> top > docs > PMC:3320587 > spans > 11230-12646 > annotations

PMC:3320587 / 11230-12646 JSONTXT

Annnotations TAB JSON ListView MergeView

pmc-enju-pas

Id Subject Object Predicate Lexical cue
T5158 398-401 CC denotes and
T5293 1406-1415 NN denotes puromycin
T5292 1400-1405 NN denotes µg/ml
T5291 1396-1399 CD denotes 0.8
T5290 1391-1395 IN denotes with
T5289 1381-1390 NN denotes treatment
T5288 1378-1380 IN denotes by
T5287 1369-1377 VB denotes expanded
T5286 1365-1368 CC denotes and
T5285 1356-1364 VB denotes selected
T5284 1351-1355 VB denotes were
T5283 1345-1350 NN denotes cells
T5282 1334-1344 VB denotes transduced
T5281 1321-1333 RB denotes Successfully
T5280 1316-1319 NN denotes RPM
T5279 1311-1315 CD denotes 2000
T5278 1308-1310 IN denotes at
T5277 1302-1307 NN denotes hours
T5276 1298-1301 CD denotes two
T5275 1294-1297 IN denotes for
T5274 1280-1293 NN denotes spinoculation
T5273 1276-1279 CC denotes and
T5272 1274-1275 -RRB- denotes )
T5271 1257-1274 NN denotes www.millipore.com
T5270 1255-1256 -COMMA- denotes ,
T5269 1246-1255 NNP denotes Millipore
T5268 1245-1246 -LRB- denotes (
T5267 1235-1244 NN denotes polybrene
T5266 1229-1234 NN denotes µg/ml
T5265 1227-1228 CD denotes 8
T5264 1224-1226 IN denotes of
T5263 1215-1223 NN denotes presence
T5262 1211-1214 DT denotes the
T5261 1208-1210 IN denotes in
T5260 1202-1207 NN denotes cells
T5259 1186-1201 JJ denotes virus-producing
T5258 1182-1185 DT denotes the
T5257 1177-1181 IN denotes from
T5256 1164-1176 NN denotes supernatants
T5255 1159-1163 IN denotes with
T5254 1153-1158 NN denotes cells
T5253 1149-1152 DT denotes the
T5252 1139-1148 VB denotes culturing
T5251 1136-1138 IN denotes by
T5250 1126-1135 NN denotes particles
T5157 396-397 -RRB- denotes )
T5156 386-396 VB denotes underlined
T5155 383-385 VB denotes is
T5154 374-382 NN denotes sequence
T5153 367-373 NN denotes target
T5152 362-366 NN denotes mRNA
T5151 356-361 NN denotes IRAK1
T5150 355-356 -LRB- denotes (
T5149 350-354 NN denotes mRNA
T5148 288-349 NN denotes 5′-AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3′
T5147 281-287 NN denotes primer
T5146 273-280 JJ denotes reverse
T5145 271-272 -COMMA- denotes ,
T5144 210-271 NN denotes 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′
T5143 203-209 NN denotes primer
T5142 195-202 JJ denotes forward
T5141 194-195 -LRB- denotes (
T5140 188-193 NN denotes IRAK1
T5139 182-187 JJ denotes human
T5138 172-181 VB denotes targeting
T5137 166-171 NN denotes shRNA
T5136 154-165 NN denotes laboratory.
T5135 150-153 PRP-DOLLAR- denotes our
T5134 147-149 IN denotes in
T5133 137-146 VB denotes validated
T5132 133-136 VB denotes was
T5131 129-132 CC denotes and
T5130 127-128 -RRB- denotes )
T5129 105-127 NN denotes www.openbiosystems.com
T5128 104-105 -LRB- denotes (
T5127 93-103 NNP denotes Biosystems
T5126 88-92 NNP denotes Open
T5125 83-87 IN denotes from
T5124 73-82 VB denotes purchased
T5123 69-72 VB denotes was
T5122 63-68 NN denotes MyD88
T5121 57-62 JJ denotes human
T5120 47-56 VB denotes targeting
T5119 41-46 NN denotes shRNA
T5118 30-40 VB denotes expressing
T5117 23-29 NN denotes pLKO.1
T5116 15-22 NN denotes plasmid
T5115 4-14 JJ denotes lentiviral
T5114 0-3 DT denotes The
T5249 1115-1125 JJ denotes lentiviral
T5248 1111-1114 DT denotes the
T5247 1106-1110 IN denotes with
T5246 1095-1105 VB denotes transduced
T5245 1090-1094 VB denotes were
T5244 1084-1089 NN denotes cells
T5243 1078-1083 NN denotes THP-1
T5242 1071-1077 NN denotes −80°C.
T5241 1068-1070 IN denotes at
T5240 1061-1067 VB denotes stored
T5239 1057-1060 CC denotes and
T5238 1055-1056 -COMMA- denotes ,
T5237 1041-1055 NN denotes centrifugation
T5236 1038-1040 IN denotes by
T5235 1028-1037 VB denotes clarified
T5234 1026-1027 -COMMA- denotes ,
T5233 1009-1026 JJ denotes post-transfection
T5232 1003-1008 NN denotes hours
T5231 1000-1002 CD denotes 48
T5230 990-999 VB denotes collected
T5229 985-989 VB denotes were
T5228 972-984 NN denotes Supernatants
T5227 969-970 -RRB- denotes )
T5226 955-969 NN denotes www.qiagen.com
T5225 953-954 -COMMA- denotes ,
T5224 947-953 NN denotes Qiagen
T5223 946-947 -LRB- denotes (
T5222 938-945 NN denotes reagent
T5221 925-937 NN denotes transfection
T5220 915-924 NN denotes Effectene
T5219 909-914 VB denotes using
T5218 902-908 NN denotes pMD2.G
T5217 894-901 NN denotes plasmid
T5216 885-893 NN denotes envelope
T5215 881-884 DT denotes the
T5214 877-880 CC denotes and
T5213 870-876 NN denotes psPAX2
T5212 862-869 NN denotes plasmid
T5211 852-861 NN denotes packaging
T5210 848-851 DT denotes the
T5209 843-847 IN denotes with
T5208 831-842 NN denotes combination
T5207 828-830 IN denotes in
T5206 819-827 NN denotes plasmids
T5205 812-818 NN denotes pLKO.1
T5204 797-811 JJ denotes shRNA-encoding
T5203 793-796 DT denotes the
T5202 788-792 IN denotes with
T5201 779-787 NN denotes HEK-293T
T5200 774-778 NN denotes line
T5199 769-773 NN denotes cell
T5198 759-768 NN denotes packaging
T5197 755-758 DT denotes the
T5196 742-754 VB denotes transfecting
T5195 739-741 IN denotes by
T5194 729-738 VB denotes generated
T5193 724-728 VB denotes were
T5192 714-723 NN denotes sequences
T5191 708-713 NN denotes shRNA
T5190 699-707 VB denotes encoding
T5189 686-698 NN denotes Lentiviruses
T5188 677-684 NN denotes plasmid
T5187 670-676 NN denotes pLKO.1
T5186 666-669 DT denotes the
T5185 661-665 IN denotes into
T5184 654-660 VB denotes cloned
T5183 649-653 VB denotes were
T5182 645-648 CC denotes and
T5181 634-644 NN denotes laboratory
T5180 630-633 PRP-DOLLAR- denotes our
T5179 627-629 IN denotes in
T5178 618-626 VB denotes designed
T5177 613-617 VB denotes were
T5176 611-612 -RRB- denotes )
T5175 601-611 VB denotes underlined
T5174 598-600 VB denotes is
T5173 589-597 NN denotes sequence
T5172 582-588 NN denotes target
T5171 577-581 NN denotes mRNA
T5170 571-576 NN denotes TRAF6
T5169 570-571 -LRB- denotes (
T5168 508-569 NN denotes 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′
T5167 501-507 NN denotes primer
T5166 493-500 JJ denotes reverse
T5165 491-492 -COMMA- denotes ,
T5164 430-491 NN denotes 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′
T5163 423-429 NN denotes primer
T5162 415-422 JJ denotes forward
T5161 414-415 -LRB- denotes (
T5160 408-413 NN denotes TRAF6
T5159 402-407 JJ denotes human
R3987 T5117 T5114 arg1Of pLKO.1,The
R3988 T5117 T5115 arg1Of pLKO.1,lentiviral
R3989 T5117 T5116 arg1Of pLKO.1,plasmid
R3990 T5117 T5118 arg1Of pLKO.1,expressing
R3991 T5117 T5123 arg1Of pLKO.1,was
R3992 T5117 T5124 arg2Of pLKO.1,purchased
R3993 T5117 T5132 arg1Of pLKO.1,was
R3995 T5117 T5183 arg1Of pLKO.1,were
R3996 T5117 T5184 arg2Of pLKO.1,cloned
R3997 T5119 T5118 arg2Of shRNA,expressing
R3998 T5119 T5120 arg1Of shRNA,targeting
R3999 T5122 T5120 arg2Of MyD88,targeting
R4000 T5122 T5121 arg1Of MyD88,human
R4001 T5124 T5123 arg2Of purchased,was
R4002 T5124 T5125 arg1Of purchased,from
R4003 T5124 T5131 arg1Of purchased,and
R4004 T5127 T5125 arg2Of Biosystems,from
R4005 T5127 T5126 arg1Of Biosystems,Open
R4006 T5127 T5128 arg1Of Biosystems,(
R4007 T5129 T5128 arg2Of www.openbiosystems.com,(
R4008 T5130 T5128 arg3Of ),(
R4009 T5133 T5132 arg2Of validated,was
R4010 T5133 T5134 arg1Of validated,in
R4011 T5133 T5182 arg1Of validated,and
R4012 T5137 T5134 arg2Of shRNA,in
R4013 T5137 T5135 arg1Of shRNA,our
R4014 T5137 T5136 arg1Of shRNA,laboratory.
R4015 T5137 T5138 arg1Of shRNA,targeting
R4016 T5144 T5139 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,human
R4017 T5144 T5140 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,IRAK1
R4018 T5144 T5141 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,(
R4019 T5144 T5142 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,forward
R4020 T5144 T5143 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,primer
R4021 T5144 T5145 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,","
R4022 T5145 T5158 arg1Of ",",and
R4023 T5149 T5145 arg2Of mRNA,","
R4024 T5149 T5146 arg1Of mRNA,reverse
R4025 T5149 T5147 arg1Of mRNA,primer
R4026 T5149 T5148 arg1Of mRNA,5′-AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3′
R4027 T5149 T5150 arg1Of mRNA,(
R4028 T5154 T5151 arg1Of sequence,IRAK1
R4029 T5154 T5152 arg1Of sequence,mRNA
R4030 T5154 T5153 arg1Of sequence,target
R4031 T5154 T5155 arg1Of sequence,is
R4032 T5154 T5156 arg2Of sequence,underlined
R4033 T5156 T5150 arg2Of underlined,(
R4034 T5156 T5155 arg2Of underlined,is
R4035 T5157 T5150 arg3Of ),(
R4036 T5158 T5138 arg2Of and,targeting
R4037 T5158 T5177 modOf and,were
R4038 T5164 T5158 arg2Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,and
R4039 T5164 T5159 arg1Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,human
R4040 T5164 T5160 arg1Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,TRAF6
R4041 T5164 T5161 arg1Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,(
R4042 T5164 T5162 arg1Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,forward
R4043 T5164 T5163 arg1Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,primer
R4044 T5168 T5166 arg1Of 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′,reverse
R4045 T5168 T5167 arg1Of 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′,primer
R4046 T5168 T5169 arg1Of 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′,(
R4047 T5168 T5177 arg1Of 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′,were
R4048 T5168 T5178 arg2Of 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′,designed
R4049 T5173 T5170 arg1Of sequence,TRAF6
R4050 T5173 T5171 arg1Of sequence,mRNA
R4051 T5173 T5172 arg1Of sequence,target
R4052 T5173 T5174 arg1Of sequence,is
R4053 T5173 T5175 arg2Of sequence,underlined
R4054 T5175 T5169 arg2Of underlined,(
R4055 T5175 T5174 arg2Of underlined,is
R4056 T5176 T5169 arg3Of ),(
R4057 T5178 T5165 arg1Of designed,","
R4058 T5178 T5177 arg2Of designed,were
R4059 T5178 T5179 arg1Of designed,in
R4060 T5181 T5179 arg2Of laboratory,in
R4061 T5181 T5180 arg1Of laboratory,our
R4062 T5182 T5131 arg2Of and,and
R4063 T5184 T5182 arg2Of cloned,and
R4064 T5184 T5183 arg2Of cloned,were
R4065 T5184 T5185 arg1Of cloned,into
R4066 T5188 T5185 arg2Of plasmid,into
R4067 T5188 T5186 arg1Of plasmid,the
R4068 T5188 T5187 arg1Of plasmid,pLKO.1
R4069 T5189 T5190 arg1Of Lentiviruses,encoding
R4070 T5189 T5193 arg1Of Lentiviruses,were
R4071 T5189 T5194 arg2Of Lentiviruses,generated
R4072 T5192 T5190 arg2Of sequences,encoding
R4073 T5192 T5191 arg1Of sequences,shRNA
R4074 T5194 T5193 arg2Of generated,were
R4075 T5194 T5195 arg1Of generated,by
R4076 T5196 T5195 arg2Of transfecting,by
R4077 T5196 T5202 arg1Of transfecting,with
R4078 T5201 T5196 arg2Of HEK-293T,transfecting
R4079 T5201 T5197 arg1Of HEK-293T,the
R4080 T5201 T5198 arg1Of HEK-293T,packaging
R4081 T5201 T5199 arg1Of HEK-293T,cell
R4082 T5201 T5200 arg1Of HEK-293T,line
R4083 T5206 T5202 arg2Of plasmids,with
R4084 T5206 T5203 arg1Of plasmids,the
R4085 T5206 T5204 arg1Of plasmids,shRNA-encoding
R4086 T5206 T5205 arg1Of plasmids,pLKO.1
R4087 T5206 T5207 arg1Of plasmids,in
R4088 T5208 T5207 arg2Of combination,in
R4089 T5208 T5209 arg1Of combination,with
R4090 T5213 T5210 arg1Of psPAX2,the
R4091 T5213 T5211 arg1Of psPAX2,packaging
R4092 T5213 T5212 arg1Of psPAX2,plasmid
R4093 T5213 T5214 arg1Of psPAX2,and
R4094 T5214 T5209 arg2Of and,with
R4095 T5218 T5214 arg2Of pMD2.G,and
R4096 T5218 T5215 arg1Of pMD2.G,the
R4097 T5218 T5216 arg1Of pMD2.G,envelope
R4098 T5218 T5217 arg1Of pMD2.G,plasmid
R4099 T5218 T5219 arg1Of pMD2.G,using
R4100 T5222 T5219 arg2Of reagent,using
R4101 T5222 T5220 arg1Of reagent,Effectene
R4102 T5222 T5221 arg1Of reagent,transfection
R4103 T5222 T5223 arg1Of reagent,(
R4104 T5224 T5223 arg2Of Qiagen,(
R4105 T5224 T5225 arg1Of Qiagen,","
R4106 T5226 T5225 arg2Of www.qiagen.com,","
R4107 T5227 T5223 arg3Of ),(
R4108 T5228 T5229 arg1Of Supernatants,were
R4109 T5228 T5230 arg2Of Supernatants,collected
R4110 T5228 T5235 arg2Of Supernatants,clarified
R4111 T5230 T5229 arg2Of collected,were
R4112 T5230 T5232 arg1Of collected,hours
R4113 T5230 T5233 arg1Of collected,post-transfection
R4114 T5230 T5234 arg1Of collected,","
R4115 T5230 T5235 modOf collected,clarified
R4116 T5230 T5239 arg1Of collected,and
R4117 T5232 T5231 arg1Of hours,48
R4118 T5237 T5235 arg1Of centrifugation,clarified
R4119 T5237 T5236 arg2Of centrifugation,by
R4120 T5239 T5238 arg1Of and,","
R4121 T5240 T5241 arg1Of stored,at
R4122 T5242 T5240 arg2Of −80°C.,stored
R4123 T5242 T5245 modOf −80°C.,were
R4124 T5244 T5243 arg1Of cells,THP-1
R4125 T5244 T5245 arg1Of cells,were
R4126 T5244 T5246 arg2Of cells,transduced
R4127 T5244 T5252 arg1Of cells,culturing
R4128 T5246 T5245 arg2Of transduced,were
R4129 T5246 T5247 arg1Of transduced,with
R4130 T5246 T5251 arg1Of transduced,by
R4131 T5250 T5247 arg2Of particles,with
R4132 T5250 T5248 arg1Of particles,the
R4133 T5250 T5249 arg1Of particles,lentiviral
R4134 T5252 T5251 arg2Of culturing,by
R4135 T5252 T5255 arg1Of culturing,with
R4136 T5252 T5261 arg1Of culturing,in
R4137 T5254 T5252 arg2Of cells,culturing
R4138 T5254 T5253 arg1Of cells,the
R4139 T5256 T5255 arg2Of supernatants,with
R4140 T5256 T5257 arg1Of supernatants,from
R4141 T5260 T5257 arg2Of cells,from
R4142 T5260 T5258 arg1Of cells,the
R4143 T5260 T5259 arg1Of cells,virus-producing
R4144 T5261 T5262 arg1Of in,the
R4145 T5261 T5264 arg1Of in,of
R4146 T5263 T5261 arg2Of presence,in
R4147 T5267 T5265 arg1Of polybrene,8
R4148 T5267 T5266 arg1Of polybrene,µg/ml
R4149 T5267 T5268 arg1Of polybrene,(
R4150 T5267 T5273 arg1Of polybrene,and
R4151 T5269 T5268 arg2Of Millipore,(
R4152 T5269 T5270 arg1Of Millipore,","
R4153 T5271 T5270 arg2Of www.millipore.com,","
R4154 T5272 T5268 arg3Of ),(
R4155 T5273 T5242 arg1Of and,−80°C.
R4156 T5273 T5278 arg1Of and,at
R4157 T5274 T5273 arg2Of spinoculation,and
R4158 T5274 T5275 arg1Of spinoculation,for
R4159 T5277 T5275 arg2Of hours,for
R4160 T5277 T5276 arg1Of hours,two
R4161 T5278 T5239 arg2Of at,and
R4162 T5280 T5278 arg2Of RPM,at
R4163 T5280 T5279 arg1Of RPM,2000
R4164 T5282 T5281 arg1Of transduced,Successfully
R4165 T5283 T5282 arg1Of cells,transduced
R4166 T5283 T5284 arg1Of cells,were
R4167 T5283 T5285 arg2Of cells,selected
R4168 T5283 T5287 arg2Of cells,expanded
R4169 T5285 T5286 arg1Of selected,and
R4170 T5286 T5284 arg2Of and,were
R4171 T5287 T5286 arg2Of expanded,and
R4172 T5289 T5285 arg1Of treatment,selected
R4173 T5289 T5287 arg1Of treatment,expanded
R4174 T5289 T5288 arg2Of treatment,by
R4175 T5289 T5290 arg1Of treatment,with
R4176 T5291 T5292 arg1Of 0.8,µg/ml
R4177 T5293 T5290 arg2Of puromycin,with
R4178 T5293 T5291 arg1Of puromycin,0.8
R3994 T5117 T5133 arg2Of pLKO.1,validated

bionlp-st-ge-2016-test-proteins

Id Subject Object Predicate Lexical cue
T5095 571-576 Protein denotes TRAF6
T5094 408-413 Protein denotes TRAF6
T5093 356-361 Protein denotes IRAK1
T5092 188-193 Protein denotes IRAK1
T5091 63-68 Protein denotes MyD88
T5090 41-46 Protein denotes shRNA

bionlp-st-ge-2016-uniprot

Id Subject Object Predicate Lexical cue
T5296 571-576 http://www.uniprot.org/uniprot/Q9Y4K3 denotes TRAF6
T5295 408-413 http://www.uniprot.org/uniprot/Q9Y4K3 denotes TRAF6
T5294 63-68 http://www.uniprot.org/uniprot/Q99836 denotes MyD88

GO-CC

Id Subject Object Predicate Lexical cue
T5101 885-893 http://purl.obolibrary.org/obo/GO_0009274 denotes envelope
T5100 1345-1350 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T5099 1202-1207 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T5098 1153-1158 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T5097 1084-1089 http://purl.obolibrary.org/obo/GO_0005623 denotes cells

sentences

Id Subject Object Predicate Lexical cue
T5072 1321-1416 Sentence denotes Successfully transduced cells were selected and expanded by treatment with 0.8 µg/ml puromycin.
T5071 972-1320 Sentence denotes Supernatants were collected 48 hours post-transfection, clarified by centrifugation, and stored at −80°C. THP-1 cells were transduced with the lentiviral particles by culturing the cells with supernatants from the virus-producing cells in the presence of 8 µg/ml polybrene (Millipore, www.millipore.com) and spinoculation for two hours at 2000 RPM.
T5070 686-971 Sentence denotes Lentiviruses encoding shRNA sequences were generated by transfecting the packaging cell line HEK-293T with the shRNA-encoding pLKO.1 plasmids in combination with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G using Effectene transfection reagent (Qiagen, www.qiagen.com).
T5069 0-685 Sentence denotes The lentiviral plasmid pLKO.1 expressing shRNA targeting human MyD88 was purchased from Open Biosystems (www.openbiosystems.com) and was validated in our laboratory. shRNA targeting human IRAK1 (forward primer 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′, reverse primer 5′-AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3′ mRNA (IRAK1 mRNA target sequence is underlined) and human TRAF6 (forward primer 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′, reverse primer 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′ (TRAF6 mRNA target sequence is underlined) were designed in our laboratory and were cloned into the pLKO.1 plasmid.
T72 0-685 Sentence denotes The lentiviral plasmid pLKO.1 expressing shRNA targeting human MyD88 was purchased from Open Biosystems (www.openbiosystems.com) and was validated in our laboratory. shRNA targeting human IRAK1 (forward primer 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′, reverse primer 5′-AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3′ mRNA (IRAK1 mRNA target sequence is underlined) and human TRAF6 (forward primer 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′, reverse primer 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′ (TRAF6 mRNA target sequence is underlined) were designed in our laboratory and were cloned into the pLKO.1 plasmid.
T73 686-971 Sentence denotes Lentiviruses encoding shRNA sequences were generated by transfecting the packaging cell line HEK-293T with the shRNA-encoding pLKO.1 plasmids in combination with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G using Effectene transfection reagent (Qiagen, www.qiagen.com).
T74 972-1077 Sentence denotes Supernatants were collected 48 hours post-transfection, clarified by centrifugation, and stored at −80°C.
T75 1078-1320 Sentence denotes THP-1 cells were transduced with the lentiviral particles by culturing the cells with supernatants from the virus-producing cells in the presence of 8 µg/ml polybrene (Millipore, www.millipore.com) and spinoculation for two hours at 2000 RPM.
T76 1321-1416 Sentence denotes Successfully transduced cells were selected and expanded by treatment with 0.8 µg/ml puromycin.

simple1

Id Subject Object Predicate Lexical cue
T5108 571-576 Protein denotes TRAF6
T5107 408-413 Protein denotes TRAF6
T5106 356-361 Protein denotes IRAK1
T5105 188-193 Protein denotes IRAK1
T5104 63-68 Protein denotes MyD88
T5103 41-46 Protein denotes shRNA

BioNLP16_DUT

Id Subject Object Predicate Lexical cue
T5566 30-40 Gene_expression denotes expressing
T5564 571-576 Protein denotes TRAF6
T5563 408-413 Protein denotes TRAF6
T5562 356-361 Protein denotes IRAK1
T5561 188-193 Protein denotes IRAK1
T5560 63-68 Protein denotes MyD88
T5559 41-46 Protein denotes shRNA
R4406 T5559 T5566 themeOf shRNA,expressing
R4407 T5560 T5566 themeOf MyD88,expressing

BioNLP16_Messiy

Id Subject Object Predicate Lexical cue
T5321 30-40 Gene_expression denotes expressing
T5319 571-576 Protein denotes TRAF6
T5318 408-413 Protein denotes TRAF6
T5317 356-361 Protein denotes IRAK1
T5316 188-193 Protein denotes IRAK1
T5315 63-68 Protein denotes MyD88
T5314 41-46 Protein denotes shRNA
R4183 T5315 T5321 themeOf MyD88,expressing

DLUT931

Id Subject Object Predicate Lexical cue
T5312 30-40 Gene_expression denotes expressing
T5310 571-576 Protein denotes TRAF6
T5309 408-413 Protein denotes TRAF6
T5308 356-361 Protein denotes IRAK1
T5307 188-193 Protein denotes IRAK1
T5306 63-68 Protein denotes MyD88
T5305 41-46 Protein denotes shRNA
R4180 T5305 T5312 themeOf shRNA,expressing
R4181 T5306 T5312 themeOf MyD88,expressing

bionlp-st-ge-2016-test-ihmc

Id Subject Object Predicate Lexical cue
T5576 402-492 Protein denotes human TRAF6 (forward primer 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,
T5575 41-68 Protein denotes shRNA targeting human MyD88
T5574 1396-1415 Entity denotes 0.8 µg/ml puromycin
T5573 57-68 Protein denotes human MyD88
T5572 571-576 Protein denotes TRAF6
T5571 281-354 Protein denotes primer 5′-AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3′ mRNA
T5570 925-945 Entity denotes transfection reagent
T5568 356-361 Protein denotes IRAK1
T5567 1345-1350 Entity denotes cells
T5590 362-366 Protein denotes mRNA
T5589 708-713 Protein denotes shRNA
T5588 1164-1191 Entity denotes supernatants from the virus
T5587 1111-1135 Entity denotes the lentiviral particles
T5586 872-876 Protein denotes PAX2
T5585 166-171 Protein denotes shRNA
T5584 1235-1244 Entity denotes polybrene
T5583 1149-1158 Entity denotes the cells
T5582 166-272 Protein denotes shRNA targeting human IRAK1 (forward primer 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,
T5580 972-984 Entity denotes Supernatants
T5579 1202-1207 Entity denotes cells
T5578 793-811 Protein denotes the shRNA-encoding
T5577 577-581 Protein denotes mRNA

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T5465 852-861 NN denotes packaging
T5464 848-851 DT denotes the
T5463 843-847 IN denotes with
T5462 831-842 NN denotes combination
T5461 828-830 IN denotes in
T5460 819-827 NNS denotes plasmids
T5459 816-818 CD denotes .1
T5458 812-816 NNP denotes pLKO
T5457 797-811 JJ denotes shRNA-encoding
T5456 793-796 DT denotes the
T5455 788-792 IN denotes with
T5454 779-787 NN denotes HEK-293T
T5453 774-778 NN denotes line
T5452 769-773 NN denotes cell
T5451 759-768 NN denotes packaging
T5450 755-758 DT denotes the
T5449 742-754 VBG denotes transfecting
T5448 739-741 IN denotes by
T5447 729-738 VBN denotes generated
T5446 724-728 VBD denotes were
T5445 714-723 NNS denotes sequences
T5444 708-713 NNP denotes shRNA
T5443 699-707 VBG denotes encoding
T5442 686-698 NNP denotes Lentiviruses
T5441 684-685 . denotes .
T5440 677-684 NN denotes plasmid
T5439 674-676 CD denotes .1
T5438 670-674 NNP denotes pLKO
T5437 666-669 DT denotes the
T5436 661-665 IN denotes into
T5435 654-660 VBN denotes cloned
T5434 649-653 VBD denotes were
T5433 645-648 CC denotes and
T5432 634-644 NN denotes laboratory
T5431 630-633 PRP$ denotes our
T5430 627-629 IN denotes in
T5429 618-626 VBN denotes designed
T5428 613-617 VBD denotes were
T5427 611-612 -RRB- denotes )
T5426 601-611 VBN denotes underlined
T5425 598-600 VBZ denotes is
T5424 589-597 NN denotes sequence
T5423 582-588 NN denotes target
T5422 577-581 NNP denotes mRNA
T5421 571-576 CD denotes TRAF6
T5420 570-571 -LRB- denotes (
T5419 568-569 NN denotes ′
T5418 511-568 NN denotes AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3
T5417 510-511 : denotes -
T5416 509-510 SYM denotes ′
T5415 508-509 CD denotes 5
T5414 501-507 NN denotes primer
T5413 493-500 VB denotes reverse
T5412 491-492 , denotes ,
T5411 490-491 NN denotes ′
T5410 433-490 NN denotes CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3
T5409 432-433 : denotes -
T5408 431-432 SYM denotes ′
T5407 430-431 CD denotes 5
T5406 423-429 JJR denotes primer
T5405 415-422 RB denotes forward
T5404 414-415 -LRB- denotes (
T5403 408-413 NNP denotes TRAF6
T5402 402-407 JJ denotes human
T5401 398-401 CC denotes and
T5400 396-397 -RRB- denotes )
T5399 386-396 VBN denotes underlined
T5398 383-385 VBZ denotes is
T5397 374-382 NN denotes sequence
T5396 367-373 NN denotes target
T5395 362-366 NNP denotes mRNA
T5394 356-361 NNP denotes IRAK1
T5393 355-356 -LRB- denotes (
T5392 350-354 NNP denotes mRNA
T5391 348-349 NN denotes ′
T5390 291-348 JJ denotes AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3
T5389 290-291 : denotes -
T5388 289-290 SYM denotes ′
T5387 288-289 CD denotes 5
T5386 281-287 NN denotes primer
T5385 273-280 VB denotes reverse
T5384 271-272 , denotes ,
T5383 270-271 NN denotes ′
T5382 213-270 NN denotes CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3
T5381 212-213 : denotes -
T5380 211-212 SYM denotes ′
T5379 210-211 CD denotes 5
T5378 203-209 JJR denotes primer
T5377 195-202 RB denotes forward
T5376 194-195 -LRB- denotes (
T5375 188-193 NNP denotes IRAK1
T5374 182-187 JJ denotes human
T5373 172-181 VBG denotes targeting
T5372 166-171 NNP denotes shRNA
T5371 164-165 . denotes .
T5370 154-164 NN denotes laboratory
T5369 150-153 PRP$ denotes our
T5366 133-136 VBD denotes was
T5365 129-132 CC denotes and
T5364 127-128 -RRB- denotes )
T5363 105-127 NN denotes www.openbiosystems.com
T5362 104-105 -LRB- denotes (
T5361 93-103 NNPS denotes Biosystems
T5360 88-92 NNP denotes Open
T5359 83-87 IN denotes from
T5358 73-82 VBN denotes purchased
T5357 69-72 VBD denotes was
T5356 63-68 NNP denotes MyD88
T5355 57-62 JJ denotes human
T5354 47-56 VBG denotes targeting
T5353 41-46 NNP denotes shRNA
T5352 30-40 VBG denotes expressing
T5351 27-29 CD denotes .1
T5350 23-27 NNP denotes pLKO
T5349 15-22 NN denotes plasmid
T5348 4-14 JJ denotes lentiviral
T5347 0-3 DT denotes The
T5557 1415-1416 . denotes .
T5556 1406-1415 NN denotes puromycin
T5555 1403-1405 NN denotes ml
T5554 1402-1403 NN denotes /
T5553 1400-1402 NN denotes µg
T5552 1396-1399 CD denotes 0.8
T5551 1391-1395 IN denotes with
T5550 1381-1390 NN denotes treatment
T5549 1378-1380 IN denotes by
T5548 1369-1377 VBN denotes expanded
T5547 1365-1368 CC denotes and
T5546 1356-1364 VBN denotes selected
T5545 1351-1355 VBD denotes were
T5544 1345-1350 NNS denotes cells
T5543 1334-1344 VBN denotes transduced
T5542 1321-1333 RB denotes Successfully
T5541 1319-1320 . denotes .
T5540 1316-1319 NNP denotes RPM
T5539 1311-1315 CD denotes 2000
T5538 1308-1310 IN denotes at
T5537 1302-1307 NNS denotes hours
T5536 1298-1301 CD denotes two
T5535 1294-1297 IN denotes for
T5534 1280-1293 NN denotes spinoculation
T5533 1276-1279 CC denotes and
T5532 1274-1275 -RRB- denotes )
T5531 1257-1274 NN denotes www.millipore.com
T5530 1255-1256 , denotes ,
T5529 1246-1255 NNP denotes Millipore
T5528 1245-1246 -LRB- denotes (
T5527 1235-1244 NN denotes polybrene
T5526 1232-1234 NN denotes ml
T5525 1231-1232 NN denotes /
T5524 1229-1231 NN denotes µg
T5523 1227-1228 CD denotes 8
T5522 1224-1226 IN denotes of
T5521 1215-1223 NN denotes presence
T5520 1211-1214 DT denotes the
T5519 1208-1210 IN denotes in
T5518 1202-1207 NNS denotes cells
T5517 1186-1201 JJ denotes virus-producing
T5516 1182-1185 DT denotes the
T5515 1177-1181 IN denotes from
T5514 1164-1176 NNS denotes supernatants
T5513 1159-1163 IN denotes with
T5512 1153-1158 NNS denotes cells
T5511 1149-1152 DT denotes the
T5510 1139-1148 VBG denotes culturing
T5509 1136-1138 IN denotes by
T5508 1126-1135 NNS denotes particles
T5507 1115-1125 JJ denotes lentiviral
T5506 1111-1114 DT denotes the
T5505 1106-1110 IN denotes with
T5504 1095-1105 VBN denotes transduced
T5503 1090-1094 VBD denotes were
T5502 1084-1089 NNS denotes cells
T5501 1078-1083 NNP denotes THP-1
T5500 1075-1077 NNP denotes C.
T5499 1074-1075 NNP denotes °
T5498 1072-1074 CD denotes 80
T5497 1071-1072 CD denotes −
T5496 1068-1070 IN denotes at
T5495 1061-1067 VBD denotes stored
T5494 1057-1060 CC denotes and
T5493 1055-1056 , denotes ,
T5492 1041-1055 NN denotes centrifugation
T5491 1038-1040 IN denotes by
T5490 1028-1037 VBN denotes clarified
T5489 1026-1027 , denotes ,
T5488 1009-1026 JJ denotes post-transfection
T5487 1003-1008 NNS denotes hours
T5486 1000-1002 CD denotes 48
T5485 990-999 VBN denotes collected
T5484 985-989 VBD denotes were
T5483 972-984 NNS denotes Supernatants
T5482 970-971 . denotes .
T5481 969-970 -RRB- denotes )
T5480 955-969 NN denotes www.qiagen.com
T5479 953-954 , denotes ,
T5478 947-953 NNP denotes Qiagen
T5477 946-947 -LRB- denotes (
T5476 938-945 NN denotes reagent
T5475 925-937 NN denotes transfection
T5474 915-924 NNP denotes Effectene
T5473 909-914 VBG denotes using
T5472 902-908 JJ denotes pMD2.G
T5471 894-901 VBD denotes plasmid
T5470 885-893 NN denotes envelope
T5469 881-884 DT denotes the
T5468 877-880 CC denotes and
T5467 870-876 NNP denotes psPAX2
T5466 862-869 VBD denotes plasmid
T5368 147-149 IN denotes in
T5367 137-146 VBN denotes validated
R4194 T5347 T5349 det The,plasmid
R4195 T5348 T5349 amod lentiviral,plasmid
R4196 T5349 T5358 nsubjpass plasmid,purchased
R4197 T5350 T5351 compound pLKO,.1
R4198 T5351 T5358 nsubjpass .1,purchased
R4199 T5352 T5351 advcl expressing,.1
R4200 T5353 T5354 nmod shRNA,targeting
R4201 T5354 T5358 nsubjpass targeting,purchased
R4202 T5355 T5356 compound human,MyD88
R4203 T5356 T5358 nsubjpass MyD88,purchased
R4204 T5357 T5358 auxpass was,purchased
R4205 T5358 T5358 ROOT purchased,purchased
R4206 T5359 T5358 prep from,purchased
R4207 T5360 T5361 compound Open,Biosystems
R4208 T5361 T5359 pobj Biosystems,from
R4209 T5362 T5361 punct (,Biosystems
R4210 T5363 T5361 appos www.openbiosystems.com,Biosystems
R4211 T5364 T5361 punct ),Biosystems
R4212 T5365 T5358 cc and,purchased
R4213 T5366 T5367 auxpass was,validated
R4214 T5367 T5358 conj validated,purchased
R4215 T5368 T5367 prep in,validated
R4216 T5369 T5370 poss our,laboratory
R4217 T5370 T5368 pobj laboratory,in
R4218 T5371 T5358 punct .,purchased
R4219 T5372 T5429 nsubjpass shRNA,designed
R4220 T5373 T5372 acl targeting,shRNA
R4221 T5374 T5375 compound human,IRAK1
R4222 T5375 T5373 dobj IRAK1,targeting
R4223 T5376 T5378 punct (,primer
R4224 T5377 T5378 advmod forward,primer
R4225 T5378 T5373 parataxis primer,targeting
R4226 T5379 T5382 nummod 5,CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3
R4227 T5380 T5382 punct ′,CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3
R4228 T5381 T5382 punct -,CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3
R4229 T5382 T5383 compound CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3,′
R4230 T5383 T5378 dobj ′,primer
R4231 T5384 T5378 punct ",",primer
R4232 T5385 T5390 ccomp reverse,AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3
R4233 T5386 T5385 dobj primer,reverse
R4234 T5387 T5386 nummod 5,primer
R4235 T5388 T5390 punct ′,AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3
R4236 T5389 T5390 punct -,AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3
R4237 T5390 T5392 amod AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3,mRNA
R4238 T5391 T5392 compound ′,mRNA
R4239 T5392 T5411 nmod mRNA,′
R4240 T5393 T5399 punct (,underlined
R4241 T5394 T5395 compound IRAK1,mRNA
R4242 T5395 T5397 compound mRNA,sequence
R4243 T5396 T5397 compound target,sequence
R4244 T5397 T5399 nsubjpass sequence,underlined
R4245 T5398 T5399 auxpass is,underlined
R4246 T5399 T5392 parataxis underlined,mRNA
R4247 T5400 T5399 punct ),underlined
R4248 T5401 T5399 cc and,underlined
R4249 T5402 T5403 amod human,TRAF6
R4250 T5403 T5392 conj TRAF6,mRNA
R4251 T5404 T5406 punct (,primer
R4252 T5405 T5406 advmod forward,primer
R4253 T5406 T5392 appos primer,mRNA
R4254 T5407 T5410 nummod 5,CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3
R4255 T5408 T5410 punct ′,CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3
R4256 T5409 T5410 punct -,CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3
R4257 T5410 T5411 compound CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3,′
R4258 T5411 T5378 dep ′,primer
R4259 T5412 T5378 punct ",",primer
R4260 T5413 T5429 nsubjpass reverse,designed
R4261 T5414 T5419 nmod primer,′
R4262 T5415 T5414 nummod 5,primer
R4263 T5416 T5418 punct ′,AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3
R4264 T5417 T5418 punct -,AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3
R4265 T5418 T5419 compound AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3,′
R4266 T5419 T5413 dobj ′,reverse
R4267 T5420 T5426 punct (,underlined
R4268 T5421 T5424 nummod TRAF6,sequence
R4269 T5422 T5424 compound mRNA,sequence
R4270 T5423 T5424 compound target,sequence
R4271 T5424 T5426 nsubjpass sequence,underlined
R4272 T5425 T5426 auxpass is,underlined
R4273 T5426 T5413 parataxis underlined,reverse
R4274 T5427 T5426 punct ),underlined
R4275 T5428 T5429 auxpass were,designed
R4276 T5429 T5429 ROOT designed,designed
R4277 T5430 T5429 prep in,designed
R4278 T5431 T5432 poss our,laboratory
R4279 T5432 T5430 pobj laboratory,in
R4280 T5433 T5429 cc and,designed
R4281 T5434 T5435 auxpass were,cloned
R4282 T5435 T5429 conj cloned,designed
R4283 T5436 T5435 prep into,cloned
R4284 T5437 T5440 det the,plasmid
R4285 T5438 T5440 nmod pLKO,plasmid
R4286 T5439 T5440 nummod .1,plasmid
R4287 T5440 T5436 pobj plasmid,into
R4288 T5441 T5429 punct .,designed
R4289 T5442 T5447 nsubjpass Lentiviruses,generated
R4290 T5443 T5445 amod encoding,sequences
R4291 T5444 T5445 compound shRNA,sequences
R4292 T5445 T5447 nsubjpass sequences,generated
R4293 T5446 T5447 auxpass were,generated
R4294 T5447 T5447 ROOT generated,generated
R4295 T5448 T5447 prep by,generated
R4296 T5449 T5448 pcomp transfecting,by
R4297 T5450 T5454 det the,HEK-293T
R4298 T5451 T5452 compound packaging,cell
R4299 T5452 T5453 compound cell,line
R4300 T5453 T5454 compound line,HEK-293T
R4301 T5454 T5449 dobj HEK-293T,transfecting
R4302 T5455 T5449 prep with,transfecting
R4303 T5456 T5460 det the,plasmids
R4304 T5457 T5460 amod shRNA-encoding,plasmids
R4305 T5458 T5460 compound pLKO,plasmids
R4306 T5459 T5460 nummod .1,plasmids
R4307 T5460 T5455 pobj plasmids,with
R4308 T5461 T5460 prep in,plasmids
R4309 T5462 T5461 pobj combination,in
R4310 T5463 T5460 prep with,plasmids
R4311 T5464 T5465 det the,packaging
R4312 T5465 T5466 compound packaging,plasmid
R4313 T5466 T5467 compound plasmid,psPAX2
R4314 T5467 T5463 pobj psPAX2,with
R4315 T5468 T5467 cc and,psPAX2
R4316 T5469 T5470 det the,envelope
R4317 T5470 T5467 conj envelope,psPAX2
R4318 T5471 T5448 pobj plasmid,by
R4319 T5472 T5473 acomp pMD2.G,using
R4320 T5473 T5471 advcl using,plasmid
R4321 T5474 T5476 nmod Effectene,reagent
R4322 T5475 T5476 compound transfection,reagent
R4323 T5476 T5473 dobj reagent,using
R4324 T5477 T5478 punct (,Qiagen
R4325 T5478 T5476 appos Qiagen,reagent
R4326 T5479 T5478 punct ",",Qiagen
R4327 T5480 T5478 appos www.qiagen.com,Qiagen
R4328 T5481 T5478 punct ),Qiagen
R4329 T5482 T5447 punct .,generated
R4330 T5483 T5485 nsubjpass Supernatants,collected
R4331 T5484 T5485 auxpass were,collected
R4332 T5485 T5485 ROOT collected,collected
R4333 T5486 T5487 nummod 48,hours
R4334 T5487 T5488 compound hours,post-transfection
R4335 T5488 T5485 oprd post-transfection,collected
R4336 T5489 T5488 punct ",",post-transfection
R4337 T5490 T5488 acl clarified,post-transfection
R4338 T5491 T5490 agent by,clarified
R4339 T5492 T5491 pobj centrifugation,by
R4340 T5493 T5485 punct ",",collected
R4341 T5494 T5485 cc and,collected
R4342 T5495 T5485 conj stored,collected
R4343 T5496 T5495 prep at,stored
R4344 T5497 T5496 pobj −,at
R4345 T5498 T5502 nummod 80,cells
R4346 T5499 T5501 compound °,THP-1
R4347 T5500 T5501 compound C.,THP-1
R4348 T5501 T5502 compound THP-1,cells
R4349 T5502 T5504 nsubjpass cells,transduced
R4350 T5503 T5504 auxpass were,transduced
R4351 T5504 T5485 conj transduced,collected
R4352 T5505 T5504 prep with,transduced
R4353 T5506 T5508 det the,particles
R4354 T5507 T5508 amod lentiviral,particles
R4355 T5508 T5505 pobj particles,with
R4356 T5509 T5504 prep by,transduced
R4357 T5510 T5509 pcomp culturing,by
R4358 T5511 T5512 det the,cells
R4359 T5512 T5510 dobj cells,culturing
R4360 T5513 T5510 prep with,culturing
R4361 T5514 T5513 pobj supernatants,with
R4362 T5515 T5514 prep from,supernatants
R4363 T5516 T5518 det the,cells
R4364 T5517 T5518 amod virus-producing,cells
R4365 T5518 T5515 pobj cells,from
R4366 T5519 T5518 prep in,cells
R4367 T5520 T5521 det the,presence
R4368 T5521 T5519 pobj presence,in
R4369 T5522 T5521 prep of,presence
R4370 T5523 T5522 pobj 8,of
R4371 T5524 T5535 meta µg,for
R4372 T5525 T5527 nmod /,polybrene
R4373 T5526 T5527 compound ml,polybrene
R4374 T5527 T5524 appos polybrene,µg
R4375 T5528 T5529 punct (,Millipore
R4376 T5529 T5527 appos Millipore,polybrene
R4377 T5530 T5529 punct ",",Millipore
R4378 T5531 T5529 appos www.millipore.com,Millipore
R4379 T5532 T5531 punct ),www.millipore.com
R4380 T5533 T5529 cc and,Millipore
R4381 T5534 T5535 meta spinoculation,for
R4382 T5535 T5504 prep for,transduced
R4383 T5536 T5537 nummod two,hours
R4384 T5537 T5535 pobj hours,for
R4385 T5538 T5537 prep at,hours
R4386 T5539 T5540 nummod 2000,RPM
R4387 T5540 T5538 pobj RPM,at
R4388 T5541 T5504 punct .,transduced
R4389 T5542 T5543 advmod Successfully,transduced
R4390 T5543 T5544 amod transduced,cells
R4391 T5544 T5546 nsubjpass cells,selected
R4392 T5545 T5546 auxpass were,selected
R4393 T5546 T5546 ROOT selected,selected
R4394 T5547 T5546 cc and,selected
R4395 T5548 T5546 conj expanded,selected
R4396 T5549 T5548 prep by,expanded
R4397 T5550 T5549 pobj treatment,by
R4398 T5551 T5548 prep with,expanded
R4399 T5552 T5553 nummod 0.8,µg
R4400 T5553 T5556 nmod µg,puromycin
R4401 T5554 T5556 nmod /,puromycin
R4402 T5555 T5556 compound ml,puromycin
R4403 T5556 T5551 pobj puromycin,with
R4404 T5557 T5546 punct .,selected

bionlp-st-ge-2016-test-tees

Id Subject Object Predicate Lexical cue
T5335 571-576 Protein denotes TRAF6
T5334 402-413 Protein denotes human TRAF6
T5333 356-361 Protein denotes IRAK1
T5332 182-193 Protein denotes human IRAK1
T5331 30-40 Gene_expression denotes expressing
T5330 63-68 Protein denotes MyD88
R4187 T5330 T5331 themeOf MyD88,expressing

testone

Id Subject Object Predicate Lexical cue
T5052 571-576 Protein denotes TRAF6
T5051 408-413 Protein denotes TRAF6
T5050 356-361 Protein denotes IRAK1
T5049 188-193 Protein denotes IRAK1
T5048 63-68 Protein denotes MyD88
T5047 41-46 Protein denotes shRNA

test3

Id Subject Object Predicate Lexical cue
T5067 571-576 Protein denotes TRAF6
T5066 408-413 Protein denotes TRAF6
T5065 356-361 Protein denotes IRAK1
T5064 188-193 Protein denotes IRAK1
T5063 63-68 Protein denotes MyD88
T5062 41-46 Protein denotes shRNA
T5059 571-576 Protein denotes TRAF6
T5058 408-413 Protein denotes TRAF6
T5057 356-361 Protein denotes IRAK1
T5056 188-193 Protein denotes IRAK1
T5055 63-68 Protein denotes MyD88
T5054 41-46 Protein denotes shRNA