813 arg1Of promoter,murine
R8764 T11815 T11814 arg1Of promoter,SerpinB2
R8765 T11817 T11816 arg1Of data,These
R8766 T11817 T11818 arg1Of data,show
R8767 T11822 T11820 arg1Of element,the
R8768 T11822 T11821 arg1Of element,C/EBP
R8769 T11822 T11826 arg1Of element,as
R8770 T11826 T11823 arg1Of as,","
R8771 T11826 T11824 arg1Of as,as
R8772 T11826 T11825 arg1Of as,well
R8773 T11826 T11829 arg1Of as,and
R8774 T11828 T11826 arg2Of CRE,as
R8775 T11828 T11827 arg1Of CRE,the
R8776 T11829 T11834 arg1Of and,are
R8777 T11829 T11835 arg1Of and,critical
R8778 T11833 T11829 arg2Of elements,and
R8779 T11833 T11830 arg1Of elements,both
R8780 T11833 T11831 arg1Of elements,AP-1
R8781 T11833 T11832 arg1Of elements,cis-acting
R8782 T11834 T11818 arg2Of are,show
R8783 T11834 T11819 arg1Of are,that
R8784 T11835 T11834 arg2Of critical,are
R8785 T11835 T11836 arg1Of critical,for
R8786 T11838 T11836 arg2Of transcription,for
R8787 T11838 T11837 arg1Of transcription,LPS-inducible
R8788 T11838 T11839 arg1Of transcription,from
R8789 T11843 T11839 arg2Of promoter,from
R8790 T11843 T11840 arg1Of promoter,the
R8791 T11843 T11841 arg1Of promoter,SerpinB2
R8792 T11843 T11842 arg1Of promoter,proximal
R9166 T12435 T12433 arg1Of Element,The
R9167 T12435 T12434 arg1Of Element,C/EBP
R9168 T12435 T12436 arg1Of Element,is
R9169 T12435 T12437 arg2Of Element,Bound
R9170 T12437 T12436 arg2Of Bound,is
R9171 T12442 T12437 arg1Of Factor,Bound
R9172 T12442 T12438 arg2Of Factor,by
R9173 T12442 T12439 arg1Of Factor,an
R9174 T12442 T12440 arg1Of Factor,LPS-induced
R9175 T12442 T12441 arg1Of Factor,Nuclear
R9176 T12442 T12443 arg1Of Factor,from
R9177 T12446 T12443 arg2Of Macrophages,from
R9178 T12446 T12444 arg1Of Macrophages,RAW
R9179 T12446 T12445 arg1Of Macrophages,264.7
R9180 T12448 T12447 arg1Of factor,Nuclear
R9181 T12448 T12449 arg1Of factor,binding
R9182 T12448 T12458 arg1Of factor,was
R9183 T12448 T12459 arg2Of factor,investigated
R9184 T12448 T12468 arg1Of factor,using
R9185 T12449 T12450 arg1Of binding,to
R9186 T12454 T12450 arg2Of element,to
R9187 T12454 T12451 arg1Of element,the
R9188 T12454 T12452 arg1Of element,putative
R9189 T12454 T12453 arg1Of element,C/EBP
R9190 T12454 T12455 arg1Of element,(
R9191 T12456 T12455 arg2Of −203/−192,(
R9192 T12457 T12455 arg3Of ),(
R9193 T12459 T12458 arg2Of investigated,was
R9194 T12459 T12468 modOf investigated,using
R9195 T12464 T12459 arg1Of assay,investigated
R9196 T12464 T12460 arg2Of assay,by
R9197 T12464 T12461 arg1Of assay,electrophoretic
R9198 T12464 T12462 arg1Of assay,mobility
R9199 T12464 T12463 arg1Of assay,shift
R9200 T12464 T12465 arg1Of assay,(
R9201 T12466 T12465 arg2Of EMSA,(
R9202 T12467 T12465 arg3Of ),(
R9203 T12470 T12468 arg2Of extracts,using
R9204 T12470 T12469 arg1Of extracts,nuclear
R9205 T12470 T12471 arg1Of extracts,from
R9206 T12472 T12473 arg1Of untreated,and
R9207 T12474 T12473 arg2Of LPS-treated,and
R9208 T12477 T12471 arg2Of macrophages,from
R9209 T12477 T12472 arg1Of macrophages,untreated
R9210 T12477 T12474 arg1Of macrophages,LPS-treated
R9211 T12477 T12475 arg1Of macrophages,RAW
R9212 T12477 T12476 arg1Of macrophages,264.7
R9213 T12481 T12479 arg1Of stranded,different
R9214 T12481 T12480 arg1Of stranded,double
R9215 T12483 T12478 arg1Of probes,Three
R9216 T12483 T12481 arg1Of probes,stranded
R9217 T12483 T12482 arg1Of probes,oligonucleotide
R9218 T12483 T12484 arg1Of probes,were
R9219 T12483 T12485 arg2Of probes,used
R9220 T12483 T12489 arg1Of probes,representing
R9221 T12485 T12484 arg2Of used,were
R9222 T12485 T12486 arg1Of used,for
R9223 T12485 T12488 arg1Of used,","
R9224 T12485 T12489 modOf used,representing
R9225 T12487 T12486 arg2Of EMSA,for
R9226 T12491 T12492 arg1Of 1,)
R9227 T12497 T12490 arg1Of element,(
R9228 T12497 T12491 arg1Of element,1
R9229 T12497 T12493 arg1Of element,the
R9230 T12497 T12494 arg1Of element,putative
R9231 T12497 T12495 arg1Of element,SerpinB2
R9232 T12497 T12496 arg1Of element,C/EBP
R9233 T12497 T12498 arg1Of element,(
R9234 T12497 T12501 arg1Of element,","
R9235 T12499 T12498 arg2Of −203/−192,(
R9236 T12500 T12498 arg3Of ),(
R9237 T12503 T12504 arg1Of 2,)
R9238 T12508 T12501 arg2Of element,","
R9239 T12508 T12502 arg1Of element,(
R9240 T12508 T12503 arg1Of element,2
R9241 T12508 T12505 arg1Of element,a
R9242 T12508 T12506 arg1Of element,mutant
R9243 T12508 T12507 arg1Of element,SerpinB2
R9244 T12508 T12509 arg1Of element,containing
R9245 T12508 T12516 arg1Of element,and
R9246 T12512 T12509 arg2Of mutation,containing
R9247 T12512 T12510 arg1Of mutation,the
R9248 T12512 T12511 arg1Of mutation,same
R9249 T12512 T12514 arg1Of mutation,in
R9250 T12514 T12513 arg1Of in,as
R9251 T12515 T12514 arg2Of pGLmP-539mC/EBP,in
R9252 T12518 T12497 arg1Of 3,element
R9253 T12518 T12517 arg1Of 3,(
R9254 T12518 T12519 arg1Of 3,)
R9255 T12525 T12489 arg2Of element,representing
R9256 T12525 T12518 arg1Of element,3
R9257 T12525 T12520 arg1Of element,the
R9258 T12525 T12521 arg1Of element,rat
R9259 T12525 T12522 arg1Of element,albumin
R9260 T12525 T12523 arg1Of element,promoter
R9261 T12525 T12524 arg1Of element,distal
R9262 T12525 T12526 arg1Of element,1
R9263 T12528 T12527 arg2Of DEI,(
R9264 T12529 T12527 arg3Of ),(
R9265 T12530 T12485 arg3Of region,used
R9266 T12530 T12527 arg1Of region,(
R9267 T12530 T12531 arg1Of region,containing
R9268 T12537 T12531 arg2Of site,containing
R9269 T12537 T12532 arg1Of site,a
R9270 T12537 T12533 arg1Of site,high
R9271 T12537 T12534 arg1Of site,affinity
R9272 T12537 T12535 arg1Of site,C/EBP
R9273 T12537 T12536 arg1Of site,binding
R9274 T12539 T12538 arg1Of bands,Four
R9275 T12539 T12540 arg1Of bands,of
R9276 T12539 T12548 arg1Of bands,were
R9277 T12539 T12549 arg2Of bands,detected
R9278 T12542 T12540 arg2Of mobilities,of
R9279 T12542 T12541 arg1Of mobilities,different
R9280 T12542 T12543 arg1Of mobilities,","
R9281 T12542 T12544 arg1Of mobilities,representing
R9282 T12547 T12544 arg2Of complexes,representing
R9283 T12547 T12545 arg1Of complexes,DNA-nuclear
R9284 T12547 T12546 arg1Of complexes,protein
R9285 T12549 T12548 arg2Of detected,were
R9286 T12549 T12550 arg1Of detected,(
R9287 T12552 T12550 arg2Of 5A,(
R9288 T12552 T12551 arg1Of 5A,Fig.
R9289 T12553 T12550 arg3Of ),(
R9290 T12554 T12555 arg1Of Three,of
R9291 T12554 T12558 arg1Of Three,(
R9292 T12554 T12565 arg1Of Three,represent
R9293 T12557 T12555 arg2Of bands,of
R9294 T12557 T12556 arg1Of bands,these
R9295 T12559 T12560 arg1Of I,","
R9296 T12560 T12558 arg2Of ",",(
R9297 T12560 T12562 arg1Of ",",","
R9298 T12561 T12560 arg2Of II,","
R9299 T12563 T12562 arg2Of III,","
R9300 T12564 T12558 arg3Of ),(
R9301 T12565 T12567 arg1Of represent,with
R9302 T12565 T12575 arg1Of represent,while
R9303 T12566 T12565 arg2Of complexes,represent
R9304 T12570 T12567 arg2Of DNA,with
R9305 T12570 T12568 arg1Of DNA,single
R9306 T12570 T12569 arg1Of DNA,stranded
R9307 T12570 T12571 arg1Of DNA,(
R9308 T12573 T12571 arg2Of 5A,(
R9309 T12573 T12572 arg1Of 5A,Fig.
R9310 T12574 T12571 arg3Of ),(
R9311 T12577 T12578 arg1Of uppermost,(
R9312 T12580 T12578 arg2Of migrating,(
R9313 T12580 T12579 arg1Of migrating,slowest
R9314 T12581 T12578 arg3Of ),(
R9315 T12582 T12576 arg1Of complex,the
R9316 T12582 T12577 arg1Of complex,uppermost
R9317 T12582 T12583 arg1Of complex,was
R9318 T12582 T12584 arg2Of complex,induced
R9319 T12584 T12575 arg2Of induced,while
R9320 T12584 T12583 arg2Of induced,was
R9321 T12586 T12584 arg1Of LPS,induced
R9322 T12586 T12585 arg2Of LPS,by
R9323 T12589 T12587 arg1Of complex,The
R9324 T12589 T12588 arg1Of complex,LPS-inducible
R9325 T12589 T12590 arg1Of complex,was
R9326 T12589 T12592 arg2Of complex,detected
R9327 T12589 T12600 arg1Of complex,could
R9328 T12589 T12601 arg1Of complex,be
R9329 T12589 T12602 arg2Of complex,abolished
R9330 T12589 T12611 arg1Of complex,carrying
R9331 T12592 T12590 arg2Of detected,was
R9332 T12592 T12591 arg1Of detected,not
R9333 T12592 T12593 modOf detected,using
R9334 T12592 T12599 arg1Of detected,and
R9335 T12598 T12593 arg2Of probe,using
R9336 T12598 T12594 arg1Of probe,the
R9337 T12598 T12595 arg1Of probe,mutant
R9338 T12598 T12596 arg1Of probe,C/EBP
R9339 T12598 T12597 arg1Of probe,oligonucleotide
R9340 T12599 T12610 arg1Of and,","
R9341 T12599 T12611 modOf and,carrying
R9342 T12602 T12599 arg2Of abolished,and
R9343 T12602 T12600 arg2Of abolished,could
R9344 T12602 T12601 arg2Of abolished,be
R9345 T12602 T12603 arg1Of abolished,by
R9346 T12605 T12603 arg2Of excess,by
R9347 T12605 T12604 arg1Of excess,an
R9348 T12605 T12606 arg1Of excess,of
R9349 T12609 T12606 arg2Of oligonucleotide,of
R9350 T12609 T12607 arg1Of oligonucleotide,unlabeled
R9351 T12609 T12608 arg1Of oligonucleotide,double-stranded
R9352 T12615 T12612 arg1Of sequence,either
R9353 T12615 T12613 arg1Of sequence,the
R9354 T12615 T12614 arg1Of sequence,same
R9355 T12615 T12616 arg1Of sequence,(
R9356 T12615 T12625 arg1Of sequence,or
R9357 T12618 T12617 arg1Of 5B,Fig.
R9358 T12618 T12619 arg1Of 5B,","
R9359 T12619 T12616 arg2Of ",",(
R9360 T12621 T12622 arg1Of 4,and
R9361 T12622 T12619 arg2Of and,","
R9362 T12622 T12620 arg1Of and,lanes
R9363 T12623 T12622 arg2Of 5,and
R9364 T12624 T12616 arg3Of ),(
R9365 T12625 T12611 arg2Of or,carrying
R9366 T12627 T12625 arg2Of sequence,or
R9367 T12627 T12626 arg1Of sequence,the
R9368 T12627 T12628 arg1Of sequence,of
R9369 T12627 T12651 arg1Of sequence,by
R9370 T12628 T12649 arg1Of of,but
R9371 T12633 T12628 arg2Of site,of
R9372 T12633 T12629 arg1Of site,a
R9373 T12633 T12630 arg2Of site,known
R9374 T12633 T12631 arg1Of site,C/EBP
R9375 T12633 T12632 arg1Of site,binding
R9376 T12633 T12634 arg1Of site,from
R9377 T12633 T12639 arg1Of site,(
R9378 T12638 T12634 arg2Of promoter,from
R9379 T12638 T12635 arg1Of promoter,the
R9380 T12638 T12636 arg1Of promoter,rat
R9381 T12638 T12637 arg1Of promoter,albumin
R9382 T12641 T12640 arg1Of 5B,Fig.
R9383 T12641 T12642 arg1Of 5B,","
R9384 T12642 T12639 arg2Of ",",(
R9385 T12644 T12645 arg1Of 8,and
R9386 T12645 T12642 arg2Of and,","
R9387 T12645 T12643 arg1Of and,lanes
R9388 T12646 T12645 arg2Of 9,and
R9389 T12647 T12639 arg3Of ),(
R9390 T12649 T12648 arg1Of but,","
R9391 T12651 T12649 arg2Of by,but
R9392 T12651 T12650 arg1Of by,not
R9393 T12654 T12651 arg2Of oligonucleotide,by
R9394 T12654 T12652 arg1Of oligonucleotide,the
R9395 T12654 T12653 arg2Of oligonucleotide,mutated
R9396 T12654 T12655 arg1Of oligonucleotide,(
R9397 T12657 T12656 arg1Of 5B,Fig.
R9398 T12657 T12658 arg1Of 5B,","
R9399 T12658 T12655 arg2Of ",",(
R9400 T12660 T12661 arg1Of 6,and
R9401 T12661 T12658 arg2Of and,","
R9402 T12661 T12659 arg1Of and,lanes
R9403 T12662 T12661 arg2Of 7,and
R9404 T12663 T12655 arg3Of ),(
R9405 T12666 T12665 arg1Of data,these
R9406 T12666 T12667 arg1Of data,indicate
R9407 T12667 T12664 arg1Of indicate,Together
R9408 T12673 T12669 arg1Of site,the
R9409 T12673 T12670 arg1Of site,putative
R9410 T12673 T12671 arg1Of site,SerpinB2
R9411 T12673 T12672 arg1Of site,C/EBP
R9412 T12673 T12674 arg1Of site,at
R9413 T12673 T12676 arg1Of site,binds
R9414 T12675 T12674 arg2Of −203/−192,at
R9415 T12676 T12667 arg2Of binds,indicate
R9416 T12676 T12668 arg1Of binds,that
R9417 T12679 T12676 arg2Of complex,binds
R9418 T12679 T12677 arg1Of complex,a
R9419 T12679 T12678 arg1Of complex,LPS-inducible
R9420 T12679 T12680 arg1Of complex,that
R9421 T12679 T12681 arg1Of complex,is
R9422 T12679 T12682 arg1Of complex,likely
R9423 T12679 T12684 arg1Of complex,contain
R9424 T12682 T12681 arg2Of likely,is
R9425 T12684 T12682 arg2Of contain,likely
R9426 T12684 T12683 arg1Of contain,to
R9427 T12686 T12684 arg2Of member,contain
R9428 T12686 T12685 arg1Of member,a
R9429 T12686 T12687 arg1Of member,of
R9430 T12690 T12687 arg2Of family,of
R9431 T12690 T12688 arg1Of family,the
R9432 T12690 T12689 arg1Of family,C/EBP
R9433 T12690 T12691 arg1Of family,of
R9434 T12693 T12691 arg2Of factors,of
R9435 T12693 T12692 arg1Of factors,transcription
R9773 T13254 T13255 arg1Of C/EBP-β,is
R9774 T13259 T13255 arg2Of Factor,is
R9775 T13259 T13256 arg1Of Factor,a
R9776 T13259 T13257 arg1Of Factor,LPS-induced
R9777 T13259 T13258 arg1Of Factor,Nuclear
R9778 T13259 T13260 arg1Of Factor,that
R9779 T13259 T13261 arg1Of Factor,Binds
R9780 T13261 T13262 arg1Of Binds,to
R9781 T13265 T13262 arg2Of Element,to
R9782 T13265 T13263 arg1Of Element,the
R9783 T13265 T13264 arg1Of Element,C/EBP
R9784 T13265 T13266 arg1Of Element,of
R9785 T13270 T13266 arg2Of Promoter,of
R9786 T13270 T13267 arg1Of Promoter,the
R9787 T13270 T13268 arg1Of Promoter,SerpinB2
R9788 T13270 T13269 arg1Of Promoter,Proximal
R9789 T13273 T13271 arg1Of family,The
R9790 T13273 T13272 arg1Of family,C/EBP
R9791 T13273 T13274 arg1Of family,of
R9792 T13273 T13280 arg1Of family,are
R9793 T13273 T13281 arg2Of family,known
R9794 T13279 T13274 arg2Of factors,of
R9795 T13279 T13275 arg1Of factors,basic
R9796 T13279 T13276 arg1Of factors,leucine
R9797 T13279 T13277 arg1Of factors,zipper
R9798 T13279 T13278 arg1Of factors,transcription
R9799 T13281 T13280 arg2Of known,are
R9800 T13281 T13282 arg1Of known,for
R9801 T13284 T13282 arg2Of roles,for
R9802 T13284 T13283 arg1Of roles,their
R9803 T13284 T13285 arg1Of roles,in
R9804 T13287 T13286 arg1Of differentiation,cellular
R9805 T13287 T13288 arg1Of differentiation,and
R9806 T13288 T13285 arg2Of and,in
R9807 T13289 T13288 arg2Of inflammation,and
R9808 T13289 T13290 arg1Of inflammation,[
R9809 T13291 T13290 arg2Of 59,[
R9810 T13292 T13290 arg3Of ],[
R9811 T13293 T13294 arg1Of Consisting,of
R9812 T13296 T13294 arg2Of members,of
R9813 T13296 T13295 arg1Of members,six
R9814 T13301 T13293 arg1Of factors,Consisting
R9815 T13301 T13298 arg1Of factors,the
R9816 T13301 T13299 arg1Of factors,C/EBP
R9817 T13301 T13300 arg1Of factors,transcription
R9818 T13301 T13302 arg1Of factors,can
R9819 T13301 T13303 arg1Of factors,homo−/heterodimerize
R9820 T13301 T13305 arg1Of factors,display
R9821 T13303 T13304 arg1Of homo−/heterodimerize,and
R9822 T13304 T13293 modOf and,Consisting
R9823 T13304 T13297 arg1Of and,","
R9824 T13304 T13302 arg2Of and,can
R9825 T13304 T13310 arg1Of and,[
R9826 T13305 T13304 arg2Of display,and
R9827 T13309 T13303 arg2Of specificities,homo−/heterodimerize
R9828 T13309 T13305 arg2Of specificities,display
R9829 T13309 T13306 arg1Of specificities,similar
R9830 T13309 T13307 arg1Of specificities,DNA
R9831 T13309 T13308 arg1Of specificities,binding
R9832 T13311 T13310 arg2Of 60,[
R9833 T13312 T13310 arg3Of ],[
R9834 T13315 T13313 arg1Of members,Four
R9835 T13315 T13314 arg1Of members,family
R9836 T13315 T13316 arg1Of members,","
R9837 T13315 T13325 arg1Of members,are
R9838 T13315 T13326 arg1Of members,present
R9839 T13315 T13331 arg1Of members,play
R9840 T13315 T13335 arg1Of members,differentiating
R9841 T13317 T13318 arg1Of C/EBP-α,","
R9842 T13318 T13320 arg1Of ",",","
R9843 T13319 T13318 arg2Of C/EBP-β,","
R9844 T13320 T13322 arg1Of ",",and
R9845 T13321 T13320 arg2Of C/EBP-δ,","
R9846 T13322 T13316 arg2Of and,","
R9847 T13323 T13322 arg2Of C/EBP-ε,and
R9848 T13325 T13330 arg1Of are,and
R9849 T13326 T13325 arg2Of present,are
R9850 T13326 T13327 arg1Of present,in
R9851 T13329 T13327 arg2Of cells,in
R9852 T13329 T13328 arg1Of cells,myeloid
R9853 T13330 T13324 arg1Of and,","
R9854 T13330 T13343 arg1Of and,[
R9855 T13331 T13330 arg2Of play,and
R9856 T13331 T13334 arg1Of play,in
R9857 T13333 T13331 arg2Of roles,play
R9858 T13333 T13332 arg1Of roles,different
R9859 T13335 T13334 arg2Of differentiating,in
R9860 T13335 T13338 arg1Of differentiating,depending
R9861 T13337 T13335 arg2Of cells,differentiating
R9862 T13337 T13336 arg1Of cells,myeloid
R9863 T13339 T13338 arg2Of on,depending
R9864 T13342 T13339 arg2Of environment,on
R9865 T13342 T13340 arg1Of environment,the
R9866 T13342 T13341 arg1Of environment,extracellular
R9867 T13344 T13343 arg2Of 61,[
R9868 T13345 T13343 arg3Of ],[
R9869 T13347 T13346 arg1Of determine,To
R9870 T13348 T13347 arg2Of which,determine
R9871 T13350 T13348 arg1Of proteins,which
R9872 T13350 T13349 arg1Of proteins,C/EBP
R9873 T13350 T13351 arg1Of proteins,were
R9874 T13350 T13352 arg2Of proteins,involved
R9875 T13352 T13351 arg2Of involved,were
R9876 T13352 T13353 arg1Of involved,in
R9877 T13352 T13364 arg1Of involved,of
R9878 T13353 T13362 arg1Of in,and
R9879 T13355 T13353 arg2Of formation,in
R9880 T13355 T13354 arg1Of formation,the
R9881 T13355 T13356 arg1Of formation,of
R9882 T13359 T13358 arg1Of nucleo-protein,different
R9883 T13360 T13356 arg2Of complexes,of
R9884 T13360 T13357 arg1Of complexes,the
R9885 T13360 T13359 arg1Of complexes,nucleo-protein
R9886 T13362 T13361 arg1Of and,","
R9887 T13364 T13362 arg2Of of,and
R9888 T13364 T13363 arg1Of of,particularly
R9889 T13367 T13364 arg2Of complex,of
R9890 T13367 T13365 arg1Of complex,the
R9891 T13367 T13366 arg1Of complex,LPS-inducible
R9892 T13369 T13370 arg1Of EMSA,was
R9893 T13369 T13371 arg2Of EMSA,performed
R9894 T13369 T13373 arg1Of EMSA,incubating
R9895 T13371 T13346 modOf performed,To
R9896 T13371 T13368 arg1Of performed,","
R9897 T13371 T13370 arg2Of performed,was
R9898 T13371 T13372 arg1Of performed,after
R9899 T13373 T13372 arg2Of incubating,after
R9900 T13373 T13377 arg1Of incubating,with
R9901 T13376 T13373 arg2Of complexes,incubating
R9902 T13376 T13374 arg1Of complexes,the
R9903 T13376 T13375 arg1Of complexes,nucleo-protein
R9904 T13378 T13377 arg2Of antibodies,with
R9905 T13378 T13379 arg1Of antibodies,specific
R9906 T13379 T13380 arg1Of specific,for
R9907 T13381 T13382 arg1Of C/EBP-α,","
R9908 T13382 T13384 arg1Of ",",","
R9909 T13383 T13382 arg2Of C/EBP-β,","
R9910 T13384 T13386 arg1Of ",",and
R9911 T13385 T13384 arg2Of C/EBP-δ,","
R9912 T13386 T13380 arg2Of and,for
R9913 T13387 T13386 arg2Of C/EBP-ε,and
R9914 T13389 T13388 arg1Of antibody,Each
R9915 T13389 T13390 arg1Of antibody,detects
R9916 T13390 T13399 arg1Of detects,","
R9917 T13390 T13400 arg1Of detects,so
R9918 T13394 T13390 arg2Of region,detects
R9919 T13394 T13391 arg1Of region,the
R9920 T13394 T13392 arg1Of region,carboxy-terminal
R9921 T13394 T13393 arg1Of region,DNA-binding
R9922 T13394 T13395 arg1Of region,of
R9923 T13398 T13395 arg2Of protein,of
R9924 T13398 T13396 arg1Of protein,the
R9925 T13398 T13397 arg1Of protein,respective
R9926 T13400 T13401 arg1Of so,that
R9927 T13402 T13403 arg1Of pre-incubation,of
R9928 T13402 T13408 arg1Of pre-incubation,is
R9929 T13402 T13409 arg2Of pre-incubation,expected
R9930 T13402 T13411 arg1Of pre-incubation,abolish
R9931 T13404 T13403 arg2Of antibody,of
R9932 T13404 T13405 arg1Of antibody,with
R9933 T13407 T13405 arg2Of extract,with
R9934 T13407 T13406 arg1Of extract,nuclear
R9935 T13409 T13400 arg2Of expected,so
R9936 T13409 T13408 arg2Of expected,is
R9937 T13411 T13409 arg3Of abolish,expected
R9938 T13411 T13410 arg1Of abolish,to
R9939 T13411 T13414 arg1Of abolish,by
R9940 T13411 T13416 arg1Of abolish,[
R9941 T13413 T13411 arg2Of binding,abolish
R9942 T13413 T13412 arg1Of binding,DNA
R9943 T13415 T13414 arg2Of EMSA,by
R9944 T13417 T13416 arg2Of 62,[
R9945 T13418 T13416 arg3Of ],[
R9946 T13420 T13419 arg1Of antibodies,Only
R9947 T13420 T13421 arg1Of antibodies,against
R9948 T13420 T13423 arg1Of antibodies,abolished
R9949 T13422 T13421 arg2Of C/EBP-β,against
R9950 T13425 T13423 arg2Of formation,abolished
R9951 T13425 T13424 arg1Of formation,the
R9952 T13425 T13426 arg1Of formation,of
R9953 T13429 T13426 arg2Of complex,of
R9954 T13429 T13427 arg1Of complex,the
R9955 T13429 T13428 arg1Of complex,LPS-inducible
R9956 T13429 T13430 arg1Of complex,(
R9957 T13432 T13430 arg2Of 5C,(
R9958 T13432 T13431 arg1Of 5C,Fig.
R9959 T13433 T13430 arg3Of ),(
R9960 T13434 T13435 arg1Of Taken,together
R9961 T13437 T13436 arg1Of data,these
R9962 T13437 T13438 arg1Of data,show
R9963 T13438 T13434 modOf show,Taken
R9964 T13442 T13440 arg1Of complex,the
R9965 T13442 T13441 arg1Of complex,LPS-induced
R9966 T13442 T13443 arg1Of complex,with
R9967 T13442 T13450 arg1Of complex,contains
R9968 T13446 T13443 arg2Of element,with
R9969 T13446 T13444 arg1Of element,the
R9970 T13446 T13445 arg1Of element,C/EBP
R9971 T13446 T13447 arg1Of element,(
R9972 T13448 T13447 arg2Of −203/−192,(
R9973 T13449 T13447 arg3Of ),(
R9974 T13450 T13438 arg2Of contains,show
R9975 T13450 T13439 arg1Of contains,that
R9976 T13451 T13450 arg2Of C/EBP-β,contains
R10339 T14060 T14059 arg1Of Mediates,C/EBP-β
R10340 T14062 T14063 arg1Of Constitutive,and
R10341 T14064 T14063 arg2Of LPS-induced,and
R10342 T14067 T14060 arg1Of Expression,Mediates
R10343 T14067 T14061 arg1Of Expression,both
R10344 T14067 T14062 arg1Of Expression,Constitutive
R10345 T14067 T14064 arg1Of Expression,LPS-induced
R10346 T14067 T14065 arg1Of Expression,SerpinB2
R10347 T14067 T14066 arg1Of Expression,mRNA
R10348 T14067 T14068 arg1Of Expression,in
R10349 T14069 T14070 arg1Of MEFs,and
R10350 T14070 T14068 arg2Of and,in
R10351 T14073 T14070 arg2Of Macrophages,and
R10352 T14073 T14071 arg1Of Macrophages,Inflammatory
R10353 T14073 T14072 arg1Of Macrophages,Primary
R10354 T14075 T14074 arg1Of investigate,To
R10355 T14077 T14075 arg2Of importance,investigate
R10356 T14077 T14076 arg1Of importance,the
R10357 T14077 T14078 arg1Of importance,of
R10358 T14077 T14080 arg1Of importance,to
R10359 T14079 T14078 arg2Of C/EBP-β,of
R10360 T14084 T14080 arg2Of expression,to
R10361 T14084 T14081 arg1Of expression,endogenous
R10362 T14084 T14082 arg1Of expression,SerpinB2
R10363 T14084 T14083 arg1Of expression,mRNA
R10364 T14084 T14085 arg1Of expression,in
R10365 T14085 T14087 arg1Of in,to
R10366 T14086 T14085 arg2Of response,in
R10367 T14088 T14085 arg3Of LPS,in
R10368 T14090 T14075 arg1Of we,investigate
R10369 T14090 T14091 arg1Of we,utilized
R10370 T14091 T14074 modOf utilized,To
R10371 T14091 T14089 arg1Of utilized,","
R10372 T14091 T14102 arg1Of utilized,","
R10373 T14091 T14103 arg1Of utilized,since
R10374 T14092 T14093 arg1Of C/EBP-β-null,(
R10375 T14092 T14096 arg1Of C/EBP-β-null,and
R10376 T14094 T14093 arg2Of Cebpb −/−,(
R10377 T14095 T14093 arg3Of ),(
R10378 T14096 T14091 arg2Of and,utilized
R10379 T14098 T14096 arg2Of MEFs,and
R10380 T14098 T14097 arg1Of MEFs,wild-type
R10381 T14098 T14099 arg1Of MEFs,(
R10382 T14100 T14099 arg2Of Cebpb+/+,(
R10383 T14101 T14099 arg3Of ),(
R10384 T14105 T14104 arg1Of cells,RAW264.7
R10385 T14105 T14107 arg1Of cells,express
R10386 T14107 T14103 arg2Of express,since
R10387 T14107 T14106 arg1Of express,constitutively
R10388 T14109 T14107 arg2Of C/EBP-β,express
R10389 T14109 T14108 arg1Of C/EBP-β,endogenous
R10390 T14111 T14110 arg1Of MEFs,Wild-type
R10391 T14111 T14112 arg1Of MEFs,express
R10392 T14112 T14118 arg1Of express,and
R10393 T14114 T14112 arg2Of levels,express
R10394 T14114 T14113 arg1Of levels,low
R10395 T14114 T14115 arg1Of levels,of
R10396 T14117 T14115 arg2Of SerpinB2,of
R10397 T14117 T14116 arg1Of SerpinB2,endogenous
R10398 T14120 T14119 arg1Of absence,the
R10399 T14120 T14121 arg1Of absence,of
R10400 T14120 T14123 arg1Of absence,attenuated
R10401 T14122 T14121 arg2Of C/EBP-β,of
R10402 T14123 T14118 arg2Of attenuated,and
R10403 T14127 T14123 arg2Of expression,attenuated
R10404 T14127 T14124 arg1Of expression,endogenous
R10405 T14127 T14125 arg1Of expression,SerpinB2
R10406 T14127 T14126 arg1Of expression,mRNA
R10407 T14128 T14129 arg1Of LPS,stimulated
R10408 T14129 T14139 arg1Of stimulated,(
R10409 T14129 T14143 arg1Of stimulated,","
R10410 T14129 T14144 arg1Of stimulated,whereas
R10411 T14131 T14129 arg2Of increase,stimulated
R10412 T14131 T14130 arg1Of increase,an
R10413 T14131 T14132 arg1Of increase,in
R10414 T14131 T14136 arg1Of increase,in
R10415 T14135 T14132 arg2Of expression,in
R10416 T14135 T14133 arg1Of expression,SerpinB2
R10417 T14135 T14134 arg1Of expression,mRNA
R10418 T14138 T14136 arg2Of MEFs,in
R10419 T14138 T14137 arg1Of MEFs,wild-type
R10420 T14141 T14139 arg2Of 6A,(
R10421 T14141 T14140 arg1Of 6A,Fig.
R10422 T14142 T14139 arg3Of ),(
R10423 T14148 T14145 arg1Of expression,LPS-stimulated
R10424 T14148 T14146 arg1Of expression,SerpinB2
R10425 T14148 T14147 arg1Of expression,mRNA
R10426 T14148 T14149 arg1Of expression,was
R10427 T14148 T14151 arg2Of expression,dampened
R10428 T14151 T14144 arg2Of dampened,whereas
R10429 T14151 T14149 arg2Of dampened,was
R10430 T14151 T14150 arg1Of dampened,significantly
R10431 T14151 T14152 arg1Of dampened,in
R10432 T14154 T14152 arg2Of MEFs,in
R10433 T14154 T14153 arg1Of MEFs,Cebpb−/−
R10434 T14155 T14151 arg3Of as,dampened
R10435 T14156 T14155 arg2Of compared,as
R10436 T14156 T14157 arg1Of compared,to
R10437 T14158 T14157 arg2Of wild-type,to
R10438 T14159 T14161 arg1Of We,tested
R10439 T14161 T14160 arg1Of tested,next
R10440 T14164 T14163 arg1Of effects,similar
R10441 T14164 T14165 arg1Of effects,could
R10442 T14164 T14166 arg1Of effects,be
R10443 T14164 T14167 arg2Of effects,seen
R10444 T14167 T14161 arg2Of seen,tested
R10445 T14167 T14162 arg1Of seen,if
R10446 T14167 T14165 arg2Of seen,could
R10447 T14167 T14166 arg2Of seen,be
R10448 T14167 T14168 arg1Of seen,in
R10449 T14167 T14183 arg1Of seen,(
R10450 T14171 T14168 arg2Of macrophages,in
R10451 T14171 T14169 arg1Of macrophages,thioglycollate-elicited
R10452 T14171 T14170 arg1Of macrophages,inflammatory
R10453 T14171 T14172 arg2Of macrophages,in
R10454 T14171 T14173 arg1Of macrophages,which
R10455 T14175 T14174 arg1Of expression,C/EBP-β
R10456 T14175 T14176 arg1Of expression,was
R10457 T14175 T14177 arg2Of expression,knocked
R10458 T14177 T14172 arg1Of knocked,in
R10459 T14177 T14176 arg2Of knocked,was
R10460 T14177 T14178 arg1Of knocked,down
R10461 T14177 T14179 modOf knocked,using
R10462 T14182 T14179 arg2Of shRNAs,using
R10463 T14182 T14180 arg1Of shRNAs,species-specific
R10464 T14182 T14181 arg1Of shRNAs,lentiviral
R10465 T14185 T14183 arg2Of 6B,(
R10466 T14185 T14184 arg1Of 6B,Fig.
R10467 T14185 T14186 arg1Of 6B,","
R10468 T14187 T14186 arg2Of left,","
R10469 T14188 T14183 arg3Of ),(
R10470 T14191 T14189 arg2Of observed,As
R10471 T14191 T14190 arg2Of observed,was
R10472 T14191 T14192 arg1Of observed,in
R10473 T14193 T14192 arg2Of MEFs,in
R10474 T14196 T14197 arg1Of constitutive,and
R10475 T14198 T14197 arg2Of LPS-induced,and
R10476 T14201 T14195 arg1Of expression,both
R10477 T14201 T14196 arg1Of expression,constitutive
R10478 T14201 T14198 arg1Of expression,LPS-induced
R10479 T14201 T14199 arg1Of expression,SerpinB2
R10480 T14201 T14200 arg1Of expression,mRNA
R10481 T14201 T14202 arg1Of expression,was
R10482 T14201 T14204 arg2Of expression,decreased
R10483 T14204 T14189 arg1Of decreased,As
R10484 T14204 T14194 arg1Of decreased,","
R10485 T14204 T14202 arg2Of decreased,was
R10486 T14204 T14203 arg1Of decreased,significantly
R10487 T14204 T14205 arg1Of decreased,in
R10488 T14204 T14209 arg1Of decreased,(
R10489 T14208 T14205 arg2Of macrophages,in
R10490 T14208 T14206 arg1Of macrophages,C/EBP-β-deficient
R10491 T14208 T14207 arg1Of macrophages,inflammatory
R10492 T14211 T14209 arg2Of 6B,(
R10493 T14211 T14210 arg1Of 6B,Fig.
R10494 T14211 T14212 arg1Of 6B,","
R10495 T14213 T14212 arg2Of right,","
R10496 T14214 T14209 arg3Of ),(
R10497 T14216 T14215 arg1Of data,These
R10498 T14216 T14217 arg1Of data,show
R10499 T14219 T14220 arg1Of C/EBP-β,is
R10500 T14219 T14221 arg1Of C/EBP-β,critical
R10501 T14220 T14217 arg2Of is,show
R10502 T14220 T14218 arg1Of is,that
R10503 T14221 T14220 arg2Of critical,is
R10504 T14221 T14222 arg1Of critical,for
R10505 T14223 T14222 arg2Of mediating,for
R10506 T14224 T14225 arg1Of constitutive,and
R10507 T14226 T14225 arg2Of LPS-inducible,and
R10508 T14227 T14223 arg2Of transcription,mediating
R10509 T14227 T14224 arg1Of transcription,constitutive
R10510 T14227 T14226 arg1Of transcription,LPS-inducible
R10511 T14227 T14228 arg1Of transcription,of
R10512 T14231 T14228 arg2Of mRNA,of
R10513 T14231 T14229 arg1Of mRNA,endogenous
R10514 T14231 T14230 arg1Of mRNA,SerpinB2
R10903 T14868 T14869 arg1Of C/EBP-β,Binds
R10904 T14869 T14877 arg1Of Binds,in
R10905 T14874 T14869 arg2Of Promoter,Binds
R10906 T14874 T14870 arg1Of Promoter,the
R10907 T14874 T14871 arg1Of Promoter,Murine
R10908 T14874 T14872 arg1Of Promoter,SerpinB2
R10909 T14874 T14873 arg1Of Promoter,Proximal
R10910 T14874 T14876 arg1Of Promoter,vivo
R10911 T14876 T14875 arg1Of vivo,in
R10912 T14880 T14877 arg2Of Manner,in
R10913 T14880 T14878 arg1Of Manner,an
R10914 T14880 T14879 arg1Of Manner,LPS-inducible
R10915 T14881 T14882 arg1Of We,investigated
R10916 T14882 T14889 arg1Of investigated,to
R10917 T14882 T14894 arg1Of investigated,in
R10918 T14885 T14882 arg2Of dynamics,investigated
R10919 T14885 T14883 arg1Of dynamics,the
R10920 T14885 T14884 arg1Of dynamics,temporal
R10921 T14885 T14886 arg1Of dynamics,of
R10922 T14888 T14886 arg2Of recruitment,of
R10923 T14888 T14887 arg1Of recruitment,C/EBP-β
R10924 T14893 T14889 arg2Of promoter,to
R10925 T14893 T14890 arg1Of promoter,the
R10926 T14893 T14891 arg1Of promoter,murine
R10927 T14893 T14892 arg1Of promoter,SerpinB2
R10928 T14895 T14894 arg2Of response,in
R10929 T14895 T14896 arg1Of response,to
R10930 T14897 T14896 arg2Of LPS,to
R10931 T14897 T14899 arg1Of LPS,vivo
R10932 T14897 T14900 arg1Of LPS,by
R10933 T14899 T14898 arg1Of vivo,in
R10934 T14902 T14900 arg2Of immunoprecipitation,by
R10935 T14902 T14901 arg1Of immunoprecipitation,chromatin
R10936 T14902 T14903 arg1Of immunoprecipitation,(
R10937 T14904 T14903 arg2Of ChIP,(
R10938 T14905 T14903 arg3Of ),(
R10939 T14908 T14906 arg1Of cells,RAW
R10940 T14908 T14907 arg1Of cells,264.7
R10941 T14908 T14909 arg1Of cells,were
R10942 T14908 T14910 arg2Of cells,stimulated
R10943 T14910 T14909 arg2Of stimulated,were
R10944 T14910 T14911 arg1Of stimulated,with
R10945 T14910 T14913 arg1Of stimulated,for
R10946 T14910 T14918 arg1Of stimulated,","
R10947 T14912 T14911 arg2Of LPS,with
R10948 T14916 T14914 arg1Of 8,up
R10949 T14916 T14915 arg1Of 8,to
R10950 T14917 T14913 arg2Of hrs,for
R10951 T14917 T14916 arg1Of hrs,8
R10952 T14918 T14930 arg1Of ",",and
R10953 T14920 T14919 arg1Of chromatin,soluble
R10954 T14920 T14921 arg1Of chromatin,was
R10955 T14920 T14922 arg2Of chromatin,immunoprecipitated
R10956 T14922 T14918 arg2Of immunoprecipitated,","
R10957 T14922 T14921 arg2Of immunoprecipitated,was
R10958 T14922 T14923 arg1Of immunoprecipitated,with
R10959 T14922 T14925 arg1Of immunoprecipitated,against
R10960 T14924 T14923 arg2Of antibodies,with
R10961 T14928 T14925 arg2Of proteins,against
R10962 T14928 T14926 arg1Of proteins,DNA
R10963 T14928 T14927 arg1Of proteins,binding
R10964 T14930 T14929 arg1Of and,","
R10965 T14933 T14931 arg1Of DNA,the
R10966 T14933 T14932 arg2Of DNA,enriched
R10967 T14933 T14934 arg2Of DNA,amplified
R10968 T14933 T14946 arg1Of DNA,(
R10969 T14933 T14947 arg2Of DNA,illustrated
R10970 T14939 T14934 arg1Of qPCR,amplified
R10971 T14939 T14935 arg2Of qPCR,by
R10972 T14939 T14936 arg1Of qPCR,both
R10973 T14939 T14937 arg1Of qPCR,semi-quantitative
R10974 T14939 T14938 arg1Of qPCR,and
R10975 T14939 T14940 arg1Of qPCR,using
R10976 T14945 T14940 arg2Of primers,using
R10977 T14945 T14941 arg1Of primers,SerpinB2
R10978 T14945 T14942 arg1Of primers,proximal
R10979 T14945 T14943 arg1Of primers,promoter
R10980 T14945 T14944 arg1Of primers,specific
R10981 T14947 T14930 arg2Of illustrated,and
R10982 T14947 T14948 arg1Of illustrated,in
R10983 T14949 T14948 arg2Of fig,in
R10984 T14950 T14951 arg1Of 4A,)
R10985 T14953 T14952 arg1Of results,The
R10986 T14953 T14954 arg1Of results,showed
R10987 T14956 T14957 arg1Of C/EBP-β,is
R10988 T14956 T14959 arg1Of C/EBP-β,present
R10989 T14957 T14954 arg2Of is,showed
R10990 T14957 T14955 arg1Of is,that
R10991 T14957 T14964 arg1Of is,as
R10992 T14959 T14957 arg2Of present,is
R10993 T14959 T14958 arg1Of present,constitutively
R10994 T14959 T14960 arg1Of present,at
R10995 T14963 T14960 arg2Of promoter,at
R10996 T14963 T14961 arg1Of promoter,the
R10997 T14963 T14962 arg1Of promoter,SerpinB2
R10998 T14965 T14975 arg1Of demonstrated,and
R10999 T14968 T14965 arg1Of association,demonstrated
R11000 T14968 T14966 arg2Of association,by
R11001 T14968 T14967 arg1Of association,its
R11002 T14968 T14969 arg1Of association,with
R11003 T14968 T14972 arg1Of association,in
R11004 T14971 T14969 arg2Of promoter,with
R11005 T14971 T14970 arg1Of promoter,the
R11006 T14974 T14972 arg2Of macrophages,in
R11007 T14974 T14973 arg1Of macrophages,unstimulated
R11008 T14975 T14964 arg2Of and,as
R11009 T14976 T14975 arg2Of increased,and
R11010 T14976 T14977 arg1Of increased,temporally
R11011 T14976 T14978 arg1Of increased,in
R11012 T14979 T14978 arg2Of response,in
R11013 T14979 T14980 arg1Of response,to
R11014 T14981 T14980 arg2Of LPS,to
R11015 T14981 T14982 arg1Of LPS,reaching
R11016 T14982 T14984 arg1Of reaching,much
R11017 T14982 T14987 arg1Of reaching,over
R11018 T14982 T14990 arg1Of reaching,after
R11019 T14982 T14993 arg1Of reaching,(
R11020 T14984 T14983 arg1Of much,as
R11021 T14984 T14985 arg1Of much,as
R11022 T14986 T14985 arg2Of 10-fold,as
R11023 T14989 T14987 arg2Of cells,over
R11024 T14989 T14988 arg1Of cells,unstimulated
R11025 T14992 T14990 arg2Of hrs,after
R11026 T14992 T14991 arg1Of hrs,8
R11027 T14994 T14993 arg2Of Fig.,(
R11028 T14994 T14995 arg1Of Fig.,7
R11029 T14996 T14993 arg3Of ),(
R11030 T14998 T14999 arg1Of changes,in
R11031 T14998 T15003 arg1Of changes,can
R11032 T14998 T15004 arg1Of changes,affect
R11033 T15002 T14999 arg2Of states,in
R11034 T15002 T15000 arg1Of states,C/EBP-β
R11035 T15002 T15001 arg1Of states,phosphorylation
R11036 T15004 T14997 arg2Of affect,Since
R11037 T15004 T15003 arg2Of affect,can
R11038 T15004 T15014 arg1Of affect,;
R11039 T15004 T15015 arg1Of affect,[
R11040 T15004 T15018 arg1Of affect,;
R11041 T15004 T15019 arg1Of affect,[
R11042 T15006 T15004 arg2Of ability,affect
R11043 T15006 T15005 arg1Of ability,C/EBP-β’s
R11044 T15006 T15007 modOf ability,to
R11045 T15008 T15007 arg1Of transactivate,to
R11046 T15010 T15008 arg2Of genes,transactivate
R11047 T15010 T15009 arg1Of genes,target
R11048 T15010 T15011 arg1Of genes,[
R11049 T15012 T15011 arg2Of 38,[
R11050 T15013 T15011 arg3Of ],[
R11051 T15016 T15015 arg2Of 63,[
R11052 T15017 T15015 arg3Of ],[
R11053 T15020 T15019 arg2Of 64,[
R11054 T15021 T15019 arg3Of ],[
R11055 T15023 T15024 arg1Of we,investigated
R11056 T15024 T14997 arg1Of investigated,Since
R11057 T15024 T15022 arg1Of investigated,","
R11058 T15025 T15024 arg2Of recruitment,investigated
R11059 T15025 T15026 arg1Of recruitment,to
R11060 T15025 T15040 arg1Of recruitment,","
R11061 T15025 T15041 arg1Of recruitment,which
R11062 T15025 T15042 arg1Of recruitment,has
R11063 T15025 T15043 arg1Of recruitment,been
R11064 T15025 T15044 arg2Of recruitment,associated
R11065 T15030 T15026 arg2Of promoter,to
R11066 T15030 T15027 arg1Of promoter,the
R11067 T15030 T15028 arg1Of promoter,SerpinB2
R11068 T15030 T15029 arg1Of promoter,proximal
R11069 T15030 T15031 arg1Of promoter,of
R11070 T15036 T15031 arg2Of isoform,of
R11071 T15036 T15032 arg1Of isoform,the
R11072 T15036 T15033 arg1Of isoform,T217
R11073 T15036 T15034 arg2Of isoform,phosphorylated
R11074 T15036 T15035 arg1Of isoform,C/EBP-β
R11075 T15036 T15037 arg1Of isoform,(
R11076 T15038 T15037 arg2Of p-C/EBP-βT217,(
R11077 T15039 T15037 arg3Of ),(
R11078 T15044 T15042 arg2Of associated,has
R11079 T15044 T15043 arg2Of associated,been
R11080 T15044 T15045 arg1Of associated,with
R11081 T15047 T15045 arg2Of survival,with
R11082 T15047 T15046 arg1Of survival,cell
R11083 T15047 T15052 modOf survival,17
R11084 T15049 T15048 arg2Of 65,[
R11085 T15050 T15048 arg3Of ],[
R11086 T15051 T15048 arg1Of . p-C/EBP-βT2,[
R11087 T15051 T15052 arg1Of . p-C/EBP-βT2,17
R11088 T15051 T15054 arg2Of . p-C/EBP-βT2,vely
R11089 T15054 T15052 arg2Of vely ,17
R11090 T15054 T15053 arg1Of vely ,was constituti
R11091 T15054 T15055 arg1Of vely ,bo
R11092 T15058 T15059 arg1Of erpinB2 ,proximal
R11093 T15058 T15060 arg1Of erpinB2 ,pro
R11094 T15062 T15060 arg2Of r and a,pro
R11095 T15062 T15061 arg1Of r and a,mote
R11096 T15062 T15063 arg1Of r and a,lso p
R11097 T15065 T15063 arg2Of es,lso p
R11098 T15065 T15064 arg1Of es,r
R11099 T15068 T15055 arg2Of fter 1 hr o,bo
R11100 T15068 T15056 arg1Of fter 1 hr o,und
R11101 T15068 T15057 arg1Of fter 1 hr o,to the S
R11102 T15068 T15058 arg1Of fter 1 hr o,erpinB2
R11103 T15068 T15062 arg1Of fter 1 hr o,r and a
R11104 T15068 T15066 arg1Of fter 1 hr o,en
R11105 T15068 T15067 arg1Of fter 1 hr o,t a
R11106 T15068 T15069 arg1Of fter 1 hr o,f
R11107 T15070 T15069 arg2Of LPS ,f
R11108 T15070 T15071 arg1Of LPS ,s
R11109 T15072 T15069 arg3Of t,f
R11110 T15074 T15073 arg2Of contrast,In
R11111 T15074 T15075 arg1Of contrast,to
R11112 T15077 T15075 arg2Of C/EBP-β,to
R11113 T15077 T15076 arg1Of C/EBP-β,total
R11114 T15081 T15079 arg1Of affinity,the
R11115 T15081 T15080 arg1Of affinity,binding
R11116 T15081 T15082 arg1Of affinity,of
R11117 T15081 T15089 arg1Of affinity,diminished
R11118 T15083 T15082 arg2Of p-C/EBP-βT217,of
R11119 T15083 T15084 arg1Of p-C/EBP-βT217,for
R11120 T15088 T15084 arg2Of promoter,for
R11121 T15088 T15085 arg1Of promoter,the
R11122 T15088 T15086 arg1Of promoter,SerpinB2
R11123 T15088 T15087 arg1Of promoter,proximal
R11124 T15089 T15073 arg1Of diminished,In
R11125 T15089 T15078 arg1Of diminished,","
R11126 T15089 T15090 arg1Of diminished,with
R11127 T15092 T15090 arg2Of stimulation,with
R11128 T15092 T15091 arg1Of stimulation,LPS
R11129 T15092 T15093 arg1Of stimulation,at
R11130 T15095 T15093 arg2Of timepoints,at
R11131 T15095 T15094 arg1Of timepoints,later
R11132 T15095 T15096 arg1Of timepoints,(
R11133 T15095 T15102 arg1Of timepoints,(
R11134 T15097 T15098 arg1Of 4,and
R11135 T15099 T15098 arg2Of 8,and
R11136 T15100 T15096 arg2Of hrs,(
R11137 T15100 T15097 arg1Of hrs,4
R11138 T15100 T15099 arg1Of hrs,8
R11139 T15101 T15096 arg3Of ),(
R11140 T15103 T15102 arg2Of Fig.,(
R11141 T15103 T15104 arg1Of Fig.,7
R11142 T15105 T15102 arg3Of ),(
R11143 T15107 T15106 arg1Of data,These
R11144 T15107 T15108 arg1Of data,show
R11145 T15107 T15119 arg1Of data,indicate
R11146 T15108 T15118 arg1Of show,and
R11147 T15111 T15108 arg2Of relationship,show
R11148 T15111 T15109 arg1Of relationship,an
R11149 T15111 T15110 arg1Of relationship,inverse
R11150 T15111 T15112 arg1Of relationship,between
R11151 T15113 T15114 arg1Of C/EBP-β,and
R11152 T15114 T15112 arg2Of and,between
R11153 T15116 T15114 arg2Of recruitment,and
R11154 T15116 T15115 arg1Of recruitment,p-C/EBP-βT217
R11155 T15118 T15117 arg1Of and,","
R11156 T15119 T15118 arg2Of indicate,and
R11157 T15122 T15121 arg1Of C/EBP-β,T217-phosphorylated
R11158 T15122 T15123 arg1Of C/EBP-β,may
R11159 T15122 T15125 arg1Of C/EBP-β,be
R11160 T15122 T15126 arg1Of C/EBP-β,responsible
R11161 T15125 T15119 arg2Of be,indicate
R11162 T15125 T15120 arg1Of be,that
R11163 T15125 T15123 arg2Of be,may
R11164 T15125 T15124 arg1Of be,not
R11165 T15126 T15125 arg2Of responsible,be
R11166 T15126 T15127 arg1Of responsible,for
R11167 T15129 T15127 arg2Of transcription,for
R11168 T15129 T15128 arg2Of transcription,increased
R11169 T15129 T15130 arg1Of transcription,from
R11170 T15129 T15134 arg1Of transcription,in
R11171 T15133 T15130 arg2Of promoter,from
R11172 T15133 T15131 arg1Of promoter,the
R11173 T15133 T15132 arg1Of promoter,SerpinB2
R11174 T15134 T15136 arg1Of in,to
R11175 T15135 T15134 arg2Of response,in
R11176 T15137 T15134 arg3Of LPS,in
R11620 T15789 T15790 arg1Of C/EBP-β,Promotes
R11621 T15796 T15790 arg2Of Activity,Promotes
R11622 T15796 T15791 arg1Of Activity,LPS-inducible
R11623 T15796 T15792 arg1Of Activity,Murine
R11624 T15796 T15793 arg1Of Activity,SerpinB2
R11625 T15796 T15794 arg1Of Activity,Proximal
R11626 T15796 T15795 arg1Of Activity,Promoter
R11627 T15798 T15799 arg1Of C/EBP-β,binds
R11628 T15799 T15797 arg2Of binds,Since
R11629 T15799 T15800 arg1Of binds,to
R11630 T15799 T15805 arg1Of binds,in
R11631 T15799 T15811 arg1Of binds,vitro
R11632 T15799 T15814 arg1Of binds,vivo
R11633 T15804 T15800 arg2Of promoter,to
R11634 T15804 T15801 arg1Of promoter,the
R11635 T15804 T15802 arg1Of promoter,SerpinB2
R11636 T15804 T15803 arg1Of promoter,proximal
R11637 T15808 T15805 arg2Of manner,in
R11638 T15808 T15806 arg1Of manner,an
R11639 T15808 T15807 arg1Of manner,LPS-inducible
R11640 T15811 T15810 arg1Of vitro,in
R11641 T15811 T15812 arg1Of vitro,and
R11642 T15812 T15809 arg1Of and,both
R11643 T15814 T15812 arg2Of vivo,and
R11644 T15814 T15813 arg1Of vivo,in
R11645 T15816 T15817 arg1Of we,wanted
R11646 T15816 T15819 arg1Of we,address
R11647 T15817 T15797 arg1Of wanted,Since
R11648 T15817 T15815 arg1Of wanted,","
R11649 T15819 T15817 arg2Of address,wanted
R11650 T15819 T15818 arg1Of address,to
R11651 T15821 T15819 arg2Of question,address
R11652 T15821 T15820 arg1Of question,the
R11653 T15821 T15822 arg1Of question,of
R11654 T15824 T15825 arg1Of C/EBP-β,was
R11655 T15825 T15822 arg2Of was,of
R11656 T15825 T15823 arg1Of was,whether
R11657 T15828 T15825 arg2Of factor,was
R11658 T15828 T15826 arg1Of factor,an
R11659 T15828 T15827 arg1Of factor,essential
R11660 T15828 T15829 arg1Of factor,for
R11661 T15830 T15829 arg2Of driving,for
R11662 T15831 T15830 arg2Of transcription,driving
R11663 T15831 T15832 arg1Of transcription,from
R11664 T15831 T15836 arg1Of transcription,in
R11665 T15835 T15832 arg2Of promoter,from
R11666 T15835 T15833 arg1Of promoter,the
R11667 T15835 T15834 arg1Of promoter,SerpinB2
R11668 T15837 T15836 arg2Of cells,in
R11669 T15837 T15838 arg1Of cells,in
R11670 T15839 T15838 arg2Of response,in
R11671 T15839 T15840 arg1Of response,to
R11672 T15841 T15840 arg2Of LPS,to
R11673 T15843 T15842 arg1Of ability,The
R11674 T15843 T15844 arg1Of ability,of
R11675 T15843 T15847 modOf ability,to
R11676 T15843 T15855 arg1Of ability,was
R11677 T15843 T15856 arg2Of ability,examined
R11678 T15846 T15844 arg2Of C/EBP-β,of
R11679 T15846 T15845 arg1Of C/EBP-β,endogenous
R11680 T15848 T15847 arg1Of direct,to
R11681 T15849 T15848 arg2Of transcription,direct
R11682 T15849 T15850 arg1Of transcription,from
R11683 T15854 T15850 arg2Of promoter,from
R11684 T15854 T15851 arg1Of promoter,the
R11685 T15854 T15852 arg1Of promoter,SerpinB2
R11686 T15854 T15853 arg1Of promoter,proximal
R11687 T15856 T15855 arg2Of examined,was
R11688 T15858 T15856 arg1Of transfection,examined
R11689 T15858 T15857 arg2Of transfection,by
R11690 T15858 T15859 arg1Of transfection,of
R11691 T15858 T15867 arg1Of transfection,into
R11692 T15866 T15859 arg2Of construct,of
R11693 T15866 T15860 arg1Of construct,the
R11694 T15866 T15861 arg1Of construct,pGLmP-539
R11695 T15866 T15862 arg1Of construct,murine
R11696 T15866 T15863 arg1Of construct,SerpinB2
R11697 T15866 T15864 arg1Of construct,luciferase
R11698 T15866 T15865 arg1Of construct,reporter
R11699 T15868 T15869 arg1Of Cebpb+/+,and
R11700 T15870 T15869 arg2Of Cebpb−/−,and
R11701 T15871 T15867 arg2Of MEFs,into
R11702 T15871 T15868 arg1Of MEFs,Cebpb+/+
R11703 T15871 T15870 arg1Of MEFs,Cebpb−/−
R11704 T15872 T15873 arg1Of We,found
R11705 T15873 T15894 arg1Of found,","
R11706 T15873 T15895 modOf found,indicating
R11707 T15878 T15875 arg1Of activity,LPS-stimulated
R11708 T15878 T15876 arg1Of activity,SerpinB2
R11709 T15878 T15877 arg1Of activity,promoter
R11710 T15878 T15879 arg1Of activity,was
R11711 T15878 T15881 arg2Of activity,increased
R11712 T15878 T15886 arg1Of activity,abrogated
R11713 T15881 T15879 arg2Of increased,was
R11714 T15881 T15880 arg1Of increased,significantly
R11715 T15881 T15882 arg1Of increased,in
R11716 T15881 T15885 arg1Of increased,and
R11717 T15884 T15882 arg2Of MEFs,in
R11718 T15884 T15883 arg1Of MEFs,Cebpb+/+
R11719 T15885 T15873 arg2Of and,found
R11720 T15885 T15874 arg1Of and,that
R11721 T15886 T15885 arg2Of abrogated,and
R11722 T15886 T15887 arg1Of abrogated,in
R11723 T15889 T15887 arg2Of MEFs,in
R11724 T15889 T15888 arg1Of MEFs,Cebpb−/−
R11725 T15892 T15886 arg2Of 8A,abrogated
R11726 T15892 T15890 arg2Of 8A,(
R11727 T15892 T15891 arg1Of 8A,Fig.
R11728 T15893 T15890 arg3Of ),(
R11729 T15898 T15897 arg1Of C/EBP-β,endogenous
R11730 T15898 T15899 arg1Of C/EBP-β,is
R11731 T15898 T15900 arg2Of C/EBP-β,required
R11732 T15900 T15895 arg2Of required,indicating
R11733 T15900 T15896 arg1Of required,that
R11734 T15900 T15899 arg2Of required,is
R11735 T15900 T15901 arg1Of required,for
R11736 T15906 T15901 arg2Of activity,for
R11737 T15906 T15902 arg1Of activity,LPS-induced
R11738 T15906 T15903 arg1Of activity,SerpinB2
R11739 T15906 T15904 arg1Of activity,proximal
R11740 T15906 T15905 arg1Of activity,promoter
R12095 T16724 T16725 arg1Of Phosphorylation,of
R12096 T16724 T16727 arg1Of Phosphorylation,at
R12097 T16724 T16731 arg1Of Phosphorylation,Regulates
R12098 T16726 T16725 arg2Of C/EBP-β,of
R12099 T16728 T16727 arg2Of Serine,at
R12100 T16728 T16729 arg1Of Serine,64
R12101 T16731 T16730 arg1Of Regulates,negatively
R12102 T16735 T16731 arg2Of Activity,Regulates
R12103 T16735 T16732 arg1Of Activity,LPS-stimulated
R12104 T16735 T16733 arg1Of Activity,SerpinB2
R12105 T16735 T16734 arg1Of Activity,Promoter
R12106 T16736 T16737 arg1Of Phosphorylation,of
R12107 T16736 T16739 arg1Of Phosphorylation,is
R12108 T16736 T16741 arg2Of Phosphorylation,recognized
R12109 T16736 T16743 arg1Of Phosphorylation,modulate
R12110 T16738 T16737 arg2Of C/EBP-β,of
R12111 T16741 T16739 arg2Of recognized,is
R12112 T16741 T16740 arg1Of recognized,well
R12113 T16743 T16741 arg3Of modulate,recognized
R12114 T16743 T16742 arg1Of modulate,to
R12115 T16743 T16747 arg1Of modulate,[
R12116 T16746 T16743 arg2Of potential,modulate
R12117 T16746 T16744 arg1Of potential,its
R12118 T16746 T16745 arg1Of potential,transactivation
R12119 T16748 T16747 arg2Of 63,[
R12120 T16749 T16747 arg3Of ],[
R12121 T16751 T16750 arg1Of investigate,To
R12122 T16754 T16751 arg2Of sites,investigate
R12123 T16754 T16752 arg1Of sites,C/EBP-β
R12124 T16754 T16753 arg1Of sites,phosphorylation
R12125 T16754 T16755 arg1Of sites,that
R12126 T16754 T16756 arg1Of sites,may
R12127 T16754 T16757 arg1Of sites,be
R12128 T16754 T16758 arg1Of sites,important
R12129 T16757 T16756 arg2Of be,may
R12130 T16758 T16757 arg2Of important,be
R12131 T16758 T16759 arg1Of important,for
R12132 T16764 T16759 arg2Of activity,for
R12133 T16764 T16760 arg1Of activity,LPS-stimulated
R12134 T16764 T16761 arg1Of activity,SerpinB2
R12135 T16764 T16762 arg1Of activity,proximal
R12136 T16764 T16763 arg1Of activity,promoter
R12137 T16764 T16765 arg1Of activity,(
R12138 T16767 T16765 arg2Of 8B,(
R12139 T16767 T16766 arg1Of 8B,Fig.
R12140 T16768 T16765 arg3Of ),(
R12141 T16770 T16751 arg1Of we,investigate
R12142 T16770 T16771 arg1Of we,co-expressed
R12143 T16771 T16750 modOf co-expressed,To
R12144 T16771 T16769 arg1Of co-expressed,","
R12145 T16775 T16771 arg2Of mutants,co-expressed
R12146 T16775 T16772 arg1Of mutants,several
R12147 T16775 T16773 arg1Of mutants,C/EBP-β
R12148 T16775 T16774 arg1Of mutants,phospho-acceptor
R12149 T16775 T16776 arg2Of mutants,in
R12150 T16775 T16777 arg1Of mutants,which
R12151 T16775 T16789 arg1Of mutants,","
R12152 T16775 T16790 arg1Of mutants,along
R12153 T16780 T16781 arg1Of threonine,or
R12154 T16782 T16781 arg2Of serine,or
R12155 T16783 T16778 arg1Of residue,the
R12156 T16783 T16779 arg1Of residue,critical
R12157 T16783 T16780 arg1Of residue,threonine
R12158 T16783 T16782 arg1Of residue,serine
R12159 T16783 T16784 arg1Of residue,was
R12160 T16783 T16785 arg2Of residue,mutated
R12161 T16785 T16776 arg1Of mutated,in
R12162 T16785 T16784 arg2Of mutated,was
R12163 T16785 T16786 arg1Of mutated,to
R12164 T16788 T16786 arg2Of alanine,to
R12165 T16788 T16787 arg1Of alanine,an
R12166 T16790 T16791 arg1Of along,with
R12167 T16797 T16791 arg2Of reporter,with
R12168 T16797 T16792 arg1Of reporter,the
R12169 T16797 T16793 arg1Of reporter,pGLmP-539
R12170 T16797 T16794 arg1Of reporter,murine
R12171 T16797 T16795 arg1Of reporter,SerpinB2
R12172 T16797 T16796 arg1Of reporter,luciferase
R12173 T16797 T16798 arg1Of reporter,in
R12174 T16800 T16798 arg2Of MEFs,in
R12175 T16800 T16799 arg1Of MEFs,Cebpb−/−
R12176 T16801 T16802 arg1Of Re-expression,of
R12177 T16801 T16805 arg1Of Re-expression,in
R12178 T16801 T16809 arg1Of Re-expression,stimulated
R12179 T16804 T16802 arg2Of C/EBP-β,of
R12180 T16804 T16803 arg1Of C/EBP-β,wild-type
R12181 T16807 T16805 arg2Of MEFs,in
R12182 T16807 T16806 arg1Of MEFs,Cebpb−/−
R12183 T16809 T16808 arg1Of stimulated,significantly
R12184 T16809 T16829 arg1Of stimulated,","
R12185 T16809 T16830 modOf stimulated,confirming
R12186 T16814 T16809 arg2Of expression,stimulated
R12187 T16814 T16810 arg1Of expression,SerpinB2
R12188 T16814 T16811 arg1Of expression,luciferase
R12189 T16814 T16812 arg1Of expression,reporter
R12190 T16814 T16813 arg1Of expression,gene
R12191 T16814 T16815 arg1Of expression,in
R12192 T16814 T16820 arg1Of expression,by
R12193 T16817 T16815 arg2Of presence,in
R12194 T16817 T16816 arg1Of presence,the
R12195 T16817 T16818 arg1Of presence,of
R12196 T16819 T16818 arg2Of LPS,of
R12197 T16822 T16820 arg2Of fold,by
R12198 T16822 T16821 arg1Of fold,∼3
R12199 T16822 T16823 arg1Of fold,(
R12200 T16825 T16823 arg2Of 8C,(
R12201 T16825 T16824 arg1Of 8C,Fig.
R12202 T16825 T16826 arg1Of 8C,","
R12203 T16827 T16826 arg2Of left,","
R12204 T16828 T16823 arg3Of ),(
R12205 T16832 T16830 arg2Of importance,confirming
R12206 T16832 T16831 arg1Of importance,the
R12207 T16832 T16833 arg1Of importance,of
R12208 T16832 T16835 arg1Of importance,to
R12209 T16834 T16833 arg2Of C/EBP-β,of
R12210 T16839 T16835 arg2Of transcription,to
R12211 T16839 T16836 arg1Of transcription,LPS-induced
R12212 T16839 T16837 arg1Of transcription,SerpinB2
R12213 T16839 T16838 arg1Of transcription,gene
R12214 T16840 T16841 arg1Of Expression,of
R12215 T16840 T16852 arg1Of Expression,did
R12216 T16840 T16855 arg1Of Expression,increase
R12217 T16845 T16841 arg2Of mutant,of
R12218 T16845 T16842 arg1Of mutant,the
R12219 T16845 T16843 arg1Of mutant,C/EBP-β
R12220 T16845 T16844 arg1Of mutant,phospho-acceptor
R12221 T16845 T16846 arg1Of mutant,","
R12222 T16847 T16846 arg2Of C/EBPβT217A,","
R12223 T16851 T16849 arg2Of MEFs,in
R12224 T16851 T16850 arg1Of MEFs,Cebpb−/−
R12225 T16855 T16848 arg1Of increase,","
R12226 T16855 T16849 arg1Of increase,in
R12227 T16855 T16852 arg2Of increase,did
R12228 T16855 T16853 arg1Of increase,not
R12229 T16855 T16854 arg1Of increase,significantly
R12230 T16855 T16870 arg1Of increase,;
R12231 T16855 T16871 modOf increase,confirming
R12232 T16858 T16855 arg2Of activity,increase
R12233 T16858 T16856 arg1Of activity,SerpinB2
R12234 T16858 T16857 arg1Of activity,promoter
R12235 T16858 T16859 arg1Of activity,above
R12236 T16858 T16864 arg1Of activity,(
R12237 T16860 T16859 arg2Of that,above
R12238 T16860 T16861 arg1Of that,of
R12239 T16863 T16861 arg2Of C/EBP-β,of
R12240 T16863 T16862 arg1Of C/EBP-β,wild-type
R12241 T16866 T16864 arg2Of 8C,(
R12242 T16866 T16865 arg1Of 8C,Fig.
R12243 T16866 T16867 arg1Of 8C,","
R12244 T16868 T16867 arg2Of right,","
R12245 T16869 T16864 arg3Of ),(
R12246 T16873 T16874 arg1Of phosphorylation,of
R12247 T16873 T16876 arg1Of phosphorylation,at
R12248 T16873 T16878 arg1Of phosphorylation,is
R12249 T16875 T16874 arg2Of C/EBP-β,of
R12250 T16877 T16876 arg2Of T217,at
R12251 T16878 T16871 arg2Of is,confirming
R12252 T16878 T16872 arg1Of is,that
R12253 T16878 T16879 arg1Of is,not
R12254 T16882 T16878 arg2Of factor,is
R12255 T16882 T16880 arg1Of factor,a
R12256 T16882 T16881 arg1Of factor,major
R12257 T16882 T16883 arg1Of factor,in
R12258 T16885 T16883 arg2Of regulation,in
R12259 T16885 T16884 arg1Of regulation,the
R12260 T16885 T16886 arg1Of regulation,of
R12261 T16885 T16890 arg1Of regulation,in
R12262 T16889 T16886 arg2Of activity,of
R12263 T16889 T16887 arg1Of activity,SerpinB2
R12264 T16889 T16888 arg1Of activity,promoter
R12265 T16890 T16892 arg1Of in,to
R12266 T16891 T16890 arg2Of response,in
R12267 T16893 T16890 arg3Of LPS,in
R12268 T16894 T16895 arg1Of C/EBP-β,contains
R12269 T16898 T16895 arg2Of sites,contains
R12270 T16898 T16896 arg1Of sites,additional
R12271 T16898 T16897 arg1Of sites,phosphorylation
R12272 T16898 T16899 arg1Of sites,","
R12273 T16900 T16901 arg1Of C/EBP-βT188,and
R12274 T16901 T16899 arg2Of and,","
R12275 T16901 T16903 arg1Of and,(
R12276 T16901 T16907 arg1Of and,","
R12277 T16901 T16908 arg1Of and,which
R12278 T16901 T16909 arg1Of and,may
R12279 T16901 T16910 arg1Of and,be
R12280 T16901 T16911 arg2Of and,involved
R12281 T16902 T16901 arg2Of C/EBP-βS64,and
R12282 T16905 T16903 arg2Of 8B,(
R12283 T16905 T16904 arg1Of 8B,Fig.
R12284 T16906 T16903 arg3Of ),(
R12285 T16911 T16909 arg2Of involved,may
R12286 T16911 T16910 arg2Of involved,be
R12287 T16911 T16912 arg1Of involved,in
R12288 T16913 T16912 arg2Of modulating,in
R12289 T16917 T16913 arg2Of transcription,modulating
R12290 T16917 T16914 arg1Of transcription,C/EBP-β-dependent
R12291 T16917 T16915 arg1Of transcription,SerpinB2
R12292 T16917 T16916 arg1Of transcription,gene
R12293 T16918 T16919 arg1Of C/EBP-βT188,is
R12294 T16918 T16920 arg2Of C/EBP-βT188,implicated
R12295 T16918 T16922 arg1Of C/EBP-βT188,regulating
R12296 T16920 T16919 arg2Of implicated,is
R12297 T16920 T16921 arg1Of implicated,in
R12298 T16922 T16921 arg2Of regulating,in
R12299 T16923 T16922 arg2Of DAPK1,regulating
R12300 T16923 T16924 arg1Of DAPK1,","
R12301 T16923 T16940 arg1Of DAPK1,","
R12302 T16927 T16924 arg2Of gene,","
R12303 T16927 T16925 arg1Of gene,an
R12304 T16927 T16926 arg1Of gene,IFNγ-inducible
R12305 T16927 T16928 arg2Of gene,involved
R12306 T16928 T16929 arg1Of involved,in
R12307 T16931 T16929 arg2Of regulation,in
R12308 T16931 T16930 arg1Of regulation,the
R12309 T16931 T16932 arg1Of regulation,of
R12310 T16934 T16933 arg1Of cycle,cell
R12311 T16934 T16935 arg1Of cycle,and
R12312 T16935 T16932 arg2Of and,of
R12313 T16936 T16935 arg2Of apoptosis,and
R12314 T16936 T16937 arg1Of apoptosis,[
R12315 T16938 T16937 arg2Of 38,[
R12316 T16939 T16937 arg3Of ],[
R12317 T16941 T16940 arg2Of processes,","
R12318 T16941 T16942 arg2Of processes,with
R12319 T16941 T16943 arg1Of processes,which
R12320 T16944 T16945 arg1Of SerpinB2,has
R12321 T16944 T16947 arg1Of SerpinB2,been
R12322 T16944 T16948 arg2Of SerpinB2,associated
R12323 T16948 T16942 arg1Of associated,with
R12324 T16948 T16945 arg2Of associated,has
R12325 T16948 T16946 arg1Of associated,also
R12326 T16948 T16947 arg2Of associated,been
R12327 T16948 T16949 arg1Of associated,[
R12328 T16950 T16949 arg2Of 17,[
R12329 T16951 T16949 arg3Of ],[
R12330 T16952 T16953 arg1Of C/EBP-βS64,is
R12331 T16952 T16954 arg1Of C/EBP-βS64,important
R12332 T16953 T16964 arg1Of is,[
R12333 T16954 T16953 arg2Of important,is
R12334 T16954 T16955 arg1Of important,for
R12335 T16957 T16955 arg2Of transcription,for
R12336 T16957 T16956 arg1Of transcription,LPS-induced
R12337 T16957 T16958 arg1Of transcription,of
R12338 T16960 T16959 arg1Of cytokines,the
R12339 T16961 T16962 arg1Of IL-6,and
R12340 T16962 T16958 arg2Of and,of
R12341 T16962 T16960 arg1Of and,cytokines
R12342 T16963 T16962 arg2Of MCP-1,and
R12343 T16965 T16964 arg2Of 64,[
R12344 T16966 T16964 arg3Of ],[
R12345 T16969 T16970 arg1Of SerpinB2,is
R12346 T16969 T16971 arg2Of SerpinB2,induced
R12347 T16969 T16975 arg2Of SerpinB2,regulated
R12348 T16971 T16974 arg1Of induced,and
R12349 T16973 T16971 arg1Of LPS,induced
R12350 T16973 T16972 arg2Of LPS,by
R12351 T16974 T16967 arg1Of and,Similarly
R12352 T16974 T16968 arg1Of and,","
R12353 T16974 T16970 arg2Of and,is
R12354 T16975 T16974 arg2Of regulated,and
R12355 T16975 T16976 arg1Of regulated,in
R12356 T16978 T16976 arg2Of manner,in
R12357 T16978 T16977 arg1Of manner,a
R12358 T16978 T16979 arg1Of manner,similar
R12359 T16979 T16980 arg1Of similar,to
R12360 T16981 T16980 arg2Of cytokines,to
R12361 T16981 T16982 arg1Of cytokines,[
R12362 T16983 T16982 arg2Of 29,[
R12363 T16984 T16982 arg3Of ],[
R12364 T16987 T16985 arg2Of similarities,Given
R12365 T16987 T16986 arg1Of similarities,the
R12366 T16987 T16988 arg1Of similarities,in
R12367 T16991 T16988 arg2Of significance,in
R12368 T16991 T16989 arg1Of significance,the
R12369 T16991 T16990 arg1Of significance,functional
R12370 T16991 T16992 arg1Of significance,of
R12371 T16995 T16992 arg2Of isoforms,of
R12372 T16995 T16993 arg1Of isoforms,these
R12373 T16995 T16994 arg1Of isoforms,phospho-specific
R12374 T16995 T16996 arg1Of isoforms,of
R12375 T16997 T16998 arg1Of C/EBP-β,and
R12376 T16998 T16996 arg2Of and,of
R12377 T16999 T16998 arg2Of SerpinB2,and
R12378 T17001 T17002 arg1Of we,investigated
R12379 T17002 T16985 arg1Of investigated,Given
R12380 T17002 T17000 arg1Of investigated,","
R12381 T17006 T17004 arg1Of sites,these
R12382 T17006 T17005 arg1Of sites,phospho-acceptor
R12383 T17006 T17007 arg1Of sites,may
R12384 T17006 T17008 arg1Of sites,play
R12385 T17008 T17002 arg2Of play,investigated
R12386 T17008 T17003 arg1Of play,whether
R12387 T17008 T17007 arg2Of play,may
R12388 T17008 T17011 arg1Of play,in
R12389 T17010 T17008 arg2Of role,play
R12390 T17010 T17009 arg1Of role,a
R12391 T17014 T17011 arg2Of expression,in
R12392 T17014 T17012 arg1Of expression,SerpinB2
R12393 T17014 T17013 arg1Of expression,gene
R12394 T17016 T17015 arg1Of MEFs,C/EBP-βT188A-transfected
R12395 T17016 T17017 arg1Of MEFs,exhibited
R12396 T17017 T17029 arg1Of exhibited,whereas
R12397 T17020 T17017 arg2Of activity,exhibited
R12398 T17020 T17018 arg1Of activity,SerpinB2
R12399 T17020 T17019 arg1Of activity,promoter
R12400 T17020 T17021 arg1Of activity,similar
R12401 T17021 T17022 arg1Of similar,to
R12402 T17023 T17022 arg2Of that,to
R12403 T17023 T17024 arg1Of that,of
R12404 T17027 T17024 arg2Of MEFs,of
R12405 T17027 T17025 arg1Of MEFs,wild-type
R12406 T17027 T17026 arg1Of MEFs,C/EBP-β-transfected
R12407 T17029 T17028 arg1Of whereas,","
R12408 T17031 T17030 arg1Of expression,the
R12409 T17031 T17032 arg1Of expression,of
R12410 T17031 T17034 arg1Of expression,potentiated
R12411 T17033 T17032 arg2Of C/EBP-βS64A,of
R12412 T17034 T17029 arg2Of potentiated,whereas
R12413 T17034 T17038 arg1Of potentiated,in
R12414 T17037 T17034 arg2Of activity,potentiated
R12415 T17037 T17035 arg1Of activity,SerpinB2
R12416 T17037 T17036 arg1Of activity,promoter
R12417 T17039 T17038 arg2Of response,in
R12418 T17039 T17040 arg1Of response,to
R12419 T17041 T17040 arg2Of LPS,to
R12420 T17041 T17042 arg1Of LPS,(
R12421 T17044 T17042 arg2Of 8C,(
R12422 T17044 T17043 arg1Of 8C,Fig.
R12423 T17044 T17045 arg1Of 8C,","
R12424 T17046 T17045 arg2Of right,","
R12425 T17047 T17042 arg3Of ),(
R12426 T17049 T17048 arg1Of data,These
R12427 T17049 T17050 arg1Of data,suggest
R12428 T17052 T17053 arg1Of phosphorylation,of
R12429 T17052 T17055 arg1Of phosphorylation,at
R12430 T17052 T17057 arg1Of phosphorylation,acts
R12431 T17052 T17060 arg1Of phosphorylation,regulate
R12432 T17054 T17053 arg2Of C/EBP-β,of
R12433 T17056 T17055 arg2Of S64,at
R12434 T17057 T17050 arg2Of acts,suggest
R12435 T17057 T17051 arg1Of acts,that
R12436 T17057 T17058 modOf acts,to
R12437 T17060 T17058 arg1Of regulate,to
R12438 T17060 T17059 arg1Of regulate,negatively
R12439 T17064 T17060 arg2Of activity,regulate
R12440 T17064 T17061 arg1Of activity,SerpinB2
R12441 T17064 T17062 arg1Of activity,proximal
R12442 T17064 T17063 arg1Of activity,promoter
R13385 T18925 T18926 arg1Of Macrophages,are
R13386 T18925 T18937 arg1Of Macrophages,provide
R13387 T18926 T18935 arg1Of are,and
R13388 T18928 T18926 arg2Of mediators,are
R13389 T18928 T18927 arg1Of mediators,key
R13390 T18928 T18929 arg1Of mediators,of
R13391 T18933 T18929 arg2Of response,of
R13392 T18933 T18930 arg1Of response,the
R13393 T18933 T18931 arg1Of response,innate
R13394 T18933 T18932 arg1Of response,immune
R13395 T18935 T18934 arg1Of and,","
R13396 T18937 T18935 arg2Of provide,and
R13397 T18937 T18936 arg1Of provide,consequently
R13398 T18940 T18937 arg2Of line,provide
R13399 T18940 T18938 arg1Of line,the
R13400 T18940 T18939 arg1Of line,first
R13401 T18940 T18941 arg1Of line,of
R13402 T18942 T18941 arg2Of defense,of
R13403 T18942 T18943 arg1Of defense,against
R13404 T18944 T18943 arg2Of pathogens,against
R13405 T18946 T18945 arg1Of stimuli,Pro-inflammatory
R13406 T18946 T18947 arg1Of stimuli,","
R13407 T18946 T18949 arg1Of stimuli,as
R13408 T18946 T18955 arg1Of stimuli,stimulate
R13409 T18949 T18948 arg1Of as,such
R13410 T18953 T18949 arg2Of LPS,as
R13411 T18953 T18950 arg1Of LPS,the
R13412 T18953 T18951 arg1Of LPS,bacterial
R13413 T18953 T18952 arg1Of LPS,endotoxin
R13414 T18955 T18954 arg1Of stimulate,","
R13415 T18956 T18955 arg2Of macrophages,stimulate
R13416 T18956 T18958 arg1Of macrophages,mount
R13417 T18958 T18955 arg3Of mount,stimulate
R13418 T18958 T18957 arg1Of mount,to
R13419 T18961 T18958 arg2Of response,mount
R13420 T18961 T18959 arg1Of response,an
R13421 T18961 T18960 arg1Of response,anti-pathogenic
R13422 T18961 T18962 arg1Of response,which
R13423 T18961 T18963 arg1Of response,involves
R13424 T18965 T18963 arg2Of induction,involves
R13425 T18965 T18964 arg1Of induction,massive
R13426 T18965 T18966 arg1Of induction,of
R13427 T18970 T18966 arg2Of SerpinB2,of
R13428 T18970 T18967 arg1Of SerpinB2,the
R13429 T18970 T18968 arg1Of SerpinB2,pro-survival
R13430 T18970 T18969 arg1Of SerpinB2,factor
R13431 T18971 T18972 arg1Of SerpinB2,is
R13432 T18971 T18974 arg2Of SerpinB2,induced
R13433 T18974 T18972 arg2Of induced,is
R13434 T18974 T18973 arg1Of induced,transcriptionally
R13435 T18977 T18974 arg1Of talk,induced
R13436 T18977 T18975 arg2Of talk,by
R13437 T18977 T18976 arg1Of talk,cross
R13438 T18977 T18978 arg1Of talk,between
R13439 T18980 T18981 arg1Of IKKβ/NF-κB,and
R13440 T18982 T18981 arg2Of p38MAPK,and
R13441 T18984 T18978 arg2Of modules,between
R13442 T18984 T18979 arg1Of modules,the
R13443 T18984 T18980 arg1Of modules,IKKβ/NF-κB
R13444 T18984 T18982 arg1Of modules,p38MAPK
R13445 T18984 T18983 arg1Of modules,signaling
R13446 T18984 T18985 arg1Of modules,in
R13447 T18986 T18985 arg2Of response,in
R13448 T18986 T18987 arg1Of response,to
R13449 T18988 T18987 arg2Of LPS,to
R13450 T18988 T18989 arg1Of LPS,[
R13451 T18990 T18989 arg2Of 16,[
R13452 T18991 T18989 arg3Of ],[
R13453 T18993 T18994 arg1Of we,report
R13454 T18994 T18992 arg1Of report,Here
R13455 T18998 T18996 arg1Of transcription,SerpinB2
R13456 T18998 T18997 arg1Of transcription,gene
R13457 T18998 T18999 arg1Of transcription,in
R13458 T18998 T19003 arg1Of transcription,is
R13459 T18998 T19004 arg2Of transcription,conferred
R13460 T18998 T19011 arg1Of transcription,is
R13461 T18998 T19013 arg1Of transcription,dependent
R13462 T19000 T18999 arg2Of response,in
R13463 T19000 T19001 arg1Of response,to
R13464 T19002 T19001 arg2Of LPS,to
R13465 T19004 T19003 arg2Of conferred,is
R13466 T19004 T19010 arg1Of conferred,and
R13467 T19009 T19004 arg1Of promoter,conferred
R13468 T19009 T19005 arg2Of promoter,by
R13469 T19009 T19006 arg1Of promoter,the
R13470 T19009 T19007 arg1Of promoter,SerpinB2
R13471 T19009 T19008 arg1Of promoter,proximal
R13472 T19010 T18994 arg2Of and,report
R13473 T19010 T18995 arg1Of and,that
R13474 T19011 T19010 arg2Of is,and
R13475 T19013 T19011 arg2Of dependent,is
R13476 T19013 T19012 arg1Of dependent,greatly
R13477 T19013 T19014 arg1Of dependent,upon
R13478 T19015 T19014 arg2Of C/EBP-β,upon
R13479 T19017 T19016 arg1Of C/EBP-β,LPS-induced
R13480 T19017 T19018 arg1Of C/EBP-β,was
R13481 T19017 T19019 arg2Of C/EBP-β,shown
R13482 T19017 T19022 arg1Of C/EBP-β,bind
R13483 T19019 T19018 arg2Of shown,was
R13484 T19019 T19038 arg1Of shown,and
R13485 T19022 T19019 arg3Of bind,shown
R13486 T19022 T19020 arg1Of bind,to
R13487 T19022 T19021 arg1Of bind,specifically
R13488 T19022 T19033 arg1Of bind,vitro
R13489 T19022 T19036 arg1Of bind,vivo
R13490 T19026 T19022 arg2Of element,bind
R13491 T19026 T19023 arg1Of element,the
R13492 T19026 T19024 arg1Of element,C/EBP
R13493 T19026 T19025 arg1Of element,response
R13494 T19026 T19027 arg1Of element,in
R13495 T19031 T19027 arg2Of promoter,in
R13496 T19031 T19028 arg1Of promoter,the
R13497 T19031 T19029 arg1Of promoter,SerpinB2
R13498 T19031 T19030 arg1Of promoter,proximal
R13499 T19033 T19032 arg1Of vitro,in
R13500 T19033 T19034 arg1Of vitro,and
R13501 T19036 T19034 arg2Of vivo,and
R13502 T19036 T19035 arg1Of vivo,in
R13503 T19038 T19037 arg1Of and,","
R13504 T19039 T19040 arg1Of loss,of
R13505 T19039 T19042 arg1Of loss,abrogates
R13506 T19041 T19040 arg2Of C/EBP-β,of
R13507 T19042 T19038 arg2Of abrogates,and
R13508 T19046 T19043 arg1Of transcription,constitutive
R13509 T19046 T19044 arg1Of transcription,SerpinB2
R13510 T19046 T19045 arg1Of transcription,gene
R13511 T19046 T19047 arg1Of transcription,and
R13512 T19047 T19042 arg2Of and,abrogates
R13513 T19049 T19047 arg2Of response,and
R13514 T19049 T19048 arg1Of response,the
R13515 T19049 T19050 arg1Of response,to
R13516 T19051 T19050 arg2Of LPS,to
R13517 T19057 T19052 arg1Of region,The
R13518 T19057 T19053 arg1Of region,murine
R13519 T19057 T19054 arg1Of region,SerpinB2
R13520 T19057 T19055 arg1Of region,proximal
R13521 T19057 T19056 arg1Of region,promoter
R13522 T19057 T19058 arg1Of region,between
R13523 T19057 T19063 arg1Of region,mediated
R13524 T19060 T19061 arg1Of -539,and
R13525 T19061 T19058 arg2Of and,between
R13526 T19061 T19059 arg1Of and,nucleotides
R13527 T19062 T19061 arg2Of +92,and
R13528 T19063 T19070 arg1Of mediated,","
R13529 T19063 T19071 arg1Of mediated,with
R13530 T19065 T19066 arg1Of PMA-,and
R13531 T19066 T19064 arg1Of and,both
R13532 T19067 T19066 arg2Of LPS-inducible,and
R13533 T19069 T19063 arg2Of transcription,mediated
R13534 T19069 T19065 arg1Of transcription,PMA-
R13535 T19069 T19067 arg1Of transcription,LPS-inducible
R13536 T19069 T19068 arg1Of transcription,gene
R13537 T19072 T19071 arg2Of induction,with
R13538 T19072 T19073 arg1Of induction,by
R13539 T19072 T19075 arg1Of induction,being
R13540 T19072 T19077 arg1Of induction,intense
R13541 T19072 T19080 arg1Of induction,transient
R13542 T19074 T19073 arg2Of PMA,by
R13543 T19075 T19071 arg3Of being,with
R13544 T19077 T19076 arg1Of intense,less
R13545 T19077 T19078 arg1Of intense,and
R13546 T19078 T19075 arg2Of and,being
R13547 T19078 T19081 arg1Of and,than
R13548 T19080 T19078 arg2Of transient,and
R13549 T19080 T19079 arg1Of transient,more
R13550 T19082 T19081 arg2Of that,than
R13551 T19082 T19083 arg1Of that,by
R13552 T19084 T19083 arg2Of LPS,by
R13553 T19085 T19086 arg1Of Inspection,of
R13554 T19085 T19093 arg1Of Inspection,shows
R13555 T19092 T19086 arg2Of sequence,of
R13556 T19092 T19087 arg1Of sequence,the
R13557 T19092 T19088 arg1Of sequence,murine
R13558 T19092 T19089 arg1Of sequence,SerpinB2
R13559 T19092 T19090 arg1Of sequence,proximal
R13560 T19092 T19091 arg1Of sequence,promoter
R13561 T19096 T19097 arg1Of CRE,and
R13562 T19097 T19095 arg1Of and,a
R13563 T19097 T19102 arg1Of and,demonstrated
R13564 T19100 T19097 arg2Of elements,and
R13565 T19100 T19098 arg1Of elements,two
R13566 T19100 T19099 arg1Of elements,AP-1-like
R13567 T19102 T19093 arg2Of demonstrated,shows
R13568 T19102 T19094 arg1Of demonstrated,that
R13569 T19102 T19101 arg1Of demonstrated,","
R13570 T19104 T19103 arg1Of mediate,to
R13571 T19104 T19117 arg1Of mediate,are
R13572 T19104 T19118 arg1Of mediate,present
R13573 T19106 T19104 arg2Of transcription,mediate
R13574 T19106 T19105 arg1Of transcription,PMA-stimulated
R13575 T19106 T19107 arg1Of transcription,of
R13576 T19111 T19107 arg2Of gene,of
R13577 T19111 T19108 arg1Of gene,the
R13578 T19111 T19109 arg1Of gene,human
R13579 T19111 T19110 arg1Of gene,SERPINB2
R13580 T19111 T19112 arg1Of gene,[
R13581 T19113 T19112 arg2Of 37,[
R13582 T19114 T19112 arg3Of ],[
R13583 T19117 T19102 arg2Of are,demonstrated
R13584 T19117 T19115 arg1Of are,","
R13585 T19117 T19116 arg1Of are,also
R13586 T19118 T19117 arg2Of present,are
R13587 T19118 T19119 arg1Of present,in
R13588 T19124 T19119 arg2Of promoter,in
R13589 T19124 T19120 arg1Of promoter,the
R13590 T19124 T19121 arg1Of promoter,murine
R13591 T19124 T19122 arg1Of promoter,SerpinB2
R13592 T19124 T19123 arg1Of promoter,proximal
R13593 T19124 T19125 arg1Of promoter,between
R13594 T19127 T19128 arg1Of −189,and
R13595 T19128 T19125 arg2Of and,between
R13596 T19128 T19126 arg1Of and,nucleotides
R13597 T19129 T19128 arg2Of −87,and
R13598 T19131 T19130 arg1Of sites,These
R13599 T19131 T19132 arg1Of sites,may
R13600 T19131 T19135 arg1Of sites,play
R13601 T19135 T19132 arg2Of play,may
R13602 T19135 T19133 arg1Of play,therefore
R13603 T19135 T19134 arg1Of play,also
R13604 T19135 T19138 arg1Of play,in
R13605 T19137 T19135 arg2Of role,play
R13606 T19137 T19136 arg1Of role,a
R13607 T19139 T19138 arg2Of mediating,in
R13608 T19141 T19139 arg2Of transcription,mediating
R13609 T19141 T19140 arg1Of transcription,PMA-inducible
R13610 T19141 T19142 arg1Of transcription,of
R13611 T19146 T19142 arg2Of gene,of
R13612 T19146 T19143 arg1Of gene,the
R13613 T19146 T19144 arg1Of gene,murine
R13614 T19146 T19145 arg1Of gene,SerpinB2
R13615 T19147 T19149 arg1Of In,to
R13616 T19148 T19147 arg2Of contrast,In
R13617 T19151 T19147 arg3Of pattern,In
R13618 T19151 T19150 arg1Of pattern,the
R13619 T19151 T19152 arg1Of pattern,of
R13620 T19154 T19152 arg2Of increases,of
R13621 T19154 T19153 arg1Of increases,incremental
R13622 T19154 T19155 arg1Of increases,in
R13623 T19158 T19155 arg2Of activity,in
R13624 T19158 T19156 arg1Of activity,PMA-induced
R13625 T19158 T19157 arg1Of activity,transcriptional
R13626 T19158 T19159 arg2Of activity,conferred
R13627 T19161 T19159 arg1Of regions,conferred
R13628 T19161 T19160 arg2Of regions,by
R13629 T19161 T19162 arg1Of regions,of
R13630 T19166 T19162 arg2Of promoter,of
R13631 T19166 T19163 arg1Of promoter,the
R13632 T19166 T19164 arg1Of promoter,murine
R13633 T19166 T19165 arg1Of promoter,SerpinB2
R13634 T19166 T19167 arg1Of promoter,containing
R13635 T19169 T19167 arg2Of sites,containing
R13636 T19169 T19168 arg1Of sites,these
R13637 T19171 T19172 arg1Of most,of
R13638 T19171 T19176 arg1Of most,is
R13639 T19171 T19177 arg1Of most,dependent
R13640 T19175 T19172 arg2Of response,of
R13641 T19175 T19173 arg1Of response,the
R13642 T19175 T19174 arg1Of response,LPS-inducible
R13643 T19176 T19147 arg1Of is,In
R13644 T19176 T19170 arg1Of is,","
R13645 T19177 T19176 arg2Of dependent,is
R13646 T19177 T19178 arg1Of dependent,upon
R13647 T19181 T19178 arg2Of sequences,upon
R13648 T19181 T19179 arg1Of sequences,cis-acting
R13649 T19181 T19180 arg1Of sequences,regulatory
R13650 T19181 T19182 arg1Of sequences,in
R13651 T19184 T19182 arg2Of region,in
R13652 T19184 T19183 arg1Of region,the
R13653 T19184 T19185 arg1Of region,between
R13654 T19187 T19188 arg1Of −189,and
R13655 T19188 T19185 arg2Of and,between
R13656 T19188 T19186 arg1Of and,nucleotides
R13657 T19189 T19188 arg2Of −539,and
R13658 T19191 T19190 arg1Of responsiveness,LPS
R13659 T19191 T19193 arg1Of responsiveness,required
R13660 T19193 T19192 arg1Of required,absolutely
R13661 T19193 T19207 arg1Of required,","
R13662 T19193 T19208 arg1Of required,with
R13663 T19197 T19193 arg2Of site,required
R13664 T19197 T19194 arg1Of site,the
R13665 T19197 T19195 arg1Of site,C/EBP
R13666 T19197 T19196 arg1Of site,binding
R13667 T19197 T19198 arg1Of site,located
R13668 T19198 T19199 arg1Of located,in
R13669 T19201 T19199 arg2Of region,in
R13670 T19201 T19200 arg1Of region,the
R13671 T19201 T19202 arg1Of region,between
R13672 T19204 T19205 arg1Of −189,and
R13673 T19205 T19202 arg2Of and,between
R13674 T19205 T19203 arg1Of and,nucleotides
R13675 T19206 T19205 arg2Of −539,and
R13676 T19211 T19209 arg1Of CRE,the
R13677 T19211 T19210 arg1Of CRE,downstream
R13678 T19211 T19212 arg1Of CRE,and
R13679 T19213 T19212 arg2Of AP-1-like,and
R13680 T19214 T19208 arg2Of elements,with
R13681 T19214 T19211 arg1Of elements,CRE
R13682 T19214 T19213 arg1Of elements,AP-1-like
R13683 T19214 T19216 arg1Of elements,being
R13684 T19214 T19217 arg1Of elements,critical
R13685 T19216 T19208 arg3Of being,with
R13686 T19216 T19215 arg1Of being,also
R13687 T19217 T19216 arg2Of critical,being
R13688 T19219 T19218 arg2Of note,Of
R13689 T19221 T19222 arg1Of there,are
R13690 T19222 T19243 arg1Of are,and
R13691 T19224 T19222 arg2Of reports,are
R13692 T19224 T19223 arg1Of reports,previous
R13693 T19224 T19225 arg1Of reports,of
R13694 T19227 T19225 arg2Of interactions,of
R13695 T19227 T19226 arg1Of interactions,combinatorial
R13696 T19227 T19228 arg1Of interactions,between
R13697 T19229 T19230 arg1Of C/EBP-β,and
R13698 T19230 T19234 arg1Of and,(
R13699 T19230 T19237 arg1Of and,and
R13700 T19233 T19230 arg2Of proteins,and
R13701 T19233 T19231 arg1Of proteins,CRE
R13702 T19233 T19232 arg1Of proteins,binding
R13703 T19235 T19234 arg2Of CREB,(
R13704 T19236 T19234 arg3Of ),(
R13705 T19237 T19228 arg2Of and,between
R13706 T19238 T19237 arg2Of AP-1,and
R13707 T19238 T19239 arg1Of AP-1,[
R13708 T19240 T19239 arg2Of 63,[
R13709 T19241 T19239 arg3Of ],[
R13710 T19243 T19218 arg1Of and,Of
R13711 T19243 T19220 arg1Of and,","
R13712 T19243 T19242 arg1Of and,","
R13713 T19244 T19245 arg1Of C/EBP-β,has
R13714 T19244 T19246 arg1Of C/EBP-β,been
R13715 T19244 T19247 arg2Of C/EBP-β,reported
R13716 T19244 T19250 arg1Of C/EBP-β,interact
R13717 T19247 T19243 arg2Of reported,and
R13718 T19247 T19245 arg2Of reported,has
R13719 T19247 T19246 arg2Of reported,been
R13720 T19247 T19266 arg1Of reported,;
R13721 T19247 T19267 arg1Of reported,[
R13722 T19250 T19247 arg3Of interact,reported
R13723 T19250 T19248 arg1Of interact,to
R13724 T19250 T19249 arg1Of interact,physically
R13725 T19250 T19251 arg1Of interact,with
R13726 T19252 T19254 arg1Of AP-1,and
R13727 T19254 T19251 arg2Of and,with
R13728 T19254 T19253 arg1Of and,","
R13729 T19255 T19254 arg2Of NF-κB,and
R13730 T19255 T19256 modOf NF-κB,to
R13731 T19257 T19256 arg1Of promote,to
R13732 T19257 T19263 arg1Of promote,[
R13733 T19259 T19257 arg2Of expression,promote
R13734 T19259 T19258 arg1Of expression,gene
R13735 T19259 T19260 arg1Of expression,of
R13736 T19262 T19260 arg2Of mediators,of
R13737 T19262 T19261 arg1Of mediators,inflammatory
R13738 T19264 T19263 arg2Of 63,[
R13739 T19265 T19263 arg3Of ],[
R13740 T19268 T19267 arg2Of 66,[
R13741 T19269 T19267 arg3Of ],[
R13742 T19272 T19273 arg1Of CREB,has
R13743 T19272 T19274 arg1Of CREB,been
R13744 T19272 T19275 arg2Of CREB,shown
R13745 T19272 T19277 arg1Of CREB,control
R13746 T19275 T19270 arg1Of shown,Additionally
R13747 T19275 T19271 arg1Of shown,","
R13748 T19275 T19273 arg2Of shown,has
R13749 T19275 T19274 arg2Of shown,been
R13750 T19277 T19275 arg3Of control,shown
R13751 T19277 T19276 arg1Of control,to
R13752 T19277 T19283 arg1Of control,[
R13753 T19278 T19277 arg2Of transcription,control
R13754 T19278 T19279 arg1Of transcription,of
R13755 T19282 T19279 arg2Of gene,of
R13756 T19282 T19280 arg1Of gene,the
R13757 T19282 T19281 arg1Of gene,C/EBP-β
R13758 T19284 T19283 arg2Of 67,[
R13759 T19285 T19283 arg3Of ],[
R13760 T19288 T19286 arg2Of study,In
R13761 T19288 T19287 arg1Of study,this
R13762 T19290 T19291 arg1Of C/EBP-β,was
R13763 T19290 T19292 arg2Of C/EBP-β,found
R13764 T19290 T19294 arg1Of C/EBP-β,be
R13765 T19292 T19286 arg1Of found,In
R13766 T19292 T19289 arg1Of found,","
R13767 T19292 T19291 arg2Of found,was
R13768 T19294 T19292 arg3Of be,found
R13769 T19294 T19293 arg1Of be,to
R13770 T19297 T19294 arg2Of requirement,be
R13771 T19297 T19295 arg1Of requirement,a
R13772 T19297 T19296 arg1Of requirement,major
R13773 T19297 T19298 arg1Of requirement,for
R13774 T19300 T19301 arg1Of constitutive,and
R13775 T19302 T19301 arg2Of LPS-induced,and
R13776 T19305 T19298 arg2Of transcription,for
R13777 T19305 T19299 arg1Of transcription,both
R13778 T19305 T19300 arg1Of transcription,constitutive
R13779 T19305 T19302 arg1Of transcription,LPS-induced
R13780 T19305 T19303 arg1Of transcription,SerpinB2
R13781 T19305 T19304 arg1Of transcription,gene
R13782 T19312 T19306 arg2Of study,In
R13783 T19312 T19307 arg1Of study,a
R13784 T19312 T19308 arg1Of study,previous
R13785 T19312 T19309 arg1Of study,microarray
R13786 T19312 T19310 arg1Of study,expression
R13787 T19312 T19311 arg1Of study,profiling
R13788 T19314 T19315 arg1Of SerpinB2,was
R13789 T19314 T19316 arg2Of SerpinB2,identified
R13790 T19316 T19306 arg1Of identified,In
R13791 T19316 T19313 arg1Of identified,","
R13792 T19316 T19315 arg2Of identified,was
R13793 T19316 T19317 arg1Of identified,as
R13794 T19316 T19332 arg1Of identified,compared
R13795 T19318 T19317 arg2Of gene,as
R13796 T19318 T19319 arg2Of gene,whose
R13797 T19320 T19319 arg1Of induction,whose
R13798 T19320 T19321 arg1Of induction,in
R13799 T19320 T19325 arg1Of induction,by
R13800 T19320 T19329 arg1Of induction,was
R13801 T19320 T19331 arg1Of induction,impaired
R13802 T19324 T19321 arg2Of macrophages,in
R13803 T19324 T19322 arg1Of macrophages,C/EBP-β-deficient
R13804 T19324 T19323 arg1Of macrophages,peritoneal
R13805 T19326 T19327 arg1Of LPS,and
R13806 T19327 T19325 arg2Of and,by
R13807 T19328 T19327 arg2Of IFNγ,and
R13808 T19329 T19330 arg1Of was,severely
R13809 T19331 T19329 arg2Of impaired,was
R13810 T19333 T19332 arg2Of to,compared
R13811 T19335 T19333 arg2Of macrophages,to
R13812 T19335 T19334 arg1Of macrophages,wild-type
R13813 T19335 T19336 arg1Of macrophages,[
R13814 T19337 T19336 arg2Of 68,[
R13815 T19338 T19336 arg3Of ],[
R13816 T19341 T19339 arg1Of results,Our
R13817 T19341 T19340 arg1Of results,qPCR
R13818 T19341 T19342 arg1Of results,validate
R13819 T19342 T19345 arg1Of validate,","
R13820 T19342 T19346 arg1Of validate,as
R13821 T19344 T19342 arg2Of finding,validate
R13822 T19344 T19343 arg1Of finding,this
R13823 T19347 T19348 arg1Of we,found
R13824 T19348 T19346 arg2Of found,as
R13825 T19351 T19352 arg1Of constitutive,and
R13826 T19353 T19352 arg2Of LPS-inducible,and
R13827 T19356 T19350 arg1Of expression,both
R13828 T19356 T19351 arg1Of expression,constitutive
R13829 T19356 T19353 arg1Of expression,LPS-inducible
R13830 T19356 T19354 arg1Of expression,SerpinB2
R13831 T19356 T19355 arg1Of expression,mRNA
R13832 T19356 T19357 arg1Of expression,is
R13833 T19356 T19359 arg2Of expression,abrogated
R13834 T19356 T19366 arg1Of expression,emphasizing
R13835 T19359 T19348 arg2Of abrogated,found
R13836 T19359 T19349 arg1Of abrogated,that
R13837 T19359 T19357 arg2Of abrogated,is
R13838 T19359 T19358 arg1Of abrogated,significantly
R13839 T19359 T19360 arg1Of abrogated,in
R13840 T19359 T19365 arg1Of abrogated,","
R13841 T19359 T19366 modOf abrogated,emphasizing
R13842 T19362 T19361 arg1Of transduced,C/EBP-β-shRNA
R13843 T19364 T19360 arg2Of macrophages,in
R13844 T19364 T19362 arg1Of macrophages,transduced
R13845 T19364 T19363 arg1Of macrophages,peritoneal
R13846 T19368 T19366 arg2Of link,emphasizing
R13847 T19368 T19367 arg1Of link,the
R13848 T19368 T19369 arg1Of link,between
R13849 T19370 T19371 arg1Of C/EBP-β,and
R13850 T19372 T19371 arg2Of SerpinB2,and
R13851 T19374 T19369 arg2Of transcription,between
R13852 T19374 T19370 arg1Of transcription,C/EBP-β
R13853 T19374 T19372 arg1Of transcription,SerpinB2
R13854 T19374 T19373 arg1Of transcription,gene
R13855 T19377 T19376 arg1Of proteins,C/EBP
R13856 T19377 T19378 arg1Of proteins,can
R13857 T19377 T19379 arg1Of proteins,act
R13858 T19379 T19375 arg2Of act,While
R13859 T19379 T19378 arg2Of act,can
R13860 T19379 T19380 arg1Of act,as
R13861 T19382 T19383 arg1Of homodimers,or
R13862 T19383 T19380 arg2Of or,as
R13863 T19383 T19381 arg1Of or,either
R13864 T19383 T19385 arg1Of or,[
R13865 T19384 T19383 arg2Of heterodimers,or
R13866 T19386 T19385 arg2Of 63,[
R13867 T19387 T19385 arg3Of ],[
R13868 T19389 T19390 arg1Of we,identified
R13869 T19390 T19375 arg1Of identified,While
R13870 T19390 T19388 arg1Of identified,","
R13871 T19390 T19392 arg1Of identified,as
R13872 T19390 T19398 modOf identified,to
R13873 T19390 T19405 arg1Of identified,","
R13874 T19390 T19406 modOf identified,suggesting
R13875 T19391 T19390 arg2Of C/EBP-β,identified
R13876 T19397 T19392 arg2Of isoform,as
R13877 T19397 T19393 arg1Of isoform,the
R13878 T19397 T19394 arg1Of isoform,only
R13879 T19397 T19395 arg1Of isoform,LPS-inducible
R13880 T19397 T19396 arg1Of isoform,C/EBP
R13881 T19399 T19398 arg1Of bind,to
R13882 T19404 T19399 arg2Of element,bind
R13883 T19404 T19400 arg1Of element,the
R13884 T19404 T19401 arg1Of element,SerpinB2
R13885 T19404 T19402 arg1Of element,C/EBP
R13886 T19404 T19403 arg1Of element,response
R13887 T19409 T19406 arg2Of role,suggesting
R13888 T19409 T19407 arg1Of role,a
R13889 T19409 T19408 arg1Of role,predominant
R13890 T19409 T19410 arg1Of role,for
R13891 T19409 T19412 arg1Of role,in
R13892 T19411 T19410 arg2Of C/EBP-β,for
R13893 T19416 T19412 arg2Of expression,in
R13894 T19416 T19413 arg1Of expression,LPS-induced
R13895 T19416 T19414 arg1Of expression,SerpinB2
R13896 T19416 T19415 arg1Of expression,gene
R13897 T19417 T19422 arg1Of C/EBP-β,plays
R13898 T19420 T19419 arg2Of SerpinB2,like
R13899 T19422 T19418 arg1Of plays,","
R13900 T19422 T19419 arg1Of plays,like
R13901 T19422 T19421 arg1Of plays,","
R13902 T19422 T19426 arg1Of plays,in
R13903 T19422 T19428 arg1Of plays,","
R13904 T19422 T19429 arg1Of plays,as
R13905 T19422 T19445 arg1Of plays,;
R13906 T19422 T19446 arg1Of plays,[
R13907 T19425 T19422 arg2Of role,plays
R13908 T19425 T19423 arg1Of role,an
R13909 T19425 T19424 arg1Of role,important
R13910 T19427 T19426 arg2Of inflammation,in
R13911 T19430 T19431 arg1Of it,is
R13912 T19430 T19432 arg2Of it,upregulated
R13913 T19432 T19429 arg2Of upregulated,as
R13914 T19432 T19431 arg2Of upregulated,is
R13915 T19434 T19435 arg1Of LPS,and
R13916 T19435 T19432 arg1Of and,upregulated
R13917 T19435 T19433 arg2Of and,by
R13918 T19437 T19435 arg2Of host,and
R13919 T19437 T19436 arg1Of host,a
R13920 T19437 T19438 arg1Of host,of
R13921 T19441 T19438 arg2Of cytokines,of
R13922 T19441 T19439 arg1Of cytokines,other
R13923 T19441 T19440 arg1Of cytokines,inflammatory
R13924 T19441 T19442 arg1Of cytokines,[
R13925 T19443 T19442 arg2Of 59,[
R13926 T19444 T19442 arg3Of ],[
R13927 T19447 T19446 arg2Of 62,[
R13928 T19448 T19446 arg3Of ],[
R13929 T19452 T19451 arg1Of mice,C/EBP-β-null
R13930 T19452 T19453 arg1Of mice,are
R13931 T19452 T19454 arg1Of mice,susceptible
R13932 T19453 T19449 arg1Of are,Furthermore
R13933 T19453 T19450 arg1Of are,","
R13934 T19453 T19461 arg1Of are,;
R13935 T19453 T19462 arg1Of are,[
R13936 T19453 T19465 arg1Of are,and
R13937 T19454 T19453 arg2Of susceptible,are
R13938 T19454 T19455 arg1Of susceptible,to
R13939 T19457 T19455 arg2Of infection,to
R13940 T19457 T19456 arg1Of infection,bacterial
R13941 T19457 T19458 arg1Of infection,[
R13942 T19459 T19458 arg2Of 69,[
R13943 T19460 T19458 arg3Of ],[
R13944 T19463 T19462 arg2Of 70,[
R13945 T19464 T19462 arg3Of ],[
R13946 T19466 T19467 arg1Of SerpinB2,has
R13947 T19466 T19468 arg1Of SerpinB2,been
R13948 T19466 T19469 arg2Of SerpinB2,demonstrated
R13949 T19466 T19471 arg1Of SerpinB2,protect
R13950 T19469 T19465 arg2Of demonstrated,and
R13951 T19469 T19467 arg2Of demonstrated,has
R13952 T19469 T19468 arg2Of demonstrated,been
R13953 T19471 T19469 arg3Of protect,demonstrated
R13954 T19471 T19470 arg1Of protect,to
R13955 T19471 T19472 arg1Of protect,from
R13956 T19471 T19478 arg1Of protect,[
R13957 T19471 T19482 arg1Of protect,[
R13958 T19471 T19485 arg1Of protect,;
R13959 T19471 T19486 arg1Of protect,[
R13960 T19473 T19474 arg1Of bacterial,and
R13961 T19475 T19474 arg2Of viral-induced,and
R13962 T19477 T19472 arg2Of death,from
R13963 T19477 T19473 arg1Of death,bacterial
R13964 T19477 T19475 arg1Of death,viral-induced
R13965 T19477 T19476 arg1Of death,cell
R13966 T19479 T19478 arg2Of 14,[
R13967 T19480 T19478 arg3Of ],[
R13968 T19481 T19471 arg2Of –,protect
R13969 T19483 T19482 arg2Of 16,[
R13970 T19484 T19482 arg3Of ],[
R13971 T19487 T19486 arg2Of 25,[
R13972 T19488 T19486 arg3Of ],[
R13973 T19491 T19490 arg1Of regulation,the
R13974 T19491 T19492 arg1Of regulation,of
R13975 T19491 T19496 arg1Of regulation,by
R13976 T19491 T19498 arg1Of regulation,is
R13977 T19491 T19499 arg1Of regulation,consistent
R13978 T19495 T19492 arg2Of expression,of
R13979 T19495 T19493 arg1Of expression,SerpinB2
R13980 T19495 T19494 arg1Of expression,gene
R13981 T19497 T19496 arg2Of C/EBP-β,by
R13982 T19498 T19489 arg1Of is,Thus
R13983 T19499 T19498 arg2Of consistent,is
R13984 T19499 T19500 arg1Of consistent,with
R13985 T19503 T19500 arg2Of role,with
R13986 T19503 T19501 arg1Of role,its
R13987 T19503 T19502 arg1Of role,functional
R13988 T19503 T19504 arg1Of role,in
R13989 T19505 T19504 arg2Of inflammation,in
R13990 T19506 T19507 arg1Of Phosphorylation,of
R13991 T19506 T19509 arg1Of Phosphorylation,at
R13992 T19506 T19515 arg1Of Phosphorylation,has
R13993 T19506 T19516 arg1Of Phosphorylation,been
R13994 T19506 T19517 arg2Of Phosphorylation,shown
R13995 T19506 T19519 arg1Of Phosphorylation,modulate
R13996 T19508 T19507 arg2Of C/EBP-β,of
R13997 T19514 T19509 arg2Of residues,at
R13998 T19514 T19510 arg1Of residues,several
R13999 T19514 T19511 arg1Of residues,different
R14000 T19514 T19512 arg1Of residues,amino
R14001 T19514 T19513 arg1Of residues,acid
R14002 T19517 T19515 arg2Of shown,has
R14003 T19517 T19516 arg2Of shown,been
R14004 T19517 T19528 arg1Of shown,;
R14005 T19519 T19517 arg3Of modulate,shown
R14006 T19519 T19518 arg1Of modulate,to
R14007 T19520 T19519 arg2Of transactivation,modulate
R14008 T19520 T19521 arg1Of transactivation,of
R14009 T19524 T19521 arg2Of genes,of
R14010 T19524 T19522 arg1Of genes,its
R14011 T19524 T19523 arg1Of genes,target
R14012 T19524 T19525 arg1Of genes,[
R14013 T19526 T19525 arg2Of 63,[
R14014 T19527 T19525 arg3Of ],[
R14015 T19529 T19530 arg2Of C/EBP-β,phosphorylated
R14016 T19529 T19533 arg1Of C/EBP-β,has
R14017 T19529 T19534 arg1Of C/EBP-β,been
R14018 T19529 T19535 arg2Of C/EBP-β,reported
R14019 T19529 T19537 arg1Of C/EBP-β,rescue
R14020 T19530 T19531 arg1Of phosphorylated,on
R14021 T19532 T19531 arg2Of T217,on
R14022 T19535 T19533 arg2Of reported,has
R14023 T19535 T19534 arg2Of reported,been
R14024 T19537 T19535 arg3Of rescue,reported
R14025 T19537 T19536 arg1Of rescue,to
R14026 T19537 T19539 arg1Of rescue,from
R14027 T19538 T19537 arg2Of macrophages,rescue
R14028 T19540 T19539 arg2Of apoptosis,from
R14029 T19540 T19541 arg2Of apoptosis,induced
R14030 T19546 T19541 arg1Of toxin,induced
R14031 T19546 T19542 arg2Of toxin,by
R14032 T19546 T19543 arg1Of toxin,Bacillus
R14033 T19546 T19544 arg1Of toxin,anthracis
R14034 T19546 T19545 arg1Of toxin,lethal
R14035 T19546 T19547 arg1Of toxin,(
R14036 T19546 T19550 arg1Of toxin,[
R14037 T19546 T19553 arg1Of toxin,","
R14038 T19548 T19547 arg2Of LT,(
R14039 T19549 T19547 arg3Of ),(
R14040 T19551 T19550 arg2Of 65,[
R14041 T19552 T19550 arg3Of ],[
R14042 T19555 T19553 arg2Of activity,","
R14043 T19555 T19554 arg1Of activity,an
R14044 T19555 T19556 arg1Of activity,that
R14045 T19555 T19557 arg1Of activity,has
R14046 T19555 T19559 arg1Of activity,been
R14047 T19555 T19560 arg2Of activity,attributed
R14048 T19560 T19557 arg2Of attributed,has
R14049 T19560 T19558 arg1Of attributed,also
R14050 T19560 T19559 arg2Of attributed,been
R14051 T19560 T19561 arg1Of attributed,to
R14052 T19562 T19561 arg2Of SerpinB2,to
R14053 T19562 T19563 arg1Of SerpinB2,[
R14054 T19564 T19563 arg2Of 16,[
R14055 T19565 T19563 arg3Of ],[
R14056 T19568 T19569 arg1Of expression,of
R14057 T19568 T19581 arg1Of expression,did
R14058 T19568 T19583 arg1Of expression,increase
R14059 T19573 T19569 arg2Of site,of
R14060 T19573 T19570 arg1Of site,a
R14061 T19573 T19571 arg1Of site,C/EBP-β
R14062 T19573 T19572 arg1Of site,phospho-acceptor
R14063 T19573 T19574 arg1Of site,mutant
R14064 T19573 T19575 arg1Of site,","
R14065 T19576 T19575 arg2Of C/EBPβT217A,","
R14066 T19580 T19578 arg2Of MEFs,in
R14067 T19580 T19579 arg1Of MEFs,Cebpb−/−
R14068 T19583 T19566 arg1Of increase,However
R14069 T19583 T19567 arg1Of increase,","
R14070 T19583 T19577 arg1Of increase,","
R14071 T19583 T19578 arg1Of increase,in
R14072 T19583 T19581 arg2Of increase,did
R14073 T19583 T19582 arg1Of increase,not
R14074 T19583 T19588 arg1Of increase,over
R14075 T19583 T19593 arg1Of increase,","
R14076 T19583 T19595 arg1Of increase,though
R14077 T19587 T19583 arg2Of activity,increase
R14078 T19587 T19584 arg1Of activity,SerpinB2
R14079 T19587 T19585 arg1Of activity,proximal
R14080 T19587 T19586 arg1Of activity,promoter
R14081 T19589 T19588 arg2Of that,over
R14082 T19589 T19590 arg1Of that,of
R14083 T19592 T19590 arg2Of C/EBP-β,of
R14084 T19592 T19591 arg1Of C/EBP-β,wild-type
R14085 T19595 T19594 arg1Of though,even
R14086 T19596 T19597 arg1Of recruitment,of
R14087 T19596 T19599 arg1Of recruitment,to
R14088 T19596 T19603 arg1Of recruitment,was
R14089 T19596 T19604 arg2Of recruitment,observed
R14090 T19596 T19606 arg1Of recruitment,decrease
R14091 T19598 T19597 arg2Of C/EBP-βT217,of
R14092 T19602 T19599 arg2Of promoter,to
R14093 T19602 T19600 arg1Of promoter,the
R14094 T19602 T19601 arg1Of promoter,SerpinB2
R14095 T19604 T19595 arg2Of observed,though
R14096 T19604 T19603 arg2Of observed,was
R14097 T19606 T19604 arg3Of decrease,observed
R14098 T19606 T19605 arg1Of decrease,to
R14099 T19609 T19606 arg2Of stimulation,decrease
R14100 T19609 T19607 arg1Of stimulation,following
R14101 T19609 T19608 arg1Of stimulation,LPS
R14102 T19609 T19610 arg1Of stimulation,of
R14103 T19612 T19610 arg2Of cells,of
R14104 T19612 T19611 arg1Of cells,RAW264.7
R14105 T19614 T19613 arg1Of data,These
R14106 T19614 T19615 arg1Of data,indicate
R14107 T19620 T19617 arg1Of site,the
R14108 T19620 T19618 arg1Of site,T217
R14109 T19620 T19619 arg1Of site,phospho-acceptor
R14110 T19620 T19621 arg1Of site,is
R14111 T19620 T19623 arg1Of site,important
R14112 T19621 T19615 arg2Of is,indicate
R14113 T19621 T19616 arg1Of is,that
R14114 T19621 T19622 arg1Of is,not
R14115 T19623 T19621 arg2Of important,is
R14116 T19623 T19624 arg1Of important,for
R14117 T19626 T19624 arg2Of regulation,for
R14118 T19626 T19625 arg1Of regulation,the
R14119 T19626 T19627 arg1Of regulation,of
R14120 T19630 T19627 arg2Of expression,of
R14121 T19630 T19628 arg1Of expression,SerpinB2
R14122 T19630 T19629 arg1Of expression,gene
R14123 T19633 T19634 arg1Of expression,of
R14124 T19633 T19643 arg1Of expression,did
R14125 T19633 T19645 arg1Of expression,affect
R14126 T19638 T19634 arg2Of site,of
R14127 T19638 T19635 arg1Of site,the
R14128 T19638 T19636 arg1Of site,C/EBP-β
R14129 T19638 T19637 arg1Of site,phospho-acceptor
R14130 T19638 T19639 arg1Of site,mutant
R14131 T19638 T19640 arg1Of site,","
R14132 T19641 T19640 arg2Of C/EBP-βT188A,","
R14133 T19645 T19631 arg1Of affect,Similarly
R14134 T19645 T19632 arg1Of affect,","
R14135 T19645 T19642 arg1Of affect,","
R14136 T19645 T19643 arg2Of affect,did
R14137 T19645 T19644 arg1Of affect,not
R14138 T19645 T19649 arg1Of affect,differently
R14139 T19645 T19650 arg1Of affect,from
R14140 T19648 T19645 arg2Of activity,affect
R14141 T19648 T19646 arg1Of activity,SerpinB2
R14142 T19648 T19647 arg1Of activity,promoter
R14143 T19651 T19650 arg2Of that,from
R14144 T19651 T19652 arg1Of that,of
R14145 T19653 T19652 arg2Of wild-type,of
R14146 T19655 T19654 arg2Of contrast,In
R14147 T19657 T19658 arg1Of expression,of
R14148 T19657 T19661 arg1Of expression,enhanced
R14149 T19659 T19658 arg2Of C/EBP-βS64A,of
R14150 T19661 T19654 arg1Of enhanced,In
R14151 T19661 T19656 arg1Of enhanced,","
R14152 T19661 T19660 arg1Of enhanced,significantly
R14153 T19661 T19666 arg1Of enhanced,","
R14154 T19665 T19661 arg2Of activity,enhanced
R14155 T19665 T19662 arg1Of activity,LPS-induced
R14156 T19665 T19663 arg1Of activity,SerpinB2
R14157 T19665 T19664 arg1Of activity,promoter
R14158 T19667 T19661 arg3Of indicating,enhanced
R14159 T19669 T19670 arg1Of phosphorylation,of
R14160 T19669 T19672 arg1Of phosphorylation,at
R14161 T19669 T19675 arg1Of phosphorylation,regulates
R14162 T19671 T19670 arg2Of C/EBP-β,of
R14163 T19673 T19672 arg2Of S64,at
R14164 T19675 T19667 arg2Of regulates,indicating
R14165 T19675 T19668 arg1Of regulates,that
R14166 T19675 T19674 arg1Of regulates,negatively
R14167 T19679 T19675 arg2Of activity,regulates
R14168 T19679 T19676 arg1Of activity,LPS-induced
R14169 T19679 T19677 arg1Of activity,SerpinB2
R14170 T19679 T19678 arg1Of activity,promoter
R14171 T19682 T19681 arg1Of S64,C/EBP-β
R14172 T19682 T19683 arg1Of S64,is
R14173 T19682 T19685 arg2Of S64,phosphorylated
R14174 T19685 T19680 arg2Of phosphorylated,Since
R14175 T19685 T19683 arg2Of phosphorylated,is
R14176 T19685 T19684 arg1Of phosphorylated,constitutively
R14177 T19685 T19686 arg1Of phosphorylated,in
R14178 T19689 T19687 arg1Of cells,both
R14179 T19689 T19688 arg1Of cells,RAW264.7
R14180 T19689 T19690 arg1Of cells,and
R14181 T19690 T19686 arg2Of and,in
R14182 T19691 T19690 arg2Of MEFs,and
R14183 T19691 T19692 arg1Of MEFs,[
R14184 T19693 T19692 arg2Of 73,[
R14185 T19694 T19692 arg3Of ],[
R14186 T19697 T19680 arg1Of is,Since
R14187 T19697 T19695 arg1Of is,","
R14188 T19698 T19697 arg2Of likely,is
R14189 T19700 T19701 arg1Of dephosphorylation,at
R14190 T19700 T19704 arg1Of dephosphorylation,may
R14191 T19700 T19705 arg1Of dephosphorylation,be
R14192 T19703 T19701 arg2Of site,at
R14193 T19703 T19702 arg1Of site,this
R14194 T19705 T19698 arg2Of be,likely
R14195 T19705 T19699 arg1Of be,that
R14196 T19705 T19704 arg2Of be,may
R14197 T19705 T19709 arg1Of be,during
R14198 T19708 T19705 arg2Of event,be
R14199 T19708 T19706 arg1Of event,a
R14200 T19708 T19707 arg1Of event,critical
R14201 T19711 T19709 arg2Of transcription,during
R14202 T19711 T19710 arg1Of transcription,LPS-induced
R14203 T19711 T19712 arg1Of transcription,of
R14204 T19713 T19712 arg2Of SerpinB2,of
R14205 T19715 T19696 arg1Of increase,it
R14206 T19715 T19697 arg1Of increase,is
R14207 T19715 T19698 arg1Of increase,likely
R14208 T19715 T19714 arg1Of increase,to
R14209 T19718 T19715 arg2Of activity,increase
R14210 T19718 T19716 arg1Of activity,its
R14211 T19718 T19717 arg1Of activity,promoter
R14212 T19719 T19720 arg1Of Roy,and
R14213 T19720 T19722 arg1Of and,demonstrated
R14214 T19721 T19720 arg2Of colleagues,and
R14215 T19728 T19727 arg2Of MLK3,(
R14216 T19729 T19727 arg3Of ),(
R14217 T19731 T19724 arg1Of dephosphorylation,Mixed
R14218 T19731 T19725 arg1Of dephosphorylation,lineage
R14219 T19731 T19726 arg1Of dephosphorylation,kinase-3
R14220 T19731 T19727 arg1Of dephosphorylation,(
R14221 T19731 T19730 arg1Of dephosphorylation,-driven
R14222 T19731 T19732 arg1Of dephosphorylation,of
R14223 T19731 T19735 arg1Of dephosphorylation,was
R14224 T19731 T19736 arg1Of dephosphorylation,important
R14225 T19734 T19732 arg2Of S64,of
R14226 T19734 T19733 arg1Of S64,C/EBP-β
R14227 T19735 T19722 arg2Of was,demonstrated
R14228 T19735 T19723 arg1Of was,that
R14229 T19736 T19735 arg2Of important,was
R14230 T19736 T19737 arg1Of important,for
R14231 T19740 T19737 arg2Of pathways,for
R14232 T19740 T19738 arg1Of pathways,IFNγ-regulated
R14233 T19740 T19739 arg1Of pathways,signaling
R14234 T19740 T19741 arg1Of pathways,[
R14235 T19742 T19741 arg2Of 73,[
R14236 T19743 T19741 arg3Of ],[
R14237 T19745 T19744 arg1Of data,Our
R14238 T19745 T19746 arg1Of data,suggest
R14239 T19749 T19748 arg1Of dephosphorylation,MLK3-driven
R14240 T19749 T19750 arg1Of dephosphorylation,of
R14241 T19749 T19752 arg1Of dephosphorylation,may
R14242 T19749 T19754 arg1Of dephosphorylation,be
R14243 T19749 T19755 arg2Of dephosphorylation,involved
R14244 T19751 T19750 arg2Of S64,of
R14245 T19755 T19746 arg2Of involved,suggest
R14246 T19755 T19747 arg1Of involved,that
R14247 T19755 T19752 arg2Of involved,may
R14248 T19755 T19753 arg1Of involved,also
R14249 T19755 T19754 arg2Of involved,be
R14250 T19755 T19756 arg1Of involved,in
R14251 T19758 T19756 arg2Of pathways,in
R14252 T19758 T19757 arg1Of pathways,LPS-signaling
R14253 T19761 T19759 arg2Of years,In
R14254 T19761 T19760 arg1Of years,recent
R14255 T19764 T19759 arg1Of become,In
R14256 T19764 T19763 arg2Of become,has
R14257 T19765 T19764 arg2Of apparent,become
R14258 T19768 T19767 arg1Of infection,persistent
R14259 T19768 T19769 arg1Of infection,is
R14260 T19768 T19771 arg2Of infection,linked
R14261 T19771 T19769 arg2Of linked,is
R14262 T19771 T19770 arg1Of linked,integrally
R14263 T19771 T19772 arg1Of linked,to
R14264 T19771 T19778 arg1Of linked,and
R14265 T19774 T19775 arg1Of inflammation,and
R14266 T19775 T19772 arg2Of and,to
R14267 T19775 T19773 arg1Of and,chronic
R14268 T19776 T19775 arg2Of cancer,and
R14269 T19778 T19762 arg1Of and,it
R14270 T19778 T19763 arg1Of and,has
R14271 T19778 T19764 arg1Of and,become
R14272 T19778 T19765 arg1Of and,apparent
R14273 T19778 T19766 arg1Of and,that
R14274 T19778 T19777 arg1Of and,","
R14275 T19780 T19779 arg1Of cells,immune
R14276 T19780 T19782 arg1Of cells,as
R14277 T19780 T19784 arg1Of cells,can
R14278 T19780 T19786 arg1Of cells,promote
R14279 T19780 T19788 arg1Of cells,attenuate
R14280 T19782 T19781 arg1Of as,such
R14281 T19783 T19782 arg2Of macrophages,as
R14282 T19786 T19787 arg1Of promote,or
R14283 T19787 T19778 arg2Of or,and
R14284 T19787 T19784 arg2Of or,can
R14285 T19787 T19785 arg1Of or,either
R14286 T19788 T19787 arg2Of attenuate,or
R14287 T19790 T19789 arg1Of progression,cancer
R14288 T19790 T19791 arg1Of progression,[
R14289 T19790 T19794 arg1Of progression,;
R14290 T19792 T19791 arg2Of 2,[
R14291 T19793 T19791 arg3Of ],[
R14292 T19794 T19786 arg2Of ;,promote
R14293 T19794 T19788 arg2Of ;,attenuate
R14294 T19796 T19795 arg2Of 74,[
R14295 T19797 T19795 arg3Of ],[
R14296 T19798 T19794 arg2Of –,;
R14297 T19798 T19795 arg1Of –,[
R14298 T19798 T19799 arg1Of –,[
R14299 T19800 T19799 arg2Of 76,[
R14300 T19801 T19799 arg3Of ],[
R14301 T19803 T19802 arg1Of expression,SerpinB2
R14302 T19803 T19804 arg1Of expression,has
R14303 T19803 T19805 arg1Of expression,been
R14304 T19803 T19806 arg2Of expression,associated
R14305 T19803 T19814 arg1Of expression,is
R14306 T19806 T19804 arg2Of associated,has
R14307 T19806 T19805 arg2Of associated,been
R14308 T19806 T19807 arg1Of associated,with
R14309 T19806 T19813 arg1Of associated,and
R14310 T19809 T19810 arg1Of inflammation,and
R14311 T19810 T19807 arg2Of and,with
R14312 T19810 T19808 arg1Of and,both
R14313 T19811 T19810 arg2Of cancer,and
R14314 T19813 T19812 arg1Of and,","
R14315 T19813 T19825 arg1Of and,[
R14316 T19814 T19813 arg2Of is,and
R14317 T19814 T19821 arg1Of is,depending
R14318 T19816 T19817 arg1Of favorable,or
R14319 T19818 T19817 arg2Of unfavorable,or
R14320 T19820 T19814 arg2Of indicator,is
R14321 T19820 T19815 arg1Of indicator,a
R14322 T19820 T19816 arg1Of indicator,favorable
R14323 T19820 T19818 arg1Of indicator,unfavorable
R14324 T19820 T19819 arg1Of indicator,prognostic
R14325 T19822 T19821 arg2Of on,depending
R14326 T19824 T19822 arg2Of type,on
R14327 T19824 T19823 arg1Of type,cancer
R14328 T19826 T19825 arg2Of 77,[
R14329 T19827 T19825 arg3Of ],[
R14330 T19829 T19828 arg1Of presence,The
R14331 T19829 T19830 arg1Of presence,of
R14332 T19829 T19832 arg1Of presence,has
R14333 T19829 T19833 arg1Of presence,been
R14334 T19829 T19834 arg2Of presence,shown
R14335 T19829 T19836 arg1Of presence,modulate
R14336 T19831 T19830 arg2Of SerpinB2,of
R14337 T19834 T19832 arg2Of shown,has
R14338 T19834 T19833 arg2Of shown,been
R14339 T19836 T19834 arg3Of modulate,shown
R14340 T19836 T19835 arg1Of modulate,to
R14341 T19838 T19836 arg2Of profiles,modulate
R14342 T19838 T19837 arg1Of profiles,cytokine
R14343 T19838 T19839 arg1Of profiles,which
R14344 T19838 T19840 arg1Of profiles,can
R14345 T19838 T19841 arg1Of profiles,affect
R14346 T19841 T19840 arg2Of affect,can
R14347 T19841 T19845 arg1Of affect,[
R14348 T19841 T19848 arg1Of affect,;
R14349 T19841 T19849 arg1Of affect,[
R14350 T19841 T19852 arg1Of affect,;
R14351 T19841 T19853 arg1Of affect,[
R14352 T19841 T19856 arg1Of affect,;
R14353 T19841 T19857 arg1Of affect,[
R14354 T19844 T19841 arg2Of polarization,affect
R14355 T19844 T19842 arg1Of polarization,immune
R14356 T19844 T19843 arg1Of polarization,cell
R14357 T19846 T19845 arg2Of 27,[
R14358 T19847 T19845 arg3Of ],[
R14359 T19850 T19849 arg2Of 28,[
R14360 T19851 T19849 arg3Of ],[
R14361 T19854 T19853 arg2Of 77,[
R14362 T19855 T19853 arg3Of ],[
R14363 T19858 T19857 arg2Of 78,[
R14364 T19859 T19857 arg3Of ],[
R14365 T19861 T19862 arg1Of C/EBP-β,has
R14366 T19861 T19864 arg1Of C/EBP-β,been
R14367 T19861 T19865 arg2Of C/EBP-β,shown
R14368 T19861 T19867 arg1Of C/EBP-β,modulate
R14369 T19861 T19875 arg1Of C/EBP-β,modifying
R14370 T19865 T19860 arg1Of shown,Interestingly
R14371 T19865 T19862 arg2Of shown,has
R14372 T19865 T19863 arg1Of shown,also
R14373 T19865 T19864 arg2Of shown,been
R14374 T19867 T19865 arg3Of modulate,shown
R14375 T19867 T19866 arg1Of modulate,to
R14376 T19867 T19870 arg1Of modulate,from
R14377 T19867 T19873 arg1Of modulate,","
R14378 T19867 T19875 modOf modulate,modifying
R14379 T19867 T19886 arg1Of modulate,[
R14380 T19869 T19867 arg2Of secretion,modulate
R14381 T19869 T19868 arg1Of secretion,cytokine
R14382 T19872 T19870 arg2Of cells,from
R14383 T19872 T19871 arg1Of cells,immune
R14384 T19875 T19874 arg1Of modifying,thereby
R14385 T19875 T19881 arg1Of modifying,;
R14386 T19875 T19882 arg1Of modifying,[
R14387 T19877 T19875 arg2Of phenotype,modifying
R14388 T19877 T19876 arg1Of phenotype,their
R14389 T19877 T19878 arg1Of phenotype,[
R14390 T19879 T19878 arg2Of 27,[
R14391 T19880 T19878 arg3Of ],[
R14392 T19883 T19882 arg2Of 79,[
R14393 T19884 T19882 arg3Of ],[
R14394 T19885 T19867 arg3Of –,modulate
R14395 T19887 T19886 arg2Of 81,[
R14396 T19888 T19886 arg3Of ],[
R14397 T19890 T19889 arg1Of study,Our
R14398 T19890 T19891 arg1Of study,has
R14399 T19890 T19892 arg1Of study,demonstrated
R14400 T19892 T19891 arg2Of demonstrated,has
R14401 T19894 T19895 arg1Of C/EBP-β,plays
R14402 T19895 T19892 arg2Of plays,demonstrated
R14403 T19895 T19893 arg1Of plays,that
R14404 T19898 T19895 arg2Of role,plays
R14405 T19898 T19896 arg1Of role,an
R14406 T19898 T19897 arg1Of role,important
R14407 T19898 T19899 arg1Of role,in
R14408 T19898 T19910 arg1Of role,","
R14409 T19898 T19911 arg1Of role,which
R14410 T19898 T19912 arg1Of role,may
R14411 T19898 T19913 arg1Of role,have
R14412 T19900 T19899 arg2Of mediating,in
R14413 T19902 T19903 arg1Of constitutive,and
R14414 T19903 T19901 arg1Of and,both
R14415 T19904 T19903 arg2Of LPS-induced,and
R14416 T19905 T19900 arg2Of transcription,mediating
R14417 T19905 T19902 arg1Of transcription,constitutive
R14418 T19905 T19904 arg1Of transcription,LPS-induced
R14419 T19905 T19906 arg1Of transcription,of
R14420 T19909 T19906 arg2Of gene,of
R14421 T19909 T19907 arg1Of gene,the
R14422 T19909 T19908 arg1Of gene,SerpinB2
R14423 T19913 T19912 arg2Of have,may
R14424 T19914 T19913 arg2Of implications,have
R14425 T19914 T19915 arg1Of implications,for
R14426 T19918 T19915 arg2Of phenotype,for
R14427 T19918 T19916 arg1Of phenotype,the
R14428 T19918 T19917 arg1Of phenotype,inflammatory
R14429 T19918 T19919 arg1Of phenotype,of
R14430 T19920 T19919 arg2Of infiltrating,of
R14431 T19920 T19923 arg1Of infiltrating,in
R14432 T19922 T19920 arg2Of cells,infiltrating
R14433 T19922 T19921 arg1Of cells,immune
R14434 T19926 T19923 arg2Of microenvironment,in
R14435 T19926 T19924 arg1Of microenvironment,the
R14436 T19926 T19925 arg1Of microenvironment,tumor
R14437 T19928 T19927 arg2Of summary,In
R14438 T19931 T19930 arg1Of studies,our
R14439 T19931 T19932 arg1Of studies,show
R14440 T19932 T19927 arg1Of show,In
R14441 T19932 T19929 arg1Of show,","
R14442 T19936 T19934 arg1Of site,the
R14443 T19936 T19935 arg1Of site,C/EBP
R14444 T19936 T19937 arg1Of site,(
R14445 T19936 T19940 arg1Of site,in
R14446 T19936 T19946 arg1Of site,is
R14447 T19936 T19947 arg1Of site,necessary
R14448 T19938 T19937 arg2Of −203/−195,(
R14449 T19939 T19937 arg3Of ),(
R14450 T19945 T19940 arg2Of promoter,in
R14451 T19945 T19941 arg1Of promoter,the
R14452 T19945 T19942 arg1Of promoter,murine
R14453 T19945 T19943 arg1Of promoter,SerpinB2
R14454 T19945 T19944 arg1Of promoter,proximal
R14455 T19946 T19932 arg2Of is,show
R14456 T19946 T19933 arg1Of is,that
R14457 T19947 T19946 arg2Of necessary,is
R14458 T19949 T19947 arg2Of support,necessary
R14459 T19949 T19948 arg1Of support,to
R14460 T19951 T19952 arg1Of constitutive,and
R14461 T19953 T19952 arg2Of LPS-induced,and
R14462 T19956 T19949 arg2Of expression,support
R14463 T19956 T19950 arg1Of expression,both
R14464 T19956 T19951 arg1Of expression,constitutive
R14465 T19956 T19953 arg1Of expression,LPS-induced
R14466 T19956 T19954 arg1Of expression,SerpinB2
R14467 T19956 T19955 arg1Of expression,gene
R14468 T19959 T19960 arg1Of we,were
R14469 T19959 T19961 arg1Of we,able
R14470 T19959 T19963 arg1Of we,uncover
R14471 T19960 T19957 arg1Of were,Importantly
R14472 T19960 T19958 arg1Of were,","
R14473 T19961 T19960 arg2Of able,were
R14474 T19963 T19961 arg2Of uncover,able
R14475 T19963 T19962 arg1Of uncover,to
R14476 T19966 T19965 arg1Of unknown,previously
R14477 T19967 T19963 arg2Of role,uncover
R14478 T19967 T19964 arg1Of role,a
R14479 T19967 T19966 arg1Of role,unknown
R14480 T19967 T19968 arg1Of role,for
R14481 T19967 T19970 arg1Of role,in
R14482 T19969 T19968 arg2Of C/EBP-βS64,for
R14483 T19972 T19971 arg1Of regulating,negatively
R14484 T19975 T19970 arg2Of activity,in
R14485 T19975 T19972 arg1Of activity,regulating
R14486 T19975 T19973 arg1Of activity,SerpinB2
R14487 T19975 T19974 arg1Of activity,promoter
R14488 T19976 T19977 arg1Of Taken,together
R14489 T19979 T19978 arg1Of data,these
R14490 T19979 T19980 arg1Of data,provide
R14491 T19980 T19976 modOf provide,Taken
R14492 T19982 T19980 arg2Of insight,provide
R14493 T19982 T19981 arg1Of insight,new
R14494 T19982 T19983 arg1Of insight,into
R14495 T19985 T19983 arg2Of regulation,into
R14496 T19985 T19984 arg1Of regulation,the
R14497 T19985 T19986 arg1Of regulation,of
R14498 T19990 T19986 arg2Of expression,of
R14499 T19990 T19987 arg1Of expression,inflammation-associated
R14500 T19990 T19988 arg1Of expression,SerpinB2
R14501 T19990 T19989 arg1Of expression,gene
R16169 T22421 T22420 arg1Of induction,LPS
R16170 T22421 T22422 arg1Of induction,of
R16171 T22421 T22428 arg1Of induction,in
R16172 T22424 T22423 arg1Of mRNA,SerpinB2
R16173 T22424 T22425 arg1Of mRNA,and
R16174 T22425 T22422 arg2Of and,of
R16175 T22427 T22425 arg2Of expression,and
R16176 T22427 T22426 arg1Of expression,protein
R16177 T22431 T22428 arg2Of cells,in
R16178 T22431 T22429 arg1Of cells,murine
R16179 T22431 T22430 arg1Of cells,macrophage
R16180 T22433 T22432 arg1Of macrophages,RAW264.7
R16181 T22433 T22434 arg1Of macrophages,were
R16182 T22433 T22435 arg2Of macrophages,treated
R16183 T22435 T22434 arg2Of treated,were
R16184 T22435 T22436 arg1Of treated,for
R16185 T22438 T22439 arg1Of indicated,times
R16186 T22439 T22440 arg1Of times,with
R16187 T22441 T22442 arg1Of 100,ng/ml
R16188 T22443 T22440 arg2Of LPS.,with
R16189 T22443 T22441 arg1Of LPS.,100
R16190 T22443 T22444 arg1Of LPS.,(
R16191 T22445 T22444 arg2Of A,(
R16192 T22446 T22444 arg3Of ),(
R16193 T22448 T22436 arg2Of analysis,for
R16194 T22448 T22437 arg1Of analysis,the
R16195 T22448 T22438 arg2Of analysis,indicated
R16196 T22448 T22447 arg1Of analysis,qPCR
R16197 T22448 T22449 arg1Of analysis,of
R16198 T22453 T22449 arg2Of levels,of
R16199 T22453 T22450 arg1Of levels,murine
R16200 T22453 T22451 arg1Of levels,SerpinB2
R16201 T22453 T22452 arg1Of levels,mRNA
R16202 T22453 T22454 arg1Of levels,","
R16203 T22453 T22455 arg1Of levels,relative
R16204 T22455 T22456 arg1Of relative,to
R16205 T22457 T22456 arg2Of β-actin,to
R16206 T22459 T22458 arg1Of plot,The
R16207 T22459 T22460 arg1Of plot,is
R16208 T22459 T22461 arg1Of plot,representative
R16209 T22461 T22460 arg2Of representative,is
R16210 T22461 T22462 arg1Of representative,of
R16211 T22465 T22463 arg1Of two,at
R16212 T22465 T22464 arg1Of two,least
R16213 T22467 T22462 arg2Of experiments,of
R16214 T22467 T22465 arg1Of experiments,two
R16215 T22467 T22466 arg1Of experiments,independent
R16216 T22467 T22468 arg2Of experiments,performed
R16217 T22468 T22469 arg1Of performed,in
R16218 T22472 T22471 arg2Of B,(
R16219 T22473 T22471 arg3Of ),(
R16220 T22475 T22469 arg2Of analysis,in
R16221 T22475 T22470 arg1Of analysis,triplicate.
R16222 T22475 T22471 arg1Of analysis,(
R16223 T22475 T22474 arg1Of analysis,Immunoblot
R16224 T22475 T22476 arg1Of analysis,of
R16225 T22479 T22476 arg2Of expression,of
R16226 T22479 T22477 arg1Of expression,SerpinB2
R16227 T22479 T22478 arg1Of expression,protein
R16228 T22479 T22480 arg1Of expression,in
R16229 T22483 T22480 arg2Of lysates,in
R16230 T22483 T22481 arg1Of lysates,whole
R16231 T22483 T22482 arg1Of lysates,cell
R16232 T22484 T22485 arg1Of Blot,was
R16233 T22484 T22486 arg2Of Blot,reprobed
R16234 T22486 T22485 arg2Of reprobed,was
R16235 T22486 T22487 arg1Of reprobed,for
R16236 T22486 T22489 arg1Of reprobed,as
R16237 T22488 T22487 arg2Of GAPDH,for
R16238 T22492 T22489 arg2Of control,as
R16239 T22492 T22490 arg1Of control,a
R16240 T22492 T22491 arg1Of control,loading
R16349 T22731 T22728 arg1Of analysis,Deletion
R16350 T22731 T22729 arg1Of analysis,reporter
R16351 T22731 T22730 arg1Of analysis,gene
R16352 T22731 T22732 arg1Of analysis,of
R16353 T22731 T22737 arg1Of analysis,in
R16354 T22733 T22734 arg1Of LPS,and
R16355 T22734 T22732 arg2Of and,of
R16356 T22736 T22734 arg2Of regions,and
R16357 T22736 T22735 arg1Of regions,PMA-responsive
R16358 T22741 T22737 arg2Of promoter,in
R16359 T22741 T22738 arg1Of promoter,the
R16360 T22741 T22739 arg1Of promoter,murine
R16361 T22741 T22740 arg1Of promoter,SerpinB2
R16362 T22743 T22742 arg2Of A,(
R16363 T22744 T22742 arg3Of ),(
R16364 T22746 T22745 arg1Of representation,Schematic
R16365 T22746 T22747 arg1Of representation,of
R16366 T22746 T22752 arg1Of representation,and
R16367 T22751 T22747 arg2Of promoter,of
R16368 T22751 T22748 arg1Of promoter,the
R16369 T22751 T22749 arg1Of promoter,murine
R16370 T22751 T22750 arg1Of promoter,SerpinB2
R16371 T22752 T22742 arg1Of and,(
R16372 T22757 T22752 arg2Of constructs,and
R16373 T22757 T22753 arg1Of constructs,5′
R16374 T22757 T22754 arg1Of constructs,deletion
R16375 T22757 T22755 arg1Of constructs,luciferase
R16376 T22757 T22756 arg1Of constructs,reporter
R16377 T22762 T22758 arg1Of region,The
R16378 T22762 T22759 arg1Of region,murine
R16379 T22762 T22760 arg1Of region,5′
R16380 T22762 T22761 arg1Of region,flanking
R16381 T22762 T22763 arg1Of region,from
R16382 T22762 T22767 arg1Of region,was
R16383 T22762 T22768 arg2Of region,inserted
R16384 T22764 T22763 arg2Of −4480,from
R16385 T22764 T22765 arg1Of −4480,to
R16386 T22766 T22765 arg2Of +92,to
R16387 T22768 T22767 arg2Of inserted,was
R16388 T22768 T22769 arg1Of inserted,upstream
R16389 T22768 T22775 arg1Of inserted,and
R16390 T22769 T22770 arg1Of upstream,of
R16391 T22774 T22770 arg2Of gene,of
R16392 T22774 T22771 arg1Of gene,the
R16393 T22774 T22772 arg1Of gene,luciferase
R16394 T22774 T22773 arg1Of gene,reporter
R16395 T22777 T22776 arg1Of deletions,5′
R16396 T22777 T22778 arg1Of deletions,were
R16397 T22777 T22779 arg2Of deletions,generated
R16398 T22779 T22775 arg2Of generated,and
R16399 T22779 T22778 arg2Of generated,were
R16400 T22780 T22779 arg3Of using,generated
R16401 T22780 T22784 arg1Of using,or
R16402 T22780 T22785 arg1Of using,with
R16403 T22783 T22780 arg2Of sites,using
R16404 T22783 T22781 arg1Of sites,restriction
R16405 T22783 T22782 arg1Of sites,enzyme
R16406 T22789 T22785 arg2Of primers,with
R16407 T22789 T22786 arg1Of primers,specific
R16408 T22789 T22787 arg1Of primers,oligonucleotide
R16409 T22789 T22788 arg1Of primers,PCR
R16410 T22791 T22790 arg1Of names,Construct
R16411 T22791 T22792 arg1Of names,indicate
R16412 T22795 T22794 arg1Of 5′,most
R16413 T22796 T22793 arg1Of nucleotide,the
R16414 T22796 T22795 arg1Of nucleotide,5′
R16415 T22796 T22797 arg1Of nucleotide,of
R16416 T22796 T22809 arg1Of nucleotide,were
R16417 T22796 T22811 arg2Of nucleotide,transfected
R16418 T22804 T22803 arg2Of B,(
R16419 T22805 T22803 arg3Of ),(
R16420 T22808 T22797 arg2Of macrophages,of
R16421 T22808 T22798 arg1Of macrophages,murine
R16422 T22808 T22799 arg1Of macrophages,SerpinB2
R16423 T22808 T22800 arg1Of macrophages,5′
R16424 T22808 T22801 arg1Of macrophages,flanking
R16425 T22808 T22802 arg1Of macrophages,sequence.
R16426 T22808 T22803 arg1Of macrophages,(
R16427 T22808 T22806 arg1Of macrophages,RAW
R16428 T22808 T22807 arg1Of macrophages,264.7
R16429 T22811 T22792 arg2Of transfected,indicate
R16430 T22811 T22809 arg2Of transfected,were
R16431 T22811 T22810 arg1Of transfected,transiently
R16432 T22811 T22812 arg1Of transfected,with
R16433 T22819 T22814 arg2Of constructs,indicated
R16434 T22819 T22815 arg1Of constructs,murine
R16435 T22819 T22816 arg1Of constructs,SerpinB2
R16436 T22819 T22817 arg1Of constructs,promoter-luciferase
R16437 T22819 T22818 arg1Of constructs,reporter
R16438 T22819 T22820 arg1Of constructs,and
R16439 T22820 T22812 arg2Of and,with
R16440 T22820 T22813 arg1Of and,the
R16441 T22822 T22820 arg2Of plasmids,and
R16442 T22822 T22821 arg1Of plasmids,control
R16443 T22823 T22824 arg1Of Cells,were
R16444 T22823 T22827 arg1Of Cells,untreated
R16445 T22823 T22829 arg2Of Cells,treated
R16446 T22827 T22825 arg1Of untreated,either
R16447 T22827 T22826 arg1Of untreated,left
R16448 T22827 T22828 arg1Of untreated,or
R16449 T22828 T22824 arg2Of or,were
R16450 T22829 T22828 arg2Of treated,or
R16451 T22829 T22830 arg1Of treated,with
R16452 T22831 T22832 arg1Of 100,ng/ml
R16453 T22833 T22831 arg1Of LPS,100
R16454 T22833 T22834 arg1Of LPS,or
R16455 T22834 T22830 arg2Of or,with
R16456 T22834 T22838 arg1Of or,for
R16457 T22835 T22836 arg1Of 40,ng/ml
R16458 T22837 T22834 arg2Of PMA,or
R16459 T22837 T22835 arg1Of PMA,40
R16460 T22840 T22838 arg2Of hrs,for
R16461 T22840 T22839 arg1Of hrs,16
R16462 T22841 T22842 arg1Of Shown,is
R16463 T22848 T22842 arg2Of activity,is
R16464 T22848 T22843 arg1Of activity,the
R16465 T22848 T22844 arg1Of activity,relative
R16466 T22848 T22845 arg1Of activity,luciferase
R16467 T22848 T22846 arg1Of activity,reporter
R16468 T22848 T22847 arg1Of activity,gene
R16469 T22848 T22849 arg1Of activity,following
R16470 T22850 T22849 arg2Of treatment,following
R16471 T22852 T22851 arg1Of results,The
R16472 T22852 T22853 arg1Of results,represent
R16473 T22855 T22854 arg1Of mean,the
R16474 T22855 T22856 arg1Of mean,and
R16475 T22856 T22853 arg2Of and,represent
R16476 T22857 T22858 arg1Of SEM,of
R16477 T22861 T22858 arg2Of experiments.,of
R16478 T22861 T22859 arg1Of experiments.,four
R16479 T22861 T22860 arg1Of experiments.,independent
R16480 T22861 T22862 arg1Of experiments.,(
R16481 T22863 T22862 arg2Of C,(
R16482 T22864 T22862 arg3Of ),(
R16483 T22867 T22856 arg2Of conservation,and
R16484 T22867 T22857 arg1Of conservation,SEM
R16485 T22867 T22865 arg1Of conservation,DNA
R16486 T22867 T22866 arg1Of conservation,sequence
R16487 T22867 T22868 arg1Of conservation,between
R16488 T22870 T22871 arg1Of human,and
R16489 T22872 T22871 arg2Of murine,and
R16490 T22876 T22868 arg2Of regions,between
R16491 T22876 T22869 arg1Of regions,the
R16492 T22876 T22870 arg1Of regions,human
R16493 T22876 T22872 arg1Of regions,murine
R16494 T22876 T22873 arg1Of regions,SerpinB2
R16495 T22876 T22874 arg1Of regions,5′
R16496 T22876 T22875 arg1Of regions,flanking
R16497 T22878 T22877 arg1Of representation,Schematic
R16498 T22878 T22879 arg1Of representation,of
R16499 T22878 T22888 arg1Of representation,with
R16500 T22881 T22882 arg1Of human,and
R16501 T22883 T22882 arg2Of murine,and
R16502 T22887 T22879 arg2Of regions,of
R16503 T22887 T22880 arg1Of regions,the
R16504 T22887 T22881 arg1Of regions,human
R16505 T22887 T22883 arg1Of regions,murine
R16506 T22887 T22884 arg1Of regions,SerpinB2
R16507 T22887 T22885 arg1Of regions,5′
R16508 T22887 T22886 arg1Of regions,flanking
R16509 T22889 T22888 arg2Of regions,with
R16510 T22889 T22890 arg1Of regions,of
R16511 T22893 T22890 arg2Of identity,of
R16512 T22893 T22891 arg1Of identity,nucleotide
R16513 T22893 T22892 arg1Of identity,sequence
R16514 T22893 T22894 arg2Of identity,indicated
R16515 T22899 T22894 arg1Of boxes,indicated
R16516 T22899 T22895 arg2Of boxes,by
R16517 T22899 T22896 arg1Of boxes,the
R16518 T22899 T22897 arg1Of boxes,same
R16519 T22899 T22898 arg2Of boxes,colored
R16520 T22901 T22900 arg1Of regions,Homologous
R16521 T22901 T22902 arg1Of regions,are
R16522 T22901 T22903 arg2Of regions,interrupted
R16523 T22903 T22902 arg2Of interrupted,are
R16524 T22907 T22903 arg1Of elements,interrupted
R16525 T22907 T22904 arg2Of elements,by
R16526 T22907 T22905 arg1Of elements,repetitive
R16527 T22907 T22906 arg1Of elements,sequence
R16528 T22907 T22908 arg1Of elements,in
R16529 T22912 T22908 arg2Of regions,in
R16530 T22912 T22909 arg1Of regions,both
R16531 T22912 T22910 arg1Of regions,5′
R16532 T22912 T22911 arg1Of regions,flanking
R16533 T22914 T22913 arg1Of repeat,Alu = Alu
R16534 T22914 T22915 arg1Of repeat,","
R16535 T22915 T22925 arg1Of ",",","
R16536 T22921 T22915 arg2Of repeat,","
R16537 T22921 T22916 arg1Of repeat,ID4 = 
R16538 T22921 T22917 arg1Of repeat,ID4
R16539 T22921 T22918 arg1Of repeat,short
R16540 T22921 T22919 arg1Of repeat,interspersed
R16541 T22921 T22920 arg1Of repeat,nuclear
R16542 T22921 T22922 arg1Of repeat,(
R16543 T22923 T22922 arg2Of SINE,(
R16544 T22924 T22922 arg3Of ),(
R16545 T22925 T22935 arg1Of ",",","
R16546 T22929 T22926 arg1Of interspersed,L1 = 
R16547 T22929 T22927 arg1Of interspersed,L1
R16548 T22929 T22928 arg1Of interspersed,long
R16549 T22931 T22925 arg2Of element,","
R16550 T22931 T22929 arg1Of element,interspersed
R16551 T22931 T22930 arg1Of element,nuclear
R16552 T22931 T22932 arg1Of element,(
R16553 T22933 T22932 arg2Of LINE,(
R16554 T22934 T22932 arg3Of ),(
R16555 T22938 T22935 arg2Of LINE,","
R16556 T22938 T22936 arg1Of LINE,L2 = 
R16557 T22938 T22937 arg1Of LINE,L2
R16558 T22938 T22939 arg1Of LINE,","
R16559 T22941 T22940 arg1Of SINE,MIR = MIR
R16560 T22941 T22942 arg1Of SINE,","
R16561 T22941 T22950 arg1Of SINE,","
R16562 T22946 T22942 arg2Of repeat,","
R16563 T22946 T22943 arg1Of repeat,MLT1L = MLT1L
R16564 T22946 T22944 arg1Of repeat,long
R16565 T22946 T22945 arg1Of repeat,terminal
R16566 T22946 T22947 arg1Of repeat,(
R16567 T22948 T22947 arg2Of LTR,(
R16568 T22949 T22947 arg3Of ),(
R16569 T22950 T22939 arg2Of ",",","
R16570 T22950 T22957 arg1Of ",",","
R16571 T22952 T22951 arg2Of TATG,(
R16572 T22953 T22951 arg3Of ),(
R16573 T22956 T22950 arg2Of repeat,","
R16574 T22956 T22951 arg1Of repeat,(
R16575 T22956 T22954 arg1Of repeat,n = TATG
R16576 T22956 T22955 arg1Of repeat,tetranucleotide
R16577 T22960 T22957 arg2Of site,","
R16578 T22960 T22958 arg1Of site,tis = transcription
R16579 T22960 T22959 arg1Of site,initiation
R16863 T23439 T23436 arg1Of elements,Potential
R16864 T23439 T23437 arg1Of elements,cis-acting
R16865 T23439 T23438 arg1Of elements,regulatory
R16866 T23439 T23440 arg1Of elements,in
R16867 T23444 T23440 arg2Of region,in
R16868 T23444 T23441 arg1Of region,the
R16869 T23444 T23442 arg1Of region,LPS
R16870 T23444 T23443 arg1Of region,responsive
R16871 T23444 T23445 arg1Of region,of
R16872 T23449 T23445 arg2Of promoter,of
R16873 T23449 T23446 arg1Of promoter,the
R16874 T23449 T23447 arg1Of promoter,murine
R16875 T23449 T23448 arg1Of promoter,SerpinB2
R16876 T23455 T23451 arg1Of sequences,Mouse
R16877 T23455 T23452 arg1Of sequences,and
R16878 T23455 T23453 arg1Of sequences,human
R16879 T23455 T23454 arg1Of sequences,nucleotide
R16880 T23455 T23456 arg1Of sequences,were
R16881 T23455 T23457 arg2Of sequences,aligned
R16882 T23457 T23456 arg2Of aligned,were
R16883 T23458 T23457 arg3Of using,aligned
R16884 T23460 T23459 arg1Of W,Clustal
R16885 T23461 T23458 arg2Of software,using
R16886 T23461 T23460 arg1Of software,W
R16887 T23463 T23462 arg1Of elements,Cis-acting
R16888 T23463 T23464 arg2Of elements,conserved
R16889 T23463 T23472 arg1Of elements,are
R16890 T23463 T23473 arg2Of elements,boxed
R16891 T23463 T23475 arg2Of elements,labeled
R16892 T23464 T23465 arg1Of conserved,between
R16893 T23467 T23468 arg1Of human,and
R16894 T23469 T23468 arg2Of murine,and
R16895 T23471 T23465 arg2Of promoters,between
R16896 T23471 T23466 arg1Of promoters,the
R16897 T23471 T23467 arg1Of promoters,human
R16898 T23471 T23469 arg1Of promoters,murine
R16899 T23471 T23470 arg1Of promoters,SerpinB2
R16900 T23473 T23474 arg1Of boxed,and
R16901 T23474 T23472 arg2Of and,are
R16902 T23475 T23474 arg2Of labeled,and
R16903 T23478 T23476 arg1Of protein,AP-1 = 
R16904 T23478 T23477 arg1Of protein,activator
R16905 T23478 T23479 arg1Of protein,1
R16906 T23478 T23480 arg1Of protein,;
R16907 T23480 T23486 arg1Of ;,;
R16908 T23485 T23480 arg2Of protein,;
R16909 T23485 T23481 arg1Of protein,C/EBP = 
R16910 T23485 T23482 arg1Of protein,CCAAT
R16911 T23485 T23483 arg1Of protein,enhancer
R16912 T23485 T23484 arg1Of protein,binding
R16913 T23486 T23496 arg1Of ;,;
R16914 T23489 T23487 arg1Of element,CRE = cAMP
R16915 T23489 T23488 arg1Of element,response
R16916 T23489 T23490 arg1Of element,;
R16917 T23490 T23486 arg2Of ;,;
R16918 T23495 T23490 arg2Of 1/POU2F1,;
R16919 T23495 T23491 arg1Of 1/POU2F1,Oct1 = 
R16920 T23495 T23492 arg1Of 1/POU2F1,octamer
R16921 T23495 T23493 arg1Of 1/POU2F1,transcription
R16922 T23495 T23494 arg1Of 1/POU2F1,factor
R16923 T23501 T23496 arg2Of protein,;
R16924 T23501 T23497 arg1Of protein,PU.1 = 
R16925 T23501 T23498 arg1Of protein,purine
R16926 T23501 T23499 arg1Of protein,box
R16927 T23501 T23500 arg1Of protein,binding
R16928 T23501 T23502 arg1Of protein,1
R16929 T23507 T23503 arg1Of site,The
R16930 T23507 T23504 arg1Of site,putative
R16931 T23507 T23505 arg1Of site,transcription
R16932 T23507 T23506 arg1Of site,initiation
R16933 T23507 T23508 arg1Of site,(
R16934 T23507 T23511 arg1Of site,is
R16935 T23507 T23512 arg2Of site,indicated
R16936 T23509 T23508 arg2Of tis,(
R16937 T23510 T23508 arg3Of ),(
R16938 T23512 T23511 arg2Of indicated,is
R16939 T23512 T23513 arg1Of indicated,and
R16940 T23514 T23515 arg1Of exon,1
R16941 T23514 T23516 arg1Of exon,is
R16942 T23514 T23517 arg2Of exon,presented
R16943 T23517 T23513 arg2Of presented,and
R16944 T23517 T23516 arg2Of presented,is
R16945 T23517 T23518 arg1Of presented,in
R16946 T23519 T23518 arg2Of uppercase,in
R16947 T23521 T23520 arg1Of location,The
R16948 T23521 T23522 arg1Of location,of
R16949 T23521 T23536 arg1Of location,are
R16950 T23521 T23538 arg2Of location,shown
R16951 T23525 T23523 arg1Of ',the
R16952 T23525 T23524 arg1Of ',5
R16953 T23526 T23522 arg2Of ends,of
R16954 T23526 T23525 arg1Of ends,'
R16955 T23526 T23527 arg1Of ends,of
R16956 T23531 T23532 arg1Of −189,and
R16957 T23533 T23532 arg2Of −87,and
R16958 T23535 T23527 arg2Of constructs,of
R16959 T23535 T23528 arg1Of constructs,the
R16960 T23535 T23529 arg1Of constructs,−539
R16961 T23535 T23530 arg1Of constructs,","
R16962 T23535 T23531 arg1Of constructs,−189
R16963 T23535 T23533 arg1Of constructs,−87
R16964 T23535 T23534 arg1Of constructs,reporter
R16965 T23538 T23536 arg2Of shown,are
R16966 T23538 T23537 arg1Of shown,also
R17112 T23815 T23816 arg1Of Identification,of
R17113 T23818 T23816 arg2Of elements,of
R17114 T23818 T23817 arg1Of elements,cis-acting
R17115 T23818 T23819 arg2Of elements,required
R17116 T23819 T23820 arg1Of required,for
R17117 T23822 T23820 arg2Of LPS-responsiveness,for
R17118 T23822 T23821 arg1Of LPS-responsiveness,the
R17119 T23822 T23823 arg1Of LPS-responsiveness,of
R17120 T23827 T23823 arg2Of promoter,of
R17121 T23827 T23824 arg1Of promoter,the
R17122 T23827 T23825 arg1Of promoter,murine
R17123 T23827 T23826 arg1Of promoter,SerpinB2
R17124 T23829 T23828 arg2Of A,(
R17125 T23830 T23828 arg3Of ),(
R17126 T23832 T23828 arg1Of representation,(
R17127 T23832 T23831 arg1Of representation,Schematic
R17128 T23832 T23833 arg1Of representation,of
R17129 T23832 T23842 arg1Of representation,with
R17130 T23836 T23833 arg2Of region,of
R17131 T23836 T23834 arg1Of region,the
R17132 T23836 T23835 arg1Of region,−539/+92
R17133 T23836 T23837 arg1Of region,of
R17134 T23841 T23837 arg2Of promoter,of
R17135 T23841 T23838 arg1Of promoter,the
R17136 T23841 T23839 arg1Of promoter,murine
R17137 T23841 T23840 arg1Of promoter,SerpinB2
R17138 T23844 T23842 arg2Of location,with
R17139 T23844 T23843 arg1Of location,the
R17140 T23844 T23845 arg1Of location,of
R17141 T23849 T23845 arg2Of elements,of
R17142 T23849 T23846 arg1Of elements,candidate
R17143 T23849 T23847 arg1Of elements,cis-acting
R17144 T23849 T23848 arg1Of elements,regulatory
R17145 T23849 T23850 arg2Of elements,indicated
R17146 T23850 T23851 arg1Of indicated,with
R17147 T23852 T23851 arg2Of boxes,with
R17148 T23854 T23853 arg1Of location,The
R17149 T23854 T23855 arg1Of location,of
R17150 T23854 T23868 arg1Of location,is
R17151 T23854 T23870 arg2Of location,shown
R17152 T23858 T23855 arg2Of ends,of
R17153 T23858 T23856 arg1Of ends,the
R17154 T23858 T23857 arg1Of ends,5′
R17155 T23858 T23859 arg1Of ends,of
R17156 T23863 T23864 arg1Of −189,and
R17157 T23865 T23864 arg2Of −87,and
R17158 T23867 T23859 arg2Of constructs,of
R17159 T23867 T23860 arg1Of constructs,the
R17160 T23867 T23861 arg1Of constructs,−539
R17161 T23867 T23862 arg1Of constructs,","
R17162 T23867 T23863 arg1Of constructs,−189
R17163 T23867 T23865 arg1Of constructs,−87
R17164 T23867 T23866 arg1Of constructs,reporter
R17165 T23870 T23868 arg2Of shown,is
R17166 T23870 T23869 arg1Of shown,also
R17167 T23871 T23872 arg1Of Positions,of
R17168 T23871 T23886 arg1Of Positions,are
R17169 T23871 T23887 arg2Of Positions,indicated.
R17170 T23877 T23872 arg2Of primers,of
R17171 T23877 T23873 arg1Of primers,murine
R17172 T23877 T23874 arg1Of primers,SerpinB2
R17173 T23877 T23875 arg1Of primers,proximal
R17174 T23877 T23876 arg1Of primers,promoter-specific
R17175 T23877 T23878 arg1Of primers,","
R17176 T23879 T23880 arg1Of 338/−315,and
R17177 T23880 T23878 arg2Of and,","
R17178 T23880 T23882 arg2Of and,used
R17179 T23881 T23880 arg2Of −5/+19,and
R17180 T23882 T23883 arg1Of used,in
R17181 T23885 T23883 arg2Of assays,in
R17182 T23885 T23884 arg1Of assays,ChIP
R17183 T23887 T23886 arg2Of indicated.,are
R17184 T23889 T23888 arg2Of B,(
R17185 T23890 T23888 arg3Of ),(
R17186 T23893 T23888 arg1Of macrophages,(
R17187 T23893 T23891 arg1Of macrophages,RAW
R17188 T23893 T23892 arg1Of macrophages,264.7
R17189 T23893 T23894 arg1Of macrophages,were
R17190 T23893 T23896 arg2Of macrophages,transfected
R17191 T23896 T23886 modOf transfected,are
R17192 T23896 T23894 arg2Of transfected,were
R17193 T23896 T23895 arg1Of transfected,transiently
R17194 T23896 T23897 arg1Of transfected,with
R17195 T23904 T23898 arg1Of constructs,the
R17196 T23904 T23899 arg2Of constructs,indicated
R17197 T23904 T23900 arg1Of constructs,murine
R17198 T23904 T23901 arg1Of constructs,SerpinB2
R17199 T23904 T23902 arg1Of constructs,promoter-luciferase
R17200 T23904 T23903 arg1Of constructs,reporter
R17201 T23904 T23905 arg1Of constructs,and
R17202 T23905 T23897 arg2Of and,with
R17203 T23908 T23906 arg1Of untreated,either
R17204 T23908 T23907 arg1Of untreated,left
R17205 T23908 T23909 arg1Of untreated,or
R17206 T23910 T23909 arg2Of treated,or
R17207 T23910 T23911 arg1Of treated,with
R17208 T23912 T23913 arg1Of 100,ng/ml
R17209 T23914 T23911 arg2Of LPS,with
R17210 T23914 T23912 arg1Of LPS,100
R17211 T23917 T23905 arg2Of hrs,and
R17212 T23917 T23908 arg1Of hrs,untreated
R17213 T23917 T23910 arg2Of hrs,treated
R17214 T23917 T23915 arg1Of hrs,for
R17215 T23917 T23916 arg1Of hrs,16
R17216 T23919 T23918 arg1Of results,The
R17217 T23919 T23920 arg1Of results,show
R17218 T23919 T23928 arg1Of results,represent
R17219 T23920 T23924 arg1Of show,following
R17220 T23920 T23927 arg1Of show,and
R17221 T23923 T23920 arg2Of activity,show
R17222 T23923 T23921 arg1Of activity,relative
R17223 T23923 T23922 arg1Of activity,luciferase
R17224 T23926 T23924 arg2Of treatment,following
R17225 T23926 T23925 arg1Of treatment,LPS
R17226 T23928 T23927 arg2Of represent,and
R17227 T23930 T23931 arg1Of mean,and
R17228 T23931 T23928 arg2Of and,represent
R17229 T23931 T23929 arg1Of and,the
R17230 T23931 T23933 arg1Of and,of
R17231 T23932 T23931 arg2Of SEM,and
R17232 T23936 T23933 arg2Of experiments,of
R17233 T23936 T23934 arg1Of experiments,4–7
R17234 T23936 T23935 arg1Of experiments,independent
R17389 T24215 T24212 arg1Of factor,The
R17390 T24215 T24213 arg1Of factor,LPS-inducible
R17391 T24215 T24214 arg1Of factor,nuclear
R17392 T24215 T24216 arg1Of factor,binding
R17393 T24215 T24224 arg1Of factor,contains
R17394 T24223 T24216 arg2Of site,binding
R17395 T24223 T24217 arg1Of site,the
R17396 T24223 T24218 arg1Of site,murine
R17397 T24223 T24219 arg1Of site,SerpinB2
R17398 T24223 T24220 arg1Of site,proximal
R17399 T24223 T24221 arg1Of site,promoter
R17400 T24223 T24222 arg1Of site,C/EBP
R17401 T24225 T24224 arg2Of C/EBP-β,contains
R17402 T24228 T24226 arg1Of complex,The
R17403 T24228 T24227 arg1Of complex,LPS-inducible
R17404 T24228 T24229 arg1Of complex,is
R17405 T24228 T24230 arg2Of complex,indicated
R17406 T24230 T24229 arg2Of indicated,is
R17407 T24230 T24231 arg1Of indicated,with
R17408 T24233 T24231 arg2Of arrowhead,with
R17623 T24630 T24631 arg1Of C/EBP-β,is
R17624 T24630 T24632 arg1Of C/EBP-β,essential
R17625 T24632 T24631 arg2Of essential,is
R17626 T24632 T24633 arg1Of essential,for
R17627 T24634 T24635 arg1Of constitutive,and
R17628 T24636 T24635 arg2Of LPS-induced,and
R17629 T24639 T24633 arg2Of expression,for
R17630 T24639 T24634 arg1Of expression,constitutive
R17631 T24639 T24636 arg1Of expression,LPS-induced
R17632 T24639 T24637 arg1Of expression,SerpinB2
R17633 T24639 T24638 arg1Of expression,mRNA
R17634 T24641 T24640 arg2Of A,(
R17635 T24642 T24640 arg3Of ),(
R17636 T24646 T24640 arg1Of expression,(
R17637 T24646 T24643 arg1Of expression,Endogenous
R17638 T24646 T24644 arg1Of expression,SerpinB2
R17639 T24646 T24645 arg1Of expression,mRNA
R17640 T24646 T24647 arg1Of expression,is
R17641 T24646 T24648 arg2Of expression,abrogated
R17642 T24648 T24647 arg2Of abrogated,is
R17643 T24648 T24649 arg1Of abrogated,in
R17644 T24648 T24652 arg1Of abrogated,compared
R17645 T24648 T24656 arg1Of abrogated,in
R17646 T24648 T24677 arg1Of abrogated,and
R17647 T24651 T24649 arg2Of MEFs,in
R17648 T24651 T24650 arg1Of MEFs,Cebpb−/−
R17649 T24653 T24652 arg2Of to,compared
R17650 T24655 T24653 arg2Of MEFs,to
R17651 T24655 T24654 arg1Of MEFs,Cebpb+/+
R17652 T24658 T24659 arg1Of absence,and
R17653 T24659 T24656 arg2Of and,in
R17654 T24659 T24657 arg1Of and,the
R17655 T24659 T24661 arg1Of and,of
R17656 T24660 T24659 arg2Of presence,and
R17657 T24664 T24661 arg2Of analysis,of
R17658 T24664 T24662 arg1Of analysis,LPS.
R17659 T24664 T24663 arg1Of analysis,qPCR
R17660 T24664 T24665 arg1Of analysis,of
R17661 T24669 T24665 arg2Of expression,of
R17662 T24669 T24666 arg1Of expression,murine
R17663 T24669 T24667 arg1Of expression,SerpinB2
R17664 T24669 T24668 arg1Of expression,mRNA
R17665 T24669 T24670 arg1Of expression,in
R17666 T24672 T24671 arg1Of Cebpb+/+,untreated
R17667 T24672 T24673 arg1Of Cebpb+/+,and
R17668 T24673 T24670 arg2Of and,in
R17669 T24675 T24673 arg2Of MEFs,and
R17670 T24675 T24674 arg1Of MEFs,Cebpb−/−
R17671 T24677 T24676 arg1Of and,","
R17672 T24679 T24678 arg2Of simulation,after
R17673 T24679 T24680 arg1Of simulation,with
R17674 T24679 T24686 arg1Of simulation,for
R17675 T24681 T24680 arg2Of LPS,with
R17676 T24681 T24682 arg1Of LPS,(
R17677 T24684 T24682 arg2Of ng/ml,(
R17678 T24684 T24683 arg1Of ng/ml,100
R17679 T24685 T24682 arg3Of ),(
R17680 T24689 T24686 arg2Of times.,for
R17681 T24689 T24687 arg1Of times.,the
R17682 T24689 T24688 arg2Of times.,indicated
R17683 T24691 T24690 arg2Of B,(
R17684 T24692 T24690 arg3Of ),(
R17685 T24695 T24690 arg1Of expression,(
R17686 T24695 T24693 arg1Of expression,Endogenous
R17687 T24695 T24694 arg1Of expression,SerpinB2
R17688 T24695 T24696 arg1Of expression,is
R17689 T24695 T24697 arg2Of expression,abrogated
R17690 T24697 T24677 arg2Of abrogated,and
R17691 T24697 T24678 arg1Of abrogated,after
R17692 T24697 T24696 arg2Of abrogated,is
R17693 T24697 T24698 arg1Of abrogated,in
R17694 T24701 T24698 arg2Of macrophages,in
R17695 T24701 T24699 arg1Of macrophages,C/EBP-β-deficient
R17696 T24701 T24700 arg1Of macrophages,inflammatory
R17697 T24704 T24702 arg1Of macrophages,Thioglycollate-elicited
R17698 T24704 T24703 arg1Of macrophages,peritoneal
R17699 T24704 T24705 arg1Of macrophages,(
R17700 T24704 T24709 arg1Of macrophages,were
R17701 T24704 T24710 arg2Of macrophages,infected
R17702 T24707 T24705 arg2Of macs,(
R17703 T24707 T24706 arg1Of macs,TG
R17704 T24708 T24705 arg3Of ),(
R17705 T24710 T24709 arg2Of infected,were
R17706 T24710 T24711 arg1Of infected,with
R17707 T24712 T24713 arg1Of human,and
R17708 T24715 T24713 arg2Of specific,and
R17709 T24715 T24714 arg1Of specific,murine
R17710 T24717 T24711 arg2Of shRNAs,with
R17711 T24717 T24712 arg1Of shRNAs,human
R17712 T24717 T24715 arg1Of shRNAs,specific
R17713 T24717 T24716 arg1Of shRNAs,lentiviral
R17714 T24720 T24718 arg1Of shRNA,Human
R17715 T24720 T24719 arg1Of shRNA,CEBPB
R17716 T24720 T24721 arg1Of shRNA,serves
R17717 T24721 T24722 arg1Of serves,as
R17718 T24721 T24726 arg1Of serves,since
R17719 T24725 T24722 arg2Of control,as
R17720 T24725 T24723 arg1Of control,the
R17721 T24725 T24724 arg1Of control,non-silencing
R17722 T24727 T24728 arg1Of it,does
R17723 T24727 T24730 arg1Of it,target
R17724 T24730 T24726 arg2Of target,since
R17725 T24730 T24728 arg2Of target,does
R17726 T24730 T24729 arg1Of target,not
R17727 T24730 T24735 arg1Of target,[
R17728 T24734 T24730 arg2Of sequence,target
R17729 T24734 T24731 arg1Of sequence,the
R17730 T24734 T24732 arg1Of sequence,murine
R17731 T24734 T24733 arg1Of sequence,Cebpb
R17732 T24736 T24735 arg2Of 38,[
R17733 T24737 T24735 arg3Of ],[
R17734 T24740 T24738 arg1Of macrophages,Lentiviral
R17735 T24740 T24739 arg2Of macrophages,transduced
R17736 T24740 T24741 arg1Of macrophages,were
R17737 T24740 T24742 arg2Of macrophages,stimulated
R17738 T24742 T24741 arg2Of stimulated,were
R17739 T24742 T24743 arg1Of stimulated,with
R17740 T24742 T24749 arg1Of stimulated,for
R17741 T24744 T24743 arg2Of LPS,with
R17742 T24744 T24745 arg1Of LPS,(
R17743 T24747 T24745 arg2Of ng/ml,(
R17744 T24747 T24746 arg1Of ng/ml,100
R17745 T24748 T24745 arg3Of ),(
R17746 T24751 T24749 arg2Of hrs,for
R17747 T24751 T24750 arg1Of hrs,4
R17748 T24752 T24753 arg1Of Left,:
R17749 T24756 T24754 arg1Of analysis,Western
R17750 T24756 T24755 arg1Of analysis,blot
R17751 T24756 T24757 arg1Of analysis,shows
R17752 T24757 T24763 arg1Of shows,following
R17753 T24759 T24757 arg2Of knockdown,shows
R17754 T24759 T24758 arg1Of knockdown,effective
R17755 T24759 T24760 arg1Of knockdown,of
R17756 T24762 T24760 arg2Of C/EBP-β,of
R17757 T24762 T24761 arg1Of C/EBP-β,endogenous
R17758 T24764 T24763 arg2Of infection,following
R17759 T24764 T24765 arg1Of infection,with
R17760 T24768 T24766 arg1Of shRNA,murine
R17761 T24768 T24767 arg1Of shRNA,Cebpb
R17762 T24768 T24769 arg1Of shRNA,and
R17763 T24769 T24765 arg2Of and,with
R17764 T24769 T24770 arg1Of and,not
R17765 T24773 T24769 arg2Of shRNA,and
R17766 T24773 T24771 arg1Of shRNA,human
R17767 T24773 T24772 arg1Of shRNA,CEBPB
R17768 T24774 T24775 arg1Of Right,:
R17769 T24777 T24774 arg1Of analysis,Right
R17770 T24777 T24776 arg1Of analysis,qPCR
R17771 T24777 T24778 arg1Of analysis,of
R17772 T24782 T24778 arg2Of expression,of
R17773 T24782 T24779 arg1Of expression,murine
R17774 T24782 T24780 arg1Of expression,SerpinB2
R17775 T24782 T24781 arg1Of expression,mRNA
R17776 T24782 T24783 arg1Of expression,in
R17777 T24788 T24783 arg2Of macrophages,in
R17778 T24788 T24784 arg1Of macrophages,the
R17779 T24788 T24785 arg1Of macrophages,lentiviral
R17780 T24788 T24786 arg2Of macrophages,transduced
R17781 T24788 T24787 arg1Of macrophages,peritoneal
R17782 T24790 T24789 arg1Of results,The
R17783 T24790 T24791 arg1Of results,represent
R17784 T24793 T24794 arg1Of mean,and
R17785 T24794 T24791 arg2Of and,represent
R17786 T24794 T24792 arg1Of and,the
R17787 T24794 T24796 arg1Of and,of
R17788 T24795 T24794 arg2Of SEM,and
R17789 T24799 T24796 arg2Of experiments,of
R17790 T24799 T24797 arg1Of experiments,two
R17791 T24799 T24798 arg1Of experiments,independent
R17792 T24799 T24800 arg2Of experiments,performed
R17793 T24799 T24805 arg1Of experiments,(
R17794 T24800 T24801 arg1Of performed,in
R17795 T24802 T24803 arg1Of duplicate,or
R17796 T24803 T24801 arg2Of or,in
R17797 T24804 T24803 arg2Of triplicate.,or
R17798 T24806 T24807 arg1Of *,","
R17799 T24808 T24807 arg2Of p,","
R17800 T24810 T24809 arg1Of 0.05,<
R17801 T24810 T24811 arg1Of 0.05,","
R17802 T24812 T24811 arg2Of two-way,","
R17803 T24813 T24805 arg2Of ANOVA,(
R17804 T24813 T24806 arg1Of ANOVA,*
R17805 T24813 T24810 arg1Of ANOVA,0.05
R17806 T24813 T24812 arg1Of ANOVA,two-way
R17807 T24814 T24805 arg3Of ),(
R18137 T25396 T25395 arg1Of recruitment,Differential
R18138 T25396 T25397 arg1Of recruitment,of
R18139 T25396 T25401 arg1Of recruitment,to
R18140 T25396 T25407 arg1Of recruitment,vivo
R18141 T25398 T25399 arg1Of C/EBP-β,and
R18142 T25399 T25397 arg2Of and,of
R18143 T25400 T25399 arg2Of C/EBP-βT217,and
R18144 T25405 T25401 arg2Of promoter,to
R18145 T25405 T25402 arg1Of promoter,the
R18146 T25405 T25403 arg1Of promoter,murine
R18147 T25405 T25404 arg1Of promoter,SerpinB2
R18148 T25407 T25406 arg1Of vivo,in
R18149 T25410 T25408 arg1Of occupancy,Transcription
R18150 T25410 T25409 arg1Of occupancy,factor
R18151 T25410 T25411 arg1Of occupancy,on
R18152 T25410 T25418 arg1Of occupancy,was
R18153 T25410 T25419 arg2Of occupancy,determined
R18154 T25415 T25411 arg2Of promoter,on
R18155 T25415 T25412 arg1Of promoter,the
R18156 T25415 T25413 arg1Of promoter,SerpinB2
R18157 T25415 T25414 arg1Of promoter,proximal
R18158 T25415 T25417 arg1Of promoter,vivo
R18159 T25417 T25416 arg1Of vivo,in
R18160 T25419 T25418 arg2Of determined,was
R18161 T25422 T25421 arg1Of immunoprecipitation,chromatin
R18162 T25422 T25423 arg1Of immunoprecipitation,(
R18163 T25424 T25423 arg2Of ChIP,(
R18164 T25425 T25423 arg3Of ),(
R18165 T25426 T25419 arg1Of assay,determined
R18166 T25426 T25420 arg2Of assay,by
R18167 T25426 T25422 arg1Of assay,immunoprecipitation
R18168 T25428 T25427 arg1Of macrophages,RAW264.7
R18169 T25428 T25429 arg1Of macrophages,were
R18170 T25428 T25430 arg2Of macrophages,treated
R18171 T25430 T25429 arg2Of treated,were
R18172 T25430 T25431 arg1Of treated,in
R18173 T25430 T25446 modOf treated,using
R18174 T25433 T25434 arg1Of presence,or
R18175 T25434 T25431 arg2Of or,in
R18176 T25434 T25432 arg1Of or,the
R18177 T25434 T25436 arg1Of or,of
R18178 T25434 T25438 arg1Of or,for
R18179 T25435 T25434 arg2Of absence,or
R18180 T25437 T25436 arg2Of LPS,of
R18181 T25441 T25442 arg1Of times,and
R18182 T25443 T25442 arg2Of chromatin,and
R18183 T25444 T25438 arg2Of immunoprecipitation,for
R18184 T25444 T25439 arg1Of immunoprecipitation,the
R18185 T25444 T25440 arg2Of immunoprecipitation,indicated
R18186 T25444 T25441 arg1Of immunoprecipitation,times
R18187 T25444 T25443 arg1Of immunoprecipitation,chromatin
R18188 T25444 T25445 arg2Of immunoprecipitation,performed
R18189 T25446 T25448 arg1Of using,against
R18190 T25447 T25446 arg2Of antibodies,using
R18191 T25449 T25450 arg1Of C/EBP-β,or
R18192 T25450 T25448 arg2Of or,against
R18193 T25450 T25452 arg1Of or,(
R18194 T25451 T25450 arg2Of p-C/EBP-β,or
R18195 T25453 T25452 arg2Of T217,(
R18196 T25454 T25452 arg3Of ),(
R18197 T25456 T25455 arg1Of chromatin,Soluble
R18198 T25456 T25457 arg1Of chromatin,(
R18199 T25456 T25461 arg1Of chromatin,was
R18200 T25456 T25462 arg2Of chromatin,immunoprecipitated
R18201 T25459 T25457 arg2Of ng,(
R18202 T25459 T25458 arg1Of ng,600–700
R18203 T25460 T25457 arg3Of ),(
R18204 T25462 T25461 arg2Of immunoprecipitated,was
R18205 T25462 T25463 arg1Of immunoprecipitated,with
R18206 T25464 T25463 arg2Of antibodies,with
R18207 T25464 T25465 arg1Of antibodies,against
R18208 T25466 T25467 arg1Of C/EBP-β,","
R18209 T25466 T25472 arg1Of C/EBP-β,","
R18210 T25468 T25467 arg2Of p-C/EBP-β,","
R18211 T25468 T25469 arg1Of p-C/EBP-β,(
R18212 T25470 T25469 arg2Of T217,(
R18213 T25471 T25469 arg3Of ),(
R18214 T25472 T25480 arg1Of ",",or
R18215 T25474 T25472 arg2Of Polymerase,","
R18216 T25474 T25473 arg1Of Polymerase,RNA
R18217 T25474 T25475 arg1Of Polymerase,II
R18218 T25474 T25476 arg1Of Polymerase,(
R18219 T25477 T25476 arg2Of RNAPII,(
R18220 T25478 T25476 arg3Of ),(
R18221 T25480 T25465 arg2Of or,against
R18222 T25480 T25479 arg1Of or,","
R18223 T25485 T25484 arg2Of rIgG,(
R18224 T25486 T25484 arg3Of ),(
R18225 T25487 T25482 arg1Of control.,rabbit
R18226 T25487 T25483 arg1Of control.,IgG
R18227 T25487 T25484 arg1Of control.,(
R18228 T25487 T25488 arg1Of control.,(
R18229 T25489 T25488 arg2Of A,(
R18230 T25490 T25488 arg3Of ),(
R18231 T25493 T25480 arg2Of pattern,or
R18232 T25493 T25481 arg1Of pattern,a
R18233 T25493 T25487 arg1Of pattern,control.
R18234 T25493 T25491 arg1Of pattern,Typical
R18235 T25493 T25492 arg1Of pattern,PCR
R18236 T25493 T25494 arg2Of pattern,obtained
R18237 T25494 T25495 arg1Of obtained,in
R18238 T25494 T25508 arg1Of obtained,","
R18239 T25494 T25509 arg1Of obtained,as
R18240 T25497 T25495 arg2Of assays,in
R18241 T25497 T25496 arg1Of assays,ChIP
R18242 T25497 T25498 arg1Of assays,using
R18243 T25503 T25498 arg2Of primers,using
R18244 T25503 T25499 arg1Of primers,murine
R18245 T25503 T25500 arg1Of primers,SerpinB2
R18246 T25503 T25501 arg1Of primers,proximal
R18247 T25503 T25502 arg1Of primers,promoter-specific
R18248 T25503 T25504 arg1Of primers,","
R18249 T25505 T25506 arg1Of 338/−315,and
R18250 T25506 T25504 arg2Of and,","
R18251 T25507 T25506 arg2Of −5/+19,and
R18252 T25510 T25509 arg2Of diagrammed,as
R18253 T25510 T25511 arg1Of diagrammed,in
R18254 T25512 T25511 arg2Of top,in
R18255 T25513 T25514 arg1Of Recruitment,of
R18256 T25513 T25516 arg1Of Recruitment,to
R18257 T25513 T25520 arg1Of Recruitment,suggests
R18258 T25515 T25514 arg2Of RNAPII,of
R18259 T25519 T25516 arg2Of promoter,to
R18260 T25519 T25517 arg1Of promoter,the
R18261 T25519 T25518 arg1Of promoter,SerpinB2
R18262 T25520 T25523 arg1Of suggests,following
R18263 T25522 T25520 arg2Of transcription,suggests
R18264 T25522 T25521 arg1Of transcription,active
R18265 T25525 T25523 arg2Of stimulation,following
R18266 T25525 T25524 arg1Of stimulation,LPS
R18267 T25527 T25526 arg1Of background,Minimal
R18268 T25527 T25528 arg1Of background,was
R18269 T25527 T25529 arg2Of background,detected
R18270 T25527 T25530 arg1Of background,using
R18271 T25529 T25528 arg2Of detected,was
R18272 T25530 T25529 arg3Of using,detected
R18273 T25530 T25535 arg1Of using,","
R18274 T25530 T25536 arg1Of using,indicative
R18275 T25534 T25530 arg2Of control,using
R18276 T25534 T25531 arg1Of control,the
R18277 T25534 T25532 arg1Of control,rabbit
R18278 T25534 T25533 arg1Of control,IgG
R18279 T25536 T25537 arg1Of indicative,of
R18280 T25539 T25537 arg2Of specificity,of
R18281 T25539 T25538 arg1Of specificity,the
R18282 T25539 T25540 arg1Of specificity,of
R18283 T25539 T25549 arg1Of specificity,of
R18284 T25545 T25544 arg2Of B,(
R18285 T25546 T25544 arg3Of ),(
R18286 T25548 T25540 arg2Of analysis,of
R18287 T25548 T25541 arg1Of analysis,the
R18288 T25548 T25542 arg1Of analysis,ChIP
R18289 T25548 T25543 arg1Of analysis,reaction.
R18290 T25548 T25544 arg1Of analysis,(
R18291 T25548 T25547 arg1Of analysis,qPCR
R18292 T25550 T25549 arg2Of chromatin,of
R18293 T25550 T25551 arg2Of chromatin,immunoprecipitated
R18294 T25551 T25552 arg1Of immunoprecipitated,with
R18295 T25553 T25552 arg2Of antibodies,with
R18296 T25553 T25554 arg1Of antibodies,against
R18297 T25555 T25556 arg1Of C/EBP-β,","
R18298 T25555 T25562 arg1Of C/EBP-β,and
R18299 T25557 T25556 arg2Of p-C/EBP-β,","
R18300 T25557 T25558 arg1Of p-C/EBP-β,(
R18301 T25559 T25558 arg2Of T217,(
R18302 T25560 T25558 arg3Of ),(
R18303 T25562 T25554 arg2Of and,against
R18304 T25562 T25561 arg1Of and,","
R18305 T25565 T25562 arg2Of control,and
R18306 T25565 T25563 arg1Of control,the
R18307 T25565 T25564 arg1Of control,rIgG
R18308 T25567 T25566 arg1Of data,The
R18309 T25567 T25568 arg1Of data,are
R18310 T25567 T25569 arg2Of data,represented
R18311 T25569 T25568 arg2Of represented,are
R18312 T25569 T25571 arg1Of represented,to
R18313 T25571 T25570 arg1Of to,relative
R18314 T25573 T25571 arg2Of signal,to
R18315 T25573 T25572 arg1Of signal,rIgG
R18316 T25573 T25574 arg1Of signal,using
R18317 T25577 T25574 arg2Of method,using
R18318 T25577 T25575 arg1Of method,the
R18319 T25577 T25576 arg1Of method,2-ΔΔCt
R18586 T26220 T26221 arg1Of C/EBP-β,is
R18587 T26220 T26222 arg1Of C/EBP-β,necessary
R18588 T26222 T26221 arg2Of necessary,is
R18589 T26222 T26223 arg1Of necessary,for
R18590 T26227 T26223 arg2Of activity,for
R18591 T26227 T26224 arg1Of activity,SerpinB2
R18592 T26227 T26225 arg1Of activity,proximal
R18593 T26227 T26226 arg1Of activity,promoter
R18594 T26229 T26228 arg2Of A,(
R18595 T26230 T26228 arg3Of ),(
R18596 T26232 T26231 arg1Of SerpinB2,The
R18597 T26233 T26232 arg1Of proximal,SerpinB2
R18598 T26234 T26228 arg1Of promoter,(
R18599 T26234 T26233 arg1Of promoter,proximal
R18600 T26234 T26235 arg1Of promoter,is
R18601 T26234 T26237 arg2Of promoter,activated
R18602 T26237 T26235 arg2Of activated,is
R18603 T26237 T26236 arg1Of activated,significantly
R18604 T26237 T26238 arg1Of activated,in
R18605 T26237 T26244 arg1Of activated,in
R18606 T26238 T26242 arg1Of in,and
R18607 T26241 T26238 arg2Of MEFs,in
R18608 T26241 T26239 arg1Of MEFs,LPS-stimulated
R18609 T26241 T26240 arg1Of MEFs,Cebpb+/+
R18610 T26244 T26242 arg2Of in,and
R18611 T26244 T26243 arg1Of in,not
R18612 T26246 T26244 arg2Of MEFs,in
R18613 T26246 T26245 arg1Of MEFs,Cebpb−/−
R18614 T26251 T26247 arg1Of activity,Murine
R18615 T26251 T26248 arg1Of activity,SerpinB2
R18616 T26251 T26249 arg1Of activity,gene
R18617 T26251 T26250 arg1Of activity,promoter
R18618 T26251 T26252 arg2Of activity,measured
R18619 T26252 T26253 arg1Of measured,in
R18620 T26254 T26255 arg1Of Cebpb+/+,and
R18621 T26256 T26255 arg2Of Cebpb−/−,and
R18622 T26257 T26253 arg2Of MEFs,in
R18623 T26257 T26254 arg1Of MEFs,Cebpb+/+
R18624 T26257 T26256 arg1Of MEFs,Cebpb−/−
R18625 T26257 T26258 arg1Of MEFs,expressing
R18626 T26258 T26264 arg1Of expressing,in
R18627 T26263 T26258 arg2Of reporter,expressing
R18628 T26263 T26259 arg1Of reporter,the
R18629 T26263 T26260 arg1Of reporter,pGLmP-539
R18630 T26263 T26261 arg1Of reporter,SerpinB2
R18631 T26263 T26262 arg1Of reporter,promoter-luciferase
R18632 T26266 T26267 arg1Of presence,or
R18633 T26267 T26264 arg2Of or,in
R18634 T26267 T26265 arg1Of or,the
R18635 T26267 T26269 arg1Of or,of
R18636 T26268 T26267 arg2Of absence,or
R18637 T26270 T26269 arg2Of LPS,of
R18638 T26270 T26271 arg1Of LPS,(
R18639 T26273 T26271 arg2Of ng/mL,(
R18640 T26273 T26272 arg1Of ng/mL,100
R18641 T26274 T26271 arg3Of ),(
R18642 T26275 T26276 arg1Of Cells,were
R18643 T26275 T26277 arg2Of Cells,co-transfected
R18644 T26277 T26276 arg2Of co-transfected,were
R18645 T26277 T26278 arg1Of co-transfected,with
R18646 T26277 T26289 arg1Of co-transfected,and
R18647 T26283 T26279 arg1Of reporter,the
R18648 T26283 T26280 arg1Of reporter,pGLmP-539
R18649 T26283 T26281 arg1Of reporter,SerpinB2
R18650 T26283 T26282 arg1Of reporter,promoter-luciferase
R18651 T26283 T26284 arg1Of reporter,and
R18652 T26284 T26278 arg2Of and,with
R18653 T26287 T26284 arg2Of plasmids,and
R18654 T26287 T26285 arg1Of plasmids,β-galactosidase
R18655 T26287 T26286 arg1Of plasmids,reporter
R18656 T26289 T26288 arg1Of and,","
R18657 T26291 T26290 arg1Of units,luciferase
R18658 T26291 T26292 arg1Of units,normalized
R18659 T26292 T26289 arg2Of normalized,and
R18660 T26292 T26293 arg1Of normalized,to
R18661 T26297 T26296 arg2Of B,(
R18662 T26298 T26296 arg3Of ),(
R18663 T26304 T26301 arg1Of structure,schematic
R18664 T26304 T26302 arg1Of structure,depicting
R18665 T26304 T26303 arg1Of structure,gene
R18666 T26304 T26305 arg1Of structure,and
R18667 T26305 T26293 arg2Of and,to
R18668 T26305 T26294 arg1Of and,β-galactosidase
R18669 T26305 T26295 arg1Of and,activity.
R18670 T26305 T26296 arg1Of and,(
R18671 T26305 T26299 arg1Of and,C/EBP-β
R18672 T26305 T26300 arg1Of and,gene
R18673 T26305 T26318 modOf and,regulates
R18674 T26307 T26305 arg2Of sites.,and
R18675 T26307 T26306 arg1Of sites.,phospho-acceptor
R18676 T26307 T26308 arg1Of sites.,(
R18677 T26309 T26308 arg2Of C,(
R18678 T26310 T26308 arg3Of ),(
R18679 T26311 T26312 arg1Of Phosphorylation,of
R18680 T26311 T26314 arg1Of Phosphorylation,at
R18681 T26311 T26318 arg1Of Phosphorylation,regulates
R18682 T26313 T26312 arg2Of C/EBP-β,of
R18683 T26315 T26314 arg2Of Serine,at
R18684 T26315 T26316 arg1Of Serine,64
R18685 T26318 T26317 arg1Of regulates,negatively
R18686 T26322 T26318 arg2Of activity,regulates
R18687 T26322 T26319 arg1Of activity,LPS-stimulated
R18688 T26322 T26320 arg1Of activity,SerpinB2
R18689 T26322 T26321 arg1Of activity,promoter
R18690 T26324 T26323 arg1Of MEFs,Cebpb−/−
R18691 T26324 T26325 arg1Of MEFs,were
R18692 T26324 T26326 arg2Of MEFs,co-transfected
R18693 T26324 T26353 arg2Of MEFs,stimulated
R18694 T26326 T26327 arg1Of co-transfected,with
R18695 T26326 T26352 arg1Of co-transfected,and
R18696 T26329 T26328 arg1Of plasmids,expression
R18697 T26329 T26330 arg1Of plasmids,encoding
R18698 T26329 T26347 arg1Of plasmids,and
R18699 T26332 T26331 arg1Of C/EBP-β,wild-type
R18700 T26332 T26333 arg1Of C/EBP-β,or
R18701 T26333 T26330 arg2Of or,encoding
R18702 T26338 T26333 arg2Of mutants,or
R18703 T26338 T26334 arg1Of mutants,the
R18704 T26338 T26335 arg2Of mutants,indicated
R18705 T26338 T26336 arg1Of mutants,C/EBP-β
R18706 T26338 T26337 arg1Of mutants,phospho-acceptor
R18707 T26338 T26339 arg1Of mutants,","
R18708 T26338 T26340 arg1Of mutants,along
R18709 T26340 T26341 arg1Of along,with
R18710 T26346 T26341 arg2Of reporter,with
R18711 T26346 T26342 arg1Of reporter,the
R18712 T26346 T26343 arg1Of reporter,pGLmP-539
R18713 T26346 T26344 arg1Of reporter,SerpinB2
R18714 T26346 T26345 arg1Of reporter,promoter-luciferase
R18715 T26347 T26327 arg2Of and,with
R18716 T26350 T26347 arg2Of plasmids,and
R18717 T26350 T26348 arg1Of plasmids,β-galactosidase
R18718 T26350 T26349 arg1Of plasmids,reporter
R18719 T26352 T26325 arg2Of and,were
R18720 T26352 T26351 arg1Of and,","
R18721 T26353 T26352 arg2Of stimulated,and
R18722 T26353 T26354 arg1Of stimulated,with
R18723 T26353 T26356 arg1Of stimulated,for
R18724 T26355 T26354 arg2Of LPS,with
R18725 T26358 T26356 arg2Of hrs,for
R18726 T26358 T26357 arg1Of hrs,4
R18727 T26360 T26359 arg1Of activity,Luciferase
R18728 T26360 T26361 arg1Of activity,was
R18729 T26360 T26362 arg2Of activity,quantified
R18730 T26360 T26364 arg2Of activity,normalized
R18731 T26362 T26363 arg1Of quantified,and
R18732 T26363 T26361 arg2Of and,was
R18733 T26364 T26363 arg2Of normalized,and
R18734 T26364 T26365 arg1Of normalized,to
R18735 T26367 T26365 arg2Of activity,to
R18736 T26367 T26366 arg1Of activity,β-galactosidase
R18737 T26370 T26368 arg1Of blot,The
R18738 T26370 T26369 arg1Of blot,western
R18739 T26370 T26371 arg1Of blot,(
R18740 T26370 T26376 arg1Of blot,confirms
R18741 T26372 T26371 arg2Of below,(
R18742 T26374 T26372 arg2Of graphs,below
R18743 T26374 T26373 arg1Of graphs,the
R18744 T26375 T26371 arg3Of ),(
R18745 T26378 T26376 arg2Of expression,confirms
R18746 T26378 T26377 arg1Of expression,the
R18747 T26378 T26379 arg1Of expression,of
R18748 T26384 T26379 arg2Of mutants,of
R18749 T26384 T26380 arg1Of mutants,the
R18750 T26384 T26381 arg1Of mutants,respective
R18751 T26384 T26382 arg1Of mutants,C/EBP-β
R18752 T26384 T26383 arg1Of mutants,phospho-acceptor
R18753 T26388 T26385 arg1Of MEFs,The
R18754 T26388 T26386 arg1Of MEFs,C/EBP-βT217A
R18755 T26388 T26387 arg1Of MEFs,-transfected
R18756 T26388 T26389 arg1Of MEFs,express
R18757 T26393 T26394 arg1Of kDa,and
R18758 T26395 T26394 arg2Of 35,and
R18759 T26397 T26389 arg2Of isoforms,express
R18760 T26397 T26390 arg1Of isoforms,both
R18761 T26397 T26391 arg1Of isoforms,the
R18762 T26397 T26392 arg1Of isoforms,38
R18763 T26397 T26393 arg1Of isoforms,kDa
R18764 T26397 T26395 arg1Of isoforms,35
R18765 T26397 T26396 arg1Of isoforms,kDa
R18766 T26397 T26398 arg1Of isoforms,of
R18767 T26399 T26398 arg2Of C/EBP-β,of
R18768 T26401 T26400 arg1Of results,The
R18769 T26401 T26402 arg1Of results,represent
R18770 T26404 T26405 arg1Of mean,and
R18771 T26405 T26402 arg2Of and,represent
R18772 T26405 T26403 arg1Of and,the
R18773 T26405 T26407 arg1Of and,of
R18774 T26406 T26405 arg2Of SEM,and
R18775 T26410 T26408 arg1Of three,at
R18776 T26410 T26409 arg1Of three,least
R18777 T26412 T26407 arg2Of experiments,of
R18778 T26412 T26410 arg1Of experiments,three
R18779 T26412 T26411 arg1Of experiments,independent
R18780 T26412 T26413 arg2Of experiments,performed
R18781 T26413 T26414 arg1Of performed,in
R18782 T26415 T26414 arg2Of triplicate.,in
R18783 T26415 T26416 arg1Of triplicate.,(
R18784 T26417 T26418 arg1Of *,","
R18785 T26419 T26418 arg2Of p,","
R18786 T26421 T26420 arg1Of 0.05,<
R18787 T26421 T26422 arg1Of 0.05,","
R18788 T26423 T26422 arg2Of one-way,","
R18789 T26424 T26416 arg2Of ANOVA,(
R18790 T26424 T26417 arg1Of ANOVA,*
R18791 T26424 T26421 arg1Of ANOVA,0.05
R18792 T26424 T26423 arg1Of ANOVA,one-way
R18793 T26425 T26416 arg3Of ),(
R2622 T3606 T3604 arg1Of PCR,Real-time
R2623 T3606 T3605 arg1Of PCR,Quantitative
R2624 T3606 T3607 arg1Of PCR,(
R2625 T3608 T3607 arg2Of qPCR,(
R2626 T3609 T3607 arg3Of ),(
R2627 T3613 T3610 arg1Of Kit,The
R2628 T3613 T3611 arg1Of Kit,RNeasy
R2629 T3613 T3612 arg1Of Kit,Mini
R2631 T3613 T3617 arg1Of Kit,was
R2635 T3616 T3614 arg3Of ),(
R2636 T3618 T3617 arg2Of used,was
R666 T234 T230 arg1Of Constitutive,Transcription
R672 T237 T229 arg1Of Transcription,The
R2802 T3860 T3859 arg2Of addition,in
R17409 T24233 T24232 arg1Of arrowhead,an

bionlp-st-ge-2016-coref

Id Subject Object Predicate Lexical cue
T18716 45568-45576 Antecedent denotes SerpinB2
T18715 45589-45592 Anaphor denotes its
T18714 43775-43782 Antecedent denotes C/EBP-β
T18713 43843-43845 Anaphor denotes it
T18712 43103-43107 Antecedent denotes gene
T18711 43108-43113 Anaphor denotes whose
T18710 41549-41558 Antecedent denotes inducible
T18709 42231-42257 Anaphor denotes the LPS-inducible response
T11520 26622-26633 Antecedent denotes these sites
T11519 26702-26706 Anaphor denotes they
T11518 26528-26533 Antecedent denotes their
T11517 26622-26633 Anaphor denotes these sites
T9525 19756-19764 Antecedent denotes deletion
T9524 20000-20013 Anaphor denotes this deletion
T13180 29571-29585 Antecedent denotes Nuclear Factor
T13179 29586-29590 Anaphor denotes that
T13178 29546-29553 Antecedent denotes C/EBP-β
T13177 29571-29585 Anaphor denotes Nuclear Factor
T16609 39506-39527 Antecedent denotes phosphorylation sites
T16608 40163-40191 Anaphor denotes these phospho-acceptor sites
T14848 33785-33792 Antecedent denotes C/EBP-β
T14847 33863-33866 Anaphor denotes its
T13185 30403-30410 Antecedent denotes C/EBP-ε
T13184 30391-30398 Antecedent denotes C/EBP-δ
T13183 30382-30389 Antecedent denotes C/EBP-β
T13182 30373-30380 Antecedent denotes C/EBP-α
T13181 30477-30499 Anaphor denotes the respective protein
T1298 5027-5036 Antecedent denotes this site
T1297 5049-5052 Anaphor denotes its
T1296 4968-4986 Antecedent denotes C/EBP binding site
T1295 5027-5036 Anaphor denotes this site
T1294 4235-4243 Antecedent denotes a factor
T1293 4244-4249 Anaphor denotes whose
T1292 4208-4216 Antecedent denotes SerpinB2
T1291 4235-4243 Anaphor denotes a factor
T1290 3271-3279 Antecedent denotes SerpinB2
T1289 3393-3395 Anaphor denotes It
T1288 2711-2720 Antecedent denotes inhibitor
T1287 2910-2923 Anaphor denotes Such function
R8507 T11517 T11518 boundBy these sites,their
R8508 T11519 T11517 boundBy they,these sites
R12094 T16608 T16609 boundBy these phospho-acceptor sites,phosphorylation sites
R13381 T18709 T18710 boundBy the LPS-inducible response,inducible
R13382 T18711 T18712 boundBy whose,gene
R13383 T18713 T18714 boundBy it,C/EBP-β
R13384 T18715 T18716 boundBy its,SerpinB2
R6961 T9524 T9525 boundBy this deletion,deletion
R819 T1287 T1288 boundBy Such function,inhibitor
R820 T1289 T1290 boundBy It,SerpinB2
R821 T1291 T1292 boundBy a factor,SerpinB2
R822 T1293 T1291 boundBy whose,a factor
R823 T1295 T1296 boundBy this site,C/EBP binding site
R824 T1297 T1295 boundBy its,this site
R10902 T14847 T14848 boundBy its,C/EBP-β
R9767 T13177 T13178 boundBy Nuclear Factor,C/EBP-β
R9768 T13179 T13177 boundBy that,Nuclear Factor
R9769 T13181 T13182 boundBy the respective protein,C/EBP-α
R9770 T13181 T13183 boundBy the respective protein,C/EBP-β
R9771 T13181 T13184 boundBy the respective protein,C/EBP-δ
R9772 T13181 T13185 boundBy the respective protein,C/EBP-ε

bionlp-st-ge-2016-test-proteins

Id Subject Object Predicate Lexical cue
T24616 33011-33019 Protein denotes SerpinB2
T24615 32901-32908 Protein denotes C/EBP-β
T24614 32730-32735 Protein denotes Cebpb
T24613 32475-32482 Protein denotes C/EBP-β
T24612 32439-32447 Protein denotes SerpinB2
T24611 32342-32347 Protein denotes Cebpb
T24610 32329-32334 Protein denotes Cebpb
T24609 32291-32299 Protein denotes SerpinB2
T24608 32217-32222 Protein denotes Cebpb
T24607 32191-32196 Protein denotes Cebpb
T24606 32150-32158 Protein denotes SerpinB2
T24605 32109-32117 Protein denotes SerpinB2
T24604 32055-32062 Protein denotes C/EBP-β
T23799 26307-26317 Protein denotes luciferase
T23798 26164-26201 Protein denotes SerpinB2 promoter-luciferase reporter
T23797 25983-25991 Protein denotes SerpinB2
T23796 25772-25780 Protein denotes SerpinB2
T23795 25687-25695 Protein denotes SerpinB2
T23418 24336-24364 Protein denotes purine box binding protein 1
T23417 24328-24332 Protein denotes PU.1
T23416 24320-24326 Protein denotes POU2F1
T23415 24289-24319 Protein denotes octamer transcription factor 1
T23414 24281-24285 Protein denotes Oct1
T23413 24140-24148 Protein denotes SerpinB2
T23412 23978-23986 Protein denotes SerpinB2
T18751 43936-43943 Protein denotes C/EBP-β
T18750 43789-43797 Protein denotes SerpinB2
T18749 43775-43782 Protein denotes C/EBP-β
T18748 43749-43757 Protein denotes SerpinB2
T18747 43726-43733 Protein denotes C/EBP-β
T18746 43659-43667 Protein denotes SerpinB2
T18745 43599-43606 Protein denotes C/EBP-β
T18744 43484-43492 Protein denotes SerpinB2
T18743 43472-43479 Protein denotes C/EBP-β
T18742 43339-43347 Protein denotes SerpinB2
T18741 43179-43183 Protein denotes IFNγ
T18740 43127-43134 Protein denotes C/EBP-β
T18739 43103-43107 Protein denotes gene
T18738 43076-43084 Protein denotes SerpinB2
T18737 42994-43002 Protein denotes SerpinB2
T18736 42912-42919 Protein denotes C/EBP-β
T18735 42878-42885 Protein denotes C/EBP-β
T18734 42677-42684 Protein denotes C/EBP-β
T18733 42618-42625 Protein denotes C/EBP-β
T18732 42181-42189 Protein denotes SerpinB2
T18731 42039-42047 Protein denotes SerpinB2
T18730 41880-41888 Protein denotes SerpinB2
T18729 41829-41837 Protein denotes SERPINB2
T18728 41682-41690 Protein denotes SerpinB2
T18727 41455-41463 Protein denotes SerpinB2
T18726 41391-41399 Protein denotes SerpinB2
T18725 41360-41367 Protein denotes C/EBP-β
T14036 31996-32004 Protein denotes SerpinB2
T14035 31903-31910 Protein denotes C/EBP-β
T14034 31821-31828 Protein denotes C/EBP-β
T14033 31765-31773 Protein denotes SerpinB2
T13192 30373-30380 Protein denotes C/EBP-α
T7243 14436-14446 Protein denotes Luciferase
T7242 14358-14362 Protein denotes S64A
T7241 14351-14356 Protein denotes T217A
T7240 14344-14349 Protein denotes T188A
T7239 14310-14342 Protein denotes C/EBP-β phospho-acceptor mutants
T7238 14299-14306 Protein denotes C/EBP-β
T7237 13971-13986 Protein denotes β-galactosidase
T7236 13963-13970 Protein denotes β-actin
T7235 13913-13923 Protein denotes luciferase
T7234 13849-13854 Protein denotes Cebpb
T7247 14745-14776 Protein denotes C/EBP-β phospho-acceptor mutant
T7246 14556-14571 Protein denotes β-Galactosidase
T7245 14528-14538 Protein denotes Luciferase
T7244 14497-14512 Protein denotes β-galactosidase
T4782 9241-9249 Protein denotes SerpinB2
T4781 9057-9079 Protein denotes SerpinB2 Reporter Gene
T1304 2933-2941 Protein denotes SerpinB2
T1303 2888-2899 Protein denotes plasminogen
T1302 2762-2765 Protein denotes uPA
T1301 2724-2760 Protein denotes urokinase-type plasminogen activator
T1300 2675-2683 Protein denotes SerpinB2
T1299 2608-2616 Protein denotes SerpinB2
T13191 29979-29986 Protein denotes C/EBP-ε
T13190 29967-29974 Protein denotes C/EBP-δ
T13189 29958-29965 Protein denotes C/EBP-β
T13188 29949-29956 Protein denotes C/EBP-α
T13187 29625-29633 Protein denotes SerpinB2
T13186 29546-29553 Protein denotes C/EBP-β
T8281 17108-17116 Protein denotes SerpinB2
T8280 16889-16901 Protein denotes Proteinase K
T8279 16719-16728 Protein denotes Protein G
T4800 11194-11202 Protein denotes SerpinB2
T4799 11061-11066 Protein denotes Xho I
T4798 11050-11056 Protein denotes EcoR I
T4797 10259-10267 Protein denotes SerpinB2
T4796 10200-10219 Protein denotes Luciferase reporter
T4795 10027-10035 Protein denotes SerpinB2
T4794 9944-9957 Protein denotes T4 DNA ligase
T4793 9883-9900 Protein denotes T4 DNA polymerase
T4792 9811-9816 Protein denotes Apo I
T4791 9799-9806 Protein denotes Hae III
T4790 9792-9797 Protein denotes Pac I
T4789 9783-9790 Protein denotes Bsu36 I
T4788 9775-9781 Protein denotes BstX I
T4787 9768-9773 Protein denotes Apa I
T4786 9761-9766 Protein denotes Sfi I
T4785 9721-9727 Protein denotes EcoR I
T4784 9552-9580 Protein denotes SerpinB2 luciferase reporter
T4783 9459-9467 Protein denotes SerpinB2
T16635 39715-39719 Protein denotes gene
T16626 39260-39268 Protein denotes SerpinB2
T16625 39215-39220 Protein denotes Cebpb
T16624 39199-39210 Protein denotes C/EBPβT217A
T16623 39166-39197 Protein denotes C/EBP-β phospho-acceptor mutant
T16622 39119-39127 Protein denotes SerpinB2
T16621 39096-39103 Protein denotes C/EBP-β
T16620 38971-38999 Protein denotes SerpinB2 luciferase reporter
T16619 38932-38937 Protein denotes Cebpb
T16618 38921-38928 Protein denotes C/EBP-β
T16617 38879-38884 Protein denotes Cebpb
T16616 38847-38875 Protein denotes SerpinB2 luciferase reporter
T16615 38705-38737 Protein denotes C/EBP-β phospho-acceptor mutants
T16614 38634-38642 Protein denotes SerpinB2
T16613 38563-38570 Protein denotes C/EBP-β
T16612 38473-38480 Protein denotes C/EBP-β
T16611 38427-38435 Protein denotes SerpinB2
T16610 38370-38377 Protein denotes C/EBP-β
T9037 17980-17988 Protein denotes SerpinB2
T9036 17860-17868 Protein denotes SerpinB2
T9035 17705-17713 Protein denotes SerpinB2
T9034 17543-17551 Protein denotes SerpinB2
T9033 17454-17462 Protein denotes SerpinB2
T3590 7064-7071 Protein denotes β-actin
T3589 7038-7043 Protein denotes Cebpb
T3588 7012-7020 Protein denotes SerpinB2
T3587 7003-7011 Protein denotes Serpinb2
T11530 27138-27146 Protein denotes SerpinB2
T11529 26972-26980 Protein denotes SerpinB2
T11528 26936-26946 Protein denotes luciferase
T11527 26755-26763 Protein denotes SerpinB2
T11526 26598-26606 Protein denotes SERPINB2
T11525 26506-26514 Protein denotes SerpinB2
T11524 25535-25543 Protein denotes SerpinB2
T11523 25411-25419 Protein denotes SerpinB2
T11522 25040-25082 Protein denotes SerpinB2 promoter-luciferase reporter gene
T11521 24603-24611 Protein denotes SerpinB2
T3825 8004-8012 Protein denotes SerpinB2
T3824 7369-7384 Protein denotes exonuclease III
T3823 7164-7172 Protein denotes SerpinB2
T157 25-32 Protein denotes C/EBP-β
T158 97-105 Protein denotes SerpinB2
T18724 41299-41307 Protein denotes SerpinB2
T18723 41226-41233 Protein denotes C/EBP-β
T18722 41205-41212 Protein denotes C/EBP-β
T18721 41148-41156 Protein denotes SerpinB2
T18720 41081-41089 Protein denotes SerpinB2
T18719 40995-40999 Protein denotes IKKβ
T18718 40931-40939 Protein denotes SerpinB2
T18717 40921-40929 Protein denotes SerpinB2
T12417 28496-28504 Protein denotes SerpinB2
T12416 28341-28348 Protein denotes albumin
T12415 27698-27705 Protein denotes albumin
T12414 27614-27622 Protein denotes SerpinB2
T12413 27565-27573 Protein denotes SerpinB2
T159 156-164 Protein denotes SerpinB2
T160 168-206 Protein denotes plasminogen activator inhibitor type 2
T161 208-213 Protein denotes PAI-2
T162 466-474 Protein denotes SerpinB2
T163 494-514 Protein denotes toll-like receptor 4
T164 516-520 Protein denotes TLR4
T165 608-616 Protein denotes SerpinB2
T166 723-731 Protein denotes SerpinB2
T167 1017-1025 Protein denotes SERPINB2
T168 1236-1244 Protein denotes SerpinB2
T169 1440-1447 Protein denotes C/EBP-β
T170 1478-1486 Protein denotes SerpinB2
T171 1544-1552 Protein denotes SerpinB2
T172 1590-1597 Protein denotes C/EBP-β
T173 1650-1657 Protein denotes C/EBP-β
T174 1738-1745 Protein denotes C/EBP-β
T175 1794-1802 Protein denotes SerpinB2
T14032 31612-31619 Protein denotes C/EBP-β
T14031 31463-31468 Protein denotes Cebpb
T14030 31408-31416 Protein denotes SerpinB2
T14029 31331-31339 Protein denotes SerpinB2
T14028 31275-31283 Protein denotes SerpinB2
T14027 31245-31252 Protein denotes C/EBP-β
T14026 31217-31225 Protein denotes SerpinB2
T14025 31160-31167 Protein denotes C/EBP-β
T14024 31094-31099 Protein denotes Cebpb
T14023 31063-31068 Protein denotes Cebpb
T14022 31049-31056 Protein denotes C/EBP-β
T14021 30992-31000 Protein denotes SerpinB2
T14020 30970-30977 Protein denotes C/EBP-β
T14019 30867-30875 Protein denotes SerpinB2
T14018 30816-30823 Protein denotes C/EBP-β
T10428 23559-23564 Protein denotes Oct-1
T10427 23538-23542 Protein denotes PU.1
T10426 23370-23378 Protein denotes SERPINB2
T10425 23005-23013 Protein denotes SERPINB2
T10424 22813-22821 Protein denotes SerpinB2
T10423 22758-22766 Protein denotes SerpinB2
T10422 22347-22355 Protein denotes SerpinB2
T10421 22159-22167 Protein denotes SerpinB2
T10420 22088-22096 Protein denotes SerpinB2
T10419 21971-21979 Protein denotes SerpinB2
T7825 14970-14994 Protein denotes T4 polynucleotide kinase
T6650 13733-13740 Protein denotes C/EBP-β
T6649 12923-12930 Protein denotes C/EBP-β
T6648 12802-12807 Protein denotes cebpb
T6647 12740-12745 Protein denotes cebpb
T4273 8982-8987 Protein denotes GAPDH
T4272 8940-8980 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4271 8893-8900 Protein denotes C/EBP-β
T4270 8771-8805 Protein denotes GST-murine SerpinB2 fusion protein
T22718 21442-21450 Protein denotes SerpinB2
T22717 21363-21371 Protein denotes SerpinB2
T22716 21177-21187 Protein denotes luciferase
T22715 20993-21030 Protein denotes SerpinB2 promoter-luciferase reporter
T22714 20881-20889 Protein denotes SerpinB2
T22713 20689-20699 Protein denotes luciferase
T22712 20546-20599 Protein denotes SerpinB2 promoter and 5′ deletion luciferase reporter
T22711 20484-20492 Protein denotes SerpinB2
T15768 36838-36846 Protein denotes SerpinB2
T15767 36802-36809 Protein denotes C/EBP-β
T15766 36750-36755 Protein denotes Cebpb
T15765 36719-36724 Protein denotes Cebpb
T15764 36661-36669 Protein denotes SerpinB2
T15763 36617-36622 Protein denotes Cebpb
T15762 36604-36609 Protein denotes Cebpb
T15761 36560-36588 Protein denotes SerpinB2 luciferase reporter
T15760 36480-36488 Protein denotes SerpinB2
T15759 36439-36446 Protein denotes C/EBP-β
T15758 36366-36374 Protein denotes SerpinB2
T15757 36299-36306 Protein denotes C/EBP-β
T15756 36173-36181 Protein denotes SerpinB2
T15755 36152-36159 Protein denotes C/EBP-β
T15754 36110-36118 Protein denotes SerpinB2
T15753 36072-36079 Protein denotes C/EBP-β
T7233 11300-11310 Protein denotes Luciferase
T5987 11495-11497 Protein denotes TK
T5986 11477-11493 Protein denotes thymidine kinase
T5985 11422-11432 Protein denotes luciferase
T5984 11300-11310 Protein denotes Luciferase
T3170 5807-5812 Protein denotes Cebpb
T3169 5783-5788 Protein denotes Cebpb
T1324 5344-5352 Protein denotes SerpinB2
T1323 5228-5236 Protein denotes SerpinB2
T1322 5153-5160 Protein denotes C/EBP-β
T1321 5111-5119 Protein denotes SerpinB2
T1320 5087-5095 Protein denotes SerpinB2
T1319 5001-5008 Protein denotes C/EBP-β
T1318 4914-4922 Protein denotes SerpinB2
T1317 4793-4801 Protein denotes SerpinB2
T1316 4722-4730 Protein denotes SerpinB2
T1315 4577-4585 Protein denotes SerpinB2
T1314 4511-4516 Protein denotes IFN-γ
T1313 4388-4396 Protein denotes SerpinB2
T1312 4299-4303 Protein denotes IKKβ
T1311 4208-4216 Protein denotes SerpinB2
T1310 3851-3855 Protein denotes TLR4
T1309 3653-3657 Protein denotes TLR4
T1308 3631-3651 Protein denotes toll-like receptor 4
T1307 3271-3279 Protein denotes SerpinB2
T1306 3096-3104 Protein denotes SerpinB2
T1305 2975-2983 Protein denotes SerpinB2
T22412 18593-18598 Protein denotes GAPDH
T22411 18520-18528 Protein denotes SerpinB2
T22410 18392-18399 Protein denotes β-actin
T22409 18358-18366 Protein denotes SerpinB2
T22408 18187-18195 Protein denotes SerpinB2
T13197 30806-30813 Protein denotes C/EBP-β
T13196 30630-30637 Protein denotes C/EBP-β
T13195 30403-30410 Protein denotes C/EBP-ε
T13194 30391-30398 Protein denotes C/EBP-δ
T13193 30382-30389 Protein denotes C/EBP-β
T9536 20296-20304 Protein denotes SerpinB2
T9535 20156-20164 Protein denotes SerpinB2
T9534 20037-20045 Protein denotes SerpinB2
T9533 19955-19963 Protein denotes SerpinB2
T9532 19595-19603 Protein denotes SerpinB2
T9531 19428-19436 Protein denotes SerpinB2
T9530 19195-19203 Protein denotes SerpinB2
T9529 19104-19114 Protein denotes luciferase
T9528 18941-18951 Protein denotes luciferase
T9527 18784-18792 Protein denotes SerpinB2
T9526 18626-18634 Protein denotes SerpinB2
T5994 12500-12502 Protein denotes TK
T5993 12472-12479 Protein denotes C/EBP-β
T5992 12390-12400 Protein denotes luciferase
T5991 12379-12381 Protein denotes TK
T5990 12331-12341 Protein denotes luciferase
T5989 12149-12159 Protein denotes Luciferase
T5988 12103-12113 Protein denotes Luciferase
T25351 35055-35063 Protein denotes SerpinB2
T25350 34990-34998 Protein denotes SerpinB2
T25349 34952-34959 Protein denotes C/EBP-β
T16649 40559-40567 Protein denotes SerpinB2
T16648 40516-40523 Protein denotes C/EBP-β
T16647 40409-40417 Protein denotes SerpinB2
T16646 40385-40396 Protein denotes C/EBP-βS64A
T16645 40333-40340 Protein denotes C/EBP-β
T16644 40277-40285 Protein denotes SerpinB2
T16643 40237-40249 Protein denotes C/EBP-βT188A
T16642 40211-40219 Protein denotes SerpinB2
T16641 40129-40137 Protein denotes SerpinB2
T16640 40117-40124 Protein denotes C/EBP-β
T16639 39945-39953 Protein denotes SerpinB2
T16638 39922-39927 Protein denotes MCP-1
T16637 39913-39917 Protein denotes IL-6
T16636 39802-39810 Protein denotes SerpinB2
T16634 39700-39704 Protein denotes IFNγ
T16633 39690-39695 Protein denotes DAPK1
T16632 39621-39629 Protein denotes SerpinB2
T16631 39603-39610 Protein denotes C/EBP-β
T16630 39478-39485 Protein denotes C/EBP-β
T16629 39431-39439 Protein denotes SerpinB2
T16628 39372-39379 Protein denotes C/EBP-β
T16627 39311-39318 Protein denotes C/EBP-β
T25360 36034-36038 Protein denotes rIgG
T25359 35957-35973 Protein denotes p-C/EBP-β (T217)
T25358 35948-35955 Protein denotes C/EBP-β
T25357 35685-35693 Protein denotes SerpinB2
T25356 35568-35576 Protein denotes SerpinB2
T25355 35429-35445 Protein denotes p-C/EBP-β (T217)
T25354 35420-35427 Protein denotes C/EBP-β
T25353 35324-35340 Protein denotes p-C/EBP-β (T217)
T25352 35313-35320 Protein denotes C/EBP-β
T18760 44644-44649 Protein denotes Cebpb
T18759 44628-44639 Protein denotes C/EBPβT217A
T18758 44590-44626 Protein denotes C/EBP-β phospho-acceptor site mutant
T18757 44550-44558 Protein denotes SerpinB2
T18756 44365-44372 Protein denotes C/EBP-β
T18755 44245-44252 Protein denotes C/EBP-β
T18754 44162-44169 Protein denotes C/EBP-β
T18753 44134-44142 Protein denotes SerpinB2
T18752 44008-44016 Protein denotes SerpinB2
T18775 45673-45677 Protein denotes MLK3
T18774 45649-45671 Protein denotes Mixed lineage kinase-3
T18773 45568-45576 Protein denotes SerpinB2
T18772 45376-45383 Protein denotes C/EBP-β
T18771 45342-45350 Protein denotes SerpinB2
T18770 45294-45301 Protein denotes C/EBP-β
T18769 45231-45239 Protein denotes SerpinB2
T18768 45184-45195 Protein denotes C/EBP-βS64A
T18767 45094-45102 Protein denotes SerpinB2
T18766 45065-45077 Protein denotes C/EBP-βT188A
T18765 45027-45063 Protein denotes C/EBP-β phospho-acceptor site mutant
T18764 44972-44980 Protein denotes SerpinB2
T18763 44789-44797 Protein denotes SerpinB2
T18762 44734-44741 Protein denotes C/EBP-β
T18761 44675-44683 Protein denotes SerpinB2
T26146 37476-37483 Protein denotes C/EBP-β
T26145 37446-37461 Protein denotes β-galactosidase
T26144 37415-37425 Protein denotes luciferase
T26143 37376-37400 Protein denotes β-galactosidase reporter
T26142 37334-37371 Protein denotes SerpinB2 promoter-luciferase reporter
T26141 37204-37241 Protein denotes SerpinB2 promoter-luciferase reporter
T26140 37165-37170 Protein denotes Cebpb
T26139 37152-37157 Protein denotes Cebpb
T26138 37108-37116 Protein denotes SerpinB2
T26137 37086-37091 Protein denotes Cebpb
T26136 37061-37066 Protein denotes Cebpb
T26135 36989-36997 Protein denotes SerpinB2
T26134 36944-36952 Protein denotes SerpinB2
T26133 36919-36926 Protein denotes C/EBP-β
T26152 37822-37859 Protein denotes SerpinB2 promoter-luciferase reporter
T26151 37763-37795 Protein denotes C/EBP-β phospho-acceptor mutants
T26150 37738-37745 Protein denotes C/EBP-β
T26149 37660-37665 Protein denotes Cebpb
T26148 37632-37640 Protein denotes SerpinB2
T26147 37575-37582 Protein denotes C/EBP-β
T24195 29173-29181 Protein denotes SerpinB2
T24194 29084-29091 Protein denotes albumin
T24193 29045-29052 Protein denotes albumin
T24192 28976-28984 Protein denotes SerpinB2
T24191 28920-28928 Protein denotes SerpinB2
T24190 28783-28790 Protein denotes C/EBP-β
T24189 28736-28744 Protein denotes SerpinB2
T18787 47226-47234 Protein denotes SerpinB2
T18786 47105-47113 Protein denotes SerpinB2
T18785 46976-46984 Protein denotes SerpinB2
T18784 46891-46899 Protein denotes SerpinB2
T18783 46682-46690 Protein denotes SerpinB2
T18782 46582-46589 Protein denotes C/EBP-β
T18781 46421-46428 Protein denotes C/EBP-β
T18780 46287-46295 Protein denotes SerpinB2
T18779 46110-46118 Protein denotes SerpinB2
T18778 45799-45803 Protein denotes MLK3
T18777 45737-45741 Protein denotes IFNγ
T18776 45707-45714 Protein denotes C/EBP-β
T26158 38207-38214 Protein denotes C/EBP-β
T26157 38129-38141 Protein denotes C/EBP-βT217A
T26156 38091-38123 Protein denotes C/EBP-β phospho-acceptor mutants
T26155 37987-38002 Protein denotes β-galactosidase
T26154 37934-37944 Protein denotes Luciferase
T26153 37864-37888 Protein denotes β-galactosidase reporter

bionlp-st-ge-2016-uniprot

Id Subject Object Predicate Lexical cue
T26512 37934-37944 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T26511 37840-37850 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T26510 37415-37425 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T26509 37352-37362 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T26508 37222-37232 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T26507 37822-37830 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T26506 37632-37640 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T26505 37334-37342 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T26504 37204-37212 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T26503 37108-37116 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T26502 36989-36997 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T26501 36944-36952 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T26500 37660-37665 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T26499 37165-37170 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T26498 37152-37157 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T26497 37086-37091 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T26496 37061-37066 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T26495 38091-38098 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T26494 37763-37770 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T26493 37738-37745 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T26492 37575-37582 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T26491 37476-37483 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T26490 36919-36926 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T25615 35685-35693 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T25614 35568-35576 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T25613 35055-35063 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T25612 34990-34998 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T25611 35959-35966 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T25610 35948-35955 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T25609 35431-35438 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T25608 35420-35427 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T25607 35326-35333 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T25606 35313-35320 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T25605 34952-34959 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T24865 33011-33019 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T24864 32439-32447 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T24863 32291-32299 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T23954 26307-26317 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T23953 26182-26192 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T23952 26164-26172 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T23951 25983-25991 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T23950 25772-25780 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T23949 25687-25695 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T22985 21011-21021 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T22984 20689-20699 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T22983 20580-20590 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T22982 21442-21450 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T22981 21363-21371 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T22980 20993-21001 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T22979 20881-20889 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T22978 20546-20554 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T22977 20484-20492 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T22511 18593-18598 http://www.uniprot.org/uniprot/P04406 denotes GAPDH
T22510 18392-18399 http://www.uniprot.org/uniprot/P60709 denotes β-actin
T22509 18520-18528 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T22508 18358-18366 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T22507 18187-18195 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20285 42826-42830 http://www.uniprot.org/uniprot/Q02930 denotes CREB
T20284 42652-42656 http://www.uniprot.org/uniprot/Q02930 denotes CREB
T20269 41743-41747 http://www.uniprot.org/uniprot/P05412 denotes AP-1
T20268 44644-44649 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T20267 46421-46428 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20266 45707-45714 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20265 45376-45383 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20264 45294-45301 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20263 45027-45034 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20262 44734-44741 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20261 44590-44597 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20260 44365-44372 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20259 44245-44252 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20258 44162-44169 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20257 43936-43943 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20256 43775-43782 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20255 43726-43733 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20254 43599-43606 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20253 43472-43479 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20252 43394-43401 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20251 43127-43134 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20250 42912-42919 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20249 42878-42885 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20248 42677-42684 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20247 42618-42625 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20246 41360-41367 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20245 41226-41233 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20244 41205-41212 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20243 40995-40999 http://www.uniprot.org/uniprot/O14920 denotes IKKβ
T20242 41829-41837 http://www.uniprot.org/uniprot/P05120 denotes SERPINB2
T20241 47105-47113 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20240 46976-46984 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20239 46891-46899 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20238 46682-46690 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20237 46287-46295 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20236 46110-46118 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20235 45568-45576 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20234 45342-45350 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20233 45231-45239 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20232 45094-45102 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20231 44972-44980 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20230 44789-44797 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20229 44675-44683 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20228 44550-44558 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20227 44134-44142 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20226 44008-44016 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20225 43789-43797 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20224 43749-43757 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20223 43659-43667 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20222 43484-43492 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20221 43339-43347 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20220 43076-43084 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20219 42994-43002 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20218 42181-42189 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20217 42039-42047 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20216 41880-41888 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20215 41682-41690 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20214 41455-41463 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20213 41391-41399 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20212 41299-41307 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20211 41148-41156 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20210 41081-41089 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20209 40931-40939 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T20208 40921-40929 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17216 39913-39917 http://www.uniprot.org/uniprot/P05231 denotes IL-6
T17215 39690-39695 http://www.uniprot.org/uniprot/P53355 denotes DAPK1
T17214 38980-38990 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T17213 38856-38866 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T17212 40559-40567 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17211 40409-40417 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17210 40277-40285 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17209 40211-40219 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17208 40129-40137 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17207 39945-39953 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17206 39802-39810 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17205 39621-39629 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17204 39431-39439 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15962 36569-36579 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T15961 36838-36846 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15960 36661-36669 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15959 36560-36568 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15958 36480-36488 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15957 36366-36374 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15956 36173-36181 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15955 36110-36118 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15954 36750-36755 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T15953 36719-36724 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T15952 36617-36622 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T15951 36604-36609 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T15950 36439-36446 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T15949 36299-36306 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T15948 36152-36159 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T15947 36072-36079 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T14300 31821-31828 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T14299 31612-31619 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T14298 31245-31252 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T14297 31160-31167 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T14296 31049-31056 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T14295 30970-30977 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T14294 30816-30823 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T14309 31996-32004 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T14308 31765-31773 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T14307 31408-31416 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T14306 31331-31339 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T14305 31275-31283 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T14304 31217-31225 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T14303 30992-31000 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T14302 30867-30875 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T14301 31903-31910 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T13471 29625-29633 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T13470 30806-30813 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T13469 30630-30637 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T13468 30382-30389 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T11888 25170-25174 http://www.uniprot.org/uniprot/P17947 denotes PU.1
T11887 26936-26946 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T11886 25058-25068 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T11885 26598-26606 http://www.uniprot.org/uniprot/P05120 denotes SERPINB2
T11884 26972-26980 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T8012 15713-15720 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T4445 8982-8987 http://www.uniprot.org/uniprot/P04406 denotes GAPDH
T4444 8955-8980 http://www.uniprot.org/uniprot/P04406 denotes 3-phosphate dehydrogenase
T4443 8893-8900 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T4442 8782-8790 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T4441 8690-8698 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T4013 8004-8012 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T4012 7164-7172 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2119 5228-5236 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2118 5111-5119 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2117 5087-5095 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2116 4914-4922 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2115 4793-4801 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2114 4722-4730 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2113 4577-4585 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2112 4388-4396 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2111 4208-4216 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2110 3271-3279 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2109 3096-3104 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2108 2975-2983 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2107 2933-2941 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2106 2675-2683 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2105 2608-2616 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2104 2555-2564 http://www.uniprot.org/uniprot/E2RVI8 denotes ovalbumin
T541 1177-1196 http://www.uniprot.org/uniprot/P10145 denotes activator protein 1
T540 1195-1200 http://www.uniprot.org/uniprot/P05412 denotes 1 (AP
T539 516-520 http://www.uniprot.org/uniprot/O00206 denotes TLR4
T538 1017-1025 http://www.uniprot.org/uniprot/P05120 denotes SERPINB2
T525 1440-1447 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T526 1590-1597 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T527 1650-1657 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T528 1738-1745 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T530 156-164 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T531 466-474 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T532 608-616 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T533 723-731 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T534 1236-1244 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T535 1478-1486 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T536 1544-1552 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T537 205-211 http://www.uniprot.org/uniprot/P05120 denotes 2 (PAI
T524 25-32 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T529 97-105 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T2127 4323-4327 http://www.uniprot.org/uniprot/O43889 denotes CREB
T2126 4323-4327 http://www.uniprot.org/uniprot/P16220 denotes CREB
T2125 4323-4327 http://www.uniprot.org/uniprot/Q8TEY5 denotes CREB
T2124 4323-4327 http://www.uniprot.org/uniprot/P18848 denotes CREB
T2123 4299-4303 http://www.uniprot.org/uniprot/O14920 denotes IKKβ
T2122 3851-3855 http://www.uniprot.org/uniprot/O00206 denotes TLR4
T2121 3653-3657 http://www.uniprot.org/uniprot/O00206 denotes TLR4
T2120 2711-2733 http://www.uniprot.org/uniprot/P05120 denotes inhibitor of urokinase
T13467 29958-29965 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T13466 29546-29553 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T12702 28496-28504 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T12701 27614-27622 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T12700 27565-27573 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9196 17705-17713 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9195 17543-17551 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9194 17454-17462 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9198 17980-17988 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9197 17860-17868 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T8560 17108-17116 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T8559 16521-16528 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T8558 16500-16507 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T6874 13733-13740 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T6873 12923-12930 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T6872 12802-12807 http://www.uniprot.org/uniprot/P28033 denotes cebpb
T6871 12740-12745 http://www.uniprot.org/uniprot/P28033 denotes cebpb
T6265 12472-12479 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T6264 12390-12400 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T6263 12331-12341 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T6262 12149-12159 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T6261 12103-12113 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T6260 11300-11310 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T2132 5153-5160 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T2131 5001-5008 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T2130 4511-4516 http://www.uniprot.org/uniprot/P01579 denotes IFN-γ
T2129 4323-4327 http://www.uniprot.org/uniprot/Q02930 denotes CREB
T2128 4323-4327 http://www.uniprot.org/uniprot/P15336 denotes CREB
T24854 32475-32482 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T24853 32055-32062 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T24253 28783-28790 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T24252 29173-29181 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T24251 28976-28984 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T24250 28920-28928 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T24249 28736-28744 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T23561 24347-24364 http://www.uniprot.org/uniprot/Q9UFW8 denotes binding protein 1
T23560 24347-24364 http://www.uniprot.org/uniprot/Q13541 denotes binding protein 1
T23559 24347-24364 http://www.uniprot.org/uniprot/Q86VP1 denotes binding protein 1
T23558 24347-24364 http://www.uniprot.org/uniprot/O00560 denotes binding protein 1
T23557 24328-24332 http://www.uniprot.org/uniprot/P17947 denotes PU.1
T23556 24185-24207 http://www.uniprot.org/uniprot/P10145 denotes 1 =  activator protein
T23555 24185-24207 http://www.uniprot.org/uniprot/P05412 denotes 1 =  activator protein
T23554 24140-24148 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T23553 23978-23986 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T22988 21674-21677 http://www.uniprot.org/uniprot/P47928 denotes ID4
T22987 21667-21670 http://www.uniprot.org/uniprot/P47928 denotes ID4
T22986 21177-21187 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T24862 32150-32158 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T24861 32109-32117 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T24860 32941-32946 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T24859 32730-32735 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T24858 32342-32347 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T24857 32329-32334 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T24856 32217-32222 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T24855 32191-32196 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T5247 10307-10311 http://www.uniprot.org/uniprot/P17947 denotes PU.1
T5246 10200-10210 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T5245 9561-9571 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T5244 11194-11202 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5243 10259-10267 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5242 10027-10035 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5241 9552-9560 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5240 9459-9467 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5239 9241-9249 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5238 9057-9065 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T10844 22813-22821 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T10843 22758-22766 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T10842 22347-22355 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T10841 22159-22167 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T10840 22088-22096 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T10839 21971-21979 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9899 19355-19359 http://www.uniprot.org/uniprot/P05412 denotes AP-1
T9898 19104-19114 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T9897 18941-18951 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T9896 20296-20304 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9895 20156-20164 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9894 20037-20045 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9893 19955-19963 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9892 19595-19603 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9891 19428-19436 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9890 19195-19203 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9889 18784-18792 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T9888 18626-18634 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T7497 13963-13970 http://www.uniprot.org/uniprot/P60709 denotes β-actin
T7496 14745-14752 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T7495 14310-14317 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T7494 14299-14306 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T7493 13849-13854 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T7492 14528-14538 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T7491 14436-14446 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T7490 11300-11310 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T11883 26755-26763 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T11882 26506-26514 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T11881 25535-25543 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T11880 25411-25419 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T11879 25040-25048 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T11878 24603-24611 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T11877 27059-27063 http://www.uniprot.org/uniprot/P05412 denotes AP-1
T11876 26849-26853 http://www.uniprot.org/uniprot/P05412 denotes AP-1
T11875 26481-26485 http://www.uniprot.org/uniprot/P05412 denotes AP-1
T11874 24578-24582 http://www.uniprot.org/uniprot/P05412 denotes AP-1
T10851 23766-23769 http://www.uniprot.org/uniprot/P21579 denotes p65
T10850 23766-23769 http://www.uniprot.org/uniprot/Q04206 denotes p65
T10849 23538-23542 http://www.uniprot.org/uniprot/P17947 denotes PU.1
T10848 23300-23304 http://www.uniprot.org/uniprot/P05412 denotes AP-1
T10847 23143-23148 http://www.uniprot.org/uniprot/P05412 denotes 1 (AP
T10846 23370-23378 http://www.uniprot.org/uniprot/P05120 denotes SERPINB2
T10845 23005-23013 http://www.uniprot.org/uniprot/P05120 denotes SERPINB2
T17203 39260-39268 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17202 39119-39127 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17201 38971-38979 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17200 38847-38855 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17199 38634-38642 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17198 38427-38435 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T17197 39215-39220 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T17196 38932-38937 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T17195 38879-38884 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T17194 40333-40340 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17193 40117-40124 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17192 39603-39610 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17191 39478-39485 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17190 39372-39379 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17189 39311-39318 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17188 39166-39173 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17187 39096-39103 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17186 38921-38928 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17185 38705-38712 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17184 38563-38570 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17183 38473-38480 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T17182 38370-38377 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T20283 42826-42830 http://www.uniprot.org/uniprot/P15336 denotes CREB
T20282 42652-42656 http://www.uniprot.org/uniprot/P15336 denotes CREB
T20281 42826-42830 http://www.uniprot.org/uniprot/O43889 denotes CREB
T20280 42652-42656 http://www.uniprot.org/uniprot/O43889 denotes CREB
T20279 42826-42830 http://www.uniprot.org/uniprot/P16220 denotes CREB
T20278 42652-42656 http://www.uniprot.org/uniprot/P16220 denotes CREB
T20277 42826-42830 http://www.uniprot.org/uniprot/Q8TEY5 denotes CREB
T20276 42652-42656 http://www.uniprot.org/uniprot/Q8TEY5 denotes CREB
T20275 42826-42830 http://www.uniprot.org/uniprot/P18848 denotes CREB
T20274 42652-42656 http://www.uniprot.org/uniprot/P18848 denotes CREB
T20273 42634-42656 http://www.uniprot.org/uniprot/Q92793 denotes binding proteins (CREB
T20272 42731-42735 http://www.uniprot.org/uniprot/P05412 denotes AP-1
T20271 42662-42666 http://www.uniprot.org/uniprot/P05412 denotes AP-1
T20270 42504-42508 http://www.uniprot.org/uniprot/P05412 denotes AP-1
T15192 34842-34850 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15191 34547-34555 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15190 34387-34395 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15189 34203-34211 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15188 33826-33834 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15187 33691-33699 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15186 33388-33396 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15185 33251-33259 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T15184 34774-34781 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T15183 34697-34704 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T15182 34492-34499 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T15181 34257-34264 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T15180 34060-34067 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T15179 33785-33792 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T15178 33354-33361 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T15177 33226-33233 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T3680 7064-7071 http://www.uniprot.org/uniprot/P60709 denotes β-actin
T3679 7038-7043 http://www.uniprot.org/uniprot/P28033 denotes Cebpb

UBERON-AE

Id Subject Object Predicate Lexical cue
T23397 24337-24343 http://purl.obolibrary.org/obo/UBERON_0001088 denotes urine
T23396 24134-24140 http://purl.obolibrary.org/obo/UBERON_0001088 denotes urine
T10388 23437-23444 http://purl.obolibrary.org/obo/UBERON_0012131 denotes central
T9012 17813-17818 http://purl.obolibrary.org/obo/UBERON_0000178 denotes blood
T9468 19229-19240 http://purl.obolibrary.org/obo/UBERON_2000106 denotes extensively
T5964 11915-11921 http://purl.obolibrary.org/obo/UBERON_0000479 denotes tissue
T4259 8566-8570 http://purl.obolibrary.org/obo/UBERON_0001913 denotes milk
T3158 6355-6360 http://purl.obolibrary.org/obo/UBERON_0001977 denotes serum
T3157 5954-5959 http://purl.obolibrary.org/obo/UBERON_0001977 denotes serum
T3156 5546-5551 http://purl.obolibrary.org/obo/UBERON_0001977 denotes serum
T1202 3742-3749 http://purl.obolibrary.org/obo/UBERON_0012131 denotes central
T1201 2018-2023 http://purl.obolibrary.org/obo/UBERON_0000062 denotes organ

GO-BP

Id Subject Object Predicate Lexical cue
T176 4-17 http://purl.obolibrary.org/obo/GO_0006351 denotes Transcription
T177 73-86 http://purl.obolibrary.org/obo/GO_0006351 denotes Transcription
T26178 37934-37953 http://purl.obolibrary.org/obo/GO_0050397 denotes Luciferase activity
T26177 37934-37953 http://purl.obolibrary.org/obo/GO_0050248 denotes Luciferase activity
T26176 37934-37953 http://purl.obolibrary.org/obo/GO_0047712 denotes Luciferase activity
T26175 37934-37953 http://purl.obolibrary.org/obo/GO_0047077 denotes Luciferase activity
T26174 37934-37953 http://purl.obolibrary.org/obo/GO_0045289 denotes Luciferase activity
T26173 37556-37571 http://purl.obolibrary.org/obo/GO_0016310 denotes Phosphorylation
T26172 37987-38011 http://purl.obolibrary.org/obo/GO_0033930 denotes β-galactosidase activity
T26171 37446-37470 http://purl.obolibrary.org/obo/GO_0033930 denotes β-galactosidase activity
T26170 37987-38011 http://purl.obolibrary.org/obo/GO_0033929 denotes β-galactosidase activity
T26169 37446-37470 http://purl.obolibrary.org/obo/GO_0033929 denotes β-galactosidase activity
T26168 37987-38011 http://purl.obolibrary.org/obo/GO_0033920 denotes β-galactosidase activity
T26167 37446-37470 http://purl.obolibrary.org/obo/GO_0033920 denotes β-galactosidase activity
T26166 37987-38011 http://purl.obolibrary.org/obo/GO_1903770 denotes β-galactosidase activity
T26165 37446-37470 http://purl.obolibrary.org/obo/GO_1903770 denotes β-galactosidase activity
T26164 37987-38011 http://purl.obolibrary.org/obo/GO_1903771 denotes β-galactosidase activity
T26163 37446-37470 http://purl.obolibrary.org/obo/GO_1903771 denotes β-galactosidase activity
T26162 37987-38011 http://purl.obolibrary.org/obo/GO_0004336 denotes β-galactosidase activity
T26161 37446-37470 http://purl.obolibrary.org/obo/GO_0004336 denotes β-galactosidase activity
T26160 37987-38011 http://purl.obolibrary.org/obo/GO_0004565 denotes β-galactosidase activity
T26159 37446-37470 http://purl.obolibrary.org/obo/GO_0004565 denotes β-galactosidase activity
T25366 36039-36045 http://purl.obolibrary.org/obo/GO_0023052 denotes signal
T25365 35447-35464 http://purl.obolibrary.org/obo/GO_0003899 denotes RNA Polymerase II
T25364 35447-35464 http://purl.obolibrary.org/obo/GO_0001055 denotes RNA Polymerase II
T25363 35447-35464 http://purl.obolibrary.org/obo/GO_1990114 denotes RNA Polymerase II
T25362 35719-35732 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T25361 35017-35030 http://purl.obolibrary.org/obo/GO_0006351 denotes Transcription
T23804 26307-26326 http://purl.obolibrary.org/obo/GO_0050397 denotes luciferase activity
T23803 26307-26326 http://purl.obolibrary.org/obo/GO_0050248 denotes luciferase activity
T23802 26307-26326 http://purl.obolibrary.org/obo/GO_0047712 denotes luciferase activity
T23801 26307-26326 http://purl.obolibrary.org/obo/GO_0047077 denotes luciferase activity
T23800 26307-26326 http://purl.obolibrary.org/obo/GO_0045289 denotes luciferase activity
T22719 21889-21902 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T23421 24379-24392 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T23420 24297-24310 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T23419 24258-24271 http://purl.obolibrary.org/obo/GO_0051591 denotes cAMP response
T18843 46772-46797 http://purl.obolibrary.org/obo/GO_0002418 denotes immune cells in the tumor
T18842 46470-46479 http://purl.obolibrary.org/obo/GO_0046903 denotes secretion
T18841 46461-46479 http://purl.obolibrary.org/obo/GO_0050663 denotes cytokine secretion
T18840 46365-46382 http://purl.obolibrary.org/obo/GO_0030010 denotes cell polarization
T18839 45864-45882 http://purl.obolibrary.org/obo/GO_0007165 denotes signaling pathways
T18838 45752-45770 http://purl.obolibrary.org/obo/GO_0007165 denotes signaling pathways
T18837 45811-45828 http://purl.obolibrary.org/obo/GO_0016311 denotes dephosphorylation
T18836 45686-45703 http://purl.obolibrary.org/obo/GO_0016311 denotes dephosphorylation
T18835 45477-45494 http://purl.obolibrary.org/obo/GO_0016311 denotes dephosphorylation
T18834 44441-44450 http://purl.obolibrary.org/obo/GO_0097194 denotes apoptosis
T18833 44441-44450 http://purl.obolibrary.org/obo/GO_0006915 denotes apoptosis
T18832 44321-44336 http://purl.obolibrary.org/obo/GO_2000144 denotes transactivation
T18831 45275-45290 http://purl.obolibrary.org/obo/GO_0016310 denotes phosphorylation
T18830 44226-44241 http://purl.obolibrary.org/obo/GO_0016310 denotes Phosphorylation
T18829 47188-47198 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T18828 44958-44968 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T18827 44120-44130 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T18826 44088-44093 http://purl.obolibrary.org/obo/GO_0016265 denotes death
T18825 44083-44093 http://purl.obolibrary.org/obo/GO_0008219 denotes cell death
T18824 47202-47214 http://purl.obolibrary.org/obo/GO_0006954 denotes inflammation
T18823 46160-46172 http://purl.obolibrary.org/obo/GO_0006954 denotes inflammation
T18822 45981-45993 http://purl.obolibrary.org/obo/GO_0006954 denotes inflammation
T18821 44212-44224 http://purl.obolibrary.org/obo/GO_0006954 denotes inflammation
T18820 43826-43838 http://purl.obolibrary.org/obo/GO_0006954 denotes inflammation
T18819 42849-42870 http://purl.obolibrary.org/obo/GO_0006355 denotes control transcription
T18818 47235-47250 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T18817 46985-47000 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T18816 44981-44996 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T18815 44143-44158 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T18814 43758-43773 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T18813 42758-42773 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T18812 41427-41442 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T18811 41112-41127 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T18810 41039-41054 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T18809 45864-45873 http://purl.obolibrary.org/obo/GO_0023052 denotes signaling
T18808 45752-45761 http://purl.obolibrary.org/obo/GO_0023052 denotes signaling
T18807 41018-41027 http://purl.obolibrary.org/obo/GO_0023052 denotes signaling
T18806 46661-46674 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T18805 45551-45564 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T18804 43498-43511 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T18803 43008-43021 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T18802 42857-42870 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T18801 42011-42024 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T18800 41802-41815 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T18799 41564-41577 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T18798 41405-41418 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T18797 41095-41108 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T18796 40943-40960 http://purl.obolibrary.org/obo/GO_0006351 denotes transcriptionally
T18795 40901-40913 http://purl.obolibrary.org/obo/GO_0043066 denotes pro-survival
T18794 40652-40667 http://purl.obolibrary.org/obo/GO_0006955 denotes immune response
T18793 40645-40667 http://purl.obolibrary.org/obo/GO_0045824 denotes innate immune response
T18792 40645-40667 http://purl.obolibrary.org/obo/GO_0045089 denotes innate immune response
T18791 40645-40667 http://purl.obolibrary.org/obo/GO_0002218 denotes innate immune response
T18790 40645-40667 http://purl.obolibrary.org/obo/GO_0045088 denotes innate immune response
T18789 40645-40667 http://purl.obolibrary.org/obo/GO_0002227 denotes innate immune response
T18788 40645-40667 http://purl.obolibrary.org/obo/GO_0045087 denotes innate immune response
T16680 39922-39925 http://purl.obolibrary.org/obo/GO_0004298 denotes MCP
T16679 39765-39774 http://purl.obolibrary.org/obo/GO_0097194 denotes apoptosis
T16678 39765-39774 http://purl.obolibrary.org/obo/GO_0006915 denotes apoptosis
T16677 39750-39760 http://purl.obolibrary.org/obo/GO_0007049 denotes cell cycle
T16676 39736-39760 http://purl.obolibrary.org/obo/GO_0071156 denotes regulation of cell cycle
T16675 39736-39760 http://purl.obolibrary.org/obo/GO_0045786 denotes regulation of cell cycle
T16674 39736-39760 http://purl.obolibrary.org/obo/GO_0007346 denotes regulation of cell cycle
T16673 39736-39760 http://purl.obolibrary.org/obo/GO_0045787 denotes regulation of cell cycle
T16672 39736-39760 http://purl.obolibrary.org/obo/GO_0032465 denotes regulation of cell cycle
T16671 39736-39760 http://purl.obolibrary.org/obo/GO_0010564 denotes regulation of cell cycle
T16670 39736-39760 http://purl.obolibrary.org/obo/GO_1901976 denotes regulation of cell cycle
T16669 39736-39760 http://purl.obolibrary.org/obo/GO_0051445 denotes regulation of cell cycle
T16668 39736-39760 http://purl.obolibrary.org/obo/GO_0051726 denotes regulation of cell cycle
T16667 40439-40454 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T16666 39461-39476 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T16665 40427-40447 http://purl.obolibrary.org/obo/GO_0014823 denotes activity in response
T16664 39449-39469 http://purl.obolibrary.org/obo/GO_0014823 denotes activity in response
T16663 39736-39746 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T16662 39417-39427 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T16661 39882-39895 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T16660 39635-39648 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T16659 39133-39146 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T16658 40220-40235 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T16657 39000-39015 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T16656 38516-38531 http://purl.obolibrary.org/obo/GO_2000144 denotes transactivation
T16655 40497-40512 http://purl.obolibrary.org/obo/GO_0016310 denotes phosphorylation
T16654 39506-39521 http://purl.obolibrary.org/obo/GO_0016310 denotes phosphorylation
T16653 39353-39368 http://purl.obolibrary.org/obo/GO_0016310 denotes phosphorylation
T16652 38571-38586 http://purl.obolibrary.org/obo/GO_0016310 denotes phosphorylation
T16651 38454-38469 http://purl.obolibrary.org/obo/GO_0016310 denotes Phosphorylation
T16650 38351-38366 http://purl.obolibrary.org/obo/GO_0016310 denotes Phosphorylation
T15771 36396-36411 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T15770 36457-36470 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T15769 36343-36356 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T14854 34819-34832 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T14853 34068-34083 http://purl.obolibrary.org/obo/GO_0016310 denotes phosphorylation
T14852 33636-33649 http://purl.obolibrary.org/obo/GO_0006277 denotes DNA amplified
T14851 34863-34878 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T14850 33953-33968 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T14849 33409-33424 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T14038 31968-31981 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T14037 31020-31035 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T13208 30652-30661 http://purl.obolibrary.org/obo/GO_0009058 denotes formation
T13207 30179-30188 http://purl.obolibrary.org/obo/GO_0009058 denotes formation
T13206 30045-30074 http://purl.obolibrary.org/obo/GO_0043011 denotes differentiating myeloid cells
T13205 30045-30074 http://purl.obolibrary.org/obo/GO_0030099 denotes differentiating myeloid cells
T13204 30045-30074 http://purl.obolibrary.org/obo/GO_0002318 denotes differentiating myeloid cells
T13203 30045-30074 http://purl.obolibrary.org/obo/GO_0045639 denotes differentiating myeloid cells
T13202 30045-30074 http://purl.obolibrary.org/obo/GO_0045638 denotes differentiating myeloid cells
T13201 29773-29785 http://purl.obolibrary.org/obo/GO_0006954 denotes inflammation
T13200 29744-29752 http://purl.obolibrary.org/obo/GO_0007349 denotes cellular
T13199 29829-29842 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T13198 29693-29706 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T12418 28617-28630 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T11542 26936-26955 http://purl.obolibrary.org/obo/GO_0050397 denotes luciferase activity
T11541 26936-26955 http://purl.obolibrary.org/obo/GO_0050248 denotes luciferase activity
T11540 26936-26955 http://purl.obolibrary.org/obo/GO_0047712 denotes luciferase activity
T11539 26936-26955 http://purl.obolibrary.org/obo/GO_0047077 denotes luciferase activity
T11538 26936-26955 http://purl.obolibrary.org/obo/GO_0045289 denotes luciferase activity
T11537 26728-26740 http://purl.obolibrary.org/obo/GO_0032496 denotes LPS response
T11536 27115-27128 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T11535 24987-25000 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T11534 24892-24905 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T11533 24825-24838 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T11532 24774-24787 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T11531 24675-24688 http://purl.obolibrary.org/obo/GO_0006351 denotes Transcription
T10440 23674-23687 http://purl.obolibrary.org/obo/GO_0001101 denotes acid response
T10439 23665-23687 http://purl.obolibrary.org/obo/GO_0032526 denotes retinoic acid response
T10438 23665-23687 http://purl.obolibrary.org/obo/GO_0071300 denotes retinoic acid response
T10437 23229-23248 http://purl.obolibrary.org/obo/GO_0051591 denotes cyclic AMP response
T10436 23229-23248 http://purl.obolibrary.org/obo/GO_0071320 denotes cyclic AMP response
T10435 22356-22371 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T10434 22333-22343 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T10433 22593-22605 http://purl.obolibrary.org/obo/GO_0032496 denotes LPS response
T10432 22110-22125 http://purl.obolibrary.org/obo/GO_0032496 denotes response to LPS
T10431 22921-22934 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T10430 22258-22271 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T10429 22060-22073 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T9547 20127-20139 http://purl.obolibrary.org/obo/GO_1904627 denotes PMA response
T9546 20087-20099 http://purl.obolibrary.org/obo/GO_0032496 denotes LPS response
T9545 19861-19873 http://purl.obolibrary.org/obo/GO_0032496 denotes LPS response
T9544 19791-19803 http://purl.obolibrary.org/obo/GO_0032496 denotes LPS-response
T9039 17932-17957 http://purl.obolibrary.org/obo/GO_0048255 denotes stabilization of the mRNA
T9038 17914-17927 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T6652 13648-13654 http://purl.obolibrary.org/obo/GO_0040007 denotes growth
T6651 12631-12643 http://purl.obolibrary.org/obo/GO_0009293 denotes Transduction
T6000 12419-12427 http://purl.obolibrary.org/obo/GO_0007349 denotes cellular
T5999 12103-12122 http://purl.obolibrary.org/obo/GO_0050397 denotes Luciferase activity
T5998 12103-12122 http://purl.obolibrary.org/obo/GO_0050248 denotes Luciferase activity
T5997 12103-12122 http://purl.obolibrary.org/obo/GO_0047712 denotes Luciferase activity
T5996 12103-12122 http://purl.obolibrary.org/obo/GO_0047077 denotes Luciferase activity
T5995 12103-12122 http://purl.obolibrary.org/obo/GO_0045289 denotes Luciferase activity
T1367 3940-3969 http://purl.obolibrary.org/obo/GO_0032111 denotes activation of protein kinases
T1366 4032-4056 http://purl.obolibrary.org/obo/GO_0030295 denotes activated protein kinase
T1365 3940-3969 http://purl.obolibrary.org/obo/GO_0030295 denotes activation of protein kinases
T1364 4032-4056 http://purl.obolibrary.org/obo/GO_0032147 denotes activated protein kinase
T1363 3940-3969 http://purl.obolibrary.org/obo/GO_0032147 denotes activation of protein kinases
T1362 4032-4056 http://purl.obolibrary.org/obo/GO_0034199 denotes activated protein kinase
T1361 3940-3969 http://purl.obolibrary.org/obo/GO_0034199 denotes activation of protein kinases
T1360 3562-3588 http://purl.obolibrary.org/obo/GO_0002922 denotes activates immune responses
T1359 3562-3588 http://purl.obolibrary.org/obo/GO_0002253 denotes activates immune responses
T1358 3185-3197 http://purl.obolibrary.org/obo/GO_0009293 denotes transduction
T1357 3606-3625 http://purl.obolibrary.org/obo/GO_0007165 denotes signalling pathways
T1356 3178-3197 http://purl.obolibrary.org/obo/GO_0007165 denotes signal transduction
T1355 3982-3989 http://purl.obolibrary.org/obo/GO_0023052 denotes signals
T1354 3606-3616 http://purl.obolibrary.org/obo/GO_0023052 denotes signalling
T1353 3178-3184 http://purl.obolibrary.org/obo/GO_0023052 denotes signal
T1352 2809-2820 http://purl.obolibrary.org/obo/GO_0009056 denotes degradation
T1351 2874-2899 http://purl.obolibrary.org/obo/GO_0031639 denotes activation of plasminogen
T1350 2739-2760 http://purl.obolibrary.org/obo/GO_0031639 denotes plasminogen activator
T1349 2570-2595 http://purl.obolibrary.org/obo/GO_0004867 denotes serine protease inhibitor
T1348 2460-2485 http://purl.obolibrary.org/obo/GO_0002250 denotes adaptive immune responses
T1347 2460-2485 http://purl.obolibrary.org/obo/GO_0002819 denotes adaptive immune responses
T1346 2460-2485 http://purl.obolibrary.org/obo/GO_0002821 denotes adaptive immune responses
T1345 2460-2485 http://purl.obolibrary.org/obo/GO_0002820 denotes adaptive immune responses
T1344 2445-2456 http://purl.obolibrary.org/obo/GO_0032502 denotes development
T1343 3783-3799 http://purl.obolibrary.org/obo/GO_0006955 denotes immune responses
T1342 3572-3588 http://purl.obolibrary.org/obo/GO_0006955 denotes immune responses
T1341 2469-2485 http://purl.obolibrary.org/obo/GO_0006955 denotes immune responses
T1340 2349-2365 http://purl.obolibrary.org/obo/GO_0006955 denotes immune responses
T1339 3776-3799 http://purl.obolibrary.org/obo/GO_0045824 denotes innate immune responses
T1338 2342-2365 http://purl.obolibrary.org/obo/GO_0045824 denotes innate immune responses
T1337 3776-3799 http://purl.obolibrary.org/obo/GO_0045089 denotes innate immune responses
T1336 2342-2365 http://purl.obolibrary.org/obo/GO_0045089 denotes innate immune responses
T1335 3776-3799 http://purl.obolibrary.org/obo/GO_0002218 denotes innate immune responses
T1334 2342-2365 http://purl.obolibrary.org/obo/GO_0002218 denotes innate immune responses
T1333 3776-3799 http://purl.obolibrary.org/obo/GO_0045088 denotes innate immune responses
T1332 2342-2365 http://purl.obolibrary.org/obo/GO_0045088 denotes innate immune responses
T1331 3776-3799 http://purl.obolibrary.org/obo/GO_0002227 denotes innate immune responses
T1330 2342-2365 http://purl.obolibrary.org/obo/GO_0002227 denotes innate immune responses
T1329 3776-3799 http://purl.obolibrary.org/obo/GO_0045087 denotes innate immune responses
T1328 2342-2365 http://purl.obolibrary.org/obo/GO_0045087 denotes innate immune responses
T1327 2342-2355 http://purl.obolibrary.org/obo/GO_0045087 denotes innate immune
T1326 2112-2133 http://purl.obolibrary.org/obo/GO_0006954 denotes inflammatory response
T1325 1833-1854 http://purl.obolibrary.org/obo/GO_0006954 denotes inflammatory response
T187 1756-1766 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T186 1427-1436 http://purl.obolibrary.org/obo/GO_0009058 denotes formation
T185 1135-1154 http://purl.obolibrary.org/obo/GO_0051591 denotes cyclic AMP response
T184 1135-1154 http://purl.obolibrary.org/obo/GO_0071320 denotes cyclic AMP response
T183 361-397 http://purl.obolibrary.org/obo/GO_0010757 denotes inhibition of plasminogen activators
T182 319-334 http://purl.obolibrary.org/obo/GO_0045087 denotes innate immunity
T181 1770-1782 http://purl.obolibrary.org/obo/GO_0006954 denotes inflammation
T180 251-275 http://purl.obolibrary.org/obo/GO_0006954 denotes response to inflammatory
T179 375-397 http://purl.obolibrary.org/obo/GO_0031639 denotes plasminogen activators
T178 168-189 http://purl.obolibrary.org/obo/GO_0031639 denotes plasminogen activator
T9543 19510-19523 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T9542 19209-19219 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T9541 19104-19123 http://purl.obolibrary.org/obo/GO_0050397 denotes luciferase activity
T9540 19104-19123 http://purl.obolibrary.org/obo/GO_0050248 denotes luciferase activity
T9539 19104-19123 http://purl.obolibrary.org/obo/GO_0047712 denotes luciferase activity
T9538 19104-19123 http://purl.obolibrary.org/obo/GO_0047077 denotes luciferase activity
T9537 19104-19123 http://purl.obolibrary.org/obo/GO_0045289 denotes luciferase activity
T8286 16997-17014 http://purl.obolibrary.org/obo/GO_0006277 denotes DNA was amplified
T8285 16889-16899 http://purl.obolibrary.org/obo/GO_0004175 denotes Proteinase
T8284 16609-16626 http://purl.obolibrary.org/obo/GO_0003899 denotes RNA polymerase II
T8283 16609-16626 http://purl.obolibrary.org/obo/GO_0001055 denotes RNA polymerase II
T8282 16609-16626 http://purl.obolibrary.org/obo/GO_1990114 denotes RNA polymerase II
T7826 15070-15075 http://purl.obolibrary.org/obo/GO_0019835 denotes lysis
T7252 14436-14455 http://purl.obolibrary.org/obo/GO_0050397 denotes Luciferase activity
T7251 14436-14455 http://purl.obolibrary.org/obo/GO_0050248 denotes Luciferase activity
T7250 14436-14455 http://purl.obolibrary.org/obo/GO_0047712 denotes Luciferase activity
T7249 14436-14455 http://purl.obolibrary.org/obo/GO_0047077 denotes Luciferase activity
T7248 14436-14455 http://purl.obolibrary.org/obo/GO_0045289 denotes Luciferase activity
T3828 7683-7696 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T3827 7928-7937 http://purl.obolibrary.org/obo/GO_0007586 denotes digestion
T3826 7385-7394 http://purl.obolibrary.org/obo/GO_0007586 denotes digestion
T3594 6971-6986 http://purl.obolibrary.org/obo/GO_0010467 denotes Gene Expression
T3593 6893-6906 http://purl.obolibrary.org/obo/GO_0006351 denotes Transcription
T3592 6885-6906 http://purl.obolibrary.org/obo/GO_0001171 denotes Reverse Transcription
T3591 6818-6827 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T1377 5326-5336 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T1376 5310-5325 http://purl.obolibrary.org/obo/GO_0006351 denotes transcriptional
T1375 4686-4699 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T1374 4625-4638 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T1373 4163-4175 http://purl.obolibrary.org/obo/GO_0043066 denotes pro-survival
T1372 4314-4317 http://purl.obolibrary.org/obo/GO_0004707 denotes p38
T1371 4198-4201 http://purl.obolibrary.org/obo/GO_0004707 denotes p38
T1370 4202-4206 http://purl.obolibrary.org/obo/GO_0004707 denotes MAPK
T1369 4058-4062 http://purl.obolibrary.org/obo/GO_0004707 denotes MAPK
T1368 4032-4056 http://purl.obolibrary.org/obo/GO_0032111 denotes activated protein kinase

GO-MF

Id Subject Object Predicate Lexical cue
T26193 37934-37953 http://purl.obolibrary.org/obo/GO_0050397 denotes Luciferase activity
T26192 37934-37953 http://purl.obolibrary.org/obo/GO_0050248 denotes Luciferase activity
T26191 37934-37953 http://purl.obolibrary.org/obo/GO_0047712 denotes Luciferase activity
T26190 37934-37953 http://purl.obolibrary.org/obo/GO_0047077 denotes Luciferase activity
T26189 37934-37953 http://purl.obolibrary.org/obo/GO_0045289 denotes Luciferase activity
T26188 37987-38011 http://purl.obolibrary.org/obo/GO_0033930 denotes β-galactosidase activity
T26187 37446-37470 http://purl.obolibrary.org/obo/GO_0033930 denotes β-galactosidase activity
T26181 37446-37470 http://purl.obolibrary.org/obo/GO_0004336 denotes β-galactosidase activity
T26180 37987-38011 http://purl.obolibrary.org/obo/GO_0004565 denotes β-galactosidase activity
T26179 37446-37470 http://purl.obolibrary.org/obo/GO_0004565 denotes β-galactosidase activity
T25371 35447-35464 http://purl.obolibrary.org/obo/GO_0003899 denotes RNA Polymerase II
T25370 35447-35464 http://purl.obolibrary.org/obo/GO_0001055 denotes RNA Polymerase II
T25369 35929-35939 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T25368 35401-35411 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T25367 35294-35304 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T24197 29477-29485 http://purl.obolibrary.org/obo/GO_0003823 denotes antibody
T24196 28717-28724 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T23809 26307-26326 http://purl.obolibrary.org/obo/GO_0050397 denotes luciferase activity
T23808 26307-26326 http://purl.obolibrary.org/obo/GO_0050248 denotes luciferase activity
T23807 26307-26326 http://purl.obolibrary.org/obo/GO_0047712 denotes luciferase activity
T23806 26307-26326 http://purl.obolibrary.org/obo/GO_0047077 denotes luciferase activity
T23805 26307-26326 http://purl.obolibrary.org/obo/GO_0045289 denotes luciferase activity
T23427 24347-24364 http://purl.obolibrary.org/obo/GO_0008157 denotes binding protein 1
T23426 24347-24362 http://purl.obolibrary.org/obo/GO_0005515 denotes binding protein
T23425 24235-24250 http://purl.obolibrary.org/obo/GO_0005515 denotes binding protein
T23424 24347-24354 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T23423 24235-24242 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T23422 24226-24242 http://purl.obolibrary.org/obo/GO_0035326 denotes enhancer binding
T18848 42634-42650 http://purl.obolibrary.org/obo/GO_0005515 denotes binding proteins
T18847 42630-42641 http://purl.obolibrary.org/obo/GO_0035497 denotes CRE binding
T18846 42634-42641 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T18845 42406-42413 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T16682 39922-39925 http://purl.obolibrary.org/obo/GO_0004298 denotes MCP
T16681 39913-39917 http://purl.obolibrary.org/obo/GO_0005138 denotes IL-6
T14859 33601-33617 http://purl.obolibrary.org/obo/GO_0005515 denotes binding proteins
T14858 34505-34512 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T14857 33601-33608 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T14856 33597-33608 http://purl.obolibrary.org/obo/GO_0003677 denotes DNA binding
T14855 33578-33588 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T13218 30455-30473 http://purl.obolibrary.org/obo/GO_0000975 denotes DNA-binding region
T13217 30611-30621 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T13216 30349-30359 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T13215 30584-30591 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T13214 30459-30466 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T13213 29900-29907 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T13212 29896-29921 http://purl.obolibrary.org/obo/GO_0043565 denotes DNA binding specificities
T13211 29896-29921 http://purl.obolibrary.org/obo/GO_0043566 denotes DNA binding specificities
T13210 30580-30591 http://purl.obolibrary.org/obo/GO_0003677 denotes DNA binding
T13209 29896-29907 http://purl.obolibrary.org/obo/GO_0003677 denotes DNA binding
T12421 28315-28322 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T12420 27778-27785 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T12419 27269-27276 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11553 26936-26955 http://purl.obolibrary.org/obo/GO_0050397 denotes luciferase activity
T11552 26936-26955 http://purl.obolibrary.org/obo/GO_0050248 denotes luciferase activity
T11551 26936-26955 http://purl.obolibrary.org/obo/GO_0047712 denotes luciferase activity
T11550 26936-26955 http://purl.obolibrary.org/obo/GO_0047077 denotes luciferase activity
T11549 26936-26955 http://purl.obolibrary.org/obo/GO_0045289 denotes luciferase activity
T11548 24987-25015 http://purl.obolibrary.org/obo/GO_0070491 denotes transcription factor binding
T11547 24987-25015 http://purl.obolibrary.org/obo/GO_0043425 denotes transcription factor binding
T11546 24987-25015 http://purl.obolibrary.org/obo/GO_0033613 denotes transcription factor binding
T11545 24987-25015 http://purl.obolibrary.org/obo/GO_0008134 denotes transcription factor binding
T11544 25008-25015 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11543 24807-24814 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T10452 23057-23075 http://purl.obolibrary.org/obo/GO_0008022 denotes binding protein (C
T10451 23057-23072 http://purl.obolibrary.org/obo/GO_0005515 denotes binding protein
T10450 23048-23064 http://purl.obolibrary.org/obo/GO_0035326 denotes enhancer binding
T10449 23770-23777 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T10448 23520-23527 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T10447 23152-23159 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T10446 23057-23064 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T10445 22279-22286 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T10444 22258-22286 http://purl.obolibrary.org/obo/GO_0070491 denotes transcription factor binding
T10443 22258-22286 http://purl.obolibrary.org/obo/GO_0043425 denotes transcription factor binding
T10442 22258-22286 http://purl.obolibrary.org/obo/GO_0033613 denotes transcription factor binding
T10441 22258-22286 http://purl.obolibrary.org/obo/GO_0008134 denotes transcription factor binding
T9552 19104-19123 http://purl.obolibrary.org/obo/GO_0050397 denotes luciferase activity
T9551 19104-19123 http://purl.obolibrary.org/obo/GO_0050248 denotes luciferase activity
T9550 19104-19123 http://purl.obolibrary.org/obo/GO_0047712 denotes luciferase activity
T9549 19104-19123 http://purl.obolibrary.org/obo/GO_0047077 denotes luciferase activity
T9548 19104-19123 http://purl.obolibrary.org/obo/GO_0045289 denotes luciferase activity
T8290 16889-16899 http://purl.obolibrary.org/obo/GO_0004175 denotes Proteinase
T8289 16609-16626 http://purl.obolibrary.org/obo/GO_0003899 denotes RNA polymerase II
T8288 16609-16626 http://purl.obolibrary.org/obo/GO_0001055 denotes RNA polymerase II
T8287 16488-16498 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T7830 15633-15641 http://purl.obolibrary.org/obo/GO_0003823 denotes antibody
T7829 15364-15371 http://purl.obolibrary.org/obo/GO_0005488 denotes Binding
T7828 15093-15100 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7827 15089-15100 http://purl.obolibrary.org/obo/GO_0003677 denotes DNA binding
T6001 12103-12122 http://purl.obolibrary.org/obo/GO_0045289 denotes Luciferase activity
T6005 12103-12122 http://purl.obolibrary.org/obo/GO_0050397 denotes Luciferase activity
T6004 12103-12122 http://purl.obolibrary.org/obo/GO_0050248 denotes Luciferase activity
T6003 12103-12122 http://purl.obolibrary.org/obo/GO_0047712 denotes Luciferase activity
T6002 12103-12122 http://purl.obolibrary.org/obo/GO_0047077 denotes Luciferase activity
T1387 4314-4317 http://purl.obolibrary.org/obo/GO_0004707 denotes p38
T1386 4198-4201 http://purl.obolibrary.org/obo/GO_0004707 denotes p38
T1385 4202-4206 http://purl.obolibrary.org/obo/GO_0004707 denotes MAPK
T1384 4058-4062 http://purl.obolibrary.org/obo/GO_0004707 denotes MAPK
T1383 4032-4056 http://purl.obolibrary.org/obo/GO_0030295 denotes activated protein kinase
T1382 3940-3969 http://purl.obolibrary.org/obo/GO_0030295 denotes activation of protein kinases
T1381 3833-3847 http://purl.obolibrary.org/obo/GO_0001530 denotes binding of LPS
T1380 4974-4981 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T1379 3833-3840 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T1378 2570-2595 http://purl.obolibrary.org/obo/GO_0004867 denotes serine protease inhibitor
T188 1099-1115 http://purl.obolibrary.org/obo/GO_0035326 denotes enhancer binding
T189 1108-1115 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T26186 37987-38011 http://purl.obolibrary.org/obo/GO_0033929 denotes β-galactosidase activity
T26185 37446-37470 http://purl.obolibrary.org/obo/GO_0033929 denotes β-galactosidase activity
T26184 37987-38011 http://purl.obolibrary.org/obo/GO_0033920 denotes β-galactosidase activity
T26183 37446-37470 http://purl.obolibrary.org/obo/GO_0033920 denotes β-galactosidase activity
T26182 37987-38011 http://purl.obolibrary.org/obo/GO_0004336 denotes β-galactosidase activity
T7257 14436-14455 http://purl.obolibrary.org/obo/GO_0050397 denotes Luciferase activity
T7256 14436-14455 http://purl.obolibrary.org/obo/GO_0050248 denotes Luciferase activity
T7255 14436-14455 http://purl.obolibrary.org/obo/GO_0047712 denotes Luciferase activity
T7254 14436-14455 http://purl.obolibrary.org/obo/GO_0047077 denotes Luciferase activity
T7253 14436-14455 http://purl.obolibrary.org/obo/GO_0045289 denotes Luciferase activity
T4276 8844-8854 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T4275 8699-8709 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T4274 8632-8642 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies

GO-CC

Id Subject Object Predicate Lexical cue
T25382 35447-35464 http://purl.obolibrary.org/obo/GO_0005665 denotes RNA Polymerase II
T25381 35929-35939 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T25380 35401-35411 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T25379 35294-35304 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T25378 35929-35939 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T25377 35401-35411 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T25376 35294-35304 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T25375 35895-35904 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T25374 35350-35359 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T25373 35248-35257 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T25372 35108-35117 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T24204 29477-29485 http://purl.obolibrary.org/obo/GO_0042571 denotes antibody
T24203 29477-29485 http://purl.obolibrary.org/obo/GO_0019815 denotes antibody
T24202 29339-29356 http://purl.obolibrary.org/obo/GO_0043234 denotes protein complexes
T24201 29335-29356 http://purl.obolibrary.org/obo/GO_0097522 denotes DNA-protein complexes
T24200 29335-29356 http://purl.obolibrary.org/obo/GO_0032993 denotes DNA-protein complexes
T24199 29335-29356 http://purl.obolibrary.org/obo/GO_0001114 denotes DNA-protein complexes
T24198 28881-28886 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T23428 24185-24207 http://purl.obolibrary.org/obo/GO_0035976 denotes 1 =  activator protein
T22414 18557-18561 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T22413 18245-18250 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T16683 39750-39754 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T15772 36387-36392 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T14867 34305-34325 http://purl.obolibrary.org/obo/GO_0009986 denotes associated with cell
T14866 33578-33588 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T14865 33578-33588 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T14864 34321-34325 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T14863 34015-34020 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T14862 33484-33489 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T14861 33540-33549 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T14860 33436-33445 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T14039 31120-31125 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T13229 30754-30776 http://purl.obolibrary.org/obo/GO_1990647 denotes complex with the C/EBP
T13228 30754-30776 http://purl.obolibrary.org/obo/GO_0036488 denotes complex with the C/EBP
T12422 27853-27870 http://purl.obolibrary.org/obo/GO_0043234 denotes protein complexes
T9553 19269-19273 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T9041 18055-18059 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T9040 17831-17836 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T8298 16609-16626 http://purl.obolibrary.org/obo/GO_0005665 denotes RNA polymerase II
T8297 16488-16498 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T8296 16488-16498 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T8295 16128-16133 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T8294 16797-16806 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T8293 16402-16411 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T8292 16005-16014 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T8291 15781-15790 http://purl.obolibrary.org/obo/GO_0000785 denotes Chromatin
T7832 15633-15641 http://purl.obolibrary.org/obo/GO_0042571 denotes antibody
T7831 15633-15641 http://purl.obolibrary.org/obo/GO_0019815 denotes antibody
T7258 14106-14111 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T6656 13248-13256 http://purl.obolibrary.org/obo/GO_0009274 denotes envelope
T6655 13487-13492 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T6654 13100-13105 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T6653 12944-12949 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T6008 11965-11969 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T6007 11853-11858 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T6006 11351-11356 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T4285 8844-8854 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T4284 8699-8709 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T4283 8632-8642 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T4282 8844-8854 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T4281 8699-8709 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T4280 8632-8642 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T4279 8522-8531 http://purl.obolibrary.org/obo/GO_0016020 denotes Membranes
T4278 8511-8520 http://purl.obolibrary.org/obo/GO_0016020 denotes membranes
T4277 8293-8297 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T3595 6802-6807 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T3173 6362-6366 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T3172 5385-5389 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T190 1349-1358 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T18853 46779-46784 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T18852 46492-46497 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T18851 46365-46369 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T18850 44083-44087 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T18849 43874-43878 http://purl.obolibrary.org/obo/GO_0018995 denotes host
T13227 30611-30621 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T13226 30349-30359 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T13225 30611-30621 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T13224 30349-30359 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T13223 30326-30343 http://purl.obolibrary.org/obo/GO_0043234 denotes protein complexes
T13222 30213-30230 http://purl.obolibrary.org/obo/GO_0043234 denotes protein complexes
T13221 30092-30105 http://purl.obolibrary.org/obo/GO_0005576 denotes extracellular
T13220 30069-30074 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T13219 30011-30016 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T1396 3072-3085 http://purl.obolibrary.org/obo/GO_0005622 denotes intracellular
T1395 3022-3035 http://purl.obolibrary.org/obo/GO_0005622 denotes intracellular
T1394 2841-2861 http://purl.obolibrary.org/obo/GO_0031012 denotes extracellular matrix
T1393 2841-2854 http://purl.obolibrary.org/obo/GO_0005576 denotes extracellular
T1392 2264-2273 http://purl.obolibrary.org/obo/GO_0005618 denotes cell wall
T1391 3310-3314 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T1390 3108-3112 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T1389 2966-2970 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T1388 2264-2268 http://purl.obolibrary.org/obo/GO_0005623 denotes cell

sentences

Id Subject Object Predicate Lexical cue
T26094 38216-38349 Sentence denotes The results represent the mean and SEM of at least three independent experiments performed in triplicate. (*, p<0.05, one-way ANOVA).
T26093 38125-38215 Sentence denotes The C/EBP-βT217A -transfected MEFs express both the 38 kDa and 35 kDa isoforms of C/EBP-β.
T26092 38013-38124 Sentence denotes The western blot (below the graphs) confirms the expression of the respective C/EBP-β phospho-acceptor mutants.
T26091 37934-38012 Sentence denotes Luciferase activity was quantified and normalized to β-galactosidase activity.
T26090 37660-37933 Sentence denotes Cebpb−/− MEFs were co-transfected with expression plasmids encoding wild-type C/EBP-β or the indicated C/EBP-β phospho-acceptor mutants, along with the pGLmP-539 SerpinB2 promoter-luciferase reporter and β-galactosidase reporter plasmids, and stimulated with LPS for 4 hrs.
T26089 37289-37659 Sentence denotes Cells were co-transfected with the pGLmP-539 SerpinB2 promoter-luciferase reporter and β-galactosidase reporter plasmids, and luciferase units normalized to β-galactosidase activity. (B) C/EBP-β gene schematic depicting gene structure and phospho-acceptor sites. (C) Phosphorylation of C/EBP-β at Serine 64 negatively regulates LPS-stimulated SerpinB2 promoter activity.
T26088 37101-37288 Sentence denotes Murine SerpinB2 gene promoter activity measured in Cebpb+/+ and Cebpb−/− MEFs expressing the pGLmP-539 SerpinB2 promoter-luciferase reporter in the presence or absence of LPS (100 ng/mL).
T26087 36981-37100 Sentence denotes (A) The SerpinB2 proximal promoter is significantly activated in LPS-stimulated Cebpb+/+ MEFs and not in Cebpb−/− MEFs.
T26086 36919-36980 Sentence denotes C/EBP-β is necessary for SerpinB2 proximal promoter activity.
T25328 35997-36070 Sentence denotes The data are represented relative to rIgG signal using the 2-ΔΔCt method.
T25327 35760-35996 Sentence denotes Minimal background was detected using the rabbit IgG control, indicative of the specificity of the ChIP reaction. (B) qPCR analysis of chromatin immunoprecipitated with antibodies against C/EBP-β, p-C/EBP-β (T217), and the rIgG control.
T25326 35656-35759 Sentence denotes Recruitment of RNAPII to the SerpinB2 promoter suggests active transcription following LPS stimulation.
T25325 35342-35655 Sentence denotes Soluble chromatin (600–700 ng) was immunoprecipitated with antibodies against C/EBP-β, p-C/EBP-β (T217), RNA Polymerase II (RNAPII), or a rabbit IgG (rIgG) control. (A) Typical PCR pattern obtained in ChIP assays using murine SerpinB2 proximal promoter-specific primers, 338/−315 and −5/+19, as diagrammed in top.
T25324 35152-35341 Sentence denotes RAW264.7 macrophages were treated in the presence or absence of LPS for the indicated times and chromatin immunoprecipitation performed using antibodies against C/EBP-β or p-C/EBP-β (T217).
T25323 35017-35151 Sentence denotes Transcription factor occupancy on the SerpinB2 proximal promoter in vivo was determined by chromatin immunoprecipitation (ChIP) assay.
T25322 34924-35016 Sentence denotes Differential recruitment of C/EBP-β and C/EBP-βT217 to the murine SerpinB2 promoter in vivo.
T24577 33089-33224 Sentence denotes The results represent the mean and SEM of two independent experiments performed in duplicate or triplicate. (*, p<0.05, two-way ANOVA).
T24576 32980-33088 Sentence denotes Right: qPCR analysis of murine SerpinB2 mRNA expression in the lentiviral transduced peritoneal macrophages.
T24575 32839-32979 Sentence denotes Western blot analysis shows effective knockdown of endogenous C/EBP-β following infection with murine Cebpb shRNA and not human CEBPB shRNA.
T24574 32833-32838 Sentence denotes Left:
T24573 32751-32832 Sentence denotes Lentiviral transduced macrophages were stimulated with LPS (100 ng/ml) for 4 hrs.
T24572 32640-32750 Sentence denotes Human CEBPB shRNA serves as the non-silencing control since it does not target the murine Cebpb sequence [38].
T24571 32519-32639 Sentence denotes Thioglycollate-elicited peritoneal macrophages (TG macs) were infected with human and murine specific lentiviral shRNAs.
T24570 32135-32518 Sentence denotes (A) Endogenous SerpinB2 mRNA expression is abrogated in Cebpb−/− MEFs compared to Cebpb+/+ MEFs in the absence and presence of LPS. qPCR analysis of murine SerpinB2 mRNA expression in untreated Cebpb+/+ and Cebpb−/− MEFs, and after simulation with LPS (100 ng/ml) for the indicated times. (B) Endogenous SerpinB2 expression is abrogated in C/EBP-β-deficient inflammatory macrophages.
T24569 32055-32134 Sentence denotes C/EBP-β is essential for constitutive and LPS-induced SerpinB2 mRNA expression.
T24178 29487-29544 Sentence denotes The LPS-inducible complex is indicated with an arrowhead.
T24177 28792-29486 Sentence denotes (A) EMSA with nuclear extracts from untreated (UN) and 10 hr LPS treated (LPS) RAW 264.7 cells incubated with either the murine SerpinB2 promoter −212/−185 probe containing an intact (SerpinB2 C/EBP) or mutated (mutant C/EBP) C/EBP site or with the rat albumin promoter DEI region C/EBP (rat albumin C/EBP) probe. (B) Cold competition EMSAs performed with the radiolabelled murine SerpinB2 promoter −212/−185 probe and a 100-fold molar excess of each of the double stranded oligonucleotides described in (A) demonstrate the specificity of the DNA-protein complexes. (C) Supershift assays were performed with the −212/−185 probe by after preincubation with the indicated specific C/EBP antibody.
T24176 28684-28791 Sentence denotes The LPS-inducible nuclear factor binding the murine SerpinB2 proximal promoter C/EBP site contains C/EBP-β.
T23785 26281-26413 Sentence denotes The results show relative luciferase activity following LPS treatment and represent the mean and SEM of 4–7 independent experiments.
T23784 25963-26280 Sentence denotes Positions of murine SerpinB2 proximal promoter-specific primers, 338/−315 and −5/+19 used in ChIP assays are indicated. (B) RAW 264.7 macrophages were transiently transfected with the indicated murine SerpinB2 promoter-luciferase reporter constructs and either left untreated or treated with 100 ng/ml LPS for 16 hrs.
T23783 25874-25962 Sentence denotes The location of the 5′ ends of the −539, −189 and −87 reporter constructs is also shown.
T23782 25706-25873 Sentence denotes (A) Schematic representation of the −539/+92 region of the murine SerpinB2 promoter with the location of candidate cis-acting regulatory elements indicated with boxes.
T23781 25599-25705 Sentence denotes Identification of cis-acting elements required for the LPS-responsiveness of the murine SerpinB2 promoter.
T22699 21649-21919 Sentence denotes Alu = Alu repeat, ID4 =  ID4 short interspersed nuclear repeat (SINE), L1 =  L1 long interspersed nuclear element (LINE), L2 =  L2 LINE, MIR = MIR SINE, MLT1L = MLT1L long terminal repeat (LTR), (TATG)n = TATG tetranucleotide repeat, tis = transcription initiation site.
T22698 21553-21648 Sentence denotes Homologous regions are interrupted by repetitive sequence elements in both 5′ flanking regions.
T22697 21393-21552 Sentence denotes Schematic representation of the human and murine SerpinB2 5′ flanking regions with regions of nucleotide sequence identity indicated by the same colored boxes.
T22696 21232-21392 Sentence denotes The results represent the mean and SEM of four independent experiments. (C) DNA sequence conservation between the human and murine SerpinB2 5′ flanking regions.
T22695 21155-21231 Sentence denotes Shown is the relative luciferase reporter gene activity following treatment.
T22694 21064-21154 Sentence denotes Cells were either left untreated or treated with 100 ng/ml LPS or 40 ng/ml PMA for 16 hrs.
T22693 20823-21063 Sentence denotes Construct names indicate the most 5′ nucleotide of murine SerpinB2 5′ flanking sequence. (B) RAW 264.7 macrophages were transiently transfected with the indicated murine SerpinB2 promoter-luciferase reporter constructs and control plasmids.
T22692 20612-20822 Sentence denotes The murine 5′ flanking region from −4480 to +92 was inserted upstream of the luciferase reporter gene and 5′ deletions were generated using restriction enzyme sites or with specific oligonucleotide PCR primers.
T22691 20503-20611 Sentence denotes (A) Schematic representation of the murine SerpinB2 promoter and 5′ deletion luciferase reporter constructs.
T22690 20404-20502 Sentence denotes Deletion reporter gene analysis of LPS and PMA-responsive regions in the murine SerpinB2 promoter.
T23404 24466-24555 Sentence denotes The location of the 5' ends of the −539, −189 and −87 reporter constructs are also shown.
T23403 24366-24465 Sentence denotes The putative transcription initiation site (tis) is indicated and exon 1 is presented in uppercase.
T23402 24182-24365 Sentence denotes AP-1 =  activator protein 1; C/EBP =  CCAAT enhancer binding protein; CRE = cAMP response element; Oct1 =  octamer transcription factor 1/POU2F1; PU.1 =  purine box binding protein 1.
T23401 24081-24181 Sentence denotes Cis-acting elements conserved between the human and murine SerpinB2 promoters are boxed and labeled.
T23400 24005-24080 Sentence denotes Mouse and human nucleotide sequences were aligned using Clustal W software.
T23399 23996-24004 Sentence denotes −563/−1.
T23398 23894-23995 Sentence denotes Potential cis-acting regulatory elements in the LPS responsive region of the murine SerpinB2 promoter
T18515 47133-47251 Sentence denotes Taken together these data provide new insight into the regulation of inflammation-associated SerpinB2 gene expression.
T18514 47002-47132 Sentence denotes Importantly, we were able to uncover a previously unknown role for C/EBP-βS64 in negatively regulating SerpinB2 promoter activity.
T18513 46816-47001 Sentence denotes In summary, our studies show that the C/EBP site (−203/−195) in the murine SerpinB2 proximal promoter is necessary to support both constitutive and LPS-induced SerpinB2 gene expression.
T18512 46550-46815 Sentence denotes Our study has demonstrated that C/EBP-β plays an important role in mediating both constitutive and LPS-induced transcription of the SerpinB2 gene, which may have implications for the inflammatory phenotype of infiltrating immune cells in the tumor microenvironment.
T18511 46407-46549 Sentence denotes Interestingly C/EBP-β has also been shown to modulate cytokine secretion from immune cells, thereby modifying their phenotype [27]; [79]–[81].
T18510 46271-46406 Sentence denotes The presence of SerpinB2 has been shown to modulate cytokine profiles which can affect immune cell polarization [27]; [28]; [77]; [78].
T18509 46110-46270 Sentence denotes SerpinB2 expression has been associated with both inflammation and cancer, and is a favorable or unfavorable prognostic indicator depending on cancer type [77].
T18508 45884-46109 Sentence denotes In recent years it has become apparent that persistent infection is integrally linked to chronic inflammation and cancer, and immune cells such as macrophages can either promote or attenuate cancer progression [2]; [74]–[76].
T18507 45777-45883 Sentence denotes Our data suggest that MLK3-driven dephosphorylation of S64 may also be involved in LPS-signaling pathways.
T18506 45612-45776 Sentence denotes Roy and colleagues demonstrated that Mixed lineage kinase-3 (MLK3)-driven dephosphorylation of C/EBP-β S64 was important for IFNγ-regulated signaling pathways [73].
T18505 45370-45611 Sentence denotes Since C/EBP-β S64 is constitutively phosphorylated in both RAW264.7 cells and MEFs [73], it is likely that dephosphorylation at this site may be a critical event during LPS-induced transcription of SerpinB2 to increase its promoter activity.
T18504 45157-45369 Sentence denotes In contrast, expression of C/EBP-βS64A significantly enhanced LPS-induced SerpinB2 promoter activity, indicating that phosphorylation of C/EBP-β at S64 negatively regulates LPS-induced SerpinB2 promoter activity.
T18503 44998-45156 Sentence denotes Similarly, expression of the C/EBP-β phospho-acceptor site mutant, C/EBP-βT188A, did not affect SerpinB2 promoter activity differently from that of wild-type.
T18502 44877-44997 Sentence denotes These data indicate that the T217 phospho-acceptor site is not important for the regulation of SerpinB2 gene expression.
T18501 44565-44876 Sentence denotes However, expression of a C/EBP-β phospho-acceptor site mutant, C/EBPβT217A, in Cebpb−/− MEFs did not increase SerpinB2 proximal promoter activity over that of wild-type C/EBP-β, even though recruitment of C/EBP-βT217 to the SerpinB2 promoter was observed to decrease following LPS stimulation of RAW264.7 cells.
T18500 44365-44564 Sentence denotes C/EBP-β phosphorylated on T217 has been reported to rescue macrophages from apoptosis induced by Bacillus anthracis lethal toxin (LT) [65], an activity that has also been attributed to SerpinB2 [16].
T18499 44226-44364 Sentence denotes Phosphorylation of C/EBP-β at several different amino acid residues has been shown to modulate transactivation of its target genes [63]; .
T18498 44111-44225 Sentence denotes Thus the regulation of SerpinB2 gene expression by C/EBP-β is consistent with its functional role in inflammation.
T18497 43923-44110 Sentence denotes Furthermore, C/EBP-β-null mice are susceptible to bacterial infection [69]; [70] and SerpinB2 has been demonstrated to protect from bacterial and viral-induced cell death [14]–[16]; [25].
T18496 43775-43922 Sentence denotes C/EBP-β, like SerpinB2, plays an important role in inflammation, as it is upregulated by LPS and a host of other inflammatory cytokines [59]; [62].
T18495 43513-43774 Sentence denotes While C/EBP proteins can act as either homodimers or heterodimers [63], we identified C/EBP-β as the only LPS-inducible C/EBP isoform to bind the SerpinB2 C/EBP response element, suggesting a predominant role for C/EBP-β in LPS-induced SerpinB2 gene expression.
T18494 43246-43512 Sentence denotes Our qPCR results validate this finding, as we found that both constitutive and LPS-inducible SerpinB2 mRNA expression is significantly abrogated in C/EBP-β-shRNA transduced peritoneal macrophages, emphasizing the link between C/EBP-β and SerpinB2 gene transcription.
T18493 43023-43245 Sentence denotes In a previous microarray expression profiling study, SerpinB2 was identified as gene whose induction in C/EBP-β-deficient peritoneal macrophages by LPS and IFNγ was severely impaired compared to wild-type macrophages [68].
T18492 42897-43022 Sentence denotes In this study, C/EBP-β was found to be a major requirement for both constitutive and LPS-induced SerpinB2 gene transcription.
T18491 42812-42896 Sentence denotes Additionally, CREB has been shown to control transcription of the C/EBP-β gene [67].
T18490 42544-42811 Sentence denotes Of note, there are previous reports of combinatorial interactions between C/EBP-β and CRE binding proteins (CREB) and AP-1 [63], and C/EBP-β has been reported to physically interact with AP-1, and NF-κB to promote gene expression of inflammatory mediators [63]; [66].
T18489 42357-42543 Sentence denotes LPS responsiveness absolutely required the C/EBP binding site located in the region between nucleotides −189 and −539, with the downstream CRE and AP-1-like elements also being critical.
T18488 42054-42356 Sentence denotes In contrast to the pattern of incremental increases in PMA-induced transcriptional activity conferred by regions of the murine SerpinB2 promoter containing these sites, most of the LPS-inducible response is dependent upon cis-acting regulatory sequences in the region between nucleotides −189 and −539.
T18487 41941-42053 Sentence denotes These sites may therefore also play a role in mediating PMA-inducible transcription of the murine SerpinB2 gene.
T18486 41657-41940 Sentence denotes Inspection of the murine SerpinB2 proximal promoter sequence shows that a CRE and two AP-1-like elements, demonstrated to mediate PMA-stimulated transcription of the human SERPINB2 gene [37], also are present in the murine SerpinB2 proximal promoter between nucleotides −189 and −87.
T18485 41444-41656 Sentence denotes The murine SerpinB2 proximal promoter region between nucleotides -539 and +92 mediated both PMA- and LPS-inducible gene transcription, with induction by PMA being less intense and more transient than that by LPS.
T18484 41214-41443 Sentence denotes LPS-induced C/EBP-β was shown to specifically bind the C/EBP response element in the SerpinB2 proximal promoter in vitro and in vivo, and loss of C/EBP-β abrogates constitutive SerpinB2 gene transcription and the response to LPS.
T18483 41061-41213 Sentence denotes Here we report that SerpinB2 gene transcription in response to LPS is conferred by the SerpinB2 proximal promoter and is greatly dependent upon C/EBP-β.
T18482 40931-41060 Sentence denotes SerpinB2 is transcriptionally induced by cross talk between the IKKβ/NF-κB and p38MAPK signaling modules in response to LPS [16].
T18481 40739-40930 Sentence denotes Pro-inflammatory stimuli, such as the bacterial endotoxin LPS, stimulate macrophages to mount an anti-pathogenic response which involves massive induction of the pro-survival factor SerpinB2.
T18480 40608-40738 Sentence denotes Macrophages are key mediators of the innate immune response, and consequently provide the first line of defense against pathogens.
T16500 39934-40024 Sentence denotes Similarly, SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29].
T16499 39842-39933 Sentence denotes C/EBP-βS64 is important for LPS-induced transcription of the cytokines IL-6 and MCP-1 [64].
T16498 39650-39841 Sentence denotes C/EBP-βT188 is implicated in regulating DAPK1, an IFNγ-inducible gene involved in the regulation of cell cycle and apoptosis [38], processes with which SerpinB2 has also been associated [17].
T16497 39478-39649 Sentence denotes C/EBP-β contains additional phosphorylation sites, C/EBP-βT188 and C/EBP-βS64 (Fig. 8B), which may be involved in modulating C/EBP-β-dependent SerpinB2 gene transcription.
T16496 39148-39477 Sentence denotes Expression of the C/EBP-β phospho-acceptor mutant, C/EBPβT217A, in Cebpb−/− MEFs did not significantly increase SerpinB2 promoter activity above that of wild-type C/EBP-β (Fig. 8C, right); confirming that phosphorylation of C/EBP-β at T217 is not a major factor in the regulation of SerpinB2 promoter activity in response to LPS.
T16495 38894-39147 Sentence denotes Re-expression of wild-type C/EBP-β in Cebpb−/− MEFs significantly stimulated SerpinB2 luciferase reporter gene expression in the presence of LPS by ∼3 fold (Fig. 8C, left), confirming the importance of C/EBP-β to LPS-induced SerpinB2 gene transcription.
T16494 38548-38893 Sentence denotes To investigate C/EBP-β phosphorylation sites that may be important for LPS-stimulated SerpinB2 proximal promoter activity (Fig. 8B), we co-expressed several C/EBP-β phospho-acceptor mutants in which the critical threonine or serine residue was mutated to an alanine, along with the pGLmP-539 murine SerpinB2 luciferase reporter in Cebpb−/− MEFs.
T16493 38454-38547 Sentence denotes Phosphorylation of C/EBP-β is well recognized to modulate its transactivation potential [63].
T16492 38351-38453 Sentence denotes Phosphorylation of C/EBP-β at Serine 64 negatively Regulates LPS-stimulated SerpinB2 Promoter Activity
T16503 40473-40595 Sentence denotes These data suggest that phosphorylation of C/EBP-β at S64 acts to negatively regulate SerpinB2 proximal promoter activity.
T16502 40237-40472 Sentence denotes C/EBP-βT188A-transfected MEFs exhibited SerpinB2 promoter activity similar to that of wild-type C/EBP-β-transfected MEFs, whereas the expression of C/EBP-βS64A potentiated SerpinB2 promoter activity in response to LPS (Fig. 8C, right).
T16501 40025-40236 Sentence denotes Given the similarities in the functional significance of these phospho-specific isoforms of C/EBP-β and SerpinB2, we investigated whether these phospho-acceptor sites may play a role in SerpinB2 gene expression.
T15713 36632-36874 Sentence denotes We found that LPS-stimulated SerpinB2 promoter activity was significantly increased in Cebpb+/+ MEFs and abrogated in Cebpb−/− MEFs (Fig. 8A), indicating that endogenous C/EBP-β is required for LPS-induced SerpinB2 proximal promoter activity.
T15712 36413-36631 Sentence denotes The ability of endogenous C/EBP-β to direct transcription from the SerpinB2 proximal promoter was examined by transfection of the pGLmP-539 murine SerpinB2 luciferase reporter construct into Cebpb+/+ and Cebpb−/− MEFs.
T15711 36146-36412 Sentence denotes Since C/EBP-β binds to the SerpinB2 proximal promoter in an LPS-inducible manner both in vitro and in vivo, we wanted to address the question of whether C/EBP-β was an essential factor for driving transcription from the SerpinB2 promoter in cells in response to LPS.
T15710 36072-36145 Sentence denotes C/EBP-β Promotes LPS-inducible Murine SerpinB2 Proximal Promoter Activity
T14846 34649-34879 Sentence denotes These data show an inverse relationship between C/EBP-β and p-C/EBP-βT217 recruitment, and indicate that T217-phosphorylated C/EBP-β may not be responsible for increased transcription from the SerpinB2 promoter in response to LPS.
T14845 34471-34648 Sentence denotes In contrast to total C/EBP-β, the binding affinity of p-C/EBP-βT217 for the SerpinB2 proximal promoter diminished with LPS stimulation at later timepoints (4 and 8 hrs)(Fig. 7).
T14844 34043-34470 Sentence denotes Since changes in C/EBP-β phosphorylation states can affect C/EBP-β’s ability to transactivate target genes [38]; [63]; [64], we investigated recruitment to the SerpinB2 proximal promoter of the T217 phosphorylated C/EBP-β isoform (p-C/EBP-βT217), which has been associated with cell survival [65]. p-C/EBP-βT217 was constitutively bound to the SerpinB2 proximal promoter and also present after 1 hr of LPS stimulation (Fig. 7).
T14843 33761-34042 Sentence denotes The results showed that C/EBP-β is constitutively present at the SerpinB2 promoter as demonstrated by its association with the promoter in unstimulated macrophages and increased temporally in response to LPS reaching as much as 10-fold over unstimulated cells after 8 hrs (Fig. 7).
T14842 33756-33760 Sentence denotes 4A).
T14841 33474-33755 Sentence denotes RAW 264.7 cells were stimulated with LPS for up to 8 hrs, soluble chromatin was immunoprecipitated with antibodies against DNA binding proteins, and the enriched DNA amplified by both semi-quantitative and qPCR using SerpinB2 proximal promoter specific primers (illustrated in fig.
T14840 33313-33473 Sentence denotes We investigated the temporal dynamics of C/EBP-β recruitment to the murine SerpinB2 promoter in response to LPS in vivo by chromatin immunoprecipitation (ChIP).
T14839 33226-33312 Sentence denotes C/EBP-β Binds the Murine SerpinB2 Proximal Promoter in vivo in an LPS-inducible Manner
T13966 31882-32010 Sentence denotes These data show that C/EBP-β is critical for mediating constitutive and LPS-inducible transcription of endogenous SerpinB2 mRNA.
T13965 31706-31881 Sentence denotes As was observed in MEFs, both constitutive and LPS-induced SerpinB2 mRNA expression was significantly decreased in C/EBP-β-deficient inflammatory macrophages (Fig. 6B, right).
T13964 31503-31705 Sentence denotes We next tested if similar effects could be seen in thioglycollate-elicited inflammatory macrophages in which C/EBP-β expression was knocked down using species-specific lentiviral shRNAs (Fig. 6B, left).
T13963 31301-31502 Sentence denotes LPS stimulated an increase in SerpinB2 mRNA expression in wild-type MEFs (Fig. 6A), whereas LPS-stimulated SerpinB2 mRNA expression was significantly dampened in Cebpb−/− MEFs as compared to wild-type.
T13962 31169-31300 Sentence denotes Wild-type MEFs express low levels of endogenous SerpinB2 and the absence of C/EBP-β attenuated endogenous SerpinB2 mRNA expression.
T13961 30937-31168 Sentence denotes To investigate the importance of C/EBP-β to endogenous SerpinB2 mRNA expression in response to LPS, we utilized C/EBP-β-null (Cebpb −/−) and wild-type MEFs (Cebpb+/+), since RAW264.7 cells constitutively express endogenous C/EBP-β.
T13960 30816-30936 Sentence denotes C/EBP-β Mediates both Constitutive and LPS-induced SerpinB2 mRNA Expression in MEFs and Inflammatory Primary Macrophages
T13148 30702-30814 Sentence denotes Taken together these data show that the LPS-induced complex with the C/EBP element (−203/−192) contains C/EBP-β.
T13147 30606-30701 Sentence denotes Only antibodies against C/EBP-β abolished the formation of the LPS-inducible complex (Fig. 5C).
T13146 30412-30605 Sentence denotes Each antibody detects the carboxy-terminal DNA-binding region of the respective protein, so that pre-incubation of antibody with nuclear extract is expected to abolish DNA binding by EMSA [62].
T13145 30124-30411 Sentence denotes To determine which C/EBP proteins were involved in the formation of the different nucleo-protein complexes, and particularly of the LPS-inducible complex, EMSA was performed after incubating the nucleo-protein complexes with antibodies specific for C/EBP-α, C/EBP-β, C/EBP-δ and C/EBP-ε.
T13144 29928-30123 Sentence denotes Four family members, C/EBP-α, C/EBP-β, C/EBP-δ and C/EBP-ε, are present in myeloid cells and play different roles in differentiating myeloid cells depending on the extracellular environment [61].
T13143 29792-29927 Sentence denotes Consisting of six members, the C/EBP transcription factors can homo−/heterodimerize and display similar DNA binding specificities [60].
T13142 29652-29791 Sentence denotes The C/EBP family of basic leucine zipper transcription factors are known for their roles in cellular differentiation and inflammation [59].
T13141 29546-29651 Sentence denotes C/EBP-β is a LPS-induced Nuclear Factor that Binds to the C/EBP Element of the SerpinB2 Proximal Promoter
T12405 28449-28639 Sentence denotes Together these data indicate that the putative SerpinB2 C/EBP site at −203/−192 binds a LPS-inducible complex that is likely to contain a member of the C/EBP family of transcription factors.
T12404 28053-28448 Sentence denotes The LPS-inducible complex was not detected using the mutant C/EBP oligonucleotide probe and could be abolished by an excess of unlabeled double-stranded oligonucleotide, carrying either the same sequence (Fig. 5B, lanes 4 and 5) or the sequence of a known C/EBP binding site from the rat albumin promoter (Fig. 5B, lanes 8 and 9), but not by the mutated oligonucleotide (Fig. 5B, lanes 6 and 7).
T12403 27896-28052 Sentence denotes Three of these bands (I, II, III) represent complexes with single stranded DNA (Fig. 5A) while the uppermost (slowest migrating) complex was induced by LPS.
T12402 27792-27895 Sentence denotes Four bands of different mobilities, representing DNA-nuclear protein complexes were detected (Fig. 5A).
T12401 27460-27791 Sentence denotes Three different double stranded oligonucleotide probes were used for EMSA, representing (1) the putative SerpinB2 C/EBP element (−203/−192), (2) a mutant SerpinB2 element containing the same mutation as in pGLmP-539mC/EBP and (3) the rat albumin promoter distal element 1 (DEI) region containing a high affinity C/EBP binding site.
T12400 27254-27459 Sentence denotes Nuclear factor binding to the putative C/EBP element (−203/−192) was investigated by electrophoretic mobility shift assay (EMSA) using nuclear extracts from untreated and LPS-treated RAW 264.7 macrophages.
T12399 27167-27253 Sentence denotes The C/EBP Element is Bound by an LPS-induced Nuclear Factor from RAW 264.7 Macrophages
T11450 26991-27165 Sentence denotes These data show that the C/EBP element, as well as the CRE and both AP-1 cis-acting elements are critical for LPS-inducible transcription from the SerpinB2 proximal promoter.
T11449 26774-26990 Sentence denotes As shown in Fig. 4B, mutation of the CRE at −177/−172 or either of the two AP-1 sites at −106/−100 and −94/−88, completely or significantly reduced LPS-inducible luciferase activity from the murine SerpinB2 promoter.
T11448 26414-26773 Sentence denotes Considering the conserved sequence and position of the CRE and two AP-1 sites in the murine SerpinB2 promoter and their demonstrated involvement in the PMA-responsiveness of the human SERPINB2 promoter [37], these sites were also mutated by nucleotide substitution to investigate whether they played a role in the LPS response of the murine SerpinB2 promoter.
T11447 25449-25554 Sentence denotes Others have also recently implicated this C/EBP site in LPS-induced activation of the SerpinB2 gene [58].
T11446 25274-25448 Sentence denotes In contrast, mutation of the C/EBP site (−203/−192) completely eliminated promoter activity, similar to the levels observed for the −189 SerpinB2 promoter deletion construct.
T11445 25104-25273 Sentence denotes As shown in Fig. 4B, mutation of the consensus E box (−538/−533), PU.1 (−412/−407), or the variant Oct-1 (−296/−288) site did not decrease LPS-induced promoter activity.
T11444 24689-25103 Sentence denotes To investigate regulatory elements between −539 and −189 essential for LPS-inducible transcription, several candidate binding sites for transcription factors previously reported to mediate LPS-inducible transcription in other genes [57] were targeted by nucleotide substitution designed to disrupt transcription factor binding to the pGLmP-539 murine SerpinB2 promoter-luciferase reporter gene construct (Fig. 4A).
T11443 24557-24688 Sentence denotes A C/EBP, CRE and Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter are Essential for Optimal LPS-inducible Transcription
T10399 23645-23849 Sentence denotes Further upstream, a retinoic acid response element at −1349/−1340, a PAUSE-1 silencer element at −1540/−1528 and a NF-κB p65 binding site at −1342/−1351 (Fig. S2) are also well conserved [16]; [30]; [56].
T10398 23468-23644 Sentence denotes A consensus E box (−538/−533), as well as potential binding sites for PU.1 (−412/−407) and Oct-1 (−296/−288) were also identified within the proximal promoter region (Fig. S2).
T10397 23288-23467 Sentence denotes Both of the AP-1 sites are identical in sequence to those identified in the human SERPINB2 promoter, and the CRE differs in the identity of a single central nucleotide [37]; [55].
T10396 23031-23287 Sentence denotes A putative CCAAT enhancer binding protein (C/EBP) site is present at −192/−203, two potential activator protein 1 (AP-1) binding sites are found at nucleotides −88/−94 and −100/−106, and a putative cyclic AMP response element (CRE) is present at −172/−177.
T10395 22841-23030 Sentence denotes Specifically, a TATA consensus sequence is located 23 to 29bp upstream from the transcription initiation site, similar to the position of the TATA box of the human SERPINB2 gene [53]; [54].
T10394 22648-22840 Sentence denotes Further analysis of Region E revealed that several of the cis-acting regulatory elements defined in the human SerpinB2 proximal promoter are conserved in the murine SerpinB2 promoter (Fig. 3).
T10393 22530-22647 Sentence denotes The proximal promoter (Region E), which contains the essential LPS response element, exhibited the greatest homology.
T10392 22378-22529 Sentence denotes The presence of several repetitive sequence elements delineated five broadly homologous regions (A-E) between the human and murine promoters (Fig. 2C).
T10391 22189-22377 Sentence denotes We reasoned that the presence of evolutionarily conserved, potential transcription factor binding sites in this region might play a role in the regulation of SerpinB2 gene expression [52].
T10390 21999-22188 Sentence denotes To look for potential cis-acting elements that might mediate transcription of the murine SerpinB2 gene and the response to LPS, we aligned the murine and human SerpinB2 5′ flanking regions.
T10389 21921-21998 Sentence denotes Sequence Conservation within the Human and Murine SerpinB2 Proximal Promoters
T9017 17980-18125 Sentence denotes SerpinB2 protein expression was also induced as has been reported in other cell types [31], and detectable after 8 hrs of LPS treatment (Fig. 1).
T9016 17848-17979 Sentence denotes LPS-induced SerpinB2 expression involves both an increase in gene transcription and stabilization of the mRNA [5]; [29]; [42]–[44].
T9015 17661-17847 Sentence denotes A similar strong induction of LPS-inducible SerpinB2 mRNA expression has been reported previously in murine peritoneal macrophages and human peripheral blood mononuclear cells [4]; [32].
T9014 17496-17660 Sentence denotes When RAW264.7 macrophages were exposed to LPS, SerpinB2 mRNA was detectable as early as 30 min following LPS challenge, reaching maximal levels at 24 hrs (Fig. 1A).
T9013 17450-17495 Sentence denotes The SerpinB2 Gene is Highly Responsive to LPS
T9476 20015-20359 Sentence denotes While deletion of the SerpinB2 promoter from −189 to −87 eliminated the LPS response and marginally reduced the PMA response, the −87 murine SerpinB2 promoter construct was still partially responsive to PMA, indicating that cis-acting elements mediating the response of the murine SerpinB2 promoter to PMA also lie downstream of nucleotide −87.
T9475 19748-20014 Sentence denotes Further deletion beyond −539 abolished the LPS-response of the promoter, indicating the presence of an essential LPS response element in the region between −539 and −189; however, the response of the murine SerpinB2 promoter to PMA is less affected by this deletion.
T9474 19572-19747 Sentence denotes Deletion of the murine SerpinB2 promoter from −1686 to −1341 increased LPS-inducibility to approximately 16-fold, indicating the presence of a silencer element in this region.
T9473 19403-19571 Sentence denotes As shown in Fig. 2B, the SerpinB2 5′ flanking region from −4480 to +92 directs both PMA- and LPS-inducible transcription, approximately 2-fold and 7-fold, respectively.
T9472 19183-19402 Sentence denotes PMA-induced SerpinB2 gene regulation has been extensively studied in human macrophage cell lines [45]–[47], and has been shown to occur through several proximal and distal AP-1 responsive elements [30]; [37]; [47]–[51].
T9471 18990-19182 Sentence denotes The reporter constructs were then transiently transfected into sub-confluent RAW264.7 macrophages and assayed for luciferase activity in the presence and absence of LPS or PMA, for comparison.
T9470 18680-18989 Sentence denotes To investigate cis-acting regulatory elements responsive to LPS in the 5′ flanking region of the murine SerpinB2 gene, nucleotides −4480 to +92 and a series of generated deletion mutants of the 5′ flanking region were cloned upstream of a promoter-less firefly luciferase reporter gene (pGL3 Basic) (Fig. 2A).
T9469 18622-18679 Sentence denotes The SerpinB2 Proximal Promoter Confers LPS Responsiveness
T8903 17299-17395 Sentence denotes Results were analyzed using the analysis of variance (ANOVA) or Student’s t test where relevant.
T8902 17255-17298 Sentence denotes Data are presented as mean ± SEM per group.
T8901 17234-17254 Sentence denotes Statistical Analysis
T8275 16997-17232 Sentence denotes DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’.
T8274 16764-16996 Sentence denotes The beads were washed, the bound chromatin was eluted in ChIP Elution Buffer (Millipore) and the proteins were digested with Proteinase K for 2 hrs at 62°C. The DNA was then purified using the QIAquick PCR Purification Kit (Qiagen).
T8273 16654-16763 Sentence denotes Immunoprecipitated products were collected after incubation with Protein G coated magnetic beads (Millipore).
T8272 16383-16653 Sentence denotes An equal amount of chromatin was immunoprecipitated at 4°C overnight with at least 1 µg of the following antibodies: C/EBP-β (sc-150X), p-C/EBP-β (T217) (sc-16993X), normal rabbit IgG (sc-2027)(Santa Cruz Biotechnologies) and RNA polymerase II (Clone CTD4H8)(Millipore).
T8271 16268-16382 Sentence denotes Nuclear lysates were sonicated 5 times for 15 sec with 1 min intervals on ice using a Sonic Dismembrator (Fisher).
T8270 16191-16267 Sentence denotes Cells extracts were prepared using a commercially available kit (Millipore).
T8269 15973-16190 Sentence denotes Briefly, after crosslinking the chromatin with 1% formaldehyde at room temperature for 10 min and neutralizing with glycine for 5 min at room temperature, cells were washed with cold PBS, scraped and collected on ice.
T8268 15824-15972 Sentence denotes ChIP assays were performed using a commercially available Magna-ChIP™ kit (Millipore), as recommended by the manufacturer, with minor modifications.
T8267 15781-15823 Sentence denotes Chromatin Immunoprecipitation (ChIP) Assay
T7823 15643-15779 Sentence denotes Antibodies were purchased from Santa Cruz: anti-C/EBP-α (sc-61), anti-C/EBP-β (sc-150), anti-C/EBP-δ (sc-151) and anti-C/EBP-ε (sc-158).
T7822 15533-15642 Sentence denotes For supershift assays, nuclear extracts were pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody.
T7821 15364-15532 Sentence denotes Binding reaction products were resolved by electrophoresis at room temperature on 5% polyacrylamide gels (29∶1 acrylamide:bis-acrylamide (Bio-Rad)) in 1x TBE at 10V/cm.
T7820 15089-15363 Sentence denotes DNA binding reactions (25 µl) containing 10 mM HEPES pH 7.9, 10 µg/ml BSA, 2 mM DTT, 30% glycerol, 20% Ficoll-400, 1 µg poly (dI-dC), 6 µg of nuclear extracts and 10,000 to 20,000 cpm (0.05 to 0.2 ng) of radiolabelled probe were performed for 20 minutes at room temperature.
T7819 15012-15088 Sentence denotes RAW 264.7 nuclear extracts were prepared by the detergent lysis method [41].
T7818 14875-15011 Sentence denotes Radiolabelled, double-stranded oligonucleotide probes for gel shift assays were prepared using T4 polynucleotide kinase and [γ-32P]-ATP.
T7817 14837-14874 Sentence denotes Electrophoretic Mobility Shift Assays
T7216 14727-14835 Sentence denotes Expression of the C/EBP-β phospho-acceptor mutant proteins was checked for equal expression by western blot.
T7215 14622-14726 Sentence denotes Each experiment was repeated at least three times, and triplicate samples were employed for each sample.
T7214 14436-14621 Sentence denotes Luciferase activity was determined and normalized to that of β-galactosidase [38] using the Luciferase Assay System and β-Galactosidase Enzyme Assay System Kits, respectively (Promega).
T7213 14260-14435 Sentence denotes In some experiments, plasmids encoding C/EBP-β or C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A) [38]–[40] or control vector were co-transfected (0.6–1.0 µg total DNA).
T7212 14094-14259 Sentence denotes Transfected cells were transferred to pre-warmed media in 24 well plates and incubated for 48 hrs prior to incubation with LPS (100 ng/ml) for 4 hrs where indicated.
T7211 13849-14093 Sentence denotes Cebpb −/− MEFs (1×105) [34] were transfected with the indicated luciferase reporter plasmid (400 ng) along with a β-actin-β-galactosidase reporter plasmid (200 ng) by electroporation using the Invitrogen Neon™ system (1 pulse, 1350 V, 30 msec).
T7210 11273-13848 Sentence denotes Transient Transfection and Luciferase Assays (RAW264.7 Macrophages) RAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities. Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS. Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega). Measurements represent the results of at least three independent experiments. Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity). Protein concentration was determined using the Bio-Rad protein microassay reagent. Lentiviral shRNAs, Packaging and Transduction pLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies. Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38]. To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen). The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter. The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs. The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown. C/EBP-β knockdown was confirmed by western blot analysis. Transient Transfection and Luciferase Assays (MEF Cells)
T6639 13733-13790 Sentence denotes C/EBP-β knockdown was confirmed by western blot analysis.
T6638 13597-13732 Sentence denotes The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown.
T6637 13476-13596 Sentence denotes The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs.
T6636 13322-13475 Sentence denotes The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter.
T6635 13058-13321 Sentence denotes To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen).
T6634 12774-13057 Sentence denotes Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38].
T6633 12644-12773 Sentence denotes pLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies.
T6632 12598-12643 Sentence denotes Lentiviral shRNAs, Packaging and Transduction
T5971 12514-12596 Sentence denotes Protein concentration was determined using the Bio-Rad protein microassay reagent.
T5970 12275-12513 Sentence denotes Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity).
T5969 12197-12274 Sentence denotes Measurements represent the results of at least three independent experiments.
T5968 12103-12196 Sentence denotes Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega).
T5967 11841-12102 Sentence denotes Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS.
T5966 11341-11840 Sentence denotes RAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities.
T5965 11273-11340 Sentence denotes Transient Transfection and Luciferase Assays (RAW264.7 Macrophages)
T4752 11213-11271 Sentence denotes Sequence verified constructs were used in the experiments.
T4751 11006-11212 Sentence denotes Recombinant PCR products were digested with EcoR I and Xho I and cloned between the EcoR I and Xho I restriction sites of pGLmP-539 in place of the −539/+92 region of the wild-type murine SerpinB2 promoter.
T4750 10866-11005 Sentence denotes The flanking oligonucleotide PCR primers were RVprimer3 (Promega) and GLprimer2 (Promega). pGLmP-539 was used as the template in each case.
T4749 10725-10865 Sentence denotes The oligonucleotide PCR primers used to generate mutants, pGLmP-539mCRE, pGLmP-539mAP-1a, and pGLmP-539mAP-1b were reported previously [37].
T4748 10444-10724 Sentence denotes The mutant oligonucleotide PCR primer sequences are provided in Fig. S1, and were used as follows: pGLmP-539mEbox: mPAI2mEboxa and mPAI2mEboxb; pGLmP-539mPU.1: mPAI2mPU.1a and mPAI2mPU.1b; pGLmP-539mOct: mPAI2mOct-2a and mPAI2mOct-2b; pGLmP-539mC/EBP: mPAI2mCEBPa and mPAI2mCEBPb.
T4747 10200-10443 Sentence denotes Luciferase reporter constructs containing mutations in the SerpinB2 promoter LPS-responsive regions E box, PU.1, Oct-1 and C/EBP (pGLmP-539mEbox, pGLmP-539mPU.1, pGLmP-539mOct and pGLmP-539mC/EBP respectively) were generated as described [36].
T4746 10149-10199 Sentence denotes The control empty vector was pGL3 Basic (Promega).
T4745 9959-10148 Sentence denotes The PCR primers BSPCR2 and DW3’LUC were used to subclone the murine SerpinB2 promoter regions −87 to +92 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic to produce pGLmP-87.
T4744 9534-9958 Sentence denotes Additional murine SerpinB2 luciferase reporter constructs (pGLmP-2751, pGLmP-2614, pGLmP-1686, pGLmP-1341, pGLmP-694, pGLmP-539 and pGLmP-189) were generated by digesting pGLmP-3261 with EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I respectively), blunt ending the resultant 5′ or 3′ overhangs with T4 DNA polymerase (NEB) and re-ligating the vector ends with T4 DNA ligase.
T4743 9384-9533 Sentence denotes The EcoR I insert of pDB9402-42 was sub-cloned immediately upstream of the SerpinB2 promoter EcoR I site (−3261) of pGLmP-3261 to produce pGLmP-4480.
T4742 9089-9383 Sentence denotes The PCR primers DW5’LUC, containing a Kpn I restriction site, and DW3’LUC, containing an Xho I restriction site, were used to PCR amplify and clone the SerpinB2 promoter (−3261 to +92) from pDB9406 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic (Promega) to produce pGLmP-3261.
T4741 9041-9088 Sentence denotes Construction of SerpinB2 Reporter Gene Plasmids
T4264 8838-9039 Sentence denotes Other antibodies used for western blot assays include: C/EBP-β (sc-150) (Santa Cruz Biotechnologies), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and α/β tubulin (Cell Signaling Technology, Inc.).
T4263 8654-8837 Sentence denotes Affinity purified rabbit anti-mouse SerpinB2 antibodies were prepared after immunization with a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli as in [35].
T4262 8522-8653 Sentence denotes Membranes were subsequently blocked with 5% milk in PBS-T (1X PBS, 0.1% Tween-20), and incubated with primary antibodies overnight.
T4261 8287-8521 Sentence denotes Whole cell lysates were prepared in RIPA buffer (10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS), proteins were separated on 4–12% Bis-Tris NuPAGE gels (Invitrogen), and transferred to PVDF membranes.
T4260 8267-8286 Sentence denotes Western Blot Assays
T3816 8178-8265 Sentence denotes This sequence was deposited in GenBank/EMBL/DDBJ Data Bank with Accession No. AF339731.
T3815 7958-8177 Sentence denotes The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′ flanking region was determined using the ABI PRISM dye terminator cycle sequencing ready reaction kit (Perkin-Elmer) and a PE 373A sequencer (Perkin-Elmer).
T3814 7874-7957 Sentence denotes Subcloned inserts were verified by restriction enzyme digestion and DNA sequencing.
T3813 7396-7873 Sentence denotes Plasmids pDB9406, pDB9402-41 and pDB9402-42 containing genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain, were kindly provided by Dr. Dominique Belin, University of Geneva. pDB9406 contains a 4.4 kb EcoRI/SpeI genomic fragment spanning the transcription initiation site; pDB9402-41 and pDB9402-42 contain a 1.2 kb EcoRI genomic fragment, located immediately upstream of the pDB9406 EcoRI fragment, cloned in opposite orientations.
T3812 7133-7395 Sentence denotes The DNA sequence of the murine SerpinB2 promoter was determined by sequencing the pUC-based plasmids pDB9406, pDB9402-41 and pDB9402-42, in addition to plasmids prepared from pDB9402-41 and pDB9402-42 containing deletions introduced by exonuclease III digestion.
T3811 7111-7132 Sentence denotes DNA Sequence Analysis
T3582 6809-7109 Sentence denotes For cDNA synthesis, 1 µg of total RNA was reverse transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems). qPCR was performed using TaqMan® Gene Expression 20X primers for Serpinb2/SerpinB2 (Mm00440905_m1), Cebpb (Mm00843434_s1) and β-actin (Mm00607939_s1) (Applied Biosystems).
T3581 6738-6808 Sentence denotes The RNeasy Mini Kit (Qiagen) was used to isolate total RNA from cells.
T3580 6704-6737 Sentence denotes Real-time Quantitative PCR (qPCR)
T1222 5256-5358 Sentence denotes Together, these findings provide new insight into the transcriptional regulation of the SerpinB2 gene.
T1221 5138-5255 Sentence denotes Importantly, a C/EBP-β phospho-acceptor site was found to negatively regulate LPS-induced SerpinB2 promoter activity.
T1220 5001-5137 Sentence denotes C/EBP-β directly bound to this site in vivo and its deficiency abrogated constitutive SerpinB2 expression and SerpinB2 induction by LPS.
T1219 4758-5000 Sentence denotes Here we show that LPS induction of SerpinB2 is dependent upon cis-acting regulatory sequences in the region between nucleotides −189 and −539 of the murine SerpinB2 promoter, and is critically dependent upon a C/EBP binding site at −203/−195.
T1218 4343-4757 Sentence denotes Our previously published data indicated that SerpinB2 is distinctly regulated from other LPS-inducible genes in terms of kinetics, LPS dose response and sensitivity to IFN-γ co-stimulation [4]; however, the cis-acting elements in the SerpinB2 promoter responsible for LPS-dependent transcription in macrophages and the specific LPS-responsive transcription factors that bind the SerpinB2 promoter were not defined.
T1217 4117-4342 Sentence denotes In studies aimed at identifying LPS-inducible pro-survival factors downstream of p38 MAPK, SerpinB2 was identified as a factor whose expression was upregulated by cooperation of the IKKβ/NF-κB and p38 MAPK/CREB pathways [16].
T1216 3829-4116 Sentence denotes The binding of LPS to TLR4 on the surface of macrophages leads to the recruitment of adaptor molecules and the activation of protein kinases, generating signals to the nuclear factor-κB (NF-κB), mitogen-activated protein kinase (MAPK) and/or phosphoinositide 3(PI3)-kinase pathways [33].
T1215 3627-3828 Sentence denotes The toll-like receptor 4 (TLR4) is responsible for the recognition of LPS and other microbial products and plays a central role in the initiation of innate immune responses, including cytokine release.
T1214 3558-3626 Sentence denotes LPS activates immune responses through multiple signalling pathways.
T1213 3393-3557 Sentence denotes It is one of the most responsive genes known [31], and can be induced over 1000-fold by LPS [31]–[32], and is up-regulated by a range of inflammatory mediators [9].
T1212 3267-3392 Sentence denotes The SerpinB2 gene is highly regulated in a cell type specific manner analogous to that of cytokines and oncogenes [29]; [30].
T1211 3050-3266 Sentence denotes Over the past decade, intracellular roles for SerpinB2 in cell survival [11]–[17], proliferation and differentiation [18]–[21], signal transduction [15]; [22]; [23] and innate immunity [24]–[28], have been described.
T1210 2910-3049 Sentence denotes Such function requires SerpinB2 to be secreted from the cell yet SerpinB2 exists primarily as a nonglycosylated intracellular protein [10].
T1209 2675-2909 Sentence denotes SerpinB2 was first identified as an inhibitor of urokinase-type plasminogen activator (uPA)[6]–[8], a serine protease involved in the degradation and turnover of the extracellular matrix through the activation of plasminogen [7]; [9].
T1208 2487-2674 Sentence denotes One of the most LPS-inducible macrophage gene products known is the ovalbumin-like serine protease inhibitor (ov-serpin) SerpinB2, a widely recognized macrophage survival factor [4]; [5].
T1207 2289-2486 Sentence denotes As macrophages are key effectors of pathogen-induced innate immune responses, their survival is critical for initial pathogen neutralization and subsequent development of adaptive immune responses.
T1206 2065-2288 Sentence denotes Many of the pathological manifestations of the inflammatory response are mediated by cytokines and other inducible gene products expressed by macrophages upon exposure to the gram-negative bacterial cell wall component LPS.
T1205 1989-2064 Sentence denotes Uncontrolled, it may lead to organ damage, sepsis, and even cancer [1]–[3].
T1204 1880-1988 Sentence denotes Properly orchestrated, it results in the clearing of foreign molecules and invading pathogens from the body.
T1203 1829-1879 Sentence denotes The inflammatory response is a double-edged sword.
T107 1692-1814 Sentence denotes Together, these data provide new insight into C/EBP-β-dependent regulation of inflammation-associated SerpinB2 expression.
T106 1497-1691 Sentence denotes Importantly, both constitutive and LPS-induced SerpinB2 expression was severely abrogated in C/EBP-β-null mouse embryonic fibroblasts (MEFs) and primary C/EBP-β-deficient peritoneal macrophages.
T105 1307-1496 Sentence denotes Electrophoretic mobility shift (EMSA) and chromatin immunoprecipitation (ChIP) assays demonstrated that LPS induces the formation of C/EBP-β containing complexes with the SerpinB2 promoter.
T104 1059-1306 Sentence denotes Mutation analyses revealed that a CCAAT enhancer binding (C/EBP) element, a cyclic AMP response element (CRE) and two activator protein 1 (AP-1) response elements in the murine SerpinB2 proximal promoter are essential for optimal LPS-inducibility.
T99 0-105 Sentence denotes The Transcription Factor C/EBP-β Mediates Constitutive and LPS-Inducible Transcription of Murine SerpinB2
T100 156-398 Sentence denotes SerpinB2 or plasminogen activator inhibitor type 2 (PAI-2) is highly induced in macrophages in response to inflammatory stimuli and is linked to the modulation of innate immunity, macrophage survival, and inhibition of plasminogen activators.
T101 399-582 Sentence denotes Lipopolysaccharide (LPS), a potent bacterial endotoxin, can induce SerpinB2 expression via the toll-like receptor 4 (TLR4) by ∼1000-fold over a period of 24 hrs in murine macrophages.
T102 583-790 Sentence denotes To map the LPS-regulated SerpinB2 promoter regions, we transfected reporter constructs driven by the ∼5 kb 5'-flanking region of the murine SerpinB2 gene and several deletion mutants into murine macrophages.
T103 791-1058 Sentence denotes In addition, we compared the DNA sequence of the murine 5′ flanking sequence with the sequence of the human gene for homologous functional regulatory elements and identified several regulatory cis-acting elements in the human SERPINB2 promoter conserved in the mouse.
T22399 18571-18620 Sentence denotes Blot was reprobed for GAPDH as a loading control.
T22398 18401-18570 Sentence denotes The plot is representative of at least two independent experiments performed in triplicate. (B) Immunoblot analysis of SerpinB2 protein expression in whole cell lysates.
T22397 18252-18400 Sentence denotes RAW264.7 macrophages were treated for the indicated times with 100 ng/ml LPS. (A) qPCR analysis of murine SerpinB2 mRNA levels, relative to β-actin.
T22396 18170-18251 Sentence denotes LPS induction of SerpinB2 mRNA and protein expression in murine macrophage cells.
T8904 17396-17439 Sentence denotes P-values <0.05 were considered significant.
T3165 6607-6702 Sentence denotes Bacterial lipopolysaccharide (LPS) (Salmonella minnesota Strain Re595) was obtained from Sigma.
T3164 6444-6606 Sentence denotes All cultures were routinely checked to exclude Mycoplasma infection by nuclear staining using Hoechst stain 33258 (Sigma) and the MycoAlert Detection Kit (Lonza).
T3163 6362-6443 Sentence denotes Cell viability was determined using the trypan blue (Sigma) dye exclusion method.
T3162 6217-6361 Sentence denotes Precautions were taken to exclude bacterial lipopolysaccharide contamination from all cell cultures through the use of certified LPS-free serum.
T3161 6021-6216 Sentence denotes Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage 3–5 days later, and maintained in 50% DMEM/F12 media (Gibco BRL).
T3160 5398-6020 Sentence denotes Murine macrophage RAW 264.7 cells (ATCC TIB-71) were maintained in RPMI 1640 media (Gibco BRL), supplemented with 2 mM L-glutamine (Gibco BRL), 10% serum supreme (BioWhittaker), 200 µg/ml penicillin, 100 µg/ml streptomycin, 25 mM N-2-hydroxyethylpiperazine-N-2-ethane sulphonic acid (HEPES) and 25 mM sodium bicarbonate, in 5% CO2 and 95% humidified air atmosphere at 37°C. Wild-type (Cebpb+/+) and knockout (Cebpb−/−) mouse embryonic fibroblasts (MEFs) [34] were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin/glutamate solution (Cellgro).
T3159 5385-5397 Sentence denotes Cell Culture
T1 0-105 Sentence denotes The Transcription Factor C/EBP-β Mediates Constitutive and LPS-Inducible Transcription of Murine SerpinB2
T2 106-145 Sentence denotes C/EBP-β Mediates SerpinB2 Transcription
T3 147-155 Sentence denotes Abstract
T4 156-398 Sentence denotes SerpinB2 or plasminogen activator inhibitor type 2 (PAI-2) is highly induced in macrophages in response to inflammatory stimuli and is linked to the modulation of innate immunity, macrophage survival, and inhibition of plasminogen activators.
T5 399-582 Sentence denotes Lipopolysaccharide (LPS), a potent bacterial endotoxin, can induce SerpinB2 expression via the toll-like receptor 4 (TLR4) by ∼1000-fold over a period of 24 hrs in murine macrophages.
T6 583-790 Sentence denotes To map the LPS-regulated SerpinB2 promoter regions, we transfected reporter constructs driven by the ∼5 kb 5'-flanking region of the murine SerpinB2 gene and several deletion mutants into murine macrophages.
T7 791-1058 Sentence denotes In addition, we compared the DNA sequence of the murine 5′ flanking sequence with the sequence of the human gene for homologous functional regulatory elements and identified several regulatory cis-acting elements in the human SERPINB2 promoter conserved in the mouse.
T8 1059-1306 Sentence denotes Mutation analyses revealed that a CCAAT enhancer binding (C/EBP) element, a cyclic AMP response element (CRE) and two activator protein 1 (AP-1) response elements in the murine SerpinB2 proximal promoter are essential for optimal LPS-inducibility.
T9 1307-1496 Sentence denotes Electrophoretic mobility shift (EMSA) and chromatin immunoprecipitation (ChIP) assays demonstrated that LPS induces the formation of C/EBP-β containing complexes with the SerpinB2 promoter.
T10 1497-1691 Sentence denotes Importantly, both constitutive and LPS-induced SerpinB2 expression was severely abrogated in C/EBP-β-null mouse embryonic fibroblasts (MEFs) and primary C/EBP-β-deficient peritoneal macrophages.
T11 1692-1814 Sentence denotes Together, these data provide new insight into C/EBP-β-dependent regulation of inflammation-associated SerpinB2 expression.
T12 1816-1828 Sentence denotes Introduction
T13 1829-1879 Sentence denotes The inflammatory response is a double-edged sword.
T14 1880-1988 Sentence denotes Properly orchestrated, it results in the clearing of foreign molecules and invading pathogens from the body.
T15 1989-2064 Sentence denotes Uncontrolled, it may lead to organ damage, sepsis, and even cancer [1]–[3].
T16 2065-2288 Sentence denotes Many of the pathological manifestations of the inflammatory response are mediated by cytokines and other inducible gene products expressed by macrophages upon exposure to the gram-negative bacterial cell wall component LPS.
T17 2289-2486 Sentence denotes As macrophages are key effectors of pathogen-induced innate immune responses, their survival is critical for initial pathogen neutralization and subsequent development of adaptive immune responses.
T18 2487-2674 Sentence denotes One of the most LPS-inducible macrophage gene products known is the ovalbumin-like serine protease inhibitor (ov-serpin) SerpinB2, a widely recognized macrophage survival factor [4]; [5].
T19 2675-2909 Sentence denotes SerpinB2 was first identified as an inhibitor of urokinase-type plasminogen activator (uPA)[6]–[8], a serine protease involved in the degradation and turnover of the extracellular matrix through the activation of plasminogen [7]; [9].
T20 2910-3049 Sentence denotes Such function requires SerpinB2 to be secreted from the cell yet SerpinB2 exists primarily as a nonglycosylated intracellular protein [10].
T21 3050-3266 Sentence denotes Over the past decade, intracellular roles for SerpinB2 in cell survival [11]–[17], proliferation and differentiation [18]–[21], signal transduction [15]; [22]; [23] and innate immunity [24]–[28], have been described.
T22 3267-3392 Sentence denotes The SerpinB2 gene is highly regulated in a cell type specific manner analogous to that of cytokines and oncogenes [29]; [30].
T23 3393-3557 Sentence denotes It is one of the most responsive genes known [31], and can be induced over 1000-fold by LPS [31]–[32], and is up-regulated by a range of inflammatory mediators [9].
T24 3558-3626 Sentence denotes LPS activates immune responses through multiple signalling pathways.
T25 3627-3828 Sentence denotes The toll-like receptor 4 (TLR4) is responsible for the recognition of LPS and other microbial products and plays a central role in the initiation of innate immune responses, including cytokine release.
T26 3829-4116 Sentence denotes The binding of LPS to TLR4 on the surface of macrophages leads to the recruitment of adaptor molecules and the activation of protein kinases, generating signals to the nuclear factor-κB (NF-κB), mitogen-activated protein kinase (MAPK) and/or phosphoinositide 3(PI3)-kinase pathways [33].
T27 4117-4342 Sentence denotes In studies aimed at identifying LPS-inducible pro-survival factors downstream of p38 MAPK, SerpinB2 was identified as a factor whose expression was upregulated by cooperation of the IKKβ/NF-κB and p38 MAPK/CREB pathways [16].
T28 4343-4757 Sentence denotes Our previously published data indicated that SerpinB2 is distinctly regulated from other LPS-inducible genes in terms of kinetics, LPS dose response and sensitivity to IFN-γ co-stimulation [4]; however, the cis-acting elements in the SerpinB2 promoter responsible for LPS-dependent transcription in macrophages and the specific LPS-responsive transcription factors that bind the SerpinB2 promoter were not defined.
T29 4758-5000 Sentence denotes Here we show that LPS induction of SerpinB2 is dependent upon cis-acting regulatory sequences in the region between nucleotides −189 and −539 of the murine SerpinB2 promoter, and is critically dependent upon a C/EBP binding site at −203/−195.
T30 5001-5137 Sentence denotes C/EBP-β directly bound to this site in vivo and its deficiency abrogated constitutive SerpinB2 expression and SerpinB2 induction by LPS.
T31 5138-5255 Sentence denotes Importantly, a C/EBP-β phospho-acceptor site was found to negatively regulate LPS-induced SerpinB2 promoter activity.
T32 5256-5358 Sentence denotes Together, these findings provide new insight into the transcriptional regulation of the SerpinB2 gene.
T33 5360-5383 Sentence denotes Experimental Procedures
T34 5385-5397 Sentence denotes Cell Culture
T35 5398-5771 Sentence denotes Murine macrophage RAW 264.7 cells (ATCC TIB-71) were maintained in RPMI 1640 media (Gibco BRL), supplemented with 2 mM L-glutamine (Gibco BRL), 10% serum supreme (BioWhittaker), 200 µg/ml penicillin, 100 µg/ml streptomycin, 25 mM N-2-hydroxyethylpiperazine-N-2-ethane sulphonic acid (HEPES) and 25 mM sodium bicarbonate, in 5% CO2 and 95% humidified air atmosphere at 37°C.
T36 5772-6020 Sentence denotes Wild-type (Cebpb+/+) and knockout (Cebpb−/−) mouse embryonic fibroblasts (MEFs) [34] were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin/glutamate solution (Cellgro).
T37 6021-6216 Sentence denotes Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage 3–5 days later, and maintained in 50% DMEM/F12 media (Gibco BRL).
T38 6217-6361 Sentence denotes Precautions were taken to exclude bacterial lipopolysaccharide contamination from all cell cultures through the use of certified LPS-free serum.
T39 6362-6443 Sentence denotes Cell viability was determined using the trypan blue (Sigma) dye exclusion method.
T40 6444-6606 Sentence denotes All cultures were routinely checked to exclude Mycoplasma infection by nuclear staining using Hoechst stain 33258 (Sigma) and the MycoAlert Detection Kit (Lonza).
T41 6607-6702 Sentence denotes Bacterial lipopolysaccharide (LPS) (Salmonella minnesota Strain Re595) was obtained from Sigma.
T42 6704-6737 Sentence denotes Real-time Quantitative PCR (qPCR)
T43 6738-6808 Sentence denotes The RNeasy Mini Kit (Qiagen) was used to isolate total RNA from cells.
T44 6809-7109 Sentence denotes For cDNA synthesis, 1 µg of total RNA was reverse transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems). qPCR was performed using TaqMan® Gene Expression 20X primers for Serpinb2/SerpinB2 (Mm00440905_m1), Cebpb (Mm00843434_s1) and β-actin (Mm00607939_s1) (Applied Biosystems).
T45 7111-7132 Sentence denotes DNA Sequence Analysis
T46 7133-7395 Sentence denotes The DNA sequence of the murine SerpinB2 promoter was determined by sequencing the pUC-based plasmids pDB9406, pDB9402-41 and pDB9402-42, in addition to plasmids prepared from pDB9402-41 and pDB9402-42 containing deletions introduced by exonuclease III digestion.
T47 7396-7873 Sentence denotes Plasmids pDB9406, pDB9402-41 and pDB9402-42 containing genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain, were kindly provided by Dr. Dominique Belin, University of Geneva. pDB9406 contains a 4.4 kb EcoRI/SpeI genomic fragment spanning the transcription initiation site; pDB9402-41 and pDB9402-42 contain a 1.2 kb EcoRI genomic fragment, located immediately upstream of the pDB9406 EcoRI fragment, cloned in opposite orientations.
T48 7874-7957 Sentence denotes Subcloned inserts were verified by restriction enzyme digestion and DNA sequencing.
T49 7958-8177 Sentence denotes The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′ flanking region was determined using the ABI PRISM dye terminator cycle sequencing ready reaction kit (Perkin-Elmer) and a PE 373A sequencer (Perkin-Elmer).
T50 8178-8255 Sentence denotes This sequence was deposited in GenBank/EMBL/DDBJ Data Bank with Accession No.
T51 8256-8265 Sentence denotes AF339731.
T52 8267-8286 Sentence denotes Western Blot Assays
T53 8287-8521 Sentence denotes Whole cell lysates were prepared in RIPA buffer (10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS), proteins were separated on 4–12% Bis-Tris NuPAGE gels (Invitrogen), and transferred to PVDF membranes.
T54 8522-8653 Sentence denotes Membranes were subsequently blocked with 5% milk in PBS-T (1X PBS, 0.1% Tween-20), and incubated with primary antibodies overnight.
T55 8654-8837 Sentence denotes Affinity purified rabbit anti-mouse SerpinB2 antibodies were prepared after immunization with a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli as in [35].
T56 8838-9039 Sentence denotes Other antibodies used for western blot assays include: C/EBP-β (sc-150) (Santa Cruz Biotechnologies), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and α/β tubulin (Cell Signaling Technology, Inc.).
T57 9041-9088 Sentence denotes Construction of SerpinB2 Reporter Gene Plasmids
T58 9089-9383 Sentence denotes The PCR primers DW5’LUC, containing a Kpn I restriction site, and DW3’LUC, containing an Xho I restriction site, were used to PCR amplify and clone the SerpinB2 promoter (−3261 to +92) from pDB9406 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic (Promega) to produce pGLmP-3261.
T59 9384-9533 Sentence denotes The EcoR I insert of pDB9402-42 was sub-cloned immediately upstream of the SerpinB2 promoter EcoR I site (−3261) of pGLmP-3261 to produce pGLmP-4480.
T60 9534-9958 Sentence denotes Additional murine SerpinB2 luciferase reporter constructs (pGLmP-2751, pGLmP-2614, pGLmP-1686, pGLmP-1341, pGLmP-694, pGLmP-539 and pGLmP-189) were generated by digesting pGLmP-3261 with EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I respectively), blunt ending the resultant 5′ or 3′ overhangs with T4 DNA polymerase (NEB) and re-ligating the vector ends with T4 DNA ligase.
T61 9959-10148 Sentence denotes The PCR primers BSPCR2 and DW3’LUC were used to subclone the murine SerpinB2 promoter regions −87 to +92 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic to produce pGLmP-87.
T62 10149-10199 Sentence denotes The control empty vector was pGL3 Basic (Promega).
T63 10200-10443 Sentence denotes Luciferase reporter constructs containing mutations in the SerpinB2 promoter LPS-responsive regions E box, PU.1, Oct-1 and C/EBP (pGLmP-539mEbox, pGLmP-539mPU.1, pGLmP-539mOct and pGLmP-539mC/EBP respectively) were generated as described [36].
T64 10444-10724 Sentence denotes The mutant oligonucleotide PCR primer sequences are provided in Fig. S1, and were used as follows: pGLmP-539mEbox: mPAI2mEboxa and mPAI2mEboxb; pGLmP-539mPU.1: mPAI2mPU.1a and mPAI2mPU.1b; pGLmP-539mOct: mPAI2mOct-2a and mPAI2mOct-2b; pGLmP-539mC/EBP: mPAI2mCEBPa and mPAI2mCEBPb.
T65 10725-10865 Sentence denotes The oligonucleotide PCR primers used to generate mutants, pGLmP-539mCRE, pGLmP-539mAP-1a, and pGLmP-539mAP-1b were reported previously [37].
T66 10866-11005 Sentence denotes The flanking oligonucleotide PCR primers were RVprimer3 (Promega) and GLprimer2 (Promega). pGLmP-539 was used as the template in each case.
T67 11006-11212 Sentence denotes Recombinant PCR products were digested with EcoR I and Xho I and cloned between the EcoR I and Xho I restriction sites of pGLmP-539 in place of the −539/+92 region of the wild-type murine SerpinB2 promoter.
T68 11213-11271 Sentence denotes Sequence verified constructs were used in the experiments.
T69 11273-11340 Sentence denotes Transient Transfection and Luciferase Assays (RAW264.7 Macrophages)
T70 11341-11840 Sentence denotes RAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities.
T71 11841-12102 Sentence denotes Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS.
T72 12103-12196 Sentence denotes Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega).
T73 12197-12274 Sentence denotes Measurements represent the results of at least three independent experiments.
T74 12275-12513 Sentence denotes Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity).
T75 12514-12596 Sentence denotes Protein concentration was determined using the Bio-Rad protein microassay reagent.
T76 12598-12643 Sentence denotes Lentiviral shRNAs, Packaging and Transduction
T77 12644-12773 Sentence denotes pLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies.
T78 12774-13057 Sentence denotes Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38].
T79 13058-13321 Sentence denotes To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen).
T80 13322-13475 Sentence denotes The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter.
T81 13476-13596 Sentence denotes The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs.
T82 13597-13732 Sentence denotes The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown.
T83 13733-13790 Sentence denotes C/EBP-β knockdown was confirmed by western blot analysis.
T84 13792-13848 Sentence denotes Transient Transfection and Luciferase Assays (MEF Cells)
T85 13849-14093 Sentence denotes Cebpb −/− MEFs (1×105) [34] were transfected with the indicated luciferase reporter plasmid (400 ng) along with a β-actin-β-galactosidase reporter plasmid (200 ng) by electroporation using the Invitrogen Neon™ system (1 pulse, 1350 V, 30 msec).
T86 14094-14259 Sentence denotes Transfected cells were transferred to pre-warmed media in 24 well plates and incubated for 48 hrs prior to incubation with LPS (100 ng/ml) for 4 hrs where indicated.
T87 14260-14435 Sentence denotes In some experiments, plasmids encoding C/EBP-β or C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A) [38]–[40] or control vector were co-transfected (0.6–1.0 µg total DNA).
T88 14436-14621 Sentence denotes Luciferase activity was determined and normalized to that of β-galactosidase [38] using the Luciferase Assay System and β-Galactosidase Enzyme Assay System Kits, respectively (Promega).
T89 14622-14726 Sentence denotes Each experiment was repeated at least three times, and triplicate samples were employed for each sample.
T90 14727-14835 Sentence denotes Expression of the C/EBP-β phospho-acceptor mutant proteins was checked for equal expression by western blot.
T91 14837-14874 Sentence denotes Electrophoretic Mobility Shift Assays
T92 14875-15011 Sentence denotes Radiolabelled, double-stranded oligonucleotide probes for gel shift assays were prepared using T4 polynucleotide kinase and [γ-32P]-ATP.
T93 15012-15088 Sentence denotes RAW 264.7 nuclear extracts were prepared by the detergent lysis method [41].
T94 15089-15363 Sentence denotes DNA binding reactions (25 µl) containing 10 mM HEPES pH 7.9, 10 µg/ml BSA, 2 mM DTT, 30% glycerol, 20% Ficoll-400, 1 µg poly (dI-dC), 6 µg of nuclear extracts and 10,000 to 20,000 cpm (0.05 to 0.2 ng) of radiolabelled probe were performed for 20 minutes at room temperature.
T95 15364-15532 Sentence denotes Binding reaction products were resolved by electrophoresis at room temperature on 5% polyacrylamide gels (29∶1 acrylamide:bis-acrylamide (Bio-Rad)) in 1x TBE at 10V/cm.
T96 15533-15642 Sentence denotes For supershift assays, nuclear extracts were pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody.
T97 15643-15779 Sentence denotes Antibodies were purchased from Santa Cruz: anti-C/EBP-α (sc-61), anti-C/EBP-β (sc-150), anti-C/EBP-δ (sc-151) and anti-C/EBP-ε (sc-158).
T98 15781-15823 Sentence denotes Chromatin Immunoprecipitation (ChIP) Assay
T99 15824-15972 Sentence denotes ChIP assays were performed using a commercially available Magna-ChIP™ kit (Millipore), as recommended by the manufacturer, with minor modifications.
T100 15973-16190 Sentence denotes Briefly, after crosslinking the chromatin with 1% formaldehyde at room temperature for 10 min and neutralizing with glycine for 5 min at room temperature, cells were washed with cold PBS, scraped and collected on ice.
T101 16191-16267 Sentence denotes Cells extracts were prepared using a commercially available kit (Millipore).
T102 16268-16382 Sentence denotes Nuclear lysates were sonicated 5 times for 15 sec with 1 min intervals on ice using a Sonic Dismembrator (Fisher).
T103 16383-16653 Sentence denotes An equal amount of chromatin was immunoprecipitated at 4°C overnight with at least 1 µg of the following antibodies: C/EBP-β (sc-150X), p-C/EBP-β (T217) (sc-16993X), normal rabbit IgG (sc-2027)(Santa Cruz Biotechnologies) and RNA polymerase II (Clone CTD4H8)(Millipore).
T104 16654-16763 Sentence denotes Immunoprecipitated products were collected after incubation with Protein G coated magnetic beads (Millipore).
T105 16764-16920 Sentence denotes The beads were washed, the bound chromatin was eluted in ChIP Elution Buffer (Millipore) and the proteins were digested with Proteinase K for 2 hrs at 62°C.
T106 16921-16996 Sentence denotes The DNA was then purified using the QIAquick PCR Purification Kit (Qiagen).
T107 16997-17232 Sentence denotes DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’.
T108 17234-17254 Sentence denotes Statistical Analysis
T109 17255-17298 Sentence denotes Data are presented as mean ± SEM per group.
T110 17299-17395 Sentence denotes Results were analyzed using the analysis of variance (ANOVA) or Student’s t test where relevant.
T111 17396-17439 Sentence denotes P-values <0.05 were considered significant.
T112 17441-17448 Sentence denotes Results
T113 17450-17495 Sentence denotes The SerpinB2 Gene is Highly Responsive to LPS
T114 17496-17660 Sentence denotes When RAW264.7 macrophages were exposed to LPS, SerpinB2 mRNA was detectable as early as 30 min following LPS challenge, reaching maximal levels at 24 hrs (Fig. 1A).
T115 17661-17847 Sentence denotes A similar strong induction of LPS-inducible SerpinB2 mRNA expression has been reported previously in murine peritoneal macrophages and human peripheral blood mononuclear cells [4]; [32].
T116 17848-17979 Sentence denotes LPS-induced SerpinB2 expression involves both an increase in gene transcription and stabilization of the mRNA [5]; [29]; [42]–[44].
T117 17980-18125 Sentence denotes SerpinB2 protein expression was also induced as has been reported in other cell types [31], and detectable after 8 hrs of LPS treatment (Fig. 1).
T118 18126-18251 Sentence denotes 10.1371/journal.pone.0057855.g001 Figure 1 LPS induction of SerpinB2 mRNA and protein expression in murine macrophage cells.
T119 18252-18400 Sentence denotes RAW264.7 macrophages were treated for the indicated times with 100 ng/ml LPS. (A) qPCR analysis of murine SerpinB2 mRNA levels, relative to β-actin.
T120 18401-18570 Sentence denotes The plot is representative of at least two independent experiments performed in triplicate. (B) Immunoblot analysis of SerpinB2 protein expression in whole cell lysates.
T121 18571-18620 Sentence denotes Blot was reprobed for GAPDH as a loading control.
T122 18622-18679 Sentence denotes The SerpinB2 Proximal Promoter Confers LPS Responsiveness
T123 18680-18989 Sentence denotes To investigate cis-acting regulatory elements responsive to LPS in the 5′ flanking region of the murine SerpinB2 gene, nucleotides −4480 to +92 and a series of generated deletion mutants of the 5′ flanking region were cloned upstream of a promoter-less firefly luciferase reporter gene (pGL3 Basic) (Fig. 2A).
T124 18990-19182 Sentence denotes The reporter constructs were then transiently transfected into sub-confluent RAW264.7 macrophages and assayed for luciferase activity in the presence and absence of LPS or PMA, for comparison.
T125 19183-19402 Sentence denotes PMA-induced SerpinB2 gene regulation has been extensively studied in human macrophage cell lines [45]–[47], and has been shown to occur through several proximal and distal AP-1 responsive elements [30]; [37]; [47]–[51].
T126 19403-19571 Sentence denotes As shown in Fig. 2B, the SerpinB2 5′ flanking region from −4480 to +92 directs both PMA- and LPS-inducible transcription, approximately 2-fold and 7-fold, respectively.
T127 19572-19747 Sentence denotes Deletion of the murine SerpinB2 promoter from −1686 to −1341 increased LPS-inducibility to approximately 16-fold, indicating the presence of a silencer element in this region.
T128 19748-20014 Sentence denotes Further deletion beyond −539 abolished the LPS-response of the promoter, indicating the presence of an essential LPS response element in the region between −539 and −189; however, the response of the murine SerpinB2 promoter to PMA is less affected by this deletion.
T129 20015-20359 Sentence denotes While deletion of the SerpinB2 promoter from −189 to −87 eliminated the LPS response and marginally reduced the PMA response, the −87 murine SerpinB2 promoter construct was still partially responsive to PMA, indicating that cis-acting elements mediating the response of the murine SerpinB2 promoter to PMA also lie downstream of nucleotide −87.
T130 20360-20502 Sentence denotes 10.1371/journal.pone.0057855.g002 Figure 2 Deletion reporter gene analysis of LPS and PMA-responsive regions in the murine SerpinB2 promoter.
T131 20503-20611 Sentence denotes (A) Schematic representation of the murine SerpinB2 promoter and 5′ deletion luciferase reporter constructs.
T132 20612-20822 Sentence denotes The murine 5′ flanking region from −4480 to +92 was inserted upstream of the luciferase reporter gene and 5′ deletions were generated using restriction enzyme sites or with specific oligonucleotide PCR primers.
T133 20823-21063 Sentence denotes Construct names indicate the most 5′ nucleotide of murine SerpinB2 5′ flanking sequence. (B) RAW 264.7 macrophages were transiently transfected with the indicated murine SerpinB2 promoter-luciferase reporter constructs and control plasmids.
T134 21064-21154 Sentence denotes Cells were either left untreated or treated with 100 ng/ml LPS or 40 ng/ml PMA for 16 hrs.
T135 21155-21231 Sentence denotes Shown is the relative luciferase reporter gene activity following treatment.
T136 21232-21392 Sentence denotes The results represent the mean and SEM of four independent experiments. (C) DNA sequence conservation between the human and murine SerpinB2 5′ flanking regions.
T137 21393-21552 Sentence denotes Schematic representation of the human and murine SerpinB2 5′ flanking regions with regions of nucleotide sequence identity indicated by the same colored boxes.
T138 21553-21648 Sentence denotes Homologous regions are interrupted by repetitive sequence elements in both 5′ flanking regions.
T139 21649-21919 Sentence denotes Alu = Alu repeat, ID4 =  ID4 short interspersed nuclear repeat (SINE), L1 =  L1 long interspersed nuclear element (LINE), L2 =  L2 LINE, MIR = MIR SINE, MLT1L = MLT1L long terminal repeat (LTR), (TATG)n = TATG tetranucleotide repeat, tis = transcription initiation site.
T140 21921-21998 Sentence denotes Sequence Conservation within the Human and Murine SerpinB2 Proximal Promoters
T141 21999-22188 Sentence denotes To look for potential cis-acting elements that might mediate transcription of the murine SerpinB2 gene and the response to LPS, we aligned the murine and human SerpinB2 5′ flanking regions.
T142 22189-22377 Sentence denotes We reasoned that the presence of evolutionarily conserved, potential transcription factor binding sites in this region might play a role in the regulation of SerpinB2 gene expression [52].
T143 22378-22529 Sentence denotes The presence of several repetitive sequence elements delineated five broadly homologous regions (A-E) between the human and murine promoters (Fig. 2C).
T144 22530-22647 Sentence denotes The proximal promoter (Region E), which contains the essential LPS response element, exhibited the greatest homology.
T145 22648-22840 Sentence denotes Further analysis of Region E revealed that several of the cis-acting regulatory elements defined in the human SerpinB2 proximal promoter are conserved in the murine SerpinB2 promoter (Fig. 3).
T146 22841-23030 Sentence denotes Specifically, a TATA consensus sequence is located 23 to 29bp upstream from the transcription initiation site, similar to the position of the TATA box of the human SERPINB2 gene [53]; [54].
T147 23031-23287 Sentence denotes A putative CCAAT enhancer binding protein (C/EBP) site is present at −192/−203, two potential activator protein 1 (AP-1) binding sites are found at nucleotides −88/−94 and −100/−106, and a putative cyclic AMP response element (CRE) is present at −172/−177.
T148 23288-23467 Sentence denotes Both of the AP-1 sites are identical in sequence to those identified in the human SERPINB2 promoter, and the CRE differs in the identity of a single central nucleotide [37]; [55].
T149 23468-23644 Sentence denotes A consensus E box (−538/−533), as well as potential binding sites for PU.1 (−412/−407) and Oct-1 (−296/−288) were also identified within the proximal promoter region (Fig. S2).
T150 23645-23849 Sentence denotes Further upstream, a retinoic acid response element at −1349/−1340, a PAUSE-1 silencer element at −1540/−1528 and a NF-κB p65 binding site at −1342/−1351 (Fig. S2) are also well conserved [16]; [30]; [56].
T151 23850-23995 Sentence denotes 10.1371/journal.pone.0057855.g003 Figure 3 Potential cis-acting regulatory elements in the LPS responsive region of the murine SerpinB2 promoter
T152 23996-24004 Sentence denotes −563/−1.
T153 24005-24080 Sentence denotes Mouse and human nucleotide sequences were aligned using Clustal W software.
T154 24081-24181 Sentence denotes Cis-acting elements conserved between the human and murine SerpinB2 promoters are boxed and labeled.
T155 24182-24365 Sentence denotes AP-1 =  activator protein 1; C/EBP =  CCAAT enhancer binding protein; CRE = cAMP response element; Oct1 =  octamer transcription factor 1/POU2F1; PU.1 =  purine box binding protein 1.
T156 24366-24465 Sentence denotes The putative transcription initiation site (tis) is indicated and exon 1 is presented in uppercase.
T157 24466-24555 Sentence denotes The location of the 5' ends of the −539, −189 and −87 reporter constructs are also shown.
T158 24557-24688 Sentence denotes A C/EBP, CRE and Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter are Essential for Optimal LPS-inducible Transcription
T159 24689-25103 Sentence denotes To investigate regulatory elements between −539 and −189 essential for LPS-inducible transcription, several candidate binding sites for transcription factors previously reported to mediate LPS-inducible transcription in other genes [57] were targeted by nucleotide substitution designed to disrupt transcription factor binding to the pGLmP-539 murine SerpinB2 promoter-luciferase reporter gene construct (Fig. 4A).
T160 25104-25273 Sentence denotes As shown in Fig. 4B, mutation of the consensus E box (−538/−533), PU.1 (−412/−407), or the variant Oct-1 (−296/−288) site did not decrease LPS-induced promoter activity.
T161 25274-25448 Sentence denotes In contrast, mutation of the C/EBP site (−203/−192) completely eliminated promoter activity, similar to the levels observed for the −189 SerpinB2 promoter deletion construct.
T162 25449-25554 Sentence denotes Others have also recently implicated this C/EBP site in LPS-induced activation of the SerpinB2 gene [58].
T163 25555-25705 Sentence denotes 10.1371/journal.pone.0057855.g004 Figure 4 Identification of cis-acting elements required for the LPS-responsiveness of the murine SerpinB2 promoter.
T164 25706-25873 Sentence denotes (A) Schematic representation of the −539/+92 region of the murine SerpinB2 promoter with the location of candidate cis-acting regulatory elements indicated with boxes.
T165 25874-25962 Sentence denotes The location of the 5′ ends of the −539, −189 and −87 reporter constructs is also shown.
T166 25963-26280 Sentence denotes Positions of murine SerpinB2 proximal promoter-specific primers, 338/−315 and −5/+19 used in ChIP assays are indicated. (B) RAW 264.7 macrophages were transiently transfected with the indicated murine SerpinB2 promoter-luciferase reporter constructs and either left untreated or treated with 100 ng/ml LPS for 16 hrs.
T167 26281-26413 Sentence denotes The results show relative luciferase activity following LPS treatment and represent the mean and SEM of 4–7 independent experiments.
T168 26414-26773 Sentence denotes Considering the conserved sequence and position of the CRE and two AP-1 sites in the murine SerpinB2 promoter and their demonstrated involvement in the PMA-responsiveness of the human SERPINB2 promoter [37], these sites were also mutated by nucleotide substitution to investigate whether they played a role in the LPS response of the murine SerpinB2 promoter.
T169 26774-26990 Sentence denotes As shown in Fig. 4B, mutation of the CRE at −177/−172 or either of the two AP-1 sites at −106/−100 and −94/−88, completely or significantly reduced LPS-inducible luciferase activity from the murine SerpinB2 promoter.
T170 26991-27165 Sentence denotes These data show that the C/EBP element, as well as the CRE and both AP-1 cis-acting elements are critical for LPS-inducible transcription from the SerpinB2 proximal promoter.
T171 27167-27253 Sentence denotes The C/EBP Element is Bound by an LPS-induced Nuclear Factor from RAW 264.7 Macrophages
T172 27254-27459 Sentence denotes Nuclear factor binding to the putative C/EBP element (−203/−192) was investigated by electrophoretic mobility shift assay (EMSA) using nuclear extracts from untreated and LPS-treated RAW 264.7 macrophages.
T173 27460-27791 Sentence denotes Three different double stranded oligonucleotide probes were used for EMSA, representing (1) the putative SerpinB2 C/EBP element (−203/−192), (2) a mutant SerpinB2 element containing the same mutation as in pGLmP-539mC/EBP and (3) the rat albumin promoter distal element 1 (DEI) region containing a high affinity C/EBP binding site.
T174 27792-27895 Sentence denotes Four bands of different mobilities, representing DNA-nuclear protein complexes were detected (Fig. 5A).
T175 27896-28052 Sentence denotes Three of these bands (I, II, III) represent complexes with single stranded DNA (Fig. 5A) while the uppermost (slowest migrating) complex was induced by LPS.
T176 28053-28448 Sentence denotes The LPS-inducible complex was not detected using the mutant C/EBP oligonucleotide probe and could be abolished by an excess of unlabeled double-stranded oligonucleotide, carrying either the same sequence (Fig. 5B, lanes 4 and 5) or the sequence of a known C/EBP binding site from the rat albumin promoter (Fig. 5B, lanes 8 and 9), but not by the mutated oligonucleotide (Fig. 5B, lanes 6 and 7).
T177 28449-28639 Sentence denotes Together these data indicate that the putative SerpinB2 C/EBP site at −203/−192 binds a LPS-inducible complex that is likely to contain a member of the C/EBP family of transcription factors.
T178 28640-28791 Sentence denotes 10.1371/journal.pone.0057855.g005 Figure 5 The LPS-inducible nuclear factor binding the murine SerpinB2 proximal promoter C/EBP site contains C/EBP-β.
T179 28792-29486 Sentence denotes (A) EMSA with nuclear extracts from untreated (UN) and 10 hr LPS treated (LPS) RAW 264.7 cells incubated with either the murine SerpinB2 promoter −212/−185 probe containing an intact (SerpinB2 C/EBP) or mutated (mutant C/EBP) C/EBP site or with the rat albumin promoter DEI region C/EBP (rat albumin C/EBP) probe. (B) Cold competition EMSAs performed with the radiolabelled murine SerpinB2 promoter −212/−185 probe and a 100-fold molar excess of each of the double stranded oligonucleotides described in (A) demonstrate the specificity of the DNA-protein complexes. (C) Supershift assays were performed with the −212/−185 probe by after preincubation with the indicated specific C/EBP antibody.
T180 29487-29544 Sentence denotes The LPS-inducible complex is indicated with an arrowhead.
T181 29546-29651 Sentence denotes C/EBP-β is a LPS-induced Nuclear Factor that Binds to the C/EBP Element of the SerpinB2 Proximal Promoter
T182 29652-29791 Sentence denotes The C/EBP family of basic leucine zipper transcription factors are known for their roles in cellular differentiation and inflammation [59].
T183 29792-29927 Sentence denotes Consisting of six members, the C/EBP transcription factors can homo−/heterodimerize and display similar DNA binding specificities [60].
T184 29928-30123 Sentence denotes Four family members, C/EBP-α, C/EBP-β, C/EBP-δ and C/EBP-ε, are present in myeloid cells and play different roles in differentiating myeloid cells depending on the extracellular environment [61].
T185 30124-30411 Sentence denotes To determine which C/EBP proteins were involved in the formation of the different nucleo-protein complexes, and particularly of the LPS-inducible complex, EMSA was performed after incubating the nucleo-protein complexes with antibodies specific for C/EBP-α, C/EBP-β, C/EBP-δ and C/EBP-ε.
T186 30412-30605 Sentence denotes Each antibody detects the carboxy-terminal DNA-binding region of the respective protein, so that pre-incubation of antibody with nuclear extract is expected to abolish DNA binding by EMSA [62].
T187 30606-30701 Sentence denotes Only antibodies against C/EBP-β abolished the formation of the LPS-inducible complex (Fig. 5C).
T188 30702-30814 Sentence denotes Taken together these data show that the LPS-induced complex with the C/EBP element (−203/−192) contains C/EBP-β.
T189 30816-30936 Sentence denotes C/EBP-β Mediates both Constitutive and LPS-induced SerpinB2 mRNA Expression in MEFs and Inflammatory Primary Macrophages
T190 30937-31168 Sentence denotes To investigate the importance of C/EBP-β to endogenous SerpinB2 mRNA expression in response to LPS, we utilized C/EBP-β-null (Cebpb −/−) and wild-type MEFs (Cebpb+/+), since RAW264.7 cells constitutively express endogenous C/EBP-β.
T191 31169-31300 Sentence denotes Wild-type MEFs express low levels of endogenous SerpinB2 and the absence of C/EBP-β attenuated endogenous SerpinB2 mRNA expression.
T192 31301-31502 Sentence denotes LPS stimulated an increase in SerpinB2 mRNA expression in wild-type MEFs (Fig. 6A), whereas LPS-stimulated SerpinB2 mRNA expression was significantly dampened in Cebpb−/− MEFs as compared to wild-type.
T193 31503-31705 Sentence denotes We next tested if similar effects could be seen in thioglycollate-elicited inflammatory macrophages in which C/EBP-β expression was knocked down using species-specific lentiviral shRNAs (Fig. 6B, left).
T194 31706-31881 Sentence denotes As was observed in MEFs, both constitutive and LPS-induced SerpinB2 mRNA expression was significantly decreased in C/EBP-β-deficient inflammatory macrophages (Fig. 6B, right).
T195 31882-32010 Sentence denotes These data show that C/EBP-β is critical for mediating constitutive and LPS-inducible transcription of endogenous SerpinB2 mRNA.
T196 32011-32134 Sentence denotes 10.1371/journal.pone.0057855.g006 Figure 6 C/EBP-β is essential for constitutive and LPS-induced SerpinB2 mRNA expression.
T197 32135-32518 Sentence denotes (A) Endogenous SerpinB2 mRNA expression is abrogated in Cebpb−/− MEFs compared to Cebpb+/+ MEFs in the absence and presence of LPS. qPCR analysis of murine SerpinB2 mRNA expression in untreated Cebpb+/+ and Cebpb−/− MEFs, and after simulation with LPS (100 ng/ml) for the indicated times. (B) Endogenous SerpinB2 expression is abrogated in C/EBP-β-deficient inflammatory macrophages.
T198 32519-32639 Sentence denotes Thioglycollate-elicited peritoneal macrophages (TG macs) were infected with human and murine specific lentiviral shRNAs.
T199 32640-32750 Sentence denotes Human CEBPB shRNA serves as the non-silencing control since it does not target the murine Cebpb sequence [38].
T200 32751-32832 Sentence denotes Lentiviral transduced macrophages were stimulated with LPS (100 ng/ml) for 4 hrs.
T201 32833-32838 Sentence denotes Left:
T202 32839-32979 Sentence denotes Western blot analysis shows effective knockdown of endogenous C/EBP-β following infection with murine Cebpb shRNA and not human CEBPB shRNA.
T203 32980-33088 Sentence denotes Right: qPCR analysis of murine SerpinB2 mRNA expression in the lentiviral transduced peritoneal macrophages.
T204 33089-33224 Sentence denotes The results represent the mean and SEM of two independent experiments performed in duplicate or triplicate. (*, p<0.05, two-way ANOVA).
T205 33226-33312 Sentence denotes C/EBP-β Binds the Murine SerpinB2 Proximal Promoter in vivo in an LPS-inducible Manner
T206 33313-33473 Sentence denotes We investigated the temporal dynamics of C/EBP-β recruitment to the murine SerpinB2 promoter in response to LPS in vivo by chromatin immunoprecipitation (ChIP).
T207 33474-33760 Sentence denotes RAW 264.7 cells were stimulated with LPS for up to 8 hrs, soluble chromatin was immunoprecipitated with antibodies against DNA binding proteins, and the enriched DNA amplified by both semi-quantitative and qPCR using SerpinB2 proximal promoter specific primers (illustrated in fig. 4A).
T208 33761-34042 Sentence denotes The results showed that C/EBP-β is constitutively present at the SerpinB2 promoter as demonstrated by its association with the promoter in unstimulated macrophages and increased temporally in response to LPS reaching as much as 10-fold over unstimulated cells after 8 hrs (Fig. 7).
T209 34043-34470 Sentence denotes Since changes in C/EBP-β phosphorylation states can affect C/EBP-β’s ability to transactivate target genes [38]; [63]; [64], we investigated recruitment to the SerpinB2 proximal promoter of the T217 phosphorylated C/EBP-β isoform (p-C/EBP-βT217), which has been associated with cell survival [65]. p-C/EBP-βT217 was constitutively bound to the SerpinB2 proximal promoter and also present after 1 hr of LPS stimulation (Fig. 7).
T210 34471-34648 Sentence denotes In contrast to total C/EBP-β, the binding affinity of p-C/EBP-βT217 for the SerpinB2 proximal promoter diminished with LPS stimulation at later timepoints (4 and 8 hrs)(Fig. 7).
T211 34649-34879 Sentence denotes These data show an inverse relationship between C/EBP-β and p-C/EBP-βT217 recruitment, and indicate that T217-phosphorylated C/EBP-β may not be responsible for increased transcription from the SerpinB2 promoter in response to LPS.
T212 34880-35016 Sentence denotes 10.1371/journal.pone.0057855.g007 Figure 7 Differential recruitment of C/EBP-β and C/EBP-βT217 to the murine SerpinB2 promoter in vivo.
T213 35017-35151 Sentence denotes Transcription factor occupancy on the SerpinB2 proximal promoter in vivo was determined by chromatin immunoprecipitation (ChIP) assay.
T214 35152-35341 Sentence denotes RAW264.7 macrophages were treated in the presence or absence of LPS for the indicated times and chromatin immunoprecipitation performed using antibodies against C/EBP-β or p-C/EBP-β (T217).
T215 35342-35655 Sentence denotes Soluble chromatin (600–700 ng) was immunoprecipitated with antibodies against C/EBP-β, p-C/EBP-β (T217), RNA Polymerase II (RNAPII), or a rabbit IgG (rIgG) control. (A) Typical PCR pattern obtained in ChIP assays using murine SerpinB2 proximal promoter-specific primers, 338/−315 and −5/+19, as diagrammed in top.
T216 35656-35759 Sentence denotes Recruitment of RNAPII to the SerpinB2 promoter suggests active transcription following LPS stimulation.
T217 35760-35996 Sentence denotes Minimal background was detected using the rabbit IgG control, indicative of the specificity of the ChIP reaction. (B) qPCR analysis of chromatin immunoprecipitated with antibodies against C/EBP-β, p-C/EBP-β (T217), and the rIgG control.
T218 35997-36070 Sentence denotes The data are represented relative to rIgG signal using the 2-ΔΔCt method.
T219 36072-36145 Sentence denotes C/EBP-β Promotes LPS-inducible Murine SerpinB2 Proximal Promoter Activity
T220 36146-36412 Sentence denotes Since C/EBP-β binds to the SerpinB2 proximal promoter in an LPS-inducible manner both in vitro and in vivo, we wanted to address the question of whether C/EBP-β was an essential factor for driving transcription from the SerpinB2 promoter in cells in response to LPS.
T221 36413-36631 Sentence denotes The ability of endogenous C/EBP-β to direct transcription from the SerpinB2 proximal promoter was examined by transfection of the pGLmP-539 murine SerpinB2 luciferase reporter construct into Cebpb+/+ and Cebpb−/− MEFs.
T222 36632-36874 Sentence denotes We found that LPS-stimulated SerpinB2 promoter activity was significantly increased in Cebpb+/+ MEFs and abrogated in Cebpb−/− MEFs (Fig. 8A), indicating that endogenous C/EBP-β is required for LPS-induced SerpinB2 proximal promoter activity.
T223 36875-36980 Sentence denotes 10.1371/journal.pone.0057855.g008 Figure 8 C/EBP-β is necessary for SerpinB2 proximal promoter activity.
T224 36981-37100 Sentence denotes (A) The SerpinB2 proximal promoter is significantly activated in LPS-stimulated Cebpb+/+ MEFs and not in Cebpb−/− MEFs.
T225 37101-37288 Sentence denotes Murine SerpinB2 gene promoter activity measured in Cebpb+/+ and Cebpb−/− MEFs expressing the pGLmP-539 SerpinB2 promoter-luciferase reporter in the presence or absence of LPS (100 ng/mL).
T226 37289-37659 Sentence denotes Cells were co-transfected with the pGLmP-539 SerpinB2 promoter-luciferase reporter and β-galactosidase reporter plasmids, and luciferase units normalized to β-galactosidase activity. (B) C/EBP-β gene schematic depicting gene structure and phospho-acceptor sites. (C) Phosphorylation of C/EBP-β at Serine 64 negatively regulates LPS-stimulated SerpinB2 promoter activity.
T227 37660-37933 Sentence denotes Cebpb−/− MEFs were co-transfected with expression plasmids encoding wild-type C/EBP-β or the indicated C/EBP-β phospho-acceptor mutants, along with the pGLmP-539 SerpinB2 promoter-luciferase reporter and β-galactosidase reporter plasmids, and stimulated with LPS for 4 hrs.
T228 37934-38012 Sentence denotes Luciferase activity was quantified and normalized to β-galactosidase activity.
T229 38013-38124 Sentence denotes The western blot (below the graphs) confirms the expression of the respective C/EBP-β phospho-acceptor mutants.
T230 38125-38215 Sentence denotes The C/EBP-βT217A -transfected MEFs express both the 38 kDa and 35 kDa isoforms of C/EBP-β.
T231 38216-38349 Sentence denotes The results represent the mean and SEM of at least three independent experiments performed in triplicate. (*, p<0.05, one-way ANOVA).
T232 38351-38453 Sentence denotes Phosphorylation of C/EBP-β at Serine 64 negatively Regulates LPS-stimulated SerpinB2 Promoter Activity
T233 38454-38547 Sentence denotes Phosphorylation of C/EBP-β is well recognized to modulate its transactivation potential [63].
T234 38548-38893 Sentence denotes To investigate C/EBP-β phosphorylation sites that may be important for LPS-stimulated SerpinB2 proximal promoter activity (Fig. 8B), we co-expressed several C/EBP-β phospho-acceptor mutants in which the critical threonine or serine residue was mutated to an alanine, along with the pGLmP-539 murine SerpinB2 luciferase reporter in Cebpb−/− MEFs.
T235 38894-39147 Sentence denotes Re-expression of wild-type C/EBP-β in Cebpb−/− MEFs significantly stimulated SerpinB2 luciferase reporter gene expression in the presence of LPS by ∼3 fold (Fig. 8C, left), confirming the importance of C/EBP-β to LPS-induced SerpinB2 gene transcription.
T236 39148-39477 Sentence denotes Expression of the C/EBP-β phospho-acceptor mutant, C/EBPβT217A, in Cebpb−/− MEFs did not significantly increase SerpinB2 promoter activity above that of wild-type C/EBP-β (Fig. 8C, right); confirming that phosphorylation of C/EBP-β at T217 is not a major factor in the regulation of SerpinB2 promoter activity in response to LPS.
T237 39478-39649 Sentence denotes C/EBP-β contains additional phosphorylation sites, C/EBP-βT188 and C/EBP-βS64 (Fig. 8B), which may be involved in modulating C/EBP-β-dependent SerpinB2 gene transcription.
T238 39650-39841 Sentence denotes C/EBP-βT188 is implicated in regulating DAPK1, an IFNγ-inducible gene involved in the regulation of cell cycle and apoptosis [38], processes with which SerpinB2 has also been associated [17].
T239 39842-39933 Sentence denotes C/EBP-βS64 is important for LPS-induced transcription of the cytokines IL-6 and MCP-1 [64].
T240 39934-40024 Sentence denotes Similarly, SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29].
T241 40025-40236 Sentence denotes Given the similarities in the functional significance of these phospho-specific isoforms of C/EBP-β and SerpinB2, we investigated whether these phospho-acceptor sites may play a role in SerpinB2 gene expression.
T242 40237-40472 Sentence denotes C/EBP-βT188A-transfected MEFs exhibited SerpinB2 promoter activity similar to that of wild-type C/EBP-β-transfected MEFs, whereas the expression of C/EBP-βS64A potentiated SerpinB2 promoter activity in response to LPS (Fig. 8C, right).
T243 40473-40595 Sentence denotes These data suggest that phosphorylation of C/EBP-β at S64 acts to negatively regulate SerpinB2 proximal promoter activity.
T244 40597-40607 Sentence denotes Discussion
T245 40608-40738 Sentence denotes Macrophages are key mediators of the innate immune response, and consequently provide the first line of defense against pathogens.
T246 40739-40930 Sentence denotes Pro-inflammatory stimuli, such as the bacterial endotoxin LPS, stimulate macrophages to mount an anti-pathogenic response which involves massive induction of the pro-survival factor SerpinB2.
T247 40931-41060 Sentence denotes SerpinB2 is transcriptionally induced by cross talk between the IKKβ/NF-κB and p38MAPK signaling modules in response to LPS [16].
T248 41061-41213 Sentence denotes Here we report that SerpinB2 gene transcription in response to LPS is conferred by the SerpinB2 proximal promoter and is greatly dependent upon C/EBP-β.
T249 41214-41443 Sentence denotes LPS-induced C/EBP-β was shown to specifically bind the C/EBP response element in the SerpinB2 proximal promoter in vitro and in vivo, and loss of C/EBP-β abrogates constitutive SerpinB2 gene transcription and the response to LPS.
T250 41444-41656 Sentence denotes The murine SerpinB2 proximal promoter region between nucleotides -539 and +92 mediated both PMA- and LPS-inducible gene transcription, with induction by PMA being less intense and more transient than that by LPS.
T251 41657-41940 Sentence denotes Inspection of the murine SerpinB2 proximal promoter sequence shows that a CRE and two AP-1-like elements, demonstrated to mediate PMA-stimulated transcription of the human SERPINB2 gene [37], also are present in the murine SerpinB2 proximal promoter between nucleotides −189 and −87.
T252 41941-42053 Sentence denotes These sites may therefore also play a role in mediating PMA-inducible transcription of the murine SerpinB2 gene.
T253 42054-42356 Sentence denotes In contrast to the pattern of incremental increases in PMA-induced transcriptional activity conferred by regions of the murine SerpinB2 promoter containing these sites, most of the LPS-inducible response is dependent upon cis-acting regulatory sequences in the region between nucleotides −189 and −539.
T254 42357-42543 Sentence denotes LPS responsiveness absolutely required the C/EBP binding site located in the region between nucleotides −189 and −539, with the downstream CRE and AP-1-like elements also being critical.
T255 42544-42811 Sentence denotes Of note, there are previous reports of combinatorial interactions between C/EBP-β and CRE binding proteins (CREB) and AP-1 [63], and C/EBP-β has been reported to physically interact with AP-1, and NF-κB to promote gene expression of inflammatory mediators [63]; [66].
T256 42812-42896 Sentence denotes Additionally, CREB has been shown to control transcription of the C/EBP-β gene [67].
T257 42897-43022 Sentence denotes In this study, C/EBP-β was found to be a major requirement for both constitutive and LPS-induced SerpinB2 gene transcription.
T258 43023-43245 Sentence denotes In a previous microarray expression profiling study, SerpinB2 was identified as gene whose induction in C/EBP-β-deficient peritoneal macrophages by LPS and IFNγ was severely impaired compared to wild-type macrophages [68].
T259 43246-43512 Sentence denotes Our qPCR results validate this finding, as we found that both constitutive and LPS-inducible SerpinB2 mRNA expression is significantly abrogated in C/EBP-β-shRNA transduced peritoneal macrophages, emphasizing the link between C/EBP-β and SerpinB2 gene transcription.
T260 43513-43774 Sentence denotes While C/EBP proteins can act as either homodimers or heterodimers [63], we identified C/EBP-β as the only LPS-inducible C/EBP isoform to bind the SerpinB2 C/EBP response element, suggesting a predominant role for C/EBP-β in LPS-induced SerpinB2 gene expression.
T261 43775-43922 Sentence denotes C/EBP-β, like SerpinB2, plays an important role in inflammation, as it is upregulated by LPS and a host of other inflammatory cytokines [59]; [62].
T262 43923-44110 Sentence denotes Furthermore, C/EBP-β-null mice are susceptible to bacterial infection [69]; [70] and SerpinB2 has been demonstrated to protect from bacterial and viral-induced cell death [14]–[16]; [25].
T263 44111-44225 Sentence denotes Thus the regulation of SerpinB2 gene expression by C/EBP-β is consistent with its functional role in inflammation.
T264 44226-44364 Sentence denotes Phosphorylation of C/EBP-β at several different amino acid residues has been shown to modulate transactivation of its target genes [63]; .
T265 44365-44564 Sentence denotes C/EBP-β phosphorylated on T217 has been reported to rescue macrophages from apoptosis induced by Bacillus anthracis lethal toxin (LT) [65], an activity that has also been attributed to SerpinB2 [16].
T266 44565-44876 Sentence denotes However, expression of a C/EBP-β phospho-acceptor site mutant, C/EBPβT217A, in Cebpb−/− MEFs did not increase SerpinB2 proximal promoter activity over that of wild-type C/EBP-β, even though recruitment of C/EBP-βT217 to the SerpinB2 promoter was observed to decrease following LPS stimulation of RAW264.7 cells.
T267 44877-44997 Sentence denotes These data indicate that the T217 phospho-acceptor site is not important for the regulation of SerpinB2 gene expression.
T268 44998-45156 Sentence denotes Similarly, expression of the C/EBP-β phospho-acceptor site mutant, C/EBP-βT188A, did not affect SerpinB2 promoter activity differently from that of wild-type.
T269 45157-45369 Sentence denotes In contrast, expression of C/EBP-βS64A significantly enhanced LPS-induced SerpinB2 promoter activity, indicating that phosphorylation of C/EBP-β at S64 negatively regulates LPS-induced SerpinB2 promoter activity.
T270 45370-45611 Sentence denotes Since C/EBP-β S64 is constitutively phosphorylated in both RAW264.7 cells and MEFs [73], it is likely that dephosphorylation at this site may be a critical event during LPS-induced transcription of SerpinB2 to increase its promoter activity.
T271 45612-45776 Sentence denotes Roy and colleagues demonstrated that Mixed lineage kinase-3 (MLK3)-driven dephosphorylation of C/EBP-β S64 was important for IFNγ-regulated signaling pathways [73].
T272 45777-45883 Sentence denotes Our data suggest that MLK3-driven dephosphorylation of S64 may also be involved in LPS-signaling pathways.
T273 45884-46109 Sentence denotes In recent years it has become apparent that persistent infection is integrally linked to chronic inflammation and cancer, and immune cells such as macrophages can either promote or attenuate cancer progression [2]; [74]–[76].
T274 46110-46270 Sentence denotes SerpinB2 expression has been associated with both inflammation and cancer, and is a favorable or unfavorable prognostic indicator depending on cancer type [77].
T275 46271-46406 Sentence denotes The presence of SerpinB2 has been shown to modulate cytokine profiles which can affect immune cell polarization [27]; [28]; [77]; [78].
T276 46407-46549 Sentence denotes Interestingly C/EBP-β has also been shown to modulate cytokine secretion from immune cells, thereby modifying their phenotype [27]; [79]–[81].
T277 46550-46815 Sentence denotes Our study has demonstrated that C/EBP-β plays an important role in mediating both constitutive and LPS-induced transcription of the SerpinB2 gene, which may have implications for the inflammatory phenotype of infiltrating immune cells in the tumor microenvironment.
T278 46816-47001 Sentence denotes In summary, our studies show that the C/EBP site (−203/−195) in the murine SerpinB2 proximal promoter is necessary to support both constitutive and LPS-induced SerpinB2 gene expression.
T279 47002-47132 Sentence denotes Importantly, we were able to uncover a previously unknown role for C/EBP-βS64 in negatively regulating SerpinB2 promoter activity.
T280 47133-47251 Sentence denotes Taken together these data provide new insight into the regulation of inflammation-associated SerpinB2 gene expression.
T281 47253-47275 Sentence denotes Supporting Information
T282 47276-47551 Sentence denotes Figure S1 PCR primer sequences used to generate murine SerpinB2 reporter constructs. (top) PCR primer sequences used to subclone SerpinB2 promoter sequences into pGL3 Basic luciferase reporter plasmid and generate deletion constructs as indicated in Experimental Procedures.
T283 47552-47734 Sentence denotes KpnI (GGTACC) and XhoI (CTCGAG) restriction sites are underlined. (bottom) mutant oligonucleotide PCR primers used to mutate LPS-responsive regions in the SerpinB2 proximal promoter.
T284 47735-47773 Sentence denotes Mutated nucleotides are shown in bold.
T285 47774-47779 Sentence denotes (TIF)
T286 47780-47816 Sentence denotes Click here for additional data file.
T287 47817-47900 Sentence denotes Figure S2 Conserved response elements in the murine and human SerpinB2 promoter.
T288 47901-48044 Sentence denotes Location and nucleotide sequences of the cis-acting elements conserved between the human and murine SerpinB2 promoters are listed as indicated.
T289 48045-48050 Sentence denotes (TIF)
T290 48051-48087 Sentence denotes Click here for additional data file.

ICD10

Id Subject Object Predicate Lexical cue
T18844 43973-43992 http://purl.bioontology.org/ontology/ICD10/A49.9 denotes bacterial infection
T3171 6491-6511 http://purl.bioontology.org/ontology/ICD10/A49.3 denotes Mycoplasma infection

simple1

Id Subject Object Predicate Lexical cue
T210 25-32 Protein denotes C/EBP-β
T26219 38207-38214 Protein denotes C/EBP-β
T26218 38129-38141 Protein denotes C/EBP-βT217A
T26217 38091-38123 Protein denotes C/EBP-β phospho-acceptor mutants
T26216 37987-38002 Protein denotes β-galactosidase
T26215 37934-37944 Protein denotes Luciferase
T26214 37864-37888 Protein denotes β-galactosidase reporter
T26213 37822-37859 Protein denotes SerpinB2 promoter-luciferase reporter
T26212 37763-37795 Protein denotes C/EBP-β phospho-acceptor mutants
T26211 37738-37745 Protein denotes C/EBP-β
T26210 37660-37665 Protein denotes Cebpb
T26209 37632-37640 Protein denotes SerpinB2
T26208 37575-37582 Protein denotes C/EBP-β
T26207 37476-37483 Protein denotes C/EBP-β
T26206 37446-37461 Protein denotes β-galactosidase
T26205 37415-37425 Protein denotes luciferase
T26204 37376-37400 Protein denotes β-galactosidase reporter
T26203 37334-37371 Protein denotes SerpinB2 promoter-luciferase reporter
T26202 37204-37241 Protein denotes SerpinB2 promoter-luciferase reporter
T26201 37165-37170 Protein denotes Cebpb
T26200 37152-37157 Protein denotes Cebpb
T26199 37108-37116 Protein denotes SerpinB2
T26198 37086-37091 Protein denotes Cebpb
T26197 37061-37066 Protein denotes Cebpb
T26196 36989-36997 Protein denotes SerpinB2
T26195 36944-36952 Protein denotes SerpinB2
T26194 36919-36926 Protein denotes C/EBP-β
T25394 36034-36038 Protein denotes rIgG
T25393 35957-35973 Protein denotes p-C/EBP-β (T217)
T25392 35948-35955 Protein denotes C/EBP-β
T25391 35685-35693 Protein denotes SerpinB2
T25390 35568-35576 Protein denotes SerpinB2
T25389 35429-35445 Protein denotes p-C/EBP-β (T217)
T25388 35420-35427 Protein denotes C/EBP-β
T25387 35324-35340 Protein denotes p-C/EBP-β (T217)
T25386 35313-35320 Protein denotes C/EBP-β
T25385 35055-35063 Protein denotes SerpinB2
T25384 34990-34998 Protein denotes SerpinB2
T25383 34952-34959 Protein denotes C/EBP-β
T24629 33011-33019 Protein denotes SerpinB2
T24628 32901-32908 Protein denotes C/EBP-β
T24627 32730-32735 Protein denotes Cebpb
T24626 32475-32482 Protein denotes C/EBP-β
T24625 32439-32447 Protein denotes SerpinB2
T24624 32342-32347 Protein denotes Cebpb
T24623 32329-32334 Protein denotes Cebpb
T24622 32291-32299 Protein denotes SerpinB2
T24621 32217-32222 Protein denotes Cebpb
T24620 32191-32196 Protein denotes Cebpb
T24619 32150-32158 Protein denotes SerpinB2
T24618 32109-32117 Protein denotes SerpinB2
T24617 32055-32062 Protein denotes C/EBP-β
T24211 29173-29181 Protein denotes SerpinB2
T24210 29084-29091 Protein denotes albumin
T24209 29045-29052 Protein denotes albumin
T24208 28976-28984 Protein denotes SerpinB2
T24207 28920-28928 Protein denotes SerpinB2
T24206 28783-28790 Protein denotes C/EBP-β
T24205 28736-28744 Protein denotes SerpinB2
T23814 26307-26317 Protein denotes luciferase
T23813 26164-26201 Protein denotes SerpinB2 promoter-luciferase reporter
T23812 25983-25991 Protein denotes SerpinB2
T23811 25772-25780 Protein denotes SerpinB2
T23810 25687-25695 Protein denotes SerpinB2
T22727 21442-21450 Protein denotes SerpinB2
T22726 21363-21371 Protein denotes SerpinB2
T22725 21177-21187 Protein denotes luciferase
T22724 20993-21030 Protein denotes SerpinB2 promoter-luciferase reporter
T22723 20881-20889 Protein denotes SerpinB2
T22722 20689-20699 Protein denotes luciferase
T22721 20546-20599 Protein denotes SerpinB2 promoter and 5′ deletion luciferase reporter
T22720 20484-20492 Protein denotes SerpinB2
T23435 24336-24364 Protein denotes purine box binding protein 1
T23434 24328-24332 Protein denotes PU.1
T23433 24320-24326 Protein denotes POU2F1
T23432 24289-24319 Protein denotes octamer transcription factor 1
T23431 24281-24285 Protein denotes Oct1
T23430 24140-24148 Protein denotes SerpinB2
T23429 23978-23986 Protein denotes SerpinB2
T22419 18593-18598 Protein denotes GAPDH
T22418 18520-18528 Protein denotes SerpinB2
T22417 18392-18399 Protein denotes β-actin
T22416 18358-18366 Protein denotes SerpinB2
T22415 18187-18195 Protein denotes SerpinB2
T18924 47226-47234 Protein denotes SerpinB2
T18923 47105-47113 Protein denotes SerpinB2
T18922 46976-46984 Protein denotes SerpinB2
T18921 46891-46899 Protein denotes SerpinB2
T18920 46682-46690 Protein denotes SerpinB2
T18919 46582-46589 Protein denotes C/EBP-β
T18918 46421-46428 Protein denotes C/EBP-β
T18917 46287-46295 Protein denotes SerpinB2
T18916 46110-46118 Protein denotes SerpinB2
T18915 45799-45803 Protein denotes MLK3
T18914 45737-45741 Protein denotes IFNγ
T18913 45707-45714 Protein denotes C/EBP-β
T18912 45673-45677 Protein denotes MLK3
T18911 45649-45671 Protein denotes Mixed lineage kinase-3
T18910 45568-45576 Protein denotes SerpinB2
T18909 45376-45383 Protein denotes C/EBP-β
T18908 45342-45350 Protein denotes SerpinB2
T18907 45294-45301 Protein denotes C/EBP-β
T18906 45231-45239 Protein denotes SerpinB2
T18905 45184-45195 Protein denotes C/EBP-βS64A
T18904 45094-45102 Protein denotes SerpinB2
T18903 45065-45077 Protein denotes C/EBP-βT188A
T18902 45027-45063 Protein denotes C/EBP-β phospho-acceptor site mutant
T18901 44972-44980 Protein denotes SerpinB2
T18900 44789-44797 Protein denotes SerpinB2
T18899 44734-44741 Protein denotes C/EBP-β
T18898 44675-44683 Protein denotes SerpinB2
T18897 44644-44649 Protein denotes Cebpb
T18896 44628-44639 Protein denotes C/EBPβT217A
T18895 44590-44626 Protein denotes C/EBP-β phospho-acceptor site mutant
T18894 44550-44558 Protein denotes SerpinB2
T18893 44365-44372 Protein denotes C/EBP-β
T18892 44245-44252 Protein denotes C/EBP-β
T18891 44162-44169 Protein denotes C/EBP-β
T18890 44134-44142 Protein denotes SerpinB2
T18889 44008-44016 Protein denotes SerpinB2
T18888 43936-43943 Protein denotes C/EBP-β
T18887 43789-43797 Protein denotes SerpinB2
T18886 43775-43782 Protein denotes C/EBP-β
T18885 43749-43757 Protein denotes SerpinB2
T18884 43726-43733 Protein denotes C/EBP-β
T18883 43659-43667 Protein denotes SerpinB2
T18882 43599-43606 Protein denotes C/EBP-β
T18881 43484-43492 Protein denotes SerpinB2
T18880 43472-43479 Protein denotes C/EBP-β
T18879 43339-43347 Protein denotes SerpinB2
T18878 43179-43183 Protein denotes IFNγ
T18877 43127-43134 Protein denotes C/EBP-β
T18876 43103-43107 Protein denotes gene
T18875 43076-43084 Protein denotes SerpinB2
T18874 42994-43002 Protein denotes SerpinB2
T18873 42912-42919 Protein denotes C/EBP-β
T18872 42878-42885 Protein denotes C/EBP-β
T18871 42677-42684 Protein denotes C/EBP-β
T18870 42618-42625 Protein denotes C/EBP-β
T18869 42181-42189 Protein denotes SerpinB2
T18868 42039-42047 Protein denotes SerpinB2
T18867 41880-41888 Protein denotes SerpinB2
T18866 41829-41837 Protein denotes SERPINB2
T18865 41682-41690 Protein denotes SerpinB2
T18864 41455-41463 Protein denotes SerpinB2
T18863 41391-41399 Protein denotes SerpinB2
T18862 41360-41367 Protein denotes C/EBP-β
T18861 41299-41307 Protein denotes SerpinB2
T18860 41226-41233 Protein denotes C/EBP-β
T18859 41205-41212 Protein denotes C/EBP-β
T18858 41148-41156 Protein denotes SerpinB2
T18857 41081-41089 Protein denotes SerpinB2
T18856 40995-40999 Protein denotes IKKβ
T18855 40931-40939 Protein denotes SerpinB2
T18854 40921-40929 Protein denotes SerpinB2
T16723 40559-40567 Protein denotes SerpinB2
T16722 40516-40523 Protein denotes C/EBP-β
T16721 40409-40417 Protein denotes SerpinB2
T16720 40385-40396 Protein denotes C/EBP-βS64A
T16719 40333-40340 Protein denotes C/EBP-β
T16718 40277-40285 Protein denotes SerpinB2
T16717 40237-40249 Protein denotes C/EBP-βT188A
T16716 40211-40219 Protein denotes SerpinB2
T16715 40129-40137 Protein denotes SerpinB2
T16714 40117-40124 Protein denotes C/EBP-β
T16713 39945-39953 Protein denotes SerpinB2
T16712 39922-39927 Protein denotes MCP-1
T16711 39913-39917 Protein denotes IL-6
T16710 39802-39810 Protein denotes SerpinB2
T16709 39715-39719 Protein denotes gene
T16708 39700-39704 Protein denotes IFNγ
T16707 39690-39695 Protein denotes DAPK1
T16706 39621-39629 Protein denotes SerpinB2
T16705 39603-39610 Protein denotes C/EBP-β
T16704 39478-39485 Protein denotes C/EBP-β
T16703 39431-39439 Protein denotes SerpinB2
T16702 39372-39379 Protein denotes C/EBP-β
T16701 39311-39318 Protein denotes C/EBP-β
T16700 39260-39268 Protein denotes SerpinB2
T16699 39215-39220 Protein denotes Cebpb
T16698 39199-39210 Protein denotes C/EBPβT217A
T16697 39166-39197 Protein denotes C/EBP-β phospho-acceptor mutant
T16696 39119-39127 Protein denotes SerpinB2
T16695 39096-39103 Protein denotes C/EBP-β
T16694 38971-38999 Protein denotes SerpinB2 luciferase reporter
T16693 38932-38937 Protein denotes Cebpb
T16692 38921-38928 Protein denotes C/EBP-β
T16691 38879-38884 Protein denotes Cebpb
T16690 38847-38875 Protein denotes SerpinB2 luciferase reporter
T16689 38705-38737 Protein denotes C/EBP-β phospho-acceptor mutants
T16688 38634-38642 Protein denotes SerpinB2
T16687 38563-38570 Protein denotes C/EBP-β
T16686 38473-38480 Protein denotes C/EBP-β
T16685 38427-38435 Protein denotes SerpinB2
T16684 38370-38377 Protein denotes C/EBP-β
T15788 36838-36846 Protein denotes SerpinB2
T15787 36802-36809 Protein denotes C/EBP-β
T15786 36750-36755 Protein denotes Cebpb
T15785 36719-36724 Protein denotes Cebpb
T15784 36661-36669 Protein denotes SerpinB2
T15783 36617-36622 Protein denotes Cebpb
T15782 36604-36609 Protein denotes Cebpb
T15781 36560-36588 Protein denotes SerpinB2 luciferase reporter
T15780 36480-36488 Protein denotes SerpinB2
T15779 36439-36446 Protein denotes C/EBP-β
T15778 36366-36374 Protein denotes SerpinB2
T15777 36299-36306 Protein denotes C/EBP-β
T15776 36173-36181 Protein denotes SerpinB2
T15775 36152-36159 Protein denotes C/EBP-β
T15774 36110-36118 Protein denotes SerpinB2
T15773 36072-36079 Protein denotes C/EBP-β
T14058 31996-32004 Protein denotes SerpinB2
T14057 31903-31910 Protein denotes C/EBP-β
T14056 31821-31828 Protein denotes C/EBP-β
T14055 31765-31773 Protein denotes SerpinB2
T14054 31612-31619 Protein denotes C/EBP-β
T14053 31463-31468 Protein denotes Cebpb
T14052 31408-31416 Protein denotes SerpinB2
T14051 31331-31339 Protein denotes SerpinB2
T14050 31275-31283 Protein denotes SerpinB2
T14049 31245-31252 Protein denotes C/EBP-β
T14048 31217-31225 Protein denotes SerpinB2
T14047 31160-31167 Protein denotes C/EBP-β
T14046 31094-31099 Protein denotes Cebpb
T14045 31063-31068 Protein denotes Cebpb
T14044 31049-31056 Protein denotes C/EBP-β
T14043 30992-31000 Protein denotes SerpinB2
T14042 30970-30977 Protein denotes C/EBP-β
T14041 30867-30875 Protein denotes SerpinB2
T14040 30816-30823 Protein denotes C/EBP-β
T13241 30806-30813 Protein denotes C/EBP-β
T13240 30630-30637 Protein denotes C/EBP-β
T13239 30403-30410 Protein denotes C/EBP-ε
T13238 30391-30398 Protein denotes C/EBP-δ
T13237 30382-30389 Protein denotes C/EBP-β
T13236 30373-30380 Protein denotes C/EBP-α
T13235 29979-29986 Protein denotes C/EBP-ε
T13234 29967-29974 Protein denotes C/EBP-δ
T13233 29958-29965 Protein denotes C/EBP-β
T13232 29949-29956 Protein denotes C/EBP-α
T13231 29625-29633 Protein denotes SerpinB2
T13230 29546-29553 Protein denotes C/EBP-β
T12432 28496-28504 Protein denotes SerpinB2
T12431 28341-28348 Protein denotes albumin
T12430 27698-27705 Protein denotes albumin
T12429 27614-27622 Protein denotes SerpinB2
T12428 27565-27573 Protein denotes SerpinB2
T11554 24603-24611 Protein denotes SerpinB2
T11563 27138-27146 Protein denotes SerpinB2
T11562 26972-26980 Protein denotes SerpinB2
T11561 26936-26946 Protein denotes luciferase
T11560 26755-26763 Protein denotes SerpinB2
T11559 26598-26606 Protein denotes SERPINB2
T11558 26506-26514 Protein denotes SerpinB2
T11557 25535-25543 Protein denotes SerpinB2
T11556 25411-25419 Protein denotes SerpinB2
T11555 25040-25082 Protein denotes SerpinB2 promoter-luciferase reporter gene
T10462 23559-23564 Protein denotes Oct-1
T10461 23538-23542 Protein denotes PU.1
T10460 23370-23378 Protein denotes SERPINB2
T10459 23005-23013 Protein denotes SERPINB2
T10458 22813-22821 Protein denotes SerpinB2
T10457 22758-22766 Protein denotes SerpinB2
T10456 22347-22355 Protein denotes SerpinB2
T10455 22159-22167 Protein denotes SerpinB2
T10454 22088-22096 Protein denotes SerpinB2
T10453 21971-21979 Protein denotes SerpinB2
T9564 20296-20304 Protein denotes SerpinB2
T9563 20156-20164 Protein denotes SerpinB2
T9562 20037-20045 Protein denotes SerpinB2
T9561 19955-19963 Protein denotes SerpinB2
T9560 19595-19603 Protein denotes SerpinB2
T9559 19428-19436 Protein denotes SerpinB2
T9558 19195-19203 Protein denotes SerpinB2
T9557 19104-19114 Protein denotes luciferase
T9556 18941-18951 Protein denotes luciferase
T9555 18784-18792 Protein denotes SerpinB2
T9554 18626-18634 Protein denotes SerpinB2
T9051 17980-17988 Protein denotes SerpinB2
T9050 17860-17868 Protein denotes SerpinB2
T9049 17705-17713 Protein denotes SerpinB2
T9048 17543-17551 Protein denotes SerpinB2
T9047 17454-17462 Protein denotes SerpinB2
T8304 17108-17116 Protein denotes SerpinB2
T8303 16889-16901 Protein denotes Proteinase K
T8302 16719-16728 Protein denotes Protein G
T7834 14970-14994 Protein denotes T4 polynucleotide kinase
T7273 14745-14776 Protein denotes C/EBP-β phospho-acceptor mutant
T7272 14556-14571 Protein denotes β-Galactosidase
T7271 14528-14538 Protein denotes Luciferase
T7270 14497-14512 Protein denotes β-galactosidase
T7269 14436-14446 Protein denotes Luciferase
T7268 14358-14362 Protein denotes S64A
T7267 14351-14356 Protein denotes T217A
T7266 14344-14349 Protein denotes T188A
T7265 14310-14342 Protein denotes C/EBP-β phospho-acceptor mutants
T7264 14299-14306 Protein denotes C/EBP-β
T7263 13971-13986 Protein denotes β-galactosidase
T7262 13963-13970 Protein denotes β-actin
T7261 13913-13923 Protein denotes luciferase
T7260 13849-13854 Protein denotes Cebpb
T7259 11300-11310 Protein denotes Luciferase
T6664 13733-13740 Protein denotes C/EBP-β
T6663 12923-12930 Protein denotes C/EBP-β
T6662 12802-12807 Protein denotes cebpb
T6661 12740-12745 Protein denotes cebpb
T6030 12500-12502 Protein denotes TK
T6029 12472-12479 Protein denotes C/EBP-β
T6028 12390-12400 Protein denotes luciferase
T6027 12379-12381 Protein denotes TK
T6026 12331-12341 Protein denotes luciferase
T6025 12149-12159 Protein denotes Luciferase
T6024 12103-12113 Protein denotes Luciferase
T6023 11495-11497 Protein denotes TK
T6022 11477-11493 Protein denotes thymidine kinase
T6021 11422-11432 Protein denotes luciferase
T6020 11300-11310 Protein denotes Luciferase
T4820 11194-11202 Protein denotes SerpinB2
T4819 11061-11066 Protein denotes Xho I
T4818 11050-11056 Protein denotes EcoR I
T4817 10259-10267 Protein denotes SerpinB2
T4816 10200-10219 Protein denotes Luciferase reporter
T4815 10027-10035 Protein denotes SerpinB2
T4814 9944-9957 Protein denotes T4 DNA ligase
T4813 9883-9900 Protein denotes T4 DNA polymerase
T4812 9811-9816 Protein denotes Apo I
T4811 9799-9806 Protein denotes Hae III
T4810 9792-9797 Protein denotes Pac I
T4809 9783-9790 Protein denotes Bsu36 I
T4808 9775-9781 Protein denotes BstX I
T4807 9768-9773 Protein denotes Apa I
T4806 9761-9766 Protein denotes Sfi I
T4805 9721-9727 Protein denotes EcoR I
T4804 9552-9580 Protein denotes SerpinB2 luciferase reporter
T4803 9459-9467 Protein denotes SerpinB2
T4802 9241-9249 Protein denotes SerpinB2
T4801 9057-9079 Protein denotes SerpinB2 Reporter Gene
T4293 8982-8987 Protein denotes GAPDH
T4292 8940-8980 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4291 8893-8900 Protein denotes C/EBP-β
T4290 8771-8805 Protein denotes GST-murine SerpinB2 fusion protein
T3603 7064-7071 Protein denotes β-actin
T3602 7038-7043 Protein denotes Cebpb
T3601 7012-7020 Protein denotes SerpinB2
T3600 7003-7011 Protein denotes Serpinb2
T3175 5807-5812 Protein denotes Cebpb
T3174 5783-5788 Protein denotes Cebpb
T3834 8004-8012 Protein denotes SerpinB2
T3833 7369-7384 Protein denotes exonuclease III
T3832 7164-7172 Protein denotes SerpinB2
T1422 5344-5352 Protein denotes SerpinB2
T1421 5228-5236 Protein denotes SerpinB2
T1420 5153-5160 Protein denotes C/EBP-β
T1419 5111-5119 Protein denotes SerpinB2
T1418 5087-5095 Protein denotes SerpinB2
T1417 5001-5008 Protein denotes C/EBP-β
T1416 4914-4922 Protein denotes SerpinB2
T1415 4793-4801 Protein denotes SerpinB2
T1414 4722-4730 Protein denotes SerpinB2
T1413 4577-4585 Protein denotes SerpinB2
T1412 4511-4516 Protein denotes IFN-γ
T1411 4388-4396 Protein denotes SerpinB2
T1410 4299-4303 Protein denotes IKKβ
T228 1794-1802 Protein denotes SerpinB2
T227 1738-1745 Protein denotes C/EBP-β
T226 1650-1657 Protein denotes C/EBP-β
T1409 4208-4216 Protein denotes SerpinB2
T1408 3851-3855 Protein denotes TLR4
T1407 3653-3657 Protein denotes TLR4
T1406 3631-3651 Protein denotes toll-like receptor 4
T1405 3271-3279 Protein denotes SerpinB2
T1404 3096-3104 Protein denotes SerpinB2
T1403 2975-2983 Protein denotes SerpinB2
T1402 2933-2941 Protein denotes SerpinB2
T1401 2888-2899 Protein denotes plasminogen
T1400 2762-2765 Protein denotes uPA
T1399 2724-2760 Protein denotes urokinase-type plasminogen activator
T1398 2675-2683 Protein denotes SerpinB2
T1397 2608-2616 Protein denotes SerpinB2
T212 156-164 Protein denotes SerpinB2
T213 168-206 Protein denotes plasminogen activator inhibitor type 2
T214 208-213 Protein denotes PAI-2
T215 466-474 Protein denotes SerpinB2
T216 494-514 Protein denotes toll-like receptor 4
T217 516-520 Protein denotes TLR4
T218 608-616 Protein denotes SerpinB2
T219 723-731 Protein denotes SerpinB2
T220 1017-1025 Protein denotes SERPINB2
T221 1236-1244 Protein denotes SerpinB2
T222 1440-1447 Protein denotes C/EBP-β
T223 1478-1486 Protein denotes SerpinB2
T224 1544-1552 Protein denotes SerpinB2
T225 1590-1597 Protein denotes C/EBP-β
T211 97-105 Protein denotes SerpinB2

BioNLP16_DUT

Id Subject Object Predicate Lexical cue
T510 59-72 Positive_regulation denotes LPS-Inducible
T511 73-86 Transcription denotes Transcription
T26464 37446-37461 Protein denotes β-galactosidase
T26463 37415-37425 Protein denotes luciferase
T26462 37376-37400 Protein denotes β-galactosidase reporter
T26461 37334-37371 Protein denotes SerpinB2 promoter-luciferase reporter
T26460 37204-37241 Protein denotes SerpinB2 promoter-luciferase reporter
T26459 37165-37170 Protein denotes Cebpb
T26458 37152-37157 Protein denotes Cebpb
T26457 37108-37116 Protein denotes SerpinB2
T26456 37086-37091 Protein denotes Cebpb
T26455 37061-37066 Protein denotes Cebpb
T26454 36989-36997 Protein denotes SerpinB2
T26453 36944-36952 Protein denotes SerpinB2
T26452 36919-36926 Protein denotes C/EBP-β
T25604 35656-35667 Binding denotes Recruitment
T25603 35038-35047 Binding denotes occupancy
T25602 34937-34948 Binding denotes recruitment
T25601 36034-36038 Protein denotes rIgG
T25600 35957-35973 Protein denotes p-C/EBP-β (T217)
T25599 35948-35955 Protein denotes C/EBP-β
T25598 35685-35693 Protein denotes SerpinB2
T25597 35568-35576 Protein denotes SerpinB2
T25596 35429-35445 Protein denotes p-C/EBP-β (T217)
T25595 35420-35427 Protein denotes C/EBP-β
T25594 35324-35340 Protein denotes p-C/EBP-β (T217)
T25593 35313-35320 Protein denotes C/EBP-β
T25592 35055-35063 Protein denotes SerpinB2
T25591 34990-34998 Protein denotes SerpinB2
T25590 34952-34959 Protein denotes C/EBP-β
T24852 33025-33035 Transcription denotes expression
T24851 32877-32886 Negative_regulation denotes knockdown
T24850 32712-32718 Regulation denotes target
T24849 32462-32471 Negative_regulation denotes abrogated
T24848 32483-32492 Negative_regulation denotes deficient
T24847 32448-32458 Gene_expression denotes expression
T24846 32164-32174 Transcription denotes expression
T24845 32305-32315 Transcription denotes expression
T24844 32178-32187 Negative_regulation denotes abrogated
T24843 32066-32075 Positive_regulation denotes essential
T24842 32097-32108 Positive_regulation denotes LPS-induced
T24841 32123-32133 Transcription denotes expression
T24840 33011-33019 Protein denotes SerpinB2
T24839 32901-32908 Protein denotes C/EBP-β
T24838 32730-32735 Protein denotes Cebpb
T24837 32439-32447 Protein denotes SerpinB2
T24836 32475-32482 Protein denotes C/EBP-β
T24835 32342-32347 Protein denotes Cebpb
T24834 32329-32334 Protein denotes Cebpb
T24833 32291-32299 Protein denotes SerpinB2
T24832 32217-32222 Protein denotes Cebpb
T24831 32191-32196 Protein denotes Cebpb
T24830 32150-32158 Protein denotes SerpinB2
T24829 32109-32117 Protein denotes SerpinB2
T24828 32055-32062 Protein denotes C/EBP-β
T24248 28717-28724 Binding denotes binding
T24247 29173-29181 Protein denotes SerpinB2
T24246 29084-29091 Protein denotes albumin
T24245 29045-29052 Protein denotes albumin
T24244 28976-28984 Protein denotes SerpinB2
T24243 28920-28928 Protein denotes SerpinB2
T24242 28783-28790 Protein denotes C/EBP-β
T24241 28736-28744 Protein denotes SerpinB2
T23948 25654-25672 Regulation denotes LPS-responsiveness
T23947 25637-25645 Positive_regulation denotes required
T23946 26307-26317 Protein denotes luciferase
T23945 26164-26201 Protein denotes SerpinB2 promoter-luciferase reporter
T23944 25983-25991 Protein denotes SerpinB2
T23943 25772-25780 Protein denotes SerpinB2
T23942 25687-25695 Protein denotes SerpinB2
T23552 24336-24364 Protein denotes purine box binding protein 1
T23551 24328-24332 Protein denotes PU.1
T23550 24320-24326 Protein denotes POU2F1
T23549 24289-24319 Protein denotes octamer transcription factor 1
T23548 24281-24285 Protein denotes Oct1
T23547 24140-24148 Protein denotes SerpinB2
T23546 23978-23986 Protein denotes SerpinB2
T22976 21442-21450 Protein denotes SerpinB2
T22975 21363-21371 Protein denotes SerpinB2
T22974 21177-21187 Protein denotes luciferase
T22973 20993-21030 Protein denotes SerpinB2 promoter-luciferase reporter
T22972 20881-20889 Protein denotes SerpinB2
T22971 20689-20699 Protein denotes luciferase
T22970 20546-20599 Protein denotes SerpinB2 promoter and 5′ deletion luciferase reporter
T22969 20484-20492 Protein denotes SerpinB2
T22506 18537-18547 Gene_expression denotes expression
T22505 18372-18378 Transcription denotes levels
T22504 18213-18223 Gene_expression denotes expression
T22503 18174-18183 Positive_regulation denotes induction
T22502 18593-18598 Protein denotes GAPDH
T22501 18520-18528 Protein denotes SerpinB2
T22500 18392-18399 Protein denotes β-actin
T22499 18358-18366 Protein denotes SerpinB2
T22498 18187-18195 Protein denotes SerpinB2
T20089 43484-43492 Protein denotes SerpinB2
T20088 43472-43479 Protein denotes C/EBP-β
T20087 43339-43347 Protein denotes SerpinB2
T20086 43179-43183 Protein denotes IFNγ
T20085 43127-43134 Protein denotes C/EBP-β
T20084 43103-43107 Protein denotes gene
T20083 43076-43084 Protein denotes SerpinB2
T20082 42994-43002 Protein denotes SerpinB2
T20081 42912-42919 Protein denotes C/EBP-β
T20080 42878-42885 Protein denotes C/EBP-β
T20079 42677-42684 Protein denotes C/EBP-β
T20078 42618-42625 Protein denotes C/EBP-β
T20077 42181-42189 Protein denotes SerpinB2
T20076 42039-42047 Protein denotes SerpinB2
T20075 41880-41888 Protein denotes SerpinB2
T20074 41829-41837 Protein denotes SERPINB2
T20073 41682-41690 Protein denotes SerpinB2
T20072 41455-41463 Protein denotes SerpinB2
T20071 41360-41367 Protein denotes C/EBP-β
T20070 41299-41307 Protein denotes SerpinB2
T20069 41226-41233 Protein denotes C/EBP-β
T20068 41391-41399 Protein denotes SerpinB2
T20067 41205-41212 Protein denotes C/EBP-β
T20066 41148-41156 Protein denotes SerpinB2
T20065 41081-41089 Protein denotes SerpinB2
T20064 40995-40999 Protein denotes IKKβ
T20063 40931-40939 Protein denotes SerpinB2
T20062 40921-40929 Protein denotes SerpinB2
T20207 47188-47198 Regulation denotes regulation
T20206 47240-47250 Gene_expression denotes expression
T20205 47202-47225 Positive_regulation denotes inflammation-associated
T20204 47094-47104 Regulation denotes regulating
T20203 47060-47064 Regulation denotes role
T20202 46921-46930 Positive_regulation denotes necessary
T20201 46964-46975 Positive_regulation denotes LPS-induced
T20200 46990-47000 Gene_expression denotes expression
T20199 46649-46660 Positive_regulation denotes LPS-induced
T20198 46661-46674 Transcription denotes transcription
T20197 46119-46129 Gene_expression denotes expression
T20196 45742-45751 Regulation denotes regulated
T20195 45686-45703 Phosphorylation denotes dephosphorylation
T20194 45551-45564 Transcription denotes transcription
T20193 45539-45550 Positive_regulation denotes LPS-induced
T20192 45406-45420 Phosphorylation denotes phosphorylated
T20191 45320-45329 Regulation denotes regulates
T20190 45170-45180 Gene_expression denotes expression
T20189 45275-45290 Phosphorylation denotes phosphorylation
T20188 45219-45230 Positive_regulation denotes LPS-induced
T20187 45330-45341 Positive_regulation denotes LPS-induced
T20186 45210-45218 Positive_regulation denotes enhanced
T20185 45009-45019 Gene_expression denotes expression
T20174 44148-44158 Gene_expression denotes expression
T20173 44120-44130 Regulation denotes regulation
T20172 43849-43860 Positive_regulation denotes upregulated
T20171 43650-43654 Binding denotes bind
T20170 43737-43748 Positive_regulation denotes LPS-induced
T20169 43763-43773 Gene_expression denotes expression
T20168 43717-43721 Positive_regulation denotes role
T20167 43353-43363 Transcription denotes expression
T20166 43498-43511 Transcription denotes transcription
T20165 43325-43338 Positive_regulation denotes LPS-inducible
T20164 43381-43390 Negative_regulation denotes abrogated
T20163 43197-43205 Negative_regulation denotes impaired
T20162 43135-43144 Negative_regulation denotes deficient
T20161 43114-43123 Positive_regulation denotes induction
T20160 42982-42993 Positive_regulation denotes LPS-induced
T20159 43008-43021 Transcription denotes transcription
T20158 42944-42955 Positive_regulation denotes requirement
T20157 42849-42856 Regulation denotes control
T20156 42857-42870 Transcription denotes transcription
T20155 42717-42725 Binding denotes interact
T20154 42597-42609 Binding denotes interactions
T20153 42096-42105 Positive_regulation denotes increases
T20152 41987-41996 Positive_regulation denotes mediating
T20151 42011-42024 Transcription denotes transcription
T20150 41979-41983 Regulation denotes role
T20149 41997-42010 Positive_regulation denotes PMA-inducible
T20148 41858-41865 Positive_regulation denotes present
T20147 41802-41815 Transcription denotes transcription
T20146 41787-41801 Positive_regulation denotes PMA-stimulated
T20145 41779-41786 Positive_regulation denotes mediate
T20144 41584-41593 Positive_regulation denotes induction
T20143 41368-41377 Negative_regulation denotes abrogates
T20142 41405-41418 Transcription denotes transcription
T20141 41352-41356 Negative_regulation denotes loss
T20140 41260-41264 Binding denotes bind
T20139 41214-41225 Positive_regulation denotes LPS-induced
T20138 41095-41108 Transcription denotes transcription
T20137 41190-41199 Positive_regulation denotes dependent
T20136 41112-41120 Positive_regulation denotes response
T20135 41131-41140 Positive_regulation denotes conferred
T20134 40961-40968 Positive_regulation denotes induced
T20133 40884-40893 Positive_regulation denotes induction
T20132 47226-47234 Protein denotes SerpinB2
T20131 47105-47113 Protein denotes SerpinB2
T20130 46976-46984 Protein denotes SerpinB2
T20129 46891-46899 Protein denotes SerpinB2
T20128 46682-46690 Protein denotes SerpinB2
T20127 46582-46589 Protein denotes C/EBP-β
T20126 46421-46428 Protein denotes C/EBP-β
T20125 46287-46295 Protein denotes SerpinB2
T20124 46110-46118 Protein denotes SerpinB2
T20123 45799-45803 Protein denotes MLK3
T20122 45737-45741 Protein denotes IFNγ
T20121 45707-45714 Protein denotes C/EBP-β
T20120 45673-45677 Protein denotes MLK3
T20119 45649-45671 Protein denotes Mixed lineage kinase-3
T20118 45568-45576 Protein denotes SerpinB2
T20117 45376-45383 Protein denotes C/EBP-β
T20116 45342-45350 Protein denotes SerpinB2
T20115 45294-45301 Protein denotes C/EBP-β
T20114 45231-45239 Protein denotes SerpinB2
T20113 45184-45195 Protein denotes C/EBP-βS64A
T20112 45094-45102 Protein denotes SerpinB2
T20111 45065-45077 Protein denotes C/EBP-βT188A
T20110 45027-45063 Protein denotes C/EBP-β phospho-acceptor site mutant
T20109 44972-44980 Protein denotes SerpinB2
T20108 44789-44797 Protein denotes SerpinB2
T20107 44734-44741 Protein denotes C/EBP-β
T20106 44675-44683 Protein denotes SerpinB2
T20105 44644-44649 Protein denotes Cebpb
T20104 44628-44639 Protein denotes C/EBPβT217A
T20103 44590-44626 Protein denotes C/EBP-β phospho-acceptor site mutant
T20102 44550-44558 Protein denotes SerpinB2
T20101 44365-44372 Protein denotes C/EBP-β
T20100 44245-44252 Protein denotes C/EBP-β
T20099 44162-44169 Protein denotes C/EBP-β
T20098 44134-44142 Protein denotes SerpinB2
T20097 44008-44016 Protein denotes SerpinB2
T20096 43936-43943 Protein denotes C/EBP-β
T20095 43789-43797 Protein denotes SerpinB2
T20094 43775-43782 Protein denotes C/EBP-β
T20093 43749-43757 Protein denotes SerpinB2
T20092 43726-43733 Protein denotes C/EBP-β
T20091 43659-43667 Protein denotes SerpinB2
T20090 43599-43606 Protein denotes C/EBP-β
T17181 40550-40558 Regulation denotes regulate
T17180 40497-40512 Phosphorylation denotes phosphorylation
T17179 40341-40352 Gene_expression denotes transfected
T17178 40371-40381 Gene_expression denotes expression
T17177 40397-40408 Positive_regulation denotes potentiated
T17176 40250-40261 Gene_expression denotes transfected
T17175 40203-40207 Regulation denotes role
T17174 40225-40235 Gene_expression denotes expression
T17173 39957-39964 Positive_regulation denotes induced
T17172 39976-39985 Regulation denotes regulated
T17171 39882-39895 Transcription denotes transcription
T17111 38847-38875 Protein denotes SerpinB2 luciferase reporter
T17110 38705-38737 Protein denotes C/EBP-β phospho-acceptor mutants
T17109 38634-38642 Protein denotes SerpinB2
T17108 38563-38570 Protein denotes C/EBP-β
T17107 38473-38480 Protein denotes C/EBP-β
T17106 38427-38435 Protein denotes SerpinB2
T17105 38370-38377 Protein denotes C/EBP-β
T17170 39856-39865 Positive_regulation denotes important
T17169 39870-39881 Positive_regulation denotes LPS-induced
T17168 39679-39689 Regulation denotes regulating
T17167 39705-39714 Positive_regulation denotes inducible
T17166 39825-39835 Binding denotes associated
T17165 39611-39620 Positive_regulation denotes dependent
T17164 39592-39602 Regulation denotes modulating
T17163 39635-39648 Transcription denotes transcription
T17162 39461-39469 Regulation denotes response
T17161 39353-39368 Phosphorylation denotes phosphorylation
T17160 39417-39427 Regulation denotes regulation
T17159 39251-39259 Positive_regulation denotes increase
T17158 39148-39158 Gene_expression denotes Expression
T17157 38960-38970 Positive_regulation denotes stimulated
T17156 39133-39146 Transcription denotes transcription
T17155 39005-39015 Gene_expression denotes expression
T17154 39107-39118 Positive_regulation denotes LPS-induced
T17153 39082-39092 Positive_regulation denotes importance
T17152 38894-38907 Gene_expression denotes Re-expression
T17151 38619-38633 Positive_regulation denotes LPS-stimulated
T17150 38605-38614 Positive_regulation denotes important
T17149 38684-38696 Gene_expression denotes co-expressed
T17148 38454-38469 Phosphorylation denotes Phosphorylation
T17147 38402-38411 Regulation denotes Regulates
T17146 38351-38366 Phosphorylation denotes Phosphorylation
T17145 38412-38426 Positive_regulation denotes LPS-stimulated
T17144 40559-40567 Protein denotes SerpinB2
T17143 40516-40523 Protein denotes C/EBP-β
T17142 40409-40417 Protein denotes SerpinB2
T17141 40385-40396 Protein denotes C/EBP-βS64A
T17140 40333-40340 Protein denotes C/EBP-β
T17139 40277-40285 Protein denotes SerpinB2
T17138 40237-40249 Protein denotes C/EBP-βT188A
T17137 40211-40219 Protein denotes SerpinB2
T17136 40129-40137 Protein denotes SerpinB2
T17135 40117-40124 Protein denotes C/EBP-β
T17134 39945-39953 Protein denotes SerpinB2
T17133 39922-39927 Protein denotes MCP-1
T17132 39913-39917 Protein denotes IL-6
T17131 39802-39810 Protein denotes SerpinB2
T17130 39715-39719 Protein denotes gene
T17129 39700-39704 Protein denotes IFNγ
T17128 39690-39695 Protein denotes DAPK1
T17127 39621-39629 Protein denotes SerpinB2
T17126 39603-39610 Protein denotes C/EBP-β
T17125 39478-39485 Protein denotes C/EBP-β
T17124 39431-39439 Protein denotes SerpinB2
T17123 39372-39379 Protein denotes C/EBP-β
T17122 39311-39318 Protein denotes C/EBP-β
T17121 39260-39268 Protein denotes SerpinB2
T17120 39215-39220 Protein denotes Cebpb
T17119 39199-39210 Protein denotes C/EBPβT217A
T17118 39166-39197 Protein denotes C/EBP-β phospho-acceptor mutant
T17117 38921-38928 Protein denotes C/EBP-β
T17116 39119-39127 Protein denotes SerpinB2
T17115 39096-39103 Protein denotes C/EBP-β
T17114 38971-38999 Protein denotes SerpinB2 luciferase reporter
T17113 38932-38937 Protein denotes Cebpb
T17112 38879-38884 Protein denotes Cebpb
T15934 36661-36669 Protein denotes SerpinB2
T15933 36560-36588 Protein denotes SerpinB2 luciferase reporter
T15932 36480-36488 Protein denotes SerpinB2
T15931 36439-36446 Protein denotes C/EBP-β
T15930 36617-36622 Protein denotes Cebpb
T15929 36604-36609 Protein denotes Cebpb
T15928 36366-36374 Protein denotes SerpinB2
T15927 36299-36306 Protein denotes C/EBP-β
T15926 36173-36181 Protein denotes SerpinB2
T15925 36152-36159 Protein denotes C/EBP-β
T15924 36110-36118 Protein denotes SerpinB2
T15923 36072-36079 Protein denotes C/EBP-β
T15946 36646-36660 Positive_regulation denotes LPS-stimulated
T15945 36737-36746 Negative_regulation denotes abrogated
T15944 36826-36837 Positive_regulation denotes LPS-induced
T15943 36813-36821 Positive_regulation denotes required
T15942 36706-36715 Positive_regulation denotes increased
T15941 36457-36470 Transcription denotes transcription
T15940 36160-36165 Binding denotes binds
T15939 36343-36356 Transcription denotes transcription
T15938 36838-36846 Protein denotes SerpinB2
T15937 36802-36809 Protein denotes C/EBP-β
T15936 36750-36755 Protein denotes Cebpb
T15935 36719-36724 Protein denotes Cebpb
T15149 34102-34109 Protein denotes C/EBP-β
T15148 34060-34067 Protein denotes C/EBP-β
T15147 34274-34287 Protein denotes p-C/EBP-βT217
T15146 34257-34264 Protein denotes C/EBP-β
T15145 34203-34211 Protein denotes SerpinB2
T15144 33826-33834 Protein denotes SerpinB2
T15143 33785-33792 Protein denotes C/EBP-β
T15142 33691-33699 Protein denotes SerpinB2
T15141 33388-33396 Protein denotes SerpinB2
T15140 33354-33361 Protein denotes C/EBP-β
T15138 33226-33233 Protein denotes C/EBP-β
T15176 34723-34734 Binding denotes recruitment
T15175 34793-34804 Regulation denotes responsible
T15174 34754-34773 Phosphorylation denotes T217-phosphorylated
T15173 34819-34832 Transcription denotes transcription
T15172 34809-34818 Positive_regulation denotes increased
T15171 34513-34521 Binding denotes affinity
T15170 34505-34512 Binding denotes binding
T15169 34574-34584 Negative_regulation denotes diminished
T15168 34374-34379 Binding denotes bound
T15167 34068-34083 Phosphorylation denotes phosphorylation
T15166 34095-34101 Regulation denotes affect
T15165 34049-34056 Regulation denotes changes
T15164 34184-34195 Binding denotes recruitment
T15163 34242-34256 Phosphorylation denotes phosphorylated
T15162 33811-33818 Gene_expression denotes present
T15161 33867-33878 Binding denotes association
T15160 33362-33373 Binding denotes recruitment
T15159 33234-33239 Binding denotes Binds
T15158 34842-34850 Protein denotes SerpinB2
T15157 34774-34781 Protein denotes C/EBP-β
T15156 34709-34722 Protein denotes p-C/EBP-βT217
T15155 34697-34704 Protein denotes C/EBP-β
T15154 34547-34555 Protein denotes SerpinB2
T15153 34525-34538 Protein denotes p-C/EBP-βT217
T15152 34492-34499 Protein denotes C/EBP-β
T15151 34387-34395 Protein denotes SerpinB2
T15150 34341-34354 Protein denotes p-C/EBP-βT217
T14293 31968-31981 Transcription denotes transcription
T14292 31954-31967 Positive_regulation denotes LPS-inducible
T14291 31829-31838 Negative_regulation denotes deficient
T14290 31779-31789 Transcription denotes expression
T14289 31808-31817 Negative_regulation denotes decreased
T14288 31753-31764 Positive_regulation denotes LPS-induced
T14287 31635-31642 Negative_regulation denotes knocked
T14286 31620-31630 Gene_expression denotes expression
T14285 31422-31432 Transcription denotes expression
T14284 31319-31327 Positive_regulation denotes increase
T14283 31345-31355 Transcription denotes expression
T14282 31451-31459 Positive_regulation denotes dampened
T14281 31305-31315 Positive_regulation denotes stimulated
T14280 31393-31407 Positive_regulation denotes LPS-stimulated
T14279 31289-31299 Transcription denotes expression
T14278 31184-31191 Gene_expression denotes express
T14277 31253-31263 Negative_regulation denotes attenuated
T14276 31234-31241 Negative_regulation denotes absence
T14275 30956-30966 Positive_regulation denotes importance
T14274 31141-31148 Gene_expression denotes express
T14273 31006-31016 Transcription denotes expression
T14272 30824-30832 Positive_regulation denotes Mediates
T14271 30855-30866 Positive_regulation denotes LPS-induced
T14270 30881-30891 Transcription denotes Expression
T14269 31996-32004 Protein denotes SerpinB2
T14268 31903-31910 Protein denotes C/EBP-β
T14267 31821-31828 Protein denotes C/EBP-β
T14266 31765-31773 Protein denotes SerpinB2
T14265 31612-31619 Protein denotes C/EBP-β
T14264 31463-31468 Protein denotes Cebpb
T14263 31408-31416 Protein denotes SerpinB2
T14262 31331-31339 Protein denotes SerpinB2
T14261 31217-31225 Protein denotes SerpinB2
T14260 31275-31283 Protein denotes SerpinB2
T14259 31245-31252 Protein denotes C/EBP-β
T14258 31160-31167 Protein denotes C/EBP-β
T14257 31094-31099 Protein denotes Cebpb
T14256 31063-31068 Protein denotes Cebpb
T14255 31049-31056 Protein denotes C/EBP-β
T14254 30992-31000 Protein denotes SerpinB2
T14253 30970-30977 Protein denotes C/EBP-β
T14252 30867-30875 Protein denotes SerpinB2
T14251 30816-30823 Protein denotes C/EBP-β
T13465 29559-29570 Positive_regulation denotes LPS-induced
T13464 29591-29596 Binding denotes Binds
T13463 30806-30813 Protein denotes C/EBP-β
T13462 30630-30637 Protein denotes C/EBP-β
T13461 30391-30398 Protein denotes C/EBP-δ
T13460 30382-30389 Protein denotes C/EBP-β
T13459 30373-30380 Protein denotes C/EBP-α
T13458 30403-30410 Protein denotes C/EBP-ε
T13457 29979-29986 Protein denotes C/EBP-ε
T13456 29967-29974 Protein denotes C/EBP-δ
T13455 29958-29965 Protein denotes C/EBP-β
T13454 29949-29956 Protein denotes C/EBP-α
T13453 29625-29633 Protein denotes SerpinB2
T13452 29546-29553 Protein denotes C/EBP-β
T12699 28529-28534 Binding denotes binds
T12698 28496-28504 Protein denotes SerpinB2
T12697 28341-28348 Protein denotes albumin
T12696 27698-27705 Protein denotes albumin
T12695 27614-27622 Protein denotes SerpinB2
T12694 27565-27573 Protein denotes SerpinB2
T11873 27101-27114 Positive_regulation denotes LPS-inducible
T11872 27088-27096 Positive_regulation denotes critical
T11871 27115-27128 Transcription denotes transcription
T11870 26914-26921 Negative_regulation denotes reduced
T11869 26922-26935 Positive_regulation denotes LPS-inducible
T11868 26732-26740 Positive_regulation denotes response
T11867 26716-26720 Regulation denotes role
T11866 26566-26584 Positive_regulation denotes PMA-responsiveness
T11865 25517-25527 Positive_regulation denotes activation
T11864 25505-25516 Positive_regulation denotes LPS-induced
T11863 27138-27146 Protein denotes SerpinB2
T11862 26972-26980 Protein denotes SerpinB2
T11861 26936-26946 Protein denotes luciferase
T11860 26755-26763 Protein denotes SerpinB2
T11859 26598-26606 Protein denotes SERPINB2
T11858 26506-26514 Protein denotes SerpinB2
T11857 25535-25543 Protein denotes SerpinB2
T11856 25411-25419 Protein denotes SerpinB2
T11855 25040-25082 Protein denotes SerpinB2 promoter-luciferase reporter gene
T11854 24603-24611 Protein denotes SerpinB2
T10838 22321-22325 Regulation denotes role
T10837 22361-22371 Gene_expression denotes expression
T10836 22333-22343 Regulation denotes regulation
T10835 22052-22059 Positive_regulation denotes mediate
T10834 22060-22073 Transcription denotes transcription
T10833 22110-22118 Regulation denotes response
T10832 23538-23542 Protein denotes PU.1
T10831 23559-23564 Protein denotes Oct-1
T10830 23370-23378 Protein denotes SERPINB2
T10829 23005-23013 Protein denotes SERPINB2
T10828 22813-22821 Protein denotes SerpinB2
T10827 22758-22766 Protein denotes SerpinB2
T10826 22347-22355 Protein denotes SerpinB2
T10825 22159-22167 Protein denotes SerpinB2
T10824 22088-22096 Protein denotes SerpinB2
T10823 21971-21979 Protein denotes SerpinB2
T9887 20259-20268 Positive_regulation denotes mediating
T9886 20273-20281 Positive_regulation denotes response
T9885 20021-20029 Negative_regulation denotes deletion
T9884 20115-20122 Negative_regulation denotes reduced
T9883 19988-19996 Regulation denotes affected
T9882 19932-19940 Positive_regulation denotes response
T9881 19572-19580 Negative_regulation denotes Deletion
T9880 19633-19642 Positive_regulation denotes increased
T9879 19209-19219 Regulation denotes regulation
T9878 19183-19194 Positive_regulation denotes PMA-induced
T9877 20037-20045 Protein denotes SerpinB2
T9876 20296-20304 Protein denotes SerpinB2
T9875 20156-20164 Protein denotes SerpinB2
T9874 19955-19963 Protein denotes SerpinB2
T9873 19595-19603 Protein denotes SerpinB2
T9872 19428-19436 Protein denotes SerpinB2
T9871 19195-19203 Protein denotes SerpinB2
T9870 19104-19114 Protein denotes luciferase
T9869 18941-18951 Protein denotes luciferase
T9868 18784-18792 Protein denotes SerpinB2
T9867 18626-18634 Protein denotes SerpinB2
T9193 18017-18024 Positive_regulation denotes induced
T9192 17997-18007 Gene_expression denotes expression
T9191 17848-17859 Positive_regulation denotes LPS-induced
T9190 17869-17879 Gene_expression denotes expression
T9189 17678-17687 Positive_regulation denotes induction
T9188 17719-17729 Transcription denotes expression
T9187 17691-17704 Positive_regulation denotes LPS-inducible
T9186 17561-17571 Transcription denotes detectable
T9185 17980-17988 Protein denotes SerpinB2
T9184 17860-17868 Protein denotes SerpinB2
T9183 17705-17713 Protein denotes SerpinB2
T9182 17543-17551 Protein denotes SerpinB2
T9181 17454-17462 Protein denotes SerpinB2
T8557 17108-17116 Protein denotes SerpinB2
T8556 16889-16901 Protein denotes Proteinase K
T8555 16719-16728 Protein denotes Protein G
T8011 14970-14994 Protein denotes T4 polynucleotide kinase
T7489 14727-14737 Gene_expression denotes Expression
T7488 14397-14411 Gene_expression denotes co-transfected
T7487 13882-13893 Gene_expression denotes transfected
T7486 14745-14776 Protein denotes C/EBP-β phospho-acceptor mutant
T7485 14556-14571 Protein denotes β-Galactosidase
T7484 14528-14538 Protein denotes Luciferase
T7483 14497-14512 Protein denotes β-galactosidase
T7482 14436-14446 Protein denotes Luciferase
T7481 14351-14356 Protein denotes T217A
T7480 14344-14349 Protein denotes T188A
T7479 14310-14342 Protein denotes C/EBP-β phospho-acceptor mutants
T7478 14299-14306 Protein denotes C/EBP-β
T7477 14358-14362 Protein denotes S64A
T7476 13971-13986 Protein denotes β-galactosidase
T7475 13963-13970 Protein denotes β-actin
T7474 13913-13923 Protein denotes luciferase
T7473 13849-13854 Protein denotes Cebpb
T7472 11300-11310 Protein denotes Luciferase
T6870 13741-13750 Negative_regulation denotes knockdown
T6869 12898-12908 Gene_expression denotes expression
T6868 12888-12897 Negative_regulation denotes knockdown
T6867 13733-13740 Protein denotes C/EBP-β
T6866 12923-12930 Protein denotes C/EBP-β
T6865 12802-12807 Protein denotes cebpb
T6864 12740-12745 Protein denotes cebpb
T6259 12487-12495 Regulation denotes affected
T6258 12457-12471 Gene_expression denotes co-transfected
T6257 12390-12400 Protein denotes luciferase
T6256 12379-12381 Protein denotes TK
T6255 12331-12341 Protein denotes luciferase
T6254 12500-12502 Protein denotes TK
T6253 12472-12479 Protein denotes C/EBP-β
T6252 12149-12159 Protein denotes Luciferase
T6251 12103-12113 Protein denotes Luciferase
T6250 11495-11497 Protein denotes TK
T6249 11477-11493 Protein denotes thymidine kinase
T6248 11422-11432 Protein denotes luciferase
T6247 11300-11310 Protein denotes Luciferase
T5237 11194-11202 Protein denotes SerpinB2
T5236 11061-11066 Protein denotes Xho I
T5235 11050-11056 Protein denotes EcoR I
T5234 10259-10267 Protein denotes SerpinB2
T5233 10200-10219 Protein denotes Luciferase reporter
T5232 10027-10035 Protein denotes SerpinB2
T5231 9783-9790 Protein denotes Bsu36 I
T5230 9775-9781 Protein denotes BstX I
T5229 9768-9773 Protein denotes Apa I
T5228 9761-9766 Protein denotes Sfi I
T5227 9721-9727 Protein denotes EcoR I
T5226 9552-9580 Protein denotes SerpinB2 luciferase reporter
T5225 9944-9957 Protein denotes T4 DNA ligase
T5224 9883-9900 Protein denotes T4 DNA polymerase
T5223 9811-9816 Protein denotes Apo I
T5222 9799-9806 Protein denotes Hae III
T5221 9792-9797 Protein denotes Pac I
T5220 9459-9467 Protein denotes SerpinB2
T5219 9241-9249 Protein denotes SerpinB2
T5218 9057-9079 Protein denotes SerpinB2 Reporter Gene
T4440 8806-8814 Gene_expression denotes produced
T4439 8982-8987 Protein denotes GAPDH
T4438 8940-8980 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4437 8893-8900 Protein denotes C/EBP-β
T4436 8771-8805 Protein denotes GST-murine SerpinB2 fusion protein
T4011 8004-8012 Protein denotes SerpinB2
T4010 7369-7384 Protein denotes exonuclease III
T4009 7164-7172 Protein denotes SerpinB2
T3678 6976-6986 Gene_expression denotes Expression
T3677 7064-7071 Protein denotes β-actin
T3676 7038-7043 Protein denotes Cebpb
T3675 7012-7020 Protein denotes SerpinB2
T3674 7003-7011 Protein denotes Serpinb2
T3289 5807-5812 Protein denotes Cebpb
T3288 5783-5788 Protein denotes Cebpb
T2083 2948-2956 Localization denotes secreted
T2082 2711-2720 Negative_regulation denotes inhibitor
T2081 2874-2884 Positive_regulation denotes activation
T2080 5344-5352 Protein denotes SerpinB2
T2079 5228-5236 Protein denotes SerpinB2
T2078 5153-5160 Protein denotes C/EBP-β
T2077 5111-5119 Protein denotes SerpinB2
T2076 5087-5095 Protein denotes SerpinB2
T2075 5001-5008 Protein denotes C/EBP-β
T2074 4914-4922 Protein denotes SerpinB2
T2073 4793-4801 Protein denotes SerpinB2
T2072 4722-4730 Protein denotes SerpinB2
T2071 4577-4585 Protein denotes SerpinB2
T2070 4511-4516 Protein denotes IFN-γ
T2069 4388-4396 Protein denotes SerpinB2
T2068 4299-4303 Protein denotes IKKβ
T2067 4208-4216 Protein denotes SerpinB2
T2066 3851-3855 Protein denotes TLR4
T2065 3653-3657 Protein denotes TLR4
T2064 3631-3651 Protein denotes toll-like receptor 4
T2063 3271-3279 Protein denotes SerpinB2
T2062 3096-3104 Protein denotes SerpinB2
T2061 2975-2983 Protein denotes SerpinB2
T2060 2933-2941 Protein denotes SerpinB2
T2059 2888-2899 Protein denotes plasminogen
T2058 2762-2765 Protein denotes uPA
T2057 2724-2760 Protein denotes urokinase-type plasminogen activator
T2056 2675-2683 Protein denotes SerpinB2
T2055 2608-2616 Protein denotes SerpinB2
T2103 5326-5336 Regulation denotes regulation
T2102 5207-5215 Regulation denotes regulate
T2101 5216-5227 Positive_regulation denotes LPS-induced
T2100 5053-5063 Negative_regulation denotes deficiency
T2099 5064-5073 Negative_regulation denotes abrogated
T2098 5120-5129 Positive_regulation denotes induction
T2097 5096-5106 Gene_expression denotes expression
T2096 5018-5023 Binding denotes bound
T2095 4780-4789 Positive_regulation denotes induction
T2094 4805-4814 Positive_regulation denotes dependent
T2093 4951-4960 Positive_regulation denotes dependent
T2092 4625-4638 Transcription denotes transcription
T2091 4411-4420 Regulation denotes regulated
T2090 4713-4717 Binding denotes bind
T2089 4250-4260 Gene_expression denotes expression
T2088 4265-4276 Positive_regulation denotes upregulated
T2087 3886-3891 Positive_regulation denotes leads
T2086 3833-3840 Binding denotes binding
T2085 3295-3304 Regulation denotes regulated
T2084 2924-2932 Positive_regulation denotes requires
T523 1756-1766 Regulation denotes regulation
T522 1770-1793 Positive_regulation denotes inflammation-associated
T521 1803-1813 Gene_expression denotes expression
T520 1577-1586 Negative_regulation denotes abrogated
T519 1553-1563 Gene_expression denotes expression
T518 1658-1667 Negative_regulation denotes deficient
T517 1532-1543 Positive_regulation denotes LPS-induced
T516 1415-1422 Positive_regulation denotes induces
T515 1427-1436 Binding denotes formation
T514 459-465 Positive_regulation denotes induce
T513 475-485 Gene_expression denotes expression
T512 225-232 Positive_regulation denotes induced
T509 1794-1802 Protein denotes SerpinB2
T508 1738-1745 Protein denotes C/EBP-β
T507 1650-1657 Protein denotes C/EBP-β
T506 1590-1597 Protein denotes C/EBP-β
T505 1544-1552 Protein denotes SerpinB2
T504 1478-1486 Protein denotes SerpinB2
T503 1440-1447 Protein denotes C/EBP-β
T502 1236-1244 Protein denotes SerpinB2
T501 1017-1025 Protein denotes SERPINB2
T500 608-616 Protein denotes SerpinB2
T499 723-731 Protein denotes SerpinB2
T498 516-520 Protein denotes TLR4
T491 25-32 Protein denotes C/EBP-β
T492 97-105 Protein denotes SerpinB2
T493 156-164 Protein denotes SerpinB2
T494 168-206 Protein denotes plasminogen activator inhibitor type 2
T495 208-213 Protein denotes PAI-2
T496 466-474 Protein denotes SerpinB2
T497 494-514 Protein denotes toll-like receptor 4
T15139 33251-33259 Protein denotes SerpinB2
T20184 45087-45093 Regulation denotes affect
T20183 44958-44968 Regulation denotes regulation
T20182 44940-44949 Positive_regulation denotes important
T20181 44986-44996 Gene_expression denotes expression
T20180 44823-44831 Negative_regulation denotes decrease
T20179 44666-44674 Positive_regulation denotes increase
T20178 44574-44584 Gene_expression denotes expression
T20177 44755-44766 Binding denotes recruitment
T20176 44373-44387 Phosphorylation denotes phosphorylated
T20175 44226-44241 Phosphorylation denotes Phosphorylation
T26489 38160-38167 Gene_expression denotes express
T26488 38062-38072 Gene_expression denotes expression
T26487 37679-37693 Gene_expression denotes co-transfected
T26486 37903-37913 Positive_regulation denotes stimulated
T26485 37699-37709 Gene_expression denotes expression
T26484 37556-37571 Phosphorylation denotes Phosphorylation
T26483 37607-37616 Regulation denotes regulates
T26482 37617-37631 Positive_regulation denotes LPS-stimulated
T26481 37300-37314 Gene_expression denotes co-transfected
T26480 37179-37189 Gene_expression denotes expressing
T26479 37033-37042 Positive_regulation denotes activated
T26478 36930-36939 Positive_regulation denotes necessary
T26477 38207-38214 Protein denotes C/EBP-β
T26476 38129-38141 Protein denotes C/EBP-βT217A
T26475 38091-38123 Protein denotes C/EBP-β phospho-acceptor mutants
T26474 37987-38002 Protein denotes β-galactosidase
T26473 37934-37944 Protein denotes Luciferase
T26472 37864-37888 Protein denotes β-galactosidase reporter
T26471 37822-37859 Protein denotes SerpinB2 promoter-luciferase reporter
T26470 37763-37795 Protein denotes C/EBP-β phospho-acceptor mutants
T26469 37738-37745 Protein denotes C/EBP-β
T26468 37660-37665 Protein denotes Cebpb
T26467 37632-37640 Protein denotes SerpinB2
T26466 37575-37582 Protein denotes C/EBP-β
T26465 37476-37483 Protein denotes C/EBP-β
R1452 T2060 T2083 themeOf SerpinB2,secreted
R1453 T2063 T2085 themeOf SerpinB2,regulated
R1454 T2066 T2086 themeOf TLR4,binding
R1455 T2067 T2089 themeOf SerpinB2,expression
R1456 T2067 T2088 themeOf SerpinB2,upregulated
R1457 T2069 T2091 themeOf SerpinB2,regulated
R1458 T2071 T2092 themeOf SerpinB2,transcription
R1459 T2072 T2090 themeOf SerpinB2,bind
R1460 T2073 T2095 themeOf SerpinB2,induction
R1461 T2075 T2100 themeOf C/EBP-β,deficiency
R1462 T2075 T2096 themeOf C/EBP-β,bound
R1463 T2076 T2097 themeOf SerpinB2,expression
R1464 T2077 T2098 themeOf SerpinB2,induction
R1465 T2079 T2102 themeOf SerpinB2,regulate
R1466 T2079 T2101 themeOf SerpinB2,LPS-induced
R1467 T2080 T2103 themeOf SerpinB2,regulation
R1468 T2086 T2087 themeOf binding,leads
R1469 T2089 T2088 themeOf expression,upregulated
R1470 T2095 T2094 themeOf induction,dependent
R1471 T2095 T2093 themeOf induction,dependent
R1472 T2097 T2099 themeOf expression,abrogated
R1473 T2098 T2099 themeOf induction,abrogated
R1474 T2101 T2102 themeOf LPS-induced,regulate
R2694 T3674 T3678 themeOf Serpinb2,Expression
R2695 T3675 T3678 themeOf SerpinB2,Expression
R2696 T3676 T3678 themeOf Cebpb,Expression
R2697 T3677 T3678 themeOf β-actin,Expression
R3281 T4436 T4440 themeOf GST-murine SerpinB2 fusion protein,produced
R4487 T6253 T6258 themeOf C/EBP-β,co-transfected
R4488 T6253 T6259 causeOf C/EBP-β,affected
R4489 T6254 T6259 themeOf TK,affected
R4950 T6866 T6869 themeOf C/EBP-β,expression
R4951 T6867 T6870 themeOf C/EBP-β,knockdown
R4952 T6869 T6868 themeOf expression,knockdown
R5379 T7473 T7487 themeOf Cebpb,transfected
R5380 T7474 T7487 themeOf luciferase,transfected
R5381 T7476 T7487 themeOf β-galactosidase,transfected
R5382 T7477 T7488 themeOf S64A,co-transfected
R5383 T7481 T7488 themeOf T217A,co-transfected
R5384 T7486 T7489 themeOf C/EBP-β phospho-acceptor mutant,Expression
R6740 T9182 T9186 themeOf SerpinB2,detectable
R6741 T9183 T9188 themeOf SerpinB2,expression
R6742 T9184 T9190 themeOf SerpinB2,expression
R6743 T9185 T9192 themeOf SerpinB2,expression
R6744 T9188 T9189 themeOf expression,induction
R6745 T9188 T9187 themeOf expression,LPS-inducible
R6746 T9190 T9191 themeOf expression,LPS-induced
R6747 T9192 T9193 themeOf expression,induced
R7264 T9871 T9878 themeOf SerpinB2,PMA-induced
R7265 T9871 T9879 themeOf SerpinB2,regulation
R7266 T9873 T9881 themeOf SerpinB2,Deletion
R7267 T9873 T9880 themeOf SerpinB2,increased
R7268 T9874 T9882 themeOf SerpinB2,response
R7269 T9874 T9883 themeOf SerpinB2,affected
R7270 T9876 T9886 themeOf SerpinB2,response
R7271 T9877 T9884 themeOf SerpinB2,reduced
R7272 T9877 T9885 themeOf SerpinB2,deletion
R7273 T9879 T9878 themeOf regulation,PMA-induced
R7274 T9882 T9883 themeOf response,affected
R7275 T9886 T9887 themeOf response,mediating
R7985 T10824 T10834 themeOf SerpinB2,transcription
R7986 T10824 T10833 themeOf SerpinB2,response
R7987 T10826 T10837 themeOf SerpinB2,expression
R7988 T10834 T10835 themeOf transcription,mediate
R7989 T10836 T10838 themeOf regulation,role
R7990 T10837 T10836 themeOf expression,regulation
R8794 T11857 T11865 themeOf SerpinB2,activation
R8795 T11859 T11866 themeOf SERPINB2,PMA-responsiveness
R8796 T11860 T11867 themeOf SerpinB2,role
R8797 T11860 T11868 themeOf SerpinB2,response
R8798 T11861 T11870 themeOf luciferase,reduced
R8799 T11861 T11869 themeOf luciferase,LPS-inducible
R8800 T11862 T11870 themeOf SerpinB2,reduced
R8801 T11863 T11871 themeOf SerpinB2,transcription
R8802 T11865 T11864 themeOf activation,LPS-induced
R8803 T11869 T11870 themeOf LPS-inducible,reduced
R8804 T11871 T11872 themeOf transcription,critical
R8805 T11871 T11873 themeOf transcription,LPS-inducible
R9436 T12698 T12699 themeOf SerpinB2,binds
R9977 T13452 T13465 themeOf C/EBP-β,LPS-induced
R9978 T13452 T13464 themeOf C/EBP-β,Binds
R10515 T14252 T14271 themeOf SerpinB2,LPS-induced
R10516 T14252 T14270 themeOf SerpinB2,Expression
R10517 T14253 T14275 themeOf C/EBP-β,importance
R10518 T14254 T14273 themeOf SerpinB2,expression
R10519 T14258 T14274 themeOf C/EBP-β,express
R10520 T14259 T14276 themeOf C/EBP-β,absence
R10521 T14260 T14279 themeOf SerpinB2,expression
R10522 T14261 T14277 themeOf SerpinB2,attenuated
R10523 T14261 T14279 themeOf SerpinB2,expression
R10524 T14261 T14278 themeOf SerpinB2,express
R10525 T14262 T14283 themeOf SerpinB2,expression
R10526 T14263 T14285 themeOf SerpinB2,expression
R10527 T14265 T14286 themeOf C/EBP-β,expression
R10528 T14266 T14290 themeOf SerpinB2,expression
R10529 T14267 T14291 themeOf C/EBP-β,deficient
R10530 T14269 T14293 themeOf SerpinB2,transcription
R10531 T14270 T14272 themeOf Expression,Mediates
R10532 T14270 T14271 themeOf Expression,LPS-induced
R10533 T14273 T14275 themeOf expression,importance
R10534 T14279 T14277 themeOf expression,attenuated
R10535 T14279 T14277 themeOf expression,attenuated
R10536 T14283 T14284 themeOf expression,increase
R10537 T14284 T14281 themeOf increase,stimulated
R10538 T14285 T14280 themeOf expression,LPS-stimulated
R10539 T14285 T14282 themeOf expression,dampened
R10540 T14286 T14287 themeOf expression,knocked
R10541 T14290 T14288 themeOf expression,LPS-induced
R10542 T14290 T14289 themeOf expression,decreased
R10543 T14293 T14292 themeOf transcription,LPS-inducible
R11177 T15138 T15159 themeOf C/EBP-β,Binds
R11178 T15139 T15159 themeOf SerpinB2,Binds
R11179 T15140 T15160 themeOf C/EBP-β,recruitment
R11180 T15143 T15161 themeOf C/EBP-β,association
R11181 T15143 T15162 themeOf C/EBP-β,present
R11182 T15144 T15161 themeOf SerpinB2,association
R11743 T15925 T15940 themeOf C/EBP-β,binds
R11744 T15926 T15940 themeOf SerpinB2,binds
R11745 T15928 T15939 themeOf SerpinB2,transcription
R11746 T15932 T15941 themeOf SerpinB2,transcription
R11747 T15934 T15942 themeOf SerpinB2,increased
R11748 T15934 T15945 themeOf SerpinB2,abrogated
R11749 T15934 T15946 themeOf SerpinB2,LPS-stimulated
R11750 T15935 T15942 themeOf Cebpb,increased
R11751 T15937 T15943 causeOf C/EBP-β,required
R11752 T15937 T15943 causeOf C/EBP-β,required
R11753 T15938 T15943 themeOf SerpinB2,required
R11754 T15938 T15944 themeOf SerpinB2,LPS-induced
R11755 T15944 T15943 themeOf LPS-induced,required
R11756 T15946 T15942 themeOf LPS-stimulated,increased
R11757 T15946 T15945 themeOf LPS-stimulated,abrogated
R12446 T17105 T17146 themeOf C/EBP-β,Phosphorylation
R12447 T17106 T17145 themeOf SerpinB2,LPS-stimulated
R12448 T17107 T17148 themeOf C/EBP-β,Phosphorylation
R12449 T17109 T17150 themeOf SerpinB2,important
R12450 T17109 T17151 themeOf SerpinB2,LPS-stimulated
R12451 T17110 T17149 themeOf C/EBP-β phospho-acceptor mutants,co-expressed
R12452 T17113 T17152 themeOf Cebpb,Re-expression
R12453 T17114 T17155 themeOf SerpinB2 luciferase reporter,expression
R12454 T17115 T17153 themeOf C/EBP-β,importance
R12455 T17116 T17154 themeOf SerpinB2,LPS-induced
R12456 T17116 T17156 themeOf SerpinB2,transcription
R12457 T17117 T17152 themeOf C/EBP-β,Re-expression
R12458 T17118 T17158 themeOf C/EBP-β phospho-acceptor mutant,Expression
R12459 T17119 T17158 themeOf C/EBPβT217A,Expression
R12460 T17120 T17158 themeOf Cebpb,Expression
R12461 T17121 T17159 themeOf SerpinB2,increase
R12462 T17123 T17161 themeOf C/EBP-β,phosphorylation
R12463 T17124 T17160 themeOf SerpinB2,regulation
R12464 T17124 T17162 themeOf SerpinB2,response
R12465 T17127 T17163 themeOf SerpinB2,transcription
R12466 T17128 T17168 themeOf DAPK1,regulating
R12467 T17129 T17167 themeOf IFNγ,inducible
R12468 T17130 T17167 themeOf gene,inducible
R12469 T17130 T17168 themeOf gene,regulating
R12470 T17131 T17166 themeOf SerpinB2,associated
R12471 T17132 T17171 themeOf IL-6,transcription
R12472 T17133 T17171 themeOf MCP-1,transcription
R12473 T17134 T17173 themeOf SerpinB2,induced
R12474 T17134 T17172 themeOf SerpinB2,regulated
R12475 T17137 T17174 themeOf SerpinB2,expression
R12476 T17138 T17176 themeOf C/EBP-βT188A,transfected
R12477 T17140 T17179 themeOf C/EBP-β,transfected
R12478 T17141 T17178 themeOf C/EBP-βS64A,expression
R12479 T17142 T17177 themeOf SerpinB2,potentiated
R12480 T17143 T17180 themeOf C/EBP-β,phosphorylation
R12481 T17144 T17181 themeOf SerpinB2,regulate
R12482 T17145 T17147 themeOf LPS-stimulated,Regulates
R12483 T17151 T17150 themeOf LPS-stimulated,important
R12484 T17155 T17157 themeOf expression,stimulated
R12485 T17156 T17154 themeOf transcription,LPS-induced
R12486 T17163 T17164 themeOf transcription,modulating
R12487 T17163 T17165 themeOf transcription,dependent
R12488 T17171 T17170 themeOf transcription,important
R12489 T17171 T17169 themeOf transcription,LPS-induced
R12490 T17171 T17169 themeOf transcription,LPS-induced
R12491 T17171 T17170 themeOf transcription,important
R12492 T17174 T17175 themeOf expression,role
R12493 T17178 T17177 causeOf expression,potentiated
R14504 T20062 T20133 themeOf SerpinB2,induction
R14505 T20063 T20134 themeOf SerpinB2,induced
R14506 T20065 T20138 themeOf SerpinB2,transcription
R14507 T20068 T20142 themeOf SerpinB2,transcription
R14508 T20069 T20139 themeOf C/EBP-β,LPS-induced
R14509 T20069 T20140 themeOf C/EBP-β,bind
R14510 T20070 T20140 themeOf SerpinB2,bind
R14511 T20071 T20141 themeOf C/EBP-β,loss
R14512 T20072 T20144 themeOf SerpinB2,induction
R14513 T20074 T20147 themeOf SERPINB2,transcription
R14514 T20075 T20148 themeOf SerpinB2,present
R14515 T20076 T20151 themeOf SerpinB2,transcription
R14516 T20077 T20153 themeOf SerpinB2,increases
R14517 T20078 T20154 themeOf C/EBP-β,interactions
R14518 T20079 T20155 themeOf C/EBP-β,interact
R14519 T20080 T20156 themeOf C/EBP-β,transcription
R14520 T20081 T20158 causeOf C/EBP-β,requirement
R14521 T20081 T20158 causeOf C/EBP-β,requirement
R14522 T20081 T20158 causeOf C/EBP-β,requirement
R14523 T20082 T20158 themeOf SerpinB2,requirement
R14524 T20082 T20160 themeOf SerpinB2,LPS-induced
R14526 T20083 T20161 themeOf SerpinB2,induction
R14527 T20084 T20161 themeOf gene,induction
R14528 T20085 T20161 themeOf C/EBP-β,induction
R14529 T20085 T20162 themeOf C/EBP-β,deficient
R14530 T20086 T20161 themeOf IFNγ,induction
R14531 T20087 T20167 themeOf SerpinB2,expression
R14532 T20089 T20166 themeOf SerpinB2,transcription
R14533 T20090 T20171 themeOf C/EBP-β,bind
R14534 T20091 T20171 themeOf SerpinB2,bind
R14535 T20092 T20168 causeOf C/EBP-β,role
R14536 T20093 T20169 themeOf SerpinB2,expression
R14537 T20094 T20172 themeOf C/EBP-β,upregulated
R14538 T20095 T20172 themeOf SerpinB2,upregulated
R14539 T20098 T20174 themeOf SerpinB2,expression
R14540 T20099 T20173 causeOf C/EBP-β,regulation
R14541 T20100 T20176 themeOf C/EBP-β,phosphorylated
R14542 T20100 T20175 themeOf C/EBP-β,Phosphorylation
R14543 T20101 T20176 themeOf C/EBP-β,phosphorylated
R14544 T20103 T20178 themeOf C/EBP-β phospho-acceptor site mutant,expression
R14545 T20104 T20178 themeOf C/EBPβT217A,expression
R14546 T20105 T20178 themeOf Cebpb,expression
R14547 T20106 T20179 themeOf SerpinB2,increase
R14548 T20107 T20179 causeOf C/EBP-β,increase
R14549 T20107 T20179 causeOf C/EBP-β,increase
R14550 T20107 T20179 causeOf C/EBP-β,increase
R14551 T20107 T20179 causeOf C/EBP-β,increase
R14552 T20108 T20177 themeOf SerpinB2,recruitment
R14553 T20109 T20181 themeOf SerpinB2,expression
R14554 T20110 T20185 themeOf C/EBP-β phospho-acceptor site mutant,expression
R14555 T20111 T20185 themeOf C/EBP-βT188A,expression
R14556 T20112 T20184 themeOf SerpinB2,affect
R14557 T20113 T20190 themeOf C/EBP-βS64A,expression
R14558 T20114 T20186 themeOf SerpinB2,enhanced
R14559 T20114 T20188 themeOf SerpinB2,LPS-induced
R14560 T20115 T20189 themeOf C/EBP-β,phosphorylation
R14561 T20116 T20191 themeOf SerpinB2,regulates
R14562 T20116 T20187 themeOf SerpinB2,LPS-induced
R14563 T20117 T20192 themeOf C/EBP-β,phosphorylated
R14564 T20118 T20194 themeOf SerpinB2,transcription
R14565 T20121 T20195 themeOf C/EBP-β,dephosphorylation
R14566 T20122 T20196 themeOf IFNγ,regulated
R14567 T20124 T20197 themeOf SerpinB2,expression
R14568 T20128 T20198 themeOf SerpinB2,transcription
R14569 T20129 T20202 themeOf SerpinB2,necessary
R14570 T20130 T20200 themeOf SerpinB2,expression
R14571 T20131 T20203 themeOf SerpinB2,role
R14572 T20131 T20204 themeOf SerpinB2,regulating
R14573 T20132 T20206 themeOf SerpinB2,expression
R14574 T20138 T20136 themeOf transcription,response
R14575 T20138 T20135 themeOf transcription,conferred
R14576 T20138 T20137 themeOf transcription,dependent
R14577 T20142 T20143 themeOf transcription,abrogates
R14578 T20147 T20145 themeOf transcription,mediate
R14579 T20147 T20146 themeOf transcription,PMA-stimulated
R14580 T20151 T20152 themeOf transcription,mediating
R14581 T20151 T20149 themeOf transcription,PMA-inducible
R14582 T20152 T20150 themeOf mediating,role
R14584 T20159 T20158 themeOf transcription,requirement
R14585 T20160 T20158 themeOf LPS-induced,requirement
R14587 T20161 T20162 themeOf induction,deficient
R14588 T20161 T20162 themeOf induction,deficient
R14590 T20161 T20163 themeOf induction,impaired
R14591 T20161 T20163 themeOf induction,impaired
R14592 T20161 T20163 themeOf induction,impaired
R14593 T20161 T20163 themeOf induction,impaired
R14594 T20167 T20165 themeOf expression,LPS-inducible
R14595 T20167 T20164 themeOf expression,abrogated
R14596 T20169 T20168 themeOf expression,role
R14597 T20169 T20170 themeOf expression,LPS-induced
R14598 T20174 T20173 themeOf expression,regulation
R14599 T20177 T20180 themeOf recruitment,decrease
R14600 T20178 T20179 themeOf expression,increase
R14601 T20178 T20179 themeOf expression,increase
R14602 T20178 T20179 themeOf expression,increase
R14603 T20181 T20183 themeOf expression,regulation
R14604 T20183 T20182 themeOf regulation,important
R14605 T20187 T20191 themeOf LPS-induced,regulates
R14606 T20188 T20186 themeOf LPS-induced,enhanced
R14607 T20190 T20186 causeOf expression,enhanced
R14608 T20190 T20186 causeOf expression,enhanced
R14609 T20194 T20193 themeOf transcription,LPS-induced
R14610 T20198 T20199 themeOf transcription,LPS-induced
R14611 T20200 T20201 themeOf expression,LPS-induced
R14612 T20206 T20207 themeOf expression,regulation
R14613 T20206 T20205 themeOf expression,inflammation-associated
R16241 T22498 T22503 themeOf SerpinB2,induction
R16242 T22498 T22504 themeOf SerpinB2,expression
R16243 T22499 T22505 themeOf SerpinB2,levels
R16244 T22501 T22506 themeOf SerpinB2,expression
R16245 T22504 T22503 themeOf expression,induction
R17235 T23942 T23947 themeOf SerpinB2,required
R17236 T23942 T23948 themeOf SerpinB2,LPS-responsiveness
R17410 T24241 T24248 themeOf SerpinB2,binding
R17808 T24828 T24843 causeOf C/EBP-β,essential
R17809 T24829 T24842 themeOf SerpinB2,LPS-induced
R17810 T24829 T24841 themeOf SerpinB2,expression
R17811 T24830 T24846 themeOf SerpinB2,expression
R17812 T24832 T24845 themeOf Cebpb,expression
R17813 T24833 T24845 themeOf SerpinB2,expression
R17814 T24834 T24845 themeOf Cebpb,expression
R17815 T24835 T24845 themeOf Cebpb,expression
R17816 T24836 T24848 themeOf C/EBP-β,deficient
R17817 T24837 T24847 themeOf SerpinB2,expression
R17818 T24838 T24850 themeOf Cebpb,target
R17819 T24839 T24851 themeOf C/EBP-β,knockdown
R17820 T24840 T24852 themeOf SerpinB2,expression
R17821 T24841 T24843 themeOf expression,essential
R17822 T24841 T24842 themeOf expression,LPS-induced
R17823 T24846 T24844 themeOf expression,abrogated
R17824 T24847 T24849 themeOf expression,abrogated
R18320 T25590 T25602 themeOf C/EBP-β,recruitment
R18321 T25591 T25602 themeOf SerpinB2,recruitment
R18322 T25592 T25603 themeOf SerpinB2,occupancy
R18323 T25598 T25604 themeOf SerpinB2,Recruitment
R18794 T26452 T26478 causeOf C/EBP-β,necessary
R18795 T26453 T26478 themeOf SerpinB2,necessary
R18796 T26454 T26479 themeOf SerpinB2,activated
R18797 T26455 T26479 themeOf Cebpb,activated
R18798 T26460 T26480 themeOf SerpinB2 promoter-luciferase reporter,expressing
R18799 T26461 T26481 themeOf SerpinB2 promoter-luciferase reporter,co-transfected
R18801 T26467 T26483 themeOf SerpinB2,regulates
R18808 T26482 T26483 themeOf LPS-stimulated,regulates
R302 T503 T515 themeOf C/EBP-β,formation
R303 T504 T515 themeOf SerpinB2,formation
R304 T505 T519 themeOf SerpinB2,expression
R305 T507 T518 themeOf C/EBP-β,deficient
R306 T509 T521 themeOf SerpinB2,expression
R307 T511 T510 themeOf Transcription,LPS-Inducible
R308 T513 T514 themeOf expression,induce
R309 T515 T516 themeOf formation,induces
R310 T515 T516 themeOf formation,induces
R311 T519 T520 themeOf expression,abrogated
R312 T519 T517 themeOf expression,LPS-induced
R313 T521 T523 themeOf expression,regulation
R314 T521 T522 themeOf expression,inflammation-associated
R676 T492 T511 themeOf SerpinB2,Transcription
R677 T493 T512 themeOf SerpinB2,induced
R678 T494 T512 themeOf plasminogen activator inhibitor type 2,induced
R679 T495 T512 themeOf PAI-2,induced
R680 T496 T513 themeOf SerpinB2,expression
R1447 T2056 T2082 themeOf SerpinB2,inhibitor
R1448 T2057 T2082 themeOf urokinase-type plasminogen activator,inhibitor
R1449 T2058 T2082 themeOf uPA,inhibitor
R1450 T2059 T2081 themeOf plasminogen,activation
R1451 T2060 T2084 themeOf SerpinB2,requires
R11183 T15144 T15162 themeOf SerpinB2,present
R11184 T15145 T15164 themeOf SerpinB2,recruitment
R11185 T15145 T15164 themeOf SerpinB2,recruitment
R11186 T15146 T15164 themeOf C/EBP-β,recruitment
R11187 T15146 T15163 themeOf C/EBP-β,phosphorylated
R11188 T15147 T15164 themeOf p-C/EBP-βT217,recruitment
R11189 T15147 T15163 themeOf p-C/EBP-βT217,phosphorylated
R11190 T15148 T15165 themeOf C/EBP-β,changes
R11191 T15148 T15167 themeOf C/EBP-β,phosphorylation
R11192 T15149 T15166 themeOf C/EBP-β,affect
R11193 T15150 T15168 themeOf p-C/EBP-βT217,bound
R11194 T15151 T15168 themeOf SerpinB2,bound
R11195 T15152 T15169 themeOf C/EBP-β,diminished
R11196 T15153 T15171 themeOf p-C/EBP-βT217,affinity
R11197 T15153 T15170 themeOf p-C/EBP-βT217,binding
R11198 T15154 T15171 themeOf SerpinB2,affinity
R11199 T15154 T15169 themeOf SerpinB2,diminished
R11200 T15154 T15170 themeOf SerpinB2,binding
R11201 T15155 T15176 themeOf C/EBP-β,recruitment
R11202 T15156 T15176 themeOf p-C/EBP-βT217,recruitment
R11203 T15157 T15174 themeOf C/EBP-β,T217-phosphorylated
R11204 T15157 T15175 themeOf C/EBP-β,responsible
R11205 T15158 T15172 themeOf SerpinB2,increased
R11206 T15158 T15173 themeOf SerpinB2,transcription
R11207 T15173 T15172 themeOf transcription,increased
R14583 T20156 T20157 themeOf transcription,control
R14525 T20082 T20159 themeOf SerpinB2,transcription
R14586 T20161 T20162 themeOf induction,deficient
R14589 T20161 T20162 themeOf induction,deficient
R18800 T26466 T26484 themeOf C/EBP-β,Phosphorylation
R18802 T26467 T26482 themeOf SerpinB2,LPS-stimulated
R18803 T26468 T26486 themeOf Cebpb,stimulated
R18804 T26468 T26487 themeOf Cebpb,co-transfected
R18805 T26469 T26485 themeOf C/EBP-β,expression
R18806 T26475 T26488 themeOf C/EBP-β phospho-acceptor mutants,expression
R18807 T26477 T26489 themeOf C/EBP-β,express

BioNLP16_Messiy

Id Subject Object Predicate Lexical cue
T26612 38160-38167 Gene_expression denotes express
T26611 38062-38072 Gene_expression denotes expression
T26610 37699-37709 Gene_expression denotes expression
T26609 37556-37571 Phosphorylation denotes Phosphorylation
T26608 37300-37314 Gene_expression denotes co-transfected
T26607 37179-37189 Gene_expression denotes expressing
T26606 37033-37042 Positive_regulation denotes activated
T26605 36930-36939 Positive_regulation denotes necessary
T26604 38207-38214 Protein denotes C/EBP-β
T26603 38129-38141 Protein denotes C/EBP-βT217A
T26602 38091-38123 Protein denotes C/EBP-β phospho-acceptor mutants
T26601 37987-38002 Protein denotes β-galactosidase
T26600 37934-37944 Protein denotes Luciferase
T26599 37864-37888 Protein denotes β-galactosidase reporter
T26598 37822-37859 Protein denotes SerpinB2 promoter-luciferase reporter
T26597 37763-37795 Protein denotes C/EBP-β phospho-acceptor mutants
T26596 37738-37745 Protein denotes C/EBP-β
T26595 37660-37665 Protein denotes Cebpb
T26594 37632-37640 Protein denotes SerpinB2
T26593 37575-37582 Protein denotes C/EBP-β
T26592 37476-37483 Protein denotes C/EBP-β
T26591 37446-37461 Protein denotes β-galactosidase
T26590 37415-37425 Protein denotes luciferase
T26589 37376-37400 Protein denotes β-galactosidase reporter
T26588 37334-37371 Protein denotes SerpinB2 promoter-luciferase reporter
T26587 37204-37241 Protein denotes SerpinB2 promoter-luciferase reporter
T26586 37165-37170 Protein denotes Cebpb
T26585 37152-37157 Protein denotes Cebpb
T26584 37108-37116 Protein denotes SerpinB2
T26583 37086-37091 Protein denotes Cebpb
T26582 37061-37066 Protein denotes Cebpb
T26581 36989-36997 Protein denotes SerpinB2
T26580 36944-36952 Protein denotes SerpinB2
T23579 24281-24285 Protein denotes Oct1
T23578 24140-24148 Protein denotes SerpinB2
T23577 23978-23986 Protein denotes SerpinB2
T23014 20955-20966 Gene_expression denotes transfected
T23013 21442-21450 Protein denotes SerpinB2
T23012 21363-21371 Protein denotes SerpinB2
T23011 21177-21187 Protein denotes luciferase
T23010 20993-21030 Protein denotes SerpinB2 promoter-luciferase reporter
T23009 20881-20889 Protein denotes SerpinB2
T23008 20689-20699 Protein denotes luciferase
T23007 20546-20599 Protein denotes SerpinB2 promoter and 5′ deletion luciferase reporter
T23006 20484-20492 Protein denotes SerpinB2
T22534 18537-18547 Gene_expression denotes expression
T22533 18174-18183 Positive_regulation denotes induction
T22532 18213-18223 Gene_expression denotes expression
T22531 18593-18598 Protein denotes GAPDH
T22530 18520-18528 Protein denotes SerpinB2
T22529 18392-18399 Protein denotes β-actin
T22528 18358-18366 Protein denotes SerpinB2
T22527 18187-18195 Protein denotes SerpinB2
T20643 47188-47198 Regulation denotes regulation
T20642 47202-47225 Positive_regulation denotes inflammation-associated
T20641 47240-47250 Gene_expression denotes expression
T20640 46990-47000 Gene_expression denotes expression
T20639 46964-46975 Positive_regulation denotes LPS-induced
T20638 46661-46674 Transcription denotes transcription
T20637 46649-46660 Positive_regulation denotes LPS-induced
T20636 46119-46129 Gene_expression denotes expression
T20635 45686-45703 Phosphorylation denotes dephosphorylation
T20634 45406-45420 Phosphorylation denotes phosphorylated
T20633 45539-45550 Positive_regulation denotes LPS-induced
T20632 45551-45564 Transcription denotes transcription
T20631 45170-45180 Gene_expression denotes expression
T20630 45275-45290 Phosphorylation denotes phosphorylation
T20629 45330-45341 Positive_regulation denotes LPS-induced
T20628 45320-45329 Regulation denotes regulates
T20627 45210-45218 Positive_regulation denotes enhanced
T20626 45219-45230 Positive_regulation denotes LPS-induced
T20625 45087-45093 Regulation denotes affect
T20624 45009-45019 Gene_expression denotes expression
T20623 44958-44968 Regulation denotes regulation
T20622 44986-44996 Gene_expression denotes expression
T20620 44666-44674 Positive_regulation denotes increase
T20619 44823-44831 Negative_regulation denotes decrease
T20618 44574-44584 Gene_expression denotes expression
T20567 45376-45383 Protein denotes C/EBP-β
T20566 45342-45350 Protein denotes SerpinB2
T20565 45294-45301 Protein denotes C/EBP-β
T20564 45231-45239 Protein denotes SerpinB2
T20563 45184-45195 Protein denotes C/EBP-βS64A
T20562 45094-45102 Protein denotes SerpinB2
T20561 45065-45077 Protein denotes C/EBP-βT188A
T20560 45027-45063 Protein denotes C/EBP-β phospho-acceptor site mutant
T20559 44972-44980 Protein denotes SerpinB2
T20558 44789-44797 Protein denotes SerpinB2
T20557 44734-44741 Protein denotes C/EBP-β
T20556 44675-44683 Protein denotes SerpinB2
T20555 44644-44649 Protein denotes Cebpb
T20554 44628-44639 Protein denotes C/EBPβT217A
T20553 44590-44626 Protein denotes C/EBP-β phospho-acceptor site mutant
T20552 44550-44558 Protein denotes SerpinB2
T20551 44365-44372 Protein denotes C/EBP-β
T20550 44245-44252 Protein denotes C/EBP-β
T20549 44162-44169 Protein denotes C/EBP-β
T20548 44134-44142 Protein denotes SerpinB2
T20547 44008-44016 Protein denotes SerpinB2
T20546 43936-43943 Protein denotes C/EBP-β
T20545 43789-43797 Protein denotes SerpinB2
T20544 43775-43782 Protein denotes C/EBP-β
T20543 43749-43757 Protein denotes SerpinB2
T20542 43726-43733 Protein denotes C/EBP-β
T20541 43659-43667 Protein denotes SerpinB2
T20540 43599-43606 Protein denotes C/EBP-β
T20539 43484-43492 Protein denotes SerpinB2
T20538 43472-43479 Protein denotes C/EBP-β
T20537 43339-43347 Protein denotes SerpinB2
T20536 43179-43183 Protein denotes IFNγ
T20535 43127-43134 Protein denotes C/EBP-β
T20534 43103-43107 Protein denotes gene
T20533 43076-43084 Protein denotes SerpinB2
T20532 42994-43002 Protein denotes SerpinB2
T20531 42912-42919 Protein denotes C/EBP-β
T20530 42878-42885 Protein denotes C/EBP-β
T20529 42677-42684 Protein denotes C/EBP-β
T20528 42618-42625 Protein denotes C/EBP-β
T20527 42181-42189 Protein denotes SerpinB2
T20526 42039-42047 Protein denotes SerpinB2
T20525 41880-41888 Protein denotes SerpinB2
T20524 41829-41837 Protein denotes SERPINB2
T20523 41682-41690 Protein denotes SerpinB2
T20522 41455-41463 Protein denotes SerpinB2
T20521 41360-41367 Protein denotes C/EBP-β
T20520 41299-41307 Protein denotes SerpinB2
T20519 41226-41233 Protein denotes C/EBP-β
T17365 39700-39704 Protein denotes IFNγ
T17364 39690-39695 Protein denotes DAPK1
T17363 39621-39629 Protein denotes SerpinB2
T17362 39603-39610 Protein denotes C/EBP-β
T17361 39478-39485 Protein denotes C/EBP-β
T17360 39431-39439 Protein denotes SerpinB2
T17359 39372-39379 Protein denotes C/EBP-β
T17358 39311-39318 Protein denotes C/EBP-β
T17357 39260-39268 Protein denotes SerpinB2
T17356 39215-39220 Protein denotes Cebpb
T17355 39199-39210 Protein denotes C/EBPβT217A
T17354 39166-39197 Protein denotes C/EBP-β phospho-acceptor mutant
T17353 38921-38928 Protein denotes C/EBP-β
T17352 39119-39127 Protein denotes SerpinB2
T17351 39096-39103 Protein denotes C/EBP-β
T17350 38971-38999 Protein denotes SerpinB2 luciferase reporter
T17349 38932-38937 Protein denotes Cebpb
T17348 38879-38884 Protein denotes Cebpb
T17347 38847-38875 Protein denotes SerpinB2 luciferase reporter
T17346 38705-38737 Protein denotes C/EBP-β phospho-acceptor mutants
T17345 38634-38642 Protein denotes SerpinB2
T17344 38563-38570 Protein denotes C/EBP-β
T17343 38473-38480 Protein denotes C/EBP-β
T17342 38427-38435 Protein denotes SerpinB2
T17341 38370-38377 Protein denotes C/EBP-β
T16025 36813-36821 Positive_regulation denotes required
T16024 36706-36715 Positive_regulation denotes increased
T16023 36737-36746 Negative_regulation denotes abrogated
T16022 36826-36837 Positive_regulation denotes LPS-induced
T16021 36314-36323 Positive_regulation denotes essential
T16020 36160-36165 Binding denotes binds
T16019 36838-36846 Protein denotes SerpinB2
T16018 36802-36809 Protein denotes C/EBP-β
T16017 36750-36755 Protein denotes Cebpb
T16016 36719-36724 Protein denotes Cebpb
T16015 36661-36669 Protein denotes SerpinB2
T16014 36560-36588 Protein denotes SerpinB2 luciferase reporter
T16013 36480-36488 Protein denotes SerpinB2
T16012 36439-36446 Protein denotes C/EBP-β
T16011 36617-36622 Protein denotes Cebpb
T16010 36604-36609 Protein denotes Cebpb
T16009 36366-36374 Protein denotes SerpinB2
T16008 36299-36306 Protein denotes C/EBP-β
T16007 36173-36181 Protein denotes SerpinB2
T16006 36152-36159 Protein denotes C/EBP-β
T16005 36110-36118 Protein denotes SerpinB2
T16004 36072-36079 Protein denotes C/EBP-β
T15268 34723-34734 Binding denotes recruitment
T15267 34754-34773 Phosphorylation denotes T217-phosphorylated
T15266 34793-34804 Regulation denotes responsible
T15265 34574-34584 Negative_regulation denotes diminished
T15264 34505-34512 Binding denotes binding
T15263 34374-34379 Binding denotes bound
T15262 34068-34083 Phosphorylation denotes phosphorylation
T15261 34184-34195 Binding denotes recruitment
T15260 34095-34101 Regulation denotes affect
T15259 34242-34256 Phosphorylation denotes phosphorylated
T15258 33867-33878 Binding denotes association
T15257 33362-33373 Binding denotes recruitment
T15256 33342-33350 Regulation denotes dynamics
T15255 33234-33239 Binding denotes Binds
T15254 34842-34850 Protein denotes SerpinB2
T15253 34774-34781 Protein denotes C/EBP-β
T14407 31141-31148 Gene_expression denotes express
T14406 30881-30891 Transcription denotes Expression
T14405 30824-30832 Positive_regulation denotes Mediates
T14404 30855-30866 Positive_regulation denotes LPS-induced
T14403 31996-32004 Protein denotes SerpinB2
T14402 31903-31910 Protein denotes C/EBP-β
T14401 31821-31828 Protein denotes C/EBP-β
T14400 31765-31773 Protein denotes SerpinB2
T14399 31612-31619 Protein denotes C/EBP-β
T14398 31463-31468 Protein denotes Cebpb
T14397 31408-31416 Protein denotes SerpinB2
T14396 31331-31339 Protein denotes SerpinB2
T14395 31217-31225 Protein denotes SerpinB2
T14394 31275-31283 Protein denotes SerpinB2
T14393 31245-31252 Protein denotes C/EBP-β
T14392 31160-31167 Protein denotes C/EBP-β
T14391 31094-31099 Protein denotes Cebpb
T14390 31063-31068 Protein denotes Cebpb
T14389 31049-31056 Protein denotes C/EBP-β
T14388 30992-31000 Protein denotes SerpinB2
T14387 30970-30977 Protein denotes C/EBP-β
T14386 30867-30875 Protein denotes SerpinB2
T14385 30816-30823 Protein denotes C/EBP-β
T13510 29559-29570 Positive_regulation denotes LPS-induced
T13509 29591-29596 Binding denotes Binds
T13508 30806-30813 Protein denotes C/EBP-β
T13507 30630-30637 Protein denotes C/EBP-β
T13506 30391-30398 Protein denotes C/EBP-δ
T13505 30382-30389 Protein denotes C/EBP-β
T13504 30373-30380 Protein denotes C/EBP-α
T13503 30403-30410 Protein denotes C/EBP-ε
T13502 29979-29986 Protein denotes C/EBP-ε
T13501 29967-29974 Protein denotes C/EBP-δ
T13500 29958-29965 Protein denotes C/EBP-β
T13499 29949-29956 Protein denotes C/EBP-α
T13498 29625-29633 Protein denotes SerpinB2
T13497 29546-29553 Protein denotes C/EBP-β
T7538 14310-14342 Protein denotes C/EBP-β phospho-acceptor mutants
T12718 28496-28504 Protein denotes SerpinB2
T12717 28341-28348 Protein denotes albumin
T12716 27698-27705 Protein denotes albumin
T12715 27614-27622 Protein denotes SerpinB2
T12714 27565-27573 Protein denotes SerpinB2
T11930 26914-26921 Negative_regulation denotes reduced
T11929 25517-25527 Positive_regulation denotes activation
T11928 25008-25015 Binding denotes binding
T11927 27138-27146 Protein denotes SerpinB2
T11926 26972-26980 Protein denotes SerpinB2
T11925 26936-26946 Protein denotes luciferase
T11924 26755-26763 Protein denotes SerpinB2
T11923 26598-26606 Protein denotes SERPINB2
T11922 26506-26514 Protein denotes SerpinB2
T11921 25535-25543 Protein denotes SerpinB2
T11920 25411-25419 Protein denotes SerpinB2
T11919 25040-25082 Protein denotes SerpinB2 promoter-luciferase reporter gene
T11918 24603-24611 Protein denotes SerpinB2
T10893 23520-23527 Binding denotes binding
T10892 22321-22325 Regulation denotes role
T10891 22361-22371 Gene_expression denotes expression
T10890 22333-22343 Regulation denotes regulation
T10889 22052-22059 Positive_regulation denotes mediate
T10888 22060-22073 Transcription denotes transcription
T10887 23538-23542 Protein denotes PU.1
T10886 23559-23564 Protein denotes Oct-1
T10885 23370-23378 Protein denotes SERPINB2
T7537 14299-14306 Protein denotes C/EBP-β
T7536 14358-14362 Protein denotes S64A
T7547 14397-14411 Gene_expression denotes co-transfected
T7546 13882-13893 Gene_expression denotes transfected
T7545 14745-14776 Protein denotes C/EBP-β phospho-acceptor mutant
T7544 14556-14571 Protein denotes β-Galactosidase
T7543 14528-14538 Protein denotes Luciferase
T7542 14497-14512 Protein denotes β-galactosidase
T7541 14436-14446 Protein denotes Luciferase
T7540 14351-14356 Protein denotes T217A
T7539 14344-14349 Protein denotes T188A
T7535 13971-13986 Protein denotes β-galactosidase
T7534 13963-13970 Protein denotes β-actin
T7533 13913-13923 Protein denotes luciferase
T7532 13849-13854 Protein denotes Cebpb
T7531 11300-11310 Protein denotes Luciferase
T6893 13741-13750 Negative_regulation denotes knockdown
T6892 12898-12908 Gene_expression denotes expression
T6891 12888-12897 Negative_regulation denotes knockdown
T6890 13733-13740 Protein denotes C/EBP-β
T6889 12923-12930 Protein denotes C/EBP-β
T6888 12802-12807 Protein denotes cebpb
T6887 12740-12745 Protein denotes cebpb
T6300 12457-12471 Gene_expression denotes co-transfected
T6299 12390-12400 Protein denotes luciferase
T6298 12379-12381 Protein denotes TK
T6297 12331-12341 Protein denotes luciferase
T6296 12500-12502 Protein denotes TK
T6295 12472-12479 Protein denotes C/EBP-β
T6294 12149-12159 Protein denotes Luciferase
T6293 12103-12113 Protein denotes Luciferase
T6292 11495-11497 Protein denotes TK
T6291 11477-11493 Protein denotes thymidine kinase
T6290 11422-11432 Protein denotes luciferase
T6289 11300-11310 Protein denotes Luciferase
T5308 11194-11202 Protein denotes SerpinB2
T5307 11061-11066 Protein denotes Xho I
T5306 11050-11056 Protein denotes EcoR I
T5305 10259-10267 Protein denotes SerpinB2
T5304 10200-10219 Protein denotes Luciferase reporter
T5303 10027-10035 Protein denotes SerpinB2
T5302 9783-9790 Protein denotes Bsu36 I
T5301 9775-9781 Protein denotes BstX I
T5300 9768-9773 Protein denotes Apa I
T5299 9761-9766 Protein denotes Sfi I
T5298 9721-9727 Protein denotes EcoR I
T5297 9552-9580 Protein denotes SerpinB2 luciferase reporter
T5296 9944-9957 Protein denotes T4 DNA ligase
T5295 9883-9900 Protein denotes T4 DNA polymerase
T5294 9811-9816 Protein denotes Apo I
T5293 9799-9806 Protein denotes Hae III
T5292 9792-9797 Protein denotes Pac I
T5291 9459-9467 Protein denotes SerpinB2
T5290 9241-9249 Protein denotes SerpinB2
T5289 9057-9079 Protein denotes SerpinB2 Reporter Gene
T4460 8806-8814 Gene_expression denotes produced
T4459 8982-8987 Protein denotes GAPDH
T4458 8940-8980 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4457 8893-8900 Protein denotes C/EBP-β
T4456 8771-8805 Protein denotes GST-murine SerpinB2 fusion protein
T4022 8004-8012 Protein denotes SerpinB2
T4021 7369-7384 Protein denotes exonuclease III
T4020 7164-7172 Protein denotes SerpinB2
T3692 7064-7071 Protein denotes β-actin
T3691 7038-7043 Protein denotes Cebpb
T3690 7012-7020 Protein denotes SerpinB2
T3689 7003-7011 Protein denotes Serpinb2
T3295 5807-5812 Protein denotes Cebpb
T2228 4388-4396 Protein denotes SerpinB2
T2227 4299-4303 Protein denotes IKKβ
T2226 4208-4216 Protein denotes SerpinB2
T2225 3851-3855 Protein denotes TLR4
T2224 3653-3657 Protein denotes TLR4
T2223 3631-3651 Protein denotes toll-like receptor 4
T2222 3271-3279 Protein denotes SerpinB2
T2221 3096-3104 Protein denotes SerpinB2
T630 1532-1543 Positive_regulation denotes LPS-induced
T631 1553-1563 Gene_expression denotes expression
T632 1803-1813 Gene_expression denotes expression
T601 25-32 Protein denotes C/EBP-β
T602 97-105 Protein denotes SerpinB2
T620 73-86 Transcription denotes Transcription
T621 33-41 Positive_regulation denotes Mediates
T2220 2975-2983 Protein denotes SerpinB2
T2219 2933-2941 Protein denotes SerpinB2
T2218 2888-2899 Protein denotes plasminogen
T2217 2762-2765 Protein denotes uPA
T2216 2724-2760 Protein denotes urokinase-type plasminogen activator
T2215 2675-2683 Protein denotes SerpinB2
T2214 2608-2616 Protein denotes SerpinB2
T603 156-164 Protein denotes SerpinB2
T604 168-206 Protein denotes plasminogen activator inhibitor type 2
T605 208-213 Protein denotes PAI-2
T606 466-474 Protein denotes SerpinB2
T607 494-514 Protein denotes toll-like receptor 4
T608 516-520 Protein denotes TLR4
T609 723-731 Protein denotes SerpinB2
T610 608-616 Protein denotes SerpinB2
T611 1017-1025 Protein denotes SERPINB2
T612 1236-1244 Protein denotes SerpinB2
T613 1440-1447 Protein denotes C/EBP-β
T614 1478-1486 Protein denotes SerpinB2
T615 1544-1552 Protein denotes SerpinB2
T616 1590-1597 Protein denotes C/EBP-β
T617 1650-1657 Protein denotes C/EBP-β
T618 1738-1745 Protein denotes C/EBP-β
T619 1794-1802 Protein denotes SerpinB2
T622 225-232 Positive_regulation denotes induced
T623 475-485 Gene_expression denotes expression
T624 459-465 Positive_regulation denotes induce
T625 1427-1436 Localization denotes formation
T626 1415-1422 Positive_regulation denotes induces
T627 1598-1602 Negative_regulation denotes null
T628 1658-1667 Negative_regulation denotes deficient
T629 1577-1586 Negative_regulation denotes abrogated
T633 1756-1766 Regulation denotes regulation
T634 1770-1793 Positive_regulation denotes inflammation-associated
T20587 41095-41108 Transcription denotes transcription
T2246 3886-3891 Positive_regulation denotes leads
T2245 3833-3840 Binding denotes binding
T2244 3295-3304 Regulation denotes regulated
T2243 2948-2956 Localization denotes secreted
T2242 2924-2932 Positive_regulation denotes requires
T2241 2874-2884 Positive_regulation denotes activation
T2240 2711-2720 Negative_regulation denotes inhibitor
T2239 5344-5352 Protein denotes SerpinB2
T2238 5228-5236 Protein denotes SerpinB2
T2237 5153-5160 Protein denotes C/EBP-β
T2236 5111-5119 Protein denotes SerpinB2
T2235 5087-5095 Protein denotes SerpinB2
T2234 5001-5008 Protein denotes C/EBP-β
T2233 4914-4922 Protein denotes SerpinB2
T2232 4793-4801 Protein denotes SerpinB2
T2231 4722-4730 Protein denotes SerpinB2
T2230 4577-4585 Protein denotes SerpinB2
T2229 4511-4516 Protein denotes IFN-γ
T3294 5783-5788 Protein denotes Cebpb
T2261 5326-5336 Regulation denotes regulation
T2260 5216-5227 Positive_regulation denotes LPS-induced
T2259 5207-5215 Regulation denotes regulate
T2258 5096-5106 Gene_expression denotes expression
T2257 5053-5063 Negative_regulation denotes deficiency
T2256 5064-5073 Negative_regulation denotes abrogated
T2255 5120-5129 Positive_regulation denotes induction
T2254 5018-5023 Binding denotes bound
T2253 4951-4960 Positive_regulation denotes dependent
T2252 4780-4789 Positive_regulation denotes induction
T2251 4805-4814 Positive_regulation denotes dependent
T2250 4411-4420 Regulation denotes regulated
T2249 4713-4717 Binding denotes bind
T2248 4265-4276 Positive_regulation denotes upregulated
T2247 4250-4260 Gene_expression denotes expression
T20586 41190-41199 Positive_regulation denotes dependent
T9928 18941-18951 Protein denotes luciferase
T9927 18784-18792 Protein denotes SerpinB2
T9926 18626-18634 Protein denotes SerpinB2
T9232 18017-18024 Positive_regulation denotes induced
T9231 17997-18007 Gene_expression denotes expression
T9230 17848-17859 Positive_regulation denotes LPS-induced
T9229 17869-17879 Gene_expression denotes expression
T9228 17719-17729 Transcription denotes expression
T9227 17691-17704 Positive_regulation denotes LPS-inducible
T9226 17678-17687 Positive_regulation denotes induction
T9225 17980-17988 Protein denotes SerpinB2
T9224 17860-17868 Protein denotes SerpinB2
T9223 17705-17713 Protein denotes SerpinB2
T9222 17543-17551 Protein denotes SerpinB2
T9221 17454-17462 Protein denotes SerpinB2
T8569 17108-17116 Protein denotes SerpinB2
T8568 16889-16901 Protein denotes Proteinase K
T8567 16719-16728 Protein denotes Protein G
T8015 14970-14994 Protein denotes T4 polynucleotide kinase
T7548 14727-14737 Gene_expression denotes Expression
T10884 23005-23013 Protein denotes SERPINB2
T10883 22813-22821 Protein denotes SerpinB2
T10882 22758-22766 Protein denotes SerpinB2
T10881 22347-22355 Protein denotes SerpinB2
T10880 22159-22167 Protein denotes SerpinB2
T10879 22088-22096 Protein denotes SerpinB2
T10878 21971-21979 Protein denotes SerpinB2
T9940 20021-20029 Negative_regulation denotes deletion
T9939 19572-19580 Negative_regulation denotes Deletion
T9938 19183-19194 Positive_regulation denotes PMA-induced
T9937 19209-19219 Regulation denotes regulation
T9936 20037-20045 Protein denotes SerpinB2
T9935 20296-20304 Protein denotes SerpinB2
T9934 20156-20164 Protein denotes SerpinB2
T9933 19955-19963 Protein denotes SerpinB2
T9932 19595-19603 Protein denotes SerpinB2
T9931 19428-19436 Protein denotes SerpinB2
T9930 19195-19203 Protein denotes SerpinB2
T9929 19104-19114 Protein denotes luciferase
T20585 40961-40968 Positive_regulation denotes induced
T20584 40867-40875 Positive_regulation denotes involves
T20583 40884-40893 Positive_regulation denotes induction
T20582 47226-47234 Protein denotes SerpinB2
T20581 47105-47113 Protein denotes SerpinB2
T20580 46976-46984 Protein denotes SerpinB2
T20579 46891-46899 Protein denotes SerpinB2
T14425 31927-31936 Positive_regulation denotes mediating
T14424 31808-31817 Negative_regulation denotes decreased
T14423 31753-31764 Positive_regulation denotes LPS-induced
T14422 31779-31789 Transcription denotes expression
T14421 31829-31838 Negative_regulation denotes deficient
T14420 31643-31647 Negative_regulation denotes down
T14419 31620-31630 Gene_expression denotes expression
T14418 31345-31355 Transcription denotes expression
T14417 31319-31327 Positive_regulation denotes increase
T14416 31393-31407 Positive_regulation denotes LPS-stimulated
T14415 31451-31459 Regulation denotes dampened
T14414 31422-31432 Transcription denotes expression
T14413 31184-31191 Gene_expression denotes express
T14412 31289-31299 Transcription denotes expression
T14411 31234-31241 Negative_regulation denotes absence
T14410 31253-31263 Negative_regulation denotes attenuated
T14409 31006-31016 Transcription denotes expression
T14408 30956-30966 Positive_regulation denotes importance
T20578 46682-46690 Protein denotes SerpinB2
T15252 34709-34722 Protein denotes p-C/EBP-βT217
T15251 34697-34704 Protein denotes C/EBP-β
T15250 34547-34555 Protein denotes SerpinB2
T15249 34525-34538 Protein denotes p-C/EBP-βT217
T15248 34492-34499 Protein denotes C/EBP-β
T15247 34387-34395 Protein denotes SerpinB2
T15246 34341-34354 Protein denotes p-C/EBP-βT217
T15245 34102-34109 Protein denotes C/EBP-β
T15244 34060-34067 Protein denotes C/EBP-β
T15243 34274-34287 Protein denotes p-C/EBP-βT217
T15242 34257-34264 Protein denotes C/EBP-β
T15241 34203-34211 Protein denotes SerpinB2
T15240 33826-33834 Protein denotes SerpinB2
T15239 33785-33792 Protein denotes C/EBP-β
T15238 33691-33699 Protein denotes SerpinB2
T15237 33388-33396 Protein denotes SerpinB2
T15236 33354-33361 Protein denotes C/EBP-β
T15235 33251-33259 Protein denotes SerpinB2
T15234 33226-33233 Protein denotes C/EBP-β
T14426 31968-31981 Transcription denotes transcription
T17386 39133-39146 Transcription denotes transcription
T17385 38960-38970 Positive_regulation denotes stimulated
T17384 38894-38907 Gene_expression denotes Re-expression
T17383 38684-38696 Gene_expression denotes co-expressed
T17382 38454-38469 Phosphorylation denotes Phosphorylation
T17381 38351-38366 Phosphorylation denotes Phosphorylation
T17380 40559-40567 Protein denotes SerpinB2
T17379 40516-40523 Protein denotes C/EBP-β
T17378 40409-40417 Protein denotes SerpinB2
T17377 40385-40396 Protein denotes C/EBP-βS64A
T17376 40333-40340 Protein denotes C/EBP-β
T17375 40277-40285 Protein denotes SerpinB2
T17374 40237-40249 Protein denotes C/EBP-βT188A
T17373 40211-40219 Protein denotes SerpinB2
T17372 40129-40137 Protein denotes SerpinB2
T17371 40117-40124 Protein denotes C/EBP-β
T17370 39945-39953 Protein denotes SerpinB2
T17369 39922-39927 Protein denotes MCP-1
T17368 39913-39917 Protein denotes IL-6
T17367 39802-39810 Protein denotes SerpinB2
T17366 39715-39719 Protein denotes gene
T17392 39353-39368 Phosphorylation denotes phosphorylation
T17391 39417-39427 Regulation denotes regulation
T17390 39148-39158 Gene_expression denotes Expression
T17389 39251-39259 Positive_regulation denotes increase
T17388 39005-39015 Gene_expression denotes expression
T17387 39107-39118 Positive_regulation denotes LPS-induced
T20518 41391-41399 Protein denotes SerpinB2
T20517 41205-41212 Protein denotes C/EBP-β
T20516 41148-41156 Protein denotes SerpinB2
T20515 41081-41089 Protein denotes SerpinB2
T20514 40995-40999 Protein denotes IKKβ
T20513 40931-40939 Protein denotes SerpinB2
T20512 40921-40929 Protein denotes SerpinB2
T17410 40550-40558 Regulation denotes regulate
T17409 40497-40512 Phosphorylation denotes phosphorylation
T17408 40397-40408 Positive_regulation denotes potentiated
T17407 40371-40381 Gene_expression denotes expression
T17406 40341-40352 Gene_expression denotes transfected
T17405 40250-40261 Gene_expression denotes transfected
T17404 40203-40207 Regulation denotes role
T17403 40225-40235 Gene_expression denotes expression
T17402 39957-39964 Positive_regulation denotes induced
T17401 39976-39985 Regulation denotes regulated
T17400 39870-39881 Positive_regulation denotes LPS-induced
T17399 39882-39895 Transcription denotes transcription
T17398 39679-39689 Regulation denotes regulating
T17397 39720-39728 Positive_regulation denotes involved
T17396 39705-39714 Positive_regulation denotes inducible
T17395 39635-39648 Transcription denotes transcription
T17394 39611-39620 Regulation denotes dependent
T17393 39592-39602 Regulation denotes modulating
T20593 42011-42024 Transcription denotes transcription
T20592 41802-41815 Transcription denotes transcription
T20591 41214-41225 Positive_regulation denotes LPS-induced
T20590 41405-41418 Transcription denotes transcription
T20589 41352-41356 Negative_regulation denotes loss
T20588 41260-41264 Binding denotes bind
T20577 46582-46589 Protein denotes C/EBP-β
T20576 46421-46428 Protein denotes C/EBP-β
T20575 46287-46295 Protein denotes SerpinB2
T20574 46110-46118 Protein denotes SerpinB2
T20573 45799-45803 Protein denotes MLK3
T20572 45737-45741 Protein denotes IFNγ
T20571 45707-45714 Protein denotes C/EBP-β
T20570 45673-45677 Protein denotes MLK3
T20569 45649-45671 Protein denotes Mixed lineage kinase-3
T20568 45568-45576 Protein denotes SerpinB2
T20621 44755-44766 Binding denotes recruitment
T20617 44226-44241 Phosphorylation denotes Phosphorylation
T20616 44451-44458 Positive_regulation denotes induced
T20615 44373-44387 Phosphorylation denotes phosphorylated
T20614 44148-44158 Gene_expression denotes expression
T20613 44120-44130 Regulation denotes regulation
T20612 43944-43948 Negative_regulation denotes null
T20611 43849-43860 Positive_regulation denotes upregulated
T20610 43763-43773 Gene_expression denotes expression
T20609 43650-43654 Binding denotes bind
T20608 43737-43748 Positive_regulation denotes LPS-induced
T20607 43381-43390 Negative_regulation denotes abrogated
T20606 43498-43511 Transcription denotes transcription
T20605 43325-43338 Positive_regulation denotes LPS-inducible
T20604 43353-43363 Transcription denotes expression
T20603 43135-43144 Negative_regulation denotes deficient
T20602 43114-43123 Positive_regulation denotes induction
T20601 43197-43205 Negative_regulation denotes impaired
T20600 42982-42993 Positive_regulation denotes LPS-induced
T20599 43008-43021 Transcription denotes transcription
T20598 42857-42870 Transcription denotes transcription
T20597 42717-42725 Binding denotes interact
T20596 42597-42609 Binding denotes interactions
T20595 41987-41996 Positive_regulation denotes mediating
T20594 41997-42010 Positive_regulation denotes PMA-inducible
T24922 32123-32133 Transcription denotes expression
T24921 33011-33019 Protein denotes SerpinB2
T24920 32901-32908 Protein denotes C/EBP-β
T24919 32730-32735 Protein denotes Cebpb
T24918 32439-32447 Protein denotes SerpinB2
T24917 32475-32482 Protein denotes C/EBP-β
T24916 32342-32347 Protein denotes Cebpb
T24915 32329-32334 Protein denotes Cebpb
T24914 32291-32299 Protein denotes SerpinB2
T24913 32217-32222 Protein denotes Cebpb
T24912 32191-32196 Protein denotes Cebpb
T24911 32150-32158 Protein denotes SerpinB2
T24910 32109-32117 Protein denotes SerpinB2
T24909 32055-32062 Protein denotes C/EBP-β
T24276 28717-28724 Binding denotes binding
T24275 29173-29181 Protein denotes SerpinB2
T24274 29084-29091 Protein denotes albumin
T24273 29045-29052 Protein denotes albumin
T24272 28976-28984 Protein denotes SerpinB2
T24271 28920-28928 Protein denotes SerpinB2
T24270 28783-28790 Protein denotes C/EBP-β
T24269 28736-28744 Protein denotes SerpinB2
T23970 26126-26137 Gene_expression denotes transfected
T23969 26307-26317 Protein denotes luciferase
T23968 26164-26201 Protein denotes SerpinB2 promoter-luciferase reporter
T23967 25983-25991 Protein denotes SerpinB2
T23966 25772-25780 Protein denotes SerpinB2
T23965 25687-25695 Protein denotes SerpinB2
T23583 24336-24364 Protein denotes purine box binding protein 1
T23582 24328-24332 Protein denotes PU.1
T23581 24320-24326 Protein denotes POU2F1
T23580 24289-24319 Protein denotes octamer transcription factor 1
T26579 36919-36926 Protein denotes C/EBP-β
T25659 35656-35667 Binding denotes Recruitment
T25658 35038-35047 Binding denotes occupancy
T25657 34937-34948 Binding denotes recruitment
T25656 36034-36038 Protein denotes rIgG
T25655 35957-35973 Protein denotes p-C/EBP-β (T217)
T25654 35948-35955 Protein denotes C/EBP-β
T25653 35685-35693 Protein denotes SerpinB2
T25652 35568-35576 Protein denotes SerpinB2
T25651 35429-35445 Protein denotes p-C/EBP-β (T217)
T25650 35420-35427 Protein denotes C/EBP-β
T25649 35324-35340 Protein denotes p-C/EBP-β (T217)
T25648 35313-35320 Protein denotes C/EBP-β
T25647 35055-35063 Protein denotes SerpinB2
T25646 34990-34998 Protein denotes SerpinB2
T25645 34952-34959 Protein denotes C/EBP-β
T24933 33025-33035 Transcription denotes expression
T24932 32877-32886 Negative_regulation denotes knockdown
T24931 32712-32718 Binding denotes target
T24930 32483-32492 Negative_regulation denotes deficient
T24929 32448-32458 Gene_expression denotes expression
T24928 32462-32471 Negative_regulation denotes abrogated
T24927 32164-32174 Transcription denotes expression
T24926 32305-32315 Transcription denotes expression
T24925 32178-32187 Negative_regulation denotes abrogated
T24924 32097-32108 Positive_regulation denotes LPS-induced
T24923 32066-32075 Positive_regulation denotes essential
R10587 T14385 T14405 causeOf C/EBP-β,Mediates
R10588 T14385 T14405 causeOf C/EBP-β,Mediates
R10589 T14386 T14404 themeOf SerpinB2,LPS-induced
R10590 T14386 T14406 themeOf SerpinB2,Expression
R10591 T14387 T14408 themeOf C/EBP-β,importance
R10592 T14388 T14409 themeOf SerpinB2,expression
R10593 T14392 T14407 themeOf C/EBP-β,express
R10594 T14393 T14411 themeOf C/EBP-β,absence
R10595 T14394 T14412 themeOf SerpinB2,expression
R10596 T14395 T14413 themeOf SerpinB2,express
R10597 T14396 T14418 themeOf SerpinB2,expression
R10598 T14397 T14414 themeOf SerpinB2,expression
R10599 T14398 T14415 themeOf Cebpb,dampened
R10600 T14399 T14419 themeOf C/EBP-β,expression
R10601 T14399 T14420 themeOf C/EBP-β,down
R10602 T14400 T14422 themeOf SerpinB2,expression
R10603 T14401 T14421 themeOf C/EBP-β,deficient
R10604 T14402 T14425 causeOf C/EBP-β,mediating
R10605 T14403 T14426 themeOf SerpinB2,transcription
R10606 T14404 T14405 themeOf LPS-induced,Mediates
R10607 T14404 T14405 themeOf LPS-induced,Mediates
R10608 T14406 T14405 themeOf Expression,Mediates
R10609 T14406 T14404 themeOf Expression,LPS-induced
R10610 T14412 T14410 themeOf expression,attenuated
R10611 T14413 T14410 themeOf express,attenuated
R10612 T14414 T14416 themeOf expression,LPS-stimulated
R10613 T14414 T14415 themeOf expression,dampened
R10614 T14418 T14417 themeOf expression,increase
R10615 T14419 T14420 themeOf expression,down
R10616 T14421 T14424 causeOf deficient,decreased
R10617 T14422 T14423 themeOf expression,LPS-induced
R10618 T14422 T14424 themeOf expression,decreased
R10619 T14426 T14425 themeOf transcription,mediating
R11239 T15234 T15255 themeOf C/EBP-β,Binds
R11240 T15236 T15257 themeOf C/EBP-β,recruitment
R11241 T15239 T15258 themeOf C/EBP-β,association
R11242 T15240 T15258 themeOf SerpinB2,association
R11243 T15241 T15261 themeOf SerpinB2,recruitment
R11244 T15241 T15261 themeOf SerpinB2,recruitment
R11245 T15242 T15261 themeOf C/EBP-β,recruitment
R11246 T15242 T15259 themeOf C/EBP-β,phosphorylated
R11247 T15243 T15261 themeOf p-C/EBP-βT217,recruitment
R11248 T15244 T15262 themeOf C/EBP-β,phosphorylation
R11249 T15245 T15260 themeOf C/EBP-β,affect
R11250 T15246 T15263 themeOf p-C/EBP-βT217,bound
R11251 T15247 T15263 themeOf SerpinB2,bound
R11252 T15248 T15265 themeOf C/EBP-β,diminished
R11253 T15249 T15264 themeOf p-C/EBP-βT217,binding
R11254 T15250 T15264 themeOf SerpinB2,binding
R11255 T15251 T15268 themeOf C/EBP-β,recruitment
R11256 T15252 T15268 themeOf p-C/EBP-βT217,recruitment
R11257 T15253 T15267 themeOf C/EBP-β,T217-phosphorylated
R11258 T15253 T15266 themeOf C/EBP-β,responsible
R11259 T15257 T15256 themeOf recruitment,dynamics
R11772 T16006 T16020 themeOf C/EBP-β,binds
R11773 T16007 T16020 themeOf SerpinB2,binds
R11774 T16008 T16021 themeOf C/EBP-β,essential
R11775 T16016 T16024 themeOf Cebpb,increased
R11776 T16017 T16023 themeOf Cebpb,abrogated
R11777 T16018 T16025 causeOf C/EBP-β,required
R11778 T16019 T16025 themeOf SerpinB2,required
R11779 T16019 T16022 themeOf SerpinB2,LPS-induced
R12554 T17341 T17381 themeOf C/EBP-β,Phosphorylation
R12555 T17343 T17382 themeOf C/EBP-β,Phosphorylation
R12556 T17346 T17383 themeOf C/EBP-β phospho-acceptor mutants,co-expressed
R12557 T17349 T17384 themeOf Cebpb,Re-expression
R12558 T17350 T17388 themeOf SerpinB2 luciferase reporter,expression
R12559 T17352 T17386 themeOf SerpinB2,transcription
R12560 T17353 T17384 themeOf C/EBP-β,Re-expression
R12561 T17354 T17390 themeOf C/EBP-β phospho-acceptor mutant,Expression
R12562 T17355 T17390 themeOf C/EBPβT217A,Expression
R12563 T17356 T17390 themeOf Cebpb,Expression
R12564 T17359 T17392 themeOf C/EBP-β,phosphorylation
R12565 T17360 T17391 themeOf SerpinB2,regulation
R12566 T17362 T17394 causeOf C/EBP-β,dependent
R12567 T17363 T17395 themeOf SerpinB2,transcription
R12568 T17364 T17398 themeOf DAPK1,regulating
R12569 T17365 T17396 themeOf IFNγ,inducible
R12570 T17366 T17396 themeOf gene,inducible
R12571 T17366 T17397 themeOf gene,involved
R12572 T17366 T17398 themeOf gene,regulating
R12573 T17367 T17398 themeOf SerpinB2,regulating
R12574 T17369 T17399 themeOf MCP-1,transcription
R12575 T17370 T17402 themeOf SerpinB2,induced
R12576 T17370 T17401 themeOf SerpinB2,regulated
R12577 T17373 T17403 themeOf SerpinB2,expression
R12578 T17374 T17405 themeOf C/EBP-βT188A,transfected
R12579 T17376 T17406 themeOf C/EBP-β,transfected
R12580 T17377 T17407 themeOf C/EBP-βS64A,expression
R12581 T17379 T17409 themeOf C/EBP-β,phosphorylation
R12582 T17384 T17385 causeOf Re-expression,stimulated
R12583 T17384 T17385 causeOf Re-expression,stimulated
R12584 T17386 T17387 themeOf transcription,LPS-induced
R12585 T17388 T17385 themeOf expression,stimulated
R12586 T17388 T17385 themeOf expression,stimulated
R12587 T17390 T17389 themeOf Expression,increase
R12588 T17390 T17389 themeOf Expression,increase
R12589 T17390 T17389 themeOf Expression,increase
R12590 T17395 T17393 themeOf transcription,modulating
R12591 T17395 T17394 themeOf transcription,dependent
R12592 T17399 T17400 themeOf transcription,LPS-induced
R12593 T17403 T17404 themeOf expression,role
R12594 T17407 T17408 themeOf expression,potentiated
R12595 T17409 T17410 themeOf phosphorylation,regulate
R14726 T20512 T20583 themeOf SerpinB2,induction
R14727 T20513 T20585 themeOf SerpinB2,induced
R14729 T20517 T20586 causeOf C/EBP-β,dependent
R14737 T20528 T20596 themeOf C/EBP-β,interactions
R14738 T20529 T20597 themeOf C/EBP-β,interact
R14739 T20530 T20598 themeOf C/EBP-β,transcription
R14740 T20532 T20600 themeOf SerpinB2,LPS-induced
R14741 T20532 T20599 themeOf SerpinB2,transcription
R14742 T20534 T20602 themeOf gene,induction
R14743 T20534 T20601 themeOf gene,impaired
R14744 T20535 T20603 themeOf C/EBP-β,deficient
R14745 T20536 T20602 themeOf IFNγ,induction
R14746 T20537 T20604 themeOf SerpinB2,expression
R14747 T20538 T20606 themeOf C/EBP-β,transcription
R14748 T20539 T20606 themeOf SerpinB2,transcription
R14749 T20540 T20609 themeOf C/EBP-β,bind
R14750 T20541 T20609 themeOf SerpinB2,bind
R14751 T20543 T20610 themeOf SerpinB2,expression
R14752 T20544 T20611 themeOf C/EBP-β,upregulated
R14753 T20546 T20612 themeOf C/EBP-β,null
R14754 T20548 T20614 themeOf SerpinB2,expression
R14755 T20549 T20613 causeOf C/EBP-β,regulation
R14756 T20550 T20615 themeOf C/EBP-β,phosphorylated
R14757 T20550 T20617 themeOf C/EBP-β,Phosphorylation
R14758 T20550 T20616 themeOf C/EBP-β,induced
R14759 T20551 T20615 themeOf C/EBP-β,phosphorylated
R14760 T20553 T20618 themeOf C/EBP-β phospho-acceptor site mutant,expression
R14761 T20554 T20618 themeOf C/EBPβT217A,expression
R14762 T20555 T20618 themeOf Cebpb,expression
R14763 T20556 T20620 themeOf SerpinB2,increase
R14764 T20556 T20619 themeOf SerpinB2,decrease
R14765 T20558 T20621 themeOf SerpinB2,recruitment
R14766 T20559 T20622 themeOf SerpinB2,expression
R14767 T20560 T20624 themeOf C/EBP-β phospho-acceptor site mutant,expression
R14768 T20561 T20624 themeOf C/EBP-βT188A,expression
R14769 T20563 T20631 themeOf C/EBP-βS64A,expression
R14770 T20564 T20626 themeOf SerpinB2,LPS-induced
R14771 T20565 T20630 themeOf C/EBP-β,phosphorylation
R14772 T20566 T20629 themeOf SerpinB2,LPS-induced
R14773 T20567 T20634 themeOf C/EBP-β,phosphorylated
R14774 T20568 T20632 themeOf SerpinB2,transcription
R14775 T20571 T20635 themeOf C/EBP-β,dephosphorylation
R14776 T20574 T20636 themeOf SerpinB2,expression
R14780 T20583 T20584 themeOf induction,involves
R14781 T20587 T20586 themeOf transcription,dependent
R14784 T20599 T20600 themeOf transcription,LPS-induced
R14785 T20604 T20605 themeOf expression,LPS-inducible
R14786 T20604 T20607 themeOf expression,abrogated
R14787 T20610 T20608 themeOf expression,LPS-induced
R14788 T20614 T20613 themeOf expression,regulation
R14789 T20618 T20620 themeOf expression,increase
R14790 T20618 T20620 themeOf expression,increase
R14791 T20618 T20620 themeOf expression,increase
R14792 T20621 T20619 themeOf recruitment,decrease
R14793 T20622 T20623 themeOf expression,regulation
R14794 T20624 T20625 themeOf expression,affect
R14795 T20624 T20625 themeOf expression,affect
R14796 T20626 T20627 themeOf LPS-induced,enhanced
R14797 T20629 T20628 themeOf LPS-induced,regulates
R14798 T20630 T20628 causeOf phosphorylation,regulates
R14799 T20632 T20633 themeOf transcription,LPS-induced
R17844 T24910 T24922 themeOf SerpinB2,expression
R17845 T24911 T24927 themeOf SerpinB2,expression
R17846 T24912 T24925 causeOf Cebpb,abrogated
R17847 T24912 T24925 causeOf Cebpb,abrogated
R17848 T24913 T24925 themeOf Cebpb,abrogated
R17849 T24914 T24926 themeOf SerpinB2,expression
R17850 T24915 T24926 themeOf Cebpb,expression
R17851 T24916 T24926 themeOf Cebpb,expression
R17852 T24917 T24930 themeOf C/EBP-β,deficient
R17853 T24918 T24929 themeOf SerpinB2,expression
R17854 T24919 T24931 themeOf Cebpb,target
R17855 T24920 T24932 themeOf C/EBP-β,knockdown
R17856 T24921 T24933 themeOf SerpinB2,expression
R17857 T24922 T24923 themeOf expression,essential
R17858 T24922 T24924 themeOf expression,LPS-induced
R17859 T24927 T24925 themeOf expression,abrogated
R17860 T24929 T24928 themeOf expression,abrogated
R17861 T24930 T24928 causeOf deficient,abrogated
R18330 T25645 T25657 themeOf C/EBP-β,recruitment
R18331 T25646 T25657 themeOf SerpinB2,recruitment
R18332 T25647 T25658 themeOf SerpinB2,occupancy
R18333 T25653 T25659 themeOf SerpinB2,Recruitment
R18832 T26579 T26605 themeOf C/EBP-β,necessary
R18833 T26581 T26606 themeOf SerpinB2,activated
R18834 T26582 T26606 themeOf Cebpb,activated
R18835 T26587 T26607 themeOf SerpinB2 promoter-luciferase reporter,expressing
R18836 T26588 T26608 themeOf SerpinB2 promoter-luciferase reporter,co-transfected
R18837 T26593 T26609 themeOf C/EBP-β,Phosphorylation
R18838 T26596 T26610 themeOf C/EBP-β,expression
R18839 T26602 T26611 themeOf C/EBP-β phospho-acceptor mutants,expression
R18840 T26604 T26612 themeOf C/EBP-β,express
R694 T601 T621 causeOf C/EBP-β,Mediates
R715 T602 T620 themeOf SerpinB2,Transcription
R717 T604 T622 themeOf plasminogen activator inhibitor type 2,induced
R718 T606 T623 themeOf SerpinB2,expression
R720 T607 T624 causeOf toll-like receptor 4,induce
R722 T613 T625 themeOf C/EBP-β,formation
R725 T614 T626 themeOf SerpinB2,induces
R726 T614 T625 themeOf SerpinB2,formation
R732 T620 T621 themeOf Transcription,Mediates
R733 T623 T624 themeOf expression,induce
R734 T625 T626 themeOf formation,induces
R735 T625 T626 themeOf formation,induces
R737 T631 T629 themeOf expression,abrogated
R727 T615 T631 themeOf SerpinB2,expression
R729 T616 T627 themeOf C/EBP-β,null
R730 T617 T628 themeOf C/EBP-β,deficient
R731 T619 T632 themeOf SerpinB2,expression
R736 T628 T629 causeOf deficient,abrogated
R740 T631 T630 themeOf expression,LPS-induced
R741 T632 T633 themeOf expression,regulation
R742 T632 T634 themeOf expression,inflammation-associated
R1506 T2216 T2240 themeOf urokinase-type plasminogen activator,inhibitor
R1507 T2217 T2240 themeOf uPA,inhibitor
R1509 T2218 T2241 themeOf plasminogen,activation
R1514 T2231 T2249 themeOf SerpinB2,bind
R1515 T2225 T2245 themeOf TLR4,binding
R1516 T2226 T2247 themeOf SerpinB2,expression
R1517 T2226 T2248 causeOf SerpinB2,upregulated
R1518 T2228 T2250 themeOf SerpinB2,regulated
R1519 T2232 T2252 themeOf SerpinB2,induction
R1520 T2234 T2257 themeOf C/EBP-β,deficiency
R1521 T2247 T2248 themeOf expression,upregulated
R1522 T2234 T2256 causeOf C/EBP-β,abrogated
R1523 T2234 T2256 causeOf C/EBP-β,abrogated
R1524 T2234 T2254 themeOf C/EBP-β,bound
R1525 T2235 T2258 themeOf SerpinB2,expression
R1526 T2252 T2251 themeOf induction,dependent
R1527 T2252 T2253 themeOf induction,dependent
R1528 T2254 T2256 causeOf bound,abrogated
R1529 T2254 T2256 causeOf bound,abrogated
R1530 T2236 T2255 themeOf SerpinB2,induction
R1531 T2238 T2260 themeOf SerpinB2,LPS-induced
R1532 T2255 T2256 themeOf induction,abrogated
R1533 T2255 T2256 themeOf induction,abrogated
R1534 T2255 T2256 themeOf induction,abrogated
R1535 T2257 T2256 causeOf deficiency,abrogated
R1536 T2257 T2256 causeOf deficiency,abrogated
R1537 T2258 T2256 themeOf expression,abrogated
R1538 T2258 T2256 themeOf expression,abrogated
R1539 T2258 T2256 themeOf expression,abrogated
R1540 T2239 T2261 themeOf SerpinB2,regulation
R1541 T2260 T2259 themeOf LPS-induced,regulate
R1542 T2245 T2246 themeOf binding,leads
R1511 T2219 T2242 themeOf SerpinB2,requires
R1512 T2219 T2243 themeOf SerpinB2,secreted
R1513 T2222 T2244 themeOf SerpinB2,regulated
R3285 T4456 T4460 themeOf GST-murine SerpinB2 fusion protein,produced
R4493 T6295 T6300 themeOf C/EBP-β,co-transfected
R4957 T6889 T6891 themeOf C/EBP-β,knockdown
R4958 T6889 T6892 themeOf C/EBP-β,expression
R4959 T6890 T6893 themeOf C/EBP-β,knockdown
R4960 T6892 T6891 themeOf expression,knockdown
R5392 T7532 T7546 themeOf Cebpb,transfected
R5393 T7536 T7547 themeOf S64A,co-transfected
R5394 T7537 T7547 themeOf C/EBP-β,co-transfected
R5395 T7539 T7547 themeOf T188A,co-transfected
R5396 T7540 T7547 themeOf T217A,co-transfected
R5397 T7545 T7548 themeOf C/EBP-β phospho-acceptor mutant,Expression
R6760 T9223 T9228 themeOf SerpinB2,expression
R6761 T9224 T9229 themeOf SerpinB2,expression
R6762 T9225 T9231 themeOf SerpinB2,expression
R6763 T9228 T9226 themeOf expression,induction
R6764 T9228 T9227 themeOf expression,LPS-inducible
R6765 T9229 T9230 themeOf expression,LPS-induced
R6766 T9231 T9232 themeOf expression,induced
R7280 T9930 T9937 themeOf SerpinB2,regulation
R7281 T9932 T9939 themeOf SerpinB2,Deletion
R7282 T9936 T9940 themeOf SerpinB2,deletion
R7283 T9937 T9938 themeOf regulation,PMA-induced
R8000 T10879 T10888 themeOf SerpinB2,transcription
R8001 T10881 T10891 themeOf SerpinB2,expression
R8002 T10886 T10893 themeOf Oct-1,binding
R8003 T10887 T10893 themeOf PU.1,binding
R8004 T10888 T10889 themeOf transcription,mediate
R8005 T10890 T10892 themeOf regulation,role
R8006 T10891 T10890 themeOf expression,regulation
R8816 T11919 T11928 themeOf SerpinB2 promoter-luciferase reporter gene,binding
R8817 T11921 T11929 themeOf SerpinB2,activation
R8818 T11925 T11930 themeOf luciferase,reduced
R9981 T13497 T13510 themeOf C/EBP-β,LPS-induced
R9982 T13497 T13509 themeOf C/EBP-β,Binds
R10586 T14385 T14405 causeOf C/EBP-β,Mediates
R14728 T20515 T20587 themeOf SerpinB2,transcription
R14730 T20518 T20590 themeOf SerpinB2,transcription
R14731 T20519 T20591 themeOf C/EBP-β,LPS-induced
R14732 T20519 T20588 themeOf C/EBP-β,bind
R14733 T20520 T20588 themeOf SerpinB2,bind
R14734 T20521 T20589 themeOf C/EBP-β,loss
R14735 T20524 T20592 themeOf SERPINB2,transcription
R14736 T20526 T20593 themeOf SerpinB2,transcription
R14777 T20578 T20638 themeOf SerpinB2,transcription
R14778 T20580 T20640 themeOf SerpinB2,expression
R14779 T20582 T20641 themeOf SerpinB2,expression
R14782 T20593 T20595 themeOf transcription,mediating
R14783 T20593 T20594 themeOf transcription,PMA-inducible
R14800 T20638 T20637 themeOf transcription,LPS-induced
R14801 T20640 T20639 themeOf expression,LPS-induced
R14802 T20641 T20643 themeOf expression,regulation
R14803 T20641 T20642 themeOf expression,inflammation-associated
R16252 T22527 T22533 themeOf SerpinB2,induction
R16253 T22527 T22532 themeOf SerpinB2,expression
R16254 T22530 T22534 themeOf SerpinB2,expression
R16255 T22532 T22533 themeOf expression,induction
R16581 T23010 T23014 themeOf SerpinB2 promoter-luciferase reporter,transfected
R17237 T23968 T23970 themeOf SerpinB2 promoter-luciferase reporter,transfected
R17413 T24269 T24276 themeOf SerpinB2,binding
R17843 T24909 T24923 causeOf C/EBP-β,essential

DLUT931

Id Subject Object Predicate Lexical cue
T26514 36944-36952 Protein denotes SerpinB2
T26513 36919-36926 Protein denotes C/EBP-β
T25629 35656-35667 Binding denotes Recruitment
T25628 34937-34948 Binding denotes recruitment
T25627 36034-36038 Protein denotes rIgG
T25626 35957-35973 Protein denotes p-C/EBP-β (T217)
T25625 35948-35955 Protein denotes C/EBP-β
T25624 35685-35693 Protein denotes SerpinB2
T25623 35568-35576 Protein denotes SerpinB2
T25622 35429-35445 Protein denotes p-C/EBP-β (T217)
T25621 35420-35427 Protein denotes C/EBP-β
T25620 35324-35340 Protein denotes p-C/EBP-β (T217)
T25619 35313-35320 Protein denotes C/EBP-β
T25618 35055-35063 Protein denotes SerpinB2
T25617 34990-34998 Protein denotes SerpinB2
T25616 34952-34959 Protein denotes C/EBP-β
T25630 35733-35742 Positive_regulation denotes following
T24908 33025-33035 Transcription denotes expression
T24907 32877-32886 Negative_regulation denotes knockdown
T24906 32712-32718 Regulation denotes target
T24905 32483-32492 Negative_regulation denotes deficient
T24904 32462-32471 Negative_regulation denotes abrogated
T24903 32448-32458 Gene_expression denotes expression
T24902 32305-32315 Transcription denotes expression
T24901 32178-32187 Negative_regulation denotes abrogated
T24900 32164-32174 Transcription denotes expression
T24899 32097-32108 Positive_regulation denotes LPS-induced
T24898 32066-32075 Positive_regulation denotes essential
T24897 32123-32133 Transcription denotes expression
T24896 33011-33019 Protein denotes SerpinB2
T24895 32901-32908 Protein denotes C/EBP-β
T24894 32730-32735 Protein denotes Cebpb
T24893 32439-32447 Protein denotes SerpinB2
T24892 32475-32482 Protein denotes C/EBP-β
T24891 32342-32347 Protein denotes Cebpb
T24890 32329-32334 Protein denotes Cebpb
T24889 32291-32299 Protein denotes SerpinB2
T24888 32217-32222 Protein denotes Cebpb
T24887 32191-32196 Protein denotes Cebpb
T24886 32150-32158 Protein denotes SerpinB2
T24885 32109-32117 Protein denotes SerpinB2
T24884 32055-32062 Protein denotes C/EBP-β
T24261 28717-28724 Binding denotes binding
T24260 29173-29181 Protein denotes SerpinB2
T24259 29084-29091 Protein denotes albumin
T24258 29045-29052 Protein denotes albumin
T24257 28976-28984 Protein denotes SerpinB2
T24256 28920-28928 Protein denotes SerpinB2
T22993 20993-21030 Protein denotes SerpinB2 promoter-luciferase reporter
T22992 20881-20889 Protein denotes SerpinB2
T22991 20689-20699 Protein denotes luciferase
T22990 20546-20599 Protein denotes SerpinB2 promoter and 5′ deletion luciferase reporter
T22989 20484-20492 Protein denotes SerpinB2
T22519 18537-18547 Gene_expression denotes expression
T22518 18213-18223 Gene_expression denotes expression
T22517 18174-18183 Positive_regulation denotes induction
T22516 18593-18598 Protein denotes GAPDH
T22515 18520-18528 Protein denotes SerpinB2
T22514 18392-18399 Protein denotes β-actin
T22513 18358-18366 Protein denotes SerpinB2
T22512 18187-18195 Protein denotes SerpinB2
T20426 47188-47198 Regulation denotes regulation
T20425 47202-47225 Positive_regulation denotes inflammation-associated
T20424 47240-47250 Gene_expression denotes expression
T20423 47060-47064 Regulation denotes role
T20422 47094-47104 Regulation denotes regulating
T20421 46964-46975 Positive_regulation denotes LPS-induced
T20420 46947-46959 Positive_regulation denotes constitutive
T20419 46990-47000 Gene_expression denotes expression
T20418 46649-46660 Positive_regulation denotes LPS-induced
T20417 46661-46674 Transcription denotes transcription
T20416 46139-46149 Binding denotes associated
T20415 46119-46129 Gene_expression denotes expression
T20414 45686-45703 Phosphorylation denotes dephosphorylation
T20413 45539-45550 Positive_regulation denotes LPS-induced
T20412 45580-45588 Positive_regulation denotes increase
T20411 45551-45564 Transcription denotes transcription
T20410 45406-45420 Phosphorylation denotes phosphorylated
T20409 45330-45341 Positive_regulation denotes LPS-induced
T20408 45320-45329 Regulation denotes regulates
T20407 45275-45290 Phosphorylation denotes phosphorylation
T20406 45219-45230 Positive_regulation denotes LPS-induced
T20405 45210-45218 Positive_regulation denotes enhanced
T20404 45170-45180 Gene_expression denotes expression
T20403 45009-45019 Gene_expression denotes expression
T20402 44958-44968 Regulation denotes regulation
T20401 44986-44996 Gene_expression denotes expression
T20400 44823-44831 Negative_regulation denotes decrease
T20399 44755-44766 Binding denotes recruitment
T20398 44666-44674 Positive_regulation denotes increase
T20397 44574-44584 Gene_expression denotes expression
T20396 44373-44387 Phosphorylation denotes phosphorylated
T20395 44226-44241 Phosphorylation denotes Phosphorylation
T20394 44120-44130 Regulation denotes regulation
T20393 44148-44158 Gene_expression denotes expression
T20392 43944-43948 Negative_regulation denotes null
T20391 43737-43748 Positive_regulation denotes LPS-induced
T20390 43717-43721 Regulation denotes role
T20389 43763-43773 Gene_expression denotes expression
T20388 43650-43654 Binding denotes bind
T20387 43325-43338 Positive_regulation denotes LPS-inducible
T20386 43498-43511 Transcription denotes transcription
T20385 43381-43390 Negative_regulation denotes abrogated
T20384 43353-43363 Transcription denotes expression
T20383 43197-43205 Negative_regulation denotes impaired
T20382 43135-43144 Negative_regulation denotes deficient
T20381 43114-43123 Positive_regulation denotes induction
T20380 42982-42993 Positive_regulation denotes LPS-induced
T20379 42944-42955 Positive_regulation denotes requirement
T20378 43008-43021 Transcription denotes transcription
T20377 42857-42870 Transcription denotes transcription
T20376 42717-42725 Binding denotes interact
T20375 42597-42609 Binding denotes interactions
T20374 41997-42010 Positive_regulation denotes PMA-inducible
T20373 41987-41996 Positive_regulation denotes mediating
T20372 42011-42024 Transcription denotes transcription
T20371 41802-41815 Transcription denotes transcription
T20370 41522-41530 Positive_regulation denotes mediated
T20369 41378-41390 Positive_regulation denotes constitutive
T20368 41368-41377 Negative_regulation denotes abrogates
T20367 41405-41418 Transcription denotes transcription
T20366 41352-41356 Negative_regulation denotes loss
T20365 41260-41264 Binding denotes bind
T20364 41214-41225 Positive_regulation denotes LPS-induced
T20363 41190-41199 Positive_regulation denotes dependent
T20362 41131-41140 Positive_regulation denotes conferred
T20361 41095-41108 Transcription denotes transcription
T20360 40961-40968 Positive_regulation denotes induced
T20359 40876-40883 Positive_regulation denotes massive
T20358 40867-40875 Positive_regulation denotes involves
T20357 40884-40893 Positive_regulation denotes induction
T20356 47226-47234 Protein denotes SerpinB2
T20355 47105-47113 Protein denotes SerpinB2
T20354 46976-46984 Protein denotes SerpinB2
T20353 46891-46899 Protein denotes SerpinB2
T20352 46682-46690 Protein denotes SerpinB2
T20351 46582-46589 Protein denotes C/EBP-β
T20350 46421-46428 Protein denotes C/EBP-β
T20349 46287-46295 Protein denotes SerpinB2
T20348 46110-46118 Protein denotes SerpinB2
T20347 45799-45803 Protein denotes MLK3
T20346 45737-45741 Protein denotes IFNγ
T20345 45707-45714 Protein denotes C/EBP-β
T20344 45673-45677 Protein denotes MLK3
T20343 45649-45671 Protein denotes Mixed lineage kinase-3
T20342 45568-45576 Protein denotes SerpinB2
T20341 45376-45383 Protein denotes C/EBP-β
T20340 45342-45350 Protein denotes SerpinB2
T20339 45294-45301 Protein denotes C/EBP-β
T20338 45231-45239 Protein denotes SerpinB2
T20337 45184-45195 Protein denotes C/EBP-βS64A
T20336 45094-45102 Protein denotes SerpinB2
T20335 45065-45077 Protein denotes C/EBP-βT188A
T20334 45027-45063 Protein denotes C/EBP-β phospho-acceptor site mutant
T20333 44972-44980 Protein denotes SerpinB2
T20332 44789-44797 Protein denotes SerpinB2
T20331 44734-44741 Protein denotes C/EBP-β
T20330 44675-44683 Protein denotes SerpinB2
T20329 44644-44649 Protein denotes Cebpb
T20328 44628-44639 Protein denotes C/EBPβT217A
T20327 44590-44626 Protein denotes C/EBP-β phospho-acceptor site mutant
T20326 44550-44558 Protein denotes SerpinB2
T20325 44365-44372 Protein denotes C/EBP-β
T20324 44245-44252 Protein denotes C/EBP-β
T20323 44162-44169 Protein denotes C/EBP-β
T20322 44134-44142 Protein denotes SerpinB2
T20321 44008-44016 Protein denotes SerpinB2
T20320 43936-43943 Protein denotes C/EBP-β
T20319 43789-43797 Protein denotes SerpinB2
T20318 43775-43782 Protein denotes C/EBP-β
T20317 43749-43757 Protein denotes SerpinB2
T20316 43726-43733 Protein denotes C/EBP-β
T20315 43659-43667 Protein denotes SerpinB2
T20314 43599-43606 Protein denotes C/EBP-β
T20313 43484-43492 Protein denotes SerpinB2
T20312 43472-43479 Protein denotes C/EBP-β
T20311 43339-43347 Protein denotes SerpinB2
T20310 43179-43183 Protein denotes IFNγ
T20309 43127-43134 Protein denotes C/EBP-β
T20308 43103-43107 Protein denotes gene
T20307 43076-43084 Protein denotes SerpinB2
T20306 42994-43002 Protein denotes SerpinB2
T20305 42912-42919 Protein denotes C/EBP-β
T20304 42878-42885 Protein denotes C/EBP-β
T20303 42677-42684 Protein denotes C/EBP-β
T20302 42618-42625 Protein denotes C/EBP-β
T20301 42181-42189 Protein denotes SerpinB2
T20300 42039-42047 Protein denotes SerpinB2
T20299 41880-41888 Protein denotes SerpinB2
T20298 41829-41837 Protein denotes SERPINB2
T20297 41682-41690 Protein denotes SerpinB2
T20296 41455-41463 Protein denotes SerpinB2
T20295 41360-41367 Protein denotes C/EBP-β
T20294 41299-41307 Protein denotes SerpinB2
T20293 41226-41233 Protein denotes C/EBP-β
T20292 41391-41399 Protein denotes SerpinB2
T20291 41205-41212 Protein denotes C/EBP-β
T20290 41148-41156 Protein denotes SerpinB2
T20289 41081-41089 Protein denotes SerpinB2
T20288 40995-40999 Protein denotes IKKβ
T20287 40931-40939 Protein denotes SerpinB2
T20286 40921-40929 Protein denotes SerpinB2
T17292 40550-40558 Regulation denotes regulate
T17291 40497-40512 Phosphorylation denotes phosphorylation
T17290 40397-40408 Negative_regulation denotes potentiated
T17289 40371-40381 Gene_expression denotes expression
T17288 40341-40352 Gene_expression denotes transfected
T17287 40250-40261 Gene_expression denotes transfected
T17286 40203-40207 Regulation denotes role
T17285 40225-40235 Gene_expression denotes expression
T17284 39976-39985 Regulation denotes regulated
T17283 39957-39964 Positive_regulation denotes induced
T17282 39870-39881 Positive_regulation denotes LPS-induced
T17281 39882-39895 Transcription denotes transcription
T17280 39736-39746 Regulation denotes regulation
T17279 39705-39714 Positive_regulation denotes inducible
T17278 39679-39689 Regulation denotes regulating
T17277 39611-39620 Regulation denotes dependent
T17276 39592-39602 Regulation denotes modulating
T17275 39635-39648 Transcription denotes transcription
T17274 39403-39409 Regulation denotes factor
T17273 39353-39368 Phosphorylation denotes phosphorylation
T17272 39251-39259 Positive_regulation denotes increase
T17271 39148-39158 Gene_expression denotes Expression
T17270 39107-39118 Positive_regulation denotes LPS-induced
T17269 39082-39092 Positive_regulation denotes importance
T17268 38960-38970 Positive_regulation denotes stimulated
T17267 39133-39146 Transcription denotes transcription
T17266 39005-39015 Gene_expression denotes expression
T17265 38894-38907 Gene_expression denotes Re-expression
T17264 38792-38799 Negative_regulation denotes mutated
T17263 38684-38696 Gene_expression denotes co-expressed
T17262 38571-38586 Phosphorylation denotes phosphorylation
T17261 38503-38511 Regulation denotes modulate
T17260 38454-38469 Phosphorylation denotes Phosphorylation
T17259 38412-38426 Positive_regulation denotes LPS-stimulated
T17258 38402-38411 Regulation denotes Regulates
T17257 38351-38366 Phosphorylation denotes Phosphorylation
T17256 40559-40567 Protein denotes SerpinB2
T17255 40516-40523 Protein denotes C/EBP-β
T17254 40409-40417 Protein denotes SerpinB2
T17253 40385-40396 Protein denotes C/EBP-βS64A
T17252 40333-40340 Protein denotes C/EBP-β
T17251 40277-40285 Protein denotes SerpinB2
T17250 40237-40249 Protein denotes C/EBP-βT188A
T17249 40211-40219 Protein denotes SerpinB2
T17248 40129-40137 Protein denotes SerpinB2
T17247 40117-40124 Protein denotes C/EBP-β
T17246 39945-39953 Protein denotes SerpinB2
T17245 39922-39927 Protein denotes MCP-1
T17244 39913-39917 Protein denotes IL-6
T17243 39802-39810 Protein denotes SerpinB2
T17242 39715-39719 Protein denotes gene
T17241 39700-39704 Protein denotes IFNγ
T17240 39690-39695 Protein denotes DAPK1
T17239 39621-39629 Protein denotes SerpinB2
T17238 39603-39610 Protein denotes C/EBP-β
T17237 39478-39485 Protein denotes C/EBP-β
T17236 39431-39439 Protein denotes SerpinB2
T17235 39372-39379 Protein denotes C/EBP-β
T17234 39311-39318 Protein denotes C/EBP-β
T17233 39260-39268 Protein denotes SerpinB2
T17232 39215-39220 Protein denotes Cebpb
T17231 39199-39210 Protein denotes C/EBPβT217A
T17230 39166-39197 Protein denotes C/EBP-β phospho-acceptor mutant
T17229 38921-38928 Protein denotes C/EBP-β
T17228 39119-39127 Protein denotes SerpinB2
T17227 39096-39103 Protein denotes C/EBP-β
T17226 38971-38999 Protein denotes SerpinB2 luciferase reporter
T17225 38932-38937 Protein denotes Cebpb
T17224 38879-38884 Protein denotes Cebpb
T17223 38847-38875 Protein denotes SerpinB2 luciferase reporter
T17222 38705-38737 Protein denotes C/EBP-β phospho-acceptor mutants
T17221 38634-38642 Protein denotes SerpinB2
T17220 38563-38570 Protein denotes C/EBP-β
T17219 38473-38480 Protein denotes C/EBP-β
T17218 38427-38435 Protein denotes SerpinB2
T17217 38370-38377 Protein denotes C/EBP-β
T15985 36826-36837 Positive_regulation denotes LPS-induced
T15984 36737-36746 Negative_regulation denotes abrogated
T15983 36706-36715 Positive_regulation denotes increased
T15982 36314-36323 Positive_regulation denotes essential
T15981 36343-36356 Transcription denotes transcription
T15980 36160-36165 Binding denotes binds
T15979 36089-36102 Positive_regulation denotes LPS-inducible
T15978 36838-36846 Protein denotes SerpinB2
T15977 36802-36809 Protein denotes C/EBP-β
T15976 36750-36755 Protein denotes Cebpb
T15975 36719-36724 Protein denotes Cebpb
T15974 36661-36669 Protein denotes SerpinB2
T15973 36560-36588 Protein denotes SerpinB2 luciferase reporter
T15972 36480-36488 Protein denotes SerpinB2
T15971 36439-36446 Protein denotes C/EBP-β
T15970 36617-36622 Protein denotes Cebpb
T15969 36604-36609 Protein denotes Cebpb
T15968 36366-36374 Protein denotes SerpinB2
T15967 36299-36306 Protein denotes C/EBP-β
T15966 36173-36181 Protein denotes SerpinB2
T15965 36152-36159 Protein denotes C/EBP-β
T15964 36110-36118 Protein denotes SerpinB2
T15963 36072-36079 Protein denotes C/EBP-β
T15233 34809-34818 Positive_regulation denotes increased
T15232 34793-34804 Positive_regulation denotes responsible
T15231 34819-34832 Transcription denotes transcription
T15230 34754-34773 Phosphorylation denotes T217-phosphorylated
T15229 34723-34734 Binding denotes recruitment
T15228 34574-34584 Negative_regulation denotes diminished
T15227 34505-34512 Binding denotes binding
T15226 34374-34379 Binding denotes bound
T15225 34095-34101 Regulation denotes affect
T15224 34049-34056 Regulation denotes changes
T15223 34242-34256 Phosphorylation denotes phosphorylated
T15222 34184-34195 Binding denotes recruitment
T15221 34068-34083 Phosphorylation denotes phosphorylation
T15220 33867-33878 Binding denotes association
T15219 33362-33373 Binding denotes recruitment
T15218 33234-33239 Binding denotes Binds
T15217 34842-34850 Protein denotes SerpinB2
T15216 34774-34781 Protein denotes C/EBP-β
T15215 34709-34722 Protein denotes p-C/EBP-βT217
T15214 34697-34704 Protein denotes C/EBP-β
T15213 34547-34555 Protein denotes SerpinB2
T15212 34525-34538 Protein denotes p-C/EBP-βT217
T15211 34492-34499 Protein denotes C/EBP-β
T15210 34387-34395 Protein denotes SerpinB2
T15209 34341-34354 Protein denotes p-C/EBP-βT217
T15208 34102-34109 Protein denotes C/EBP-β
T15207 34060-34067 Protein denotes C/EBP-β
T15206 34274-34287 Protein denotes p-C/EBP-βT217
T15205 34257-34264 Protein denotes C/EBP-β
T15204 34203-34211 Protein denotes SerpinB2
T15203 33826-33834 Protein denotes SerpinB2
T15202 33785-33792 Protein denotes C/EBP-β
T15201 33691-33699 Protein denotes SerpinB2
T15200 33388-33396 Protein denotes SerpinB2
T15199 33354-33361 Protein denotes C/EBP-β
T15198 33251-33259 Protein denotes SerpinB2
T15197 33226-33233 Protein denotes C/EBP-β
T14359 31954-31967 Positive_regulation denotes LPS-inducible
T14358 31927-31936 Positive_regulation denotes mediating
T14357 31968-31981 Transcription denotes transcription
T14356 31753-31764 Positive_regulation denotes LPS-induced
T14355 31736-31748 Positive_regulation denotes constitutive
T14354 31829-31838 Negative_regulation denotes deficient
T14353 31808-31817 Negative_regulation denotes decreased
T14352 31779-31789 Transcription denotes expression
T14351 31635-31642 Negative_regulation denotes knocked
T14350 31643-31647 Negative_regulation denotes down
T14349 31620-31630 Gene_expression denotes expression
T14348 31305-31315 Positive_regulation denotes stimulated
T14347 31393-31407 Positive_regulation denotes LPS-stimulated
T14346 31319-31327 Positive_regulation denotes increase
T14345 31451-31459 Positive_regulation denotes dampened
T14344 31422-31432 Transcription denotes expression
T14343 31345-31355 Transcription denotes expression
T14342 31264-31274 Positive_regulation denotes endogenous
T14341 31253-31263 Negative_regulation denotes attenuated
T14340 31289-31299 Transcription denotes expression
T14339 31234-31241 Negative_regulation denotes absence
T14338 31192-31195 Positive_regulation denotes low
T14337 31184-31191 Gene_expression denotes express
T14336 30956-30966 Positive_regulation denotes importance
T14335 31141-31148 Gene_expression denotes express
T14334 31057-31061 Negative_regulation denotes null
T14333 31006-31016 Transcription denotes expression
T14332 30855-30866 Positive_regulation denotes LPS-induced
T14331 30838-30850 Positive_regulation denotes Constitutive
T14330 30824-30832 Positive_regulation denotes Mediates
T14329 30881-30891 Transcription denotes Expression
T14328 31996-32004 Protein denotes SerpinB2
T14327 31903-31910 Protein denotes C/EBP-β
T14326 31821-31828 Protein denotes C/EBP-β
T14325 31765-31773 Protein denotes SerpinB2
T14324 31612-31619 Protein denotes C/EBP-β
T14323 31463-31468 Protein denotes Cebpb
T14322 31408-31416 Protein denotes SerpinB2
T14321 31331-31339 Protein denotes SerpinB2
T14320 31217-31225 Protein denotes SerpinB2
T14319 31275-31283 Protein denotes SerpinB2
T14318 31245-31252 Protein denotes C/EBP-β
T14317 31160-31167 Protein denotes C/EBP-β
T14316 31094-31099 Protein denotes Cebpb
T14315 31063-31068 Protein denotes Cebpb
T14314 31049-31056 Protein denotes C/EBP-β
T14313 30992-31000 Protein denotes SerpinB2
T14312 30970-30977 Protein denotes C/EBP-β
T14311 30867-30875 Protein denotes SerpinB2
T14310 30816-30823 Protein denotes C/EBP-β
T13484 29591-29596 Binding denotes Binds
T13483 30806-30813 Protein denotes C/EBP-β
T13482 30630-30637 Protein denotes C/EBP-β
T13481 30391-30398 Protein denotes C/EBP-δ
T13480 30382-30389 Protein denotes C/EBP-β
T13479 30373-30380 Protein denotes C/EBP-α
T13478 30403-30410 Protein denotes C/EBP-ε
T13477 29979-29986 Protein denotes C/EBP-ε
T13476 29967-29974 Protein denotes C/EBP-δ
T13475 29958-29965 Protein denotes C/EBP-β
T13474 29949-29956 Protein denotes C/EBP-α
T13473 29625-29633 Protein denotes SerpinB2
T13472 29546-29553 Protein denotes C/EBP-β
T12708 28529-28534 Binding denotes binds
T12707 28496-28504 Protein denotes SerpinB2
T12706 28341-28348 Protein denotes albumin
T12705 27698-27705 Protein denotes albumin
T12704 27614-27622 Protein denotes SerpinB2
T12703 27565-27573 Protein denotes SerpinB2
T11917 26922-26935 Positive_regulation denotes LPS-inducible
T11916 26914-26921 Negative_regulation denotes reduced
T11915 25505-25516 Positive_regulation denotes LPS-induced
T11914 25517-25527 Positive_regulation denotes activation
T11913 25008-25015 Binding denotes binding
T11912 27138-27146 Protein denotes SerpinB2
T11911 26972-26980 Protein denotes SerpinB2
T11910 26936-26946 Protein denotes luciferase
T11909 26755-26763 Protein denotes SerpinB2
T11908 26598-26606 Protein denotes SERPINB2
T11907 26506-26514 Protein denotes SerpinB2
T11906 25535-25543 Protein denotes SerpinB2
T11905 25411-25419 Protein denotes SerpinB2
T11904 25040-25082 Protein denotes SerpinB2 promoter-luciferase reporter gene
T11903 24603-24611 Protein denotes SerpinB2
T10877 23520-23527 Binding denotes binding
T10876 22321-22325 Regulation denotes role
T10875 22333-22343 Regulation denotes regulation
T10874 22361-22371 Gene_expression denotes expression
T10873 22052-22059 Positive_regulation denotes mediate
T10872 22060-22073 Transcription denotes transcription
T10871 23538-23542 Protein denotes PU.1
T10870 23559-23564 Protein denotes Oct-1
T10869 23370-23378 Protein denotes SERPINB2
T10868 23005-23013 Protein denotes SERPINB2
T10867 22813-22821 Protein denotes SerpinB2
T10866 22758-22766 Protein denotes SerpinB2
T10865 22347-22355 Protein denotes SerpinB2
T10864 22159-22167 Protein denotes SerpinB2
T10863 22088-22096 Protein denotes SerpinB2
T10862 21971-21979 Protein denotes SerpinB2
T9913 19988-19996 Regulation denotes affected
T9912 19633-19642 Positive_regulation denotes increased
T9911 19572-19580 Negative_regulation denotes Deletion
T9910 20037-20045 Protein denotes SerpinB2
T9909 20296-20304 Protein denotes SerpinB2
T9908 20156-20164 Protein denotes SerpinB2
T9907 19955-19963 Protein denotes SerpinB2
T9906 19595-19603 Protein denotes SerpinB2
T9905 19428-19436 Protein denotes SerpinB2
T9904 19195-19203 Protein denotes SerpinB2
T9903 19104-19114 Protein denotes luciferase
T9902 18941-18951 Protein denotes luciferase
T9901 18784-18792 Protein denotes SerpinB2
T9900 18626-18634 Protein denotes SerpinB2
T9914 20021-20029 Negative_regulation denotes deletion
T9212 18017-18024 Positive_regulation denotes induced
T9211 17997-18007 Gene_expression denotes expression
T9210 17848-17859 Positive_regulation denotes LPS-induced
T9209 17869-17879 Gene_expression denotes expression
T9208 17691-17704 Positive_regulation denotes LPS-inducible
T9207 17678-17687 Positive_regulation denotes induction
T9206 17719-17729 Transcription denotes expression
T9205 17552-17556 Transcription denotes mRNA
T9204 17478-17488 Positive_regulation denotes Responsive
T9203 17980-17988 Protein denotes SerpinB2
T9202 17860-17868 Protein denotes SerpinB2
T9201 17705-17713 Protein denotes SerpinB2
T9200 17543-17551 Protein denotes SerpinB2
T9199 17454-17462 Protein denotes SerpinB2
T8563 17108-17116 Protein denotes SerpinB2
T8562 16889-16901 Protein denotes Proteinase K
T8561 16719-16728 Protein denotes Protein G
T8013 14970-14994 Protein denotes T4 polynucleotide kinase
T7514 14727-14737 Gene_expression denotes Expression
T7513 14397-14411 Gene_expression denotes co-transfected
T7512 14745-14776 Protein denotes C/EBP-β phospho-acceptor mutant
T7511 14556-14571 Protein denotes β-Galactosidase
T7510 14528-14538 Protein denotes Luciferase
T7509 14497-14512 Protein denotes β-galactosidase
T7508 14436-14446 Protein denotes Luciferase
T7507 14351-14356 Protein denotes T217A
T7506 14344-14349 Protein denotes T188A
T7505 14310-14342 Protein denotes C/EBP-β phospho-acceptor mutants
T7504 14299-14306 Protein denotes C/EBP-β
T7503 14358-14362 Protein denotes S64A
T7502 13971-13986 Protein denotes β-galactosidase
T7501 13963-13970 Protein denotes β-actin
T7500 13913-13923 Protein denotes luciferase
T7499 13849-13854 Protein denotes Cebpb
T7498 11300-11310 Protein denotes Luciferase
T6881 13741-13750 Negative_regulation denotes knockdown
T6880 12888-12897 Negative_regulation denotes knockdown
T6879 12898-12908 Gene_expression denotes expression
T6878 13733-13740 Protein denotes C/EBP-β
T6877 12923-12930 Protein denotes C/EBP-β
T6876 12802-12807 Protein denotes cebpb
T6875 12740-12745 Protein denotes cebpb
T6277 12457-12471 Gene_expression denotes co-transfected
T6276 12390-12400 Protein denotes luciferase
T6275 12379-12381 Protein denotes TK
T6274 12331-12341 Protein denotes luciferase
T6273 12500-12502 Protein denotes TK
T6272 12472-12479 Protein denotes C/EBP-β
T6271 12149-12159 Protein denotes Luciferase
T6270 12103-12113 Protein denotes Luciferase
T6269 11495-11497 Protein denotes TK
T6268 11477-11493 Protein denotes thymidine kinase
T6267 11422-11432 Protein denotes luciferase
T6266 11300-11310 Protein denotes Luciferase
T5268 9041-9053 Positive_regulation denotes Construction
T5267 11194-11202 Protein denotes SerpinB2
T5266 11061-11066 Protein denotes Xho I
T5265 11050-11056 Protein denotes EcoR I
T5264 10259-10267 Protein denotes SerpinB2
T5263 10200-10219 Protein denotes Luciferase reporter
T5262 10027-10035 Protein denotes SerpinB2
T5261 9783-9790 Protein denotes Bsu36 I
T5260 9775-9781 Protein denotes BstX I
T5259 9768-9773 Protein denotes Apa I
T5258 9761-9766 Protein denotes Sfi I
T5257 9721-9727 Protein denotes EcoR I
T5256 9552-9580 Protein denotes SerpinB2 luciferase reporter
T5255 9944-9957 Protein denotes T4 DNA ligase
T5254 9883-9900 Protein denotes T4 DNA polymerase
T5253 9811-9816 Protein denotes Apo I
T5252 9799-9806 Protein denotes Hae III
T5251 9792-9797 Protein denotes Pac I
T5250 9459-9467 Protein denotes SerpinB2
T5249 9241-9249 Protein denotes SerpinB2
T5248 9057-9079 Protein denotes SerpinB2 Reporter Gene
T4455 8806-8814 Gene_expression denotes produced
T4454 8982-8987 Protein denotes GAPDH
T4453 8940-8980 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4452 8893-8900 Protein denotes C/EBP-β
T4451 8771-8805 Protein denotes GST-murine SerpinB2 fusion protein
T4016 8004-8012 Protein denotes SerpinB2
T4015 7369-7384 Protein denotes exonuclease III
T4014 7164-7172 Protein denotes SerpinB2
T3684 7064-7071 Protein denotes β-actin
T3683 7038-7043 Protein denotes Cebpb
T3682 7012-7020 Protein denotes SerpinB2
T3681 7003-7011 Protein denotes Serpinb2
T3291 5807-5812 Protein denotes Cebpb
T3290 5783-5788 Protein denotes Cebpb
T2180 5326-5336 Regulation denotes regulation
T2179 5207-5215 Regulation denotes regulate
T2178 5216-5227 Positive_regulation denotes LPS-induced
T2177 5074-5086 Positive_regulation denotes constitutive
T2176 5120-5129 Positive_regulation denotes induction
T2175 5096-5106 Gene_expression denotes expression
T2174 5018-5023 Binding denotes bound
T2173 4974-4981 Binding denotes binding
T2172 4805-4814 Positive_regulation denotes dependent
T2171 4780-4789 Positive_regulation denotes induction
T2170 4713-4717 Binding denotes bind
T2169 4411-4420 Regulation denotes regulated
T2168 4265-4276 Positive_regulation denotes upregulated
T2167 4250-4260 Gene_expression denotes expression
T2166 3886-3891 Positive_regulation denotes leads
T2165 3833-3840 Binding denotes binding
T2164 3295-3304 Regulation denotes regulated
T2163 2948-2956 Localization denotes secreted
T2162 2924-2932 Positive_regulation denotes requires
T2161 2874-2884 Positive_regulation denotes activation
T2160 2809-2820 Protein_catabolism denotes degradation
T2159 2711-2720 Negative_regulation denotes inhibitor
T2158 5344-5352 Protein denotes SerpinB2
T2157 5228-5236 Protein denotes SerpinB2
T2156 5153-5160 Protein denotes C/EBP-β
T2155 5111-5119 Protein denotes SerpinB2
T2154 5087-5095 Protein denotes SerpinB2
T2153 5001-5008 Protein denotes C/EBP-β
T2152 4914-4922 Protein denotes SerpinB2
T2151 4793-4801 Protein denotes SerpinB2
T2150 4722-4730 Protein denotes SerpinB2
T2149 4577-4585 Protein denotes SerpinB2
T2148 4511-4516 Protein denotes IFN-γ
T2147 4388-4396 Protein denotes SerpinB2
T2146 4299-4303 Protein denotes IKKβ
T2145 4208-4216 Protein denotes SerpinB2
T2144 3851-3855 Protein denotes TLR4
T2143 3653-3657 Protein denotes TLR4
T2142 3631-3651 Protein denotes toll-like receptor 4
T2141 3271-3279 Protein denotes SerpinB2
T2140 3096-3104 Protein denotes SerpinB2
T2139 2975-2983 Protein denotes SerpinB2
T2138 2933-2941 Protein denotes SerpinB2
T2137 2888-2899 Protein denotes plasminogen
T2136 2762-2765 Protein denotes uPA
T2135 2724-2760 Protein denotes urokinase-type plasminogen activator
T2134 2675-2683 Protein denotes SerpinB2
T2133 2608-2616 Protein denotes SerpinB2
T600 1746-1755 Regulation denotes dependent
T599 1756-1766 Regulation denotes regulation
T598 1770-1793 Positive_regulation denotes inflammation-associated
T597 1803-1813 Gene_expression denotes expression
T596 1532-1543 Positive_regulation denotes LPS-induced
T595 1515-1527 Positive_regulation denotes constitutive
T594 1658-1667 Negative_regulation denotes deficient
T593 1577-1586 Negative_regulation denotes abrogated
T592 1553-1563 Gene_expression denotes expression
T567 25-32 Protein denotes C/EBP-β
T568 97-105 Protein denotes SerpinB2
T586 73-86 Transcription denotes Transcription
T587 33-41 Positive_regulation denotes Mediates
T588 59-72 Positive_regulation denotes LPS-Inducible
T569 156-164 Protein denotes SerpinB2
T570 168-206 Protein denotes plasminogen activator inhibitor type 2
T571 208-213 Protein denotes PAI-2
T572 466-474 Protein denotes SerpinB2
T573 494-514 Protein denotes toll-like receptor 4
T574 516-520 Protein denotes TLR4
T575 723-731 Protein denotes SerpinB2
T576 608-616 Protein denotes SerpinB2
T577 1017-1025 Protein denotes SERPINB2
T578 1236-1244 Protein denotes SerpinB2
T579 1440-1447 Protein denotes C/EBP-β
T580 1478-1486 Protein denotes SerpinB2
T581 1544-1552 Protein denotes SerpinB2
T582 1590-1597 Protein denotes C/EBP-β
T583 1650-1657 Protein denotes C/EBP-β
T584 1738-1745 Protein denotes C/EBP-β
T585 1794-1802 Protein denotes SerpinB2
T589 225-232 Positive_regulation denotes induced
T590 475-485 Gene_expression denotes expression
T591 459-465 Positive_regulation denotes induce
T24255 28783-28790 Protein denotes C/EBP-β
T24254 28736-28744 Protein denotes SerpinB2
T23959 26307-26317 Protein denotes luciferase
T23958 26164-26201 Protein denotes SerpinB2 promoter-luciferase reporter
T23957 25983-25991 Protein denotes SerpinB2
T23956 25772-25780 Protein denotes SerpinB2
T23955 25687-25695 Protein denotes SerpinB2
T23569 24235-24242 Binding denotes binding
T23568 24336-24364 Protein denotes purine box binding protein 1
T23567 24328-24332 Protein denotes PU.1
T23566 24320-24326 Protein denotes POU2F1
T23565 24289-24319 Protein denotes octamer transcription factor 1
T23564 24281-24285 Protein denotes Oct1
T23563 24140-24148 Protein denotes SerpinB2
T23562 23978-23986 Protein denotes SerpinB2
T22997 20955-20966 Gene_expression denotes transfected
T22996 21442-21450 Protein denotes SerpinB2
T22995 21363-21371 Protein denotes SerpinB2
T22994 21177-21187 Protein denotes luciferase
T26527 37575-37582 Protein denotes C/EBP-β
T26526 37476-37483 Protein denotes C/EBP-β
T26525 37446-37461 Protein denotes β-galactosidase
T26524 37415-37425 Protein denotes luciferase
T26523 37376-37400 Protein denotes β-galactosidase reporter
T26522 37334-37371 Protein denotes SerpinB2 promoter-luciferase reporter
T26521 37204-37241 Protein denotes SerpinB2 promoter-luciferase reporter
T26520 37165-37170 Protein denotes Cebpb
T26519 37152-37157 Protein denotes Cebpb
T26518 37108-37116 Protein denotes SerpinB2
T26517 37086-37091 Protein denotes Cebpb
T26516 37061-37066 Protein denotes Cebpb
T26515 36989-36997 Protein denotes SerpinB2
T26548 38160-38167 Gene_expression denotes express
T26547 38142-38154 Gene_expression denotes -transfected
T26546 38062-38072 Gene_expression denotes expression
T26545 37699-37709 Gene_expression denotes expression
T26544 37607-37616 Regulation denotes regulates
T26543 37617-37631 Positive_regulation denotes LPS-stimulated
T26542 37556-37571 Phosphorylation denotes Phosphorylation
T26541 37300-37314 Gene_expression denotes co-transfected
T26540 37179-37189 Gene_expression denotes expressing
T26539 37033-37042 Positive_regulation denotes activated
T26538 38207-38214 Protein denotes C/EBP-β
T26537 38129-38141 Protein denotes C/EBP-βT217A
T26536 38091-38123 Protein denotes C/EBP-β phospho-acceptor mutants
T26535 37987-38002 Protein denotes β-galactosidase
T26534 37934-37944 Protein denotes Luciferase
T26533 37864-37888 Protein denotes β-galactosidase reporter
T26532 37822-37859 Protein denotes SerpinB2 promoter-luciferase reporter
T26531 37763-37795 Protein denotes C/EBP-β phospho-acceptor mutants
T26530 37738-37745 Protein denotes C/EBP-β
T26529 37660-37665 Protein denotes Cebpb
T26528 37632-37640 Protein denotes SerpinB2
R318 T592 T596 themeOf expression,LPS-induced
R319 T597 T598 themeOf expression,inflammation-associated
R320 T598 T599 themeOf inflammation-associated,regulation
R321 T599 T600 themeOf regulation,dependent
R684 T570 T589 themeOf plasminogen activator inhibitor type 2,induced
R689 T584 T600 causeOf C/EBP-β,dependent
R690 T585 T597 themeOf SerpinB2,expression
R1475 T2135 T2159 themeOf urokinase-type plasminogen activator,inhibitor
R1476 T2136 T2160 themeOf uPA,degradation
R1477 T2136 T2159 themeOf uPA,inhibitor
R1478 T2137 T2161 themeOf plasminogen,activation
R1479 T2138 T2162 themeOf SerpinB2,requires
R1480 T2138 T2163 themeOf SerpinB2,secreted
R1481 T2141 T2164 themeOf SerpinB2,regulated
R1482 T2144 T2165 themeOf TLR4,binding
R1483 T2145 T2167 themeOf SerpinB2,expression
R1484 T2147 T2169 themeOf SerpinB2,regulated
R1485 T2150 T2170 themeOf SerpinB2,bind
R1486 T2151 T2171 themeOf SerpinB2,induction
R1487 T2151 T2173 themeOf SerpinB2,binding
R1488 T2153 T2174 themeOf C/EBP-β,bound
R1489 T2154 T2175 themeOf SerpinB2,expression
R1490 T2155 T2176 themeOf SerpinB2,induction
R1491 T2157 T2178 themeOf SerpinB2,LPS-induced
R1492 T2158 T2180 themeOf SerpinB2,regulation
R1493 T2163 T2162 themeOf secreted,requires
R1494 T2165 T2166 themeOf binding,leads
R1495 T2167 T2168 themeOf expression,upregulated
R1496 T2171 T2172 themeOf induction,dependent
R1499 T2175 T2177 themeOf expression,constitutive
R1500 T2175 T2176 themeOf expression,induction
R1501 T2178 T2179 themeOf LPS-induced,regulate
R3284 T4451 T4455 themeOf GST-murine SerpinB2 fusion protein,produced
R3836 T5248 T5268 themeOf SerpinB2 Reporter Gene,Construction
R4490 T6272 T6277 themeOf C/EBP-β,co-transfected
R4491 T6274 T6277 themeOf luciferase,co-transfected
R4953 T6877 T6879 themeOf C/EBP-β,expression
R4954 T6878 T6881 themeOf C/EBP-β,knockdown
R4955 T6879 T6880 themeOf expression,knockdown
R5385 T7503 T7513 themeOf S64A,co-transfected
R5386 T7504 T7513 themeOf C/EBP-β,co-transfected
R5387 T7505 T7513 themeOf C/EBP-β phospho-acceptor mutants,co-transfected
R5388 T7506 T7513 themeOf T188A,co-transfected
R5389 T7507 T7513 themeOf T217A,co-transfected
R5390 T7512 T7514 themeOf C/EBP-β phospho-acceptor mutant,Expression
R6748 T9199 T9204 themeOf SerpinB2,Responsive
R6749 T9200 T9205 themeOf SerpinB2,mRNA
R6750 T9201 T9206 themeOf SerpinB2,expression
R6751 T9202 T9209 themeOf SerpinB2,expression
R6752 T9203 T9211 themeOf SerpinB2,expression
R6753 T9206 T9207 themeOf expression,induction
R6754 T9206 T9208 themeOf expression,LPS-inducible
R6755 T9209 T9210 themeOf expression,LPS-induced
R6756 T9211 T9212 themeOf expression,induced
R7276 T9906 T9911 themeOf SerpinB2,Deletion
R7277 T9907 T9913 themeOf SerpinB2,affected
R7278 T9910 T9914 themeOf SerpinB2,deletion
R7279 T9911 T9912 themeOf Deletion,increased
R7991 T10863 T10872 themeOf SerpinB2,transcription
R7992 T10865 T10874 themeOf SerpinB2,expression
R7993 T10870 T10877 themeOf Oct-1,binding
R7994 T10870 T10877 themeOf Oct-1,binding
R7995 T10871 T10877 themeOf PU.1,binding
R7996 T10871 T10877 themeOf PU.1,binding
R7997 T10872 T10873 themeOf transcription,mediate
R7998 T10874 T10875 themeOf expression,regulation
R7999 T10875 T10876 themeOf regulation,role
R8809 T11904 T11913 themeOf SerpinB2 promoter-luciferase reporter gene,binding
R8810 T11906 T11914 themeOf SerpinB2,activation
R8811 T11910 T11916 themeOf luciferase,reduced
R8812 T11910 T11917 themeOf luciferase,LPS-inducible
R8813 T11911 T11916 themeOf SerpinB2,reduced
R8814 T11914 T11915 themeOf activation,LPS-induced
R8815 T11917 T11916 themeOf LPS-inducible,reduced
R9437 T12707 T12708 themeOf SerpinB2,binds
R9979 T13472 T13484 themeOf C/EBP-β,Binds
R9980 T13473 T13484 themeOf SerpinB2,Binds
R10545 T14311 T14329 themeOf SerpinB2,Expression
R10546 T14312 T14336 causeOf C/EBP-β,importance
R10547 T14313 T14333 themeOf SerpinB2,expression
R10548 T14314 T14334 themeOf C/EBP-β,null
R10549 T14315 T14334 themeOf Cebpb,null
R10550 T14317 T14335 themeOf C/EBP-β,express
R10551 T14318 T14339 themeOf C/EBP-β,absence
R10552 T14319 T14340 themeOf SerpinB2,expression
R10553 T14320 T14337 themeOf SerpinB2,express
R10554 T14321 T14343 themeOf SerpinB2,expression
R10555 T14322 T14344 themeOf SerpinB2,expression
R10556 T14324 T14349 themeOf C/EBP-β,expression
R10557 T14325 T14352 themeOf SerpinB2,expression
R10558 T14326 T14354 themeOf C/EBP-β,deficient
R10559 T14327 T14358 causeOf C/EBP-β,mediating
R10560 T14328 T14357 themeOf SerpinB2,transcription
R10561 T14329 T14330 themeOf Expression,Mediates
R10562 T14329 T14331 themeOf Expression,Constitutive
R10563 T14329 T14332 themeOf Expression,LPS-induced
R10564 T14333 T14336 themeOf expression,importance
R10565 T14337 T14338 themeOf express,low
R10566 T14340 T14341 themeOf expression,attenuated
R10567 T14340 T14342 themeOf expression,endogenous
R10568 T14343 T14346 themeOf expression,increase
R10569 T14344 T14345 themeOf expression,dampened
R10570 T14344 T14347 themeOf expression,LPS-stimulated
R10571 T14346 T14348 themeOf increase,stimulated
R10572 T14349 T14350 themeOf expression,down
R10573 T14349 T14351 themeOf expression,knocked
R10574 T14350 T14351 causeOf down,knocked
R10575 T14351 T14350 themeOf knocked,down
R10576 T14352 T14353 themeOf expression,decreased
R10577 T14352 T14355 themeOf expression,constitutive
R10578 T14352 T14356 themeOf expression,LPS-induced
R10579 T14357 T14358 themeOf transcription,mediating
R10580 T14357 T14359 themeOf transcription,LPS-inducible
R11210 T15197 T15218 themeOf C/EBP-β,Binds
R11211 T15198 T15218 themeOf SerpinB2,Binds
R11212 T15199 T15219 themeOf C/EBP-β,recruitment
R11213 T15200 T15219 themeOf SerpinB2,recruitment
R11214 T15202 T15220 themeOf C/EBP-β,association
R11215 T15203 T15220 themeOf SerpinB2,association
R11216 T15204 T15222 themeOf SerpinB2,recruitment
R11217 T15204 T15222 themeOf SerpinB2,recruitment
R11218 T15205 T15222 themeOf C/EBP-β,recruitment
R11219 T15205 T15223 themeOf C/EBP-β,phosphorylated
R11220 T15206 T15222 themeOf p-C/EBP-βT217,recruitment
R11221 T15206 T15223 themeOf p-C/EBP-βT217,phosphorylated
R11222 T15207 T15221 themeOf C/EBP-β,phosphorylation
R11223 T15208 T15225 themeOf C/EBP-β,affect
R11224 T15209 T15226 themeOf p-C/EBP-βT217,bound
R11225 T15210 T15226 themeOf SerpinB2,bound
R11226 T15211 T15228 themeOf C/EBP-β,diminished
R11227 T15212 T15227 themeOf p-C/EBP-βT217,binding
R11228 T15213 T15227 themeOf SerpinB2,binding
R11229 T15214 T15229 themeOf C/EBP-β,recruitment
R11230 T15215 T15229 themeOf p-C/EBP-βT217,recruitment
R11231 T15216 T15230 themeOf C/EBP-β,T217-phosphorylated
R11232 T15216 T15232 causeOf C/EBP-β,responsible
R11233 T15217 T15231 themeOf SerpinB2,transcription
R11234 T15221 T15224 themeOf phosphorylation,changes
R11235 T15224 T15225 causeOf changes,affect
R11236 T15227 T15228 themeOf binding,diminished
R11237 T15231 T15232 themeOf transcription,responsible
R11238 T15231 T15233 themeOf transcription,increased
R11758 T15964 T15979 themeOf SerpinB2,LPS-inducible
R11759 T15965 T15980 themeOf C/EBP-β,binds
R11760 T15966 T15980 themeOf SerpinB2,binds
R11761 T15967 T15982 causeOf C/EBP-β,essential
R11762 T15968 T15981 themeOf SerpinB2,transcription
R11763 T15974 T15983 themeOf SerpinB2,increased
R11764 T15974 T15984 themeOf SerpinB2,abrogated
R11765 T15978 T15985 themeOf SerpinB2,LPS-induced
R11766 T15981 T15982 themeOf transcription,essential
R12494 T17217 T17257 themeOf C/EBP-β,Phosphorylation
R12495 T17218 T17258 themeOf SerpinB2,Regulates
R12496 T17218 T17259 themeOf SerpinB2,LPS-stimulated
R12497 T17219 T17260 themeOf C/EBP-β,Phosphorylation
R12498 T17220 T17262 themeOf C/EBP-β,phosphorylation
R12499 T17222 T17263 themeOf C/EBP-β phospho-acceptor mutants,co-expressed
R12500 T17222 T17264 themeOf C/EBP-β phospho-acceptor mutants,mutated
R12526 T17257 T17258 causeOf Phosphorylation,Regulates
R12529 T17260 T17261 themeOf Phosphorylation,modulate
R14618 T20292 T20367 themeOf SerpinB2,transcription
R14619 T20293 T20364 themeOf C/EBP-β,LPS-induced
R14620 T20293 T20365 themeOf C/EBP-β,bind
R14621 T20294 T20365 themeOf SerpinB2,bind
R14622 T20295 T20366 themeOf C/EBP-β,loss
R14623 T20296 T20370 themeOf SerpinB2,mediated
R14624 T20298 T20371 themeOf SERPINB2,transcription
R14625 T20300 T20372 themeOf SerpinB2,transcription
R14629 T20305 T20379 causeOf C/EBP-β,requirement
R14630 T20306 T20378 themeOf SerpinB2,transcription
R14631 T20308 T20381 themeOf gene,induction
R14632 T20309 T20382 themeOf C/EBP-β,deficient
R14633 T20310 T20381 themeOf IFNγ,induction
R14634 T20311 T20384 themeOf SerpinB2,expression
R14635 T20312 T20386 themeOf C/EBP-β,transcription
R14636 T20313 T20386 themeOf SerpinB2,transcription
R14637 T20315 T20388 themeOf SerpinB2,bind
R14638 T20316 T20390 causeOf C/EBP-β,role
R14639 T20317 T20389 themeOf SerpinB2,expression
R14640 T20320 T20392 themeOf C/EBP-β,null
R14641 T20322 T20393 themeOf SerpinB2,expression
R14642 T20323 T20394 causeOf C/EBP-β,regulation
R14643 T20324 T20395 themeOf C/EBP-β,Phosphorylation
R14644 T20325 T20396 themeOf C/EBP-β,phosphorylated
R14645 T20327 T20397 themeOf C/EBP-β phospho-acceptor site mutant,expression
R14646 T20328 T20397 themeOf C/EBPβT217A,expression
R14647 T20332 T20399 themeOf SerpinB2,recruitment
R14648 T20333 T20401 themeOf SerpinB2,expression
R14649 T20334 T20403 themeOf C/EBP-β phospho-acceptor site mutant,expression
R14650 T20335 T20403 themeOf C/EBP-βT188A,expression
R14651 T20337 T20404 themeOf C/EBP-βS64A,expression
R14652 T20338 T20406 themeOf SerpinB2,LPS-induced
R14653 T20339 T20407 themeOf C/EBP-β,phosphorylation
R14654 T20340 T20408 themeOf SerpinB2,regulates
R14655 T20340 T20409 themeOf SerpinB2,LPS-induced
R14656 T20341 T20410 themeOf C/EBP-β,phosphorylated
R14657 T20342 T20411 themeOf SerpinB2,transcription
R14658 T20343 T20414 themeOf Mixed lineage kinase-3,dephosphorylation
R14659 T20344 T20414 themeOf MLK3,dephosphorylation
R14660 T20345 T20414 themeOf C/EBP-β,dephosphorylation
R14661 T20348 T20415 themeOf SerpinB2,expression
R14662 T20348 T20416 themeOf SerpinB2,associated
R14663 T20352 T20417 themeOf SerpinB2,transcription
R14664 T20354 T20419 themeOf SerpinB2,expression
R14665 T20355 T20422 themeOf SerpinB2,regulating
R14666 T20356 T20424 themeOf SerpinB2,expression
R14667 T20357 T20358 themeOf induction,involves
R14668 T20357 T20359 themeOf induction,massive
R14669 T20361 T20362 themeOf transcription,conferred
R14670 T20361 T20363 themeOf transcription,dependent
R14671 T20366 T20368 causeOf loss,abrogates
R14672 T20367 T20368 themeOf transcription,abrogates
R14673 T20367 T20369 themeOf transcription,constitutive
R14676 T20378 T20379 themeOf transcription,requirement
R14677 T20378 T20380 themeOf transcription,LPS-induced
R14678 T20381 T20383 themeOf induction,impaired
R14679 T20381 T20382 themeOf induction,deficient
R14680 T20381 T20382 themeOf induction,deficient
R14681 T20381 T20383 themeOf induction,impaired
R14682 T20384 T20385 themeOf expression,abrogated
R14683 T20384 T20387 themeOf expression,LPS-inducible
R14684 T20389 T20390 themeOf expression,role
R14685 T20389 T20391 themeOf expression,LPS-induced
R14686 T20393 T20394 themeOf expression,regulation
R14687 T20397 T20398 themeOf expression,increase
R14688 T20397 T20398 themeOf expression,increase
R14689 T20399 T20400 themeOf recruitment,decrease
R14690 T20401 T20402 themeOf expression,regulation
R14691 T20404 T20405 themeOf expression,enhanced
R14692 T20406 T20405 themeOf LPS-induced,enhanced
R14693 T20407 T20408 causeOf phosphorylation,regulates
R14694 T20407 T20408 causeOf phosphorylation,regulates
R14695 T20409 T20408 themeOf LPS-induced,regulates
R14696 T20411 T20412 themeOf transcription,increase
R14697 T20411 T20413 themeOf transcription,LPS-induced
R14698 T20417 T20418 themeOf transcription,LPS-induced
R14699 T20419 T20420 themeOf expression,constitutive
R14700 T20419 T20421 themeOf expression,LPS-induced
R14701 T20422 T20423 themeOf regulating,role
R14702 T20424 T20425 themeOf expression,inflammation-associated
R14703 T20425 T20426 themeOf inflammation-associated,regulation
R16246 T22512 T22517 themeOf SerpinB2,induction
R16247 T22512 T22518 themeOf SerpinB2,expression
R16248 T22515 T22519 themeOf SerpinB2,expression
R16249 T22518 T22517 themeOf expression,induction
R16580 T22993 T22997 themeOf SerpinB2 promoter-luciferase reporter,transfected
R16967 T23565 T23569 themeOf octamer transcription factor 1,binding
R16968 T23565 T23569 themeOf octamer transcription factor 1,binding
R16969 T23566 T23569 themeOf POU2F1,binding
R16970 T23566 T23569 themeOf POU2F1,binding
R16971 T23568 T23569 themeOf purine box binding protein 1,binding
R16972 T23568 T23569 themeOf purine box binding protein 1,binding
R17411 T24254 T24261 themeOf SerpinB2,binding
R17412 T24255 T24261 themeOf C/EBP-β,binding
R17831 T24885 T24897 themeOf SerpinB2,expression
R17839 T24897 T24898 themeOf expression,essential
R316 T592 T593 themeOf expression,abrogated
R681 T567 T587 causeOf C/EBP-β,Mediates
R682 T568 T586 themeOf SerpinB2,Transcription
R683 T569 T589 themeOf SerpinB2,induced
R685 T572 T590 themeOf SerpinB2,expression
R686 T573 T591 causeOf toll-like receptor 4,induce
R687 T581 T592 themeOf SerpinB2,expression
R688 T583 T594 themeOf C/EBP-β,deficient
R691 T586 T587 themeOf Transcription,Mediates
R692 T586 T588 themeOf Transcription,LPS-Inducible
R693 T590 T591 themeOf expression,induce
R317 T592 T595 themeOf expression,constitutive
R10544 T14310 T14330 causeOf C/EBP-β,Mediates
R12502 T17226 T17266 themeOf SerpinB2 luciferase reporter,expression
R12503 T17227 T17269 causeOf C/EBP-β,importance
R12504 T17228 T17267 themeOf SerpinB2,transcription
R12505 T17229 T17265 themeOf C/EBP-β,Re-expression
R12506 T17230 T17271 themeOf C/EBP-β phospho-acceptor mutant,Expression
R12530 T17265 T17268 causeOf Re-expression,stimulated
R12531 T17266 T17268 themeOf expression,stimulated
R12532 T17267 T17269 themeOf transcription,importance
R12533 T17267 T17270 themeOf transcription,LPS-induced
R12534 T17271 T17272 themeOf Expression,increase
R12508 T17235 T17273 themeOf C/EBP-β,phosphorylation
R12536 T17273 T17274 themeOf phosphorylation,factor
R12501 T17223 T17264 themeOf SerpinB2 luciferase reporter,mutated
R12507 T17231 T17271 themeOf C/EBPβT217A,Expression
R12509 T17237 T17276 causeOf C/EBP-β,modulating
R12510 T17238 T17277 causeOf C/EBP-β,dependent
R12511 T17239 T17275 themeOf SerpinB2,transcription
R12512 T17240 T17278 themeOf DAPK1,regulating
R12513 T17241 T17279 causeOf IFNγ,inducible
R12514 T17242 T17279 themeOf gene,inducible
R12515 T17243 T17280 themeOf SerpinB2,regulation
R12516 T17244 T17281 themeOf IL-6,transcription
R12517 T17245 T17281 themeOf MCP-1,transcription
R12518 T17246 T17283 themeOf SerpinB2,induced
R12519 T17246 T17284 themeOf SerpinB2,regulated
R12520 T17249 T17285 themeOf SerpinB2,expression
R12521 T17250 T17287 themeOf C/EBP-βT188A,transfected
R12522 T17252 T17288 themeOf C/EBP-β,transfected
R12523 T17253 T17289 themeOf C/EBP-βS64A,expression
R12524 T17255 T17291 themeOf C/EBP-β,phosphorylation
R12525 T17256 T17292 themeOf SerpinB2,regulate
R12527 T17257 T17258 causeOf Phosphorylation,Regulates
R12528 T17259 T17258 themeOf LPS-stimulated,Regulates
R12535 T17271 T17272 themeOf Expression,increase
R12537 T17275 T17276 themeOf transcription,modulating
R12538 T17275 T17277 themeOf transcription,dependent
R12539 T17281 T17282 themeOf transcription,LPS-induced
R12540 T17281 T17282 themeOf transcription,LPS-induced
R12541 T17285 T17286 themeOf expression,role
R12542 T17289 T17290 themeOf expression,potentiated
R12543 T17291 T17292 causeOf phosphorylation,regulate
R14614 T20286 T20357 themeOf SerpinB2,induction
R14615 T20287 T20360 themeOf SerpinB2,induced
R14616 T20289 T20361 themeOf SerpinB2,transcription
R14617 T20291 T20363 causeOf C/EBP-β,dependent
R14626 T20302 T20375 themeOf C/EBP-β,interactions
R14627 T20303 T20376 themeOf C/EBP-β,interact
R14628 T20304 T20377 themeOf C/EBP-β,transcription
R14674 T20372 T20373 themeOf transcription,mediating
R14675 T20372 T20374 themeOf transcription,PMA-inducible
R17830 T24884 T24898 causeOf C/EBP-β,essential
R17832 T24886 T24900 themeOf SerpinB2,expression
R17833 T24889 T24902 themeOf SerpinB2,expression
R17834 T24892 T24905 themeOf C/EBP-β,deficient
R17835 T24893 T24903 themeOf SerpinB2,expression
R17836 T24894 T24906 themeOf Cebpb,target
R17837 T24895 T24907 themeOf C/EBP-β,knockdown
R17838 T24896 T24908 themeOf SerpinB2,expression
R17840 T24897 T24899 themeOf expression,LPS-induced
R17841 T24900 T24901 themeOf expression,abrogated
R17842 T24903 T24904 themeOf expression,abrogated
R18324 T25616 T25628 themeOf C/EBP-β,recruitment
R18325 T25617 T25628 themeOf SerpinB2,recruitment
R18326 T25624 T25629 themeOf SerpinB2,Recruitment
R18327 T25629 T25630 themeOf Recruitment,following
R18809 T26515 T26539 themeOf SerpinB2,activated
R18810 T26521 T26540 themeOf SerpinB2 promoter-luciferase reporter,expressing
R18811 T26522 T26541 themeOf SerpinB2 promoter-luciferase reporter,co-transfected
R18812 T26523 T26541 themeOf β-galactosidase reporter,co-transfected
R18813 T26527 T26542 themeOf C/EBP-β,Phosphorylation
R18814 T26528 T26543 themeOf SerpinB2,LPS-stimulated
R18815 T26529 T26545 themeOf Cebpb,expression
R18816 T26530 T26545 themeOf C/EBP-β,expression
R18817 T26531 T26545 themeOf C/EBP-β phospho-acceptor mutants,expression
R18818 T26532 T26545 themeOf SerpinB2 promoter-luciferase reporter,expression
R18819 T26533 T26545 themeOf β-galactosidase reporter,expression
R18820 T26536 T26546 themeOf C/EBP-β phospho-acceptor mutants,expression
R18821 T26537 T26547 themeOf C/EBP-βT217A,-transfected
R18822 T26537 T26548 themeOf C/EBP-βT217A,express
R18823 T26538 T26548 themeOf C/EBP-β,express
R18824 T26542 T26544 causeOf Phosphorylation,regulates
R18825 T26543 T26544 themeOf LPS-stimulated,regulates

bionlp-st-ge-2016-test-ihmc

Id Subject Object Predicate Lexical cue Negation
T26746 37046-37074 Positive_regulation denotes LPS-stimulated Cebpb+/+ MEFs
T26745 37476-37523 Gene_expression denotes C/EBP-β gene schematic depicting gene structure
T26744 37174-37275 Gene_expression denotes MEFs expressing the pGLmP-539 SerpinB2 promoter-luciferase reporter in the presence or absence of LPS
T26743 37617-37658 Positive_regulation denotes LPS-stimulated SerpinB2 promoter activity
T26742 37556-37658 Regulation denotes Phosphorylation of C/EBP-β at Serine 64 negatively regulates LPS-stimulated SerpinB2 promoter activity
T26741 37808-37859 Protein denotes the pGLmP-539 SerpinB2 promoter-luciferase reporter
T26740 37376-37400 Protein denotes β-galactosidase reporter
T26739 37476-37483 Protein denotes C/EBP-β
T26738 37108-37116 Protein denotes SerpinB2
T26737 36944-36952 Protein denotes SerpinB2
T26736 37934-37944 Protein denotes Luciferase
T26735 37086-37091 Protein denotes Cebpb
T26734 37987-38002 Protein denotes β-galactosidase
T26733 37669-37672 Protein denotes MEF
T26732 37174-37275 Protein denotes MEFs expressing the pGLmP-539 SerpinB2 promoter-luciferase reporter in the presence or absence of LPS
T26731 37728-37745 Protein denotes wild-type C/EBP-β
T26730 37190-37241 Protein denotes the pGLmP-539 SerpinB2 promoter-luciferase reporter
T26729 37320-37371 Protein denotes the pGLmP-539 SerpinB2 promoter-luciferase reporter
T26728 36944-36970 Entity denotes SerpinB2 proximal promoter
T26727 36985-37015 Entity denotes The SerpinB2 proximal promoter
T26726 37095-37099 Protein denotes MEFs
T26725 37289-37294 Entity denotes Cells
T26724 37446-37461 Protein denotes β-galactosidase
T26723 37325-37329 Protein denotes GLmP
T26722 37101-37139 Protein denotes Murine SerpinB2 gene promoter activity
T26721 37046-37060 Entity denotes LPS-stimulated
T26720 38129-38154 Protein denotes C/EBP-βT217A -transfected
T26719 37415-37425 Protein denotes luciferase
T26718 37632-37649 Entity denotes SerpinB2 promoter
T26717 37919-37922 Entity denotes LPS
T26716 37572-37582 Protein denotes of C/EBP-β
T26715 37927-37932 Protein denotes 4 hrs
T26714 37476-37523 Protein denotes C/EBP-β gene schematic depicting gene structure
T26713 37632-37640 Protein denotes SerpinB2
T26712 37122-37130 Entity denotes promoter
T26711 37813-37817 Protein denotes GLmP
T26710 38125-38159 Protein denotes The C/EBP-βT217A -transfected MEFs
T26709 37586-37595 Entity denotes Serine 64
T26708 37195-37199 Protein denotes GLmP
T26707 37269-37275 Entity denotes of LPS
T26706 37617-37631 Entity denotes LPS-stimulated
T26705 37660-37666 Protein denotes Cebpb−
T26704 37165-37171 Protein denotes Cebpb−
T26703 36919-36926 Protein denotes C/EBP-β
T26702 37528-37550 Entity denotes phospho-acceptor sites
T26701 37864-37888 Protein denotes β-galactosidase reporter
T26700 37509-37513 Protein denotes gene
T26699 36989-36997 Protein denotes SerpinB2
T26698 38076-38123 Protein denotes the respective C/EBP-β phospho-acceptor mutants
T26697 38207-38214 Protein denotes C/EBP-β
T26696 37046-37074 Protein denotes LPS-stimulated Cebpb+/+ MEFs
T26695 37763-37796 Protein denotes C/EBP-β phospho-acceptor mutants,
T26694 37536-37544 Entity denotes acceptor
T26693 38334-38347 Protein denotes one-way ANOVA
T749 87-105 Protein denotes of Murine SerpinB2
T758 59-105 Transcription denotes LPS-Inducible Transcription of Murine SerpinB2
T755 1738-1813 Regulation denotes C/EBP-β-dependent regulation of inflammation-associated SerpinB2 expression
T25741 35681-35758 Transcription denotes the SerpinB2 promoter suggests active transcription following LPS stimulation
T25740 35979-35995 Regulation denotes the rIgG control
T25739 35586-35603 Entity denotes promoter-specific
T25738 35248-35257 Entity denotes chromatin
T25737 35743-35746 Entity denotes LPS
T25736 35892-35939 Entity denotes of chromatin immunoprecipitated with antibodies
T25735 35294-35304 Entity denotes antibodies
T25734 35694-35702 Entity denotes promoter
T25733 34990-34998 Protein denotes SerpinB2
T25732 35487-35489 Protein denotes Ig
T25731 36034-36038 Protein denotes rIgG
T25730 35681-35711 Protein denotes the SerpinB2 promoter suggests
T25729 35420-35464 Protein denotes C/EBP-β, p-C/EBP-β (T217), RNA Polymerase II
T25728 35983-35987 Protein denotes rIgG
T25727 35929-35939 Entity denotes antibodies
T25726 35396-35411 Entity denotes with antibodies
T25725 35519-35522 Protein denotes PCR
T25724 34952-34959 Protein denotes C/EBP-β
T25723 35213-35219 Entity denotes of LPS
T25722 35879-35882 Protein denotes PCR
T25721 35313-35320 Protein denotes C/EBP-β
T25720 34979-35015 Entity denotes the murine SerpinB2 promoter in vivo
T25719 35335-35339 Entity denotes T217
T25718 35420-35446 Protein denotes C/EBP-β, p-C/EBP-β (T217),
T25717 35108-35117 Entity denotes chromatin
T25716 35568-35576 Protein denotes SerpinB2
T25715 35968-35972 Entity denotes T217
T25714 35073-35089 Entity denotes promoter in vivo
T25713 35429-35445 Protein denotes p-C/EBP-β (T217)
T25712 35948-35955 Protein denotes C/EBP-β
T25711 35324-35333 Protein denotes p-C/EBP-β
T25710 35492-35496 Protein denotes rIgG
T25709 35051-35072 Protein denotes the SerpinB2 proximal
T25708 35543-35554 Entity denotes ChIP assays
T25707 35440-35444 Entity denotes T217
T25706 35957-35973 Protein denotes p-C/EBP-β (T217)
T25705 35152-35172 Entity denotes RAW264.7 macrophages
T25704 35342-35359 Entity denotes Soluble chromatin
T25036 32987-33087 Gene_expression denotes qPCR analysis of murine SerpinB2 mRNA expression in the lentiviral transduced peritoneal macrophages
T25035 32150-32199 Negative_regulation denotes SerpinB2 mRNA expression is abrogated in Cebpb−/−
T25034 32300-32337 Gene_expression denotes mRNA expression in untreated Cebpb+/+
T25033 32300-32337 Transcription denotes mRNA expression in untreated Cebpb+/+
T25032 32076-32133 Gene_expression denotes for constitutive and LPS-induced SerpinB2 mRNA expression
T25031 32150-32174 Gene_expression denotes SerpinB2 mRNA expression
T25030 32475-32482 Protein denotes C/EBP-β
T25029 32439-32447 Protein denotes SerpinB2
T25028 32055-32062 Protein denotes C/EBP-β
T25027 33011-33019 Protein denotes SerpinB2
T25026 32281-32299 Protein denotes of murine SerpinB2
T25025 32806-32809 Entity denotes LPS
T25024 32826-32831 Protein denotes 4 hrs
T25023 32214-32230 Protein denotes to Cebpb+/+ MEFs
T25022 32267-32271 Protein denotes qPCR
T25021 32109-32122 Protein denotes SerpinB2 mRNA
T25020 32109-32117 Protein denotes SerpinB2
T25019 32751-32784 Entity denotes Lentiviral transduced macrophages
T25018 32097-32108 Entity denotes LPS-induced
T25017 32887-32908 Protein denotes of endogenous C/EBP-β
T25016 33011-33024 Protein denotes SerpinB2 mRNA
T25015 32150-32158 Protein denotes SerpinB2
T25014 32567-32569 Protein denotes TG
T25013 32730-32735 Protein denotes Cebpb
T25012 32646-32651 Protein denotes CEBPB
T25011 32300-32304 Protein denotes mRNA
T25010 32987-32991 Protein denotes qPCR
T25009 32967-32972 Protein denotes CEBPB
T25008 32342-32348 Protein denotes Cebpb−
T25007 32519-32575 Entity denotes Thioglycollate-elicited peritoneal macrophages (TG macs)
T25006 32567-32574 Protein denotes TG macs
T25005 32259-32265 Entity denotes of LPS
T25004 33039-33087 Entity denotes the lentiviral transduced peritoneal macrophages
T25003 32150-32163 Protein denotes SerpinB2 mRNA
T25002 32941-32946 Protein denotes Cebpb
T25001 32200-32204 Protein denotes MEFs
T25000 32351-32356 Protein denotes MEFs,
T24999 32483-32517 Entity denotes deficient inflammatory macrophages
T24998 32383-32386 Entity denotes LPS
T24332 28976-28984 Protein denotes SerpinB2
T24331 28736-28744 Protein denotes SerpinB2
T24330 29328-29356 Entity denotes of the DNA-protein complexes
T24329 29487-29512 Entity denotes The LPS-inducible complex
T24328 29018-29028 Entity denotes C/EBP site
T24327 29045-29052 Protein denotes albumin
T24326 29173-29181 Protein denotes SerpinB2
T24325 28847-28864 Entity denotes 10 hr LPS treated
T24324 29257-29292 Entity denotes stranded oligonucleotides described
T24323 28976-28990 Protein denotes SerpinB2 C/EBP
T24322 28783-28790 Protein denotes C/EBP-β
T24321 29471-29476 Protein denotes C/EBP
T24320 29084-29091 Protein denotes albumin
T24319 29080-29097 Protein denotes rat albumin C/EBP
T24318 29018-29023 Protein denotes C/EBP
T24317 29462-29485 Protein denotes specific C/EBP antibody
T24316 28765-28768 Protein denotes EBP
T24315 29037-29098 Entity denotes the rat albumin promoter DEI region C/EBP (rat albumin C/EBP)
T24314 29148-29206 Entity denotes the radiolabelled murine SerpinB2 promoter −212/−185 probe
T24313 28725-28768 Entity denotes the murine SerpinB2 proximal promoter C/EBP
T24312 29037-29098 Protein denotes the rat albumin promoter DEI region C/EBP (rat albumin C/EBP)
T24311 29004-29016 Protein denotes mutant C/EBP
T24310 28866-28869 Entity denotes LPS
T24309 28806-28822 Entity denotes nuclear extracts
T24308 28769-28773 Entity denotes site
T24307 29062-29065 Protein denotes DEI
T23997 25758-25789 Entity denotes of the murine SerpinB2 promoter
T23996 25983-25991 Protein denotes SerpinB2
T23995 26307-26317 Protein denotes luciferase
T23994 26056-26067 Entity denotes ChIP assays
T23993 25867-25872 Entity denotes boxes
T23992 26273-26279 Protein denotes 16 hrs
T23991 25673-25704 Entity denotes of the murine SerpinB2 promoter
T23990 25973-26067 Entity denotes of murine SerpinB2 proximal promoter-specific primers, 338/−315 and −5/+19 used in ChIP assays
T23989 25687-25695 Protein denotes SerpinB2
T23988 25973-26067 Entity denotes of murine SerpinB2 proximal promoter-specific primers, 338/−315 and −5/+19 used in ChIP assays
T23987 25821-25824 Protein denotes cis
T23986 26087-26108 Entity denotes RAW 264.7 macrophages
T23985 26259-26279 Entity denotes ng/ml LPS for 16 hrs
T23984 25772-25780 Protein denotes SerpinB2
T23983 25650-25704 Entity denotes the LPS-responsiveness of the murine SerpinB2 promoter
T23982 26337-26340 Entity denotes LPS
T23981 26157-26212 Protein denotes murine SerpinB2 promoter-luciferase reporter constructs
T23629 24328-24364 Protein denotes PU.1 =  purine box binding protein 1
T23628 24182-24207 Entity denotes AP-1 =  activator protein
T23627 24289-24326 Protein denotes octamer transcription factor 1/POU2F1
T23626 24289-24326 Protein denotes octamer transcription factor 1/POU2F1
T23625 24366-24414 Entity denotes The putative transcription initiation site (tis)
T23624 23978-23986 Protein denotes SerpinB2
T23623 24021-24031 Entity denotes nucleotide
T23622 24328-24333 Protein denotes PU.1 
T23621 24258-24262 Protein denotes cAMP
T23620 24133-24158 Entity denotes murine SerpinB2 promoters
T23619 24182-24207 Protein denotes AP-1 =  activator protein
T23618 24320-24326 Protein denotes POU2F1
T23617 24182-24187 Protein denotes AP-1 
T23616 24252-24326 Protein denotes CRE = cAMP response element; Oct1 =  octamer transcription factor 1/POU2F1
T23615 24432-24438 Entity denotes exon 1
T23614 24081-24084 Protein denotes Cis
T23613 24140-24148 Protein denotes SerpinB2
T23612 24252-24256 Protein denotes CRE 
T23611 24211-24217 Protein denotes C/EBP 
T23610 24061-24079 Entity denotes Clustal W software
T23609 23942-23945 Entity denotes LPS
T23608 23964-23995 Entity denotes of the murine SerpinB2 promoter
T23057 21786-21790 Protein denotes MIR 
T23056 20422-20426 Protein denotes gene
T23055 20848-20910 Entity denotes the most 5′ nucleotide of murine SerpinB2 5′ flanking sequence
T23054 21667-21671 Protein denotes ID4 
T23053 21850-21852 Entity denotes n 
T23092 21859-21864 Entity denotes tetra
T23091 20439-20442 Entity denotes LPS
T23090 21720-21728 Protein denotes L1 =  L1
T23089 21771-21774 Entity denotes L2 
T23088 20685-20713 Protein denotes the luciferase reporter gene
T23087 21435-21450 Protein denotes murine SerpinB2
T23086 21363-21371 Protein denotes SerpinB2
T23085 21777-21779 Entity denotes L2
T23084 20752-20776 Entity denotes restriction enzyme sites
T23083 20546-20599 Protein denotes SerpinB2 promoter and 5′ deletion luciferase reporter
T23082 20810-20813 Protein denotes PCR
T23081 20484-20492 Protein denotes SerpinB2
T23080 21082-21126 Entity denotes left untreated or treated with 100 ng/ml LPS
T23079 21720-21723 Protein denotes L1 
T23078 21667-21683 Protein denotes ID4 =  ID4 short
T23077 21792-21795 Protein denotes MIR
T23076 20881-20889 Protein denotes SerpinB2
T23075 20785-20821 Entity denotes specific oligonucleotide PCR primers
T23074 20916-20937 Entity denotes RAW 264.7 macrophages
T23073 20689-20699 Protein denotes luciferase
T23072 21883-21887 Entity denotes tis 
T23071 20473-20501 Entity denotes the murine SerpinB2 promoter
T23070 20986-21021 Protein denotes murine SerpinB2 promoter-luciferase
T23069 20752-20770 Protein denotes restriction enzyme
T23068 21197-21201 Protein denotes gene
T23067 21859-21874 Entity denotes tetranucleotide
T23066 21133-21153 Entity denotes ng/ml PMA for 16 hrs
T23065 21487-21497 Entity denotes nucleotide
T23064 20993-21001 Protein denotes SerpinB2
T23063 21308-21311 Entity denotes DNA
T23062 21064-21069 Entity denotes Cells
T23061 20986-21021 Entity denotes murine SerpinB2 promoter-luciferase
T23060 21526-21551 Entity denotes by the same colored boxes
T23059 21177-21187 Protein denotes luciferase
T23058 21147-21153 Protein denotes 16 hrs
T22572 18205-18223 Gene_expression denotes protein expression
T22571 18508-18569 Gene_expression denotes analysis of SerpinB2 protein expression in whole cell lysates
T22570 18602-18619 Regulation denotes a loading control
T22569 18187-18200 Protein denotes SerpinB2 mRNA
T22568 18234-18244 Entity denotes macrophage
T22567 18252-18272 Entity denotes RAW264.7 macrophages
T22566 18334-18338 Protein denotes qPCR
T22565 18319-18328 Entity denotes ng/ml LPS
T22564 18227-18250 Entity denotes murine macrophage cells
T22563 18593-18598 Protein denotes GAPDH
T22562 18367-18371 Protein denotes mRNA
T22561 18348-18379 Protein denotes of murine SerpinB2 mRNA levels,
T22560 18520-18528 Protein denotes SerpinB2
T22559 18170-18173 Entity denotes LPS
T22558 18205-18212 Protein denotes protein
T22557 18392-18399 Protein denotes β-actin
T22556 18187-18195 Protein denotes SerpinB2
T22555 18520-18536 Protein denotes SerpinB2 protein
T21121 41378-41418 Transcription denotes constitutive SerpinB2 gene transcription
T21120 45539-45576 Transcription denotes LPS-induced transcription of SerpinB2
T21119 41787-41847 Transcription denotes PMA-stimulated transcription of the human SERPINB2 gene [37]
T21118 44969-44996 Gene_expression denotes of SerpinB2 gene expression
T21117 42812-42895 Regulation denotes Additionally, CREB has been shown to control transcription of the C/EBP-β gene [67]
T21116 44950-44996 Regulation denotes for the regulation of SerpinB2 gene expression
T21115 43484-43511 Transcription denotes SerpinB2 gene transcription
T21114 40876-40929 Positive_regulation denotes massive induction of the pro-survival factor SerpinB2
T21113 40876-40929 Gene_expression denotes massive induction of the pro-survival factor SerpinB2
T21112 45170-45195 Gene_expression denotes expression of C/EBP-βS64A
T21111 46632-46695 Transcription denotes constitutive and LPS-induced transcription of the SerpinB2 gene
T21110 42750-42773 Positive_regulation denotes promote gene expression
T21109 41787-41847 Positive_regulation denotes PMA-stimulated transcription of the human SERPINB2 gene [37]
T21108 47184-47250 Regulation denotes the regulation of inflammation-associated SerpinB2 gene expression
T21107 47083-47131 Regulation denotes negatively regulating SerpinB2 promoter activity
T21106 45157-45257 Positive_regulation denotes In contrast, expression of C/EBP-βS64A significantly enhanced LPS-induced SerpinB2 promoter activity
T21105 45259-45368 Regulation denotes indicating that phosphorylation of C/EBP-β at S64 negatively regulates LPS-induced SerpinB2 promoter activity
T21104 46976-47000 Gene_expression denotes SerpinB2 gene expression
T21103 43325-43363 Gene_expression denotes LPS-inducible SerpinB2 mRNA expression
T21102 45376-45458 Phosphorylation denotes C/EBP-β S64 is constitutively phosphorylated in both RAW264.7 cells and MEFs [73],
T21101 45009-45078 Gene_expression denotes expression of the C/EBP-β phospho-acceptor site mutant, C/EBP-βT188A,
T21100 47199-47250 Gene_expression denotes of inflammation-associated SerpinB2 gene expression
T21099 45275-45308 Phosphorylation denotes phosphorylation of C/EBP-β at S64
T21098 44365-44395 Phosphorylation denotes C/EBP-β phosphorylated on T217
T21097 41214-41233 Positive_regulation denotes LPS-induced C/EBP-β
T21096 41214-41233 Gene_expression denotes LPS-induced C/EBP-β
T21095 41997-42052 Transcription denotes PMA-inducible transcription of the murine SerpinB2 gene
T21094 42758-42773 Gene_expression denotes gene expression
T21093 42960-43021 Transcription denotes both constitutive and LPS-induced SerpinB2 gene transcription
T21092 42610-42672 Binding denotes between C/EBP-β and CRE binding proteins (CREB) and AP-1 [63],
T21091 41090-41108 Transcription denotes gene transcription
T21090 43737-43773 Gene_expression denotes LPS-induced SerpinB2 gene expression
T21089 43114-43205 Negative_regulation denotes induction in C/EBP-β-deficient peritoneal macrophages by LPS and IFNγ was severely impaired
T21088 44131-44158 Gene_expression denotes of SerpinB2 gene expression
T21087 46617-46695 Regulation denotes mediating both constitutive and LPS-induced transcription of the SerpinB2 gene
T21086 44116-44169 Regulation denotes the regulation of SerpinB2 gene expression by C/EBP-β
T21085 42703-42773 Binding denotes to physically interact with AP-1, and NF-κB to promote gene expression
T21084 41987-42052 Regulation denotes mediating PMA-inducible transcription of the murine SerpinB2 gene
T21083 41545-41578 Transcription denotes LPS-inducible gene transcription,
T21082 45009-45132 Regulation denotes expression of the C/EBP-β phospho-acceptor site mutant, C/EBP-βT188A, did not affect SerpinB2 promoter activity differently true
T21081 42857-42895 Transcription denotes transcription of the C/EBP-β gene [67]
T21080 41051-41059 Entity denotes LPS [16]
T21079 46485-46498 Entity denotes immune cells,
T21078 40812-40823 Entity denotes macrophages
T21077 41444-41488 Entity denotes The murine SerpinB2 proximal promoter region
T21076 41880-41888 Protein denotes SerpinB2
T21075 47226-47234 Protein denotes SerpinB2
T21074 43882-43910 Protein denotes other inflammatory cytokines
T21073 43599-43606 Protein denotes C/EBP-β
T21072 43775-43798 Protein denotes C/EBP-β, like SerpinB2,
T21071 44789-44797 Protein denotes SerpinB2
T21070 41391-41399 Protein denotes SerpinB2
T21069 45539-45550 Entity denotes LPS-induced
T21068 43408-43442 Entity denotes transduced peritoneal macrophages,
T21067 41652-41655 Entity denotes LPS
T21066 42662-42672 Protein denotes AP-1 [63],
T21065 41000-41005 Protein denotes NF-κB
T21064 43472-43479 Protein denotes C/EBP-β
T21063 46854-46859 Protein denotes C/EBP
T21062 45376-45383 Protein denotes C/EBP-β
T21061 40995-41005 Protein denotes IKKβ/NF-κB
T21060 43076-43084 Protein denotes SerpinB2
T21059 43737-43748 Entity denotes LPS-induced
T21058 42449-42460 Entity denotes nucleotides
T21057 41536-41540 Entity denotes PMA-
T21056 41317-41346 Entity denotes promoter in vitro and in vivo
T21055 44134-44142 Protein denotes SerpinB2
T21054 42871-42890 Protein denotes of the C/EBP-β gene
T21053 46964-46975 Entity denotes LPS-induced
T21052 43171-43174 Entity denotes LPS
T21051 45330-45341 Entity denotes LPS-induced
T21050 41378-41404 Protein denotes constitutive SerpinB2 gene
T21049 43668-43673 Protein denotes C/EBP
T21048 41357-41367 Protein denotes of C/EBP-β
T21047 43179-43183 Protein denotes IFNγ
T21046 45094-45111 Entity denotes SerpinB2 promoter
T21045 42109-42112 Entity denotes PMA
T21044 45707-45714 Protein denotes C/EBP-β
T21043 42741-42746 Protein denotes NF-κB
T21042 46850-46864 Entity denotes the C/EBP site
T21041 43864-43867 Entity denotes LPS
T21040 43789-43797 Protein denotes SerpinB2
T21039 46421-46428 Protein denotes C/EBP-β
T21038 44365-44395 Protein denotes C/EBP-β phosphorylated on T217
T21037 43215-43244 Entity denotes to wild-type macrophages [68]
T21036 41731-41734 Protein denotes CRE
T21035 45448-45452 Protein denotes MEFs
T21034 41668-41690 Protein denotes of the murine SerpinB2
T21033 45704-45718 Entity denotes of C/EBP-β S64
T21032 43103-43107 Protein denotes gene
T21031 45231-45248 Entity denotes SerpinB2 promoter
T21030 44606-44614 Entity denotes acceptor
T21029 41559-41563 Protein denotes gene
T21028 44842-44845 Entity denotes LPS
T21027 41214-41225 Entity denotes LPS-induced
T21026 42228-42248 Entity denotes of the LPS-inducible
T21025 42504-42508 Protein denotes AP-1
T21024 40608-40619 Entity denotes Macrophages
T21023 44972-44985 Protein denotes SerpinB2 gene
T21022 44585-44626 Entity denotes of a C/EBP-β phospho-acceptor site mutant
T21021 41915-41926 Entity denotes nucleotides
T21020 41743-41847 Protein denotes AP-1-like elements, demonstrated to mediate PMA-stimulated transcription of the human SERPINB2 gene [37]
T21019 45065-45077 Protein denotes C/EBP-βT188A
T21018 46682-46690 Protein denotes SerpinB2
T21017 42167-42222 Entity denotes of the murine SerpinB2 promoter containing these sites,
T21016 44902-44932 Entity denotes the T217 phospho-acceptor site
T21015 42039-42047 Protein denotes SerpinB2
T21014 44724-44742 Protein denotes wild-type C/EBP-β,
T21013 44159-44169 Protein denotes by C/EBP-β
T21012 45565-45576 Protein denotes of SerpinB2
T21011 45737-45751 Protein denotes IFNγ-regulated
T21010 44675-44683 Protein denotes SerpinB2
T21009 45799-45810 Protein denotes MLK3-driven
T21008 42357-42360 Entity denotes LPS
T21007 44550-44563 Protein denotes SerpinB2 [16]
T21006 42630-42633 Protein denotes CRE
T21005 44242-44252 Protein denotes of C/EBP-β
T21004 41144-41174 Entity denotes the SerpinB2 proximal promoter
T21003 40894-40929 Protein denotes of the pro-survival factor SerpinB2
T21002 42025-42052 Protein denotes of the murine SerpinB2 gene
T21001 44256-44293 Entity denotes several different amino acid residues
T21000 44134-44147 Protein denotes SerpinB2 gene
T20999 42982-42993 Entity denotes LPS-induced
T20998 42960-43021 Protein denotes both constitutive and LPS-induced SerpinB2 gene transcription
T20997 45181-45195 Protein denotes of C/EBP-βS64A
T20996 45020-45063 Protein denotes of the C/EBP-β phospho-acceptor site mutant
T20995 43513-43533 Protein denotes While C/EBP proteins
T20994 42210-42221 Entity denotes these sites
T20993 41787-41801 Entity denotes PMA-stimulated
T20992 45094-45102 Protein denotes SerpinB2
T20991 42652-42656 Protein denotes CREB
T20990 43484-43492 Protein denotes SerpinB2
T20989 41816-41847 Protein denotes of the human SERPINB2 gene [37]
T20988 44906-44910 Entity denotes T217
T20987 40773-40800 Entity denotes the bacterial endotoxin LPS
T20986 41455-41463 Protein denotes SerpinB2
T20985 42878-42885 Protein denotes C/EBP-β
T20984 41700-41708 Entity denotes promoter
T20983 40995-41005 Protein denotes IKKβ/NF-κB
T20982 41148-41156 Protein denotes SerpinB2
T20981 43339-43352 Protein denotes SerpinB2 mRNA
T20980 43552-43562 Entity denotes homodimers
T20979 43484-43497 Protein denotes SerpinB2 gene
T20978 42758-42762 Protein denotes gene
T20977 44351-44361 Protein denotes genes [63]
T20976 46323-46387 Protein denotes cytokine profiles which can affect immune cell polarization [27]
T20975 43127-43134 Protein denotes C/EBP-β
T20974 45342-45350 Protein denotes SerpinB2
T20973 44585-44626 Entity denotes of a C/EBP-β phospho-acceptor site mutant
T20972 43519-43524 Protein denotes C/EBP
T20971 43251-43254 Protein denotes PCR
T20970 43339-43347 Protein denotes SerpinB2
T20969 45829-45835 Entity denotes of S64
T20968 42677-42684 Protein denotes C/EBP-β
T20967 41941-41952 Entity denotes These sites
T20966 46976-46984 Protein denotes SerpinB2
T20965 43633-43638 Protein denotes C/EBP
T20964 44653-44657 Protein denotes MEFs
T20963 44008-44098 Protein denotes SerpinB2 has been demonstrated to protect from bacterial and viral-induced cell death [14]
T20962 41214-41233 Protein denotes LPS-induced C/EBP-β
T20961 46976-47000 Protein denotes SerpinB2 gene expression
T20960 47105-47122 Entity denotes SerpinB2 promoter
T20959 43936-43953 Protein denotes C/EBP-β-null mice
T20958 41829-41837 Protein denotes SERPINB2
T20957 41295-41316 Protein denotes the SerpinB2 proximal
T20956 43659-43667 Protein denotes SerpinB2
T20955 44902-44932 Entity denotes the T217 phospho-acceptor site
T20947 45498-45507 Entity denotes this site
T20946 46010-46042 Entity denotes immune cells such as macrophages
T20945 47105-47113 Protein denotes SerpinB2
T20944 41200-41212 Protein denotes upon C/EBP-β
T20943 44628-44650 Protein denotes C/EBPβT217A, in Cebpb−
T20942 44274-44284 Entity denotes amino acid
T20941 42481-42499 Protein denotes the downstream CRE
T20940 41497-41508 Entity denotes nucleotides
T20939 45305-45308 Entity denotes S64
T20938 45593-45601 Entity denotes promoter
T20937 42223-42248 Entity denotes most of the LPS-inducible
T20936 41090-41094 Protein denotes gene
T20935 42642-42657 Protein denotes proteins (CREB)
T20934 44417-44435 Entity denotes rescue macrophages
T20933 43003-43007 Protein denotes gene
T20932 41869-41939 Entity denotes the murine SerpinB2 proximal promoter between nucleotides −189 and −87
T20931 45231-45239 Protein denotes SerpinB2
T20930 45857-45882 Entity denotes in LPS-signaling pathways
T20929 46582-46589 Protein denotes C/EBP-β
T20928 44972-44980 Protein denotes SerpinB2
T20927 44481-44498 Protein denotes lethal toxin (LT)
T20926 42912-42919 Protein denotes C/EBP-β
T20925 45644-45678 Protein denotes that Mixed lineage kinase-3 (MLK3)
T20924 45342-45359 Entity denotes SerpinB2 promoter
T20923 42618-42625 Protein denotes C/EBP-β
T20922 42400-42405 Protein denotes C/EBP
T20921 46284-46295 Protein denotes of SerpinB2
T20920 44785-44806 Entity denotes the SerpinB2 promoter
T20919 44644-44650 Protein denotes Cebpb−
T20918 44693-44701 Entity denotes promoter
T20917 40931-40939 Protein denotes SerpinB2
T20916 46649-46660 Entity denotes LPS-induced
T20915 45291-45301 Protein denotes of C/EBP-β
T20914 46891-46899 Protein denotes SerpinB2
T20913 46110-46118 Protein denotes SerpinB2
T20912 41081-41130 Protein denotes SerpinB2 gene transcription in response to LPS is
T20911 43135-43167 Entity denotes deficient peritoneal macrophages
T20910 46891-46917 Entity denotes SerpinB2 proximal promoter
T20909 45219-45230 Entity denotes LPS-induced
T20908 43726-43773 Protein denotes C/EBP-β in LPS-induced SerpinB2 gene expression
T20907 42181-42189 Protein denotes SerpinB2
T20906 42330-42346 Entity denotes nucleotides −189
T20905 41597-41600 Entity denotes PMA
T20904 45376-45387 Entity denotes C/EBP-β S64
T20903 42731-42736 Protein denotes AP-1,
T20902 41269-41274 Protein denotes C/EBP
T20954 46675-46695 Protein denotes of the SerpinB2 gene
T20953 43566-43584 Entity denotes heterodimers [63],
T20952 42826-42830 Protein denotes CREB
T20951 45673-45677 Protein denotes MLK3
T20950 43749-43757 Protein denotes SerpinB2
T20949 44391-44395 Entity denotes T217
T20948 46010-46030 Entity denotes immune cells such as
T17650 39603-39648 Transcription denotes C/EBP-β-dependent SerpinB2 gene transcription
T17649 38894-38938 Gene_expression denotes Re-expression of wild-type C/EBP-β in Cebpb−
T17648 39148-39198 Gene_expression denotes Expression of the C/EBP-β phospho-acceptor mutant,
T17647 38615-38679 Positive_regulation denotes for LPS-stimulated SerpinB2 proximal promoter activity (Fig. 8B)
T17646 40211-40235 Gene_expression denotes SerpinB2 gene expression
T17645 39603-39648 Regulation denotes C/EBP-β-dependent SerpinB2 gene transcription
T17644 39107-39146 Transcription denotes LPS-induced SerpinB2 gene transcription
T17643 39945-40023 Regulation denotes SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29]
T17642 39589-39648 Regulation denotes in modulating C/EBP-β-dependent SerpinB2 gene transcription
T17641 40539-40567 Regulation denotes negatively regulate SerpinB2
T17640 39945-40023 Positive_regulation denotes SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29]
T17639 39945-40023 Gene_expression denotes SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29]
T17638 39679-39696 Regulation denotes regulating DAPK1,
T17637 39866-39932 Transcription denotes for LPS-induced transcription of the cytokines IL-6 and MCP-1 [64]
T17636 39866-39932 Transcription denotes for LPS-induced transcription of the cytokines IL-6 and MCP-1 [64]
T17635 38563-38679 Phosphorylation denotes C/EBP-β phosphorylation sites that may be important for LPS-stimulated SerpinB2 proximal promoter activity (Fig. 8B)
T17634 38971-39015 Gene_expression denotes SerpinB2 luciferase reporter gene expression
T17633 38351-38453 Regulation denotes Phosphorylation of C/EBP-β at Serine 64 negatively Regulates LPS-stimulated SerpinB2 Promoter Activity
T17632 40497-40530 Phosphorylation denotes phosphorylation of C/EBP-β at S64
T17631 38941-39038 Positive_regulation denotes MEFs significantly stimulated SerpinB2 luciferase reporter gene expression in the presence of LPS
T17630 40367-40396 Gene_expression denotes the expression of C/EBP-βS64A
T17629 38412-38453 Positive_regulation denotes LPS-stimulated SerpinB2 Promoter Activity
T17628 38980-38990 Protein denotes luciferase
T17627 38634-38660 Entity denotes SerpinB2 proximal promoter
T17626 39260-39277 Entity denotes SerpinB2 promoter
T17625 38470-38480 Protein denotes of C/EBP-β
T17624 39215-39221 Protein denotes Cebpb−
T17623 40513-40523 Protein denotes of C/EBP-β
T17622 39000-39004 Protein denotes gene
T17621 39431-39439 Protein denotes SerpinB2
T17620 39690-39696 Protein denotes DAPK1,
T17619 39495-39527 Entity denotes additional phosphorylation sites
T17618 38806-38813 Entity denotes alanine
T17617 39621-39634 Protein denotes SerpinB2 gene
T17616 40456-40459 Protein denotes Fig
T17615 40277-40285 Protein denotes SerpinB2
T17614 38832-38835 Protein denotes LmP
T17613 40323-40357 Protein denotes wild-type C/EBP-β-transfected MEFs
T17612 39965-39971 Entity denotes by LPS
T17611 39603-39620 Protein denotes C/EBP-β-dependent
T17610 40382-40396 Protein denotes of C/EBP-βS64A
T17609 39260-39268 Protein denotes SerpinB2
T17608 40409-40417 Protein denotes SerpinB2
T17607 39478-39485 Protein denotes C/EBP-β
T17606 39945-39953 Protein denotes SerpinB2
T17605 38412-38426 Entity denotes LPS-stimulated
T17604 38563-38679 Entity denotes C/EBP-β phosphorylation sites that may be important for LPS-stimulated SerpinB2 proximal promoter activity (Fig. 8B)
T17603 39159-39198 Protein denotes of the C/EBP-β phospho-acceptor mutant,
T17602 39473-39476 Entity denotes LPS
T17601 38773-38779 Entity denotes serine
T17600 38705-38737 Protein denotes C/EBP-β phospho-acceptor mutants
T17599 39199-39221 Protein denotes C/EBPβT217A, in Cebpb−
T17598 39650-39661 Protein denotes C/EBP-βT188
T17597 38634-38642 Protein denotes SerpinB2
T17596 40129-40137 Protein denotes SerpinB2
T17595 39899-39917 Protein denotes the cytokines IL-6
T17594 39383-39387 Entity denotes T217
T17593 39119-39132 Protein denotes SerpinB2 gene
T17592 38826-38892 Protein denotes the pGLmP-539 murine SerpinB2 luciferase reporter in Cebpb−/− MEFs
T17591 40117-40124 Protein denotes C/EBP-β
T17590 38427-38444 Entity denotes SerpinB2 Promoter
T17589 38971-38979 Protein denotes SerpinB2
T17588 39051-39054 Protein denotes Fig
T17587 39899-39917 Protein denotes the cytokines IL-6
T17586 39870-39881 Entity denotes LPS-induced
T17585 39107-39118 Entity denotes LPS-induced
T17584 38619-38633 Entity denotes LPS-stimulated
T17583 39621-39629 Protein denotes SerpinB2
T17582 39697-39780 Protein denotes an IFNγ-inducible gene involved in the regulation of cell cycle and apoptosis [38],
T17581 40559-40567 Protein denotes SerpinB2
T17580 40211-40219 Protein denotes SerpinB2
T17579 38760-38787 Entity denotes threonine or serine residue
T17578 38932-38938 Protein denotes Cebpb−
T17577 38427-38435 Protein denotes SerpinB2
T17576 40006-40023 Protein denotes to cytokines [29]
T17575 40237-40261 Protein denotes C/EBP-βT188A-transfected
T17574 38908-38928 Protein denotes of wild-type C/EBP-β
T17573 39301-39318 Protein denotes wild-type C/EBP-β
T17572 39119-39127 Protein denotes SerpinB2
T17571 39369-39379 Protein denotes of C/EBP-β
T17570 39035-39038 Entity denotes LPS
T17569 38381-38390 Entity denotes Serine 64
T17568 39431-39448 Entity denotes SerpinB2 promoter
T17567 39320-39323 Protein denotes Fig
T17566 40409-40426 Entity denotes SerpinB2 promoter
T17565 39224-39228 Protein denotes MEFs
T17564 39093-39103 Protein denotes of C/EBP-β
T17563 38563-38570 Protein denotes C/EBP-β
T17562 40237-40266 Protein denotes C/EBP-βT188A-transfected MEFs
T17561 38367-38377 Protein denotes of C/EBP-β
T17560 39545-39555 Protein denotes C/EBP-βS64
T17559 38760-38769 Entity denotes threonine
T17558 40163-40191 Entity denotes these phospho-acceptor sites
T17557 40177-40185 Entity denotes acceptor
T17556 40451-40454 Entity denotes LPS
T17555 40277-40294 Entity denotes SerpinB2 promoter
T17554 38941-38945 Protein denotes MEFs
T17553 39922-39927 Protein denotes MCP-1
T17552 40527-40530 Entity denotes S64
T17551 38879-38892 Protein denotes Cebpb−/− MEFs
T17550 39842-39852 Protein denotes C/EBP-βS64
T17549 40333-40352 Protein denotes C/EBP-β-transfected
T16105 36146-36252 Binding denotes Since C/EBP-β binds to the SerpinB2 proximal promoter in an LPS-inducible manner both in vitro and in vivo
T16104 36646-36687 Positive_regulation denotes LPS-stimulated SerpinB2 promoter activity
T16103 36447-36497 Regulation denotes to direct transcription from the SerpinB2 proximal
T16102 36072-36145 Positive_regulation denotes C/EBP-β Promotes LPS-inducible Murine SerpinB2 Proximal Promoter Activity
T16101 36626-36630 Protein denotes MEFs
T16100 36299-36306 Protein denotes C/EBP-β
T16099 36604-36609 Protein denotes Cebpb
T16098 36476-36497 Protein denotes the SerpinB2 proximal
T16097 36152-36159 Protein denotes C/EBP-β
T16096 36387-36392 Entity denotes cells
T16095 36856-36864 Entity denotes promoter
T16094 36072-36079 Protein denotes C/EBP-β
T16093 36128-36136 Entity denotes Promoter
T16092 36498-36506 Entity denotes promoter
T16091 36544-36548 Protein denotes GLmP
T16090 36728-36732 Protein denotes MEFs
T16089 36765-36768 Protein denotes Fig
T16088 36362-36383 Entity denotes the SerpinB2 promoter
T16087 36646-36660 Entity denotes LPS-stimulated
T16086 36661-36669 Protein denotes SerpinB2
T16085 36617-36623 Protein denotes Cebpb−
T16084 36786-36809 Protein denotes that endogenous C/EBP-β
T16083 36759-36763 Protein denotes MEFs
T16082 36366-36374 Protein denotes SerpinB2
T16081 36826-36873 Protein denotes LPS-induced SerpinB2 proximal promoter activity
T16080 36425-36446 Protein denotes of endogenous C/EBP-β
T16079 36826-36837 Entity denotes LPS-induced
T16078 36173-36181 Protein denotes SerpinB2
T16077 36661-36678 Entity denotes SerpinB2 promoter
T16076 36750-36756 Protein denotes Cebpb−
T16075 36166-36199 Entity denotes to the SerpinB2 proximal promoter
T16074 36408-36411 Entity denotes LPS
T16073 36110-36118 Protein denotes SerpinB2
T16072 36560-36588 Protein denotes SerpinB2 luciferase reporter
T15328 34754-34781 Phosphorylation denotes T217-phosphorylated C/EBP-β
T15327 33351-33373 Binding denotes of C/EBP-β recruitment
T15326 33226-33268 Binding denotes C/EBP-β Binds the Murine SerpinB2 Proximal
T15325 34341-34413 Binding denotes p-C/EBP-βT217 was constitutively bound to the SerpinB2 proximal promoter
T15324 34501-34564 Binding denotes the binding affinity of p-C/EBP-βT217 for the SerpinB2 proximal
T15323 34501-34564 Binding denotes the binding affinity of p-C/EBP-βT217 for the SerpinB2 proximal
T15322 34709-34734 Binding denotes p-C/EBP-βT217 recruitment
T15321 34060-34083 Phosphorylation denotes C/EBP-β phosphorylation
T15320 34123-34154 Positive_regulation denotes transactivate target genes [38]
T15319 33879-33896 Entity denotes with the promoter
T15318 33785-33792 Protein denotes C/EBP-β
T15317 33826-33834 Protein denotes SerpinB2
T15316 34203-34211 Protein denotes SerpinB2
T15315 34754-34773 Entity denotes T217-phosphorylated
T15314 34633-34638 Protein denotes 8 hrs
T15313 34539-34564 Protein denotes for the SerpinB2 proximal
T15312 33436-33445 Entity denotes chromatin
T15311 33388-33396 Protein denotes SerpinB2
T15310 33822-33843 Entity denotes the SerpinB2 promoter
T15309 34257-34264 Protein denotes C/EBP-β
T15308 34697-34704 Protein denotes C/EBP-β
T15307 34387-34395 Protein denotes SerpinB2
T15306 34590-34593 Entity denotes LPS
T15305 33377-33405 Entity denotes the murine SerpinB2 promoter
T15304 33269-33312 Entity denotes Promoter in vivo in an LPS-inducible Manner
T15303 34522-34538 Protein denotes of p-C/EBP-βT217
T15302 34199-34288 Entity denotes the SerpinB2 proximal promoter of the T217 phosphorylated C/EBP-β isoform (p-C/EBP-βT217)
T15301 34380-34413 Entity denotes to the SerpinB2 proximal promoter
T15300 34233-34288 Entity denotes the T217 phosphorylated C/EBP-β isoform (p-C/EBP-βT217)
T15299 34137-34154 Protein denotes target genes [38]
T15298 34060-34067 Protein denotes C/EBP-β
T15297 34842-34850 Protein denotes SerpinB2
T15296 34462-34465 Protein denotes Fig
T15295 33532-33549 Entity denotes soluble chromatin
T15294 33240-33268 Protein denotes the Murine SerpinB2 Proximal
T15293 34838-34859 Entity denotes the SerpinB2 promoter
T15292 34027-34032 Protein denotes 8 hrs
T15291 34565-34639 Entity denotes promoter diminished with LPS stimulation at later timepoints (4 and 8 hrs)
T15290 34316-34339 Entity denotes with cell survival [65]
T15289 33573-33588 Entity denotes with antibodies
T15288 34274-34287 Protein denotes p-C/EBP-βT217
T15287 34492-34500 Protein denotes C/EBP-β,
T15286 33700-33726 Entity denotes proximal promoter specific
T15285 34640-34643 Protein denotes Fig
T15284 34445-34448 Entity denotes LPS
T15283 33226-33233 Protein denotes C/EBP-β
T15282 33511-33514 Entity denotes LPS
T15281 33623-33639 Entity denotes the enriched DNA
T15280 33965-33968 Entity denotes LPS
T15279 34034-34037 Protein denotes Fig
T15278 33913-33924 Entity denotes macrophages
T15277 34709-34722 Protein denotes p-C/EBP-βT217
T15276 34341-34354 Protein denotes p-C/EBP-βT217
T15275 33421-33472 Entity denotes LPS in vivo by chromatin immunoprecipitation (ChIP)
T15274 33691-33699 Protein denotes SerpinB2
T15273 33519-33530 Protein denotes up to 8 hrs
T15272 33680-33684 Protein denotes qPCR
T15271 34754-34781 Protein denotes T217-phosphorylated C/EBP-β
T15270 33354-33361 Protein denotes C/EBP-β
T15269 33597-33618 Protein denotes DNA binding proteins,
T14532 31375-31378 Protein denotes Fig
T14531 31275-31288 Protein denotes SerpinB2 mRNA
T14530 31242-31252 Protein denotes of C/EBP-β
T14529 31408-31416 Protein denotes SerpinB2
T14528 30904-30936 Entity denotes Inflammatory Primary Macrophages
T14527 31301-31304 Entity denotes LPS
T14526 31829-31863 Entity denotes deficient inflammatory macrophages
T14525 31206-31225 Protein denotes endogenous SerpinB2
T14524 31149-31167 Protein denotes endogenous C/EBP-β
T14523 31725-31730 Protein denotes MEFs,
T14522 30967-30977 Protein denotes of C/EBP-β
T14521 31463-31469 Protein denotes Cebpb−
T14520 31169-31183 Protein denotes Wild-type MEFs
T14519 31612-31619 Protein denotes C/EBP-β
T14518 31903-31910 Protein denotes C/EBP-β
T14517 30816-30823 Protein denotes C/EBP-β
T14516 31753-31764 Entity denotes LPS-induced
T14515 31049-31073 Protein denotes C/EBP-β-null (Cebpb −/−)
T14514 31275-31283 Protein denotes SerpinB2
T14513 31393-31396 Entity denotes LPS
T14512 31865-31868 Protein denotes Fig
T14511 31821-31828 Protein denotes C/EBP-β
T14510 31765-31778 Protein denotes SerpinB2 mRNA
T14509 30981-31000 Protein denotes endogenous SerpinB2
T14508 31078-31104 Protein denotes wild-type MEFs (Cebpb+/+),
T14507 31359-31373 Protein denotes wild-type MEFs
T14506 31417-31421 Protein denotes mRNA
T14505 31001-31005 Protein denotes mRNA
T14504 31331-31339 Protein denotes SerpinB2
T14503 31554-31602 Entity denotes thioglycollate-elicited inflammatory macrophages
T14502 31472-31476 Protein denotes MEFs
T14501 31331-31344 Protein denotes SerpinB2 mRNA
T14500 30876-30880 Protein denotes mRNA
T14499 31996-32004 Protein denotes SerpinB2
T14498 31982-32009 Protein denotes of endogenous SerpinB2 mRNA
T14497 31765-31773 Protein denotes SerpinB2
T14553 30876-30936 Gene_expression denotes mRNA Expression in MEFs and Inflammatory Primary Macrophages
T14552 30876-30936 Transcription denotes mRNA Expression in MEFs and Inflammatory Primary Macrophages
T14551 31001-31036 Gene_expression denotes mRNA expression in response to LPS,
T14550 31001-31036 Transcription denotes mRNA expression in response to LPS,
T14549 31937-32009 Transcription denotes constitutive and LPS-inducible transcription of endogenous SerpinB2 mRNA
T14548 31264-31299 Gene_expression denotes endogenous SerpinB2 mRNA expression
T14547 31385-31469 Negative_regulation denotes whereas LPS-stimulated SerpinB2 mRNA expression was significantly dampened in Cebpb−
T14546 31385-31469 Negative_regulation denotes whereas LPS-stimulated SerpinB2 mRNA expression was significantly dampened in Cebpb−
T14545 31328-31355 Gene_expression denotes in SerpinB2 mRNA expression
T14544 31612-31630 Gene_expression denotes C/EBP-β expression
T14543 31417-31432 Transcription denotes mRNA expression
T14542 31417-31432 Gene_expression denotes mRNA expression
T14541 31301-31373 Positive_regulation denotes LPS stimulated an increase in SerpinB2 mRNA expression in wild-type MEFs
T14540 31316-31373 Positive_regulation denotes an increase in SerpinB2 mRNA expression in wild-type MEFs
T14539 31393-31416 Positive_regulation denotes LPS-stimulated SerpinB2
T14538 31753-31789 Gene_expression denotes LPS-induced SerpinB2 mRNA expression
T14537 31753-31863 Negative_regulation denotes LPS-induced SerpinB2 mRNA expression was significantly decreased in C/EBP-β-deficient inflammatory macrophages
T14536 31923-32009 Regulation denotes for mediating constitutive and LPS-inducible transcription of endogenous SerpinB2 mRNA
T14535 30855-30875 Protein denotes LPS-induced SerpinB2
T14534 30855-30866 Entity denotes LPS-induced
T14533 30895-30899 Protein denotes MEFs
T13592 30403-30410 Protein denotes C/EBP-ε
T13591 29604-29609 Protein denotes C/EBP
T13590 29958-29965 Protein denotes C/EBP-β
T13589 30391-30398 Protein denotes C/EBP-δ
T13588 30373-30380 Protein denotes C/EBP-α
T13587 29546-29553 Protein denotes C/EBP-β
T13586 29625-29633 Protein denotes SerpinB2
T13585 29823-29828 Protein denotes C/EBP
T13584 30417-30425 Protein denotes antibody
T13583 30143-30148 Protein denotes C/EBP
T13582 30315-30343 Protein denotes the nucleo-protein complexes
T13581 30662-30700 Entity denotes of the LPS-inducible complex (Fig. 5C)
T13580 29979-29986 Protein denotes C/EBP-ε
T13579 29967-29974 Protein denotes C/EBP-δ
T13578 30252-30278 Entity denotes the LPS-inducible complex,
T13577 30771-30776 Protein denotes C/EBP
T13576 29819-29850 Protein denotes the C/EBP transcription factors
T13575 29949-29956 Protein denotes C/EBP-α
T13574 30474-30499 Protein denotes of the respective protein
T13573 30541-30556 Entity denotes nuclear extract
T13572 29559-29570 Entity denotes LPS-induced
T13571 30143-30157 Protein denotes C/EBP proteins
T13570 29656-29661 Protein denotes C/EBP
T13569 30189-30230 Entity denotes of the different nucleo-protein complexes
T13568 29678-29685 Entity denotes leucine
T13567 30315-30343 Entity denotes the nucleo-protein complexes
T13566 30606-30621 Entity denotes Only antibodies
T13565 29618-29651 Entity denotes of the SerpinB2 Proximal Promoter
T13564 30092-30105 Entity denotes extracellular
T13563 30003-30016 Entity denotes myeloid cells
T13562 30349-30359 Entity denotes antibodies
T13561 30806-30813 Protein denotes C/EBP-β
T13560 30742-30753 Entity denotes LPS-induced
T13559 30189-30230 Protein denotes of the different nucleo-protein complexes
T13558 30382-30389 Protein denotes C/EBP-β
T13557 30045-30122 Entity denotes differentiating myeloid cells depending on the extracellular environment [61]
T13556 30630-30637 Protein denotes C/EBP-β
T13555 30527-30556 Protein denotes antibody with nuclear extract
T12799 27756-27790 Binding denotes a high affinity C/EBP binding site
T12798 28298-28357 Binding denotes of a known C/EBP binding site from the rat albumin promoter
T12797 28449-28638 Binding denotes Together these data indicate that the putative SerpinB2 C/EBP site at −203/−192 binds a LPS-inducible complex that is likely to contain a member of the C/EBP family of transcription factors
T12796 27460-27507 Entity denotes Three different double stranded oligonucleotide
T12795 27642-27681 Protein denotes the same mutation as in pGLmP-539mC/EBP
T12794 27200-27203 Entity denotes LPS
T12793 27733-27736 Protein denotes DEI
T12792 28113-28118 Protein denotes C/EBP
T12791 27167-27184 Entity denotes The C/EBP Element
T12790 27411-27458 Entity denotes untreated and LPS-treated RAW 264.7 macrophages
T12789 27171-27176 Protein denotes C/EBP
T12788 27552-27587 Protein denotes the putative SerpinB2 C/EBP element
T12787 27690-27714 Entity denotes the rat albumin promoter
T12786 27389-27405 Entity denotes nuclear extracts
T12785 27772-27777 Protein denotes C/EBP
T12784 27293-27298 Protein denotes C/EBP
T12783 28045-28051 Entity denotes by LPS
T12782 28206-28222 Entity denotes oligonucleotide,
T12781 27698-27705 Protein denotes albumin
T12780 28298-28357 Entity denotes of a known C/EBP binding site from the rat albumin promoter
T12779 28483-28515 Entity denotes the putative SerpinB2 C/EBP site
T12778 28341-28348 Protein denotes albumin
T12777 27667-27671 Protein denotes GLmP
T12776 28496-28504 Protein denotes SerpinB2
T12775 28395-28422 Entity denotes the mutated oligonucleotide
T12774 27565-27573 Protein denotes SerpinB2
T12773 27841-27870 Entity denotes DNA-nuclear protein complexes
T12772 27232-27253 Entity denotes RAW 264.7 Macrophages
T12771 27921-27923 Entity denotes II
T12770 27756-27790 Entity denotes a high affinity C/EBP binding site
T12769 27940-27949 Entity denotes complexes
T12768 28483-28515 Protein denotes the putative SerpinB2 C/EBP site
T12767 28053-28078 Entity denotes The LPS-inducible complex
T12766 27425-27436 Entity denotes LPS-treated
T12765 27194-27253 Entity denotes by an LPS-induced Nuclear Factor from RAW 264.7 Macrophages
T12764 28333-28357 Entity denotes the rat albumin promoter
T12763 27614-27622 Protein denotes SerpinB2
T12762 28025-28032 Entity denotes complex
T12761 28601-28606 Protein denotes C/EBP
T12760 28535-28638 Entity denotes a LPS-inducible complex that is likely to contain a member of the C/EBP family of transcription factors
T12759 28309-28314 Protein denotes C/EBP
T12044 25456-25548 Gene_expression denotes have also recently implicated this C/EBP site in LPS-induced activation of the SerpinB2 gene
T12043 24559-24688 Regulation denotes C/EBP, CRE and Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter are Essential for Optimal LPS-inducible Transcription
T12042 24559-24688 Regulation denotes C/EBP, CRE and Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter are Essential for Optimal LPS-inducible Transcription
T12041 24559-24688 Regulation denotes C/EBP, CRE and Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter are Essential for Optimal LPS-inducible Transcription
T12040 24815-24925 Regulation denotes sites for transcription factors previously reported to mediate LPS-inducible transcription in other genes [57]
T12039 25505-25548 Positive_regulation denotes LPS-induced activation of the SerpinB2 gene
T12038 25411-25419 Protein denotes SerpinB2
T12037 26936-26946 Protein denotes luciferase
T12036 25402-25437 Entity denotes the −189 SerpinB2 promoter deletion
T12035 25134-25168 Entity denotes of the consensus E box (−538/−533)
T12034 25535-25543 Protein denotes SerpinB2
T12033 26849-26853 Protein denotes AP-1
T12032 26598-26606 Protein denotes SERPINB2
T12031 24574-24634 Entity denotes Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter
T12030 27101-27104 Entity denotes LPS
T12029 25348-25356 Entity denotes promoter
T12028 26728-26731 Entity denotes LPS
T12027 26465-26472 Protein denotes the CRE
T12026 27042-27049 Protein denotes the CRE
T12025 24592-24634 Entity denotes the Murine SerpinB2 Gene Proximal Promoter
T12024 25491-25496 Protein denotes C/EBP
T12023 25505-25516 Entity denotes LPS-induced
T12022 26622-26633 Entity denotes these sites
T12021 25019-25028 Protein denotes the pGLmP
T12020 26961-26989 Entity denotes the murine SerpinB2 promoter
T12019 26972-26980 Protein denotes SerpinB2
T12018 25203-25220 Protein denotes Oct-1 (−296/−288)
T12017 27059-27063 Protein denotes AP-1
T12016 27138-27146 Protein denotes SerpinB2
T12015 26831-26872 Entity denotes either of the two AP-1 sites at −106/−100
T12014 26755-26763 Protein denotes SerpinB2
T12013 25528-25548 Protein denotes of the SerpinB2 gene
T12012 26744-26772 Entity denotes the murine SerpinB2 promoter
T12011 24909-24925 Protein denotes other genes [57]
T12010 25255-25263 Entity denotes promoter
T12009 26481-26485 Protein denotes AP-1
T12008 24559-24564 Protein denotes C/EBP
T12007 24566-24569 Protein denotes CRE
T12006 27016-27021 Protein denotes C/EBP
T12005 26506-26514 Protein denotes SerpinB2
T12004 26804-26814 Protein denotes of the CRE
T12003 24578-24582 Protein denotes AP-1
T12002 26495-26523 Entity denotes the murine SerpinB2 promoter
T12001 25486-25501 Entity denotes this C/EBP site
T12000 25094-25097 Protein denotes Fig
T11999 25170-25186 Protein denotes PU.1 (−412/−407)
T11998 24603-24611 Protein denotes SerpinB2
T11997 26655-26665 Entity denotes nucleotide
T11996 25221-25225 Entity denotes site
T11995 26477-26491 Entity denotes two AP-1 sites
T11994 26559-26620 Entity denotes in the PMA-responsiveness of the human SERPINB2 promoter [37]
T11993 24943-24953 Entity denotes nucleotide
T11992 25303-25308 Protein denotes C/EBP
T11991 25134-25168 Entity denotes of the consensus E box (−538/−533)
T11990 26585-26620 Entity denotes of the human SERPINB2 promoter [37]
T11989 25040-25082 Protein denotes SerpinB2 promoter-luciferase reporter gene
T11988 26838-26872 Entity denotes of the two AP-1 sites at −106/−100
T11987 25296-25313 Entity denotes of the C/EBP site
T11986 24592-24634 Protein denotes the Murine SerpinB2 Gene Proximal Promoter
T11985 26786-26789 Protein denotes Fig
T11984 24815-24925 Entity denotes sites for transcription factors previously reported to mediate LPS-inducible transcription in other genes [57]
T11983 27134-27164 Entity denotes the SerpinB2 proximal promoter
T10977 22344-22376 Gene_expression denotes of SerpinB2 gene expression [52]
T10976 22329-22376 Regulation denotes the regulation of SerpinB2 gene expression [52]
T10975 23510-23564 Binding denotes potential binding sites for PU.1 (−412/−407) and Oct-1
T10974 23005-23013 Protein denotes SERPINB2
T10973 22917-22978 Entity denotes the transcription initiation site, similar to the position of
T10972 22088-22096 Protein denotes SerpinB2
T10971 22011-22031 Protein denotes potential cis-acting
T10970 23065-23080 Protein denotes protein (C/EBP)
T10969 23074-23079 Protein denotes C/EBP
T10968 23293-23310 Entity denotes of the AP-1 sites
T10967 22530-22563 Entity denotes The proximal promoter (Region E),
T10966 23258-23261 Protein denotes CRE
T10965 23778-23782 Entity denotes site
T10964 23538-23554 Protein denotes PU.1 (−412/−407)
T10963 22802-22839 Entity denotes the murine SerpinB2 promoter (Fig. 3)
T10962 22347-22355 Protein denotes SerpinB2
T10961 23635-23638 Protein denotes Fig
T10960 22159-22167 Protein denotes SerpinB2
T10959 22758-22766 Protein denotes SerpinB2
T10958 22593-22596 Entity denotes LPS
T10957 23510-23564 Entity denotes potential binding sites for PU.1 (−412/−407) and Oct-1
T10956 23236-23239 Entity denotes AMP
T10955 23111-23151 Protein denotes two potential activator protein 1 (AP-1)
T10954 23288-23310 Entity denotes Both of the AP-1 sites
T10953 23605-23626 Entity denotes the proximal promoter
T10952 21964-21998 Entity denotes Murine SerpinB2 Proximal Promoters
T10951 23360-23388 Entity denotes the human SERPINB2 promoter,
T10950 23799-23806 Entity denotes Fig. S2
T10949 23300-23304 Protein denotes AP-1
T10948 23480-23497 Entity denotes E box (−538/−533)
T10947 23393-23400 Protein denotes the CRE
T10946 23370-23378 Protein denotes SERPINB2
T10945 23559-23564 Protein denotes Oct-1
T10944 22979-23023 Entity denotes the TATA box of the human SERPINB2 gene [53]
T10943 22077-22101 Protein denotes the murine SerpinB2 gene
T10942 22748-22784 Entity denotes the human SerpinB2 proximal promoter
T10941 22813-22821 Protein denotes SerpinB2
T10940 22502-22518 Entity denotes murine promoters
T10939 22248-22292 Entity denotes potential transcription factor binding sites
T10938 22992-23023 Protein denotes of the human SERPINB2 gene [53]
T10937 23146-23150 Protein denotes AP-1
T10936 21971-21979 Protein denotes SerpinB2
T10935 23428-23460 Entity denotes a single central nucleotide [37]
T10934 23645-23678 Entity denotes Further upstream, a retinoic acid
T10018 19183-19284 Regulation denotes PMA-induced SerpinB2 gene regulation has been extensively studied in human macrophage cell lines [45]
T10017 20317-20320 Entity denotes PMA
T10016 19428-19436 Protein denotes SerpinB2
T10015 20344-20354 Entity denotes nucleotide
T10014 20037-20045 Protein denotes SerpinB2
T10013 18784-18792 Protein denotes SerpinB2
T10012 20141-20164 Protein denotes the −87 murine SerpinB2
T10011 19162-19165 Entity denotes PMA
T10010 19104-19114 Protein denotes luciferase
T10009 19976-19979 Entity denotes PMA
T10008 18799-18810 Entity denotes nucleotides
T10007 19195-19208 Protein denotes SerpinB2 gene
T10006 19944-19972 Entity denotes the murine SerpinB2 promoter
T10005 19487-19491 Entity denotes PMA-
T10004 20218-20222 Entity denotes PMA,
T10003 18770-18797 Protein denotes of the murine SerpinB2 gene
T10002 18695-18698 Protein denotes cis
T10001 20296-20304 Protein denotes SerpinB2
T10000 19183-19194 Entity denotes PMA-induced
T9999 18622-18652 Entity denotes The SerpinB2 Proximal Promoter
T9998 19195-19203 Protein denotes SerpinB2
T9997 19355-19370 Protein denotes AP-1 responsive
T9996 19155-19158 Entity denotes LPS
T9995 18622-18652 Protein denotes The SerpinB2 Proximal Promoter
T9994 20087-20090 Entity denotes LPS
T9993 20127-20130 Entity denotes PMA
T9992 19258-19268 Entity denotes macrophage
T9991 18961-18978 Protein denotes gene (pGL3 Basic)
T9990 18740-18797 Entity denotes LPS in the 5′ flanking region of the murine SerpinB2 gene
T9989 20030-20054 Entity denotes of the SerpinB2 promoter
T9988 18933-18951 Protein denotes firefly luciferase
T9987 18967-18971 Protein denotes pGL3
T9986 19643-19659 Entity denotes LPS-inducibility
T9985 19955-19963 Protein denotes SerpinB2
T9984 20165-20183 Entity denotes promoter construct
T9983 19861-19864 Entity denotes LPS
T9982 19581-19612 Entity denotes of the murine SerpinB2 promoter
T9981 19595-19603 Protein denotes SerpinB2
T9980 18661-18664 Entity denotes LPS
T9979 19787-19820 Entity denotes the LPS-response of the promoter,
T9978 19053-19087 Entity denotes sub-confluent RAW264.7 macrophages
T9977 18967-18977 Protein denotes pGL3 Basic
T9976 20285-20313 Entity denotes the murine SerpinB2 promoter
T9975 19807-19819 Entity denotes the promoter
T9282 17894-17927 Positive_regulation denotes an increase in gene transcription
T9281 17688-17729 Gene_expression denotes of LPS-inducible SerpinB2 mRNA expression
T9280 17848-17879 Gene_expression denotes LPS-induced SerpinB2 expression
T9279 17906-17927 Transcription denotes in gene transcription
T9278 17492-17495 Entity denotes LPS
T9277 17601-17604 Entity denotes LPS
T9276 17796-17836 Entity denotes human peripheral blood mononuclear cells
T9275 17860-17868 Protein denotes SerpinB2
T9274 17946-17957 Protein denotes of the mRNA
T9273 17980-17988 Protein denotes SerpinB2
T9272 17848-17859 Entity denotes LPS-induced
T9271 17552-17556 Protein denotes mRNA
T9270 17450-17467 Protein denotes The SerpinB2 Gene
T9269 17909-17913 Protein denotes gene
T9268 18049-18071 Entity denotes other cell types [31],
T9267 17980-18027 Protein denotes SerpinB2 protein expression was also induced as
T9266 18102-18105 Entity denotes LPS
T9265 17762-17791 Entity denotes murine peritoneal macrophages
T9264 18076-18124 Protein denotes detectable after 8 hrs of LPS treatment (Fig. 1)
T9263 17643-17659 Protein denotes 24 hrs (Fig. 1A)
T9262 17543-17586 Protein denotes SerpinB2 mRNA was detectable as early as 30
T9261 17705-17718 Protein denotes SerpinB2 mRNA
T9260 17501-17521 Entity denotes RAW264.7 macrophages
T9259 17538-17542 Entity denotes LPS,
T9258 17454-17462 Protein denotes SerpinB2
T9257 17705-17713 Protein denotes SerpinB2
T8940 17353-17358 Protein denotes ANOVA
T8939 17363-17374 Entity denotes Student’s t
T8618 16787-16806 Binding denotes the bound chromatin
T8617 17018-17039 Protein denotes semi-quantitative PCR
T8616 16128-16133 Entity denotes cells
T8615 16474-16498 Entity denotes the following antibodies
T8614 16191-16210 Entity denotes Cells extracts were
T8613 16197-16205 Entity denotes extracts
T8612 16089-16096 Entity denotes glycine
T8611 16609-16626 Protein denotes RNA polymerase II
T8610 16966-16969 Protein denotes PCR
T8609 16500-16535 Protein denotes C/EBP-β (sc-150X), p-C/EBP-β (T217)
T8608 16020-16035 Entity denotes 1% formaldehyde
T8607 16001-16066 Entity denotes the chromatin with 1% formaldehyde at room temperature for 10 min
T8606 16821-16852 Entity denotes ChIP Elution Buffer (Millipore)
T8605 16186-16189 Entity denotes ice
T8604 16719-16728 Protein denotes Protein G
T8603 16399-16411 Entity denotes of chromatin
T8602 16500-16518 Protein denotes C/EBP-β (sc-150X),
T8601 17104-17134 Entity denotes the SerpinB2 proximal promoter
T8600 16997-17000 Entity denotes DNA
T8599 16857-16869 Protein denotes the proteins
T8598 17046-17050 Protein denotes qPCR
T8597 16530-16534 Entity denotes T217
T8596 16787-16806 Entity denotes the bound chromatin
T8595 16906-16911 Protein denotes 2 hrs
T8594 16889-16901 Protein denotes Proteinase K
T8593 16983-16995 Protein denotes Kit (Qiagen)
T8592 16921-16928 Entity denotes The DNA
T8591 16342-16345 Entity denotes ice
T8590 17108-17116 Protein denotes SerpinB2
T8058 15643-15684 Binding denotes Antibodies were purchased from Santa Cruz
T8057 15601-15641 Entity denotes ice with 4 µg of specific C/EBP antibody
T8056 15012-15038 Entity denotes RAW 264.7 nuclear extracts
T8055 15269-15272 Protein denotes cpm
T8054 15174-15186 Entity denotes 30% glycerol
T8053 15231-15247 Entity denotes nuclear extracts
T8052 15490-15500 Entity denotes acrylamide
T8051 15130-15148 Entity denotes 10 mM HEPES pH 7.9
T8050 15578-15641 Protein denotes pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody
T8049 15674-15679 Protein denotes Santa
T8048 14955-14994 Protein denotes prepared using T4 polynucleotide kinase
T8047 15731-15752 Protein denotes anti-C/EBP-δ (sc-151)
T8046 15556-15572 Entity denotes nuclear extracts
T8045 15627-15632 Protein denotes C/EBP
T8044 14890-14921 Entity denotes double-stranded oligonucleotide
T8043 15537-15554 Entity denotes supershift assays
T8042 15473-15485 Entity denotes 1 acrylamide
T8041 15643-15653 Entity denotes Antibodies
T8040 15204-15221 Entity denotes 1 µg poly (dI-dC)
T8039 15486-15500 Protein denotes bis-acrylamide
T8038 15449-15463 Entity denotes polyacrylamide
T8037 14970-14972 Entity denotes T4
T8036 15615-15641 Entity denotes of specific C/EBP antibody
T8035 15159-15187 Entity denotes BSA, 2 mM DTT, 30% glycerol,
T8034 15486-15500 Entity denotes bis-acrylamide
T8033 15446-15468 Entity denotes 5% polyacrylamide gels
T8032 15610-15641 Entity denotes 4 µg of specific C/EBP antibody
T8031 15006-15010 Entity denotes -ATP
T8030 15053-15087 Entity denotes by the detergent lysis method [41]
T7596 14727-14785 Gene_expression denotes Expression of the C/EBP-β phospho-acceptor mutant proteins
T7595 11300-11310 Protein denotes Luciferase
T7594 13961-14003 Protein denotes a β-actin-β-galactosidase reporter plasmid
T7593 14497-14517 Protein denotes β-galactosidase [38]
T7592 13913-13923 Protein denotes luciferase
T7591 14237-14242 Protein denotes 4 hrs
T7590 14528-14538 Protein denotes Luciferase
T7589 14430-14433 Entity denotes DNA
T7588 13961-14003 Protein denotes a β-actin-β-galactosidase reporter plasmid
T7587 14344-14362 Protein denotes T188A, T217A, S64A
T7586 14217-14220 Entity denotes LPS
T7585 14436-14459 Protein denotes Luciferase activity was
T7584 13859-13871 Protein denotes MEFs (1×105)
T7583 14556-14596 Protein denotes β-Galactosidase Enzyme Assay System Kits
T6350 11807-11815 Entity denotes promoter
T6349 11319-11339 Entity denotes RAW264.7 Macrophages
T6348 12077-12101 Entity denotes absence of 100 ng/ml LPS
T6347 12569-12595 Protein denotes protein microassay reagent
T6346 11422-11432 Protein denotes luciferase
T6345 11473-11486 Protein denotes pRL-thymidine
T6344 11680-11697 Entity denotes the SV40 promoter
T6343 11300-11310 Protein denotes Luciferase
T6342 11951-11975 Entity denotes two identical cell pools
T6341 12379-12381 Protein denotes TK
T6340 12569-12595 Entity denotes protein microassay reagent
T6339 12514-12535 Entity denotes Protein concentration
T6338 11473-11486 Entity denotes pRL-thymidine
T6337 12419-12435 Protein denotes cellular protein
T6336 12323-12341 Protein denotes firefly luciferase
T6335 11575-11589 Protein denotes a Bio-Rad Gene
T5482 9883-9906 Protein denotes T4 DNA polymerase (NEB)
T5481 9775-9781 Protein denotes BstX I
T5480 9811-9816 Protein denotes Apo I
T5479 9552-9591 Protein denotes SerpinB2 luciferase reporter constructs
T5478 9617-9620 Protein denotes pGL
T5477 10016-10052 Entity denotes the murine SerpinB2 promoter regions
T5476 9501-9505 Protein denotes GLmP
T5475 10544-10548 Protein denotes GLmP
T5474 10680-10684 Protein denotes GLmP
T5473 11086-11096 Protein denotes the EcoR I
T5472 9721-9727 Protein denotes EcoR I
T5471 10679-10694 Protein denotes pGLmP-539mC/EBP
T5470 10895-10898 Protein denotes PCR
T5469 10255-10291 Entity denotes the SerpinB2 promoter LPS-responsive
T5468 9215-9218 Protein denotes PCR
T5467 9345-9360 Protein denotes Basic (Promega)
T5466 9593-9594 Entity denotes p
T5465 10866-10906 Entity denotes The flanking oligonucleotide PCR primers
T5464 9388-9394 Protein denotes EcoR I
T5463 9606-9610 Protein denotes GLmP
T5462 9799-9806 Protein denotes Hae III
T5461 10259-10267 Protein denotes SerpinB2
T5460 11061-11066 Protein denotes Xho I
T5459 10508-10511 Protein denotes Fig
T5458 10713-10717 Protein denotes PAI2
T5457 10798-10813 Protein denotes pGLmP-539mAP-1a
T5456 9500-9532 Entity denotes pGLmP-3261 to produce pGLmP-4480
T5455 9641-9642 Entity denotes p
T5454 10634-10638 Protein denotes GLmP
T5453 10323-10328 Protein denotes C/EBP
T5452 10799-10803 Protein denotes GLmP
T5451 9373-9377 Protein denotes GLmP
T5450 9125-9149 Entity denotes a Kpn I restriction site
T5449 9783-9790 Protein denotes Bsu36 I
T5448 11194-11202 Protein denotes SerpinB2
T5447 11170-11211 Entity denotes of the wild-type murine SerpinB2 promoter
T5446 9652-9657 Protein denotes pGLmP
T5445 9455-9496 Entity denotes the SerpinB2 promoter EcoR I site (−3261)
T5444 9523-9527 Protein denotes GLmP
T5443 9241-9249 Protein denotes SerpinB2
T5442 10712-10723 Protein denotes mPAI2mCEBPb
T5441 10444-10491 Entity denotes The mutant oligonucleotide PCR primer sequences
T5440 10178-10182 Protein denotes pGL3
T5439 9455-9496 Entity denotes the SerpinB2 promoter EcoR I site (−3261)
T5438 10380-10395 Protein denotes pGLmP-539mC/EBP
T5437 10122-10147 Protein denotes Basic to produce pGLmP-87
T5436 10696-10707 Protein denotes mPAI2mCEBPa
T5435 9522-9532 Entity denotes pGLmP-4480
T5434 9605-9606 Entity denotes p
T5433 9477-9483 Protein denotes EcoR I
T5432 10697-10701 Protein denotes PAI2
T5431 9178-9183 Protein denotes Xho I
T5430 9944-9946 Entity denotes T4
T5429 10819-10834 Protein denotes pGLmP-539mAP-1b
T5428 10783-10793 Protein denotes pGLmP-539m
T5427 9093-9096 Protein denotes PCR
T5426 10725-10756 Entity denotes The oligonucleotide PCR primers
T5425 9705-9710 Protein denotes pGLmP
T5424 9459-9467 Protein denotes SerpinB2
T5423 10200-10210 Protein denotes Luciferase
T5422 9761-9766 Protein denotes Sfi I
T5421 10178-10198 Protein denotes pGL3 Basic (Promega)
T5420 9944-9957 Protein denotes T4 DNA ligase
T5419 10820-10824 Protein denotes GLmP
T5418 11018-11021 Protein denotes PCR
T5417 9963-9966 Protein denotes PCR
T5416 10027-10035 Protein denotes SerpinB2
T5415 10307-10311 Protein denotes PU.1
T5414 9753-9767 Protein denotes enzyme (Sfi I,
T5413 9642-9646 Protein denotes GLmP
T5412 10331-10335 Protein denotes GLmP
T5411 9792-9797 Protein denotes Pac I
T5410 10362-10375 Protein denotes pGLmP-539mOct
T5409 9054-9088 Protein denotes of SerpinB2 Reporter Gene Plasmids
T5408 10745-10748 Protein denotes PCR
T5407 9237-9273 Entity denotes the SerpinB2 promoter (−3261 to +92)
T5406 11129-11133 Protein denotes GLmP
T5405 9372-9382 Entity denotes pGLmP-3261
T5404 11101-11106 Protein denotes Xho I
T5403 9594-9598 Protein denotes GLmP
T5402 11006-11030 Entity denotes Recombinant PCR products
T5401 9666-9671 Protein denotes pGLmP
T5400 10633-10646 Protein denotes pGLmP-539mOct
T5399 9552-9560 Protein denotes SerpinB2
T5398 10292-10312 Entity denotes regions E box, PU.1,
T5397 9721-9816 Protein denotes EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I
T5396 10363-10367 Protein denotes GLmP
T5395 9883-9885 Entity denotes T4
T5394 11128-11137 Entity denotes pGLmP-539
T5393 9621-9634 Protein denotes P-1686, pGLmP
T5392 10471-10474 Protein denotes PCR
T5391 11050-11056 Protein denotes EcoR I
T5390 9902-9905 Protein denotes NEB
T5389 10381-10385 Protein denotes GLmP
T4500 8748-8825 Gene_expression denotes a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli
T4499 8348-8359 Entity denotes 150 mM NaCl
T4498 8982-8987 Protein denotes GAPDH
T4497 8433-8460 Entity denotes separated on 4–12% Bis-Tris
T4496 8993-9004 Protein denotes α/β tubulin
T4495 8408-8416 Protein denotes 0.1% SDS
T4494 8506-8520 Entity denotes PVDF membranes
T4493 8389-8417 Entity denotes 0.5% deoxycholate, 0.1% SDS)
T4492 9006-9010 Entity denotes Cell
T4491 8940-8988 Protein denotes glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
T4490 8336-8381 Entity denotes 10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5%
T4489 8864-8883 Entity denotes western blot assays
T4488 8574-8588 Entity denotes PBS-T (1X PBS,
T4487 8893-8909 Protein denotes C/EBP-β (sc-150)
T4486 8506-8510 Entity denotes PVDF
T4485 8342-8360 Entity denotes Tris, 150 mM NaCl,
T4484 8748-8825 Protein denotes a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli
T4483 8522-8531 Entity denotes Membranes
T4482 8468-8485 Entity denotes gels (Invitrogen)
T4481 8419-8427 Protein denotes proteins
T4480 8690-8709 Entity denotes SerpinB2 antibodies
T4479 8690-8698 Protein denotes SerpinB2
T4478 8624-8642 Entity denotes primary antibodies
T4477 8838-8883 Entity denotes Other antibodies used for western blot assays
T4057 8004-8012 Protein denotes SerpinB2
T4056 7111-7114 Entity denotes DNA
T4055 8209-8251 Protein denotes GenBank/EMBL/DDBJ Data Bank with Accession
T4054 7451-7547 Entity denotes genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain
T4053 7825-7840 Entity denotes EcoRI fragment,
T4052 8212-8216 Protein denotes Bank
T4051 7962-7972 Entity denotes nucleotide
T4050 7958-8020 Protein denotes The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′
T4049 7234-7237 Entity denotes pDB
T4048 7137-7140 Entity denotes DNA
T4047 7909-7937 Protein denotes restriction enzyme digestion
T4046 8058-8071 Protein denotes the ABI PRISM
T4045 8209-8251 Protein denotes GenBank/EMBL/DDBJ Data Bank with Accession
T4044 7164-7172 Protein denotes SerpinB2
T4043 7679-7712 Entity denotes the transcription initiation site
T4042 8142-8146 Protein denotes a PE
T4041 7757-7760 Protein denotes Eco
T4040 7642-7647 Entity denotes EcoRI
T4039 7150-7181 Entity denotes of the murine SerpinB2 promoter
T4038 7211-7216 Entity denotes the p
T4037 7369-7394 Protein denotes exonuclease III digestion
T3719 6963-6998 Gene_expression denotes TaqMan® Gene Expression 20X primers
T3718 6797-6807 Entity denotes from cells
T3717 6837-6846 Protein denotes total RNA
T3716 6787-6796 Protein denotes total RNA
T3715 6732-6736 Protein denotes qPCR
T3714 6704-6737 Protein denotes Real-time Quantitative PCR (qPCR)
T3713 7038-7059 Protein denotes Cebpb (Mm00843434_s1)
T3712 6749-6766 Protein denotes Mini Kit (Qiagen)
T3711 7064-7087 Protein denotes β-actin (Mm00607939_s1)
T3710 6963-6975 Protein denotes TaqMan® Gene
T3709 6877-6936 Entity denotes TaqMan® Reverse Transcription Reagents (Applied Biosystems)
T3708 6813-6827 Entity denotes cDNA synthesis
T3707 7003-7037 Protein denotes Serpinb2/SerpinB2 (Mm00440905_m1),
T3315 6021-6150 Binding denotes Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage
T3314 6483-6531 Regulation denotes exclude Mycoplasma infection by nuclear staining
T3313 5967-5977 Entity denotes penicillin
T3312 6362-6376 Entity denotes Cell viability
T3311 6415-6420 Protein denotes Sigma
T3310 6021-6051 Entity denotes Primary peritoneal macrophages
T3309 6402-6421 Entity denotes trypan blue (Sigma)
T3308 5978-5990 Entity denotes streptomycin
T3307 6607-6641 Entity denotes Bacterial lipopolysaccharide (LPS)
T3306 6346-6354 Entity denotes LPS-free
T3305 6194-6197 Protein denotes F12
T3304 6205-6214 Protein denotes Gibco BRL
T3303 5967-6000 Entity denotes penicillin/streptomycin/glutamate
T3302 6637-6640 Entity denotes LPS
T3301 6100-6114 Entity denotes thioglycollate
T3300 6584-6605 Protein denotes Detection Kit (Lonza)
T3299 6261-6279 Entity denotes lipopolysaccharide
T3298 6696-6701 Protein denotes Sigma
T3297 5967-6000 Entity denotes penicillin/streptomycin/glutamate
T3296 6559-6564 Protein denotes Sigma
T2487 5306-5357 Regulation denotes the transcriptional regulation of the SerpinB2 gene
T2486 5111-5136 Gene_expression denotes SerpinB2 induction by LPS
T2485 5111-5136 Positive_regulation denotes SerpinB2 induction by LPS
T2484 3758-3827 Regulation denotes the initiation of innate immune responses, including cytokine release
T2483 4511-4535 Positive_regulation denotes IFN-γ co-stimulation [4]
T2482 5138-5254 Regulation denotes Importantly, a C/EBP-β phospho-acceptor site was found to negatively regulate LPS-induced SerpinB2 promoter activity
T2481 4607-4638 Regulation denotes for LPS-dependent transcription
T2480 4961-4986 Binding denotes upon a C/EBP binding site
T2479 3004-3048 Localization denotes a nonglycosylated intracellular protein [10]
T2478 4244-4276 Positive_regulation denotes whose expression was upregulated
T2477 4024-4063 Positive_regulation denotes mitogen-activated protein kinase (MAPK)
T2476 4776-4830 Regulation denotes LPS induction of SerpinB2 is dependent upon cis-acting
T2475 4776-4830 Regulation denotes LPS induction of SerpinB2 is dependent upon cis-acting
T2474 3895-3931 Binding denotes the recruitment of adaptor molecules
T2473 3829-3885 Binding denotes The binding of LPS to TLR4 on the surface of macrophages
T2472 5074-5106 Gene_expression denotes constitutive SerpinB2 expression
T2471 4776-4801 Positive_regulation denotes LPS induction of SerpinB2
T2470 4776-4801 Gene_expression denotes LPS induction of SerpinB2
T2469 2870-2899 Positive_regulation denotes the activation of plasminogen
T2468 5001-5044 Binding denotes C/EBP-β directly bound to this site in vivo
T2467 3267-3385 Regulation denotes The SerpinB2 gene is highly regulated in a cell type specific manner analogous to that of cytokines and oncogenes [29]
T2466 3936-3969 Positive_regulation denotes the activation of protein kinases
T2465 3004-3048 Protein_modification denotes a nonglycosylated intracellular protein [10]
T2464 5344-5352 Protein denotes SerpinB2
T2463 2777-2903 Protein denotes serine protease involved in the degradation and turnover of the extracellular matrix through the activation of plasminogen [7]
T2462 2837-2861 Entity denotes the extracellular matrix
T2461 4611-4624 Entity denotes LPS-dependent
T2460 3848-3855 Protein denotes to TLR4
T2459 4042-4063 Protein denotes protein kinase (MAPK)
T2458 2777-2783 Entity denotes serine
T2457 3871-3885 Entity denotes of macrophages
T2456 2164-2193 Protein denotes other inducible gene products
T2455 4318-4327 Protein denotes MAPK/CREB
T2454 4299-4309 Protein denotes IKKβ/NF-κB
T2453 2570-2576 Entity denotes serine
T2452 2885-2899 Protein denotes of plasminogen
T2451 3951-3969 Protein denotes of protein kinases
T2450 4208-4216 Protein denotes SerpinB2
T2449 5216-5227 Entity denotes LPS-induced
T2448 2150-2159 Protein denotes cytokines
T2447 4198-4206 Protein denotes p38 MAPK
T2446 5169-5177 Entity denotes acceptor
T2445 4198-4201 Protein denotes p38
T2444 4790-4801 Protein denotes of SerpinB2
T2443 4722-4730 Protein denotes SerpinB2
T2442 3653-3657 Protein denotes TLR4
T2441 4299-4309 Protein denotes IKKβ/NF-κB
T2440 3267-3284 Protein denotes The SerpinB2 gene
T2439 4573-4638 Entity denotes the SerpinB2 promoter responsible for LPS-dependent transcription
T2438 2762-2765 Protein denotes uPA
T2437 2975-2983 Protein denotes SerpinB2
T2436 3406-3437 Protein denotes the most responsive genes known
T2435 4024-4031 Entity denotes mitogen
T2434 4903-4932 Entity denotes the murine SerpinB2 promoter,
T2433 4426-4451 Protein denotes other LPS-inducible genes
T2432 2507-2547 Protein denotes inducible macrophage gene products known
T2431 4718-4739 Entity denotes the SerpinB2 promoter
T2430 1930-1950 Entity denotes of foreign molecules
T2429 4577-4585 Protein denotes SerpinB2
T2428 2292-2303 Entity denotes macrophages
T2427 3481-3489 Entity denotes LPS [31]
T2426 4071-4101 Entity denotes phosphoinositide 3(PI3)-kinase
T2425 5228-5245 Entity denotes SerpinB2 promoter
T2424 4090-4093 Protein denotes PI3
T2423 5151-5182 Entity denotes a C/EBP-β phospho-acceptor site
T2422 2933-2941 Protein denotes SerpinB2
T2421 3271-3279 Protein denotes SerpinB2
T2420 3357-3366 Protein denotes cytokines
T2419 4304-4309 Protein denotes NF-κB
T2418 2638-2648 Entity denotes macrophage
T2417 2711-2769 Entity denotes inhibitor of urokinase-type plasminogen activator (uPA)[6]
T2416 2675-2683 Protein denotes SerpinB2
T2415 5111-5119 Protein denotes SerpinB2
T2414 3004-3048 Protein denotes a nonglycosylated intracellular protein [10]
T2413 3558-3561 Entity denotes LPS
T2412 4323-4327 Protein denotes CREB
T2411 3310-3328 Entity denotes cell type specific
T2410 4388-4410 Protein denotes SerpinB2 is distinctly
T2409 2236-2287 Entity denotes the gram-negative bacterial cell wall component LPS
T2408 3811-3819 Protein denotes cytokine
T2407 3072-3085 Entity denotes intracellular
T2406 4511-4516 Protein denotes IFN-γ
T2405 2962-2970 Entity denotes the cell
T2404 3096-3132 Protein denotes SerpinB2 in cell survival [11]–[17],
T2403 3911-3931 Entity denotes of adaptor molecules
T2402 4671-4674 Entity denotes LPS
T2401 2724-2766 Protein denotes urokinase-type plasminogen activator (uPA)
T2400 5153-5160 Protein denotes C/EBP-β
T2399 4968-4973 Protein denotes C/EBP
T2398 3697-3700 Entity denotes LPS
T2397 5130-5136 Entity denotes by LPS
T2396 2503-2506 Entity denotes LPS
T2395 3022-3035 Entity denotes intracellular
T2394 2517-2527 Entity denotes macrophage
T2393 5337-5357 Protein denotes of the SerpinB2 gene
T2392 2551-2617 Protein denotes the ovalbumin-like serine protease inhibitor (ov-serpin) SerpinB2,
T2391 4071-4101 Protein denotes phosphoinositide 3(PI3)-kinase
T2390 4776-4779 Entity denotes LPS
T2389 2586-2607 Entity denotes inhibitor (ov-serpin)
T2388 3627-3658 Protein denotes The toll-like receptor 4 (TLR4)
T2387 2551-2617 Protein denotes the ovalbumin-like serine protease inhibitor (ov-serpin) SerpinB2,
T2386 2264-2273 Entity denotes cell wall
T2385 3841-3847 Entity denotes of LPS
T2384 4815-4830 Protein denotes upon cis-acting
T2383 4642-4653 Entity denotes macrophages
T2382 5001-5008 Protein denotes C/EBP-β
T2381 5228-5236 Protein denotes SerpinB2
T2380 4474-4477 Entity denotes LPS
T2379 2597-2606 Protein denotes ov-serpin
T2378 3371-3380 Protein denotes oncogenes
T2377 4318-4327 Protein denotes MAPK/CREB
T2376 4914-4922 Protein denotes SerpinB2
T2375 2204-2218 Entity denotes by macrophages
T2374 4874-4885 Entity denotes nucleotides
T2373 5087-5095 Protein denotes SerpinB2
T2372 4016-4021 Protein denotes NF-κB
T2371 4961-4986 Entity denotes upon a C/EBP binding site
T2370 4058-4062 Protein denotes MAPK
T762 1738-1813 Regulation denotes C/EBP-β-dependent regulation of inflammation-associated SerpinB2 expression
T761 1007-1057 Binding denotes the human SERPINB2 promoter conserved in the mouse
T760 553-581 Localization denotes 24 hrs in murine macrophages
T759 466-485 Gene_expression denotes SerpinB2 expression
T757 1423-1495 Gene_expression denotes the formation of C/EBP-β containing complexes with the SerpinB2 promoter
T756 1767-1813 Gene_expression denotes of inflammation-associated SerpinB2 expression
T754 1474-1495 Entity denotes the SerpinB2 promoter
T753 723-731 Protein denotes SerpinB2
T752 1017-1025 Protein denotes SERPINB2
T751 886-903 Protein denotes of the human gene
T750 419-422 Entity denotes LPS
T748 466-474 Protein denotes SerpinB2
T6355 12483-12486 Entity denotes LPS
T6354 12390-12400 Protein denotes luciferase
T6353 12375-12381 Protein denotes pRL-TK
T6352 11477-11486 Entity denotes thymidine
T6351 12496-12502 Protein denotes pRL-TK
T731 0-32 Protein denotes The Transcription Factor C/EBP-β
T705 336-346 Entity denotes macrophage
T706 1738-1755 Protein denotes C/EBP-β-dependent
T707 1142-1145 Entity denotes AMP
T708 1609-1637 Entity denotes embryonic fibroblasts (MEFs)
T709 399-424 Entity denotes Lipopolysaccharide (LPS),
T710 1478-1486 Protein denotes SerpinB2
T711 444-453 Entity denotes endotoxin
T712 1590-1597 Protein denotes C/EBP-β
T713 1225-1262 Entity denotes the murine SerpinB2 proximal promoter
T714 490-521 Protein denotes the toll-like receptor 4 (TLR4)
T715 516-520 Protein denotes TLR4
T716 1164-1167 Protein denotes CRE
T717 1544-1552 Protein denotes SerpinB2
T718 1437-1495 Protein denotes of C/EBP-β containing complexes with the SerpinB2 promoter
T719 553-581 Protein denotes 24 hrs in murine macrophages
T720 608-616 Protein denotes SerpinB2
T721 1632-1636 Protein denotes MEFs
T722 820-823 Entity denotes DNA
T723 236-247 Entity denotes macrophages
T724 563-581 Entity denotes murine macrophages
T725 1117-1122 Protein denotes C/EBP
T726 771-789 Entity denotes murine macrophages
T727 1794-1802 Protein denotes SerpinB2
T728 1236-1244 Protein denotes SerpinB2
T729 590-634 Entity denotes the LPS-regulated SerpinB2 promoter regions,
T730 1277-1305 Entity denotes for optimal LPS-inducibility
T732 1173-1186 Entity denotes two activator
T733 372-397 Entity denotes of plasminogen activators
T734 1642-1690 Entity denotes primary C/EBP-β-deficient peritoneal macrophages
T735 1411-1414 Entity denotes LPS
T736 1532-1543 Entity denotes LPS-induced
T737 1459-1495 Entity denotes complexes with the SerpinB2 promoter
T738 1007-1057 Entity denotes the human SERPINB2 promoter conserved in the mouse
T739 208-213 Protein denotes PAI-2
T740 156-214 Protein denotes SerpinB2 or plasminogen activator inhibitor type 2 (PAI-2)
T741 594-607 Entity denotes LPS-regulated
T742 1187-1203 Protein denotes protein 1 (AP-1)
T743 709-736 Protein denotes of the murine SerpinB2 gene
T744 168-214 Protein denotes plasminogen activator inhibitor type 2 (PAI-2)
T745 375-386 Protein denotes plasminogen
T746 1349-1358 Entity denotes chromatin
T747 1198-1202 Protein denotes AP-1
T7582 14351-14356 Protein denotes T217A
T7581 14745-14776 Protein denotes C/EBP-β phospho-acceptor mutant
T7580 14556-14596 Protein denotes β-Galactosidase Enzyme Assay System Kits
T7579 14556-14571 Protein denotes β-Galactosidase
T7578 14344-14357 Protein denotes T188A, T217A,
T7577 14299-14306 Protein denotes C/EBP-β
T7576 14310-14363 Protein denotes C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A)
T7575 14738-14785 Protein denotes of the C/EBP-β phospho-acceptor mutant proteins
T6926 13687-13731 Protein denotes 72 hrs to allow for effective gene knockdown
T6925 12802-12807 Protein denotes cebpb
T6924 13337-13348 Entity denotes supernatant
T6923 13281-13320 Entity denotes Lipofectamine 2000 reagent (Invitrogen)
T6922 13733-13740 Protein denotes C/EBP-β
T6921 13589-13595 Protein denotes 24 hrs
T6920 13363-13369 Protein denotes 48 hrs
T6919 13008-13011 Protein denotes RNA
T6918 12944-12970 Entity denotes cells of the other species
T6917 13476-13492 Entity denotes The target cells
T6916 13717-13721 Protein denotes gene
T6915 13511-13537 Entity denotes the lentiviral supernatant
T6914 13069-13090 Entity denotes lentiviral particles,
T6913 13597-13623 Entity denotes The lentiviral supernatant
T6912 13542-13584 Entity denotes 8 µg/ml Polybrene (American Bioanalytical)
T6911 13000-13005 Protein denotes CEBPB
T6910 12734-12745 Protein denotes mouse cebpb
T6909 13123-13149 Entity denotes with a mixture of plasmids
T6908 12909-12928 Protein denotes of endogenous C/EBP
T6367 12451-12511 Regulation denotes where co-transfected C/EBP-β or LPS affected pRL-TK activity
T6366 12451-12511 Regulation denotes where co-transfected C/EBP-β or LPS affected pRL-TK activity
T6365 12375-12381 Protein denotes pRL-TK
T6364 11841-11858 Entity denotes Transfected cells
T6363 11495-11497 Protein denotes TK
T6362 12457-12479 Protein denotes co-transfected C/EBP-β
T6361 11469-11498 Protein denotes the pRL-thymidine kinase (TK)
T6360 11980-12008 Protein denotes incubated 16 hrs in a 5% CO2
T6359 12496-12502 Protein denotes pRL-TK
T6358 12275-12283 Entity denotes Promoter
T6357 12103-12113 Protein denotes Luciferase
T6356 12142-12174 Protein denotes a Dual-Luciferase Reporter Assay
R1646 T2452 T2469 themeOf of plasminogen,the activation of plasminogen
R1649 T2459 T2477 themeOf protein kinase (MAPK),mitogen-activated protein kinase (MAPK)
R1651 T2460 T2473 themeOf to TLR4,The binding of LPS to TLR4 on the surface of macrophages
R5780 T8041 T8058 themeOf Antibodies,Antibodies were purchased from Santa Cruz
R6236 T8596 T8618 themeOf the bound chromatin,the bound chromatin
R6237 T8601 T8590 partOf the SerpinB2 proximal promoter,SerpinB2
R6781 T9261 T9281 themeOf SerpinB2 mRNA,of LPS-inducible SerpinB2 mRNA expression
R6782 T9269 T9279 themeOf gene,in gene transcription
R6783 T9275 T9280 themeOf SerpinB2,LPS-induced SerpinB2 expression
R6784 T9279 T9282 themeOf in gene transcription,an increase in gene transcription
R7300 T9976 T10001 partOf the murine SerpinB2 promoter,SerpinB2
R7301 T9982 T9981 partOf of the murine SerpinB2 promoter,SerpinB2
R7302 T9989 T10014 partOf of the SerpinB2 promoter,SerpinB2
R7303 T9999 T9995 partOf The SerpinB2 Proximal Promoter,The SerpinB2 Proximal Promoter
R7304 T10006 T9985 partOf the murine SerpinB2 promoter,SerpinB2
R7305 T10007 T10018 themeOf SerpinB2 gene,PMA-induced SerpinB2 gene regulation has been extensively studied in human macrophage cell lines [45]
R8021 T10957 T10975 themeOf potential binding sites for PU.1 (−412/−407) and Oct-1,potential binding sites for PU.1 (−412/−407) and Oct-1
R8022 T10962 T10977 themeOf SerpinB2,of SerpinB2 gene expression [52]
R8023 T10977 T10976 themeOf of SerpinB2 gene expression [52],the regulation of SerpinB2 gene expression [52]
R8839 T11984 T12040 causeOf sites for transcription factors previously reported to mediate LPS-inducible transcription in other genes [57],sites for transcription factors previously reported to mediate LPS-inducible transcription in other genes [57]
R8840 T12007 T12043 causeOf CRE,"C/EBP, CRE and Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter are Essential for Optimal LPS-inducible Transcription"
R8841 T12008 T12041 causeOf C/EBP,"C/EBP, CRE and Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter are Essential for Optimal LPS-inducible Transcription"
R8842 T12013 T12039 themeOf of the SerpinB2 gene,LPS-induced activation of the SerpinB2 gene
R8843 T12024 T12044 themeOf C/EBP,have also recently implicated this C/EBP site in LPS-induced activation of the SerpinB2 gene
R8844 T12031 T12042 causeOf Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter,"C/EBP, CRE and Two AP-1 Sites in the Murine SerpinB2 Gene Proximal Promoter are Essential for Optimal LPS-inducible Transcription"
R9458 T12760 T12797 themeOf a LPS-inducible complex that is likely to contain a member of the C/EBP family of transcription factors,Together these data indicate that the putative SerpinB2 C/EBP site at −203/−192 binds a LPS-inducible complex that is likely to contain a member of the C/EBP family of transcription factors
R9459 T12764 T12778 partOf the rat albumin promoter,albumin
R9460 T12770 T12799 themeOf a high affinity C/EBP binding site,a high affinity C/EBP binding site
R9461 T12779 T12797 themeOf the putative SerpinB2 C/EBP site,Together these data indicate that the putative SerpinB2 C/EBP site at −203/−192 binds a LPS-inducible complex that is likely to contain a member of the C/EBP family of transcription factors
R9462 T12780 T12798 themeOf of a known C/EBP binding site from the rat albumin promoter,of a known C/EBP binding site from the rat albumin promoter
R9463 T12787 T12781 partOf the rat albumin promoter,albumin
R10666 T14498 T14549 themeOf of endogenous SerpinB2 mRNA,constitutive and LPS-inducible transcription of endogenous SerpinB2 mRNA
R10667 T14500 T14552 themeOf mRNA,mRNA Expression in MEFs and Inflammatory Primary Macrophages
R10668 T14500 T14553 themeOf mRNA,mRNA Expression in MEFs and Inflammatory Primary Macrophages
R10669 T14501 T14545 themeOf SerpinB2 mRNA,in SerpinB2 mRNA expression
R10670 T14505 T14550 themeOf mRNA,"mRNA expression in response to LPS,"
R10671 T14505 T14551 themeOf mRNA,"mRNA expression in response to LPS,"
R10672 T14506 T14542 themeOf mRNA,mRNA expression
R10673 T14506 T14543 themeOf mRNA,mRNA expression
R10674 T14510 T14538 themeOf SerpinB2 mRNA,LPS-induced SerpinB2 mRNA expression
R10675 T14513 T14539 causeOf LPS,LPS-stimulated SerpinB2
R10676 T14519 T14544 themeOf C/EBP-β,C/EBP-β expression
R10677 T14527 T14541 causeOf LPS,LPS stimulated an increase in SerpinB2 mRNA expression in wild-type MEFs
R10678 T14529 T14539 themeOf SerpinB2,LPS-stimulated SerpinB2
R10679 T14531 T14548 themeOf SerpinB2 mRNA,endogenous SerpinB2 mRNA expression
R10680 T14538 T14537 themeOf LPS-induced SerpinB2 mRNA expression,LPS-induced SerpinB2 mRNA expression was significantly decreased in C/EBP-β-deficient inflammatory macrophages
R10681 T14540 T14541 themeOf an increase in SerpinB2 mRNA expression in wild-type MEFs,LPS stimulated an increase in SerpinB2 mRNA expression in wild-type MEFs
R10682 T14542 T14547 themeOf mRNA expression,whereas LPS-stimulated SerpinB2 mRNA expression was significantly dampened in Cebpb−
R10683 T14543 T14546 themeOf mRNA expression,whereas LPS-stimulated SerpinB2 mRNA expression was significantly dampened in Cebpb−
R10684 T14545 T14540 themeOf in SerpinB2 mRNA expression,an increase in SerpinB2 mRNA expression in wild-type MEFs
R10685 T14549 T14536 themeOf constitutive and LPS-inducible transcription of endogenous SerpinB2 mRNA,for mediating constitutive and LPS-inducible transcription of endogenous SerpinB2 mRNA
R11260 T15270 T15327 themeOf C/EBP-β,of C/EBP-β recruitment
R11261 T15271 T15328 themeOf T217-phosphorylated C/EBP-β,T217-phosphorylated C/EBP-β
R11262 T15276 T15325 themeOf p-C/EBP-βT217,p-C/EBP-βT217 was constitutively bound to the SerpinB2 proximal promoter
R11263 T15277 T15322 themeOf p-C/EBP-βT217,p-C/EBP-βT217 recruitment
R11264 T15283 T15326 themeOf C/EBP-β,C/EBP-β Binds the Murine SerpinB2 Proximal
R11265 T15293 T15297 partOf the SerpinB2 promoter,SerpinB2
R11266 T15298 T15321 themeOf C/EBP-β,C/EBP-β phosphorylation
R11267 T15299 T15320 themeOf target genes [38],transactivate target genes [38]
R11268 T15301 T15307 partOf to the SerpinB2 proximal promoter,SerpinB2
R11269 T15301 T15325 themeOf to the SerpinB2 proximal promoter,p-C/EBP-βT217 was constitutively bound to the SerpinB2 proximal promoter
R11270 T15302 T15316 partOf the SerpinB2 proximal promoter of the T217 phosphorylated C/EBP-β isoform (p-C/EBP-βT217),SerpinB2
R11271 T15303 T15323 themeOf of p-C/EBP-βT217,the binding affinity of p-C/EBP-βT217 for the SerpinB2 proximal
R11272 T15305 T15311 partOf the murine SerpinB2 promoter,SerpinB2
R11273 T15310 T15317 partOf the SerpinB2 promoter,SerpinB2
R11274 T15313 T15323 themeOf for the SerpinB2 proximal,the binding affinity of p-C/EBP-βT217 for the SerpinB2 proximal
R11275 T15315 T15271 partOf T217-phosphorylated,T217-phosphorylated C/EBP-β
R11276 T15315 T15328 siteOf T217-phosphorylated,T217-phosphorylated C/EBP-β
R11800 T16075 T16078 partOf to the SerpinB2 proximal promoter,SerpinB2
R11801 T16075 T16105 themeOf to the SerpinB2 proximal promoter,Since C/EBP-β binds to the SerpinB2 proximal promoter in an LPS-inducible manner both in vitro and in vivo
R11802 T16077 T16086 partOf SerpinB2 promoter,SerpinB2
R11803 T16087 T16104 causeOf LPS-stimulated,LPS-stimulated SerpinB2 promoter activity
R11804 T16088 T16082 partOf the SerpinB2 promoter,SerpinB2
R11805 T16094 T16102 causeOf C/EBP-β,C/EBP-β Promotes LPS-inducible Murine SerpinB2 Proximal Promoter Activity
R11806 T16097 T16105 themeOf C/EBP-β,Since C/EBP-β binds to the SerpinB2 proximal promoter in an LPS-inducible manner both in vitro and in vivo
R12674 T17552 T17623 partOf S64,of C/EBP-β
R12675 T17552 T17632 siteOf S64,phosphorylation of C/EBP-β at S64
R12676 T17553 T17637 themeOf MCP-1,for LPS-induced transcription of the cytokines IL-6 and MCP-1 [64]
R12677 T17554 T17631 causeOf MEFs,MEFs significantly stimulated SerpinB2 luciferase reporter gene expression in the presence of LPS
R12678 T17555 T17615 partOf SerpinB2 promoter,SerpinB2
R12679 T17563 T17635 themeOf C/EBP-β,C/EBP-β phosphorylation sites that may be important for LPS-stimulated SerpinB2 proximal promoter activity (Fig. 8B)
R12680 T17566 T17608 partOf SerpinB2 promoter,SerpinB2
R12681 T17568 T17621 partOf SerpinB2 promoter,SerpinB2
R12682 T17574 T17649 themeOf of wild-type C/EBP-β,Re-expression of wild-type C/EBP-β in Cebpb−
R12683 T17580 T17646 themeOf SerpinB2,SerpinB2 gene expression
R12684 T17581 T17641 themeOf SerpinB2,negatively regulate SerpinB2
R12685 T17584 T17647 causeOf LPS-stimulated,for LPS-stimulated SerpinB2 proximal promoter activity (Fig. 8B)
R12686 T17590 T17577 partOf SerpinB2 Promoter,SerpinB2
R12687 T17593 T17644 themeOf SerpinB2 gene,LPS-induced SerpinB2 gene transcription
R12688 T17595 T17636 themeOf the cytokines IL-6,for LPS-induced transcription of the cytokines IL-6 and MCP-1 [64]
R12689 T17603 T17648 themeOf "of the C/EBP-β phospho-acceptor mutant,","Expression of the C/EBP-β phospho-acceptor mutant,"
R12690 T17605 T17629 causeOf LPS-stimulated,LPS-stimulated SerpinB2 Promoter Activity
R12691 T17606 T17639 themeOf SerpinB2,SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29]
R12692 T17606 T17640 themeOf SerpinB2,SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29]
R12693 T17606 T17643 themeOf SerpinB2,SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29]
R12694 T17610 T17630 themeOf of C/EBP-βS64A,the expression of C/EBP-βS64A
R12695 T17611 T17645 causeOf C/EBP-β-dependent,C/EBP-β-dependent SerpinB2 gene transcription
R12696 T17612 T17640 causeOf by LPS,SerpinB2 is induced by LPS and regulated in a manner similar to cytokines [29]
R12697 T17617 T17650 themeOf SerpinB2 gene,C/EBP-β-dependent SerpinB2 gene transcription
R12698 T17620 T17638 themeOf "DAPK1,","regulating DAPK1,"
R12699 T17622 T17634 themeOf gene,SerpinB2 luciferase reporter gene expression
R12700 T17623 T17632 themeOf of C/EBP-β,phosphorylation of C/EBP-β at S64
R12701 T17626 T17609 partOf SerpinB2 promoter,SerpinB2
R12702 T17627 T17597 partOf SerpinB2 proximal promoter,SerpinB2
R12703 T17634 T17631 themeOf SerpinB2 luciferase reporter gene expression,MEFs significantly stimulated SerpinB2 luciferase reporter gene expression in the presence of LPS
R12704 T17650 T17642 themeOf C/EBP-β-dependent SerpinB2 gene transcription,in modulating C/EBP-β-dependent SerpinB2 gene transcription
R12705 T17650 T17645 themeOf C/EBP-β-dependent SerpinB2 gene transcription,C/EBP-β-dependent SerpinB2 gene transcription
R14932 T20903 T21085 themeOf "AP-1,","to physically interact with AP-1, and NF-κB to promote gene expression"
R14933 T20904 T21062 partOf C/EBP-β S64,C/EBP-β
R14934 T20904 T21102 siteOf C/EBP-β S64,"C/EBP-β S64 is constitutively phosphorylated in both RAW264.7 cells and MEFs [73],"
R14935 T20915 T21099 themeOf of C/EBP-β,phosphorylation of C/EBP-β at S64
R14936 T20933 T21093 themeOf gene,both constitutive and LPS-induced SerpinB2 gene transcription
R14937 T20935 T21092 themeOf proteins (CREB),"between C/EBP-β and CRE binding proteins (CREB) and AP-1 [63],"
R14938 T20936 T21091 themeOf gene,gene transcription
R14939 T20939 T20915 partOf S64,of C/EBP-β
R14940 T20939 T21099 siteOf S64,phosphorylation of C/EBP-β at S64
R14941 T20949 T21038 partOf T217,C/EBP-β phosphorylated on T217
R14942 T20949 T21098 siteOf T217,C/EBP-β phosphorylated on T217
R14943 T20950 T21090 themeOf SerpinB2,LPS-induced SerpinB2 gene expression
R14944 T20952 T21117 causeOf CREB,"Additionally, CREB has been shown to control transcription of the C/EBP-β gene [67]"
R14945 T20954 T21111 themeOf of the SerpinB2 gene,constitutive and LPS-induced transcription of the SerpinB2 gene
R14946 T20962 T21096 themeOf LPS-induced C/EBP-β,LPS-induced C/EBP-β
R14947 T20962 T21097 themeOf LPS-induced C/EBP-β,LPS-induced C/EBP-β
R14948 T20966 T21104 themeOf SerpinB2,SerpinB2 gene expression
R14949 T20978 T21094 themeOf gene,gene expression
R14950 T20979 T21115 themeOf SerpinB2 gene,SerpinB2 gene transcription
R14951 T20981 T21103 themeOf SerpinB2 mRNA,LPS-inducible SerpinB2 mRNA expression
R14952 T20989 T21119 themeOf of the human SERPINB2 gene [37],PMA-stimulated transcription of the human SERPINB2 gene [37]
R14953 T20993 T21109 causeOf PMA-stimulated,PMA-stimulated transcription of the human SERPINB2 gene [37]
R14954 T20996 T21101 themeOf of the C/EBP-β phospho-acceptor site mutant,"expression of the C/EBP-β phospho-acceptor site mutant, C/EBP-βT188A,"
R14955 T20997 T21112 themeOf of C/EBP-βS64A,expression of C/EBP-βS64A
R14956 T21000 T21088 themeOf SerpinB2 gene,of SerpinB2 gene expression
R14957 T21002 T21095 themeOf of the murine SerpinB2 gene,PMA-inducible transcription of the murine SerpinB2 gene
R14958 T21003 T21113 themeOf of the pro-survival factor SerpinB2,massive induction of the pro-survival factor SerpinB2
R14959 T21003 T21114 themeOf of the pro-survival factor SerpinB2,massive induction of the pro-survival factor SerpinB2
R14960 T21012 T21120 themeOf of SerpinB2,LPS-induced transcription of SerpinB2
R14961 T21013 T21086 causeOf by C/EBP-β,the regulation of SerpinB2 gene expression by C/EBP-β
R14962 T21023 T21118 themeOf SerpinB2 gene,of SerpinB2 gene expression
R14963 T21027 T21097 causeOf LPS-induced,LPS-induced C/EBP-β
R14964 T21029 T21083 themeOf gene,"LPS-inducible gene transcription,"
R14965 T21038 T21098 themeOf C/EBP-β phosphorylated on T217,C/EBP-β phosphorylated on T217
R14966 T21043 T21085 themeOf NF-κB,"to physically interact with AP-1, and NF-κB to promote gene expression"
R14967 T21050 T21121 themeOf constitutive SerpinB2 gene,constitutive SerpinB2 gene transcription
R14968 T21054 T21081 themeOf of the C/EBP-β gene,transcription of the C/EBP-β gene [67]
R14969 T21062 T21102 themeOf C/EBP-β,"C/EBP-β S64 is constitutively phosphorylated in both RAW264.7 cells and MEFs [73],"
R14970 T21066 T21092 themeOf "AP-1 [63],","between C/EBP-β and CRE binding proteins (CREB) and AP-1 [63],"
R14971 T21075 T21100 themeOf SerpinB2,of inflammation-associated SerpinB2 gene expression
R14972 T21081 T21117 themeOf transcription of the C/EBP-β gene [67],"Additionally, CREB has been shown to control transcription of the C/EBP-β gene [67]"
R14973 T21088 T21086 themeOf of SerpinB2 gene expression,the regulation of SerpinB2 gene expression by C/EBP-β
R14974 T21094 T21110 themeOf gene expression,promote gene expression
R14975 T21095 T21084 themeOf PMA-inducible transcription of the murine SerpinB2 gene,mediating PMA-inducible transcription of the murine SerpinB2 gene
R14976 T21099 T21105 causeOf phosphorylation of C/EBP-β at S64,indicating that phosphorylation of C/EBP-β at S64 negatively regulates LPS-induced SerpinB2 promoter activity
R14977 T21100 T21108 themeOf of inflammation-associated SerpinB2 gene expression,the regulation of inflammation-associated SerpinB2 gene expression
R14978 T21101 T21082 causeOf "expression of the C/EBP-β phospho-acceptor site mutant, C/EBP-βT188A,","expression of the C/EBP-β phospho-acceptor site mutant, C/EBP-βT188A, did not affect SerpinB2 promoter activity differently"
R14979 T21111 T21087 themeOf constitutive and LPS-induced transcription of the SerpinB2 gene,mediating both constitutive and LPS-induced transcription of the SerpinB2 gene
R14980 T21112 T21106 causeOf expression of C/EBP-βS64A,"In contrast, expression of C/EBP-βS64A significantly enhanced LPS-induced SerpinB2 promoter activity"
R14981 T21118 T21116 themeOf of SerpinB2 gene expression,for the regulation of SerpinB2 gene expression
R14982 T21119 T21109 themeOf PMA-stimulated transcription of the human SERPINB2 gene [37],PMA-stimulated transcription of the human SERPINB2 gene [37]
R16264 T22555 T22571 themeOf SerpinB2 protein,analysis of SerpinB2 protein expression in whole cell lysates
R16265 T22558 T22572 themeOf protein,protein expression
R16590 T23061 T23070 partOf murine SerpinB2 promoter-luciferase,murine SerpinB2 promoter-luciferase
R16591 T23071 T23081 partOf the murine SerpinB2 promoter,SerpinB2
R16981 T23608 T23624 partOf of the murine SerpinB2 promoter,SerpinB2
R16982 T23620 T23613 partOf murine SerpinB2 promoters,SerpinB2
R17238 T23991 T23989 partOf of the murine SerpinB2 promoter,SerpinB2
R17239 T23997 T23984 partOf of the murine SerpinB2 promoter,SerpinB2
R17428 T24313 T24331 partOf the murine SerpinB2 proximal promoter C/EBP,SerpinB2
R348 T748 T759 themeOf SerpinB2,SerpinB2 expression
R349 T749 T758 themeOf of Murine SerpinB2,LPS-Inducible Transcription of Murine SerpinB2
R350 T755 T762 themeOf C/EBP-β-dependent regulation of inflammation-associated SerpinB2 expression,C/EBP-β-dependent regulation of inflammation-associated SerpinB2 expression
R351 T756 T755 themeOf of inflammation-associated SerpinB2 expression,C/EBP-β-dependent regulation of inflammation-associated SerpinB2 expression
R716 T706 T762 causeOf C/EBP-β-dependent,C/EBP-β-dependent regulation of inflammation-associated SerpinB2 expression
R719 T718 T757 themeOf of C/EBP-β containing complexes with the SerpinB2 promoter,the formation of C/EBP-β containing complexes with the SerpinB2 promoter
R721 T719 T760 themeOf 24 hrs in murine macrophages,24 hrs in murine macrophages
R723 T724 T760 locationOf murine macrophages,24 hrs in murine macrophages
R724 T727 T756 themeOf SerpinB2,of inflammation-associated SerpinB2 expression
R728 T738 T761 themeOf the human SERPINB2 promoter conserved in the mouse,the human SERPINB2 promoter conserved in the mouse
R1599 T2461 T2481 causeOf LPS-dependent,for LPS-dependent transcription
R1600 T2470 T2475 themeOf LPS induction of SerpinB2,LPS induction of SerpinB2 is dependent upon cis-acting
R1601 T2371 T2480 themeOf upon a C/EBP binding site,upon a C/EBP binding site
R1602 T2373 T2472 themeOf SerpinB2,constitutive SerpinB2 expression
R1603 T2471 T2476 themeOf LPS induction of SerpinB2,LPS induction of SerpinB2 is dependent upon cis-acting
R1604 T2382 T2468 themeOf C/EBP-β,C/EBP-β directly bound to this site in vivo
R1606 T2385 T2473 themeOf of LPS,The binding of LPS to TLR4 on the surface of macrophages
R1607 T2390 T2471 causeOf LPS,LPS induction of SerpinB2
R1608 T2393 T2487 themeOf of the SerpinB2 gene,the transcriptional regulation of the SerpinB2 gene
R1609 T2395 T2479 locationOf intracellular,a nonglycosylated intracellular protein [10]
R1610 T2397 T2485 causeOf by LPS,SerpinB2 induction by LPS
R1611 T2403 T2474 themeOf of adaptor molecules,the recruitment of adaptor molecules
R1613 T2406 T2483 themeOf IFN-γ,IFN-γ co-stimulation [4]
R1615 T2408 T2484 themeOf cytokine,"the initiation of innate immune responses, including cytokine release"
R1618 T2414 T2465 themeOf a nonglycosylated intracellular protein [10],a nonglycosylated intracellular protein [10]
R1619 T2414 T2479 themeOf a nonglycosylated intracellular protein [10],a nonglycosylated intracellular protein [10]
R1620 T2415 T2485 themeOf SerpinB2,SerpinB2 induction by LPS
R1621 T2415 T2486 themeOf SerpinB2,SerpinB2 induction by LPS
R1625 T2423 T2482 causeOf a C/EBP-β phospho-acceptor site,"Importantly, a C/EBP-β phospho-acceptor site was found to negatively regulate LPS-induced SerpinB2 promoter activity"
R1627 T2425 T2381 partOf SerpinB2 promoter,SerpinB2
R1630 T2431 T2443 partOf the SerpinB2 promoter,SerpinB2
R1632 T2434 T2376 partOf "the murine SerpinB2 promoter,",SerpinB2
R1634 T2435 T2477 causeOf mitogen,mitogen-activated protein kinase (MAPK)
R1636 T2439 T2429 partOf the SerpinB2 promoter responsible for LPS-dependent transcription,SerpinB2
R1637 T2440 T2467 themeOf The SerpinB2 gene,The SerpinB2 gene is highly regulated in a cell type specific manner analogous to that of cytokines and oncogenes [29]
R1640 T2444 T2470 themeOf of SerpinB2,LPS induction of SerpinB2
R1641 T2444 T2471 themeOf of SerpinB2,LPS induction of SerpinB2
R1644 T2451 T2466 themeOf of protein kinases,the activation of protein kinases
R2698 T3710 T3719 themeOf TaqMan® Gene,TaqMan® Gene Expression 20X primers
R2951 T4039 T4044 partOf of the murine SerpinB2 promoter,SerpinB2
R3290 T4484 T4500 themeOf a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli,a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli
R3841 T5407 T5443 partOf the SerpinB2 promoter (−3261 to +92),SerpinB2
R3842 T5447 T5448 partOf of the wild-type murine SerpinB2 promoter,SerpinB2
R3843 T5469 T5461 partOf the SerpinB2 promoter LPS-responsive,SerpinB2
R4504 T6355 T6367 causeOf LPS,where co-transfected C/EBP-β or LPS affected pRL-TK activity
R4505 T6362 T6366 causeOf co-transfected C/EBP-β,where co-transfected C/EBP-β or LPS affected pRL-TK activity
R5402 T7575 T7596 themeOf of the C/EBP-β phospho-acceptor mutant proteins,Expression of the C/EBP-β phospho-acceptor mutant proteins
R17898 T25003 T25031 themeOf SerpinB2 mRNA,SerpinB2 mRNA expression
R17899 T25011 T25033 themeOf mRNA,mRNA expression in untreated Cebpb+/+
R17900 T25011 T25034 themeOf mRNA,mRNA expression in untreated Cebpb+/+
R17901 T25016 T25036 themeOf SerpinB2 mRNA,qPCR analysis of murine SerpinB2 mRNA expression in the lentiviral transduced peritoneal macrophages
R17902 T25021 T25032 themeOf SerpinB2 mRNA,for constitutive and LPS-induced SerpinB2 mRNA expression
R17903 T25031 T25035 themeOf SerpinB2 mRNA expression,SerpinB2 mRNA expression is abrogated in Cebpb−/−
R18338 T25720 T25733 partOf the murine SerpinB2 promoter in vivo,SerpinB2
R18339 T25728 T25740 themeOf rIgG,the rIgG control
R18340 T25730 T25741 themeOf the SerpinB2 promoter suggests,the SerpinB2 promoter suggests active transcription following LPS stimulation
R18877 T26696 T26746 themeOf LPS-stimulated Cebpb+/+ MEFs,LPS-stimulated Cebpb+/+ MEFs
R18878 T26700 T26745 themeOf gene,C/EBP-β gene schematic depicting gene structure
R18879 T26706 T26743 causeOf LPS-stimulated,LPS-stimulated SerpinB2 promoter activity
R18880 T26718 T26713 partOf SerpinB2 promoter,SerpinB2
R18881 T26721 T26746 causeOf LPS-stimulated,LPS-stimulated Cebpb+/+ MEFs
R18882 T26727 T26699 partOf The SerpinB2 proximal promoter,SerpinB2
R18883 T26728 T26737 partOf SerpinB2 proximal promoter,SerpinB2
R18884 T26730 T26744 themeOf the pGLmP-539 SerpinB2 promoter-luciferase reporter,MEFs expressing the pGLmP-539 SerpinB2 promoter-luciferase reporter in the presence or absence of LPS

bionlp-st-ge-2016-test-tees

Id Subject Object Predicate Lexical cue
T26652 38160-38167 Gene_expression denotes express
T26651 38160-38167 Gene_expression denotes express
T26650 38207-38214 Protein denotes C/EBP-β
T26649 38129-38141 Protein denotes C/EBP-βT217A
T26648 38049-38057 Regulation denotes confirms
T26647 38062-38072 Gene_expression denotes expression
T26646 38091-38123 Protein denotes C/EBP-β phospho-acceptor mutants
T26645 37987-38002 Protein denotes β-galactosidase
T26644 37934-37944 Protein denotes Luciferase
T26643 37699-37709 Gene_expression denotes expression
T26642 37699-37709 Gene_expression denotes expression
T26641 37699-37709 Gene_expression denotes expression
T26640 37699-37709 Gene_expression denotes expression
T26639 37864-37888 Protein denotes β-galactosidase reporter
T26638 37840-37850 Protein denotes luciferase
T26637 37812-37839 Protein denotes pGLmP-539 SerpinB2 promoter
T26636 37763-37770 Protein denotes C/EBP-β
T26635 37556-37571 Phosphorylation denotes Phosphorylation
T26634 37586-37592 Entity denotes Serine
T26633 37632-37649 Protein denotes SerpinB2 promoter
T26632 37575-37582 Protein denotes C/EBP-β
T26631 37446-37461 Protein denotes β-galactosidase
T26630 37415-37425 Protein denotes luciferase
T26629 37376-37400 Protein denotes β-galactosidase reporter
T26628 37352-37362 Protein denotes luciferase
T26627 37324-37351 Protein denotes pGLmP-539 SerpinB2 promoter
T26626 37179-37189 Gene_expression denotes expressing
T26625 37179-37189 Gene_expression denotes expressing
T26624 37222-37232 Protein denotes luciferase
T26623 37194-37221 Protein denotes pGLmP-539 SerpinB2 promoter
T26622 37165-37178 Protein denotes Cebpb−/− MEFs
T26621 37033-37042 Positive_regulation denotes activated
T26620 37033-37042 Positive_regulation denotes activated
T26619 37033-37042 Positive_regulation denotes activated
T26618 37086-37099 Protein denotes Cebpb−/− MEFs
T26617 37061-37074 Protein denotes Cebpb+/+ MEFs
T26616 36989-37015 Protein denotes SerpinB2 proximal promoter
T26615 36930-36939 Positive_regulation denotes necessary
T26614 36944-36970 Protein denotes SerpinB2 proximal promoter
T26613 36919-36926 Protein denotes C/EBP-β
T25681 36034-36038 Protein denotes rIgG
T25680 35983-35995 Protein denotes rIgG control
T25679 35968-35972 Protein denotes T217
T25678 35948-35966 Protein denotes C/EBP-β, p-C/EBP-β
T25677 35859-35863 Protein denotes ChIP
T25676 35809-35812 Protein denotes IgG
T25675 35656-35667 Binding denotes Recruitment
T25674 35685-35702 Protein denotes SerpinB2 promoter
T25673 35671-35677 Protein denotes RNAPII
T25672 35492-35496 Protein denotes rIgG
T25671 35480-35490 Protein denotes rabbit IgG
T25670 35466-35472 Protein denotes RNAPII
T25669 35447-35464 Protein denotes RNA Polymerase II
T25668 35440-35444 Protein denotes T217
T25667 35420-35438 Protein denotes C/EBP-β, p-C/EBP-β
T25666 35335-35339 Protein denotes T217
T25665 35324-35333 Protein denotes p-C/EBP-β
T25664 35313-35320 Protein denotes C/EBP-β
T25663 35055-35081 Protein denotes SerpinB2 proximal promoter
T25662 34983-35007 Protein denotes murine SerpinB2 promoter
T25661 34964-34975 Protein denotes C/EBP-βT217
T25660 34952-34959 Protein denotes C/EBP-β
T24965 33025-33035 Gene_expression denotes expression
T24964 33011-33024 Protein denotes SerpinB2 mRNA
T24963 32877-32886 Negative_regulation denotes knockdown
T24962 32877-32886 Negative_regulation denotes knockdown
T24961 32919-32928 Binding denotes infection
T24960 32919-32928 Binding denotes infection
T24959 32877-32886 Negative_regulation denotes knockdown
T24958 32957-32978 Protein denotes not human CEBPB shRNA
T24957 32941-32952 Protein denotes Cebpb shRNA
T24956 32901-32908 Protein denotes C/EBP-β
T24955 32640-32657 Protein denotes Human CEBPB shRNA
T24954 32605-32638 Protein denotes murine specific lentiviral shRNAs
T24953 32483-32492 Negative_regulation denotes deficient
T24952 32462-32471 Negative_regulation denotes abrogated
T24951 32448-32458 Gene_expression denotes expression
T24950 32475-32482 Protein denotes C/EBP-β
T24949 32439-32447 Protein denotes SerpinB2
T24948 32284-32290 Positive_regulation denotes murine
T24947 32284-32290 Positive_regulation denotes murine
T24946 32305-32315 Gene_expression denotes expression
T24945 32305-32315 Gene_expression denotes expression
T24944 32178-32187 Negative_regulation denotes abrogated
T24943 32164-32174 Gene_expression denotes expression
T24942 32342-32355 Protein denotes Cebpb−/− MEFs
T24941 32291-32304 Protein denotes SerpinB2 mRNA
T24940 32217-32230 Protein denotes Cebpb+/+ MEFs
T24939 32191-32204 Protein denotes Cebpb−/− MEFs
T24938 32150-32163 Protein denotes SerpinB2 mRNA
T24937 32066-32075 Positive_regulation denotes essential
T24936 32123-32133 Gene_expression denotes expression
T24935 32109-32122 Protein denotes SerpinB2 mRNA
T24934 32055-32062 Protein denotes C/EBP-β
T24291 29471-29485 Protein denotes C/EBP antibody
T24290 28887-28896 Positive_regulation denotes incubated
T24289 28954-28964 Positive_regulation denotes containing
T24288 28968-28974 Positive_regulation denotes intact
T24287 28887-28896 Positive_regulation denotes incubated
T24286 28887-28896 Positive_regulation denotes incubated
T24285 28887-28896 Positive_regulation denotes incubated
T24284 29080-29097 Protein denotes rat albumin C/EBP
T24283 29066-29078 Protein denotes region C/EBP
T24282 29041-29061 Protein denotes rat albumin promoter
T24281 29018-29028 Protein denotes C/EBP site
T24280 28976-28990 Protein denotes SerpinB2 C/EBP
T24279 28717-28724 Binding denotes binding
T24278 28783-28790 Protein denotes C/EBP-β
T24277 28729-28773 Protein denotes murine SerpinB2 proximal promoter C/EBP site
T23595 24187-24188 Negative_regulation denotes =
T23594 24328-24364 Protein denotes PU.1 =  purine box binding protein 1
T23593 24320-24326 Protein denotes POU2F1
T23592 24281-24319 Protein denotes Oct1 =  octamer transcription factor 1
T23591 24220-24250 Protein denotes CCAAT enhancer binding protein
T23590 24211-24216 Protein denotes C/EBP
T23589 24190-24209 Protein denotes activator protein 1
T23588 24182-24186 Protein denotes AP-1
T23587 24133-24158 Protein denotes murine SerpinB2 promoters
T23586 23946-23956 Regulation denotes responsive
T23585 23957-23963 Gene_expression denotes region
T23584 23971-23995 Protein denotes murine SerpinB2 promoter
T23033 21671-21672 Positive_regulation denotes =
T23032 21671-21672 Positive_regulation denotes =
T23031 21678-21711 Protein denotes short interspersed nuclear repeat
T23030 21802-21836 Protein denotes MLT1L = MLT1L long terminal repeat
T23029 21796-21800 Protein denotes SINE
T23028 21726-21728 Protein denotes L1
T23027 21720-21722 Protein denotes L1
T23026 21674-21677 Protein denotes ID4
T23025 21667-21670 Protein denotes ID4
T23024 21649-21652 Protein denotes Alu
T23023 21177-21187 Protein denotes luciferase
T23022 21011-21021 Protein denotes luciferase
T23021 20986-21010 Protein denotes murine SerpinB2 promoter
T23020 20689-20699 Protein denotes luciferase
T23019 20517-20531 Gene_expression denotes representation
T23018 20517-20531 Gene_expression denotes representation
T23017 20580-20610 Protein denotes luciferase reporter constructs
T23016 20539-20563 Protein denotes murine SerpinB2 promoter
T23015 20477-20501 Protein denotes murine SerpinB2 promoter
T22544 18593-18598 Protein denotes GAPDH
T22543 18571-18575 Protein denotes Blot
T22542 18537-18547 Gene_expression denotes expression
T22541 18520-18536 Protein denotes SerpinB2 protein
T22540 18392-18399 Protein denotes β-actin
T22539 18358-18371 Protein denotes SerpinB2 mRNA
T22538 18174-18183 Positive_regulation denotes induction
T22537 18213-18223 Gene_expression denotes expression
T22536 18174-18183 Positive_regulation denotes induction
T22535 18187-18200 Protein denotes SerpinB2 mRNA
T20772 47105-47122 Protein denotes SerpinB2 promoter
T20771 47069-47079 Protein denotes C/EBP-βS64
T20770 46964-46975 Positive_regulation denotes LPS-induced
T20769 46990-47000 Gene_expression denotes expression
T20768 46976-46989 Protein denotes SerpinB2 gene
T20767 46884-46917 Protein denotes murine SerpinB2 proximal promoter
T20766 46854-46864 Protein denotes C/EBP site
T20765 46617-46626 Positive_regulation denotes mediating
T20764 46661-46674 Transcription denotes transcription
T20763 46682-46695 Protein denotes SerpinB2 gene
T20762 46582-46589 Protein denotes C/EBP-β
T20761 46421-46428 Protein denotes C/EBP-β
T20760 46287-46295 Protein denotes SerpinB2
T20759 46119-46129 Gene_expression denotes expression
T20758 46110-46118 Protein denotes SerpinB2
T20757 45799-45803 Protein denotes MLK3
T20756 45686-45703 Phosphorylation denotes dephosphorylation
T20755 45686-45703 Phosphorylation denotes dephosphorylation
T20754 45686-45703 Phosphorylation denotes dephosphorylation
T20753 45737-45741 Protein denotes IFNγ
T20752 45707-45718 Protein denotes C/EBP-β S64
T20751 45673-45677 Protein denotes MLK3
T20750 45649-45671 Protein denotes Mixed lineage kinase-3
T20749 45580-45588 Positive_regulation denotes increase
T20748 45551-45564 Transcription denotes transcription
T20747 45406-45420 Phosphorylation denotes phosphorylated
T20746 45568-45576 Protein denotes SerpinB2
T20745 45376-45387 Protein denotes C/EBP-β S64
T20744 45320-45329 Regulation denotes regulates
T20743 45275-45290 Phosphorylation denotes phosphorylation
T20742 45210-45218 Positive_regulation denotes enhanced
T20741 45170-45180 Gene_expression denotes expression
T20740 45342-45359 Protein denotes SerpinB2 promoter
T20739 45294-45301 Protein denotes C/EBP-β
T20738 45231-45248 Protein denotes SerpinB2 promoter
T20737 45184-45195 Protein denotes C/EBP-βS64A
T20736 45087-45093 Regulation denotes affect
T20735 45087-45093 Regulation denotes affect
T20734 45009-45019 Gene_expression denotes expression
T20733 45009-45019 Gene_expression denotes expression
T20732 45094-45111 Protein denotes SerpinB2 promoter
T20698 43633-43646 Protein denotes C/EBP isoform
T20697 43599-43606 Protein denotes C/EBP-β
T20696 43519-43533 Protein denotes C/EBP proteins
T20695 43498-43511 Transcription denotes transcription
T20694 43498-43511 Transcription denotes transcription
T20693 43381-43390 Negative_regulation denotes abrogated
T20692 43353-43363 Gene_expression denotes expression
T20691 43484-43497 Protein denotes SerpinB2 gene
T20690 43472-43479 Protein denotes C/EBP-β
T20689 43394-43407 Protein denotes C/EBP-β-shRNA
T20688 43339-43352 Protein denotes SerpinB2 mRNA
T20687 43179-43183 Protein denotes IFNγ
T20686 43127-43134 Protein denotes C/EBP-β
T20685 42912-42919 Protein denotes C/EBP-β
T20684 42849-42856 Regulation denotes control
T20683 42857-42870 Transcription denotes transcription
T20682 42878-42890 Protein denotes C/EBP-β gene
T20681 42826-42830 Protein denotes CREB
T20680 42597-42609 Binding denotes interactions
T20679 42741-42746 Protein denotes NF-κB
T20678 42731-42735 Protein denotes AP-1
T20677 42677-42684 Protein denotes C/EBP-β
T20676 42652-42656 Protein denotes CREB
T20675 42630-42650 Protein denotes CRE binding proteins
T20674 42618-42625 Protein denotes C/EBP-β
T20673 42504-42508 Protein denotes AP-1
T20672 42400-42405 Protein denotes C/EBP
T20671 42174-42198 Protein denotes murine SerpinB2 promoter
T20670 41987-41996 Positive_regulation denotes mediating
T20669 42011-42024 Transcription denotes transcription
T20668 42032-42052 Protein denotes murine SerpinB2 gene
T20667 41873-41906 Protein denotes murine SerpinB2 proximal promoter
T20666 41743-41747 Protein denotes AP-1
T20665 41675-41717 Protein denotes murine SerpinB2 proximal promoter sequence
T20664 41448-41481 Protein denotes murine SerpinB2 proximal promoter
T20663 41352-41356 Negative_regulation denotes loss
T20662 41260-41264 Binding denotes bind
T20661 41260-41264 Binding denotes bind
T20660 41214-41225 Positive_regulation denotes LPS-induced
T20659 41360-41367 Protein denotes C/EBP-β
T20658 41299-41325 Protein denotes SerpinB2 proximal promoter
T20657 41269-41291 Protein denotes C/EBP response element
T20656 41226-41233 Protein denotes C/EBP-β
T20655 41190-41199 Positive_regulation denotes dependent
T20654 41131-41140 Regulation denotes conferred
T20653 41112-41120 Positive_regulation denotes response
T20652 41095-41108 Transcription denotes transcription
T20651 41205-41212 Protein denotes C/EBP-β
T20650 41148-41174 Protein denotes SerpinB2 proximal promoter
T20649 41081-41094 Protein denotes SerpinB2 gene
T20648 40961-40968 Positive_regulation denotes induced
T20647 41010-41017 Protein denotes p38MAPK
T20646 41000-41005 Protein denotes NF-κB
T20645 40995-40999 Protein denotes IKKβ
T20644 40931-40939 Protein denotes SerpinB2
T20731 45065-45077 Protein denotes C/EBP-βT188A
T20730 45027-45063 Protein denotes C/EBP-β phospho-acceptor site mutant
T20729 44958-44968 Regulation denotes regulation
T20728 44986-44996 Gene_expression denotes expression
T20727 44972-44985 Protein denotes SerpinB2 gene
T20726 44823-44831 Negative_regulation denotes decrease
T20725 44755-44766 Binding denotes recruitment
T20724 44574-44584 Gene_expression denotes expression
T20723 44574-44584 Gene_expression denotes expression
T20722 44574-44584 Gene_expression denotes expression
T20721 44789-44806 Protein denotes SerpinB2 promoter
T20720 44770-44781 Protein denotes C/EBP-βT217
T20719 44675-44701 Protein denotes SerpinB2 proximal promoter
T20718 44644-44657 Protein denotes Cebpb−/− MEFs
T20717 44628-44639 Protein denotes C/EBPβT217A
T20716 44590-44626 Protein denotes C/EBP-β phospho-acceptor site mutant
T20715 44373-44387 Phosphorylation denotes phosphorylated
T20714 44365-44372 Protein denotes C/EBP-β
T20713 44245-44252 Protein denotes C/EBP-β
T20712 44120-44130 Regulation denotes regulation
T20711 44148-44158 Gene_expression denotes expression
T20710 44162-44169 Protein denotes C/EBP-β
T20709 44134-44147 Protein denotes SerpinB2 gene
T20708 43936-43943 Protein denotes C/EBP-β
T20707 43775-43782 Protein denotes C/EBP-β
T20706 43737-43748 Positive_regulation denotes LPS-induced
T20705 43717-43721 Positive_regulation denotes role
T20704 43763-43773 Gene_expression denotes expression
T20703 43619-43632 Positive_regulation denotes LPS-inducible
T20702 43552-43562 Binding denotes homodimers
T20701 43749-43762 Protein denotes SerpinB2 gene
T20700 43726-43733 Protein denotes C/EBP-β
T20699 43659-43673 Protein denotes SerpinB2 C/EBP
T17447 39251-39259 Positive_regulation denotes increase
T17446 39251-39259 Positive_regulation denotes increase
T17445 39251-39259 Positive_regulation denotes increase
T17444 39148-39158 Gene_expression denotes Expression
T17443 39148-39158 Gene_expression denotes Expression
T17442 39148-39158 Gene_expression denotes Expression
T17441 39431-39448 Protein denotes SerpinB2 promoter
T17440 39372-39379 Protein denotes C/EBP-β
T17439 39260-39277 Protein denotes SerpinB2 promoter
T17438 39215-39228 Protein denotes Cebpb−/− MEFs
T17437 39199-39210 Protein denotes C/EBPβT217A
T17436 39166-39197 Protein denotes C/EBP-β phospho-acceptor mutant
T17435 38960-38970 Positive_regulation denotes stimulated
T17434 38960-38970 Positive_regulation denotes stimulated
T17433 39082-39092 Positive_regulation denotes importance
T17432 39005-39015 Gene_expression denotes expression
T17431 38894-38907 Gene_expression denotes Re-expression
T17430 38894-38907 Gene_expression denotes Re-expression
T17429 39096-39103 Protein denotes C/EBP-β
T17428 38971-38990 Protein denotes SerpinB2 luciferase
T17427 38932-38945 Protein denotes Cebpb−/− MEFs
T17426 38921-38928 Protein denotes C/EBP-β
T17425 38684-38696 Gene_expression denotes co-expressed
T17424 38605-38614 Positive_regulation denotes important
T17423 38879-38892 Protein denotes Cebpb−/− MEFs
T17422 38847-38875 Protein denotes SerpinB2 luciferase reporter
T17421 38705-38737 Protein denotes C/EBP-β phospho-acceptor mutants
T17420 38634-38660 Protein denotes SerpinB2 proximal promoter
T17419 38563-38592 Protein denotes C/EBP-β phosphorylation sites
T17418 38503-38511 Regulation denotes modulate
T17417 38454-38469 Phosphorylation denotes Phosphorylation
T17416 38473-38480 Protein denotes C/EBP-β
T17415 38402-38411 Regulation denotes Regulates
T17414 38351-38366 Phosphorylation denotes Phosphorylation
T17413 38381-38387 Entity denotes Serine
T17412 38427-38444 Protein denotes SerpinB2 Promoter
T17411 38370-38377 Protein denotes C/EBP-β
T16048 36813-36821 Positive_regulation denotes required
T16047 36737-36746 Negative_regulation denotes abrogated
T16046 36706-36715 Positive_regulation denotes increased
T16045 36838-36864 Protein denotes SerpinB2 proximal promoter
T16044 36802-36809 Protein denotes C/EBP-β
T16043 36719-36732 Protein denotes Cebpb+/+ MEFs
T16042 36661-36678 Protein denotes SerpinB2 promoter
T16041 36457-36470 Transcription denotes transcription
T16040 36617-36630 Protein denotes Cebpb−/− MEFs
T16039 36604-36609 Protein denotes Cebpb
T16038 36560-36579 Protein denotes SerpinB2 luciferase
T16037 36480-36506 Protein denotes SerpinB2 proximal promoter
T16036 36439-36446 Protein denotes C/EBP-β
T16035 36343-36356 Transcription denotes transcription
T16034 36160-36165 Binding denotes binds
T16033 36160-36165 Binding denotes binds
T16032 36366-36383 Protein denotes SerpinB2 promoter
T16031 36299-36306 Protein denotes C/EBP-β
T16030 36173-36199 Protein denotes SerpinB2 proximal promoter
T16029 36152-36159 Protein denotes C/EBP-β
T16028 36089-36102 Positive_regulation denotes LPS-inducible
T16027 36103-36136 Protein denotes Murine SerpinB2 Proximal Promoter
T16026 36072-36079 Protein denotes C/EBP-β
T14461 31927-31936 Positive_regulation denotes mediating
T14460 31968-31981 Transcription denotes transcription
T14459 31996-32009 Protein denotes SerpinB2 mRNA
T14458 31903-31910 Protein denotes C/EBP-β
T14457 31829-31838 Negative_regulation denotes deficient
T14456 31808-31817 Negative_regulation denotes decreased
T14455 31779-31789 Gene_expression denotes expression
T14454 31821-31828 Protein denotes C/EBP-β
T14453 31765-31778 Protein denotes SerpinB2 mRNA
T14452 31620-31630 Gene_expression denotes expression
T14451 31612-31619 Protein denotes C/EBP-β
T14450 31319-31327 Positive_regulation denotes increase
T14449 31451-31459 Positive_regulation denotes dampened
T14448 31422-31432 Gene_expression denotes expression
T14447 31345-31355 Gene_expression denotes expression
T14446 31463-31476 Protein denotes Cebpb−/− MEFs
T14445 31408-31421 Protein denotes SerpinB2 mRNA
T14444 31331-31344 Protein denotes SerpinB2 mRNA
T14443 31289-31299 Gene_expression denotes expression
T14442 31245-31288 Protein denotes C/EBP-β attenuated endogenous SerpinB2 mRNA
T14441 30956-30966 Positive_regulation denotes importance
T14440 31141-31148 Gene_expression denotes express
T14439 31020-31028 Positive_regulation denotes response
T14438 31006-31016 Gene_expression denotes expression
T14437 31149-31167 Protein denotes endogenous C/EBP-β
T14436 31063-31068 Protein denotes Cebpb
T14435 31049-31061 Protein denotes C/EBP-β-null
T14434 30992-31005 Protein denotes SerpinB2 mRNA
T14433 30970-30977 Protein denotes C/EBP-β
T14432 30824-30832 Positive_regulation denotes Mediates
T14431 30855-30866 Positive_regulation denotes LPS-induced
T14430 30824-30832 Positive_regulation denotes Mediates
T14429 30881-30891 Gene_expression denotes Expression
T14428 30867-30880 Protein denotes SerpinB2 mRNA
T14427 30816-30823 Protein denotes C/EBP-β
T13511 29546-29553 Protein denotes C/EBP-β
T13532 30806-30813 Protein denotes C/EBP-β
T13531 30771-30784 Protein denotes C/EBP element
T13530 30630-30637 Protein denotes C/EBP-β
T13529 30403-30410 Protein denotes C/EBP-ε
T13528 30382-30398 Protein denotes C/EBP-β, C/EBP-δ
T13527 30373-30380 Protein denotes C/EBP-α
T13526 30143-30157 Protein denotes C/EBP proteins
T13525 29979-29986 Protein denotes C/EBP-ε
T13524 29958-29974 Protein denotes C/EBP-β, C/EBP-δ
T13523 29949-29956 Protein denotes C/EBP-α
T13522 29855-29875 Binding denotes homo−/heterodimerize
T13521 29823-29850 Protein denotes C/EBP transcription factors
T13520 29672-29714 Protein denotes basic leucine zipper transcription factors
T13519 29656-29668 Protein denotes C/EBP family
T13518 29591-29596 Binding denotes Binds
T13517 29591-29596 Binding denotes Binds
T13516 29591-29596 Binding denotes Binds
T13515 29591-29596 Binding denotes Binds
T13514 29643-29651 Entity denotes Promoter
T13513 29625-29642 Protein denotes SerpinB2 Proximal
T13512 29604-29617 Protein denotes C/EBP Element
T12738 28529-28534 Binding denotes binds
T12737 28601-28613 Protein denotes C/EBP family
T12736 28496-28515 Protein denotes SerpinB2 C/EBP site
T12735 28359-28362 Protein denotes Fig
T12734 28337-28357 Protein denotes rat albumin promoter
T12733 28309-28327 Protein denotes C/EBP binding site
T12732 28106-28134 Protein denotes mutant C/EBP oligonucleotide
T12731 27535-27547 Positive_regulation denotes representing
T12730 27758-27762 Positive_regulation denotes high
T12729 27738-27744 Entity denotes region
T12728 27556-27564 Positive_regulation denotes putative
T12727 27772-27790 Protein denotes C/EBP binding site
T12726 27733-27736 Protein denotes DEI
T12725 27694-27731 Protein denotes rat albumin promoter distal element 1
T12724 27666-27681 Protein denotes pGLmP-539mC/EBP
T12723 27565-27587 Protein denotes SerpinB2 C/EBP element
T12722 27269-27276 Binding denotes binding
T12721 27293-27306 Protein denotes C/EBP element
T12720 27188-27193 Binding denotes Bound
T12719 27171-27184 Protein denotes C/EBP Element
T11956 27088-27096 Positive_regulation denotes critical
T11955 27115-27128 Transcription denotes transcription
T11954 27138-27164 Protein denotes SerpinB2 proximal promoter
T11953 27016-27029 Protein denotes C/EBP element
T11952 26914-26921 Negative_regulation denotes reduced
T11951 26926-26935 Positive_regulation denotes inducible
T11950 26965-26989 Protein denotes murine SerpinB2 promoter
T11949 26936-26946 Protein denotes luciferase
T11948 26922-26925 Protein denotes LPS
T11947 26849-26859 Protein denotes AP-1 sites
T11946 26786-26789 Protein denotes Fig
T11945 26716-26720 Regulation denotes role
T11944 26732-26740 Positive_regulation denotes response
T11943 26748-26772 Protein denotes murine SerpinB2 promoter
T11942 26499-26523 Protein denotes murine SerpinB2 promoter
T11941 26481-26491 Protein denotes AP-1 sites
T11940 25491-25501 Protein denotes C/EBP site
T11939 25303-25313 Protein denotes C/EBP site
T11938 25203-25208 Protein denotes Oct-1
T11937 25116-25119 Protein denotes Fig
T11936 25008-25015 Binding denotes binding
T11935 25094-25101 Protein denotes Fig. 4A
T11934 25058-25068 Protein denotes luciferase
T11933 25023-25057 Protein denotes pGLmP-539 murine SerpinB2 promoter
T11932 24675-24688 Transcription denotes Transcription
T11931 24559-24564 Protein denotes C/EBP
T10913 23760-23769 Protein denotes NF-κB p65
T10912 23520-23527 Binding denotes binding
T10911 23559-23564 Protein denotes Oct-1
T10910 23288-23292 Gene_expression denotes Both
T10909 23364-23387 Protein denotes human SERPINB2 promoter
T10908 23300-23310 Protein denotes AP-1 sites
T10907 23115-23144 Protein denotes potential activator protein 1
T10906 23074-23079 Protein denotes C/EBP
T10905 23042-23072 Protein denotes CCAAT enhancer binding protein
T10904 22832-22835 Protein denotes Fig
T10903 22806-22830 Protein denotes murine SerpinB2 promoter
T10902 22752-22784 Protein denotes human SerpinB2 proximal promoter
T10901 22333-22343 Regulation denotes regulation
T10900 22361-22371 Gene_expression denotes expression
T10899 22347-22360 Protein denotes SerpinB2 gene
T10898 22052-22059 Positive_regulation denotes mediate
T10897 22060-22073 Transcription denotes transcription
T10896 22081-22101 Protein denotes murine SerpinB2 gene
T10895 21989-21998 Entity denotes Promoters
T10894 21971-21988 Protein denotes SerpinB2 Proximal
T9957 20259-20268 Positive_regulation denotes mediating
T9956 20273-20281 Positive_regulation denotes response
T9955 20115-20122 Negative_regulation denotes reduced
T9954 20021-20029 Negative_regulation denotes deletion
T9953 20289-20313 Protein denotes murine SerpinB2 promoter
T9952 20037-20054 Protein denotes SerpinB2 promoter
T9951 19988-19996 Regulation denotes affected
T9950 19932-19940 Positive_regulation denotes response
T9949 19948-19972 Protein denotes murine SerpinB2 promoter
T9948 19633-19642 Positive_regulation denotes increased
T9947 19572-19580 Gene_expression denotes Deletion
T9946 19588-19612 Protein denotes murine SerpinB2 promoter
T9945 19415-19418 Protein denotes Fig
T9944 19104-19114 Protein denotes luciferase
T9943 18941-18951 Protein denotes luciferase
T9942 18777-18797 Protein denotes murine SerpinB2 gene
T9941 18626-18652 Protein denotes SerpinB2 Proximal Promoter
T9244 18017-18024 Positive_regulation denotes induced
T9243 17997-18007 Gene_expression denotes expression
T9242 17980-17996 Protein denotes SerpinB2 protein
T9241 17848-17859 Positive_regulation denotes LPS-induced
T9240 17869-17879 Gene_expression denotes expression
T9239 17860-17868 Protein denotes SerpinB2
T9238 17678-17687 Positive_regulation denotes induction
T9237 17691-17704 Positive_regulation denotes LPS-inducible
T9236 17719-17729 Gene_expression denotes expression
T9235 17705-17718 Protein denotes SerpinB2 mRNA
T9234 17543-17556 Protein denotes SerpinB2 mRNA
T9233 17454-17467 Protein denotes SerpinB2 Gene
T8579 17108-17134 Protein denotes SerpinB2 proximal promoter
T8578 16889-16901 Protein denotes Proteinase K
T8577 16628-16640 Protein denotes Clone CTD4H8
T8576 16609-16626 Protein denotes RNA polymerase II
T8575 16563-16566 Protein denotes IgG
T8574 16530-16534 Protein denotes T217
T8573 16519-16528 Protein denotes p-C/EBP-β
T8572 16500-16507 Protein denotes C/EBP-β
T8571 15791-15810 Localization denotes Immunoprecipitation
T8570 15781-15790 Protein denotes Chromatin
T8022 15757-15769 Protein denotes anti-C/EBP-ε
T8021 15731-15743 Protein denotes anti-C/EBP-δ
T8020 15708-15720 Protein denotes anti-C/EBP-β
T8019 15686-15698 Protein denotes anti-C/EBP-α
T8018 15627-15641 Protein denotes C/EBP antibody
T8017 15506-15509 Protein denotes Rad
T8016 14970-14994 Protein denotes T4 polynucleotide kinase
T7561 14790-14797 Positive_regulation denotes checked
T7560 14727-14737 Gene_expression denotes Expression
T7559 14745-14785 Protein denotes C/EBP-β phospho-acceptor mutant proteins
T7558 14556-14578 Protein denotes β-Galactosidase Enzyme
T7557 14545-14551 Protein denotes System
T7556 14528-14538 Protein denotes Luciferase
T7555 14497-14512 Protein denotes β-galactosidase
T7554 14436-14446 Protein denotes Luciferase
T7553 14310-14317 Protein denotes C/EBP-β
T7552 14299-14306 Protein denotes C/EBP-β
T7551 13963-13995 Protein denotes β-actin-β-galactosidase reporter
T7550 13913-13923 Protein denotes luciferase
T7549 11300-11310 Protein denotes Luciferase
T6900 13741-13750 Negative_regulation denotes knockdown
T6899 13733-13740 Protein denotes C/EBP-β
T6898 12888-12897 Negative_regulation denotes knockdown
T6897 13017-13024 Regulation denotes control
T6896 12898-12908 Gene_expression denotes expression
T6895 12994-13011 Protein denotes human CEBPB shRNA
T6894 12923-12930 Protein denotes C/EBP-β
T6317 12565-12568 Protein denotes Rad
T6316 12487-12495 Regulation denotes affected
T6315 12487-12495 Regulation denotes affected
T6314 12296-12305 Gene_expression denotes expressed
T6313 12500-12502 Protein denotes TK
T6312 12496-12499 Protein denotes pRL
T6311 12472-12479 Protein denotes C/EBP-β
T6310 12379-12412 Protein denotes TK renilla luciferase light units
T6309 12375-12378 Protein denotes pRL
T6308 12331-12341 Protein denotes luciferase
T6307 12149-12159 Protein denotes Luciferase
T6306 12103-12113 Protein denotes Luciferase
T6305 11684-11697 Protein denotes SV40 promoter
T6304 11495-11497 Protein denotes TK
T6303 11473-11493 Protein denotes pRL-thymidine kinase
T6302 11422-11432 Protein denotes luciferase
T6301 11300-11310 Protein denotes Luciferase
T5348 11194-11211 Protein denotes SerpinB2 promoter
T5347 11101-11106 Protein denotes Xho I
T5346 11090-11096 Protein denotes EcoR I
T5345 11061-11066 Protein denotes Xho I
T5344 11050-11056 Protein denotes EcoR I
T5343 11006-11030 Protein denotes Recombinant PCR products
T5342 10712-10723 Protein denotes mPAI2mCEBPb
T5341 10696-10707 Protein denotes mPAI2mCEBPa
T5340 10679-10694 Protein denotes pGLmP-539mC/EBP
T5339 10665-10677 Protein denotes mPAI2mOct-2b
T5338 10648-10660 Protein denotes mPAI2mOct-2a
T5337 10633-10646 Protein denotes pGLmP-539mOct
T5336 10620-10631 Protein denotes mPAI2mPU.1b
T5335 10604-10615 Protein denotes mPAI2mPU.1a
T5334 10508-10511 Protein denotes Fig
T5333 10323-10328 Protein denotes C/EBP
T5332 10313-10318 Protein denotes Oct-1
T5331 10307-10311 Protein denotes PU.1
T5330 10200-10230 Protein denotes Luciferase reporter constructs
T5329 10131-10138 Gene_expression denotes produce
T5328 10117-10121 Protein denotes pGL3
T5327 10073-10084 Protein denotes Kpn I/Xho I
T5326 9944-9957 Protein denotes T4 DNA ligase
T5325 9902-9905 Protein denotes NEB
T5324 9883-9900 Protein denotes T4 DNA polymerase
T5323 9811-9816 Protein denotes Apo I
T5322 9799-9806 Protein denotes Hae III
T5321 9792-9797 Protein denotes Pac I
T5320 9783-9790 Protein denotes Bsu36 I
T5319 9775-9781 Protein denotes BstX I
T5318 9768-9773 Protein denotes Apa I
T5317 9761-9766 Protein denotes Sfi I
T5316 9721-9727 Protein denotes EcoR I
T5315 9545-9580 Protein denotes murine SerpinB2 luciferase reporter
T5314 9514-9521 Gene_expression denotes produce
T5313 9388-9394 Protein denotes EcoR I
T5312 9340-9344 Protein denotes pGL3
T5311 9296-9307 Protein denotes Kpn I/Xho I
T5310 9127-9132 Protein denotes Kpn I
T5309 9057-9079 Protein denotes SerpinB2 Reporter Gene
T4468 8993-9004 Protein denotes α/β tubulin
T4467 8982-8987 Protein denotes GAPDH
T4466 8940-8980 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4465 8893-8900 Protein denotes C/EBP-β
T4464 8806-8814 Gene_expression denotes produced
T4463 8806-8814 Gene_expression denotes produced
T4462 8775-8805 Protein denotes murine SerpinB2 fusion protein
T4461 8771-8774 Protein denotes GST
T4029 8062-8071 Protein denotes ABI PRISM
T4028 7817-7839 Protein denotes pDB9406 EcoRI fragment
T4027 7757-7762 Protein denotes EcoRI
T4026 7648-7652 Protein denotes SpeI
T4025 7642-7647 Protein denotes EcoRI
T4024 7369-7384 Protein denotes exonuclease III
T4023 7157-7181 Protein denotes murine SerpinB2 promoter
T2315 5326-5336 Regulation denotes regulation
T2314 5344-5357 Protein denotes SerpinB2 gene
T2313 5228-5245 Protein denotes SerpinB2 promoter
T2312 5153-5182 Protein denotes C/EBP-β phospho-acceptor site
T2311 5018-5023 Binding denotes bound
T2310 5001-5008 Protein denotes C/EBP-β
T2309 4951-4960 Negative_regulation denotes dependent
T2308 4874-4885 Gene_expression denotes nucleotides
T2307 4805-4814 Regulation denotes dependent
T2306 4780-4789 Positive_regulation denotes induction
T2305 4968-4973 Protein denotes C/EBP
T2304 4907-4931 Protein denotes murine SerpinB2 promoter
T2303 4793-4801 Protein denotes SerpinB2
T2302 4595-4606 Regulation denotes responsible
T2301 4713-4717 Binding denotes bind
T2300 4625-4638 Transcription denotes transcription
T2299 4722-4739 Protein denotes SerpinB2 promoter
T2298 4577-4594 Protein denotes SerpinB2 promoter
T2297 4511-4516 Protein denotes IFN-γ
T2296 4265-4276 Positive_regulation denotes upregulated
T2295 4265-4276 Positive_regulation denotes upregulated
T2294 4265-4276 Positive_regulation denotes upregulated
T2293 4280-4291 Gene_expression denotes cooperation
T2292 4280-4291 Gene_expression denotes cooperation
T2291 4280-4291 Gene_expression denotes cooperation
T2290 4250-4260 Gene_expression denotes expression
T2289 4323-4327 Protein denotes CREB
T2288 4314-4322 Protein denotes p38 MAPK
T2287 4299-4309 Protein denotes IKKβ/NF-κB
T2286 4208-4216 Protein denotes SerpinB2
T2285 4198-4206 Protein denotes p38 MAPK
T2284 3833-3840 Binding denotes binding
T2283 4058-4062 Protein denotes MAPK
T2282 4024-4056 Protein denotes mitogen-activated protein kinase
T2281 4016-4021 Protein denotes NF-κB
T2280 3997-4014 Protein denotes nuclear factor-κB
T2279 3851-3855 Protein denotes TLR4
T2278 3811-3827 Protein denotes cytokine release
T2277 3271-3284 Protein denotes SerpinB2 gene
T2276 3096-3104 Protein denotes SerpinB2
T2275 2948-2956 Localization denotes secreted
T2274 2933-2941 Protein denotes SerpinB2
T2273 2809-2820 Protein_catabolism denotes degradation
T2272 2809-2820 Protein_catabolism denotes degradation
T2271 2809-2820 Protein_catabolism denotes degradation
T2270 2711-2720 Negative_regulation denotes inhibitor
T2269 2711-2720 Negative_regulation denotes inhibitor
T2268 2711-2720 Negative_regulation denotes inhibitor
T2267 2777-2792 Protein denotes serine protease
T2266 2762-2765 Protein denotes uPA
T2265 2724-2760 Protein denotes urokinase-type plasminogen activator
T2264 2675-2683 Protein denotes SerpinB2
T2263 2586-2595 Negative_regulation denotes inhibitor
T2262 2555-2585 Protein denotes ovalbumin-like serine protease
T669 1756-1766 Regulation denotes regulation
T668 1803-1813 Gene_expression denotes expression
T667 1794-1802 Protein denotes SerpinB2
T666 1738-1745 Protein denotes C/EBP-β
T665 1658-1667 Negative_regulation denotes deficient
T664 1577-1586 Negative_regulation denotes abrogated
T663 1553-1563 Gene_expression denotes expression
T662 1650-1657 Protein denotes C/EBP-β
T661 1590-1597 Protein denotes C/EBP-β
T660 1544-1552 Protein denotes SerpinB2
T659 1415-1422 Positive_regulation denotes induces
T658 1415-1422 Positive_regulation denotes induces
T657 1459-1468 Binding denotes complexes
T656 1459-1468 Binding denotes complexes
T655 1478-1495 Protein denotes SerpinB2 promoter
T654 1440-1447 Protein denotes C/EBP-β
T653 1229-1262 Protein denotes murine SerpinB2 proximal promoter
T652 1198-1202 Protein denotes AP-1
T651 1177-1196 Protein denotes activator protein 1
T650 1011-1034 Protein denotes human SERPINB2 promoter
T649 716-736 Protein denotes murine SerpinB2 gene
T648 608-625 Protein denotes SerpinB2 promoter
T647 459-465 Positive_regulation denotes induce
T646 475-485 Gene_expression denotes expression
T645 466-474 Protein denotes SerpinB2
T644 361-371 Negative_regulation denotes inhibition
T643 225-232 Positive_regulation denotes induced
T642 225-232 Positive_regulation denotes induced
T641 375-397 Protein denotes plasminogen activators
T640 208-213 Protein denotes PAI-2
T635 4-32 Protein denotes Transcription Factor C/EBP-β
T636 90-105 Protein denotes Murine SerpinB2
T637 73-86 Transcription denotes Transcription
T638 33-41 Positive_regulation denotes Mediates
T639 168-206 Protein denotes plasminogen activator inhibitor type 2
T17458 39802-39810 Protein denotes SerpinB2
T17457 39700-39704 Protein denotes IFNγ
T17456 39690-39695 Protein denotes DAPK1
T17455 39650-39661 Protein denotes C/EBP-βT188
T17454 39603-39610 Protein denotes C/EBP-β
T17453 39557-39564 Protein denotes Fig. 8B
T17452 39545-39555 Protein denotes C/EBP-βS64
T23975 26307-26317 Protein denotes luciferase
T23974 26182-26192 Protein denotes luciferase
T23973 26157-26181 Protein denotes murine SerpinB2 promoter
T23972 25765-25789 Protein denotes murine SerpinB2 promoter
T23971 25680-25704 Protein denotes murine SerpinB2 promoter
T17479 40550-40558 Regulation denotes regulate
T17478 40497-40512 Phosphorylation denotes phosphorylation
T17477 40559-40585 Protein denotes SerpinB2 proximal promoter
T17476 40516-40523 Protein denotes C/EBP-β
T17475 40397-40408 Positive_regulation denotes potentiated
T17474 40371-40381 Gene_expression denotes expression
T17473 40409-40426 Protein denotes SerpinB2 promoter
T17472 40385-40396 Protein denotes C/EBP-βS64A
T17471 40277-40294 Protein denotes SerpinB2 promoter
T17470 40203-40207 Regulation denotes role
T17469 40225-40235 Gene_expression denotes expression
T17468 40211-40224 Protein denotes SerpinB2 gene
T17467 40117-40124 Protein denotes C/EBP-β
T17466 39976-39985 Regulation denotes regulated
T17465 39957-39964 Positive_regulation denotes induced
T17464 39945-39953 Protein denotes SerpinB2
T17463 39882-39895 Transcription denotes transcription
T17462 39882-39895 Transcription denotes transcription
T17461 39903-39917 Protein denotes cytokines IL-6
T17460 39842-39852 Protein denotes C/EBP-βS64
T17459 39679-39689 Regulation denotes regulating
T17451 39529-39540 Protein denotes C/EBP-βT188
T17450 39478-39485 Protein denotes C/EBP-β
T17449 39417-39427 Regulation denotes regulation
T17448 39353-39368 Phosphorylation denotes phosphorylation
T3699 7073-7086 Protein denotes Mm00607939_s1
T3698 7064-7071 Protein denotes β-actin
T3697 7045-7058 Protein denotes Mm00843434_s1
T3696 7038-7043 Protein denotes Cebpb
T3695 7022-7035 Protein denotes Mm00440905_m1
T3694 7012-7020 Protein denotes SerpinB2
T3693 7003-7011 Protein denotes Serpinb2
R1546 T2265 T2271 themeOf urokinase-type plasminogen activator,degradation
R1547 T2286 T2290 themeOf SerpinB2,expression
R1548 T2266 T2269 themeOf uPA,inhibitor
R1549 T2266 T2272 themeOf uPA,degradation
R1550 T2267 T2270 themeOf serine protease,inhibitor
R1551 T2267 T2273 themeOf serine protease,degradation
R1552 T2274 T2275 themeOf SerpinB2,secreted
R1553 T2287 T2291 themeOf IKKβ/NF-κB,cooperation
R1554 T2288 T2292 themeOf p38 MAPK,cooperation
R1555 T2289 T2293 themeOf CREB,cooperation
R1556 T2290 T2294 themeOf expression,upregulated
R1557 T2290 T2295 themeOf expression,upregulated
R1559 T2290 T2296 themeOf expression,upregulated
R1560 T2291 T2294 causeOf cooperation,upregulated
R1561 T2292 T2295 causeOf cooperation,upregulated
R1562 T2293 T2296 causeOf cooperation,upregulated
R1569 T2298 T2300 themeOf SerpinB2 promoter,transcription
R1571 T2299 T2301 themeOf SerpinB2 promoter,bind
R1572 T2300 T2302 themeOf transcription,responsible
R1573 T2303 T2306 themeOf SerpinB2,induction
R1575 T2304 T2308 themeOf murine SerpinB2 promoter,nucleotides
R1576 T2306 T2307 themeOf induction,dependent
R1581 T2306 T2309 themeOf induction,dependent
R1582 T2310 T2311 themeOf C/EBP-β,bound
R1589 T2314 T2315 themeOf SerpinB2 gene,regulation
R3286 T4461 T4463 themeOf GST,produced
R3287 T4462 T4464 themeOf murine SerpinB2 fusion protein,produced
R3837 T5313 T5314 themeOf EcoR I,produce
R3838 T5328 T5329 themeOf pGL3,produce
R4494 T6308 T6314 themeOf luciferase,expressed
R4495 T6311 T6315 causeOf C/EBP-β,affected
R4496 T6311 T6316 causeOf C/EBP-β,affected
R4497 T6312 T6315 themeOf pRL,affected
R4498 T6313 T6316 themeOf TK,affected
R4961 T6894 T6896 themeOf C/EBP-β,expression
R4962 T6896 T6897 themeOf expression,control
R4963 T6896 T6898 themeOf expression,knockdown
R4964 T6899 T6900 themeOf C/EBP-β,knockdown
R5398 T7559 T7560 themeOf C/EBP-β phospho-acceptor mutant proteins,Expression
R5399 T7560 T7561 themeOf Expression,checked
R6234 T8570 T8571 themeOf Chromatin,Immunoprecipitation
R6767 T9235 T9236 themeOf SerpinB2 mRNA,expression
R6768 T9236 T9237 themeOf expression,LPS-inducible
R6769 T9237 T9238 themeOf LPS-inducible,induction
R6770 T9239 T9240 themeOf SerpinB2,expression
R6771 T9240 T9241 themeOf expression,LPS-induced
R6772 T9242 T9243 themeOf SerpinB2 protein,expression
R6773 T9243 T9244 themeOf expression,induced
R7284 T9946 T9947 themeOf murine SerpinB2 promoter,Deletion
R7285 T9947 T9948 themeOf Deletion,increased
R7286 T9949 T9950 themeOf murine SerpinB2 promoter,response
R7287 T9950 T9951 themeOf response,affected
R7288 T9952 T9954 themeOf SerpinB2 promoter,deletion
R7289 T9953 T9956 themeOf murine SerpinB2 promoter,response
R7290 T9954 T9955 themeOf deletion,reduced
R7291 T9956 T9957 themeOf response,mediating
R8007 T10894 T10895 partOf SerpinB2 Proximal,Promoters
R8008 T10896 T10897 themeOf murine SerpinB2 gene,transcription
R8009 T10897 T10898 themeOf transcription,mediate
R8010 T10899 T10900 themeOf SerpinB2 gene,expression
R8011 T10900 T10901 themeOf expression,regulation
R8012 T10908 T10910 themeOf AP-1 sites,Both
R8013 T10911 T10912 themeOf Oct-1,binding
R8819 T11931 T11932 themeOf C/EBP,Transcription
R8820 T11934 T11936 themeOf luciferase,binding
R8821 T11943 T11944 themeOf murine SerpinB2 promoter,response
R8822 T11944 T11945 themeOf response,role
R8823 T11948 T11951 causeOf LPS,inducible
R8824 T11949 T11951 themeOf luciferase,inducible
R8825 T11951 T11952 themeOf inducible,reduced
R8826 T11953 T11956 causeOf C/EBP element,critical
R8827 T11954 T11955 themeOf SerpinB2 proximal promoter,transcription
R8828 T11955 T11956 themeOf transcription,critical
R9438 T12719 T12720 themeOf C/EBP Element,Bound
R9439 T12721 T12722 themeOf C/EBP element,binding
R9440 T12723 T12728 themeOf SerpinB2 C/EBP element,putative
R9441 T12724 T12729 partOf pGLmP-539mC/EBP,region
R9442 T12725 T12729 partOf rat albumin promoter distal element 1,region
R9443 T12726 T12729 partOf DEI,region
R9444 T12727 T12730 themeOf C/EBP binding site,high
R9445 T12727 T12729 partOf C/EBP binding site,region
R9446 T12728 T12731 themeOf putative,representing
R9447 T12736 T12738 themeOf SerpinB2 C/EBP site,binds
R9983 T13511 T13515 themeOf C/EBP-β,Binds
R9984 T13511 T13516 themeOf C/EBP-β,Binds
R9985 T13511 T13518 themeOf C/EBP-β,Binds
R9986 T13512 T13515 themeOf C/EBP Element,Binds
R9987 T13512 T13517 themeOf C/EBP Element,Binds
R9988 T13512 T13518 themeOf C/EBP Element,Binds
R9989 T13513 T13516 themeOf SerpinB2 Proximal,Binds
R9990 T13513 T13517 themeOf SerpinB2 Proximal,Binds
R9991 T13513 T13518 themeOf SerpinB2 Proximal,Binds
R9992 T13513 T13514 partOf SerpinB2 Proximal,Promoter
R9993 T13514 T13515 Site Promoter,Binds
R9994 T13514 T13516 Site Promoter,Binds
R9995 T13514 T13517 Site Promoter,Binds
R9996 T13514 T13518 Site Promoter,Binds
R9997 T13521 T13522 themeOf C/EBP transcription factors,homo−/heterodimerize
R10620 T14427 T14430 causeOf C/EBP-β,Mediates
R10621 T14427 T14432 causeOf C/EBP-β,Mediates
R10622 T14428 T14429 themeOf SerpinB2 mRNA,Expression
R10623 T14429 T14430 themeOf Expression,Mediates
R10624 T14429 T14431 themeOf Expression,LPS-induced
R10625 T14431 T14432 themeOf LPS-induced,Mediates
R10626 T14433 T14441 causeOf C/EBP-β,importance
R10627 T14434 T14438 themeOf SerpinB2 mRNA,expression
R10628 T14437 T14440 themeOf endogenous C/EBP-β,express
R10629 T14438 T14439 themeOf expression,response
R10630 T14438 T14441 themeOf expression,importance
R10631 T14442 T14443 themeOf C/EBP-β attenuated endogenous SerpinB2 mRNA,expression
R10632 T14444 T14447 themeOf SerpinB2 mRNA,expression
R10633 T14445 T14448 themeOf SerpinB2 mRNA,expression
R10634 T14447 T14450 themeOf expression,increase
R10635 T14448 T14449 themeOf expression,dampened
R10636 T14451 T14452 themeOf C/EBP-β,expression
R10637 T14453 T14455 themeOf SerpinB2 mRNA,expression
R10638 T14454 T14457 themeOf C/EBP-β,deficient
R10639 T14455 T14456 themeOf expression,decreased
R10640 T14458 T14461 causeOf C/EBP-β,mediating
R10641 T14459 T14460 themeOf SerpinB2 mRNA,transcription
R10642 T14460 T14461 themeOf transcription,mediating
R11780 T16027 T16028 themeOf Murine SerpinB2 Proximal Promoter,LPS-inducible
R11781 T16029 T16033 themeOf C/EBP-β,binds
R11782 T16029 T16034 themeOf C/EBP-β,binds
R11783 T16030 T16034 themeOf SerpinB2 proximal promoter,binds
R11784 T16032 T16035 themeOf SerpinB2 promoter,transcription
R11785 T16037 T16041 themeOf SerpinB2 proximal promoter,transcription
R11786 T16042 T16047 themeOf SerpinB2 promoter,abrogated
R11787 T16043 T16046 themeOf Cebpb+/+ MEFs,increased
R11788 T16044 T16048 causeOf C/EBP-β,required
R11789 T16045 T16048 themeOf SerpinB2 proximal promoter,required
R12596 T17411 T17414 themeOf C/EBP-β,Phosphorylation
R12597 T17411 T17413 partOf C/EBP-β,Serine
R12598 T17413 T17414 Site Serine,Phosphorylation
R12599 T17414 T17415 themeOf Phosphorylation,Regulates
R12600 T17416 T17417 themeOf C/EBP-β,Phosphorylation
R12601 T17417 T17418 themeOf Phosphorylation,modulate
R14804 T20644 T20648 themeOf SerpinB2,induced
R14805 T20649 T20652 themeOf SerpinB2 gene,transcription
R14806 T20650 T20654 causeOf SerpinB2 proximal promoter,conferred
R14807 T20651 T20655 causeOf C/EBP-β,dependent
R14808 T20652 T20653 themeOf transcription,response
R14809 T20652 T20654 themeOf transcription,conferred
R14810 T20652 T20655 themeOf transcription,dependent
R14811 T20656 T20660 themeOf C/EBP-β,LPS-induced
R14812 T20656 T20661 themeOf C/EBP-β,bind
R14813 T20656 T20662 themeOf C/EBP-β,bind
R14814 T20657 T20661 themeOf C/EBP response element,bind
R14815 T20658 T20662 themeOf SerpinB2 proximal promoter,bind
R14816 T20659 T20663 themeOf C/EBP-β,loss
R14817 T20668 T20669 themeOf murine SerpinB2 gene,transcription
R14818 T20669 T20670 themeOf transcription,mediating
R14819 T20674 T20680 themeOf C/EBP-β,interactions
R14820 T20675 T20680 themeOf CRE binding proteins,interactions
R14821 T20681 T20684 causeOf CREB,control
R14822 T20682 T20683 themeOf C/EBP-β gene,transcription
R14823 T20683 T20684 themeOf transcription,control
R14824 T20688 T20692 themeOf SerpinB2 mRNA,expression
R14825 T20690 T20694 themeOf C/EBP-β,transcription
R14826 T20691 T20695 themeOf SerpinB2 gene,transcription
R14827 T20692 T20693 themeOf expression,abrogated
R14828 T20696 T20702 themeOf C/EBP proteins,homodimers
R14829 T20697 T20702 themeOf C/EBP-β,homodimers
R14830 T20698 T20703 themeOf C/EBP isoform,LPS-inducible
R14831 T20700 T20705 causeOf C/EBP-β,role
R14832 T20701 T20704 themeOf SerpinB2 gene,expression
R14833 T20704 T20705 themeOf expression,role
R14834 T20704 T20706 themeOf expression,LPS-induced
R14835 T20709 T20711 themeOf SerpinB2 gene,expression
R14836 T20710 T20712 causeOf C/EBP-β,regulation
R14837 T20711 T20712 themeOf expression,regulation
R14838 T20714 T20715 themeOf C/EBP-β,phosphorylated
R14839 T20716 T20722 themeOf C/EBP-β phospho-acceptor site mutant,expression
R14840 T20717 T20723 themeOf C/EBPβT217A,expression
R14841 T20718 T20724 themeOf Cebpb−/− MEFs,expression
R14842 T20720 T20725 themeOf C/EBP-βT217,recruitment
R14843 T20721 T20725 themeOf SerpinB2 promoter,recruitment
R14844 T20725 T20726 themeOf recruitment,decrease
R14845 T20727 T20728 themeOf SerpinB2 gene,expression
R14846 T20728 T20729 themeOf expression,regulation
R14847 T20730 T20733 themeOf C/EBP-β phospho-acceptor site mutant,expression
R14848 T20731 T20734 themeOf C/EBP-βT188A,expression
R14849 T20733 T20735 themeOf expression,affect
R14850 T20734 T20736 themeOf expression,affect
R14851 T20737 T20741 themeOf C/EBP-βS64A,expression
R14852 T20738 T20742 themeOf SerpinB2 promoter,enhanced
R14853 T20739 T20743 themeOf C/EBP-β,phosphorylation
R14854 T20741 T20742 causeOf expression,enhanced
R14855 T20743 T20744 themeOf phosphorylation,regulates
R14856 T20745 T20747 themeOf C/EBP-β S64,phosphorylated
R14857 T20746 T20748 themeOf SerpinB2,transcription
R14858 T20748 T20749 themeOf transcription,increase
R14859 T20750 T20754 themeOf Mixed lineage kinase-3,dephosphorylation
R14860 T20751 T20755 themeOf MLK3,dephosphorylation
R14861 T20752 T20756 themeOf C/EBP-β S64,dephosphorylation
R14862 T20758 T20759 themeOf SerpinB2,expression
R14863 T20762 T20765 causeOf C/EBP-β,mediating
R14864 T20763 T20764 themeOf SerpinB2 gene,transcription
R14865 T20764 T20765 themeOf transcription,mediating
R14866 T20768 T20769 themeOf SerpinB2 gene,expression
R14867 T20769 T20770 themeOf expression,LPS-induced
R16256 T22535 T22536 themeOf SerpinB2 mRNA,induction
R16257 T22535 T22537 themeOf SerpinB2 mRNA,expression
R16258 T22537 T22538 themeOf expression,induction
R16259 T22541 T22542 themeOf SerpinB2 protein,expression
R16582 T23016 T23018 themeOf murine SerpinB2 promoter,representation
R16583 T23017 T23019 themeOf luciferase reporter constructs,representation
R16584 T23030 T23032 themeOf MLT1L = MLT1L long terminal repeat,=
R16585 T23031 T23033 themeOf short interspersed nuclear repeat,=
R16973 T23584 T23585 themeOf murine SerpinB2 promoter,region
R16974 T23585 T23586 themeOf region,responsive
R16975 T23588 T23595 causeOf AP-1,=
R16976 T23589 T23595 themeOf activator protein 1,=
R17414 T24277 T24279 themeOf murine SerpinB2 proximal promoter C/EBP site,binding
R17415 T24280 T24288 themeOf SerpinB2 C/EBP,intact
R17416 T24282 T24285 themeOf rat albumin promoter,incubated
R17417 T24283 T24286 themeOf region C/EBP,incubated
R17418 T24284 T24287 themeOf rat albumin C/EBP,incubated
R17419 T24288 T24289 themeOf intact,containing
R17420 T24289 T24290 themeOf containing,incubated
R17862 T24934 T24937 causeOf C/EBP-β,essential
R17863 T24935 T24936 themeOf SerpinB2 mRNA,expression
R17864 T24936 T24937 themeOf expression,essential
R17865 T24938 T24943 themeOf SerpinB2 mRNA,expression
R17866 T24941 T24945 themeOf SerpinB2 mRNA,expression
R17867 T24942 T24946 themeOf Cebpb−/− MEFs,expression
R17868 T24943 T24944 themeOf expression,abrogated
R17869 T24945 T24947 themeOf expression,murine
R17870 T24946 T24948 themeOf expression,murine
R17871 T24949 T24951 themeOf SerpinB2,expression
R17872 T24950 T24953 themeOf C/EBP-β,deficient
R17873 T24951 T24952 themeOf expression,abrogated
R17874 T24956 T24959 themeOf C/EBP-β,knockdown
R17875 T24957 T24960 themeOf Cebpb shRNA,infection
R17876 T24958 T24961 themeOf not human CEBPB shRNA,infection
R17877 T24960 T24962 themeOf infection,knockdown
R17878 T24961 T24963 themeOf infection,knockdown
R17879 T24964 T24965 themeOf SerpinB2 mRNA,expression
R18334 T25673 T25675 themeOf RNAPII,Recruitment
R18335 T25674 T25675 themeOf SerpinB2 promoter,Recruitment
R18841 T26613 T26615 causeOf C/EBP-β,necessary
R18842 T26614 T26615 themeOf SerpinB2 proximal promoter,necessary
R18843 T26616 T26619 themeOf SerpinB2 proximal promoter,activated
R18844 T26617 T26620 themeOf Cebpb+/+ MEFs,activated
R18845 T26618 T26621 themeOf Cebpb−/− MEFs,activated
R18846 T26622 T26625 themeOf Cebpb−/− MEFs,expressing
R18847 T26624 T26626 themeOf luciferase,expressing
R18848 T26632 T26635 themeOf C/EBP-β,Phosphorylation
R18849 T26632 T26634 partOf C/EBP-β,Serine
R18850 T26634 T26635 Site Serine,Phosphorylation
R18851 T26636 T26640 themeOf C/EBP-β,expression
R18852 T26637 T26641 themeOf pGLmP-539 SerpinB2 promoter,expression
R18853 T26638 T26642 themeOf luciferase,expression
R18854 T26639 T26643 themeOf β-galactosidase reporter,expression
R18855 T26646 T26647 themeOf C/EBP-β phospho-acceptor mutants,expression
R18856 T26647 T26648 themeOf expression,confirms
R18857 T26649 T26651 themeOf C/EBP-βT217A,express
R18858 T26650 T26652 themeOf C/EBP-β,express
R322 T640 T643 themeOf PAI-2,induced
R323 T641 T644 themeOf plasminogen activators,inhibition
R324 T645 T646 themeOf SerpinB2,expression
R325 T646 T647 themeOf expression,induce
R326 T654 T656 themeOf C/EBP-β,complexes
R327 T654 T657 themeOf C/EBP-β,complexes
R328 T655 T657 themeOf SerpinB2 promoter,complexes
R329 T656 T658 themeOf complexes,induces
R330 T657 T659 themeOf complexes,induces
R331 T660 T663 themeOf SerpinB2,expression
R332 T662 T665 themeOf C/EBP-β,deficient
R333 T663 T664 themeOf expression,abrogated
R334 T666 T669 causeOf C/EBP-β,regulation
R335 T667 T668 themeOf SerpinB2,expression
R336 T668 T669 themeOf expression,regulation
R703 T635 T638 causeOf Transcription Factor C/EBP-β,Mediates
R704 T636 T637 themeOf Murine SerpinB2,Transcription
R705 T637 T638 themeOf Transcription,Mediates
R706 T639 T642 themeOf plasminogen activator inhibitor type 2,induced
R1543 T2279 T2284 themeOf TLR4,binding
R1544 T2262 T2263 themeOf ovalbumin-like serine protease,inhibitor
R1545 T2265 T2268 themeOf urokinase-type plasminogen activator,inhibitor
R12602 T17419 T17424 causeOf C/EBP-β phosphorylation sites,important
R12603 T17420 T17424 themeOf SerpinB2 proximal promoter,important
R12604 T17421 T17425 themeOf C/EBP-β phospho-acceptor mutants,co-expressed
R12605 T17426 T17430 themeOf C/EBP-β,Re-expression
R12606 T17427 T17431 themeOf Cebpb−/− MEFs,Re-expression
R12607 T17428 T17432 themeOf SerpinB2 luciferase,expression
R12608 T17429 T17433 themeOf C/EBP-β,importance
R12609 T17430 T17434 causeOf Re-expression,stimulated
R12610 T17431 T17435 causeOf Re-expression,stimulated
R12611 T17432 T17434 themeOf expression,stimulated
R12612 T17432 T17435 themeOf expression,stimulated
R12613 T17436 T17442 themeOf C/EBP-β phospho-acceptor mutant,Expression
R12614 T17437 T17443 themeOf C/EBPβT217A,Expression
R12615 T17438 T17444 themeOf Cebpb−/− MEFs,Expression
R12616 T17440 T17448 themeOf C/EBP-β,phosphorylation
R12617 T17441 T17449 themeOf SerpinB2 promoter,regulation
R12618 T17442 T17445 themeOf Expression,increase
R12619 T17443 T17446 themeOf Expression,increase
R12620 T17444 T17447 themeOf Expression,increase
R12621 T17448 T17449 causeOf phosphorylation,regulation
R12622 T17455 T17459 causeOf C/EBP-βT188,regulating
R12623 T17456 T17459 themeOf DAPK1,regulating
R12624 T17460 T17462 themeOf C/EBP-βS64,transcription
R12625 T17461 T17463 themeOf cytokines IL-6,transcription
R12626 T17464 T17465 themeOf SerpinB2,induced
R12627 T17464 T17466 themeOf SerpinB2,regulated
R12628 T17468 T17469 themeOf SerpinB2 gene,expression
R12629 T17469 T17470 themeOf expression,role
R12630 T17472 T17474 themeOf C/EBP-βS64A,expression
R12631 T17474 T17475 themeOf expression,potentiated
R12632 T17476 T17478 themeOf C/EBP-β,phosphorylation
R12633 T17477 T17479 themeOf SerpinB2 proximal promoter,regulate
R12634 T17478 T17479 causeOf phosphorylation,regulate

testone

Id Subject Object Predicate Lexical cue
T20 25-32 Protein denotes C/EBP-β
T21 97-105 Protein denotes SerpinB2
T26026 38160-38167 Gene_expression denotes express
T26025 38062-38072 Gene_expression denotes expression
T26024 37556-37571 Phosphorylation denotes Phosphorylation
T26023 37300-37314 Gene_expression denotes co-transfected
T26022 37179-37189 Gene_expression denotes expressing
T26021 38207-38214 Protein denotes C/EBP-β
T26020 38129-38141 Protein denotes C/EBP-βT217A
T26019 38091-38123 Protein denotes C/EBP-β phospho-acceptor mutants
T26018 37987-38002 Protein denotes β-galactosidase
T26017 37934-37944 Protein denotes Luciferase
T26016 37864-37888 Protein denotes β-galactosidase reporter
T26015 37822-37859 Protein denotes SerpinB2 promoter-luciferase reporter
T26014 37763-37795 Protein denotes C/EBP-β phospho-acceptor mutants
T26013 37738-37745 Protein denotes C/EBP-β
T26012 37660-37665 Protein denotes Cebpb
T26011 37632-37640 Protein denotes SerpinB2
T26010 37575-37582 Protein denotes C/EBP-β
T26009 37476-37483 Protein denotes C/EBP-β
T26008 37446-37461 Protein denotes β-galactosidase
T26007 37415-37425 Protein denotes luciferase
T26006 37376-37400 Protein denotes β-galactosidase reporter
T26005 37334-37371 Protein denotes SerpinB2 promoter-luciferase reporter
T26004 37204-37241 Protein denotes SerpinB2 promoter-luciferase reporter
T26003 37165-37170 Protein denotes Cebpb
T26002 37152-37157 Protein denotes Cebpb
T26001 37108-37116 Protein denotes SerpinB2
T26000 37086-37091 Protein denotes Cebpb
T25999 37061-37066 Protein denotes Cebpb
T25998 36989-36997 Protein denotes SerpinB2
T25997 36944-36952 Protein denotes SerpinB2
T25996 36919-36926 Protein denotes C/EBP-β
T25293 35719-35732 Transcription denotes transcription
T25292 35694-35702 Entity denotes promoter
T25291 35656-35667 Binding denotes Recruitment
T25290 35073-35081 Entity denotes promoter
T25289 34999-35007 Entity denotes promoter
T25288 34937-34948 Binding denotes recruitment
T25287 36034-36038 Protein denotes rIgG
T25286 35957-35973 Protein denotes p-C/EBP-β (T217)
T25285 35948-35955 Protein denotes C/EBP-β
T25284 35685-35693 Protein denotes SerpinB2
T25283 35568-35576 Protein denotes SerpinB2
T25282 35429-35445 Protein denotes p-C/EBP-β (T217)
T25281 35420-35427 Protein denotes C/EBP-β
T25280 35324-35340 Protein denotes p-C/EBP-β (T217)
T25279 35313-35320 Protein denotes C/EBP-β
T25278 35055-35063 Protein denotes SerpinB2
T25277 34990-34998 Protein denotes SerpinB2
T25276 34952-34959 Protein denotes C/EBP-β
T24534 33020-33035 Transcription denotes mRNA expression
T24533 32483-32492 Negative_regulation denotes deficient
T24532 32300-32304 Transcription denotes mRNA
T24531 32159-32174 Transcription denotes mRNA expression
T24530 32118-32133 Transcription denotes mRNA expression
T24529 32101-32108 Positive_regulation denotes induced
T24528 32066-32075 Positive_regulation denotes essential
T24527 33011-33019 Protein denotes SerpinB2
T24526 32901-32908 Protein denotes C/EBP-β
T24525 32730-32735 Protein denotes Cebpb
T24524 32475-32482 Protein denotes C/EBP-β
T24523 32439-32447 Protein denotes SerpinB2
T24522 32342-32347 Protein denotes Cebpb
T24521 32329-32334 Protein denotes Cebpb
T24520 32291-32299 Protein denotes SerpinB2
T24519 32217-32222 Protein denotes Cebpb
T24518 32191-32196 Protein denotes Cebpb
T24517 32150-32158 Protein denotes SerpinB2
T24516 32109-32117 Protein denotes SerpinB2
T24515 32055-32062 Protein denotes C/EBP-β
T24160 28717-28724 Binding denotes binding
T24159 28692-28701 Positive_regulation denotes inducible
T24158 29173-29181 Protein denotes SerpinB2
T24157 29084-29091 Protein denotes albumin
T24156 29045-29052 Protein denotes albumin
T24155 28976-28984 Protein denotes SerpinB2
T24154 28920-28928 Protein denotes SerpinB2
T24153 28783-28790 Protein denotes C/EBP-β
T24152 28736-28744 Protein denotes SerpinB2
T23769 26307-26317 Protein denotes luciferase
T23768 26164-26201 Protein denotes SerpinB2 promoter-luciferase reporter
T23767 25983-25991 Protein denotes SerpinB2
T23766 25772-25780 Protein denotes SerpinB2
T23765 25687-25695 Protein denotes SerpinB2
T22673 21442-21450 Protein denotes SerpinB2
T22672 21363-21371 Protein denotes SerpinB2
T22671 21177-21187 Protein denotes luciferase
T22670 20993-21030 Protein denotes SerpinB2 promoter-luciferase reporter
T22669 20881-20889 Protein denotes SerpinB2
T22668 20689-20699 Protein denotes luciferase
T22667 20546-20599 Protein denotes SerpinB2 promoter and 5′ deletion luciferase reporter
T22666 20484-20492 Protein denotes SerpinB2
T23381 24336-24364 Protein denotes purine box binding protein 1
T23380 24328-24332 Protein denotes PU.1
T23379 24320-24326 Protein denotes POU2F1
T23378 24289-24319 Protein denotes octamer transcription factor 1
T23377 24281-24285 Protein denotes Oct1
T23376 24140-24148 Protein denotes SerpinB2
T23375 23978-23986 Protein denotes SerpinB2
T22382 18537-18547 Gene_expression denotes expression
T22381 18213-18223 Gene_expression denotes expression
T22380 18174-18183 Positive_regulation denotes induction
T22379 18593-18598 Protein denotes GAPDH
T22378 18520-18528 Protein denotes SerpinB2
T22377 18392-18399 Protein denotes β-actin
T22376 18358-18366 Protein denotes SerpinB2
T22375 18187-18195 Protein denotes SerpinB2
T18281 47188-47198 Regulation denotes regulation
T18280 46968-46975 Positive_regulation denotes induced
T18279 46921-46930 Positive_regulation denotes necessary
T18278 46661-46674 Transcription denotes transcription
T18277 46653-46660 Positive_regulation denotes induced
T18276 45477-45494 Phosphorylation denotes dephosphorylation
T18275 45406-45420 Phosphorylation denotes phosphorylated
T18274 45275-45290 Phosphorylation denotes phosphorylation
T18273 45170-45180 Gene_expression denotes expression
T18272 45035-45042 Phosphorylation denotes phospho
T18271 45009-45019 Gene_expression denotes expression
T18270 44958-44968 Regulation denotes regulation
T18269 44823-44831 Negative_regulation denotes decrease
T18268 44798-44806 Entity denotes promoter
T18267 44755-44766 Binding denotes recruitment
T18266 44574-44584 Gene_expression denotes expression
T18265 44373-44387 Phosphorylation denotes phosphorylated
T18264 44226-44241 Phosphorylation denotes Phosphorylation
T18263 44148-44158 Gene_expression denotes expression
T18262 44120-44130 Regulation denotes regulation
T18261 43944-43948 Negative_regulation denotes null
T18260 43849-43860 Positive_regulation denotes upregulated
T18259 43763-43773 Gene_expression denotes expression
T18258 43741-43748 Positive_regulation denotes induced
T18257 43717-43721 Regulation denotes role
T18256 43650-43654 Binding denotes bind
T18255 43381-43390 Negative_regulation denotes abrogated
T18254 43348-43363 Transcription denotes mRNA expression
T18253 43329-43338 Positive_regulation denotes inducible
T18252 43197-43205 Negative_regulation denotes impaired
T18251 43135-43144 Negative_regulation denotes deficient
T18250 42986-42993 Positive_regulation denotes induced
T18249 42944-42955 Positive_regulation denotes requirement
T18248 42717-42725 Binding denotes interact
T18247 42634-42641 Binding denotes binding
T18246 42597-42609 Binding denotes interactions
T18245 42011-42024 Transcription denotes transcription
T18244 42001-42010 Positive_regulation denotes inducible
T18243 41802-41815 Transcription denotes transcription
T18242 41791-41801 Positive_regulation denotes stimulated
T18241 41779-41786 Positive_regulation denotes mediate
T18240 41352-41356 Negative_regulation denotes loss
T18239 41260-41264 Binding denotes bind
T18238 41218-41225 Positive_regulation denotes induced
T18237 41166-41174 Entity denotes promoter
T18236 41157-41165 Entity denotes proximal
T18235 47226-47234 Protein denotes SerpinB2
T18234 47105-47113 Protein denotes SerpinB2
T18233 46976-46984 Protein denotes SerpinB2
T18232 46891-46899 Protein denotes SerpinB2
T18231 46682-46690 Protein denotes SerpinB2
T18230 46582-46589 Protein denotes C/EBP-β
T18229 46421-46428 Protein denotes C/EBP-β
T18228 46287-46295 Protein denotes SerpinB2
T18227 46110-46118 Protein denotes SerpinB2
T18226 45799-45803 Protein denotes MLK3
T18225 45737-45741 Protein denotes IFNγ
T18224 45707-45714 Protein denotes C/EBP-β
T18223 45673-45677 Protein denotes MLK3
T18222 45649-45671 Protein denotes Mixed lineage kinase-3
T18221 45568-45576 Protein denotes SerpinB2
T18220 45376-45383 Protein denotes C/EBP-β
T18219 45342-45350 Protein denotes SerpinB2
T18218 45294-45301 Protein denotes C/EBP-β
T18217 45231-45239 Protein denotes SerpinB2
T18216 45184-45195 Protein denotes C/EBP-βS64A
T18215 45094-45102 Protein denotes SerpinB2
T18214 45065-45077 Protein denotes C/EBP-βT188A
T18213 45027-45063 Protein denotes C/EBP-β phospho-acceptor site mutant
T18212 44972-44980 Protein denotes SerpinB2
T18211 44789-44797 Protein denotes SerpinB2
T18210 44734-44741 Protein denotes C/EBP-β
T18209 44675-44683 Protein denotes SerpinB2
T18208 44644-44649 Protein denotes Cebpb
T18207 44628-44639 Protein denotes C/EBPβT217A
T18206 44590-44626 Protein denotes C/EBP-β phospho-acceptor site mutant
T18205 44550-44558 Protein denotes SerpinB2
T18204 44365-44372 Protein denotes C/EBP-β
T18203 44245-44252 Protein denotes C/EBP-β
T18202 44162-44169 Protein denotes C/EBP-β
T18201 44134-44142 Protein denotes SerpinB2
T18200 44008-44016 Protein denotes SerpinB2
T18199 43936-43943 Protein denotes C/EBP-β
T18198 43789-43797 Protein denotes SerpinB2
T18197 43775-43782 Protein denotes C/EBP-β
T18196 43749-43757 Protein denotes SerpinB2
T18195 43726-43733 Protein denotes C/EBP-β
T18194 43659-43667 Protein denotes SerpinB2
T18193 43599-43606 Protein denotes C/EBP-β
T18192 43484-43492 Protein denotes SerpinB2
T18191 43472-43479 Protein denotes C/EBP-β
T18190 43339-43347 Protein denotes SerpinB2
T18189 43179-43183 Protein denotes IFNγ
T18188 43127-43134 Protein denotes C/EBP-β
T18187 43103-43107 Protein denotes gene
T18186 43076-43084 Protein denotes SerpinB2
T18185 42994-43002 Protein denotes SerpinB2
T18184 42912-42919 Protein denotes C/EBP-β
T18183 42878-42885 Protein denotes C/EBP-β
T18182 42677-42684 Protein denotes C/EBP-β
T18181 42618-42625 Protein denotes C/EBP-β
T18180 42181-42189 Protein denotes SerpinB2
T18179 42039-42047 Protein denotes SerpinB2
T18178 41880-41888 Protein denotes SerpinB2
T18177 41829-41837 Protein denotes SERPINB2
T18176 41682-41690 Protein denotes SerpinB2
T18175 41455-41463 Protein denotes SerpinB2
T18174 41391-41399 Protein denotes SerpinB2
T18173 41360-41367 Protein denotes C/EBP-β
T18172 41299-41307 Protein denotes SerpinB2
T18171 41226-41233 Protein denotes C/EBP-β
T18170 41205-41212 Protein denotes C/EBP-β
T18169 41148-41156 Protein denotes SerpinB2
T18168 41081-41089 Protein denotes SerpinB2
T18167 40995-40999 Protein denotes IKKβ
T18166 40931-40939 Protein denotes SerpinB2
T18165 40921-40929 Protein denotes SerpinB2
T16376 40497-40512 Phosphorylation denotes phosphorylation
T16375 40439-40450 Positive_regulation denotes response to
T16374 40371-40381 Gene_expression denotes expression
T16373 40341-40352 Gene_expression denotes transfected
T16372 40225-40235 Gene_expression denotes expression
T16371 40203-40207 Regulation denotes role
T16370 40186-40191 Entity denotes sites
T16369 40176-40177 Entity denotes -
T16368 39976-39985 Regulation denotes regulated
T16367 39957-39964 Positive_regulation denotes induced
T16366 39882-39895 Transcription denotes transcription
T16365 39874-39881 Positive_regulation denotes induced
T16364 39856-39865 Regulation denotes important
T16363 39679-39689 Regulation denotes regulating
T16362 39635-39648 Transcription denotes transcription
T16361 39611-39620 Regulation denotes dependent
T16360 39592-39602 Regulation denotes modulating
T16359 39506-39521 Phosphorylation denotes phosphorylation
T16358 39353-39368 Phosphorylation denotes phosphorylation
T16357 39251-39259 Positive_regulation denotes increase
T16356 39148-39158 Gene_expression denotes Expression
T16355 39133-39146 Transcription denotes transcription
T16354 39111-39118 Positive_regulation denotes induced
T16353 39023-39031 Positive_regulation denotes presence
T16352 39005-39015 Gene_expression denotes expression
T16351 38960-38970 Positive_regulation denotes stimulated
T16350 38894-38907 Gene_expression denotes Re-expression
T16349 38684-38696 Gene_expression denotes co-expressed
T16348 38571-38586 Phosphorylation denotes phosphorylation
T16347 38489-38499 Binding denotes recognized
T16346 38454-38469 Phosphorylation denotes Phosphorylation
T16345 38351-38366 Phosphorylation denotes Phosphorylation
T16344 40559-40567 Protein denotes SerpinB2
T16343 40516-40523 Protein denotes C/EBP-β
T16342 40409-40417 Protein denotes SerpinB2
T16341 40385-40396 Protein denotes C/EBP-βS64A
T16340 40333-40340 Protein denotes C/EBP-β
T16339 40277-40285 Protein denotes SerpinB2
T16338 40237-40249 Protein denotes C/EBP-βT188A
T16337 40211-40219 Protein denotes SerpinB2
T16336 40129-40137 Protein denotes SerpinB2
T16335 40117-40124 Protein denotes C/EBP-β
T16334 39945-39953 Protein denotes SerpinB2
T16333 39922-39927 Protein denotes MCP-1
T16332 39913-39917 Protein denotes IL-6
T16331 39802-39810 Protein denotes SerpinB2
T16330 39715-39719 Protein denotes gene
T16329 39700-39704 Protein denotes IFNγ
T16328 39690-39695 Protein denotes DAPK1
T16327 39621-39629 Protein denotes SerpinB2
T16326 39603-39610 Protein denotes C/EBP-β
T16325 39478-39485 Protein denotes C/EBP-β
T16324 39431-39439 Protein denotes SerpinB2
T16323 39372-39379 Protein denotes C/EBP-β
T16322 39311-39318 Protein denotes C/EBP-β
T16321 39260-39268 Protein denotes SerpinB2
T16320 39215-39220 Protein denotes Cebpb
T16319 39199-39210 Protein denotes C/EBPβT217A
T16318 39166-39197 Protein denotes C/EBP-β phospho-acceptor mutant
T16317 39119-39127 Protein denotes SerpinB2
T16316 39096-39103 Protein denotes C/EBP-β
T16315 38971-38999 Protein denotes SerpinB2 luciferase reporter
T16314 38932-38937 Protein denotes Cebpb
T16313 38921-38928 Protein denotes C/EBP-β
T16312 38879-38884 Protein denotes Cebpb
T16311 38847-38875 Protein denotes SerpinB2 luciferase reporter
T16310 38705-38737 Protein denotes C/EBP-β phospho-acceptor mutants
T16309 38634-38642 Protein denotes SerpinB2
T16308 38563-38570 Protein denotes C/EBP-β
T16307 38473-38480 Protein denotes C/EBP-β
T16306 38427-38435 Protein denotes SerpinB2
T16305 38370-38377 Protein denotes C/EBP-β
T15670 36737-36746 Negative_regulation denotes abrogated
T15669 36523-36535 Gene_expression denotes transfection
T15668 36498-36506 Entity denotes promoter
T15667 36457-36470 Transcription denotes transcription
T15666 36191-36199 Entity denotes promoter
T15665 36182-36190 Entity denotes proximal
T15664 36160-36165 Binding denotes binds
T15663 36838-36846 Protein denotes SerpinB2
T15662 36802-36809 Protein denotes C/EBP-β
T15661 36750-36755 Protein denotes Cebpb
T15660 36719-36724 Protein denotes Cebpb
T15659 36661-36669 Protein denotes SerpinB2
T15658 36617-36622 Protein denotes Cebpb
T15657 36604-36609 Protein denotes Cebpb
T15656 36560-36588 Protein denotes SerpinB2 luciferase reporter
T15655 36480-36488 Protein denotes SerpinB2
T15654 36439-36446 Protein denotes C/EBP-β
T15653 36366-36374 Protein denotes SerpinB2
T15652 36299-36306 Protein denotes C/EBP-β
T15651 36173-36181 Protein denotes SerpinB2
T15650 36152-36159 Protein denotes C/EBP-β
T15649 36110-36118 Protein denotes SerpinB2
T15648 36072-36079 Protein denotes C/EBP-β
T14821 34819-34832 Transcription denotes transcription
T14820 34809-34818 Positive_regulation denotes increased
T14819 34759-34773 Phosphorylation denotes phosphorylated
T14818 34723-34734 Binding denotes recruitment
T14817 34565-34573 Entity denotes promoter
T14816 34505-34512 Binding denotes binding
T14815 34405-34413 Entity denotes promoter
T14814 34396-34404 Entity denotes proximal
T14813 34387-34395 Entity denotes SerpinB2
T14812 34374-34379 Binding denotes bound
T14811 34242-34256 Phosphorylation denotes phosphorylated
T14810 34221-34229 Entity denotes promoter
T14809 34212-34220 Entity denotes proximal
T14808 34203-34211 Entity denotes SerpinB2
T14807 34184-34195 Binding denotes recruitment
T14806 34068-34083 Phosphorylation denotes phosphorylation
T14805 34049-34056 Regulation denotes changes
T14804 33953-33964 Positive_regulation denotes response to
T14803 33867-33878 Binding denotes association
T14802 33397-33405 Entity denotes promoter
T14801 33362-33373 Binding denotes recruitment
T14800 33269-33277 Entity denotes Promoter
T14799 33234-33239 Binding denotes Binds
T13898 31968-31981 Transcription denotes transcription
T13897 31958-31967 Positive_regulation denotes inducible
T13896 31914-31922 Positive_regulation denotes critical
T13895 31829-31838 Negative_regulation denotes deficient
T13894 31808-31817 Negative_regulation denotes decreased
T13893 31774-31789 Transcription denotes mRNA expression
T13892 31757-31764 Positive_regulation denotes induced
T13891 31635-31647 Negative_regulation denotes knocked down
T13890 31620-31630 Gene_expression denotes expression
T13889 31417-31432 Transcription denotes mRNA expression
T13888 31397-31407 Positive_regulation denotes stimulated
T13887 31340-31355 Transcription denotes mRNA expression
T13886 31319-31327 Positive_regulation denotes increase
T13885 31284-31299 Transcription denotes mRNA expression
T13884 31253-31263 Negative_regulation denotes attenuated
T13883 31184-31191 Gene_expression denotes express
T13882 31141-31148 Gene_expression denotes express
T13881 31057-31061 Negative_regulation denotes null
T13880 31001-31016 Transcription denotes mRNA expression
T13879 30876-30891 Transcription denotes mRNA Expression
T13878 30859-30866 Positive_regulation denotes induced
T13877 30824-30832 Positive_regulation denotes Mediates
T13876 31996-32004 Protein denotes SerpinB2
T13875 31903-31910 Protein denotes C/EBP-β
T13874 31821-31828 Protein denotes C/EBP-β
T13873 31765-31773 Protein denotes SerpinB2
T13872 31612-31619 Protein denotes C/EBP-β
T13871 31463-31468 Protein denotes Cebpb
T13870 31408-31416 Protein denotes SerpinB2
T13869 31331-31339 Protein denotes SerpinB2
T13868 31275-31283 Protein denotes SerpinB2
T13867 31245-31252 Protein denotes C/EBP-β
T13866 31217-31225 Protein denotes SerpinB2
T13865 31160-31167 Protein denotes C/EBP-β
T13864 31094-31099 Protein denotes Cebpb
T13863 31063-31068 Protein denotes Cebpb
T13862 31049-31056 Protein denotes C/EBP-β
T13861 30992-31000 Protein denotes SerpinB2
T13860 30970-30977 Protein denotes C/EBP-β
T13859 30867-30875 Protein denotes SerpinB2
T13858 30816-30823 Protein denotes C/EBP-β
T13114 30163-30171 Regulation denotes involved
T13113 29643-29651 Entity denotes Promoter
T13112 29610-29617 Entity denotes Element
T13111 29591-29596 Binding denotes Binds
T13110 29563-29570 Positive_regulation denotes induced
T13109 30806-30813 Protein denotes C/EBP-β
T13108 30630-30637 Protein denotes C/EBP-β
T13107 30403-30410 Protein denotes C/EBP-ε
T13106 30391-30398 Protein denotes C/EBP-δ
T13105 30382-30389 Protein denotes C/EBP-β
T13104 30373-30380 Protein denotes C/EBP-α
T13103 29979-29986 Protein denotes C/EBP-ε
T13102 29967-29974 Protein denotes C/EBP-δ
T13101 29958-29965 Protein denotes C/EBP-β
T13100 29949-29956 Protein denotes C/EBP-α
T13099 29625-29633 Protein denotes SerpinB2
T13098 29546-29553 Protein denotes C/EBP-β
T12387 28315-28322 Entity denotes binding
T12386 28037-28044 Positive_regulation denotes induced
T12385 27269-27276 Binding denotes binding
T12384 27188-27193 Binding denotes Bound
T12383 28496-28504 Protein denotes SerpinB2
T12382 28341-28348 Protein denotes albumin
T12381 27698-27705 Protein denotes albumin
T12380 27614-27622 Protein denotes SerpinB2
T12379 27565-27573 Protein denotes SerpinB2
T11416 26926-26935 Positive_regulation denotes inducible
T11415 26914-26921 Negative_regulation denotes reduced
T11414 25509-25516 Positive_regulation denotes induced
T11413 25309-25313 Entity denotes site
T11412 25008-25015 Binding denotes binding
T11411 27138-27146 Protein denotes SerpinB2
T11410 26972-26980 Protein denotes SerpinB2
T11409 26936-26946 Protein denotes luciferase
T11408 26755-26763 Protein denotes SerpinB2
T11407 26598-26606 Protein denotes SERPINB2
T11406 26506-26514 Protein denotes SerpinB2
T11405 25535-25543 Protein denotes SerpinB2
T11404 25411-25419 Protein denotes SerpinB2
T11403 25040-25082 Protein denotes SerpinB2 promoter-luciferase reporter gene
T11402 24603-24611 Protein denotes SerpinB2
T10362 22333-22343 Regulation denotes regulation
T10361 23559-23564 Protein denotes Oct-1
T10360 23538-23542 Protein denotes PU.1
T10359 23370-23378 Protein denotes SERPINB2
T10358 23005-23013 Protein denotes SERPINB2
T10357 22813-22821 Protein denotes SerpinB2
T10356 22758-22766 Protein denotes SerpinB2
T10355 22347-22355 Protein denotes SerpinB2
T10354 22159-22167 Protein denotes SerpinB2
T10353 22088-22096 Protein denotes SerpinB2
T10352 21971-21979 Protein denotes SerpinB2
T9444 19633-19642 Positive_regulation denotes increased
T9443 19572-19580 Negative_regulation denotes Deletion
T9442 20296-20304 Protein denotes SerpinB2
T9441 20156-20164 Protein denotes SerpinB2
T9440 20037-20045 Protein denotes SerpinB2
T9439 19955-19963 Protein denotes SerpinB2
T9438 19595-19603 Protein denotes SerpinB2
T9437 19428-19436 Protein denotes SerpinB2
T9436 19195-19203 Protein denotes SerpinB2
T9435 19104-19114 Protein denotes luciferase
T9434 18941-18951 Protein denotes luciferase
T9433 18784-18792 Protein denotes SerpinB2
T9432 18626-18634 Protein denotes SerpinB2
T8993 17997-18007 Gene_expression denotes expression
T8992 17852-17859 Positive_regulation denotes induced
T8991 17714-17729 Transcription denotes mRNA expression
T8990 17695-17704 Positive_regulation denotes inducible
T8989 17678-17687 Positive_regulation denotes induction
T8988 17591-17600 Positive_regulation denotes following
T8987 17980-17988 Protein denotes SerpinB2
T8986 17860-17868 Protein denotes SerpinB2
T8985 17705-17713 Protein denotes SerpinB2
T8984 17543-17551 Protein denotes SerpinB2
T8983 17454-17462 Protein denotes SerpinB2
T8260 17108-17116 Protein denotes SerpinB2
T8259 16889-16901 Protein denotes Proteinase K
T8258 16719-16728 Protein denotes Protein G
T7814 14970-14994 Protein denotes T4 polynucleotide kinase
T7177 14808-14818 Gene_expression denotes expression
T7176 14727-14737 Gene_expression denotes Expression
T7175 14745-14776 Protein denotes C/EBP-β phospho-acceptor mutant
T7174 14556-14571 Protein denotes β-Galactosidase
T7173 14528-14538 Protein denotes Luciferase
T7172 14497-14512 Protein denotes β-galactosidase
T7171 14436-14446 Protein denotes Luciferase
T7170 14358-14362 Protein denotes S64A
T7169 14351-14356 Protein denotes T217A
T7168 14344-14349 Protein denotes T188A
T7167 14310-14342 Protein denotes C/EBP-β phospho-acceptor mutants
T7166 14299-14306 Protein denotes C/EBP-β
T7165 13971-13986 Protein denotes β-galactosidase
T7164 13963-13970 Protein denotes β-actin
T7163 13913-13923 Protein denotes luciferase
T7162 13849-13854 Protein denotes Cebpb
T7161 11300-11310 Protein denotes Luciferase
T6620 13741-13750 Negative_regulation denotes knockdown
T6619 13061-13068 Gene_expression denotes produce
T6618 12898-12908 Gene_expression denotes expression
T6617 12888-12897 Negative_regulation denotes knockdown
T6616 13733-13740 Protein denotes C/EBP-β
T6615 12923-12930 Protein denotes C/EBP-β
T6614 12802-12807 Protein denotes cebpb
T6613 12740-12745 Protein denotes cebpb
T5939 12487-12495 Regulation denotes affected
T5938 12457-12471 Gene_expression denotes co-transfected
T5937 12296-12305 Gene_expression denotes expressed
T5936 12500-12502 Protein denotes TK
T5935 12472-12479 Protein denotes C/EBP-β
T5934 12390-12400 Protein denotes luciferase
T5933 12379-12381 Protein denotes TK
T5932 12331-12341 Protein denotes luciferase
T5931 12149-12159 Protein denotes Luciferase
T5930 12103-12113 Protein denotes Luciferase
T5929 11495-11497 Protein denotes TK
T5928 11477-11493 Protein denotes thymidine kinase
T5927 11422-11432 Protein denotes luciferase
T5926 11300-11310 Protein denotes Luciferase
T4698 10131-10138 Gene_expression denotes produce
T4697 9514-9521 Gene_expression denotes produce
T4696 9364-9371 Gene_expression denotes produce
T4695 11194-11202 Protein denotes SerpinB2
T4694 11061-11066 Protein denotes Xho I
T4693 11050-11056 Protein denotes EcoR I
T4692 10259-10267 Protein denotes SerpinB2
T4691 10200-10219 Protein denotes Luciferase reporter
T4690 10027-10035 Protein denotes SerpinB2
T4689 9944-9957 Protein denotes T4 DNA ligase
T4688 9883-9900 Protein denotes T4 DNA polymerase
T4687 9811-9816 Protein denotes Apo I
T4686 9799-9806 Protein denotes Hae III
T4685 9792-9797 Protein denotes Pac I
T4684 9783-9790 Protein denotes Bsu36 I
T4683 9775-9781 Protein denotes BstX I
T4682 9768-9773 Protein denotes Apa I
T4681 9761-9766 Protein denotes Sfi I
T4680 9721-9727 Protein denotes EcoR I
T4679 9552-9580 Protein denotes SerpinB2 luciferase reporter
T4678 9459-9467 Protein denotes SerpinB2
T4677 9241-9249 Protein denotes SerpinB2
T4676 9057-9079 Protein denotes SerpinB2 Reporter Gene
T4250 8982-8987 Protein denotes GAPDH
T4249 8940-8980 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4248 8893-8900 Protein denotes C/EBP-β
T4247 8771-8805 Protein denotes GST-murine SerpinB2 fusion protein
T3803 7369-7384 Protein denotes exonuclease III
T3802 7164-7172 Protein denotes SerpinB2
T3151 5807-5812 Protein denotes Cebpb
T3150 5783-5788 Protein denotes Cebpb
T3804 8004-8012 Protein denotes SerpinB2
T3571 7064-7071 Protein denotes β-actin
T3570 7038-7043 Protein denotes Cebpb
T3569 7012-7020 Protein denotes SerpinB2
T3568 7003-7011 Protein denotes Serpinb2
T1134 5326-5336 Regulation denotes regulation
T1133 5161-5168 Phosphorylation denotes phospho
T1132 5120-5129 Positive_regulation denotes induction
T1131 5064-5073 Negative_regulation denotes abrogated
T1130 5053-5063 Negative_regulation denotes deficiency
T1129 5018-5023 Binding denotes bound
T1128 4780-4789 Positive_regulation denotes induction
T1127 4713-4717 Binding denotes bind
T1126 4411-4420 Regulation denotes regulated
T1125 4265-4276 Positive_regulation denotes upregulated
T1124 3899-3910 Binding denotes recruitment
T1123 3833-3840 Binding denotes binding
T1122 3503-3515 Positive_regulation denotes up-regulated
T1121 3455-3462 Positive_regulation denotes induced
T1120 2948-2956 Localization denotes secreted
T1119 5344-5352 Protein denotes SerpinB2
T1118 5228-5236 Protein denotes SerpinB2
T1117 5153-5160 Protein denotes C/EBP-β
T1116 5111-5119 Protein denotes SerpinB2
T1115 5087-5095 Protein denotes SerpinB2
T1114 5001-5008 Protein denotes C/EBP-β
T1113 4914-4922 Protein denotes SerpinB2
T1112 4793-4801 Protein denotes SerpinB2
T1111 4722-4730 Protein denotes SerpinB2
T1110 4577-4585 Protein denotes SerpinB2
T1109 4511-4516 Protein denotes IFN-γ
T1108 4388-4396 Protein denotes SerpinB2
T1107 4299-4303 Protein denotes IKKβ
T1106 4208-4216 Protein denotes SerpinB2
T1105 3851-3855 Protein denotes TLR4
T1104 3653-3657 Protein denotes TLR4
T1103 3631-3651 Protein denotes toll-like receptor 4
T1102 3271-3279 Protein denotes SerpinB2
T1101 3096-3104 Protein denotes SerpinB2
T1100 2975-2983 Protein denotes SerpinB2
T1099 2933-2941 Protein denotes SerpinB2
T1098 2888-2899 Protein denotes plasminogen
T1097 2762-2765 Protein denotes uPA
T1096 2724-2760 Protein denotes urokinase-type plasminogen activator
T1095 2675-2683 Protein denotes SerpinB2
T1094 2608-2616 Protein denotes SerpinB2
T48 1803-1813 Gene_expression denotes expression
T47 1756-1766 Regulation denotes regulation
T46 1658-1667 Negative_regulation denotes deficient
T45 1598-1602 Negative_regulation denotes null
T44 1577-1586 Negative_regulation denotes abrogated
T43 1553-1563 Gene_expression denotes expression
T42 1536-1543 Positive_regulation denotes induced
T41 1415-1422 Positive_regulation denotes induces
T40 475-485 Gene_expression denotes expression
T39 459-465 Positive_regulation denotes induce
T38 1794-1802 Protein denotes SerpinB2
T37 1738-1745 Protein denotes C/EBP-β
T36 1650-1657 Protein denotes C/EBP-β
T35 1590-1597 Protein denotes C/EBP-β
T34 1544-1552 Protein denotes SerpinB2
T33 1478-1486 Protein denotes SerpinB2
T32 1440-1447 Protein denotes C/EBP-β
T31 1236-1244 Protein denotes SerpinB2
T30 1017-1025 Protein denotes SERPINB2
T29 723-731 Protein denotes SerpinB2
T28 608-616 Protein denotes SerpinB2
T27 516-520 Protein denotes TLR4
T26 494-514 Protein denotes toll-like receptor 4
T25 466-474 Protein denotes SerpinB2
T24 208-213 Protein denotes PAI-2
T23 168-206 Protein denotes plasminogen activator inhibitor type 2
T22 156-164 Protein denotes SerpinB2
R3 T27 T26 equivalentTo TLR4,toll-like receptor 4
R4 T34 T43 themeOf SerpinB2,expression
R6 T36 T46 themeOf C/EBP-β,deficient
R7 T38 T48 themeOf SerpinB2,expression
R8 T40 T39 themeOf expression,induce
R9 T42 T44 themeOf induced,abrogated
R10 T43 T42 themeOf expression,induced
R11 T43 T44 themeOf expression,abrogated
R12 T45 T44 causeOf null,abrogated
R13 T46 T44 causeOf deficient,abrogated
R743 T1097 T1096 equivalentTo uPA,urokinase-type plasminogen activator
R744 T1099 T1120 themeOf SerpinB2,secreted
R745 T1100 T1120 themeOf SerpinB2,secreted
R746 T1104 T1103 equivalentTo TLR4,toll-like receptor 4
R747 T1105 T1123 themeOf TLR4,binding
R748 T1108 T1127 themeOf SerpinB2,bind
R749 T1108 T1126 themeOf SerpinB2,regulated
R750 T1112 T1128 themeOf SerpinB2,induction
R751 T1114 T1129 themeOf C/EBP-β,bound
R752 T1116 T1132 themeOf SerpinB2,induction
R753 T1117 T1133 themeOf C/EBP-β,phospho
R754 T1121 T1122 themeOf induced,up-regulated
R755 T1132 T1131 themeOf induction,abrogated
R3134 T4250 T4249 equivalentTo GAPDH,glyceraldehyde-3-phosphate dehydrogenase
R4256 T5929 T5928 equivalentTo TK,thymidine kinase
R4257 T5932 T5938 themeOf luciferase,co-transfected
R4258 T5932 T5937 themeOf luciferase,expressed
R4259 T5934 T5938 themeOf luciferase,co-transfected
R4260 T5934 T5937 themeOf luciferase,expressed
R4261 T5935 T5938 themeOf C/EBP-β,co-transfected
R4262 T5938 T5939 themeOf co-transfected,affected
R4736 T6615 T6618 themeOf C/EBP-β,expression
R4737 T6616 T6620 themeOf C/EBP-β,knockdown
R5184 T7168 T7167 equivalentTo T188A,C/EBP-β phospho-acceptor mutants
R5185 T7175 T7177 themeOf C/EBP-β phospho-acceptor mutant,expression
R5186 T7175 T7176 themeOf C/EBP-β phospho-acceptor mutant,Expression
R6588 T8985 T8991 themeOf SerpinB2,mRNA expression
R6589 T8987 T8993 themeOf SerpinB2,expression
R6590 T8991 T8990 themeOf mRNA expression,inducible
R6591 T8991 T8989 themeOf mRNA expression,induction
R8428 T11403 T11412 themeOf SerpinB2 promoter-luciferase reporter gene,binding
R8429 T11409 T11416 themeOf luciferase,inducible
R8430 T11416 T11415 themeOf inducible,reduced
R9745 T13098 T13110 causeOf C/EBP-β,induced
R9746 T13098 T13111 themeOf C/EBP-β,Binds
R9747 T13111 T13110 themeOf Binds,induced
R9748 T13113 T13111 themeOf Promoter,Binds
R10247 T13858 T13877 causeOf C/EBP-β,Mediates
R10248 T13859 T13879 themeOf SerpinB2,mRNA Expression
R10249 T13861 T13880 themeOf SerpinB2,mRNA expression
R10250 T13862 T13881 themeOf C/EBP-β,null
R10251 T13865 T13882 themeOf C/EBP-β,express
R10252 T13866 T13883 themeOf SerpinB2,express
R10253 T13867 T13883 themeOf C/EBP-β,express
R10254 T13868 T13885 themeOf SerpinB2,mRNA expression
R10255 T13869 T13887 themeOf SerpinB2,mRNA expression
R10256 T13870 T13889 themeOf SerpinB2,mRNA expression
R10257 T13872 T13890 themeOf C/EBP-β,expression
R10258 T13873 T13893 themeOf SerpinB2,mRNA expression
R10259 T13874 T13895 themeOf C/EBP-β,deficient
R10260 T13875 T13896 causeOf C/EBP-β,critical
R10261 T13876 T13898 themeOf SerpinB2,transcription
R10262 T13878 T13877 themeOf induced,Mediates
R10263 T13879 T13878 themeOf mRNA Expression,induced
R10264 T13885 T13884 themeOf mRNA expression,attenuated
R10265 T13887 T13886 themeOf mRNA expression,increase
R10266 T13889 T13888 themeOf mRNA expression,stimulated
R10267 T13892 T13894 themeOf induced,decreased
R10268 T13893 T13894 themeOf mRNA expression,decreased
R10269 T13893 T13892 themeOf mRNA expression,induced
R10270 T13895 T13894 causeOf deficient,decreased
R10271 T13897 T13896 themeOf inducible,critical
R10272 T13898 T13897 themeOf transcription,inducible
R10891 T14800 T14799 themeOf Promoter,Binds
R10892 T14806 T14805 themeOf phosphorylation,changes
R10893 T14810 T14807 themeOf promoter,recruitment
R10894 T14815 T14812 themeOf promoter,bound
R10895 T14817 T14816 themeOf promoter,binding
R10896 T14821 T14820 themeOf transcription,increased
R11580 T15650 T15664 themeOf C/EBP-β,binds
R11581 T15654 T15667 themeOf C/EBP-β,transcription
R11582 T15656 T15669 themeOf SerpinB2 luciferase reporter,transfection
R11583 T15666 T15664 themeOf promoter,binds
R11584 T15668 T15667 themeOf promoter,transcription
R11950 T16307 T16347 themeOf C/EBP-β,recognized
R11951 T16307 T16346 themeOf C/EBP-β,Phosphorylation
R11952 T16308 T16348 themeOf C/EBP-β,phosphorylation
R11953 T16310 T16349 themeOf C/EBP-β phospho-acceptor mutants,co-expressed
R11954 T16311 T16349 themeOf SerpinB2 luciferase reporter,co-expressed
R11955 T16313 T16350 themeOf C/EBP-β,Re-expression
R11956 T16315 T16352 themeOf SerpinB2 luciferase reporter,expression
R11957 T16317 T16355 themeOf SerpinB2,transcription
R11958 T16318 T16356 themeOf C/EBP-β phospho-acceptor mutant,Expression
R11959 T16319 T16356 themeOf C/EBPβT217A,Expression
R11960 T16323 T16358 themeOf C/EBP-β,phosphorylation
R11961 T16325 T16359 themeOf C/EBP-β,phosphorylation
R11962 T16326 T16360 themeOf C/EBP-β,modulating
R11963 T16326 T16361 causeOf C/EBP-β,dependent
R11964 T16327 T16362 themeOf SerpinB2,transcription
R11965 T16328 T16363 themeOf DAPK1,regulating
R11966 T16330 T16363 themeOf gene,regulating
R11967 T16332 T16366 themeOf IL-6,transcription
R11968 T16333 T16366 themeOf MCP-1,transcription
R11969 T16334 T16367 themeOf SerpinB2,induced
R11970 T16334 T16368 themeOf SerpinB2,regulated
R11971 T16337 T16372 themeOf SerpinB2,expression
R11972 T16340 T16373 themeOf C/EBP-β,transfected
R11973 T16341 T16374 themeOf C/EBP-βS64A,expression
R11974 T16343 T16376 themeOf C/EBP-β,phosphorylation
R11975 T16350 T16351 causeOf Re-expression,stimulated
R11976 T16352 T16351 themeOf expression,stimulated
R11977 T16355 T16354 themeOf transcription,induced
R11978 T16362 T16361 themeOf transcription,dependent
R11979 T16365 T16364 themeOf induced,important
R11980 T16366 T16365 themeOf transcription,induced
R11981 T16372 T16371 themeOf expression,role
R13109 T18171 T18238 themeOf C/EBP-β,induced
R13110 T18171 T18239 themeOf C/EBP-β,bind
R13111 T18173 T18240 themeOf C/EBP-β,loss
R13112 T18177 T18243 themeOf SERPINB2,transcription
R13113 T18179 T18245 themeOf SerpinB2,transcription
R13114 T18181 T18247 themeOf C/EBP-β,binding
R13115 T18181 T18248 themeOf C/EBP-β,interact
R13116 T18181 T18246 themeOf C/EBP-β,interactions
R13117 T18182 T18248 themeOf C/EBP-β,interact
R13118 T18182 T18246 themeOf C/EBP-β,interactions
R13119 T18184 T18249 causeOf C/EBP-β,requirement
R13120 T18188 T18251 themeOf C/EBP-β,deficient
R13121 T18189 T18187 themeOf IFNγ,gene
R13122 T18190 T18254 themeOf SerpinB2,mRNA expression
R13123 T18193 T18256 themeOf C/EBP-β,bind
R13124 T18194 T18256 themeOf SerpinB2,bind
R13125 T18195 T18257 causeOf C/EBP-β,role
R13126 T18196 T18259 themeOf SerpinB2,expression
R13127 T18197 T18260 themeOf C/EBP-β,upregulated
R13128 T18198 T18260 themeOf SerpinB2,upregulated
R13129 T18199 T18261 themeOf C/EBP-β,null
R13130 T18201 T18263 themeOf SerpinB2,expression
R13131 T18202 T18262 causeOf C/EBP-β,regulation
R13132 T18203 T18264 themeOf C/EBP-β,Phosphorylation
R13133 T18204 T18265 themeOf C/EBP-β,phosphorylated
R13134 T18206 T18266 themeOf C/EBP-β phospho-acceptor site mutant,expression
R13135 T18207 T18266 themeOf C/EBPβT217A,expression
R13136 T18213 T18271 themeOf C/EBP-β phospho-acceptor site mutant,expression
R13137 T18214 T18271 themeOf C/EBP-βT188A,expression
R13138 T18216 T18273 themeOf C/EBP-βS64A,expression
R13139 T18218 T18274 themeOf C/EBP-β,phosphorylation
R13140 T18220 T18275 themeOf C/EBP-β,phosphorylated
R13141 T18223 T18222 equivalentTo MLK3,Mixed lineage kinase-3
R13142 T18231 T18278 themeOf SerpinB2,transcription
R13143 T18237 T18169 partOf promoter,SerpinB2
R13144 T18242 T18241 themeOf stimulated,mediate
R13145 T18243 T18242 themeOf transcription,stimulated
R13146 T18243 T18241 themeOf transcription,mediate
R13147 T18245 T18244 themeOf transcription,inducible
R13148 T18253 T18255 themeOf inducible,abrogated
R13149 T18254 T18255 themeOf mRNA expression,abrogated
R13150 T18254 T18253 themeOf mRNA expression,inducible
R13151 T18259 T18258 themeOf expression,induced
R13152 T18263 T18262 themeOf expression,regulation
R13153 T18267 T18269 themeOf recruitment,decrease
R13154 T18268 T18267 themeOf promoter,recruitment
R13155 T18268 T18211 partOf promoter,SerpinB2
R13156 T18278 T18277 themeOf transcription,induced
R13157 T18280 T18279 themeOf induced,necessary
R16160 T22375 T22380 themeOf SerpinB2,induction
R16161 T22378 T22382 themeOf SerpinB2,expression
R16162 T22381 T22380 themeOf expression,induction
R17382 T24153 T24160 themeOf C/EBP-β,binding
R17383 T24160 T24159 themeOf binding,inducible
R17591 T24515 T24528 causeOf C/EBP-β,essential
R17592 T24516 T24530 themeOf SerpinB2,mRNA expression
R17593 T24517 T24531 themeOf SerpinB2,mRNA expression
R17594 T24524 T24533 themeOf C/EBP-β,deficient
R17595 T24527 T24534 themeOf SerpinB2,mRNA expression
R17596 T24529 T24528 themeOf induced,essential
R17597 T24530 T24529 themeOf mRNA expression,induced
R18118 T25276 T25288 themeOf C/EBP-β,recruitment
R18119 T25284 T25293 themeOf SerpinB2,transcription
R18120 T25289 T25288 themeOf promoter,recruitment
R18121 T25289 T25277 partOf promoter,SerpinB2
R18122 T25290 T25278 partOf promoter,SerpinB2
R18123 T25292 T25291 themeOf promoter,Recruitment
R18124 T25292 T25284 partOf promoter,SerpinB2
R18557 T26004 T26022 themeOf SerpinB2 promoter-luciferase reporter,expressing
R18558 T26005 T26023 themeOf SerpinB2 promoter-luciferase reporter,co-transfected
R18559 T26006 T26023 themeOf β-galactosidase reporter,co-transfected
R18560 T26007 T26023 themeOf luciferase,co-transfected
R18561 T26008 T26023 themeOf β-galactosidase,co-transfected
R18562 T26010 T26024 themeOf C/EBP-β,Phosphorylation
R18563 T26019 T26025 themeOf C/EBP-β phospho-acceptor mutants,expression
R18564 T26021 T26026 themeOf C/EBP-β,express
R1 T24 T23 equivalentTo PAI-2,plasminogen activator inhibitor type 2
R2 T25 T40 themeOf SerpinB2,expression
R5 T35 T45 themeOf C/EBP-β,null
R14 T48 T47 themeOf expression,regulation

test3

Id Subject Object Predicate Lexical cue
T49 25-32 Protein denotes C/EBP-β
T50 97-105 Protein denotes SerpinB2
T68 25-32 Protein denotes C/EBP-β
T69 97-105 Protein denotes SerpinB2
T26085 38207-38214 Protein denotes C/EBP-β
T26084 38160-38167 Gene_expression denotes express
T26083 38129-38141 Protein denotes C/EBP-βT217A
T26082 38091-38123 Protein denotes C/EBP-β phospho-acceptor mutants
T26081 37987-38002 Protein denotes β-galactosidase
T26080 37934-37944 Protein denotes Luciferase
T26079 37864-37888 Protein denotes β-galactosidase reporter
T26078 37822-37859 Protein denotes SerpinB2 promoter-luciferase reporter
T26077 37763-37795 Protein denotes C/EBP-β phospho-acceptor mutants
T26076 37738-37745 Protein denotes C/EBP-β
T26075 37699-37709 Gene_expression denotes expression
T26074 37660-37665 Protein denotes Cebpb
T26073 37632-37640 Protein denotes SerpinB2
T26072 37621-37631 Positive_regulation denotes stimulated
T26071 37607-37616 Regulation denotes regulates
T26070 37575-37582 Protein denotes C/EBP-β
T26069 37556-37571 Phosphorylation denotes Phosphorylation
T26068 37476-37483 Protein denotes C/EBP-β
T26067 37446-37461 Protein denotes β-galactosidase
T26066 37415-37425 Protein denotes luciferase
T26065 37376-37400 Protein denotes β-galactosidase reporter
T26064 37334-37371 Protein denotes SerpinB2 promoter-luciferase reporter
T26063 37204-37241 Protein denotes SerpinB2 promoter-luciferase reporter
T26062 37179-37189 Gene_expression denotes expressing
T26061 37165-37170 Protein denotes Cebpb
T26060 37152-37157 Protein denotes Cebpb
T26059 37108-37116 Protein denotes SerpinB2
T26058 37086-37091 Protein denotes Cebpb
T26057 37061-37066 Protein denotes Cebpb
T26056 36989-36997 Protein denotes SerpinB2
T26055 36944-36952 Protein denotes SerpinB2
T26054 36930-36939 Positive_regulation denotes necessary
T26053 36919-36926 Protein denotes C/EBP-β
T26052 38207-38214 Protein denotes C/EBP-β
T26051 38129-38141 Protein denotes C/EBP-βT217A
T26050 38091-38123 Protein denotes C/EBP-β phospho-acceptor mutants
T26049 37987-38002 Protein denotes β-galactosidase
T26048 37934-37944 Protein denotes Luciferase
T26047 37864-37888 Protein denotes β-galactosidase reporter
T26046 37822-37859 Protein denotes SerpinB2 promoter-luciferase reporter
T26045 37763-37795 Protein denotes C/EBP-β phospho-acceptor mutants
T26044 37738-37745 Protein denotes C/EBP-β
T26043 37660-37665 Protein denotes Cebpb
T26042 37632-37640 Protein denotes SerpinB2
T26041 37575-37582 Protein denotes C/EBP-β
T26040 37476-37483 Protein denotes C/EBP-β
T26039 37446-37461 Protein denotes β-galactosidase
T26038 37415-37425 Protein denotes luciferase
T26037 37376-37400 Protein denotes β-galactosidase reporter
T26036 37334-37371 Protein denotes SerpinB2 promoter-luciferase reporter
T26035 37204-37241 Protein denotes SerpinB2 promoter-luciferase reporter
T26034 37165-37170 Protein denotes Cebpb
T26033 37152-37157 Protein denotes Cebpb
T26032 37108-37116 Protein denotes SerpinB2
T26031 37086-37091 Protein denotes Cebpb
T26030 37061-37066 Protein denotes Cebpb
T26029 36989-36997 Protein denotes SerpinB2
T26028 36944-36952 Protein denotes SerpinB2
T26027 36919-36926 Protein denotes C/EBP-β
T25321 36034-36038 Protein denotes rIgG
T25320 35957-35974 Protein denotes p-C/EBP-β (T217),
T25319 35948-35955 Protein denotes C/EBP-β
T25318 35719-35732 Transcription denotes transcription
T25317 35694-35702 Entity denotes promoter
T25316 35685-35693 Protein denotes SerpinB2
T25315 35656-35667 Binding denotes Recruitment
T25314 35568-35576 Protein denotes SerpinB2
T25313 35429-35446 Protein denotes p-C/EBP-β (T217),
T25312 35420-35427 Protein denotes C/EBP-β
T25311 35313-35320 Protein denotes C/EBP-β
T25310 35055-35063 Protein denotes SerpinB2
T25309 35038-35047 Binding denotes occupancy
T25308 34990-34998 Protein denotes SerpinB2
T25307 34952-34959 Protein denotes C/EBP-β
T25306 34937-34948 Binding denotes recruitment
T25305 36034-36038 Protein denotes rIgG
T25304 35957-35973 Protein denotes p-C/EBP-β (T217)
T25303 35948-35955 Protein denotes C/EBP-β
T25302 35685-35693 Protein denotes SerpinB2
T25301 35568-35576 Protein denotes SerpinB2
T25300 35429-35445 Protein denotes p-C/EBP-β (T217)
T25299 35420-35427 Protein denotes C/EBP-β
T25298 35324-35340 Protein denotes p-C/EBP-β (T217)
T25297 35313-35320 Protein denotes C/EBP-β
T25296 35055-35063 Protein denotes SerpinB2
T25295 34990-34998 Protein denotes SerpinB2
T25294 34952-34959 Protein denotes C/EBP-β
T24568 33020-33035 Transcription denotes mRNA expression
T24567 33011-33019 Protein denotes SerpinB2
T24566 32901-32908 Protein denotes C/EBP-β
T24565 32730-32735 Protein denotes Cebpb
T24564 32483-32492 Negative_regulation denotes deficient
T24563 32475-32482 Protein denotes C/EBP-β
T24562 32462-32471 Negative_regulation denotes abrogated
T24561 32448-32458 Gene_expression denotes expression
T24560 32439-32447 Protein denotes SerpinB2
T24559 32342-32347 Protein denotes Cebpb
T24558 32329-32334 Protein denotes Cebpb
T24557 32300-32315 Transcription denotes mRNA expression
T24556 32291-32299 Protein denotes SerpinB2
T24555 32217-32222 Protein denotes Cebpb
T24554 32191-32196 Protein denotes Cebpb
T24553 32159-32174 Transcription denotes mRNA expression
T24552 32150-32158 Protein denotes SerpinB2
T24551 32118-32133 Transcription denotes mRNA expression
T24550 32109-32117 Protein denotes SerpinB2
T24549 32101-32108 Positive_regulation denotes induced
T24548 32055-32062 Protein denotes C/EBP-β
T24547 33011-33019 Protein denotes SerpinB2
T24546 32901-32908 Protein denotes C/EBP-β
T24545 32730-32735 Protein denotes Cebpb
T24544 32475-32482 Protein denotes C/EBP-β
T24543 32439-32447 Protein denotes SerpinB2
T24542 32342-32347 Protein denotes Cebpb
T24541 32329-32334 Protein denotes Cebpb
T24540 32291-32299 Protein denotes SerpinB2
T24539 32217-32222 Protein denotes Cebpb
T24538 32191-32196 Protein denotes Cebpb
T24537 32150-32158 Protein denotes SerpinB2
T24536 32109-32117 Protein denotes SerpinB2
T24535 32055-32062 Protein denotes C/EBP-β
T24175 29173-29181 Protein denotes SerpinB2
T24174 29084-29091 Protein denotes albumin
T24173 29045-29052 Protein denotes albumin
T24172 28976-28984 Protein denotes SerpinB2
T24171 28920-28928 Protein denotes SerpinB2
T24170 28783-28790 Protein denotes C/EBP-β
T24169 28736-28744 Protein denotes SerpinB2
T24168 28717-28724 Binding denotes binding
T24167 29173-29181 Protein denotes SerpinB2
T24166 29084-29091 Protein denotes albumin
T24165 29045-29052 Protein denotes albumin
T24164 28976-28984 Protein denotes SerpinB2
T24163 28920-28928 Protein denotes SerpinB2
T24162 28783-28790 Protein denotes C/EBP-β
T24161 28736-28744 Protein denotes SerpinB2
T23780 26327-26336 Positive_regulation denotes following
T23779 26307-26317 Protein denotes luciferase
T23778 26164-26201 Protein denotes SerpinB2 promoter-luciferase reporter
T23777 25983-25991 Protein denotes SerpinB2
T23776 25772-25780 Protein denotes SerpinB2
T23775 25687-25695 Protein denotes SerpinB2
T23774 26307-26317 Protein denotes luciferase
T23773 26164-26201 Protein denotes SerpinB2 promoter-luciferase reporter
T23772 25983-25991 Protein denotes SerpinB2
T23771 25772-25780 Protein denotes SerpinB2
T23770 25687-25695 Protein denotes SerpinB2
T22689 21442-21450 Protein denotes SerpinB2
T22688 21363-21371 Protein denotes SerpinB2
T22687 21177-21187 Protein denotes luciferase
T22686 20993-21030 Protein denotes SerpinB2 promoter-luciferase reporter
T22685 20881-20889 Protein denotes SerpinB2
T22684 20689-20699 Protein denotes luciferase
T22683 20546-20599 Protein denotes SerpinB2 promoter and 5′ deletion luciferase reporter
T22682 20484-20492 Protein denotes SerpinB2
T22681 21442-21450 Protein denotes SerpinB2
T22680 21363-21371 Protein denotes SerpinB2
T22679 21177-21187 Protein denotes luciferase
T22678 20993-21030 Protein denotes SerpinB2 promoter-luciferase reporter
T22677 20881-20889 Protein denotes SerpinB2
T22676 20689-20699 Protein denotes luciferase
T22675 20546-20599 Protein denotes SerpinB2 promoter and 5′ deletion luciferase reporter
T22674 20484-20492 Protein denotes SerpinB2
T23395 24336-24364 Protein denotes purine box binding protein 1
T23394 24328-24335 Protein denotes PU.1 = 
T23393 24320-24326 Protein denotes POU2F1
T23392 24289-24319 Protein denotes octamer transcription factor 1
T23391 24281-24288 Protein denotes Oct1 = 
T23390 24140-24148 Protein denotes SerpinB2
T23389 23978-23986 Protein denotes SerpinB2
T23388 24336-24364 Protein denotes purine box binding protein 1
T23387 24328-24332 Protein denotes PU.1
T23386 24320-24326 Protein denotes POU2F1
T23385 24289-24319 Protein denotes octamer transcription factor 1
T23384 24281-24285 Protein denotes Oct1
T23383 24140-24148 Protein denotes SerpinB2
T23382 23978-23986 Protein denotes SerpinB2
T22395 18593-18598 Protein denotes GAPDH
T22394 18537-18547 Gene_expression denotes expression
T22393 18520-18528 Protein denotes SerpinB2
T22392 18392-18399 Protein denotes β-actin
T22391 18358-18366 Protein denotes SerpinB2
T22390 18213-18223 Gene_expression denotes expression
T22389 18187-18195 Protein denotes SerpinB2
T22388 18174-18183 Positive_regulation denotes induction
T22387 18593-18598 Protein denotes GAPDH
T22386 18520-18528 Protein denotes SerpinB2
T22385 18392-18399 Protein denotes β-actin
T22384 18358-18366 Protein denotes SerpinB2
T22383 18187-18195 Protein denotes SerpinB2
T18479 47226-47234 Protein denotes SerpinB2
T18478 47105-47113 Protein denotes SerpinB2
T18477 47094-47104 Regulation denotes regulating
T18476 46990-47000 Gene_expression denotes expression
T18475 46976-46984 Protein denotes SerpinB2
T18474 46968-46975 Positive_regulation denotes induced
T18473 46891-46899 Protein denotes SerpinB2
T18472 46682-46690 Protein denotes SerpinB2
T18471 46661-46674 Transcription denotes transcription
T18470 46653-46660 Positive_regulation denotes induced
T18469 46582-46589 Protein denotes C/EBP-β
T18468 46421-46428 Protein denotes C/EBP-β
T18467 46287-46295 Protein denotes SerpinB2
T18466 46119-46129 Gene_expression denotes expression
T18465 46110-46118 Protein denotes SerpinB2
T18464 45799-45803 Protein denotes MLK3
T18463 45737-45741 Protein denotes IFNγ
T18462 45707-45714 Protein denotes C/EBP-β
T18461 45673-45677 Protein denotes MLK3
T18460 45649-45671 Protein denotes Mixed lineage kinase-3
T18459 45580-45588 Positive_regulation denotes increase
T18458 45568-45576 Protein denotes SerpinB2
T18457 45551-45564 Transcription denotes transcription
T18456 45543-45550 Positive_regulation denotes induced
T18455 45477-45494 Phosphorylation denotes dephosphorylation
T18454 45406-45420 Phosphorylation denotes phosphorylated
T18453 45376-45383 Protein denotes C/EBP-β
T18452 45342-45350 Protein denotes SerpinB2
T18451 45334-45341 Positive_regulation denotes induced
T18450 45320-45329 Regulation denotes regulates
T18449 45294-45301 Protein denotes C/EBP-β
T18448 45275-45290 Phosphorylation denotes phosphorylation
T18447 45231-45239 Protein denotes SerpinB2
T18446 45223-45230 Positive_regulation denotes induced
T18445 45210-45218 Positive_regulation denotes enhanced
T18444 45184-45195 Protein denotes C/EBP-βS64A
T18443 45170-45180 Gene_expression denotes expression
T18442 45103-45111 Entity denotes promoter
T18441 45094-45102 Protein denotes SerpinB2
T18440 45087-45093 Regulation denotes affect
T18439 45065-45077 Protein denotes C/EBP-βT188A
T18438 45027-45063 Protein denotes C/EBP-β phospho-acceptor site mutant
T18437 45009-45019 Gene_expression denotes expression
T18436 44986-44996 Gene_expression denotes expression
T18435 44972-44980 Protein denotes SerpinB2
T18434 44958-44968 Regulation denotes regulation
T18433 44823-44831 Negative_regulation denotes decrease
T18432 44798-44806 Entity denotes promoter
T18431 44789-44797 Protein denotes SerpinB2
T18430 44755-44766 Binding denotes recruitment
T18429 44734-44741 Protein denotes C/EBP-β
T18428 44675-44683 Protein denotes SerpinB2
T18427 44666-44674 Positive_regulation denotes increase
T18426 44644-44649 Protein denotes Cebpb
T18425 44628-44639 Protein denotes C/EBPβT217A
T18424 44590-44626 Protein denotes C/EBP-β phospho-acceptor site mutant
T18423 44574-44584 Gene_expression denotes expression
T18422 44550-44558 Protein denotes SerpinB2
T18421 44373-44387 Phosphorylation denotes phosphorylated
T18420 44365-44372 Protein denotes C/EBP-β
T18419 44245-44252 Protein denotes C/EBP-β
T18418 44226-44241 Phosphorylation denotes Phosphorylation
T18417 44162-44169 Protein denotes C/EBP-β
T18416 44148-44158 Gene_expression denotes expression
T18415 44134-44142 Protein denotes SerpinB2
T18414 44120-44130 Regulation denotes regulation
T18413 44008-44016 Protein denotes SerpinB2
T18412 43944-43948 Negative_regulation denotes null
T18411 43936-43943 Protein denotes C/EBP-β
T18410 43789-43797 Protein denotes SerpinB2
T18409 43775-43782 Protein denotes C/EBP-β
T18408 43763-43773 Gene_expression denotes expression
T18407 43749-43757 Protein denotes SerpinB2
T18406 43741-43748 Positive_regulation denotes induced
T18405 43726-43733 Protein denotes C/EBP-β
T18404 43659-43667 Protein denotes SerpinB2
T18403 43650-43654 Binding denotes bind
T18402 43599-43606 Protein denotes C/EBP-β
T18401 43498-43511 Transcription denotes transcription
T18400 43484-43492 Protein denotes SerpinB2
T18399 43472-43479 Protein denotes C/EBP-β
T18398 43381-43390 Negative_regulation denotes abrogated
T18397 43348-43363 Transcription denotes mRNA expression
T18396 43339-43347 Protein denotes SerpinB2
T18395 43329-43338 Positive_regulation denotes inducible
T18394 43197-43205 Negative_regulation denotes impaired
T18393 43179-43183 Protein denotes IFNγ
T18392 43135-43144 Negative_regulation denotes deficient
T18391 43127-43134 Protein denotes C/EBP-β
T18390 43103-43107 Protein denotes gene
T18389 43076-43084 Protein denotes SerpinB2
T18388 43008-43021 Transcription denotes transcription
T18387 42994-43002 Protein denotes SerpinB2
T18386 42986-42993 Positive_regulation denotes induced
T18385 42912-42919 Protein denotes C/EBP-β
T18384 42878-42885 Protein denotes C/EBP-β
T18383 42857-42870 Transcription denotes transcription
T18382 42717-42725 Binding denotes interact
T18381 42677-42684 Protein denotes C/EBP-β
T18380 42634-42641 Binding denotes binding
T18379 42618-42625 Protein denotes C/EBP-β
T18378 42181-42189 Protein denotes SerpinB2
T18377 42039-42047 Protein denotes SerpinB2
T18376 41880-41888 Protein denotes SerpinB2
T18375 41829-41837 Protein denotes SERPINB2
T18374 41802-41815 Transcription denotes transcription
T18373 41791-41801 Positive_regulation denotes stimulated
T18372 41682-41690 Protein denotes SerpinB2
T18371 41455-41463 Protein denotes SerpinB2
T18370 41405-41418 Transcription denotes transcription
T18369 41391-41399 Protein denotes SerpinB2
T18368 41368-41377 Positive_regulation denotes abrogates
T18367 41360-41367 Protein denotes C/EBP-β
T18366 41352-41356 Negative_regulation denotes loss
T18365 41299-41307 Protein denotes SerpinB2
T18364 41260-41264 Binding denotes bind
T18363 41226-41233 Protein denotes C/EBP-β
T18362 41218-41225 Positive_regulation denotes induced
T18361 41205-41212 Protein denotes C/EBP-β
T18360 41190-41199 Regulation denotes dependent
T18359 41148-41156 Protein denotes SerpinB2
T18358 41095-41108 Transcription denotes transcription
T18357 41081-41089 Protein denotes SerpinB2
T18356 40995-40999 Protein denotes IKKβ
T18355 40961-40968 Positive_regulation denotes induced
T18340 45673-45677 Protein denotes MLK3
T18339 45649-45671 Protein denotes Mixed lineage kinase-3
T18338 45568-45576 Protein denotes SerpinB2
T18337 45376-45383 Protein denotes C/EBP-β
T18336 45342-45350 Protein denotes SerpinB2
T18335 45294-45301 Protein denotes C/EBP-β
T18334 45231-45239 Protein denotes SerpinB2
T18333 45184-45195 Protein denotes C/EBP-βS64A
T18332 45094-45102 Protein denotes SerpinB2
T18331 45065-45077 Protein denotes C/EBP-βT188A
T18330 45027-45063 Protein denotes C/EBP-β phospho-acceptor site mutant
T18329 44972-44980 Protein denotes SerpinB2
T18328 44789-44797 Protein denotes SerpinB2
T18327 44734-44741 Protein denotes C/EBP-β
T18326 44675-44683 Protein denotes SerpinB2
T18325 44644-44649 Protein denotes Cebpb
T18324 44628-44639 Protein denotes C/EBPβT217A
T18323 44590-44626 Protein denotes C/EBP-β phospho-acceptor site mutant
T18322 44550-44558 Protein denotes SerpinB2
T18321 44365-44372 Protein denotes C/EBP-β
T18320 44245-44252 Protein denotes C/EBP-β
T18319 44162-44169 Protein denotes C/EBP-β
T18318 44134-44142 Protein denotes SerpinB2
T18317 44008-44016 Protein denotes SerpinB2
T18316 43936-43943 Protein denotes C/EBP-β
T18315 43789-43797 Protein denotes SerpinB2
T18314 43775-43782 Protein denotes C/EBP-β
T18313 43749-43757 Protein denotes SerpinB2
T18312 43726-43733 Protein denotes C/EBP-β
T18311 43659-43667 Protein denotes SerpinB2
T18310 43599-43606 Protein denotes C/EBP-β
T18309 43484-43492 Protein denotes SerpinB2
T18308 43472-43479 Protein denotes C/EBP-β
T18307 43339-43347 Protein denotes SerpinB2
T18306 43179-43183 Protein denotes IFNγ
T18305 43127-43134 Protein denotes C/EBP-β
T18304 43103-43107 Protein denotes gene
T18303 43076-43084 Protein denotes SerpinB2
T18302 42994-43002 Protein denotes SerpinB2
T18301 42912-42919 Protein denotes C/EBP-β
T18300 42878-42885 Protein denotes C/EBP-β
T18299 42677-42684 Protein denotes C/EBP-β
T18298 42618-42625 Protein denotes C/EBP-β
T18297 42181-42189 Protein denotes SerpinB2
T18296 42039-42047 Protein denotes SerpinB2
T18295 41880-41888 Protein denotes SerpinB2
T18294 41829-41837 Protein denotes SERPINB2
T18293 41682-41690 Protein denotes SerpinB2
T18292 41455-41463 Protein denotes SerpinB2
T18291 41391-41399 Protein denotes SerpinB2
T18290 41360-41367 Protein denotes C/EBP-β
T18289 41299-41307 Protein denotes SerpinB2
T18288 41226-41233 Protein denotes C/EBP-β
T18287 41205-41212 Protein denotes C/EBP-β
T18286 41148-41156 Protein denotes SerpinB2
T18285 41081-41089 Protein denotes SerpinB2
T18284 40995-40999 Protein denotes IKKβ
T18283 40931-40939 Protein denotes SerpinB2
T18282 40921-40929 Protein denotes SerpinB2
T13907 31217-31225 Protein denotes SerpinB2
T18354 40931-40939 Protein denotes SerpinB2
T18353 40921-40929 Protein denotes SerpinB2
T18352 47226-47234 Protein denotes SerpinB2
T18351 47105-47113 Protein denotes SerpinB2
T18350 46976-46984 Protein denotes SerpinB2
T18349 46891-46899 Protein denotes SerpinB2
T18348 46682-46690 Protein denotes SerpinB2
T18347 46582-46589 Protein denotes C/EBP-β
T18346 46421-46428 Protein denotes C/EBP-β
T18345 46287-46295 Protein denotes SerpinB2
T18344 46110-46118 Protein denotes SerpinB2
T18343 45799-45803 Protein denotes MLK3
T18342 45737-45741 Protein denotes IFNγ
T18341 45707-45714 Protein denotes C/EBP-β
T16491 40577-40585 Entity denotes promoter
T16490 40559-40567 Protein denotes SerpinB2
T16489 40550-40558 Regulation denotes regulate
T16488 40516-40523 Protein denotes C/EBP-β
T16487 40497-40512 Phosphorylation denotes phosphorylation
T16486 40439-40447 Positive_regulation denotes response
T16485 40409-40417 Protein denotes SerpinB2
T16484 40397-40408 Negative_regulation denotes potentiated
T16483 40385-40396 Protein denotes C/EBP-βS64A
T16482 40371-40381 Gene_expression denotes expression
T16481 40333-40340 Protein denotes C/EBP-β
T16480 40277-40285 Protein denotes SerpinB2
T16479 40237-40249 Protein denotes C/EBP-βT188A
T16478 40225-40235 Gene_expression denotes expression
T16477 40211-40219 Protein denotes SerpinB2
T16476 40203-40207 Regulation denotes role
T16475 40129-40137 Protein denotes SerpinB2
T16474 40117-40124 Protein denotes C/EBP-β
T16473 39976-39985 Regulation denotes regulated
T16472 39957-39964 Positive_regulation denotes induced
T16471 39945-39953 Protein denotes SerpinB2
T16470 39922-39927 Protein denotes MCP-1
T16469 39913-39917 Protein denotes IL-6
T16468 39882-39895 Transcription denotes transcription
T16467 39874-39881 Positive_regulation denotes induced
T16466 39856-39865 Regulation denotes important
T16465 39802-39810 Protein denotes SerpinB2
T16464 39715-39719 Protein denotes gene
T16463 39700-39704 Protein denotes IFNγ
T16462 39690-39695 Protein denotes DAPK1
T16461 39635-39648 Transcription denotes transcription
T16460 39621-39629 Protein denotes SerpinB2
T16459 39611-39620 Regulation denotes dependent
T16458 39603-39610 Protein denotes C/EBP-β
T16457 39592-39602 Regulation denotes modulating
T16456 39506-39521 Phosphorylation denotes phosphorylation
T16455 39478-39485 Protein denotes C/EBP-β
T16454 39431-39439 Protein denotes SerpinB2
T16453 39417-39427 Regulation denotes regulation
T16452 39372-39379 Protein denotes C/EBP-β
T16451 39353-39368 Phosphorylation denotes phosphorylation
T16450 39311-39318 Protein denotes C/EBP-β
T16449 39260-39268 Protein denotes SerpinB2
T16448 39251-39259 Positive_regulation denotes increase
T16447 39215-39220 Protein denotes Cebpb
T16446 39199-39210 Protein denotes C/EBPβT217A
T16445 39166-39197 Protein denotes C/EBP-β phospho-acceptor mutant
T16444 39148-39158 Gene_expression denotes Expression
T16443 39133-39146 Transcription denotes transcription
T16442 39119-39127 Protein denotes SerpinB2
T16441 39111-39118 Positive_regulation denotes induced
T16440 39096-39103 Protein denotes C/EBP-β
T16439 39005-39015 Gene_expression denotes expression
T16438 38971-38999 Protein denotes SerpinB2 luciferase reporter
T16437 38960-38970 Positive_regulation denotes stimulated
T16436 38932-38937 Protein denotes Cebpb
T16435 38921-38928 Protein denotes C/EBP-β
T16434 38897-38907 Gene_expression denotes expression
T16433 38896-38897 Gene_expression denotes -
T16432 38894-38896 Positive_regulation denotes Re
T16431 38879-38884 Protein denotes Cebpb
T16430 38847-38875 Protein denotes SerpinB2 luciferase reporter
T16429 38705-38737 Protein denotes C/EBP-β phospho-acceptor mutants
T16428 38687-38696 Gene_expression denotes expressed
T16427 38634-38642 Protein denotes SerpinB2
T16426 38571-38586 Phosphorylation denotes phosphorylation
T16425 38563-38570 Protein denotes C/EBP-β
T16424 38489-38499 Binding denotes recognized
T16423 38473-38480 Protein denotes C/EBP-β
T16422 38454-38469 Phosphorylation denotes Phosphorylation
T16421 38427-38435 Protein denotes SerpinB2
T16420 38416-38426 Positive_regulation denotes stimulated
T16419 38402-38411 Regulation denotes Regulates
T16418 38370-38377 Protein denotes C/EBP-β
T16417 38351-38366 Phosphorylation denotes Phosphorylation
T16416 40559-40567 Protein denotes SerpinB2
T16415 40516-40523 Protein denotes C/EBP-β
T16414 40409-40417 Protein denotes SerpinB2
T16413 40385-40396 Protein denotes C/EBP-βS64A
T16412 40333-40340 Protein denotes C/EBP-β
T16411 40277-40285 Protein denotes SerpinB2
T16410 40237-40249 Protein denotes C/EBP-βT188A
T16409 40211-40219 Protein denotes SerpinB2
T16408 40129-40137 Protein denotes SerpinB2
T16407 40117-40124 Protein denotes C/EBP-β
T16406 39945-39953 Protein denotes SerpinB2
T16405 39922-39927 Protein denotes MCP-1
T16404 39913-39917 Protein denotes IL-6
T16403 39802-39810 Protein denotes SerpinB2
T16402 39715-39719 Protein denotes gene
T16401 39700-39704 Protein denotes IFNγ
T16400 39690-39695 Protein denotes DAPK1
T16399 39621-39629 Protein denotes SerpinB2
T16398 39603-39610 Protein denotes C/EBP-β
T16397 39478-39485 Protein denotes C/EBP-β
T16396 39431-39439 Protein denotes SerpinB2
T16395 39372-39379 Protein denotes C/EBP-β
T16394 39311-39318 Protein denotes C/EBP-β
T16393 39260-39268 Protein denotes SerpinB2
T16392 39215-39220 Protein denotes Cebpb
T16391 39199-39210 Protein denotes C/EBPβT217A
T16390 39166-39197 Protein denotes C/EBP-β phospho-acceptor mutant
T16389 39119-39127 Protein denotes SerpinB2
T16388 39096-39103 Protein denotes C/EBP-β
T16387 38971-38999 Protein denotes SerpinB2 luciferase reporter
T16386 38932-38937 Protein denotes Cebpb
T16385 38921-38928 Protein denotes C/EBP-β
T16384 38879-38884 Protein denotes Cebpb
T16383 38847-38875 Protein denotes SerpinB2 luciferase reporter
T16382 38705-38737 Protein denotes C/EBP-β phospho-acceptor mutants
T16381 38634-38642 Protein denotes SerpinB2
T16380 38563-38570 Protein denotes C/EBP-β
T16379 38473-38480 Protein denotes C/EBP-β
T16378 38427-38435 Protein denotes SerpinB2
T16377 38370-38377 Protein denotes C/EBP-β
T15693 36299-36306 Protein denotes C/EBP-β
T15692 36191-36199 Entity denotes promoter
T15691 36173-36181 Protein denotes SerpinB2
T15690 36160-36165 Binding denotes binds
T15689 36152-36159 Protein denotes C/EBP-β
T15688 36110-36118 Protein denotes SerpinB2
T15687 36072-36079 Protein denotes C/EBP-β
T15686 36838-36846 Protein denotes SerpinB2
T15685 36802-36809 Protein denotes C/EBP-β
T15684 36750-36755 Protein denotes Cebpb
T15683 36719-36724 Protein denotes Cebpb
T15682 36661-36669 Protein denotes SerpinB2
T15681 36617-36622 Protein denotes Cebpb
T15680 36604-36609 Protein denotes Cebpb
T15679 36560-36588 Protein denotes SerpinB2 luciferase reporter
T15678 36480-36488 Protein denotes SerpinB2
T15677 36439-36446 Protein denotes C/EBP-β
T15676 36366-36374 Protein denotes SerpinB2
T15675 36299-36306 Protein denotes C/EBP-β
T15674 36173-36181 Protein denotes SerpinB2
T15673 36152-36159 Protein denotes C/EBP-β
T15672 36110-36118 Protein denotes SerpinB2
T15671 36072-36079 Protein denotes C/EBP-β
T15709 36838-36846 Protein denotes SerpinB2
T15708 36830-36837 Positive_regulation denotes induced
T15707 36802-36809 Protein denotes C/EBP-β
T15706 36750-36755 Protein denotes Cebpb
T15705 36719-36724 Protein denotes Cebpb
T15704 36661-36669 Protein denotes SerpinB2
T15703 36650-36660 Positive_regulation denotes stimulated
T15702 36617-36622 Protein denotes Cebpb
T15701 36604-36609 Protein denotes Cebpb
T15700 36560-36588 Protein denotes SerpinB2 luciferase reporter
T15699 36480-36488 Protein denotes SerpinB2
T15698 36457-36470 Transcription denotes transcription
T15697 36439-36446 Protein denotes C/EBP-β
T15696 36396-36404 Positive_regulation denotes response
T15695 36366-36374 Protein denotes SerpinB2
T15694 36343-36356 Transcription denotes transcription
T14838 34819-34832 Transcription denotes transcription
T14837 34809-34818 Positive_regulation denotes increased
T14836 34793-34804 Positive_regulation denotes responsible
T14835 34759-34773 Phosphorylation denotes phosphorylated
T14834 34723-34734 Binding denotes recruitment
T14833 34505-34512 Binding denotes binding
T14832 34374-34379 Binding denotes bound
T14831 34242-34256 Phosphorylation denotes phosphorylated
T14830 34221-34229 Entity denotes promoter
T14829 34184-34195 Binding denotes recruitment
T14828 34095-34101 Regulation denotes affect
T14827 34068-34083 Phosphorylation denotes phosphorylation
T14826 34049-34056 Regulation denotes changes
T14825 33867-33878 Binding denotes association
T14824 33835-33843 Entity denotes promoter
T14823 33362-33373 Binding denotes recruitment
T14822 33234-33239 Binding denotes Binds
T13959 31996-32004 Protein denotes SerpinB2
T13958 31968-31981 Transcription denotes transcription
T13957 31958-31967 Positive_regulation denotes inducible
T13956 31914-31922 Positive_regulation denotes critical
T13955 31903-31910 Protein denotes C/EBP-β
T13954 31829-31838 Negative_regulation denotes deficient
T13953 31821-31828 Protein denotes C/EBP-β
T13952 31808-31817 Negative_regulation denotes decreased
T13951 31774-31789 Transcription denotes mRNA expression
T13950 31765-31773 Protein denotes SerpinB2
T13949 31757-31764 Positive_regulation denotes induced
T13948 31635-31647 Negative_regulation denotes knocked down
T13947 31620-31630 Gene_expression denotes expression
T13946 31612-31619 Protein denotes C/EBP-β
T13945 31463-31468 Protein denotes Cebpb
T13944 31417-31432 Transcription denotes mRNA expression
T13943 31408-31416 Protein denotes SerpinB2
T13942 31397-31407 Positive_regulation denotes stimulated
T13941 31340-31355 Transcription denotes mRNA expression
T13940 31331-31339 Protein denotes SerpinB2
T13939 31319-31327 Positive_regulation denotes increase
T13938 31284-31299 Transcription denotes mRNA expression
T13937 31275-31283 Protein denotes SerpinB2
T13936 31253-31263 Negative_regulation denotes attenuated
T13935 31245-31252 Protein denotes C/EBP-β
T13934 31234-31241 Negative_regulation denotes absence
T13933 31217-31225 Protein denotes SerpinB2
T13932 31184-31191 Gene_expression denotes express
T13931 31160-31167 Protein denotes C/EBP-β
T13930 31141-31148 Gene_expression denotes express
T13929 31094-31099 Protein denotes Cebpb
T13928 31063-31068 Protein denotes Cebpb
T13927 31057-31061 Negative_regulation denotes null
T13926 31049-31056 Protein denotes C/EBP-β
T13925 31017-31031 Positive_regulation denotes in response to
T13924 31001-31016 Transcription denotes mRNA expression
T13923 30992-31000 Protein denotes SerpinB2
T13922 30970-30977 Protein denotes C/EBP-β
T13921 30876-30891 Transcription denotes mRNA Expression
T13920 30867-30875 Protein denotes SerpinB2
T13919 30859-30866 Positive_regulation denotes induced
T13918 30816-30823 Protein denotes C/EBP-β
T13917 31996-32004 Protein denotes SerpinB2
T13916 31903-31910 Protein denotes C/EBP-β
T13915 31821-31828 Protein denotes C/EBP-β
T13914 31765-31773 Protein denotes SerpinB2
T13913 31612-31619 Protein denotes C/EBP-β
T13912 31463-31468 Protein denotes Cebpb
T13911 31408-31416 Protein denotes SerpinB2
T13910 31331-31339 Protein denotes SerpinB2
T13909 31275-31283 Protein denotes SerpinB2
T13908 31245-31252 Protein denotes C/EBP-β
T13906 31160-31167 Protein denotes C/EBP-β
T13905 31094-31099 Protein denotes Cebpb
T13904 31063-31068 Protein denotes Cebpb
T13903 31049-31056 Protein denotes C/EBP-β
T13902 30992-31000 Protein denotes SerpinB2
T13901 30970-30977 Protein denotes C/EBP-β
T13900 30867-30875 Protein denotes SerpinB2
T13899 30816-30823 Protein denotes C/EBP-β
T13140 30806-30813 Protein denotes C/EBP-β
T13139 30630-30637 Protein denotes C/EBP-β
T13138 30403-30410 Protein denotes C/EBP-ε
T13137 30391-30398 Protein denotes C/EBP-δ
T13136 30382-30389 Protein denotes C/EBP-β
T13135 30373-30380 Protein denotes C/EBP-α
T13134 29979-29986 Protein denotes C/EBP-ε
T13133 29967-29974 Protein denotes C/EBP-δ
T13132 29958-29965 Protein denotes C/EBP-β
T13131 29949-29956 Protein denotes C/EBP-α
T13130 29625-29633 Protein denotes SerpinB2
T13129 29591-29596 Binding denotes Binds
T13128 29563-29570 Positive_regulation denotes induced
T13127 29546-29553 Protein denotes C/EBP-β
T13126 30806-30813 Protein denotes C/EBP-β
T13125 30630-30637 Protein denotes C/EBP-β
T13124 30403-30410 Protein denotes C/EBP-ε
T13123 30391-30398 Protein denotes C/EBP-δ
T13122 30382-30389 Protein denotes C/EBP-β
T13121 30373-30380 Protein denotes C/EBP-α
T13120 29979-29986 Protein denotes C/EBP-ε
T13119 29967-29974 Protein denotes C/EBP-δ
T13118 29958-29965 Protein denotes C/EBP-β
T13117 29949-29956 Protein denotes C/EBP-α
T13116 29625-29633 Protein denotes SerpinB2
T13115 29546-29553 Protein denotes C/EBP-β
T12398 28496-28504 Protein denotes SerpinB2
T12397 28341-28348 Protein denotes albumin
T12396 27698-27705 Protein denotes albumin
T12395 27614-27622 Protein denotes SerpinB2
T12394 27565-27573 Protein denotes SerpinB2
T12393 27188-27193 Binding denotes Bound
T12392 28496-28504 Protein denotes SerpinB2
T12391 28341-28348 Protein denotes albumin
T12390 27698-27705 Protein denotes albumin
T12389 27614-27622 Protein denotes SerpinB2
T12388 27565-27573 Protein denotes SerpinB2
T11442 27138-27146 Protein denotes SerpinB2
T11441 26972-26980 Protein denotes SerpinB2
T11440 26936-26946 Protein denotes luciferase
T11439 26926-26935 Positive_regulation denotes inducible
T11438 26914-26921 Negative_regulation denotes reduced
T11437 26755-26763 Protein denotes SerpinB2
T11436 26598-26606 Protein denotes SERPINB2
T11435 26506-26514 Protein denotes SerpinB2
T11434 26483-26484 Entity denotes -
T11433 25535-25543 Protein denotes SerpinB2
T11432 25517-25527 Positive_regulation denotes activation
T11431 25509-25516 Positive_regulation denotes induced
T11430 25411-25419 Protein denotes SerpinB2
T11429 25040-25082 Protein denotes SerpinB2 promoter-luciferase reporter gene
T11428 25008-25015 Binding denotes binding
T11427 24603-24611 Protein denotes SerpinB2
T11426 27138-27146 Protein denotes SerpinB2
T11425 26972-26980 Protein denotes SerpinB2
T11424 26936-26946 Protein denotes luciferase
T11423 26755-26763 Protein denotes SerpinB2
T11422 26598-26606 Protein denotes SERPINB2
T11421 26506-26514 Protein denotes SerpinB2
T11420 25535-25543 Protein denotes SerpinB2
T11419 25411-25419 Protein denotes SerpinB2
T11418 25040-25082 Protein denotes SerpinB2 promoter-luciferase reporter gene
T11417 24603-24611 Protein denotes SerpinB2
T10387 23770-23777 Binding denotes binding
T10386 23559-23564 Protein denotes Oct-1
T10385 23538-23542 Protein denotes PU.1
T10384 23370-23378 Protein denotes SERPINB2
T10383 23005-23013 Protein denotes SERPINB2
T10382 22813-22821 Protein denotes SerpinB2
T10381 22758-22766 Protein denotes SerpinB2
T10380 22361-22371 Gene_expression denotes expression
T10379 22347-22355 Protein denotes SerpinB2
T10378 22333-22343 Regulation denotes regulation
T10377 22321-22325 Regulation denotes role
T10376 22279-22292 Entity denotes binding sites
T10375 22159-22167 Protein denotes SerpinB2
T10374 22088-22096 Protein denotes SerpinB2
T10373 21971-21979 Protein denotes SerpinB2
T10372 23559-23564 Protein denotes Oct-1
T10371 23538-23542 Protein denotes PU.1
T10370 23370-23378 Protein denotes SERPINB2
T10369 23005-23013 Protein denotes SERPINB2
T10368 22813-22821 Protein denotes SerpinB2
T10367 22758-22766 Protein denotes SerpinB2
T10366 22347-22355 Protein denotes SerpinB2
T10365 22159-22167 Protein denotes SerpinB2
T10364 22088-22096 Protein denotes SerpinB2
T10363 21971-21979 Protein denotes SerpinB2
T9458 18941-18951 Protein denotes luciferase
T9457 18784-18792 Protein denotes SerpinB2
T9456 18626-18634 Protein denotes SerpinB2
T9455 20296-20304 Protein denotes SerpinB2
T9454 20156-20164 Protein denotes SerpinB2
T9453 20037-20045 Protein denotes SerpinB2
T9452 19955-19963 Protein denotes SerpinB2
T9451 19595-19603 Protein denotes SerpinB2
T9450 19428-19436 Protein denotes SerpinB2
T9449 19195-19203 Protein denotes SerpinB2
T9448 19104-19114 Protein denotes luciferase
T9447 18941-18951 Protein denotes luciferase
T9446 18784-18792 Protein denotes SerpinB2
T9445 18626-18634 Protein denotes SerpinB2
T9011 18017-18024 Positive_regulation denotes induced
T9010 17997-18007 Gene_expression denotes expression
T9009 17980-17988 Protein denotes SerpinB2
T9008 17869-17879 Gene_expression denotes expression
T9007 17860-17868 Protein denotes SerpinB2
T9467 20296-20304 Protein denotes SerpinB2
T9466 20156-20164 Protein denotes SerpinB2
T9465 20037-20045 Protein denotes SerpinB2
T9464 20021-20029 Negative_regulation denotes deletion
T9463 19955-19963 Protein denotes SerpinB2
T9462 19595-19603 Protein denotes SerpinB2
T9461 19428-19436 Protein denotes SerpinB2
T9460 19195-19203 Protein denotes SerpinB2
T9459 19104-19114 Protein denotes luciferase
T9006 17852-17859 Positive_regulation denotes induced
T9005 17714-17729 Transcription denotes mRNA expression
T9004 17705-17713 Protein denotes SerpinB2
T9003 17695-17704 Positive_regulation denotes inducible
T9002 17678-17687 Positive_regulation denotes induction
T9001 17591-17600 Positive_regulation denotes following
T9000 17543-17551 Protein denotes SerpinB2
T8999 17454-17462 Protein denotes SerpinB2
T8998 17980-17988 Protein denotes SerpinB2
T8997 17860-17868 Protein denotes SerpinB2
T8996 17705-17713 Protein denotes SerpinB2
T8995 17543-17551 Protein denotes SerpinB2
T8994 17454-17462 Protein denotes SerpinB2
T8266 17108-17116 Protein denotes SerpinB2
T8265 16889-16901 Protein denotes Proteinase K
T8264 16719-16728 Protein denotes Protein G
T8263 17108-17116 Protein denotes SerpinB2
T8262 16889-16901 Protein denotes Proteinase K
T8261 16719-16728 Protein denotes Protein G
T7816 14970-14994 Protein denotes T4 polynucleotide kinase
T7815 14970-14994 Protein denotes T4 polynucleotide kinase
T7209 14808-14818 Gene_expression denotes expression
T7208 14745-14776 Protein denotes C/EBP-β phospho-acceptor mutant
T7207 14727-14737 Gene_expression denotes Expression
T7206 14556-14571 Protein denotes β-Galactosidase
T7205 14528-14538 Protein denotes Luciferase
T7204 14497-14512 Protein denotes β-galactosidase
T7203 14436-14446 Protein denotes Luciferase
T7202 14358-14362 Protein denotes S64A
T7201 14351-14356 Protein denotes T217A
T7200 14344-14349 Protein denotes T188A
T7199 14310-14342 Protein denotes C/EBP-β phospho-acceptor mutants
T7198 14299-14306 Protein denotes C/EBP-β
T7197 13971-13986 Protein denotes β-galactosidase
T7196 13963-13970 Protein denotes β-actin
T7195 13913-13923 Protein denotes luciferase
T7194 13849-13854 Protein denotes Cebpb
T7193 11300-11310 Protein denotes Luciferase
T7192 14745-14776 Protein denotes C/EBP-β phospho-acceptor mutant
T7191 14556-14571 Protein denotes β-Galactosidase
T7190 14528-14538 Protein denotes Luciferase
T7189 14497-14512 Protein denotes β-galactosidase
T7188 14436-14446 Protein denotes Luciferase
T7187 14358-14362 Protein denotes S64A
T7186 14351-14356 Protein denotes T217A
T7185 14344-14349 Protein denotes T188A
T7184 14310-14342 Protein denotes C/EBP-β phospho-acceptor mutants
T7183 14299-14306 Protein denotes C/EBP-β
T7182 13971-13986 Protein denotes β-galactosidase
T7181 13963-13970 Protein denotes β-actin
T7180 13913-13923 Protein denotes luciferase
T7179 13849-13854 Protein denotes Cebpb
T7178 11300-11310 Protein denotes Luciferase
T6631 13741-13750 Negative_regulation denotes knockdown
T6630 13733-13740 Protein denotes C/EBP-β
T6629 12923-12930 Protein denotes C/EBP-β
T6628 12898-12908 Gene_expression denotes expression
T6627 12888-12897 Negative_regulation denotes knockdown
T6626 12802-12807 Protein denotes cebpb
T6625 12740-12745 Protein denotes cebpb
T6624 13733-13740 Protein denotes C/EBP-β
T6623 12923-12930 Protein denotes C/EBP-β
T6622 12802-12807 Protein denotes cebpb
T6621 12740-12745 Protein denotes cebpb
T5963 12500-12502 Protein denotes TK
T5962 12472-12479 Protein denotes C/EBP-β
T5961 12460-12471 Gene_expression denotes transfected
T5960 12390-12400 Protein denotes luciferase
T5959 12379-12381 Protein denotes TK
T5958 12331-12341 Protein denotes luciferase
T5957 12296-12305 Gene_expression denotes expressed
T5956 12149-12159 Protein denotes Luciferase
T5955 12103-12113 Protein denotes Luciferase
T5954 11495-11497 Protein denotes TK
T5953 11477-11493 Protein denotes thymidine kinase
T5952 11422-11432 Protein denotes luciferase
T5951 11300-11310 Protein denotes Luciferase
T5950 12500-12502 Protein denotes TK
T5949 12472-12479 Protein denotes C/EBP-β
T5948 12390-12400 Protein denotes luciferase
T5947 12379-12381 Protein denotes TK
T5946 12331-12341 Protein denotes luciferase
T5945 12149-12159 Protein denotes Luciferase
T5944 12103-12113 Protein denotes Luciferase
T5943 11495-11497 Protein denotes TK
T5942 11477-11493 Protein denotes thymidine kinase
T5941 11422-11432 Protein denotes luciferase
T5940 11300-11310 Protein denotes Luciferase
T4740 11194-11202 Protein denotes SerpinB2
T4739 11061-11066 Protein denotes Xho I
T4738 11050-11056 Protein denotes EcoR I
T4737 10259-10267 Protein denotes SerpinB2
T4736 10200-10219 Protein denotes Luciferase reporter
T4735 10027-10035 Protein denotes SerpinB2
T4734 9944-9957 Protein denotes T4 DNA ligase
T4733 9883-9900 Protein denotes T4 DNA polymerase
T4732 9811-9816 Protein denotes Apo I
T4731 9799-9806 Protein denotes Hae III
T4730 9792-9797 Protein denotes Pac I
T4729 9783-9790 Protein denotes Bsu36 I
T4728 9775-9781 Protein denotes BstX I
T4727 9768-9773 Protein denotes Apa I
T4726 9761-9766 Protein denotes Sfi I
T4725 9721-9727 Protein denotes EcoR I
T4724 9552-9580 Protein denotes SerpinB2 luciferase reporter
T4723 9514-9521 Gene_expression denotes produce
T4722 9459-9467 Protein denotes SerpinB2
T4721 9364-9371 Gene_expression denotes produce
T4720 9241-9249 Protein denotes SerpinB2
T4719 9057-9079 Protein denotes SerpinB2 Reporter Gene
T4718 11194-11202 Protein denotes SerpinB2
T4717 11061-11066 Protein denotes Xho I
T4716 11050-11056 Protein denotes EcoR I
T4715 10259-10267 Protein denotes SerpinB2
T4714 10200-10219 Protein denotes Luciferase reporter
T4713 10027-10035 Protein denotes SerpinB2
T4712 9944-9957 Protein denotes T4 DNA ligase
T4711 9883-9900 Protein denotes T4 DNA polymerase
T4710 9811-9816 Protein denotes Apo I
T4709 9799-9806 Protein denotes Hae III
T4708 9792-9797 Protein denotes Pac I
T4707 9783-9790 Protein denotes Bsu36 I
T4706 9775-9781 Protein denotes BstX I
T4705 9768-9773 Protein denotes Apa I
T4704 9761-9766 Protein denotes Sfi I
T4703 9721-9727 Protein denotes EcoR I
T4702 9552-9580 Protein denotes SerpinB2 luciferase reporter
T4701 9459-9467 Protein denotes SerpinB2
T4700 9241-9249 Protein denotes SerpinB2
T4699 9057-9079 Protein denotes SerpinB2 Reporter Gene
T4258 8982-8987 Protein denotes GAPDH
T4257 8940-8980 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4256 8893-8900 Protein denotes C/EBP-β
T4255 8771-8805 Protein denotes GST-murine SerpinB2 fusion protein
T4254 8982-8987 Protein denotes GAPDH
T4253 8940-8980 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4252 8893-8900 Protein denotes C/EBP-β
T4251 8771-8805 Protein denotes GST-murine SerpinB2 fusion protein
T3155 5807-5812 Protein denotes Cebpb
T3154 5783-5788 Protein denotes Cebpb
T3153 5807-5812 Protein denotes Cebpb
T3152 5783-5788 Protein denotes Cebpb
T3810 8004-8012 Protein denotes SerpinB2
T3809 7369-7384 Protein denotes exonuclease III
T3808 7164-7172 Protein denotes SerpinB2
T3807 8004-8012 Protein denotes SerpinB2
T3806 7369-7384 Protein denotes exonuclease III
T3805 7164-7172 Protein denotes SerpinB2
T3579 7064-7071 Protein denotes β-actin
T3578 7038-7043 Protein denotes Cebpb
T3577 7012-7020 Protein denotes SerpinB2
T3576 7003-7011 Protein denotes Serpinb2
T3575 7064-7071 Protein denotes β-actin
T3574 7038-7043 Protein denotes Cebpb
T3573 7012-7020 Protein denotes SerpinB2
T3572 7003-7011 Protein denotes Serpinb2
T1200 5344-5352 Protein denotes SerpinB2
T1199 5326-5336 Regulation denotes regulation
T1198 5228-5236 Protein denotes SerpinB2
T1197 5220-5227 Positive_regulation denotes induced
T1196 5207-5215 Regulation denotes regulate
T1195 5153-5160 Protein denotes C/EBP-β
T1194 5120-5129 Positive_regulation denotes induction
T1193 5111-5119 Protein denotes SerpinB2
T1192 5096-5106 Gene_expression denotes expression
T1191 5087-5095 Protein denotes SerpinB2
T1190 5064-5073 Negative_regulation denotes abrogated
T1189 5053-5063 Negative_regulation denotes deficiency
T1188 5018-5023 Binding denotes bound
T1187 5001-5008 Protein denotes C/EBP-β
T1186 4914-4922 Protein denotes SerpinB2
T1185 4805-4814 Regulation denotes dependent
T1184 4793-4801 Protein denotes SerpinB2
T1183 4780-4789 Positive_regulation denotes induction
T1182 4722-4730 Protein denotes SerpinB2
T1181 4713-4717 Binding denotes bind
T1180 4577-4585 Protein denotes SerpinB2
T1179 4511-4516 Protein denotes IFN-γ
T1178 4411-4420 Regulation denotes regulated
T1177 4388-4396 Protein denotes SerpinB2
T1176 4299-4303 Protein denotes IKKβ
T1175 4208-4216 Protein denotes SerpinB2
T1174 3851-3855 Protein denotes TLR4
T1173 3833-3840 Binding denotes binding
T1172 3653-3657 Protein denotes TLR4
T1171 3631-3651 Protein denotes toll-like receptor 4
T1170 3455-3462 Positive_regulation denotes induced
T1169 3271-3279 Protein denotes SerpinB2
T1168 3096-3104 Protein denotes SerpinB2
T1167 2975-2983 Protein denotes SerpinB2
T1166 2933-2941 Protein denotes SerpinB2
T1165 2888-2899 Protein denotes plasminogen
T1164 2762-2765 Protein denotes uPA
T1163 2724-2760 Protein denotes urokinase-type plasminogen activator
T1162 2675-2683 Protein denotes SerpinB2
T1161 2608-2616 Protein denotes SerpinB2
T1160 5344-5352 Protein denotes SerpinB2
T1159 5228-5236 Protein denotes SerpinB2
T1158 5153-5160 Protein denotes C/EBP-β
T1157 5111-5119 Protein denotes SerpinB2
T1156 5087-5095 Protein denotes SerpinB2
T1155 5001-5008 Protein denotes C/EBP-β
T1154 4914-4922 Protein denotes SerpinB2
T1153 4793-4801 Protein denotes SerpinB2
T1152 4722-4730 Protein denotes SerpinB2
T1151 4577-4585 Protein denotes SerpinB2
T1150 4511-4516 Protein denotes IFN-γ
T1149 4388-4396 Protein denotes SerpinB2
T1148 4299-4303 Protein denotes IKKβ
T1147 4208-4216 Protein denotes SerpinB2
T1146 3851-3855 Protein denotes TLR4
T1145 3653-3657 Protein denotes TLR4
T1144 3631-3651 Protein denotes toll-like receptor 4
T1143 3271-3279 Protein denotes SerpinB2
T1142 3096-3104 Protein denotes SerpinB2
T1141 2975-2983 Protein denotes SerpinB2
T1140 2933-2941 Protein denotes SerpinB2
T1139 2888-2899 Protein denotes plasminogen
T1138 2762-2765 Protein denotes uPA
T1137 2724-2760 Protein denotes urokinase-type plasminogen activator
T1136 2675-2683 Protein denotes SerpinB2
T1135 2608-2616 Protein denotes SerpinB2
T98 1803-1813 Gene_expression denotes expression
T97 1794-1802 Protein denotes SerpinB2
T96 1756-1766 Regulation denotes regulation
T95 1746-1755 Regulation denotes dependent
T94 1738-1745 Protein denotes C/EBP-β
T93 1658-1667 Negative_regulation denotes deficient
T92 1650-1657 Protein denotes C/EBP-β
T91 1598-1602 Negative_regulation denotes null
T90 1590-1597 Protein denotes C/EBP-β
T89 1577-1586 Negative_regulation denotes abrogated
T88 1553-1563 Gene_expression denotes expression
T87 1544-1552 Protein denotes SerpinB2
T86 1536-1543 Positive_regulation denotes induced
T85 1478-1486 Protein denotes SerpinB2
T84 1440-1447 Protein denotes C/EBP-β
T83 1415-1422 Positive_regulation denotes induces
T82 1236-1244 Protein denotes SerpinB2
T81 1017-1025 Protein denotes SERPINB2
T80 723-731 Protein denotes SerpinB2
T79 608-616 Protein denotes SerpinB2
T78 516-520 Protein denotes TLR4
T77 494-514 Protein denotes toll-like receptor 4
T76 475-485 Gene_expression denotes expression
T75 466-474 Protein denotes SerpinB2
T74 459-465 Positive_regulation denotes induce
T73 225-232 Positive_regulation denotes induced
T72 208-213 Protein denotes PAI-2
T71 168-206 Protein denotes plasminogen activator inhibitor type 2
T70 156-164 Protein denotes SerpinB2
T67 1794-1802 Protein denotes SerpinB2
T66 1738-1745 Protein denotes C/EBP-β
T65 1650-1657 Protein denotes C/EBP-β
T64 1590-1597 Protein denotes C/EBP-β
T63 1544-1552 Protein denotes SerpinB2
T62 1478-1486 Protein denotes SerpinB2
T61 1440-1447 Protein denotes C/EBP-β
T60 1236-1244 Protein denotes SerpinB2
T59 1017-1025 Protein denotes SERPINB2
T58 723-731 Protein denotes SerpinB2
T57 608-616 Protein denotes SerpinB2
T56 516-520 Protein denotes TLR4
T55 494-514 Protein denotes toll-like receptor 4
T54 466-474 Protein denotes SerpinB2
T53 208-213 Protein denotes PAI-2
T52 168-206 Protein denotes plasminogen activator inhibitor type 2
T51 156-164 Protein denotes SerpinB2
R21 T87 T88 themeOf SerpinB2,expression
R22 T88 T86 themeOf expression,induced
R23 T88 T89 themeOf expression,abrogated
R24 T90 T91 themeOf C/EBP-β,null
R25 T91 T89 causeOf null,abrogated
R26 T92 T93 themeOf C/EBP-β,deficient
R28 T94 T95 causeOf C/EBP-β,dependent
R29 T94 T96 causeOf C/EBP-β,regulation
R30 T97 T98 themeOf SerpinB2,expression
R31 T98 T96 themeOf expression,regulation
R756 T1164 T1163 equivalentTo uPA,urokinase-type plasminogen activator
R757 T1172 T1171 equivalentTo TLR4,toll-like receptor 4
R758 T1174 T1173 themeOf TLR4,binding
R759 T1177 T1178 themeOf SerpinB2,regulated
R760 T1182 T1181 themeOf SerpinB2,bind
R761 T1183 T1185 themeOf induction,dependent
R762 T1184 T1183 themeOf SerpinB2,induction
R763 T1187 T1188 themeOf C/EBP-β,bound
R764 T1191 T1192 themeOf SerpinB2,expression
R765 T1192 T1190 themeOf expression,abrogated
R766 T1193 T1194 themeOf SerpinB2,induction
R767 T1194 T1190 themeOf induction,abrogated
R768 T1197 T1196 themeOf induced,regulate
R769 T1200 T1199 themeOf SerpinB2,regulation
R6592 T9004 T9005 themeOf SerpinB2,mRNA expression
R6593 T9005 T9003 themeOf mRNA expression,inducible
R6594 T9005 T9002 themeOf mRNA expression,induction
R6595 T9007 T9008 themeOf SerpinB2,expression
R6596 T9008 T9006 themeOf expression,induced
R6597 T9009 T9010 themeOf SerpinB2,expression
R6598 T9010 T9011 themeOf expression,induced
R7618 T10379 T10380 themeOf SerpinB2,expression
R7619 T10380 T10378 themeOf expression,regulation
R8431 T11429 T11428 themeOf SerpinB2 promoter-luciferase reporter gene,binding
R8432 T11432 T11431 themeOf activation,induced
R8433 T11433 T11432 themeOf SerpinB2,activation
R8434 T11439 T11438 themeOf inducible,reduced
R8435 T11440 T11439 themeOf luciferase,inducible
R9749 T13127 T13129 themeOf C/EBP-β,Binds
R10273 T13920 T13921 themeOf SerpinB2,mRNA Expression
R10274 T13921 T13919 themeOf mRNA Expression,induced
R10275 T13923 T13924 themeOf SerpinB2,mRNA expression
R10276 T13924 T13925 themeOf mRNA expression,in response to
R10277 T13926 T13927 themeOf C/EBP-β,null
R10278 T13927 T13925 causeOf null,in response to
R10279 T13931 T13930 themeOf C/EBP-β,express
R10280 T13933 T13932 themeOf SerpinB2,express
R10281 T13937 T13938 themeOf SerpinB2,mRNA expression
R10282 T13938 T13936 themeOf mRNA expression,attenuated
R10283 T13940 T13941 themeOf SerpinB2,mRNA expression
R10284 T13941 T13939 themeOf mRNA expression,increase
R10285 T13943 T13944 themeOf SerpinB2,mRNA expression
R10286 T13944 T13942 themeOf mRNA expression,stimulated
R10287 T13946 T13947 themeOf C/EBP-β,expression
R10288 T13947 T13948 themeOf expression,knocked down
R10289 T13949 T13952 themeOf induced,decreased
R10290 T13950 T13951 themeOf SerpinB2,mRNA expression
R10291 T13951 T13952 themeOf mRNA expression,decreased
R10292 T13951 T13949 themeOf mRNA expression,induced
R10293 T13953 T13954 themeOf C/EBP-β,deficient
R10294 T13954 T13952 causeOf deficient,decreased
R10295 T13955 T13957 causeOf C/EBP-β,inducible
R10296 T13955 T13956 causeOf C/EBP-β,critical
R10297 T13958 T13957 themeOf transcription,inducible
R10298 T13959 T13958 themeOf SerpinB2,transcription
R10897 T14827 T14826 themeOf phosphorylation,changes
R10898 T14827 T14828 causeOf phosphorylation,affect
R10899 T14830 T14829 themeOf promoter,recruitment
R10900 T14837 T14836 themeOf increased,responsible
R10901 T14838 T14837 themeOf transcription,increased
R11585 T15689 T15690 themeOf C/EBP-β,binds
R11586 T15691 T15690 themeOf SerpinB2,binds
R11587 T15692 T15690 themeOf promoter,binds
R11588 T15695 T15694 themeOf SerpinB2,transcription
R11589 T15699 T15698 themeOf SerpinB2,transcription
R11982 T16417 T16419 causeOf Phosphorylation,Regulates
R11983 T16418 T16417 themeOf C/EBP-β,Phosphorylation
R11984 T16420 T16419 themeOf stimulated,Regulates
R11985 T16423 T16422 themeOf C/EBP-β,Phosphorylation
R11986 T16425 T16426 themeOf C/EBP-β,phosphorylation
R11987 T16429 T16428 themeOf C/EBP-β phospho-acceptor mutants,expressed
R11988 T16435 T16434 themeOf C/EBP-β,expression
R11989 T16438 T16439 themeOf SerpinB2 luciferase reporter,expression
R11990 T16439 T16437 themeOf expression,stimulated
R11991 T16440 T16441 causeOf C/EBP-β,induced
R11992 T16442 T16443 themeOf SerpinB2,transcription
R11993 T16443 T16441 themeOf transcription,induced
R11994 T16445 T16444 themeOf C/EBP-β phospho-acceptor mutant,Expression
R11995 T16446 T16444 themeOf C/EBPβT217A,Expression
R11996 T16452 T16451 themeOf C/EBP-β,phosphorylation
R11997 T16455 T16456 themeOf C/EBP-β,phosphorylation
R11998 T16458 T16459 causeOf C/EBP-β,dependent
R11999 T16459 T16457 themeOf dependent,modulating
R12000 T16460 T16461 themeOf SerpinB2,transcription
R12001 T16461 T16459 themeOf transcription,dependent
R12002 T16467 T16466 themeOf induced,important
R12003 T16468 T16467 themeOf transcription,induced
R12004 T16469 T16468 themeOf IL-6,transcription
R12005 T16470 T16468 themeOf MCP-1,transcription
R12006 T16471 T16473 themeOf SerpinB2,regulated
R12007 T16471 T16472 themeOf SerpinB2,induced
R12008 T16477 T16478 themeOf SerpinB2,expression
R12009 T16478 T16476 themeOf expression,role
R12010 T16483 T16482 themeOf C/EBP-βS64A,expression
R12011 T16488 T16487 themeOf C/EBP-β,phosphorylation
R13158 T18354 T18355 themeOf SerpinB2,induced
R13159 T18357 T18358 themeOf SerpinB2,transcription
R13160 T18358 T18360 themeOf transcription,dependent
R13161 T18361 T18360 causeOf C/EBP-β,dependent
R13162 T18363 T18362 themeOf C/EBP-β,induced
R13163 T18363 T18364 themeOf C/EBP-β,bind
R13164 T18367 T18366 themeOf C/EBP-β,loss
R13165 T18367 T18368 causeOf C/EBP-β,abrogates
R13166 T18369 T18370 themeOf SerpinB2,transcription
R13167 T18370 T18368 themeOf transcription,abrogates
R13168 T18374 T18373 themeOf transcription,stimulated
R13169 T18375 T18374 themeOf SERPINB2,transcription
R13170 T18376 T18374 themeOf SerpinB2,transcription
R13171 T18379 T18380 themeOf C/EBP-β,binding
R13172 T18379 T18382 themeOf C/EBP-β,interact
R13173 T18381 T18382 themeOf C/EBP-β,interact
R13174 T18384 T18383 themeOf C/EBP-β,transcription
R13175 T18385 T18386 causeOf C/EBP-β,induced
R13176 T18387 T18388 themeOf SerpinB2,transcription
R13177 T18388 T18386 themeOf transcription,induced
R13178 T18389 T18390 themeOf SerpinB2,gene
R13179 T18390 T18394 themeOf gene,impaired
R13180 T18391 T18392 themeOf C/EBP-β,deficient
R13181 T18393 T18390 themeOf IFNγ,gene
R13182 T18396 T18397 themeOf SerpinB2,mRNA expression
R13183 T18397 T18398 themeOf mRNA expression,abrogated
R13184 T18397 T18395 themeOf mRNA expression,inducible
R13185 T18399 T18401 themeOf C/EBP-β,transcription
R13186 T18400 T18401 themeOf SerpinB2,transcription
R13187 T18402 T18403 themeOf C/EBP-β,bind
R13188 T18404 T18403 themeOf SerpinB2,bind
R13189 T18405 T18403 themeOf C/EBP-β,bind
R13190 T18407 T18408 themeOf SerpinB2,expression
R13191 T18408 T18406 themeOf expression,induced
R13192 T18411 T18412 themeOf C/EBP-β,null
R13193 T18415 T18416 themeOf SerpinB2,expression
R13194 T18416 T18414 themeOf expression,regulation
R13195 T18417 T18414 causeOf C/EBP-β,regulation
R13196 T18419 T18418 themeOf C/EBP-β,Phosphorylation
R13197 T18420 T18421 themeOf C/EBP-β,phosphorylated
R13198 T18424 T18423 themeOf C/EBP-β phospho-acceptor site mutant,expression
R13199 T18425 T18423 themeOf C/EBPβT217A,expression
R13200 T18430 T18433 themeOf recruitment,decrease
R13201 T18432 T18431 partOf promoter,SerpinB2
R13202 T18432 T18430 themeOf promoter,recruitment
R13203 T18435 T18436 themeOf SerpinB2,expression
R13204 T18436 T18434 themeOf expression,regulation
R13205 T18437 T18440 causeOf expression,affect
R13206 T18438 T18437 themeOf C/EBP-β phospho-acceptor site mutant,expression
R13207 T18439 T18437 themeOf C/EBP-βT188A,expression
R13208 T18442 T18441 partOf promoter,SerpinB2
R13209 T18443 T18445 causeOf expression,enhanced
R13210 T18444 T18443 themeOf C/EBP-βS64A,expression
R13211 T18446 T18445 themeOf induced,enhanced
R13212 T18448 T18450 causeOf phosphorylation,regulates
R13213 T18449 T18448 themeOf C/EBP-β,phosphorylation
R13214 T18451 T18450 themeOf induced,regulates
R17606 T24567 T24568 themeOf SerpinB2,mRNA expression
R18125 T25307 T25306 themeOf C/EBP-β,recruitment
R18126 T25317 T25315 themeOf promoter,Recruitment
R18127 T25317 T25316 partOf promoter,SerpinB2
R18565 T26053 T26054 causeOf C/EBP-β,necessary
R18566 T26063 T26062 themeOf SerpinB2 promoter-luciferase reporter,expressing
R18567 T26069 T26071 causeOf Phosphorylation,regulates
R18568 T26070 T26069 themeOf C/EBP-β,Phosphorylation
R18569 T26072 T26071 themeOf stimulated,regulates
R18570 T26076 T26075 themeOf C/EBP-β,expression
R18571 T26085 T26084 themeOf C/EBP-β,express
R17601 T24552 T24553 themeOf SerpinB2,mRNA expression
R17602 T24556 T24557 themeOf SerpinB2,mRNA expression
R17603 T24560 T24561 themeOf SerpinB2,expression
R17604 T24561 T24562 themeOf expression,abrogated
R17605 T24563 T24564 themeOf C/EBP-β,deficient
R15 T71 T73 themeOf plasminogen activator inhibitor type 2,induced
R16 T72 T71 equivalentTo PAI-2,plasminogen activator inhibitor type 2
R17 T75 T76 themeOf SerpinB2,expression
R18 T76 T74 themeOf expression,induce
R19 T78 T77 equivalentTo TLR4,toll-like receptor 4
R20 T86 T89 themeOf induced,abrogated
R27 T93 T89 causeOf deficient,abrogated
R3135 T4258 T4257 equivalentTo GAPDH,glyceraldehyde-3-phosphate dehydrogenase
R4263 T5954 T5953 equivalentTo TK,thymidine kinase
R4264 T5958 T5957 themeOf luciferase,expressed
R4265 T5960 T5957 themeOf luciferase,expressed
R4266 T5962 T5961 themeOf C/EBP-β,transfected
R4738 T6626 T6627 causeOf cebpb,knockdown
R4739 T6628 T6627 themeOf expression,knockdown
R4740 T6629 T6628 themeOf C/EBP-β,expression
R4741 T6630 T6631 themeOf C/EBP-β,knockdown
R5187 T7200 T7199 equivalentTo T188A,C/EBP-β phospho-acceptor mutants
R5188 T7208 T7207 themeOf C/EBP-β phospho-acceptor mutant,Expression
R5189 T7208 T7209 themeOf C/EBP-β phospho-acceptor mutant,expression
R13215 T18457 T18456 themeOf transcription,induced
R13216 T18458 T18457 themeOf SerpinB2,transcription
R13217 T18461 T18460 equivalentTo MLK3,Mixed lineage kinase-3
R13218 T18465 T18466 themeOf SerpinB2,expression
R13219 T18471 T18470 themeOf transcription,induced
R13220 T18472 T18471 themeOf SerpinB2,transcription
R13221 T18475 T18476 themeOf SerpinB2,expression
R13222 T18476 T18474 themeOf expression,induced
R16163 T22389 T22390 themeOf SerpinB2,expression
R16164 T22390 T22388 themeOf expression,induction
R16165 T22393 T22394 themeOf SerpinB2,expression
R16859 T23393 T23392 equivalentTo POU2F1,octamer transcription factor 1
R17106 T23779 T23780 themeOf luciferase,following
R17384 T24169 T24168 themeOf SerpinB2,binding
R17385 T24170 T24168 themeOf C/EBP-β,binding
R17598 T24548 T24549 causeOf C/EBP-β,induced
R17599 T24550 T24551 themeOf SerpinB2,mRNA expression
R17600 T24551 T24549 themeOf mRNA expression,induced