> top > docs > PMC:3320587 > spans > 11194-12646 > annotations

PMC:3320587 / 11194-12646 JSONTXT

Annnotations TAB JSON ListView MergeView

pmc-enju-pas

Id Subject Object Predicate Lexical cue
T5158 434-437 CC denotes and
T5293 1442-1451 NN denotes puromycin
T5292 1436-1441 NN denotes µg/ml
T5291 1432-1435 CD denotes 0.8
T5290 1427-1431 IN denotes with
T5289 1417-1426 NN denotes treatment
T5288 1414-1416 IN denotes by
T5287 1405-1413 VB denotes expanded
T5286 1401-1404 CC denotes and
T5285 1392-1400 VB denotes selected
T5284 1387-1391 VB denotes were
T5283 1381-1386 NN denotes cells
T5282 1370-1380 VB denotes transduced
T5281 1357-1369 RB denotes Successfully
T5280 1352-1355 NN denotes RPM
T5279 1347-1351 CD denotes 2000
T5278 1344-1346 IN denotes at
T5277 1338-1343 NN denotes hours
T5276 1334-1337 CD denotes two
T5275 1330-1333 IN denotes for
T5274 1316-1329 NN denotes spinoculation
T5273 1312-1315 CC denotes and
T5272 1310-1311 -RRB- denotes )
T5271 1293-1310 NN denotes www.millipore.com
T5270 1291-1292 -COMMA- denotes ,
T5269 1282-1291 NNP denotes Millipore
T5268 1281-1282 -LRB- denotes (
T5267 1271-1280 NN denotes polybrene
T5266 1265-1270 NN denotes µg/ml
T5265 1263-1264 CD denotes 8
T5264 1260-1262 IN denotes of
T5263 1251-1259 NN denotes presence
T5262 1247-1250 DT denotes the
T5261 1244-1246 IN denotes in
T5260 1238-1243 NN denotes cells
T5259 1222-1237 JJ denotes virus-producing
T5258 1218-1221 DT denotes the
T5257 1213-1217 IN denotes from
T5256 1200-1212 NN denotes supernatants
T5255 1195-1199 IN denotes with
T5254 1189-1194 NN denotes cells
T5253 1185-1188 DT denotes the
T5252 1175-1184 VB denotes culturing
T5251 1172-1174 IN denotes by
T5250 1162-1171 NN denotes particles
T5157 432-433 -RRB- denotes )
T5156 422-432 VB denotes underlined
T5155 419-421 VB denotes is
T5154 410-418 NN denotes sequence
T5153 403-409 NN denotes target
T5152 398-402 NN denotes mRNA
T5151 392-397 NN denotes IRAK1
T5150 391-392 -LRB- denotes (
T5149 386-390 NN denotes mRNA
T5148 324-385 NN denotes 5′-AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3′
T5147 317-323 NN denotes primer
T5146 309-316 JJ denotes reverse
T5145 307-308 -COMMA- denotes ,
T5144 246-307 NN denotes 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′
T5143 239-245 NN denotes primer
T5142 231-238 JJ denotes forward
T5141 230-231 -LRB- denotes (
T5140 224-229 NN denotes IRAK1
T5139 218-223 JJ denotes human
T5138 208-217 VB denotes targeting
T5137 202-207 NN denotes shRNA
T5136 190-201 NN denotes laboratory.
T5135 186-189 PRP-DOLLAR- denotes our
T5134 183-185 IN denotes in
T5133 173-182 VB denotes validated
T5132 169-172 VB denotes was
T5131 165-168 CC denotes and
T5130 163-164 -RRB- denotes )
T5129 141-163 NN denotes www.openbiosystems.com
T5128 140-141 -LRB- denotes (
T5127 129-139 NNP denotes Biosystems
T5126 124-128 NNP denotes Open
T5125 119-123 IN denotes from
T5124 109-118 VB denotes purchased
T5123 105-108 VB denotes was
T5122 99-104 NN denotes MyD88
T5121 93-98 JJ denotes human
T5120 83-92 VB denotes targeting
T5119 77-82 NN denotes shRNA
T5118 66-76 VB denotes expressing
T5117 59-65 NN denotes pLKO.1
T5116 51-58 NN denotes plasmid
T5115 40-50 JJ denotes lentiviral
T5114 36-39 DT denotes The
T5113 30-35 NN denotes shRNA
T5112 19-29 VB denotes expressing
T5111 13-18 NN denotes cells
T5110 7-12 NN denotes THP-1
T5109 0-6 JJ denotes Stable
T5249 1151-1161 JJ denotes lentiviral
T5248 1147-1150 DT denotes the
T5247 1142-1146 IN denotes with
T5246 1131-1141 VB denotes transduced
T5245 1126-1130 VB denotes were
T5244 1120-1125 NN denotes cells
T5243 1114-1119 NN denotes THP-1
T5242 1107-1113 NN denotes −80°C.
T5241 1104-1106 IN denotes at
T5240 1097-1103 VB denotes stored
T5239 1093-1096 CC denotes and
T5238 1091-1092 -COMMA- denotes ,
T5237 1077-1091 NN denotes centrifugation
T5236 1074-1076 IN denotes by
T5235 1064-1073 VB denotes clarified
T5234 1062-1063 -COMMA- denotes ,
T5233 1045-1062 JJ denotes post-transfection
T5232 1039-1044 NN denotes hours
T5231 1036-1038 CD denotes 48
T5230 1026-1035 VB denotes collected
T5229 1021-1025 VB denotes were
T5228 1008-1020 NN denotes Supernatants
T5227 1005-1006 -RRB- denotes )
T5226 991-1005 NN denotes www.qiagen.com
T5225 989-990 -COMMA- denotes ,
T5224 983-989 NN denotes Qiagen
T5223 982-983 -LRB- denotes (
T5222 974-981 NN denotes reagent
T5221 961-973 NN denotes transfection
T5220 951-960 NN denotes Effectene
T5219 945-950 VB denotes using
T5218 938-944 NN denotes pMD2.G
T5217 930-937 NN denotes plasmid
T5216 921-929 NN denotes envelope
T5215 917-920 DT denotes the
T5214 913-916 CC denotes and
T5213 906-912 NN denotes psPAX2
T5212 898-905 NN denotes plasmid
T5211 888-897 NN denotes packaging
T5210 884-887 DT denotes the
T5209 879-883 IN denotes with
T5208 867-878 NN denotes combination
T5207 864-866 IN denotes in
T5206 855-863 NN denotes plasmids
T5205 848-854 NN denotes pLKO.1
T5204 833-847 JJ denotes shRNA-encoding
T5203 829-832 DT denotes the
T5202 824-828 IN denotes with
T5201 815-823 NN denotes HEK-293T
T5200 810-814 NN denotes line
T5199 805-809 NN denotes cell
T5198 795-804 NN denotes packaging
T5197 791-794 DT denotes the
T5196 778-790 VB denotes transfecting
T5195 775-777 IN denotes by
T5194 765-774 VB denotes generated
T5193 760-764 VB denotes were
T5192 750-759 NN denotes sequences
T5191 744-749 NN denotes shRNA
T5190 735-743 VB denotes encoding
T5189 722-734 NN denotes Lentiviruses
T5188 713-720 NN denotes plasmid
T5187 706-712 NN denotes pLKO.1
T5186 702-705 DT denotes the
T5185 697-701 IN denotes into
T5184 690-696 VB denotes cloned
T5183 685-689 VB denotes were
T5182 681-684 CC denotes and
T5181 670-680 NN denotes laboratory
T5180 666-669 PRP-DOLLAR- denotes our
T5179 663-665 IN denotes in
T5178 654-662 VB denotes designed
T5177 649-653 VB denotes were
T5176 647-648 -RRB- denotes )
T5175 637-647 VB denotes underlined
T5174 634-636 VB denotes is
T5173 625-633 NN denotes sequence
T5172 618-624 NN denotes target
T5171 613-617 NN denotes mRNA
T5170 607-612 NN denotes TRAF6
T5169 606-607 -LRB- denotes (
T5168 544-605 NN denotes 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′
T5167 537-543 NN denotes primer
T5166 529-536 JJ denotes reverse
T5165 527-528 -COMMA- denotes ,
T5164 466-527 NN denotes 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′
T5163 459-465 NN denotes primer
T5162 451-458 JJ denotes forward
T5161 450-451 -LRB- denotes (
T5160 444-449 NN denotes TRAF6
T5159 438-443 JJ denotes human
R3983 T5111 T5109 arg1Of cells,Stable
R3984 T5111 T5110 arg1Of cells,THP-1
R3985 T5111 T5112 arg1Of cells,expressing
R3986 T5113 T5112 arg2Of shRNA,expressing
R3987 T5117 T5114 arg1Of pLKO.1,The
R3988 T5117 T5115 arg1Of pLKO.1,lentiviral
R3989 T5117 T5116 arg1Of pLKO.1,plasmid
R3990 T5117 T5118 arg1Of pLKO.1,expressing
R3991 T5117 T5123 arg1Of pLKO.1,was
R3992 T5117 T5124 arg2Of pLKO.1,purchased
R3993 T5117 T5132 arg1Of pLKO.1,was
R3995 T5117 T5183 arg1Of pLKO.1,were
R3996 T5117 T5184 arg2Of pLKO.1,cloned
R3997 T5119 T5118 arg2Of shRNA,expressing
R3998 T5119 T5120 arg1Of shRNA,targeting
R3999 T5122 T5120 arg2Of MyD88,targeting
R4000 T5122 T5121 arg1Of MyD88,human
R4001 T5124 T5123 arg2Of purchased,was
R4002 T5124 T5125 arg1Of purchased,from
R4003 T5124 T5131 arg1Of purchased,and
R4004 T5127 T5125 arg2Of Biosystems,from
R4005 T5127 T5126 arg1Of Biosystems,Open
R4006 T5127 T5128 arg1Of Biosystems,(
R4007 T5129 T5128 arg2Of www.openbiosystems.com,(
R4008 T5130 T5128 arg3Of ),(
R4009 T5133 T5132 arg2Of validated,was
R4010 T5133 T5134 arg1Of validated,in
R4011 T5133 T5182 arg1Of validated,and
R4012 T5137 T5134 arg2Of shRNA,in
R4013 T5137 T5135 arg1Of shRNA,our
R4014 T5137 T5136 arg1Of shRNA,laboratory.
R4015 T5137 T5138 arg1Of shRNA,targeting
R4016 T5144 T5139 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,human
R4017 T5144 T5140 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,IRAK1
R4018 T5144 T5141 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,(
R4019 T5144 T5142 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,forward
R4020 T5144 T5143 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,primer
R4021 T5144 T5145 arg1Of 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,","
R4022 T5145 T5158 arg1Of ",",and
R4023 T5149 T5145 arg2Of mRNA,","
R4024 T5149 T5146 arg1Of mRNA,reverse
R4025 T5149 T5147 arg1Of mRNA,primer
R4026 T5149 T5148 arg1Of mRNA,5′-AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3′
R4027 T5149 T5150 arg1Of mRNA,(
R4028 T5154 T5151 arg1Of sequence,IRAK1
R4029 T5154 T5152 arg1Of sequence,mRNA
R4030 T5154 T5153 arg1Of sequence,target
R4031 T5154 T5155 arg1Of sequence,is
R4032 T5154 T5156 arg2Of sequence,underlined
R4033 T5156 T5150 arg2Of underlined,(
R4034 T5156 T5155 arg2Of underlined,is
R4035 T5157 T5150 arg3Of ),(
R4036 T5158 T5138 arg2Of and,targeting
R4037 T5158 T5177 modOf and,were
R4038 T5164 T5158 arg2Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,and
R4039 T5164 T5159 arg1Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,human
R4040 T5164 T5160 arg1Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,TRAF6
R4041 T5164 T5161 arg1Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,(
R4042 T5164 T5162 arg1Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,forward
R4043 T5164 T5163 arg1Of 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,primer
R4044 T5168 T5166 arg1Of 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′,reverse
R4045 T5168 T5167 arg1Of 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′,primer
R4046 T5168 T5169 arg1Of 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′,(
R4047 T5168 T5177 arg1Of 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′,were
R4048 T5168 T5178 arg2Of 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′,designed
R4049 T5173 T5170 arg1Of sequence,TRAF6
R4050 T5173 T5171 arg1Of sequence,mRNA
R4051 T5173 T5172 arg1Of sequence,target
R4052 T5173 T5174 arg1Of sequence,is
R4053 T5173 T5175 arg2Of sequence,underlined
R4054 T5175 T5169 arg2Of underlined,(
R4055 T5175 T5174 arg2Of underlined,is
R4056 T5176 T5169 arg3Of ),(
R4057 T5178 T5165 arg1Of designed,","
R4058 T5178 T5177 arg2Of designed,were
R4059 T5178 T5179 arg1Of designed,in
R4060 T5181 T5179 arg2Of laboratory,in
R4061 T5181 T5180 arg1Of laboratory,our
R4062 T5182 T5131 arg2Of and,and
R4063 T5184 T5182 arg2Of cloned,and
R4064 T5184 T5183 arg2Of cloned,were
R4065 T5184 T5185 arg1Of cloned,into
R4066 T5188 T5185 arg2Of plasmid,into
R4067 T5188 T5186 arg1Of plasmid,the
R4068 T5188 T5187 arg1Of plasmid,pLKO.1
R4069 T5189 T5190 arg1Of Lentiviruses,encoding
R4070 T5189 T5193 arg1Of Lentiviruses,were
R4071 T5189 T5194 arg2Of Lentiviruses,generated
R4072 T5192 T5190 arg2Of sequences,encoding
R4073 T5192 T5191 arg1Of sequences,shRNA
R4074 T5194 T5193 arg2Of generated,were
R4075 T5194 T5195 arg1Of generated,by
R4076 T5196 T5195 arg2Of transfecting,by
R4077 T5196 T5202 arg1Of transfecting,with
R4078 T5201 T5196 arg2Of HEK-293T,transfecting
R4079 T5201 T5197 arg1Of HEK-293T,the
R4080 T5201 T5198 arg1Of HEK-293T,packaging
R4081 T5201 T5199 arg1Of HEK-293T,cell
R4082 T5201 T5200 arg1Of HEK-293T,line
R4083 T5206 T5202 arg2Of plasmids,with
R4084 T5206 T5203 arg1Of plasmids,the
R4085 T5206 T5204 arg1Of plasmids,shRNA-encoding
R4086 T5206 T5205 arg1Of plasmids,pLKO.1
R4087 T5206 T5207 arg1Of plasmids,in
R4088 T5208 T5207 arg2Of combination,in
R4089 T5208 T5209 arg1Of combination,with
R4090 T5213 T5210 arg1Of psPAX2,the
R4091 T5213 T5211 arg1Of psPAX2,packaging
R4092 T5213 T5212 arg1Of psPAX2,plasmid
R4093 T5213 T5214 arg1Of psPAX2,and
R4094 T5214 T5209 arg2Of and,with
R4095 T5218 T5214 arg2Of pMD2.G,and
R4096 T5218 T5215 arg1Of pMD2.G,the
R4097 T5218 T5216 arg1Of pMD2.G,envelope
R4098 T5218 T5217 arg1Of pMD2.G,plasmid
R4099 T5218 T5219 arg1Of pMD2.G,using
R4100 T5222 T5219 arg2Of reagent,using
R4101 T5222 T5220 arg1Of reagent,Effectene
R4102 T5222 T5221 arg1Of reagent,transfection
R4103 T5222 T5223 arg1Of reagent,(
R4104 T5224 T5223 arg2Of Qiagen,(
R4105 T5224 T5225 arg1Of Qiagen,","
R4106 T5226 T5225 arg2Of www.qiagen.com,","
R4107 T5227 T5223 arg3Of ),(
R4108 T5228 T5229 arg1Of Supernatants,were
R4109 T5228 T5230 arg2Of Supernatants,collected
R4110 T5228 T5235 arg2Of Supernatants,clarified
R4111 T5230 T5229 arg2Of collected,were
R4112 T5230 T5232 arg1Of collected,hours
R4113 T5230 T5233 arg1Of collected,post-transfection
R4114 T5230 T5234 arg1Of collected,","
R4115 T5230 T5235 modOf collected,clarified
R4116 T5230 T5239 arg1Of collected,and
R4117 T5232 T5231 arg1Of hours,48
R4118 T5237 T5235 arg1Of centrifugation,clarified
R4119 T5237 T5236 arg2Of centrifugation,by
R4120 T5239 T5238 arg1Of and,","
R4121 T5240 T5241 arg1Of stored,at
R4122 T5242 T5240 arg2Of −80°C.,stored
R4123 T5242 T5245 modOf −80°C.,were
R4124 T5244 T5243 arg1Of cells,THP-1
R4125 T5244 T5245 arg1Of cells,were
R4126 T5244 T5246 arg2Of cells,transduced
R4127 T5244 T5252 arg1Of cells,culturing
R4128 T5246 T5245 arg2Of transduced,were
R4129 T5246 T5247 arg1Of transduced,with
R4130 T5246 T5251 arg1Of transduced,by
R4131 T5250 T5247 arg2Of particles,with
R4132 T5250 T5248 arg1Of particles,the
R4133 T5250 T5249 arg1Of particles,lentiviral
R4134 T5252 T5251 arg2Of culturing,by
R4135 T5252 T5255 arg1Of culturing,with
R4136 T5252 T5261 arg1Of culturing,in
R4137 T5254 T5252 arg2Of cells,culturing
R4138 T5254 T5253 arg1Of cells,the
R4139 T5256 T5255 arg2Of supernatants,with
R4140 T5256 T5257 arg1Of supernatants,from
R4141 T5260 T5257 arg2Of cells,from
R4142 T5260 T5258 arg1Of cells,the
R4143 T5260 T5259 arg1Of cells,virus-producing
R4144 T5261 T5262 arg1Of in,the
R4145 T5261 T5264 arg1Of in,of
R4146 T5263 T5261 arg2Of presence,in
R4147 T5267 T5265 arg1Of polybrene,8
R4148 T5267 T5266 arg1Of polybrene,µg/ml
R4149 T5267 T5268 arg1Of polybrene,(
R4150 T5267 T5273 arg1Of polybrene,and
R4151 T5269 T5268 arg2Of Millipore,(
R4152 T5269 T5270 arg1Of Millipore,","
R4153 T5271 T5270 arg2Of www.millipore.com,","
R4154 T5272 T5268 arg3Of ),(
R4155 T5273 T5242 arg1Of and,−80°C.
R4156 T5273 T5278 arg1Of and,at
R4157 T5274 T5273 arg2Of spinoculation,and
R4158 T5274 T5275 arg1Of spinoculation,for
R4159 T5277 T5275 arg2Of hours,for
R4160 T5277 T5276 arg1Of hours,two
R4161 T5278 T5239 arg2Of at,and
R4162 T5280 T5278 arg2Of RPM,at
R4163 T5280 T5279 arg1Of RPM,2000
R4164 T5282 T5281 arg1Of transduced,Successfully
R4165 T5283 T5282 arg1Of cells,transduced
R4166 T5283 T5284 arg1Of cells,were
R4167 T5283 T5285 arg2Of cells,selected
R4168 T5283 T5287 arg2Of cells,expanded
R4169 T5285 T5286 arg1Of selected,and
R4170 T5286 T5284 arg2Of and,were
R4171 T5287 T5286 arg2Of expanded,and
R4172 T5289 T5285 arg1Of treatment,selected
R4173 T5289 T5287 arg1Of treatment,expanded
R4174 T5289 T5288 arg2Of treatment,by
R4175 T5289 T5290 arg1Of treatment,with
R4176 T5291 T5292 arg1Of 0.8,µg/ml
R4177 T5293 T5290 arg2Of puromycin,with
R4178 T5293 T5291 arg1Of puromycin,0.8
R3994 T5117 T5133 arg2Of pLKO.1,validated

bionlp-st-ge-2016-test-proteins

Id Subject Object Predicate Lexical cue
T5095 607-612 Protein denotes TRAF6
T5094 444-449 Protein denotes TRAF6
T5093 392-397 Protein denotes IRAK1
T5092 224-229 Protein denotes IRAK1
T5091 99-104 Protein denotes MyD88
T5090 77-82 Protein denotes shRNA
T5089 30-35 Protein denotes shRNA

bionlp-st-ge-2016-uniprot

Id Subject Object Predicate Lexical cue
T5296 607-612 http://www.uniprot.org/uniprot/Q9Y4K3 denotes TRAF6
T5295 444-449 http://www.uniprot.org/uniprot/Q9Y4K3 denotes TRAF6
T5294 99-104 http://www.uniprot.org/uniprot/Q99836 denotes MyD88

GO-CC

Id Subject Object Predicate Lexical cue
T5101 921-929 http://purl.obolibrary.org/obo/GO_0009274 denotes envelope
T5100 1381-1386 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T5099 1238-1243 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T5098 1189-1194 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T5097 1120-1125 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T5096 13-18 http://purl.obolibrary.org/obo/GO_0005623 denotes cells

sentences

Id Subject Object Predicate Lexical cue
T5072 1357-1452 Sentence denotes Successfully transduced cells were selected and expanded by treatment with 0.8 µg/ml puromycin.
T5071 1008-1356 Sentence denotes Supernatants were collected 48 hours post-transfection, clarified by centrifugation, and stored at −80°C. THP-1 cells were transduced with the lentiviral particles by culturing the cells with supernatants from the virus-producing cells in the presence of 8 µg/ml polybrene (Millipore, www.millipore.com) and spinoculation for two hours at 2000 RPM.
T5070 722-1007 Sentence denotes Lentiviruses encoding shRNA sequences were generated by transfecting the packaging cell line HEK-293T with the shRNA-encoding pLKO.1 plasmids in combination with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G using Effectene transfection reagent (Qiagen, www.qiagen.com).
T5069 36-721 Sentence denotes The lentiviral plasmid pLKO.1 expressing shRNA targeting human MyD88 was purchased from Open Biosystems (www.openbiosystems.com) and was validated in our laboratory. shRNA targeting human IRAK1 (forward primer 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′, reverse primer 5′-AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3′ mRNA (IRAK1 mRNA target sequence is underlined) and human TRAF6 (forward primer 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′, reverse primer 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′ (TRAF6 mRNA target sequence is underlined) were designed in our laboratory and were cloned into the pLKO.1 plasmid.
T5068 0-35 Sentence denotes Stable THP-1 cells expressing shRNA
T71 0-35 Sentence denotes Stable THP-1 cells expressing shRNA
T72 36-721 Sentence denotes The lentiviral plasmid pLKO.1 expressing shRNA targeting human MyD88 was purchased from Open Biosystems (www.openbiosystems.com) and was validated in our laboratory. shRNA targeting human IRAK1 (forward primer 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′, reverse primer 5′-AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3′ mRNA (IRAK1 mRNA target sequence is underlined) and human TRAF6 (forward primer 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′, reverse primer 5′-AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3′ (TRAF6 mRNA target sequence is underlined) were designed in our laboratory and were cloned into the pLKO.1 plasmid.
T73 722-1007 Sentence denotes Lentiviruses encoding shRNA sequences were generated by transfecting the packaging cell line HEK-293T with the shRNA-encoding pLKO.1 plasmids in combination with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G using Effectene transfection reagent (Qiagen, www.qiagen.com).
T74 1008-1113 Sentence denotes Supernatants were collected 48 hours post-transfection, clarified by centrifugation, and stored at −80°C.
T75 1114-1356 Sentence denotes THP-1 cells were transduced with the lentiviral particles by culturing the cells with supernatants from the virus-producing cells in the presence of 8 µg/ml polybrene (Millipore, www.millipore.com) and spinoculation for two hours at 2000 RPM.
T76 1357-1452 Sentence denotes Successfully transduced cells were selected and expanded by treatment with 0.8 µg/ml puromycin.

simple1

Id Subject Object Predicate Lexical cue
T5108 607-612 Protein denotes TRAF6
T5107 444-449 Protein denotes TRAF6
T5106 392-397 Protein denotes IRAK1
T5105 224-229 Protein denotes IRAK1
T5104 99-104 Protein denotes MyD88
T5103 77-82 Protein denotes shRNA
T5102 30-35 Protein denotes shRNA

BioNLP16_DUT

Id Subject Object Predicate Lexical cue
T5566 66-76 Gene_expression denotes expressing
T5565 19-29 Gene_expression denotes expressing
T5564 607-612 Protein denotes TRAF6
T5563 444-449 Protein denotes TRAF6
T5562 392-397 Protein denotes IRAK1
T5561 224-229 Protein denotes IRAK1
T5560 99-104 Protein denotes MyD88
T5559 77-82 Protein denotes shRNA
T5558 30-35 Protein denotes shRNA
R4405 T5558 T5565 themeOf shRNA,expressing
R4406 T5559 T5566 themeOf shRNA,expressing
R4407 T5560 T5566 themeOf MyD88,expressing

BioNLP16_Messiy

Id Subject Object Predicate Lexical cue
T5321 66-76 Gene_expression denotes expressing
T5320 19-29 Gene_expression denotes expressing
T5319 607-612 Protein denotes TRAF6
T5318 444-449 Protein denotes TRAF6
T5317 392-397 Protein denotes IRAK1
T5316 224-229 Protein denotes IRAK1
T5315 99-104 Protein denotes MyD88
T5314 77-82 Protein denotes shRNA
T5313 30-35 Protein denotes shRNA
R4182 T5313 T5320 themeOf shRNA,expressing
R4183 T5315 T5321 themeOf MyD88,expressing

DLUT931

Id Subject Object Predicate Lexical cue
T5312 66-76 Gene_expression denotes expressing
T5311 19-29 Gene_expression denotes expressing
T5310 607-612 Protein denotes TRAF6
T5309 444-449 Protein denotes TRAF6
T5308 392-397 Protein denotes IRAK1
T5307 224-229 Protein denotes IRAK1
T5306 99-104 Protein denotes MyD88
T5305 77-82 Protein denotes shRNA
T5304 30-35 Protein denotes shRNA
R4179 T5304 T5311 themeOf shRNA,expressing
R4180 T5305 T5312 themeOf shRNA,expressing
R4181 T5306 T5312 themeOf MyD88,expressing

bionlp-st-ge-2016-test-ihmc

Id Subject Object Predicate Lexical cue
T5576 438-528 Protein denotes human TRAF6 (forward primer 5′-CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3′,
T5575 77-104 Protein denotes shRNA targeting human MyD88
T5574 1432-1451 Entity denotes 0.8 µg/ml puromycin
T5573 93-104 Protein denotes human MyD88
T5572 607-612 Protein denotes TRAF6
T5571 317-390 Protein denotes primer 5′-AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3′ mRNA
T5570 961-981 Entity denotes transfection reagent
T5569 30-35 Protein denotes shRNA
T5568 392-397 Protein denotes IRAK1
T5567 1381-1386 Entity denotes cells
T5592 0-35 Gene_expression denotes Stable THP-1 cells expressing shRNA
T5591 0-35 Transcription denotes Stable THP-1 cells expressing shRNA
T5590 398-402 Protein denotes mRNA
T5589 744-749 Protein denotes shRNA
T5588 1200-1227 Entity denotes supernatants from the virus
T5587 1147-1171 Entity denotes the lentiviral particles
T5586 908-912 Protein denotes PAX2
T5585 202-207 Protein denotes shRNA
T5584 1271-1280 Entity denotes polybrene
T5583 1185-1194 Entity denotes the cells
T5582 202-308 Protein denotes shRNA targeting human IRAK1 (forward primer 5′-CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3′,
T5581 0-35 Entity denotes Stable THP-1 cells expressing shRNA
T5580 1008-1020 Entity denotes Supernatants
T5579 1238-1243 Entity denotes cells
T5578 829-847 Protein denotes the shRNA-encoding
T5577 613-617 Protein denotes mRNA
R4408 T5569 T5591 themeOf shRNA,Stable THP-1 cells expressing shRNA
R4409 T5569 T5592 themeOf shRNA,Stable THP-1 cells expressing shRNA

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T5465 888-897 NN denotes packaging
T5464 884-887 DT denotes the
T5463 879-883 IN denotes with
T5462 867-878 NN denotes combination
T5461 864-866 IN denotes in
T5460 855-863 NNS denotes plasmids
T5459 852-854 CD denotes .1
T5458 848-852 NNP denotes pLKO
T5457 833-847 JJ denotes shRNA-encoding
T5456 829-832 DT denotes the
T5455 824-828 IN denotes with
T5454 815-823 NN denotes HEK-293T
T5453 810-814 NN denotes line
T5452 805-809 NN denotes cell
T5451 795-804 NN denotes packaging
T5450 791-794 DT denotes the
T5449 778-790 VBG denotes transfecting
T5448 775-777 IN denotes by
T5447 765-774 VBN denotes generated
T5446 760-764 VBD denotes were
T5445 750-759 NNS denotes sequences
T5444 744-749 NNP denotes shRNA
T5443 735-743 VBG denotes encoding
T5442 722-734 NNP denotes Lentiviruses
T5441 720-721 . denotes .
T5440 713-720 NN denotes plasmid
T5439 710-712 CD denotes .1
T5438 706-710 NNP denotes pLKO
T5437 702-705 DT denotes the
T5436 697-701 IN denotes into
T5435 690-696 VBN denotes cloned
T5434 685-689 VBD denotes were
T5433 681-684 CC denotes and
T5432 670-680 NN denotes laboratory
T5431 666-669 PRP$ denotes our
T5430 663-665 IN denotes in
T5429 654-662 VBN denotes designed
T5428 649-653 VBD denotes were
T5427 647-648 -RRB- denotes )
T5426 637-647 VBN denotes underlined
T5425 634-636 VBZ denotes is
T5424 625-633 NN denotes sequence
T5423 618-624 NN denotes target
T5422 613-617 NNP denotes mRNA
T5421 607-612 CD denotes TRAF6
T5420 606-607 -LRB- denotes (
T5419 604-605 NN denotes ′
T5418 547-604 NN denotes AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3
T5417 546-547 : denotes -
T5416 545-546 SYM denotes ′
T5415 544-545 CD denotes 5
T5414 537-543 NN denotes primer
T5413 529-536 VB denotes reverse
T5412 527-528 , denotes ,
T5411 526-527 NN denotes ′
T5410 469-526 NN denotes CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3
T5409 468-469 : denotes -
T5408 467-468 SYM denotes ′
T5407 466-467 CD denotes 5
T5406 459-465 JJR denotes primer
T5405 451-458 RB denotes forward
T5404 450-451 -LRB- denotes (
T5403 444-449 NNP denotes TRAF6
T5402 438-443 JJ denotes human
T5401 434-437 CC denotes and
T5400 432-433 -RRB- denotes )
T5399 422-432 VBN denotes underlined
T5398 419-421 VBZ denotes is
T5397 410-418 NN denotes sequence
T5396 403-409 NN denotes target
T5395 398-402 NNP denotes mRNA
T5394 392-397 NNP denotes IRAK1
T5393 391-392 -LRB- denotes (
T5392 386-390 NNP denotes mRNA
T5391 384-385 NN denotes ′
T5390 327-384 JJ denotes AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3
T5389 326-327 : denotes -
T5388 325-326 SYM denotes ′
T5387 324-325 CD denotes 5
T5386 317-323 NN denotes primer
T5385 309-316 VB denotes reverse
T5384 307-308 , denotes ,
T5383 306-307 NN denotes ′
T5382 249-306 NN denotes CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3
T5381 248-249 : denotes -
T5380 247-248 SYM denotes ′
T5379 246-247 CD denotes 5
T5378 239-245 JJR denotes primer
T5377 231-238 RB denotes forward
T5376 230-231 -LRB- denotes (
T5375 224-229 NNP denotes IRAK1
T5374 218-223 JJ denotes human
T5373 208-217 VBG denotes targeting
T5372 202-207 NNP denotes shRNA
T5371 200-201 . denotes .
T5370 190-200 NN denotes laboratory
T5369 186-189 PRP$ denotes our
T5366 169-172 VBD denotes was
T5365 165-168 CC denotes and
T5364 163-164 -RRB- denotes )
T5363 141-163 NN denotes www.openbiosystems.com
T5362 140-141 -LRB- denotes (
T5361 129-139 NNPS denotes Biosystems
T5360 124-128 NNP denotes Open
T5359 119-123 IN denotes from
T5358 109-118 VBN denotes purchased
T5357 105-108 VBD denotes was
T5356 99-104 NNP denotes MyD88
T5355 93-98 JJ denotes human
T5354 83-92 VBG denotes targeting
T5353 77-82 NNP denotes shRNA
T5352 66-76 VBG denotes expressing
T5351 63-65 CD denotes .1
T5350 59-63 NNP denotes pLKO
T5349 51-58 NN denotes plasmid
T5348 40-50 JJ denotes lentiviral
T5347 36-39 DT denotes The
T5346 30-35 NNP denotes shRNA
T5345 19-29 VBG denotes expressing
T5344 13-18 NNS denotes cells
T5343 7-12 NN denotes THP-1
T5342 0-6 JJ denotes Stable
T5557 1451-1452 . denotes .
T5556 1442-1451 NN denotes puromycin
T5555 1439-1441 NN denotes ml
T5554 1438-1439 NN denotes /
T5553 1436-1438 NN denotes µg
T5552 1432-1435 CD denotes 0.8
T5551 1427-1431 IN denotes with
T5550 1417-1426 NN denotes treatment
T5549 1414-1416 IN denotes by
T5548 1405-1413 VBN denotes expanded
T5547 1401-1404 CC denotes and
T5546 1392-1400 VBN denotes selected
T5545 1387-1391 VBD denotes were
T5544 1381-1386 NNS denotes cells
T5543 1370-1380 VBN denotes transduced
T5542 1357-1369 RB denotes Successfully
T5541 1355-1356 . denotes .
T5540 1352-1355 NNP denotes RPM
T5539 1347-1351 CD denotes 2000
T5538 1344-1346 IN denotes at
T5537 1338-1343 NNS denotes hours
T5536 1334-1337 CD denotes two
T5535 1330-1333 IN denotes for
T5534 1316-1329 NN denotes spinoculation
T5533 1312-1315 CC denotes and
T5532 1310-1311 -RRB- denotes )
T5531 1293-1310 NN denotes www.millipore.com
T5530 1291-1292 , denotes ,
T5529 1282-1291 NNP denotes Millipore
T5528 1281-1282 -LRB- denotes (
T5527 1271-1280 NN denotes polybrene
T5526 1268-1270 NN denotes ml
T5525 1267-1268 NN denotes /
T5524 1265-1267 NN denotes µg
T5523 1263-1264 CD denotes 8
T5522 1260-1262 IN denotes of
T5521 1251-1259 NN denotes presence
T5520 1247-1250 DT denotes the
T5519 1244-1246 IN denotes in
T5518 1238-1243 NNS denotes cells
T5517 1222-1237 JJ denotes virus-producing
T5516 1218-1221 DT denotes the
T5515 1213-1217 IN denotes from
T5514 1200-1212 NNS denotes supernatants
T5513 1195-1199 IN denotes with
T5512 1189-1194 NNS denotes cells
T5511 1185-1188 DT denotes the
T5510 1175-1184 VBG denotes culturing
T5509 1172-1174 IN denotes by
T5508 1162-1171 NNS denotes particles
T5507 1151-1161 JJ denotes lentiviral
T5506 1147-1150 DT denotes the
T5505 1142-1146 IN denotes with
T5504 1131-1141 VBN denotes transduced
T5503 1126-1130 VBD denotes were
T5502 1120-1125 NNS denotes cells
T5501 1114-1119 NNP denotes THP-1
T5500 1111-1113 NNP denotes C.
T5499 1110-1111 NNP denotes °
T5498 1108-1110 CD denotes 80
T5497 1107-1108 CD denotes −
T5496 1104-1106 IN denotes at
T5495 1097-1103 VBD denotes stored
T5494 1093-1096 CC denotes and
T5493 1091-1092 , denotes ,
T5492 1077-1091 NN denotes centrifugation
T5491 1074-1076 IN denotes by
T5490 1064-1073 VBN denotes clarified
T5489 1062-1063 , denotes ,
T5488 1045-1062 JJ denotes post-transfection
T5487 1039-1044 NNS denotes hours
T5486 1036-1038 CD denotes 48
T5485 1026-1035 VBN denotes collected
T5484 1021-1025 VBD denotes were
T5483 1008-1020 NNS denotes Supernatants
T5482 1006-1007 . denotes .
T5481 1005-1006 -RRB- denotes )
T5480 991-1005 NN denotes www.qiagen.com
T5479 989-990 , denotes ,
T5478 983-989 NNP denotes Qiagen
T5477 982-983 -LRB- denotes (
T5476 974-981 NN denotes reagent
T5475 961-973 NN denotes transfection
T5474 951-960 NNP denotes Effectene
T5473 945-950 VBG denotes using
T5472 938-944 JJ denotes pMD2.G
T5471 930-937 VBD denotes plasmid
T5470 921-929 NN denotes envelope
T5469 917-920 DT denotes the
T5468 913-916 CC denotes and
T5467 906-912 NNP denotes psPAX2
T5466 898-905 VBD denotes plasmid
T5368 183-185 IN denotes in
T5367 173-182 VBN denotes validated
R4189 T5342 T5344 amod Stable,cells
R4190 T5343 T5344 compound THP-1,cells
R4191 T5344 T5344 ROOT cells,cells
R4192 T5345 T5344 acl expressing,cells
R4193 T5346 T5345 dobj shRNA,expressing
R4194 T5347 T5349 det The,plasmid
R4195 T5348 T5349 amod lentiviral,plasmid
R4196 T5349 T5358 nsubjpass plasmid,purchased
R4197 T5350 T5351 compound pLKO,.1
R4198 T5351 T5358 nsubjpass .1,purchased
R4199 T5352 T5351 advcl expressing,.1
R4200 T5353 T5354 nmod shRNA,targeting
R4201 T5354 T5358 nsubjpass targeting,purchased
R4202 T5355 T5356 compound human,MyD88
R4203 T5356 T5358 nsubjpass MyD88,purchased
R4204 T5357 T5358 auxpass was,purchased
R4205 T5358 T5358 ROOT purchased,purchased
R4206 T5359 T5358 prep from,purchased
R4207 T5360 T5361 compound Open,Biosystems
R4208 T5361 T5359 pobj Biosystems,from
R4209 T5362 T5361 punct (,Biosystems
R4210 T5363 T5361 appos www.openbiosystems.com,Biosystems
R4211 T5364 T5361 punct ),Biosystems
R4212 T5365 T5358 cc and,purchased
R4213 T5366 T5367 auxpass was,validated
R4214 T5367 T5358 conj validated,purchased
R4215 T5368 T5367 prep in,validated
R4216 T5369 T5370 poss our,laboratory
R4217 T5370 T5368 pobj laboratory,in
R4218 T5371 T5358 punct .,purchased
R4219 T5372 T5429 nsubjpass shRNA,designed
R4220 T5373 T5372 acl targeting,shRNA
R4221 T5374 T5375 compound human,IRAK1
R4222 T5375 T5373 dobj IRAK1,targeting
R4223 T5376 T5378 punct (,primer
R4224 T5377 T5378 advmod forward,primer
R4225 T5378 T5373 parataxis primer,targeting
R4226 T5379 T5382 nummod 5,CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3
R4227 T5380 T5382 punct ′,CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3
R4228 T5381 T5382 punct -,CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3
R4229 T5382 T5383 compound CCGGAGCAGCTGTCCAGGTTTCGTCTCATAAAACCTGGACAGCTGCTCCTTTTTG-3,′
R4230 T5383 T5378 dobj ′,primer
R4231 T5384 T5378 punct ",",primer
R4232 T5385 T5390 ccomp reverse,AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3
R4233 T5386 T5385 dobj primer,reverse
R4234 T5387 T5386 nummod 5,primer
R4235 T5388 T5390 punct ′,AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3
R4236 T5389 T5390 punct -,AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3
R4237 T5390 T5392 amod AATTCAAAAAGGAGCAGCTGTCCAGGTTTTATGAGACGAAACCTGGACAGCTGCT-3,mRNA
R4238 T5391 T5392 compound ′,mRNA
R4239 T5392 T5411 nmod mRNA,′
R4240 T5393 T5399 punct (,underlined
R4241 T5394 T5395 compound IRAK1,mRNA
R4242 T5395 T5397 compound mRNA,sequence
R4243 T5396 T5397 compound target,sequence
R4244 T5397 T5399 nsubjpass sequence,underlined
R4245 T5398 T5399 auxpass is,underlined
R4246 T5399 T5392 parataxis underlined,mRNA
R4247 T5400 T5399 punct ),underlined
R4248 T5401 T5399 cc and,underlined
R4249 T5402 T5403 amod human,TRAF6
R4250 T5403 T5392 conj TRAF6,mRNA
R4251 T5404 T5406 punct (,primer
R4252 T5405 T5406 advmod forward,primer
R4253 T5406 T5392 appos primer,mRNA
R4254 T5407 T5410 nummod 5,CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3
R4255 T5408 T5410 punct ′,CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3
R4256 T5409 T5410 punct -,CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3
R4257 T5410 T5411 compound CCGGAGAAACCTGTTGTGATTCGTCTCATAAATCACAACAGGTTTCTCCTTTTTG-3,′
R4258 T5411 T5378 dep ′,primer
R4259 T5412 T5378 punct ",",primer
R4260 T5413 T5429 nsubjpass reverse,designed
R4261 T5414 T5419 nmod primer,′
R4262 T5415 T5414 nummod 5,primer
R4263 T5416 T5418 punct ′,AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3
R4264 T5417 T5418 punct -,AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3
R4265 T5418 T5419 compound AATTCAAAAAGGAGAAACCTGTTGTGATTTATGAGACGAATCACAACAGGTTTCT-3,′
R4266 T5419 T5413 dobj ′,reverse
R4267 T5420 T5426 punct (,underlined
R4268 T5421 T5424 nummod TRAF6,sequence
R4269 T5422 T5424 compound mRNA,sequence
R4270 T5423 T5424 compound target,sequence
R4271 T5424 T5426 nsubjpass sequence,underlined
R4272 T5425 T5426 auxpass is,underlined
R4273 T5426 T5413 parataxis underlined,reverse
R4274 T5427 T5426 punct ),underlined
R4275 T5428 T5429 auxpass were,designed
R4276 T5429 T5429 ROOT designed,designed
R4277 T5430 T5429 prep in,designed
R4278 T5431 T5432 poss our,laboratory
R4279 T5432 T5430 pobj laboratory,in
R4280 T5433 T5429 cc and,designed
R4281 T5434 T5435 auxpass were,cloned
R4282 T5435 T5429 conj cloned,designed
R4283 T5436 T5435 prep into,cloned
R4284 T5437 T5440 det the,plasmid
R4285 T5438 T5440 nmod pLKO,plasmid
R4286 T5439 T5440 nummod .1,plasmid
R4287 T5440 T5436 pobj plasmid,into
R4288 T5441 T5429 punct .,designed
R4289 T5442 T5447 nsubjpass Lentiviruses,generated
R4290 T5443 T5445 amod encoding,sequences
R4291 T5444 T5445 compound shRNA,sequences
R4292 T5445 T5447 nsubjpass sequences,generated
R4293 T5446 T5447 auxpass were,generated
R4294 T5447 T5447 ROOT generated,generated
R4295 T5448 T5447 prep by,generated
R4296 T5449 T5448 pcomp transfecting,by
R4297 T5450 T5454 det the,HEK-293T
R4298 T5451 T5452 compound packaging,cell
R4299 T5452 T5453 compound cell,line
R4300 T5453 T5454 compound line,HEK-293T
R4301 T5454 T5449 dobj HEK-293T,transfecting
R4302 T5455 T5449 prep with,transfecting
R4303 T5456 T5460 det the,plasmids
R4304 T5457 T5460 amod shRNA-encoding,plasmids
R4305 T5458 T5460 compound pLKO,plasmids
R4306 T5459 T5460 nummod .1,plasmids
R4307 T5460 T5455 pobj plasmids,with
R4308 T5461 T5460 prep in,plasmids
R4309 T5462 T5461 pobj combination,in
R4310 T5463 T5460 prep with,plasmids
R4311 T5464 T5465 det the,packaging
R4312 T5465 T5466 compound packaging,plasmid
R4313 T5466 T5467 compound plasmid,psPAX2
R4314 T5467 T5463 pobj psPAX2,with
R4315 T5468 T5467 cc and,psPAX2
R4316 T5469 T5470 det the,envelope
R4317 T5470 T5467 conj envelope,psPAX2
R4318 T5471 T5448 pobj plasmid,by
R4319 T5472 T5473 acomp pMD2.G,using
R4320 T5473 T5471 advcl using,plasmid
R4321 T5474 T5476 nmod Effectene,reagent
R4322 T5475 T5476 compound transfection,reagent
R4323 T5476 T5473 dobj reagent,using
R4324 T5477 T5478 punct (,Qiagen
R4325 T5478 T5476 appos Qiagen,reagent
R4326 T5479 T5478 punct ",",Qiagen
R4327 T5480 T5478 appos www.qiagen.com,Qiagen
R4328 T5481 T5478 punct ),Qiagen
R4329 T5482 T5447 punct .,generated
R4330 T5483 T5485 nsubjpass Supernatants,collected
R4331 T5484 T5485 auxpass were,collected
R4332 T5485 T5485 ROOT collected,collected
R4333 T5486 T5487 nummod 48,hours
R4334 T5487 T5488 compound hours,post-transfection
R4335 T5488 T5485 oprd post-transfection,collected
R4336 T5489 T5488 punct ",",post-transfection
R4337 T5490 T5488 acl clarified,post-transfection
R4338 T5491 T5490 agent by,clarified
R4339 T5492 T5491 pobj centrifugation,by
R4340 T5493 T5485 punct ",",collected
R4341 T5494 T5485 cc and,collected
R4342 T5495 T5485 conj stored,collected
R4343 T5496 T5495 prep at,stored
R4344 T5497 T5496 pobj −,at
R4345 T5498 T5502 nummod 80,cells
R4346 T5499 T5501 compound °,THP-1
R4347 T5500 T5501 compound C.,THP-1
R4348 T5501 T5502 compound THP-1,cells
R4349 T5502 T5504 nsubjpass cells,transduced
R4350 T5503 T5504 auxpass were,transduced
R4351 T5504 T5485 conj transduced,collected
R4352 T5505 T5504 prep with,transduced
R4353 T5506 T5508 det the,particles
R4354 T5507 T5508 amod lentiviral,particles
R4355 T5508 T5505 pobj particles,with
R4356 T5509 T5504 prep by,transduced
R4357 T5510 T5509 pcomp culturing,by
R4358 T5511 T5512 det the,cells
R4359 T5512 T5510 dobj cells,culturing
R4360 T5513 T5510 prep with,culturing
R4361 T5514 T5513 pobj supernatants,with
R4362 T5515 T5514 prep from,supernatants
R4363 T5516 T5518 det the,cells
R4364 T5517 T5518 amod virus-producing,cells
R4365 T5518 T5515 pobj cells,from
R4366 T5519 T5518 prep in,cells
R4367 T5520 T5521 det the,presence
R4368 T5521 T5519 pobj presence,in
R4369 T5522 T5521 prep of,presence
R4370 T5523 T5522 pobj 8,of
R4371 T5524 T5535 meta µg,for
R4372 T5525 T5527 nmod /,polybrene
R4373 T5526 T5527 compound ml,polybrene
R4374 T5527 T5524 appos polybrene,µg
R4375 T5528 T5529 punct (,Millipore
R4376 T5529 T5527 appos Millipore,polybrene
R4377 T5530 T5529 punct ",",Millipore
R4378 T5531 T5529 appos www.millipore.com,Millipore
R4379 T5532 T5531 punct ),www.millipore.com
R4380 T5533 T5529 cc and,Millipore
R4381 T5534 T5535 meta spinoculation,for
R4382 T5535 T5504 prep for,transduced
R4383 T5536 T5537 nummod two,hours
R4384 T5537 T5535 pobj hours,for
R4385 T5538 T5537 prep at,hours
R4386 T5539 T5540 nummod 2000,RPM
R4387 T5540 T5538 pobj RPM,at
R4388 T5541 T5504 punct .,transduced
R4389 T5542 T5543 advmod Successfully,transduced
R4390 T5543 T5544 amod transduced,cells
R4391 T5544 T5546 nsubjpass cells,selected
R4392 T5545 T5546 auxpass were,selected
R4393 T5546 T5546 ROOT selected,selected
R4394 T5547 T5546 cc and,selected
R4395 T5548 T5546 conj expanded,selected
R4396 T5549 T5548 prep by,expanded
R4397 T5550 T5549 pobj treatment,by
R4398 T5551 T5548 prep with,expanded
R4399 T5552 T5553 nummod 0.8,µg
R4400 T5553 T5556 nmod µg,puromycin
R4401 T5554 T5556 nmod /,puromycin
R4402 T5555 T5556 compound ml,puromycin
R4403 T5556 T5551 pobj puromycin,with
R4404 T5557 T5546 punct .,selected

bionlp-st-ge-2016-test-tees

Id Subject Object Predicate Lexical cue
T5335 607-612 Protein denotes TRAF6
T5334 438-449 Protein denotes human TRAF6
T5333 392-397 Protein denotes IRAK1
T5332 218-229 Protein denotes human IRAK1
T5331 66-76 Gene_expression denotes expressing
T5330 99-104 Protein denotes MyD88
R4187 T5330 T5331 themeOf MyD88,expressing

testone

Id Subject Object Predicate Lexical cue
T5052 607-612 Protein denotes TRAF6
T5051 444-449 Protein denotes TRAF6
T5050 392-397 Protein denotes IRAK1
T5049 224-229 Protein denotes IRAK1
T5048 99-104 Protein denotes MyD88
T5047 77-82 Protein denotes shRNA
T5046 30-35 Protein denotes shRNA

test3

Id Subject Object Predicate Lexical cue
T5067 607-612 Protein denotes TRAF6
T5066 444-449 Protein denotes TRAF6
T5065 392-397 Protein denotes IRAK1
T5064 224-229 Protein denotes IRAK1
T5063 99-104 Protein denotes MyD88
T5062 77-82 Protein denotes shRNA
T5061 30-35 Protein denotes shRNA
T5060 19-29 Gene_expression denotes expressing
T5059 607-612 Protein denotes TRAF6
T5058 444-449 Protein denotes TRAF6
T5057 392-397 Protein denotes IRAK1
T5056 224-229 Protein denotes IRAK1
T5055 99-104 Protein denotes MyD88
T5054 77-82 Protein denotes shRNA
T5053 30-35 Protein denotes shRNA
R3972 T5061 T5060 themeOf shRNA,expressing