| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T171 |
0-50 |
sentence |
denotes |
Dorsoventral Patterning of the Mouse Coat by Tbx15 |
| T172 |
24-26 |
IN |
denotes |
of |
| T173 |
27-30 |
DT |
denotes |
the |
| T174 |
37-41 |
NN |
denotes |
Coat |
| T175 |
31-36 |
NN |
denotes |
Mouse |
| T176 |
42-44 |
IN |
denotes |
by |
| T177 |
45-50 |
NN |
denotes |
Tbx15 |
| T178 |
100-205 |
sentence |
denotes |
Many members of the animal kingdom display coat or skin color differences along their dorsoventral axis. |
| T179 |
101-105 |
JJ |
denotes |
Many |
| T180 |
106-113 |
NNS |
denotes |
members |
| T181 |
136-143 |
VBP |
denotes |
display |
| T182 |
114-116 |
IN |
denotes |
of |
| T183 |
117-120 |
DT |
denotes |
the |
| T184 |
128-135 |
NN |
denotes |
kingdom |
| T185 |
121-127 |
NN |
denotes |
animal |
| T186 |
144-148 |
NN |
denotes |
coat |
| T187 |
163-174 |
NNS |
denotes |
differences |
| T188 |
149-151 |
CC |
denotes |
or |
| T189 |
152-156 |
NN |
denotes |
skin |
| T190 |
157-162 |
NN |
denotes |
color |
| T191 |
175-180 |
IN |
denotes |
along |
| T192 |
181-186 |
PRP$ |
denotes |
their |
| T193 |
200-204 |
NN |
denotes |
axis |
| T194 |
187-199 |
JJ |
denotes |
dorsoventral |
| T195 |
204-205 |
. |
denotes |
. |
| T196 |
205-444 |
sentence |
denotes |
To determine the mechanisms that control regional differences in pigmentation, we have studied how a classical mouse mutation, droopy ear (deH), affects dorsoventral skin characteristics, especially those under control of the Agouti gene. |
| T197 |
206-208 |
TO |
denotes |
To |
| T198 |
209-218 |
VB |
denotes |
determine |
| T199 |
293-300 |
VBN |
denotes |
studied |
| T200 |
219-222 |
DT |
denotes |
the |
| T201 |
223-233 |
NNS |
denotes |
mechanisms |
| T202 |
234-238 |
WDT |
denotes |
that |
| T203 |
239-246 |
VBP |
denotes |
control |
| T204 |
247-255 |
JJ |
denotes |
regional |
| T205 |
256-267 |
NNS |
denotes |
differences |
| T206 |
268-270 |
IN |
denotes |
in |
| T207 |
271-283 |
NN |
denotes |
pigmentation |
| T208 |
283-285 |
, |
denotes |
, |
| T209 |
285-287 |
PRP |
denotes |
we |
| T210 |
288-292 |
VBP |
denotes |
have |
| T211 |
301-304 |
WRB |
denotes |
how |
| T212 |
351-358 |
VBZ |
denotes |
affects |
| T213 |
305-306 |
DT |
denotes |
a |
| T214 |
323-331 |
NN |
denotes |
mutation |
| T215 |
307-316 |
JJ |
denotes |
classical |
| T216 |
317-322 |
NN |
denotes |
mouse |
| T217 |
331-333 |
, |
denotes |
, |
| T218 |
333-339 |
JJ |
denotes |
droopy |
| T219 |
340-343 |
NN |
denotes |
ear |
| T220 |
344-345 |
-LRB- |
denotes |
( |
| T221 |
345-348 |
NN |
denotes |
deH |
| T222 |
348-349 |
-RRB- |
denotes |
) |
| T223 |
349-351 |
, |
denotes |
, |
| T224 |
359-371 |
JJ |
denotes |
dorsoventral |
| T225 |
377-392 |
NNS |
denotes |
characteristics |
| T226 |
372-376 |
NN |
denotes |
skin |
| T227 |
392-394 |
, |
denotes |
, |
| T228 |
394-404 |
RB |
denotes |
especially |
| T229 |
405-410 |
DT |
denotes |
those |
| T230 |
411-416 |
IN |
denotes |
under |
| T231 |
417-424 |
NN |
denotes |
control |
| T232 |
425-427 |
IN |
denotes |
of |
| T233 |
428-431 |
DT |
denotes |
the |
| T234 |
439-443 |
NN |
denotes |
gene |
| T235 |
432-438 |
NN |
denotes |
Agouti |
| T236 |
443-444 |
. |
denotes |
. |
| T237 |
444-684 |
sentence |
denotes |
Mice carrying the Agouti allele black-and-tan (at) normally have a sharp boundary between dorsal black hair and yellow ventral hair; the deH mutation raises the pigmentation boundary, producing an apparent dorsal-to-ventral transformation. |
| T238 |
445-449 |
NNS |
denotes |
Mice |
| T239 |
505-509 |
VBP |
denotes |
have |
| T240 |
450-458 |
VBG |
denotes |
carrying |
| T241 |
459-462 |
DT |
denotes |
the |
| T242 |
470-476 |
NN |
denotes |
allele |
| T243 |
463-469 |
NN |
denotes |
Agouti |
| T244 |
477-482 |
NN |
denotes |
black |
| T245 |
482-483 |
HYPH |
denotes |
- |
| T246 |
483-486 |
CC |
denotes |
and |
| T247 |
486-487 |
HYPH |
denotes |
- |
| T248 |
487-490 |
NN |
denotes |
tan |
| T249 |
491-492 |
-LRB- |
denotes |
( |
| T250 |
492-494 |
NN |
denotes |
at |
| T251 |
494-495 |
-RRB- |
denotes |
) |
| T252 |
496-504 |
RB |
denotes |
normally |
| T253 |
595-601 |
VBZ |
denotes |
raises |
| T254 |
510-511 |
DT |
denotes |
a |
| T255 |
518-526 |
NN |
denotes |
boundary |
| T256 |
512-517 |
JJ |
denotes |
sharp |
| T257 |
527-534 |
IN |
denotes |
between |
| T258 |
535-541 |
JJ |
denotes |
dorsal |
| T259 |
548-552 |
NN |
denotes |
hair |
| T260 |
542-547 |
JJ |
denotes |
black |
| T261 |
553-556 |
CC |
denotes |
and |
| T262 |
557-563 |
JJ |
denotes |
yellow |
| T263 |
572-576 |
NN |
denotes |
hair |
| T264 |
564-571 |
JJ |
denotes |
ventral |
| T265 |
576-577 |
: |
denotes |
; |
| T266 |
578-581 |
DT |
denotes |
the |
| T267 |
586-594 |
NN |
denotes |
mutation |
| T268 |
582-585 |
NN |
denotes |
deH |
| T269 |
602-605 |
DT |
denotes |
the |
| T270 |
619-627 |
NN |
denotes |
boundary |
| T271 |
606-618 |
NN |
denotes |
pigmentation |
| T272 |
627-629 |
, |
denotes |
, |
| T273 |
629-638 |
VBG |
denotes |
producing |
| T274 |
639-641 |
DT |
denotes |
an |
| T275 |
669-683 |
NN |
denotes |
transformation |
| T276 |
642-650 |
JJ |
denotes |
apparent |
| T277 |
651-657 |
JJ |
denotes |
dorsal |
| T278 |
657-658 |
HYPH |
denotes |
- |
| T279 |
658-660 |
IN |
denotes |
to |
| T280 |
660-661 |
HYPH |
denotes |
- |
| T281 |
661-668 |
JJ |
denotes |
ventral |
| T282 |
683-684 |
. |
denotes |
. |
| T283 |
684-911 |
sentence |
denotes |
We identify a 216 kb deletion in deH that removes all but the first exon of the Tbx15 gene, whose embryonic expression in developing mesenchyme correlates with pigmentary and skeletal malformations observed in deH/deH animals. |
| T284 |
685-687 |
PRP |
denotes |
We |
| T285 |
688-696 |
VBP |
denotes |
identify |
| T286 |
697-698 |
DT |
denotes |
a |
| T287 |
706-714 |
NN |
denotes |
deletion |
| T288 |
699-702 |
CD |
denotes |
216 |
| T289 |
703-705 |
NN |
denotes |
kb |
| T290 |
715-717 |
IN |
denotes |
in |
| T291 |
718-721 |
NN |
denotes |
deH |
| T292 |
722-726 |
WDT |
denotes |
that |
| T293 |
727-734 |
VBZ |
denotes |
removes |
| T294 |
735-738 |
DT |
denotes |
all |
| T295 |
739-742 |
IN |
denotes |
but |
| T296 |
743-746 |
DT |
denotes |
the |
| T297 |
753-757 |
NN |
denotes |
exon |
| T298 |
747-752 |
JJ |
denotes |
first |
| T299 |
758-760 |
IN |
denotes |
of |
| T300 |
761-764 |
DT |
denotes |
the |
| T301 |
771-775 |
NN |
denotes |
gene |
| T302 |
765-770 |
NN |
denotes |
Tbx15 |
| T303 |
775-777 |
, |
denotes |
, |
| T304 |
777-782 |
WP$ |
denotes |
whose |
| T305 |
793-803 |
NN |
denotes |
expression |
| T306 |
783-792 |
JJ |
denotes |
embryonic |
| T307 |
829-839 |
VBZ |
denotes |
correlates |
| T308 |
804-806 |
IN |
denotes |
in |
| T309 |
807-817 |
VBG |
denotes |
developing |
| T310 |
818-828 |
NN |
denotes |
mesenchyme |
| T311 |
840-844 |
IN |
denotes |
with |
| T312 |
845-855 |
JJ |
denotes |
pigmentary |
| T313 |
869-882 |
NNS |
denotes |
malformations |
| T314 |
856-859 |
CC |
denotes |
and |
| T315 |
860-868 |
JJ |
denotes |
skeletal |
| T316 |
883-891 |
VBN |
denotes |
observed |
| T317 |
892-894 |
IN |
denotes |
in |
| T318 |
895-898 |
NN |
denotes |
deH |
| T319 |
899-902 |
NN |
denotes |
deH |
| T320 |
898-899 |
HYPH |
denotes |
/ |
| T321 |
903-910 |
NNS |
denotes |
animals |
| T322 |
910-911 |
. |
denotes |
. |
| T323 |
911-1025 |
sentence |
denotes |
Construction of a targeted allele of Tbx15 confirmed that the deH phenotype was caused by Tbx15 loss of function. |
| T324 |
912-924 |
NN |
denotes |
Construction |
| T325 |
955-964 |
VBD |
denotes |
confirmed |
| T326 |
925-927 |
IN |
denotes |
of |
| T327 |
928-929 |
DT |
denotes |
a |
| T328 |
939-945 |
NN |
denotes |
allele |
| T329 |
930-938 |
VBN |
denotes |
targeted |
| T330 |
946-948 |
IN |
denotes |
of |
| T331 |
949-954 |
NN |
denotes |
Tbx15 |
| T332 |
965-969 |
IN |
denotes |
that |
| T333 |
992-998 |
VBN |
denotes |
caused |
| T334 |
970-973 |
DT |
denotes |
the |
| T335 |
978-987 |
NN |
denotes |
phenotype |
| T336 |
974-977 |
NN |
denotes |
deH |
| T337 |
988-991 |
VBD |
denotes |
was |
| T338 |
999-1001 |
IN |
denotes |
by |
| T339 |
1002-1007 |
NN |
denotes |
Tbx15 |
| T340 |
1008-1012 |
NN |
denotes |
loss |
| T341 |
1013-1015 |
IN |
denotes |
of |
| T342 |
1016-1024 |
NN |
denotes |
function |
| T343 |
1024-1025 |
. |
denotes |
. |
| T344 |
1025-1250 |
sentence |
denotes |
Early embryonic expression of Tbx15 in dorsal mesenchyme is complementary to Agouti expression in ventral mesenchyme; in the absence of Tbx15, expression of Agouti in both embryos and postnatal animals is displaced dorsally. |
| T345 |
1026-1031 |
RB |
denotes |
Early |
| T346 |
1032-1041 |
JJ |
denotes |
embryonic |
| T347 |
1042-1052 |
NN |
denotes |
expression |
| T348 |
1083-1085 |
VBZ |
denotes |
is |
| T349 |
1053-1055 |
IN |
denotes |
of |
| T350 |
1056-1061 |
NN |
denotes |
Tbx15 |
| T351 |
1062-1064 |
IN |
denotes |
in |
| T352 |
1065-1071 |
JJ |
denotes |
dorsal |
| T353 |
1072-1082 |
NN |
denotes |
mesenchyme |
| T354 |
1231-1240 |
VBN |
denotes |
displaced |
| T355 |
1086-1099 |
JJ |
denotes |
complementary |
| T356 |
1100-1102 |
IN |
denotes |
to |
| T357 |
1103-1109 |
NN |
denotes |
Agouti |
| T358 |
1110-1120 |
NN |
denotes |
expression |
| T359 |
1121-1123 |
IN |
denotes |
in |
| T360 |
1124-1131 |
JJ |
denotes |
ventral |
| T361 |
1132-1142 |
NN |
denotes |
mesenchyme |
| T362 |
1142-1143 |
: |
denotes |
; |
| T363 |
1144-1146 |
IN |
denotes |
in |
| T364 |
1147-1150 |
DT |
denotes |
the |
| T365 |
1151-1158 |
NN |
denotes |
absence |
| T366 |
1159-1161 |
IN |
denotes |
of |
| T367 |
1162-1167 |
NN |
denotes |
Tbx15 |
| T368 |
1167-1169 |
, |
denotes |
, |
| T369 |
1169-1179 |
NN |
denotes |
expression |
| T370 |
1180-1182 |
IN |
denotes |
of |
| T371 |
1183-1189 |
NN |
denotes |
Agouti |
| T372 |
1190-1192 |
IN |
denotes |
in |
| T373 |
1193-1197 |
CC |
denotes |
both |
| T374 |
1198-1205 |
NNS |
denotes |
embryos |
| T375 |
1206-1209 |
CC |
denotes |
and |
| T376 |
1210-1219 |
JJ |
denotes |
postnatal |
| T377 |
1220-1227 |
NNS |
denotes |
animals |
| T378 |
1228-1230 |
VBZ |
denotes |
is |
| T379 |
1241-1249 |
RB |
denotes |
dorsally |
| T380 |
1249-1250 |
. |
denotes |
. |
| T381 |
1250-1462 |
sentence |
denotes |
Transplantation experiments demonstrate that positional identity of the skin with regard to dorsoventral pigmentation differences is acquired by E12.5, which is shortly after early embryonic expression of Tbx15. |
| T382 |
1251-1266 |
NN |
denotes |
Transplantation |
| T383 |
1267-1278 |
NNS |
denotes |
experiments |
| T384 |
1279-1290 |
VBP |
denotes |
demonstrate |
| T385 |
1291-1295 |
IN |
denotes |
that |
| T386 |
1384-1392 |
VBN |
denotes |
acquired |
| T387 |
1296-1306 |
JJ |
denotes |
positional |
| T388 |
1307-1315 |
NN |
denotes |
identity |
| T389 |
1316-1318 |
IN |
denotes |
of |
| T390 |
1319-1322 |
DT |
denotes |
the |
| T391 |
1323-1327 |
NN |
denotes |
skin |
| T392 |
1328-1332 |
IN |
denotes |
with |
| T393 |
1333-1339 |
NN |
denotes |
regard |
| T394 |
1340-1342 |
IN |
denotes |
to |
| T395 |
1343-1355 |
JJ |
denotes |
dorsoventral |
| T396 |
1369-1380 |
NNS |
denotes |
differences |
| T397 |
1356-1368 |
NN |
denotes |
pigmentation |
| T398 |
1381-1383 |
VBZ |
denotes |
is |
| T399 |
1393-1395 |
IN |
denotes |
by |
| T400 |
1396-1401 |
NN |
denotes |
E12.5 |
| T401 |
1401-1403 |
, |
denotes |
, |
| T402 |
1403-1408 |
WDT |
denotes |
which |
| T403 |
1409-1411 |
VBZ |
denotes |
is |
| T404 |
1412-1419 |
RB |
denotes |
shortly |
| T405 |
1420-1425 |
IN |
denotes |
after |
| T406 |
1426-1431 |
RB |
denotes |
early |
| T407 |
1432-1441 |
JJ |
denotes |
embryonic |
| T408 |
1442-1452 |
NN |
denotes |
expression |
| T409 |
1453-1455 |
IN |
denotes |
of |
| T410 |
1456-1461 |
NN |
denotes |
Tbx15 |
| T411 |
1461-1462 |
. |
denotes |
. |
| T412 |
1462-1658 |
sentence |
denotes |
Fate-mapping studies show that the dorsoventral pigmentation boundary is not in register with a previously identified dermal cell lineage boundary, but rather with the limb dorsoventral boundary. |
| T413 |
1463-1467 |
NN |
denotes |
Fate |
| T414 |
1468-1475 |
VBG |
denotes |
mapping |
| T415 |
1467-1468 |
HYPH |
denotes |
- |
| T416 |
1476-1483 |
NNS |
denotes |
studies |
| T417 |
1484-1488 |
VBP |
denotes |
show |
| T418 |
1489-1493 |
IN |
denotes |
that |
| T419 |
1533-1535 |
VBZ |
denotes |
is |
| T420 |
1494-1497 |
DT |
denotes |
the |
| T421 |
1524-1532 |
NN |
denotes |
boundary |
| T422 |
1498-1510 |
JJ |
denotes |
dorsoventral |
| T423 |
1511-1523 |
NN |
denotes |
pigmentation |
| T424 |
1536-1539 |
RB |
denotes |
not |
| T425 |
1540-1542 |
IN |
denotes |
in |
| T426 |
1543-1551 |
NN |
denotes |
register |
| T427 |
1552-1556 |
IN |
denotes |
with |
| T428 |
1557-1558 |
DT |
denotes |
a |
| T429 |
1601-1609 |
NN |
denotes |
boundary |
| T430 |
1559-1569 |
RB |
denotes |
previously |
| T431 |
1570-1580 |
VBN |
denotes |
identified |
| T432 |
1581-1587 |
JJ |
denotes |
dermal |
| T433 |
1588-1592 |
NN |
denotes |
cell |
| T434 |
1593-1600 |
NN |
denotes |
lineage |
| T435 |
1609-1611 |
, |
denotes |
, |
| T436 |
1611-1614 |
CC |
denotes |
but |
| T437 |
1615-1621 |
RB |
denotes |
rather |
| T438 |
1622-1626 |
IN |
denotes |
with |
| T439 |
1627-1630 |
DT |
denotes |
the |
| T440 |
1649-1657 |
NN |
denotes |
boundary |
| T441 |
1631-1635 |
NN |
denotes |
limb |
| T442 |
1636-1648 |
JJ |
denotes |
dorsoventral |
| T443 |
1657-1658 |
. |
denotes |
. |
| T444 |
1658-1816 |
sentence |
denotes |
Embryonic expression of Tbx15 in dorsolateral mesenchyme provides an instructional cue required to establish the future positional identity of dorsal dermis. |
| T445 |
1659-1668 |
JJ |
denotes |
Embryonic |
| T446 |
1669-1679 |
NN |
denotes |
expression |
| T447 |
1716-1724 |
VBZ |
denotes |
provides |
| T448 |
1680-1682 |
IN |
denotes |
of |
| T449 |
1683-1688 |
NN |
denotes |
Tbx15 |
| T450 |
1689-1691 |
IN |
denotes |
in |
| T451 |
1692-1704 |
JJ |
denotes |
dorsolateral |
| T452 |
1705-1715 |
NN |
denotes |
mesenchyme |
| T453 |
1725-1727 |
DT |
denotes |
an |
| T454 |
1742-1745 |
NN |
denotes |
cue |
| T455 |
1728-1741 |
JJ |
denotes |
instructional |
| T456 |
1746-1754 |
VBN |
denotes |
required |
| T457 |
1755-1757 |
TO |
denotes |
to |
| T458 |
1758-1767 |
VB |
denotes |
establish |
| T459 |
1768-1771 |
DT |
denotes |
the |
| T460 |
1790-1798 |
NN |
denotes |
identity |
| T461 |
1772-1778 |
JJ |
denotes |
future |
| T462 |
1779-1789 |
JJ |
denotes |
positional |
| T463 |
1799-1801 |
IN |
denotes |
of |
| T464 |
1802-1808 |
JJ |
denotes |
dorsal |
| T465 |
1809-1815 |
NN |
denotes |
dermis |
| T466 |
1815-1816 |
. |
denotes |
. |
| T467 |
1816-2120 |
sentence |
denotes |
These findings represent a novel role for T-box gene action in embryonic development, identify a previously unappreciated aspect of dorsoventral patterning that is widely represented in furred mammals, and provide insight into the mechanisms that underlie region-specific differences in body morphology. |
| T468 |
1817-1822 |
DT |
denotes |
These |
| T469 |
1823-1831 |
NNS |
denotes |
findings |
| T470 |
1832-1841 |
VBP |
denotes |
represent |
| T471 |
1842-1843 |
DT |
denotes |
a |
| T472 |
1850-1854 |
NN |
denotes |
role |
| T473 |
1844-1849 |
JJ |
denotes |
novel |
| T474 |
1855-1858 |
IN |
denotes |
for |
| T475 |
1859-1860 |
NN |
denotes |
T |
| T476 |
1861-1864 |
NN |
denotes |
box |
| T477 |
1860-1861 |
HYPH |
denotes |
- |
| T478 |
1870-1876 |
NN |
denotes |
action |
| T479 |
1865-1869 |
NN |
denotes |
gene |
| T480 |
1877-1879 |
IN |
denotes |
in |
| T481 |
1880-1889 |
JJ |
denotes |
embryonic |
| T482 |
1890-1901 |
NN |
denotes |
development |
| T483 |
1901-1903 |
, |
denotes |
, |
| T484 |
1903-1911 |
VBP |
denotes |
identify |
| T485 |
1912-1913 |
DT |
denotes |
a |
| T486 |
1939-1945 |
NN |
denotes |
aspect |
| T487 |
1914-1924 |
RB |
denotes |
previously |
| T488 |
1925-1938 |
JJ |
denotes |
unappreciated |
| T489 |
1946-1948 |
IN |
denotes |
of |
| T490 |
1949-1961 |
JJ |
denotes |
dorsoventral |
| T491 |
1962-1972 |
NN |
denotes |
patterning |
| T492 |
1973-1977 |
WDT |
denotes |
that |
| T493 |
1988-1999 |
VBN |
denotes |
represented |
| T494 |
1978-1980 |
VBZ |
denotes |
is |
| T495 |
1981-1987 |
RB |
denotes |
widely |
| T496 |
2000-2002 |
IN |
denotes |
in |
| T497 |
2003-2009 |
VBN |
denotes |
furred |
| T498 |
2010-2017 |
NNS |
denotes |
mammals |
| T499 |
2017-2019 |
, |
denotes |
, |
| T500 |
2019-2022 |
CC |
denotes |
and |
| T501 |
2023-2030 |
VBP |
denotes |
provide |
| T502 |
2031-2038 |
NN |
denotes |
insight |
| T503 |
2039-2043 |
IN |
denotes |
into |
| T504 |
2044-2047 |
DT |
denotes |
the |
| T505 |
2048-2058 |
NNS |
denotes |
mechanisms |
| T506 |
2059-2063 |
WDT |
denotes |
that |
| T507 |
2064-2072 |
VBP |
denotes |
underlie |
| T508 |
2073-2079 |
NN |
denotes |
region |
| T509 |
2080-2088 |
JJ |
denotes |
specific |
| T510 |
2079-2080 |
HYPH |
denotes |
- |
| T511 |
2089-2100 |
NNS |
denotes |
differences |
| T512 |
2101-2103 |
IN |
denotes |
in |
| T513 |
2104-2108 |
NN |
denotes |
body |
| T514 |
2109-2119 |
NN |
denotes |
morphology |
| T515 |
2119-2120 |
. |
denotes |
. |
| T992 |
2278-2279 |
DT |
denotes |
A |
| T993 |
2292-2300 |
NN |
denotes |
question |
| T994 |
2280-2291 |
JJ |
denotes |
fundamental |
| T995 |
2326-2328 |
VBZ |
denotes |
is |
| T996 |
2301-2303 |
IN |
denotes |
in |
| T997 |
2304-2317 |
JJ |
denotes |
developmental |
| T998 |
2318-2325 |
NN |
denotes |
biology |
| T999 |
2329-2332 |
WRB |
denotes |
how |
| T1000 |
2373-2380 |
VBP |
denotes |
acquire |
| T1001 |
2333-2341 |
JJ |
denotes |
adjacent |
| T1002 |
2342-2349 |
NNS |
denotes |
regions |
| T1003 |
2350-2352 |
IN |
denotes |
of |
| T1004 |
2353-2356 |
DT |
denotes |
the |
| T1005 |
2368-2372 |
NN |
denotes |
body |
| T1006 |
2357-2367 |
NN |
denotes |
vertebrate |
| T1007 |
2381-2392 |
NNS |
denotes |
differences |
| T1008 |
2393-2395 |
IN |
denotes |
in |
| T1009 |
2396-2401 |
PRP$ |
denotes |
their |
| T1010 |
2402-2412 |
NN |
denotes |
appearance |
| T1011 |
2413-2415 |
CC |
denotes |
or |
| T1012 |
2416-2426 |
NN |
denotes |
morphology |
| T1013 |
2426-2427 |
. |
denotes |
. |
| T1014 |
2427-2705 |
sentence |
denotes |
Mechanisms that establish the general body plan make use of a relatively small number of signaling pathways shared among all animals (reviewed in Pires-daSilva and Sommer 2003), but the extent to which these pathways control finer differences between body regions is not clear. |
| T1015 |
2428-2438 |
NNS |
denotes |
Mechanisms |
| T1016 |
2476-2480 |
VBP |
denotes |
make |
| T1017 |
2439-2443 |
WDT |
denotes |
that |
| T1018 |
2444-2453 |
VBP |
denotes |
establish |
| T1019 |
2454-2457 |
DT |
denotes |
the |
| T1020 |
2471-2475 |
NN |
denotes |
plan |
| T1021 |
2458-2465 |
JJ |
denotes |
general |
| T1022 |
2466-2470 |
NN |
denotes |
body |
| T1023 |
2481-2484 |
NN |
denotes |
use |
| T1024 |
2485-2487 |
IN |
denotes |
of |
| T1025 |
2488-2489 |
DT |
denotes |
a |
| T1026 |
2507-2513 |
NN |
denotes |
number |
| T1027 |
2490-2500 |
RB |
denotes |
relatively |
| T1028 |
2501-2506 |
JJ |
denotes |
small |
| T1029 |
2514-2516 |
IN |
denotes |
of |
| T1030 |
2517-2526 |
NN |
denotes |
signaling |
| T1031 |
2527-2535 |
NNS |
denotes |
pathways |
| T1032 |
2536-2542 |
VBN |
denotes |
shared |
| T1033 |
2543-2548 |
IN |
denotes |
among |
| T1034 |
2549-2552 |
DT |
denotes |
all |
| T1035 |
2553-2560 |
NNS |
denotes |
animals |
| T1036 |
2561-2562 |
-LRB- |
denotes |
( |
| T1037 |
2562-2570 |
VBN |
denotes |
reviewed |
| T1038 |
2571-2573 |
IN |
denotes |
in |
| T1039 |
2574-2579 |
NNP |
denotes |
Pires |
| T1040 |
2580-2587 |
NNP |
denotes |
daSilva |
| T1041 |
2579-2580 |
HYPH |
denotes |
- |
| T1042 |
2588-2591 |
CC |
denotes |
and |
| T1043 |
2592-2598 |
NNP |
denotes |
Sommer |
| T1044 |
2599-2603 |
CD |
denotes |
2003 |
| T1045 |
2603-2604 |
-RRB- |
denotes |
) |
| T1046 |
2604-2606 |
, |
denotes |
, |
| T1047 |
2606-2609 |
CC |
denotes |
but |
| T1048 |
2610-2613 |
DT |
denotes |
the |
| T1049 |
2614-2620 |
NN |
denotes |
extent |
| T1050 |
2692-2694 |
VBZ |
denotes |
is |
| T1051 |
2621-2623 |
IN |
denotes |
to |
| T1052 |
2645-2652 |
VBP |
denotes |
control |
| T1053 |
2624-2629 |
WDT |
denotes |
which |
| T1054 |
2630-2635 |
DT |
denotes |
these |
| T1055 |
2636-2644 |
NNS |
denotes |
pathways |
| T1056 |
2653-2658 |
JJR |
denotes |
finer |
| T1057 |
2659-2670 |
NNS |
denotes |
differences |
| T1058 |
2671-2678 |
IN |
denotes |
between |
| T1059 |
2679-2683 |
NN |
denotes |
body |
| T1060 |
2684-2691 |
NNS |
denotes |
regions |
| T1061 |
2695-2698 |
RB |
denotes |
not |
| T1062 |
2699-2704 |
JJ |
denotes |
clear |
| T1063 |
2704-2705 |
. |
denotes |
. |
| T1064 |
2705-2942 |
sentence |
denotes |
Among vertebrates, differences in the shape or number of skeletal elements, altered morphology of epidermal appendages, and variation in pigment distribution combine to produce the majority of what distinguishes one animal from another. |
| T1065 |
2706-2711 |
IN |
denotes |
Among |
| T1066 |
2864-2871 |
VBP |
denotes |
combine |
| T1067 |
2712-2723 |
NNS |
denotes |
vertebrates |
| T1068 |
2723-2725 |
, |
denotes |
, |
| T1069 |
2725-2736 |
NNS |
denotes |
differences |
| T1070 |
2737-2739 |
IN |
denotes |
in |
| T1071 |
2740-2743 |
DT |
denotes |
the |
| T1072 |
2744-2749 |
NN |
denotes |
shape |
| T1073 |
2750-2752 |
CC |
denotes |
or |
| T1074 |
2753-2759 |
NN |
denotes |
number |
| T1075 |
2760-2762 |
IN |
denotes |
of |
| T1076 |
2763-2771 |
JJ |
denotes |
skeletal |
| T1077 |
2772-2780 |
NNS |
denotes |
elements |
| T1078 |
2780-2782 |
, |
denotes |
, |
| T1079 |
2782-2789 |
JJ |
denotes |
altered |
| T1080 |
2790-2800 |
NN |
denotes |
morphology |
| T1081 |
2801-2803 |
IN |
denotes |
of |
| T1082 |
2804-2813 |
JJ |
denotes |
epidermal |
| T1083 |
2814-2824 |
NNS |
denotes |
appendages |
| T1084 |
2824-2826 |
, |
denotes |
, |
| T1085 |
2826-2829 |
CC |
denotes |
and |
| T1086 |
2830-2839 |
NN |
denotes |
variation |
| T1087 |
2840-2842 |
IN |
denotes |
in |
| T1088 |
2843-2850 |
NN |
denotes |
pigment |
| T1089 |
2851-2863 |
NN |
denotes |
distribution |
| T1090 |
2872-2874 |
TO |
denotes |
to |
| T1091 |
2875-2882 |
VB |
denotes |
produce |
| T1092 |
2883-2886 |
DT |
denotes |
the |
| T1093 |
2887-2895 |
NN |
denotes |
majority |
| T1094 |
2896-2898 |
IN |
denotes |
of |
| T1095 |
2899-2903 |
WP |
denotes |
what |
| T1096 |
2904-2917 |
VBZ |
denotes |
distinguishes |
| T1097 |
2918-2921 |
CD |
denotes |
one |
| T1098 |
2922-2928 |
NN |
denotes |
animal |
| T1099 |
2929-2933 |
IN |
denotes |
from |
| T1100 |
2934-2941 |
DT |
denotes |
another |
| T1101 |
2941-2942 |
. |
denotes |
. |
| T1102 |
2942-3160 |
sentence |
denotes |
Among these, pigment patterns are an excellent system to investigate how morphological differences arise, both for different regions of the body within a species and for different animals from closely related species. |
| T1103 |
2943-2948 |
IN |
denotes |
Among |
| T1104 |
2973-2976 |
VBP |
denotes |
are |
| T1105 |
2949-2954 |
DT |
denotes |
these |
| T1106 |
2954-2956 |
, |
denotes |
, |
| T1107 |
2956-2963 |
NN |
denotes |
pigment |
| T1108 |
2964-2972 |
NNS |
denotes |
patterns |
| T1109 |
2977-2979 |
DT |
denotes |
an |
| T1110 |
2990-2996 |
NN |
denotes |
system |
| T1111 |
2980-2989 |
JJ |
denotes |
excellent |
| T1112 |
2997-2999 |
TO |
denotes |
to |
| T1113 |
3000-3011 |
VB |
denotes |
investigate |
| T1114 |
3012-3015 |
WRB |
denotes |
how |
| T1115 |
3042-3047 |
VBP |
denotes |
arise |
| T1116 |
3016-3029 |
JJ |
denotes |
morphological |
| T1117 |
3030-3041 |
NNS |
denotes |
differences |
| T1118 |
3047-3049 |
, |
denotes |
, |
| T1119 |
3049-3053 |
CC |
denotes |
both |
| T1120 |
3054-3057 |
IN |
denotes |
for |
| T1121 |
3058-3067 |
JJ |
denotes |
different |
| T1122 |
3068-3075 |
NNS |
denotes |
regions |
| T1123 |
3076-3078 |
IN |
denotes |
of |
| T1124 |
3079-3082 |
DT |
denotes |
the |
| T1125 |
3083-3087 |
NN |
denotes |
body |
| T1126 |
3088-3094 |
IN |
denotes |
within |
| T1127 |
3095-3096 |
DT |
denotes |
a |
| T1128 |
3097-3104 |
NN |
denotes |
species |
| T1129 |
3105-3108 |
CC |
denotes |
and |
| T1130 |
3109-3112 |
IN |
denotes |
for |
| T1131 |
3113-3122 |
JJ |
denotes |
different |
| T1132 |
3123-3130 |
NNS |
denotes |
animals |
| T1133 |
3131-3135 |
IN |
denotes |
from |
| T1134 |
3136-3143 |
RB |
denotes |
closely |
| T1135 |
3144-3151 |
JJ |
denotes |
related |
| T1136 |
3152-3159 |
NNS |
denotes |
species |
| T1137 |
3159-3160 |
. |
denotes |
. |
| T1138 |
3160-3430 |
sentence |
denotes |
In natural environments, color variation is a nearly universal mechanism for recognition, camouflage, or both; consequently, a large number of pigment patterns have been characterized from an evolutionary and ecological perspective (Boughman 2001; Jiggins et al. 2001). |
| T1139 |
3161-3163 |
IN |
denotes |
In |
| T1140 |
3202-3204 |
VBZ |
denotes |
is |
| T1141 |
3164-3171 |
JJ |
denotes |
natural |
| T1142 |
3172-3184 |
NNS |
denotes |
environments |
| T1143 |
3184-3186 |
, |
denotes |
, |
| T1144 |
3186-3191 |
NN |
denotes |
color |
| T1145 |
3192-3201 |
NN |
denotes |
variation |
| T1146 |
3331-3344 |
VBN |
denotes |
characterized |
| T1147 |
3205-3206 |
DT |
denotes |
a |
| T1148 |
3224-3233 |
NN |
denotes |
mechanism |
| T1149 |
3207-3213 |
RB |
denotes |
nearly |
| T1150 |
3214-3223 |
JJ |
denotes |
universal |
| T1151 |
3234-3237 |
IN |
denotes |
for |
| T1152 |
3238-3249 |
NN |
denotes |
recognition |
| T1153 |
3249-3251 |
, |
denotes |
, |
| T1154 |
3251-3261 |
NN |
denotes |
camouflage |
| T1155 |
3261-3263 |
, |
denotes |
, |
| T1156 |
3263-3265 |
CC |
denotes |
or |
| T1157 |
3266-3270 |
DT |
denotes |
both |
| T1158 |
3270-3271 |
: |
denotes |
; |
| T1159 |
3272-3284 |
RB |
denotes |
consequently |
| T1160 |
3284-3286 |
, |
denotes |
, |
| T1161 |
3286-3287 |
DT |
denotes |
a |
| T1162 |
3294-3300 |
NN |
denotes |
number |
| T1163 |
3288-3293 |
JJ |
denotes |
large |
| T1164 |
3301-3303 |
IN |
denotes |
of |
| T1165 |
3304-3311 |
NN |
denotes |
pigment |
| T1166 |
3312-3320 |
NNS |
denotes |
patterns |
| T1167 |
3321-3325 |
VBP |
denotes |
have |
| T1168 |
3326-3330 |
VBN |
denotes |
been |
| T1169 |
3345-3349 |
IN |
denotes |
from |
| T1170 |
3350-3352 |
DT |
denotes |
an |
| T1171 |
3381-3392 |
NN |
denotes |
perspective |
| T1172 |
3353-3365 |
JJ |
denotes |
evolutionary |
| T1173 |
3366-3369 |
CC |
denotes |
and |
| T1174 |
3370-3380 |
JJ |
denotes |
ecological |
| T1175 |
3393-3394 |
-LRB- |
denotes |
( |
| T1176 |
3394-3402 |
NNP |
denotes |
Boughman |
| T1177 |
3403-3407 |
CD |
denotes |
2001 |
| T1178 |
3407-3408 |
: |
denotes |
; |
| T1179 |
3409-3416 |
NNP |
denotes |
Jiggins |
| T1180 |
3417-3419 |
FW |
denotes |
et |
| T1181 |
3420-3423 |
FW |
denotes |
al. |
| T1182 |
3424-3428 |
CD |
denotes |
2001 |
| T1183 |
3428-3429 |
-RRB- |
denotes |
) |
| T1184 |
3429-3430 |
. |
denotes |
. |
| T1185 |
3430-3721 |
sentence |
denotes |
In the laboratory, color variation has been the subject of vertebrate genetics for more than a century (Searle 1968; Silvers 1979), and many pigmentary components have been identified whose actions are understood in a cellular or organ-based context (reviewed in Bennett and Lamoreux 2003). |
| T1186 |
3431-3433 |
IN |
denotes |
In |
| T1187 |
3470-3474 |
VBN |
denotes |
been |
| T1188 |
3434-3437 |
DT |
denotes |
the |
| T1189 |
3438-3448 |
NN |
denotes |
laboratory |
| T1190 |
3448-3450 |
, |
denotes |
, |
| T1191 |
3450-3455 |
NN |
denotes |
color |
| T1192 |
3456-3465 |
NN |
denotes |
variation |
| T1193 |
3466-3469 |
VBZ |
denotes |
has |
| T1194 |
3475-3478 |
DT |
denotes |
the |
| T1195 |
3479-3486 |
NN |
denotes |
subject |
| T1196 |
3487-3489 |
IN |
denotes |
of |
| T1197 |
3490-3500 |
NN |
denotes |
vertebrate |
| T1198 |
3501-3509 |
NN |
denotes |
genetics |
| T1199 |
3510-3513 |
IN |
denotes |
for |
| T1200 |
3514-3518 |
JJR |
denotes |
more |
| T1201 |
3524-3525 |
DT |
denotes |
a |
| T1202 |
3519-3523 |
IN |
denotes |
than |
| T1203 |
3526-3533 |
NN |
denotes |
century |
| T1204 |
3534-3535 |
-LRB- |
denotes |
( |
| T1205 |
3535-3541 |
NNP |
denotes |
Searle |
| T1206 |
3542-3546 |
CD |
denotes |
1968 |
| T1207 |
3546-3547 |
: |
denotes |
; |
| T1208 |
3548-3555 |
NNP |
denotes |
Silvers |
| T1209 |
3556-3560 |
CD |
denotes |
1979 |
| T1210 |
3560-3561 |
-RRB- |
denotes |
) |
| T1211 |
3561-3563 |
, |
denotes |
, |
| T1212 |
3563-3566 |
CC |
denotes |
and |
| T1213 |
3567-3571 |
JJ |
denotes |
many |
| T1214 |
3583-3593 |
NNS |
denotes |
components |
| T1215 |
3572-3582 |
JJ |
denotes |
pigmentary |
| T1216 |
3604-3614 |
VBN |
denotes |
identified |
| T1217 |
3594-3598 |
VBP |
denotes |
have |
| T1218 |
3599-3603 |
VBN |
denotes |
been |
| T1219 |
3615-3620 |
WP$ |
denotes |
whose |
| T1220 |
3621-3628 |
NNS |
denotes |
actions |
| T1221 |
3633-3643 |
VBN |
denotes |
understood |
| T1222 |
3629-3632 |
VBP |
denotes |
are |
| T1223 |
3644-3646 |
IN |
denotes |
in |
| T1224 |
3647-3648 |
DT |
denotes |
a |
| T1225 |
3673-3680 |
NN |
denotes |
context |
| T1226 |
3649-3657 |
JJ |
denotes |
cellular |
| T1227 |
3658-3660 |
CC |
denotes |
or |
| T1228 |
3661-3666 |
NN |
denotes |
organ |
| T1229 |
3667-3672 |
VBN |
denotes |
based |
| T1230 |
3666-3667 |
HYPH |
denotes |
- |
| T1231 |
3681-3682 |
-LRB- |
denotes |
( |
| T1232 |
3682-3690 |
VBN |
denotes |
reviewed |
| T1233 |
3691-3693 |
IN |
denotes |
in |
| T1234 |
3694-3701 |
NNP |
denotes |
Bennett |
| T1235 |
3702-3705 |
CC |
denotes |
and |
| T1236 |
3706-3714 |
NNP |
denotes |
Lamoreux |
| T1237 |
3715-3719 |
CD |
denotes |
2003 |
| T1238 |
3719-3720 |
-RRB- |
denotes |
) |
| T1239 |
3720-3721 |
. |
denotes |
. |
| T1240 |
3721-3807 |
sentence |
denotes |
Several mechanisms may contribute to regional differences in vertebrate pigmentation. |
| T1241 |
3722-3729 |
JJ |
denotes |
Several |
| T1242 |
3730-3740 |
NNS |
denotes |
mechanisms |
| T1243 |
3745-3755 |
VB |
denotes |
contribute |
| T1244 |
3741-3744 |
MD |
denotes |
may |
| T1245 |
3756-3758 |
IN |
denotes |
to |
| T1246 |
3759-3767 |
JJ |
denotes |
regional |
| T1247 |
3768-3779 |
NNS |
denotes |
differences |
| T1248 |
3780-3782 |
IN |
denotes |
in |
| T1249 |
3783-3793 |
NN |
denotes |
vertebrate |
| T1250 |
3794-3806 |
NN |
denotes |
pigmentation |
| T1251 |
3806-3807 |
. |
denotes |
. |
| T1252 |
3807-4002 |
sentence |
denotes |
In the embryo, alterations in the determination or migration of melanoblasts from the neural crest affect the number or distribution of pigment cells in the skin (reviewed in Reedy et al. 1998). |
| T1253 |
3808-3810 |
IN |
denotes |
In |
| T1254 |
3907-3913 |
VBP |
denotes |
affect |
| T1255 |
3811-3814 |
DT |
denotes |
the |
| T1256 |
3815-3821 |
NN |
denotes |
embryo |
| T1257 |
3821-3823 |
, |
denotes |
, |
| T1258 |
3823-3834 |
NNS |
denotes |
alterations |
| T1259 |
3835-3837 |
IN |
denotes |
in |
| T1260 |
3838-3841 |
DT |
denotes |
the |
| T1261 |
3842-3855 |
NN |
denotes |
determination |
| T1262 |
3856-3858 |
CC |
denotes |
or |
| T1263 |
3859-3868 |
NN |
denotes |
migration |
| T1264 |
3869-3871 |
IN |
denotes |
of |
| T1265 |
3872-3884 |
NNS |
denotes |
melanoblasts |
| T1266 |
3885-3889 |
IN |
denotes |
from |
| T1267 |
3890-3893 |
DT |
denotes |
the |
| T1268 |
3901-3906 |
NN |
denotes |
crest |
| T1269 |
3894-3900 |
JJ |
denotes |
neural |
| T1270 |
3914-3917 |
DT |
denotes |
the |
| T1271 |
3918-3924 |
NN |
denotes |
number |
| T1272 |
3925-3927 |
CC |
denotes |
or |
| T1273 |
3928-3940 |
NN |
denotes |
distribution |
| T1274 |
3941-3943 |
IN |
denotes |
of |
| T1275 |
3944-3951 |
NN |
denotes |
pigment |
| T1276 |
3952-3957 |
NNS |
denotes |
cells |
| T1277 |
3958-3960 |
IN |
denotes |
in |
| T1278 |
3961-3964 |
DT |
denotes |
the |
| T1279 |
3965-3969 |
NN |
denotes |
skin |
| T1280 |
3970-3971 |
-LRB- |
denotes |
( |
| T1281 |
3971-3979 |
VBN |
denotes |
reviewed |
| T1282 |
3980-3982 |
IN |
denotes |
in |
| T1283 |
3983-3988 |
NNP |
denotes |
Reedy |
| T1284 |
3989-3991 |
FW |
denotes |
et |
| T1285 |
3992-3995 |
FW |
denotes |
al. |
| T1286 |
3996-4000 |
CD |
denotes |
1998 |
| T1287 |
4000-4001 |
-RRB- |
denotes |
) |
| T1288 |
4001-4002 |
. |
denotes |
. |
| T1289 |
4002-4206 |
sentence |
denotes |
Within hair follicles, paracrine signals control the type of pigment made in specific regions of the body or at specific times during the hair cycle (reviewed in Furumura et al. 1996; Barsh et al. 2000). |
| T1290 |
4003-4009 |
IN |
denotes |
Within |
| T1291 |
4044-4051 |
VBP |
denotes |
control |
| T1292 |
4010-4014 |
NN |
denotes |
hair |
| T1293 |
4015-4024 |
NNS |
denotes |
follicles |
| T1294 |
4024-4026 |
, |
denotes |
, |
| T1295 |
4026-4035 |
JJ |
denotes |
paracrine |
| T1296 |
4036-4043 |
NNS |
denotes |
signals |
| T1297 |
4052-4055 |
DT |
denotes |
the |
| T1298 |
4056-4060 |
NN |
denotes |
type |
| T1299 |
4061-4063 |
IN |
denotes |
of |
| T1300 |
4064-4071 |
NN |
denotes |
pigment |
| T1301 |
4072-4076 |
VBN |
denotes |
made |
| T1302 |
4077-4079 |
IN |
denotes |
in |
| T1303 |
4080-4088 |
JJ |
denotes |
specific |
| T1304 |
4089-4096 |
NNS |
denotes |
regions |
| T1305 |
4097-4099 |
IN |
denotes |
of |
| T1306 |
4100-4103 |
DT |
denotes |
the |
| T1307 |
4104-4108 |
NN |
denotes |
body |
| T1308 |
4109-4111 |
CC |
denotes |
or |
| T1309 |
4112-4114 |
IN |
denotes |
at |
| T1310 |
4115-4123 |
JJ |
denotes |
specific |
| T1311 |
4124-4129 |
NNS |
denotes |
times |
| T1312 |
4130-4136 |
IN |
denotes |
during |
| T1313 |
4137-4140 |
DT |
denotes |
the |
| T1314 |
4146-4151 |
NN |
denotes |
cycle |
| T1315 |
4141-4145 |
NN |
denotes |
hair |
| T1316 |
4152-4153 |
-LRB- |
denotes |
( |
| T1317 |
4153-4161 |
VBN |
denotes |
reviewed |
| T1318 |
4162-4164 |
IN |
denotes |
in |
| T1319 |
4165-4173 |
NNP |
denotes |
Furumura |
| T1320 |
4174-4176 |
FW |
denotes |
et |
| T1321 |
4177-4180 |
FW |
denotes |
al. |
| T1322 |
4181-4185 |
CD |
denotes |
1996 |
| T1323 |
4185-4186 |
: |
denotes |
; |
| T1324 |
4187-4192 |
NNP |
denotes |
Barsh |
| T1325 |
4193-4195 |
FW |
denotes |
et |
| T1326 |
4196-4199 |
FW |
denotes |
al. |
| T1327 |
4200-4204 |
CD |
denotes |
2000 |
| T1328 |
4204-4205 |
-RRB- |
denotes |
) |
| T1329 |
4205-4206 |
. |
denotes |
. |
| T1330 |
4206-4463 |
sentence |
denotes |
Finally, movement of pigment granules within melanocytes or from melanocytes to keratinocytes makes use of cellular machinery that is shared by a variety of cell types, but that can vary in different regions of the body (reviewed in Marks and Seabra 2001). |
| T1331 |
4207-4214 |
RB |
denotes |
Finally |
| T1332 |
4301-4306 |
VBZ |
denotes |
makes |
| T1333 |
4214-4216 |
, |
denotes |
, |
| T1334 |
4216-4224 |
NN |
denotes |
movement |
| T1335 |
4225-4227 |
IN |
denotes |
of |
| T1336 |
4228-4235 |
NN |
denotes |
pigment |
| T1337 |
4236-4244 |
NNS |
denotes |
granules |
| T1338 |
4245-4251 |
IN |
denotes |
within |
| T1339 |
4252-4263 |
NNS |
denotes |
melanocytes |
| T1340 |
4264-4266 |
CC |
denotes |
or |
| T1341 |
4267-4271 |
IN |
denotes |
from |
| T1342 |
4272-4283 |
NNS |
denotes |
melanocytes |
| T1343 |
4284-4286 |
IN |
denotes |
to |
| T1344 |
4287-4300 |
NNS |
denotes |
keratinocytes |
| T1345 |
4307-4310 |
NN |
denotes |
use |
| T1346 |
4311-4313 |
IN |
denotes |
of |
| T1347 |
4314-4322 |
JJ |
denotes |
cellular |
| T1348 |
4323-4332 |
NN |
denotes |
machinery |
| T1349 |
4333-4337 |
WDT |
denotes |
that |
| T1350 |
4341-4347 |
VBN |
denotes |
shared |
| T1351 |
4338-4340 |
VBZ |
denotes |
is |
| T1352 |
4348-4350 |
IN |
denotes |
by |
| T1353 |
4351-4352 |
DT |
denotes |
a |
| T1354 |
4353-4360 |
NN |
denotes |
variety |
| T1355 |
4361-4363 |
IN |
denotes |
of |
| T1356 |
4364-4368 |
NN |
denotes |
cell |
| T1357 |
4369-4374 |
NNS |
denotes |
types |
| T1358 |
4374-4376 |
, |
denotes |
, |
| T1359 |
4376-4379 |
CC |
denotes |
but |
| T1360 |
4380-4384 |
DT |
denotes |
that |
| T1361 |
4389-4393 |
VB |
denotes |
vary |
| T1362 |
4385-4388 |
MD |
denotes |
can |
| T1363 |
4394-4396 |
IN |
denotes |
in |
| T1364 |
4397-4406 |
JJ |
denotes |
different |
| T1365 |
4407-4414 |
NNS |
denotes |
regions |
| T1366 |
4415-4417 |
IN |
denotes |
of |
| T1367 |
4418-4421 |
DT |
denotes |
the |
| T1368 |
4422-4426 |
NN |
denotes |
body |
| T1369 |
4427-4428 |
-LRB- |
denotes |
( |
| T1370 |
4428-4436 |
VBN |
denotes |
reviewed |
| T1371 |
4437-4439 |
IN |
denotes |
in |
| T1372 |
4440-4445 |
NNP |
denotes |
Marks |
| T1373 |
4446-4449 |
CC |
denotes |
and |
| T1374 |
4450-4456 |
NNP |
denotes |
Seabra |
| T1375 |
4457-4461 |
CD |
denotes |
2001 |
| T1376 |
4461-4462 |
-RRB- |
denotes |
) |
| T1377 |
4462-4463 |
. |
denotes |
. |
| T1378 |
4463-4668 |
sentence |
denotes |
However, for all of these mechanisms—white spotting, pigment-type switching, and melanosome biogenesis—more is known about the identity of the molecular components than their spatial and temporal control. |
| T1379 |
4464-4471 |
RB |
denotes |
However |
| T1380 |
4575-4580 |
VBN |
denotes |
known |
| T1381 |
4471-4473 |
, |
denotes |
, |
| T1382 |
4473-4476 |
IN |
denotes |
for |
| T1383 |
4477-4480 |
DT |
denotes |
all |
| T1384 |
4481-4483 |
IN |
denotes |
of |
| T1385 |
4484-4489 |
DT |
denotes |
these |
| T1386 |
4490-4500 |
NNS |
denotes |
mechanisms |
| T1387 |
4500-4501 |
HYPH |
denotes |
— |
| T1388 |
4501-4506 |
JJ |
denotes |
white |
| T1389 |
4507-4515 |
NN |
denotes |
spotting |
| T1390 |
4515-4517 |
, |
denotes |
, |
| T1391 |
4517-4524 |
NN |
denotes |
pigment |
| T1392 |
4525-4529 |
NN |
denotes |
type |
| T1393 |
4524-4525 |
HYPH |
denotes |
- |
| T1394 |
4530-4539 |
VBG |
denotes |
switching |
| T1395 |
4539-4541 |
, |
denotes |
, |
| T1396 |
4541-4544 |
CC |
denotes |
and |
| T1397 |
4545-4555 |
NN |
denotes |
melanosome |
| T1398 |
4556-4566 |
NN |
denotes |
biogenesis |
| T1399 |
4566-4567 |
HYPH |
denotes |
— |
| T1400 |
4567-4571 |
JJR |
denotes |
more |
| T1401 |
4572-4574 |
VBZ |
denotes |
is |
| T1402 |
4581-4586 |
IN |
denotes |
about |
| T1403 |
4587-4590 |
DT |
denotes |
the |
| T1404 |
4591-4599 |
NN |
denotes |
identity |
| T1405 |
4600-4602 |
IN |
denotes |
of |
| T1406 |
4603-4606 |
DT |
denotes |
the |
| T1407 |
4617-4627 |
NNS |
denotes |
components |
| T1408 |
4607-4616 |
JJ |
denotes |
molecular |
| T1409 |
4628-4632 |
IN |
denotes |
than |
| T1410 |
4633-4638 |
PRP$ |
denotes |
their |
| T1411 |
4660-4667 |
NN |
denotes |
control |
| T1412 |
4639-4646 |
JJ |
denotes |
spatial |
| T1413 |
4647-4650 |
CC |
denotes |
and |
| T1414 |
4651-4659 |
JJ |
denotes |
temporal |
| T1415 |
4667-4668 |
. |
denotes |
. |
| T1416 |
4668-4979 |
sentence |
denotes |
One of the most obvious aspects of regional color variation in vertebrates is a dark dorsal surface juxtaposed to a light ventral surface, apparent in the color of skin, scales, feathers, or hair, in which the boundary between dorsal and ventral compartments is often sharp and lies in register with the limbs. |
| T1417 |
4669-4672 |
CD |
denotes |
One |
| T1418 |
4744-4746 |
VBZ |
denotes |
is |
| T1419 |
4673-4675 |
IN |
denotes |
of |
| T1420 |
4676-4679 |
DT |
denotes |
the |
| T1421 |
4693-4700 |
NNS |
denotes |
aspects |
| T1422 |
4680-4684 |
RBS |
denotes |
most |
| T1423 |
4685-4692 |
JJ |
denotes |
obvious |
| T1424 |
4701-4703 |
IN |
denotes |
of |
| T1425 |
4704-4712 |
JJ |
denotes |
regional |
| T1426 |
4719-4728 |
NN |
denotes |
variation |
| T1427 |
4713-4718 |
NN |
denotes |
color |
| T1428 |
4729-4731 |
IN |
denotes |
in |
| T1429 |
4732-4743 |
NNS |
denotes |
vertebrates |
| T1430 |
4747-4748 |
DT |
denotes |
a |
| T1431 |
4761-4768 |
NN |
denotes |
surface |
| T1432 |
4749-4753 |
JJ |
denotes |
dark |
| T1433 |
4754-4760 |
JJ |
denotes |
dorsal |
| T1434 |
4769-4779 |
VBN |
denotes |
juxtaposed |
| T1435 |
4780-4782 |
IN |
denotes |
to |
| T1436 |
4783-4784 |
DT |
denotes |
a |
| T1437 |
4799-4806 |
NN |
denotes |
surface |
| T1438 |
4785-4790 |
JJ |
denotes |
light |
| T1439 |
4791-4798 |
JJ |
denotes |
ventral |
| T1440 |
4806-4808 |
, |
denotes |
, |
| T1441 |
4808-4816 |
JJ |
denotes |
apparent |
| T1442 |
4817-4819 |
IN |
denotes |
in |
| T1443 |
4820-4823 |
DT |
denotes |
the |
| T1444 |
4824-4829 |
NN |
denotes |
color |
| T1445 |
4830-4832 |
IN |
denotes |
of |
| T1446 |
4833-4837 |
NN |
denotes |
skin |
| T1447 |
4837-4839 |
, |
denotes |
, |
| T1448 |
4839-4845 |
NNS |
denotes |
scales |
| T1449 |
4845-4847 |
, |
denotes |
, |
| T1450 |
4847-4855 |
NNS |
denotes |
feathers |
| T1451 |
4855-4857 |
, |
denotes |
, |
| T1452 |
4857-4859 |
CC |
denotes |
or |
| T1453 |
4860-4864 |
NN |
denotes |
hair |
| T1454 |
4864-4866 |
, |
denotes |
, |
| T1455 |
4866-4868 |
IN |
denotes |
in |
| T1456 |
4928-4930 |
VBZ |
denotes |
is |
| T1457 |
4869-4874 |
WDT |
denotes |
which |
| T1458 |
4875-4878 |
DT |
denotes |
the |
| T1459 |
4879-4887 |
NN |
denotes |
boundary |
| T1460 |
4888-4895 |
IN |
denotes |
between |
| T1461 |
4896-4902 |
JJ |
denotes |
dorsal |
| T1462 |
4915-4927 |
NNS |
denotes |
compartments |
| T1463 |
4903-4906 |
CC |
denotes |
and |
| T1464 |
4907-4914 |
JJ |
denotes |
ventral |
| T1465 |
4931-4936 |
RB |
denotes |
often |
| T1466 |
4937-4942 |
JJ |
denotes |
sharp |
| T1467 |
4943-4946 |
CC |
denotes |
and |
| T1468 |
4947-4951 |
VBZ |
denotes |
lies |
| T1469 |
4952-4954 |
IN |
denotes |
in |
| T1470 |
4955-4963 |
NN |
denotes |
register |
| T1471 |
4964-4968 |
IN |
denotes |
with |
| T1472 |
4969-4972 |
DT |
denotes |
the |
| T1473 |
4973-4978 |
NNS |
denotes |
limbs |
| T1474 |
4978-4979 |
. |
denotes |
. |
| T1475 |
4979-5206 |
sentence |
denotes |
In rodents and probably other mammals, this dorsoventral difference in hair color is brought about by differences in pigment type as determined by allelic variation of the Agouti gene (Bultman et al. 1992; Miller et al. 1993). |
| T1476 |
4980-4982 |
IN |
denotes |
In |
| T1477 |
5065-5072 |
VBN |
denotes |
brought |
| T1478 |
4983-4990 |
NNS |
denotes |
rodents |
| T1479 |
4991-4994 |
CC |
denotes |
and |
| T1480 |
4995-5003 |
RB |
denotes |
probably |
| T1481 |
5010-5017 |
NNS |
denotes |
mammals |
| T1482 |
5004-5009 |
JJ |
denotes |
other |
| T1483 |
5017-5019 |
, |
denotes |
, |
| T1484 |
5019-5023 |
DT |
denotes |
this |
| T1485 |
5037-5047 |
NN |
denotes |
difference |
| T1486 |
5024-5036 |
JJ |
denotes |
dorsoventral |
| T1487 |
5048-5050 |
IN |
denotes |
in |
| T1488 |
5051-5055 |
NN |
denotes |
hair |
| T1489 |
5056-5061 |
NN |
denotes |
color |
| T1490 |
5062-5064 |
VBZ |
denotes |
is |
| T1491 |
5073-5078 |
RP |
denotes |
about |
| T1492 |
5079-5081 |
IN |
denotes |
by |
| T1493 |
5082-5093 |
NNS |
denotes |
differences |
| T1494 |
5094-5096 |
IN |
denotes |
in |
| T1495 |
5097-5104 |
NN |
denotes |
pigment |
| T1496 |
5105-5109 |
NN |
denotes |
type |
| T1497 |
5110-5112 |
IN |
denotes |
as |
| T1498 |
5113-5123 |
VBN |
denotes |
determined |
| T1499 |
5124-5126 |
IN |
denotes |
by |
| T1500 |
5127-5134 |
JJ |
denotes |
allelic |
| T1501 |
5135-5144 |
NN |
denotes |
variation |
| T1502 |
5145-5147 |
IN |
denotes |
of |
| T1503 |
5148-5151 |
DT |
denotes |
the |
| T1504 |
5159-5163 |
NN |
denotes |
gene |
| T1505 |
5152-5158 |
NN |
denotes |
Agouti |
| T1506 |
5164-5165 |
-LRB- |
denotes |
( |
| T1507 |
5165-5172 |
NNP |
denotes |
Bultman |
| T1508 |
5173-5175 |
FW |
denotes |
et |
| T1509 |
5176-5179 |
FW |
denotes |
al. |
| T1510 |
5180-5184 |
CD |
denotes |
1992 |
| T1511 |
5184-5185 |
: |
denotes |
; |
| T1512 |
5186-5192 |
NNP |
denotes |
Miller |
| T1513 |
5193-5195 |
FW |
denotes |
et |
| T1514 |
5196-5199 |
FW |
denotes |
al. |
| T1515 |
5200-5204 |
CD |
denotes |
1993 |
| T1516 |
5204-5205 |
-RRB- |
denotes |
) |
| T1517 |
5205-5206 |
. |
denotes |
. |
| T1518 |
5206-5420 |
sentence |
denotes |
Secreted by dermal papilla cells within each hair follicle (Millar et al. 1995), Agouti protein causes melanocytes in that follicle to switch from the production of brown/black eumelanin to red/yellow pheomelanin. |
| T1519 |
5207-5215 |
VBN |
denotes |
Secreted |
| T1520 |
5303-5309 |
VBZ |
denotes |
causes |
| T1521 |
5216-5218 |
IN |
denotes |
by |
| T1522 |
5219-5225 |
JJ |
denotes |
dermal |
| T1523 |
5234-5239 |
NNS |
denotes |
cells |
| T1524 |
5226-5233 |
NN |
denotes |
papilla |
| T1525 |
5240-5246 |
IN |
denotes |
within |
| T1526 |
5247-5251 |
DT |
denotes |
each |
| T1527 |
5257-5265 |
NN |
denotes |
follicle |
| T1528 |
5252-5256 |
NN |
denotes |
hair |
| T1529 |
5266-5267 |
-LRB- |
denotes |
( |
| T1530 |
5267-5273 |
NNP |
denotes |
Millar |
| T1531 |
5274-5276 |
FW |
denotes |
et |
| T1532 |
5277-5280 |
FW |
denotes |
al. |
| T1533 |
5281-5285 |
CD |
denotes |
1995 |
| T1534 |
5285-5286 |
-RRB- |
denotes |
) |
| T1535 |
5286-5288 |
, |
denotes |
, |
| T1536 |
5288-5294 |
NN |
denotes |
Agouti |
| T1537 |
5295-5302 |
NN |
denotes |
protein |
| T1538 |
5310-5321 |
NNS |
denotes |
melanocytes |
| T1539 |
5342-5348 |
VB |
denotes |
switch |
| T1540 |
5322-5324 |
IN |
denotes |
in |
| T1541 |
5325-5329 |
DT |
denotes |
that |
| T1542 |
5330-5338 |
NN |
denotes |
follicle |
| T1543 |
5339-5341 |
TO |
denotes |
to |
| T1544 |
5349-5353 |
IN |
denotes |
from |
| T1545 |
5354-5357 |
DT |
denotes |
the |
| T1546 |
5358-5368 |
NN |
denotes |
production |
| T1547 |
5369-5371 |
IN |
denotes |
of |
| T1548 |
5372-5377 |
JJ |
denotes |
brown |
| T1549 |
5378-5383 |
JJ |
denotes |
black |
| T1550 |
5377-5378 |
HYPH |
denotes |
/ |
| T1551 |
5384-5393 |
NN |
denotes |
eumelanin |
| T1552 |
5394-5396 |
IN |
denotes |
to |
| T1553 |
5397-5400 |
JJ |
denotes |
red |
| T1554 |
5401-5407 |
JJ |
denotes |
yellow |
| T1555 |
5400-5401 |
HYPH |
denotes |
/ |
| T1556 |
5408-5419 |
NN |
denotes |
pheomelanin |
| T1557 |
5419-5420 |
. |
denotes |
. |
| T1558 |
5420-5889 |
sentence |
denotes |
Agouti protein has a short radius of action (Silvers and Russel 1955) and can be switched on and off during a single hair cycle (Bultman et al. 1992, 1994; Miller et al. 1993; Vrieling et al. 1994); thus, its regulated expression is thought to be responsible for the cream-colored or yellow ventral surface of mice carrying the black-and-tan (at) allele and for the yellow markings around the feet, ears, or head, i.e., tan points or head spots, of certain dog breeds. |
| T1559 |
5421-5427 |
NN |
denotes |
Agouti |
| T1560 |
5428-5435 |
NN |
denotes |
protein |
| T1561 |
5436-5439 |
VBZ |
denotes |
has |
| T1562 |
5654-5661 |
VBN |
denotes |
thought |
| T1563 |
5440-5441 |
DT |
denotes |
a |
| T1564 |
5448-5454 |
NN |
denotes |
radius |
| T1565 |
5442-5447 |
JJ |
denotes |
short |
| T1566 |
5455-5457 |
IN |
denotes |
of |
| T1567 |
5458-5464 |
NN |
denotes |
action |
| T1568 |
5465-5466 |
-LRB- |
denotes |
( |
| T1569 |
5466-5473 |
NNP |
denotes |
Silvers |
| T1570 |
5474-5477 |
CC |
denotes |
and |
| T1571 |
5478-5484 |
NNP |
denotes |
Russel |
| T1572 |
5485-5489 |
CD |
denotes |
1955 |
| T1573 |
5489-5490 |
-RRB- |
denotes |
) |
| T1574 |
5491-5494 |
CC |
denotes |
and |
| T1575 |
5495-5498 |
MD |
denotes |
can |
| T1576 |
5502-5510 |
VBN |
denotes |
switched |
| T1577 |
5499-5501 |
VB |
denotes |
be |
| T1578 |
5511-5513 |
RP |
denotes |
on |
| T1579 |
5514-5517 |
CC |
denotes |
and |
| T1580 |
5518-5521 |
RP |
denotes |
off |
| T1581 |
5522-5528 |
IN |
denotes |
during |
| T1582 |
5529-5530 |
DT |
denotes |
a |
| T1583 |
5543-5548 |
NN |
denotes |
cycle |
| T1584 |
5531-5537 |
JJ |
denotes |
single |
| T1585 |
5538-5542 |
NN |
denotes |
hair |
| T1586 |
5549-5550 |
-LRB- |
denotes |
( |
| T1587 |
5550-5557 |
NNP |
denotes |
Bultman |
| T1588 |
5558-5560 |
FW |
denotes |
et |
| T1589 |
5561-5564 |
FW |
denotes |
al. |
| T1590 |
5565-5569 |
CD |
denotes |
1992 |
| T1591 |
5569-5571 |
, |
denotes |
, |
| T1592 |
5571-5575 |
CD |
denotes |
1994 |
| T1593 |
5575-5576 |
: |
denotes |
; |
| T1594 |
5577-5583 |
NNP |
denotes |
Miller |
| T1595 |
5584-5586 |
FW |
denotes |
et |
| T1596 |
5587-5590 |
FW |
denotes |
al. |
| T1597 |
5591-5595 |
CD |
denotes |
1993 |
| T1598 |
5595-5596 |
: |
denotes |
; |
| T1599 |
5597-5605 |
NNP |
denotes |
Vrieling |
| T1600 |
5606-5608 |
FW |
denotes |
et |
| T1601 |
5609-5612 |
FW |
denotes |
al. |
| T1602 |
5613-5617 |
CD |
denotes |
1994 |
| T1603 |
5617-5618 |
-RRB- |
denotes |
) |
| T1604 |
5618-5619 |
: |
denotes |
; |
| T1605 |
5620-5624 |
RB |
denotes |
thus |
| T1606 |
5624-5626 |
, |
denotes |
, |
| T1607 |
5626-5629 |
PRP$ |
denotes |
its |
| T1608 |
5640-5650 |
NN |
denotes |
expression |
| T1609 |
5630-5639 |
VBN |
denotes |
regulated |
| T1610 |
5651-5653 |
VBZ |
denotes |
is |
| T1611 |
5662-5664 |
TO |
denotes |
to |
| T1612 |
5665-5667 |
VB |
denotes |
be |
| T1613 |
5668-5679 |
JJ |
denotes |
responsible |
| T1614 |
5680-5683 |
IN |
denotes |
for |
| T1615 |
5684-5687 |
DT |
denotes |
the |
| T1616 |
5720-5727 |
NN |
denotes |
surface |
| T1617 |
5688-5693 |
NN |
denotes |
cream |
| T1618 |
5694-5701 |
VBN |
denotes |
colored |
| T1619 |
5693-5694 |
HYPH |
denotes |
- |
| T1620 |
5702-5704 |
CC |
denotes |
or |
| T1621 |
5705-5711 |
JJ |
denotes |
yellow |
| T1622 |
5712-5719 |
JJ |
denotes |
ventral |
| T1623 |
5728-5730 |
IN |
denotes |
of |
| T1624 |
5731-5735 |
NNS |
denotes |
mice |
| T1625 |
5736-5744 |
VBG |
denotes |
carrying |
| T1626 |
5745-5748 |
DT |
denotes |
the |
| T1627 |
5768-5774 |
NN |
denotes |
allele |
| T1628 |
5749-5754 |
JJ |
denotes |
black |
| T1629 |
5754-5755 |
HYPH |
denotes |
- |
| T1630 |
5755-5758 |
CC |
denotes |
and |
| T1631 |
5758-5759 |
HYPH |
denotes |
- |
| T1632 |
5759-5762 |
JJ |
denotes |
tan |
| T1633 |
5763-5764 |
-LRB- |
denotes |
( |
| T1634 |
5764-5766 |
NN |
denotes |
at |
| T1635 |
5766-5767 |
-RRB- |
denotes |
) |
| T1636 |
5775-5778 |
CC |
denotes |
and |
| T1637 |
5779-5782 |
IN |
denotes |
for |
| T1638 |
5783-5786 |
DT |
denotes |
the |
| T1639 |
5794-5802 |
NNS |
denotes |
markings |
| T1640 |
5787-5793 |
JJ |
denotes |
yellow |
| T1641 |
5803-5809 |
IN |
denotes |
around |
| T1642 |
5810-5813 |
DT |
denotes |
the |
| T1643 |
5814-5818 |
NNS |
denotes |
feet |
| T1644 |
5818-5820 |
, |
denotes |
, |
| T1645 |
5820-5824 |
NNS |
denotes |
ears |
| T1646 |
5824-5826 |
, |
denotes |
, |
| T1647 |
5826-5828 |
CC |
denotes |
or |
| T1648 |
5829-5833 |
NN |
denotes |
head |
| T1649 |
5833-5835 |
, |
denotes |
, |
| T1650 |
5835-5839 |
FW |
denotes |
i.e. |
| T1651 |
5845-5851 |
NNS |
denotes |
points |
| T1652 |
5839-5841 |
, |
denotes |
, |
| T1653 |
5841-5844 |
JJ |
denotes |
tan |
| T1654 |
5852-5854 |
CC |
denotes |
or |
| T1655 |
5855-5859 |
NN |
denotes |
head |
| T1656 |
5860-5865 |
NNS |
denotes |
spots |
| T1657 |
5865-5867 |
, |
denotes |
, |
| T1658 |
5867-5869 |
IN |
denotes |
of |
| T1659 |
5870-5877 |
JJ |
denotes |
certain |
| T1660 |
5882-5888 |
NNS |
denotes |
breeds |
| T1661 |
5878-5881 |
NN |
denotes |
dog |
| T1662 |
5888-5889 |
. |
denotes |
. |
| T1663 |
5889-6090 |
sentence |
denotes |
In laboratory mice, previous studies from our group and others identified two predominant Agouti mRNA isoforms that differ by virtue of their transcriptional initiation site and 5′ untranslated exons. |
| T1664 |
5890-5892 |
IN |
denotes |
In |
| T1665 |
5953-5963 |
VBD |
denotes |
identified |
| T1666 |
5893-5903 |
NN |
denotes |
laboratory |
| T1667 |
5904-5908 |
NNS |
denotes |
mice |
| T1668 |
5908-5910 |
, |
denotes |
, |
| T1669 |
5910-5918 |
JJ |
denotes |
previous |
| T1670 |
5919-5926 |
NNS |
denotes |
studies |
| T1671 |
5927-5931 |
IN |
denotes |
from |
| T1672 |
5932-5935 |
PRP$ |
denotes |
our |
| T1673 |
5936-5941 |
NN |
denotes |
group |
| T1674 |
5942-5945 |
CC |
denotes |
and |
| T1675 |
5946-5952 |
NNS |
denotes |
others |
| T1676 |
5964-5967 |
CD |
denotes |
two |
| T1677 |
5992-6000 |
NNS |
denotes |
isoforms |
| T1678 |
5968-5979 |
JJ |
denotes |
predominant |
| T1679 |
5980-5986 |
NN |
denotes |
Agouti |
| T1680 |
5987-5991 |
NN |
denotes |
mRNA |
| T1681 |
6001-6005 |
WDT |
denotes |
that |
| T1682 |
6006-6012 |
VBP |
denotes |
differ |
| T1683 |
6013-6015 |
IN |
denotes |
by |
| T1684 |
6016-6022 |
NN |
denotes |
virtue |
| T1685 |
6023-6025 |
IN |
denotes |
of |
| T1686 |
6026-6031 |
PRP$ |
denotes |
their |
| T1687 |
6059-6063 |
NN |
denotes |
site |
| T1688 |
6032-6047 |
JJ |
denotes |
transcriptional |
| T1689 |
6048-6058 |
NN |
denotes |
initiation |
| T1690 |
6064-6067 |
CC |
denotes |
and |
| T1691 |
6068-6069 |
CD |
denotes |
5 |
| T1692 |
6084-6089 |
NNS |
denotes |
exons |
| T1693 |
6069-6070 |
SYM |
denotes |
′ |
| T1694 |
6071-6083 |
JJ |
denotes |
untranslated |
| T1695 |
6089-6090 |
. |
denotes |
. |
| T1696 |
6090-6382 |
sentence |
denotes |
A “hair cycle-specific” transcript is expressed in both dorsal and ventral skin for 2–3 days during early hair growth, while a “ventral-specific” transcript is expressed throughout the entire period of active hair growth, but only in ventral skin (Bultman et al. 1994; Vrieling et al. 1994). |
| T1697 |
6091-6092 |
DT |
denotes |
A |
| T1698 |
6115-6125 |
NN |
denotes |
transcript |
| T1699 |
6093-6094 |
`` |
denotes |
“ |
| T1700 |
6094-6098 |
NN |
denotes |
hair |
| T1701 |
6099-6104 |
NN |
denotes |
cycle |
| T1702 |
6105-6113 |
JJ |
denotes |
specific |
| T1703 |
6104-6105 |
HYPH |
denotes |
- |
| T1704 |
6113-6114 |
'' |
denotes |
” |
| T1705 |
6129-6138 |
VBN |
denotes |
expressed |
| T1706 |
6126-6128 |
VBZ |
denotes |
is |
| T1707 |
6139-6141 |
IN |
denotes |
in |
| T1708 |
6142-6146 |
CC |
denotes |
both |
| T1709 |
6147-6153 |
JJ |
denotes |
dorsal |
| T1710 |
6166-6170 |
NN |
denotes |
skin |
| T1711 |
6154-6157 |
CC |
denotes |
and |
| T1712 |
6158-6165 |
JJ |
denotes |
ventral |
| T1713 |
6171-6174 |
IN |
denotes |
for |
| T1714 |
6175-6176 |
CD |
denotes |
2 |
| T1715 |
6177-6178 |
CD |
denotes |
3 |
| T1716 |
6176-6177 |
HYPH |
denotes |
– |
| T1717 |
6179-6183 |
NNS |
denotes |
days |
| T1718 |
6184-6190 |
IN |
denotes |
during |
| T1719 |
6191-6196 |
JJ |
denotes |
early |
| T1720 |
6202-6208 |
NN |
denotes |
growth |
| T1721 |
6197-6201 |
NN |
denotes |
hair |
| T1722 |
6208-6210 |
, |
denotes |
, |
| T1723 |
6210-6215 |
IN |
denotes |
while |
| T1724 |
6251-6260 |
VBN |
denotes |
expressed |
| T1725 |
6216-6217 |
DT |
denotes |
a |
| T1726 |
6237-6247 |
NN |
denotes |
transcript |
| T1727 |
6218-6219 |
`` |
denotes |
“ |
| T1728 |
6219-6226 |
JJ |
denotes |
ventral |
| T1729 |
6227-6235 |
JJ |
denotes |
specific |
| T1730 |
6226-6227 |
HYPH |
denotes |
- |
| T1731 |
6235-6236 |
'' |
denotes |
” |
| T1732 |
6248-6250 |
VBZ |
denotes |
is |
| T1733 |
6261-6271 |
IN |
denotes |
throughout |
| T1734 |
6272-6275 |
DT |
denotes |
the |
| T1735 |
6283-6289 |
NN |
denotes |
period |
| T1736 |
6276-6282 |
JJ |
denotes |
entire |
| T1737 |
6290-6292 |
IN |
denotes |
of |
| T1738 |
6293-6299 |
JJ |
denotes |
active |
| T1739 |
6305-6311 |
NN |
denotes |
growth |
| T1740 |
6300-6304 |
NN |
denotes |
hair |
| T1741 |
6311-6313 |
, |
denotes |
, |
| T1742 |
6313-6316 |
CC |
denotes |
but |
| T1743 |
6317-6321 |
RB |
denotes |
only |
| T1744 |
6322-6324 |
IN |
denotes |
in |
| T1745 |
6325-6332 |
JJ |
denotes |
ventral |
| T1746 |
6333-6337 |
NN |
denotes |
skin |
| T1747 |
6338-6339 |
-LRB- |
denotes |
( |
| T1748 |
6339-6346 |
NNP |
denotes |
Bultman |
| T1749 |
6347-6349 |
FW |
denotes |
et |
| T1750 |
6350-6353 |
FW |
denotes |
al. |
| T1751 |
6354-6358 |
CD |
denotes |
1994 |
| T1752 |
6358-6359 |
: |
denotes |
; |
| T1753 |
6360-6368 |
NNP |
denotes |
Vrieling |
| T1754 |
6369-6371 |
FW |
denotes |
et |
| T1755 |
6372-6375 |
FW |
denotes |
al. |
| T1756 |
6376-6380 |
CD |
denotes |
1994 |
| T1757 |
6380-6381 |
-RRB- |
denotes |
) |
| T1758 |
6381-6382 |
. |
denotes |
. |
| T1759 |
6382-6689 |
sentence |
denotes |
Animals carrying the at allele express only the ventral-specific Agouti transcript (Bultman et al. 1994; Vrieling et al. 1994) and have black dorsal hairs and cream-colored to yellow ventral hairs, with a sharp boundary at the level of the limb–body wall articulations and in the middle of the whisker pad. |
| T1760 |
6383-6390 |
NNS |
denotes |
Animals |
| T1761 |
6414-6421 |
VBP |
denotes |
express |
| T1762 |
6391-6399 |
VBG |
denotes |
carrying |
| T1763 |
6400-6403 |
DT |
denotes |
the |
| T1764 |
6407-6413 |
NN |
denotes |
allele |
| T1765 |
6404-6406 |
NN |
denotes |
at |
| T1766 |
6422-6426 |
RB |
denotes |
only |
| T1767 |
6455-6465 |
NN |
denotes |
transcript |
| T1768 |
6427-6430 |
DT |
denotes |
the |
| T1769 |
6431-6438 |
JJ |
denotes |
ventral |
| T1770 |
6439-6447 |
JJ |
denotes |
specific |
| T1771 |
6438-6439 |
HYPH |
denotes |
- |
| T1772 |
6448-6454 |
NN |
denotes |
Agouti |
| T1773 |
6466-6467 |
-LRB- |
denotes |
( |
| T1774 |
6467-6474 |
NNP |
denotes |
Bultman |
| T1775 |
6475-6477 |
FW |
denotes |
et |
| T1776 |
6478-6481 |
FW |
denotes |
al. |
| T1777 |
6482-6486 |
CD |
denotes |
1994 |
| T1778 |
6486-6487 |
: |
denotes |
; |
| T1779 |
6488-6496 |
NNP |
denotes |
Vrieling |
| T1780 |
6497-6499 |
FW |
denotes |
et |
| T1781 |
6500-6503 |
FW |
denotes |
al. |
| T1782 |
6504-6508 |
CD |
denotes |
1994 |
| T1783 |
6508-6509 |
-RRB- |
denotes |
) |
| T1784 |
6510-6513 |
CC |
denotes |
and |
| T1785 |
6514-6518 |
VBP |
denotes |
have |
| T1786 |
6519-6524 |
JJ |
denotes |
black |
| T1787 |
6532-6537 |
NNS |
denotes |
hairs |
| T1788 |
6525-6531 |
JJ |
denotes |
dorsal |
| T1789 |
6538-6541 |
CC |
denotes |
and |
| T1790 |
6542-6547 |
NN |
denotes |
cream |
| T1791 |
6548-6555 |
VBN |
denotes |
colored |
| T1792 |
6547-6548 |
HYPH |
denotes |
- |
| T1793 |
6574-6579 |
NNS |
denotes |
hairs |
| T1794 |
6556-6558 |
IN |
denotes |
to |
| T1795 |
6559-6565 |
JJ |
denotes |
yellow |
| T1796 |
6566-6573 |
JJ |
denotes |
ventral |
| T1797 |
6579-6581 |
, |
denotes |
, |
| T1798 |
6581-6585 |
IN |
denotes |
with |
| T1799 |
6586-6587 |
DT |
denotes |
a |
| T1800 |
6594-6602 |
NN |
denotes |
boundary |
| T1801 |
6588-6593 |
JJ |
denotes |
sharp |
| T1802 |
6603-6605 |
IN |
denotes |
at |
| T1803 |
6606-6609 |
DT |
denotes |
the |
| T1804 |
6610-6615 |
NN |
denotes |
level |
| T1805 |
6616-6618 |
IN |
denotes |
of |
| T1806 |
6619-6622 |
DT |
denotes |
the |
| T1807 |
6638-6651 |
NNS |
denotes |
articulations |
| T1808 |
6623-6627 |
NN |
denotes |
limb |
| T1809 |
6627-6628 |
HYPH |
denotes |
– |
| T1810 |
6628-6632 |
NN |
denotes |
body |
| T1811 |
6633-6637 |
NN |
denotes |
wall |
| T1812 |
6652-6655 |
CC |
denotes |
and |
| T1813 |
6656-6658 |
IN |
denotes |
in |
| T1814 |
6659-6662 |
DT |
denotes |
the |
| T1815 |
6663-6669 |
NN |
denotes |
middle |
| T1816 |
6670-6672 |
IN |
denotes |
of |
| T1817 |
6673-6676 |
DT |
denotes |
the |
| T1818 |
6685-6688 |
NN |
denotes |
pad |
| T1819 |
6677-6684 |
NN |
denotes |
whisker |
| T1820 |
6688-6689 |
. |
denotes |
. |
| T1821 |
6689-6877 |
sentence |
denotes |
Ventral-specific Agouti isoforms are also expressed in developing skin from embryonic day 10.5 (E10.5) and beyond and may play a role in pigment cell differentiation (Millar et al. 1995). |
| T1822 |
6690-6697 |
JJ |
denotes |
Ventral |
| T1823 |
6698-6706 |
JJ |
denotes |
specific |
| T1824 |
6697-6698 |
HYPH |
denotes |
- |
| T1825 |
6714-6722 |
NNS |
denotes |
isoforms |
| T1826 |
6707-6713 |
NN |
denotes |
Agouti |
| T1827 |
6732-6741 |
VBN |
denotes |
expressed |
| T1828 |
6723-6726 |
VBP |
denotes |
are |
| T1829 |
6727-6731 |
RB |
denotes |
also |
| T1830 |
6742-6744 |
IN |
denotes |
in |
| T1831 |
6745-6755 |
VBG |
denotes |
developing |
| T1832 |
6756-6760 |
NN |
denotes |
skin |
| T1833 |
6761-6765 |
IN |
denotes |
from |
| T1834 |
6766-6775 |
JJ |
denotes |
embryonic |
| T1835 |
6776-6779 |
NN |
denotes |
day |
| T1836 |
6780-6784 |
CD |
denotes |
10.5 |
| T1837 |
6785-6786 |
-LRB- |
denotes |
( |
| T1838 |
6786-6791 |
NN |
denotes |
E10.5 |
| T1839 |
6791-6792 |
-RRB- |
denotes |
) |
| T1840 |
6793-6796 |
CC |
denotes |
and |
| T1841 |
6797-6803 |
RB |
denotes |
beyond |
| T1842 |
6804-6807 |
CC |
denotes |
and |
| T1843 |
6808-6811 |
MD |
denotes |
may |
| T1844 |
6812-6816 |
VB |
denotes |
play |
| T1845 |
6817-6818 |
DT |
denotes |
a |
| T1846 |
6819-6823 |
NN |
denotes |
role |
| T1847 |
6824-6826 |
IN |
denotes |
in |
| T1848 |
6827-6834 |
NN |
denotes |
pigment |
| T1849 |
6840-6855 |
NN |
denotes |
differentiation |
| T1850 |
6835-6839 |
NN |
denotes |
cell |
| T1851 |
6856-6857 |
-LRB- |
denotes |
( |
| T1852 |
6857-6863 |
NNP |
denotes |
Millar |
| T1853 |
6864-6866 |
FW |
denotes |
et |
| T1854 |
6867-6870 |
FW |
denotes |
al. |
| T1855 |
6871-6875 |
CD |
denotes |
1995 |
| T1856 |
6875-6876 |
-RRB- |
denotes |
) |
| T1857 |
6876-6877 |
. |
denotes |
. |
| T1858 |
6877-7052 |
sentence |
denotes |
Thus, regulatory elements for ventral-specific Agouti isoforms are responsive to dorsoventral positional cues established in the embryo and whose effects persist after birth. |
| T1859 |
6878-6882 |
RB |
denotes |
Thus |
| T1860 |
6941-6944 |
VBP |
denotes |
are |
| T1861 |
6882-6884 |
, |
denotes |
, |
| T1862 |
6884-6894 |
JJ |
denotes |
regulatory |
| T1863 |
6895-6903 |
NNS |
denotes |
elements |
| T1864 |
6904-6907 |
IN |
denotes |
for |
| T1865 |
6908-6915 |
JJ |
denotes |
ventral |
| T1866 |
6916-6924 |
JJ |
denotes |
specific |
| T1867 |
6915-6916 |
HYPH |
denotes |
- |
| T1868 |
6932-6940 |
NNS |
denotes |
isoforms |
| T1869 |
6925-6931 |
NN |
denotes |
Agouti |
| T1870 |
6945-6955 |
JJ |
denotes |
responsive |
| T1871 |
6956-6958 |
IN |
denotes |
to |
| T1872 |
6959-6971 |
JJ |
denotes |
dorsoventral |
| T1873 |
6983-6987 |
NNS |
denotes |
cues |
| T1874 |
6972-6982 |
JJ |
denotes |
positional |
| T1875 |
6988-6999 |
VBN |
denotes |
established |
| T1876 |
7000-7002 |
IN |
denotes |
in |
| T1877 |
7003-7006 |
DT |
denotes |
the |
| T1878 |
7007-7013 |
NN |
denotes |
embryo |
| T1879 |
7014-7017 |
CC |
denotes |
and |
| T1880 |
7018-7023 |
WP$ |
denotes |
whose |
| T1881 |
7024-7031 |
NNS |
denotes |
effects |
| T1882 |
7032-7039 |
VBP |
denotes |
persist |
| T1883 |
7040-7045 |
IN |
denotes |
after |
| T1884 |
7046-7051 |
NN |
denotes |
birth |
| T1885 |
7051-7052 |
. |
denotes |
. |
| T1886 |
7052-7374 |
sentence |
denotes |
The boundary between dorsal and ventral color compartments in at/at mice bears superficial resemblance to dorsoventral boundaries apparent for many other mammals, but morphogenetic differences between dorsal and ventral skin seem likely to include more elements than the type of pigment made by hair follicle melanocytes. |
| T1887 |
7053-7056 |
DT |
denotes |
The |
| T1888 |
7057-7065 |
NN |
denotes |
boundary |
| T1889 |
7126-7131 |
VBZ |
denotes |
bears |
| T1890 |
7066-7073 |
IN |
denotes |
between |
| T1891 |
7074-7080 |
JJ |
denotes |
dorsal |
| T1892 |
7099-7111 |
NNS |
denotes |
compartments |
| T1893 |
7081-7084 |
CC |
denotes |
and |
| T1894 |
7085-7092 |
JJ |
denotes |
ventral |
| T1895 |
7093-7098 |
NN |
denotes |
color |
| T1896 |
7112-7114 |
IN |
denotes |
in |
| T1897 |
7115-7117 |
NN |
denotes |
at |
| T1898 |
7118-7120 |
NN |
denotes |
at |
| T1899 |
7117-7118 |
HYPH |
denotes |
/ |
| T1900 |
7121-7125 |
NNS |
denotes |
mice |
| T1901 |
7132-7143 |
JJ |
denotes |
superficial |
| T1902 |
7144-7155 |
NN |
denotes |
resemblance |
| T1903 |
7156-7158 |
IN |
denotes |
to |
| T1904 |
7159-7171 |
JJ |
denotes |
dorsoventral |
| T1905 |
7172-7182 |
NNS |
denotes |
boundaries |
| T1906 |
7183-7191 |
JJ |
denotes |
apparent |
| T1907 |
7192-7195 |
IN |
denotes |
for |
| T1908 |
7196-7200 |
JJ |
denotes |
many |
| T1909 |
7207-7214 |
NNS |
denotes |
mammals |
| T1910 |
7201-7206 |
JJ |
denotes |
other |
| T1911 |
7214-7216 |
, |
denotes |
, |
| T1912 |
7216-7219 |
CC |
denotes |
but |
| T1913 |
7220-7233 |
JJ |
denotes |
morphogenetic |
| T1914 |
7234-7245 |
NNS |
denotes |
differences |
| T1915 |
7278-7282 |
VBP |
denotes |
seem |
| T1916 |
7246-7253 |
IN |
denotes |
between |
| T1917 |
7254-7260 |
JJ |
denotes |
dorsal |
| T1918 |
7273-7277 |
NN |
denotes |
skin |
| T1919 |
7261-7264 |
CC |
denotes |
and |
| T1920 |
7265-7272 |
JJ |
denotes |
ventral |
| T1921 |
7283-7289 |
RB |
denotes |
likely |
| T1922 |
7290-7292 |
TO |
denotes |
to |
| T1923 |
7293-7300 |
VB |
denotes |
include |
| T1924 |
7301-7305 |
JJR |
denotes |
more |
| T1925 |
7306-7314 |
NNS |
denotes |
elements |
| T1926 |
7315-7319 |
IN |
denotes |
than |
| T1927 |
7320-7323 |
DT |
denotes |
the |
| T1928 |
7324-7328 |
NN |
denotes |
type |
| T1929 |
7329-7331 |
IN |
denotes |
of |
| T1930 |
7332-7339 |
NN |
denotes |
pigment |
| T1931 |
7340-7344 |
VBN |
denotes |
made |
| T1932 |
7345-7347 |
IN |
denotes |
by |
| T1933 |
7348-7352 |
NN |
denotes |
hair |
| T1934 |
7353-7361 |
NN |
denotes |
follicle |
| T1935 |
7362-7373 |
NNS |
denotes |
melanocytes |
| T1936 |
7373-7374 |
. |
denotes |
. |
| T1937 |
7374-7792 |
sentence |
denotes |
In particular, dermis of the flank has at least two distinct origins: dermatomal derivatives of somites and loose mesenchyme derived from the lateral plate mesoderm (Mauger 1972; Christ et al. 1983; Olivera-Martinez et al. 2000; Nowicki et al. 2003); these lineages are established early in development and could, in principle, set up compartments whose identity contributes to dorsoventral differences in adult skin. |
| T1938 |
7375-7377 |
IN |
denotes |
In |
| T1939 |
7410-7413 |
VBZ |
denotes |
has |
| T1940 |
7378-7388 |
JJ |
denotes |
particular |
| T1941 |
7388-7390 |
, |
denotes |
, |
| T1942 |
7390-7396 |
NN |
denotes |
dermis |
| T1943 |
7397-7399 |
IN |
denotes |
of |
| T1944 |
7400-7403 |
DT |
denotes |
the |
| T1945 |
7404-7409 |
NN |
denotes |
flank |
| T1946 |
7645-7656 |
VBN |
denotes |
established |
| T1947 |
7414-7416 |
RB |
denotes |
at |
| T1948 |
7423-7426 |
CD |
denotes |
two |
| T1949 |
7417-7422 |
RBS |
denotes |
least |
| T1950 |
7436-7443 |
NNS |
denotes |
origins |
| T1951 |
7427-7435 |
JJ |
denotes |
distinct |
| T1952 |
7443-7445 |
: |
denotes |
: |
| T1953 |
7445-7455 |
JJ |
denotes |
dermatomal |
| T1954 |
7456-7467 |
NNS |
denotes |
derivatives |
| T1955 |
7468-7470 |
IN |
denotes |
of |
| T1956 |
7471-7478 |
NNS |
denotes |
somites |
| T1957 |
7479-7482 |
CC |
denotes |
and |
| T1958 |
7483-7488 |
JJ |
denotes |
loose |
| T1959 |
7489-7499 |
NN |
denotes |
mesenchyme |
| T1960 |
7500-7507 |
VBN |
denotes |
derived |
| T1961 |
7508-7512 |
IN |
denotes |
from |
| T1962 |
7513-7516 |
DT |
denotes |
the |
| T1963 |
7531-7539 |
NN |
denotes |
mesoderm |
| T1964 |
7517-7524 |
JJ |
denotes |
lateral |
| T1965 |
7525-7530 |
NN |
denotes |
plate |
| T1966 |
7540-7541 |
-LRB- |
denotes |
( |
| T1967 |
7541-7547 |
NNP |
denotes |
Mauger |
| T1968 |
7548-7552 |
CD |
denotes |
1972 |
| T1969 |
7552-7553 |
: |
denotes |
; |
| T1970 |
7554-7560 |
NNP |
denotes |
Christ |
| T1971 |
7561-7563 |
FW |
denotes |
et |
| T1972 |
7564-7567 |
FW |
denotes |
al. |
| T1973 |
7568-7572 |
CD |
denotes |
1983 |
| T1974 |
7572-7573 |
: |
denotes |
; |
| T1975 |
7574-7581 |
NNP |
denotes |
Olivera |
| T1976 |
7581-7582 |
HYPH |
denotes |
- |
| T1977 |
7582-7590 |
NNP |
denotes |
Martinez |
| T1978 |
7591-7593 |
FW |
denotes |
et |
| T1979 |
7594-7597 |
FW |
denotes |
al. |
| T1980 |
7598-7602 |
CD |
denotes |
2000 |
| T1981 |
7602-7603 |
: |
denotes |
; |
| T1982 |
7604-7611 |
NNP |
denotes |
Nowicki |
| T1983 |
7612-7614 |
FW |
denotes |
et |
| T1984 |
7615-7618 |
FW |
denotes |
al. |
| T1985 |
7619-7623 |
CD |
denotes |
2003 |
| T1986 |
7623-7624 |
-RRB- |
denotes |
) |
| T1987 |
7624-7625 |
: |
denotes |
; |
| T1988 |
7626-7631 |
DT |
denotes |
these |
| T1989 |
7632-7640 |
NNS |
denotes |
lineages |
| T1990 |
7641-7644 |
VBP |
denotes |
are |
| T1991 |
7657-7662 |
RB |
denotes |
early |
| T1992 |
7663-7665 |
IN |
denotes |
in |
| T1993 |
7666-7677 |
NN |
denotes |
development |
| T1994 |
7678-7681 |
CC |
denotes |
and |
| T1995 |
7682-7687 |
MD |
denotes |
could |
| T1996 |
7703-7706 |
VBN |
denotes |
set |
| T1997 |
7687-7689 |
, |
denotes |
, |
| T1998 |
7689-7691 |
IN |
denotes |
in |
| T1999 |
7692-7701 |
JJ |
denotes |
principle |
| T2000 |
7701-7703 |
, |
denotes |
, |
| T2001 |
7707-7709 |
RP |
denotes |
up |
| T2002 |
7710-7722 |
NNS |
denotes |
compartments |
| T2003 |
7723-7728 |
WP$ |
denotes |
whose |
| T2004 |
7729-7737 |
NN |
denotes |
identity |
| T2005 |
7738-7749 |
VBZ |
denotes |
contributes |
| T2006 |
7750-7752 |
IN |
denotes |
to |
| T2007 |
7753-7765 |
JJ |
denotes |
dorsoventral |
| T2008 |
7766-7777 |
NNS |
denotes |
differences |
| T2009 |
7778-7780 |
IN |
denotes |
in |
| T2010 |
7781-7786 |
JJ |
denotes |
adult |
| T2011 |
7787-7791 |
NN |
denotes |
skin |
| T2012 |
7791-7792 |
. |
denotes |
. |
| T2013 |
7792-8191 |
sentence |
denotes |
To better understand the mechanisms that give rise to differences between dorsal and ventral skin and to the boundary between them, we have determined how several morphologic characteristics vary along the dorsoventral axis of the mouse and how these characteristics correspond to ventral-specific Agouti expression and the lineage boundary that distinguishes somite from lateral plate derivatives. |
| T2014 |
7793-7795 |
TO |
denotes |
To |
| T2015 |
7803-7813 |
VB |
denotes |
understand |
| T2016 |
7796-7802 |
RBR |
denotes |
better |
| T2017 |
7933-7943 |
VBN |
denotes |
determined |
| T2018 |
7814-7817 |
DT |
denotes |
the |
| T2019 |
7818-7828 |
NNS |
denotes |
mechanisms |
| T2020 |
7829-7833 |
WDT |
denotes |
that |
| T2021 |
7834-7838 |
VBP |
denotes |
give |
| T2022 |
7839-7843 |
NN |
denotes |
rise |
| T2023 |
7844-7846 |
IN |
denotes |
to |
| T2024 |
7847-7858 |
NNS |
denotes |
differences |
| T2025 |
7859-7866 |
IN |
denotes |
between |
| T2026 |
7867-7873 |
JJ |
denotes |
dorsal |
| T2027 |
7886-7890 |
NN |
denotes |
skin |
| T2028 |
7874-7877 |
CC |
denotes |
and |
| T2029 |
7878-7885 |
JJ |
denotes |
ventral |
| T2030 |
7891-7894 |
CC |
denotes |
and |
| T2031 |
7895-7897 |
IN |
denotes |
to |
| T2032 |
7898-7901 |
DT |
denotes |
the |
| T2033 |
7902-7910 |
NN |
denotes |
boundary |
| T2034 |
7911-7918 |
IN |
denotes |
between |
| T2035 |
7919-7923 |
PRP |
denotes |
them |
| T2036 |
7923-7925 |
, |
denotes |
, |
| T2037 |
7925-7927 |
PRP |
denotes |
we |
| T2038 |
7928-7932 |
VBP |
denotes |
have |
| T2039 |
7944-7947 |
WRB |
denotes |
how |
| T2040 |
7984-7988 |
VBP |
denotes |
vary |
| T2041 |
7948-7955 |
JJ |
denotes |
several |
| T2042 |
7968-7983 |
NNS |
denotes |
characteristics |
| T2043 |
7956-7967 |
JJ |
denotes |
morphologic |
| T2044 |
7989-7994 |
IN |
denotes |
along |
| T2045 |
7995-7998 |
DT |
denotes |
the |
| T2046 |
8012-8016 |
NN |
denotes |
axis |
| T2047 |
7999-8011 |
JJ |
denotes |
dorsoventral |
| T2048 |
8017-8019 |
IN |
denotes |
of |
| T2049 |
8020-8023 |
DT |
denotes |
the |
| T2050 |
8024-8029 |
NN |
denotes |
mouse |
| T2051 |
8030-8033 |
CC |
denotes |
and |
| T2052 |
8034-8037 |
WRB |
denotes |
how |
| T2053 |
8060-8070 |
VBP |
denotes |
correspond |
| T2054 |
8038-8043 |
DT |
denotes |
these |
| T2055 |
8044-8059 |
NNS |
denotes |
characteristics |
| T2056 |
8071-8073 |
IN |
denotes |
to |
| T2057 |
8074-8081 |
JJ |
denotes |
ventral |
| T2058 |
8082-8090 |
JJ |
denotes |
specific |
| T2059 |
8081-8082 |
HYPH |
denotes |
- |
| T2060 |
8098-8108 |
NN |
denotes |
expression |
| T2061 |
8091-8097 |
NN |
denotes |
Agouti |
| T2062 |
8109-8112 |
CC |
denotes |
and |
| T2063 |
8113-8116 |
DT |
denotes |
the |
| T2064 |
8125-8133 |
NN |
denotes |
boundary |
| T2065 |
8117-8124 |
NN |
denotes |
lineage |
| T2066 |
8134-8138 |
WDT |
denotes |
that |
| T2067 |
8139-8152 |
VBZ |
denotes |
distinguishes |
| T2068 |
8153-8159 |
NN |
denotes |
somite |
| T2069 |
8160-8164 |
IN |
denotes |
from |
| T2070 |
8165-8172 |
JJ |
denotes |
lateral |
| T2071 |
8179-8190 |
NNS |
denotes |
derivatives |
| T2072 |
8173-8178 |
NN |
denotes |
plate |
| T2073 |
8190-8191 |
. |
denotes |
. |
| T2074 |
8191-8496 |
sentence |
denotes |
Our results indicate that the apparent uniformity of the dorsoventral boundary represents the sum of independent mechanisms that affect melanocyte density and/or differentiation, pigment-type synthesis, and hair length; surprisingly, none of these coincide with the somite–lateral plate lineage boundary. |
| T2075 |
8192-8195 |
PRP$ |
denotes |
Our |
| T2076 |
8196-8203 |
NNS |
denotes |
results |
| T2077 |
8204-8212 |
VBP |
denotes |
indicate |
| T2078 |
8440-8448 |
VBP |
denotes |
coincide |
| T2079 |
8213-8217 |
IN |
denotes |
that |
| T2080 |
8271-8281 |
VBZ |
denotes |
represents |
| T2081 |
8218-8221 |
DT |
denotes |
the |
| T2082 |
8231-8241 |
NN |
denotes |
uniformity |
| T2083 |
8222-8230 |
JJ |
denotes |
apparent |
| T2084 |
8242-8244 |
IN |
denotes |
of |
| T2085 |
8245-8248 |
DT |
denotes |
the |
| T2086 |
8262-8270 |
NN |
denotes |
boundary |
| T2087 |
8249-8261 |
JJ |
denotes |
dorsoventral |
| T2088 |
8282-8285 |
DT |
denotes |
the |
| T2089 |
8286-8289 |
NN |
denotes |
sum |
| T2090 |
8290-8292 |
IN |
denotes |
of |
| T2091 |
8293-8304 |
JJ |
denotes |
independent |
| T2092 |
8305-8315 |
NNS |
denotes |
mechanisms |
| T2093 |
8316-8320 |
WDT |
denotes |
that |
| T2094 |
8321-8327 |
VBP |
denotes |
affect |
| T2095 |
8328-8338 |
NN |
denotes |
melanocyte |
| T2096 |
8339-8346 |
NN |
denotes |
density |
| T2097 |
8347-8350 |
CC |
denotes |
and |
| T2098 |
8350-8351 |
HYPH |
denotes |
/ |
| T2099 |
8351-8353 |
CC |
denotes |
or |
| T2100 |
8354-8369 |
NN |
denotes |
differentiation |
| T2101 |
8369-8371 |
, |
denotes |
, |
| T2102 |
8371-8378 |
NN |
denotes |
pigment |
| T2103 |
8379-8383 |
NN |
denotes |
type |
| T2104 |
8378-8379 |
HYPH |
denotes |
- |
| T2105 |
8384-8393 |
NN |
denotes |
synthesis |
| T2106 |
8393-8395 |
, |
denotes |
, |
| T2107 |
8395-8398 |
CC |
denotes |
and |
| T2108 |
8399-8403 |
NN |
denotes |
hair |
| T2109 |
8404-8410 |
NN |
denotes |
length |
| T2110 |
8410-8411 |
: |
denotes |
; |
| T2111 |
8412-8424 |
RB |
denotes |
surprisingly |
| T2112 |
8424-8426 |
, |
denotes |
, |
| T2113 |
8426-8430 |
NN |
denotes |
none |
| T2114 |
8431-8433 |
IN |
denotes |
of |
| T2115 |
8434-8439 |
DT |
denotes |
these |
| T2116 |
8449-8453 |
IN |
denotes |
with |
| T2117 |
8454-8457 |
DT |
denotes |
the |
| T2118 |
8487-8495 |
NN |
denotes |
boundary |
| T2119 |
8458-8464 |
NN |
denotes |
somite |
| T2120 |
8465-8472 |
JJ |
denotes |
lateral |
| T2121 |
8464-8465 |
HYPH |
denotes |
– |
| T2122 |
8473-8478 |
NN |
denotes |
plate |
| T2123 |
8479-8486 |
NN |
denotes |
lineage |
| T2124 |
8495-8496 |
. |
denotes |
. |
| T2125 |
8496-8703 |
sentence |
denotes |
We also make use of a classical mouse mutation, droopy ear (Curry 1959), that produces a dorsal-to-ventral transformation of flank coat color by allowing expansion of the ventral-specific Agouti transcript. |
| T2126 |
8497-8499 |
PRP |
denotes |
We |
| T2127 |
8505-8509 |
VBP |
denotes |
make |
| T2128 |
8500-8504 |
RB |
denotes |
also |
| T2129 |
8510-8513 |
NN |
denotes |
use |
| T2130 |
8514-8516 |
IN |
denotes |
of |
| T2131 |
8517-8518 |
DT |
denotes |
a |
| T2132 |
8535-8543 |
NN |
denotes |
mutation |
| T2133 |
8519-8528 |
JJ |
denotes |
classical |
| T2134 |
8529-8534 |
NN |
denotes |
mouse |
| T2135 |
8543-8545 |
, |
denotes |
, |
| T2136 |
8545-8551 |
JJ |
denotes |
droopy |
| T2137 |
8552-8555 |
NN |
denotes |
ear |
| T2138 |
8556-8557 |
-LRB- |
denotes |
( |
| T2139 |
8557-8562 |
NNP |
denotes |
Curry |
| T2140 |
8563-8567 |
CD |
denotes |
1959 |
| T2141 |
8567-8568 |
-RRB- |
denotes |
) |
| T2142 |
8568-8570 |
, |
denotes |
, |
| T2143 |
8570-8574 |
WDT |
denotes |
that |
| T2144 |
8575-8583 |
VBZ |
denotes |
produces |
| T2145 |
8584-8585 |
DT |
denotes |
a |
| T2146 |
8604-8618 |
NN |
denotes |
transformation |
| T2147 |
8586-8592 |
JJ |
denotes |
dorsal |
| T2148 |
8592-8593 |
HYPH |
denotes |
- |
| T2149 |
8593-8595 |
IN |
denotes |
to |
| T2150 |
8595-8596 |
HYPH |
denotes |
- |
| T2151 |
8596-8603 |
JJ |
denotes |
ventral |
| T2152 |
8619-8621 |
IN |
denotes |
of |
| T2153 |
8622-8627 |
NN |
denotes |
flank |
| T2154 |
8633-8638 |
NN |
denotes |
color |
| T2155 |
8628-8632 |
NN |
denotes |
coat |
| T2156 |
8639-8641 |
IN |
denotes |
by |
| T2157 |
8642-8650 |
VBG |
denotes |
allowing |
| T2158 |
8651-8660 |
NN |
denotes |
expansion |
| T2159 |
8661-8663 |
IN |
denotes |
of |
| T2160 |
8664-8667 |
DT |
denotes |
the |
| T2161 |
8692-8702 |
NN |
denotes |
transcript |
| T2162 |
8668-8675 |
JJ |
denotes |
ventral |
| T2163 |
8676-8684 |
JJ |
denotes |
specific |
| T2164 |
8675-8676 |
HYPH |
denotes |
- |
| T2165 |
8685-8691 |
NN |
denotes |
Agouti |
| T2166 |
8702-8703 |
. |
denotes |
. |
| T2167 |
8703-8969 |
sentence |
denotes |
By positional cloning and gene targeting, we identify an allele of droopy ear, deH, as a loss of function for Tbx15, which encodes a T-box transcription factor expressed in a dynamic and spatially restricted manner in the developing skin and musculoskeletal system. |
| T2168 |
8704-8706 |
IN |
denotes |
By |
| T2169 |
8749-8757 |
VBP |
denotes |
identify |
| T2170 |
8707-8717 |
JJ |
denotes |
positional |
| T2171 |
8718-8725 |
NN |
denotes |
cloning |
| T2172 |
8726-8729 |
CC |
denotes |
and |
| T2173 |
8730-8734 |
NN |
denotes |
gene |
| T2174 |
8735-8744 |
NN |
denotes |
targeting |
| T2175 |
8744-8746 |
, |
denotes |
, |
| T2176 |
8746-8748 |
PRP |
denotes |
we |
| T2177 |
8758-8760 |
DT |
denotes |
an |
| T2178 |
8761-8767 |
NN |
denotes |
allele |
| T2179 |
8768-8770 |
IN |
denotes |
of |
| T2180 |
8771-8777 |
JJ |
denotes |
droopy |
| T2181 |
8778-8781 |
NN |
denotes |
ear |
| T2182 |
8781-8783 |
, |
denotes |
, |
| T2183 |
8783-8786 |
NN |
denotes |
deH |
| T2184 |
8786-8788 |
, |
denotes |
, |
| T2185 |
8788-8790 |
IN |
denotes |
as |
| T2186 |
8791-8792 |
DT |
denotes |
a |
| T2187 |
8793-8797 |
NN |
denotes |
loss |
| T2188 |
8798-8800 |
IN |
denotes |
of |
| T2189 |
8801-8809 |
NN |
denotes |
function |
| T2190 |
8810-8813 |
IN |
denotes |
for |
| T2191 |
8814-8819 |
NN |
denotes |
Tbx15 |
| T2192 |
8819-8821 |
, |
denotes |
, |
| T2193 |
8821-8826 |
WDT |
denotes |
which |
| T2194 |
8827-8834 |
VBZ |
denotes |
encodes |
| T2195 |
8835-8836 |
DT |
denotes |
a |
| T2196 |
8857-8863 |
NN |
denotes |
factor |
| T2197 |
8837-8838 |
NN |
denotes |
T |
| T2198 |
8839-8842 |
NN |
denotes |
box |
| T2199 |
8838-8839 |
HYPH |
denotes |
- |
| T2200 |
8843-8856 |
NN |
denotes |
transcription |
| T2201 |
8864-8873 |
VBN |
denotes |
expressed |
| T2202 |
8874-8876 |
IN |
denotes |
in |
| T2220 |
8980-8990 |
NN |
denotes |
expression |
| T2221 |
8991-8994 |
CC |
denotes |
and |
| T2222 |
8995-9010 |
NN |
denotes |
transplantation |
| T2223 |
9019-9026 |
VBP |
denotes |
suggest |
| T2224 |
9027-9031 |
IN |
denotes |
that |
| T2225 |
9041-9049 |
VBN |
denotes |
required |
| T2226 |
9032-9037 |
NN |
denotes |
Tbx15 |
| T2227 |
9038-9040 |
VBZ |
denotes |
is |
| T2228 |
9050-9052 |
TO |
denotes |
to |
| T2229 |
9053-9062 |
VB |
denotes |
establish |
| T2230 |
9063-9070 |
JJ |
denotes |
certain |
| T2231 |
9071-9086 |
NNS |
denotes |
characteristics |
| T2232 |
9087-9089 |
IN |
denotes |
of |
| T2233 |
9090-9096 |
JJ |
denotes |
dorsal |
| T2234 |
9097-9107 |
NN |
denotes |
patterning |
| T2235 |
9108-9110 |
IN |
denotes |
in |
| T2236 |
9111-9122 |
JJ |
denotes |
mesenchymal |
| T2237 |
9123-9128 |
NNS |
denotes |
cells |
| T2238 |
9129-9131 |
IN |
denotes |
of |
| T2239 |
9132-9135 |
DT |
denotes |
the |
| T2240 |
9147-9152 |
NN |
denotes |
flank |
| T2241 |
9136-9146 |
VBG |
denotes |
developing |
| T2242 |
9152-9153 |
. |
denotes |
. |
| T2243 |
9153-9384 |
sentence |
denotes |
These results identify a previously unappreciated aspect of dorsoventral patterning that is widely represented in furred mammals and provide insight into the mechanisms that underlie region-specific differences in body morphology. |
| T2244 |
9154-9159 |
DT |
denotes |
These |
| T2245 |
9160-9167 |
NNS |
denotes |
results |
| T2246 |
9168-9176 |
VBP |
denotes |
identify |
| T2247 |
9177-9178 |
DT |
denotes |
a |
| T2248 |
9204-9210 |
NN |
denotes |
aspect |
| T2249 |
9179-9189 |
RB |
denotes |
previously |
| T2250 |
9190-9203 |
JJ |
denotes |
unappreciated |
| T2251 |
9211-9213 |
IN |
denotes |
of |
| T2252 |
9214-9226 |
JJ |
denotes |
dorsoventral |
| T2253 |
9227-9237 |
NN |
denotes |
patterning |
| T2254 |
9238-9242 |
WDT |
denotes |
that |
| T2255 |
9253-9264 |
VBN |
denotes |
represented |
| T2256 |
9243-9245 |
VBZ |
denotes |
is |
| T2257 |
9246-9252 |
RB |
denotes |
widely |
| T2258 |
9265-9267 |
IN |
denotes |
in |
| T2259 |
9268-9274 |
JJ |
denotes |
furred |
| T2260 |
9275-9282 |
NNS |
denotes |
mammals |
| T2261 |
9283-9286 |
CC |
denotes |
and |
| T2262 |
9287-9294 |
VBP |
denotes |
provide |
| T2263 |
9295-9302 |
NN |
denotes |
insight |
| T2264 |
9303-9307 |
IN |
denotes |
into |
| T2265 |
9308-9311 |
DT |
denotes |
the |
| T2266 |
9312-9322 |
NNS |
denotes |
mechanisms |
| T2267 |
9323-9327 |
WDT |
denotes |
that |
| T2268 |
9328-9336 |
VBP |
denotes |
underlie |
| T2269 |
9337-9343 |
NN |
denotes |
region |
| T2270 |
9344-9352 |
JJ |
denotes |
specific |
| T2271 |
9343-9344 |
HYPH |
denotes |
- |
| T2272 |
9353-9364 |
NNS |
denotes |
differences |
| T2273 |
9365-9367 |
IN |
denotes |
in |
| T2274 |
9368-9372 |
NN |
denotes |
body |
| T2275 |
9373-9383 |
NN |
denotes |
morphology |
| T2276 |
9383-9384 |
. |
denotes |
. |
| T2547 |
9395-9408 |
JJ |
denotes |
Morphological |
| T2548 |
9409-9419 |
NNS |
denotes |
Components |
| T2549 |
9420-9422 |
IN |
denotes |
of |
| T2550 |
9423-9435 |
JJ |
denotes |
Dorsoventral |
| T2551 |
9441-9452 |
NNS |
denotes |
Differences |
| T2552 |
9436-9440 |
NN |
denotes |
Skin |
| T2553 |
9452-9673 |
sentence |
denotes |
Besides the obvious change in hair color that frequently distinguishes dorsal from ventral skin, casual observation suggests there are additional differences in hair length, distribution of hair type, and skin thickness. |
| T2554 |
9453-9460 |
IN |
denotes |
Besides |
| T2555 |
9569-9577 |
VBZ |
denotes |
suggests |
| T2556 |
9461-9464 |
DT |
denotes |
the |
| T2557 |
9473-9479 |
NN |
denotes |
change |
| T2558 |
9465-9472 |
JJ |
denotes |
obvious |
| T2559 |
9480-9482 |
IN |
denotes |
in |
| T2560 |
9483-9487 |
NN |
denotes |
hair |
| T2561 |
9488-9493 |
NN |
denotes |
color |
| T2562 |
9494-9498 |
WDT |
denotes |
that |
| T2563 |
9510-9523 |
VBZ |
denotes |
distinguishes |
| T2564 |
9499-9509 |
RB |
denotes |
frequently |
| T2565 |
9524-9530 |
JJ |
denotes |
dorsal |
| T2566 |
9531-9535 |
IN |
denotes |
from |
| T2567 |
9536-9543 |
JJ |
denotes |
ventral |
| T2568 |
9544-9548 |
NN |
denotes |
skin |
| T2569 |
9548-9550 |
, |
denotes |
, |
| T2570 |
9550-9556 |
JJ |
denotes |
casual |
| T2571 |
9557-9568 |
NN |
denotes |
observation |
| T2572 |
9578-9583 |
EX |
denotes |
there |
| T2573 |
9584-9587 |
VBP |
denotes |
are |
| T2574 |
9588-9598 |
JJ |
denotes |
additional |
| T2575 |
9599-9610 |
NNS |
denotes |
differences |
| T2576 |
9611-9613 |
IN |
denotes |
in |
| T2577 |
9614-9618 |
NN |
denotes |
hair |
| T2578 |
9619-9625 |
NN |
denotes |
length |
| T2579 |
9625-9627 |
, |
denotes |
, |
| T2580 |
9627-9639 |
NN |
denotes |
distribution |
| T2581 |
9640-9642 |
IN |
denotes |
of |
| T2582 |
9643-9647 |
NN |
denotes |
hair |
| T2583 |
9648-9652 |
NN |
denotes |
type |
| T2584 |
9652-9654 |
, |
denotes |
, |
| T2585 |
9654-9657 |
CC |
denotes |
and |
| T2586 |
9658-9662 |
NN |
denotes |
skin |
| T2587 |
9663-9672 |
NN |
denotes |
thickness |
| T2588 |
9672-9673 |
. |
denotes |
. |
| T2589 |
9673-9893 |
sentence |
denotes |
Furthermore, dorsoventral differences in pigmentation can represent differences in the number and/or differentiated state of pigment cells, as well as the type of pigment synthesized in response to expression of Agouti. |
| T2590 |
9674-9685 |
RB |
denotes |
Furthermore |
| T2591 |
9732-9741 |
VB |
denotes |
represent |
| T2592 |
9685-9687 |
, |
denotes |
, |
| T2593 |
9687-9699 |
JJ |
denotes |
dorsoventral |
| T2594 |
9700-9711 |
NNS |
denotes |
differences |
| T2595 |
9712-9714 |
IN |
denotes |
in |
| T2596 |
9715-9727 |
NN |
denotes |
pigmentation |
| T2597 |
9728-9731 |
MD |
denotes |
can |
| T2598 |
9742-9753 |
NNS |
denotes |
differences |
| T2599 |
9754-9756 |
IN |
denotes |
in |
| T2600 |
9757-9760 |
DT |
denotes |
the |
| T2601 |
9761-9767 |
NN |
denotes |
number |
| T2602 |
9768-9771 |
CC |
denotes |
and |
| T2603 |
9771-9772 |
HYPH |
denotes |
/ |
| T2604 |
9772-9774 |
CC |
denotes |
or |
| T2605 |
9775-9789 |
VBN |
denotes |
differentiated |
| T2606 |
9790-9795 |
NN |
denotes |
state |
| T2607 |
9796-9798 |
IN |
denotes |
of |
| T2608 |
9799-9806 |
NN |
denotes |
pigment |
| T2609 |
9807-9812 |
NNS |
denotes |
cells |
| T2610 |
9812-9814 |
, |
denotes |
, |
| T2611 |
9814-9816 |
RB |
denotes |
as |
| T2612 |
9822-9824 |
IN |
denotes |
as |
| T2613 |
9817-9821 |
RB |
denotes |
well |
| T2614 |
9825-9828 |
DT |
denotes |
the |
| T2615 |
9829-9833 |
NN |
denotes |
type |
| T2616 |
9834-9836 |
IN |
denotes |
of |
| T2617 |
9837-9844 |
NN |
denotes |
pigment |
| T2618 |
9845-9856 |
VBN |
denotes |
synthesized |
| T2619 |
9857-9859 |
IN |
denotes |
in |
| T2620 |
9860-9868 |
NN |
denotes |
response |
| T2621 |
9869-9871 |
IN |
denotes |
to |
| T2622 |
9872-9882 |
NN |
denotes |
expression |
| T2623 |
9883-9885 |
IN |
denotes |
of |
| T2624 |
9886-9892 |
NN |
denotes |
Agouti |
| T2625 |
9892-9893 |
. |
denotes |
. |
| T2626 |
9893-10063 |
sentence |
denotes |
In particular, ventral hair of at/at animals can vary from cream-colored to reddish-yellow depending on age, strain background, and position along the dorsoventral axis. |
| T2627 |
9894-9896 |
IN |
denotes |
In |
| T2628 |
9943-9947 |
VB |
denotes |
vary |
| T2629 |
9897-9907 |
JJ |
denotes |
particular |
| T2630 |
9907-9909 |
, |
denotes |
, |
| T2631 |
9909-9916 |
JJ |
denotes |
ventral |
| T2632 |
9917-9921 |
NN |
denotes |
hair |
| T2633 |
9922-9924 |
IN |
denotes |
of |
| T2634 |
9925-9927 |
NN |
denotes |
at |
| T2635 |
9928-9930 |
NN |
denotes |
at |
| T2636 |
9927-9928 |
HYPH |
denotes |
/ |
| T2637 |
9931-9938 |
NNS |
denotes |
animals |
| T2638 |
9939-9942 |
MD |
denotes |
can |
| T2639 |
9948-9952 |
IN |
denotes |
from |
| T2640 |
9953-9958 |
NN |
denotes |
cream |
| T2641 |
9959-9966 |
VBN |
denotes |
colored |
| T2642 |
9958-9959 |
HYPH |
denotes |
- |
| T2643 |
9967-9969 |
IN |
denotes |
to |
| T2644 |
9970-9977 |
JJ |
denotes |
reddish |
| T2645 |
9978-9984 |
JJ |
denotes |
yellow |
| T2646 |
9977-9978 |
HYPH |
denotes |
- |
| T2647 |
9985-9994 |
VBG |
denotes |
depending |
| T2648 |
9995-9997 |
IN |
denotes |
on |
| T2649 |
9998-10001 |
NN |
denotes |
age |
| T2650 |
10001-10003 |
, |
denotes |
, |
| T2651 |
10003-10009 |
NN |
denotes |
strain |
| T2652 |
10010-10020 |
NN |
denotes |
background |
| T2653 |
10020-10022 |
, |
denotes |
, |
| T2654 |
10022-10025 |
CC |
denotes |
and |
| T2655 |
10026-10034 |
NN |
denotes |
position |
| T2656 |
10035-10040 |
IN |
denotes |
along |
| T2657 |
10041-10044 |
DT |
denotes |
the |
| T2658 |
10058-10062 |
NN |
denotes |
axis |
| T2659 |
10045-10057 |
JJ |
denotes |
dorsoventral |
| T2660 |
10062-10063 |
. |
denotes |
. |
| T2661 |
10063-10185 |
sentence |
denotes |
To evaluate the relationship among these components, we compared their features among mice of different Agouti genotypes. |
| T2662 |
10064-10066 |
TO |
denotes |
To |
| T2663 |
10067-10075 |
VB |
denotes |
evaluate |
| T2664 |
10120-10128 |
VBD |
denotes |
compared |
| T2665 |
10076-10079 |
DT |
denotes |
the |
| T2666 |
10080-10092 |
NN |
denotes |
relationship |
| T2667 |
10093-10098 |
IN |
denotes |
among |
| T2668 |
10099-10104 |
DT |
denotes |
these |
| T2669 |
10105-10115 |
NNS |
denotes |
components |
| T2670 |
10115-10117 |
, |
denotes |
, |
| T2671 |
10117-10119 |
PRP |
denotes |
we |
| T2672 |
10129-10134 |
PRP$ |
denotes |
their |
| T2673 |
10135-10143 |
NNS |
denotes |
features |
| T2674 |
10144-10149 |
IN |
denotes |
among |
| T2675 |
10150-10154 |
NNS |
denotes |
mice |
| T2676 |
10155-10157 |
IN |
denotes |
of |
| T2677 |
10158-10167 |
JJ |
denotes |
different |
| T2678 |
10175-10184 |
NNS |
denotes |
genotypes |
| T2679 |
10168-10174 |
NN |
denotes |
Agouti |
| T2680 |
10184-10185 |
. |
denotes |
. |
| T2681 |
10185-10467 |
sentence |
denotes |
Semiquantitative measurements of hair length plotted as a function of dorsoventral position reveal that the apparent sharp boundary between dorsal and ventral pigment compartments in at/at mice coincides with a more gradual change in both hair color and hair length (Figure 1A–1D). |
| T2682 |
10186-10202 |
JJ |
denotes |
Semiquantitative |
| T2683 |
10203-10215 |
NNS |
denotes |
measurements |
| T2684 |
10278-10284 |
VBP |
denotes |
reveal |
| T2685 |
10216-10218 |
IN |
denotes |
of |
| T2686 |
10219-10223 |
NN |
denotes |
hair |
| T2687 |
10224-10230 |
NN |
denotes |
length |
| T2688 |
10231-10238 |
VBN |
denotes |
plotted |
| T2689 |
10239-10241 |
IN |
denotes |
as |
| T2690 |
10242-10243 |
DT |
denotes |
a |
| T2691 |
10244-10252 |
NN |
denotes |
function |
| T2692 |
10253-10255 |
IN |
denotes |
of |
| T2693 |
10256-10268 |
JJ |
denotes |
dorsoventral |
| T2694 |
10269-10277 |
NN |
denotes |
position |
| T2695 |
10285-10289 |
IN |
denotes |
that |
| T2696 |
10380-10389 |
VBZ |
denotes |
coincides |
| T2697 |
10290-10293 |
DT |
denotes |
the |
| T2698 |
10309-10317 |
NN |
denotes |
boundary |
| T2699 |
10294-10302 |
JJ |
denotes |
apparent |
| T2700 |
10303-10308 |
JJ |
denotes |
sharp |
| T2701 |
10318-10325 |
IN |
denotes |
between |
| T2702 |
10326-10332 |
JJ |
denotes |
dorsal |
| T2703 |
10353-10365 |
NNS |
denotes |
compartments |
| T2704 |
10333-10336 |
CC |
denotes |
and |
| T2705 |
10337-10344 |
JJ |
denotes |
ventral |
| T2706 |
10345-10352 |
NN |
denotes |
pigment |
| T2707 |
10366-10368 |
IN |
denotes |
in |
| T2708 |
10369-10371 |
NN |
denotes |
at |
| T2709 |
10372-10374 |
NN |
denotes |
at |
| T2710 |
10371-10372 |
HYPH |
denotes |
/ |
| T2711 |
10375-10379 |
NNS |
denotes |
mice |
| T2712 |
10390-10394 |
IN |
denotes |
with |
| T2713 |
10395-10396 |
DT |
denotes |
a |
| T2714 |
10410-10416 |
NN |
denotes |
change |
| T2715 |
10397-10401 |
RBR |
denotes |
more |
| T2716 |
10402-10409 |
JJ |
denotes |
gradual |
| T2717 |
10417-10419 |
IN |
denotes |
in |
| T2718 |
10420-10424 |
CC |
denotes |
both |
| T2719 |
10430-10435 |
NN |
denotes |
color |
| T2720 |
10425-10429 |
NN |
denotes |
hair |
| T2721 |
10436-10439 |
CC |
denotes |
and |
| T2722 |
10440-10444 |
NN |
denotes |
hair |
| T2723 |
10445-10451 |
NN |
denotes |
length |
| T2724 |
10452-10453 |
-LRB- |
denotes |
( |
| T2725 |
10460-10462 |
CD |
denotes |
1A |
| T2726 |
10453-10459 |
NN |
denotes |
Figure |
| T2727 |
10462-10463 |
SYM |
denotes |
– |
| T2728 |
10463-10465 |
CD |
denotes |
1D |
| T2729 |
10465-10466 |
-RRB- |
denotes |
) |
| T2730 |
10466-10467 |
. |
denotes |
. |
| T2731 |
10467-10699 |
sentence |
denotes |
Within the region of transition from dorsum to ventrum (Figure 1B), flank hairs from at/at mice become progressively shorter and exhibit increasing amounts of pheomelanin deposition progressing from the tip to the base of the hair. |
| T2732 |
10468-10474 |
IN |
denotes |
Within |
| T2733 |
10564-10570 |
VBP |
denotes |
become |
| T2734 |
10475-10478 |
DT |
denotes |
the |
| T2735 |
10479-10485 |
NN |
denotes |
region |
| T2736 |
10486-10488 |
IN |
denotes |
of |
| T2737 |
10489-10499 |
NN |
denotes |
transition |
| T2738 |
10500-10504 |
IN |
denotes |
from |
| T2739 |
10505-10511 |
NN |
denotes |
dorsum |
| T2740 |
10512-10514 |
IN |
denotes |
to |
| T2741 |
10515-10522 |
NN |
denotes |
ventrum |
| T2742 |
10523-10524 |
-LRB- |
denotes |
( |
| T2743 |
10524-10530 |
NN |
denotes |
Figure |
| T2744 |
10531-10533 |
CD |
denotes |
1B |
| T2745 |
10533-10534 |
-RRB- |
denotes |
) |
| T2746 |
10534-10536 |
, |
denotes |
, |
| T2747 |
10536-10541 |
NN |
denotes |
flank |
| T2748 |
10542-10547 |
NNS |
denotes |
hairs |
| T2749 |
10548-10552 |
IN |
denotes |
from |
| T2750 |
10553-10555 |
NN |
denotes |
at |
| T2751 |
10556-10558 |
NN |
denotes |
at |
| T2752 |
10555-10556 |
HYPH |
denotes |
/ |
| T2753 |
10559-10563 |
NNS |
denotes |
mice |
| T2754 |
10571-10584 |
RB |
denotes |
progressively |
| T2755 |
10585-10592 |
JJR |
denotes |
shorter |
| T2756 |
10593-10596 |
CC |
denotes |
and |
| T2757 |
10597-10604 |
VBP |
denotes |
exhibit |
| T2758 |
10605-10615 |
VBG |
denotes |
increasing |
| T2759 |
10616-10623 |
NNS |
denotes |
amounts |
| T2760 |
10624-10626 |
IN |
denotes |
of |
| T2761 |
10627-10638 |
NN |
denotes |
pheomelanin |
| T2762 |
10639-10649 |
NN |
denotes |
deposition |
| T2763 |
10650-10661 |
VBG |
denotes |
progressing |
| T2764 |
10662-10666 |
IN |
denotes |
from |
| T2765 |
10667-10670 |
DT |
denotes |
the |
| T2766 |
10671-10674 |
NN |
denotes |
tip |
| T2767 |
10675-10677 |
IN |
denotes |
to |
| T2768 |
10678-10681 |
DT |
denotes |
the |
| T2769 |
10682-10686 |
NN |
denotes |
base |
| T2770 |
10687-10689 |
IN |
denotes |
of |
| T2771 |
10690-10693 |
DT |
denotes |
the |
| T2772 |
10694-10698 |
NN |
denotes |
hair |
| T2773 |
10698-10699 |
. |
denotes |
. |
| T2774 |
10699-10836 |
sentence |
denotes |
However, the region of transition for hair length is considerably broader than that for pigmentation and independent of Agouti genotype. |
| T2775 |
10700-10707 |
RB |
denotes |
However |
| T2776 |
10750-10752 |
VBZ |
denotes |
is |
| T2777 |
10707-10709 |
, |
denotes |
, |
| T2778 |
10709-10712 |
DT |
denotes |
the |
| T2779 |
10713-10719 |
NN |
denotes |
region |
| T2780 |
10720-10722 |
IN |
denotes |
of |
| T2781 |
10723-10733 |
NN |
denotes |
transition |
| T2782 |
10734-10737 |
IN |
denotes |
for |
| T2783 |
10738-10742 |
NN |
denotes |
hair |
| T2784 |
10743-10749 |
NN |
denotes |
length |
| T2785 |
10753-10765 |
RB |
denotes |
considerably |
| T2786 |
10766-10773 |
JJR |
denotes |
broader |
| T2787 |
10774-10778 |
IN |
denotes |
than |
| T2788 |
10779-10783 |
DT |
denotes |
that |
| T2789 |
10784-10787 |
IN |
denotes |
for |
| T2790 |
10788-10800 |
NN |
denotes |
pigmentation |
| T2791 |
10801-10804 |
CC |
denotes |
and |
| T2792 |
10805-10816 |
JJ |
denotes |
independent |
| T2793 |
10817-10819 |
IN |
denotes |
of |
| T2794 |
10820-10826 |
NN |
denotes |
Agouti |
| T2795 |
10827-10835 |
NN |
denotes |
genotype |
| T2796 |
10835-10836 |
. |
denotes |
. |
| T2797 |
10836-11020 |
sentence |
denotes |
Although hair-cycle timing varies along the rostrocaudal axis, measurements of absolute hair length for mice matched for age and rostrocaudal level are remarkably similar (Figure 1D). |
| T2798 |
10837-10845 |
IN |
denotes |
Although |
| T2799 |
10864-10870 |
VBZ |
denotes |
varies |
| T2800 |
10846-10850 |
NN |
denotes |
hair |
| T2801 |
10851-10856 |
NN |
denotes |
cycle |
| T2802 |
10850-10851 |
HYPH |
denotes |
- |
| T2803 |
10857-10863 |
NN |
denotes |
timing |
| T2804 |
10985-10988 |
VBP |
denotes |
are |
| T2805 |
10871-10876 |
IN |
denotes |
along |
| T2806 |
10877-10880 |
DT |
denotes |
the |
| T2807 |
10894-10898 |
NN |
denotes |
axis |
| T2808 |
10881-10893 |
JJ |
denotes |
rostrocaudal |
| T2809 |
10898-10900 |
, |
denotes |
, |
| T2810 |
10900-10912 |
NNS |
denotes |
measurements |
| T2811 |
10913-10915 |
IN |
denotes |
of |
| T2812 |
10916-10924 |
JJ |
denotes |
absolute |
| T2813 |
10930-10936 |
NN |
denotes |
length |
| T2814 |
10925-10929 |
NN |
denotes |
hair |
| T2815 |
10937-10940 |
IN |
denotes |
for |
| T2816 |
10941-10945 |
NNS |
denotes |
mice |
| T2817 |
10946-10953 |
VBN |
denotes |
matched |
| T2818 |
10954-10957 |
IN |
denotes |
for |
| T2819 |
10958-10961 |
NN |
denotes |
age |
| T2820 |
10962-10965 |
CC |
denotes |
and |
| T2821 |
10966-10978 |
JJ |
denotes |
rostrocaudal |
| T2822 |
10979-10984 |
NN |
denotes |
level |
| T2823 |
10989-10999 |
RB |
denotes |
remarkably |
| T2824 |
11000-11007 |
JJ |
denotes |
similar |
| T2825 |
11008-11009 |
-LRB- |
denotes |
( |
| T2826 |
11009-11015 |
NN |
denotes |
Figure |
| T2827 |
11016-11018 |
CD |
denotes |
1D |
| T2828 |
11018-11019 |
-RRB- |
denotes |
) |
| T2829 |
11019-11020 |
. |
denotes |
. |
| T2830 |
11020-11199 |
sentence |
denotes |
Furthermore, measurements of relative hair length for animals of different age, size, and Agouti genotype also are very similar when normalized to body circumference (Figure 1C). |
| T2831 |
11021-11032 |
RB |
denotes |
Furthermore |
| T2832 |
11132-11135 |
VBP |
denotes |
are |
| T2833 |
11032-11034 |
, |
denotes |
, |
| T2834 |
11034-11046 |
NNS |
denotes |
measurements |
| T2835 |
11047-11049 |
IN |
denotes |
of |
| T2836 |
11050-11058 |
JJ |
denotes |
relative |
| T2837 |
11064-11070 |
NN |
denotes |
length |
| T2838 |
11059-11063 |
NN |
denotes |
hair |
| T2839 |
11071-11074 |
IN |
denotes |
for |
| T2840 |
11075-11082 |
NNS |
denotes |
animals |
| T2841 |
11083-11085 |
IN |
denotes |
of |
| T2842 |
11086-11095 |
JJ |
denotes |
different |
| T2843 |
11096-11099 |
NN |
denotes |
age |
| T2844 |
11099-11101 |
, |
denotes |
, |
| T2845 |
11101-11105 |
NN |
denotes |
size |
| T2846 |
11105-11107 |
, |
denotes |
, |
| T2847 |
11107-11110 |
CC |
denotes |
and |
| T2848 |
11111-11117 |
NN |
denotes |
Agouti |
| T2849 |
11118-11126 |
NN |
denotes |
genotype |
| T2850 |
11127-11131 |
RB |
denotes |
also |
| T2851 |
11136-11140 |
RB |
denotes |
very |
| T2852 |
11141-11148 |
JJ |
denotes |
similar |
| T2853 |
11149-11153 |
WRB |
denotes |
when |
| T2854 |
11154-11164 |
VBN |
denotes |
normalized |
| T2855 |
11165-11167 |
IN |
denotes |
to |
| T2856 |
11168-11172 |
NN |
denotes |
body |
| T2857 |
11173-11186 |
NN |
denotes |
circumference |
| T2858 |
11187-11188 |
-LRB- |
denotes |
( |
| T2859 |
11188-11194 |
NN |
denotes |
Figure |
| T2860 |
11195-11197 |
CD |
denotes |
1C |
| T2861 |
11197-11198 |
-RRB- |
denotes |
) |
| T2862 |
11198-11199 |
. |
denotes |
. |
| T2863 |
11199-11469 |
sentence |
denotes |
Taken together, these observations indicate that variation of hair length along the dorsoventral axis is stereotyped and maintained through multiple hair cycles, with a transition in hair length that is gradual and encompasses the pigment-type transition in at/at mice. |
| T2864 |
11200-11205 |
VBN |
denotes |
Taken |
| T2865 |
11235-11243 |
VBP |
denotes |
indicate |
| T2866 |
11206-11214 |
RB |
denotes |
together |
| T2867 |
11214-11216 |
, |
denotes |
, |
| T2868 |
11216-11221 |
DT |
denotes |
these |
| T2869 |
11222-11234 |
NNS |
denotes |
observations |
| T2870 |
11244-11248 |
IN |
denotes |
that |
| T2871 |
11305-11316 |
VBN |
denotes |
stereotyped |
| T2872 |
11249-11258 |
NN |
denotes |
variation |
| T2873 |
11259-11261 |
IN |
denotes |
of |
| T2874 |
11262-11266 |
NN |
denotes |
hair |
| T2875 |
11267-11273 |
NN |
denotes |
length |
| T2876 |
11274-11279 |
IN |
denotes |
along |
| T2877 |
11280-11283 |
DT |
denotes |
the |
| T2878 |
11297-11301 |
NN |
denotes |
axis |
| T2879 |
11284-11296 |
JJ |
denotes |
dorsoventral |
| T2880 |
11302-11304 |
VBZ |
denotes |
is |
| T2881 |
11317-11320 |
CC |
denotes |
and |
| T2882 |
11321-11331 |
VBN |
denotes |
maintained |
| T2883 |
11332-11339 |
IN |
denotes |
through |
| T2884 |
11340-11348 |
JJ |
denotes |
multiple |
| T2885 |
11354-11360 |
NNS |
denotes |
cycles |
| T2886 |
11349-11353 |
NN |
denotes |
hair |
| T2887 |
11360-11362 |
, |
denotes |
, |
| T2888 |
11362-11366 |
IN |
denotes |
with |
| T2889 |
11367-11368 |
DT |
denotes |
a |
| T2890 |
11369-11379 |
NN |
denotes |
transition |
| T2891 |
11380-11382 |
IN |
denotes |
in |
| T2892 |
11383-11387 |
NN |
denotes |
hair |
| T2893 |
11388-11394 |
NN |
denotes |
length |
| T2894 |
11395-11399 |
WDT |
denotes |
that |
| T2895 |
11400-11402 |
VBZ |
denotes |
is |
| T2896 |
11403-11410 |
JJ |
denotes |
gradual |
| T2897 |
11411-11414 |
CC |
denotes |
and |
| T2898 |
11415-11426 |
VBZ |
denotes |
encompasses |
| T2899 |
11427-11430 |
DT |
denotes |
the |
| T2900 |
11444-11454 |
NN |
denotes |
transition |
| T2901 |
11431-11438 |
NN |
denotes |
pigment |
| T2902 |
11439-11443 |
NN |
denotes |
type |
| T2903 |
11438-11439 |
HYPH |
denotes |
- |
| T2904 |
11455-11457 |
IN |
denotes |
in |
| T2905 |
11458-11460 |
NN |
denotes |
at |
| T2906 |
11461-11463 |
NN |
denotes |
at |
| T2907 |
11460-11461 |
HYPH |
denotes |
/ |
| T2908 |
11464-11468 |
NNS |
denotes |
mice |
| T2909 |
11468-11469 |
. |
denotes |
. |
| T2910 |
11469-12667 |
sentence |
denotes |
Figure 1 Dorsoventral Skin Characteristics
(A) Skin slices from animals of different age and genotype demonstrate similar patterns of hair-length variation along the dorsoventral axis (scale bar = 1 cm).
(B) Enlarged area from (A), demonstrating the transition in hair length and color in at/at mice (scale bar = 0.375 cm).
(C) Proportional hair length for (A) plotted as a function of relative position along the dorsoventral axis.
(D) Hair length plotted as a function of absolute position along the dorsoventral axis for 8-wk-old BA strain mice.
(E) Proportion of zigzag hairs (± SEM) differs slightly between dorsum and ventrum of inbred mice (p < 0.0001, χ2 test, n = 1,958, 1,477, 1,579, 1,502).
(F) Differences in dorsal and ventral skin development at P4.5 (scale bar = 1 mm, upper; 200 μm, lower).
(G) Differences in hair melanin content and DOPA staining for dorsum (d), flank (f), and ventrum (v) in ae/ae and at/at mice. The upper panel also demonstrates a cream-colored appearance of the at/at ventrum. The middle panel shows representative awls (scale bar = 100 μm). The lower panel shows DOPA-stained dermis (scale bar = 200 μm). Dorsal and ventral skin develop at different rates. |
| T2911 |
12616-12622 |
JJ |
denotes |
Dorsal |
| T2912 |
12635-12639 |
NN |
denotes |
skin |
| T2913 |
12623-12626 |
CC |
denotes |
and |
| T2914 |
12627-12634 |
JJ |
denotes |
ventral |
| T2915 |
12640-12647 |
VBP |
denotes |
develop |
| T2916 |
12648-12650 |
IN |
denotes |
at |
| T2917 |
12651-12660 |
JJ |
denotes |
different |
| T2918 |
12661-12666 |
NNS |
denotes |
rates |
| T2919 |
12666-12667 |
. |
denotes |
. |
| T2920 |
12667-12893 |
sentence |
denotes |
Transverse sections of skin at postnatal day 4.5 (P4.5) exhibit dorsal hair follicles that are noticeably more developed than ventral hair follicles, along with a gradual dorsoventral decrease in dermal thickness (Figure 1F). |
| T2921 |
12668-12678 |
JJ |
denotes |
Transverse |
| T2922 |
12679-12687 |
NNS |
denotes |
sections |
| T2923 |
12724-12731 |
VBP |
denotes |
exhibit |
| T2924 |
12688-12690 |
IN |
denotes |
of |
| T2925 |
12691-12695 |
NN |
denotes |
skin |
| T2926 |
12696-12698 |
IN |
denotes |
at |
| T2927 |
12699-12708 |
JJ |
denotes |
postnatal |
| T2928 |
12709-12712 |
NN |
denotes |
day |
| T2929 |
12713-12716 |
CD |
denotes |
4.5 |
| T2930 |
12717-12718 |
-LRB- |
denotes |
( |
| T2931 |
12718-12722 |
NN |
denotes |
P4.5 |
| T2932 |
12722-12723 |
-RRB- |
denotes |
) |
| T2933 |
12732-12738 |
JJ |
denotes |
dorsal |
| T2934 |
12744-12753 |
NNS |
denotes |
follicles |
| T2935 |
12739-12743 |
NN |
denotes |
hair |
| T2936 |
12754-12758 |
WDT |
denotes |
that |
| T2937 |
12759-12762 |
VBP |
denotes |
are |
| T2938 |
12763-12773 |
RB |
denotes |
noticeably |
| T2939 |
12779-12788 |
JJ |
denotes |
developed |
| T2940 |
12774-12778 |
RBR |
denotes |
more |
| T2941 |
12789-12793 |
IN |
denotes |
than |
| T2942 |
12794-12801 |
JJ |
denotes |
ventral |
| T2943 |
12807-12816 |
NNS |
denotes |
follicles |
| T2944 |
12802-12806 |
NN |
denotes |
hair |
| T2945 |
12816-12818 |
, |
denotes |
, |
| T2946 |
12818-12823 |
IN |
denotes |
along |
| T2947 |
12824-12828 |
IN |
denotes |
with |
| T2948 |
12829-12830 |
DT |
denotes |
a |
| T2949 |
12852-12860 |
NN |
denotes |
decrease |
| T2950 |
12831-12838 |
JJ |
denotes |
gradual |
| T2951 |
12839-12851 |
JJ |
denotes |
dorsoventral |
| T2952 |
12861-12863 |
IN |
denotes |
in |
| T2953 |
12864-12870 |
JJ |
denotes |
dermal |
| T2954 |
12871-12880 |
NN |
denotes |
thickness |
| T2955 |
12881-12882 |
-LRB- |
denotes |
( |
| T2956 |
12882-12888 |
NN |
denotes |
Figure |
| T2957 |
12889-12891 |
CD |
denotes |
1F |
| T2958 |
12891-12892 |
-RRB- |
denotes |
) |
| T2959 |
12892-12893 |
. |
denotes |
. |
| T2960 |
12893-13090 |
sentence |
denotes |
However, differences in skin thickness disappear by 3–4 wk of age (Forsthoefel et al. 1966), and, overall, the proportion of different hair types is also similar in dorsa and ventra of adult mice. |
| T2961 |
12894-12901 |
RB |
denotes |
However |
| T2962 |
12933-12942 |
VBP |
denotes |
disappear |
| T2963 |
12901-12903 |
, |
denotes |
, |
| T2964 |
12903-12914 |
NNS |
denotes |
differences |
| T2965 |
12915-12917 |
IN |
denotes |
in |
| T2966 |
12918-12922 |
NN |
denotes |
skin |
| T2967 |
12923-12932 |
NN |
denotes |
thickness |
| T2968 |
12943-12945 |
IN |
denotes |
by |
| T2969 |
12946-12947 |
CD |
denotes |
3 |
| T2970 |
12948-12949 |
CD |
denotes |
4 |
| T2971 |
12947-12948 |
SYM |
denotes |
– |
| T2972 |
12950-12952 |
NN |
denotes |
wk |
| T2973 |
12953-12955 |
IN |
denotes |
of |
| T2974 |
12956-12959 |
NN |
denotes |
age |
| T2975 |
12960-12961 |
-LRB- |
denotes |
( |
| T2976 |
12961-12972 |
NNP |
denotes |
Forsthoefel |
| T2977 |
12973-12975 |
FW |
denotes |
et |
| T2978 |
12976-12979 |
FW |
denotes |
al. |
| T2979 |
12980-12984 |
CD |
denotes |
1966 |
| T2980 |
12984-12985 |
-RRB- |
denotes |
) |
| T2981 |
12985-12987 |
, |
denotes |
, |
| T2982 |
12987-12990 |
CC |
denotes |
and |
| T2983 |
12990-12992 |
, |
denotes |
, |
| T2984 |
12992-12999 |
RB |
denotes |
overall |
| T2985 |
13040-13042 |
VBZ |
denotes |
is |
| T2986 |
12999-13001 |
, |
denotes |
, |
| T2987 |
13001-13004 |
DT |
denotes |
the |
| T2988 |
13005-13015 |
NN |
denotes |
proportion |
| T2989 |
13016-13018 |
IN |
denotes |
of |
| T2990 |
13019-13028 |
JJ |
denotes |
different |
| T2991 |
13034-13039 |
NNS |
denotes |
types |
| T2992 |
13029-13033 |
NN |
denotes |
hair |
| T2993 |
13043-13047 |
RB |
denotes |
also |
| T2994 |
13048-13055 |
JJ |
denotes |
similar |
| T2995 |
13056-13058 |
IN |
denotes |
in |
| T2996 |
13059-13064 |
NNS |
denotes |
dorsa |
| T2997 |
13065-13068 |
CC |
denotes |
and |
| T2998 |
13069-13075 |
NNS |
denotes |
ventra |
| T2999 |
13076-13078 |
IN |
denotes |
of |
| T3000 |
13079-13084 |
JJ |
denotes |
adult |
| T3001 |
13085-13089 |
NNS |
denotes |
mice |
| T3002 |
13089-13090 |
. |
denotes |
. |
| T3003 |
13090-13384 |
sentence |
denotes |
In age-matched inbred mice, we observed a small decrease in the ratio of undercoat hairs (zigzags) to overcoat hairs (auchenes, awls, and guard hairs) in dorsum compared to ventrum (Figure 1E), but there was no consistent difference in hair-type distribution for outbred mice (data not shown). |
| T3004 |
13091-13093 |
IN |
denotes |
In |
| T3005 |
13122-13130 |
VBD |
denotes |
observed |
| T3006 |
13094-13097 |
NN |
denotes |
age |
| T3007 |
13098-13105 |
VBN |
denotes |
matched |
| T3008 |
13097-13098 |
HYPH |
denotes |
- |
| T3009 |
13113-13117 |
NNS |
denotes |
mice |
| T3010 |
13106-13112 |
JJ |
denotes |
inbred |
| T3011 |
13117-13119 |
, |
denotes |
, |
| T3012 |
13119-13121 |
PRP |
denotes |
we |
| T3013 |
13131-13132 |
DT |
denotes |
a |
| T3014 |
13139-13147 |
NN |
denotes |
decrease |
| T3015 |
13133-13138 |
JJ |
denotes |
small |
| T3016 |
13148-13150 |
IN |
denotes |
in |
| T3017 |
13151-13154 |
DT |
denotes |
the |
| T3018 |
13155-13160 |
NN |
denotes |
ratio |
| T3019 |
13161-13163 |
IN |
denotes |
of |
| T3020 |
13164-13173 |
NN |
denotes |
undercoat |
| T3021 |
13174-13179 |
NNS |
denotes |
hairs |
| T3022 |
13180-13181 |
-LRB- |
denotes |
( |
| T3023 |
13181-13188 |
NNS |
denotes |
zigzags |
| T3024 |
13188-13189 |
-RRB- |
denotes |
) |
| T3025 |
13190-13192 |
IN |
denotes |
to |
| T3026 |
13193-13201 |
NN |
denotes |
overcoat |
| T3027 |
13202-13207 |
NNS |
denotes |
hairs |
| T3028 |
13208-13209 |
-LRB- |
denotes |
( |
| T3029 |
13209-13217 |
NNS |
denotes |
auchenes |
| T3030 |
13217-13219 |
, |
denotes |
, |
| T3031 |
13219-13223 |
NNS |
denotes |
awls |
| T3032 |
13223-13225 |
, |
denotes |
, |
| T3033 |
13225-13228 |
CC |
denotes |
and |
| T3034 |
13229-13234 |
NN |
denotes |
guard |
| T3035 |
13235-13240 |
NNS |
denotes |
hairs |
| T3036 |
13240-13241 |
-RRB- |
denotes |
) |
| T3037 |
13242-13244 |
IN |
denotes |
in |
| T3038 |
13245-13251 |
NN |
denotes |
dorsum |
| T3039 |
13252-13260 |
VBN |
denotes |
compared |
| T3040 |
13261-13263 |
IN |
denotes |
to |
| T3041 |
13264-13271 |
NN |
denotes |
ventrum |
| T3042 |
13272-13273 |
-LRB- |
denotes |
( |
| T3043 |
13273-13279 |
NN |
denotes |
Figure |
| T3044 |
13280-13282 |
CD |
denotes |
1E |
| T3045 |
13282-13283 |
-RRB- |
denotes |
) |
| T3046 |
13283-13285 |
, |
denotes |
, |
| T3047 |
13285-13288 |
CC |
denotes |
but |
| T3048 |
13289-13294 |
EX |
denotes |
there |
| T3049 |
13295-13298 |
VBD |
denotes |
was |
| T3050 |
13299-13301 |
DT |
denotes |
no |
| T3051 |
13313-13323 |
NN |
denotes |
difference |
| T3052 |
13302-13312 |
JJ |
denotes |
consistent |
| T3053 |
13324-13326 |
IN |
denotes |
in |
| T3054 |
13327-13331 |
NN |
denotes |
hair |
| T3055 |
13332-13336 |
NN |
denotes |
type |
| T3056 |
13331-13332 |
HYPH |
denotes |
- |
| T3057 |
13337-13349 |
NN |
denotes |
distribution |
| T3058 |
13350-13353 |
IN |
denotes |
for |
| T3059 |
13354-13361 |
JJ |
denotes |
outbred |
| T3060 |
13362-13366 |
NNS |
denotes |
mice |
| T3061 |
13367-13368 |
-LRB- |
denotes |
( |
| T3062 |
13377-13382 |
VBN |
denotes |
shown |
| T3063 |
13368-13372 |
NNS |
denotes |
data |
| T3064 |
13373-13376 |
RB |
denotes |
not |
| T3065 |
13382-13383 |
-RRB- |
denotes |
) |
| T3066 |
13383-13384 |
. |
denotes |
. |
| T3067 |
13384-13758 |
sentence |
denotes |
Differences between dorsal and ventral pigmentation of at/at mice are usually attributed to pigment-type differences caused by ventral-specific expression of Agouti, but animals homozygous for a null allele of Agouti, extreme nonagouti (ae), have ventral hairs that contain less melanin than dorsal hairs, giving a slightly paler appearance to the ventral coat (Figure 1G). |
| T3068 |
13385-13396 |
NNS |
denotes |
Differences |
| T3069 |
13463-13473 |
VBN |
denotes |
attributed |
| T3070 |
13397-13404 |
IN |
denotes |
between |
| T3071 |
13405-13411 |
JJ |
denotes |
dorsal |
| T3072 |
13424-13436 |
NN |
denotes |
pigmentation |
| T3073 |
13412-13415 |
CC |
denotes |
and |
| T3074 |
13416-13423 |
JJ |
denotes |
ventral |
| T3075 |
13437-13439 |
IN |
denotes |
of |
| T3076 |
13440-13442 |
NN |
denotes |
at |
| T3077 |
13443-13445 |
NN |
denotes |
at |
| T3078 |
13442-13443 |
HYPH |
denotes |
/ |
| T3079 |
13446-13450 |
NNS |
denotes |
mice |
| T3080 |
13451-13454 |
VBP |
denotes |
are |
| T3081 |
13455-13462 |
RB |
denotes |
usually |
| T3082 |
13474-13476 |
IN |
denotes |
to |
| T3083 |
13477-13484 |
NN |
denotes |
pigment |
| T3084 |
13485-13489 |
NN |
denotes |
type |
| T3085 |
13484-13485 |
HYPH |
denotes |
- |
| T3086 |
13490-13501 |
NNS |
denotes |
differences |
| T3087 |
13502-13508 |
VBN |
denotes |
caused |
| T3088 |
13509-13511 |
IN |
denotes |
by |
| T3089 |
13512-13519 |
JJ |
denotes |
ventral |
| T3090 |
13520-13528 |
JJ |
denotes |
specific |
| T3091 |
13519-13520 |
HYPH |
denotes |
- |
| T3092 |
13529-13539 |
NN |
denotes |
expression |
| T3093 |
13540-13542 |
IN |
denotes |
of |
| T3094 |
13543-13549 |
NN |
denotes |
Agouti |
| T3095 |
13549-13551 |
, |
denotes |
, |
| T3096 |
13551-13554 |
CC |
denotes |
but |
| T3097 |
13555-13562 |
NNS |
denotes |
animals |
| T3098 |
13627-13631 |
VBP |
denotes |
have |
| T3099 |
13563-13573 |
JJ |
denotes |
homozygous |
| T3100 |
13574-13577 |
IN |
denotes |
for |
| T3101 |
13578-13579 |
DT |
denotes |
a |
| T3102 |
13585-13591 |
NN |
denotes |
allele |
| T3103 |
13580-13584 |
JJ |
denotes |
null |
| T3104 |
13592-13594 |
IN |
denotes |
of |
| T3105 |
13595-13601 |
NN |
denotes |
Agouti |
| T3106 |
13601-13603 |
, |
denotes |
, |
| T3107 |
13603-13610 |
JJ |
denotes |
extreme |
| T3108 |
13611-13620 |
NN |
denotes |
nonagouti |
| T3109 |
13621-13622 |
-LRB- |
denotes |
( |
| T3110 |
13622-13624 |
NN |
denotes |
ae |
| T3111 |
13624-13625 |
-RRB- |
denotes |
) |
| T3112 |
13625-13627 |
, |
denotes |
, |
| T3113 |
13632-13639 |
JJ |
denotes |
ventral |
| T3114 |
13640-13645 |
NNS |
denotes |
hairs |
| T3115 |
13646-13650 |
WDT |
denotes |
that |
| T3116 |
13651-13658 |
VBP |
denotes |
contain |
| T3117 |
13659-13663 |
JJR |
denotes |
less |
| T3118 |
13664-13671 |
NN |
denotes |
melanin |
| T3119 |
13672-13676 |
IN |
denotes |
than |
| T3120 |
13677-13683 |
JJ |
denotes |
dorsal |
| T3121 |
13684-13689 |
NNS |
denotes |
hairs |
| T3122 |
13689-13691 |
, |
denotes |
, |
| T3123 |
13691-13697 |
VBG |
denotes |
giving |
| T3124 |
13698-13699 |
DT |
denotes |
a |
| T3125 |
13715-13725 |
NN |
denotes |
appearance |
| T3126 |
13700-13708 |
RB |
denotes |
slightly |
| T3127 |
13709-13714 |
JJ |
denotes |
paler |
| T3128 |
13726-13728 |
IN |
denotes |
to |
| T3129 |
13729-13732 |
DT |
denotes |
the |
| T3130 |
13741-13745 |
NN |
denotes |
coat |
| T3131 |
13733-13740 |
JJ |
denotes |
ventral |
| T3132 |
13746-13747 |
-LRB- |
denotes |
( |
| T3133 |
13747-13753 |
NN |
denotes |
Figure |
| T3134 |
13754-13756 |
CD |
denotes |
1G |
| T3135 |
13756-13757 |
-RRB- |
denotes |
) |
| T3136 |
13757-13758 |
. |
denotes |
. |
| T3137 |
13758-13930 |
sentence |
denotes |
Using DOPA staining as an indicator of tyrosinase activity, we observed a gradual dorsoventral transition in isolated dermis preparations from P4.5 ae/ae mice (Figure 1G). |
| T3138 |
13759-13764 |
VBG |
denotes |
Using |
| T3139 |
13822-13830 |
VBD |
denotes |
observed |
| T3140 |
13765-13769 |
NN |
denotes |
DOPA |
| T3141 |
13770-13778 |
NN |
denotes |
staining |
| T3142 |
13779-13781 |
IN |
denotes |
as |
| T3143 |
13782-13784 |
DT |
denotes |
an |
| T3144 |
13785-13794 |
NN |
denotes |
indicator |
| T3145 |
13795-13797 |
IN |
denotes |
of |
| T3146 |
13798-13808 |
NN |
denotes |
tyrosinase |
| T3147 |
13809-13817 |
NN |
denotes |
activity |
| T3148 |
13817-13819 |
, |
denotes |
, |
| T3149 |
13819-13821 |
PRP |
denotes |
we |
| T3150 |
13831-13832 |
DT |
denotes |
a |
| T3151 |
13854-13864 |
NN |
denotes |
transition |
| T3152 |
13833-13840 |
JJ |
denotes |
gradual |
| T3153 |
13841-13853 |
JJ |
denotes |
dorsoventral |
| T3154 |
13865-13867 |
IN |
denotes |
in |
| T3155 |
13868-13876 |
VBN |
denotes |
isolated |
| T3156 |
13884-13896 |
NNS |
denotes |
preparations |
| T3157 |
13877-13883 |
NN |
denotes |
dermis |
| T3158 |
13897-13901 |
IN |
denotes |
from |
| T3159 |
13902-13906 |
NN |
denotes |
P4.5 |
| T3160 |
13913-13917 |
NNS |
denotes |
mice |
| T3161 |
13907-13909 |
NN |
denotes |
ae |
| T3162 |
13910-13912 |
NN |
denotes |
ae |
| T3163 |
13909-13910 |
HYPH |
denotes |
/ |
| T3164 |
13918-13919 |
-LRB- |
denotes |
( |
| T3165 |
13919-13925 |
NN |
denotes |
Figure |
| T3166 |
13926-13928 |
CD |
denotes |
1G |
| T3167 |
13928-13929 |
-RRB- |
denotes |
) |
| T3168 |
13929-13930 |
. |
denotes |
. |
| T3169 |
13930-14175 |
sentence |
denotes |
By contrast, skin from at/at mice reveal an abrupt dorsoventral transition of DOPA staining, which probably reflects the additive effects of reduced melanin content (as in ae/ae mice) and downregulation of tyrosinase activity induced by Agouti. |
| T3170 |
13931-13933 |
IN |
denotes |
By |
| T3171 |
13965-13971 |
VBP |
denotes |
reveal |
| T3172 |
13934-13942 |
NN |
denotes |
contrast |
| T3173 |
13942-13944 |
, |
denotes |
, |
| T3174 |
13944-13948 |
NN |
denotes |
skin |
| T3175 |
13949-13953 |
IN |
denotes |
from |
| T3176 |
13954-13956 |
NN |
denotes |
at |
| T3177 |
13957-13959 |
NN |
denotes |
at |
| T3178 |
13956-13957 |
HYPH |
denotes |
/ |
| T3179 |
13960-13964 |
NNS |
denotes |
mice |
| T3180 |
13972-13974 |
DT |
denotes |
an |
| T3181 |
13995-14005 |
NN |
denotes |
transition |
| T3182 |
13975-13981 |
JJ |
denotes |
abrupt |
| T3183 |
13982-13994 |
JJ |
denotes |
dorsoventral |
| T3184 |
14006-14008 |
IN |
denotes |
of |
| T3185 |
14009-14013 |
NN |
denotes |
DOPA |
| T3186 |
14014-14022 |
NN |
denotes |
staining |
| T3187 |
14022-14024 |
, |
denotes |
, |
| T3188 |
14024-14029 |
WDT |
denotes |
which |
| T3189 |
14039-14047 |
VBZ |
denotes |
reflects |
| T3190 |
14030-14038 |
RB |
denotes |
probably |
| T3191 |
14048-14051 |
DT |
denotes |
the |
| T3192 |
14061-14068 |
NNS |
denotes |
effects |
| T3193 |
14052-14060 |
JJ |
denotes |
additive |
| T3194 |
14069-14071 |
IN |
denotes |
of |
| T3195 |
14072-14079 |
VBN |
denotes |
reduced |
| T3196 |
14088-14095 |
NN |
denotes |
content |
| T3197 |
14080-14087 |
NN |
denotes |
melanin |
| T3198 |
14096-14097 |
-LRB- |
denotes |
( |
| T3199 |
14097-14099 |
IN |
denotes |
as |
| T3200 |
14100-14102 |
IN |
denotes |
in |
| T3201 |
14103-14105 |
NN |
denotes |
ae |
| T3202 |
14106-14108 |
NN |
denotes |
ae |
| T3203 |
14105-14106 |
HYPH |
denotes |
/ |
| T3204 |
14109-14113 |
NNS |
denotes |
mice |
| T3205 |
14113-14114 |
-RRB- |
denotes |
) |
| T3206 |
14115-14118 |
CC |
denotes |
and |
| T3207 |
14119-14133 |
NN |
denotes |
downregulation |
| T3208 |
14134-14136 |
IN |
denotes |
of |
| T3209 |
14137-14147 |
NN |
denotes |
tyrosinase |
| T3210 |
14148-14156 |
NN |
denotes |
activity |
| T3211 |
14157-14164 |
VBN |
denotes |
induced |
| T3212 |
14165-14167 |
IN |
denotes |
by |
| T3213 |
14168-14174 |
NN |
denotes |
Agouti |
| T3214 |
14174-14175 |
. |
denotes |
. |
| T3215 |
14175-14308 |
sentence |
denotes |
Melanin content of individual hairs is likely to be influenced both by the number of pigment cells and their follicular environment. |
| T3216 |
14176-14183 |
NN |
denotes |
Melanin |
| T3217 |
14184-14191 |
NN |
denotes |
content |
| T3218 |
14212-14214 |
VBZ |
denotes |
is |
| T3219 |
14192-14194 |
IN |
denotes |
of |
| T3220 |
14195-14205 |
JJ |
denotes |
individual |
| T3221 |
14206-14211 |
NNS |
denotes |
hairs |
| T3222 |
14215-14221 |
JJ |
denotes |
likely |
| T3223 |
14222-14224 |
TO |
denotes |
to |
| T3224 |
14228-14238 |
VBN |
denotes |
influenced |
| T3225 |
14225-14227 |
VB |
denotes |
be |
| T3226 |
14239-14243 |
CC |
denotes |
both |
| T3227 |
14244-14246 |
IN |
denotes |
by |
| T3228 |
14247-14250 |
DT |
denotes |
the |
| T3229 |
14251-14257 |
NN |
denotes |
number |
| T3230 |
14258-14260 |
IN |
denotes |
of |
| T3231 |
14261-14268 |
NN |
denotes |
pigment |
| T3232 |
14269-14274 |
NNS |
denotes |
cells |
| T3233 |
14275-14278 |
CC |
denotes |
and |
| T3234 |
14279-14284 |
PRP$ |
denotes |
their |
| T3235 |
14296-14307 |
NN |
denotes |
environment |
| T3236 |
14285-14295 |
JJ |
denotes |
follicular |
| T3237 |
14307-14308 |
. |
denotes |
. |
| T3238 |
14308-14491 |
sentence |
denotes |
Regardless, dorsoventral differences in hair pigment content of ae/ae mice persist throughout multiple hair cycles into adulthood, similar to hair length (but unlike skin thickness). |
| T3239 |
14309-14319 |
RB |
denotes |
Regardless |
| T3240 |
14384-14391 |
VBP |
denotes |
persist |
| T3241 |
14319-14321 |
, |
denotes |
, |
| T3242 |
14321-14333 |
JJ |
denotes |
dorsoventral |
| T3243 |
14334-14345 |
NNS |
denotes |
differences |
| T3244 |
14346-14348 |
IN |
denotes |
in |
| T3245 |
14349-14353 |
NN |
denotes |
hair |
| T3246 |
14362-14369 |
NN |
denotes |
content |
| T3247 |
14354-14361 |
NN |
denotes |
pigment |
| T3248 |
14370-14372 |
IN |
denotes |
of |
| T3249 |
14373-14375 |
NN |
denotes |
ae |
| T3250 |
14376-14378 |
NN |
denotes |
ae |
| T3251 |
14375-14376 |
HYPH |
denotes |
/ |
| T3252 |
14379-14383 |
NNS |
denotes |
mice |
| T3253 |
14392-14402 |
IN |
denotes |
throughout |
| T3254 |
14403-14411 |
JJ |
denotes |
multiple |
| T3255 |
14417-14423 |
NNS |
denotes |
cycles |
| T3256 |
14412-14416 |
NN |
denotes |
hair |
| T3257 |
14424-14428 |
IN |
denotes |
into |
| T3258 |
14429-14438 |
NN |
denotes |
adulthood |
| T3259 |
14438-14440 |
, |
denotes |
, |
| T3260 |
14440-14447 |
JJ |
denotes |
similar |
| T3261 |
14448-14450 |
IN |
denotes |
to |
| T3262 |
14451-14455 |
NN |
denotes |
hair |
| T3263 |
14456-14462 |
NN |
denotes |
length |
| T3264 |
14463-14464 |
-LRB- |
denotes |
( |
| T3265 |
14464-14467 |
CC |
denotes |
but |
| T3266 |
14468-14474 |
IN |
denotes |
unlike |
| T3267 |
14475-14479 |
NN |
denotes |
skin |
| T3268 |
14480-14489 |
NN |
denotes |
thickness |
| T3269 |
14489-14490 |
-RRB- |
denotes |
) |
| T3270 |
14490-14491 |
. |
denotes |
. |
| T3271 |
14491-14700 |
sentence |
denotes |
Thus, at least three characteristics distinguish dorsal from ventral skin: differences in pigment-type synthesis (depending on Agouti genotype), differences in hair length, and differences in melanin content. |
| T3272 |
14492-14496 |
RB |
denotes |
Thus |
| T3273 |
14529-14540 |
VBP |
denotes |
distinguish |
| T3274 |
14496-14498 |
, |
denotes |
, |
| T3275 |
14498-14500 |
RB |
denotes |
at |
| T3276 |
14507-14512 |
CD |
denotes |
three |
| T3277 |
14501-14506 |
RBS |
denotes |
least |
| T3278 |
14513-14528 |
NNS |
denotes |
characteristics |
| T3279 |
14541-14547 |
JJ |
denotes |
dorsal |
| T3280 |
14548-14552 |
IN |
denotes |
from |
| T3281 |
14553-14560 |
JJ |
denotes |
ventral |
| T3282 |
14561-14565 |
NN |
denotes |
skin |
| T3283 |
14565-14567 |
: |
denotes |
: |
| T3284 |
14567-14578 |
NNS |
denotes |
differences |
| T3285 |
14579-14581 |
IN |
denotes |
in |
| T3286 |
14582-14589 |
NN |
denotes |
pigment |
| T3287 |
14590-14594 |
NN |
denotes |
type |
| T3288 |
14589-14590 |
HYPH |
denotes |
- |
| T3289 |
14595-14604 |
NN |
denotes |
synthesis |
| T3290 |
14605-14606 |
-LRB- |
denotes |
( |
| T3291 |
14606-14615 |
VBG |
denotes |
depending |
| T3292 |
14616-14618 |
IN |
denotes |
on |
| T3293 |
14619-14625 |
NN |
denotes |
Agouti |
| T3294 |
14626-14634 |
NN |
denotes |
genotype |
| T3295 |
14634-14635 |
-RRB- |
denotes |
) |
| T3296 |
14635-14637 |
, |
denotes |
, |
| T3297 |
14637-14648 |
NNS |
denotes |
differences |
| T3298 |
14649-14651 |
IN |
denotes |
in |
| T3299 |
14652-14656 |
NN |
denotes |
hair |
| T3300 |
14657-14663 |
NN |
denotes |
length |
| T3301 |
14663-14665 |
, |
denotes |
, |
| T3302 |
14665-14668 |
CC |
denotes |
and |
| T3303 |
14669-14680 |
NNS |
denotes |
differences |
| T3304 |
14681-14683 |
IN |
denotes |
in |
| T3305 |
14684-14691 |
NN |
denotes |
melanin |
| T3306 |
14692-14699 |
NN |
denotes |
content |
| T3307 |
14699-14700 |
. |
denotes |
. |
| T3535 |
14702-14716 |
NN |
denotes |
Ventralization |
| T3536 |
14717-14719 |
IN |
denotes |
of |
| T3537 |
14720-14724 |
NN |
denotes |
Skin |
| T3538 |
14725-14735 |
NN |
denotes |
Morphology |
| T3539 |
14736-14738 |
IN |
denotes |
by |
| T3540 |
14739-14742 |
DT |
denotes |
the |
| T3541 |
14754-14762 |
NN |
denotes |
Mutation |
| T3542 |
14743-14749 |
JJ |
denotes |
droopy |
| T3543 |
14750-14753 |
NN |
denotes |
ear |
| T3544 |
14762-15093 |
sentence |
denotes |
Named after its effects on craniofacial morphology, droopy ear is a recessive mutation on mouse Chromosome 3; the original allele described more than 40 years ago by Curry (1959) is extinct, but a spontaneous remutation that occurred in Harwell, deH, is available through The Jackson Laboratory (Bar Harbor, Maine, United States). |
| T3545 |
14763-14768 |
VBN |
denotes |
Named |
| T3546 |
14826-14828 |
VBZ |
denotes |
is |
| T3547 |
14769-14774 |
IN |
denotes |
after |
| T3548 |
14775-14778 |
PRP$ |
denotes |
its |
| T3549 |
14779-14786 |
NNS |
denotes |
effects |
| T3550 |
14787-14789 |
IN |
denotes |
on |
| T3551 |
14790-14802 |
JJ |
denotes |
craniofacial |
| T3552 |
14803-14813 |
NN |
denotes |
morphology |
| T3553 |
14813-14815 |
, |
denotes |
, |
| T3554 |
14815-14821 |
JJ |
denotes |
droopy |
| T3555 |
14822-14825 |
NN |
denotes |
ear |
| T3556 |
14942-14944 |
VBZ |
denotes |
is |
| T3557 |
14829-14830 |
DT |
denotes |
a |
| T3558 |
14841-14849 |
NN |
denotes |
mutation |
| T3559 |
14831-14840 |
JJ |
denotes |
recessive |
| T3560 |
14850-14852 |
IN |
denotes |
on |
| T3561 |
14853-14858 |
NN |
denotes |
mouse |
| T3562 |
14859-14869 |
NN |
denotes |
Chromosome |
| T3563 |
14870-14871 |
CD |
denotes |
3 |
| T3564 |
14871-14872 |
: |
denotes |
; |
| T3565 |
14873-14876 |
DT |
denotes |
the |
| T3566 |
14886-14892 |
NN |
denotes |
allele |
| T3567 |
14877-14885 |
JJ |
denotes |
original |
| T3568 |
14893-14902 |
VBN |
denotes |
described |
| T3569 |
14903-14907 |
JJR |
denotes |
more |
| T3570 |
14913-14915 |
CD |
denotes |
40 |
| T3571 |
14908-14912 |
IN |
denotes |
than |
| T3572 |
14916-14921 |
NNS |
denotes |
years |
| T3573 |
14922-14925 |
RB |
denotes |
ago |
| T3574 |
14926-14928 |
IN |
denotes |
by |
| T3575 |
14929-14934 |
NNP |
denotes |
Curry |
| T3576 |
14935-14936 |
-LRB- |
denotes |
( |
| T3577 |
14936-14940 |
CD |
denotes |
1959 |
| T3578 |
14940-14941 |
-RRB- |
denotes |
) |
| T3579 |
14945-14952 |
JJ |
denotes |
extinct |
| T3580 |
14952-14954 |
, |
denotes |
, |
| T3581 |
14954-14957 |
CC |
denotes |
but |
| T3582 |
14958-14959 |
DT |
denotes |
a |
| T3583 |
14972-14982 |
NN |
denotes |
remutation |
| T3584 |
14960-14971 |
JJ |
denotes |
spontaneous |
| T3585 |
15014-15016 |
VBZ |
denotes |
is |
| T3586 |
14983-14987 |
WDT |
denotes |
that |
| T3587 |
14988-14996 |
VBD |
denotes |
occurred |
| T3588 |
14997-14999 |
IN |
denotes |
in |
| T3589 |
15000-15007 |
NNP |
denotes |
Harwell |
| T3590 |
15007-15009 |
, |
denotes |
, |
| T3591 |
15009-15012 |
NN |
denotes |
deH |
| T3592 |
15012-15014 |
, |
denotes |
, |
| T3593 |
15017-15026 |
JJ |
denotes |
available |
| T3594 |
15027-15034 |
IN |
denotes |
through |
| T3595 |
15035-15038 |
DT |
denotes |
The |
| T3596 |
15047-15057 |
NNP |
denotes |
Laboratory |
| T3597 |
15039-15046 |
NNP |
denotes |
Jackson |
| T3598 |
15058-15059 |
-LRB- |
denotes |
( |
| T3599 |
15063-15069 |
NNP |
denotes |
Harbor |
| T3600 |
15059-15062 |
NNP |
denotes |
Bar |
| T3601 |
15069-15071 |
, |
denotes |
, |
| T3602 |
15071-15076 |
NNP |
denotes |
Maine |
| T3603 |
15076-15078 |
, |
denotes |
, |
| T3604 |
15078-15084 |
NNP |
denotes |
United |
| T3605 |
15085-15091 |
NNP |
denotes |
States |
| T3606 |
15091-15092 |
-RRB- |
denotes |
) |
| T3607 |
15092-15093 |
. |
denotes |
. |
| T3608 |
15093-15390 |
sentence |
denotes |
External craniofacial malformations are the most obvious characteristic of deH/deH animals, including widely spaced eyes, small palpebral fissures, a broad nasal area, and a shortened skull held in an elevated position, which presumably causes or contributes to the abnormal position of the ears. |
| T3609 |
15094-15102 |
JJ |
denotes |
External |
| T3610 |
15116-15129 |
NNS |
denotes |
malformations |
| T3611 |
15103-15115 |
JJ |
denotes |
craniofacial |
| T3612 |
15130-15133 |
VBP |
denotes |
are |
| T3613 |
15134-15137 |
DT |
denotes |
the |
| T3614 |
15151-15165 |
NN |
denotes |
characteristic |
| T3615 |
15138-15142 |
RBS |
denotes |
most |
| T3616 |
15143-15150 |
JJ |
denotes |
obvious |
| T3617 |
15166-15168 |
IN |
denotes |
of |
| T3618 |
15169-15172 |
NN |
denotes |
deH |
| T3619 |
15173-15176 |
NN |
denotes |
deH |
| T3620 |
15172-15173 |
HYPH |
denotes |
/ |
| T3621 |
15177-15184 |
NNS |
denotes |
animals |
| T3622 |
15184-15186 |
, |
denotes |
, |
| T3623 |
15186-15195 |
VBG |
denotes |
including |
| T3624 |
15196-15202 |
RB |
denotes |
widely |
| T3625 |
15203-15209 |
VBN |
denotes |
spaced |
| T3626 |
15210-15214 |
NNS |
denotes |
eyes |
| T3627 |
15214-15216 |
, |
denotes |
, |
| T3628 |
15216-15221 |
JJ |
denotes |
small |
| T3629 |
15232-15240 |
NNS |
denotes |
fissures |
| T3630 |
15222-15231 |
JJ |
denotes |
palpebral |
| T3631 |
15240-15242 |
, |
denotes |
, |
| T3632 |
15242-15243 |
DT |
denotes |
a |
| T3633 |
15256-15260 |
NN |
denotes |
area |
| T3634 |
15244-15249 |
JJ |
denotes |
broad |
| T3635 |
15250-15255 |
JJ |
denotes |
nasal |
| T3636 |
15260-15262 |
, |
denotes |
, |
| T3637 |
15262-15265 |
CC |
denotes |
and |
| T3638 |
15266-15267 |
DT |
denotes |
a |
| T3639 |
15278-15283 |
NN |
denotes |
skull |
| T3640 |
15268-15277 |
JJ |
denotes |
shortened |
| T3641 |
15284-15288 |
VBN |
denotes |
held |
| T3642 |
15289-15291 |
IN |
denotes |
in |
| T3643 |
15292-15294 |
DT |
denotes |
an |
| T3644 |
15304-15312 |
NN |
denotes |
position |
| T3645 |
15295-15303 |
JJ |
denotes |
elevated |
| T3646 |
15312-15314 |
, |
denotes |
, |
| T3647 |
15314-15319 |
WDT |
denotes |
which |
| T3648 |
15331-15337 |
VBZ |
denotes |
causes |
| T3649 |
15320-15330 |
RB |
denotes |
presumably |
| T3650 |
15338-15340 |
CC |
denotes |
or |
| T3651 |
15341-15352 |
VBZ |
denotes |
contributes |
| T3652 |
15353-15355 |
IN |
denotes |
to |
| T3653 |
15356-15359 |
DT |
denotes |
the |
| T3654 |
15369-15377 |
NN |
denotes |
position |
| T3655 |
15360-15368 |
JJ |
denotes |
abnormal |
| T3656 |
15378-15380 |
IN |
denotes |
of |
| T3657 |
15381-15384 |
DT |
denotes |
the |
| T3658 |
15385-15389 |
NNS |
denotes |
ears |
| T3659 |
15389-15390 |
. |
denotes |
. |
| T3660 |
15390-15744 |
sentence |
denotes |
We became interested in droopy ear because the original allele was described to affect pigment pattern in a way that suggests a possible dorsal to ventral transformation: “On a genetic background (at and AW) which causes the belly hair to be lighter than the back hair, the belly hair comes up farther round the sides of the body and face” (Curry 1959). |
| T3661 |
15391-15393 |
PRP |
denotes |
We |
| T3662 |
15394-15400 |
VBD |
denotes |
became |
| T3663 |
15676-15681 |
VBZ |
denotes |
comes |
| T3664 |
15401-15411 |
JJ |
denotes |
interested |
| T3665 |
15412-15414 |
IN |
denotes |
in |
| T3666 |
15415-15421 |
JJ |
denotes |
droopy |
| T3667 |
15422-15425 |
NN |
denotes |
ear |
| T3668 |
15426-15433 |
IN |
denotes |
because |
| T3669 |
15458-15467 |
VBN |
denotes |
described |
| T3670 |
15434-15437 |
DT |
denotes |
the |
| T3671 |
15447-15453 |
NN |
denotes |
allele |
| T3672 |
15438-15446 |
JJ |
denotes |
original |
| T3673 |
15454-15457 |
VBD |
denotes |
was |
| T3674 |
15468-15470 |
TO |
denotes |
to |
| T3675 |
15471-15477 |
VB |
denotes |
affect |
| T3676 |
15478-15485 |
NN |
denotes |
pigment |
| T3677 |
15486-15493 |
NN |
denotes |
pattern |
| T3678 |
15494-15496 |
IN |
denotes |
in |
| T3679 |
15497-15498 |
DT |
denotes |
a |
| T3680 |
15499-15502 |
NN |
denotes |
way |
| T3681 |
15503-15507 |
WDT |
denotes |
that |
| T3682 |
15508-15516 |
VBZ |
denotes |
suggests |
| T3683 |
15517-15518 |
DT |
denotes |
a |
| T3684 |
15546-15560 |
NN |
denotes |
transformation |
| T3685 |
15519-15527 |
JJ |
denotes |
possible |
| T3686 |
15528-15534 |
JJ |
denotes |
dorsal |
| T3687 |
15535-15537 |
IN |
denotes |
to |
| T3688 |
15538-15545 |
JJ |
denotes |
ventral |
| T3689 |
15560-15562 |
: |
denotes |
: |
| T3690 |
15562-15563 |
`` |
denotes |
“ |
| T3691 |
15563-15565 |
IN |
denotes |
On |
| T3692 |
15566-15567 |
DT |
denotes |
a |
| T3693 |
15576-15586 |
NN |
denotes |
background |
| T3694 |
15568-15575 |
JJ |
denotes |
genetic |
| T3695 |
15587-15588 |
-LRB- |
denotes |
( |
| T3696 |
15588-15590 |
NN |
denotes |
at |
| T3697 |
15591-15594 |
CC |
denotes |
and |
| T3698 |
15595-15597 |
NN |
denotes |
AW |
| T3699 |
15597-15598 |
-RRB- |
denotes |
) |
| T3700 |
15599-15604 |
WDT |
denotes |
which |
| T3701 |
15605-15611 |
VBZ |
denotes |
causes |
| T3702 |
15612-15615 |
DT |
denotes |
the |
| T3703 |
15622-15626 |
NN |
denotes |
hair |
| T3704 |
15616-15621 |
NN |
denotes |
belly |
| T3705 |
15630-15632 |
VB |
denotes |
be |
| T3706 |
15627-15629 |
TO |
denotes |
to |
| T3707 |
15633-15640 |
JJR |
denotes |
lighter |
| T3708 |
15641-15645 |
IN |
denotes |
than |
| T3709 |
15646-15649 |
DT |
denotes |
the |
| T3710 |
15655-15659 |
NN |
denotes |
hair |
| T3711 |
15650-15654 |
NN |
denotes |
back |
| T3712 |
15659-15661 |
, |
denotes |
, |
| T3713 |
15661-15664 |
DT |
denotes |
the |
| T3714 |
15671-15675 |
NN |
denotes |
hair |
| T3715 |
15665-15670 |
NN |
denotes |
belly |
| T3716 |
15682-15684 |
RP |
denotes |
up |
| T3717 |
15685-15692 |
RBR |
denotes |
farther |
| T3718 |
15693-15698 |
IN |
denotes |
round |
| T3719 |
15699-15702 |
DT |
denotes |
the |
| T3720 |
15703-15708 |
NNS |
denotes |
sides |
| T3721 |
15709-15711 |
IN |
denotes |
of |
| T3722 |
15712-15715 |
DT |
denotes |
the |
| T3723 |
15716-15720 |
NN |
denotes |
body |
| T3724 |
15721-15724 |
CC |
denotes |
and |
| T3725 |
15725-15729 |
NN |
denotes |
face |
| T3726 |
15729-15730 |
'' |
denotes |
” |
| T3727 |
15731-15732 |
-LRB- |
denotes |
( |
| T3728 |
15732-15737 |
NNP |
denotes |
Curry |
| T3729 |
15738-15742 |
CD |
denotes |
1959 |
| T3730 |
15742-15743 |
-RRB- |
denotes |
) |
| T3731 |
15743-15744 |
. |
denotes |
. |
| T3732 |
15744-15964 |
sentence |
denotes |
An abnormal dorsoventral pigment pattern is readily apparent in at/at; deH/deH mice, but comparison to nonmutant animals is more accurately described in terms of ventral, lateral, and dorsal regions (Figures 1G and 2A). |
| T3733 |
15745-15747 |
DT |
denotes |
An |
| T3734 |
15778-15785 |
NN |
denotes |
pattern |
| T3735 |
15748-15756 |
JJ |
denotes |
abnormal |
| T3736 |
15757-15769 |
JJ |
denotes |
dorsoventral |
| T3737 |
15770-15777 |
NN |
denotes |
pigment |
| T3738 |
15786-15788 |
VBZ |
denotes |
is |
| T3739 |
15789-15796 |
RB |
denotes |
readily |
| T3740 |
15797-15805 |
JJ |
denotes |
apparent |
| T3741 |
15806-15808 |
IN |
denotes |
in |
| T3742 |
15809-15811 |
NN |
denotes |
at |
| T3743 |
15812-15814 |
NN |
denotes |
at |
| T3744 |
15811-15812 |
HYPH |
denotes |
/ |
| T3745 |
15824-15828 |
NNS |
denotes |
mice |
| T3746 |
15814-15815 |
, |
denotes |
; |
| T3747 |
15816-15819 |
NN |
denotes |
deH |
| T3748 |
15820-15823 |
NN |
denotes |
deH |
| T3749 |
15819-15820 |
HYPH |
denotes |
/ |
| T3750 |
15828-15830 |
, |
denotes |
, |
| T3751 |
15830-15833 |
CC |
denotes |
but |
| T3752 |
15834-15844 |
NN |
denotes |
comparison |
| T3753 |
15885-15894 |
VBN |
denotes |
described |
| T3754 |
15845-15847 |
IN |
denotes |
to |
| T3755 |
15848-15857 |
JJ |
denotes |
nonmutant |
| T3756 |
15858-15865 |
NNS |
denotes |
animals |
| T3757 |
15866-15868 |
VBZ |
denotes |
is |
| T3758 |
15869-15873 |
RBR |
denotes |
more |
| T3759 |
15874-15884 |
RB |
denotes |
accurately |
| T3760 |
15895-15897 |
IN |
denotes |
in |
| T3761 |
15898-15903 |
NNS |
denotes |
terms |
| T3762 |
15904-15906 |
IN |
denotes |
of |
| T3763 |
15907-15914 |
JJ |
denotes |
ventral |
| T3764 |
15936-15943 |
NNS |
denotes |
regions |
| T3765 |
15914-15916 |
, |
denotes |
, |
| T3766 |
15916-15923 |
JJ |
denotes |
lateral |
| T3767 |
15923-15925 |
, |
denotes |
, |
| T3768 |
15925-15928 |
CC |
denotes |
and |
| T3769 |
15929-15935 |
JJ |
denotes |
dorsal |
| T3770 |
15944-15945 |
-LRB- |
denotes |
( |
| T3771 |
15953-15955 |
CD |
denotes |
1G |
| T3772 |
15945-15952 |
NNS |
denotes |
Figures |
| T3773 |
15956-15959 |
CC |
denotes |
and |
| T3774 |
15960-15962 |
CD |
denotes |
2A |
| T3775 |
15962-15963 |
-RRB- |
denotes |
) |
| T3776 |
15963-15964 |
. |
denotes |
. |
| T3777 |
15964-16229 |
sentence |
denotes |
The ventral region has short hairs with a gray base and cream-colored tip whose boundary coincides with the limb–body wall junction; both the appearance of this region and position of the boundary are approximately similar in at/at compared to at/at; deH/deH mice. |
| T3778 |
15965-15968 |
DT |
denotes |
The |
| T3779 |
15977-15983 |
NN |
denotes |
region |
| T3780 |
15969-15976 |
JJ |
denotes |
ventral |
| T3781 |
15984-15987 |
VBZ |
denotes |
has |
| T3782 |
16162-16165 |
VBP |
denotes |
are |
| T3783 |
15988-15993 |
JJ |
denotes |
short |
| T3784 |
15994-15999 |
NNS |
denotes |
hairs |
| T3785 |
16000-16004 |
IN |
denotes |
with |
| T3786 |
16005-16006 |
DT |
denotes |
a |
| T3787 |
16012-16016 |
NN |
denotes |
base |
| T3788 |
16007-16011 |
JJ |
denotes |
gray |
| T3789 |
16017-16020 |
CC |
denotes |
and |
| T3790 |
16021-16026 |
NN |
denotes |
cream |
| T3791 |
16027-16034 |
VBN |
denotes |
colored |
| T3792 |
16026-16027 |
HYPH |
denotes |
- |
| T3793 |
16035-16038 |
NN |
denotes |
tip |
| T3794 |
16039-16044 |
WP$ |
denotes |
whose |
| T3795 |
16045-16053 |
NN |
denotes |
boundary |
| T3796 |
16054-16063 |
VBZ |
denotes |
coincides |
| T3797 |
16064-16068 |
IN |
denotes |
with |
| T3798 |
16069-16072 |
DT |
denotes |
the |
| T3799 |
16088-16096 |
NN |
denotes |
junction |
| T3800 |
16073-16077 |
NN |
denotes |
limb |
| T3801 |
16078-16082 |
NN |
denotes |
body |
| T3802 |
16077-16078 |
HYPH |
denotes |
– |
| T3803 |
16083-16087 |
NN |
denotes |
wall |
| T3804 |
16096-16097 |
: |
denotes |
; |
| T3805 |
16098-16102 |
CC |
denotes |
both |
| T3806 |
16107-16117 |
NN |
denotes |
appearance |
| T3807 |
16103-16106 |
DT |
denotes |
the |
| T3808 |
16118-16120 |
IN |
denotes |
of |
| T3809 |
16121-16125 |
DT |
denotes |
this |
| T3810 |
16126-16132 |
NN |
denotes |
region |
| T3811 |
16133-16136 |
CC |
denotes |
and |
| T3812 |
16137-16145 |
NN |
denotes |
position |
| T3813 |
16146-16148 |
IN |
denotes |
of |
| T3814 |
16149-16152 |
DT |
denotes |
the |
| T3815 |
16153-16161 |
NN |
denotes |
boundary |
| T3816 |
16166-16179 |
RB |
denotes |
approximately |
| T3817 |
16180-16187 |
JJ |
denotes |
similar |
| T3818 |
16188-16190 |
IN |
denotes |
in |
| T3819 |
16191-16193 |
NN |
denotes |
at |
| T3820 |
16194-16196 |
NN |
denotes |
at |
| T3821 |
16193-16194 |
HYPH |
denotes |
/ |
| T3822 |
16224-16228 |
NNS |
denotes |
mice |
| T3823 |
16197-16205 |
VBN |
denotes |
compared |
| T3824 |
16206-16208 |
IN |
denotes |
to |
| T3825 |
16209-16211 |
NN |
denotes |
at |
| T3826 |
16212-16214 |
NN |
denotes |
at |
| T3827 |
16211-16212 |
HYPH |
denotes |
/ |
| T3828 |
16214-16215 |
, |
denotes |
; |
| T3829 |
16216-16219 |
NN |
denotes |
deH |
| T3830 |
16220-16223 |
NN |
denotes |
deH |
| T3831 |
16219-16220 |
HYPH |
denotes |
/ |
| T3832 |
16228-16229 |
. |
denotes |
. |
| T3833 |
16229-16597 |
sentence |
denotes |
The lateral region contains yellow hairs of progressively increasing length; in at/at mice, the lateral region appears as a thin yellow stripe along the flank, but in at/at; deH/deH mice, the lateral region is considerably expanded with a diffuse boundary along the dorsal flank, and a dorsal eumelanic region whose size is correspondingly reduced (Figure 2A and 2B). |
| T3834 |
16230-16233 |
DT |
denotes |
The |
| T3835 |
16242-16248 |
NN |
denotes |
region |
| T3836 |
16234-16241 |
JJ |
denotes |
lateral |
| T3837 |
16249-16257 |
VBZ |
denotes |
contains |
| T3838 |
16341-16348 |
VBZ |
denotes |
appears |
| T3839 |
16258-16264 |
JJ |
denotes |
yellow |
| T3840 |
16265-16270 |
NNS |
denotes |
hairs |
| T3841 |
16271-16273 |
IN |
denotes |
of |
| T3842 |
16274-16287 |
RB |
denotes |
progressively |
| T3843 |
16288-16298 |
VBG |
denotes |
increasing |
| T3844 |
16299-16305 |
NN |
denotes |
length |
| T3845 |
16305-16306 |
: |
denotes |
; |
| T3846 |
16307-16309 |
IN |
denotes |
in |
| T3847 |
16310-16312 |
NN |
denotes |
at |
| T3848 |
16313-16315 |
NN |
denotes |
at |
| T3849 |
16312-16313 |
HYPH |
denotes |
/ |
| T3850 |
16316-16320 |
NNS |
denotes |
mice |
| T3851 |
16320-16322 |
, |
denotes |
, |
| T3852 |
16322-16325 |
DT |
denotes |
the |
| T3853 |
16334-16340 |
NN |
denotes |
region |
| T3854 |
16326-16333 |
JJ |
denotes |
lateral |
| T3855 |
16349-16351 |
IN |
denotes |
as |
| T3856 |
16352-16353 |
DT |
denotes |
a |
| T3857 |
16366-16372 |
NN |
denotes |
stripe |
| T3858 |
16354-16358 |
JJ |
denotes |
thin |
| T3859 |
16359-16365 |
JJ |
denotes |
yellow |
| T3860 |
16373-16378 |
IN |
denotes |
along |
| T3861 |
16379-16382 |
DT |
denotes |
the |
| T3862 |
16383-16388 |
NN |
denotes |
flank |
| T3863 |
16388-16390 |
, |
denotes |
, |
| T3864 |
16390-16393 |
CC |
denotes |
but |
| T3865 |
16394-16396 |
IN |
denotes |
in |
| T3866 |
16437-16439 |
VBZ |
denotes |
is |
| T3867 |
16397-16399 |
NN |
denotes |
at |
| T3868 |
16400-16402 |
NN |
denotes |
at |
| T3869 |
16399-16400 |
HYPH |
denotes |
/ |
| T3870 |
16412-16416 |
NNS |
denotes |
mice |
| T3871 |
16402-16403 |
, |
denotes |
; |
| T3872 |
16404-16407 |
NN |
denotes |
deH |
| T3873 |
16408-16411 |
NN |
denotes |
deH |
| T3874 |
16407-16408 |
HYPH |
denotes |
/ |
| T3875 |
16416-16418 |
, |
denotes |
, |
| T3876 |
16418-16421 |
DT |
denotes |
the |
| T3877 |
16430-16436 |
NN |
denotes |
region |
| T3878 |
16422-16429 |
JJ |
denotes |
lateral |
| T3879 |
16440-16452 |
RB |
denotes |
considerably |
| T3880 |
16453-16461 |
JJ |
denotes |
expanded |
| T3881 |
16462-16466 |
IN |
denotes |
with |
| T3882 |
16467-16468 |
DT |
denotes |
a |
| T3883 |
16477-16485 |
NN |
denotes |
boundary |
| T3884 |
16469-16476 |
JJ |
denotes |
diffuse |
| T3885 |
16486-16491 |
IN |
denotes |
along |
| T3886 |
16492-16495 |
DT |
denotes |
the |
| T3887 |
16503-16508 |
NN |
denotes |
flank |
| T3888 |
16496-16502 |
JJ |
denotes |
dorsal |
| T3889 |
16508-16510 |
, |
denotes |
, |
| T3890 |
16510-16513 |
CC |
denotes |
and |
| T3891 |
16514-16515 |
DT |
denotes |
a |
| T3892 |
16533-16539 |
NN |
denotes |
region |
| T3893 |
16516-16522 |
JJ |
denotes |
dorsal |
| T3894 |
16523-16532 |
JJ |
denotes |
eumelanic |
| T3895 |
16540-16545 |
WP$ |
denotes |
whose |
| T3896 |
16546-16550 |
NN |
denotes |
size |
| T3897 |
16570-16577 |
VBN |
denotes |
reduced |
| T3898 |
16551-16553 |
VBZ |
denotes |
is |
| T3899 |
16554-16569 |
RB |
denotes |
correspondingly |
| T3900 |
16578-16579 |
-LRB- |
denotes |
( |
| T3901 |
16586-16588 |
CD |
denotes |
2A |
| T3902 |
16579-16585 |
NN |
denotes |
Figure |
| T3903 |
16589-16592 |
CC |
denotes |
and |
| T3904 |
16593-16595 |
CD |
denotes |
2B |
| T3905 |
16595-16596 |
-RRB- |
denotes |
) |
| T3906 |
16596-16597 |
. |
denotes |
. |
| T3907 |
16597-16815 |
sentence |
denotes |
Total body size is smaller in mutant compared to nonmutant animals, but the proportion of body circumference occupied by the lateral region in mutant animals is increased about 2-fold, from 11.9% to 22.2% (Figure 2C). |
| T3908 |
16598-16603 |
JJ |
denotes |
Total |
| T3909 |
16609-16613 |
NN |
denotes |
size |
| T3910 |
16604-16608 |
NN |
denotes |
body |
| T3911 |
16614-16616 |
VBZ |
denotes |
is |
| T3912 |
16617-16624 |
JJR |
denotes |
smaller |
| T3913 |
16625-16627 |
IN |
denotes |
in |
| T3914 |
16628-16634 |
JJ |
denotes |
mutant |
| T3915 |
16635-16643 |
VBN |
denotes |
compared |
| T3916 |
16644-16646 |
IN |
denotes |
to |
| T3917 |
16647-16656 |
JJ |
denotes |
nonmutant |
| T3918 |
16657-16664 |
NNS |
denotes |
animals |
| T3919 |
16664-16666 |
, |
denotes |
, |
| T3920 |
16666-16669 |
CC |
denotes |
but |
| T3921 |
16670-16673 |
DT |
denotes |
the |
| T3922 |
16674-16684 |
NN |
denotes |
proportion |
| T3923 |
16759-16768 |
VBN |
denotes |
increased |
| T3924 |
16685-16687 |
IN |
denotes |
of |
| T3925 |
16688-16692 |
NN |
denotes |
body |
| T3926 |
16693-16706 |
NN |
denotes |
circumference |
| T3927 |
16707-16715 |
VBN |
denotes |
occupied |
| T3928 |
16716-16718 |
IN |
denotes |
by |
| T3929 |
16719-16722 |
DT |
denotes |
the |
| T3930 |
16731-16737 |
NN |
denotes |
region |
| T3931 |
16723-16730 |
JJ |
denotes |
lateral |
| T3932 |
16738-16740 |
IN |
denotes |
in |
| T3933 |
16741-16747 |
JJ |
denotes |
mutant |
| T3934 |
16748-16755 |
NNS |
denotes |
animals |
| T3935 |
16756-16758 |
VBZ |
denotes |
is |
| T3936 |
16769-16774 |
RB |
denotes |
about |
| T3937 |
16775-16776 |
CD |
denotes |
2 |
| T3938 |
16777-16781 |
RB |
denotes |
fold |
| T3939 |
16776-16777 |
HYPH |
denotes |
- |
| T3940 |
16781-16783 |
, |
denotes |
, |
| T3941 |
16783-16787 |
IN |
denotes |
from |
| T3942 |
16788-16792 |
CD |
denotes |
11.9 |
| T3943 |
16792-16793 |
NN |
denotes |
% |
| T3944 |
16794-16796 |
IN |
denotes |
to |
| T3945 |
16797-16801 |
CD |
denotes |
22.2 |
| T3946 |
16801-16802 |
NN |
denotes |
% |
| T3947 |
16803-16804 |
-LRB- |
denotes |
( |
| T3948 |
16804-16810 |
NN |
denotes |
Figure |
| T3949 |
16811-16813 |
CD |
denotes |
2C |
| T3950 |
16813-16814 |
-RRB- |
denotes |
) |
| T3951 |
16814-16815 |
. |
denotes |
. |
| T3952 |
16815-17174 |
sentence |
denotes |
The proportion of the ventral cream-colored region is also expanded a small amount, 47.9% in mutant compared to 37.8% in nonmutant animals, but expansion of the lateral region, which occurs at all levels of the body, including the limbs and the cranium (but not the whisker pad), is the major feature responsible for the ventralized appearance caused by deH. |
| T3953 |
16816-16819 |
DT |
denotes |
The |
| T3954 |
16820-16830 |
NN |
denotes |
proportion |
| T3955 |
16875-16883 |
VBN |
denotes |
expanded |
| T3956 |
16831-16833 |
IN |
denotes |
of |
| T3957 |
16834-16837 |
DT |
denotes |
the |
| T3958 |
16860-16866 |
NN |
denotes |
region |
| T3959 |
16838-16845 |
JJ |
denotes |
ventral |
| T3960 |
16846-16851 |
NN |
denotes |
cream |
| T3961 |
16852-16859 |
VBN |
denotes |
colored |
| T3962 |
16851-16852 |
HYPH |
denotes |
- |
| T3963 |
16867-16869 |
VBZ |
denotes |
is |
| T3964 |
16870-16874 |
RB |
denotes |
also |
| T3965 |
16884-16885 |
DT |
denotes |
a |
| T3966 |
16892-16898 |
NN |
denotes |
amount |
| T3967 |
16886-16891 |
JJ |
denotes |
small |
| T3968 |
16898-16900 |
, |
denotes |
, |
| T3969 |
16900-16904 |
CD |
denotes |
47.9 |
| T3970 |
16904-16905 |
NN |
denotes |
% |
| T3971 |
16906-16908 |
IN |
denotes |
in |
| T3972 |
16909-16915 |
JJ |
denotes |
mutant |
| T3973 |
16916-16924 |
VBN |
denotes |
compared |
| T3974 |
16925-16927 |
IN |
denotes |
to |
| T3975 |
16928-16932 |
CD |
denotes |
37.8 |
| T3976 |
16932-16933 |
NN |
denotes |
% |
| T3977 |
16934-16936 |
IN |
denotes |
in |
| T3978 |
16937-16946 |
JJ |
denotes |
nonmutant |
| T3979 |
16947-16954 |
NNS |
denotes |
animals |
| T3980 |
16954-16956 |
, |
denotes |
, |
| T3981 |
16956-16959 |
CC |
denotes |
but |
| T3982 |
16960-16969 |
NN |
denotes |
expansion |
| T3983 |
17096-17098 |
VBZ |
denotes |
is |
| T3984 |
16970-16972 |
IN |
denotes |
of |
| T3985 |
16973-16976 |
DT |
denotes |
the |
| T3986 |
16985-16991 |
NN |
denotes |
region |
| T3987 |
16977-16984 |
JJ |
denotes |
lateral |
| T3988 |
16991-16993 |
, |
denotes |
, |
| T3989 |
16993-16998 |
WDT |
denotes |
which |
| T3990 |
16999-17005 |
VBZ |
denotes |
occurs |
| T3991 |
17006-17008 |
IN |
denotes |
at |
| T3992 |
17009-17012 |
DT |
denotes |
all |
| T3993 |
17013-17019 |
NNS |
denotes |
levels |
| T3994 |
17020-17022 |
IN |
denotes |
of |
| T3995 |
17023-17026 |
DT |
denotes |
the |
| T3996 |
17027-17031 |
NN |
denotes |
body |
| T3997 |
17031-17033 |
, |
denotes |
, |
| T3998 |
17033-17042 |
VBG |
denotes |
including |
| T3999 |
17043-17046 |
DT |
denotes |
the |
| T4000 |
17047-17052 |
NNS |
denotes |
limbs |
| T4001 |
17053-17056 |
CC |
denotes |
and |
| T4002 |
17057-17060 |
DT |
denotes |
the |
| T4003 |
17061-17068 |
NN |
denotes |
cranium |
| T4004 |
17069-17070 |
-LRB- |
denotes |
( |
| T4005 |
17070-17073 |
CC |
denotes |
but |
| T4006 |
17074-17077 |
RB |
denotes |
not |
| T4007 |
17078-17081 |
DT |
denotes |
the |
| T4008 |
17090-17093 |
NN |
denotes |
pad |
| T4009 |
17082-17089 |
NN |
denotes |
whisker |
| T4010 |
17093-17094 |
-RRB- |
denotes |
) |
| T4011 |
17094-17096 |
, |
denotes |
, |
| T4012 |
17099-17102 |
DT |
denotes |
the |
| T4013 |
17109-17116 |
NN |
denotes |
feature |
| T4014 |
17103-17108 |
JJ |
denotes |
major |
| T4015 |
17117-17128 |
JJ |
denotes |
responsible |
| T4016 |
17129-17132 |
IN |
denotes |
for |
| T4017 |
17133-17136 |
DT |
denotes |
the |
| T4018 |
17149-17159 |
NN |
denotes |
appearance |
| T4019 |
17137-17148 |
VBN |
denotes |
ventralized |
| T4020 |
17160-17166 |
VBN |
denotes |
caused |
| T4021 |
17167-17169 |
IN |
denotes |
by |
| T4022 |
17170-17173 |
NN |
denotes |
deH |
| T4023 |
17173-17174 |
. |
denotes |
. |
| T4024 |
17174-18639 |
sentence |
denotes |
Figure 2 The deH Pigmentation Phenotype
(A) 10-wk-old deH/deH and nonmutant animals on a at background. A thin stripe of yellow hair normally separates the dorsal black hairs from the ventral cream hairs. In deH, the yellow stripe is extended dorsally, and the boundary between the yellow and the black hairs is fuzzier.
(B) Skin slices taken from 1.5-mo-old deH/deH and nonmutant littermates (scale bar = 0.5 cm).
(C) Proportion of total skin area as determined by observation of pelts taken from the interlimb region. The proportion occupied by the yellow lateral compartment (± SEM) differs between mutant and nonmutant littermate flanks (p < 0.0005, paired t-test, n = 6 pairs). There is also (data not shown) a small increase in the proportion of total skin area occupied by the ventral cream-colored compartment, 47.9 % in mutant compared to 37.8% in nonmutant (p < 0.005, paired t-test, n = 6 pairs).
(D) On an ae/ae background, the extent of dorsal skin pigmentation is reduced in deH/deH neonates (P3.5).
(E) Hair length in a representative pair of 1.5-mo-old deH/deH and nonmutant littermates, averaged over three skin slices at different rostrocaudal levels, and plotted as a function of the absolute distance from middorsum or the percentage of total slice length. To investigate whether deH affects other dorsoventral skin characteristics besides pigment-type switching, we examined its effects on hair length and pigmentation in an ae/ae background. |
| T4025 |
18453-18455 |
TO |
denotes |
To |
| T4026 |
18456-18467 |
VB |
denotes |
investigate |
| T4027 |
18563-18571 |
VBD |
denotes |
examined |
| T4028 |
18468-18475 |
IN |
denotes |
whether |
| T4029 |
18480-18487 |
VBZ |
denotes |
affects |
| T4030 |
18476-18479 |
NN |
denotes |
deH |
| T4031 |
18488-18493 |
JJ |
denotes |
other |
| T4032 |
18512-18527 |
NNS |
denotes |
characteristics |
| T4033 |
18494-18506 |
JJ |
denotes |
dorsoventral |
| T4034 |
18507-18511 |
NN |
denotes |
skin |
| T4035 |
18528-18535 |
IN |
denotes |
besides |
| T4036 |
18536-18543 |
NN |
denotes |
pigment |
| T4037 |
18544-18548 |
NN |
denotes |
type |
| T4038 |
18543-18544 |
HYPH |
denotes |
- |
| T4039 |
18549-18558 |
VBG |
denotes |
switching |
| T4040 |
18558-18560 |
, |
denotes |
, |
| T4041 |
18560-18562 |
PRP |
denotes |
we |
| T4042 |
18572-18575 |
PRP$ |
denotes |
its |
| T4043 |
18576-18583 |
NNS |
denotes |
effects |
| T4044 |
18584-18586 |
IN |
denotes |
on |
| T4045 |
18587-18591 |
NN |
denotes |
hair |
| T4046 |
18592-18598 |
NN |
denotes |
length |
| T4047 |
18599-18602 |
CC |
denotes |
and |
| T4048 |
18603-18615 |
NN |
denotes |
pigmentation |
| T4049 |
18616-18618 |
IN |
denotes |
in |
| T4050 |
18619-18621 |
DT |
denotes |
an |
| T4051 |
18628-18638 |
NN |
denotes |
background |
| T4052 |
18622-18624 |
NN |
denotes |
ae |
| T4053 |
18625-18627 |
NN |
denotes |
ae |
| T4054 |
18624-18625 |
HYPH |
denotes |
/ |
| T4055 |
18638-18639 |
. |
denotes |
. |
| T4056 |
18639-18880 |
sentence |
denotes |
Overall, deH causes a small but consistent reduction in hair length in both dorsum and ventrum; when mutant and nonmutant animals are normalized for body circumference, reduced hair length is most apparent in the lateral region (Figure 2E). |
| T4057 |
18640-18647 |
RB |
denotes |
Overall |
| T4058 |
18653-18659 |
VBZ |
denotes |
causes |
| T4059 |
18647-18649 |
, |
denotes |
, |
| T4060 |
18649-18652 |
NN |
denotes |
deH |
| T4061 |
18829-18831 |
VBZ |
denotes |
is |
| T4062 |
18660-18661 |
DT |
denotes |
a |
| T4063 |
18683-18692 |
NN |
denotes |
reduction |
| T4064 |
18662-18667 |
JJ |
denotes |
small |
| T4065 |
18668-18671 |
CC |
denotes |
but |
| T4066 |
18672-18682 |
JJ |
denotes |
consistent |
| T4067 |
18693-18695 |
IN |
denotes |
in |
| T4068 |
18696-18700 |
NN |
denotes |
hair |
| T4069 |
18701-18707 |
NN |
denotes |
length |
| T4070 |
18708-18710 |
IN |
denotes |
in |
| T4071 |
18711-18715 |
CC |
denotes |
both |
| T4072 |
18716-18722 |
NN |
denotes |
dorsum |
| T4073 |
18723-18726 |
CC |
denotes |
and |
| T4074 |
18727-18734 |
NN |
denotes |
ventrum |
| T4075 |
18734-18735 |
: |
denotes |
; |
| T4076 |
18736-18740 |
WRB |
denotes |
when |
| T4077 |
18774-18784 |
VBN |
denotes |
normalized |
| T4078 |
18741-18747 |
JJ |
denotes |
mutant |
| T4079 |
18762-18769 |
NNS |
denotes |
animals |
| T4080 |
18748-18751 |
CC |
denotes |
and |
| T4081 |
18752-18761 |
JJ |
denotes |
nonmutant |
| T4082 |
18770-18773 |
VBP |
denotes |
are |
| T4083 |
18785-18788 |
IN |
denotes |
for |
| T4084 |
18789-18793 |
NN |
denotes |
body |
| T4085 |
18794-18807 |
NN |
denotes |
circumference |
| T4086 |
18807-18809 |
, |
denotes |
, |
| T4087 |
18809-18816 |
JJ |
denotes |
reduced |
| T4088 |
18822-18828 |
NN |
denotes |
length |
| T4089 |
18817-18821 |
NN |
denotes |
hair |
| T4090 |
18832-18836 |
RBS |
denotes |
most |
| T4091 |
18837-18845 |
JJ |
denotes |
apparent |
| T4092 |
18846-18848 |
IN |
denotes |
in |
| T4093 |
18849-18852 |
DT |
denotes |
the |
| T4094 |
18861-18867 |
NN |
denotes |
region |
| T4095 |
18853-18860 |
JJ |
denotes |
lateral |
| T4096 |
18868-18869 |
-LRB- |
denotes |
( |
| T4097 |
18869-18875 |
NN |
denotes |
Figure |
| T4098 |
18876-18878 |
CD |
denotes |
2E |
| T4099 |
18878-18879 |
-RRB- |
denotes |
) |
| T4100 |
18879-18880 |
. |
denotes |
. |
| T4101 |
18880-19019 |
sentence |
denotes |
Adult ae/ae; deH/deH animals exhibit body-size reduction and skeletal abnormalities, but display no coat-color phenotype (data not shown). |
| T4102 |
18881-18886 |
JJ |
denotes |
Adult |
| T4103 |
18902-18909 |
NNS |
denotes |
animals |
| T4104 |
18887-18889 |
NN |
denotes |
ae |
| T4105 |
18890-18892 |
NN |
denotes |
ae |
| T4106 |
18889-18890 |
HYPH |
denotes |
/ |
| T4107 |
18892-18893 |
, |
denotes |
; |
| T4108 |
18894-18897 |
NN |
denotes |
deH |
| T4109 |
18898-18901 |
NN |
denotes |
deH |
| T4110 |
18897-18898 |
HYPH |
denotes |
/ |
| T4111 |
18910-18917 |
VBP |
denotes |
exhibit |
| T4112 |
18918-18922 |
NN |
denotes |
body |
| T4113 |
18923-18927 |
NN |
denotes |
size |
| T4114 |
18922-18923 |
HYPH |
denotes |
- |
| T4115 |
18928-18937 |
NN |
denotes |
reduction |
| T4116 |
18938-18941 |
CC |
denotes |
and |
| T4117 |
18942-18950 |
JJ |
denotes |
skeletal |
| T4118 |
18951-18964 |
NNS |
denotes |
abnormalities |
| T4119 |
18964-18966 |
, |
denotes |
, |
| T4120 |
18966-18969 |
CC |
denotes |
but |
| T4121 |
18970-18977 |
VBP |
denotes |
display |
| T4122 |
18978-18980 |
DT |
denotes |
no |
| T4123 |
18992-19001 |
NN |
denotes |
phenotype |
| T4124 |
18981-18985 |
NN |
denotes |
coat |
| T4125 |
18986-18991 |
NN |
denotes |
color |
| T4126 |
18985-18986 |
HYPH |
denotes |
- |
| T4127 |
19002-19003 |
-LRB- |
denotes |
( |
| T4128 |
19012-19017 |
VBN |
denotes |
shown |
| T4129 |
19003-19007 |
NNS |
denotes |
data |
| T4130 |
19008-19011 |
RB |
denotes |
not |
| T4131 |
19017-19018 |
-RRB- |
denotes |
) |
| T4132 |
19018-19019 |
. |
denotes |
. |
| T4133 |
19019-19218 |
sentence |
denotes |
However, ae/ae and ae/ae; deH/deH neonates are clearly distinguishable in the first few days after birth, when a dorsoventral gradient of melanogenic activity is apparent under the skin (Figure 2D). |
| T4134 |
19020-19027 |
RB |
denotes |
However |
| T4135 |
19063-19066 |
VBP |
denotes |
are |
| T4136 |
19027-19029 |
, |
denotes |
, |
| T4137 |
19029-19031 |
NN |
denotes |
ae |
| T4138 |
19032-19034 |
NN |
denotes |
ae |
| T4139 |
19031-19032 |
SYM |
denotes |
/ |
| T4140 |
19054-19062 |
NNS |
denotes |
neonates |
| T4141 |
19035-19038 |
CC |
denotes |
and |
| T4142 |
19039-19041 |
NN |
denotes |
ae |
| T4143 |
19042-19044 |
NN |
denotes |
ae |
| T4144 |
19041-19042 |
SYM |
denotes |
/ |
| T4145 |
19044-19045 |
, |
denotes |
; |
| T4146 |
19046-19049 |
NN |
denotes |
deH |
| T4147 |
19050-19053 |
NN |
denotes |
deH |
| T4148 |
19049-19050 |
HYPH |
denotes |
/ |
| T4149 |
19067-19074 |
RB |
denotes |
clearly |
| T4150 |
19075-19090 |
JJ |
denotes |
distinguishable |
| T4151 |
19091-19093 |
IN |
denotes |
in |
| T4152 |
19094-19097 |
DT |
denotes |
the |
| T4153 |
19108-19112 |
NNS |
denotes |
days |
| T4154 |
19098-19103 |
JJ |
denotes |
first |
| T4155 |
19104-19107 |
JJ |
denotes |
few |
| T4156 |
19113-19118 |
IN |
denotes |
after |
| T4157 |
19119-19124 |
NN |
denotes |
birth |
| T4158 |
19124-19126 |
, |
denotes |
, |
| T4159 |
19126-19130 |
WRB |
denotes |
when |
| T4160 |
19179-19181 |
VBZ |
denotes |
is |
| T4161 |
19131-19132 |
DT |
denotes |
a |
| T4162 |
19146-19154 |
NN |
denotes |
gradient |
| T4163 |
19133-19145 |
JJ |
denotes |
dorsoventral |
| T4164 |
19155-19157 |
IN |
denotes |
of |
| T4165 |
19158-19169 |
JJ |
denotes |
melanogenic |
| T4166 |
19170-19178 |
NN |
denotes |
activity |
| T4167 |
19182-19190 |
JJ |
denotes |
apparent |
| T4168 |
19191-19196 |
IN |
denotes |
under |
| T4169 |
19197-19200 |
DT |
denotes |
the |
| T4170 |
19201-19205 |
NN |
denotes |
skin |
| T4171 |
19206-19207 |
-LRB- |
denotes |
( |
| T4172 |
19207-19213 |
NN |
denotes |
Figure |
| T4173 |
19214-19216 |
CD |
denotes |
2D |
| T4174 |
19216-19217 |
-RRB- |
denotes |
) |
| T4175 |
19217-19218 |
. |
denotes |
. |
| T4176 |
19218-19387 |
sentence |
denotes |
At this stage, melanoblast migration from the neural crest is mostly complete, but there is a dorsoventral gradient in melanocyte differentiation and pigment synthesis. |
| T4177 |
19219-19221 |
IN |
denotes |
At |
| T4178 |
19278-19280 |
VBZ |
denotes |
is |
| T4179 |
19222-19226 |
DT |
denotes |
this |
| T4180 |
19227-19232 |
NN |
denotes |
stage |
| T4181 |
19232-19234 |
, |
denotes |
, |
| T4182 |
19234-19245 |
NN |
denotes |
melanoblast |
| T4183 |
19246-19255 |
NN |
denotes |
migration |
| T4184 |
19256-19260 |
IN |
denotes |
from |
| T4185 |
19261-19264 |
DT |
denotes |
the |
| T4186 |
19272-19277 |
NN |
denotes |
crest |
| T4187 |
19265-19271 |
JJ |
denotes |
neural |
| T4188 |
19281-19287 |
RB |
denotes |
mostly |
| T4189 |
19288-19296 |
JJ |
denotes |
complete |
| T4190 |
19296-19298 |
, |
denotes |
, |
| T4191 |
19298-19301 |
CC |
denotes |
but |
| T4192 |
19302-19307 |
EX |
denotes |
there |
| T4193 |
19308-19310 |
VBZ |
denotes |
is |
| T4194 |
19311-19312 |
DT |
denotes |
a |
| T4195 |
19326-19334 |
NN |
denotes |
gradient |
| T4196 |
19313-19325 |
JJ |
denotes |
dorsoventral |
| T4197 |
19335-19337 |
IN |
denotes |
in |
| T4198 |
19338-19348 |
NN |
denotes |
melanocyte |
| T4199 |
19349-19364 |
NN |
denotes |
differentiation |
| T4200 |
19365-19368 |
CC |
denotes |
and |
| T4201 |
19369-19376 |
NN |
denotes |
pigment |
| T4202 |
19377-19386 |
NN |
denotes |
synthesis |
| T4203 |
19386-19387 |
. |
denotes |
. |
| T4204 |
19387-19644 |
sentence |
denotes |
The skin of ae/ae neonates appears uniformly dark over the entire dorsum, but in ae/ae; deH/deH neonates, the area of dark skin is more restricted, particularly above the limbs, and resembles the pattern of dorsal eumelanin in at/at; deH/deH adult animals. |
| T4205 |
19388-19391 |
DT |
denotes |
The |
| T4206 |
19392-19396 |
NN |
denotes |
skin |
| T4207 |
19415-19422 |
VBZ |
denotes |
appears |
| T4208 |
19397-19399 |
IN |
denotes |
of |
| T4209 |
19400-19402 |
NN |
denotes |
ae |
| T4210 |
19403-19405 |
NN |
denotes |
ae |
| T4211 |
19402-19403 |
HYPH |
denotes |
/ |
| T4212 |
19406-19414 |
NNS |
denotes |
neonates |
| T4213 |
19423-19432 |
RB |
denotes |
uniformly |
| T4214 |
19433-19437 |
JJ |
denotes |
dark |
| T4215 |
19438-19442 |
IN |
denotes |
over |
| T4216 |
19443-19446 |
DT |
denotes |
the |
| T4217 |
19454-19460 |
NN |
denotes |
dorsum |
| T4218 |
19447-19453 |
JJ |
denotes |
entire |
| T4219 |
19460-19462 |
, |
denotes |
, |
| T4220 |
19462-19465 |
CC |
denotes |
but |
| T4221 |
19466-19468 |
IN |
denotes |
in |
| T4222 |
19516-19518 |
VBZ |
denotes |
is |
| T4223 |
19469-19471 |
NN |
denotes |
ae |
| T4224 |
19472-19474 |
NN |
denotes |
ae |
| T4225 |
19471-19472 |
HYPH |
denotes |
/ |
| T4226 |
19484-19492 |
NNS |
denotes |
neonates |
| T4227 |
19474-19475 |
: |
denotes |
; |
| T4228 |
19476-19479 |
NN |
denotes |
deH |
| T4229 |
19480-19483 |
NN |
denotes |
deH |
| T4230 |
19479-19480 |
HYPH |
denotes |
/ |
| T4231 |
19492-19494 |
, |
denotes |
, |
| T4232 |
19494-19497 |
DT |
denotes |
the |
| T4233 |
19498-19502 |
NN |
denotes |
area |
| T4234 |
19503-19505 |
IN |
denotes |
of |
| T4235 |
19506-19510 |
JJ |
denotes |
dark |
| T4236 |
19511-19515 |
NN |
denotes |
skin |
| T4237 |
19519-19523 |
RBR |
denotes |
more |
| T4238 |
19524-19534 |
JJ |
denotes |
restricted |
| T4239 |
19534-19536 |
, |
denotes |
, |
| T4240 |
19536-19548 |
RB |
denotes |
particularly |
| T4241 |
19549-19554 |
IN |
denotes |
above |
| T4242 |
19555-19558 |
DT |
denotes |
the |
| T4243 |
19559-19564 |
NNS |
denotes |
limbs |
| T4244 |
19564-19566 |
, |
denotes |
, |
| T4245 |
19566-19569 |
CC |
denotes |
and |
| T4246 |
19570-19579 |
VBZ |
denotes |
resembles |
| T4247 |
19580-19583 |
DT |
denotes |
the |
| T4248 |
19584-19591 |
NN |
denotes |
pattern |
| T4249 |
19592-19594 |
IN |
denotes |
of |
| T4250 |
19595-19601 |
JJ |
denotes |
dorsal |
| T4251 |
19602-19611 |
NN |
denotes |
eumelanin |
| T4252 |
19612-19614 |
IN |
denotes |
in |
| T4253 |
19615-19617 |
NN |
denotes |
at |
| T4254 |
19618-19620 |
NN |
denotes |
at |
| T4255 |
19617-19618 |
HYPH |
denotes |
/ |
| T4256 |
19636-19643 |
NNS |
denotes |
animals |
| T4257 |
19620-19621 |
, |
denotes |
; |
| T4258 |
19622-19625 |
NN |
denotes |
deH |
| T4259 |
19626-19629 |
NN |
denotes |
deH |
| T4260 |
19625-19626 |
HYPH |
denotes |
/ |
| T4261 |
19630-19635 |
JJ |
denotes |
adult |
| T4262 |
19643-19644 |
. |
denotes |
. |
| T4263 |
19644-19863 |
sentence |
denotes |
Taken together, these observations suggest that deH interferes with the establishment of dorsoventral patterning during skin development by causing dorsal expansion of a lateral region that is normally 3–5 mm in width. |
| T4264 |
19645-19650 |
VBN |
denotes |
Taken |
| T4265 |
19680-19687 |
VBP |
denotes |
suggest |
| T4266 |
19651-19659 |
RB |
denotes |
together |
| T4267 |
19659-19661 |
, |
denotes |
, |
| T4268 |
19661-19666 |
DT |
denotes |
these |
| T4269 |
19667-19679 |
NNS |
denotes |
observations |
| T4270 |
19688-19692 |
IN |
denotes |
that |
| T4271 |
19697-19707 |
VBZ |
denotes |
interferes |
| T4272 |
19693-19696 |
NN |
denotes |
deH |
| T4273 |
19708-19712 |
IN |
denotes |
with |
| T4274 |
19713-19716 |
DT |
denotes |
the |
| T4275 |
19717-19730 |
NN |
denotes |
establishment |
| T4276 |
19731-19733 |
IN |
denotes |
of |
| T4277 |
19734-19746 |
JJ |
denotes |
dorsoventral |
| T4278 |
19747-19757 |
NN |
denotes |
patterning |
| T4279 |
19758-19764 |
IN |
denotes |
during |
| T4280 |
19765-19769 |
NN |
denotes |
skin |
| T4281 |
19770-19781 |
NN |
denotes |
development |
| T4282 |
19782-19784 |
IN |
denotes |
by |
| T4283 |
19785-19792 |
VBG |
denotes |
causing |
| T4284 |
19793-19799 |
JJ |
denotes |
dorsal |
| T4285 |
19800-19809 |
NN |
denotes |
expansion |
| T4286 |
19810-19812 |
IN |
denotes |
of |
| T4287 |
19813-19814 |
DT |
denotes |
a |
| T4288 |
19823-19829 |
NN |
denotes |
region |
| T4289 |
19815-19822 |
JJ |
denotes |
lateral |
| T4290 |
19830-19834 |
WDT |
denotes |
that |
| T4291 |
19835-19837 |
VBZ |
denotes |
is |
| T4292 |
19838-19846 |
RB |
denotes |
normally |
| T4293 |
19847-19848 |
CD |
denotes |
3 |
| T4294 |
19849-19850 |
CD |
denotes |
5 |
| T4295 |
19848-19849 |
SYM |
denotes |
– |
| T4296 |
19851-19853 |
NN |
denotes |
mm |
| T4297 |
19854-19856 |
IN |
denotes |
in |
| T4298 |
19857-19862 |
NN |
denotes |
width |
| T4299 |
19862-19863 |
. |
denotes |
. |
| T4300 |
19863-20094 |
sentence |
denotes |
This same region may serve as a boundary between dorsal and ventral skin by inhibiting melanocyte differentiation, by promoting pheomelanin synthesis, and by supporting a progressive increase in hair growth from ventrum to dorsum. |
| T4301 |
19864-19868 |
DT |
denotes |
This |
| T4302 |
19874-19880 |
NN |
denotes |
region |
| T4303 |
19869-19873 |
JJ |
denotes |
same |
| T4304 |
19885-19890 |
VB |
denotes |
serve |
| T4305 |
19881-19884 |
MD |
denotes |
may |
| T4306 |
19891-19893 |
IN |
denotes |
as |
| T4307 |
19894-19895 |
DT |
denotes |
a |
| T4308 |
19896-19904 |
NN |
denotes |
boundary |
| T4309 |
19905-19912 |
IN |
denotes |
between |
| T4310 |
19913-19919 |
JJ |
denotes |
dorsal |
| T4311 |
19932-19936 |
NN |
denotes |
skin |
| T4312 |
19920-19923 |
CC |
denotes |
and |
| T4313 |
19924-19931 |
JJ |
denotes |
ventral |
| T4314 |
19937-19939 |
IN |
denotes |
by |
| T4315 |
19940-19950 |
VBG |
denotes |
inhibiting |
| T4316 |
19951-19961 |
NN |
denotes |
melanocyte |
| T4317 |
19962-19977 |
NN |
denotes |
differentiation |
| T4318 |
19977-19979 |
, |
denotes |
, |
| T4319 |
19979-19981 |
IN |
denotes |
by |
| T4320 |
19982-19991 |
VBG |
denotes |
promoting |
| T4321 |
19992-20003 |
NN |
denotes |
pheomelanin |
| T4322 |
20004-20013 |
NN |
denotes |
synthesis |
| T4323 |
20013-20015 |
, |
denotes |
, |
| T4324 |
20015-20018 |
CC |
denotes |
and |
| T4325 |
20019-20021 |
IN |
denotes |
by |
| T4326 |
20022-20032 |
VBG |
denotes |
supporting |
| T4327 |
20033-20034 |
DT |
denotes |
a |
| T4328 |
20047-20055 |
NN |
denotes |
increase |
| T4329 |
20035-20046 |
JJ |
denotes |
progressive |
| T4330 |
20056-20058 |
IN |
denotes |
in |
| T4331 |
20059-20063 |
NN |
denotes |
hair |
| T4332 |
20064-20070 |
NN |
denotes |
growth |
| T4333 |
20071-20075 |
IN |
denotes |
from |
| T4334 |
20076-20083 |
NN |
denotes |
ventrum |
| T4335 |
20084-20086 |
IN |
denotes |
to |
| T4336 |
20087-20093 |
NN |
denotes |
dorsum |
| T4337 |
20093-20094 |
. |
denotes |
. |
| T4338 |
20094-20296 |
sentence |
denotes |
As described below, the gene defective in deH, Tbx15, is normally expressed in the dorsal region and therefore is likely to play a role in establishing the size and dorsal extent of the lateral region. |
| T4339 |
20095-20097 |
IN |
denotes |
As |
| T4340 |
20098-20107 |
VBN |
denotes |
described |
| T4341 |
20161-20170 |
VBN |
denotes |
expressed |
| T4342 |
20108-20113 |
RB |
denotes |
below |
| T4343 |
20113-20115 |
, |
denotes |
, |
| T4344 |
20115-20118 |
DT |
denotes |
the |
| T4345 |
20119-20123 |
NN |
denotes |
gene |
| T4346 |
20124-20133 |
JJ |
denotes |
defective |
| T4347 |
20134-20136 |
IN |
denotes |
in |
| T4348 |
20137-20140 |
NN |
denotes |
deH |
| T4349 |
20140-20142 |
, |
denotes |
, |
| T4350 |
20142-20147 |
NN |
denotes |
Tbx15 |
| T4351 |
20147-20149 |
, |
denotes |
, |
| T4352 |
20149-20151 |
VBZ |
denotes |
is |
| T4353 |
20152-20160 |
RB |
denotes |
normally |
| T4354 |
20171-20173 |
IN |
denotes |
in |
| T4355 |
20174-20177 |
DT |
denotes |
the |
| T4356 |
20185-20191 |
NN |
denotes |
region |
| T4357 |
20178-20184 |
JJ |
denotes |
dorsal |
| T4358 |
20192-20195 |
CC |
denotes |
and |
| T4359 |
20196-20205 |
RB |
denotes |
therefore |
| T4360 |
20206-20208 |
VBZ |
denotes |
is |
| T4361 |
20209-20215 |
JJ |
denotes |
likely |
| T4362 |
20216-20218 |
TO |
denotes |
to |
| T4363 |
20219-20223 |
VB |
denotes |
play |
| T4364 |
20224-20225 |
DT |
denotes |
a |
| T4365 |
20226-20230 |
NN |
denotes |
role |
| T4366 |
20231-20233 |
IN |
denotes |
in |
| T4367 |
20234-20246 |
VBG |
denotes |
establishing |
| T4368 |
20247-20250 |
DT |
denotes |
the |
| T4369 |
20251-20255 |
NN |
denotes |
size |
| T4370 |
20256-20259 |
CC |
denotes |
and |
| T4371 |
20260-20266 |
JJ |
denotes |
dorsal |
| T4372 |
20267-20273 |
NN |
denotes |
extent |
| T4373 |
20274-20276 |
IN |
denotes |
of |
| T4374 |
20277-20280 |
DT |
denotes |
the |
| T4375 |
20289-20295 |
NN |
denotes |
region |
| T4376 |
20281-20288 |
JJ |
denotes |
lateral |
| T4377 |
20295-20296 |
. |
denotes |
. |
| T4613 |
20298-20308 |
JJ |
denotes |
Positional |
| T4614 |
20309-20316 |
NN |
denotes |
Cloning |
| T4615 |
20317-20319 |
IN |
denotes |
of |
| T4616 |
20320-20323 |
NN |
denotes |
deH |
| T4617 |
20323-20609 |
sentence |
denotes |
As a visible marker, early linkage studies with the original droopy ear allele or the deH allele identified a map position in the middle of Chromosome 3, distal to matted and proximal to Varitint-waddler (Carter and Falconer 1951; Curry 1959; Lane and Eicher 1979; Holmes et al. 1981). |
| T4618 |
20324-20326 |
IN |
denotes |
As |
| T4619 |
20421-20431 |
VBD |
denotes |
identified |
| T4620 |
20327-20328 |
DT |
denotes |
a |
| T4621 |
20337-20343 |
NN |
denotes |
marker |
| T4622 |
20329-20336 |
JJ |
denotes |
visible |
| T4623 |
20343-20345 |
, |
denotes |
, |
| T4624 |
20345-20350 |
JJ |
denotes |
early |
| T4625 |
20359-20366 |
NNS |
denotes |
studies |
| T4626 |
20351-20358 |
NN |
denotes |
linkage |
| T4627 |
20367-20371 |
IN |
denotes |
with |
| T4628 |
20372-20375 |
DT |
denotes |
the |
| T4629 |
20396-20402 |
NN |
denotes |
allele |
| T4630 |
20376-20384 |
JJ |
denotes |
original |
| T4631 |
20385-20391 |
JJ |
denotes |
droopy |
| T4632 |
20392-20395 |
NN |
denotes |
ear |
| T4633 |
20403-20405 |
CC |
denotes |
or |
| T4634 |
20406-20409 |
DT |
denotes |
the |
| T4635 |
20414-20420 |
NN |
denotes |
allele |
| T4636 |
20410-20413 |
NN |
denotes |
deH |
| T4637 |
20432-20433 |
DT |
denotes |
a |
| T4638 |
20438-20446 |
NN |
denotes |
position |
| T4639 |
20434-20437 |
NN |
denotes |
map |
| T4640 |
20447-20449 |
IN |
denotes |
in |
| T4641 |
20450-20453 |
DT |
denotes |
the |
| T4642 |
20454-20460 |
NN |
denotes |
middle |
| T4643 |
20461-20463 |
IN |
denotes |
of |
| T4644 |
20464-20474 |
NN |
denotes |
Chromosome |
| T4645 |
20475-20476 |
CD |
denotes |
3 |
| T4646 |
20476-20478 |
, |
denotes |
, |
| T4647 |
20478-20484 |
JJ |
denotes |
distal |
| T4648 |
20485-20487 |
IN |
denotes |
to |
| T4649 |
20488-20494 |
JJ |
denotes |
matted |
| T4650 |
20495-20498 |
CC |
denotes |
and |
| T4651 |
20499-20507 |
JJ |
denotes |
proximal |
| T4652 |
20508-20510 |
IN |
denotes |
to |
| T4653 |
20511-20519 |
NNP |
denotes |
Varitint |
| T4654 |
20520-20527 |
NNP |
denotes |
waddler |
| T4655 |
20519-20520 |
HYPH |
denotes |
- |
| T4656 |
20528-20529 |
-LRB- |
denotes |
( |
| T4657 |
20529-20535 |
NNP |
denotes |
Carter |
| T4658 |
20536-20539 |
CC |
denotes |
and |
| T4659 |
20540-20548 |
NNP |
denotes |
Falconer |
| T4660 |
20549-20553 |
CD |
denotes |
1951 |
| T4661 |
20553-20554 |
: |
denotes |
; |
| T4662 |
20555-20560 |
NNP |
denotes |
Curry |
| T4663 |
20561-20565 |
CD |
denotes |
1959 |
| T4664 |
20565-20566 |
: |
denotes |
; |
| T4665 |
20567-20571 |
NNP |
denotes |
Lane |
| T4666 |
20572-20575 |
CC |
denotes |
and |
| T4667 |
20576-20582 |
NNP |
denotes |
Eicher |
| T4668 |
20583-20587 |
CD |
denotes |
1979 |
| T4669 |
20587-20588 |
: |
denotes |
; |
| T4670 |
20589-20595 |
NNP |
denotes |
Holmes |
| T4671 |
20596-20598 |
FW |
denotes |
et |
| T4672 |
20599-20602 |
FW |
denotes |
al. |
| T4673 |
20603-20607 |
CD |
denotes |
1981 |
| T4674 |
20607-20608 |
-RRB- |
denotes |
) |
| T4675 |
20608-20609 |
. |
denotes |
. |
| T4676 |
20609-20908 |
sentence |
denotes |
We used an F2 intercross with CAST/Ei mice to localize deH to a 0.1 cM interval between D3Mit213 and 16.MMHAP32FLF1, which was refined by development of a bacterial artificial chromosome (BAC) contig and additional markers to a 1.4 Mb region that contained eight genes, including Tbx15 (Figure 3A). |
| T4677 |
20610-20612 |
PRP |
denotes |
We |
| T4678 |
20613-20617 |
VBD |
denotes |
used |
| T4679 |
20618-20620 |
DT |
denotes |
an |
| T4680 |
20624-20634 |
NN |
denotes |
intercross |
| T4681 |
20621-20623 |
NN |
denotes |
F2 |
| T4682 |
20635-20639 |
IN |
denotes |
with |
| T4683 |
20640-20644 |
NN |
denotes |
CAST |
| T4684 |
20645-20647 |
NN |
denotes |
Ei |
| T4685 |
20644-20645 |
HYPH |
denotes |
/ |
| T4686 |
20648-20652 |
NNS |
denotes |
mice |
| T4687 |
20653-20655 |
TO |
denotes |
to |
| T4688 |
20656-20664 |
VB |
denotes |
localize |
| T4689 |
20665-20668 |
NN |
denotes |
deH |
| T4690 |
20669-20671 |
IN |
denotes |
to |
| T4691 |
20672-20673 |
DT |
denotes |
a |
| T4692 |
20681-20689 |
NN |
denotes |
interval |
| T4693 |
20674-20677 |
CD |
denotes |
0.1 |
| T4694 |
20678-20680 |
NN |
denotes |
cM |
| T4695 |
20690-20697 |
IN |
denotes |
between |
| T4696 |
20698-20706 |
NN |
denotes |
D3Mit213 |
| T4697 |
20707-20710 |
CC |
denotes |
and |
| T4698 |
20711-20725 |
NN |
denotes |
16.MMHAP32FLF1 |
| T4699 |
20725-20727 |
, |
denotes |
, |
| T4700 |
20727-20732 |
WDT |
denotes |
which |
| T4701 |
20737-20744 |
VBN |
denotes |
refined |
| T4702 |
20733-20736 |
VBD |
denotes |
was |
| T4703 |
20745-20747 |
IN |
denotes |
by |
| T4704 |
20748-20759 |
NN |
denotes |
development |
| T4705 |
20760-20762 |
IN |
denotes |
of |
| T4706 |
20763-20764 |
DT |
denotes |
a |
| T4707 |
20803-20809 |
NN |
denotes |
contig |
| T4708 |
20765-20774 |
JJ |
denotes |
bacterial |
| T4709 |
20786-20796 |
NN |
denotes |
chromosome |
| T4710 |
20775-20785 |
JJ |
denotes |
artificial |
| T4711 |
20797-20798 |
-LRB- |
denotes |
( |
| T4712 |
20798-20801 |
NN |
denotes |
BAC |
| T4713 |
20801-20802 |
-RRB- |
denotes |
) |
| T4714 |
20810-20813 |
CC |
denotes |
and |
| T4715 |
20814-20824 |
JJ |
denotes |
additional |
| T4716 |
20825-20832 |
NNS |
denotes |
markers |
| T4717 |
20833-20835 |
IN |
denotes |
to |
| T4718 |
20836-20837 |
DT |
denotes |
a |
| T4719 |
20845-20851 |
NN |
denotes |
region |
| T4720 |
20838-20841 |
CD |
denotes |
1.4 |
| T4721 |
20842-20844 |
NN |
denotes |
Mb |
| T4722 |
20852-20856 |
WDT |
denotes |
that |
| T4723 |
20857-20866 |
VBD |
denotes |
contained |
| T4724 |
20867-20872 |
CD |
denotes |
eight |
| T4725 |
20873-20878 |
NNS |
denotes |
genes |
| T4726 |
20878-20880 |
, |
denotes |
, |
| T4727 |
20880-20889 |
VBG |
denotes |
including |
| T4728 |
20890-20895 |
NN |
denotes |
Tbx15 |
| T4729 |
20896-20897 |
-LRB- |
denotes |
( |
| T4730 |
20897-20903 |
NN |
denotes |
Figure |
| T4731 |
20904-20906 |
CD |
denotes |
3A |
| T4732 |
20906-20907 |
-RRB- |
denotes |
) |
| T4733 |
20907-20908 |
. |
denotes |
. |
| T4734 |
20908-21131 |
sentence |
denotes |
We considered Tbx15 as an excellent candidate for the skeletal abnormalities caused by deH, based on studies by Agulnik et al. (1998), who described its embryonic expression in the craniofacial region and developing limbs. |
| T4735 |
20909-20911 |
PRP |
denotes |
We |
| T4736 |
20912-20922 |
VBD |
denotes |
considered |
| T4737 |
20923-20928 |
NN |
denotes |
Tbx15 |
| T4738 |
20929-20931 |
IN |
denotes |
as |
| T4739 |
20932-20934 |
DT |
denotes |
an |
| T4740 |
20945-20954 |
NN |
denotes |
candidate |
| T4741 |
20935-20944 |
JJ |
denotes |
excellent |
| T4742 |
20955-20958 |
IN |
denotes |
for |
| T4743 |
20959-20962 |
DT |
denotes |
the |
| T4744 |
20972-20985 |
NNS |
denotes |
abnormalities |
| T4745 |
20963-20971 |
JJ |
denotes |
skeletal |
| T4746 |
20986-20992 |
VBN |
denotes |
caused |
| T4747 |
20993-20995 |
IN |
denotes |
by |
| T4748 |
20996-20999 |
NN |
denotes |
deH |
| T4749 |
20999-21001 |
, |
denotes |
, |
| T4750 |
21001-21006 |
VBN |
denotes |
based |
| T4751 |
21007-21009 |
IN |
denotes |
on |
| T4752 |
21010-21017 |
NNS |
denotes |
studies |
| T4753 |
21018-21020 |
IN |
denotes |
by |
| T4754 |
21021-21028 |
NNP |
denotes |
Agulnik |
| T4755 |
21029-21031 |
FW |
denotes |
et |
| T4756 |
21032-21035 |
FW |
denotes |
al. |
| T4757 |
21036-21037 |
-LRB- |
denotes |
( |
| T4758 |
21037-21041 |
CD |
denotes |
1998 |
| T4759 |
21041-21042 |
-RRB- |
denotes |
) |
| T4760 |
21042-21044 |
, |
denotes |
, |
| T4761 |
21044-21047 |
WP |
denotes |
who |
| T4762 |
21048-21057 |
VBD |
denotes |
described |
| T4763 |
21058-21061 |
PRP$ |
denotes |
its |
| T4764 |
21072-21082 |
NN |
denotes |
expression |
| T4765 |
21062-21071 |
JJ |
denotes |
embryonic |
| T4766 |
21083-21085 |
IN |
denotes |
in |
| T4767 |
21086-21089 |
DT |
denotes |
the |
| T4768 |
21103-21109 |
NN |
denotes |
region |
| T4769 |
21090-21102 |
JJ |
denotes |
craniofacial |
| T4770 |
21110-21113 |
CC |
denotes |
and |
| T4771 |
21114-21124 |
VBG |
denotes |
developing |
| T4772 |
21125-21130 |
NNS |
denotes |
limbs |
| T4773 |
21130-21131 |
. |
denotes |
. |
| T4774 |
21131-22266 |
sentence |
denotes |
Figure 3 Molecular Genetics of deH and Tbx15
(A) Genetic and physical map, as described in the text. Markers M1 to M3 are SSCP markers generated from a BAC contig of the region; marker M4 is STS 16.MMHAP32FLF1 and was also used as an SSCP marker. M2 and M3, which flank the Tbx15 and M6pr-ps on the UCSC genome browser map and lie 634 kb apart, were nonrecombinant with deH in 2340 meioses.
(B) The deH mutation is a deletion that starts in Tbx15 intron 1 and ends in the M6pr-ps.
(C) Sequence of deletion breakpoints.
(D) Diagram of Tbx15LacZ allele constructed by gene targeting. As described in the text, this allele is predicted to give rise to a protein truncated after approximately 154 codons and is lacking critical residues of the T box. Heterozygotes for the targeted allele exhibit normal size, morphology, and hair-color patterns, but homozygotes and Tbx15LacZ/deH compound heterozygotes are identical to deH homozygotes. Using sequence information from Agulnik et al. (1998) and the partially completed mouse genome sequence, we found that portions of several Tbx15 exons could not be amplified from deH/deH genomic DNA. |
| T4775 |
22067-22072 |
VBG |
denotes |
Using |
| T4776 |
22175-22180 |
VBD |
denotes |
found |
| T4777 |
22073-22081 |
NN |
denotes |
sequence |
| T4778 |
22082-22093 |
NN |
denotes |
information |
| T4779 |
22094-22098 |
IN |
denotes |
from |
| T4780 |
22099-22106 |
NNP |
denotes |
Agulnik |
| T4781 |
22107-22109 |
FW |
denotes |
et |
| T4782 |
22110-22113 |
FW |
denotes |
al. |
| T4783 |
22114-22115 |
-LRB- |
denotes |
( |
| T4784 |
22115-22119 |
CD |
denotes |
1998 |
| T4785 |
22119-22120 |
-RRB- |
denotes |
) |
| T4786 |
22121-22124 |
CC |
denotes |
and |
| T4787 |
22125-22128 |
DT |
denotes |
the |
| T4788 |
22162-22170 |
NN |
denotes |
sequence |
| T4789 |
22129-22138 |
RB |
denotes |
partially |
| T4790 |
22139-22148 |
VBN |
denotes |
completed |
| T4791 |
22149-22154 |
NN |
denotes |
mouse |
| T4792 |
22155-22161 |
NN |
denotes |
genome |
| T4793 |
22170-22172 |
, |
denotes |
, |
| T4794 |
22172-22174 |
PRP |
denotes |
we |
| T4795 |
22181-22185 |
IN |
denotes |
that |
| T4796 |
22231-22240 |
VBN |
denotes |
amplified |
| T4797 |
22186-22194 |
NNS |
denotes |
portions |
| T4798 |
22195-22197 |
IN |
denotes |
of |
| T4799 |
22198-22205 |
JJ |
denotes |
several |
| T4800 |
22212-22217 |
NNS |
denotes |
exons |
| T4801 |
22206-22211 |
NN |
denotes |
Tbx15 |
| T4802 |
22218-22223 |
MD |
denotes |
could |
| T4803 |
22224-22227 |
RB |
denotes |
not |
| T4804 |
22228-22230 |
VB |
denotes |
be |
| T4805 |
22241-22245 |
IN |
denotes |
from |
| T4806 |
22246-22249 |
NN |
denotes |
deH |
| T4807 |
22250-22253 |
NN |
denotes |
deH |
| T4808 |
22249-22250 |
HYPH |
denotes |
/ |
| T4809 |
22262-22265 |
NN |
denotes |
DNA |
| T4810 |
22254-22261 |
JJ |
denotes |
genomic |
| T4811 |
22265-22266 |
. |
denotes |
. |
| T4812 |
22266-22479 |
sentence |
denotes |
The same gene was initially referred to as Tbx8 (Wattler et al. 1998) and then later renamed Tbx14, but is currently referred to in several vertebrate genomes as Tbx15 (Agulnik et al. 1998; Begemann et al. 2002). |
| T4813 |
22267-22270 |
DT |
denotes |
The |
| T4814 |
22276-22280 |
NN |
denotes |
gene |
| T4815 |
22271-22275 |
JJ |
denotes |
same |
| T4816 |
22295-22303 |
VBN |
denotes |
referred |
| T4817 |
22281-22284 |
VBD |
denotes |
was |
| T4818 |
22285-22294 |
RB |
denotes |
initially |
| T4819 |
22304-22306 |
IN |
denotes |
to |
| T4820 |
22307-22309 |
IN |
denotes |
as |
| T4821 |
22310-22314 |
NN |
denotes |
Tbx8 |
| T4822 |
22315-22316 |
-LRB- |
denotes |
( |
| T4823 |
22316-22323 |
NNP |
denotes |
Wattler |
| T4824 |
22324-22326 |
FW |
denotes |
et |
| T4825 |
22327-22330 |
FW |
denotes |
al. |
| T4826 |
22331-22335 |
CD |
denotes |
1998 |
| T4827 |
22335-22336 |
-RRB- |
denotes |
) |
| T4828 |
22337-22340 |
CC |
denotes |
and |
| T4829 |
22341-22345 |
RB |
denotes |
then |
| T4830 |
22352-22359 |
VBN |
denotes |
renamed |
| T4831 |
22346-22351 |
RB |
denotes |
later |
| T4832 |
22360-22365 |
NN |
denotes |
Tbx14 |
| T4833 |
22365-22367 |
, |
denotes |
, |
| T4834 |
22367-22370 |
CC |
denotes |
but |
| T4835 |
22371-22373 |
VBZ |
denotes |
is |
| T4836 |
22384-22392 |
VBN |
denotes |
referred |
| T4837 |
22374-22383 |
RB |
denotes |
currently |
| T4838 |
22393-22395 |
IN |
denotes |
to |
| T4839 |
22396-22398 |
IN |
denotes |
in |
| T4840 |
22399-22406 |
JJ |
denotes |
several |
| T4841 |
22418-22425 |
NNS |
denotes |
genomes |
| T4842 |
22407-22417 |
NN |
denotes |
vertebrate |
| T4843 |
22426-22428 |
IN |
denotes |
as |
| T4844 |
22429-22434 |
NN |
denotes |
Tbx15 |
| T4845 |
22435-22436 |
-LRB- |
denotes |
( |
| T4846 |
22436-22443 |
NNP |
denotes |
Agulnik |
| T4847 |
22444-22446 |
FW |
denotes |
et |
| T4848 |
22447-22450 |
FW |
denotes |
al. |
| T4849 |
22451-22455 |
CD |
denotes |
1998 |
| T4850 |
22455-22456 |
: |
denotes |
; |
| T4851 |
22457-22465 |
NNP |
denotes |
Begemann |
| T4852 |
22466-22468 |
FW |
denotes |
et |
| T4853 |
22469-22472 |
FW |
denotes |
al. |
| T4854 |
22473-22477 |
CD |
denotes |
2002 |
| T4855 |
22477-22478 |
-RRB- |
denotes |
) |
| T4856 |
22478-22479 |
. |
denotes |
. |
| T4857 |
22479-22829 |
sentence |
denotes |
By comparing the sequence of a 1.3 kb junction fragment amplified from deH/deH genomic DNA to publicly available mouse genome sequence, we identified a 216 kb deletion that extends from Tbx15 intron 1 to 148 kb downstream of the polyadenylation sequence in a region annotated as a mannose-6-phosphate receptor pseudogene, M6pr-ps (Figure 3B and 3C). |
| T4858 |
22480-22482 |
IN |
denotes |
By |
| T4859 |
22619-22629 |
VBD |
denotes |
identified |
| T4860 |
22483-22492 |
VBG |
denotes |
comparing |
| T4861 |
22493-22496 |
DT |
denotes |
the |
| T4862 |
22497-22505 |
NN |
denotes |
sequence |
| T4863 |
22506-22508 |
IN |
denotes |
of |
| T4864 |
22509-22510 |
DT |
denotes |
a |
| T4865 |
22527-22535 |
NN |
denotes |
fragment |
| T4866 |
22511-22514 |
CD |
denotes |
1.3 |
| T4867 |
22515-22517 |
NN |
denotes |
kb |
| T4868 |
22518-22526 |
NN |
denotes |
junction |
| T4869 |
22536-22545 |
VBN |
denotes |
amplified |
| T4870 |
22546-22550 |
IN |
denotes |
from |
| T4871 |
22551-22554 |
NN |
denotes |
deH |
| T4872 |
22555-22558 |
NN |
denotes |
deH |
| T4873 |
22554-22555 |
HYPH |
denotes |
/ |
| T4874 |
22567-22570 |
NN |
denotes |
DNA |
| T4875 |
22559-22566 |
JJ |
denotes |
genomic |
| T4876 |
22571-22573 |
IN |
denotes |
to |
| T4877 |
22574-22582 |
RB |
denotes |
publicly |
| T4878 |
22583-22592 |
JJ |
denotes |
available |
| T4879 |
22606-22614 |
NN |
denotes |
sequence |
| T4880 |
22593-22598 |
NN |
denotes |
mouse |
| T4881 |
22599-22605 |
NN |
denotes |
genome |
| T4882 |
22614-22616 |
, |
denotes |
, |
| T4883 |
22616-22618 |
PRP |
denotes |
we |
| T4884 |
22630-22631 |
DT |
denotes |
a |
| T4885 |
22639-22647 |
NN |
denotes |
deletion |
| T4886 |
22632-22635 |
CD |
denotes |
216 |
| T4887 |
22636-22638 |
NN |
denotes |
kb |
| T4888 |
22648-22652 |
WDT |
denotes |
that |
| T4889 |
22653-22660 |
VBZ |
denotes |
extends |
| T4890 |
22661-22665 |
IN |
denotes |
from |
| T4891 |
22666-22671 |
NN |
denotes |
Tbx15 |
| T4892 |
22672-22678 |
NN |
denotes |
intron |
| T4893 |
22679-22680 |
CD |
denotes |
1 |
| T4894 |
22681-22683 |
IN |
denotes |
to |
| T4895 |
22684-22687 |
CD |
denotes |
148 |
| T4896 |
22688-22690 |
NN |
denotes |
kb |
| T4897 |
22691-22701 |
RB |
denotes |
downstream |
| T4898 |
22702-22704 |
IN |
denotes |
of |
| T4899 |
22705-22708 |
DT |
denotes |
the |
| T4900 |
22725-22733 |
NN |
denotes |
sequence |
| T4901 |
22709-22724 |
NN |
denotes |
polyadenylation |
| T4902 |
22734-22736 |
IN |
denotes |
in |
| T4903 |
22737-22738 |
DT |
denotes |
a |
| T4904 |
22739-22745 |
NN |
denotes |
region |
| T4905 |
22746-22755 |
VBN |
denotes |
annotated |
| T4906 |
22756-22758 |
IN |
denotes |
as |
| T4907 |
22759-22760 |
DT |
denotes |
a |
| T4908 |
22790-22800 |
NN |
denotes |
pseudogene |
| T4909 |
22761-22768 |
NN |
denotes |
mannose |
| T4910 |
22771-22780 |
NN |
denotes |
phosphate |
| T4911 |
22768-22769 |
HYPH |
denotes |
- |
| T4912 |
22769-22770 |
CD |
denotes |
6 |
| T4913 |
22770-22771 |
HYPH |
denotes |
- |
| T4914 |
22781-22789 |
NN |
denotes |
receptor |
| T4915 |
22800-22802 |
, |
denotes |
, |
| T4916 |
22802-22806 |
NN |
denotes |
M6pr |
| T4917 |
22807-22809 |
NN |
denotes |
ps |
| T4918 |
22806-22807 |
HYPH |
denotes |
- |
| T4919 |
22810-22811 |
-LRB- |
denotes |
( |
| T4920 |
22818-22820 |
CD |
denotes |
3B |
| T4921 |
22811-22817 |
NN |
denotes |
Figure |
| T4922 |
22821-22824 |
CC |
denotes |
and |
| T4923 |
22825-22827 |
CD |
denotes |
3C |
| T4924 |
22827-22828 |
-RRB- |
denotes |
) |
| T4925 |
22828-22829 |
. |
denotes |
. |
| T4926 |
22829-22851 |
sentence |
denotes |
(Ludwig et al. 1992). |
| T4927 |
22830-22831 |
-LRB- |
denotes |
( |
| T4928 |
22831-22837 |
NNP |
denotes |
Ludwig |
| T4929 |
22838-22840 |
FW |
denotes |
et |
| T4930 |
22841-22844 |
FW |
denotes |
al. |
| T4931 |
22845-22849 |
CD |
denotes |
1992 |
| T4932 |
22849-22850 |
-RRB- |
denotes |
) |
| T4933 |
22850-22851 |
. |
denotes |
. |
| T4934 |
22851-22963 |
sentence |
denotes |
By Northern blot analysis, we identified a fusion transcript produced from the deH chromosome (data not shown). |
| T4935 |
22852-22854 |
IN |
denotes |
By |
| T4936 |
22882-22892 |
VBD |
denotes |
identified |
| T4937 |
22855-22863 |
NNP |
denotes |
Northern |
| T4938 |
22864-22868 |
NN |
denotes |
blot |
| T4939 |
22869-22877 |
NN |
denotes |
analysis |
| T4940 |
22877-22879 |
, |
denotes |
, |
| T4941 |
22879-22881 |
PRP |
denotes |
we |
| T4942 |
22893-22894 |
DT |
denotes |
a |
| T4943 |
22902-22912 |
NN |
denotes |
transcript |
| T4944 |
22895-22901 |
NN |
denotes |
fusion |
| T4945 |
22913-22921 |
VBN |
denotes |
produced |
| T4946 |
22922-22926 |
IN |
denotes |
from |
| T4947 |
22927-22930 |
DT |
denotes |
the |
| T4948 |
22935-22945 |
NN |
denotes |
chromosome |
| T4949 |
22931-22934 |
NN |
denotes |
deH |
| T4950 |
22946-22947 |
-LRB- |
denotes |
( |
| T4951 |
22956-22961 |
VBN |
denotes |
shown |
| T4952 |
22947-22951 |
NNS |
denotes |
data |
| T4953 |
22952-22955 |
RB |
denotes |
not |
| T4954 |
22961-22962 |
-RRB- |
denotes |
) |
| T4955 |
22962-22963 |
. |
denotes |
. |
| T4956 |
22963-23206 |
sentence |
denotes |
However, the deletion removes 534 of the 602 amino acids encoded by Tbx15 (including the T-box DNA-binding domain), deH/+ animals are grossly normal, and the phenotype of deH/deH animals is identical to that described for the original allele. |
| T4957 |
22964-22971 |
RB |
denotes |
However |
| T4958 |
22986-22993 |
VBZ |
denotes |
removes |
| T4959 |
22971-22973 |
, |
denotes |
, |
| T4960 |
22973-22976 |
DT |
denotes |
the |
| T4961 |
22977-22985 |
NN |
denotes |
deletion |
| T4962 |
22994-22997 |
CD |
denotes |
534 |
| T4963 |
23005-23008 |
CD |
denotes |
602 |
| T4964 |
22998-23000 |
IN |
denotes |
of |
| T4965 |
23001-23004 |
DT |
denotes |
the |
| T4966 |
23015-23020 |
NNS |
denotes |
acids |
| T4967 |
23009-23014 |
NN |
denotes |
amino |
| T4968 |
23021-23028 |
VBN |
denotes |
encoded |
| T4969 |
23029-23031 |
IN |
denotes |
by |
| T4970 |
23032-23037 |
NN |
denotes |
Tbx15 |
| T4971 |
23038-23039 |
-LRB- |
denotes |
( |
| T4972 |
23039-23048 |
VBG |
denotes |
including |
| T4973 |
23049-23052 |
DT |
denotes |
the |
| T4974 |
23071-23077 |
NN |
denotes |
domain |
| T4975 |
23053-23054 |
NN |
denotes |
T |
| T4976 |
23055-23058 |
NN |
denotes |
box |
| T4977 |
23054-23055 |
HYPH |
denotes |
- |
| T4978 |
23059-23062 |
NN |
denotes |
DNA |
| T4979 |
23063-23070 |
VBG |
denotes |
binding |
| T4980 |
23062-23063 |
HYPH |
denotes |
- |
| T4981 |
23077-23078 |
-RRB- |
denotes |
) |
| T4982 |
23078-23080 |
, |
denotes |
, |
| T4983 |
23080-23083 |
NN |
denotes |
deH |
| T4984 |
23086-23093 |
NNS |
denotes |
animals |
| T4985 |
23083-23084 |
HYPH |
denotes |
/ |
| T4986 |
23084-23085 |
SYM |
denotes |
+ |
| T4987 |
23094-23097 |
VBP |
denotes |
are |
| T4988 |
23098-23105 |
RB |
denotes |
grossly |
| T4989 |
23106-23112 |
JJ |
denotes |
normal |
| T4990 |
23112-23114 |
, |
denotes |
, |
| T4991 |
23114-23117 |
CC |
denotes |
and |
| T4992 |
23118-23121 |
DT |
denotes |
the |
| T4993 |
23122-23131 |
NN |
denotes |
phenotype |
| T4994 |
23151-23153 |
VBZ |
denotes |
is |
| T4995 |
23132-23134 |
IN |
denotes |
of |
| T4996 |
23135-23138 |
NN |
denotes |
deH |
| T4997 |
23139-23142 |
NN |
denotes |
deH |
| T4998 |
23138-23139 |
HYPH |
denotes |
/ |
| T4999 |
23143-23150 |
NNS |
denotes |
animals |
| T5000 |
23154-23163 |
JJ |
denotes |
identical |
| T5001 |
23164-23166 |
IN |
denotes |
to |
| T5002 |
23167-23171 |
DT |
denotes |
that |
| T5003 |
23172-23181 |
VBN |
denotes |
described |
| T5004 |
23182-23185 |
IN |
denotes |
for |
| T5005 |
23186-23189 |
DT |
denotes |
the |
| T5006 |
23199-23205 |
NN |
denotes |
allele |
| T5007 |
23190-23198 |
JJ |
denotes |
original |
| T5008 |
23205-23206 |
. |
denotes |
. |
| T5009 |
23206-23313 |
sentence |
denotes |
In addition, other than M6pr-ps, no other genes or transcripts have been annotated to the 216 kb deletion. |
| T5010 |
23207-23209 |
IN |
denotes |
In |
| T5011 |
23280-23289 |
VBN |
denotes |
annotated |
| T5012 |
23210-23218 |
NN |
denotes |
addition |
| T5013 |
23218-23220 |
, |
denotes |
, |
| T5014 |
23220-23225 |
JJ |
denotes |
other |
| T5015 |
23226-23230 |
IN |
denotes |
than |
| T5016 |
23231-23235 |
NN |
denotes |
M6pr |
| T5017 |
23236-23238 |
NN |
denotes |
ps |
| T5018 |
23235-23236 |
HYPH |
denotes |
- |
| T5019 |
23238-23240 |
, |
denotes |
, |
| T5020 |
23240-23242 |
DT |
denotes |
no |
| T5021 |
23249-23254 |
NNS |
denotes |
genes |
| T5022 |
23243-23248 |
JJ |
denotes |
other |
| T5023 |
23255-23257 |
CC |
denotes |
or |
| T5024 |
23258-23269 |
NNS |
denotes |
transcripts |
| T5025 |
23270-23274 |
VBP |
denotes |
have |
| T5026 |
23275-23279 |
VBN |
denotes |
been |
| T5027 |
23290-23292 |
IN |
denotes |
to |
| T5028 |
23293-23296 |
DT |
denotes |
the |
| T5029 |
23304-23312 |
NN |
denotes |
deletion |
| T5030 |
23297-23300 |
CD |
denotes |
216 |
| T5031 |
23301-23303 |
NN |
denotes |
kb |
| T5032 |
23312-23313 |
. |
denotes |
. |
| T5033 |
23313-23467 |
sentence |
denotes |
While the positional cloning work was underway, one of us (A. Russ) generated an independent mutation of Tbx15 by gene targeting in embryonic stem cells. |
| T5034 |
23314-23319 |
IN |
denotes |
While |
| T5035 |
23348-23351 |
VBD |
denotes |
was |
| T5036 |
23320-23323 |
DT |
denotes |
the |
| T5037 |
23343-23347 |
NN |
denotes |
work |
| T5038 |
23324-23334 |
JJ |
denotes |
positional |
| T5039 |
23335-23342 |
NN |
denotes |
cloning |
| T5040 |
23382-23391 |
VBD |
denotes |
generated |
| T5041 |
23352-23360 |
RB |
denotes |
underway |
| T5042 |
23360-23362 |
, |
denotes |
, |
| T5043 |
23362-23365 |
CD |
denotes |
one |
| T5044 |
23366-23368 |
IN |
denotes |
of |
| T5045 |
23369-23371 |
PRP |
denotes |
us |
| T5046 |
23372-23373 |
-LRB- |
denotes |
( |
| T5047 |
23373-23375 |
NNP |
denotes |
A. |
| T5048 |
23376-23380 |
NNP |
denotes |
Russ |
| T5049 |
23380-23381 |
-RRB- |
denotes |
) |
| T5050 |
23392-23394 |
DT |
denotes |
an |
| T5051 |
23407-23415 |
NN |
denotes |
mutation |
| T5052 |
23395-23406 |
JJ |
denotes |
independent |
| T5053 |
23416-23418 |
IN |
denotes |
of |
| T5054 |
23419-23424 |
NN |
denotes |
Tbx15 |
| T5055 |
23425-23427 |
IN |
denotes |
by |
| T5056 |
23428-23432 |
NN |
denotes |
gene |
| T5057 |
23433-23442 |
NN |
denotes |
targeting |
| T5058 |
23443-23445 |
IN |
denotes |
in |
| T5059 |
23446-23455 |
JJ |
denotes |
embryonic |
| T5060 |
23461-23466 |
NNS |
denotes |
cells |
| T5061 |
23456-23460 |
NN |
denotes |
stem |
| T5062 |
23466-23467 |
. |
denotes |
. |
| T5063 |
23467-23627 |
sentence |
denotes |
The targeted allele, Tbx15LacZ, carries an IRES-LacZ-neo cDNA cassette that disrupts the open reading frame at codon 154 early in the T-box domain (Figure 3D). |
| T5064 |
23468-23471 |
DT |
denotes |
The |
| T5065 |
23481-23487 |
NN |
denotes |
allele |
| T5066 |
23472-23480 |
VBN |
denotes |
targeted |
| T5067 |
23500-23507 |
VBZ |
denotes |
carries |
| T5068 |
23487-23489 |
, |
denotes |
, |
| T5069 |
23489-23498 |
NN |
denotes |
Tbx15LacZ |
| T5070 |
23498-23500 |
, |
denotes |
, |
| T5071 |
23508-23510 |
DT |
denotes |
an |
| T5072 |
23530-23538 |
NN |
denotes |
cassette |
| T5073 |
23511-23515 |
NN |
denotes |
IRES |
| T5074 |
23516-23520 |
NN |
denotes |
LacZ |
| T5075 |
23515-23516 |
HYPH |
denotes |
- |
| T5076 |
23520-23521 |
HYPH |
denotes |
- |
| T5077 |
23521-23524 |
JJ |
denotes |
neo |
| T5078 |
23525-23529 |
NN |
denotes |
cDNA |
| T5079 |
23539-23543 |
WDT |
denotes |
that |
| T5080 |
23544-23552 |
VBZ |
denotes |
disrupts |
| T5081 |
23553-23556 |
DT |
denotes |
the |
| T5082 |
23570-23575 |
NN |
denotes |
frame |
| T5083 |
23557-23561 |
JJ |
denotes |
open |
| T5084 |
23562-23569 |
NN |
denotes |
reading |
| T5085 |
23576-23578 |
IN |
denotes |
at |
| T5086 |
23579-23584 |
NN |
denotes |
codon |
| T5087 |
23585-23588 |
CD |
denotes |
154 |
| T5088 |
23589-23594 |
RB |
denotes |
early |
| T5089 |
23595-23597 |
IN |
denotes |
in |
| T5090 |
23598-23601 |
DT |
denotes |
the |
| T5091 |
23608-23614 |
NN |
denotes |
domain |
| T5092 |
23602-23603 |
NN |
denotes |
T |
| T5093 |
23604-23607 |
NN |
denotes |
box |
| T5094 |
23603-23604 |
HYPH |
denotes |
- |
| T5095 |
23615-23616 |
-LRB- |
denotes |
( |
| T5096 |
23616-23622 |
NN |
denotes |
Figure |
| T5097 |
23623-23625 |
CD |
denotes |
3D |
| T5098 |
23625-23626 |
-RRB- |
denotes |
) |
| T5099 |
23626-23627 |
. |
denotes |
. |
| T5100 |
23627-23914 |
sentence |
denotes |
Animals heterozygous for the targeted allele are completely normal with regard to size, skeletal morphology, and hair-color distribution, but Tbx15LacZ/Tbx15LacZ homozygotes were noted to exhibit reduced body size and an abnormal craniofacial appearance identical to that caused by deH. |
| T5101 |
23628-23635 |
NNS |
denotes |
Animals |
| T5102 |
23673-23676 |
VBP |
denotes |
are |
| T5103 |
23636-23648 |
JJ |
denotes |
heterozygous |
| T5104 |
23649-23652 |
IN |
denotes |
for |
| T5105 |
23653-23656 |
DT |
denotes |
the |
| T5106 |
23666-23672 |
NN |
denotes |
allele |
| T5107 |
23657-23665 |
VBN |
denotes |
targeted |
| T5108 |
23677-23687 |
RB |
denotes |
completely |
| T5109 |
23688-23694 |
JJ |
denotes |
normal |
| T5110 |
23695-23699 |
IN |
denotes |
with |
| T5111 |
23700-23706 |
NN |
denotes |
regard |
| T5112 |
23707-23709 |
IN |
denotes |
to |
| T5113 |
23710-23714 |
NN |
denotes |
size |
| T5114 |
23714-23716 |
, |
denotes |
, |
| T5115 |
23716-23724 |
JJ |
denotes |
skeletal |
| T5116 |
23725-23735 |
NN |
denotes |
morphology |
| T5117 |
23735-23737 |
, |
denotes |
, |
| T5118 |
23737-23740 |
CC |
denotes |
and |
| T5119 |
23741-23745 |
NN |
denotes |
hair |
| T5120 |
23746-23751 |
NN |
denotes |
color |
| T5121 |
23745-23746 |
HYPH |
denotes |
- |
| T5122 |
23752-23764 |
NN |
denotes |
distribution |
| T5123 |
23764-23766 |
, |
denotes |
, |
| T5124 |
23766-23769 |
CC |
denotes |
but |
| T5125 |
23770-23779 |
NN |
denotes |
Tbx15LacZ |
| T5126 |
23780-23789 |
NN |
denotes |
Tbx15LacZ |
| T5127 |
23779-23780 |
HYPH |
denotes |
/ |
| T5128 |
23790-23801 |
NNS |
denotes |
homozygotes |
| T5129 |
23807-23812 |
VBN |
denotes |
noted |
| T5130 |
23802-23806 |
VBD |
denotes |
were |
| T5131 |
23813-23815 |
TO |
denotes |
to |
| T5132 |
23816-23823 |
VB |
denotes |
exhibit |
| T5133 |
23824-23831 |
VBN |
denotes |
reduced |
| T5134 |
23837-23841 |
NN |
denotes |
size |
| T5135 |
23832-23836 |
NN |
denotes |
body |
| T5136 |
23842-23845 |
CC |
denotes |
and |
| T5137 |
23846-23848 |
DT |
denotes |
an |
| T5138 |
23871-23881 |
NN |
denotes |
appearance |
| T5139 |
23849-23857 |
JJ |
denotes |
abnormal |
| T5140 |
23858-23870 |
JJ |
denotes |
craniofacial |
| T5141 |
23882-23891 |
JJ |
denotes |
identical |
| T5142 |
23892-23894 |
IN |
denotes |
to |
| T5143 |
23895-23899 |
DT |
denotes |
that |
| T5144 |
23900-23906 |
VBN |
denotes |
caused |
| T5145 |
23907-23909 |
IN |
denotes |
by |
| T5146 |
23910-23913 |
NN |
denotes |
deH |
| T5147 |
23913-23914 |
. |
denotes |
. |
| T5148 |
23914-24160 |
sentence |
denotes |
We generated Tbx15LacZ/deH compound heterozygotes; on an Aw/at background, these animals exhibited the same abnormal restriction of dorsal pigmentation at P3.5 and expanded yellow flank area as described above for deH/deH animals (see Figure 2). |
| T5149 |
23915-23917 |
PRP |
denotes |
We |
| T5150 |
23918-23927 |
VBD |
denotes |
generated |
| T5151 |
24004-24013 |
VBD |
denotes |
exhibited |
| T5152 |
23928-23937 |
NN |
denotes |
Tbx15LacZ |
| T5153 |
23938-23941 |
NN |
denotes |
deH |
| T5154 |
23937-23938 |
SYM |
denotes |
/ |
| T5155 |
23951-23964 |
NNS |
denotes |
heterozygotes |
| T5156 |
23942-23950 |
NN |
denotes |
compound |
| T5157 |
23964-23965 |
: |
denotes |
; |
| T5158 |
23966-23968 |
IN |
denotes |
on |
| T5159 |
23969-23971 |
DT |
denotes |
an |
| T5160 |
23978-23988 |
NN |
denotes |
background |
| T5161 |
23972-23974 |
NN |
denotes |
Aw |
| T5162 |
23975-23977 |
NN |
denotes |
at |
| T5163 |
23974-23975 |
HYPH |
denotes |
/ |
| T5164 |
23988-23990 |
, |
denotes |
, |
| T5165 |
23990-23995 |
DT |
denotes |
these |
| T5166 |
23996-24003 |
NNS |
denotes |
animals |
| T5167 |
24014-24017 |
DT |
denotes |
the |
| T5168 |
24032-24043 |
NN |
denotes |
restriction |
| T5169 |
24018-24022 |
JJ |
denotes |
same |
| T5170 |
24023-24031 |
JJ |
denotes |
abnormal |
| T5171 |
24044-24046 |
IN |
denotes |
of |
| T5172 |
24047-24053 |
JJ |
denotes |
dorsal |
| T5173 |
24054-24066 |
NN |
denotes |
pigmentation |
| T5174 |
24067-24069 |
IN |
denotes |
at |
| T5175 |
24070-24074 |
NN |
denotes |
P3.5 |
| T5176 |
24075-24078 |
CC |
denotes |
and |
| T5177 |
24079-24087 |
VBN |
denotes |
expanded |
| T5178 |
24101-24105 |
NN |
denotes |
area |
| T5179 |
24088-24094 |
JJ |
denotes |
yellow |
| T5180 |
24095-24100 |
NN |
denotes |
flank |
| T5181 |
24106-24108 |
IN |
denotes |
as |
| T5182 |
24109-24118 |
VBN |
denotes |
described |
| T5183 |
24119-24124 |
RB |
denotes |
above |
| T5184 |
24125-24128 |
IN |
denotes |
for |
| T5185 |
24129-24132 |
NN |
denotes |
deH |
| T5186 |
24133-24136 |
NN |
denotes |
deH |
| T5187 |
24132-24133 |
HYPH |
denotes |
/ |
| T5188 |
24137-24144 |
NNS |
denotes |
animals |
| T5189 |
24145-24146 |
-LRB- |
denotes |
( |
| T5190 |
24146-24149 |
VB |
denotes |
see |
| T5191 |
24150-24156 |
NN |
denotes |
Figure |
| T5192 |
24157-24158 |
CD |
denotes |
2 |
| T5193 |
24158-24159 |
-RRB- |
denotes |
) |
| T5194 |
24159-24160 |
. |
denotes |
. |
| T5195 |
24160-24293 |
sentence |
denotes |
These observations demonstrate that the pigmentary and craniofacial characteristics of deH are caused by loss of function for Tbx15. |
| T5196 |
24161-24166 |
DT |
denotes |
These |
| T5197 |
24167-24179 |
NNS |
denotes |
observations |
| T5198 |
24180-24191 |
VBP |
denotes |
demonstrate |
| T5199 |
24192-24196 |
IN |
denotes |
that |
| T5200 |
24256-24262 |
VBN |
denotes |
caused |
| T5201 |
24197-24200 |
DT |
denotes |
the |
| T5202 |
24229-24244 |
NNS |
denotes |
characteristics |
| T5203 |
24201-24211 |
JJ |
denotes |
pigmentary |
| T5204 |
24212-24215 |
CC |
denotes |
and |
| T5205 |
24216-24228 |
JJ |
denotes |
craniofacial |
| T5206 |
24245-24247 |
IN |
denotes |
of |
| T5207 |
24248-24251 |
NN |
denotes |
deH |
| T5208 |
24252-24255 |
VBP |
denotes |
are |
| T5209 |
24263-24265 |
IN |
denotes |
by |
| T5210 |
24266-24270 |
NN |
denotes |
loss |
| T5211 |
24271-24273 |
IN |
denotes |
of |
| T5212 |
24274-24282 |
NN |
denotes |
function |
| T5213 |
24283-24286 |
IN |
denotes |
for |
| T5214 |
24287-24292 |
NN |
denotes |
Tbx15 |
| T5215 |
24292-24293 |
. |
denotes |
. |
| T5465 |
24295-24305 |
NN |
denotes |
Expression |
| T5466 |
24306-24308 |
IN |
denotes |
of |
| T5467 |
24309-24314 |
NN |
denotes |
Tbx15 |
| T5468 |
24315-24318 |
CC |
denotes |
and |
| T5469 |
24319-24325 |
NN |
denotes |
Agouti |
| T5470 |
24325-24568 |
sentence |
denotes |
Previous studies by Agulnik et al. (1998) using whole-mount in situ hybridization described expression of Tbx15 as first detectable at E9.5 in the limb buds, progressing to the branchial arches, flanks, and craniofacial regions through E12.5. |
| T5471 |
24326-24334 |
JJ |
denotes |
Previous |
| T5472 |
24335-24342 |
NNS |
denotes |
studies |
| T5473 |
24408-24417 |
VBD |
denotes |
described |
| T5474 |
24343-24345 |
IN |
denotes |
by |
| T5475 |
24346-24353 |
NNP |
denotes |
Agulnik |
| T5476 |
24354-24356 |
FW |
denotes |
et |
| T5477 |
24357-24360 |
FW |
denotes |
al. |
| T5478 |
24361-24362 |
-LRB- |
denotes |
( |
| T5479 |
24362-24366 |
CD |
denotes |
1998 |
| T5480 |
24366-24367 |
-RRB- |
denotes |
) |
| T5481 |
24368-24373 |
VBG |
denotes |
using |
| T5482 |
24374-24379 |
JJ |
denotes |
whole |
| T5483 |
24380-24385 |
NN |
denotes |
mount |
| T5484 |
24379-24380 |
HYPH |
denotes |
- |
| T5485 |
24394-24407 |
NN |
denotes |
hybridization |
| T5486 |
24386-24388 |
FW |
denotes |
in |
| T5487 |
24389-24393 |
FW |
denotes |
situ |
| T5488 |
24418-24428 |
NN |
denotes |
expression |
| T5489 |
24429-24431 |
IN |
denotes |
of |
| T5490 |
24432-24437 |
NN |
denotes |
Tbx15 |
| T5491 |
24438-24440 |
IN |
denotes |
as |
| T5492 |
24441-24446 |
RB |
denotes |
first |
| T5493 |
24447-24457 |
JJ |
denotes |
detectable |
| T5494 |
24458-24460 |
IN |
denotes |
at |
| T5495 |
24461-24465 |
NN |
denotes |
E9.5 |
| T5496 |
24466-24468 |
IN |
denotes |
in |
| T5497 |
24469-24472 |
DT |
denotes |
the |
| T5498 |
24478-24482 |
NNS |
denotes |
buds |
| T5499 |
24473-24477 |
NN |
denotes |
limb |
| T5500 |
24482-24484 |
, |
denotes |
, |
| T5501 |
24484-24495 |
VBG |
denotes |
progressing |
| T5502 |
24496-24498 |
IN |
denotes |
to |
| T5503 |
24499-24502 |
DT |
denotes |
the |
| T5504 |
24513-24519 |
NNS |
denotes |
arches |
| T5505 |
24503-24512 |
JJ |
denotes |
branchial |
| T5506 |
24519-24521 |
, |
denotes |
, |
| T5507 |
24521-24527 |
NNS |
denotes |
flanks |
| T5508 |
24527-24529 |
, |
denotes |
, |
| T5509 |
24529-24532 |
CC |
denotes |
and |
| T5510 |
24533-24545 |
JJ |
denotes |
craniofacial |
| T5511 |
24546-24553 |
NNS |
denotes |
regions |
| T5512 |
24554-24561 |
IN |
denotes |
through |
| T5513 |
24562-24567 |
NN |
denotes |
E12.5 |
| T5514 |
24567-24568 |
. |
denotes |
. |
| T5515 |
24568-24945 |
sentence |
denotes |
To investigate this pattern in more detail, we hybridized a Tbx15 mRNA probe to a series of transverse sections at E12.5 and observed expression in multiple mesenchymal tissues of the head, trunk, and developing limbs (Figure 4A), much of which is consistent with the skull, cervical vertebrae, and limb malformations reported for mice carrying the original droopy ear allele. |
| T5516 |
24569-24571 |
TO |
denotes |
To |
| T5517 |
24572-24583 |
VB |
denotes |
investigate |
| T5518 |
24616-24626 |
VBD |
denotes |
hybridized |
| T5519 |
24584-24588 |
DT |
denotes |
this |
| T5520 |
24589-24596 |
NN |
denotes |
pattern |
| T5521 |
24597-24599 |
IN |
denotes |
in |
| T5522 |
24600-24604 |
JJR |
denotes |
more |
| T5523 |
24605-24611 |
NN |
denotes |
detail |
| T5524 |
24611-24613 |
, |
denotes |
, |
| T5525 |
24613-24615 |
PRP |
denotes |
we |
| T5526 |
24627-24628 |
DT |
denotes |
a |
| T5527 |
24640-24645 |
NN |
denotes |
probe |
| T5528 |
24629-24634 |
NN |
denotes |
Tbx15 |
| T5529 |
24635-24639 |
NN |
denotes |
mRNA |
| T5530 |
24646-24648 |
IN |
denotes |
to |
| T5531 |
24649-24650 |
DT |
denotes |
a |
| T5532 |
24651-24657 |
NN |
denotes |
series |
| T5533 |
24658-24660 |
IN |
denotes |
of |
| T5534 |
24661-24671 |
JJ |
denotes |
transverse |
| T5535 |
24672-24680 |
NNS |
denotes |
sections |
| T5536 |
24681-24683 |
IN |
denotes |
at |
| T5537 |
24684-24689 |
NN |
denotes |
E12.5 |
| T5538 |
24690-24693 |
CC |
denotes |
and |
| T5539 |
24694-24702 |
VBD |
denotes |
observed |
| T5540 |
24703-24713 |
NN |
denotes |
expression |
| T5541 |
24714-24716 |
IN |
denotes |
in |
| T5542 |
24717-24725 |
JJ |
denotes |
multiple |
| T5543 |
24738-24745 |
NNS |
denotes |
tissues |
| T5544 |
24726-24737 |
JJ |
denotes |
mesenchymal |
| T5545 |
24746-24748 |
IN |
denotes |
of |
| T5546 |
24749-24752 |
DT |
denotes |
the |
| T5547 |
24753-24757 |
NN |
denotes |
head |
| T5548 |
24757-24759 |
, |
denotes |
, |
| T5549 |
24759-24764 |
NN |
denotes |
trunk |
| T5550 |
24764-24766 |
, |
denotes |
, |
| T5551 |
24766-24769 |
CC |
denotes |
and |
| T5552 |
24770-24780 |
VBG |
denotes |
developing |
| T5553 |
24781-24786 |
NNS |
denotes |
limbs |
| T5554 |
24787-24788 |
-LRB- |
denotes |
( |
| T5555 |
24788-24794 |
NN |
denotes |
Figure |
| T5556 |
24795-24797 |
CD |
denotes |
4A |
| T5557 |
24797-24798 |
-RRB- |
denotes |
) |
| T5558 |
24798-24800 |
, |
denotes |
, |
| T5559 |
24800-24804 |
JJ |
denotes |
much |
| T5560 |
24814-24816 |
VBZ |
denotes |
is |
| T5561 |
24805-24807 |
IN |
denotes |
of |
| T5562 |
24808-24813 |
WDT |
denotes |
which |
| T5563 |
24817-24827 |
JJ |
denotes |
consistent |
| T5564 |
24828-24832 |
IN |
denotes |
with |
| T5565 |
24833-24836 |
DT |
denotes |
the |
| T5566 |
24873-24886 |
NNS |
denotes |
malformations |
| T5567 |
24837-24842 |
NN |
denotes |
skull |
| T5568 |
24842-24844 |
, |
denotes |
, |
| T5569 |
24844-24852 |
JJ |
denotes |
cervical |
| T5570 |
24853-24862 |
NNS |
denotes |
vertebrae |
| T5571 |
24862-24864 |
, |
denotes |
, |
| T5572 |
24864-24867 |
CC |
denotes |
and |
| T5573 |
24868-24872 |
NN |
denotes |
limb |
| T5574 |
24887-24895 |
VBN |
denotes |
reported |
| T5575 |
24896-24899 |
IN |
denotes |
for |
| T5576 |
24900-24904 |
NNS |
denotes |
mice |
| T5577 |
24905-24913 |
VBG |
denotes |
carrying |
| T5578 |
24914-24917 |
DT |
denotes |
the |
| T5579 |
24938-24944 |
NN |
denotes |
allele |
| T5580 |
24918-24926 |
JJ |
denotes |
original |
| T5581 |
24927-24933 |
JJ |
denotes |
droopy |
| T5582 |
24934-24937 |
NN |
denotes |
ear |
| T5583 |
24944-24945 |
. |
denotes |
. |
| T5584 |
24945-25896 |
sentence |
denotes |
Figure 4 Developmental Expression of Tbx15
(A) At E12.5, transverse sections at different levels show expression in head mesenchyme (a and b); myotome, occipital, and periocular mesenchyme (b); palatal shelf, cervical sclerotome, and nasal cartilage (c); maxillary and mandibular processes (d); limbs (e); and myotome and lateral mesenchyme (e and f) (scale bars = 500 μm).
(B) Transverse sections through the flank at different times show expression in lateral mesenchyme (E11.5), expanding dorsally at E12.5, and both ventrally and dorsally at E13.5, detectable in loose mesenchyme underlying the dermis and the abdominal and subcutaneous muscles (scale bar = 500 μm). At P3.5, Tbx15 is expressed in the entire dermis and is most strongly expressed in dermal sheaths (scale bar = 200 μm). We were particularly interested in determining the exact nature of the embryonic flank expression relative to the ventralized phenotype of adult deH/deH mice. |
| T5585 |
25738-25740 |
PRP |
denotes |
We |
| T5586 |
25741-25745 |
VBD |
denotes |
were |
| T5587 |
25746-25758 |
RB |
denotes |
particularly |
| T5588 |
25759-25769 |
JJ |
denotes |
interested |
| T5589 |
25770-25772 |
IN |
denotes |
in |
| T5590 |
25773-25784 |
VBG |
denotes |
determining |
| T5591 |
25785-25788 |
DT |
denotes |
the |
| T5592 |
25795-25801 |
NN |
denotes |
nature |
| T5593 |
25789-25794 |
JJ |
denotes |
exact |
| T5594 |
25802-25804 |
IN |
denotes |
of |
| T5595 |
25805-25808 |
DT |
denotes |
the |
| T5596 |
25825-25835 |
NN |
denotes |
expression |
| T5597 |
25809-25818 |
JJ |
denotes |
embryonic |
| T5598 |
25819-25824 |
NN |
denotes |
flank |
| T5599 |
25836-25844 |
JJ |
denotes |
relative |
| T5600 |
25845-25847 |
IN |
denotes |
to |
| T5601 |
25848-25851 |
DT |
denotes |
the |
| T5602 |
25864-25873 |
NN |
denotes |
phenotype |
| T5603 |
25852-25863 |
VBN |
denotes |
ventralized |
| T5604 |
25874-25876 |
IN |
denotes |
of |
| T5605 |
25877-25882 |
JJ |
denotes |
adult |
| T5606 |
25891-25895 |
NNS |
denotes |
mice |
| T5607 |
25883-25886 |
NN |
denotes |
deH |
| T5608 |
25887-25890 |
NN |
denotes |
deH |
| T5609 |
25886-25887 |
SYM |
denotes |
/ |
| T5610 |
25895-25896 |
. |
denotes |
. |
| T5611 |
25896-26128 |
sentence |
denotes |
Transverse abdominal sections from different times during development reveal a dorsolateral band of expression in the superficial mesenchyme at E11.5 that broadens both dorsally and ventrally over the next several days (Figure 4B). |
| T5612 |
25897-25907 |
JJ |
denotes |
Transverse |
| T5613 |
25918-25926 |
NNS |
denotes |
sections |
| T5614 |
25908-25917 |
JJ |
denotes |
abdominal |
| T5615 |
25967-25973 |
VBP |
denotes |
reveal |
| T5616 |
25927-25931 |
IN |
denotes |
from |
| T5617 |
25932-25941 |
JJ |
denotes |
different |
| T5618 |
25942-25947 |
NNS |
denotes |
times |
| T5619 |
25948-25954 |
IN |
denotes |
during |
| T5620 |
25955-25966 |
NN |
denotes |
development |
| T5621 |
25974-25975 |
DT |
denotes |
a |
| T5622 |
25989-25993 |
NN |
denotes |
band |
| T5623 |
25976-25988 |
JJ |
denotes |
dorsolateral |
| T5624 |
25994-25996 |
IN |
denotes |
of |
| T5625 |
25997-26007 |
NN |
denotes |
expression |
| T5626 |
26008-26010 |
IN |
denotes |
in |
| T5627 |
26011-26014 |
DT |
denotes |
the |
| T5628 |
26027-26037 |
NN |
denotes |
mesenchyme |
| T5629 |
26015-26026 |
JJ |
denotes |
superficial |
| T5630 |
26038-26040 |
IN |
denotes |
at |
| T5631 |
26041-26046 |
NN |
denotes |
E11.5 |
| T5632 |
26047-26051 |
WDT |
denotes |
that |
| T5633 |
26052-26060 |
VBZ |
denotes |
broadens |
| T5634 |
26061-26065 |
CC |
denotes |
both |
| T5635 |
26066-26074 |
RB |
denotes |
dorsally |
| T5636 |
26075-26078 |
CC |
denotes |
and |
| T5637 |
26079-26088 |
RB |
denotes |
ventrally |
| T5638 |
26089-26093 |
IN |
denotes |
over |
| T5639 |
26094-26097 |
DT |
denotes |
the |
| T5640 |
26111-26115 |
NNS |
denotes |
days |
| T5641 |
26098-26102 |
JJ |
denotes |
next |
| T5642 |
26103-26110 |
JJ |
denotes |
several |
| T5643 |
26116-26117 |
-LRB- |
denotes |
( |
| T5644 |
26117-26123 |
NN |
denotes |
Figure |
| T5645 |
26124-26126 |
CD |
denotes |
4B |
| T5646 |
26126-26127 |
-RRB- |
denotes |
) |
| T5647 |
26127-26128 |
. |
denotes |
. |
| T5648 |
26128-26326 |
sentence |
denotes |
By E13.5, the developing dermis has become separated from the loose mesenchyme by a subcutaneous muscle layer; Tbx15 is expressed in all of these layers as well as the underlying abdominal muscles. |
| T5649 |
26129-26131 |
IN |
denotes |
By |
| T5650 |
26165-26171 |
VBN |
denotes |
become |
| T5651 |
26132-26137 |
NN |
denotes |
E13.5 |
| T5652 |
26137-26139 |
, |
denotes |
, |
| T5653 |
26139-26142 |
DT |
denotes |
the |
| T5654 |
26154-26160 |
NN |
denotes |
dermis |
| T5655 |
26143-26153 |
VBG |
denotes |
developing |
| T5656 |
26161-26164 |
VBZ |
denotes |
has |
| T5657 |
26249-26258 |
VBN |
denotes |
expressed |
| T5658 |
26172-26181 |
JJ |
denotes |
separated |
| T5659 |
26182-26186 |
IN |
denotes |
from |
| T5660 |
26187-26190 |
DT |
denotes |
the |
| T5661 |
26197-26207 |
NN |
denotes |
mesenchyme |
| T5662 |
26191-26196 |
JJ |
denotes |
loose |
| T5663 |
26208-26210 |
IN |
denotes |
by |
| T5664 |
26211-26212 |
DT |
denotes |
a |
| T5665 |
26233-26238 |
NN |
denotes |
layer |
| T5666 |
26213-26225 |
JJ |
denotes |
subcutaneous |
| T5667 |
26226-26232 |
NN |
denotes |
muscle |
| T5668 |
26238-26239 |
: |
denotes |
; |
| T5669 |
26240-26245 |
NN |
denotes |
Tbx15 |
| T5670 |
26246-26248 |
VBZ |
denotes |
is |
| T5671 |
26259-26261 |
IN |
denotes |
in |
| T5672 |
26262-26265 |
DT |
denotes |
all |
| T5673 |
26266-26268 |
IN |
denotes |
of |
| T5674 |
26269-26274 |
DT |
denotes |
these |
| T5675 |
26275-26281 |
NNS |
denotes |
layers |
| T5676 |
26282-26284 |
RB |
denotes |
as |
| T5677 |
26290-26292 |
IN |
denotes |
as |
| T5678 |
26285-26289 |
RB |
denotes |
well |
| T5679 |
26293-26296 |
DT |
denotes |
the |
| T5680 |
26318-26325 |
NNS |
denotes |
muscles |
| T5681 |
26297-26307 |
VBG |
denotes |
underlying |
| T5682 |
26308-26317 |
JJ |
denotes |
abdominal |
| T5683 |
26325-26326 |
. |
denotes |
. |
| T5684 |
26326-26566 |
sentence |
denotes |
In P3.5 skin, Tbx15 is expressed in both dorsal and ventral skin, most strongly in the condensed upper dermis and developing dermal sheaths of hair follicles; faint expression can also be detected in rare dermal papillae cells (Figure 4B). |
| T5685 |
26327-26329 |
IN |
denotes |
In |
| T5686 |
26350-26359 |
VBN |
denotes |
expressed |
| T5687 |
26330-26334 |
NN |
denotes |
P3.5 |
| T5688 |
26335-26339 |
NN |
denotes |
skin |
| T5689 |
26339-26341 |
, |
denotes |
, |
| T5690 |
26341-26346 |
NN |
denotes |
Tbx15 |
| T5691 |
26347-26349 |
VBZ |
denotes |
is |
| T5692 |
26515-26523 |
VBN |
denotes |
detected |
| T5693 |
26360-26362 |
IN |
denotes |
in |
| T5694 |
26363-26367 |
CC |
denotes |
both |
| T5695 |
26368-26374 |
JJ |
denotes |
dorsal |
| T5696 |
26387-26391 |
NN |
denotes |
skin |
| T5697 |
26375-26378 |
CC |
denotes |
and |
| T5698 |
26379-26386 |
JJ |
denotes |
ventral |
| T5699 |
26391-26393 |
, |
denotes |
, |
| T5700 |
26393-26397 |
RBS |
denotes |
most |
| T5701 |
26398-26406 |
RB |
denotes |
strongly |
| T5702 |
26407-26409 |
IN |
denotes |
in |
| T5703 |
26410-26413 |
DT |
denotes |
the |
| T5704 |
26430-26436 |
NN |
denotes |
dermis |
| T5705 |
26414-26423 |
VBN |
denotes |
condensed |
| T5706 |
26424-26429 |
JJ |
denotes |
upper |
| T5707 |
26437-26440 |
CC |
denotes |
and |
| T5708 |
26441-26451 |
VBG |
denotes |
developing |
| T5709 |
26459-26466 |
NNS |
denotes |
sheaths |
| T5710 |
26452-26458 |
JJ |
denotes |
dermal |
| T5711 |
26467-26469 |
IN |
denotes |
of |
| T5712 |
26470-26474 |
NN |
denotes |
hair |
| T5713 |
26475-26484 |
NNS |
denotes |
follicles |
| T5714 |
26484-26485 |
: |
denotes |
; |
| T5715 |
26486-26491 |
JJ |
denotes |
faint |
| T5716 |
26492-26502 |
NN |
denotes |
expression |
| T5717 |
26503-26506 |
MD |
denotes |
can |
| T5718 |
26507-26511 |
RB |
denotes |
also |
| T5719 |
26512-26514 |
VB |
denotes |
be |
| T5720 |
26524-26526 |
IN |
denotes |
in |
| T5721 |
26527-26531 |
JJ |
denotes |
rare |
| T5722 |
26548-26553 |
NNS |
denotes |
cells |
| T5723 |
26532-26538 |
JJ |
denotes |
dermal |
| T5724 |
26539-26547 |
NNS |
denotes |
papillae |
| T5725 |
26554-26555 |
-LRB- |
denotes |
( |
| T5726 |
26555-26561 |
NN |
denotes |
Figure |
| T5727 |
26562-26564 |
CD |
denotes |
4B |
| T5728 |
26564-26565 |
-RRB- |
denotes |
) |
| T5729 |
26565-26566 |
. |
denotes |
. |
| T5730 |
26566-26750 |
sentence |
denotes |
Although the effects of Agouti on pigment-type switching occur during postnatal hair growth, the ventral-specific isoform of Agouti is expressed in developing skin beginning at E11.5. |
| T5731 |
26567-26575 |
IN |
denotes |
Although |
| T5732 |
26624-26629 |
VBP |
denotes |
occur |
| T5733 |
26576-26579 |
DT |
denotes |
the |
| T5734 |
26580-26587 |
NNS |
denotes |
effects |
| T5735 |
26588-26590 |
IN |
denotes |
of |
| T5736 |
26591-26597 |
NN |
denotes |
Agouti |
| T5737 |
26598-26600 |
IN |
denotes |
on |
| T5738 |
26601-26608 |
NN |
denotes |
pigment |
| T5739 |
26609-26613 |
NN |
denotes |
type |
| T5740 |
26608-26609 |
HYPH |
denotes |
- |
| T5741 |
26614-26623 |
VBG |
denotes |
switching |
| T5742 |
26702-26711 |
VBN |
denotes |
expressed |
| T5743 |
26630-26636 |
IN |
denotes |
during |
| T5744 |
26637-26646 |
JJ |
denotes |
postnatal |
| T5745 |
26652-26658 |
NN |
denotes |
growth |
| T5746 |
26647-26651 |
NN |
denotes |
hair |
| T5747 |
26658-26660 |
, |
denotes |
, |
| T5748 |
26660-26663 |
DT |
denotes |
the |
| T5749 |
26681-26688 |
NN |
denotes |
isoform |
| T5750 |
26664-26671 |
JJ |
denotes |
ventral |
| T5751 |
26672-26680 |
JJ |
denotes |
specific |
| T5752 |
26671-26672 |
HYPH |
denotes |
- |
| T5753 |
26689-26691 |
IN |
denotes |
of |
| T5754 |
26692-26698 |
NN |
denotes |
Agouti |
| T5755 |
26699-26701 |
VBZ |
denotes |
is |
| T5756 |
26712-26714 |
IN |
denotes |
in |
| T5757 |
26715-26725 |
VBG |
denotes |
developing |
| T5758 |
26726-26730 |
NN |
denotes |
skin |
| T5759 |
26731-26740 |
VBG |
denotes |
beginning |
| T5760 |
26741-26743 |
IN |
denotes |
at |
| T5761 |
26744-26749 |
NN |
denotes |
E11.5 |
| T5762 |
26749-26750 |
. |
denotes |
. |
| T5763 |
26750-26971 |
sentence |
denotes |
We compared adjacent sections hybridized with probes for Tbx15 and Agouti and observed complementary patterns at E12.5, with expression of Agouti in ventral skin and expression of Tbx15 in dorsal skin (Figure 5A and 5B). |
| T5764 |
26751-26753 |
PRP |
denotes |
We |
| T5765 |
26754-26762 |
VBD |
denotes |
compared |
| T5766 |
26763-26771 |
JJ |
denotes |
adjacent |
| T5767 |
26772-26780 |
NNS |
denotes |
sections |
| T5768 |
26781-26791 |
VBN |
denotes |
hybridized |
| T5769 |
26792-26796 |
IN |
denotes |
with |
| T5770 |
26797-26803 |
NNS |
denotes |
probes |
| T5771 |
26804-26807 |
IN |
denotes |
for |
| T5772 |
26808-26813 |
NN |
denotes |
Tbx15 |
| T5773 |
26814-26817 |
CC |
denotes |
and |
| T5774 |
26818-26824 |
NN |
denotes |
Agouti |
| T5775 |
26825-26828 |
CC |
denotes |
and |
| T5776 |
26829-26837 |
VBD |
denotes |
observed |
| T5777 |
26838-26851 |
JJ |
denotes |
complementary |
| T5778 |
26852-26860 |
NNS |
denotes |
patterns |
| T5779 |
26861-26863 |
IN |
denotes |
at |
| T5780 |
26864-26869 |
NN |
denotes |
E12.5 |
| T5781 |
26869-26871 |
, |
denotes |
, |
| T5782 |
26871-26875 |
IN |
denotes |
with |
| T5783 |
26876-26886 |
NN |
denotes |
expression |
| T5784 |
26887-26889 |
IN |
denotes |
of |
| T5785 |
26890-26896 |
NN |
denotes |
Agouti |
| T5786 |
26897-26899 |
IN |
denotes |
in |
| T5787 |
26900-26907 |
JJ |
denotes |
ventral |
| T5788 |
26908-26912 |
NN |
denotes |
skin |
| T5789 |
26913-26916 |
CC |
denotes |
and |
| T5790 |
26917-26927 |
NN |
denotes |
expression |
| T5791 |
26928-26930 |
IN |
denotes |
of |
| T5792 |
26931-26936 |
NN |
denotes |
Tbx15 |
| T5793 |
26937-26939 |
IN |
denotes |
in |
| T5794 |
26940-26946 |
JJ |
denotes |
dorsal |
| T5795 |
26947-26951 |
NN |
denotes |
skin |
| T5796 |
26952-26953 |
-LRB- |
denotes |
( |
| T5797 |
26960-26962 |
CD |
denotes |
5A |
| T5798 |
26953-26959 |
NN |
denotes |
Figure |
| T5799 |
26963-26966 |
CC |
denotes |
and |
| T5800 |
26967-26969 |
CD |
denotes |
5B |
| T5801 |
26969-26970 |
-RRB- |
denotes |
) |
| T5802 |
26970-26971 |
. |
denotes |
. |
| T5803 |
26971-27143 |
sentence |
denotes |
The junction between expression domains is indistinct, and by E14.5, Tbx15 expression extends ventrally and overlaps extensively with Agouti expression (Figure 5C and 5D). |
| T5804 |
26972-26975 |
DT |
denotes |
The |
| T5805 |
26976-26984 |
NN |
denotes |
junction |
| T5806 |
27012-27014 |
VBZ |
denotes |
is |
| T5807 |
26985-26992 |
IN |
denotes |
between |
| T5808 |
26993-27003 |
NN |
denotes |
expression |
| T5809 |
27004-27011 |
NNS |
denotes |
domains |
| T5810 |
27015-27025 |
JJ |
denotes |
indistinct |
| T5811 |
27025-27027 |
, |
denotes |
, |
| T5812 |
27027-27030 |
CC |
denotes |
and |
| T5813 |
27031-27033 |
IN |
denotes |
by |
| T5814 |
27058-27065 |
VBZ |
denotes |
extends |
| T5815 |
27034-27039 |
NN |
denotes |
E14.5 |
| T5816 |
27039-27041 |
, |
denotes |
, |
| T5817 |
27041-27046 |
NN |
denotes |
Tbx15 |
| T5818 |
27047-27057 |
NN |
denotes |
expression |
| T5819 |
27066-27075 |
RB |
denotes |
ventrally |
| T5820 |
27076-27079 |
CC |
denotes |
and |
| T5821 |
27080-27088 |
VBZ |
denotes |
overlaps |
| T5822 |
27089-27100 |
RB |
denotes |
extensively |
| T5823 |
27101-27105 |
IN |
denotes |
with |
| T5824 |
27106-27112 |
NN |
denotes |
Agouti |
| T5825 |
27113-27123 |
NN |
denotes |
expression |
| T5826 |
27124-27125 |
-LRB- |
denotes |
( |
| T5827 |
27132-27134 |
CD |
denotes |
5C |
| T5828 |
27125-27131 |
NN |
denotes |
Figure |
| T5829 |
27135-27138 |
CC |
denotes |
and |
| T5830 |
27139-27141 |
CD |
denotes |
5D |
| T5831 |
27141-27142 |
-RRB- |
denotes |
) |
| T5832 |
27142-27143 |
. |
denotes |
. |
| T5833 |
27143-27798 |
sentence |
denotes |
Figure 5 Embryonic Expression of Tbx15 Compared to Agouti in at/at Mice
(A and C) Tbx15. (B and D) Agouti. At E12.5, expression of Tbx15 in dorsal skin is approximately complementary to that of Agouti in ventral skin. At E14.5, the levels of expression for both genes are lower, but Tbx15 expression has expanded ventrally and overlaps extensively with that of Agouti. In all four panels, arrows mark the approximate ventral limit of Tbx15 and the approximate dorsal limit of Agouti (scale bars = 500 μm). We also examined the effect of deH on expression of Agouti and found no difference between mutant and nonmutant at E12.5 or E13.5 (data not shown). |
| T5834 |
27651-27653 |
PRP |
denotes |
We |
| T5835 |
27659-27667 |
VBD |
denotes |
examined |
| T5836 |
27654-27658 |
RB |
denotes |
also |
| T5837 |
27668-27671 |
DT |
denotes |
the |
| T5838 |
27672-27678 |
NN |
denotes |
effect |
| T5839 |
27679-27681 |
IN |
denotes |
of |
| T5840 |
27682-27685 |
NN |
denotes |
deH |
| T5841 |
27686-27688 |
IN |
denotes |
on |
| T5842 |
27689-27699 |
NN |
denotes |
expression |
| T5843 |
27700-27702 |
IN |
denotes |
of |
| T5844 |
27703-27709 |
NN |
denotes |
Agouti |
| T5845 |
27710-27713 |
CC |
denotes |
and |
| T5846 |
27714-27719 |
VBD |
denotes |
found |
| T5847 |
27720-27722 |
DT |
denotes |
no |
| T5848 |
27723-27733 |
NN |
denotes |
difference |
| T5849 |
27734-27741 |
IN |
denotes |
between |
| T5850 |
27742-27748 |
JJ |
denotes |
mutant |
| T5851 |
27749-27752 |
CC |
denotes |
and |
| T5852 |
27753-27762 |
JJ |
denotes |
nonmutant |
| T5853 |
27763-27765 |
IN |
denotes |
at |
| T5854 |
27766-27771 |
NN |
denotes |
E12.5 |
| T5855 |
27772-27774 |
CC |
denotes |
or |
| T5856 |
27775-27780 |
NN |
denotes |
E13.5 |
| T5857 |
27781-27782 |
-LRB- |
denotes |
( |
| T5858 |
27791-27796 |
VBN |
denotes |
shown |
| T5859 |
27782-27786 |
NNS |
denotes |
data |
| T5860 |
27787-27790 |
RB |
denotes |
not |
| T5861 |
27796-27797 |
-RRB- |
denotes |
) |
| T5862 |
27797-27798 |
. |
denotes |
. |
| T5863 |
27798-27941 |
sentence |
denotes |
However, at E14.5, the normal ventral-to-dorsal gradient of Agouti expression appeared to extend more dorsally in deH/deH embryos (Figure 6A). |
| T5864 |
27799-27806 |
RB |
denotes |
However |
| T5865 |
27877-27885 |
VBD |
denotes |
appeared |
| T5866 |
27806-27808 |
, |
denotes |
, |
| T5867 |
27808-27810 |
IN |
denotes |
at |
| T5868 |
27811-27816 |
NN |
denotes |
E14.5 |
| T5869 |
27816-27818 |
, |
denotes |
, |
| T5870 |
27818-27821 |
DT |
denotes |
the |
| T5871 |
27847-27855 |
NN |
denotes |
gradient |
| T5872 |
27822-27828 |
JJ |
denotes |
normal |
| T5873 |
27829-27836 |
JJ |
denotes |
ventral |
| T5874 |
27836-27837 |
HYPH |
denotes |
- |
| T5875 |
27837-27839 |
IN |
denotes |
to |
| T5876 |
27839-27840 |
HYPH |
denotes |
- |
| T5877 |
27840-27846 |
JJ |
denotes |
dorsal |
| T5878 |
27856-27858 |
IN |
denotes |
of |
| T5879 |
27859-27865 |
NN |
denotes |
Agouti |
| T5880 |
27866-27876 |
NN |
denotes |
expression |
| T5881 |
27886-27888 |
TO |
denotes |
to |
| T5882 |
27889-27895 |
VB |
denotes |
extend |
| T5883 |
27896-27900 |
RBR |
denotes |
more |
| T5884 |
27901-27909 |
RB |
denotes |
dorsally |
| T5885 |
27910-27912 |
IN |
denotes |
in |
| T5886 |
27913-27916 |
NN |
denotes |
deH |
| T5887 |
27917-27920 |
NN |
denotes |
deH |
| T5888 |
27916-27917 |
HYPH |
denotes |
/ |
| T5889 |
27921-27928 |
NNS |
denotes |
embryos |
| T5890 |
27929-27930 |
-LRB- |
denotes |
( |
| T5891 |
27930-27936 |
NN |
denotes |
Figure |
| T5892 |
27937-27939 |
CD |
denotes |
6A |
| T5893 |
27939-27940 |
-RRB- |
denotes |
) |
| T5894 |
27940-27941 |
. |
denotes |
. |
| T5895 |
27941-28128 |
sentence |
denotes |
In P4.5 skin, expression of Agouti is also extended dorsally in deH/deH animals and is most apparent in the midflank region within the upper dermis and dermal papillae cells (Figure 6B). |
| T5896 |
27942-27944 |
IN |
denotes |
In |
| T5897 |
27985-27993 |
VBN |
denotes |
extended |
| T5898 |
27945-27949 |
NN |
denotes |
P4.5 |
| T5899 |
27950-27954 |
NN |
denotes |
skin |
| T5900 |
27954-27956 |
, |
denotes |
, |
| T5901 |
27956-27966 |
NN |
denotes |
expression |
| T5902 |
27967-27969 |
IN |
denotes |
of |
| T5903 |
27970-27976 |
NN |
denotes |
Agouti |
| T5904 |
27977-27979 |
VBZ |
denotes |
is |
| T5905 |
27980-27984 |
RB |
denotes |
also |
| T5906 |
27994-28002 |
RB |
denotes |
dorsally |
| T5907 |
28003-28005 |
IN |
denotes |
in |
| T5908 |
28006-28009 |
NN |
denotes |
deH |
| T5909 |
28010-28013 |
NN |
denotes |
deH |
| T5910 |
28009-28010 |
HYPH |
denotes |
/ |
| T5911 |
28014-28021 |
NNS |
denotes |
animals |
| T5912 |
28022-28025 |
CC |
denotes |
and |
| T5913 |
28026-28028 |
VBZ |
denotes |
is |
| T5914 |
28029-28033 |
RBS |
denotes |
most |
| T5915 |
28034-28042 |
JJ |
denotes |
apparent |
| T5916 |
28043-28045 |
IN |
denotes |
in |
| T5917 |
28046-28049 |
DT |
denotes |
the |
| T5918 |
28059-28065 |
NN |
denotes |
region |
| T5919 |
28050-28058 |
JJ |
denotes |
midflank |
| T5920 |
28066-28072 |
IN |
denotes |
within |
| T5921 |
28073-28076 |
DT |
denotes |
the |
| T5922 |
28083-28089 |
NN |
denotes |
dermis |
| T5923 |
28077-28082 |
JJ |
denotes |
upper |
| T5924 |
28090-28093 |
CC |
denotes |
and |
| T5925 |
28094-28100 |
JJ |
denotes |
dermal |
| T5926 |
28110-28115 |
NNS |
denotes |
cells |
| T5927 |
28101-28109 |
NNS |
denotes |
papillae |
| T5928 |
28116-28117 |
-LRB- |
denotes |
( |
| T5929 |
28117-28123 |
NN |
denotes |
Figure |
| T5930 |
28124-28126 |
CD |
denotes |
6B |
| T5931 |
28126-28127 |
-RRB- |
denotes |
) |
| T5932 |
28127-28128 |
. |
denotes |
. |
| T5933 |
28128-28460 |
sentence |
denotes |
Thus, while the pigmentation phenotype of deH/deH mice can be explained, not surprisingly, by dorsal extension of Agouti expression after birth, patterned expression of Tbx15 and Agouti are apparent some 10 days earlier, between E12.5 and E13.5, and the effects of Tbx15 deficiency on expression of Agouti can be detected by E14.5. |
| T5934 |
28129-28133 |
RB |
denotes |
Thus |
| T5935 |
28315-28318 |
VBP |
denotes |
are |
| T5936 |
28133-28135 |
, |
denotes |
, |
| T5937 |
28135-28140 |
IN |
denotes |
while |
| T5938 |
28191-28200 |
VBN |
denotes |
explained |
| T5939 |
28141-28144 |
DT |
denotes |
the |
| T5940 |
28158-28167 |
NN |
denotes |
phenotype |
| T5941 |
28145-28157 |
NN |
denotes |
pigmentation |
| T5942 |
28168-28170 |
IN |
denotes |
of |
| T5943 |
28171-28174 |
NN |
denotes |
deH |
| T5944 |
28175-28178 |
NN |
denotes |
deH |
| T5945 |
28174-28175 |
HYPH |
denotes |
/ |
| T5946 |
28179-28183 |
NNS |
denotes |
mice |
| T5947 |
28184-28187 |
MD |
denotes |
can |
| T5948 |
28188-28190 |
VB |
denotes |
be |
| T5949 |
28200-28202 |
, |
denotes |
, |
| T5950 |
28202-28205 |
RB |
denotes |
not |
| T5951 |
28206-28218 |
RB |
denotes |
surprisingly |
| T5952 |
28218-28220 |
, |
denotes |
, |
| T5953 |
28220-28222 |
IN |
denotes |
by |
| T5954 |
28223-28229 |
JJ |
denotes |
dorsal |
| T5955 |
28230-28239 |
NN |
denotes |
extension |
| T5956 |
28240-28242 |
IN |
denotes |
of |
| T5957 |
28243-28249 |
NN |
denotes |
Agouti |
| T5958 |
28250-28260 |
NN |
denotes |
expression |
| T5959 |
28261-28266 |
IN |
denotes |
after |
| T5960 |
28267-28272 |
NN |
denotes |
birth |
| T5961 |
28272-28274 |
, |
denotes |
, |
| T5962 |
28274-28283 |
VBN |
denotes |
patterned |
| T5963 |
28284-28294 |
NN |
denotes |
expression |
| T5964 |
28295-28297 |
IN |
denotes |
of |
| T5965 |
28298-28303 |
NN |
denotes |
Tbx15 |
| T5966 |
28304-28307 |
CC |
denotes |
and |
| T5967 |
28308-28314 |
NN |
denotes |
Agouti |
| T5968 |
28319-28327 |
JJ |
denotes |
apparent |
| T5969 |
28328-28332 |
DT |
denotes |
some |
| T5970 |
28333-28335 |
CD |
denotes |
10 |
| T5971 |
28336-28340 |
NNS |
denotes |
days |
| T5972 |
28341-28348 |
RBR |
denotes |
earlier |
| T5973 |
28348-28350 |
, |
denotes |
, |
| T5974 |
28350-28357 |
IN |
denotes |
between |
| T5975 |
28358-28363 |
NN |
denotes |
E12.5 |
| T5976 |
28364-28367 |
CC |
denotes |
and |
| T5977 |
28368-28373 |
NN |
denotes |
E13.5 |
| T5978 |
28373-28375 |
, |
denotes |
, |
| T5979 |
28375-28378 |
CC |
denotes |
and |
| T5980 |
28379-28382 |
DT |
denotes |
the |
| T5981 |
28383-28390 |
NNS |
denotes |
effects |
| T5982 |
28442-28450 |
VBN |
denotes |
detected |
| T5983 |
28391-28393 |
IN |
denotes |
of |
| T5984 |
28394-28399 |
NN |
denotes |
Tbx15 |
| T5985 |
28400-28410 |
NN |
denotes |
deficiency |
| T5986 |
28411-28413 |
IN |
denotes |
on |
| T5987 |
28414-28424 |
NN |
denotes |
expression |
| T5988 |
28425-28427 |
IN |
denotes |
of |
| T5989 |
28428-28434 |
NN |
denotes |
Agouti |
| T5990 |
28435-28438 |
MD |
denotes |
can |
| T5991 |
28439-28441 |
VB |
denotes |
be |
| T5992 |
28451-28453 |
IN |
denotes |
by |
| T5993 |
28454-28459 |
NN |
denotes |
E14.5 |
| T5994 |
28459-28460 |
. |
denotes |
. |
| T6165 |
29089-29101 |
NN |
denotes |
Relationship |
| T6166 |
29102-29104 |
IN |
denotes |
of |
| T6167 |
29105-29114 |
JJ |
denotes |
Embryonic |
| T6168 |
29121-29131 |
NN |
denotes |
Expression |
| T6169 |
29115-29120 |
NN |
denotes |
Tbx15 |
| T6170 |
29132-29134 |
IN |
denotes |
to |
| T6171 |
29135-29141 |
JJ |
denotes |
Dorsal |
| T6172 |
29167-29174 |
NNS |
denotes |
Domains |
| T6173 |
29142-29145 |
CC |
denotes |
and |
| T6174 |
29146-29153 |
JJ |
denotes |
Ventral |
| T6175 |
29154-29166 |
NN |
denotes |
Pigmentation |
| T6176 |
29174-29466 |
sentence |
denotes |
The observations described above are consistent with a model in which transient expression of Tbx15 in the embryonic dorsal flank is required to establish positional identity of the future dermis, at least with respect to pigment-type synthesis caused by the ventral-specific Agouti isoform. |
| T6177 |
29175-29178 |
DT |
denotes |
The |
| T6178 |
29179-29191 |
NNS |
denotes |
observations |
| T6179 |
29208-29211 |
VBP |
denotes |
are |
| T6180 |
29192-29201 |
VBN |
denotes |
described |
| T6181 |
29202-29207 |
RB |
denotes |
above |
| T6182 |
29212-29222 |
JJ |
denotes |
consistent |
| T6183 |
29223-29227 |
IN |
denotes |
with |
| T6184 |
29228-29229 |
DT |
denotes |
a |
| T6185 |
29230-29235 |
NN |
denotes |
model |
| T6186 |
29236-29238 |
IN |
denotes |
in |
| T6187 |
29308-29316 |
VBN |
denotes |
required |
| T6188 |
29239-29244 |
WDT |
denotes |
which |
| T6189 |
29245-29254 |
JJ |
denotes |
transient |
| T6190 |
29255-29265 |
NN |
denotes |
expression |
| T6191 |
29266-29268 |
IN |
denotes |
of |
| T6192 |
29269-29274 |
NN |
denotes |
Tbx15 |
| T6193 |
29275-29277 |
IN |
denotes |
in |
| T6194 |
29278-29281 |
DT |
denotes |
the |
| T6195 |
29299-29304 |
NN |
denotes |
flank |
| T6196 |
29282-29291 |
JJ |
denotes |
embryonic |
| T6197 |
29292-29298 |
JJ |
denotes |
dorsal |
| T6198 |
29305-29307 |
VBZ |
denotes |
is |
| T6199 |
29317-29319 |
TO |
denotes |
to |
| T6200 |
29320-29329 |
VB |
denotes |
establish |
| T6201 |
29330-29340 |
JJ |
denotes |
positional |
| T6202 |
29341-29349 |
NN |
denotes |
identity |
| T6203 |
29350-29352 |
IN |
denotes |
of |
| T6204 |
29353-29356 |
DT |
denotes |
the |
| T6205 |
29364-29370 |
NN |
denotes |
dermis |
| T6206 |
29357-29363 |
JJ |
denotes |
future |
| T6207 |
29370-29372 |
, |
denotes |
, |
| T6208 |
29372-29374 |
RB |
denotes |
at |
| T6209 |
29375-29380 |
RBS |
denotes |
least |
| T6210 |
29381-29385 |
IN |
denotes |
with |
| T6211 |
29386-29393 |
NN |
denotes |
respect |
| T6212 |
29394-29396 |
IN |
denotes |
to |
| T6213 |
29397-29404 |
NN |
denotes |
pigment |
| T6214 |
29405-29409 |
NN |
denotes |
type |
| T6215 |
29404-29405 |
HYPH |
denotes |
- |
| T6216 |
29410-29419 |
NN |
denotes |
synthesis |
| T6217 |
29420-29426 |
VBN |
denotes |
caused |
| T6218 |
29427-29429 |
IN |
denotes |
by |
| T6219 |
29430-29433 |
DT |
denotes |
the |
| T6220 |
29458-29465 |
NN |
denotes |
isoform |
| T6221 |
29434-29441 |
JJ |
denotes |
ventral |
| T6222 |
29442-29450 |
JJ |
denotes |
specific |
| T6223 |
29441-29442 |
HYPH |
denotes |
- |
| T6224 |
29451-29457 |
NN |
denotes |
Agouti |
| T6225 |
29465-29466 |
. |
denotes |
. |
| T6226 |
29466-29636 |
sentence |
denotes |
To further investigate this hypothesis, we carried out transplantation experiments in which pieces of embryonic skin were isolated from different dorsoventral positions. |
| T6227 |
29467-29469 |
TO |
denotes |
To |
| T6228 |
29478-29489 |
VB |
denotes |
investigate |
| T6229 |
29470-29477 |
RB |
denotes |
further |
| T6230 |
29510-29517 |
VBD |
denotes |
carried |
| T6231 |
29490-29494 |
DT |
denotes |
this |
| T6232 |
29495-29505 |
NN |
denotes |
hypothesis |
| T6233 |
29505-29507 |
, |
denotes |
, |
| T6234 |
29507-29509 |
PRP |
denotes |
we |
| T6235 |
29518-29521 |
RP |
denotes |
out |
| T6236 |
29522-29537 |
NN |
denotes |
transplantation |
| T6237 |
29538-29549 |
NNS |
denotes |
experiments |
| T6238 |
29550-29552 |
IN |
denotes |
in |
| T6239 |
29589-29597 |
VBN |
denotes |
isolated |
| T6240 |
29553-29558 |
WDT |
denotes |
which |
| T6241 |
29559-29565 |
NNS |
denotes |
pieces |
| T6242 |
29566-29568 |
IN |
denotes |
of |
| T6243 |
29569-29578 |
JJ |
denotes |
embryonic |
| T6244 |
29579-29583 |
NN |
denotes |
skin |
| T6245 |
29584-29588 |
VBD |
denotes |
were |
| T6246 |
29598-29602 |
IN |
denotes |
from |
| T6247 |
29603-29612 |
JJ |
denotes |
different |
| T6248 |
29626-29635 |
NNS |
denotes |
positions |
| T6249 |
29613-29625 |
JJ |
denotes |
dorsoventral |
| T6250 |
29635-29636 |
. |
denotes |
. |
| T6251 |
29636-29782 |
sentence |
denotes |
We evaluated the embryonic skin fragments for their potential to give rise to different hair colors and for their expression of Tbx15 and Agouti. |
| T6252 |
29637-29639 |
PRP |
denotes |
We |
| T6253 |
29640-29649 |
VBD |
denotes |
evaluated |
| T6254 |
29650-29653 |
DT |
denotes |
the |
| T6255 |
29669-29678 |
NNS |
denotes |
fragments |
| T6256 |
29654-29663 |
JJ |
denotes |
embryonic |
| T6257 |
29664-29668 |
NN |
denotes |
skin |
| T6258 |
29679-29682 |
IN |
denotes |
for |
| T6259 |
29683-29688 |
PRP$ |
denotes |
their |
| T6260 |
29689-29698 |
NN |
denotes |
potential |
| T6261 |
29699-29701 |
TO |
denotes |
to |
| T6262 |
29702-29706 |
VB |
denotes |
give |
| T6263 |
29707-29711 |
NN |
denotes |
rise |
| T6264 |
29712-29714 |
IN |
denotes |
to |
| T6265 |
29715-29724 |
JJ |
denotes |
different |
| T6266 |
29730-29736 |
NNS |
denotes |
colors |
| T6267 |
29725-29729 |
NN |
denotes |
hair |
| T6268 |
29737-29740 |
CC |
denotes |
and |
| T6269 |
29741-29744 |
IN |
denotes |
for |
| T6270 |
29745-29750 |
PRP$ |
denotes |
their |
| T6271 |
29751-29761 |
NN |
denotes |
expression |
| T6272 |
29762-29764 |
IN |
denotes |
of |
| T6273 |
29765-29770 |
NN |
denotes |
Tbx15 |
| T6274 |
29771-29774 |
CC |
denotes |
and |
| T6275 |
29775-29781 |
NN |
denotes |
Agouti |
| T6276 |
29781-29782 |
. |
denotes |
. |
| T6277 |
29782-30037 |
sentence |
denotes |
Previous studies by Silvers and colleagues (Poole and Silvers 1976) showed that dorsal and ventral skin isolated from at/at embryos gives rise to black and yellow hair, respectively, when transplanted into testis and allowed to develop for several weeks. |
| T6278 |
29783-29791 |
JJ |
denotes |
Previous |
| T6279 |
29792-29799 |
NNS |
denotes |
studies |
| T6280 |
29851-29857 |
VBD |
denotes |
showed |
| T6281 |
29800-29802 |
IN |
denotes |
by |
| T6282 |
29803-29810 |
NNP |
denotes |
Silvers |
| T6283 |
29811-29814 |
CC |
denotes |
and |
| T6284 |
29815-29825 |
NNS |
denotes |
colleagues |
| T6285 |
29826-29827 |
-LRB- |
denotes |
( |
| T6286 |
29827-29832 |
NNP |
denotes |
Poole |
| T6287 |
29833-29836 |
CC |
denotes |
and |
| T6288 |
29837-29844 |
NNP |
denotes |
Silvers |
| T6289 |
29845-29849 |
CD |
denotes |
1976 |
| T6290 |
29849-29850 |
-RRB- |
denotes |
) |
| T6291 |
29858-29862 |
IN |
denotes |
that |
| T6292 |
29915-29920 |
VBZ |
denotes |
gives |
| T6293 |
29863-29869 |
JJ |
denotes |
dorsal |
| T6294 |
29882-29886 |
NN |
denotes |
skin |
| T6295 |
29870-29873 |
CC |
denotes |
and |
| T6296 |
29874-29881 |
JJ |
denotes |
ventral |
| T6297 |
29887-29895 |
VBN |
denotes |
isolated |
| T6298 |
29896-29900 |
IN |
denotes |
from |
| T6299 |
29901-29903 |
NN |
denotes |
at |
| T6300 |
29904-29906 |
NN |
denotes |
at |
| T6301 |
29903-29904 |
HYPH |
denotes |
/ |
| T6302 |
29907-29914 |
NNS |
denotes |
embryos |
| T6303 |
29921-29925 |
NN |
denotes |
rise |
| T6304 |
29926-29928 |
IN |
denotes |
to |
| T6305 |
29929-29934 |
JJ |
denotes |
black |
| T6306 |
29946-29950 |
NN |
denotes |
hair |
| T6307 |
29935-29938 |
CC |
denotes |
and |
| T6308 |
29939-29945 |
JJ |
denotes |
yellow |
| T6309 |
29950-29952 |
, |
denotes |
, |
| T6310 |
29952-29964 |
RB |
denotes |
respectively |
| T6311 |
29964-29966 |
, |
denotes |
, |
| T6312 |
29966-29970 |
WRB |
denotes |
when |
| T6313 |
29971-29983 |
VBN |
denotes |
transplanted |
| T6314 |
29984-29988 |
IN |
denotes |
into |
| T6315 |
29989-29995 |
NN |
denotes |
testis |
| T6316 |
29996-29999 |
CC |
denotes |
and |
| T6317 |
30000-30007 |
VBN |
denotes |
allowed |
| T6318 |
30008-30010 |
TO |
denotes |
to |
| T6319 |
30011-30018 |
VB |
denotes |
develop |
| T6320 |
30019-30022 |
IN |
denotes |
for |
| T6321 |
30023-30030 |
JJ |
denotes |
several |
| T6322 |
30031-30036 |
NNS |
denotes |
weeks |
| T6323 |
30036-30037 |
. |
denotes |
. |
| T6324 |
30037-30188 |
sentence |
denotes |
Furthermore, dermal–epidermal recombination experiments carried out at E14.5 demonstrated that positional identity is carried by the embryonic dermis. |
| T6325 |
30038-30049 |
RB |
denotes |
Furthermore |
| T6326 |
30115-30127 |
VBD |
denotes |
demonstrated |
| T6327 |
30049-30051 |
, |
denotes |
, |
| T6328 |
30051-30057 |
JJ |
denotes |
dermal |
| T6329 |
30058-30067 |
JJ |
denotes |
epidermal |
| T6330 |
30057-30058 |
HYPH |
denotes |
– |
| T6331 |
30082-30093 |
NNS |
denotes |
experiments |
| T6332 |
30068-30081 |
NN |
denotes |
recombination |
| T6333 |
30094-30101 |
VBN |
denotes |
carried |
| T6334 |
30102-30105 |
RP |
denotes |
out |
| T6335 |
30106-30108 |
IN |
denotes |
at |
| T6336 |
30109-30114 |
NN |
denotes |
E14.5 |
| T6337 |
30128-30132 |
IN |
denotes |
that |
| T6338 |
30156-30163 |
VBN |
denotes |
carried |
| T6339 |
30133-30143 |
JJ |
denotes |
positional |
| T6340 |
30144-30152 |
NN |
denotes |
identity |
| T6341 |
30153-30155 |
VBZ |
denotes |
is |
| T6342 |
30164-30166 |
IN |
denotes |
by |
| T6343 |
30167-30170 |
DT |
denotes |
the |
| T6344 |
30181-30187 |
NN |
denotes |
dermis |
| T6345 |
30171-30180 |
JJ |
denotes |
embryonic |
| T6346 |
30187-30188 |
. |
denotes |
. |
| T6347 |
30188-30492 |
sentence |
denotes |
In a variation on this experiment, we divided embryonic skin from at/a embryos into dorsal, flank, and ventral pieces and analyzed the different pieces for their ability to give rise to black or yellow hair after testis transplantation, and, in parallel, for gene expression using in situ hybridization. |
| T6348 |
30189-30191 |
IN |
denotes |
In |
| T6349 |
30227-30234 |
VBD |
denotes |
divided |
| T6350 |
30192-30193 |
DT |
denotes |
a |
| T6351 |
30194-30203 |
NN |
denotes |
variation |
| T6352 |
30204-30206 |
IN |
denotes |
on |
| T6353 |
30207-30211 |
DT |
denotes |
this |
| T6354 |
30212-30222 |
NN |
denotes |
experiment |
| T6355 |
30222-30224 |
, |
denotes |
, |
| T6356 |
30224-30226 |
PRP |
denotes |
we |
| T6357 |
30235-30244 |
JJ |
denotes |
embryonic |
| T6358 |
30245-30249 |
NN |
denotes |
skin |
| T6359 |
30250-30254 |
IN |
denotes |
from |
| T6360 |
30255-30257 |
NN |
denotes |
at |
| T6361 |
30258-30259 |
NN |
denotes |
a |
| T6362 |
30257-30258 |
HYPH |
denotes |
/ |
| T6363 |
30260-30267 |
NNS |
denotes |
embryos |
| T6364 |
30268-30272 |
IN |
denotes |
into |
| T6365 |
30273-30279 |
JJ |
denotes |
dorsal |
| T6366 |
30300-30306 |
NNS |
denotes |
pieces |
| T6367 |
30279-30281 |
, |
denotes |
, |
| T6368 |
30281-30286 |
NN |
denotes |
flank |
| T6369 |
30286-30288 |
, |
denotes |
, |
| T6370 |
30288-30291 |
CC |
denotes |
and |
| T6371 |
30292-30299 |
JJ |
denotes |
ventral |
| T6372 |
30307-30310 |
CC |
denotes |
and |
| T6373 |
30311-30319 |
VBD |
denotes |
analyzed |
| T6374 |
30320-30323 |
DT |
denotes |
the |
| T6375 |
30334-30340 |
NNS |
denotes |
pieces |
| T6376 |
30324-30333 |
JJ |
denotes |
different |
| T6377 |
30341-30344 |
IN |
denotes |
for |
| T6378 |
30345-30350 |
PRP$ |
denotes |
their |
| T6379 |
30351-30358 |
NN |
denotes |
ability |
| T6380 |
30359-30361 |
TO |
denotes |
to |
| T6381 |
30362-30366 |
VB |
denotes |
give |
| T6382 |
30367-30371 |
NN |
denotes |
rise |
| T6383 |
30372-30374 |
IN |
denotes |
to |
| T6384 |
30375-30380 |
JJ |
denotes |
black |
| T6385 |
30391-30395 |
NN |
denotes |
hair |
| T6386 |
30381-30383 |
CC |
denotes |
or |
| T6387 |
30384-30390 |
JJ |
denotes |
yellow |
| T6388 |
30396-30401 |
IN |
denotes |
after |
| T6389 |
30402-30408 |
NN |
denotes |
testis |
| T6390 |
30409-30424 |
NN |
denotes |
transplantation |
| T6391 |
30424-30426 |
, |
denotes |
, |
| T6392 |
30426-30429 |
CC |
denotes |
and |
| T6393 |
30429-30431 |
, |
denotes |
, |
| T6394 |
30444-30447 |
IN |
denotes |
for |
| T6395 |
30431-30433 |
IN |
denotes |
in |
| T6396 |
30434-30442 |
NN |
denotes |
parallel |
| T6397 |
30442-30444 |
, |
denotes |
, |
| T6398 |
30448-30452 |
NN |
denotes |
gene |
| T6399 |
30453-30463 |
NN |
denotes |
expression |
| T6400 |
30464-30469 |
VBG |
denotes |
using |
| T6401 |
30470-30472 |
FW |
denotes |
in |
| T6402 |
30473-30477 |
FW |
denotes |
situ |
| T6403 |
30478-30491 |
NN |
denotes |
hybridization |
| T6404 |
30491-30492 |
. |
denotes |
. |
| T6405 |
30492-30885 |
sentence |
denotes |
For the purposes of a reproducible morphologic boundary, we divided flank from ventral skin based on a change in skin thickness and divided dorsal from flank skin at the level of an ectodermal notch that lies at the same level as the ventral extent of the myotome (Figure 7) (Huang and Christ 2000; Olivera-Martinez et al. 2000; Sudo et al. 2001; Burke and Nowicki 2003; Nowicki et al. 2003). |
| T6406 |
30493-30496 |
IN |
denotes |
For |
| T6407 |
30553-30560 |
VBD |
denotes |
divided |
| T6408 |
30497-30500 |
DT |
denotes |
the |
| T6409 |
30501-30509 |
NNS |
denotes |
purposes |
| T6410 |
30510-30512 |
IN |
denotes |
of |
| T6411 |
30513-30514 |
DT |
denotes |
a |
| T6412 |
30540-30548 |
NN |
denotes |
boundary |
| T6413 |
30515-30527 |
JJ |
denotes |
reproducible |
| T6414 |
30528-30539 |
JJ |
denotes |
morphologic |
| T6415 |
30548-30550 |
, |
denotes |
, |
| T6416 |
30550-30552 |
PRP |
denotes |
we |
| T6417 |
30561-30566 |
NN |
denotes |
flank |
| T6418 |
30567-30571 |
IN |
denotes |
from |
| T6419 |
30572-30579 |
JJ |
denotes |
ventral |
| T6420 |
30580-30584 |
NN |
denotes |
skin |
| T6421 |
30585-30590 |
VBN |
denotes |
based |
| T6422 |
30591-30593 |
IN |
denotes |
on |
| T6423 |
30594-30595 |
DT |
denotes |
a |
| T6424 |
30596-30602 |
NN |
denotes |
change |
| T6425 |
30603-30605 |
IN |
denotes |
in |
| T6426 |
30606-30610 |
NN |
denotes |
skin |
| T6427 |
30611-30620 |
NN |
denotes |
thickness |
| T6428 |
30621-30624 |
CC |
denotes |
and |
| T6429 |
30625-30632 |
VBN |
denotes |
divided |
| T6430 |
30633-30639 |
JJ |
denotes |
dorsal |
| T6431 |
30640-30644 |
IN |
denotes |
from |
| T6432 |
30645-30650 |
NN |
denotes |
flank |
| T6433 |
30651-30655 |
NN |
denotes |
skin |
| T6434 |
30656-30658 |
IN |
denotes |
at |
| T6435 |
30659-30662 |
DT |
denotes |
the |
| T6436 |
30663-30668 |
NN |
denotes |
level |
| T6437 |
30669-30671 |
IN |
denotes |
of |
| T6438 |
30672-30674 |
DT |
denotes |
an |
| T6439 |
30686-30691 |
NN |
denotes |
notch |
| T6440 |
30675-30685 |
JJ |
denotes |
ectodermal |
| T6441 |
30692-30696 |
WDT |
denotes |
that |
| T6442 |
30697-30701 |
VBZ |
denotes |
lies |
| T6443 |
30702-30704 |
IN |
denotes |
at |
| T6444 |
30705-30708 |
DT |
denotes |
the |
| T6445 |
30714-30719 |
NN |
denotes |
level |
| T6446 |
30709-30713 |
JJ |
denotes |
same |
| T6447 |
30720-30722 |
IN |
denotes |
as |
| T6448 |
30723-30726 |
DT |
denotes |
the |
| T6449 |
30735-30741 |
NN |
denotes |
extent |
| T6450 |
30727-30734 |
JJ |
denotes |
ventral |
| T6451 |
30742-30744 |
IN |
denotes |
of |
| T6452 |
30745-30748 |
DT |
denotes |
the |
| T6453 |
30749-30756 |
NN |
denotes |
myotome |
| T6454 |
30757-30758 |
-LRB- |
denotes |
( |
| T6455 |
30758-30764 |
NN |
denotes |
Figure |
| T6456 |
30765-30766 |
CD |
denotes |
7 |
| T6457 |
30766-30767 |
-RRB- |
denotes |
) |
| T6458 |
30768-30769 |
-LRB- |
denotes |
( |
| T6459 |
30769-30774 |
NNP |
denotes |
Huang |
| T6460 |
30775-30778 |
CC |
denotes |
and |
| T6461 |
30779-30785 |
NNP |
denotes |
Christ |
| T6462 |
30786-30790 |
CD |
denotes |
2000 |
| T6463 |
30790-30791 |
: |
denotes |
; |
| T6464 |
30792-30799 |
NNP |
denotes |
Olivera |
| T6465 |
30799-30800 |
HYPH |
denotes |
- |
| T6466 |
30800-30808 |
NNP |
denotes |
Martinez |
| T6467 |
30809-30811 |
FW |
denotes |
et |
| T6468 |
30812-30815 |
FW |
denotes |
al. |
| T6469 |
30816-30820 |
CD |
denotes |
2000 |
| T6470 |
30820-30821 |
: |
denotes |
; |
| T6471 |
30822-30826 |
NNP |
denotes |
Sudo |
| T6472 |
30827-30829 |
FW |
denotes |
et |
| T6473 |
30830-30833 |
FW |
denotes |
al. |
| T6474 |
30834-30838 |
CD |
denotes |
2001 |
| T6475 |
30838-30839 |
: |
denotes |
; |
| T6476 |
30840-30845 |
NNP |
denotes |
Burke |
| T6477 |
30846-30849 |
CC |
denotes |
and |
| T6478 |
30850-30857 |
NNP |
denotes |
Nowicki |
| T6479 |
30858-30862 |
CD |
denotes |
2003 |
| T6480 |
30862-30863 |
: |
denotes |
; |
| T6481 |
30864-30871 |
NNP |
denotes |
Nowicki |
| T6482 |
30872-30874 |
FW |
denotes |
et |
| T6483 |
30875-30878 |
FW |
denotes |
al. |
| T6484 |
30879-30883 |
CD |
denotes |
2003 |
| T6485 |
30883-30884 |
-RRB- |
denotes |
) |
| T6486 |
30884-30885 |
. |
denotes |
. |
| T6487 |
30885-31727 |
sentence |
denotes |
Figure 7 Embryonic Establishment of Dorsoventral Skin Patterning
Pieces of skin from dorsal, flank, and ventral regions of at/a E12.5 embryos were transplanted into the testes of congenic animals as described in the text. Hair color of the grafts was examined 3 wk later. Grafts of ventral embryonic skin (n = 3) produced yellow hairs, dorsal embryonic skin (n = 4) produced black hairs, and flank embryonic skin produced mostly (13 out of 15) black and yellow hairs in distinct regions as shown. In parallel, in situ hybridization studies revealed that the embryonic flank contains the boundary of expression between Agouti and Tbx15 (scale bars = 1 mm for hairs and 200 μm for in situ hybridization results). We found that E12.5 is the earliest time at which embryonic ventral skin is able to produce hair when transplanted to the testis. |
| T6488 |
31598-31600 |
PRP |
denotes |
We |
| T6489 |
31601-31606 |
VBD |
denotes |
found |
| T6490 |
31607-31611 |
IN |
denotes |
that |
| T6491 |
31618-31620 |
VBZ |
denotes |
is |
| T6492 |
31612-31617 |
NN |
denotes |
E12.5 |
| T6493 |
31621-31624 |
DT |
denotes |
the |
| T6494 |
31634-31638 |
NN |
denotes |
time |
| T6495 |
31625-31633 |
JJS |
denotes |
earliest |
| T6496 |
31639-31641 |
IN |
denotes |
at |
| T6497 |
31671-31673 |
VBZ |
denotes |
is |
| T6498 |
31642-31647 |
WDT |
denotes |
which |
| T6499 |
31648-31657 |
JJ |
denotes |
embryonic |
| T6500 |
31666-31670 |
NN |
denotes |
skin |
| T6501 |
31658-31665 |
JJ |
denotes |
ventral |
| T6502 |
31674-31678 |
JJ |
denotes |
able |
| T6503 |
31679-31681 |
TO |
denotes |
to |
| T6504 |
31682-31689 |
VB |
denotes |
produce |
| T6505 |
31690-31694 |
NN |
denotes |
hair |
| T6506 |
31695-31699 |
WRB |
denotes |
when |
| T6507 |
31700-31712 |
VBN |
denotes |
transplanted |
| T6508 |
31713-31715 |
IN |
denotes |
to |
| T6509 |
31716-31719 |
DT |
denotes |
the |
| T6510 |
31720-31726 |
NN |
denotes |
testis |
| T6511 |
31726-31727 |
. |
denotes |
. |
| T6512 |
31727-31857 |
sentence |
denotes |
Of the grafts that produced hair, ventral skin gave rise to yellow hair (n = 3), and dorsal skin gave rise to black hair (n = 4). |
| T6513 |
31728-31730 |
IN |
denotes |
Of |
| T6514 |
31775-31779 |
VBD |
denotes |
gave |
| T6515 |
31731-31734 |
DT |
denotes |
the |
| T6516 |
31735-31741 |
NNS |
denotes |
grafts |
| T6517 |
31742-31746 |
WDT |
denotes |
that |
| T6518 |
31747-31755 |
VBD |
denotes |
produced |
| T6519 |
31756-31760 |
NN |
denotes |
hair |
| T6520 |
31760-31762 |
, |
denotes |
, |
| T6521 |
31762-31769 |
JJ |
denotes |
ventral |
| T6522 |
31770-31774 |
NN |
denotes |
skin |
| T6523 |
31780-31784 |
NN |
denotes |
rise |
| T6524 |
31785-31787 |
IN |
denotes |
to |
| T6525 |
31788-31794 |
JJ |
denotes |
yellow |
| T6526 |
31795-31799 |
NN |
denotes |
hair |
| T6527 |
31800-31801 |
-LRB- |
denotes |
( |
| T6528 |
31805-31806 |
CD |
denotes |
3 |
| T6529 |
31801-31802 |
NN |
denotes |
n |
| T6530 |
31803-31804 |
SYM |
denotes |
= |
| T6531 |
31806-31807 |
-RRB- |
denotes |
) |
| T6532 |
31807-31809 |
, |
denotes |
, |
| T6533 |
31809-31812 |
CC |
denotes |
and |
| T6534 |
31813-31819 |
JJ |
denotes |
dorsal |
| T6535 |
31820-31824 |
NN |
denotes |
skin |
| T6536 |
31825-31829 |
VBD |
denotes |
gave |
| T6537 |
31830-31834 |
NN |
denotes |
rise |
| T6538 |
31835-31837 |
IN |
denotes |
to |
| T6539 |
31838-31843 |
JJ |
denotes |
black |
| T6540 |
31844-31848 |
NN |
denotes |
hair |
| T6541 |
31849-31850 |
-LRB- |
denotes |
( |
| T6542 |
31854-31855 |
CD |
denotes |
4 |
| T6543 |
31850-31851 |
NN |
denotes |
n |
| T6544 |
31852-31853 |
SYM |
denotes |
= |
| T6545 |
31855-31856 |
-RRB- |
denotes |
) |
| T6546 |
31856-31857 |
. |
denotes |
. |
| T6547 |
31857-32075 |
sentence |
denotes |
Transplantation of flank skin gave rise to a patch of yellow hair juxtaposed against a patch of black hair in 85% of the successful grafts (n = 13); the remaining two flank grafts produced solely black or yellow hair. |
| T6548 |
31858-31873 |
NN |
denotes |
Transplantation |
| T6549 |
31888-31892 |
VBD |
denotes |
gave |
| T6550 |
31874-31876 |
IN |
denotes |
of |
| T6551 |
31877-31882 |
NN |
denotes |
flank |
| T6552 |
31883-31887 |
NN |
denotes |
skin |
| T6553 |
32038-32046 |
VBD |
denotes |
produced |
| T6554 |
31893-31897 |
NN |
denotes |
rise |
| T6555 |
31898-31900 |
IN |
denotes |
to |
| T6556 |
31901-31902 |
DT |
denotes |
a |
| T6557 |
31903-31908 |
NN |
denotes |
patch |
| T6558 |
31909-31911 |
IN |
denotes |
of |
| T6559 |
31912-31918 |
JJ |
denotes |
yellow |
| T6560 |
31919-31923 |
NN |
denotes |
hair |
| T6561 |
31924-31934 |
VBN |
denotes |
juxtaposed |
| T6562 |
31935-31942 |
IN |
denotes |
against |
| T6563 |
31943-31944 |
DT |
denotes |
a |
| T6564 |
31945-31950 |
NN |
denotes |
patch |
| T6565 |
31951-31953 |
IN |
denotes |
of |
| T6566 |
31954-31959 |
JJ |
denotes |
black |
| T6567 |
31960-31964 |
NN |
denotes |
hair |
| T6568 |
31965-31967 |
IN |
denotes |
in |
| T6569 |
31968-31970 |
CD |
denotes |
85 |
| T6570 |
31970-31971 |
NN |
denotes |
% |
| T6571 |
31972-31974 |
IN |
denotes |
of |
| T6572 |
31975-31978 |
DT |
denotes |
the |
| T6573 |
31990-31996 |
NNS |
denotes |
grafts |
| T6574 |
31979-31989 |
JJ |
denotes |
successful |
| T6575 |
31997-31998 |
-LRB- |
denotes |
( |
| T6576 |
32002-32004 |
CD |
denotes |
13 |
| T6577 |
31998-31999 |
NN |
denotes |
n |
| T6578 |
32000-32001 |
SYM |
denotes |
= |
| T6579 |
32004-32005 |
-RRB- |
denotes |
) |
| T6580 |
32005-32006 |
: |
denotes |
; |
| T6581 |
32007-32010 |
DT |
denotes |
the |
| T6582 |
32031-32037 |
NNS |
denotes |
grafts |
| T6583 |
32011-32020 |
VBG |
denotes |
remaining |
| T6584 |
32021-32024 |
CD |
denotes |
two |
| T6585 |
32025-32030 |
NN |
denotes |
flank |
| T6586 |
32047-32053 |
RB |
denotes |
solely |
| T6587 |
32054-32059 |
JJ |
denotes |
black |
| T6588 |
32070-32074 |
NN |
denotes |
hair |
| T6589 |
32060-32062 |
CC |
denotes |
or |
| T6590 |
32063-32069 |
JJ |
denotes |
yellow |
| T6591 |
32074-32075 |
. |
denotes |
. |
| T6592 |
32075-32142 |
sentence |
denotes |
In no case did we observe intermingling of black and yellow hairs. |
| T6593 |
32076-32078 |
IN |
denotes |
In |
| T6594 |
32094-32101 |
VBP |
denotes |
observe |
| T6595 |
32079-32081 |
DT |
denotes |
no |
| T6596 |
32082-32086 |
NN |
denotes |
case |
| T6597 |
32087-32090 |
VBD |
denotes |
did |
| T6598 |
32091-32093 |
PRP |
denotes |
we |
| T6599 |
32102-32115 |
VBG |
denotes |
intermingling |
| T6600 |
32116-32118 |
IN |
denotes |
of |
| T6601 |
32119-32124 |
JJ |
denotes |
black |
| T6602 |
32136-32141 |
NNS |
denotes |
hairs |
| T6603 |
32125-32128 |
CC |
denotes |
and |
| T6604 |
32129-32135 |
JJ |
denotes |
yellow |
| T6605 |
32141-32142 |
. |
denotes |
. |
| T6606 |
32142-32323 |
sentence |
denotes |
As predicted from the experiments using tissue sections (see Figures 5 and 6), dorsal pieces expressed Tbx15 but not Agouti, while flank pieces expressed both genes (see Figure 7). |
| T6607 |
32143-32145 |
IN |
denotes |
As |
| T6608 |
32146-32155 |
VBN |
denotes |
predicted |
| T6609 |
32236-32245 |
VBD |
denotes |
expressed |
| T6610 |
32156-32160 |
IN |
denotes |
from |
| T6611 |
32161-32164 |
DT |
denotes |
the |
| T6612 |
32165-32176 |
NNS |
denotes |
experiments |
| T6613 |
32177-32182 |
VBG |
denotes |
using |
| T6614 |
32183-32189 |
NN |
denotes |
tissue |
| T6615 |
32190-32198 |
NNS |
denotes |
sections |
| T6616 |
32199-32200 |
-LRB- |
denotes |
( |
| T6617 |
32200-32203 |
VB |
denotes |
see |
| T6618 |
32204-32211 |
NNS |
denotes |
Figures |
| T6619 |
32212-32213 |
CD |
denotes |
5 |
| T6620 |
32214-32217 |
CC |
denotes |
and |
| T6621 |
32218-32219 |
CD |
denotes |
6 |
| T6622 |
32219-32220 |
-RRB- |
denotes |
) |
| T6623 |
32220-32222 |
, |
denotes |
, |
| T6624 |
32222-32228 |
JJ |
denotes |
dorsal |
| T6625 |
32229-32235 |
NNS |
denotes |
pieces |
| T6626 |
32246-32251 |
NN |
denotes |
Tbx15 |
| T6627 |
32252-32255 |
CC |
denotes |
but |
| T6628 |
32256-32259 |
RB |
denotes |
not |
| T6629 |
32260-32266 |
NN |
denotes |
Agouti |
| T6630 |
32266-32268 |
, |
denotes |
, |
| T6631 |
32268-32273 |
IN |
denotes |
while |
| T6632 |
32287-32296 |
VBD |
denotes |
expressed |
| T6633 |
32274-32279 |
NN |
denotes |
flank |
| T6634 |
32280-32286 |
NNS |
denotes |
pieces |
| T6635 |
32297-32301 |
DT |
denotes |
both |
| T6636 |
32302-32307 |
NNS |
denotes |
genes |
| T6637 |
32308-32309 |
-LRB- |
denotes |
( |
| T6638 |
32309-32312 |
VB |
denotes |
see |
| T6639 |
32313-32319 |
NN |
denotes |
Figure |
| T6640 |
32320-32321 |
CD |
denotes |
7 |
| T6641 |
32321-32322 |
-RRB- |
denotes |
) |
| T6642 |
32322-32323 |
. |
denotes |
. |
| T6643 |
32323-32656 |
sentence |
denotes |
Thus, dorsoventral identity for adult pigmentation is established by the time when patterned expression becomes apparent for Tbx15 and Agouti (E11.5–E12.5); furthermore, positional identity is maintained throughout later stages of skin development, even though expression of Tbx15 broadens to include ventral as well as dorsal skin. |
| T6644 |
32324-32328 |
RB |
denotes |
Thus |
| T6645 |
32378-32389 |
VBN |
denotes |
established |
| T6646 |
32328-32330 |
, |
denotes |
, |
| T6647 |
32330-32342 |
JJ |
denotes |
dorsoventral |
| T6648 |
32343-32351 |
NN |
denotes |
identity |
| T6649 |
32352-32355 |
IN |
denotes |
for |
| T6650 |
32356-32361 |
JJ |
denotes |
adult |
| T6651 |
32362-32374 |
NN |
denotes |
pigmentation |
| T6652 |
32375-32377 |
VBZ |
denotes |
is |
| T6653 |
32517-32527 |
VBN |
denotes |
maintained |
| T6654 |
32390-32392 |
IN |
denotes |
by |
| T6655 |
32393-32396 |
DT |
denotes |
the |
| T6656 |
32397-32401 |
NN |
denotes |
time |
| T6657 |
32402-32406 |
WRB |
denotes |
when |
| T6658 |
32428-32435 |
VBZ |
denotes |
becomes |
| T6659 |
32407-32416 |
VBN |
denotes |
patterned |
| T6660 |
32417-32427 |
NN |
denotes |
expression |
| T6661 |
32436-32444 |
JJ |
denotes |
apparent |
| T6662 |
32445-32448 |
IN |
denotes |
for |
| T6663 |
32449-32454 |
NN |
denotes |
Tbx15 |
| T6664 |
32455-32458 |
CC |
denotes |
and |
| T6665 |
32459-32465 |
NN |
denotes |
Agouti |
| T6666 |
32466-32467 |
-LRB- |
denotes |
( |
| T6667 |
32467-32472 |
NN |
denotes |
E11.5 |
| T6668 |
32472-32473 |
SYM |
denotes |
– |
| T6669 |
32473-32478 |
NN |
denotes |
E12.5 |
| T6670 |
32478-32479 |
-RRB- |
denotes |
) |
| T6671 |
32479-32480 |
: |
denotes |
; |
| T6672 |
32481-32492 |
RB |
denotes |
furthermore |
| T6673 |
32492-32494 |
, |
denotes |
, |
| T6674 |
32494-32504 |
JJ |
denotes |
positional |
| T6675 |
32505-32513 |
NN |
denotes |
identity |
| T6676 |
32514-32516 |
VBZ |
denotes |
is |
| T6677 |
32528-32538 |
IN |
denotes |
throughout |
| T6678 |
32539-32544 |
JJ |
denotes |
later |
| T6679 |
32545-32551 |
NNS |
denotes |
stages |
| T6680 |
32552-32554 |
IN |
denotes |
of |
| T6681 |
32555-32559 |
NN |
denotes |
skin |
| T6682 |
32560-32571 |
NN |
denotes |
development |
| T6683 |
32571-32573 |
, |
denotes |
, |
| T6684 |
32573-32577 |
RB |
denotes |
even |
| T6685 |
32605-32613 |
VBZ |
denotes |
broadens |
| T6686 |
32578-32584 |
IN |
denotes |
though |
| T6687 |
32585-32595 |
NN |
denotes |
expression |
| T6688 |
32596-32598 |
IN |
denotes |
of |
| T6689 |
32599-32604 |
NN |
denotes |
Tbx15 |
| T6690 |
32614-32616 |
TO |
denotes |
to |
| T6691 |
32617-32624 |
VB |
denotes |
include |
| T6692 |
32625-32632 |
JJ |
denotes |
ventral |
| T6693 |
32651-32655 |
NN |
denotes |
skin |
| T6694 |
32633-32635 |
RB |
denotes |
as |
| T6695 |
32641-32643 |
IN |
denotes |
as |
| T6696 |
32636-32640 |
RB |
denotes |
well |
| T6697 |
32644-32650 |
JJ |
denotes |
dorsal |
| T6698 |
32655-32656 |
. |
denotes |
. |
| T6883 |
32658-32670 |
NN |
denotes |
Relationship |
| T6884 |
32671-32673 |
IN |
denotes |
of |
| T6885 |
32674-32677 |
DT |
denotes |
the |
| T6886 |
32699-32707 |
NN |
denotes |
Boundary |
| T6887 |
32678-32690 |
JJ |
denotes |
Dorsoventral |
| T6888 |
32691-32698 |
NN |
denotes |
Pigment |
| T6889 |
32708-32710 |
IN |
denotes |
to |
| T6890 |
32711-32718 |
NN |
denotes |
Lineage |
| T6891 |
32719-32731 |
NNS |
denotes |
Compartments |
| T6892 |
32732-32735 |
CC |
denotes |
and |
| T6893 |
32736-32739 |
DT |
denotes |
the |
| T6894 |
32756-32764 |
NN |
denotes |
Frontier |
| T6895 |
32740-32747 |
JJ |
denotes |
Lateral |
| T6896 |
32748-32755 |
JJ |
denotes |
Somitic |
| T6897 |
32764-32915 |
sentence |
denotes |
The ectodermal notch that we used to mark the boundary between embryonic dorsum and embryonic flank is a characteristic feature in vertebrate embryos. |
| T6898 |
32765-32768 |
DT |
denotes |
The |
| T6899 |
32780-32785 |
NN |
denotes |
notch |
| T6900 |
32769-32779 |
JJ |
denotes |
ectodermal |
| T6901 |
32865-32867 |
VBZ |
denotes |
is |
| T6902 |
32786-32790 |
WDT |
denotes |
that |
| T6903 |
32794-32798 |
VBD |
denotes |
used |
| T6904 |
32791-32793 |
PRP |
denotes |
we |
| T6905 |
32799-32801 |
TO |
denotes |
to |
| T6906 |
32802-32806 |
VB |
denotes |
mark |
| T6907 |
32807-32810 |
DT |
denotes |
the |
| T6908 |
32811-32819 |
NN |
denotes |
boundary |
| T6909 |
32820-32827 |
IN |
denotes |
between |
| T6910 |
32828-32837 |
JJ |
denotes |
embryonic |
| T6911 |
32838-32844 |
NN |
denotes |
dorsum |
| T6912 |
32845-32848 |
CC |
denotes |
and |
| T6913 |
32849-32858 |
JJ |
denotes |
embryonic |
| T6914 |
32859-32864 |
NN |
denotes |
flank |
| T6915 |
32868-32869 |
DT |
denotes |
a |
| T6916 |
32885-32892 |
NN |
denotes |
feature |
| T6917 |
32870-32884 |
JJ |
denotes |
characteristic |
| T6918 |
32893-32895 |
IN |
denotes |
in |
| T6919 |
32896-32906 |
NN |
denotes |
vertebrate |
| T6920 |
32907-32914 |
NNS |
denotes |
embryos |
| T6921 |
32914-32915 |
. |
denotes |
. |
| T6922 |
32915-33258 |
sentence |
denotes |
In cell lineage studies carried out in the chick system, the notch serves as a landmark for the boundary between dermis derived from somitic mesoderm and dermis derived from lateral plate mesoderm and has been termed the “lateral somitic frontier” (Olivera-Martinez et al. 2000; Sudo et al. 2001; Burke and Nowicki 2003; Nowicki et al. 2003). |
| T6923 |
32916-32918 |
IN |
denotes |
In |
| T6924 |
32983-32989 |
VBZ |
denotes |
serves |
| T6925 |
32919-32923 |
NN |
denotes |
cell |
| T6926 |
32932-32939 |
NNS |
denotes |
studies |
| T6927 |
32924-32931 |
NN |
denotes |
lineage |
| T6928 |
32940-32947 |
VBN |
denotes |
carried |
| T6929 |
32948-32951 |
RP |
denotes |
out |
| T6930 |
32952-32954 |
IN |
denotes |
in |
| T6931 |
32955-32958 |
DT |
denotes |
the |
| T6932 |
32965-32971 |
NN |
denotes |
system |
| T6933 |
32959-32964 |
NN |
denotes |
chick |
| T6934 |
32971-32973 |
, |
denotes |
, |
| T6935 |
32973-32976 |
DT |
denotes |
the |
| T6936 |
32977-32982 |
NN |
denotes |
notch |
| T6937 |
32990-32992 |
IN |
denotes |
as |
| T6938 |
32993-32994 |
DT |
denotes |
a |
| T6939 |
32995-33003 |
NN |
denotes |
landmark |
| T6940 |
33004-33007 |
IN |
denotes |
for |
| T6941 |
33008-33011 |
DT |
denotes |
the |
| T6942 |
33012-33020 |
NN |
denotes |
boundary |
| T6943 |
33021-33028 |
IN |
denotes |
between |
| T6944 |
33029-33035 |
NN |
denotes |
dermis |
| T6945 |
33036-33043 |
VBN |
denotes |
derived |
| T6946 |
33044-33048 |
IN |
denotes |
from |
| T6947 |
33049-33056 |
JJ |
denotes |
somitic |
| T6948 |
33057-33065 |
NN |
denotes |
mesoderm |
| T6949 |
33066-33069 |
CC |
denotes |
and |
| T6950 |
33070-33076 |
NN |
denotes |
dermis |
| T6951 |
33077-33084 |
VBN |
denotes |
derived |
| T6952 |
33085-33089 |
IN |
denotes |
from |
| T6953 |
33090-33097 |
JJ |
denotes |
lateral |
| T6954 |
33098-33103 |
NN |
denotes |
plate |
| T6955 |
33104-33112 |
NN |
denotes |
mesoderm |
| T6956 |
33113-33116 |
CC |
denotes |
and |
| T6957 |
33117-33120 |
VBZ |
denotes |
has |
| T6958 |
33126-33132 |
VBN |
denotes |
termed |
| T6959 |
33121-33125 |
VBN |
denotes |
been |
| T6960 |
33133-33136 |
DT |
denotes |
the |
| T6961 |
33154-33162 |
NN |
denotes |
frontier |
| T6962 |
33137-33138 |
`` |
denotes |
“ |
| T6963 |
33138-33145 |
JJ |
denotes |
lateral |
| T6964 |
33146-33153 |
JJ |
denotes |
somitic |
| T6965 |
33162-33163 |
'' |
denotes |
” |
| T6966 |
33164-33165 |
-LRB- |
denotes |
( |
| T6967 |
33165-33172 |
NNP |
denotes |
Olivera |
| T6968 |
33172-33173 |
HYPH |
denotes |
- |
| T6969 |
33173-33181 |
NNP |
denotes |
Martinez |
| T6970 |
33182-33184 |
FW |
denotes |
et |
| T6971 |
33185-33188 |
FW |
denotes |
al. |
| T6972 |
33189-33193 |
CD |
denotes |
2000 |
| T6973 |
33193-33194 |
: |
denotes |
; |
| T6974 |
33195-33199 |
NNP |
denotes |
Sudo |
| T6975 |
33200-33202 |
FW |
denotes |
et |
| T6976 |
33203-33206 |
FW |
denotes |
al. |
| T6977 |
33207-33211 |
CD |
denotes |
2001 |
| T6978 |
33211-33212 |
: |
denotes |
; |
| T6979 |
33213-33218 |
NNP |
denotes |
Burke |
| T6980 |
33219-33222 |
CC |
denotes |
and |
| T6981 |
33223-33230 |
NNP |
denotes |
Nowicki |
| T6982 |
33231-33235 |
CD |
denotes |
2003 |
| T6983 |
33235-33236 |
: |
denotes |
; |
| T6984 |
33237-33244 |
NNP |
denotes |
Nowicki |
| T6985 |
33245-33247 |
FW |
denotes |
et |
| T6986 |
33248-33251 |
FW |
denotes |
al. |
| T6987 |
33252-33256 |
CD |
denotes |
2003 |
| T6988 |
33256-33257 |
-RRB- |
denotes |
) |
| T6989 |
33257-33258 |
. |
denotes |
. |
| T6990 |
33258-33485 |
sentence |
denotes |
Although fate-mapping studies have not been carried out in mammalian embryos, somite- and lateral plate-derived mesoderm could give rise to precursors for dermis dorsal and ventral to the limb–body wall junction, respectively. |
| T6991 |
33259-33267 |
IN |
denotes |
Although |
| T6992 |
33303-33310 |
VBN |
denotes |
carried |
| T6993 |
33268-33272 |
NN |
denotes |
fate |
| T6994 |
33273-33280 |
VBG |
denotes |
mapping |
| T6995 |
33272-33273 |
HYPH |
denotes |
- |
| T6996 |
33281-33288 |
NNS |
denotes |
studies |
| T6997 |
33289-33293 |
VBP |
denotes |
have |
| T6998 |
33294-33297 |
RB |
denotes |
not |
| T6999 |
33298-33302 |
VBN |
denotes |
been |
| T7000 |
33386-33390 |
VB |
denotes |
give |
| T7001 |
33311-33314 |
RP |
denotes |
out |
| T7002 |
33315-33317 |
IN |
denotes |
in |
| T7003 |
33318-33327 |
JJ |
denotes |
mammalian |
| T7004 |
33328-33335 |
NNS |
denotes |
embryos |
| T7005 |
33335-33337 |
, |
denotes |
, |
| T7006 |
33337-33343 |
NN |
denotes |
somite |
| T7007 |
33363-33370 |
VBN |
denotes |
derived |
| T7008 |
33343-33344 |
HYPH |
denotes |
- |
| T7009 |
33345-33348 |
CC |
denotes |
and |
| T7010 |
33349-33356 |
JJ |
denotes |
lateral |
| T7011 |
33357-33362 |
NN |
denotes |
plate |
| T7012 |
33362-33363 |
HYPH |
denotes |
- |
| T7013 |
33371-33379 |
NN |
denotes |
mesoderm |
| T7014 |
33380-33385 |
MD |
denotes |
could |
| T7015 |
33391-33395 |
NN |
denotes |
rise |
| T7016 |
33396-33398 |
IN |
denotes |
to |
| T7017 |
33399-33409 |
NNS |
denotes |
precursors |
| T7018 |
33410-33413 |
IN |
denotes |
for |
| T7019 |
33414-33420 |
NN |
denotes |
dermis |
| T7020 |
33421-33427 |
JJ |
denotes |
dorsal |
| T7021 |
33428-33431 |
CC |
denotes |
and |
| T7022 |
33432-33439 |
JJ |
denotes |
ventral |
| T7023 |
33440-33442 |
IN |
denotes |
to |
| T7024 |
33443-33446 |
DT |
denotes |
the |
| T7025 |
33462-33470 |
NN |
denotes |
junction |
| T7026 |
33447-33451 |
NN |
denotes |
limb |
| T7027 |
33451-33452 |
HYPH |
denotes |
– |
| T7028 |
33452-33456 |
NN |
denotes |
body |
| T7029 |
33457-33461 |
NN |
denotes |
wall |
| T7030 |
33470-33472 |
, |
denotes |
, |
| T7031 |
33472-33484 |
RB |
denotes |
respectively |
| T7032 |
33484-33485 |
. |
denotes |
. |
| T7033 |
33485-33628 |
sentence |
denotes |
However, this notion conflicts with our observation that the future pigmentation boundary lies ventral to the ectodermal notch (see Figure 7). |
| T7034 |
33486-33493 |
RB |
denotes |
However |
| T7035 |
33507-33516 |
VBZ |
denotes |
conflicts |
| T7036 |
33493-33495 |
, |
denotes |
, |
| T7037 |
33495-33499 |
DT |
denotes |
this |
| T7038 |
33500-33506 |
NN |
denotes |
notion |
| T7039 |
33517-33521 |
IN |
denotes |
with |
| T7040 |
33522-33525 |
PRP$ |
denotes |
our |
| T7041 |
33526-33537 |
NN |
denotes |
observation |
| T7042 |
33538-33542 |
IN |
denotes |
that |
| T7043 |
33576-33580 |
VBZ |
denotes |
lies |
| T7044 |
33543-33546 |
DT |
denotes |
the |
| T7045 |
33567-33575 |
NN |
denotes |
boundary |
| T7046 |
33547-33553 |
JJ |
denotes |
future |
| T7047 |
33554-33566 |
NN |
denotes |
pigmentation |
| T7048 |
33581-33588 |
RB |
denotes |
ventral |
| T7049 |
33589-33591 |
IN |
denotes |
to |
| T7050 |
33592-33595 |
DT |
denotes |
the |
| T7051 |
33607-33612 |
NN |
denotes |
notch |
| T7052 |
33596-33606 |
JJ |
denotes |
ectodermal |
| T7053 |
33613-33614 |
-LRB- |
denotes |
( |
| T7054 |
33614-33617 |
VB |
denotes |
see |
| T7055 |
33618-33624 |
NN |
denotes |
Figure |
| T7056 |
33625-33626 |
CD |
denotes |
7 |
| T7057 |
33626-33627 |
-RRB- |
denotes |
) |
| T7058 |
33627-33628 |
. |
denotes |
. |
| T7059 |
33628-33870 |
sentence |
denotes |
To examine directly the relationship between the pigmentation boundary and dermis derived from lateral plate mesoderm, we made use of a Cre transgene driven by the Hoxb6 promoter that was developed by Kuehn and colleagues (Lowe et al. 2000). |
| T7060 |
33629-33631 |
TO |
denotes |
To |
| T7061 |
33632-33639 |
VB |
denotes |
examine |
| T7062 |
33751-33755 |
VBD |
denotes |
made |
| T7063 |
33640-33648 |
RB |
denotes |
directly |
| T7064 |
33649-33652 |
DT |
denotes |
the |
| T7065 |
33653-33665 |
NN |
denotes |
relationship |
| T7066 |
33666-33673 |
IN |
denotes |
between |
| T7067 |
33674-33677 |
DT |
denotes |
the |
| T7068 |
33691-33699 |
NN |
denotes |
boundary |
| T7069 |
33678-33690 |
NN |
denotes |
pigmentation |
| T7070 |
33700-33703 |
CC |
denotes |
and |
| T7071 |
33704-33710 |
NN |
denotes |
dermis |
| T7072 |
33711-33718 |
VBN |
denotes |
derived |
| T7073 |
33719-33723 |
IN |
denotes |
from |
| T7074 |
33724-33731 |
JJ |
denotes |
lateral |
| T7075 |
33732-33737 |
NN |
denotes |
plate |
| T7076 |
33738-33746 |
NN |
denotes |
mesoderm |
| T7077 |
33746-33748 |
, |
denotes |
, |
| T7078 |
33748-33750 |
PRP |
denotes |
we |
| T7079 |
33756-33759 |
NN |
denotes |
use |
| T7080 |
33760-33762 |
IN |
denotes |
of |
| T7081 |
33763-33764 |
DT |
denotes |
a |
| T7082 |
33769-33778 |
NN |
denotes |
transgene |
| T7083 |
33765-33768 |
NN |
denotes |
Cre |
| T7084 |
33779-33785 |
VBN |
denotes |
driven |
| T7085 |
33786-33788 |
IN |
denotes |
by |
| T7086 |
33789-33792 |
DT |
denotes |
the |
| T7087 |
33799-33807 |
NN |
denotes |
promoter |
| T7088 |
33793-33798 |
NN |
denotes |
Hoxb6 |
| T7089 |
33808-33812 |
WDT |
denotes |
that |
| T7090 |
33817-33826 |
VBN |
denotes |
developed |
| T7091 |
33813-33816 |
VBD |
denotes |
was |
| T7092 |
33827-33829 |
IN |
denotes |
by |
| T7093 |
33830-33835 |
NNP |
denotes |
Kuehn |
| T7094 |
33836-33839 |
CC |
denotes |
and |
| T7095 |
33840-33850 |
NNS |
denotes |
colleagues |
| T7096 |
33851-33852 |
-LRB- |
denotes |
( |
| T7097 |
33852-33856 |
NNP |
denotes |
Lowe |
| T7098 |
33857-33859 |
FW |
denotes |
et |
| T7099 |
33860-33863 |
FW |
denotes |
al. |
| T7100 |
33864-33868 |
CD |
denotes |
2000 |
| T7101 |
33868-33869 |
-RRB- |
denotes |
) |
| T7102 |
33869-33870 |
. |
denotes |
. |
| T7103 |
33870-34107 |
sentence |
denotes |
As described by Lowe et al. (2000), midgestation embryos carrying both the Hoxb6-Cre transgene and the R26R lacZ reporter gene (Soriano 1999) exhibit X-Gal staining in lateral plate mesoderm but not somite-derived mesoderm of the trunk. |
| T7104 |
33871-33873 |
IN |
denotes |
As |
| T7105 |
33874-33883 |
VBN |
denotes |
described |
| T7106 |
34013-34020 |
VBP |
denotes |
exhibit |
| T7107 |
33884-33886 |
IN |
denotes |
by |
| T7108 |
33887-33891 |
NNP |
denotes |
Lowe |
| T7109 |
33892-33894 |
FW |
denotes |
et |
| T7110 |
33895-33898 |
FW |
denotes |
al. |
| T7111 |
33899-33900 |
-LRB- |
denotes |
( |
| T7112 |
33900-33904 |
CD |
denotes |
2000 |
| T7113 |
33904-33905 |
-RRB- |
denotes |
) |
| T7114 |
33905-33907 |
, |
denotes |
, |
| T7115 |
33907-33919 |
NN |
denotes |
midgestation |
| T7116 |
33920-33927 |
NNS |
denotes |
embryos |
| T7117 |
33928-33936 |
VBG |
denotes |
carrying |
| T7118 |
33937-33941 |
CC |
denotes |
both |
| T7119 |
33956-33965 |
NN |
denotes |
transgene |
| T7120 |
33942-33945 |
DT |
denotes |
the |
| T7121 |
33946-33951 |
NN |
denotes |
Hoxb6 |
| T7122 |
33952-33955 |
NN |
denotes |
Cre |
| T7123 |
33951-33952 |
HYPH |
denotes |
- |
| T7124 |
33966-33969 |
CC |
denotes |
and |
| T7125 |
33970-33973 |
DT |
denotes |
the |
| T7126 |
33993-33997 |
NN |
denotes |
gene |
| T7127 |
33974-33978 |
NN |
denotes |
R26R |
| T7128 |
33979-33983 |
NN |
denotes |
lacZ |
| T7129 |
33984-33992 |
NN |
denotes |
reporter |
| T7130 |
33998-33999 |
-LRB- |
denotes |
( |
| T7131 |
33999-34006 |
NNP |
denotes |
Soriano |
| T7132 |
34007-34011 |
CD |
denotes |
1999 |
| T7133 |
34011-34012 |
-RRB- |
denotes |
) |
| T7134 |
34021-34022 |
NN |
denotes |
X |
| T7135 |
34023-34026 |
NN |
denotes |
Gal |
| T7136 |
34022-34023 |
HYPH |
denotes |
- |
| T7137 |
34027-34035 |
NN |
denotes |
staining |
| T7138 |
34036-34038 |
IN |
denotes |
in |
| T7139 |
34039-34046 |
JJ |
denotes |
lateral |
| T7140 |
34047-34052 |
NN |
denotes |
plate |
| T7141 |
34053-34061 |
NN |
denotes |
mesoderm |
| T7142 |
34062-34065 |
CC |
denotes |
but |
| T7143 |
34066-34069 |
RB |
denotes |
not |
| T7144 |
34070-34076 |
NN |
denotes |
somite |
| T7145 |
34077-34084 |
VBN |
denotes |
derived |
| T7146 |
34076-34077 |
HYPH |
denotes |
- |
| T7147 |
34085-34093 |
NN |
denotes |
mesoderm |
| T7148 |
34094-34096 |
IN |
denotes |
of |
| T7149 |
34097-34100 |
DT |
denotes |
the |
| T7150 |
34101-34106 |
NN |
denotes |
trunk |
| T7151 |
34106-34107 |
. |
denotes |
. |
| T7152 |
34107-34334 |
sentence |
denotes |
In whole-mount skin preparations from P1.5 or P4.5 neonatal animals, we observed a ventral band of dark X-Gal staining corresponding to lateral plate-derived dermis, which represents 63% of the total circumference (Figure 8A). |
| T7153 |
34108-34110 |
IN |
denotes |
In |
| T7154 |
34180-34188 |
VBD |
denotes |
observed |
| T7155 |
34111-34116 |
JJ |
denotes |
whole |
| T7156 |
34117-34122 |
NN |
denotes |
mount |
| T7157 |
34116-34117 |
HYPH |
denotes |
- |
| T7158 |
34128-34140 |
NNS |
denotes |
preparations |
| T7159 |
34123-34127 |
NN |
denotes |
skin |
| T7160 |
34141-34145 |
IN |
denotes |
from |
| T7161 |
34146-34150 |
NN |
denotes |
P1.5 |
| T7162 |
34168-34175 |
NNS |
denotes |
animals |
| T7163 |
34151-34153 |
CC |
denotes |
or |
| T7164 |
34154-34158 |
NN |
denotes |
P4.5 |
| T7165 |
34159-34167 |
JJ |
denotes |
neonatal |
| T7166 |
34175-34177 |
, |
denotes |
, |
| T7167 |
34177-34179 |
PRP |
denotes |
we |
| T7168 |
34189-34190 |
DT |
denotes |
a |
| T7169 |
34199-34203 |
NN |
denotes |
band |
| T7170 |
34191-34198 |
JJ |
denotes |
ventral |
| T7171 |
34204-34206 |
IN |
denotes |
of |
| T7172 |
34207-34211 |
JJ |
denotes |
dark |
| T7173 |
34218-34226 |
NN |
denotes |
staining |
| T7174 |
34212-34213 |
NN |
denotes |
X |
| T7175 |
34213-34214 |
HYPH |
denotes |
- |
| T7176 |
34214-34217 |
NN |
denotes |
Gal |
| T7177 |
34227-34240 |
VBG |
denotes |
corresponding |
| T7178 |
34241-34243 |
IN |
denotes |
to |
| T7179 |
34244-34251 |
JJ |
denotes |
lateral |
| T7180 |
34252-34257 |
NN |
denotes |
plate |
| T7181 |
34258-34265 |
VBN |
denotes |
derived |
| T7182 |
34257-34258 |
HYPH |
denotes |
- |
| T7183 |
34266-34272 |
NN |
denotes |
dermis |
| T7184 |
34272-34274 |
, |
denotes |
, |
| T7185 |
34274-34279 |
WDT |
denotes |
which |
| T7186 |
34280-34290 |
VBZ |
denotes |
represents |
| T7187 |
34291-34293 |
CD |
denotes |
63 |
| T7188 |
34293-34294 |
NN |
denotes |
% |
| T7189 |
34295-34297 |
IN |
denotes |
of |
| T7190 |
34298-34301 |
DT |
denotes |
the |
| T7191 |
34308-34321 |
NN |
denotes |
circumference |
| T7192 |
34302-34307 |
JJ |
denotes |
total |
| T7193 |
34322-34323 |
-LRB- |
denotes |
( |
| T7194 |
34323-34329 |
NN |
denotes |
Figure |
| T7195 |
34330-34332 |
CD |
denotes |
8A |
| T7196 |
34332-34333 |
-RRB- |
denotes |
) |
| T7197 |
34333-34334 |
. |
denotes |
. |
| T7198 |
34334-34617 |
sentence |
denotes |
However, in parallel preparations from at/at mice, the ventral pheomelanin domain represents 47% of the total skin circumference; therefore, the proportions of total skin circumference occupied by dorsal eumelanin and somite-derived dermis are 53% and 37%, respectively (Figure 8B). |
| T7199 |
34335-34342 |
RB |
denotes |
However |
| T7200 |
34417-34427 |
VBZ |
denotes |
represents |
| T7201 |
34342-34344 |
, |
denotes |
, |
| T7202 |
34344-34346 |
IN |
denotes |
in |
| T7203 |
34347-34355 |
JJ |
denotes |
parallel |
| T7204 |
34356-34368 |
NNS |
denotes |
preparations |
| T7205 |
34369-34373 |
IN |
denotes |
from |
| T7206 |
34374-34376 |
NN |
denotes |
at |
| T7207 |
34377-34379 |
NN |
denotes |
at |
| T7208 |
34376-34377 |
HYPH |
denotes |
/ |
| T7209 |
34380-34384 |
NNS |
denotes |
mice |
| T7210 |
34384-34386 |
, |
denotes |
, |
| T7211 |
34386-34389 |
DT |
denotes |
the |
| T7212 |
34410-34416 |
NN |
denotes |
domain |
| T7213 |
34390-34397 |
JJ |
denotes |
ventral |
| T7214 |
34398-34409 |
NN |
denotes |
pheomelanin |
| T7215 |
34575-34578 |
VBP |
denotes |
are |
| T7216 |
34428-34430 |
CD |
denotes |
47 |
| T7217 |
34430-34431 |
NN |
denotes |
% |
| T7218 |
34432-34434 |
IN |
denotes |
of |
| T7219 |
34435-34438 |
DT |
denotes |
the |
| T7220 |
34450-34463 |
NN |
denotes |
circumference |
| T7221 |
34439-34444 |
JJ |
denotes |
total |
| T7222 |
34445-34449 |
NN |
denotes |
skin |
| T7223 |
34463-34464 |
: |
denotes |
; |
| T7224 |
34465-34474 |
RB |
denotes |
therefore |
| T7225 |
34474-34476 |
, |
denotes |
, |
| T7226 |
34476-34479 |
DT |
denotes |
the |
| T7227 |
34480-34491 |
NNS |
denotes |
proportions |
| T7228 |
34492-34494 |
IN |
denotes |
of |
| T7229 |
34495-34500 |
JJ |
denotes |
total |
| T7230 |
34506-34519 |
NN |
denotes |
circumference |
| T7231 |
34501-34505 |
NN |
denotes |
skin |
| T7232 |
34520-34528 |
VBN |
denotes |
occupied |
| T7233 |
34529-34531 |
IN |
denotes |
by |
| T7234 |
34532-34538 |
JJ |
denotes |
dorsal |
| T7235 |
34539-34548 |
NN |
denotes |
eumelanin |
| T7236 |
34568-34574 |
NN |
denotes |
dermis |
| T7237 |
34549-34552 |
CC |
denotes |
and |
| T7238 |
34553-34559 |
NN |
denotes |
somite |
| T7239 |
34560-34567 |
VBN |
denotes |
derived |
| T7240 |
34559-34560 |
HYPH |
denotes |
- |
| T7241 |
34579-34581 |
CD |
denotes |
53 |
| T7242 |
34581-34582 |
NN |
denotes |
% |
| T7243 |
34583-34586 |
CC |
denotes |
and |
| T7244 |
34587-34589 |
CD |
denotes |
37 |
| T7245 |
34589-34590 |
NN |
denotes |
% |
| T7246 |
34590-34592 |
, |
denotes |
, |
| T7247 |
34592-34604 |
RB |
denotes |
respectively |
| T7248 |
34605-34606 |
-LRB- |
denotes |
( |
| T7249 |
34606-34612 |
NN |
denotes |
Figure |
| T7250 |
34613-34615 |
CD |
denotes |
8B |
| T7251 |
34615-34616 |
-RRB- |
denotes |
) |
| T7252 |
34616-34617 |
. |
denotes |
. |
| T7253 |
34617-34781 |
sentence |
denotes |
These results indicate that the pigmentation boundary is clearly distinct from, and more ventral to, the boundary between lateral plate- and somite-derived dermis. |
| T7254 |
34618-34623 |
DT |
denotes |
These |
| T7255 |
34624-34631 |
NNS |
denotes |
results |
| T7256 |
34632-34640 |
VBP |
denotes |
indicate |
| T7257 |
34641-34645 |
IN |
denotes |
that |
| T7258 |
34672-34674 |
VBZ |
denotes |
is |
| T7259 |
34646-34649 |
DT |
denotes |
the |
| T7260 |
34663-34671 |
NN |
denotes |
boundary |
| T7261 |
34650-34662 |
NN |
denotes |
pigmentation |
| T7262 |
34675-34682 |
RB |
denotes |
clearly |
| T7263 |
34683-34691 |
JJ |
denotes |
distinct |
| T7264 |
34692-34696 |
IN |
denotes |
from |
| T7265 |
34696-34698 |
, |
denotes |
, |
| T7266 |
34698-34701 |
CC |
denotes |
and |
| T7267 |
34702-34706 |
RBR |
denotes |
more |
| T7268 |
34707-34714 |
JJ |
denotes |
ventral |
| T7269 |
34715-34717 |
IN |
denotes |
to |
| T7270 |
34717-34719 |
, |
denotes |
, |
| T7271 |
34719-34722 |
DT |
denotes |
the |
| T7272 |
34723-34731 |
NN |
denotes |
boundary |
| T7273 |
34732-34739 |
IN |
denotes |
between |
| T7274 |
34740-34747 |
JJ |
denotes |
lateral |
| T7275 |
34748-34753 |
NN |
denotes |
plate |
| T7276 |
34766-34773 |
VBN |
denotes |
derived |
| T7277 |
34753-34754 |
HYPH |
denotes |
- |
| T7278 |
34755-34758 |
CC |
denotes |
and |
| T7279 |
34759-34765 |
NN |
denotes |
somite |
| T7280 |
34765-34766 |
HYPH |
denotes |
- |
| T7281 |
34774-34780 |
NN |
denotes |
dermis |
| T7282 |
34780-34781 |
. |
denotes |
. |
| T7283 |
34781-36057 |
sentence |
denotes |
Figure 8 Comparison of the Dorsoventral at/at Pigmentation Boundary to the Lateral Somitic Frontier
(A) Dorsoventral slices of skin from at the midtrunk region prepared such that the dorsal midline lies in the center of the slice. Sections were taken at P1.5 (a) or P4.5 (b–e) from at/at or R26R/+; Tg.Hoxb6-Cre/+ mice (the latter were stained with X-Gal), as described in Materials and Methods. For purposes of comparison, images were proportionally scaled. The boundary of X-Gal staining marks dermis derived from lateral plate versus dermis derived from mesoderm (the lateral somitic frontier) and lies more dorsal than the at/at pigmentation boundary.
(B) Quantitation of mean (± SEM) dorsal pigmentation area (n = 5) and somite-derived dermis area (n = 3) shows a significant difference (p < 0.005, t-test).
(C) RNA in situ hybridization showing that Tbx15 expression at E11.5 is complementary to En1 expression on the flank (scale bars = 200 μm). The arrow indicates the boundary between the expression domains of the two genes. Because the pigmentation boundary lies in register with the limb–body wall junction (see Figure 2), we wondered whether mechanisms used for dorsoventral limb patterning might be related to those used to establish the pigmentation boundary. |
| T7284 |
35818-35825 |
IN |
denotes |
Because |
| T7285 |
35852-35856 |
VBZ |
denotes |
lies |
| T7286 |
35826-35829 |
DT |
denotes |
the |
| T7287 |
35843-35851 |
NN |
denotes |
boundary |
| T7288 |
35830-35842 |
NN |
denotes |
pigmentation |
| T7289 |
35921-35929 |
VBD |
denotes |
wondered |
| T7290 |
35857-35859 |
IN |
denotes |
in |
| T7291 |
35860-35868 |
NN |
denotes |
register |
| T7292 |
35869-35873 |
IN |
denotes |
with |
| T7293 |
35874-35877 |
DT |
denotes |
the |
| T7294 |
35893-35901 |
NN |
denotes |
junction |
| T7295 |
35878-35882 |
NN |
denotes |
limb |
| T7296 |
35882-35883 |
HYPH |
denotes |
– |
| T7297 |
35883-35887 |
NN |
denotes |
body |
| T7298 |
35888-35892 |
NN |
denotes |
wall |
| T7299 |
35902-35903 |
-LRB- |
denotes |
( |
| T7300 |
35903-35906 |
VB |
denotes |
see |
| T7301 |
35907-35913 |
NN |
denotes |
Figure |
| T7302 |
35914-35915 |
CD |
denotes |
2 |
| T7303 |
35915-35916 |
-RRB- |
denotes |
) |
| T7304 |
35916-35918 |
, |
denotes |
, |
| T7305 |
35918-35920 |
PRP |
denotes |
we |
| T7306 |
35930-35937 |
IN |
denotes |
whether |
| T7307 |
35993-35995 |
VB |
denotes |
be |
| T7308 |
35938-35948 |
NNS |
denotes |
mechanisms |
| T7309 |
35949-35953 |
VBN |
denotes |
used |
| T7310 |
35954-35957 |
IN |
denotes |
for |
| T7311 |
35958-35970 |
JJ |
denotes |
dorsoventral |
| T7312 |
35976-35986 |
NN |
denotes |
patterning |
| T7313 |
35971-35975 |
NN |
denotes |
limb |
| T7314 |
35987-35992 |
MD |
denotes |
might |
| T7315 |
35996-36003 |
JJ |
denotes |
related |
| T7316 |
36004-36006 |
IN |
denotes |
to |
| T7317 |
36007-36012 |
DT |
denotes |
those |
| T7318 |
36013-36017 |
VBN |
denotes |
used |
| T7319 |
36018-36020 |
TO |
denotes |
to |
| T7320 |
36021-36030 |
VB |
denotes |
establish |
| T7321 |
36031-36034 |
DT |
denotes |
the |
| T7322 |
36048-36056 |
NN |
denotes |
boundary |
| T7323 |
36035-36047 |
NN |
denotes |
pigmentation |
| T7324 |
36056-36057 |
. |
denotes |
. |
| T7325 |
36057-36247 |
sentence |
denotes |
In the developing limb, Engrailed1 (En1), Wnt7a, and Lmx1b are part of a network whose restricted domains of expression help to establish dorsoventral identity (reviewed in Niswander 2003). |
| T7326 |
36058-36060 |
IN |
denotes |
In |
| T7327 |
36117-36120 |
VBP |
denotes |
are |
| T7328 |
36061-36064 |
DT |
denotes |
the |
| T7329 |
36076-36080 |
NN |
denotes |
limb |
| T7330 |
36065-36075 |
VBG |
denotes |
developing |
| T7331 |
36080-36082 |
, |
denotes |
, |
| T7332 |
36082-36092 |
NN |
denotes |
Engrailed1 |
| T7333 |
36093-36094 |
-LRB- |
denotes |
( |
| T7334 |
36094-36097 |
NN |
denotes |
En1 |
| T7335 |
36097-36098 |
-RRB- |
denotes |
) |
| T7336 |
36098-36100 |
, |
denotes |
, |
| T7337 |
36100-36105 |
NN |
denotes |
Wnt7a |
| T7338 |
36105-36107 |
, |
denotes |
, |
| T7339 |
36107-36110 |
CC |
denotes |
and |
| T7340 |
36111-36116 |
NN |
denotes |
Lmx1b |
| T7341 |
36121-36125 |
NN |
denotes |
part |
| T7342 |
36126-36128 |
IN |
denotes |
of |
| T7343 |
36129-36130 |
DT |
denotes |
a |
| T7344 |
36131-36138 |
NN |
denotes |
network |
| T7345 |
36139-36144 |
WP$ |
denotes |
whose |
| T7346 |
36156-36163 |
NNS |
denotes |
domains |
| T7347 |
36145-36155 |
JJ |
denotes |
restricted |
| T7348 |
36178-36182 |
VBP |
denotes |
help |
| T7349 |
36164-36166 |
IN |
denotes |
of |
| T7350 |
36167-36177 |
NN |
denotes |
expression |
| T7351 |
36183-36185 |
TO |
denotes |
to |
| T7352 |
36186-36195 |
VB |
denotes |
establish |
| T7353 |
36196-36208 |
JJ |
denotes |
dorsoventral |
| T7354 |
36209-36217 |
NN |
denotes |
identity |
| T7355 |
36218-36219 |
-LRB- |
denotes |
( |
| T7356 |
36219-36227 |
VBN |
denotes |
reviewed |
| T7357 |
36228-36230 |
IN |
denotes |
in |
| T7358 |
36231-36240 |
NNP |
denotes |
Niswander |
| T7359 |
36241-36245 |
CD |
denotes |
2003 |
| T7360 |
36245-36246 |
-RRB- |
denotes |
) |
| T7361 |
36246-36247 |
. |
denotes |
. |
| T7362 |
36247-36442 |
sentence |
denotes |
En1 is transiently expressed in the developing flank; at E11.5, transverse abdominal sections reveal domains in the neural tube, somite-derived mesenchyme, and the ventral body wall (Figure 8C). |
| T7363 |
36248-36251 |
NN |
denotes |
En1 |
| T7364 |
36267-36276 |
VBN |
denotes |
expressed |
| T7365 |
36252-36254 |
VBZ |
denotes |
is |
| T7366 |
36255-36266 |
RB |
denotes |
transiently |
| T7367 |
36342-36348 |
VBP |
denotes |
reveal |
| T7368 |
36277-36279 |
IN |
denotes |
in |
| T7369 |
36280-36283 |
DT |
denotes |
the |
| T7370 |
36295-36300 |
NN |
denotes |
flank |
| T7371 |
36284-36294 |
VBG |
denotes |
developing |
| T7372 |
36300-36301 |
: |
denotes |
; |
| T7373 |
36302-36304 |
IN |
denotes |
at |
| T7374 |
36305-36310 |
NN |
denotes |
E11.5 |
| T7375 |
36310-36312 |
, |
denotes |
, |
| T7376 |
36312-36322 |
JJ |
denotes |
transverse |
| T7377 |
36333-36341 |
NNS |
denotes |
sections |
| T7378 |
36323-36332 |
JJ |
denotes |
abdominal |
| T7379 |
36349-36356 |
NNS |
denotes |
domains |
| T7380 |
36357-36359 |
IN |
denotes |
in |
| T7381 |
36360-36363 |
DT |
denotes |
the |
| T7382 |
36371-36375 |
NN |
denotes |
tube |
| T7383 |
36364-36370 |
JJ |
denotes |
neural |
| T7384 |
36375-36377 |
, |
denotes |
, |
| T7385 |
36377-36383 |
NN |
denotes |
somite |
| T7386 |
36384-36391 |
VBN |
denotes |
derived |
| T7387 |
36383-36384 |
HYPH |
denotes |
- |
| T7388 |
36392-36402 |
NN |
denotes |
mesenchyme |
| T7389 |
36402-36404 |
, |
denotes |
, |
| T7390 |
36404-36407 |
CC |
denotes |
and |
| T7391 |
36408-36411 |
DT |
denotes |
the |
| T7392 |
36425-36429 |
NN |
denotes |
wall |
| T7393 |
36412-36419 |
JJ |
denotes |
ventral |
| T7394 |
36420-36424 |
NN |
denotes |
body |
| T7395 |
36430-36431 |
-LRB- |
denotes |
( |
| T7396 |
36431-36437 |
NN |
denotes |
Figure |
| T7397 |
36438-36440 |
CD |
denotes |
8C |
| T7398 |
36440-36441 |
-RRB- |
denotes |
) |
| T7399 |
36441-36442 |
. |
denotes |
. |
| T7400 |
36442-36753 |
sentence |
denotes |
An adjacent section hybridized with Tbx15 reveals a complementary pattern in the flank, which provides additional evidence for developmental mechanisms that establish a pigmentation boundary entirely within lateral plate mesoderm and independent of lineage restrictions imposed by the lateral somitic frontier. |
| T7401 |
36443-36445 |
DT |
denotes |
An |
| T7402 |
36455-36462 |
NN |
denotes |
section |
| T7403 |
36446-36454 |
JJ |
denotes |
adjacent |
| T7404 |
36485-36492 |
VBZ |
denotes |
reveals |
| T7405 |
36463-36473 |
VBN |
denotes |
hybridized |
| T7406 |
36474-36478 |
IN |
denotes |
with |
| T7407 |
36479-36484 |
NN |
denotes |
Tbx15 |
| T7408 |
36493-36494 |
DT |
denotes |
a |
| T7409 |
36509-36516 |
NN |
denotes |
pattern |
| T7410 |
36495-36508 |
JJ |
denotes |
complementary |
| T7411 |
36517-36519 |
IN |
denotes |
in |
| T7412 |
36520-36523 |
DT |
denotes |
the |
| T7413 |
36524-36529 |
NN |
denotes |
flank |
| T7414 |
36529-36531 |
, |
denotes |
, |
| T7415 |
36531-36536 |
WDT |
denotes |
which |
| T7416 |
36537-36545 |
VBZ |
denotes |
provides |
| T7417 |
36546-36556 |
JJ |
denotes |
additional |
| T7418 |
36557-36565 |
NN |
denotes |
evidence |
| T7419 |
36566-36569 |
IN |
denotes |
for |
| T7420 |
36570-36583 |
JJ |
denotes |
developmental |
| T7421 |
36584-36594 |
NNS |
denotes |
mechanisms |
| T7422 |
36595-36599 |
WDT |
denotes |
that |
| T7423 |
36600-36609 |
VBP |
denotes |
establish |
| T7424 |
36610-36611 |
DT |
denotes |
a |
| T7425 |
36625-36633 |
NN |
denotes |
boundary |
| T7426 |
36612-36624 |
NN |
denotes |
pigmentation |
| T7427 |
36634-36642 |
RB |
denotes |
entirely |
| T7428 |
36643-36649 |
IN |
denotes |
within |
| T7429 |
36650-36657 |
JJ |
denotes |
lateral |
| T7430 |
36658-36663 |
NN |
denotes |
plate |
| T7431 |
36664-36672 |
NN |
denotes |
mesoderm |
| T7432 |
36673-36676 |
CC |
denotes |
and |
| T7433 |
36677-36688 |
JJ |
denotes |
independent |
| T7434 |
36689-36691 |
IN |
denotes |
of |
| T7435 |
36692-36699 |
NN |
denotes |
lineage |
| T7436 |
36700-36712 |
NNS |
denotes |
restrictions |
| T7437 |
36713-36720 |
VBN |
denotes |
imposed |
| T7438 |
36721-36723 |
IN |
denotes |
by |
| T7439 |
36724-36727 |
DT |
denotes |
the |
| T7440 |
36744-36752 |
NN |
denotes |
frontier |
| T7441 |
36728-36735 |
JJ |
denotes |
lateral |
| T7442 |
36736-36743 |
JJ |
denotes |
somitic |
| T7443 |
36752-36753 |
. |
denotes |
. |
| T7563 |
36766-36773 |
JJ |
denotes |
Several |
| T7564 |
36774-36783 |
NNS |
denotes |
mutations |
| T7565 |
36804-36814 |
VBN |
denotes |
identified |
| T7566 |
36784-36787 |
CC |
denotes |
and |
| T7567 |
36788-36793 |
NNS |
denotes |
genes |
| T7568 |
36794-36798 |
VBP |
denotes |
have |
| T7569 |
36799-36803 |
VBN |
denotes |
been |
| T7570 |
36815-36819 |
WDT |
denotes |
that |
| T7571 |
36820-36826 |
VBP |
denotes |
affect |
| T7572 |
36827-36830 |
DT |
denotes |
the |
| T7573 |
36831-36838 |
NN |
denotes |
pattern |
| T7574 |
36839-36841 |
IN |
denotes |
of |
| T7575 |
36842-36846 |
NN |
denotes |
hair |
| T7576 |
36847-36855 |
NN |
denotes |
follicle |
| T7577 |
36856-36867 |
NN |
denotes |
development |
| T7578 |
36867-36869 |
, |
denotes |
, |
| T7579 |
36869-36872 |
CC |
denotes |
but |
| T7580 |
36873-36878 |
NN |
denotes |
Tbx15 |
| T7581 |
36879-36881 |
VBZ |
denotes |
is |
| T7582 |
36882-36885 |
DT |
denotes |
the |
| T7583 |
36891-36895 |
NN |
denotes |
gene |
| T7584 |
36886-36890 |
JJ |
denotes |
only |
| T7585 |
36896-36898 |
IN |
denotes |
of |
| T7586 |
36908-36911 |
VBP |
denotes |
are |
| T7587 |
36899-36904 |
WDT |
denotes |
which |
| T7588 |
36905-36907 |
PRP |
denotes |
we |
| T7589 |
36912-36917 |
JJ |
denotes |
aware |
| T7590 |
36918-36922 |
WDT |
denotes |
that |
| T7591 |
36923-36930 |
VBZ |
denotes |
affects |
| T7592 |
36931-36934 |
DT |
denotes |
the |
| T7593 |
36935-36942 |
NN |
denotes |
pattern |
| T7594 |
36943-36945 |
IN |
denotes |
of |
| T7595 |
36946-36950 |
NN |
denotes |
hair |
| T7596 |
36951-36963 |
NN |
denotes |
pigmentation |
| T7597 |
36964-36966 |
IN |
denotes |
in |
| T7598 |
36967-36976 |
JJ |
denotes |
different |
| T7599 |
36982-36989 |
NNS |
denotes |
regions |
| T7600 |
36977-36981 |
NN |
denotes |
body |
| T7601 |
36989-36990 |
. |
denotes |
. |
| T7602 |
36990-37254 |
sentence |
denotes |
Ventral areas that normally produce yellow hair in the trunk, limbs, and craniofacial regions are expanded in deH/deH mice and, in the trunk at least, represent inappropriate dorsal expression of an Agouti mRNA isoform that is normally restricted to ventral skin. |
| T7603 |
36991-36998 |
JJ |
denotes |
Ventral |
| T7604 |
36999-37004 |
NNS |
denotes |
areas |
| T7605 |
37089-37097 |
VBN |
denotes |
expanded |
| T7606 |
37005-37009 |
WDT |
denotes |
that |
| T7607 |
37019-37026 |
VBP |
denotes |
produce |
| T7608 |
37010-37018 |
RB |
denotes |
normally |
| T7609 |
37027-37033 |
JJ |
denotes |
yellow |
| T7610 |
37034-37038 |
NN |
denotes |
hair |
| T7611 |
37039-37041 |
IN |
denotes |
in |
| T7612 |
37042-37045 |
DT |
denotes |
the |
| T7613 |
37046-37051 |
NN |
denotes |
trunk |
| T7614 |
37051-37053 |
, |
denotes |
, |
| T7615 |
37053-37058 |
NNS |
denotes |
limbs |
| T7616 |
37058-37060 |
, |
denotes |
, |
| T7617 |
37060-37063 |
CC |
denotes |
and |
| T7618 |
37064-37076 |
JJ |
denotes |
craniofacial |
| T7619 |
37077-37084 |
NNS |
denotes |
regions |
| T7620 |
37085-37088 |
VBP |
denotes |
are |
| T7621 |
37098-37100 |
IN |
denotes |
in |
| T7622 |
37101-37104 |
NN |
denotes |
deH |
| T7623 |
37105-37108 |
NN |
denotes |
deH |
| T7624 |
37104-37105 |
SYM |
denotes |
/ |
| T7625 |
37109-37113 |
NNS |
denotes |
mice |
| T7626 |
37114-37117 |
CC |
denotes |
and |
| T7627 |
37117-37119 |
, |
denotes |
, |
| T7628 |
37119-37121 |
IN |
denotes |
in |
| T7629 |
37142-37151 |
VBP |
denotes |
represent |
| T7630 |
37122-37125 |
DT |
denotes |
the |
| T7631 |
37126-37131 |
NN |
denotes |
trunk |
| T7632 |
37132-37134 |
RB |
denotes |
at |
| T7633 |
37135-37140 |
RBS |
denotes |
least |
| T7634 |
37140-37142 |
, |
denotes |
, |
| T7635 |
37152-37165 |
JJ |
denotes |
inappropriate |
| T7636 |
37173-37183 |
NN |
denotes |
expression |
| T7637 |
37166-37172 |
JJ |
denotes |
dorsal |
| T7638 |
37184-37186 |
IN |
denotes |
of |
| T7639 |
37187-37189 |
DT |
denotes |
an |
| T7640 |
37202-37209 |
NN |
denotes |
isoform |
| T7641 |
37190-37196 |
NN |
denotes |
Agouti |
| T7642 |
37197-37201 |
NN |
denotes |
mRNA |
| T7643 |
37210-37214 |
WDT |
denotes |
that |
| T7644 |
37227-37237 |
VBN |
denotes |
restricted |
| T7645 |
37215-37217 |
VBZ |
denotes |
is |
| T7646 |
37218-37226 |
RB |
denotes |
normally |
| T7647 |
37238-37240 |
IN |
denotes |
to |
| T7648 |
37241-37248 |
JJ |
denotes |
ventral |
| T7649 |
37249-37253 |
NN |
denotes |
skin |
| T7650 |
37253-37254 |
. |
denotes |
. |
| T7651 |
37254-37485 |
sentence |
denotes |
The deH allele is caused by a large deletion that removes most of the Tbx15 coding sequence, but the pleiotropic phenotype is caused by a simple loss of function for Tbx15 rather than a dominant-negative or contiguous gene effect. |
| T7652 |
37255-37258 |
DT |
denotes |
The |
| T7653 |
37263-37269 |
NN |
denotes |
allele |
| T7654 |
37259-37262 |
NN |
denotes |
deH |
| T7655 |
37273-37279 |
VBN |
denotes |
caused |
| T7656 |
37270-37272 |
VBZ |
denotes |
is |
| T7657 |
37280-37282 |
IN |
denotes |
by |
| T7658 |
37283-37284 |
DT |
denotes |
a |
| T7659 |
37291-37299 |
NN |
denotes |
deletion |
| T7660 |
37285-37290 |
JJ |
denotes |
large |
| T7661 |
37300-37304 |
WDT |
denotes |
that |
| T7662 |
37305-37312 |
VBZ |
denotes |
removes |
| T7663 |
37313-37317 |
JJS |
denotes |
most |
| T7664 |
37318-37320 |
IN |
denotes |
of |
| T7665 |
37321-37324 |
DT |
denotes |
the |
| T7666 |
37338-37346 |
NN |
denotes |
sequence |
| T7667 |
37325-37330 |
NN |
denotes |
Tbx15 |
| T7668 |
37331-37337 |
NN |
denotes |
coding |
| T7669 |
37346-37348 |
, |
denotes |
, |
| T7670 |
37348-37351 |
CC |
denotes |
but |
| T7671 |
37352-37355 |
DT |
denotes |
the |
| T7672 |
37368-37377 |
NN |
denotes |
phenotype |
| T7673 |
37356-37367 |
JJ |
denotes |
pleiotropic |
| T7674 |
37381-37387 |
VBN |
denotes |
caused |
| T7675 |
37378-37380 |
VBZ |
denotes |
is |
| T7676 |
37388-37390 |
IN |
denotes |
by |
| T7677 |
37391-37392 |
DT |
denotes |
a |
| T7678 |
37400-37404 |
NN |
denotes |
loss |
| T7679 |
37393-37399 |
JJ |
denotes |
simple |
| T7680 |
37405-37407 |
IN |
denotes |
of |
| T7681 |
37408-37416 |
NN |
denotes |
function |
| T7682 |
37417-37420 |
IN |
denotes |
for |
| T7683 |
37421-37426 |
NN |
denotes |
Tbx15 |
| T7684 |
37427-37433 |
RB |
denotes |
rather |
| T7685 |
37434-37438 |
IN |
denotes |
than |
| T7686 |
37439-37440 |
DT |
denotes |
a |
| T7687 |
37478-37484 |
NN |
denotes |
effect |
| T7688 |
37441-37449 |
JJ |
denotes |
dominant |
| T7689 |
37450-37458 |
JJ |
denotes |
negative |
| T7690 |
37449-37450 |
HYPH |
denotes |
- |
| T7691 |
37459-37461 |
CC |
denotes |
or |
| T7692 |
37462-37472 |
JJ |
denotes |
contiguous |
| T7693 |
37473-37477 |
NN |
denotes |
gene |
| T7694 |
37484-37485 |
. |
denotes |
. |
| T7695 |
37485-37747 |
sentence |
denotes |
In particular, there is no heterozygous phenotype, no other genes lie within or close to the deletion breakpoints, and the expression pattern of Tbx15 is consistent with the spectrum of phenotypic abnormalities in both the original de allele and the deH allele. |
| T7696 |
37486-37488 |
IN |
denotes |
In |
| T7697 |
37507-37509 |
VBZ |
denotes |
is |
| T7698 |
37489-37499 |
JJ |
denotes |
particular |
| T7699 |
37499-37501 |
, |
denotes |
, |
| T7700 |
37501-37506 |
EX |
denotes |
there |
| T7701 |
37510-37512 |
DT |
denotes |
no |
| T7702 |
37526-37535 |
NN |
denotes |
phenotype |
| T7703 |
37513-37525 |
JJ |
denotes |
heterozygous |
| T7704 |
37535-37537 |
, |
denotes |
, |
| T7705 |
37537-37539 |
DT |
denotes |
no |
| T7706 |
37546-37551 |
NNS |
denotes |
genes |
| T7707 |
37540-37545 |
JJ |
denotes |
other |
| T7708 |
37552-37555 |
VBP |
denotes |
lie |
| T7709 |
37556-37562 |
IN |
denotes |
within |
| T7710 |
37563-37565 |
CC |
denotes |
or |
| T7711 |
37566-37571 |
RB |
denotes |
close |
| T7712 |
37588-37599 |
NNS |
denotes |
breakpoints |
| T7713 |
37572-37574 |
IN |
denotes |
to |
| T7714 |
37575-37578 |
DT |
denotes |
the |
| T7715 |
37579-37587 |
NN |
denotes |
deletion |
| T7716 |
37599-37601 |
, |
denotes |
, |
| T7717 |
37601-37604 |
CC |
denotes |
and |
| T7718 |
37605-37608 |
DT |
denotes |
the |
| T7719 |
37620-37627 |
NN |
denotes |
pattern |
| T7720 |
37609-37619 |
NN |
denotes |
expression |
| T7721 |
37637-37639 |
VBZ |
denotes |
is |
| T7722 |
37628-37630 |
IN |
denotes |
of |
| T7723 |
37631-37636 |
NN |
denotes |
Tbx15 |
| T7724 |
37640-37650 |
JJ |
denotes |
consistent |
| T7725 |
37651-37655 |
IN |
denotes |
with |
| T7726 |
37656-37659 |
DT |
denotes |
the |
| T7727 |
37660-37668 |
NN |
denotes |
spectrum |
| T7728 |
37669-37671 |
IN |
denotes |
of |
| T7729 |
37672-37682 |
JJ |
denotes |
phenotypic |
| T7730 |
37683-37696 |
NNS |
denotes |
abnormalities |
| T7731 |
37697-37699 |
IN |
denotes |
in |
| T7732 |
37700-37704 |
CC |
denotes |
both |
| T7733 |
37721-37727 |
NN |
denotes |
allele |
| T7734 |
37705-37708 |
DT |
denotes |
the |
| T7735 |
37709-37717 |
JJ |
denotes |
original |
| T7736 |
37718-37720 |
NN |
denotes |
de |
| T7737 |
37728-37731 |
CC |
denotes |
and |
| T7738 |
37732-37735 |
DT |
denotes |
the |
| T7739 |
37740-37746 |
NN |
denotes |
allele |
| T7740 |
37736-37739 |
NN |
denotes |
deH |
| T7741 |
37746-37747 |
. |
denotes |
. |
| T7742 |
37747-37811 |
sentence |
denotes |
Finally, a Tbx15 targeted allele has the same phenotype as deH. |
| T7743 |
37748-37755 |
RB |
denotes |
Finally |
| T7744 |
37781-37784 |
VBZ |
denotes |
has |
| T7745 |
37755-37757 |
, |
denotes |
, |
| T7746 |
37757-37758 |
DT |
denotes |
a |
| T7747 |
37774-37780 |
NN |
denotes |
allele |
| T7748 |
37759-37764 |
NN |
denotes |
Tbx15 |
| T7749 |
37765-37773 |
VBN |
denotes |
targeted |
| T7750 |
37785-37788 |
DT |
denotes |
the |
| T7751 |
37794-37803 |
NN |
denotes |
phenotype |
| T7752 |
37789-37793 |
JJ |
denotes |
same |
| T7753 |
37804-37806 |
IN |
denotes |
as |
| T7754 |
37807-37810 |
NN |
denotes |
deH |
| T7755 |
37810-37811 |
. |
denotes |
. |
| T7756 |
37812-38009 |
sentence |
denotes |
Our results suggest that patterned expression of Tbx15 provides an instructional cue required to establish the future identity of dorsal dermis with regard to pigmentary and hair length patterning. |
| T7757 |
37812-37815 |
PRP$ |
denotes |
Our |
| T7758 |
37816-37823 |
NNS |
denotes |
results |
| T7759 |
37824-37831 |
VBP |
denotes |
suggest |
| T7760 |
37832-37836 |
IN |
denotes |
that |
| T7761 |
37867-37875 |
VBZ |
denotes |
provides |
| T7762 |
37837-37846 |
VBN |
denotes |
patterned |
| T7763 |
37847-37857 |
NN |
denotes |
expression |
| T7764 |
37858-37860 |
IN |
denotes |
of |
| T7765 |
37861-37866 |
NN |
denotes |
Tbx15 |
| T7766 |
37876-37878 |
DT |
denotes |
an |
| T7767 |
37893-37896 |
NN |
denotes |
cue |
| T7768 |
37879-37892 |
JJ |
denotes |
instructional |
| T7769 |
37897-37905 |
VBN |
denotes |
required |
| T7770 |
37906-37908 |
TO |
denotes |
to |
| T7771 |
37909-37918 |
VB |
denotes |
establish |
| T7772 |
37919-37922 |
DT |
denotes |
the |
| T7773 |
37930-37938 |
NN |
denotes |
identity |
| T7774 |
37923-37929 |
JJ |
denotes |
future |
| T7775 |
37939-37941 |
IN |
denotes |
of |
| T7776 |
37942-37948 |
JJ |
denotes |
dorsal |
| T7777 |
37949-37955 |
NN |
denotes |
dermis |
| T7778 |
37956-37960 |
IN |
denotes |
with |
| T7779 |
37961-37967 |
NN |
denotes |
regard |
| T7780 |
37968-37970 |
IN |
denotes |
to |
| T7781 |
37971-37981 |
JJ |
denotes |
pigmentary |
| T7782 |
37998-38008 |
NN |
denotes |
patterning |
| T7783 |
37982-37985 |
CC |
denotes |
and |
| T7784 |
37986-37990 |
NN |
denotes |
hair |
| T7785 |
37991-37997 |
NN |
denotes |
length |
| T7786 |
38008-38009 |
. |
denotes |
. |
| T7787 |
38009-38188 |
sentence |
denotes |
The ventral edge of Tbx15 expression in the developing flank does not correspond to a known lineage compartment, but, like limb development, occurs within lateral plate mesoderm. |
| T7788 |
38010-38013 |
DT |
denotes |
The |
| T7789 |
38022-38026 |
NN |
denotes |
edge |
| T7790 |
38014-38021 |
JJ |
denotes |
ventral |
| T7791 |
38080-38090 |
VB |
denotes |
correspond |
| T7792 |
38027-38029 |
IN |
denotes |
of |
| T7793 |
38030-38035 |
NN |
denotes |
Tbx15 |
| T7794 |
38036-38046 |
NN |
denotes |
expression |
| T7795 |
38047-38049 |
IN |
denotes |
in |
| T7796 |
38050-38053 |
DT |
denotes |
the |
| T7797 |
38065-38070 |
NN |
denotes |
flank |
| T7798 |
38054-38064 |
VBG |
denotes |
developing |
| T7799 |
38071-38075 |
VBZ |
denotes |
does |
| T7800 |
38076-38079 |
RB |
denotes |
not |
| T7801 |
38091-38093 |
IN |
denotes |
to |
| T7802 |
38094-38095 |
DT |
denotes |
a |
| T7803 |
38110-38121 |
NN |
denotes |
compartment |
| T7804 |
38096-38101 |
VBN |
denotes |
known |
| T7805 |
38102-38109 |
NN |
denotes |
lineage |
| T7806 |
38121-38123 |
, |
denotes |
, |
| T7807 |
38123-38126 |
CC |
denotes |
but |
| T7808 |
38126-38128 |
, |
denotes |
, |
| T7809 |
38128-38132 |
IN |
denotes |
like |
| T7810 |
38151-38157 |
VBZ |
denotes |
occurs |
| T7811 |
38133-38137 |
NN |
denotes |
limb |
| T7812 |
38138-38149 |
NN |
denotes |
development |
| T7813 |
38149-38151 |
, |
denotes |
, |
| T7814 |
38158-38164 |
IN |
denotes |
within |
| T7815 |
38165-38172 |
JJ |
denotes |
lateral |
| T7816 |
38173-38178 |
NN |
denotes |
plate |
| T7817 |
38179-38187 |
NN |
denotes |
mesoderm |
| T7818 |
38187-38188 |
. |
denotes |
. |
| T7819 |
38188-38406 |
sentence |
denotes |
These findings represent a novel role for T-box gene action in embryonic development and provide evidence for a previously unappreciated complexity to acquisition of dorsoventral positional identity in mammalian skin. |
| T7820 |
38189-38194 |
DT |
denotes |
These |
| T7821 |
38195-38203 |
NNS |
denotes |
findings |
| T7822 |
38204-38213 |
VBP |
denotes |
represent |
| T7823 |
38214-38215 |
DT |
denotes |
a |
| T7824 |
38222-38226 |
NN |
denotes |
role |
| T7825 |
38216-38221 |
JJ |
denotes |
novel |
| T7826 |
38227-38230 |
IN |
denotes |
for |
| T7827 |
38231-38232 |
NN |
denotes |
T |
| T7828 |
38233-38236 |
NN |
denotes |
box |
| T7829 |
38232-38233 |
HYPH |
denotes |
- |
| T7830 |
38242-38248 |
NN |
denotes |
action |
| T7831 |
38237-38241 |
NN |
denotes |
gene |
| T7832 |
38249-38251 |
IN |
denotes |
in |
| T7833 |
38252-38261 |
JJ |
denotes |
embryonic |
| T7834 |
38262-38273 |
NN |
denotes |
development |
| T7835 |
38274-38277 |
CC |
denotes |
and |
| T7836 |
38278-38285 |
VBP |
denotes |
provide |
| T7837 |
38286-38294 |
NN |
denotes |
evidence |
| T7838 |
38295-38298 |
IN |
denotes |
for |
| T7839 |
38299-38300 |
DT |
denotes |
a |
| T7840 |
38326-38336 |
NN |
denotes |
complexity |
| T7841 |
38301-38311 |
RB |
denotes |
previously |
| T7842 |
38312-38325 |
JJ |
denotes |
unappreciated |
| T7843 |
38337-38339 |
IN |
denotes |
to |
| T7844 |
38340-38351 |
NN |
denotes |
acquisition |
| T7845 |
38352-38354 |
IN |
denotes |
of |
| T7846 |
38355-38367 |
JJ |
denotes |
dorsoventral |
| T7847 |
38379-38387 |
NN |
denotes |
identity |
| T7848 |
38368-38378 |
JJ |
denotes |
positional |
| T7849 |
38388-38390 |
IN |
denotes |
in |
| T7850 |
38391-38400 |
JJ |
denotes |
mammalian |
| T7851 |
38401-38405 |
NN |
denotes |
skin |
| T7852 |
38405-38406 |
. |
denotes |
. |
| T7946 |
38408-38416 |
JJ |
denotes |
Distinct |
| T7947 |
38429-38436 |
NNS |
denotes |
Regions |
| T7948 |
38417-38428 |
JJ |
denotes |
Morphologic |
| T7949 |
38437-38446 |
VBP |
denotes |
Represent |
| T7950 |
38447-38450 |
DT |
denotes |
the |
| T7951 |
38451-38454 |
NN |
denotes |
Sum |
| T7952 |
38455-38457 |
IN |
denotes |
of |
| T7953 |
38458-38467 |
JJ |
denotes |
Different |
| T7954 |
38468-38477 |
NNS |
denotes |
Gradients |
| T7955 |
38477-38731 |
sentence |
denotes |
The visual boundary between dorsal and ventral skin in at/at mice is reminiscent of other systems in which adjacent compartments enforce a binary choice between alternative patterns of gene expression and cell fate (reviewed in Dahmann and Basler 1999). |
| T7956 |
38478-38481 |
DT |
denotes |
The |
| T7957 |
38489-38497 |
NN |
denotes |
boundary |
| T7958 |
38482-38488 |
JJ |
denotes |
visual |
| T7959 |
38544-38546 |
VBZ |
denotes |
is |
| T7960 |
38498-38505 |
IN |
denotes |
between |
| T7961 |
38506-38512 |
JJ |
denotes |
dorsal |
| T7962 |
38525-38529 |
NN |
denotes |
skin |
| T7963 |
38513-38516 |
CC |
denotes |
and |
| T7964 |
38517-38524 |
JJ |
denotes |
ventral |
| T7965 |
38530-38532 |
IN |
denotes |
in |
| T7966 |
38533-38535 |
NN |
denotes |
at |
| T7967 |
38536-38538 |
NN |
denotes |
at |
| T7968 |
38535-38536 |
SYM |
denotes |
/ |
| T7969 |
38539-38543 |
NNS |
denotes |
mice |
| T7970 |
38547-38558 |
JJ |
denotes |
reminiscent |
| T7971 |
38559-38561 |
IN |
denotes |
of |
| T7972 |
38562-38567 |
JJ |
denotes |
other |
| T7973 |
38568-38575 |
NNS |
denotes |
systems |
| T7974 |
38576-38578 |
IN |
denotes |
in |
| T7975 |
38607-38614 |
VBP |
denotes |
enforce |
| T7976 |
38579-38584 |
WDT |
denotes |
which |
| T7977 |
38585-38593 |
JJ |
denotes |
adjacent |
| T7978 |
38594-38606 |
NNS |
denotes |
compartments |
| T7979 |
38615-38616 |
DT |
denotes |
a |
| T7980 |
38624-38630 |
NN |
denotes |
choice |
| T7981 |
38617-38623 |
JJ |
denotes |
binary |
| T7982 |
38631-38638 |
IN |
denotes |
between |
| T7983 |
38639-38650 |
JJ |
denotes |
alternative |
| T7984 |
38651-38659 |
NNS |
denotes |
patterns |
| T7985 |
38660-38662 |
IN |
denotes |
of |
| T7986 |
38663-38667 |
NN |
denotes |
gene |
| T7987 |
38668-38678 |
NN |
denotes |
expression |
| T7988 |
38679-38682 |
CC |
denotes |
and |
| T7989 |
38683-38687 |
NN |
denotes |
cell |
| T7990 |
38688-38692 |
NN |
denotes |
fate |
| T7991 |
38693-38694 |
-LRB- |
denotes |
( |
| T7992 |
38694-38702 |
VBN |
denotes |
reviewed |
| T7993 |
38703-38705 |
IN |
denotes |
in |
| T7994 |
38706-38713 |
NNP |
denotes |
Dahmann |
| T7995 |
38714-38717 |
CC |
denotes |
and |
| T7996 |
38718-38724 |
NNP |
denotes |
Basler |
| T7997 |
38725-38729 |
CD |
denotes |
1999 |
| T7998 |
38729-38730 |
-RRB- |
denotes |
) |
| T7999 |
38730-38731 |
. |
denotes |
. |
| T8000 |
38731-38987 |
sentence |
denotes |
However, Agouti mRNA in both embryonic and postnatal skin is distributed along a gradient whose dorsal boundary is indistinct and overlaps with two additional gradients recognized by their effects on hair length and histochemical staining for melanocytes. |
| T8001 |
38732-38739 |
RB |
denotes |
However |
| T8002 |
38793-38804 |
VBN |
denotes |
distributed |
| T8003 |
38739-38741 |
, |
denotes |
, |
| T8004 |
38741-38747 |
NN |
denotes |
Agouti |
| T8005 |
38748-38752 |
NN |
denotes |
mRNA |
| T8006 |
38753-38755 |
IN |
denotes |
in |
| T8007 |
38756-38760 |
CC |
denotes |
both |
| T8008 |
38761-38770 |
JJ |
denotes |
embryonic |
| T8009 |
38785-38789 |
NN |
denotes |
skin |
| T8010 |
38771-38774 |
CC |
denotes |
and |
| T8011 |
38775-38784 |
JJ |
denotes |
postnatal |
| T8012 |
38790-38792 |
VBZ |
denotes |
is |
| T8013 |
38805-38810 |
IN |
denotes |
along |
| T8014 |
38811-38812 |
DT |
denotes |
a |
| T8015 |
38813-38821 |
NN |
denotes |
gradient |
| T8016 |
38822-38827 |
WP$ |
denotes |
whose |
| T8017 |
38835-38843 |
NN |
denotes |
boundary |
| T8018 |
38828-38834 |
JJ |
denotes |
dorsal |
| T8019 |
38844-38846 |
VBZ |
denotes |
is |
| T8020 |
38847-38857 |
JJ |
denotes |
indistinct |
| T8021 |
38858-38861 |
CC |
denotes |
and |
| T8022 |
38862-38870 |
VBZ |
denotes |
overlaps |
| T8023 |
38871-38875 |
IN |
denotes |
with |
| T8024 |
38876-38879 |
CD |
denotes |
two |
| T8025 |
38891-38900 |
NNS |
denotes |
gradients |
| T8026 |
38880-38890 |
JJ |
denotes |
additional |
| T8027 |
38901-38911 |
VBN |
denotes |
recognized |
| T8028 |
38912-38914 |
IN |
denotes |
by |
| T8029 |
38915-38920 |
PRP$ |
denotes |
their |
| T8030 |
38921-38928 |
NNS |
denotes |
effects |
| T8031 |
38929-38931 |
IN |
denotes |
on |
| T8032 |
38932-38936 |
NN |
denotes |
hair |
| T8033 |
38937-38943 |
NN |
denotes |
length |
| T8034 |
38944-38947 |
CC |
denotes |
and |
| T8035 |
38948-38961 |
JJ |
denotes |
histochemical |
| T8036 |
38962-38970 |
NN |
denotes |
staining |
| T8037 |
38971-38974 |
IN |
denotes |
for |
| T8038 |
38975-38986 |
NNS |
denotes |
melanocytes |
| T8039 |
38986-38987 |
. |
denotes |
. |
| T8040 |
38987-39156 |
sentence |
denotes |
The three gradients are close but not congruent, and it is their proximity that gives rise to the superficial distinction between dorsal and ventral skin of at/at mice. |
| T8041 |
38988-38991 |
DT |
denotes |
The |
| T8042 |
38998-39007 |
NNS |
denotes |
gradients |
| T8043 |
38992-38997 |
CD |
denotes |
three |
| T8044 |
39008-39011 |
VBP |
denotes |
are |
| T8045 |
39012-39017 |
JJ |
denotes |
close |
| T8046 |
39018-39021 |
CC |
denotes |
but |
| T8047 |
39022-39025 |
RB |
denotes |
not |
| T8048 |
39026-39035 |
JJ |
denotes |
congruent |
| T8049 |
39035-39037 |
, |
denotes |
, |
| T8050 |
39037-39040 |
CC |
denotes |
and |
| T8051 |
39041-39043 |
PRP |
denotes |
it |
| T8052 |
39044-39046 |
VBZ |
denotes |
is |
| T8053 |
39047-39052 |
PRP$ |
denotes |
their |
| T8054 |
39053-39062 |
NN |
denotes |
proximity |
| T8055 |
39063-39067 |
WDT |
denotes |
that |
| T8056 |
39068-39073 |
VBZ |
denotes |
gives |
| T8057 |
39074-39078 |
NN |
denotes |
rise |
| T8058 |
39079-39081 |
IN |
denotes |
to |
| T8059 |
39082-39085 |
DT |
denotes |
the |
| T8060 |
39098-39109 |
NN |
denotes |
distinction |
| T8061 |
39086-39097 |
JJ |
denotes |
superficial |
| T8062 |
39110-39117 |
IN |
denotes |
between |
| T8063 |
39118-39124 |
JJ |
denotes |
dorsal |
| T8064 |
39137-39141 |
NN |
denotes |
skin |
| T8065 |
39125-39128 |
CC |
denotes |
and |
| T8066 |
39129-39136 |
JJ |
denotes |
ventral |
| T8067 |
39142-39144 |
IN |
denotes |
of |
| T8068 |
39145-39147 |
NN |
denotes |
at |
| T8069 |
39148-39150 |
NN |
denotes |
at |
| T8070 |
39147-39148 |
SYM |
denotes |
/ |
| T8071 |
39151-39155 |
NNS |
denotes |
mice |
| T8072 |
39155-39156 |
. |
denotes |
. |
| T8073 |
39156-39344 |
sentence |
denotes |
Indeed, slight differences between the regions of transition for pigment-type switching and pigment content give rise to a subtle yellow stripe along the flank (see Figures 1, 2, and 9A). |
| T8074 |
39157-39163 |
RB |
denotes |
Indeed |
| T8075 |
39265-39269 |
VBP |
denotes |
give |
| T8076 |
39163-39165 |
, |
denotes |
, |
| T8077 |
39165-39171 |
JJ |
denotes |
slight |
| T8078 |
39172-39183 |
NNS |
denotes |
differences |
| T8079 |
39184-39191 |
IN |
denotes |
between |
| T8080 |
39192-39195 |
DT |
denotes |
the |
| T8081 |
39196-39203 |
NNS |
denotes |
regions |
| T8082 |
39204-39206 |
IN |
denotes |
of |
| T8083 |
39207-39217 |
NN |
denotes |
transition |
| T8084 |
39218-39221 |
IN |
denotes |
for |
| T8085 |
39222-39229 |
NN |
denotes |
pigment |
| T8086 |
39230-39234 |
NN |
denotes |
type |
| T8087 |
39229-39230 |
HYPH |
denotes |
- |
| T8088 |
39235-39244 |
NN |
denotes |
switching |
| T8089 |
39245-39248 |
CC |
denotes |
and |
| T8090 |
39249-39256 |
NN |
denotes |
pigment |
| T8091 |
39257-39264 |
NN |
denotes |
content |
| T8092 |
39270-39274 |
NN |
denotes |
rise |
| T8093 |
39275-39277 |
IN |
denotes |
to |
| T8094 |
39278-39279 |
DT |
denotes |
a |
| T8095 |
39294-39300 |
NN |
denotes |
stripe |
| T8096 |
39280-39286 |
JJ |
denotes |
subtle |
| T8097 |
39287-39293 |
JJ |
denotes |
yellow |
| T8098 |
39301-39306 |
IN |
denotes |
along |
| T8099 |
39307-39310 |
DT |
denotes |
the |
| T8100 |
39311-39316 |
NN |
denotes |
flank |
| T8101 |
39317-39318 |
-LRB- |
denotes |
( |
| T8102 |
39318-39321 |
VB |
denotes |
see |
| T8103 |
39322-39329 |
NNS |
denotes |
Figures |
| T8104 |
39330-39331 |
CD |
denotes |
1 |
| T8105 |
39331-39333 |
, |
denotes |
, |
| T8106 |
39333-39334 |
CD |
denotes |
2 |
| T8107 |
39334-39336 |
, |
denotes |
, |
| T8108 |
39336-39339 |
CC |
denotes |
and |
| T8109 |
39340-39342 |
CD |
denotes |
9A |
| T8110 |
39342-39343 |
-RRB- |
denotes |
) |
| T8111 |
39343-39344 |
. |
denotes |
. |
| T8112 |
39344-39610 |
sentence |
denotes |
Levels of Agouti mRNA remain high throughout the entire ventrum, but hair pigment content is reduced, giving rise to a cream-colored region in the ventrum that, depending on age and genetic backgrounds, may appear more or less distinct from the yellow flank stripe. |
| T8113 |
39345-39351 |
NNS |
denotes |
Levels |
| T8114 |
39367-39373 |
VBP |
denotes |
remain |
| T8115 |
39352-39354 |
IN |
denotes |
of |
| T8116 |
39355-39361 |
NN |
denotes |
Agouti |
| T8117 |
39362-39366 |
NN |
denotes |
mRNA |
| T8118 |
39374-39378 |
JJ |
denotes |
high |
| T8119 |
39379-39389 |
IN |
denotes |
throughout |
| T8120 |
39390-39393 |
DT |
denotes |
the |
| T8121 |
39401-39408 |
NN |
denotes |
ventrum |
| T8122 |
39394-39400 |
JJ |
denotes |
entire |
| T8123 |
39408-39410 |
, |
denotes |
, |
| T8124 |
39410-39413 |
CC |
denotes |
but |
| T8125 |
39414-39418 |
NN |
denotes |
hair |
| T8126 |
39427-39434 |
NN |
denotes |
content |
| T8127 |
39419-39426 |
NN |
denotes |
pigment |
| T8128 |
39438-39445 |
VBN |
denotes |
reduced |
| T8129 |
39435-39437 |
VBZ |
denotes |
is |
| T8130 |
39445-39447 |
, |
denotes |
, |
| T8131 |
39447-39453 |
VBG |
denotes |
giving |
| T8132 |
39454-39458 |
NN |
denotes |
rise |
| T8133 |
39459-39461 |
IN |
denotes |
to |
| T8134 |
39462-39463 |
DT |
denotes |
a |
| T8135 |
39478-39484 |
NN |
denotes |
region |
| T8136 |
39464-39469 |
NN |
denotes |
cream |
| T8137 |
39470-39477 |
VBN |
denotes |
colored |
| T8138 |
39469-39470 |
HYPH |
denotes |
- |
| T8139 |
39485-39487 |
IN |
denotes |
in |
| T8140 |
39488-39491 |
DT |
denotes |
the |
| T8141 |
39492-39499 |
NN |
denotes |
ventrum |
| T8142 |
39500-39504 |
WDT |
denotes |
that |
| T8143 |
39552-39558 |
VB |
denotes |
appear |
| T8144 |
39504-39506 |
, |
denotes |
, |
| T8145 |
39506-39515 |
VBG |
denotes |
depending |
| T8146 |
39516-39518 |
IN |
denotes |
on |
| T8147 |
39519-39522 |
NN |
denotes |
age |
| T8148 |
39523-39526 |
CC |
denotes |
and |
| T8149 |
39527-39534 |
JJ |
denotes |
genetic |
| T8150 |
39535-39546 |
NNS |
denotes |
backgrounds |
| T8151 |
39546-39548 |
, |
denotes |
, |
| T8152 |
39548-39551 |
MD |
denotes |
may |
| T8153 |
39559-39563 |
RBR |
denotes |
more |
| T8154 |
39572-39580 |
JJ |
denotes |
distinct |
| T8155 |
39564-39566 |
CC |
denotes |
or |
| T8156 |
39567-39571 |
RBR |
denotes |
less |
| T8157 |
39581-39585 |
IN |
denotes |
from |
| T8158 |
39586-39589 |
DT |
denotes |
the |
| T8159 |
39603-39609 |
NN |
denotes |
stripe |
| T8160 |
39590-39596 |
JJ |
denotes |
yellow |
| T8161 |
39597-39602 |
NN |
denotes |
flank |
| T8162 |
39609-39610 |
. |
denotes |
. |
| T8163 |
39610-41130 |
sentence |
denotes |
Figure 9 Model for Acquisition of Dorsoventral Patterning in the Trunk and the Role of Tbx15
(A) A tricolor pigmentation pattern is generated by the combination of distinct mechanisms that affect distribution of Agouti mRNA and histochemical staining for melanocytes; effects of the latter mechanism by itself are evident in ae/ae mice (see Figure 1). In at/at mice, reduced hair melanocyte activity and high levels of Agouti mRNA in the ventrum lead to a cream color; as melanocyte activity gradually increases towards the dorsum, a lateral stripe is apparent on the flank. The distributions of Agouti mRNA and histochemical staining for melanocytes are both affected by Tbx15 and are externally evident by a widening of the lateral stripe and an increased proportion of total skin occupied by the cream-colored area.
(B) The lateral yellow stripe in at/at mice lies at the same level as the limb dorsoventral boundary. As described in the text, we propose that distinct dorsoventral compartments in ectoderm of the trunk provide an instructional cue to the mesoderm, leading to expression of Tbx15 in dorsal trunk mesenchyme and acquisition of dorsal dermis character. In the absence of Tbx15, dorsal mesenchyme assumes ventral characteristics instead. Loss of Tbx15 affects dorsoventral transitions of hair length, pigment content, and expression of the ventral-specific Agouti isoform; however, the former two effects are subtle and contribute little, if at all, to the abnormal pigmentation of adult deH/deH mice. |
| T8164 |
40867-40871 |
NN |
denotes |
Loss |
| T8165 |
40881-40888 |
VBZ |
denotes |
affects |
| T8166 |
40872-40874 |
IN |
denotes |
of |
| T8167 |
40875-40880 |
NN |
denotes |
Tbx15 |
| T8168 |
41034-41037 |
VBP |
denotes |
are |
| T8169 |
40889-40901 |
JJ |
denotes |
dorsoventral |
| T8170 |
40902-40913 |
NNS |
denotes |
transitions |
| T8171 |
40914-40916 |
IN |
denotes |
of |
| T8172 |
40917-40921 |
NN |
denotes |
hair |
| T8173 |
40922-40928 |
NN |
denotes |
length |
| T8174 |
40928-40930 |
, |
denotes |
, |
| T8175 |
40930-40937 |
NN |
denotes |
pigment |
| T8176 |
40938-40945 |
NN |
denotes |
content |
| T8177 |
40945-40947 |
, |
denotes |
, |
| T8178 |
40947-40950 |
CC |
denotes |
and |
| T8179 |
40951-40961 |
NN |
denotes |
expression |
| T8180 |
40962-40964 |
IN |
denotes |
of |
| T8181 |
40965-40968 |
DT |
denotes |
the |
| T8182 |
40993-41000 |
NN |
denotes |
isoform |
| T8183 |
40969-40976 |
JJ |
denotes |
ventral |
| T8184 |
40977-40985 |
JJ |
denotes |
specific |
| T8185 |
40976-40977 |
HYPH |
denotes |
- |
| T8186 |
40986-40992 |
NN |
denotes |
Agouti |
| T8187 |
41000-41001 |
: |
denotes |
; |
| T8188 |
41002-41009 |
RB |
denotes |
however |
| T8189 |
41009-41011 |
, |
denotes |
, |
| T8190 |
41011-41014 |
DT |
denotes |
the |
| T8191 |
41026-41033 |
NNS |
denotes |
effects |
| T8192 |
41015-41021 |
JJ |
denotes |
former |
| T8193 |
41022-41025 |
CD |
denotes |
two |
| T8194 |
41038-41044 |
JJ |
denotes |
subtle |
| T8195 |
41045-41048 |
CC |
denotes |
and |
| T8196 |
41049-41059 |
VBP |
denotes |
contribute |
| T8197 |
41060-41066 |
JJ |
denotes |
little |
| T8198 |
41066-41068 |
, |
denotes |
, |
| T8199 |
41074-41077 |
RB |
denotes |
all |
| T8200 |
41068-41070 |
IN |
denotes |
if |
| T8201 |
41071-41073 |
RB |
denotes |
at |
| T8202 |
41077-41079 |
, |
denotes |
, |
| T8203 |
41079-41081 |
IN |
denotes |
to |
| T8204 |
41082-41085 |
DT |
denotes |
the |
| T8205 |
41095-41107 |
NN |
denotes |
pigmentation |
| T8206 |
41086-41094 |
JJ |
denotes |
abnormal |
| T8207 |
41108-41110 |
IN |
denotes |
of |
| T8208 |
41111-41116 |
JJ |
denotes |
adult |
| T8209 |
41125-41129 |
NNS |
denotes |
mice |
| T8210 |
41117-41120 |
NN |
denotes |
deH |
| T8211 |
41121-41124 |
NN |
denotes |
deH |
| T8212 |
41120-41121 |
SYM |
denotes |
/ |
| T8213 |
41129-41130 |
. |
denotes |
. |
| T8214 |
41130-41341 |
sentence |
denotes |
Thus, despite the abnormal pattern of dark skin in neonatal deH/deH mice (e.g., Figure 2D), the most obvious feature in adults is dorsal displacement of the “boundary” between black and yellow hair (Figure 9A). |
| T8215 |
41131-41135 |
RB |
denotes |
Thus |
| T8216 |
41258-41260 |
VBZ |
denotes |
is |
| T8217 |
41135-41137 |
, |
denotes |
, |
| T8218 |
41137-41144 |
IN |
denotes |
despite |
| T8219 |
41145-41148 |
DT |
denotes |
the |
| T8220 |
41158-41165 |
NN |
denotes |
pattern |
| T8221 |
41149-41157 |
JJ |
denotes |
abnormal |
| T8222 |
41166-41168 |
IN |
denotes |
of |
| T8223 |
41169-41173 |
JJ |
denotes |
dark |
| T8224 |
41174-41178 |
NN |
denotes |
skin |
| T8225 |
41179-41181 |
IN |
denotes |
in |
| T8226 |
41182-41190 |
JJ |
denotes |
neonatal |
| T8227 |
41199-41203 |
NNS |
denotes |
mice |
| T8228 |
41191-41194 |
NN |
denotes |
deH |
| T8229 |
41195-41198 |
NN |
denotes |
deH |
| T8230 |
41194-41195 |
SYM |
denotes |
/ |
| T8231 |
41204-41205 |
-LRB- |
denotes |
( |
| T8232 |
41211-41217 |
NN |
denotes |
Figure |
| T8233 |
41205-41209 |
FW |
denotes |
e.g. |
| T8234 |
41209-41211 |
, |
denotes |
, |
| T8235 |
41218-41220 |
CD |
denotes |
2D |
| T8236 |
41220-41221 |
-RRB- |
denotes |
) |
| T8237 |
41221-41223 |
, |
denotes |
, |
| T8238 |
41223-41226 |
DT |
denotes |
the |
| T8239 |
41240-41247 |
NN |
denotes |
feature |
| T8240 |
41227-41231 |
RBS |
denotes |
most |
| T8241 |
41232-41239 |
JJ |
denotes |
obvious |
| T8242 |
41248-41250 |
IN |
denotes |
in |
| T8243 |
41251-41257 |
NNS |
denotes |
adults |
| T8244 |
41261-41267 |
JJ |
denotes |
dorsal |
| T8245 |
41268-41280 |
NN |
denotes |
displacement |
| T8246 |
41281-41283 |
IN |
denotes |
of |
| T8247 |
41284-41287 |
DT |
denotes |
the |
| T8248 |
41289-41297 |
NN |
denotes |
boundary |
| T8249 |
41288-41289 |
`` |
denotes |
“ |
| T8250 |
41297-41298 |
'' |
denotes |
” |
| T8251 |
41299-41306 |
IN |
denotes |
between |
| T8252 |
41307-41312 |
JJ |
denotes |
black |
| T8253 |
41324-41328 |
NN |
denotes |
hair |
| T8254 |
41313-41316 |
CC |
denotes |
and |
| T8255 |
41317-41323 |
JJ |
denotes |
yellow |
| T8256 |
41329-41330 |
-LRB- |
denotes |
( |
| T8257 |
41330-41336 |
NN |
denotes |
Figure |
| T8258 |
41337-41339 |
CD |
denotes |
9A |
| T8259 |
41339-41340 |
-RRB- |
denotes |
) |
| T8260 |
41340-41341 |
. |
denotes |
. |
| T8496 |
41343-41351 |
NN |
denotes |
Genetics |
| T8497 |
41352-41354 |
IN |
denotes |
of |
| T8498 |
41355-41360 |
NN |
denotes |
Tbx15 |
| T8499 |
41360-41656 |
sentence |
denotes |
Named for the presence of a DNA-binding domain first identified in the mouse Brachyury gene (haploinsufficiency causes a short tail), T box–containing genes have been identified as developmental regulators in a wide spectrum of tissues and multicellular organisms (reviewed in Papaioannou 2001). |
| T8500 |
41361-41366 |
VBN |
denotes |
Named |
| T8501 |
41528-41538 |
VBN |
denotes |
identified |
| T8502 |
41367-41370 |
IN |
denotes |
for |
| T8503 |
41371-41374 |
DT |
denotes |
the |
| T8504 |
41375-41383 |
NN |
denotes |
presence |
| T8505 |
41384-41386 |
IN |
denotes |
of |
| T8506 |
41387-41388 |
DT |
denotes |
a |
| T8507 |
41401-41407 |
NN |
denotes |
domain |
| T8508 |
41389-41392 |
NN |
denotes |
DNA |
| T8509 |
41393-41400 |
VBG |
denotes |
binding |
| T8510 |
41392-41393 |
HYPH |
denotes |
- |
| T8511 |
41408-41413 |
RB |
denotes |
first |
| T8512 |
41414-41424 |
VBN |
denotes |
identified |
| T8513 |
41425-41427 |
IN |
denotes |
in |
| T8514 |
41428-41431 |
DT |
denotes |
the |
| T8515 |
41448-41452 |
NN |
denotes |
gene |
| T8516 |
41432-41437 |
NN |
denotes |
mouse |
| T8517 |
41438-41447 |
NN |
denotes |
Brachyury |
| T8518 |
41453-41454 |
-LRB- |
denotes |
( |
| T8519 |
41473-41479 |
VBZ |
denotes |
causes |
| T8520 |
41454-41472 |
NN |
denotes |
haploinsufficiency |
| T8521 |
41480-41481 |
DT |
denotes |
a |
| T8522 |
41488-41492 |
NN |
denotes |
tail |
| T8523 |
41482-41487 |
JJ |
denotes |
short |
| T8524 |
41492-41493 |
-RRB- |
denotes |
) |
| T8525 |
41493-41495 |
, |
denotes |
, |
| T8526 |
41495-41496 |
NN |
denotes |
T |
| T8527 |
41497-41500 |
NN |
denotes |
box |
| T8528 |
41501-41511 |
VBG |
denotes |
containing |
| T8529 |
41500-41501 |
HYPH |
denotes |
– |
| T8530 |
41512-41517 |
NNS |
denotes |
genes |
| T8531 |
41518-41522 |
VBP |
denotes |
have |
| T8532 |
41523-41527 |
VBN |
denotes |
been |
| T8533 |
41539-41541 |
IN |
denotes |
as |
| T8534 |
41542-41555 |
JJ |
denotes |
developmental |
| T8535 |
41556-41566 |
NNS |
denotes |
regulators |
| T8536 |
41567-41569 |
IN |
denotes |
in |
| T8537 |
41570-41571 |
DT |
denotes |
a |
| T8538 |
41577-41585 |
NN |
denotes |
spectrum |
| T8539 |
41572-41576 |
JJ |
denotes |
wide |
| T8540 |
41586-41588 |
IN |
denotes |
of |
| T8541 |
41589-41596 |
NNS |
denotes |
tissues |
| T8542 |
41597-41600 |
CC |
denotes |
and |
| T8543 |
41601-41614 |
JJ |
denotes |
multicellular |
| T8544 |
41615-41624 |
NNS |
denotes |
organisms |
| T8545 |
41625-41626 |
-LRB- |
denotes |
( |
| T8546 |
41626-41634 |
VBN |
denotes |
reviewed |
| T8547 |
41635-41637 |
IN |
denotes |
in |
| T8548 |
41638-41649 |
NNP |
denotes |
Papaioannou |
| T8549 |
41650-41654 |
CD |
denotes |
2001 |
| T8550 |
41654-41655 |
-RRB- |
denotes |
) |
| T8551 |
41655-41656 |
. |
denotes |
. |
| T8552 |
41656-41878 |
sentence |
denotes |
The Tbx15 subfamily, which also includes Tbx18 and Tbx22, is likely to have arisen during early chordate evolution since there is a single gene in amphioxus but no obvious homolog in the fly genome (Ruvinsky et al. 2000). |
| T8553 |
41657-41660 |
DT |
denotes |
The |
| T8554 |
41667-41676 |
NN |
denotes |
subfamily |
| T8555 |
41661-41666 |
NN |
denotes |
Tbx15 |
| T8556 |
41715-41717 |
VBZ |
denotes |
is |
| T8557 |
41676-41678 |
, |
denotes |
, |
| T8558 |
41678-41683 |
WDT |
denotes |
which |
| T8559 |
41689-41697 |
VBZ |
denotes |
includes |
| T8560 |
41684-41688 |
RB |
denotes |
also |
| T8561 |
41698-41703 |
NN |
denotes |
Tbx18 |
| T8562 |
41704-41707 |
CC |
denotes |
and |
| T8563 |
41708-41713 |
NN |
denotes |
Tbx22 |
| T8564 |
41713-41715 |
, |
denotes |
, |
| T8565 |
41718-41724 |
JJ |
denotes |
likely |
| T8566 |
41725-41727 |
TO |
denotes |
to |
| T8567 |
41733-41739 |
VBN |
denotes |
arisen |
| T8568 |
41728-41732 |
VB |
denotes |
have |
| T8569 |
41740-41746 |
IN |
denotes |
during |
| T8570 |
41747-41752 |
JJ |
denotes |
early |
| T8571 |
41762-41771 |
NN |
denotes |
evolution |
| T8572 |
41753-41761 |
NN |
denotes |
chordate |
| T8573 |
41772-41777 |
IN |
denotes |
since |
| T8574 |
41784-41786 |
VBZ |
denotes |
is |
| T8575 |
41778-41783 |
EX |
denotes |
there |
| T8576 |
41787-41788 |
DT |
denotes |
a |
| T8577 |
41796-41800 |
NN |
denotes |
gene |
| T8578 |
41789-41795 |
JJ |
denotes |
single |
| T8579 |
41801-41803 |
IN |
denotes |
in |
| T8580 |
41804-41813 |
NN |
denotes |
amphioxus |
| T8581 |
41814-41817 |
CC |
denotes |
but |
| T8582 |
41818-41820 |
DT |
denotes |
no |
| T8583 |
41829-41836 |
NN |
denotes |
homolog |
| T8584 |
41821-41828 |
JJ |
denotes |
obvious |
| T8585 |
41837-41839 |
IN |
denotes |
in |
| T8586 |
41840-41843 |
DT |
denotes |
the |
| T8587 |
41848-41854 |
NN |
denotes |
genome |
| T8588 |
41844-41847 |
NN |
denotes |
fly |
| T8589 |
41855-41856 |
-LRB- |
denotes |
( |
| T8590 |
41856-41864 |
NNP |
denotes |
Ruvinsky |
| T8591 |
41865-41867 |
FW |
denotes |
et |
| T8592 |
41868-41871 |
FW |
denotes |
al. |
| T8593 |
41872-41876 |
CD |
denotes |
2000 |
| T8594 |
41876-41877 |
-RRB- |
denotes |
) |
| T8595 |
41877-41878 |
. |
denotes |
. |
| T8596 |
41878-42248 |
sentence |
denotes |
Consistent with this relationship, the three genes are expressed in partially overlapping patterns that include anterior somites (Tbx18 and Tbx22), limb mesenchyme (Tbx15 and Tbx18), and craniofacial mesenchyme (all three genes, Tbx15 more broadly than Tbx18 or Tbx22) (Agulnik et al. 1998; Kraus et al. 2001; Braybrook et al. 2002; Bush et al. 2002; Herr et al. 2003). |
| T8597 |
41879-41889 |
JJ |
denotes |
Consistent |
| T8598 |
41934-41943 |
VBN |
denotes |
expressed |
| T8599 |
41890-41894 |
IN |
denotes |
with |
| T8600 |
41895-41899 |
DT |
denotes |
this |
| T8601 |
41900-41912 |
NN |
denotes |
relationship |
| T8602 |
41912-41914 |
, |
denotes |
, |
| T8603 |
41914-41917 |
DT |
denotes |
the |
| T8604 |
41924-41929 |
NNS |
denotes |
genes |
| T8605 |
41918-41923 |
CD |
denotes |
three |
| T8606 |
41930-41933 |
VBP |
denotes |
are |
| T8607 |
41944-41946 |
IN |
denotes |
in |
| T8608 |
41947-41956 |
RB |
denotes |
partially |
| T8609 |
41957-41968 |
VBG |
denotes |
overlapping |
| T8610 |
41969-41977 |
NNS |
denotes |
patterns |
| T8611 |
41978-41982 |
WDT |
denotes |
that |
| T8612 |
41983-41990 |
VBP |
denotes |
include |
| T8613 |
41991-41999 |
JJ |
denotes |
anterior |
| T8614 |
42000-42007 |
NNS |
denotes |
somites |
| T8615 |
42008-42009 |
-LRB- |
denotes |
( |
| T8616 |
42009-42014 |
NN |
denotes |
Tbx18 |
| T8617 |
42015-42018 |
CC |
denotes |
and |
| T8618 |
42019-42024 |
NN |
denotes |
Tbx22 |
| T8619 |
42024-42025 |
-RRB- |
denotes |
) |
| T8620 |
42025-42027 |
, |
denotes |
, |
| T8621 |
42027-42031 |
NN |
denotes |
limb |
| T8622 |
42032-42042 |
NN |
denotes |
mesenchyme |
| T8623 |
42043-42044 |
-LRB- |
denotes |
( |
| T8624 |
42044-42049 |
NN |
denotes |
Tbx15 |
| T8625 |
42050-42053 |
CC |
denotes |
and |
| T8626 |
42054-42059 |
NN |
denotes |
Tbx18 |
| T8627 |
42059-42060 |
-RRB- |
denotes |
) |
| T8628 |
42060-42062 |
, |
denotes |
, |
| T8629 |
42062-42065 |
CC |
denotes |
and |
| T8630 |
42066-42078 |
JJ |
denotes |
craniofacial |
| T8631 |
42079-42089 |
NN |
denotes |
mesenchyme |
| T8632 |
42090-42091 |
-LRB- |
denotes |
( |
| T8633 |
42101-42106 |
NNS |
denotes |
genes |
| T8634 |
42091-42094 |
DT |
denotes |
all |
| T8635 |
42095-42100 |
CD |
denotes |
three |
| T8636 |
42106-42108 |
, |
denotes |
, |
| T8637 |
42108-42113 |
NN |
denotes |
Tbx15 |
| T8638 |
42114-42118 |
RBR |
denotes |
more |
| T8639 |
42119-42126 |
RB |
denotes |
broadly |
| T8640 |
42127-42131 |
IN |
denotes |
than |
| T8641 |
42132-42137 |
NN |
denotes |
Tbx18 |
| T8642 |
42138-42140 |
CC |
denotes |
or |
| T8643 |
42141-42146 |
NN |
denotes |
Tbx22 |
| T8644 |
42146-42147 |
-RRB- |
denotes |
) |
| T8645 |
42148-42149 |
-LRB- |
denotes |
( |
| T8646 |
42149-42156 |
NNP |
denotes |
Agulnik |
| T8647 |
42157-42159 |
FW |
denotes |
et |
| T8648 |
42160-42163 |
FW |
denotes |
al. |
| T8649 |
42164-42168 |
CD |
denotes |
1998 |
| T8650 |
42168-42169 |
: |
denotes |
; |
| T8651 |
42170-42175 |
NNP |
denotes |
Kraus |
| T8652 |
42176-42178 |
FW |
denotes |
et |
| T8653 |
42179-42182 |
FW |
denotes |
al. |
| T8654 |
42183-42187 |
CD |
denotes |
2001 |
| T8655 |
42187-42188 |
: |
denotes |
; |
| T8656 |
42189-42198 |
NNP |
denotes |
Braybrook |
| T8657 |
42199-42201 |
FW |
denotes |
et |
| T8658 |
42202-42205 |
FW |
denotes |
al. |
| T8659 |
42206-42210 |
CD |
denotes |
2002 |
| T8660 |
42210-42211 |
: |
denotes |
; |
| T8661 |
42212-42216 |
NNP |
denotes |
Bush |
| T8662 |
42217-42219 |
FW |
denotes |
et |
| T8663 |
42220-42223 |
FW |
denotes |
al. |
| T8664 |
42224-42228 |
CD |
denotes |
2002 |
| T8665 |
42228-42229 |
: |
denotes |
; |
| T8666 |
42230-42234 |
NNP |
denotes |
Herr |
| T8667 |
42235-42237 |
FW |
denotes |
et |
| T8668 |
42238-42241 |
FW |
denotes |
al. |
| T8669 |
42242-42246 |
CD |
denotes |
2003 |
| T8670 |
42246-42247 |
-RRB- |
denotes |
) |
| T8671 |
42247-42248 |
. |
denotes |
. |
| T8672 |
42248-42540 |
sentence |
denotes |
These observations suggest that an ancestral gene for Tbx15, Tbx18, and Tbx22 may have been important for craniofacial development in cephalochordates, with acquisition of additional expression patterns and developmental functions in the limb and the trunk during early vertebrate evolution. |
| T8673 |
42249-42254 |
DT |
denotes |
These |
| T8674 |
42255-42267 |
NNS |
denotes |
observations |
| T8675 |
42268-42275 |
VBP |
denotes |
suggest |
| T8676 |
42276-42280 |
IN |
denotes |
that |
| T8677 |
42336-42340 |
VBN |
denotes |
been |
| T8678 |
42281-42283 |
DT |
denotes |
an |
| T8679 |
42294-42298 |
NN |
denotes |
gene |
| T8680 |
42284-42293 |
JJ |
denotes |
ancestral |
| T8681 |
42299-42302 |
IN |
denotes |
for |
| T8682 |
42303-42308 |
NN |
denotes |
Tbx15 |
| T8683 |
42308-42310 |
, |
denotes |
, |
| T8684 |
42310-42315 |
NN |
denotes |
Tbx18 |
| T8685 |
42315-42317 |
, |
denotes |
, |
| T8686 |
42317-42320 |
CC |
denotes |
and |
| T8687 |
42321-42326 |
NN |
denotes |
Tbx22 |
| T8688 |
42327-42330 |
MD |
denotes |
may |
| T8689 |
42331-42335 |
VB |
denotes |
have |
| T8690 |
42341-42350 |
JJ |
denotes |
important |
| T8691 |
42351-42354 |
IN |
denotes |
for |
| T8692 |
42355-42367 |
JJ |
denotes |
craniofacial |
| T8693 |
42368-42379 |
NN |
denotes |
development |
| T8694 |
42380-42382 |
IN |
denotes |
in |
| T8695 |
42383-42399 |
NNS |
denotes |
cephalochordates |
| T8696 |
42399-42401 |
, |
denotes |
, |
| T8697 |
42401-42405 |
IN |
denotes |
with |
| T8698 |
42406-42417 |
NN |
denotes |
acquisition |
| T8699 |
42418-42420 |
IN |
denotes |
of |
| T8700 |
42421-42431 |
JJ |
denotes |
additional |
| T8701 |
42443-42451 |
NNS |
denotes |
patterns |
| T8702 |
42432-42442 |
NN |
denotes |
expression |
| T8703 |
42452-42455 |
CC |
denotes |
and |
| T8704 |
42456-42469 |
JJ |
denotes |
developmental |
| T8705 |
42470-42479 |
NNS |
denotes |
functions |
| T8706 |
42480-42482 |
IN |
denotes |
in |
| T8707 |
42483-42486 |
DT |
denotes |
the |
| T8708 |
42487-42491 |
NN |
denotes |
limb |
| T8709 |
42492-42495 |
CC |
denotes |
and |
| T8710 |
42496-42499 |
DT |
denotes |
the |
| T8711 |
42500-42505 |
NN |
denotes |
trunk |
| T8712 |
42506-42512 |
IN |
denotes |
during |
| T8713 |
42513-42518 |
JJ |
denotes |
early |
| T8714 |
42530-42539 |
NN |
denotes |
evolution |
| T8715 |
42519-42529 |
NN |
denotes |
vertebrate |
| T8716 |
42539-42540 |
. |
denotes |
. |
| T8717 |
42540-42740 |
sentence |
denotes |
Expression of Tbx18 and Tbx22 has not been reported in embryonic flank mesenchyme, which suggests that Tbx15 is the only family member involved in establishing the dorsoventral identity of the trunk. |
| T8718 |
42541-42551 |
NN |
denotes |
Expression |
| T8719 |
42584-42592 |
VBN |
denotes |
reported |
| T8720 |
42552-42554 |
IN |
denotes |
of |
| T8721 |
42555-42560 |
NN |
denotes |
Tbx18 |
| T8722 |
42561-42564 |
CC |
denotes |
and |
| T8723 |
42565-42570 |
NN |
denotes |
Tbx22 |
| T8724 |
42571-42574 |
VBZ |
denotes |
has |
| T8725 |
42575-42578 |
RB |
denotes |
not |
| T8726 |
42579-42583 |
VBN |
denotes |
been |
| T8727 |
42593-42595 |
IN |
denotes |
in |
| T8728 |
42596-42605 |
JJ |
denotes |
embryonic |
| T8729 |
42612-42622 |
NN |
denotes |
mesenchyme |
| T8730 |
42606-42611 |
NN |
denotes |
flank |
| T8731 |
42622-42624 |
, |
denotes |
, |
| T8732 |
42624-42629 |
WDT |
denotes |
which |
| T8733 |
42630-42638 |
VBZ |
denotes |
suggests |
| T8734 |
42639-42643 |
IN |
denotes |
that |
| T8735 |
42650-42652 |
VBZ |
denotes |
is |
| T8736 |
42644-42649 |
NN |
denotes |
Tbx15 |
| T8737 |
42653-42656 |
DT |
denotes |
the |
| T8738 |
42669-42675 |
NN |
denotes |
member |
| T8739 |
42657-42661 |
JJ |
denotes |
only |
| T8740 |
42662-42668 |
NN |
denotes |
family |
| T8741 |
42676-42684 |
VBN |
denotes |
involved |
| T8742 |
42685-42687 |
IN |
denotes |
in |
| T8743 |
42688-42700 |
VBG |
denotes |
establishing |
| T8744 |
42701-42704 |
DT |
denotes |
the |
| T8745 |
42718-42726 |
NN |
denotes |
identity |
| T8746 |
42705-42717 |
JJ |
denotes |
dorsoventral |
| T8747 |
42727-42729 |
IN |
denotes |
of |
| T8748 |
42730-42733 |
DT |
denotes |
the |
| T8749 |
42734-42739 |
NN |
denotes |
trunk |
| T8750 |
42739-42740 |
. |
denotes |
. |
| T8751 |
42740-42942 |
sentence |
denotes |
However, it would not be surprising to find some degree of functional redundancy in animals mutated for two or three of the subfamily members in other body regions, particularly the limbs and the head. |
| T8752 |
42741-42748 |
RB |
denotes |
However |
| T8753 |
42763-42765 |
VB |
denotes |
be |
| T8754 |
42748-42750 |
, |
denotes |
, |
| T8755 |
42750-42752 |
PRP |
denotes |
it |
| T8756 |
42753-42758 |
MD |
denotes |
would |
| T8757 |
42759-42762 |
RB |
denotes |
not |
| T8758 |
42766-42776 |
JJ |
denotes |
surprising |
| T8759 |
42777-42779 |
TO |
denotes |
to |
| T8760 |
42780-42784 |
VB |
denotes |
find |
| T8761 |
42785-42789 |
DT |
denotes |
some |
| T8762 |
42790-42796 |
NN |
denotes |
degree |
| T8763 |
42797-42799 |
IN |
denotes |
of |
| T8764 |
42800-42810 |
JJ |
denotes |
functional |
| T8765 |
42811-42821 |
NN |
denotes |
redundancy |
| T8766 |
42822-42824 |
IN |
denotes |
in |
| T8767 |
42825-42832 |
NNS |
denotes |
animals |
| T8768 |
42833-42840 |
VBN |
denotes |
mutated |
| T8769 |
42841-42844 |
IN |
denotes |
for |
| T8770 |
42845-42848 |
CD |
denotes |
two |
| T8771 |
42849-42851 |
CC |
denotes |
or |
| T8772 |
42852-42857 |
CD |
denotes |
three |
| T8773 |
42858-42860 |
IN |
denotes |
of |
| T8774 |
42861-42864 |
DT |
denotes |
the |
| T8775 |
42875-42882 |
NNS |
denotes |
members |
| T8776 |
42865-42874 |
NN |
denotes |
subfamily |
| T8777 |
42883-42885 |
IN |
denotes |
in |
| T8778 |
42886-42891 |
JJ |
denotes |
other |
| T8779 |
42897-42904 |
NNS |
denotes |
regions |
| T8780 |
42892-42896 |
NN |
denotes |
body |
| T8781 |
42904-42906 |
, |
denotes |
, |
| T8782 |
42906-42918 |
RB |
denotes |
particularly |
| T8783 |
42923-42928 |
NNS |
denotes |
limbs |
| T8784 |
42919-42922 |
DT |
denotes |
the |
| T8785 |
42929-42932 |
CC |
denotes |
and |
| T8786 |
42933-42936 |
DT |
denotes |
the |
| T8787 |
42937-42941 |
NN |
denotes |
head |
| T8788 |
42941-42942 |
. |
denotes |
. |
| T8789 |
42942-43064 |
sentence |
denotes |
For example, mutations in Tbx22 cause the human syndrome X-linked cleft palate and ankyloglossia (Braybrook et al. 2001). |
| T8790 |
42943-42946 |
IN |
denotes |
For |
| T8791 |
42975-42980 |
VBP |
denotes |
cause |
| T8792 |
42947-42954 |
NN |
denotes |
example |
| T8793 |
42954-42956 |
, |
denotes |
, |
| T8794 |
42956-42965 |
NNS |
denotes |
mutations |
| T8795 |
42966-42968 |
IN |
denotes |
in |
| T8796 |
42969-42974 |
NN |
denotes |
Tbx22 |
| T8797 |
42981-42984 |
DT |
denotes |
the |
| T8798 |
42991-42999 |
NN |
denotes |
syndrome |
| T8799 |
42985-42990 |
JJ |
denotes |
human |
| T8800 |
43000-43001 |
NN |
denotes |
X |
| T8801 |
43002-43008 |
VBN |
denotes |
linked |
| T8802 |
43001-43002 |
HYPH |
denotes |
- |
| T8803 |
43015-43021 |
NN |
denotes |
palate |
| T8804 |
43009-43014 |
JJ |
denotes |
cleft |
| T8805 |
43022-43025 |
CC |
denotes |
and |
| T8806 |
43026-43039 |
NN |
denotes |
ankyloglossia |
| T8807 |
43040-43041 |
-LRB- |
denotes |
( |
| T8808 |
43041-43050 |
NNP |
denotes |
Braybrook |
| T8809 |
43051-43053 |
FW |
denotes |
et |
| T8810 |
43054-43057 |
FW |
denotes |
al. |
| T8811 |
43058-43062 |
CD |
denotes |
2001 |
| T8812 |
43062-43063 |
-RRB- |
denotes |
) |
| T8813 |
43063-43064 |
. |
denotes |
. |
| T8814 |
43064-43314 |
sentence |
denotes |
Despite high levels of Tbx22 expression in periocular embryonic mesenchyme (Braybrook et al. 2002; Bush et al. 2002; Herr et al. 2003), the condition does not affect the eye, perhaps because residual activity is provided by Tbx15 in the same region. |
| T8815 |
43065-43072 |
IN |
denotes |
Despite |
| T8816 |
43224-43230 |
VB |
denotes |
affect |
| T8817 |
43073-43077 |
JJ |
denotes |
high |
| T8818 |
43078-43084 |
NNS |
denotes |
levels |
| T8819 |
43085-43087 |
IN |
denotes |
of |
| T8820 |
43088-43093 |
NN |
denotes |
Tbx22 |
| T8821 |
43094-43104 |
NN |
denotes |
expression |
| T8822 |
43105-43107 |
IN |
denotes |
in |
| T8823 |
43108-43118 |
JJ |
denotes |
periocular |
| T8824 |
43129-43139 |
NN |
denotes |
mesenchyme |
| T8825 |
43119-43128 |
JJ |
denotes |
embryonic |
| T8826 |
43140-43141 |
-LRB- |
denotes |
( |
| T8827 |
43141-43150 |
NNP |
denotes |
Braybrook |
| T8828 |
43151-43153 |
FW |
denotes |
et |
| T8829 |
43154-43157 |
FW |
denotes |
al. |
| T8830 |
43158-43162 |
CD |
denotes |
2002 |
| T8831 |
43162-43163 |
: |
denotes |
; |
| T8832 |
43164-43168 |
NNP |
denotes |
Bush |
| T8833 |
43169-43171 |
FW |
denotes |
et |
| T8834 |
43172-43175 |
FW |
denotes |
al. |
| T8835 |
43176-43180 |
CD |
denotes |
2002 |
| T8836 |
43180-43181 |
: |
denotes |
; |
| T8837 |
43182-43186 |
NNP |
denotes |
Herr |
| T8838 |
43187-43189 |
FW |
denotes |
et |
| T8839 |
43190-43193 |
FW |
denotes |
al. |
| T8840 |
43194-43198 |
CD |
denotes |
2003 |
| T8841 |
43198-43199 |
-RRB- |
denotes |
) |
| T8842 |
43199-43201 |
, |
denotes |
, |
| T8843 |
43201-43204 |
DT |
denotes |
the |
| T8844 |
43205-43214 |
NN |
denotes |
condition |
| T8845 |
43215-43219 |
VBZ |
denotes |
does |
| T8846 |
43220-43223 |
RB |
denotes |
not |
| T8847 |
43231-43234 |
DT |
denotes |
the |
| T8848 |
43235-43238 |
NN |
denotes |
eye |
| T8849 |
43238-43240 |
, |
denotes |
, |
| T8850 |
43240-43247 |
RB |
denotes |
perhaps |
| T8851 |
43277-43285 |
VBN |
denotes |
provided |
| T8852 |
43248-43255 |
IN |
denotes |
because |
| T8853 |
43256-43264 |
JJ |
denotes |
residual |
| T8854 |
43265-43273 |
NN |
denotes |
activity |
| T8855 |
43274-43276 |
VBZ |
denotes |
is |
| T8856 |
43286-43288 |
IN |
denotes |
by |
| T8857 |
43289-43294 |
NN |
denotes |
Tbx15 |
| T8858 |
43295-43297 |
IN |
denotes |
in |
| T8859 |
43298-43301 |
DT |
denotes |
the |
| T8860 |
43307-43313 |
NN |
denotes |
region |
| T8861 |
43302-43306 |
JJ |
denotes |
same |
| T8862 |
43313-43314 |
. |
denotes |
. |
| T8863 |
43314-43616 |
sentence |
denotes |
In an initial description of the expression and map location of mouse Tbx15, Agulnik et al. (1998) suggested human Tbx15 that lies on Chromosome 1p11.1 as a candidate for acromegaloid facial appearance (AFA) syndrome, for which there is a weak positive LOD score to Chromosome 1p (Hughes et al. 1985). |
| T8864 |
43315-43317 |
IN |
denotes |
In |
| T8865 |
43414-43423 |
VBD |
denotes |
suggested |
| T8866 |
43318-43320 |
DT |
denotes |
an |
| T8867 |
43329-43340 |
NN |
denotes |
description |
| T8868 |
43321-43328 |
JJ |
denotes |
initial |
| T8869 |
43341-43343 |
IN |
denotes |
of |
| T8870 |
43344-43347 |
DT |
denotes |
the |
| T8871 |
43348-43358 |
NN |
denotes |
expression |
| T8872 |
43359-43362 |
CC |
denotes |
and |
| T8873 |
43363-43366 |
NN |
denotes |
map |
| T8874 |
43367-43375 |
NN |
denotes |
location |
| T8875 |
43376-43378 |
IN |
denotes |
of |
| T8876 |
43379-43384 |
NN |
denotes |
mouse |
| T8877 |
43385-43390 |
NN |
denotes |
Tbx15 |
| T8878 |
43390-43392 |
, |
denotes |
, |
| T8879 |
43392-43399 |
NNP |
denotes |
Agulnik |
| T8880 |
43400-43402 |
FW |
denotes |
et |
| T8881 |
43403-43406 |
FW |
denotes |
al. |
| T8882 |
43407-43408 |
-LRB- |
denotes |
( |
| T8883 |
43408-43412 |
CD |
denotes |
1998 |
| T8884 |
43412-43413 |
-RRB- |
denotes |
) |
| T8885 |
43424-43429 |
JJ |
denotes |
human |
| T8886 |
43430-43435 |
NN |
denotes |
Tbx15 |
| T8887 |
43436-43440 |
WDT |
denotes |
that |
| T8888 |
43441-43445 |
VBZ |
denotes |
lies |
| T8889 |
43446-43448 |
IN |
denotes |
on |
| T8890 |
43449-43459 |
NN |
denotes |
Chromosome |
| T8891 |
43460-43466 |
NN |
denotes |
1p11.1 |
| T8892 |
43467-43469 |
IN |
denotes |
as |
| T8893 |
43470-43471 |
DT |
denotes |
a |
| T8894 |
43472-43481 |
NN |
denotes |
candidate |
| T8895 |
43482-43485 |
IN |
denotes |
for |
| T8896 |
43486-43498 |
JJ |
denotes |
acromegaloid |
| T8897 |
43506-43516 |
NN |
denotes |
appearance |
| T8898 |
43499-43505 |
JJ |
denotes |
facial |
| T8899 |
43523-43531 |
NN |
denotes |
syndrome |
| T8900 |
43517-43518 |
-LRB- |
denotes |
( |
| T8901 |
43518-43521 |
NN |
denotes |
AFA |
| T8902 |
43521-43522 |
-RRB- |
denotes |
) |
| T8903 |
43531-43533 |
, |
denotes |
, |
| T8904 |
43533-43536 |
IN |
denotes |
for |
| T8905 |
43549-43551 |
VBZ |
denotes |
is |
| T8906 |
43537-43542 |
WDT |
denotes |
which |
| T8907 |
43543-43548 |
EX |
denotes |
there |
| T8908 |
43552-43553 |
DT |
denotes |
a |
| T8909 |
43572-43577 |
NN |
denotes |
score |
| T8910 |
43554-43558 |
JJ |
denotes |
weak |
| T8911 |
43559-43567 |
JJ |
denotes |
positive |
| T8912 |
43568-43571 |
NN |
denotes |
LOD |
| T8913 |
43578-43580 |
IN |
denotes |
to |
| T8914 |
43581-43591 |
NN |
denotes |
Chromosome |
| T8915 |
43592-43594 |
NN |
denotes |
1p |
| T8916 |
43595-43596 |
-LRB- |
denotes |
( |
| T8917 |
43596-43602 |
NNP |
denotes |
Hughes |
| T8918 |
43603-43605 |
FW |
denotes |
et |
| T8919 |
43606-43609 |
FW |
denotes |
al. |
| T8920 |
43610-43614 |
CD |
denotes |
1985 |
| T8921 |
43614-43615 |
-RRB- |
denotes |
) |
| T8922 |
43615-43616 |
. |
denotes |
. |
| T8923 |
43616-43990 |
sentence |
denotes |
Originally described as a rare autosomal-dominant syndrome with progressive facial coarsening, overgrowth of the intraoral mucosa, and large, doughy hands, more recent case reports describe macrosomia, macrocephaly, or both and generalized hypertrichosis with progressive coarsening (Dallapiccola et al. 1992; Irvine et al. 1996; da Silva et al. 1998; Zelante et al. 2000). |
| T8924 |
43617-43627 |
RB |
denotes |
Originally |
| T8925 |
43628-43637 |
VBN |
denotes |
described |
| T8926 |
43798-43806 |
VBP |
denotes |
describe |
| T8927 |
43638-43640 |
IN |
denotes |
as |
| T8928 |
43641-43642 |
DT |
denotes |
a |
| T8929 |
43667-43675 |
NN |
denotes |
syndrome |
| T8930 |
43643-43647 |
JJ |
denotes |
rare |
| T8931 |
43648-43657 |
JJ |
denotes |
autosomal |
| T8932 |
43658-43666 |
JJ |
denotes |
dominant |
| T8933 |
43657-43658 |
HYPH |
denotes |
- |
| T8934 |
43676-43680 |
IN |
denotes |
with |
| T8935 |
43681-43692 |
JJ |
denotes |
progressive |
| T8936 |
43700-43710 |
NN |
denotes |
coarsening |
| T8937 |
43693-43699 |
JJ |
denotes |
facial |
| T8938 |
43710-43712 |
, |
denotes |
, |
| T8939 |
43712-43722 |
NN |
denotes |
overgrowth |
| T8940 |
43723-43725 |
IN |
denotes |
of |
| T8941 |
43726-43729 |
DT |
denotes |
the |
| T8942 |
43740-43746 |
NN |
denotes |
mucosa |
| T8943 |
43730-43739 |
JJ |
denotes |
intraoral |
| T8944 |
43746-43748 |
, |
denotes |
, |
| T8945 |
43748-43751 |
CC |
denotes |
and |
| T8946 |
43752-43757 |
JJ |
denotes |
large |
| T8947 |
43766-43771 |
NNS |
denotes |
hands |
| T8948 |
43757-43759 |
, |
denotes |
, |
| T8949 |
43759-43765 |
JJ |
denotes |
doughy |
| T8950 |
43771-43773 |
, |
denotes |
, |
| T8951 |
43773-43777 |
RBR |
denotes |
more |
| T8952 |
43778-43784 |
JJ |
denotes |
recent |
| T8953 |
43790-43797 |
NNS |
denotes |
reports |
| T8954 |
43785-43789 |
NN |
denotes |
case |
| T8955 |
43807-43817 |
NN |
denotes |
macrosomia |
| T8956 |
43817-43819 |
, |
denotes |
, |
| T8957 |
43819-43831 |
NN |
denotes |
macrocephaly |
| T8958 |
43831-43833 |
, |
denotes |
, |
| T8959 |
43833-43835 |
CC |
denotes |
or |
| T8960 |
43836-43840 |
DT |
denotes |
both |
| T8961 |
43841-43844 |
CC |
denotes |
and |
| T8962 |
43845-43856 |
VBN |
denotes |
generalized |
| T8963 |
43857-43871 |
NN |
denotes |
hypertrichosis |
| T8964 |
43872-43876 |
IN |
denotes |
with |
| T8965 |
43877-43888 |
JJ |
denotes |
progressive |
| T8966 |
43889-43899 |
NN |
denotes |
coarsening |
| T8967 |
43900-43901 |
-LRB- |
denotes |
( |
| T8968 |
43901-43913 |
NNP |
denotes |
Dallapiccola |
| T8969 |
43914-43916 |
FW |
denotes |
et |
| T8970 |
43917-43920 |
FW |
denotes |
al. |
| T8971 |
43921-43925 |
CD |
denotes |
1992 |
| T8972 |
43925-43926 |
: |
denotes |
; |
| T8973 |
43927-43933 |
NNP |
denotes |
Irvine |
| T8974 |
43934-43936 |
FW |
denotes |
et |
| T8975 |
43937-43940 |
FW |
denotes |
al. |
| T8976 |
43941-43945 |
CD |
denotes |
1996 |
| T8977 |
43945-43946 |
: |
denotes |
; |
| T8978 |
43947-43949 |
NNP |
denotes |
da |
| T8979 |
43950-43955 |
NNP |
denotes |
Silva |
| T8980 |
43956-43958 |
FW |
denotes |
et |
| T8981 |
43959-43962 |
FW |
denotes |
al. |
| T8982 |
43963-43967 |
CD |
denotes |
1998 |
| T8983 |
43967-43968 |
: |
denotes |
; |
| T8984 |
43969-43976 |
NNP |
denotes |
Zelante |
| T8985 |
43977-43979 |
FW |
denotes |
et |
| T8986 |
43980-43983 |
FW |
denotes |
al. |
| T8987 |
43984-43988 |
CD |
denotes |
2000 |
| T8988 |
43988-43989 |
-RRB- |
denotes |
) |
| T8989 |
43989-43990 |
. |
denotes |
. |
| T8990 |
43990-44300 |
sentence |
denotes |
The deH phenotype exhibits little overlap with these features; instead, we suggest a more likely candidate for mutations of human TBX15 would be frontofacionasal syndrome, an unmapped autosomal recessive condition characterized by brachycephaly, blepharophimosis, and midface hypoplasia (Reardon et al. 1994). |
| T8991 |
43991-43994 |
DT |
denotes |
The |
| T8992 |
43999-44008 |
NN |
denotes |
phenotype |
| T8993 |
43995-43998 |
NN |
denotes |
deH |
| T8994 |
44009-44017 |
VBZ |
denotes |
exhibits |
| T8995 |
44066-44073 |
VBP |
denotes |
suggest |
| T8996 |
44018-44024 |
JJ |
denotes |
little |
| T8997 |
44025-44032 |
NN |
denotes |
overlap |
| T8998 |
44033-44037 |
IN |
denotes |
with |
| T8999 |
44038-44043 |
DT |
denotes |
these |
| T9000 |
44044-44052 |
NNS |
denotes |
features |
| T9001 |
44052-44053 |
: |
denotes |
; |
| T9002 |
44054-44061 |
RB |
denotes |
instead |
| T9003 |
44061-44063 |
, |
denotes |
, |
| T9004 |
44063-44065 |
PRP |
denotes |
we |
| T9005 |
44074-44075 |
DT |
denotes |
a |
| T9006 |
44088-44097 |
NN |
denotes |
candidate |
| T9007 |
44076-44080 |
RBR |
denotes |
more |
| T9008 |
44081-44087 |
JJ |
denotes |
likely |
| T9009 |
44133-44135 |
VB |
denotes |
be |
| T9010 |
44098-44101 |
IN |
denotes |
for |
| T9011 |
44102-44111 |
NNS |
denotes |
mutations |
| T9012 |
44112-44114 |
IN |
denotes |
of |
| T9013 |
44115-44120 |
JJ |
denotes |
human |
| T9014 |
44121-44126 |
NN |
denotes |
TBX15 |
| T9015 |
44127-44132 |
MD |
denotes |
would |
| T9016 |
44136-44152 |
JJ |
denotes |
frontofacionasal |
| T9017 |
44153-44161 |
NN |
denotes |
syndrome |
| T9018 |
44161-44163 |
, |
denotes |
, |
| T9019 |
44163-44165 |
DT |
denotes |
an |
| T9020 |
44195-44204 |
NN |
denotes |
condition |
| T9021 |
44166-44174 |
JJ |
denotes |
unmapped |
| T9022 |
44175-44184 |
JJ |
denotes |
autosomal |
| T9023 |
44185-44194 |
JJ |
denotes |
recessive |
| T9024 |
44205-44218 |
VBN |
denotes |
characterized |
| T9025 |
44219-44221 |
IN |
denotes |
by |
| T9026 |
44222-44235 |
RB |
denotes |
brachycephaly |
| T9027 |
44235-44237 |
, |
denotes |
, |
| T9028 |
44237-44253 |
NN |
denotes |
blepharophimosis |
| T9029 |
44253-44255 |
, |
denotes |
, |
| T9030 |
44255-44258 |
CC |
denotes |
and |
| T9031 |
44259-44266 |
JJ |
denotes |
midface |
| T9032 |
44267-44277 |
NN |
denotes |
hypoplasia |
| T9033 |
44278-44279 |
-LRB- |
denotes |
( |
| T9034 |
44279-44286 |
NNP |
denotes |
Reardon |
| T9035 |
44287-44289 |
FW |
denotes |
et |
| T9036 |
44290-44293 |
FW |
denotes |
al. |
| T9037 |
44294-44298 |
CD |
denotes |
1994 |
| T9038 |
44298-44299 |
-RRB- |
denotes |
) |
| T9039 |
44299-44300 |
. |
denotes |
. |
| T9040 |
44300-44553 |
sentence |
denotes |
Two of us (S. Kuijper and F. Meijlink) became interested in the deH mutation because of its effects on skeletal development (Curry 1959) and the possibility that the aristaless-related gene Alx3 might be allelic with droopy ear (ten Berge et al. 1998). |
| T9041 |
44301-44304 |
CD |
denotes |
Two |
| T9042 |
44340-44346 |
VBD |
denotes |
became |
| T9043 |
44305-44307 |
IN |
denotes |
of |
| T9044 |
44308-44310 |
PRP |
denotes |
us |
| T9045 |
44311-44312 |
-LRB- |
denotes |
( |
| T9046 |
44312-44314 |
NNP |
denotes |
S. |
| T9047 |
44315-44322 |
NNP |
denotes |
Kuijper |
| T9048 |
44323-44326 |
CC |
denotes |
and |
| T9049 |
44327-44329 |
NNP |
denotes |
F. |
| T9050 |
44330-44338 |
NNP |
denotes |
Meijlink |
| T9051 |
44338-44339 |
-RRB- |
denotes |
) |
| T9052 |
44347-44357 |
JJ |
denotes |
interested |
| T9053 |
44358-44360 |
IN |
denotes |
in |
| T9054 |
44361-44364 |
DT |
denotes |
the |
| T9055 |
44369-44377 |
NN |
denotes |
mutation |
| T9056 |
44365-44368 |
NN |
denotes |
deH |
| T9057 |
44378-44385 |
IN |
denotes |
because |
| T9058 |
44386-44388 |
IN |
denotes |
of |
| T9059 |
44389-44392 |
PRP$ |
denotes |
its |
| T9060 |
44393-44400 |
NNS |
denotes |
effects |
| T9061 |
44401-44403 |
IN |
denotes |
on |
| T9062 |
44404-44412 |
JJ |
denotes |
skeletal |
| T9063 |
44413-44424 |
NN |
denotes |
development |
| T9064 |
44425-44426 |
-LRB- |
denotes |
( |
| T9065 |
44426-44431 |
NNP |
denotes |
Curry |
| T9066 |
44432-44436 |
CD |
denotes |
1959 |
| T9067 |
44436-44437 |
-RRB- |
denotes |
) |
| T9068 |
44438-44441 |
CC |
denotes |
and |
| T9069 |
44442-44445 |
DT |
denotes |
the |
| T9070 |
44446-44457 |
NN |
denotes |
possibility |
| T9071 |
44458-44462 |
IN |
denotes |
that |
| T9072 |
44502-44504 |
VB |
denotes |
be |
| T9073 |
44463-44466 |
DT |
denotes |
the |
| T9074 |
44486-44490 |
NN |
denotes |
gene |
| T9075 |
44467-44477 |
NN |
denotes |
aristaless |
| T9076 |
44478-44485 |
VBN |
denotes |
related |
| T9077 |
44477-44478 |
HYPH |
denotes |
- |
| T9078 |
44491-44495 |
NN |
denotes |
Alx3 |
| T9079 |
44496-44501 |
MD |
denotes |
might |
| T9080 |
44505-44512 |
JJ |
denotes |
allelic |
| T9081 |
44513-44517 |
IN |
denotes |
with |
| T9082 |
44518-44524 |
JJ |
denotes |
droopy |
| T9083 |
44525-44528 |
NN |
denotes |
ear |
| T9084 |
44529-44530 |
-LRB- |
denotes |
( |
| T9085 |
44530-44533 |
NNP |
denotes |
ten |
| T9086 |
44534-44539 |
NNP |
denotes |
Berge |
| T9087 |
44540-44542 |
FW |
denotes |
et |
| T9088 |
44543-44546 |
FW |
denotes |
al. |
| T9089 |
44547-44551 |
CD |
denotes |
1998 |
| T9090 |
44551-44552 |
-RRB- |
denotes |
) |
| T9091 |
44552-44553 |
. |
denotes |
. |
| T9092 |
44553-44800 |
sentence |
denotes |
In spite of similarities between skeletal phenotypes of deH and Alx3 or Alx4 mutants, subsequent experiments (unpublished data) excluded allelism of Alx3 and deH, and a full description of the Tbx15 skeletal phenotype will be published elsewhere. |
| T9093 |
44554-44556 |
IN |
denotes |
In |
| T9094 |
44682-44690 |
VBD |
denotes |
excluded |
| T9095 |
44557-44562 |
NN |
denotes |
spite |
| T9096 |
44563-44565 |
IN |
denotes |
of |
| T9097 |
44566-44578 |
NNS |
denotes |
similarities |
| T9098 |
44579-44586 |
IN |
denotes |
between |
| T9099 |
44587-44595 |
JJ |
denotes |
skeletal |
| T9100 |
44596-44606 |
NNS |
denotes |
phenotypes |
| T9101 |
44607-44609 |
IN |
denotes |
of |
| T9102 |
44610-44613 |
NN |
denotes |
deH |
| T9103 |
44631-44638 |
NNS |
denotes |
mutants |
| T9104 |
44614-44617 |
CC |
denotes |
and |
| T9105 |
44618-44622 |
NN |
denotes |
Alx3 |
| T9106 |
44623-44625 |
CC |
denotes |
or |
| T9107 |
44626-44630 |
NN |
denotes |
Alx4 |
| T9108 |
44638-44640 |
, |
denotes |
, |
| T9109 |
44640-44650 |
JJ |
denotes |
subsequent |
| T9110 |
44651-44662 |
NNS |
denotes |
experiments |
| T9111 |
44663-44664 |
-LRB- |
denotes |
( |
| T9112 |
44676-44680 |
NNS |
denotes |
data |
| T9113 |
44664-44675 |
JJ |
denotes |
unpublished |
| T9114 |
44680-44681 |
-RRB- |
denotes |
) |
| T9115 |
44691-44699 |
NN |
denotes |
allelism |
| T9116 |
44700-44702 |
IN |
denotes |
of |
| T9117 |
44703-44707 |
NN |
denotes |
Alx3 |
| T9118 |
44708-44711 |
CC |
denotes |
and |
| T9119 |
44712-44715 |
NN |
denotes |
deH |
| T9120 |
44715-44717 |
, |
denotes |
, |
| T9121 |
44717-44720 |
CC |
denotes |
and |
| T9122 |
44721-44722 |
DT |
denotes |
a |
| T9123 |
44728-44739 |
NN |
denotes |
description |
| T9124 |
44723-44727 |
JJ |
denotes |
full |
| T9125 |
44780-44789 |
VBN |
denotes |
published |
| T9126 |
44740-44742 |
IN |
denotes |
of |
| T9127 |
44743-44746 |
DT |
denotes |
the |
| T9128 |
44762-44771 |
NN |
denotes |
phenotype |
| T9129 |
44747-44752 |
NN |
denotes |
Tbx15 |
| T9130 |
44753-44761 |
JJ |
denotes |
skeletal |
| T9131 |
44772-44776 |
MD |
denotes |
will |
| T9132 |
44777-44779 |
VB |
denotes |
be |
| T9133 |
44790-44799 |
RB |
denotes |
elsewhere |
| T9134 |
44799-44800 |
. |
denotes |
. |
| T9366 |
44802-44815 |
JJ |
denotes |
Developmental |
| T9367 |
44816-44825 |
NN |
denotes |
Mechanism |
| T9368 |
44826-44828 |
IN |
denotes |
of |
| T9369 |
44829-44834 |
NN |
denotes |
Tbx15 |
| T9370 |
44835-44845 |
NN |
denotes |
Expression |
| T9371 |
44846-44849 |
CC |
denotes |
and |
| T9372 |
44850-44856 |
NN |
denotes |
Action |
| T9373 |
44857-44859 |
IN |
denotes |
in |
| T9374 |
44860-44863 |
DT |
denotes |
the |
| T9375 |
44864-44868 |
NN |
denotes |
Skin |
| T9376 |
44868-44986 |
sentence |
denotes |
Our attention to the role of Tbx15 in pigment patterning was motivated by the effects of Agouti in postnatal animals. |
| T9377 |
44869-44872 |
PRP$ |
denotes |
Our |
| T9378 |
44873-44882 |
NN |
denotes |
attention |
| T9379 |
44930-44939 |
VBN |
denotes |
motivated |
| T9380 |
44883-44885 |
IN |
denotes |
to |
| T9381 |
44886-44889 |
DT |
denotes |
the |
| T9382 |
44890-44894 |
NN |
denotes |
role |
| T9383 |
44895-44897 |
IN |
denotes |
of |
| T9384 |
44898-44903 |
NN |
denotes |
Tbx15 |
| T9385 |
44904-44906 |
IN |
denotes |
in |
| T9386 |
44907-44914 |
NN |
denotes |
pigment |
| T9387 |
44915-44925 |
NN |
denotes |
patterning |
| T9388 |
44926-44929 |
VBD |
denotes |
was |
| T9389 |
44940-44942 |
IN |
denotes |
by |
| T9390 |
44943-44946 |
DT |
denotes |
the |
| T9391 |
44947-44954 |
NNS |
denotes |
effects |
| T9392 |
44955-44957 |
IN |
denotes |
of |
| T9393 |
44958-44964 |
NN |
denotes |
Agouti |
| T9394 |
44965-44967 |
IN |
denotes |
in |
| T9395 |
44968-44977 |
JJ |
denotes |
postnatal |
| T9396 |
44978-44985 |
NNS |
denotes |
animals |
| T9397 |
44985-44986 |
. |
denotes |
. |
| T9398 |
44986-45101 |
sentence |
denotes |
However, Agouti is also expressed in the embryo, where it provides a convenient marker of ventral dermis identity. |
| T9399 |
44987-44994 |
RB |
denotes |
However |
| T9400 |
45011-45020 |
VBN |
denotes |
expressed |
| T9401 |
44994-44996 |
, |
denotes |
, |
| T9402 |
44996-45002 |
NN |
denotes |
Agouti |
| T9403 |
45003-45005 |
VBZ |
denotes |
is |
| T9404 |
45006-45010 |
RB |
denotes |
also |
| T9405 |
45021-45023 |
IN |
denotes |
in |
| T9406 |
45024-45027 |
DT |
denotes |
the |
| T9407 |
45028-45034 |
NN |
denotes |
embryo |
| T9408 |
45034-45036 |
, |
denotes |
, |
| T9409 |
45036-45041 |
WRB |
denotes |
where |
| T9410 |
45045-45053 |
VBZ |
denotes |
provides |
| T9411 |
45042-45044 |
PRP |
denotes |
it |
| T9412 |
45054-45055 |
DT |
denotes |
a |
| T9413 |
45067-45073 |
NN |
denotes |
marker |
| T9414 |
45056-45066 |
JJ |
denotes |
convenient |
| T9415 |
45074-45076 |
IN |
denotes |
of |
| T9416 |
45077-45084 |
JJ |
denotes |
ventral |
| T9417 |
45092-45100 |
NN |
denotes |
identity |
| T9418 |
45085-45091 |
NN |
denotes |
dermis |
| T9419 |
45100-45101 |
. |
denotes |
. |
| T9420 |
45101-45281 |
sentence |
denotes |
Because an expanded domain of embryonic Agouti expression in deH/deH animals is detectable by E14.5, the effects of Tbx15 on dorsoventral patterning must occur prior to this time. |
| T9421 |
45102-45109 |
IN |
denotes |
Because |
| T9422 |
45179-45181 |
VBZ |
denotes |
is |
| T9423 |
45110-45112 |
DT |
denotes |
an |
| T9424 |
45122-45128 |
NN |
denotes |
domain |
| T9425 |
45113-45121 |
VBN |
denotes |
expanded |
| T9426 |
45129-45131 |
IN |
denotes |
of |
| T9427 |
45132-45141 |
JJ |
denotes |
embryonic |
| T9428 |
45149-45159 |
NN |
denotes |
expression |
| T9429 |
45142-45148 |
NN |
denotes |
Agouti |
| T9430 |
45160-45162 |
IN |
denotes |
in |
| T9431 |
45163-45166 |
NN |
denotes |
deH |
| T9432 |
45167-45170 |
NN |
denotes |
deH |
| T9433 |
45166-45167 |
HYPH |
denotes |
/ |
| T9434 |
45171-45178 |
NNS |
denotes |
animals |
| T9435 |
45256-45261 |
VB |
denotes |
occur |
| T9436 |
45182-45192 |
JJ |
denotes |
detectable |
| T9437 |
45193-45195 |
IN |
denotes |
by |
| T9438 |
45196-45201 |
NN |
denotes |
E14.5 |
| T9439 |
45201-45203 |
, |
denotes |
, |
| T9440 |
45203-45206 |
DT |
denotes |
the |
| T9441 |
45207-45214 |
NNS |
denotes |
effects |
| T9442 |
45215-45217 |
IN |
denotes |
of |
| T9443 |
45218-45223 |
NN |
denotes |
Tbx15 |
| T9444 |
45224-45226 |
IN |
denotes |
on |
| T9445 |
45227-45239 |
JJ |
denotes |
dorsoventral |
| T9446 |
45240-45250 |
NN |
denotes |
patterning |
| T9447 |
45251-45255 |
MD |
denotes |
must |
| T9448 |
45262-45267 |
RB |
denotes |
prior |
| T9449 |
45268-45270 |
IN |
denotes |
to |
| T9450 |
45271-45275 |
DT |
denotes |
this |
| T9451 |
45276-45280 |
NN |
denotes |
time |
| T9452 |
45280-45281 |
. |
denotes |
. |
| T9453 |
45281-45665 |
sentence |
denotes |
Among other T-box genes whose developmental actions are at least partially understood, two general themes have emerged, one focused on the ability to specify alternative fates for an undifferentiated group of precursor cells and another focused on the ability to support proliferative expansion of a cell population whose fate is already determined (reviewed in Tada and Smith 2001). |
| T9454 |
45282-45287 |
IN |
denotes |
Among |
| T9455 |
45393-45400 |
VBN |
denotes |
emerged |
| T9456 |
45288-45293 |
JJ |
denotes |
other |
| T9457 |
45300-45305 |
NNS |
denotes |
genes |
| T9458 |
45294-45295 |
NN |
denotes |
T |
| T9459 |
45296-45299 |
NN |
denotes |
box |
| T9460 |
45295-45296 |
HYPH |
denotes |
- |
| T9461 |
45306-45311 |
WP$ |
denotes |
whose |
| T9462 |
45326-45333 |
NNS |
denotes |
actions |
| T9463 |
45312-45325 |
JJ |
denotes |
developmental |
| T9464 |
45357-45367 |
VBN |
denotes |
understood |
| T9465 |
45334-45337 |
VBP |
denotes |
are |
| T9466 |
45338-45340 |
RB |
denotes |
at |
| T9467 |
45341-45346 |
RBS |
denotes |
least |
| T9468 |
45347-45356 |
RB |
denotes |
partially |
| T9469 |
45367-45369 |
, |
denotes |
, |
| T9470 |
45369-45372 |
CD |
denotes |
two |
| T9471 |
45381-45387 |
NNS |
denotes |
themes |
| T9472 |
45373-45380 |
JJ |
denotes |
general |
| T9473 |
45388-45392 |
VBP |
denotes |
have |
| T9474 |
45400-45402 |
, |
denotes |
, |
| T9475 |
45402-45405 |
CD |
denotes |
one |
| T9476 |
45406-45413 |
VBD |
denotes |
focused |
| T9477 |
45414-45416 |
IN |
denotes |
on |
| T9478 |
45417-45420 |
DT |
denotes |
the |
| T9479 |
45421-45428 |
NN |
denotes |
ability |
| T9480 |
45429-45431 |
TO |
denotes |
to |
| T9481 |
45432-45439 |
VB |
denotes |
specify |
| T9482 |
45440-45451 |
JJ |
denotes |
alternative |
| T9483 |
45452-45457 |
NNS |
denotes |
fates |
| T9484 |
45458-45461 |
IN |
denotes |
for |
| T9485 |
45462-45464 |
DT |
denotes |
an |
| T9486 |
45482-45487 |
NN |
denotes |
group |
| T9487 |
45465-45481 |
JJ |
denotes |
undifferentiated |
| T9488 |
45488-45490 |
IN |
denotes |
of |
| T9489 |
45491-45500 |
NN |
denotes |
precursor |
| T9490 |
45501-45506 |
NNS |
denotes |
cells |
| T9491 |
45507-45510 |
CC |
denotes |
and |
| T9492 |
45511-45518 |
DT |
denotes |
another |
| T9493 |
45519-45526 |
VBD |
denotes |
focused |
| T9494 |
45527-45529 |
IN |
denotes |
on |
| T9495 |
45530-45533 |
DT |
denotes |
the |
| T9496 |
45534-45541 |
NN |
denotes |
ability |
| T9497 |
45542-45544 |
TO |
denotes |
to |
| T9498 |
45545-45552 |
VB |
denotes |
support |
| T9499 |
45553-45566 |
JJ |
denotes |
proliferative |
| T9500 |
45567-45576 |
NN |
denotes |
expansion |
| T9501 |
45577-45579 |
IN |
denotes |
of |
| T9502 |
45580-45581 |
DT |
denotes |
a |
| T9503 |
45587-45597 |
NN |
denotes |
population |
| T9504 |
45582-45586 |
NN |
denotes |
cell |
| T9505 |
45598-45603 |
WP$ |
denotes |
whose |
| T9506 |
45604-45608 |
NN |
denotes |
fate |
| T9507 |
45620-45630 |
VBN |
denotes |
determined |
| T9508 |
45609-45611 |
VBZ |
denotes |
is |
| T9509 |
45612-45619 |
RB |
denotes |
already |
| T9510 |
45631-45632 |
-LRB- |
denotes |
( |
| T9511 |
45632-45640 |
VBN |
denotes |
reviewed |
| T9512 |
45641-45643 |
IN |
denotes |
in |
| T9513 |
45644-45648 |
NNP |
denotes |
Tada |
| T9514 |
45649-45652 |
CC |
denotes |
and |
| T9515 |
45653-45658 |
NNP |
denotes |
Smith |
| T9516 |
45659-45663 |
CD |
denotes |
2001 |
| T9517 |
45663-45664 |
-RRB- |
denotes |
) |
| T9518 |
45664-45665 |
. |
denotes |
. |
| T9519 |
45665-45758 |
sentence |
denotes |
Either mechanism may apply to the apparent dorsal-to-ventral transformation in deH/deH mice. |
| T9520 |
45666-45672 |
DT |
denotes |
Either |
| T9521 |
45673-45682 |
NN |
denotes |
mechanism |
| T9522 |
45687-45692 |
VB |
denotes |
apply |
| T9523 |
45683-45686 |
MD |
denotes |
may |
| T9524 |
45693-45695 |
IN |
denotes |
to |
| T9525 |
45696-45699 |
DT |
denotes |
the |
| T9526 |
45727-45741 |
NN |
denotes |
transformation |
| T9527 |
45700-45708 |
JJ |
denotes |
apparent |
| T9528 |
45709-45715 |
JJ |
denotes |
dorsal |
| T9529 |
45715-45716 |
HYPH |
denotes |
- |
| T9530 |
45716-45718 |
IN |
denotes |
to |
| T9531 |
45718-45719 |
HYPH |
denotes |
- |
| T9532 |
45719-45726 |
JJ |
denotes |
ventral |
| T9533 |
45742-45744 |
IN |
denotes |
in |
| T9534 |
45745-45748 |
NN |
denotes |
deH |
| T9535 |
45749-45752 |
NN |
denotes |
deH |
| T9536 |
45748-45749 |
HYPH |
denotes |
/ |
| T9537 |
45753-45757 |
NNS |
denotes |
mice |
| T9538 |
45757-45758 |
. |
denotes |
. |
| T9539 |
45758-46132 |
sentence |
denotes |
For example, while the expanded domain of Agouti expression in postnatal deH/deH animals can be traced to events that occur between E11.5 and E13.5, the underlying cause may be that embryonic cells in dorsolateral mesenchyme acquire a ventral rather than dorsal identity or that those cells fail to proliferate normally, followed by compensatory expansion of ventral cells. |
| T9540 |
45759-45762 |
IN |
denotes |
For |
| T9541 |
45933-45935 |
VB |
denotes |
be |
| T9542 |
45763-45770 |
NN |
denotes |
example |
| T9543 |
45770-45772 |
, |
denotes |
, |
| T9544 |
45772-45777 |
IN |
denotes |
while |
| T9545 |
45855-45861 |
VBN |
denotes |
traced |
| T9546 |
45778-45781 |
DT |
denotes |
the |
| T9547 |
45791-45797 |
NN |
denotes |
domain |
| T9548 |
45782-45790 |
VBN |
denotes |
expanded |
| T9549 |
45798-45800 |
IN |
denotes |
of |
| T9550 |
45801-45807 |
NN |
denotes |
Agouti |
| T9551 |
45808-45818 |
NN |
denotes |
expression |
| T9552 |
45819-45821 |
IN |
denotes |
in |
| T9553 |
45822-45831 |
JJ |
denotes |
postnatal |
| T9554 |
45840-45847 |
NNS |
denotes |
animals |
| T9555 |
45832-45835 |
NN |
denotes |
deH |
| T9556 |
45836-45839 |
NN |
denotes |
deH |
| T9557 |
45835-45836 |
HYPH |
denotes |
/ |
| T9558 |
45848-45851 |
MD |
denotes |
can |
| T9559 |
45852-45854 |
VB |
denotes |
be |
| T9560 |
45862-45864 |
IN |
denotes |
to |
| T9561 |
45865-45871 |
NNS |
denotes |
events |
| T9562 |
45872-45876 |
WDT |
denotes |
that |
| T9563 |
45877-45882 |
VBP |
denotes |
occur |
| T9564 |
45883-45890 |
IN |
denotes |
between |
| T9565 |
45891-45896 |
NN |
denotes |
E11.5 |
| T9566 |
45897-45900 |
CC |
denotes |
and |
| T9567 |
45901-45906 |
NN |
denotes |
E13.5 |
| T9568 |
45906-45908 |
, |
denotes |
, |
| T9569 |
45908-45911 |
DT |
denotes |
the |
| T9570 |
45923-45928 |
NN |
denotes |
cause |
| T9571 |
45912-45922 |
JJ |
denotes |
underlying |
| T9572 |
45929-45932 |
MD |
denotes |
may |
| T9573 |
45936-45940 |
IN |
denotes |
that |
| T9574 |
45984-45991 |
VBP |
denotes |
acquire |
| T9575 |
45941-45950 |
JJ |
denotes |
embryonic |
| T9576 |
45951-45956 |
NNS |
denotes |
cells |
| T9577 |
45957-45959 |
IN |
denotes |
in |
| T9578 |
45960-45972 |
JJ |
denotes |
dorsolateral |
| T9579 |
45973-45983 |
NN |
denotes |
mesenchyme |
| T9580 |
45992-45993 |
DT |
denotes |
a |
| T9581 |
46021-46029 |
NN |
denotes |
identity |
| T9582 |
45994-46001 |
JJ |
denotes |
ventral |
| T9583 |
46002-46008 |
IN |
denotes |
rather |
| T9584 |
46009-46013 |
IN |
denotes |
than |
| T9585 |
46014-46020 |
JJ |
denotes |
dorsal |
| T9586 |
46030-46032 |
CC |
denotes |
or |
| T9587 |
46033-46037 |
IN |
denotes |
that |
| T9588 |
46050-46054 |
VBP |
denotes |
fail |
| T9589 |
46038-46043 |
DT |
denotes |
those |
| T9590 |
46044-46049 |
NNS |
denotes |
cells |
| T9591 |
46055-46057 |
TO |
denotes |
to |
| T9592 |
46058-46069 |
VB |
denotes |
proliferate |
| T9593 |
46070-46078 |
RB |
denotes |
normally |
| T9594 |
46078-46080 |
, |
denotes |
, |
| T9595 |
46080-46088 |
VBN |
denotes |
followed |
| T9596 |
46089-46091 |
IN |
denotes |
by |
| T9597 |
46092-46104 |
JJ |
denotes |
compensatory |
| T9598 |
46105-46114 |
NN |
denotes |
expansion |
| T9599 |
46115-46117 |
IN |
denotes |
of |
| T9600 |
46118-46125 |
JJ |
denotes |
ventral |
| T9601 |
46126-46131 |
NNS |
denotes |
cells |
| T9602 |
46131-46132 |
. |
denotes |
. |
| T9603 |
46132-46455 |
sentence |
denotes |
Cell lineage studies should provide a definitive answer, but we favor the latter hypothesis, because measurements of dorsoventral regions according to hair color in deH/deH mice revealed a small increase of the cream-colored ventral region in addition to the approximate doubling of the yellow flank region (see Figure 2). |
| T9604 |
46133-46137 |
NN |
denotes |
Cell |
| T9605 |
46138-46145 |
NN |
denotes |
lineage |
| T9606 |
46146-46153 |
NNS |
denotes |
studies |
| T9607 |
46161-46168 |
VB |
denotes |
provide |
| T9608 |
46154-46160 |
MD |
denotes |
should |
| T9609 |
46169-46170 |
DT |
denotes |
a |
| T9610 |
46182-46188 |
NN |
denotes |
answer |
| T9611 |
46171-46181 |
JJ |
denotes |
definitive |
| T9612 |
46188-46190 |
, |
denotes |
, |
| T9613 |
46190-46193 |
CC |
denotes |
but |
| T9614 |
46194-46196 |
PRP |
denotes |
we |
| T9615 |
46197-46202 |
VBP |
denotes |
favor |
| T9616 |
46203-46206 |
DT |
denotes |
the |
| T9617 |
46214-46224 |
NN |
denotes |
hypothesis |
| T9618 |
46207-46213 |
JJ |
denotes |
latter |
| T9619 |
46224-46226 |
, |
denotes |
, |
| T9620 |
46226-46233 |
IN |
denotes |
because |
| T9621 |
46311-46319 |
VBD |
denotes |
revealed |
| T9622 |
46234-46246 |
NNS |
denotes |
measurements |
| T9623 |
46247-46249 |
IN |
denotes |
of |
| T9624 |
46250-46262 |
JJ |
denotes |
dorsoventral |
| T9625 |
46263-46270 |
NNS |
denotes |
regions |
| T9626 |
46271-46280 |
VBG |
denotes |
according |
| T9627 |
46281-46283 |
IN |
denotes |
to |
| T9628 |
46284-46288 |
NN |
denotes |
hair |
| T9629 |
46289-46294 |
NN |
denotes |
color |
| T9630 |
46295-46297 |
IN |
denotes |
in |
| T9631 |
46298-46301 |
NN |
denotes |
deH |
| T9632 |
46302-46305 |
NN |
denotes |
deH |
| T9633 |
46301-46302 |
HYPH |
denotes |
/ |
| T9634 |
46306-46310 |
NNS |
denotes |
mice |
| T9635 |
46320-46321 |
DT |
denotes |
a |
| T9636 |
46328-46336 |
NN |
denotes |
increase |
| T9637 |
46322-46327 |
JJ |
denotes |
small |
| T9638 |
46337-46339 |
IN |
denotes |
of |
| T9639 |
46340-46343 |
DT |
denotes |
the |
| T9640 |
46366-46372 |
NN |
denotes |
region |
| T9641 |
46344-46349 |
JJ |
denotes |
cream |
| T9642 |
46350-46357 |
JJ |
denotes |
colored |
| T9643 |
46349-46350 |
HYPH |
denotes |
- |
| T9644 |
46358-46365 |
JJ |
denotes |
ventral |
| T9645 |
46373-46375 |
IN |
denotes |
in |
| T9646 |
46376-46384 |
NN |
denotes |
addition |
| T9647 |
46385-46387 |
IN |
denotes |
to |
| T9648 |
46388-46391 |
DT |
denotes |
the |
| T9649 |
46404-46412 |
NN |
denotes |
doubling |
| T9650 |
46392-46403 |
JJ |
denotes |
approximate |
| T9651 |
46413-46415 |
IN |
denotes |
of |
| T9652 |
46416-46419 |
DT |
denotes |
the |
| T9653 |
46433-46439 |
NN |
denotes |
region |
| T9654 |
46420-46426 |
JJ |
denotes |
yellow |
| T9655 |
46427-46432 |
NN |
denotes |
flank |
| T9656 |
46440-46441 |
-LRB- |
denotes |
( |
| T9657 |
46441-46444 |
VB |
denotes |
see |
| T9658 |
46445-46451 |
NN |
denotes |
Figure |
| T9659 |
46452-46453 |
CD |
denotes |
2 |
| T9660 |
46453-46454 |
-RRB- |
denotes |
) |
| T9661 |
46454-46455 |
. |
denotes |
. |
| T9662 |
46455-46634 |
sentence |
denotes |
In embryonic mesenchyme, expression of Tbx15 and Agouti are complementary, and it is possible that Tbx15 acts directly to inhibit Agouti transcription in dorsolateral mesenchyme. |
| T9663 |
46456-46458 |
IN |
denotes |
In |
| T9664 |
46512-46515 |
VBP |
denotes |
are |
| T9665 |
46459-46468 |
JJ |
denotes |
embryonic |
| T9666 |
46469-46479 |
NN |
denotes |
mesenchyme |
| T9667 |
46479-46481 |
, |
denotes |
, |
| T9668 |
46481-46491 |
NN |
denotes |
expression |
| T9669 |
46492-46494 |
IN |
denotes |
of |
| T9670 |
46495-46500 |
NN |
denotes |
Tbx15 |
| T9671 |
46501-46504 |
CC |
denotes |
and |
| T9672 |
46505-46511 |
NN |
denotes |
Agouti |
| T9673 |
46516-46529 |
JJ |
denotes |
complementary |
| T9674 |
46529-46531 |
, |
denotes |
, |
| T9675 |
46531-46534 |
CC |
denotes |
and |
| T9676 |
46535-46537 |
PRP |
denotes |
it |
| T9677 |
46538-46540 |
VBZ |
denotes |
is |
| T9678 |
46541-46549 |
JJ |
denotes |
possible |
| T9679 |
46550-46554 |
IN |
denotes |
that |
| T9680 |
46561-46565 |
VBZ |
denotes |
acts |
| T9681 |
46555-46560 |
NN |
denotes |
Tbx15 |
| T9682 |
46566-46574 |
RB |
denotes |
directly |
| T9683 |
46575-46577 |
TO |
denotes |
to |
| T9684 |
46578-46585 |
VB |
denotes |
inhibit |
| T9685 |
46586-46592 |
NN |
denotes |
Agouti |
| T9686 |
46593-46606 |
NN |
denotes |
transcription |
| T9687 |
46607-46609 |
IN |
denotes |
in |
| T9688 |
46610-46622 |
JJ |
denotes |
dorsolateral |
| T9689 |
46623-46633 |
NN |
denotes |
mesenchyme |
| T9690 |
46633-46634 |
. |
denotes |
. |
| T9691 |
46634-46895 |
sentence |
denotes |
However, the ability of Tbx15 to suppress expression of the ventral-specific Agouti isoform in postnatal mice is likely to be indirect, since postnatal expression of Tbx15 occurs broadly along the dorsoventral axis and overlaps extensively with that of Agouti. |
| T9692 |
46635-46642 |
RB |
denotes |
However |
| T9693 |
46745-46747 |
VBZ |
denotes |
is |
| T9694 |
46642-46644 |
, |
denotes |
, |
| T9695 |
46644-46647 |
DT |
denotes |
the |
| T9696 |
46648-46655 |
NN |
denotes |
ability |
| T9697 |
46656-46658 |
IN |
denotes |
of |
| T9698 |
46659-46664 |
NN |
denotes |
Tbx15 |
| T9699 |
46665-46667 |
TO |
denotes |
to |
| T9700 |
46668-46676 |
VB |
denotes |
suppress |
| T9701 |
46677-46687 |
NN |
denotes |
expression |
| T9702 |
46688-46690 |
IN |
denotes |
of |
| T9703 |
46691-46694 |
DT |
denotes |
the |
| T9704 |
46719-46726 |
NN |
denotes |
isoform |
| T9705 |
46695-46702 |
JJ |
denotes |
ventral |
| T9706 |
46703-46711 |
JJ |
denotes |
specific |
| T9707 |
46702-46703 |
HYPH |
denotes |
- |
| T9708 |
46712-46718 |
NN |
denotes |
Agouti |
| T9709 |
46727-46729 |
IN |
denotes |
in |
| T9710 |
46730-46739 |
JJ |
denotes |
postnatal |
| T9711 |
46740-46744 |
NNS |
denotes |
mice |
| T9712 |
46748-46754 |
JJ |
denotes |
likely |
| T9713 |
46755-46757 |
TO |
denotes |
to |
| T9714 |
46758-46760 |
VB |
denotes |
be |
| T9715 |
46761-46769 |
JJ |
denotes |
indirect |
| T9716 |
46769-46771 |
, |
denotes |
, |
| T9717 |
46771-46776 |
IN |
denotes |
since |
| T9718 |
46807-46813 |
VBZ |
denotes |
occurs |
| T9719 |
46777-46786 |
JJ |
denotes |
postnatal |
| T9720 |
46787-46797 |
NN |
denotes |
expression |
| T9721 |
46798-46800 |
IN |
denotes |
of |
| T9722 |
46801-46806 |
NN |
denotes |
Tbx15 |
| T9723 |
46814-46821 |
RB |
denotes |
broadly |
| T9724 |
46822-46827 |
IN |
denotes |
along |
| T9725 |
46828-46831 |
DT |
denotes |
the |
| T9726 |
46845-46849 |
NN |
denotes |
axis |
| T9727 |
46832-46844 |
JJ |
denotes |
dorsoventral |
| T9728 |
46850-46853 |
CC |
denotes |
and |
| T9729 |
46854-46862 |
VBZ |
denotes |
overlaps |
| T9730 |
46863-46874 |
RB |
denotes |
extensively |
| T9731 |
46875-46879 |
IN |
denotes |
with |
| T9732 |
46880-46884 |
DT |
denotes |
that |
| T9733 |
46885-46887 |
IN |
denotes |
of |
| T9734 |
46888-46894 |
NN |
denotes |
Agouti |
| T9735 |
46894-46895 |
. |
denotes |
. |
| T9736 |
46895-47128 |
sentence |
denotes |
In either case, the targets of Tbx15 action in the skin include genes in addition to Agouti, since hair length and melanocyte distribution exhibit a demonstrable, albeit subtle, alteration in animals that carry a null Agouti allele. |
| T9737 |
46896-46898 |
IN |
denotes |
In |
| T9738 |
46952-46959 |
VBP |
denotes |
include |
| T9739 |
46899-46905 |
DT |
denotes |
either |
| T9740 |
46906-46910 |
NN |
denotes |
case |
| T9741 |
46910-46912 |
, |
denotes |
, |
| T9742 |
46912-46915 |
DT |
denotes |
the |
| T9743 |
46916-46923 |
NNS |
denotes |
targets |
| T9744 |
46924-46926 |
IN |
denotes |
of |
| T9745 |
46927-46932 |
NN |
denotes |
Tbx15 |
| T9746 |
46933-46939 |
NN |
denotes |
action |
| T9747 |
46940-46942 |
IN |
denotes |
in |
| T9748 |
46943-46946 |
DT |
denotes |
the |
| T9749 |
46947-46951 |
NN |
denotes |
skin |
| T9750 |
46960-46965 |
NNS |
denotes |
genes |
| T9751 |
46966-46968 |
IN |
denotes |
in |
| T9752 |
46969-46977 |
NN |
denotes |
addition |
| T9753 |
46978-46980 |
IN |
denotes |
to |
| T9754 |
46981-46987 |
NN |
denotes |
Agouti |
| T9755 |
46987-46989 |
, |
denotes |
, |
| T9756 |
46989-46994 |
IN |
denotes |
since |
| T9757 |
47035-47042 |
VBP |
denotes |
exhibit |
| T9758 |
46995-46999 |
NN |
denotes |
hair |
| T9759 |
47000-47006 |
NN |
denotes |
length |
| T9760 |
47007-47010 |
CC |
denotes |
and |
| T9761 |
47011-47021 |
NN |
denotes |
melanocyte |
| T9762 |
47022-47034 |
NN |
denotes |
distribution |
| T9763 |
47043-47044 |
DT |
denotes |
a |
| T9764 |
47074-47084 |
NN |
denotes |
alteration |
| T9765 |
47045-47057 |
JJ |
denotes |
demonstrable |
| T9766 |
47057-47059 |
, |
denotes |
, |
| T9767 |
47059-47065 |
CC |
denotes |
albeit |
| T9768 |
47066-47072 |
JJ |
denotes |
subtle |
| T9769 |
47072-47074 |
, |
denotes |
, |
| T9770 |
47085-47087 |
IN |
denotes |
in |
| T9771 |
47088-47095 |
NNS |
denotes |
animals |
| T9772 |
47096-47100 |
WDT |
denotes |
that |
| T9773 |
47101-47106 |
VBP |
denotes |
carry |
| T9774 |
47107-47108 |
DT |
denotes |
a |
| T9775 |
47121-47127 |
NN |
denotes |
allele |
| T9776 |
47109-47113 |
JJ |
denotes |
null |
| T9777 |
47114-47120 |
NN |
denotes |
Agouti |
| T9778 |
47127-47128 |
. |
denotes |
. |
| T9779 |
47128-47395 |
sentence |
denotes |
One potential target is Alx4, which, like Agouti, is expressed in ventral embryonic mesenchyme, and, when mutated, affects hair-follicle as well as limb and craniofacial development (Qu et al. 1997, 1998; Wu et al. 2000; Wuyts et al. 2000; Mavrogiannis et al. 2001). |
| T9780 |
47129-47132 |
CD |
denotes |
One |
| T9781 |
47143-47149 |
NN |
denotes |
target |
| T9782 |
47133-47142 |
JJ |
denotes |
potential |
| T9783 |
47150-47152 |
VBZ |
denotes |
is |
| T9784 |
47153-47157 |
NN |
denotes |
Alx4 |
| T9785 |
47157-47159 |
, |
denotes |
, |
| T9786 |
47159-47164 |
WDT |
denotes |
which |
| T9787 |
47182-47191 |
VBN |
denotes |
expressed |
| T9788 |
47164-47166 |
, |
denotes |
, |
| T9789 |
47166-47170 |
IN |
denotes |
like |
| T9790 |
47171-47177 |
NN |
denotes |
Agouti |
| T9791 |
47177-47179 |
, |
denotes |
, |
| T9792 |
47179-47181 |
VBZ |
denotes |
is |
| T9793 |
47192-47194 |
IN |
denotes |
in |
| T9794 |
47195-47202 |
JJ |
denotes |
ventral |
| T9795 |
47213-47223 |
NN |
denotes |
mesenchyme |
| T9796 |
47203-47212 |
JJ |
denotes |
embryonic |
| T9797 |
47223-47225 |
, |
denotes |
, |
| T9798 |
47225-47228 |
CC |
denotes |
and |
| T9799 |
47228-47230 |
, |
denotes |
, |
| T9800 |
47230-47234 |
WRB |
denotes |
when |
| T9801 |
47235-47242 |
VBN |
denotes |
mutated |
| T9802 |
47244-47251 |
VBZ |
denotes |
affects |
| T9803 |
47242-47244 |
, |
denotes |
, |
| T9804 |
47252-47256 |
NN |
denotes |
hair |
| T9805 |
47257-47265 |
NN |
denotes |
follicle |
| T9806 |
47256-47257 |
HYPH |
denotes |
- |
| T9807 |
47299-47310 |
NN |
denotes |
development |
| T9808 |
47266-47268 |
RB |
denotes |
as |
| T9809 |
47274-47276 |
IN |
denotes |
as |
| T9810 |
47269-47273 |
RB |
denotes |
well |
| T9811 |
47277-47281 |
NN |
denotes |
limb |
| T9812 |
47282-47285 |
CC |
denotes |
and |
| T9813 |
47286-47298 |
JJ |
denotes |
craniofacial |
| T9814 |
47311-47312 |
-LRB- |
denotes |
( |
| T9815 |
47312-47314 |
NNP |
denotes |
Qu |
| T9816 |
47315-47317 |
FW |
denotes |
et |
| T9817 |
47318-47321 |
FW |
denotes |
al. |
| T9818 |
47322-47326 |
CD |
denotes |
1997 |
| T9819 |
47326-47328 |
, |
denotes |
, |
| T9820 |
47328-47332 |
CD |
denotes |
1998 |
| T9821 |
47332-47333 |
: |
denotes |
; |
| T9822 |
47334-47336 |
NNP |
denotes |
Wu |
| T9823 |
47337-47339 |
FW |
denotes |
et |
| T9824 |
47340-47343 |
FW |
denotes |
al. |
| T9825 |
47344-47348 |
CD |
denotes |
2000 |
| T9826 |
47348-47349 |
: |
denotes |
; |
| T9827 |
47350-47355 |
NNP |
denotes |
Wuyts |
| T9828 |
47356-47358 |
FW |
denotes |
et |
| T9829 |
47359-47362 |
FW |
denotes |
al. |
| T9830 |
47363-47367 |
CD |
denotes |
2000 |
| T9831 |
47367-47368 |
: |
denotes |
; |
| T9832 |
47369-47381 |
NNP |
denotes |
Mavrogiannis |
| T9833 |
47382-47384 |
FW |
denotes |
et |
| T9834 |
47385-47388 |
FW |
denotes |
al. |
| T9835 |
47389-47393 |
CD |
denotes |
2001 |
| T9836 |
47393-47394 |
-RRB- |
denotes |
) |
| T9837 |
47394-47395 |
. |
denotes |
. |
| T9838 |
47395-47545 |
sentence |
denotes |
However, expression of ventral markers such as Alx4, as well as Alx3 and Msx2, appears to be unaffected at E11.5 in deH/deH embryos (data not shown). |
| T9839 |
47396-47403 |
RB |
denotes |
However |
| T9840 |
47475-47482 |
VBZ |
denotes |
appears |
| T9841 |
47403-47405 |
, |
denotes |
, |
| T9842 |
47405-47415 |
NN |
denotes |
expression |
| T9843 |
47416-47418 |
IN |
denotes |
of |
| T9844 |
47419-47426 |
JJ |
denotes |
ventral |
| T9845 |
47427-47434 |
NNS |
denotes |
markers |
| T9846 |
47435-47439 |
JJ |
denotes |
such |
| T9847 |
47440-47442 |
IN |
denotes |
as |
| T9848 |
47443-47447 |
NN |
denotes |
Alx4 |
| T9849 |
47447-47449 |
, |
denotes |
, |
| T9850 |
47449-47451 |
RB |
denotes |
as |
| T9851 |
47457-47459 |
IN |
denotes |
as |
| T9852 |
47452-47456 |
RB |
denotes |
well |
| T9853 |
47460-47464 |
NN |
denotes |
Alx3 |
| T9854 |
47465-47468 |
CC |
denotes |
and |
| T9855 |
47469-47473 |
NN |
denotes |
Msx2 |
| T9856 |
47473-47475 |
, |
denotes |
, |
| T9857 |
47483-47485 |
TO |
denotes |
to |
| T9858 |
47486-47488 |
VB |
denotes |
be |
| T9859 |
47489-47499 |
JJ |
denotes |
unaffected |
| T9860 |
47500-47502 |
IN |
denotes |
at |
| T9861 |
47503-47508 |
NN |
denotes |
E11.5 |
| T9862 |
47509-47511 |
IN |
denotes |
in |
| T9863 |
47512-47515 |
NN |
denotes |
deH |
| T9864 |
47516-47519 |
NN |
denotes |
deH |
| T9865 |
47515-47516 |
HYPH |
denotes |
/ |
| T9866 |
47520-47527 |
NNS |
denotes |
embryos |
| T9867 |
47528-47529 |
-LRB- |
denotes |
( |
| T9868 |
47538-47543 |
VBN |
denotes |
shown |
| T9869 |
47529-47533 |
NNS |
denotes |
data |
| T9870 |
47534-47537 |
RB |
denotes |
not |
| T9871 |
47543-47544 |
-RRB- |
denotes |
) |
| T9872 |
47544-47545 |
. |
denotes |
. |
| T10219 |
47547-47558 |
NNS |
denotes |
Differences |
| T10220 |
47559-47562 |
CC |
denotes |
and |
| T10221 |
47563-47575 |
NNS |
denotes |
Similarities |
| T10222 |
47576-47578 |
IN |
denotes |
to |
| T10223 |
47579-47591 |
JJ |
denotes |
Dorsoventral |
| T10224 |
47597-47607 |
NN |
denotes |
Patterning |
| T10225 |
47592-47596 |
NN |
denotes |
Limb |
| T10226 |
47607-47770 |
sentence |
denotes |
Loss of Tbx15 also affects regional distribution of hair color in the limbs, with areas that would normally produce black hair giving rise to yellow hair instead. |
| T10227 |
47608-47612 |
NN |
denotes |
Loss |
| T10228 |
47627-47634 |
VBZ |
denotes |
affects |
| T10229 |
47613-47615 |
IN |
denotes |
of |
| T10230 |
47616-47621 |
NN |
denotes |
Tbx15 |
| T10231 |
47622-47626 |
RB |
denotes |
also |
| T10232 |
47635-47643 |
JJ |
denotes |
regional |
| T10233 |
47644-47656 |
NN |
denotes |
distribution |
| T10234 |
47657-47659 |
IN |
denotes |
of |
| T10235 |
47660-47664 |
NN |
denotes |
hair |
| T10236 |
47665-47670 |
NN |
denotes |
color |
| T10237 |
47671-47673 |
IN |
denotes |
in |
| T10238 |
47674-47677 |
DT |
denotes |
the |
| T10239 |
47678-47683 |
NNS |
denotes |
limbs |
| T10240 |
47683-47685 |
, |
denotes |
, |
| T10241 |
47685-47689 |
IN |
denotes |
with |
| T10242 |
47690-47695 |
NNS |
denotes |
areas |
| T10243 |
47735-47741 |
VBG |
denotes |
giving |
| T10244 |
47696-47700 |
WDT |
denotes |
that |
| T10245 |
47716-47723 |
VB |
denotes |
produce |
| T10246 |
47701-47706 |
MD |
denotes |
would |
| T10247 |
47707-47715 |
RB |
denotes |
normally |
| T10248 |
47724-47729 |
JJ |
denotes |
black |
| T10249 |
47730-47734 |
NN |
denotes |
hair |
| T10250 |
47742-47746 |
NN |
denotes |
rise |
| T10251 |
47747-47749 |
IN |
denotes |
to |
| T10252 |
47750-47756 |
JJ |
denotes |
yellow |
| T10253 |
47757-47761 |
NN |
denotes |
hair |
| T10254 |
47762-47769 |
RB |
denotes |
instead |
| T10255 |
47769-47770 |
. |
denotes |
. |
| T10256 |
47770-47928 |
sentence |
denotes |
However, neither normal patterns of pigment-type synthesis in the limb nor their disruption in deH/deH mice correspond to obvious developmental compartments. |
| T10257 |
47771-47778 |
RB |
denotes |
However |
| T10258 |
47879-47889 |
VBP |
denotes |
correspond |
| T10259 |
47778-47780 |
, |
denotes |
, |
| T10260 |
47780-47787 |
CC |
denotes |
neither |
| T10261 |
47795-47803 |
NNS |
denotes |
patterns |
| T10262 |
47788-47794 |
JJ |
denotes |
normal |
| T10263 |
47804-47806 |
IN |
denotes |
of |
| T10264 |
47807-47814 |
JJ |
denotes |
pigment |
| T10265 |
47815-47819 |
NN |
denotes |
type |
| T10266 |
47814-47815 |
HYPH |
denotes |
- |
| T10267 |
47820-47829 |
NN |
denotes |
synthesis |
| T10268 |
47830-47832 |
IN |
denotes |
in |
| T10269 |
47833-47836 |
DT |
denotes |
the |
| T10270 |
47837-47841 |
NN |
denotes |
limb |
| T10271 |
47842-47845 |
CC |
denotes |
nor |
| T10272 |
47846-47851 |
PRP$ |
denotes |
their |
| T10273 |
47852-47862 |
NN |
denotes |
disruption |
| T10274 |
47863-47865 |
IN |
denotes |
in |
| T10275 |
47866-47869 |
NN |
denotes |
deH |
| T10276 |
47870-47873 |
NN |
denotes |
deH |
| T10277 |
47869-47870 |
HYPH |
denotes |
/ |
| T10278 |
47874-47878 |
NNS |
denotes |
mice |
| T10279 |
47890-47892 |
IN |
denotes |
to |
| T10280 |
47893-47900 |
JJ |
denotes |
obvious |
| T10281 |
47915-47927 |
NNS |
denotes |
compartments |
| T10282 |
47901-47914 |
JJ |
denotes |
developmental |
| T10283 |
47927-47928 |
. |
denotes |
. |
| T10284 |
47928-48262 |
sentence |
denotes |
Furthermore, losses of function for En1 or Wnt7a, which cause a partial transformation of the distal limb from dorsum to ventrum (Loomis et al. 1996) or ventrum to dorsum (Parr and McMahon 1995), respectively, have no effect on regional patterns of Agouti expression or distribution of hair-color regions (Y. Chen, unpublished data). |
| T10285 |
47929-47940 |
RB |
denotes |
Furthermore |
| T10286 |
48139-48143 |
VBP |
denotes |
have |
| T10287 |
47940-47942 |
, |
denotes |
, |
| T10288 |
47942-47948 |
NNS |
denotes |
losses |
| T10289 |
47949-47951 |
IN |
denotes |
of |
| T10290 |
47952-47960 |
NN |
denotes |
function |
| T10291 |
47961-47964 |
IN |
denotes |
for |
| T10292 |
47965-47968 |
NN |
denotes |
En1 |
| T10293 |
47969-47971 |
CC |
denotes |
or |
| T10294 |
47972-47977 |
NN |
denotes |
Wnt7a |
| T10295 |
47977-47979 |
, |
denotes |
, |
| T10296 |
47979-47984 |
WDT |
denotes |
which |
| T10297 |
47985-47990 |
VBP |
denotes |
cause |
| T10298 |
47991-47992 |
DT |
denotes |
a |
| T10299 |
48001-48015 |
NN |
denotes |
transformation |
| T10300 |
47993-48000 |
JJ |
denotes |
partial |
| T10301 |
48016-48018 |
IN |
denotes |
of |
| T10302 |
48019-48022 |
DT |
denotes |
the |
| T10303 |
48030-48034 |
NN |
denotes |
limb |
| T10304 |
48023-48029 |
JJ |
denotes |
distal |
| T10305 |
48035-48039 |
IN |
denotes |
from |
| T10306 |
48040-48046 |
NN |
denotes |
dorsum |
| T10307 |
48047-48049 |
IN |
denotes |
to |
| T10308 |
48050-48057 |
NN |
denotes |
ventrum |
| T10309 |
48058-48059 |
-LRB- |
denotes |
( |
| T10310 |
48059-48065 |
NNP |
denotes |
Loomis |
| T10311 |
48066-48068 |
FW |
denotes |
et |
| T10312 |
48069-48072 |
FW |
denotes |
al. |
| T10313 |
48073-48077 |
CD |
denotes |
1996 |
| T10314 |
48077-48078 |
-RRB- |
denotes |
) |
| T10315 |
48079-48081 |
CC |
denotes |
or |
| T10316 |
48082-48089 |
NN |
denotes |
ventrum |
| T10317 |
48090-48092 |
IN |
denotes |
to |
| T10318 |
48093-48099 |
NN |
denotes |
dorsum |
| T10319 |
48100-48101 |
-LRB- |
denotes |
( |
| T10320 |
48101-48105 |
NNP |
denotes |
Parr |
| T10321 |
48106-48109 |
CC |
denotes |
and |
| T10322 |
48110-48117 |
NNP |
denotes |
McMahon |
| T10323 |
48118-48122 |
CD |
denotes |
1995 |
| T10324 |
48122-48123 |
-RRB- |
denotes |
) |
| T10325 |
48123-48125 |
, |
denotes |
, |
| T10326 |
48125-48137 |
RB |
denotes |
respectively |
| T10327 |
48137-48139 |
, |
denotes |
, |
| T10328 |
48144-48146 |
DT |
denotes |
no |
| T10329 |
48147-48153 |
NN |
denotes |
effect |
| T10330 |
48154-48156 |
IN |
denotes |
on |
| T10331 |
48157-48165 |
JJ |
denotes |
regional |
| T10332 |
48166-48174 |
NNS |
denotes |
patterns |
| T10333 |
48175-48177 |
IN |
denotes |
of |
| T10334 |
48178-48184 |
NN |
denotes |
Agouti |
| T10335 |
48185-48195 |
NN |
denotes |
expression |
| T10336 |
48196-48198 |
CC |
denotes |
or |
| T10337 |
48199-48211 |
NN |
denotes |
distribution |
| T10338 |
48212-48214 |
IN |
denotes |
of |
| T10339 |
48215-48219 |
NN |
denotes |
hair |
| T10340 |
48220-48225 |
NN |
denotes |
color |
| T10341 |
48219-48220 |
HYPH |
denotes |
- |
| T10342 |
48226-48233 |
NNS |
denotes |
regions |
| T10343 |
48234-48235 |
-LRB- |
denotes |
( |
| T10344 |
48235-48237 |
NNP |
denotes |
Y. |
| T10345 |
48238-48242 |
NNP |
denotes |
Chen |
| T10346 |
48242-48244 |
, |
denotes |
, |
| T10347 |
48244-48255 |
JJ |
denotes |
unpublished |
| T10348 |
48256-48260 |
NNS |
denotes |
data |
| T10349 |
48260-48261 |
-RRB- |
denotes |
) |
| T10350 |
48261-48262 |
. |
denotes |
. |
| T10351 |
48262-48581 |
sentence |
denotes |
(Ectopic pigmentation of the ventral footpads that develops in En1 mutant mice is unrelated to pigment-type synthesis and instead likely reflects a requirement for En1, independent of Wnt7a, to repress migration or proliferation (or both) of pigment cells in ventral epidermis [Cygan et al. 1997; Loomis et al. 1998].) |
| T10352 |
48263-48264 |
-LRB- |
denotes |
( |
| T10353 |
48342-48344 |
VBZ |
denotes |
is |
| T10354 |
48264-48271 |
JJ |
denotes |
Ectopic |
| T10355 |
48272-48284 |
NN |
denotes |
pigmentation |
| T10356 |
48285-48287 |
IN |
denotes |
of |
| T10357 |
48288-48291 |
DT |
denotes |
the |
| T10358 |
48300-48308 |
NNS |
denotes |
footpads |
| T10359 |
48292-48299 |
JJ |
denotes |
ventral |
| T10360 |
48309-48313 |
WDT |
denotes |
that |
| T10361 |
48314-48322 |
VBZ |
denotes |
develops |
| T10362 |
48323-48325 |
IN |
denotes |
in |
| T10363 |
48326-48329 |
NN |
denotes |
En1 |
| T10364 |
48337-48341 |
NNS |
denotes |
mice |
| T10365 |
48330-48336 |
NN |
denotes |
mutant |
| T10366 |
48345-48354 |
JJ |
denotes |
unrelated |
| T10367 |
48355-48357 |
IN |
denotes |
to |
| T10368 |
48358-48365 |
NN |
denotes |
pigment |
| T10369 |
48366-48370 |
NN |
denotes |
type |
| T10370 |
48365-48366 |
HYPH |
denotes |
- |
| T10371 |
48371-48380 |
NN |
denotes |
synthesis |
| T10372 |
48381-48384 |
CC |
denotes |
and |
| T10373 |
48385-48392 |
RB |
denotes |
instead |
| T10374 |
48400-48408 |
VBZ |
denotes |
reflects |
| T10375 |
48393-48399 |
RB |
denotes |
likely |
| T10376 |
48409-48410 |
DT |
denotes |
a |
| T10377 |
48411-48422 |
NN |
denotes |
requirement |
| T10378 |
48423-48426 |
IN |
denotes |
for |
| T10379 |
48427-48430 |
NN |
denotes |
En1 |
| T10380 |
48430-48432 |
, |
denotes |
, |
| T10381 |
48432-48443 |
JJ |
denotes |
independent |
| T10382 |
48444-48446 |
IN |
denotes |
of |
| T10383 |
48447-48452 |
NN |
denotes |
Wnt7a |
| T10384 |
48452-48454 |
, |
denotes |
, |
| T10385 |
48454-48456 |
TO |
denotes |
to |
| T10386 |
48457-48464 |
VB |
denotes |
repress |
| T10387 |
48465-48474 |
NN |
denotes |
migration |
| T10388 |
48475-48477 |
CC |
denotes |
or |
| T10389 |
48478-48491 |
NN |
denotes |
proliferation |
| T10390 |
48492-48493 |
-LRB- |
denotes |
( |
| T10391 |
48493-48495 |
CC |
denotes |
or |
| T10392 |
48496-48500 |
DT |
denotes |
both |
| T10393 |
48500-48501 |
-RRB- |
denotes |
) |
| T10394 |
48502-48504 |
IN |
denotes |
of |
| T10395 |
48505-48512 |
NN |
denotes |
pigment |
| T10396 |
48513-48518 |
NNS |
denotes |
cells |
| T10397 |
48519-48521 |
IN |
denotes |
in |
| T10398 |
48522-48529 |
JJ |
denotes |
ventral |
| T10399 |
48530-48539 |
NN |
denotes |
epidermis |
| T10400 |
48540-48541 |
-LRB- |
denotes |
[ |
| T10401 |
48541-48546 |
NNP |
denotes |
Cygan |
| T10402 |
48547-48549 |
FW |
denotes |
et |
| T10403 |
48550-48553 |
FW |
denotes |
al. |
| T10404 |
48554-48558 |
CD |
denotes |
1997 |
| T10405 |
48558-48559 |
: |
denotes |
; |
| T10406 |
48560-48566 |
NNP |
denotes |
Loomis |
| T10407 |
48567-48569 |
FW |
denotes |
et |
| T10408 |
48570-48573 |
FW |
denotes |
al. |
| T10409 |
48574-48578 |
CD |
denotes |
1998 |
| T10410 |
48578-48579 |
-RRB- |
denotes |
] |
| T10411 |
48579-48580 |
. |
denotes |
. |
| T10412 |
48580-48581 |
-RRB- |
denotes |
) |
| T10413 |
48581-48939 |
sentence |
denotes |
These considerations notwithstanding, control of dorsoventral trunk pattern by Tbx15 shares certain features with control of dorsoventral limb patterning by Lmx1b, a LIM domain transcription factor that acts downstream of Wnt7a and En1 (Riddle et al. 1995; Vogel et al. 1995; Cygan et al. 1997; Logan et al. 1997; Loomis et al. 1998; Chen and Johnson 2002). |
| T10414 |
48582-48587 |
DT |
denotes |
These |
| T10415 |
48588-48602 |
NNS |
denotes |
considerations |
| T10416 |
48603-48618 |
RB |
denotes |
notwithstanding |
| T10417 |
48667-48673 |
VBZ |
denotes |
shares |
| T10418 |
48618-48620 |
, |
denotes |
, |
| T10419 |
48620-48627 |
NN |
denotes |
control |
| T10420 |
48628-48630 |
IN |
denotes |
of |
| T10421 |
48631-48643 |
JJ |
denotes |
dorsoventral |
| T10422 |
48650-48657 |
NN |
denotes |
pattern |
| T10423 |
48644-48649 |
NN |
denotes |
trunk |
| T10424 |
48658-48660 |
IN |
denotes |
by |
| T10425 |
48661-48666 |
NN |
denotes |
Tbx15 |
| T10426 |
48674-48681 |
JJ |
denotes |
certain |
| T10427 |
48682-48690 |
NNS |
denotes |
features |
| T10428 |
48691-48695 |
IN |
denotes |
with |
| T10429 |
48696-48703 |
NN |
denotes |
control |
| T10430 |
48704-48706 |
IN |
denotes |
of |
| T10431 |
48707-48719 |
JJ |
denotes |
dorsoventral |
| T10432 |
48725-48735 |
NN |
denotes |
patterning |
| T10433 |
48720-48724 |
NN |
denotes |
limb |
| T10434 |
48736-48738 |
IN |
denotes |
by |
| T10435 |
48739-48744 |
NN |
denotes |
Lmx1b |
| T10436 |
48744-48746 |
, |
denotes |
, |
| T10437 |
48746-48747 |
DT |
denotes |
a |
| T10438 |
48773-48779 |
NN |
denotes |
factor |
| T10439 |
48748-48751 |
NN |
denotes |
LIM |
| T10440 |
48752-48758 |
NN |
denotes |
domain |
| T10441 |
48759-48772 |
NN |
denotes |
transcription |
| T10442 |
48780-48784 |
WDT |
denotes |
that |
| T10443 |
48785-48789 |
VBZ |
denotes |
acts |
| T10444 |
48790-48800 |
RB |
denotes |
downstream |
| T10445 |
48801-48803 |
IN |
denotes |
of |
| T10446 |
48804-48809 |
NN |
denotes |
Wnt7a |
| T10447 |
48810-48813 |
CC |
denotes |
and |
| T10448 |
48814-48817 |
NN |
denotes |
En1 |
| T10449 |
48818-48819 |
-LRB- |
denotes |
( |
| T10450 |
48819-48825 |
NNP |
denotes |
Riddle |
| T10451 |
48826-48828 |
FW |
denotes |
et |
| T10452 |
48829-48832 |
FW |
denotes |
al. |
| T10453 |
48833-48837 |
CD |
denotes |
1995 |
| T10454 |
48837-48838 |
: |
denotes |
; |
| T10455 |
48839-48844 |
NNP |
denotes |
Vogel |
| T10456 |
48845-48847 |
FW |
denotes |
et |
| T10457 |
48848-48851 |
FW |
denotes |
al. |
| T10458 |
48852-48856 |
CD |
denotes |
1995 |
| T10459 |
48856-48857 |
: |
denotes |
; |
| T10460 |
48858-48863 |
NNP |
denotes |
Cygan |
| T10461 |
48864-48866 |
FW |
denotes |
et |
| T10462 |
48867-48870 |
FW |
denotes |
al. |
| T10463 |
48871-48875 |
CD |
denotes |
1997 |
| T10464 |
48875-48876 |
: |
denotes |
; |
| T10465 |
48877-48882 |
NNP |
denotes |
Logan |
| T10466 |
48883-48885 |
FW |
denotes |
et |
| T10467 |
48886-48889 |
FW |
denotes |
al. |
| T10468 |
48890-48894 |
CD |
denotes |
1997 |
| T10469 |
48894-48895 |
: |
denotes |
; |
| T10470 |
48896-48902 |
NNP |
denotes |
Loomis |
| T10471 |
48903-48905 |
FW |
denotes |
et |
| T10472 |
48906-48909 |
FW |
denotes |
al. |
| T10473 |
48910-48914 |
CD |
denotes |
1998 |
| T10474 |
48914-48915 |
: |
denotes |
; |
| T10475 |
48916-48920 |
NNP |
denotes |
Chen |
| T10476 |
48921-48924 |
CC |
denotes |
and |
| T10477 |
48925-48932 |
NNP |
denotes |
Johnson |
| T10478 |
48933-48937 |
CD |
denotes |
2002 |
| T10479 |
48937-48938 |
-RRB- |
denotes |
) |
| T10480 |
48938-48939 |
. |
denotes |
. |
| T10481 |
48939-49193 |
sentence |
denotes |
Both Tbx15 and Lmx1b act autonomously in mesenchymal cells to promote a dorsal identity, yet have expression domains that do not correspond to cell lineage compartments in the flank (Tbx15) or the limb (Lmx1b) (Altabef et al. 1997; Michaud et al. 1997). |
| T10482 |
48940-48944 |
CC |
denotes |
Both |
| T10483 |
48945-48950 |
NN |
denotes |
Tbx15 |
| T10484 |
48961-48964 |
VBP |
denotes |
act |
| T10485 |
48951-48954 |
CC |
denotes |
and |
| T10486 |
48955-48960 |
NN |
denotes |
Lmx1b |
| T10487 |
48965-48977 |
RB |
denotes |
autonomously |
| T10488 |
48978-48980 |
IN |
denotes |
in |
| T10489 |
48981-48992 |
JJ |
denotes |
mesenchymal |
| T10490 |
48993-48998 |
NNS |
denotes |
cells |
| T10491 |
48999-49001 |
TO |
denotes |
to |
| T10492 |
49002-49009 |
VB |
denotes |
promote |
| T10493 |
49010-49011 |
DT |
denotes |
a |
| T10494 |
49019-49027 |
NN |
denotes |
identity |
| T10495 |
49012-49018 |
JJ |
denotes |
dorsal |
| T10496 |
49027-49029 |
, |
denotes |
, |
| T10497 |
49029-49032 |
CC |
denotes |
yet |
| T10498 |
49033-49037 |
VBP |
denotes |
have |
| T10499 |
49038-49048 |
NN |
denotes |
expression |
| T10500 |
49049-49056 |
NNS |
denotes |
domains |
| T10501 |
49057-49061 |
WDT |
denotes |
that |
| T10502 |
49069-49079 |
VB |
denotes |
correspond |
| T10503 |
49062-49064 |
VBP |
denotes |
do |
| T10504 |
49065-49068 |
RB |
denotes |
not |
| T10505 |
49080-49082 |
IN |
denotes |
to |
| T10506 |
49083-49087 |
NN |
denotes |
cell |
| T10507 |
49088-49095 |
NN |
denotes |
lineage |
| T10508 |
49096-49108 |
NNS |
denotes |
compartments |
| T10509 |
49109-49111 |
IN |
denotes |
in |
| T10510 |
49112-49115 |
DT |
denotes |
the |
| T10511 |
49116-49121 |
NN |
denotes |
flank |
| T10512 |
49122-49123 |
-LRB- |
denotes |
( |
| T10513 |
49123-49128 |
NN |
denotes |
Tbx15 |
| T10514 |
49128-49129 |
-RRB- |
denotes |
) |
| T10515 |
49130-49132 |
CC |
denotes |
or |
| T10516 |
49133-49136 |
DT |
denotes |
the |
| T10517 |
49137-49141 |
NN |
denotes |
limb |
| T10518 |
49142-49143 |
-LRB- |
denotes |
( |
| T10519 |
49143-49148 |
NN |
denotes |
Lmx1b |
| T10520 |
49148-49149 |
-RRB- |
denotes |
) |
| T10521 |
49150-49151 |
-LRB- |
denotes |
( |
| T10522 |
49151-49158 |
NNP |
denotes |
Altabef |
| T10523 |
49159-49161 |
FW |
denotes |
et |
| T10524 |
49162-49165 |
FW |
denotes |
al. |
| T10525 |
49166-49170 |
CD |
denotes |
1997 |
| T10526 |
49170-49171 |
: |
denotes |
; |
| T10527 |
49172-49179 |
NNP |
denotes |
Michaud |
| T10528 |
49180-49182 |
FW |
denotes |
et |
| T10529 |
49183-49186 |
FW |
denotes |
al. |
| T10530 |
49187-49191 |
CD |
denotes |
1997 |
| T10531 |
49191-49192 |
-RRB- |
denotes |
) |
| T10532 |
49192-49193 |
. |
denotes |
. |
| T10533 |
49193-49369 |
sentence |
denotes |
In the case of Lmx1b, its expression in the distal limb depends on Wnt7a produced in the overlying dorsal ectoderm (Riddle et al. 1995; Cygan et al. 1997; Loomis et al. 1998). |
| T10534 |
49194-49196 |
IN |
denotes |
In |
| T10535 |
49250-49257 |
VBZ |
denotes |
depends |
| T10536 |
49197-49200 |
DT |
denotes |
the |
| T10537 |
49201-49205 |
NN |
denotes |
case |
| T10538 |
49206-49208 |
IN |
denotes |
of |
| T10539 |
49209-49214 |
NN |
denotes |
Lmx1b |
| T10540 |
49214-49216 |
, |
denotes |
, |
| T10541 |
49216-49219 |
PRP$ |
denotes |
its |
| T10542 |
49220-49230 |
NN |
denotes |
expression |
| T10543 |
49231-49233 |
IN |
denotes |
in |
| T10544 |
49234-49237 |
DT |
denotes |
the |
| T10545 |
49245-49249 |
NN |
denotes |
limb |
| T10546 |
49238-49244 |
JJ |
denotes |
distal |
| T10547 |
49258-49260 |
IN |
denotes |
on |
| T10548 |
49261-49266 |
NN |
denotes |
Wnt7a |
| T10549 |
49267-49275 |
VBN |
denotes |
produced |
| T10550 |
49276-49278 |
IN |
denotes |
in |
| T10551 |
49279-49282 |
DT |
denotes |
the |
| T10552 |
49300-49308 |
NN |
denotes |
ectoderm |
| T10553 |
49283-49292 |
VBG |
denotes |
overlying |
| T10554 |
49293-49299 |
JJ |
denotes |
dorsal |
| T10555 |
49309-49310 |
-LRB- |
denotes |
( |
| T10556 |
49310-49316 |
NNP |
denotes |
Riddle |
| T10557 |
49317-49319 |
FW |
denotes |
et |
| T10558 |
49320-49323 |
FW |
denotes |
al. |
| T10559 |
49324-49328 |
CD |
denotes |
1995 |
| T10560 |
49328-49329 |
: |
denotes |
; |
| T10561 |
49330-49335 |
NNP |
denotes |
Cygan |
| T10562 |
49336-49338 |
FW |
denotes |
et |
| T10563 |
49339-49342 |
FW |
denotes |
al. |
| T10564 |
49343-49347 |
CD |
denotes |
1997 |
| T10565 |
49347-49348 |
: |
denotes |
; |
| T10566 |
49349-49355 |
NNP |
denotes |
Loomis |
| T10567 |
49356-49358 |
FW |
denotes |
et |
| T10568 |
49359-49362 |
FW |
denotes |
al. |
| T10569 |
49363-49367 |
CD |
denotes |
1998 |
| T10570 |
49367-49368 |
-RRB- |
denotes |
) |
| T10571 |
49368-49369 |
. |
denotes |
. |
| T10572 |
49369-49687 |
sentence |
denotes |
Wnt7a, in turn, is restricted to dorsal ectoderm by En1 in the ventral ectoderm (Loomis et al. 1996; Cygan et al. 1997; Logan et al. 1997), whose expression marks a lineage boundary coincident with the dorsoventral midline of the apical ectodermal ridge (Altabef et al. 1997; Michaud et al. 1997; Kimmel et al. 2000). |
| T10573 |
49370-49375 |
NN |
denotes |
Wnt7a |
| T10574 |
49389-49399 |
VBN |
denotes |
restricted |
| T10575 |
49375-49377 |
, |
denotes |
, |
| T10576 |
49377-49379 |
IN |
denotes |
in |
| T10577 |
49380-49384 |
NN |
denotes |
turn |
| T10578 |
49384-49386 |
, |
denotes |
, |
| T10579 |
49386-49388 |
VBZ |
denotes |
is |
| T10580 |
49400-49402 |
IN |
denotes |
to |
| T10581 |
49403-49409 |
JJ |
denotes |
dorsal |
| T10582 |
49410-49418 |
NN |
denotes |
ectoderm |
| T10583 |
49419-49421 |
IN |
denotes |
by |
| T10584 |
49422-49425 |
NN |
denotes |
En1 |
| T10585 |
49426-49428 |
IN |
denotes |
in |
| T10586 |
49429-49432 |
DT |
denotes |
the |
| T10587 |
49441-49449 |
NN |
denotes |
ectoderm |
| T10588 |
49433-49440 |
JJ |
denotes |
ventral |
| T10589 |
49450-49451 |
-LRB- |
denotes |
( |
| T10590 |
49451-49457 |
NNP |
denotes |
Loomis |
| T10591 |
49458-49460 |
FW |
denotes |
et |
| T10592 |
49461-49464 |
FW |
denotes |
al. |
| T10593 |
49465-49469 |
CD |
denotes |
1996 |
| T10594 |
49469-49470 |
: |
denotes |
; |
| T10595 |
49471-49476 |
NNP |
denotes |
Cygan |
| T10596 |
49477-49479 |
FW |
denotes |
et |
| T10597 |
49480-49483 |
FW |
denotes |
al. |
| T10598 |
49484-49488 |
CD |
denotes |
1997 |
| T10599 |
49488-49489 |
: |
denotes |
; |
| T10600 |
49490-49495 |
NNP |
denotes |
Logan |
| T10601 |
49496-49498 |
FW |
denotes |
et |
| T10602 |
49499-49502 |
FW |
denotes |
al. |
| T10603 |
49503-49507 |
CD |
denotes |
1997 |
| T10604 |
49507-49508 |
-RRB- |
denotes |
) |
| T10605 |
49508-49510 |
, |
denotes |
, |
| T10606 |
49510-49515 |
WP$ |
denotes |
whose |
| T10607 |
49516-49526 |
NN |
denotes |
expression |
| T10608 |
49527-49532 |
VBZ |
denotes |
marks |
| T10609 |
49533-49534 |
DT |
denotes |
a |
| T10610 |
49543-49551 |
NN |
denotes |
boundary |
| T10611 |
49535-49542 |
NN |
denotes |
lineage |
| T10612 |
49552-49562 |
JJ |
denotes |
coincident |
| T10613 |
49563-49567 |
IN |
denotes |
with |
| T10614 |
49568-49571 |
DT |
denotes |
the |
| T10615 |
49585-49592 |
NN |
denotes |
midline |
| T10616 |
49572-49584 |
JJ |
denotes |
dorsoventral |
| T10617 |
49593-49595 |
IN |
denotes |
of |
| T10618 |
49596-49599 |
DT |
denotes |
the |
| T10619 |
49618-49623 |
NN |
denotes |
ridge |
| T10620 |
49600-49606 |
JJ |
denotes |
apical |
| T10621 |
49607-49617 |
JJ |
denotes |
ectodermal |
| T10622 |
49624-49625 |
-LRB- |
denotes |
( |
| T10623 |
49646-49653 |
NNP |
denotes |
Michaud |
| T10624 |
49625-49632 |
NN |
denotes |
Altabef |
| T10625 |
49633-49635 |
FW |
denotes |
et |
| T10626 |
49636-49639 |
FW |
denotes |
al. |
| T10627 |
49640-49644 |
CD |
denotes |
1997 |
| T10628 |
49644-49645 |
: |
denotes |
; |
| T10629 |
49654-49656 |
FW |
denotes |
et |
| T10630 |
49657-49660 |
FW |
denotes |
al. |
| T10631 |
49661-49665 |
CD |
denotes |
1997 |
| T10632 |
49665-49666 |
: |
denotes |
; |
| T10633 |
49667-49673 |
NNP |
denotes |
Kimmel |
| T10634 |
49674-49676 |
FW |
denotes |
et |
| T10635 |
49677-49680 |
FW |
denotes |
al. |
| T10636 |
49681-49685 |
CD |
denotes |
2000 |
| T10637 |
49685-49686 |
-RRB- |
denotes |
) |
| T10638 |
49686-49687 |
. |
denotes |
. |
| T10639 |
49687-49879 |
sentence |
denotes |
As described above, En1 or Wnt7a mutations have not been reported to affect patterns of hair-color distribution (C. Loomis, personal communication; Parr and McMahon 1995; Loomis et al. 1996). |
| T10640 |
49688-49690 |
IN |
denotes |
As |
| T10641 |
49691-49700 |
VBN |
denotes |
described |
| T10642 |
49745-49753 |
VBN |
denotes |
reported |
| T10643 |
49701-49706 |
RB |
denotes |
above |
| T10644 |
49706-49708 |
, |
denotes |
, |
| T10645 |
49708-49711 |
NN |
denotes |
En1 |
| T10646 |
49721-49730 |
NNS |
denotes |
mutations |
| T10647 |
49712-49714 |
CC |
denotes |
or |
| T10648 |
49715-49720 |
NN |
denotes |
Wnt7a |
| T10649 |
49731-49735 |
VBP |
denotes |
have |
| T10650 |
49736-49739 |
RB |
denotes |
not |
| T10651 |
49740-49744 |
VBN |
denotes |
been |
| T10652 |
49754-49756 |
TO |
denotes |
to |
| T10653 |
49757-49763 |
VB |
denotes |
affect |
| T10654 |
49764-49772 |
NNS |
denotes |
patterns |
| T10655 |
49773-49775 |
IN |
denotes |
of |
| T10656 |
49776-49780 |
NN |
denotes |
hair |
| T10657 |
49781-49786 |
NN |
denotes |
color |
| T10658 |
49780-49781 |
HYPH |
denotes |
- |
| T10659 |
49787-49799 |
NN |
denotes |
distribution |
| T10660 |
49800-49801 |
-LRB- |
denotes |
( |
| T10661 |
49801-49803 |
NNP |
denotes |
C. |
| T10662 |
49804-49810 |
NNP |
denotes |
Loomis |
| T10663 |
49810-49812 |
, |
denotes |
, |
| T10664 |
49812-49820 |
JJ |
denotes |
personal |
| T10665 |
49821-49834 |
NN |
denotes |
communication |
| T10666 |
49834-49835 |
: |
denotes |
; |
| T10667 |
49836-49840 |
NNP |
denotes |
Parr |
| T10668 |
49841-49844 |
CC |
denotes |
and |
| T10669 |
49845-49852 |
NNP |
denotes |
McMahon |
| T10670 |
49853-49857 |
CD |
denotes |
1995 |
| T10671 |
49857-49858 |
: |
denotes |
; |
| T10672 |
49859-49865 |
NNP |
denotes |
Loomis |
| T10673 |
49866-49868 |
FW |
denotes |
et |
| T10674 |
49869-49872 |
RB |
denotes |
al. |
| T10675 |
49873-49877 |
CD |
denotes |
1996 |
| T10676 |
49877-49878 |
-RRB- |
denotes |
) |
| T10677 |
49878-49879 |
. |
denotes |
. |
| T10678 |
49879-50051 |
sentence |
denotes |
However, the essential theme that ectodermal lineage compartments control the fate of underlying mesenchyme in developing limbs may apply to the trunk as well as the limb. |
| T10679 |
49880-49887 |
RB |
denotes |
However |
| T10680 |
50012-50017 |
VB |
denotes |
apply |
| T10681 |
49887-49889 |
, |
denotes |
, |
| T10682 |
49889-49892 |
DT |
denotes |
the |
| T10683 |
49903-49908 |
NN |
denotes |
theme |
| T10684 |
49893-49902 |
JJ |
denotes |
essential |
| T10685 |
49909-49913 |
IN |
denotes |
that |
| T10686 |
49946-49953 |
VBP |
denotes |
control |
| T10687 |
49914-49924 |
JJ |
denotes |
ectodermal |
| T10688 |
49933-49945 |
NNS |
denotes |
compartments |
| T10689 |
49925-49932 |
NN |
denotes |
lineage |
| T10690 |
49954-49957 |
DT |
denotes |
the |
| T10691 |
49958-49962 |
NN |
denotes |
fate |
| T10692 |
49963-49965 |
IN |
denotes |
of |
| T10693 |
49966-49976 |
VBG |
denotes |
underlying |
| T10694 |
49977-49987 |
NN |
denotes |
mesenchyme |
| T10695 |
49988-49990 |
IN |
denotes |
in |
| T10696 |
49991-50001 |
VBG |
denotes |
developing |
| T10697 |
50002-50007 |
NNS |
denotes |
limbs |
| T10698 |
50008-50011 |
MD |
denotes |
may |
| T10699 |
50018-50020 |
IN |
denotes |
to |
| T10700 |
50021-50024 |
DT |
denotes |
the |
| T10701 |
50025-50030 |
NN |
denotes |
trunk |
| T10702 |
50031-50033 |
RB |
denotes |
as |
| T10703 |
50039-50041 |
IN |
denotes |
as |
| T10704 |
50034-50038 |
RB |
denotes |
well |
| T10705 |
50042-50045 |
DT |
denotes |
the |
| T10706 |
50046-50050 |
NN |
denotes |
limb |
| T10707 |
50050-50051 |
. |
denotes |
. |
| T10708 |
50051-50173 |
sentence |
denotes |
The mammary glands also develop at a stereotyped dorsoventral position and depend on epithelial–mesenchymal interactions. |
| T10709 |
50052-50055 |
DT |
denotes |
The |
| T10710 |
50064-50070 |
NNS |
denotes |
glands |
| T10711 |
50056-50063 |
JJ |
denotes |
mammary |
| T10712 |
50076-50083 |
VBP |
denotes |
develop |
| T10713 |
50071-50075 |
RB |
denotes |
also |
| T10714 |
50084-50086 |
IN |
denotes |
at |
| T10715 |
50087-50088 |
DT |
denotes |
a |
| T10716 |
50114-50122 |
NN |
denotes |
position |
| T10717 |
50089-50100 |
JJ |
denotes |
stereotyped |
| T10718 |
50101-50113 |
JJ |
denotes |
dorsoventral |
| T10719 |
50123-50126 |
CC |
denotes |
and |
| T10720 |
50127-50133 |
VBP |
denotes |
depend |
| T10721 |
50134-50136 |
IN |
denotes |
on |
| T10722 |
50137-50147 |
JJ |
denotes |
epithelial |
| T10723 |
50148-50159 |
JJ |
denotes |
mesenchymal |
| T10724 |
50147-50148 |
HYPH |
denotes |
– |
| T10725 |
50160-50172 |
NNS |
denotes |
interactions |
| T10726 |
50172-50173 |
. |
denotes |
. |
| T10727 |
50173-50393 |
sentence |
denotes |
However, the number and apparent position of the mammary glands are normal in deH/deH animals, indicating the existence of additional mechanisms that control dorsoventral patterning in the trunk as well as in the limbs. |
| T10728 |
50174-50181 |
RB |
denotes |
However |
| T10729 |
50238-50241 |
VBP |
denotes |
are |
| T10730 |
50181-50183 |
, |
denotes |
, |
| T10731 |
50183-50186 |
DT |
denotes |
the |
| T10732 |
50187-50193 |
NN |
denotes |
number |
| T10733 |
50194-50197 |
CC |
denotes |
and |
| T10734 |
50198-50206 |
JJ |
denotes |
apparent |
| T10735 |
50207-50215 |
NN |
denotes |
position |
| T10736 |
50216-50218 |
IN |
denotes |
of |
| T10737 |
50219-50222 |
DT |
denotes |
the |
| T10738 |
50231-50237 |
NNS |
denotes |
glands |
| T10739 |
50223-50230 |
JJ |
denotes |
mammary |
| T10740 |
50242-50248 |
JJ |
denotes |
normal |
| T10741 |
50249-50251 |
IN |
denotes |
in |
| T10742 |
50252-50255 |
NN |
denotes |
deH |
| T10743 |
50256-50259 |
NN |
denotes |
deH |
| T10744 |
50255-50256 |
HYPH |
denotes |
/ |
| T10745 |
50260-50267 |
NNS |
denotes |
animals |
| T10746 |
50267-50269 |
, |
denotes |
, |
| T10747 |
50269-50279 |
VBG |
denotes |
indicating |
| T10748 |
50280-50283 |
DT |
denotes |
the |
| T10749 |
50284-50293 |
NN |
denotes |
existence |
| T10750 |
50294-50296 |
IN |
denotes |
of |
| T10751 |
50297-50307 |
JJ |
denotes |
additional |
| T10752 |
50308-50318 |
NNS |
denotes |
mechanisms |
| T10753 |
50319-50323 |
WDT |
denotes |
that |
| T10754 |
50324-50331 |
VBP |
denotes |
control |
| T10755 |
50332-50344 |
JJ |
denotes |
dorsoventral |
| T10756 |
50345-50355 |
NN |
denotes |
patterning |
| T10757 |
50356-50358 |
IN |
denotes |
in |
| T10758 |
50359-50362 |
DT |
denotes |
the |
| T10759 |
50363-50368 |
NN |
denotes |
trunk |
| T10760 |
50369-50371 |
RB |
denotes |
as |
| T10761 |
50377-50379 |
IN |
denotes |
as |
| T10762 |
50372-50376 |
RB |
denotes |
well |
| T10763 |
50380-50382 |
IN |
denotes |
in |
| T10764 |
50383-50386 |
DT |
denotes |
the |
| T10765 |
50387-50392 |
NNS |
denotes |
limbs |
| T10766 |
50392-50393 |
. |
denotes |
. |
| T10767 |
50393-50453 |
sentence |
denotes |
These ideas are summarized in the model shown in Figure 9B. |
| T10768 |
50394-50399 |
DT |
denotes |
These |
| T10769 |
50400-50405 |
NNS |
denotes |
ideas |
| T10770 |
50410-50420 |
VBN |
denotes |
summarized |
| T10771 |
50406-50409 |
VBP |
denotes |
are |
| T10772 |
50421-50423 |
IN |
denotes |
in |
| T10773 |
50424-50427 |
DT |
denotes |
the |
| T10774 |
50428-50433 |
NN |
denotes |
model |
| T10775 |
50434-50439 |
VBN |
denotes |
shown |
| T10776 |
50440-50442 |
IN |
denotes |
in |
| T10777 |
50443-50449 |
NN |
denotes |
Figure |
| T10778 |
50450-50452 |
CD |
denotes |
9B |
| T10779 |
50452-50453 |
. |
denotes |
. |
| T10780 |
50453-50757 |
sentence |
denotes |
We speculate that a diffusible signal from dorsal trunk ectoderm, at or prior to E11.5, promotes expression of Tbx15 in dorsal trunk mesenchyme, which then establishes dorsal positional identity of those cells as manifested by differences in Agouti expression, pigment-cell development, and hair growth. |
| T10781 |
50454-50456 |
PRP |
denotes |
We |
| T10782 |
50457-50466 |
VBP |
denotes |
speculate |
| T10783 |
50467-50471 |
IN |
denotes |
that |
| T10784 |
50542-50550 |
VBZ |
denotes |
promotes |
| T10785 |
50472-50473 |
DT |
denotes |
a |
| T10786 |
50485-50491 |
NN |
denotes |
signal |
| T10787 |
50474-50484 |
JJ |
denotes |
diffusible |
| T10788 |
50492-50496 |
IN |
denotes |
from |
| T10789 |
50497-50503 |
JJ |
denotes |
dorsal |
| T10790 |
50510-50518 |
NN |
denotes |
ectoderm |
| T10791 |
50504-50509 |
NN |
denotes |
trunk |
| T10792 |
50518-50520 |
, |
denotes |
, |
| T10793 |
50520-50522 |
IN |
denotes |
at |
| T10794 |
50523-50525 |
CC |
denotes |
or |
| T10795 |
50526-50531 |
RB |
denotes |
prior |
| T10796 |
50535-50540 |
NN |
denotes |
E11.5 |
| T10797 |
50532-50534 |
IN |
denotes |
to |
| T10798 |
50540-50542 |
, |
denotes |
, |
| T10799 |
50551-50561 |
NN |
denotes |
expression |
| T10800 |
50562-50564 |
IN |
denotes |
of |
| T10801 |
50565-50570 |
NN |
denotes |
Tbx15 |
| T10802 |
50571-50573 |
IN |
denotes |
in |
| T10803 |
50574-50580 |
JJ |
denotes |
dorsal |
| T10804 |
50587-50597 |
NN |
denotes |
mesenchyme |
| T10805 |
50581-50586 |
NN |
denotes |
trunk |
| T10806 |
50597-50599 |
, |
denotes |
, |
| T10807 |
50599-50604 |
WDT |
denotes |
which |
| T10808 |
50610-50621 |
VBZ |
denotes |
establishes |
| T10809 |
50605-50609 |
RB |
denotes |
then |
| T10810 |
50622-50628 |
JJ |
denotes |
dorsal |
| T10811 |
50640-50648 |
NN |
denotes |
identity |
| T10812 |
50629-50639 |
JJ |
denotes |
positional |
| T10813 |
50649-50651 |
IN |
denotes |
of |
| T10814 |
50652-50657 |
DT |
denotes |
those |
| T10815 |
50658-50663 |
NNS |
denotes |
cells |
| T10816 |
50664-50666 |
IN |
denotes |
as |
| T10817 |
50667-50677 |
VBN |
denotes |
manifested |
| T10818 |
50678-50680 |
IN |
denotes |
by |
| T10819 |
50681-50692 |
NNS |
denotes |
differences |
| T10820 |
50693-50695 |
IN |
denotes |
in |
| T10821 |
50696-50702 |
NN |
denotes |
Agouti |
| T10822 |
50703-50713 |
NN |
denotes |
expression |
| T10823 |
50713-50715 |
, |
denotes |
, |
| T10824 |
50715-50722 |
NN |
denotes |
pigment |
| T10825 |
50723-50727 |
NN |
denotes |
cell |
| T10826 |
50722-50723 |
HYPH |
denotes |
- |
| T10827 |
50728-50739 |
NN |
denotes |
development |
| T10828 |
50739-50741 |
, |
denotes |
, |
| T10829 |
50741-50744 |
CC |
denotes |
and |
| T10830 |
50745-50749 |
NN |
denotes |
hair |
| T10831 |
50750-50756 |
NN |
denotes |
growth |
| T10832 |
50756-50757 |
. |
denotes |
. |
| T10833 |
50757-51103 |
sentence |
denotes |
Because the ventral limit of Tbx15 expression corresponds to the dorsal limit of En1 expression and because the normal position of the pigmentation boundary lies approximately in register with the limb-bud outgrowths, we depict the position of a putative dorsoventral boundary in trunk ectoderm as coincident with the limb dorsoventral boundary. |
| T10834 |
50758-50765 |
IN |
denotes |
Because |
| T10835 |
50804-50815 |
VBZ |
denotes |
corresponds |
| T10836 |
50766-50769 |
DT |
denotes |
the |
| T10837 |
50778-50783 |
NN |
denotes |
limit |
| T10838 |
50770-50777 |
JJ |
denotes |
ventral |
| T10839 |
50784-50786 |
IN |
denotes |
of |
| T10840 |
50787-50792 |
NN |
denotes |
Tbx15 |
| T10841 |
50793-50803 |
NN |
denotes |
expression |
| T10842 |
50979-50985 |
VBP |
denotes |
depict |
| T10843 |
50816-50818 |
IN |
denotes |
to |
| T10844 |
50819-50822 |
DT |
denotes |
the |
| T10845 |
50830-50835 |
NN |
denotes |
limit |
| T10846 |
50823-50829 |
JJ |
denotes |
dorsal |
| T10847 |
50836-50838 |
IN |
denotes |
of |
| T10848 |
50839-50842 |
NN |
denotes |
En1 |
| T10849 |
50843-50853 |
NN |
denotes |
expression |
| T10850 |
50854-50857 |
CC |
denotes |
and |
| T10851 |
50858-50865 |
IN |
denotes |
because |
| T10852 |
50915-50919 |
VBZ |
denotes |
lies |
| T10853 |
50866-50869 |
DT |
denotes |
the |
| T10854 |
50877-50885 |
NN |
denotes |
position |
| T10855 |
50870-50876 |
JJ |
denotes |
normal |
| T10856 |
50886-50888 |
IN |
denotes |
of |
| T10857 |
50889-50892 |
DT |
denotes |
the |
| T10858 |
50906-50914 |
NN |
denotes |
boundary |
| T10859 |
50893-50905 |
NN |
denotes |
pigmentation |
| T10860 |
50920-50933 |
RB |
denotes |
approximately |
| T10861 |
50934-50936 |
IN |
denotes |
in |
| T10862 |
50937-50945 |
NN |
denotes |
register |
| T10863 |
50946-50950 |
IN |
denotes |
with |
| T10864 |
50951-50954 |
DT |
denotes |
the |
| T10865 |
50964-50974 |
NNS |
denotes |
outgrowths |
| T10866 |
50955-50959 |
NN |
denotes |
limb |
| T10867 |
50960-50963 |
NN |
denotes |
bud |
| T10868 |
50959-50960 |
HYPH |
denotes |
- |
| T10869 |
50974-50976 |
, |
denotes |
, |
| T10870 |
50976-50978 |
PRP |
denotes |
we |
| T10871 |
50986-50989 |
DT |
denotes |
the |
| T10872 |
50990-50998 |
NN |
denotes |
position |
| T10873 |
50999-51001 |
IN |
denotes |
of |
| T10874 |
51002-51003 |
DT |
denotes |
a |
| T10875 |
51026-51034 |
NN |
denotes |
boundary |
| T10876 |
51004-51012 |
JJ |
denotes |
putative |
| T10877 |
51013-51025 |
JJ |
denotes |
dorsoventral |
| T10878 |
51035-51037 |
IN |
denotes |
in |
| T10879 |
51038-51043 |
NN |
denotes |
trunk |
| T10880 |
51044-51052 |
NN |
denotes |
ectoderm |
| T10881 |
51053-51055 |
IN |
denotes |
as |
| T10882 |
51056-51066 |
JJ |
denotes |
coincident |
| T10883 |
51067-51071 |
IN |
denotes |
with |
| T10884 |
51072-51075 |
DT |
denotes |
the |
| T10885 |
51094-51102 |
NN |
denotes |
boundary |
| T10886 |
51076-51080 |
NN |
denotes |
limb |
| T10887 |
51081-51093 |
JJ |
denotes |
dorsoventral |
| T10888 |
51102-51103 |
. |
denotes |
. |
| T10889 |
51103-51436 |
sentence |
denotes |
This model is consistent with studies in the chick, where distinct dorsal and ventral lineage compartments exist for ectoderm in both the limb (Altabef et al. 1997, 2000; Michaud et al. 1997; Kimmel et al. 2000) and interlimb regions (Altabef et al. 1997, 2000), but not for limb mesoderm (Altabef et al. 1997; Michaud et al. 1997). |
| T10890 |
51104-51108 |
DT |
denotes |
This |
| T10891 |
51109-51114 |
NN |
denotes |
model |
| T10892 |
51115-51117 |
VBZ |
denotes |
is |
| T10893 |
51118-51128 |
JJ |
denotes |
consistent |
| T10894 |
51129-51133 |
IN |
denotes |
with |
| T10895 |
51134-51141 |
NNS |
denotes |
studies |
| T10896 |
51142-51144 |
IN |
denotes |
in |
| T10897 |
51145-51148 |
DT |
denotes |
the |
| T10898 |
51149-51154 |
NN |
denotes |
chick |
| T10899 |
51154-51156 |
, |
denotes |
, |
| T10900 |
51156-51161 |
WRB |
denotes |
where |
| T10901 |
51211-51216 |
VBP |
denotes |
exist |
| T10902 |
51162-51170 |
JJ |
denotes |
distinct |
| T10903 |
51198-51210 |
NNS |
denotes |
compartments |
| T10904 |
51171-51177 |
JJ |
denotes |
dorsal |
| T10905 |
51178-51181 |
CC |
denotes |
and |
| T10906 |
51182-51189 |
JJ |
denotes |
ventral |
| T10907 |
51190-51197 |
NN |
denotes |
lineage |
| T10908 |
51217-51220 |
IN |
denotes |
for |
| T10909 |
51221-51229 |
NN |
denotes |
ectoderm |
| T10910 |
51230-51232 |
IN |
denotes |
in |
| T10911 |
51233-51237 |
CC |
denotes |
both |
| T10912 |
51242-51246 |
NN |
denotes |
limb |
| T10913 |
51238-51241 |
DT |
denotes |
the |
| T10914 |
51247-51248 |
-LRB- |
denotes |
( |
| T10915 |
51275-51282 |
NNP |
denotes |
Michaud |
| T10916 |
51248-51255 |
NN |
denotes |
Altabef |
| T10917 |
51256-51258 |
FW |
denotes |
et |
| T10918 |
51259-51262 |
FW |
denotes |
al. |
| T10919 |
51263-51267 |
CD |
denotes |
1997 |
| T10920 |
51267-51269 |
, |
denotes |
, |
| T10921 |
51269-51273 |
CD |
denotes |
2000 |
| T10922 |
51273-51274 |
: |
denotes |
; |
| T10923 |
51283-51285 |
FW |
denotes |
et |
| T10924 |
51286-51289 |
FW |
denotes |
al. |
| T10925 |
51290-51294 |
CD |
denotes |
1997 |
| T10926 |
51294-51295 |
: |
denotes |
; |
| T10927 |
51296-51302 |
NNP |
denotes |
Kimmel |
| T10928 |
51303-51305 |
FW |
denotes |
et |
| T10929 |
51306-51309 |
FW |
denotes |
al. |
| T10930 |
51310-51314 |
CD |
denotes |
2000 |
| T10931 |
51314-51315 |
-RRB- |
denotes |
) |
| T10932 |
51316-51319 |
CC |
denotes |
and |
| T10933 |
51320-51329 |
JJ |
denotes |
interlimb |
| T10934 |
51330-51337 |
NNS |
denotes |
regions |
| T10935 |
51338-51339 |
-LRB- |
denotes |
( |
| T10936 |
51339-51346 |
NNP |
denotes |
Altabef |
| T10937 |
51347-51349 |
FW |
denotes |
et |
| T10938 |
51350-51353 |
FW |
denotes |
al. |
| T10939 |
51354-51358 |
CD |
denotes |
1997 |
| T10940 |
51358-51360 |
, |
denotes |
, |
| T10941 |
51360-51364 |
CD |
denotes |
2000 |
| T10942 |
51364-51365 |
-RRB- |
denotes |
) |
| T10943 |
51365-51367 |
, |
denotes |
, |
| T10944 |
51367-51370 |
CC |
denotes |
but |
| T10945 |
51375-51378 |
IN |
denotes |
for |
| T10946 |
51371-51374 |
RB |
denotes |
not |
| T10947 |
51379-51383 |
NN |
denotes |
limb |
| T10948 |
51384-51392 |
NN |
denotes |
mesoderm |
| T10949 |
51393-51394 |
-LRB- |
denotes |
( |
| T10950 |
51394-51401 |
NNP |
denotes |
Altabef |
| T10951 |
51402-51404 |
FW |
denotes |
et |
| T10952 |
51405-51408 |
FW |
denotes |
al. |
| T10953 |
51409-51413 |
CD |
denotes |
1997 |
| T10954 |
51413-51414 |
: |
denotes |
; |
| T10955 |
51415-51422 |
NNP |
denotes |
Michaud |
| T10956 |
51423-51425 |
FW |
denotes |
et |
| T10957 |
51426-51429 |
FW |
denotes |
al. |
| T10958 |
51430-51434 |
CD |
denotes |
1997 |
| T10959 |
51434-51435 |
-RRB- |
denotes |
) |
| T10960 |
51435-51436 |
. |
denotes |
. |
| T10961 |
51436-51873 |
sentence |
denotes |
In fact, the same mechanism that determines dorsoventral position of the limbs and the apical ectodermal ridge may also act on expression of Tbx15 in the trunk, since ectopic limbs induced in the interlimb region by application of FGF beads develop along a single line that is coincident with normal limb buds (and the future pigmentation boundary) (Cohn et al. 1995; Crossley et al. 1996; Vogel et al. 1996; Altabef et al. 1997, 2000). |
| T10962 |
51437-51439 |
IN |
denotes |
In |
| T10963 |
51557-51560 |
VB |
denotes |
act |
| T10964 |
51440-51444 |
NN |
denotes |
fact |
| T10965 |
51444-51446 |
, |
denotes |
, |
| T10966 |
51446-51449 |
DT |
denotes |
the |
| T10967 |
51455-51464 |
NN |
denotes |
mechanism |
| T10968 |
51450-51454 |
JJ |
denotes |
same |
| T10969 |
51465-51469 |
WDT |
denotes |
that |
| T10970 |
51470-51480 |
VBZ |
denotes |
determines |
| T10971 |
51481-51493 |
JJ |
denotes |
dorsoventral |
| T10972 |
51494-51502 |
NN |
denotes |
position |
| T10973 |
51503-51505 |
IN |
denotes |
of |
| T10974 |
51506-51509 |
DT |
denotes |
the |
| T10975 |
51510-51515 |
NNS |
denotes |
limbs |
| T10976 |
51516-51519 |
CC |
denotes |
and |
| T10977 |
51520-51523 |
DT |
denotes |
the |
| T10978 |
51542-51547 |
NN |
denotes |
ridge |
| T10979 |
51524-51530 |
JJ |
denotes |
apical |
| T10980 |
51531-51541 |
JJ |
denotes |
ectodermal |
| T10981 |
51548-51551 |
MD |
denotes |
may |
| T10982 |
51552-51556 |
RB |
denotes |
also |
| T10983 |
51561-51563 |
IN |
denotes |
on |
| T10984 |
51564-51574 |
NN |
denotes |
expression |
| T10985 |
51575-51577 |
IN |
denotes |
of |
| T10986 |
51578-51583 |
NN |
denotes |
Tbx15 |
| T10987 |
51584-51586 |
IN |
denotes |
in |
| T10988 |
51587-51590 |
DT |
denotes |
the |
| T10989 |
51591-51596 |
NN |
denotes |
trunk |
| T10990 |
51596-51598 |
, |
denotes |
, |
| T10991 |
51598-51603 |
IN |
denotes |
since |
| T10992 |
51678-51685 |
VBP |
denotes |
develop |
| T10993 |
51604-51611 |
JJ |
denotes |
ectopic |
| T10994 |
51612-51617 |
NNS |
denotes |
limbs |
| T10995 |
51618-51625 |
VBN |
denotes |
induced |
| T10996 |
51626-51628 |
IN |
denotes |
in |
| T10997 |
51629-51632 |
DT |
denotes |
the |
| T10998 |
51643-51649 |
NN |
denotes |
region |
| T10999 |
51633-51642 |
JJ |
denotes |
interlimb |
| T11000 |
51650-51652 |
IN |
denotes |
by |
| T11001 |
51653-51664 |
NN |
denotes |
application |
| T11002 |
51665-51667 |
IN |
denotes |
of |
| T11003 |
51668-51671 |
NN |
denotes |
FGF |
| T11004 |
51672-51677 |
NNS |
denotes |
beads |
| T11005 |
51686-51691 |
IN |
denotes |
along |
| T11006 |
51692-51693 |
DT |
denotes |
a |
| T11007 |
51701-51705 |
NN |
denotes |
line |
| T11008 |
51694-51700 |
JJ |
denotes |
single |
| T11009 |
51706-51710 |
WDT |
denotes |
that |
| T11010 |
51711-51713 |
VBZ |
denotes |
is |
| T11011 |
51714-51724 |
JJ |
denotes |
coincident |
| T11012 |
51725-51729 |
IN |
denotes |
with |
| T11013 |
51730-51736 |
JJ |
denotes |
normal |
| T11014 |
51742-51746 |
NNS |
denotes |
buds |
| T11015 |
51737-51741 |
NN |
denotes |
limb |
| T11016 |
51747-51748 |
-LRB- |
denotes |
( |
| T11017 |
51748-51751 |
CC |
denotes |
and |
| T11018 |
51752-51755 |
DT |
denotes |
the |
| T11019 |
51776-51784 |
NN |
denotes |
boundary |
| T11020 |
51756-51762 |
JJ |
denotes |
future |
| T11021 |
51763-51775 |
NN |
denotes |
pigmentation |
| T11022 |
51784-51785 |
-RRB- |
denotes |
) |
| T11023 |
51786-51787 |
-LRB- |
denotes |
( |
| T11024 |
51787-51791 |
NNP |
denotes |
Cohn |
| T11025 |
51792-51794 |
FW |
denotes |
et |
| T11026 |
51795-51798 |
FW |
denotes |
al. |
| T11027 |
51799-51803 |
CD |
denotes |
1995 |
| T11028 |
51803-51804 |
: |
denotes |
; |
| T11029 |
51805-51813 |
NNP |
denotes |
Crossley |
| T11030 |
51814-51816 |
FW |
denotes |
et |
| T11031 |
51817-51820 |
FW |
denotes |
al. |
| T11032 |
51821-51825 |
CD |
denotes |
1996 |
| T11033 |
51825-51826 |
: |
denotes |
; |
| T11034 |
51827-51832 |
NNP |
denotes |
Vogel |
| T11035 |
51833-51835 |
FW |
denotes |
et |
| T11036 |
51836-51839 |
FW |
denotes |
al. |
| T11037 |
51840-51844 |
CD |
denotes |
1996 |
| T11038 |
51844-51845 |
: |
denotes |
; |
| T11039 |
51846-51853 |
NNP |
denotes |
Altabef |
| T11040 |
51854-51856 |
FW |
denotes |
et |
| T11041 |
51857-51860 |
FW |
denotes |
al. |
| T11042 |
51861-51865 |
CD |
denotes |
1997 |
| T11043 |
51865-51867 |
, |
denotes |
, |
| T11044 |
51867-51871 |
CD |
denotes |
2000 |
| T11045 |
51871-51872 |
-RRB- |
denotes |
) |
| T11046 |
51872-51873 |
. |
denotes |
. |
| T11047 |
51873-52057 |
sentence |
denotes |
Our model predicts that ectopic expression of Tbx15 in ventral mesenchyme should give rise to a dorsalized pigmentation phenotype and could be tested with gain-of-function approaches. |
| T11048 |
51874-51877 |
PRP$ |
denotes |
Our |
| T11049 |
51878-51883 |
NN |
denotes |
model |
| T11050 |
51884-51892 |
VBZ |
denotes |
predicts |
| T11051 |
51893-51897 |
IN |
denotes |
that |
| T11052 |
51955-51959 |
VB |
denotes |
give |
| T11053 |
51898-51905 |
JJ |
denotes |
ectopic |
| T11054 |
51906-51916 |
NN |
denotes |
expression |
| T11055 |
51917-51919 |
IN |
denotes |
of |
| T11056 |
51920-51925 |
NN |
denotes |
Tbx15 |
| T11057 |
51926-51928 |
IN |
denotes |
in |
| T11058 |
51929-51936 |
JJ |
denotes |
ventral |
| T11059 |
51937-51947 |
NN |
denotes |
mesenchyme |
| T11060 |
51948-51954 |
MD |
denotes |
should |
| T11061 |
51960-51964 |
NN |
denotes |
rise |
| T11062 |
51965-51967 |
IN |
denotes |
to |
| T11063 |
51968-51969 |
DT |
denotes |
a |
| T11064 |
51994-52003 |
NN |
denotes |
phenotype |
| T11065 |
51970-51980 |
JJ |
denotes |
dorsalized |
| T11066 |
51981-51993 |
NN |
denotes |
pigmentation |
| T11067 |
52004-52007 |
CC |
denotes |
and |
| T11068 |
52008-52013 |
MD |
denotes |
could |
| T11069 |
52017-52023 |
VBN |
denotes |
tested |
| T11070 |
52014-52016 |
VB |
denotes |
be |
| T11071 |
52024-52028 |
IN |
denotes |
with |
| T11072 |
52029-52033 |
NN |
denotes |
gain |
| T11073 |
52046-52056 |
NNS |
denotes |
approaches |
| T11074 |
52033-52034 |
HYPH |
denotes |
- |
| T11075 |
52034-52036 |
IN |
denotes |
of |
| T11076 |
52036-52037 |
HYPH |
denotes |
- |
| T11077 |
52037-52045 |
NN |
denotes |
function |
| T11078 |
52056-52057 |
. |
denotes |
. |
| T11079 |
52057-52162 |
sentence |
denotes |
However, Tbx15 expression is very dynamic and is restricted to dorsal mesoderm only from E11.5 to E13.5. |
| T11080 |
52058-52065 |
RB |
denotes |
However |
| T11081 |
52084-52086 |
VBZ |
denotes |
is |
| T11082 |
52065-52067 |
, |
denotes |
, |
| T11083 |
52067-52072 |
NN |
denotes |
Tbx15 |
| T11084 |
52073-52083 |
NN |
denotes |
expression |
| T11085 |
52087-52091 |
RB |
denotes |
very |
| T11086 |
52092-52099 |
JJ |
denotes |
dynamic |
| T11087 |
52100-52103 |
CC |
denotes |
and |
| T11088 |
52104-52106 |
VBZ |
denotes |
is |
| T11089 |
52107-52117 |
VBN |
denotes |
restricted |
| T11090 |
52118-52120 |
IN |
denotes |
to |
| T11091 |
52121-52127 |
JJ |
denotes |
dorsal |
| T11092 |
52128-52136 |
NN |
denotes |
mesoderm |
| T11093 |
52137-52141 |
RB |
denotes |
only |
| T11094 |
52142-52146 |
IN |
denotes |
from |
| T11095 |
52147-52152 |
NN |
denotes |
E11.5 |
| T11096 |
52153-52155 |
IN |
denotes |
to |
| T11097 |
52156-52161 |
NN |
denotes |
E13.5 |
| T11098 |
52161-52162 |
. |
denotes |
. |
| T11099 |
52162-52426 |
sentence |
denotes |
It is possible that Tbx15 influences skin patterning in a very narrow window of development; alternatively, establishment of dorsal identity by Tbx15 may require another as-yet-unidentified factor that is only present in the mesenchyme underlying dorsal ectoderm. |
| T11100 |
52163-52165 |
PRP |
denotes |
It |
| T11101 |
52166-52168 |
VBZ |
denotes |
is |
| T11102 |
52317-52324 |
VB |
denotes |
require |
| T11103 |
52169-52177 |
JJ |
denotes |
possible |
| T11104 |
52178-52182 |
IN |
denotes |
that |
| T11105 |
52189-52199 |
VBZ |
denotes |
influences |
| T11106 |
52183-52188 |
NN |
denotes |
Tbx15 |
| T11107 |
52200-52204 |
NN |
denotes |
skin |
| T11108 |
52205-52215 |
NN |
denotes |
patterning |
| T11109 |
52216-52218 |
IN |
denotes |
in |
| T11110 |
52219-52220 |
DT |
denotes |
a |
| T11111 |
52233-52239 |
NN |
denotes |
window |
| T11112 |
52221-52225 |
RB |
denotes |
very |
| T11113 |
52226-52232 |
JJ |
denotes |
narrow |
| T11114 |
52240-52242 |
IN |
denotes |
of |
| T11115 |
52243-52254 |
NN |
denotes |
development |
| T11116 |
52254-52255 |
: |
denotes |
; |
| T11117 |
52256-52269 |
RB |
denotes |
alternatively |
| T11118 |
52269-52271 |
, |
denotes |
, |
| T11119 |
52271-52284 |
NN |
denotes |
establishment |
| T11120 |
52285-52287 |
IN |
denotes |
of |
| T11121 |
52288-52294 |
JJ |
denotes |
dorsal |
| T11122 |
52295-52303 |
NN |
denotes |
identity |
| T11123 |
52304-52306 |
IN |
denotes |
by |
| T11124 |
52307-52312 |
NN |
denotes |
Tbx15 |
| T11125 |
52313-52316 |
MD |
denotes |
may |
| T11126 |
52325-52332 |
DT |
denotes |
another |
| T11127 |
52353-52359 |
NN |
denotes |
factor |
| T11128 |
52333-52335 |
RB |
denotes |
as |
| T11129 |
52336-52339 |
RB |
denotes |
yet |
| T11130 |
52335-52336 |
HYPH |
denotes |
- |
| T11131 |
52340-52352 |
JJ |
denotes |
unidentified |
| T11132 |
52339-52340 |
HYPH |
denotes |
- |
| T11133 |
52360-52364 |
WDT |
denotes |
that |
| T11134 |
52365-52367 |
VBZ |
denotes |
is |
| T11135 |
52368-52372 |
RB |
denotes |
only |
| T11136 |
52373-52380 |
JJ |
denotes |
present |
| T11137 |
52381-52383 |
IN |
denotes |
in |
| T11138 |
52384-52387 |
DT |
denotes |
the |
| T11139 |
52388-52398 |
NN |
denotes |
mesenchyme |
| T11140 |
52399-52409 |
VBG |
denotes |
underlying |
| T11141 |
52410-52416 |
JJ |
denotes |
dorsal |
| T11142 |
52417-52425 |
NN |
denotes |
ectoderm |
| T11143 |
52425-52426 |
. |
denotes |
. |
| T11305 |
52428-52440 |
NN |
denotes |
Pigmentation |
| T11306 |
52441-52449 |
NNS |
denotes |
Patterns |
| T11307 |
52450-52453 |
CC |
denotes |
and |
| T11308 |
52454-52459 |
NN |
denotes |
Tbx15 |
| T11309 |
52460-52462 |
IN |
denotes |
in |
| T11310 |
52463-52468 |
JJ |
denotes |
Other |
| T11311 |
52469-52476 |
NNS |
denotes |
Mammals |
| T11312 |
52476-52849 |
sentence |
denotes |
The lateral somitic frontier, defined as the lineage boundary between somite-derived versus lateral plate-derived mesoderm, is established during somitogenesis early in development (Mauger 1972; Christ et al. 1983; Olivera-Martinez et al. 2000; Nowicki et al. 2003), but remains distinct in postnatal animals despite the potential for extensive cell mixing (see Figure 8). |
| T11313 |
52477-52480 |
DT |
denotes |
The |
| T11314 |
52497-52505 |
NN |
denotes |
frontier |
| T11315 |
52481-52488 |
JJ |
denotes |
lateral |
| T11316 |
52489-52496 |
JJ |
denotes |
somitic |
| T11317 |
52604-52615 |
VBN |
denotes |
established |
| T11318 |
52505-52507 |
, |
denotes |
, |
| T11319 |
52507-52514 |
VBN |
denotes |
defined |
| T11320 |
52515-52517 |
IN |
denotes |
as |
| T11321 |
52518-52521 |
DT |
denotes |
the |
| T11322 |
52530-52538 |
NN |
denotes |
boundary |
| T11323 |
52522-52529 |
NN |
denotes |
lineage |
| T11324 |
52539-52546 |
IN |
denotes |
between |
| T11325 |
52547-52553 |
NN |
denotes |
somite |
| T11326 |
52554-52561 |
VBN |
denotes |
derived |
| T11327 |
52553-52554 |
HYPH |
denotes |
- |
| T11328 |
52591-52599 |
NN |
denotes |
mesoderm |
| T11329 |
52562-52568 |
CC |
denotes |
versus |
| T11330 |
52569-52576 |
JJ |
denotes |
lateral |
| T11331 |
52577-52582 |
NN |
denotes |
plate |
| T11332 |
52583-52590 |
VBN |
denotes |
derived |
| T11333 |
52582-52583 |
HYPH |
denotes |
- |
| T11334 |
52599-52601 |
, |
denotes |
, |
| T11335 |
52601-52603 |
VBZ |
denotes |
is |
| T11336 |
52616-52622 |
IN |
denotes |
during |
| T11337 |
52623-52636 |
NN |
denotes |
somitogenesis |
| T11338 |
52637-52642 |
RB |
denotes |
early |
| T11339 |
52643-52645 |
IN |
denotes |
in |
| T11340 |
52646-52657 |
NN |
denotes |
development |
| T11341 |
52658-52659 |
-LRB- |
denotes |
( |
| T11342 |
52659-52665 |
NNP |
denotes |
Mauger |
| T11343 |
52666-52670 |
CD |
denotes |
1972 |
| T11344 |
52670-52671 |
: |
denotes |
; |
| T11345 |
52672-52678 |
NNP |
denotes |
Christ |
| T11346 |
52679-52681 |
FW |
denotes |
et |
| T11347 |
52682-52685 |
FW |
denotes |
al. |
| T11348 |
52686-52690 |
CD |
denotes |
1983 |
| T11349 |
52690-52691 |
: |
denotes |
; |
| T11350 |
52692-52699 |
NNP |
denotes |
Olivera |
| T11351 |
52699-52700 |
HYPH |
denotes |
- |
| T11352 |
52700-52708 |
NNP |
denotes |
Martinez |
| T11353 |
52709-52711 |
FW |
denotes |
et |
| T11354 |
52712-52715 |
FW |
denotes |
al. |
| T11355 |
52716-52720 |
CD |
denotes |
2000 |
| T11356 |
52720-52721 |
: |
denotes |
; |
| T11357 |
52722-52729 |
NNP |
denotes |
Nowicki |
| T11358 |
52730-52732 |
FW |
denotes |
et |
| T11359 |
52733-52736 |
FW |
denotes |
al. |
| T11360 |
52737-52741 |
CD |
denotes |
2003 |
| T11361 |
52741-52742 |
-RRB- |
denotes |
) |
| T11362 |
52742-52744 |
, |
denotes |
, |
| T11363 |
52744-52747 |
CC |
denotes |
but |
| T11364 |
52748-52755 |
VBZ |
denotes |
remains |
| T11365 |
52756-52764 |
JJ |
denotes |
distinct |
| T11366 |
52765-52767 |
IN |
denotes |
in |
| T11367 |
52768-52777 |
JJ |
denotes |
postnatal |
| T11368 |
52778-52785 |
NNS |
denotes |
animals |
| T11369 |
52786-52793 |
IN |
denotes |
despite |
| T11370 |
52794-52797 |
DT |
denotes |
the |
| T11371 |
52798-52807 |
NN |
denotes |
potential |
| T11372 |
52808-52811 |
IN |
denotes |
for |
| T11373 |
52812-52821 |
JJ |
denotes |
extensive |
| T11374 |
52827-52833 |
NN |
denotes |
mixing |
| T11375 |
52822-52826 |
NN |
denotes |
cell |
| T11376 |
52834-52835 |
-LRB- |
denotes |
( |
| T11377 |
52835-52838 |
VB |
denotes |
see |
| T11378 |
52839-52845 |
NN |
denotes |
Figure |
| T11379 |
52846-52847 |
CD |
denotes |
8 |
| T11380 |
52847-52848 |
-RRB- |
denotes |
) |
| T11381 |
52848-52849 |
. |
denotes |
. |
| T11382 |
52849-53061 |
sentence |
denotes |
However, our transplantation and fate-mapping studies demonstrate that the lateral somitic frontier lies dorsal to the pigmentation boundary and does not obviously correlate with a difference in skin morphology. |
| T11383 |
52850-52857 |
RB |
denotes |
However |
| T11384 |
52904-52915 |
VBP |
denotes |
demonstrate |
| T11385 |
52857-52859 |
, |
denotes |
, |
| T11386 |
52859-52862 |
PRP$ |
denotes |
our |
| T11387 |
52896-52903 |
NNS |
denotes |
studies |
| T11388 |
52863-52878 |
NN |
denotes |
transplantation |
| T11389 |
52879-52882 |
CC |
denotes |
and |
| T11390 |
52883-52887 |
NN |
denotes |
fate |
| T11391 |
52887-52888 |
HYPH |
denotes |
- |
| T11392 |
52888-52895 |
VBG |
denotes |
mapping |
| T11393 |
52916-52920 |
IN |
denotes |
that |
| T11394 |
52950-52954 |
VBZ |
denotes |
lies |
| T11395 |
52921-52924 |
DT |
denotes |
the |
| T11396 |
52941-52949 |
NN |
denotes |
frontier |
| T11397 |
52925-52932 |
JJ |
denotes |
lateral |
| T11398 |
52933-52940 |
JJ |
denotes |
somitic |
| T11399 |
52955-52961 |
RB |
denotes |
dorsal |
| T11400 |
52962-52964 |
IN |
denotes |
to |
| T11401 |
52965-52968 |
DT |
denotes |
the |
| T11402 |
52982-52990 |
NN |
denotes |
boundary |
| T11403 |
52969-52981 |
NN |
denotes |
pigmentation |
| T11404 |
52991-52994 |
CC |
denotes |
and |
| T11405 |
52995-52999 |
VBZ |
denotes |
does |
| T11406 |
53014-53023 |
VB |
denotes |
correlate |
| T11407 |
53000-53003 |
RB |
denotes |
not |
| T11408 |
53004-53013 |
RB |
denotes |
obviously |
| T11409 |
53024-53028 |
IN |
denotes |
with |
| T11410 |
53029-53030 |
DT |
denotes |
a |
| T11411 |
53031-53041 |
NN |
denotes |
difference |
| T11412 |
53042-53044 |
IN |
denotes |
in |
| T11413 |
53045-53049 |
NN |
denotes |
skin |
| T11414 |
53050-53060 |
NN |
denotes |
morphology |
| T11415 |
53060-53061 |
. |
denotes |
. |
| T11416 |
53061-53331 |
sentence |
denotes |
An additional dorsoventral domain that is not externally apparent has emerged from studies of Msx1, whose expression marks a subgroup of somite-derived mesenchymal cells that contribute to dermis in a narrow stripe along the paraspinal region (Houzelstein et al. 2000). |
| T11417 |
53062-53064 |
DT |
denotes |
An |
| T11418 |
53089-53095 |
NN |
denotes |
domain |
| T11419 |
53065-53075 |
JJ |
denotes |
additional |
| T11420 |
53076-53088 |
JJ |
denotes |
dorsoventral |
| T11421 |
53132-53139 |
VBN |
denotes |
emerged |
| T11422 |
53096-53100 |
WDT |
denotes |
that |
| T11423 |
53101-53103 |
VBZ |
denotes |
is |
| T11424 |
53104-53107 |
RB |
denotes |
not |
| T11425 |
53108-53118 |
RB |
denotes |
externally |
| T11426 |
53119-53127 |
JJ |
denotes |
apparent |
| T11427 |
53128-53131 |
VBZ |
denotes |
has |
| T11428 |
53140-53144 |
IN |
denotes |
from |
| T11429 |
53145-53152 |
NNS |
denotes |
studies |
| T11430 |
53153-53155 |
IN |
denotes |
of |
| T11431 |
53156-53160 |
NN |
denotes |
Msx1 |
| T11432 |
53160-53162 |
, |
denotes |
, |
| T11433 |
53162-53167 |
WP$ |
denotes |
whose |
| T11434 |
53168-53178 |
NN |
denotes |
expression |
| T11435 |
53179-53184 |
VBZ |
denotes |
marks |
| T11436 |
53185-53186 |
DT |
denotes |
a |
| T11437 |
53187-53195 |
NN |
denotes |
subgroup |
| T11438 |
53196-53198 |
IN |
denotes |
of |
| T11439 |
53199-53205 |
NN |
denotes |
somite |
| T11440 |
53206-53213 |
VBN |
denotes |
derived |
| T11441 |
53205-53206 |
HYPH |
denotes |
- |
| T11442 |
53226-53231 |
NNS |
denotes |
cells |
| T11443 |
53214-53225 |
JJ |
denotes |
mesenchymal |
| T11444 |
53232-53236 |
WDT |
denotes |
that |
| T11445 |
53237-53247 |
VBP |
denotes |
contribute |
| T11446 |
53248-53250 |
IN |
denotes |
to |
| T11447 |
53251-53257 |
NN |
denotes |
dermis |
| T11448 |
53258-53260 |
IN |
denotes |
in |
| T11449 |
53261-53262 |
DT |
denotes |
a |
| T11450 |
53270-53276 |
NN |
denotes |
stripe |
| T11451 |
53263-53269 |
JJ |
denotes |
narrow |
| T11452 |
53277-53282 |
IN |
denotes |
along |
| T11453 |
53283-53286 |
DT |
denotes |
the |
| T11454 |
53298-53304 |
NN |
denotes |
region |
| T11455 |
53287-53297 |
JJ |
denotes |
paraspinal |
| T11456 |
53305-53306 |
-LRB- |
denotes |
( |
| T11457 |
53306-53317 |
NNP |
denotes |
Houzelstein |
| T11458 |
53318-53320 |
FW |
denotes |
et |
| T11459 |
53321-53324 |
FW |
denotes |
al. |
| T11460 |
53325-53329 |
CD |
denotes |
2000 |
| T11461 |
53329-53330 |
-RRB- |
denotes |
) |
| T11462 |
53330-53331 |
. |
denotes |
. |
| T11463 |
53331-53570 |
sentence |
denotes |
Thus, there exist at least three distinct boundaries in postnatal mammalian skin that are parallel to the sagittal plane, marked by differences in pigment-type synthesis, differences in cell lineage, and differences in expression of Msx1. |
| T11464 |
53332-53336 |
RB |
denotes |
Thus |
| T11465 |
53344-53349 |
VBP |
denotes |
exist |
| T11466 |
53336-53338 |
, |
denotes |
, |
| T11467 |
53338-53343 |
EX |
denotes |
there |
| T11468 |
53350-53352 |
RB |
denotes |
at |
| T11469 |
53359-53364 |
CD |
denotes |
three |
| T11470 |
53353-53358 |
RBS |
denotes |
least |
| T11471 |
53374-53384 |
NNS |
denotes |
boundaries |
| T11472 |
53365-53373 |
JJ |
denotes |
distinct |
| T11473 |
53385-53387 |
IN |
denotes |
in |
| T11474 |
53388-53397 |
JJ |
denotes |
postnatal |
| T11475 |
53408-53412 |
NN |
denotes |
skin |
| T11476 |
53398-53407 |
JJ |
denotes |
mammalian |
| T11477 |
53413-53417 |
WDT |
denotes |
that |
| T11478 |
53418-53421 |
VBP |
denotes |
are |
| T11479 |
53422-53430 |
JJ |
denotes |
parallel |
| T11480 |
53431-53433 |
IN |
denotes |
to |
| T11481 |
53434-53437 |
DT |
denotes |
the |
| T11482 |
53447-53452 |
NN |
denotes |
plane |
| T11483 |
53438-53446 |
JJ |
denotes |
sagittal |
| T11484 |
53452-53454 |
, |
denotes |
, |
| T11485 |
53454-53460 |
VBN |
denotes |
marked |
| T11486 |
53461-53463 |
IN |
denotes |
by |
| T11487 |
53464-53475 |
NNS |
denotes |
differences |
| T11488 |
53476-53478 |
IN |
denotes |
in |
| T11489 |
53479-53486 |
NN |
denotes |
pigment |
| T11490 |
53487-53491 |
NN |
denotes |
type |
| T11491 |
53486-53487 |
HYPH |
denotes |
- |
| T11492 |
53492-53501 |
NN |
denotes |
synthesis |
| T11493 |
53501-53503 |
, |
denotes |
, |
| T11494 |
53503-53514 |
NNS |
denotes |
differences |
| T11495 |
53515-53517 |
IN |
denotes |
in |
| T11496 |
53518-53522 |
NN |
denotes |
cell |
| T11497 |
53523-53530 |
NN |
denotes |
lineage |
| T11498 |
53530-53532 |
, |
denotes |
, |
| T11499 |
53532-53535 |
CC |
denotes |
and |
| T11500 |
53536-53547 |
NNS |
denotes |
differences |
| T11501 |
53548-53550 |
IN |
denotes |
in |
| T11502 |
53551-53561 |
NN |
denotes |
expression |
| T11503 |
53562-53564 |
IN |
denotes |
of |
| T11504 |
53565-53569 |
NN |
denotes |
Msx1 |
| T11505 |
53569-53570 |
. |
denotes |
. |
| T11506 |
53570-53758 |
sentence |
denotes |
In rodents, only the pigmentation boundary is evident externally, but many mammals have more complicated patterns of hair type, length, and/or color that vary along the dorsoventral axis. |
| T11507 |
53571-53573 |
IN |
denotes |
In |
| T11508 |
53614-53616 |
VBZ |
denotes |
is |
| T11509 |
53574-53581 |
NNS |
denotes |
rodents |
| T11510 |
53581-53583 |
, |
denotes |
, |
| T11511 |
53583-53587 |
RB |
denotes |
only |
| T11512 |
53605-53613 |
NN |
denotes |
boundary |
| T11513 |
53588-53591 |
DT |
denotes |
the |
| T11514 |
53592-53604 |
NN |
denotes |
pigmentation |
| T11515 |
53617-53624 |
JJ |
denotes |
evident |
| T11516 |
53625-53635 |
RB |
denotes |
externally |
| T11517 |
53635-53637 |
, |
denotes |
, |
| T11518 |
53637-53640 |
CC |
denotes |
but |
| T11519 |
53641-53645 |
JJ |
denotes |
many |
| T11520 |
53646-53653 |
NNS |
denotes |
mammals |
| T11521 |
53654-53658 |
VBP |
denotes |
have |
| T11522 |
53659-53663 |
RBR |
denotes |
more |
| T11523 |
53664-53675 |
JJ |
denotes |
complicated |
| T11524 |
53676-53684 |
NNS |
denotes |
patterns |
| T11525 |
53685-53687 |
IN |
denotes |
of |
| T11526 |
53688-53692 |
NN |
denotes |
hair |
| T11527 |
53693-53697 |
NN |
denotes |
type |
| T11528 |
53697-53699 |
, |
denotes |
, |
| T11529 |
53699-53705 |
NN |
denotes |
length |
| T11530 |
53705-53707 |
, |
denotes |
, |
| T11531 |
53707-53710 |
CC |
denotes |
and |
| T11532 |
53710-53711 |
HYPH |
denotes |
/ |
| T11533 |
53711-53713 |
CC |
denotes |
or |
| T11534 |
53714-53719 |
NN |
denotes |
color |
| T11535 |
53720-53724 |
WDT |
denotes |
that |
| T11536 |
53725-53729 |
VBP |
denotes |
vary |
| T11537 |
53730-53735 |
IN |
denotes |
along |
| T11538 |
53736-53739 |
DT |
denotes |
the |
| T11539 |
53753-53757 |
NN |
denotes |
axis |
| T11540 |
53740-53752 |
JJ |
denotes |
dorsoventral |
| T11541 |
53757-53758 |
. |
denotes |
. |
| T11542 |
53758-54022 |
sentence |
denotes |
Raccoons, squirrels, skunks, and many different ungulates exhibit lateral stripes whose developmental origins have not been investigated, but may correspond to the lateral somitic frontier, the paraspinal Msx1 compartment, or an interaction between these domains. |
| T11543 |
53759-53767 |
NNS |
denotes |
Raccoons |
| T11544 |
53817-53824 |
VBP |
denotes |
exhibit |
| T11545 |
53767-53769 |
, |
denotes |
, |
| T11546 |
53769-53778 |
NNS |
denotes |
squirrels |
| T11547 |
53778-53780 |
, |
denotes |
, |
| T11548 |
53780-53786 |
NNS |
denotes |
skunks |
| T11549 |
53786-53788 |
, |
denotes |
, |
| T11550 |
53788-53791 |
CC |
denotes |
and |
| T11551 |
53792-53796 |
JJ |
denotes |
many |
| T11552 |
53807-53816 |
NNS |
denotes |
ungulates |
| T11553 |
53797-53806 |
JJ |
denotes |
different |
| T11554 |
53825-53832 |
JJ |
denotes |
lateral |
| T11555 |
53833-53840 |
NNS |
denotes |
stripes |
| T11556 |
53841-53846 |
WP$ |
denotes |
whose |
| T11557 |
53861-53868 |
NNS |
denotes |
origins |
| T11558 |
53847-53860 |
JJ |
denotes |
developmental |
| T11559 |
53883-53895 |
VBN |
denotes |
investigated |
| T11560 |
53869-53873 |
VBP |
denotes |
have |
| T11561 |
53874-53877 |
RB |
denotes |
not |
| T11562 |
53878-53882 |
VBN |
denotes |
been |
| T11563 |
53895-53897 |
, |
denotes |
, |
| T11564 |
53897-53900 |
CC |
denotes |
but |
| T11565 |
53901-53904 |
MD |
denotes |
may |
| T11566 |
53905-53915 |
VB |
denotes |
correspond |
| T11567 |
53916-53918 |
IN |
denotes |
to |
| T11568 |
53919-53922 |
DT |
denotes |
the |
| T11569 |
53939-53947 |
NN |
denotes |
frontier |
| T11570 |
53923-53930 |
JJ |
denotes |
lateral |
| T11571 |
53931-53938 |
JJ |
denotes |
somitic |
| T11572 |
53947-53949 |
, |
denotes |
, |
| T11573 |
53949-53952 |
DT |
denotes |
the |
| T11574 |
53969-53980 |
NN |
denotes |
compartment |
| T11575 |
53953-53963 |
JJ |
denotes |
paraspinal |
| T11576 |
53964-53968 |
NN |
denotes |
Msx1 |
| T11577 |
53980-53982 |
, |
denotes |
, |
| T11578 |
53982-53984 |
CC |
denotes |
or |
| T11579 |
53985-53987 |
DT |
denotes |
an |
| T11580 |
53988-53999 |
NN |
denotes |
interaction |
| T11581 |
54000-54007 |
IN |
denotes |
between |
| T11582 |
54008-54013 |
DT |
denotes |
these |
| T11583 |
54014-54021 |
NNS |
denotes |
domains |
| T11584 |
54021-54022 |
. |
denotes |
. |
| T11585 |
54022-54174 |
sentence |
denotes |
The effect of Tbx15 on pigmentation in laboratory mice is reminiscent of coat-color patterns in both selected and natural populations of other mammals. |
| T11586 |
54023-54026 |
DT |
denotes |
The |
| T11587 |
54027-54033 |
NN |
denotes |
effect |
| T11588 |
54078-54080 |
VBZ |
denotes |
is |
| T11589 |
54034-54036 |
IN |
denotes |
of |
| T11590 |
54037-54042 |
NN |
denotes |
Tbx15 |
| T11591 |
54043-54045 |
IN |
denotes |
on |
| T11592 |
54046-54058 |
NN |
denotes |
pigmentation |
| T11593 |
54059-54061 |
IN |
denotes |
in |
| T11594 |
54062-54072 |
NN |
denotes |
laboratory |
| T11595 |
54073-54077 |
NNS |
denotes |
mice |
| T11596 |
54081-54092 |
JJ |
denotes |
reminiscent |
| T11597 |
54093-54095 |
IN |
denotes |
of |
| T11598 |
54096-54100 |
NN |
denotes |
coat |
| T11599 |
54101-54106 |
NN |
denotes |
color |
| T11600 |
54100-54101 |
HYPH |
denotes |
- |
| T11601 |
54107-54115 |
NNS |
denotes |
patterns |
| T11602 |
54116-54118 |
IN |
denotes |
in |
| T11603 |
54119-54123 |
CC |
denotes |
both |
| T11604 |
54124-54132 |
JJ |
denotes |
selected |
| T11605 |
54145-54156 |
NNS |
denotes |
populations |
| T11606 |
54133-54136 |
CC |
denotes |
and |
| T11607 |
54137-54144 |
JJ |
denotes |
natural |
| T11608 |
54157-54159 |
IN |
denotes |
of |
| T11609 |
54160-54165 |
JJ |
denotes |
other |
| T11610 |
54166-54173 |
NNS |
denotes |
mammals |
| T11611 |
54173-54174 |
. |
denotes |
. |
| T11612 |
54174-54478 |
sentence |
denotes |
Saddle markings are common in some dog breeds, such as German shepherds, and in certain populations of Peromyscus polionotus, in which a dorsal extension of ventral depigmentation provides an adaptive advantage to subspecies that live on white sand reefs (Blair 1951; Kaufman 1974; Belk and Smith 1996). |
| T11613 |
54175-54181 |
NN |
denotes |
Saddle |
| T11614 |
54182-54190 |
NNS |
denotes |
markings |
| T11615 |
54191-54194 |
VBP |
denotes |
are |
| T11616 |
54195-54201 |
JJ |
denotes |
common |
| T11617 |
54202-54204 |
IN |
denotes |
in |
| T11618 |
54205-54209 |
DT |
denotes |
some |
| T11619 |
54214-54220 |
NNS |
denotes |
breeds |
| T11620 |
54210-54213 |
NN |
denotes |
dog |
| T11621 |
54220-54222 |
, |
denotes |
, |
| T11622 |
54222-54226 |
JJ |
denotes |
such |
| T11623 |
54227-54229 |
IN |
denotes |
as |
| T11624 |
54230-54236 |
NNP |
denotes |
German |
| T11625 |
54237-54246 |
NNS |
denotes |
shepherds |
| T11626 |
54246-54248 |
, |
denotes |
, |
| T11627 |
54248-54251 |
CC |
denotes |
and |
| T11628 |
54252-54254 |
IN |
denotes |
in |
| T11629 |
54255-54262 |
JJ |
denotes |
certain |
| T11630 |
54263-54274 |
NNS |
denotes |
populations |
| T11631 |
54275-54277 |
IN |
denotes |
of |
| T11632 |
54278-54288 |
NNP |
denotes |
Peromyscus |
| T11633 |
54289-54299 |
NNP |
denotes |
polionotus |
| T11634 |
54299-54301 |
, |
denotes |
, |
| T11635 |
54301-54303 |
IN |
denotes |
in |
| T11636 |
54355-54363 |
VBZ |
denotes |
provides |
| T11637 |
54304-54309 |
WDT |
denotes |
which |
| T11638 |
54310-54311 |
DT |
denotes |
a |
| T11639 |
54319-54328 |
NN |
denotes |
extension |
| T11640 |
54312-54318 |
JJ |
denotes |
dorsal |
| T11641 |
54329-54331 |
IN |
denotes |
of |
| T11642 |
54332-54339 |
JJ |
denotes |
ventral |
| T11643 |
54340-54354 |
NN |
denotes |
depigmentation |
| T11644 |
54364-54366 |
DT |
denotes |
an |
| T11645 |
54376-54385 |
NN |
denotes |
advantage |
| T11646 |
54367-54375 |
JJ |
denotes |
adaptive |
| T11647 |
54386-54388 |
IN |
denotes |
to |
| T11648 |
54389-54399 |
NNS |
denotes |
subspecies |
| T11649 |
54400-54404 |
WDT |
denotes |
that |
| T11650 |
54405-54409 |
VBP |
denotes |
live |
| T11651 |
54410-54412 |
IN |
denotes |
on |
| T11652 |
54413-54418 |
JJ |
denotes |
white |
| T11653 |
54424-54429 |
NNS |
denotes |
reefs |
| T11654 |
54419-54423 |
NN |
denotes |
sand |
| T11655 |
54430-54431 |
-LRB- |
denotes |
( |
| T11656 |
54431-54436 |
NNP |
denotes |
Blair |
| T11657 |
54437-54441 |
CD |
denotes |
1951 |
| T11658 |
54441-54442 |
: |
denotes |
; |
| T11659 |
54443-54450 |
NNP |
denotes |
Kaufman |
| T11660 |
54451-54455 |
CD |
denotes |
1974 |
| T11661 |
54455-54456 |
: |
denotes |
; |
| T11662 |
54457-54461 |
NNP |
denotes |
Belk |
| T11663 |
54462-54465 |
CC |
denotes |
and |
| T11664 |
54466-54471 |
NNP |
denotes |
Smith |
| T11665 |
54472-54476 |
CD |
denotes |
1996 |
| T11666 |
54476-54477 |
-RRB- |
denotes |
) |
| T11667 |
54477-54478 |
. |
denotes |
. |
| T11668 |
54478-54702 |
sentence |
denotes |
Neither German shepherds nor deer mice have craniofacial characteristics similar to the deH mutation, but the pigmentation patterns in these animals could represent alterations in the regulation or action of Tbx15 activity. |
| T11669 |
54479-54486 |
CC |
denotes |
Neither |
| T11670 |
54494-54503 |
NNS |
denotes |
shepherds |
| T11671 |
54487-54493 |
NNP |
denotes |
German |
| T11672 |
54518-54522 |
VBP |
denotes |
have |
| T11673 |
54504-54507 |
CC |
denotes |
nor |
| T11674 |
54508-54512 |
NN |
denotes |
deer |
| T11675 |
54513-54517 |
NNS |
denotes |
mice |
| T11676 |
54523-54535 |
JJ |
denotes |
craniofacial |
| T11677 |
54536-54551 |
NNS |
denotes |
characteristics |
| T11678 |
54552-54559 |
JJ |
denotes |
similar |
| T11679 |
54560-54562 |
IN |
denotes |
to |
| T11680 |
54563-54566 |
DT |
denotes |
the |
| T11681 |
54571-54579 |
NN |
denotes |
mutation |
| T11682 |
54567-54570 |
NN |
denotes |
deH |
| T11683 |
54579-54581 |
, |
denotes |
, |
| T11684 |
54581-54584 |
CC |
denotes |
but |
| T11685 |
54585-54588 |
DT |
denotes |
the |
| T11686 |
54602-54610 |
NNS |
denotes |
patterns |
| T11687 |
54589-54601 |
NN |
denotes |
pigmentation |
| T11688 |
54634-54643 |
VB |
denotes |
represent |
| T11689 |
54611-54613 |
IN |
denotes |
in |
| T11690 |
54614-54619 |
DT |
denotes |
these |
| T11691 |
54620-54627 |
NNS |
denotes |
animals |
| T11692 |
54628-54633 |
MD |
denotes |
could |
| T11693 |
54644-54655 |
NNS |
denotes |
alterations |
| T11694 |
54656-54658 |
IN |
denotes |
in |
| T11695 |
54659-54662 |
DT |
denotes |
the |
| T11696 |
54663-54673 |
NN |
denotes |
regulation |
| T11697 |
54674-54676 |
CC |
denotes |
or |
| T11698 |
54677-54683 |
NN |
denotes |
action |
| T11699 |
54684-54686 |
IN |
denotes |
of |
| T11700 |
54687-54692 |
NN |
denotes |
Tbx15 |
| T11701 |
54693-54701 |
NN |
denotes |
activity |
| T11702 |
54701-54702 |
. |
denotes |
. |
| T11703 |
54702-54904 |
sentence |
denotes |
From the opposite perspective, the effects of Tbx15 on coat color are only apparent in certain genetic backgrounds and may not be evident at all in mammals that lack dorsoventral pigmentation patterns. |
| T11704 |
54703-54707 |
IN |
denotes |
From |
| T11705 |
54769-54772 |
VBP |
denotes |
are |
| T11706 |
54708-54711 |
DT |
denotes |
the |
| T11707 |
54721-54732 |
NN |
denotes |
perspective |
| T11708 |
54712-54720 |
JJ |
denotes |
opposite |
| T11709 |
54732-54734 |
, |
denotes |
, |
| T11710 |
54734-54737 |
DT |
denotes |
the |
| T11711 |
54738-54745 |
NNS |
denotes |
effects |
| T11712 |
54746-54748 |
IN |
denotes |
of |
| T11713 |
54749-54754 |
NN |
denotes |
Tbx15 |
| T11714 |
54755-54757 |
IN |
denotes |
on |
| T11715 |
54758-54762 |
NN |
denotes |
coat |
| T11716 |
54763-54768 |
NN |
denotes |
color |
| T11717 |
54773-54777 |
RB |
denotes |
only |
| T11718 |
54778-54786 |
JJ |
denotes |
apparent |
| T11719 |
54787-54789 |
IN |
denotes |
in |
| T11720 |
54790-54797 |
JJ |
denotes |
certain |
| T11721 |
54806-54817 |
NNS |
denotes |
backgrounds |
| T11722 |
54798-54805 |
JJ |
denotes |
genetic |
| T11723 |
54818-54821 |
CC |
denotes |
and |
| T11724 |
54822-54825 |
MD |
denotes |
may |
| T11725 |
54830-54832 |
VB |
denotes |
be |
| T11726 |
54826-54829 |
RB |
denotes |
not |
| T11727 |
54833-54840 |
JJ |
denotes |
evident |
| T11728 |
54841-54843 |
RB |
denotes |
at |
| T11729 |
54844-54847 |
RB |
denotes |
all |
| T11730 |
54848-54850 |
IN |
denotes |
in |
| T11731 |
54851-54858 |
NNS |
denotes |
mammals |
| T11732 |
54859-54863 |
WDT |
denotes |
that |
| T11733 |
54864-54868 |
VBP |
denotes |
lack |
| T11734 |
54869-54881 |
JJ |
denotes |
dorsoventral |
| T11735 |
54895-54903 |
NNS |
denotes |
patterns |
| T11736 |
54882-54894 |
NN |
denotes |
pigmentation |
| T11737 |
54903-54904 |
. |
denotes |
. |
| T11738 |
54904-55075 |
sentence |
denotes |
Studying the sequence and expression of Tbx15 in other vertebrates may provide additional insight into patterns that affect the skeleton as well as the pigmentary system. |
| T11739 |
54905-54913 |
VBG |
denotes |
Studying |
| T11740 |
54976-54983 |
VB |
denotes |
provide |
| T11741 |
54914-54917 |
DT |
denotes |
the |
| T11742 |
54918-54926 |
NN |
denotes |
sequence |
| T11743 |
54927-54930 |
CC |
denotes |
and |
| T11744 |
54931-54941 |
NN |
denotes |
expression |
| T11745 |
54942-54944 |
IN |
denotes |
of |
| T11746 |
54945-54950 |
NN |
denotes |
Tbx15 |
| T11747 |
54951-54953 |
IN |
denotes |
in |
| T11748 |
54954-54959 |
JJ |
denotes |
other |
| T11749 |
54960-54971 |
NNS |
denotes |
vertebrates |
| T11750 |
54972-54975 |
MD |
denotes |
may |
| T11751 |
54984-54994 |
JJ |
denotes |
additional |
| T11752 |
54995-55002 |
NN |
denotes |
insight |
| T11753 |
55003-55007 |
IN |
denotes |
into |
| T11754 |
55008-55016 |
NNS |
denotes |
patterns |
| T11755 |
55017-55021 |
WDT |
denotes |
that |
| T11756 |
55022-55028 |
VBP |
denotes |
affect |
| T11757 |
55029-55032 |
DT |
denotes |
the |
| T11758 |
55033-55041 |
NN |
denotes |
skeleton |
| T11759 |
55042-55044 |
RB |
denotes |
as |
| T11760 |
55050-55052 |
IN |
denotes |
as |
| T11761 |
55045-55049 |
RB |
denotes |
well |
| T11762 |
55053-55056 |
DT |
denotes |
the |
| T11763 |
55068-55074 |
NN |
denotes |
system |
| T11764 |
55057-55067 |
JJ |
denotes |
pigmentary |
| T11765 |
55074-55075 |
. |
denotes |
. |
| T11800 |
55104-55714 |
sentence |
denotes |
All mice were obtained originally from The Jackson Laboratory (Bar Harbor, Maine, United States), except the BA strain (Stanford Veterinary Services Center, Stanford, California, United States), Hoxb6-Cre transgenic mice (kindly provided by M. Kuehn of the National Institutes of Health, Bethesda, Maryland, United States), mice carrying the R26R lacZ reporter allele (kindly provided by P. Soriano, Fred Hutchinson Cancer Research Center, Seattle, Washington, United States), and C57BL/6J (B6) ae/ae mice (kindly provided by L. Siracusa, Jefferson Medical College, Philadelphia, Pennsylvania, United States). |
| T11801 |
55105-55108 |
DT |
denotes |
All |
| T11802 |
55109-55113 |
NNS |
denotes |
mice |
| T11803 |
55119-55127 |
VBN |
denotes |
obtained |
| T11804 |
55114-55118 |
VBD |
denotes |
were |
| T11805 |
55128-55138 |
RB |
denotes |
originally |
| T11806 |
55139-55143 |
IN |
denotes |
from |
| T11807 |
55144-55147 |
DT |
denotes |
The |
| T11808 |
55156-55166 |
NNP |
denotes |
Laboratory |
| T11809 |
55148-55155 |
NNP |
denotes |
Jackson |
| T11810 |
55167-55168 |
-LRB- |
denotes |
( |
| T11811 |
55172-55178 |
NNP |
denotes |
Harbor |
| T11812 |
55168-55171 |
NNP |
denotes |
Bar |
| T11813 |
55178-55180 |
, |
denotes |
, |
| T11814 |
55180-55185 |
NNP |
denotes |
Maine |
| T11815 |
55185-55187 |
, |
denotes |
, |
| T11816 |
55187-55193 |
NNP |
denotes |
United |
| T11817 |
55194-55200 |
NNP |
denotes |
States |
| T11818 |
55200-55201 |
-RRB- |
denotes |
) |
| T11819 |
55201-55203 |
, |
denotes |
, |
| T11820 |
55203-55209 |
IN |
denotes |
except |
| T11821 |
55210-55213 |
DT |
denotes |
the |
| T11822 |
55217-55223 |
NN |
denotes |
strain |
| T11823 |
55214-55216 |
NN |
denotes |
BA |
| T11824 |
55224-55225 |
-LRB- |
denotes |
( |
| T11825 |
55254-55260 |
NNP |
denotes |
Center |
| T11826 |
55225-55233 |
NNP |
denotes |
Stanford |
| T11827 |
55234-55244 |
NNP |
denotes |
Veterinary |
| T11828 |
55245-55253 |
NNPS |
denotes |
Services |
| T11829 |
55260-55262 |
, |
denotes |
, |
| T11830 |
55262-55270 |
NNP |
denotes |
Stanford |
| T11831 |
55270-55272 |
, |
denotes |
, |
| T11832 |
55272-55282 |
NNP |
denotes |
California |
| T11833 |
55282-55284 |
, |
denotes |
, |
| T11834 |
55284-55290 |
NNP |
denotes |
United |
| T11835 |
55291-55297 |
NNP |
denotes |
States |
| T11836 |
55297-55298 |
-RRB- |
denotes |
) |
| T11837 |
55298-55300 |
, |
denotes |
, |
| T11838 |
55300-55305 |
NN |
denotes |
Hoxb6 |
| T11839 |
55306-55309 |
NN |
denotes |
Cre |
| T11840 |
55305-55306 |
HYPH |
denotes |
- |
| T11841 |
55321-55325 |
NNS |
denotes |
mice |
| T11842 |
55310-55320 |
JJ |
denotes |
transgenic |
| T11843 |
55326-55327 |
-LRB- |
denotes |
( |
| T11844 |
55327-55333 |
RB |
denotes |
kindly |
| T11845 |
55334-55342 |
VBN |
denotes |
provided |
| T11846 |
55343-55345 |
IN |
denotes |
by |
| T11847 |
55346-55348 |
NNP |
denotes |
M. |
| T11848 |
55349-55354 |
NNP |
denotes |
Kuehn |
| T11849 |
55355-55357 |
IN |
denotes |
of |
| T11850 |
55358-55361 |
DT |
denotes |
the |
| T11851 |
55371-55381 |
NNPS |
denotes |
Institutes |
| T11852 |
55362-55370 |
NNP |
denotes |
National |
| T11853 |
55382-55384 |
IN |
denotes |
of |
| T11854 |
55385-55391 |
NNP |
denotes |
Health |
| T11855 |
55391-55393 |
, |
denotes |
, |
| T11856 |
55393-55401 |
NNP |
denotes |
Bethesda |
| T11857 |
55401-55403 |
, |
denotes |
, |
| T11858 |
55403-55411 |
NNP |
denotes |
Maryland |
| T11859 |
55411-55413 |
, |
denotes |
, |
| T11860 |
55413-55419 |
NNP |
denotes |
United |
| T11861 |
55420-55426 |
NNP |
denotes |
States |
| T11862 |
55426-55427 |
-RRB- |
denotes |
) |
| T11863 |
55427-55429 |
, |
denotes |
, |
| T11864 |
55429-55433 |
NNS |
denotes |
mice |
| T11865 |
55434-55442 |
VBG |
denotes |
carrying |
| T11866 |
55443-55446 |
DT |
denotes |
the |
| T11867 |
55466-55472 |
NN |
denotes |
allele |
| T11868 |
55447-55451 |
NN |
denotes |
R26R |
| T11869 |
55457-55465 |
NN |
denotes |
reporter |
| T11870 |
55452-55456 |
NN |
denotes |
lacZ |
| T11871 |
55473-55474 |
-LRB- |
denotes |
( |
| T11872 |
55474-55480 |
RB |
denotes |
kindly |
| T11873 |
55481-55489 |
VBN |
denotes |
provided |
| T11874 |
55490-55492 |
IN |
denotes |
by |
| T11875 |
55493-55495 |
NNP |
denotes |
P. |
| T11876 |
55496-55503 |
NNP |
denotes |
Soriano |
| T11877 |
55503-55505 |
, |
denotes |
, |
| T11878 |
55505-55509 |
NNP |
denotes |
Fred |
| T11879 |
55537-55543 |
NNP |
denotes |
Center |
| T11880 |
55510-55520 |
NNP |
denotes |
Hutchinson |
| T11881 |
55521-55527 |
NNP |
denotes |
Cancer |
| T11882 |
55528-55536 |
NNP |
denotes |
Research |
| T11883 |
55543-55545 |
, |
denotes |
, |
| T11884 |
55545-55552 |
NNP |
denotes |
Seattle |
| T11885 |
55552-55554 |
, |
denotes |
, |
| T11886 |
55554-55564 |
NNP |
denotes |
Washington |
| T11887 |
55564-55566 |
, |
denotes |
, |
| T11888 |
55566-55572 |
NNP |
denotes |
United |
| T11889 |
55573-55579 |
NNP |
denotes |
States |
| T11890 |
55579-55580 |
-RRB- |
denotes |
) |
| T11891 |
55580-55582 |
, |
denotes |
, |
| T11892 |
55582-55585 |
CC |
denotes |
and |
| T11893 |
55586-55591 |
NN |
denotes |
C57BL |
| T11894 |
55592-55594 |
NN |
denotes |
6J |
| T11895 |
55591-55592 |
HYPH |
denotes |
/ |
| T11896 |
55606-55610 |
NNS |
denotes |
mice |
| T11897 |
55595-55596 |
-LRB- |
denotes |
( |
| T11898 |
55596-55598 |
NN |
denotes |
B6 |
| T11899 |
55598-55599 |
-RRB- |
denotes |
) |
| T11900 |
55600-55602 |
NN |
denotes |
ae |
| T11901 |
55603-55605 |
NN |
denotes |
ae |
| T11902 |
55602-55603 |
HYPH |
denotes |
/ |
| T11903 |
55611-55612 |
-LRB- |
denotes |
( |
| T11904 |
55612-55618 |
RB |
denotes |
kindly |
| T11905 |
55619-55627 |
VBN |
denotes |
provided |
| T11906 |
55628-55630 |
IN |
denotes |
by |
| T11907 |
55631-55633 |
NNP |
denotes |
L. |
| T11908 |
55634-55642 |
NNP |
denotes |
Siracusa |
| T11909 |
55642-55644 |
, |
denotes |
, |
| T11910 |
55644-55653 |
NNP |
denotes |
Jefferson |
| T11911 |
55662-55669 |
NNP |
denotes |
College |
| T11912 |
55654-55661 |
NNP |
denotes |
Medical |
| T11913 |
55669-55671 |
, |
denotes |
, |
| T11914 |
55671-55683 |
NNP |
denotes |
Philadelphia |
| T11915 |
55683-55685 |
, |
denotes |
, |
| T11916 |
55685-55697 |
NNP |
denotes |
Pennsylvania |
| T11917 |
55697-55699 |
, |
denotes |
, |
| T11918 |
55699-55705 |
NNP |
denotes |
United |
| T11919 |
55706-55712 |
NNP |
denotes |
States |
| T11920 |
55712-55713 |
-RRB- |
denotes |
) |
| T11921 |
55713-55714 |
. |
denotes |
. |
| T11922 |
55714-55837 |
sentence |
denotes |
The deH mutation arose in the 1960s in Harwell, probably on the BN strain background (C. Beechey, personal communication). |
| T11923 |
55715-55718 |
DT |
denotes |
The |
| T11924 |
55723-55731 |
NN |
denotes |
mutation |
| T11925 |
55719-55722 |
NN |
denotes |
deH |
| T11926 |
55732-55737 |
VBD |
denotes |
arose |
| T11927 |
55738-55740 |
IN |
denotes |
in |
| T11928 |
55741-55744 |
DT |
denotes |
the |
| T11929 |
55745-55750 |
NNS |
denotes |
1960s |
| T11930 |
55751-55753 |
IN |
denotes |
in |
| T11931 |
55754-55761 |
NNP |
denotes |
Harwell |
| T11932 |
55761-55763 |
, |
denotes |
, |
| T11933 |
55763-55771 |
RB |
denotes |
probably |
| T11934 |
55772-55774 |
IN |
denotes |
on |
| T11935 |
55775-55778 |
DT |
denotes |
the |
| T11936 |
55789-55799 |
NN |
denotes |
background |
| T11937 |
55779-55781 |
NN |
denotes |
BN |
| T11938 |
55782-55788 |
NN |
denotes |
strain |
| T11939 |
55800-55801 |
-LRB- |
denotes |
( |
| T11940 |
55801-55803 |
NNP |
denotes |
C. |
| T11941 |
55804-55811 |
NNP |
denotes |
Beechey |
| T11942 |
55811-55813 |
, |
denotes |
, |
| T11943 |
55813-55821 |
JJ |
denotes |
personal |
| T11944 |
55822-55835 |
NN |
denotes |
communication |
| T11945 |
55835-55836 |
-RRB- |
denotes |
) |
| T11946 |
55836-55837 |
. |
denotes |
. |
| T11947 |
55837-56038 |
sentence |
denotes |
We obtained deH on a B6/EiC3H background, introduced the at allele from the BTBR strain, and have maintained the line as a mixed deH/+ × deH/+ intercross stock with periodic outcrossing to BTBR or B6. |
| T11948 |
55838-55840 |
PRP |
denotes |
We |
| T11949 |
55841-55849 |
VBD |
denotes |
obtained |
| T11950 |
55850-55853 |
NN |
denotes |
deH |
| T11951 |
55854-55856 |
IN |
denotes |
on |
| T11952 |
55857-55858 |
DT |
denotes |
a |
| T11953 |
55868-55878 |
NN |
denotes |
background |
| T11954 |
55859-55861 |
NN |
denotes |
B6 |
| T11955 |
55862-55867 |
NN |
denotes |
EiC3H |
| T11956 |
55861-55862 |
HYPH |
denotes |
/ |
| T11957 |
55878-55880 |
, |
denotes |
, |
| T11958 |
55880-55890 |
VBD |
denotes |
introduced |
| T11959 |
55891-55894 |
DT |
denotes |
the |
| T11960 |
55898-55904 |
NN |
denotes |
allele |
| T11961 |
55895-55897 |
NN |
denotes |
at |
| T11962 |
55905-55909 |
IN |
denotes |
from |
| T11963 |
55910-55913 |
DT |
denotes |
the |
| T11964 |
55919-55925 |
NN |
denotes |
strain |
| T11965 |
55914-55918 |
NN |
denotes |
BTBR |
| T11966 |
55925-55927 |
, |
denotes |
, |
| T11967 |
55927-55930 |
CC |
denotes |
and |
| T11968 |
55931-55935 |
VBP |
denotes |
have |
| T11969 |
55936-55946 |
VBN |
denotes |
maintained |
| T11970 |
55947-55950 |
DT |
denotes |
the |
| T11971 |
55951-55955 |
NN |
denotes |
line |
| T11972 |
55956-55958 |
IN |
denotes |
as |
| T11973 |
55959-55960 |
DT |
denotes |
a |
| T11974 |
55992-55997 |
NN |
denotes |
stock |
| T11975 |
55961-55966 |
VBN |
denotes |
mixed |
| T11976 |
55967-55970 |
NN |
denotes |
deH |
| T11977 |
55970-55971 |
HYPH |
denotes |
/ |
| T11978 |
55971-55972 |
SYM |
denotes |
+ |
| T11979 |
55973-55974 |
SYM |
denotes |
× |
| T11980 |
55975-55978 |
NN |
denotes |
deH |
| T11981 |
55978-55979 |
HYPH |
denotes |
/ |
| T11982 |
55979-55980 |
SYM |
denotes |
+ |
| T11983 |
55981-55991 |
JJ |
denotes |
intercross |
| T11984 |
55998-56002 |
IN |
denotes |
with |
| T11985 |
56003-56011 |
JJ |
denotes |
periodic |
| T11986 |
56012-56023 |
NN |
denotes |
outcrossing |
| T11987 |
56024-56026 |
IN |
denotes |
to |
| T11988 |
56027-56031 |
NN |
denotes |
BTBR |
| T11989 |
56032-56034 |
CC |
denotes |
or |
| T11990 |
56035-56037 |
NN |
denotes |
B6 |
| T11991 |
56037-56038 |
. |
denotes |
. |
| T11992 |
56038-56102 |
sentence |
denotes |
For timed matings, the morning of the plug was considered E0.5. |
| T11993 |
56039-56042 |
IN |
denotes |
For |
| T11994 |
56086-56096 |
VBN |
denotes |
considered |
| T11995 |
56043-56048 |
VBN |
denotes |
timed |
| T11996 |
56049-56056 |
NNS |
denotes |
matings |
| T11997 |
56056-56058 |
, |
denotes |
, |
| T11998 |
56058-56061 |
DT |
denotes |
the |
| T11999 |
56062-56069 |
NN |
denotes |
morning |
| T12000 |
56070-56072 |
IN |
denotes |
of |
| T12001 |
56073-56076 |
DT |
denotes |
the |
| T12002 |
56077-56081 |
NN |
denotes |
plug |
| T12003 |
56082-56085 |
VBD |
denotes |
was |
| T12004 |
56097-56101 |
NN |
denotes |
E0.5 |
| T12005 |
56101-56102 |
. |
denotes |
. |
| T12006 |
56102-56159 |
sentence |
denotes |
Postnatally, the day of birth was considered to be P0.5. |
| T12007 |
56103-56114 |
RB |
denotes |
Postnatally |
| T12008 |
56137-56147 |
VBN |
denotes |
considered |
| T12009 |
56114-56116 |
, |
denotes |
, |
| T12010 |
56116-56119 |
DT |
denotes |
the |
| T12011 |
56120-56123 |
NN |
denotes |
day |
| T12012 |
56124-56126 |
IN |
denotes |
of |
| T12013 |
56127-56132 |
NN |
denotes |
birth |
| T12014 |
56133-56136 |
VBD |
denotes |
was |
| T12015 |
56148-56150 |
TO |
denotes |
to |
| T12016 |
56151-56153 |
VB |
denotes |
be |
| T12017 |
56154-56158 |
NN |
denotes |
P0.5 |
| T12018 |
56158-56159 |
. |
denotes |
. |
| T12097 |
56161-56171 |
JJ |
denotes |
Phenotypic |
| T12098 |
56172-56180 |
NN |
denotes |
analysis |
| T12099 |
56180-56372 |
sentence |
denotes |
For measurements of hair length and color, the entire interlimb region of skin was first dissected with a single incision at the dorsal midline and preserved with powdered sodium bicarbonate. |
| T12100 |
56181-56184 |
IN |
denotes |
For |
| T12101 |
56270-56279 |
VBN |
denotes |
dissected |
| T12102 |
56185-56197 |
NNS |
denotes |
measurements |
| T12103 |
56198-56200 |
IN |
denotes |
of |
| T12104 |
56201-56205 |
NN |
denotes |
hair |
| T12105 |
56206-56212 |
NN |
denotes |
length |
| T12106 |
56213-56216 |
CC |
denotes |
and |
| T12107 |
56217-56222 |
NN |
denotes |
color |
| T12108 |
56222-56224 |
, |
denotes |
, |
| T12109 |
56224-56227 |
DT |
denotes |
the |
| T12110 |
56245-56251 |
NN |
denotes |
region |
| T12111 |
56228-56234 |
JJ |
denotes |
entire |
| T12112 |
56235-56244 |
NN |
denotes |
interlimb |
| T12113 |
56252-56254 |
IN |
denotes |
of |
| T12114 |
56255-56259 |
NN |
denotes |
skin |
| T12115 |
56260-56263 |
VBD |
denotes |
was |
| T12116 |
56264-56269 |
RB |
denotes |
first |
| T12117 |
56280-56284 |
IN |
denotes |
with |
| T12118 |
56285-56286 |
DT |
denotes |
a |
| T12119 |
56294-56302 |
NN |
denotes |
incision |
| T12120 |
56287-56293 |
JJ |
denotes |
single |
| T12121 |
56303-56305 |
IN |
denotes |
at |
| T12122 |
56306-56309 |
DT |
denotes |
the |
| T12123 |
56317-56324 |
NN |
denotes |
midline |
| T12124 |
56310-56316 |
JJ |
denotes |
dorsal |
| T12125 |
56325-56328 |
CC |
denotes |
and |
| T12126 |
56329-56338 |
VBN |
denotes |
preserved |
| T12127 |
56339-56343 |
IN |
denotes |
with |
| T12128 |
56344-56352 |
VBN |
denotes |
powdered |
| T12129 |
56360-56371 |
NN |
denotes |
bicarbonate |
| T12130 |
56353-56359 |
NN |
denotes |
sodium |
| T12131 |
56371-56372 |
. |
denotes |
. |
| T12132 |
56372-56640 |
sentence |
denotes |
Slices 2–2.5 mm in width were then prepared parallel to the dorsoventral axis, hair length boundaries determined from electronic images with Adobe Photoshop (San Jose, California, United States), and measurements obtained using ImageJ (National Institutes of Health). |
| T12133 |
56373-56379 |
NNS |
denotes |
Slices |
| T12134 |
56408-56416 |
VBN |
denotes |
prepared |
| T12135 |
56380-56381 |
CD |
denotes |
2 |
| T12136 |
56382-56385 |
CD |
denotes |
2.5 |
| T12137 |
56381-56382 |
HYPH |
denotes |
– |
| T12138 |
56386-56388 |
NN |
denotes |
mm |
| T12139 |
56389-56391 |
IN |
denotes |
in |
| T12140 |
56392-56397 |
NN |
denotes |
width |
| T12141 |
56398-56402 |
VBD |
denotes |
were |
| T12142 |
56403-56407 |
RB |
denotes |
then |
| T12143 |
56417-56425 |
RB |
denotes |
parallel |
| T12144 |
56426-56428 |
IN |
denotes |
to |
| T12145 |
56429-56432 |
DT |
denotes |
the |
| T12146 |
56446-56450 |
NN |
denotes |
axis |
| T12147 |
56433-56445 |
JJ |
denotes |
dorsoventral |
| T12148 |
56450-56452 |
, |
denotes |
, |
| T12149 |
56452-56456 |
NN |
denotes |
hair |
| T12150 |
56464-56474 |
NNS |
denotes |
boundaries |
| T12151 |
56457-56463 |
NN |
denotes |
length |
| T12152 |
56475-56485 |
VBN |
denotes |
determined |
| T12153 |
56486-56490 |
IN |
denotes |
from |
| T12154 |
56491-56501 |
JJ |
denotes |
electronic |
| T12155 |
56502-56508 |
NNS |
denotes |
images |
| T12156 |
56509-56513 |
IN |
denotes |
with |
| T12157 |
56514-56519 |
NNP |
denotes |
Adobe |
| T12158 |
56520-56529 |
NNP |
denotes |
Photoshop |
| T12159 |
56530-56531 |
-LRB- |
denotes |
( |
| T12160 |
56535-56539 |
NNP |
denotes |
Jose |
| T12161 |
56531-56534 |
NNP |
denotes |
San |
| T12162 |
56539-56541 |
, |
denotes |
, |
| T12163 |
56541-56551 |
NNP |
denotes |
California |
| T12164 |
56551-56553 |
, |
denotes |
, |
| T12165 |
56553-56559 |
NNP |
denotes |
United |
| T12166 |
56560-56566 |
NNP |
denotes |
States |
| T12167 |
56566-56567 |
-RRB- |
denotes |
) |
| T12168 |
56567-56569 |
, |
denotes |
, |
| T12169 |
56569-56572 |
CC |
denotes |
and |
| T12170 |
56573-56585 |
NNS |
denotes |
measurements |
| T12171 |
56586-56594 |
VBN |
denotes |
obtained |
| T12172 |
56595-56600 |
VBG |
denotes |
using |
| T12173 |
56601-56607 |
NNP |
denotes |
ImageJ |
| T12174 |
56608-56609 |
-LRB- |
denotes |
( |
| T12175 |
56618-56628 |
NNPS |
denotes |
Institutes |
| T12176 |
56609-56617 |
NNP |
denotes |
National |
| T12177 |
56629-56631 |
IN |
denotes |
of |
| T12178 |
56632-56638 |
NNP |
denotes |
Health |
| T12179 |
56638-56639 |
-RRB- |
denotes |
) |
| T12180 |
56639-56640 |
. |
denotes |
. |
| T12181 |
56640-56775 |
sentence |
denotes |
This approach samples awls and auchenes, because they are much thicker and therefore visually more predominant than zigzag underhairs. |
| T12182 |
56641-56645 |
DT |
denotes |
This |
| T12183 |
56646-56654 |
NN |
denotes |
approach |
| T12184 |
56655-56662 |
VBZ |
denotes |
samples |
| T12185 |
56663-56667 |
NNS |
denotes |
awls |
| T12186 |
56668-56671 |
CC |
denotes |
and |
| T12187 |
56672-56680 |
NNS |
denotes |
auchenes |
| T12188 |
56680-56682 |
, |
denotes |
, |
| T12189 |
56682-56689 |
IN |
denotes |
because |
| T12190 |
56695-56698 |
VBP |
denotes |
are |
| T12191 |
56690-56694 |
PRP |
denotes |
they |
| T12192 |
56699-56703 |
RB |
denotes |
much |
| T12193 |
56704-56711 |
JJR |
denotes |
thicker |
| T12194 |
56712-56715 |
CC |
denotes |
and |
| T12195 |
56716-56725 |
RB |
denotes |
therefore |
| T12196 |
56740-56751 |
JJ |
denotes |
predominant |
| T12197 |
56726-56734 |
RB |
denotes |
visually |
| T12198 |
56735-56739 |
RBR |
denotes |
more |
| T12199 |
56752-56756 |
IN |
denotes |
than |
| T12200 |
56757-56763 |
NN |
denotes |
zigzag |
| T12201 |
56764-56774 |
NNS |
denotes |
underhairs |
| T12202 |
56774-56775 |
. |
denotes |
. |
| T12203 |
56775-56998 |
sentence |
denotes |
To assess dorsoventral variation in hair-type distribution, several hundred hairs were plucked from the middorsum or midventrum of 8-wk-old male BA strain animals, then sorted and categorized using a dissection microscope. |
| T12204 |
56776-56778 |
TO |
denotes |
To |
| T12205 |
56779-56785 |
VB |
denotes |
assess |
| T12206 |
56863-56870 |
VBN |
denotes |
plucked |
| T12207 |
56786-56798 |
JJ |
denotes |
dorsoventral |
| T12208 |
56799-56808 |
NN |
denotes |
variation |
| T12209 |
56809-56811 |
IN |
denotes |
in |
| T12210 |
56812-56816 |
NN |
denotes |
hair |
| T12211 |
56817-56821 |
NN |
denotes |
type |
| T12212 |
56816-56817 |
HYPH |
denotes |
- |
| T12213 |
56822-56834 |
NN |
denotes |
distribution |
| T12214 |
56834-56836 |
, |
denotes |
, |
| T12215 |
56836-56843 |
JJ |
denotes |
several |
| T12216 |
56852-56857 |
NNS |
denotes |
hairs |
| T12217 |
56844-56851 |
CD |
denotes |
hundred |
| T12218 |
56858-56862 |
VBD |
denotes |
were |
| T12219 |
56871-56875 |
IN |
denotes |
from |
| T12220 |
56876-56879 |
DT |
denotes |
the |
| T12221 |
56880-56889 |
NN |
denotes |
middorsum |
| T12222 |
56890-56892 |
CC |
denotes |
or |
| T12223 |
56893-56903 |
NN |
denotes |
midventrum |
| T12224 |
56904-56906 |
IN |
denotes |
of |
| T12225 |
56907-56908 |
CD |
denotes |
8 |
| T12226 |
56909-56911 |
NN |
denotes |
wk |
| T12227 |
56908-56909 |
HYPH |
denotes |
- |
| T12228 |
56912-56915 |
JJ |
denotes |
old |
| T12229 |
56911-56912 |
HYPH |
denotes |
- |
| T12230 |
56931-56938 |
NNS |
denotes |
animals |
| T12231 |
56916-56920 |
JJ |
denotes |
male |
| T12232 |
56921-56923 |
NN |
denotes |
BA |
| T12233 |
56924-56930 |
NN |
denotes |
strain |
| T12234 |
56938-56940 |
, |
denotes |
, |
| T12235 |
56940-56944 |
RB |
denotes |
then |
| T12236 |
56945-56951 |
VBN |
denotes |
sorted |
| T12237 |
56952-56955 |
CC |
denotes |
and |
| T12238 |
56956-56967 |
VBN |
denotes |
categorized |
| T12239 |
56968-56973 |
VBG |
denotes |
using |
| T12240 |
56974-56975 |
DT |
denotes |
a |
| T12241 |
56987-56997 |
NN |
denotes |
microscope |
| T12242 |
56976-56986 |
NN |
denotes |
dissection |
| T12243 |
56997-56998 |
. |
denotes |
. |
| T12244 |
56998-57060 |
sentence |
denotes |
No attempt was made to distinguish between awls and auchenes. |
| T12245 |
56999-57001 |
DT |
denotes |
No |
| T12246 |
57002-57009 |
NN |
denotes |
attempt |
| T12247 |
57014-57018 |
VBN |
denotes |
made |
| T12248 |
57010-57013 |
VBD |
denotes |
was |
| T12249 |
57019-57021 |
TO |
denotes |
to |
| T12250 |
57022-57033 |
VB |
denotes |
distinguish |
| T12251 |
57034-57041 |
IN |
denotes |
between |
| T12252 |
57042-57046 |
NNS |
denotes |
awls |
| T12253 |
57047-57050 |
CC |
denotes |
and |
| T12254 |
57051-57059 |
NNS |
denotes |
auchenes |
| T12255 |
57059-57060 |
. |
denotes |
. |
| T12256 |
57060-57166 |
sentence |
denotes |
For skin histology, 12 μm sections from paraffin-embedded tissue were stained with hematoxylin and eosin. |
| T12257 |
57061-57064 |
IN |
denotes |
For |
| T12258 |
57131-57138 |
VBN |
denotes |
stained |
| T12259 |
57065-57069 |
NN |
denotes |
skin |
| T12260 |
57070-57079 |
NN |
denotes |
histology |
| T12261 |
57079-57081 |
, |
denotes |
, |
| T12262 |
57081-57083 |
CD |
denotes |
12 |
| T12263 |
57084-57086 |
NN |
denotes |
μm |
| T12264 |
57087-57095 |
NNS |
denotes |
sections |
| T12265 |
57096-57100 |
IN |
denotes |
from |
| T12266 |
57101-57109 |
NN |
denotes |
paraffin |
| T12267 |
57110-57118 |
VBN |
denotes |
embedded |
| T12268 |
57109-57110 |
HYPH |
denotes |
- |
| T12269 |
57119-57125 |
NN |
denotes |
tissue |
| T12270 |
57126-57130 |
VBD |
denotes |
were |
| T12271 |
57139-57143 |
IN |
denotes |
with |
| T12272 |
57144-57155 |
NN |
denotes |
hematoxylin |
| T12273 |
57156-57159 |
CC |
denotes |
and |
| T12274 |
57160-57165 |
NN |
denotes |
eosin |
| T12275 |
57165-57166 |
. |
denotes |
. |
| T12276 |
57166-57572 |
sentence |
denotes |
For DOPA staining, the dermis and epidermis were split after 3 h of incubation in 2 M sodium bromide at 37°C (this preparation causes most hair follicles to remain with the dermis), individually fixed for 1 h, then rinsed and stained with 0.1% L-DOPA (Sigma, St. Louis, Missouri, United States), 0.1 M sodium phosphate buffer (pH 6.8) for 5 h at 37°C in the dark, changing the staining solution after 1 h. |
| T12277 |
57167-57170 |
IN |
denotes |
For |
| T12278 |
57216-57221 |
VBN |
denotes |
split |
| T12279 |
57171-57175 |
NN |
denotes |
DOPA |
| T12280 |
57176-57184 |
NN |
denotes |
staining |
| T12281 |
57184-57186 |
, |
denotes |
, |
| T12282 |
57186-57189 |
DT |
denotes |
the |
| T12283 |
57190-57196 |
NN |
denotes |
dermis |
| T12284 |
57197-57200 |
CC |
denotes |
and |
| T12285 |
57201-57210 |
NN |
denotes |
epidermis |
| T12286 |
57211-57215 |
VBD |
denotes |
were |
| T12287 |
57222-57227 |
IN |
denotes |
after |
| T12288 |
57228-57229 |
CD |
denotes |
3 |
| T12289 |
57230-57231 |
NN |
denotes |
h |
| T12290 |
57232-57234 |
IN |
denotes |
of |
| T12291 |
57235-57245 |
NN |
denotes |
incubation |
| T12292 |
57246-57248 |
IN |
denotes |
in |
| T12293 |
57249-57250 |
CD |
denotes |
2 |
| T12294 |
57251-57252 |
NN |
denotes |
M |
| T12295 |
57260-57267 |
NN |
denotes |
bromide |
| T12296 |
57253-57259 |
NN |
denotes |
sodium |
| T12297 |
57268-57270 |
IN |
denotes |
at |
| T12298 |
57271-57273 |
CD |
denotes |
37 |
| T12299 |
57273-57275 |
NN |
denotes |
°C |
| T12300 |
57276-57277 |
-LRB- |
denotes |
( |
| T12301 |
57294-57300 |
VBZ |
denotes |
causes |
| T12302 |
57277-57281 |
DT |
denotes |
this |
| T12303 |
57282-57293 |
NN |
denotes |
preparation |
| T12304 |
57301-57305 |
JJS |
denotes |
most |
| T12305 |
57311-57320 |
NNS |
denotes |
follicles |
| T12306 |
57306-57310 |
NN |
denotes |
hair |
| T12307 |
57324-57330 |
VB |
denotes |
remain |
| T12308 |
57321-57323 |
TO |
denotes |
to |
| T12309 |
57331-57335 |
IN |
denotes |
with |
| T12310 |
57336-57339 |
DT |
denotes |
the |
| T12311 |
57340-57346 |
NN |
denotes |
dermis |
| T12312 |
57346-57347 |
-RRB- |
denotes |
) |
| T12313 |
57347-57349 |
, |
denotes |
, |
| T12314 |
57349-57361 |
RB |
denotes |
individually |
| T12315 |
57362-57367 |
VBN |
denotes |
fixed |
| T12316 |
57368-57371 |
IN |
denotes |
for |
| T12317 |
57372-57373 |
CD |
denotes |
1 |
| T12318 |
57374-57375 |
NN |
denotes |
h |
| T12319 |
57375-57377 |
, |
denotes |
, |
| T12320 |
57377-57381 |
RB |
denotes |
then |
| T12321 |
57382-57388 |
VBD |
denotes |
rinsed |
| T12322 |
57389-57392 |
CC |
denotes |
and |
| T12323 |
57393-57400 |
VBD |
denotes |
stained |
| T12324 |
57401-57405 |
IN |
denotes |
with |
| T12325 |
57406-57409 |
CD |
denotes |
0.1 |
| T12326 |
57409-57410 |
NN |
denotes |
% |
| T12327 |
57413-57417 |
NN |
denotes |
DOPA |
| T12328 |
57411-57412 |
NN |
denotes |
L |
| T12329 |
57412-57413 |
HYPH |
denotes |
- |
| T12330 |
57486-57492 |
NN |
denotes |
buffer |
| T12331 |
57418-57419 |
-LRB- |
denotes |
( |
| T12332 |
57419-57424 |
NNP |
denotes |
Sigma |
| T12333 |
57424-57426 |
, |
denotes |
, |
| T12334 |
57426-57429 |
NNP |
denotes |
St. |
| T12335 |
57430-57435 |
NNP |
denotes |
Louis |
| T12336 |
57435-57437 |
, |
denotes |
, |
| T12337 |
57437-57445 |
NNP |
denotes |
Missouri |
| T12338 |
57445-57447 |
, |
denotes |
, |
| T12339 |
57447-57453 |
NNP |
denotes |
United |
| T12340 |
57454-57460 |
NNP |
denotes |
States |
| T12341 |
57460-57461 |
-RRB- |
denotes |
) |
| T12342 |
57461-57463 |
, |
denotes |
, |
| T12343 |
57463-57466 |
CD |
denotes |
0.1 |
| T12344 |
57467-57468 |
NN |
denotes |
M |
| T12345 |
57476-57485 |
NN |
denotes |
phosphate |
| T12346 |
57469-57475 |
NN |
denotes |
sodium |
| T12347 |
57493-57494 |
-LRB- |
denotes |
( |
| T12348 |
57494-57496 |
NN |
denotes |
pH |
| T12349 |
57497-57500 |
CD |
denotes |
6.8 |
| T12350 |
57500-57501 |
-RRB- |
denotes |
) |
| T12351 |
57502-57505 |
IN |
denotes |
for |
| T12352 |
57506-57507 |
CD |
denotes |
5 |
| T12353 |
57508-57509 |
NN |
denotes |
h |
| T12354 |
57510-57512 |
IN |
denotes |
at |
| T12355 |
57513-57515 |
CD |
denotes |
37 |
| T12356 |
57515-57517 |
NN |
denotes |
°C |
| T12357 |
57518-57520 |
IN |
denotes |
in |
| T12358 |
57521-57524 |
DT |
denotes |
the |
| T12359 |
57525-57529 |
NN |
denotes |
dark |
| T12360 |
57529-57531 |
, |
denotes |
, |
| T12361 |
57531-57539 |
VBG |
denotes |
changing |
| T12362 |
57540-57543 |
DT |
denotes |
the |
| T12363 |
57553-57561 |
NN |
denotes |
solution |
| T12364 |
57544-57552 |
NN |
denotes |
staining |
| T12365 |
57562-57567 |
IN |
denotes |
after |
| T12366 |
57568-57569 |
CD |
denotes |
1 |
| T12367 |
57570-57571 |
NN |
denotes |
h |
| T12368 |
57571-57572 |
. |
denotes |
. |
| T12369 |
57572-57636 |
sentence |
denotes |
The samples were then fixed overnight, dehydrated, and mounted. |
| T12370 |
57573-57576 |
DT |
denotes |
The |
| T12371 |
57577-57584 |
NNS |
denotes |
samples |
| T12372 |
57595-57600 |
VBN |
denotes |
fixed |
| T12373 |
57585-57589 |
VBD |
denotes |
were |
| T12374 |
57590-57594 |
RB |
denotes |
then |
| T12375 |
57601-57610 |
RB |
denotes |
overnight |
| T12376 |
57610-57612 |
, |
denotes |
, |
| T12377 |
57612-57622 |
VBN |
denotes |
dehydrated |
| T12378 |
57622-57624 |
, |
denotes |
, |
| T12379 |
57624-57627 |
CC |
denotes |
and |
| T12380 |
57628-57635 |
VBN |
denotes |
mounted |
| T12381 |
57635-57636 |
. |
denotes |
. |
| T12382 |
57636-57735 |
sentence |
denotes |
This method is sufficient to stain interfollicular melanocytes without creating a high background. |
| T12383 |
57637-57641 |
DT |
denotes |
This |
| T12384 |
57642-57648 |
NN |
denotes |
method |
| T12385 |
57649-57651 |
VBZ |
denotes |
is |
| T12386 |
57652-57662 |
JJ |
denotes |
sufficient |
| T12387 |
57663-57665 |
TO |
denotes |
to |
| T12388 |
57666-57671 |
VB |
denotes |
stain |
| T12389 |
57672-57687 |
JJ |
denotes |
interfollicular |
| T12390 |
57688-57699 |
NNS |
denotes |
melanocytes |
| T12391 |
57700-57707 |
IN |
denotes |
without |
| T12392 |
57708-57716 |
VBG |
denotes |
creating |
| T12393 |
57717-57718 |
DT |
denotes |
a |
| T12394 |
57724-57734 |
NN |
denotes |
background |
| T12395 |
57719-57723 |
JJ |
denotes |
high |
| T12396 |
57734-57735 |
. |
denotes |
. |
| T12397 |
57735-57785 |
sentence |
denotes |
The fixative used was always 4% paraformaldehyde. |
| T12398 |
57736-57739 |
DT |
denotes |
The |
| T12399 |
57740-57748 |
JJ |
denotes |
fixative |
| T12400 |
57754-57757 |
VBD |
denotes |
was |
| T12401 |
57749-57753 |
VBN |
denotes |
used |
| T12402 |
57758-57764 |
RB |
denotes |
always |
| T12403 |
57765-57766 |
CD |
denotes |
4 |
| T12404 |
57766-57767 |
NN |
denotes |
% |
| T12405 |
57768-57784 |
NN |
denotes |
paraformaldehyde |
| T12406 |
57784-57785 |
. |
denotes |
. |
| T12538 |
57787-57797 |
JJ |
denotes |
Positional |
| T12539 |
57798-57805 |
NN |
denotes |
cloning |
| T12540 |
57805-57919 |
sentence |
denotes |
A high-resolution map for deH was generated from an intersubspecific intercross between deH/deH and CAST/Ei mice. |
| T12541 |
57806-57807 |
DT |
denotes |
A |
| T12542 |
57824-57827 |
NN |
denotes |
map |
| T12543 |
57808-57812 |
JJ |
denotes |
high |
| T12544 |
57813-57823 |
NN |
denotes |
resolution |
| T12545 |
57812-57813 |
HYPH |
denotes |
- |
| T12546 |
57840-57849 |
VBN |
denotes |
generated |
| T12547 |
57828-57831 |
IN |
denotes |
for |
| T12548 |
57832-57835 |
NN |
denotes |
deH |
| T12549 |
57836-57839 |
VBD |
denotes |
was |
| T12550 |
57850-57854 |
IN |
denotes |
from |
| T12551 |
57855-57857 |
DT |
denotes |
an |
| T12552 |
57875-57885 |
NN |
denotes |
intercross |
| T12553 |
57858-57874 |
JJ |
denotes |
intersubspecific |
| T12554 |
57886-57893 |
IN |
denotes |
between |
| T12555 |
57894-57897 |
NN |
denotes |
deH |
| T12556 |
57898-57901 |
NN |
denotes |
deH |
| T12557 |
57897-57898 |
HYPH |
denotes |
/ |
| T12558 |
57914-57918 |
NNS |
denotes |
mice |
| T12559 |
57902-57905 |
CC |
denotes |
and |
| T12560 |
57906-57910 |
NN |
denotes |
CAST |
| T12561 |
57911-57913 |
NN |
denotes |
Ei |
| T12562 |
57910-57911 |
HYPH |
denotes |
/ |
| T12563 |
57918-57919 |
. |
denotes |
. |
| T12564 |
57919-57995 |
sentence |
denotes |
We initially localized deH to a 1 cM interval between D3Mit233 and D3Mit11. |
| T12565 |
57920-57922 |
PRP |
denotes |
We |
| T12566 |
57933-57942 |
VBD |
denotes |
localized |
| T12567 |
57923-57932 |
RB |
denotes |
initially |
| T12568 |
57943-57946 |
NN |
denotes |
deH |
| T12569 |
57947-57949 |
IN |
denotes |
to |
| T12570 |
57950-57951 |
DT |
denotes |
a |
| T12571 |
57957-57965 |
NN |
denotes |
interval |
| T12572 |
57952-57953 |
CD |
denotes |
1 |
| T12573 |
57954-57956 |
NN |
denotes |
cM |
| T12574 |
57966-57973 |
IN |
denotes |
between |
| T12575 |
57974-57982 |
NN |
denotes |
D3Mit233 |
| T12576 |
57983-57986 |
CC |
denotes |
and |
| T12577 |
57987-57994 |
NN |
denotes |
D3Mit11 |
| T12578 |
57994-57995 |
. |
denotes |
. |
| T12579 |
57995-58167 |
sentence |
denotes |
F2 animals carrying recombinant chromosomes between these markers whose genotype at de was indeterminate (deH/+ or +/+) were progeny-tested by crossing to deH/deH animals. |
| T12580 |
57996-57998 |
NN |
denotes |
F2 |
| T12581 |
57999-58006 |
NNS |
denotes |
animals |
| T12582 |
58129-58135 |
VBN |
denotes |
tested |
| T12583 |
58007-58015 |
VBG |
denotes |
carrying |
| T12584 |
58016-58027 |
JJ |
denotes |
recombinant |
| T12585 |
58028-58039 |
NNS |
denotes |
chromosomes |
| T12586 |
58040-58047 |
IN |
denotes |
between |
| T12587 |
58048-58053 |
DT |
denotes |
these |
| T12588 |
58054-58061 |
NNS |
denotes |
markers |
| T12589 |
58062-58067 |
WP$ |
denotes |
whose |
| T12590 |
58068-58076 |
NN |
denotes |
genotype |
| T12591 |
58083-58086 |
VBD |
denotes |
was |
| T12592 |
58077-58079 |
IN |
denotes |
at |
| T12593 |
58080-58082 |
NN |
denotes |
de |
| T12594 |
58087-58100 |
JJ |
denotes |
indeterminate |
| T12595 |
58101-58102 |
-LRB- |
denotes |
( |
| T12596 |
58102-58105 |
NN |
denotes |
deH |
| T12597 |
58105-58106 |
HYPH |
denotes |
/ |
| T12598 |
58106-58107 |
SYM |
denotes |
+ |
| T12599 |
58108-58110 |
CC |
denotes |
or |
| T12600 |
58111-58112 |
SYM |
denotes |
+ |
| T12601 |
58113-58114 |
SYM |
denotes |
+ |
| T12602 |
58112-58113 |
HYPH |
denotes |
/ |
| T12603 |
58114-58115 |
-RRB- |
denotes |
) |
| T12604 |
58116-58120 |
VBD |
denotes |
were |
| T12605 |
58121-58128 |
NN |
denotes |
progeny |
| T12606 |
58128-58129 |
HYPH |
denotes |
- |
| T12607 |
58136-58138 |
IN |
denotes |
by |
| T12608 |
58139-58147 |
VBG |
denotes |
crossing |
| T12609 |
58148-58150 |
IN |
denotes |
to |
| T12610 |
58151-58154 |
NN |
denotes |
deH |
| T12611 |
58155-58158 |
NN |
denotes |
deH |
| T12612 |
58154-58155 |
HYPH |
denotes |
/ |
| T12613 |
58159-58166 |
NNS |
denotes |
animals |
| T12614 |
58166-58167 |
. |
denotes |
. |
| T12615 |
58167-58471 |
sentence |
denotes |
Further genetic mapping established a minimal region of 0.1 cM between D3Mit213 and 16.MMHAP32FLF1; these markers were used to initiate construction of a physical map with BAC genomic clones (Research Genetics, Huntsville, Alabama, United States, and Genome Systems, St. Louis, Missouri, United States). |
| T12616 |
58168-58175 |
JJ |
denotes |
Further |
| T12617 |
58184-58191 |
NN |
denotes |
mapping |
| T12618 |
58176-58183 |
JJ |
denotes |
genetic |
| T12619 |
58192-58203 |
VBD |
denotes |
established |
| T12620 |
58287-58291 |
VBN |
denotes |
used |
| T12621 |
58204-58205 |
DT |
denotes |
a |
| T12622 |
58214-58220 |
NN |
denotes |
region |
| T12623 |
58206-58213 |
JJ |
denotes |
minimal |
| T12624 |
58221-58223 |
IN |
denotes |
of |
| T12625 |
58224-58227 |
CD |
denotes |
0.1 |
| T12626 |
58228-58230 |
NN |
denotes |
cM |
| T12627 |
58231-58238 |
IN |
denotes |
between |
| T12628 |
58239-58247 |
NN |
denotes |
D3Mit213 |
| T12629 |
58248-58251 |
CC |
denotes |
and |
| T12630 |
58252-58266 |
NN |
denotes |
16.MMHAP32FLF1 |
| T12631 |
58266-58267 |
: |
denotes |
; |
| T12632 |
58268-58273 |
DT |
denotes |
these |
| T12633 |
58274-58281 |
NNS |
denotes |
markers |
| T12634 |
58282-58286 |
VBD |
denotes |
were |
| T12635 |
58292-58294 |
TO |
denotes |
to |
| T12636 |
58295-58303 |
VB |
denotes |
initiate |
| T12637 |
58304-58316 |
NN |
denotes |
construction |
| T12638 |
58317-58319 |
IN |
denotes |
of |
| T12639 |
58320-58321 |
DT |
denotes |
a |
| T12640 |
58331-58334 |
NN |
denotes |
map |
| T12641 |
58322-58330 |
JJ |
denotes |
physical |
| T12642 |
58335-58339 |
IN |
denotes |
with |
| T12643 |
58340-58343 |
NN |
denotes |
BAC |
| T12644 |
58352-58358 |
NNS |
denotes |
clones |
| T12645 |
58344-58351 |
JJ |
denotes |
genomic |
| T12646 |
58359-58360 |
-LRB- |
denotes |
( |
| T12647 |
58369-58377 |
NNP |
denotes |
Genetics |
| T12648 |
58360-58368 |
NNP |
denotes |
Research |
| T12649 |
58377-58379 |
, |
denotes |
, |
| T12650 |
58379-58389 |
NNP |
denotes |
Huntsville |
| T12651 |
58389-58391 |
, |
denotes |
, |
| T12652 |
58391-58398 |
NNP |
denotes |
Alabama |
| T12653 |
58398-58400 |
, |
denotes |
, |
| T12654 |
58400-58406 |
NNP |
denotes |
United |
| T12655 |
58407-58413 |
NNP |
denotes |
States |
| T12656 |
58413-58415 |
, |
denotes |
, |
| T12657 |
58415-58418 |
CC |
denotes |
and |
| T12658 |
58419-58425 |
NNP |
denotes |
Genome |
| T12659 |
58426-58433 |
NNP |
denotes |
Systems |
| T12660 |
58433-58435 |
, |
denotes |
, |
| T12661 |
58435-58438 |
NNP |
denotes |
St. |
| T12662 |
58439-58444 |
NNP |
denotes |
Louis |
| T12663 |
58444-58446 |
, |
denotes |
, |
| T12664 |
58446-58454 |
NNP |
denotes |
Missouri |
| T12665 |
58454-58456 |
, |
denotes |
, |
| T12666 |
58456-58462 |
NNP |
denotes |
United |
| T12667 |
58463-58469 |
NNP |
denotes |
States |
| T12668 |
58469-58470 |
-RRB- |
denotes |
) |
| T12669 |
58470-58471 |
. |
denotes |
. |
| T12670 |
58471-58624 |
sentence |
denotes |
End sequence from those BACs was used to develop SSCP markers M1 to M3, as depicted in Figure 3, and to establish a minimal physical interval of 1.4 Mb. |
| T12671 |
58472-58475 |
NN |
denotes |
End |
| T12672 |
58476-58484 |
NN |
denotes |
sequence |
| T12673 |
58505-58509 |
VBN |
denotes |
used |
| T12674 |
58485-58489 |
IN |
denotes |
from |
| T12675 |
58490-58495 |
DT |
denotes |
those |
| T12676 |
58496-58500 |
NNS |
denotes |
BACs |
| T12677 |
58501-58504 |
VBD |
denotes |
was |
| T12678 |
58510-58512 |
TO |
denotes |
to |
| T12679 |
58513-58520 |
VB |
denotes |
develop |
| T12680 |
58521-58525 |
NN |
denotes |
SSCP |
| T12681 |
58526-58533 |
NNS |
denotes |
markers |
| T12682 |
58534-58536 |
NN |
denotes |
M1 |
| T12683 |
58537-58539 |
IN |
denotes |
to |
| T12684 |
58540-58542 |
NN |
denotes |
M3 |
| T12685 |
58542-58544 |
, |
denotes |
, |
| T12686 |
58544-58546 |
IN |
denotes |
as |
| T12687 |
58547-58555 |
VBN |
denotes |
depicted |
| T12688 |
58556-58558 |
IN |
denotes |
in |
| T12689 |
58559-58565 |
NN |
denotes |
Figure |
| T12690 |
58566-58567 |
CD |
denotes |
3 |
| T12691 |
58567-58569 |
, |
denotes |
, |
| T12692 |
58569-58572 |
CC |
denotes |
and |
| T12693 |
58573-58575 |
TO |
denotes |
to |
| T12694 |
58576-58585 |
VB |
denotes |
establish |
| T12695 |
58586-58587 |
DT |
denotes |
a |
| T12696 |
58605-58613 |
NN |
denotes |
interval |
| T12697 |
58588-58595 |
JJ |
denotes |
minimal |
| T12698 |
58596-58604 |
JJ |
denotes |
physical |
| T12699 |
58614-58616 |
IN |
denotes |
of |
| T12700 |
58617-58620 |
CD |
denotes |
1.4 |
| T12701 |
58621-58623 |
NN |
denotes |
Mb |
| T12702 |
58623-58624 |
. |
denotes |
. |
| T12703 |
58624-58953 |
sentence |
denotes |
Primer pairs used were TTCCCTCCAATAAGTTCTGGGTACC and AAGCTTGCTGCTCTGGATTCCATTTGTAG for M1, CCTTCATTTTTTTTTCAAGTAAAA and AAGCTTGGCTTAGTCCCAGTGGC for M2, CCTCCAGGAAGATCTACTAGGCAC and ATGGAAAAAAAAAAGTAAGATTGAAAG for M3, and TGGTTATCGATCTGTGGACCATTC and AAGTGAGAGAGCAGGATGGACCAC for M4 (the M4 marker represents STS 16.MMHAP32FLF1). |
| T12704 |
58625-58631 |
NN |
denotes |
Primer |
| T12705 |
58632-58637 |
NNS |
denotes |
pairs |
| T12706 |
58643-58647 |
VBD |
denotes |
were |
| T12707 |
58638-58642 |
VBN |
denotes |
used |
| T12708 |
58648-58673 |
NN |
denotes |
TTCCCTCCAATAAGTTCTGGGTACC |
| T12709 |
58674-58677 |
CC |
denotes |
and |
| T12710 |
58678-58707 |
NN |
denotes |
AAGCTTGCTGCTCTGGATTCCATTTGTAG |
| T12711 |
58708-58711 |
IN |
denotes |
for |
| T12712 |
58712-58714 |
NN |
denotes |
M1 |
| T12713 |
58714-58716 |
, |
denotes |
, |
| T12714 |
58716-58740 |
NN |
denotes |
CCTTCATTTTTTTTTCAAGTAAAA |
| T12715 |
58741-58744 |
CC |
denotes |
and |
| T12716 |
58745-58768 |
NN |
denotes |
AAGCTTGGCTTAGTCCCAGTGGC |
| T12717 |
58769-58772 |
IN |
denotes |
for |
| T12718 |
58773-58775 |
NN |
denotes |
M2 |
| T12719 |
58775-58777 |
, |
denotes |
, |
| T12720 |
58777-58801 |
NN |
denotes |
CCTCCAGGAAGATCTACTAGGCAC |
| T12721 |
58802-58805 |
CC |
denotes |
and |
| T12722 |
58806-58833 |
NN |
denotes |
ATGGAAAAAAAAAAGTAAGATTGAAAG |
| T12723 |
58834-58837 |
IN |
denotes |
for |
| T12724 |
58838-58840 |
NN |
denotes |
M3 |
| T12725 |
58840-58842 |
, |
denotes |
, |
| T12726 |
58842-58845 |
CC |
denotes |
and |
| T12727 |
58846-58870 |
NN |
denotes |
TGGTTATCGATCTGTGGACCATTC |
| T12728 |
58871-58874 |
CC |
denotes |
and |
| T12729 |
58875-58899 |
NN |
denotes |
AAGTGAGAGAGCAGGATGGACCAC |
| T12730 |
58900-58903 |
IN |
denotes |
for |
| T12731 |
58904-58906 |
NN |
denotes |
M4 |
| T12732 |
58907-58908 |
-LRB- |
denotes |
( |
| T12733 |
58922-58932 |
VBZ |
denotes |
represents |
| T12734 |
58908-58911 |
DT |
denotes |
the |
| T12735 |
58915-58921 |
NN |
denotes |
marker |
| T12736 |
58912-58914 |
NN |
denotes |
M4 |
| T12737 |
58933-58936 |
NN |
denotes |
STS |
| T12738 |
58937-58951 |
NN |
denotes |
16.MMHAP32FLF1 |
| T12739 |
58951-58952 |
-RRB- |
denotes |
) |
| T12740 |
58952-58953 |
. |
denotes |
. |
| T12741 |
58953-59353 |
sentence |
denotes |
Genomic sequence and annotations were obtained from the UCSC Genome Browser February 2003 assembly version mm3 (http://genome.ucsc.edu); the 1.4 Mb interval between M1 and M4 contains eight genes: four hydroxysteroid dehydrogenase isomerases, Hsd3b3, Hsd3b2, Hsd3b6, and Hsd3b1; an hydroacid oxidase, Hao3; a tryptophanyl-tRNA synthetase, Wars2; a T-box gene, Tbx15; and a novel gene, 4931427F14Rik. |
| T12742 |
58954-58961 |
JJ |
denotes |
Genomic |
| T12743 |
58962-58970 |
NN |
denotes |
sequence |
| T12744 |
58992-59000 |
VBN |
denotes |
obtained |
| T12745 |
58971-58974 |
CC |
denotes |
and |
| T12746 |
58975-58986 |
NNS |
denotes |
annotations |
| T12747 |
58987-58991 |
VBD |
denotes |
were |
| T12748 |
59129-59137 |
VBZ |
denotes |
contains |
| T12749 |
59001-59005 |
IN |
denotes |
from |
| T12750 |
59006-59009 |
DT |
denotes |
the |
| T12751 |
59022-59029 |
NN |
denotes |
Browser |
| T12752 |
59010-59014 |
NN |
denotes |
UCSC |
| T12753 |
59015-59021 |
NN |
denotes |
Genome |
| T12754 |
59061-59064 |
NN |
denotes |
mm3 |
| T12755 |
59030-59038 |
NNP |
denotes |
February |
| T12756 |
59044-59052 |
NN |
denotes |
assembly |
| T12757 |
59039-59043 |
CD |
denotes |
2003 |
| T12758 |
59053-59060 |
NN |
denotes |
version |
| T12759 |
59065-59066 |
-LRB- |
denotes |
( |
| T12760 |
59066-59088 |
NN |
denotes |
http://genome.ucsc.edu |
| T12761 |
59088-59089 |
-RRB- |
denotes |
) |
| T12762 |
59089-59090 |
: |
denotes |
; |
| T12763 |
59091-59094 |
DT |
denotes |
the |
| T12764 |
59102-59110 |
NN |
denotes |
interval |
| T12765 |
59095-59098 |
CD |
denotes |
1.4 |
| T12766 |
59099-59101 |
NN |
denotes |
Mb |
| T12767 |
59111-59118 |
IN |
denotes |
between |
| T12768 |
59119-59121 |
NN |
denotes |
M1 |
| T12769 |
59122-59125 |
CC |
denotes |
and |
| T12770 |
59126-59128 |
NN |
denotes |
M4 |
| T12771 |
59138-59143 |
CD |
denotes |
eight |
| T12772 |
59144-59149 |
NNS |
denotes |
genes |
| T12773 |
59149-59151 |
: |
denotes |
: |
| T12774 |
59151-59155 |
CD |
denotes |
four |
| T12775 |
59185-59195 |
NNS |
denotes |
isomerases |
| T12776 |
59156-59170 |
NN |
denotes |
hydroxysteroid |
| T12777 |
59171-59184 |
NN |
denotes |
dehydrogenase |
| T12778 |
59195-59197 |
, |
denotes |
, |
| T12779 |
59197-59203 |
NN |
denotes |
Hsd3b3 |
| T12780 |
59203-59205 |
, |
denotes |
, |
| T12781 |
59205-59211 |
NN |
denotes |
Hsd3b2 |
| T12782 |
59211-59213 |
, |
denotes |
, |
| T12783 |
59213-59219 |
NN |
denotes |
Hsd3b6 |
| T12784 |
59219-59221 |
, |
denotes |
, |
| T12785 |
59221-59224 |
CC |
denotes |
and |
| T12786 |
59225-59231 |
NN |
denotes |
Hsd3b1 |
| T12787 |
59231-59232 |
, |
denotes |
; |
| T12788 |
59233-59235 |
DT |
denotes |
an |
| T12789 |
59246-59253 |
NN |
denotes |
oxidase |
| T12790 |
59236-59245 |
NN |
denotes |
hydroacid |
| T12791 |
59253-59255 |
, |
denotes |
, |
| T12792 |
59255-59259 |
NN |
denotes |
Hao3 |
| T12793 |
59259-59260 |
, |
denotes |
; |
| T12794 |
59261-59262 |
DT |
denotes |
a |
| T12795 |
59281-59291 |
NN |
denotes |
synthetase |
| T12796 |
59263-59275 |
NN |
denotes |
tryptophanyl |
| T12797 |
59276-59280 |
NN |
denotes |
tRNA |
| T12798 |
59275-59276 |
HYPH |
denotes |
- |
| T12799 |
59291-59293 |
, |
denotes |
, |
| T12800 |
59293-59298 |
NN |
denotes |
Wars2 |
| T12801 |
59298-59299 |
, |
denotes |
; |
| T12802 |
59300-59301 |
DT |
denotes |
a |
| T12803 |
59308-59312 |
NN |
denotes |
gene |
| T12804 |
59302-59303 |
NN |
denotes |
T |
| T12805 |
59304-59307 |
NN |
denotes |
box |
| T12806 |
59303-59304 |
HYPH |
denotes |
- |
| T12807 |
59312-59314 |
, |
denotes |
, |
| T12808 |
59314-59319 |
NN |
denotes |
Tbx15 |
| T12809 |
59319-59320 |
, |
denotes |
; |
| T12810 |
59321-59324 |
CC |
denotes |
and |
| T12811 |
59325-59326 |
DT |
denotes |
a |
| T12812 |
59333-59337 |
NN |
denotes |
gene |
| T12813 |
59327-59332 |
JJ |
denotes |
novel |
| T12814 |
59337-59339 |
, |
denotes |
, |
| T12815 |
59339-59352 |
NN |
denotes |
4931427F14Rik |
| T12816 |
59352-59353 |
. |
denotes |
. |
| T12817 |
59353-59620 |
sentence |
denotes |
In the genome sequence, M1 primers correspond to AGGCCTCCAATAAGTTCTGGGTACC and AAGCTTGCTCTCTGGATTCCATTTGTAG, the M2 reverse primer corresponds to AAGCTTGGCTTTAGTCCCAGTGGGC, and the M3 primers correspond to CCTCCAGGAAGAATCTACTAGGCAC and AATGAAAAAAAAAAAAGTAAGATTGAAAG. |
| T12818 |
59354-59356 |
IN |
denotes |
In |
| T12819 |
59389-59399 |
VBP |
denotes |
correspond |
| T12820 |
59357-59360 |
DT |
denotes |
the |
| T12821 |
59368-59376 |
NN |
denotes |
sequence |
| T12822 |
59361-59367 |
NN |
denotes |
genome |
| T12823 |
59376-59378 |
, |
denotes |
, |
| T12824 |
59378-59380 |
NN |
denotes |
M1 |
| T12825 |
59381-59388 |
NNS |
denotes |
primers |
| T12826 |
59400-59402 |
IN |
denotes |
to |
| T12827 |
59403-59428 |
NN |
denotes |
AGGCCTCCAATAAGTTCTGGGTACC |
| T12828 |
59429-59432 |
CC |
denotes |
and |
| T12829 |
59433-59461 |
NN |
denotes |
AAGCTTGCTCTCTGGATTCCATTTGTAG |
| T12830 |
59461-59463 |
, |
denotes |
, |
| T12831 |
59463-59466 |
DT |
denotes |
the |
| T12832 |
59478-59484 |
NN |
denotes |
primer |
| T12833 |
59467-59469 |
NN |
denotes |
M2 |
| T12834 |
59470-59477 |
JJ |
denotes |
reverse |
| T12835 |
59485-59496 |
VBZ |
denotes |
corresponds |
| T12836 |
59497-59499 |
IN |
denotes |
to |
| T12837 |
59500-59525 |
NN |
denotes |
AAGCTTGGCTTTAGTCCCAGTGGGC |
| T12838 |
59525-59527 |
, |
denotes |
, |
| T12839 |
59527-59530 |
CC |
denotes |
and |
| T12840 |
59531-59534 |
DT |
denotes |
the |
| T12841 |
59538-59545 |
NNS |
denotes |
primers |
| T12842 |
59535-59537 |
NN |
denotes |
M3 |
| T12843 |
59546-59556 |
VBP |
denotes |
correspond |
| T12844 |
59557-59559 |
IN |
denotes |
to |
| T12845 |
59560-59585 |
NN |
denotes |
CCTCCAGGAAGAATCTACTAGGCAC |
| T12846 |
59586-59589 |
CC |
denotes |
and |
| T12847 |
59590-59619 |
NN |
denotes |
AATGAAAAAAAAAAAAGTAAGATTGAAAG |
| T12848 |
59619-59620 |
. |
denotes |
. |
| T12849 |
59620-59804 |
sentence |
denotes |
Minor differences among the sequences of the primers we obtained from the BAC ends and the public genome sequence may represent strain differences or sequencing errors on the BAC DNA. |
| T12850 |
59621-59626 |
JJ |
denotes |
Minor |
| T12851 |
59627-59638 |
NNS |
denotes |
differences |
| T12852 |
59739-59748 |
VB |
denotes |
represent |
| T12853 |
59639-59644 |
IN |
denotes |
among |
| T12854 |
59645-59648 |
DT |
denotes |
the |
| T12855 |
59649-59658 |
NNS |
denotes |
sequences |
| T12856 |
59659-59661 |
IN |
denotes |
of |
| T12857 |
59662-59665 |
DT |
denotes |
the |
| T12858 |
59666-59673 |
NNS |
denotes |
primers |
| T12859 |
59674-59676 |
PRP |
denotes |
we |
| T12860 |
59677-59685 |
VBD |
denotes |
obtained |
| T12861 |
59686-59690 |
IN |
denotes |
from |
| T12862 |
59691-59694 |
DT |
denotes |
the |
| T12863 |
59695-59698 |
NN |
denotes |
BAC |
| T12864 |
59699-59703 |
VBZ |
denotes |
ends |
| T12865 |
59704-59707 |
CC |
denotes |
and |
| T12866 |
59708-59711 |
DT |
denotes |
the |
| T12867 |
59726-59734 |
NN |
denotes |
sequence |
| T12868 |
59712-59718 |
JJ |
denotes |
public |
| T12869 |
59719-59725 |
NN |
denotes |
genome |
| T12870 |
59735-59738 |
MD |
denotes |
may |
| T12871 |
59749-59755 |
NN |
denotes |
strain |
| T12872 |
59756-59767 |
NNS |
denotes |
differences |
| T12873 |
59768-59770 |
CC |
denotes |
or |
| T12874 |
59771-59781 |
NN |
denotes |
sequencing |
| T12875 |
59782-59788 |
NNS |
denotes |
errors |
| T12876 |
59789-59791 |
IN |
denotes |
on |
| T12877 |
59792-59795 |
DT |
denotes |
the |
| T12878 |
59800-59803 |
NN |
denotes |
DNA |
| T12879 |
59796-59799 |
NN |
denotes |
BAC |
| T12880 |
59803-59804 |
. |
denotes |
. |
| T12881 |
59804-59964 |
sentence |
denotes |
A multiplex genotyping assay was developed to genotype for the deH deletion using primers GGAGCAGATCCAATTGCTTT, TCCATAGCCCATCTTCACAA, and CATGTCCACTTCTGCTTCCA. |
| T12882 |
59805-59806 |
DT |
denotes |
A |
| T12883 |
59828-59833 |
NN |
denotes |
assay |
| T12884 |
59807-59816 |
JJ |
denotes |
multiplex |
| T12885 |
59817-59827 |
VBG |
denotes |
genotyping |
| T12886 |
59838-59847 |
VBN |
denotes |
developed |
| T12887 |
59834-59837 |
VBD |
denotes |
was |
| T12888 |
59848-59850 |
TO |
denotes |
to |
| T12889 |
59851-59859 |
VB |
denotes |
genotype |
| T12890 |
59860-59863 |
IN |
denotes |
for |
| T12891 |
59864-59867 |
DT |
denotes |
the |
| T12892 |
59872-59880 |
NN |
denotes |
deletion |
| T12893 |
59868-59871 |
NN |
denotes |
deH |
| T12894 |
59881-59886 |
VBG |
denotes |
using |
| T12895 |
59887-59894 |
NNS |
denotes |
primers |
| T12896 |
59895-59915 |
NN |
denotes |
GGAGCAGATCCAATTGCTTT |
| T12897 |
59915-59917 |
, |
denotes |
, |
| T12898 |
59917-59937 |
NN |
denotes |
TCCATAGCCCATCTTCACAA |
| T12899 |
59937-59939 |
, |
denotes |
, |
| T12900 |
59939-59942 |
CC |
denotes |
and |
| T12901 |
59943-59963 |
NN |
denotes |
CATGTCCACTTCTGCTTCCA |
| T12902 |
59963-59964 |
. |
denotes |
. |
| T12903 |
59964-60081 |
sentence |
denotes |
This PCR assay produces a 392 bp product from the deH chromosome and a 595 bp product from the nonmutant chromosome. |
| T12904 |
59965-59969 |
DT |
denotes |
This |
| T12905 |
59974-59979 |
NN |
denotes |
assay |
| T12906 |
59970-59973 |
NN |
denotes |
PCR |
| T12907 |
59980-59988 |
VBZ |
denotes |
produces |
| T12908 |
59989-59990 |
DT |
denotes |
a |
| T12909 |
59998-60005 |
NN |
denotes |
product |
| T12910 |
59991-59994 |
CD |
denotes |
392 |
| T12911 |
59995-59997 |
NN |
denotes |
bp |
| T12912 |
60006-60010 |
IN |
denotes |
from |
| T12913 |
60011-60014 |
DT |
denotes |
the |
| T12914 |
60019-60029 |
NN |
denotes |
chromosome |
| T12915 |
60015-60018 |
NN |
denotes |
deH |
| T12916 |
60030-60033 |
CC |
denotes |
and |
| T12917 |
60034-60035 |
DT |
denotes |
a |
| T12918 |
60043-60050 |
NN |
denotes |
product |
| T12919 |
60036-60039 |
CD |
denotes |
595 |
| T12920 |
60040-60042 |
NN |
denotes |
bp |
| T12921 |
60051-60055 |
IN |
denotes |
from |
| T12922 |
60056-60059 |
DT |
denotes |
the |
| T12923 |
60070-60080 |
NN |
denotes |
chromosome |
| T12924 |
60060-60069 |
JJ |
denotes |
nonmutant |
| T12925 |
60080-60081 |
. |
denotes |
. |
| T12999 |
60288-60296 |
VBN |
denotes |
inserted |
| T13000 |
60201-60206 |
NN |
denotes |
brief |
| T13001 |
60206-60208 |
, |
denotes |
, |
| T13002 |
60208-60210 |
DT |
denotes |
an |
| T13003 |
60225-60233 |
NN |
denotes |
cassette |
| T13004 |
60211-60215 |
NN |
denotes |
IRES |
| T13005 |
60221-60224 |
NN |
denotes |
neo |
| T13006 |
60215-60216 |
HYPH |
denotes |
- |
| T13007 |
60216-60220 |
NN |
denotes |
LacZ |
| T13008 |
60220-60221 |
HYPH |
denotes |
- |
| T13009 |
60234-60238 |
IN |
denotes |
with |
| T13010 |
60239-60240 |
CD |
denotes |
5 |
| T13011 |
60258-60262 |
NNS |
denotes |
arms |
| T13012 |
60240-60241 |
SYM |
denotes |
′ |
| T13013 |
60242-60245 |
CC |
denotes |
and |
| T13014 |
60246-60247 |
CD |
denotes |
3 |
| T13015 |
60247-60248 |
SYM |
denotes |
′ |
| T13016 |
60249-60257 |
NN |
denotes |
homology |
| T13017 |
60263-60265 |
IN |
denotes |
of |
| T13018 |
60266-60269 |
CD |
denotes |
3.5 |
| T13019 |
60270-60272 |
NN |
denotes |
kb |
| T13020 |
60273-60276 |
CC |
denotes |
and |
| T13021 |
60277-60280 |
CD |
denotes |
1.8 |
| T13022 |
60281-60283 |
NN |
denotes |
kb |
| T13023 |
60284-60287 |
VBD |
denotes |
was |
| T13024 |
60297-60301 |
IN |
denotes |
into |
| T13025 |
60302-60303 |
DT |
denotes |
a |
| T13026 |
60317-60321 |
NN |
denotes |
site |
| T13027 |
60304-60310 |
JJ |
denotes |
unique |
| T13028 |
60311-60316 |
NN |
denotes |
BamHI |
| T13029 |
60322-60326 |
WDT |
denotes |
that |
| T13030 |
60327-60331 |
VBZ |
denotes |
lies |
| T13031 |
60332-60335 |
CD |
denotes |
479 |
| T13032 |
60336-60347 |
NNS |
denotes |
nucleotides |
| T13033 |
60348-60358 |
RB |
denotes |
downstream |
| T13034 |
60359-60361 |
IN |
denotes |
of |
| T13035 |
60362-60365 |
DT |
denotes |
the |
| T13036 |
60393-60397 |
NN |
denotes |
site |
| T13037 |
60366-60381 |
JJ |
denotes |
transcriptional |
| T13038 |
60382-60392 |
NN |
denotes |
initiation |
| T13039 |
60398-60399 |
-LRB- |
denotes |
( |
| T13040 |
60399-60407 |
JJ |
denotes |
relative |
| T13041 |
60408-60410 |
IN |
denotes |
to |
| T13042 |
60411-60414 |
DT |
denotes |
the |
| T13043 |
60420-60428 |
NN |
denotes |
sequence |
| T13044 |
60415-60419 |
NN |
denotes |
mRNA |
| T13045 |
60428-60429 |
-RRB- |
denotes |
) |
| T13046 |
60430-60432 |
IN |
denotes |
in |
| T13047 |
60433-60437 |
NN |
denotes |
exon |
| T13048 |
60438-60439 |
CD |
denotes |
3 |
| T13049 |
60439-60440 |
. |
denotes |
. |
| T13050 |
60440-60563 |
sentence |
denotes |
Positive ES clones were injected into B6 blastocysts, and chimeric founders crossed to either B6 mice or to deH/+ animals. |
| T13051 |
60441-60449 |
JJ |
denotes |
Positive |
| T13052 |
60453-60459 |
NNS |
denotes |
clones |
| T13053 |
60450-60452 |
NN |
denotes |
ES |
| T13054 |
60465-60473 |
VBN |
denotes |
injected |
| T13055 |
60460-60464 |
VBD |
denotes |
were |
| T13056 |
60474-60478 |
IN |
denotes |
into |
| T13057 |
60479-60481 |
NN |
denotes |
B6 |
| T13058 |
60482-60493 |
NNS |
denotes |
blastocysts |
| T13059 |
60493-60495 |
, |
denotes |
, |
| T13060 |
60495-60498 |
CC |
denotes |
and |
| T13061 |
60499-60507 |
JJ |
denotes |
chimeric |
| T13062 |
60508-60516 |
NNS |
denotes |
founders |
| T13063 |
60517-60524 |
VBN |
denotes |
crossed |
| T13064 |
60525-60527 |
IN |
denotes |
to |
| T13065 |
60528-60534 |
CC |
denotes |
either |
| T13066 |
60538-60542 |
NNS |
denotes |
mice |
| T13067 |
60535-60537 |
NN |
denotes |
B6 |
| T13068 |
60543-60545 |
CC |
denotes |
or |
| T13069 |
60546-60548 |
IN |
denotes |
to |
| T13070 |
60549-60552 |
NN |
denotes |
deH |
| T13071 |
60555-60562 |
NNS |
denotes |
animals |
| T13072 |
60552-60553 |
HYPH |
denotes |
/ |
| T13073 |
60553-60554 |
SYM |
denotes |
+ |
| T13074 |
60562-60563 |
. |
denotes |
. |
| T13131 |
60565-60567 |
FW |
denotes |
In |
| T13132 |
60568-60572 |
FW |
denotes |
situ |
| T13133 |
60573-60586 |
NN |
denotes |
hybridization |
| T13134 |
60586-60806 |
sentence |
denotes |
In situ hybridization was carried out on 12-μm paraffin sections using digoxigenin-labeled RNA probes (Roche Diagnostics, Indianapolis, Indiana, United States) according to standard protocols (Wilkinson and Nieto 1993). |
| T13135 |
60587-60589 |
FW |
denotes |
In |
| T13136 |
60590-60594 |
FW |
denotes |
situ |
| T13137 |
60595-60608 |
NN |
denotes |
hybridization |
| T13138 |
60613-60620 |
VBN |
denotes |
carried |
| T13139 |
60609-60612 |
VBD |
denotes |
was |
| T13140 |
60621-60624 |
RP |
denotes |
out |
| T13141 |
60625-60627 |
IN |
denotes |
on |
| T13142 |
60628-60630 |
CD |
denotes |
12 |
| T13143 |
60631-60633 |
NN |
denotes |
μm |
| T13144 |
60630-60631 |
HYPH |
denotes |
- |
| T13145 |
60643-60651 |
NNS |
denotes |
sections |
| T13146 |
60634-60642 |
NN |
denotes |
paraffin |
| T13147 |
60652-60657 |
VBG |
denotes |
using |
| T13148 |
60658-60669 |
NN |
denotes |
digoxigenin |
| T13149 |
60670-60677 |
VBN |
denotes |
labeled |
| T13150 |
60669-60670 |
HYPH |
denotes |
- |
| T13151 |
60682-60688 |
NNS |
denotes |
probes |
| T13152 |
60678-60681 |
NN |
denotes |
RNA |
| T13153 |
60689-60690 |
-LRB- |
denotes |
( |
| T13154 |
60696-60707 |
NNP |
denotes |
Diagnostics |
| T13155 |
60690-60695 |
NNP |
denotes |
Roche |
| T13156 |
60707-60709 |
, |
denotes |
, |
| T13157 |
60709-60721 |
NNP |
denotes |
Indianapolis |
| T13158 |
60721-60723 |
, |
denotes |
, |
| T13159 |
60723-60730 |
NNP |
denotes |
Indiana |
| T13160 |
60730-60732 |
, |
denotes |
, |
| T13161 |
60732-60738 |
NNP |
denotes |
United |
| T13162 |
60739-60745 |
NNP |
denotes |
States |
| T13163 |
60745-60746 |
-RRB- |
denotes |
) |
| T13164 |
60747-60756 |
VBG |
denotes |
according |
| T13165 |
60757-60759 |
IN |
denotes |
to |
| T13166 |
60760-60768 |
JJ |
denotes |
standard |
| T13167 |
60769-60778 |
NNS |
denotes |
protocols |
| T13168 |
60779-60780 |
-LRB- |
denotes |
( |
| T13169 |
60780-60789 |
NNP |
denotes |
Wilkinson |
| T13170 |
60790-60793 |
CC |
denotes |
and |
| T13171 |
60794-60799 |
NNP |
denotes |
Nieto |
| T13172 |
60800-60804 |
CD |
denotes |
1993 |
| T13173 |
60804-60805 |
-RRB- |
denotes |
) |
| T13174 |
60805-60806 |
. |
denotes |
. |
| T13175 |
60806-60888 |
sentence |
denotes |
Embryos and postnatal skin samples were obtained from intercrosses of deH/+ mice. |
| T13176 |
60807-60814 |
NNS |
denotes |
Embryos |
| T13177 |
60847-60855 |
VBN |
denotes |
obtained |
| T13178 |
60815-60818 |
CC |
denotes |
and |
| T13179 |
60819-60828 |
JJ |
denotes |
postnatal |
| T13180 |
60834-60841 |
NNS |
denotes |
samples |
| T13181 |
60829-60833 |
NN |
denotes |
skin |
| T13182 |
60842-60846 |
VBD |
denotes |
were |
| T13183 |
60856-60860 |
IN |
denotes |
from |
| T13184 |
60861-60873 |
NNS |
denotes |
intercrosses |
| T13185 |
60874-60876 |
IN |
denotes |
of |
| T13186 |
60877-60880 |
NN |
denotes |
deH |
| T13187 |
60883-60887 |
NNS |
denotes |
mice |
| T13188 |
60880-60881 |
HYPH |
denotes |
/ |
| T13189 |
60881-60882 |
SYM |
denotes |
+ |
| T13190 |
60887-60888 |
. |
denotes |
. |
| T13191 |
60888-61019 |
sentence |
denotes |
Embryos E13.5 or younger were fixed for 24 h; those older than E13.5 and postnatal skin were fixed for 36–48 h prior to embedding. |
| T13192 |
60889-60896 |
NNS |
denotes |
Embryos |
| T13193 |
60919-60924 |
VBN |
denotes |
fixed |
| T13194 |
60897-60902 |
NN |
denotes |
E13.5 |
| T13195 |
60903-60905 |
CC |
denotes |
or |
| T13196 |
60906-60913 |
JJR |
denotes |
younger |
| T13197 |
60914-60918 |
VBD |
denotes |
were |
| T13198 |
60982-60987 |
VBN |
denotes |
fixed |
| T13199 |
60925-60928 |
IN |
denotes |
for |
| T13200 |
60929-60931 |
CD |
denotes |
24 |
| T13201 |
60932-60933 |
NN |
denotes |
h |
| T13202 |
60933-60934 |
: |
denotes |
; |
| T13203 |
60935-60940 |
DT |
denotes |
those |
| T13204 |
60941-60946 |
JJR |
denotes |
older |
| T13205 |
60947-60951 |
IN |
denotes |
than |
| T13206 |
60952-60957 |
NN |
denotes |
E13.5 |
| T13207 |
60958-60961 |
CC |
denotes |
and |
| T13208 |
60962-60971 |
JJ |
denotes |
postnatal |
| T13209 |
60972-60976 |
NN |
denotes |
skin |
| T13210 |
60977-60981 |
VBD |
denotes |
were |
| T13211 |
60988-60991 |
IN |
denotes |
for |
| T13212 |
60992-60994 |
CD |
denotes |
36 |
| T13213 |
60995-60997 |
CD |
denotes |
48 |
| T13214 |
60994-60995 |
SYM |
denotes |
– |
| T13215 |
60998-60999 |
NN |
denotes |
h |
| T13216 |
61000-61005 |
RB |
denotes |
prior |
| T13217 |
61006-61008 |
IN |
denotes |
to |
| T13218 |
61009-61018 |
VBG |
denotes |
embedding |
| T13219 |
61018-61019 |
. |
denotes |
. |
| T13220 |
61019-61294 |
sentence |
denotes |
The Tbx15 probe was generated by RT–PCR using primers GGCGGCTAAAATGAGTGAAC and TGCCTGCTTTGGTGATGAT (corresponds to exons 1 and 2), and the En1 probe was generated by PCR from genomic DNA using primers ACGCACCAGGAAGCTAAAGA and AGCAACGAAAACGAAACTGG (located in the last exon). |
| T13221 |
61020-61023 |
DT |
denotes |
The |
| T13222 |
61030-61035 |
NN |
denotes |
probe |
| T13223 |
61024-61029 |
NN |
denotes |
Tbx15 |
| T13224 |
61040-61049 |
VBN |
denotes |
generated |
| T13225 |
61036-61039 |
VBD |
denotes |
was |
| T13226 |
61050-61052 |
IN |
denotes |
by |
| T13227 |
61053-61055 |
NN |
denotes |
RT |
| T13228 |
61056-61059 |
NN |
denotes |
PCR |
| T13229 |
61055-61056 |
HYPH |
denotes |
– |
| T13230 |
61060-61065 |
VBG |
denotes |
using |
| T13231 |
61066-61073 |
NNS |
denotes |
primers |
| T13232 |
61074-61094 |
NN |
denotes |
GGCGGCTAAAATGAGTGAAC |
| T13233 |
61095-61098 |
CC |
denotes |
and |
| T13234 |
61099-61118 |
NN |
denotes |
TGCCTGCTTTGGTGATGAT |
| T13235 |
61119-61120 |
-LRB- |
denotes |
( |
| T13236 |
61120-61131 |
VBZ |
denotes |
corresponds |
| T13237 |
61132-61134 |
IN |
denotes |
to |
| T13238 |
61135-61140 |
NNS |
denotes |
exons |
| T13239 |
61141-61142 |
CD |
denotes |
1 |
| T13240 |
61143-61146 |
CC |
denotes |
and |
| T13241 |
61147-61148 |
CD |
denotes |
2 |
| T13242 |
61148-61149 |
-RRB- |
denotes |
) |
| T13243 |
61149-61151 |
, |
denotes |
, |
| T13244 |
61151-61154 |
CC |
denotes |
and |
| T13245 |
61155-61158 |
DT |
denotes |
the |
| T13246 |
61163-61168 |
NN |
denotes |
probe |
| T13247 |
61159-61162 |
NN |
denotes |
En1 |
| T13248 |
61173-61182 |
VBN |
denotes |
generated |
| T13249 |
61169-61172 |
VBD |
denotes |
was |
| T13250 |
61183-61185 |
IN |
denotes |
by |
| T13251 |
61186-61189 |
NN |
denotes |
PCR |
| T13252 |
61190-61194 |
IN |
denotes |
from |
| T13253 |
61195-61202 |
JJ |
denotes |
genomic |
| T13254 |
61203-61206 |
NN |
denotes |
DNA |
| T13255 |
61207-61212 |
VBG |
denotes |
using |
| T13256 |
61213-61220 |
NNS |
denotes |
primers |
| T13257 |
61221-61241 |
NN |
denotes |
ACGCACCAGGAAGCTAAAGA |
| T13258 |
61242-61245 |
CC |
denotes |
and |
| T13259 |
61246-61266 |
NN |
denotes |
AGCAACGAAAACGAAACTGG |
| T13260 |
61267-61268 |
-LRB- |
denotes |
( |
| T13261 |
61268-61275 |
VBN |
denotes |
located |
| T13262 |
61276-61278 |
IN |
denotes |
in |
| T13263 |
61279-61282 |
DT |
denotes |
the |
| T13264 |
61288-61292 |
NN |
denotes |
exon |
| T13265 |
61283-61287 |
JJ |
denotes |
last |
| T13266 |
61292-61293 |
-RRB- |
denotes |
) |
| T13267 |
61293-61294 |
. |
denotes |
. |
| T13268 |
61294-61355 |
sentence |
denotes |
The Agouti probe corresponds to the protein-coding sequence. |
| T13269 |
61295-61298 |
DT |
denotes |
The |
| T13270 |
61306-61311 |
NN |
denotes |
probe |
| T13271 |
61299-61305 |
NN |
denotes |
Agouti |
| T13272 |
61312-61323 |
VBZ |
denotes |
corresponds |
| T13273 |
61324-61326 |
IN |
denotes |
to |
| T13274 |
61327-61330 |
DT |
denotes |
the |
| T13275 |
61346-61354 |
NN |
denotes |
sequence |
| T13276 |
61331-61338 |
NN |
denotes |
protein |
| T13277 |
61339-61345 |
VBG |
denotes |
coding |
| T13278 |
61338-61339 |
HYPH |
denotes |
- |
| T13279 |
61354-61355 |
. |
denotes |
. |
| T13332 |
61357-61366 |
JJ |
denotes |
Embryonic |
| T13333 |
61372-61387 |
NN |
denotes |
transplantation |
| T13334 |
61367-61371 |
NN |
denotes |
skin |
| T13335 |
61387-61588 |
sentence |
denotes |
(BTBR-at/at × B6-a/a)F1 embryos at E12.5 were dissected in sterile Tyrode's solution, and embryonic skin was divided into dorsal, flank, and ventral pieces, each 1–2 mm2 in size, as shown in Figure 7. |
| T13336 |
61388-61389 |
-LRB- |
denotes |
( |
| T13337 |
61434-61443 |
VBN |
denotes |
dissected |
| T13338 |
61389-61393 |
NN |
denotes |
BTBR |
| T13339 |
61412-61419 |
NNS |
denotes |
embryos |
| T13340 |
61393-61394 |
HYPH |
denotes |
- |
| T13341 |
61394-61396 |
NN |
denotes |
at |
| T13342 |
61397-61399 |
NN |
denotes |
at |
| T13343 |
61396-61397 |
HYPH |
denotes |
/ |
| T13344 |
61400-61401 |
SYM |
denotes |
× |
| T13345 |
61402-61404 |
NN |
denotes |
B6 |
| T13346 |
61404-61405 |
HYPH |
denotes |
- |
| T13347 |
61405-61406 |
NN |
denotes |
a |
| T13348 |
61407-61408 |
NN |
denotes |
a |
| T13349 |
61406-61407 |
HYPH |
denotes |
/ |
| T13350 |
61408-61409 |
-RRB- |
denotes |
) |
| T13351 |
61409-61411 |
NN |
denotes |
F1 |
| T13352 |
61420-61422 |
IN |
denotes |
at |
| T13353 |
61423-61428 |
NN |
denotes |
E12.5 |
| T13354 |
61429-61433 |
VBD |
denotes |
were |
| T13355 |
61444-61446 |
IN |
denotes |
in |
| T13356 |
61447-61454 |
JJ |
denotes |
sterile |
| T13357 |
61464-61472 |
NN |
denotes |
solution |
| T13358 |
61455-61461 |
NNP |
denotes |
Tyrode |
| T13359 |
61461-61463 |
POS |
denotes |
's |
| T13360 |
61472-61474 |
, |
denotes |
, |
| T13361 |
61474-61477 |
CC |
denotes |
and |
| T13362 |
61478-61487 |
JJ |
denotes |
embryonic |
| T13363 |
61488-61492 |
NN |
denotes |
skin |
| T13364 |
61497-61504 |
VBN |
denotes |
divided |
| T13365 |
61493-61496 |
VBD |
denotes |
was |
| T13366 |
61505-61509 |
IN |
denotes |
into |
| T13367 |
61510-61516 |
JJ |
denotes |
dorsal |
| T13368 |
61537-61543 |
NNS |
denotes |
pieces |
| T13369 |
61516-61518 |
, |
denotes |
, |
| T13370 |
61518-61523 |
NN |
denotes |
flank |
| T13371 |
61523-61525 |
, |
denotes |
, |
| T13372 |
61525-61528 |
CC |
denotes |
and |
| T13373 |
61529-61536 |
JJ |
denotes |
ventral |
| T13374 |
61543-61545 |
, |
denotes |
, |
| T13375 |
61545-61549 |
RB |
denotes |
each |
| T13376 |
61554-61557 |
NN |
denotes |
mm2 |
| T13377 |
61550-61551 |
CD |
denotes |
1 |
| T13378 |
61552-61553 |
CD |
denotes |
2 |
| T13379 |
61551-61552 |
HYPH |
denotes |
– |
| T13380 |
61558-61560 |
IN |
denotes |
in |
| T13381 |
61561-61565 |
NN |
denotes |
size |
| T13382 |
61565-61567 |
, |
denotes |
, |
| T13383 |
61567-61569 |
IN |
denotes |
as |
| T13384 |
61570-61575 |
VBN |
denotes |
shown |
| T13385 |
61576-61578 |
IN |
denotes |
in |
| T13386 |
61579-61585 |
NN |
denotes |
Figure |
| T13387 |
61586-61587 |
CD |
denotes |
7 |
| T13388 |
61587-61588 |
. |
denotes |
. |
| T13389 |
61588-61662 |
sentence |
denotes |
Skin fragments were grafted to the testes of congenic animals as follows. |
| T13390 |
61589-61593 |
NN |
denotes |
Skin |
| T13391 |
61594-61603 |
NNS |
denotes |
fragments |
| T13392 |
61609-61616 |
VBN |
denotes |
grafted |
| T13393 |
61604-61608 |
VBD |
denotes |
were |
| T13394 |
61617-61619 |
IN |
denotes |
to |
| T13395 |
61620-61623 |
DT |
denotes |
the |
| T13396 |
61624-61630 |
NNS |
denotes |
testes |
| T13397 |
61631-61633 |
IN |
denotes |
of |
| T13398 |
61634-61642 |
JJ |
denotes |
congenic |
| T13399 |
61643-61650 |
NNS |
denotes |
animals |
| T13400 |
61651-61653 |
IN |
denotes |
as |
| T13401 |
61654-61661 |
VBZ |
denotes |
follows |
| T13402 |
61661-61662 |
. |
denotes |
. |
| T13403 |
61662-61800 |
sentence |
denotes |
After anesthetization with 2.5% Avertin, a 1.5-cm incision in the skin and body wall was made at a point level with the top of the limbs. |
| T13404 |
61663-61668 |
IN |
denotes |
After |
| T13405 |
61752-61756 |
VBN |
denotes |
made |
| T13406 |
61669-61684 |
NN |
denotes |
anesthetization |
| T13407 |
61685-61689 |
IN |
denotes |
with |
| T13408 |
61690-61693 |
CD |
denotes |
2.5 |
| T13409 |
61693-61694 |
NN |
denotes |
% |
| T13410 |
61695-61702 |
NN |
denotes |
Avertin |
| T13411 |
61702-61704 |
, |
denotes |
, |
| T13412 |
61704-61705 |
DT |
denotes |
a |
| T13413 |
61713-61721 |
NN |
denotes |
incision |
| T13414 |
61706-61709 |
CD |
denotes |
1.5 |
| T13415 |
61710-61712 |
NN |
denotes |
cm |
| T13416 |
61709-61710 |
HYPH |
denotes |
- |
| T13417 |
61722-61724 |
IN |
denotes |
in |
| T13418 |
61725-61728 |
DT |
denotes |
the |
| T13419 |
61729-61733 |
NN |
denotes |
skin |
| T13420 |
61734-61737 |
CC |
denotes |
and |
| T13421 |
61738-61742 |
NN |
denotes |
body |
| T13422 |
61743-61747 |
NN |
denotes |
wall |
| T13423 |
61748-61751 |
VBD |
denotes |
was |
| T13424 |
61757-61759 |
IN |
denotes |
at |
| T13425 |
61760-61761 |
DT |
denotes |
a |
| T13426 |
61762-61767 |
NN |
denotes |
point |
| T13427 |
61768-61773 |
JJ |
denotes |
level |
| T13428 |
61774-61778 |
IN |
denotes |
with |
| T13429 |
61779-61782 |
DT |
denotes |
the |
| T13430 |
61783-61786 |
NN |
denotes |
top |
| T13431 |
61787-61789 |
IN |
denotes |
of |
| T13432 |
61790-61793 |
DT |
denotes |
the |
| T13433 |
61794-61799 |
NNS |
denotes |
limbs |
| T13434 |
61799-61800 |
. |
denotes |
. |
| T13435 |
61800-61887 |
sentence |
denotes |
The fat pads were pulled out and laid on the outside of the body, exposing the testes. |
| T13436 |
61801-61804 |
DT |
denotes |
The |
| T13437 |
61809-61813 |
NNS |
denotes |
pads |
| T13438 |
61805-61808 |
NN |
denotes |
fat |
| T13439 |
61819-61825 |
VBN |
denotes |
pulled |
| T13440 |
61814-61818 |
VBD |
denotes |
were |
| T13441 |
61826-61829 |
RP |
denotes |
out |
| T13442 |
61830-61833 |
CC |
denotes |
and |
| T13443 |
61834-61838 |
VBN |
denotes |
laid |
| T13444 |
61839-61841 |
IN |
denotes |
on |
| T13445 |
61842-61845 |
DT |
denotes |
the |
| T13446 |
61846-61853 |
NN |
denotes |
outside |
| T13447 |
61854-61856 |
IN |
denotes |
of |
| T13448 |
61857-61860 |
DT |
denotes |
the |
| T13449 |
61861-61865 |
NN |
denotes |
body |
| T13450 |
61865-61867 |
, |
denotes |
, |
| T13451 |
61867-61875 |
VBG |
denotes |
exposing |
| T13452 |
61876-61879 |
DT |
denotes |
the |
| T13453 |
61880-61886 |
NNS |
denotes |
testes |
| T13454 |
61886-61887 |
. |
denotes |
. |
| T13455 |
61887-62135 |
sentence |
denotes |
Forceps were used to introduce a small hole in the testis capsule through which a piece of dissected embryonic skin was inserted, the testes were then replaced into the abdominal cavity, and the wound was closed in both the body wall and the skin. |
| T13456 |
61888-61895 |
NNS |
denotes |
Forceps |
| T13457 |
61901-61905 |
VBN |
denotes |
used |
| T13458 |
61896-61900 |
VBD |
denotes |
were |
| T13459 |
61906-61908 |
TO |
denotes |
to |
| T13460 |
61909-61918 |
VB |
denotes |
introduce |
| T13461 |
61919-61920 |
DT |
denotes |
a |
| T13462 |
61927-61931 |
NN |
denotes |
hole |
| T13463 |
61921-61926 |
JJ |
denotes |
small |
| T13464 |
61932-61934 |
IN |
denotes |
in |
| T13465 |
61935-61938 |
DT |
denotes |
the |
| T13466 |
61946-61953 |
NN |
denotes |
capsule |
| T13467 |
61939-61945 |
NN |
denotes |
testis |
| T13468 |
61954-61961 |
IN |
denotes |
through |
| T13469 |
62008-62016 |
VBN |
denotes |
inserted |
| T13470 |
61962-61967 |
WDT |
denotes |
which |
| T13471 |
61968-61969 |
DT |
denotes |
a |
| T13472 |
61970-61975 |
NN |
denotes |
piece |
| T13473 |
61976-61978 |
IN |
denotes |
of |
| T13474 |
61979-61988 |
VBN |
denotes |
dissected |
| T13475 |
61999-62003 |
NN |
denotes |
skin |
| T13476 |
61989-61998 |
JJ |
denotes |
embryonic |
| T13477 |
62004-62007 |
VBD |
denotes |
was |
| T13478 |
62016-62018 |
, |
denotes |
, |
| T13479 |
62018-62021 |
DT |
denotes |
the |
| T13480 |
62022-62028 |
NNS |
denotes |
testes |
| T13481 |
62039-62047 |
VBN |
denotes |
replaced |
| T13482 |
62029-62033 |
VBD |
denotes |
were |
| T13483 |
62034-62038 |
RB |
denotes |
then |
| T13484 |
62048-62052 |
IN |
denotes |
into |
| T13485 |
62053-62056 |
DT |
denotes |
the |
| T13486 |
62067-62073 |
NN |
denotes |
cavity |
| T13487 |
62057-62066 |
JJ |
denotes |
abdominal |
| T13488 |
62073-62075 |
, |
denotes |
, |
| T13489 |
62075-62078 |
CC |
denotes |
and |
| T13490 |
62079-62082 |
DT |
denotes |
the |
| T13491 |
62083-62088 |
NN |
denotes |
wound |
| T13492 |
62093-62099 |
VBN |
denotes |
closed |
| T13493 |
62089-62092 |
VBD |
denotes |
was |
| T13494 |
62100-62102 |
IN |
denotes |
in |
| T13495 |
62103-62107 |
CC |
denotes |
both |
| T13496 |
62117-62121 |
NN |
denotes |
wall |
| T13497 |
62108-62111 |
DT |
denotes |
the |
| T13498 |
62112-62116 |
NN |
denotes |
body |
| T13499 |
62122-62125 |
CC |
denotes |
and |
| T13500 |
62126-62129 |
DT |
denotes |
the |
| T13501 |
62130-62134 |
NN |
denotes |
skin |
| T13502 |
62134-62135 |
. |
denotes |
. |
| T13503 |
62135-62259 |
sentence |
denotes |
After 21 days, mice that received grafts were sacrificed and the resulting hair was dissected from the testes and examined. |
| T13504 |
62136-62141 |
IN |
denotes |
After |
| T13505 |
62182-62192 |
VBN |
denotes |
sacrificed |
| T13506 |
62142-62144 |
CD |
denotes |
21 |
| T13507 |
62145-62149 |
NNS |
denotes |
days |
| T13508 |
62149-62151 |
, |
denotes |
, |
| T13509 |
62151-62155 |
NNS |
denotes |
mice |
| T13510 |
62156-62160 |
WDT |
denotes |
that |
| T13511 |
62161-62169 |
VBD |
denotes |
received |
| T13512 |
62170-62176 |
NNS |
denotes |
grafts |
| T13513 |
62177-62181 |
VBD |
denotes |
were |
| T13514 |
62193-62196 |
CC |
denotes |
and |
| T13515 |
62197-62200 |
DT |
denotes |
the |
| T13516 |
62211-62215 |
NN |
denotes |
hair |
| T13517 |
62201-62210 |
VBG |
denotes |
resulting |
| T13518 |
62220-62229 |
VBN |
denotes |
dissected |
| T13519 |
62216-62219 |
VBD |
denotes |
was |
| T13520 |
62230-62234 |
IN |
denotes |
from |
| T13521 |
62235-62238 |
DT |
denotes |
the |
| T13522 |
62239-62245 |
NNS |
denotes |
testes |
| T13523 |
62246-62249 |
CC |
denotes |
and |
| T13524 |
62250-62258 |
VBN |
denotes |
examined |
| T13525 |
62258-62259 |
. |
denotes |
. |
| T13570 |
62261-62265 |
NN |
denotes |
Fate |
| T13571 |
62266-62273 |
VBG |
denotes |
mapping |
| T13572 |
62265-62266 |
HYPH |
denotes |
- |
| T13573 |
62274-62277 |
DT |
denotes |
the |
| T13574 |
62294-62302 |
NN |
denotes |
frontier |
| T13575 |
62278-62285 |
JJ |
denotes |
lateral |
| T13576 |
62286-62293 |
JJ |
denotes |
somitic |
| T13577 |
62302-62475 |
sentence |
denotes |
The Hoxb6-Cre transgene described by Kuehn and colleagues (Lowe et al. 2000) is expressed in the lateral plate but not the somitic mesoderm of the trunk, beginning at E9.5. |
| T13578 |
62303-62306 |
DT |
denotes |
The |
| T13579 |
62317-62326 |
NN |
denotes |
transgene |
| T13580 |
62307-62312 |
NN |
denotes |
Hoxb6 |
| T13581 |
62313-62316 |
NN |
denotes |
Cre |
| T13582 |
62312-62313 |
HYPH |
denotes |
- |
| T13583 |
62383-62392 |
VBN |
denotes |
expressed |
| T13584 |
62327-62336 |
VBN |
denotes |
described |
| T13585 |
62337-62339 |
IN |
denotes |
by |
| T13586 |
62340-62345 |
NN |
denotes |
Kuehn |
| T13587 |
62346-62349 |
CC |
denotes |
and |
| T13588 |
62350-62360 |
NNS |
denotes |
colleagues |
| T13589 |
62361-62362 |
-LRB- |
denotes |
( |
| T13590 |
62362-62366 |
NNP |
denotes |
Lowe |
| T13591 |
62367-62369 |
FW |
denotes |
et |
| T13592 |
62370-62373 |
FW |
denotes |
al. |
| T13593 |
62374-62378 |
CD |
denotes |
2000 |
| T13594 |
62378-62379 |
-RRB- |
denotes |
) |
| T13595 |
62380-62382 |
VBZ |
denotes |
is |
| T13596 |
62393-62395 |
IN |
denotes |
in |
| T13597 |
62396-62399 |
DT |
denotes |
the |
| T13598 |
62408-62413 |
NN |
denotes |
plate |
| T13599 |
62400-62407 |
JJ |
denotes |
lateral |
| T13600 |
62414-62417 |
CC |
denotes |
but |
| T13601 |
62418-62421 |
RB |
denotes |
not |
| T13602 |
62422-62425 |
DT |
denotes |
the |
| T13603 |
62434-62442 |
NN |
denotes |
mesoderm |
| T13604 |
62426-62433 |
JJ |
denotes |
somitic |
| T13605 |
62443-62445 |
IN |
denotes |
of |
| T13606 |
62446-62449 |
DT |
denotes |
the |
| T13607 |
62450-62455 |
NN |
denotes |
trunk |
| T13608 |
62455-62457 |
, |
denotes |
, |
| T13609 |
62457-62466 |
VBG |
denotes |
beginning |
| T13610 |
62467-62469 |
IN |
denotes |
at |
| T13611 |
62470-62474 |
NN |
denotes |
E9.5 |
| T13612 |
62474-62475 |
. |
denotes |
. |
| T13613 |
62475-62602 |
sentence |
denotes |
Animals doubly heterozygous for this transgene and the R26R reporter gene were used as a source of whole skin at P1.5 or P4.5. |
| T13614 |
62476-62483 |
NNS |
denotes |
Animals |
| T13615 |
62555-62559 |
VBN |
denotes |
used |
| T13616 |
62484-62490 |
RB |
denotes |
doubly |
| T13617 |
62491-62503 |
JJ |
denotes |
heterozygous |
| T13618 |
62504-62507 |
IN |
denotes |
for |
| T13619 |
62508-62512 |
DT |
denotes |
this |
| T13620 |
62513-62522 |
NN |
denotes |
transgene |
| T13621 |
62523-62526 |
CC |
denotes |
and |
| T13622 |
62527-62530 |
DT |
denotes |
the |
| T13623 |
62545-62549 |
NN |
denotes |
gene |
| T13624 |
62531-62535 |
NN |
denotes |
R26R |
| T13625 |
62536-62544 |
NN |
denotes |
reporter |
| T13626 |
62550-62554 |
VBD |
denotes |
were |
| T13627 |
62560-62562 |
IN |
denotes |
as |
| T13628 |
62563-62564 |
DT |
denotes |
a |
| T13629 |
62565-62571 |
NN |
denotes |
source |
| T13630 |
62572-62574 |
IN |
denotes |
of |
| T13631 |
62575-62580 |
JJ |
denotes |
whole |
| T13632 |
62581-62585 |
NN |
denotes |
skin |
| T13633 |
62586-62588 |
IN |
denotes |
at |
| T13634 |
62589-62593 |
NN |
denotes |
P1.5 |
| T13635 |
62594-62596 |
CC |
denotes |
or |
| T13636 |
62597-62601 |
NN |
denotes |
P4.5 |
| T13637 |
62601-62602 |
. |
denotes |
. |
| T13638 |
62602-62800 |
sentence |
denotes |
Skin sections parallel to the dorsoventral axis were prepared with a single incision along the ventral midline and stained for β-galactosidase activity using standard protocols at room temperature. |
| T13639 |
62603-62607 |
NN |
denotes |
Skin |
| T13640 |
62608-62616 |
NNS |
denotes |
sections |
| T13641 |
62656-62664 |
VBN |
denotes |
prepared |
| T13642 |
62617-62625 |
JJ |
denotes |
parallel |
| T13643 |
62626-62628 |
IN |
denotes |
to |
| T13644 |
62629-62632 |
DT |
denotes |
the |
| T13645 |
62646-62650 |
NN |
denotes |
axis |
| T13646 |
62633-62645 |
JJ |
denotes |
dorsoventral |
| T13647 |
62651-62655 |
VBD |
denotes |
were |
| T13648 |
62665-62669 |
IN |
denotes |
with |
| T13649 |
62670-62671 |
DT |
denotes |
a |
| T13650 |
62679-62687 |
NN |
denotes |
incision |
| T13651 |
62672-62678 |
JJ |
denotes |
single |
| T13652 |
62688-62693 |
IN |
denotes |
along |
| T13653 |
62694-62697 |
DT |
denotes |
the |
| T13654 |
62706-62713 |
NN |
denotes |
midline |
| T13655 |
62698-62705 |
JJ |
denotes |
ventral |
| T13656 |
62714-62717 |
CC |
denotes |
and |
| T13657 |
62718-62725 |
VBN |
denotes |
stained |
| T13658 |
62726-62729 |
IN |
denotes |
for |
| T13659 |
62730-62731 |
NN |
denotes |
β |
| T13660 |
62732-62745 |
NN |
denotes |
galactosidase |
| T13661 |
62731-62732 |
HYPH |
denotes |
- |
| T13662 |
62746-62754 |
NN |
denotes |
activity |
| T13663 |
62755-62760 |
VBG |
denotes |
using |
| T13664 |
62761-62769 |
JJ |
denotes |
standard |
| T13665 |
62770-62779 |
NNS |
denotes |
protocols |
| T13666 |
62780-62782 |
IN |
denotes |
at |
| T13667 |
62783-62787 |
NN |
denotes |
room |
| T13668 |
62788-62799 |
NN |
denotes |
temperature |
| T13669 |
62799-62800 |
. |
denotes |
. |
| T13670 |
62800-62883 |
sentence |
denotes |
The P1.5 sample was stained overnight and the P4.5 samples were stained for 5.5 h. |
| T13671 |
62801-62804 |
DT |
denotes |
The |
| T13672 |
62810-62816 |
NN |
denotes |
sample |
| T13673 |
62805-62809 |
NN |
denotes |
P1.5 |
| T13674 |
62821-62828 |
VBN |
denotes |
stained |
| T13675 |
62817-62820 |
VBD |
denotes |
was |
| T13676 |
62829-62838 |
RB |
denotes |
overnight |
| T13677 |
62839-62842 |
CC |
denotes |
and |
| T13678 |
62843-62846 |
DT |
denotes |
the |
| T13679 |
62852-62859 |
NNS |
denotes |
samples |
| T13680 |
62847-62851 |
NN |
denotes |
P4.5 |
| T13681 |
62865-62872 |
VBN |
denotes |
stained |
| T13682 |
62860-62864 |
VBD |
denotes |
were |
| T13683 |
62873-62876 |
IN |
denotes |
for |
| T13684 |
62877-62880 |
CD |
denotes |
5.5 |
| T13685 |
62881-62882 |
NN |
denotes |
h |
| T13686 |
62882-62883 |
. |
denotes |
. |
| T13687 |
62883-62967 |
sentence |
denotes |
Similar nonstained skin sections were prepared from animals carrying the at allele. |
| T13688 |
62884-62891 |
JJ |
denotes |
Similar |
| T13689 |
62908-62916 |
NNS |
denotes |
sections |
| T13690 |
62892-62902 |
JJ |
denotes |
nonstained |
| T13691 |
62903-62907 |
NN |
denotes |
skin |
| T13692 |
62922-62930 |
VBN |
denotes |
prepared |
| T13693 |
62917-62921 |
VBD |
denotes |
were |
| T13694 |
62931-62935 |
IN |
denotes |
from |
| T13695 |
62936-62943 |
NNS |
denotes |
animals |
| T13696 |
62944-62952 |
VBG |
denotes |
carrying |
| T13697 |
62953-62956 |
DT |
denotes |
the |
| T13698 |
62960-62966 |
NN |
denotes |
allele |
| T13699 |
62957-62959 |
NN |
denotes |
at |
| T13700 |
62966-62967 |
. |
denotes |
. |
| T13701 |
62967-63145 |
sentence |
denotes |
Images of the different skin fragments were aligned and scaled, and the relative position of the somite–lateral plate and the pigmentation boundaries were measured using ImageJ. |
| T13702 |
62968-62974 |
NNS |
denotes |
Images |
| T13703 |
63012-63019 |
VBN |
denotes |
aligned |
| T13704 |
62975-62977 |
IN |
denotes |
of |
| T13705 |
62978-62981 |
DT |
denotes |
the |
| T13706 |
62997-63006 |
NNS |
denotes |
fragments |
| T13707 |
62982-62991 |
JJ |
denotes |
different |
| T13708 |
62992-62996 |
NN |
denotes |
skin |
| T13709 |
63007-63011 |
VBD |
denotes |
were |
| T13710 |
63020-63023 |
CC |
denotes |
and |
| T13711 |
63024-63030 |
VBN |
denotes |
scaled |
| T13712 |
63030-63032 |
, |
denotes |
, |
| T13713 |
63032-63035 |
CC |
denotes |
and |
| T13714 |
63036-63039 |
DT |
denotes |
the |
| T13715 |
63049-63057 |
NN |
denotes |
position |
| T13716 |
63040-63048 |
JJ |
denotes |
relative |
| T13717 |
63123-63131 |
VBN |
denotes |
measured |
| T13718 |
63058-63060 |
IN |
denotes |
of |
| T13719 |
63061-63064 |
DT |
denotes |
the |
| T13720 |
63080-63085 |
NN |
denotes |
plate |
| T13721 |
63065-63071 |
NN |
denotes |
somite |
| T13722 |
63072-63079 |
JJ |
denotes |
lateral |
| T13723 |
63071-63072 |
HYPH |
denotes |
– |
| T13724 |
63086-63089 |
CC |
denotes |
and |
| T13725 |
63090-63093 |
DT |
denotes |
the |
| T13726 |
63107-63117 |
NNS |
denotes |
boundaries |
| T13727 |
63094-63106 |
NN |
denotes |
pigmentation |
| T13728 |
63118-63122 |
VBD |
denotes |
were |
| T13729 |
63132-63137 |
VBG |
denotes |
using |
| T13730 |
63138-63144 |
NN |
denotes |
ImageJ |
| T13731 |
63144-63145 |
. |
denotes |
. |
| T12974 |
60083-60087 |
NN |
denotes |
Gene |
| T12975 |
60088-60097 |
NN |
denotes |
targeting |
| T12976 |
60097-60197 |
sentence |
denotes |
A targeted allele of Tbx15 was constructed using the same approach described in Russ et al. (2000). |
| T12977 |
60098-60099 |
DT |
denotes |
A |
| T12978 |
60109-60115 |
NN |
denotes |
allele |
| T12979 |
60100-60108 |
VBN |
denotes |
targeted |
| T12980 |
60129-60140 |
VBN |
denotes |
constructed |
| T12981 |
60116-60118 |
IN |
denotes |
of |
| T12982 |
60119-60124 |
NN |
denotes |
Tbx15 |
| T12983 |
60125-60128 |
VBD |
denotes |
was |
| T12984 |
60141-60146 |
VBG |
denotes |
using |
| T12985 |
60147-60150 |
DT |
denotes |
the |
| T12986 |
60156-60164 |
NN |
denotes |
approach |
| T12987 |
60151-60155 |
JJ |
denotes |
same |
| T12988 |
60165-60174 |
VBN |
denotes |
described |
| T12989 |
60175-60177 |
IN |
denotes |
in |
| T12990 |
60178-60182 |
NNP |
denotes |
Russ |
| T12991 |
60183-60185 |
FW |
denotes |
et |
| T12992 |
60186-60189 |
FW |
denotes |
al. |
| T12993 |
60190-60191 |
-LRB- |
denotes |
( |
| T12994 |
60191-60195 |
CD |
denotes |
2000 |
| T12995 |
60195-60196 |
-RRB- |
denotes |
) |
| T12996 |
60196-60197 |
. |
denotes |
. |
| T12997 |
60197-60440 |
sentence |
denotes |
In brief, an IRES-LacZ-neo cassette with 5′ and 3′ homology arms of 3.5 kb and 1.8 kb was inserted into a unique BamHI site that lies 479 nucleotides downstream of the transcriptional initiation site (relative to the mRNA sequence) in exon 3. |
| T12998 |
60198-60200 |
IN |
denotes |
In |
| T169 |
0-12 |
JJ |
denotes |
Dorsoventral |
| T170 |
13-23 |
NN |
denotes |
Patterning |
| T2203 |
8877-8878 |
DT |
denotes |
a |
| T2204 |
8912-8918 |
NN |
denotes |
manner |
| T2205 |
8879-8886 |
JJ |
denotes |
dynamic |
| T2206 |
8887-8890 |
CC |
denotes |
and |
| T2207 |
8891-8900 |
RB |
denotes |
spatially |
| T2208 |
8901-8911 |
JJ |
denotes |
restricted |
| T2209 |
8919-8921 |
IN |
denotes |
in |
| T2210 |
8922-8925 |
DT |
denotes |
the |
| T2211 |
8937-8941 |
NN |
denotes |
skin |
| T2212 |
8926-8936 |
VBG |
denotes |
developing |
| T2213 |
8942-8945 |
CC |
denotes |
and |
| T2214 |
8946-8961 |
JJ |
denotes |
musculoskeletal |
| T2215 |
8962-8968 |
NN |
denotes |
system |
| T2216 |
8968-8969 |
. |
denotes |
. |
| T2217 |
8969-9153 |
sentence |
denotes |
Embryonic expression and transplantation studies suggest that Tbx15 is required to establish certain characteristics of dorsal patterning in mesenchymal cells of the developing flank. |
| T2218 |
8970-8979 |
JJ |
denotes |
Embryonic |
| T2219 |
9011-9018 |
NNS |
denotes |
studies |
| R92 |
T269 |
T270 |
det |
the,boundary |
| R93 |
T270 |
T253 |
dobj |
boundary,raises |
| R1 |
T172 |
T170 |
prep |
of,Patterning |
| R2 |
T173 |
T174 |
det |
the,Coat |
| R3 |
T174 |
T172 |
pobj |
Coat,of |
| R5 |
T176 |
T170 |
prep |
by,Patterning |
| R6 |
T177 |
T176 |
pobj |
Tbx15,by |
| R7 |
T179 |
T180 |
amod |
Many,members |
| R8 |
T180 |
T181 |
nsubj |
members,display |
| R9 |
T182 |
T180 |
prep |
of,members |
| R10 |
T183 |
T184 |
det |
the,kingdom |
| R11 |
T184 |
T182 |
pobj |
kingdom,of |
| R13 |
T186 |
T187 |
nmod |
coat,differences |
| R14 |
T187 |
T181 |
dobj |
differences,display |
| R18 |
T191 |
T181 |
prep |
along,display |
| R19 |
T192 |
T193 |
poss |
their,axis |
| R20 |
T193 |
T191 |
pobj |
axis,along |
| R22 |
T195 |
T181 |
punct |
.,display |
| R23 |
T197 |
T198 |
aux |
To,determine |
| R24 |
T198 |
T199 |
advcl |
determine,studied |
| R25 |
T200 |
T201 |
det |
the,mechanisms |
| R26 |
T201 |
T198 |
dobj |
mechanisms,determine |
| R27 |
T202 |
T203 |
dep |
that,control |
| R28 |
T203 |
T201 |
relcl |
control,mechanisms |
| R29 |
T204 |
T205 |
amod |
regional,differences |
| R30 |
T205 |
T203 |
dobj |
differences,control |
| R31 |
T206 |
T205 |
prep |
in,differences |
| R32 |
T207 |
T206 |
pobj |
pigmentation,in |
| R33 |
T208 |
T199 |
punct |
", ",studied |
| R34 |
T209 |
T199 |
nsubj |
we,studied |
| R35 |
T210 |
T199 |
aux |
have,studied |
| R36 |
T211 |
T212 |
advmod |
how,affects |
| R37 |
T212 |
T199 |
ccomp |
affects,studied |
| R39 |
T214 |
T212 |
nsubj |
mutation,affects |
| R40 |
T215 |
T214 |
amod |
classical,mutation |
| R41 |
T216 |
T214 |
compound |
mouse,mutation |
| R49 |
T224 |
T225 |
amod |
dorsoventral,characteristics |
| R50 |
T225 |
T212 |
dobj |
characteristics,affects |
| R52 |
T227 |
T225 |
punct |
", ",characteristics |
| R53 |
T228 |
T229 |
advmod |
especially,those |
| R54 |
T229 |
T225 |
appos |
those,characteristics |
| R55 |
T230 |
T229 |
prep |
under,those |
| R56 |
T231 |
T230 |
pobj |
control,under |
| R57 |
T232 |
T231 |
prep |
of,control |
| R58 |
T233 |
T234 |
det |
the,gene |
| R59 |
T234 |
T232 |
pobj |
gene,of |
| R61 |
T236 |
T199 |
punct |
.,studied |
| R62 |
T238 |
T239 |
nsubj |
Mice,have |
| R63 |
T239 |
T253 |
ccomp |
have,raises |
| R66 |
T242 |
T240 |
dobj |
allele,carrying |
| R67 |
T243 |
T242 |
compound |
Agouti,allele |
| R77 |
T254 |
T255 |
det |
a,boundary |
| R78 |
T255 |
T239 |
dobj |
boundary,have |
| R80 |
T257 |
T255 |
prep |
between,boundary |
| R81 |
T258 |
T259 |
amod |
dorsal,hair |
| R82 |
T259 |
T257 |
pobj |
hair,between |
| R84 |
T261 |
T259 |
cc |
and,hair |
| R85 |
T262 |
T263 |
amod |
yellow,hair |
| R86 |
T263 |
T259 |
conj |
hair,hair |
| R88 |
T265 |
T253 |
punct |
;,raises |
| R89 |
T266 |
T267 |
det |
the,mutation |
| R90 |
T267 |
T253 |
nsubj |
mutation,raises |
| R95 |
T272 |
T253 |
punct |
", ",raises |
| R96 |
T273 |
T253 |
advcl |
producing,raises |
| R97 |
T274 |
T275 |
det |
an,transformation |
| R98 |
T275 |
T273 |
dobj |
transformation,producing |
| R105 |
T282 |
T253 |
punct |
.,raises |
| R106 |
T284 |
T285 |
nsubj |
We,identify |
| R107 |
T286 |
T287 |
det |
a,deletion |
| R108 |
T287 |
T285 |
dobj |
deletion,identify |
| R111 |
T290 |
T287 |
prep |
in,deletion |
| R112 |
T291 |
T290 |
pobj |
deH,in |
| R113 |
T292 |
T293 |
dep |
that,removes |
| R114 |
T293 |
T287 |
relcl |
removes,deletion |
| R115 |
T294 |
T293 |
dobj |
all,removes |
| R116 |
T295 |
T294 |
prep |
but,all |
| R117 |
T296 |
T297 |
det |
the,exon |
| R118 |
T297 |
T295 |
pobj |
exon,but |
| R120 |
T299 |
T297 |
prep |
of,exon |
| R121 |
T300 |
T301 |
det |
the,gene |
| R122 |
T301 |
T299 |
pobj |
gene,of |
| R124 |
T303 |
T297 |
punct |
", ",exon |
| R125 |
T304 |
T305 |
poss |
whose,expression |
| R126 |
T305 |
T307 |
dep |
expression,correlates |
| R128 |
T307 |
T297 |
relcl |
correlates,exon |
| R132 |
T311 |
T307 |
prep |
with,correlates |
| R133 |
T312 |
T313 |
amod |
pigmentary,malformations |
| R134 |
T313 |
T311 |
pobj |
malformations,with |
| R137 |
T316 |
T313 |
acl |
observed,malformations |
| R138 |
T317 |
T316 |
prep |
in,observed |
| R139 |
T318 |
T319 |
compound |
deH,deH |
| R140 |
T319 |
T321 |
compound |
deH,animals |
| R142 |
T321 |
T317 |
pobj |
animals,in |
| R143 |
T322 |
T285 |
punct |
.,identify |
| R144 |
T324 |
T325 |
nsubj |
Construction,confirmed |
| R145 |
T326 |
T324 |
prep |
of,Construction |
| R146 |
T327 |
T328 |
det |
a,allele |
| R147 |
T328 |
T326 |
pobj |
allele,of |
| R149 |
T330 |
T328 |
prep |
of,allele |
| R150 |
T331 |
T330 |
pobj |
Tbx15,of |
| R151 |
T332 |
T333 |
mark |
that,caused |
| R152 |
T333 |
T325 |
ccomp |
caused,confirmed |
| R154 |
T335 |
T333 |
nsubjpass |
phenotype,caused |
| R155 |
T336 |
T335 |
compound |
deH,phenotype |
| R157 |
T338 |
T333 |
agent |
by,caused |
| R158 |
T339 |
T340 |
compound |
Tbx15,loss |
| R159 |
T340 |
T338 |
pobj |
loss,by |
| R160 |
T341 |
T340 |
prep |
of,loss |
| R161 |
T342 |
T341 |
pobj |
function,of |
| R162 |
T343 |
T325 |
punct |
.,confirmed |
| R163 |
T345 |
T346 |
advmod |
Early,embryonic |
| R164 |
T346 |
T347 |
amod |
embryonic,expression |
| R165 |
T347 |
T348 |
nsubj |
expression,is |
| R166 |
T348 |
T354 |
ccomp |
is,displaced |
| R172 |
T355 |
T348 |
acomp |
complementary,is |
| R173 |
T356 |
T355 |
prep |
to,complementary |
| R174 |
T357 |
T358 |
compound |
Agouti,expression |
| R175 |
T358 |
T356 |
pobj |
expression,to |
| R176 |
T359 |
T358 |
prep |
in,expression |
| R177 |
T360 |
T361 |
amod |
ventral,mesenchyme |
| R178 |
T361 |
T359 |
pobj |
mesenchyme,in |
| R179 |
T362 |
T354 |
punct |
;,displaced |
| R180 |
T363 |
T354 |
prep |
in,displaced |
| R181 |
T364 |
T365 |
det |
the,absence |
| R182 |
T365 |
T363 |
pobj |
absence,in |
| R183 |
T366 |
T365 |
prep |
of,absence |
| R184 |
T367 |
T366 |
pobj |
Tbx15,of |
| R185 |
T368 |
T354 |
punct |
", ",displaced |
| R186 |
T369 |
T354 |
nsubjpass |
expression,displaced |
| R187 |
T370 |
T369 |
prep |
of,expression |
| R188 |
T371 |
T370 |
pobj |
Agouti,of |
| R189 |
T372 |
T369 |
prep |
in,expression |
| R190 |
T373 |
T374 |
preconj |
both,embryos |
| R191 |
T374 |
T372 |
pobj |
embryos,in |
| R192 |
T375 |
T374 |
cc |
and,embryos |
| R193 |
T376 |
T377 |
amod |
postnatal,animals |
| R194 |
T377 |
T374 |
conj |
animals,embryos |
| R195 |
T378 |
T354 |
auxpass |
is,displaced |
| R196 |
T379 |
T354 |
advmod |
dorsally,displaced |
| R197 |
T380 |
T354 |
punct |
.,displaced |
| R198 |
T382 |
T383 |
compound |
Transplantation,experiments |
| R199 |
T383 |
T384 |
nsubj |
experiments,demonstrate |
| R200 |
T385 |
T386 |
mark |
that,acquired |
| R201 |
T386 |
T384 |
ccomp |
acquired,demonstrate |
| R211 |
T396 |
T394 |
pobj |
differences,to |
| R212 |
T397 |
T396 |
compound |
pigmentation,differences |
| R214 |
T399 |
T386 |
prep |
by,acquired |
| R215 |
T400 |
T399 |
pobj |
E12.5,by |
| R216 |
T401 |
T386 |
punct |
", ",acquired |
| R217 |
T402 |
T403 |
dep |
which,is |
| R218 |
T403 |
T386 |
advcl |
is,acquired |
| R219 |
T404 |
T405 |
advmod |
shortly,after |
| R220 |
T405 |
T403 |
prep |
after,is |
| R221 |
T406 |
T407 |
advmod |
early,embryonic |
| R222 |
T407 |
T408 |
amod |
embryonic,expression |
| R223 |
T408 |
T405 |
pobj |
expression,after |
| R224 |
T409 |
T408 |
prep |
of,expression |
| R225 |
T410 |
T409 |
pobj |
Tbx15,of |
| R226 |
T411 |
T384 |
punct |
.,demonstrate |
| R227 |
T413 |
T414 |
npadvmod |
Fate,mapping |
| R228 |
T414 |
T416 |
amod |
mapping,studies |
| R230 |
T416 |
T417 |
nsubj |
studies,show |
| R231 |
T418 |
T419 |
mark |
that,is |
| R232 |
T419 |
T417 |
ccomp |
is,show |
| R234 |
T421 |
T419 |
nsubj |
boundary,is |
| R235 |
T422 |
T421 |
amod |
dorsoventral,boundary |
| R236 |
T423 |
T421 |
compound |
pigmentation,boundary |
| R237 |
T424 |
T419 |
neg |
not,is |
| R238 |
T425 |
T419 |
prep |
in,is |
| R239 |
T426 |
T425 |
pobj |
register,in |
| R240 |
T427 |
T426 |
prep |
with,register |
| R241 |
T428 |
T429 |
det |
a,boundary |
| R242 |
T429 |
T427 |
pobj |
boundary,with |
| R248 |
T435 |
T419 |
punct |
", ",is |
| R249 |
T436 |
T419 |
cc |
but,is |
| R250 |
T437 |
T419 |
conj |
rather,is |
| R251 |
T438 |
T437 |
prep |
with,rather |
| R252 |
T439 |
T440 |
det |
the,boundary |
| R253 |
T440 |
T438 |
pobj |
boundary,with |
| R256 |
T443 |
T417 |
punct |
.,show |
| R257 |
T445 |
T446 |
amod |
Embryonic,expression |
| R258 |
T446 |
T447 |
nsubj |
expression,provides |
| R259 |
T448 |
T446 |
prep |
of,expression |
| R260 |
T449 |
T448 |
pobj |
Tbx15,of |
| R261 |
T450 |
T446 |
prep |
in,expression |
| R262 |
T451 |
T452 |
amod |
dorsolateral,mesenchyme |
| R263 |
T452 |
T450 |
pobj |
mesenchyme,in |
| R264 |
T453 |
T454 |
det |
an,cue |
| R265 |
T454 |
T447 |
dobj |
cue,provides |
| R267 |
T456 |
T454 |
acl |
required,cue |
| R268 |
T457 |
T458 |
aux |
to,establish |
| R269 |
T458 |
T456 |
advcl |
establish,required |
| R270 |
T459 |
T460 |
det |
the,identity |
| R271 |
T460 |
T458 |
dobj |
identity,establish |
| R274 |
T463 |
T460 |
prep |
of,identity |
| R275 |
T464 |
T465 |
amod |
dorsal,dermis |
| R276 |
T465 |
T463 |
pobj |
dermis,of |
| R277 |
T466 |
T447 |
punct |
.,provides |
| R278 |
T468 |
T469 |
det |
These,findings |
| R279 |
T469 |
T470 |
nsubj |
findings,represent |
| R280 |
T471 |
T472 |
det |
a,role |
| R281 |
T472 |
T470 |
dobj |
role,represent |
| R283 |
T474 |
T472 |
prep |
for,role |
| R284 |
T475 |
T476 |
compound |
T,box |
| R285 |
T476 |
T478 |
compound |
box,action |
| R287 |
T478 |
T474 |
pobj |
action,for |
| R289 |
T480 |
T472 |
prep |
in,role |
| R290 |
T481 |
T482 |
amod |
embryonic,development |
| R291 |
T482 |
T480 |
pobj |
development,in |
| R292 |
T483 |
T470 |
punct |
", ",represent |
| R293 |
T484 |
T470 |
conj |
identify,represent |
| R294 |
T485 |
T486 |
det |
a,aspect |
| R295 |
T486 |
T484 |
dobj |
aspect,identify |
| R298 |
T489 |
T486 |
prep |
of,aspect |
| R299 |
T490 |
T491 |
amod |
dorsoventral,patterning |
| R300 |
T491 |
T489 |
pobj |
patterning,of |
| R301 |
T492 |
T493 |
dep |
that,represented |
| R302 |
T493 |
T486 |
relcl |
represented,aspect |
| R305 |
T496 |
T493 |
prep |
in,represented |
| R306 |
T497 |
T498 |
amod |
furred,mammals |
| R307 |
T498 |
T496 |
pobj |
mammals,in |
| R308 |
T499 |
T484 |
punct |
", ",identify |
| R309 |
T500 |
T484 |
cc |
and,identify |
| R310 |
T501 |
T484 |
conj |
provide,identify |
| R311 |
T502 |
T501 |
dobj |
insight,provide |
| R312 |
T503 |
T502 |
prep |
into,insight |
| R313 |
T504 |
T505 |
det |
the,mechanisms |
| R314 |
T505 |
T503 |
pobj |
mechanisms,into |
| R315 |
T506 |
T507 |
dep |
that,underlie |
| R316 |
T507 |
T505 |
relcl |
underlie,mechanisms |
| R317 |
T508 |
T509 |
npadvmod |
region,specific |
| R318 |
T509 |
T511 |
amod |
specific,differences |
| R320 |
T511 |
T507 |
dobj |
differences,underlie |
| R321 |
T512 |
T511 |
prep |
in,differences |
| R322 |
T513 |
T514 |
compound |
body,morphology |
| R323 |
T514 |
T512 |
pobj |
morphology,in |
| R324 |
T515 |
T470 |
punct |
.,represent |
| R325 |
T169 |
T170 |
amod |
Dorsoventral,Patterning |
| R327 |
T993 |
T995 |
nsubj |
question,is |
| R328 |
T994 |
T993 |
amod |
fundamental,question |
| R333 |
T1000 |
T995 |
ccomp |
acquire,is |
| R334 |
T1001 |
T1002 |
amod |
adjacent,regions |
| R335 |
T1002 |
T1000 |
nsubj |
regions,acquire |
| R336 |
T1003 |
T1002 |
prep |
of,regions |
| R337 |
T1004 |
T1005 |
det |
the,body |
| R339 |
T1006 |
T1005 |
compound |
vertebrate,body |
| R351 |
T1020 |
T1018 |
dobj |
plan,establish |
| R352 |
T1021 |
T1020 |
amod |
general,plan |
| R353 |
T1022 |
T1020 |
compound |
body,plan |
| R357 |
T1026 |
T1024 |
pobj |
number,of |
| R358 |
T1027 |
T1028 |
advmod |
relatively,small |
| R359 |
T1028 |
T1026 |
amod |
small,number |
| R371 |
T1040 |
T1038 |
pobj |
daSilva,in |
| R372 |
T1041 |
T1040 |
punct |
-,daSilva |
| R381 |
T1050 |
T1016 |
conj |
is,make |
| R382 |
T1051 |
T1052 |
prep |
to,control |
| R383 |
T1052 |
T1049 |
relcl |
control,extent |
| R384 |
T1053 |
T1051 |
pobj |
which,to |
| R385 |
T1054 |
T1055 |
det |
these,pathways |
| R386 |
T1055 |
T1052 |
nsubj |
pathways,control |
| R387 |
T1056 |
T1057 |
amod |
finer,differences |
| R388 |
T1057 |
T1052 |
dobj |
differences,control |
| R389 |
T1058 |
T1057 |
prep |
between,differences |
| R390 |
T1059 |
T1060 |
compound |
body,regions |
| R391 |
T1060 |
T1058 |
pobj |
regions,between |
| R437 |
T1110 |
T1104 |
attr |
system,are |
| R438 |
T1111 |
T1110 |
amod |
excellent,system |
| R442 |
T1115 |
T1113 |
ccomp |
arise,investigate |
| R443 |
T1116 |
T1117 |
amod |
morphological,differences |
| R444 |
T1117 |
T1115 |
nsubj |
differences,arise |
| R466 |
T1140 |
T1146 |
ccomp |
is,characterized |
| R467 |
T1141 |
T1142 |
amod |
natural,environments |
| R468 |
T1142 |
T1139 |
pobj |
environments,In |
| R469 |
T1143 |
T1140 |
punct |
", ",is |
| R470 |
T1144 |
T1145 |
compound |
color,variation |
| R471 |
T1145 |
T1140 |
nsubj |
variation,is |
| R473 |
T1148 |
T1140 |
attr |
mechanism,is |
| R474 |
T1149 |
T1150 |
advmod |
nearly,universal |
| R475 |
T1150 |
T1148 |
amod |
universal,mechanism |
| R487 |
T1162 |
T1146 |
nsubjpass |
number,characterized |
| R488 |
T1163 |
T1162 |
amod |
large,number |
| R496 |
T1171 |
T1169 |
pobj |
perspective,from |
| R497 |
T1172 |
T1171 |
amod |
evolutionary,perspective |
| R498 |
T1173 |
T1172 |
cc |
and,evolutionary |
| R499 |
T1174 |
T1172 |
conj |
ecological,evolutionary |
| R524 |
T1201 |
T1203 |
nummod |
a,century |
| R525 |
T1202 |
T1201 |
quantmod |
than,a |
| R537 |
T1214 |
T1216 |
nsubjpass |
components,identified |
| R538 |
T1215 |
T1214 |
amod |
pigmentary,components |
| R539 |
T1216 |
T1187 |
conj |
identified,been |
| R540 |
T1217 |
T1216 |
aux |
have,identified |
| R541 |
T1218 |
T1216 |
auxpass |
been,identified |
| R544 |
T1221 |
T1216 |
ccomp |
understood,identified |
| R545 |
T1222 |
T1221 |
auxpass |
are,understood |
| R548 |
T1225 |
T1223 |
pobj |
context,in |
| R549 |
T1226 |
T1225 |
amod |
cellular,context |
| R550 |
T1227 |
T1226 |
cc |
or,cellular |
| R551 |
T1228 |
T1229 |
npadvmod |
organ,based |
| R553 |
T1230 |
T1229 |
punct |
-,based |
| R587 |
T1268 |
T1266 |
pobj |
crest,from |
| R588 |
T1269 |
T1268 |
amod |
neural,crest |
| R631 |
T1314 |
T1312 |
pobj |
cycle,during |
| R632 |
T1315 |
T1314 |
compound |
hair,cycle |
| R665 |
T1350 |
T1348 |
advcl |
shared,machinery |
| R666 |
T1351 |
T1350 |
auxpass |
is,shared |
| R676 |
T1361 |
T1350 |
conj |
vary,shared |
| R677 |
T1362 |
T1361 |
aux |
can,vary |
| R705 |
T1392 |
T1389 |
conj |
type,spotting |
| R706 |
T1393 |
T1392 |
punct |
-,type |
| R720 |
T1407 |
T1405 |
pobj |
components,of |
| R721 |
T1408 |
T1407 |
amod |
molecular,components |
| R724 |
T1411 |
T1409 |
pobj |
control,than |
| R725 |
T1412 |
T1411 |
amod |
spatial,control |
| R726 |
T1413 |
T1412 |
cc |
and,spatial |
| R727 |
T1414 |
T1412 |
conj |
temporal,spatial |
| R732 |
T1421 |
T1419 |
pobj |
aspects,of |
| R733 |
T1422 |
T1423 |
advmod |
most,obvious |
| R734 |
T1423 |
T1421 |
amod |
obvious,aspects |
| R737 |
T1426 |
T1424 |
pobj |
variation,of |
| R738 |
T1427 |
T1426 |
compound |
color,variation |
| R742 |
T1431 |
T1418 |
attr |
surface,is |
| R743 |
T1432 |
T1431 |
amod |
dark,surface |
| R744 |
T1433 |
T1431 |
amod |
dorsal,surface |
| R748 |
T1437 |
T1435 |
pobj |
surface,to |
| R749 |
T1438 |
T1437 |
amod |
light,surface |
| R750 |
T1439 |
T1437 |
amod |
ventral,surface |
| R767 |
T1456 |
T1446 |
relcl |
is,skin |
| R768 |
T1457 |
T1455 |
pobj |
which,in |
| R769 |
T1458 |
T1459 |
det |
the,boundary |
| R770 |
T1459 |
T1456 |
nsubj |
boundary,is |
| R771 |
T1460 |
T1459 |
prep |
between,boundary |
| R772 |
T1461 |
T1462 |
amod |
dorsal,compartments |
| R773 |
T1462 |
T1460 |
pobj |
compartments,between |
| R774 |
T1463 |
T1461 |
cc |
and,dorsal |
| R775 |
T1464 |
T1461 |
conj |
ventral,dorsal |
| R790 |
T1481 |
T1478 |
conj |
mammals,rodents |
| R791 |
T1482 |
T1481 |
amod |
other,mammals |
| R794 |
T1485 |
T1477 |
nsubjpass |
difference,brought |
| R795 |
T1486 |
T1485 |
amod |
dorsoventral,difference |
| R813 |
T1504 |
T1502 |
pobj |
gene,of |
| R814 |
T1505 |
T1504 |
compound |
Agouti,gene |
| R830 |
T1523 |
T1521 |
pobj |
cells,by |
| R831 |
T1524 |
T1523 |
compound |
papilla,cells |
| R834 |
T1527 |
T1525 |
pobj |
follicle,within |
| R835 |
T1528 |
T1527 |
compound |
hair,follicle |
| R846 |
T1539 |
T1520 |
ccomp |
switch,causes |
| R847 |
T1540 |
T1538 |
prep |
in,melanocytes |
| R848 |
T1541 |
T1542 |
det |
that,follicle |
| R849 |
T1542 |
T1540 |
pobj |
follicle,in |
| R850 |
T1543 |
T1539 |
aux |
to,switch |
| R856 |
T1549 |
T1551 |
amod |
black,eumelanin |
| R857 |
T1550 |
T1549 |
punct |
/,black |
| R861 |
T1554 |
T1556 |
amod |
yellow,pheomelanin |
| R862 |
T1555 |
T1554 |
punct |
/,yellow |
| R869 |
T1564 |
T1561 |
dobj |
radius,has |
| R870 |
T1565 |
T1564 |
amod |
short,radius |
| R881 |
T1576 |
T1561 |
conj |
switched,has |
| R882 |
T1577 |
T1576 |
auxpass |
be,switched |
| R888 |
T1583 |
T1581 |
pobj |
cycle,during |
| R889 |
T1584 |
T1583 |
amod |
single,cycle |
| R890 |
T1585 |
T1583 |
compound |
hair,cycle |
| R913 |
T1608 |
T1562 |
nsubjpass |
expression,thought |
| R914 |
T1609 |
T1608 |
amod |
regulated,expression |
| R921 |
T1616 |
T1614 |
pobj |
surface,for |
| R922 |
T1617 |
T1618 |
npadvmod |
cream,colored |
| R924 |
T1619 |
T1618 |
punct |
-,colored |
| R925 |
T1620 |
T1618 |
cc |
or,colored |
| R926 |
T1621 |
T1618 |
conj |
yellow,colored |
| R927 |
T1622 |
T1616 |
amod |
ventral,surface |
| R932 |
T1627 |
T1625 |
dobj |
allele,carrying |
| R933 |
T1628 |
T1627 |
amod |
black,allele |
| R934 |
T1629 |
T1628 |
punct |
-,black |
| R935 |
T1630 |
T1628 |
cc |
and,black |
| R936 |
T1631 |
T1632 |
punct |
-,tan |
| R937 |
T1632 |
T1628 |
conj |
tan,black |
| R938 |
T1633 |
T1634 |
punct |
(,at |
| R939 |
T1634 |
T1627 |
parataxis |
at,allele |
| R940 |
T1635 |
T1634 |
punct |
),at |
| R944 |
T1639 |
T1637 |
pobj |
markings,for |
| R945 |
T1640 |
T1639 |
amod |
yellow,markings |
| R956 |
T1651 |
T1639 |
appos |
points,markings |
| R957 |
T1652 |
T1651 |
punct |
", ",points |
| R958 |
T1653 |
T1651 |
amod |
tan,points |
| R965 |
T1660 |
T1658 |
pobj |
breeds,of |
| R966 |
T1661 |
T1660 |
compound |
dog,breeds |
| R975 |
T1778 |
T1774 |
punct |
;,Bultman |
| R976 |
T1779 |
T1774 |
nmod |
Vrieling,Bultman |
| R977 |
T1780 |
T1774 |
nmod |
et,Bultman |
| R978 |
T1672 |
T1673 |
poss |
our,group |
| R979 |
T1781 |
T1774 |
nmod |
al.,Bultman |
| R980 |
T1673 |
T1671 |
pobj |
group,from |
| R981 |
T1782 |
T1774 |
nummod |
1994,Bultman |
| R982 |
T1674 |
T1673 |
cc |
and,group |
| R983 |
T1675 |
T1673 |
conj |
others,group |
| R984 |
T1783 |
T1774 |
punct |
),Bultman |
| R985 |
T1676 |
T1677 |
nummod |
two,isoforms |
| R986 |
T1677 |
T1665 |
dobj |
isoforms,identified |
| R987 |
T1784 |
T1761 |
cc |
and,express |
| R988 |
T1678 |
T1677 |
amod |
predominant,isoforms |
| R989 |
T1679 |
T1680 |
compound |
Agouti,mRNA |
| R990 |
T1680 |
T1677 |
compound |
mRNA,isoforms |
| R991 |
T1785 |
T1761 |
conj |
have,express |
| R992 |
T1681 |
T1682 |
dep |
that,differ |
| R993 |
T1682 |
T1677 |
relcl |
differ,isoforms |
| R994 |
T1683 |
T1682 |
prep |
by,differ |
| R995 |
T1786 |
T1787 |
amod |
black,hairs |
| R996 |
T1684 |
T1683 |
pobj |
virtue,by |
| R997 |
T1685 |
T1684 |
prep |
of,virtue |
| R998 |
T1787 |
T1785 |
dobj |
hairs,have |
| R999 |
T1686 |
T1687 |
poss |
their,site |
| R1000 |
T1687 |
T1685 |
pobj |
site,of |
| R1001 |
T1688 |
T1687 |
amod |
transcriptional,site |
| R1002 |
T1788 |
T1787 |
amod |
dorsal,hairs |
| R1003 |
T1689 |
T1687 |
compound |
initiation,site |
| R1004 |
T1690 |
T1687 |
cc |
and,site |
| R1005 |
T1691 |
T1692 |
nummod |
5,exons |
| R1006 |
T1692 |
T1687 |
conj |
exons,site |
| R1007 |
T1693 |
T1691 |
punct |
′,5 |
| R1008 |
T1694 |
T1692 |
amod |
untranslated,exons |
| R1009 |
T1695 |
T1665 |
punct |
.,identified |
| R1010 |
T1789 |
T1787 |
cc |
and,hairs |
| R1011 |
T1697 |
T1698 |
det |
A,transcript |
| R1012 |
T1790 |
T1791 |
npadvmod |
cream,colored |
| R1013 |
T1698 |
T1705 |
nsubjpass |
transcript,expressed |
| R1014 |
T1699 |
T1698 |
punct |
“,transcript |
| R1015 |
T1700 |
T1701 |
compound |
hair,cycle |
| R1016 |
T1701 |
T1702 |
npadvmod |
cycle,specific |
| R1017 |
T1791 |
T1793 |
amod |
colored,hairs |
| R1018 |
T1702 |
T1698 |
amod |
specific,transcript |
| R1019 |
T1792 |
T1791 |
punct |
-,colored |
| R1020 |
T1703 |
T1702 |
punct |
-,specific |
| R1021 |
T1704 |
T1698 |
punct |
”,transcript |
| R1022 |
T1706 |
T1705 |
auxpass |
is,expressed |
| R1023 |
T1793 |
T1787 |
conj |
hairs,hairs |
| R1024 |
T1707 |
T1705 |
prep |
in,expressed |
| R1025 |
T1708 |
T1709 |
preconj |
both,dorsal |
| R1026 |
T1794 |
T1791 |
prep |
to,colored |
| R1027 |
T1709 |
T1710 |
amod |
dorsal,skin |
| R1028 |
T1710 |
T1707 |
pobj |
skin,in |
| R1029 |
T1711 |
T1709 |
cc |
and,dorsal |
| R1030 |
T1712 |
T1709 |
conj |
ventral,dorsal |
| R1031 |
T1795 |
T1794 |
amod |
yellow,to |
| R1032 |
T1713 |
T1705 |
prep |
for,expressed |
| R1033 |
T1714 |
T1715 |
compound |
2,3 |
| R1034 |
T1796 |
T1793 |
amod |
ventral,hairs |
| R1035 |
T1715 |
T1717 |
nummod |
3,days |
| R1036 |
T1716 |
T1715 |
punct |
–,3 |
| R1037 |
T1717 |
T1713 |
pobj |
days,for |
| R1038 |
T1797 |
T1787 |
punct |
", ",hairs |
| R1039 |
T1718 |
T1705 |
prep |
during,expressed |
| R1040 |
T1719 |
T1720 |
amod |
early,growth |
| R1041 |
T1720 |
T1718 |
pobj |
growth,during |
| R1042 |
T1798 |
T1787 |
prep |
with,hairs |
| R1043 |
T1721 |
T1720 |
compound |
hair,growth |
| R1044 |
T1722 |
T1705 |
punct |
", ",expressed |
| R1045 |
T1723 |
T1724 |
mark |
while,expressed |
| R1046 |
T1799 |
T1800 |
det |
a,boundary |
| R1047 |
T1724 |
T1705 |
advcl |
expressed,expressed |
| R1048 |
T1725 |
T1726 |
det |
a,transcript |
| R1049 |
T1726 |
T1724 |
nsubjpass |
transcript,expressed |
| R1050 |
T1800 |
T1798 |
pobj |
boundary,with |
| R1051 |
T1727 |
T1726 |
punct |
“,transcript |
| R1052 |
T1728 |
T1729 |
amod |
ventral,specific |
| R1053 |
T1729 |
T1726 |
amod |
specific,transcript |
| R1054 |
T1801 |
T1800 |
amod |
sharp,boundary |
| R1055 |
T1730 |
T1729 |
punct |
-,specific |
| R1056 |
T1731 |
T1726 |
punct |
”,transcript |
| R1057 |
T1732 |
T1724 |
auxpass |
is,expressed |
| R1058 |
T1802 |
T1800 |
prep |
at,boundary |
| R1059 |
T1733 |
T1724 |
prep |
throughout,expressed |
| R1060 |
T1803 |
T1804 |
det |
the,level |
| R1061 |
T1734 |
T1735 |
det |
the,period |
| R1062 |
T1735 |
T1733 |
pobj |
period,throughout |
| R1063 |
T1736 |
T1735 |
amod |
entire,period |
| R1064 |
T1804 |
T1802 |
pobj |
level,at |
| R1065 |
T1737 |
T1735 |
prep |
of,period |
| R1066 |
T1738 |
T1739 |
amod |
active,growth |
| R1067 |
T1739 |
T1737 |
pobj |
growth,of |
| R1068 |
T1805 |
T1804 |
prep |
of,level |
| R1069 |
T1740 |
T1739 |
compound |
hair,growth |
| R1070 |
T1741 |
T1733 |
punct |
", ",throughout |
| R1071 |
T1806 |
T1807 |
det |
the,articulations |
| R1072 |
T1742 |
T1733 |
cc |
but,throughout |
| R1073 |
T1807 |
T1805 |
pobj |
articulations,of |
| R1074 |
T1743 |
T1744 |
advmod |
only,in |
| R1075 |
T1744 |
T1733 |
conj |
in,throughout |
| R1076 |
T1745 |
T1746 |
amod |
ventral,skin |
| R1077 |
T1808 |
T1807 |
nmod |
limb,articulations |
| R1078 |
T1746 |
T1744 |
pobj |
skin,in |
| R1079 |
T1747 |
T1748 |
punct |
(,Bultman |
| R1080 |
T1748 |
T1724 |
meta |
Bultman,expressed |
| R1081 |
T1809 |
T1808 |
punct |
–,limb |
| R1082 |
T1749 |
T1748 |
nmod |
et,Bultman |
| R1083 |
T1750 |
T1748 |
nmod |
al.,Bultman |
| R1084 |
T1751 |
T1748 |
nummod |
1994,Bultman |
| R1085 |
T1810 |
T1811 |
compound |
body,wall |
| R1086 |
T1752 |
T1748 |
punct |
;,Bultman |
| R1087 |
T1753 |
T1748 |
nmod |
Vrieling,Bultman |
| R1088 |
T1754 |
T1748 |
nmod |
et,Bultman |
| R1089 |
T1811 |
T1808 |
appos |
wall,limb |
| R1090 |
T1755 |
T1748 |
nmod |
al.,Bultman |
| R1091 |
T1756 |
T1748 |
nummod |
1994,Bultman |
| R1092 |
T1757 |
T1748 |
punct |
),Bultman |
| R1093 |
T1812 |
T1802 |
cc |
and,at |
| R1094 |
T1758 |
T1705 |
punct |
.,expressed |
| R1095 |
T1813 |
T1802 |
conj |
in,at |
| R1096 |
T1814 |
T1815 |
det |
the,middle |
| R1097 |
T1760 |
T1761 |
nsubj |
Animals,express |
| R1098 |
T1815 |
T1813 |
pobj |
middle,in |
| R1099 |
T1762 |
T1760 |
acl |
carrying,Animals |
| R1100 |
T1816 |
T1815 |
prep |
of,middle |
| R1101 |
T1763 |
T1764 |
det |
the,allele |
| R1102 |
T1764 |
T1762 |
dobj |
allele,carrying |
| R1103 |
T1817 |
T1818 |
det |
the,pad |
| R1104 |
T1765 |
T1764 |
compound |
at,allele |
| R1105 |
T1766 |
T1767 |
advmod |
only,transcript |
| R1106 |
T1767 |
T1761 |
dobj |
transcript,express |
| R1107 |
T1818 |
T1816 |
pobj |
pad,of |
| R1108 |
T1768 |
T1767 |
det |
the,transcript |
| R1109 |
T1769 |
T1770 |
amod |
ventral,specific |
| R1110 |
T1770 |
T1767 |
amod |
specific,transcript |
| R1111 |
T1771 |
T1770 |
punct |
-,specific |
| R1112 |
T1772 |
T1767 |
compound |
Agouti,transcript |
| R1113 |
T1819 |
T1818 |
compound |
whisker,pad |
| R1114 |
T1773 |
T1774 |
punct |
(,Bultman |
| R1115 |
T1774 |
T1761 |
meta |
Bultman,express |
| R1116 |
T1775 |
T1774 |
nmod |
et,Bultman |
| R1117 |
T1776 |
T1774 |
nmod |
al.,Bultman |
| R1118 |
T1820 |
T1761 |
punct |
.,express |
| R1119 |
T1777 |
T1774 |
nummod |
1994,Bultman |
| R1121 |
T1823 |
T1825 |
amod |
specific,isoforms |
| R1122 |
T1824 |
T1823 |
punct |
-,specific |
| R1123 |
T1825 |
T1827 |
nsubjpass |
isoforms,expressed |
| R1124 |
T1826 |
T1825 |
compound |
Agouti,isoforms |
| R1125 |
T1884 |
T1883 |
pobj |
birth,after |
| R1126 |
T1828 |
T1827 |
auxpass |
are,expressed |
| R1127 |
T1885 |
T1860 |
punct |
.,are |
| R1128 |
T1887 |
T1888 |
det |
The,boundary |
| R1129 |
T1829 |
T1827 |
advmod |
also,expressed |
| R1130 |
T1888 |
T1889 |
nsubj |
boundary,bears |
| R1131 |
T1890 |
T1888 |
prep |
between,boundary |
| R1132 |
T1830 |
T1827 |
prep |
in,expressed |
| R1133 |
T1891 |
T1892 |
amod |
dorsal,compartments |
| R1134 |
T1892 |
T1890 |
pobj |
compartments,between |
| R1135 |
T1831 |
T1832 |
amod |
developing,skin |
| R1136 |
T1893 |
T1891 |
cc |
and,dorsal |
| R1137 |
T1894 |
T1891 |
conj |
ventral,dorsal |
| R1138 |
T1895 |
T1892 |
compound |
color,compartments |
| R1139 |
T1896 |
T1888 |
prep |
in,boundary |
| R1140 |
T1832 |
T1830 |
pobj |
skin,in |
| R1141 |
T1897 |
T1898 |
compound |
at,at |
| R1142 |
T1898 |
T1900 |
compound |
at,mice |
| R1143 |
T1833 |
T1827 |
prep |
from,expressed |
| R1144 |
T1899 |
T1898 |
punct |
/,at |
| R1145 |
T1900 |
T1896 |
pobj |
mice,in |
| R1146 |
T1901 |
T1902 |
amod |
superficial,resemblance |
| R1147 |
T1834 |
T1835 |
amod |
embryonic,day |
| R1148 |
T1902 |
T1889 |
dobj |
resemblance,bears |
| R1149 |
T1835 |
T1833 |
pobj |
day,from |
| R1150 |
T1903 |
T1902 |
prep |
to,resemblance |
| R1151 |
T1904 |
T1905 |
amod |
dorsoventral,boundaries |
| R1152 |
T1836 |
T1835 |
nummod |
10.5,day |
| R1153 |
T1905 |
T1903 |
pobj |
boundaries,to |
| R1154 |
T1906 |
T1905 |
amod |
apparent,boundaries |
| R1155 |
T1907 |
T1906 |
prep |
for,apparent |
| R1156 |
T1837 |
T1835 |
punct |
(,day |
| R1157 |
T1908 |
T1909 |
amod |
many,mammals |
| R1158 |
T1909 |
T1907 |
pobj |
mammals,for |
| R1159 |
T1910 |
T1909 |
amod |
other,mammals |
| R1160 |
T1838 |
T1835 |
appos |
E10.5,day |
| R1161 |
T1911 |
T1889 |
punct |
", ",bears |
| R1162 |
T1912 |
T1889 |
cc |
but,bears |
| R1163 |
T1913 |
T1914 |
amod |
morphogenetic,differences |
| R1164 |
T1914 |
T1915 |
nsubj |
differences,seem |
| R1165 |
T1915 |
T1889 |
conj |
seem,bears |
| R1166 |
T1839 |
T1835 |
punct |
),day |
| R1167 |
T1916 |
T1914 |
prep |
between,differences |
| R1168 |
T1840 |
T1833 |
cc |
and,from |
| R1169 |
T1917 |
T1918 |
amod |
dorsal,skin |
| R1170 |
T1841 |
T1833 |
conj |
beyond,from |
| R1171 |
T1918 |
T1916 |
pobj |
skin,between |
| R1172 |
T1919 |
T1917 |
cc |
and,dorsal |
| R1173 |
T1842 |
T1827 |
cc |
and,expressed |
| R1174 |
T1920 |
T1917 |
conj |
ventral,dorsal |
| R1175 |
T1921 |
T1915 |
oprd |
likely,seem |
| R1176 |
T1922 |
T1923 |
aux |
to,include |
| R1177 |
T1843 |
T1844 |
aux |
may,play |
| R1178 |
T1923 |
T1921 |
xcomp |
include,likely |
| R1179 |
T1924 |
T1925 |
amod |
more,elements |
| R1180 |
T1925 |
T1923 |
dobj |
elements,include |
| R1181 |
T1844 |
T1827 |
conj |
play,expressed |
| R1182 |
T1926 |
T1925 |
prep |
than,elements |
| R1183 |
T1927 |
T1928 |
det |
the,type |
| R1184 |
T1845 |
T1846 |
det |
a,role |
| R1185 |
T1928 |
T1926 |
pobj |
type,than |
| R1186 |
T1929 |
T1928 |
prep |
of,type |
| R1187 |
T1930 |
T1929 |
pobj |
pigment,of |
| R1188 |
T1846 |
T1844 |
dobj |
role,play |
| R1189 |
T1931 |
T1930 |
acl |
made,pigment |
| R1190 |
T1932 |
T1931 |
agent |
by,made |
| R1191 |
T1933 |
T1934 |
compound |
hair,follicle |
| R1192 |
T1847 |
T1844 |
prep |
in,play |
| R1193 |
T1934 |
T1935 |
compound |
follicle,melanocytes |
| R1194 |
T1935 |
T1932 |
pobj |
melanocytes,by |
| R1195 |
T1936 |
T1915 |
punct |
.,seem |
| R1196 |
T1848 |
T1849 |
compound |
pigment,differentiation |
| R1197 |
T1938 |
T1939 |
prep |
In,has |
| R1198 |
T1849 |
T1847 |
pobj |
differentiation,in |
| R1199 |
T1939 |
T1946 |
ccomp |
has,established |
| R1200 |
T1940 |
T1938 |
amod |
particular,In |
| R1201 |
T1941 |
T1939 |
punct |
", ",has |
| R1202 |
T1850 |
T1849 |
compound |
cell,differentiation |
| R1203 |
T1942 |
T1939 |
nsubj |
dermis,has |
| R1204 |
T1943 |
T1942 |
prep |
of,dermis |
| R1205 |
T1944 |
T1945 |
det |
the,flank |
| R1206 |
T1851 |
T1852 |
punct |
(,Millar |
| R1207 |
T1945 |
T1943 |
pobj |
flank,of |
| R1208 |
T1852 |
T1844 |
meta |
Millar,play |
| R1209 |
T1947 |
T1948 |
advmod |
at,two |
| R1210 |
T1948 |
T1950 |
nummod |
two,origins |
| R1211 |
T1949 |
T1948 |
advmod |
least,two |
| R1212 |
T1853 |
T1852 |
nmod |
et,Millar |
| R1213 |
T1950 |
T1939 |
dobj |
origins,has |
| R1214 |
T1951 |
T1950 |
amod |
distinct,origins |
| R1215 |
T1952 |
T1950 |
punct |
: ,origins |
| R1216 |
T1953 |
T1954 |
amod |
dermatomal,derivatives |
| R1217 |
T1954 |
T1950 |
appos |
derivatives,origins |
| R1218 |
T1955 |
T1954 |
prep |
of,derivatives |
| R1219 |
T1854 |
T1852 |
nmod |
al.,Millar |
| R1220 |
T1956 |
T1955 |
pobj |
somites,of |
| R1221 |
T1957 |
T1954 |
cc |
and,derivatives |
| R1222 |
T1958 |
T1959 |
amod |
loose,mesenchyme |
| R1223 |
T1855 |
T1852 |
nummod |
1995,Millar |
| R1224 |
T1959 |
T1954 |
conj |
mesenchyme,derivatives |
| R1225 |
T1960 |
T1959 |
acl |
derived,mesenchyme |
| R1226 |
T1961 |
T1960 |
prep |
from,derived |
| R1227 |
T1856 |
T1852 |
punct |
),Millar |
| R1228 |
T1962 |
T1963 |
det |
the,mesoderm |
| R1229 |
T1963 |
T1961 |
pobj |
mesoderm,from |
| R1230 |
T1857 |
T1827 |
punct |
.,expressed |
| R1231 |
T1964 |
T1963 |
amod |
lateral,mesoderm |
| R1232 |
T1965 |
T1963 |
compound |
plate,mesoderm |
| R1233 |
T1966 |
T1967 |
punct |
(,Mauger |
| R1234 |
T1859 |
T1860 |
advmod |
Thus,are |
| R1235 |
T1967 |
T1939 |
meta |
Mauger,has |
| R1236 |
T1968 |
T1967 |
nummod |
1972,Mauger |
| R1237 |
T1969 |
T1967 |
punct |
;,Mauger |
| R1238 |
T1861 |
T1860 |
punct |
", ",are |
| R1239 |
T1970 |
T1967 |
nmod |
Christ,Mauger |
| R1240 |
T1971 |
T1967 |
nmod |
et,Mauger |
| R1241 |
T1972 |
T1967 |
nmod |
al.,Mauger |
| R1242 |
T1862 |
T1863 |
amod |
regulatory,elements |
| R1243 |
T1973 |
T1967 |
nummod |
1983,Mauger |
| R1244 |
T1974 |
T1967 |
punct |
;,Mauger |
| R1245 |
T1975 |
T1967 |
nmod |
Olivera,Mauger |
| R1246 |
T1863 |
T1860 |
nsubj |
elements,are |
| R1247 |
T1976 |
T1967 |
punct |
-,Mauger |
| R1248 |
T1977 |
T1967 |
nmod |
Martinez,Mauger |
| R1249 |
T1864 |
T1863 |
prep |
for,elements |
| R1250 |
T1978 |
T1967 |
nmod |
et,Mauger |
| R1251 |
T1979 |
T1967 |
nmod |
al.,Mauger |
| R1252 |
T1980 |
T1967 |
nummod |
2000,Mauger |
| R1253 |
T1865 |
T1866 |
amod |
ventral,specific |
| R1254 |
T1981 |
T1967 |
punct |
;,Mauger |
| R1255 |
T1982 |
T1967 |
nmod |
Nowicki,Mauger |
| R1256 |
T1983 |
T1967 |
nmod |
et,Mauger |
| R1257 |
T1866 |
T1868 |
amod |
specific,isoforms |
| R1258 |
T1984 |
T1967 |
nmod |
al.,Mauger |
| R1259 |
T1985 |
T1967 |
nummod |
2003,Mauger |
| R1260 |
T1867 |
T1866 |
punct |
-,specific |
| R1261 |
T1986 |
T1967 |
punct |
),Mauger |
| R1262 |
T1868 |
T1864 |
pobj |
isoforms,for |
| R1263 |
T1987 |
T1946 |
punct |
;,established |
| R1264 |
T1988 |
T1989 |
det |
these,lineages |
| R1265 |
T1989 |
T1946 |
nsubjpass |
lineages,established |
| R1266 |
T1869 |
T1868 |
compound |
Agouti,isoforms |
| R1267 |
T1870 |
T1860 |
acomp |
responsive,are |
| R1268 |
T1871 |
T1870 |
prep |
to,responsive |
| R1269 |
T1990 |
T1946 |
auxpass |
are,established |
| R1270 |
T1991 |
T1992 |
advmod |
early,in |
| R1271 |
T1872 |
T1873 |
amod |
dorsoventral,cues |
| R1272 |
T1992 |
T1946 |
prep |
in,established |
| R1273 |
T1993 |
T1992 |
pobj |
development,in |
| R1274 |
T1994 |
T1946 |
cc |
and,established |
| R1275 |
T1873 |
T1871 |
pobj |
cues,to |
| R1276 |
T1995 |
T1996 |
aux |
could,set |
| R1277 |
T1996 |
T1946 |
conj |
set,established |
| R1278 |
T1874 |
T1873 |
amod |
positional,cues |
| R1279 |
T1997 |
T1996 |
punct |
", ",set |
| R1280 |
T1998 |
T1996 |
prep |
in,set |
| R1281 |
T1999 |
T1998 |
amod |
principle,in |
| R1282 |
T1875 |
T1873 |
acl |
established,cues |
| R1283 |
T2000 |
T1996 |
punct |
", ",set |
| R1284 |
T2001 |
T1996 |
prt |
up,set |
| R1285 |
T2002 |
T1996 |
dobj |
compartments,set |
| R1286 |
T1876 |
T1875 |
prep |
in,established |
| R1287 |
T2003 |
T2004 |
poss |
whose,identity |
| R1288 |
T2004 |
T2005 |
dep |
identity,contributes |
| R1289 |
T2005 |
T2002 |
relcl |
contributes,compartments |
| R1290 |
T1877 |
T1878 |
det |
the,embryo |
| R1291 |
T2006 |
T2005 |
prep |
to,contributes |
| R1292 |
T2007 |
T2008 |
amod |
dorsoventral,differences |
| R1293 |
T1878 |
T1876 |
pobj |
embryo,in |
| R1294 |
T2008 |
T2006 |
pobj |
differences,to |
| R1295 |
T2009 |
T2008 |
prep |
in,differences |
| R1296 |
T2010 |
T2011 |
amod |
adult,skin |
| R1297 |
T1879 |
T1875 |
cc |
and,established |
| R1298 |
T2011 |
T2009 |
pobj |
skin,in |
| R1299 |
T2012 |
T1946 |
punct |
.,established |
| R1300 |
T1880 |
T1881 |
poss |
whose,effects |
| R1301 |
T2014 |
T2015 |
aux |
To,understand |
| R1302 |
T2015 |
T2017 |
advcl |
understand,determined |
| R1303 |
T1881 |
T1882 |
dep |
effects,persist |
| R1304 |
T1882 |
T1875 |
conj |
persist,established |
| R1305 |
T1883 |
T1882 |
prep |
after,persist |
| R1306 |
T2016 |
T2015 |
advmod |
better,understand |
| R1307 |
T2097 |
T2096 |
cc |
and,density |
| R1308 |
T2018 |
T2019 |
det |
the,mechanisms |
| R1309 |
T2019 |
T2015 |
dobj |
mechanisms,understand |
| R1310 |
T2020 |
T2021 |
dep |
that,give |
| R1311 |
T2098 |
T2097 |
punct |
/,and |
| R1312 |
T2021 |
T2019 |
relcl |
give,mechanisms |
| R1313 |
T2022 |
T2021 |
dobj |
rise,give |
| R1314 |
T2023 |
T2021 |
prep |
to,give |
| R1315 |
T2024 |
T2023 |
pobj |
differences,to |
| R1316 |
T2099 |
T2097 |
cc |
or,and |
| R1317 |
T2025 |
T2024 |
prep |
between,differences |
| R1318 |
T2026 |
T2027 |
amod |
dorsal,skin |
| R1319 |
T2027 |
T2025 |
pobj |
skin,between |
| R1320 |
T2028 |
T2026 |
cc |
and,dorsal |
| R1321 |
T2029 |
T2026 |
conj |
ventral,dorsal |
| R1322 |
T2030 |
T2023 |
cc |
and,to |
| R1323 |
T2100 |
T2096 |
conj |
differentiation,density |
| R1324 |
T2031 |
T2023 |
conj |
to,to |
| R1325 |
T2032 |
T2033 |
det |
the,boundary |
| R1326 |
T2033 |
T2031 |
pobj |
boundary,to |
| R1327 |
T2101 |
T2096 |
punct |
", ",density |
| R1328 |
T2034 |
T2033 |
prep |
between,boundary |
| R1329 |
T2035 |
T2034 |
pobj |
them,between |
| R1330 |
T2036 |
T2017 |
punct |
", ",determined |
| R1331 |
T2102 |
T2103 |
compound |
pigment,type |
| R1332 |
T2037 |
T2017 |
nsubj |
we,determined |
| R1333 |
T2038 |
T2017 |
aux |
have,determined |
| R1334 |
T2103 |
T2105 |
compound |
type,synthesis |
| R1335 |
T2039 |
T2040 |
advmod |
how,vary |
| R1336 |
T2040 |
T2017 |
advcl |
vary,determined |
| R1337 |
T2041 |
T2042 |
amod |
several,characteristics |
| R1338 |
T2104 |
T2103 |
punct |
-,type |
| R1339 |
T2042 |
T2040 |
nsubj |
characteristics,vary |
| R1340 |
T2043 |
T2042 |
amod |
morphologic,characteristics |
| R1341 |
T2044 |
T2040 |
prep |
along,vary |
| R1342 |
T2105 |
T2096 |
conj |
synthesis,density |
| R1343 |
T2045 |
T2046 |
det |
the,axis |
| R1344 |
T2046 |
T2044 |
pobj |
axis,along |
| R1345 |
T2047 |
T2046 |
amod |
dorsoventral,axis |
| R1346 |
T2106 |
T2105 |
punct |
", ",synthesis |
| R1347 |
T2048 |
T2046 |
prep |
of,axis |
| R1348 |
T2049 |
T2050 |
det |
the,mouse |
| R1349 |
T2107 |
T2105 |
cc |
and,synthesis |
| R1350 |
T2050 |
T2048 |
pobj |
mouse,of |
| R1351 |
T2051 |
T2040 |
cc |
and,vary |
| R1352 |
T2052 |
T2053 |
advmod |
how,correspond |
| R1353 |
T2108 |
T2109 |
compound |
hair,length |
| R1354 |
T2053 |
T2040 |
conj |
correspond,vary |
| R1355 |
T2054 |
T2055 |
det |
these,characteristics |
| R1356 |
T2055 |
T2053 |
nsubj |
characteristics,correspond |
| R1357 |
T2109 |
T2105 |
conj |
length,synthesis |
| R1358 |
T2056 |
T2053 |
prep |
to,correspond |
| R1359 |
T2057 |
T2058 |
amod |
ventral,specific |
| R1360 |
T2110 |
T2078 |
punct |
;,coincide |
| R1361 |
T2058 |
T2060 |
amod |
specific,expression |
| R1362 |
T2059 |
T2058 |
punct |
-,specific |
| R1363 |
T2060 |
T2056 |
pobj |
expression,to |
| R1364 |
T2061 |
T2060 |
compound |
Agouti,expression |
| R1365 |
T2111 |
T2078 |
advmod |
surprisingly,coincide |
| R1366 |
T2062 |
T2060 |
cc |
and,expression |
| R1367 |
T2112 |
T2078 |
punct |
", ",coincide |
| R1368 |
T2063 |
T2064 |
det |
the,boundary |
| R1369 |
T2064 |
T2060 |
conj |
boundary,expression |
| R1370 |
T2065 |
T2064 |
compound |
lineage,boundary |
| R1371 |
T2066 |
T2067 |
dep |
that,distinguishes |
| R1372 |
T2067 |
T2064 |
relcl |
distinguishes,boundary |
| R1373 |
T2068 |
T2067 |
dobj |
somite,distinguishes |
| R1374 |
T2113 |
T2078 |
nsubj |
none,coincide |
| R1375 |
T2114 |
T2113 |
prep |
of,none |
| R1376 |
T2069 |
T2067 |
prep |
from,distinguishes |
| R1377 |
T2070 |
T2071 |
amod |
lateral,derivatives |
| R1378 |
T2071 |
T2069 |
pobj |
derivatives,from |
| R1379 |
T2072 |
T2071 |
compound |
plate,derivatives |
| R1380 |
T2115 |
T2114 |
pobj |
these,of |
| R1381 |
T2073 |
T2017 |
punct |
.,determined |
| R1382 |
T2075 |
T2076 |
poss |
Our,results |
| R1383 |
T2116 |
T2078 |
prep |
with,coincide |
| R1384 |
T2076 |
T2077 |
nsubj |
results,indicate |
| R1385 |
T2077 |
T2078 |
ccomp |
indicate,coincide |
| R1386 |
T2117 |
T2118 |
det |
the,boundary |
| R1387 |
T2079 |
T2080 |
mark |
that,represents |
| R1388 |
T2080 |
T2077 |
ccomp |
represents,indicate |
| R1389 |
T2118 |
T2116 |
pobj |
boundary,with |
| R1390 |
T2081 |
T2082 |
det |
the,uniformity |
| R1391 |
T2082 |
T2080 |
nsubj |
uniformity,represents |
| R1392 |
T2119 |
T2120 |
npadvmod |
somite,lateral |
| R1393 |
T2083 |
T2082 |
amod |
apparent,uniformity |
| R1394 |
T2084 |
T2082 |
prep |
of,uniformity |
| R1395 |
T2085 |
T2086 |
det |
the,boundary |
| R1396 |
T2120 |
T2118 |
amod |
lateral,boundary |
| R1397 |
T2086 |
T2084 |
pobj |
boundary,of |
| R1398 |
T2087 |
T2086 |
amod |
dorsoventral,boundary |
| R1399 |
T2088 |
T2089 |
det |
the,sum |
| R1400 |
T2121 |
T2120 |
punct |
–,lateral |
| R1401 |
T2089 |
T2080 |
dobj |
sum,represents |
| R1402 |
T2090 |
T2089 |
prep |
of,sum |
| R1403 |
T2091 |
T2092 |
amod |
independent,mechanisms |
| R1404 |
T2122 |
T2123 |
compound |
plate,lineage |
| R1405 |
T2092 |
T2090 |
pobj |
mechanisms,of |
| R1406 |
T2093 |
T2094 |
dep |
that,affect |
| R1407 |
T2094 |
T2092 |
relcl |
affect,mechanisms |
| R1408 |
T2123 |
T2118 |
compound |
lineage,boundary |
| R1409 |
T2095 |
T2096 |
compound |
melanocyte,density |
| R1410 |
T2124 |
T2078 |
punct |
.,coincide |
| R1411 |
T2096 |
T2094 |
dobj |
density,affect |
| R1417 |
T2132 |
T2130 |
pobj |
mutation,of |
| R1418 |
T2133 |
T2132 |
amod |
classical,mutation |
| R1419 |
T2203 |
T2204 |
det |
a,manner |
| R1420 |
T2134 |
T2132 |
compound |
mouse,mutation |
| R1421 |
T2204 |
T2202 |
pobj |
manner,in |
| R1422 |
T2205 |
T2204 |
amod |
dynamic,manner |
| R1423 |
T2206 |
T2205 |
cc |
and,dynamic |
| R1424 |
T2207 |
T2208 |
advmod |
spatially,restricted |
| R1425 |
T2208 |
T2205 |
conj |
restricted,dynamic |
| R1426 |
T2209 |
T2201 |
prep |
in,expressed |
| R1427 |
T2135 |
T2132 |
punct |
", ",mutation |
| R1428 |
T2210 |
T2211 |
det |
the,skin |
| R1429 |
T2211 |
T2209 |
pobj |
skin,in |
| R1430 |
T2212 |
T2211 |
amod |
developing,skin |
| R1431 |
T2136 |
T2137 |
amod |
droopy,ear |
| R1432 |
T2213 |
T2211 |
cc |
and,skin |
| R1433 |
T2214 |
T2215 |
amod |
musculoskeletal,system |
| R1434 |
T2215 |
T2211 |
conj |
system,skin |
| R1435 |
T2137 |
T2132 |
appos |
ear,mutation |
| R1436 |
T2216 |
T2169 |
punct |
.,identify |
| R1437 |
T2138 |
T2139 |
punct |
(,Curry |
| R1438 |
T2218 |
T2219 |
amod |
Embryonic,studies |
| R1439 |
T2219 |
T2223 |
nsubj |
studies,suggest |
| R1440 |
T2220 |
T2219 |
nmod |
expression,studies |
| R1441 |
T2139 |
T2132 |
meta |
Curry,mutation |
| R1442 |
T2221 |
T2220 |
cc |
and,expression |
| R1443 |
T2222 |
T2220 |
conj |
transplantation,expression |
| R1444 |
T2140 |
T2139 |
nummod |
1959,Curry |
| R1445 |
T2224 |
T2225 |
mark |
that,required |
| R1446 |
T2225 |
T2223 |
ccomp |
required,suggest |
| R1447 |
T2226 |
T2225 |
nsubjpass |
Tbx15,required |
| R1448 |
T2141 |
T2139 |
punct |
),Curry |
| R1449 |
T2227 |
T2225 |
auxpass |
is,required |
| R1450 |
T2228 |
T2229 |
aux |
to,establish |
| R1451 |
T2229 |
T2225 |
xcomp |
establish,required |
| R1452 |
T2142 |
T2132 |
punct |
", ",mutation |
| R1453 |
T2230 |
T2231 |
amod |
certain,characteristics |
| R1454 |
T2231 |
T2229 |
dobj |
characteristics,establish |
| R1455 |
T2232 |
T2231 |
prep |
of,characteristics |
| R1456 |
T2233 |
T2234 |
amod |
dorsal,patterning |
| R1457 |
T2143 |
T2144 |
dep |
that,produces |
| R1458 |
T2234 |
T2232 |
pobj |
patterning,of |
| R1459 |
T2235 |
T2229 |
prep |
in,establish |
| R1460 |
T2144 |
T2132 |
relcl |
produces,mutation |
| R1461 |
T2236 |
T2237 |
amod |
mesenchymal,cells |
| R1462 |
T2237 |
T2235 |
pobj |
cells,in |
| R1463 |
T2238 |
T2237 |
prep |
of,cells |
| R1464 |
T2145 |
T2146 |
det |
a,transformation |
| R1465 |
T2146 |
T2144 |
dobj |
transformation,produces |
| R1466 |
T2147 |
T2146 |
amod |
dorsal,transformation |
| R1469 |
T2148 |
T2147 |
punct |
-,dorsal |
| R1472 |
T2149 |
T2147 |
prep |
to,dorsal |
| R1476 |
T2150 |
T2149 |
punct |
-,to |
| R1480 |
T2151 |
T2149 |
amod |
ventral,to |
| R1485 |
T2152 |
T2146 |
prep |
of,transformation |
| R1489 |
T2153 |
T2154 |
compound |
flank,color |
| R1492 |
T2154 |
T2152 |
pobj |
color,of |
| R1497 |
T2155 |
T2154 |
compound |
coat,color |
| R1501 |
T2156 |
T2144 |
prep |
by,produces |
| R1505 |
T2157 |
T2156 |
pcomp |
allowing,by |
| R1509 |
T2158 |
T2157 |
dobj |
expansion,allowing |
| R1512 |
T2159 |
T2158 |
prep |
of,expansion |
| R1515 |
T2160 |
T2161 |
det |
the,transcript |
| R1516 |
T2161 |
T2159 |
pobj |
transcript,of |
| R1517 |
T2162 |
T2163 |
amod |
ventral,specific |
| R1518 |
T2163 |
T2161 |
amod |
specific,transcript |
| R1519 |
T2164 |
T2163 |
punct |
-,specific |
| R1520 |
T2165 |
T2161 |
compound |
Agouti,transcript |
| R1521 |
T2166 |
T2127 |
punct |
.,make |
| R1522 |
T2168 |
T2169 |
prep |
By,identify |
| R1523 |
T2170 |
T2171 |
amod |
positional,cloning |
| R1524 |
T2171 |
T2168 |
pobj |
cloning,By |
| R1525 |
T2172 |
T2171 |
cc |
and,cloning |
| R1526 |
T2173 |
T2174 |
compound |
gene,targeting |
| R1527 |
T2174 |
T2171 |
conj |
targeting,cloning |
| R1528 |
T2175 |
T2169 |
punct |
", ",identify |
| R1529 |
T2176 |
T2169 |
nsubj |
we,identify |
| R1530 |
T2177 |
T2178 |
det |
an,allele |
| R1531 |
T2178 |
T2169 |
dobj |
allele,identify |
| R1532 |
T2179 |
T2178 |
prep |
of,allele |
| R1533 |
T2180 |
T2181 |
amod |
droopy,ear |
| R1534 |
T2181 |
T2179 |
pobj |
ear,of |
| R1535 |
T2182 |
T2178 |
punct |
", ",allele |
| R1536 |
T2183 |
T2178 |
appos |
deH,allele |
| R1537 |
T2184 |
T2169 |
punct |
", ",identify |
| R1538 |
T2185 |
T2169 |
prep |
as,identify |
| R1539 |
T2186 |
T2187 |
det |
a,loss |
| R1540 |
T2187 |
T2185 |
pobj |
loss,as |
| R1541 |
T2188 |
T2187 |
prep |
of,loss |
| R1542 |
T2189 |
T2188 |
pobj |
function,of |
| R1543 |
T2190 |
T2187 |
prep |
for,loss |
| R1544 |
T2191 |
T2190 |
pobj |
Tbx15,for |
| R1545 |
T2192 |
T2191 |
punct |
", ",Tbx15 |
| R1546 |
T2193 |
T2194 |
dep |
which,encodes |
| R1547 |
T2194 |
T2191 |
relcl |
encodes,Tbx15 |
| R1548 |
T2195 |
T2196 |
det |
a,factor |
| R1549 |
T2196 |
T2194 |
dobj |
factor,encodes |
| R1550 |
T2197 |
T2198 |
compound |
T,box |
| R1551 |
T2198 |
T2196 |
compound |
box,factor |
| R1552 |
T2199 |
T2198 |
punct |
-,box |
| R1553 |
T2200 |
T2196 |
compound |
transcription,factor |
| R1554 |
T2201 |
T2196 |
acl |
expressed,factor |
| R1555 |
T2202 |
T2201 |
prep |
in,expressed |
| R1559 |
T2551 |
T2549 |
pobj |
Differences,of |
| R1560 |
T2552 |
T2551 |
compound |
Skin,Differences |
| R1563 |
T2557 |
T2554 |
pobj |
change,Besides |
| R1564 |
T2558 |
T2557 |
amod |
obvious,change |
| R1569 |
T2563 |
T2557 |
relcl |
distinguishes,change |
| R1570 |
T2564 |
T2563 |
advmod |
frequently,distinguishes |
| R1616 |
T2612 |
T2601 |
cc |
as,number |
| R1617 |
T2613 |
T2612 |
advmod |
well,as |
| R1637 |
T2635 |
T2637 |
compound |
at,animals |
| R1638 |
T2636 |
T2635 |
punct |
/,at |
| R1643 |
T2641 |
T2639 |
amod |
colored,from |
| R1644 |
T2642 |
T2641 |
punct |
-,colored |
| R1647 |
T2645 |
T2643 |
amod |
yellow,to |
| R1648 |
T2646 |
T2645 |
punct |
-,yellow |
| R1660 |
T2658 |
T2656 |
pobj |
axis,along |
| R1661 |
T2659 |
T2658 |
amod |
dorsoventral,axis |
| R1678 |
T2678 |
T2676 |
pobj |
genotypes,of |
| R1679 |
T2679 |
T2678 |
compound |
Agouti,genotypes |
| R1694 |
T2696 |
T2684 |
ccomp |
coincides,reveal |
| R1695 |
T2697 |
T2698 |
det |
the,boundary |
| R1696 |
T2698 |
T2696 |
nsubj |
boundary,coincides |
| R1697 |
T2699 |
T2698 |
amod |
apparent,boundary |
| R1698 |
T2700 |
T2698 |
amod |
sharp,boundary |
| R1699 |
T2701 |
T2698 |
prep |
between,boundary |
| R1700 |
T2702 |
T2703 |
amod |
dorsal,compartments |
| R1701 |
T2703 |
T2701 |
pobj |
compartments,between |
| R1702 |
T2704 |
T2702 |
cc |
and,dorsal |
| R1703 |
T2705 |
T2702 |
conj |
ventral,dorsal |
| R1704 |
T2706 |
T2703 |
compound |
pigment,compartments |
| R1705 |
T2707 |
T2698 |
prep |
in,boundary |
| R1706 |
T2708 |
T2709 |
compound |
at,at |
| R1708 |
T2710 |
T2709 |
punct |
/,at |
| R1709 |
T2711 |
T2707 |
pobj |
mice,in |
| R1712 |
T2714 |
T2712 |
pobj |
change,with |
| R1713 |
T2715 |
T2716 |
advmod |
more,gradual |
| R1714 |
T2716 |
T2714 |
amod |
gradual,change |
| R1717 |
T2719 |
T2717 |
pobj |
color,in |
| R1718 |
T2720 |
T2719 |
compound |
hair,color |
| R1723 |
T2725 |
T2696 |
parataxis |
1A,coincides |
| R1724 |
T2726 |
T2725 |
nmod |
Figure,1A |
| R1747 |
T2751 |
T2753 |
compound |
at,mice |
| R1748 |
T2752 |
T2751 |
punct |
/,at |
| R1792 |
T2799 |
T2804 |
advcl |
varies,are |
| R1793 |
T2800 |
T2801 |
compound |
hair,cycle |
| R1795 |
T2802 |
T2801 |
punct |
-,cycle |
| R1796 |
T2803 |
T2799 |
nsubj |
timing,varies |
| R1799 |
T2807 |
T2805 |
pobj |
axis,along |
| R1800 |
T2808 |
T2807 |
amod |
rostrocaudal,axis |
| R1805 |
T2813 |
T2811 |
pobj |
length,of |
| R1806 |
T2814 |
T2813 |
compound |
hair,length |
| R1827 |
T2837 |
T2835 |
pobj |
length,of |
| R1828 |
T2838 |
T2837 |
compound |
hair,length |
| R1859 |
T2871 |
T2865 |
ccomp |
stereotyped,indicate |
| R1860 |
T2872 |
T2871 |
nsubj |
variation,stereotyped |
| R1861 |
T2873 |
T2872 |
prep |
of,variation |
| R1862 |
T2874 |
T2875 |
compound |
hair,length |
| R1863 |
T2875 |
T2873 |
pobj |
length,of |
| R1864 |
T2876 |
T2872 |
prep |
along,variation |
| R1865 |
T2877 |
T2878 |
det |
the,axis |
| R1867 |
T2879 |
T2878 |
amod |
dorsoventral,axis |
| R1868 |
T2880 |
T2871 |
aux |
is,stereotyped |
| R1873 |
T2885 |
T2883 |
pobj |
cycles,through |
| R1874 |
T2886 |
T2885 |
compound |
hair,cycles |
| R1888 |
T2900 |
T2898 |
dobj |
transition,encompasses |
| R1889 |
T2901 |
T2902 |
compound |
pigment,type |
| R1891 |
T2903 |
T2902 |
punct |
-,type |
| R1894 |
T2906 |
T2908 |
compound |
at,mice |
| R1895 |
T2907 |
T2906 |
punct |
/,at |
| R1899 |
T2912 |
T2915 |
nsubj |
skin,develop |
| R1900 |
T2913 |
T2911 |
cc |
and,Dorsal |
| R1901 |
T2914 |
T2911 |
conj |
ventral,Dorsal |
| R1918 |
T2934 |
T2923 |
dobj |
follicles,exhibit |
| R1919 |
T2935 |
T2934 |
compound |
hair,follicles |
| R1923 |
T2939 |
T2937 |
acomp |
developed,are |
| R1924 |
T2940 |
T2939 |
advmod |
more,developed |
| R1927 |
T2943 |
T2941 |
pobj |
follicles,than |
| R1928 |
T2944 |
T2943 |
compound |
hair,follicles |
| R1933 |
T2949 |
T2947 |
pobj |
decrease,with |
| R1934 |
T2950 |
T2949 |
amod |
gradual,decrease |
| R1935 |
T2951 |
T2949 |
amod |
dorsoventral,decrease |
| R1952 |
T2970 |
T2972 |
nummod |
4,wk |
| R1953 |
T2971 |
T2970 |
punct |
–,4 |
| R1967 |
T2985 |
T2962 |
conj |
is,disappear |
| R1968 |
T2986 |
T2985 |
punct |
", ",is |
| R1969 |
T2987 |
T2988 |
det |
the,proportion |
| R1970 |
T2988 |
T2985 |
nsubj |
proportion,is |
| R1971 |
T2989 |
T2988 |
prep |
of,proportion |
| R1972 |
T2990 |
T2991 |
amod |
different,types |
| R1974 |
T2992 |
T2991 |
compound |
hair,types |
| R1987 |
T3007 |
T3009 |
amod |
matched,mice |
| R1988 |
T3008 |
T3007 |
punct |
-,matched |
| R1989 |
T3009 |
T3004 |
pobj |
mice,In |
| R1990 |
T3010 |
T3009 |
amod |
inbred,mice |
| R1994 |
T3014 |
T3005 |
dobj |
decrease,observed |
| R1995 |
T3015 |
T3014 |
amod |
small,decrease |
| R2031 |
T3051 |
T3049 |
attr |
difference,was |
| R2032 |
T3052 |
T3051 |
amod |
consistent,difference |
| R2035 |
T3055 |
T3057 |
compound |
type,distribution |
| R2036 |
T3056 |
T3055 |
punct |
-,type |
| R2042 |
T3062 |
T3049 |
parataxis |
shown,was |
| R2043 |
T3063 |
T3062 |
nsubj |
data,shown |
| R2044 |
T3064 |
T3062 |
neg |
not,shown |
| R2050 |
T3072 |
T3070 |
pobj |
pigmentation,between |
| R2051 |
T3073 |
T3071 |
cc |
and,dorsal |
| R2052 |
T3074 |
T3071 |
conj |
ventral,dorsal |
| R2055 |
T3077 |
T3079 |
compound |
at,mice |
| R2056 |
T3078 |
T3077 |
punct |
/,at |
| R2062 |
T3084 |
T3086 |
compound |
type,differences |
| R2063 |
T3085 |
T3084 |
punct |
-,type |
| R2068 |
T3090 |
T3092 |
amod |
specific,expression |
| R2069 |
T3091 |
T3090 |
punct |
-,specific |
| R2076 |
T3098 |
T3069 |
conj |
have,attributed |
| R2077 |
T3099 |
T3097 |
amod |
homozygous,animals |
| R2078 |
T3100 |
T3099 |
prep |
for,homozygous |
| R2079 |
T3101 |
T3102 |
det |
a,allele |
| R2081 |
T3103 |
T3102 |
amod |
null,allele |
| R2082 |
T3104 |
T3102 |
prep |
of,allele |
| R2083 |
T3105 |
T3104 |
pobj |
Agouti,of |
| R2084 |
T3106 |
T3102 |
punct |
", ",allele |
| R2085 |
T3107 |
T3108 |
amod |
extreme,nonagouti |
| R2086 |
T3108 |
T3102 |
appos |
nonagouti,allele |
| R2087 |
T3109 |
T3108 |
punct |
(,nonagouti |
| R2088 |
T3110 |
T3108 |
appos |
ae,nonagouti |
| R2089 |
T3111 |
T3108 |
punct |
),nonagouti |
| R2090 |
T3112 |
T3098 |
punct |
", ",have |
| R2103 |
T3125 |
T3123 |
dobj |
appearance,giving |
| R2104 |
T3126 |
T3127 |
advmod |
slightly,paler |
| R2105 |
T3127 |
T3125 |
amod |
paler,appearance |
| R2108 |
T3130 |
T3128 |
pobj |
coat,to |
| R2109 |
T3131 |
T3130 |
amod |
ventral,coat |
| R2127 |
T3151 |
T3139 |
dobj |
transition,observed |
| R2128 |
T3152 |
T3151 |
amod |
gradual,transition |
| R2129 |
T3153 |
T3151 |
amod |
dorsoventral,transition |
| R2132 |
T3156 |
T3154 |
pobj |
preparations,in |
| R2133 |
T3157 |
T3156 |
compound |
dermis,preparations |
| R2136 |
T3160 |
T3158 |
pobj |
mice,from |
| R2137 |
T3161 |
T3162 |
compound |
ae,ae |
| R2139 |
T3163 |
T3162 |
punct |
/,ae |
| R2151 |
T3177 |
T3179 |
compound |
at,mice |
| R2152 |
T3178 |
T3177 |
punct |
/,at |
| R2155 |
T3181 |
T3171 |
dobj |
transition,reveal |
| R2156 |
T3182 |
T3181 |
amod |
abrupt,transition |
| R2157 |
T3183 |
T3181 |
amod |
dorsoventral,transition |
| R2163 |
T3189 |
T3181 |
relcl |
reflects,transition |
| R2164 |
T3190 |
T3189 |
advmod |
probably,reflects |
| R2166 |
T3192 |
T3189 |
dobj |
effects,reflects |
| R2167 |
T3193 |
T3192 |
amod |
additive,effects |
| R2170 |
T3196 |
T3194 |
pobj |
content,of |
| R2171 |
T3197 |
T3196 |
compound |
melanin,content |
| R2176 |
T3202 |
T3204 |
compound |
ae,mice |
| R2177 |
T3203 |
T3202 |
punct |
/,ae |
| R2196 |
T3224 |
T3222 |
xcomp |
influenced,likely |
| R2197 |
T3225 |
T3224 |
auxpass |
be,influenced |
| R2207 |
T3235 |
T3229 |
conj |
environment,number |
| R2208 |
T3236 |
T3235 |
amod |
follicular,environment |
| R2216 |
T3246 |
T3244 |
pobj |
content,in |
| R2217 |
T3247 |
T3246 |
compound |
pigment,content |
| R2220 |
T3250 |
T3252 |
compound |
ae,mice |
| R2221 |
T3251 |
T3250 |
punct |
/,ae |
| R2225 |
T3255 |
T3253 |
pobj |
cycles,throughout |
| R2226 |
T3256 |
T3255 |
compound |
hair,cycles |
| R2244 |
T3276 |
T3278 |
nummod |
three,characteristics |
| R2245 |
T3277 |
T3276 |
advmod |
least,three |
| R2255 |
T3287 |
T3289 |
compound |
type,synthesis |
| R2256 |
T3288 |
T3287 |
punct |
-,type |
| R2278 |
T3536 |
T3535 |
prep |
of,Ventralization |
| R2279 |
T3537 |
T3538 |
compound |
Skin,Morphology |
| R2280 |
T3538 |
T3536 |
pobj |
Morphology,of |
| R2281 |
T3539 |
T3535 |
prep |
by,Ventralization |
| R2282 |
T3540 |
T3541 |
det |
the,Mutation |
| R2284 |
T3542 |
T3543 |
amod |
droopy,ear |
| R2285 |
T3543 |
T3541 |
compound |
ear,Mutation |
| R2286 |
T3545 |
T3546 |
advcl |
Named,is |
| R2287 |
T3546 |
T3556 |
ccomp |
is,is |
| R2288 |
T3547 |
T3545 |
prep |
after,Named |
| R2289 |
T3548 |
T3549 |
poss |
its,effects |
| R2290 |
T3549 |
T3547 |
pobj |
effects,after |
| R2291 |
T3550 |
T3549 |
prep |
on,effects |
| R2292 |
T3551 |
T3552 |
amod |
craniofacial,morphology |
| R2293 |
T3552 |
T3550 |
pobj |
morphology,on |
| R2294 |
T3553 |
T3546 |
punct |
", ",is |
| R2295 |
T3554 |
T3555 |
amod |
droopy,ear |
| R2296 |
T3555 |
T3546 |
nsubj |
ear,is |
| R2297 |
T3557 |
T3558 |
det |
a,mutation |
| R2298 |
T3558 |
T3546 |
attr |
mutation,is |
| R2299 |
T3559 |
T3558 |
amod |
recessive,mutation |
| R2300 |
T3560 |
T3558 |
prep |
on,mutation |
| R2301 |
T3561 |
T3562 |
compound |
mouse,Chromosome |
| R2302 |
T3562 |
T3560 |
pobj |
Chromosome,on |
| R2303 |
T3563 |
T3562 |
nummod |
3,Chromosome |
| R2304 |
T3564 |
T3556 |
punct |
;,is |
| R2305 |
T3565 |
T3566 |
det |
the,allele |
| R2306 |
T3566 |
T3556 |
nsubj |
allele,is |
| R2307 |
T3567 |
T3566 |
amod |
original,allele |
| R2308 |
T3568 |
T3566 |
acl |
described,allele |
| R2309 |
T3569 |
T3570 |
amod |
more,40 |
| R2310 |
T3570 |
T3572 |
nummod |
40,years |
| R2311 |
T3571 |
T3570 |
quantmod |
than,40 |
| R2312 |
T3572 |
T3573 |
npadvmod |
years,ago |
| R2313 |
T3573 |
T3568 |
advmod |
ago,described |
| R2314 |
T3574 |
T3568 |
agent |
by,described |
| R2315 |
T3575 |
T3574 |
pobj |
Curry,by |
| R2316 |
T3576 |
T3577 |
punct |
(,1959 |
| R2317 |
T3577 |
T3568 |
parataxis |
1959,described |
| R2318 |
T3578 |
T3577 |
punct |
),1959 |
| R2319 |
T3579 |
T3556 |
acomp |
extinct,is |
| R2320 |
T3580 |
T3556 |
punct |
", ",is |
| R2321 |
T3581 |
T3556 |
cc |
but,is |
| R2322 |
T3582 |
T3583 |
det |
a,remutation |
| R2323 |
T3583 |
T3585 |
nsubj |
remutation,is |
| R2324 |
T3584 |
T3583 |
amod |
spontaneous,remutation |
| R2325 |
T3585 |
T3556 |
conj |
is,is |
| R2326 |
T3586 |
T3587 |
dep |
that,occurred |
| R2327 |
T3587 |
T3583 |
relcl |
occurred,remutation |
| R2328 |
T3588 |
T3587 |
prep |
in,occurred |
| R2329 |
T3589 |
T3588 |
pobj |
Harwell,in |
| R2330 |
T3590 |
T3583 |
punct |
", ",remutation |
| R2331 |
T3591 |
T3583 |
appos |
deH,remutation |
| R2332 |
T3592 |
T3585 |
punct |
", ",is |
| R2333 |
T3593 |
T3585 |
acomp |
available,is |
| R2334 |
T3594 |
T3585 |
prep |
through,is |
| R2335 |
T3595 |
T3596 |
det |
The,Laboratory |
| R2336 |
T3596 |
T3594 |
pobj |
Laboratory,through |
| R2337 |
T3597 |
T3596 |
compound |
Jackson,Laboratory |
| R2338 |
T3598 |
T3599 |
punct |
(,Harbor |
| R2339 |
T3599 |
T3585 |
parataxis |
Harbor,is |
| R2340 |
T3600 |
T3599 |
compound |
Bar,Harbor |
| R2341 |
T3601 |
T3599 |
punct |
", ",Harbor |
| R2342 |
T3602 |
T3599 |
npadvmod |
Maine,Harbor |
| R2343 |
T3603 |
T3599 |
punct |
", ",Harbor |
| R2344 |
T3604 |
T3605 |
compound |
United,States |
| R2345 |
T3605 |
T3599 |
npadvmod |
States,Harbor |
| R2346 |
T3606 |
T3599 |
punct |
),Harbor |
| R2347 |
T3607 |
T3556 |
punct |
.,is |
| R2348 |
T3609 |
T3610 |
amod |
External,malformations |
| R2349 |
T3610 |
T3612 |
nsubj |
malformations,are |
| R2350 |
T3611 |
T3610 |
amod |
craniofacial,malformations |
| R2351 |
T3613 |
T3614 |
det |
the,characteristic |
| R2353 |
T3615 |
T3616 |
advmod |
most,obvious |
| R2354 |
T3616 |
T3614 |
amod |
obvious,characteristic |
| R2355 |
T3617 |
T3614 |
prep |
of,characteristic |
| R2356 |
T3618 |
T3619 |
compound |
deH,deH |
| R2357 |
T3619 |
T3621 |
compound |
deH,animals |
| R2358 |
T3620 |
T3619 |
punct |
/,deH |
| R2359 |
T3621 |
T3617 |
pobj |
animals,of |
| R2360 |
T3622 |
T3612 |
punct |
", ",are |
| R2361 |
T3623 |
T3612 |
prep |
including,are |
| R2362 |
T3624 |
T3625 |
advmod |
widely,spaced |
| R2363 |
T3625 |
T3626 |
amod |
spaced,eyes |
| R2364 |
T3626 |
T3623 |
pobj |
eyes,including |
| R2365 |
T3627 |
T3626 |
punct |
", ",eyes |
| R2366 |
T3628 |
T3629 |
amod |
small,fissures |
| R2367 |
T3629 |
T3626 |
conj |
fissures,eyes |
| R2368 |
T3630 |
T3629 |
amod |
palpebral,fissures |
| R2369 |
T3631 |
T3629 |
punct |
", ",fissures |
| R2370 |
T3632 |
T3633 |
det |
a,area |
| R2372 |
T3634 |
T3633 |
amod |
broad,area |
| R2373 |
T3635 |
T3633 |
amod |
nasal,area |
| R2374 |
T3636 |
T3633 |
punct |
", ",area |
| R2375 |
T3637 |
T3633 |
cc |
and,area |
| R2376 |
T3638 |
T3639 |
det |
a,skull |
| R2377 |
T3639 |
T3633 |
conj |
skull,area |
| R2378 |
T3640 |
T3639 |
amod |
shortened,skull |
| R2379 |
T3641 |
T3639 |
acl |
held,skull |
| R2380 |
T3642 |
T3641 |
prep |
in,held |
| R2381 |
T3643 |
T3644 |
det |
an,position |
| R2382 |
T3644 |
T3642 |
pobj |
position,in |
| R2383 |
T3645 |
T3644 |
amod |
elevated,position |
| R2384 |
T3646 |
T3639 |
punct |
", ",skull |
| R2385 |
T3647 |
T3648 |
dep |
which,causes |
| R2386 |
T3648 |
T3639 |
relcl |
causes,skull |
| R2387 |
T3649 |
T3648 |
advmod |
presumably,causes |
| R2388 |
T3650 |
T3648 |
cc |
or,causes |
| R2389 |
T3651 |
T3648 |
conj |
contributes,causes |
| R2390 |
T3652 |
T3651 |
prep |
to,contributes |
| R2391 |
T3653 |
T3654 |
det |
the,position |
| R2392 |
T3654 |
T3651 |
dobj |
position,contributes |
| R2393 |
T3655 |
T3654 |
amod |
abnormal,position |
| R2394 |
T3656 |
T3654 |
prep |
of,position |
| R2395 |
T3657 |
T3658 |
det |
the,ears |
| R2396 |
T3658 |
T3656 |
pobj |
ears,of |
| R2397 |
T3659 |
T3612 |
punct |
.,are |
| R2398 |
T3661 |
T3662 |
nsubj |
We,became |
| R2399 |
T3662 |
T3663 |
ccomp |
became,comes |
| R2400 |
T3664 |
T3662 |
acomp |
interested,became |
| R2401 |
T3665 |
T3664 |
prep |
in,interested |
| R2402 |
T3666 |
T3667 |
amod |
droopy,ear |
| R2403 |
T3667 |
T3665 |
pobj |
ear,in |
| R2404 |
T3668 |
T3669 |
mark |
because,described |
| R2405 |
T3669 |
T3662 |
advcl |
described,became |
| R2406 |
T3670 |
T3671 |
det |
the,allele |
| R2407 |
T3671 |
T3669 |
nsubjpass |
allele,described |
| R2408 |
T3672 |
T3671 |
amod |
original,allele |
| R2409 |
T3673 |
T3669 |
auxpass |
was,described |
| R2410 |
T3674 |
T3675 |
aux |
to,affect |
| R2411 |
T3675 |
T3669 |
xcomp |
affect,described |
| R2412 |
T3676 |
T3677 |
compound |
pigment,pattern |
| R2413 |
T3677 |
T3675 |
dobj |
pattern,affect |
| R2414 |
T3678 |
T3675 |
prep |
in,affect |
| R2415 |
T3679 |
T3680 |
det |
a,way |
| R2416 |
T3680 |
T3678 |
pobj |
way,in |
| R2417 |
T3681 |
T3682 |
dep |
that,suggests |
| R2418 |
T3682 |
T3680 |
relcl |
suggests,way |
| R2419 |
T3683 |
T3684 |
det |
a,transformation |
| R2420 |
T3684 |
T3682 |
dobj |
transformation,suggests |
| R2421 |
T3685 |
T3684 |
amod |
possible,transformation |
| R2422 |
T3686 |
T3684 |
amod |
dorsal,transformation |
| R2423 |
T3687 |
T3686 |
prep |
to,dorsal |
| R2424 |
T3688 |
T3687 |
amod |
ventral,to |
| R2425 |
T3689 |
T3663 |
punct |
: ,comes |
| R2426 |
T3690 |
T3663 |
punct |
“,comes |
| R2427 |
T3691 |
T3663 |
prep |
On,comes |
| R2428 |
T3692 |
T3693 |
det |
a,background |
| R2429 |
T3693 |
T3691 |
pobj |
background,On |
| R2430 |
T3694 |
T3693 |
amod |
genetic,background |
| R2431 |
T3695 |
T3693 |
punct |
(,background |
| R2432 |
T3696 |
T3693 |
appos |
at,background |
| R2433 |
T3697 |
T3696 |
cc |
and,at |
| R2434 |
T3698 |
T3696 |
conj |
AW,at |
| R2435 |
T3699 |
T3693 |
punct |
),background |
| R2436 |
T3700 |
T3701 |
dep |
which,causes |
| R2437 |
T3701 |
T3693 |
relcl |
causes,background |
| R2438 |
T3702 |
T3703 |
det |
the,hair |
| R2439 |
T3703 |
T3705 |
nsubj |
hair,be |
| R2440 |
T3704 |
T3703 |
compound |
belly,hair |
| R2441 |
T3705 |
T3701 |
ccomp |
be,causes |
| R2442 |
T3706 |
T3705 |
aux |
to,be |
| R2443 |
T3707 |
T3705 |
acomp |
lighter,be |
| R2444 |
T3708 |
T3707 |
prep |
than,lighter |
| R2445 |
T3709 |
T3710 |
det |
the,hair |
| R2446 |
T3710 |
T3708 |
pobj |
hair,than |
| R2447 |
T3711 |
T3710 |
compound |
back,hair |
| R2448 |
T3712 |
T3663 |
punct |
", ",comes |
| R2449 |
T3713 |
T3714 |
det |
the,hair |
| R2450 |
T3714 |
T3663 |
nsubj |
hair,comes |
| R2451 |
T3715 |
T3714 |
compound |
belly,hair |
| R2452 |
T3716 |
T3663 |
prt |
up,comes |
| R2453 |
T3717 |
T3663 |
advmod |
farther,comes |
| R2454 |
T3718 |
T3663 |
prep |
round,comes |
| R2455 |
T3719 |
T3720 |
det |
the,sides |
| R2456 |
T3720 |
T3718 |
pobj |
sides,round |
| R2457 |
T3721 |
T3720 |
prep |
of,sides |
| R2458 |
T3722 |
T3723 |
det |
the,body |
| R2459 |
T3723 |
T3721 |
pobj |
body,of |
| R2460 |
T3724 |
T3723 |
cc |
and,body |
| R2461 |
T3725 |
T3723 |
conj |
face,body |
| R2462 |
T3726 |
T3663 |
punct |
”,comes |
| R2463 |
T3727 |
T3728 |
punct |
(,Curry |
| R2464 |
T3728 |
T3663 |
meta |
Curry,comes |
| R2465 |
T3729 |
T3728 |
nummod |
1959,Curry |
| R2466 |
T3730 |
T3728 |
punct |
),Curry |
| R2467 |
T3731 |
T3663 |
punct |
.,comes |
| R2468 |
T3733 |
T3734 |
det |
An,pattern |
| R2469 |
T3734 |
T3738 |
nsubj |
pattern,is |
| R2470 |
T3735 |
T3734 |
amod |
abnormal,pattern |
| R2471 |
T3736 |
T3734 |
amod |
dorsoventral,pattern |
| R2472 |
T3737 |
T3734 |
compound |
pigment,pattern |
| R2473 |
T3739 |
T3740 |
advmod |
readily,apparent |
| R2474 |
T3740 |
T3738 |
acomp |
apparent,is |
| R2475 |
T3741 |
T3738 |
prep |
in,is |
| R2476 |
T3742 |
T3743 |
nmod |
at,at |
| R2477 |
T3743 |
T3745 |
nmod |
at,mice |
| R2478 |
T3744 |
T3743 |
punct |
/,at |
| R2479 |
T3745 |
T3741 |
pobj |
mice,in |
| R2480 |
T3746 |
T3743 |
punct |
;,at |
| R2481 |
T3747 |
T3748 |
compound |
deH,deH |
| R2482 |
T3748 |
T3743 |
appos |
deH,at |
| R2483 |
T3749 |
T3748 |
punct |
/,deH |
| R2484 |
T3750 |
T3738 |
punct |
", ",is |
| R2485 |
T3751 |
T3738 |
cc |
but,is |
| R2486 |
T3752 |
T3753 |
nsubjpass |
comparison,described |
| R2487 |
T3753 |
T3738 |
conj |
described,is |
| R2488 |
T3754 |
T3752 |
prep |
to,comparison |
| R2489 |
T3755 |
T3756 |
amod |
nonmutant,animals |
| R2490 |
T3756 |
T3754 |
pobj |
animals,to |
| R2491 |
T3757 |
T3753 |
auxpass |
is,described |
| R2492 |
T3758 |
T3759 |
advmod |
more,accurately |
| R2493 |
T3759 |
T3753 |
advmod |
accurately,described |
| R2494 |
T3760 |
T3753 |
prep |
in,described |
| R2495 |
T3761 |
T3760 |
pobj |
terms,in |
| R2496 |
T3762 |
T3761 |
prep |
of,terms |
| R2497 |
T3763 |
T3764 |
amod |
ventral,regions |
| R2498 |
T3764 |
T3762 |
pobj |
regions,of |
| R2499 |
T3765 |
T3763 |
punct |
", ",ventral |
| R2500 |
T3766 |
T3763 |
conj |
lateral,ventral |
| R2501 |
T3767 |
T3766 |
punct |
", ",lateral |
| R2502 |
T3768 |
T3766 |
cc |
and,lateral |
| R2503 |
T3769 |
T3766 |
conj |
dorsal,lateral |
| R2504 |
T3770 |
T3771 |
punct |
(,1G |
| R2505 |
T3771 |
T3753 |
parataxis |
1G,described |
| R2506 |
T3772 |
T3771 |
nmod |
Figures,1G |
| R2507 |
T3773 |
T3771 |
cc |
and,1G |
| R2508 |
T3774 |
T3771 |
conj |
2A,1G |
| R2509 |
T3775 |
T3771 |
punct |
),1G |
| R2510 |
T3776 |
T3753 |
punct |
.,described |
| R2511 |
T3778 |
T3779 |
det |
The,region |
| R2512 |
T3779 |
T3781 |
nsubj |
region,has |
| R2513 |
T3780 |
T3779 |
amod |
ventral,region |
| R2514 |
T3781 |
T3782 |
ccomp |
has,are |
| R2515 |
T3783 |
T3784 |
amod |
short,hairs |
| R2516 |
T3784 |
T3781 |
dobj |
hairs,has |
| R2517 |
T3785 |
T3784 |
prep |
with,hairs |
| R2518 |
T3786 |
T3787 |
det |
a,base |
| R2519 |
T3787 |
T3785 |
pobj |
base,with |
| R2520 |
T3788 |
T3787 |
amod |
gray,base |
| R2521 |
T3789 |
T3787 |
cc |
and,base |
| R2522 |
T3790 |
T3791 |
npadvmod |
cream,colored |
| R2523 |
T3791 |
T3793 |
amod |
colored,tip |
| R2524 |
T3792 |
T3791 |
punct |
-,colored |
| R2525 |
T3793 |
T3787 |
conj |
tip,base |
| R2526 |
T3794 |
T3795 |
poss |
whose,boundary |
| R2527 |
T3795 |
T3796 |
dep |
boundary,coincides |
| R2528 |
T3796 |
T3784 |
relcl |
coincides,hairs |
| R2529 |
T3797 |
T3796 |
prep |
with,coincides |
| R2530 |
T3798 |
T3799 |
det |
the,junction |
| R2531 |
T3799 |
T3797 |
pobj |
junction,with |
| R2532 |
T3800 |
T3801 |
compound |
limb,body |
| R2533 |
T3801 |
T3799 |
compound |
body,junction |
| R2534 |
T3802 |
T3801 |
punct |
–,body |
| R2535 |
T3803 |
T3799 |
compound |
wall,junction |
| R2536 |
T3804 |
T3782 |
punct |
;,are |
| R2537 |
T3805 |
T3806 |
preconj |
both,appearance |
| R2538 |
T3806 |
T3782 |
nsubj |
appearance,are |
| R2539 |
T3807 |
T3806 |
det |
the,appearance |
| R2540 |
T3808 |
T3806 |
prep |
of,appearance |
| R2541 |
T3809 |
T3810 |
det |
this,region |
| R2542 |
T3810 |
T3808 |
pobj |
region,of |
| R2543 |
T3811 |
T3806 |
cc |
and,appearance |
| R2544 |
T3812 |
T3806 |
conj |
position,appearance |
| R2545 |
T3813 |
T3812 |
prep |
of,position |
| R2546 |
T3814 |
T3815 |
det |
the,boundary |
| R2547 |
T3815 |
T3813 |
pobj |
boundary,of |
| R2548 |
T3816 |
T3817 |
advmod |
approximately,similar |
| R2549 |
T3817 |
T3782 |
acomp |
similar,are |
| R2550 |
T3818 |
T3782 |
prep |
in,are |
| R2551 |
T3819 |
T3820 |
nmod |
at,at |
| R2552 |
T3820 |
T3822 |
nmod |
at,mice |
| R2553 |
T3821 |
T3820 |
punct |
/,at |
| R2554 |
T3822 |
T3818 |
pobj |
mice,in |
| R2555 |
T3823 |
T3820 |
prep |
compared,at |
| R2556 |
T3824 |
T3823 |
prep |
to,compared |
| R2557 |
T3825 |
T3826 |
compound |
at,at |
| R2558 |
T3826 |
T3824 |
pobj |
at,to |
| R2559 |
T3827 |
T3826 |
punct |
/,at |
| R2560 |
T3828 |
T3826 |
punct |
;,at |
| R2561 |
T3829 |
T3830 |
compound |
deH,deH |
| R2562 |
T3830 |
T3826 |
appos |
deH,at |
| R2563 |
T3831 |
T3830 |
punct |
/,deH |
| R2564 |
T3832 |
T3782 |
punct |
.,are |
| R2565 |
T3834 |
T3835 |
det |
The,region |
| R2566 |
T3835 |
T3837 |
nsubj |
region,contains |
| R2567 |
T3836 |
T3835 |
amod |
lateral,region |
| R2568 |
T3837 |
T3838 |
ccomp |
contains,appears |
| R2569 |
T3839 |
T3840 |
amod |
yellow,hairs |
| R2570 |
T3840 |
T3837 |
dobj |
hairs,contains |
| R2571 |
T3841 |
T3840 |
prep |
of,hairs |
| R2572 |
T3842 |
T3843 |
advmod |
progressively,increasing |
| R2573 |
T3843 |
T3844 |
amod |
increasing,length |
| R2574 |
T3844 |
T3841 |
pobj |
length,of |
| R2575 |
T3845 |
T3838 |
punct |
;,appears |
| R2576 |
T3846 |
T3838 |
prep |
in,appears |
| R2577 |
T3847 |
T3848 |
compound |
at,at |
| R2578 |
T3848 |
T3850 |
compound |
at,mice |
| R2579 |
T3849 |
T3848 |
punct |
/,at |
| R2580 |
T3850 |
T3846 |
pobj |
mice,in |
| R2581 |
T3851 |
T3838 |
punct |
", ",appears |
| R2582 |
T3852 |
T3853 |
det |
the,region |
| R2583 |
T3853 |
T3838 |
nsubj |
region,appears |
| R2584 |
T3854 |
T3853 |
amod |
lateral,region |
| R2585 |
T3855 |
T3838 |
prep |
as,appears |
| R2586 |
T3856 |
T3857 |
det |
a,stripe |
| R2588 |
T3858 |
T3857 |
amod |
thin,stripe |
| R2589 |
T3859 |
T3857 |
amod |
yellow,stripe |
| R2590 |
T3860 |
T3838 |
prep |
along,appears |
| R2591 |
T3861 |
T3862 |
det |
the,flank |
| R2592 |
T3862 |
T3860 |
pobj |
flank,along |
| R2593 |
T3863 |
T3838 |
punct |
", ",appears |
| R2594 |
T3864 |
T3838 |
cc |
but,appears |
| R2595 |
T3865 |
T3866 |
prep |
in,is |
| R2596 |
T3866 |
T3838 |
conj |
is,appears |
| R2597 |
T3867 |
T3868 |
nmod |
at,at |
| R2598 |
T3868 |
T3870 |
nmod |
at,mice |
| R2599 |
T3869 |
T3868 |
punct |
/,at |
| R2600 |
T3870 |
T3865 |
pobj |
mice,in |
| R2601 |
T3871 |
T3868 |
punct |
;,at |
| R2602 |
T3872 |
T3873 |
compound |
deH,deH |
| R2603 |
T3873 |
T3868 |
appos |
deH,at |
| R2604 |
T3874 |
T3873 |
punct |
/,deH |
| R2605 |
T3875 |
T3866 |
punct |
", ",is |
| R2606 |
T3876 |
T3877 |
det |
the,region |
| R2607 |
T3877 |
T3866 |
nsubj |
region,is |
| R2608 |
T3878 |
T3877 |
amod |
lateral,region |
| R2609 |
T3879 |
T3880 |
advmod |
considerably,expanded |
| R2610 |
T3880 |
T3866 |
acomp |
expanded,is |
| R2611 |
T3881 |
T3866 |
prep |
with,is |
| R2612 |
T3882 |
T3883 |
det |
a,boundary |
| R2613 |
T3883 |
T3881 |
pobj |
boundary,with |
| R2614 |
T3884 |
T3883 |
amod |
diffuse,boundary |
| R2615 |
T3885 |
T3883 |
prep |
along,boundary |
| R2616 |
T3886 |
T3887 |
det |
the,flank |
| R2617 |
T3887 |
T3885 |
pobj |
flank,along |
| R2618 |
T3888 |
T3887 |
amod |
dorsal,flank |
| R2619 |
T3889 |
T3883 |
punct |
", ",boundary |
| R2620 |
T3890 |
T3883 |
cc |
and,boundary |
| R2621 |
T3891 |
T3892 |
det |
a,region |
| R2623 |
T3893 |
T3892 |
amod |
dorsal,region |
| R2624 |
T3894 |
T3892 |
amod |
eumelanic,region |
| R2625 |
T3895 |
T3896 |
poss |
whose,size |
| R2626 |
T3896 |
T3897 |
dep |
size,reduced |
| R2628 |
T3898 |
T3897 |
auxpass |
is,reduced |
| R2629 |
T3899 |
T3897 |
advmod |
correspondingly,reduced |
| R2630 |
T3900 |
T3901 |
punct |
(,2A |
| R2631 |
T3901 |
T3866 |
parataxis |
2A,is |
| R2632 |
T3902 |
T3901 |
nmod |
Figure,2A |
| R2633 |
T3903 |
T3901 |
cc |
and,2A |
| R2634 |
T3904 |
T3901 |
conj |
2B,2A |
| R2635 |
T3905 |
T3901 |
punct |
),2A |
| R2636 |
T3906 |
T3838 |
punct |
.,appears |
| R2637 |
T3908 |
T3909 |
amod |
Total,size |
| R2638 |
T3909 |
T3911 |
nsubj |
size,is |
| R2639 |
T3910 |
T3909 |
compound |
body,size |
| R2640 |
T3912 |
T3911 |
acomp |
smaller,is |
| R2641 |
T3913 |
T3911 |
prep |
in,is |
| R2642 |
T3914 |
T3913 |
pobj |
mutant,in |
| R2643 |
T3915 |
T3914 |
prep |
compared,mutant |
| R2644 |
T3916 |
T3915 |
prep |
to,compared |
| R2645 |
T3917 |
T3916 |
pobj |
nonmutant,to |
| R2646 |
T3918 |
T3914 |
appos |
animals,mutant |
| R2647 |
T3919 |
T3911 |
punct |
", ",is |
| R2648 |
T3920 |
T3911 |
cc |
but,is |
| R2649 |
T3921 |
T3922 |
det |
the,proportion |
| R2650 |
T3922 |
T3923 |
nsubjpass |
proportion,increased |
| R2651 |
T3923 |
T3911 |
conj |
increased,is |
| R2652 |
T3924 |
T3922 |
prep |
of,proportion |
| R2653 |
T3925 |
T3926 |
compound |
body,circumference |
| R2654 |
T3926 |
T3924 |
pobj |
circumference,of |
| R2655 |
T3927 |
T3922 |
acl |
occupied,proportion |
| R2656 |
T3928 |
T3927 |
agent |
by,occupied |
| R2657 |
T3929 |
T3930 |
det |
the,region |
| R2658 |
T3930 |
T3928 |
pobj |
region,by |
| R2659 |
T3931 |
T3930 |
amod |
lateral,region |
| R2660 |
T3932 |
T3927 |
prep |
in,occupied |
| R2661 |
T3933 |
T3934 |
amod |
mutant,animals |
| R2662 |
T3934 |
T3932 |
pobj |
animals,in |
| R2663 |
T3935 |
T3923 |
auxpass |
is,increased |
| R2664 |
T3936 |
T3937 |
advmod |
about,2 |
| R2665 |
T3937 |
T3938 |
quantmod |
2,fold |
| R2666 |
T3938 |
T3923 |
advmod |
fold,increased |
| R2667 |
T3939 |
T3938 |
punct |
-,fold |
| R2668 |
T3940 |
T3923 |
punct |
", ",increased |
| R2669 |
T3941 |
T3923 |
prep |
from,increased |
| R2670 |
T3942 |
T3943 |
nummod |
11.9,% |
| R2671 |
T3943 |
T3941 |
pobj |
%,from |
| R2672 |
T3944 |
T3923 |
prep |
to,increased |
| R2673 |
T3945 |
T3946 |
nummod |
22.2,% |
| R2674 |
T3946 |
T3944 |
pobj |
%,to |
| R2675 |
T3947 |
T3948 |
punct |
(,Figure |
| R2676 |
T3948 |
T3923 |
parataxis |
Figure,increased |
| R2677 |
T3949 |
T3948 |
nummod |
2C,Figure |
| R2678 |
T3950 |
T3948 |
punct |
),Figure |
| R2679 |
T3951 |
T3923 |
punct |
.,increased |
| R2680 |
T3953 |
T3954 |
det |
The,proportion |
| R2681 |
T3954 |
T3955 |
nsubjpass |
proportion,expanded |
| R2682 |
T3956 |
T3954 |
prep |
of,proportion |
| R2683 |
T3957 |
T3958 |
det |
the,region |
| R2684 |
T3958 |
T3956 |
pobj |
region,of |
| R2685 |
T3959 |
T3958 |
amod |
ventral,region |
| R2686 |
T3960 |
T3961 |
npadvmod |
cream,colored |
| R2687 |
T3961 |
T3958 |
amod |
colored,region |
| R2688 |
T3962 |
T3961 |
punct |
-,colored |
| R2689 |
T3963 |
T3955 |
auxpass |
is,expanded |
| R2690 |
T3964 |
T3955 |
advmod |
also,expanded |
| R2691 |
T3965 |
T3966 |
det |
a,amount |
| R2692 |
T3966 |
T3955 |
npadvmod |
amount,expanded |
| R2693 |
T3967 |
T3966 |
amod |
small,amount |
| R2694 |
T3968 |
T3966 |
punct |
", ",amount |
| R2695 |
T3969 |
T3970 |
nummod |
47.9,% |
| R2696 |
T3970 |
T3966 |
appos |
%,amount |
| R2697 |
T3971 |
T3955 |
prep |
in,expanded |
| R2698 |
T3972 |
T3971 |
pobj |
mutant,in |
| R2699 |
T3973 |
T3955 |
prep |
compared,expanded |
| R2700 |
T3974 |
T3973 |
prep |
to,compared |
| R2701 |
T3975 |
T3976 |
nummod |
37.8,% |
| R2702 |
T3976 |
T3974 |
pobj |
%,to |
| R2703 |
T3977 |
T3976 |
prep |
in,% |
| R2704 |
T3978 |
T3977 |
pobj |
nonmutant,in |
| R2705 |
T3979 |
T3955 |
dobj |
animals,expanded |
| R2706 |
T3980 |
T3955 |
punct |
", ",expanded |
| R2707 |
T3981 |
T3955 |
cc |
but,expanded |
| R2708 |
T3982 |
T3983 |
nsubj |
expansion,is |
| R2709 |
T3983 |
T3955 |
conj |
is,expanded |
| R2710 |
T3984 |
T3982 |
prep |
of,expansion |
| R2711 |
T3985 |
T3986 |
det |
the,region |
| R2712 |
T3986 |
T3984 |
pobj |
region,of |
| R2713 |
T3987 |
T3986 |
amod |
lateral,region |
| R2714 |
T3988 |
T3982 |
punct |
", ",expansion |
| R2715 |
T3989 |
T3990 |
dep |
which,occurs |
| R2716 |
T3990 |
T3982 |
relcl |
occurs,expansion |
| R2717 |
T3991 |
T3990 |
prep |
at,occurs |
| R2718 |
T3992 |
T3993 |
det |
all,levels |
| R2719 |
T3993 |
T3991 |
pobj |
levels,at |
| R2720 |
T3994 |
T3993 |
prep |
of,levels |
| R2721 |
T3995 |
T3996 |
det |
the,body |
| R2722 |
T3996 |
T3994 |
pobj |
body,of |
| R2723 |
T3997 |
T3993 |
punct |
", ",levels |
| R2724 |
T3998 |
T3993 |
prep |
including,levels |
| R2725 |
T3999 |
T4000 |
det |
the,limbs |
| R2726 |
T4000 |
T3998 |
pobj |
limbs,including |
| R2727 |
T4001 |
T4000 |
cc |
and,limbs |
| R2728 |
T4002 |
T4003 |
det |
the,cranium |
| R2729 |
T4003 |
T4000 |
conj |
cranium,limbs |
| R2730 |
T4004 |
T4000 |
punct |
(,limbs |
| R2731 |
T4005 |
T4000 |
cc |
but,limbs |
| R2732 |
T4006 |
T4005 |
neg |
not,but |
| R2733 |
T4007 |
T4008 |
det |
the,pad |
| R2734 |
T4008 |
T4000 |
conj |
pad,limbs |
| R2735 |
T4009 |
T4008 |
compound |
whisker,pad |
| R2736 |
T4010 |
T4008 |
punct |
),pad |
| R2737 |
T4011 |
T3983 |
punct |
", ",is |
| R2738 |
T4012 |
T4013 |
det |
the,feature |
| R2739 |
T4013 |
T3983 |
attr |
feature,is |
| R2740 |
T4014 |
T4013 |
amod |
major,feature |
| R2741 |
T4015 |
T4013 |
amod |
responsible,feature |
| R2742 |
T4016 |
T4015 |
prep |
for,responsible |
| R2743 |
T4017 |
T4018 |
det |
the,appearance |
| R2744 |
T4018 |
T4016 |
pobj |
appearance,for |
| R2745 |
T4019 |
T4018 |
amod |
ventralized,appearance |
| R2746 |
T4020 |
T4018 |
acl |
caused,appearance |
| R2747 |
T4021 |
T4020 |
agent |
by,caused |
| R2748 |
T4022 |
T4021 |
pobj |
deH,by |
| R2749 |
T4023 |
T3983 |
punct |
.,is |
| R2750 |
T4025 |
T4026 |
aux |
To,investigate |
| R2751 |
T4026 |
T4027 |
advcl |
investigate,examined |
| R2752 |
T4028 |
T4029 |
mark |
whether,affects |
| R2753 |
T4029 |
T4026 |
ccomp |
affects,investigate |
| R2754 |
T4030 |
T4029 |
nsubj |
deH,affects |
| R2755 |
T4031 |
T4032 |
amod |
other,characteristics |
| R2757 |
T4033 |
T4032 |
amod |
dorsoventral,characteristics |
| R2758 |
T4034 |
T4032 |
compound |
skin,characteristics |
| R2759 |
T4035 |
T4032 |
prep |
besides,characteristics |
| R2760 |
T4036 |
T4037 |
compound |
pigment,type |
| R2761 |
T4037 |
T4035 |
pobj |
type,besides |
| R2762 |
T4038 |
T4037 |
punct |
-,type |
| R2763 |
T4039 |
T4037 |
amod |
switching,type |
| R2764 |
T4040 |
T4027 |
punct |
", ",examined |
| R2765 |
T4041 |
T4027 |
nsubj |
we,examined |
| R2766 |
T4042 |
T4043 |
poss |
its,effects |
| R2767 |
T4043 |
T4027 |
dobj |
effects,examined |
| R2768 |
T4044 |
T4043 |
prep |
on,effects |
| R2769 |
T4045 |
T4046 |
compound |
hair,length |
| R2770 |
T4046 |
T4044 |
pobj |
length,on |
| R2771 |
T4047 |
T4046 |
cc |
and,length |
| R2772 |
T4048 |
T4046 |
conj |
pigmentation,length |
| R2773 |
T4049 |
T4027 |
prep |
in,examined |
| R2774 |
T4050 |
T4051 |
det |
an,background |
| R2775 |
T4051 |
T4049 |
pobj |
background,in |
| R2776 |
T4052 |
T4053 |
compound |
ae,ae |
| R2777 |
T4053 |
T4051 |
compound |
ae,background |
| R2778 |
T4054 |
T4053 |
punct |
/,ae |
| R2779 |
T4055 |
T4027 |
punct |
.,examined |
| R2780 |
T4057 |
T4058 |
advmod |
Overall,causes |
| R2782 |
T4059 |
T4058 |
punct |
", ",causes |
| R2783 |
T4060 |
T4058 |
nsubj |
deH,causes |
| R2784 |
T4062 |
T4063 |
det |
a,reduction |
| R2785 |
T4063 |
T4058 |
dobj |
reduction,causes |
| R2786 |
T4064 |
T4063 |
amod |
small,reduction |
| R2787 |
T4065 |
T4064 |
cc |
but,small |
| R2788 |
T4066 |
T4064 |
conj |
consistent,small |
| R2789 |
T4067 |
T4063 |
prep |
in,reduction |
| R2790 |
T4068 |
T4069 |
compound |
hair,length |
| R2791 |
T4069 |
T4067 |
pobj |
length,in |
| R2792 |
T4070 |
T4058 |
prep |
in,causes |
| R2793 |
T4071 |
T4072 |
preconj |
both,dorsum |
| R2794 |
T4072 |
T4070 |
pobj |
dorsum,in |
| R2795 |
T4073 |
T4072 |
cc |
and,dorsum |
| R2796 |
T4074 |
T4072 |
conj |
ventrum,dorsum |
| R2797 |
T4075 |
T4061 |
punct |
;,is |
| R2798 |
T4076 |
T4077 |
advmod |
when,normalized |
| R2799 |
T4077 |
T4061 |
advcl |
normalized,is |
| R2800 |
T4078 |
T4079 |
amod |
mutant,animals |
| R2801 |
T4079 |
T4077 |
nsubjpass |
animals,normalized |
| R2802 |
T4080 |
T4078 |
cc |
and,mutant |
| R2803 |
T4081 |
T4078 |
conj |
nonmutant,mutant |
| R2804 |
T4082 |
T4077 |
auxpass |
are,normalized |
| R2805 |
T4083 |
T4077 |
prep |
for,normalized |
| R2806 |
T4084 |
T4085 |
compound |
body,circumference |
| R2807 |
T4085 |
T4083 |
pobj |
circumference,for |
| R2808 |
T4086 |
T4061 |
punct |
", ",is |
| R2809 |
T4087 |
T4088 |
amod |
reduced,length |
| R2810 |
T4088 |
T4061 |
nsubj |
length,is |
| R2811 |
T4089 |
T4088 |
compound |
hair,length |
| R2812 |
T4090 |
T4091 |
advmod |
most,apparent |
| R2813 |
T4091 |
T4061 |
acomp |
apparent,is |
| R2814 |
T4092 |
T4061 |
prep |
in,is |
| R2815 |
T4093 |
T4094 |
det |
the,region |
| R2816 |
T4094 |
T4092 |
pobj |
region,in |
| R2817 |
T4095 |
T4094 |
amod |
lateral,region |
| R2818 |
T4096 |
T4097 |
punct |
(,Figure |
| R2819 |
T4097 |
T4061 |
parataxis |
Figure,is |
| R2820 |
T4098 |
T4097 |
nummod |
2E,Figure |
| R2821 |
T4099 |
T4097 |
punct |
),Figure |
| R2822 |
T4100 |
T4061 |
punct |
.,is |
| R2823 |
T4102 |
T4103 |
amod |
Adult,animals |
| R2824 |
T4103 |
T4111 |
nsubj |
animals,exhibit |
| R2825 |
T4104 |
T4105 |
nmod |
ae,ae |
| R2826 |
T4105 |
T4103 |
nmod |
ae,animals |
| R2827 |
T4106 |
T4105 |
punct |
/,ae |
| R2828 |
T4107 |
T4105 |
punct |
;,ae |
| R2829 |
T4108 |
T4109 |
compound |
deH,deH |
| R2830 |
T4109 |
T4105 |
appos |
deH,ae |
| R2831 |
T4110 |
T4109 |
punct |
/,deH |
| R2832 |
T4112 |
T4113 |
compound |
body,size |
| R2833 |
T4113 |
T4115 |
compound |
size,reduction |
| R2834 |
T4114 |
T4113 |
punct |
-,size |
| R2835 |
T4115 |
T4111 |
dobj |
reduction,exhibit |
| R2836 |
T4116 |
T4115 |
cc |
and,reduction |
| R2837 |
T4117 |
T4118 |
amod |
skeletal,abnormalities |
| R2838 |
T4118 |
T4115 |
conj |
abnormalities,reduction |
| R2839 |
T4119 |
T4111 |
punct |
", ",exhibit |
| R2840 |
T4120 |
T4111 |
cc |
but,exhibit |
| R2841 |
T4121 |
T4111 |
conj |
display,exhibit |
| R2842 |
T4122 |
T4123 |
det |
no,phenotype |
| R2843 |
T4123 |
T4121 |
dobj |
phenotype,display |
| R2844 |
T4124 |
T4125 |
compound |
coat,color |
| R2845 |
T4125 |
T4123 |
compound |
color,phenotype |
| R2846 |
T4126 |
T4125 |
punct |
-,color |
| R2847 |
T4127 |
T4128 |
punct |
(,shown |
| R2849 |
T4129 |
T4128 |
nsubj |
data,shown |
| R2850 |
T4130 |
T4128 |
neg |
not,shown |
| R2851 |
T4131 |
T4128 |
punct |
),shown |
| R2852 |
T4132 |
T4111 |
punct |
.,exhibit |
| R2853 |
T4134 |
T4135 |
advmod |
However,are |
| R2854 |
T4136 |
T4135 |
punct |
", ",are |
| R2855 |
T4137 |
T4138 |
nmod |
ae,ae |
| R2856 |
T4138 |
T4140 |
nmod |
ae,neonates |
| R2857 |
T4139 |
T4138 |
punct |
/,ae |
| R2858 |
T4140 |
T4135 |
nsubj |
neonates,are |
| R2859 |
T4141 |
T4138 |
cc |
and,ae |
| R2860 |
T4142 |
T4143 |
nmod |
ae,ae |
| R2861 |
T4143 |
T4138 |
conj |
ae,ae |
| R2862 |
T4144 |
T4143 |
punct |
/,ae |
| R2863 |
T4145 |
T4143 |
punct |
;,ae |
| R2864 |
T4146 |
T4147 |
compound |
deH,deH |
| R2865 |
T4147 |
T4143 |
appos |
deH,ae |
| R2866 |
T4148 |
T4147 |
punct |
/,deH |
| R2867 |
T4149 |
T4135 |
advmod |
clearly,are |
| R2868 |
T4150 |
T4135 |
acomp |
distinguishable,are |
| R2869 |
T4151 |
T4135 |
prep |
in,are |
| R2870 |
T4152 |
T4153 |
det |
the,days |
| R2872 |
T4154 |
T4153 |
amod |
first,days |
| R2873 |
T4155 |
T4153 |
amod |
few,days |
| R2874 |
T4156 |
T4153 |
prep |
after,days |
| R2875 |
T4157 |
T4156 |
pobj |
birth,after |
| R2876 |
T4158 |
T4135 |
punct |
", ",are |
| R2877 |
T4159 |
T4160 |
advmod |
when,is |
| R2878 |
T4160 |
T4135 |
advcl |
is,are |
| R2879 |
T4161 |
T4162 |
det |
a,gradient |
| R2880 |
T4162 |
T4160 |
nsubj |
gradient,is |
| R2881 |
T4163 |
T4162 |
amod |
dorsoventral,gradient |
| R2882 |
T4164 |
T4162 |
prep |
of,gradient |
| R2883 |
T4165 |
T4166 |
amod |
melanogenic,activity |
| R2884 |
T4166 |
T4164 |
pobj |
activity,of |
| R2885 |
T4167 |
T4160 |
acomp |
apparent,is |
| R2886 |
T4168 |
T4160 |
prep |
under,is |
| R2887 |
T4169 |
T4170 |
det |
the,skin |
| R2888 |
T4170 |
T4168 |
pobj |
skin,under |
| R2889 |
T4171 |
T4172 |
punct |
(,Figure |
| R2890 |
T4172 |
T4135 |
parataxis |
Figure,are |
| R2891 |
T4173 |
T4172 |
nummod |
2D,Figure |
| R2892 |
T4174 |
T4172 |
punct |
),Figure |
| R2893 |
T4175 |
T4135 |
punct |
.,are |
| R2894 |
T4177 |
T4178 |
prep |
At,is |
| R2895 |
T4179 |
T4180 |
det |
this,stage |
| R2896 |
T4180 |
T4177 |
pobj |
stage,At |
| R2897 |
T4181 |
T4178 |
punct |
", ",is |
| R2898 |
T4182 |
T4183 |
compound |
melanoblast,migration |
| R2899 |
T4183 |
T4178 |
nsubj |
migration,is |
| R2900 |
T4184 |
T4183 |
prep |
from,migration |
| R2901 |
T4185 |
T4186 |
det |
the,crest |
| R2902 |
T4186 |
T4184 |
pobj |
crest,from |
| R2903 |
T4187 |
T4186 |
amod |
neural,crest |
| R2904 |
T4188 |
T4189 |
advmod |
mostly,complete |
| R2905 |
T4189 |
T4178 |
acomp |
complete,is |
| R2906 |
T4190 |
T4178 |
punct |
", ",is |
| R2907 |
T4191 |
T4178 |
cc |
but,is |
| R2908 |
T4192 |
T4193 |
expl |
there,is |
| R2909 |
T4193 |
T4178 |
conj |
is,is |
| R2910 |
T4194 |
T4195 |
det |
a,gradient |
| R2911 |
T4195 |
T4193 |
attr |
gradient,is |
| R2912 |
T4196 |
T4195 |
amod |
dorsoventral,gradient |
| R2913 |
T4197 |
T4195 |
prep |
in,gradient |
| R2914 |
T4198 |
T4199 |
compound |
melanocyte,differentiation |
| R2915 |
T4199 |
T4197 |
pobj |
differentiation,in |
| R2916 |
T4200 |
T4199 |
cc |
and,differentiation |
| R2917 |
T4201 |
T4202 |
compound |
pigment,synthesis |
| R2918 |
T4202 |
T4199 |
conj |
synthesis,differentiation |
| R2919 |
T4203 |
T4178 |
punct |
.,is |
| R2920 |
T4205 |
T4206 |
det |
The,skin |
| R2921 |
T4206 |
T4207 |
nsubj |
skin,appears |
| R2922 |
T4208 |
T4206 |
prep |
of,skin |
| R2923 |
T4209 |
T4210 |
compound |
ae,ae |
| R2924 |
T4210 |
T4212 |
compound |
ae,neonates |
| R2925 |
T4211 |
T4210 |
punct |
/,ae |
| R2926 |
T4212 |
T4208 |
pobj |
neonates,of |
| R2927 |
T4213 |
T4214 |
advmod |
uniformly,dark |
| R2928 |
T4214 |
T4207 |
oprd |
dark,appears |
| R2929 |
T4215 |
T4207 |
prep |
over,appears |
| R2930 |
T4216 |
T4217 |
det |
the,dorsum |
| R2931 |
T4217 |
T4215 |
pobj |
dorsum,over |
| R2932 |
T4218 |
T4217 |
amod |
entire,dorsum |
| R2933 |
T4219 |
T4207 |
punct |
", ",appears |
| R2934 |
T4220 |
T4207 |
cc |
but,appears |
| R2935 |
T4221 |
T4222 |
prep |
in,is |
| R2936 |
T4222 |
T4207 |
conj |
is,appears |
| R2937 |
T4223 |
T4224 |
nmod |
ae,ae |
| R2938 |
T4224 |
T4226 |
nmod |
ae,neonates |
| R2939 |
T4225 |
T4224 |
punct |
/,ae |
| R2940 |
T4226 |
T4221 |
pobj |
neonates,in |
| R2941 |
T4227 |
T4224 |
punct |
;,ae |
| R2942 |
T4228 |
T4229 |
compound |
deH,deH |
| R2943 |
T4229 |
T4224 |
appos |
deH,ae |
| R2944 |
T4230 |
T4229 |
punct |
/,deH |
| R2945 |
T4231 |
T4222 |
punct |
", ",is |
| R2946 |
T4232 |
T4233 |
det |
the,area |
| R2947 |
T4233 |
T4222 |
nsubj |
area,is |
| R2948 |
T4234 |
T4233 |
prep |
of,area |
| R2949 |
T4235 |
T4236 |
amod |
dark,skin |
| R2950 |
T4236 |
T4234 |
pobj |
skin,of |
| R2951 |
T4237 |
T4238 |
advmod |
more,restricted |
| R2952 |
T4238 |
T4222 |
acomp |
restricted,is |
| R2953 |
T4239 |
T4222 |
punct |
", ",is |
| R2954 |
T4240 |
T4241 |
advmod |
particularly,above |
| R2955 |
T4241 |
T4222 |
prep |
above,is |
| R2956 |
T4242 |
T4243 |
det |
the,limbs |
| R2957 |
T4243 |
T4241 |
pobj |
limbs,above |
| R2958 |
T4244 |
T4222 |
punct |
", ",is |
| R2959 |
T4245 |
T4222 |
cc |
and,is |
| R2960 |
T4246 |
T4222 |
conj |
resembles,is |
| R2961 |
T4247 |
T4248 |
det |
the,pattern |
| R2962 |
T4248 |
T4246 |
dobj |
pattern,resembles |
| R2963 |
T4249 |
T4248 |
prep |
of,pattern |
| R2964 |
T4250 |
T4251 |
amod |
dorsal,eumelanin |
| R2965 |
T4251 |
T4249 |
pobj |
eumelanin,of |
| R2966 |
T4252 |
T4248 |
prep |
in,pattern |
| R2967 |
T4253 |
T4254 |
nmod |
at,at |
| R2968 |
T4254 |
T4256 |
nmod |
at,animals |
| R2969 |
T4255 |
T4254 |
punct |
/,at |
| R2970 |
T4256 |
T4252 |
pobj |
animals,in |
| R2971 |
T4257 |
T4254 |
punct |
;,at |
| R2972 |
T4258 |
T4259 |
compound |
deH,deH |
| R2973 |
T4259 |
T4254 |
appos |
deH,at |
| R2974 |
T4260 |
T4259 |
punct |
/,deH |
| R2975 |
T4261 |
T4256 |
amod |
adult,animals |
| R2976 |
T4262 |
T4222 |
punct |
.,is |
| R2977 |
T4264 |
T4265 |
advcl |
Taken,suggest |
| R2978 |
T4266 |
T4264 |
advmod |
together,Taken |
| R2979 |
T4267 |
T4265 |
punct |
", ",suggest |
| R2980 |
T4268 |
T4269 |
det |
these,observations |
| R2981 |
T4269 |
T4265 |
nsubj |
observations,suggest |
| R2982 |
T4270 |
T4271 |
mark |
that,interferes |
| R2983 |
T4271 |
T4265 |
ccomp |
interferes,suggest |
| R2984 |
T4272 |
T4271 |
nsubj |
deH,interferes |
| R2985 |
T4273 |
T4271 |
prep |
with,interferes |
| R2986 |
T4274 |
T4275 |
det |
the,establishment |
| R2987 |
T4275 |
T4273 |
pobj |
establishment,with |
| R2988 |
T4276 |
T4275 |
prep |
of,establishment |
| R2989 |
T4277 |
T4278 |
amod |
dorsoventral,patterning |
| R2990 |
T4278 |
T4276 |
pobj |
patterning,of |
| R2991 |
T4279 |
T4271 |
prep |
during,interferes |
| R2992 |
T4280 |
T4281 |
compound |
skin,development |
| R2993 |
T4281 |
T4279 |
pobj |
development,during |
| R2994 |
T4282 |
T4271 |
prep |
by,interferes |
| R2995 |
T4283 |
T4282 |
pcomp |
causing,by |
| R2996 |
T4284 |
T4285 |
amod |
dorsal,expansion |
| R2997 |
T4285 |
T4283 |
dobj |
expansion,causing |
| R2998 |
T4286 |
T4285 |
prep |
of,expansion |
| R2999 |
T4287 |
T4288 |
det |
a,region |
| R3000 |
T4288 |
T4286 |
pobj |
region,of |
| R3001 |
T4289 |
T4288 |
amod |
lateral,region |
| R3002 |
T4290 |
T4291 |
dep |
that,is |
| R3003 |
T4291 |
T4288 |
relcl |
is,region |
| R3004 |
T4292 |
T4291 |
advmod |
normally,is |
| R3005 |
T4293 |
T4294 |
quantmod |
3,5 |
| R3006 |
T4294 |
T4296 |
nummod |
5,mm |
| R3007 |
T4295 |
T4294 |
punct |
–,5 |
| R3008 |
T4296 |
T4291 |
attr |
mm,is |
| R3009 |
T4297 |
T4296 |
prep |
in,mm |
| R3010 |
T4298 |
T4297 |
pobj |
width,in |
| R3011 |
T4299 |
T4265 |
punct |
.,suggest |
| R3012 |
T4301 |
T4302 |
det |
This,region |
| R3013 |
T4302 |
T4304 |
nsubj |
region,serve |
| R3014 |
T4303 |
T4302 |
amod |
same,region |
| R3015 |
T4305 |
T4304 |
aux |
may,serve |
| R3016 |
T4306 |
T4304 |
prep |
as,serve |
| R3017 |
T4307 |
T4308 |
det |
a,boundary |
| R3018 |
T4308 |
T4306 |
pobj |
boundary,as |
| R3019 |
T4309 |
T4308 |
prep |
between,boundary |
| R3020 |
T4310 |
T4311 |
amod |
dorsal,skin |
| R3022 |
T4312 |
T4310 |
cc |
and,dorsal |
| R3023 |
T4313 |
T4310 |
conj |
ventral,dorsal |
| R3024 |
T4314 |
T4304 |
prep |
by,serve |
| R3025 |
T4315 |
T4314 |
pcomp |
inhibiting,by |
| R3026 |
T4316 |
T4317 |
compound |
melanocyte,differentiation |
| R3027 |
T4317 |
T4315 |
dobj |
differentiation,inhibiting |
| R3028 |
T4318 |
T4314 |
punct |
", ",by |
| R3029 |
T4319 |
T4314 |
conj |
by,by |
| R3030 |
T4320 |
T4319 |
pcomp |
promoting,by |
| R3031 |
T4321 |
T4322 |
compound |
pheomelanin,synthesis |
| R3032 |
T4322 |
T4320 |
dobj |
synthesis,promoting |
| R3033 |
T4323 |
T4319 |
punct |
", ",by |
| R3034 |
T4324 |
T4319 |
cc |
and,by |
| R3035 |
T4325 |
T4319 |
conj |
by,by |
| R3036 |
T4326 |
T4325 |
pcomp |
supporting,by |
| R3037 |
T4327 |
T4328 |
det |
a,increase |
| R3038 |
T4328 |
T4326 |
dobj |
increase,supporting |
| R3039 |
T4329 |
T4328 |
amod |
progressive,increase |
| R3040 |
T4330 |
T4328 |
prep |
in,increase |
| R3041 |
T4331 |
T4332 |
compound |
hair,growth |
| R3042 |
T4332 |
T4330 |
pobj |
growth,in |
| R3043 |
T4333 |
T4328 |
prep |
from,increase |
| R3044 |
T4334 |
T4333 |
pobj |
ventrum,from |
| R3045 |
T4335 |
T4328 |
prep |
to,increase |
| R3046 |
T4336 |
T4335 |
pobj |
dorsum,to |
| R3047 |
T4337 |
T4304 |
punct |
.,serve |
| R3048 |
T4339 |
T4340 |
mark |
As,described |
| R3049 |
T4340 |
T4341 |
advcl |
described,expressed |
| R3050 |
T4342 |
T4340 |
advmod |
below,described |
| R3051 |
T4343 |
T4341 |
punct |
", ",expressed |
| R3052 |
T4344 |
T4345 |
det |
the,gene |
| R3053 |
T4345 |
T4341 |
nsubjpass |
gene,expressed |
| R3054 |
T4346 |
T4345 |
amod |
defective,gene |
| R3055 |
T4347 |
T4346 |
prep |
in,defective |
| R3056 |
T4348 |
T4347 |
pobj |
deH,in |
| R3057 |
T4349 |
T4345 |
punct |
", ",gene |
| R3058 |
T4350 |
T4345 |
appos |
Tbx15,gene |
| R3059 |
T4351 |
T4341 |
punct |
", ",expressed |
| R3060 |
T4352 |
T4341 |
auxpass |
is,expressed |
| R3061 |
T4353 |
T4341 |
advmod |
normally,expressed |
| R3062 |
T4354 |
T4341 |
prep |
in,expressed |
| R3063 |
T4355 |
T4356 |
det |
the,region |
| R3064 |
T4356 |
T4354 |
pobj |
region,in |
| R3065 |
T4357 |
T4356 |
amod |
dorsal,region |
| R3066 |
T4358 |
T4341 |
cc |
and,expressed |
| R3067 |
T4359 |
T4360 |
advmod |
therefore,is |
| R3068 |
T4360 |
T4341 |
conj |
is,expressed |
| R3069 |
T4361 |
T4360 |
acomp |
likely,is |
| R3070 |
T4362 |
T4363 |
aux |
to,play |
| R3071 |
T4363 |
T4361 |
xcomp |
play,likely |
| R3072 |
T4364 |
T4365 |
det |
a,role |
| R3073 |
T4365 |
T4363 |
dobj |
role,play |
| R3074 |
T4366 |
T4363 |
prep |
in,play |
| R3075 |
T4367 |
T4366 |
pcomp |
establishing,in |
| R3076 |
T4368 |
T4369 |
det |
the,size |
| R3077 |
T4369 |
T4367 |
dobj |
size,establishing |
| R3078 |
T4370 |
T4369 |
cc |
and,size |
| R3079 |
T4371 |
T4372 |
amod |
dorsal,extent |
| R3080 |
T4372 |
T4369 |
conj |
extent,size |
| R3081 |
T4373 |
T4369 |
prep |
of,size |
| R3082 |
T4374 |
T4375 |
det |
the,region |
| R3083 |
T4375 |
T4373 |
pobj |
region,of |
| R3084 |
T4376 |
T4375 |
amod |
lateral,region |
| R3085 |
T4377 |
T4341 |
punct |
.,expressed |
| R3088 |
T4613 |
T4614 |
amod |
Positional,Cloning |
| R3089 |
T4615 |
T4614 |
prep |
of,Cloning |
| R3090 |
T4616 |
T4615 |
pobj |
deH,of |
| R3091 |
T4618 |
T4619 |
prep |
As,identified |
| R3092 |
T4620 |
T4621 |
det |
a,marker |
| R3093 |
T4621 |
T4618 |
pobj |
marker,As |
| R3094 |
T4622 |
T4621 |
amod |
visible,marker |
| R3095 |
T4623 |
T4619 |
punct |
", ",identified |
| R3096 |
T4624 |
T4625 |
amod |
early,studies |
| R3097 |
T4625 |
T4619 |
nsubj |
studies,identified |
| R3098 |
T4626 |
T4625 |
compound |
linkage,studies |
| R3099 |
T4627 |
T4625 |
prep |
with,studies |
| R3100 |
T4628 |
T4629 |
det |
the,allele |
| R3101 |
T4629 |
T4627 |
pobj |
allele,with |
| R3102 |
T4630 |
T4629 |
amod |
original,allele |
| R3103 |
T4631 |
T4632 |
amod |
droopy,ear |
| R3104 |
T4632 |
T4629 |
compound |
ear,allele |
| R3105 |
T4633 |
T4629 |
cc |
or,allele |
| R3106 |
T4634 |
T4635 |
det |
the,allele |
| R3107 |
T4635 |
T4629 |
conj |
allele,allele |
| R3108 |
T4636 |
T4635 |
compound |
deH,allele |
| R3109 |
T4637 |
T4638 |
det |
a,position |
| R3110 |
T4638 |
T4619 |
dobj |
position,identified |
| R3111 |
T4639 |
T4638 |
compound |
map,position |
| R3112 |
T4640 |
T4638 |
prep |
in,position |
| R3113 |
T4641 |
T4642 |
det |
the,middle |
| R3114 |
T4642 |
T4640 |
pobj |
middle,in |
| R3115 |
T4643 |
T4642 |
prep |
of,middle |
| R3116 |
T4644 |
T4643 |
pobj |
Chromosome,of |
| R3117 |
T4645 |
T4644 |
nummod |
3,Chromosome |
| R3118 |
T4646 |
T4638 |
punct |
", ",position |
| R3119 |
T4647 |
T4638 |
amod |
distal,position |
| R3120 |
T4648 |
T4647 |
prep |
to,distal |
| R3121 |
T4649 |
T4648 |
amod |
matted,to |
| R3122 |
T4650 |
T4647 |
cc |
and,distal |
| R3123 |
T4651 |
T4647 |
conj |
proximal,distal |
| R3124 |
T4652 |
T4651 |
prep |
to,proximal |
| R3125 |
T4653 |
T4654 |
compound |
Varitint,waddler |
| R3126 |
T4654 |
T4652 |
pobj |
waddler,to |
| R3127 |
T4655 |
T4654 |
punct |
-,waddler |
| R3128 |
T4656 |
T4657 |
punct |
(,Carter |
| R3129 |
T4657 |
T4619 |
meta |
Carter,identified |
| R3130 |
T4658 |
T4657 |
cc |
and,Carter |
| R3131 |
T4659 |
T4657 |
conj |
Falconer,Carter |
| R3132 |
T4660 |
T4659 |
nummod |
1951,Falconer |
| R3133 |
T4661 |
T4659 |
punct |
;,Falconer |
| R3134 |
T4662 |
T4659 |
conj |
Curry,Falconer |
| R3135 |
T4663 |
T4662 |
nummod |
1959,Curry |
| R3136 |
T4664 |
T4662 |
punct |
;,Curry |
| R3137 |
T4665 |
T4662 |
conj |
Lane,Curry |
| R3138 |
T4666 |
T4665 |
cc |
and,Lane |
| R3139 |
T4667 |
T4665 |
conj |
Eicher,Lane |
| R3140 |
T4668 |
T4667 |
nummod |
1979,Eicher |
| R3141 |
T4669 |
T4667 |
punct |
;,Eicher |
| R3142 |
T4670 |
T4667 |
conj |
Holmes,Eicher |
| R3143 |
T4671 |
T4670 |
nmod |
et,Holmes |
| R3144 |
T4672 |
T4670 |
nmod |
al.,Holmes |
| R3145 |
T4673 |
T4670 |
nummod |
1981,Holmes |
| R3146 |
T4674 |
T4670 |
punct |
),Holmes |
| R3147 |
T4675 |
T4619 |
punct |
.,identified |
| R3148 |
T4677 |
T4678 |
nsubj |
We,used |
| R3149 |
T4679 |
T4680 |
det |
an,intercross |
| R3150 |
T4680 |
T4678 |
dobj |
intercross,used |
| R3151 |
T4681 |
T4680 |
compound |
F2,intercross |
| R3152 |
T4682 |
T4680 |
prep |
with,intercross |
| R3153 |
T4683 |
T4684 |
compound |
CAST,Ei |
| R3154 |
T4684 |
T4686 |
compound |
Ei,mice |
| R3155 |
T4685 |
T4684 |
punct |
/,Ei |
| R3156 |
T4686 |
T4682 |
pobj |
mice,with |
| R3157 |
T4687 |
T4688 |
aux |
to,localize |
| R3158 |
T4688 |
T4678 |
advcl |
localize,used |
| R3159 |
T4689 |
T4688 |
dobj |
deH,localize |
| R3160 |
T4690 |
T4688 |
prep |
to,localize |
| R3161 |
T4691 |
T4692 |
det |
a,interval |
| R3162 |
T4692 |
T4690 |
pobj |
interval,to |
| R3163 |
T4693 |
T4694 |
nummod |
0.1,cM |
| R3164 |
T4694 |
T4692 |
compound |
cM,interval |
| R3165 |
T4695 |
T4692 |
prep |
between,interval |
| R3166 |
T4696 |
T4695 |
pobj |
D3Mit213,between |
| R3167 |
T4697 |
T4696 |
cc |
and,D3Mit213 |
| R3168 |
T4698 |
T4696 |
conj |
16.MMHAP32FLF1,D3Mit213 |
| R3169 |
T4699 |
T4692 |
punct |
", ",interval |
| R3170 |
T4700 |
T4701 |
dep |
which,refined |
| R3171 |
T4701 |
T4692 |
relcl |
refined,interval |
| R3172 |
T4702 |
T4701 |
auxpass |
was,refined |
| R3173 |
T4703 |
T4701 |
prep |
by,refined |
| R3174 |
T4704 |
T4703 |
pobj |
development,by |
| R3175 |
T4705 |
T4704 |
prep |
of,development |
| R3176 |
T4706 |
T4707 |
det |
a,contig |
| R3177 |
T4707 |
T4705 |
pobj |
contig,of |
| R3178 |
T4708 |
T4709 |
amod |
bacterial,chromosome |
| R3179 |
T4709 |
T4707 |
nmod |
chromosome,contig |
| R3180 |
T4710 |
T4709 |
amod |
artificial,chromosome |
| R3181 |
T4711 |
T4709 |
punct |
(,chromosome |
| R3182 |
T4712 |
T4709 |
appos |
BAC,chromosome |
| R3183 |
T4713 |
T4707 |
punct |
),contig |
| R3184 |
T4714 |
T4707 |
cc |
and,contig |
| R3185 |
T4715 |
T4716 |
amod |
additional,markers |
| R3186 |
T4716 |
T4707 |
conj |
markers,contig |
| R3187 |
T4717 |
T4716 |
prep |
to,markers |
| R3188 |
T4718 |
T4719 |
det |
a,region |
| R3189 |
T4719 |
T4717 |
pobj |
region,to |
| R3190 |
T4720 |
T4721 |
nummod |
1.4,Mb |
| R3191 |
T4721 |
T4719 |
compound |
Mb,region |
| R3192 |
T4722 |
T4723 |
dep |
that,contained |
| R3193 |
T4723 |
T4719 |
relcl |
contained,region |
| R3194 |
T4724 |
T4725 |
nummod |
eight,genes |
| R3195 |
T4725 |
T4723 |
dobj |
genes,contained |
| R3196 |
T4726 |
T4725 |
punct |
", ",genes |
| R3197 |
T4727 |
T4725 |
prep |
including,genes |
| R3198 |
T4728 |
T4727 |
pobj |
Tbx15,including |
| R3199 |
T4729 |
T4730 |
punct |
(,Figure |
| R3200 |
T4730 |
T4688 |
parataxis |
Figure,localize |
| R3201 |
T4731 |
T4730 |
nummod |
3A,Figure |
| R3202 |
T4732 |
T4730 |
punct |
),Figure |
| R3203 |
T4733 |
T4678 |
punct |
.,used |
| R3204 |
T4735 |
T4736 |
nsubj |
We,considered |
| R3205 |
T4737 |
T4736 |
dobj |
Tbx15,considered |
| R3206 |
T4738 |
T4736 |
prep |
as,considered |
| R3207 |
T4739 |
T4740 |
det |
an,candidate |
| R3208 |
T4740 |
T4738 |
pobj |
candidate,as |
| R3209 |
T4741 |
T4740 |
amod |
excellent,candidate |
| R3210 |
T4742 |
T4740 |
prep |
for,candidate |
| R3211 |
T4743 |
T4744 |
det |
the,abnormalities |
| R3212 |
T4744 |
T4742 |
pobj |
abnormalities,for |
| R3213 |
T4745 |
T4744 |
amod |
skeletal,abnormalities |
| R3214 |
T4746 |
T4744 |
acl |
caused,abnormalities |
| R3215 |
T4747 |
T4746 |
agent |
by,caused |
| R3216 |
T4748 |
T4747 |
pobj |
deH,by |
| R3217 |
T4749 |
T4736 |
punct |
", ",considered |
| R3218 |
T4750 |
T4736 |
prep |
based,considered |
| R3219 |
T4751 |
T4750 |
prep |
on,based |
| R3220 |
T4752 |
T4751 |
pobj |
studies,on |
| R3221 |
T4753 |
T4752 |
prep |
by,studies |
| R3222 |
T4754 |
T4753 |
pobj |
Agulnik,by |
| R3223 |
T4755 |
T4756 |
advmod |
et,al. |
| R3224 |
T4756 |
T4754 |
advmod |
al.,Agulnik |
| R3225 |
T4757 |
T4754 |
punct |
(,Agulnik |
| R3226 |
T4758 |
T4754 |
npadvmod |
1998,Agulnik |
| R3227 |
T4759 |
T4754 |
punct |
),Agulnik |
| R3228 |
T4760 |
T4754 |
punct |
", ",Agulnik |
| R3229 |
T4761 |
T4762 |
dep |
who,described |
| R3230 |
T4762 |
T4754 |
relcl |
described,Agulnik |
| R3231 |
T4763 |
T4764 |
poss |
its,expression |
| R3232 |
T4764 |
T4762 |
dobj |
expression,described |
| R3233 |
T4765 |
T4764 |
amod |
embryonic,expression |
| R3234 |
T4766 |
T4764 |
prep |
in,expression |
| R3235 |
T4767 |
T4768 |
det |
the,region |
| R3236 |
T4768 |
T4766 |
pobj |
region,in |
| R3237 |
T4769 |
T4768 |
amod |
craniofacial,region |
| R3238 |
T4770 |
T4768 |
cc |
and,region |
| R3239 |
T4771 |
T4772 |
amod |
developing,limbs |
| R3240 |
T4772 |
T4768 |
conj |
limbs,region |
| R3241 |
T4773 |
T4736 |
punct |
.,considered |
| R3242 |
T4775 |
T4776 |
advcl |
Using,found |
| R3243 |
T4777 |
T4778 |
compound |
sequence,information |
| R3244 |
T4778 |
T4775 |
dobj |
information,Using |
| R3245 |
T4779 |
T4778 |
prep |
from,information |
| R3246 |
T4780 |
T4779 |
pobj |
Agulnik,from |
| R3247 |
T4781 |
T4782 |
advmod |
et,al. |
| R3248 |
T4782 |
T4780 |
advmod |
al.,Agulnik |
| R3249 |
T4783 |
T4780 |
punct |
(,Agulnik |
| R3250 |
T4784 |
T4780 |
npadvmod |
1998,Agulnik |
| R3251 |
T4785 |
T4780 |
punct |
),Agulnik |
| R3252 |
T4786 |
T4778 |
cc |
and,information |
| R3253 |
T4787 |
T4788 |
det |
the,sequence |
| R3255 |
T4789 |
T4790 |
advmod |
partially,completed |
| R3256 |
T4790 |
T4788 |
amod |
completed,sequence |
| R3257 |
T4791 |
T4792 |
compound |
mouse,genome |
| R3258 |
T4792 |
T4788 |
compound |
genome,sequence |
| R3259 |
T4793 |
T4776 |
punct |
", ",found |
| R3260 |
T4794 |
T4776 |
nsubj |
we,found |
| R3261 |
T4795 |
T4796 |
mark |
that,amplified |
| R3262 |
T4796 |
T4776 |
ccomp |
amplified,found |
| R3263 |
T4797 |
T4796 |
nsubjpass |
portions,amplified |
| R3264 |
T4798 |
T4797 |
prep |
of,portions |
| R3265 |
T4799 |
T4800 |
amod |
several,exons |
| R3266 |
T4800 |
T4798 |
pobj |
exons,of |
| R3267 |
T4801 |
T4800 |
compound |
Tbx15,exons |
| R3268 |
T4802 |
T4796 |
aux |
could,amplified |
| R3269 |
T4803 |
T4796 |
neg |
not,amplified |
| R3270 |
T4804 |
T4796 |
auxpass |
be,amplified |
| R3271 |
T4805 |
T4796 |
prep |
from,amplified |
| R3272 |
T4806 |
T4807 |
nmod |
deH,deH |
| R3273 |
T4807 |
T4809 |
nmod |
deH,DNA |
| R3274 |
T4808 |
T4807 |
punct |
/,deH |
| R3275 |
T4809 |
T4805 |
pobj |
DNA,from |
| R3276 |
T4810 |
T4809 |
amod |
genomic,DNA |
| R3277 |
T4811 |
T4776 |
punct |
.,found |
| R3278 |
T4813 |
T4814 |
det |
The,gene |
| R3279 |
T4814 |
T4816 |
nsubjpass |
gene,referred |
| R3280 |
T4815 |
T4814 |
amod |
same,gene |
| R3281 |
T4817 |
T4816 |
auxpass |
was,referred |
| R3282 |
T4818 |
T4816 |
advmod |
initially,referred |
| R3283 |
T4819 |
T4816 |
prep |
to,referred |
| R3284 |
T4820 |
T4816 |
prep |
as,referred |
| R3285 |
T4821 |
T4820 |
pobj |
Tbx8,as |
| R3286 |
T4822 |
T4823 |
punct |
(,Wattler |
| R3287 |
T4823 |
T4816 |
meta |
Wattler,referred |
| R3288 |
T4824 |
T4823 |
nmod |
et,Wattler |
| R3289 |
T4825 |
T4823 |
nmod |
al.,Wattler |
| R3290 |
T4826 |
T4823 |
nummod |
1998,Wattler |
| R3291 |
T4827 |
T4823 |
punct |
),Wattler |
| R3292 |
T4828 |
T4816 |
cc |
and,referred |
| R3293 |
T4829 |
T4830 |
advmod |
then,renamed |
| R3294 |
T4830 |
T4816 |
conj |
renamed,referred |
| R3295 |
T4831 |
T4830 |
advmod |
later,renamed |
| R3296 |
T4832 |
T4830 |
oprd |
Tbx14,renamed |
| R3297 |
T4833 |
T4830 |
punct |
", ",renamed |
| R3298 |
T4834 |
T4830 |
cc |
but,renamed |
| R3299 |
T4835 |
T4836 |
auxpass |
is,referred |
| R3300 |
T4836 |
T4830 |
conj |
referred,renamed |
| R3301 |
T4837 |
T4836 |
advmod |
currently,referred |
| R3302 |
T4838 |
T4836 |
prep |
to,referred |
| R3303 |
T4839 |
T4836 |
prep |
in,referred |
| R3304 |
T4840 |
T4841 |
amod |
several,genomes |
| R3305 |
T4841 |
T4839 |
pobj |
genomes,in |
| R3306 |
T4842 |
T4841 |
compound |
vertebrate,genomes |
| R3307 |
T4843 |
T4836 |
prep |
as,referred |
| R3308 |
T4844 |
T4843 |
pobj |
Tbx15,as |
| R3309 |
T4845 |
T4846 |
punct |
(,Agulnik |
| R3310 |
T4846 |
T4836 |
meta |
Agulnik,referred |
| R3311 |
T4847 |
T4846 |
nmod |
et,Agulnik |
| R3312 |
T4848 |
T4846 |
nmod |
al.,Agulnik |
| R3313 |
T4849 |
T4846 |
nummod |
1998,Agulnik |
| R3314 |
T4850 |
T4846 |
punct |
;,Agulnik |
| R3315 |
T4851 |
T4846 |
nmod |
Begemann,Agulnik |
| R3316 |
T4852 |
T4846 |
nmod |
et,Agulnik |
| R3317 |
T4853 |
T4846 |
nmod |
al.,Agulnik |
| R3318 |
T4854 |
T4846 |
nummod |
2002,Agulnik |
| R3319 |
T4855 |
T4846 |
punct |
),Agulnik |
| R3320 |
T4856 |
T4816 |
punct |
.,referred |
| R3321 |
T4858 |
T4859 |
prep |
By,identified |
| R3322 |
T4860 |
T4858 |
pcomp |
comparing,By |
| R3323 |
T4861 |
T4862 |
det |
the,sequence |
| R3324 |
T4862 |
T4860 |
dobj |
sequence,comparing |
| R3325 |
T4863 |
T4862 |
prep |
of,sequence |
| R3326 |
T4864 |
T4865 |
det |
a,fragment |
| R3327 |
T4865 |
T4863 |
pobj |
fragment,of |
| R3328 |
T4866 |
T4867 |
nummod |
1.3,kb |
| R3329 |
T4867 |
T4868 |
compound |
kb,junction |
| R3330 |
T4868 |
T4865 |
compound |
junction,fragment |
| R3331 |
T4869 |
T4865 |
acl |
amplified,fragment |
| R3332 |
T4870 |
T4869 |
prep |
from,amplified |
| R3333 |
T4871 |
T4872 |
nmod |
deH,deH |
| R3334 |
T4872 |
T4874 |
nmod |
deH,DNA |
| R3335 |
T4873 |
T4872 |
punct |
/,deH |
| R3336 |
T4874 |
T4870 |
pobj |
DNA,from |
| R3337 |
T4875 |
T4874 |
amod |
genomic,DNA |
| R3338 |
T4876 |
T4860 |
prep |
to,comparing |
| R3339 |
T4877 |
T4878 |
advmod |
publicly,available |
| R3340 |
T4878 |
T4879 |
amod |
available,sequence |
| R3341 |
T4879 |
T4876 |
pobj |
sequence,to |
| R3342 |
T4880 |
T4881 |
compound |
mouse,genome |
| R3343 |
T4881 |
T4879 |
compound |
genome,sequence |
| R3344 |
T4882 |
T4859 |
punct |
", ",identified |
| R3345 |
T4883 |
T4859 |
nsubj |
we,identified |
| R3346 |
T4884 |
T4885 |
det |
a,deletion |
| R3347 |
T4885 |
T4859 |
dobj |
deletion,identified |
| R3348 |
T4886 |
T4887 |
nummod |
216,kb |
| R3349 |
T4887 |
T4885 |
compound |
kb,deletion |
| R3350 |
T4888 |
T4889 |
dep |
that,extends |
| R3351 |
T4889 |
T4885 |
relcl |
extends,deletion |
| R3352 |
T4890 |
T4889 |
prep |
from,extends |
| R3353 |
T4891 |
T4892 |
compound |
Tbx15,intron |
| R3354 |
T4892 |
T4890 |
pobj |
intron,from |
| R3355 |
T4893 |
T4892 |
nummod |
1,intron |
| R3356 |
T4894 |
T4889 |
prep |
to,extends |
| R3357 |
T4895 |
T4896 |
nummod |
148,kb |
| R3358 |
T4896 |
T4897 |
npadvmod |
kb,downstream |
| R3359 |
T4897 |
T4894 |
pcomp |
downstream,to |
| R3360 |
T4898 |
T4897 |
prep |
of,downstream |
| R3361 |
T4899 |
T4900 |
det |
the,sequence |
| R3362 |
T4900 |
T4898 |
pobj |
sequence,of |
| R3363 |
T4901 |
T4900 |
compound |
polyadenylation,sequence |
| R3364 |
T4902 |
T4900 |
prep |
in,sequence |
| R3365 |
T4903 |
T4904 |
det |
a,region |
| R3366 |
T4904 |
T4902 |
pobj |
region,in |
| R3367 |
T4905 |
T4904 |
acl |
annotated,region |
| R3368 |
T4906 |
T4905 |
prep |
as,annotated |
| R3369 |
T4907 |
T4908 |
det |
a,pseudogene |
| R3370 |
T4908 |
T4906 |
pobj |
pseudogene,as |
| R3371 |
T4909 |
T4910 |
nmod |
mannose,phosphate |
| R3372 |
T4910 |
T4914 |
compound |
phosphate,receptor |
| R3373 |
T4911 |
T4910 |
punct |
-,phosphate |
| R3374 |
T4912 |
T4910 |
nummod |
6,phosphate |
| R3375 |
T4913 |
T4910 |
punct |
-,phosphate |
| R3376 |
T4914 |
T4908 |
compound |
receptor,pseudogene |
| R3377 |
T4915 |
T4908 |
punct |
", ",pseudogene |
| R3378 |
T4916 |
T4917 |
compound |
M6pr,ps |
| R3379 |
T4917 |
T4908 |
appos |
ps,pseudogene |
| R3380 |
T4918 |
T4917 |
punct |
-,ps |
| R3381 |
T4919 |
T4920 |
punct |
(,3B |
| R3382 |
T4920 |
T4859 |
parataxis |
3B,identified |
| R3383 |
T4921 |
T4920 |
nmod |
Figure,3B |
| R3384 |
T4922 |
T4920 |
cc |
and,3B |
| R3385 |
T4923 |
T4920 |
conj |
3C,3B |
| R3386 |
T4924 |
T4920 |
punct |
),3B |
| R3387 |
T4925 |
T4859 |
punct |
.,identified |
| R3388 |
T4927 |
T4928 |
punct |
(,Ludwig |
| R3389 |
T4929 |
T4928 |
nmod |
et,Ludwig |
| R3390 |
T4930 |
T4928 |
nmod |
al.,Ludwig |
| R3391 |
T4931 |
T4928 |
nummod |
1992,Ludwig |
| R3392 |
T4932 |
T4928 |
punct |
),Ludwig |
| R3393 |
T4933 |
T4928 |
punct |
.,Ludwig |
| R3394 |
T4935 |
T4936 |
prep |
By,identified |
| R3395 |
T4937 |
T4938 |
compound |
Northern,blot |
| R3396 |
T4938 |
T4939 |
compound |
blot,analysis |
| R3397 |
T4939 |
T4935 |
pobj |
analysis,By |
| R3398 |
T4940 |
T4936 |
punct |
", ",identified |
| R3399 |
T4941 |
T4936 |
nsubj |
we,identified |
| R3400 |
T4942 |
T4943 |
det |
a,transcript |
| R3401 |
T4943 |
T4936 |
dobj |
transcript,identified |
| R3402 |
T4944 |
T4943 |
compound |
fusion,transcript |
| R3403 |
T4945 |
T4943 |
acl |
produced,transcript |
| R3404 |
T4946 |
T4945 |
prep |
from,produced |
| R3405 |
T4947 |
T4948 |
det |
the,chromosome |
| R3406 |
T4948 |
T4946 |
pobj |
chromosome,from |
| R3407 |
T4949 |
T4948 |
compound |
deH,chromosome |
| R3408 |
T4950 |
T4951 |
punct |
(,shown |
| R3409 |
T4951 |
T4936 |
parataxis |
shown,identified |
| R3410 |
T4952 |
T4951 |
nsubj |
data,shown |
| R3411 |
T4953 |
T4951 |
neg |
not,shown |
| R3412 |
T4954 |
T4951 |
punct |
),shown |
| R3413 |
T4955 |
T4936 |
punct |
.,identified |
| R3414 |
T4957 |
T4958 |
advmod |
However,removes |
| R3415 |
T4959 |
T4958 |
punct |
", ",removes |
| R3416 |
T4960 |
T4961 |
det |
the,deletion |
| R3417 |
T4961 |
T4958 |
nsubj |
deletion,removes |
| R3418 |
T4962 |
T4963 |
quantmod |
534,602 |
| R3419 |
T4963 |
T4966 |
nummod |
602,acids |
| R3420 |
T4964 |
T4963 |
quantmod |
of,602 |
| R3421 |
T4965 |
T4963 |
quantmod |
the,602 |
| R3422 |
T4966 |
T4958 |
dobj |
acids,removes |
| R3423 |
T4967 |
T4966 |
compound |
amino,acids |
| R3424 |
T4968 |
T4966 |
acl |
encoded,acids |
| R3425 |
T4969 |
T4968 |
agent |
by,encoded |
| R3426 |
T4970 |
T4969 |
pobj |
Tbx15,by |
| R3427 |
T4971 |
T4966 |
punct |
(,acids |
| R3428 |
T4972 |
T4966 |
prep |
including,acids |
| R3429 |
T4973 |
T4974 |
det |
the,domain |
| R3430 |
T4974 |
T4972 |
pobj |
domain,including |
| R3431 |
T4975 |
T4976 |
nmod |
T,box |
| R3432 |
T4976 |
T4974 |
nmod |
box,domain |
| R3433 |
T4977 |
T4976 |
punct |
-,box |
| R3434 |
T4978 |
T4979 |
npadvmod |
DNA,binding |
| R3435 |
T4979 |
T4974 |
amod |
binding,domain |
| R3436 |
T4980 |
T4979 |
punct |
-,binding |
| R3437 |
T4981 |
T4958 |
punct |
),removes |
| R3438 |
T4982 |
T4958 |
punct |
", ",removes |
| R3439 |
T4983 |
T4984 |
nmod |
deH,animals |
| R3440 |
T4984 |
T4987 |
nsubj |
animals,are |
| R3441 |
T4985 |
T4983 |
punct |
/,deH |
| R3442 |
T4986 |
T4983 |
punct |
+,deH |
| R3443 |
T4987 |
T4958 |
conj |
are,removes |
| R3444 |
T4988 |
T4989 |
advmod |
grossly,normal |
| R3445 |
T4989 |
T4987 |
acomp |
normal,are |
| R3446 |
T4990 |
T4987 |
punct |
", ",are |
| R3447 |
T4991 |
T4987 |
cc |
and,are |
| R3448 |
T4992 |
T4993 |
det |
the,phenotype |
| R3449 |
T4993 |
T4994 |
nsubj |
phenotype,is |
| R3450 |
T4994 |
T4987 |
conj |
is,are |
| R3451 |
T4995 |
T4993 |
prep |
of,phenotype |
| R3452 |
T4996 |
T4997 |
compound |
deH,deH |
| R3453 |
T4997 |
T4999 |
compound |
deH,animals |
| R3454 |
T4998 |
T4997 |
punct |
/,deH |
| R3455 |
T4999 |
T4995 |
pobj |
animals,of |
| R3456 |
T5000 |
T4994 |
acomp |
identical,is |
| R3457 |
T5001 |
T5000 |
prep |
to,identical |
| R3458 |
T5002 |
T5001 |
pobj |
that,to |
| R3459 |
T5003 |
T5002 |
acl |
described,that |
| R3460 |
T5004 |
T5003 |
prep |
for,described |
| R3461 |
T5005 |
T5006 |
det |
the,allele |
| R3462 |
T5006 |
T5004 |
pobj |
allele,for |
| R3463 |
T5007 |
T5006 |
amod |
original,allele |
| R3464 |
T5008 |
T4994 |
punct |
.,is |
| R3465 |
T5010 |
T5011 |
prep |
In,annotated |
| R3466 |
T5012 |
T5010 |
pobj |
addition,In |
| R3467 |
T5013 |
T5011 |
punct |
", ",annotated |
| R3468 |
T5014 |
T5011 |
amod |
other,annotated |
| R3469 |
T5015 |
T5014 |
prep |
than,other |
| R3470 |
T5016 |
T5017 |
compound |
M6pr,ps |
| R3471 |
T5017 |
T5015 |
pobj |
ps,than |
| R3472 |
T5018 |
T5017 |
punct |
-,ps |
| R3473 |
T5019 |
T5011 |
punct |
", ",annotated |
| R3474 |
T5020 |
T5021 |
det |
no,genes |
| R3475 |
T5021 |
T5011 |
nsubjpass |
genes,annotated |
| R3476 |
T5022 |
T5021 |
amod |
other,genes |
| R3477 |
T5023 |
T5021 |
cc |
or,genes |
| R3478 |
T5024 |
T5021 |
conj |
transcripts,genes |
| R3479 |
T5025 |
T5011 |
aux |
have,annotated |
| R3480 |
T5026 |
T5011 |
auxpass |
been,annotated |
| R3481 |
T5027 |
T5011 |
prep |
to,annotated |
| R3482 |
T5028 |
T5029 |
det |
the,deletion |
| R3483 |
T5029 |
T5027 |
pobj |
deletion,to |
| R3484 |
T5030 |
T5031 |
nummod |
216,kb |
| R3485 |
T5031 |
T5029 |
compound |
kb,deletion |
| R3486 |
T5032 |
T5011 |
punct |
.,annotated |
| R3487 |
T5034 |
T5035 |
mark |
While,was |
| R3489 |
T5036 |
T5037 |
det |
the,work |
| R3490 |
T5037 |
T5035 |
nsubj |
work,was |
| R3491 |
T5038 |
T5037 |
amod |
positional,work |
| R3492 |
T5039 |
T5037 |
compound |
cloning,work |
| R3493 |
T5041 |
T5035 |
advmod |
underway,was |
| R3494 |
T5042 |
T5040 |
punct |
", ",generated |
| R3495 |
T5043 |
T5040 |
nsubj |
one,generated |
| R3496 |
T5044 |
T5043 |
prep |
of,one |
| R3497 |
T5045 |
T5044 |
pobj |
us,of |
| R3498 |
T5046 |
T5043 |
punct |
(,one |
| R3499 |
T5047 |
T5048 |
compound |
A.,Russ |
| R3500 |
T5048 |
T5043 |
appos |
Russ,one |
| R3501 |
T5049 |
T5043 |
punct |
),one |
| R3502 |
T5050 |
T5051 |
det |
an,mutation |
| R3503 |
T5051 |
T5040 |
dobj |
mutation,generated |
| R3504 |
T5052 |
T5051 |
amod |
independent,mutation |
| R3505 |
T5053 |
T5051 |
prep |
of,mutation |
| R3506 |
T5054 |
T5053 |
pobj |
Tbx15,of |
| R3507 |
T5055 |
T5040 |
prep |
by,generated |
| R3508 |
T5056 |
T5057 |
compound |
gene,targeting |
| R3509 |
T5057 |
T5055 |
pobj |
targeting,by |
| R3510 |
T5058 |
T5057 |
prep |
in,targeting |
| R3511 |
T5059 |
T5060 |
amod |
embryonic,cells |
| R3512 |
T5060 |
T5058 |
pobj |
cells,in |
| R3513 |
T5061 |
T5060 |
compound |
stem,cells |
| R3514 |
T5062 |
T5040 |
punct |
.,generated |
| R3515 |
T5064 |
T5065 |
det |
The,allele |
| R3516 |
T5065 |
T5067 |
nsubj |
allele,carries |
| R3517 |
T5066 |
T5065 |
amod |
targeted,allele |
| R3518 |
T5068 |
T5065 |
punct |
", ",allele |
| R3519 |
T5069 |
T5065 |
appos |
Tbx15LacZ,allele |
| R3520 |
T5070 |
T5067 |
punct |
", ",carries |
| R3521 |
T5071 |
T5072 |
det |
an,cassette |
| R3522 |
T5072 |
T5067 |
dobj |
cassette,carries |
| R3523 |
T5073 |
T5074 |
nmod |
IRES,LacZ |
| R3524 |
T5074 |
T5072 |
nmod |
LacZ,cassette |
| R3525 |
T5075 |
T5074 |
punct |
-,LacZ |
| R3526 |
T5076 |
T5074 |
punct |
-,LacZ |
| R3527 |
T5077 |
T5074 |
amod |
neo,LacZ |
| R3528 |
T5078 |
T5072 |
compound |
cDNA,cassette |
| R3529 |
T5079 |
T5080 |
dep |
that,disrupts |
| R3530 |
T5080 |
T5072 |
relcl |
disrupts,cassette |
| R3531 |
T5081 |
T5082 |
det |
the,frame |
| R3532 |
T5082 |
T5080 |
dobj |
frame,disrupts |
| R3533 |
T5083 |
T5082 |
amod |
open,frame |
| R3534 |
T5084 |
T5082 |
compound |
reading,frame |
| R3535 |
T5085 |
T5082 |
prep |
at,frame |
| R3536 |
T5086 |
T5085 |
pobj |
codon,at |
| R3537 |
T5087 |
T5086 |
nummod |
154,codon |
| R3538 |
T5088 |
T5080 |
advmod |
early,disrupts |
| R3539 |
T5089 |
T5080 |
prep |
in,disrupts |
| R3540 |
T5090 |
T5091 |
det |
the,domain |
| R3541 |
T5091 |
T5089 |
pobj |
domain,in |
| R3542 |
T5092 |
T5093 |
compound |
T,box |
| R3543 |
T5093 |
T5091 |
compound |
box,domain |
| R3544 |
T5094 |
T5093 |
punct |
-,box |
| R3545 |
T5095 |
T5096 |
punct |
(,Figure |
| R3546 |
T5096 |
T5080 |
parataxis |
Figure,disrupts |
| R3547 |
T5097 |
T5096 |
nummod |
3D,Figure |
| R3548 |
T5098 |
T5096 |
punct |
),Figure |
| R3549 |
T5099 |
T5067 |
punct |
.,carries |
| R3550 |
T5101 |
T5102 |
nsubj |
Animals,are |
| R3551 |
T5103 |
T5101 |
amod |
heterozygous,Animals |
| R3552 |
T5104 |
T5103 |
prep |
for,heterozygous |
| R3553 |
T5105 |
T5106 |
det |
the,allele |
| R3554 |
T5106 |
T5104 |
pobj |
allele,for |
| R3555 |
T5107 |
T5106 |
amod |
targeted,allele |
| R3556 |
T5108 |
T5109 |
advmod |
completely,normal |
| R3557 |
T5109 |
T5102 |
acomp |
normal,are |
| R3558 |
T5110 |
T5102 |
prep |
with,are |
| R3559 |
T5111 |
T5110 |
pobj |
regard,with |
| R3560 |
T5112 |
T5111 |
prep |
to,regard |
| R3561 |
T5113 |
T5112 |
pobj |
size,to |
| R3562 |
T5114 |
T5113 |
punct |
", ",size |
| R3563 |
T5115 |
T5116 |
amod |
skeletal,morphology |
| R3564 |
T5116 |
T5113 |
conj |
morphology,size |
| R3565 |
T5117 |
T5116 |
punct |
", ",morphology |
| R3566 |
T5118 |
T5116 |
cc |
and,morphology |
| R3567 |
T5119 |
T5120 |
compound |
hair,color |
| R3568 |
T5120 |
T5122 |
compound |
color,distribution |
| R3569 |
T5121 |
T5120 |
punct |
-,color |
| R3570 |
T5122 |
T5116 |
conj |
distribution,morphology |
| R3571 |
T5123 |
T5102 |
punct |
", ",are |
| R3572 |
T5124 |
T5102 |
cc |
but,are |
| R3573 |
T5125 |
T5126 |
compound |
Tbx15LacZ,Tbx15LacZ |
| R3574 |
T5126 |
T5128 |
compound |
Tbx15LacZ,homozygotes |
| R3575 |
T5127 |
T5126 |
punct |
/,Tbx15LacZ |
| R3576 |
T5128 |
T5129 |
nsubjpass |
homozygotes,noted |
| R3577 |
T5129 |
T5102 |
conj |
noted,are |
| R3578 |
T5130 |
T5129 |
auxpass |
were,noted |
| R3579 |
T5131 |
T5132 |
aux |
to,exhibit |
| R3580 |
T5132 |
T5129 |
xcomp |
exhibit,noted |
| R3581 |
T5133 |
T5134 |
amod |
reduced,size |
| R3582 |
T5134 |
T5132 |
dobj |
size,exhibit |
| R3583 |
T5135 |
T5134 |
compound |
body,size |
| R3584 |
T5136 |
T5134 |
cc |
and,size |
| R3585 |
T5137 |
T5138 |
det |
an,appearance |
| R3586 |
T5138 |
T5134 |
conj |
appearance,size |
| R3587 |
T5139 |
T5138 |
amod |
abnormal,appearance |
| R3588 |
T5140 |
T5138 |
amod |
craniofacial,appearance |
| R3589 |
T5141 |
T5138 |
amod |
identical,appearance |
| R3590 |
T5142 |
T5141 |
prep |
to,identical |
| R3591 |
T5143 |
T5142 |
pobj |
that,to |
| R3592 |
T5144 |
T5143 |
acl |
caused,that |
| R3593 |
T5145 |
T5144 |
agent |
by,caused |
| R3594 |
T5146 |
T5145 |
pobj |
deH,by |
| R3595 |
T5147 |
T5129 |
punct |
.,noted |
| R3596 |
T5149 |
T5150 |
nsubj |
We,generated |
| R3597 |
T5150 |
T5151 |
ccomp |
generated,exhibited |
| R3598 |
T5152 |
T5153 |
nmod |
Tbx15LacZ,deH |
| R3599 |
T5153 |
T5155 |
compound |
deH,heterozygotes |
| R3600 |
T5154 |
T5153 |
punct |
/,deH |
| R3601 |
T5155 |
T5150 |
dobj |
heterozygotes,generated |
| R3602 |
T5156 |
T5155 |
compound |
compound,heterozygotes |
| R3603 |
T5157 |
T5151 |
punct |
;,exhibited |
| R3604 |
T5158 |
T5151 |
prep |
on,exhibited |
| R3605 |
T5159 |
T5160 |
det |
an,background |
| R3606 |
T5160 |
T5158 |
pobj |
background,on |
| R3607 |
T5161 |
T5162 |
compound |
Aw,at |
| R3608 |
T5162 |
T5160 |
compound |
at,background |
| R3609 |
T5163 |
T5162 |
punct |
/,at |
| R3610 |
T5164 |
T5151 |
punct |
", ",exhibited |
| R3611 |
T5165 |
T5166 |
det |
these,animals |
| R3612 |
T5166 |
T5151 |
nsubj |
animals,exhibited |
| R3613 |
T5167 |
T5168 |
det |
the,restriction |
| R3614 |
T5168 |
T5151 |
dobj |
restriction,exhibited |
| R3615 |
T5169 |
T5168 |
amod |
same,restriction |
| R3616 |
T5170 |
T5168 |
amod |
abnormal,restriction |
| R3617 |
T5171 |
T5168 |
prep |
of,restriction |
| R3618 |
T5172 |
T5173 |
amod |
dorsal,pigmentation |
| R3619 |
T5173 |
T5171 |
pobj |
pigmentation,of |
| R3620 |
T5174 |
T5168 |
prep |
at,restriction |
| R3621 |
T5175 |
T5174 |
pobj |
P3.5,at |
| R3622 |
T5176 |
T5168 |
cc |
and,restriction |
| R3623 |
T5177 |
T5178 |
amod |
expanded,area |
| R3624 |
T5178 |
T5168 |
conj |
area,restriction |
| R3625 |
T5179 |
T5178 |
amod |
yellow,area |
| R3626 |
T5180 |
T5178 |
compound |
flank,area |
| R3627 |
T5181 |
T5182 |
mark |
as,described |
| R3628 |
T5182 |
T5151 |
advcl |
described,exhibited |
| R3629 |
T5183 |
T5182 |
advmod |
above,described |
| R3630 |
T5184 |
T5182 |
prep |
for,described |
| R3631 |
T5185 |
T5186 |
compound |
deH,deH |
| R3632 |
T5186 |
T5188 |
compound |
deH,animals |
| R3633 |
T5187 |
T5186 |
punct |
/,deH |
| R3634 |
T5188 |
T5184 |
pobj |
animals,for |
| R3635 |
T5189 |
T5190 |
punct |
(,see |
| R3636 |
T5190 |
T5151 |
parataxis |
see,exhibited |
| R3637 |
T5191 |
T5190 |
dobj |
Figure,see |
| R3638 |
T5192 |
T5191 |
nummod |
2,Figure |
| R3639 |
T5193 |
T5190 |
punct |
),see |
| R3640 |
T5194 |
T5151 |
punct |
.,exhibited |
| R3641 |
T5196 |
T5197 |
det |
These,observations |
| R3642 |
T5197 |
T5198 |
nsubj |
observations,demonstrate |
| R3643 |
T5199 |
T5200 |
mark |
that,caused |
| R3644 |
T5200 |
T5198 |
ccomp |
caused,demonstrate |
| R3645 |
T5201 |
T5202 |
det |
the,characteristics |
| R3646 |
T5202 |
T5200 |
nsubjpass |
characteristics,caused |
| R3647 |
T5203 |
T5202 |
amod |
pigmentary,characteristics |
| R3648 |
T5204 |
T5203 |
cc |
and,pigmentary |
| R3649 |
T5205 |
T5203 |
conj |
craniofacial,pigmentary |
| R3650 |
T5206 |
T5202 |
prep |
of,characteristics |
| R3651 |
T5207 |
T5206 |
pobj |
deH,of |
| R3652 |
T5208 |
T5200 |
auxpass |
are,caused |
| R3653 |
T5209 |
T5200 |
agent |
by,caused |
| R3654 |
T5210 |
T5209 |
pobj |
loss,by |
| R3655 |
T5211 |
T5210 |
prep |
of,loss |
| R3656 |
T5212 |
T5211 |
pobj |
function,of |
| R3657 |
T5213 |
T5210 |
prep |
for,loss |
| R3658 |
T5214 |
T5213 |
pobj |
Tbx15,for |
| R3659 |
T5215 |
T5198 |
punct |
.,demonstrate |
| R3666 |
T5466 |
T5465 |
prep |
of,Expression |
| R3667 |
T5467 |
T5466 |
pobj |
Tbx15,of |
| R3668 |
T5468 |
T5467 |
cc |
and,Tbx15 |
| R3669 |
T5469 |
T5467 |
conj |
Agouti,Tbx15 |
| R3670 |
T5471 |
T5472 |
amod |
Previous,studies |
| R3671 |
T5472 |
T5473 |
nsubj |
studies,described |
| R3672 |
T5474 |
T5472 |
prep |
by,studies |
| R3673 |
T5475 |
T5474 |
pobj |
Agulnik,by |
| R3674 |
T5476 |
T5477 |
advmod |
et,al. |
| R3675 |
T5477 |
T5475 |
advmod |
al.,Agulnik |
| R3676 |
T5478 |
T5475 |
punct |
(,Agulnik |
| R3677 |
T5479 |
T5475 |
npadvmod |
1998,Agulnik |
| R3678 |
T5480 |
T5475 |
punct |
),Agulnik |
| R3679 |
T5481 |
T5472 |
acl |
using,studies |
| R3680 |
T5482 |
T5483 |
amod |
whole,mount |
| R3681 |
T5483 |
T5485 |
nmod |
mount,hybridization |
| R3682 |
T5484 |
T5483 |
punct |
-,mount |
| R3683 |
T5485 |
T5481 |
dobj |
hybridization,using |
| R3684 |
T5486 |
T5487 |
advmod |
in,situ |
| R3685 |
T5487 |
T5485 |
amod |
situ,hybridization |
| R3686 |
T5488 |
T5473 |
dobj |
expression,described |
| R3687 |
T5489 |
T5488 |
prep |
of,expression |
| R3688 |
T5490 |
T5489 |
pobj |
Tbx15,of |
| R3689 |
T5491 |
T5473 |
prep |
as,described |
| R3690 |
T5492 |
T5493 |
advmod |
first,detectable |
| R3691 |
T5493 |
T5491 |
pcomp |
detectable,as |
| R3692 |
T5494 |
T5493 |
prep |
at,detectable |
| R3693 |
T5495 |
T5494 |
pobj |
E9.5,at |
| R3694 |
T5496 |
T5493 |
prep |
in,detectable |
| R3695 |
T5497 |
T5498 |
det |
the,buds |
| R3696 |
T5498 |
T5496 |
pobj |
buds,in |
| R3697 |
T5499 |
T5498 |
compound |
limb,buds |
| R3698 |
T5500 |
T5493 |
punct |
", ",detectable |
| R3699 |
T5501 |
T5493 |
advcl |
progressing,detectable |
| R3700 |
T5502 |
T5501 |
prep |
to,progressing |
| R3701 |
T5503 |
T5504 |
det |
the,arches |
| R3702 |
T5504 |
T5502 |
pobj |
arches,to |
| R3703 |
T5505 |
T5504 |
amod |
branchial,arches |
| R3704 |
T5506 |
T5504 |
punct |
", ",arches |
| R3705 |
T5507 |
T5504 |
conj |
flanks,arches |
| R3706 |
T5508 |
T5507 |
punct |
", ",flanks |
| R3707 |
T5509 |
T5507 |
cc |
and,flanks |
| R3708 |
T5510 |
T5511 |
amod |
craniofacial,regions |
| R3709 |
T5511 |
T5507 |
conj |
regions,flanks |
| R3710 |
T5512 |
T5501 |
prep |
through,progressing |
| R3711 |
T5513 |
T5512 |
pobj |
E12.5,through |
| R3712 |
T5514 |
T5473 |
punct |
.,described |
| R3713 |
T5516 |
T5517 |
aux |
To,investigate |
| R3714 |
T5517 |
T5518 |
advcl |
investigate,hybridized |
| R3715 |
T5519 |
T5520 |
det |
this,pattern |
| R3716 |
T5520 |
T5517 |
dobj |
pattern,investigate |
| R3717 |
T5521 |
T5517 |
prep |
in,investigate |
| R3718 |
T5522 |
T5523 |
amod |
more,detail |
| R3719 |
T5523 |
T5521 |
pobj |
detail,in |
| R3720 |
T5524 |
T5518 |
punct |
", ",hybridized |
| R3721 |
T5525 |
T5518 |
nsubj |
we,hybridized |
| R3722 |
T5526 |
T5527 |
det |
a,probe |
| R3723 |
T5527 |
T5518 |
dobj |
probe,hybridized |
| R3724 |
T5528 |
T5527 |
compound |
Tbx15,probe |
| R3725 |
T5529 |
T5527 |
compound |
mRNA,probe |
| R3726 |
T5530 |
T5518 |
prep |
to,hybridized |
| R3727 |
T5531 |
T5532 |
det |
a,series |
| R3728 |
T5532 |
T5530 |
pobj |
series,to |
| R3729 |
T5533 |
T5532 |
prep |
of,series |
| R3730 |
T5534 |
T5535 |
amod |
transverse,sections |
| R3731 |
T5535 |
T5533 |
pobj |
sections,of |
| R3732 |
T5536 |
T5518 |
prep |
at,hybridized |
| R3733 |
T5537 |
T5536 |
pobj |
E12.5,at |
| R3734 |
T5538 |
T5518 |
cc |
and,hybridized |
| R3735 |
T5539 |
T5518 |
conj |
observed,hybridized |
| R3736 |
T5540 |
T5539 |
dobj |
expression,observed |
| R3737 |
T5541 |
T5540 |
prep |
in,expression |
| R3738 |
T5542 |
T5543 |
amod |
multiple,tissues |
| R3739 |
T5543 |
T5541 |
pobj |
tissues,in |
| R3740 |
T5544 |
T5543 |
amod |
mesenchymal,tissues |
| R3741 |
T5545 |
T5543 |
prep |
of,tissues |
| R3742 |
T5546 |
T5547 |
det |
the,head |
| R3743 |
T5547 |
T5545 |
pobj |
head,of |
| R3744 |
T5548 |
T5547 |
punct |
", ",head |
| R3745 |
T5549 |
T5547 |
conj |
trunk,head |
| R3746 |
T5550 |
T5549 |
punct |
", ",trunk |
| R3747 |
T5551 |
T5549 |
cc |
and,trunk |
| R3748 |
T5552 |
T5553 |
amod |
developing,limbs |
| R3749 |
T5553 |
T5549 |
conj |
limbs,trunk |
| R3750 |
T5554 |
T5555 |
punct |
(,Figure |
| R3751 |
T5555 |
T5540 |
parataxis |
Figure,expression |
| R3752 |
T5556 |
T5555 |
nummod |
4A,Figure |
| R3753 |
T5557 |
T5555 |
punct |
),Figure |
| R3754 |
T5558 |
T5540 |
punct |
", ",expression |
| R3755 |
T5559 |
T5560 |
dep |
much,is |
| R3756 |
T5560 |
T5540 |
relcl |
is,expression |
| R3757 |
T5561 |
T5559 |
prep |
of,much |
| R3758 |
T5562 |
T5561 |
pobj |
which,of |
| R3759 |
T5563 |
T5560 |
acomp |
consistent,is |
| R3760 |
T5564 |
T5563 |
prep |
with,consistent |
| R3761 |
T5565 |
T5566 |
det |
the,malformations |
| R3762 |
T5566 |
T5564 |
pobj |
malformations,with |
| R3763 |
T5567 |
T5566 |
nmod |
skull,malformations |
| R3764 |
T5568 |
T5567 |
punct |
", ",skull |
| R3765 |
T5569 |
T5570 |
amod |
cervical,vertebrae |
| R3766 |
T5570 |
T5567 |
conj |
vertebrae,skull |
| R3767 |
T5571 |
T5570 |
punct |
", ",vertebrae |
| R3768 |
T5572 |
T5570 |
cc |
and,vertebrae |
| R3769 |
T5573 |
T5570 |
conj |
limb,vertebrae |
| R3770 |
T5574 |
T5566 |
acl |
reported,malformations |
| R3771 |
T5575 |
T5574 |
prep |
for,reported |
| R3772 |
T5576 |
T5575 |
pobj |
mice,for |
| R3773 |
T5577 |
T5576 |
acl |
carrying,mice |
| R3774 |
T5578 |
T5579 |
det |
the,allele |
| R3775 |
T5579 |
T5577 |
dobj |
allele,carrying |
| R3776 |
T5580 |
T5579 |
amod |
original,allele |
| R3777 |
T5581 |
T5582 |
amod |
droopy,ear |
| R3778 |
T5582 |
T5579 |
compound |
ear,allele |
| R3779 |
T5583 |
T5518 |
punct |
.,hybridized |
| R3780 |
T5585 |
T5586 |
nsubj |
We,were |
| R3781 |
T5587 |
T5588 |
advmod |
particularly,interested |
| R3782 |
T5588 |
T5586 |
acomp |
interested,were |
| R3783 |
T5589 |
T5588 |
prep |
in,interested |
| R3784 |
T5590 |
T5589 |
pcomp |
determining,in |
| R3785 |
T5591 |
T5592 |
det |
the,nature |
| R3786 |
T5592 |
T5590 |
dobj |
nature,determining |
| R3787 |
T5593 |
T5592 |
amod |
exact,nature |
| R3788 |
T5594 |
T5592 |
prep |
of,nature |
| R3789 |
T5595 |
T5596 |
det |
the,expression |
| R3790 |
T5596 |
T5594 |
pobj |
expression,of |
| R3791 |
T5597 |
T5596 |
amod |
embryonic,expression |
| R3792 |
T5598 |
T5596 |
compound |
flank,expression |
| R3793 |
T5599 |
T5592 |
amod |
relative,nature |
| R3794 |
T5600 |
T5599 |
prep |
to,relative |
| R3795 |
T5601 |
T5602 |
det |
the,phenotype |
| R3796 |
T5602 |
T5600 |
pobj |
phenotype,to |
| R3797 |
T5603 |
T5602 |
amod |
ventralized,phenotype |
| R3798 |
T5604 |
T5602 |
prep |
of,phenotype |
| R3799 |
T5605 |
T5606 |
amod |
adult,mice |
| R3800 |
T5606 |
T5604 |
pobj |
mice,of |
| R3801 |
T5607 |
T5608 |
nmod |
deH,deH |
| R3802 |
T5608 |
T5606 |
compound |
deH,mice |
| R3803 |
T5609 |
T5608 |
punct |
/,deH |
| R3804 |
T5610 |
T5586 |
punct |
.,were |
| R3805 |
T5612 |
T5613 |
amod |
Transverse,sections |
| R3806 |
T5613 |
T5615 |
nsubj |
sections,reveal |
| R3807 |
T5614 |
T5613 |
amod |
abdominal,sections |
| R3808 |
T5616 |
T5613 |
prep |
from,sections |
| R3809 |
T5617 |
T5618 |
amod |
different,times |
| R3810 |
T5618 |
T5616 |
pobj |
times,from |
| R3811 |
T5619 |
T5618 |
prep |
during,times |
| R3812 |
T5620 |
T5619 |
pobj |
development,during |
| R3813 |
T5621 |
T5622 |
det |
a,band |
| R3814 |
T5622 |
T5615 |
dobj |
band,reveal |
| R3815 |
T5623 |
T5622 |
amod |
dorsolateral,band |
| R3816 |
T5624 |
T5622 |
prep |
of,band |
| R3817 |
T5625 |
T5624 |
pobj |
expression,of |
| R3818 |
T5626 |
T5622 |
prep |
in,band |
| R3819 |
T5627 |
T5628 |
det |
the,mesenchyme |
| R3820 |
T5628 |
T5626 |
pobj |
mesenchyme,in |
| R3821 |
T5629 |
T5628 |
amod |
superficial,mesenchyme |
| R3822 |
T5630 |
T5622 |
prep |
at,band |
| R3823 |
T5631 |
T5630 |
pobj |
E11.5,at |
| R3824 |
T5632 |
T5633 |
dep |
that,broadens |
| R3825 |
T5633 |
T5622 |
relcl |
broadens,band |
| R3826 |
T5634 |
T5635 |
preconj |
both,dorsally |
| R3827 |
T5635 |
T5633 |
advmod |
dorsally,broadens |
| R3828 |
T5636 |
T5635 |
cc |
and,dorsally |
| R3829 |
T5637 |
T5635 |
conj |
ventrally,dorsally |
| R3830 |
T5638 |
T5633 |
prep |
over,broadens |
| R3831 |
T5639 |
T5640 |
det |
the,days |
| R3832 |
T5640 |
T5638 |
pobj |
days,over |
| R3833 |
T5641 |
T5640 |
amod |
next,days |
| R3834 |
T5642 |
T5640 |
amod |
several,days |
| R3835 |
T5643 |
T5644 |
punct |
(,Figure |
| R3836 |
T5644 |
T5633 |
parataxis |
Figure,broadens |
| R3837 |
T5645 |
T5644 |
nummod |
4B,Figure |
| R3838 |
T5646 |
T5644 |
punct |
),Figure |
| R3839 |
T5647 |
T5615 |
punct |
.,reveal |
| R3840 |
T5649 |
T5650 |
prep |
By,become |
| R3841 |
T5650 |
T5657 |
ccomp |
become,expressed |
| R3842 |
T5651 |
T5649 |
pobj |
E13.5,By |
| R3843 |
T5652 |
T5650 |
punct |
", ",become |
| R3844 |
T5653 |
T5654 |
det |
the,dermis |
| R3845 |
T5654 |
T5650 |
nsubj |
dermis,become |
| R3846 |
T5655 |
T5654 |
amod |
developing,dermis |
| R3847 |
T5656 |
T5650 |
aux |
has,become |
| R3848 |
T5658 |
T5650 |
acomp |
separated,become |
| R3849 |
T5659 |
T5658 |
prep |
from,separated |
| R3850 |
T5660 |
T5661 |
det |
the,mesenchyme |
| R3851 |
T5661 |
T5659 |
pobj |
mesenchyme,from |
| R3852 |
T5662 |
T5661 |
amod |
loose,mesenchyme |
| R3853 |
T5663 |
T5650 |
prep |
by,become |
| R3854 |
T5664 |
T5665 |
det |
a,layer |
| R3855 |
T5665 |
T5663 |
pobj |
layer,by |
| R3856 |
T5666 |
T5665 |
amod |
subcutaneous,layer |
| R3857 |
T5667 |
T5665 |
compound |
muscle,layer |
| R3858 |
T5668 |
T5657 |
punct |
;,expressed |
| R3859 |
T5669 |
T5657 |
nsubjpass |
Tbx15,expressed |
| R3860 |
T5670 |
T5657 |
auxpass |
is,expressed |
| R3861 |
T5671 |
T5657 |
prep |
in,expressed |
| R3862 |
T5672 |
T5671 |
pobj |
all,in |
| R3863 |
T5673 |
T5672 |
prep |
of,all |
| R3864 |
T5674 |
T5675 |
det |
these,layers |
| R3865 |
T5675 |
T5673 |
pobj |
layers,of |
| R3866 |
T5676 |
T5677 |
advmod |
as,as |
| R3867 |
T5677 |
T5672 |
cc |
as,all |
| R3868 |
T5678 |
T5677 |
advmod |
well,as |
| R3869 |
T5679 |
T5680 |
det |
the,muscles |
| R3870 |
T5680 |
T5672 |
conj |
muscles,all |
| R3871 |
T5681 |
T5680 |
amod |
underlying,muscles |
| R3872 |
T5682 |
T5680 |
amod |
abdominal,muscles |
| R3873 |
T5683 |
T5657 |
punct |
.,expressed |
| R3874 |
T5685 |
T5686 |
prep |
In,expressed |
| R3875 |
T5686 |
T5692 |
ccomp |
expressed,detected |
| R3876 |
T5687 |
T5688 |
compound |
P3.5,skin |
| R3877 |
T5688 |
T5685 |
pobj |
skin,In |
| R3878 |
T5689 |
T5686 |
punct |
", ",expressed |
| R3879 |
T5690 |
T5686 |
nsubjpass |
Tbx15,expressed |
| R3880 |
T5691 |
T5686 |
auxpass |
is,expressed |
| R3881 |
T5693 |
T5686 |
prep |
in,expressed |
| R3882 |
T5694 |
T5695 |
preconj |
both,dorsal |
| R3883 |
T5695 |
T5696 |
amod |
dorsal,skin |
| R3884 |
T5696 |
T5693 |
pobj |
skin,in |
| R3885 |
T5697 |
T5695 |
cc |
and,dorsal |
| R3886 |
T5698 |
T5695 |
conj |
ventral,dorsal |
| R3887 |
T5699 |
T5686 |
punct |
", ",expressed |
| R3888 |
T5700 |
T5701 |
advmod |
most,strongly |
| R3889 |
T5701 |
T5686 |
advmod |
strongly,expressed |
| R3890 |
T5702 |
T5701 |
prep |
in,strongly |
| R3891 |
T5703 |
T5704 |
det |
the,dermis |
| R3892 |
T5704 |
T5702 |
pobj |
dermis,in |
| R3893 |
T5705 |
T5704 |
amod |
condensed,dermis |
| R3894 |
T5706 |
T5704 |
amod |
upper,dermis |
| R3895 |
T5707 |
T5704 |
cc |
and,dermis |
| R3896 |
T5708 |
T5709 |
amod |
developing,sheaths |
| R3897 |
T5709 |
T5704 |
conj |
sheaths,dermis |
| R3898 |
T5710 |
T5709 |
amod |
dermal,sheaths |
| R3899 |
T5711 |
T5704 |
prep |
of,dermis |
| R3900 |
T5712 |
T5713 |
compound |
hair,follicles |
| R3901 |
T5713 |
T5711 |
pobj |
follicles,of |
| R3902 |
T5714 |
T5692 |
punct |
;,detected |
| R3903 |
T5715 |
T5716 |
amod |
faint,expression |
| R3904 |
T5716 |
T5692 |
nsubjpass |
expression,detected |
| R3905 |
T5717 |
T5692 |
aux |
can,detected |
| R3906 |
T5718 |
T5692 |
advmod |
also,detected |
| R3907 |
T5719 |
T5692 |
auxpass |
be,detected |
| R3908 |
T5720 |
T5692 |
prep |
in,detected |
| R3909 |
T5721 |
T5722 |
amod |
rare,cells |
| R3910 |
T5722 |
T5720 |
pobj |
cells,in |
| R3911 |
T5723 |
T5722 |
amod |
dermal,cells |
| R3912 |
T5724 |
T5722 |
compound |
papillae,cells |
| R3913 |
T5725 |
T5726 |
punct |
(,Figure |
| R3914 |
T5726 |
T5692 |
parataxis |
Figure,detected |
| R3915 |
T5727 |
T5726 |
nummod |
4B,Figure |
| R3916 |
T5728 |
T5726 |
punct |
),Figure |
| R3917 |
T5729 |
T5692 |
punct |
.,detected |
| R3918 |
T5731 |
T5732 |
mark |
Although,occur |
| R3919 |
T5732 |
T5742 |
advcl |
occur,expressed |
| R3920 |
T5733 |
T5734 |
det |
the,effects |
| R3921 |
T5734 |
T5732 |
nsubj |
effects,occur |
| R3922 |
T5735 |
T5734 |
prep |
of,effects |
| R3923 |
T5736 |
T5735 |
pobj |
Agouti,of |
| R3924 |
T5737 |
T5734 |
prep |
on,effects |
| R3925 |
T5738 |
T5739 |
compound |
pigment,type |
| R3926 |
T5739 |
T5737 |
pobj |
type,on |
| R3927 |
T5740 |
T5739 |
punct |
-,type |
| R3928 |
T5741 |
T5739 |
amod |
switching,type |
| R3929 |
T5743 |
T5732 |
prep |
during,occur |
| R3930 |
T5744 |
T5745 |
amod |
postnatal,growth |
| R3931 |
T5745 |
T5743 |
pobj |
growth,during |
| R3932 |
T5746 |
T5745 |
compound |
hair,growth |
| R3933 |
T5747 |
T5742 |
punct |
", ",expressed |
| R3934 |
T5748 |
T5749 |
det |
the,isoform |
| R3935 |
T5749 |
T5742 |
nsubjpass |
isoform,expressed |
| R3936 |
T5750 |
T5751 |
amod |
ventral,specific |
| R3937 |
T5751 |
T5749 |
amod |
specific,isoform |
| R3938 |
T5752 |
T5751 |
punct |
-,specific |
| R3939 |
T5753 |
T5749 |
prep |
of,isoform |
| R3940 |
T5754 |
T5753 |
pobj |
Agouti,of |
| R3941 |
T5755 |
T5742 |
auxpass |
is,expressed |
| R3942 |
T5756 |
T5742 |
prep |
in,expressed |
| R3943 |
T5757 |
T5758 |
amod |
developing,skin |
| R3944 |
T5758 |
T5756 |
pobj |
skin,in |
| R3945 |
T5759 |
T5742 |
advcl |
beginning,expressed |
| R3946 |
T5760 |
T5759 |
prep |
at,beginning |
| R3947 |
T5761 |
T5760 |
pobj |
E11.5,at |
| R3948 |
T5762 |
T5742 |
punct |
.,expressed |
| R3949 |
T5764 |
T5765 |
nsubj |
We,compared |
| R3950 |
T5766 |
T5767 |
amod |
adjacent,sections |
| R3951 |
T5767 |
T5765 |
dobj |
sections,compared |
| R3952 |
T5768 |
T5767 |
acl |
hybridized,sections |
| R3953 |
T5769 |
T5768 |
prep |
with,hybridized |
| R3954 |
T5770 |
T5769 |
pobj |
probes,with |
| R3955 |
T5771 |
T5770 |
prep |
for,probes |
| R3956 |
T5772 |
T5771 |
pobj |
Tbx15,for |
| R3957 |
T5773 |
T5772 |
cc |
and,Tbx15 |
| R3958 |
T5774 |
T5772 |
conj |
Agouti,Tbx15 |
| R3959 |
T5775 |
T5776 |
cc |
and,observed |
| R3960 |
T5776 |
T5765 |
dep |
observed,compared |
| R3961 |
T5777 |
T5778 |
amod |
complementary,patterns |
| R3962 |
T5778 |
T5776 |
dobj |
patterns,observed |
| R3963 |
T5779 |
T5776 |
prep |
at,observed |
| R3964 |
T5780 |
T5779 |
pobj |
E12.5,at |
| R3965 |
T5781 |
T5776 |
punct |
", ",observed |
| R3966 |
T5782 |
T5783 |
mark |
with,expression |
| R3967 |
T5783 |
T5776 |
advcl |
expression,observed |
| R3968 |
T5784 |
T5783 |
prep |
of,expression |
| R3969 |
T5785 |
T5784 |
pobj |
Agouti,of |
| R3970 |
T5786 |
T5783 |
prep |
in,expression |
| R3971 |
T5787 |
T5788 |
amod |
ventral,skin |
| R3972 |
T5788 |
T5786 |
pobj |
skin,in |
| R3973 |
T5789 |
T5783 |
cc |
and,expression |
| R3974 |
T5790 |
T5783 |
conj |
expression,expression |
| R3975 |
T5791 |
T5790 |
prep |
of,expression |
| R3976 |
T5792 |
T5791 |
pobj |
Tbx15,of |
| R3977 |
T5793 |
T5790 |
prep |
in,expression |
| R3978 |
T5794 |
T5795 |
amod |
dorsal,skin |
| R3979 |
T5795 |
T5793 |
pobj |
skin,in |
| R3980 |
T5796 |
T5797 |
punct |
(,5A |
| R3981 |
T5797 |
T5776 |
parataxis |
5A,observed |
| R3982 |
T5798 |
T5797 |
nmod |
Figure,5A |
| R3983 |
T5799 |
T5797 |
cc |
and,5A |
| R3984 |
T5800 |
T5797 |
conj |
5B,5A |
| R3985 |
T5801 |
T5797 |
punct |
),5A |
| R3986 |
T5802 |
T5765 |
punct |
.,compared |
| R3987 |
T5804 |
T5805 |
det |
The,junction |
| R3988 |
T5805 |
T5806 |
nsubj |
junction,is |
| R3989 |
T5807 |
T5805 |
prep |
between,junction |
| R3990 |
T5808 |
T5809 |
compound |
expression,domains |
| R3991 |
T5809 |
T5807 |
pobj |
domains,between |
| R3992 |
T5810 |
T5806 |
acomp |
indistinct,is |
| R3993 |
T5811 |
T5806 |
punct |
", ",is |
| R3994 |
T5812 |
T5806 |
cc |
and,is |
| R3995 |
T5813 |
T5814 |
prep |
by,extends |
| R3996 |
T5814 |
T5806 |
conj |
extends,is |
| R3997 |
T5815 |
T5813 |
pobj |
E14.5,by |
| R3998 |
T5816 |
T5814 |
punct |
", ",extends |
| R3999 |
T5817 |
T5818 |
compound |
Tbx15,expression |
| R4000 |
T5818 |
T5814 |
nsubj |
expression,extends |
| R4001 |
T5819 |
T5814 |
advmod |
ventrally,extends |
| R4002 |
T5820 |
T5814 |
cc |
and,extends |
| R4003 |
T5821 |
T5814 |
conj |
overlaps,extends |
| R4004 |
T5822 |
T5821 |
advmod |
extensively,overlaps |
| R4005 |
T5823 |
T5821 |
prep |
with,overlaps |
| R4006 |
T5824 |
T5825 |
compound |
Agouti,expression |
| R4007 |
T5825 |
T5823 |
pobj |
expression,with |
| R4008 |
T5826 |
T5827 |
punct |
(,5C |
| R4009 |
T5827 |
T5821 |
parataxis |
5C,overlaps |
| R4010 |
T5828 |
T5827 |
nmod |
Figure,5C |
| R4011 |
T5829 |
T5827 |
cc |
and,5C |
| R4012 |
T5830 |
T5827 |
conj |
5D,5C |
| R4013 |
T5831 |
T5827 |
punct |
),5C |
| R4014 |
T5832 |
T5814 |
punct |
.,extends |
| R4015 |
T5834 |
T5835 |
nsubj |
We,examined |
| R4016 |
T5836 |
T5835 |
advmod |
also,examined |
| R4017 |
T5837 |
T5838 |
det |
the,effect |
| R4018 |
T5838 |
T5835 |
dobj |
effect,examined |
| R4019 |
T5839 |
T5838 |
prep |
of,effect |
| R4020 |
T5840 |
T5839 |
pobj |
deH,of |
| R4021 |
T5841 |
T5838 |
prep |
on,effect |
| R4022 |
T5842 |
T5841 |
pobj |
expression,on |
| R4023 |
T5843 |
T5842 |
prep |
of,expression |
| R4024 |
T5844 |
T5843 |
pobj |
Agouti,of |
| R4025 |
T5845 |
T5835 |
cc |
and,examined |
| R4026 |
T5846 |
T5835 |
conj |
found,examined |
| R4027 |
T5847 |
T5848 |
det |
no,difference |
| R4028 |
T5848 |
T5846 |
dobj |
difference,found |
| R4029 |
T5849 |
T5848 |
prep |
between,difference |
| R4030 |
T5850 |
T5849 |
pobj |
mutant,between |
| R4031 |
T5851 |
T5850 |
cc |
and,mutant |
| R4032 |
T5852 |
T5850 |
conj |
nonmutant,mutant |
| R4033 |
T5853 |
T5846 |
prep |
at,found |
| R4034 |
T5854 |
T5853 |
pobj |
E12.5,at |
| R4035 |
T5855 |
T5854 |
cc |
or,E12.5 |
| R4036 |
T5856 |
T5854 |
conj |
E13.5,E12.5 |
| R4037 |
T5857 |
T5858 |
punct |
(,shown |
| R4038 |
T5858 |
T5846 |
parataxis |
shown,found |
| R4039 |
T5859 |
T5858 |
nsubj |
data,shown |
| R4040 |
T5860 |
T5858 |
neg |
not,shown |
| R4041 |
T5861 |
T5858 |
punct |
),shown |
| R4042 |
T5862 |
T5835 |
punct |
.,examined |
| R4043 |
T5864 |
T5865 |
advmod |
However,appeared |
| R4044 |
T5866 |
T5865 |
punct |
", ",appeared |
| R4045 |
T5867 |
T5865 |
prep |
at,appeared |
| R4046 |
T5868 |
T5867 |
pobj |
E14.5,at |
| R4047 |
T5869 |
T5865 |
punct |
", ",appeared |
| R4048 |
T5870 |
T5871 |
det |
the,gradient |
| R4049 |
T5871 |
T5865 |
nsubj |
gradient,appeared |
| R4050 |
T5872 |
T5871 |
amod |
normal,gradient |
| R4051 |
T5873 |
T5871 |
amod |
ventral,gradient |
| R4052 |
T5874 |
T5873 |
punct |
-,ventral |
| R4053 |
T5875 |
T5873 |
prep |
to,ventral |
| R4054 |
T5876 |
T5875 |
punct |
-,to |
| R4055 |
T5877 |
T5875 |
amod |
dorsal,to |
| R4056 |
T5878 |
T5871 |
prep |
of,gradient |
| R4057 |
T5879 |
T5880 |
compound |
Agouti,expression |
| R4058 |
T5880 |
T5878 |
pobj |
expression,of |
| R4059 |
T5881 |
T5882 |
aux |
to,extend |
| R4060 |
T5882 |
T5865 |
xcomp |
extend,appeared |
| R4061 |
T5883 |
T5884 |
advmod |
more,dorsally |
| R4062 |
T5884 |
T5882 |
advmod |
dorsally,extend |
| R4063 |
T5885 |
T5882 |
prep |
in,extend |
| R4064 |
T5886 |
T5887 |
compound |
deH,deH |
| R4065 |
T5887 |
T5889 |
compound |
deH,embryos |
| R4066 |
T5888 |
T5887 |
punct |
/,deH |
| R4067 |
T5889 |
T5885 |
pobj |
embryos,in |
| R4068 |
T5890 |
T5891 |
punct |
(,Figure |
| R4069 |
T5891 |
T5882 |
parataxis |
Figure,extend |
| R4070 |
T5892 |
T5891 |
nummod |
6A,Figure |
| R4071 |
T5893 |
T5891 |
punct |
),Figure |
| R4072 |
T5894 |
T5865 |
punct |
.,appeared |
| R4073 |
T5896 |
T5897 |
prep |
In,extended |
| R4074 |
T5898 |
T5899 |
compound |
P4.5,skin |
| R4075 |
T5899 |
T5896 |
pobj |
skin,In |
| R4076 |
T5900 |
T5897 |
punct |
", ",extended |
| R4077 |
T5901 |
T5897 |
nsubjpass |
expression,extended |
| R4078 |
T5902 |
T5901 |
prep |
of,expression |
| R4079 |
T5903 |
T5902 |
pobj |
Agouti,of |
| R4080 |
T5904 |
T5897 |
auxpass |
is,extended |
| R4081 |
T5905 |
T5897 |
advmod |
also,extended |
| R4082 |
T5906 |
T5897 |
advmod |
dorsally,extended |
| R4083 |
T5907 |
T5897 |
prep |
in,extended |
| R4084 |
T5908 |
T5909 |
compound |
deH,deH |
| R4085 |
T5909 |
T5911 |
compound |
deH,animals |
| R4086 |
T5910 |
T5909 |
punct |
/,deH |
| R4087 |
T5911 |
T5907 |
pobj |
animals,in |
| R4088 |
T5912 |
T5897 |
cc |
and,extended |
| R4089 |
T5913 |
T5897 |
conj |
is,extended |
| R4090 |
T5914 |
T5915 |
advmod |
most,apparent |
| R4091 |
T5915 |
T5913 |
acomp |
apparent,is |
| R4092 |
T5916 |
T5913 |
prep |
in,is |
| R4093 |
T5917 |
T5918 |
det |
the,region |
| R4094 |
T5918 |
T5916 |
pobj |
region,in |
| R4095 |
T5919 |
T5918 |
amod |
midflank,region |
| R4096 |
T5920 |
T5913 |
prep |
within,is |
| R4097 |
T5921 |
T5922 |
det |
the,dermis |
| R4098 |
T5922 |
T5920 |
pobj |
dermis,within |
| R4099 |
T5923 |
T5922 |
amod |
upper,dermis |
| R4100 |
T5924 |
T5922 |
cc |
and,dermis |
| R4101 |
T5925 |
T5926 |
amod |
dermal,cells |
| R4102 |
T5926 |
T5922 |
conj |
cells,dermis |
| R4103 |
T5927 |
T5926 |
compound |
papillae,cells |
| R4104 |
T5928 |
T5929 |
punct |
(,Figure |
| R4105 |
T5929 |
T5913 |
parataxis |
Figure,is |
| R4106 |
T5930 |
T5929 |
nummod |
6B,Figure |
| R4107 |
T5931 |
T5929 |
punct |
),Figure |
| R4108 |
T5932 |
T5897 |
punct |
.,extended |
| R4109 |
T5934 |
T5935 |
advmod |
Thus,are |
| R4110 |
T5936 |
T5935 |
punct |
", ",are |
| R4111 |
T5937 |
T5938 |
mark |
while,explained |
| R4113 |
T5939 |
T5940 |
det |
the,phenotype |
| R4114 |
T5940 |
T5938 |
nsubjpass |
phenotype,explained |
| R4115 |
T5941 |
T5940 |
compound |
pigmentation,phenotype |
| R4116 |
T5942 |
T5940 |
prep |
of,phenotype |
| R4117 |
T5943 |
T5944 |
compound |
deH,deH |
| R4118 |
T5944 |
T5946 |
compound |
deH,mice |
| R4119 |
T5945 |
T5944 |
punct |
/,deH |
| R4120 |
T5946 |
T5942 |
pobj |
mice,of |
| R4121 |
T5947 |
T5938 |
aux |
can,explained |
| R4122 |
T5948 |
T5938 |
auxpass |
be,explained |
| R4123 |
T5949 |
T5938 |
punct |
", ",explained |
| R4124 |
T5950 |
T5951 |
neg |
not,surprisingly |
| R4125 |
T5951 |
T5938 |
advmod |
surprisingly,explained |
| R4126 |
T5952 |
T5938 |
punct |
", ",explained |
| R4127 |
T5953 |
T5938 |
agent |
by,explained |
| R4128 |
T5954 |
T5955 |
amod |
dorsal,extension |
| R4129 |
T5955 |
T5953 |
pobj |
extension,by |
| R4130 |
T5956 |
T5955 |
prep |
of,extension |
| R4131 |
T5957 |
T5958 |
compound |
Agouti,expression |
| R4132 |
T5958 |
T5956 |
pobj |
expression,of |
| R4133 |
T5959 |
T5955 |
prep |
after,extension |
| R4134 |
T5960 |
T5959 |
pobj |
birth,after |
| R4135 |
T5961 |
T5935 |
punct |
", ",are |
| R4136 |
T5962 |
T5963 |
amod |
patterned,expression |
| R4137 |
T5963 |
T5935 |
nsubj |
expression,are |
| R4138 |
T5964 |
T5963 |
prep |
of,expression |
| R4139 |
T5965 |
T5964 |
pobj |
Tbx15,of |
| R4140 |
T5966 |
T5965 |
cc |
and,Tbx15 |
| R4141 |
T5967 |
T5965 |
conj |
Agouti,Tbx15 |
| R4142 |
T5968 |
T5935 |
acomp |
apparent,are |
| R4143 |
T5969 |
T5970 |
quantmod |
some,10 |
| R4144 |
T5970 |
T5971 |
nummod |
10,days |
| R4145 |
T5971 |
T5972 |
npadvmod |
days,earlier |
| R4146 |
T5972 |
T5935 |
advmod |
earlier,are |
| R4147 |
T5973 |
T5935 |
punct |
", ",are |
| R4148 |
T5974 |
T5935 |
prep |
between,are |
| R4149 |
T5975 |
T5974 |
pobj |
E12.5,between |
| R4150 |
T5976 |
T5975 |
cc |
and,E12.5 |
| R4151 |
T5977 |
T5975 |
conj |
E13.5,E12.5 |
| R4152 |
T5978 |
T5935 |
punct |
", ",are |
| R4153 |
T5979 |
T5935 |
cc |
and,are |
| R4154 |
T5980 |
T5981 |
det |
the,effects |
| R4155 |
T5981 |
T5982 |
nsubjpass |
effects,detected |
| R4156 |
T5982 |
T5935 |
conj |
detected,are |
| R4157 |
T5983 |
T5981 |
prep |
of,effects |
| R4158 |
T5984 |
T5985 |
compound |
Tbx15,deficiency |
| R4159 |
T5985 |
T5983 |
pobj |
deficiency,of |
| R4160 |
T5986 |
T5981 |
prep |
on,effects |
| R4161 |
T5987 |
T5986 |
pobj |
expression,on |
| R4162 |
T5988 |
T5987 |
prep |
of,expression |
| R4163 |
T5989 |
T5988 |
pobj |
Agouti,of |
| R4164 |
T5990 |
T5982 |
aux |
can,detected |
| R4165 |
T5991 |
T5982 |
auxpass |
be,detected |
| R4166 |
T5992 |
T5982 |
prep |
by,detected |
| R4167 |
T5993 |
T5992 |
pobj |
E14.5,by |
| R4168 |
T5994 |
T5935 |
punct |
.,are |
| R4169 |
T6166 |
T6165 |
prep |
of,Relationship |
| R4170 |
T6167 |
T6168 |
amod |
Embryonic,Expression |
| R4171 |
T6168 |
T6166 |
pobj |
Expression,of |
| R4172 |
T6169 |
T6168 |
compound |
Tbx15,Expression |
| R4173 |
T6170 |
T6165 |
prep |
to,Relationship |
| R4174 |
T6171 |
T6172 |
amod |
Dorsal,Domains |
| R4175 |
T6172 |
T6170 |
pobj |
Domains,to |
| R4176 |
T6173 |
T6171 |
cc |
and,Dorsal |
| R4177 |
T6174 |
T6171 |
conj |
Ventral,Dorsal |
| R4178 |
T6175 |
T6172 |
compound |
Pigmentation,Domains |
| R4179 |
T6177 |
T6178 |
det |
The,observations |
| R4180 |
T6178 |
T6179 |
nsubj |
observations,are |
| R4181 |
T6180 |
T6178 |
acl |
described,observations |
| R4182 |
T6181 |
T6180 |
advmod |
above,described |
| R4183 |
T6182 |
T6179 |
acomp |
consistent,are |
| R4184 |
T6183 |
T6182 |
prep |
with,consistent |
| R4185 |
T6184 |
T6185 |
det |
a,model |
| R4186 |
T6185 |
T6183 |
pobj |
model,with |
| R4187 |
T6186 |
T6187 |
prep |
in,required |
| R4188 |
T6187 |
T6185 |
relcl |
required,model |
| R4189 |
T6188 |
T6186 |
pobj |
which,in |
| R4190 |
T6189 |
T6190 |
amod |
transient,expression |
| R4191 |
T6190 |
T6187 |
nsubjpass |
expression,required |
| R4192 |
T6191 |
T6190 |
prep |
of,expression |
| R4193 |
T6192 |
T6191 |
pobj |
Tbx15,of |
| R4194 |
T6193 |
T6190 |
prep |
in,expression |
| R4195 |
T6194 |
T6195 |
det |
the,flank |
| R4196 |
T6195 |
T6193 |
pobj |
flank,in |
| R4197 |
T6196 |
T6195 |
amod |
embryonic,flank |
| R4198 |
T6197 |
T6195 |
amod |
dorsal,flank |
| R4199 |
T6198 |
T6187 |
auxpass |
is,required |
| R4200 |
T6199 |
T6200 |
aux |
to,establish |
| R4201 |
T6200 |
T6187 |
advcl |
establish,required |
| R4202 |
T6201 |
T6202 |
amod |
positional,identity |
| R4203 |
T6202 |
T6200 |
dobj |
identity,establish |
| R4204 |
T6203 |
T6202 |
prep |
of,identity |
| R4205 |
T6204 |
T6205 |
det |
the,dermis |
| R4206 |
T6205 |
T6203 |
pobj |
dermis,of |
| R4207 |
T6206 |
T6205 |
amod |
future,dermis |
| R4208 |
T6207 |
T6200 |
punct |
", ",establish |
| R4209 |
T6208 |
T6209 |
advmod |
at,least |
| R4210 |
T6209 |
T6210 |
advmod |
least,with |
| R4211 |
T6210 |
T6200 |
prep |
with,establish |
| R4212 |
T6211 |
T6210 |
pobj |
respect,with |
| R4213 |
T6212 |
T6211 |
prep |
to,respect |
| R4214 |
T6213 |
T6214 |
compound |
pigment,type |
| R4215 |
T6214 |
T6216 |
compound |
type,synthesis |
| R4216 |
T6215 |
T6214 |
punct |
-,type |
| R4217 |
T6216 |
T6212 |
pobj |
synthesis,to |
| R4218 |
T6217 |
T6216 |
acl |
caused,synthesis |
| R4219 |
T6218 |
T6217 |
agent |
by,caused |
| R4220 |
T6219 |
T6220 |
det |
the,isoform |
| R4221 |
T6220 |
T6218 |
pobj |
isoform,by |
| R4222 |
T6221 |
T6222 |
amod |
ventral,specific |
| R4223 |
T6222 |
T6220 |
amod |
specific,isoform |
| R4224 |
T6223 |
T6222 |
punct |
-,specific |
| R4225 |
T6224 |
T6220 |
compound |
Agouti,isoform |
| R4226 |
T6225 |
T6179 |
punct |
.,are |
| R4227 |
T6227 |
T6228 |
aux |
To,investigate |
| R4228 |
T6228 |
T6230 |
advcl |
investigate,carried |
| R4229 |
T6229 |
T6228 |
advmod |
further,investigate |
| R4230 |
T6231 |
T6232 |
det |
this,hypothesis |
| R4231 |
T6232 |
T6228 |
dobj |
hypothesis,investigate |
| R4232 |
T6233 |
T6230 |
punct |
", ",carried |
| R4233 |
T6234 |
T6230 |
nsubj |
we,carried |
| R4234 |
T6235 |
T6230 |
prt |
out,carried |
| R4235 |
T6236 |
T6237 |
compound |
transplantation,experiments |
| R4236 |
T6237 |
T6230 |
dobj |
experiments,carried |
| R4237 |
T6238 |
T6239 |
prep |
in,isolated |
| R4238 |
T6239 |
T6237 |
relcl |
isolated,experiments |
| R4239 |
T6240 |
T6238 |
pobj |
which,in |
| R4240 |
T6241 |
T6239 |
nsubjpass |
pieces,isolated |
| R4241 |
T6242 |
T6241 |
prep |
of,pieces |
| R4242 |
T6243 |
T6244 |
amod |
embryonic,skin |
| R4243 |
T6244 |
T6242 |
pobj |
skin,of |
| R4244 |
T6245 |
T6239 |
auxpass |
were,isolated |
| R4245 |
T6246 |
T6239 |
prep |
from,isolated |
| R4246 |
T6247 |
T6248 |
amod |
different,positions |
| R4247 |
T6248 |
T6246 |
pobj |
positions,from |
| R4248 |
T6249 |
T6248 |
amod |
dorsoventral,positions |
| R4249 |
T6250 |
T6230 |
punct |
.,carried |
| R4250 |
T6252 |
T6253 |
nsubj |
We,evaluated |
| R4251 |
T6254 |
T6255 |
det |
the,fragments |
| R4252 |
T6255 |
T6253 |
dobj |
fragments,evaluated |
| R4253 |
T6256 |
T6255 |
amod |
embryonic,fragments |
| R4254 |
T6257 |
T6255 |
compound |
skin,fragments |
| R4255 |
T6258 |
T6253 |
prep |
for,evaluated |
| R4256 |
T6259 |
T6260 |
poss |
their,potential |
| R4257 |
T6260 |
T6258 |
pobj |
potential,for |
| R4258 |
T6261 |
T6262 |
aux |
to,give |
| R4259 |
T6262 |
T6260 |
acl |
give,potential |
| R4260 |
T6263 |
T6262 |
dobj |
rise,give |
| R4261 |
T6264 |
T6262 |
prep |
to,give |
| R4262 |
T6265 |
T6266 |
amod |
different,colors |
| R4263 |
T6266 |
T6264 |
pobj |
colors,to |
| R4264 |
T6267 |
T6266 |
compound |
hair,colors |
| R4265 |
T6268 |
T6258 |
cc |
and,for |
| R4266 |
T6269 |
T6258 |
conj |
for,for |
| R4267 |
T6270 |
T6271 |
poss |
their,expression |
| R4268 |
T6271 |
T6269 |
pobj |
expression,for |
| R4269 |
T6272 |
T6271 |
prep |
of,expression |
| R4270 |
T6273 |
T6272 |
pobj |
Tbx15,of |
| R4271 |
T6274 |
T6273 |
cc |
and,Tbx15 |
| R4272 |
T6275 |
T6273 |
conj |
Agouti,Tbx15 |
| R4273 |
T6276 |
T6253 |
punct |
.,evaluated |
| R4274 |
T6278 |
T6279 |
amod |
Previous,studies |
| R4275 |
T6279 |
T6280 |
nsubj |
studies,showed |
| R4276 |
T6281 |
T6279 |
prep |
by,studies |
| R4277 |
T6282 |
T6281 |
pobj |
Silvers,by |
| R4278 |
T6283 |
T6282 |
cc |
and,Silvers |
| R4279 |
T6284 |
T6282 |
conj |
colleagues,Silvers |
| R4280 |
T6285 |
T6286 |
punct |
(,Poole |
| R4281 |
T6286 |
T6279 |
meta |
Poole,studies |
| R4282 |
T6287 |
T6286 |
cc |
and,Poole |
| R4283 |
T6288 |
T6286 |
conj |
Silvers,Poole |
| R4284 |
T6289 |
T6288 |
nummod |
1976,Silvers |
| R4285 |
T6290 |
T6288 |
punct |
),Silvers |
| R4286 |
T6291 |
T6292 |
mark |
that,gives |
| R4288 |
T6293 |
T6294 |
amod |
dorsal,skin |
| R4289 |
T6294 |
T6292 |
nsubj |
skin,gives |
| R4290 |
T6295 |
T6293 |
cc |
and,dorsal |
| R4291 |
T6296 |
T6293 |
conj |
ventral,dorsal |
| R4292 |
T6297 |
T6294 |
acl |
isolated,skin |
| R4293 |
T6298 |
T6297 |
prep |
from,isolated |
| R4294 |
T6299 |
T6300 |
compound |
at,at |
| R4295 |
T6300 |
T6302 |
compound |
at,embryos |
| R4296 |
T6301 |
T6300 |
punct |
/,at |
| R4297 |
T6302 |
T6298 |
pobj |
embryos,from |
| R4298 |
T6303 |
T6292 |
dobj |
rise,gives |
| R4299 |
T6304 |
T6292 |
prep |
to,gives |
| R4300 |
T6305 |
T6306 |
amod |
black,hair |
| R4301 |
T6306 |
T6304 |
pobj |
hair,to |
| R4302 |
T6307 |
T6305 |
cc |
and,black |
| R4303 |
T6308 |
T6305 |
conj |
yellow,black |
| R4304 |
T6309 |
T6292 |
punct |
", ",gives |
| R4305 |
T6310 |
T6292 |
advmod |
respectively,gives |
| R4306 |
T6311 |
T6292 |
punct |
", ",gives |
| R4307 |
T6312 |
T6313 |
advmod |
when,transplanted |
| R4308 |
T6313 |
T6292 |
advcl |
transplanted,gives |
| R4309 |
T6314 |
T6313 |
prep |
into,transplanted |
| R4310 |
T6315 |
T6314 |
pobj |
testis,into |
| R4311 |
T6316 |
T6313 |
cc |
and,transplanted |
| R4312 |
T6317 |
T6313 |
conj |
allowed,transplanted |
| R4313 |
T6318 |
T6319 |
aux |
to,develop |
| R4314 |
T6319 |
T6317 |
xcomp |
develop,allowed |
| R4315 |
T6320 |
T6319 |
prep |
for,develop |
| R4316 |
T6321 |
T6322 |
amod |
several,weeks |
| R4317 |
T6322 |
T6320 |
pobj |
weeks,for |
| R4318 |
T6323 |
T6280 |
punct |
.,showed |
| R4319 |
T6325 |
T6326 |
advmod |
Furthermore,demonstrated |
| R4320 |
T6327 |
T6326 |
punct |
", ",demonstrated |
| R4321 |
T6328 |
T6329 |
amod |
dermal,epidermal |
| R4322 |
T6329 |
T6331 |
amod |
epidermal,experiments |
| R4323 |
T6330 |
T6329 |
punct |
–,epidermal |
| R4324 |
T6331 |
T6326 |
nsubj |
experiments,demonstrated |
| R4325 |
T6332 |
T6331 |
compound |
recombination,experiments |
| R4326 |
T6333 |
T6331 |
acl |
carried,experiments |
| R4327 |
T6334 |
T6333 |
prt |
out,carried |
| R4328 |
T6335 |
T6333 |
prep |
at,carried |
| R4329 |
T6336 |
T6335 |
pobj |
E14.5,at |
| R4330 |
T6337 |
T6338 |
mark |
that,carried |
| R4331 |
T6338 |
T6326 |
ccomp |
carried,demonstrated |
| R4332 |
T6339 |
T6340 |
amod |
positional,identity |
| R4333 |
T6340 |
T6338 |
nsubjpass |
identity,carried |
| R4334 |
T6341 |
T6338 |
auxpass |
is,carried |
| R4335 |
T6342 |
T6338 |
agent |
by,carried |
| R4336 |
T6343 |
T6344 |
det |
the,dermis |
| R4337 |
T6344 |
T6342 |
pobj |
dermis,by |
| R4338 |
T6345 |
T6344 |
amod |
embryonic,dermis |
| R4339 |
T6346 |
T6326 |
punct |
.,demonstrated |
| R4340 |
T6348 |
T6349 |
prep |
In,divided |
| R4341 |
T6350 |
T6351 |
det |
a,variation |
| R4342 |
T6351 |
T6348 |
pobj |
variation,In |
| R4343 |
T6352 |
T6351 |
prep |
on,variation |
| R4344 |
T6353 |
T6354 |
det |
this,experiment |
| R4345 |
T6354 |
T6352 |
pobj |
experiment,on |
| R4346 |
T6355 |
T6349 |
punct |
", ",divided |
| R4347 |
T6356 |
T6349 |
nsubj |
we,divided |
| R4348 |
T6357 |
T6358 |
amod |
embryonic,skin |
| R4349 |
T6358 |
T6349 |
dobj |
skin,divided |
| R4350 |
T6359 |
T6358 |
prep |
from,skin |
| R4351 |
T6360 |
T6361 |
compound |
at,a |
| R4352 |
T6361 |
T6363 |
compound |
a,embryos |
| R4353 |
T6362 |
T6361 |
punct |
/,a |
| R4354 |
T6363 |
T6359 |
pobj |
embryos,from |
| R4355 |
T6364 |
T6349 |
prep |
into,divided |
| R4356 |
T6365 |
T6366 |
amod |
dorsal,pieces |
| R4357 |
T6366 |
T6364 |
pobj |
pieces,into |
| R4358 |
T6367 |
T6365 |
punct |
", ",dorsal |
| R4359 |
T6368 |
T6365 |
conj |
flank,dorsal |
| R4360 |
T6369 |
T6368 |
punct |
", ",flank |
| R4361 |
T6370 |
T6368 |
cc |
and,flank |
| R4362 |
T6371 |
T6368 |
conj |
ventral,flank |
| R4363 |
T6372 |
T6349 |
cc |
and,divided |
| R4364 |
T6373 |
T6349 |
conj |
analyzed,divided |
| R4365 |
T6374 |
T6375 |
det |
the,pieces |
| R4366 |
T6375 |
T6373 |
dobj |
pieces,analyzed |
| R4367 |
T6376 |
T6375 |
amod |
different,pieces |
| R4368 |
T6377 |
T6373 |
prep |
for,analyzed |
| R4369 |
T6378 |
T6379 |
poss |
their,ability |
| R4370 |
T6379 |
T6377 |
pobj |
ability,for |
| R4371 |
T6380 |
T6381 |
aux |
to,give |
| R4372 |
T6381 |
T6379 |
acl |
give,ability |
| R4373 |
T6382 |
T6381 |
dobj |
rise,give |
| R4374 |
T6383 |
T6381 |
prep |
to,give |
| R4375 |
T6384 |
T6385 |
amod |
black,hair |
| R4376 |
T6385 |
T6383 |
pobj |
hair,to |
| R4377 |
T6386 |
T6384 |
cc |
or,black |
| R4378 |
T6387 |
T6384 |
conj |
yellow,black |
| R4379 |
T6388 |
T6381 |
prep |
after,give |
| R4380 |
T6389 |
T6390 |
compound |
testis,transplantation |
| R4381 |
T6390 |
T6388 |
pobj |
transplantation,after |
| R4382 |
T6391 |
T6377 |
punct |
", ",for |
| R4383 |
T6392 |
T6377 |
cc |
and,for |
| R4384 |
T6393 |
T6394 |
punct |
", ",for |
| R4385 |
T6394 |
T6377 |
conj |
for,for |
| R4386 |
T6395 |
T6394 |
prep |
in,for |
| R4387 |
T6396 |
T6395 |
pobj |
parallel,in |
| R4388 |
T6397 |
T6394 |
punct |
", ",for |
| R4389 |
T6398 |
T6399 |
compound |
gene,expression |
| R4390 |
T6399 |
T6394 |
pobj |
expression,for |
| R4391 |
T6400 |
T6373 |
advcl |
using,analyzed |
| R4392 |
T6401 |
T6402 |
advmod |
in,situ |
| R4393 |
T6402 |
T6403 |
amod |
situ,hybridization |
| R4394 |
T6403 |
T6400 |
dobj |
hybridization,using |
| R4395 |
T6404 |
T6349 |
punct |
.,divided |
| R4396 |
T6406 |
T6407 |
prep |
For,divided |
| R4397 |
T6408 |
T6409 |
det |
the,purposes |
| R4398 |
T6409 |
T6406 |
pobj |
purposes,For |
| R4399 |
T6410 |
T6409 |
prep |
of,purposes |
| R4400 |
T6411 |
T6412 |
det |
a,boundary |
| R4401 |
T6412 |
T6410 |
pobj |
boundary,of |
| R4402 |
T6413 |
T6412 |
amod |
reproducible,boundary |
| R4403 |
T6414 |
T6412 |
amod |
morphologic,boundary |
| R4404 |
T6415 |
T6407 |
punct |
", ",divided |
| R4405 |
T6416 |
T6407 |
nsubj |
we,divided |
| R4406 |
T6417 |
T6407 |
dobj |
flank,divided |
| R4407 |
T6418 |
T6417 |
prep |
from,flank |
| R4408 |
T6419 |
T6418 |
pobj |
ventral,from |
| R4409 |
T6420 |
T6417 |
appos |
skin,flank |
| R4410 |
T6421 |
T6407 |
prep |
based,divided |
| R4411 |
T6422 |
T6421 |
prep |
on,based |
| R4412 |
T6423 |
T6424 |
det |
a,change |
| R4413 |
T6424 |
T6422 |
pobj |
change,on |
| R4414 |
T6425 |
T6424 |
prep |
in,change |
| R4415 |
T6426 |
T6427 |
compound |
skin,thickness |
| R4416 |
T6427 |
T6425 |
pobj |
thickness,in |
| R4417 |
T6428 |
T6407 |
cc |
and,divided |
| R4418 |
T6429 |
T6407 |
conj |
divided,divided |
| R4419 |
T6430 |
T6429 |
dobj |
dorsal,divided |
| R4420 |
T6431 |
T6430 |
prep |
from,dorsal |
| R4421 |
T6432 |
T6431 |
pobj |
flank,from |
| R4422 |
T6433 |
T6430 |
appos |
skin,dorsal |
| R4423 |
T6434 |
T6429 |
prep |
at,divided |
| R4424 |
T6435 |
T6436 |
det |
the,level |
| R4425 |
T6436 |
T6434 |
pobj |
level,at |
| R4426 |
T6437 |
T6436 |
prep |
of,level |
| R4427 |
T6438 |
T6439 |
det |
an,notch |
| R4428 |
T6439 |
T6437 |
pobj |
notch,of |
| R4429 |
T6440 |
T6439 |
amod |
ectodermal,notch |
| R4430 |
T6441 |
T6442 |
dep |
that,lies |
| R4431 |
T6442 |
T6439 |
relcl |
lies,notch |
| R4432 |
T6443 |
T6442 |
prep |
at,lies |
| R4433 |
T6444 |
T6445 |
det |
the,level |
| R4434 |
T6445 |
T6443 |
pobj |
level,at |
| R4435 |
T6446 |
T6445 |
amod |
same,level |
| R4436 |
T6447 |
T6445 |
prep |
as,level |
| R4437 |
T6448 |
T6449 |
det |
the,extent |
| R4438 |
T6449 |
T6447 |
pobj |
extent,as |
| R4439 |
T6450 |
T6449 |
amod |
ventral,extent |
| R4440 |
T6451 |
T6449 |
prep |
of,extent |
| R4441 |
T6452 |
T6453 |
det |
the,myotome |
| R4442 |
T6453 |
T6451 |
pobj |
myotome,of |
| R4443 |
T6454 |
T6455 |
punct |
(,Figure |
| R4444 |
T6455 |
T6429 |
parataxis |
Figure,divided |
| R4445 |
T6456 |
T6455 |
nummod |
7,Figure |
| R4446 |
T6457 |
T6455 |
punct |
),Figure |
| R4447 |
T6458 |
T6459 |
punct |
(,Huang |
| R4448 |
T6459 |
T6429 |
meta |
Huang,divided |
| R4449 |
T6460 |
T6459 |
cc |
and,Huang |
| R4450 |
T6461 |
T6459 |
conj |
Christ,Huang |
| R4451 |
T6462 |
T6461 |
nummod |
2000,Christ |
| R4452 |
T6463 |
T6461 |
punct |
;,Christ |
| R4453 |
T6464 |
T6461 |
conj |
Olivera,Christ |
| R4454 |
T6465 |
T6464 |
punct |
-,Olivera |
| R4455 |
T6466 |
T6464 |
nmod |
Martinez,Olivera |
| R4456 |
T6467 |
T6464 |
nmod |
et,Olivera |
| R4457 |
T6468 |
T6464 |
nmod |
al.,Olivera |
| R4458 |
T6469 |
T6464 |
nummod |
2000,Olivera |
| R4459 |
T6470 |
T6464 |
punct |
;,Olivera |
| R4460 |
T6471 |
T6464 |
conj |
Sudo,Olivera |
| R4461 |
T6472 |
T6471 |
nmod |
et,Sudo |
| R4462 |
T6473 |
T6471 |
nmod |
al.,Sudo |
| R4463 |
T6474 |
T6471 |
nummod |
2001,Sudo |
| R4464 |
T6475 |
T6471 |
punct |
;,Sudo |
| R4465 |
T6476 |
T6471 |
conj |
Burke,Sudo |
| R4466 |
T6477 |
T6476 |
cc |
and,Burke |
| R4467 |
T6478 |
T6476 |
conj |
Nowicki,Burke |
| R4468 |
T6479 |
T6478 |
nummod |
2003,Nowicki |
| R4469 |
T6480 |
T6478 |
punct |
;,Nowicki |
| R4470 |
T6481 |
T6478 |
conj |
Nowicki,Nowicki |
| R4471 |
T6482 |
T6481 |
nmod |
et,Nowicki |
| R4472 |
T6483 |
T6481 |
nmod |
al.,Nowicki |
| R4473 |
T6484 |
T6481 |
nummod |
2003,Nowicki |
| R4474 |
T6485 |
T6481 |
punct |
),Nowicki |
| R4475 |
T6486 |
T6407 |
punct |
.,divided |
| R4476 |
T6488 |
T6489 |
nsubj |
We,found |
| R4477 |
T6490 |
T6491 |
mark |
that,is |
| R4478 |
T6491 |
T6489 |
ccomp |
is,found |
| R4479 |
T6492 |
T6491 |
nsubj |
E12.5,is |
| R4480 |
T6493 |
T6494 |
det |
the,time |
| R4481 |
T6494 |
T6491 |
attr |
time,is |
| R4482 |
T6495 |
T6494 |
amod |
earliest,time |
| R4483 |
T6496 |
T6497 |
prep |
at,is |
| R4484 |
T6497 |
T6494 |
relcl |
is,time |
| R4485 |
T6498 |
T6496 |
pobj |
which,at |
| R4486 |
T6499 |
T6500 |
amod |
embryonic,skin |
| R4487 |
T6500 |
T6497 |
nsubj |
skin,is |
| R4488 |
T6501 |
T6500 |
amod |
ventral,skin |
| R4489 |
T6502 |
T6497 |
acomp |
able,is |
| R4490 |
T6503 |
T6504 |
aux |
to,produce |
| R4491 |
T6504 |
T6502 |
xcomp |
produce,able |
| R4492 |
T6505 |
T6504 |
dobj |
hair,produce |
| R4493 |
T6506 |
T6507 |
advmod |
when,transplanted |
| R4494 |
T6507 |
T6504 |
advcl |
transplanted,produce |
| R4495 |
T6508 |
T6507 |
prep |
to,transplanted |
| R4496 |
T6509 |
T6510 |
det |
the,testis |
| R4497 |
T6510 |
T6508 |
pobj |
testis,to |
| R4498 |
T6511 |
T6489 |
punct |
.,found |
| R4499 |
T6513 |
T6514 |
prep |
Of,gave |
| R4500 |
T6515 |
T6516 |
det |
the,grafts |
| R4501 |
T6516 |
T6513 |
pobj |
grafts,Of |
| R4502 |
T6517 |
T6518 |
dep |
that,produced |
| R4503 |
T6518 |
T6516 |
relcl |
produced,grafts |
| R4504 |
T6519 |
T6518 |
dobj |
hair,produced |
| R4505 |
T6520 |
T6514 |
punct |
", ",gave |
| R4506 |
T6521 |
T6522 |
amod |
ventral,skin |
| R4507 |
T6522 |
T6514 |
nsubj |
skin,gave |
| R4508 |
T6523 |
T6514 |
dobj |
rise,gave |
| R4509 |
T6524 |
T6514 |
prep |
to,gave |
| R4510 |
T6525 |
T6526 |
amod |
yellow,hair |
| R4511 |
T6526 |
T6524 |
pobj |
hair,to |
| R4512 |
T6527 |
T6528 |
punct |
(,3 |
| R4513 |
T6528 |
T6514 |
parataxis |
3,gave |
| R4514 |
T6529 |
T6528 |
nsubj |
n,3 |
| R4515 |
T6530 |
T6528 |
punct |
=,3 |
| R4516 |
T6531 |
T6528 |
punct |
),3 |
| R4517 |
T6532 |
T6514 |
punct |
", ",gave |
| R4518 |
T6533 |
T6514 |
cc |
and,gave |
| R4519 |
T6534 |
T6535 |
amod |
dorsal,skin |
| R4520 |
T6535 |
T6536 |
nsubj |
skin,gave |
| R4521 |
T6536 |
T6514 |
conj |
gave,gave |
| R4522 |
T6537 |
T6536 |
dobj |
rise,gave |
| R4523 |
T6538 |
T6536 |
prep |
to,gave |
| R4524 |
T6539 |
T6540 |
amod |
black,hair |
| R4525 |
T6540 |
T6538 |
pobj |
hair,to |
| R4526 |
T6541 |
T6542 |
punct |
(,4 |
| R4527 |
T6542 |
T6536 |
parataxis |
4,gave |
| R4528 |
T6543 |
T6542 |
nsubj |
n,4 |
| R4529 |
T6544 |
T6542 |
punct |
=,4 |
| R4530 |
T6545 |
T6542 |
punct |
),4 |
| R4531 |
T6546 |
T6514 |
punct |
.,gave |
| R4532 |
T6548 |
T6549 |
nsubj |
Transplantation,gave |
| R4533 |
T6549 |
T6553 |
ccomp |
gave,produced |
| R4534 |
T6550 |
T6548 |
prep |
of,Transplantation |
| R4535 |
T6551 |
T6552 |
compound |
flank,skin |
| R4536 |
T6552 |
T6550 |
pobj |
skin,of |
| R4537 |
T6554 |
T6549 |
dobj |
rise,gave |
| R4538 |
T6555 |
T6549 |
prep |
to,gave |
| R4539 |
T6556 |
T6557 |
det |
a,patch |
| R4540 |
T6557 |
T6555 |
pobj |
patch,to |
| R4541 |
T6558 |
T6557 |
prep |
of,patch |
| R4542 |
T6559 |
T6560 |
amod |
yellow,hair |
| R4543 |
T6560 |
T6558 |
pobj |
hair,of |
| R4544 |
T6561 |
T6557 |
acl |
juxtaposed,patch |
| R4545 |
T6562 |
T6561 |
prep |
against,juxtaposed |
| R4546 |
T6563 |
T6564 |
det |
a,patch |
| R4547 |
T6564 |
T6562 |
pobj |
patch,against |
| R4548 |
T6565 |
T6564 |
prep |
of,patch |
| R4549 |
T6566 |
T6567 |
amod |
black,hair |
| R4550 |
T6567 |
T6565 |
pobj |
hair,of |
| R4551 |
T6568 |
T6549 |
prep |
in,gave |
| R4552 |
T6569 |
T6570 |
nummod |
85,% |
| R4553 |
T6570 |
T6568 |
pobj |
%,in |
| R4554 |
T6571 |
T6570 |
prep |
of,% |
| R4555 |
T6572 |
T6573 |
det |
the,grafts |
| R4556 |
T6573 |
T6571 |
pobj |
grafts,of |
| R4557 |
T6574 |
T6573 |
amod |
successful,grafts |
| R4558 |
T6575 |
T6576 |
punct |
(,13 |
| R4559 |
T6576 |
T6549 |
parataxis |
13,gave |
| R4560 |
T6577 |
T6576 |
nsubj |
n,13 |
| R4561 |
T6578 |
T6576 |
punct |
=,13 |
| R4562 |
T6579 |
T6576 |
punct |
),13 |
| R4563 |
T6580 |
T6553 |
punct |
;,produced |
| R4564 |
T6581 |
T6582 |
det |
the,grafts |
| R4565 |
T6582 |
T6553 |
nsubj |
grafts,produced |
| R4566 |
T6583 |
T6582 |
amod |
remaining,grafts |
| R4567 |
T6584 |
T6582 |
nummod |
two,grafts |
| R4568 |
T6585 |
T6582 |
compound |
flank,grafts |
| R4569 |
T6586 |
T6587 |
advmod |
solely,black |
| R4570 |
T6587 |
T6588 |
amod |
black,hair |
| R4571 |
T6588 |
T6553 |
dobj |
hair,produced |
| R4572 |
T6589 |
T6587 |
cc |
or,black |
| R4573 |
T6590 |
T6587 |
conj |
yellow,black |
| R4574 |
T6591 |
T6553 |
punct |
.,produced |
| R4575 |
T6593 |
T6594 |
prep |
In,observe |
| R4576 |
T6595 |
T6596 |
det |
no,case |
| R4577 |
T6596 |
T6593 |
pobj |
case,In |
| R4578 |
T6597 |
T6594 |
aux |
did,observe |
| R4579 |
T6598 |
T6594 |
nsubj |
we,observe |
| R4580 |
T6599 |
T6594 |
dobj |
intermingling,observe |
| R4581 |
T6600 |
T6599 |
prep |
of,intermingling |
| R4582 |
T6601 |
T6602 |
amod |
black,hairs |
| R4583 |
T6602 |
T6600 |
pobj |
hairs,of |
| R4584 |
T6603 |
T6601 |
cc |
and,black |
| R4585 |
T6604 |
T6601 |
conj |
yellow,black |
| R4586 |
T6605 |
T6594 |
punct |
.,observe |
| R4587 |
T6607 |
T6608 |
mark |
As,predicted |
| R4588 |
T6608 |
T6609 |
advcl |
predicted,expressed |
| R4589 |
T6610 |
T6608 |
prep |
from,predicted |
| R4590 |
T6611 |
T6612 |
det |
the,experiments |
| R4591 |
T6612 |
T6610 |
pobj |
experiments,from |
| R4592 |
T6613 |
T6612 |
acl |
using,experiments |
| R4593 |
T6614 |
T6615 |
compound |
tissue,sections |
| R4594 |
T6615 |
T6613 |
dobj |
sections,using |
| R4595 |
T6616 |
T6617 |
punct |
(,see |
| R4596 |
T6617 |
T6608 |
parataxis |
see,predicted |
| R4597 |
T6618 |
T6619 |
nmod |
Figures,5 |
| R4598 |
T6619 |
T6617 |
dobj |
5,see |
| R4599 |
T6620 |
T6619 |
cc |
and,5 |
| R4600 |
T6621 |
T6619 |
conj |
6,5 |
| R4601 |
T6622 |
T6617 |
punct |
),see |
| R4602 |
T6623 |
T6609 |
punct |
", ",expressed |
| R4603 |
T6624 |
T6625 |
amod |
dorsal,pieces |
| R4604 |
T6625 |
T6609 |
nsubj |
pieces,expressed |
| R4605 |
T6626 |
T6609 |
dobj |
Tbx15,expressed |
| R4606 |
T6627 |
T6626 |
cc |
but,Tbx15 |
| R4607 |
T6628 |
T6627 |
neg |
not,but |
| R4608 |
T6629 |
T6626 |
conj |
Agouti,Tbx15 |
| R4609 |
T6630 |
T6609 |
punct |
", ",expressed |
| R4610 |
T6631 |
T6632 |
mark |
while,expressed |
| R4611 |
T6632 |
T6609 |
advcl |
expressed,expressed |
| R4612 |
T6633 |
T6634 |
compound |
flank,pieces |
| R4613 |
T6634 |
T6632 |
nsubj |
pieces,expressed |
| R4614 |
T6635 |
T6636 |
det |
both,genes |
| R4615 |
T6636 |
T6632 |
dobj |
genes,expressed |
| R4616 |
T6637 |
T6638 |
punct |
(,see |
| R4617 |
T6638 |
T6609 |
parataxis |
see,expressed |
| R4618 |
T6639 |
T6638 |
dobj |
Figure,see |
| R4619 |
T6640 |
T6639 |
nummod |
7,Figure |
| R4620 |
T6641 |
T6638 |
punct |
),see |
| R4621 |
T6642 |
T6609 |
punct |
.,expressed |
| R4622 |
T6644 |
T6645 |
advmod |
Thus,established |
| R4623 |
T6645 |
T6653 |
ccomp |
established,maintained |
| R4624 |
T6646 |
T6645 |
punct |
", ",established |
| R4625 |
T6647 |
T6648 |
amod |
dorsoventral,identity |
| R4626 |
T6648 |
T6645 |
nsubjpass |
identity,established |
| R4627 |
T6649 |
T6648 |
prep |
for,identity |
| R4628 |
T6650 |
T6651 |
amod |
adult,pigmentation |
| R4629 |
T6651 |
T6649 |
pobj |
pigmentation,for |
| R4630 |
T6652 |
T6645 |
auxpass |
is,established |
| R4631 |
T6654 |
T6645 |
prep |
by,established |
| R4632 |
T6655 |
T6656 |
det |
the,time |
| R4633 |
T6656 |
T6654 |
pobj |
time,by |
| R4634 |
T6657 |
T6658 |
advmod |
when,becomes |
| R4635 |
T6658 |
T6656 |
relcl |
becomes,time |
| R4636 |
T6659 |
T6660 |
amod |
patterned,expression |
| R4637 |
T6660 |
T6658 |
nsubj |
expression,becomes |
| R4638 |
T6661 |
T6658 |
acomp |
apparent,becomes |
| R4639 |
T6662 |
T6658 |
prep |
for,becomes |
| R4640 |
T6663 |
T6662 |
pobj |
Tbx15,for |
| R4641 |
T6664 |
T6663 |
cc |
and,Tbx15 |
| R4642 |
T6665 |
T6663 |
conj |
Agouti,Tbx15 |
| R4643 |
T6666 |
T6667 |
punct |
(,E11.5 |
| R4644 |
T6667 |
T6658 |
parataxis |
E11.5,becomes |
| R4645 |
T6668 |
T6669 |
punct |
–,E12.5 |
| R4646 |
T6669 |
T6667 |
prep |
E12.5,E11.5 |
| R4647 |
T6670 |
T6667 |
punct |
),E11.5 |
| R4648 |
T6671 |
T6653 |
punct |
;,maintained |
| R4649 |
T6672 |
T6653 |
advmod |
furthermore,maintained |
| R4650 |
T6673 |
T6653 |
punct |
", ",maintained |
| R4651 |
T6674 |
T6675 |
amod |
positional,identity |
| R4652 |
T6675 |
T6653 |
nsubjpass |
identity,maintained |
| R4653 |
T6676 |
T6653 |
auxpass |
is,maintained |
| R4654 |
T6677 |
T6653 |
prep |
throughout,maintained |
| R4655 |
T6678 |
T6679 |
amod |
later,stages |
| R4656 |
T6679 |
T6677 |
pobj |
stages,throughout |
| R4657 |
T6680 |
T6679 |
prep |
of,stages |
| R4658 |
T6681 |
T6682 |
compound |
skin,development |
| R4659 |
T6682 |
T6680 |
pobj |
development,of |
| R4660 |
T6683 |
T6653 |
punct |
", ",maintained |
| R4661 |
T6684 |
T6685 |
advmod |
even,broadens |
| R4662 |
T6685 |
T6653 |
advcl |
broadens,maintained |
| R4663 |
T6686 |
T6685 |
mark |
though,broadens |
| R4664 |
T6687 |
T6685 |
nsubj |
expression,broadens |
| R4665 |
T6688 |
T6687 |
prep |
of,expression |
| R4666 |
T6689 |
T6688 |
pobj |
Tbx15,of |
| R4667 |
T6690 |
T6691 |
aux |
to,include |
| R4668 |
T6691 |
T6685 |
advcl |
include,broadens |
| R4669 |
T6692 |
T6693 |
amod |
ventral,skin |
| R4670 |
T6693 |
T6691 |
dobj |
skin,include |
| R4671 |
T6694 |
T6695 |
advmod |
as,as |
| R4672 |
T6695 |
T6692 |
cc |
as,ventral |
| R4673 |
T6696 |
T6695 |
advmod |
well,as |
| R4674 |
T6697 |
T6692 |
conj |
dorsal,ventral |
| R4675 |
T6698 |
T6653 |
punct |
.,maintained |
| R4676 |
T6884 |
T6883 |
prep |
of,Relationship |
| R4677 |
T6885 |
T6886 |
det |
the,Boundary |
| R4678 |
T6886 |
T6884 |
pobj |
Boundary,of |
| R4679 |
T6887 |
T6886 |
amod |
Dorsoventral,Boundary |
| R4680 |
T6888 |
T6886 |
compound |
Pigment,Boundary |
| R4681 |
T6889 |
T6883 |
prep |
to,Relationship |
| R4682 |
T6890 |
T6891 |
compound |
Lineage,Compartments |
| R4683 |
T6891 |
T6889 |
pobj |
Compartments,to |
| R4684 |
T6892 |
T6891 |
cc |
and,Compartments |
| R4685 |
T6893 |
T6894 |
det |
the,Frontier |
| R4686 |
T6894 |
T6891 |
conj |
Frontier,Compartments |
| R4687 |
T6895 |
T6894 |
amod |
Lateral,Frontier |
| R4688 |
T6896 |
T6894 |
amod |
Somitic,Frontier |
| R4689 |
T6898 |
T6899 |
det |
The,notch |
| R4690 |
T6899 |
T6901 |
nsubj |
notch,is |
| R4691 |
T6900 |
T6899 |
amod |
ectodermal,notch |
| R4692 |
T6902 |
T6903 |
dep |
that,used |
| R4693 |
T6903 |
T6899 |
relcl |
used,notch |
| R4694 |
T6904 |
T6903 |
nsubj |
we,used |
| R4695 |
T6905 |
T6906 |
aux |
to,mark |
| R4696 |
T6906 |
T6903 |
advcl |
mark,used |
| R4697 |
T6907 |
T6908 |
det |
the,boundary |
| R4698 |
T6908 |
T6906 |
dobj |
boundary,mark |
| R4699 |
T6909 |
T6908 |
prep |
between,boundary |
| R4700 |
T6910 |
T6911 |
amod |
embryonic,dorsum |
| R4701 |
T6911 |
T6909 |
pobj |
dorsum,between |
| R4702 |
T6912 |
T6911 |
cc |
and,dorsum |
| R4703 |
T6913 |
T6914 |
amod |
embryonic,flank |
| R4704 |
T6914 |
T6911 |
conj |
flank,dorsum |
| R4705 |
T6915 |
T6916 |
det |
a,feature |
| R4706 |
T6916 |
T6901 |
attr |
feature,is |
| R4707 |
T6917 |
T6916 |
amod |
characteristic,feature |
| R4708 |
T6918 |
T6901 |
prep |
in,is |
| R4709 |
T6919 |
T6920 |
compound |
vertebrate,embryos |
| R4710 |
T6920 |
T6918 |
pobj |
embryos,in |
| R4711 |
T6921 |
T6901 |
punct |
.,is |
| R4712 |
T6923 |
T6924 |
prep |
In,serves |
| R4713 |
T6925 |
T6926 |
compound |
cell,studies |
| R4714 |
T6926 |
T6923 |
pobj |
studies,In |
| R4715 |
T6927 |
T6926 |
compound |
lineage,studies |
| R4716 |
T6928 |
T6926 |
acl |
carried,studies |
| R4717 |
T6929 |
T6928 |
prt |
out,carried |
| R4718 |
T6930 |
T6928 |
prep |
in,carried |
| R4719 |
T6931 |
T6932 |
det |
the,system |
| R4720 |
T6932 |
T6930 |
pobj |
system,in |
| R4721 |
T6933 |
T6932 |
compound |
chick,system |
| R4722 |
T6934 |
T6924 |
punct |
", ",serves |
| R4723 |
T6935 |
T6936 |
det |
the,notch |
| R4724 |
T6936 |
T6924 |
nsubj |
notch,serves |
| R4725 |
T6937 |
T6924 |
prep |
as,serves |
| R4726 |
T6938 |
T6939 |
det |
a,landmark |
| R4727 |
T6939 |
T6937 |
pobj |
landmark,as |
| R4728 |
T6940 |
T6939 |
prep |
for,landmark |
| R4729 |
T6941 |
T6942 |
det |
the,boundary |
| R4730 |
T6942 |
T6940 |
pobj |
boundary,for |
| R4731 |
T6943 |
T6942 |
prep |
between,boundary |
| R4732 |
T6944 |
T6943 |
pobj |
dermis,between |
| R4733 |
T6945 |
T6944 |
acl |
derived,dermis |
| R4734 |
T6946 |
T6945 |
prep |
from,derived |
| R4735 |
T6947 |
T6948 |
amod |
somitic,mesoderm |
| R4736 |
T6948 |
T6946 |
pobj |
mesoderm,from |
| R4737 |
T6949 |
T6944 |
cc |
and,dermis |
| R4738 |
T6950 |
T6944 |
conj |
dermis,dermis |
| R4739 |
T6951 |
T6950 |
acl |
derived,dermis |
| R4740 |
T6952 |
T6951 |
prep |
from,derived |
| R4741 |
T6953 |
T6954 |
amod |
lateral,plate |
| R4742 |
T6954 |
T6955 |
compound |
plate,mesoderm |
| R4743 |
T6955 |
T6952 |
pobj |
mesoderm,from |
| R4744 |
T6956 |
T6924 |
cc |
and,serves |
| R4745 |
T6957 |
T6958 |
aux |
has,termed |
| R4746 |
T6958 |
T6924 |
conj |
termed,serves |
| R4747 |
T6959 |
T6958 |
auxpass |
been,termed |
| R4748 |
T6960 |
T6961 |
det |
the,frontier |
| R4749 |
T6961 |
T6958 |
oprd |
frontier,termed |
| R4750 |
T6962 |
T6961 |
punct |
“,frontier |
| R4751 |
T6963 |
T6961 |
amod |
lateral,frontier |
| R4752 |
T6964 |
T6961 |
amod |
somitic,frontier |
| R4753 |
T6965 |
T6958 |
punct |
”,termed |
| R4754 |
T6966 |
T6967 |
punct |
(,Olivera |
| R4755 |
T6967 |
T6958 |
meta |
Olivera,termed |
| R4756 |
T6968 |
T6967 |
punct |
-,Olivera |
| R4757 |
T6969 |
T6967 |
nmod |
Martinez,Olivera |
| R4758 |
T6970 |
T6967 |
nmod |
et,Olivera |
| R4759 |
T6971 |
T6967 |
nmod |
al.,Olivera |
| R4760 |
T6972 |
T6967 |
nummod |
2000,Olivera |
| R4761 |
T6973 |
T6967 |
punct |
;,Olivera |
| R4762 |
T6974 |
T6967 |
conj |
Sudo,Olivera |
| R4763 |
T6975 |
T6974 |
nmod |
et,Sudo |
| R4764 |
T6976 |
T6974 |
nmod |
al.,Sudo |
| R4765 |
T6977 |
T6974 |
nummod |
2001,Sudo |
| R4766 |
T6978 |
T6974 |
punct |
;,Sudo |
| R4767 |
T6979 |
T6974 |
conj |
Burke,Sudo |
| R4768 |
T6980 |
T6979 |
cc |
and,Burke |
| R4769 |
T6981 |
T6979 |
conj |
Nowicki,Burke |
| R4770 |
T6982 |
T6981 |
nummod |
2003,Nowicki |
| R4771 |
T6983 |
T6981 |
punct |
;,Nowicki |
| R4772 |
T6984 |
T6981 |
conj |
Nowicki,Nowicki |
| R4773 |
T6985 |
T6984 |
nmod |
et,Nowicki |
| R4774 |
T6986 |
T6984 |
nmod |
al.,Nowicki |
| R4775 |
T6987 |
T6984 |
nummod |
2003,Nowicki |
| R4776 |
T6988 |
T6984 |
punct |
),Nowicki |
| R4777 |
T6989 |
T6924 |
punct |
.,serves |
| R4778 |
T6991 |
T6992 |
mark |
Although,carried |
| R4779 |
T6992 |
T7000 |
advcl |
carried,give |
| R4780 |
T6993 |
T6994 |
npadvmod |
fate,mapping |
| R4781 |
T6994 |
T6996 |
amod |
mapping,studies |
| R4782 |
T6995 |
T6994 |
punct |
-,mapping |
| R4783 |
T6996 |
T6992 |
nsubjpass |
studies,carried |
| R4784 |
T6997 |
T6992 |
aux |
have,carried |
| R4785 |
T6998 |
T6992 |
neg |
not,carried |
| R4786 |
T6999 |
T6992 |
auxpass |
been,carried |
| R4787 |
T7001 |
T6992 |
prt |
out,carried |
| R4788 |
T7002 |
T6992 |
prep |
in,carried |
| R4789 |
T7003 |
T7004 |
amod |
mammalian,embryos |
| R4790 |
T7004 |
T7002 |
pobj |
embryos,in |
| R4791 |
T7005 |
T7000 |
punct |
", ",give |
| R4792 |
T7006 |
T7007 |
npadvmod |
somite,derived |
| R4793 |
T7007 |
T7013 |
amod |
derived,mesoderm |
| R4794 |
T7008 |
T7006 |
punct |
-,somite |
| R4795 |
T7009 |
T7006 |
cc |
and,somite |
| R4796 |
T7010 |
T7011 |
amod |
lateral,plate |
| R4797 |
T7011 |
T7006 |
conj |
plate,somite |
| R4798 |
T7012 |
T7007 |
punct |
-,derived |
| R4799 |
T7013 |
T7000 |
nsubj |
mesoderm,give |
| R4800 |
T7014 |
T7000 |
aux |
could,give |
| R4801 |
T7015 |
T7000 |
dobj |
rise,give |
| R4802 |
T7016 |
T7000 |
prep |
to,give |
| R4803 |
T7017 |
T7016 |
pobj |
precursors,to |
| R4804 |
T7018 |
T7000 |
prep |
for,give |
| R4805 |
T7019 |
T7018 |
pobj |
dermis,for |
| R4806 |
T7020 |
T7019 |
amod |
dorsal,dermis |
| R4807 |
T7021 |
T7020 |
cc |
and,dorsal |
| R4808 |
T7022 |
T7020 |
conj |
ventral,dorsal |
| R4809 |
T7023 |
T7022 |
prep |
to,ventral |
| R4810 |
T7024 |
T7025 |
det |
the,junction |
| R4811 |
T7025 |
T7023 |
pobj |
junction,to |
| R4812 |
T7026 |
T7025 |
nmod |
limb,junction |
| R4813 |
T7027 |
T7026 |
punct |
–,limb |
| R4814 |
T7028 |
T7029 |
compound |
body,wall |
| R4815 |
T7029 |
T7026 |
appos |
wall,limb |
| R4816 |
T7030 |
T7000 |
punct |
", ",give |
| R4817 |
T7031 |
T7000 |
advmod |
respectively,give |
| R4818 |
T7032 |
T7000 |
punct |
.,give |
| R4819 |
T7034 |
T7035 |
advmod |
However,conflicts |
| R4820 |
T7036 |
T7035 |
punct |
", ",conflicts |
| R4821 |
T7037 |
T7038 |
det |
this,notion |
| R4822 |
T7038 |
T7035 |
nsubj |
notion,conflicts |
| R4823 |
T7039 |
T7035 |
prep |
with,conflicts |
| R4824 |
T7040 |
T7041 |
poss |
our,observation |
| R4825 |
T7041 |
T7039 |
pobj |
observation,with |
| R4826 |
T7042 |
T7043 |
mark |
that,lies |
| R4827 |
T7043 |
T7041 |
acl |
lies,observation |
| R4828 |
T7044 |
T7045 |
det |
the,boundary |
| R4829 |
T7045 |
T7043 |
nsubj |
boundary,lies |
| R4830 |
T7046 |
T7045 |
amod |
future,boundary |
| R4831 |
T7047 |
T7045 |
compound |
pigmentation,boundary |
| R4832 |
T7048 |
T7043 |
advmod |
ventral,lies |
| R4833 |
T7049 |
T7048 |
prep |
to,ventral |
| R4834 |
T7050 |
T7051 |
det |
the,notch |
| R4835 |
T7051 |
T7049 |
pobj |
notch,to |
| R4836 |
T7052 |
T7051 |
amod |
ectodermal,notch |
| R4837 |
T7053 |
T7054 |
punct |
(,see |
| R4838 |
T7054 |
T7041 |
parataxis |
see,observation |
| R4839 |
T7055 |
T7054 |
dobj |
Figure,see |
| R4840 |
T7056 |
T7055 |
nummod |
7,Figure |
| R4841 |
T7057 |
T7054 |
punct |
),see |
| R4842 |
T7058 |
T7035 |
punct |
.,conflicts |
| R4843 |
T7060 |
T7061 |
aux |
To,examine |
| R4844 |
T7061 |
T7062 |
advcl |
examine,made |
| R4845 |
T7063 |
T7061 |
advmod |
directly,examine |
| R4846 |
T7064 |
T7065 |
det |
the,relationship |
| R4847 |
T7065 |
T7061 |
dobj |
relationship,examine |
| R4848 |
T7066 |
T7065 |
prep |
between,relationship |
| R4849 |
T7067 |
T7068 |
det |
the,boundary |
| R4850 |
T7068 |
T7066 |
pobj |
boundary,between |
| R4851 |
T7069 |
T7068 |
compound |
pigmentation,boundary |
| R4852 |
T7070 |
T7068 |
cc |
and,boundary |
| R4853 |
T7071 |
T7068 |
conj |
dermis,boundary |
| R4854 |
T7072 |
T7071 |
acl |
derived,dermis |
| R4855 |
T7073 |
T7072 |
prep |
from,derived |
| R4856 |
T7074 |
T7075 |
amod |
lateral,plate |
| R4857 |
T7075 |
T7076 |
compound |
plate,mesoderm |
| R4858 |
T7076 |
T7073 |
pobj |
mesoderm,from |
| R4859 |
T7077 |
T7062 |
punct |
", ",made |
| R4860 |
T7078 |
T7062 |
nsubj |
we,made |
| R4861 |
T7079 |
T7062 |
dobj |
use,made |
| R4862 |
T7080 |
T7062 |
prep |
of,made |
| R4863 |
T7081 |
T7082 |
det |
a,transgene |
| R4864 |
T7082 |
T7080 |
pobj |
transgene,of |
| R4865 |
T7083 |
T7082 |
compound |
Cre,transgene |
| R4866 |
T7084 |
T7082 |
acl |
driven,transgene |
| R4867 |
T7085 |
T7084 |
agent |
by,driven |
| R4868 |
T7086 |
T7087 |
det |
the,promoter |
| R4869 |
T7087 |
T7085 |
pobj |
promoter,by |
| R4870 |
T7088 |
T7087 |
compound |
Hoxb6,promoter |
| R4871 |
T7089 |
T7090 |
dep |
that,developed |
| R4872 |
T7090 |
T7087 |
relcl |
developed,promoter |
| R4873 |
T7091 |
T7090 |
auxpass |
was,developed |
| R4874 |
T7092 |
T7090 |
agent |
by,developed |
| R4875 |
T7093 |
T7092 |
pobj |
Kuehn,by |
| R4876 |
T7094 |
T7093 |
cc |
and,Kuehn |
| R4877 |
T7095 |
T7093 |
conj |
colleagues,Kuehn |
| R4878 |
T7096 |
T7097 |
punct |
(,Lowe |
| R4879 |
T7097 |
T7062 |
meta |
Lowe,made |
| R4880 |
T7098 |
T7097 |
nmod |
et,Lowe |
| R4881 |
T7099 |
T7097 |
nmod |
al.,Lowe |
| R4882 |
T7100 |
T7097 |
nummod |
2000,Lowe |
| R4883 |
T7101 |
T7097 |
punct |
),Lowe |
| R4884 |
T7102 |
T7062 |
punct |
.,made |
| R4885 |
T7104 |
T7105 |
mark |
As,described |
| R4886 |
T7105 |
T7106 |
advcl |
described,exhibit |
| R4887 |
T7107 |
T7105 |
agent |
by,described |
| R4888 |
T7108 |
T7107 |
pobj |
Lowe,by |
| R4889 |
T7109 |
T7110 |
advmod |
et,al. |
| R4890 |
T7110 |
T7108 |
advmod |
al.,Lowe |
| R4891 |
T7111 |
T7108 |
punct |
(,Lowe |
| R4892 |
T7112 |
T7108 |
npadvmod |
2000,Lowe |
| R4893 |
T7113 |
T7108 |
punct |
),Lowe |
| R4894 |
T7114 |
T7106 |
punct |
", ",exhibit |
| R4895 |
T7115 |
T7116 |
compound |
midgestation,embryos |
| R4896 |
T7116 |
T7106 |
nsubj |
embryos,exhibit |
| R4897 |
T7117 |
T7116 |
acl |
carrying,embryos |
| R4898 |
T7118 |
T7119 |
preconj |
both,transgene |
| R4899 |
T7119 |
T7117 |
dobj |
transgene,carrying |
| R4900 |
T7120 |
T7119 |
det |
the,transgene |
| R4901 |
T7121 |
T7122 |
compound |
Hoxb6,Cre |
| R4902 |
T7122 |
T7119 |
compound |
Cre,transgene |
| R4903 |
T7123 |
T7122 |
punct |
-,Cre |
| R4904 |
T7124 |
T7119 |
cc |
and,transgene |
| R4905 |
T7125 |
T7126 |
det |
the,gene |
| R4906 |
T7126 |
T7119 |
conj |
gene,transgene |
| R4907 |
T7127 |
T7126 |
compound |
R26R,gene |
| R4908 |
T7128 |
T7126 |
compound |
lacZ,gene |
| R4909 |
T7129 |
T7126 |
compound |
reporter,gene |
| R4910 |
T7130 |
T7131 |
punct |
(,Soriano |
| R4911 |
T7131 |
T7126 |
meta |
Soriano,gene |
| R4912 |
T7132 |
T7131 |
nummod |
1999,Soriano |
| R4913 |
T7133 |
T7131 |
punct |
),Soriano |
| R4914 |
T7134 |
T7135 |
compound |
X,Gal |
| R4915 |
T7135 |
T7137 |
compound |
Gal,staining |
| R4916 |
T7136 |
T7135 |
punct |
-,Gal |
| R4917 |
T7137 |
T7106 |
dobj |
staining,exhibit |
| R4918 |
T7138 |
T7106 |
prep |
in,exhibit |
| R4919 |
T7139 |
T7140 |
amod |
lateral,plate |
| R4920 |
T7140 |
T7141 |
compound |
plate,mesoderm |
| R4921 |
T7141 |
T7138 |
pobj |
mesoderm,in |
| R4922 |
T7142 |
T7141 |
cc |
but,mesoderm |
| R4923 |
T7143 |
T7142 |
neg |
not,but |
| R4924 |
T7144 |
T7145 |
npadvmod |
somite,derived |
| R4925 |
T7145 |
T7147 |
amod |
derived,mesoderm |
| R4926 |
T7146 |
T7145 |
punct |
-,derived |
| R4927 |
T7147 |
T7141 |
conj |
mesoderm,mesoderm |
| R4928 |
T7148 |
T7147 |
prep |
of,mesoderm |
| R4929 |
T7149 |
T7150 |
det |
the,trunk |
| R4930 |
T7150 |
T7148 |
pobj |
trunk,of |
| R4931 |
T7151 |
T7106 |
punct |
.,exhibit |
| R4932 |
T7153 |
T7154 |
prep |
In,observed |
| R4933 |
T7155 |
T7156 |
amod |
whole,mount |
| R4934 |
T7156 |
T7158 |
compound |
mount,preparations |
| R4935 |
T7157 |
T7156 |
punct |
-,mount |
| R4936 |
T7158 |
T7153 |
pobj |
preparations,In |
| R4937 |
T7159 |
T7158 |
compound |
skin,preparations |
| R4938 |
T7160 |
T7158 |
prep |
from,preparations |
| R4939 |
T7161 |
T7162 |
nmod |
P1.5,animals |
| R4940 |
T7162 |
T7160 |
pobj |
animals,from |
| R4941 |
T7163 |
T7161 |
cc |
or,P1.5 |
| R4942 |
T7164 |
T7161 |
conj |
P4.5,P1.5 |
| R4943 |
T7165 |
T7162 |
amod |
neonatal,animals |
| R4944 |
T7166 |
T7154 |
punct |
", ",observed |
| R4945 |
T7167 |
T7154 |
nsubj |
we,observed |
| R4946 |
T7168 |
T7169 |
det |
a,band |
| R4947 |
T7169 |
T7154 |
dobj |
band,observed |
| R4948 |
T7170 |
T7169 |
amod |
ventral,band |
| R4949 |
T7171 |
T7169 |
prep |
of,band |
| R4950 |
T7172 |
T7173 |
amod |
dark,staining |
| R4951 |
T7173 |
T7171 |
pobj |
staining,of |
| R4952 |
T7174 |
T7173 |
compound |
X,staining |
| R4953 |
T7175 |
T7173 |
punct |
-,staining |
| R4954 |
T7176 |
T7173 |
compound |
Gal,staining |
| R4955 |
T7177 |
T7169 |
acl |
corresponding,band |
| R4956 |
T7178 |
T7177 |
prep |
to,corresponding |
| R4957 |
T7179 |
T7180 |
amod |
lateral,plate |
| R4958 |
T7180 |
T7181 |
npadvmod |
plate,derived |
| R4959 |
T7181 |
T7183 |
amod |
derived,dermis |
| R4960 |
T7182 |
T7181 |
punct |
-,derived |
| R4961 |
T7183 |
T7178 |
pobj |
dermis,to |
| R4962 |
T7184 |
T7183 |
punct |
", ",dermis |
| R4963 |
T7185 |
T7186 |
dep |
which,represents |
| R4964 |
T7186 |
T7183 |
relcl |
represents,dermis |
| R4965 |
T7187 |
T7188 |
nummod |
63,% |
| R4966 |
T7188 |
T7186 |
dobj |
%,represents |
| R4967 |
T7189 |
T7188 |
prep |
of,% |
| R4968 |
T7190 |
T7191 |
det |
the,circumference |
| R4969 |
T7191 |
T7189 |
pobj |
circumference,of |
| R4970 |
T7192 |
T7191 |
amod |
total,circumference |
| R4971 |
T7193 |
T7194 |
punct |
(,Figure |
| R4972 |
T7194 |
T7154 |
parataxis |
Figure,observed |
| R4973 |
T7195 |
T7194 |
nummod |
8A,Figure |
| R4974 |
T7196 |
T7194 |
punct |
),Figure |
| R4975 |
T7197 |
T7154 |
punct |
.,observed |
| R4976 |
T7199 |
T7200 |
advmod |
However,represents |
| R4977 |
T7200 |
T7215 |
ccomp |
represents,are |
| R4978 |
T7201 |
T7200 |
punct |
", ",represents |
| R4979 |
T7202 |
T7200 |
prep |
in,represents |
| R4980 |
T7203 |
T7204 |
amod |
parallel,preparations |
| R4981 |
T7204 |
T7202 |
pobj |
preparations,in |
| R4982 |
T7205 |
T7204 |
prep |
from,preparations |
| R4983 |
T7206 |
T7207 |
compound |
at,at |
| R4984 |
T7207 |
T7209 |
compound |
at,mice |
| R4985 |
T7208 |
T7207 |
punct |
/,at |
| R4986 |
T7209 |
T7205 |
pobj |
mice,from |
| R4987 |
T7210 |
T7200 |
punct |
", ",represents |
| R4988 |
T7211 |
T7212 |
det |
the,domain |
| R4989 |
T7212 |
T7200 |
nsubj |
domain,represents |
| R4990 |
T7213 |
T7212 |
amod |
ventral,domain |
| R4991 |
T7214 |
T7212 |
compound |
pheomelanin,domain |
| R4992 |
T7216 |
T7217 |
nummod |
47,% |
| R4993 |
T7217 |
T7200 |
dobj |
%,represents |
| R4994 |
T7218 |
T7217 |
prep |
of,% |
| R4995 |
T7219 |
T7220 |
det |
the,circumference |
| R4996 |
T7220 |
T7218 |
pobj |
circumference,of |
| R4997 |
T7221 |
T7220 |
amod |
total,circumference |
| R4998 |
T7222 |
T7220 |
compound |
skin,circumference |
| R4999 |
T7223 |
T7215 |
punct |
;,are |
| R5000 |
T7224 |
T7215 |
advmod |
therefore,are |
| R5001 |
T7225 |
T7215 |
punct |
", ",are |
| R5002 |
T7226 |
T7227 |
det |
the,proportions |
| R5003 |
T7227 |
T7215 |
nsubj |
proportions,are |
| R5004 |
T7228 |
T7227 |
prep |
of,proportions |
| R5005 |
T7229 |
T7230 |
amod |
total,circumference |
| R5006 |
T7230 |
T7228 |
pobj |
circumference,of |
| R5007 |
T7231 |
T7230 |
compound |
skin,circumference |
| R5008 |
T7232 |
T7230 |
acl |
occupied,circumference |
| R5009 |
T7233 |
T7232 |
agent |
by,occupied |
| R5010 |
T7234 |
T7235 |
amod |
dorsal,eumelanin |
| R5011 |
T7235 |
T7236 |
nmod |
eumelanin,dermis |
| R5012 |
T7236 |
T7233 |
pobj |
dermis,by |
| R5013 |
T7237 |
T7235 |
cc |
and,eumelanin |
| R5014 |
T7238 |
T7239 |
npadvmod |
somite,derived |
| R5015 |
T7239 |
T7235 |
conj |
derived,eumelanin |
| R5016 |
T7240 |
T7239 |
punct |
-,derived |
| R5017 |
T7241 |
T7242 |
nummod |
53,% |
| R5018 |
T7242 |
T7215 |
attr |
%,are |
| R5019 |
T7243 |
T7242 |
cc |
and,% |
| R5020 |
T7244 |
T7245 |
nummod |
37,% |
| R5021 |
T7245 |
T7242 |
conj |
%,% |
| R5022 |
T7246 |
T7215 |
punct |
", ",are |
| R5023 |
T7247 |
T7215 |
advmod |
respectively,are |
| R5024 |
T7248 |
T7249 |
punct |
(,Figure |
| R5025 |
T7249 |
T7215 |
parataxis |
Figure,are |
| R5026 |
T7250 |
T7249 |
nummod |
8B,Figure |
| R5027 |
T7251 |
T7249 |
punct |
),Figure |
| R5028 |
T7252 |
T7215 |
punct |
.,are |
| R5029 |
T7254 |
T7255 |
det |
These,results |
| R5030 |
T7255 |
T7256 |
nsubj |
results,indicate |
| R5031 |
T7257 |
T7258 |
mark |
that,is |
| R5032 |
T7258 |
T7256 |
ccomp |
is,indicate |
| R5033 |
T7259 |
T7260 |
det |
the,boundary |
| R5034 |
T7260 |
T7258 |
nsubj |
boundary,is |
| R5035 |
T7261 |
T7260 |
compound |
pigmentation,boundary |
| R5036 |
T7262 |
T7258 |
advmod |
clearly,is |
| R5037 |
T7263 |
T7258 |
acomp |
distinct,is |
| R5038 |
T7264 |
T7263 |
prep |
from,distinct |
| R5039 |
T7265 |
T7263 |
punct |
", ",distinct |
| R5040 |
T7266 |
T7263 |
cc |
and,distinct |
| R5041 |
T7267 |
T7268 |
advmod |
more,ventral |
| R5042 |
T7268 |
T7263 |
conj |
ventral,distinct |
| R5043 |
T7269 |
T7268 |
prep |
to,ventral |
| R5044 |
T7270 |
T7268 |
punct |
", ",ventral |
| R5045 |
T7271 |
T7272 |
det |
the,boundary |
| R5046 |
T7272 |
T7268 |
conj |
boundary,ventral |
| R5047 |
T7273 |
T7272 |
prep |
between,boundary |
| R5048 |
T7274 |
T7275 |
amod |
lateral,plate |
| R5049 |
T7275 |
T7276 |
npadvmod |
plate,derived |
| R5050 |
T7276 |
T7281 |
amod |
derived,dermis |
| R5051 |
T7277 |
T7275 |
punct |
-,plate |
| R5052 |
T7278 |
T7275 |
cc |
and,plate |
| R5053 |
T7279 |
T7275 |
conj |
somite,plate |
| R5054 |
T7280 |
T7276 |
punct |
-,derived |
| R5055 |
T7281 |
T7273 |
pobj |
dermis,between |
| R5056 |
T7282 |
T7256 |
punct |
.,indicate |
| R5057 |
T7284 |
T7285 |
mark |
Because,lies |
| R5058 |
T7285 |
T7289 |
advcl |
lies,wondered |
| R5059 |
T7286 |
T7287 |
det |
the,boundary |
| R5060 |
T7287 |
T7285 |
nsubj |
boundary,lies |
| R5061 |
T7288 |
T7287 |
compound |
pigmentation,boundary |
| R5062 |
T7290 |
T7285 |
prep |
in,lies |
| R5063 |
T7291 |
T7290 |
pobj |
register,in |
| R5064 |
T7292 |
T7291 |
prep |
with,register |
| R5065 |
T7293 |
T7294 |
det |
the,junction |
| R5066 |
T7294 |
T7292 |
pobj |
junction,with |
| R5067 |
T7295 |
T7294 |
nmod |
limb,junction |
| R5068 |
T7296 |
T7295 |
punct |
–,limb |
| R5069 |
T7297 |
T7298 |
compound |
body,wall |
| R5070 |
T7298 |
T7295 |
appos |
wall,limb |
| R5071 |
T7299 |
T7300 |
punct |
(,see |
| R5072 |
T7300 |
T7285 |
parataxis |
see,lies |
| R5073 |
T7301 |
T7300 |
dobj |
Figure,see |
| R5074 |
T7302 |
T7301 |
nummod |
2,Figure |
| R5075 |
T7303 |
T7300 |
punct |
),see |
| R5076 |
T7304 |
T7289 |
punct |
", ",wondered |
| R5077 |
T7305 |
T7289 |
nsubj |
we,wondered |
| R5078 |
T7306 |
T7307 |
mark |
whether,be |
| R5079 |
T7307 |
T7289 |
ccomp |
be,wondered |
| R5080 |
T7308 |
T7307 |
nsubj |
mechanisms,be |
| R5081 |
T7309 |
T7308 |
acl |
used,mechanisms |
| R5082 |
T7310 |
T7309 |
prep |
for,used |
| R5083 |
T7311 |
T7312 |
amod |
dorsoventral,patterning |
| R5084 |
T7312 |
T7310 |
pobj |
patterning,for |
| R5085 |
T7313 |
T7312 |
compound |
limb,patterning |
| R5086 |
T7314 |
T7307 |
aux |
might,be |
| R5087 |
T7315 |
T7307 |
acomp |
related,be |
| R5088 |
T7316 |
T7315 |
prep |
to,related |
| R5089 |
T7317 |
T7316 |
pobj |
those,to |
| R5090 |
T7318 |
T7317 |
acl |
used,those |
| R5091 |
T7319 |
T7320 |
aux |
to,establish |
| R5092 |
T7320 |
T7318 |
advcl |
establish,used |
| R5093 |
T7321 |
T7322 |
det |
the,boundary |
| R5094 |
T7322 |
T7320 |
dobj |
boundary,establish |
| R5095 |
T7323 |
T7322 |
compound |
pigmentation,boundary |
| R5096 |
T7324 |
T7289 |
punct |
.,wondered |
| R5097 |
T7326 |
T7327 |
prep |
In,are |
| R5098 |
T7328 |
T7329 |
det |
the,limb |
| R5099 |
T7329 |
T7326 |
pobj |
limb,In |
| R5100 |
T7330 |
T7329 |
amod |
developing,limb |
| R5101 |
T7331 |
T7327 |
punct |
", ",are |
| R5102 |
T7332 |
T7327 |
nsubj |
Engrailed1,are |
| R5103 |
T7333 |
T7332 |
punct |
(,Engrailed1 |
| R5104 |
T7334 |
T7332 |
appos |
En1,Engrailed1 |
| R5105 |
T7335 |
T7332 |
punct |
),Engrailed1 |
| R5106 |
T7336 |
T7332 |
punct |
", ",Engrailed1 |
| R5107 |
T7337 |
T7332 |
conj |
Wnt7a,Engrailed1 |
| R5108 |
T7338 |
T7337 |
punct |
", ",Wnt7a |
| R5109 |
T7339 |
T7337 |
cc |
and,Wnt7a |
| R5110 |
T7340 |
T7337 |
conj |
Lmx1b,Wnt7a |
| R5111 |
T7341 |
T7327 |
attr |
part,are |
| R5112 |
T7342 |
T7341 |
prep |
of,part |
| R5113 |
T7343 |
T7344 |
det |
a,network |
| R5114 |
T7344 |
T7342 |
pobj |
network,of |
| R5115 |
T7345 |
T7346 |
poss |
whose,domains |
| R5116 |
T7346 |
T7348 |
dep |
domains,help |
| R5117 |
T7347 |
T7346 |
amod |
restricted,domains |
| R5118 |
T7348 |
T7344 |
relcl |
help,network |
| R5119 |
T7349 |
T7346 |
prep |
of,domains |
| R5120 |
T7350 |
T7349 |
pobj |
expression,of |
| R5121 |
T7351 |
T7352 |
aux |
to,establish |
| R5122 |
T7352 |
T7348 |
xcomp |
establish,help |
| R5123 |
T7353 |
T7354 |
amod |
dorsoventral,identity |
| R5124 |
T7354 |
T7352 |
dobj |
identity,establish |
| R5125 |
T7355 |
T7356 |
punct |
(,reviewed |
| R5126 |
T7356 |
T7352 |
parataxis |
reviewed,establish |
| R5127 |
T7357 |
T7356 |
prep |
in,reviewed |
| R5128 |
T7358 |
T7357 |
pobj |
Niswander,in |
| R5129 |
T7359 |
T7358 |
npadvmod |
2003,Niswander |
| R5130 |
T7360 |
T7356 |
punct |
),reviewed |
| R5131 |
T7361 |
T7327 |
punct |
.,are |
| R5132 |
T7363 |
T7364 |
nsubjpass |
En1,expressed |
| R5133 |
T7364 |
T7367 |
ccomp |
expressed,reveal |
| R5134 |
T7365 |
T7364 |
auxpass |
is,expressed |
| R5135 |
T7366 |
T7364 |
advmod |
transiently,expressed |
| R5136 |
T7368 |
T7364 |
prep |
in,expressed |
| R5137 |
T7369 |
T7370 |
det |
the,flank |
| R5138 |
T7370 |
T7368 |
pobj |
flank,in |
| R5139 |
T7371 |
T7370 |
amod |
developing,flank |
| R5140 |
T7372 |
T7367 |
punct |
;,reveal |
| R5141 |
T7373 |
T7367 |
prep |
at,reveal |
| R5142 |
T7374 |
T7373 |
pobj |
E11.5,at |
| R5143 |
T7375 |
T7367 |
punct |
", ",reveal |
| R5144 |
T7376 |
T7377 |
amod |
transverse,sections |
| R5145 |
T7377 |
T7367 |
nsubj |
sections,reveal |
| R5146 |
T7378 |
T7377 |
amod |
abdominal,sections |
| R5147 |
T7379 |
T7367 |
dobj |
domains,reveal |
| R5148 |
T7380 |
T7367 |
prep |
in,reveal |
| R5149 |
T7381 |
T7382 |
det |
the,tube |
| R5150 |
T7382 |
T7380 |
pobj |
tube,in |
| R5151 |
T7383 |
T7382 |
amod |
neural,tube |
| R5152 |
T7384 |
T7382 |
punct |
", ",tube |
| R5153 |
T7385 |
T7386 |
npadvmod |
somite,derived |
| R5154 |
T7386 |
T7388 |
amod |
derived,mesenchyme |
| R5155 |
T7387 |
T7386 |
punct |
-,derived |
| R5156 |
T7388 |
T7382 |
conj |
mesenchyme,tube |
| R5157 |
T7389 |
T7388 |
punct |
", ",mesenchyme |
| R5158 |
T7390 |
T7388 |
cc |
and,mesenchyme |
| R5159 |
T7391 |
T7392 |
det |
the,wall |
| R5160 |
T7392 |
T7388 |
conj |
wall,mesenchyme |
| R5161 |
T7393 |
T7392 |
amod |
ventral,wall |
| R5162 |
T7394 |
T7392 |
compound |
body,wall |
| R5163 |
T7395 |
T7396 |
punct |
(,Figure |
| R5164 |
T7396 |
T7367 |
parataxis |
Figure,reveal |
| R5165 |
T7397 |
T7396 |
nummod |
8C,Figure |
| R5166 |
T7398 |
T7396 |
punct |
),Figure |
| R5167 |
T7399 |
T7367 |
punct |
.,reveal |
| R5168 |
T7401 |
T7402 |
det |
An,section |
| R5169 |
T7402 |
T7404 |
nsubj |
section,reveals |
| R5170 |
T7403 |
T7402 |
amod |
adjacent,section |
| R5171 |
T7405 |
T7402 |
acl |
hybridized,section |
| R5172 |
T7406 |
T7405 |
prep |
with,hybridized |
| R5173 |
T7407 |
T7406 |
pobj |
Tbx15,with |
| R5174 |
T7408 |
T7409 |
det |
a,pattern |
| R5175 |
T7409 |
T7404 |
dobj |
pattern,reveals |
| R5176 |
T7410 |
T7409 |
amod |
complementary,pattern |
| R5177 |
T7411 |
T7409 |
prep |
in,pattern |
| R5178 |
T7412 |
T7413 |
det |
the,flank |
| R5179 |
T7413 |
T7411 |
pobj |
flank,in |
| R5180 |
T7414 |
T7409 |
punct |
", ",pattern |
| R5181 |
T7415 |
T7416 |
dep |
which,provides |
| R5182 |
T7416 |
T7409 |
relcl |
provides,pattern |
| R5183 |
T7417 |
T7418 |
amod |
additional,evidence |
| R5184 |
T7418 |
T7416 |
dobj |
evidence,provides |
| R5185 |
T7419 |
T7418 |
prep |
for,evidence |
| R5186 |
T7420 |
T7421 |
amod |
developmental,mechanisms |
| R5187 |
T7421 |
T7419 |
pobj |
mechanisms,for |
| R5188 |
T7422 |
T7423 |
dep |
that,establish |
| R5189 |
T7423 |
T7421 |
relcl |
establish,mechanisms |
| R5190 |
T7424 |
T7425 |
det |
a,boundary |
| R5191 |
T7425 |
T7423 |
dobj |
boundary,establish |
| R5192 |
T7426 |
T7425 |
compound |
pigmentation,boundary |
| R5193 |
T7427 |
T7428 |
advmod |
entirely,within |
| R5194 |
T7428 |
T7425 |
prep |
within,boundary |
| R5195 |
T7429 |
T7430 |
amod |
lateral,plate |
| R5196 |
T7430 |
T7431 |
compound |
plate,mesoderm |
| R5197 |
T7431 |
T7428 |
pobj |
mesoderm,within |
| R5198 |
T7432 |
T7428 |
cc |
and,within |
| R5199 |
T7433 |
T7428 |
conj |
independent,within |
| R5200 |
T7434 |
T7433 |
prep |
of,independent |
| R5201 |
T7435 |
T7436 |
compound |
lineage,restrictions |
| R5202 |
T7436 |
T7434 |
pobj |
restrictions,of |
| R5203 |
T7437 |
T7436 |
acl |
imposed,restrictions |
| R5204 |
T7438 |
T7437 |
agent |
by,imposed |
| R5205 |
T7439 |
T7440 |
det |
the,frontier |
| R5206 |
T7440 |
T7438 |
pobj |
frontier,by |
| R5207 |
T7441 |
T7440 |
amod |
lateral,frontier |
| R5208 |
T7442 |
T7440 |
amod |
somitic,frontier |
| R5209 |
T7443 |
T7404 |
punct |
.,reveals |
| R5210 |
T7563 |
T7564 |
amod |
Several,mutations |
| R5211 |
T7564 |
T7565 |
nsubjpass |
mutations,identified |
| R5212 |
T7566 |
T7564 |
cc |
and,mutations |
| R5213 |
T7567 |
T7564 |
conj |
genes,mutations |
| R5214 |
T7568 |
T7565 |
aux |
have,identified |
| R5215 |
T7569 |
T7565 |
auxpass |
been,identified |
| R5216 |
T7570 |
T7571 |
dep |
that,affect |
| R5217 |
T7571 |
T7565 |
ccomp |
affect,identified |
| R5218 |
T7572 |
T7573 |
det |
the,pattern |
| R5219 |
T7573 |
T7571 |
dobj |
pattern,affect |
| R5220 |
T7574 |
T7573 |
prep |
of,pattern |
| R5221 |
T7575 |
T7576 |
compound |
hair,follicle |
| R5222 |
T7576 |
T7577 |
compound |
follicle,development |
| R5223 |
T7577 |
T7574 |
pobj |
development,of |
| R5224 |
T7578 |
T7565 |
punct |
", ",identified |
| R5225 |
T7579 |
T7565 |
cc |
but,identified |
| R5226 |
T7580 |
T7581 |
nsubj |
Tbx15,is |
| R5227 |
T7581 |
T7565 |
conj |
is,identified |
| R5228 |
T7582 |
T7583 |
det |
the,gene |
| R5229 |
T7583 |
T7581 |
attr |
gene,is |
| R5230 |
T7584 |
T7583 |
amod |
only,gene |
| R5231 |
T7585 |
T7586 |
prep |
of,are |
| R5232 |
T7586 |
T7583 |
relcl |
are,gene |
| R5233 |
T7587 |
T7585 |
pobj |
which,of |
| R5234 |
T7588 |
T7586 |
nsubj |
we,are |
| R5235 |
T7589 |
T7586 |
acomp |
aware,are |
| R5236 |
T7590 |
T7591 |
dep |
that,affects |
| R5237 |
T7591 |
T7583 |
relcl |
affects,gene |
| R5238 |
T7592 |
T7593 |
det |
the,pattern |
| R5239 |
T7593 |
T7591 |
dobj |
pattern,affects |
| R5240 |
T7594 |
T7593 |
prep |
of,pattern |
| R5241 |
T7595 |
T7596 |
compound |
hair,pigmentation |
| R5242 |
T7596 |
T7594 |
pobj |
pigmentation,of |
| R5243 |
T7597 |
T7591 |
prep |
in,affects |
| R5244 |
T7598 |
T7599 |
amod |
different,regions |
| R5245 |
T7599 |
T7597 |
pobj |
regions,in |
| R5246 |
T7600 |
T7599 |
compound |
body,regions |
| R5247 |
T7601 |
T7581 |
punct |
.,is |
| R5248 |
T7603 |
T7604 |
amod |
Ventral,areas |
| R5249 |
T7604 |
T7605 |
nsubjpass |
areas,expanded |
| R5250 |
T7606 |
T7607 |
dep |
that,produce |
| R5251 |
T7607 |
T7604 |
relcl |
produce,areas |
| R5252 |
T7608 |
T7607 |
advmod |
normally,produce |
| R5253 |
T7609 |
T7610 |
amod |
yellow,hair |
| R5254 |
T7610 |
T7607 |
dobj |
hair,produce |
| R5255 |
T7611 |
T7607 |
prep |
in,produce |
| R5256 |
T7612 |
T7613 |
det |
the,trunk |
| R5257 |
T7613 |
T7611 |
pobj |
trunk,in |
| R5258 |
T7614 |
T7613 |
punct |
", ",trunk |
| R5259 |
T7615 |
T7613 |
conj |
limbs,trunk |
| R5260 |
T7616 |
T7615 |
punct |
", ",limbs |
| R5261 |
T7617 |
T7615 |
cc |
and,limbs |
| R5262 |
T7618 |
T7619 |
amod |
craniofacial,regions |
| R5263 |
T7619 |
T7615 |
conj |
regions,limbs |
| R5264 |
T7620 |
T7605 |
auxpass |
are,expanded |
| R5265 |
T7621 |
T7605 |
prep |
in,expanded |
| R5266 |
T7622 |
T7623 |
nmod |
deH,deH |
| R5267 |
T7623 |
T7625 |
compound |
deH,mice |
| R5268 |
T7624 |
T7623 |
punct |
/,deH |
| R5269 |
T7625 |
T7621 |
pobj |
mice,in |
| R5270 |
T7626 |
T7605 |
cc |
and,expanded |
| R5271 |
T7627 |
T7605 |
punct |
", ",expanded |
| R5272 |
T7628 |
T7629 |
prep |
in,represent |
| R5273 |
T7629 |
T7605 |
conj |
represent,expanded |
| R5274 |
T7630 |
T7631 |
det |
the,trunk |
| R5275 |
T7631 |
T7628 |
pobj |
trunk,in |
| R5276 |
T7632 |
T7633 |
advmod |
at,least |
| R5277 |
T7633 |
T7629 |
advmod |
least,represent |
| R5278 |
T7634 |
T7629 |
punct |
", ",represent |
| R5279 |
T7635 |
T7636 |
amod |
inappropriate,expression |
| R5280 |
T7636 |
T7629 |
dobj |
expression,represent |
| R5281 |
T7637 |
T7636 |
amod |
dorsal,expression |
| R5282 |
T7638 |
T7636 |
prep |
of,expression |
| R5283 |
T7639 |
T7640 |
det |
an,isoform |
| R5284 |
T7640 |
T7638 |
pobj |
isoform,of |
| R5285 |
T7641 |
T7640 |
compound |
Agouti,isoform |
| R5286 |
T7642 |
T7640 |
compound |
mRNA,isoform |
| R5287 |
T7643 |
T7644 |
dep |
that,restricted |
| R5288 |
T7644 |
T7640 |
relcl |
restricted,isoform |
| R5289 |
T7645 |
T7644 |
auxpass |
is,restricted |
| R5290 |
T7646 |
T7644 |
advmod |
normally,restricted |
| R5291 |
T7647 |
T7644 |
prep |
to,restricted |
| R5292 |
T7648 |
T7649 |
amod |
ventral,skin |
| R5293 |
T7649 |
T7647 |
pobj |
skin,to |
| R5294 |
T7650 |
T7605 |
punct |
.,expanded |
| R5295 |
T7652 |
T7653 |
det |
The,allele |
| R5296 |
T7653 |
T7655 |
nsubjpass |
allele,caused |
| R5297 |
T7654 |
T7653 |
compound |
deH,allele |
| R5298 |
T7656 |
T7655 |
auxpass |
is,caused |
| R5299 |
T7657 |
T7655 |
agent |
by,caused |
| R5300 |
T7658 |
T7659 |
det |
a,deletion |
| R5301 |
T7659 |
T7657 |
pobj |
deletion,by |
| R5302 |
T7660 |
T7659 |
amod |
large,deletion |
| R5303 |
T7661 |
T7662 |
dep |
that,removes |
| R5304 |
T7662 |
T7659 |
relcl |
removes,deletion |
| R5305 |
T7663 |
T7662 |
dobj |
most,removes |
| R5306 |
T7664 |
T7663 |
prep |
of,most |
| R5307 |
T7665 |
T7666 |
det |
the,sequence |
| R5308 |
T7666 |
T7664 |
pobj |
sequence,of |
| R5309 |
T7667 |
T7666 |
compound |
Tbx15,sequence |
| R5310 |
T7668 |
T7666 |
compound |
coding,sequence |
| R5311 |
T7669 |
T7655 |
punct |
", ",caused |
| R5312 |
T7670 |
T7655 |
cc |
but,caused |
| R5313 |
T7671 |
T7672 |
det |
the,phenotype |
| R5314 |
T7672 |
T7674 |
nsubjpass |
phenotype,caused |
| R5315 |
T7673 |
T7672 |
amod |
pleiotropic,phenotype |
| R5316 |
T7674 |
T7655 |
conj |
caused,caused |
| R5317 |
T7675 |
T7674 |
auxpass |
is,caused |
| R5318 |
T7676 |
T7674 |
agent |
by,caused |
| R5319 |
T7677 |
T7678 |
det |
a,loss |
| R5320 |
T7678 |
T7676 |
pobj |
loss,by |
| R5321 |
T7679 |
T7678 |
amod |
simple,loss |
| R5322 |
T7680 |
T7678 |
prep |
of,loss |
| R5323 |
T7681 |
T7680 |
pobj |
function,of |
| R5324 |
T7682 |
T7678 |
prep |
for,loss |
| R5325 |
T7683 |
T7682 |
pobj |
Tbx15,for |
| R5326 |
T7684 |
T7685 |
advmod |
rather,than |
| R5327 |
T7685 |
T7678 |
cc |
than,loss |
| R5328 |
T7686 |
T7687 |
det |
a,effect |
| R5329 |
T7687 |
T7678 |
conj |
effect,loss |
| R5330 |
T7688 |
T7689 |
amod |
dominant,negative |
| R5331 |
T7689 |
T7687 |
amod |
negative,effect |
| R5332 |
T7690 |
T7689 |
punct |
-,negative |
| R5333 |
T7691 |
T7689 |
cc |
or,negative |
| R5334 |
T7692 |
T7689 |
conj |
contiguous,negative |
| R5335 |
T7693 |
T7687 |
compound |
gene,effect |
| R5336 |
T7694 |
T7674 |
punct |
.,caused |
| R5337 |
T7696 |
T7697 |
prep |
In,is |
| R5338 |
T7698 |
T7696 |
amod |
particular,In |
| R5339 |
T7699 |
T7697 |
punct |
", ",is |
| R5340 |
T7700 |
T7697 |
expl |
there,is |
| R5341 |
T7701 |
T7702 |
det |
no,phenotype |
| R5342 |
T7702 |
T7697 |
attr |
phenotype,is |
| R5343 |
T7703 |
T7702 |
amod |
heterozygous,phenotype |
| R5344 |
T7704 |
T7697 |
punct |
", ",is |
| R5345 |
T7705 |
T7706 |
det |
no,genes |
| R5346 |
T7706 |
T7708 |
nsubj |
genes,lie |
| R5347 |
T7707 |
T7706 |
amod |
other,genes |
| R5348 |
T7708 |
T7697 |
conj |
lie,is |
| R5349 |
T7709 |
T7708 |
prep |
within,lie |
| R5350 |
T7710 |
T7709 |
cc |
or,within |
| R5351 |
T7711 |
T7712 |
advmod |
close,breakpoints |
| R5352 |
T7712 |
T7709 |
conj |
breakpoints,within |
| R5353 |
T7713 |
T7711 |
prep |
to,close |
| R5354 |
T7714 |
T7712 |
det |
the,breakpoints |
| R5355 |
T7715 |
T7712 |
compound |
deletion,breakpoints |
| R5356 |
T7716 |
T7708 |
punct |
", ",lie |
| R5357 |
T7717 |
T7708 |
cc |
and,lie |
| R5358 |
T7718 |
T7719 |
det |
the,pattern |
| R5359 |
T7719 |
T7721 |
nsubj |
pattern,is |
| R5360 |
T7720 |
T7719 |
compound |
expression,pattern |
| R5361 |
T7721 |
T7708 |
conj |
is,lie |
| R5362 |
T7722 |
T7719 |
prep |
of,pattern |
| R5363 |
T7723 |
T7722 |
pobj |
Tbx15,of |
| R5364 |
T7724 |
T7721 |
acomp |
consistent,is |
| R5365 |
T7725 |
T7724 |
prep |
with,consistent |
| R5366 |
T7726 |
T7727 |
det |
the,spectrum |
| R5367 |
T7727 |
T7725 |
pobj |
spectrum,with |
| R5368 |
T7728 |
T7727 |
prep |
of,spectrum |
| R5369 |
T7729 |
T7730 |
amod |
phenotypic,abnormalities |
| R5370 |
T7730 |
T7728 |
pobj |
abnormalities,of |
| R5371 |
T7731 |
T7721 |
prep |
in,is |
| R5372 |
T7732 |
T7733 |
preconj |
both,allele |
| R5373 |
T7733 |
T7731 |
pobj |
allele,in |
| R5374 |
T7734 |
T7733 |
det |
the,allele |
| R5375 |
T7735 |
T7733 |
amod |
original,allele |
| R5376 |
T7736 |
T7733 |
compound |
de,allele |
| R5377 |
T7737 |
T7733 |
cc |
and,allele |
| R5378 |
T7738 |
T7739 |
det |
the,allele |
| R5379 |
T7739 |
T7733 |
conj |
allele,allele |
| R5380 |
T7740 |
T7739 |
compound |
deH,allele |
| R5381 |
T7741 |
T7721 |
punct |
.,is |
| R5382 |
T7743 |
T7744 |
advmod |
Finally,has |
| R5383 |
T7745 |
T7744 |
punct |
", ",has |
| R5384 |
T7746 |
T7747 |
det |
a,allele |
| R5385 |
T7747 |
T7744 |
nsubj |
allele,has |
| R5386 |
T7748 |
T7747 |
nmod |
Tbx15,allele |
| R5387 |
T7749 |
T7747 |
amod |
targeted,allele |
| R5388 |
T7750 |
T7751 |
det |
the,phenotype |
| R5389 |
T7751 |
T7744 |
dobj |
phenotype,has |
| R5390 |
T7752 |
T7751 |
amod |
same,phenotype |
| R5391 |
T7753 |
T7751 |
prep |
as,phenotype |
| R5392 |
T7754 |
T7753 |
pobj |
deH,as |
| R5393 |
T7755 |
T7744 |
punct |
.,has |
| R5394 |
T7757 |
T7758 |
poss |
Our,results |
| R5395 |
T7758 |
T7759 |
nsubj |
results,suggest |
| R5396 |
T7760 |
T7761 |
mark |
that,provides |
| R5397 |
T7761 |
T7759 |
ccomp |
provides,suggest |
| R5398 |
T7762 |
T7763 |
amod |
patterned,expression |
| R5399 |
T7763 |
T7761 |
nsubj |
expression,provides |
| R5400 |
T7764 |
T7763 |
prep |
of,expression |
| R5401 |
T7765 |
T7764 |
pobj |
Tbx15,of |
| R5402 |
T7766 |
T7767 |
det |
an,cue |
| R5403 |
T7767 |
T7761 |
dobj |
cue,provides |
| R5404 |
T7768 |
T7767 |
amod |
instructional,cue |
| R5405 |
T7769 |
T7767 |
acl |
required,cue |
| R5406 |
T7770 |
T7771 |
aux |
to,establish |
| R5407 |
T7771 |
T7769 |
advcl |
establish,required |
| R5408 |
T7772 |
T7773 |
det |
the,identity |
| R5409 |
T7773 |
T7771 |
dobj |
identity,establish |
| R5410 |
T7774 |
T7773 |
amod |
future,identity |
| R5411 |
T7775 |
T7773 |
prep |
of,identity |
| R5412 |
T7776 |
T7777 |
amod |
dorsal,dermis |
| R5413 |
T7777 |
T7775 |
pobj |
dermis,of |
| R5414 |
T7778 |
T7771 |
prep |
with,establish |
| R5415 |
T7779 |
T7778 |
pobj |
regard,with |
| R5416 |
T7780 |
T7779 |
prep |
to,regard |
| R5417 |
T7781 |
T7782 |
amod |
pigmentary,patterning |
| R5418 |
T7782 |
T7780 |
pobj |
patterning,to |
| R5419 |
T7783 |
T7781 |
cc |
and,pigmentary |
| R5420 |
T7784 |
T7785 |
compound |
hair,length |
| R5421 |
T7785 |
T7781 |
conj |
length,pigmentary |
| R5422 |
T7786 |
T7759 |
punct |
.,suggest |
| R5423 |
T7788 |
T7789 |
det |
The,edge |
| R5424 |
T7789 |
T7791 |
nsubj |
edge,correspond |
| R5425 |
T7790 |
T7789 |
amod |
ventral,edge |
| R5426 |
T7792 |
T7789 |
prep |
of,edge |
| R5427 |
T7793 |
T7794 |
compound |
Tbx15,expression |
| R5428 |
T7794 |
T7792 |
pobj |
expression,of |
| R5429 |
T7795 |
T7789 |
prep |
in,edge |
| R5430 |
T7796 |
T7797 |
det |
the,flank |
| R5431 |
T7797 |
T7795 |
pobj |
flank,in |
| R5432 |
T7798 |
T7797 |
amod |
developing,flank |
| R5433 |
T7799 |
T7791 |
aux |
does,correspond |
| R5434 |
T7800 |
T7791 |
neg |
not,correspond |
| R5435 |
T7801 |
T7791 |
prep |
to,correspond |
| R5436 |
T7802 |
T7803 |
det |
a,compartment |
| R5437 |
T7803 |
T7801 |
pobj |
compartment,to |
| R5438 |
T7804 |
T7803 |
amod |
known,compartment |
| R5439 |
T7805 |
T7803 |
compound |
lineage,compartment |
| R5440 |
T7806 |
T7791 |
punct |
", ",correspond |
| R5441 |
T7807 |
T7791 |
cc |
but,correspond |
| R5442 |
T7808 |
T7791 |
punct |
", ",correspond |
| R5443 |
T7809 |
T7810 |
prep |
like,occurs |
| R5444 |
T7810 |
T7791 |
conj |
occurs,correspond |
| R5445 |
T7811 |
T7812 |
compound |
limb,development |
| R5446 |
T7812 |
T7809 |
pobj |
development,like |
| R5447 |
T7813 |
T7810 |
punct |
", ",occurs |
| R5448 |
T7814 |
T7810 |
prep |
within,occurs |
| R5449 |
T7815 |
T7816 |
amod |
lateral,plate |
| R5450 |
T7816 |
T7817 |
compound |
plate,mesoderm |
| R5451 |
T7817 |
T7814 |
pobj |
mesoderm,within |
| R5452 |
T7818 |
T7791 |
punct |
.,correspond |
| R5453 |
T7820 |
T7821 |
det |
These,findings |
| R5454 |
T7821 |
T7822 |
nsubj |
findings,represent |
| R5455 |
T7823 |
T7824 |
det |
a,role |
| R5456 |
T7824 |
T7822 |
dobj |
role,represent |
| R5457 |
T7825 |
T7824 |
amod |
novel,role |
| R5458 |
T7826 |
T7824 |
prep |
for,role |
| R5459 |
T7827 |
T7828 |
compound |
T,box |
| R5460 |
T7828 |
T7830 |
compound |
box,action |
| R5461 |
T7829 |
T7828 |
punct |
-,box |
| R5462 |
T7830 |
T7826 |
pobj |
action,for |
| R5463 |
T7831 |
T7830 |
compound |
gene,action |
| R5464 |
T7832 |
T7824 |
prep |
in,role |
| R5465 |
T7833 |
T7834 |
amod |
embryonic,development |
| R5466 |
T7834 |
T7832 |
pobj |
development,in |
| R5467 |
T7835 |
T7822 |
cc |
and,represent |
| R5468 |
T7836 |
T7822 |
conj |
provide,represent |
| R5469 |
T7837 |
T7836 |
dobj |
evidence,provide |
| R5470 |
T7838 |
T7837 |
prep |
for,evidence |
| R5471 |
T7839 |
T7840 |
det |
a,complexity |
| R5472 |
T7840 |
T7838 |
pobj |
complexity,for |
| R5473 |
T7841 |
T7842 |
advmod |
previously,unappreciated |
| R5474 |
T7842 |
T7840 |
amod |
unappreciated,complexity |
| R5475 |
T7843 |
T7840 |
prep |
to,complexity |
| R5476 |
T7844 |
T7843 |
pobj |
acquisition,to |
| R5477 |
T7845 |
T7844 |
prep |
of,acquisition |
| R5478 |
T7846 |
T7847 |
amod |
dorsoventral,identity |
| R5479 |
T7847 |
T7845 |
pobj |
identity,of |
| R5480 |
T7848 |
T7847 |
amod |
positional,identity |
| R5481 |
T7849 |
T7844 |
prep |
in,acquisition |
| R5482 |
T7850 |
T7851 |
amod |
mammalian,skin |
| R5483 |
T7851 |
T7849 |
pobj |
skin,in |
| R5484 |
T7852 |
T7822 |
punct |
.,represent |
| R5485 |
T7946 |
T7947 |
amod |
Distinct,Regions |
| R5486 |
T7947 |
T7949 |
nsubj |
Regions,Represent |
| R5487 |
T7948 |
T7947 |
amod |
Morphologic,Regions |
| R5488 |
T7950 |
T7951 |
det |
the,Sum |
| R5489 |
T7951 |
T7949 |
dobj |
Sum,Represent |
| R5490 |
T7952 |
T7951 |
prep |
of,Sum |
| R5491 |
T7953 |
T7954 |
amod |
Different,Gradients |
| R5492 |
T7954 |
T7952 |
pobj |
Gradients,of |
| R5493 |
T7956 |
T7957 |
det |
The,boundary |
| R5494 |
T7957 |
T7959 |
nsubj |
boundary,is |
| R5495 |
T7958 |
T7957 |
amod |
visual,boundary |
| R5496 |
T7960 |
T7957 |
prep |
between,boundary |
| R5497 |
T7961 |
T7962 |
amod |
dorsal,skin |
| R5498 |
T7962 |
T7960 |
pobj |
skin,between |
| R5499 |
T7963 |
T7961 |
cc |
and,dorsal |
| R5500 |
T7964 |
T7961 |
conj |
ventral,dorsal |
| R5501 |
T7965 |
T7957 |
prep |
in,boundary |
| R5502 |
T7966 |
T7967 |
nmod |
at,at |
| R5503 |
T7967 |
T7969 |
compound |
at,mice |
| R5504 |
T7968 |
T7967 |
punct |
/,at |
| R5505 |
T7969 |
T7965 |
pobj |
mice,in |
| R5506 |
T7970 |
T7959 |
acomp |
reminiscent,is |
| R5507 |
T7971 |
T7970 |
prep |
of,reminiscent |
| R5508 |
T7972 |
T7973 |
amod |
other,systems |
| R5509 |
T7973 |
T7971 |
pobj |
systems,of |
| R5510 |
T7974 |
T7975 |
prep |
in,enforce |
| R5511 |
T7975 |
T7973 |
relcl |
enforce,systems |
| R5512 |
T7976 |
T7974 |
pobj |
which,in |
| R5513 |
T7977 |
T7978 |
amod |
adjacent,compartments |
| R5514 |
T7978 |
T7975 |
nsubj |
compartments,enforce |
| R5515 |
T7979 |
T7980 |
det |
a,choice |
| R5516 |
T7980 |
T7975 |
dobj |
choice,enforce |
| R5517 |
T7981 |
T7980 |
amod |
binary,choice |
| R5518 |
T7982 |
T7980 |
prep |
between,choice |
| R5519 |
T7983 |
T7984 |
amod |
alternative,patterns |
| R5520 |
T7984 |
T7982 |
pobj |
patterns,between |
| R5521 |
T7985 |
T7984 |
prep |
of,patterns |
| R5522 |
T7986 |
T7987 |
compound |
gene,expression |
| R5523 |
T7987 |
T7985 |
pobj |
expression,of |
| R5524 |
T7988 |
T7987 |
cc |
and,expression |
| R5525 |
T7989 |
T7990 |
compound |
cell,fate |
| R5526 |
T7990 |
T7987 |
conj |
fate,expression |
| R5527 |
T7991 |
T7992 |
punct |
(,reviewed |
| R5528 |
T7992 |
T7959 |
parataxis |
reviewed,is |
| R5529 |
T7993 |
T7992 |
prep |
in,reviewed |
| R5530 |
T7994 |
T7993 |
pobj |
Dahmann,in |
| R5531 |
T7995 |
T7994 |
cc |
and,Dahmann |
| R5532 |
T7996 |
T7994 |
conj |
Basler,Dahmann |
| R5533 |
T7997 |
T7994 |
npadvmod |
1999,Dahmann |
| R5534 |
T7998 |
T7992 |
punct |
),reviewed |
| R5535 |
T7999 |
T7959 |
punct |
.,is |
| R5536 |
T8001 |
T8002 |
advmod |
However,distributed |
| R5537 |
T8003 |
T8002 |
punct |
", ",distributed |
| R5538 |
T8004 |
T8005 |
compound |
Agouti,mRNA |
| R5539 |
T8005 |
T8002 |
nsubjpass |
mRNA,distributed |
| R5540 |
T8006 |
T8005 |
prep |
in,mRNA |
| R5541 |
T8007 |
T8008 |
preconj |
both,embryonic |
| R5542 |
T8008 |
T8009 |
amod |
embryonic,skin |
| R5543 |
T8009 |
T8006 |
pobj |
skin,in |
| R5544 |
T8010 |
T8008 |
cc |
and,embryonic |
| R5545 |
T8011 |
T8008 |
conj |
postnatal,embryonic |
| R5546 |
T8012 |
T8002 |
auxpass |
is,distributed |
| R5547 |
T8013 |
T8002 |
prep |
along,distributed |
| R5548 |
T8014 |
T8015 |
det |
a,gradient |
| R5549 |
T8015 |
T8013 |
pobj |
gradient,along |
| R5550 |
T8016 |
T8017 |
poss |
whose,boundary |
| R5551 |
T8017 |
T8019 |
dep |
boundary,is |
| R5552 |
T8018 |
T8017 |
amod |
dorsal,boundary |
| R5553 |
T8019 |
T8015 |
relcl |
is,gradient |
| R5554 |
T8020 |
T8019 |
acomp |
indistinct,is |
| R5555 |
T8021 |
T8019 |
cc |
and,is |
| R5556 |
T8022 |
T8019 |
conj |
overlaps,is |
| R5557 |
T8023 |
T8022 |
prep |
with,overlaps |
| R5558 |
T8024 |
T8025 |
nummod |
two,gradients |
| R5559 |
T8025 |
T8023 |
pobj |
gradients,with |
| R5560 |
T8026 |
T8025 |
amod |
additional,gradients |
| R5561 |
T8027 |
T8025 |
acl |
recognized,gradients |
| R5562 |
T8028 |
T8027 |
prep |
by,recognized |
| R5563 |
T8029 |
T8030 |
poss |
their,effects |
| R5564 |
T8030 |
T8028 |
pobj |
effects,by |
| R5565 |
T8031 |
T8030 |
prep |
on,effects |
| R5566 |
T8032 |
T8033 |
compound |
hair,length |
| R5567 |
T8033 |
T8031 |
pobj |
length,on |
| R5568 |
T8034 |
T8033 |
cc |
and,length |
| R5569 |
T8035 |
T8036 |
amod |
histochemical,staining |
| R5570 |
T8036 |
T8033 |
conj |
staining,length |
| R5571 |
T8037 |
T8002 |
prep |
for,distributed |
| R5572 |
T8038 |
T8037 |
pobj |
melanocytes,for |
| R5573 |
T8039 |
T8002 |
punct |
.,distributed |
| R5574 |
T8041 |
T8042 |
det |
The,gradients |
| R5575 |
T8042 |
T8044 |
nsubj |
gradients,are |
| R5576 |
T8043 |
T8042 |
nummod |
three,gradients |
| R5577 |
T8045 |
T8044 |
acomp |
close,are |
| R5578 |
T8046 |
T8045 |
cc |
but,close |
| R5579 |
T8047 |
T8046 |
neg |
not,but |
| R5580 |
T8048 |
T8045 |
conj |
congruent,close |
| R5581 |
T8049 |
T8044 |
punct |
", ",are |
| R5582 |
T8050 |
T8044 |
cc |
and,are |
| R5583 |
T8051 |
T8052 |
nsubj |
it,is |
| R5584 |
T8052 |
T8044 |
conj |
is,are |
| R5585 |
T8053 |
T8054 |
poss |
their,proximity |
| R5586 |
T8054 |
T8052 |
attr |
proximity,is |
| R5587 |
T8055 |
T8056 |
dep |
that,gives |
| R5588 |
T8056 |
T8052 |
ccomp |
gives,is |
| R5589 |
T8057 |
T8056 |
dobj |
rise,gives |
| R5590 |
T8058 |
T8056 |
prep |
to,gives |
| R5591 |
T8059 |
T8060 |
det |
the,distinction |
| R5592 |
T8060 |
T8058 |
pobj |
distinction,to |
| R5593 |
T8061 |
T8060 |
amod |
superficial,distinction |
| R5594 |
T8062 |
T8060 |
prep |
between,distinction |
| R5595 |
T8063 |
T8064 |
amod |
dorsal,skin |
| R5596 |
T8064 |
T8062 |
pobj |
skin,between |
| R5597 |
T8065 |
T8063 |
cc |
and,dorsal |
| R5598 |
T8066 |
T8063 |
conj |
ventral,dorsal |
| R5599 |
T8067 |
T8064 |
prep |
of,skin |
| R5600 |
T8068 |
T8069 |
nmod |
at,at |
| R5601 |
T8069 |
T8071 |
compound |
at,mice |
| R5602 |
T8070 |
T8069 |
punct |
/,at |
| R5603 |
T8071 |
T8067 |
pobj |
mice,of |
| R5604 |
T8072 |
T8052 |
punct |
.,is |
| R5605 |
T8074 |
T8075 |
advmod |
Indeed,give |
| R5606 |
T8076 |
T8075 |
punct |
", ",give |
| R5607 |
T8077 |
T8078 |
amod |
slight,differences |
| R5608 |
T8078 |
T8075 |
nsubj |
differences,give |
| R5609 |
T8079 |
T8078 |
prep |
between,differences |
| R5610 |
T8080 |
T8081 |
det |
the,regions |
| R5611 |
T8081 |
T8079 |
pobj |
regions,between |
| R5612 |
T8082 |
T8081 |
prep |
of,regions |
| R5613 |
T8083 |
T8082 |
pobj |
transition,of |
| R5614 |
T8084 |
T8081 |
prep |
for,regions |
| R5615 |
T8085 |
T8086 |
compound |
pigment,type |
| R5616 |
T8086 |
T8088 |
compound |
type,switching |
| R5617 |
T8087 |
T8086 |
punct |
-,type |
| R5618 |
T8088 |
T8084 |
pobj |
switching,for |
| R5619 |
T8089 |
T8088 |
cc |
and,switching |
| R5620 |
T8090 |
T8091 |
compound |
pigment,content |
| R5621 |
T8091 |
T8088 |
conj |
content,switching |
| R5622 |
T8092 |
T8075 |
dobj |
rise,give |
| R5623 |
T8093 |
T8075 |
prep |
to,give |
| R5624 |
T8094 |
T8095 |
det |
a,stripe |
| R5625 |
T8095 |
T8093 |
pobj |
stripe,to |
| R5626 |
T8096 |
T8095 |
amod |
subtle,stripe |
| R5627 |
T8097 |
T8095 |
amod |
yellow,stripe |
| R5628 |
T8098 |
T8095 |
prep |
along,stripe |
| R5629 |
T8099 |
T8100 |
det |
the,flank |
| R5630 |
T8100 |
T8098 |
pobj |
flank,along |
| R5631 |
T8101 |
T8102 |
punct |
(,see |
| R5632 |
T8102 |
T8075 |
parataxis |
see,give |
| R5633 |
T8103 |
T8104 |
nmod |
Figures,1 |
| R5634 |
T8104 |
T8102 |
dobj |
1,see |
| R5635 |
T8105 |
T8104 |
punct |
", ",1 |
| R5636 |
T8106 |
T8104 |
conj |
2,1 |
| R5637 |
T8107 |
T8106 |
punct |
", ",2 |
| R5638 |
T8108 |
T8106 |
cc |
and,2 |
| R5639 |
T8109 |
T8106 |
conj |
9A,2 |
| R5640 |
T8110 |
T8102 |
punct |
),see |
| R5641 |
T8111 |
T8075 |
punct |
.,give |
| R5642 |
T8113 |
T8114 |
nsubj |
Levels,remain |
| R5643 |
T8115 |
T8113 |
prep |
of,Levels |
| R5644 |
T8116 |
T8117 |
compound |
Agouti,mRNA |
| R5645 |
T8117 |
T8115 |
pobj |
mRNA,of |
| R5646 |
T8118 |
T8114 |
oprd |
high,remain |
| R5647 |
T8119 |
T8114 |
prep |
throughout,remain |
| R5648 |
T8120 |
T8121 |
det |
the,ventrum |
| R5649 |
T8121 |
T8119 |
pobj |
ventrum,throughout |
| R5650 |
T8122 |
T8121 |
amod |
entire,ventrum |
| R5651 |
T8123 |
T8114 |
punct |
", ",remain |
| R5652 |
T8124 |
T8114 |
cc |
but,remain |
| R5653 |
T8125 |
T8126 |
compound |
hair,content |
| R5654 |
T8126 |
T8128 |
nsubjpass |
content,reduced |
| R5655 |
T8127 |
T8126 |
compound |
pigment,content |
| R5656 |
T8128 |
T8114 |
conj |
reduced,remain |
| R5657 |
T8129 |
T8128 |
auxpass |
is,reduced |
| R5658 |
T8130 |
T8128 |
punct |
", ",reduced |
| R5659 |
T8131 |
T8128 |
advcl |
giving,reduced |
| R5660 |
T8132 |
T8131 |
dobj |
rise,giving |
| R5661 |
T8133 |
T8131 |
prep |
to,giving |
| R5662 |
T8134 |
T8135 |
det |
a,region |
| R5663 |
T8135 |
T8133 |
pobj |
region,to |
| R5664 |
T8136 |
T8137 |
npadvmod |
cream,colored |
| R5665 |
T8137 |
T8135 |
amod |
colored,region |
| R5666 |
T8138 |
T8137 |
punct |
-,colored |
| R5667 |
T8139 |
T8135 |
prep |
in,region |
| R5668 |
T8140 |
T8141 |
det |
the,ventrum |
| R5669 |
T8141 |
T8139 |
pobj |
ventrum,in |
| R5670 |
T8142 |
T8143 |
dep |
that,appear |
| R5671 |
T8143 |
T8135 |
relcl |
appear,region |
| R5672 |
T8144 |
T8143 |
punct |
", ",appear |
| R5673 |
T8145 |
T8143 |
prep |
depending,appear |
| R5674 |
T8146 |
T8145 |
prep |
on,depending |
| R5675 |
T8147 |
T8146 |
pobj |
age,on |
| R5676 |
T8148 |
T8147 |
cc |
and,age |
| R5677 |
T8149 |
T8150 |
amod |
genetic,backgrounds |
| R5678 |
T8150 |
T8147 |
conj |
backgrounds,age |
| R5679 |
T8151 |
T8143 |
punct |
", ",appear |
| R5680 |
T8152 |
T8143 |
aux |
may,appear |
| R5681 |
T8153 |
T8154 |
advmod |
more,distinct |
| R5682 |
T8154 |
T8143 |
oprd |
distinct,appear |
| R5683 |
T8155 |
T8153 |
cc |
or,more |
| R5684 |
T8156 |
T8153 |
conj |
less,more |
| R5685 |
T8157 |
T8154 |
prep |
from,distinct |
| R5686 |
T8158 |
T8159 |
det |
the,stripe |
| R5687 |
T8159 |
T8157 |
pobj |
stripe,from |
| R5688 |
T8160 |
T8159 |
amod |
yellow,stripe |
| R5689 |
T8161 |
T8159 |
compound |
flank,stripe |
| R5690 |
T8162 |
T8128 |
punct |
.,reduced |
| R5691 |
T8164 |
T8165 |
nsubj |
Loss,affects |
| R5692 |
T8165 |
T8168 |
ccomp |
affects,are |
| R5693 |
T8166 |
T8164 |
prep |
of,Loss |
| R5694 |
T8167 |
T8166 |
pobj |
Tbx15,of |
| R5695 |
T8169 |
T8170 |
amod |
dorsoventral,transitions |
| R5696 |
T8170 |
T8165 |
dobj |
transitions,affects |
| R5697 |
T8171 |
T8170 |
prep |
of,transitions |
| R5698 |
T8172 |
T8173 |
compound |
hair,length |
| R5699 |
T8173 |
T8171 |
pobj |
length,of |
| R5700 |
T8174 |
T8170 |
punct |
", ",transitions |
| R5701 |
T8175 |
T8176 |
compound |
pigment,content |
| R5702 |
T8176 |
T8170 |
conj |
content,transitions |
| R5703 |
T8177 |
T8176 |
punct |
", ",content |
| R5704 |
T8178 |
T8176 |
cc |
and,content |
| R5705 |
T8179 |
T8176 |
conj |
expression,content |
| R5706 |
T8180 |
T8179 |
prep |
of,expression |
| R5707 |
T8181 |
T8182 |
det |
the,isoform |
| R5708 |
T8182 |
T8180 |
pobj |
isoform,of |
| R5709 |
T8183 |
T8184 |
amod |
ventral,specific |
| R5710 |
T8184 |
T8182 |
amod |
specific,isoform |
| R5711 |
T8185 |
T8184 |
punct |
-,specific |
| R5712 |
T8186 |
T8182 |
compound |
Agouti,isoform |
| R5713 |
T8187 |
T8168 |
punct |
;,are |
| R5714 |
T8188 |
T8168 |
advmod |
however,are |
| R5715 |
T8189 |
T8168 |
punct |
", ",are |
| R5716 |
T8190 |
T8191 |
det |
the,effects |
| R5717 |
T8191 |
T8168 |
nsubj |
effects,are |
| R5718 |
T8192 |
T8191 |
amod |
former,effects |
| R5719 |
T8193 |
T8191 |
nummod |
two,effects |
| R5720 |
T8194 |
T8168 |
acomp |
subtle,are |
| R5721 |
T8195 |
T8168 |
cc |
and,are |
| R5722 |
T8196 |
T8168 |
conj |
contribute,are |
| R5723 |
T8197 |
T8196 |
dobj |
little,contribute |
| R5724 |
T8198 |
T8199 |
punct |
", ",all |
| R5725 |
T8199 |
T8197 |
parataxis |
all,little |
| R5726 |
T8200 |
T8199 |
mark |
if,all |
| R5727 |
T8201 |
T8199 |
advmod |
at,all |
| R5728 |
T8202 |
T8199 |
punct |
", ",all |
| R5729 |
T8203 |
T8196 |
prep |
to,contribute |
| R5730 |
T8204 |
T8205 |
det |
the,pigmentation |
| R5731 |
T8205 |
T8203 |
pobj |
pigmentation,to |
| R5732 |
T8206 |
T8205 |
amod |
abnormal,pigmentation |
| R5733 |
T8207 |
T8205 |
prep |
of,pigmentation |
| R5734 |
T8208 |
T8209 |
amod |
adult,mice |
| R5735 |
T8209 |
T8207 |
pobj |
mice,of |
| R5736 |
T8210 |
T8211 |
nmod |
deH,deH |
| R5737 |
T8211 |
T8209 |
compound |
deH,mice |
| R5738 |
T8212 |
T8211 |
punct |
/,deH |
| R5739 |
T8213 |
T8168 |
punct |
.,are |
| R5740 |
T8215 |
T8216 |
advmod |
Thus,is |
| R5741 |
T8217 |
T8216 |
punct |
", ",is |
| R5742 |
T8218 |
T8216 |
prep |
despite,is |
| R5743 |
T8219 |
T8220 |
det |
the,pattern |
| R5744 |
T8220 |
T8218 |
pobj |
pattern,despite |
| R5745 |
T8221 |
T8220 |
amod |
abnormal,pattern |
| R5746 |
T8222 |
T8220 |
prep |
of,pattern |
| R5747 |
T8223 |
T8224 |
amod |
dark,skin |
| R5748 |
T8224 |
T8222 |
pobj |
skin,of |
| R5749 |
T8225 |
T8220 |
prep |
in,pattern |
| R5750 |
T8226 |
T8227 |
amod |
neonatal,mice |
| R5751 |
T8227 |
T8225 |
pobj |
mice,in |
| R5752 |
T8228 |
T8229 |
nmod |
deH,deH |
| R5753 |
T8229 |
T8227 |
compound |
deH,mice |
| R5754 |
T8230 |
T8229 |
punct |
/,deH |
| R5755 |
T8231 |
T8232 |
punct |
(,Figure |
| R5756 |
T8232 |
T8220 |
parataxis |
Figure,pattern |
| R5757 |
T8233 |
T8232 |
advmod |
e.g.,Figure |
| R5758 |
T8234 |
T8232 |
punct |
", ",Figure |
| R5759 |
T8235 |
T8232 |
nummod |
2D,Figure |
| R5760 |
T8236 |
T8232 |
punct |
),Figure |
| R5761 |
T8237 |
T8216 |
punct |
", ",is |
| R5762 |
T8238 |
T8239 |
det |
the,feature |
| R5763 |
T8239 |
T8216 |
nsubj |
feature,is |
| R5764 |
T8240 |
T8241 |
advmod |
most,obvious |
| R5765 |
T8241 |
T8239 |
amod |
obvious,feature |
| R5766 |
T8242 |
T8239 |
prep |
in,feature |
| R5767 |
T8243 |
T8242 |
pobj |
adults,in |
| R5768 |
T8244 |
T8245 |
amod |
dorsal,displacement |
| R5769 |
T8245 |
T8216 |
attr |
displacement,is |
| R5770 |
T8246 |
T8245 |
prep |
of,displacement |
| R5771 |
T8247 |
T8248 |
det |
the,boundary |
| R5772 |
T8248 |
T8246 |
pobj |
boundary,of |
| R5773 |
T8249 |
T8248 |
punct |
“,boundary |
| R5774 |
T8250 |
T8248 |
punct |
”,boundary |
| R5775 |
T8251 |
T8248 |
prep |
between,boundary |
| R5776 |
T8252 |
T8253 |
amod |
black,hair |
| R5777 |
T8253 |
T8251 |
pobj |
hair,between |
| R5778 |
T8254 |
T8252 |
cc |
and,black |
| R5779 |
T8255 |
T8252 |
conj |
yellow,black |
| R5780 |
T8256 |
T8257 |
punct |
(,Figure |
| R5781 |
T8257 |
T8216 |
parataxis |
Figure,is |
| R5782 |
T8258 |
T8257 |
nummod |
9A,Figure |
| R5783 |
T8259 |
T8257 |
punct |
),Figure |
| R5784 |
T8260 |
T8216 |
punct |
.,is |
| R5787 |
T8497 |
T8496 |
prep |
of,Genetics |
| R5788 |
T8498 |
T8497 |
pobj |
Tbx15,of |
| R5789 |
T8500 |
T8501 |
advcl |
Named,identified |
| R5790 |
T8502 |
T8500 |
prep |
for,Named |
| R5791 |
T8503 |
T8504 |
det |
the,presence |
| R5792 |
T8504 |
T8502 |
pobj |
presence,for |
| R5793 |
T8505 |
T8504 |
prep |
of,presence |
| R5794 |
T8506 |
T8507 |
det |
a,domain |
| R5795 |
T8507 |
T8505 |
pobj |
domain,of |
| R5796 |
T8508 |
T8509 |
npadvmod |
DNA,binding |
| R5797 |
T8509 |
T8507 |
amod |
binding,domain |
| R5798 |
T8510 |
T8509 |
punct |
-,binding |
| R5799 |
T8511 |
T8512 |
advmod |
first,identified |
| R5800 |
T8512 |
T8507 |
acl |
identified,domain |
| R5801 |
T8513 |
T8512 |
prep |
in,identified |
| R5802 |
T8514 |
T8515 |
det |
the,gene |
| R5803 |
T8515 |
T8513 |
pobj |
gene,in |
| R5804 |
T8516 |
T8515 |
compound |
mouse,gene |
| R5805 |
T8517 |
T8515 |
compound |
Brachyury,gene |
| R5806 |
T8518 |
T8519 |
punct |
(,causes |
| R5807 |
T8519 |
T8500 |
parataxis |
causes,Named |
| R5808 |
T8520 |
T8519 |
nsubj |
haploinsufficiency,causes |
| R5809 |
T8521 |
T8522 |
det |
a,tail |
| R5810 |
T8522 |
T8519 |
dobj |
tail,causes |
| R5811 |
T8523 |
T8522 |
amod |
short,tail |
| R5812 |
T8524 |
T8519 |
punct |
),causes |
| R5813 |
T8525 |
T8501 |
punct |
", ",identified |
| R5814 |
T8526 |
T8527 |
compound |
T,box |
| R5815 |
T8527 |
T8528 |
npadvmod |
box,containing |
| R5816 |
T8528 |
T8530 |
amod |
containing,genes |
| R5817 |
T8529 |
T8528 |
punct |
–,containing |
| R5818 |
T8530 |
T8501 |
nsubjpass |
genes,identified |
| R5819 |
T8531 |
T8501 |
aux |
have,identified |
| R5820 |
T8532 |
T8501 |
auxpass |
been,identified |
| R5821 |
T8533 |
T8501 |
prep |
as,identified |
| R5822 |
T8534 |
T8535 |
amod |
developmental,regulators |
| R5823 |
T8535 |
T8533 |
pobj |
regulators,as |
| R5824 |
T8536 |
T8501 |
prep |
in,identified |
| R5825 |
T8537 |
T8538 |
det |
a,spectrum |
| R5826 |
T8538 |
T8536 |
pobj |
spectrum,in |
| R5827 |
T8539 |
T8538 |
amod |
wide,spectrum |
| R5828 |
T8540 |
T8538 |
prep |
of,spectrum |
| R5829 |
T8541 |
T8540 |
pobj |
tissues,of |
| R5830 |
T8542 |
T8541 |
cc |
and,tissues |
| R5831 |
T8543 |
T8544 |
amod |
multicellular,organisms |
| R5832 |
T8544 |
T8541 |
conj |
organisms,tissues |
| R5833 |
T8545 |
T8546 |
punct |
(,reviewed |
| R5834 |
T8546 |
T8501 |
parataxis |
reviewed,identified |
| R5835 |
T8547 |
T8546 |
prep |
in,reviewed |
| R5836 |
T8548 |
T8547 |
pobj |
Papaioannou,in |
| R5837 |
T8549 |
T8548 |
npadvmod |
2001,Papaioannou |
| R5838 |
T8550 |
T8546 |
punct |
),reviewed |
| R5839 |
T8551 |
T8501 |
punct |
.,identified |
| R5840 |
T8553 |
T8554 |
det |
The,subfamily |
| R5841 |
T8554 |
T8556 |
nsubj |
subfamily,is |
| R5842 |
T8555 |
T8554 |
compound |
Tbx15,subfamily |
| R5843 |
T8557 |
T8554 |
punct |
", ",subfamily |
| R5844 |
T8558 |
T8559 |
dep |
which,includes |
| R5845 |
T8559 |
T8554 |
relcl |
includes,subfamily |
| R5846 |
T8560 |
T8559 |
advmod |
also,includes |
| R5847 |
T8561 |
T8559 |
dobj |
Tbx18,includes |
| R5848 |
T8562 |
T8561 |
cc |
and,Tbx18 |
| R5849 |
T8563 |
T8561 |
conj |
Tbx22,Tbx18 |
| R5850 |
T8564 |
T8556 |
punct |
", ",is |
| R5851 |
T8565 |
T8556 |
acomp |
likely,is |
| R5852 |
T8566 |
T8567 |
aux |
to,arisen |
| R5853 |
T8567 |
T8565 |
xcomp |
arisen,likely |
| R5854 |
T8568 |
T8567 |
aux |
have,arisen |
| R5855 |
T8569 |
T8567 |
prep |
during,arisen |
| R5856 |
T8570 |
T8571 |
amod |
early,evolution |
| R5857 |
T8571 |
T8569 |
pobj |
evolution,during |
| R5858 |
T8572 |
T8571 |
compound |
chordate,evolution |
| R5859 |
T8573 |
T8574 |
mark |
since,is |
| R5860 |
T8574 |
T8567 |
advcl |
is,arisen |
| R5861 |
T8575 |
T8574 |
expl |
there,is |
| R5862 |
T8576 |
T8577 |
det |
a,gene |
| R5863 |
T8577 |
T8574 |
attr |
gene,is |
| R5864 |
T8578 |
T8577 |
amod |
single,gene |
| R5865 |
T8579 |
T8577 |
prep |
in,gene |
| R5866 |
T8580 |
T8579 |
pobj |
amphioxus,in |
| R5867 |
T8581 |
T8577 |
cc |
but,gene |
| R5868 |
T8582 |
T8583 |
det |
no,homolog |
| R5869 |
T8583 |
T8577 |
conj |
homolog,gene |
| R5870 |
T8584 |
T8583 |
amod |
obvious,homolog |
| R5871 |
T8585 |
T8583 |
prep |
in,homolog |
| R5872 |
T8586 |
T8587 |
det |
the,genome |
| R5873 |
T8587 |
T8585 |
pobj |
genome,in |
| R5874 |
T8588 |
T8587 |
compound |
fly,genome |
| R5875 |
T8589 |
T8590 |
punct |
(,Ruvinsky |
| R5876 |
T8590 |
T8574 |
meta |
Ruvinsky,is |
| R5877 |
T8591 |
T8590 |
nmod |
et,Ruvinsky |
| R5878 |
T8592 |
T8590 |
nmod |
al.,Ruvinsky |
| R5879 |
T8593 |
T8590 |
nummod |
2000,Ruvinsky |
| R5880 |
T8594 |
T8590 |
punct |
),Ruvinsky |
| R5881 |
T8595 |
T8556 |
punct |
.,is |
| R5882 |
T8597 |
T8598 |
advcl |
Consistent,expressed |
| R5883 |
T8599 |
T8597 |
prep |
with,Consistent |
| R5884 |
T8600 |
T8601 |
det |
this,relationship |
| R5885 |
T8601 |
T8599 |
pobj |
relationship,with |
| R5886 |
T8602 |
T8598 |
punct |
", ",expressed |
| R5887 |
T8603 |
T8604 |
det |
the,genes |
| R5888 |
T8604 |
T8598 |
nsubjpass |
genes,expressed |
| R5889 |
T8605 |
T8604 |
nummod |
three,genes |
| R5890 |
T8606 |
T8598 |
auxpass |
are,expressed |
| R5891 |
T8607 |
T8598 |
prep |
in,expressed |
| R5892 |
T8608 |
T8609 |
advmod |
partially,overlapping |
| R5893 |
T8609 |
T8610 |
amod |
overlapping,patterns |
| R5894 |
T8610 |
T8607 |
pobj |
patterns,in |
| R5895 |
T8611 |
T8612 |
dep |
that,include |
| R5896 |
T8612 |
T8610 |
relcl |
include,patterns |
| R5897 |
T8613 |
T8614 |
amod |
anterior,somites |
| R5898 |
T8614 |
T8612 |
dobj |
somites,include |
| R5899 |
T8615 |
T8616 |
punct |
(,Tbx18 |
| R5900 |
T8616 |
T8614 |
parataxis |
Tbx18,somites |
| R5901 |
T8617 |
T8616 |
cc |
and,Tbx18 |
| R5902 |
T8618 |
T8616 |
conj |
Tbx22,Tbx18 |
| R5903 |
T8619 |
T8616 |
punct |
),Tbx18 |
| R5904 |
T8620 |
T8614 |
punct |
", ",somites |
| R5905 |
T8621 |
T8622 |
compound |
limb,mesenchyme |
| R5906 |
T8622 |
T8614 |
conj |
mesenchyme,somites |
| R5907 |
T8623 |
T8624 |
punct |
(,Tbx15 |
| R5908 |
T8624 |
T8622 |
parataxis |
Tbx15,mesenchyme |
| R5909 |
T8625 |
T8624 |
cc |
and,Tbx15 |
| R5910 |
T8626 |
T8624 |
conj |
Tbx18,Tbx15 |
| R5911 |
T8627 |
T8624 |
punct |
),Tbx15 |
| R5912 |
T8628 |
T8622 |
punct |
", ",mesenchyme |
| R5913 |
T8629 |
T8622 |
cc |
and,mesenchyme |
| R5914 |
T8630 |
T8631 |
amod |
craniofacial,mesenchyme |
| R5915 |
T8631 |
T8622 |
conj |
mesenchyme,mesenchyme |
| R5916 |
T8632 |
T8633 |
punct |
(,genes |
| R5917 |
T8633 |
T8631 |
parataxis |
genes,mesenchyme |
| R5918 |
T8634 |
T8633 |
det |
all,genes |
| R5919 |
T8635 |
T8633 |
nummod |
three,genes |
| R5920 |
T8636 |
T8633 |
punct |
", ",genes |
| R5921 |
T8637 |
T8633 |
dep |
Tbx15,genes |
| R5922 |
T8638 |
T8639 |
advmod |
more,broadly |
| R5923 |
T8639 |
T8637 |
advmod |
broadly,Tbx15 |
| R5924 |
T8640 |
T8639 |
prep |
than,broadly |
| R5925 |
T8641 |
T8640 |
pobj |
Tbx18,than |
| R5926 |
T8642 |
T8641 |
cc |
or,Tbx18 |
| R5927 |
T8643 |
T8641 |
conj |
Tbx22,Tbx18 |
| R5928 |
T8644 |
T8633 |
punct |
),genes |
| R5929 |
T8645 |
T8646 |
punct |
(,Agulnik |
| R5930 |
T8646 |
T8612 |
meta |
Agulnik,include |
| R5931 |
T8647 |
T8646 |
nmod |
et,Agulnik |
| R5932 |
T8648 |
T8646 |
nmod |
al.,Agulnik |
| R5933 |
T8649 |
T8646 |
nummod |
1998,Agulnik |
| R5934 |
T8650 |
T8646 |
punct |
;,Agulnik |
| R5935 |
T8651 |
T8646 |
nmod |
Kraus,Agulnik |
| R5936 |
T8652 |
T8646 |
nmod |
et,Agulnik |
| R5937 |
T8653 |
T8646 |
nmod |
al.,Agulnik |
| R5938 |
T8654 |
T8646 |
nummod |
2001,Agulnik |
| R5939 |
T8655 |
T8646 |
punct |
;,Agulnik |
| R5940 |
T8656 |
T8646 |
nmod |
Braybrook,Agulnik |
| R5941 |
T8657 |
T8646 |
nmod |
et,Agulnik |
| R5942 |
T8658 |
T8646 |
nmod |
al.,Agulnik |
| R5943 |
T8659 |
T8646 |
nummod |
2002,Agulnik |
| R5944 |
T8660 |
T8646 |
punct |
;,Agulnik |
| R5945 |
T8661 |
T8646 |
nmod |
Bush,Agulnik |
| R5946 |
T8662 |
T8646 |
nmod |
et,Agulnik |
| R5947 |
T8663 |
T8646 |
nmod |
al.,Agulnik |
| R5948 |
T8664 |
T8646 |
nummod |
2002,Agulnik |
| R5949 |
T8665 |
T8646 |
punct |
;,Agulnik |
| R5950 |
T8666 |
T8646 |
nmod |
Herr,Agulnik |
| R5951 |
T8667 |
T8646 |
nmod |
et,Agulnik |
| R5952 |
T8668 |
T8646 |
nmod |
al.,Agulnik |
| R5953 |
T8669 |
T8646 |
nummod |
2003,Agulnik |
| R5954 |
T8670 |
T8646 |
punct |
),Agulnik |
| R5955 |
T8671 |
T8598 |
punct |
.,expressed |
| R5956 |
T8673 |
T8674 |
det |
These,observations |
| R5957 |
T8674 |
T8675 |
nsubj |
observations,suggest |
| R5958 |
T8676 |
T8677 |
mark |
that,been |
| R5960 |
T8678 |
T8679 |
det |
an,gene |
| R5961 |
T8679 |
T8677 |
nsubj |
gene,been |
| R5962 |
T8680 |
T8679 |
amod |
ancestral,gene |
| R5963 |
T8681 |
T8679 |
prep |
for,gene |
| R5964 |
T8682 |
T8681 |
pobj |
Tbx15,for |
| R5965 |
T8683 |
T8682 |
punct |
", ",Tbx15 |
| R5966 |
T8684 |
T8682 |
conj |
Tbx18,Tbx15 |
| R5967 |
T8685 |
T8684 |
punct |
", ",Tbx18 |
| R5968 |
T8686 |
T8684 |
cc |
and,Tbx18 |
| R5969 |
T8687 |
T8684 |
conj |
Tbx22,Tbx18 |
| R5970 |
T8688 |
T8677 |
aux |
may,been |
| R5971 |
T8689 |
T8677 |
aux |
have,been |
| R5972 |
T8690 |
T8677 |
acomp |
important,been |
| R5973 |
T8691 |
T8677 |
prep |
for,been |
| R5974 |
T8692 |
T8693 |
amod |
craniofacial,development |
| R5975 |
T8693 |
T8691 |
pobj |
development,for |
| R5976 |
T8694 |
T8693 |
prep |
in,development |
| R5977 |
T8695 |
T8694 |
pobj |
cephalochordates,in |
| R5978 |
T8696 |
T8677 |
punct |
", ",been |
| R5979 |
T8697 |
T8677 |
prep |
with,been |
| R5980 |
T8698 |
T8697 |
pobj |
acquisition,with |
| R5981 |
T8699 |
T8698 |
prep |
of,acquisition |
| R5982 |
T8700 |
T8701 |
amod |
additional,patterns |
| R5983 |
T8701 |
T8699 |
pobj |
patterns,of |
| R5984 |
T8702 |
T8701 |
compound |
expression,patterns |
| R5985 |
T8703 |
T8701 |
cc |
and,patterns |
| R5986 |
T8704 |
T8705 |
amod |
developmental,functions |
| R5987 |
T8705 |
T8701 |
conj |
functions,patterns |
| R5988 |
T8706 |
T8698 |
prep |
in,acquisition |
| R5989 |
T8707 |
T8708 |
det |
the,limb |
| R5990 |
T8708 |
T8706 |
pobj |
limb,in |
| R5991 |
T8709 |
T8708 |
cc |
and,limb |
| R5992 |
T8710 |
T8711 |
det |
the,trunk |
| R5993 |
T8711 |
T8708 |
conj |
trunk,limb |
| R5994 |
T8712 |
T8698 |
prep |
during,acquisition |
| R5995 |
T8713 |
T8714 |
amod |
early,evolution |
| R5996 |
T8714 |
T8712 |
pobj |
evolution,during |
| R5997 |
T8715 |
T8714 |
compound |
vertebrate,evolution |
| R5998 |
T8716 |
T8675 |
punct |
.,suggest |
| R5999 |
T8718 |
T8719 |
nsubjpass |
Expression,reported |
| R6000 |
T8720 |
T8718 |
prep |
of,Expression |
| R6001 |
T8721 |
T8720 |
pobj |
Tbx18,of |
| R6002 |
T8722 |
T8721 |
cc |
and,Tbx18 |
| R6003 |
T8723 |
T8721 |
conj |
Tbx22,Tbx18 |
| R6004 |
T8724 |
T8719 |
aux |
has,reported |
| R6005 |
T8725 |
T8719 |
neg |
not,reported |
| R6006 |
T8726 |
T8719 |
auxpass |
been,reported |
| R6007 |
T8727 |
T8719 |
prep |
in,reported |
| R6008 |
T8728 |
T8729 |
amod |
embryonic,mesenchyme |
| R6009 |
T8729 |
T8727 |
pobj |
mesenchyme,in |
| R6010 |
T8730 |
T8729 |
compound |
flank,mesenchyme |
| R6011 |
T8731 |
T8719 |
punct |
", ",reported |
| R6012 |
T8732 |
T8733 |
dep |
which,suggests |
| R6013 |
T8733 |
T8719 |
advcl |
suggests,reported |
| R6014 |
T8734 |
T8735 |
mark |
that,is |
| R6015 |
T8735 |
T8733 |
ccomp |
is,suggests |
| R6016 |
T8736 |
T8735 |
nsubj |
Tbx15,is |
| R6017 |
T8737 |
T8738 |
det |
the,member |
| R6018 |
T8738 |
T8735 |
attr |
member,is |
| R6019 |
T8739 |
T8738 |
amod |
only,member |
| R6020 |
T8740 |
T8738 |
compound |
family,member |
| R6021 |
T8741 |
T8738 |
acl |
involved,member |
| R6022 |
T8742 |
T8741 |
prep |
in,involved |
| R6023 |
T8743 |
T8742 |
pcomp |
establishing,in |
| R6024 |
T8744 |
T8745 |
det |
the,identity |
| R6025 |
T8745 |
T8743 |
dobj |
identity,establishing |
| R6026 |
T8746 |
T8745 |
amod |
dorsoventral,identity |
| R6027 |
T8747 |
T8745 |
prep |
of,identity |
| R6028 |
T8748 |
T8749 |
det |
the,trunk |
| R6029 |
T8749 |
T8747 |
pobj |
trunk,of |
| R6030 |
T8750 |
T8719 |
punct |
.,reported |
| R6031 |
T8752 |
T8753 |
advmod |
However,be |
| R6032 |
T8754 |
T8753 |
punct |
", ",be |
| R6033 |
T8755 |
T8753 |
nsubj |
it,be |
| R6034 |
T8756 |
T8753 |
aux |
would,be |
| R6035 |
T8757 |
T8753 |
neg |
not,be |
| R6036 |
T8758 |
T8753 |
acomp |
surprising,be |
| R6037 |
T8759 |
T8760 |
aux |
to,find |
| R6038 |
T8760 |
T8753 |
xcomp |
find,be |
| R6039 |
T8761 |
T8762 |
det |
some,degree |
| R6040 |
T8762 |
T8760 |
dobj |
degree,find |
| R6041 |
T8763 |
T8762 |
prep |
of,degree |
| R6042 |
T8764 |
T8765 |
amod |
functional,redundancy |
| R6043 |
T8765 |
T8763 |
pobj |
redundancy,of |
| R6044 |
T8766 |
T8760 |
prep |
in,find |
| R6045 |
T8767 |
T8766 |
pobj |
animals,in |
| R6046 |
T8768 |
T8767 |
acl |
mutated,animals |
| R6047 |
T8769 |
T8768 |
prep |
for,mutated |
| R6048 |
T8770 |
T8769 |
pobj |
two,for |
| R6049 |
T8771 |
T8770 |
cc |
or,two |
| R6050 |
T8772 |
T8770 |
conj |
three,two |
| R6051 |
T8773 |
T8770 |
prep |
of,two |
| R6052 |
T8774 |
T8775 |
det |
the,members |
| R6053 |
T8775 |
T8773 |
pobj |
members,of |
| R6054 |
T8776 |
T8775 |
compound |
subfamily,members |
| R6055 |
T8777 |
T8760 |
prep |
in,find |
| R6056 |
T8778 |
T8779 |
amod |
other,regions |
| R6057 |
T8779 |
T8777 |
pobj |
regions,in |
| R6058 |
T8780 |
T8779 |
compound |
body,regions |
| R6059 |
T8781 |
T8779 |
punct |
", ",regions |
| R6060 |
T8782 |
T8783 |
advmod |
particularly,limbs |
| R6061 |
T8783 |
T8779 |
appos |
limbs,regions |
| R6062 |
T8784 |
T8783 |
det |
the,limbs |
| R6063 |
T8785 |
T8783 |
cc |
and,limbs |
| R6064 |
T8786 |
T8787 |
det |
the,head |
| R6065 |
T8787 |
T8783 |
conj |
head,limbs |
| R6066 |
T8788 |
T8753 |
punct |
.,be |
| R6067 |
T8790 |
T8791 |
prep |
For,cause |
| R6068 |
T8792 |
T8790 |
pobj |
example,For |
| R6069 |
T8793 |
T8791 |
punct |
", ",cause |
| R6070 |
T8794 |
T8791 |
nsubj |
mutations,cause |
| R6071 |
T8795 |
T8794 |
prep |
in,mutations |
| R6072 |
T8796 |
T8795 |
pobj |
Tbx22,in |
| R6073 |
T8797 |
T8798 |
det |
the,syndrome |
| R6074 |
T8798 |
T8791 |
dobj |
syndrome,cause |
| R6075 |
T8799 |
T8798 |
amod |
human,syndrome |
| R6076 |
T8800 |
T8801 |
npadvmod |
X,linked |
| R6077 |
T8801 |
T8803 |
amod |
linked,palate |
| R6078 |
T8802 |
T8801 |
punct |
-,linked |
| R6079 |
T8803 |
T8798 |
appos |
palate,syndrome |
| R6080 |
T8804 |
T8803 |
amod |
cleft,palate |
| R6081 |
T8805 |
T8803 |
cc |
and,palate |
| R6082 |
T8806 |
T8803 |
conj |
ankyloglossia,palate |
| R6083 |
T8807 |
T8808 |
punct |
(,Braybrook |
| R6084 |
T8808 |
T8791 |
meta |
Braybrook,cause |
| R6085 |
T8809 |
T8808 |
nmod |
et,Braybrook |
| R6086 |
T8810 |
T8808 |
nmod |
al.,Braybrook |
| R6087 |
T8811 |
T8808 |
nummod |
2001,Braybrook |
| R6088 |
T8812 |
T8808 |
punct |
),Braybrook |
| R6089 |
T8813 |
T8791 |
punct |
.,cause |
| R6090 |
T8815 |
T8816 |
prep |
Despite,affect |
| R6091 |
T8817 |
T8818 |
amod |
high,levels |
| R6092 |
T8818 |
T8815 |
pobj |
levels,Despite |
| R6093 |
T8819 |
T8818 |
prep |
of,levels |
| R6094 |
T8820 |
T8821 |
compound |
Tbx22,expression |
| R6095 |
T8821 |
T8819 |
pobj |
expression,of |
| R6096 |
T8822 |
T8818 |
prep |
in,levels |
| R6097 |
T8823 |
T8824 |
amod |
periocular,mesenchyme |
| R6098 |
T8824 |
T8822 |
pobj |
mesenchyme,in |
| R6099 |
T8825 |
T8824 |
amod |
embryonic,mesenchyme |
| R6100 |
T8826 |
T8827 |
punct |
(,Braybrook |
| R6101 |
T8827 |
T8818 |
meta |
Braybrook,levels |
| R6102 |
T8828 |
T8827 |
nmod |
et,Braybrook |
| R6103 |
T8829 |
T8827 |
nmod |
al.,Braybrook |
| R6104 |
T8830 |
T8827 |
nummod |
2002,Braybrook |
| R6105 |
T8831 |
T8827 |
punct |
;,Braybrook |
| R6106 |
T8832 |
T8827 |
nmod |
Bush,Braybrook |
| R6107 |
T8833 |
T8827 |
nmod |
et,Braybrook |
| R6108 |
T8834 |
T8827 |
nmod |
al.,Braybrook |
| R6109 |
T8835 |
T8827 |
nummod |
2002,Braybrook |
| R6110 |
T8836 |
T8827 |
punct |
;,Braybrook |
| R6111 |
T8837 |
T8827 |
nmod |
Herr,Braybrook |
| R6112 |
T8838 |
T8827 |
nmod |
et,Braybrook |
| R6113 |
T8839 |
T8827 |
nmod |
al.,Braybrook |
| R6114 |
T8840 |
T8827 |
nummod |
2003,Braybrook |
| R6115 |
T8841 |
T8827 |
punct |
),Braybrook |
| R6116 |
T8842 |
T8816 |
punct |
", ",affect |
| R6117 |
T8843 |
T8844 |
det |
the,condition |
| R6118 |
T8844 |
T8816 |
nsubj |
condition,affect |
| R6119 |
T8845 |
T8816 |
aux |
does,affect |
| R6120 |
T8846 |
T8816 |
neg |
not,affect |
| R6121 |
T8847 |
T8848 |
det |
the,eye |
| R6122 |
T8848 |
T8816 |
dobj |
eye,affect |
| R6123 |
T8849 |
T8816 |
punct |
", ",affect |
| R6124 |
T8850 |
T8851 |
advmod |
perhaps,provided |
| R6125 |
T8851 |
T8816 |
advcl |
provided,affect |
| R6126 |
T8852 |
T8851 |
mark |
because,provided |
| R6127 |
T8853 |
T8854 |
amod |
residual,activity |
| R6128 |
T8854 |
T8851 |
nsubjpass |
activity,provided |
| R6129 |
T8855 |
T8851 |
auxpass |
is,provided |
| R6130 |
T8856 |
T8851 |
agent |
by,provided |
| R6131 |
T8857 |
T8856 |
pobj |
Tbx15,by |
| R6132 |
T8858 |
T8851 |
prep |
in,provided |
| R6133 |
T8859 |
T8860 |
det |
the,region |
| R6134 |
T8860 |
T8858 |
pobj |
region,in |
| R6135 |
T8861 |
T8860 |
amod |
same,region |
| R6136 |
T8862 |
T8816 |
punct |
.,affect |
| R6137 |
T8864 |
T8865 |
prep |
In,suggested |
| R6138 |
T8866 |
T8867 |
det |
an,description |
| R6139 |
T8867 |
T8864 |
pobj |
description,In |
| R6140 |
T8868 |
T8867 |
amod |
initial,description |
| R6141 |
T8869 |
T8867 |
prep |
of,description |
| R6142 |
T8870 |
T8871 |
det |
the,expression |
| R6143 |
T8871 |
T8869 |
pobj |
expression,of |
| R6144 |
T8872 |
T8871 |
cc |
and,expression |
| R6145 |
T8873 |
T8874 |
compound |
map,location |
| R6146 |
T8874 |
T8871 |
conj |
location,expression |
| R6147 |
T8875 |
T8871 |
prep |
of,expression |
| R6148 |
T8876 |
T8877 |
compound |
mouse,Tbx15 |
| R6149 |
T8877 |
T8875 |
pobj |
Tbx15,of |
| R6150 |
T8878 |
T8865 |
punct |
", ",suggested |
| R6151 |
T8879 |
T8865 |
nsubj |
Agulnik,suggested |
| R6152 |
T8880 |
T8881 |
advmod |
et,al. |
| R6153 |
T8881 |
T8879 |
advmod |
al.,Agulnik |
| R6154 |
T8882 |
T8879 |
punct |
(,Agulnik |
| R6155 |
T8883 |
T8879 |
npadvmod |
1998,Agulnik |
| R6156 |
T8884 |
T8879 |
punct |
),Agulnik |
| R6157 |
T8885 |
T8886 |
amod |
human,Tbx15 |
| R6158 |
T8886 |
T8865 |
dobj |
Tbx15,suggested |
| R6159 |
T8887 |
T8888 |
dep |
that,lies |
| R6160 |
T8888 |
T8886 |
relcl |
lies,Tbx15 |
| R6161 |
T8889 |
T8888 |
prep |
on,lies |
| R6162 |
T8890 |
T8891 |
compound |
Chromosome,1p11.1 |
| R6163 |
T8891 |
T8889 |
pobj |
1p11.1,on |
| R6164 |
T8892 |
T8865 |
prep |
as,suggested |
| R6165 |
T8893 |
T8894 |
det |
a,candidate |
| R6166 |
T8894 |
T8892 |
pobj |
candidate,as |
| R6167 |
T8895 |
T8894 |
prep |
for,candidate |
| R6168 |
T8896 |
T8897 |
amod |
acromegaloid,appearance |
| R6169 |
T8897 |
T8899 |
nmod |
appearance,syndrome |
| R6170 |
T8898 |
T8897 |
amod |
facial,appearance |
| R6171 |
T8899 |
T8895 |
pobj |
syndrome,for |
| R6172 |
T8900 |
T8897 |
punct |
(,appearance |
| R6173 |
T8901 |
T8897 |
appos |
AFA,appearance |
| R6174 |
T8902 |
T8899 |
punct |
),syndrome |
| R6175 |
T8903 |
T8899 |
punct |
", ",syndrome |
| R6176 |
T8904 |
T8905 |
prep |
for,is |
| R6177 |
T8905 |
T8899 |
relcl |
is,syndrome |
| R6178 |
T8906 |
T8904 |
pobj |
which,for |
| R6179 |
T8907 |
T8905 |
expl |
there,is |
| R6180 |
T8908 |
T8909 |
det |
a,score |
| R6181 |
T8909 |
T8905 |
attr |
score,is |
| R6182 |
T8910 |
T8909 |
amod |
weak,score |
| R6183 |
T8911 |
T8909 |
amod |
positive,score |
| R6184 |
T8912 |
T8909 |
compound |
LOD,score |
| R6185 |
T8913 |
T8909 |
prep |
to,score |
| R6186 |
T8914 |
T8915 |
compound |
Chromosome,1p |
| R6187 |
T8915 |
T8913 |
pobj |
1p,to |
| R6188 |
T8916 |
T8917 |
punct |
(,Hughes |
| R6189 |
T8917 |
T8905 |
meta |
Hughes,is |
| R6190 |
T8918 |
T8917 |
nmod |
et,Hughes |
| R6191 |
T8919 |
T8917 |
nmod |
al.,Hughes |
| R6192 |
T8920 |
T8917 |
nummod |
1985,Hughes |
| R6193 |
T8921 |
T8917 |
punct |
),Hughes |
| R6194 |
T8922 |
T8865 |
punct |
.,suggested |
| R6195 |
T8924 |
T8925 |
advmod |
Originally,described |
| R6196 |
T8925 |
T8926 |
advcl |
described,describe |
| R6197 |
T8927 |
T8925 |
prep |
as,described |
| R6198 |
T8928 |
T8929 |
det |
a,syndrome |
| R6199 |
T8929 |
T8927 |
pobj |
syndrome,as |
| R6200 |
T8930 |
T8929 |
amod |
rare,syndrome |
| R6201 |
T8931 |
T8932 |
amod |
autosomal,dominant |
| R6202 |
T8932 |
T8929 |
amod |
dominant,syndrome |
| R6203 |
T8933 |
T8932 |
punct |
-,dominant |
| R6204 |
T8934 |
T8929 |
prep |
with,syndrome |
| R6205 |
T8935 |
T8936 |
amod |
progressive,coarsening |
| R6206 |
T8936 |
T8934 |
pobj |
coarsening,with |
| R6207 |
T8937 |
T8936 |
amod |
facial,coarsening |
| R6208 |
T8938 |
T8936 |
punct |
", ",coarsening |
| R6209 |
T8939 |
T8936 |
conj |
overgrowth,coarsening |
| R6210 |
T8940 |
T8939 |
prep |
of,overgrowth |
| R6211 |
T8941 |
T8942 |
det |
the,mucosa |
| R6212 |
T8942 |
T8940 |
pobj |
mucosa,of |
| R6213 |
T8943 |
T8942 |
amod |
intraoral,mucosa |
| R6214 |
T8944 |
T8939 |
punct |
", ",overgrowth |
| R6215 |
T8945 |
T8939 |
cc |
and,overgrowth |
| R6216 |
T8946 |
T8947 |
amod |
large,hands |
| R6217 |
T8947 |
T8939 |
conj |
hands,overgrowth |
| R6218 |
T8948 |
T8947 |
punct |
", ",hands |
| R6219 |
T8949 |
T8947 |
amod |
doughy,hands |
| R6220 |
T8950 |
T8926 |
punct |
", ",describe |
| R6221 |
T8951 |
T8952 |
advmod |
more,recent |
| R6222 |
T8952 |
T8953 |
amod |
recent,reports |
| R6223 |
T8953 |
T8926 |
nsubj |
reports,describe |
| R6224 |
T8954 |
T8953 |
compound |
case,reports |
| R6225 |
T8955 |
T8926 |
dobj |
macrosomia,describe |
| R6226 |
T8956 |
T8955 |
punct |
", ",macrosomia |
| R6227 |
T8957 |
T8955 |
conj |
macrocephaly,macrosomia |
| R6228 |
T8958 |
T8957 |
punct |
", ",macrocephaly |
| R6229 |
T8959 |
T8957 |
cc |
or,macrocephaly |
| R6230 |
T8960 |
T8957 |
conj |
both,macrocephaly |
| R6231 |
T8961 |
T8955 |
cc |
and,macrosomia |
| R6232 |
T8962 |
T8963 |
amod |
generalized,hypertrichosis |
| R6233 |
T8963 |
T8955 |
conj |
hypertrichosis,macrosomia |
| R6234 |
T8964 |
T8926 |
prep |
with,describe |
| R6235 |
T8965 |
T8966 |
amod |
progressive,coarsening |
| R6236 |
T8966 |
T8964 |
pobj |
coarsening,with |
| R6237 |
T8967 |
T8968 |
punct |
(,Dallapiccola |
| R6238 |
T8968 |
T8926 |
meta |
Dallapiccola,describe |
| R6239 |
T8969 |
T8968 |
nmod |
et,Dallapiccola |
| R6240 |
T8970 |
T8968 |
nmod |
al.,Dallapiccola |
| R6241 |
T8971 |
T8968 |
nummod |
1992,Dallapiccola |
| R6242 |
T8972 |
T8968 |
punct |
;,Dallapiccola |
| R6243 |
T8973 |
T8968 |
nmod |
Irvine,Dallapiccola |
| R6244 |
T8974 |
T8968 |
nmod |
et,Dallapiccola |
| R6245 |
T8975 |
T8968 |
nmod |
al.,Dallapiccola |
| R6246 |
T8976 |
T8968 |
nummod |
1996,Dallapiccola |
| R6247 |
T8977 |
T8968 |
punct |
;,Dallapiccola |
| R6248 |
T8978 |
T8968 |
nmod |
da,Dallapiccola |
| R6249 |
T8979 |
T8968 |
nmod |
Silva,Dallapiccola |
| R6250 |
T8980 |
T8968 |
nmod |
et,Dallapiccola |
| R6251 |
T8981 |
T8968 |
nmod |
al.,Dallapiccola |
| R6252 |
T8982 |
T8968 |
nummod |
1998,Dallapiccola |
| R6253 |
T8983 |
T8968 |
punct |
;,Dallapiccola |
| R6254 |
T8984 |
T8968 |
nmod |
Zelante,Dallapiccola |
| R6255 |
T8985 |
T8968 |
nmod |
et,Dallapiccola |
| R6256 |
T8986 |
T8968 |
nmod |
al.,Dallapiccola |
| R6257 |
T8987 |
T8968 |
nummod |
2000,Dallapiccola |
| R6258 |
T8988 |
T8968 |
punct |
),Dallapiccola |
| R6259 |
T8989 |
T8926 |
punct |
.,describe |
| R6260 |
T8991 |
T8992 |
det |
The,phenotype |
| R6261 |
T8992 |
T8994 |
nsubj |
phenotype,exhibits |
| R6262 |
T8993 |
T8992 |
compound |
deH,phenotype |
| R6263 |
T8994 |
T8995 |
ccomp |
exhibits,suggest |
| R6264 |
T8996 |
T8997 |
amod |
little,overlap |
| R6265 |
T8997 |
T8994 |
dobj |
overlap,exhibits |
| R6266 |
T8998 |
T8997 |
prep |
with,overlap |
| R6267 |
T8999 |
T9000 |
det |
these,features |
| R6268 |
T9000 |
T8998 |
pobj |
features,with |
| R6269 |
T9001 |
T8995 |
punct |
;,suggest |
| R6270 |
T9002 |
T8995 |
advmod |
instead,suggest |
| R6271 |
T9003 |
T8995 |
punct |
", ",suggest |
| R6272 |
T9004 |
T8995 |
nsubj |
we,suggest |
| R6273 |
T9005 |
T9006 |
det |
a,candidate |
| R6274 |
T9006 |
T9009 |
nsubj |
candidate,be |
| R6275 |
T9007 |
T9008 |
advmod |
more,likely |
| R6276 |
T9008 |
T9006 |
amod |
likely,candidate |
| R6277 |
T9009 |
T8995 |
advcl |
be,suggest |
| R6278 |
T9010 |
T9006 |
prep |
for,candidate |
| R6279 |
T9011 |
T9010 |
pobj |
mutations,for |
| R6280 |
T9012 |
T9011 |
prep |
of,mutations |
| R6281 |
T9013 |
T9014 |
amod |
human,TBX15 |
| R6282 |
T9014 |
T9012 |
pobj |
TBX15,of |
| R6283 |
T9015 |
T9009 |
aux |
would,be |
| R6284 |
T9016 |
T9017 |
amod |
frontofacionasal,syndrome |
| R6285 |
T9017 |
T9009 |
attr |
syndrome,be |
| R6286 |
T9018 |
T9017 |
punct |
", ",syndrome |
| R6287 |
T9019 |
T9020 |
det |
an,condition |
| R6288 |
T9020 |
T9017 |
appos |
condition,syndrome |
| R6289 |
T9021 |
T9020 |
amod |
unmapped,condition |
| R6290 |
T9022 |
T9020 |
amod |
autosomal,condition |
| R6291 |
T9023 |
T9020 |
amod |
recessive,condition |
| R6292 |
T9024 |
T9020 |
acl |
characterized,condition |
| R6293 |
T9025 |
T9024 |
agent |
by,characterized |
| R6294 |
T9026 |
T9025 |
pobj |
brachycephaly,by |
| R6295 |
T9027 |
T9026 |
punct |
", ",brachycephaly |
| R6296 |
T9028 |
T9026 |
conj |
blepharophimosis,brachycephaly |
| R6297 |
T9029 |
T9028 |
punct |
", ",blepharophimosis |
| R6298 |
T9030 |
T9028 |
cc |
and,blepharophimosis |
| R6299 |
T9031 |
T9032 |
amod |
midface,hypoplasia |
| R6300 |
T9032 |
T9028 |
conj |
hypoplasia,blepharophimosis |
| R6301 |
T9033 |
T9034 |
punct |
(,Reardon |
| R6302 |
T9034 |
T9024 |
meta |
Reardon,characterized |
| R6303 |
T9035 |
T9034 |
nmod |
et,Reardon |
| R6304 |
T9036 |
T9034 |
nmod |
al.,Reardon |
| R6305 |
T9037 |
T9034 |
nummod |
1994,Reardon |
| R6306 |
T9038 |
T9034 |
punct |
),Reardon |
| R6307 |
T9039 |
T8995 |
punct |
.,suggest |
| R6308 |
T9041 |
T9042 |
nsubj |
Two,became |
| R6309 |
T9043 |
T9041 |
prep |
of,Two |
| R6310 |
T9044 |
T9043 |
pobj |
us,of |
| R6311 |
T9045 |
T9041 |
punct |
(,Two |
| R6312 |
T9046 |
T9047 |
compound |
S.,Kuijper |
| R6313 |
T9047 |
T9041 |
appos |
Kuijper,Two |
| R6314 |
T9048 |
T9047 |
cc |
and,Kuijper |
| R6315 |
T9049 |
T9050 |
compound |
F.,Meijlink |
| R6316 |
T9050 |
T9047 |
conj |
Meijlink,Kuijper |
| R6317 |
T9051 |
T9042 |
punct |
),became |
| R6318 |
T9052 |
T9042 |
acomp |
interested,became |
| R6319 |
T9053 |
T9052 |
prep |
in,interested |
| R6320 |
T9054 |
T9055 |
det |
the,mutation |
| R6321 |
T9055 |
T9053 |
pobj |
mutation,in |
| R6322 |
T9056 |
T9055 |
compound |
deH,mutation |
| R6323 |
T9057 |
T9042 |
prep |
because,became |
| R6324 |
T9058 |
T9057 |
pcomp |
of,because |
| R6325 |
T9059 |
T9060 |
poss |
its,effects |
| R6326 |
T9060 |
T9057 |
pobj |
effects,because |
| R6327 |
T9061 |
T9060 |
prep |
on,effects |
| R6328 |
T9062 |
T9063 |
amod |
skeletal,development |
| R6329 |
T9063 |
T9061 |
pobj |
development,on |
| R6330 |
T9064 |
T9065 |
punct |
(,Curry |
| R6331 |
T9065 |
T9060 |
meta |
Curry,effects |
| R6332 |
T9066 |
T9065 |
nummod |
1959,Curry |
| R6333 |
T9067 |
T9065 |
punct |
),Curry |
| R6334 |
T9068 |
T9060 |
cc |
and,effects |
| R6335 |
T9069 |
T9070 |
det |
the,possibility |
| R6336 |
T9070 |
T9060 |
conj |
possibility,effects |
| R6337 |
T9071 |
T9072 |
mark |
that,be |
| R6338 |
T9072 |
T9070 |
acl |
be,possibility |
| R6339 |
T9073 |
T9074 |
det |
the,gene |
| R6340 |
T9074 |
T9072 |
nsubj |
gene,be |
| R6341 |
T9075 |
T9076 |
npadvmod |
aristaless,related |
| R6342 |
T9076 |
T9074 |
amod |
related,gene |
| R6343 |
T9077 |
T9076 |
punct |
-,related |
| R6344 |
T9078 |
T9074 |
appos |
Alx3,gene |
| R6345 |
T9079 |
T9072 |
aux |
might,be |
| R6346 |
T9080 |
T9072 |
acomp |
allelic,be |
| R6347 |
T9081 |
T9080 |
prep |
with,allelic |
| R6348 |
T9082 |
T9083 |
amod |
droopy,ear |
| R6349 |
T9083 |
T9081 |
pobj |
ear,with |
| R6350 |
T9084 |
T9085 |
punct |
(,ten |
| R6351 |
T9085 |
T9072 |
meta |
ten,be |
| R6352 |
T9086 |
T9085 |
nmod |
Berge,ten |
| R6353 |
T9087 |
T9085 |
nmod |
et,ten |
| R6354 |
T9088 |
T9085 |
nmod |
al.,ten |
| R6355 |
T9089 |
T9085 |
nummod |
1998,ten |
| R6356 |
T9090 |
T9085 |
punct |
),ten |
| R6357 |
T9091 |
T9042 |
punct |
.,became |
| R6358 |
T9093 |
T9094 |
prep |
In,excluded |
| R6359 |
T9095 |
T9093 |
pobj |
spite,In |
| R6360 |
T9096 |
T9095 |
prep |
of,spite |
| R6361 |
T9097 |
T9096 |
pobj |
similarities,of |
| R6362 |
T9098 |
T9097 |
prep |
between,similarities |
| R6363 |
T9099 |
T9100 |
amod |
skeletal,phenotypes |
| R6364 |
T9100 |
T9098 |
pobj |
phenotypes,between |
| R6365 |
T9101 |
T9100 |
prep |
of,phenotypes |
| R6366 |
T9102 |
T9103 |
nmod |
deH,mutants |
| R6367 |
T9103 |
T9101 |
pobj |
mutants,of |
| R6368 |
T9104 |
T9102 |
cc |
and,deH |
| R6369 |
T9105 |
T9102 |
conj |
Alx3,deH |
| R6370 |
T9106 |
T9105 |
cc |
or,Alx3 |
| R6371 |
T9107 |
T9105 |
conj |
Alx4,Alx3 |
| R6372 |
T9108 |
T9094 |
punct |
", ",excluded |
| R6373 |
T9109 |
T9110 |
amod |
subsequent,experiments |
| R6374 |
T9110 |
T9094 |
nsubj |
experiments,excluded |
| R6375 |
T9111 |
T9112 |
punct |
(,data |
| R6376 |
T9112 |
T9110 |
meta |
data,experiments |
| R6377 |
T9113 |
T9112 |
amod |
unpublished,data |
| R6378 |
T9114 |
T9112 |
punct |
),data |
| R6379 |
T9115 |
T9094 |
dobj |
allelism,excluded |
| R6380 |
T9116 |
T9115 |
prep |
of,allelism |
| R6381 |
T9117 |
T9116 |
pobj |
Alx3,of |
| R6382 |
T9118 |
T9117 |
cc |
and,Alx3 |
| R6383 |
T9119 |
T9117 |
conj |
deH,Alx3 |
| R6384 |
T9120 |
T9094 |
punct |
", ",excluded |
| R6385 |
T9121 |
T9094 |
cc |
and,excluded |
| R6386 |
T9122 |
T9123 |
det |
a,description |
| R6387 |
T9123 |
T9125 |
nsubjpass |
description,published |
| R6388 |
T9124 |
T9123 |
amod |
full,description |
| R6389 |
T9125 |
T9094 |
conj |
published,excluded |
| R6390 |
T9126 |
T9123 |
prep |
of,description |
| R6391 |
T9127 |
T9128 |
det |
the,phenotype |
| R6392 |
T9128 |
T9126 |
pobj |
phenotype,of |
| R6393 |
T9129 |
T9128 |
nmod |
Tbx15,phenotype |
| R6394 |
T9130 |
T9128 |
amod |
skeletal,phenotype |
| R6395 |
T9131 |
T9125 |
aux |
will,published |
| R6396 |
T9132 |
T9125 |
auxpass |
be,published |
| R6397 |
T9133 |
T9125 |
advmod |
elsewhere,published |
| R6398 |
T9134 |
T9094 |
punct |
.,excluded |
| R6406 |
T9366 |
T9367 |
amod |
Developmental,Mechanism |
| R6407 |
T9368 |
T9367 |
prep |
of,Mechanism |
| R6408 |
T9369 |
T9370 |
compound |
Tbx15,Expression |
| R6409 |
T9370 |
T9368 |
pobj |
Expression,of |
| R6410 |
T9371 |
T9370 |
cc |
and,Expression |
| R6411 |
T9372 |
T9370 |
conj |
Action,Expression |
| R6412 |
T9373 |
T9370 |
prep |
in,Expression |
| R6413 |
T9374 |
T9375 |
det |
the,Skin |
| R6414 |
T9375 |
T9373 |
pobj |
Skin,in |
| R6415 |
T9377 |
T9378 |
poss |
Our,attention |
| R6416 |
T9378 |
T9379 |
nsubjpass |
attention,motivated |
| R6417 |
T9380 |
T9378 |
prep |
to,attention |
| R6418 |
T9381 |
T9382 |
det |
the,role |
| R6419 |
T9382 |
T9380 |
pobj |
role,to |
| R6420 |
T9383 |
T9382 |
prep |
of,role |
| R6421 |
T9384 |
T9383 |
pobj |
Tbx15,of |
| R6422 |
T9385 |
T9382 |
prep |
in,role |
| R6423 |
T9386 |
T9387 |
compound |
pigment,patterning |
| R6424 |
T9387 |
T9385 |
pobj |
patterning,in |
| R6425 |
T9388 |
T9379 |
auxpass |
was,motivated |
| R6426 |
T9389 |
T9379 |
agent |
by,motivated |
| R6427 |
T9390 |
T9391 |
det |
the,effects |
| R6428 |
T9391 |
T9389 |
pobj |
effects,by |
| R6429 |
T9392 |
T9391 |
prep |
of,effects |
| R6430 |
T9393 |
T9392 |
pobj |
Agouti,of |
| R6431 |
T9394 |
T9391 |
prep |
in,effects |
| R6432 |
T9395 |
T9396 |
amod |
postnatal,animals |
| R6433 |
T9396 |
T9394 |
pobj |
animals,in |
| R6434 |
T9397 |
T9379 |
punct |
.,motivated |
| R6435 |
T9399 |
T9400 |
advmod |
However,expressed |
| R6436 |
T9401 |
T9400 |
punct |
", ",expressed |
| R6437 |
T9402 |
T9400 |
nsubjpass |
Agouti,expressed |
| R6438 |
T9403 |
T9400 |
auxpass |
is,expressed |
| R6439 |
T9404 |
T9400 |
advmod |
also,expressed |
| R6440 |
T9405 |
T9400 |
prep |
in,expressed |
| R6441 |
T9406 |
T9407 |
det |
the,embryo |
| R6442 |
T9407 |
T9405 |
pobj |
embryo,in |
| R6443 |
T9408 |
T9407 |
punct |
", ",embryo |
| R6444 |
T9409 |
T9410 |
advmod |
where,provides |
| R6445 |
T9410 |
T9407 |
relcl |
provides,embryo |
| R6446 |
T9411 |
T9410 |
nsubj |
it,provides |
| R6447 |
T9412 |
T9413 |
det |
a,marker |
| R6448 |
T9413 |
T9410 |
dobj |
marker,provides |
| R6449 |
T9414 |
T9413 |
amod |
convenient,marker |
| R6450 |
T9415 |
T9413 |
prep |
of,marker |
| R6451 |
T9416 |
T9417 |
amod |
ventral,identity |
| R6452 |
T9417 |
T9415 |
pobj |
identity,of |
| R6453 |
T9418 |
T9417 |
compound |
dermis,identity |
| R6454 |
T9419 |
T9400 |
punct |
.,expressed |
| R6455 |
T9421 |
T9422 |
mark |
Because,is |
| R6456 |
T9422 |
T9435 |
advcl |
is,occur |
| R6457 |
T9423 |
T9424 |
det |
an,domain |
| R6458 |
T9424 |
T9422 |
nsubj |
domain,is |
| R6459 |
T9425 |
T9424 |
amod |
expanded,domain |
| R6460 |
T9426 |
T9424 |
prep |
of,domain |
| R6461 |
T9427 |
T9428 |
amod |
embryonic,expression |
| R6462 |
T9428 |
T9426 |
pobj |
expression,of |
| R6463 |
T9429 |
T9428 |
compound |
Agouti,expression |
| R6464 |
T9430 |
T9424 |
prep |
in,domain |
| R6465 |
T9431 |
T9432 |
compound |
deH,deH |
| R6466 |
T9432 |
T9434 |
compound |
deH,animals |
| R6467 |
T9433 |
T9432 |
punct |
/,deH |
| R6468 |
T9434 |
T9430 |
pobj |
animals,in |
| R6469 |
T9436 |
T9422 |
acomp |
detectable,is |
| R6470 |
T9437 |
T9422 |
prep |
by,is |
| R6471 |
T9438 |
T9437 |
pobj |
E14.5,by |
| R6472 |
T9439 |
T9435 |
punct |
", ",occur |
| R6473 |
T9440 |
T9441 |
det |
the,effects |
| R6474 |
T9441 |
T9435 |
nsubj |
effects,occur |
| R6475 |
T9442 |
T9441 |
prep |
of,effects |
| R6476 |
T9443 |
T9442 |
pobj |
Tbx15,of |
| R6477 |
T9444 |
T9441 |
prep |
on,effects |
| R6478 |
T9445 |
T9446 |
amod |
dorsoventral,patterning |
| R6479 |
T9446 |
T9444 |
pobj |
patterning,on |
| R6480 |
T9447 |
T9435 |
aux |
must,occur |
| R6481 |
T9448 |
T9435 |
advmod |
prior,occur |
| R6482 |
T9449 |
T9448 |
prep |
to,prior |
| R6483 |
T9450 |
T9451 |
det |
this,time |
| R6484 |
T9451 |
T9449 |
pobj |
time,to |
| R6485 |
T9452 |
T9435 |
punct |
.,occur |
| R6486 |
T9454 |
T9455 |
prep |
Among,emerged |
| R6487 |
T9456 |
T9457 |
amod |
other,genes |
| R6488 |
T9457 |
T9454 |
pobj |
genes,Among |
| R6489 |
T9458 |
T9459 |
compound |
T,box |
| R6490 |
T9459 |
T9457 |
compound |
box,genes |
| R6491 |
T9460 |
T9459 |
punct |
-,box |
| R6492 |
T9461 |
T9462 |
poss |
whose,actions |
| R6493 |
T9462 |
T9464 |
dep |
actions,understood |
| R6494 |
T9463 |
T9462 |
amod |
developmental,actions |
| R6495 |
T9464 |
T9457 |
relcl |
understood,genes |
| R6496 |
T9465 |
T9464 |
auxpass |
are,understood |
| R6497 |
T9466 |
T9467 |
advmod |
at,least |
| R6498 |
T9467 |
T9468 |
advmod |
least,partially |
| R6499 |
T9468 |
T9464 |
advmod |
partially,understood |
| R6500 |
T9469 |
T9455 |
punct |
", ",emerged |
| R6501 |
T9470 |
T9471 |
nummod |
two,themes |
| R6502 |
T9471 |
T9455 |
nsubj |
themes,emerged |
| R6503 |
T9472 |
T9471 |
amod |
general,themes |
| R6504 |
T9473 |
T9455 |
aux |
have,emerged |
| R6505 |
T9474 |
T9455 |
punct |
", ",emerged |
| R6506 |
T9475 |
T9476 |
nsubj |
one,focused |
| R6507 |
T9476 |
T9455 |
advcl |
focused,emerged |
| R6508 |
T9477 |
T9476 |
prep |
on,focused |
| R6509 |
T9478 |
T9479 |
det |
the,ability |
| R6510 |
T9479 |
T9477 |
pobj |
ability,on |
| R6511 |
T9480 |
T9481 |
aux |
to,specify |
| R6512 |
T9481 |
T9479 |
acl |
specify,ability |
| R6513 |
T9482 |
T9483 |
amod |
alternative,fates |
| R6514 |
T9483 |
T9481 |
dobj |
fates,specify |
| R6515 |
T9484 |
T9481 |
prep |
for,specify |
| R6516 |
T9485 |
T9486 |
det |
an,group |
| R6517 |
T9486 |
T9484 |
pobj |
group,for |
| R6518 |
T9487 |
T9486 |
amod |
undifferentiated,group |
| R6519 |
T9488 |
T9486 |
prep |
of,group |
| R6520 |
T9489 |
T9490 |
compound |
precursor,cells |
| R6521 |
T9490 |
T9488 |
pobj |
cells,of |
| R6522 |
T9491 |
T9476 |
cc |
and,focused |
| R6523 |
T9492 |
T9493 |
nsubj |
another,focused |
| R6524 |
T9493 |
T9476 |
conj |
focused,focused |
| R6525 |
T9494 |
T9493 |
prep |
on,focused |
| R6526 |
T9495 |
T9496 |
det |
the,ability |
| R6527 |
T9496 |
T9494 |
pobj |
ability,on |
| R6528 |
T9497 |
T9498 |
aux |
to,support |
| R6529 |
T9498 |
T9496 |
acl |
support,ability |
| R6530 |
T9499 |
T9500 |
amod |
proliferative,expansion |
| R6531 |
T9500 |
T9498 |
dobj |
expansion,support |
| R6532 |
T9501 |
T9500 |
prep |
of,expansion |
| R6533 |
T9502 |
T9503 |
det |
a,population |
| R6534 |
T9503 |
T9501 |
pobj |
population,of |
| R6535 |
T9504 |
T9503 |
compound |
cell,population |
| R6536 |
T9505 |
T9506 |
poss |
whose,fate |
| R6537 |
T9506 |
T9507 |
dep |
fate,determined |
| R6538 |
T9507 |
T9503 |
relcl |
determined,population |
| R6539 |
T9508 |
T9507 |
auxpass |
is,determined |
| R6540 |
T9509 |
T9507 |
advmod |
already,determined |
| R6541 |
T9510 |
T9511 |
punct |
(,reviewed |
| R6542 |
T9511 |
T9493 |
parataxis |
reviewed,focused |
| R6543 |
T9512 |
T9511 |
prep |
in,reviewed |
| R6544 |
T9513 |
T9512 |
pobj |
Tada,in |
| R6545 |
T9514 |
T9513 |
cc |
and,Tada |
| R6546 |
T9515 |
T9513 |
conj |
Smith,Tada |
| R6547 |
T9516 |
T9513 |
npadvmod |
2001,Tada |
| R6548 |
T9517 |
T9511 |
punct |
),reviewed |
| R6549 |
T9518 |
T9455 |
punct |
.,emerged |
| R6550 |
T9520 |
T9521 |
det |
Either,mechanism |
| R6551 |
T9521 |
T9522 |
nsubj |
mechanism,apply |
| R6552 |
T9523 |
T9522 |
aux |
may,apply |
| R6553 |
T9524 |
T9522 |
prep |
to,apply |
| R6554 |
T9525 |
T9526 |
det |
the,transformation |
| R6555 |
T9526 |
T9524 |
pobj |
transformation,to |
| R6556 |
T9527 |
T9526 |
amod |
apparent,transformation |
| R6557 |
T9528 |
T9526 |
amod |
dorsal,transformation |
| R6558 |
T9529 |
T9528 |
punct |
-,dorsal |
| R6559 |
T9530 |
T9528 |
prep |
to,dorsal |
| R6560 |
T9531 |
T9530 |
punct |
-,to |
| R6561 |
T9532 |
T9530 |
amod |
ventral,to |
| R6562 |
T9533 |
T9526 |
prep |
in,transformation |
| R6563 |
T9534 |
T9535 |
compound |
deH,deH |
| R6564 |
T9535 |
T9537 |
compound |
deH,mice |
| R6565 |
T9536 |
T9535 |
punct |
/,deH |
| R6566 |
T9537 |
T9533 |
pobj |
mice,in |
| R6567 |
T9538 |
T9522 |
punct |
.,apply |
| R6568 |
T9540 |
T9541 |
prep |
For,be |
| R6569 |
T9542 |
T9540 |
pobj |
example,For |
| R6570 |
T9543 |
T9541 |
punct |
", ",be |
| R6571 |
T9544 |
T9545 |
mark |
while,traced |
| R6572 |
T9545 |
T9541 |
advcl |
traced,be |
| R6573 |
T9546 |
T9547 |
det |
the,domain |
| R6574 |
T9547 |
T9545 |
nsubjpass |
domain,traced |
| R6575 |
T9548 |
T9547 |
amod |
expanded,domain |
| R6576 |
T9549 |
T9547 |
prep |
of,domain |
| R6577 |
T9550 |
T9551 |
compound |
Agouti,expression |
| R6578 |
T9551 |
T9549 |
pobj |
expression,of |
| R6579 |
T9552 |
T9547 |
prep |
in,domain |
| R6580 |
T9553 |
T9554 |
amod |
postnatal,animals |
| R6581 |
T9554 |
T9552 |
pobj |
animals,in |
| R6582 |
T9555 |
T9556 |
compound |
deH,deH |
| R6583 |
T9556 |
T9554 |
compound |
deH,animals |
| R6584 |
T9557 |
T9556 |
punct |
/,deH |
| R6585 |
T9558 |
T9545 |
aux |
can,traced |
| R6586 |
T9559 |
T9545 |
auxpass |
be,traced |
| R6587 |
T9560 |
T9545 |
prep |
to,traced |
| R6588 |
T9561 |
T9560 |
pobj |
events,to |
| R6589 |
T9562 |
T9563 |
dep |
that,occur |
| R6590 |
T9563 |
T9561 |
relcl |
occur,events |
| R6591 |
T9564 |
T9563 |
prep |
between,occur |
| R6592 |
T9565 |
T9564 |
pobj |
E11.5,between |
| R6593 |
T9566 |
T9565 |
cc |
and,E11.5 |
| R6594 |
T9567 |
T9565 |
conj |
E13.5,E11.5 |
| R6595 |
T9568 |
T9541 |
punct |
", ",be |
| R6596 |
T9569 |
T9570 |
det |
the,cause |
| R6597 |
T9570 |
T9541 |
nsubj |
cause,be |
| R6598 |
T9571 |
T9570 |
amod |
underlying,cause |
| R6599 |
T9572 |
T9541 |
aux |
may,be |
| R6600 |
T9573 |
T9574 |
mark |
that,acquire |
| R6601 |
T9574 |
T9541 |
advcl |
acquire,be |
| R6602 |
T9575 |
T9576 |
amod |
embryonic,cells |
| R6603 |
T9576 |
T9574 |
nsubj |
cells,acquire |
| R6604 |
T9577 |
T9576 |
prep |
in,cells |
| R6605 |
T9578 |
T9579 |
amod |
dorsolateral,mesenchyme |
| R6606 |
T9579 |
T9577 |
pobj |
mesenchyme,in |
| R6607 |
T9580 |
T9581 |
det |
a,identity |
| R6608 |
T9581 |
T9574 |
dobj |
identity,acquire |
| R6609 |
T9582 |
T9581 |
amod |
ventral,identity |
| R6610 |
T9583 |
T9582 |
cc |
rather,ventral |
| R6611 |
T9584 |
T9583 |
dep |
than,rather |
| R6612 |
T9585 |
T9582 |
conj |
dorsal,ventral |
| R6613 |
T9586 |
T9574 |
cc |
or,acquire |
| R6614 |
T9587 |
T9588 |
mark |
that,fail |
| R6615 |
T9588 |
T9574 |
conj |
fail,acquire |
| R6616 |
T9589 |
T9590 |
det |
those,cells |
| R6617 |
T9590 |
T9588 |
nsubj |
cells,fail |
| R6618 |
T9591 |
T9592 |
aux |
to,proliferate |
| R6619 |
T9592 |
T9588 |
xcomp |
proliferate,fail |
| R6620 |
T9593 |
T9592 |
advmod |
normally,proliferate |
| R6621 |
T9594 |
T9588 |
punct |
", ",fail |
| R6622 |
T9595 |
T9588 |
advcl |
followed,fail |
| R6623 |
T9596 |
T9595 |
agent |
by,followed |
| R6624 |
T9597 |
T9598 |
amod |
compensatory,expansion |
| R6625 |
T9598 |
T9596 |
pobj |
expansion,by |
| R6626 |
T9599 |
T9598 |
prep |
of,expansion |
| R6627 |
T9600 |
T9601 |
amod |
ventral,cells |
| R6628 |
T9601 |
T9599 |
pobj |
cells,of |
| R6629 |
T9602 |
T9541 |
punct |
.,be |
| R6630 |
T9604 |
T9605 |
compound |
Cell,lineage |
| R6631 |
T9605 |
T9606 |
compound |
lineage,studies |
| R6632 |
T9606 |
T9607 |
nsubj |
studies,provide |
| R6633 |
T9608 |
T9607 |
aux |
should,provide |
| R6634 |
T9609 |
T9610 |
det |
a,answer |
| R6635 |
T9610 |
T9607 |
dobj |
answer,provide |
| R6636 |
T9611 |
T9610 |
amod |
definitive,answer |
| R6637 |
T9612 |
T9607 |
punct |
", ",provide |
| R6638 |
T9613 |
T9607 |
cc |
but,provide |
| R6639 |
T9614 |
T9615 |
nsubj |
we,favor |
| R6640 |
T9615 |
T9607 |
conj |
favor,provide |
| R6641 |
T9616 |
T9617 |
det |
the,hypothesis |
| R6642 |
T9617 |
T9615 |
dobj |
hypothesis,favor |
| R6643 |
T9618 |
T9617 |
amod |
latter,hypothesis |
| R6644 |
T9619 |
T9615 |
punct |
", ",favor |
| R6645 |
T9620 |
T9621 |
mark |
because,revealed |
| R6646 |
T9621 |
T9615 |
advcl |
revealed,favor |
| R6647 |
T9622 |
T9621 |
nsubj |
measurements,revealed |
| R6648 |
T9623 |
T9622 |
prep |
of,measurements |
| R6649 |
T9624 |
T9625 |
amod |
dorsoventral,regions |
| R6650 |
T9625 |
T9623 |
pobj |
regions,of |
| R6651 |
T9626 |
T9622 |
prep |
according,measurements |
| R6652 |
T9627 |
T9626 |
prep |
to,according |
| R6653 |
T9628 |
T9629 |
compound |
hair,color |
| R6654 |
T9629 |
T9627 |
pobj |
color,to |
| R6655 |
T9630 |
T9629 |
prep |
in,color |
| R6656 |
T9631 |
T9632 |
compound |
deH,deH |
| R6657 |
T9632 |
T9634 |
compound |
deH,mice |
| R6658 |
T9633 |
T9632 |
punct |
/,deH |
| R6659 |
T9634 |
T9630 |
pobj |
mice,in |
| R6660 |
T9635 |
T9636 |
det |
a,increase |
| R6661 |
T9636 |
T9621 |
dobj |
increase,revealed |
| R6662 |
T9637 |
T9636 |
amod |
small,increase |
| R6663 |
T9638 |
T9636 |
prep |
of,increase |
| R6664 |
T9639 |
T9640 |
det |
the,region |
| R6665 |
T9640 |
T9638 |
pobj |
region,of |
| R6666 |
T9641 |
T9642 |
amod |
cream,colored |
| R6667 |
T9642 |
T9640 |
amod |
colored,region |
| R6668 |
T9643 |
T9642 |
punct |
-,colored |
| R6669 |
T9644 |
T9640 |
amod |
ventral,region |
| R6670 |
T9645 |
T9621 |
prep |
in,revealed |
| R6671 |
T9646 |
T9645 |
pobj |
addition,in |
| R6672 |
T9647 |
T9646 |
prep |
to,addition |
| R6673 |
T9648 |
T9649 |
det |
the,doubling |
| R6674 |
T9649 |
T9647 |
pobj |
doubling,to |
| R6675 |
T9650 |
T9649 |
amod |
approximate,doubling |
| R6676 |
T9651 |
T9649 |
prep |
of,doubling |
| R6677 |
T9652 |
T9653 |
det |
the,region |
| R6678 |
T9653 |
T9651 |
pobj |
region,of |
| R6679 |
T9654 |
T9653 |
amod |
yellow,region |
| R6680 |
T9655 |
T9653 |
compound |
flank,region |
| R6681 |
T9656 |
T9657 |
punct |
(,see |
| R6682 |
T9657 |
T9621 |
parataxis |
see,revealed |
| R6683 |
T9658 |
T9657 |
dobj |
Figure,see |
| R6684 |
T9659 |
T9658 |
nummod |
2,Figure |
| R6685 |
T9660 |
T9657 |
punct |
),see |
| R6686 |
T9661 |
T9615 |
punct |
.,favor |
| R6687 |
T9663 |
T9664 |
prep |
In,are |
| R6688 |
T9665 |
T9666 |
amod |
embryonic,mesenchyme |
| R6689 |
T9666 |
T9663 |
pobj |
mesenchyme,In |
| R6690 |
T9667 |
T9664 |
punct |
", ",are |
| R6691 |
T9668 |
T9664 |
nsubj |
expression,are |
| R6692 |
T9669 |
T9668 |
prep |
of,expression |
| R6693 |
T9670 |
T9669 |
pobj |
Tbx15,of |
| R6694 |
T9671 |
T9670 |
cc |
and,Tbx15 |
| R6695 |
T9672 |
T9670 |
conj |
Agouti,Tbx15 |
| R6696 |
T9673 |
T9664 |
acomp |
complementary,are |
| R6697 |
T9674 |
T9664 |
punct |
", ",are |
| R6698 |
T9675 |
T9664 |
cc |
and,are |
| R6699 |
T9676 |
T9677 |
nsubj |
it,is |
| R6700 |
T9677 |
T9664 |
conj |
is,are |
| R6701 |
T9678 |
T9677 |
acomp |
possible,is |
| R6702 |
T9679 |
T9680 |
mark |
that,acts |
| R6703 |
T9680 |
T9677 |
ccomp |
acts,is |
| R6704 |
T9681 |
T9680 |
nsubj |
Tbx15,acts |
| R6705 |
T9682 |
T9680 |
advmod |
directly,acts |
| R6706 |
T9683 |
T9684 |
aux |
to,inhibit |
| R6707 |
T9684 |
T9680 |
advcl |
inhibit,acts |
| R6708 |
T9685 |
T9686 |
compound |
Agouti,transcription |
| R6709 |
T9686 |
T9684 |
dobj |
transcription,inhibit |
| R6710 |
T9687 |
T9684 |
prep |
in,inhibit |
| R6711 |
T9688 |
T9689 |
amod |
dorsolateral,mesenchyme |
| R6712 |
T9689 |
T9687 |
pobj |
mesenchyme,in |
| R6713 |
T9690 |
T9664 |
punct |
.,are |
| R6714 |
T9692 |
T9693 |
advmod |
However,is |
| R6715 |
T9694 |
T9693 |
punct |
", ",is |
| R6716 |
T9695 |
T9696 |
det |
the,ability |
| R6717 |
T9696 |
T9693 |
nsubj |
ability,is |
| R6718 |
T9697 |
T9696 |
prep |
of,ability |
| R6719 |
T9698 |
T9697 |
pobj |
Tbx15,of |
| R6720 |
T9699 |
T9700 |
aux |
to,suppress |
| R6721 |
T9700 |
T9696 |
acl |
suppress,ability |
| R6722 |
T9701 |
T9700 |
dobj |
expression,suppress |
| R6723 |
T9702 |
T9701 |
prep |
of,expression |
| R6724 |
T9703 |
T9704 |
det |
the,isoform |
| R6725 |
T9704 |
T9702 |
pobj |
isoform,of |
| R6726 |
T9705 |
T9706 |
amod |
ventral,specific |
| R6727 |
T9706 |
T9704 |
amod |
specific,isoform |
| R6728 |
T9707 |
T9706 |
punct |
-,specific |
| R6729 |
T9708 |
T9704 |
compound |
Agouti,isoform |
| R6730 |
T9709 |
T9700 |
prep |
in,suppress |
| R6731 |
T9710 |
T9711 |
amod |
postnatal,mice |
| R6732 |
T9711 |
T9709 |
pobj |
mice,in |
| R6733 |
T9712 |
T9693 |
acomp |
likely,is |
| R6734 |
T9713 |
T9714 |
aux |
to,be |
| R6735 |
T9714 |
T9712 |
xcomp |
be,likely |
| R6736 |
T9715 |
T9714 |
acomp |
indirect,be |
| R6737 |
T9716 |
T9693 |
punct |
", ",is |
| R6738 |
T9717 |
T9718 |
mark |
since,occurs |
| R6739 |
T9718 |
T9693 |
advcl |
occurs,is |
| R6740 |
T9719 |
T9720 |
amod |
postnatal,expression |
| R6741 |
T9720 |
T9718 |
nsubj |
expression,occurs |
| R6742 |
T9721 |
T9720 |
prep |
of,expression |
| R6743 |
T9722 |
T9721 |
pobj |
Tbx15,of |
| R6744 |
T9723 |
T9718 |
advmod |
broadly,occurs |
| R6745 |
T9724 |
T9718 |
prep |
along,occurs |
| R6746 |
T9725 |
T9726 |
det |
the,axis |
| R6747 |
T9726 |
T9724 |
pobj |
axis,along |
| R6748 |
T9727 |
T9726 |
amod |
dorsoventral,axis |
| R6749 |
T9728 |
T9718 |
cc |
and,occurs |
| R6750 |
T9729 |
T9718 |
conj |
overlaps,occurs |
| R6751 |
T9730 |
T9729 |
advmod |
extensively,overlaps |
| R6752 |
T9731 |
T9729 |
prep |
with,overlaps |
| R6753 |
T9732 |
T9731 |
pobj |
that,with |
| R6754 |
T9733 |
T9732 |
prep |
of,that |
| R6755 |
T9734 |
T9733 |
pobj |
Agouti,of |
| R6756 |
T9735 |
T9693 |
punct |
.,is |
| R6757 |
T9737 |
T9738 |
prep |
In,include |
| R6758 |
T9739 |
T9740 |
det |
either,case |
| R6759 |
T9740 |
T9737 |
pobj |
case,In |
| R6760 |
T9741 |
T9738 |
punct |
", ",include |
| R6761 |
T9742 |
T9743 |
det |
the,targets |
| R6762 |
T9743 |
T9738 |
nsubj |
targets,include |
| R6763 |
T9744 |
T9743 |
prep |
of,targets |
| R6764 |
T9745 |
T9746 |
compound |
Tbx15,action |
| R6765 |
T9746 |
T9744 |
pobj |
action,of |
| R6766 |
T9747 |
T9743 |
prep |
in,targets |
| R6767 |
T9748 |
T9749 |
det |
the,skin |
| R6768 |
T9749 |
T9747 |
pobj |
skin,in |
| R6769 |
T9750 |
T9738 |
dobj |
genes,include |
| R6770 |
T9751 |
T9738 |
prep |
in,include |
| R6771 |
T9752 |
T9751 |
pobj |
addition,in |
| R6772 |
T9753 |
T9752 |
prep |
to,addition |
| R6773 |
T9754 |
T9753 |
pobj |
Agouti,to |
| R6774 |
T9755 |
T9738 |
punct |
", ",include |
| R6775 |
T9756 |
T9757 |
mark |
since,exhibit |
| R6776 |
T9757 |
T9738 |
advcl |
exhibit,include |
| R6777 |
T9758 |
T9759 |
compound |
hair,length |
| R6778 |
T9759 |
T9757 |
nsubj |
length,exhibit |
| R6779 |
T9760 |
T9759 |
cc |
and,length |
| R6780 |
T9761 |
T9762 |
compound |
melanocyte,distribution |
| R6781 |
T9762 |
T9759 |
conj |
distribution,length |
| R6782 |
T9763 |
T9764 |
det |
a,alteration |
| R6783 |
T9764 |
T9757 |
dobj |
alteration,exhibit |
| R6784 |
T9765 |
T9764 |
amod |
demonstrable,alteration |
| R6785 |
T9766 |
T9765 |
punct |
", ",demonstrable |
| R6786 |
T9767 |
T9765 |
cc |
albeit,demonstrable |
| R6787 |
T9768 |
T9765 |
conj |
subtle,demonstrable |
| R6788 |
T9769 |
T9764 |
punct |
", ",alteration |
| R6789 |
T9770 |
T9757 |
prep |
in,exhibit |
| R6790 |
T9771 |
T9770 |
pobj |
animals,in |
| R6791 |
T9772 |
T9773 |
dep |
that,carry |
| R6792 |
T9773 |
T9771 |
relcl |
carry,animals |
| R6793 |
T9774 |
T9775 |
det |
a,allele |
| R6794 |
T9775 |
T9773 |
dobj |
allele,carry |
| R6795 |
T9776 |
T9775 |
amod |
null,allele |
| R6796 |
T9777 |
T9775 |
compound |
Agouti,allele |
| R6797 |
T9778 |
T9738 |
punct |
.,include |
| R6798 |
T9780 |
T9781 |
nummod |
One,target |
| R6799 |
T9781 |
T9783 |
nsubj |
target,is |
| R6800 |
T9782 |
T9781 |
amod |
potential,target |
| R6801 |
T9784 |
T9783 |
attr |
Alx4,is |
| R6802 |
T9785 |
T9784 |
punct |
", ",Alx4 |
| R6803 |
T9786 |
T9787 |
dep |
which,expressed |
| R6804 |
T9787 |
T9784 |
relcl |
expressed,Alx4 |
| R6805 |
T9788 |
T9787 |
punct |
", ",expressed |
| R6806 |
T9789 |
T9787 |
prep |
like,expressed |
| R6807 |
T9790 |
T9789 |
pobj |
Agouti,like |
| R6808 |
T9791 |
T9787 |
punct |
", ",expressed |
| R6809 |
T9792 |
T9787 |
auxpass |
is,expressed |
| R6810 |
T9793 |
T9787 |
prep |
in,expressed |
| R6811 |
T9794 |
T9795 |
amod |
ventral,mesenchyme |
| R6812 |
T9795 |
T9793 |
pobj |
mesenchyme,in |
| R6813 |
T9796 |
T9795 |
amod |
embryonic,mesenchyme |
| R6814 |
T9797 |
T9787 |
punct |
", ",expressed |
| R6815 |
T9798 |
T9787 |
cc |
and,expressed |
| R6816 |
T9799 |
T9787 |
punct |
", ",expressed |
| R6817 |
T9800 |
T9801 |
advmod |
when,mutated |
| R6818 |
T9801 |
T9802 |
advcl |
mutated,affects |
| R6819 |
T9802 |
T9787 |
conj |
affects,expressed |
| R6820 |
T9803 |
T9802 |
punct |
", ",affects |
| R6821 |
T9804 |
T9805 |
nmod |
hair,follicle |
| R6822 |
T9805 |
T9807 |
nmod |
follicle,development |
| R6823 |
T9806 |
T9805 |
punct |
-,follicle |
| R6824 |
T9807 |
T9802 |
dobj |
development,affects |
| R6825 |
T9808 |
T9809 |
advmod |
as,as |
| R6826 |
T9809 |
T9805 |
cc |
as,follicle |
| R6827 |
T9810 |
T9809 |
advmod |
well,as |
| R6828 |
T9811 |
T9805 |
conj |
limb,follicle |
| R6829 |
T9812 |
T9811 |
cc |
and,limb |
| R6830 |
T9813 |
T9811 |
conj |
craniofacial,limb |
| R6831 |
T9814 |
T9815 |
punct |
(,Qu |
| R6832 |
T9815 |
T9783 |
meta |
Qu,is |
| R6833 |
T9816 |
T9815 |
nmod |
et,Qu |
| R6834 |
T9817 |
T9815 |
nmod |
al.,Qu |
| R6835 |
T9818 |
T9815 |
nummod |
1997,Qu |
| R6836 |
T9819 |
T9815 |
punct |
", ",Qu |
| R6837 |
T9820 |
T9815 |
nummod |
1998,Qu |
| R6838 |
T9821 |
T9815 |
punct |
;,Qu |
| R6839 |
T9822 |
T9815 |
nmod |
Wu,Qu |
| R6840 |
T9823 |
T9815 |
nmod |
et,Qu |
| R6841 |
T9824 |
T9815 |
nmod |
al.,Qu |
| R6842 |
T9825 |
T9815 |
nummod |
2000,Qu |
| R6843 |
T9826 |
T9815 |
punct |
;,Qu |
| R6844 |
T9827 |
T9815 |
nmod |
Wuyts,Qu |
| R6845 |
T9828 |
T9815 |
nmod |
et,Qu |
| R6846 |
T9829 |
T9815 |
nmod |
al.,Qu |
| R6847 |
T9830 |
T9815 |
nummod |
2000,Qu |
| R6848 |
T9831 |
T9815 |
punct |
;,Qu |
| R6849 |
T9832 |
T9815 |
nmod |
Mavrogiannis,Qu |
| R6850 |
T9833 |
T9815 |
nmod |
et,Qu |
| R6851 |
T9834 |
T9815 |
nmod |
al.,Qu |
| R6852 |
T9835 |
T9815 |
nummod |
2001,Qu |
| R6853 |
T9836 |
T9815 |
punct |
),Qu |
| R6854 |
T9837 |
T9783 |
punct |
.,is |
| R6855 |
T9839 |
T9840 |
advmod |
However,appears |
| R6856 |
T9841 |
T9840 |
punct |
", ",appears |
| R6857 |
T9842 |
T9840 |
nsubj |
expression,appears |
| R6858 |
T9843 |
T9842 |
prep |
of,expression |
| R6859 |
T9844 |
T9845 |
amod |
ventral,markers |
| R6860 |
T9845 |
T9843 |
pobj |
markers,of |
| R6861 |
T9846 |
T9847 |
amod |
such,as |
| R6862 |
T9847 |
T9845 |
prep |
as,markers |
| R6863 |
T9848 |
T9847 |
pobj |
Alx4,as |
| R6864 |
T9849 |
T9848 |
punct |
", ",Alx4 |
| R6865 |
T9850 |
T9851 |
advmod |
as,as |
| R6866 |
T9851 |
T9848 |
cc |
as,Alx4 |
| R6867 |
T9852 |
T9851 |
advmod |
well,as |
| R6868 |
T9853 |
T9848 |
conj |
Alx3,Alx4 |
| R6869 |
T9854 |
T9853 |
cc |
and,Alx3 |
| R6870 |
T9855 |
T9853 |
conj |
Msx2,Alx3 |
| R6871 |
T9856 |
T9840 |
punct |
", ",appears |
| R6872 |
T9857 |
T9858 |
aux |
to,be |
| R6873 |
T9858 |
T9840 |
xcomp |
be,appears |
| R6874 |
T9859 |
T9858 |
acomp |
unaffected,be |
| R6875 |
T9860 |
T9858 |
prep |
at,be |
| R6876 |
T9861 |
T9860 |
pobj |
E11.5,at |
| R6877 |
T9862 |
T9858 |
prep |
in,be |
| R6878 |
T9863 |
T9864 |
compound |
deH,deH |
| R6879 |
T9864 |
T9866 |
compound |
deH,embryos |
| R6880 |
T9865 |
T9864 |
punct |
/,deH |
| R6881 |
T9866 |
T9862 |
pobj |
embryos,in |
| R6882 |
T9867 |
T9868 |
punct |
(,shown |
| R6883 |
T9868 |
T9858 |
parataxis |
shown,be |
| R6884 |
T9869 |
T9868 |
nsubj |
data,shown |
| R6885 |
T9870 |
T9868 |
neg |
not,shown |
| R6886 |
T9871 |
T9868 |
punct |
),shown |
| R6887 |
T9872 |
T9840 |
punct |
.,appears |
| R6896 |
T10220 |
T10219 |
cc |
and,Differences |
| R6897 |
T10221 |
T10219 |
conj |
Similarities,Differences |
| R6898 |
T10222 |
T10219 |
prep |
to,Differences |
| R6899 |
T10223 |
T10224 |
amod |
Dorsoventral,Patterning |
| R6900 |
T10224 |
T10222 |
pobj |
Patterning,to |
| R6901 |
T10225 |
T10224 |
compound |
Limb,Patterning |
| R6902 |
T10227 |
T10228 |
nsubj |
Loss,affects |
| R6903 |
T10229 |
T10227 |
prep |
of,Loss |
| R6904 |
T10230 |
T10229 |
pobj |
Tbx15,of |
| R6905 |
T10231 |
T10228 |
advmod |
also,affects |
| R6906 |
T10232 |
T10233 |
amod |
regional,distribution |
| R6907 |
T10233 |
T10228 |
dobj |
distribution,affects |
| R6908 |
T10234 |
T10233 |
prep |
of,distribution |
| R6909 |
T10235 |
T10236 |
compound |
hair,color |
| R6910 |
T10236 |
T10234 |
pobj |
color,of |
| R6911 |
T10237 |
T10233 |
prep |
in,distribution |
| R6912 |
T10238 |
T10239 |
det |
the,limbs |
| R6913 |
T10239 |
T10237 |
pobj |
limbs,in |
| R6914 |
T10240 |
T10228 |
punct |
", ",affects |
| R6915 |
T10241 |
T10228 |
prep |
with,affects |
| R6916 |
T10242 |
T10243 |
nsubj |
areas,giving |
| R6917 |
T10243 |
T10241 |
pcomp |
giving,with |
| R6918 |
T10244 |
T10245 |
dep |
that,produce |
| R6919 |
T10245 |
T10242 |
relcl |
produce,areas |
| R6920 |
T10246 |
T10245 |
aux |
would,produce |
| R6921 |
T10247 |
T10245 |
advmod |
normally,produce |
| R6922 |
T10248 |
T10249 |
amod |
black,hair |
| R6923 |
T10249 |
T10245 |
dobj |
hair,produce |
| R6924 |
T10250 |
T10243 |
dobj |
rise,giving |
| R6925 |
T10251 |
T10243 |
prep |
to,giving |
| R6926 |
T10252 |
T10253 |
amod |
yellow,hair |
| R6927 |
T10253 |
T10251 |
pobj |
hair,to |
| R6928 |
T10254 |
T10243 |
advmod |
instead,giving |
| R6929 |
T10255 |
T10228 |
punct |
.,affects |
| R6930 |
T10257 |
T10258 |
advmod |
However,correspond |
| R6931 |
T10259 |
T10258 |
punct |
", ",correspond |
| R6932 |
T10260 |
T10261 |
preconj |
neither,patterns |
| R6933 |
T10261 |
T10258 |
nsubj |
patterns,correspond |
| R6934 |
T10262 |
T10261 |
amod |
normal,patterns |
| R6935 |
T10263 |
T10261 |
prep |
of,patterns |
| R6936 |
T10264 |
T10265 |
amod |
pigment,type |
| R6937 |
T10265 |
T10267 |
compound |
type,synthesis |
| R6938 |
T10266 |
T10265 |
punct |
-,type |
| R6939 |
T10267 |
T10263 |
pobj |
synthesis,of |
| R6940 |
T10268 |
T10261 |
prep |
in,patterns |
| R6941 |
T10269 |
T10270 |
det |
the,limb |
| R6942 |
T10270 |
T10268 |
pobj |
limb,in |
| R6943 |
T10271 |
T10261 |
cc |
nor,patterns |
| R6944 |
T10272 |
T10273 |
poss |
their,disruption |
| R6945 |
T10273 |
T10261 |
conj |
disruption,patterns |
| R6946 |
T10274 |
T10273 |
prep |
in,disruption |
| R6947 |
T10275 |
T10276 |
compound |
deH,deH |
| R6948 |
T10276 |
T10278 |
compound |
deH,mice |
| R6949 |
T10277 |
T10276 |
punct |
/,deH |
| R6950 |
T10278 |
T10274 |
pobj |
mice,in |
| R6951 |
T10279 |
T10258 |
prep |
to,correspond |
| R6952 |
T10280 |
T10281 |
amod |
obvious,compartments |
| R6953 |
T10281 |
T10279 |
pobj |
compartments,to |
| R6954 |
T10282 |
T10281 |
amod |
developmental,compartments |
| R6955 |
T10283 |
T10258 |
punct |
.,correspond |
| R6956 |
T10285 |
T10286 |
advmod |
Furthermore,have |
| R6957 |
T10287 |
T10286 |
punct |
", ",have |
| R6958 |
T10288 |
T10286 |
nsubj |
losses,have |
| R6959 |
T10289 |
T10288 |
prep |
of,losses |
| R6960 |
T10290 |
T10289 |
pobj |
function,of |
| R6961 |
T10291 |
T10288 |
prep |
for,losses |
| R6962 |
T10292 |
T10291 |
pobj |
En1,for |
| R6963 |
T10293 |
T10292 |
cc |
or,En1 |
| R6964 |
T10294 |
T10292 |
conj |
Wnt7a,En1 |
| R6965 |
T10295 |
T10288 |
punct |
", ",losses |
| R6966 |
T10296 |
T10297 |
dep |
which,cause |
| R6967 |
T10297 |
T10288 |
relcl |
cause,losses |
| R6968 |
T10298 |
T10299 |
det |
a,transformation |
| R6969 |
T10299 |
T10297 |
dobj |
transformation,cause |
| R6970 |
T10300 |
T10299 |
amod |
partial,transformation |
| R6971 |
T10301 |
T10299 |
prep |
of,transformation |
| R6972 |
T10302 |
T10303 |
det |
the,limb |
| R6973 |
T10303 |
T10301 |
pobj |
limb,of |
| R6974 |
T10304 |
T10303 |
amod |
distal,limb |
| R6975 |
T10305 |
T10299 |
prep |
from,transformation |
| R6976 |
T10306 |
T10305 |
pobj |
dorsum,from |
| R6977 |
T10307 |
T10305 |
prep |
to,from |
| R6978 |
T10308 |
T10307 |
pobj |
ventrum,to |
| R6979 |
T10309 |
T10310 |
punct |
(,Loomis |
| R6980 |
T10310 |
T10305 |
meta |
Loomis,from |
| R6981 |
T10311 |
T10310 |
nmod |
et,Loomis |
| R6982 |
T10312 |
T10310 |
nmod |
al.,Loomis |
| R6983 |
T10313 |
T10310 |
nummod |
1996,Loomis |
| R6984 |
T10314 |
T10310 |
punct |
),Loomis |
| R6985 |
T10315 |
T10305 |
cc |
or,from |
| R6986 |
T10316 |
T10317 |
npadvmod |
ventrum,to |
| R6987 |
T10317 |
T10305 |
conj |
to,from |
| R6988 |
T10318 |
T10317 |
pobj |
dorsum,to |
| R6989 |
T10319 |
T10320 |
punct |
(,Parr |
| R6990 |
T10320 |
T10317 |
meta |
Parr,to |
| R6991 |
T10321 |
T10320 |
cc |
and,Parr |
| R6992 |
T10322 |
T10320 |
conj |
McMahon,Parr |
| R6993 |
T10323 |
T10322 |
nummod |
1995,McMahon |
| R6994 |
T10324 |
T10322 |
punct |
),McMahon |
| R6995 |
T10325 |
T10297 |
punct |
", ",cause |
| R6996 |
T10326 |
T10297 |
advmod |
respectively,cause |
| R6997 |
T10327 |
T10286 |
punct |
", ",have |
| R6998 |
T10328 |
T10329 |
det |
no,effect |
| R6999 |
T10329 |
T10286 |
dobj |
effect,have |
| R7000 |
T10330 |
T10329 |
prep |
on,effect |
| R7001 |
T10331 |
T10332 |
amod |
regional,patterns |
| R7002 |
T10332 |
T10330 |
pobj |
patterns,on |
| R7003 |
T10333 |
T10332 |
prep |
of,patterns |
| R7004 |
T10334 |
T10335 |
compound |
Agouti,expression |
| R7005 |
T10335 |
T10333 |
pobj |
expression,of |
| R7006 |
T10336 |
T10332 |
cc |
or,patterns |
| R7007 |
T10337 |
T10332 |
conj |
distribution,patterns |
| R7008 |
T10338 |
T10337 |
prep |
of,distribution |
| R7009 |
T10339 |
T10340 |
compound |
hair,color |
| R7010 |
T10340 |
T10342 |
compound |
color,regions |
| R7011 |
T10341 |
T10340 |
punct |
-,color |
| R7012 |
T10342 |
T10338 |
pobj |
regions,of |
| R7013 |
T10343 |
T10344 |
punct |
(,Y. |
| R7014 |
T10344 |
T10286 |
meta |
Y.,have |
| R7015 |
T10345 |
T10344 |
nmod |
Chen,Y. |
| R7016 |
T10346 |
T10344 |
punct |
", ",Y. |
| R7017 |
T10347 |
T10344 |
amod |
unpublished,Y. |
| R7018 |
T10348 |
T10344 |
nmod |
data,Y. |
| R7019 |
T10349 |
T10344 |
punct |
),Y. |
| R7020 |
T10350 |
T10286 |
punct |
.,have |
| R7021 |
T10352 |
T10353 |
punct |
(,is |
| R7022 |
T10354 |
T10355 |
amod |
Ectopic,pigmentation |
| R7023 |
T10355 |
T10353 |
nsubj |
pigmentation,is |
| R7024 |
T10356 |
T10355 |
prep |
of,pigmentation |
| R7025 |
T10357 |
T10358 |
det |
the,footpads |
| R7026 |
T10358 |
T10356 |
pobj |
footpads,of |
| R7027 |
T10359 |
T10358 |
amod |
ventral,footpads |
| R7028 |
T10360 |
T10361 |
dep |
that,develops |
| R7029 |
T10361 |
T10355 |
relcl |
develops,pigmentation |
| R7030 |
T10362 |
T10361 |
prep |
in,develops |
| R7031 |
T10363 |
T10364 |
compound |
En1,mice |
| R7032 |
T10364 |
T10362 |
pobj |
mice,in |
| R7033 |
T10365 |
T10364 |
compound |
mutant,mice |
| R7034 |
T10366 |
T10353 |
acomp |
unrelated,is |
| R7035 |
T10367 |
T10366 |
prep |
to,unrelated |
| R7036 |
T10368 |
T10369 |
compound |
pigment,type |
| R7037 |
T10369 |
T10371 |
compound |
type,synthesis |
| R7038 |
T10370 |
T10369 |
punct |
-,type |
| R7039 |
T10371 |
T10367 |
pobj |
synthesis,to |
| R7040 |
T10372 |
T10353 |
cc |
and,is |
| R7041 |
T10373 |
T10374 |
advmod |
instead,reflects |
| R7042 |
T10374 |
T10353 |
conj |
reflects,is |
| R7043 |
T10375 |
T10374 |
advmod |
likely,reflects |
| R7044 |
T10376 |
T10377 |
det |
a,requirement |
| R7045 |
T10377 |
T10374 |
dobj |
requirement,reflects |
| R7046 |
T10378 |
T10377 |
prep |
for,requirement |
| R7047 |
T10379 |
T10378 |
pobj |
En1,for |
| R7048 |
T10380 |
T10377 |
punct |
", ",requirement |
| R7049 |
T10381 |
T10377 |
amod |
independent,requirement |
| R7050 |
T10382 |
T10381 |
prep |
of,independent |
| R7051 |
T10383 |
T10382 |
pobj |
Wnt7a,of |
| R7052 |
T10384 |
T10377 |
punct |
", ",requirement |
| R7053 |
T10385 |
T10386 |
aux |
to,repress |
| R7054 |
T10386 |
T10377 |
acl |
repress,requirement |
| R7055 |
T10387 |
T10386 |
dobj |
migration,repress |
| R7056 |
T10388 |
T10387 |
cc |
or,migration |
| R7057 |
T10389 |
T10387 |
conj |
proliferation,migration |
| R7058 |
T10390 |
T10387 |
punct |
(,migration |
| R7059 |
T10391 |
T10387 |
cc |
or,migration |
| R7060 |
T10392 |
T10387 |
conj |
both,migration |
| R7061 |
T10393 |
T10392 |
punct |
),both |
| R7062 |
T10394 |
T10387 |
prep |
of,migration |
| R7063 |
T10395 |
T10396 |
compound |
pigment,cells |
| R7064 |
T10396 |
T10394 |
pobj |
cells,of |
| R7065 |
T10397 |
T10387 |
prep |
in,migration |
| R7066 |
T10398 |
T10399 |
amod |
ventral,epidermis |
| R7067 |
T10399 |
T10397 |
pobj |
epidermis,in |
| R7068 |
T10400 |
T10401 |
punct |
[,Cygan |
| R7069 |
T10401 |
T10374 |
meta |
Cygan,reflects |
| R7070 |
T10402 |
T10401 |
nmod |
et,Cygan |
| R7071 |
T10403 |
T10401 |
nmod |
al.,Cygan |
| R7072 |
T10404 |
T10401 |
nummod |
1997,Cygan |
| R7073 |
T10405 |
T10401 |
punct |
;,Cygan |
| R7074 |
T10406 |
T10401 |
nmod |
Loomis,Cygan |
| R7075 |
T10407 |
T10401 |
nmod |
et,Cygan |
| R7076 |
T10408 |
T10401 |
nmod |
al.,Cygan |
| R7077 |
T10409 |
T10401 |
nummod |
1998,Cygan |
| R7078 |
T10410 |
T10401 |
punct |
],Cygan |
| R7079 |
T10411 |
T10353 |
punct |
.,is |
| R7080 |
T10412 |
T10353 |
punct |
),is |
| R7081 |
T10414 |
T10415 |
det |
These,considerations |
| R7082 |
T10415 |
T10416 |
nsubj |
considerations,notwithstanding |
| R7083 |
T10416 |
T10417 |
advcl |
notwithstanding,shares |
| R7084 |
T10418 |
T10417 |
punct |
", ",shares |
| R7085 |
T10419 |
T10417 |
nsubj |
control,shares |
| R7086 |
T10420 |
T10419 |
prep |
of,control |
| R7087 |
T10421 |
T10422 |
amod |
dorsoventral,pattern |
| R7088 |
T10422 |
T10420 |
pobj |
pattern,of |
| R7089 |
T10423 |
T10422 |
compound |
trunk,pattern |
| R7090 |
T10424 |
T10419 |
prep |
by,control |
| R7091 |
T10425 |
T10424 |
pobj |
Tbx15,by |
| R7092 |
T10426 |
T10427 |
amod |
certain,features |
| R7093 |
T10427 |
T10417 |
dobj |
features,shares |
| R7094 |
T10428 |
T10417 |
prep |
with,shares |
| R7095 |
T10429 |
T10428 |
pobj |
control,with |
| R7096 |
T10430 |
T10429 |
prep |
of,control |
| R7097 |
T10431 |
T10432 |
amod |
dorsoventral,patterning |
| R7098 |
T10432 |
T10430 |
pobj |
patterning,of |
| R7099 |
T10433 |
T10432 |
compound |
limb,patterning |
| R7100 |
T10434 |
T10429 |
prep |
by,control |
| R7101 |
T10435 |
T10434 |
pobj |
Lmx1b,by |
| R7102 |
T10436 |
T10435 |
punct |
", ",Lmx1b |
| R7103 |
T10437 |
T10438 |
det |
a,factor |
| R7104 |
T10438 |
T10435 |
appos |
factor,Lmx1b |
| R7105 |
T10439 |
T10440 |
compound |
LIM,domain |
| R7106 |
T10440 |
T10438 |
compound |
domain,factor |
| R7107 |
T10441 |
T10438 |
compound |
transcription,factor |
| R7108 |
T10442 |
T10443 |
dep |
that,acts |
| R7109 |
T10443 |
T10438 |
relcl |
acts,factor |
| R7110 |
T10444 |
T10443 |
advmod |
downstream,acts |
| R7111 |
T10445 |
T10444 |
prep |
of,downstream |
| R7112 |
T10446 |
T10445 |
pobj |
Wnt7a,of |
| R7113 |
T10447 |
T10446 |
cc |
and,Wnt7a |
| R7114 |
T10448 |
T10446 |
conj |
En1,Wnt7a |
| R7115 |
T10449 |
T10450 |
punct |
(,Riddle |
| R7116 |
T10450 |
T10429 |
meta |
Riddle,control |
| R7117 |
T10451 |
T10450 |
nmod |
et,Riddle |
| R7118 |
T10452 |
T10450 |
nmod |
al.,Riddle |
| R7119 |
T10453 |
T10450 |
nummod |
1995,Riddle |
| R7120 |
T10454 |
T10450 |
punct |
;,Riddle |
| R7121 |
T10455 |
T10450 |
conj |
Vogel,Riddle |
| R7122 |
T10456 |
T10455 |
nmod |
et,Vogel |
| R7123 |
T10457 |
T10455 |
nmod |
al.,Vogel |
| R7124 |
T10458 |
T10455 |
nummod |
1995,Vogel |
| R7125 |
T10459 |
T10455 |
punct |
;,Vogel |
| R7126 |
T10460 |
T10455 |
conj |
Cygan,Vogel |
| R7127 |
T10461 |
T10460 |
nmod |
et,Cygan |
| R7128 |
T10462 |
T10460 |
nmod |
al.,Cygan |
| R7129 |
T10463 |
T10460 |
nummod |
1997,Cygan |
| R7130 |
T10464 |
T10460 |
punct |
;,Cygan |
| R7131 |
T10465 |
T10460 |
conj |
Logan,Cygan |
| R7132 |
T10466 |
T10465 |
nmod |
et,Logan |
| R7133 |
T10467 |
T10465 |
nmod |
al.,Logan |
| R7134 |
T10468 |
T10465 |
nummod |
1997,Logan |
| R7135 |
T10469 |
T10465 |
punct |
;,Logan |
| R7136 |
T10470 |
T10465 |
conj |
Loomis,Logan |
| R7137 |
T10471 |
T10470 |
nmod |
et,Loomis |
| R7138 |
T10472 |
T10470 |
nmod |
al.,Loomis |
| R7139 |
T10473 |
T10470 |
nummod |
1998,Loomis |
| R7140 |
T10474 |
T10470 |
punct |
;,Loomis |
| R7141 |
T10475 |
T10470 |
conj |
Chen,Loomis |
| R7142 |
T10476 |
T10475 |
cc |
and,Chen |
| R7143 |
T10477 |
T10475 |
conj |
Johnson,Chen |
| R7144 |
T10478 |
T10477 |
nummod |
2002,Johnson |
| R7145 |
T10479 |
T10477 |
punct |
),Johnson |
| R7146 |
T10480 |
T10417 |
punct |
.,shares |
| R7147 |
T10482 |
T10483 |
preconj |
Both,Tbx15 |
| R7148 |
T10483 |
T10484 |
nsubj |
Tbx15,act |
| R7149 |
T10485 |
T10483 |
cc |
and,Tbx15 |
| R7150 |
T10486 |
T10483 |
conj |
Lmx1b,Tbx15 |
| R7151 |
T10487 |
T10484 |
advmod |
autonomously,act |
| R7152 |
T10488 |
T10484 |
prep |
in,act |
| R7153 |
T10489 |
T10490 |
amod |
mesenchymal,cells |
| R7154 |
T10490 |
T10488 |
pobj |
cells,in |
| R7155 |
T10491 |
T10492 |
aux |
to,promote |
| R7156 |
T10492 |
T10484 |
advcl |
promote,act |
| R7157 |
T10493 |
T10494 |
det |
a,identity |
| R7158 |
T10494 |
T10492 |
dobj |
identity,promote |
| R7159 |
T10495 |
T10494 |
amod |
dorsal,identity |
| R7160 |
T10496 |
T10484 |
punct |
", ",act |
| R7161 |
T10497 |
T10484 |
cc |
yet,act |
| R7162 |
T10498 |
T10484 |
conj |
have,act |
| R7163 |
T10499 |
T10500 |
compound |
expression,domains |
| R7164 |
T10500 |
T10498 |
dobj |
domains,have |
| R7165 |
T10501 |
T10502 |
dep |
that,correspond |
| R7166 |
T10502 |
T10500 |
relcl |
correspond,domains |
| R7167 |
T10503 |
T10502 |
aux |
do,correspond |
| R7168 |
T10504 |
T10502 |
neg |
not,correspond |
| R7169 |
T10505 |
T10502 |
prep |
to,correspond |
| R7170 |
T10506 |
T10507 |
compound |
cell,lineage |
| R7171 |
T10507 |
T10508 |
compound |
lineage,compartments |
| R7172 |
T10508 |
T10505 |
pobj |
compartments,to |
| R7173 |
T10509 |
T10502 |
prep |
in,correspond |
| R7174 |
T10510 |
T10511 |
det |
the,flank |
| R7175 |
T10511 |
T10509 |
pobj |
flank,in |
| R7176 |
T10512 |
T10513 |
punct |
(,Tbx15 |
| R7177 |
T10513 |
T10511 |
parataxis |
Tbx15,flank |
| R7178 |
T10514 |
T10513 |
punct |
),Tbx15 |
| R7179 |
T10515 |
T10511 |
cc |
or,flank |
| R7180 |
T10516 |
T10517 |
det |
the,limb |
| R7181 |
T10517 |
T10511 |
conj |
limb,flank |
| R7182 |
T10518 |
T10519 |
punct |
(,Lmx1b |
| R7183 |
T10519 |
T10517 |
parataxis |
Lmx1b,limb |
| R7184 |
T10520 |
T10519 |
punct |
),Lmx1b |
| R7185 |
T10521 |
T10522 |
punct |
(,Altabef |
| R7186 |
T10522 |
T10498 |
meta |
Altabef,have |
| R7187 |
T10523 |
T10522 |
nmod |
et,Altabef |
| R7188 |
T10524 |
T10522 |
nmod |
al.,Altabef |
| R7189 |
T10525 |
T10522 |
nummod |
1997,Altabef |
| R7190 |
T10526 |
T10522 |
punct |
;,Altabef |
| R7191 |
T10527 |
T10522 |
nmod |
Michaud,Altabef |
| R7192 |
T10528 |
T10522 |
nmod |
et,Altabef |
| R7193 |
T10529 |
T10522 |
nmod |
al.,Altabef |
| R7194 |
T10530 |
T10522 |
nummod |
1997,Altabef |
| R7195 |
T10531 |
T10522 |
punct |
),Altabef |
| R7196 |
T10532 |
T10484 |
punct |
.,act |
| R7197 |
T10534 |
T10535 |
prep |
In,depends |
| R7198 |
T10536 |
T10537 |
det |
the,case |
| R7199 |
T10537 |
T10534 |
pobj |
case,In |
| R7200 |
T10538 |
T10537 |
prep |
of,case |
| R7201 |
T10539 |
T10538 |
pobj |
Lmx1b,of |
| R7202 |
T10540 |
T10535 |
punct |
", ",depends |
| R7203 |
T10541 |
T10542 |
poss |
its,expression |
| R7204 |
T10542 |
T10535 |
nsubj |
expression,depends |
| R7205 |
T10543 |
T10542 |
prep |
in,expression |
| R7206 |
T10544 |
T10545 |
det |
the,limb |
| R7207 |
T10545 |
T10543 |
pobj |
limb,in |
| R7208 |
T10546 |
T10545 |
amod |
distal,limb |
| R7209 |
T10547 |
T10535 |
prep |
on,depends |
| R7210 |
T10548 |
T10547 |
pobj |
Wnt7a,on |
| R7211 |
T10549 |
T10548 |
acl |
produced,Wnt7a |
| R7212 |
T10550 |
T10549 |
prep |
in,produced |
| R7213 |
T10551 |
T10552 |
det |
the,ectoderm |
| R7214 |
T10552 |
T10550 |
pobj |
ectoderm,in |
| R7215 |
T10553 |
T10552 |
amod |
overlying,ectoderm |
| R7216 |
T10554 |
T10552 |
amod |
dorsal,ectoderm |
| R7217 |
T10555 |
T10556 |
punct |
(,Riddle |
| R7218 |
T10556 |
T10535 |
meta |
Riddle,depends |
| R7219 |
T10557 |
T10556 |
nmod |
et,Riddle |
| R7220 |
T10558 |
T10556 |
nmod |
al.,Riddle |
| R7221 |
T10559 |
T10556 |
nummod |
1995,Riddle |
| R7222 |
T10560 |
T10556 |
punct |
;,Riddle |
| R7223 |
T10561 |
T10556 |
nmod |
Cygan,Riddle |
| R7224 |
T10562 |
T10556 |
nmod |
et,Riddle |
| R7225 |
T10563 |
T10556 |
nmod |
al.,Riddle |
| R7226 |
T10564 |
T10556 |
nummod |
1997,Riddle |
| R7227 |
T10565 |
T10556 |
punct |
;,Riddle |
| R7228 |
T10566 |
T10556 |
nmod |
Loomis,Riddle |
| R7229 |
T10567 |
T10556 |
nmod |
et,Riddle |
| R7230 |
T10568 |
T10556 |
nmod |
al.,Riddle |
| R7231 |
T10569 |
T10556 |
nummod |
1998,Riddle |
| R7232 |
T10570 |
T10556 |
punct |
),Riddle |
| R7233 |
T10571 |
T10535 |
punct |
.,depends |
| R7234 |
T10573 |
T10574 |
nsubjpass |
Wnt7a,restricted |
| R7235 |
T10575 |
T10574 |
punct |
", ",restricted |
| R7236 |
T10576 |
T10574 |
prep |
in,restricted |
| R7237 |
T10577 |
T10576 |
pobj |
turn,in |
| R7238 |
T10578 |
T10574 |
punct |
", ",restricted |
| R7239 |
T10579 |
T10574 |
auxpass |
is,restricted |
| R7240 |
T10580 |
T10574 |
prep |
to,restricted |
| R7241 |
T10581 |
T10582 |
amod |
dorsal,ectoderm |
| R7242 |
T10582 |
T10580 |
pobj |
ectoderm,to |
| R7243 |
T10583 |
T10574 |
agent |
by,restricted |
| R7244 |
T10584 |
T10583 |
pobj |
En1,by |
| R7245 |
T10585 |
T10574 |
prep |
in,restricted |
| R7246 |
T10586 |
T10587 |
det |
the,ectoderm |
| R7247 |
T10587 |
T10585 |
pobj |
ectoderm,in |
| R7248 |
T10588 |
T10587 |
amod |
ventral,ectoderm |
| R7249 |
T10589 |
T10590 |
punct |
(,Loomis |
| R7250 |
T10590 |
T10574 |
meta |
Loomis,restricted |
| R7251 |
T10591 |
T10590 |
nmod |
et,Loomis |
| R7252 |
T10592 |
T10590 |
nmod |
al.,Loomis |
| R7253 |
T10593 |
T10590 |
nummod |
1996,Loomis |
| R7254 |
T10594 |
T10590 |
punct |
;,Loomis |
| R7255 |
T10595 |
T10590 |
nmod |
Cygan,Loomis |
| R7256 |
T10596 |
T10590 |
nmod |
et,Loomis |
| R7257 |
T10597 |
T10590 |
nmod |
al.,Loomis |
| R7258 |
T10598 |
T10590 |
nummod |
1997,Loomis |
| R7259 |
T10599 |
T10590 |
punct |
;,Loomis |
| R7260 |
T10600 |
T10590 |
nmod |
Logan,Loomis |
| R7261 |
T10601 |
T10590 |
nmod |
et,Loomis |
| R7262 |
T10602 |
T10590 |
nmod |
al.,Loomis |
| R7263 |
T10603 |
T10590 |
nummod |
1997,Loomis |
| R7264 |
T10604 |
T10590 |
punct |
),Loomis |
| R7265 |
T10605 |
T10574 |
punct |
", ",restricted |
| R7266 |
T10606 |
T10607 |
poss |
whose,expression |
| R7267 |
T10607 |
T10608 |
dep |
expression,marks |
| R7268 |
T10608 |
T10574 |
ccomp |
marks,restricted |
| R7269 |
T10609 |
T10610 |
det |
a,boundary |
| R7270 |
T10610 |
T10608 |
dobj |
boundary,marks |
| R7271 |
T10611 |
T10610 |
compound |
lineage,boundary |
| R7272 |
T10612 |
T10610 |
amod |
coincident,boundary |
| R7273 |
T10613 |
T10612 |
prep |
with,coincident |
| R7274 |
T10614 |
T10615 |
det |
the,midline |
| R7275 |
T10615 |
T10613 |
pobj |
midline,with |
| R7276 |
T10616 |
T10615 |
amod |
dorsoventral,midline |
| R7277 |
T10617 |
T10615 |
prep |
of,midline |
| R7278 |
T10618 |
T10619 |
det |
the,ridge |
| R7279 |
T10619 |
T10617 |
pobj |
ridge,of |
| R7280 |
T10620 |
T10619 |
amod |
apical,ridge |
| R7281 |
T10621 |
T10619 |
amod |
ectodermal,ridge |
| R7282 |
T10622 |
T10623 |
punct |
(,Michaud |
| R7283 |
T10623 |
T10608 |
meta |
Michaud,marks |
| R7284 |
T10624 |
T10623 |
nmod |
Altabef,Michaud |
| R7285 |
T10625 |
T10623 |
nmod |
et,Michaud |
| R7286 |
T10626 |
T10623 |
nmod |
al.,Michaud |
| R7287 |
T10627 |
T10623 |
nummod |
1997,Michaud |
| R7288 |
T10628 |
T10623 |
punct |
;,Michaud |
| R7289 |
T10629 |
T10623 |
nmod |
et,Michaud |
| R7290 |
T10630 |
T10623 |
nmod |
al.,Michaud |
| R7291 |
T10631 |
T10623 |
nummod |
1997,Michaud |
| R7292 |
T10632 |
T10623 |
punct |
;,Michaud |
| R7293 |
T10633 |
T10623 |
nmod |
Kimmel,Michaud |
| R7294 |
T10634 |
T10623 |
nmod |
et,Michaud |
| R7295 |
T10635 |
T10623 |
nmod |
al.,Michaud |
| R7296 |
T10636 |
T10623 |
nummod |
2000,Michaud |
| R7297 |
T10637 |
T10623 |
punct |
),Michaud |
| R7298 |
T10638 |
T10574 |
punct |
.,restricted |
| R7299 |
T10640 |
T10641 |
mark |
As,described |
| R7300 |
T10641 |
T10642 |
advcl |
described,reported |
| R7301 |
T10643 |
T10641 |
advmod |
above,described |
| R7302 |
T10644 |
T10642 |
punct |
", ",reported |
| R7303 |
T10645 |
T10646 |
nmod |
En1,mutations |
| R7304 |
T10646 |
T10642 |
nsubjpass |
mutations,reported |
| R7305 |
T10647 |
T10645 |
cc |
or,En1 |
| R7306 |
T10648 |
T10645 |
conj |
Wnt7a,En1 |
| R7307 |
T10649 |
T10642 |
aux |
have,reported |
| R7308 |
T10650 |
T10642 |
neg |
not,reported |
| R7309 |
T10651 |
T10642 |
auxpass |
been,reported |
| R7310 |
T10652 |
T10653 |
aux |
to,affect |
| R7311 |
T10653 |
T10642 |
xcomp |
affect,reported |
| R7312 |
T10654 |
T10653 |
dobj |
patterns,affect |
| R7313 |
T10655 |
T10654 |
prep |
of,patterns |
| R7314 |
T10656 |
T10657 |
compound |
hair,color |
| R7315 |
T10657 |
T10659 |
compound |
color,distribution |
| R7316 |
T10658 |
T10657 |
punct |
-,color |
| R7317 |
T10659 |
T10655 |
pobj |
distribution,of |
| R7318 |
T10660 |
T10661 |
punct |
(,C. |
| R7319 |
T10661 |
T10642 |
meta |
C.,reported |
| R7320 |
T10662 |
T10661 |
nmod |
Loomis,C. |
| R7321 |
T10663 |
T10661 |
punct |
", ",C. |
| R7322 |
T10664 |
T10665 |
amod |
personal,communication |
| R7323 |
T10665 |
T10661 |
conj |
communication,C. |
| R7324 |
T10666 |
T10665 |
punct |
;,communication |
| R7325 |
T10667 |
T10665 |
conj |
Parr,communication |
| R7326 |
T10668 |
T10667 |
cc |
and,Parr |
| R7327 |
T10669 |
T10667 |
conj |
McMahon,Parr |
| R7328 |
T10670 |
T10669 |
nummod |
1995,McMahon |
| R7329 |
T10671 |
T10669 |
punct |
;,McMahon |
| R7330 |
T10672 |
T10669 |
conj |
Loomis,McMahon |
| R7331 |
T10673 |
T10672 |
nmod |
et,Loomis |
| R7332 |
T10674 |
T10672 |
advmod |
al.,Loomis |
| R7333 |
T10675 |
T10672 |
nummod |
1996,Loomis |
| R7334 |
T10676 |
T10672 |
punct |
),Loomis |
| R7335 |
T10677 |
T10642 |
punct |
.,reported |
| R7336 |
T10679 |
T10680 |
advmod |
However,apply |
| R7337 |
T10681 |
T10680 |
punct |
", ",apply |
| R7338 |
T10682 |
T10683 |
det |
the,theme |
| R7339 |
T10683 |
T10680 |
nsubj |
theme,apply |
| R7340 |
T10684 |
T10683 |
amod |
essential,theme |
| R7341 |
T10685 |
T10686 |
mark |
that,control |
| R7342 |
T10686 |
T10683 |
acl |
control,theme |
| R7343 |
T10687 |
T10688 |
amod |
ectodermal,compartments |
| R7344 |
T10688 |
T10686 |
nsubj |
compartments,control |
| R7345 |
T10689 |
T10688 |
compound |
lineage,compartments |
| R7346 |
T10690 |
T10691 |
det |
the,fate |
| R7347 |
T10691 |
T10686 |
dobj |
fate,control |
| R7348 |
T10692 |
T10691 |
prep |
of,fate |
| R7349 |
T10693 |
T10694 |
amod |
underlying,mesenchyme |
| R7350 |
T10694 |
T10692 |
pobj |
mesenchyme,of |
| R7351 |
T10695 |
T10686 |
prep |
in,control |
| R7352 |
T10696 |
T10697 |
amod |
developing,limbs |
| R7353 |
T10697 |
T10695 |
pobj |
limbs,in |
| R7354 |
T10698 |
T10680 |
aux |
may,apply |
| R7355 |
T10699 |
T10680 |
prep |
to,apply |
| R7356 |
T10700 |
T10701 |
det |
the,trunk |
| R7357 |
T10701 |
T10699 |
pobj |
trunk,to |
| R7358 |
T10702 |
T10703 |
advmod |
as,as |
| R7359 |
T10703 |
T10701 |
cc |
as,trunk |
| R7360 |
T10704 |
T10703 |
advmod |
well,as |
| R7361 |
T10705 |
T10706 |
det |
the,limb |
| R7362 |
T10706 |
T10701 |
conj |
limb,trunk |
| R7363 |
T10707 |
T10680 |
punct |
.,apply |
| R7364 |
T10709 |
T10710 |
det |
The,glands |
| R7365 |
T10710 |
T10712 |
nsubj |
glands,develop |
| R7366 |
T10711 |
T10710 |
amod |
mammary,glands |
| R7367 |
T10713 |
T10712 |
advmod |
also,develop |
| R7368 |
T10714 |
T10712 |
prep |
at,develop |
| R7369 |
T10715 |
T10716 |
det |
a,position |
| R7370 |
T10716 |
T10714 |
pobj |
position,at |
| R7371 |
T10717 |
T10716 |
amod |
stereotyped,position |
| R7372 |
T10718 |
T10716 |
amod |
dorsoventral,position |
| R7373 |
T10719 |
T10712 |
cc |
and,develop |
| R7374 |
T10720 |
T10712 |
conj |
depend,develop |
| R7375 |
T10721 |
T10720 |
prep |
on,depend |
| R7376 |
T10722 |
T10723 |
amod |
epithelial,mesenchymal |
| R7377 |
T10723 |
T10725 |
amod |
mesenchymal,interactions |
| R7378 |
T10724 |
T10723 |
punct |
–,mesenchymal |
| R7379 |
T10725 |
T10721 |
pobj |
interactions,on |
| R7380 |
T10726 |
T10712 |
punct |
.,develop |
| R7381 |
T10728 |
T10729 |
advmod |
However,are |
| R7382 |
T10730 |
T10729 |
punct |
", ",are |
| R7383 |
T10731 |
T10732 |
det |
the,number |
| R7384 |
T10732 |
T10729 |
nsubj |
number,are |
| R7385 |
T10733 |
T10732 |
cc |
and,number |
| R7386 |
T10734 |
T10735 |
amod |
apparent,position |
| R7387 |
T10735 |
T10732 |
conj |
position,number |
| R7388 |
T10736 |
T10732 |
prep |
of,number |
| R7389 |
T10737 |
T10738 |
det |
the,glands |
| R7390 |
T10738 |
T10736 |
pobj |
glands,of |
| R7391 |
T10739 |
T10738 |
amod |
mammary,glands |
| R7392 |
T10740 |
T10729 |
acomp |
normal,are |
| R7393 |
T10741 |
T10729 |
prep |
in,are |
| R7394 |
T10742 |
T10743 |
compound |
deH,deH |
| R7395 |
T10743 |
T10745 |
compound |
deH,animals |
| R7396 |
T10744 |
T10743 |
punct |
/,deH |
| R7397 |
T10745 |
T10741 |
pobj |
animals,in |
| R7398 |
T10746 |
T10729 |
punct |
", ",are |
| R7399 |
T10747 |
T10729 |
advcl |
indicating,are |
| R7400 |
T10748 |
T10749 |
det |
the,existence |
| R7401 |
T10749 |
T10747 |
dobj |
existence,indicating |
| R7402 |
T10750 |
T10749 |
prep |
of,existence |
| R7403 |
T10751 |
T10752 |
amod |
additional,mechanisms |
| R7404 |
T10752 |
T10750 |
pobj |
mechanisms,of |
| R7405 |
T10753 |
T10754 |
dep |
that,control |
| R7406 |
T10754 |
T10752 |
relcl |
control,mechanisms |
| R7407 |
T10755 |
T10756 |
amod |
dorsoventral,patterning |
| R7408 |
T10756 |
T10754 |
dobj |
patterning,control |
| R7409 |
T10757 |
T10754 |
prep |
in,control |
| R7410 |
T10758 |
T10759 |
det |
the,trunk |
| R7411 |
T10759 |
T10757 |
pobj |
trunk,in |
| R7412 |
T10760 |
T10761 |
advmod |
as,as |
| R7413 |
T10761 |
T10757 |
cc |
as,in |
| R7414 |
T10762 |
T10761 |
advmod |
well,as |
| R7415 |
T10763 |
T10757 |
conj |
in,in |
| R7416 |
T10764 |
T10765 |
det |
the,limbs |
| R7417 |
T10765 |
T10763 |
pobj |
limbs,in |
| R7418 |
T10766 |
T10729 |
punct |
.,are |
| R7419 |
T10768 |
T10769 |
det |
These,ideas |
| R7420 |
T10769 |
T10770 |
nsubjpass |
ideas,summarized |
| R7421 |
T10771 |
T10770 |
auxpass |
are,summarized |
| R7422 |
T10772 |
T10770 |
prep |
in,summarized |
| R7423 |
T10773 |
T10774 |
det |
the,model |
| R7424 |
T10774 |
T10772 |
pobj |
model,in |
| R7425 |
T10775 |
T10774 |
acl |
shown,model |
| R7426 |
T10776 |
T10775 |
prep |
in,shown |
| R7427 |
T10777 |
T10776 |
pobj |
Figure,in |
| R7428 |
T10778 |
T10777 |
nummod |
9B,Figure |
| R7429 |
T10779 |
T10770 |
punct |
.,summarized |
| R7430 |
T10781 |
T10782 |
nsubj |
We,speculate |
| R7431 |
T10783 |
T10784 |
mark |
that,promotes |
| R7432 |
T10784 |
T10782 |
ccomp |
promotes,speculate |
| R7433 |
T10785 |
T10786 |
det |
a,signal |
| R7434 |
T10786 |
T10784 |
nsubj |
signal,promotes |
| R7435 |
T10787 |
T10786 |
amod |
diffusible,signal |
| R7436 |
T10788 |
T10786 |
prep |
from,signal |
| R7437 |
T10789 |
T10790 |
amod |
dorsal,ectoderm |
| R7438 |
T10790 |
T10788 |
pobj |
ectoderm,from |
| R7439 |
T10791 |
T10790 |
compound |
trunk,ectoderm |
| R7440 |
T10792 |
T10784 |
punct |
", ",promotes |
| R7441 |
T10793 |
T10784 |
prep |
at,promotes |
| R7442 |
T10794 |
T10793 |
cc |
or,at |
| R7443 |
T10795 |
T10796 |
advmod |
prior,E11.5 |
| R7444 |
T10796 |
T10793 |
conj |
E11.5,at |
| R7445 |
T10797 |
T10795 |
prep |
to,prior |
| R7446 |
T10798 |
T10784 |
punct |
", ",promotes |
| R7447 |
T10799 |
T10784 |
dobj |
expression,promotes |
| R7448 |
T10800 |
T10799 |
prep |
of,expression |
| R7449 |
T10801 |
T10800 |
pobj |
Tbx15,of |
| R7450 |
T10802 |
T10799 |
prep |
in,expression |
| R7451 |
T10803 |
T10804 |
amod |
dorsal,mesenchyme |
| R7452 |
T10804 |
T10802 |
pobj |
mesenchyme,in |
| R7453 |
T10805 |
T10804 |
compound |
trunk,mesenchyme |
| R7454 |
T10806 |
T10799 |
punct |
", ",expression |
| R7455 |
T10807 |
T10808 |
dep |
which,establishes |
| R7456 |
T10808 |
T10799 |
relcl |
establishes,expression |
| R7457 |
T10809 |
T10808 |
advmod |
then,establishes |
| R7458 |
T10810 |
T10811 |
amod |
dorsal,identity |
| R7459 |
T10811 |
T10808 |
dobj |
identity,establishes |
| R7460 |
T10812 |
T10811 |
amod |
positional,identity |
| R7461 |
T10813 |
T10811 |
prep |
of,identity |
| R7462 |
T10814 |
T10815 |
det |
those,cells |
| R7463 |
T10815 |
T10813 |
pobj |
cells,of |
| R7464 |
T10816 |
T10817 |
mark |
as,manifested |
| R7465 |
T10817 |
T10808 |
advcl |
manifested,establishes |
| R7466 |
T10818 |
T10817 |
agent |
by,manifested |
| R7467 |
T10819 |
T10818 |
pobj |
differences,by |
| R7468 |
T10820 |
T10819 |
prep |
in,differences |
| R7469 |
T10821 |
T10822 |
compound |
Agouti,expression |
| R7470 |
T10822 |
T10820 |
pobj |
expression,in |
| R7471 |
T10823 |
T10822 |
punct |
", ",expression |
| R7472 |
T10824 |
T10825 |
compound |
pigment,cell |
| R7473 |
T10825 |
T10827 |
compound |
cell,development |
| R7474 |
T10826 |
T10825 |
punct |
-,cell |
| R7475 |
T10827 |
T10822 |
conj |
development,expression |
| R7476 |
T10828 |
T10827 |
punct |
", ",development |
| R7477 |
T10829 |
T10827 |
cc |
and,development |
| R7478 |
T10830 |
T10831 |
compound |
hair,growth |
| R7479 |
T10831 |
T10827 |
conj |
growth,development |
| R7480 |
T10832 |
T10782 |
punct |
.,speculate |
| R7481 |
T10834 |
T10835 |
mark |
Because,corresponds |
| R7482 |
T10835 |
T10842 |
advcl |
corresponds,depict |
| R7483 |
T10836 |
T10837 |
det |
the,limit |
| R7484 |
T10837 |
T10835 |
nsubj |
limit,corresponds |
| R7485 |
T10838 |
T10837 |
amod |
ventral,limit |
| R7486 |
T10839 |
T10837 |
prep |
of,limit |
| R7487 |
T10840 |
T10841 |
compound |
Tbx15,expression |
| R7488 |
T10841 |
T10839 |
pobj |
expression,of |
| R7489 |
T10843 |
T10835 |
prep |
to,corresponds |
| R7490 |
T10844 |
T10845 |
det |
the,limit |
| R7491 |
T10845 |
T10843 |
pobj |
limit,to |
| R7492 |
T10846 |
T10845 |
amod |
dorsal,limit |
| R7493 |
T10847 |
T10845 |
prep |
of,limit |
| R7494 |
T10848 |
T10849 |
compound |
En1,expression |
| R7495 |
T10849 |
T10847 |
pobj |
expression,of |
| R7496 |
T10850 |
T10835 |
cc |
and,corresponds |
| R7497 |
T10851 |
T10852 |
mark |
because,lies |
| R7498 |
T10852 |
T10835 |
conj |
lies,corresponds |
| R7499 |
T10853 |
T10854 |
det |
the,position |
| R7500 |
T10854 |
T10852 |
nsubj |
position,lies |
| R7501 |
T10855 |
T10854 |
amod |
normal,position |
| R7502 |
T10856 |
T10854 |
prep |
of,position |
| R7503 |
T10857 |
T10858 |
det |
the,boundary |
| R7504 |
T10858 |
T10856 |
pobj |
boundary,of |
| R7505 |
T10859 |
T10858 |
compound |
pigmentation,boundary |
| R7506 |
T10860 |
T10861 |
advmod |
approximately,in |
| R7507 |
T10861 |
T10852 |
prep |
in,lies |
| R7508 |
T10862 |
T10861 |
pobj |
register,in |
| R7509 |
T10863 |
T10862 |
prep |
with,register |
| R7510 |
T10864 |
T10865 |
det |
the,outgrowths |
| R7511 |
T10865 |
T10863 |
pobj |
outgrowths,with |
| R7512 |
T10866 |
T10867 |
compound |
limb,bud |
| R7513 |
T10867 |
T10865 |
compound |
bud,outgrowths |
| R7514 |
T10868 |
T10867 |
punct |
-,bud |
| R7515 |
T10869 |
T10842 |
punct |
", ",depict |
| R7516 |
T10870 |
T10842 |
nsubj |
we,depict |
| R7517 |
T10871 |
T10872 |
det |
the,position |
| R7518 |
T10872 |
T10842 |
dobj |
position,depict |
| R7519 |
T10873 |
T10872 |
prep |
of,position |
| R7520 |
T10874 |
T10875 |
det |
a,boundary |
| R7521 |
T10875 |
T10873 |
pobj |
boundary,of |
| R7522 |
T10876 |
T10875 |
amod |
putative,boundary |
| R7523 |
T10877 |
T10875 |
amod |
dorsoventral,boundary |
| R7524 |
T10878 |
T10842 |
prep |
in,depict |
| R7525 |
T10879 |
T10880 |
compound |
trunk,ectoderm |
| R7526 |
T10880 |
T10878 |
pobj |
ectoderm,in |
| R7527 |
T10881 |
T10842 |
prep |
as,depict |
| R7528 |
T10882 |
T10881 |
amod |
coincident,as |
| R7529 |
T10883 |
T10882 |
prep |
with,coincident |
| R7530 |
T10884 |
T10885 |
det |
the,boundary |
| R7531 |
T10885 |
T10883 |
pobj |
boundary,with |
| R7532 |
T10886 |
T10885 |
nmod |
limb,boundary |
| R7533 |
T10887 |
T10885 |
amod |
dorsoventral,boundary |
| R7534 |
T10888 |
T10842 |
punct |
.,depict |
| R7535 |
T10890 |
T10891 |
det |
This,model |
| R7536 |
T10891 |
T10892 |
nsubj |
model,is |
| R7537 |
T10893 |
T10892 |
acomp |
consistent,is |
| R7538 |
T10894 |
T10893 |
prep |
with,consistent |
| R7539 |
T10895 |
T10894 |
pobj |
studies,with |
| R7540 |
T10896 |
T10895 |
prep |
in,studies |
| R7541 |
T10897 |
T10898 |
det |
the,chick |
| R7542 |
T10898 |
T10896 |
pobj |
chick,in |
| R7543 |
T10899 |
T10898 |
punct |
", ",chick |
| R7544 |
T10900 |
T10901 |
advmod |
where,exist |
| R7545 |
T10901 |
T10898 |
relcl |
exist,chick |
| R7546 |
T10902 |
T10903 |
amod |
distinct,compartments |
| R7547 |
T10903 |
T10901 |
nsubj |
compartments,exist |
| R7548 |
T10904 |
T10903 |
amod |
dorsal,compartments |
| R7549 |
T10905 |
T10904 |
cc |
and,dorsal |
| R7550 |
T10906 |
T10904 |
conj |
ventral,dorsal |
| R7551 |
T10907 |
T10903 |
compound |
lineage,compartments |
| R7552 |
T10908 |
T10901 |
prep |
for,exist |
| R7553 |
T10909 |
T10908 |
pobj |
ectoderm,for |
| R7554 |
T10910 |
T10901 |
prep |
in,exist |
| R7555 |
T10911 |
T10912 |
preconj |
both,limb |
| R7556 |
T10912 |
T10910 |
pobj |
limb,in |
| R7557 |
T10913 |
T10912 |
det |
the,limb |
| R7558 |
T10914 |
T10915 |
punct |
(,Michaud |
| R7559 |
T10915 |
T10912 |
meta |
Michaud,limb |
| R7560 |
T10916 |
T10915 |
nmod |
Altabef,Michaud |
| R7561 |
T10917 |
T10915 |
nmod |
et,Michaud |
| R7562 |
T10918 |
T10915 |
nmod |
al.,Michaud |
| R7563 |
T10919 |
T10915 |
nummod |
1997,Michaud |
| R7564 |
T10920 |
T10915 |
punct |
", ",Michaud |
| R7565 |
T10921 |
T10915 |
nummod |
2000,Michaud |
| R7566 |
T10922 |
T10915 |
punct |
;,Michaud |
| R7567 |
T10923 |
T10915 |
nmod |
et,Michaud |
| R7568 |
T10924 |
T10915 |
nmod |
al.,Michaud |
| R7569 |
T10925 |
T10915 |
nummod |
1997,Michaud |
| R7570 |
T10926 |
T10915 |
punct |
;,Michaud |
| R7571 |
T10927 |
T10915 |
nmod |
Kimmel,Michaud |
| R7572 |
T10928 |
T10915 |
nmod |
et,Michaud |
| R7573 |
T10929 |
T10915 |
nmod |
al.,Michaud |
| R7574 |
T10930 |
T10915 |
nummod |
2000,Michaud |
| R7575 |
T10931 |
T10915 |
punct |
),Michaud |
| R7576 |
T10932 |
T10912 |
cc |
and,limb |
| R7577 |
T10933 |
T10934 |
amod |
interlimb,regions |
| R7578 |
T10934 |
T10912 |
conj |
regions,limb |
| R7579 |
T10935 |
T10936 |
punct |
(,Altabef |
| R7580 |
T10936 |
T10934 |
meta |
Altabef,regions |
| R7581 |
T10937 |
T10936 |
nmod |
et,Altabef |
| R7582 |
T10938 |
T10936 |
nmod |
al.,Altabef |
| R7583 |
T10939 |
T10936 |
nummod |
1997,Altabef |
| R7584 |
T10940 |
T10936 |
punct |
", ",Altabef |
| R7585 |
T10941 |
T10936 |
nummod |
2000,Altabef |
| R7586 |
T10942 |
T10936 |
punct |
),Altabef |
| R7587 |
T10943 |
T10901 |
punct |
", ",exist |
| R7588 |
T10944 |
T10945 |
cc |
but,for |
| R7589 |
T10945 |
T10901 |
prep |
for,exist |
| R7590 |
T10946 |
T10945 |
neg |
not,for |
| R7591 |
T10947 |
T10948 |
compound |
limb,mesoderm |
| R7592 |
T10948 |
T10945 |
pobj |
mesoderm,for |
| R7593 |
T10949 |
T10950 |
punct |
(,Altabef |
| R7594 |
T10950 |
T10948 |
meta |
Altabef,mesoderm |
| R7595 |
T10951 |
T10950 |
nmod |
et,Altabef |
| R7596 |
T10952 |
T10950 |
nmod |
al.,Altabef |
| R7597 |
T10953 |
T10950 |
nummod |
1997,Altabef |
| R7598 |
T10954 |
T10950 |
punct |
;,Altabef |
| R7599 |
T10955 |
T10950 |
nmod |
Michaud,Altabef |
| R7600 |
T10956 |
T10950 |
nmod |
et,Altabef |
| R7601 |
T10957 |
T10950 |
nmod |
al.,Altabef |
| R7602 |
T10958 |
T10950 |
nummod |
1997,Altabef |
| R7603 |
T10959 |
T10950 |
punct |
),Altabef |
| R7604 |
T10960 |
T10892 |
punct |
.,is |
| R7605 |
T10962 |
T10963 |
prep |
In,act |
| R7606 |
T10964 |
T10962 |
pobj |
fact,In |
| R7607 |
T10965 |
T10963 |
punct |
", ",act |
| R7608 |
T10966 |
T10967 |
det |
the,mechanism |
| R7609 |
T10967 |
T10963 |
nsubj |
mechanism,act |
| R7610 |
T10968 |
T10967 |
amod |
same,mechanism |
| R7611 |
T10969 |
T10970 |
dep |
that,determines |
| R7612 |
T10970 |
T10967 |
relcl |
determines,mechanism |
| R7613 |
T10971 |
T10972 |
amod |
dorsoventral,position |
| R7614 |
T10972 |
T10970 |
dobj |
position,determines |
| R7615 |
T10973 |
T10972 |
prep |
of,position |
| R7616 |
T10974 |
T10975 |
det |
the,limbs |
| R7617 |
T10975 |
T10973 |
pobj |
limbs,of |
| R7618 |
T10976 |
T10975 |
cc |
and,limbs |
| R7619 |
T10977 |
T10978 |
det |
the,ridge |
| R7620 |
T10978 |
T10975 |
conj |
ridge,limbs |
| R7621 |
T10979 |
T10978 |
amod |
apical,ridge |
| R7622 |
T10980 |
T10978 |
amod |
ectodermal,ridge |
| R7623 |
T10981 |
T10963 |
aux |
may,act |
| R7624 |
T10982 |
T10963 |
advmod |
also,act |
| R7625 |
T10983 |
T10963 |
prep |
on,act |
| R7626 |
T10984 |
T10983 |
pobj |
expression,on |
| R7627 |
T10985 |
T10984 |
prep |
of,expression |
| R7628 |
T10986 |
T10985 |
pobj |
Tbx15,of |
| R7629 |
T10987 |
T10963 |
prep |
in,act |
| R7630 |
T10988 |
T10989 |
det |
the,trunk |
| R7631 |
T10989 |
T10987 |
pobj |
trunk,in |
| R7632 |
T10990 |
T10963 |
punct |
", ",act |
| R7633 |
T10991 |
T10992 |
mark |
since,develop |
| R7634 |
T10992 |
T10963 |
advcl |
develop,act |
| R7635 |
T10993 |
T10994 |
amod |
ectopic,limbs |
| R7636 |
T10994 |
T10992 |
nsubj |
limbs,develop |
| R7637 |
T10995 |
T10994 |
acl |
induced,limbs |
| R7638 |
T10996 |
T10995 |
prep |
in,induced |
| R7639 |
T10997 |
T10998 |
det |
the,region |
| R7640 |
T10998 |
T10996 |
pobj |
region,in |
| R7641 |
T10999 |
T10998 |
amod |
interlimb,region |
| R7642 |
T11000 |
T10995 |
prep |
by,induced |
| R7643 |
T11001 |
T11000 |
pobj |
application,by |
| R7644 |
T11002 |
T11001 |
prep |
of,application |
| R7645 |
T11003 |
T11004 |
compound |
FGF,beads |
| R7646 |
T11004 |
T11002 |
pobj |
beads,of |
| R7647 |
T11005 |
T10992 |
prep |
along,develop |
| R7648 |
T11006 |
T11007 |
det |
a,line |
| R7649 |
T11007 |
T11005 |
pobj |
line,along |
| R7650 |
T11008 |
T11007 |
amod |
single,line |
| R7651 |
T11009 |
T11010 |
dep |
that,is |
| R7652 |
T11010 |
T11007 |
relcl |
is,line |
| R7653 |
T11011 |
T11010 |
acomp |
coincident,is |
| R7654 |
T11012 |
T11011 |
prep |
with,coincident |
| R7655 |
T11013 |
T11014 |
amod |
normal,buds |
| R7656 |
T11014 |
T11012 |
pobj |
buds,with |
| R7657 |
T11015 |
T11014 |
compound |
limb,buds |
| R7658 |
T11016 |
T11014 |
punct |
(,buds |
| R7659 |
T11017 |
T11014 |
cc |
and,buds |
| R7660 |
T11018 |
T11019 |
det |
the,boundary |
| R7661 |
T11019 |
T11014 |
conj |
boundary,buds |
| R7662 |
T11020 |
T11019 |
amod |
future,boundary |
| R7663 |
T11021 |
T11019 |
compound |
pigmentation,boundary |
| R7664 |
T11022 |
T10992 |
punct |
),develop |
| R7665 |
T11023 |
T11024 |
punct |
(,Cohn |
| R7666 |
T11024 |
T10992 |
meta |
Cohn,develop |
| R7667 |
T11025 |
T11024 |
nmod |
et,Cohn |
| R7668 |
T11026 |
T11024 |
nmod |
al.,Cohn |
| R7669 |
T11027 |
T11024 |
nummod |
1995,Cohn |
| R7670 |
T11028 |
T11024 |
punct |
;,Cohn |
| R7671 |
T11029 |
T11024 |
nmod |
Crossley,Cohn |
| R7672 |
T11030 |
T11024 |
nmod |
et,Cohn |
| R7673 |
T11031 |
T11024 |
nmod |
al.,Cohn |
| R7674 |
T11032 |
T11024 |
nummod |
1996,Cohn |
| R7675 |
T11033 |
T11024 |
punct |
;,Cohn |
| R7676 |
T11034 |
T11024 |
nmod |
Vogel,Cohn |
| R7677 |
T11035 |
T11024 |
nmod |
et,Cohn |
| R7678 |
T11036 |
T11024 |
nmod |
al.,Cohn |
| R7679 |
T11037 |
T11024 |
nummod |
1996,Cohn |
| R7680 |
T11038 |
T11024 |
punct |
;,Cohn |
| R7681 |
T11039 |
T11024 |
nmod |
Altabef,Cohn |
| R7682 |
T11040 |
T11024 |
nmod |
et,Cohn |
| R7683 |
T11041 |
T11024 |
nmod |
al.,Cohn |
| R7684 |
T11042 |
T11024 |
nummod |
1997,Cohn |
| R7685 |
T11043 |
T11024 |
punct |
", ",Cohn |
| R7686 |
T11044 |
T11024 |
nummod |
2000,Cohn |
| R7687 |
T11045 |
T11024 |
punct |
),Cohn |
| R7688 |
T11046 |
T10963 |
punct |
.,act |
| R7689 |
T11048 |
T11049 |
poss |
Our,model |
| R7690 |
T11049 |
T11050 |
nsubj |
model,predicts |
| R7691 |
T11051 |
T11052 |
mark |
that,give |
| R7692 |
T11052 |
T11050 |
ccomp |
give,predicts |
| R7693 |
T11053 |
T11054 |
amod |
ectopic,expression |
| R7694 |
T11054 |
T11052 |
nsubj |
expression,give |
| R7695 |
T11055 |
T11054 |
prep |
of,expression |
| R7696 |
T11056 |
T11055 |
pobj |
Tbx15,of |
| R7697 |
T11057 |
T11054 |
prep |
in,expression |
| R7698 |
T11058 |
T11059 |
amod |
ventral,mesenchyme |
| R7699 |
T11059 |
T11057 |
pobj |
mesenchyme,in |
| R7700 |
T11060 |
T11052 |
aux |
should,give |
| R7701 |
T11061 |
T11052 |
dobj |
rise,give |
| R7702 |
T11062 |
T11052 |
prep |
to,give |
| R7703 |
T11063 |
T11064 |
det |
a,phenotype |
| R7704 |
T11064 |
T11062 |
pobj |
phenotype,to |
| R7705 |
T11065 |
T11064 |
amod |
dorsalized,phenotype |
| R7706 |
T11066 |
T11064 |
compound |
pigmentation,phenotype |
| R7707 |
T11067 |
T11052 |
cc |
and,give |
| R7708 |
T11068 |
T11069 |
aux |
could,tested |
| R7709 |
T11069 |
T11052 |
conj |
tested,give |
| R7710 |
T11070 |
T11069 |
auxpass |
be,tested |
| R7711 |
T11071 |
T11069 |
prep |
with,tested |
| R7712 |
T11072 |
T11073 |
nmod |
gain,approaches |
| R7713 |
T11073 |
T11071 |
pobj |
approaches,with |
| R7714 |
T11074 |
T11072 |
punct |
-,gain |
| R7715 |
T11075 |
T11072 |
prep |
of,gain |
| R7716 |
T11076 |
T11075 |
punct |
-,of |
| R7717 |
T11077 |
T11075 |
pobj |
function,of |
| R7718 |
T11078 |
T11050 |
punct |
.,predicts |
| R7719 |
T11080 |
T11081 |
advmod |
However,is |
| R7720 |
T11082 |
T11081 |
punct |
", ",is |
| R7721 |
T11083 |
T11084 |
compound |
Tbx15,expression |
| R7722 |
T11084 |
T11081 |
nsubj |
expression,is |
| R7723 |
T11085 |
T11086 |
advmod |
very,dynamic |
| R7724 |
T11086 |
T11081 |
acomp |
dynamic,is |
| R7725 |
T11087 |
T11081 |
cc |
and,is |
| R7726 |
T11088 |
T11089 |
auxpass |
is,restricted |
| R7727 |
T11089 |
T11081 |
conj |
restricted,is |
| R7728 |
T11090 |
T11089 |
prep |
to,restricted |
| R7729 |
T11091 |
T11092 |
amod |
dorsal,mesoderm |
| R7730 |
T11092 |
T11090 |
pobj |
mesoderm,to |
| R7731 |
T11093 |
T11094 |
advmod |
only,from |
| R7732 |
T11094 |
T11089 |
prep |
from,restricted |
| R7733 |
T11095 |
T11094 |
pobj |
E11.5,from |
| R7734 |
T11096 |
T11094 |
prep |
to,from |
| R7735 |
T11097 |
T11096 |
pobj |
E13.5,to |
| R7736 |
T11098 |
T11081 |
punct |
.,is |
| R7737 |
T11100 |
T11101 |
nsubj |
It,is |
| R7738 |
T11101 |
T11102 |
ccomp |
is,require |
| R7739 |
T11103 |
T11101 |
acomp |
possible,is |
| R7740 |
T11104 |
T11105 |
mark |
that,influences |
| R7741 |
T11105 |
T11101 |
ccomp |
influences,is |
| R7742 |
T11106 |
T11105 |
nsubj |
Tbx15,influences |
| R7743 |
T11107 |
T11108 |
compound |
skin,patterning |
| R7744 |
T11108 |
T11105 |
dobj |
patterning,influences |
| R7745 |
T11109 |
T11105 |
prep |
in,influences |
| R7746 |
T11110 |
T11111 |
det |
a,window |
| R7747 |
T11111 |
T11109 |
pobj |
window,in |
| R7748 |
T11112 |
T11113 |
advmod |
very,narrow |
| R7749 |
T11113 |
T11111 |
amod |
narrow,window |
| R7750 |
T11114 |
T11111 |
prep |
of,window |
| R7751 |
T11115 |
T11114 |
pobj |
development,of |
| R7752 |
T11116 |
T11102 |
punct |
;,require |
| R7753 |
T11117 |
T11102 |
advmod |
alternatively,require |
| R7754 |
T11118 |
T11102 |
punct |
", ",require |
| R7755 |
T11119 |
T11102 |
nsubj |
establishment,require |
| R7756 |
T11120 |
T11119 |
prep |
of,establishment |
| R7757 |
T11121 |
T11122 |
amod |
dorsal,identity |
| R7758 |
T11122 |
T11120 |
pobj |
identity,of |
| R7759 |
T11123 |
T11119 |
prep |
by,establishment |
| R7760 |
T11124 |
T11123 |
pobj |
Tbx15,by |
| R7761 |
T11125 |
T11102 |
aux |
may,require |
| R7762 |
T11126 |
T11127 |
det |
another,factor |
| R7763 |
T11127 |
T11102 |
dobj |
factor,require |
| R7764 |
T11128 |
T11129 |
advmod |
as,yet |
| R7765 |
T11129 |
T11131 |
advmod |
yet,unidentified |
| R7766 |
T11130 |
T11129 |
punct |
-,yet |
| R7767 |
T11131 |
T11127 |
amod |
unidentified,factor |
| R7768 |
T11132 |
T11131 |
punct |
-,unidentified |
| R7769 |
T11133 |
T11134 |
dep |
that,is |
| R7770 |
T11134 |
T11127 |
relcl |
is,factor |
| R7771 |
T11135 |
T11134 |
advmod |
only,is |
| R7772 |
T11136 |
T11134 |
acomp |
present,is |
| R7773 |
T11137 |
T11134 |
prep |
in,is |
| R7774 |
T11138 |
T11139 |
det |
the,mesenchyme |
| R7775 |
T11139 |
T11137 |
pobj |
mesenchyme,in |
| R7776 |
T11140 |
T11139 |
acl |
underlying,mesenchyme |
| R7777 |
T11141 |
T11142 |
amod |
dorsal,ectoderm |
| R7778 |
T11142 |
T11140 |
dobj |
ectoderm,underlying |
| R7779 |
T11143 |
T11102 |
punct |
.,require |
| R7780 |
T11305 |
T11306 |
compound |
Pigmentation,Patterns |
| R7781 |
T11307 |
T11306 |
cc |
and,Patterns |
| R7782 |
T11308 |
T11306 |
conj |
Tbx15,Patterns |
| R7783 |
T11309 |
T11306 |
prep |
in,Patterns |
| R7784 |
T11310 |
T11311 |
amod |
Other,Mammals |
| R7785 |
T11311 |
T11309 |
pobj |
Mammals,in |
| R7786 |
T11313 |
T11314 |
det |
The,frontier |
| R7787 |
T11314 |
T11317 |
nsubjpass |
frontier,established |
| R7788 |
T11315 |
T11314 |
amod |
lateral,frontier |
| R7789 |
T11316 |
T11314 |
amod |
somitic,frontier |
| R7790 |
T11318 |
T11314 |
punct |
", ",frontier |
| R7791 |
T11319 |
T11314 |
acl |
defined,frontier |
| R7792 |
T11320 |
T11319 |
prep |
as,defined |
| R7793 |
T11321 |
T11322 |
det |
the,boundary |
| R7794 |
T11322 |
T11320 |
pobj |
boundary,as |
| R7795 |
T11323 |
T11322 |
compound |
lineage,boundary |
| R7796 |
T11324 |
T11322 |
prep |
between,boundary |
| R7797 |
T11325 |
T11326 |
npadvmod |
somite,derived |
| R7798 |
T11326 |
T11328 |
amod |
derived,mesoderm |
| R7799 |
T11327 |
T11326 |
punct |
-,derived |
| R7800 |
T11328 |
T11324 |
pobj |
mesoderm,between |
| R7801 |
T11329 |
T11326 |
cc |
versus,derived |
| R7802 |
T11330 |
T11331 |
amod |
lateral,plate |
| R7803 |
T11331 |
T11332 |
npadvmod |
plate,derived |
| R7804 |
T11332 |
T11326 |
conj |
derived,derived |
| R7805 |
T11333 |
T11332 |
punct |
-,derived |
| R7806 |
T11334 |
T11317 |
punct |
", ",established |
| R7807 |
T11335 |
T11317 |
auxpass |
is,established |
| R7808 |
T11336 |
T11317 |
prep |
during,established |
| R7809 |
T11337 |
T11336 |
pobj |
somitogenesis,during |
| R7810 |
T11338 |
T11339 |
advmod |
early,in |
| R7811 |
T11339 |
T11317 |
prep |
in,established |
| R7812 |
T11340 |
T11339 |
pobj |
development,in |
| R7813 |
T11341 |
T11342 |
punct |
(,Mauger |
| R7814 |
T11342 |
T11317 |
meta |
Mauger,established |
| R7815 |
T11343 |
T11342 |
nummod |
1972,Mauger |
| R7816 |
T11344 |
T11342 |
punct |
;,Mauger |
| R7817 |
T11345 |
T11342 |
nmod |
Christ,Mauger |
| R7818 |
T11346 |
T11342 |
nmod |
et,Mauger |
| R7819 |
T11347 |
T11342 |
nmod |
al.,Mauger |
| R7820 |
T11348 |
T11342 |
nummod |
1983,Mauger |
| R7821 |
T11349 |
T11342 |
punct |
;,Mauger |
| R7822 |
T11350 |
T11342 |
nmod |
Olivera,Mauger |
| R7823 |
T11351 |
T11342 |
punct |
-,Mauger |
| R7824 |
T11352 |
T11342 |
nmod |
Martinez,Mauger |
| R7825 |
T11353 |
T11342 |
nmod |
et,Mauger |
| R7826 |
T11354 |
T11342 |
nmod |
al.,Mauger |
| R7827 |
T11355 |
T11342 |
nummod |
2000,Mauger |
| R7828 |
T11356 |
T11342 |
punct |
;,Mauger |
| R7829 |
T11357 |
T11342 |
nmod |
Nowicki,Mauger |
| R7830 |
T11358 |
T11342 |
nmod |
et,Mauger |
| R7831 |
T11359 |
T11342 |
nmod |
al.,Mauger |
| R7832 |
T11360 |
T11342 |
nummod |
2003,Mauger |
| R7833 |
T11361 |
T11342 |
punct |
),Mauger |
| R7834 |
T11362 |
T11317 |
punct |
", ",established |
| R7835 |
T11363 |
T11317 |
cc |
but,established |
| R7836 |
T11364 |
T11317 |
conj |
remains,established |
| R7837 |
T11365 |
T11364 |
oprd |
distinct,remains |
| R7838 |
T11366 |
T11364 |
prep |
in,remains |
| R7839 |
T11367 |
T11368 |
amod |
postnatal,animals |
| R7840 |
T11368 |
T11366 |
pobj |
animals,in |
| R7841 |
T11369 |
T11364 |
prep |
despite,remains |
| R7842 |
T11370 |
T11371 |
det |
the,potential |
| R7843 |
T11371 |
T11369 |
pobj |
potential,despite |
| R7844 |
T11372 |
T11371 |
prep |
for,potential |
| R7845 |
T11373 |
T11374 |
amod |
extensive,mixing |
| R7846 |
T11374 |
T11372 |
pobj |
mixing,for |
| R7847 |
T11375 |
T11374 |
compound |
cell,mixing |
| R7848 |
T11376 |
T11377 |
punct |
(,see |
| R7849 |
T11377 |
T11364 |
parataxis |
see,remains |
| R7850 |
T11378 |
T11377 |
dobj |
Figure,see |
| R7851 |
T11379 |
T11378 |
nummod |
8,Figure |
| R7852 |
T11380 |
T11377 |
punct |
),see |
| R7853 |
T11381 |
T11317 |
punct |
.,established |
| R7854 |
T11383 |
T11384 |
advmod |
However,demonstrate |
| R7855 |
T11385 |
T11384 |
punct |
", ",demonstrate |
| R7856 |
T11386 |
T11387 |
poss |
our,studies |
| R7857 |
T11387 |
T11384 |
nsubj |
studies,demonstrate |
| R7858 |
T11388 |
T11387 |
nmod |
transplantation,studies |
| R7859 |
T11389 |
T11388 |
cc |
and,transplantation |
| R7860 |
T11390 |
T11388 |
conj |
fate,transplantation |
| R7861 |
T11391 |
T11390 |
punct |
-,fate |
| R7862 |
T11392 |
T11390 |
amod |
mapping,fate |
| R7863 |
T11393 |
T11394 |
mark |
that,lies |
| R7864 |
T11394 |
T11384 |
ccomp |
lies,demonstrate |
| R7865 |
T11395 |
T11396 |
det |
the,frontier |
| R7866 |
T11396 |
T11394 |
nsubj |
frontier,lies |
| R7867 |
T11397 |
T11396 |
amod |
lateral,frontier |
| R7868 |
T11398 |
T11396 |
amod |
somitic,frontier |
| R7869 |
T11399 |
T11394 |
advmod |
dorsal,lies |
| R7870 |
T11400 |
T11399 |
prep |
to,dorsal |
| R7871 |
T11401 |
T11402 |
det |
the,boundary |
| R7872 |
T11402 |
T11400 |
pobj |
boundary,to |
| R7873 |
T11403 |
T11402 |
compound |
pigmentation,boundary |
| R7874 |
T11404 |
T11394 |
cc |
and,lies |
| R7875 |
T11405 |
T11406 |
aux |
does,correlate |
| R7876 |
T11406 |
T11394 |
conj |
correlate,lies |
| R7877 |
T11407 |
T11406 |
neg |
not,correlate |
| R7878 |
T11408 |
T11406 |
advmod |
obviously,correlate |
| R7879 |
T11409 |
T11406 |
prep |
with,correlate |
| R7880 |
T11410 |
T11411 |
det |
a,difference |
| R7881 |
T11411 |
T11409 |
pobj |
difference,with |
| R7882 |
T11412 |
T11411 |
prep |
in,difference |
| R7883 |
T11413 |
T11414 |
compound |
skin,morphology |
| R7884 |
T11414 |
T11412 |
pobj |
morphology,in |
| R7885 |
T11415 |
T11384 |
punct |
.,demonstrate |
| R7886 |
T11417 |
T11418 |
det |
An,domain |
| R7887 |
T11418 |
T11421 |
nsubj |
domain,emerged |
| R7888 |
T11419 |
T11418 |
amod |
additional,domain |
| R7889 |
T11420 |
T11418 |
amod |
dorsoventral,domain |
| R7890 |
T11422 |
T11423 |
dep |
that,is |
| R7891 |
T11423 |
T11418 |
relcl |
is,domain |
| R7892 |
T11424 |
T11423 |
neg |
not,is |
| R7893 |
T11425 |
T11426 |
advmod |
externally,apparent |
| R7894 |
T11426 |
T11423 |
acomp |
apparent,is |
| R7895 |
T11427 |
T11421 |
aux |
has,emerged |
| R7896 |
T11428 |
T11421 |
prep |
from,emerged |
| R7897 |
T11429 |
T11428 |
pobj |
studies,from |
| R7898 |
T11430 |
T11429 |
prep |
of,studies |
| R7899 |
T11431 |
T11430 |
pobj |
Msx1,of |
| R7900 |
T11432 |
T11431 |
punct |
", ",Msx1 |
| R7901 |
T11433 |
T11434 |
poss |
whose,expression |
| R7902 |
T11434 |
T11435 |
dep |
expression,marks |
| R7903 |
T11435 |
T11431 |
relcl |
marks,Msx1 |
| R7904 |
T11436 |
T11437 |
det |
a,subgroup |
| R7905 |
T11437 |
T11435 |
dobj |
subgroup,marks |
| R7906 |
T11438 |
T11437 |
prep |
of,subgroup |
| R7907 |
T11439 |
T11440 |
npadvmod |
somite,derived |
| R7908 |
T11440 |
T11442 |
amod |
derived,cells |
| R7909 |
T11441 |
T11440 |
punct |
-,derived |
| R7910 |
T11442 |
T11438 |
pobj |
cells,of |
| R7911 |
T11443 |
T11442 |
amod |
mesenchymal,cells |
| R7912 |
T11444 |
T11445 |
dep |
that,contribute |
| R7913 |
T11445 |
T11437 |
relcl |
contribute,subgroup |
| R7914 |
T11446 |
T11445 |
prep |
to,contribute |
| R7915 |
T11447 |
T11446 |
pobj |
dermis,to |
| R7916 |
T11448 |
T11445 |
prep |
in,contribute |
| R7917 |
T11449 |
T11450 |
det |
a,stripe |
| R7918 |
T11450 |
T11448 |
pobj |
stripe,in |
| R7919 |
T11451 |
T11450 |
amod |
narrow,stripe |
| R7920 |
T11452 |
T11450 |
prep |
along,stripe |
| R7921 |
T11453 |
T11454 |
det |
the,region |
| R7922 |
T11454 |
T11452 |
pobj |
region,along |
| R7923 |
T11455 |
T11454 |
amod |
paraspinal,region |
| R7924 |
T11456 |
T11457 |
punct |
(,Houzelstein |
| R7925 |
T11457 |
T11421 |
meta |
Houzelstein,emerged |
| R7926 |
T11458 |
T11457 |
nmod |
et,Houzelstein |
| R7927 |
T11459 |
T11457 |
nmod |
al.,Houzelstein |
| R7928 |
T11460 |
T11457 |
nummod |
2000,Houzelstein |
| R7929 |
T11461 |
T11457 |
punct |
),Houzelstein |
| R7930 |
T11462 |
T11421 |
punct |
.,emerged |
| R7931 |
T11464 |
T11465 |
advmod |
Thus,exist |
| R7932 |
T11466 |
T11465 |
punct |
", ",exist |
| R7933 |
T11467 |
T11465 |
expl |
there,exist |
| R7934 |
T11468 |
T11469 |
advmod |
at,three |
| R7935 |
T11469 |
T11471 |
nummod |
three,boundaries |
| R7936 |
T11470 |
T11469 |
advmod |
least,three |
| R7937 |
T11471 |
T11465 |
dobj |
boundaries,exist |
| R7938 |
T11472 |
T11471 |
amod |
distinct,boundaries |
| R7939 |
T11473 |
T11471 |
prep |
in,boundaries |
| R7940 |
T11474 |
T11475 |
amod |
postnatal,skin |
| R7941 |
T11475 |
T11473 |
pobj |
skin,in |
| R7942 |
T11476 |
T11475 |
amod |
mammalian,skin |
| R7943 |
T11477 |
T11478 |
dep |
that,are |
| R7944 |
T11478 |
T11471 |
relcl |
are,boundaries |
| R7945 |
T11479 |
T11478 |
acomp |
parallel,are |
| R7946 |
T11480 |
T11479 |
prep |
to,parallel |
| R7947 |
T11481 |
T11482 |
det |
the,plane |
| R7948 |
T11482 |
T11480 |
pobj |
plane,to |
| R7949 |
T11483 |
T11482 |
amod |
sagittal,plane |
| R7950 |
T11484 |
T11471 |
punct |
", ",boundaries |
| R7951 |
T11485 |
T11471 |
acl |
marked,boundaries |
| R7952 |
T11486 |
T11485 |
agent |
by,marked |
| R7953 |
T11487 |
T11486 |
pobj |
differences,by |
| R7954 |
T11488 |
T11487 |
prep |
in,differences |
| R7955 |
T11489 |
T11490 |
compound |
pigment,type |
| R7956 |
T11490 |
T11492 |
compound |
type,synthesis |
| R7957 |
T11491 |
T11490 |
punct |
-,type |
| R7958 |
T11492 |
T11488 |
pobj |
synthesis,in |
| R7959 |
T11493 |
T11487 |
punct |
", ",differences |
| R7960 |
T11494 |
T11487 |
conj |
differences,differences |
| R7961 |
T11495 |
T11494 |
prep |
in,differences |
| R7962 |
T11496 |
T11497 |
compound |
cell,lineage |
| R7963 |
T11497 |
T11495 |
pobj |
lineage,in |
| R7964 |
T11498 |
T11494 |
punct |
", ",differences |
| R7965 |
T11499 |
T11494 |
cc |
and,differences |
| R7966 |
T11500 |
T11494 |
conj |
differences,differences |
| R7967 |
T11501 |
T11500 |
prep |
in,differences |
| R7968 |
T11502 |
T11501 |
pobj |
expression,in |
| R7969 |
T11503 |
T11502 |
prep |
of,expression |
| R7970 |
T11504 |
T11503 |
pobj |
Msx1,of |
| R7971 |
T11505 |
T11465 |
punct |
.,exist |
| R7972 |
T11507 |
T11508 |
prep |
In,is |
| R7973 |
T11509 |
T11507 |
pobj |
rodents,In |
| R7974 |
T11510 |
T11508 |
punct |
", ",is |
| R7975 |
T11511 |
T11512 |
advmod |
only,boundary |
| R7976 |
T11512 |
T11508 |
nsubj |
boundary,is |
| R7977 |
T11513 |
T11512 |
det |
the,boundary |
| R7978 |
T11514 |
T11512 |
compound |
pigmentation,boundary |
| R7979 |
T11515 |
T11508 |
acomp |
evident,is |
| R7980 |
T11516 |
T11508 |
advmod |
externally,is |
| R7981 |
T11517 |
T11508 |
punct |
", ",is |
| R7982 |
T11518 |
T11508 |
cc |
but,is |
| R7983 |
T11519 |
T11520 |
amod |
many,mammals |
| R7984 |
T11520 |
T11521 |
nsubj |
mammals,have |
| R7985 |
T11521 |
T11508 |
conj |
have,is |
| R7986 |
T11522 |
T11523 |
advmod |
more,complicated |
| R7987 |
T11523 |
T11524 |
amod |
complicated,patterns |
| R7988 |
T11524 |
T11521 |
dobj |
patterns,have |
| R7989 |
T11525 |
T11524 |
prep |
of,patterns |
| R7990 |
T11526 |
T11527 |
compound |
hair,type |
| R7991 |
T11527 |
T11525 |
pobj |
type,of |
| R7992 |
T11528 |
T11527 |
punct |
", ",type |
| R7993 |
T11529 |
T11527 |
conj |
length,type |
| R7994 |
T11530 |
T11529 |
punct |
", ",length |
| R7995 |
T11531 |
T11529 |
cc |
and,length |
| R7996 |
T11532 |
T11531 |
punct |
/,and |
| R7997 |
T11533 |
T11531 |
cc |
or,and |
| R7998 |
T11534 |
T11529 |
conj |
color,length |
| R7999 |
T11535 |
T11536 |
dep |
that,vary |
| R8000 |
T11536 |
T11524 |
relcl |
vary,patterns |
| R8001 |
T11537 |
T11536 |
prep |
along,vary |
| R8002 |
T11538 |
T11539 |
det |
the,axis |
| R8003 |
T11539 |
T11537 |
pobj |
axis,along |
| R8004 |
T11540 |
T11539 |
amod |
dorsoventral,axis |
| R8005 |
T11541 |
T11521 |
punct |
.,have |
| R8006 |
T11543 |
T11544 |
nsubj |
Raccoons,exhibit |
| R8007 |
T11545 |
T11543 |
punct |
", ",Raccoons |
| R8008 |
T11546 |
T11543 |
conj |
squirrels,Raccoons |
| R8009 |
T11547 |
T11546 |
punct |
", ",squirrels |
| R8010 |
T11548 |
T11546 |
conj |
skunks,squirrels |
| R8011 |
T11549 |
T11548 |
punct |
", ",skunks |
| R8012 |
T11550 |
T11548 |
cc |
and,skunks |
| R8013 |
T11551 |
T11552 |
amod |
many,ungulates |
| R8014 |
T11552 |
T11548 |
conj |
ungulates,skunks |
| R8015 |
T11553 |
T11552 |
amod |
different,ungulates |
| R8016 |
T11554 |
T11555 |
amod |
lateral,stripes |
| R8017 |
T11555 |
T11544 |
dobj |
stripes,exhibit |
| R8018 |
T11556 |
T11557 |
poss |
whose,origins |
| R8019 |
T11557 |
T11559 |
dep |
origins,investigated |
| R8020 |
T11558 |
T11557 |
amod |
developmental,origins |
| R8021 |
T11559 |
T11555 |
relcl |
investigated,stripes |
| R8022 |
T11560 |
T11559 |
aux |
have,investigated |
| R8023 |
T11561 |
T11559 |
neg |
not,investigated |
| R8024 |
T11562 |
T11559 |
auxpass |
been,investigated |
| R8025 |
T11563 |
T11559 |
punct |
", ",investigated |
| R8026 |
T11564 |
T11559 |
cc |
but,investigated |
| R8027 |
T11565 |
T11566 |
aux |
may,correspond |
| R8028 |
T11566 |
T11559 |
conj |
correspond,investigated |
| R8029 |
T11567 |
T11566 |
prep |
to,correspond |
| R8030 |
T11568 |
T11569 |
det |
the,frontier |
| R8031 |
T11569 |
T11567 |
pobj |
frontier,to |
| R8032 |
T11570 |
T11569 |
amod |
lateral,frontier |
| R8033 |
T11571 |
T11569 |
amod |
somitic,frontier |
| R8034 |
T11572 |
T11569 |
punct |
", ",frontier |
| R8035 |
T11573 |
T11574 |
det |
the,compartment |
| R8036 |
T11574 |
T11569 |
conj |
compartment,frontier |
| R8037 |
T11575 |
T11574 |
amod |
paraspinal,compartment |
| R8038 |
T11576 |
T11574 |
compound |
Msx1,compartment |
| R8039 |
T11577 |
T11574 |
punct |
", ",compartment |
| R8040 |
T11578 |
T11574 |
cc |
or,compartment |
| R8041 |
T11579 |
T11580 |
det |
an,interaction |
| R8042 |
T11580 |
T11574 |
conj |
interaction,compartment |
| R8043 |
T11581 |
T11580 |
prep |
between,interaction |
| R8044 |
T11582 |
T11583 |
det |
these,domains |
| R8045 |
T11583 |
T11581 |
pobj |
domains,between |
| R8046 |
T11584 |
T11544 |
punct |
.,exhibit |
| R8047 |
T11586 |
T11587 |
det |
The,effect |
| R8048 |
T11587 |
T11588 |
nsubj |
effect,is |
| R8049 |
T11589 |
T11587 |
prep |
of,effect |
| R8050 |
T11590 |
T11589 |
pobj |
Tbx15,of |
| R8051 |
T11591 |
T11587 |
prep |
on,effect |
| R8052 |
T11592 |
T11591 |
pobj |
pigmentation,on |
| R8053 |
T11593 |
T11587 |
prep |
in,effect |
| R8054 |
T11594 |
T11595 |
compound |
laboratory,mice |
| R8055 |
T11595 |
T11593 |
pobj |
mice,in |
| R8056 |
T11596 |
T11588 |
acomp |
reminiscent,is |
| R8057 |
T11597 |
T11596 |
prep |
of,reminiscent |
| R8058 |
T11598 |
T11599 |
compound |
coat,color |
| R8059 |
T11599 |
T11601 |
compound |
color,patterns |
| R8060 |
T11600 |
T11599 |
punct |
-,color |
| R8061 |
T11601 |
T11597 |
pobj |
patterns,of |
| R8062 |
T11602 |
T11601 |
prep |
in,patterns |
| R8063 |
T11603 |
T11604 |
preconj |
both,selected |
| R8064 |
T11604 |
T11605 |
amod |
selected,populations |
| R8065 |
T11605 |
T11602 |
pobj |
populations,in |
| R8066 |
T11606 |
T11604 |
cc |
and,selected |
| R8067 |
T11607 |
T11604 |
conj |
natural,selected |
| R8068 |
T11608 |
T11605 |
prep |
of,populations |
| R8069 |
T11609 |
T11610 |
amod |
other,mammals |
| R8070 |
T11610 |
T11608 |
pobj |
mammals,of |
| R8071 |
T11611 |
T11588 |
punct |
.,is |
| R8072 |
T11613 |
T11614 |
compound |
Saddle,markings |
| R8073 |
T11614 |
T11615 |
nsubj |
markings,are |
| R8074 |
T11616 |
T11615 |
acomp |
common,are |
| R8075 |
T11617 |
T11615 |
prep |
in,are |
| R8076 |
T11618 |
T11619 |
det |
some,breeds |
| R8077 |
T11619 |
T11617 |
pobj |
breeds,in |
| R8078 |
T11620 |
T11619 |
compound |
dog,breeds |
| R8079 |
T11621 |
T11619 |
punct |
", ",breeds |
| R8080 |
T11622 |
T11623 |
amod |
such,as |
| R8081 |
T11623 |
T11619 |
prep |
as,breeds |
| R8082 |
T11624 |
T11625 |
compound |
German,shepherds |
| R8083 |
T11625 |
T11623 |
pobj |
shepherds,as |
| R8084 |
T11626 |
T11617 |
punct |
", ",in |
| R8085 |
T11627 |
T11617 |
cc |
and,in |
| R8086 |
T11628 |
T11617 |
conj |
in,in |
| R8087 |
T11629 |
T11630 |
amod |
certain,populations |
| R8088 |
T11630 |
T11628 |
pobj |
populations,in |
| R8089 |
T11631 |
T11630 |
prep |
of,populations |
| R8090 |
T11632 |
T11633 |
compound |
Peromyscus,polionotus |
| R8091 |
T11633 |
T11631 |
pobj |
polionotus,of |
| R8092 |
T11634 |
T11630 |
punct |
", ",populations |
| R8093 |
T11635 |
T11636 |
prep |
in,provides |
| R8094 |
T11636 |
T11630 |
relcl |
provides,populations |
| R8095 |
T11637 |
T11635 |
pobj |
which,in |
| R8096 |
T11638 |
T11639 |
det |
a,extension |
| R8097 |
T11639 |
T11636 |
nsubj |
extension,provides |
| R8098 |
T11640 |
T11639 |
amod |
dorsal,extension |
| R8099 |
T11641 |
T11639 |
prep |
of,extension |
| R8100 |
T11642 |
T11643 |
amod |
ventral,depigmentation |
| R8101 |
T11643 |
T11641 |
pobj |
depigmentation,of |
| R8102 |
T11644 |
T11645 |
det |
an,advantage |
| R8103 |
T11645 |
T11636 |
dobj |
advantage,provides |
| R8104 |
T11646 |
T11645 |
amod |
adaptive,advantage |
| R8105 |
T11647 |
T11636 |
dative |
to,provides |
| R8106 |
T11648 |
T11647 |
pobj |
subspecies,to |
| R8107 |
T11649 |
T11650 |
dep |
that,live |
| R8108 |
T11650 |
T11648 |
relcl |
live,subspecies |
| R8109 |
T11651 |
T11650 |
prep |
on,live |
| R8110 |
T11652 |
T11653 |
amod |
white,reefs |
| R8111 |
T11653 |
T11651 |
pobj |
reefs,on |
| R8112 |
T11654 |
T11653 |
compound |
sand,reefs |
| R8113 |
T11655 |
T11656 |
punct |
(,Blair |
| R8114 |
T11656 |
T11615 |
meta |
Blair,are |
| R8115 |
T11657 |
T11656 |
nummod |
1951,Blair |
| R8116 |
T11658 |
T11656 |
punct |
;,Blair |
| R8117 |
T11659 |
T11656 |
conj |
Kaufman,Blair |
| R8118 |
T11660 |
T11659 |
nummod |
1974,Kaufman |
| R8119 |
T11661 |
T11659 |
punct |
;,Kaufman |
| R8120 |
T11662 |
T11659 |
conj |
Belk,Kaufman |
| R8121 |
T11663 |
T11662 |
cc |
and,Belk |
| R8122 |
T11664 |
T11662 |
conj |
Smith,Belk |
| R8123 |
T11665 |
T11664 |
nummod |
1996,Smith |
| R8124 |
T11666 |
T11664 |
punct |
),Smith |
| R8125 |
T11667 |
T11615 |
punct |
.,are |
| R8126 |
T11669 |
T11670 |
preconj |
Neither,shepherds |
| R8127 |
T11670 |
T11672 |
nsubj |
shepherds,have |
| R8128 |
T11671 |
T11670 |
compound |
German,shepherds |
| R8129 |
T11673 |
T11670 |
cc |
nor,shepherds |
| R8130 |
T11674 |
T11675 |
compound |
deer,mice |
| R8131 |
T11675 |
T11670 |
conj |
mice,shepherds |
| R8132 |
T11676 |
T11677 |
amod |
craniofacial,characteristics |
| R8133 |
T11677 |
T11672 |
dobj |
characteristics,have |
| R8134 |
T11678 |
T11677 |
amod |
similar,characteristics |
| R8135 |
T11679 |
T11678 |
prep |
to,similar |
| R8136 |
T11680 |
T11681 |
det |
the,mutation |
| R8137 |
T11681 |
T11679 |
pobj |
mutation,to |
| R8138 |
T11682 |
T11681 |
compound |
deH,mutation |
| R8139 |
T11683 |
T11672 |
punct |
", ",have |
| R8140 |
T11684 |
T11672 |
cc |
but,have |
| R8141 |
T11685 |
T11686 |
det |
the,patterns |
| R8142 |
T11686 |
T11688 |
nsubj |
patterns,represent |
| R8143 |
T11687 |
T11686 |
compound |
pigmentation,patterns |
| R8144 |
T11688 |
T11672 |
conj |
represent,have |
| R8145 |
T11689 |
T11686 |
prep |
in,patterns |
| R8146 |
T11690 |
T11691 |
det |
these,animals |
| R8147 |
T11691 |
T11689 |
pobj |
animals,in |
| R8148 |
T11692 |
T11688 |
aux |
could,represent |
| R8149 |
T11693 |
T11688 |
dobj |
alterations,represent |
| R8150 |
T11694 |
T11693 |
prep |
in,alterations |
| R8151 |
T11695 |
T11696 |
det |
the,regulation |
| R8152 |
T11696 |
T11694 |
pobj |
regulation,in |
| R8153 |
T11697 |
T11696 |
cc |
or,regulation |
| R8154 |
T11698 |
T11696 |
conj |
action,regulation |
| R8155 |
T11699 |
T11696 |
prep |
of,regulation |
| R8156 |
T11700 |
T11701 |
compound |
Tbx15,activity |
| R8157 |
T11701 |
T11699 |
pobj |
activity,of |
| R8158 |
T11702 |
T11688 |
punct |
.,represent |
| R8159 |
T11704 |
T11705 |
prep |
From,are |
| R8160 |
T11706 |
T11707 |
det |
the,perspective |
| R8161 |
T11707 |
T11704 |
pobj |
perspective,From |
| R8162 |
T11708 |
T11707 |
amod |
opposite,perspective |
| R8163 |
T11709 |
T11705 |
punct |
", ",are |
| R8164 |
T11710 |
T11711 |
det |
the,effects |
| R8165 |
T11711 |
T11705 |
nsubj |
effects,are |
| R8166 |
T11712 |
T11711 |
prep |
of,effects |
| R8167 |
T11713 |
T11712 |
pobj |
Tbx15,of |
| R8168 |
T11714 |
T11711 |
prep |
on,effects |
| R8169 |
T11715 |
T11716 |
compound |
coat,color |
| R8170 |
T11716 |
T11714 |
pobj |
color,on |
| R8171 |
T11717 |
T11705 |
advmod |
only,are |
| R8172 |
T11718 |
T11705 |
acomp |
apparent,are |
| R8173 |
T11719 |
T11705 |
prep |
in,are |
| R8174 |
T11720 |
T11721 |
amod |
certain,backgrounds |
| R8175 |
T11721 |
T11719 |
pobj |
backgrounds,in |
| R8176 |
T11722 |
T11721 |
amod |
genetic,backgrounds |
| R8177 |
T11723 |
T11705 |
cc |
and,are |
| R8178 |
T11724 |
T11725 |
aux |
may,be |
| R8179 |
T11725 |
T11705 |
conj |
be,are |
| R8180 |
T11726 |
T11725 |
neg |
not,be |
| R8181 |
T11727 |
T11725 |
acomp |
evident,be |
| R8182 |
T11728 |
T11729 |
advmod |
at,all |
| R8183 |
T11729 |
T11725 |
advmod |
all,be |
| R8184 |
T11730 |
T11725 |
prep |
in,be |
| R8185 |
T11731 |
T11730 |
pobj |
mammals,in |
| R8186 |
T11732 |
T11733 |
dep |
that,lack |
| R8187 |
T11733 |
T11731 |
relcl |
lack,mammals |
| R8188 |
T11734 |
T11735 |
amod |
dorsoventral,patterns |
| R8189 |
T11735 |
T11733 |
dobj |
patterns,lack |
| R8190 |
T11736 |
T11735 |
compound |
pigmentation,patterns |
| R8191 |
T11737 |
T11705 |
punct |
.,are |
| R8192 |
T11739 |
T11740 |
csubj |
Studying,provide |
| R8193 |
T11741 |
T11742 |
det |
the,sequence |
| R8194 |
T11742 |
T11739 |
dobj |
sequence,Studying |
| R8195 |
T11743 |
T11742 |
cc |
and,sequence |
| R8196 |
T11744 |
T11742 |
conj |
expression,sequence |
| R8197 |
T11745 |
T11742 |
prep |
of,sequence |
| R8198 |
T11746 |
T11745 |
pobj |
Tbx15,of |
| R8199 |
T11747 |
T11739 |
prep |
in,Studying |
| R8200 |
T11748 |
T11749 |
amod |
other,vertebrates |
| R8201 |
T11749 |
T11747 |
pobj |
vertebrates,in |
| R8202 |
T11750 |
T11740 |
aux |
may,provide |
| R8203 |
T11751 |
T11752 |
amod |
additional,insight |
| R8204 |
T11752 |
T11740 |
dobj |
insight,provide |
| R8205 |
T11753 |
T11752 |
prep |
into,insight |
| R8206 |
T11754 |
T11753 |
pobj |
patterns,into |
| R8207 |
T11755 |
T11756 |
dep |
that,affect |
| R8208 |
T11756 |
T11754 |
relcl |
affect,patterns |
| R8209 |
T11757 |
T11758 |
det |
the,skeleton |
| R8210 |
T11758 |
T11756 |
dobj |
skeleton,affect |
| R8211 |
T11759 |
T11760 |
advmod |
as,as |
| R8212 |
T11760 |
T11758 |
cc |
as,skeleton |
| R8213 |
T11761 |
T11760 |
advmod |
well,as |
| R8214 |
T11762 |
T11763 |
det |
the,system |
| R8215 |
T11763 |
T11758 |
conj |
system,skeleton |
| R8216 |
T11764 |
T11763 |
amod |
pigmentary,system |
| R8217 |
T11765 |
T11740 |
punct |
.,provide |
| R8218 |
T11801 |
T11802 |
det |
All,mice |
| R8219 |
T11802 |
T11803 |
nsubjpass |
mice,obtained |
| R8220 |
T11804 |
T11803 |
auxpass |
were,obtained |
| R8221 |
T11805 |
T11803 |
advmod |
originally,obtained |
| R8222 |
T11806 |
T11803 |
prep |
from,obtained |
| R8223 |
T11807 |
T11808 |
det |
The,Laboratory |
| R8224 |
T11808 |
T11806 |
pobj |
Laboratory,from |
| R8225 |
T11809 |
T11808 |
compound |
Jackson,Laboratory |
| R8226 |
T11810 |
T11811 |
punct |
(,Harbor |
| R8227 |
T11811 |
T11808 |
parataxis |
Harbor,Laboratory |
| R8228 |
T11812 |
T11811 |
compound |
Bar,Harbor |
| R8229 |
T11813 |
T11811 |
punct |
", ",Harbor |
| R8230 |
T11814 |
T11811 |
npadvmod |
Maine,Harbor |
| R8231 |
T11815 |
T11811 |
punct |
", ",Harbor |
| R8232 |
T11816 |
T11817 |
compound |
United,States |
| R8233 |
T11817 |
T11811 |
npadvmod |
States,Harbor |
| R8234 |
T11818 |
T11811 |
punct |
),Harbor |
| R8235 |
T11819 |
T11803 |
punct |
", ",obtained |
| R8236 |
T11820 |
T11803 |
prep |
except,obtained |
| R8237 |
T11821 |
T11822 |
det |
the,strain |
| R8238 |
T11822 |
T11820 |
pobj |
strain,except |
| R8239 |
T11823 |
T11822 |
compound |
BA,strain |
| R8240 |
T11824 |
T11825 |
punct |
(,Center |
| R8241 |
T11825 |
T11822 |
parataxis |
Center,strain |
| R8242 |
T11826 |
T11825 |
compound |
Stanford,Center |
| R8243 |
T11827 |
T11828 |
compound |
Veterinary,Services |
| R8244 |
T11828 |
T11825 |
compound |
Services,Center |
| R8245 |
T11829 |
T11825 |
punct |
", ",Center |
| R8246 |
T11830 |
T11825 |
npadvmod |
Stanford,Center |
| R8247 |
T11831 |
T11825 |
punct |
", ",Center |
| R8248 |
T11832 |
T11825 |
npadvmod |
California,Center |
| R8249 |
T11833 |
T11825 |
punct |
", ",Center |
| R8250 |
T11834 |
T11835 |
compound |
United,States |
| R8251 |
T11835 |
T11825 |
npadvmod |
States,Center |
| R8252 |
T11836 |
T11825 |
punct |
),Center |
| R8253 |
T11837 |
T11822 |
punct |
", ",strain |
| R8254 |
T11838 |
T11839 |
nmod |
Hoxb6,Cre |
| R8255 |
T11839 |
T11841 |
nmod |
Cre,mice |
| R8256 |
T11840 |
T11839 |
punct |
-,Cre |
| R8257 |
T11841 |
T11822 |
conj |
mice,strain |
| R8258 |
T11842 |
T11841 |
amod |
transgenic,mice |
| R8259 |
T11843 |
T11841 |
punct |
(,mice |
| R8260 |
T11844 |
T11845 |
advmod |
kindly,provided |
| R8261 |
T11845 |
T11841 |
acl |
provided,mice |
| R8262 |
T11846 |
T11845 |
agent |
by,provided |
| R8263 |
T11847 |
T11848 |
compound |
M.,Kuehn |
| R8264 |
T11848 |
T11846 |
pobj |
Kuehn,by |
| R8265 |
T11849 |
T11848 |
prep |
of,Kuehn |
| R8266 |
T11850 |
T11851 |
det |
the,Institutes |
| R8267 |
T11851 |
T11849 |
pobj |
Institutes,of |
| R8268 |
T11852 |
T11851 |
compound |
National,Institutes |
| R8269 |
T11853 |
T11851 |
prep |
of,Institutes |
| R8270 |
T11854 |
T11853 |
pobj |
Health,of |
| R8271 |
T11855 |
T11851 |
punct |
", ",Institutes |
| R8272 |
T11856 |
T11851 |
npadvmod |
Bethesda,Institutes |
| R8273 |
T11857 |
T11851 |
punct |
", ",Institutes |
| R8274 |
T11858 |
T11851 |
npadvmod |
Maryland,Institutes |
| R8275 |
T11859 |
T11851 |
punct |
", ",Institutes |
| R8276 |
T11860 |
T11861 |
compound |
United,States |
| R8277 |
T11861 |
T11851 |
npadvmod |
States,Institutes |
| R8278 |
T11862 |
T11841 |
punct |
),mice |
| R8279 |
T11863 |
T11841 |
punct |
", ",mice |
| R8280 |
T11864 |
T11841 |
conj |
mice,mice |
| R8281 |
T11865 |
T11864 |
acl |
carrying,mice |
| R8282 |
T11866 |
T11867 |
det |
the,allele |
| R8283 |
T11867 |
T11865 |
dobj |
allele,carrying |
| R8284 |
T11868 |
T11869 |
compound |
R26R,reporter |
| R8285 |
T11869 |
T11867 |
compound |
reporter,allele |
| R8286 |
T11870 |
T11869 |
compound |
lacZ,reporter |
| R8287 |
T11871 |
T11864 |
punct |
(,mice |
| R8288 |
T11872 |
T11873 |
advmod |
kindly,provided |
| R8289 |
T11873 |
T11864 |
acl |
provided,mice |
| R8290 |
T11874 |
T11873 |
agent |
by,provided |
| R8291 |
T11875 |
T11876 |
compound |
P.,Soriano |
| R8292 |
T11876 |
T11874 |
pobj |
Soriano,by |
| R8293 |
T11877 |
T11876 |
punct |
", ",Soriano |
| R8294 |
T11878 |
T11879 |
compound |
Fred,Center |
| R8295 |
T11879 |
T11876 |
appos |
Center,Soriano |
| R8296 |
T11880 |
T11879 |
compound |
Hutchinson,Center |
| R8297 |
T11881 |
T11882 |
compound |
Cancer,Research |
| R8298 |
T11882 |
T11879 |
compound |
Research,Center |
| R8299 |
T11883 |
T11879 |
punct |
", ",Center |
| R8300 |
T11884 |
T11879 |
npadvmod |
Seattle,Center |
| R8301 |
T11885 |
T11879 |
punct |
", ",Center |
| R8302 |
T11886 |
T11879 |
npadvmod |
Washington,Center |
| R8303 |
T11887 |
T11879 |
punct |
", ",Center |
| R8304 |
T11888 |
T11889 |
compound |
United,States |
| R8305 |
T11889 |
T11879 |
npadvmod |
States,Center |
| R8306 |
T11890 |
T11864 |
punct |
),mice |
| R8307 |
T11891 |
T11864 |
punct |
", ",mice |
| R8308 |
T11892 |
T11864 |
cc |
and,mice |
| R8309 |
T11893 |
T11894 |
nmod |
C57BL,6J |
| R8310 |
T11894 |
T11896 |
nmod |
6J,mice |
| R8311 |
T11895 |
T11894 |
punct |
/,6J |
| R8312 |
T11896 |
T11864 |
conj |
mice,mice |
| R8313 |
T11897 |
T11894 |
punct |
(,6J |
| R8314 |
T11898 |
T11894 |
appos |
B6,6J |
| R8315 |
T11899 |
T11894 |
punct |
),6J |
| R8316 |
T11900 |
T11901 |
compound |
ae,ae |
| R8317 |
T11901 |
T11896 |
compound |
ae,mice |
| R8318 |
T11902 |
T11901 |
punct |
/,ae |
| R8319 |
T11903 |
T11896 |
punct |
(,mice |
| R8320 |
T11904 |
T11905 |
advmod |
kindly,provided |
| R8321 |
T11905 |
T11896 |
acl |
provided,mice |
| R8322 |
T11906 |
T11905 |
agent |
by,provided |
| R8323 |
T11907 |
T11908 |
compound |
L.,Siracusa |
| R8324 |
T11908 |
T11906 |
pobj |
Siracusa,by |
| R8325 |
T11909 |
T11908 |
punct |
", ",Siracusa |
| R8326 |
T11910 |
T11911 |
compound |
Jefferson,College |
| R8327 |
T11911 |
T11908 |
appos |
College,Siracusa |
| R8328 |
T11912 |
T11911 |
compound |
Medical,College |
| R8329 |
T11913 |
T11911 |
punct |
", ",College |
| R8330 |
T11914 |
T11911 |
npadvmod |
Philadelphia,College |
| R8331 |
T11915 |
T11911 |
punct |
", ",College |
| R8332 |
T11916 |
T11911 |
npadvmod |
Pennsylvania,College |
| R8333 |
T11917 |
T11911 |
punct |
", ",College |
| R8334 |
T11918 |
T11919 |
compound |
United,States |
| R8335 |
T11919 |
T11911 |
npadvmod |
States,College |
| R8336 |
T11920 |
T11896 |
punct |
),mice |
| R8337 |
T11921 |
T11803 |
punct |
.,obtained |
| R8338 |
T11923 |
T11924 |
det |
The,mutation |
| R8339 |
T11924 |
T11926 |
nsubj |
mutation,arose |
| R8340 |
T11925 |
T11924 |
compound |
deH,mutation |
| R8341 |
T11927 |
T11926 |
prep |
in,arose |
| R8342 |
T11928 |
T11929 |
det |
the,1960s |
| R8343 |
T11929 |
T11927 |
pobj |
1960s,in |
| R8344 |
T11930 |
T11926 |
prep |
in,arose |
| R8345 |
T11931 |
T11930 |
pobj |
Harwell,in |
| R8346 |
T11932 |
T11926 |
punct |
", ",arose |
| R8347 |
T11933 |
T11934 |
advmod |
probably,on |
| R8348 |
T11934 |
T11926 |
prep |
on,arose |
| R8349 |
T11935 |
T11936 |
det |
the,background |
| R8350 |
T11936 |
T11934 |
pobj |
background,on |
| R8351 |
T11937 |
T11938 |
compound |
BN,strain |
| R8352 |
T11938 |
T11936 |
compound |
strain,background |
| R8353 |
T11939 |
T11940 |
punct |
(,C. |
| R8354 |
T11940 |
T11926 |
meta |
C.,arose |
| R8355 |
T11941 |
T11940 |
nmod |
Beechey,C. |
| R8356 |
T11942 |
T11940 |
punct |
", ",C. |
| R8357 |
T11943 |
T11940 |
amod |
personal,C. |
| R8358 |
T11944 |
T11940 |
nmod |
communication,C. |
| R8359 |
T11945 |
T11940 |
punct |
),C. |
| R8360 |
T11946 |
T11926 |
punct |
.,arose |
| R8361 |
T11948 |
T11949 |
nsubj |
We,obtained |
| R8362 |
T11950 |
T11949 |
dobj |
deH,obtained |
| R8363 |
T11951 |
T11950 |
prep |
on,deH |
| R8364 |
T11952 |
T11953 |
det |
a,background |
| R8365 |
T11953 |
T11951 |
pobj |
background,on |
| R8366 |
T11954 |
T11955 |
compound |
B6,EiC3H |
| R8367 |
T11955 |
T11953 |
compound |
EiC3H,background |
| R8368 |
T11956 |
T11955 |
punct |
/,EiC3H |
| R8369 |
T11957 |
T11949 |
punct |
", ",obtained |
| R8370 |
T11958 |
T11949 |
conj |
introduced,obtained |
| R8371 |
T11959 |
T11960 |
det |
the,allele |
| R8372 |
T11960 |
T11958 |
dobj |
allele,introduced |
| R8373 |
T11961 |
T11960 |
compound |
at,allele |
| R8374 |
T11962 |
T11960 |
prep |
from,allele |
| R8375 |
T11963 |
T11964 |
det |
the,strain |
| R8376 |
T11964 |
T11962 |
pobj |
strain,from |
| R8377 |
T11965 |
T11964 |
compound |
BTBR,strain |
| R8378 |
T11966 |
T11958 |
punct |
", ",introduced |
| R8379 |
T11967 |
T11958 |
cc |
and,introduced |
| R8380 |
T11968 |
T11969 |
aux |
have,maintained |
| R8381 |
T11969 |
T11958 |
conj |
maintained,introduced |
| R8382 |
T11970 |
T11971 |
det |
the,line |
| R8383 |
T11971 |
T11969 |
dobj |
line,maintained |
| R8384 |
T11972 |
T11969 |
prep |
as,maintained |
| R8385 |
T11973 |
T11974 |
det |
a,stock |
| R8386 |
T11974 |
T11972 |
pobj |
stock,as |
| R8387 |
T11975 |
T11974 |
amod |
mixed,stock |
| R8388 |
T11976 |
T11974 |
nmod |
deH,stock |
| R8389 |
T11977 |
T11976 |
punct |
/,deH |
| R8390 |
T11978 |
T11976 |
punct |
+,deH |
| R8391 |
T11979 |
T11976 |
punct |
×,deH |
| R8392 |
T11980 |
T11976 |
appos |
deH,deH |
| R8393 |
T11981 |
T11980 |
punct |
/,deH |
| R8394 |
T11982 |
T11980 |
punct |
+,deH |
| R8395 |
T11983 |
T11976 |
amod |
intercross,deH |
| R8396 |
T11984 |
T11969 |
prep |
with,maintained |
| R8397 |
T11985 |
T11986 |
amod |
periodic,outcrossing |
| R8398 |
T11986 |
T11984 |
pobj |
outcrossing,with |
| R8399 |
T11987 |
T11986 |
prep |
to,outcrossing |
| R8400 |
T11988 |
T11987 |
pobj |
BTBR,to |
| R8401 |
T11989 |
T11988 |
cc |
or,BTBR |
| R8402 |
T11990 |
T11988 |
conj |
B6,BTBR |
| R8403 |
T11991 |
T11949 |
punct |
.,obtained |
| R8404 |
T11993 |
T11994 |
prep |
For,considered |
| R8405 |
T11995 |
T11996 |
amod |
timed,matings |
| R8406 |
T11996 |
T11993 |
pobj |
matings,For |
| R8407 |
T11997 |
T11994 |
punct |
", ",considered |
| R8408 |
T11998 |
T11999 |
det |
the,morning |
| R8409 |
T11999 |
T11994 |
nsubjpass |
morning,considered |
| R8410 |
T12000 |
T11999 |
prep |
of,morning |
| R8411 |
T12001 |
T12002 |
det |
the,plug |
| R8412 |
T12002 |
T12000 |
pobj |
plug,of |
| R8413 |
T12003 |
T11994 |
auxpass |
was,considered |
| R8414 |
T12004 |
T11994 |
oprd |
E0.5,considered |
| R8415 |
T12005 |
T11994 |
punct |
.,considered |
| R8416 |
T12007 |
T12008 |
advmod |
Postnatally,considered |
| R8417 |
T12009 |
T12008 |
punct |
", ",considered |
| R8418 |
T12010 |
T12011 |
det |
the,day |
| R8419 |
T12011 |
T12008 |
nsubjpass |
day,considered |
| R8420 |
T12012 |
T12011 |
prep |
of,day |
| R8421 |
T12013 |
T12012 |
pobj |
birth,of |
| R8422 |
T12014 |
T12008 |
auxpass |
was,considered |
| R8423 |
T12015 |
T12016 |
aux |
to,be |
| R8424 |
T12016 |
T12008 |
xcomp |
be,considered |
| R8425 |
T12017 |
T12016 |
attr |
P0.5,be |
| R8426 |
T12018 |
T12008 |
punct |
.,considered |
| R8429 |
T12097 |
T12098 |
amod |
Phenotypic,analysis |
| R8430 |
T12100 |
T12101 |
prep |
For,dissected |
| R8431 |
T12102 |
T12100 |
pobj |
measurements,For |
| R8432 |
T12103 |
T12102 |
prep |
of,measurements |
| R8433 |
T12104 |
T12105 |
compound |
hair,length |
| R8434 |
T12105 |
T12103 |
pobj |
length,of |
| R8435 |
T12106 |
T12105 |
cc |
and,length |
| R8436 |
T12107 |
T12105 |
conj |
color,length |
| R8437 |
T12108 |
T12101 |
punct |
", ",dissected |
| R8438 |
T12109 |
T12110 |
det |
the,region |
| R8439 |
T12110 |
T12101 |
nsubjpass |
region,dissected |
| R8440 |
T12111 |
T12110 |
amod |
entire,region |
| R8441 |
T12112 |
T12110 |
compound |
interlimb,region |
| R8442 |
T12113 |
T12110 |
prep |
of,region |
| R8443 |
T12114 |
T12113 |
pobj |
skin,of |
| R8444 |
T12115 |
T12101 |
auxpass |
was,dissected |
| R8445 |
T12116 |
T12101 |
advmod |
first,dissected |
| R8446 |
T12117 |
T12101 |
prep |
with,dissected |
| R8447 |
T12118 |
T12119 |
det |
a,incision |
| R8448 |
T12119 |
T12117 |
pobj |
incision,with |
| R8449 |
T12120 |
T12119 |
amod |
single,incision |
| R8450 |
T12121 |
T12119 |
prep |
at,incision |
| R8451 |
T12122 |
T12123 |
det |
the,midline |
| R8452 |
T12123 |
T12121 |
pobj |
midline,at |
| R8453 |
T12124 |
T12123 |
amod |
dorsal,midline |
| R8454 |
T12125 |
T12101 |
cc |
and,dissected |
| R8455 |
T12126 |
T12101 |
conj |
preserved,dissected |
| R8456 |
T12127 |
T12126 |
prep |
with,preserved |
| R8457 |
T12128 |
T12129 |
amod |
powdered,bicarbonate |
| R8458 |
T12129 |
T12127 |
pobj |
bicarbonate,with |
| R8459 |
T12130 |
T12129 |
compound |
sodium,bicarbonate |
| R8460 |
T12131 |
T12101 |
punct |
.,dissected |
| R8461 |
T12133 |
T12134 |
nsubjpass |
Slices,prepared |
| R8462 |
T12135 |
T12136 |
compound |
2,2.5 |
| R8463 |
T12136 |
T12138 |
nummod |
2.5,mm |
| R8464 |
T12137 |
T12136 |
punct |
–,2.5 |
| R8465 |
T12138 |
T12139 |
nsubj |
mm,in |
| R8466 |
T12139 |
T12133 |
relcl |
in,Slices |
| R8467 |
T12140 |
T12139 |
pobj |
width,in |
| R8468 |
T12141 |
T12134 |
auxpass |
were,prepared |
| R8469 |
T12142 |
T12134 |
advmod |
then,prepared |
| R8470 |
T12143 |
T12134 |
advmod |
parallel,prepared |
| R8471 |
T12144 |
T12143 |
prep |
to,parallel |
| R8472 |
T12145 |
T12146 |
det |
the,axis |
| R8473 |
T12146 |
T12144 |
pobj |
axis,to |
| R8474 |
T12147 |
T12146 |
amod |
dorsoventral,axis |
| R8475 |
T12148 |
T12134 |
punct |
", ",prepared |
| R8476 |
T12149 |
T12150 |
compound |
hair,boundaries |
| R8477 |
T12150 |
T12152 |
nsubj |
boundaries,determined |
| R8478 |
T12151 |
T12150 |
compound |
length,boundaries |
| R8479 |
T12152 |
T12134 |
conj |
determined,prepared |
| R8480 |
T12153 |
T12152 |
prep |
from,determined |
| R8481 |
T12154 |
T12155 |
amod |
electronic,images |
| R8482 |
T12155 |
T12153 |
pobj |
images,from |
| R8483 |
T12156 |
T12152 |
prep |
with,determined |
| R8484 |
T12157 |
T12158 |
compound |
Adobe,Photoshop |
| R8485 |
T12158 |
T12156 |
pobj |
Photoshop,with |
| R8486 |
T12159 |
T12160 |
punct |
(,Jose |
| R8487 |
T12160 |
T12158 |
parataxis |
Jose,Photoshop |
| R8488 |
T12161 |
T12160 |
compound |
San,Jose |
| R8489 |
T12162 |
T12160 |
punct |
", ",Jose |
| R8490 |
T12163 |
T12160 |
npadvmod |
California,Jose |
| R8491 |
T12164 |
T12160 |
punct |
", ",Jose |
| R8492 |
T12165 |
T12166 |
compound |
United,States |
| R8493 |
T12166 |
T12160 |
npadvmod |
States,Jose |
| R8494 |
T12167 |
T12160 |
punct |
),Jose |
| R8495 |
T12168 |
T12152 |
punct |
", ",determined |
| R8496 |
T12169 |
T12152 |
cc |
and,determined |
| R8497 |
T12170 |
T12171 |
nsubj |
measurements,obtained |
| R8498 |
T12171 |
T12152 |
conj |
obtained,determined |
| R8499 |
T12172 |
T12171 |
advcl |
using,obtained |
| R8500 |
T12173 |
T12172 |
dobj |
ImageJ,using |
| R8501 |
T12174 |
T12175 |
punct |
(,Institutes |
| R8502 |
T12175 |
T12173 |
parataxis |
Institutes,ImageJ |
| R8503 |
T12176 |
T12175 |
compound |
National,Institutes |
| R8504 |
T12177 |
T12175 |
prep |
of,Institutes |
| R8505 |
T12178 |
T12177 |
pobj |
Health,of |
| R8506 |
T12179 |
T12175 |
punct |
),Institutes |
| R8507 |
T12180 |
T12171 |
punct |
.,obtained |
| R8508 |
T12182 |
T12183 |
det |
This,approach |
| R8509 |
T12183 |
T12184 |
nsubj |
approach,samples |
| R8510 |
T12185 |
T12184 |
dobj |
awls,samples |
| R8511 |
T12186 |
T12185 |
cc |
and,awls |
| R8512 |
T12187 |
T12185 |
conj |
auchenes,awls |
| R8513 |
T12188 |
T12184 |
punct |
", ",samples |
| R8514 |
T12189 |
T12190 |
mark |
because,are |
| R8515 |
T12190 |
T12184 |
advcl |
are,samples |
| R8516 |
T12191 |
T12190 |
nsubj |
they,are |
| R8517 |
T12192 |
T12193 |
advmod |
much,thicker |
| R8518 |
T12193 |
T12190 |
acomp |
thicker,are |
| R8519 |
T12194 |
T12193 |
cc |
and,thicker |
| R8520 |
T12195 |
T12196 |
advmod |
therefore,predominant |
| R8521 |
T12196 |
T12193 |
conj |
predominant,thicker |
| R8522 |
T12197 |
T12196 |
advmod |
visually,predominant |
| R8523 |
T12198 |
T12196 |
advmod |
more,predominant |
| R8524 |
T12199 |
T12193 |
prep |
than,thicker |
| R8525 |
T12200 |
T12201 |
compound |
zigzag,underhairs |
| R8526 |
T12201 |
T12199 |
pobj |
underhairs,than |
| R8527 |
T12202 |
T12184 |
punct |
.,samples |
| R8528 |
T12204 |
T12205 |
aux |
To,assess |
| R8529 |
T12205 |
T12206 |
advcl |
assess,plucked |
| R8530 |
T12207 |
T12208 |
amod |
dorsoventral,variation |
| R8531 |
T12208 |
T12205 |
dobj |
variation,assess |
| R8532 |
T12209 |
T12208 |
prep |
in,variation |
| R8533 |
T12210 |
T12211 |
compound |
hair,type |
| R8534 |
T12211 |
T12213 |
compound |
type,distribution |
| R8535 |
T12212 |
T12211 |
punct |
-,type |
| R8536 |
T12213 |
T12209 |
pobj |
distribution,in |
| R8537 |
T12214 |
T12206 |
punct |
", ",plucked |
| R8538 |
T12215 |
T12216 |
amod |
several,hairs |
| R8539 |
T12216 |
T12206 |
nsubjpass |
hairs,plucked |
| R8540 |
T12217 |
T12216 |
nummod |
hundred,hairs |
| R8541 |
T12218 |
T12206 |
auxpass |
were,plucked |
| R8542 |
T12219 |
T12206 |
prep |
from,plucked |
| R8543 |
T12220 |
T12221 |
det |
the,middorsum |
| R8544 |
T12221 |
T12219 |
pobj |
middorsum,from |
| R8545 |
T12222 |
T12221 |
cc |
or,middorsum |
| R8546 |
T12223 |
T12221 |
conj |
midventrum,middorsum |
| R8547 |
T12224 |
T12221 |
prep |
of,middorsum |
| R8548 |
T12225 |
T12226 |
nummod |
8,wk |
| R8549 |
T12226 |
T12228 |
npadvmod |
wk,old |
| R8550 |
T12227 |
T12226 |
punct |
-,wk |
| R8551 |
T12228 |
T12230 |
amod |
old,animals |
| R8552 |
T12229 |
T12228 |
punct |
-,old |
| R8553 |
T12230 |
T12224 |
pobj |
animals,of |
| R8554 |
T12231 |
T12230 |
amod |
male,animals |
| R8555 |
T12232 |
T12233 |
compound |
BA,strain |
| R8556 |
T12233 |
T12230 |
compound |
strain,animals |
| R8557 |
T12234 |
T12206 |
punct |
", ",plucked |
| R8558 |
T12235 |
T12236 |
advmod |
then,sorted |
| R8559 |
T12236 |
T12206 |
dep |
sorted,plucked |
| R8560 |
T12237 |
T12236 |
cc |
and,sorted |
| R8561 |
T12238 |
T12236 |
conj |
categorized,sorted |
| R8562 |
T12239 |
T12236 |
advcl |
using,sorted |
| R8563 |
T12240 |
T12241 |
det |
a,microscope |
| R8564 |
T12241 |
T12239 |
dobj |
microscope,using |
| R8565 |
T12242 |
T12241 |
compound |
dissection,microscope |
| R8566 |
T12243 |
T12206 |
punct |
.,plucked |
| R8567 |
T12245 |
T12246 |
det |
No,attempt |
| R8568 |
T12246 |
T12247 |
nsubjpass |
attempt,made |
| R8569 |
T12248 |
T12247 |
auxpass |
was,made |
| R8570 |
T12249 |
T12250 |
aux |
to,distinguish |
| R8571 |
T12250 |
T12247 |
xcomp |
distinguish,made |
| R8572 |
T12251 |
T12250 |
prep |
between,distinguish |
| R8573 |
T12252 |
T12251 |
pobj |
awls,between |
| R8574 |
T12253 |
T12252 |
cc |
and,awls |
| R8575 |
T12254 |
T12252 |
conj |
auchenes,awls |
| R8576 |
T12255 |
T12247 |
punct |
.,made |
| R8577 |
T12257 |
T12258 |
prep |
For,stained |
| R8578 |
T12259 |
T12260 |
compound |
skin,histology |
| R8579 |
T12260 |
T12257 |
pobj |
histology,For |
| R8580 |
T12261 |
T12258 |
punct |
", ",stained |
| R8581 |
T12262 |
T12263 |
nummod |
12,μm |
| R8582 |
T12263 |
T12264 |
compound |
μm,sections |
| R8583 |
T12264 |
T12258 |
nsubjpass |
sections,stained |
| R8584 |
T12265 |
T12264 |
prep |
from,sections |
| R8585 |
T12266 |
T12267 |
npadvmod |
paraffin,embedded |
| R8586 |
T12267 |
T12269 |
amod |
embedded,tissue |
| R8587 |
T12268 |
T12267 |
punct |
-,embedded |
| R8588 |
T12269 |
T12265 |
pobj |
tissue,from |
| R8589 |
T12270 |
T12258 |
auxpass |
were,stained |
| R8590 |
T12271 |
T12258 |
prep |
with,stained |
| R8591 |
T12272 |
T12271 |
pobj |
hematoxylin,with |
| R8592 |
T12273 |
T12272 |
cc |
and,hematoxylin |
| R8593 |
T12274 |
T12272 |
conj |
eosin,hematoxylin |
| R8594 |
T12275 |
T12258 |
punct |
.,stained |
| R8595 |
T12277 |
T12278 |
prep |
For,split |
| R8596 |
T12279 |
T12280 |
compound |
DOPA,staining |
| R8597 |
T12280 |
T12277 |
pobj |
staining,For |
| R8598 |
T12281 |
T12278 |
punct |
", ",split |
| R8599 |
T12282 |
T12283 |
det |
the,dermis |
| R8600 |
T12283 |
T12278 |
nsubjpass |
dermis,split |
| R8601 |
T12284 |
T12283 |
cc |
and,dermis |
| R8602 |
T12285 |
T12283 |
conj |
epidermis,dermis |
| R8603 |
T12286 |
T12278 |
auxpass |
were,split |
| R8604 |
T12287 |
T12278 |
prep |
after,split |
| R8605 |
T12288 |
T12289 |
nummod |
3,h |
| R8606 |
T12289 |
T12287 |
pobj |
h,after |
| R8607 |
T12290 |
T12289 |
prep |
of,h |
| R8608 |
T12291 |
T12290 |
pobj |
incubation,of |
| R8609 |
T12292 |
T12291 |
prep |
in,incubation |
| R8610 |
T12293 |
T12294 |
nummod |
2,M |
| R8611 |
T12294 |
T12295 |
compound |
M,bromide |
| R8612 |
T12295 |
T12292 |
pobj |
bromide,in |
| R8613 |
T12296 |
T12295 |
compound |
sodium,bromide |
| R8614 |
T12297 |
T12291 |
prep |
at,incubation |
| R8615 |
T12298 |
T12299 |
nummod |
37,°C |
| R8616 |
T12299 |
T12297 |
pobj |
°C,at |
| R8617 |
T12300 |
T12301 |
punct |
(,causes |
| R8618 |
T12301 |
T12291 |
parataxis |
causes,incubation |
| R8619 |
T12302 |
T12303 |
det |
this,preparation |
| R8620 |
T12303 |
T12301 |
nsubj |
preparation,causes |
| R8621 |
T12304 |
T12305 |
amod |
most,follicles |
| R8622 |
T12305 |
T12307 |
nsubj |
follicles,remain |
| R8623 |
T12306 |
T12305 |
compound |
hair,follicles |
| R8624 |
T12307 |
T12301 |
ccomp |
remain,causes |
| R8625 |
T12308 |
T12307 |
aux |
to,remain |
| R8626 |
T12309 |
T12307 |
prep |
with,remain |
| R8627 |
T12310 |
T12311 |
det |
the,dermis |
| R8628 |
T12311 |
T12309 |
pobj |
dermis,with |
| R8629 |
T12312 |
T12301 |
punct |
),causes |
| R8630 |
T12313 |
T12278 |
punct |
", ",split |
| R8631 |
T12314 |
T12315 |
advmod |
individually,fixed |
| R8632 |
T12315 |
T12278 |
dep |
fixed,split |
| R8633 |
T12316 |
T12315 |
prep |
for,fixed |
| R8634 |
T12317 |
T12318 |
nummod |
1,h |
| R8635 |
T12318 |
T12316 |
pobj |
h,for |
| R8636 |
T12319 |
T12278 |
punct |
", ",split |
| R8637 |
T12320 |
T12321 |
advmod |
then,rinsed |
| R8638 |
T12321 |
T12278 |
dep |
rinsed,split |
| R8639 |
T12322 |
T12321 |
cc |
and,rinsed |
| R8640 |
T12323 |
T12321 |
conj |
stained,rinsed |
| R8641 |
T12324 |
T12323 |
prep |
with,stained |
| R8642 |
T12325 |
T12326 |
nummod |
0.1,% |
| R8643 |
T12326 |
T12327 |
nmod |
%,DOPA |
| R8644 |
T12327 |
T12330 |
nmod |
DOPA,buffer |
| R8645 |
T12328 |
T12327 |
nmod |
L,DOPA |
| R8646 |
T12329 |
T12327 |
punct |
-,DOPA |
| R8647 |
T12330 |
T12324 |
pobj |
buffer,with |
| R8648 |
T12331 |
T12332 |
punct |
(,Sigma |
| R8649 |
T12332 |
T12327 |
parataxis |
Sigma,DOPA |
| R8650 |
T12333 |
T12332 |
punct |
", ",Sigma |
| R8651 |
T12334 |
T12335 |
compound |
St.,Louis |
| R8652 |
T12335 |
T12332 |
npadvmod |
Louis,Sigma |
| R8653 |
T12336 |
T12332 |
punct |
", ",Sigma |
| R8654 |
T12337 |
T12332 |
npadvmod |
Missouri,Sigma |
| R8655 |
T12338 |
T12332 |
punct |
", ",Sigma |
| R8656 |
T12339 |
T12340 |
compound |
United,States |
| R8657 |
T12340 |
T12332 |
npadvmod |
States,Sigma |
| R8658 |
T12341 |
T12332 |
punct |
),Sigma |
| R8659 |
T12342 |
T12327 |
punct |
", ",DOPA |
| R8660 |
T12343 |
T12344 |
nummod |
0.1,M |
| R8661 |
T12344 |
T12345 |
compound |
M,phosphate |
| R8662 |
T12345 |
T12327 |
appos |
phosphate,DOPA |
| R8663 |
T12346 |
T12345 |
compound |
sodium,phosphate |
| R8664 |
T12347 |
T12330 |
punct |
(,buffer |
| R8665 |
T12348 |
T12330 |
npadvmod |
pH,buffer |
| R8666 |
T12349 |
T12348 |
nummod |
6.8,pH |
| R8667 |
T12350 |
T12330 |
punct |
),buffer |
| R8668 |
T12351 |
T12330 |
prep |
for,buffer |
| R8669 |
T12352 |
T12353 |
nummod |
5,h |
| R8670 |
T12353 |
T12351 |
pobj |
h,for |
| R8671 |
T12354 |
T12330 |
prep |
at,buffer |
| R8672 |
T12355 |
T12356 |
nummod |
37,°C |
| R8673 |
T12356 |
T12354 |
pobj |
°C,at |
| R8674 |
T12357 |
T12330 |
prep |
in,buffer |
| R8675 |
T12358 |
T12359 |
det |
the,dark |
| R8676 |
T12359 |
T12357 |
pobj |
dark,in |
| R8677 |
T12360 |
T12323 |
punct |
", ",stained |
| R8678 |
T12361 |
T12323 |
advcl |
changing,stained |
| R8679 |
T12362 |
T12363 |
det |
the,solution |
| R8680 |
T12363 |
T12361 |
dobj |
solution,changing |
| R8681 |
T12364 |
T12363 |
compound |
staining,solution |
| R8682 |
T12365 |
T12361 |
prep |
after,changing |
| R8683 |
T12366 |
T12367 |
nummod |
1,h |
| R8684 |
T12367 |
T12365 |
pobj |
h,after |
| R8685 |
T12368 |
T12278 |
punct |
.,split |
| R8686 |
T12370 |
T12371 |
det |
The,samples |
| R8687 |
T12371 |
T12372 |
nsubjpass |
samples,fixed |
| R8688 |
T12373 |
T12372 |
auxpass |
were,fixed |
| R8689 |
T12374 |
T12372 |
advmod |
then,fixed |
| R8690 |
T12375 |
T12372 |
advmod |
overnight,fixed |
| R8691 |
T12376 |
T12372 |
punct |
", ",fixed |
| R8692 |
T12377 |
T12372 |
conj |
dehydrated,fixed |
| R8693 |
T12378 |
T12377 |
punct |
", ",dehydrated |
| R8694 |
T12379 |
T12377 |
cc |
and,dehydrated |
| R8695 |
T12380 |
T12377 |
conj |
mounted,dehydrated |
| R8696 |
T12381 |
T12372 |
punct |
.,fixed |
| R8697 |
T12383 |
T12384 |
det |
This,method |
| R8698 |
T12384 |
T12385 |
nsubj |
method,is |
| R8699 |
T12386 |
T12385 |
acomp |
sufficient,is |
| R8700 |
T12387 |
T12388 |
aux |
to,stain |
| R8701 |
T12388 |
T12386 |
xcomp |
stain,sufficient |
| R8702 |
T12389 |
T12390 |
amod |
interfollicular,melanocytes |
| R8703 |
T12390 |
T12388 |
dobj |
melanocytes,stain |
| R8704 |
T12391 |
T12388 |
prep |
without,stain |
| R8705 |
T12392 |
T12391 |
pcomp |
creating,without |
| R8706 |
T12393 |
T12394 |
det |
a,background |
| R8707 |
T12394 |
T12392 |
dobj |
background,creating |
| R8708 |
T12395 |
T12394 |
amod |
high,background |
| R8709 |
T12396 |
T12385 |
punct |
.,is |
| R8710 |
T12398 |
T12399 |
det |
The,fixative |
| R8711 |
T12399 |
T12400 |
nsubj |
fixative,was |
| R8712 |
T12401 |
T12399 |
acl |
used,fixative |
| R8713 |
T12402 |
T12400 |
advmod |
always,was |
| R8714 |
T12403 |
T12404 |
nummod |
4,% |
| R8715 |
T12404 |
T12405 |
compound |
%,paraformaldehyde |
| R8716 |
T12405 |
T12400 |
attr |
paraformaldehyde,was |
| R8717 |
T12406 |
T12400 |
punct |
.,was |
| R8718 |
T12538 |
T12539 |
amod |
Positional,cloning |
| R8719 |
T12541 |
T12542 |
det |
A,map |
| R8720 |
T12542 |
T12546 |
nsubjpass |
map,generated |
| R8721 |
T12543 |
T12544 |
amod |
high,resolution |
| R8722 |
T12544 |
T12542 |
compound |
resolution,map |
| R8723 |
T12545 |
T12544 |
punct |
-,resolution |
| R8724 |
T12547 |
T12542 |
prep |
for,map |
| R8725 |
T12548 |
T12547 |
pobj |
deH,for |
| R8726 |
T12549 |
T12546 |
auxpass |
was,generated |
| R8727 |
T12550 |
T12546 |
prep |
from,generated |
| R8728 |
T12551 |
T12552 |
det |
an,intercross |
| R8729 |
T12552 |
T12550 |
pobj |
intercross,from |
| R8730 |
T12553 |
T12552 |
amod |
intersubspecific,intercross |
| R8731 |
T12554 |
T12552 |
prep |
between,intercross |
| R8732 |
T12555 |
T12556 |
nmod |
deH,deH |
| R8733 |
T12556 |
T12558 |
nmod |
deH,mice |
| R8734 |
T12557 |
T12556 |
punct |
/,deH |
| R8735 |
T12558 |
T12554 |
pobj |
mice,between |
| R8736 |
T12559 |
T12556 |
cc |
and,deH |
| R8737 |
T12560 |
T12561 |
compound |
CAST,Ei |
| R8738 |
T12561 |
T12556 |
conj |
Ei,deH |
| R8739 |
T12562 |
T12561 |
punct |
/,Ei |
| R8740 |
T12563 |
T12546 |
punct |
.,generated |
| R8741 |
T12565 |
T12566 |
nsubj |
We,localized |
| R8742 |
T12567 |
T12566 |
advmod |
initially,localized |
| R8743 |
T12568 |
T12566 |
dobj |
deH,localized |
| R8744 |
T12569 |
T12566 |
prep |
to,localized |
| R8745 |
T12570 |
T12571 |
det |
a,interval |
| R8746 |
T12571 |
T12569 |
pobj |
interval,to |
| R8747 |
T12572 |
T12573 |
nummod |
1,cM |
| R8748 |
T12573 |
T12571 |
compound |
cM,interval |
| R8749 |
T12574 |
T12571 |
prep |
between,interval |
| R8750 |
T12575 |
T12574 |
pobj |
D3Mit233,between |
| R8751 |
T12576 |
T12575 |
cc |
and,D3Mit233 |
| R8752 |
T12577 |
T12575 |
conj |
D3Mit11,D3Mit233 |
| R8753 |
T12578 |
T12566 |
punct |
.,localized |
| R8754 |
T12580 |
T12581 |
compound |
F2,animals |
| R8755 |
T12581 |
T12582 |
nsubjpass |
animals,tested |
| R8756 |
T12583 |
T12581 |
acl |
carrying,animals |
| R8757 |
T12584 |
T12585 |
amod |
recombinant,chromosomes |
| R8758 |
T12585 |
T12583 |
dobj |
chromosomes,carrying |
| R8759 |
T12586 |
T12585 |
prep |
between,chromosomes |
| R8760 |
T12587 |
T12588 |
det |
these,markers |
| R8761 |
T12588 |
T12586 |
pobj |
markers,between |
| R8762 |
T12589 |
T12590 |
poss |
whose,genotype |
| R8763 |
T12590 |
T12591 |
dep |
genotype,was |
| R8764 |
T12591 |
T12581 |
relcl |
was,animals |
| R8765 |
T12592 |
T12591 |
prep |
at,was |
| R8766 |
T12593 |
T12592 |
pobj |
de,at |
| R8767 |
T12594 |
T12591 |
acomp |
indeterminate,was |
| R8768 |
T12595 |
T12596 |
punct |
(,deH |
| R8769 |
T12596 |
T12591 |
parataxis |
deH,was |
| R8770 |
T12597 |
T12596 |
punct |
/,deH |
| R8771 |
T12598 |
T12596 |
punct |
+,deH |
| R8772 |
T12599 |
T12596 |
cc |
or,deH |
| R8773 |
T12600 |
T12601 |
punct |
+,+ |
| R8774 |
T12601 |
T12596 |
conj |
+,deH |
| R8775 |
T12602 |
T12601 |
punct |
/,+ |
| R8776 |
T12603 |
T12596 |
punct |
),deH |
| R8777 |
T12604 |
T12582 |
auxpass |
were,tested |
| R8778 |
T12605 |
T12582 |
dep |
progeny,tested |
| R8779 |
T12606 |
T12582 |
punct |
-,tested |
| R8780 |
T12607 |
T12582 |
prep |
by,tested |
| R8781 |
T12608 |
T12607 |
pcomp |
crossing,by |
| R8782 |
T12609 |
T12608 |
prep |
to,crossing |
| R8783 |
T12610 |
T12611 |
compound |
deH,deH |
| R8784 |
T12611 |
T12613 |
compound |
deH,animals |
| R8785 |
T12612 |
T12611 |
punct |
/,deH |
| R8786 |
T12613 |
T12609 |
pobj |
animals,to |
| R8787 |
T12614 |
T12582 |
punct |
.,tested |
| R8788 |
T12616 |
T12617 |
amod |
Further,mapping |
| R8789 |
T12617 |
T12619 |
nsubj |
mapping,established |
| R8790 |
T12618 |
T12617 |
amod |
genetic,mapping |
| R8791 |
T12619 |
T12620 |
ccomp |
established,used |
| R8792 |
T12621 |
T12622 |
det |
a,region |
| R8793 |
T12622 |
T12619 |
dobj |
region,established |
| R8794 |
T12623 |
T12622 |
amod |
minimal,region |
| R8795 |
T12624 |
T12622 |
prep |
of,region |
| R8796 |
T12625 |
T12626 |
nummod |
0.1,cM |
| R8797 |
T12626 |
T12624 |
pobj |
cM,of |
| R8798 |
T12627 |
T12622 |
prep |
between,region |
| R8799 |
T12628 |
T12627 |
pobj |
D3Mit213,between |
| R8800 |
T12629 |
T12628 |
cc |
and,D3Mit213 |
| R8801 |
T12630 |
T12628 |
conj |
16.MMHAP32FLF1,D3Mit213 |
| R8802 |
T12631 |
T12620 |
punct |
;,used |
| R8803 |
T12632 |
T12633 |
det |
these,markers |
| R8804 |
T12633 |
T12620 |
nsubjpass |
markers,used |
| R8805 |
T12634 |
T12620 |
auxpass |
were,used |
| R8806 |
T12635 |
T12636 |
aux |
to,initiate |
| R8807 |
T12636 |
T12620 |
advcl |
initiate,used |
| R8808 |
T12637 |
T12636 |
dobj |
construction,initiate |
| R8809 |
T12638 |
T12637 |
prep |
of,construction |
| R8810 |
T12639 |
T12640 |
det |
a,map |
| R8811 |
T12640 |
T12638 |
pobj |
map,of |
| R8812 |
T12641 |
T12640 |
amod |
physical,map |
| R8813 |
T12642 |
T12637 |
prep |
with,construction |
| R8814 |
T12643 |
T12644 |
nmod |
BAC,clones |
| R8815 |
T12644 |
T12642 |
pobj |
clones,with |
| R8816 |
T12645 |
T12644 |
amod |
genomic,clones |
| R8817 |
T12646 |
T12647 |
punct |
(,Genetics |
| R8818 |
T12647 |
T12636 |
parataxis |
Genetics,initiate |
| R8819 |
T12648 |
T12647 |
compound |
Research,Genetics |
| R8820 |
T12649 |
T12647 |
punct |
", ",Genetics |
| R8821 |
T12650 |
T12647 |
npadvmod |
Huntsville,Genetics |
| R8822 |
T12651 |
T12647 |
punct |
", ",Genetics |
| R8823 |
T12652 |
T12647 |
npadvmod |
Alabama,Genetics |
| R8824 |
T12653 |
T12647 |
punct |
", ",Genetics |
| R8825 |
T12654 |
T12655 |
compound |
United,States |
| R8826 |
T12655 |
T12647 |
npadvmod |
States,Genetics |
| R8827 |
T12656 |
T12647 |
punct |
", ",Genetics |
| R8828 |
T12657 |
T12647 |
cc |
and,Genetics |
| R8829 |
T12658 |
T12659 |
compound |
Genome,Systems |
| R8830 |
T12659 |
T12647 |
conj |
Systems,Genetics |
| R8831 |
T12660 |
T12659 |
punct |
", ",Systems |
| R8832 |
T12661 |
T12662 |
compound |
St.,Louis |
| R8833 |
T12662 |
T12659 |
npadvmod |
Louis,Systems |
| R8834 |
T12663 |
T12659 |
punct |
", ",Systems |
| R8835 |
T12664 |
T12659 |
npadvmod |
Missouri,Systems |
| R8836 |
T12665 |
T12659 |
punct |
", ",Systems |
| R8837 |
T12666 |
T12667 |
compound |
United,States |
| R8838 |
T12667 |
T12659 |
npadvmod |
States,Systems |
| R8839 |
T12668 |
T12647 |
punct |
),Genetics |
| R8840 |
T12669 |
T12620 |
punct |
.,used |
| R8841 |
T12671 |
T12672 |
compound |
End,sequence |
| R8842 |
T12672 |
T12673 |
nsubjpass |
sequence,used |
| R8843 |
T12674 |
T12672 |
prep |
from,sequence |
| R8844 |
T12675 |
T12676 |
det |
those,BACs |
| R8845 |
T12676 |
T12674 |
pobj |
BACs,from |
| R8846 |
T12677 |
T12673 |
auxpass |
was,used |
| R8847 |
T12678 |
T12679 |
aux |
to,develop |
| R8848 |
T12679 |
T12673 |
advcl |
develop,used |
| R8849 |
T12680 |
T12681 |
compound |
SSCP,markers |
| R8850 |
T12681 |
T12679 |
dobj |
markers,develop |
| R8851 |
T12682 |
T12681 |
appos |
M1,markers |
| R8852 |
T12683 |
T12682 |
prep |
to,M1 |
| R8853 |
T12684 |
T12683 |
pobj |
M3,to |
| R8854 |
T12685 |
T12679 |
punct |
", ",develop |
| R8855 |
T12686 |
T12687 |
mark |
as,depicted |
| R8856 |
T12687 |
T12679 |
advcl |
depicted,develop |
| R8857 |
T12688 |
T12687 |
prep |
in,depicted |
| R8858 |
T12689 |
T12688 |
pobj |
Figure,in |
| R8859 |
T12690 |
T12689 |
nummod |
3,Figure |
| R8860 |
T12691 |
T12679 |
punct |
", ",develop |
| R8861 |
T12692 |
T12679 |
cc |
and,develop |
| R8862 |
T12693 |
T12694 |
aux |
to,establish |
| R8863 |
T12694 |
T12679 |
conj |
establish,develop |
| R8864 |
T12695 |
T12696 |
det |
a,interval |
| R8865 |
T12696 |
T12694 |
dobj |
interval,establish |
| R8866 |
T12697 |
T12696 |
amod |
minimal,interval |
| R8867 |
T12698 |
T12696 |
amod |
physical,interval |
| R8868 |
T12699 |
T12696 |
prep |
of,interval |
| R8869 |
T12700 |
T12701 |
nummod |
1.4,Mb |
| R8870 |
T12701 |
T12699 |
pobj |
Mb,of |
| R8871 |
T12702 |
T12673 |
punct |
.,used |
| R8872 |
T12704 |
T12705 |
compound |
Primer,pairs |
| R8873 |
T12705 |
T12706 |
nsubj |
pairs,were |
| R8874 |
T12707 |
T12705 |
acl |
used,pairs |
| R8875 |
T12708 |
T12706 |
attr |
TTCCCTCCAATAAGTTCTGGGTACC,were |
| R8876 |
T12709 |
T12708 |
cc |
and,TTCCCTCCAATAAGTTCTGGGTACC |
| R8877 |
T12710 |
T12708 |
conj |
AAGCTTGCTGCTCTGGATTCCATTTGTAG,TTCCCTCCAATAAGTTCTGGGTACC |
| R8878 |
T12711 |
T12708 |
prep |
for,TTCCCTCCAATAAGTTCTGGGTACC |
| R8879 |
T12712 |
T12711 |
pobj |
M1,for |
| R8880 |
T12713 |
T12708 |
punct |
", ",TTCCCTCCAATAAGTTCTGGGTACC |
| R8881 |
T12714 |
T12708 |
conj |
CCTTCATTTTTTTTTCAAGTAAAA,TTCCCTCCAATAAGTTCTGGGTACC |
| R8882 |
T12715 |
T12714 |
cc |
and,CCTTCATTTTTTTTTCAAGTAAAA |
| R8883 |
T12716 |
T12714 |
conj |
AAGCTTGGCTTAGTCCCAGTGGC,CCTTCATTTTTTTTTCAAGTAAAA |
| R8884 |
T12717 |
T12714 |
prep |
for,CCTTCATTTTTTTTTCAAGTAAAA |
| R8885 |
T12718 |
T12717 |
pobj |
M2,for |
| R8886 |
T12719 |
T12714 |
punct |
", ",CCTTCATTTTTTTTTCAAGTAAAA |
| R8887 |
T12720 |
T12714 |
conj |
CCTCCAGGAAGATCTACTAGGCAC,CCTTCATTTTTTTTTCAAGTAAAA |
| R8888 |
T12721 |
T12720 |
cc |
and,CCTCCAGGAAGATCTACTAGGCAC |
| R8889 |
T12722 |
T12720 |
conj |
ATGGAAAAAAAAAAGTAAGATTGAAAG,CCTCCAGGAAGATCTACTAGGCAC |
| R8890 |
T12723 |
T12720 |
prep |
for,CCTCCAGGAAGATCTACTAGGCAC |
| R8891 |
T12724 |
T12723 |
pobj |
M3,for |
| R8892 |
T12725 |
T12720 |
punct |
", ",CCTCCAGGAAGATCTACTAGGCAC |
| R8893 |
T12726 |
T12720 |
cc |
and,CCTCCAGGAAGATCTACTAGGCAC |
| R8894 |
T12727 |
T12720 |
conj |
TGGTTATCGATCTGTGGACCATTC,CCTCCAGGAAGATCTACTAGGCAC |
| R8895 |
T12728 |
T12727 |
cc |
and,TGGTTATCGATCTGTGGACCATTC |
| R8896 |
T12729 |
T12727 |
conj |
AAGTGAGAGAGCAGGATGGACCAC,TGGTTATCGATCTGTGGACCATTC |
| R8897 |
T12730 |
T12727 |
prep |
for,TGGTTATCGATCTGTGGACCATTC |
| R8898 |
T12731 |
T12730 |
pobj |
M4,for |
| R8899 |
T12732 |
T12733 |
punct |
(,represents |
| R8900 |
T12733 |
T12731 |
parataxis |
represents,M4 |
| R8901 |
T12734 |
T12735 |
det |
the,marker |
| R8902 |
T12735 |
T12733 |
nsubj |
marker,represents |
| R8903 |
T12736 |
T12735 |
compound |
M4,marker |
| R8904 |
T12737 |
T12738 |
compound |
STS,16.MMHAP32FLF1 |
| R8905 |
T12738 |
T12733 |
dobj |
16.MMHAP32FLF1,represents |
| R8906 |
T12739 |
T12733 |
punct |
),represents |
| R8907 |
T12740 |
T12706 |
punct |
.,were |
| R8908 |
T12742 |
T12743 |
amod |
Genomic,sequence |
| R8909 |
T12743 |
T12744 |
nsubjpass |
sequence,obtained |
| R8910 |
T12744 |
T12748 |
ccomp |
obtained,contains |
| R8911 |
T12745 |
T12743 |
cc |
and,sequence |
| R8912 |
T12746 |
T12743 |
conj |
annotations,sequence |
| R8913 |
T12747 |
T12744 |
auxpass |
were,obtained |
| R8914 |
T12749 |
T12744 |
prep |
from,obtained |
| R8915 |
T12750 |
T12751 |
det |
the,Browser |
| R8916 |
T12751 |
T12754 |
nmod |
Browser,mm3 |
| R8917 |
T12752 |
T12751 |
nmod |
UCSC,Browser |
| R8918 |
T12753 |
T12751 |
nmod |
Genome,Browser |
| R8919 |
T12754 |
T12749 |
pobj |
mm3,from |
| R8920 |
T12755 |
T12756 |
nmod |
February,assembly |
| R8921 |
T12756 |
T12754 |
compound |
assembly,mm3 |
| R8922 |
T12757 |
T12755 |
nummod |
2003,February |
| R8923 |
T12758 |
T12754 |
compound |
version,mm3 |
| R8924 |
T12759 |
T12760 |
punct |
(,http://genome.ucsc.edu |
| R8925 |
T12760 |
T12754 |
parataxis |
http://genome.ucsc.edu,mm3 |
| R8926 |
T12761 |
T12760 |
punct |
),http://genome.ucsc.edu |
| R8927 |
T12762 |
T12748 |
punct |
;,contains |
| R8928 |
T12763 |
T12764 |
det |
the,interval |
| R8929 |
T12764 |
T12748 |
nsubj |
interval,contains |
| R8930 |
T12765 |
T12766 |
nummod |
1.4,Mb |
| R8931 |
T12766 |
T12764 |
compound |
Mb,interval |
| R8932 |
T12767 |
T12764 |
prep |
between,interval |
| R8933 |
T12768 |
T12767 |
pobj |
M1,between |
| R8934 |
T12769 |
T12768 |
cc |
and,M1 |
| R8935 |
T12770 |
T12768 |
conj |
M4,M1 |
| R8936 |
T12771 |
T12772 |
nummod |
eight,genes |
| R8937 |
T12772 |
T12748 |
dobj |
genes,contains |
| R8938 |
T12773 |
T12772 |
punct |
: ,genes |
| R8939 |
T12774 |
T12775 |
nummod |
four,isomerases |
| R8940 |
T12775 |
T12772 |
appos |
isomerases,genes |
| R8941 |
T12776 |
T12775 |
compound |
hydroxysteroid,isomerases |
| R8942 |
T12777 |
T12775 |
compound |
dehydrogenase,isomerases |
| R8943 |
T12778 |
T12775 |
punct |
", ",isomerases |
| R8944 |
T12779 |
T12775 |
appos |
Hsd3b3,isomerases |
| R8945 |
T12780 |
T12779 |
punct |
", ",Hsd3b3 |
| R8946 |
T12781 |
T12779 |
conj |
Hsd3b2,Hsd3b3 |
| R8947 |
T12782 |
T12781 |
punct |
", ",Hsd3b2 |
| R8948 |
T12783 |
T12781 |
conj |
Hsd3b6,Hsd3b2 |
| R8949 |
T12784 |
T12783 |
punct |
", ",Hsd3b6 |
| R8950 |
T12785 |
T12783 |
cc |
and,Hsd3b6 |
| R8951 |
T12786 |
T12783 |
conj |
Hsd3b1,Hsd3b6 |
| R8952 |
T12787 |
T12775 |
punct |
;,isomerases |
| R8953 |
T12788 |
T12789 |
det |
an,oxidase |
| R8954 |
T12789 |
T12775 |
conj |
oxidase,isomerases |
| R8955 |
T12790 |
T12789 |
compound |
hydroacid,oxidase |
| R8956 |
T12791 |
T12789 |
punct |
", ",oxidase |
| R8957 |
T12792 |
T12789 |
appos |
Hao3,oxidase |
| R8958 |
T12793 |
T12789 |
punct |
;,oxidase |
| R8959 |
T12794 |
T12795 |
det |
a,synthetase |
| R8960 |
T12795 |
T12789 |
conj |
synthetase,oxidase |
| R8961 |
T12796 |
T12797 |
compound |
tryptophanyl,tRNA |
| R8962 |
T12797 |
T12795 |
compound |
tRNA,synthetase |
| R8963 |
T12798 |
T12797 |
punct |
-,tRNA |
| R8964 |
T12799 |
T12795 |
punct |
", ",synthetase |
| R8965 |
T12800 |
T12795 |
appos |
Wars2,synthetase |
| R8966 |
T12801 |
T12795 |
punct |
;,synthetase |
| R8967 |
T12802 |
T12803 |
det |
a,gene |
| R8968 |
T12803 |
T12795 |
conj |
gene,synthetase |
| R8969 |
T12804 |
T12805 |
compound |
T,box |
| R8970 |
T12805 |
T12803 |
compound |
box,gene |
| R8971 |
T12806 |
T12805 |
punct |
-,box |
| R8972 |
T12807 |
T12803 |
punct |
", ",gene |
| R8973 |
T12808 |
T12803 |
appos |
Tbx15,gene |
| R8974 |
T12809 |
T12803 |
punct |
;,gene |
| R8975 |
T12810 |
T12803 |
cc |
and,gene |
| R8976 |
T12811 |
T12812 |
det |
a,gene |
| R8977 |
T12812 |
T12803 |
conj |
gene,gene |
| R8978 |
T12813 |
T12812 |
amod |
novel,gene |
| R8979 |
T12814 |
T12812 |
punct |
", ",gene |
| R8980 |
T12815 |
T12812 |
appos |
4931427F14Rik,gene |
| R8981 |
T12816 |
T12748 |
punct |
.,contains |
| R8982 |
T12818 |
T12819 |
prep |
In,correspond |
| R8983 |
T12820 |
T12821 |
det |
the,sequence |
| R8984 |
T12821 |
T12818 |
pobj |
sequence,In |
| R8985 |
T12822 |
T12821 |
compound |
genome,sequence |
| R8986 |
T12823 |
T12819 |
punct |
", ",correspond |
| R8987 |
T12824 |
T12825 |
compound |
M1,primers |
| R8988 |
T12825 |
T12819 |
nsubj |
primers,correspond |
| R8989 |
T12826 |
T12819 |
prep |
to,correspond |
| R8990 |
T12827 |
T12826 |
pobj |
AGGCCTCCAATAAGTTCTGGGTACC,to |
| R8991 |
T12828 |
T12827 |
cc |
and,AGGCCTCCAATAAGTTCTGGGTACC |
| R8992 |
T12829 |
T12827 |
conj |
AAGCTTGCTCTCTGGATTCCATTTGTAG,AGGCCTCCAATAAGTTCTGGGTACC |
| R8993 |
T12830 |
T12819 |
punct |
", ",correspond |
| R8994 |
T12831 |
T12832 |
det |
the,primer |
| R8995 |
T12832 |
T12835 |
nsubj |
primer,corresponds |
| R8996 |
T12833 |
T12832 |
nmod |
M2,primer |
| R8997 |
T12834 |
T12832 |
amod |
reverse,primer |
| R8998 |
T12835 |
T12819 |
conj |
corresponds,correspond |
| R8999 |
T12836 |
T12835 |
prep |
to,corresponds |
| R9000 |
T12837 |
T12836 |
pobj |
AAGCTTGGCTTTAGTCCCAGTGGGC,to |
| R9001 |
T12838 |
T12835 |
punct |
", ",corresponds |
| R9002 |
T12839 |
T12835 |
cc |
and,corresponds |
| R9003 |
T12840 |
T12841 |
det |
the,primers |
| R9004 |
T12841 |
T12843 |
nsubj |
primers,correspond |
| R9005 |
T12842 |
T12841 |
compound |
M3,primers |
| R9006 |
T12843 |
T12835 |
conj |
correspond,corresponds |
| R9007 |
T12844 |
T12843 |
prep |
to,correspond |
| R9008 |
T12845 |
T12844 |
pobj |
CCTCCAGGAAGAATCTACTAGGCAC,to |
| R9009 |
T12846 |
T12845 |
cc |
and,CCTCCAGGAAGAATCTACTAGGCAC |
| R9010 |
T12847 |
T12845 |
conj |
AATGAAAAAAAAAAAAGTAAGATTGAAAG,CCTCCAGGAAGAATCTACTAGGCAC |
| R9011 |
T12848 |
T12819 |
punct |
.,correspond |
| R9012 |
T12850 |
T12851 |
amod |
Minor,differences |
| R9013 |
T12851 |
T12852 |
nsubj |
differences,represent |
| R9014 |
T12853 |
T12851 |
prep |
among,differences |
| R9015 |
T12854 |
T12855 |
det |
the,sequences |
| R9016 |
T12855 |
T12853 |
pobj |
sequences,among |
| R9017 |
T12856 |
T12855 |
prep |
of,sequences |
| R9018 |
T12857 |
T12858 |
det |
the,primers |
| R9019 |
T12858 |
T12856 |
pobj |
primers,of |
| R9020 |
T12859 |
T12860 |
nsubj |
we,obtained |
| R9021 |
T12860 |
T12858 |
advcl |
obtained,primers |
| R9022 |
T12861 |
T12860 |
prep |
from,obtained |
| R9023 |
T12862 |
T12863 |
det |
the,BAC |
| R9024 |
T12863 |
T12861 |
pobj |
BAC,from |
| R9025 |
T12864 |
T12863 |
nmod |
ends,BAC |
| R9026 |
T12865 |
T12855 |
cc |
and,sequences |
| R9027 |
T12866 |
T12867 |
det |
the,sequence |
| R9028 |
T12867 |
T12855 |
conj |
sequence,sequences |
| R9029 |
T12868 |
T12867 |
amod |
public,sequence |
| R9030 |
T12869 |
T12867 |
compound |
genome,sequence |
| R9031 |
T12870 |
T12852 |
aux |
may,represent |
| R9032 |
T12871 |
T12872 |
compound |
strain,differences |
| R9033 |
T12872 |
T12852 |
dobj |
differences,represent |
| R9034 |
T12873 |
T12872 |
cc |
or,differences |
| R9035 |
T12874 |
T12875 |
compound |
sequencing,errors |
| R9036 |
T12875 |
T12872 |
conj |
errors,differences |
| R9037 |
T12876 |
T12875 |
prep |
on,errors |
| R9038 |
T12877 |
T12878 |
det |
the,DNA |
| R9039 |
T12878 |
T12876 |
pobj |
DNA,on |
| R9040 |
T12879 |
T12878 |
compound |
BAC,DNA |
| R9041 |
T12880 |
T12852 |
punct |
.,represent |
| R9042 |
T12882 |
T12883 |
det |
A,assay |
| R9043 |
T12883 |
T12886 |
nsubjpass |
assay,developed |
| R9044 |
T12884 |
T12883 |
amod |
multiplex,assay |
| R9045 |
T12885 |
T12883 |
amod |
genotyping,assay |
| R9046 |
T12887 |
T12886 |
auxpass |
was,developed |
| R9047 |
T12888 |
T12889 |
aux |
to,genotype |
| R9048 |
T12889 |
T12886 |
advcl |
genotype,developed |
| R9049 |
T12890 |
T12889 |
prep |
for,genotype |
| R9050 |
T12891 |
T12892 |
det |
the,deletion |
| R9051 |
T12892 |
T12890 |
pobj |
deletion,for |
| R9052 |
T12893 |
T12892 |
compound |
deH,deletion |
| R9053 |
T12894 |
T12889 |
advcl |
using,genotype |
| R9054 |
T12895 |
T12896 |
compound |
primers,GGAGCAGATCCAATTGCTTT |
| R9055 |
T12896 |
T12894 |
dobj |
GGAGCAGATCCAATTGCTTT,using |
| R9056 |
T12897 |
T12896 |
punct |
", ",GGAGCAGATCCAATTGCTTT |
| R9057 |
T12898 |
T12896 |
conj |
TCCATAGCCCATCTTCACAA,GGAGCAGATCCAATTGCTTT |
| R9058 |
T12899 |
T12898 |
punct |
", ",TCCATAGCCCATCTTCACAA |
| R9059 |
T12900 |
T12898 |
cc |
and,TCCATAGCCCATCTTCACAA |
| R9060 |
T12901 |
T12898 |
conj |
CATGTCCACTTCTGCTTCCA,TCCATAGCCCATCTTCACAA |
| R9061 |
T12902 |
T12886 |
punct |
.,developed |
| R9062 |
T12904 |
T12905 |
det |
This,assay |
| R9063 |
T12905 |
T12907 |
nsubj |
assay,produces |
| R9064 |
T12906 |
T12905 |
compound |
PCR,assay |
| R9065 |
T12908 |
T12909 |
det |
a,product |
| R9066 |
T12909 |
T12907 |
dobj |
product,produces |
| R9067 |
T12910 |
T12911 |
nummod |
392,bp |
| R9068 |
T12911 |
T12909 |
compound |
bp,product |
| R9069 |
T12912 |
T12907 |
prep |
from,produces |
| R9070 |
T12913 |
T12914 |
det |
the,chromosome |
| R9071 |
T12914 |
T12912 |
pobj |
chromosome,from |
| R9072 |
T12915 |
T12914 |
compound |
deH,chromosome |
| R9073 |
T12916 |
T12907 |
cc |
and,produces |
| R9074 |
T12917 |
T12918 |
det |
a,product |
| R9075 |
T12918 |
T12907 |
conj |
product,produces |
| R9076 |
T12919 |
T12920 |
nummod |
595,bp |
| R9077 |
T12920 |
T12918 |
compound |
bp,product |
| R9078 |
T12921 |
T12918 |
prep |
from,product |
| R9079 |
T12922 |
T12923 |
det |
the,chromosome |
| R9080 |
T12923 |
T12921 |
pobj |
chromosome,from |
| R9081 |
T12924 |
T12923 |
amod |
nonmutant,chromosome |
| R9082 |
T12925 |
T12907 |
punct |
.,produces |
| R9099 |
T12993 |
T12990 |
punct |
(,Russ |
| R9100 |
T12994 |
T12990 |
npadvmod |
2000,Russ |
| R9101 |
T12995 |
T12990 |
punct |
),Russ |
| R9102 |
T12996 |
T12980 |
punct |
.,constructed |
| R9103 |
T12998 |
T12999 |
prep |
In,inserted |
| R9104 |
T13000 |
T12998 |
pobj |
brief,In |
| R9105 |
T13001 |
T12999 |
punct |
", ",inserted |
| R9106 |
T13002 |
T13003 |
det |
an,cassette |
| R9107 |
T13003 |
T12999 |
nsubjpass |
cassette,inserted |
| R9108 |
T13004 |
T13005 |
compound |
IRES,neo |
| R9109 |
T13005 |
T13003 |
compound |
neo,cassette |
| R9110 |
T13006 |
T13005 |
punct |
-,neo |
| R9111 |
T13007 |
T13005 |
compound |
LacZ,neo |
| R9112 |
T13008 |
T13005 |
punct |
-,neo |
| R9113 |
T13009 |
T13003 |
prep |
with,cassette |
| R9114 |
T13010 |
T13011 |
nummod |
5,arms |
| R9115 |
T13011 |
T13009 |
pobj |
arms,with |
| R9116 |
T13012 |
T13010 |
punct |
′,5 |
| R9117 |
T13013 |
T13010 |
cc |
and,5 |
| R9118 |
T13014 |
T13010 |
conj |
3,5 |
| R9119 |
T13015 |
T13014 |
punct |
′,3 |
| R9120 |
T13016 |
T13011 |
compound |
homology,arms |
| R9121 |
T13017 |
T13011 |
prep |
of,arms |
| R9122 |
T13018 |
T13019 |
nummod |
3.5,kb |
| R9123 |
T13019 |
T13017 |
pobj |
kb,of |
| R9124 |
T13020 |
T13019 |
cc |
and,kb |
| R9125 |
T13021 |
T13022 |
nummod |
1.8,kb |
| R9126 |
T13022 |
T13019 |
conj |
kb,kb |
| R9127 |
T13023 |
T12999 |
auxpass |
was,inserted |
| R9128 |
T13024 |
T12999 |
prep |
into,inserted |
| R9129 |
T13025 |
T13026 |
det |
a,site |
| R9130 |
T13026 |
T13024 |
pobj |
site,into |
| R9131 |
T13027 |
T13026 |
amod |
unique,site |
| R9132 |
T13028 |
T13026 |
compound |
BamHI,site |
| R9133 |
T13029 |
T13030 |
dep |
that,lies |
| R9134 |
T13030 |
T13026 |
relcl |
lies,site |
| R9135 |
T13031 |
T13032 |
nummod |
479,nucleotides |
| R9136 |
T13032 |
T13033 |
npadvmod |
nucleotides,downstream |
| R9137 |
T13033 |
T13030 |
advmod |
downstream,lies |
| R9138 |
T13034 |
T13033 |
prep |
of,downstream |
| R9139 |
T13035 |
T13036 |
det |
the,site |
| R9140 |
T13036 |
T13034 |
pobj |
site,of |
| R9141 |
T13037 |
T13036 |
amod |
transcriptional,site |
| R9142 |
T13038 |
T13036 |
compound |
initiation,site |
| R9143 |
T13039 |
T13030 |
punct |
(,lies |
| R9144 |
T13040 |
T13030 |
advcl |
relative,lies |
| R9145 |
T13041 |
T13040 |
prep |
to,relative |
| R9146 |
T13042 |
T13043 |
det |
the,sequence |
| R9147 |
T13043 |
T13041 |
pobj |
sequence,to |
| R9148 |
T13044 |
T13043 |
compound |
mRNA,sequence |
| R9149 |
T13045 |
T13030 |
punct |
),lies |
| R9150 |
T13046 |
T13030 |
prep |
in,lies |
| R9151 |
T13047 |
T13046 |
pobj |
exon,in |
| R9152 |
T13048 |
T13047 |
nummod |
3,exon |
| R9153 |
T13049 |
T12999 |
punct |
.,inserted |
| R9154 |
T13051 |
T13052 |
amod |
Positive,clones |
| R9155 |
T13052 |
T13054 |
nsubjpass |
clones,injected |
| R9156 |
T13053 |
T13052 |
compound |
ES,clones |
| R9157 |
T13055 |
T13054 |
auxpass |
were,injected |
| R9158 |
T13056 |
T13054 |
prep |
into,injected |
| R9159 |
T13057 |
T13058 |
compound |
B6,blastocysts |
| R9160 |
T13058 |
T13056 |
pobj |
blastocysts,into |
| R9161 |
T13059 |
T13054 |
punct |
", ",injected |
| R9162 |
T13060 |
T13054 |
cc |
and,injected |
| R9163 |
T13061 |
T13062 |
amod |
chimeric,founders |
| R9164 |
T13062 |
T13063 |
nsubj |
founders,crossed |
| R9165 |
T13063 |
T13054 |
conj |
crossed,injected |
| R9166 |
T13064 |
T13063 |
prep |
to,crossed |
| R9167 |
T13065 |
T13066 |
preconj |
either,mice |
| R9168 |
T13066 |
T13064 |
pobj |
mice,to |
| R9169 |
T13067 |
T13066 |
compound |
B6,mice |
| R9170 |
T13068 |
T13064 |
cc |
or,to |
| R9171 |
T13069 |
T13064 |
conj |
to,to |
| R9172 |
T13070 |
T13071 |
nmod |
deH,animals |
| R9173 |
T13071 |
T13069 |
pobj |
animals,to |
| R9174 |
T13072 |
T13070 |
punct |
/,deH |
| R9175 |
T13073 |
T13070 |
punct |
+,deH |
| R9176 |
T13074 |
T13063 |
punct |
.,crossed |
| R9177 |
T13131 |
T13132 |
advmod |
In,situ |
| R9178 |
T13132 |
T13133 |
amod |
situ,hybridization |
| R9179 |
T13135 |
T13136 |
advmod |
In,situ |
| R9180 |
T13136 |
T13137 |
amod |
situ,hybridization |
| R9181 |
T13137 |
T13138 |
nsubjpass |
hybridization,carried |
| R9182 |
T13139 |
T13138 |
auxpass |
was,carried |
| R9183 |
T13140 |
T13138 |
prt |
out,carried |
| R9184 |
T13141 |
T13138 |
prep |
on,carried |
| R9185 |
T13142 |
T13143 |
nummod |
12,μm |
| R9186 |
T13143 |
T13145 |
compound |
μm,sections |
| R9187 |
T13144 |
T13143 |
punct |
-,μm |
| R9188 |
T13145 |
T13141 |
pobj |
sections,on |
| R9189 |
T13146 |
T13145 |
compound |
paraffin,sections |
| R9190 |
T13147 |
T13138 |
advcl |
using,carried |
| R9191 |
T13148 |
T13149 |
npadvmod |
digoxigenin,labeled |
| R9192 |
T13149 |
T13151 |
amod |
labeled,probes |
| R9193 |
T13150 |
T13149 |
punct |
-,labeled |
| R9194 |
T13151 |
T13147 |
dobj |
probes,using |
| R9195 |
T13152 |
T13151 |
compound |
RNA,probes |
| R9196 |
T13153 |
T13154 |
punct |
(,Diagnostics |
| R9197 |
T13154 |
T13151 |
parataxis |
Diagnostics,probes |
| R9198 |
T13155 |
T13154 |
compound |
Roche,Diagnostics |
| R9199 |
T13156 |
T13154 |
punct |
", ",Diagnostics |
| R9200 |
T13157 |
T13154 |
npadvmod |
Indianapolis,Diagnostics |
| R9201 |
T13158 |
T13154 |
punct |
", ",Diagnostics |
| R9202 |
T13159 |
T13154 |
npadvmod |
Indiana,Diagnostics |
| R9203 |
T13160 |
T13154 |
punct |
", ",Diagnostics |
| R9204 |
T13161 |
T13162 |
compound |
United,States |
| R9205 |
T13162 |
T13154 |
npadvmod |
States,Diagnostics |
| R9206 |
T13163 |
T13154 |
punct |
),Diagnostics |
| R9207 |
T13164 |
T13147 |
prep |
according,using |
| R9208 |
T13165 |
T13164 |
prep |
to,according |
| R9209 |
T13166 |
T13167 |
amod |
standard,protocols |
| R9210 |
T13167 |
T13165 |
pobj |
protocols,to |
| R9211 |
T13168 |
T13169 |
punct |
(,Wilkinson |
| R9212 |
T13169 |
T13167 |
meta |
Wilkinson,protocols |
| R9213 |
T13170 |
T13169 |
cc |
and,Wilkinson |
| R9214 |
T13171 |
T13169 |
conj |
Nieto,Wilkinson |
| R9215 |
T13172 |
T13171 |
nummod |
1993,Nieto |
| R9216 |
T13173 |
T13171 |
punct |
),Nieto |
| R9217 |
T13174 |
T13138 |
punct |
.,carried |
| R9218 |
T13176 |
T13177 |
nsubjpass |
Embryos,obtained |
| R9219 |
T13178 |
T13176 |
cc |
and,Embryos |
| R9220 |
T13179 |
T13180 |
amod |
postnatal,samples |
| R9221 |
T13180 |
T13176 |
conj |
samples,Embryos |
| R9222 |
T13181 |
T13180 |
compound |
skin,samples |
| R9223 |
T13182 |
T13177 |
auxpass |
were,obtained |
| R9224 |
T13183 |
T13177 |
prep |
from,obtained |
| R9225 |
T13184 |
T13183 |
pobj |
intercrosses,from |
| R9226 |
T13185 |
T13184 |
prep |
of,intercrosses |
| R9227 |
T13186 |
T13187 |
nmod |
deH,mice |
| R9228 |
T13187 |
T13185 |
pobj |
mice,of |
| R9229 |
T13188 |
T13186 |
punct |
/,deH |
| R9230 |
T13189 |
T13186 |
punct |
+,deH |
| R9231 |
T13190 |
T13177 |
punct |
.,obtained |
| R9232 |
T13192 |
T13193 |
nsubjpass |
Embryos,fixed |
| R9233 |
T13193 |
T13198 |
ccomp |
fixed,fixed |
| R9234 |
T13194 |
T13192 |
npadvmod |
E13.5,Embryos |
| R9235 |
T13195 |
T13194 |
cc |
or,E13.5 |
| R9236 |
T13196 |
T13194 |
conj |
younger,E13.5 |
| R9237 |
T13197 |
T13193 |
auxpass |
were,fixed |
| R9238 |
T13199 |
T13193 |
prep |
for,fixed |
| R9239 |
T13200 |
T13201 |
nummod |
24,h |
| R9240 |
T13201 |
T13199 |
pobj |
h,for |
| R9241 |
T13202 |
T13198 |
punct |
;,fixed |
| R9242 |
T13203 |
T13198 |
nsubjpass |
those,fixed |
| R9243 |
T13204 |
T13203 |
amod |
older,those |
| R9244 |
T13205 |
T13204 |
prep |
than,older |
| R9245 |
T13206 |
T13205 |
pobj |
E13.5,than |
| R9246 |
T13207 |
T13203 |
cc |
and,those |
| R9247 |
T13208 |
T13209 |
amod |
postnatal,skin |
| R9248 |
T13209 |
T13203 |
conj |
skin,those |
| R9249 |
T13210 |
T13198 |
auxpass |
were,fixed |
| R9250 |
T13211 |
T13198 |
prep |
for,fixed |
| R9251 |
T13212 |
T13213 |
quantmod |
36,48 |
| R9252 |
T13213 |
T13215 |
nummod |
48,h |
| R9253 |
T13214 |
T13213 |
punct |
–,48 |
| R9254 |
T13215 |
T13211 |
pobj |
h,for |
| R9255 |
T13216 |
T13198 |
advmod |
prior,fixed |
| R9256 |
T13217 |
T13216 |
prep |
to,prior |
| R9257 |
T13218 |
T13217 |
pobj |
embedding,to |
| R9258 |
T13219 |
T13198 |
punct |
.,fixed |
| R9259 |
T13221 |
T13222 |
det |
The,probe |
| R9260 |
T13222 |
T13224 |
nsubjpass |
probe,generated |
| R9261 |
T13223 |
T13222 |
compound |
Tbx15,probe |
| R9262 |
T13225 |
T13224 |
auxpass |
was,generated |
| R9263 |
T13226 |
T13224 |
prep |
by,generated |
| R9264 |
T13227 |
T13228 |
compound |
RT,PCR |
| R9265 |
T13228 |
T13226 |
pobj |
PCR,by |
| R9266 |
T13229 |
T13228 |
punct |
–,PCR |
| R9267 |
T13230 |
T13224 |
advcl |
using,generated |
| R9268 |
T13231 |
T13232 |
compound |
primers,GGCGGCTAAAATGAGTGAAC |
| R9269 |
T13232 |
T13230 |
dobj |
GGCGGCTAAAATGAGTGAAC,using |
| R9270 |
T13233 |
T13232 |
cc |
and,GGCGGCTAAAATGAGTGAAC |
| R9271 |
T13234 |
T13232 |
conj |
TGCCTGCTTTGGTGATGAT,GGCGGCTAAAATGAGTGAAC |
| R9272 |
T13235 |
T13236 |
punct |
(,corresponds |
| R9273 |
T13236 |
T13230 |
parataxis |
corresponds,using |
| R9274 |
T13237 |
T13236 |
prep |
to,corresponds |
| R9275 |
T13238 |
T13237 |
pobj |
exons,to |
| R9276 |
T13239 |
T13238 |
nummod |
1,exons |
| R9277 |
T13240 |
T13238 |
cc |
and,exons |
| R9278 |
T13241 |
T13238 |
conj |
2,exons |
| R9279 |
T13242 |
T13236 |
punct |
),corresponds |
| R9280 |
T13243 |
T13224 |
punct |
", ",generated |
| R9281 |
T13244 |
T13224 |
cc |
and,generated |
| R9282 |
T13245 |
T13246 |
det |
the,probe |
| R9283 |
T13246 |
T13248 |
nsubjpass |
probe,generated |
| R9284 |
T13247 |
T13246 |
compound |
En1,probe |
| R9285 |
T13248 |
T13224 |
conj |
generated,generated |
| R9286 |
T13249 |
T13248 |
auxpass |
was,generated |
| R9287 |
T13250 |
T13248 |
prep |
by,generated |
| R9288 |
T13251 |
T13250 |
pobj |
PCR,by |
| R9289 |
T13252 |
T13248 |
prep |
from,generated |
| R9290 |
T13253 |
T13254 |
amod |
genomic,DNA |
| R9291 |
T13254 |
T13252 |
pobj |
DNA,from |
| R9292 |
T13255 |
T13248 |
advcl |
using,generated |
| R9293 |
T13256 |
T13257 |
compound |
primers,ACGCACCAGGAAGCTAAAGA |
| R9294 |
T13257 |
T13255 |
dobj |
ACGCACCAGGAAGCTAAAGA,using |
| R9295 |
T13258 |
T13257 |
cc |
and,ACGCACCAGGAAGCTAAAGA |
| R9296 |
T13259 |
T13257 |
conj |
AGCAACGAAAACGAAACTGG,ACGCACCAGGAAGCTAAAGA |
| R9297 |
T13260 |
T13261 |
punct |
(,located |
| R9298 |
T13261 |
T13255 |
parataxis |
located,using |
| R9299 |
T13262 |
T13261 |
prep |
in,located |
| R9300 |
T13263 |
T13264 |
det |
the,exon |
| R9301 |
T13264 |
T13262 |
pobj |
exon,in |
| R9302 |
T13265 |
T13264 |
amod |
last,exon |
| R9303 |
T13266 |
T13261 |
punct |
),located |
| R9304 |
T13267 |
T13248 |
punct |
.,generated |
| R9305 |
T13269 |
T13270 |
det |
The,probe |
| R9306 |
T13270 |
T13272 |
nsubj |
probe,corresponds |
| R9307 |
T13271 |
T13270 |
compound |
Agouti,probe |
| R9308 |
T13273 |
T13272 |
prep |
to,corresponds |
| R9309 |
T13274 |
T13275 |
det |
the,sequence |
| R9310 |
T13275 |
T13273 |
pobj |
sequence,to |
| R9311 |
T13276 |
T13277 |
npadvmod |
protein,coding |
| R9312 |
T13277 |
T13275 |
amod |
coding,sequence |
| R9313 |
T13278 |
T13277 |
punct |
-,coding |
| R9314 |
T13279 |
T13272 |
punct |
.,corresponds |
| R9315 |
T13332 |
T13333 |
amod |
Embryonic,transplantation |
| R9316 |
T13334 |
T13333 |
compound |
skin,transplantation |
| R9317 |
T13336 |
T13337 |
punct |
(,dissected |
| R9318 |
T13338 |
T13339 |
nmod |
BTBR,embryos |
| R9319 |
T13339 |
T13337 |
nsubjpass |
embryos,dissected |
| R9320 |
T13340 |
T13338 |
punct |
-,BTBR |
| R9321 |
T13341 |
T13342 |
compound |
at,at |
| R9322 |
T13342 |
T13338 |
appos |
at,BTBR |
| R9323 |
T13343 |
T13342 |
punct |
/,at |
| R9324 |
T13344 |
T13338 |
punct |
×,BTBR |
| R9325 |
T13345 |
T13338 |
appos |
B6,BTBR |
| R9326 |
T13346 |
T13345 |
punct |
-,B6 |
| R9327 |
T13347 |
T13348 |
compound |
a,a |
| R9328 |
T13348 |
T13345 |
appos |
a,B6 |
| R9329 |
T13349 |
T13348 |
punct |
/,a |
| R9330 |
T13350 |
T13339 |
punct |
),embryos |
| R9331 |
T13351 |
T13339 |
compound |
F1,embryos |
| R9332 |
T13352 |
T13339 |
prep |
at,embryos |
| R9333 |
T13353 |
T13352 |
pobj |
E12.5,at |
| R9334 |
T13354 |
T13337 |
auxpass |
were,dissected |
| R9335 |
T13355 |
T13337 |
prep |
in,dissected |
| R9336 |
T13356 |
T13357 |
amod |
sterile,solution |
| R9337 |
T13357 |
T13355 |
pobj |
solution,in |
| R9338 |
T13358 |
T13357 |
poss |
Tyrode,solution |
| R9339 |
T13359 |
T13358 |
case |
's,Tyrode |
| R9340 |
T13360 |
T13337 |
punct |
", ",dissected |
| R9341 |
T13361 |
T13337 |
cc |
and,dissected |
| R9342 |
T13362 |
T13363 |
amod |
embryonic,skin |
| R9343 |
T13363 |
T13364 |
nsubjpass |
skin,divided |
| R9344 |
T13364 |
T13337 |
conj |
divided,dissected |
| R9345 |
T13365 |
T13364 |
auxpass |
was,divided |
| R9346 |
T13366 |
T13364 |
prep |
into,divided |
| R9347 |
T13367 |
T13368 |
amod |
dorsal,pieces |
| R9348 |
T13368 |
T13366 |
pobj |
pieces,into |
| R9349 |
T13369 |
T13367 |
punct |
", ",dorsal |
| R9350 |
T13370 |
T13367 |
conj |
flank,dorsal |
| R9351 |
T13371 |
T13370 |
punct |
", ",flank |
| R9352 |
T13372 |
T13370 |
cc |
and,flank |
| R9353 |
T13373 |
T13370 |
conj |
ventral,flank |
| R9354 |
T13374 |
T13368 |
punct |
", ",pieces |
| R9355 |
T13375 |
T13376 |
advmod |
each,mm2 |
| R9356 |
T13376 |
T13368 |
appos |
mm2,pieces |
| R9357 |
T13377 |
T13378 |
compound |
1,2 |
| R9358 |
T13378 |
T13376 |
nummod |
2,mm2 |
| R9359 |
T13379 |
T13378 |
punct |
–,2 |
| R9360 |
T13380 |
T13376 |
prep |
in,mm2 |
| R9361 |
T13381 |
T13380 |
pobj |
size,in |
| R9362 |
T13382 |
T13364 |
punct |
", ",divided |
| R9363 |
T13383 |
T13384 |
mark |
as,shown |
| R9364 |
T13384 |
T13364 |
advcl |
shown,divided |
| R9365 |
T13385 |
T13384 |
prep |
in,shown |
| R9366 |
T13386 |
T13385 |
pobj |
Figure,in |
| R9367 |
T13387 |
T13386 |
nummod |
7,Figure |
| R9368 |
T13388 |
T13364 |
punct |
.,divided |
| R9369 |
T13390 |
T13391 |
compound |
Skin,fragments |
| R9370 |
T13391 |
T13392 |
nsubjpass |
fragments,grafted |
| R9371 |
T13393 |
T13392 |
auxpass |
were,grafted |
| R9372 |
T13394 |
T13392 |
prep |
to,grafted |
| R9373 |
T13395 |
T13396 |
det |
the,testes |
| R9374 |
T13396 |
T13394 |
pobj |
testes,to |
| R9375 |
T13397 |
T13396 |
prep |
of,testes |
| R9376 |
T13398 |
T13399 |
amod |
congenic,animals |
| R9377 |
T13399 |
T13397 |
pobj |
animals,of |
| R9378 |
T13400 |
T13401 |
mark |
as,follows |
| R9379 |
T13401 |
T13392 |
advcl |
follows,grafted |
| R9380 |
T13402 |
T13392 |
punct |
.,grafted |
| R9381 |
T13404 |
T13405 |
prep |
After,made |
| R9382 |
T13406 |
T13404 |
pobj |
anesthetization,After |
| R9383 |
T13407 |
T13406 |
prep |
with,anesthetization |
| R9384 |
T13408 |
T13409 |
nummod |
2.5,% |
| R9385 |
T13409 |
T13410 |
compound |
%,Avertin |
| R9386 |
T13410 |
T13407 |
pobj |
Avertin,with |
| R9387 |
T13411 |
T13405 |
punct |
", ",made |
| R9388 |
T13412 |
T13413 |
det |
a,incision |
| R9389 |
T13413 |
T13405 |
nsubjpass |
incision,made |
| R9390 |
T13414 |
T13415 |
nummod |
1.5,cm |
| R9391 |
T13415 |
T13413 |
compound |
cm,incision |
| R9392 |
T13416 |
T13415 |
punct |
-,cm |
| R9393 |
T13417 |
T13413 |
prep |
in,incision |
| R9394 |
T13418 |
T13419 |
det |
the,skin |
| R9395 |
T13419 |
T13417 |
pobj |
skin,in |
| R9396 |
T13420 |
T13419 |
cc |
and,skin |
| R9397 |
T13421 |
T13422 |
compound |
body,wall |
| R9398 |
T13422 |
T13419 |
conj |
wall,skin |
| R9399 |
T13423 |
T13405 |
auxpass |
was,made |
| R9400 |
T13424 |
T13405 |
prep |
at,made |
| R9401 |
T13425 |
T13426 |
det |
a,point |
| R9402 |
T13426 |
T13424 |
pobj |
point,at |
| R9403 |
T13427 |
T13426 |
amod |
level,point |
| R9404 |
T13428 |
T13427 |
prep |
with,level |
| R9405 |
T13429 |
T13430 |
det |
the,top |
| R9406 |
T13430 |
T13428 |
pobj |
top,with |
| R9407 |
T13431 |
T13430 |
prep |
of,top |
| R9408 |
T13432 |
T13433 |
det |
the,limbs |
| R9409 |
T13433 |
T13431 |
pobj |
limbs,of |
| R9410 |
T13434 |
T13405 |
punct |
.,made |
| R9411 |
T13436 |
T13437 |
det |
The,pads |
| R9412 |
T13437 |
T13439 |
nsubjpass |
pads,pulled |
| R9413 |
T13438 |
T13437 |
compound |
fat,pads |
| R9414 |
T13440 |
T13439 |
auxpass |
were,pulled |
| R9415 |
T13441 |
T13439 |
prt |
out,pulled |
| R9416 |
T13442 |
T13439 |
cc |
and,pulled |
| R9417 |
T13443 |
T13439 |
conj |
laid,pulled |
| R9418 |
T13444 |
T13443 |
prep |
on,laid |
| R9419 |
T13445 |
T13446 |
det |
the,outside |
| R9420 |
T13446 |
T13444 |
pobj |
outside,on |
| R9421 |
T13447 |
T13446 |
prep |
of,outside |
| R9422 |
T13448 |
T13449 |
det |
the,body |
| R9423 |
T13449 |
T13447 |
pobj |
body,of |
| R9424 |
T13450 |
T13443 |
punct |
", ",laid |
| R9425 |
T13451 |
T13443 |
advcl |
exposing,laid |
| R9426 |
T13452 |
T13453 |
det |
the,testes |
| R9427 |
T13453 |
T13451 |
dobj |
testes,exposing |
| R9428 |
T13454 |
T13439 |
punct |
.,pulled |
| R9429 |
T13456 |
T13457 |
nsubjpass |
Forceps,used |
| R9430 |
T13458 |
T13457 |
auxpass |
were,used |
| R9431 |
T13459 |
T13460 |
aux |
to,introduce |
| R9432 |
T13460 |
T13457 |
advcl |
introduce,used |
| R9433 |
T13461 |
T13462 |
det |
a,hole |
| R9434 |
T13462 |
T13460 |
dobj |
hole,introduce |
| R9435 |
T13463 |
T13462 |
amod |
small,hole |
| R9436 |
T13464 |
T13462 |
prep |
in,hole |
| R9437 |
T13465 |
T13466 |
det |
the,capsule |
| R9438 |
T13466 |
T13464 |
pobj |
capsule,in |
| R9439 |
T13467 |
T13466 |
compound |
testis,capsule |
| R9440 |
T13468 |
T13469 |
prep |
through,inserted |
| R9441 |
T13469 |
T13462 |
relcl |
inserted,hole |
| R9442 |
T13470 |
T13468 |
pobj |
which,through |
| R9443 |
T13471 |
T13472 |
det |
a,piece |
| R9444 |
T13472 |
T13469 |
nsubjpass |
piece,inserted |
| R9445 |
T13473 |
T13472 |
prep |
of,piece |
| R9446 |
T13474 |
T13475 |
amod |
dissected,skin |
| R9447 |
T13475 |
T13473 |
pobj |
skin,of |
| R9448 |
T13476 |
T13475 |
amod |
embryonic,skin |
| R9449 |
T13477 |
T13469 |
auxpass |
was,inserted |
| R9450 |
T13478 |
T13457 |
punct |
", ",used |
| R9451 |
T13479 |
T13480 |
det |
the,testes |
| R9452 |
T13480 |
T13481 |
nsubjpass |
testes,replaced |
| R9453 |
T13481 |
T13457 |
conj |
replaced,used |
| R9454 |
T13482 |
T13481 |
auxpass |
were,replaced |
| R9455 |
T13483 |
T13481 |
advmod |
then,replaced |
| R9456 |
T13484 |
T13481 |
prep |
into,replaced |
| R9457 |
T13485 |
T13486 |
det |
the,cavity |
| R9458 |
T13486 |
T13484 |
pobj |
cavity,into |
| R9459 |
T13487 |
T13486 |
amod |
abdominal,cavity |
| R9460 |
T13488 |
T13481 |
punct |
", ",replaced |
| R9461 |
T13489 |
T13481 |
cc |
and,replaced |
| R9462 |
T13490 |
T13491 |
det |
the,wound |
| R9463 |
T13491 |
T13492 |
nsubjpass |
wound,closed |
| R9464 |
T13492 |
T13481 |
conj |
closed,replaced |
| R9465 |
T13493 |
T13492 |
auxpass |
was,closed |
| R9466 |
T13494 |
T13492 |
prep |
in,closed |
| R9467 |
T13495 |
T13496 |
preconj |
both,wall |
| R9468 |
T13496 |
T13494 |
pobj |
wall,in |
| R9469 |
T13497 |
T13496 |
det |
the,wall |
| R9470 |
T13498 |
T13496 |
compound |
body,wall |
| R9471 |
T13499 |
T13496 |
cc |
and,wall |
| R9472 |
T13500 |
T13501 |
det |
the,skin |
| R9473 |
T13501 |
T13496 |
conj |
skin,wall |
| R9474 |
T13502 |
T13492 |
punct |
.,closed |
| R9475 |
T13504 |
T13505 |
prep |
After,sacrificed |
| R9476 |
T13506 |
T13507 |
nummod |
21,days |
| R9477 |
T13507 |
T13504 |
pobj |
days,After |
| R9478 |
T13508 |
T13505 |
punct |
", ",sacrificed |
| R9479 |
T13509 |
T13505 |
nsubjpass |
mice,sacrificed |
| R9480 |
T13510 |
T13511 |
dep |
that,received |
| R9481 |
T13511 |
T13509 |
relcl |
received,mice |
| R9482 |
T13512 |
T13511 |
dobj |
grafts,received |
| R9483 |
T13513 |
T13505 |
auxpass |
were,sacrificed |
| R9484 |
T13514 |
T13505 |
cc |
and,sacrificed |
| R9485 |
T13515 |
T13516 |
det |
the,hair |
| R9486 |
T13516 |
T13518 |
nsubjpass |
hair,dissected |
| R9487 |
T13517 |
T13516 |
amod |
resulting,hair |
| R9488 |
T13518 |
T13505 |
conj |
dissected,sacrificed |
| R9489 |
T13519 |
T13518 |
auxpass |
was,dissected |
| R9490 |
T13520 |
T13518 |
prep |
from,dissected |
| R9491 |
T13521 |
T13522 |
det |
the,testes |
| R9492 |
T13522 |
T13520 |
pobj |
testes,from |
| R9493 |
T13523 |
T13518 |
cc |
and,dissected |
| R9494 |
T13524 |
T13518 |
conj |
examined,dissected |
| R9495 |
T13525 |
T13505 |
punct |
.,sacrificed |
| R9498 |
T13570 |
T13571 |
dep |
Fate,mapping |
| R9499 |
T13572 |
T13571 |
punct |
-,mapping |
| R9500 |
T13573 |
T13574 |
det |
the,frontier |
| R9501 |
T13574 |
T13571 |
dobj |
frontier,mapping |
| R9502 |
T13575 |
T13574 |
amod |
lateral,frontier |
| R9503 |
T13576 |
T13574 |
amod |
somitic,frontier |
| R9504 |
T13578 |
T13579 |
det |
The,transgene |
| R9505 |
T13579 |
T13583 |
nsubjpass |
transgene,expressed |
| R9506 |
T13580 |
T13581 |
compound |
Hoxb6,Cre |
| R9507 |
T13581 |
T13579 |
compound |
Cre,transgene |
| R9508 |
T13582 |
T13581 |
punct |
-,Cre |
| R9509 |
T13584 |
T13579 |
acl |
described,transgene |
| R9510 |
T13585 |
T13584 |
agent |
by,described |
| R9511 |
T13586 |
T13585 |
pobj |
Kuehn,by |
| R9512 |
T13587 |
T13586 |
cc |
and,Kuehn |
| R9513 |
T13588 |
T13586 |
conj |
colleagues,Kuehn |
| R9514 |
T13589 |
T13590 |
punct |
(,Lowe |
| R9515 |
T13590 |
T13584 |
meta |
Lowe,described |
| R9516 |
T13591 |
T13590 |
nmod |
et,Lowe |
| R9517 |
T13592 |
T13590 |
nmod |
al.,Lowe |
| R9518 |
T13593 |
T13590 |
nummod |
2000,Lowe |
| R9519 |
T13594 |
T13590 |
punct |
),Lowe |
| R9520 |
T13595 |
T13583 |
auxpass |
is,expressed |
| R9521 |
T13596 |
T13583 |
prep |
in,expressed |
| R9522 |
T13597 |
T13598 |
det |
the,plate |
| R9523 |
T13598 |
T13596 |
pobj |
plate,in |
| R9524 |
T13599 |
T13598 |
amod |
lateral,plate |
| R9525 |
T13600 |
T13598 |
cc |
but,plate |
| R9526 |
T13601 |
T13600 |
neg |
not,but |
| R9527 |
T13602 |
T13603 |
det |
the,mesoderm |
| R9528 |
T13603 |
T13598 |
conj |
mesoderm,plate |
| R9529 |
T13604 |
T13603 |
amod |
somitic,mesoderm |
| R9530 |
T13605 |
T13598 |
prep |
of,plate |
| R9531 |
T13606 |
T13607 |
det |
the,trunk |
| R9532 |
T13607 |
T13605 |
pobj |
trunk,of |
| R9533 |
T13608 |
T13583 |
punct |
", ",expressed |
| R9534 |
T13609 |
T13583 |
advcl |
beginning,expressed |
| R9535 |
T13610 |
T13609 |
prep |
at,beginning |
| R9536 |
T13611 |
T13610 |
pobj |
E9.5,at |
| R9537 |
T13612 |
T13583 |
punct |
.,expressed |
| R9538 |
T13614 |
T13615 |
nsubjpass |
Animals,used |
| R9539 |
T13616 |
T13617 |
advmod |
doubly,heterozygous |
| R9540 |
T13617 |
T13614 |
amod |
heterozygous,Animals |
| R9541 |
T13618 |
T13617 |
prep |
for,heterozygous |
| R9542 |
T13619 |
T13620 |
det |
this,transgene |
| R9543 |
T13620 |
T13618 |
pobj |
transgene,for |
| R9544 |
T13621 |
T13620 |
cc |
and,transgene |
| R9545 |
T13622 |
T13623 |
det |
the,gene |
| R9546 |
T13623 |
T13620 |
conj |
gene,transgene |
| R9547 |
T13624 |
T13623 |
compound |
R26R,gene |
| R9548 |
T13625 |
T13623 |
compound |
reporter,gene |
| R9549 |
T13626 |
T13615 |
auxpass |
were,used |
| R9550 |
T13627 |
T13615 |
prep |
as,used |
| R9551 |
T13628 |
T13629 |
det |
a,source |
| R9552 |
T13629 |
T13627 |
pobj |
source,as |
| R9553 |
T13630 |
T13629 |
prep |
of,source |
| R9554 |
T13631 |
T13632 |
amod |
whole,skin |
| R9555 |
T13632 |
T13630 |
pobj |
skin,of |
| R9556 |
T13633 |
T13615 |
prep |
at,used |
| R9557 |
T13634 |
T13633 |
pobj |
P1.5,at |
| R9558 |
T13635 |
T13634 |
cc |
or,P1.5 |
| R9559 |
T13636 |
T13634 |
conj |
P4.5,P1.5 |
| R9560 |
T13637 |
T13615 |
punct |
.,used |
| R9561 |
T13639 |
T13640 |
compound |
Skin,sections |
| R9562 |
T13640 |
T13641 |
nsubjpass |
sections,prepared |
| R9563 |
T13642 |
T13640 |
amod |
parallel,sections |
| R9564 |
T13643 |
T13642 |
prep |
to,parallel |
| R9565 |
T13644 |
T13645 |
det |
the,axis |
| R9566 |
T13645 |
T13643 |
pobj |
axis,to |
| R9567 |
T13646 |
T13645 |
amod |
dorsoventral,axis |
| R9568 |
T13647 |
T13641 |
auxpass |
were,prepared |
| R9569 |
T13648 |
T13641 |
prep |
with,prepared |
| R9570 |
T13649 |
T13650 |
det |
a,incision |
| R9571 |
T13650 |
T13648 |
pobj |
incision,with |
| R9572 |
T13651 |
T13650 |
amod |
single,incision |
| R9573 |
T13652 |
T13650 |
prep |
along,incision |
| R9574 |
T13653 |
T13654 |
det |
the,midline |
| R9575 |
T13654 |
T13652 |
pobj |
midline,along |
| R9576 |
T13655 |
T13654 |
amod |
ventral,midline |
| R9577 |
T13656 |
T13641 |
cc |
and,prepared |
| R9578 |
T13657 |
T13641 |
conj |
stained,prepared |
| R9579 |
T13658 |
T13657 |
prep |
for,stained |
| R9580 |
T13659 |
T13660 |
compound |
β,galactosidase |
| R9581 |
T13660 |
T13662 |
compound |
galactosidase,activity |
| R9582 |
T13661 |
T13660 |
punct |
-,galactosidase |
| R9583 |
T13662 |
T13658 |
pobj |
activity,for |
| R9584 |
T13663 |
T13657 |
advcl |
using,stained |
| R9585 |
T13664 |
T13665 |
amod |
standard,protocols |
| R9586 |
T13665 |
T13663 |
dobj |
protocols,using |
| R9587 |
T13666 |
T13657 |
prep |
at,stained |
| R9588 |
T13667 |
T13668 |
compound |
room,temperature |
| R9589 |
T13668 |
T13666 |
pobj |
temperature,at |
| R9590 |
T13669 |
T13641 |
punct |
.,prepared |
| R9591 |
T13671 |
T13672 |
det |
The,sample |
| R9592 |
T13672 |
T13674 |
nsubjpass |
sample,stained |
| R9593 |
T13673 |
T13672 |
compound |
P1.5,sample |
| R9594 |
T13675 |
T13674 |
auxpass |
was,stained |
| R9595 |
T13676 |
T13674 |
advmod |
overnight,stained |
| R9596 |
T13677 |
T13674 |
cc |
and,stained |
| R9597 |
T13678 |
T13679 |
det |
the,samples |
| R9598 |
T13679 |
T13681 |
nsubjpass |
samples,stained |
| R9599 |
T13680 |
T13679 |
compound |
P4.5,samples |
| R9600 |
T13681 |
T13674 |
conj |
stained,stained |
| R9601 |
T13682 |
T13681 |
auxpass |
were,stained |
| R9602 |
T13683 |
T13681 |
prep |
for,stained |
| R9603 |
T13684 |
T13685 |
nummod |
5.5,h |
| R9604 |
T13685 |
T13683 |
pobj |
h,for |
| R9605 |
T13686 |
T13681 |
punct |
.,stained |
| R9606 |
T13688 |
T13689 |
amod |
Similar,sections |
| R9607 |
T13689 |
T13692 |
nsubjpass |
sections,prepared |
| R9608 |
T13690 |
T13689 |
amod |
nonstained,sections |
| R9609 |
T13691 |
T13689 |
compound |
skin,sections |
| R9610 |
T13693 |
T13692 |
auxpass |
were,prepared |
| R9611 |
T13694 |
T13692 |
prep |
from,prepared |
| R9612 |
T13695 |
T13694 |
pobj |
animals,from |
| R9613 |
T13696 |
T13695 |
acl |
carrying,animals |
| R9614 |
T13697 |
T13698 |
det |
the,allele |
| R9615 |
T13698 |
T13696 |
dobj |
allele,carrying |
| R9616 |
T13699 |
T13698 |
compound |
at,allele |
| R9617 |
T13700 |
T13692 |
punct |
.,prepared |
| R9618 |
T13702 |
T13703 |
nsubjpass |
Images,aligned |
| R9619 |
T13704 |
T13702 |
prep |
of,Images |
| R9620 |
T13705 |
T13706 |
det |
the,fragments |
| R9621 |
T13706 |
T13704 |
pobj |
fragments,of |
| R9622 |
T13707 |
T13706 |
amod |
different,fragments |
| R9623 |
T13708 |
T13706 |
compound |
skin,fragments |
| R9624 |
T13709 |
T13703 |
auxpass |
were,aligned |
| R9625 |
T13710 |
T13703 |
cc |
and,aligned |
| R9626 |
T13711 |
T13703 |
conj |
scaled,aligned |
| R9627 |
T13712 |
T13703 |
punct |
", ",aligned |
| R9628 |
T13713 |
T13703 |
cc |
and,aligned |
| R9629 |
T13714 |
T13715 |
det |
the,position |
| R9630 |
T13715 |
T13717 |
nsubjpass |
position,measured |
| R9631 |
T13716 |
T13715 |
amod |
relative,position |
| R9632 |
T13717 |
T13703 |
conj |
measured,aligned |
| R9633 |
T13718 |
T13715 |
prep |
of,position |
| R9634 |
T13719 |
T13720 |
det |
the,plate |
| R9635 |
T13720 |
T13718 |
pobj |
plate,of |
| R9636 |
T13721 |
T13722 |
npadvmod |
somite,lateral |
| R9637 |
T13722 |
T13720 |
amod |
lateral,plate |
| R9638 |
T13723 |
T13722 |
punct |
–,lateral |
| R9639 |
T13724 |
T13720 |
cc |
and,plate |
| R9640 |
T13725 |
T13726 |
det |
the,boundaries |
| R9641 |
T13726 |
T13720 |
conj |
boundaries,plate |
| R9642 |
T13727 |
T13726 |
compound |
pigmentation,boundaries |
| R9643 |
T13728 |
T13717 |
auxpass |
were,measured |
| R9644 |
T13729 |
T13717 |
advcl |
using,measured |
| R9645 |
T13730 |
T13729 |
dobj |
ImageJ,using |
| R9646 |
T13731 |
T13717 |
punct |
.,measured |
| R9096 |
T12990 |
T12989 |
pobj |
Russ,in |
| R9097 |
T12991 |
T12992 |
advmod |
et,al. |
| R9098 |
T12992 |
T12990 |
advmod |
al.,Russ |
| R4 |
T175 |
T174 |
compound |
Mouse,Coat |
| R12 |
T185 |
T184 |
compound |
animal,kingdom |
| R15 |
T188 |
T186 |
cc |
or,coat |
| R16 |
T189 |
T190 |
compound |
skin,color |
| R17 |
T190 |
T186 |
conj |
color,coat |
| R21 |
T194 |
T193 |
amod |
dorsoventral,axis |
| R38 |
T213 |
T214 |
det |
a,mutation |
| R42 |
T217 |
T214 |
punct |
", ",mutation |
| R43 |
T218 |
T219 |
amod |
droopy,ear |
| R44 |
T219 |
T214 |
appos |
ear,mutation |
| R45 |
T220 |
T219 |
punct |
(,ear |
| R46 |
T221 |
T219 |
appos |
deH,ear |
| R47 |
T222 |
T219 |
punct |
),ear |
| R48 |
T223 |
T212 |
punct |
", ",affects |
| R51 |
T226 |
T225 |
compound |
skin,characteristics |
| R60 |
T235 |
T234 |
compound |
Agouti,gene |
| R64 |
T240 |
T238 |
acl |
carrying,Mice |
| R65 |
T241 |
T242 |
det |
the,allele |
| R68 |
T244 |
T242 |
appos |
black,allele |
| R69 |
T245 |
T244 |
punct |
-,black |
| R70 |
T246 |
T244 |
cc |
and,black |
| R71 |
T247 |
T248 |
punct |
-,tan |
| R72 |
T248 |
T244 |
conj |
tan,black |
| R73 |
T249 |
T244 |
punct |
(,black |
| R74 |
T250 |
T244 |
appos |
at,black |
| R75 |
T251 |
T239 |
punct |
),have |
| R76 |
T252 |
T239 |
advmod |
normally,have |
| R79 |
T256 |
T255 |
amod |
sharp,boundary |
| R83 |
T260 |
T259 |
amod |
black,hair |
| R87 |
T264 |
T263 |
amod |
ventral,hair |
| R91 |
T268 |
T267 |
compound |
deH,mutation |
| R94 |
T271 |
T270 |
compound |
pigmentation,boundary |
| R99 |
T276 |
T275 |
amod |
apparent,transformation |
| R100 |
T277 |
T275 |
amod |
dorsal,transformation |
| R101 |
T278 |
T277 |
punct |
-,dorsal |
| R102 |
T279 |
T277 |
prep |
to,dorsal |
| R103 |
T280 |
T279 |
punct |
-,to |
| R104 |
T281 |
T279 |
amod |
ventral,to |
| R109 |
T288 |
T289 |
nummod |
216,kb |
| R110 |
T289 |
T287 |
compound |
kb,deletion |
| R119 |
T298 |
T297 |
amod |
first,exon |
| R123 |
T302 |
T301 |
compound |
Tbx15,gene |
| R127 |
T306 |
T305 |
amod |
embryonic,expression |
| R129 |
T308 |
T305 |
prep |
in,expression |
| R130 |
T309 |
T310 |
amod |
developing,mesenchyme |
| R131 |
T310 |
T308 |
pobj |
mesenchyme,in |
| R135 |
T314 |
T312 |
cc |
and,pigmentary |
| R136 |
T315 |
T312 |
conj |
skeletal,pigmentary |
| R141 |
T320 |
T319 |
punct |
/,deH |
| R148 |
T329 |
T328 |
amod |
targeted,allele |
| R153 |
T334 |
T335 |
det |
the,phenotype |
| R156 |
T337 |
T333 |
auxpass |
was,caused |
| R167 |
T349 |
T347 |
prep |
of,expression |
| R168 |
T350 |
T349 |
pobj |
Tbx15,of |
| R169 |
T351 |
T347 |
prep |
in,expression |
| R170 |
T352 |
T353 |
amod |
dorsal,mesenchyme |
| R171 |
T353 |
T351 |
pobj |
mesenchyme,in |
| R202 |
T387 |
T388 |
amod |
positional,identity |
| R1609 |
T2605 |
T2606 |
amod |
differentiated,state |
| R1610 |
T2606 |
T2601 |
conj |
state,number |
| R1611 |
T2607 |
T2601 |
prep |
of,number |
| R1612 |
T2608 |
T2609 |
compound |
pigment,cells |
| R1613 |
T2609 |
T2607 |
pobj |
cells,of |
| R1614 |
T2610 |
T2601 |
punct |
", ",number |
| R1615 |
T2611 |
T2612 |
advmod |
as,as |
| R1618 |
T2614 |
T2615 |
det |
the,type |
| R1619 |
T2615 |
T2601 |
conj |
type,number |
| R1620 |
T2616 |
T2615 |
prep |
of,type |
| R1621 |
T2617 |
T2616 |
pobj |
pigment,of |
| R1622 |
T2618 |
T2615 |
acl |
synthesized,type |
| R1623 |
T2619 |
T2618 |
prep |
in,synthesized |
| R1624 |
T2620 |
T2619 |
pobj |
response,in |
| R1625 |
T2621 |
T2620 |
prep |
to,response |
| R1626 |
T2622 |
T2621 |
pobj |
expression,to |
| R1627 |
T2623 |
T2622 |
prep |
of,expression |
| R1628 |
T2624 |
T2623 |
pobj |
Agouti,of |
| R1629 |
T2625 |
T2591 |
punct |
.,represent |
| R1630 |
T2627 |
T2628 |
prep |
In,vary |
| R1631 |
T2629 |
T2627 |
amod |
particular,In |
| R1632 |
T2630 |
T2628 |
punct |
", ",vary |
| R1633 |
T2631 |
T2632 |
amod |
ventral,hair |
| R1634 |
T2632 |
T2628 |
nsubj |
hair,vary |
| R1635 |
T2633 |
T2632 |
prep |
of,hair |
| R1636 |
T2634 |
T2635 |
compound |
at,at |
| R1639 |
T2637 |
T2633 |
pobj |
animals,of |
| R1640 |
T2638 |
T2628 |
aux |
can,vary |
| R1641 |
T2639 |
T2628 |
prep |
from,vary |
| R1642 |
T2640 |
T2641 |
npadvmod |
cream,colored |
| R1645 |
T2643 |
T2639 |
prep |
to,from |
| R1646 |
T2644 |
T2645 |
amod |
reddish,yellow |
| R1649 |
T2647 |
T2628 |
prep |
depending,vary |
| R1650 |
T2648 |
T2647 |
prep |
on,depending |
| R1651 |
T2649 |
T2648 |
pobj |
age,on |
| R1652 |
T2650 |
T2649 |
punct |
", ",age |
| R1653 |
T2651 |
T2652 |
compound |
strain,background |
| R1654 |
T2652 |
T2649 |
conj |
background,age |
| R1655 |
T2653 |
T2652 |
punct |
", ",background |
| R1656 |
T2654 |
T2652 |
cc |
and,background |
| R1657 |
T2655 |
T2652 |
conj |
position,background |
| R1658 |
T2656 |
T2655 |
prep |
along,position |
| R1659 |
T2657 |
T2658 |
det |
the,axis |
| R1662 |
T2660 |
T2628 |
punct |
.,vary |
| R1663 |
T2662 |
T2663 |
aux |
To,evaluate |
| R1664 |
T2663 |
T2664 |
advcl |
evaluate,compared |
| R1665 |
T2665 |
T2666 |
det |
the,relationship |
| R1666 |
T2666 |
T2663 |
dobj |
relationship,evaluate |
| R1667 |
T2667 |
T2666 |
prep |
among,relationship |
| R1668 |
T2668 |
T2669 |
det |
these,components |
| R1669 |
T2669 |
T2667 |
pobj |
components,among |
| R1670 |
T2670 |
T2664 |
punct |
", ",compared |
| R1671 |
T2671 |
T2664 |
nsubj |
we,compared |
| R1672 |
T2672 |
T2673 |
poss |
their,features |
| R1673 |
T2673 |
T2664 |
dobj |
features,compared |
| R1674 |
T2674 |
T2664 |
prep |
among,compared |
| R1675 |
T2675 |
T2674 |
pobj |
mice,among |
| R1676 |
T2676 |
T2675 |
prep |
of,mice |
| R1677 |
T2677 |
T2678 |
amod |
different,genotypes |
| R1680 |
T2680 |
T2664 |
punct |
.,compared |
| R1681 |
T2682 |
T2683 |
amod |
Semiquantitative,measurements |
| R1682 |
T2683 |
T2684 |
nsubj |
measurements,reveal |
| R1683 |
T2685 |
T2683 |
prep |
of,measurements |
| R1684 |
T2686 |
T2687 |
compound |
hair,length |
| R1685 |
T2687 |
T2685 |
pobj |
length,of |
| R1686 |
T2688 |
T2683 |
acl |
plotted,measurements |
| R1687 |
T2689 |
T2688 |
prep |
as,plotted |
| R1688 |
T2690 |
T2691 |
det |
a,function |
| R1689 |
T2691 |
T2689 |
pobj |
function,as |
| R1690 |
T2692 |
T2691 |
prep |
of,function |
| R1691 |
T2693 |
T2694 |
amod |
dorsoventral,position |
| R1692 |
T2694 |
T2692 |
pobj |
position,of |
| R1693 |
T2695 |
T2696 |
mark |
that,coincides |
| R1707 |
T2709 |
T2711 |
compound |
at,mice |
| R1710 |
T2712 |
T2696 |
prep |
with,coincides |
| R1711 |
T2713 |
T2714 |
det |
a,change |
| R1715 |
T2717 |
T2714 |
prep |
in,change |
| R1716 |
T2718 |
T2719 |
preconj |
both,color |
| R1719 |
T2721 |
T2719 |
cc |
and,color |
| R1720 |
T2722 |
T2723 |
compound |
hair,length |
| R1721 |
T2723 |
T2719 |
conj |
length,color |
| R1722 |
T2724 |
T2725 |
punct |
(,1A |
| R1725 |
T2727 |
T2728 |
punct |
–,1D |
| R1726 |
T2728 |
T2725 |
prep |
1D,1A |
| R1727 |
T2729 |
T2725 |
punct |
),1A |
| R1728 |
T2730 |
T2684 |
punct |
.,reveal |
| R1729 |
T2732 |
T2733 |
prep |
Within,become |
| R1730 |
T2734 |
T2735 |
det |
the,region |
| R1731 |
T2735 |
T2732 |
pobj |
region,Within |
| R1732 |
T2736 |
T2735 |
prep |
of,region |
| R1733 |
T2737 |
T2736 |
pobj |
transition,of |
| R1734 |
T2738 |
T2737 |
prep |
from,transition |
| R1735 |
T2739 |
T2738 |
pobj |
dorsum,from |
| R1736 |
T2740 |
T2737 |
prep |
to,transition |
| R1737 |
T2741 |
T2740 |
pobj |
ventrum,to |
| R1738 |
T2742 |
T2743 |
punct |
(,Figure |
| R1832 |
T2842 |
T2843 |
amod |
different,age |
| R1833 |
T2843 |
T2841 |
pobj |
age,of |
| R1834 |
T2844 |
T2843 |
punct |
", ",age |
| R1835 |
T2845 |
T2843 |
conj |
size,age |
| R1836 |
T2846 |
T2845 |
punct |
", ",size |
| R1837 |
T2847 |
T2845 |
cc |
and,size |
| R1838 |
T2848 |
T2849 |
compound |
Agouti,genotype |
| R1839 |
T2849 |
T2845 |
conj |
genotype,size |
| R1840 |
T2850 |
T2832 |
advmod |
also,are |
| R1841 |
T2851 |
T2852 |
advmod |
very,similar |
| R1842 |
T2852 |
T2832 |
acomp |
similar,are |
| R1843 |
T2853 |
T2854 |
advmod |
when,normalized |
| R1844 |
T2854 |
T2832 |
advcl |
normalized,are |
| R1845 |
T2855 |
T2854 |
prep |
to,normalized |
| R1846 |
T2856 |
T2857 |
compound |
body,circumference |
| R1847 |
T2857 |
T2855 |
pobj |
circumference,to |
| R1848 |
T2858 |
T2859 |
punct |
(,Figure |
| R1960 |
T2978 |
T2976 |
nmod |
al.,Forsthoefel |
| R1961 |
T2979 |
T2976 |
nummod |
1966,Forsthoefel |
| R1962 |
T2980 |
T2976 |
punct |
),Forsthoefel |
| R1963 |
T2981 |
T2962 |
punct |
", ",disappear |
| R1964 |
T2982 |
T2962 |
cc |
and,disappear |
| R1965 |
T2983 |
T2962 |
punct |
", ",disappear |
| R1966 |
T2984 |
T2985 |
advmod |
overall,is |
| R1973 |
T2991 |
T2989 |
pobj |
types,of |
| R1975 |
T2993 |
T2994 |
advmod |
also,similar |
| R1976 |
T2994 |
T2985 |
acomp |
similar,is |
| R1977 |
T2995 |
T2985 |
prep |
in,is |
| R1978 |
T2996 |
T2995 |
pobj |
dorsa,in |
| R1979 |
T2997 |
T2996 |
cc |
and,dorsa |
| R1980 |
T2998 |
T2996 |
conj |
ventra,dorsa |
| R1981 |
T2999 |
T2996 |
prep |
of,dorsa |
| R1982 |
T3000 |
T3001 |
amod |
adult,mice |
| R1983 |
T3001 |
T2999 |
pobj |
mice,of |
| R1984 |
T3002 |
T2985 |
punct |
.,is |
| R1985 |
T3004 |
T3005 |
prep |
In,observed |
| R1986 |
T3006 |
T3007 |
npadvmod |
age,matched |
| R1991 |
T3011 |
T3005 |
punct |
", ",observed |
| R1992 |
T3012 |
T3005 |
nsubj |
we,observed |
| R1993 |
T3013 |
T3014 |
det |
a,decrease |
| R1996 |
T3016 |
T3014 |
prep |
in,decrease |
| R1997 |
T3017 |
T3018 |
det |
the,ratio |
| R1998 |
T3018 |
T3016 |
pobj |
ratio,in |
| R1999 |
T3019 |
T3018 |
prep |
of,ratio |
| R2000 |
T3020 |
T3021 |
compound |
undercoat,hairs |
| R2001 |
T3021 |
T3019 |
pobj |
hairs,of |
| R2002 |
T3022 |
T3023 |
punct |
(,zigzags |
| R2119 |
T3143 |
T3144 |
det |
an,indicator |
| R2120 |
T3144 |
T3142 |
pobj |
indicator,as |
| R2121 |
T3145 |
T3144 |
prep |
of,indicator |
| R2122 |
T3146 |
T3147 |
compound |
tyrosinase,activity |
| R2123 |
T3147 |
T3145 |
pobj |
activity,of |
| R2124 |
T3148 |
T3139 |
punct |
", ",observed |
| R2125 |
T3149 |
T3139 |
nsubj |
we,observed |
| R2126 |
T3150 |
T3151 |
det |
a,transition |
| R2130 |
T3154 |
T3139 |
prep |
in,observed |
| R2131 |
T3155 |
T3156 |
amod |
isolated,preparations |
| R2134 |
T3158 |
T3156 |
prep |
from,preparations |
| R2135 |
T3159 |
T3160 |
compound |
P4.5,mice |
| R2138 |
T3162 |
T3160 |
compound |
ae,mice |
| R2140 |
T3164 |
T3165 |
punct |
(,Figure |
| R2247 |
T3279 |
T3273 |
dative |
dorsal,distinguish |
| R2248 |
T3280 |
T3273 |
prep |
from,distinguish |
| R2249 |
T3281 |
T3280 |
pobj |
ventral,from |
| R2250 |
T3282 |
T3273 |
dobj |
skin,distinguish |
| R2251 |
T3283 |
T3273 |
punct |
: ,distinguish |
| R2252 |
T3284 |
T3273 |
dobj |
differences,distinguish |
| R2253 |
T3285 |
T3284 |
prep |
in,differences |
| R2254 |
T3286 |
T3287 |
compound |
pigment,type |
| R2257 |
T3289 |
T3285 |
pobj |
synthesis,in |
| R2258 |
T3290 |
T3284 |
punct |
(,differences |
| R2259 |
T3291 |
T3284 |
prep |
depending,differences |
| R2260 |
T3292 |
T3291 |
prep |
on,depending |
| R2261 |
T3293 |
T3294 |
compound |
Agouti,genotype |
| R2262 |
T3294 |
T3292 |
pobj |
genotype,on |
| R2263 |
T3295 |
T3284 |
punct |
),differences |
| R2264 |
T3296 |
T3284 |
punct |
", ",differences |
| R2265 |
T3297 |
T3284 |
conj |
differences,differences |
| R2266 |
T3298 |
T3297 |
prep |
in,differences |
| R2267 |
T3299 |
T3300 |
compound |
hair,length |
| R2268 |
T3300 |
T3298 |
pobj |
length,in |
| R2269 |
T3301 |
T3297 |
punct |
", ",differences |
| R2270 |
T3302 |
T3297 |
cc |
and,differences |
| R2271 |
T3303 |
T3297 |
conj |
differences,differences |
| R2272 |
T3304 |
T3303 |
prep |
in,differences |
| R2273 |
T3305 |
T3306 |
compound |
melanin,content |
| R2274 |
T3306 |
T3304 |
pobj |
content,in |
| R2275 |
T3307 |
T3273 |
punct |
.,distinguish |
| R2283 |
T3541 |
T3539 |
pobj |
Mutation,by |
| R2352 |
T3614 |
T3612 |
attr |
characteristic,are |
| R2371 |
T3633 |
T3629 |
conj |
area,fissures |
| R2587 |
T3857 |
T3855 |
pobj |
stripe,as |
| R2622 |
T3892 |
T3883 |
conj |
region,boundary |
| R2627 |
T3897 |
T3892 |
relcl |
reduced,region |
| R2756 |
T4032 |
T4029 |
dobj |
characteristics,affects |
| R2781 |
T4058 |
T4061 |
ccomp |
causes,is |
| R431 |
T1103 |
T1104 |
prep |
Among,are |
| R432 |
T1105 |
T1103 |
pobj |
these,Among |
| R433 |
T1106 |
T1104 |
punct |
", ",are |
| R434 |
T1107 |
T1108 |
compound |
pigment,patterns |
| R435 |
T1108 |
T1104 |
nsubj |
patterns,are |
| R436 |
T1109 |
T1110 |
det |
an,system |
| R439 |
T1112 |
T1113 |
aux |
to,investigate |
| R440 |
T1113 |
T1110 |
advcl |
investigate,system |
| R441 |
T1114 |
T1115 |
advmod |
how,arise |
| R445 |
T1118 |
T1115 |
punct |
", ",arise |
| R446 |
T1119 |
T1120 |
preconj |
both,for |
| R447 |
T1120 |
T1115 |
prep |
for,arise |
| R448 |
T1121 |
T1122 |
amod |
different,regions |
| R449 |
T1122 |
T1120 |
pobj |
regions,for |
| R450 |
T1123 |
T1122 |
prep |
of,regions |
| R451 |
T1124 |
T1125 |
det |
the,body |
| R452 |
T1125 |
T1123 |
pobj |
body,of |
| R453 |
T1126 |
T1122 |
prep |
within,regions |
| R454 |
T1127 |
T1128 |
det |
a,species |
| R455 |
T1128 |
T1126 |
pobj |
species,within |
| R456 |
T1129 |
T1120 |
cc |
and,for |
| R457 |
T1130 |
T1120 |
conj |
for,for |
| R458 |
T1131 |
T1132 |
amod |
different,animals |
| R459 |
T1132 |
T1130 |
pobj |
animals,for |
| R460 |
T1133 |
T1132 |
prep |
from,animals |
| R461 |
T1134 |
T1135 |
advmod |
closely,related |
| R462 |
T1135 |
T1136 |
amod |
related,species |
| R463 |
T1136 |
T1133 |
pobj |
species,from |
| R464 |
T1137 |
T1104 |
punct |
.,are |
| R465 |
T1139 |
T1140 |
prep |
In,is |
| R472 |
T1147 |
T1148 |
det |
a,mechanism |
| R476 |
T1151 |
T1148 |
prep |
for,mechanism |
| R477 |
T1152 |
T1151 |
pobj |
recognition,for |
| R478 |
T1153 |
T1152 |
punct |
", ",recognition |
| R479 |
T1154 |
T1152 |
conj |
camouflage,recognition |
| R480 |
T1155 |
T1154 |
punct |
", ",camouflage |
| R481 |
T1156 |
T1154 |
cc |
or,camouflage |
| R482 |
T1157 |
T1154 |
conj |
both,camouflage |
| R483 |
T1158 |
T1146 |
punct |
;,characterized |
| R484 |
T1159 |
T1146 |
advmod |
consequently,characterized |
| R485 |
T1160 |
T1146 |
punct |
", ",characterized |
| R486 |
T1161 |
T1162 |
det |
a,number |
| R489 |
T1164 |
T1162 |
prep |
of,number |
| R490 |
T1165 |
T1166 |
compound |
pigment,patterns |
| R491 |
T1166 |
T1164 |
pobj |
patterns,of |
| R492 |
T1167 |
T1146 |
aux |
have,characterized |
| R493 |
T1168 |
T1146 |
auxpass |
been,characterized |
| R494 |
T1169 |
T1146 |
prep |
from,characterized |
| R495 |
T1170 |
T1171 |
det |
an,perspective |
| R500 |
T1175 |
T1176 |
punct |
(,Boughman |
| R501 |
T1176 |
T1146 |
meta |
Boughman,characterized |
| R502 |
T1177 |
T1176 |
nummod |
2001,Boughman |
| R503 |
T1178 |
T1176 |
punct |
;,Boughman |
| R504 |
T1179 |
T1176 |
nmod |
Jiggins,Boughman |
| R505 |
T1180 |
T1176 |
nmod |
et,Boughman |
| R506 |
T1181 |
T1176 |
nmod |
al.,Boughman |
| R507 |
T1182 |
T1176 |
nummod |
2001,Boughman |
| R508 |
T1183 |
T1176 |
punct |
),Boughman |
| R509 |
T1184 |
T1146 |
punct |
.,characterized |
| R510 |
T1186 |
T1187 |
prep |
In,been |
| R511 |
T1188 |
T1189 |
det |
the,laboratory |
| R512 |
T1189 |
T1186 |
pobj |
laboratory,In |
| R513 |
T1190 |
T1187 |
punct |
", ",been |
| R514 |
T1191 |
T1192 |
compound |
color,variation |
| R515 |
T1192 |
T1187 |
nsubj |
variation,been |
| R516 |
T1193 |
T1187 |
aux |
has,been |
| R517 |
T1194 |
T1195 |
det |
the,subject |
| R518 |
T1195 |
T1187 |
attr |
subject,been |
| R519 |
T1196 |
T1195 |
prep |
of,subject |
| R520 |
T1197 |
T1198 |
compound |
vertebrate,genetics |
| R521 |
T1198 |
T1196 |
pobj |
genetics,of |
| R522 |
T1199 |
T1187 |
prep |
for,been |
| R523 |
T1200 |
T1201 |
amod |
more,a |
| R526 |
T1203 |
T1199 |
pobj |
century,for |
| R527 |
T1204 |
T1205 |
punct |
(,Searle |
| R528 |
T1205 |
T1187 |
meta |
Searle,been |
| R529 |
T1206 |
T1205 |
nummod |
1968,Searle |
| R530 |
T1207 |
T1205 |
punct |
;,Searle |
| R531 |
T1208 |
T1205 |
nmod |
Silvers,Searle |
| R532 |
T1209 |
T1205 |
nummod |
1979,Searle |
| R533 |
T1210 |
T1205 |
punct |
),Searle |
| R534 |
T1211 |
T1187 |
punct |
", ",been |
| R535 |
T1212 |
T1187 |
cc |
and,been |
| R536 |
T1213 |
T1214 |
amod |
many,components |
| R542 |
T1219 |
T1220 |
poss |
whose,actions |
| R543 |
T1220 |
T1221 |
dep |
actions,understood |
| R546 |
T1223 |
T1221 |
prep |
in,understood |
| R547 |
T1224 |
T1225 |
det |
a,context |
| R552 |
T1229 |
T1226 |
conj |
based,cellular |
| R554 |
T1231 |
T1232 |
punct |
(,reviewed |
| R640 |
T1323 |
T1319 |
punct |
;,Furumura |
| R641 |
T1324 |
T1319 |
appos |
Barsh,Furumura |
| R642 |
T1325 |
T1326 |
advmod |
et,al. |
| R643 |
T1326 |
T1324 |
advmod |
al.,Barsh |
| R644 |
T1327 |
T1324 |
npadvmod |
2000,Barsh |
| R645 |
T1328 |
T1317 |
punct |
),reviewed |
| R646 |
T1329 |
T1291 |
punct |
.,control |
| R647 |
T1331 |
T1332 |
advmod |
Finally,makes |
| R648 |
T1333 |
T1332 |
punct |
", ",makes |
| R649 |
T1334 |
T1332 |
nsubj |
movement,makes |
| R650 |
T1335 |
T1334 |
prep |
of,movement |
| R651 |
T1336 |
T1337 |
compound |
pigment,granules |
| R652 |
T1337 |
T1335 |
pobj |
granules,of |
| R653 |
T1338 |
T1334 |
prep |
within,movement |
| R654 |
T1339 |
T1338 |
pobj |
melanocytes,within |
| R655 |
T1340 |
T1338 |
cc |
or,within |
| R656 |
T1341 |
T1338 |
conj |
from,within |
| R657 |
T1342 |
T1341 |
pobj |
melanocytes,from |
| R658 |
T1343 |
T1341 |
prep |
to,from |
| R659 |
T1344 |
T1343 |
pobj |
keratinocytes,to |
| R660 |
T1345 |
T1332 |
dobj |
use,makes |
| R661 |
T1346 |
T1332 |
prep |
of,makes |
| R662 |
T1347 |
T1348 |
amod |
cellular,machinery |
| R663 |
T1348 |
T1346 |
pobj |
machinery,of |
| R664 |
T1349 |
T1350 |
dep |
that,shared |
| R667 |
T1352 |
T1350 |
agent |
by,shared |
| R668 |
T1353 |
T1354 |
det |
a,variety |
| R669 |
T1354 |
T1352 |
pobj |
variety,by |
| R670 |
T1355 |
T1354 |
prep |
of,variety |
| R671 |
T1356 |
T1357 |
compound |
cell,types |
| R672 |
T1357 |
T1355 |
pobj |
types,of |
| R673 |
T1358 |
T1350 |
punct |
", ",shared |
| R674 |
T1359 |
T1350 |
cc |
but,shared |
| R675 |
T1360 |
T1361 |
dep |
that,vary |
| R678 |
T1363 |
T1361 |
prep |
in,vary |
| R679 |
T1364 |
T1365 |
amod |
different,regions |
| R680 |
T1365 |
T1363 |
pobj |
regions,in |
| R681 |
T1366 |
T1365 |
prep |
of,regions |
| R682 |
T1367 |
T1368 |
det |
the,body |
| R683 |
T1368 |
T1366 |
pobj |
body,of |
| R684 |
T1369 |
T1370 |
punct |
(,reviewed |
| R798 |
T1489 |
T1487 |
pobj |
color,in |
| R799 |
T1490 |
T1477 |
auxpass |
is,brought |
| R800 |
T1491 |
T1477 |
prt |
about,brought |
| R801 |
T1492 |
T1477 |
agent |
by,brought |
| R802 |
T1493 |
T1492 |
pobj |
differences,by |
| R803 |
T1494 |
T1493 |
prep |
in,differences |
| R804 |
T1495 |
T1496 |
compound |
pigment,type |
| R805 |
T1496 |
T1494 |
pobj |
type,in |
| R806 |
T1497 |
T1498 |
mark |
as,determined |
| R807 |
T1498 |
T1477 |
advcl |
determined,brought |
| R808 |
T1499 |
T1498 |
agent |
by,determined |
| R809 |
T1500 |
T1501 |
amod |
allelic,variation |
| R810 |
T1501 |
T1499 |
pobj |
variation,by |
| R811 |
T1502 |
T1501 |
prep |
of,variation |
| R812 |
T1503 |
T1504 |
det |
the,gene |
| R815 |
T1506 |
T1507 |
punct |
(,Bultman |
| R816 |
T1507 |
T1477 |
meta |
Bultman,brought |
| R817 |
T1508 |
T1507 |
nmod |
et,Bultman |
| R818 |
T1509 |
T1507 |
nmod |
al.,Bultman |
| R819 |
T1510 |
T1507 |
nummod |
1992,Bultman |
| R820 |
T1511 |
T1507 |
punct |
;,Bultman |
| R821 |
T1512 |
T1507 |
nmod |
Miller,Bultman |
| R822 |
T1513 |
T1507 |
nmod |
et,Bultman |
| R823 |
T1514 |
T1507 |
nmod |
al.,Bultman |
| R824 |
T1515 |
T1507 |
nummod |
1993,Bultman |
| R825 |
T1516 |
T1507 |
punct |
),Bultman |
| R826 |
T1517 |
T1477 |
punct |
.,brought |
| R827 |
T1519 |
T1520 |
advcl |
Secreted,causes |
| R828 |
T1521 |
T1519 |
agent |
by,Secreted |
| R829 |
T1522 |
T1523 |
amod |
dermal,cells |
| R832 |
T1525 |
T1519 |
prep |
within,Secreted |
| R833 |
T1526 |
T1527 |
det |
each,follicle |
| R836 |
T1529 |
T1530 |
punct |
(,Millar |
| R837 |
T1530 |
T1519 |
meta |
Millar,Secreted |
| R838 |
T1531 |
T1530 |
nmod |
et,Millar |
| R839 |
T1532 |
T1530 |
nmod |
al.,Millar |
| R840 |
T1533 |
T1530 |
nummod |
1995,Millar |
| R841 |
T1534 |
T1530 |
punct |
),Millar |
| R842 |
T1535 |
T1520 |
punct |
", ",causes |
| R843 |
T1536 |
T1537 |
compound |
Agouti,protein |
| R844 |
T1537 |
T1520 |
nsubj |
protein,causes |
| R845 |
T1538 |
T1539 |
nsubj |
melanocytes,switch |
| R851 |
T1544 |
T1539 |
prep |
from,switch |
| R852 |
T1545 |
T1546 |
det |
the,production |
| R853 |
T1546 |
T1544 |
pobj |
production,from |
| R854 |
T1547 |
T1546 |
prep |
of,production |
| R855 |
T1548 |
T1549 |
amod |
brown,black |
| R858 |
T1551 |
T1547 |
pobj |
eumelanin,of |
| R859 |
T1552 |
T1539 |
prep |
to,switch |
| R860 |
T1553 |
T1554 |
amod |
red,yellow |
| R863 |
T1556 |
T1552 |
pobj |
pheomelanin,to |
| R864 |
T1557 |
T1520 |
punct |
.,causes |
| R865 |
T1559 |
T1560 |
compound |
Agouti,protein |
| R866 |
T1560 |
T1561 |
nsubj |
protein,has |
| R867 |
T1561 |
T1562 |
ccomp |
has,thought |
| R868 |
T1563 |
T1564 |
det |
a,radius |
| R871 |
T1566 |
T1564 |
prep |
of,radius |
| R872 |
T1567 |
T1566 |
pobj |
action,of |
| R873 |
T1568 |
T1569 |
punct |
(,Silvers |
| R874 |
T1569 |
T1564 |
meta |
Silvers,radius |
| R875 |
T1570 |
T1569 |
cc |
and,Silvers |
| R876 |
T1571 |
T1569 |
conj |
Russel,Silvers |
| R877 |
T1572 |
T1571 |
nummod |
1955,Russel |
| R878 |
T1573 |
T1571 |
punct |
),Russel |
| R879 |
T1574 |
T1561 |
cc |
and,has |
| R880 |
T1575 |
T1576 |
aux |
can,switched |
| R883 |
T1578 |
T1576 |
prt |
on,switched |
| R884 |
T1579 |
T1578 |
cc |
and,on |
| R885 |
T1580 |
T1578 |
conj |
off,on |
| R886 |
T1581 |
T1576 |
prep |
during,switched |
| R887 |
T1582 |
T1583 |
det |
a,cycle |
| R891 |
T1586 |
T1587 |
punct |
(,Bultman |
| R892 |
T1587 |
T1576 |
meta |
Bultman,switched |
| R893 |
T1588 |
T1587 |
nmod |
et,Bultman |
| R894 |
T1589 |
T1587 |
nmod |
al.,Bultman |
| R895 |
T1590 |
T1587 |
nummod |
1992,Bultman |
| R896 |
T1591 |
T1587 |
punct |
", ",Bultman |
| R897 |
T1592 |
T1587 |
nummod |
1994,Bultman |
| R898 |
T1593 |
T1587 |
punct |
;,Bultman |
| R899 |
T1594 |
T1587 |
nmod |
Miller,Bultman |
| R900 |
T1595 |
T1587 |
nmod |
et,Bultman |
| R901 |
T1596 |
T1587 |
nmod |
al.,Bultman |
| R902 |
T1597 |
T1587 |
nummod |
1993,Bultman |
| R903 |
T1598 |
T1587 |
punct |
;,Bultman |
| R904 |
T1599 |
T1587 |
nmod |
Vrieling,Bultman |
| R905 |
T1600 |
T1587 |
nmod |
et,Bultman |
| R906 |
T1601 |
T1587 |
nmod |
al.,Bultman |
| R907 |
T1602 |
T1587 |
nummod |
1994,Bultman |
| R908 |
T1603 |
T1587 |
punct |
),Bultman |
| R909 |
T1604 |
T1562 |
punct |
;,thought |
| R910 |
T1605 |
T1562 |
advmod |
thus,thought |
| R911 |
T1606 |
T1562 |
punct |
", ",thought |
| R912 |
T1607 |
T1608 |
poss |
its,expression |
| R915 |
T1610 |
T1562 |
auxpass |
is,thought |
| R916 |
T1611 |
T1612 |
aux |
to,be |
| R917 |
T1612 |
T1562 |
xcomp |
be,thought |
| R918 |
T1613 |
T1612 |
acomp |
responsible,be |
| R919 |
T1614 |
T1613 |
prep |
for,responsible |
| R920 |
T1615 |
T1616 |
det |
the,surface |
| R923 |
T1618 |
T1616 |
amod |
colored,surface |
| R928 |
T1623 |
T1616 |
prep |
of,surface |
| R929 |
T1624 |
T1623 |
pobj |
mice,of |
| R930 |
T1625 |
T1624 |
acl |
carrying,mice |
| R931 |
T1626 |
T1627 |
det |
the,allele |
| R941 |
T1636 |
T1614 |
cc |
and,for |
| R942 |
T1637 |
T1614 |
conj |
for,for |
| R943 |
T1638 |
T1639 |
det |
the,markings |
| R946 |
T1641 |
T1639 |
prep |
around,markings |
| R947 |
T1642 |
T1643 |
det |
the,feet |
| R948 |
T1643 |
T1641 |
pobj |
feet,around |
| R949 |
T1644 |
T1643 |
punct |
", ",feet |
| R950 |
T1645 |
T1643 |
conj |
ears,feet |
| R951 |
T1646 |
T1645 |
punct |
", ",ears |
| R952 |
T1647 |
T1645 |
cc |
or,ears |
| R953 |
T1648 |
T1645 |
conj |
head,ears |
| R954 |
T1649 |
T1639 |
punct |
", ",markings |
| R955 |
T1650 |
T1651 |
advmod |
i.e.,points |
| R959 |
T1654 |
T1651 |
cc |
or,points |
| R960 |
T1655 |
T1656 |
compound |
head,spots |
| R961 |
T1656 |
T1651 |
conj |
spots,points |
| R962 |
T1657 |
T1639 |
punct |
", ",markings |
| R963 |
T1658 |
T1639 |
prep |
of,markings |
| R964 |
T1659 |
T1660 |
amod |
certain,breeds |
| R967 |
T1662 |
T1562 |
punct |
.,thought |
| R968 |
T1664 |
T1665 |
prep |
In,identified |
| R969 |
T1666 |
T1667 |
compound |
laboratory,mice |
| R970 |
T1667 |
T1664 |
pobj |
mice,In |
| R971 |
T1668 |
T1665 |
punct |
", ",identified |
| R972 |
T1669 |
T1670 |
amod |
previous,studies |
| R973 |
T1670 |
T1665 |
nsubj |
studies,identified |
| R974 |
T1671 |
T1670 |
prep |
from,studies |
| R1120 |
T1822 |
T1823 |
amod |
Ventral,specific |
| R1412 |
T2126 |
T2127 |
nsubj |
We,make |
| R1413 |
T2128 |
T2127 |
advmod |
also,make |
| R1414 |
T2129 |
T2127 |
dobj |
use,make |
| R1415 |
T2130 |
T2127 |
prep |
of,make |
| R1416 |
T2131 |
T2132 |
det |
a,mutation |
| R1467 |
T2239 |
T2240 |
det |
the,flank |
| R1468 |
T2240 |
T2238 |
pobj |
flank,of |
| R1470 |
T2241 |
T2240 |
amod |
developing,flank |
| R1471 |
T2242 |
T2223 |
punct |
.,suggest |
| R1473 |
T2244 |
T2245 |
det |
These,results |
| R1474 |
T2245 |
T2246 |
nsubj |
results,identify |
| R1475 |
T2247 |
T2248 |
det |
a,aspect |
| R1477 |
T2248 |
T2246 |
dobj |
aspect,identify |
| R1478 |
T2249 |
T2250 |
advmod |
previously,unappreciated |
| R1479 |
T2250 |
T2248 |
amod |
unappreciated,aspect |
| R1481 |
T2251 |
T2248 |
prep |
of,aspect |
| R1482 |
T2252 |
T2253 |
amod |
dorsoventral,patterning |
| R1483 |
T2253 |
T2251 |
pobj |
patterning,of |
| R1484 |
T2254 |
T2255 |
dep |
that,represented |
| R1486 |
T2255 |
T2248 |
relcl |
represented,aspect |
| R1487 |
T2256 |
T2255 |
auxpass |
is,represented |
| R1488 |
T2257 |
T2255 |
advmod |
widely,represented |
| R1490 |
T2258 |
T2255 |
prep |
in,represented |
| R1491 |
T2259 |
T2260 |
amod |
furred,mammals |
| R1493 |
T2260 |
T2258 |
pobj |
mammals,in |
| R1494 |
T2261 |
T2255 |
cc |
and,represented |
| R1495 |
T2262 |
T2255 |
conj |
provide,represented |
| R1496 |
T2263 |
T2262 |
dobj |
insight,provide |
| R1498 |
T2264 |
T2263 |
prep |
into,insight |
| R1499 |
T2265 |
T2266 |
det |
the,mechanisms |
| R1500 |
T2266 |
T2264 |
pobj |
mechanisms,into |
| R1502 |
T2267 |
T2268 |
dep |
that,underlie |
| R1503 |
T2268 |
T2266 |
relcl |
underlie,mechanisms |
| R1504 |
T2269 |
T2270 |
npadvmod |
region,specific |
| R1506 |
T2270 |
T2272 |
amod |
specific,differences |
| R1507 |
T2271 |
T2270 |
punct |
-,specific |
| R1508 |
T2272 |
T2268 |
dobj |
differences,underlie |
| R1510 |
T2273 |
T2272 |
prep |
in,differences |
| R1511 |
T2274 |
T2275 |
compound |
body,morphology |
| R1513 |
T2275 |
T2273 |
pobj |
morphology,in |
| R1514 |
T2276 |
T2246 |
punct |
.,identify |
| R9083 |
T12974 |
T12975 |
compound |
Gene,targeting |
| R9084 |
T12977 |
T12978 |
det |
A,allele |
| R9085 |
T12978 |
T12980 |
nsubjpass |
allele,constructed |
| R9086 |
T12979 |
T12978 |
amod |
targeted,allele |
| R9087 |
T12981 |
T12978 |
prep |
of,allele |
| R9088 |
T12982 |
T12981 |
pobj |
Tbx15,of |
| R9089 |
T12983 |
T12980 |
auxpass |
was,constructed |
| R9090 |
T12984 |
T12980 |
advcl |
using,constructed |
| R9091 |
T12985 |
T12986 |
det |
the,approach |
| R9092 |
T12986 |
T12984 |
dobj |
approach,using |
| R9093 |
T12987 |
T12986 |
amod |
same,approach |
| R9094 |
T12988 |
T12986 |
acl |
described,approach |
| R9095 |
T12989 |
T12988 |
prep |
in,described |
| R203 |
T388 |
T386 |
nsubjpass |
identity,acquired |
| R204 |
T389 |
T388 |
prep |
of,identity |
| R205 |
T390 |
T391 |
det |
the,skin |
| R206 |
T391 |
T389 |
pobj |
skin,of |
| R207 |
T392 |
T388 |
prep |
with,identity |
| R208 |
T393 |
T392 |
pobj |
regard,with |
| R209 |
T394 |
T393 |
prep |
to,regard |
| R210 |
T395 |
T396 |
amod |
dorsoventral,differences |
| R213 |
T398 |
T386 |
auxpass |
is,acquired |
| R229 |
T415 |
T414 |
punct |
-,mapping |
| R233 |
T420 |
T421 |
det |
the,boundary |
| R243 |
T430 |
T431 |
advmod |
previously,identified |
| R244 |
T431 |
T429 |
amod |
identified,boundary |
| R245 |
T432 |
T433 |
amod |
dermal,cell |
| R246 |
T433 |
T434 |
compound |
cell,lineage |
| R247 |
T434 |
T429 |
compound |
lineage,boundary |
| R254 |
T441 |
T440 |
nmod |
limb,boundary |
| R255 |
T442 |
T440 |
amod |
dorsoventral,boundary |
| R266 |
T455 |
T454 |
amod |
instructional,cue |
| R272 |
T461 |
T460 |
amod |
future,identity |
| R273 |
T462 |
T460 |
amod |
positional,identity |
| R282 |
T473 |
T472 |
amod |
novel,role |
| R286 |
T477 |
T476 |
punct |
-,box |
| R288 |
T479 |
T478 |
compound |
gene,action |
| R296 |
T487 |
T488 |
advmod |
previously,unappreciated |
| R297 |
T488 |
T486 |
amod |
unappreciated,aspect |
| R303 |
T494 |
T493 |
auxpass |
is,represented |
| R304 |
T495 |
T493 |
advmod |
widely,represented |
| R319 |
T510 |
T509 |
punct |
-,specific |
| R4287 |
T6292 |
T6280 |
ccomp |
gives,showed |
| R4112 |
T5938 |
T5935 |
advcl |
explained,are |
| R3254 |
T4788 |
T4778 |
conj |
sequence,information |
| R3488 |
T5035 |
T5040 |
advcl |
was,generated |
| R5959 |
T8677 |
T8675 |
ccomp |
been,suggest |
| R1556 |
T2547 |
T2548 |
amod |
Morphological,Components |
| R1557 |
T2549 |
T2548 |
prep |
of,Components |
| R1558 |
T2550 |
T2551 |
amod |
Dorsoventral,Differences |
| R1561 |
T2554 |
T2555 |
prep |
Besides,suggests |
| R1562 |
T2556 |
T2557 |
det |
the,change |
| R1565 |
T2559 |
T2557 |
prep |
in,change |
| R1566 |
T2560 |
T2561 |
compound |
hair,color |
| R1567 |
T2561 |
T2559 |
pobj |
color,in |
| R1568 |
T2562 |
T2563 |
dep |
that,distinguishes |
| R1571 |
T2565 |
T2563 |
dative |
dorsal,distinguishes |
| R1572 |
T2566 |
T2563 |
prep |
from,distinguishes |
| R1573 |
T2567 |
T2566 |
pobj |
ventral,from |
| R1574 |
T2568 |
T2563 |
dobj |
skin,distinguishes |
| R1575 |
T2569 |
T2555 |
punct |
", ",suggests |
| R1576 |
T2570 |
T2571 |
amod |
casual,observation |
| R1577 |
T2571 |
T2555 |
nsubj |
observation,suggests |
| R1578 |
T2572 |
T2573 |
expl |
there,are |
| R1579 |
T2573 |
T2555 |
advcl |
are,suggests |
| R1580 |
T2574 |
T2575 |
amod |
additional,differences |
| R1581 |
T2575 |
T2573 |
attr |
differences,are |
| R1582 |
T2576 |
T2575 |
prep |
in,differences |
| R1583 |
T2577 |
T2578 |
compound |
hair,length |
| R1584 |
T2578 |
T2576 |
pobj |
length,in |
| R1585 |
T2579 |
T2578 |
punct |
", ",length |
| R1586 |
T2580 |
T2578 |
conj |
distribution,length |
| R1587 |
T2581 |
T2580 |
prep |
of,distribution |
| R1588 |
T2582 |
T2583 |
compound |
hair,type |
| R1589 |
T2583 |
T2581 |
pobj |
type,of |
| R1590 |
T2584 |
T2580 |
punct |
", ",distribution |
| R1591 |
T2585 |
T2580 |
cc |
and,distribution |
| R1592 |
T2586 |
T2587 |
compound |
skin,thickness |
| R1593 |
T2587 |
T2580 |
conj |
thickness,distribution |
| R1594 |
T2588 |
T2555 |
punct |
.,suggests |
| R1595 |
T2590 |
T2591 |
advmod |
Furthermore,represent |
| R1596 |
T2592 |
T2591 |
punct |
", ",represent |
| R1597 |
T2593 |
T2594 |
amod |
dorsoventral,differences |
| R1598 |
T2594 |
T2591 |
nsubj |
differences,represent |
| R1599 |
T2595 |
T2594 |
prep |
in,differences |
| R1600 |
T2596 |
T2595 |
pobj |
pigmentation,in |
| R1601 |
T2597 |
T2591 |
aux |
can,represent |
| R1602 |
T2598 |
T2591 |
dobj |
differences,represent |
| R1603 |
T2599 |
T2598 |
prep |
in,differences |
| R1604 |
T2600 |
T2601 |
det |
the,number |
| R1605 |
T2601 |
T2599 |
pobj |
number,in |
| R1606 |
T2602 |
T2601 |
cc |
and,number |
| R1607 |
T2603 |
T2602 |
punct |
/,and |
| R1608 |
T2604 |
T2602 |
cc |
or,and |
| R1739 |
T2743 |
T2735 |
parataxis |
Figure,region |
| R1740 |
T2744 |
T2743 |
nummod |
1B,Figure |
| R1741 |
T2745 |
T2743 |
punct |
),Figure |
| R1742 |
T2746 |
T2733 |
punct |
", ",become |
| R1743 |
T2747 |
T2748 |
compound |
flank,hairs |
| R1744 |
T2748 |
T2733 |
nsubj |
hairs,become |
| R1745 |
T2749 |
T2748 |
prep |
from,hairs |
| R1746 |
T2750 |
T2751 |
compound |
at,at |
| R1749 |
T2753 |
T2749 |
pobj |
mice,from |
| R1750 |
T2754 |
T2755 |
advmod |
progressively,shorter |
| R1751 |
T2755 |
T2733 |
acomp |
shorter,become |
| R1752 |
T2756 |
T2733 |
cc |
and,become |
| R1753 |
T2757 |
T2733 |
conj |
exhibit,become |
| R1754 |
T2758 |
T2759 |
amod |
increasing,amounts |
| R1755 |
T2759 |
T2757 |
dobj |
amounts,exhibit |
| R1756 |
T2760 |
T2759 |
prep |
of,amounts |
| R1757 |
T2761 |
T2762 |
compound |
pheomelanin,deposition |
| R1758 |
T2762 |
T2760 |
pobj |
deposition,of |
| R1759 |
T2763 |
T2762 |
amod |
progressing,deposition |
| R1760 |
T2764 |
T2757 |
prep |
from,exhibit |
| R1761 |
T2765 |
T2766 |
det |
the,tip |
| R1762 |
T2766 |
T2764 |
pobj |
tip,from |
| R1763 |
T2767 |
T2764 |
prep |
to,from |
| R1764 |
T2768 |
T2769 |
det |
the,base |
| R1765 |
T2769 |
T2767 |
pobj |
base,to |
| R1766 |
T2770 |
T2764 |
prep |
of,from |
| R1767 |
T2771 |
T2772 |
det |
the,hair |
| R1768 |
T2772 |
T2770 |
pobj |
hair,of |
| R1769 |
T2773 |
T2733 |
punct |
.,become |
| R1770 |
T2775 |
T2776 |
advmod |
However,is |
| R1771 |
T2777 |
T2776 |
punct |
", ",is |
| R1772 |
T2778 |
T2779 |
det |
the,region |
| R1773 |
T2779 |
T2776 |
nsubj |
region,is |
| R1774 |
T2780 |
T2779 |
prep |
of,region |
| R1775 |
T2781 |
T2780 |
pobj |
transition,of |
| R1776 |
T2782 |
T2776 |
prep |
for,is |
| R1777 |
T2783 |
T2784 |
compound |
hair,length |
| R1778 |
T2784 |
T2782 |
pobj |
length,for |
| R1779 |
T2785 |
T2786 |
advmod |
considerably,broader |
| R1780 |
T2786 |
T2776 |
acomp |
broader,is |
| R1781 |
T2787 |
T2786 |
prep |
than,broader |
| R1782 |
T2788 |
T2787 |
pobj |
that,than |
| R1783 |
T2789 |
T2788 |
prep |
for,that |
| R1784 |
T2790 |
T2789 |
pobj |
pigmentation,for |
| R1785 |
T2791 |
T2786 |
cc |
and,broader |
| R1786 |
T2792 |
T2786 |
conj |
independent,broader |
| R1787 |
T2793 |
T2792 |
prep |
of,independent |
| R1788 |
T2794 |
T2795 |
compound |
Agouti,genotype |
| R1789 |
T2795 |
T2793 |
pobj |
genotype,of |
| R1790 |
T2796 |
T2776 |
punct |
.,is |
| R1791 |
T2798 |
T2799 |
mark |
Although,varies |
| R1794 |
T2801 |
T2803 |
compound |
cycle,timing |
| R1797 |
T2805 |
T2799 |
prep |
along,varies |
| R1798 |
T2806 |
T2807 |
det |
the,axis |
| R1801 |
T2809 |
T2804 |
punct |
", ",are |
| R1802 |
T2810 |
T2804 |
nsubj |
measurements,are |
| R1803 |
T2811 |
T2810 |
prep |
of,measurements |
| R1804 |
T2812 |
T2813 |
amod |
absolute,length |
| R1807 |
T2815 |
T2810 |
prep |
for,measurements |
| R1808 |
T2816 |
T2815 |
pobj |
mice,for |
| R1809 |
T2817 |
T2816 |
acl |
matched,mice |
| R1810 |
T2818 |
T2817 |
prep |
for,matched |
| R1811 |
T2819 |
T2818 |
pobj |
age,for |
| R1812 |
T2820 |
T2819 |
cc |
and,age |
| R1813 |
T2821 |
T2822 |
amod |
rostrocaudal,level |
| R1814 |
T2822 |
T2819 |
conj |
level,age |
| R1815 |
T2823 |
T2824 |
advmod |
remarkably,similar |
| R1816 |
T2824 |
T2804 |
acomp |
similar,are |
| R1817 |
T2825 |
T2826 |
punct |
(,Figure |
| R1818 |
T2826 |
T2804 |
parataxis |
Figure,are |
| R1819 |
T2827 |
T2826 |
nummod |
1D,Figure |
| R1820 |
T2828 |
T2826 |
punct |
),Figure |
| R1821 |
T2829 |
T2804 |
punct |
.,are |
| R1822 |
T2831 |
T2832 |
advmod |
Furthermore,are |
| R1823 |
T2833 |
T2832 |
punct |
", ",are |
| R1824 |
T2834 |
T2832 |
nsubj |
measurements,are |
| R1825 |
T2835 |
T2834 |
prep |
of,measurements |
| R1826 |
T2836 |
T2837 |
amod |
relative,length |
| R1829 |
T2839 |
T2832 |
prep |
for,are |
| R1830 |
T2840 |
T2839 |
pobj |
animals,for |
| R1831 |
T2841 |
T2840 |
prep |
of,animals |
| R1849 |
T2859 |
T2832 |
parataxis |
Figure,are |
| R1850 |
T2860 |
T2859 |
nummod |
1C,Figure |
| R1851 |
T2861 |
T2859 |
punct |
),Figure |
| R1852 |
T2862 |
T2832 |
punct |
.,are |
| R1853 |
T2864 |
T2865 |
advcl |
Taken,indicate |
| R1854 |
T2866 |
T2864 |
advmod |
together,Taken |
| R1855 |
T2867 |
T2865 |
punct |
", ",indicate |
| R1856 |
T2868 |
T2869 |
det |
these,observations |
| R1857 |
T2869 |
T2865 |
nsubj |
observations,indicate |
| R1858 |
T2870 |
T2871 |
mark |
that,stereotyped |
| R1866 |
T2878 |
T2876 |
pobj |
axis,along |
| R1869 |
T2881 |
T2871 |
cc |
and,stereotyped |
| R1870 |
T2882 |
T2871 |
conj |
maintained,stereotyped |
| R1871 |
T2883 |
T2871 |
prep |
through,stereotyped |
| R1872 |
T2884 |
T2885 |
amod |
multiple,cycles |
| R1875 |
T2887 |
T2871 |
punct |
", ",stereotyped |
| R1876 |
T2888 |
T2871 |
prep |
with,stereotyped |
| R1877 |
T2889 |
T2890 |
det |
a,transition |
| R1878 |
T2890 |
T2888 |
pobj |
transition,with |
| R1879 |
T2891 |
T2890 |
prep |
in,transition |
| R1880 |
T2892 |
T2893 |
compound |
hair,length |
| R1881 |
T2893 |
T2891 |
pobj |
length,in |
| R1882 |
T2894 |
T2895 |
dep |
that,is |
| R1883 |
T2895 |
T2890 |
relcl |
is,transition |
| R1884 |
T2896 |
T2895 |
acomp |
gradual,is |
| R1885 |
T2897 |
T2895 |
cc |
and,is |
| R1886 |
T2898 |
T2895 |
conj |
encompasses,is |
| R1887 |
T2899 |
T2900 |
det |
the,transition |
| R1890 |
T2902 |
T2900 |
compound |
type,transition |
| R1892 |
T2904 |
T2895 |
prep |
in,is |
| R1893 |
T2905 |
T2906 |
compound |
at,at |
| R1896 |
T2908 |
T2904 |
pobj |
mice,in |
| R1897 |
T2909 |
T2865 |
punct |
.,indicate |
| R1898 |
T2911 |
T2912 |
amod |
Dorsal,skin |
| R1902 |
T2916 |
T2915 |
prep |
at,develop |
| R1903 |
T2917 |
T2918 |
amod |
different,rates |
| R1904 |
T2918 |
T2916 |
pobj |
rates,at |
| R1905 |
T2919 |
T2915 |
punct |
.,develop |
| R1906 |
T2921 |
T2922 |
amod |
Transverse,sections |
| R1907 |
T2922 |
T2923 |
nsubj |
sections,exhibit |
| R1908 |
T2924 |
T2922 |
prep |
of,sections |
| R1909 |
T2925 |
T2924 |
pobj |
skin,of |
| R1910 |
T2926 |
T2922 |
prep |
at,sections |
| R1911 |
T2927 |
T2928 |
amod |
postnatal,day |
| R1912 |
T2928 |
T2926 |
pobj |
day,at |
| R1913 |
T2929 |
T2928 |
nummod |
4.5,day |
| R1914 |
T2930 |
T2928 |
punct |
(,day |
| R1915 |
T2931 |
T2928 |
appos |
P4.5,day |
| R1916 |
T2932 |
T2928 |
punct |
),day |
| R1917 |
T2933 |
T2934 |
amod |
dorsal,follicles |
| R1920 |
T2936 |
T2937 |
dep |
that,are |
| R1921 |
T2937 |
T2934 |
relcl |
are,follicles |
| R1922 |
T2938 |
T2939 |
advmod |
noticeably,developed |
| R1925 |
T2941 |
T2939 |
prep |
than,developed |
| R1926 |
T2942 |
T2943 |
amod |
ventral,follicles |
| R1929 |
T2945 |
T2934 |
punct |
", ",follicles |
| R1930 |
T2946 |
T2934 |
prep |
along,follicles |
| R1931 |
T2947 |
T2946 |
prep |
with,along |
| R1932 |
T2948 |
T2949 |
det |
a,decrease |
| R1936 |
T2952 |
T2949 |
prep |
in,decrease |
| R1937 |
T2953 |
T2954 |
amod |
dermal,thickness |
| R1938 |
T2954 |
T2952 |
pobj |
thickness,in |
| R1939 |
T2955 |
T2956 |
punct |
(,Figure |
| R1940 |
T2956 |
T2923 |
parataxis |
Figure,exhibit |
| R1941 |
T2957 |
T2956 |
nummod |
1F,Figure |
| R1942 |
T2958 |
T2956 |
punct |
),Figure |
| R1943 |
T2959 |
T2923 |
punct |
.,exhibit |
| R1944 |
T2961 |
T2962 |
advmod |
However,disappear |
| R1945 |
T2963 |
T2962 |
punct |
", ",disappear |
| R1946 |
T2964 |
T2962 |
nsubj |
differences,disappear |
| R1947 |
T2965 |
T2964 |
prep |
in,differences |
| R1948 |
T2966 |
T2967 |
compound |
skin,thickness |
| R1949 |
T2967 |
T2965 |
pobj |
thickness,in |
| R1950 |
T2968 |
T2962 |
prep |
by,disappear |
| R1951 |
T2969 |
T2970 |
quantmod |
3,4 |
| R1954 |
T2972 |
T2968 |
pobj |
wk,by |
| R1955 |
T2973 |
T2972 |
prep |
of,wk |
| R1956 |
T2974 |
T2973 |
pobj |
age,of |
| R1957 |
T2975 |
T2976 |
punct |
(,Forsthoefel |
| R1958 |
T2976 |
T2962 |
meta |
Forsthoefel,disappear |
| R1959 |
T2977 |
T2976 |
nmod |
et,Forsthoefel |
| R2003 |
T3023 |
T3021 |
parataxis |
zigzags,hairs |
| R2004 |
T3024 |
T3023 |
punct |
),zigzags |
| R2005 |
T3025 |
T3018 |
prep |
to,ratio |
| R2006 |
T3026 |
T3027 |
compound |
overcoat,hairs |
| R2007 |
T3027 |
T3025 |
pobj |
hairs,to |
| R2008 |
T3028 |
T3027 |
punct |
(,hairs |
| R2009 |
T3029 |
T3027 |
appos |
auchenes,hairs |
| R2010 |
T3030 |
T3029 |
punct |
", ",auchenes |
| R2011 |
T3031 |
T3029 |
conj |
awls,auchenes |
| R2012 |
T3032 |
T3031 |
punct |
", ",awls |
| R2013 |
T3033 |
T3031 |
cc |
and,awls |
| R2014 |
T3034 |
T3035 |
compound |
guard,hairs |
| R2015 |
T3035 |
T3031 |
conj |
hairs,awls |
| R2016 |
T3036 |
T3005 |
punct |
),observed |
| R2017 |
T3037 |
T3005 |
prep |
in,observed |
| R2018 |
T3038 |
T3037 |
pobj |
dorsum,in |
| R2019 |
T3039 |
T3005 |
prep |
compared,observed |
| R2020 |
T3040 |
T3039 |
prep |
to,compared |
| R2021 |
T3041 |
T3040 |
pobj |
ventrum,to |
| R2022 |
T3042 |
T3043 |
punct |
(,Figure |
| R2023 |
T3043 |
T3005 |
parataxis |
Figure,observed |
| R2024 |
T3044 |
T3043 |
nummod |
1E,Figure |
| R2025 |
T3045 |
T3043 |
punct |
),Figure |
| R2026 |
T3046 |
T3005 |
punct |
", ",observed |
| R2027 |
T3047 |
T3005 |
cc |
but,observed |
| R2028 |
T3048 |
T3049 |
expl |
there,was |
| R2029 |
T3049 |
T3005 |
conj |
was,observed |
| R2030 |
T3050 |
T3051 |
det |
no,difference |
| R2033 |
T3053 |
T3051 |
prep |
in,difference |
| R2034 |
T3054 |
T3055 |
compound |
hair,type |
| R2037 |
T3057 |
T3053 |
pobj |
distribution,in |
| R2038 |
T3058 |
T3057 |
prep |
for,distribution |
| R2039 |
T3059 |
T3060 |
amod |
outbred,mice |
| R2040 |
T3060 |
T3058 |
pobj |
mice,for |
| R2041 |
T3061 |
T3062 |
punct |
(,shown |
| R2045 |
T3065 |
T3062 |
punct |
),shown |
| R2046 |
T3066 |
T3049 |
punct |
.,was |
| R2047 |
T3068 |
T3069 |
nsubjpass |
Differences,attributed |
| R2048 |
T3070 |
T3068 |
prep |
between,Differences |
| R2049 |
T3071 |
T3072 |
amod |
dorsal,pigmentation |
| R2053 |
T3075 |
T3072 |
prep |
of,pigmentation |
| R2054 |
T3076 |
T3077 |
compound |
at,at |
| R2057 |
T3079 |
T3075 |
pobj |
mice,of |
| R2058 |
T3080 |
T3069 |
auxpass |
are,attributed |
| R2059 |
T3081 |
T3069 |
advmod |
usually,attributed |
| R2060 |
T3082 |
T3069 |
prep |
to,attributed |
| R2061 |
T3083 |
T3084 |
compound |
pigment,type |
| R2064 |
T3086 |
T3082 |
pobj |
differences,to |
| R2065 |
T3087 |
T3086 |
acl |
caused,differences |
| R2066 |
T3088 |
T3087 |
agent |
by,caused |
| R2067 |
T3089 |
T3090 |
amod |
ventral,specific |
| R2070 |
T3092 |
T3088 |
pobj |
expression,by |
| R2071 |
T3093 |
T3092 |
prep |
of,expression |
| R2072 |
T3094 |
T3093 |
pobj |
Agouti,of |
| R2073 |
T3095 |
T3069 |
punct |
", ",attributed |
| R2074 |
T3096 |
T3069 |
cc |
but,attributed |
| R2075 |
T3097 |
T3098 |
nsubj |
animals,have |
| R2080 |
T3102 |
T3100 |
pobj |
allele,for |
| R2091 |
T3113 |
T3114 |
amod |
ventral,hairs |
| R2092 |
T3114 |
T3098 |
dobj |
hairs,have |
| R2093 |
T3115 |
T3116 |
dep |
that,contain |
| R2094 |
T3116 |
T3114 |
relcl |
contain,hairs |
| R2095 |
T3117 |
T3118 |
amod |
less,melanin |
| R2096 |
T3118 |
T3116 |
dobj |
melanin,contain |
| R2097 |
T3119 |
T3118 |
prep |
than,melanin |
| R2098 |
T3120 |
T3121 |
amod |
dorsal,hairs |
| R2099 |
T3121 |
T3119 |
pobj |
hairs,than |
| R2100 |
T3122 |
T3116 |
punct |
", ",contain |
| R2101 |
T3123 |
T3116 |
advcl |
giving,contain |
| R2102 |
T3124 |
T3125 |
det |
a,appearance |
| R2106 |
T3128 |
T3123 |
dative |
to,giving |
| R2107 |
T3129 |
T3130 |
det |
the,coat |
| R2110 |
T3132 |
T3133 |
punct |
(,Figure |
| R2111 |
T3133 |
T3098 |
parataxis |
Figure,have |
| R2112 |
T3134 |
T3133 |
nummod |
1G,Figure |
| R2113 |
T3135 |
T3133 |
punct |
),Figure |
| R2114 |
T3136 |
T3098 |
punct |
.,have |
| R2115 |
T3138 |
T3139 |
advcl |
Using,observed |
| R2116 |
T3140 |
T3141 |
compound |
DOPA,staining |
| R2117 |
T3141 |
T3138 |
dobj |
staining,Using |
| R2118 |
T3142 |
T3138 |
prep |
as,Using |
| R2141 |
T3165 |
T3139 |
parataxis |
Figure,observed |
| R2142 |
T3166 |
T3165 |
nummod |
1G,Figure |
| R2143 |
T3167 |
T3165 |
punct |
),Figure |
| R2144 |
T3168 |
T3139 |
punct |
.,observed |
| R2145 |
T3170 |
T3171 |
prep |
By,reveal |
| R2146 |
T3172 |
T3170 |
pobj |
contrast,By |
| R2147 |
T3173 |
T3171 |
punct |
", ",reveal |
| R2148 |
T3174 |
T3171 |
nsubj |
skin,reveal |
| R2149 |
T3175 |
T3174 |
prep |
from,skin |
| R2150 |
T3176 |
T3177 |
compound |
at,at |
| R2153 |
T3179 |
T3175 |
pobj |
mice,from |
| R2154 |
T3180 |
T3181 |
det |
an,transition |
| R2158 |
T3184 |
T3181 |
prep |
of,transition |
| R2159 |
T3185 |
T3186 |
compound |
DOPA,staining |
| R2160 |
T3186 |
T3184 |
pobj |
staining,of |
| R2161 |
T3187 |
T3181 |
punct |
", ",transition |
| R2162 |
T3188 |
T3189 |
dep |
which,reflects |
| R2165 |
T3191 |
T3192 |
det |
the,effects |
| R2168 |
T3194 |
T3192 |
prep |
of,effects |
| R2169 |
T3195 |
T3196 |
amod |
reduced,content |
| R2172 |
T3198 |
T3196 |
punct |
(,content |
| R2173 |
T3199 |
T3196 |
prep |
as,content |
| R2174 |
T3200 |
T3199 |
prep |
in,as |
| R2175 |
T3201 |
T3202 |
compound |
ae,ae |
| R2178 |
T3204 |
T3200 |
pobj |
mice,in |
| R2179 |
T3205 |
T3192 |
punct |
),effects |
| R2180 |
T3206 |
T3192 |
cc |
and,effects |
| R2181 |
T3207 |
T3192 |
conj |
downregulation,effects |
| R2182 |
T3208 |
T3207 |
prep |
of,downregulation |
| R2183 |
T3209 |
T3210 |
compound |
tyrosinase,activity |
| R2184 |
T3210 |
T3208 |
pobj |
activity,of |
| R2185 |
T3211 |
T3210 |
acl |
induced,activity |
| R2186 |
T3212 |
T3211 |
agent |
by,induced |
| R2187 |
T3213 |
T3212 |
pobj |
Agouti,by |
| R2188 |
T3214 |
T3171 |
punct |
.,reveal |
| R2189 |
T3216 |
T3217 |
compound |
Melanin,content |
| R2190 |
T3217 |
T3218 |
nsubj |
content,is |
| R2191 |
T3219 |
T3217 |
prep |
of,content |
| R2192 |
T3220 |
T3221 |
amod |
individual,hairs |
| R2193 |
T3221 |
T3219 |
pobj |
hairs,of |
| R2194 |
T3222 |
T3218 |
acomp |
likely,is |
| R2195 |
T3223 |
T3224 |
aux |
to,influenced |
| R2198 |
T3226 |
T3227 |
preconj |
both,by |
| R2199 |
T3227 |
T3224 |
agent |
by,influenced |
| R2200 |
T3228 |
T3229 |
det |
the,number |
| R2201 |
T3229 |
T3227 |
pobj |
number,by |
| R2202 |
T3230 |
T3229 |
prep |
of,number |
| R2203 |
T3231 |
T3232 |
compound |
pigment,cells |
| R2204 |
T3232 |
T3230 |
pobj |
cells,of |
| R2205 |
T3233 |
T3229 |
cc |
and,number |
| R2206 |
T3234 |
T3235 |
poss |
their,environment |
| R2209 |
T3237 |
T3218 |
punct |
.,is |
| R2210 |
T3239 |
T3240 |
advmod |
Regardless,persist |
| R2211 |
T3241 |
T3240 |
punct |
", ",persist |
| R2212 |
T3242 |
T3243 |
amod |
dorsoventral,differences |
| R2213 |
T3243 |
T3240 |
nsubj |
differences,persist |
| R2214 |
T3244 |
T3243 |
prep |
in,differences |
| R2215 |
T3245 |
T3246 |
compound |
hair,content |
| R2218 |
T3248 |
T3246 |
prep |
of,content |
| R2219 |
T3249 |
T3250 |
compound |
ae,ae |
| R2222 |
T3252 |
T3248 |
pobj |
mice,of |
| R2223 |
T3253 |
T3240 |
prep |
throughout,persist |
| R2224 |
T3254 |
T3255 |
amod |
multiple,cycles |
| R2227 |
T3257 |
T3240 |
prep |
into,persist |
| R2228 |
T3258 |
T3257 |
pobj |
adulthood,into |
| R2229 |
T3259 |
T3240 |
punct |
", ",persist |
| R2230 |
T3260 |
T3240 |
advcl |
similar,persist |
| R2231 |
T3261 |
T3260 |
prep |
to,similar |
| R2232 |
T3262 |
T3263 |
compound |
hair,length |
| R2233 |
T3263 |
T3261 |
pobj |
length,to |
| R2234 |
T3264 |
T3260 |
punct |
(,similar |
| R2235 |
T3265 |
T3260 |
cc |
but,similar |
| R2236 |
T3266 |
T3260 |
conj |
unlike,similar |
| R2237 |
T3267 |
T3268 |
compound |
skin,thickness |
| R2238 |
T3268 |
T3266 |
pobj |
thickness,unlike |
| R2239 |
T3269 |
T3240 |
punct |
),persist |
| R2240 |
T3270 |
T3240 |
punct |
.,persist |
| R2241 |
T3272 |
T3273 |
advmod |
Thus,distinguish |
| R2242 |
T3274 |
T3273 |
punct |
", ",distinguish |
| R2243 |
T3275 |
T3276 |
advmod |
at,three |
| R2246 |
T3278 |
T3273 |
nsubj |
characteristics,distinguish |
| R2848 |
T4128 |
T4121 |
parataxis |
shown,display |
| R2871 |
T4153 |
T4151 |
pobj |
days,in |
| R3021 |
T4311 |
T4309 |
pobj |
skin,between |
| R326 |
T992 |
T993 |
det |
A,question |
| R329 |
T996 |
T993 |
prep |
in,question |
| R330 |
T997 |
T998 |
amod |
developmental,biology |
| R331 |
T998 |
T996 |
pobj |
biology,in |
| R332 |
T999 |
T1000 |
advmod |
how,acquire |
| R338 |
T1005 |
T1003 |
pobj |
body,of |
| R340 |
T1007 |
T1000 |
dobj |
differences,acquire |
| R341 |
T1008 |
T1007 |
prep |
in,differences |
| R342 |
T1009 |
T1010 |
poss |
their,appearance |
| R343 |
T1010 |
T1008 |
pobj |
appearance,in |
| R344 |
T1011 |
T1010 |
cc |
or,appearance |
| R345 |
T1012 |
T1010 |
conj |
morphology,appearance |
| R346 |
T1013 |
T995 |
punct |
.,is |
| R347 |
T1015 |
T1016 |
nsubj |
Mechanisms,make |
| R348 |
T1017 |
T1018 |
dep |
that,establish |
| R349 |
T1018 |
T1015 |
relcl |
establish,Mechanisms |
| R350 |
T1019 |
T1020 |
det |
the,plan |
| R354 |
T1023 |
T1016 |
dobj |
use,make |
| R355 |
T1024 |
T1016 |
prep |
of,make |
| R356 |
T1025 |
T1026 |
det |
a,number |
| R360 |
T1029 |
T1026 |
prep |
of,number |
| R361 |
T1030 |
T1031 |
compound |
signaling,pathways |
| R362 |
T1031 |
T1029 |
pobj |
pathways,of |
| R363 |
T1032 |
T1031 |
acl |
shared,pathways |
| R364 |
T1033 |
T1032 |
prep |
among,shared |
| R365 |
T1034 |
T1035 |
det |
all,animals |
| R366 |
T1035 |
T1033 |
pobj |
animals,among |
| R367 |
T1036 |
T1037 |
punct |
(,reviewed |
| R368 |
T1037 |
T1016 |
parataxis |
reviewed,make |
| R369 |
T1038 |
T1037 |
prep |
in,reviewed |
| R370 |
T1039 |
T1040 |
compound |
Pires,daSilva |
| R373 |
T1042 |
T1040 |
cc |
and,daSilva |
| R374 |
T1043 |
T1040 |
conj |
Sommer,daSilva |
| R375 |
T1044 |
T1040 |
npadvmod |
2003,daSilva |
| R376 |
T1045 |
T1037 |
punct |
),reviewed |
| R377 |
T1046 |
T1016 |
punct |
", ",make |
| R378 |
T1047 |
T1016 |
cc |
but,make |
| R379 |
T1048 |
T1049 |
det |
the,extent |
| R380 |
T1049 |
T1050 |
nsubj |
extent,is |
| R392 |
T1061 |
T1050 |
neg |
not,is |
| R393 |
T1062 |
T1050 |
acomp |
clear,is |
| R394 |
T1063 |
T1050 |
punct |
.,is |
| R395 |
T1065 |
T1066 |
prep |
Among,combine |
| R396 |
T1067 |
T1065 |
pobj |
vertebrates,Among |
| R397 |
T1068 |
T1066 |
punct |
", ",combine |
| R398 |
T1069 |
T1066 |
nsubj |
differences,combine |
| R399 |
T1070 |
T1069 |
prep |
in,differences |
| R400 |
T1071 |
T1072 |
det |
the,shape |
| R401 |
T1072 |
T1070 |
pobj |
shape,in |
| R402 |
T1073 |
T1072 |
cc |
or,shape |
| R403 |
T1074 |
T1072 |
conj |
number,shape |
| R404 |
T1075 |
T1072 |
prep |
of,shape |
| R405 |
T1076 |
T1077 |
amod |
skeletal,elements |
| R406 |
T1077 |
T1075 |
pobj |
elements,of |
| R407 |
T1078 |
T1072 |
punct |
", ",shape |
| R408 |
T1079 |
T1080 |
amod |
altered,morphology |
| R409 |
T1080 |
T1072 |
conj |
morphology,shape |
| R410 |
T1081 |
T1080 |
prep |
of,morphology |
| R411 |
T1082 |
T1083 |
amod |
epidermal,appendages |
| R412 |
T1083 |
T1081 |
pobj |
appendages,of |
| R413 |
T1084 |
T1080 |
punct |
", ",morphology |
| R414 |
T1085 |
T1080 |
cc |
and,morphology |
| R415 |
T1086 |
T1080 |
conj |
variation,morphology |
| R416 |
T1087 |
T1086 |
prep |
in,variation |
| R417 |
T1088 |
T1089 |
compound |
pigment,distribution |
| R418 |
T1089 |
T1087 |
pobj |
distribution,in |
| R419 |
T1090 |
T1091 |
aux |
to,produce |
| R420 |
T1091 |
T1066 |
advcl |
produce,combine |
| R421 |
T1092 |
T1093 |
det |
the,majority |
| R422 |
T1093 |
T1091 |
dobj |
majority,produce |
| R423 |
T1094 |
T1093 |
prep |
of,majority |
| R424 |
T1095 |
T1096 |
dep |
what,distinguishes |
| R425 |
T1096 |
T1094 |
pcomp |
distinguishes,of |
| R426 |
T1097 |
T1098 |
nummod |
one,animal |
| R427 |
T1098 |
T1096 |
dobj |
animal,distinguishes |
| R428 |
T1099 |
T1096 |
prep |
from,distinguishes |
| R429 |
T1100 |
T1099 |
pobj |
another,from |
| R430 |
T1101 |
T1066 |
punct |
.,combine |
| R555 |
T1232 |
T1221 |
parataxis |
reviewed,understood |
| R556 |
T1233 |
T1232 |
prep |
in,reviewed |
| R557 |
T1234 |
T1233 |
pobj |
Bennett,in |
| R558 |
T1235 |
T1234 |
cc |
and,Bennett |
| R559 |
T1236 |
T1234 |
conj |
Lamoreux,Bennett |
| R560 |
T1237 |
T1234 |
npadvmod |
2003,Bennett |
| R561 |
T1238 |
T1232 |
punct |
),reviewed |
| R562 |
T1239 |
T1216 |
punct |
.,identified |
| R563 |
T1241 |
T1242 |
amod |
Several,mechanisms |
| R564 |
T1242 |
T1243 |
nsubj |
mechanisms,contribute |
| R565 |
T1244 |
T1243 |
aux |
may,contribute |
| R566 |
T1245 |
T1243 |
prep |
to,contribute |
| R567 |
T1246 |
T1247 |
amod |
regional,differences |
| R568 |
T1247 |
T1245 |
pobj |
differences,to |
| R569 |
T1248 |
T1247 |
prep |
in,differences |
| R570 |
T1249 |
T1250 |
compound |
vertebrate,pigmentation |
| R571 |
T1250 |
T1248 |
pobj |
pigmentation,in |
| R572 |
T1251 |
T1243 |
punct |
.,contribute |
| R573 |
T1253 |
T1254 |
prep |
In,affect |
| R574 |
T1255 |
T1256 |
det |
the,embryo |
| R575 |
T1256 |
T1253 |
pobj |
embryo,In |
| R576 |
T1257 |
T1254 |
punct |
", ",affect |
| R577 |
T1258 |
T1254 |
nsubj |
alterations,affect |
| R578 |
T1259 |
T1258 |
prep |
in,alterations |
| R579 |
T1260 |
T1261 |
det |
the,determination |
| R580 |
T1261 |
T1259 |
pobj |
determination,in |
| R581 |
T1262 |
T1261 |
cc |
or,determination |
| R582 |
T1263 |
T1261 |
conj |
migration,determination |
| R583 |
T1264 |
T1261 |
prep |
of,determination |
| R584 |
T1265 |
T1264 |
pobj |
melanoblasts,of |
| R585 |
T1266 |
T1265 |
prep |
from,melanoblasts |
| R586 |
T1267 |
T1268 |
det |
the,crest |
| R589 |
T1270 |
T1271 |
det |
the,number |
| R590 |
T1271 |
T1254 |
dobj |
number,affect |
| R591 |
T1272 |
T1271 |
cc |
or,number |
| R592 |
T1273 |
T1271 |
conj |
distribution,number |
| R593 |
T1274 |
T1271 |
prep |
of,number |
| R594 |
T1275 |
T1276 |
compound |
pigment,cells |
| R595 |
T1276 |
T1274 |
pobj |
cells,of |
| R596 |
T1277 |
T1254 |
prep |
in,affect |
| R597 |
T1278 |
T1279 |
det |
the,skin |
| R598 |
T1279 |
T1277 |
pobj |
skin,in |
| R599 |
T1280 |
T1281 |
punct |
(,reviewed |
| R600 |
T1281 |
T1254 |
parataxis |
reviewed,affect |
| R601 |
T1282 |
T1281 |
prep |
in,reviewed |
| R602 |
T1283 |
T1282 |
pobj |
Reedy,in |
| R603 |
T1284 |
T1285 |
advmod |
et,al. |
| R604 |
T1285 |
T1283 |
advmod |
al.,Reedy |
| R605 |
T1286 |
T1283 |
npadvmod |
1998,Reedy |
| R606 |
T1287 |
T1281 |
punct |
),reviewed |
| R607 |
T1288 |
T1254 |
punct |
.,affect |
| R608 |
T1290 |
T1291 |
prep |
Within,control |
| R609 |
T1292 |
T1293 |
compound |
hair,follicles |
| R610 |
T1293 |
T1290 |
pobj |
follicles,Within |
| R611 |
T1294 |
T1291 |
punct |
", ",control |
| R612 |
T1295 |
T1296 |
amod |
paracrine,signals |
| R613 |
T1296 |
T1291 |
nsubj |
signals,control |
| R614 |
T1297 |
T1298 |
det |
the,type |
| R615 |
T1298 |
T1291 |
dobj |
type,control |
| R616 |
T1299 |
T1298 |
prep |
of,type |
| R617 |
T1300 |
T1299 |
pobj |
pigment,of |
| R618 |
T1301 |
T1298 |
acl |
made,type |
| R619 |
T1302 |
T1301 |
prep |
in,made |
| R620 |
T1303 |
T1304 |
amod |
specific,regions |
| R621 |
T1304 |
T1302 |
pobj |
regions,in |
| R622 |
T1305 |
T1304 |
prep |
of,regions |
| R623 |
T1306 |
T1307 |
det |
the,body |
| R624 |
T1307 |
T1305 |
pobj |
body,of |
| R625 |
T1308 |
T1302 |
cc |
or,in |
| R626 |
T1309 |
T1302 |
conj |
at,in |
| R627 |
T1310 |
T1311 |
amod |
specific,times |
| R628 |
T1311 |
T1309 |
pobj |
times,at |
| R629 |
T1312 |
T1311 |
prep |
during,times |
| R630 |
T1313 |
T1314 |
det |
the,cycle |
| R633 |
T1316 |
T1317 |
punct |
(,reviewed |
| R634 |
T1317 |
T1291 |
parataxis |
reviewed,control |
| R635 |
T1318 |
T1317 |
prep |
in,reviewed |
| R636 |
T1319 |
T1318 |
pobj |
Furumura,in |
| R637 |
T1320 |
T1321 |
advmod |
et,al. |
| R638 |
T1321 |
T1319 |
advmod |
al.,Furumura |
| R639 |
T1322 |
T1319 |
npadvmod |
1996,Furumura |
| R685 |
T1370 |
T1332 |
parataxis |
reviewed,makes |
| R686 |
T1371 |
T1370 |
prep |
in,reviewed |
| R687 |
T1372 |
T1371 |
pobj |
Marks,in |
| R688 |
T1373 |
T1372 |
cc |
and,Marks |
| R689 |
T1374 |
T1372 |
conj |
Seabra,Marks |
| R690 |
T1375 |
T1372 |
npadvmod |
2001,Marks |
| R691 |
T1376 |
T1370 |
punct |
),reviewed |
| R692 |
T1377 |
T1332 |
punct |
.,makes |
| R693 |
T1379 |
T1380 |
advmod |
However,known |
| R694 |
T1381 |
T1380 |
punct |
", ",known |
| R695 |
T1382 |
T1380 |
prep |
for,known |
| R696 |
T1383 |
T1382 |
pobj |
all,for |
| R697 |
T1384 |
T1383 |
prep |
of,all |
| R698 |
T1385 |
T1386 |
det |
these,mechanisms |
| R699 |
T1386 |
T1384 |
pobj |
mechanisms,of |
| R700 |
T1387 |
T1383 |
punct |
—,all |
| R701 |
T1388 |
T1389 |
amod |
white,spotting |
| R702 |
T1389 |
T1383 |
appos |
spotting,all |
| R703 |
T1390 |
T1389 |
punct |
", ",spotting |
| R704 |
T1391 |
T1392 |
compound |
pigment,type |
| R707 |
T1394 |
T1392 |
amod |
switching,type |
| R708 |
T1395 |
T1392 |
punct |
", ",type |
| R709 |
T1396 |
T1392 |
cc |
and,type |
| R710 |
T1397 |
T1398 |
compound |
melanosome,biogenesis |
| R711 |
T1398 |
T1392 |
conj |
biogenesis,type |
| R712 |
T1399 |
T1380 |
punct |
—,known |
| R713 |
T1400 |
T1380 |
nsubjpass |
more,known |
| R714 |
T1401 |
T1380 |
auxpass |
is,known |
| R715 |
T1402 |
T1380 |
prep |
about,known |
| R716 |
T1403 |
T1404 |
det |
the,identity |
| R717 |
T1404 |
T1402 |
pobj |
identity,about |
| R718 |
T1405 |
T1404 |
prep |
of,identity |
| R719 |
T1406 |
T1407 |
det |
the,components |
| R722 |
T1409 |
T1380 |
prep |
than,known |
| R723 |
T1410 |
T1411 |
poss |
their,control |
| R728 |
T1415 |
T1380 |
punct |
.,known |
| R729 |
T1417 |
T1418 |
nsubj |
One,is |
| R730 |
T1419 |
T1417 |
prep |
of,One |
| R731 |
T1420 |
T1421 |
det |
the,aspects |
| R735 |
T1424 |
T1421 |
prep |
of,aspects |
| R736 |
T1425 |
T1426 |
amod |
regional,variation |
| R739 |
T1428 |
T1426 |
prep |
in,variation |
| R740 |
T1429 |
T1428 |
pobj |
vertebrates,in |
| R741 |
T1430 |
T1431 |
det |
a,surface |
| R745 |
T1434 |
T1431 |
acl |
juxtaposed,surface |
| R746 |
T1435 |
T1434 |
prep |
to,juxtaposed |
| R747 |
T1436 |
T1437 |
det |
a,surface |
| R751 |
T1440 |
T1418 |
punct |
", ",is |
| R752 |
T1441 |
T1418 |
advcl |
apparent,is |
| R753 |
T1442 |
T1441 |
prep |
in,apparent |
| R754 |
T1443 |
T1444 |
det |
the,color |
| R755 |
T1444 |
T1442 |
pobj |
color,in |
| R756 |
T1445 |
T1444 |
prep |
of,color |
| R757 |
T1446 |
T1445 |
pobj |
skin,of |
| R758 |
T1447 |
T1446 |
punct |
", ",skin |
| R759 |
T1448 |
T1446 |
conj |
scales,skin |
| R760 |
T1449 |
T1448 |
punct |
", ",scales |
| R761 |
T1450 |
T1448 |
conj |
feathers,scales |
| R762 |
T1451 |
T1450 |
punct |
", ",feathers |
| R763 |
T1452 |
T1450 |
cc |
or,feathers |
| R764 |
T1453 |
T1450 |
conj |
hair,feathers |
| R765 |
T1454 |
T1446 |
punct |
", ",skin |
| R766 |
T1455 |
T1456 |
prep |
in,is |
| R776 |
T1465 |
T1456 |
advmod |
often,is |
| R777 |
T1466 |
T1456 |
acomp |
sharp,is |
| R778 |
T1467 |
T1456 |
cc |
and,is |
| R779 |
T1468 |
T1456 |
conj |
lies,is |
| R780 |
T1469 |
T1468 |
prep |
in,lies |
| R781 |
T1470 |
T1469 |
pobj |
register,in |
| R782 |
T1471 |
T1470 |
prep |
with,register |
| R783 |
T1472 |
T1473 |
det |
the,limbs |
| R784 |
T1473 |
T1471 |
pobj |
limbs,with |
| R785 |
T1474 |
T1418 |
punct |
.,is |
| R786 |
T1476 |
T1477 |
prep |
In,brought |
| R787 |
T1478 |
T1476 |
pobj |
rodents,In |
| R788 |
T1479 |
T1478 |
cc |
and,rodents |
| R789 |
T1480 |
T1481 |
advmod |
probably,mammals |
| R792 |
T1483 |
T1477 |
punct |
", ",brought |
| R793 |
T1484 |
T1485 |
det |
this,difference |
| R796 |
T1487 |
T1485 |
prep |
in,difference |
| R797 |
T1488 |
T1489 |
compound |
hair,color |