PMC:3062687
Annnotations
bionlp-st-ge-2016-uniprot
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T239 | 0-4 | O14920 | denotes | IKKβ |
| T240 | 31-35 | P23396 | denotes | RPS3 |
| T241 | 208-212 | P23396 | denotes | RPS3 |
| T242 | 303-307 | P23396 | denotes | RPS3 |
| T243 | 364-368 | O14920 | denotes | IKKβ |
| T244 | 422-426 | P23396 | denotes | RPS3 |
| T245 | 559-564 | P23396 | denotes | NleH1 |
| T246 | 588-592 | P23396 | denotes | RPS3 |
| T247 | 626-630 | P23396 | denotes | RPS3 |
| T248 | 771-775 | O14920 | denotes | IKKβ |
| T249 | 827-831 | P23396 | denotes | RPS3 |
| T1132 | 1179-1182 | Q04864 | denotes | Rel |
| T1133 | 1203-1207 | Q04206 | denotes | RelA |
| T1134 | 1203-1207 | Q04206-3 | denotes | RelA |
| T1135 | 1209-1212 | Q04206 | denotes | p65 |
| T1136 | 1209-1212 | P21579 | denotes | p65 |
| T1137 | 1215-1219 | Q01201 | denotes | RelB |
| T1138 | 1221-1226 | Q04864 | denotes | c-Rel |
| T1139 | 1223-1226 | Q04864 | denotes | Rel |
| T1140 | 1228-1231 | P19838 | denotes | p50 |
| T1141 | 1237-1240 | Q00653 | denotes | p52 |
| T1142 | 1316-1320 | P23396 | denotes | RPS3 |
| T1143 | 1335-1338 | Q04864 | denotes | Rel |
| T1144 | 1383-1387 | P23396 | denotes | RPS3 |
| T1145 | 1564-1568 | P23396 | denotes | RPS3 |
| T1146 | 1908-1913 | P23396 | denotes | NleH1 |
| T1147 | 1980-1984 | P23396 | denotes | RPS3 |
| T1148 | 2026-2029 | P21579 | denotes | p65 |
| T1149 | 2026-2029 | Q04206 | denotes | p65 |
| T1150 | 2103-2107 | P23396 | denotes | RPS3 |
| T1151 | 2266-2270 | P23396 | denotes | RPS3 |
| T1152 | 2353-2357 | P23396 | denotes | RPS3 |
| T1153 | 2487-2491 | P23396 | denotes | RPS3 |
| T1154 | 2611-2616 | P26358 | denotes | aimed |
| T1155 | 2672-2676 | P23396 | denotes | RPS3 |
| T1156 | 2762-2766 | O14920 | denotes | IKKβ |
| T1157 | 2783-2787 | P23396 | denotes | RPS3 |
| T1158 | 2810-2814 | P23396 | denotes | RPS3 |
| T1159 | 2888-2892 | P23396 | denotes | RPS3 |
| T1160 | 3018-3022 | P23396 | denotes | RPS3 |
| T2157 | 3126-3130 | P23396 | denotes | RPS3 |
| T2158 | 3195-3199 | P23396 | denotes | RPS3 |
| T2159 | 3284-3305 | P01375 | denotes | tumor necrosis factor |
| T2160 | 3307-3310 | P01375 | denotes | TNF |
| T2161 | 3345-3349 | P23396 | denotes | RPS3 |
| T2162 | 3458-3461 | P01375 | denotes | TNF |
| T2163 | 3497-3501 | P23396 | denotes | RPS3 |
| T2164 | 3540-3544 | P23396 | denotes | RPS3 |
| T2165 | 3597-3601 | P23396 | denotes | RPS3 |
| T2166 | 3718-3721 | P01375 | denotes | TNF |
| T2167 | 3821-3825 | P25963 | denotes | IκBα |
| T2168 | 3864-3868 | P23396 | denotes | RPS3 |
| T2169 | 4027-4031 | P23396 | denotes | RPS3 |
| T2807 | 4044-4048 | P23396 | denotes | RPS3 |
| T2808 | 4053-4057 | O14920 | denotes | IKKβ |
| T2809 | 4199-4203 | O14920 | denotes | IKKβ |
| T2810 | 4322-4326 | P23396 | denotes | RPS3 |
| T2811 | 4359-4362 | P21579 | denotes | p65 |
| T2812 | 4359-4362 | Q04206 | denotes | p65 |
| T2813 | 4363-4366 | P19838 | denotes | p50 |
| T2814 | 4367-4371 | P25963 | denotes | IκBα |
| T2815 | 4441-4445 | O14920 | denotes | IKKβ |
| T2816 | 4483-4487 | P23396 | denotes | RPS3 |
| T2817 | 4532-4536 | O14920 | denotes | IKKβ |
| T2818 | 4541-4545 | P23396 | denotes | RPS3 |
| T2819 | 4639-4643 | O14920 | denotes | IKKβ |
| T2820 | 4644-4648 | P23396 | denotes | RPS3 |
| T2821 | 4775-4779 | P23396 | denotes | RPS3 |
| T2822 | 4780-4784 | O14920 | denotes | IKKβ |
| T2823 | 4824-4827 | P01375 | denotes | TNF |
| T2824 | 4901-4905 | P23396 | denotes | RPS3 |
| T2825 | 4997-5001 | P23396 | denotes | RPS3 |
| T3830 | 5023-5027 | O14920 | denotes | IKKβ |
| T3831 | 5044-5048 | P23396 | denotes | RPS3 |
| T3832 | 5094-5098 | P23396 | denotes | RPS3 |
| T3833 | 5099-5103 | O14920 | denotes | IKKβ |
| T3834 | 5132-5136 | P23396 | denotes | RPS3 |
| T3835 | 5184-5188 | O14920 | denotes | IKKβ |
| T3836 | 5273-5277 | P23396 | denotes | RPS3 |
| T3837 | 5325-5328 | P01375 | denotes | TNF |
| T3838 | 5349-5353 | P23396 | denotes | RPS3 |
| T3839 | 5456-5460 | P23396 | denotes | RPS3 |
| T3840 | 5566-5570 | O14920 | denotes | IKKβ |
| T3841 | 5592-5596 | P23396 | denotes | RPS3 |
| T3842 | 5721-5725 | O14920 | denotes | IKKβ |
| T3843 | 5778-5782 | P23396 | denotes | RPS3 |
| T3844 | 5850-5853 | Q04206 | denotes | p65 |
| T3845 | 5850-5853 | P21579 | denotes | p65 |
| T3846 | 5971-5975 | P23396 | denotes | RPS3 |
| T3847 | 6073-6077 | O14920 | denotes | IKKβ |
| T3848 | 6135-6139 | O14920 | denotes | IKKβ |
| T3849 | 6164-6174 | P08659 | denotes | luciferase |
| T3850 | 6218-6222 | P23396 | denotes | RPS3 |
| T3851 | 6245-6249 | O14920 | denotes | IKKβ |
| T3852 | 6320-6324 | P23396 | denotes | RPS3 |
| T3853 | 6373-6377 | O14920 | denotes | IKKβ |
| T3854 | 6457-6461 | P23396 | denotes | RPS3 |
| T3855 | 6482-6486 | O14920 | denotes | IKKβ |
| T3856 | 6523-6527 | O14920 | denotes | IKKβ |
| T3857 | 6593-6597 | O14920 | denotes | IKKβ |
| T3858 | 6639-6643 | P23396 | denotes | RPS3 |
| T5567 | 6708-6712 | P25963 | denotes | IκBα |
| T5568 | 6729-6733 | P23396 | denotes | RPS3 |
| T5569 | 6805-6808 | Q04864 | denotes | Rel |
| T5570 | 6825-6829 | P23396 | denotes | RPS3 |
| T5571 | 6958-6961 | P21579 | denotes | p65 |
| T5572 | 6958-6961 | Q04206 | denotes | p65 |
| T5573 | 6997-7001 | P23396 | denotes | RPS3 |
| T5574 | 7076-7080 | P23396 | denotes | RPS3 |
| T5575 | 7146-7149 | P01375 | denotes | TNF |
| T5576 | 7209-7213 | P23396 | denotes | RPS3 |
| T5577 | 7306-7310 | P25963 | denotes | IκBα |
| T5578 | 7362-7365 | Q04206 | denotes | p65 |
| T5579 | 7362-7365 | P21579 | denotes | p65 |
| T5580 | 7376-7380 | P23396 | denotes | RPS3 |
| T5581 | 7385-7389 | P25963 | denotes | IκBα |
| T5582 | 7398-7401 | Q04206 | denotes | p65 |
| T5583 | 7398-7401 | P21579 | denotes | p65 |
| T5584 | 7459-7463 | P25963 | denotes | IκBα |
| T5585 | 7510-7514 | P23396 | denotes | RPS3 |
| T5586 | 7547-7551 | P23396 | denotes | RPS3 |
| T5587 | 7607-7611 | P25963 | denotes | IκBα |
| T5588 | 7618-7622 | P25963 | denotes | IκBα |
| T5589 | 7650-7654 | O14920 | denotes | IKKβ |
| T5590 | 7732-7736 | P25963 | denotes | IκBα |
| T5591 | 7738-7741 | P01375 | denotes | TNF |
| T5592 | 7783-7787 | P23396 | denotes | RPS3 |
| T5593 | 7886-7890 | P23396 | denotes | RPS3 |
| T5594 | 7962-7966 | P25963 | denotes | IκBα |
| T5595 | 7997-8001 | P25963 | denotes | IκBα |
| T5596 | 8045-8049 | P23396 | denotes | RPS3 |
| T5597 | 8090-8094 | P23396 | denotes | RPS3 |
| T5598 | 8130-8134 | P23396 | denotes | RPS3 |
| T5599 | 8150-8154 | P25963 | denotes | IκBα |
| T5600 | 8219-8223 | P25963 | denotes | IκBα |
| T5601 | 8244-8248 | P25963 | denotes | IκBα |
| T5602 | 8301-8305 | P23396 | denotes | RPS3 |
| T5603 | 8386-8390 | P23396 | denotes | RPS3 |
| T5604 | 8474-8478 | P25963 | denotes | IκBα |
| T5605 | 8576-8580 | P23396 | denotes | RPS3 |
| T5606 | 8659-8663 | P23396 | denotes | RPS3 |
| T5607 | 8682-8686 | P25963 | denotes | IκBα |
| T5608 | 8864-8868 | P23396 | denotes | RPS3 |
| T5609 | 8875-8879 | P25963 | denotes | IκBα |
| T5610 | 8907-8910 | P01375 | denotes | TNF |
| T5611 | 8967-8971 | P23396 | denotes | RPS3 |
| T5612 | 9010-9013 | P01375 | denotes | TNF |
| T5613 | 9049-9053 | P25963 | denotes | IκBα |
| T5614 | 9133-9137 | P23396 | denotes | RPS3 |
| T5615 | 9243-9247 | O14920 | denotes | IKKβ |
| T5616 | 9267-9271 | P23396 | denotes | RPS3 |
| T7633 | 9287-9291 | O14920 | denotes | IKKβ |
| T7634 | 9307-9311 | P23396 | denotes | RPS3 |
| T7635 | 9395-9399 | O14920 | denotes | IKKβ |
| T7636 | 9463-9468 | O95999 | denotes | Bcl10 |
| T7637 | 9552-9556 | O14920 | denotes | IKKβ |
| T7638 | 9586-9590 | P23396 | denotes | RPS3 |
| T7639 | 9644-9648 | P23396 | denotes | RPS3 |
| T7640 | 9729-9733 | O14920 | denotes | IKKβ |
| T7641 | 9784-9788 | P25963 | denotes | IκBα |
| T7642 | 9896-9900 | O14920 | denotes | IKKβ |
| T7643 | 9934-9938 | P23396 | denotes | RPS3 |
| T7644 | 9966-9970 | O14920 | denotes | IKKβ |
| T7645 | 10045-10049 | P23396 | denotes | RPS3 |
| T7646 | 10090-10094 | O14920 | denotes | IKKβ |
| T7647 | 10195-10199 | P23396 | denotes | RPS3 |
| T7648 | 10228-10232 | O14920 | denotes | IKKβ |
| T7649 | 10269-10273 | P23396 | denotes | RPS3 |
| T7650 | 10296-10300 | P23396 | denotes | RPS3 |
| T7651 | 10599-10603 | O14920 | denotes | IKKβ |
| T7652 | 10707-10711 | P23396 | denotes | RPS3 |
| T7653 | 10786-10790 | O14920 | denotes | IKKβ |
| T7654 | 10800-10804 | P23396 | denotes | RPS3 |
| T7655 | 10943-10947 | P23396 | denotes | RPS3 |
| T7656 | 10959-10963 | P23396 | denotes | RPS3 |
| T7657 | 11140-11144 | O14920 | denotes | IKKβ |
| T7658 | 11298-11302 | P23396 | denotes | RPS3 |
| T7659 | 11368-11372 | O14920 | denotes | IKKβ |
| T7660 | 11487-11491 | O14920 | denotes | IKKβ |
| T7661 | 11507-11511 | P23396 | denotes | RPS3 |
| T7662 | 11579-11583 | P23396 | denotes | RPS3 |
| T7663 | 11608-11612 | O14920 | denotes | IKKβ |
| T7664 | 11665-11669 | O14920 | denotes | IKKβ |
| T7665 | 11684-11688 | P23396 | denotes | RPS3 |
| T7666 | 11833-11837 | O14920 | denotes | IKKβ |
| T7667 | 11898-11902 | P23396 | denotes | RPS3 |
| T7668 | 11942-11946 | P23396 | denotes | RPS3 |
| T7669 | 12006-12009 | P01375 | denotes | TNF |
| T7670 | 12043-12047 | P23396 | denotes | RPS3 |
| T9793 | 12135-12139 | P23396 | denotes | RPS3 |
| T9794 | 12254-12258 | P23396 | denotes | RPS3 |
| T9795 | 12344-12348 | P23396 | denotes | RPS3 |
| T9796 | 12608-12612 | P23396 | denotes | RPS3 |
| T9797 | 12655-12659 | P23396 | denotes | RPS3 |
| T9798 | 12780-12784 | O14920 | denotes | IKKβ |
| T9799 | 12788-12792 | P23396 | denotes | RPS3 |
| T9800 | 12816-12820 | O14920 | denotes | IKKβ |
| T9801 | 12864-12874 | P08659 | denotes | luciferase |
| T9802 | 12978-12982 | P23396 | denotes | RPS3 |
| T9803 | 13084-13088 | P23396 | denotes | RPS3 |
| T9804 | 13159-13163 | P23396 | denotes | RPS3 |
| T9805 | 13218-13222 | P23396 | denotes | RPS3 |
| T9806 | 13301-13305 | P23396 | denotes | RPS3 |
| T9807 | 13378-13382 | P23396 | denotes | RPS3 |
| T9808 | 13414-13418 | P23396 | denotes | RPS3 |
| T9809 | 13453-13457 | P23396 | denotes | RPS3 |
| T9810 | 13546-13550 | P23396 | denotes | RPS3 |
| T9811 | 13629-13633 | P23396 | denotes | RPS3 |
| T9812 | 13652-13655 | P01375 | denotes | TNF |
| T9813 | 13694-13704 | P08659 | denotes | luciferase |
| T9814 | 13740-13750 | P08659 | denotes | luciferase |
| T9815 | 13768-13772 | P23396 | denotes | RPS3 |
| T9816 | 13852-13856 | P23396 | denotes | RPS3 |
| T9817 | 13940-13944 | P23396 | denotes | RPS3 |
| T9818 | 13956-13966 | P08659 | denotes | luciferase |
| T9819 | 14085-14088 | Q9U6Y4 | denotes | GFP |
| T9820 | 14151-14155 | P23396 | denotes | RPS3 |
| T9821 | 14220-14224 | P23396 | denotes | RPS3 |
| T9822 | 14406-14410 | P23396 | denotes | RPS3 |
| T9823 | 14415-14418 | Q04206 | denotes | p65 |
| T9824 | 14415-14418 | P21579 | denotes | p65 |
| T9825 | 14500-14504 | P23396 | denotes | RPS3 |
| T9826 | 14618-14622 | P23396 | denotes | RPS3 |
| T9827 | 14646-14652 | P25963 | denotes | NFKBIA |
| T9828 | 14657-14660 | P10145 | denotes | IL8 |
| T9829 | 14699-14703 | P23396 | denotes | RPS3 |
| T9830 | 14727-14730 | P21579 | denotes | p65 |
| T9831 | 14727-14730 | Q04206 | denotes | p65 |
| T9832 | 14782-14785 | P21579 | denotes | p65 |
| T9833 | 14782-14785 | Q04206 | denotes | p65 |
| T9834 | 14846-14849 | P21579 | denotes | p65 |
| T9835 | 14846-14849 | Q04206 | denotes | p65 |
| T9836 | 14864-14868 | P23396 | denotes | RPS3 |
| T9837 | 14917-14921 | P01589 | denotes | CD25 |
| T9838 | 15034-15038 | P23396 | denotes | RPS3 |
| T9839 | 15042-15045 | Q04206 | denotes | p65 |
| T9840 | 15042-15045 | P21579 | denotes | p65 |
| T9841 | 15061-15065 | P60709 | denotes | ACTB |
| T9842 | 15177-15181 | P23396 | denotes | RPS3 |
| T9843 | 15223-15226 | Q04206 | denotes | p65 |
| T9844 | 15223-15226 | P21579 | denotes | p65 |
| T9845 | 15262-15275 | P10145 | denotes | Interleukin 8 |
| T9846 | 15277-15281 | P10145 | denotes | IL-8 |
| T9847 | 15404-15408 | P23396 | denotes | RPS3 |
| T9848 | 15409-15412 | P21579 | denotes | p65 |
| T9849 | 15409-15412 | Q04206 | denotes | p65 |
| T9850 | 15432-15435 | P10145 | denotes | IL8 |
| T9851 | 15499-15503 | P23396 | denotes | RPS3 |
| T9852 | 15551-15555 | P01589 | denotes | CD25 |
| T9853 | 15614-15618 | P23396 | denotes | RPS3 |
| T9854 | 15673-15677 | P23396 | denotes | RPS3 |
| T9855 | 15702-15706 | O14920 | denotes | IKKβ |
| T9856 | 15734-15738 | P23396 | denotes | RPS3 |
| T12387 | 15797-15802 | P23396 | denotes | NleH1 |
| T12388 | 15812-15816 | P23396 | denotes | RPS3 |
| T12389 | 16148-16153 | P23396 | denotes | NleH1 |
| T12390 | 16178-16182 | P23396 | denotes | RPS3 |
| T12391 | 16221-16225 | P23396 | denotes | RPS3 |
| T12392 | 16285-16290 | P23396 | denotes | NleH1 |
| T12393 | 16318-16322 | P23396 | denotes | RPS3 |
| T12394 | 16393-16398 | P23396 | denotes | NleH1 |
| T12395 | 16501-16506 | P23396 | denotes | NleH1 |
| T12396 | 16520-16523 | P01375 | denotes | TNF |
| T12397 | 16550-16554 | P23396 | denotes | RPS3 |
| T12398 | 16627-16632 | P23396 | denotes | NleH1 |
| T12399 | 16664-16667 | P01375 | denotes | TNF |
| T12400 | 16694-16698 | P25963 | denotes | IκBα |
| T12401 | 16740-16745 | P23396 | denotes | NleH1 |
| T12402 | 16756-16759 | P21579 | denotes | p65 |
| T12403 | 16756-16759 | Q04206 | denotes | p65 |
| T12404 | 16810-16815 | P23396 | denotes | NleH1 |
| T12405 | 16825-16829 | P23396 | denotes | RPS3 |
| T12406 | 16928-16933 | P23396 | denotes | nleH1 |
| T12407 | 16935-16941 | P23396 | denotes | ΔnleH1 |
| T12408 | 17003-17008 | P23396 | denotes | NleH1 |
| T12409 | 17031-17036 | Q7DB71 | denotes | ΔescN |
| T12410 | 17060-17063 | P01375 | denotes | TNF |
| T12411 | 17107-17111 | P23396 | denotes | RPS3 |
| T12412 | 17180-17184 | P23396 | denotes | RPS3 |
| T12413 | 17302-17305 | P01375 | denotes | TNF |
| T12414 | 17314-17318 | P23396 | denotes | RPS3 |
| T12415 | 17385-17391 | P23396 | denotes | ΔnleH1 |
| T12416 | 17395-17400 | Q7DB71 | denotes | ΔescN |
| T12417 | 17457-17463 | P23396 | denotes | ΔnleH1 |
| T12418 | 17467-17472 | Q7DB71 | denotes | ΔescN |
| T12419 | 17514-17517 | P01375 | denotes | TNF |
| T12420 | 17526-17530 | P23396 | denotes | RPS3 |
| T12421 | 17576-17580 | P23396 | denotes | RPS3 |
| T12422 | 17728-17732 | P23396 | denotes | RPS3 |
| T12423 | 17813-17818 | P23396 | denotes | NleH1 |
| T12424 | 17828-17832 | P23396 | denotes | RPS3 |
| T12425 | 17891-17895 | P23396 | denotes | RPS3 |
| T12426 | 17944-17947 | P10145 | denotes | IL8 |
| T12427 | 17949-17955 | P25963 | denotes | NFKBIA |
| T12428 | 17961-17968 | P21580 | denotes | TNFAIP3 |
| T12429 | 18128-18134 | P23396 | denotes | ΔnleH1 |
| T12430 | 18138-18143 | Q7DB71 | denotes | ΔescN |
| T12431 | 18185-18190 | P23396 | denotes | nleH1 |
| T12432 | 18226-18230 | P23396 | denotes | RPS3 |
| T12433 | 18260-18264 | P01589 | denotes | CD25 |
| T12434 | 18343-18348 | P23396 | denotes | NleH1 |
| T12435 | 18423-18427 | P23396 | denotes | RPS3 |
| T12436 | 18480-18484 | P23396 | denotes | RPS3 |
| T13936 | 18516-18521 | P23396 | denotes | NleH1 |
| T13937 | 18531-18535 | P23396 | denotes | RPS3 |
| T13938 | 18665-18671 | P23396 | denotes | ΔnleH1 |
| T13939 | 18771-18777 | P23396 | denotes | ΔnleH1 |
| T13940 | 19007-19012 | P23396 | denotes | NleH1 |
| T13941 | 19021-19025 | P23396 | denotes | RPS3 |
| T13942 | 19075-19079 | P23396 | denotes | RPS3 |
| T13943 | 19223-19227 | P23396 | denotes | RPS3 |
| T13944 | 19361-19365 | P23396 | denotes | RPS3 |
| T13945 | 19409-19415 | P23396 | denotes | ΔnleH1 |
| T13946 | 19432-19436 | P23396 | denotes | RPS3 |
| T13947 | 19510-19515 | P23396 | denotes | NleH1 |
| T13948 | 19525-19529 | P23396 | denotes | RPS3 |
| T15646 | 19647-19652 | P23396 | denotes | NleH1 |
| T15647 | 19664-19668 | O14920 | denotes | IKKβ |
| T15648 | 19693-19698 | P23396 | denotes | NleH1 |
| T15649 | 19824-19829 | P23396 | denotes | NleH1 |
| T15650 | 19839-19843 | P23396 | denotes | RPS3 |
| T15651 | 19938-19943 | P23396 | denotes | NleH1 |
| T15652 | 19969-19974 | P23396 | denotes | NleH1 |
| T15653 | 20008-20013 | P23396 | denotes | NleH1 |
| T15654 | 20056-20061 | P23396 | denotes | NleH1 |
| T15655 | 20147-20152 | P23396 | denotes | NleH1 |
| T15656 | 20164-20168 | O14920 | denotes | IKKβ |
| T15657 | 20188-20192 | P23396 | denotes | RPS3 |
| T15658 | 20254-20259 | P23396 | denotes | NleH1 |
| T15659 | 20285-20290 | P23396 | denotes | NleH1 |
| T15660 | 20324-20327 | P01375 | denotes | TNF |
| T15661 | 20336-20340 | P23396 | denotes | RPS3 |
| T15662 | 20420-20425 | P23396 | denotes | NleH1 |
| T15663 | 20465-20469 | P23396 | denotes | RPS3 |
| T15664 | 20475-20479 | O14920 | denotes | IKKβ |
| T15665 | 20663-20667 | P23396 | denotes | RPS3 |
| T15666 | 20694-20698 | P23396 | denotes | RPS3 |
| T15667 | 20715-20725 | P08659 | denotes | luciferase |
| T15668 | 20770-20775 | P23396 | denotes | NleH1 |
| T15669 | 20797-20801 | P23396 | denotes | RPS3 |
| T15670 | 20904-20907 | P01375 | denotes | TNF |
| T15671 | 20953-20957 | P23396 | denotes | RPS3 |
| T15672 | 21011-21015 | P23396 | denotes | RPS3 |
| T15673 | 21113-21117 | P23396 | denotes | RPS3 |
| T15674 | 21262-21267 | P23396 | denotes | NleH1 |
| T15675 | 21390-21395 | P23396 | denotes | NleH1 |
| T15676 | 21439-21444 | P23396 | denotes | NleH1 |
| T15677 | 21462-21465 | P01375 | denotes | TNF |
| T15678 | 21474-21478 | P23396 | denotes | RPS3 |
| T15679 | 21551-21555 | P23396 | denotes | RPS3 |
| T15680 | 21628-21633 | P23396 | denotes | NleH1 |
| T15681 | 21671-21675 | P23396 | denotes | RPS3 |
| T15682 | 21750-21755 | P23396 | denotes | NleH1 |
| T15683 | 21825-21829 | P23396 | denotes | RPS3 |
| T15684 | 21867-21871 | O14920 | denotes | IKKβ |
| T15685 | 21873-21877 | O14920 | denotes | IKKβ |
| T15686 | 21959-21963 | O14920 | denotes | IKKβ |
| T15687 | 21989-21993 | P23396 | denotes | RPS3 |
| T15688 | 22037-22041 | O14920 | denotes | IKKβ |
| T15689 | 22068-22072 | P23396 | denotes | RPS3 |
| T15690 | 22217-22223 | P23396 | denotes | ΔnleH1 |
| T15691 | 22227-22232 | Q7DB71 | denotes | ΔescN |
| T15692 | 22264-22268 | P23396 | denotes | RPS3 |
| T15693 | 22301-22305 | O14920 | denotes | IKKβ |
| T15694 | 22310-22314 | O14920 | denotes | IKKβ |
| T15695 | 22401-22405 | P23396 | denotes | RPS3 |
| T15696 | 22431-22435 | O14920 | denotes | IKKβ |
| T15697 | 22525-22530 | P23396 | denotes | NleH1 |
| T15698 | 22565-22569 | P23396 | denotes | RPS3 |
| T15699 | 22642-22646 | O14920 | denotes | IKKβ |
| T15700 | 22668-22673 | P23396 | denotes | NleH1 |
| T15701 | 22703-22707 | O14920 | denotes | IKKβ |
| T15702 | 22724-22728 | O14920 | denotes | IKKβ |
| T15703 | 22738-22742 | P23396 | denotes | RPS3 |
| T15704 | 22831-22835 | O14920 | denotes | IKKβ |
| T15705 | 22876-22881 | P23396 | denotes | NleH1 |
| T15706 | 22901-22905 | O14920 | denotes | IKKβ |
| T15707 | 22944-22949 | P23396 | denotes | NleH1 |
| T15708 | 23039-23043 | O14920 | denotes | IKKβ |
| T15709 | 23138-23143 | P23396 | denotes | NleH1 |
| T15710 | 23160-23164 | O14920 | denotes | IKKβ |
| T15711 | 23277-23281 | O14920 | denotes | IKKβ |
| T15712 | 23296-23300 | O14920 | denotes | IKKβ |
| T15713 | 23316-23320 | P23396 | denotes | RPS3 |
| T15714 | 23347-23351 | P25963 | denotes | IκBα |
| T15715 | 23469-23473 | O14920 | denotes | IKKβ |
| T15716 | 23479-23484 | P23396 | denotes | NleH1 |
| T15717 | 23493-23497 | O14920 | denotes | IKKβ |
| T15718 | 23507-23511 | P23396 | denotes | RPS3 |
| T15719 | 23570-23574 | O14920 | denotes | IKKβ |
| T15720 | 23588-23592 | P25963 | denotes | IκBα |
| T15721 | 23685-23690 | P23396 | denotes | NleH1 |
| T15722 | 23742-23746 | P23396 | denotes | RPS3 |
| T15723 | 23754-23758 | P25963 | denotes | IκBα |
| T15724 | 23786-23791 | P23396 | denotes | NleH1 |
| T15725 | 23832-23836 | O14920 | denotes | IKKβ |
| T15726 | 23857-23861 | O14920 | denotes | IKKβ |
| T15727 | 23871-23875 | P23396 | denotes | RPS3 |
| T18781 | 24005-24009 | P23396 | denotes | RPS3 |
| T18782 | 24183-24187 | P23396 | denotes | RPS3 |
| T18783 | 24273-24277 | O14920 | denotes | IKKβ |
| T18784 | 24287-24291 | P23396 | denotes | RPS3 |
| T18785 | 24449-24453 | O14920 | denotes | IKKβ |
| T18786 | 24586-24590 | P23396 | denotes | RPS3 |
| T18787 | 24716-24720 | O14920 | denotes | IKKβ |
| T18788 | 24815-24819 | O14920 | denotes | IKKβ |
| T18789 | 24850-24854 | P23396 | denotes | RPS3 |
| T18790 | 24915-24919 | P23396 | denotes | RPS3 |
| T18791 | 25049-25052 | P21579 | denotes | p65 |
| T18792 | 25049-25052 | Q04206 | denotes | p65 |
| T18793 | 25144-25148 | O14920 | denotes | IKKβ |
| T18794 | 25190-25194 | P23396 | denotes | RPS3 |
| T18795 | 25246-25250 | O14920 | denotes | IKKβ |
| T18796 | 25308-25312 | P23396 | denotes | RPS3 |
| T18797 | 25378-25382 | P23396 | denotes | RPS3 |
| T18798 | 25534-25538 | P23396 | denotes | RPS3 |
| T18799 | 25687-25691 | O14920 | denotes | IKKβ |
| T18800 | 25701-25705 | P23396 | denotes | RPS3 |
| T18801 | 25831-25836 | P23396 | denotes | NleH1 |
| T18802 | 25859-25863 | P23396 | denotes | RPS3 |
| T18803 | 25997-26002 | P23396 | denotes | NleH1 |
| T18804 | 26024-26028 | P23396 | denotes | RPS3 |
| T18805 | 26167-26172 | P23396 | denotes | NleH1 |
| T18806 | 26204-26208 | O14920 | denotes | IKKβ |
| T18807 | 26254-26258 | O14920 | denotes | IKKβ |
| T18808 | 26268-26272 | P23396 | denotes | RPS3 |
| T18809 | 26424-26429 | P23396 | denotes | NleH1 |
| T18810 | 26468-26472 | O14920 | denotes | IKKβ |
| T18811 | 26739-26744 | P23396 | denotes | NleH1 |
| T18812 | 26777-26781 | P23396 | denotes | RPS3 |
| T18813 | 26911-26914 | P10145 | denotes | IL8 |
| T18814 | 26919-26922 | P01375 | denotes | TNF |
| T18815 | 26937-26942 | P23396 | denotes | NleH1 |
| T18816 | 26964-26967 | P21579 | denotes | p65 |
| T18817 | 26964-26967 | Q04206 | denotes | p65 |
| T18818 | 27019-27022 | Q04206 | denotes | p65 |
| T18819 | 27019-27022 | P21579 | denotes | p65 |
| T18820 | 27037-27041 | P23396 | denotes | RPS3 |
| T18821 | 27186-27190 | P23396 | denotes | RPS3 |
| T18822 | 27229-27234 | P23396 | denotes | NleH1 |
| T18823 | 27830-27834 | P23396 | denotes | RPS3 |
| T18824 | 27853-27856 | Q04206 | denotes | p65 |
| T18825 | 27853-27856 | P21579 | denotes | p65 |
| T18826 | 28136-28140 | P23396 | denotes | RPS3 |
| T20205 | 28402-28406 | P25963 | denotes | IκBα |
| T20206 | 28423-28426 | P21579 | denotes | p65 |
| T20207 | 28423-28426 | Q04206 | denotes | p65 |
| T20208 | 28527-28534 | P60709 | denotes | β-actin |
| T20209 | 28719-28723 | O14920 | denotes | IKKβ |
| T20210 | 28873-28877 | P25963 | denotes | IκBα |
| T20211 | 29086-29090 | P23396 | denotes | RPS3 |
| T20212 | 29195-29199 | P23396 | denotes | RPS3 |
| T20625 | 29326-29330 | O14920 | denotes | IKKβ |
| T20626 | 29344-29348 | O14920 | denotes | IKKβ |
| T20627 | 29364-29368 | P25963 | denotes | IκBα |
| T20628 | 29484-29488 | P25963 | denotes | IκBα |
| T20629 | 29493-29497 | O14920 | denotes | IKKβ |
| T20630 | 29563-29567 | P23396 | denotes | RPS3 |
| T20631 | 29573-29577 | P23396 | denotes | RPS3 |
| T20632 | 29582-29586 | P23396 | denotes | RPS3 |
| T20633 | 29595-29600 | P23396 | denotes | NleH1 |
| T20634 | 29665-29669 | P23396 | denotes | RPS3 |
| T20905 | 30115-30118 | P01375 | denotes | TNF |
| T20906 | 30232-30236 | P23396 | denotes | RPS3 |
| T21148 | 30296-30300 | O14920 | denotes | IKKβ |
| T21149 | 30439-30443 | P25963 | denotes | IκBα |
| T21150 | 30474-30478 | P23396 | denotes | RPS3 |
| T21151 | 30483-30487 | P23396 | denotes | RPS3 |
| T21152 | 30693-30695 | P0A7Z4 | denotes | pH |
| T21153 | 30762-30767 | P23396 | denotes | NleH1 |
| T21154 | 30801-30803 | P0A7Z4 | denotes | pH |
| T21438 | 31013-31017 | P23396 | denotes | RPS3 |
| T21439 | 31049-31053 | O14920 | denotes | IKKβ |
| T21599 | 31526-31530 | O14920 | denotes | IKKβ |
| T21600 | 31566-31570 | P25963 | denotes | IκBα |
| T21601 | 31606-31610 | P23396 | denotes | RPS3 |
| T21862 | 31963-31965 | P0A7Z4 | denotes | pH |
| T22106 | 32510-32520 | P08659 | denotes | Luciferase |
| T22107 | 32542-32552 | P08659 | denotes | Luciferase |
| T22108 | 32705-32715 | P08659 | denotes | luciferase |
| T22109 | 32742-32752 | P08659 | denotes | luciferase |
| T22110 | 32922-32932 | P08659 | denotes | Luciferase |
| T22254 | 33114-33117 | P10145 | denotes | IL8 |
| T22255 | 33122-33128 | P25963 | denotes | NFKBIA |
| T22256 | 33141-33145 | P60709 | denotes | ACTB |
| T22422 | 33474-33478 | P23396 | denotes | RPS3 |
| T22800 | 33873-33875 | P0A7Z4 | denotes | pH |
| T23136 | 35151-35155 | P10145 | denotes | IL-8 |
| T23137 | 35242-35255 | P10145 | denotes | Interleukin-8 |
| T23282 | 35706-35710 | P23396 | denotes | RPS3 |
2_test
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| 21399639-17072322-74765153 | 4304-4306 | 17072322 | denotes | 20 |
| 21399639-17072322-74765153 | 4304-4306 | 17072322 | denotes | 20 |
| 21399639-10602462-74765153 | 4304-4306 | 10602462 | denotes | 20 |
| 21399639-10602462-74765153 | 4304-4306 | 10602462 | denotes | 20 |
| 21399639-10740266-74765153 | 4304-4306 | 10740266 | denotes | 20 |
| 21399639-10740266-74765153 | 4304-4306 | 10740266 | denotes | 20 |
| 21399639-18045535-74765154 | 4407-4408 | 18045535 | denotes | 6 |
| 21399639-18045535-74765154 | 4407-4408 | 18045535 | denotes | 6 |
| 21399639-18045535-74765155 | 5453-5454 | 18045535 | denotes | 6 |
| 21399639-18045535-74765155 | 5453-5454 | 18045535 | denotes | 6 |
| 21399639-18462924-74765156 | 6817-6819 | 18462924 | denotes | 23 |
| 21399639-18462924-74765156 | 6817-6819 | 18462924 | denotes | 23 |
| 21399639-15677444-74765157 | 6821-6823 | 15677444 | denotes | 24 |
| 21399639-15677444-74765157 | 6821-6823 | 15677444 | denotes | 24 |
| 21399639-18045535-74765158 | 6975-6976 | 18045535 | denotes | 6 |
| 21399639-18045535-74765158 | 6975-6976 | 18045535 | denotes | 6 |
| 21399639-8797825-74765159 | 8527-8529 | 8797825 | denotes | 25 |
| 21399639-8797825-74765159 | 8527-8529 | 8797825 | denotes | 25 |
| 21399639-17537731-74765159 | 8527-8529 | 17537731 | denotes | 25 |
| 21399639-17537731-74765159 | 8527-8529 | 17537731 | denotes | 25 |
| 21399639-12429743-74765159 | 8527-8529 | 12429743 | denotes | 25 |
| 21399639-12429743-74765159 | 8527-8529 | 12429743 | denotes | 25 |
| 21399639-10837071-74765160 | 9391-9393 | 10837071 | denotes | 19 |
| 21399639-10837071-74765160 | 9391-9393 | 10837071 | denotes | 19 |
| 21399639-16818229-74765161 | 9517-9519 | 16818229 | denotes | 28 |
| 21399639-16818229-74765161 | 9517-9519 | 16818229 | denotes | 28 |
| 21399639-18045535-74765162 | 13185-13186 | 18045535 | denotes | 6 |
| 21399639-18045535-74765162 | 13185-13186 | 18045535 | denotes | 6 |
| 21399639-20066093-74765163 | 13188-13189 | 20066093 | denotes | 7 |
| 21399639-20066093-74765163 | 13188-13189 | 20066093 | denotes | 7 |
| 21399639-19997086-74765164 | 13191-13193 | 19997086 | denotes | 30 |
| 21399639-19997086-74765164 | 13191-13193 | 19997086 | denotes | 30 |
| 21399639-18045535-74765165 | 13714-13715 | 18045535 | denotes | 6 |
| 21399639-18045535-74765165 | 13714-13715 | 18045535 | denotes | 6 |
| 21399639-18045535-74765166 | 15001-15002 | 18045535 | denotes | 6 |
| 21399639-18045535-74765166 | 15001-15002 | 18045535 | denotes | 6 |
| 21399639-8852900-74765167 | 15941-15943 | 8852900 | denotes | 31 |
| 21399639-8852900-74765167 | 15941-15943 | 8852900 | denotes | 31 |
| 21399639-20041225-74765168 | 16094-16095 | 20041225 | denotes | 9 |
| 21399639-20041225-74765168 | 16094-16095 | 20041225 | denotes | 9 |
| 21399639-20126447-74765169 | 16097-16099 | 20126447 | denotes | 33 |
| 21399639-20126447-74765169 | 16097-16099 | 20126447 | denotes | 33 |
| 21399639-20485572-74765169 | 16097-16099 | 20485572 | denotes | 33 |
| 21399639-20485572-74765169 | 16097-16099 | 20485572 | denotes | 33 |
| 21399639-21091507-74765169 | 16097-16099 | 21091507 | denotes | 33 |
| 21399639-21091507-74765169 | 16097-16099 | 21091507 | denotes | 33 |
| 21399639-21113130-74765169 | 16097-16099 | 21113130 | denotes | 33 |
| 21399639-21113130-74765169 | 16097-16099 | 21113130 | denotes | 33 |
| 21399639-20833837-74765169 | 16097-16099 | 20833837 | denotes | 33 |
| 21399639-20833837-74765169 | 16097-16099 | 20833837 | denotes | 33 |
| 21399639-21187904-74765169 | 16097-16099 | 21187904 | denotes | 33 |
| 21399639-21187904-74765169 | 16097-16099 | 21187904 | denotes | 33 |
| 21399639-20041225-74765170 | 16251-16252 | 20041225 | denotes | 9 |
| 21399639-20041225-74765170 | 16251-16252 | 20041225 | denotes | 9 |
| 21399639-20041225-74765171 | 16486-16487 | 20041225 | denotes | 9 |
| 21399639-20041225-74765171 | 16486-16487 | 20041225 | denotes | 9 |
| 21399639-20041225-74765172 | 16781-16782 | 20041225 | denotes | 9 |
| 21399639-20041225-74765172 | 16781-16782 | 20041225 | denotes | 9 |
| 21399639-20041225-74765173 | 17552-17553 | 20041225 | denotes | 9 |
| 21399639-20041225-74765173 | 17552-17553 | 20041225 | denotes | 9 |
| 21399639-20041225-74765174 | 18912-18913 | 20041225 | denotes | 9 |
| 21399639-20041225-74765174 | 18912-18913 | 20041225 | denotes | 9 |
| 21399639-20041225-74765175 | 19787-19788 | 20041225 | denotes | 9 |
| 21399639-20041225-74765175 | 19787-19788 | 20041225 | denotes | 9 |
| 21399639-12657048-74765176 | 20595-20597 | 12657048 | denotes | 39 |
| 21399639-12657048-74765176 | 20595-20597 | 12657048 | denotes | 39 |
| 21399639-20041225-74765177 | 20782-20783 | 20041225 | denotes | 9 |
| 21399639-20041225-74765177 | 20782-20783 | 20041225 | denotes | 9 |
| 21399639-18045535-74765178 | 24112-24113 | 18045535 | denotes | 6 |
| 21399639-18045535-74765178 | 24112-24113 | 18045535 | denotes | 6 |
| 21399639-17047224-74765179 | 24570-24572 | 17047224 | denotes | 40 |
| 21399639-17047224-74765179 | 24570-24572 | 17047224 | denotes | 40 |
| 21399639-16818647-74765180 | 25090-25092 | 16818647 | denotes | 41 |
| 21399639-16818647-74765180 | 25090-25092 | 16818647 | denotes | 41 |
| 21399639-10938077-74765180 | 25090-25092 | 10938077 | denotes | 41 |
| 21399639-10938077-74765180 | 25090-25092 | 10938077 | denotes | 41 |
| 21399639-15033982-74765180 | 25090-25092 | 15033982 | denotes | 41 |
| 21399639-15033982-74765180 | 25090-25092 | 15033982 | denotes | 41 |
| 21399639-20041225-74765181 | 25971-25972 | 20041225 | denotes | 9 |
| 21399639-20041225-74765181 | 25971-25972 | 20041225 | denotes | 9 |
| 21399639-18045535-74765182 | 29128-29129 | 18045535 | denotes | 6 |
| 21399639-18045535-74765182 | 29128-29129 | 18045535 | denotes | 6 |
| 21399639-8622650-74765183 | 29546-29548 | 8622650 | denotes | 44 |
| 21399639-8622650-74765183 | 29546-29548 | 8622650 | denotes | 44 |
| 21399639-9710600-74765184 | 29550-29552 | 9710600 | denotes | 45 |
| 21399639-9710600-74765184 | 29550-29552 | 9710600 | denotes | 45 |
| 21399639-18045535-74765185 | 29638-29639 | 18045535 | denotes | 6 |
| 21399639-18045535-74765185 | 29638-29639 | 18045535 | denotes | 6 |
| 21399639-20041225-74765186 | 29641-29642 | 20041225 | denotes | 9 |
| 21399639-20041225-74765186 | 29641-29642 | 20041225 | denotes | 9 |
| 21399639-18045535-74765187 | 31770-31771 | 18045535 | denotes | 6 |
| 21399639-18045535-74765187 | 31770-31771 | 18045535 | denotes | 6 |
| 21399639-18045535-74765188 | 31894-31895 | 18045535 | denotes | 6 |
| 21399639-18045535-74765188 | 31894-31895 | 18045535 | denotes | 6 |
| 21399639-18045535-74765189 | 32612-32613 | 18045535 | denotes | 6 |
| 21399639-18045535-74765189 | 32612-32613 | 18045535 | denotes | 6 |
| 21399639-18045535-74765190 | 33035-33036 | 18045535 | denotes | 6 |
| 21399639-18045535-74765190 | 33035-33036 | 18045535 | denotes | 6 |
| 21399639-18045535-74765191 | 33165-33166 | 18045535 | denotes | 6 |
| 21399639-18045535-74765191 | 33165-33166 | 18045535 | denotes | 6 |
| 21399639-18045535-74765192 | 33256-33257 | 18045535 | denotes | 6 |
| 21399639-18045535-74765192 | 33256-33257 | 18045535 | denotes | 6 |
| 21399639-18045535-74765193 | 34695-34696 | 18045535 | denotes | 6 |
| 21399639-18045535-74765193 | 34695-34696 | 18045535 | denotes | 6 |
| 21399639-20041225-74765194 | 35449-35450 | 20041225 | denotes | 9 |
| 21399639-20041225-74765194 | 35449-35450 | 20041225 | denotes | 9 |
| 21399639-20041225-74765195 | 35560-35561 | 20041225 | denotes | 9 |
| 21399639-20041225-74765195 | 35560-35561 | 20041225 | denotes | 9 |
pmc-enju-pas
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T100 | 0-4 | NN | denotes | IKKβ |
| T101 | 5-20 | NN | denotes | phosphorylation |
| T102 | 21-30 | VB | denotes | regulates |
| T103 | 31-35 | NN | denotes | RPS3 |
| T104 | 36-43 | JJ | denotes | nuclear |
| T105 | 44-57 | NN | denotes | translocation |
| T106 | 58-61 | CC | denotes | and |
| T107 | 62-67 | NN | denotes | NF-κB |
| T108 | 68-76 | NN | denotes | function |
| T109 | 77-95 | NN | denotes | during Escherichia |
| T110 | 96-105 | NN | denotes | coli O157 |
| T111 | 105-106 | -COLON- | denotes | : |
| T112 | 106-108 | NN | denotes | H7 |
| T113 | 109-118 | NN | denotes | infection |
| T114 | 130-135 | NN | denotes | NF-κB |
| T115 | 136-138 | VB | denotes | is |
| T116 | 139-140 | DT | denotes | a |
| T117 | 141-146 | JJ | denotes | major |
| T118 | 147-151 | NN | denotes | gene |
| T119 | 152-161 | NN | denotes | regulator |
| T120 | 162-164 | IN | denotes | in |
| T121 | 165-171 | JJ | denotes | immune |
| T122 | 172-181 | NN | denotes | responses |
| T123 | 182-185 | CC | denotes | and |
| T124 | 186-195 | JJ | denotes | ribosomal |
| T125 | 196-203 | NN | denotes | protein |
| T126 | 204-206 | NN | denotes | S3 |
| T127 | 207-208 | -LRB- | denotes | ( |
| T128 | 208-212 | NN | denotes | RPS3 |
| T129 | 212-213 | -RRB- | denotes | ) |
| T130 | 214-216 | VB | denotes | is |
| T131 | 217-219 | DT | denotes | an |
| T132 | 220-225 | NN | denotes | NF-κB |
| T133 | 226-233 | NN | denotes | subunit |
| T134 | 234-238 | WDT | denotes | that |
| T135 | 239-246 | VB | denotes | directs |
| T136 | 247-255 | JJ | denotes | specific |
| T137 | 256-260 | NN | denotes | gene |
| T138 | 261-274 | NN | denotes | transcription |
| T139 | 276-283 | RB | denotes | However |
| T140 | 283-284 | -COMMA- | denotes | , |
| T141 | 285-287 | PRP | denotes | it |
| T142 | 288-290 | VB | denotes | is |
| T143 | 291-298 | JJ | denotes | unknown |
| T144 | 299-302 | WRB | denotes | how |
| T145 | 303-307 | NN | denotes | RPS3 |
| T146 | 308-315 | JJ | denotes | nuclear |
| T147 | 316-329 | NN | denotes | translocation |
| T148 | 330-332 | VB | denotes | is |
| T149 | 333-342 | VB | denotes | regulated |
| T150 | 344-348 | RB | denotes | Here |
| T151 | 349-351 | PRP | denotes | we |
| T152 | 352-358 | VB | denotes | report |
| T153 | 359-363 | IN | denotes | that |
| T154 | 364-368 | NN | denotes | IKKβ |
| T155 | 369-384 | NN | denotes | phosphorylation |
| T156 | 385-387 | IN | denotes | of |
| T157 | 388-394 | NN | denotes | serine |
| T158 | 395-398 | CD | denotes | 209 |
| T159 | 399-400 | -LRB- | denotes | ( |
| T160 | 400-404 | NN | denotes | S209 |
| T161 | 404-405 | -RRB- | denotes | ) |
| T162 | 406-409 | VB | denotes | was |
| T163 | 410-417 | JJ | denotes | crucial |
| T164 | 418-421 | IN | denotes | for |
| T165 | 422-426 | NN | denotes | RPS3 |
| T166 | 427-434 | JJ | denotes | nuclear |
| T167 | 435-447 | NN | denotes | localization |
| T168 | 448-450 | IN | denotes | in |
| T169 | 451-459 | NN | denotes | response |
| T170 | 460-462 | TO | denotes | to |
| T171 | 463-473 | VB | denotes | activating |
| T172 | 474-481 | NN | denotes | stimuli |
| T173 | 483-491 | RB | denotes | Moreover |
| T174 | 491-492 | -COMMA- | denotes | , |
| T175 | 493-496 | DT | denotes | the |
| T176 | 497-506 | JJ | denotes | foodborne |
| T177 | 507-515 | NN | denotes | pathogen |
| T178 | 516-527 | FW | denotes | Escherichia |
| T179 | 528-532 | FW | denotes | coli |
| T180 | 533-537 | NN | denotes | O157 |
| T181 | 537-538 | -COLON- | denotes | : |
| T182 | 538-540 | NN | denotes | H7 |
| T183 | 541-550 | NN | denotes | virulence |
| T184 | 551-558 | NN | denotes | protein |
| T185 | 559-564 | NN | denotes | NleH1 |
| T186 | 565-577 | RB | denotes | specifically |
| T187 | 578-587 | VB | denotes | inhibited |
| T188 | 588-592 | NN | denotes | RPS3 |
| T189 | 593-597 | NN | denotes | S209 |
| T190 | 598-613 | NN | denotes | phosphorylation |
| T191 | 614-617 | CC | denotes | and |
| T192 | 618-625 | VB | denotes | blocked |
| T193 | 626-630 | NN | denotes | RPS3 |
| T194 | 631-639 | NN | denotes | function |
| T195 | 639-640 | -COMMA- | denotes | , |
| T196 | 641-648 | RB | denotes | thereby |
| T197 | 649-658 | VB | denotes | promoting |
| T198 | 659-668 | JJ | denotes | bacterial |
| T199 | 669-681 | NN | denotes | colonization |
| T200 | 682-685 | CC | denotes | and |
| T201 | 686-694 | NN | denotes | diarrhea |
| T202 | 695-698 | CC | denotes | but |
| T203 | 699-709 | VB | denotes | decreasing |
| T204 | 710-719 | NN | denotes | mortality |
| T205 | 720-722 | IN | denotes | in |
| T206 | 723-724 | DT | denotes | a |
| T207 | 725-736 | JJ | denotes | gnotobiotic |
| T208 | 737-743 | NN | denotes | piglet |
| T209 | 744-753 | NN | denotes | infection |
| T210 | 754-759 | NN | denotes | model |
| T211 | 761-765 | RB | denotes | Thus |
| T212 | 765-766 | -COMMA- | denotes | , |
| T213 | 767-770 | DT | denotes | the |
| T214 | 771-785 | JJ | denotes | IKKβ-dependent |
| T215 | 786-798 | NN | denotes | modification |
| T216 | 799-801 | IN | denotes | of |
| T217 | 802-803 | DT | denotes | a |
| T218 | 804-812 | JJ | denotes | specific |
| T219 | 813-818 | NN | denotes | amino |
| T220 | 819-823 | NN | denotes | acid |
| T221 | 824-826 | IN | denotes | in |
| T222 | 827-831 | NN | denotes | RPS3 |
| T223 | 832-840 | VB | denotes | promotes |
| T224 | 841-849 | JJ | denotes | specific |
| T225 | 850-855 | NN | denotes | NF-κB |
| T226 | 856-865 | NN | denotes | functions |
| T227 | 866-870 | WDT | denotes | that |
| T228 | 871-879 | VB | denotes | underlie |
| T229 | 880-883 | DT | denotes | the |
| T230 | 884-893 | JJ | denotes | molecular |
| T231 | 894-906 | JJ | denotes | pathogenetic |
| T232 | 907-917 | NN | denotes | mechanisms |
| T233 | 918-920 | IN | denotes | of |
| T234 | 921-923 | FW | denotes | E. |
| T235 | 924-928 | FW | denotes | coli |
| T236 | 929-933 | NN | denotes | O157 |
| T237 | 933-934 | -COLON- | denotes | : |
| T238 | 934-936 | NN | denotes | H7 |
| T793 | 939-946 | JJ | denotes | Nuclear |
| T794 | 947-959 | NN | denotes | Factor-kappa |
| T795 | 960-961 | NN | denotes | B |
| T796 | 962-963 | -LRB- | denotes | ( |
| T797 | 963-968 | NN | denotes | NF-κB |
| T798 | 968-969 | -RRB- | denotes | ) |
| T799 | 970-979 | VB | denotes | regulates |
| T800 | 980-987 | JJ | denotes | crucial |
| T801 | 988-996 | JJ | denotes | cellular |
| T802 | 997-1006 | NN | denotes | functions |
| T803 | 1007-1010 | CC | denotes | and |
| T804 | 1011-1018 | JJ | denotes | diverse |
| T805 | 1019-1026 | NN | denotes | stimuli |
| T806 | 1027-1035 | VB | denotes | activate |
| T807 | 1036-1040 | DT | denotes | this |
| T808 | 1041-1052 | JJ | denotes | pleiotropic |
| T809 | 1053-1066 | NN | denotes | transcription |
| T810 | 1067-1073 | NN | denotes | factor |
| T811 | 1073-1074 | -COMMA- | denotes | , |
| T812 | 1075-1080 | WDT | denotes | which |
| T813 | 1081-1083 | IN | denotes | in |
| T814 | 1084-1088 | NN | denotes | turn |
| T815 | 1089-1098 | VB | denotes | regulates |
| T816 | 1099-1100 | DT | denotes | a |
| T817 | 1101-1105 | JJ | denotes | vast |
| T818 | 1106-1111 | NN | denotes | array |
| T819 | 1112-1114 | IN | denotes | of |
| T820 | 1115-1122 | JJ | denotes | genetic |
| T821 | 1123-1133 | NN | denotes | targets1-3 |
| T822 | 1135-1138 | DT | denotes | The |
| T823 | 1139-1149 | JJ | denotes | best-known |
| T824 | 1150-1159 | JJ | denotes | mammalian |
| T825 | 1160-1165 | NN | denotes | NF-κB |
| T826 | 1166-1174 | NN | denotes | subunits |
| T827 | 1175-1178 | VB | denotes | are |
| T828 | 1179-1182 | NN | denotes | Rel |
| T829 | 1183-1191 | NN | denotes | proteins |
| T830 | 1191-1192 | -COMMA- | denotes | , |
| T831 | 1193-1202 | VB | denotes | including |
| T832 | 1203-1207 | NN | denotes | RelA |
| T833 | 1208-1209 | -LRB- | denotes | ( |
| T834 | 1209-1212 | NN | denotes | p65 |
| T835 | 1212-1213 | -RRB- | denotes | ) |
| T836 | 1213-1214 | -COMMA- | denotes | , |
| T837 | 1215-1219 | NN | denotes | RelB |
| T838 | 1219-1220 | -COMMA- | denotes | , |
| T839 | 1221-1226 | NN | denotes | c-Rel |
| T840 | 1226-1227 | -COMMA- | denotes | , |
| T841 | 1228-1231 | NN | denotes | p50 |
| T842 | 1231-1232 | -COMMA- | denotes | , |
| T843 | 1233-1236 | CC | denotes | and |
| T844 | 1237-1240 | NN | denotes | p52 |
| T845 | 1241-1242 | -LRB- | denotes | ( |
| T846 | 1242-1246 | NN | denotes | refs |
| T847 | 1248-1252 | CD | denotes | 4, 5 |
| T848 | 1252-1253 | -RRB- | denotes | ) |
| T849 | 1255-1262 | RB | denotes | However |
| T850 | 1262-1263 | -COMMA- | denotes | , |
| T851 | 1264-1266 | PRP | denotes | we |
| T852 | 1267-1275 | RB | denotes | recently |
| T853 | 1276-1288 | VB | denotes | demonstrated |
| T854 | 1289-1293 | IN | denotes | that |
| T855 | 1294-1303 | JJ | denotes | ribosomal |
| T856 | 1304-1311 | NN | denotes | protein |
| T857 | 1312-1314 | NN | denotes | S3 |
| T858 | 1315-1316 | -LRB- | denotes | ( |
| T859 | 1316-1320 | NN | denotes | RPS3 |
| T860 | 1320-1321 | -RRB- | denotes | ) |
| T861 | 1322-1324 | VB | denotes | is |
| T862 | 1325-1326 | DT | denotes | a |
| T863 | 1327-1330 | JJ | denotes | key |
| T864 | 1331-1338 | JJ | denotes | non-Rel |
| T865 | 1339-1346 | NN | denotes | subunit |
| T866 | 1347-1349 | IN | denotes | of |
| T867 | 1350-1357 | JJ | denotes | certain |
| T868 | 1358-1364 | JJ | denotes | native |
| T869 | 1365-1370 | NN | denotes | NF-κB |
| T870 | 1371-1381 | NN | denotes | complexes6 |
| T871 | 1383-1387 | NN | denotes | RPS3 |
| T872 | 1388-1390 | VB | denotes | is |
| T873 | 1391-1398 | VB | denotes | defined |
| T874 | 1399-1401 | IN | denotes | as |
| T875 | 1402-1403 | DT | denotes | a |
| T876 | 1404-1415 | JJ | denotes | “specifier” |
| T877 | 1416-1423 | NN | denotes | subunit |
| T878 | 1424-1426 | IN | denotes | of |
| T879 | 1427-1432 | NN | denotes | NF-κB |
| T880 | 1432-1433 | -COMMA- | denotes | , |
| T881 | 1434-1441 | IN | denotes | because |
| T882 | 1442-1444 | PRP | denotes | it |
| T883 | 1445-1456 | VB | denotes | facilitates |
| T884 | 1457-1461 | JJ | denotes | high |
| T885 | 1462-1470 | NN | denotes | affinity |
| T886 | 1471-1474 | NN | denotes | DNA |
| T887 | 1475-1482 | NN | denotes | binding |
| T888 | 1483-1487 | RB | denotes | thus |
| T889 | 1488-1499 | VB | denotes | determining |
| T890 | 1500-1503 | DT | denotes | the |
| T891 | 1504-1514 | JJ | denotes | regulatory |
| T892 | 1515-1526 | NN | denotes | specificity |
| T893 | 1527-1529 | IN | denotes | of |
| T894 | 1530-1535 | NN | denotes | NF-κB |
| T895 | 1536-1539 | IN | denotes | for |
| T896 | 1540-1548 | VB | denotes | selected |
| T897 | 1549-1555 | NN | denotes | target |
| T898 | 1556-1562 | NN | denotes | genes7 |
| T899 | 1564-1568 | NN | denotes | RPS3 |
| T900 | 1569-1579 | NN | denotes | regulation |
| T901 | 1580-1582 | IN | denotes | of |
| T902 | 1583-1588 | NN | denotes | NF-κB |
| T903 | 1589-1596 | NN | denotes | governs |
| T904 | 1597-1600 | JJ | denotes | key |
| T905 | 1601-1614 | JJ | denotes | physiological |
| T906 | 1615-1624 | NN | denotes | processes |
| T907 | 1624-1625 | -COMMA- | denotes | , |
| T908 | 1626-1635 | VB | denotes | including |
| T909 | 1636-1650 | NN | denotes | immunoglobulin |
| T910 | 1651-1652 | JJ | denotes | κ |
| T911 | 1653-1658 | JJ | denotes | light |
| T912 | 1659-1664 | NN | denotes | chain |
| T913 | 1665-1669 | NN | denotes | gene |
| T914 | 1670-1680 | NN | denotes | expression |
| T915 | 1681-1684 | CC | denotes | and |
| T916 | 1685-1693 | NN | denotes | receptor |
| T917 | 1694-1701 | NN | denotes | editing |
| T918 | 1702-1704 | IN | denotes | in |
| T919 | 1705-1706 | NN | denotes | B |
| T920 | 1707-1716 | NN | denotes | cells6, 8 |
| T921 | 1716-1717 | -COMMA- | denotes | , |
| T922 | 1718-1726 | NN | denotes | cytokine |
| T923 | 1727-1737 | NN | denotes | production |
| T924 | 1738-1740 | IN | denotes | in |
| T925 | 1741-1742 | NN | denotes | T |
| T926 | 1743-1749 | NN | denotes | cells6 |
| T927 | 1749-1750 | -COMMA- | denotes | , |
| T928 | 1751-1754 | CC | denotes | and |
| T929 | 1755-1757 | IN | denotes | in |
| T930 | 1758-1762 | NN | denotes | host |
| T931 | 1763-1770 | NN | denotes | defense |
| T932 | 1771-1778 | IN | denotes | against |
| T933 | 1779-1808 | FW | denotes | enterohemorrhagic Escherichia |
| T934 | 1809-1813 | FW | denotes | coli |
| T935 | 1814-1815 | -LRB- | denotes | ( |
| T936 | 1815-1819 | NN | denotes | EHEC |
| T937 | 1819-1820 | -RRB- | denotes | ) |
| T938 | 1820-1821 | CD | denotes | 9 |
| T939 | 1823-1825 | IN | denotes | In |
| T940 | 1826-1836 | JJ | denotes | particular |
| T941 | 1836-1837 | -COMMA- | denotes | , |
| T942 | 1838-1844 | NNP | denotes | the E. |
| T943 | 1845-1854 | NN | denotes | coli O157 |
| T944 | 1854-1855 | -COLON- | denotes | : |
| T945 | 1855-1857 | NN | denotes | H7 |
| T946 | 1858-1862 | NN | denotes | type |
| T947 | 1863-1866 | CD | denotes | III |
| T948 | 1867-1876 | NN | denotes | secretion |
| T949 | 1877-1883 | NN | denotes | system |
| T950 | 1884-1885 | -LRB- | denotes | ( |
| T951 | 1885-1889 | NN | denotes | T3SS |
| T952 | 1889-1890 | -RRB- | denotes | ) |
| T953 | 1891-1899 | NN | denotes | effector |
| T954 | 1900-1907 | NN | denotes | protein |
| T955 | 1908-1913 | NN | denotes | NleH1 |
| T956 | 1914-1925 | RB | denotes | selectively |
| T957 | 1926-1932 | VB | denotes | blocks |
| T958 | 1933-1938 | NN | denotes | NF-κB |
| T959 | 1939-1945 | NN | denotes | target |
| T960 | 1946-1950 | NN | denotes | gene |
| T961 | 1951-1964 | NN | denotes | transcription |
| T962 | 1965-1967 | IN | denotes | by |
| T963 | 1968-1979 | VB | denotes | attenuating |
| T964 | 1980-1984 | NN | denotes | RPS3 |
| T965 | 1985-1992 | JJ | denotes | nuclear |
| T966 | 1993-2006 | NN | denotes | translocation |
| T967 | 2006-2007 | -COMMA- | denotes | , |
| T968 | 2008-2015 | IN | denotes | without |
| T969 | 2016-2025 | VB | denotes | affecting |
| T970 | 2026-2029 | NN | denotes | p65 |
| T971 | 2030-2043 | NN | denotes | localization9 |
| T972 | 2045-2056 | RB | denotes | Nonetheless |
| T973 | 2056-2057 | -COMMA- | denotes | , |
| T974 | 2058-2061 | WRB | denotes | how |
| T975 | 2062-2070 | JJ | denotes | specific |
| T976 | 2071-2076 | NN | denotes | NF-κB |
| T977 | 2077-2087 | NN | denotes | activating |
| T978 | 2088-2095 | NN | denotes | signals |
| T979 | 2096-2102 | VB | denotes | induce |
| T980 | 2103-2107 | NN | denotes | RPS3 |
| T981 | 2108-2115 | JJ | denotes | nuclear |
| T982 | 2116-2129 | NN | denotes | translocation |
| T983 | 2130-2132 | VB | denotes | is |
| T984 | 2133-2157 | JJ | denotes | unknown. Extra-ribosomal |
| T985 | 2158-2167 | NN | denotes | functions |
| T986 | 2168-2172 | VB | denotes | have |
| T987 | 2173-2177 | VB | denotes | been |
| T988 | 2178-2186 | VB | denotes | ascribed |
| T989 | 2187-2189 | TO | denotes | to |
| T990 | 2190-2199 | JJ | denotes | ribosomal |
| T991 | 2200-2210 | NN | denotes | proteins10 |
| T992 | 2212-2219 | IN | denotes | Besides |
| T993 | 2220-2227 | NN | denotes | binding |
| T994 | 2228-2231 | NN | denotes | RNA |
| T995 | 2232-2238 | IN | denotes | within |
| T996 | 2239-2242 | DT | denotes | the |
| T997 | 2243-2246 | NN | denotes | 40S |
| T998 | 2247-2256 | JJ | denotes | ribosomal |
| T999 | 2257-2264 | NN | denotes | subunit |
| T1000 | 2264-2265 | -COMMA- | denotes | , |
| T1001 | 2266-2270 | NN | denotes | RPS3 |
| T1002 | 2271-2283 | VB | denotes | participates |
| T1003 | 2284-2286 | IN | denotes | in |
| T1004 | 2287-2301 | NN | denotes | transcription6 |
| T1005 | 2301-2302 | -COMMA- | denotes | , |
| T1006 | 2303-2306 | NN | denotes | DNA |
| T1007 | 2307-2319 | NN | denotes | repair11, 12 |
| T1008 | 2319-2320 | -COMMA- | denotes | , |
| T1009 | 2321-2324 | CC | denotes | and |
| T1010 | 2325-2336 | NN | denotes | apoptosis13 |
| T1011 | 2338-2345 | IN | denotes | Whether |
| T1012 | 2346-2348 | CC | denotes | or |
| T1013 | 2349-2352 | RB | denotes | not |
| T1014 | 2353-2357 | NN | denotes | RPS3 |
| T1015 | 2358-2360 | VB | denotes | is |
| T1016 | 2361-2375 | VB | denotes | phosphorylated |
| T1017 | 2376-2379 | VB | denotes | had |
| T1018 | 2380-2384 | VB | denotes | been |
| T1019 | 2385-2403 | JJ | denotes | controversial14-18 |
| T1020 | 2405-2410 | IN | denotes | Since |
| T1021 | 2411-2417 | NN | denotes | kinase |
| T1022 | 2418-2426 | NN | denotes | cascades |
| T1023 | 2427-2431 | VB | denotes | play |
| T1024 | 2432-2433 | DT | denotes | a |
| T1025 | 2434-2442 | JJ | denotes | critical |
| T1026 | 2443-2447 | NN | denotes | role |
| T1027 | 2448-2450 | IN | denotes | in |
| T1028 | 2451-2456 | NN | denotes | NF-κB |
| T1029 | 2457-2467 | NN | denotes | regulation |
| T1030 | 2467-2468 | -COMMA- | denotes | , |
| T1031 | 2469-2471 | PRP | denotes | we |
| T1032 | 2472-2478 | VB | denotes | tested |
| T1033 | 2479-2486 | IN | denotes | whether |
| T1034 | 2487-2491 | NN | denotes | RPS3 |
| T1035 | 2492-2494 | VB | denotes | is |
| T1036 | 2495-2509 | VB | denotes | phosphorylated |
| T1037 | 2510-2512 | IN | denotes | in |
| T1038 | 2513-2516 | DT | denotes | the |
| T1039 | 2517-2524 | NN | denotes | context |
| T1040 | 2525-2527 | IN | denotes | of |
| T1041 | 2528-2533 | NN | denotes | NF-κB |
| T1042 | 2534-2544 | NN | denotes | activation |
| T1043 | 2545-2548 | CC | denotes | and |
| T1044 | 2549-2555 | VB | denotes | sought |
| T1045 | 2556-2558 | TO | denotes | to |
| T1046 | 2559-2567 | VB | denotes | identify |
| T1047 | 2568-2571 | DT | denotes | the |
| T1048 | 2572-2583 | JJ | denotes | responsible |
| T1049 | 2584-2592 | NN | denotes | kinase19 |
| T1050 | 2594-2606 | RB | denotes | Additionally |
| T1051 | 2606-2607 | -COMMA- | denotes | , |
| T1052 | 2608-2610 | PRP | denotes | we |
| T1053 | 2611-2616 | VB | denotes | aimed |
| T1054 | 2617-2619 | TO | denotes | to |
| T1055 | 2620-2626 | VB | denotes | define |
| T1056 | 2627-2628 | DT | denotes | a |
| T1057 | 2629-2639 | JJ | denotes | regulatory |
| T1058 | 2640-2644 | NN | denotes | role |
| T1059 | 2645-2648 | IN | denotes | for |
| T1060 | 2649-2652 | DT | denotes | the |
| T1061 | 2653-2663 | JJ | denotes | C-terminal |
| T1062 | 2664-2668 | NN | denotes | tail |
| T1063 | 2669-2671 | IN | denotes | of |
| T1064 | 2672-2676 | NN | denotes | RPS3 |
| T1065 | 2677-2682 | WP-DOLLAR- | denotes | whose |
| T1066 | 2683-2691 | NN | denotes | function |
| T1067 | 2692-2695 | VB | denotes | was |
| T1068 | 2696-2709 | JJ | denotes | unknown. Here |
| T1069 | 2710-2712 | PRP | denotes | we |
| T1070 | 2713-2717 | VB | denotes | show |
| T1071 | 2718-2722 | IN | denotes | that |
| T1072 | 2723-2726 | DT | denotes | the |
| T1073 | 2727-2736 | NN | denotes | Inhibitor |
| T1074 | 2737-2739 | IN | denotes | of |
| T1075 | 2740-2742 | NN | denotes | κB |
| T1076 | 2743-2744 | -LRB- | denotes | ( |
| T1077 | 2744-2747 | NN | denotes | IκB |
| T1078 | 2747-2748 | -RRB- | denotes | ) |
| T1079 | 2749-2755 | NN | denotes | kinase |
| T1080 | 2756-2760 | NN | denotes | beta |
| T1081 | 2761-2762 | -LRB- | denotes | ( |
| T1082 | 2762-2766 | NN | denotes | IKKβ |
| T1083 | 2766-2767 | -RRB- | denotes | ) |
| T1084 | 2768-2782 | VB | denotes | phosphorylated |
| T1085 | 2783-2787 | NN | denotes | RPS3 |
| T1086 | 2788-2790 | IN | denotes | at |
| T1087 | 2791-2797 | NN | denotes | serine |
| T1088 | 2798-2801 | CD | denotes | 209 |
| T1089 | 2802-2803 | -LRB- | denotes | ( |
| T1090 | 2803-2807 | NN | denotes | S209 |
| T1091 | 2807-2808 | -RRB- | denotes | ) |
| T1092 | 2810-2814 | NN | denotes | RPS3 |
| T1093 | 2815-2819 | NN | denotes | S209 |
| T1094 | 2820-2835 | NN | denotes | phosphorylation |
| T1095 | 2836-2844 | VB | denotes | enhanced |
| T1096 | 2845-2848 | PRP-DOLLAR- | denotes | its |
| T1097 | 2849-2860 | NN | denotes | association |
| T1098 | 2861-2865 | IN | denotes | with |
| T1099 | 2866-2876 | NN | denotes | importin-α |
| T1100 | 2876-2877 | -COMMA- | denotes | , |
| T1101 | 2878-2887 | VB | denotes | mediating |
| T1102 | 2888-2892 | NN | denotes | RPS3 |
| T1103 | 2893-2898 | NN | denotes | entry |
| T1104 | 2899-2903 | IN | denotes | into |
| T1105 | 2904-2907 | DT | denotes | the |
| T1106 | 2908-2919 | NN | denotes | karyopherin |
| T1107 | 2920-2927 | NN | denotes | pathway |
| T1108 | 2928-2931 | IN | denotes | for |
| T1109 | 2932-2939 | JJ | denotes | nuclear |
| T1110 | 2940-2953 | NN | denotes | translocation |
| T1111 | 2955-2966 | RB | denotes | Furthermore |
| T1112 | 2966-2967 | -COMMA- | denotes | , |
| T1113 | 2968-2974 | NN | denotes | the E. |
| T1114 | 2975-2985 | NN | denotes | coli NleH1 |
| T1115 | 2986-2994 | NN | denotes | effector |
| T1116 | 2995-3007 | RB | denotes | specifically |
| T1117 | 3008-3017 | VB | denotes | inhibited |
| T1118 | 3018-3022 | NN | denotes | RPS3 |
| T1119 | 3023-3027 | NN | denotes | S209 |
| T1120 | 3028-3037 | VB | denotes | revealing |
| T1121 | 3038-3044 | NN | denotes | how E. |
| T1122 | 3045-3054 | NN | denotes | coli O157 |
| T1123 | 3054-3055 | -COLON- | denotes | : |
| T1124 | 3055-3057 | NN | denotes | H7 |
| T1125 | 3058-3066 | VB | denotes | inhibits |
| T1126 | 3067-3071 | DT | denotes | this |
| T1127 | 3072-3081 | JJ | denotes | important |
| T1128 | 3082-3088 | JJ | denotes | innate |
| T1129 | 3089-3095 | JJ | denotes | immune |
| T1130 | 3096-3104 | NN | denotes | response |
| T1131 | 3105-3114 | NN | denotes | mechanism |
| T2017 | 3126-3130 | NN | denotes | RPS3 |
| T2018 | 3131-3146 | NN | denotes | phosphorylation |
| T2019 | 3147-3149 | IN | denotes | in |
| T2020 | 3150-3158 | NN | denotes | response |
| T2021 | 3159-3161 | TO | denotes | to |
| T2022 | 3162-3167 | NN | denotes | NF-κB |
| T2023 | 3168-3178 | NN | denotes | activation |
| T2024 | 3179-3181 | TO | denotes | To |
| T2025 | 3182-3186 | VB | denotes | test |
| T2026 | 3187-3194 | IN | denotes | whether |
| T2027 | 3195-3199 | NN | denotes | RPS3 |
| T2028 | 3200-3202 | VB | denotes | is |
| T2029 | 3203-3217 | VB | denotes | phosphorylated |
| T2030 | 3218-3224 | IN | denotes | during |
| T2031 | 3225-3230 | NN | denotes | NF-κB |
| T2032 | 3231-3241 | NN | denotes | activation |
| T2033 | 3241-3242 | -COMMA- | denotes | , |
| T2034 | 3243-3245 | PRP | denotes | we |
| T2035 | 3246-3255 | VB | denotes | performed |
| T2036 | 3256-3268 | JJ | denotes | 32P-labeling |
| T2037 | 3269-3280 | NN | denotes | experiments |
| T2038 | 3281-3283 | IN | denotes | in |
| T2039 | 3284-3289 | NN | denotes | tumor |
| T2040 | 3290-3298 | NN | denotes | necrosis |
| T2041 | 3299-3305 | NN | denotes | factor |
| T2042 | 3306-3307 | -LRB- | denotes | ( |
| T2043 | 3307-3310 | NN | denotes | TNF |
| T2044 | 3310-3311 | -RRB- | denotes | ) |
| T2045 | 3311-3322 | JJ | denotes | -stimulated |
| T2046 | 3323-3326 | NN | denotes | HEK |
| T2047 | 3327-3331 | NN | denotes | 293T |
| T2048 | 3332-3337 | NN | denotes | cells |
| T2049 | 3339-3344 | IN | denotes | While |
| T2050 | 3345-3349 | NN | denotes | RPS3 |
| T2051 | 3350-3353 | VB | denotes | was |
| T2052 | 3354-3362 | RB | denotes | scarcely |
| T2053 | 3363-3377 | VB | denotes | phosphorylated |
| T2054 | 3378-3380 | IN | denotes | in |
| T2055 | 3381-3393 | JJ | denotes | unstimulated |
| T2056 | 3394-3399 | NN | denotes | cells |
| T2057 | 3399-3400 | -COMMA- | denotes | , |
| T2058 | 3401-3403 | PRP | denotes | we |
| T2059 | 3404-3412 | VB | denotes | observed |
| T2060 | 3413-3414 | DT | denotes | a |
| T2061 | 3415-3421 | JJ | denotes | marked |
| T2062 | 3422-3430 | NN | denotes | increase |
| T2063 | 3431-3433 | IN | denotes | in |
| T2064 | 3434-3451 | NN | denotes | 32P-incorporation |
| T2065 | 3452-3457 | IN | denotes | after |
| T2066 | 3458-3461 | NN | denotes | TNF |
| T2067 | 3462-3473 | NN | denotes | stimulation |
| T2068 | 3474-3481 | IN | denotes | despite |
| T2069 | 3482-3484 | DT | denotes | no |
| T2070 | 3485-3493 | NN | denotes | increase |
| T2071 | 3494-3496 | IN | denotes | in |
| T2072 | 3497-3501 | NN | denotes | RPS3 |
| T2073 | 3502-3509 | NN | denotes | protein |
| T2074 | 3510-3511 | -LRB- | denotes | ( |
| T2075 | 3511-3515 | NN | denotes | Fig. |
| T2076 | 3516-3518 | NN | denotes | 1a |
| T2077 | 3518-3519 | -RRB- | denotes | ) |
| T2078 | 3521-3523 | TO | denotes | To |
| T2079 | 3524-3533 | VB | denotes | determine |
| T2080 | 3534-3539 | WDT | denotes | which |
| T2081 | 3540-3544 | NN | denotes | RPS3 |
| T2082 | 3545-3553 | NN | denotes | residues |
| T2083 | 3554-3558 | VB | denotes | were |
| T2084 | 3559-3573 | VB | denotes | phosphorylated |
| T2085 | 3573-3574 | -COMMA- | denotes | , |
| T2086 | 3575-3577 | PRP | denotes | we |
| T2087 | 3578-3596 | VB | denotes | immunoprecipitated |
| T2088 | 3597-3601 | NN | denotes | RPS3 |
| T2089 | 3602-3606 | IN | denotes | from |
| T2090 | 3607-3613 | CC | denotes | either |
| T2091 | 3614-3621 | VB | denotes | resting |
| T2092 | 3622-3624 | CC | denotes | or |
| T2093 | 3625-3635 | VB | denotes | stimulated |
| T2094 | 3636-3641 | NN | denotes | cells |
| T2095 | 3642-3645 | CC | denotes | and |
| T2096 | 3646-3655 | VB | denotes | performed |
| T2097 | 3656-3670 | NN | denotes | immunoblotting |
| T2098 | 3671-3675 | IN | denotes | with |
| T2099 | 3676-3700 | JJ | denotes | phosphorylation-specific |
| T2100 | 3701-3711 | NN | denotes | antibodies |
| T2101 | 3713-3717 | CC | denotes | Both |
| T2102 | 3718-3721 | NN | denotes | TNF |
| T2103 | 3722-3725 | CC | denotes | and |
| T2104 | 3726-3733 | NN | denotes | phorbol |
| T2105 | 3734-3743 | NN | denotes | myristate |
| T2106 | 3744-3761 | NN | denotes | acetate/ionomycin |
| T2107 | 3762-3763 | -LRB- | denotes | ( |
| T2108 | 3763-3768 | NN | denotes | PMA+I |
| T2109 | 3768-3769 | -RRB- | denotes | ) |
| T2110 | 3770-3780 | VB | denotes | stimulated |
| T2111 | 3781-3786 | JJ | denotes | rapid |
| T2112 | 3787-3802 | NN | denotes | phosphorylation |
| T2113 | 3803-3806 | CC | denotes | and |
| T2114 | 3807-3817 | NN | denotes | degradaion |
| T2115 | 3818-3820 | IN | denotes | of |
| T2116 | 3821-3825 | NN | denotes | IκBα |
| T2117 | 3826-3832 | IN | denotes | within |
| T2118 | 3833-3834 | CD | denotes | 5 |
| T2119 | 3835-3838 | NN | denotes | min |
| T2120 | 3839-3844 | WDT | denotes | which |
| T2121 | 3845-3848 | VB | denotes | was |
| T2122 | 3849-3860 | VB | denotes | accompanied |
| T2123 | 3861-3863 | IN | denotes | by |
| T2124 | 3864-3868 | NN | denotes | RPS3 |
| T2125 | 3869-3884 | NN | denotes | phosphorylation |
| T2126 | 3885-3887 | IN | denotes | on |
| T2127 | 3888-3894 | NN | denotes | serine |
| T2128 | 3895-3903 | NN | denotes | residues |
| T2129 | 3904-3905 | -LRB- | denotes | ( |
| T2130 | 3905-3909 | NN | denotes | Fig. |
| T2131 | 3910-3912 | NN | denotes | 1b |
| T2132 | 3913-3916 | CC | denotes | and |
| T2133 | 3917-3921 | NN | denotes | data |
| T2134 | 3922-3925 | RB | denotes | not |
| T2135 | 3926-3931 | VB | denotes | shown |
| T2136 | 3931-3932 | -RRB- | denotes | ) |
| T2137 | 3932-3933 | -COMMA- | denotes | , |
| T2138 | 3934-3941 | JJ | denotes | similar |
| T2139 | 3942-3944 | TO | denotes | to |
| T2140 | 3945-3948 | DT | denotes | the |
| T2141 | 3949-3951 | FW | denotes | in |
| T2142 | 3952-3956 | FW | denotes | vivo |
| T2143 | 3957-3965 | NN | denotes | labeling |
| T2144 | 3967-3969 | PRP | denotes | We |
| T2145 | 3970-3973 | VB | denotes | did |
| T2146 | 3974-3977 | RB | denotes | not |
| T2147 | 3978-3984 | VB | denotes | detect |
| T2148 | 3985-3994 | NN | denotes | tyrosine- |
| T2149 | 3995-3997 | CC | denotes | or |
| T2150 | 3998-4023 | NN | denotes | threonine-phosphorylation |
| T2151 | 4024-4026 | IN | denotes | of |
| T2152 | 4027-4031 | NN | denotes | RPS3 |
| T2153 | 4032-4033 | -LRB- | denotes | ( |
| T2154 | 4033-4037 | NN | denotes | Fig. |
| T2155 | 4038-4040 | NN | denotes | 1b |
| T2156 | 4040-4041 | -RRB- | denotes | ) |
| T2641 | 4044-4048 | NN | denotes | RPS3 |
| T2642 | 4049-4052 | CC | denotes | and |
| T2643 | 4053-4057 | NN | denotes | IKKβ |
| T2644 | 4058-4069 | NN | denotes | interaction |
| T2645 | 4070-4073 | DT | denotes | The |
| T2646 | 4074-4084 | NN | denotes | activation |
| T2647 | 4085-4087 | IN | denotes | of |
| T2648 | 4088-4091 | DT | denotes | the |
| T2649 | 4092-4101 | NN | denotes | inhibitor |
| T2650 | 4102-4104 | IN | denotes | of |
| T2651 | 4105-4107 | NN | denotes | κB |
| T2652 | 4108-4114 | NN | denotes | kinase |
| T2653 | 4115-4116 | -LRB- | denotes | ( |
| T2654 | 4116-4119 | NN | denotes | IKK |
| T2655 | 4119-4120 | -RRB- | denotes | ) |
| T2656 | 4120-4121 | -COMMA- | denotes | , |
| T2657 | 4122-4132 | VB | denotes | consisting |
| T2658 | 4133-4135 | IN | denotes | of |
| T2659 | 4136-4137 | DT | denotes | a |
| T2660 | 4138-4148 | JJ | denotes | regulatory |
| T2661 | 4149-4156 | NN | denotes | subunit |
| T2662 | 4157-4161 | NN | denotes | IKKγ |
| T2663 | 4162-4165 | CC | denotes | and |
| T2664 | 4166-4169 | CD | denotes | two |
| T2665 | 4170-4179 | JJ | denotes | catalytic |
| T2666 | 4180-4188 | NN | denotes | subunits |
| T2667 | 4188-4189 | -COMMA- | denotes | , |
| T2668 | 4190-4194 | NN | denotes | IKKα |
| T2669 | 4195-4198 | CC | denotes | and |
| T2670 | 4199-4203 | NN | denotes | IKKβ |
| T2671 | 4203-4204 | -COMMA- | denotes | , |
| T2672 | 4205-4207 | VB | denotes | is |
| T2673 | 4208-4216 | JJ | denotes | critical |
| T2674 | 4217-4220 | IN | denotes | for |
| T2675 | 4221-4224 | DT | denotes | the |
| T2676 | 4225-4240 | NN | denotes | phosphorylation |
| T2677 | 4241-4244 | CC | denotes | and |
| T2678 | 4245-4253 | NN | denotes | dispatch |
| T2679 | 4254-4256 | IN | denotes | of |
| T2680 | 4257-4260 | DT | denotes | the |
| T2681 | 4261-4271 | JJ | denotes | inhibitory |
| T2682 | 4272-4276 | NN | denotes | IκBs |
| T2683 | 4277-4280 | CC | denotes | and |
| T2684 | 4281-4284 | DT | denotes | the |
| T2685 | 4285-4295 | NN | denotes | liberation |
| T2686 | 4296-4298 | IN | denotes | of |
| T2687 | 4299-4309 | NN | denotes | NF-κB20-22 |
| T2688 | 4311-4316 | VB | denotes | Given |
| T2689 | 4317-4321 | IN | denotes | that |
| T2690 | 4322-4326 | NN | denotes | RPS3 |
| T2691 | 4327-4330 | MD | denotes | can |
| T2692 | 4331-4333 | VB | denotes | be |
| T2693 | 4334-4339 | VB | denotes | found |
| T2694 | 4340-4342 | IN | denotes | in |
| T2695 | 4343-4346 | DT | denotes | the |
| T2696 | 4347-4358 | JJ | denotes | cytoplasmic |
| T2697 | 4359-4371 | NN | denotes | p65-p50-IκBα |
| T2698 | 4372-4382 | JJ | denotes | inhibitory |
| T2699 | 4383-4390 | NN | denotes | complex |
| T2700 | 4391-4393 | IN | denotes | in |
| T2701 | 4394-4401 | VB | denotes | resting |
| T2702 | 4402-4408 | NN | denotes | cells6 |
| T2703 | 4408-4409 | -COMMA- | denotes | , |
| T2704 | 4410-4412 | PRP | denotes | we |
| T2705 | 4413-4425 | VB | denotes | hypothesized |
| T2706 | 4426-4430 | IN | denotes | that |
| T2707 | 4431-4440 | VB | denotes | activated |
| T2708 | 4441-4445 | NN | denotes | IKKβ |
| T2709 | 4446-4451 | MD | denotes | might |
| T2710 | 4452-4456 | RB | denotes | also |
| T2711 | 4457-4461 | VB | denotes | bind |
| T2712 | 4462-4464 | TO | denotes | to |
| T2713 | 4465-4468 | CC | denotes | and |
| T2714 | 4469-4482 | VB | denotes | phosphorylate |
| T2715 | 4483-4487 | NN | denotes | RPS3 |
| T2716 | 4489-4494 | RB | denotes | First |
| T2717 | 4494-4495 | -COMMA- | denotes | , |
| T2718 | 4496-4498 | PRP | denotes | we |
| T2719 | 4499-4504 | VB | denotes | found |
| T2720 | 4505-4509 | IN | denotes | that |
| T2721 | 4510-4521 | RB | denotes | ectopically |
| T2722 | 4522-4531 | VB | denotes | expressed |
| T2723 | 4532-4536 | NN | denotes | IKKβ |
| T2724 | 4537-4540 | CC | denotes | and |
| T2725 | 4541-4545 | NN | denotes | RPS3 |
| T2726 | 4546-4556 | VB | denotes | interacted |
| T2727 | 4557-4558 | -LRB- | denotes | ( |
| T2728 | 4558-4562 | NNP | denotes | Fig. |
| T2729 | 4563-4565 | NN | denotes | 1c |
| T2730 | 4565-4566 | -RRB- | denotes | ) |
| T2731 | 4568-4570 | PRP | denotes | We |
| T2732 | 4571-4575 | RB | denotes | next |
| T2733 | 4576-4584 | VB | denotes | examined |
| T2734 | 4585-4592 | VB | denotes | resting |
| T2735 | 4593-4599 | NN | denotes | Jurkat |
| T2736 | 4600-4605 | NN | denotes | cells |
| T2737 | 4606-4609 | CC | denotes | and |
| T2738 | 4610-4618 | VB | denotes | detected |
| T2739 | 4619-4620 | DT | denotes | a |
| T2740 | 4621-4627 | JJ | denotes | modest |
| T2741 | 4628-4638 | JJ | denotes | endogenous |
| T2742 | 4639-4648 | NN | denotes | IKKβ-RPS3 |
| T2743 | 4649-4660 | NN | denotes | interaction |
| T2744 | 4661-4662 | -LRB- | denotes | ( |
| T2745 | 4662-4666 | NNP | denotes | Fig. |
| T2746 | 4667-4669 | NN | denotes | 1d |
| T2747 | 4669-4670 | -RRB- | denotes | ) |
| T2748 | 4670-4671 | -COMMA- | denotes | , |
| T2749 | 4672-4683 | RB | denotes | potentially |
| T2750 | 4684-4694 | VB | denotes | accounting |
| T2751 | 4695-4698 | IN | denotes | for |
| T2752 | 4699-4702 | DT | denotes | the |
| T2753 | 4703-4708 | JJ | denotes | basal |
| T2754 | 4709-4714 | NN | denotes | NF-κB |
| T2755 | 4715-4728 | NN | denotes | transcription |
| T2756 | 4729-4737 | VB | denotes | required |
| T2757 | 4738-4741 | IN | denotes | for |
| T2758 | 4742-4746 | NN | denotes | cell |
| T2759 | 4747-4760 | NN | denotes | proliferation |
| T2760 | 4761-4764 | CC | denotes | and |
| T2761 | 4765-4773 | NN | denotes | survival |
| T2762 | 4775-4784 | NN | denotes | RPS3-IKKβ |
| T2763 | 4785-4796 | NN | denotes | association |
| T2764 | 4797-4800 | VB | denotes | was |
| T2765 | 4801-4808 | RB | denotes | clearly |
| T2766 | 4809-4818 | VB | denotes | augmented |
| T2767 | 4819-4823 | IN | denotes | upon |
| T2768 | 4824-4827 | NN | denotes | TNF |
| T2769 | 4828-4839 | NN | denotes | stimulation |
| T2770 | 4839-4840 | -COMMA- | denotes | , |
| T2771 | 4841-4848 | VB | denotes | peaking |
| T2772 | 4849-4851 | IN | denotes | at |
| T2773 | 4852-4854 | CD | denotes | 10 |
| T2774 | 4855-4859 | NN | denotes | min. |
| T2775 | 4860-4861 | -LRB- | denotes | ( |
| T2776 | 4861-4865 | NNP | denotes | Fig. |
| T2777 | 4866-4868 | NN | denotes | 1d |
| T2778 | 4868-4869 | -RRB- | denotes | ) |
| T2779 | 4869-4870 | -COMMA- | denotes | , |
| T2780 | 4871-4880 | VB | denotes | following |
| T2781 | 4881-4888 | JJ | denotes | similar |
| T2782 | 4889-4897 | NN | denotes | kinetics |
| T2783 | 4898-4900 | TO | denotes | to |
| T2784 | 4901-4905 | NN | denotes | RPS3 |
| T2785 | 4906-4912 | NN | denotes | serine |
| T2786 | 4913-4928 | NN | denotes | phosphorylation |
| T2787 | 4929-4930 | -LRB- | denotes | ( |
| T2788 | 4930-4934 | NN | denotes | Fig. |
| T2789 | 4935-4937 | NN | denotes | 1b |
| T2790 | 4937-4938 | -RRB- | denotes | ) |
| T2791 | 4940-4942 | IN | denotes | By |
| T2792 | 4943-4951 | NN | denotes | contrast |
| T2793 | 4951-4952 | -COMMA- | denotes | , |
| T2794 | 4953-4958 | EX | denotes | there |
| T2795 | 4959-4962 | VB | denotes | was |
| T2796 | 4963-4965 | DT | denotes | no |
| T2797 | 4966-4976 | JJ | denotes | detectable |
| T2798 | 4977-4988 | NN | denotes | interaction |
| T2799 | 4989-4996 | IN | denotes | between |
| T2800 | 4997-5001 | NN | denotes | RPS3 |
| T2801 | 5002-5005 | CC | denotes | and |
| T2802 | 5006-5010 | NN | denotes | IKKα |
| T2803 | 5011-5012 | -LRB- | denotes | ( |
| T2804 | 5012-5016 | NNP | denotes | Fig. |
| T2805 | 5017-5019 | NN | denotes | 1d |
| T2806 | 5019-5020 | -RRB- | denotes | ) |
| T3544 | 5023-5027 | NN | denotes | IKKβ |
| T3545 | 5028-5030 | VB | denotes | is |
| T3546 | 5031-5039 | VB | denotes | required |
| T3547 | 5040-5043 | IN | denotes | for |
| T3548 | 5044-5048 | NN | denotes | RPS3 |
| T3549 | 5049-5056 | JJ | denotes | nuclear |
| T3550 | 5057-5070 | NN | denotes | translocation |
| T3551 | 5071-5073 | TO | denotes | To |
| T3552 | 5074-5081 | VB | denotes | examine |
| T3553 | 5082-5089 | IN | denotes | whether |
| T3554 | 5090-5093 | DT | denotes | the |
| T3555 | 5094-5103 | JJ | denotes | RPS3-IKKβ |
| T3556 | 5104-5115 | NN | denotes | interaction |
| T3557 | 5116-5118 | VB | denotes | is |
| T3558 | 5119-5127 | VB | denotes | required |
| T3559 | 5128-5131 | IN | denotes | for |
| T3560 | 5132-5136 | NN | denotes | RPS3 |
| T3561 | 5137-5144 | JJ | denotes | nuclear |
| T3562 | 5145-5158 | NN | denotes | translocation |
| T3563 | 5158-5159 | -COMMA- | denotes | , |
| T3564 | 5160-5162 | PRP | denotes | we |
| T3565 | 5163-5170 | VB | denotes | knocked |
| T3566 | 5171-5175 | RB | denotes | down |
| T3567 | 5176-5180 | NN | denotes | IKKα |
| T3568 | 5181-5183 | CC | denotes | or |
| T3569 | 5184-5188 | NN | denotes | IKKβ |
| T3570 | 5189-5199 | NN | denotes | expression |
| T3571 | 5200-5204 | IN | denotes | with |
| T3572 | 5205-5211 | NN | denotes | siRNAs |
| T3573 | 5212-5213 | -LRB- | denotes | ( |
| T3574 | 5213-5226 | NNP | denotes | Supplementary |
| T3575 | 5227-5231 | NNP | denotes | Fig. |
| T3576 | 5232-5233 | CD | denotes | 1 |
| T3577 | 5233-5234 | -RRB- | denotes | ) |
| T3578 | 5235-5238 | CC | denotes | and |
| T3579 | 5239-5243 | RB | denotes | then |
| T3580 | 5244-5252 | VB | denotes | observed |
| T3581 | 5253-5272 | JJ | denotes | stimulation-induced |
| T3582 | 5273-5277 | NN | denotes | RPS3 |
| T3583 | 5278-5285 | JJ | denotes | nuclear |
| T3584 | 5286-5295 | NN | denotes | migration |
| T3585 | 5296-5298 | IN | denotes | by |
| T3586 | 5299-5307 | JJ | denotes | confocal |
| T3587 | 5308-5318 | NN | denotes | microscopy |
| T3588 | 5320-5324 | CC | denotes | Both |
| T3589 | 5325-5328 | NN | denotes | TNF |
| T3590 | 5329-5332 | CC | denotes | and |
| T3591 | 5333-5338 | NN | denotes | PMA+I |
| T3592 | 5339-5348 | VB | denotes | triggered |
| T3593 | 5349-5353 | NN | denotes | RPS3 |
| T3594 | 5354-5361 | JJ | denotes | nuclear |
| T3595 | 5362-5375 | NN | denotes | translocation |
| T3596 | 5376-5378 | IN | denotes | in |
| T3597 | 5379-5385 | NN | denotes | Jurkat |
| T3598 | 5386-5391 | NN | denotes | cells |
| T3599 | 5392-5403 | VB | denotes | transfected |
| T3600 | 5404-5408 | IN | denotes | with |
| T3601 | 5409-5410 | DT | denotes | a |
| T3602 | 5411-5420 | VB | denotes | scrambled |
| T3603 | 5421-5432 | JJ | denotes | nonspecific |
| T3604 | 5433-5434 | -LRB- | denotes | ( |
| T3605 | 5434-5436 | NN | denotes | NS |
| T3606 | 5436-5437 | -RRB- | denotes | ) |
| T3607 | 5438-5443 | NN | denotes | siRNA |
| T3608 | 5444-5445 | -LRB- | denotes | ( |
| T3609 | 5445-5449 | NN | denotes | Fig. |
| T3610 | 5450-5452 | NN | denotes | 2a |
| T3611 | 5452-5453 | -RRB- | denotes | ) |
| T3612 | 5453-5454 | CD | denotes | 6 |
| T3613 | 5456-5460 | NN | denotes | RPS3 |
| T3614 | 5461-5468 | JJ | denotes | nuclear |
| T3615 | 5469-5482 | NN | denotes | translocation |
| T3616 | 5483-5486 | VB | denotes | was |
| T3617 | 5487-5491 | RB | denotes | only |
| T3618 | 5492-5500 | RB | denotes | slightly |
| T3619 | 5500-5501 | -COMMA- | denotes | , |
| T3620 | 5502-5504 | IN | denotes | if |
| T3621 | 5505-5507 | IN | denotes | at |
| T3622 | 5508-5511 | DT | denotes | all |
| T3623 | 5511-5512 | -COMMA- | denotes | , |
| T3624 | 5513-5521 | VB | denotes | impaired |
| T3625 | 5522-5524 | IN | denotes | by |
| T3626 | 5525-5539 | NN | denotes | IKKα-silencing |
| T3627 | 5541-5551 | RB | denotes | Conversely |
| T3628 | 5551-5552 | -COMMA- | denotes | , |
| T3629 | 5553-5562 | NN | denotes | knockdown |
| T3630 | 5563-5565 | IN | denotes | of |
| T3631 | 5566-5570 | NN | denotes | IKKβ |
| T3632 | 5571-5581 | VB | denotes | attenuated |
| T3633 | 5582-5587 | CD | denotes | 60-70 |
| T3634 | 5587-5588 | NN | denotes | % |
| T3635 | 5589-5591 | IN | denotes | of |
| T3636 | 5592-5596 | NN | denotes | RPS3 |
| T3637 | 5597-5604 | JJ | denotes | nuclear |
| T3638 | 5605-5617 | NN | denotes | accumulation |
| T3639 | 5618-5627 | VB | denotes | following |
| T3640 | 5628-5639 | NN | denotes | stimulation |
| T3641 | 5640-5641 | -LRB- | denotes | ( |
| T3642 | 5641-5645 | NN | denotes | Fig. |
| T3643 | 5646-5648 | NN | denotes | 2a |
| T3644 | 5648-5649 | -RRB- | denotes | ) |
| T3645 | 5651-5665 | NN | denotes | Immunoblotting |
| T3646 | 5666-5668 | IN | denotes | of |
| T3647 | 5669-5676 | JJ | denotes | nuclear |
| T3648 | 5677-5686 | NN | denotes | fractions |
| T3649 | 5687-5696 | VB | denotes | confirmed |
| T3650 | 5697-5701 | IN | denotes | that |
| T3651 | 5702-5706 | JJ | denotes | full |
| T3652 | 5707-5717 | NN | denotes | expression |
| T3653 | 5718-5720 | IN | denotes | of |
| T3654 | 5721-5725 | NN | denotes | IKKβ |
| T3655 | 5725-5726 | -COMMA- | denotes | , |
| T3656 | 5727-5730 | CC | denotes | but |
| T3657 | 5731-5734 | RB | denotes | not |
| T3658 | 5735-5739 | NN | denotes | IKKα |
| T3659 | 5739-5740 | -COMMA- | denotes | , |
| T3660 | 5741-5744 | VB | denotes | was |
| T3661 | 5745-5754 | JJ | denotes | necessary |
| T3662 | 5755-5758 | IN | denotes | for |
| T3663 | 5759-5777 | JJ | denotes | activation-induced |
| T3664 | 5778-5782 | NN | denotes | RPS3 |
| T3665 | 5783-5790 | JJ | denotes | nuclear |
| T3666 | 5791-5804 | NN | denotes | translocation |
| T3667 | 5805-5806 | -LRB- | denotes | ( |
| T3668 | 5806-5810 | NN | denotes | Fig. |
| T3669 | 5811-5813 | NN | denotes | 2b |
| T3670 | 5813-5814 | -RRB- | denotes | ) |
| T3671 | 5816-5823 | NN | denotes | Control |
| T3672 | 5824-5835 | NN | denotes | immunoblots |
| T3673 | 5836-5844 | VB | denotes | revealed |
| T3674 | 5845-5849 | IN | denotes | that |
| T3675 | 5850-5853 | NN | denotes | p65 |
| T3676 | 5854-5861 | JJ | denotes | nuclear |
| T3677 | 5862-5875 | NN | denotes | translocation |
| T3678 | 5876-5879 | VB | denotes | was |
| T3679 | 5880-5887 | VB | denotes | blocked |
| T3680 | 5888-5893 | IN | denotes | under |
| T3681 | 5894-5897 | DT | denotes | the |
| T3682 | 5898-5902 | JJ | denotes | same |
| T3683 | 5903-5913 | NN | denotes | conditions |
| T3684 | 5914-5915 | -LRB- | denotes | ( |
| T3685 | 5915-5919 | NNP | denotes | Fig. |
| T3686 | 5920-5922 | NN | denotes | 2b |
| T3687 | 5922-5923 | -RRB- | denotes | ) |
| T3688 | 5925-5927 | PRP | denotes | We |
| T3689 | 5928-5932 | RB | denotes | next |
| T3690 | 5933-5941 | VB | denotes | examined |
| T3691 | 5942-5945 | DT | denotes | the |
| T3692 | 5946-5953 | JJ | denotes | nuclear |
| T3693 | 5954-5967 | NN | denotes | translocation |
| T3694 | 5968-5970 | IN | denotes | of |
| T3695 | 5971-5975 | NN | denotes | RPS3 |
| T3696 | 5976-5978 | IN | denotes | in |
| T3697 | 5979-5984 | NN | denotes | cells |
| T3698 | 5985-5996 | RB | denotes | ectopically |
| T3699 | 5997-6007 | VB | denotes | expressing |
| T3700 | 6008-6014 | CC | denotes | either |
| T3701 | 6015-6026 | NN | denotes | kinase-dead |
| T3702 | 6027-6028 | -LRB- | denotes | ( |
| T3703 | 6028-6032 | NN | denotes | SSAA |
| T3704 | 6032-6033 | -RRB- | denotes | ) |
| T3705 | 6034-6036 | CC | denotes | or |
| T3706 | 6037-6058 | JJ | denotes | constitutively-active |
| T3707 | 6059-6060 | -LRB- | denotes | ( |
| T3708 | 6060-6064 | NN | denotes | SSEE |
| T3709 | 6064-6065 | -RRB- | denotes | ) |
| T3710 | 6066-6072 | JJ | denotes | mutant |
| T3711 | 6073-6077 | NN | denotes | IKKβ |
| T3712 | 6078-6086 | NN | denotes | proteins |
| T3713 | 6088-6090 | IN | denotes | As |
| T3714 | 6091-6099 | VB | denotes | expected |
| T3715 | 6099-6100 | -COMMA- | denotes | , |
| T3716 | 6101-6104 | DT | denotes | the |
| T3717 | 6105-6109 | NN | denotes | SSEE |
| T3718 | 6109-6110 | -COMMA- | denotes | , |
| T3719 | 6111-6114 | CC | denotes | but |
| T3720 | 6115-6118 | RB | denotes | not |
| T3721 | 6119-6123 | NN | denotes | SSAA |
| T3722 | 6123-6124 | -COMMA- | denotes | , |
| T3723 | 6125-6131 | NN | denotes | mutant |
| T3724 | 6132-6134 | IN | denotes | of |
| T3725 | 6135-6139 | NN | denotes | IKKβ |
| T3726 | 6140-6147 | VB | denotes | induced |
| T3727 | 6148-6163 | JJ | denotes | NF-κB-dependent |
| T3728 | 6164-6174 | NN | denotes | luciferase |
| T3729 | 6175-6183 | NN | denotes | reporter |
| T3730 | 6184-6192 | NN | denotes | activity |
| T3731 | 6193-6194 | -LRB- | denotes | ( |
| T3732 | 6194-6198 | NNP | denotes | Fig. |
| T3733 | 6199-6201 | NN | denotes | 2c |
| T3734 | 6201-6202 | -COMMA- | denotes | , |
| T3735 | 6203-6207 | JJ | denotes | left |
| T3736 | 6207-6208 | -RRB- | denotes | ) |
| T3737 | 6210-6217 | IN | denotes | Whereas |
| T3738 | 6218-6222 | NN | denotes | RPS3 |
| T3739 | 6223-6231 | VB | denotes | remained |
| T3740 | 6232-6241 | JJ | denotes | cytosolic |
| T3741 | 6242-6244 | IN | denotes | in |
| T3742 | 6245-6249 | NN | denotes | IKKβ |
| T3743 | 6250-6251 | -LRB- | denotes | ( |
| T3744 | 6251-6255 | NN | denotes | SSAA |
| T3745 | 6255-6256 | -RRB- | denotes | ) |
| T3746 | 6256-6267 | JJ | denotes | -expressing |
| T3747 | 6268-6273 | NN | denotes | cells |
| T3748 | 6274-6275 | -LRB- | denotes | ( |
| T3749 | 6275-6279 | NN | denotes | Fig. |
| T3750 | 6280-6282 | NN | denotes | 2c |
| T3751 | 6282-6283 | -COMMA- | denotes | , |
| T3752 | 6284-6289 | JJ | denotes | right |
| T3753 | 6289-6290 | -RRB- | denotes | ) |
| T3754 | 6290-6291 | -COMMA- | denotes | , |
| T3755 | 6292-6293 | DT | denotes | a |
| T3756 | 6294-6305 | JJ | denotes | substantial |
| T3757 | 6306-6316 | NN | denotes | proportion |
| T3758 | 6317-6319 | IN | denotes | of |
| T3759 | 6320-6324 | NN | denotes | RPS3 |
| T3760 | 6325-6337 | VB | denotes | translocated |
| T3761 | 6338-6340 | TO | denotes | to |
| T3762 | 6341-6344 | DT | denotes | the |
| T3763 | 6345-6352 | NN | denotes | nucleus |
| T3764 | 6353-6355 | IN | denotes | in |
| T3765 | 6356-6361 | NN | denotes | cells |
| T3766 | 6362-6372 | VB | denotes | expressing |
| T3767 | 6373-6377 | NN | denotes | IKKβ |
| T3768 | 6378-6379 | -LRB- | denotes | ( |
| T3769 | 6379-6383 | NN | denotes | SSEE |
| T3770 | 6383-6384 | -RRB- | denotes | ) |
| T3771 | 6385-6386 | -LRB- | denotes | ( |
| T3772 | 6386-6390 | NNP | denotes | Fig. |
| T3773 | 6391-6393 | NN | denotes | 2c |
| T3774 | 6393-6394 | -COMMA- | denotes | , |
| T3775 | 6395-6400 | JJ | denotes | right |
| T3776 | 6400-6401 | -RRB- | denotes | ) |
| T3777 | 6403-6406 | DT | denotes | The |
| T3778 | 6407-6417 | NN | denotes | percentage |
| T3779 | 6418-6420 | IN | denotes | of |
| T3780 | 6421-6426 | NN | denotes | cells |
| T3781 | 6427-6437 | VB | denotes | containing |
| T3782 | 6438-6448 | JJ | denotes | detectable |
| T3783 | 6449-6456 | JJ | denotes | nuclear |
| T3784 | 6457-6461 | NN | denotes | RPS3 |
| T3785 | 6462-6471 | VB | denotes | increased |
| T3786 | 6472-6478 | RB | denotes | 5-fold |
| T3787 | 6479-6481 | IN | denotes | in |
| T3788 | 6482-6486 | NN | denotes | IKKβ |
| T3789 | 6487-6488 | -LRB- | denotes | ( |
| T3790 | 6488-6492 | NN | denotes | SSEE |
| T3791 | 6492-6493 | -RRB- | denotes | ) |
| T3792 | 6493-6504 | JJ | denotes | -expressing |
| T3793 | 6505-6510 | NN | denotes | cells |
| T3794 | 6510-6511 | -COMMA- | denotes | , |
| T3795 | 6512-6515 | CC | denotes | but |
| T3796 | 6516-6519 | RB | denotes | not |
| T3797 | 6520-6522 | IN | denotes | in |
| T3798 | 6523-6527 | NN | denotes | IKKβ |
| T3799 | 6528-6529 | -LRB- | denotes | ( |
| T3800 | 6529-6533 | NN | denotes | SSAA |
| T3801 | 6533-6534 | -RRB- | denotes | ) |
| T3802 | 6534-6545 | JJ | denotes | -expressing |
| T3803 | 6546-6550 | NN | denotes | ones |
| T3804 | 6551-6552 | -LRB- | denotes | ( |
| T3805 | 6552-6556 | NNP | denotes | Fig. |
| T3806 | 6557-6559 | CD | denotes | 2d |
| T3807 | 6560-6563 | CC | denotes | and |
| T3808 | 6564-6577 | NNP | denotes | Supplementary |
| T3809 | 6578-6582 | NNP | denotes | Fig. |
| T3810 | 6583-6584 | CD | denotes | 2 |
| T3811 | 6584-6585 | -RRB- | denotes | ) |
| T3812 | 6587-6591 | RB | denotes | Thus |
| T3813 | 6591-6592 | -COMMA- | denotes | , |
| T3814 | 6593-6597 | NN | denotes | IKKβ |
| T3815 | 6598-6606 | NN | denotes | activity |
| T3816 | 6607-6609 | VB | denotes | is |
| T3817 | 6610-6619 | JJ | denotes | necessary |
| T3818 | 6620-6623 | CC | denotes | and |
| T3819 | 6624-6634 | JJ | denotes | sufficient |
| T3820 | 6635-6638 | IN | denotes | for |
| T3821 | 6639-6643 | NN | denotes | RPS3 |
| T3822 | 6644-6651 | JJ | denotes | nuclear |
| T3823 | 6652-6665 | NN | denotes | translocation |
| T3824 | 6666-6668 | IN | denotes | in |
| T3825 | 6669-6677 | NN | denotes | response |
| T3826 | 6678-6680 | TO | denotes | to |
| T3827 | 6681-6686 | NN | denotes | NF-κB |
| T3828 | 6687-6697 | VB | denotes | activating |
| T3829 | 6698-6705 | NN | denotes | stimuli |
| T5160 | 6708-6712 | NN | denotes | IκBα |
| T5161 | 6713-6724 | NN | denotes | degradation |
| T5162 | 6725-6728 | CC | denotes | and |
| T5163 | 6729-6733 | NN | denotes | RPS3 |
| T5164 | 6734-6741 | JJ | denotes | nuclear |
| T5165 | 6742-6755 | NN | denotes | translocation |
| T5166 | 6756-6766 | NN | denotes | Importin-α |
| T5167 | 6767-6776 | VB | denotes | regulates |
| T5168 | 6777-6780 | DT | denotes | the |
| T5169 | 6781-6788 | JJ | denotes | nuclear |
| T5170 | 6789-6795 | NN | denotes | import |
| T5171 | 6796-6798 | IN | denotes | of |
| T5172 | 6799-6804 | NN | denotes | NF-κB |
| T5173 | 6805-6808 | NN | denotes | Rel |
| T5174 | 6809-6819 | NN | denotes | subunits23 |
| T5175 | 6819-6820 | -COMMA- | denotes | , |
| T5176 | 6821-6823 | CD | denotes | 24 |
| T5177 | 6825-6829 | NN | denotes | RPS3 |
| T5178 | 6830-6837 | VB | denotes | harbors |
| T5179 | 6838-6839 | DT | denotes | a |
| T5180 | 6840-6847 | JJ | denotes | nuclear |
| T5181 | 6848-6860 | NN | denotes | localization |
| T5182 | 6861-6867 | NN | denotes | signal |
| T5183 | 6868-6869 | -LRB- | denotes | ( |
| T5184 | 6869-6872 | NN | denotes | NLS |
| T5185 | 6872-6873 | -RRB- | denotes | ) |
| T5186 | 6874-6882 | NN | denotes | sequence |
| T5187 | 6883-6886 | CC | denotes | and |
| T5188 | 6887-6890 | PRP-DOLLAR- | denotes | its |
| T5189 | 6891-6898 | JJ | denotes | nuclear |
| T5190 | 6899-6912 | NN | denotes | translocation |
| T5191 | 6913-6919 | VB | denotes | occurs |
| T5192 | 6920-6922 | IN | denotes | in |
| T5193 | 6923-6931 | NN | denotes | parallel |
| T5194 | 6932-6934 | TO | denotes | to |
| T5195 | 6934-6935 | -COMMA- | denotes | , |
| T5196 | 6936-6939 | CC | denotes | but |
| T5197 | 6940-6953 | RB | denotes | independently |
| T5198 | 6954-6956 | IN | denotes | of |
| T5199 | 6956-6957 | -COMMA- | denotes | , |
| T5200 | 6958-6961 | NN | denotes | p65 |
| T5201 | 6962-6976 | NN | denotes | translocation6 |
| T5202 | 6978-6980 | PRP | denotes | We |
| T5203 | 6981-6991 | VB | denotes | envisioned |
| T5204 | 6992-6996 | IN | denotes | that |
| T5205 | 6997-7001 | NN | denotes | RPS3 |
| T5206 | 7002-7007 | MD | denotes | could |
| T5207 | 7008-7012 | RB | denotes | also |
| T5208 | 7013-7020 | VB | denotes | utilize |
| T5209 | 7021-7024 | DT | denotes | the |
| T5210 | 7025-7037 | JJ | denotes | importin-α/β |
| T5211 | 7038-7045 | NN | denotes | pathway |
| T5212 | 7047-7057 | JJ | denotes | Consistent |
| T5213 | 7058-7062 | IN | denotes | with |
| T5214 | 7063-7067 | DT | denotes | this |
| T5215 | 7068-7074 | NN | denotes | notion |
| T5216 | 7074-7075 | -COMMA- | denotes | , |
| T5217 | 7076-7080 | NN | denotes | RPS3 |
| T5218 | 7081-7092 | NN | denotes | association |
| T5219 | 7093-7097 | IN | denotes | with |
| T5220 | 7098-7108 | NN | denotes | importin-α |
| T5221 | 7108-7109 | -COMMA- | denotes | , |
| T5222 | 7110-7113 | CC | denotes | but |
| T5223 | 7114-7117 | RB | denotes | not |
| T5224 | 7118-7128 | JJ | denotes | importin-β |
| T5225 | 7128-7129 | -COMMA- | denotes | , |
| T5226 | 7130-7133 | VB | denotes | was |
| T5227 | 7134-7142 | VB | denotes | enhanced |
| T5228 | 7143-7145 | IN | denotes | in |
| T5229 | 7146-7160 | VB | denotes | TNF–stimulated |
| T5230 | 7161-7166 | NN | denotes | cells |
| T5231 | 7167-7168 | -LRB- | denotes | ( |
| T5232 | 7168-7172 | NN | denotes | Fig. |
| T5233 | 7173-7175 | NN | denotes | 3a |
| T5234 | 7175-7176 | -RRB- | denotes | ) |
| T5235 | 7178-7187 | RB | denotes | Therefore |
| T5236 | 7187-7188 | -COMMA- | denotes | , |
| T5237 | 7189-7191 | PRP | denotes | we |
| T5238 | 7192-7200 | VB | denotes | examined |
| T5239 | 7201-7208 | IN | denotes | whether |
| T5240 | 7209-7213 | NN | denotes | RPS3 |
| T5241 | 7214-7221 | NN | denotes | binding |
| T5242 | 7222-7224 | TO | denotes | to |
| T5243 | 7225-7235 | NN | denotes | importin-α |
| T5244 | 7236-7238 | VB | denotes | is |
| T5245 | 7239-7248 | JJ | denotes | essential |
| T5246 | 7249-7252 | IN | denotes | for |
| T5247 | 7253-7260 | JJ | denotes | nuclear |
| T5248 | 7261-7274 | NN | denotes | translocation |
| T5249 | 7275-7281 | IN | denotes | during |
| T5250 | 7282-7287 | NN | denotes | NF-κB |
| T5251 | 7288-7298 | NN | denotes | activation |
| T5252 | 7300-7305 | IN | denotes | Since |
| T5253 | 7306-7310 | NN | denotes | IκBα |
| T5254 | 7311-7322 | NN | denotes | degradation |
| T5255 | 7323-7325 | VB | denotes | is |
| T5256 | 7326-7327 | DT | denotes | a |
| T5257 | 7328-7340 | NN | denotes | prerequisite |
| T5258 | 7341-7343 | TO | denotes | to |
| T5259 | 7344-7350 | VB | denotes | unmask |
| T5260 | 7351-7354 | DT | denotes | the |
| T5261 | 7355-7358 | NN | denotes | NLS |
| T5262 | 7359-7361 | IN | denotes | of |
| T5263 | 7362-7365 | NN | denotes | p65 |
| T5264 | 7365-7366 | -COMMA- | denotes | , |
| T5265 | 7367-7370 | CC | denotes | and |
| T5266 | 7371-7375 | CC | denotes | both |
| T5267 | 7376-7380 | NN | denotes | RPS3 |
| T5268 | 7381-7384 | CC | denotes | and |
| T5269 | 7385-7389 | NN | denotes | IκBα |
| T5270 | 7390-7394 | VB | denotes | bind |
| T5271 | 7395-7397 | TO | denotes | to |
| T5272 | 7398-7401 | NN | denotes | p65 |
| T5273 | 7402-7404 | IN | denotes | in |
| T5274 | 7405-7408 | DT | denotes | the |
| T5275 | 7409-7420 | JJ | denotes | cytoplasmic |
| T5276 | 7421-7431 | JJ | denotes | inhibitory |
| T5277 | 7432-7439 | NN | denotes | complex |
| T5278 | 7439-7440 | -COMMA- | denotes | , |
| T5279 | 7441-7443 | PRP | denotes | we |
| T5280 | 7444-7450 | VB | denotes | tested |
| T5281 | 7451-7458 | IN | denotes | whether |
| T5282 | 7459-7463 | NN | denotes | IκBα |
| T5283 | 7464-7475 | NN | denotes | degradation |
| T5284 | 7476-7478 | VB | denotes | is |
| T5285 | 7479-7487 | VB | denotes | required |
| T5286 | 7488-7491 | IN | denotes | for |
| T5287 | 7492-7495 | DT | denotes | the |
| T5288 | 7496-7506 | NN | denotes | liberation |
| T5289 | 7507-7509 | IN | denotes | of |
| T5290 | 7510-7514 | NN | denotes | RPS3 |
| T5291 | 7516-7518 | PRP | denotes | We |
| T5292 | 7519-7527 | VB | denotes | measured |
| T5293 | 7528-7531 | DT | denotes | the |
| T5294 | 7532-7543 | NN | denotes | association |
| T5295 | 7544-7546 | IN | denotes | of |
| T5296 | 7547-7551 | NN | denotes | RPS3 |
| T5297 | 7552-7556 | IN | denotes | with |
| T5298 | 7557-7567 | NN | denotes | importin-α |
| T5299 | 7568-7570 | IN | denotes | in |
| T5300 | 7571-7575 | NN | denotes | 293T |
| T5301 | 7576-7581 | NN | denotes | cells |
| T5302 | 7582-7596 | VB | denotes | overexpressing |
| T5303 | 7597-7606 | JJ | denotes | wild-type |
| T5304 | 7607-7611 | NN | denotes | IκBα |
| T5305 | 7612-7614 | CC | denotes | or |
| T5306 | 7615-7617 | DT | denotes | an |
| T5307 | 7618-7622 | NN | denotes | IκBα |
| T5308 | 7623-7629 | NN | denotes | mutant |
| T5309 | 7630-7631 | -LRB- | denotes | ( |
| T5310 | 7631-7635 | NN | denotes | SSAA |
| T5311 | 7635-7636 | -RRB- | denotes | ) |
| T5312 | 7637-7646 | JJ | denotes | resistant |
| T5313 | 7647-7649 | TO | denotes | to |
| T5314 | 7650-7662 | JJ | denotes | IKKβ-induced |
| T5315 | 7663-7678 | NN | denotes | phosphorylation |
| T5316 | 7679-7682 | CC | denotes | and |
| T5317 | 7683-7694 | NN | denotes | degradation |
| T5318 | 7696-7698 | IN | denotes | In |
| T5319 | 7699-7704 | NN | denotes | cells |
| T5320 | 7705-7716 | VB | denotes | transfected |
| T5321 | 7717-7721 | IN | denotes | with |
| T5322 | 7722-7731 | JJ | denotes | wild-type |
| T5323 | 7732-7736 | NN | denotes | IκBα |
| T5324 | 7736-7737 | -COMMA- | denotes | , |
| T5325 | 7738-7741 | NN | denotes | TNF |
| T5326 | 7742-7753 | NN | denotes | stimulation |
| T5327 | 7754-7763 | VB | denotes | augmented |
| T5328 | 7764-7767 | DT | denotes | the |
| T5329 | 7768-7779 | NN | denotes | interaction |
| T5330 | 7780-7782 | IN | denotes | of |
| T5331 | 7783-7787 | NN | denotes | RPS3 |
| T5332 | 7788-7791 | CC | denotes | and |
| T5333 | 7792-7802 | JJ | denotes | importin-α |
| T5334 | 7803-7805 | TO | denotes | to |
| T5335 | 7806-7807 | DT | denotes | a |
| T5336 | 7808-7815 | JJ | denotes | similar |
| T5337 | 7816-7822 | NN | denotes | degree |
| T5338 | 7823-7825 | IN | denotes | as |
| T5339 | 7826-7828 | IN | denotes | in |
| T5340 | 7829-7844 | JJ | denotes | non-transfected |
| T5341 | 7845-7850 | NN | denotes | cells |
| T5342 | 7852-7854 | IN | denotes | By |
| T5343 | 7855-7863 | NN | denotes | contrast |
| T5344 | 7863-7864 | -COMMA- | denotes | , |
| T5345 | 7865-7867 | PRP | denotes | we |
| T5346 | 7868-7876 | VB | denotes | observed |
| T5347 | 7877-7881 | IN | denotes | that |
| T5348 | 7882-7885 | DT | denotes | the |
| T5349 | 7886-7901 | NN | denotes | RPS3-importin-α |
| T5350 | 7902-7913 | NN | denotes | association |
| T5351 | 7914-7917 | VB | denotes | was |
| T5352 | 7918-7927 | VB | denotes | abolished |
| T5353 | 7928-7930 | IN | denotes | by |
| T5354 | 7931-7934 | DT | denotes | the |
| T5355 | 7935-7943 | NN | denotes | presence |
| T5356 | 7944-7946 | IN | denotes | of |
| T5357 | 7947-7961 | JJ | denotes | non-degradable |
| T5358 | 7962-7966 | NN | denotes | IκBα |
| T5359 | 7967-7968 | -LRB- | denotes | ( |
| T5360 | 7968-7972 | NN | denotes | Fig. |
| T5361 | 7973-7975 | NN | denotes | 3b |
| T5362 | 7975-7976 | -RRB- | denotes | ) |
| T5363 | 7978-7980 | TO | denotes | To |
| T5364 | 7981-7988 | VB | denotes | examine |
| T5365 | 7989-7996 | IN | denotes | whether |
| T5366 | 7997-8001 | NN | denotes | IκBα |
| T5367 | 8002-8004 | VB | denotes | is |
| T5368 | 8005-8008 | DT | denotes | the |
| T5369 | 8009-8013 | RB | denotes | only |
| T5370 | 8014-8025 | JJ | denotes | cytoplasmic |
| T5371 | 8026-8033 | NN | denotes | barrier |
| T5372 | 8034-8044 | VB | denotes | precluding |
| T5373 | 8045-8049 | NN | denotes | RPS3 |
| T5374 | 8050-8057 | JJ | denotes | nuclear |
| T5375 | 8058-8071 | NN | denotes | translocation |
| T5376 | 8071-8072 | -COMMA- | denotes | , |
| T5377 | 8073-8075 | PRP | denotes | we |
| T5378 | 8076-8084 | VB | denotes | measured |
| T5379 | 8085-8089 | CC | denotes | both |
| T5380 | 8090-8105 | NN | denotes | RPS3-importin-α |
| T5381 | 8106-8117 | NN | denotes | association |
| T5382 | 8118-8121 | CC | denotes | and |
| T5383 | 8122-8129 | JJ | denotes | nuclear |
| T5384 | 8130-8134 | NN | denotes | RPS3 |
| T5385 | 8135-8140 | IN | denotes | after |
| T5386 | 8141-8149 | VB | denotes | reducing |
| T5387 | 8150-8154 | NN | denotes | IκBα |
| T5388 | 8155-8165 | NN | denotes | expression |
| T5389 | 8167-8175 | VB | denotes | Compared |
| T5390 | 8176-8180 | IN | denotes | with |
| T5391 | 8181-8192 | JJ | denotes | nonspecific |
| T5392 | 8193-8198 | NN | denotes | siRNA |
| T5393 | 8198-8199 | -COMMA- | denotes | , |
| T5394 | 8200-8205 | NN | denotes | siRNA |
| T5395 | 8206-8215 | NN | denotes | targeting |
| T5396 | 8216-8218 | IN | denotes | of |
| T5397 | 8219-8223 | NN | denotes | IκBα |
| T5398 | 8224-8234 | RB | denotes | completely |
| T5399 | 8235-8243 | VB | denotes | depleted |
| T5400 | 8244-8248 | NN | denotes | IκBα |
| T5401 | 8249-8251 | IN | denotes | in |
| T5402 | 8252-8258 | NN | denotes | Jurkat |
| T5403 | 8259-8264 | NN | denotes | cells |
| T5404 | 8265-8266 | -LRB- | denotes | ( |
| T5405 | 8266-8270 | NN | denotes | Fig. |
| T5406 | 8271-8273 | NN | denotes | 3c |
| T5407 | 8273-8274 | -COMMA- | denotes | , |
| T5408 | 8275-8280 | NN | denotes | input |
| T5409 | 8280-8281 | -RRB- | denotes | ) |
| T5410 | 8283-8295 | RB | denotes | Nevertheless |
| T5411 | 8295-8296 | -COMMA- | denotes | , |
| T5412 | 8297-8300 | DT | denotes | the |
| T5413 | 8301-8316 | NN | denotes | RPS3-importin-α |
| T5414 | 8317-8328 | NN | denotes | association |
| T5415 | 8329-8332 | VB | denotes | was |
| T5416 | 8333-8336 | RB | denotes | not |
| T5417 | 8337-8346 | JJ | denotes | augmented |
| T5418 | 8347-8348 | -LRB- | denotes | ( |
| T5419 | 8348-8352 | NNP | denotes | Fig. |
| T5420 | 8353-8355 | NN | denotes | 3c |
| T5421 | 8355-8356 | -RRB- | denotes | ) |
| T5422 | 8356-8357 | -COMMA- | denotes | , |
| T5423 | 8358-8361 | CC | denotes | nor |
| T5424 | 8362-8365 | VB | denotes | was |
| T5425 | 8366-8377 | JJ | denotes | significant |
| T5426 | 8378-8385 | JJ | denotes | nuclear |
| T5427 | 8386-8390 | NN | denotes | RPS3 |
| T5428 | 8391-8399 | VB | denotes | detected |
| T5429 | 8400-8401 | -LRB- | denotes | ( |
| T5430 | 8401-8405 | NNP | denotes | Fig. |
| T5431 | 8406-8408 | NNP | denotes | 3d |
| T5432 | 8408-8409 | -RRB- | denotes | ) |
| T5433 | 8411-8419 | RB | denotes | Moreover |
| T5434 | 8419-8420 | -COMMA- | denotes | , |
| T5435 | 8421-8426 | NN | denotes | cells |
| T5436 | 8427-8434 | VB | denotes | treated |
| T5437 | 8435-8439 | IN | denotes | with |
| T5438 | 8440-8446 | NN | denotes | sodium |
| T5439 | 8447-8458 | NN | denotes | pervanadate |
| T5440 | 8459-8460 | -LRB- | denotes | ( |
| T5441 | 8460-8462 | NN | denotes | Pv |
| T5442 | 8462-8463 | -RRB- | denotes | ) |
| T5443 | 8464-8466 | TO | denotes | to |
| T5444 | 8467-8473 | VB | denotes | induce |
| T5445 | 8474-8478 | NN | denotes | IκBα |
| T5446 | 8479-8490 | NN | denotes | degradation |
| T5447 | 8491-8498 | IN | denotes | through |
| T5448 | 8499-8501 | DT | denotes | an |
| T5449 | 8502-8517 | JJ | denotes | IKK-independent |
| T5450 | 8518-8532 | NN | denotes | mechanism25-27 |
| T5451 | 8533-8536 | VB | denotes | did |
| T5452 | 8537-8540 | RB | denotes | not |
| T5453 | 8541-8545 | VB | denotes | show |
| T5454 | 8546-8555 | VB | denotes | increased |
| T5455 | 8556-8567 | NN | denotes | association |
| T5456 | 8568-8575 | IN | denotes | between |
| T5457 | 8576-8580 | NN | denotes | RPS3 |
| T5458 | 8581-8584 | CC | denotes | and |
| T5459 | 8585-8595 | NN | denotes | importin-α |
| T5460 | 8596-8597 | -LRB- | denotes | ( |
| T5461 | 8597-8601 | NN | denotes | Fig. |
| T5462 | 8602-8604 | NN | denotes | 3e |
| T5463 | 8605-8608 | CC | denotes | and |
| T5464 | 8609-8622 | NNP | denotes | Supplementary |
| T5465 | 8623-8627 | NNP | denotes | Fig. |
| T5466 | 8628-8630 | NN | denotes | 3b |
| T5467 | 8630-8631 | -RRB- | denotes | ) |
| T5468 | 8632-8634 | CC | denotes | or |
| T5469 | 8635-8642 | JJ | denotes | nuclear |
| T5470 | 8643-8655 | NN | denotes | accumulation |
| T5471 | 8656-8658 | IN | denotes | of |
| T5472 | 8659-8663 | NN | denotes | RPS3 |
| T5473 | 8663-8664 | -COMMA- | denotes | , |
| T5474 | 8665-8672 | IN | denotes | despite |
| T5475 | 8673-8681 | JJ | denotes | complete |
| T5476 | 8682-8686 | NN | denotes | IκBα |
| T5477 | 8687-8698 | NN | denotes | degradation |
| T5478 | 8699-8700 | -LRB- | denotes | ( |
| T5479 | 8700-8713 | NNP | denotes | Supplementary |
| T5480 | 8714-8718 | NNP | denotes | Fig. |
| T5481 | 8719-8721 | NN | denotes | 3c |
| T5482 | 8721-8722 | -RRB- | denotes | ) |
| T5483 | 8724-8726 | PRP | denotes | We |
| T5484 | 8727-8734 | RB | denotes | further |
| T5485 | 8735-8743 | VB | denotes | examined |
| T5486 | 8744-8751 | IN | denotes | whether |
| T5487 | 8752-8753 | DT | denotes | a |
| T5488 | 8754-8764 | JJ | denotes | subsequent |
| T5489 | 8765-8770 | NN | denotes | NF-κB |
| T5490 | 8771-8781 | NN | denotes | activation |
| T5491 | 8782-8788 | NN | denotes | signal |
| T5492 | 8789-8802 | RB | denotes | independently |
| T5493 | 8803-8811 | VB | denotes | promotes |
| T5494 | 8812-8815 | DT | denotes | the |
| T5495 | 8816-8826 | JJ | denotes | importin-α |
| T5496 | 8827-8838 | NN | denotes | association |
| T5497 | 8839-8842 | CC | denotes | and |
| T5498 | 8843-8850 | JJ | denotes | nuclear |
| T5499 | 8851-8860 | NN | denotes | transport |
| T5500 | 8861-8863 | IN | denotes | of |
| T5501 | 8864-8868 | NN | denotes | RPS3 |
| T5502 | 8869-8874 | IN | denotes | after |
| T5503 | 8875-8879 | NN | denotes | IκBα |
| T5504 | 8880-8891 | NN | denotes | degradation |
| T5505 | 8893-8895 | PRP | denotes | We |
| T5506 | 8896-8901 | VB | denotes | found |
| T5507 | 8902-8906 | IN | denotes | that |
| T5508 | 8907-8910 | NN | denotes | TNF |
| T5509 | 8911-8922 | NN | denotes | stimulation |
| T5510 | 8923-8932 | VB | denotes | following |
| T5511 | 8933-8935 | NN | denotes | Pv |
| T5512 | 8936-8945 | NN | denotes | treatment |
| T5513 | 8946-8949 | VB | denotes | was |
| T5514 | 8950-8958 | VB | denotes | required |
| T5515 | 8959-8962 | IN | denotes | for |
| T5516 | 8963-8966 | DT | denotes | the |
| T5517 | 8967-8982 | NN | denotes | RPS3-importin-α |
| T5518 | 8983-8994 | NN | denotes | association |
| T5519 | 8994-8995 | -COMMA- | denotes | , |
| T5520 | 8996-9006 | JJ | denotes | comparable |
| T5521 | 9007-9009 | TO | denotes | to |
| T5522 | 9010-9013 | NN | denotes | TNF |
| T5523 | 9014-9025 | NN | denotes | stimulation |
| T5524 | 9026-9031 | RB | denotes | alone |
| T5525 | 9032-9033 | -LRB- | denotes | ( |
| T5526 | 9033-9037 | NNP | denotes | Fig. |
| T5527 | 9038-9040 | NN | denotes | 3e |
| T5528 | 9040-9041 | -RRB- | denotes | ) |
| T5529 | 9043-9047 | RB | denotes | Thus |
| T5530 | 9047-9048 | -COMMA- | denotes | , |
| T5531 | 9049-9053 | NN | denotes | IκBα |
| T5532 | 9054-9069 | NN | denotes | phosphorylation |
| T5533 | 9070-9073 | CC | denotes | and |
| T5534 | 9074-9085 | NN | denotes | degradation |
| T5535 | 9086-9092 | PRP | denotes | itself |
| T5536 | 9093-9095 | VB | denotes | is |
| T5537 | 9096-9104 | VB | denotes | required |
| T5538 | 9105-9108 | CC | denotes | but |
| T5539 | 9109-9112 | RB | denotes | not |
| T5540 | 9113-9123 | JJ | denotes | sufficient |
| T5541 | 9124-9126 | TO | denotes | to |
| T5542 | 9127-9132 | VB | denotes | cause |
| T5543 | 9133-9137 | NN | denotes | RPS3 |
| T5544 | 9138-9149 | NN | denotes | association |
| T5545 | 9150-9154 | IN | denotes | with |
| T5546 | 9155-9165 | NN | denotes | importin-α |
| T5547 | 9166-9174 | VB | denotes | followed |
| T5548 | 9175-9177 | IN | denotes | by |
| T5549 | 9178-9185 | JJ | denotes | nuclear |
| T5550 | 9186-9199 | NN | denotes | translocation |
| T5551 | 9201-9207 | RB | denotes | Rather |
| T5552 | 9207-9208 | -COMMA- | denotes | , |
| T5553 | 9209-9211 | DT | denotes | an |
| T5554 | 9212-9222 | JJ | denotes | additional |
| T5555 | 9223-9229 | NN | denotes | signal |
| T5556 | 9229-9230 | -COMMA- | denotes | , |
| T5557 | 9231-9242 | RB | denotes | potentially |
| T5558 | 9243-9247 | NN | denotes | IKKβ |
| T5559 | 9248-9263 | NN | denotes | phosphorylation |
| T5560 | 9264-9266 | IN | denotes | of |
| T5561 | 9267-9271 | NN | denotes | RPS3 |
| T5562 | 9271-9272 | -COMMA- | denotes | , |
| T5563 | 9273-9275 | VB | denotes | is |
| T5564 | 9276-9284 | VB | denotes | required |
| T7159 | 9287-9291 | NN | denotes | IKKβ |
| T7160 | 9292-9306 | VB | denotes | phosphorylates |
| T7161 | 9307-9311 | NN | denotes | RPS3 |
| T7162 | 9312-9314 | IN | denotes | at |
| T7163 | 9315-9321 | NN | denotes | serine |
| T7164 | 9322-9325 | CD | denotes | 209 |
| T7165 | 9326-9334 | IN | denotes | Although |
| T7166 | 9335-9345 | RB | denotes | originally |
| T7167 | 9346-9353 | VB | denotes | defined |
| T7168 | 9354-9356 | IN | denotes | as |
| T7169 | 9357-9360 | DT | denotes | the |
| T7170 | 9361-9367 | NN | denotes | kinase |
| T7171 | 9368-9372 | WDT | denotes | that |
| T7172 | 9373-9387 | VB | denotes | phosphorylates |
| T7173 | 9388-9393 | NN | denotes | IκB19 |
| T7174 | 9393-9394 | -COMMA- | denotes | , |
| T7175 | 9395-9399 | NN | denotes | IKKβ |
| T7176 | 9400-9404 | RB | denotes | also |
| T7177 | 9405-9419 | VB | denotes | phosphorylates |
| T7178 | 9420-9429 | JJ | denotes | unrelated |
| T7179 | 9430-9440 | NN | denotes | substrates |
| T7180 | 9441-9450 | VB | denotes | including |
| T7181 | 9451-9458 | JJ | denotes | 14-3-3β |
| T7182 | 9459-9462 | CC | denotes | and |
| T7183 | 9463-9468 | NN | denotes | Bcl10 |
| T7184 | 9468-9469 | -COMMA- | denotes | , |
| T7185 | 9470-9475 | WDT | denotes | which |
| T7186 | 9476-9480 | VB | denotes | lack |
| T7187 | 9481-9484 | DT | denotes | the |
| T7188 | 9485-9488 | NN | denotes | IKK |
| T7189 | 9489-9498 | NN | denotes | consensus |
| T7190 | 9499-9504 | NN | denotes | motif |
| T7191 | 9505-9506 | -LRB- | denotes | ( |
| T7192 | 9506-9516 | NN | denotes | DpSGYXpS/T |
| T7193 | 9516-9517 | -RRB- | denotes | ) |
| T7194 | 9517-9519 | CD | denotes | 28 |
| T7195 | 9521-9523 | PRP | denotes | We |
| T7196 | 9524-9533 | RB | denotes | therefore |
| T7197 | 9534-9546 | VB | denotes | hypothesized |
| T7198 | 9547-9551 | IN | denotes | that |
| T7199 | 9552-9556 | NN | denotes | IKKβ |
| T7200 | 9557-9562 | MD | denotes | could |
| T7201 | 9563-9571 | RB | denotes | directly |
| T7202 | 9572-9585 | VB | denotes | phosphorylate |
| T7203 | 9586-9590 | NN | denotes | RPS3 |
| T7204 | 9592-9594 | IN | denotes | By |
| T7205 | 9595-9597 | FW | denotes | in |
| T7206 | 9598-9603 | FW | denotes | vitro |
| T7207 | 9604-9610 | NN | denotes | kinase |
| T7208 | 9611-9617 | NN | denotes | assays |
| T7209 | 9618-9623 | VB | denotes | using |
| T7210 | 9624-9635 | JJ | denotes | recombinant |
| T7211 | 9636-9639 | NN | denotes | IKK |
| T7212 | 9640-9643 | CC | denotes | and |
| T7213 | 9644-9648 | NN | denotes | RPS3 |
| T7214 | 9649-9657 | NN | denotes | proteins |
| T7215 | 9657-9658 | -COMMA- | denotes | , |
| T7216 | 9659-9661 | PRP | denotes | we |
| T7217 | 9662-9670 | VB | denotes | observed |
| T7218 | 9671-9677 | JJ | denotes | strong |
| T7219 | 9678-9691 | NN | denotes | incorporation |
| T7220 | 9692-9694 | IN | denotes | of |
| T7221 | 9695-9698 | NN | denotes | 32P |
| T7222 | 9699-9701 | IN | denotes | in |
| T7223 | 9702-9719 | NN | denotes | autophosphorylatd |
| T7224 | 9720-9724 | NN | denotes | IKKα |
| T7225 | 9725-9728 | CC | denotes | and |
| T7226 | 9729-9733 | NN | denotes | IKKβ |
| T7227 | 9734-9735 | -LRB- | denotes | ( |
| T7228 | 9735-9739 | NNP | denotes | Fig. |
| T7229 | 9740-9742 | NN | denotes | 4a |
| T7230 | 9742-9743 | -COMMA- | denotes | , |
| T7231 | 9744-9749 | NN | denotes | lanes |
| T7232 | 9750-9753 | CD | denotes | 2-7 |
| T7233 | 9753-9754 | -RRB- | denotes | ) |
| T7234 | 9755-9757 | RB | denotes | as |
| T7235 | 9758-9762 | RB | denotes | well |
| T7236 | 9763-9765 | IN | denotes | as |
| T7237 | 9766-9779 | VB | denotes | phosporylated |
| T7238 | 9780-9788 | NN | denotes | GST-IκBα |
| T7239 | 9789-9790 | -LRB- | denotes | ( |
| T7240 | 9790-9794 | CD | denotes | 1-54 |
| T7241 | 9794-9795 | -RRB- | denotes | ) |
| T7242 | 9796-9797 | -LRB- | denotes | ( |
| T7243 | 9797-9810 | NNP | denotes | Supplementary |
| T7244 | 9811-9815 | NNP | denotes | Fig. |
| T7245 | 9816-9817 | CD | denotes | 4 |
| T7246 | 9817-9818 | -RRB- | denotes | ) |
| T7247 | 9818-9819 | -COMMA- | denotes | , |
| T7248 | 9820-9823 | CC | denotes | but |
| T7249 | 9824-9827 | RB | denotes | not |
| T7250 | 9828-9831 | DT | denotes | the |
| T7251 | 9832-9835 | NN | denotes | GST |
| T7252 | 9836-9843 | NN | denotes | protein |
| T7253 | 9844-9849 | RB | denotes | alone |
| T7254 | 9850-9851 | -LRB- | denotes | ( |
| T7255 | 9851-9855 | NNP | denotes | Fig. |
| T7256 | 9856-9858 | NN | denotes | 4a |
| T7257 | 9858-9859 | -COMMA- | denotes | , |
| T7258 | 9860-9865 | NN | denotes | lanes |
| T7259 | 9866-9867 | CD | denotes | 3 |
| T7260 | 9868-9871 | CC | denotes | and |
| T7261 | 9872-9873 | CD | denotes | 6 |
| T7262 | 9873-9874 | -RRB- | denotes | ) |
| T7263 | 9874-9875 | -COMMA- | denotes | , |
| T7264 | 9876-9880 | WRB | denotes | when |
| T7265 | 9881-9887 | CC | denotes | either |
| T7266 | 9888-9892 | NN | denotes | IKKα |
| T7267 | 9893-9895 | CC | denotes | or |
| T7268 | 9896-9900 | NN | denotes | IKKβ |
| T7269 | 9901-9904 | VB | denotes | was |
| T7270 | 9905-9909 | VB | denotes | used |
| T7271 | 9911-9913 | PRP | denotes | We |
| T7272 | 9914-9924 | VB | denotes | discovered |
| T7273 | 9925-9929 | IN | denotes | that |
| T7274 | 9930-9938 | NN | denotes | GST-RPS3 |
| T7275 | 9939-9944 | MD | denotes | could |
| T7276 | 9945-9947 | VB | denotes | be |
| T7277 | 9948-9962 | VB | denotes | phosphorylated |
| T7278 | 9963-9965 | IN | denotes | by |
| T7279 | 9966-9970 | NN | denotes | IKKβ |
| T7280 | 9970-9971 | -COMMA- | denotes | , |
| T7281 | 9972-9975 | CC | denotes | but |
| T7282 | 9976-9979 | RB | denotes | not |
| T7283 | 9980-9984 | NN | denotes | IKKα |
| T7284 | 9984-9985 | -COMMA- | denotes | , |
| T7285 | 9986-9988 | FW | denotes | in |
| T7286 | 9989-9994 | FW | denotes | vitro |
| T7287 | 9995-9996 | -LRB- | denotes | ( |
| T7288 | 9996-10000 | FW | denotes | Fig. |
| T7289 | 10001-10003 | NN | denotes | 4a |
| T7290 | 10003-10004 | -COMMA- | denotes | , |
| T7291 | 10005-10012 | NN | denotes | compare |
| T7292 | 10013-10018 | NN | denotes | lanes |
| T7293 | 10019-10020 | CD | denotes | 4 |
| T7294 | 10021-10024 | CC | denotes | and |
| T7295 | 10025-10026 | CD | denotes | 7 |
| T7296 | 10026-10027 | -RRB- | denotes | ) |
| T7297 | 10029-10031 | TO | denotes | To |
| T7298 | 10032-10040 | VB | denotes | identify |
| T7299 | 10041-10044 | DT | denotes | the |
| T7300 | 10045-10049 | NN | denotes | RPS3 |
| T7301 | 10050-10055 | JJ | denotes | amino |
| T7302 | 10056-10060 | NN | denotes | acid |
| T7303 | 10061-10068 | NN | denotes | residue |
| T7304 | 10068-10069 | -LRB- | denotes | ( |
| T7305 | 10069-10070 | NN | denotes | s |
| T7306 | 10070-10071 | -RRB- | denotes | ) |
| T7307 | 10072-10086 | VB | denotes | phosphorylated |
| T7308 | 10087-10089 | IN | denotes | by |
| T7309 | 10090-10094 | NN | denotes | IKKβ |
| T7310 | 10094-10095 | -COMMA- | denotes | , |
| T7311 | 10096-10098 | PRP | denotes | we |
| T7312 | 10099-10108 | VB | denotes | performed |
| T7313 | 10109-10115 | JJ | denotes | liquid |
| T7314 | 10116-10137 | JJ | denotes | chromatography-tandem |
| T7315 | 10138-10142 | NN | denotes | mass |
| T7316 | 10143-10155 | NN | denotes | spectrometry |
| T7317 | 10156-10164 | NN | denotes | analyses |
| T7318 | 10165-10170 | VB | denotes | using |
| T7319 | 10171-10173 | FW | denotes | in |
| T7320 | 10174-10179 | FW | denotes | vitro |
| T7321 | 10180-10194 | VB | denotes | phosphorylated |
| T7322 | 10195-10199 | NN | denotes | RPS3 |
| T7323 | 10201-10204 | DT | denotes | The |
| T7324 | 10205-10212 | NN | denotes | results |
| T7325 | 10213-10222 | VB | denotes | indicated |
| T7326 | 10223-10227 | IN | denotes | that |
| T7327 | 10228-10232 | NN | denotes | IKKβ |
| T7328 | 10233-10247 | VB | denotes | phosphorylated |
| T7329 | 10248-10252 | NN | denotes | S209 |
| T7330 | 10252-10253 | -COMMA- | denotes | , |
| T7331 | 10254-10261 | JJ | denotes | located |
| T7332 | 10262-10264 | IN | denotes | in |
| T7333 | 10265-10268 | DT | denotes | the |
| T7334 | 10269-10273 | NN | denotes | RPS3 |
| T7335 | 10274-10284 | NN | denotes | C-terminus |
| T7336 | 10285-10286 | -LRB- | denotes | ( |
| T7337 | 10286-10290 | NN | denotes | Fig. |
| T7338 | 10291-10293 | NN | denotes | 4b |
| T7339 | 10293-10294 | -RRB- | denotes | ) |
| T7340 | 10296-10300 | NN | denotes | RPS3 |
| T7341 | 10301-10306 | JJ | denotes | amino |
| T7342 | 10307-10311 | NN | denotes | acid |
| T7343 | 10312-10320 | NN | denotes | sequence |
| T7344 | 10321-10330 | NN | denotes | alignment |
| T7345 | 10331-10339 | VB | denotes | revealed |
| T7346 | 10340-10344 | IN | denotes | that |
| T7347 | 10345-10349 | NN | denotes | S209 |
| T7348 | 10350-10352 | VB | denotes | is |
| T7349 | 10353-10362 | VB | denotes | conserved |
| T7350 | 10363-10365 | IN | denotes | in |
| T7351 | 10366-10370 | JJ | denotes | many |
| T7352 | 10371-10378 | NN | denotes | species |
| T7353 | 10379-10389 | IN | denotes | throughout |
| T7354 | 10390-10399 | NN | denotes | phylogeny |
| T7355 | 10400-10404 | IN | denotes | with |
| T7356 | 10405-10408 | DT | denotes | the |
| T7357 | 10409-10418 | NN | denotes | exception |
| T7358 | 10419-10421 | IN | denotes | of |
| T7359 | 10422-10436 | NN | denotes | Caenorhabditis |
| T7360 | 10437-10444 | NN | denotes | elegans |
| T7361 | 10445-10448 | CC | denotes | and |
| T7362 | 10449-10468 | FW | denotes | Schizosaccharomyces |
| T7363 | 10469-10474 | FW | denotes | pombe |
| T7364 | 10474-10475 | -COMMA- | denotes | , |
| T7365 | 10476-10479 | CD | denotes | two |
| T7366 | 10480-10489 | NN | denotes | organisms |
| T7367 | 10490-10494 | WDT | denotes | that |
| T7368 | 10495-10497 | VB | denotes | do |
| T7369 | 10498-10501 | RB | denotes | not |
| T7370 | 10502-10509 | VB | denotes | possess |
| T7371 | 10510-10513 | DT | denotes | the |
| T7372 | 10514-10519 | NN | denotes | NF-κB |
| T7373 | 10520-10526 | NN | denotes | signal |
| T7374 | 10527-10534 | NN | denotes | pathway |
| T7375 | 10535-10536 | -LRB- | denotes | ( |
| T7376 | 10536-10549 | NNP | denotes | Supplementary |
| T7377 | 10550-10554 | NNP | denotes | Fig. |
| T7378 | 10555-10556 | CD | denotes | 5 |
| T7379 | 10556-10557 | -RRB- | denotes | ) |
| T7380 | 10559-10561 | TO | denotes | To |
| T7381 | 10562-10568 | VB | denotes | verify |
| T7382 | 10569-10582 | RB | denotes | biochemically |
| T7383 | 10583-10587 | IN | denotes | that |
| T7384 | 10588-10592 | NN | denotes | S209 |
| T7385 | 10593-10595 | VB | denotes | is |
| T7386 | 10596-10598 | DT | denotes | an |
| T7387 | 10599-10603 | NN | denotes | IKKβ |
| T7388 | 10604-10613 | NN | denotes | substrate |
| T7389 | 10613-10614 | -COMMA- | denotes | , |
| T7390 | 10615-10617 | PRP | denotes | we |
| T7391 | 10618-10627 | VB | denotes | performed |
| T7392 | 10628-10640 | JJ | denotes | 32P-labeling |
| T7393 | 10641-10643 | FW | denotes | in |
| T7394 | 10644-10649 | FW | denotes | vitro |
| T7395 | 10650-10656 | NN | denotes | kinase |
| T7396 | 10657-10663 | NN | denotes | assays |
| T7397 | 10664-10668 | IN | denotes | with |
| T7398 | 10669-10680 | JJ | denotes | recombinant |
| T7399 | 10681-10690 | JJ | denotes | wild-type |
| T7400 | 10691-10693 | CC | denotes | or |
| T7401 | 10694-10699 | NN | denotes | S209A |
| T7402 | 10700-10706 | JJ | denotes | mutant |
| T7403 | 10707-10711 | NN | denotes | RPS3 |
| T7404 | 10712-10720 | NN | denotes | proteins |
| T7405 | 10722-10730 | VB | denotes | Compared |
| T7406 | 10731-10735 | IN | denotes | with |
| T7407 | 10736-10739 | DT | denotes | the |
| T7408 | 10740-10749 | JJ | denotes | wild-type |
| T7409 | 10750-10757 | NN | denotes | protein |
| T7410 | 10757-10758 | -COMMA- | denotes | , |
| T7411 | 10759-10762 | DT | denotes | the |
| T7412 | 10763-10768 | NN | denotes | S209A |
| T7413 | 10769-10777 | NN | denotes | mutation |
| T7414 | 10778-10785 | VB | denotes | reduced |
| T7415 | 10786-10799 | JJ | denotes | IKKβ–mediated |
| T7416 | 10800-10804 | NN | denotes | RPS3 |
| T7417 | 10805-10820 | NN | denotes | phosphorylation |
| T7418 | 10821-10822 | -LRB- | denotes | ( |
| T7419 | 10822-10826 | NN | denotes | Fig. |
| T7420 | 10827-10829 | NN | denotes | 4c |
| T7421 | 10829-10830 | -RRB- | denotes | ) |
| T7422 | 10832-10837 | EX | denotes | There |
| T7423 | 10838-10843 | MD | denotes | might |
| T7424 | 10844-10846 | VB | denotes | be |
| T7425 | 10847-10858 | JJ | denotes | alternative |
| T7426 | 10859-10874 | NN | denotes | phosphorylation |
| T7427 | 10875-10879 | NN | denotes | site |
| T7428 | 10879-10880 | -LRB- | denotes | ( |
| T7429 | 10880-10881 | NN | denotes | s |
| T7430 | 10881-10882 | -RRB- | denotes | ) |
| T7431 | 10883-10888 | IN | denotes | under |
| T7432 | 10889-10894 | DT | denotes | these |
| T7433 | 10895-10905 | NN | denotes | conditions |
| T7434 | 10906-10911 | VB | denotes | given |
| T7435 | 10912-10918 | JJ | denotes | modest |
| T7436 | 10919-10927 | JJ | denotes | residual |
| T7437 | 10928-10942 | VB | denotes | phosphorylated |
| T7438 | 10943-10947 | NN | denotes | RPS3 |
| T7439 | 10948-10949 | -LRB- | denotes | ( |
| T7440 | 10949-10953 | NN | denotes | Fig. |
| T7441 | 10954-10956 | NN | denotes | 4c |
| T7442 | 10956-10957 | -RRB- | denotes | ) |
| T7443 | 10959-10963 | NN | denotes | RPS3 |
| T7444 | 10964-10968 | NN | denotes | S209 |
| T7445 | 10969-10973 | VB | denotes | does |
| T7446 | 10974-10977 | RB | denotes | not |
| T7447 | 10978-10982 | VB | denotes | fall |
| T7448 | 10983-10989 | IN | denotes | within |
| T7449 | 10990-10991 | DT | denotes | a |
| T7450 | 10992-11004 | JJ | denotes | conventional |
| T7451 | 11005-11008 | NN | denotes | IKK |
| T7452 | 11009-11020 | NN | denotes | recognition |
| T7453 | 11021-11026 | NN | denotes | motif |
| T7454 | 11026-11027 | -COMMA- | denotes | , |
| T7455 | 11028-11031 | CC | denotes | but |
| T7456 | 11032-11038 | RB | denotes | rather |
| T7457 | 11039-11046 | VB | denotes | resides |
| T7458 | 11047-11049 | IN | denotes | in |
| T7459 | 11050-11051 | DT | denotes | a |
| T7460 | 11052-11060 | NN | denotes | sequence |
| T7461 | 11061-11066 | NN | denotes | motif |
| T7462 | 11067-11068 | -LRB- | denotes | ( |
| T7463 | 11068-11078 | NN | denotes | XXXpS/TXXE |
| T7464 | 11078-11079 | -RRB- | denotes | ) |
| T7465 | 11079-11080 | -COMMA- | denotes | , |
| T7466 | 11081-11092 | RB | denotes | potentially |
| T7467 | 11093-11103 | VB | denotes | recognized |
| T7468 | 11104-11106 | IN | denotes | by |
| T7469 | 11107-11113 | NN | denotes | casein |
| T7470 | 11114-11120 | NN | denotes | kinase |
| T7471 | 11121-11123 | CD | denotes | II |
| T7472 | 11124-11125 | -LRB- | denotes | ( |
| T7473 | 11125-11128 | NN | denotes | CK2 |
| T7474 | 11128-11129 | -RRB- | denotes | ) |
| T7475 | 11131-11139 | IN | denotes | Although |
| T7476 | 11140-11144 | NN | denotes | IKKβ |
| T7477 | 11145-11151 | NN | denotes | kinase |
| T7478 | 11152-11155 | MD | denotes | can |
| T7479 | 11156-11163 | VB | denotes | display |
| T7480 | 11164-11165 | DT | denotes | a |
| T7481 | 11166-11174 | JJ | denotes | CK2-like |
| T7482 | 11175-11190 | NN | denotes | phosphorylation |
| T7483 | 11191-11204 | NN | denotes | specificity29 |
| T7484 | 11204-11205 | -COMMA- | denotes | , |
| T7485 | 11206-11208 | DT | denotes | no |
| T7486 | 11209-11212 | NN | denotes | CK2 |
| T7487 | 11213-11220 | NN | denotes | protein |
| T7488 | 11221-11224 | VB | denotes | was |
| T7489 | 11225-11235 | JJ | denotes | detectable |
| T7490 | 11236-11238 | IN | denotes | in |
| T7491 | 11239-11242 | PRP-DOLLAR- | denotes | our |
| T7492 | 11243-11254 | JJ | denotes | recombinant |
| T7493 | 11255-11258 | NN | denotes | IKK |
| T7494 | 11259-11267 | NN | denotes | proteins |
| T7495 | 11268-11269 | -LRB- | denotes | ( |
| T7496 | 11269-11282 | NNP | denotes | Supplementary |
| T7497 | 11283-11287 | NNP | denotes | Fig. |
| T7498 | 11288-11289 | CD | denotes | 6 |
| T7499 | 11289-11290 | -RRB- | denotes | ) |
| T7500 | 11292-11296 | RB | denotes | Thus |
| T7501 | 11296-11297 | -COMMA- | denotes | , |
| T7502 | 11298-11302 | NN | denotes | RPS3 |
| T7503 | 11303-11307 | NN | denotes | S209 |
| T7504 | 11308-11323 | NN | denotes | phosphorylation |
| T7505 | 11324-11327 | VB | denotes | was |
| T7506 | 11328-11331 | JJ | denotes | due |
| T7507 | 11332-11334 | TO | denotes | to |
| T7508 | 11335-11338 | DT | denotes | the |
| T7509 | 11339-11348 | JJ | denotes | alternate |
| T7510 | 11349-11360 | NN | denotes | specificity |
| T7511 | 11361-11363 | IN | denotes | of |
| T7512 | 11364-11367 | DT | denotes | the |
| T7513 | 11368-11372 | NN | denotes | IKKβ |
| T7514 | 11373-11379 | NN | denotes | kinase |
| T7515 | 11380-11386 | RB | denotes | rather |
| T7516 | 11387-11391 | IN | denotes | than |
| T7517 | 11392-11395 | DT | denotes | any |
| T7518 | 11396-11401 | NN | denotes | trace |
| T7519 | 11402-11408 | NN | denotes | amount |
| T7520 | 11409-11411 | IN | denotes | of |
| T7521 | 11412-11415 | NN | denotes | CK2 |
| T7522 | 11416-11421 | VB | denotes | bound |
| T7523 | 11422-11424 | TO | denotes | to |
| T7524 | 11425-11429 | NN | denotes | IKKs |
| T7525 | 11431-11433 | TO | denotes | To |
| T7526 | 11434-11443 | VB | denotes | determine |
| T7527 | 11444-11451 | IN | denotes | whether |
| T7528 | 11452-11456 | NN | denotes | S209 |
| T7529 | 11457-11459 | VB | denotes | is |
| T7530 | 11460-11463 | DT | denotes | the |
| T7531 | 11464-11472 | JJ | denotes | critical |
| T7532 | 11473-11477 | NN | denotes | site |
| T7533 | 11478-11480 | IN | denotes | at |
| T7534 | 11481-11486 | WDT | denotes | which |
| T7535 | 11487-11491 | NN | denotes | IKKβ |
| T7536 | 11492-11506 | VB | denotes | phosphorylates |
| T7537 | 11507-11511 | NN | denotes | RPS3 |
| T7538 | 11512-11514 | IN | denotes | in |
| T7539 | 11515-11521 | VB | denotes | living |
| T7540 | 11522-11527 | NN | denotes | cells |
| T7541 | 11527-11528 | -COMMA- | denotes | , |
| T7542 | 11529-11531 | PRP | denotes | we |
| T7543 | 11532-11543 | VB | denotes | transfected |
| T7544 | 11544-11547 | DT | denotes | the |
| T7545 | 11548-11557 | JJ | denotes | wild-type |
| T7546 | 11558-11560 | CC | denotes | or |
| T7547 | 11561-11566 | NN | denotes | S209A |
| T7548 | 11567-11573 | JJ | denotes | mutant |
| T7549 | 11574-11583 | NN | denotes | Flag-RPS3 |
| T7550 | 11584-11589 | RB | denotes | alone |
| T7551 | 11589-11590 | -COMMA- | denotes | , |
| T7552 | 11591-11593 | CC | denotes | or |
| T7553 | 11594-11602 | RB | denotes | together |
| T7554 | 11603-11607 | IN | denotes | with |
| T7555 | 11608-11612 | NN | denotes | IKKβ |
| T7556 | 11613-11617 | IN | denotes | into |
| T7557 | 11618-11623 | NN | denotes | cells |
| T7558 | 11625-11631 | RB | denotes | Indeed |
| T7559 | 11631-11632 | -COMMA- | denotes | , |
| T7560 | 11633-11635 | PRP | denotes | we |
| T7561 | 11636-11644 | VB | denotes | observed |
| T7562 | 11645-11649 | IN | denotes | that |
| T7563 | 11650-11664 | VB | denotes | overexpressing |
| T7564 | 11665-11669 | NN | denotes | IKKβ |
| T7565 | 11670-11678 | VB | denotes | enhanced |
| T7566 | 11679-11688 | NN | denotes | Flag-RPS3 |
| T7567 | 11689-11704 | NN | denotes | phosphorylation |
| T7568 | 11704-11705 | -COMMA- | denotes | , |
| T7569 | 11706-11709 | CC | denotes | but |
| T7570 | 11710-11725 | NN | denotes | phosphorylation |
| T7571 | 11726-11729 | VB | denotes | was |
| T7572 | 11730-11741 | RB | denotes | effectively |
| T7573 | 11742-11752 | VB | denotes | eliminated |
| T7574 | 11753-11755 | IN | denotes | by |
| T7575 | 11756-11763 | NN | denotes | alanine |
| T7576 | 11764-11776 | NN | denotes | substitution |
| T7577 | 11777-11787 | VB | denotes | indicating |
| T7578 | 11788-11792 | IN | denotes | that |
| T7579 | 11793-11797 | NN | denotes | S209 |
| T7580 | 11798-11800 | VB | denotes | is |
| T7581 | 11801-11804 | DT | denotes | the |
| T7582 | 11805-11816 | JJ | denotes | predominant |
| T7583 | 11817-11823 | NN | denotes | target |
| T7584 | 11824-11828 | NN | denotes | site |
| T7585 | 11829-11832 | IN | denotes | for |
| T7586 | 11833-11837 | NN | denotes | IKKβ |
| T7587 | 11838-11853 | NN | denotes | phosphorylation |
| T7588 | 11854-11855 | -LRB- | denotes | ( |
| T7589 | 11855-11859 | NNP | denotes | Fig. |
| T7590 | 11860-11862 | NN | denotes | 4d |
| T7591 | 11862-11863 | -RRB- | denotes | ) |
| T7592 | 11865-11867 | PRP | denotes | We |
| T7593 | 11868-11872 | RB | denotes | next |
| T7594 | 11873-11882 | VB | denotes | generated |
| T7595 | 11883-11884 | DT | denotes | a |
| T7596 | 11885-11897 | NN | denotes | phospho-S209 |
| T7597 | 11898-11902 | NN | denotes | RPS3 |
| T7598 | 11903-11911 | NN | denotes | antibody |
| T7599 | 11912-11915 | CC | denotes | and |
| T7600 | 11916-11925 | VB | denotes | confirmed |
| T7601 | 11926-11930 | IN | denotes | that |
| T7602 | 11931-11941 | JJ | denotes | endogenous |
| T7603 | 11942-11946 | NN | denotes | RPS3 |
| T7604 | 11947-11950 | VB | denotes | was |
| T7605 | 11951-11965 | VB | denotes | phosphorylated |
| T7606 | 11966-11968 | IN | denotes | at |
| T7607 | 11969-11973 | NN | denotes | S209 |
| T7608 | 11974-11976 | IN | denotes | in |
| T7609 | 11977-11978 | DT | denotes | a |
| T7610 | 11979-11993 | JJ | denotes | time-dependent |
| T7611 | 11994-12000 | NN | denotes | manner |
| T7612 | 12001-12005 | IN | denotes | upon |
| T7613 | 12006-12009 | NN | denotes | TNF |
| T7614 | 12010-12021 | NN | denotes | stimulation |
| T7615 | 12022-12023 | -LRB- | denotes | ( |
| T7616 | 12023-12027 | NN | denotes | Fig. |
| T7617 | 12028-12030 | NN | denotes | 4e |
| T7618 | 12030-12031 | -RRB- | denotes | ) |
| T7619 | 12033-12037 | RB | denotes | Thus |
| T7620 | 12037-12038 | -COMMA- | denotes | , |
| T7621 | 12039-12042 | DT | denotes | the |
| T7622 | 12043-12047 | NN | denotes | RPS3 |
| T7623 | 12048-12058 | JJ | denotes | C-terminal |
| T7624 | 12059-12063 | NN | denotes | tail |
| T7625 | 12064-12075 | RB | denotes | potentially |
| T7626 | 12076-12084 | VB | denotes | contains |
| T7627 | 12085-12087 | DT | denotes | an |
| T7628 | 12088-12097 | JJ | denotes | important |
| T7629 | 12098-12108 | JJ | denotes | regulatory |
| T7630 | 12109-12113 | NN | denotes | site |
| T9178 | 12116-12131 | NN | denotes | Phosphorylation |
| T9179 | 12132-12134 | IN | denotes | of |
| T9180 | 12135-12139 | NN | denotes | RPS3 |
| T9181 | 12140-12143 | CC | denotes | and |
| T9182 | 12144-12147 | PRP-DOLLAR- | denotes | its |
| T9183 | 12148-12153 | NN | denotes | NF-κB |
| T9184 | 12154-12162 | NN | denotes | function |
| T9185 | 12163-12165 | PRP | denotes | We |
| T9186 | 12166-12170 | RB | denotes | next |
| T9187 | 12171-12179 | VB | denotes | examined |
| T9188 | 12180-12187 | IN | denotes | whether |
| T9189 | 12188-12192 | NN | denotes | S209 |
| T9190 | 12193-12208 | NN | denotes | phosphorylation |
| T9191 | 12209-12214 | VB | denotes | plays |
| T9192 | 12215-12216 | DT | denotes | a |
| T9193 | 12217-12221 | NN | denotes | role |
| T9194 | 12222-12224 | IN | denotes | in |
| T9195 | 12225-12228 | DT | denotes | the |
| T9196 | 12229-12236 | JJ | denotes | nuclear |
| T9197 | 12237-12250 | NN | denotes | translocation |
| T9198 | 12251-12253 | IN | denotes | of |
| T9199 | 12254-12258 | NN | denotes | RPS3 |
| T9200 | 12259-12265 | IN | denotes | during |
| T9201 | 12266-12271 | NN | denotes | NF-κB |
| T9202 | 12272-12282 | NN | denotes | activation |
| T9203 | 12284-12295 | JJ | denotes | Subcellular |
| T9204 | 12296-12305 | NN | denotes | fractions |
| T9205 | 12306-12310 | IN | denotes | from |
| T9206 | 12311-12317 | CC | denotes | either |
| T9207 | 12318-12327 | JJ | denotes | wild-type |
| T9208 | 12328-12330 | CC | denotes | or |
| T9209 | 12331-12336 | NN | denotes | S209A |
| T9210 | 12337-12343 | JJ | denotes | mutant |
| T9211 | 12344-12360 | JJ | denotes | RPS3-transfected |
| T9212 | 12361-12366 | NN | denotes | cells |
| T9213 | 12367-12371 | VB | denotes | were |
| T9214 | 12372-12380 | VB | denotes | prepared |
| T9215 | 12381-12384 | CC | denotes | and |
| T9216 | 12385-12392 | VB | denotes | blotted |
| T9217 | 12393-12396 | IN | denotes | for |
| T9218 | 12397-12407 | NN | denotes | heat-shock |
| T9219 | 12408-12415 | NN | denotes | protein |
| T9220 | 12416-12418 | CD | denotes | 90 |
| T9221 | 12419-12420 | -LRB- | denotes | ( |
| T9222 | 12420-12425 | NN | denotes | hsp90 |
| T9223 | 12425-12426 | -RRB- | denotes | ) |
| T9224 | 12426-12427 | -COMMA- | denotes | , |
| T9225 | 12428-12429 | DT | denotes | a |
| T9226 | 12430-12441 | JJ | denotes | cytoplasmic |
| T9227 | 12442-12449 | NN | denotes | protein |
| T9228 | 12449-12450 | -COMMA- | denotes | , |
| T9229 | 12451-12454 | CC | denotes | and |
| T9230 | 12455-12459 | NN | denotes | poly |
| T9231 | 12460-12461 | -LRB- | denotes | ( |
| T9232 | 12461-12471 | NN | denotes | ADP-ribose |
| T9233 | 12471-12472 | -RRB- | denotes | ) |
| T9234 | 12473-12483 | NN | denotes | polymerase |
| T9235 | 12484-12485 | -LRB- | denotes | ( |
| T9236 | 12485-12489 | NN | denotes | PARP |
| T9237 | 12489-12490 | -RRB- | denotes | ) |
| T9238 | 12490-12491 | -COMMA- | denotes | , |
| T9239 | 12492-12493 | DT | denotes | a |
| T9240 | 12494-12501 | JJ | denotes | nuclear |
| T9241 | 12502-12509 | NN | denotes | protein |
| T9242 | 12509-12510 | -COMMA- | denotes | , |
| T9243 | 12511-12521 | VB | denotes | confirming |
| T9244 | 12522-12523 | DT | denotes | a |
| T9245 | 12524-12529 | JJ | denotes | clean |
| T9246 | 12530-12540 | NN | denotes | separation |
| T9247 | 12541-12542 | -LRB- | denotes | ( |
| T9248 | 12542-12546 | NN | denotes | Fig. |
| T9249 | 12547-12549 | NN | denotes | 5a |
| T9250 | 12549-12550 | -RRB- | denotes | ) |
| T9251 | 12552-12554 | IN | denotes | As |
| T9252 | 12555-12563 | VB | denotes | expected |
| T9253 | 12563-12564 | -COMMA- | denotes | , |
| T9254 | 12565-12570 | NN | denotes | PMA+I |
| T9255 | 12571-12582 | NN | denotes | stimulation |
| T9256 | 12583-12592 | VB | denotes | triggered |
| T9257 | 12593-12602 | JJ | denotes | wild-type |
| T9258 | 12603-12612 | NN | denotes | Flag-RPS3 |
| T9259 | 12613-12620 | JJ | denotes | nuclear |
| T9260 | 12621-12634 | NN | denotes | translocation |
| T9261 | 12635-12636 | -LRB- | denotes | ( |
| T9262 | 12636-12640 | NN | denotes | Fig. |
| T9263 | 12641-12643 | NN | denotes | 5a |
| T9264 | 12643-12644 | -RRB- | denotes | ) |
| T9265 | 12646-12653 | RB | denotes | However |
| T9266 | 12653-12654 | -COMMA- | denotes | , |
| T9267 | 12655-12659 | NN | denotes | RPS3 |
| T9268 | 12660-12661 | -LRB- | denotes | ( |
| T9269 | 12661-12666 | NN | denotes | S209A |
| T9270 | 12666-12667 | -RRB- | denotes | ) |
| T9271 | 12668-12675 | JJ | denotes | nuclear |
| T9272 | 12676-12689 | NN | denotes | translocation |
| T9273 | 12690-12693 | VB | denotes | was |
| T9274 | 12694-12704 | VB | denotes | attenuated |
| T9275 | 12705-12706 | -LRB- | denotes | ( |
| T9276 | 12706-12710 | NNP | denotes | Fig. |
| T9277 | 12711-12713 | NN | denotes | 5a |
| T9278 | 12713-12714 | -RRB- | denotes | ) |
| T9279 | 12716-12718 | PRP | denotes | We |
| T9280 | 12719-12723 | RB | denotes | also |
| T9281 | 12724-12730 | VB | denotes | tested |
| T9282 | 12731-12734 | DT | denotes | the |
| T9283 | 12735-12741 | NN | denotes | impact |
| T9284 | 12742-12744 | IN | denotes | of |
| T9285 | 12745-12755 | VB | denotes | activating |
| T9286 | 12756-12761 | NN | denotes | NF-κB |
| T9287 | 12762-12764 | IN | denotes | by |
| T9288 | 12765-12779 | VB | denotes | overexpressing |
| T9289 | 12780-12784 | NN | denotes | IKKβ |
| T9290 | 12785-12787 | IN | denotes | on |
| T9291 | 12788-12792 | NN | denotes | RPS3 |
| T9292 | 12793-12800 | JJ | denotes | nuclear |
| T9293 | 12801-12814 | NN | denotes | translocation |
| T9294 | 12816-12820 | NN | denotes | IKKβ |
| T9295 | 12821-12835 | NN | denotes | overexpression |
| T9296 | 12836-12845 | VB | denotes | activated |
| T9297 | 12846-12851 | NN | denotes | NF-κB |
| T9298 | 12852-12860 | VB | denotes | measured |
| T9299 | 12861-12863 | IN | denotes | by |
| T9300 | 12864-12874 | NN | denotes | luciferase |
| T9301 | 12875-12881 | NN | denotes | assays |
| T9302 | 12882-12883 | -LRB- | denotes | ( |
| T9303 | 12883-12896 | NNP | denotes | Supplementary |
| T9304 | 12897-12901 | NNP | denotes | Fig. |
| T9305 | 12902-12903 | CD | denotes | 7 |
| T9306 | 12903-12904 | -RRB- | denotes | ) |
| T9307 | 12904-12905 | -COMMA- | denotes | , |
| T9308 | 12906-12909 | CC | denotes | and |
| T9309 | 12910-12914 | RB | denotes | also |
| T9310 | 12915-12922 | VB | denotes | induced |
| T9311 | 12923-12926 | DT | denotes | the |
| T9312 | 12927-12934 | JJ | denotes | nuclear |
| T9313 | 12935-12948 | NN | denotes | translocation |
| T9314 | 12949-12951 | IN | denotes | of |
| T9315 | 12952-12961 | JJ | denotes | wild-type |
| T9316 | 12961-12962 | -COMMA- | denotes | , |
| T9317 | 12963-12966 | CC | denotes | but |
| T9318 | 12967-12970 | RB | denotes | not |
| T9319 | 12971-12976 | NN | denotes | S209A |
| T9320 | 12976-12977 | -COMMA- | denotes | , |
| T9321 | 12978-12982 | NN | denotes | RPS3 |
| T9322 | 12983-12984 | -LRB- | denotes | ( |
| T9323 | 12984-12988 | NN | denotes | Fig. |
| T9324 | 12989-12991 | NN | denotes | 5b |
| T9325 | 12991-12992 | -RRB- | denotes | ) |
| T9326 | 12994-12999 | DT | denotes | These |
| T9327 | 13000-13004 | NN | denotes | data |
| T9328 | 13005-13012 | VB | denotes | suggest |
| T9329 | 13013-13017 | IN | denotes | that |
| T9330 | 13018-13022 | NN | denotes | S209 |
| T9331 | 13023-13038 | NN | denotes | phosphorylation |
| T9332 | 13039-13041 | VB | denotes | is |
| T9333 | 13042-13050 | JJ | denotes | critical |
| T9334 | 13051-13054 | IN | denotes | for |
| T9335 | 13055-13058 | DT | denotes | the |
| T9336 | 13059-13064 | NN | denotes | NF-κB |
| T9337 | 13065-13083 | JJ | denotes | activation-induced |
| T9338 | 13084-13088 | NN | denotes | RPS3 |
| T9339 | 13089-13096 | JJ | denotes | nuclear |
| T9340 | 13097-13110 | NN | denotes | translocation |
| T9341 | 13112-13114 | TO | denotes | To |
| T9342 | 13115-13122 | VB | denotes | examine |
| T9343 | 13123-13126 | DT | denotes | the |
| T9344 | 13127-13131 | NN | denotes | role |
| T9345 | 13132-13134 | IN | denotes | of |
| T9346 | 13135-13139 | NN | denotes | S209 |
| T9347 | 13140-13155 | NN | denotes | phosphorylation |
| T9348 | 13156-13158 | IN | denotes | of |
| T9349 | 13159-13163 | NN | denotes | RPS3 |
| T9350 | 13164-13166 | TO | denotes | to |
| T9351 | 13167-13170 | PRP-DOLLAR- | denotes | its |
| T9352 | 13171-13176 | NN | denotes | NF-κB |
| T9353 | 13177-13186 | NN | denotes | function6 |
| T9354 | 13186-13187 | -COMMA- | denotes | , |
| T9355 | 13188-13189 | CD | denotes | 7 |
| T9356 | 13189-13190 | -COMMA- | denotes | , |
| T9357 | 13191-13193 | CD | denotes | 30 |
| T9358 | 13193-13194 | -COMMA- | denotes | , |
| T9359 | 13195-13197 | PRP | denotes | we |
| T9360 | 13198-13206 | VB | denotes | silenced |
| T9361 | 13207-13217 | JJ | denotes | endogenous |
| T9362 | 13218-13222 | NN | denotes | RPS3 |
| T9363 | 13223-13233 | NN | denotes | expression |
| T9364 | 13234-13239 | VB | denotes | using |
| T9365 | 13240-13242 | DT | denotes | an |
| T9366 | 13243-13248 | NN | denotes | siRNA |
| T9367 | 13249-13253 | WDT | denotes | that |
| T9368 | 13254-13261 | VB | denotes | targets |
| T9369 | 13262-13265 | DT | denotes | the |
| T9370 | 13266-13268 | CD | denotes | 3′ |
| T9371 | 13269-13281 | JJ | denotes | untranslated |
| T9372 | 13282-13288 | NN | denotes | region |
| T9373 | 13289-13290 | -LRB- | denotes | ( |
| T9374 | 13290-13292 | CD | denotes | 3′ |
| T9375 | 13293-13296 | NN | denotes | UTR |
| T9376 | 13296-13297 | -RRB- | denotes | ) |
| T9377 | 13298-13300 | IN | denotes | of |
| T9378 | 13301-13305 | NN | denotes | RPS3 |
| T9379 | 13306-13310 | NN | denotes | mRNA |
| T9380 | 13310-13311 | -COMMA- | denotes | , |
| T9381 | 13312-13320 | VB | denotes | followed |
| T9382 | 13321-13323 | IN | denotes | by |
| T9383 | 13324-13339 | NN | denotes | complementation |
| T9384 | 13340-13344 | IN | denotes | with |
| T9385 | 13345-13351 | CC | denotes | either |
| T9386 | 13352-13361 | JJ | denotes | wild-type |
| T9387 | 13362-13364 | CC | denotes | or |
| T9388 | 13365-13370 | NN | denotes | S209A |
| T9389 | 13371-13377 | JJ | denotes | mutant |
| T9390 | 13378-13382 | NN | denotes | RPS3 |
| T9391 | 13383-13386 | IN | denotes | via |
| T9392 | 13387-13399 | NN | denotes | transfection |
| T9393 | 13401-13403 | IN | denotes | As |
| T9394 | 13404-13412 | VB | denotes | expected |
| T9395 | 13412-13413 | -COMMA- | denotes | , |
| T9396 | 13414-13418 | NN | denotes | RPS3 |
| T9397 | 13419-13424 | NN | denotes | siRNA |
| T9398 | 13425-13433 | RB | denotes | severely |
| T9399 | 13434-13441 | VB | denotes | reduced |
| T9400 | 13442-13452 | JJ | denotes | endogenous |
| T9401 | 13453-13457 | NN | denotes | RPS3 |
| T9402 | 13458-13467 | NN | denotes | abundance |
| T9403 | 13468-13476 | VB | denotes | compared |
| T9404 | 13477-13479 | TO | denotes | to |
| T9405 | 13480-13482 | NN | denotes | NS |
| T9406 | 13483-13488 | NN | denotes | siRNA |
| T9407 | 13488-13489 | -COMMA- | denotes | , |
| T9408 | 13490-13493 | CC | denotes | but |
| T9409 | 13494-13497 | VB | denotes | did |
| T9410 | 13498-13501 | RB | denotes | not |
| T9411 | 13502-13508 | VB | denotes | affect |
| T9412 | 13509-13512 | DT | denotes | the |
| T9413 | 13513-13519 | JJ | denotes | robust |
| T9414 | 13520-13530 | NN | denotes | expression |
| T9415 | 13531-13533 | IN | denotes | of |
| T9416 | 13534-13545 | JJ | denotes | Flag-tagged |
| T9417 | 13546-13550 | NN | denotes | RPS3 |
| T9418 | 13551-13555 | IN | denotes | from |
| T9419 | 13556-13557 | DT | denotes | a |
| T9420 | 13558-13569 | VB | denotes | transfected |
| T9421 | 13570-13579 | NN | denotes | construct |
| T9422 | 13580-13587 | VB | denotes | lacking |
| T9423 | 13588-13591 | DT | denotes | the |
| T9424 | 13592-13594 | NN | denotes | 3′ |
| T9425 | 13595-13598 | NN | denotes | UTR |
| T9426 | 13599-13600 | -LRB- | denotes | ( |
| T9427 | 13600-13604 | NN | denotes | Fig. |
| T9428 | 13605-13607 | NN | denotes | 5c |
| T9429 | 13607-13608 | -RRB- | denotes | ) |
| T9430 | 13610-13612 | PRP | denotes | We |
| T9431 | 13613-13617 | RB | denotes | also |
| T9432 | 13618-13623 | VB | denotes | found |
| T9433 | 13624-13628 | IN | denotes | that |
| T9434 | 13629-13633 | NN | denotes | RPS3 |
| T9435 | 13634-13643 | NN | denotes | knockdown |
| T9436 | 13644-13651 | VB | denotes | reduced |
| T9437 | 13652-13663 | JJ | denotes | TNF-induced |
| T9438 | 13664-13674 | NN | denotes | expression |
| T9439 | 13675-13677 | IN | denotes | of |
| T9440 | 13678-13680 | DT | denotes | an |
| T9441 | 13681-13683 | NN | denotes | Ig |
| T9442 | 13684-13693 | JJ | denotes | κB-driven |
| T9443 | 13694-13704 | NN | denotes | luciferase |
| T9444 | 13705-13715 | NN | denotes | construct6 |
| T9445 | 13716-13717 | -LRB- | denotes | ( |
| T9446 | 13717-13721 | NNP | denotes | Fig. |
| T9447 | 13722-13724 | NN | denotes | 5d |
| T9448 | 13724-13725 | -RRB- | denotes | ) |
| T9449 | 13727-13730 | DT | denotes | The |
| T9450 | 13731-13739 | JJ | denotes | impaired |
| T9451 | 13740-13750 | NN | denotes | luciferase |
| T9452 | 13751-13757 | NN | denotes | signal |
| T9453 | 13758-13764 | VB | denotes | caused |
| T9454 | 13765-13767 | IN | denotes | by |
| T9455 | 13768-13772 | NN | denotes | RPS3 |
| T9456 | 13773-13783 | NN | denotes | deficiency |
| T9457 | 13784-13787 | VB | denotes | was |
| T9458 | 13788-13798 | RB | denotes | completely |
| T9459 | 13799-13807 | VB | denotes | restored |
| T9460 | 13808-13810 | IN | denotes | by |
| T9461 | 13811-13823 | VB | denotes | transfecting |
| T9462 | 13824-13833 | JJ | denotes | wild-type |
| T9463 | 13833-13834 | -COMMA- | denotes | , |
| T9464 | 13835-13838 | CC | denotes | but |
| T9465 | 13839-13842 | RB | denotes | not |
| T9466 | 13843-13845 | IN | denotes | by |
| T9467 | 13846-13851 | NN | denotes | S209A |
| T9468 | 13852-13856 | NN | denotes | RPS3 |
| T9469 | 13857-13858 | -LRB- | denotes | ( |
| T9470 | 13858-13862 | NNP | denotes | Fig. |
| T9471 | 13863-13865 | NN | denotes | 5d |
| T9472 | 13865-13866 | -RRB- | denotes | ) |
| T9473 | 13866-13867 | -COMMA- | denotes | , |
| T9474 | 13868-13875 | IN | denotes | despite |
| T9475 | 13876-13886 | JJ | denotes | equivalent |
| T9476 | 13887-13897 | NN | denotes | expression |
| T9477 | 13898-13899 | -LRB- | denotes | ( |
| T9478 | 13899-13903 | NN | denotes | Fig. |
| T9479 | 13904-13906 | NN | denotes | 5c |
| T9480 | 13906-13907 | -RRB- | denotes | ) |
| T9481 | 13909-13917 | RB | denotes | Moreover |
| T9482 | 13917-13918 | -COMMA- | denotes | , |
| T9483 | 13919-13922 | DT | denotes | the |
| T9484 | 13923-13930 | NN | denotes | failure |
| T9485 | 13931-13933 | IN | denotes | of |
| T9486 | 13934-13939 | NN | denotes | S209A |
| T9487 | 13940-13944 | NN | denotes | RPS3 |
| T9488 | 13945-13947 | TO | denotes | to |
| T9489 | 13948-13955 | VB | denotes | restore |
| T9490 | 13956-13966 | NN | denotes | luciferase |
| T9491 | 13967-13975 | NN | denotes | activity |
| T9492 | 13976-13979 | VB | denotes | did |
| T9493 | 13980-13983 | RB | denotes | not |
| T9494 | 13984-13990 | VB | denotes | result |
| T9495 | 13991-13995 | IN | denotes | from |
| T9496 | 13996-14005 | JJ | denotes | defective |
| T9497 | 14006-14017 | NN | denotes | translation |
| T9498 | 14018-14025 | IN | denotes | because |
| T9499 | 14026-14029 | DT | denotes | the |
| T9500 | 14030-14039 | JJ | denotes | transient |
| T9501 | 14040-14054 | NN | denotes | overexpression |
| T9502 | 14055-14057 | IN | denotes | of |
| T9503 | 14058-14063 | JJ | denotes | green |
| T9504 | 14064-14075 | JJ | denotes | fluorescent |
| T9505 | 14076-14083 | NN | denotes | protein |
| T9506 | 14084-14085 | -LRB- | denotes | ( |
| T9507 | 14085-14088 | NN | denotes | GFP |
| T9508 | 14088-14089 | -RRB- | denotes | ) |
| T9509 | 14090-14093 | VB | denotes | was |
| T9510 | 14094-14104 | JJ | denotes | comparable |
| T9511 | 14105-14107 | IN | denotes | in |
| T9512 | 14108-14113 | NN | denotes | cells |
| T9513 | 14114-14126 | VB | denotes | complemented |
| T9514 | 14127-14131 | IN | denotes | with |
| T9515 | 14132-14141 | JJ | denotes | wild-type |
| T9516 | 14142-14144 | CC | denotes | or |
| T9517 | 14145-14150 | NN | denotes | S029A |
| T9518 | 14151-14155 | NN | denotes | RPS3 |
| T9519 | 14156-14157 | -LRB- | denotes | ( |
| T9520 | 14157-14170 | NNP | denotes | Supplementary |
| T9521 | 14171-14175 | NNP | denotes | Fig. |
| T9522 | 14176-14177 | CD | denotes | 8 |
| T9523 | 14177-14178 | -RRB- | denotes | ) |
| T9524 | 14180-14185 | VB | denotes | Taken |
| T9525 | 14186-14194 | RB | denotes | together |
| T9526 | 14194-14195 | -COMMA- | denotes | , |
| T9527 | 14196-14201 | DT | denotes | these |
| T9528 | 14202-14206 | NN | denotes | data |
| T9529 | 14207-14214 | VB | denotes | suggest |
| T9530 | 14215-14219 | IN | denotes | that |
| T9531 | 14220-14224 | NN | denotes | RPS3 |
| T9532 | 14225-14229 | NN | denotes | S209 |
| T9533 | 14230-14245 | NN | denotes | phosphorylation |
| T9534 | 14246-14248 | VB | denotes | is |
| T9535 | 14249-14257 | JJ | denotes | critical |
| T9536 | 14258-14261 | IN | denotes | for |
| T9537 | 14262-14267 | NN | denotes | NF-κB |
| T9538 | 14268-14276 | NN | denotes | activity |
| T9539 | 14277-14286 | VB | denotes | involving |
| T9540 | 14287-14290 | DT | denotes | the |
| T9541 | 14291-14300 | JJ | denotes | canonical |
| T9542 | 14301-14303 | NN | denotes | Ig |
| T9543 | 14304-14306 | NN | denotes | κB |
| T9544 | 14307-14311 | NN | denotes | site |
| T9545 | 14313-14315 | PRP | denotes | We |
| T9546 | 14316-14320 | RB | denotes | next |
| T9547 | 14321-14325 | VB | denotes | used |
| T9548 | 14326-14335 | NN | denotes | chromatin |
| T9549 | 14336-14355 | NN | denotes | immunoprecipitation |
| T9550 | 14356-14358 | TO | denotes | to |
| T9551 | 14359-14368 | VB | denotes | determine |
| T9552 | 14369-14376 | IN | denotes | whether |
| T9553 | 14377-14381 | NN | denotes | S209 |
| T9554 | 14382-14397 | NN | denotes | phosphorylation |
| T9555 | 14398-14405 | VB | denotes | affects |
| T9556 | 14406-14410 | NN | denotes | RPS3 |
| T9557 | 14411-14414 | CC | denotes | and |
| T9558 | 14415-14418 | NN | denotes | p65 |
| T9559 | 14419-14430 | NN | denotes | recruitment |
| T9560 | 14431-14433 | TO | denotes | to |
| T9561 | 14434-14442 | JJ | denotes | specific |
| T9562 | 14443-14445 | NN | denotes | κB |
| T9563 | 14446-14451 | NN | denotes | sites |
| T9564 | 14452-14454 | IN | denotes | in |
| T9565 | 14455-14461 | JJ | denotes | intact |
| T9566 | 14462-14471 | NN | denotes | chromatin |
| T9567 | 14472-14478 | IN | denotes | during |
| T9568 | 14479-14484 | NN | denotes | NF-κB |
| T9569 | 14485-14495 | NN | denotes | activation |
| T9570 | 14497-14499 | IN | denotes | In |
| T9571 | 14500-14504 | NN | denotes | RPS3 |
| T9572 | 14505-14514 | NN | denotes | knockdown |
| T9573 | 14515-14520 | NN | denotes | cells |
| T9574 | 14520-14521 | -COMMA- | denotes | , |
| T9575 | 14522-14527 | NN | denotes | PMA+I |
| T9576 | 14528-14538 | VB | denotes | stimulated |
| T9577 | 14539-14542 | DT | denotes | the |
| T9578 | 14543-14554 | NN | denotes | recruitment |
| T9579 | 14555-14557 | IN | denotes | of |
| T9580 | 14558-14569 | RB | denotes | ectopically |
| T9581 | 14570-14579 | VB | denotes | expressed |
| T9582 | 14579-14580 | -COMMA- | denotes | , |
| T9583 | 14581-14592 | JJ | denotes | Flag-tagged |
| T9584 | 14593-14602 | JJ | denotes | wild-type |
| T9585 | 14602-14603 | -COMMA- | denotes | , |
| T9586 | 14604-14607 | CC | denotes | but |
| T9587 | 14608-14611 | RB | denotes | not |
| T9588 | 14612-14617 | NN | denotes | S209A |
| T9589 | 14618-14622 | NN | denotes | RPS3 |
| T9590 | 14623-14625 | TO | denotes | to |
| T9591 | 14626-14629 | DT | denotes | the |
| T9592 | 14630-14632 | NN | denotes | κB |
| T9593 | 14633-14638 | NN | denotes | sites |
| T9594 | 14639-14641 | IN | denotes | of |
| T9595 | 14642-14645 | DT | denotes | the |
| T9596 | 14646-14652 | NN | denotes | NFKBIA |
| T9597 | 14653-14656 | CC | denotes | and |
| T9598 | 14657-14660 | NN | denotes | IL8 |
| T9599 | 14661-14670 | NN | denotes | promoters |
| T9600 | 14671-14672 | -LRB- | denotes | ( |
| T9601 | 14672-14676 | NNP | denotes | Fig. |
| T9602 | 14677-14679 | NN | denotes | 5e |
| T9603 | 14679-14680 | -RRB- | denotes | ) |
| T9604 | 14682-14687 | IN | denotes | While |
| T9605 | 14688-14698 | VB | denotes | expressing |
| T9606 | 14699-14703 | NN | denotes | RPS3 |
| T9607 | 14704-14709 | NN | denotes | S209A |
| T9608 | 14710-14713 | VB | denotes | had |
| T9609 | 14714-14716 | DT | denotes | no |
| T9610 | 14717-14723 | NN | denotes | impact |
| T9611 | 14724-14726 | IN | denotes | on |
| T9612 | 14727-14730 | NN | denotes | p65 |
| T9613 | 14731-14738 | JJ | denotes | nuclear |
| T9614 | 14739-14752 | NN | denotes | translocation |
| T9615 | 14752-14753 | -COMMA- | denotes | , |
| T9616 | 14754-14756 | PRP | denotes | it |
| T9617 | 14757-14770 | RB | denotes | substantially |
| T9618 | 14771-14781 | VB | denotes | attenuated |
| T9619 | 14782-14785 | NN | denotes | p65 |
| T9620 | 14786-14797 | NN | denotes | recruitment |
| T9621 | 14798-14799 | -LRB- | denotes | ( |
| T9622 | 14799-14803 | NN | denotes | Fig. |
| T9623 | 14804-14806 | NN | denotes | 5e |
| T9624 | 14806-14807 | -RRB- | denotes | ) |
| T9625 | 14809-14819 | JJ | denotes | Additional |
| T9626 | 14820-14831 | NN | denotes | experiments |
| T9627 | 14832-14840 | VB | denotes | revealed |
| T9628 | 14841-14845 | IN | denotes | that |
| T9629 | 14846-14849 | NN | denotes | p65 |
| T9630 | 14850-14860 | NN | denotes | attraction |
| T9631 | 14861-14863 | TO | denotes | to |
| T9632 | 14864-14880 | JJ | denotes | RPS3-independent |
| T9633 | 14881-14886 | NN | denotes | NF-κB |
| T9634 | 14887-14893 | NN | denotes | target |
| T9635 | 14894-14898 | NN | denotes | gene |
| T9636 | 14899-14908 | NN | denotes | promoters |
| T9637 | 14909-14913 | JJ | denotes | such |
| T9638 | 14914-14916 | IN | denotes | as |
| T9639 | 14917-14921 | NN | denotes | CD25 |
| T9640 | 14922-14925 | VB | denotes | was |
| T9641 | 14926-14935 | VB | denotes | increased |
| T9642 | 14936-14937 | -LRB- | denotes | ( |
| T9643 | 14937-14950 | NNP | denotes | Supplementary |
| T9644 | 14951-14955 | NNP | denotes | Fig. |
| T9645 | 14956-14957 | CD | denotes | 9 |
| T9646 | 14957-14958 | -RRB- | denotes | ) |
| T9647 | 14958-14959 | -COMMA- | denotes | , |
| T9648 | 14960-14970 | JJ | denotes | consistent |
| T9649 | 14971-14975 | IN | denotes | with |
| T9650 | 14976-14979 | PRP-DOLLAR- | denotes | our |
| T9651 | 14980-14988 | JJ | denotes | previous |
| T9652 | 14989-15002 | NN | denotes | observations6 |
| T9653 | 15004-15009 | EX | denotes | There |
| T9654 | 15010-15013 | VB | denotes | was |
| T9655 | 15014-15016 | DT | denotes | no |
| T9656 | 15017-15028 | JJ | denotes | significant |
| T9657 | 15029-15038 | NN | denotes | Flag-RPS3 |
| T9658 | 15039-15041 | CC | denotes | or |
| T9659 | 15042-15045 | NN | denotes | p65 |
| T9660 | 15046-15057 | NN | denotes | recruitment |
| T9661 | 15058-15060 | TO | denotes | to |
| T9662 | 15061-15065 | NN | denotes | ACTB |
| T9663 | 15066-15074 | NN | denotes | promoter |
| T9664 | 15075-15082 | VB | denotes | lacking |
| T9665 | 15083-15085 | NN | denotes | κB |
| T9666 | 15086-15091 | NN | denotes | sites |
| T9667 | 15092-15093 | -LRB- | denotes | ( |
| T9668 | 15093-15097 | NNP | denotes | Fig. |
| T9669 | 15098-15100 | NN | denotes | 5e |
| T9670 | 15100-15101 | -RRB- | denotes | ) |
| T9671 | 15101-15102 | -COMMA- | denotes | , |
| T9672 | 15103-15113 | VB | denotes | suggesting |
| T9673 | 15114-15117 | DT | denotes | the |
| T9674 | 15118-15129 | NN | denotes | recruitment |
| T9675 | 15130-15133 | VB | denotes | was |
| T9676 | 15134-15136 | NN | denotes | κB |
| T9677 | 15137-15150 | JJ | denotes | site-specific |
| T9678 | 15152-15156 | RB | denotes | Thus |
| T9679 | 15156-15157 | -COMMA- | denotes | , |
| T9680 | 15158-15161 | DT | denotes | the |
| T9681 | 15162-15173 | NN | denotes | recruitment |
| T9682 | 15174-15176 | IN | denotes | of |
| T9683 | 15177-15181 | NN | denotes | RPS3 |
| T9684 | 15182-15184 | RB | denotes | as |
| T9685 | 15185-15189 | RB | denotes | well |
| T9686 | 15190-15192 | IN | denotes | as |
| T9687 | 15193-15196 | DT | denotes | the |
| T9688 | 15197-15207 | JJ | denotes | contingent |
| T9689 | 15208-15219 | NN | denotes | recruitment |
| T9690 | 15220-15222 | IN | denotes | of |
| T9691 | 15223-15226 | NN | denotes | p65 |
| T9692 | 15227-15229 | TO | denotes | to |
| T9693 | 15230-15233 | JJ | denotes | key |
| T9694 | 15234-15243 | NN | denotes | promoters |
| T9695 | 15244-15252 | VB | denotes | depended |
| T9696 | 15253-15255 | IN | denotes | on |
| T9697 | 15256-15260 | NN | denotes | S209 |
| T9698 | 15262-15273 | NN | denotes | Interleukin |
| T9699 | 15274-15275 | CD | denotes | 8 |
| T9700 | 15276-15277 | -LRB- | denotes | ( |
| T9701 | 15277-15281 | NN | denotes | IL-8 |
| T9702 | 15281-15282 | -RRB- | denotes | ) |
| T9703 | 15283-15292 | NN | denotes | secretion |
| T9704 | 15293-15300 | VB | denotes | induced |
| T9705 | 15301-15303 | IN | denotes | by |
| T9706 | 15304-15310 | CC | denotes | either |
| T9707 | 15311-15312 | NN | denotes | T |
| T9708 | 15313-15317 | NN | denotes | cell |
| T9709 | 15318-15326 | NN | denotes | receptor |
| T9710 | 15327-15328 | -LRB- | denotes | ( |
| T9711 | 15328-15331 | NN | denotes | TCR |
| T9712 | 15331-15332 | -RRB- | denotes | ) |
| T9713 | 15333-15340 | NN | denotes | agonist |
| T9714 | 15341-15352 | NN | denotes | stimulation |
| T9715 | 15353-15355 | CC | denotes | or |
| T9716 | 15356-15361 | NN | denotes | PMA+I |
| T9717 | 15362-15365 | VB | denotes | was |
| T9718 | 15366-15375 | VB | denotes | decreased |
| T9719 | 15376-15378 | IN | denotes | as |
| T9720 | 15379-15380 | DT | denotes | a |
| T9721 | 15381-15392 | NN | denotes | consequence |
| T9722 | 15393-15395 | IN | denotes | of |
| T9723 | 15396-15403 | VB | denotes | reduced |
| T9724 | 15404-15412 | NN | denotes | RPS3/p65 |
| T9725 | 15413-15424 | NN | denotes | recruitment |
| T9726 | 15425-15427 | TO | denotes | to |
| T9727 | 15428-15431 | DT | denotes | the |
| T9728 | 15432-15435 | NN | denotes | IL8 |
| T9729 | 15436-15438 | NN | denotes | κB |
| T9730 | 15439-15444 | NN | denotes | sites |
| T9731 | 15445-15447 | IN | denotes | in |
| T9732 | 15448-15451 | DT | denotes | the |
| T9733 | 15452-15460 | NN | denotes | presence |
| T9734 | 15461-15463 | IN | denotes | of |
| T9735 | 15464-15469 | NN | denotes | S209A |
| T9736 | 15470-15476 | NN | denotes | mutant |
| T9737 | 15477-15485 | VB | denotes | compared |
| T9738 | 15486-15488 | TO | denotes | to |
| T9739 | 15489-15498 | JJ | denotes | wild-type |
| T9740 | 15499-15503 | NN | denotes | RPS3 |
| T9741 | 15504-15505 | -LRB- | denotes | ( |
| T9742 | 15505-15518 | NNP | denotes | Supplementary |
| T9743 | 15519-15523 | NNP | denotes | Fig. |
| T9744 | 15524-15526 | CD | denotes | 10 |
| T9745 | 15526-15527 | -RRB- | denotes | ) |
| T9746 | 15529-15536 | RB | denotes | However |
| T9747 | 15536-15537 | -COMMA- | denotes | , |
| T9748 | 15538-15542 | NN | denotes | cell |
| T9749 | 15543-15550 | NN | denotes | surface |
| T9750 | 15551-15555 | NN | denotes | CD25 |
| T9751 | 15556-15566 | NN | denotes | expression |
| T9752 | 15567-15570 | VB | denotes | was |
| T9753 | 15571-15581 | JJ | denotes | comparable |
| T9754 | 15582-15589 | IN | denotes | between |
| T9755 | 15590-15593 | DT | denotes | the |
| T9756 | 15594-15603 | JJ | denotes | wild-type |
| T9757 | 15604-15607 | CC | denotes | and |
| T9758 | 15608-15613 | NN | denotes | S209A |
| T9759 | 15614-15618 | NN | denotes | RPS3 |
| T9760 | 15619-15630 | VB | denotes | transfected |
| T9761 | 15631-15636 | NN | denotes | cells |
| T9762 | 15637-15638 | -LRB- | denotes | ( |
| T9763 | 15638-15651 | JJ | denotes | Supplementary |
| T9764 | 15652-15656 | NNP | denotes | Fig. |
| T9765 | 15657-15659 | CD | denotes | 11 |
| T9766 | 15659-15660 | -RRB- | denotes | ) |
| T9767 | 15662-15671 | RB | denotes | Therefore |
| T9768 | 15671-15672 | -COMMA- | denotes | , |
| T9769 | 15673-15677 | NN | denotes | RPS3 |
| T9770 | 15678-15682 | NN | denotes | S209 |
| T9771 | 15683-15698 | NN | denotes | phosphorylation |
| T9772 | 15699-15701 | IN | denotes | by |
| T9773 | 15702-15706 | NN | denotes | IKKβ |
| T9774 | 15707-15709 | VB | denotes | is |
| T9775 | 15710-15720 | RB | denotes | apparently |
| T9776 | 15721-15729 | VB | denotes | required |
| T9777 | 15730-15733 | IN | denotes | for |
| T9778 | 15734-15738 | NN | denotes | RPS3 |
| T9779 | 15739-15741 | IN | denotes | in |
| T9780 | 15742-15751 | VB | denotes | directing |
| T9781 | 15752-15757 | NN | denotes | NF-κB |
| T9782 | 15758-15760 | TO | denotes | to |
| T9783 | 15761-15762 | DT | denotes | a |
| T9784 | 15763-15771 | JJ | denotes | specific |
| T9785 | 15772-15778 | NN | denotes | subset |
| T9786 | 15779-15781 | IN | denotes | of |
| T9787 | 15782-15788 | NN | denotes | target |
| T9788 | 15789-15794 | NN | denotes | genes |
| T11955 | 15797-15802 | NN | denotes | NleH1 |
| T11956 | 15803-15811 | VB | denotes | inhibits |
| T11957 | 15812-15816 | NN | denotes | RPS3 |
| T11958 | 15817-15832 | NN | denotes | phosphorylation |
| T11959 | 15833-15835 | FW | denotes | in |
| T11960 | 15836-15841 | FW | denotes | vitro |
| T11961 | 15842-15846 | NN | denotes | EHEC |
| T11962 | 15847-15856 | NN | denotes | pathogens |
| T11963 | 15857-15860 | VB | denotes | are |
| T11964 | 15861-15870 | JJ | denotes | important |
| T11965 | 15871-15880 | JJ | denotes | causative |
| T11966 | 15881-15887 | NN | denotes | agents |
| T11967 | 15888-15890 | IN | denotes | of |
| T11968 | 15891-15895 | CC | denotes | both |
| T11969 | 15896-15905 | JJ | denotes | foodborne |
| T11970 | 15906-15913 | NN | denotes | disease |
| T11971 | 15914-15917 | CC | denotes | and |
| T11972 | 15918-15927 | JJ | denotes | pediatric |
| T11973 | 15928-15933 | JJ | denotes | renal |
| T11974 | 15934-15943 | NN | denotes | failure31 |
| T11975 | 15945-15949 | NN | denotes | EHEC |
| T11976 | 15950-15957 | VB | denotes | utilize |
| T11977 | 15958-15962 | NN | denotes | T3SS |
| T11978 | 15963-15965 | TO | denotes | to |
| T11979 | 15966-15972 | VB | denotes | inject |
| T11980 | 15973-15981 | NN | denotes | effector |
| T11981 | 15982-15990 | NN | denotes | proteins |
| T11982 | 15991-15999 | RB | denotes | directly |
| T11983 | 16000-16004 | IN | denotes | into |
| T11984 | 16005-16015 | JJ | denotes | intestinal |
| T11985 | 16016-16026 | JJ | denotes | epithelial |
| T11986 | 16027-16034 | NN | denotes | cells32 |
| T11987 | 16034-16035 | -COMMA- | denotes | , |
| T11988 | 16036-16037 | DT | denotes | a |
| T11989 | 16038-16044 | NN | denotes | subset |
| T11990 | 16045-16047 | IN | denotes | of |
| T11991 | 16048-16053 | WDT | denotes | which |
| T11992 | 16054-16061 | VB | denotes | inhibit |
| T11993 | 16062-16077 | JJ | denotes | NF-κB-dependent |
| T11994 | 16078-16084 | JJ | denotes | innate |
| T11995 | 16085-16095 | NN | denotes | responses9 |
| T11996 | 16095-16096 | -COMMA- | denotes | , |
| T11997 | 16097-16102 | CD | denotes | 33-38 |
| T11998 | 16104-16107 | DT | denotes | The |
| T11999 | 16108-16110 | FW | denotes | E. |
| T12000 | 16111-16115 | FW | denotes | coli |
| T12001 | 16116-16120 | NN | denotes | O157 |
| T12002 | 16120-16121 | -COLON- | denotes | : |
| T12003 | 16121-16123 | NN | denotes | H7 |
| T12004 | 16124-16130 | NN | denotes | EDL933 |
| T12005 | 16131-16139 | NN | denotes | effector |
| T12006 | 16140-16147 | NN | denotes | protein |
| T12007 | 16148-16153 | NN | denotes | NleH1 |
| T12008 | 16154-16159 | VB | denotes | binds |
| T12009 | 16160-16162 | TO | denotes | to |
| T12010 | 16163-16166 | CC | denotes | and |
| T12011 | 16167-16177 | VB | denotes | attenuates |
| T12012 | 16178-16182 | NN | denotes | RPS3 |
| T12013 | 16183-16190 | JJ | denotes | nuclear |
| T12014 | 16191-16204 | NN | denotes | translocation |
| T12015 | 16204-16205 | -COMMA- | denotes | , |
| T12016 | 16206-16210 | RB | denotes | thus |
| T12017 | 16211-16220 | VB | denotes | impairing |
| T12018 | 16221-16235 | JJ | denotes | RPS3-dependent |
| T12019 | 16236-16241 | NN | denotes | NF-κB |
| T12020 | 16242-16252 | NN | denotes | signaling9 |
| T12021 | 16254-16256 | PRP | denotes | We |
| T12022 | 16257-16266 | RB | denotes | therefore |
| T12023 | 16267-16279 | VB | denotes | hypothesized |
| T12024 | 16280-16284 | IN | denotes | that |
| T12025 | 16285-16290 | NN | denotes | NleH1 |
| T12026 | 16291-16294 | MD | denotes | may |
| T12027 | 16295-16303 | VB | denotes | function |
| T12028 | 16304-16306 | IN | denotes | by |
| T12029 | 16307-16317 | VB | denotes | inhibiting |
| T12030 | 16318-16322 | NN | denotes | RPS3 |
| T12031 | 16323-16327 | NN | denotes | S209 |
| T12032 | 16328-16343 | NN | denotes | phosphorylation |
| T12033 | 16345-16347 | IN | denotes | As |
| T12034 | 16348-16356 | VB | denotes | expected |
| T12035 | 16356-16357 | -COMMA- | denotes | , |
| T12036 | 16358-16370 | VB | denotes | transfecting |
| T12037 | 16371-16381 | VB | denotes | increasing |
| T12038 | 16382-16389 | NN | denotes | amounts |
| T12039 | 16390-16392 | IN | denotes | of |
| T12040 | 16393-16401 | NN | denotes | NleH1-HA |
| T12041 | 16402-16409 | NN | denotes | plasmid |
| T12042 | 16410-16417 | VB | denotes | blocked |
| T12043 | 16418-16430 | JJ | denotes | TNFα-induced |
| T12044 | 16431-16436 | NN | denotes | NF-κB |
| T12045 | 16437-16447 | NN | denotes | activation |
| T12046 | 16448-16450 | IN | denotes | in |
| T12047 | 16451-16452 | DT | denotes | a |
| T12048 | 16453-16467 | JJ | denotes | dose-dependent |
| T12049 | 16468-16474 | NN | denotes | manner |
| T12050 | 16475-16476 | -LRB- | denotes | ( |
| T12051 | 16476-16480 | NNP | denotes | Fig. |
| T12052 | 16481-16485 | CD | denotes | 6a-b |
| T12053 | 16485-16486 | -RRB- | denotes | ) |
| T12054 | 16486-16487 | CD | denotes | 9 |
| T12055 | 16489-16499 | RB | denotes | Remarkably |
| T12056 | 16499-16500 | -COMMA- | denotes | , |
| T12057 | 16501-16506 | NN | denotes | NleH1 |
| T12058 | 16507-16514 | VB | denotes | reduced |
| T12059 | 16515-16519 | CC | denotes | both |
| T12060 | 16520-16531 | JJ | denotes | TNF-induced |
| T12061 | 16531-16532 | -COMMA- | denotes | , |
| T12062 | 16533-16535 | RB | denotes | as |
| T12063 | 16536-16540 | RB | denotes | well |
| T12064 | 16541-16543 | IN | denotes | as |
| T12065 | 16544-16549 | JJ | denotes | basal |
| T12066 | 16550-16554 | NN | denotes | RPS3 |
| T12067 | 16555-16570 | NN | denotes | phosphorylation |
| T12068 | 16571-16573 | TO | denotes | to |
| T12069 | 16574-16581 | RB | denotes | roughly |
| T12070 | 16582-16584 | CD | denotes | 20 |
| T12071 | 16584-16585 | NN | denotes | % |
| T12072 | 16586-16588 | IN | denotes | of |
| T12073 | 16589-16596 | NN | denotes | vehicle |
| T12074 | 16597-16604 | NN | denotes | control |
| T12075 | 16605-16606 | -LRB- | denotes | ( |
| T12076 | 16606-16610 | NNP | denotes | Fig. |
| T12077 | 16611-16613 | NN | denotes | 6c |
| T12078 | 16613-16614 | -RRB- | denotes | ) |
| T12079 | 16616-16626 | VB | denotes | Expressing |
| T12080 | 16627-16632 | NN | denotes | NleH1 |
| T12081 | 16633-16637 | VB | denotes | does |
| T12082 | 16638-16641 | RB | denotes | not |
| T12083 | 16642-16651 | VB | denotes | interfere |
| T12084 | 16652-16656 | IN | denotes | with |
| T12085 | 16657-16663 | CC | denotes | either |
| T12086 | 16664-16675 | JJ | denotes | TNF-induced |
| T12087 | 16676-16679 | NN | denotes | IKK |
| T12088 | 16680-16690 | NN | denotes | activation |
| T12089 | 16691-16693 | CC | denotes | or |
| T12090 | 16694-16698 | NN | denotes | IκBα |
| T12091 | 16699-16710 | NN | denotes | degradation |
| T12092 | 16710-16711 | -COMMA- | denotes | , |
| T12093 | 16712-16722 | JJ | denotes | consistent |
| T12094 | 16723-16727 | IN | denotes | with |
| T12095 | 16728-16731 | DT | denotes | the |
| T12096 | 16732-16736 | NN | denotes | lack |
| T12097 | 16737-16739 | IN | denotes | of |
| T12098 | 16740-16745 | NN | denotes | NleH1 |
| T12099 | 16746-16752 | NN | denotes | impact |
| T12100 | 16753-16755 | IN | denotes | on |
| T12101 | 16756-16759 | NN | denotes | p65 |
| T12102 | 16760-16767 | JJ | denotes | nuclear |
| T12103 | 16768-16782 | NN | denotes | translocation9 |
| T12104 | 16783-16784 | -LRB- | denotes | ( |
| T12105 | 16784-16788 | NN | denotes | Fig. |
| T12106 | 16789-16791 | NN | denotes | 6c |
| T12107 | 16791-16792 | -RRB- | denotes | ) |
| T12108 | 16794-16796 | TO | denotes | To |
| T12109 | 16797-16806 | VB | denotes | determine |
| T12110 | 16807-16809 | IN | denotes | if |
| T12111 | 16810-16815 | NN | denotes | NleH1 |
| T12112 | 16816-16824 | VB | denotes | inhibits |
| T12113 | 16825-16829 | NN | denotes | RPS3 |
| T12114 | 16830-16845 | NN | denotes | phosphorylation |
| T12115 | 16845-16846 | -COMMA- | denotes | , |
| T12116 | 16847-16849 | PRP | denotes | we |
| T12117 | 16850-16858 | VB | denotes | infected |
| T12118 | 16859-16863 | NN | denotes | HeLa |
| T12119 | 16864-16869 | NN | denotes | cells |
| T12120 | 16870-16874 | IN | denotes | with |
| T12121 | 16875-16877 | FW | denotes | E. |
| T12122 | 16878-16882 | FW | denotes | coli |
| T12123 | 16883-16887 | NN | denotes | O157 |
| T12124 | 16887-16888 | -COLON- | denotes | : |
| T12125 | 16888-16890 | NN | denotes | H7 |
| T12126 | 16891-16898 | NN | denotes | strains |
| T12127 | 16899-16909 | VB | denotes | possessing |
| T12128 | 16910-16912 | CC | denotes | or |
| T12129 | 16913-16920 | VB | denotes | lacking |
| T12130 | 16921-16927 | CC | denotes | either |
| T12131 | 16928-16933 | NN | denotes | nleH1 |
| T12132 | 16934-16935 | -LRB- | denotes | ( |
| T12133 | 16935-16941 | NN | denotes | ΔnleH1 |
| T12134 | 16941-16942 | -RRB- | denotes | ) |
| T12135 | 16943-16945 | CC | denotes | or |
| T12136 | 16946-16950 | IN | denotes | with |
| T12137 | 16951-16952 | DT | denotes | a |
| T12138 | 16953-16959 | NN | denotes | strain |
| T12139 | 16960-16967 | VB | denotes | lacking |
| T12140 | 16968-16969 | DT | denotes | a |
| T12141 | 16970-16980 | JJ | denotes | functional |
| T12142 | 16981-16985 | NN | denotes | T3SS |
| T12143 | 16986-16992 | JJ | denotes | unable |
| T12144 | 16993-16995 | TO | denotes | to |
| T12145 | 16996-17002 | VB | denotes | inject |
| T12146 | 17003-17008 | NN | denotes | NleH1 |
| T12147 | 17009-17013 | IN | denotes | into |
| T12148 | 17014-17023 | JJ | denotes | mammalian |
| T12149 | 17024-17029 | NN | denotes | cells |
| T12150 | 17030-17031 | -LRB- | denotes | ( |
| T12151 | 17031-17036 | NN | denotes | ΔescN |
| T12152 | 17036-17037 | -RRB- | denotes | ) |
| T12153 | 17039-17041 | IN | denotes | In |
| T12154 | 17042-17052 | JJ | denotes | uninfected |
| T12155 | 17053-17058 | NN | denotes | cells |
| T12156 | 17058-17059 | -COMMA- | denotes | , |
| T12157 | 17060-17073 | NN | denotes | TNF-treatment |
| T12158 | 17074-17084 | VB | denotes | stimulated |
| T12159 | 17085-17086 | DT | denotes | a |
| T12160 | 17087-17094 | JJ | denotes | ∼7-fold |
| T12161 | 17095-17103 | NN | denotes | increase |
| T12162 | 17104-17106 | IN | denotes | in |
| T12163 | 17107-17111 | NN | denotes | RPS3 |
| T12164 | 17112-17116 | NN | denotes | S209 |
| T12165 | 17117-17132 | NN | denotes | phosphorylation |
| T12166 | 17132-17133 | -COMMA- | denotes | , |
| T12167 | 17134-17141 | VB | denotes | peaking |
| T12168 | 17142-17144 | IN | denotes | at |
| T12169 | 17145-17147 | CD | denotes | 30 |
| T12170 | 17148-17155 | NN | denotes | minutes |
| T12171 | 17156-17157 | -LRB- | denotes | ( |
| T12172 | 17157-17161 | NNP | denotes | Fig. |
| T12173 | 17162-17164 | CD | denotes | 6d |
| T12174 | 17164-17165 | -RRB- | denotes | ) |
| T12175 | 17167-17169 | IN | denotes | By |
| T12176 | 17170-17178 | NN | denotes | contrast |
| T12177 | 17178-17179 | -COMMA- | denotes | , |
| T12178 | 17180-17184 | NN | denotes | RPS3 |
| T12179 | 17185-17189 | NN | denotes | S209 |
| T12180 | 17190-17205 | NN | denotes | phosphorylation |
| T12181 | 17206-17209 | VB | denotes | was |
| T12182 | 17210-17223 | RB | denotes | substantially |
| T12183 | 17224-17232 | JJ | denotes | impaired |
| T12184 | 17233-17235 | IN | denotes | in |
| T12185 | 17236-17241 | NN | denotes | cells |
| T12186 | 17242-17250 | VB | denotes | infected |
| T12187 | 17251-17255 | IN | denotes | with |
| T12188 | 17256-17265 | JJ | denotes | wild-type |
| T12189 | 17266-17268 | FW | denotes | E. |
| T12190 | 17269-17273 | FW | denotes | coli |
| T12191 | 17274-17278 | NN | denotes | O157 |
| T12192 | 17278-17279 | -COLON- | denotes | : |
| T12193 | 17279-17281 | NN | denotes | H7 |
| T12194 | 17282-17283 | -LRB- | denotes | ( |
| T12195 | 17283-17287 | NNP | denotes | Fig. |
| T12196 | 17288-17290 | CD | denotes | 6d |
| T12197 | 17290-17291 | -RRB- | denotes | ) |
| T12198 | 17293-17300 | RB | denotes | However |
| T12199 | 17300-17301 | -COMMA- | denotes | , |
| T12200 | 17302-17313 | JJ | denotes | TNF-induced |
| T12201 | 17314-17318 | NN | denotes | RPS3 |
| T12202 | 17319-17323 | NN | denotes | S209 |
| T12203 | 17324-17339 | NN | denotes | phosphorylation |
| T12204 | 17340-17343 | VB | denotes | was |
| T12205 | 17344-17354 | JJ | denotes | unimpaired |
| T12206 | 17355-17357 | IN | denotes | in |
| T12207 | 17358-17363 | NN | denotes | cells |
| T12208 | 17364-17372 | VB | denotes | infected |
| T12209 | 17373-17377 | IN | denotes | with |
| T12210 | 17378-17384 | CC | denotes | either |
| T12211 | 17385-17391 | NN | denotes | ΔnleH1 |
| T12212 | 17392-17394 | CC | denotes | or |
| T12213 | 17395-17400 | NN | denotes | ΔescN |
| T12214 | 17401-17402 | -LRB- | denotes | ( |
| T12215 | 17402-17406 | NNP | denotes | Fig. |
| T12216 | 17407-17409 | CD | denotes | 6d |
| T12217 | 17409-17410 | -RRB- | denotes | ) |
| T12218 | 17412-17414 | PRP | denotes | We |
| T12219 | 17415-17421 | VB | denotes | showed |
| T12220 | 17422-17432 | RB | denotes | previously |
| T12221 | 17433-17437 | IN | denotes | that |
| T12222 | 17438-17447 | JJ | denotes | wild-type |
| T12223 | 17447-17448 | -COMMA- | denotes | , |
| T12224 | 17449-17452 | CC | denotes | but |
| T12225 | 17453-17456 | RB | denotes | not |
| T12226 | 17457-17463 | NN | denotes | ΔnleH1 |
| T12227 | 17464-17466 | CC | denotes | or |
| T12228 | 17467-17472 | FW | denotes | ΔescN |
| T12229 | 17473-17475 | FW | denotes | E. |
| T12230 | 17476-17480 | FW | denotes | coli |
| T12231 | 17481-17485 | NN | denotes | O157 |
| T12232 | 17485-17486 | -COLON- | denotes | : |
| T12233 | 17486-17488 | NN | denotes | H7 |
| T12234 | 17489-17502 | RB | denotes | significantly |
| T12235 | 17503-17513 | VB | denotes | attenuated |
| T12236 | 17514-17525 | JJ | denotes | TNF-induced |
| T12237 | 17526-17530 | NN | denotes | RPS3 |
| T12238 | 17531-17538 | JJ | denotes | nuclear |
| T12239 | 17539-17553 | NN | denotes | translocation9 |
| T12240 | 17555-17558 | DT | denotes | The |
| T12241 | 17559-17567 | NN | denotes | parallel |
| T12242 | 17568-17575 | IN | denotes | between |
| T12243 | 17576-17580 | NN | denotes | RPS3 |
| T12244 | 17581-17596 | NN | denotes | phosphorylation |
| T12245 | 17597-17600 | CC | denotes | and |
| T12246 | 17601-17604 | PRP-DOLLAR- | denotes | its |
| T12247 | 17605-17612 | JJ | denotes | nuclear |
| T12248 | 17613-17626 | NN | denotes | translocation |
| T12249 | 17627-17633 | IN | denotes | during |
| T12250 | 17634-17636 | FW | denotes | E. |
| T12251 | 17637-17641 | FW | denotes | coli |
| T12252 | 17642-17651 | NN | denotes | infection |
| T12253 | 17652-17660 | VB | denotes | provides |
| T12254 | 17661-17669 | NN | denotes | evidence |
| T12255 | 17670-17672 | IN | denotes | in |
| T12256 | 17673-17676 | DT | denotes | the |
| T12257 | 17677-17684 | NN | denotes | context |
| T12258 | 17685-17687 | IN | denotes | of |
| T12259 | 17688-17690 | DT | denotes | an |
| T12260 | 17691-17706 | JJ | denotes | NF-κB-dependent |
| T12261 | 17707-17714 | NN | denotes | disease |
| T12262 | 17715-17722 | NN | denotes | process |
| T12263 | 17723-17727 | IN | denotes | that |
| T12264 | 17728-17732 | NN | denotes | RPS3 |
| T12265 | 17733-17737 | NN | denotes | S209 |
| T12266 | 17738-17753 | NN | denotes | phosphorylation |
| T12267 | 17754-17756 | VB | denotes | is |
| T12268 | 17757-17766 | JJ | denotes | important |
| T12269 | 17767-17770 | IN | denotes | for |
| T12270 | 17771-17778 | JJ | denotes | nuclear |
| T12271 | 17779-17792 | NN | denotes | translocation |
| T12272 | 17794-17797 | PRP-DOLLAR- | denotes | Our |
| T12273 | 17798-17807 | NN | denotes | discovery |
| T12274 | 17808-17812 | IN | denotes | that |
| T12275 | 17813-17818 | NN | denotes | NleH1 |
| T12276 | 17819-17827 | VB | denotes | inhibits |
| T12277 | 17828-17832 | NN | denotes | RPS3 |
| T12278 | 17833-17837 | NN | denotes | S209 |
| T12279 | 17838-17853 | NN | denotes | phosphorylation |
| T12280 | 17854-17863 | VB | denotes | suggested |
| T12281 | 17864-17868 | IN | denotes | that |
| T12282 | 17869-17871 | PRP | denotes | it |
| T12283 | 17872-17878 | MD | denotes | should |
| T12284 | 17879-17883 | RB | denotes | also |
| T12285 | 17884-17890 | VB | denotes | blocks |
| T12286 | 17891-17905 | JJ | denotes | RPS3-dependent |
| T12287 | 17906-17911 | NN | denotes | NF-κB |
| T12288 | 17912-17918 | NN | denotes | target |
| T12289 | 17919-17923 | NN | denotes | gene |
| T12290 | 17924-17937 | NN | denotes | transcription |
| T12291 | 17938-17939 | -LRB- | denotes | ( |
| T12292 | 17939-17943 | FW | denotes | e.g. |
| T12293 | 17944-17947 | NN | denotes | IL8 |
| T12294 | 17947-17948 | -COMMA- | denotes | , |
| T12295 | 17949-17955 | NN | denotes | NFKBIA |
| T12296 | 17955-17956 | -COMMA- | denotes | , |
| T12297 | 17957-17960 | CC | denotes | and |
| T12298 | 17961-17968 | NN | denotes | TNFAIP3 |
| T12299 | 17968-17969 | -RRB- | denotes | ) |
| T12300 | 17971-17977 | RB | denotes | Indeed |
| T12301 | 17977-17978 | -COMMA- | denotes | , |
| T12302 | 17979-17984 | DT | denotes | these |
| T12303 | 17985-17990 | NN | denotes | genes |
| T12304 | 17991-17995 | VB | denotes | were |
| T12305 | 17996-18000 | RB | denotes | only |
| T12306 | 18001-18009 | RB | denotes | modestly |
| T12307 | 18010-18021 | VB | denotes | upregulated |
| T12308 | 18022-18024 | IN | denotes | in |
| T12309 | 18025-18030 | NN | denotes | cells |
| T12310 | 18031-18039 | VB | denotes | infected |
| T12311 | 18040-18044 | IN | denotes | with |
| T12312 | 18045-18054 | JJ | denotes | wild-type |
| T12313 | 18055-18057 | FW | denotes | E. |
| T12314 | 18058-18062 | FW | denotes | coli |
| T12315 | 18063-18067 | NN | denotes | O157 |
| T12316 | 18067-18068 | -COLON- | denotes | : |
| T12317 | 18068-18070 | NN | denotes | H7 |
| T12318 | 18070-18071 | -COMMA- | denotes | , |
| T12319 | 18072-18075 | CC | denotes | but |
| T12320 | 18076-18089 | RB | denotes | significantly |
| T12321 | 18090-18097 | VB | denotes | induced |
| T12322 | 18098-18100 | IN | denotes | in |
| T12323 | 18101-18106 | NN | denotes | cells |
| T12324 | 18107-18115 | VB | denotes | infected |
| T12325 | 18116-18120 | IN | denotes | with |
| T12326 | 18121-18127 | CC | denotes | either |
| T12327 | 18128-18134 | NN | denotes | ΔnleH1 |
| T12328 | 18135-18137 | CC | denotes | or |
| T12329 | 18138-18143 | NN | denotes | ΔescN |
| T12330 | 18144-18151 | NN | denotes | strains |
| T12331 | 18152-18153 | -LRB- | denotes | ( |
| T12332 | 18153-18157 | NNP | denotes | Fig. |
| T12333 | 18158-18160 | NNP | denotes | 6e |
| T12334 | 18160-18161 | -RRB- | denotes | ) |
| T12335 | 18163-18165 | IN | denotes | In |
| T12336 | 18166-18174 | NN | denotes | contrast |
| T12337 | 18174-18175 | -COMMA- | denotes | , |
| T12338 | 18176-18184 | VB | denotes | deleting |
| T12339 | 18185-18190 | NN | denotes | nleH1 |
| T12340 | 18191-18194 | VB | denotes | had |
| T12341 | 18195-18197 | DT | denotes | no |
| T12342 | 18198-18204 | NN | denotes | impact |
| T12343 | 18205-18207 | IN | denotes | on |
| T12344 | 18208-18211 | DT | denotes | the |
| T12345 | 18212-18222 | NN | denotes | expression |
| T12346 | 18223-18225 | IN | denotes | of |
| T12347 | 18226-18242 | JJ | denotes | RPS3-independent |
| T12348 | 18243-18248 | NN | denotes | genes |
| T12349 | 18248-18249 | -COMMA- | denotes | , |
| T12350 | 18250-18259 | VB | denotes | including |
| T12351 | 18260-18264 | NN | denotes | CD25 |
| T12352 | 18265-18268 | CC | denotes | and |
| T12353 | 18269-18277 | NN | denotes | TNFSF13B |
| T12354 | 18278-18279 | -LRB- | denotes | ( |
| T12355 | 18279-18292 | NNP | denotes | Supplementary |
| T12356 | 18293-18297 | NNP | denotes | Fig. |
| T12357 | 18298-18300 | CD | denotes | 12 |
| T12358 | 18300-18301 | -RRB- | denotes | ) |
| T12359 | 18303-18311 | RB | denotes | Together |
| T12360 | 18312-18317 | DT | denotes | these |
| T12361 | 18318-18325 | NN | denotes | results |
| T12362 | 18326-18337 | VB | denotes | demonstrate |
| T12363 | 18338-18342 | IN | denotes | that |
| T12364 | 18343-18348 | NN | denotes | NleH1 |
| T12365 | 18349-18361 | RB | denotes | specifically |
| T12366 | 18362-18370 | VB | denotes | inhibits |
| T12367 | 18371-18374 | DT | denotes | the |
| T12368 | 18375-18385 | JJ | denotes | protective |
| T12369 | 18386-18392 | JJ | denotes | immune |
| T12370 | 18393-18401 | NN | denotes | response |
| T12371 | 18402-18404 | IN | denotes | by |
| T12372 | 18405-18413 | RB | denotes | directly |
| T12373 | 18414-18422 | VB | denotes | blocking |
| T12374 | 18423-18427 | NN | denotes | RPS3 |
| T12375 | 18428-18432 | NN | denotes | S209 |
| T12376 | 18433-18448 | NN | denotes | phosphorylation |
| T12377 | 18449-18452 | CC | denotes | and |
| T12378 | 18453-18460 | RB | denotes | thereby |
| T12379 | 18461-18470 | VB | denotes | impairing |
| T12380 | 18471-18479 | JJ | denotes | critical |
| T12381 | 18480-18494 | JJ | denotes | RPS3-dependent |
| T12382 | 18495-18500 | NN | denotes | NF-κB |
| T12383 | 18501-18507 | NN | denotes | target |
| T12384 | 18508-18513 | NN | denotes | genes |
| T13762 | 18516-18521 | NN | denotes | NleH1 |
| T13763 | 18522-18530 | VB | denotes | inhibits |
| T13764 | 18531-18535 | NN | denotes | RPS3 |
| T13765 | 18536-18540 | NN | denotes | S209 |
| T13766 | 18541-18556 | NN | denotes | phosphorylation |
| T13767 | 18557-18559 | FW | denotes | in |
| T13768 | 18560-18564 | FW | denotes | vivo |
| T13769 | 18565-18567 | PRP | denotes | We |
| T13770 | 18568-18578 | RB | denotes | previously |
| T13771 | 18579-18587 | VB | denotes | utilized |
| T13772 | 18588-18589 | DT | denotes | a |
| T13773 | 18590-18601 | JJ | denotes | gnotobiotic |
| T13774 | 18602-18608 | NN | denotes | piglet |
| T13775 | 18609-18618 | NN | denotes | infection |
| T13776 | 18619-18624 | NN | denotes | model |
| T13777 | 18625-18627 | TO | denotes | to |
| T13778 | 18628-18637 | VB | denotes | determine |
| T13779 | 18638-18642 | IN | denotes | that |
| T13780 | 18643-18650 | NN | denotes | piglets |
| T13781 | 18651-18659 | VB | denotes | infected |
| T13782 | 18660-18664 | IN | denotes | with |
| T13783 | 18665-18671 | NN | denotes | ΔnleH1 |
| T13784 | 18672-18678 | NN | denotes | mutant |
| T13785 | 18679-18683 | VB | denotes | died |
| T13786 | 18684-18688 | RB | denotes | more |
| T13787 | 18689-18696 | RB | denotes | rapidly |
| T13788 | 18697-18701 | IN | denotes | than |
| T13789 | 18702-18707 | DT | denotes | those |
| T13790 | 18708-18716 | VB | denotes | infected |
| T13791 | 18717-18721 | IN | denotes | with |
| T13792 | 18722-18731 | JJ | denotes | wild-type |
| T13793 | 18732-18734 | FW | denotes | E. |
| T13794 | 18735-18739 | FW | denotes | coli |
| T13795 | 18740-18744 | NN | denotes | O157 |
| T13796 | 18744-18745 | -COLON- | denotes | : |
| T13797 | 18745-18747 | NN | denotes | H7 |
| T13798 | 18749-18756 | NN | denotes | Piglets |
| T13799 | 18757-18765 | VB | denotes | infected |
| T13800 | 18766-18770 | IN | denotes | with |
| T13801 | 18771-18777 | NN | denotes | ΔnleH1 |
| T13802 | 18778-18787 | VB | denotes | displayed |
| T13803 | 18788-18796 | JJ | denotes | clinical |
| T13804 | 18797-18804 | NN | denotes | disease |
| T13805 | 18805-18815 | JJ | denotes | consistent |
| T13806 | 18816-18820 | IN | denotes | with |
| T13807 | 18821-18822 | DT | denotes | a |
| T13808 | 18823-18829 | JJ | denotes | robust |
| T13809 | 18830-18842 | JJ | denotes | inflammatory |
| T13810 | 18843-18851 | NN | denotes | response |
| T13811 | 18851-18852 | -COMMA- | denotes | , |
| T13812 | 18853-18856 | CC | denotes | but |
| T13813 | 18857-18861 | IN | denotes | with |
| T13814 | 18862-18869 | VB | denotes | reduced |
| T13815 | 18870-18879 | JJ | denotes | bacterial |
| T13816 | 18880-18892 | NN | denotes | colonization |
| T13817 | 18893-18896 | CC | denotes | and |
| T13818 | 18897-18903 | JJ | denotes | little |
| T13819 | 18904-18913 | NN | denotes | diarrhea9 |
| T13820 | 18915-18920 | IN | denotes | While |
| T13821 | 18921-18930 | RB | denotes | seemingly |
| T13822 | 18931-18942 | JJ | denotes | paradoxical |
| T13823 | 18942-18943 | -COMMA- | denotes | , |
| T13824 | 18944-18949 | VB | denotes | based |
| T13825 | 18950-18952 | IN | denotes | on |
| T13826 | 18953-18956 | PRP-DOLLAR- | denotes | our |
| T13827 | 18957-18961 | NN | denotes | cell |
| T13828 | 18962-18969 | NN | denotes | culture |
| T13829 | 18970-18974 | NN | denotes | data |
| T13830 | 18975-18976 | -LRB- | denotes | ( |
| T13831 | 18976-18980 | NNP | denotes | Fig. |
| T13832 | 18981-18983 | NNP | denotes | 6d |
| T13833 | 18983-18984 | -RRB- | denotes | ) |
| T13834 | 18984-18985 | -COMMA- | denotes | , |
| T13835 | 18986-18988 | PRP | denotes | we |
| T13836 | 18989-19001 | VB | denotes | hypothesized |
| T13837 | 19002-19006 | IN | denotes | that |
| T13838 | 19007-19012 | NN | denotes | NleH1 |
| T13839 | 19013-19020 | VB | denotes | blocked |
| T13840 | 19021-19025 | NN | denotes | RPS3 |
| T13841 | 19026-19030 | NN | denotes | S209 |
| T13842 | 19031-19046 | NN | denotes | phosphorylation |
| T13843 | 19047-19049 | FW | denotes | in |
| T13844 | 19050-19054 | FW | denotes | vivo |
| T13845 | 19054-19055 | -COMMA- | denotes | , |
| T13846 | 19056-19063 | RB | denotes | thereby |
| T13847 | 19064-19074 | VB | denotes | preventing |
| T13848 | 19075-19079 | NN | denotes | RPS3 |
| T13849 | 19080-19087 | JJ | denotes | nuclear |
| T13850 | 19088-19101 | NN | denotes | translocation |
| T13851 | 19102-19104 | IN | denotes | in |
| T13852 | 19105-19113 | JJ | denotes | infected |
| T13853 | 19114-19121 | NN | denotes | piglets |
| T13854 | 19123-19125 | PRP | denotes | We |
| T13855 | 19126-19134 | VB | denotes | isolated |
| T13856 | 19135-19141 | NN | denotes | piglet |
| T13857 | 19142-19148 | NN | denotes | colons |
| T13858 | 19149-19151 | IN | denotes | at |
| T13859 | 19152-19160 | NN | denotes | necropsy |
| T13860 | 19160-19161 | -COMMA- | denotes | , |
| T13861 | 19162-19165 | CC | denotes | and |
| T13862 | 19166-19175 | VB | denotes | subjected |
| T13863 | 19176-19180 | PRP | denotes | them |
| T13864 | 19181-19183 | TO | denotes | to |
| T13865 | 19184-19204 | NN | denotes | immunohistochemistry |
| T13866 | 19205-19210 | VB | denotes | using |
| T13867 | 19211-19214 | PRP-DOLLAR- | denotes | our |
| T13868 | 19215-19227 | NN | denotes | phospho-RPS3 |
| T13869 | 19228-19236 | NN | denotes | antibody |
| T13870 | 19238-19248 | JJ | denotes | Consistent |
| T13871 | 19249-19253 | IN | denotes | with |
| T13872 | 19254-19256 | FW | denotes | in |
| T13873 | 19257-19262 | FW | denotes | vitro |
| T13874 | 19263-19267 | NN | denotes | data |
| T13875 | 19267-19268 | -COMMA- | denotes | , |
| T13876 | 19269-19276 | NN | denotes | piglets |
| T13877 | 19277-19285 | VB | denotes | infected |
| T13878 | 19286-19290 | IN | denotes | with |
| T13879 | 19291-19300 | JJ | denotes | wild-type |
| T13880 | 19301-19303 | FW | denotes | E. |
| T13881 | 19304-19308 | FW | denotes | coli |
| T13882 | 19309-19313 | NN | denotes | O157 |
| T13883 | 19313-19314 | -COLON- | denotes | : |
| T13884 | 19314-19316 | NN | denotes | H7 |
| T13885 | 19317-19326 | VB | denotes | exhibited |
| T13886 | 19327-19334 | JJ | denotes | diffuse |
| T13887 | 19335-19338 | CC | denotes | and |
| T13888 | 19339-19342 | JJ | denotes | low |
| T13889 | 19343-19352 | NN | denotes | intensity |
| T13890 | 19353-19365 | NN | denotes | phospho-RPS3 |
| T13891 | 19366-19374 | NN | denotes | staining |
| T13892 | 19374-19375 | -COMMA- | denotes | , |
| T13893 | 19376-19383 | IN | denotes | whereas |
| T13894 | 19384-19386 | IN | denotes | in |
| T13895 | 19387-19394 | NN | denotes | piglets |
| T13896 | 19395-19403 | VB | denotes | infected |
| T13897 | 19404-19408 | IN | denotes | with |
| T13898 | 19409-19415 | NN | denotes | ΔnleH1 |
| T13899 | 19416-19422 | NN | denotes | mutant |
| T13900 | 19422-19423 | -COMMA- | denotes | , |
| T13901 | 19424-19436 | NN | denotes | phospho-RPS3 |
| T13902 | 19437-19447 | NN | denotes | expression |
| T13903 | 19448-19451 | VB | denotes | was |
| T13904 | 19452-19458 | JJ | denotes | florid |
| T13905 | 19459-19462 | CC | denotes | and |
| T13906 | 19463-19470 | JJ | denotes | intense |
| T13907 | 19471-19472 | -LRB- | denotes | ( |
| T13908 | 19472-19476 | NNP | denotes | Fig. |
| T13909 | 19477-19479 | CD | denotes | 6f |
| T13910 | 19479-19480 | -RRB- | denotes | ) |
| T13911 | 19482-19487 | DT | denotes | These |
| T13912 | 19488-19492 | NN | denotes | data |
| T13913 | 19493-19504 | VB | denotes | demonstrate |
| T13914 | 19505-19509 | IN | denotes | that |
| T13915 | 19510-19515 | NN | denotes | NleH1 |
| T13916 | 19516-19524 | VB | denotes | inhibits |
| T13917 | 19525-19529 | NN | denotes | RPS3 |
| T13918 | 19530-19534 | NN | denotes | S209 |
| T13919 | 19535-19550 | NN | denotes | phosphorylation |
| T13920 | 19551-19555 | CC | denotes | both |
| T13921 | 19556-19558 | FW | denotes | in |
| T13922 | 19559-19564 | FW | denotes | vitro |
| T13923 | 19565-19568 | CC | denotes | and |
| T13924 | 19569-19571 | FW | denotes | in |
| T13925 | 19572-19576 | FW | denotes | vivo |
| T13926 | 19576-19577 | -COMMA- | denotes | , |
| T13927 | 19578-19583 | WDT | denotes | which |
| T13928 | 19584-19589 | MD | denotes | might |
| T13929 | 19590-19597 | VB | denotes | benefit |
| T13930 | 19598-19601 | DT | denotes | the |
| T13931 | 19602-19611 | NN | denotes | bacterium |
| T13932 | 19612-19614 | IN | denotes | in |
| T13933 | 19615-19627 | NN | denotes | colonization |
| T13934 | 19628-19631 | CC | denotes | and |
| T13935 | 19632-19644 | NN | denotes | transmission |
| T14934 | 19647-19652 | NN | denotes | NleH1 |
| T14935 | 19653-19659 | NN | denotes | steers |
| T14936 | 19660-19663 | DT | denotes | the |
| T14937 | 19664-19668 | NN | denotes | IKKβ |
| T14938 | 19669-19678 | NN | denotes | substrate |
| T14939 | 19679-19692 | NN | denotes | specificities |
| T14940 | 19693-19698 | NN | denotes | NleH1 |
| T14941 | 19699-19701 | VB | denotes | is |
| T14942 | 19702-19704 | DT | denotes | an |
| T14943 | 19705-19723 | VB | denotes | autophosphorylated |
| T14944 | 19724-19740 | NN | denotes | serine-threonine |
| T14945 | 19741-19747 | NN | denotes | kinase |
| T14946 | 19747-19748 | -COMMA- | denotes | , |
| T14947 | 19749-19754 | WDT | denotes | which |
| T14948 | 19755-19762 | VB | denotes | depends |
| T14949 | 19763-19765 | IN | denotes | on |
| T14950 | 19766-19769 | DT | denotes | the |
| T14951 | 19770-19776 | NN | denotes | lysine |
| T14952 | 19777-19780 | CD | denotes | 159 |
| T14953 | 19781-19782 | -LRB- | denotes | ( |
| T14954 | 19782-19786 | NN | denotes | K159 |
| T14955 | 19786-19787 | -RRB- | denotes | ) |
| T14956 | 19787-19788 | CD | denotes | 9 |
| T14957 | 19790-19792 | TO | denotes | To |
| T14958 | 19793-19800 | VB | denotes | explore |
| T14959 | 19801-19804 | DT | denotes | the |
| T14960 | 19805-19814 | NN | denotes | mechanism |
| T14961 | 19815-19817 | IN | denotes | by |
| T14962 | 19818-19823 | WDT | denotes | which |
| T14963 | 19824-19829 | NN | denotes | NleH1 |
| T14964 | 19830-19838 | VB | denotes | inhibits |
| T14965 | 19839-19843 | NN | denotes | RPS3 |
| T14966 | 19844-19848 | NN | denotes | S209 |
| T14967 | 19849-19864 | NN | denotes | phosphorylation |
| T14968 | 19864-19865 | -COMMA- | denotes | , |
| T14969 | 19866-19868 | PRP | denotes | we |
| T14970 | 19869-19874 | RB | denotes | first |
| T14971 | 19875-19884 | VB | denotes | performed |
| T14972 | 19885-19887 | DT | denotes | an |
| T14973 | 19888-19890 | FW | denotes | in |
| T14974 | 19891-19896 | FW | denotes | vitro |
| T14975 | 19897-19903 | NN | denotes | kinase |
| T14976 | 19904-19909 | NN | denotes | assay |
| T14977 | 19910-19914 | IN | denotes | with |
| T14978 | 19915-19923 | VB | denotes | purified |
| T14979 | 19924-19933 | JJ | denotes | wild-type |
| T14980 | 19934-19943 | NN | denotes | His-NleH1 |
| T14981 | 19944-19951 | NN | denotes | protein |
| T14982 | 19952-19955 | CC | denotes | and |
| T14983 | 19956-19957 | DT | denotes | a |
| T14984 | 19958-19964 | JJ | denotes | mutant |
| T14985 | 19965-19974 | NN | denotes | His-NleH1 |
| T14986 | 19975-19976 | -LRB- | denotes | ( |
| T14987 | 19976-19981 | NN | denotes | K159A |
| T14988 | 19981-19982 | -RRB- | denotes | ) |
| T14989 | 19983-19990 | NN | denotes | protein |
| T14990 | 19990-19991 | -COMMA- | denotes | , |
| T14991 | 19992-20002 | VB | denotes | confirming |
| T14992 | 20003-20007 | IN | denotes | that |
| T14993 | 20008-20013 | NN | denotes | NleH1 |
| T14994 | 20014-20016 | VB | denotes | is |
| T14995 | 20017-20035 | VB | denotes | autophosphorylated |
| T14996 | 20036-20039 | CC | denotes | and |
| T14997 | 20040-20043 | DT | denotes | the |
| T14998 | 20044-20049 | NN | denotes | K159A |
| T14999 | 20050-20052 | VB | denotes | is |
| T15000 | 20053-20055 | DT | denotes | an |
| T15001 | 20056-20061 | NN | denotes | NleH1 |
| T15002 | 20062-20073 | NN | denotes | kinase-dead |
| T15003 | 20074-20080 | NN | denotes | mutant |
| T15004 | 20081-20082 | -LRB- | denotes | ( |
| T15005 | 20082-20086 | NN | denotes | Fig. |
| T15006 | 20087-20089 | NN | denotes | 7a |
| T15007 | 20089-20090 | -RRB- | denotes | ) |
| T15008 | 20092-20094 | TO | denotes | To |
| T15009 | 20095-20102 | VB | denotes | examine |
| T15010 | 20103-20110 | IN | denotes | whether |
| T15011 | 20111-20114 | DT | denotes | the |
| T15012 | 20115-20121 | NN | denotes | kinase |
| T15013 | 20122-20130 | NN | denotes | activity |
| T15014 | 20131-20133 | VB | denotes | is |
| T15015 | 20134-20142 | VB | denotes | required |
| T15016 | 20143-20146 | IN | denotes | for |
| T15017 | 20147-20152 | NN | denotes | NleH1 |
| T15018 | 20153-20155 | TO | denotes | to |
| T15019 | 20156-20163 | VB | denotes | inhibit |
| T15020 | 20164-20168 | NN | denotes | IKKβ |
| T15021 | 20169-20184 | NN | denotes | phosphorlyation |
| T15022 | 20185-20187 | IN | denotes | of |
| T15023 | 20188-20192 | NN | denotes | RPS3 |
| T15024 | 20193-20195 | IN | denotes | on |
| T15025 | 20196-20200 | NN | denotes | S209 |
| T15026 | 20200-20201 | -COMMA- | denotes | , |
| T15027 | 20202-20204 | PRP | denotes | we |
| T15028 | 20205-20216 | RB | denotes | ectopically |
| T15029 | 20217-20227 | VB | denotes | expressing |
| T15030 | 20228-20234 | CC | denotes | either |
| T15031 | 20235-20244 | JJ | denotes | wild-type |
| T15032 | 20245-20247 | CC | denotes | or |
| T15033 | 20248-20253 | NN | denotes | K159A |
| T15034 | 20254-20259 | NN | denotes | NleH1 |
| T15035 | 20260-20262 | IN | denotes | in |
| T15036 | 20263-20267 | NN | denotes | 293T |
| T15037 | 20268-20273 | NN | denotes | cells |
| T15038 | 20275-20284 | JJ | denotes | Wild-type |
| T15039 | 20285-20290 | NN | denotes | NleH1 |
| T15040 | 20291-20301 | NN | denotes | expression |
| T15041 | 20302-20315 | RB | denotes | significantly |
| T15042 | 20316-20323 | VB | denotes | reduced |
| T15043 | 20324-20335 | JJ | denotes | TNF-induced |
| T15044 | 20336-20340 | NN | denotes | RPS3 |
| T15045 | 20341-20345 | NN | denotes | S209 |
| T15046 | 20346-20361 | NN | denotes | phosphorylation |
| T15047 | 20361-20362 | -COMMA- | denotes | , |
| T15048 | 20363-20370 | IN | denotes | whereas |
| T15049 | 20371-20374 | DT | denotes | the |
| T15050 | 20375-20380 | NN | denotes | K159A |
| T15051 | 20381-20387 | NN | denotes | mutant |
| T15052 | 20388-20394 | VB | denotes | failed |
| T15053 | 20395-20397 | TO | denotes | to |
| T15054 | 20398-20400 | VB | denotes | do |
| T15055 | 20401-20403 | RB | denotes | so |
| T15056 | 20404-20405 | -LRB- | denotes | ( |
| T15057 | 20405-20409 | NNP | denotes | Fig. |
| T15058 | 20410-20412 | NN | denotes | 7b |
| T15059 | 20412-20413 | -RRB- | denotes | ) |
| T15060 | 20415-20419 | RB | denotes | Thus |
| T15061 | 20420-20425 | NN | denotes | NleH1 |
| T15062 | 20426-20432 | NN | denotes | kinase |
| T15063 | 20433-20441 | NN | denotes | activity |
| T15064 | 20442-20444 | VB | denotes | is |
| T15065 | 20445-20453 | VB | denotes | required |
| T15066 | 20454-20456 | TO | denotes | to |
| T15067 | 20457-20464 | VB | denotes | protect |
| T15068 | 20465-20469 | NN | denotes | RPS3 |
| T15069 | 20470-20474 | IN | denotes | from |
| T15070 | 20475-20488 | JJ | denotes | IKKβ-mediated |
| T15071 | 20489-20504 | NN | denotes | phosphorylation |
| T15072 | 20506-20517 | NN | denotes | Citrobacter |
| T15073 | 20518-20527 | NN | denotes | rodentium |
| T15074 | 20528-20530 | VB | denotes | is |
| T15075 | 20531-20532 | DT | denotes | a |
| T15076 | 20533-20538 | NN | denotes | mouse |
| T15077 | 20539-20547 | NN | denotes | pathogen |
| T15078 | 20548-20552 | WDT | denotes | that |
| T15079 | 20553-20559 | VB | denotes | shares |
| T15080 | 20560-20570 | JJ | denotes | pathogenic |
| T15081 | 20571-20581 | NN | denotes | strategies |
| T15082 | 20582-20586 | IN | denotes | with |
| T15083 | 20587-20589 | FW | denotes | E. |
| T15084 | 20590-20594 | FW | denotes | coli |
| T15085 | 20595-20597 | CD | denotes | 39 |
| T15086 | 20597-20598 | -COMMA- | denotes | , |
| T15087 | 20599-20603 | RB | denotes | most |
| T15088 | 20604-20611 | RB | denotes | notably |
| T15089 | 20612-20615 | IN | denotes | for |
| T15090 | 20616-20619 | PRP-DOLLAR- | denotes | our |
| T15091 | 20620-20633 | NN | denotes | investigation |
| T15092 | 20633-20634 | -COMMA- | denotes | , |
| T15093 | 20635-20637 | NNP | denotes | C. |
| T15094 | 20638-20647 | NN | denotes | rodentium |
| T15095 | 20648-20652 | NN | denotes | NleH |
| T15096 | 20653-20662 | VB | denotes | inhibited |
| T15097 | 20663-20667 | NN | denotes | RPS3 |
| T15098 | 20668-20675 | JJ | denotes | nuclear |
| T15099 | 20676-20689 | NN | denotes | translocation |
| T15100 | 20690-20693 | CC | denotes | and |
| T15101 | 20694-20708 | JJ | denotes | RPS3-dependent |
| T15102 | 20709-20714 | NN | denotes | NF-κB |
| T15103 | 20715-20725 | NN | denotes | luciferase |
| T15104 | 20726-20734 | NN | denotes | activity |
| T15105 | 20735-20737 | TO | denotes | to |
| T15106 | 20738-20740 | DT | denotes | an |
| T15107 | 20741-20747 | NN | denotes | extent |
| T15108 | 20748-20758 | JJ | denotes | equivalent |
| T15109 | 20759-20761 | TO | denotes | to |
| T15110 | 20762-20764 | FW | denotes | E. |
| T15111 | 20765-20769 | FW | denotes | coli |
| T15112 | 20770-20775 | NN | denotes | NleH1 |
| T15113 | 20776-20777 | -LRB- | denotes | ( |
| T15114 | 20777-20780 | NN | denotes | ref |
| T15115 | 20782-20783 | CD | denotes | 9 |
| T15116 | 20783-20784 | -RRB- | denotes | ) |
| T15117 | 20786-20788 | PRP | denotes | We |
| T15118 | 20789-20796 | VB | denotes | assayed |
| T15119 | 20797-20801 | NN | denotes | RPS3 |
| T15120 | 20802-20806 | NN | denotes | S209 |
| T15121 | 20807-20822 | NN | denotes | phosphorylation |
| T15122 | 20823-20825 | IN | denotes | in |
| T15123 | 20826-20830 | NN | denotes | HeLa |
| T15124 | 20831-20836 | NN | denotes | cells |
| T15125 | 20837-20845 | VB | denotes | infected |
| T15126 | 20846-20850 | IN | denotes | with |
| T15127 | 20851-20860 | JJ | denotes | different |
| T15128 | 20861-20863 | NNP | denotes | C. |
| T15129 | 20864-20873 | NN | denotes | rodentium |
| T15130 | 20874-20881 | NN | denotes | strains |
| T15131 | 20883-20885 | IN | denotes | In |
| T15132 | 20886-20896 | JJ | denotes | uninfected |
| T15133 | 20897-20902 | NN | denotes | cells |
| T15134 | 20902-20903 | -COMMA- | denotes | , |
| T15135 | 20904-20917 | NN | denotes | TNF-treatment |
| T15136 | 20918-20928 | VB | denotes | stimulated |
| T15137 | 20929-20930 | DT | denotes | a |
| T15138 | 20931-20940 | JJ | denotes | ∼3.5-fold |
| T15139 | 20941-20949 | NN | denotes | increase |
| T15140 | 20950-20952 | IN | denotes | in |
| T15141 | 20953-20957 | NN | denotes | RPS3 |
| T15142 | 20958-20962 | NN | denotes | S209 |
| T15143 | 20963-20978 | NN | denotes | phosphorylation |
| T15144 | 20979-20980 | -LRB- | denotes | ( |
| T15145 | 20980-20984 | NN | denotes | Fig. |
| T15146 | 20985-20987 | NN | denotes | 7c |
| T15147 | 20987-20988 | -RRB- | denotes | ) |
| T15148 | 20990-20994 | JJ | denotes | Such |
| T15149 | 20995-21007 | NN | denotes | augmentation |
| T15150 | 21008-21010 | IN | denotes | of |
| T15151 | 21011-21015 | NN | denotes | RPS3 |
| T15152 | 21016-21031 | NN | denotes | phosphorylation |
| T15153 | 21032-21035 | VB | denotes | was |
| T15154 | 21036-21043 | VB | denotes | reduced |
| T15155 | 21044-21046 | IN | denotes | by |
| T15156 | 21047-21052 | RB | denotes | about |
| T15157 | 21053-21055 | CD | denotes | 60 |
| T15158 | 21055-21056 | NN | denotes | % |
| T15159 | 21057-21059 | IN | denotes | by |
| T15160 | 21060-21069 | JJ | denotes | wild-type |
| T15161 | 21070-21072 | FW | denotes | C. |
| T15162 | 21073-21082 | NN | denotes | rodentium |
| T15163 | 21083-21092 | NN | denotes | infection |
| T15164 | 21093-21094 | -LRB- | denotes | ( |
| T15165 | 21094-21098 | NN | denotes | Fig. |
| T15166 | 21099-21101 | NN | denotes | 7c |
| T15167 | 21101-21102 | -RRB- | denotes | ) |
| T15168 | 21104-21111 | RB | denotes | However |
| T15169 | 21111-21112 | -COMMA- | denotes | , |
| T15170 | 21113-21117 | NN | denotes | RPS3 |
| T15171 | 21118-21133 | NN | denotes | phosphorylation |
| T15172 | 21134-21137 | VB | denotes | was |
| T15173 | 21138-21146 | VB | denotes | enhanced |
| T15174 | 21147-21151 | WRB | denotes | when |
| T15175 | 21152-21157 | NN | denotes | cells |
| T15176 | 21158-21162 | VB | denotes | were |
| T15177 | 21163-21171 | VB | denotes | infected |
| T15178 | 21172-21176 | IN | denotes | with |
| T15179 | 21177-21178 | DT | denotes | a |
| T15180 | 21179-21181 | NNP | denotes | C. |
| T15181 | 21182-21191 | NN | denotes | rodentium |
| T15182 | 21192-21198 | NN | denotes | strain |
| T15183 | 21199-21206 | VB | denotes | lacking |
| T15184 | 21207-21211 | NN | denotes | NleH |
| T15185 | 21212-21213 | -LRB- | denotes | ( |
| T15186 | 21213-21217 | NNP | denotes | Fig. |
| T15187 | 21218-21220 | NN | denotes | 7c |
| T15188 | 21220-21221 | -COMMA- | denotes | , |
| T15189 | 21222-21227 | NN | denotes | ΔnleH |
| T15190 | 21227-21228 | -RRB- | denotes | ) |
| T15191 | 21230-21232 | PRP | denotes | We |
| T15192 | 21233-21240 | RB | denotes | further |
| T15193 | 21241-21249 | VB | denotes | examined |
| T15194 | 21250-21253 | DT | denotes | the |
| T15195 | 21254-21258 | NN | denotes | role |
| T15196 | 21259-21261 | IN | denotes | of |
| T15197 | 21262-21267 | NN | denotes | NleH1 |
| T15198 | 21268-21274 | NN | denotes | kinase |
| T15199 | 21275-21283 | NN | denotes | activity |
| T15200 | 21284-21289 | VB | denotes | using |
| T15201 | 21290-21293 | DT | denotes | the |
| T15202 | 21294-21296 | NNP | denotes | C. |
| T15203 | 21297-21306 | NN | denotes | rodentium |
| T15204 | 21307-21312 | NN | denotes | ΔnleH |
| T15205 | 21313-21319 | NN | denotes | strain |
| T15206 | 21320-21322 | IN | denotes | as |
| T15207 | 21323-21324 | DT | denotes | a |
| T15208 | 21325-21335 | NN | denotes | background |
| T15209 | 21336-21338 | IN | denotes | on |
| T15210 | 21339-21344 | WDT | denotes | which |
| T15211 | 21345-21347 | TO | denotes | to |
| T15212 | 21348-21355 | VB | denotes | express |
| T15213 | 21356-21362 | CC | denotes | either |
| T15214 | 21363-21372 | JJ | denotes | wild-type |
| T15215 | 21373-21375 | CC | denotes | or |
| T15216 | 21376-21381 | NN | denotes | K159A |
| T15217 | 21382-21384 | FW | denotes | E. |
| T15218 | 21385-21389 | FW | denotes | coli |
| T15219 | 21390-21395 | NN | denotes | NleH1 |
| T15220 | 21397-21410 | VB | denotes | Complementing |
| T15221 | 21411-21416 | NN | denotes | ΔnleH |
| T15222 | 21417-21423 | NN | denotes | mutant |
| T15223 | 21424-21428 | IN | denotes | with |
| T15224 | 21429-21438 | JJ | denotes | wild-type |
| T15225 | 21439-21444 | NN | denotes | NleH1 |
| T15226 | 21445-21451 | RB | denotes | almost |
| T15227 | 21452-21461 | VB | denotes | abolished |
| T15228 | 21462-21473 | JJ | denotes | TNF-induced |
| T15229 | 21474-21478 | NN | denotes | RPS3 |
| T15230 | 21479-21483 | NN | denotes | S209 |
| T15231 | 21484-21499 | NN | denotes | phosphorylation |
| T15232 | 21500-21507 | IN | denotes | whereas |
| T15233 | 21508-21521 | VB | denotes | complementing |
| T15234 | 21522-21526 | IN | denotes | with |
| T15235 | 21527-21532 | NN | denotes | K159A |
| T15236 | 21533-21539 | VB | denotes | failed |
| T15237 | 21540-21542 | TO | denotes | to |
| T15238 | 21543-21550 | VB | denotes | inhibit |
| T15239 | 21551-21555 | NN | denotes | RPS3 |
| T15240 | 21556-21571 | NN | denotes | phosphorylation |
| T15241 | 21572-21573 | -LRB- | denotes | ( |
| T15242 | 21573-21577 | NN | denotes | Fig. |
| T15243 | 21578-21580 | NN | denotes | 7c |
| T15244 | 21580-21581 | -RRB- | denotes | ) |
| T15245 | 21583-21595 | RB | denotes | Collectively |
| T15246 | 21595-21596 | -COMMA- | denotes | , |
| T15247 | 21597-21602 | DT | denotes | these |
| T15248 | 21603-21610 | NN | denotes | results |
| T15249 | 21611-21622 | VB | denotes | demonstrate |
| T15250 | 21623-21627 | IN | denotes | that |
| T15251 | 21628-21633 | NN | denotes | NleH1 |
| T15252 | 21634-21640 | NN | denotes | kinase |
| T15253 | 21641-21649 | NN | denotes | activity |
| T15254 | 21650-21652 | VB | denotes | is |
| T15255 | 21653-21661 | VB | denotes | required |
| T15256 | 21662-21664 | TO | denotes | to |
| T15257 | 21665-21670 | VB | denotes | block |
| T15258 | 21671-21675 | NN | denotes | RPS3 |
| T15259 | 21676-21680 | NN | denotes | S209 |
| T15260 | 21681-21696 | NN | denotes | phosphorylation |
| T15261 | 21698-21700 | PRP | denotes | We |
| T15262 | 21701-21705 | RB | denotes | next |
| T15263 | 21706-21714 | VB | denotes | examined |
| T15264 | 21715-21722 | IN | denotes | whether |
| T15265 | 21723-21726 | DT | denotes | the |
| T15266 | 21727-21737 | JJ | denotes | inhibitory |
| T15267 | 21738-21746 | NN | denotes | activity |
| T15268 | 21747-21749 | IN | denotes | of |
| T15269 | 21750-21755 | NN | denotes | NleH1 |
| T15270 | 21756-21758 | VB | denotes | is |
| T15271 | 21759-21771 | RB | denotes | sufficiently |
| T15272 | 21772-21778 | JJ | denotes | robust |
| T15273 | 21779-21781 | TO | denotes | to |
| T15274 | 21782-21788 | VB | denotes | impair |
| T15275 | 21789-21792 | DT | denotes | the |
| T15276 | 21793-21799 | JJ | denotes | strong |
| T15277 | 21800-21807 | JJ | denotes | nuclear |
| T15278 | 21808-21821 | NN | denotes | translocation |
| T15279 | 21822-21824 | IN | denotes | of |
| T15280 | 21825-21829 | NN | denotes | RPS3 |
| T15281 | 21830-21837 | VB | denotes | trigged |
| T15282 | 21838-21840 | IN | denotes | by |
| T15283 | 21841-21844 | DT | denotes | the |
| T15284 | 21845-21866 | JJ | denotes | constitutively-active |
| T15285 | 21867-21871 | NN | denotes | IKKβ |
| T15286 | 21872-21873 | -LRB- | denotes | ( |
| T15287 | 21873-21877 | NN | denotes | IKKβ |
| T15288 | 21878-21879 | -LRB- | denotes | [ |
| T15289 | 21879-21883 | NN | denotes | SSEE |
| T15290 | 21883-21884 | -RRB- | denotes | ] |
| T15291 | 21884-21885 | -RRB- | denotes | ) |
| T15292 | 21886-21887 | -LRB- | denotes | ( |
| T15293 | 21887-21891 | NNP | denotes | Fig. |
| T15294 | 21892-21894 | NNP | denotes | 2d |
| T15295 | 21894-21895 | -RRB- | denotes | ) |
| T15296 | 21897-21899 | PRP | denotes | We |
| T15297 | 21900-21905 | VB | denotes | found |
| T15298 | 21906-21910 | IN | denotes | that |
| T15299 | 21911-21922 | RB | denotes | ectopically |
| T15300 | 21923-21933 | VB | denotes | expressing |
| T15301 | 21934-21940 | CC | denotes | either |
| T15302 | 21941-21950 | JJ | denotes | wild-type |
| T15303 | 21951-21953 | CC | denotes | or |
| T15304 | 21954-21958 | NN | denotes | SSEE |
| T15305 | 21959-21963 | NN | denotes | IKKβ |
| T15306 | 21964-21972 | NN | denotes | proteins |
| T15307 | 21972-21973 | -COMMA- | denotes | , |
| T15308 | 21974-21983 | VB | denotes | triggered |
| T15309 | 21984-21988 | JJ | denotes | more |
| T15310 | 21989-21993 | NN | denotes | RPS3 |
| T15311 | 21994-22001 | JJ | denotes | nuclear |
| T15312 | 22002-22015 | NN | denotes | translocation |
| T15313 | 22016-22020 | IN | denotes | than |
| T15314 | 22021-22024 | DT | denotes | the |
| T15315 | 22025-22036 | JJ | denotes | kinase-dead |
| T15316 | 22037-22041 | NN | denotes | IKKβ |
| T15317 | 22042-22043 | -LRB- | denotes | ( |
| T15318 | 22043-22047 | NN | denotes | SSAA |
| T15319 | 22047-22048 | -RRB- | denotes | ) |
| T15320 | 22049-22056 | NN | denotes | protein |
| T15321 | 22057-22058 | -LRB- | denotes | ( |
| T15322 | 22058-22062 | NNP | denotes | Fig. |
| T15323 | 22063-22065 | NNP | denotes | 7d |
| T15324 | 22065-22066 | -RRB- | denotes | ) |
| T15325 | 22068-22072 | NN | denotes | RPS3 |
| T15326 | 22073-22080 | JJ | denotes | nuclear |
| T15327 | 22081-22093 | NN | denotes | accumulation |
| T15328 | 22094-22097 | VB | denotes | was |
| T15329 | 22098-22111 | RB | denotes | substantially |
| T15330 | 22112-22120 | VB | denotes | retarded |
| T15331 | 22121-22123 | IN | denotes | by |
| T15332 | 22124-22133 | VB | denotes | infecting |
| T15333 | 22134-22139 | NN | denotes | cells |
| T15334 | 22140-22144 | IN | denotes | with |
| T15335 | 22145-22154 | JJ | denotes | wild-type |
| T15336 | 22155-22157 | FW | denotes | E. |
| T15337 | 22158-22162 | FW | denotes | coli |
| T15338 | 22163-22167 | NN | denotes | O157 |
| T15339 | 22167-22168 | -COLON- | denotes | : |
| T15340 | 22168-22170 | NN | denotes | H7 |
| T15341 | 22171-22172 | -LRB- | denotes | ( |
| T15342 | 22172-22176 | NNP | denotes | Fig. |
| T15343 | 22177-22179 | NNP | denotes | 7d |
| T15344 | 22179-22180 | -RRB- | denotes | ) |
| T15345 | 22182-22184 | IN | denotes | In |
| T15346 | 22185-22193 | NN | denotes | contrast |
| T15347 | 22193-22194 | -COMMA- | denotes | , |
| T15348 | 22195-22204 | VB | denotes | infecting |
| T15349 | 22205-22209 | IN | denotes | with |
| T15350 | 22210-22216 | CC | denotes | either |
| T15351 | 22217-22223 | NN | denotes | ΔnleH1 |
| T15352 | 22224-22226 | CC | denotes | or |
| T15353 | 22227-22232 | NN | denotes | ΔescN |
| T15354 | 22233-22240 | NN | denotes | strains |
| T15355 | 22241-22245 | RB | denotes | only |
| T15356 | 22246-22254 | RB | denotes | slightly |
| T15357 | 22255-22263 | JJ | denotes | impaired |
| T15358 | 22264-22268 | NN | denotes | RPS3 |
| T15359 | 22269-22276 | JJ | denotes | nuclear |
| T15360 | 22277-22290 | NN | denotes | translocation |
| T15361 | 22291-22293 | IN | denotes | in |
| T15362 | 22294-22300 | CC | denotes | either |
| T15363 | 22301-22306 | NN | denotes | IKKβ- |
| T15364 | 22307-22309 | CC | denotes | or |
| T15365 | 22310-22314 | NN | denotes | IKKβ |
| T15366 | 22315-22316 | -LRB- | denotes | ( |
| T15367 | 22316-22320 | NN | denotes | SSEE |
| T15368 | 22320-22321 | -RRB- | denotes | ) |
| T15369 | 22321-22332 | JJ | denotes | -expressing |
| T15370 | 22333-22338 | NN | denotes | cells |
| T15371 | 22339-22340 | -LRB- | denotes | ( |
| T15372 | 22340-22344 | NNP | denotes | Fig. |
| T15373 | 22345-22347 | NNP | denotes | 7d |
| T15374 | 22347-22348 | -RRB- | denotes | ) |
| T15375 | 22350-22352 | IN | denotes | As |
| T15376 | 22353-22361 | VB | denotes | expected |
| T15377 | 22361-22362 | -COMMA- | denotes | , |
| T15378 | 22363-22365 | NNP | denotes | E. |
| T15379 | 22366-22370 | NNP | denotes | coli |
| T15380 | 22371-22381 | NN | denotes | infections |
| T15381 | 22382-22385 | VB | denotes | did |
| T15382 | 22386-22389 | RB | denotes | not |
| T15383 | 22390-22396 | VB | denotes | affect |
| T15384 | 22397-22400 | DT | denotes | the |
| T15385 | 22401-22405 | NN | denotes | RPS3 |
| T15386 | 22406-22413 | JJ | denotes | nuclear |
| T15387 | 22414-22427 | NN | denotes | translocation |
| T15388 | 22428-22430 | IN | denotes | in |
| T15389 | 22431-22435 | NN | denotes | IKKβ |
| T15390 | 22436-22437 | -LRB- | denotes | ( |
| T15391 | 22437-22441 | NN | denotes | SSAA |
| T15392 | 22441-22442 | -RRB- | denotes | ) |
| T15393 | 22442-22453 | JJ | denotes | -expressing |
| T15394 | 22454-22459 | NN | denotes | cells |
| T15395 | 22459-22460 | -COMMA- | denotes | , |
| T15396 | 22461-22466 | WRB | denotes | where |
| T15397 | 22467-22472 | NN | denotes | NF-κB |
| T15398 | 22473-22482 | NN | denotes | signaling |
| T15399 | 22483-22486 | VB | denotes | was |
| T15400 | 22487-22490 | JJ | denotes | low |
| T15401 | 22491-22492 | -LRB- | denotes | ( |
| T15402 | 22492-22496 | NNP | denotes | Fig. |
| T15403 | 22497-22499 | NNP | denotes | 7d |
| T15404 | 22499-22500 | -RRB- | denotes | ) |
| T15405 | 22502-22506 | RB | denotes | Thus |
| T15406 | 22506-22507 | -COMMA- | denotes | , |
| T15407 | 22508-22514 | IN | denotes | during |
| T15408 | 22515-22524 | NN | denotes | infection |
| T15409 | 22525-22530 | NN | denotes | NleH1 |
| T15410 | 22531-22533 | VB | denotes | is |
| T15411 | 22534-22546 | RB | denotes | sufficiently |
| T15412 | 22547-22553 | JJ | denotes | potent |
| T15413 | 22554-22556 | TO | denotes | to |
| T15414 | 22557-22564 | VB | denotes | inhibit |
| T15415 | 22565-22569 | NN | denotes | RPS3 |
| T15416 | 22570-22577 | JJ | denotes | nuclear |
| T15417 | 22578-22591 | NN | denotes | translocation |
| T15418 | 22592-22596 | RB | denotes | even |
| T15419 | 22597-22599 | IN | denotes | in |
| T15420 | 22600-22605 | NN | denotes | cells |
| T15421 | 22606-22616 | VB | denotes | expressing |
| T15422 | 22617-22641 | JJ | denotes | constitutively-activated |
| T15423 | 22642-22646 | NN | denotes | IKKβ |
| T15424 | 22648-22650 | PRP | denotes | We |
| T15425 | 22651-22659 | VB | denotes | examined |
| T15426 | 22660-22667 | IN | denotes | whether |
| T15427 | 22668-22673 | NN | denotes | NleH1 |
| T15428 | 22674-22679 | MD | denotes | could |
| T15429 | 22680-22688 | RB | denotes | directly |
| T15430 | 22689-22702 | VB | denotes | phosphorylate |
| T15431 | 22703-22707 | NN | denotes | IKKβ |
| T15432 | 22708-22712 | RB | denotes | thus |
| T15433 | 22713-22723 | VB | denotes | inhibiting |
| T15434 | 22724-22737 | JJ | denotes | IKKβ-mediated |
| T15435 | 22738-22742 | NN | denotes | RPS3 |
| T15436 | 22743-22747 | NN | denotes | S209 |
| T15437 | 22748-22763 | NN | denotes | phosphorylation |
| T15438 | 22765-22767 | PRP | denotes | We |
| T15439 | 22768-22777 | VB | denotes | performed |
| T15440 | 22778-22780 | FW | denotes | in |
| T15441 | 22781-22786 | FW | denotes | vitro |
| T15442 | 22787-22793 | NN | denotes | kinase |
| T15443 | 22794-22800 | NN | denotes | assays |
| T15444 | 22801-22806 | VB | denotes | using |
| T15445 | 22807-22825 | VB | denotes | immunoprecipitated |
| T15446 | 22826-22835 | NN | denotes | Flag-IKKβ |
| T15447 | 22836-22837 | -LRB- | denotes | ( |
| T15448 | 22837-22841 | NN | denotes | K44A |
| T15449 | 22841-22842 | -RRB- | denotes | ) |
| T15450 | 22843-22845 | IN | denotes | as |
| T15451 | 22846-22855 | NN | denotes | substrate |
| T15452 | 22856-22859 | CC | denotes | and |
| T15453 | 22860-22871 | JJ | denotes | recombinant |
| T15454 | 22872-22881 | NN | denotes | His-NleH1 |
| T15455 | 22882-22884 | IN | denotes | as |
| T15456 | 22885-22891 | NN | denotes | kinase |
| T15457 | 22891-22892 | -COMMA- | denotes | , |
| T15458 | 22893-22895 | IN | denotes | so |
| T15459 | 22896-22900 | IN | denotes | that |
| T15460 | 22901-22905 | NN | denotes | IKKβ |
| T15461 | 22906-22925 | NN | denotes | autophosphorylation |
| T15462 | 22926-22931 | MD | denotes | would |
| T15463 | 22932-22935 | RB | denotes | not |
| T15464 | 22936-22943 | VB | denotes | obscure |
| T15465 | 22944-22957 | JJ | denotes | NleH1-induced |
| T15466 | 22958-22973 | NN | denotes | phosphorylation |
| T15467 | 22975-22982 | RB | denotes | However |
| T15468 | 22982-22983 | -COMMA- | denotes | , |
| T15469 | 22984-22986 | PRP | denotes | we |
| T15470 | 22987-22990 | VB | denotes | did |
| T15471 | 22991-22994 | RB | denotes | not |
| T15472 | 22995-23002 | VB | denotes | observe |
| T15473 | 23003-23006 | DT | denotes | any |
| T15474 | 23007-23017 | JJ | denotes | detectable |
| T15475 | 23018-23021 | NN | denotes | 32P |
| T15476 | 23022-23035 | NN | denotes | incorporation |
| T15477 | 23036-23038 | IN | denotes | in |
| T15478 | 23039-23043 | NN | denotes | IKKβ |
| T15479 | 23044-23045 | -LRB- | denotes | ( |
| T15480 | 23045-23058 | NNP | denotes | Supplementary |
| T15481 | 23059-23063 | NNP | denotes | Fig. |
| T15482 | 23064-23066 | CD | denotes | 13 |
| T15483 | 23066-23067 | -RRB- | denotes | ) |
| T15484 | 23067-23068 | -COMMA- | denotes | , |
| T15485 | 23069-23073 | RB | denotes | thus |
| T15486 | 23074-23080 | VB | denotes | ruling |
| T15487 | 23081-23084 | RP | denotes | out |
| T15488 | 23085-23089 | DT | denotes | this |
| T15489 | 23090-23101 | NN | denotes | possibility |
| T15490 | 23103-23105 | PRP | denotes | We |
| T15491 | 23106-23110 | RB | denotes | then |
| T15492 | 23111-23117 | VB | denotes | tested |
| T15493 | 23118-23121 | DT | denotes | the |
| T15494 | 23122-23132 | NN | denotes | hypothesis |
| T15495 | 23133-23137 | IN | denotes | that |
| T15496 | 23138-23143 | NN | denotes | NleH1 |
| T15497 | 23144-23149 | MD | denotes | could |
| T15498 | 23150-23155 | VB | denotes | alter |
| T15499 | 23156-23159 | DT | denotes | the |
| T15500 | 23160-23164 | NN | denotes | IKKβ |
| T15501 | 23165-23174 | NN | denotes | substrate |
| T15502 | 23175-23188 | NN | denotes | specificities |
| T15503 | 23190-23192 | TO | denotes | To |
| T15504 | 23193-23197 | DT | denotes | this |
| T15505 | 23198-23201 | NN | denotes | end |
| T15506 | 23201-23202 | -COMMA- | denotes | , |
| T15507 | 23203-23205 | PRP | denotes | we |
| T15508 | 23206-23215 | VB | denotes | performed |
| T15509 | 23216-23218 | FW | denotes | in |
| T15510 | 23219-23224 | FW | denotes | vitro |
| T15511 | 23225-23231 | NN | denotes | kinase |
| T15512 | 23232-23238 | NN | denotes | assays |
| T15513 | 23239-23244 | VB | denotes | using |
| T15514 | 23245-23249 | CC | denotes | both |
| T15515 | 23250-23253 | NN | denotes | CK2 |
| T15516 | 23254-23257 | CC | denotes | and |
| T15517 | 23258-23261 | NN | denotes | IKK |
| T15518 | 23262-23272 | NN | denotes | substrates |
| T15519 | 23273-23276 | IN | denotes | for |
| T15520 | 23277-23281 | NN | denotes | IKKβ |
| T15521 | 23283-23285 | IN | denotes | As |
| T15522 | 23286-23294 | VB | denotes | expected |
| T15523 | 23294-23295 | -COMMA- | denotes | , |
| T15524 | 23296-23300 | NN | denotes | IKKβ |
| T15525 | 23301-23315 | VB | denotes | phosphorylated |
| T15526 | 23316-23320 | NN | denotes | RPS3 |
| T15527 | 23321-23322 | -LRB- | denotes | ( |
| T15528 | 23322-23326 | NNP | denotes | Fig. |
| T15529 | 23327-23329 | NNP | denotes | 7e |
| T15530 | 23329-23330 | -COMMA- | denotes | , |
| T15531 | 23331-23335 | NN | denotes | lane |
| T15532 | 23336-23337 | CD | denotes | 7 |
| T15533 | 23337-23338 | -RRB- | denotes | ) |
| T15534 | 23339-23342 | CC | denotes | and |
| T15535 | 23343-23351 | NN | denotes | GST-IκBα |
| T15536 | 23352-23353 | -LRB- | denotes | ( |
| T15537 | 23353-23357 | CD | denotes | 1-54 |
| T15538 | 23357-23358 | -RRB- | denotes | ) |
| T15539 | 23359-23366 | NN | denotes | protein |
| T15540 | 23367-23368 | -LRB- | denotes | ( |
| T15541 | 23368-23372 | NNP | denotes | Fig. |
| T15542 | 23373-23375 | NNP | denotes | 7e |
| T15543 | 23375-23376 | -COMMA- | denotes | , |
| T15544 | 23377-23381 | NN | denotes | lane |
| T15545 | 23382-23383 | CD | denotes | 9 |
| T15546 | 23383-23384 | -RRB- | denotes | ) |
| T15547 | 23384-23385 | -COMMA- | denotes | , |
| T15548 | 23386-23399 | VB | denotes | demonstrating |
| T15549 | 23400-23402 | PRP | denotes | it |
| T15550 | 23403-23410 | VB | denotes | harbors |
| T15551 | 23411-23417 | CC | denotes | either |
| T15552 | 23418-23421 | NN | denotes | CK2 |
| T15553 | 23422-23424 | CC | denotes | or |
| T15554 | 23425-23428 | NN | denotes | IKK |
| T15555 | 23429-23438 | NN | denotes | substrate |
| T15556 | 23439-23450 | NN | denotes | specificity |
| T15557 | 23452-23465 | NN | denotes | Preincubation |
| T15558 | 23466-23468 | IN | denotes | of |
| T15559 | 23469-23473 | NN | denotes | IKKβ |
| T15560 | 23474-23478 | IN | denotes | with |
| T15561 | 23479-23484 | NN | denotes | NleH1 |
| T15562 | 23485-23492 | VB | denotes | reduced |
| T15563 | 23493-23506 | JJ | denotes | IKKβ-mediated |
| T15564 | 23507-23511 | NN | denotes | RPS3 |
| T15565 | 23512-23527 | NN | denotes | phosphorylation |
| T15566 | 23527-23528 | -COMMA- | denotes | , |
| T15567 | 23529-23533 | FW | denotes | i.e. |
| T15568 | 23534-23537 | DT | denotes | the |
| T15569 | 23538-23541 | NN | denotes | CK2 |
| T15570 | 23542-23548 | NN | denotes | kinase |
| T15571 | 23549-23560 | NN | denotes | specificity |
| T15572 | 23560-23561 | -COMMA- | denotes | , |
| T15573 | 23562-23565 | CC | denotes | but |
| T15574 | 23566-23569 | RB | denotes | not |
| T15575 | 23570-23583 | JJ | denotes | IKKβ-mediated |
| T15576 | 23584-23592 | NN | denotes | GST-IκBα |
| T15577 | 23593-23608 | NN | denotes | phosphorylation |
| T15578 | 23608-23609 | -COMMA- | denotes | , |
| T15579 | 23610-23614 | FW | denotes | i.e. |
| T15580 | 23615-23618 | DT | denotes | the |
| T15581 | 23619-23622 | NN | denotes | IKK |
| T15582 | 23623-23629 | NN | denotes | kinase |
| T15583 | 23630-23641 | NN | denotes | specificity |
| T15584 | 23642-23643 | -LRB- | denotes | ( |
| T15585 | 23643-23647 | NNP | denotes | Fig. |
| T15586 | 23648-23650 | NNP | denotes | 7e |
| T15587 | 23650-23651 | -RRB- | denotes | ) |
| T15588 | 23653-23660 | NN | denotes | Control |
| T15589 | 23661-23672 | NN | denotes | experiments |
| T15590 | 23673-23681 | VB | denotes | revealed |
| T15591 | 23682-23684 | DT | denotes | no |
| T15592 | 23685-23699 | JJ | denotes | NleH1-mediated |
| T15593 | 23700-23715 | NN | denotes | phosphorylation |
| T15594 | 23716-23718 | CC | denotes | or |
| T15595 | 23719-23738 | NN | denotes | autophosphorylation |
| T15596 | 23739-23741 | IN | denotes | of |
| T15597 | 23742-23746 | NN | denotes | RPS3 |
| T15598 | 23747-23749 | CC | denotes | or |
| T15599 | 23750-23758 | NN | denotes | GST-IκBα |
| T15600 | 23759-23760 | -LRB- | denotes | ( |
| T15601 | 23760-23764 | NNP | denotes | Fig. |
| T15602 | 23765-23767 | NNP | denotes | 7e |
| T15603 | 23767-23768 | -RRB- | denotes | ) |
| T15604 | 23770-23775 | VB | denotes | Taken |
| T15605 | 23776-23784 | RB | denotes | together |
| T15606 | 23784-23785 | -COMMA- | denotes | , |
| T15607 | 23786-23791 | NN | denotes | NleH1 |
| T15608 | 23792-23798 | VB | denotes | blocks |
| T15609 | 23799-23802 | DT | denotes | the |
| T15610 | 23803-23806 | NN | denotes | CK2 |
| T15611 | 23807-23816 | NN | denotes | substrate |
| T15612 | 23817-23828 | NN | denotes | specificity |
| T15613 | 23829-23831 | IN | denotes | of |
| T15614 | 23832-23836 | NN | denotes | IKKβ |
| T15615 | 23837-23841 | RB | denotes | thus |
| T15616 | 23842-23852 | VB | denotes | inhibiting |
| T15617 | 23853-23856 | DT | denotes | the |
| T15618 | 23857-23870 | JJ | denotes | IKKβ-mediated |
| T15619 | 23871-23875 | NN | denotes | RPS3 |
| T15620 | 23876-23880 | NN | denotes | S209 |
| T15621 | 23881-23896 | NN | denotes | phosphorylation |
| T15622 | 23897-23901 | RB | denotes | thus |
| T15623 | 23902-23914 | VB | denotes | representing |
| T15624 | 23915-23916 | DT | denotes | a |
| T15625 | 23917-23922 | JJ | denotes | novel |
| T15626 | 23923-23931 | NN | denotes | strategy |
| T15627 | 23932-23934 | IN | denotes | by |
| T15628 | 23935-23937 | FW | denotes | E. |
| T15629 | 23938-23942 | FW | denotes | coli |
| T15630 | 23943-23947 | NN | denotes | O157 |
| T15631 | 23947-23948 | -COLON- | denotes | : |
| T15632 | 23948-23950 | NN | denotes | H7 |
| T15633 | 23951-23953 | TO | denotes | to |
| T15634 | 23954-23959 | VB | denotes | alter |
| T15635 | 23960-23963 | DT | denotes | the |
| T15636 | 23964-23968 | NN | denotes | host |
| T15637 | 23969-23975 | JJ | denotes | innate |
| T15638 | 23976-23982 | JJ | denotes | immune |
| T15639 | 23983-23991 | NN | denotes | response |
| T18146 | 24005-24009 | NN | denotes | RPS3 |
| T18148 | 24014-24024 | RB | denotes | previously |
| T18149 | 24025-24037 | VB | denotes | demonstrated |
| T18150 | 24038-24040 | TO | denotes | to |
| T18151 | 24041-24049 | VB | denotes | function |
| T18152 | 24050-24052 | IN | denotes | as |
| T18153 | 24053-24055 | DT | denotes | an |
| T18154 | 24056-24064 | JJ | denotes | integral |
| T18155 | 24065-24072 | NN | denotes | subunit |
| T18156 | 24073-24083 | VB | denotes | conferring |
| T18157 | 24084-24089 | NN | denotes | NF-κB |
| T18158 | 24090-24100 | JJ | denotes | regulatory |
| T18159 | 24101-24113 | NN | denotes | specificity6 |
| T18160 | 24115-24119 | RB | denotes | Here |
| T18161 | 24120-24122 | PRP | denotes | we |
| T18162 | 24123-24129 | VB | denotes | sought |
| T18163 | 24130-24132 | TO | denotes | to |
| T18164 | 24133-24142 | VB | denotes | elucidate |
| T18165 | 24143-24146 | WRB | denotes | how |
| T18166 | 24147-24152 | NN | denotes | NF-κB |
| T18167 | 24153-24163 | NN | denotes | activation |
| T18168 | 24164-24173 | NN | denotes | signaling |
| T18169 | 24174-24182 | VB | denotes | triggers |
| T18170 | 24183-24187 | NN | denotes | RPS3 |
| T18171 | 24188-24190 | TO | denotes | to |
| T18172 | 24191-24202 | VB | denotes | translocate |
| T18173 | 24203-24206 | CC | denotes | and |
| T18174 | 24207-24218 | VB | denotes | participate |
| T18175 | 24219-24221 | IN | denotes | in |
| T18176 | 24222-24227 | NN | denotes | NF-κB |
| T18177 | 24228-24236 | NN | denotes | function |
| T18178 | 24237-24239 | IN | denotes | in |
| T18179 | 24240-24243 | DT | denotes | the |
| T18180 | 24244-24251 | NN | denotes | nucleus |
| T18181 | 24253-24255 | PRP | denotes | We |
| T18182 | 24256-24267 | VB | denotes | demonstrate |
| T18183 | 24268-24272 | IN | denotes | that |
| T18184 | 24273-24286 | JJ | denotes | IKKβ-mediated |
| T18185 | 24287-24291 | NN | denotes | RPS3 |
| T18186 | 24292-24296 | NN | denotes | S209 |
| T18187 | 24297-24312 | NN | denotes | phosphorylation |
| T18188 | 24313-24323 | VB | denotes | represents |
| T18189 | 24324-24325 | DT | denotes | a |
| T18190 | 24326-24334 | JJ | denotes | critical |
| T18191 | 24335-24346 | NN | denotes | determinant |
| T18192 | 24347-24349 | IN | denotes | in |
| T18193 | 24350-24359 | VB | denotes | governing |
| T18194 | 24360-24363 | PRP-DOLLAR- | denotes | its |
| T18195 | 24364-24371 | JJ | denotes | nuclear |
| T18196 | 24372-24378 | NN | denotes | import |
| T18197 | 24379-24383 | RB | denotes | thus |
| T18198 | 24384-24393 | VB | denotes | unveiling |
| T18199 | 24394-24395 | DT | denotes | a |
| T18200 | 24396-24401 | JJ | denotes | novel |
| T18201 | 24402-24411 | NN | denotes | mechanism |
| T18202 | 24412-24418 | IN | denotes | behind |
| T18203 | 24419-24424 | NN | denotes | NF-κB |
| T18204 | 24425-24435 | JJ | denotes | regulatory |
| T18205 | 24436-24447 | NN | denotes | specificity |
| T18206 | 24449-24453 | NN | denotes | IKKβ |
| T18207 | 24454-24456 | VB | denotes | is |
| T18208 | 24457-24460 | DT | denotes | the |
| T18209 | 24461-24466 | JJ | denotes | major |
| T18210 | 24467-24473 | NN | denotes | kinase |
| T18211 | 24474-24478 | WDT | denotes | that |
| T18212 | 24479-24493 | VB | denotes | phosphorylates |
| T18213 | 24494-24498 | NN | denotes | IκBs |
| T18214 | 24499-24501 | IN | denotes | in |
| T18215 | 24502-24505 | DT | denotes | the |
| T18216 | 24506-24515 | JJ | denotes | classical |
| T18217 | 24516-24521 | NN | denotes | NF-κB |
| T18218 | 24522-24529 | NN | denotes | pathway |
| T18219 | 24529-24530 | -COMMA- | denotes | , |
| T18220 | 24531-24538 | VB | denotes | leading |
| T18221 | 24539-24541 | TO | denotes | to |
| T18222 | 24542-24547 | PRP-DOLLAR- | denotes | their |
| T18223 | 24548-24558 | JJ | denotes | subsequent |
| T18224 | 24559-24572 | NN | denotes | degradation40 |
| T18225 | 24574-24584 | RB | denotes | Strikingly |
| T18226 | 24584-24585 | -COMMA- | denotes | , |
| T18227 | 24586-24590 | NN | denotes | RPS3 |
| T18228 | 24591-24600 | VB | denotes | possesses |
| T18229 | 24601-24604 | RB | denotes | not |
| T18230 | 24605-24608 | DT | denotes | any |
| T18231 | 24609-24618 | NN | denotes | consensus |
| T18232 | 24619-24622 | NN | denotes | IKK |
| T18233 | 24623-24628 | NN | denotes | motif |
| T18234 | 24628-24629 | -COLON- | denotes | ; |
| T18235 | 24630-24637 | RB | denotes | instead |
| T18236 | 24637-24638 | -COMMA- | denotes | , |
| T18237 | 24639-24643 | NN | denotes | S209 |
| T18238 | 24644-24646 | VB | denotes | is |
| T18239 | 24647-24655 | VB | denotes | centered |
| T18240 | 24656-24658 | IN | denotes | in |
| T18241 | 24659-24660 | DT | denotes | a |
| T18242 | 24661-24670 | NN | denotes | consensus |
| T18243 | 24671-24674 | NN | denotes | CK2 |
| T18244 | 24675-24680 | NN | denotes | motif |
| T18245 | 24682-24685 | DT | denotes | The |
| T18246 | 24686-24692 | JJ | denotes | recent |
| T18247 | 24693-24704 | NN | denotes | observation |
| T18248 | 24705-24709 | IN | denotes | that |
| T18249 | 24710-24715 | JJ | denotes | human |
| T18250 | 24716-24720 | NN | denotes | IKKβ |
| T18251 | 24721-24730 | VB | denotes | displayed |
| T18252 | 24731-24739 | JJ | denotes | CK2-like |
| T18253 | 24740-24755 | NN | denotes | phosphorylation |
| T18254 | 24756-24769 | NN | denotes | specificity29 |
| T18255 | 24770-24779 | NN | denotes | coincides |
| T18256 | 24780-24784 | IN | denotes | with |
| T18257 | 24785-24788 | PRP-DOLLAR- | denotes | our |
| T18258 | 24789-24797 | NN | denotes | evidence |
| T18259 | 24798-24802 | IN | denotes | that |
| T18260 | 24803-24814 | JJ | denotes | recombinant |
| T18261 | 24815-24819 | NN | denotes | IKKβ |
| T18262 | 24819-24820 | -COMMA- | denotes | , |
| T18263 | 24821-24824 | CC | denotes | but |
| T18264 | 24825-24828 | RB | denotes | not |
| T18265 | 24829-24833 | NN | denotes | IKKα |
| T18266 | 24833-24834 | -COMMA- | denotes | , |
| T18267 | 24835-24849 | VB | denotes | phosphorylated |
| T18268 | 24850-24854 | NN | denotes | RPS3 |
| T18269 | 24856-24858 | PRP | denotes | We |
| T18270 | 24859-24864 | VB | denotes | found |
| T18271 | 24865-24869 | DT | denotes | this |
| T18272 | 24870-24885 | NN | denotes | phosphorylation |
| T18273 | 24886-24888 | VB | denotes | is |
| T18274 | 24889-24890 | DT | denotes | a |
| T18275 | 24891-24899 | JJ | denotes | critical |
| T18276 | 24900-24910 | NN | denotes | modulation |
| T18277 | 24911-24914 | IN | denotes | for |
| T18278 | 24915-24919 | NN | denotes | RPS3 |
| T18279 | 24920-24927 | JJ | denotes | nuclear |
| T18280 | 24928-24941 | NN | denotes | translocation |
| T18281 | 24942-24943 | -LRB- | denotes | ( |
| T18282 | 24943-24946 | IN | denotes | via |
| T18283 | 24947-24957 | NN | denotes | importin-α |
| T18284 | 24957-24958 | -RRB- | denotes | ) |
| T18285 | 24959-24962 | CC | denotes | and |
| T18286 | 24963-24973 | NN | denotes | engagement |
| T18287 | 24974-24976 | IN | denotes | in |
| T18288 | 24977-24985 | JJ | denotes | specific |
| T18289 | 24986-24991 | NN | denotes | NF-κB |
| T18290 | 24992-25005 | NN | denotes | transcription |
| T18291 | 25007-25010 | NN | denotes | CK2 |
| T18292 | 25011-25014 | VB | denotes | was |
| T18293 | 25015-25025 | RB | denotes | previously |
| T18294 | 25026-25031 | VB | denotes | shown |
| T18295 | 25032-25034 | TO | denotes | to |
| T18296 | 25035-25048 | VB | denotes | phosphorylate |
| T18297 | 25049-25052 | NN | denotes | p65 |
| T18298 | 25053-25056 | CC | denotes | and |
| T18299 | 25057-25059 | TO | denotes | to |
| T18300 | 25060-25064 | VB | denotes | bind |
| T18301 | 25065-25067 | TO | denotes | to |
| T18302 | 25068-25071 | CC | denotes | and |
| T18303 | 25072-25085 | VB | denotes | phosphorylate |
| T18304 | 25086-25095 | NN | denotes | IKKβ41-43 |
| T18305 | 25095-25096 | -COMMA- | denotes | , |
| T18306 | 25097-25104 | RB | denotes | however |
| T18307 | 25104-25105 | -COMMA- | denotes | , |
| T18308 | 25106-25108 | PRP | denotes | we |
| T18309 | 25109-25114 | VB | denotes | ruled |
| T18310 | 25115-25118 | RP | denotes | out |
| T18311 | 25119-25122 | DT | denotes | the |
| T18312 | 25123-25134 | NN | denotes | possibility |
| T18313 | 25135-25139 | IN | denotes | that |
| T18314 | 25140-25143 | DT | denotes | the |
| T18315 | 25144-25154 | JJ | denotes | IKKβ-bound |
| T18316 | 25155-25158 | NN | denotes | CK2 |
| T18317 | 25159-25164 | MD | denotes | could |
| T18318 | 25165-25172 | VB | denotes | account |
| T18319 | 25173-25176 | IN | denotes | for |
| T18320 | 25177-25180 | DT | denotes | the |
| T18321 | 25181-25189 | VB | denotes | observed |
| T18322 | 25190-25194 | NN | denotes | RPS3 |
| T18323 | 25195-25210 | NN | denotes | phosphorylation |
| T18324 | 25211-25218 | IN | denotes | because |
| T18325 | 25219-25221 | DT | denotes | no |
| T18326 | 25222-25225 | NN | denotes | CK2 |
| T18327 | 25226-25229 | VB | denotes | was |
| T18328 | 25230-25238 | VB | denotes | detected |
| T18329 | 25239-25241 | IN | denotes | in |
| T18330 | 25242-25245 | DT | denotes | the |
| T18331 | 25246-25250 | NN | denotes | IKKβ |
| T18332 | 25251-25263 | NN | denotes | preparations |
| T18333 | 25264-25268 | VB | denotes | used |
| T18334 | 25269-25272 | IN | denotes | for |
| T18335 | 25273-25276 | DT | denotes | the |
| T18336 | 25277-25279 | FW | denotes | in |
| T18337 | 25280-25285 | FW | denotes | vitro |
| T18338 | 25286-25292 | NN | denotes | kinase |
| T18339 | 25293-25298 | NN | denotes | assay |
| T18340 | 25300-25307 | IN | denotes | Because |
| T18341 | 25308-25312 | NN | denotes | RPS3 |
| T18342 | 25313-25317 | RB | denotes | only |
| T18343 | 25318-25325 | VB | denotes | harbors |
| T18344 | 25326-25329 | DT | denotes | the |
| T18345 | 25330-25333 | NN | denotes | CK2 |
| T18346 | 25334-25339 | NN | denotes | motif |
| T18347 | 25340-25343 | CC | denotes | and |
| T18348 | 25344-25347 | RB | denotes | not |
| T18349 | 25348-25349 | DT | denotes | a |
| T18350 | 25350-25361 | JJ | denotes | traditional |
| T18351 | 25362-25365 | NN | denotes | IKK |
| T18352 | 25366-25371 | NN | denotes | motif |
| T18353 | 25371-25372 | -COMMA- | denotes | , |
| T18354 | 25373-25377 | DT | denotes | this |
| T18355 | 25378-25382 | NN | denotes | RPS3 |
| T18356 | 25383-25393 | JJ | denotes | regulatory |
| T18357 | 25394-25402 | NN | denotes | function |
| T18358 | 25403-25408 | MD | denotes | could |
| T18359 | 25409-25416 | VB | denotes | explain |
| T18360 | 25417-25420 | WRB | denotes | why |
| T18361 | 25421-25424 | NN | denotes | IKK |
| T18362 | 25425-25432 | VB | denotes | harbors |
| T18363 | 25433-25436 | DT | denotes | the |
| T18364 | 25437-25448 | JJ | denotes | alternative |
| T18365 | 25449-25458 | NN | denotes | substrate |
| T18366 | 25459-25474 | NN | denotes | phosphorylation |
| T18367 | 25475-25485 | NN | denotes | capability |
| T18368 | 25487-25491 | RB | denotes | More |
| T18369 | 25492-25503 | RB | denotes | importantly |
| T18370 | 25503-25504 | -COMMA- | denotes | , |
| T18371 | 25505-25508 | PRP-DOLLAR- | denotes | our |
| T18372 | 25509-25514 | NN | denotes | study |
| T18373 | 25515-25518 | VB | denotes | has |
| T18374 | 25519-25529 | VB | denotes | elucidated |
| T18375 | 25530-25533 | WRB | denotes | how |
| T18376 | 25534-25538 | NN | denotes | RPS3 |
| T18377 | 25539-25541 | VB | denotes | is |
| T18378 | 25542-25555 | RB | denotes | biochemically |
| T18379 | 25556-25566 | VB | denotes | integrated |
| T18380 | 25567-25571 | IN | denotes | into |
| T18381 | 25572-25577 | NN | denotes | NF-κB |
| T18382 | 25578-25588 | NN | denotes | activation |
| T18383 | 25589-25598 | NN | denotes | signaling |
| T18384 | 25599-25601 | IN | denotes | in |
| T18385 | 25602-25603 | DT | denotes | a |
| T18386 | 25604-25610 | NN | denotes | manner |
| T18387 | 25611-25615 | WDT | denotes | that |
| T18388 | 25616-25618 | VB | denotes | is |
| T18389 | 25619-25626 | JJ | denotes | pivotal |
| T18390 | 25627-25630 | IN | denotes | for |
| T18391 | 25631-25634 | DT | denotes | the |
| T18392 | 25635-25647 | NN | denotes | pathogenesis |
| T18393 | 25648-25650 | IN | denotes | of |
| T18394 | 25651-25660 | JJ | denotes | foodborne |
| T18395 | 25661-25669 | NN | denotes | pathogen |
| T18396 | 25670-25672 | FW | denotes | E. |
| T18397 | 25673-25677 | FW | denotes | coli |
| T18398 | 25678-25682 | NN | denotes | O157 |
| T18399 | 25682-25683 | -COLON- | denotes | : |
| T18400 | 25683-25685 | NN | denotes | H7 |
| T18401 | 25687-25700 | JJ | denotes | IKKβ-mediated |
| T18402 | 25701-25705 | NN | denotes | RPS3 |
| T18403 | 25706-25710 | NN | denotes | S209 |
| T18404 | 25711-25726 | NN | denotes | phosphorylation |
| T18405 | 25727-25729 | VB | denotes | is |
| T18406 | 25730-25731 | DT | denotes | a |
| T18407 | 25732-25740 | JJ | denotes | critical |
| T18408 | 25741-25747 | NN | denotes | target |
| T18409 | 25748-25757 | VB | denotes | modulated |
| T18410 | 25758-25760 | IN | denotes | by |
| T18411 | 25761-25765 | DT | denotes | this |
| T18412 | 25766-25774 | NN | denotes | pathogen |
| T18413 | 25775-25777 | TO | denotes | to |
| T18414 | 25778-25785 | VB | denotes | subvert |
| T18415 | 25786-25790 | NN | denotes | host |
| T18416 | 25791-25796 | NN | denotes | NF-κB |
| T18417 | 25797-25806 | NN | denotes | signaling |
| T18418 | 25808-25811 | DT | denotes | The |
| T18419 | 25812-25821 | JJ | denotes | bacterial |
| T18420 | 25822-25830 | NN | denotes | effector |
| T18421 | 25831-25836 | NN | denotes | NleH1 |
| T18422 | 25837-25849 | RB | denotes | specifically |
| T18423 | 25850-25855 | VB | denotes | binds |
| T18424 | 25856-25858 | TO | denotes | to |
| T18425 | 25859-25863 | NN | denotes | RPS3 |
| T18426 | 25864-25868 | RB | denotes | once |
| T18427 | 25869-25877 | VB | denotes | injected |
| T18428 | 25878-25882 | IN | denotes | into |
| T18429 | 25883-25887 | NN | denotes | host |
| T18430 | 25888-25893 | NN | denotes | cells |
| T18431 | 25894-25897 | CC | denotes | and |
| T18432 | 25898-25908 | RB | denotes | profoundly |
| T18433 | 25909-25919 | VB | denotes | suppresses |
| T18434 | 25920-25925 | NN | denotes | NF-κB |
| T18435 | 25926-25929 | CC | denotes | and |
| T18436 | 25930-25933 | PRP-DOLLAR- | denotes | its |
| T18437 | 25934-25943 | JJ | denotes | attendant |
| T18439 | 25955-25961 | JJ | denotes | immune |
| T18440 | 25962-25972 | NN | denotes | responses9 |
| T18441 | 25974-25977 | PRP-DOLLAR- | denotes | Our |
| T18442 | 25978-25982 | NN | denotes | data |
| T18443 | 25983-25986 | RB | denotes | now |
| T18444 | 25987-25991 | VB | denotes | show |
| T18445 | 25992-25996 | IN | denotes | that |
| T18446 | 25997-26002 | NN | denotes | NleH1 |
| T18447 | 26003-26014 | RB | denotes | selectively |
| T18448 | 26015-26023 | VB | denotes | inhibits |
| T18449 | 26024-26028 | NN | denotes | RPS3 |
| T18450 | 26029-26044 | NN | denotes | phosphorylation |
| T18451 | 26044-26045 | -COMMA- | denotes | , |
| T18452 | 26046-26050 | RB | denotes | thus |
| T18453 | 26051-26060 | VB | denotes | retarding |
| T18454 | 26061-26064 | PRP-DOLLAR- | denotes | its |
| T18455 | 26065-26072 | JJ | denotes | nuclear |
| T18456 | 26073-26086 | NN | denotes | translocation |
| T18457 | 26087-26090 | CC | denotes | and |
| T18458 | 26091-26101 | JJ | denotes | subsequent |
| T18459 | 26102-26107 | NN | denotes | NF-κB |
| T18460 | 26108-26116 | NN | denotes | function |
| T18461 | 26116-26117 | -COMMA- | denotes | , |
| T18462 | 26118-26125 | IN | denotes | without |
| T18463 | 26126-26134 | VB | denotes | altering |
| T18464 | 26135-26140 | JJ | denotes | other |
| T18465 | 26141-26146 | NN | denotes | NF-κB |
| T18466 | 26147-26156 | NN | denotes | signaling |
| T18467 | 26158-26166 | IN | denotes | Although |
| T18468 | 26167-26172 | NN | denotes | NleH1 |
| T18469 | 26173-26176 | VB | denotes | did |
| T18470 | 26177-26180 | RB | denotes | not |
| T18471 | 26181-26189 | RB | denotes | directly |
| T18472 | 26190-26203 | VB | denotes | phosphorylate |
| T18473 | 26204-26208 | NN | denotes | IKKβ |
| T18474 | 26208-26209 | -COMMA- | denotes | , |
| T18475 | 26210-26213 | PRP-DOLLAR- | denotes | its |
| T18476 | 26214-26220 | NN | denotes | kinase |
| T18477 | 26221-26229 | NN | denotes | activity |
| T18478 | 26230-26233 | VB | denotes | was |
| T18479 | 26234-26242 | VB | denotes | required |
| T18480 | 26243-26245 | TO | denotes | to |
| T18481 | 26246-26253 | VB | denotes | inhibit |
| T18482 | 26254-26267 | JJ | denotes | IKKβ-mediated |
| T18483 | 26268-26272 | NN | denotes | RPS3 |
| T18484 | 26273-26277 | NN | denotes | S209 |
| T18485 | 26278-26293 | NN | denotes | phosphorylation |
| T18486 | 26295-26299 | JJ | denotes | Many |
| T18487 | 26300-26308 | NN | denotes | bacteria |
| T18488 | 26309-26318 | NN | denotes | pathogens |
| T18489 | 26319-26323 | VB | denotes | have |
| T18490 | 26324-26332 | NN | denotes | products |
| T18491 | 26333-26337 | WDT | denotes | that |
| T18492 | 26338-26344 | VB | denotes | target |
| T18493 | 26345-26348 | JJ | denotes | key |
| T18494 | 26349-26356 | NN | denotes | kinases |
| T18495 | 26357-26359 | TO | denotes | to |
| T18496 | 26360-26370 | VB | denotes | inactivate |
| T18497 | 26371-26375 | PRP | denotes | them |
| T18498 | 26376-26378 | IN | denotes | in |
| T18499 | 26379-26383 | NN | denotes | host |
| T18500 | 26384-26389 | NN | denotes | cells |
| T18501 | 26389-26390 | -COMMA- | denotes | , |
| T18502 | 26391-26398 | IN | denotes | whereas |
| T18503 | 26399-26401 | FW | denotes | E. |
| T18504 | 26402-26406 | FW | denotes | coli |
| T18505 | 26407-26411 | NN | denotes | O157 |
| T18506 | 26411-26412 | -COLON- | denotes | : |
| T18507 | 26412-26414 | NN | denotes | H7 |
| T18508 | 26415-26423 | VB | denotes | employed |
| T18509 | 26424-26429 | NN | denotes | NleH1 |
| T18510 | 26430-26432 | TO | denotes | to |
| T18511 | 26433-26438 | VB | denotes | steer |
| T18512 | 26439-26442 | DT | denotes | the |
| T18513 | 26443-26452 | NN | denotes | substrate |
| T18514 | 26453-26464 | NN | denotes | specificity |
| T18515 | 26465-26467 | IN | denotes | of |
| T18516 | 26468-26472 | NN | denotes | IKKβ |
| T18517 | 26473-26477 | RB | denotes | thus |
| T18518 | 26478-26490 | RB | denotes | specifically |
| T18519 | 26491-26502 | JJ | denotes | fine-tuning |
| T18520 | 26503-26507 | NN | denotes | host |
| T18521 | 26508-26513 | NN | denotes | NF-κB |
| T18522 | 26514-26523 | NN | denotes | signaling |
| T18523 | 26525-26529 | DT | denotes | This |
| T18524 | 26530-26535 | MD | denotes | could |
| T18525 | 26536-26545 | VB | denotes | represent |
| T18526 | 26546-26547 | DT | denotes | a |
| T18527 | 26548-26553 | JJ | denotes | novel |
| T18528 | 26554-26562 | NN | denotes | strategy |
| T18529 | 26563-26565 | TO | denotes | to |
| T18530 | 26566-26575 | VB | denotes | fine-tune |
| T18531 | 26576-26580 | NN | denotes | host |
| T18532 | 26581-26586 | NN | denotes | NF-κB |
| T18533 | 26587-26596 | NN | denotes | signaling |
| T18534 | 26597-26601 | WDT | denotes | that |
| T18535 | 26602-26607 | MD | denotes | could |
| T18536 | 26608-26610 | VB | denotes | be |
| T18537 | 26611-26617 | VB | denotes | shared |
| T18538 | 26618-26620 | IN | denotes | by |
| T18539 | 26621-26626 | JJ | denotes | other |
| T18540 | 26627-26636 | NN | denotes | pathogens |
| T18541 | 26638-26643 | DT | denotes | These |
| T18542 | 26644-26648 | NN | denotes | data |
| T18543 | 26649-26656 | VB | denotes | provide |
| T18544 | 26657-26660 | JJ | denotes | new |
| T18545 | 26661-26669 | NN | denotes | insights |
| T18546 | 26670-26674 | IN | denotes | into |
| T18547 | 26675-26678 | DT | denotes | the |
| T18548 | 26679-26685 | RB | denotes | poorly |
| T18549 | 26686-26696 | VB | denotes | understood |
| T18550 | 26697-26703 | NN | denotes | action |
| T18551 | 26704-26713 | NN | denotes | mechanism |
| T18552 | 26714-26717 | IN | denotes | for |
| T18553 | 26718-26722 | JJ | denotes | most |
| T18554 | 26723-26727 | NN | denotes | T3SS |
| T18555 | 26728-26737 | NN | denotes | effectors |
| T18556 | 26739-26744 | NN | denotes | NleH1 |
| T18557 | 26745-26755 | VB | denotes | attenuates |
| T18558 | 26756-26759 | DT | denotes | the |
| T18559 | 26760-26773 | NN | denotes | transcription |
| T18560 | 26774-26776 | IN | denotes | of |
| T18561 | 26777-26791 | JJ | denotes | RPS3-dependent |
| T18562 | 26791-26792 | -COMMA- | denotes | , |
| T18563 | 26793-26796 | CC | denotes | but |
| T18564 | 26797-26800 | RB | denotes | not |
| T18565 | 26801-26804 | DT | denotes | all |
| T18566 | 26804-26805 | -COMMA- | denotes | , |
| T18567 | 26806-26811 | NN | denotes | NF-κB |
| T18568 | 26812-26818 | NN | denotes | target |
| T18569 | 26819-26824 | NN | denotes | genes |
| T18570 | 26824-26825 | -COMMA- | denotes | , |
| T18571 | 26826-26828 | IN | denotes | in |
| T18572 | 26829-26839 | JJ | denotes | particular |
| T18573 | 26840-26845 | DT | denotes | those |
| T18574 | 26846-26851 | NN | denotes | genes |
| T18575 | 26852-26862 | VB | denotes | associated |
| T18576 | 26863-26867 | IN | denotes | with |
| T18577 | 26868-26873 | JJ | denotes | acute |
| T18578 | 26874-26889 | JJ | denotes | proinflammatory |
| T18579 | 26890-26899 | NN | denotes | responses |
| T18580 | 26899-26900 | -COMMA- | denotes | , |
| T18581 | 26901-26910 | VB | denotes | including |
| T18582 | 26911-26914 | NN | denotes | IL8 |
| T18583 | 26915-26918 | CC | denotes | and |
| T18584 | 26919-26922 | NN | denotes | TNF |
| T18585 | 26924-26926 | IN | denotes | In |
| T18586 | 26927-26935 | NN | denotes | contrast |
| T18587 | 26935-26936 | -COMMA- | denotes | , |
| T18588 | 26937-26942 | NN | denotes | NleH1 |
| T18589 | 26943-26947 | VB | denotes | does |
| T18590 | 26948-26951 | RB | denotes | not |
| T18591 | 26952-26957 | VB | denotes | block |
| T18592 | 26958-26963 | NN | denotes | NF-κB |
| T18593 | 26964-26967 | NN | denotes | p65 |
| T18594 | 26968-26975 | JJ | denotes | nuclear |
| T18595 | 26976-26989 | NN | denotes | translocation |
| T18596 | 26989-26990 | -COMMA- | denotes | , |
| T18597 | 26991-26996 | WDT | denotes | which |
| T18598 | 26997-27005 | VB | denotes | suggests |
| T18599 | 27006-27010 | IN | denotes | that |
| T18600 | 27011-27018 | JJ | denotes | certain |
| T18601 | 27019-27032 | JJ | denotes | p65-dependent |
| T18602 | 27033-27036 | CC | denotes | but |
| T18603 | 27037-27053 | JJ | denotes | RPS3-independent |
| T18604 | 27054-27059 | NN | denotes | NF-κB |
| T18605 | 27060-27066 | NN | denotes | target |
| T18606 | 27067-27072 | NN | denotes | genes |
| T18607 | 27073-27078 | MD | denotes | might |
| T18608 | 27079-27083 | RB | denotes | thus |
| T18609 | 27084-27086 | VB | denotes | be |
| T18610 | 27087-27097 | JJ | denotes | beneficial |
| T18611 | 27098-27101 | IN | denotes | for |
| T18612 | 27102-27104 | FW | denotes | E. |
| T18613 | 27105-27109 | FW | denotes | coli |
| T18614 | 27110-27114 | NN | denotes | O157 |
| T18615 | 27114-27115 | -COLON- | denotes | : |
| T18616 | 27115-27117 | NN | denotes | H7 |
| T18617 | 27118-27120 | TO | denotes | to |
| T18618 | 27121-27130 | VB | denotes | replicate |
| T18619 | 27131-27134 | CC | denotes | and |
| T18620 | 27135-27146 | VB | denotes | disseminate |
| T18621 | 27147-27149 | IN | denotes | in |
| T18622 | 27150-27153 | DT | denotes | the |
| T18623 | 27154-27158 | NN | denotes | host |
| T18624 | 27160-27162 | IN | denotes | By |
| T18625 | 27163-27174 | RB | denotes | selectively |
| T18626 | 27175-27185 | VB | denotes | inhibiting |
| T18627 | 27186-27190 | NN | denotes | RPS3 |
| T18628 | 27191-27194 | CC | denotes | and |
| T18629 | 27195-27198 | PRP-DOLLAR- | denotes | its |
| T18630 | 27199-27208 | JJ | denotes | attendant |
| T18631 | 27209-27214 | NN | denotes | NF-κB |
| T18632 | 27215-27223 | NN | denotes | function |
| T18633 | 27224-27228 | IN | denotes | with |
| T18634 | 27229-27234 | NN | denotes | NleH1 |
| T18635 | 27234-27235 | -COMMA- | denotes | , |
| T18636 | 27236-27239 | DT | denotes | the |
| T18637 | 27240-27248 | NN | denotes | pathogen |
| T18638 | 27249-27257 | VB | denotes | achieves |
| T18639 | 27258-27261 | DT | denotes | the |
| T18640 | 27262-27269 | NN | denotes | ability |
| T18641 | 27270-27272 | TO | denotes | to |
| T18642 | 27273-27281 | VB | denotes | increase |
| T18643 | 27282-27294 | NN | denotes | colonization |
| T18644 | 27295-27298 | CC | denotes | and |
| T18645 | 27299-27307 | NN | denotes | diarrhea |
| T18646 | 27308-27311 | RB | denotes | yet |
| T18647 | 27312-27320 | VB | denotes | limiting |
| T18648 | 27321-27324 | DT | denotes | the |
| T18649 | 27325-27334 | NN | denotes | mortality |
| T18650 | 27335-27337 | IN | denotes | of |
| T18651 | 27338-27341 | DT | denotes | the |
| T18652 | 27342-27346 | NN | denotes | host |
| T18653 | 27348-27352 | DT | denotes | This |
| T18654 | 27353-27362 | RB | denotes | seemingly |
| T18655 | 27363-27374 | JJ | denotes | paradoxical |
| T18656 | 27375-27386 | NN | denotes | combination |
| T18657 | 27387-27389 | IN | denotes | of |
| T18658 | 27390-27397 | NN | denotes | effects |
| T18659 | 27398-27402 | VB | denotes | make |
| T18660 | 27403-27408 | NN | denotes | sense |
| T18661 | 27409-27413 | WRB | denotes | when |
| T18662 | 27414-27417 | CD | denotes | one |
| T18663 | 27418-27427 | VB | denotes | considers |
| T18664 | 27428-27432 | IN | denotes | that |
| T18665 | 27433-27442 | VB | denotes | increased |
| T18666 | 27443-27452 | JJ | denotes | bacterial |
| T18667 | 27453-27457 | NN | denotes | load |
| T18668 | 27458-27461 | CC | denotes | and |
| T18669 | 27462-27470 | NN | denotes | diarrhea |
| T18670 | 27471-27479 | RB | denotes | together |
| T18671 | 27480-27484 | IN | denotes | with |
| T18672 | 27485-27493 | NN | denotes | survival |
| T18673 | 27494-27496 | IN | denotes | of |
| T18674 | 27497-27500 | DT | denotes | the |
| T18675 | 27501-27509 | JJ | denotes | infected |
| T18676 | 27510-27514 | NN | denotes | host |
| T18677 | 27515-27520 | MD | denotes | would |
| T18678 | 27521-27528 | VB | denotes | promote |
| T18679 | 27529-27532 | DT | denotes | the |
| T18680 | 27533-27542 | NN | denotes | spreading |
| T18681 | 27543-27545 | IN | denotes | of |
| T18682 | 27546-27549 | DT | denotes | the |
| T18683 | 27550-27558 | NN | denotes | bacteria |
| T18684 | 27559-27564 | IN | denotes | among |
| T18685 | 27565-27566 | DT | denotes | a |
| T18686 | 27567-27577 | NN | denotes | population |
| T18687 | 27578-27580 | IN | denotes | of |
| T18688 | 27581-27592 | JJ | denotes | susceptible |
| T18689 | 27593-27604 | NN | denotes | individuals |
| T18690 | 27606-27610 | JJ | denotes | Such |
| T18691 | 27611-27618 | NN | denotes | complex |
| T18692 | 27619-27622 | CC | denotes | and |
| T18693 | 27623-27634 | JJ | denotes | paradoxical |
| T18694 | 27635-27647 | JJ | denotes | pathological |
| T18695 | 27648-27655 | NN | denotes | effects |
| T18696 | 27656-27660 | WDT | denotes | that |
| T18697 | 27661-27670 | VB | denotes | influence |
| T18698 | 27671-27674 | DT | denotes | the |
| T18699 | 27675-27681 | NN | denotes | spread |
| T18700 | 27682-27684 | IN | denotes | of |
| T18701 | 27685-27692 | NN | denotes | disease |
| T18702 | 27693-27696 | VB | denotes | are |
| T18703 | 27697-27702 | RB | denotes | often |
| T18704 | 27703-27709 | RB | denotes | poorly |
| T18705 | 27710-27720 | VB | denotes | understood |
| T18706 | 27721-27723 | IN | denotes | at |
| T18707 | 27724-27727 | DT | denotes | the |
| T18708 | 27728-27737 | JJ | denotes | molecular |
| T18709 | 27738-27743 | NN | denotes | level |
| T18710 | 27745-27748 | PRP-DOLLAR- | denotes | Our |
| T18711 | 27749-27753 | NN | denotes | data |
| T18712 | 27754-27763 | VB | denotes | elucidate |
| T18713 | 27764-27767 | WRB | denotes | how |
| T18714 | 27768-27779 | NN | denotes | alterations |
| T18715 | 27780-27782 | IN | denotes | in |
| T18716 | 27783-27792 | JJ | denotes | selective |
| T18717 | 27793-27798 | NN | denotes | NF-κB |
| T18718 | 27799-27807 | NN | denotes | function |
| T18719 | 27807-27808 | -COMMA- | denotes | , |
| T18720 | 27809-27817 | VB | denotes | achieved |
| T18721 | 27818-27820 | IN | denotes | by |
| T18722 | 27821-27829 | VB | denotes | impeding |
| T18723 | 27830-27834 | NN | denotes | RPS3 |
| T18724 | 27834-27835 | -COMMA- | denotes | , |
| T18725 | 27836-27839 | CC | denotes | but |
| T18726 | 27840-27843 | RB | denotes | not |
| T18727 | 27844-27852 | VB | denotes | altering |
| T18728 | 27853-27856 | NN | denotes | p65 |
| T18729 | 27857-27864 | JJ | denotes | nuclear |
| T18730 | 27865-27878 | NN | denotes | translocation |
| T18731 | 27878-27879 | -COMMA- | denotes | , |
| T18732 | 27880-27883 | MD | denotes | can |
| T18733 | 27884-27893 | VB | denotes | influence |
| T18734 | 27894-27902 | JJ | denotes | specific |
| T18735 | 27903-27912 | NN | denotes | cytokines |
| T18736 | 27913-27917 | WDT | denotes | that |
| T18737 | 27918-27924 | VB | denotes | affect |
| T18738 | 27925-27934 | JJ | denotes | bacterial |
| T18739 | 27935-27947 | NN | denotes | colonization |
| T18740 | 27947-27948 | -COMMA- | denotes | , |
| T18741 | 27949-27957 | NN | denotes | diarrhea |
| T18742 | 27958-27966 | NN | denotes | diseases |
| T18743 | 27967-27970 | CC | denotes | and |
| T18744 | 27971-27980 | NN | denotes | mortality |
| T18745 | 27982-27984 | PRP | denotes | It |
| T18746 | 27985-27988 | MD | denotes | may |
| T18747 | 27989-27991 | VB | denotes | be |
| T18748 | 27992-28000 | JJ | denotes | fruitful |
| T18749 | 28001-28003 | IN | denotes | in |
| T18750 | 28004-28014 | VB | denotes | attempting |
| T18751 | 28015-28017 | TO | denotes | to |
| T18752 | 28018-28028 | VB | denotes | understand |
| T18753 | 28029-28034 | JJ | denotes | other |
| T18754 | 28035-28045 | JJ | denotes | infectious |
| T18755 | 28046-28049 | CC | denotes | and |
| T18756 | 28050-28060 | JJ | denotes | autoimmune |
| T18757 | 28061-28069 | NN | denotes | diseases |
| T18758 | 28070-28079 | VB | denotes | involving |
| T18759 | 28080-28085 | NN | denotes | NF-κB |
| T18760 | 28086-28088 | TO | denotes | to |
| T18761 | 28089-28097 | VB | denotes | consider |
| T18762 | 28098-28107 | JJ | denotes | selective |
| T18763 | 28108-28115 | NN | denotes | effects |
| T18764 | 28116-28118 | IN | denotes | of |
| T18765 | 28119-28127 | NN | denotes | subunits |
| T18766 | 28128-28132 | JJ | denotes | such |
| T18767 | 28133-28135 | IN | denotes | as |
| T18768 | 28136-28140 | NN | denotes | RPS3 |
| T18769 | 28141-28143 | IN | denotes | in |
| T18770 | 28144-28152 | NN | denotes | addition |
| T18771 | 28153-28155 | TO | denotes | to |
| T18772 | 28156-28162 | JJ | denotes | global |
| T18773 | 28163-28168 | NN | denotes | NF-κB |
| T18774 | 28169-28179 | NN | denotes | inhibition |
| T20521 | 29298-29305 | NN | denotes | Plasmid |
| T20522 | 29306-29316 | NN | denotes | Constructs |
| T20523 | 29317-29320 | DT | denotes | The |
| T20524 | 29321-29330 | NN | denotes | Flag-IKKβ |
| T20525 | 29331-29332 | -LRB- | denotes | ( |
| T20526 | 29332-29336 | NN | denotes | SSEE |
| T20527 | 29336-29337 | -RRB- | denotes | ) |
| T20528 | 29337-29338 | -COMMA- | denotes | , |
| T20529 | 29339-29348 | NN | denotes | Flag-IKKβ |
| T20530 | 29349-29350 | -LRB- | denotes | ( |
| T20531 | 29350-29354 | NN | denotes | SSAA |
| T20532 | 29354-29355 | -RRB- | denotes | ) |
| T20533 | 29355-29356 | -COMMA- | denotes | , |
| T20534 | 29357-29360 | CC | denotes | and |
| T20535 | 29361-29368 | NN | denotes | HA-IκBα |
| T20536 | 29369-29370 | -LRB- | denotes | ( |
| T20537 | 29370-29374 | NN | denotes | SSAA |
| T20538 | 29374-29375 | -RRB- | denotes | ) |
| T20539 | 29376-29386 | NN | denotes | constructs |
| T20540 | 29387-29391 | VB | denotes | were |
| T20541 | 29392-29400 | VB | denotes | provided |
| T20542 | 29401-29403 | IN | denotes | by |
| T20543 | 29404-29406 | NNP | denotes | C. |
| T20544 | 29407-29409 | NNP | denotes | Wu |
| T20545 | 29410-29411 | -LRB- | denotes | ( |
| T20546 | 29411-29414 | NNP | denotes | NCI |
| T20547 | 29414-29415 | -COMMA- | denotes | , |
| T20548 | 29416-29424 | NNP | denotes | Bethesda |
| T20549 | 29424-29425 | -RRB- | denotes | ) |
| T20550 | 29426-29429 | CC | denotes | and |
| T20551 | 29430-29432 | NNP | denotes | U. |
| T20552 | 29433-29443 | NNP | denotes | Siebenlist |
| T20553 | 29444-29445 | -LRB- | denotes | ( |
| T20554 | 29445-29450 | NNP | denotes | NIAID |
| T20555 | 29450-29451 | -COMMA- | denotes | , |
| T20556 | 29452-29460 | NNP | denotes | Bethesda |
| T20557 | 29460-29461 | -RRB- | denotes | ) |
| T20558 | 29461-29462 | -COMMA- | denotes | , |
| T20559 | 29463-29475 | RB | denotes | respectively |
| T20560 | 29477-29480 | DT | denotes | The |
| T20561 | 29481-29488 | NN | denotes | HA-IκBα |
| T20562 | 29489-29492 | CC | denotes | and |
| T20563 | 29493-29497 | NN | denotes | IKKβ |
| T20564 | 29498-29499 | -LRB- | denotes | ( |
| T20565 | 29499-29503 | NN | denotes | K44A |
| T20566 | 29503-29504 | -RRB- | denotes | ) |
| T20567 | 29504-29509 | NN | denotes | -Flag |
| T20568 | 29510-29518 | NN | denotes | plasmids |
| T20569 | 29519-29523 | VB | denotes | were |
| T20570 | 29524-29533 | VB | denotes | purchased |
| T20571 | 29534-29538 | IN | denotes | from |
| T20572 | 29539-29548 | NN | denotes | Addgene44 |
| T20573 | 29548-29549 | -COMMA- | denotes | , |
| T20574 | 29550-29552 | CD | denotes | 45 |
| T20575 | 29554-29557 | DT | denotes | The |
| T20576 | 29558-29567 | NN | denotes | Flag-RPS3 |
| T20577 | 29567-29568 | -COMMA- | denotes | , |
| T20578 | 29569-29577 | NN | denotes | GST-RPS3 |
| T20579 | 29577-29578 | -COMMA- | denotes | , |
| T20580 | 29579-29586 | NN | denotes | HA-RPS3 |
| T20581 | 29586-29587 | -COMMA- | denotes | , |
| T20582 | 29588-29593 | NN | denotes | VN-HA |
| T20583 | 29593-29594 | -COMMA- | denotes | , |
| T20584 | 29595-29603 | NN | denotes | NleH1-HA |
| T20585 | 29604-29612 | NN | denotes | plasmids |
| T20586 | 29613-29617 | VB | denotes | were |
| T20587 | 29618-29627 | VB | denotes | described |
| T20588 | 29628-29639 | NN | denotes | previously6 |
| T20589 | 29639-29640 | -COMMA- | denotes | , |
| T20590 | 29641-29642 | CD | denotes | 9 |
| T20591 | 29644-29647 | DT | denotes | The |
| T20592 | 29648-29653 | NN | denotes | point |
| T20593 | 29654-29661 | NN | denotes | mutants |
| T20594 | 29662-29664 | IN | denotes | of |
| T20595 | 29665-29669 | NN | denotes | RPS3 |
| T20596 | 29670-29674 | VB | denotes | were |
| T20597 | 29675-29684 | VB | denotes | generated |
| T20598 | 29685-29687 | IN | denotes | by |
| T20599 | 29688-29701 | JJ | denotes | site-directed |
| T20600 | 29702-29713 | NN | denotes | mutagenesis |
| T20601 | 29714-29719 | VB | denotes | using |
| T20602 | 29720-29723 | DT | denotes | the |
| T20603 | 29724-29729 | NNP | denotes | Quick |
| T20604 | 29730-29736 | NNP | denotes | Change |
| T20605 | 29737-29740 | NN | denotes | Kit |
| T20606 | 29741-29742 | -LRB- | denotes | ( |
| T20607 | 29742-29752 | NN | denotes | Stratagene |
| T20608 | 29752-29753 | -RRB- | denotes | ) |
| T20609 | 29754-29758 | IN | denotes | with |
| T20610 | 29759-29766 | NN | denotes | primers |
| T20611 | 29767-29774 | RB | denotes | forward |
| T20612 | 29775-29814 | JJ | denotes | 5′-CTGCCTGACCACGTGGCCATTGTGGAACCCAAA-3′ |
| T20613 | 29815-29818 | CC | denotes | and |
| T20614 | 29819-29826 | JJ | denotes | reverse |
| T20615 | 29827-29866 | NN | denotes | 5′-TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3′ |
| T20616 | 29867-29870 | IN | denotes | for |
| T20617 | 29871-29876 | NN | denotes | S209A |
| T20618 | 29878-29881 | DT | denotes | All |
| T20619 | 29882-29889 | NN | denotes | mutants |
| T20620 | 29890-29894 | VB | denotes | were |
| T20621 | 29895-29903 | VB | denotes | verified |
| T20622 | 29904-29906 | IN | denotes | by |
| T20623 | 29907-29910 | NN | denotes | DNA |
| T20624 | 29911-29921 | NN | denotes | sequencing |
| T20847 | 29924-29927 | NN | denotes | 32P |
| T20848 | 29928-29930 | FW | denotes | in |
| T20849 | 29931-29935 | FW | denotes | vivo |
| T20850 | 29936-29944 | NN | denotes | Labeling |
| T20851 | 29945-29948 | NN | denotes | HEK |
| T20852 | 29949-29953 | NN | denotes | 293T |
| T20853 | 29954-29959 | NN | denotes | cells |
| T20854 | 29960-29964 | VB | denotes | were |
| T20855 | 29965-29972 | VB | denotes | labeled |
| T20856 | 29973-29977 | IN | denotes | with |
| T20857 | 29978-29979 | CD | denotes | 2 |
| T20858 | 29980-29986 | NN | denotes | mCi/ml |
| T20859 | 29987-30005 | NN | denotes | 32P-orthophosphate |
| T20860 | 30006-30007 | -LRB- | denotes | ( |
| T20861 | 30007-30013 | NNP | denotes | Perkin |
| T20862 | 30014-30019 | NNP | denotes | Elmer |
| T20863 | 30019-30020 | -RRB- | denotes | ) |
| T20864 | 30021-30023 | IN | denotes | in |
| T20865 | 30024-30038 | JJ | denotes | phosphate-free |
| T20866 | 30039-30045 | NN | denotes | medium |
| T20867 | 30046-30047 | -LRB- | denotes | ( |
| T20868 | 30047-30057 | NN | denotes | Invitrogen |
| T20869 | 30057-30058 | -RRB- | denotes | ) |
| T20870 | 30059-30062 | IN | denotes | for |
| T20871 | 30063-30064 | CD | denotes | 2 |
| T20872 | 30065-30066 | NN | denotes | h |
| T20873 | 30068-30073 | NN | denotes | Cells |
| T20874 | 30074-30078 | VB | denotes | were |
| T20875 | 30079-30083 | RB | denotes | then |
| T20876 | 30084-30088 | VB | denotes | left |
| T20877 | 30089-30098 | JJ | denotes | untreated |
| T20878 | 30099-30101 | CC | denotes | or |
| T20879 | 30102-30109 | VB | denotes | treated |
| T20880 | 30110-30114 | IN | denotes | with |
| T20881 | 30115-30118 | NN | denotes | TNF |
| T20882 | 30119-30120 | -LRB- | denotes | ( |
| T20883 | 30120-30122 | CD | denotes | 50 |
| T20884 | 30123-30128 | NN | denotes | ng/ml |
| T20885 | 30128-30129 | -COMMA- | denotes | , |
| T20886 | 30130-30131 | NNP | denotes | R |
| T20887 | 30131-30132 | CC | denotes | & |
| T20888 | 30132-30133 | NNP | denotes | D |
| T20889 | 30134-30141 | NNP | denotes | Systems |
| T20890 | 30141-30142 | -RRB- | denotes | ) |
| T20891 | 30143-30146 | IN | denotes | for |
| T20892 | 30147-30156 | VB | denotes | indicated |
| T20893 | 30157-30164 | NN | denotes | periods |
| T20894 | 30166-30170 | NN | denotes | Cell |
| T20895 | 30171-30178 | NN | denotes | lysates |
| T20896 | 30179-30183 | VB | denotes | were |
| T20897 | 30184-30192 | VB | denotes | prepared |
| T20898 | 30193-30196 | CC | denotes | and |
| T20899 | 30197-30201 | VB | denotes | used |
| T20900 | 30202-30205 | IN | denotes | for |
| T20901 | 30206-30226 | NN | denotes | immunoprecipitations |
| T20902 | 30227-30231 | IN | denotes | with |
| T20903 | 30232-30236 | NN | denotes | RPS3 |
| T20904 | 30237-30245 | NN | denotes | antibody |
| T20995 | 30248-30250 | IN | denotes | In |
| T20996 | 30251-30256 | NNP | denotes | Vitro |
| T20997 | 30257-30263 | NNP | denotes | Kinase |
| T20998 | 30264-30269 | NNP | denotes | Assay |
| T20999 | 30270-30283 | JJ | denotes | Kinase-active |
| T21000 | 30284-30295 | JJ | denotes | recombinant |
| T21001 | 30296-30300 | NN | denotes | IKKβ |
| T21002 | 30301-30304 | CC | denotes | and |
| T21003 | 30305-30309 | NN | denotes | IKKα |
| T21004 | 30310-30318 | NN | denotes | proteins |
| T21005 | 30319-30323 | VB | denotes | were |
| T21006 | 30324-30333 | VB | denotes | purchased |
| T21007 | 30334-30338 | IN | denotes | from |
| T21008 | 30339-30345 | JJ | denotes | Active |
| T21009 | 30346-30351 | NNP | denotes | Motif |
| T21010 | 30352-30355 | CC | denotes | and |
| T21011 | 30356-30365 | NNP | denotes | Millipore |
| T21012 | 30365-30366 | -COMMA- | denotes | , |
| T21013 | 30367-30379 | RB | denotes | respectively |
| T21014 | 30381-30392 | RB | denotes | Bacterially |
| T21015 | 30393-30401 | VB | denotes | purified |
| T21016 | 30402-30413 | NN | denotes | glutathione |
| T21017 | 30414-30427 | NN | denotes | S-transferase |
| T21018 | 30428-30429 | -LRB- | denotes | ( |
| T21019 | 30429-30432 | NN | denotes | GST |
| T21020 | 30432-30433 | -RRB- | denotes | ) |
| T21021 | 30433-30434 | -COMMA- | denotes | , |
| T21022 | 30435-30443 | NN | denotes | GST-IκBα |
| T21023 | 30444-30445 | -LRB- | denotes | ( |
| T21024 | 30445-30449 | CD | denotes | 1-54 |
| T21025 | 30449-30450 | -RRB- | denotes | ) |
| T21026 | 30450-30451 | -COMMA- | denotes | , |
| T21027 | 30452-30456 | JJ | denotes | wild |
| T21028 | 30457-30461 | NN | denotes | type |
| T21029 | 30461-30462 | -COMMA- | denotes | , |
| T21030 | 30463-30469 | JJ | denotes | mutant |
| T21031 | 30470-30478 | NN | denotes | GST-RPS3 |
| T21032 | 30478-30479 | -COMMA- | denotes | , |
| T21033 | 30480-30482 | CC | denotes | or |
| T21034 | 30483-30487 | NN | denotes | RPS3 |
| T21035 | 30488-30496 | NN | denotes | proteins |
| T21036 | 30497-30501 | VB | denotes | were |
| T21037 | 30502-30506 | VB | denotes | used |
| T21038 | 30507-30509 | IN | denotes | as |
| T21039 | 30510-30520 | NN | denotes | substrates |
| T21040 | 30522-30525 | DT | denotes | The |
| T21041 | 30526-30528 | FW | denotes | in |
| T21042 | 30529-30534 | FW | denotes | vitro |
| T21043 | 30535-30541 | NN | denotes | kinase |
| T21044 | 30542-30547 | NN | denotes | assay |
| T21045 | 30548-30551 | VB | denotes | was |
| T21046 | 30552-30561 | VB | denotes | performed |
| T21047 | 30562-30564 | IN | denotes | as |
| T21048 | 30565-30575 | RB | denotes | previously |
| T21049 | 30576-30587 | NN | denotes | described29 |
| T21050 | 30589-30596 | RB | denotes | Briefly |
| T21051 | 30596-30597 | -COMMA- | denotes | , |
| T21052 | 30598-30604 | NN | denotes | enzyme |
| T21053 | 30605-30606 | -LRB- | denotes | ( |
| T21054 | 30606-30609 | CD | denotes | 100 |
| T21055 | 30610-30612 | NN | denotes | ng |
| T21056 | 30612-30613 | -RRB- | denotes | ) |
| T21057 | 30614-30617 | CC | denotes | and |
| T21058 | 30618-30627 | NN | denotes | substrate |
| T21059 | 30628-30629 | -LRB- | denotes | ( |
| T21060 | 30629-30630 | CD | denotes | 2 |
| T21061 | 30631-30633 | NN | denotes | μg |
| T21062 | 30633-30634 | -RRB- | denotes | ) |
| T21063 | 30635-30639 | VB | denotes | were |
| T21064 | 30640-30652 | VB | denotes | co-incubated |
| T21065 | 30653-30655 | IN | denotes | in |
| T21066 | 30656-30659 | NN | denotes | IKK |
| T21067 | 30660-30668 | NN | denotes | reaction |
| T21068 | 30669-30675 | NN | denotes | buffer |
| T21069 | 30676-30677 | -LRB- | denotes | ( |
| T21070 | 30677-30679 | CD | denotes | 25 |
| T21071 | 30680-30682 | NN | denotes | mM |
| T21072 | 30683-30691 | NN | denotes | Tris–HCl |
| T21073 | 30692-30693 | -LRB- | denotes | [ |
| T21074 | 30693-30695 | NN | denotes | pH |
| T21075 | 30696-30699 | CD | denotes | 8.0 |
| T21076 | 30699-30700 | -RRB- | denotes | ] |
| T21077 | 30700-30701 | -COMMA- | denotes | , |
| T21078 | 30702-30704 | CD | denotes | 50 |
| T21079 | 30705-30707 | NN | denotes | mM |
| T21080 | 30708-30711 | NN | denotes | KCl |
| T21081 | 30711-30712 | -COMMA- | denotes | , |
| T21082 | 30713-30715 | CD | denotes | 10 |
| T21083 | 30716-30718 | NN | denotes | mM |
| T21084 | 30719-30724 | NN | denotes | MgCl2 |
| T21085 | 30724-30725 | -COMMA- | denotes | , |
| T21086 | 30726-30727 | CD | denotes | 1 |
| T21087 | 30728-30730 | NN | denotes | mM |
| T21088 | 30731-30734 | NN | denotes | DTT |
| T21089 | 30734-30735 | -COMMA- | denotes | , |
| T21090 | 30736-30737 | CD | denotes | 1 |
| T21091 | 30738-30740 | NN | denotes | mM |
| T21092 | 30741-30747 | NN | denotes | Na3VO4 |
| T21093 | 30747-30748 | -COMMA- | denotes | , |
| T21094 | 30749-30750 | CD | denotes | 1 |
| T21095 | 30751-30753 | NN | denotes | mM |
| T21096 | 30754-30757 | NN | denotes | ATP |
| T21097 | 30757-30758 | -RRB- | denotes | ) |
| T21098 | 30759-30761 | CC | denotes | or |
| T21099 | 30762-30767 | NN | denotes | NleH1 |
| T21100 | 30768-30776 | NN | denotes | reaction |
| T21101 | 30777-30783 | NN | denotes | buffer |
| T21102 | 30784-30785 | -LRB- | denotes | ( |
| T21103 | 30785-30787 | CD | denotes | 50 |
| T21104 | 30788-30790 | NN | denotes | mM |
| T21105 | 30791-30799 | NN | denotes | Tris-HCl |
| T21106 | 30800-30801 | -LRB- | denotes | [ |
| T21107 | 30801-30803 | NN | denotes | pH |
| T21108 | 30804-30807 | CD | denotes | 7.6 |
| T21109 | 30807-30808 | -RRB- | denotes | ] |
| T21110 | 30808-30809 | -COMMA- | denotes | , |
| T21111 | 30810-30811 | CD | denotes | 5 |
| T21112 | 30812-30814 | NN | denotes | mM |
| T21113 | 30815-30820 | NN | denotes | MgCl2 |
| T21114 | 30820-30821 | -COMMA- | denotes | , |
| T21115 | 30822-30823 | CD | denotes | 1 |
| T21116 | 30824-30826 | NN | denotes | mM |
| T21117 | 30827-30830 | NN | denotes | DTT |
| T21118 | 30830-30831 | -COMMA- | denotes | , |
| T21119 | 30832-30833 | CD | denotes | 1 |
| T21120 | 30834-30836 | NN | denotes | mM |
| T21121 | 30837-30840 | NN | denotes | ATP |
| T21122 | 30840-30841 | -RRB- | denotes | ) |
| T21123 | 30842-30846 | IN | denotes | with |
| T21124 | 30847-30850 | CD | denotes | 0.5 |
| T21125 | 30851-30854 | NNP | denotes | μCi |
| T21126 | 30855-30864 | NN | denotes | 32P-γ-ATP |
| T21127 | 30865-30866 | -LRB- | denotes | ( |
| T21128 | 30866-30868 | NNP | denotes | GE |
| T21129 | 30869-30879 | NNP | denotes | Healthcare |
| T21130 | 30879-30880 | -RRB- | denotes | ) |
| T21131 | 30881-30886 | VB | denotes | added |
| T21132 | 30887-30889 | IN | denotes | at |
| T21133 | 30890-30892 | CD | denotes | 37 |
| T21134 | 30893-30895 | NN | denotes | °C |
| T21135 | 30896-30899 | IN | denotes | for |
| T21136 | 30900-30902 | CD | denotes | 30 |
| T21137 | 30903-30906 | NN | denotes | min |
| T21138 | 30908-30911 | DT | denotes | The |
| T21139 | 30912-30921 | NN | denotes | reactions |
| T21140 | 30922-30926 | VB | denotes | were |
| T21141 | 30927-30935 | VB | denotes | resolved |
| T21142 | 30936-30938 | IN | denotes | by |
| T21143 | 30939-30947 | NN | denotes | SDS–PAGE |
| T21144 | 30948-30951 | CC | denotes | and |
| T21145 | 30952-30962 | VB | denotes | visualized |
| T21146 | 30963-30965 | IN | denotes | by |
| T21147 | 30966-30981 | NN | denotes | autoradiography |
| T21367 | 30984-30992 | NN | denotes | LC-MS/MS |
| T21368 | 30993-31001 | NN | denotes | Analysis |
| T21369 | 31002-31005 | NN | denotes | GST |
| T21370 | 31006-31008 | CC | denotes | or |
| T21371 | 31009-31017 | NN | denotes | GST-RPS3 |
| T21372 | 31018-31021 | VB | denotes | was |
| T21373 | 31022-31031 | VB | denotes | incubated |
| T21374 | 31032-31036 | IN | denotes | with |
| T21375 | 31037-31048 | JJ | denotes | recombinant |
| T21376 | 31049-31053 | NN | denotes | IKKβ |
| T21377 | 31054-31061 | NN | denotes | protein |
| T21378 | 31062-31064 | IN | denotes | as |
| T21379 | 31065-31074 | VB | denotes | described |
| T21380 | 31075-31080 | IN | denotes | above |
| T21381 | 31081-31083 | IN | denotes | in |
| T21382 | 31084-31086 | DT | denotes | an |
| T21383 | 31087-31089 | FW | denotes | in |
| T21384 | 31090-31095 | FW | denotes | vitro |
| T21385 | 31096-31102 | NN | denotes | kinase |
| T21386 | 31103-31108 | NN | denotes | assay |
| T21387 | 31109-31117 | NN | denotes | reaction |
| T21388 | 31118-31127 | VB | denotes | conducted |
| T21389 | 31128-31135 | IN | denotes | without |
| T21390 | 31136-31145 | NN | denotes | 32P-γ-ATP |
| T21391 | 31146-31154 | NN | denotes | labeling |
| T21392 | 31156-31159 | DT | denotes | The |
| T21393 | 31160-31168 | NN | denotes | reaction |
| T21394 | 31169-31172 | VB | denotes | was |
| T21395 | 31173-31182 | VB | denotes | separated |
| T21396 | 31183-31185 | IN | denotes | by |
| T21397 | 31186-31194 | NN | denotes | SDS-PAGE |
| T21398 | 31194-31195 | -COMMA- | denotes | , |
| T21399 | 31196-31199 | CC | denotes | and |
| T21400 | 31200-31203 | DT | denotes | the |
| T21401 | 31204-31211 | NN | denotes | protein |
| T21402 | 31212-31215 | NN | denotes | gel |
| T21403 | 31216-31219 | VB | denotes | was |
| T21404 | 31220-31227 | VB | denotes | stained |
| T21405 | 31228-31232 | IN | denotes | with |
| T21406 | 31233-31242 | NNP | denotes | Colloidal |
| T21407 | 31243-31247 | NNP | denotes | Blue |
| T21408 | 31248-31249 | -LRB- | denotes | ( |
| T21409 | 31249-31259 | NN | denotes | Invitrogen |
| T21410 | 31259-31260 | -RRB- | denotes | ) |
| T21411 | 31262-31265 | DT | denotes | The |
| T21412 | 31266-31279 | VB | denotes | corresponding |
| T21413 | 31280-31287 | NN | denotes | protein |
| T21414 | 31288-31297 | NN | denotes | fragments |
| T21415 | 31298-31302 | VB | denotes | were |
| T21416 | 31303-31310 | VB | denotes | excised |
| T21417 | 31311-31314 | CC | denotes | and |
| T21418 | 31315-31324 | VB | denotes | subjected |
| T21419 | 31325-31327 | TO | denotes | to |
| T21420 | 31328-31335 | NN | denotes | trypsin |
| T21421 | 31336-31345 | NN | denotes | digestion |
| T21422 | 31346-31349 | CC | denotes | and |
| T21423 | 31350-31358 | NN | denotes | LC-MS/MS |
| T21424 | 31359-31361 | IN | denotes | at |
| T21425 | 31362-31365 | DT | denotes | the |
| T21426 | 31366-31370 | NNP | denotes | Yale |
| T21427 | 31371-31377 | NNP | denotes | Cancer |
| T21428 | 31378-31384 | NNP | denotes | Center |
| T21429 | 31385-31389 | NNP | denotes | Mass |
| T21430 | 31390-31402 | NNP | denotes | Spectrometry |
| T21431 | 31403-31411 | NNP | denotes | Resource |
| T21432 | 31412-31413 | -LRB- | denotes | ( |
| T21433 | 31413-31416 | NNP | denotes | New |
| T21434 | 31417-31422 | NNP | denotes | Haven |
| T21435 | 31422-31423 | -COMMA- | denotes | , |
| T21436 | 31424-31426 | NN | denotes | CT |
| T21437 | 31426-31427 | -RRB- | denotes | ) |
| T21551 | 31430-31434 | NN | denotes | RNAi |
| T21552 | 31435-31438 | CC | denotes | and |
| T21553 | 31439-31451 | NN | denotes | Transfection |
| T21554 | 31452-31455 | DT | denotes | The |
| T21555 | 31456-31461 | NN | denotes | siRNA |
| T21556 | 31462-31463 | -LRB- | denotes | ( |
| T21557 | 31463-31475 | JJ | denotes | sense-strand |
| T21558 | 31476-31484 | NN | denotes | sequence |
| T21559 | 31484-31485 | -RRB- | denotes | ) |
| T21560 | 31486-31490 | NN | denotes | IKKα |
| T21561 | 31490-31491 | -COMMA- | denotes | , |
| T21562 | 31492-31520 | NN | denotes | 5′-AUGACAGAGAAUGAUCAUGUUCUGC |
| T21563 | 31521-31524 | NN | denotes | -3′ |
| T21564 | 31524-31525 | -COLON- | denotes | ; |
| T21565 | 31526-31530 | NN | denotes | IKKβ |
| T21566 | 31530-31531 | -COMMA- | denotes | , |
| T21567 | 31532-31560 | NN | denotes | 5′-GCAGCAAGGAGAACAGAGGUUAAUA |
| T21568 | 31561-31564 | CD | denotes | -3′ |
| T21569 | 31564-31565 | -COLON- | denotes | ; |
| T21570 | 31566-31570 | NN | denotes | IκBα |
| T21571 | 31570-31571 | -COMMA- | denotes | , |
| T21572 | 31572-31600 | NN | denotes | 5′-GAGCUCCGAGACUUUCGAGGAAAUA |
| T21573 | 31601-31604 | NN | denotes | -3′ |
| T21574 | 31604-31605 | -COLON- | denotes | ; |
| T21575 | 31606-31613 | NN | denotes | RPS3-3′ |
| T21576 | 31614-31617 | NN | denotes | UTR |
| T21577 | 31617-31618 | -COMMA- | denotes | , |
| T21578 | 31619-31643 | NN | denotes | 5′-GGAUGUUGCUCUCUAAAGACC |
| T21579 | 31644-31647 | NN | denotes | -3′ |
| T21580 | 31648-31649 | -LRB- | denotes | ( |
| T21581 | 31649-31659 | NN | denotes | Invitrogen |
| T21582 | 31659-31660 | -RRB- | denotes | ) |
| T21583 | 31662-31671 | JJ | denotes | Transient |
| T21584 | 31672-31684 | NN | denotes | transfection |
| T21585 | 31685-31687 | IN | denotes | of |
| T21586 | 31688-31693 | NN | denotes | siRNA |
| T21587 | 31694-31697 | CC | denotes | and |
| T21588 | 31698-31701 | NN | denotes | DNA |
| T21589 | 31702-31712 | NN | denotes | constructs |
| T21590 | 31713-31717 | IN | denotes | into |
| T21591 | 31718-31724 | NN | denotes | Jurkat |
| T21592 | 31725-31730 | NN | denotes | cells |
| T21593 | 31731-31734 | CC | denotes | and |
| T21594 | 31735-31739 | NN | denotes | 293T |
| T21595 | 31740-31745 | NN | denotes | cells |
| T21596 | 31746-31749 | VB | denotes | was |
| T21597 | 31750-31759 | VB | denotes | described |
| T21598 | 31760-31771 | NN | denotes | previously6 |
| T21712 | 31774-31785 | JJ | denotes | Subcellular |
| T21713 | 31786-31799 | NN | denotes | Fractionation |
| T21714 | 31800-31811 | JJ | denotes | Subcellular |
| T21715 | 31812-31825 | NN | denotes | fractionation |
| T21716 | 31826-31829 | VB | denotes | was |
| T21717 | 31830-31839 | VB | denotes | performed |
| T21718 | 31840-31842 | IN | denotes | by |
| T21719 | 31843-31855 | JJ | denotes | differential |
| T21720 | 31856-31870 | NN | denotes | centrifugation |
| T21721 | 31871-31873 | IN | denotes | as |
| T21722 | 31874-31884 | RB | denotes | previously |
| T21723 | 31885-31895 | NN | denotes | described6 |
| T21724 | 31897-31904 | RB | denotes | Briefly |
| T21725 | 31904-31905 | -COMMA- | denotes | , |
| T21726 | 31906-31911 | NN | denotes | cells |
| T21727 | 31912-31916 | VB | denotes | were |
| T21728 | 31917-31928 | VB | denotes | resuspended |
| T21729 | 31929-31931 | IN | denotes | in |
| T21730 | 31932-31940 | JJ | denotes | ice-cold |
| T21731 | 31941-31947 | NN | denotes | Buffer |
| T21732 | 31948-31949 | NN | denotes | A |
| T21733 | 31950-31951 | -LRB- | denotes | ( |
| T21734 | 31951-31953 | CD | denotes | 10 |
| T21735 | 31954-31956 | NN | denotes | mM |
| T21736 | 31957-31962 | NN | denotes | HEPES |
| T21737 | 31963-31965 | NN | denotes | pH |
| T21738 | 31966-31969 | CD | denotes | 7.9 |
| T21739 | 31969-31970 | -COMMA- | denotes | , |
| T21740 | 31971-31973 | CD | denotes | 10 |
| T21741 | 31974-31976 | NN | denotes | mM |
| T21742 | 31977-31980 | NN | denotes | KCl |
| T21743 | 31980-31981 | -COMMA- | denotes | , |
| T21744 | 31982-31985 | CD | denotes | 1.5 |
| T21745 | 31986-31988 | NN | denotes | mM |
| T21746 | 31989-31994 | NN | denotes | MgCl2 |
| T21747 | 31994-31995 | -COMMA- | denotes | , |
| T21748 | 31996-31999 | CD | denotes | 0.1 |
| T21749 | 32000-32002 | NN | denotes | mM |
| T21750 | 32003-32007 | NN | denotes | EDTA |
| T21751 | 32007-32008 | -COMMA- | denotes | , |
| T21752 | 32009-32012 | CD | denotes | 0.5 |
| T21753 | 32013-32015 | NN | denotes | mM |
| T21754 | 32016-32019 | NN | denotes | DTT |
| T21755 | 32019-32020 | -COMMA- | denotes | , |
| T21756 | 32021-32024 | CD | denotes | 0.4 |
| T21757 | 32025-32026 | NN | denotes | % |
| T21758 | 32027-32032 | NN | denotes | NP-40 |
| T21759 | 32032-32033 | -COMMA- | denotes | , |
| T21760 | 32034-32037 | CD | denotes | 0.5 |
| T21761 | 32038-32040 | NN | denotes | mM |
| T21762 | 32041-32045 | NN | denotes | PMSF |
| T21763 | 32045-32046 | -COMMA- | denotes | , |
| T21764 | 32047-32055 | JJ | denotes | complete |
| T21765 | 32056-32064 | NN | denotes | protease |
| T21766 | 32065-32074 | NN | denotes | inhibitor |
| T21767 | 32075-32083 | NN | denotes | cocktail |
| T21768 | 32083-32084 | -RRB- | denotes | ) |
| T21769 | 32085-32087 | IN | denotes | at |
| T21770 | 32088-32089 | CD | denotes | 4 |
| T21771 | 32090-32092 | NN | denotes | °C |
| T21772 | 32093-32096 | IN | denotes | for |
| T21773 | 32097-32098 | CD | denotes | 5 |
| T21774 | 32099-32102 | NN | denotes | min |
| T21775 | 32104-32111 | NN | denotes | Lysates |
| T21776 | 32112-32116 | VB | denotes | were |
| T21777 | 32117-32128 | VB | denotes | centrifuged |
| T21778 | 32129-32131 | IN | denotes | at |
| T21779 | 32132-32133 | CD | denotes | 4 |
| T21780 | 32134-32136 | NN | denotes | °C |
| T21781 | 32136-32137 | -COMMA- | denotes | , |
| T21782 | 32138-32141 | CD | denotes | 500 |
| T21783 | 32142-32143 | SYM | denotes | × |
| T21784 | 32144-32145 | NN | denotes | g |
| T21785 | 32146-32149 | IN | denotes | for |
| T21786 | 32150-32151 | CD | denotes | 3 |
| T21787 | 32152-32155 | NN | denotes | min |
| T21788 | 32155-32156 | -COMMA- | denotes | , |
| T21789 | 32157-32160 | CC | denotes | and |
| T21790 | 32161-32173 | NN | denotes | supernatants |
| T21791 | 32174-32178 | VB | denotes | were |
| T21792 | 32179-32188 | VB | denotes | collected |
| T21793 | 32189-32191 | IN | denotes | as |
| T21794 | 32192-32201 | JJ | denotes | cytosolic |
| T21795 | 32202-32211 | NN | denotes | fractions |
| T21796 | 32213-32220 | NN | denotes | Pellets |
| T21797 | 32221-32225 | VB | denotes | were |
| T21798 | 32226-32235 | VB | denotes | incubated |
| T21799 | 32236-32238 | IN | denotes | in |
| T21800 | 32239-32245 | NNP | denotes | Buffer |
| T21801 | 32246-32247 | NNP | denotes | C |
| T21802 | 32248-32249 | -LRB- | denotes | ( |
| T21803 | 32249-32251 | CD | denotes | 20 |
| T21804 | 32252-32254 | NN | denotes | mM |
| T21805 | 32255-32260 | NN | denotes | HEPES |
| T21806 | 32261-32266 | NN | denotes | pH7.9 |
| T21807 | 32266-32267 | -COMMA- | denotes | , |
| T21808 | 32268-32271 | CD | denotes | 420 |
| T21809 | 32272-32274 | NN | denotes | mM |
| T21810 | 32275-32279 | NN | denotes | NaCl |
| T21811 | 32279-32280 | -COMMA- | denotes | , |
| T21812 | 32281-32284 | CD | denotes | 1.5 |
| T21813 | 32285-32287 | NN | denotes | mM |
| T21814 | 32288-32293 | NN | denotes | MgCl2 |
| T21815 | 32293-32294 | -COMMA- | denotes | , |
| T21816 | 32295-32297 | CD | denotes | 25 |
| T21817 | 32297-32298 | NN | denotes | % |
| T21818 | 32299-32307 | NN | denotes | glycerol |
| T21819 | 32307-32308 | -COMMA- | denotes | , |
| T21820 | 32309-32312 | CD | denotes | 0.5 |
| T21821 | 32313-32315 | NN | denotes | mM |
| T21822 | 32316-32320 | NN | denotes | PMSF |
| T21823 | 32320-32321 | -COMMA- | denotes | , |
| T21824 | 32322-32325 | CD | denotes | 0.2 |
| T21825 | 32326-32328 | NN | denotes | mM |
| T21826 | 32329-32333 | NN | denotes | EDTA |
| T21827 | 32333-32334 | -COMMA- | denotes | , |
| T21828 | 32335-32338 | CD | denotes | 0.5 |
| T21829 | 32339-32341 | NN | denotes | mM |
| T21830 | 32342-32345 | NN | denotes | DTT |
| T21831 | 32345-32346 | -COMMA- | denotes | , |
| T21832 | 32347-32355 | JJ | denotes | complete |
| T21833 | 32356-32364 | NN | denotes | protease |
| T21834 | 32365-32374 | NN | denotes | inhibitor |
| T21835 | 32375-32383 | NN | denotes | cocktail |
| T21836 | 32383-32384 | -RRB- | denotes | ) |
| T21837 | 32385-32387 | IN | denotes | at |
| T21838 | 32388-32389 | CD | denotes | 4 |
| T21839 | 32390-32392 | NN | denotes | °C |
| T21840 | 32393-32396 | IN | denotes | for |
| T21841 | 32397-32399 | CD | denotes | 10 |
| T21842 | 32400-32403 | NN | denotes | min |
| T21843 | 32405-32417 | NN | denotes | Supernatants |
| T21844 | 32418-32422 | VB | denotes | were |
| T21845 | 32423-32432 | VB | denotes | collected |
| T21846 | 32433-32435 | IN | denotes | as |
| T21847 | 32436-32443 | JJ | denotes | nuclear |
| T21848 | 32444-32453 | NN | denotes | fractions |
| T21849 | 32454-32463 | VB | denotes | following |
| T21850 | 32464-32465 | DT | denotes | a |
| T21851 | 32466-32476 | NN | denotes | centrifuge |
| T21852 | 32477-32479 | IN | denotes | at |
| T21853 | 32480-32481 | CD | denotes | 4 |
| T21854 | 32482-32484 | NN | denotes | °C |
| T21855 | 32484-32485 | -COMMA- | denotes | , |
| T21856 | 32486-32492 | CD | denotes | 13,800 |
| T21857 | 32493-32494 | SYM | denotes | × |
| T21858 | 32495-32496 | NN | denotes | g |
| T21859 | 32497-32500 | IN | denotes | for |
| T21860 | 32501-32503 | CD | denotes | 10 |
| T21861 | 32504-32507 | NN | denotes | min |
| T22041 | 32510-32520 | NNP | denotes | Luciferase |
| T22042 | 32521-32529 | NNP | denotes | Reporter |
| T22043 | 32530-32534 | NNP | denotes | Gene |
| T22044 | 32535-32541 | NN | denotes | Assays |
| T22045 | 32542-32552 | NN | denotes | Luciferase |
| T22046 | 32553-32561 | NN | denotes | reporter |
| T22047 | 32562-32566 | NN | denotes | gene |
| T22048 | 32567-32573 | NN | denotes | assays |
| T22049 | 32574-32578 | VB | denotes | were |
| T22050 | 32579-32588 | VB | denotes | performed |
| T22051 | 32589-32591 | IN | denotes | as |
| T22052 | 32592-32602 | RB | denotes | previously |
| T22053 | 32603-32613 | NN | denotes | described6 |
| T22054 | 32615-32622 | RB | denotes | Briefly |
| T22055 | 32622-32623 | -COMMA- | denotes | , |
| T22056 | 32624-32629 | NN | denotes | cells |
| T22057 | 32630-32634 | VB | denotes | were |
| T22058 | 32635-32648 | VB | denotes | cotransfected |
| T22059 | 32649-32651 | IN | denotes | at |
| T22060 | 32652-32653 | DT | denotes | a |
| T22061 | 32654-32659 | NN | denotes | ratio |
| T22062 | 32660-32662 | IN | denotes | of |
| T22063 | 32663-32665 | CD | denotes | 10 |
| T22064 | 32665-32666 | -COLON- | denotes | : |
| T22065 | 32666-32667 | CD | denotes | 1 |
| T22066 | 32668-32672 | IN | denotes | with |
| T22067 | 32673-32680 | JJ | denotes | various |
| T22068 | 32681-32696 | JJ | denotes | promoter-driven |
| T22069 | 32697-32704 | NN | denotes | firefly |
| T22070 | 32705-32715 | NN | denotes | luciferase |
| T22071 | 32716-32726 | NN | denotes | constructs |
| T22072 | 32727-32729 | TO | denotes | to |
| T22073 | 32730-32733 | DT | denotes | the |
| T22074 | 32734-32741 | NNP | denotes | Renilla |
| T22075 | 32742-32752 | NN | denotes | luciferase |
| T22076 | 32753-32758 | NN | denotes | pTKRL |
| T22077 | 32759-32766 | NN | denotes | plasmid |
| T22078 | 32766-32767 | -COMMA- | denotes | , |
| T22079 | 32768-32776 | RB | denotes | together |
| T22080 | 32777-32781 | IN | denotes | with |
| T22081 | 32782-32791 | VB | denotes | indicated |
| T22082 | 32792-32800 | NN | denotes | plasmids |
| T22083 | 32802-32807 | NN | denotes | Cells |
| T22084 | 32808-32812 | VB | denotes | were |
| T22085 | 32813-32821 | VB | denotes | cultured |
| T22086 | 32822-32825 | IN | denotes | for |
| T22087 | 32826-32829 | CD | denotes | 1–2 |
| T22088 | 32830-32834 | NN | denotes | days |
| T22089 | 32835-32838 | CC | denotes | and |
| T22090 | 32839-32843 | RB | denotes | then |
| T22091 | 32844-32854 | VB | denotes | stimulated |
| T22092 | 32855-32857 | IN | denotes | in |
| T22093 | 32858-32868 | NN | denotes | triplicate |
| T22094 | 32869-32875 | IN | denotes | before |
| T22095 | 32876-32883 | NN | denotes | harvest |
| T22096 | 32885-32892 | NN | denotes | Lysates |
| T22097 | 32893-32897 | VB | denotes | were |
| T22098 | 32898-32906 | VB | denotes | analyzed |
| T22099 | 32907-32912 | VB | denotes | using |
| T22100 | 32913-32916 | DT | denotes | the |
| T22101 | 32917-32932 | NN | denotes | Dual-Luciferase |
| T22102 | 32933-32936 | NN | denotes | Kit |
| T22103 | 32937-32938 | -LRB- | denotes | ( |
| T22104 | 32938-32945 | NN | denotes | Promega |
| T22105 | 32945-32946 | -RRB- | denotes | ) |
| T22217 | 32949-32958 | NN | denotes | Chromatin |
| T22218 | 32959-32978 | NN | denotes | Immunoprecipitation |
| T22219 | 32979-32980 | -LRB- | denotes | ( |
| T22220 | 32980-32984 | NN | denotes | ChIP |
| T22221 | 32984-32985 | -RRB- | denotes | ) |
| T22222 | 32986-32990 | NN | denotes | ChIP |
| T22223 | 32991-32997 | NN | denotes | assays |
| T22224 | 32998-33001 | VB | denotes | was |
| T22225 | 33002-33011 | VB | denotes | performed |
| T22226 | 33012-33014 | IN | denotes | as |
| T22227 | 33015-33025 | RB | denotes | previously |
| T22228 | 33026-33036 | NN | denotes | described6 |
| T22229 | 33038-33041 | DT | denotes | The |
| T22230 | 33042-33049 | NN | denotes | primers |
| T22231 | 33050-33054 | VB | denotes | used |
| T22232 | 33055-33057 | TO | denotes | to |
| T22233 | 33058-33065 | VB | denotes | amplify |
| T22234 | 33066-33069 | DT | denotes | the |
| T22235 | 33070-33078 | NN | denotes | promoter |
| T22236 | 33079-33085 | NN | denotes | region |
| T22237 | 33086-33094 | JJ | denotes | adjacent |
| T22238 | 33095-33097 | TO | denotes | to |
| T22239 | 33098-33101 | DT | denotes | the |
| T22240 | 33102-33104 | NN | denotes | κB |
| T22241 | 33105-33110 | NN | denotes | sites |
| T22242 | 33111-33113 | IN | denotes | of |
| T22243 | 33114-33117 | NN | denotes | IL8 |
| T22244 | 33118-33121 | CC | denotes | and |
| T22245 | 33122-33128 | NN | denotes | NFKBIA |
| T22246 | 33128-33129 | -COMMA- | denotes | , |
| T22247 | 33130-33132 | RB | denotes | as |
| T22248 | 33133-33137 | RB | denotes | well |
| T22249 | 33138-33140 | IN | denotes | as |
| T22250 | 33141-33145 | NN | denotes | ACTB |
| T22251 | 33146-33150 | VB | denotes | have |
| T22252 | 33151-33155 | VB | denotes | been |
| T22253 | 33156-33166 | NN | denotes | described6 |
| T22328 | 33169-33187 | NN | denotes | Immunofluorescence |
| T22329 | 33188-33198 | NNP | denotes | Microscopy |
| T22330 | 33199-33207 | JJ | denotes | Confocal |
| T22331 | 33208-33218 | NN | denotes | microscopy |
| T22332 | 33219-33222 | VB | denotes | was |
| T22333 | 33223-33232 | VB | denotes | performed |
| T22334 | 33233-33235 | IN | denotes | as |
| T22335 | 33236-33246 | RB | denotes | previously |
| T22336 | 33247-33257 | NN | denotes | described6 |
| T22337 | 33259-33266 | RB | denotes | Briefly |
| T22338 | 33266-33267 | -COMMA- | denotes | , |
| T22339 | 33268-33273 | NN | denotes | cells |
| T22340 | 33274-33278 | VB | denotes | were |
| T22341 | 33279-33284 | VB | denotes | fixed |
| T22342 | 33285-33289 | IN | denotes | with |
| T22343 | 33290-33291 | CD | denotes | 4 |
| T22344 | 33292-33293 | NN | denotes | % |
| T22345 | 33294-33310 | NN | denotes | paraformaldehyde |
| T22346 | 33311-33313 | IN | denotes | in |
| T22347 | 33314-33317 | NNP | denotes | PBS |
| T22348 | 33318-33321 | CC | denotes | and |
| T22349 | 33322-33326 | RB | denotes | then |
| T22350 | 33327-33335 | NNP | denotes | Cellspin |
| T22351 | 33336-33343 | VB | denotes | mounted |
| T22352 | 33344-33348 | IN | denotes | onto |
| T22353 | 33349-33355 | NN | denotes | slides |
| T22354 | 33357-33360 | DT | denotes | The |
| T22355 | 33361-33366 | VB | denotes | fixed |
| T22356 | 33367-33372 | NN | denotes | cells |
| T22357 | 33373-33377 | VB | denotes | were |
| T22358 | 33378-33382 | RB | denotes | then |
| T22359 | 33383-33396 | VB | denotes | permeabilized |
| T22360 | 33397-33401 | IN | denotes | with |
| T22361 | 33402-33406 | CD | denotes | 0.05 |
| T22362 | 33407-33408 | NN | denotes | % |
| T22363 | 33409-33415 | NN | denotes | Triton |
| T22364 | 33416-33421 | NN | denotes | X-100 |
| T22365 | 33422-33424 | IN | denotes | in |
| T22366 | 33425-33428 | NNP | denotes | PBS |
| T22367 | 33429-33432 | CC | denotes | and |
| T22368 | 33433-33440 | VB | denotes | stained |
| T22369 | 33441-33445 | IN | denotes | with |
| T22370 | 33446-33461 | JJ | denotes | FITC-conjugated |
| T22371 | 33462-33468 | NN | denotes | rabbit |
| T22372 | 33469-33478 | JJ | denotes | anti-RPS3 |
| T22373 | 33479-33489 | NN | denotes | antibodies |
| T22374 | 33490-33491 | -LRB- | denotes | ( |
| T22375 | 33491-33496 | NNP | denotes | Primm |
| T22376 | 33497-33504 | NNP | denotes | Biotech |
| T22377 | 33504-33505 | -RRB- | denotes | ) |
| T22378 | 33505-33506 | -COMMA- | denotes | , |
| T22379 | 33507-33509 | CC | denotes | or |
| T22380 | 33510-33520 | NNP | denotes | AlexaFluor |
| T22381 | 33521-33535 | JJ | denotes | 594-conjugated |
| T22382 | 33536-33539 | NN | denotes | rat |
| T22383 | 33540-33549 | JJ | denotes | anti-Flag |
| T22384 | 33550-33560 | NN | denotes | antibodies |
| T22385 | 33561-33562 | -LRB- | denotes | ( |
| T22386 | 33562-33564 | NN | denotes | BD |
| T22387 | 33564-33565 | -RRB- | denotes | ) |
| T22388 | 33566-33569 | IN | denotes | for |
| T22389 | 33570-33572 | CD | denotes | 40 |
| T22390 | 33573-33576 | NN | denotes | min |
| T22391 | 33577-33585 | RB | denotes | together |
| T22392 | 33586-33590 | IN | denotes | with |
| T22393 | 33591-33592 | CD | denotes | 1 |
| T22394 | 33593-33598 | NN | denotes | μg/ml |
| T22395 | 33599-33601 | IN | denotes | of |
| T22396 | 33602-33609 | NNP | denotes | Hoechst |
| T22397 | 33610-33615 | CD | denotes | 33342 |
| T22398 | 33616-33617 | -LRB- | denotes | ( |
| T22399 | 33617-33622 | NN | denotes | Sigma |
| T22400 | 33622-33623 | -RRB- | denotes | ) |
| T22401 | 33624-33627 | IN | denotes | for |
| T22402 | 33628-33629 | CD | denotes | 5 |
| T22403 | 33630-33633 | NN | denotes | min |
| T22404 | 33634-33636 | IN | denotes | at |
| T22405 | 33637-33639 | CD | denotes | 25 |
| T22406 | 33640-33643 | NNP | denotes | °C. |
| T22407 | 33644-33647 | DT | denotes | The |
| T22408 | 33648-33654 | NN | denotes | slides |
| T22409 | 33655-33659 | VB | denotes | were |
| T22410 | 33660-33664 | RB | denotes | then |
| T22411 | 33665-33671 | VB | denotes | rinsed |
| T22412 | 33672-33676 | IN | denotes | with |
| T22413 | 33677-33680 | NNP | denotes | PBS |
| T22414 | 33681-33686 | CD | denotes | three |
| T22415 | 33687-33692 | NN | denotes | times |
| T22416 | 33693-33696 | CC | denotes | and |
| T22417 | 33697-33702 | NN | denotes | cover |
| T22418 | 33703-33710 | VB | denotes | mounted |
| T22419 | 33711-33714 | IN | denotes | for |
| T22420 | 33715-33727 | NN | denotes | fluorescence |
| T22421 | 33728-33738 | NN | denotes | microscopy |
| T22550 | 33741-33760 | NN | denotes | Immunoprecipitation |
| T22551 | 33761-33764 | CC | denotes | and |
| T22552 | 33765-33775 | NN | denotes | immunoblot |
| T22553 | 33776-33779 | DT | denotes | The |
| T22554 | 33780-33785 | NN | denotes | cells |
| T22555 | 33786-33790 | VB | denotes | were |
| T22556 | 33791-33800 | VB | denotes | harvested |
| T22557 | 33801-33804 | CC | denotes | and |
| T22558 | 33805-33810 | VB | denotes | lysed |
| T22559 | 33811-33813 | IN | denotes | on |
| T22560 | 33814-33817 | NN | denotes | ice |
| T22561 | 33818-33820 | IN | denotes | by |
| T22562 | 33821-33824 | CD | denotes | 0.4 |
| T22563 | 33825-33827 | NN | denotes | ml |
| T22564 | 33828-33830 | IN | denotes | of |
| T22565 | 33831-33834 | DT | denotes | the |
| T22566 | 33835-33843 | VB | denotes | modified |
| T22567 | 33844-33848 | NN | denotes | RIPA |
| T22568 | 33849-33855 | NN | denotes | buffer |
| T22569 | 33856-33857 | -LRB- | denotes | ( |
| T22570 | 33857-33859 | CD | denotes | 50 |
| T22571 | 33860-33862 | NN | denotes | mM |
| T22572 | 33863-33871 | NN | denotes | Tris-HCl |
| T22573 | 33872-33873 | -LRB- | denotes | [ |
| T22574 | 33873-33875 | NN | denotes | pH |
| T22575 | 33876-33879 | CD | denotes | 7.4 |
| T22576 | 33879-33880 | -RRB- | denotes | ] |
| T22577 | 33880-33881 | -COMMA- | denotes | , |
| T22578 | 33882-33883 | CD | denotes | 1 |
| T22579 | 33883-33884 | NN | denotes | % |
| T22580 | 33885-33890 | NN | denotes | NP-40 |
| T22581 | 33890-33891 | -COMMA- | denotes | , |
| T22582 | 33892-33896 | CD | denotes | 0.25 |
| T22583 | 33896-33897 | NN | denotes | % |
| T22584 | 33898-33913 | JJ | denotes | Na-deoxycholate |
| T22585 | 33913-33914 | -COMMA- | denotes | , |
| T22586 | 33915-33918 | CD | denotes | 150 |
| T22587 | 33919-33921 | NN | denotes | mM |
| T22588 | 33922-33926 | NN | denotes | NaCl |
| T22589 | 33926-33927 | -COMMA- | denotes | , |
| T22590 | 33928-33929 | CD | denotes | 1 |
| T22591 | 33930-33932 | NN | denotes | mM |
| T22592 | 33933-33937 | NN | denotes | EDTA |
| T22593 | 33937-33938 | -COMMA- | denotes | , |
| T22594 | 33939-33940 | CD | denotes | 1 |
| T22595 | 33941-33943 | NN | denotes | mM |
| T22596 | 33944-33948 | NN | denotes | PMSF |
| T22597 | 33948-33949 | -COMMA- | denotes | , |
| T22598 | 33950-33951 | CD | denotes | 1 |
| T22599 | 33952-33954 | NN | denotes | mM |
| T22600 | 33955-33961 | NN | denotes | Na3VO4 |
| T22601 | 33961-33962 | -COMMA- | denotes | , |
| T22602 | 33963-33964 | CD | denotes | 1 |
| T22603 | 33965-33967 | NN | denotes | mM |
| T22604 | 33968-33971 | NN | denotes | NaF |
| T22605 | 33971-33972 | -RRB- | denotes | ) |
| T22606 | 33973-33985 | VB | denotes | supplemented |
| T22607 | 33986-33990 | IN | denotes | with |
| T22608 | 33991-33992 | CD | denotes | 1 |
| T22609 | 33993-33994 | SYM | denotes | × |
| T22610 | 33995-34003 | NN | denotes | protease |
| T22611 | 34004-34013 | NN | denotes | inhibitor |
| T22612 | 34014-34022 | NN | denotes | cocktail |
| T22613 | 34023-34024 | -LRB- | denotes | ( |
| T22614 | 34024-34029 | NN | denotes | Roche |
| T22615 | 34029-34030 | -RRB- | denotes | ) |
| T22616 | 34031-34034 | CC | denotes | and |
| T22617 | 34035-34036 | CD | denotes | 1 |
| T22618 | 34037-34038 | CC | denotes | × |
| T22619 | 34039-34050 | NN | denotes | phosphatase |
| T22620 | 34051-34060 | NN | denotes | inhibitor |
| T22621 | 34061-34069 | NN | denotes | cocktail |
| T22622 | 34070-34073 | NN | denotes | set |
| T22623 | 34074-34075 | CD | denotes | I |
| T22624 | 34076-34077 | -LRB- | denotes | ( |
| T22625 | 34077-34080 | NNP | denotes | EMD |
| T22626 | 34081-34092 | NNP | denotes | Biosciences |
| T22627 | 34092-34093 | -RRB- | denotes | ) |
| T22628 | 34094-34097 | IN | denotes | for |
| T22629 | 34098-34100 | CD | denotes | 30 |
| T22630 | 34101-34104 | NN | denotes | min |
| T22631 | 34106-34109 | DT | denotes | The |
| T22632 | 34110-34117 | NN | denotes | lysates |
| T22633 | 34118-34122 | VB | denotes | were |
| T22634 | 34123-34134 | VB | denotes | centrifuged |
| T22635 | 34135-34137 | IN | denotes | at |
| T22636 | 34138-34144 | CD | denotes | 10,000 |
| T22637 | 34145-34146 | SYM | denotes | × |
| T22638 | 34147-34148 | NN | denotes | g |
| T22639 | 34149-34151 | IN | denotes | at |
| T22640 | 34152-34153 | CD | denotes | 4 |
| T22641 | 34154-34156 | NN | denotes | °C |
| T22642 | 34157-34160 | IN | denotes | for |
| T22643 | 34161-34163 | CD | denotes | 10 |
| T22644 | 34164-34167 | NN | denotes | min |
| T22645 | 34168-34170 | TO | denotes | to |
| T22646 | 34171-34177 | VB | denotes | remove |
| T22647 | 34178-34187 | JJ | denotes | insoluble |
| T22648 | 34188-34196 | NN | denotes | material |
| T22649 | 34198-34203 | IN | denotes | After |
| T22650 | 34204-34215 | VB | denotes | normalizing |
| T22651 | 34216-34223 | NN | denotes | protein |
| T22652 | 34224-34238 | NN | denotes | concentrations |
| T22653 | 34238-34239 | -COMMA- | denotes | , |
| T22654 | 34240-34247 | NN | denotes | lysates |
| T22655 | 34248-34252 | VB | denotes | were |
| T22656 | 34253-34262 | VB | denotes | subjected |
| T22657 | 34263-34265 | TO | denotes | to |
| T22658 | 34266-34285 | NN | denotes | immunoprecipitation |
| T22659 | 34286-34288 | IN | denotes | by |
| T22660 | 34289-34295 | VB | denotes | adding |
| T22661 | 34296-34298 | CD | denotes | 10 |
| T22662 | 34299-34304 | NN | denotes | mg/ml |
| T22663 | 34305-34316 | JJ | denotes | appropriate |
| T22664 | 34317-34325 | NN | denotes | antibody |
| T22665 | 34326-34330 | CC | denotes | plus |
| T22666 | 34331-34333 | CD | denotes | 30 |
| T22667 | 34334-34336 | NN | denotes | ml |
| T22668 | 34337-34339 | IN | denotes | of |
| T22669 | 34340-34347 | NN | denotes | protein |
| T22670 | 34348-34357 | NN | denotes | G-agarose |
| T22671 | 34358-34359 | -LRB- | denotes | ( |
| T22672 | 34359-34364 | NNP | denotes | Roche |
| T22673 | 34364-34365 | -RRB- | denotes | ) |
| T22674 | 34365-34366 | -COMMA- | denotes | , |
| T22675 | 34367-34370 | CC | denotes | and |
| T22676 | 34371-34378 | VB | denotes | rotated |
| T22677 | 34379-34382 | IN | denotes | for |
| T22678 | 34383-34385 | IN | denotes | at |
| T22679 | 34386-34391 | JJ | denotes | least |
| T22680 | 34392-34393 | CD | denotes | 2 |
| T22681 | 34394-34395 | NN | denotes | h |
| T22682 | 34396-34398 | IN | denotes | at |
| T22683 | 34399-34403 | NNP | denotes | 4°C. |
| T22684 | 34404-34407 | DT | denotes | The |
| T22685 | 34408-34420 | NN | denotes | precipitates |
| T22686 | 34421-34425 | VB | denotes | were |
| T22687 | 34426-34432 | VB | denotes | washed |
| T22688 | 34433-34435 | IN | denotes | at |
| T22689 | 34436-34441 | JJ | denotes | least |
| T22690 | 34442-34446 | CD | denotes | five |
| T22691 | 34447-34452 | NN | denotes | times |
| T22692 | 34453-34457 | IN | denotes | with |
| T22693 | 34458-34462 | JJ | denotes | cold |
| T22694 | 34463-34468 | NN | denotes | lysis |
| T22695 | 34469-34475 | NN | denotes | buffer |
| T22696 | 34476-34484 | VB | denotes | followed |
| T22697 | 34485-34487 | IN | denotes | by |
| T22698 | 34488-34498 | NN | denotes | separation |
| T22699 | 34499-34501 | IN | denotes | by |
| T22700 | 34502-34510 | NN | denotes | SDS-PAGE |
| T22701 | 34511-34516 | IN | denotes | under |
| T22702 | 34517-34524 | VB | denotes | reduced |
| T22703 | 34525-34528 | CC | denotes | and |
| T22704 | 34529-34539 | VB | denotes | denaturing |
| T22705 | 34540-34550 | NN | denotes | conditions |
| T22706 | 34552-34566 | NN | denotes | Nitrocellulose |
| T22707 | 34567-34576 | NN | denotes | membranes |
| T22708 | 34577-34581 | VB | denotes | were |
| T22709 | 34582-34589 | VB | denotes | blocked |
| T22710 | 34590-34592 | IN | denotes | in |
| T22711 | 34593-34594 | CD | denotes | 5 |
| T22712 | 34595-34596 | NN | denotes | % |
| T22713 | 34597-34603 | JJ | denotes | nonfat |
| T22714 | 34604-34608 | NN | denotes | milk |
| T22715 | 34609-34611 | IN | denotes | in |
| T22716 | 34612-34615 | CD | denotes | 0.1 |
| T22717 | 34616-34617 | NN | denotes | % |
| T22718 | 34618-34627 | JJ | denotes | PBS-Tween |
| T22719 | 34628-34630 | CD | denotes | 20 |
| T22720 | 34631-34632 | -LRB- | denotes | ( |
| T22721 | 34632-34637 | NN | denotes | PBS-T |
| T22722 | 34637-34638 | -RRB- | denotes | ) |
| T22723 | 34638-34639 | -COMMA- | denotes | , |
| T22724 | 34640-34646 | VB | denotes | probed |
| T22725 | 34647-34651 | IN | denotes | with |
| T22726 | 34652-34660 | JJ | denotes | specific |
| T22727 | 34661-34671 | NN | denotes | antibodies |
| T22728 | 34672-34674 | IN | denotes | as |
| T22729 | 34675-34684 | VB | denotes | described |
| T22730 | 34685-34696 | NN | denotes | previously6 |
| T22731 | 34698-34701 | IN | denotes | For |
| T22732 | 34702-34716 | NN | denotes | immunoblotting |
| T22733 | 34717-34719 | IN | denotes | of |
| T22734 | 34720-34734 | VB | denotes | phosphorylated |
| T22735 | 34735-34743 | NN | denotes | proteins |
| T22736 | 34743-34744 | -COMMA- | denotes | , |
| T22737 | 34745-34749 | NN | denotes | gels |
| T22738 | 34750-34754 | VB | denotes | were |
| T22739 | 34755-34766 | VB | denotes | transferred |
| T22740 | 34767-34769 | TO | denotes | to |
| T22741 | 34770-34786 | JJ | denotes | methanol-treated |
| T22742 | 34787-34801 | NN | denotes | polyvinylidene |
| T22743 | 34802-34810 | NN | denotes | chloride |
| T22744 | 34811-34820 | NN | denotes | membranes |
| T22745 | 34820-34821 | -COMMA- | denotes | , |
| T22746 | 34822-34831 | VB | denotes | retreated |
| T22747 | 34832-34836 | IN | denotes | with |
| T22748 | 34837-34845 | NN | denotes | methanol |
| T22749 | 34845-34846 | -COMMA- | denotes | , |
| T22750 | 34847-34850 | CC | denotes | and |
| T22751 | 34851-34856 | VB | denotes | dried |
| T22752 | 34857-34860 | IN | denotes | for |
| T22753 | 34861-34863 | CD | denotes | 30 |
| T22754 | 34864-34867 | NN | denotes | min |
| T22755 | 34869-34874 | NN | denotes | Blots |
| T22756 | 34875-34879 | VB | denotes | were |
| T22757 | 34880-34887 | VB | denotes | blocked |
| T22758 | 34888-34890 | IN | denotes | in |
| T22759 | 34891-34892 | CD | denotes | 5 |
| T22760 | 34893-34894 | NN | denotes | % |
| T22761 | 34895-34901 | JJ | denotes | bovine |
| T22762 | 34902-34907 | NN | denotes | serum |
| T22763 | 34908-34915 | NN | denotes | albumin |
| T22764 | 34916-34918 | IN | denotes | in |
| T22765 | 34919-34922 | CD | denotes | 0.1 |
| T22766 | 34923-34924 | NN | denotes | % |
| T22767 | 34925-34929 | NNP | denotes | Tris |
| T22768 | 34930-34938 | VB | denotes | buffered |
| T22769 | 34939-34951 | JJ | denotes | saline-Tween |
| T22770 | 34952-34954 | CD | denotes | 20 |
| T22771 | 34955-34956 | -LRB- | denotes | ( |
| T22772 | 34956-34961 | NN | denotes | TBS-T |
| T22773 | 34961-34962 | -RRB- | denotes | ) |
| T22774 | 34962-34963 | -COMMA- | denotes | , |
| T22775 | 34964-34967 | CC | denotes | and |
| T22776 | 34968-34974 | VB | denotes | probed |
| T22777 | 34975-34979 | IN | denotes | with |
| T22778 | 34980-34988 | JJ | denotes | specific |
| T22779 | 34989-34999 | NN | denotes | antibodies |
| T22780 | 35000-35002 | IN | denotes | as |
| T22781 | 35003-35012 | VB | denotes | described |
| T22782 | 35013-35025 | NN | denotes | previously46 |
| T22783 | 35027-35032 | NN | denotes | Bands |
| T22784 | 35033-35037 | VB | denotes | were |
| T22785 | 35038-35044 | VB | denotes | imaged |
| T22786 | 35045-35047 | IN | denotes | by |
| T22787 | 35048-35051 | DT | denotes | the |
| T22788 | 35052-35057 | NNP | denotes | Super |
| T22789 | 35058-35067 | NN | denotes | Signaling |
| T22790 | 35068-35074 | NN | denotes | system |
| T22791 | 35075-35076 | -LRB- | denotes | ( |
| T22792 | 35076-35082 | NN | denotes | Pierce |
| T22793 | 35082-35083 | -RRB- | denotes | ) |
| T22794 | 35084-35093 | VB | denotes | according |
| T22795 | 35094-35096 | TO | denotes | to |
| T22796 | 35097-35100 | DT | denotes | the |
| T22797 | 35101-35113 | NN | denotes | manufacturer |
| T22798 | 35113-35115 | POS | denotes | 's |
| T22799 | 35116-35128 | NN | denotes | instructions |
| T23105 | 35131-35136 | NN | denotes | ELISA |
| T23106 | 35137-35140 | DT | denotes | The |
| T23107 | 35141-35147 | NN | denotes | amount |
| T23108 | 35148-35150 | IN | denotes | of |
| T23109 | 35151-35155 | NN | denotes | IL-8 |
| T23110 | 35156-35163 | JJ | denotes | present |
| T23111 | 35164-35166 | IN | denotes | in |
| T23112 | 35167-35179 | NN | denotes | supernatants |
| T23113 | 35180-35189 | VB | denotes | collected |
| T23114 | 35190-35194 | IN | denotes | from |
| T23115 | 35195-35201 | NN | denotes | Jurkat |
| T23116 | 35202-35206 | NN | denotes | cell |
| T23117 | 35207-35214 | NN | denotes | culture |
| T23118 | 35215-35218 | VB | denotes | was |
| T23119 | 35219-35227 | VB | denotes | measured |
| T23120 | 35228-35233 | VB | denotes | using |
| T23121 | 35234-35235 | DT | denotes | a |
| T23122 | 35236-35241 | JJ | denotes | Human |
| T23123 | 35242-35255 | NN | denotes | Interleukin-8 |
| T23124 | 35256-35261 | NN | denotes | ELISA |
| T23125 | 35262-35274 | NN | denotes | Ready-SET-Go |
| T23126 | 35275-35278 | NN | denotes | kit |
| T23127 | 35279-35280 | -LRB- | denotes | ( |
| T23128 | 35280-35291 | NN | denotes | eBioscience |
| T23129 | 35291-35292 | -RRB- | denotes | ) |
| T23130 | 35293-35302 | VB | denotes | according |
| T23131 | 35303-35305 | TO | denotes | to |
| T23132 | 35306-35309 | DT | denotes | the |
| T23133 | 35310-35322 | NN | denotes | manufacturer |
| T23134 | 35322-35324 | POS | denotes | 's |
| T23135 | 35325-35337 | NN | denotes | instructions |
| T23195 | 35340-35344 | NN | denotes | Cell |
| T23196 | 35345-35355 | NN | denotes | Infections |
| T23197 | 35356-35360 | NN | denotes | HeLa |
| T23198 | 35361-35366 | NN | denotes | cells |
| T23199 | 35367-35371 | VB | denotes | were |
| T23200 | 35372-35380 | VB | denotes | infected |
| T23201 | 35381-35385 | IN | denotes | with |
| T23202 | 35386-35388 | FW | denotes | E. |
| T23203 | 35389-35393 | FW | denotes | coli |
| T23204 | 35394-35398 | NN | denotes | O157 |
| T23205 | 35398-35399 | -COLON- | denotes | : |
| T23206 | 35399-35401 | NN | denotes | H7 |
| T23207 | 35402-35404 | CC | denotes | or |
| T23208 | 35405-35407 | FW | denotes | C. |
| T23209 | 35408-35417 | NN | denotes | rodentium |
| T23210 | 35418-35425 | NN | denotes | strains |
| T23211 | 35426-35428 | IN | denotes | as |
| T23212 | 35429-35438 | VB | denotes | described |
| T23213 | 35439-35450 | NN | denotes | previously9 |
| T23243 | 35453-35473 | NN | denotes | Immunohistochemistry |
| T23244 | 35474-35485 | JJ | denotes | Gnotobiotic |
| T23245 | 35486-35493 | NN | denotes | piglets |
| T23246 | 35494-35498 | VB | denotes | were |
| T23247 | 35499-35507 | VB | denotes | infected |
| T23248 | 35508-35512 | IN | denotes | with |
| T23249 | 35513-35515 | FW | denotes | E. |
| T23250 | 35516-35520 | FW | denotes | coli |
| T23251 | 35521-35525 | NN | denotes | O157 |
| T23252 | 35525-35526 | -COLON- | denotes | : |
| T23253 | 35526-35528 | NN | denotes | H7 |
| T23254 | 35529-35536 | NN | denotes | strains |
| T23255 | 35537-35539 | IN | denotes | as |
| T23256 | 35540-35549 | VB | denotes | described |
| T23257 | 35550-35561 | NN | denotes | previously9 |
| T23258 | 35563-35569 | JJ | denotes | Spiral |
| T23259 | 35570-35575 | NN | denotes | colon |
| T23260 | 35576-35585 | NN | denotes | specimens |
| T23261 | 35586-35590 | VB | denotes | were |
| T23262 | 35591-35600 | VB | denotes | collected |
| T23263 | 35601-35603 | IN | denotes | at |
| T23264 | 35604-35612 | NN | denotes | necropsy |
| T23265 | 35613-35616 | CC | denotes | and |
| T23266 | 35617-35625 | VB | denotes | embedded |
| T23267 | 35626-35628 | IN | denotes | in |
| T23268 | 35629-35637 | NN | denotes | paraffin |
| T23269 | 35639-35647 | NN | denotes | Paraffin |
| T23270 | 35648-35658 | NN | denotes | sectioning |
| T23271 | 35659-35662 | CC | denotes | and |
| T23272 | 35663-35682 | JJ | denotes | immunohistochemical |
| T23273 | 35683-35691 | NN | denotes | staining |
| T23274 | 35692-35697 | VB | denotes | using |
| T23275 | 35698-35710 | NN | denotes | phospho-RPS3 |
| T23276 | 35711-35719 | NN | denotes | antibody |
| T23277 | 35720-35724 | VB | denotes | were |
| T23278 | 35725-35734 | VB | denotes | performed |
| T23279 | 35735-35737 | IN | denotes | by |
| T23280 | 35738-35747 | NNP | denotes | Histoserv |
| T23281 | 35748-35751 | NNP | denotes | Inc |
| T18147 | 24010-24013 | VB | denotes | was |
| T18438 | 25944-25954 | JJ | denotes | protective |
| R78 | T100 | T102 | modOf | IKKβ,regulates |
| R79 | T100 | T111 | arg1Of | IKKβ,: |
| R80 | T101 | T102 | arg1Of | phosphorylation,regulates |
| R81 | T105 | T103 | arg1Of | translocation,RPS3 |
| R82 | T105 | T104 | arg1Of | translocation,nuclear |
| R83 | T105 | T106 | arg1Of | translocation,and |
| R84 | T106 | T102 | arg2Of | and,regulates |
| R85 | T110 | T106 | arg2Of | coli O157,and |
| R86 | T110 | T107 | arg1Of | coli O157,NF-κB |
| R87 | T110 | T108 | arg1Of | coli O157,function |
| R88 | T110 | T109 | arg1Of | coli O157,during Escherichia |
| R89 | T113 | T100 | arg1Of | infection,IKKβ |
| R90 | T113 | T112 | arg1Of | infection,H7 |
| R91 | T114 | T115 | arg1Of | NF-κB,is |
| R92 | T115 | T123 | arg1Of | is,and |
| R93 | T119 | T115 | arg2Of | regulator,is |
| R94 | T119 | T116 | arg1Of | regulator,a |
| R95 | T119 | T117 | arg1Of | regulator,major |
| R96 | T119 | T118 | arg1Of | regulator,gene |
| R97 | T119 | T120 | arg1Of | regulator,in |
| R98 | T122 | T120 | arg2Of | responses,in |
| R99 | T122 | T121 | arg1Of | responses,immune |
| R100 | T126 | T124 | arg1Of | S3,ribosomal |
| R101 | T126 | T125 | arg1Of | S3,protein |
| R102 | T126 | T127 | arg1Of | S3,( |
| R103 | T126 | T130 | arg1Of | S3,is |
| R104 | T128 | T127 | arg2Of | RPS3,( |
| R105 | T129 | T127 | arg3Of | ),( |
| R106 | T130 | T123 | arg2Of | is,and |
| R107 | T133 | T130 | arg2Of | subunit,is |
| R108 | T133 | T131 | arg1Of | subunit,an |
| R109 | T133 | T132 | arg1Of | subunit,NF-κB |
| R110 | T133 | T134 | arg1Of | subunit,that |
| R111 | T133 | T135 | arg1Of | subunit,directs |
| R112 | T138 | T135 | arg2Of | transcription,directs |
| R113 | T138 | T136 | arg1Of | transcription,specific |
| R114 | T138 | T137 | arg1Of | transcription,gene |
| R115 | T142 | T139 | arg1Of | is,However |
| R116 | T142 | T140 | arg1Of | is,"," |
| R117 | T143 | T142 | arg2Of | unknown,is |
| R118 | T144 | T141 | arg1Of | how,it |
| R119 | T144 | T142 | arg1Of | how,is |
| R120 | T144 | T143 | arg1Of | how,unknown |
| R121 | T147 | T145 | arg1Of | translocation,RPS3 |
| R122 | T147 | T146 | arg1Of | translocation,nuclear |
| R123 | T147 | T148 | arg1Of | translocation,is |
| R124 | T147 | T149 | arg2Of | translocation,regulated |
| R125 | T149 | T144 | arg1Of | regulated,how |
| R126 | T149 | T148 | arg2Of | regulated,is |
| R127 | T151 | T152 | arg1Of | we,report |
| R128 | T152 | T150 | arg1Of | report,Here |
| R129 | T155 | T154 | arg1Of | phosphorylation,IKKβ |
| R130 | T155 | T156 | arg1Of | phosphorylation,of |
| R131 | T155 | T162 | arg1Of | phosphorylation,was |
| R132 | T155 | T163 | arg1Of | phosphorylation,crucial |
| R133 | T157 | T156 | arg2Of | serine,of |
| R134 | T157 | T158 | arg1Of | serine,209 |
| R135 | T157 | T159 | arg1Of | serine,( |
| R136 | T160 | T159 | arg2Of | S209,( |
| R137 | T161 | T159 | arg3Of | ),( |
| R138 | T162 | T152 | arg2Of | was,report |
| R139 | T162 | T153 | arg1Of | was,that |
| R140 | T162 | T168 | arg1Of | was,in |
| R141 | T163 | T162 | arg2Of | crucial,was |
| R142 | T163 | T164 | arg1Of | crucial,for |
| R143 | T167 | T164 | arg2Of | localization,for |
| R144 | T167 | T165 | arg1Of | localization,RPS3 |
| R145 | T167 | T166 | arg1Of | localization,nuclear |
| R146 | T168 | T170 | arg1Of | in,to |
| R147 | T169 | T168 | arg2Of | response,in |
| R148 | T172 | T168 | arg3Of | stimuli,in |
| R149 | T172 | T171 | arg1Of | stimuli,activating |
| R150 | T180 | T176 | arg1Of | O157,foodborne |
| R151 | T180 | T177 | arg1Of | O157,pathogen |
| R152 | T180 | T178 | arg1Of | O157,Escherichia |
| R153 | T180 | T179 | arg1Of | O157,coli |
| R154 | T180 | T181 | arg1Of | O157,: |
| R155 | T181 | T175 | arg1Of | :,the |
| R156 | T181 | T187 | arg1Of | :,inhibited |
| R157 | T181 | T192 | arg1Of | :,blocked |
| R158 | T181 | T197 | arg1Of | :,promoting |
| R159 | T181 | T203 | arg1Of | :,decreasing |
| R160 | T185 | T181 | arg2Of | NleH1,: |
| R161 | T185 | T182 | arg1Of | NleH1,H7 |
| R162 | T185 | T183 | arg1Of | NleH1,virulence |
| R163 | T185 | T184 | arg1Of | NleH1,protein |
| R164 | T187 | T191 | arg1Of | inhibited,and |
| R165 | T190 | T187 | arg2Of | phosphorylation,inhibited |
| R166 | T190 | T188 | arg1Of | phosphorylation,RPS3 |
| R167 | T190 | T189 | arg1Of | phosphorylation,S209 |
| R168 | T191 | T173 | arg1Of | and,Moreover |
| R169 | T191 | T174 | arg1Of | and,"," |
| R170 | T191 | T186 | arg1Of | and,specifically |
| R171 | T191 | T195 | arg1Of | and,"," |
| R172 | T191 | T197 | modOf | and,promoting |
| R173 | T191 | T203 | modOf | and,decreasing |
| R174 | T192 | T191 | arg2Of | blocked,and |
| R175 | T194 | T192 | arg2Of | function,blocked |
| R176 | T194 | T193 | arg1Of | function,RPS3 |
| R177 | T197 | T202 | arg1Of | promoting,but |
| R178 | T199 | T200 | arg1Of | colonization,and |
| R179 | T200 | T197 | arg2Of | and,promoting |
| R180 | T200 | T198 | arg1Of | and,bacterial |
| R181 | T201 | T200 | arg2Of | diarrhea,and |
| R182 | T202 | T196 | arg1Of | but,thereby |
| R183 | T203 | T202 | arg2Of | decreasing,but |
| R184 | T203 | T205 | arg1Of | decreasing,in |
| R185 | T204 | T203 | arg2Of | mortality,decreasing |
| R186 | T210 | T205 | arg2Of | model,in |
| R187 | T210 | T206 | arg1Of | model,a |
| R188 | T210 | T207 | arg1Of | model,gnotobiotic |
| R189 | T210 | T208 | arg1Of | model,piglet |
| R190 | T210 | T209 | arg1Of | model,infection |
| R191 | T215 | T213 | arg1Of | modification,the |
| R192 | T215 | T214 | arg1Of | modification,IKKβ-dependent |
| R193 | T215 | T216 | arg1Of | modification,of |
| R194 | T215 | T223 | arg1Of | modification,promotes |
| R195 | T220 | T216 | arg2Of | acid,of |
| R196 | T220 | T217 | arg1Of | acid,a |
| R197 | T220 | T218 | arg1Of | acid,specific |
| R198 | T220 | T219 | arg1Of | acid,amino |
| R199 | T220 | T221 | arg1Of | acid,in |
| R200 | T222 | T221 | arg2Of | RPS3,in |
| R201 | T223 | T211 | arg1Of | promotes,Thus |
| R202 | T223 | T212 | arg1Of | promotes,"," |
| R203 | T226 | T223 | arg2Of | functions,promotes |
| R204 | T226 | T224 | arg1Of | functions,specific |
| R205 | T226 | T225 | arg1Of | functions,NF-κB |
| R206 | T226 | T227 | arg1Of | functions,that |
| R207 | T226 | T228 | arg1Of | functions,underlie |
| R208 | T232 | T228 | arg2Of | mechanisms,underlie |
| R209 | T232 | T229 | arg1Of | mechanisms,the |
| R210 | T232 | T230 | arg1Of | mechanisms,molecular |
| R211 | T232 | T231 | arg1Of | mechanisms,pathogenetic |
| R212 | T232 | T233 | arg1Of | mechanisms,of |
| R213 | T232 | T237 | arg1Of | mechanisms,: |
| R214 | T236 | T233 | arg2Of | O157,of |
| R215 | T236 | T234 | arg1Of | O157,E. |
| R216 | T236 | T235 | arg1Of | O157,coli |
| R217 | T238 | T237 | arg2Of | H7,: |
| R626 | T795 | T793 | arg1Of | B,Nuclear |
| R627 | T795 | T794 | arg1Of | B,Factor-kappa |
| R628 | T795 | T796 | arg1Of | B,( |
| R629 | T795 | T799 | arg1Of | B,regulates |
| R630 | T797 | T796 | arg2Of | NF-κB,( |
| R631 | T798 | T796 | arg3Of | ),( |
| R632 | T799 | T803 | arg1Of | regulates,and |
| R633 | T802 | T799 | arg2Of | functions,regulates |
| R634 | T802 | T800 | arg1Of | functions,crucial |
| R635 | T802 | T801 | arg1Of | functions,cellular |
| R636 | T805 | T804 | arg1Of | stimuli,diverse |
| R637 | T805 | T806 | arg1Of | stimuli,activate |
| R638 | T806 | T803 | arg2Of | activate,and |
| R639 | T810 | T806 | arg2Of | factor,activate |
| R640 | T810 | T807 | arg1Of | factor,this |
| R641 | T810 | T808 | arg1Of | factor,pleiotropic |
| R642 | T810 | T809 | arg1Of | factor,transcription |
| R643 | T810 | T811 | arg1Of | factor,"," |
| R644 | T810 | T812 | arg1Of | factor,which |
| R645 | T810 | T815 | arg1Of | factor,regulates |
| R646 | T814 | T813 | arg2Of | turn,in |
| R647 | T815 | T813 | arg1Of | regulates,in |
| R648 | T818 | T815 | arg2Of | array,regulates |
| R649 | T818 | T816 | arg1Of | array,a |
| R650 | T818 | T817 | arg1Of | array,vast |
| R651 | T818 | T819 | arg1Of | array,of |
| R652 | T821 | T819 | arg2Of | targets1-3,of |
| R653 | T821 | T820 | arg1Of | targets1-3,genetic |
| R654 | T826 | T822 | arg1Of | subunits,The |
| R655 | T826 | T823 | arg1Of | subunits,best-known |
| R656 | T826 | T824 | arg1Of | subunits,mammalian |
| R657 | T826 | T825 | arg1Of | subunits,NF-κB |
| R658 | T826 | T827 | arg1Of | subunits,are |
| R659 | T829 | T827 | arg2Of | proteins,are |
| R660 | T829 | T828 | arg1Of | proteins,Rel |
| R661 | T829 | T830 | arg1Of | proteins,"," |
| R662 | T829 | T831 | arg1Of | proteins,including |
| R663 | T832 | T833 | arg1Of | RelA,( |
| R664 | T832 | T836 | arg1Of | RelA,"," |
| R665 | T834 | T833 | arg2Of | p65,( |
| R666 | T835 | T833 | arg3Of | ),( |
| R667 | T836 | T838 | arg1Of | ",","," |
| R668 | T837 | T836 | arg2Of | RelB,"," |
| R669 | T838 | T840 | arg1Of | ",","," |
| R670 | T839 | T838 | arg2Of | c-Rel,"," |
| R671 | T840 | T843 | arg1Of | ",",and |
| R672 | T841 | T840 | arg2Of | p50,"," |
| R673 | T843 | T831 | arg2Of | and,including |
| R674 | T843 | T842 | arg1Of | and,"," |
| R675 | T844 | T845 | arg1Of | p52,( |
| R676 | T846 | T843 | arg2Of | refs,and |
| R677 | T846 | T844 | arg1Of | refs,p52 |
| R678 | T847 | T848 | arg1Of | "4, 5",) |
| R679 | T851 | T853 | arg1Of | we,demonstrated |
| R680 | T853 | T849 | arg1Of | demonstrated,However |
| R681 | T853 | T850 | arg1Of | demonstrated,"," |
| R682 | T853 | T852 | arg1Of | demonstrated,recently |
| R683 | T857 | T855 | arg1Of | S3,ribosomal |
| R684 | T857 | T856 | arg1Of | S3,protein |
| R685 | T857 | T858 | arg1Of | S3,( |
| R686 | T857 | T861 | arg1Of | S3,is |
| R687 | T859 | T858 | arg2Of | RPS3,( |
| R688 | T860 | T858 | arg3Of | ),( |
| R689 | T861 | T853 | arg2Of | is,demonstrated |
| R690 | T861 | T854 | arg1Of | is,that |
| R691 | T865 | T861 | arg2Of | subunit,is |
| R692 | T865 | T862 | arg1Of | subunit,a |
| R693 | T865 | T863 | arg1Of | subunit,key |
| R694 | T865 | T864 | arg1Of | subunit,non-Rel |
| R695 | T865 | T866 | arg1Of | subunit,of |
| R696 | T870 | T866 | arg2Of | complexes6,of |
| R697 | T870 | T867 | arg1Of | complexes6,certain |
| R698 | T870 | T868 | arg1Of | complexes6,native |
| R699 | T870 | T869 | arg1Of | complexes6,NF-κB |
| R700 | T871 | T872 | arg1Of | RPS3,is |
| R701 | T871 | T873 | arg2Of | RPS3,defined |
| R702 | T873 | T872 | arg2Of | defined,is |
| R703 | T873 | T874 | arg1Of | defined,as |
| R704 | T873 | T880 | arg1Of | defined,"," |
| R705 | T873 | T881 | arg1Of | defined,because |
| R706 | T877 | T874 | arg2Of | subunit,as |
| R707 | T877 | T875 | arg1Of | subunit,a |
| R708 | T877 | T876 | arg1Of | subunit,“specifier” |
| R709 | T877 | T878 | arg1Of | subunit,of |
| R710 | T879 | T878 | arg2Of | NF-κB,of |
| R711 | T882 | T883 | arg1Of | it,facilitates |
| R712 | T883 | T881 | arg2Of | facilitates,because |
| R713 | T887 | T883 | arg2Of | binding,facilitates |
| R714 | T887 | T884 | arg1Of | binding,high |
| R715 | T887 | T885 | arg1Of | binding,affinity |
| R716 | T887 | T886 | arg1Of | binding,DNA |
| R717 | T887 | T889 | arg1Of | binding,determining |
| R718 | T889 | T888 | arg1Of | determining,thus |
| R719 | T892 | T889 | arg2Of | specificity,determining |
| R720 | T892 | T890 | arg1Of | specificity,the |
| R721 | T892 | T891 | arg1Of | specificity,regulatory |
| R722 | T892 | T893 | arg1Of | specificity,of |
| R723 | T892 | T895 | arg1Of | specificity,for |
| R724 | T894 | T893 | arg2Of | NF-κB,of |
| R725 | T898 | T895 | arg2Of | genes7,for |
| R726 | T898 | T896 | arg2Of | genes7,selected |
| R727 | T898 | T897 | arg1Of | genes7,target |
| R728 | T900 | T899 | arg1Of | regulation,RPS3 |
| R729 | T900 | T901 | arg1Of | regulation,of |
| R730 | T906 | T901 | arg2Of | processes,of |
| R731 | T906 | T902 | arg1Of | processes,NF-κB |
| R732 | T906 | T903 | arg1Of | processes,governs |
| R733 | T906 | T904 | arg1Of | processes,key |
| R734 | T906 | T905 | arg1Of | processes,physiological |
| R735 | T906 | T907 | arg1Of | processes,"," |
| R736 | T906 | T908 | arg1Of | processes,including |
| R737 | T914 | T909 | arg1Of | expression,immunoglobulin |
| R738 | T914 | T910 | arg1Of | expression,κ |
| R739 | T914 | T911 | arg1Of | expression,light |
| R740 | T914 | T912 | arg1Of | expression,chain |
| R741 | T914 | T913 | arg1Of | expression,gene |
| R742 | T914 | T915 | arg1Of | expression,and |
| R743 | T915 | T908 | arg2Of | and,including |
| R744 | T915 | T918 | arg1Of | and,in |
| R745 | T915 | T929 | arg1Of | and,in |
| R746 | T915 | T938 | arg1Of | and,9 |
| R747 | T917 | T915 | arg2Of | editing,and |
| R748 | T917 | T916 | arg1Of | editing,receptor |
| R749 | T918 | T928 | arg1Of | in,and |
| R750 | T920 | T918 | arg2Of | "cells6, 8",in |
| R751 | T920 | T919 | arg1Of | "cells6, 8",B |
| R752 | T920 | T921 | arg1Of | "cells6, 8","," |
| R753 | T923 | T921 | arg2Of | production,"," |
| R754 | T923 | T922 | arg1Of | production,cytokine |
| R755 | T923 | T924 | arg1Of | production,in |
| R756 | T926 | T924 | arg2Of | cells6,in |
| R757 | T926 | T925 | arg1Of | cells6,T |
| R758 | T928 | T927 | arg1Of | and,"," |
| R759 | T929 | T928 | arg2Of | in,and |
| R760 | T931 | T929 | arg2Of | defense,in |
| R761 | T931 | T930 | arg1Of | defense,host |
| R762 | T931 | T932 | arg1Of | defense,against |
| R763 | T934 | T932 | arg2Of | coli,against |
| R764 | T934 | T933 | arg1Of | coli,enterohemorrhagic Escherichia |
| R765 | T934 | T935 | arg1Of | coli,( |
| R766 | T936 | T935 | arg2Of | EHEC,( |
| R767 | T937 | T935 | arg3Of | ),( |
| R768 | T940 | T939 | arg2Of | particular,In |
| R769 | T943 | T942 | arg1Of | coli O157,the E. |
| R770 | T943 | T944 | arg1Of | coli O157,: |
| R771 | T949 | T944 | arg2Of | system,: |
| R772 | T949 | T945 | arg1Of | system,H7 |
| R773 | T949 | T946 | arg1Of | system,type |
| R774 | T949 | T947 | arg1Of | system,III |
| R775 | T949 | T948 | arg1Of | system,secretion |
| R776 | T949 | T950 | arg1Of | system,( |
| R777 | T951 | T950 | arg2Of | T3SS,( |
| R778 | T952 | T950 | arg3Of | ),( |
| R779 | T955 | T953 | arg1Of | NleH1,effector |
| R780 | T955 | T954 | arg1Of | NleH1,protein |
| R781 | T955 | T957 | arg1Of | NleH1,blocks |
| R782 | T955 | T963 | arg1Of | NleH1,attenuating |
| R783 | T957 | T939 | arg1Of | blocks,In |
| R784 | T957 | T941 | arg1Of | blocks,"," |
| R785 | T957 | T943 | arg1Of | blocks,coli O157 |
| R786 | T957 | T956 | arg1Of | blocks,selectively |
| R787 | T957 | T962 | arg1Of | blocks,by |
| R788 | T960 | T958 | arg1Of | gene,NF-κB |
| R789 | T960 | T959 | arg1Of | gene,target |
| R790 | T961 | T957 | arg2Of | transcription,blocks |
| R791 | T961 | T960 | arg1Of | transcription,gene |
| R792 | T963 | T962 | arg2Of | attenuating,by |
| R793 | T963 | T967 | arg1Of | attenuating,"," |
| R794 | T963 | T968 | arg1Of | attenuating,without |
| R795 | T966 | T963 | arg2Of | translocation,attenuating |
| R796 | T966 | T964 | arg1Of | translocation,RPS3 |
| R797 | T966 | T965 | arg1Of | translocation,nuclear |
| R798 | T969 | T968 | arg2Of | affecting,without |
| R799 | T971 | T969 | arg2Of | localization9,affecting |
| R800 | T971 | T970 | arg1Of | localization9,p65 |
| R801 | T974 | T983 | arg1Of | how,is |
| R802 | T978 | T975 | arg1Of | signals,specific |
| R803 | T978 | T976 | arg1Of | signals,NF-κB |
| R804 | T978 | T977 | arg1Of | signals,activating |
| R805 | T978 | T979 | arg1Of | signals,induce |
| R806 | T979 | T974 | arg1Of | induce,how |
| R807 | T982 | T979 | arg2Of | translocation,induce |
| R808 | T982 | T980 | arg1Of | translocation,RPS3 |
| R809 | T982 | T981 | arg1Of | translocation,nuclear |
| R810 | T983 | T972 | arg1Of | is,Nonetheless |
| R811 | T983 | T973 | arg1Of | is,"," |
| R812 | T985 | T984 | arg1Of | functions,"unknown. Extra-ribosomal" |
| R813 | T985 | T986 | arg1Of | functions,have |
| R814 | T985 | T987 | arg1Of | functions,been |
| R815 | T985 | T988 | arg2Of | functions,ascribed |
| R816 | T988 | T983 | arg2Of | ascribed,is |
| R817 | T988 | T986 | arg2Of | ascribed,have |
| R818 | T988 | T987 | arg2Of | ascribed,been |
| R819 | T988 | T989 | arg1Of | ascribed,to |
| R820 | T991 | T989 | arg2Of | proteins10,to |
| R821 | T991 | T990 | arg1Of | proteins10,ribosomal |
| R822 | T994 | T992 | arg2Of | RNA,Besides |
| R823 | T994 | T993 | arg1Of | RNA,binding |
| R824 | T994 | T995 | arg1Of | RNA,within |
| R825 | T999 | T995 | arg2Of | subunit,within |
| R826 | T999 | T996 | arg1Of | subunit,the |
| R827 | T999 | T997 | arg1Of | subunit,40S |
| R828 | T999 | T998 | arg1Of | subunit,ribosomal |
| R829 | T1001 | T1002 | arg1Of | RPS3,participates |
| R830 | T1002 | T992 | arg1Of | participates,Besides |
| R831 | T1002 | T1000 | arg1Of | participates,"," |
| R832 | T1002 | T1003 | arg1Of | participates,in |
| R833 | T1004 | T1005 | arg1Of | transcription6,"," |
| R834 | T1005 | T1009 | arg1Of | ",",and |
| R835 | T1007 | T1005 | arg2Of | "repair11, 12","," |
| R836 | T1007 | T1006 | arg1Of | "repair11, 12",DNA |
| R837 | T1009 | T1003 | arg2Of | and,in |
| R838 | T1009 | T1008 | arg1Of | and,"," |
| R839 | T1010 | T1009 | arg2Of | apoptosis13,and |
| R840 | T1014 | T1012 | arg1Of | RPS3,or |
| R841 | T1014 | T1013 | arg1Of | RPS3,not |
| R842 | T1014 | T1015 | arg1Of | RPS3,is |
| R843 | T1014 | T1016 | arg2Of | RPS3,phosphorylated |
| R844 | T1016 | T1011 | arg1Of | phosphorylated,Whether |
| R845 | T1016 | T1015 | arg2Of | phosphorylated,is |
| R846 | T1016 | T1017 | arg1Of | phosphorylated,had |
| R847 | T1016 | T1018 | arg1Of | phosphorylated,been |
| R848 | T1016 | T1019 | arg1Of | phosphorylated,controversial14-18 |
| R849 | T1018 | T1017 | arg2Of | been,had |
| R850 | T1019 | T1018 | arg2Of | controversial14-18,been |
| R851 | T1022 | T1021 | arg1Of | cascades,kinase |
| R852 | T1022 | T1023 | arg1Of | cascades,play |
| R853 | T1023 | T1020 | arg2Of | play,Since |
| R854 | T1023 | T1027 | arg1Of | play,in |
| R855 | T1026 | T1023 | arg2Of | role,play |
| R856 | T1026 | T1024 | arg1Of | role,a |
| R857 | T1026 | T1025 | arg1Of | role,critical |
| R858 | T1029 | T1027 | arg2Of | regulation,in |
| R859 | T1029 | T1028 | arg1Of | regulation,NF-κB |
| R860 | T1031 | T1032 | arg1Of | we,tested |
| R861 | T1032 | T1020 | arg1Of | tested,Since |
| R862 | T1032 | T1030 | arg1Of | tested,"," |
| R863 | T1034 | T1035 | arg1Of | RPS3,is |
| R864 | T1034 | T1036 | arg2Of | RPS3,phosphorylated |
| R865 | T1034 | T1044 | arg2Of | RPS3,sought |
| R866 | T1036 | T1037 | arg1Of | phosphorylated,in |
| R867 | T1036 | T1043 | arg1Of | phosphorylated,and |
| R868 | T1039 | T1037 | arg2Of | context,in |
| R869 | T1039 | T1038 | arg1Of | context,the |
| R870 | T1039 | T1040 | arg1Of | context,of |
| R871 | T1042 | T1040 | arg2Of | activation,of |
| R872 | T1042 | T1041 | arg1Of | activation,NF-κB |
| R873 | T1043 | T1032 | arg2Of | and,tested |
| R874 | T1043 | T1033 | arg1Of | and,whether |
| R875 | T1043 | T1035 | arg2Of | and,is |
| R876 | T1044 | T1043 | arg2Of | sought,and |
| R877 | T1046 | T1044 | arg3Of | identify,sought |
| R878 | T1046 | T1045 | arg1Of | identify,to |
| R879 | T1049 | T1046 | arg2Of | kinase19,identify |
| R880 | T1049 | T1047 | arg1Of | kinase19,the |
| R881 | T1049 | T1048 | arg1Of | kinase19,responsible |
| R882 | T1052 | T1053 | arg1Of | we,aimed |
| R883 | T1052 | T1055 | arg1Of | we,define |
| R884 | T1053 | T1050 | arg1Of | aimed,Additionally |
| R885 | T1053 | T1051 | arg1Of | aimed,"," |
| R886 | T1055 | T1053 | arg2Of | define,aimed |
| R887 | T1055 | T1054 | arg1Of | define,to |
| R888 | T1058 | T1055 | arg2Of | role,define |
| R889 | T1058 | T1056 | arg1Of | role,a |
| R890 | T1058 | T1057 | arg1Of | role,regulatory |
| R891 | T1058 | T1059 | arg1Of | role,for |
| R892 | T1058 | T1065 | arg2Of | role,whose |
| R893 | T1062 | T1059 | arg2Of | tail,for |
| R894 | T1062 | T1060 | arg1Of | tail,the |
| R895 | T1062 | T1061 | arg1Of | tail,C-terminal |
| R896 | T1062 | T1063 | arg1Of | tail,of |
| R897 | T1064 | T1063 | arg2Of | RPS3,of |
| R898 | T1066 | T1065 | arg1Of | function,whose |
| R899 | T1066 | T1067 | arg1Of | function,was |
| R900 | T1066 | T1068 | arg1Of | function,"unknown. Here" |
| R901 | T1068 | T1067 | arg2Of | "unknown. Here",was |
| R902 | T1069 | T1070 | arg1Of | we,show |
| R903 | T1070 | T1068 | arg2Of | show,"unknown. Here" |
| R904 | T1071 | T1070 | arg2Of | that,show |
| R905 | T1073 | T1070 | arg3Of | Inhibitor,show |
| R906 | T1073 | T1072 | arg1Of | Inhibitor,the |
| R907 | T1073 | T1074 | arg1Of | Inhibitor,of |
| R908 | T1073 | T1086 | arg1Of | Inhibitor,at |
| R909 | T1077 | T1076 | arg2Of | IκB,( |
| R910 | T1078 | T1076 | arg3Of | ),( |
| R911 | T1080 | T1075 | arg1Of | beta,κB |
| R912 | T1080 | T1076 | arg1Of | beta,( |
| R913 | T1080 | T1079 | arg1Of | beta,kinase |
| R914 | T1080 | T1081 | arg1Of | beta,( |
| R915 | T1082 | T1081 | arg2Of | IKKβ,( |
| R916 | T1083 | T1081 | arg3Of | ),( |
| R917 | T1085 | T1074 | arg2Of | RPS3,of |
| R918 | T1085 | T1080 | arg1Of | RPS3,beta |
| R919 | T1085 | T1084 | arg2Of | RPS3,phosphorylated |
| R920 | T1087 | T1086 | arg2Of | serine,at |
| R921 | T1087 | T1088 | arg1Of | serine,209 |
| R922 | T1087 | T1089 | arg1Of | serine,( |
| R923 | T1090 | T1089 | arg2Of | S209,( |
| R924 | T1091 | T1089 | arg3Of | ),( |
| R925 | T1094 | T1092 | arg1Of | phosphorylation,RPS3 |
| R926 | T1094 | T1093 | arg1Of | phosphorylation,S209 |
| R927 | T1094 | T1095 | arg1Of | phosphorylation,enhanced |
| R928 | T1095 | T1100 | arg1Of | enhanced,"," |
| R929 | T1097 | T1095 | arg2Of | association,enhanced |
| R930 | T1097 | T1096 | arg1Of | association,its |
| R931 | T1097 | T1098 | arg1Of | association,with |
| R932 | T1099 | T1098 | arg2Of | importin-α,with |
| R933 | T1101 | T1095 | arg3Of | mediating,enhanced |
| R934 | T1103 | T1101 | arg2Of | entry,mediating |
| R935 | T1103 | T1102 | arg1Of | entry,RPS3 |
| R936 | T1103 | T1104 | arg1Of | entry,into |
| R937 | T1107 | T1104 | arg2Of | pathway,into |
| R938 | T1107 | T1105 | arg1Of | pathway,the |
| R939 | T1107 | T1106 | arg1Of | pathway,karyopherin |
| R940 | T1107 | T1108 | arg1Of | pathway,for |
| R941 | T1110 | T1108 | arg2Of | translocation,for |
| R942 | T1110 | T1109 | arg1Of | translocation,nuclear |
| R943 | T1115 | T1113 | arg1Of | effector,the E. |
| R944 | T1115 | T1114 | arg1Of | effector,coli NleH1 |
| R945 | T1115 | T1117 | arg1Of | effector,inhibited |
| R946 | T1117 | T1111 | arg1Of | inhibited,Furthermore |
| R947 | T1117 | T1112 | arg1Of | inhibited,"," |
| R948 | T1117 | T1116 | arg1Of | inhibited,specifically |
| R949 | T1119 | T1117 | arg2Of | S209,inhibited |
| R950 | T1119 | T1118 | arg1Of | S209,RPS3 |
| R951 | T1119 | T1120 | arg1Of | S209,revealing |
| R952 | T1122 | T1120 | arg2Of | coli O157,revealing |
| R953 | T1122 | T1121 | arg1Of | coli O157,how E. |
| R954 | T1122 | T1123 | arg1Of | coli O157,: |
| R955 | T1124 | T1125 | arg1Of | H7,inhibits |
| R956 | T1125 | T1123 | arg2Of | inhibits,: |
| R957 | T1131 | T1125 | arg2Of | mechanism,inhibits |
| R958 | T1131 | T1126 | arg1Of | mechanism,this |
| R959 | T1131 | T1127 | arg1Of | mechanism,important |
| R960 | T1131 | T1128 | arg1Of | mechanism,innate |
| R961 | T1131 | T1129 | arg1Of | mechanism,immune |
| R962 | T1131 | T1130 | arg1Of | mechanism,response |
| R1587 | T2018 | T2017 | arg1Of | phosphorylation,RPS3 |
| R1588 | T2018 | T2019 | arg1Of | phosphorylation,in |
| R1589 | T2019 | T2021 | arg1Of | in,to |
| R1590 | T2020 | T2019 | arg2Of | response,in |
| R1591 | T2023 | T2019 | arg3Of | activation,in |
| R1592 | T2023 | T2022 | arg1Of | activation,NF-κB |
| R1593 | T2025 | T2024 | arg1Of | test,To |
| R1594 | T2027 | T2028 | arg1Of | RPS3,is |
| R1595 | T2027 | T2029 | arg2Of | RPS3,phosphorylated |
| R1596 | T2029 | T2025 | arg2Of | phosphorylated,test |
| R1597 | T2029 | T2026 | arg1Of | phosphorylated,whether |
| R1598 | T2029 | T2028 | arg2Of | phosphorylated,is |
| R1599 | T2029 | T2030 | arg1Of | phosphorylated,during |
| R1600 | T2032 | T2030 | arg2Of | activation,during |
| R1601 | T2032 | T2031 | arg1Of | activation,NF-κB |
| R1602 | T2034 | T2025 | arg1Of | we,test |
| R1603 | T2034 | T2035 | arg1Of | we,performed |
| R1604 | T2035 | T2024 | modOf | performed,To |
| R1605 | T2035 | T2033 | arg1Of | performed,"," |
| R1606 | T2037 | T2035 | arg2Of | experiments,performed |
| R1607 | T2037 | T2036 | arg1Of | experiments,32P-labeling |
| R1608 | T2037 | T2038 | arg1Of | experiments,in |
| R1609 | T2043 | T2042 | arg2Of | TNF,( |
| R1610 | T2044 | T2042 | arg3Of | ),( |
| R1611 | T2048 | T2038 | arg2Of | cells,in |
| R1612 | T2048 | T2039 | arg1Of | cells,tumor |
| R1613 | T2048 | T2040 | arg1Of | cells,necrosis |
| R1614 | T2048 | T2041 | arg1Of | cells,factor |
| R1615 | T2048 | T2042 | arg1Of | cells,( |
| R1616 | T2048 | T2045 | arg1Of | cells,-stimulated |
| R1617 | T2048 | T2046 | arg1Of | cells,HEK |
| R1618 | T2048 | T2047 | arg1Of | cells,293T |
| R1619 | T2050 | T2051 | arg1Of | RPS3,was |
| R1620 | T2050 | T2053 | arg2Of | RPS3,phosphorylated |
| R1621 | T2053 | T2049 | arg2Of | phosphorylated,While |
| R1622 | T2053 | T2051 | arg2Of | phosphorylated,was |
| R1623 | T2053 | T2052 | arg1Of | phosphorylated,scarcely |
| R1624 | T2053 | T2054 | arg1Of | phosphorylated,in |
| R1625 | T2056 | T2054 | arg2Of | cells,in |
| R1626 | T2056 | T2055 | arg1Of | cells,unstimulated |
| R1627 | T2058 | T2059 | arg1Of | we,observed |
| R1628 | T2059 | T2049 | arg1Of | observed,While |
| R1629 | T2059 | T2057 | arg1Of | observed,"," |
| R1630 | T2059 | T2068 | arg1Of | observed,despite |
| R1631 | T2062 | T2059 | arg2Of | increase,observed |
| R1632 | T2062 | T2060 | arg1Of | increase,a |
| R1633 | T2062 | T2061 | arg1Of | increase,marked |
| R1634 | T2062 | T2063 | arg1Of | increase,in |
| R1635 | T2062 | T2065 | arg1Of | increase,after |
| R1636 | T2064 | T2063 | arg2Of | 32P-incorporation,in |
| R1637 | T2067 | T2065 | arg2Of | stimulation,after |
| R1638 | T2067 | T2066 | arg1Of | stimulation,TNF |
| R1639 | T2070 | T2068 | arg2Of | increase,despite |
| R1640 | T2070 | T2069 | arg1Of | increase,no |
| R1641 | T2070 | T2071 | arg1Of | increase,in |
| R1642 | T2073 | T2071 | arg2Of | protein,in |
| R1643 | T2073 | T2072 | arg1Of | protein,RPS3 |
| R1644 | T2073 | T2074 | arg1Of | protein,( |
| R1645 | T2076 | T2074 | arg2Of | 1a,( |
| R1646 | T2076 | T2075 | arg1Of | 1a,Fig. |
| R1647 | T2077 | T2074 | arg3Of | ),( |
| R1648 | T2079 | T2078 | arg1Of | determine,To |
| R1649 | T2080 | T2079 | arg2Of | which,determine |
| R1650 | T2082 | T2080 | arg1Of | residues,which |
| R1651 | T2082 | T2081 | arg1Of | residues,RPS3 |
| R1652 | T2082 | T2083 | arg1Of | residues,were |
| R1653 | T2082 | T2084 | arg2Of | residues,phosphorylated |
| R1654 | T2084 | T2083 | arg2Of | phosphorylated,were |
| R1655 | T2086 | T2087 | arg1Of | we,immunoprecipitated |
| R1656 | T2087 | T2078 | modOf | immunoprecipitated,To |
| R1657 | T2087 | T2085 | arg1Of | immunoprecipitated,"," |
| R1658 | T2088 | T2087 | arg2Of | RPS3,immunoprecipitated |
| R1659 | T2088 | T2089 | arg1Of | RPS3,from |
| R1660 | T2091 | T2092 | arg1Of | resting,or |
| R1661 | T2092 | T2095 | arg1Of | or,and |
| R1662 | T2094 | T2092 | arg2Of | cells,or |
| R1663 | T2094 | T2093 | arg2Of | cells,stimulated |
| R1664 | T2095 | T2089 | arg2Of | and,from |
| R1665 | T2095 | T2090 | arg1Of | and,either |
| R1666 | T2095 | T2098 | arg1Of | and,with |
| R1667 | T2097 | T2095 | arg2Of | immunoblotting,and |
| R1668 | T2097 | T2096 | arg2Of | immunoblotting,performed |
| R1669 | T2100 | T2098 | arg2Of | antibodies,with |
| R1670 | T2100 | T2099 | arg1Of | antibodies,phosphorylation-specific |
| R1671 | T2102 | T2103 | arg1Of | TNF,and |
| R1672 | T2103 | T2101 | arg1Of | and,Both |
| R1673 | T2103 | T2110 | arg1Of | and,stimulated |
| R1674 | T2106 | T2103 | arg2Of | acetate/ionomycin,and |
| R1675 | T2106 | T2104 | arg1Of | acetate/ionomycin,phorbol |
| R1676 | T2106 | T2105 | arg1Of | acetate/ionomycin,myristate |
| R1677 | T2106 | T2107 | arg1Of | acetate/ionomycin,( |
| R1678 | T2108 | T2107 | arg2Of | PMA+I,( |
| R1679 | T2109 | T2107 | arg3Of | ),( |
| R1680 | T2110 | T2117 | arg1Of | stimulated,within |
| R1681 | T2112 | T2111 | arg1Of | phosphorylation,rapid |
| R1682 | T2112 | T2113 | arg1Of | phosphorylation,and |
| R1683 | T2113 | T2110 | arg2Of | and,stimulated |
| R1684 | T2114 | T2113 | arg2Of | degradaion,and |
| R1685 | T2114 | T2115 | arg1Of | degradaion,of |
| R1686 | T2116 | T2115 | arg2Of | IκBα,of |
| R1687 | T2119 | T2117 | arg2Of | min,within |
| R1688 | T2119 | T2118 | arg1Of | min,5 |
| R1689 | T2119 | T2120 | arg1Of | min,which |
| R1690 | T2119 | T2121 | arg1Of | min,was |
| R1691 | T2119 | T2122 | arg2Of | min,accompanied |
| R1692 | T2122 | T2121 | arg2Of | accompanied,was |
| R1693 | T2125 | T2122 | arg1Of | phosphorylation,accompanied |
| R1694 | T2125 | T2123 | arg2Of | phosphorylation,by |
| R1695 | T2125 | T2124 | arg1Of | phosphorylation,RPS3 |
| R1696 | T2125 | T2126 | arg1Of | phosphorylation,on |
| R1697 | T2128 | T2126 | arg2Of | residues,on |
| R1698 | T2128 | T2127 | arg1Of | residues,serine |
| R1699 | T2128 | T2129 | arg1Of | residues,( |
| R1700 | T2128 | T2137 | arg1Of | residues,"," |
| R1701 | T2128 | T2138 | arg1Of | residues,similar |
| R1702 | T2131 | T2130 | arg1Of | 1b,Fig. |
| R1703 | T2131 | T2132 | arg1Of | 1b,and |
| R1704 | T2132 | T2129 | arg2Of | and,( |
| R1705 | T2133 | T2132 | arg2Of | data,and |
| R1706 | T2133 | T2135 | arg2Of | data,shown |
| R1707 | T2135 | T2134 | arg1Of | shown,not |
| R1708 | T2136 | T2129 | arg3Of | ),( |
| R1709 | T2138 | T2139 | arg1Of | similar,to |
| R1710 | T2142 | T2141 | arg1Of | vivo,in |
| R1711 | T2143 | T2139 | arg2Of | labeling,to |
| R1712 | T2143 | T2140 | arg1Of | labeling,the |
| R1713 | T2143 | T2142 | arg1Of | labeling,vivo |
| R1714 | T2144 | T2145 | arg1Of | We,did |
| R1715 | T2144 | T2147 | arg1Of | We,detect |
| R1716 | T2147 | T2145 | arg2Of | detect,did |
| R1717 | T2147 | T2146 | arg1Of | detect,not |
| R1718 | T2148 | T2149 | arg1Of | tyrosine-,or |
| R1719 | T2149 | T2147 | arg2Of | or,detect |
| R1720 | T2149 | T2151 | arg1Of | or,of |
| R1721 | T2150 | T2149 | arg2Of | threonine-phosphorylation,or |
| R1722 | T2152 | T2151 | arg2Of | RPS3,of |
| R1723 | T2152 | T2153 | arg1Of | RPS3,( |
| R1724 | T2155 | T2153 | arg2Of | 1b,( |
| R1725 | T2155 | T2154 | arg1Of | 1b,Fig. |
| R1726 | T2156 | T2153 | arg3Of | ),( |
| R2062 | T2641 | T2642 | arg1Of | RPS3,and |
| R2063 | T2643 | T2642 | arg2Of | IKKβ,and |
| R2064 | T2644 | T2641 | arg1Of | interaction,RPS3 |
| R2065 | T2644 | T2643 | arg1Of | interaction,IKKβ |
| R2066 | T2646 | T2645 | arg1Of | activation,The |
| R2067 | T2646 | T2647 | arg1Of | activation,of |
| R2068 | T2646 | T2656 | arg1Of | activation,"," |
| R2069 | T2646 | T2657 | arg1Of | activation,consisting |
| R2070 | T2646 | T2672 | arg1Of | activation,is |
| R2071 | T2646 | T2673 | arg1Of | activation,critical |
| R2072 | T2649 | T2647 | arg2Of | inhibitor,of |
| R2073 | T2649 | T2648 | arg1Of | inhibitor,the |
| R2074 | T2649 | T2650 | arg1Of | inhibitor,of |
| R2075 | T2652 | T2650 | arg2Of | kinase,of |
| R2076 | T2652 | T2651 | arg1Of | kinase,κB |
| R2077 | T2652 | T2653 | arg1Of | kinase,( |
| R2078 | T2654 | T2653 | arg2Of | IKK,( |
| R2079 | T2655 | T2653 | arg3Of | ),( |
| R2080 | T2657 | T2658 | arg1Of | consisting,of |
| R2081 | T2662 | T2659 | arg1Of | IKKγ,a |
| R2082 | T2662 | T2660 | arg1Of | IKKγ,regulatory |
| R2083 | T2662 | T2661 | arg1Of | IKKγ,subunit |
| R2084 | T2662 | T2663 | arg1Of | IKKγ,and |
| R2085 | T2663 | T2658 | arg2Of | and,of |
| R2086 | T2663 | T2667 | arg1Of | and,"," |
| R2087 | T2666 | T2663 | arg2Of | subunits,and |
| R2088 | T2666 | T2664 | arg1Of | subunits,two |
| R2089 | T2666 | T2665 | arg1Of | subunits,catalytic |
| R2090 | T2668 | T2669 | arg1Of | IKKα,and |
| R2091 | T2669 | T2667 | arg2Of | and,"," |
| R2092 | T2670 | T2669 | arg2Of | IKKβ,and |
| R2093 | T2672 | T2671 | arg1Of | is,"," |
| R2094 | T2673 | T2672 | arg2Of | critical,is |
| R2095 | T2673 | T2674 | arg1Of | critical,for |
| R2096 | T2676 | T2677 | arg1Of | phosphorylation,and |
| R2097 | T2677 | T2675 | arg1Of | and,the |
| R2098 | T2677 | T2679 | arg1Of | and,of |
| R2099 | T2677 | T2683 | arg1Of | and,and |
| R2100 | T2678 | T2677 | arg2Of | dispatch,and |
| R2101 | T2682 | T2679 | arg2Of | IκBs,of |
| R2102 | T2682 | T2680 | arg1Of | IκBs,the |
| R2103 | T2682 | T2681 | arg1Of | IκBs,inhibitory |
| R2104 | T2683 | T2674 | arg2Of | and,for |
| R2105 | T2685 | T2683 | arg2Of | liberation,and |
| R2106 | T2685 | T2684 | arg1Of | liberation,the |
| R2107 | T2685 | T2686 | arg1Of | liberation,of |
| R2108 | T2687 | T2686 | arg2Of | NF-κB20-22,of |
| R2109 | T2690 | T2688 | arg2Of | RPS3,Given |
| R2110 | T2690 | T2689 | arg1Of | RPS3,that |
| R2111 | T2690 | T2691 | arg1Of | RPS3,can |
| R2112 | T2690 | T2692 | arg1Of | RPS3,be |
| R2113 | T2690 | T2693 | arg2Of | RPS3,found |
| R2114 | T2693 | T2691 | arg2Of | found,can |
| R2115 | T2693 | T2692 | arg2Of | found,be |
| R2116 | T2693 | T2694 | arg1Of | found,in |
| R2117 | T2693 | T2703 | arg1Of | found,"," |
| R2118 | T2699 | T2694 | arg2Of | complex,in |
| R2119 | T2699 | T2695 | arg1Of | complex,the |
| R2120 | T2699 | T2696 | arg1Of | complex,cytoplasmic |
| R2121 | T2699 | T2697 | arg1Of | complex,p65-p50-IκBα |
| R2122 | T2699 | T2698 | arg1Of | complex,inhibitory |
| R2123 | T2699 | T2700 | arg1Of | complex,in |
| R2124 | T2702 | T2700 | arg2Of | cells6,in |
| R2125 | T2702 | T2701 | arg1Of | cells6,resting |
| R2126 | T2704 | T2705 | arg1Of | we,hypothesized |
| R2127 | T2705 | T2703 | arg2Of | hypothesized,"," |
| R2128 | T2708 | T2707 | arg2Of | IKKβ,activated |
| R2129 | T2708 | T2709 | arg1Of | IKKβ,might |
| R2130 | T2708 | T2711 | arg1Of | IKKβ,bind |
| R2131 | T2708 | T2714 | arg1Of | IKKβ,phosphorylate |
| R2132 | T2711 | T2712 | arg1Of | bind,to |
| R2133 | T2711 | T2713 | arg1Of | bind,and |
| R2134 | T2713 | T2705 | arg2Of | and,hypothesized |
| R2135 | T2713 | T2706 | arg1Of | and,that |
| R2136 | T2713 | T2709 | arg2Of | and,might |
| R2137 | T2713 | T2710 | arg1Of | and,also |
| R2138 | T2714 | T2713 | arg2Of | phosphorylate,and |
| R2139 | T2715 | T2714 | arg2Of | RPS3,phosphorylate |
| R2140 | T2718 | T2719 | arg1Of | we,found |
| R2141 | T2719 | T2716 | arg1Of | found,First |
| R2142 | T2719 | T2717 | arg1Of | found,"," |
| R2143 | T2722 | T2721 | arg1Of | expressed,ectopically |
| R2144 | T2723 | T2724 | arg1Of | IKKβ,and |
| R2145 | T2724 | T2722 | arg1Of | and,expressed |
| R2146 | T2724 | T2726 | arg1Of | and,interacted |
| R2147 | T2725 | T2724 | arg2Of | RPS3,and |
| R2148 | T2726 | T2719 | arg2Of | interacted,found |
| R2149 | T2726 | T2720 | arg1Of | interacted,that |
| R2150 | T2726 | T2727 | arg1Of | interacted,( |
| R2151 | T2729 | T2727 | arg2Of | 1c,( |
| R2152 | T2729 | T2728 | arg1Of | 1c,Fig. |
| R2153 | T2730 | T2727 | arg3Of | ),( |
| R2154 | T2731 | T2733 | arg1Of | We,examined |
| R2155 | T2731 | T2738 | arg1Of | We,detected |
| R2156 | T2731 | T2750 | arg1Of | We,accounting |
| R2157 | T2733 | T2737 | arg1Of | examined,and |
| R2158 | T2736 | T2733 | arg2Of | cells,examined |
| R2159 | T2736 | T2734 | arg1Of | cells,resting |
| R2160 | T2736 | T2735 | arg1Of | cells,Jurkat |
| R2161 | T2737 | T2732 | arg1Of | and,next |
| R2162 | T2737 | T2748 | arg1Of | and,"," |
| R2163 | T2737 | T2750 | modOf | and,accounting |
| R2164 | T2738 | T2737 | arg2Of | detected,and |
| R2165 | T2743 | T2738 | arg2Of | interaction,detected |
| R2166 | T2743 | T2739 | arg1Of | interaction,a |
| R2167 | T2743 | T2740 | arg1Of | interaction,modest |
| R2168 | T2743 | T2741 | arg1Of | interaction,endogenous |
| R2169 | T2743 | T2742 | arg1Of | interaction,IKKβ-RPS3 |
| R2170 | T2743 | T2744 | arg1Of | interaction,( |
| R2171 | T2746 | T2744 | arg2Of | 1d,( |
| R2172 | T2746 | T2745 | arg1Of | 1d,Fig. |
| R2173 | T2747 | T2744 | arg3Of | ),( |
| R2174 | T2750 | T2749 | arg1Of | accounting,potentially |
| R2175 | T2750 | T2751 | arg1Of | accounting,for |
| R2176 | T2755 | T2751 | arg2Of | transcription,for |
| R2177 | T2755 | T2752 | arg1Of | transcription,the |
| R2178 | T2755 | T2753 | arg1Of | transcription,basal |
| R2179 | T2755 | T2754 | arg1Of | transcription,NF-κB |
| R2180 | T2755 | T2756 | arg2Of | transcription,required |
| R2181 | T2756 | T2757 | arg1Of | required,for |
| R2182 | T2759 | T2760 | arg1Of | proliferation,and |
| R2183 | T2760 | T2757 | arg2Of | and,for |
| R2184 | T2760 | T2758 | arg1Of | and,cell |
| R2185 | T2761 | T2760 | arg2Of | survival,and |
| R2186 | T2763 | T2762 | arg1Of | association,RPS3-IKKβ |
| R2187 | T2763 | T2764 | arg1Of | association,was |
| R2188 | T2763 | T2766 | arg2Of | association,augmented |
| R2189 | T2763 | T2771 | arg1Of | association,peaking |
| R2190 | T2766 | T2764 | arg2Of | augmented,was |
| R2191 | T2766 | T2765 | arg1Of | augmented,clearly |
| R2192 | T2766 | T2767 | arg1Of | augmented,upon |
| R2193 | T2766 | T2770 | arg1Of | augmented,"," |
| R2194 | T2766 | T2771 | modOf | augmented,peaking |
| R2195 | T2766 | T2779 | arg1Of | augmented,"," |
| R2196 | T2766 | T2780 | arg1Of | augmented,following |
| R2197 | T2769 | T2767 | arg2Of | stimulation,upon |
| R2198 | T2769 | T2768 | arg1Of | stimulation,TNF |
| R2199 | T2771 | T2772 | arg1Of | peaking,at |
| R2200 | T2774 | T2772 | arg2Of | min.,at |
| R2201 | T2774 | T2773 | arg1Of | min.,10 |
| R2202 | T2774 | T2775 | arg1Of | min.,( |
| R2203 | T2777 | T2775 | arg2Of | 1d,( |
| R2204 | T2777 | T2776 | arg1Of | 1d,Fig. |
| R2205 | T2778 | T2775 | arg3Of | ),( |
| R2206 | T2782 | T2780 | arg2Of | kinetics,following |
| R2207 | T2782 | T2781 | arg1Of | kinetics,similar |
| R2208 | T2782 | T2783 | arg1Of | kinetics,to |
| R2209 | T2786 | T2783 | arg2Of | phosphorylation,to |
| R2210 | T2786 | T2784 | arg1Of | phosphorylation,RPS3 |
| R2211 | T2786 | T2785 | arg1Of | phosphorylation,serine |
| R2212 | T2786 | T2787 | arg1Of | phosphorylation,( |
| R2213 | T2789 | T2787 | arg2Of | 1b,( |
| R2214 | T2789 | T2788 | arg1Of | 1b,Fig. |
| R2215 | T2790 | T2787 | arg3Of | ),( |
| R2216 | T2792 | T2791 | arg2Of | contrast,By |
| R2217 | T2794 | T2795 | arg1Of | there,was |
| R2218 | T2795 | T2791 | arg1Of | was,By |
| R2219 | T2795 | T2793 | arg1Of | was,"," |
| R2220 | T2798 | T2795 | arg2Of | interaction,was |
| R2221 | T2798 | T2796 | arg1Of | interaction,no |
| R2222 | T2798 | T2797 | arg1Of | interaction,detectable |
| R2223 | T2798 | T2799 | arg1Of | interaction,between |
| R2224 | T2800 | T2801 | arg1Of | RPS3,and |
| R2225 | T2801 | T2799 | arg2Of | and,between |
| R2226 | T2801 | T2803 | arg1Of | and,( |
| R2227 | T2802 | T2801 | arg2Of | IKKα,and |
| R2228 | T2805 | T2803 | arg2Of | 1d,( |
| R2229 | T2805 | T2804 | arg1Of | 1d,Fig. |
| R2230 | T2806 | T2803 | arg3Of | ),( |
| R2766 | T3544 | T3545 | arg1Of | IKKβ,is |
| R2767 | T3544 | T3546 | arg2Of | IKKβ,required |
| R2768 | T3546 | T3545 | arg2Of | required,is |
| R2769 | T3546 | T3547 | arg1Of | required,for |
| R2770 | T3550 | T3547 | arg2Of | translocation,for |
| R2771 | T3550 | T3548 | arg1Of | translocation,RPS3 |
| R2772 | T3550 | T3549 | arg1Of | translocation,nuclear |
| R2773 | T3552 | T3551 | arg1Of | examine,To |
| R2774 | T3556 | T3554 | arg1Of | interaction,the |
| R2775 | T3556 | T3555 | arg1Of | interaction,RPS3-IKKβ |
| R2776 | T3556 | T3557 | arg1Of | interaction,is |
| R2777 | T3556 | T3558 | arg2Of | interaction,required |
| R2778 | T3558 | T3552 | arg2Of | required,examine |
| R2779 | T3558 | T3553 | arg1Of | required,whether |
| R2780 | T3558 | T3557 | arg2Of | required,is |
| R2781 | T3558 | T3559 | arg1Of | required,for |
| R2782 | T3562 | T3559 | arg2Of | translocation,for |
| R2783 | T3562 | T3560 | arg1Of | translocation,RPS3 |
| R2784 | T3562 | T3561 | arg1Of | translocation,nuclear |
| R2785 | T3564 | T3552 | arg1Of | we,examine |
| R2786 | T3564 | T3565 | arg1Of | we,knocked |
| R2787 | T3565 | T3551 | modOf | knocked,To |
| R2788 | T3565 | T3563 | arg1Of | knocked,"," |
| R2789 | T3565 | T3566 | arg1Of | knocked,down |
| R2790 | T3567 | T3568 | arg1Of | IKKα,or |
| R2791 | T3568 | T3565 | arg2Of | or,knocked |
| R2792 | T3568 | T3571 | arg1Of | or,with |
| R2793 | T3570 | T3568 | arg2Of | expression,or |
| R2794 | T3570 | T3569 | arg1Of | expression,IKKβ |
| R2795 | T3572 | T3573 | arg1Of | siRNAs,( |
| R2796 | T3572 | T3578 | arg1Of | siRNAs,and |
| R2797 | T3575 | T3573 | arg2Of | Fig.,( |
| R2798 | T3575 | T3574 | arg1Of | Fig.,Supplementary |
| R2799 | T3575 | T3576 | arg1Of | Fig.,1 |
| R2800 | T3577 | T3573 | arg3Of | ),( |
| R2801 | T3578 | T3571 | arg2Of | and,with |
| R2802 | T3580 | T3579 | arg1Of | observed,then |
| R2803 | T3584 | T3578 | arg2Of | migration,and |
| R2804 | T3584 | T3580 | arg1Of | migration,observed |
| R2805 | T3584 | T3581 | arg1Of | migration,stimulation-induced |
| R2806 | T3584 | T3582 | arg1Of | migration,RPS3 |
| R2807 | T3584 | T3583 | arg1Of | migration,nuclear |
| R2808 | T3584 | T3585 | arg1Of | migration,by |
| R2809 | T3587 | T3585 | arg2Of | microscopy,by |
| R2810 | T3587 | T3586 | arg1Of | microscopy,confocal |
| R2811 | T3589 | T3590 | arg1Of | TNF,and |
| R2812 | T3590 | T3588 | arg1Of | and,Both |
| R2813 | T3590 | T3592 | arg1Of | and,triggered |
| R2814 | T3591 | T3590 | arg2Of | PMA+I,and |
| R2815 | T3595 | T3592 | arg2Of | translocation,triggered |
| R2816 | T3595 | T3593 | arg1Of | translocation,RPS3 |
| R2817 | T3595 | T3594 | arg1Of | translocation,nuclear |
| R2818 | T3595 | T3596 | arg1Of | translocation,in |
| R2819 | T3598 | T3596 | arg2Of | cells,in |
| R2820 | T3598 | T3597 | arg1Of | cells,Jurkat |
| R2821 | T3598 | T3599 | arg2Of | cells,transfected |
| R2822 | T3599 | T3600 | arg1Of | transfected,with |
| R2823 | T3605 | T3604 | arg2Of | NS,( |
| R2824 | T3606 | T3604 | arg3Of | ),( |
| R2825 | T3607 | T3600 | arg2Of | siRNA,with |
| R2826 | T3607 | T3601 | arg1Of | siRNA,a |
| R2827 | T3607 | T3602 | arg2Of | siRNA,scrambled |
| R2828 | T3607 | T3603 | arg1Of | siRNA,nonspecific |
| R2829 | T3607 | T3604 | arg1Of | siRNA,( |
| R2830 | T3607 | T3608 | arg1Of | siRNA,( |
| R2831 | T3607 | T3612 | arg1Of | siRNA,6 |
| R2832 | T3610 | T3608 | arg2Of | 2a,( |
| R2833 | T3610 | T3609 | arg1Of | 2a,Fig. |
| R2834 | T3611 | T3608 | arg3Of | ),( |
| R2835 | T3615 | T3613 | arg1Of | translocation,RPS3 |
| R2836 | T3615 | T3614 | arg1Of | translocation,nuclear |
| R2837 | T3615 | T3616 | arg1Of | translocation,was |
| R2838 | T3615 | T3624 | arg2Of | translocation,impaired |
| R2839 | T3618 | T3617 | arg1Of | slightly,only |
| R2840 | T3618 | T3620 | arg1Of | slightly,if |
| R2841 | T3620 | T3619 | arg1Of | if,"," |
| R2842 | T3621 | T3620 | arg2Of | at,if |
| R2843 | T3621 | T3622 | arg1Of | at,all |
| R2844 | T3624 | T3616 | arg2Of | impaired,was |
| R2845 | T3624 | T3618 | arg1Of | impaired,slightly |
| R2846 | T3624 | T3621 | arg1Of | impaired,at |
| R2847 | T3624 | T3623 | arg1Of | impaired,"," |
| R2848 | T3626 | T3624 | arg1Of | IKKα-silencing,impaired |
| R2849 | T3626 | T3625 | arg2Of | IKKα-silencing,by |
| R2850 | T3629 | T3630 | arg1Of | knockdown,of |
| R2851 | T3629 | T3632 | arg1Of | knockdown,attenuated |
| R2852 | T3631 | T3630 | arg2Of | IKKβ,of |
| R2853 | T3632 | T3627 | arg1Of | attenuated,Conversely |
| R2854 | T3632 | T3628 | arg1Of | attenuated,"," |
| R2855 | T3632 | T3639 | arg1Of | attenuated,following |
| R2856 | T3634 | T3632 | arg2Of | %,attenuated |
| R2857 | T3634 | T3633 | arg1Of | %,60-70 |
| R2858 | T3634 | T3635 | arg1Of | %,of |
| R2859 | T3638 | T3635 | arg2Of | accumulation,of |
| R2860 | T3638 | T3636 | arg1Of | accumulation,RPS3 |
| R2861 | T3638 | T3637 | arg1Of | accumulation,nuclear |
| R2862 | T3640 | T3639 | arg2Of | stimulation,following |
| R2863 | T3640 | T3641 | arg1Of | stimulation,( |
| R2864 | T3643 | T3641 | arg2Of | 2a,( |
| R2865 | T3643 | T3642 | arg1Of | 2a,Fig. |
| R2866 | T3644 | T3641 | arg3Of | ),( |
| R2867 | T3645 | T3646 | arg1Of | Immunoblotting,of |
| R2868 | T3645 | T3649 | arg1Of | Immunoblotting,confirmed |
| R2869 | T3648 | T3646 | arg2Of | fractions,of |
| R2870 | T3648 | T3647 | arg1Of | fractions,nuclear |
| R2871 | T3652 | T3651 | arg1Of | expression,full |
| R2872 | T3652 | T3653 | arg1Of | expression,of |
| R2873 | T3652 | T3660 | arg1Of | expression,was |
| R2874 | T3652 | T3661 | arg1Of | expression,necessary |
| R2875 | T3654 | T3656 | arg1Of | IKKβ,but |
| R2876 | T3656 | T3653 | arg2Of | but,of |
| R2877 | T3656 | T3655 | arg1Of | but,"," |
| R2878 | T3656 | T3657 | arg1Of | but,not |
| R2879 | T3658 | T3656 | arg2Of | IKKα,but |
| R2880 | T3660 | T3649 | arg2Of | was,confirmed |
| R2881 | T3660 | T3650 | arg1Of | was,that |
| R2882 | T3660 | T3659 | arg1Of | was,"," |
| R2883 | T3661 | T3660 | arg2Of | necessary,was |
| R2884 | T3661 | T3662 | arg1Of | necessary,for |
| R2885 | T3666 | T3662 | arg2Of | translocation,for |
| R2886 | T3666 | T3663 | arg1Of | translocation,activation-induced |
| R2887 | T3666 | T3664 | arg1Of | translocation,RPS3 |
| R2888 | T3666 | T3665 | arg1Of | translocation,nuclear |
| R2889 | T3666 | T3667 | arg1Of | translocation,( |
| R2890 | T3669 | T3667 | arg2Of | 2b,( |
| R2891 | T3669 | T3668 | arg1Of | 2b,Fig. |
| R2892 | T3670 | T3667 | arg3Of | ),( |
| R2893 | T3672 | T3671 | arg1Of | immunoblots,Control |
| R2894 | T3672 | T3673 | arg1Of | immunoblots,revealed |
| R2895 | T3677 | T3675 | arg1Of | translocation,p65 |
| R2896 | T3677 | T3676 | arg1Of | translocation,nuclear |
| R2897 | T3677 | T3678 | arg1Of | translocation,was |
| R2898 | T3677 | T3679 | arg2Of | translocation,blocked |
| R2899 | T3679 | T3673 | arg2Of | blocked,revealed |
| R2900 | T3679 | T3674 | arg1Of | blocked,that |
| R2901 | T3679 | T3678 | arg2Of | blocked,was |
| R2902 | T3679 | T3680 | arg1Of | blocked,under |
| R2903 | T3679 | T3684 | arg1Of | blocked,( |
| R2904 | T3683 | T3680 | arg2Of | conditions,under |
| R2905 | T3683 | T3681 | arg1Of | conditions,the |
| R2906 | T3683 | T3682 | arg1Of | conditions,same |
| R2907 | T3686 | T3684 | arg2Of | 2b,( |
| R2908 | T3686 | T3685 | arg1Of | 2b,Fig. |
| R2909 | T3687 | T3684 | arg3Of | ),( |
| R2910 | T3688 | T3690 | arg1Of | We,examined |
| R2911 | T3690 | T3689 | arg1Of | examined,next |
| R2912 | T3693 | T3690 | arg2Of | translocation,examined |
| R2913 | T3693 | T3691 | arg1Of | translocation,the |
| R2914 | T3693 | T3692 | arg1Of | translocation,nuclear |
| R2915 | T3693 | T3694 | arg1Of | translocation,of |
| R2916 | T3693 | T3696 | arg1Of | translocation,in |
| R2917 | T3695 | T3694 | arg2Of | RPS3,of |
| R2918 | T3697 | T3699 | arg1Of | cells,expressing |
| R2919 | T3697 | T3705 | arg1Of | cells,or |
| R2920 | T3699 | T3698 | arg1Of | expressing,ectopically |
| R2921 | T3701 | T3699 | arg2Of | kinase-dead,expressing |
| R2922 | T3701 | T3700 | arg1Of | kinase-dead,either |
| R2923 | T3701 | T3702 | arg1Of | kinase-dead,( |
| R2924 | T3703 | T3702 | arg2Of | SSAA,( |
| R2925 | T3704 | T3702 | arg3Of | ),( |
| R2926 | T3705 | T3696 | arg2Of | or,in |
| R2927 | T3708 | T3707 | arg2Of | SSEE,( |
| R2928 | T3709 | T3707 | arg3Of | ),( |
| R2929 | T3712 | T3705 | arg2Of | proteins,or |
| R2930 | T3712 | T3706 | arg1Of | proteins,constitutively-active |
| R2931 | T3712 | T3707 | arg1Of | proteins,( |
| R2932 | T3712 | T3710 | arg1Of | proteins,mutant |
| R2933 | T3712 | T3711 | arg1Of | proteins,IKKβ |
| R2934 | T3714 | T3713 | arg2Of | expected,As |
| R2935 | T3717 | T3719 | arg1Of | SSEE,but |
| R2936 | T3719 | T3718 | arg1Of | but,"," |
| R2937 | T3719 | T3720 | arg1Of | but,not |
| R2938 | T3719 | T3722 | arg1Of | but,"," |
| R2939 | T3721 | T3719 | arg2Of | SSAA,but |
| R2940 | T3722 | T3716 | arg1Of | ",",the |
| R2941 | T3722 | T3724 | arg1Of | ",",of |
| R2942 | T3722 | T3726 | arg1Of | ",",induced |
| R2943 | T3723 | T3722 | arg2Of | mutant,"," |
| R2944 | T3725 | T3724 | arg2Of | IKKβ,of |
| R2945 | T3726 | T3713 | arg1Of | induced,As |
| R2946 | T3726 | T3715 | arg1Of | induced,"," |
| R2947 | T3726 | T3731 | arg1Of | induced,( |
| R2948 | T3730 | T3726 | arg2Of | activity,induced |
| R2949 | T3730 | T3727 | arg1Of | activity,NF-κB-dependent |
| R2950 | T3730 | T3728 | arg1Of | activity,luciferase |
| R2951 | T3730 | T3729 | arg1Of | activity,reporter |
| R2952 | T3733 | T3731 | arg2Of | 2c,( |
| R2953 | T3733 | T3732 | arg1Of | 2c,Fig. |
| R2954 | T3733 | T3734 | arg1Of | 2c,"," |
| R2955 | T3735 | T3734 | arg2Of | left,"," |
| R2956 | T3736 | T3731 | arg3Of | ),( |
| R2957 | T3738 | T3739 | arg1Of | RPS3,remained |
| R2958 | T3739 | T3737 | arg2Of | remained,Whereas |
| R2959 | T3740 | T3741 | arg1Of | cytosolic,in |
| R2960 | T3742 | T3741 | arg2Of | IKKβ,in |
| R2961 | T3742 | T3743 | arg1Of | IKKβ,( |
| R2962 | T3744 | T3743 | arg2Of | SSAA,( |
| R2963 | T3745 | T3743 | arg3Of | ),( |
| R2964 | T3747 | T3739 | arg2Of | cells,remained |
| R2965 | T3747 | T3740 | arg1Of | cells,cytosolic |
| R2966 | T3747 | T3746 | arg1Of | cells,-expressing |
| R2967 | T3747 | T3748 | arg1Of | cells,( |
| R2968 | T3747 | T3754 | arg1Of | cells,"," |
| R2969 | T3750 | T3748 | arg2Of | 2c,( |
| R2970 | T3750 | T3749 | arg1Of | 2c,Fig. |
| R2971 | T3750 | T3751 | arg1Of | 2c,"," |
| R2972 | T3752 | T3751 | arg2Of | right,"," |
| R2973 | T3753 | T3748 | arg3Of | ),( |
| R2974 | T3757 | T3754 | arg2Of | proportion,"," |
| R2975 | T3757 | T3755 | arg1Of | proportion,a |
| R2976 | T3757 | T3756 | arg1Of | proportion,substantial |
| R2977 | T3757 | T3758 | arg1Of | proportion,of |
| R2978 | T3759 | T3758 | arg2Of | RPS3,of |
| R2979 | T3759 | T3760 | arg2Of | RPS3,translocated |
| R2980 | T3760 | T3761 | arg1Of | translocated,to |
| R2981 | T3763 | T3761 | arg2Of | nucleus,to |
| R2982 | T3763 | T3762 | arg1Of | nucleus,the |
| R2983 | T3763 | T3764 | arg1Of | nucleus,in |
| R2984 | T3765 | T3764 | arg2Of | cells,in |
| R2985 | T3765 | T3766 | arg1Of | cells,expressing |
| R2986 | T3767 | T3766 | arg2Of | IKKβ,expressing |
| R2987 | T3767 | T3768 | arg1Of | IKKβ,( |
| R2988 | T3767 | T3771 | arg1Of | IKKβ,( |
| R2989 | T3769 | T3768 | arg2Of | SSEE,( |
| R2990 | T3770 | T3768 | arg3Of | ),( |
| R2991 | T3773 | T3771 | arg2Of | 2c,( |
| R2992 | T3773 | T3772 | arg1Of | 2c,Fig. |
| R2993 | T3773 | T3774 | arg1Of | 2c,"," |
| R2994 | T3775 | T3774 | arg2Of | right,"," |
| R2995 | T3776 | T3771 | arg3Of | ),( |
| R2996 | T3778 | T3777 | arg1Of | percentage,The |
| R2997 | T3778 | T3779 | arg1Of | percentage,of |
| R2998 | T3778 | T3785 | arg1Of | percentage,increased |
| R2999 | T3780 | T3779 | arg2Of | cells,of |
| R3000 | T3780 | T3781 | arg1Of | cells,containing |
| R3001 | T3784 | T3781 | arg2Of | RPS3,containing |
| R3002 | T3784 | T3782 | arg1Of | RPS3,detectable |
| R3003 | T3784 | T3783 | arg1Of | RPS3,nuclear |
| R3004 | T3785 | T3786 | arg1Of | increased,5-fold |
| R3005 | T3785 | T3787 | arg1Of | increased,in |
| R3006 | T3785 | T3797 | arg1Of | increased,in |
| R3007 | T3785 | T3804 | arg1Of | increased,( |
| R3008 | T3787 | T3795 | arg1Of | in,but |
| R3009 | T3790 | T3789 | arg2Of | SSEE,( |
| R3010 | T3791 | T3789 | arg3Of | ),( |
| R3011 | T3793 | T3787 | arg2Of | cells,in |
| R3012 | T3793 | T3788 | arg1Of | cells,IKKβ |
| R3013 | T3793 | T3789 | arg1Of | cells,( |
| R3014 | T3793 | T3792 | arg1Of | cells,-expressing |
| R3015 | T3795 | T3794 | arg1Of | but,"," |
| R3016 | T3797 | T3795 | arg2Of | in,but |
| R3017 | T3797 | T3796 | arg1Of | in,not |
| R3018 | T3800 | T3799 | arg2Of | SSAA,( |
| R3019 | T3801 | T3799 | arg3Of | ),( |
| R3020 | T3803 | T3797 | arg2Of | ones,in |
| R3021 | T3803 | T3798 | arg1Of | ones,IKKβ |
| R3022 | T3803 | T3799 | arg1Of | ones,( |
| R3023 | T3803 | T3802 | arg1Of | ones,-expressing |
| R3024 | T3805 | T3806 | arg1Of | Fig.,2d |
| R3025 | T3805 | T3807 | arg1Of | Fig.,and |
| R3026 | T3807 | T3804 | arg2Of | and,( |
| R3027 | T3809 | T3807 | arg2Of | Fig.,and |
| R3028 | T3809 | T3808 | arg1Of | Fig.,Supplementary |
| R3029 | T3809 | T3810 | arg1Of | Fig.,2 |
| R3030 | T3811 | T3804 | arg3Of | ),( |
| R3031 | T3815 | T3814 | arg1Of | activity,IKKβ |
| R3032 | T3815 | T3816 | arg1Of | activity,is |
| R3033 | T3815 | T3817 | arg1Of | activity,necessary |
| R3034 | T3815 | T3819 | arg1Of | activity,sufficient |
| R3035 | T3816 | T3812 | arg1Of | is,Thus |
| R3036 | T3816 | T3813 | arg1Of | is,"," |
| R3037 | T3817 | T3818 | arg1Of | necessary,and |
| R3038 | T3818 | T3816 | arg2Of | and,is |
| R3039 | T3818 | T3820 | arg1Of | and,for |
| R3040 | T3819 | T3818 | arg2Of | sufficient,and |
| R3041 | T3823 | T3820 | arg2Of | translocation,for |
| R3042 | T3823 | T3821 | arg1Of | translocation,RPS3 |
| R3043 | T3823 | T3822 | arg1Of | translocation,nuclear |
| R3044 | T3823 | T3824 | arg1Of | translocation,in |
| R3045 | T3825 | T3824 | arg2Of | response,in |
| R3046 | T3825 | T3826 | arg1Of | response,to |
| R3047 | T3829 | T3826 | arg2Of | stimuli,to |
| R3048 | T3829 | T3827 | arg1Of | stimuli,NF-κB |
| R3049 | T3829 | T3828 | arg1Of | stimuli,activating |
| R4092 | T5161 | T5160 | arg1Of | degradation,IκBα |
| R4093 | T5161 | T5162 | arg1Of | degradation,and |
| R4094 | T5165 | T5162 | arg2Of | translocation,and |
| R4095 | T5165 | T5163 | arg1Of | translocation,RPS3 |
| R4096 | T5165 | T5164 | arg1Of | translocation,nuclear |
| R4097 | T5166 | T5167 | arg1Of | Importin-α,regulates |
| R4100 | T5170 | T5167 | arg2Of | import,regulates |
| R4101 | T5170 | T5168 | arg1Of | import,the |
| R4102 | T5174 | T5171 | arg2Of | subunits23,of |
| R4103 | T5174 | T5172 | arg1Of | subunits23,NF-κB |
| R4104 | T5174 | T5173 | arg1Of | subunits23,Rel |
| R4105 | T5174 | T5175 | arg1Of | subunits23,"," |
| R4106 | T5176 | T5175 | arg2Of | 24,"," |
| R4107 | T5177 | T5178 | arg1Of | RPS3,harbors |
| R4108 | T5178 | T5187 | arg1Of | harbors,and |
| R4109 | T5182 | T5180 | arg1Of | signal,nuclear |
| R4110 | T5182 | T5181 | arg1Of | signal,localization |
| R4111 | T5182 | T5183 | arg1Of | signal,( |
| R4112 | T5184 | T5183 | arg2Of | NLS,( |
| R4113 | T5185 | T5183 | arg3Of | ),( |
| R4114 | T5186 | T5178 | arg2Of | sequence,harbors |
| R4115 | T5186 | T5179 | arg1Of | sequence,a |
| R4116 | T5186 | T5182 | arg1Of | sequence,signal |
| R4117 | T5190 | T5188 | arg1Of | translocation,its |
| R4118 | T5190 | T5189 | arg1Of | translocation,nuclear |
| R4119 | T5190 | T5191 | arg1Of | translocation,occurs |
| R4120 | T5191 | T5187 | arg2Of | occurs,and |
| R4121 | T5191 | T5192 | arg1Of | occurs,in |
| R4122 | T5191 | T5194 | arg1Of | occurs,to |
| R4123 | T5191 | T5198 | arg1Of | occurs,of |
| R4124 | T5193 | T5192 | arg2Of | parallel,in |
| R4125 | T5194 | T5196 | arg1Of | to,but |
| R4126 | T5196 | T5195 | arg1Of | but,"," |
| R4127 | T5198 | T5196 | arg2Of | of,but |
| R4128 | T5198 | T5197 | arg1Of | of,independently |
| R4129 | T5198 | T5199 | arg1Of | of,"," |
| R4130 | T5201 | T5198 | arg2Of | translocation6,of |
| R4131 | T5201 | T5200 | arg1Of | translocation6,p65 |
| R4132 | T5202 | T5203 | arg1Of | We,envisioned |
| R4133 | T5205 | T5206 | arg1Of | RPS3,could |
| R4134 | T5205 | T5208 | arg1Of | RPS3,utilize |
| R4135 | T5208 | T5203 | arg2Of | utilize,envisioned |
| R4136 | T5208 | T5204 | arg1Of | utilize,that |
| R4137 | T5208 | T5206 | arg2Of | utilize,could |
| R4138 | T5208 | T5207 | arg1Of | utilize,also |
| R4139 | T5211 | T5208 | arg2Of | pathway,utilize |
| R4140 | T5211 | T5209 | arg1Of | pathway,the |
| R4141 | T5211 | T5210 | arg1Of | pathway,importin-α/β |
| R4142 | T5212 | T5213 | arg1Of | Consistent,with |
| R4143 | T5215 | T5213 | arg2Of | notion,with |
| R4144 | T5215 | T5214 | arg1Of | notion,this |
| R4145 | T5218 | T5217 | arg1Of | association,RPS3 |
| R4146 | T5218 | T5219 | arg1Of | association,with |
| R4147 | T5218 | T5226 | arg1Of | association,was |
| R4148 | T5218 | T5227 | arg2Of | association,enhanced |
| R4149 | T5220 | T5222 | arg1Of | importin-α,but |
| R4150 | T5222 | T5219 | arg2Of | but,with |
| R4151 | T5222 | T5221 | arg1Of | but,"," |
| R4152 | T5222 | T5223 | arg1Of | but,not |
| R4153 | T5224 | T5222 | arg2Of | importin-β,but |
| R4154 | T5227 | T5212 | arg1Of | enhanced,Consistent |
| R4155 | T5227 | T5216 | arg1Of | enhanced,"," |
| R4156 | T5227 | T5225 | arg1Of | enhanced,"," |
| R4157 | T5227 | T5226 | arg2Of | enhanced,was |
| R4158 | T5227 | T5228 | arg1Of | enhanced,in |
| R4159 | T5230 | T5228 | arg2Of | cells,in |
| R4160 | T5230 | T5229 | arg2Of | cells,TNF–stimulated |
| R4161 | T5230 | T5231 | arg1Of | cells,( |
| R4162 | T5233 | T5231 | arg2Of | 3a,( |
| R4163 | T5233 | T5232 | arg1Of | 3a,Fig. |
| R4164 | T5234 | T5231 | arg3Of | ),( |
| R4165 | T5237 | T5238 | arg1Of | we,examined |
| R4166 | T5238 | T5235 | arg1Of | examined,Therefore |
| R4167 | T5238 | T5236 | arg1Of | examined,"," |
| R4168 | T5241 | T5240 | arg1Of | binding,RPS3 |
| R4169 | T5241 | T5242 | arg1Of | binding,to |
| R4170 | T5241 | T5244 | arg1Of | binding,is |
| R4171 | T5241 | T5245 | arg1Of | binding,essential |
| R4172 | T5243 | T5242 | arg2Of | importin-α,to |
| R4173 | T5244 | T5238 | arg2Of | is,examined |
| R4174 | T5244 | T5239 | arg1Of | is,whether |
| R4175 | T5245 | T5244 | arg2Of | essential,is |
| R4176 | T5245 | T5246 | arg1Of | essential,for |
| R4177 | T5245 | T5249 | arg1Of | essential,during |
| R4178 | T5248 | T5246 | arg2Of | translocation,for |
| R4179 | T5248 | T5247 | arg1Of | translocation,nuclear |
| R4180 | T5251 | T5249 | arg2Of | activation,during |
| R4181 | T5251 | T5250 | arg1Of | activation,NF-κB |
| R4182 | T5254 | T5253 | arg1Of | degradation,IκBα |
| R4183 | T5254 | T5255 | arg1Of | degradation,is |
| R4184 | T5255 | T5265 | arg1Of | is,and |
| R4185 | T5257 | T5255 | arg2Of | prerequisite,is |
| R4186 | T5257 | T5256 | arg1Of | prerequisite,a |
| R4187 | T5257 | T5258 | modOf | prerequisite,to |
| R4188 | T5259 | T5258 | arg1Of | unmask,to |
| R4189 | T5261 | T5259 | arg2Of | NLS,unmask |
| R4190 | T5261 | T5260 | arg1Of | NLS,the |
| R4191 | T5261 | T5262 | arg1Of | NLS,of |
| R4192 | T5263 | T5262 | arg2Of | p65,of |
| R4193 | T5265 | T5252 | arg2Of | and,Since |
| R4194 | T5265 | T5264 | arg1Of | and,"," |
| R4195 | T5267 | T5268 | arg1Of | RPS3,and |
| R4196 | T5268 | T5266 | arg1Of | and,both |
| R4197 | T5268 | T5270 | arg1Of | and,bind |
| R4198 | T5269 | T5268 | arg2Of | IκBα,and |
| R4199 | T5270 | T5265 | arg2Of | bind,and |
| R4200 | T5270 | T5271 | arg1Of | bind,to |
| R4201 | T5270 | T5273 | arg1Of | bind,in |
| R4202 | T5272 | T5271 | arg2Of | p65,to |
| R4203 | T5277 | T5273 | arg2Of | complex,in |
| R4204 | T5277 | T5274 | arg1Of | complex,the |
| R4205 | T5277 | T5275 | arg1Of | complex,cytoplasmic |
| R4206 | T5277 | T5276 | arg1Of | complex,inhibitory |
| R4207 | T5279 | T5280 | arg1Of | we,tested |
| R4208 | T5280 | T5252 | arg1Of | tested,Since |
| R4209 | T5280 | T5278 | arg1Of | tested,"," |
| R4210 | T5283 | T5282 | arg1Of | degradation,IκBα |
| R4211 | T5283 | T5284 | arg1Of | degradation,is |
| R4212 | T5283 | T5285 | arg2Of | degradation,required |
| R4213 | T5285 | T5280 | arg2Of | required,tested |
| R4214 | T5285 | T5281 | arg1Of | required,whether |
| R4215 | T5285 | T5284 | arg2Of | required,is |
| R4216 | T5285 | T5286 | arg1Of | required,for |
| R4217 | T5288 | T5286 | arg2Of | liberation,for |
| R4218 | T5288 | T5287 | arg1Of | liberation,the |
| R4219 | T5288 | T5289 | arg1Of | liberation,of |
| R4220 | T5290 | T5289 | arg2Of | RPS3,of |
| R4221 | T5291 | T5292 | arg1Of | We,measured |
| R4222 | T5294 | T5293 | arg1Of | association,the |
| R4223 | T5294 | T5295 | arg1Of | association,of |
| R4224 | T5294 | T5297 | arg1Of | association,with |
| R4225 | T5294 | T5299 | arg1Of | association,in |
| R4226 | T5294 | T5305 | arg1Of | association,or |
| R4227 | T5296 | T5295 | arg2Of | RPS3,of |
| R4228 | T5298 | T5297 | arg2Of | importin-α,with |
| R4229 | T5301 | T5299 | arg2Of | cells,in |
| R4230 | T5301 | T5300 | arg1Of | cells,293T |
| R4231 | T5301 | T5302 | arg1Of | cells,overexpressing |
| R4232 | T5304 | T5302 | arg2Of | IκBα,overexpressing |
| R4233 | T5304 | T5303 | arg1Of | IκBα,wild-type |
| R4234 | T5305 | T5292 | arg2Of | or,measured |
| R4235 | T5308 | T5305 | arg2Of | mutant,or |
| R4236 | T5308 | T5306 | arg1Of | mutant,an |
| R4237 | T5308 | T5307 | arg1Of | mutant,IκBα |
| R4238 | T5308 | T5309 | arg1Of | mutant,( |
| R4239 | T5308 | T5312 | arg1Of | mutant,resistant |
| R4240 | T5310 | T5309 | arg2Of | SSAA,( |
| R4241 | T5311 | T5309 | arg3Of | ),( |
| R4242 | T5312 | T5313 | arg1Of | resistant,to |
| R4243 | T5315 | T5316 | arg1Of | phosphorylation,and |
| R4244 | T5316 | T5313 | arg2Of | and,to |
| R4245 | T5316 | T5314 | arg1Of | and,IKKβ-induced |
| R4246 | T5317 | T5316 | arg2Of | degradation,and |
| R4247 | T5319 | T5318 | arg2Of | cells,In |
| R4248 | T5319 | T5320 | arg2Of | cells,transfected |
| R4249 | T5320 | T5321 | arg1Of | transfected,with |
| R4250 | T5323 | T5321 | arg2Of | IκBα,with |
| R4251 | T5323 | T5322 | arg1Of | IκBα,wild-type |
| R4252 | T5326 | T5325 | arg1Of | stimulation,TNF |
| R4253 | T5326 | T5327 | arg1Of | stimulation,augmented |
| R4254 | T5327 | T5318 | arg1Of | augmented,In |
| R4255 | T5327 | T5324 | arg1Of | augmented,"," |
| R4256 | T5329 | T5327 | arg2Of | interaction,augmented |
| R4257 | T5329 | T5328 | arg1Of | interaction,the |
| R4258 | T5329 | T5330 | arg1Of | interaction,of |
| R4259 | T5331 | T5332 | arg1Of | RPS3,and |
| R4260 | T5333 | T5332 | arg2Of | importin-α,and |
| R4261 | T5333 | T5334 | arg1Of | importin-α,to |
| R4262 | T5333 | T5339 | arg1Of | importin-α,in |
| R4263 | T5337 | T5334 | arg2Of | degree,to |
| R4264 | T5337 | T5335 | arg1Of | degree,a |
| R4265 | T5337 | T5336 | arg1Of | degree,similar |
| R4266 | T5339 | T5338 | arg1Of | in,as |
| R4267 | T5340 | T5339 | arg2Of | non-transfected,in |
| R4268 | T5341 | T5330 | arg2Of | cells,of |
| R4269 | T5341 | T5331 | arg1Of | cells,RPS3 |
| R4270 | T5341 | T5333 | arg1Of | cells,importin-α |
| R4271 | T5343 | T5342 | arg2Of | contrast,By |
| R4272 | T5345 | T5346 | arg1Of | we,observed |
| R4273 | T5346 | T5342 | arg1Of | observed,By |
| R4274 | T5346 | T5344 | arg1Of | observed,"," |
| R4275 | T5350 | T5348 | arg1Of | association,the |
| R4276 | T5350 | T5349 | arg1Of | association,RPS3-importin-α |
| R4277 | T5350 | T5351 | arg1Of | association,was |
| R4278 | T5350 | T5352 | arg2Of | association,abolished |
| R4279 | T5352 | T5346 | arg2Of | abolished,observed |
| R4280 | T5352 | T5347 | arg1Of | abolished,that |
| R4281 | T5352 | T5351 | arg2Of | abolished,was |
| R4282 | T5355 | T5352 | arg1Of | presence,abolished |
| R4283 | T5355 | T5353 | arg2Of | presence,by |
| R4284 | T5355 | T5354 | arg1Of | presence,the |
| R4285 | T5355 | T5356 | arg1Of | presence,of |
| R4286 | T5358 | T5356 | arg2Of | IκBα,of |
| R4287 | T5358 | T5357 | arg1Of | IκBα,non-degradable |
| R4288 | T5358 | T5359 | arg1Of | IκBα,( |
| R4289 | T5361 | T5359 | arg2Of | 3b,( |
| R4290 | T5361 | T5360 | arg1Of | 3b,Fig. |
| R4291 | T5362 | T5359 | arg3Of | ),( |
| R4292 | T5364 | T5363 | arg1Of | examine,To |
| R4293 | T5366 | T5367 | arg1Of | IκBα,is |
| R4294 | T5367 | T5364 | arg2Of | is,examine |
| R4295 | T5367 | T5365 | arg1Of | is,whether |
| R4296 | T5371 | T5367 | arg2Of | barrier,is |
| R4297 | T5371 | T5368 | arg1Of | barrier,the |
| R4298 | T5371 | T5369 | arg1Of | barrier,only |
| R4299 | T5371 | T5370 | arg1Of | barrier,cytoplasmic |
| R4300 | T5371 | T5372 | arg1Of | barrier,precluding |
| R4301 | T5375 | T5372 | arg2Of | translocation,precluding |
| R4302 | T5375 | T5373 | arg1Of | translocation,RPS3 |
| R4303 | T5375 | T5374 | arg1Of | translocation,nuclear |
| R4304 | T5377 | T5364 | arg1Of | we,examine |
| R4305 | T5377 | T5378 | arg1Of | we,measured |
| R4306 | T5377 | T5386 | arg1Of | we,reducing |
| R4307 | T5378 | T5363 | modOf | measured,To |
| R4308 | T5378 | T5376 | arg1Of | measured,"," |
| R4309 | T5378 | T5385 | arg1Of | measured,after |
| R4310 | T5381 | T5380 | arg1Of | association,RPS3-importin-α |
| R4311 | T5381 | T5382 | arg1Of | association,and |
| R4312 | T5382 | T5378 | arg2Of | and,measured |
| R4313 | T5382 | T5379 | arg1Of | and,both |
| R4314 | T5384 | T5382 | arg2Of | RPS3,and |
| R4315 | T5384 | T5383 | arg1Of | RPS3,nuclear |
| R4316 | T5386 | T5385 | arg2Of | reducing,after |
| R4317 | T5388 | T5386 | arg2Of | expression,reducing |
| R4318 | T5388 | T5387 | arg1Of | expression,IκBα |
| R4319 | T5390 | T5389 | arg2Of | with,Compared |
| R4320 | T5392 | T5390 | arg2Of | siRNA,with |
| R4321 | T5392 | T5391 | arg1Of | siRNA,nonspecific |
| R4322 | T5395 | T5394 | arg1Of | targeting,siRNA |
| R4323 | T5395 | T5396 | arg1Of | targeting,of |
| R4324 | T5395 | T5399 | arg1Of | targeting,depleted |
| R4325 | T5397 | T5396 | arg2Of | IκBα,of |
| R4326 | T5399 | T5389 | arg1Of | depleted,Compared |
| R4327 | T5399 | T5393 | arg1Of | depleted,"," |
| R4328 | T5399 | T5398 | arg1Of | depleted,completely |
| R4329 | T5399 | T5401 | arg1Of | depleted,in |
| R4330 | T5400 | T5399 | arg2Of | IκBα,depleted |
| R4331 | T5403 | T5401 | arg2Of | cells,in |
| R4332 | T5403 | T5402 | arg1Of | cells,Jurkat |
| R4333 | T5403 | T5404 | arg1Of | cells,( |
| R4334 | T5406 | T5404 | arg2Of | 3c,( |
| R4335 | T5406 | T5405 | arg1Of | 3c,Fig. |
| R4336 | T5406 | T5407 | arg1Of | 3c,"," |
| R4337 | T5408 | T5407 | arg2Of | input,"," |
| R4338 | T5409 | T5404 | arg3Of | ),( |
| R4339 | T5414 | T5412 | arg1Of | association,the |
| R4340 | T5414 | T5413 | arg1Of | association,RPS3-importin-α |
| R4341 | T5414 | T5415 | arg1Of | association,was |
| R4342 | T5414 | T5417 | arg1Of | association,augmented |
| R4343 | T5414 | T5424 | arg1Of | association,was |
| R4344 | T5415 | T5416 | arg1Of | was,not |
| R4345 | T5415 | T5423 | arg1Of | was,nor |
| R4346 | T5417 | T5415 | arg2Of | augmented,was |
| R4347 | T5417 | T5418 | arg1Of | augmented,( |
| R4348 | T5420 | T5418 | arg2Of | 3c,( |
| R4349 | T5420 | T5419 | arg1Of | 3c,Fig. |
| R4350 | T5421 | T5418 | arg3Of | ),( |
| R4351 | T5423 | T5410 | arg1Of | nor,Nevertheless |
| R4352 | T5423 | T5411 | arg1Of | nor,"," |
| R4353 | T5423 | T5422 | arg1Of | nor,"," |
| R4354 | T5424 | T5423 | arg2Of | was,nor |
| R4355 | T5426 | T5425 | arg1Of | nuclear,significant |
| R4356 | T5427 | T5424 | arg2Of | RPS3,was |
| R4357 | T5427 | T5426 | arg1Of | RPS3,nuclear |
| R4358 | T5427 | T5428 | arg2Of | RPS3,detected |
| R4359 | T5428 | T5429 | arg1Of | detected,( |
| R4360 | T5431 | T5429 | arg2Of | 3d,( |
| R4361 | T5431 | T5430 | arg1Of | 3d,Fig. |
| R4362 | T5432 | T5429 | arg3Of | ),( |
| R4363 | T5435 | T5436 | arg2Of | cells,treated |
| R4364 | T5435 | T5451 | arg1Of | cells,did |
| R4365 | T5435 | T5453 | arg1Of | cells,show |
| R4366 | T5436 | T5437 | arg1Of | treated,with |
| R4367 | T5439 | T5437 | arg2Of | pervanadate,with |
| R4368 | T5439 | T5438 | arg1Of | pervanadate,sodium |
| R4369 | T5439 | T5440 | arg1Of | pervanadate,( |
| R4370 | T5439 | T5443 | modOf | pervanadate,to |
| R4371 | T5441 | T5440 | arg2Of | Pv,( |
| R4372 | T5442 | T5440 | arg3Of | ),( |
| R4373 | T5444 | T5443 | arg1Of | induce,to |
| R4374 | T5444 | T5447 | arg1Of | induce,through |
| R4375 | T5446 | T5444 | arg2Of | degradation,induce |
| R4376 | T5446 | T5445 | arg1Of | degradation,IκBα |
| R4377 | T5450 | T5447 | arg2Of | mechanism25-27,through |
| R4378 | T5450 | T5448 | arg1Of | mechanism25-27,an |
| R4379 | T5450 | T5449 | arg1Of | mechanism25-27,IKK-independent |
| R4380 | T5453 | T5433 | arg1Of | show,Moreover |
| R4381 | T5453 | T5434 | arg1Of | show,"," |
| R4382 | T5453 | T5451 | arg2Of | show,did |
| R4383 | T5453 | T5452 | arg1Of | show,not |
| R4384 | T5453 | T5473 | arg1Of | show,"," |
| R4385 | T5453 | T5474 | arg1Of | show,despite |
| R4386 | T5455 | T5453 | arg2Of | association,show |
| R4387 | T5455 | T5454 | arg2Of | association,increased |
| R4388 | T5455 | T5456 | arg1Of | association,between |
| R4389 | T5457 | T5458 | arg1Of | RPS3,and |
| R4390 | T5458 | T5456 | arg2Of | and,between |
| R4391 | T5459 | T5460 | arg1Of | importin-α,( |
| R4392 | T5459 | T5468 | arg1Of | importin-α,or |
| R4393 | T5462 | T5461 | arg1Of | 3e,Fig. |
| R4394 | T5462 | T5463 | arg1Of | 3e,and |
| R4395 | T5463 | T5460 | arg2Of | and,( |
| R4396 | T5465 | T5464 | arg1Of | Fig.,Supplementary |
| R4397 | T5466 | T5463 | arg2Of | 3b,and |
| R4398 | T5466 | T5465 | arg1Of | 3b,Fig. |
| R4399 | T5467 | T5460 | arg3Of | ),( |
| R4400 | T5468 | T5458 | arg2Of | or,and |
| R4401 | T5470 | T5468 | arg2Of | accumulation,or |
| R4402 | T5470 | T5469 | arg1Of | accumulation,nuclear |
| R4403 | T5470 | T5471 | arg1Of | accumulation,of |
| R4404 | T5472 | T5471 | arg2Of | RPS3,of |
| R4405 | T5477 | T5474 | arg2Of | degradation,despite |
| R4406 | T5477 | T5475 | arg1Of | degradation,complete |
| R4407 | T5477 | T5476 | arg1Of | degradation,IκBα |
| R4408 | T5477 | T5478 | arg1Of | degradation,( |
| R4409 | T5480 | T5479 | arg1Of | Fig.,Supplementary |
| R4410 | T5481 | T5478 | arg2Of | 3c,( |
| R4411 | T5481 | T5480 | arg1Of | 3c,Fig. |
| R4412 | T5482 | T5478 | arg3Of | ),( |
| R4413 | T5483 | T5485 | arg1Of | We,examined |
| R4414 | T5485 | T5484 | arg1Of | examined,further |
| R4415 | T5491 | T5487 | arg1Of | signal,a |
| R4416 | T5491 | T5488 | arg1Of | signal,subsequent |
| R4417 | T5491 | T5489 | arg1Of | signal,NF-κB |
| R4418 | T5491 | T5490 | arg1Of | signal,activation |
| R4419 | T5491 | T5493 | arg1Of | signal,promotes |
| R4420 | T5493 | T5485 | arg2Of | promotes,examined |
| R4421 | T5493 | T5486 | arg1Of | promotes,whether |
| R4422 | T5493 | T5492 | arg1Of | promotes,independently |
| R4423 | T5493 | T5502 | arg1Of | promotes,after |
| R4424 | T5496 | T5494 | arg1Of | association,the |
| R4425 | T5496 | T5495 | arg1Of | association,importin-α |
| R4426 | T5496 | T5497 | arg1Of | association,and |
| R4427 | T5497 | T5493 | arg2Of | and,promotes |
| R4428 | T5499 | T5497 | arg2Of | transport,and |
| R4429 | T5499 | T5498 | arg1Of | transport,nuclear |
| R4430 | T5499 | T5500 | arg1Of | transport,of |
| R4431 | T5501 | T5500 | arg2Of | RPS3,of |
| R4432 | T5504 | T5502 | arg2Of | degradation,after |
| R4433 | T5504 | T5503 | arg1Of | degradation,IκBα |
| R4434 | T5505 | T5506 | arg1Of | We,found |
| R4435 | T5509 | T5508 | arg1Of | stimulation,TNF |
| R4436 | T5509 | T5510 | arg1Of | stimulation,following |
| R4437 | T5509 | T5513 | arg1Of | stimulation,was |
| R4438 | T5509 | T5514 | arg2Of | stimulation,required |
| R4439 | T5512 | T5510 | arg2Of | treatment,following |
| R4440 | T5512 | T5511 | arg1Of | treatment,Pv |
| R4441 | T5514 | T5506 | arg2Of | required,found |
| R4442 | T5514 | T5507 | arg1Of | required,that |
| R4443 | T5514 | T5513 | arg2Of | required,was |
| R4444 | T5514 | T5515 | arg1Of | required,for |
| R4445 | T5518 | T5515 | arg2Of | association,for |
| R4446 | T5518 | T5516 | arg1Of | association,the |
| R4447 | T5518 | T5517 | arg1Of | association,RPS3-importin-α |
| R4448 | T5518 | T5519 | arg1Of | association,"," |
| R4449 | T5518 | T5520 | arg1Of | association,comparable |
| R4450 | T5520 | T5521 | arg1Of | comparable,to |
| R4451 | T5523 | T5521 | arg2Of | stimulation,to |
| R4452 | T5523 | T5522 | arg1Of | stimulation,TNF |
| R4453 | T5523 | T5524 | arg1Of | stimulation,alone |
| R4454 | T5523 | T5525 | arg1Of | stimulation,( |
| R4455 | T5527 | T5525 | arg2Of | 3e,( |
| R4456 | T5527 | T5526 | arg1Of | 3e,Fig. |
| R4457 | T5528 | T5525 | arg3Of | ),( |
| R4458 | T5532 | T5531 | arg1Of | phosphorylation,IκBα |
| R4459 | T5532 | T5533 | arg1Of | phosphorylation,and |
| R4460 | T5533 | T5536 | arg1Of | and,is |
| R4461 | T5533 | T5537 | arg2Of | and,required |
| R4462 | T5533 | T5540 | arg1Of | and,sufficient |
| R4463 | T5534 | T5533 | arg2Of | degradation,and |
| R4464 | T5534 | T5535 | arg1Of | degradation,itself |
| R4465 | T5537 | T5538 | arg1Of | required,but |
| R4466 | T5538 | T5529 | arg1Of | but,Thus |
| R4467 | T5538 | T5530 | arg1Of | but,"," |
| R4468 | T5538 | T5536 | arg2Of | but,is |
| R4469 | T5538 | T5541 | modOf | but,to |
| R4470 | T5540 | T5538 | arg2Of | sufficient,but |
| R4471 | T5540 | T5539 | arg1Of | sufficient,not |
| R4472 | T5542 | T5541 | arg1Of | cause,to |
| R4473 | T5544 | T5542 | arg2Of | association,cause |
| R4474 | T5544 | T5543 | arg1Of | association,RPS3 |
| R4475 | T5544 | T5545 | arg1Of | association,with |
| R4476 | T5546 | T5545 | arg2Of | importin-α,with |
| R4477 | T5546 | T5547 | arg2Of | importin-α,followed |
| R4478 | T5550 | T5547 | arg1Of | translocation,followed |
| R4479 | T5550 | T5548 | arg2Of | translocation,by |
| R4480 | T5550 | T5549 | arg1Of | translocation,nuclear |
| R4481 | T5555 | T5553 | arg1Of | signal,an |
| R4482 | T5555 | T5554 | arg1Of | signal,additional |
| R4483 | T5555 | T5556 | arg1Of | signal,"," |
| R4484 | T5555 | T5563 | arg1Of | signal,is |
| R4485 | T5555 | T5564 | arg2Of | signal,required |
| R4486 | T5559 | T5556 | arg2Of | phosphorylation,"," |
| R4487 | T5559 | T5557 | arg1Of | phosphorylation,potentially |
| R4488 | T5559 | T5558 | arg1Of | phosphorylation,IKKβ |
| R4489 | T5559 | T5560 | arg1Of | phosphorylation,of |
| R4490 | T5561 | T5560 | arg2Of | RPS3,of |
| R4491 | T5564 | T5551 | arg1Of | required,Rather |
| R4492 | T5564 | T5552 | arg1Of | required,"," |
| R4493 | T5564 | T5562 | arg1Of | required,"," |
| R4494 | T5564 | T5563 | arg2Of | required,is |
| R5650 | T7159 | T7160 | arg1Of | IKKβ,phosphorylates |
| R5651 | T7161 | T7160 | arg2Of | RPS3,phosphorylates |
| R5652 | T7161 | T7162 | arg1Of | RPS3,at |
| R5653 | T7163 | T7162 | arg2Of | serine,at |
| R5654 | T7163 | T7164 | arg1Of | serine,209 |
| R5655 | T7167 | T7165 | arg2Of | defined,Although |
| R5656 | T7167 | T7166 | arg1Of | defined,originally |
| R5657 | T7167 | T7168 | arg1Of | defined,as |
| R5658 | T7170 | T7168 | arg2Of | kinase,as |
| R5659 | T7170 | T7169 | arg1Of | kinase,the |
| R5660 | T7170 | T7171 | arg1Of | kinase,that |
| R5661 | T7170 | T7172 | arg1Of | kinase,phosphorylates |
| R5662 | T7173 | T7172 | arg2Of | IκB19,phosphorylates |
| R5663 | T7175 | T7177 | arg1Of | IKKβ,phosphorylates |
| R5664 | T7177 | T7165 | arg1Of | phosphorylates,Although |
| R5665 | T7177 | T7174 | arg1Of | phosphorylates,"," |
| R5666 | T7177 | T7176 | arg1Of | phosphorylates,also |
| R5667 | T7179 | T7177 | arg2Of | substrates,phosphorylates |
| R5668 | T7179 | T7178 | arg1Of | substrates,unrelated |
| R5669 | T7179 | T7180 | arg1Of | substrates,including |
| R5670 | T7181 | T7182 | arg1Of | 14-3-3β,and |
| R5671 | T7182 | T7180 | arg2Of | and,including |
| R5672 | T7182 | T7184 | arg1Of | and,"," |
| R5673 | T7182 | T7185 | arg1Of | and,which |
| R5674 | T7182 | T7186 | arg1Of | and,lack |
| R5675 | T7183 | T7182 | arg2Of | Bcl10,and |
| R5676 | T7190 | T7186 | arg2Of | motif,lack |
| R5677 | T7190 | T7187 | arg1Of | motif,the |
| R5678 | T7190 | T7188 | arg1Of | motif,IKK |
| R5679 | T7190 | T7189 | arg1Of | motif,consensus |
| R5680 | T7190 | T7191 | arg1Of | motif,( |
| R5681 | T7190 | T7194 | arg1Of | motif,28 |
| R5682 | T7192 | T7191 | arg2Of | DpSGYXpS/T,( |
| R5683 | T7193 | T7191 | arg3Of | ),( |
| R5684 | T7195 | T7197 | arg1Of | We,hypothesized |
| R5685 | T7197 | T7196 | arg1Of | hypothesized,therefore |
| R5686 | T7199 | T7200 | arg1Of | IKKβ,could |
| R5687 | T7199 | T7202 | arg1Of | IKKβ,phosphorylate |
| R5688 | T7202 | T7197 | arg2Of | phosphorylate,hypothesized |
| R5689 | T7202 | T7198 | arg1Of | phosphorylate,that |
| R5690 | T7202 | T7200 | arg2Of | phosphorylate,could |
| R5691 | T7202 | T7201 | arg1Of | phosphorylate,directly |
| R5692 | T7203 | T7202 | arg2Of | RPS3,phosphorylate |
| R5693 | T7206 | T7205 | arg1Of | vitro,in |
| R5694 | T7208 | T7204 | arg2Of | assays,By |
| R5695 | T7208 | T7206 | arg1Of | assays,vitro |
| R5696 | T7208 | T7207 | arg1Of | assays,kinase |
| R5697 | T7208 | T7209 | arg1Of | assays,using |
| R5698 | T7211 | T7212 | arg1Of | IKK,and |
| R5699 | T7213 | T7212 | arg2Of | RPS3,and |
| R5700 | T7214 | T7209 | arg2Of | proteins,using |
| R5701 | T7214 | T7210 | arg1Of | proteins,recombinant |
| R5702 | T7214 | T7211 | arg1Of | proteins,IKK |
| R5703 | T7214 | T7213 | arg1Of | proteins,RPS3 |
| R5704 | T7216 | T7217 | arg1Of | we,observed |
| R5705 | T7217 | T7204 | arg1Of | observed,By |
| R5706 | T7217 | T7215 | arg1Of | observed,"," |
| R5707 | T7217 | T7263 | arg1Of | observed,"," |
| R5708 | T7217 | T7264 | arg1Of | observed,when |
| R5709 | T7219 | T7218 | arg1Of | incorporation,strong |
| R5710 | T7219 | T7220 | arg1Of | incorporation,of |
| R5711 | T7219 | T7222 | arg1Of | incorporation,in |
| R5712 | T7219 | T7225 | arg1Of | incorporation,and |
| R5713 | T7221 | T7220 | arg2Of | 32P,of |
| R5714 | T7224 | T7222 | arg2Of | IKKα,in |
| R5715 | T7224 | T7223 | arg1Of | IKKα,autophosphorylatd |
| R5716 | T7225 | T7236 | arg1Of | and,as |
| R5717 | T7226 | T7225 | arg2Of | IKKβ,and |
| R5718 | T7226 | T7227 | arg1Of | IKKβ,( |
| R5719 | T7229 | T7227 | arg2Of | 4a,( |
| R5720 | T7229 | T7228 | arg1Of | 4a,Fig. |
| R5721 | T7229 | T7230 | arg1Of | 4a,"," |
| R5722 | T7231 | T7230 | arg2Of | lanes,"," |
| R5723 | T7231 | T7232 | arg1Of | lanes,2-7 |
| R5724 | T7233 | T7227 | arg3Of | ),( |
| R5725 | T7236 | T7217 | arg2Of | as,observed |
| R5726 | T7236 | T7234 | arg1Of | as,as |
| R5727 | T7236 | T7235 | arg1Of | as,well |
| R5728 | T7238 | T7237 | arg2Of | GST-IκBα,phosporylated |
| R5729 | T7238 | T7239 | arg1Of | GST-IκBα,( |
| R5730 | T7238 | T7242 | arg1Of | GST-IκBα,( |
| R5731 | T7238 | T7248 | arg1Of | GST-IκBα,but |
| R5732 | T7240 | T7239 | arg2Of | 1-54,( |
| R5733 | T7241 | T7239 | arg3Of | ),( |
| R5734 | T7244 | T7242 | arg2Of | Fig.,( |
| R5735 | T7244 | T7243 | arg1Of | Fig.,Supplementary |
| R5736 | T7244 | T7245 | arg1Of | Fig.,4 |
| R5737 | T7246 | T7242 | arg3Of | ),( |
| R5738 | T7248 | T7236 | arg2Of | but,as |
| R5739 | T7248 | T7247 | arg1Of | but,"," |
| R5740 | T7248 | T7249 | arg1Of | but,not |
| R5741 | T7252 | T7248 | arg2Of | protein,but |
| R5742 | T7252 | T7250 | arg1Of | protein,the |
| R5743 | T7252 | T7251 | arg1Of | protein,GST |
| R5744 | T7252 | T7253 | arg1Of | protein,alone |
| R5745 | T7252 | T7254 | arg1Of | protein,( |
| R5746 | T7256 | T7255 | arg1Of | 4a,Fig. |
| R5747 | T7256 | T7257 | arg1Of | 4a,"," |
| R5748 | T7257 | T7254 | arg2Of | ",",( |
| R5749 | T7259 | T7260 | arg1Of | 3,and |
| R5750 | T7260 | T7257 | arg2Of | and,"," |
| R5751 | T7260 | T7258 | arg1Of | and,lanes |
| R5752 | T7261 | T7260 | arg2Of | 6,and |
| R5753 | T7262 | T7254 | arg3Of | ),( |
| R5754 | T7266 | T7267 | arg1Of | IKKα,or |
| R5755 | T7267 | T7265 | arg1Of | or,either |
| R5756 | T7267 | T7269 | arg1Of | or,was |
| R5757 | T7267 | T7270 | arg2Of | or,used |
| R5758 | T7268 | T7267 | arg2Of | IKKβ,or |
| R5759 | T7270 | T7264 | arg2Of | used,when |
| R5760 | T7270 | T7269 | arg2Of | used,was |
| R5761 | T7271 | T7272 | arg1Of | We,discovered |
| R5762 | T7274 | T7275 | arg1Of | GST-RPS3,could |
| R5763 | T7274 | T7276 | arg1Of | GST-RPS3,be |
| R5764 | T7274 | T7277 | arg2Of | GST-RPS3,phosphorylated |
| R5765 | T7277 | T7272 | arg2Of | phosphorylated,discovered |
| R5766 | T7277 | T7273 | arg1Of | phosphorylated,that |
| R5767 | T7277 | T7275 | arg2Of | phosphorylated,could |
| R5768 | T7277 | T7276 | arg2Of | phosphorylated,be |
| R5769 | T7279 | T7281 | arg1Of | IKKβ,but |
| R5770 | T7281 | T7277 | arg1Of | but,phosphorylated |
| R5771 | T7281 | T7278 | arg2Of | but,by |
| R5772 | T7281 | T7280 | arg1Of | but,"," |
| R5773 | T7281 | T7282 | arg1Of | but,not |
| R5774 | T7281 | T7284 | arg1Of | but,"," |
| R5775 | T7281 | T7286 | arg1Of | but,vitro |
| R5776 | T7281 | T7287 | arg1Of | but,( |
| R5777 | T7283 | T7281 | arg2Of | IKKα,but |
| R5778 | T7286 | T7285 | arg1Of | vitro,in |
| R5779 | T7289 | T7287 | arg2Of | 4a,( |
| R5780 | T7289 | T7288 | arg1Of | 4a,Fig. |
| R5781 | T7289 | T7290 | arg1Of | 4a,"," |
| R5782 | T7293 | T7294 | arg1Of | 4,and |
| R5783 | T7294 | T7290 | arg2Of | and,"," |
| R5784 | T7294 | T7291 | arg1Of | and,compare |
| R5785 | T7294 | T7292 | arg1Of | and,lanes |
| R5786 | T7295 | T7294 | arg2Of | 7,and |
| R5787 | T7296 | T7287 | arg3Of | ),( |
| R5788 | T7298 | T7297 | arg1Of | identify,To |
| R5789 | T7303 | T7298 | arg2Of | residue,identify |
| R5790 | T7303 | T7299 | arg1Of | residue,the |
| R5791 | T7303 | T7300 | arg1Of | residue,RPS3 |
| R5792 | T7303 | T7301 | arg1Of | residue,amino |
| R5793 | T7303 | T7302 | arg1Of | residue,acid |
| R5794 | T7303 | T7304 | arg1Of | residue,( |
| R5795 | T7303 | T7307 | arg2Of | residue,phosphorylated |
| R5796 | T7305 | T7304 | arg2Of | s,( |
| R5797 | T7306 | T7304 | arg3Of | ),( |
| R5798 | T7309 | T7307 | arg1Of | IKKβ,phosphorylated |
| R5799 | T7309 | T7308 | arg2Of | IKKβ,by |
| R5800 | T7311 | T7298 | arg1Of | we,identify |
| R5801 | T7311 | T7312 | arg1Of | we,performed |
| R5802 | T7312 | T7297 | modOf | performed,To |
| R5803 | T7312 | T7310 | arg1Of | performed,"," |
| R5804 | T7317 | T7312 | arg2Of | analyses,performed |
| R5805 | T7317 | T7313 | arg1Of | analyses,liquid |
| R5806 | T7317 | T7314 | arg1Of | analyses,chromatography-tandem |
| R5807 | T7317 | T7315 | arg1Of | analyses,mass |
| R5808 | T7317 | T7316 | arg1Of | analyses,spectrometry |
| R5809 | T7317 | T7318 | arg1Of | analyses,using |
| R5810 | T7318 | T7320 | arg1Of | using,vitro |
| R5811 | T7320 | T7319 | arg1Of | vitro,in |
| R5812 | T7322 | T7318 | arg2Of | RPS3,using |
| R5813 | T7322 | T7321 | arg2Of | RPS3,phosphorylated |
| R5814 | T7324 | T7325 | arg1Of | results,indicated |
| R5815 | T7327 | T7325 | arg2Of | IKKβ,indicated |
| R5816 | T7327 | T7326 | arg1Of | IKKβ,that |
| R5817 | T7328 | T7325 | arg3Of | phosphorylated,indicated |
| R5818 | T7329 | T7323 | arg1Of | S209,The |
| R5819 | T7329 | T7328 | arg2Of | S209,phosphorylated |
| R5820 | T7329 | T7330 | arg1Of | S209,"," |
| R5821 | T7329 | T7331 | arg1Of | S209,located |
| R5822 | T7331 | T7332 | arg1Of | located,in |
| R5823 | T7335 | T7332 | arg2Of | C-terminus,in |
| R5824 | T7335 | T7333 | arg1Of | C-terminus,the |
| R5825 | T7335 | T7334 | arg1Of | C-terminus,RPS3 |
| R5826 | T7335 | T7336 | arg1Of | C-terminus,( |
| R5827 | T7338 | T7336 | arg2Of | 4b,( |
| R5828 | T7338 | T7337 | arg1Of | 4b,Fig. |
| R5829 | T7339 | T7336 | arg3Of | ),( |
| R5830 | T7344 | T7340 | arg1Of | alignment,RPS3 |
| R5831 | T7344 | T7341 | arg1Of | alignment,amino |
| R5832 | T7344 | T7342 | arg1Of | alignment,acid |
| R5833 | T7344 | T7343 | arg1Of | alignment,sequence |
| R5834 | T7344 | T7345 | arg1Of | alignment,revealed |
| R5835 | T7347 | T7348 | arg1Of | S209,is |
| R5836 | T7347 | T7349 | arg2Of | S209,conserved |
| R5837 | T7349 | T7345 | arg2Of | conserved,revealed |
| R5838 | T7349 | T7346 | arg1Of | conserved,that |
| R5839 | T7349 | T7348 | arg2Of | conserved,is |
| R5840 | T7349 | T7350 | arg1Of | conserved,in |
| R5841 | T7349 | T7353 | arg1Of | conserved,throughout |
| R5842 | T7352 | T7350 | arg2Of | species,in |
| R5843 | T7352 | T7351 | arg1Of | species,many |
| R5844 | T7354 | T7353 | arg2Of | phylogeny,throughout |
| R5845 | T7354 | T7355 | arg1Of | phylogeny,with |
| R5846 | T7357 | T7355 | arg2Of | exception,with |
| R5847 | T7357 | T7356 | arg1Of | exception,the |
| R5848 | T7357 | T7358 | arg1Of | exception,of |
| R5849 | T7357 | T7364 | arg1Of | exception,"," |
| R5850 | T7360 | T7359 | arg1Of | elegans,Caenorhabditis |
| R5851 | T7360 | T7361 | arg1Of | elegans,and |
| R5852 | T7361 | T7358 | arg2Of | and,of |
| R5853 | T7363 | T7361 | arg2Of | pombe,and |
| R5854 | T7363 | T7362 | arg1Of | pombe,Schizosaccharomyces |
| R5855 | T7366 | T7364 | arg2Of | organisms,"," |
| R5856 | T7366 | T7365 | arg1Of | organisms,two |
| R5857 | T7366 | T7367 | arg1Of | organisms,that |
| R5858 | T7366 | T7368 | arg1Of | organisms,do |
| R5859 | T7366 | T7370 | arg1Of | organisms,possess |
| R5860 | T7370 | T7368 | arg2Of | possess,do |
| R5861 | T7370 | T7369 | arg1Of | possess,not |
| R5862 | T7370 | T7375 | arg1Of | possess,( |
| R5863 | T7374 | T7370 | arg2Of | pathway,possess |
| R5864 | T7374 | T7371 | arg1Of | pathway,the |
| R5865 | T7374 | T7372 | arg1Of | pathway,NF-κB |
| R5866 | T7374 | T7373 | arg1Of | pathway,signal |
| R5867 | T7377 | T7375 | arg2Of | Fig.,( |
| R5868 | T7377 | T7376 | arg1Of | Fig.,Supplementary |
| R5869 | T7377 | T7378 | arg1Of | Fig.,5 |
| R5870 | T7379 | T7375 | arg3Of | ),( |
| R5871 | T7381 | T7380 | arg1Of | verify,To |
| R5872 | T7381 | T7382 | arg1Of | verify,biochemically |
| R5873 | T7384 | T7385 | arg1Of | S209,is |
| R5874 | T7385 | T7381 | arg2Of | is,verify |
| R5875 | T7385 | T7383 | arg1Of | is,that |
| R5876 | T7388 | T7385 | arg2Of | substrate,is |
| R5877 | T7388 | T7386 | arg1Of | substrate,an |
| R5878 | T7388 | T7387 | arg1Of | substrate,IKKβ |
| R5879 | T7390 | T7381 | arg1Of | we,verify |
| R5880 | T7390 | T7391 | arg1Of | we,performed |
| R5881 | T7391 | T7380 | modOf | performed,To |
| R5882 | T7391 | T7389 | arg1Of | performed,"," |
| R5883 | T7394 | T7393 | arg1Of | vitro,in |
| R5884 | T7396 | T7391 | arg2Of | assays,performed |
| R5885 | T7396 | T7392 | arg1Of | assays,32P-labeling |
| R5886 | T7396 | T7394 | arg1Of | assays,vitro |
| R5887 | T7396 | T7395 | arg1Of | assays,kinase |
| R5888 | T7396 | T7397 | arg1Of | assays,with |
| R5889 | T7399 | T7398 | arg1Of | wild-type,recombinant |
| R5890 | T7399 | T7400 | arg1Of | wild-type,or |
| R5891 | T7400 | T7397 | arg2Of | or,with |
| R5892 | T7404 | T7400 | arg2Of | proteins,or |
| R5893 | T7404 | T7401 | arg1Of | proteins,S209A |
| R5894 | T7404 | T7402 | arg1Of | proteins,mutant |
| R5895 | T7404 | T7403 | arg1Of | proteins,RPS3 |
| R5896 | T7406 | T7405 | arg2Of | with,Compared |
| R5897 | T7409 | T7406 | arg2Of | protein,with |
| R5898 | T7409 | T7407 | arg1Of | protein,the |
| R5899 | T7409 | T7408 | arg1Of | protein,wild-type |
| R5900 | T7413 | T7411 | arg1Of | mutation,the |
| R5901 | T7413 | T7412 | arg1Of | mutation,S209A |
| R5902 | T7413 | T7414 | arg1Of | mutation,reduced |
| R5903 | T7414 | T7405 | arg1Of | reduced,Compared |
| R5904 | T7414 | T7410 | arg1Of | reduced,"," |
| R5905 | T7417 | T7414 | arg2Of | phosphorylation,reduced |
| R5906 | T7417 | T7415 | arg1Of | phosphorylation,IKKβ–mediated |
| R5907 | T7417 | T7416 | arg1Of | phosphorylation,RPS3 |
| R5908 | T7417 | T7418 | arg1Of | phosphorylation,( |
| R5909 | T7420 | T7418 | arg2Of | 4c,( |
| R5910 | T7420 | T7419 | arg1Of | 4c,Fig. |
| R5911 | T7421 | T7418 | arg3Of | ),( |
| R5912 | T7422 | T7423 | arg1Of | There,might |
| R5913 | T7422 | T7424 | arg1Of | There,be |
| R5914 | T7424 | T7423 | arg2Of | be,might |
| R5915 | T7424 | T7431 | arg1Of | be,under |
| R5916 | T7424 | T7434 | arg1Of | be,given |
| R5917 | T7427 | T7424 | arg2Of | site,be |
| R5918 | T7427 | T7425 | arg1Of | site,alternative |
| R5919 | T7427 | T7426 | arg1Of | site,phosphorylation |
| R5920 | T7427 | T7428 | arg1Of | site,( |
| R5921 | T7429 | T7428 | arg2Of | s,( |
| R5922 | T7430 | T7428 | arg3Of | ),( |
| R5923 | T7433 | T7431 | arg2Of | conditions,under |
| R5924 | T7433 | T7432 | arg1Of | conditions,these |
| R5925 | T7438 | T7434 | arg2Of | RPS3,given |
| R5926 | T7438 | T7435 | arg1Of | RPS3,modest |
| R5927 | T7438 | T7436 | arg1Of | RPS3,residual |
| R5928 | T7438 | T7437 | arg2Of | RPS3,phosphorylated |
| R5929 | T7438 | T7439 | arg1Of | RPS3,( |
| R5930 | T7441 | T7439 | arg2Of | 4c,( |
| R5931 | T7441 | T7440 | arg1Of | 4c,Fig. |
| R5932 | T7442 | T7439 | arg3Of | ),( |
| R5933 | T7444 | T7443 | arg1Of | S209,RPS3 |
| R5934 | T7444 | T7445 | arg1Of | S209,does |
| R5935 | T7444 | T7447 | arg1Of | S209,fall |
| R5936 | T7444 | T7457 | arg1Of | S209,resides |
| R5937 | T7447 | T7445 | arg2Of | fall,does |
| R5938 | T7447 | T7446 | arg1Of | fall,not |
| R5939 | T7447 | T7448 | arg1Of | fall,within |
| R5940 | T7447 | T7455 | arg1Of | fall,but |
| R5941 | T7453 | T7448 | arg2Of | motif,within |
| R5942 | T7453 | T7449 | arg1Of | motif,a |
| R5943 | T7453 | T7450 | arg1Of | motif,conventional |
| R5944 | T7453 | T7451 | arg1Of | motif,IKK |
| R5945 | T7453 | T7452 | arg1Of | motif,recognition |
| R5946 | T7455 | T7454 | arg1Of | but,"," |
| R5947 | T7457 | T7455 | arg2Of | resides,but |
| R5948 | T7457 | T7456 | arg1Of | resides,rather |
| R5949 | T7457 | T7458 | arg1Of | resides,in |
| R5950 | T7461 | T7458 | arg2Of | motif,in |
| R5951 | T7461 | T7459 | arg1Of | motif,a |
| R5952 | T7461 | T7460 | arg1Of | motif,sequence |
| R5953 | T7461 | T7462 | arg1Of | motif,( |
| R5954 | T7461 | T7465 | arg1Of | motif,"," |
| R5955 | T7461 | T7467 | arg2Of | motif,recognized |
| R5956 | T7463 | T7462 | arg2Of | XXXpS/TXXE,( |
| R5957 | T7464 | T7462 | arg3Of | ),( |
| R5958 | T7467 | T7466 | arg1Of | recognized,potentially |
| R5959 | T7470 | T7467 | arg1Of | kinase,recognized |
| R5960 | T7470 | T7468 | arg2Of | kinase,by |
| R5961 | T7470 | T7469 | arg1Of | kinase,casein |
| R5962 | T7470 | T7471 | arg1Of | kinase,II |
| R5963 | T7470 | T7472 | arg1Of | kinase,( |
| R5964 | T7473 | T7472 | arg2Of | CK2,( |
| R5965 | T7474 | T7472 | arg3Of | ),( |
| R5966 | T7477 | T7476 | arg1Of | kinase,IKKβ |
| R5967 | T7477 | T7478 | arg1Of | kinase,can |
| R5968 | T7477 | T7479 | arg1Of | kinase,display |
| R5969 | T7479 | T7475 | arg2Of | display,Although |
| R5970 | T7479 | T7478 | arg2Of | display,can |
| R5971 | T7483 | T7479 | arg2Of | specificity29,display |
| R5972 | T7483 | T7480 | arg1Of | specificity29,a |
| R5973 | T7483 | T7481 | arg1Of | specificity29,CK2-like |
| R5974 | T7483 | T7482 | arg1Of | specificity29,phosphorylation |
| R5975 | T7487 | T7485 | arg1Of | protein,no |
| R5976 | T7487 | T7486 | arg1Of | protein,CK2 |
| R5977 | T7487 | T7488 | arg1Of | protein,was |
| R5978 | T7487 | T7489 | arg1Of | protein,detectable |
| R5979 | T7488 | T7475 | arg1Of | was,Although |
| R5980 | T7488 | T7484 | arg1Of | was,"," |
| R5981 | T7488 | T7490 | arg1Of | was,in |
| R5982 | T7489 | T7488 | arg2Of | detectable,was |
| R5983 | T7494 | T7490 | arg2Of | proteins,in |
| R5984 | T7494 | T7491 | arg1Of | proteins,our |
| R5985 | T7494 | T7492 | arg1Of | proteins,recombinant |
| R5986 | T7494 | T7493 | arg1Of | proteins,IKK |
| R5987 | T7494 | T7495 | arg1Of | proteins,( |
| R5988 | T7497 | T7495 | arg2Of | Fig.,( |
| R5989 | T7497 | T7496 | arg1Of | Fig.,Supplementary |
| R5990 | T7497 | T7498 | arg1Of | Fig.,6 |
| R5991 | T7499 | T7495 | arg3Of | ),( |
| R5992 | T7504 | T7502 | arg1Of | phosphorylation,RPS3 |
| R5993 | T7504 | T7503 | arg1Of | phosphorylation,S209 |
| R5994 | T7504 | T7505 | arg1Of | phosphorylation,was |
| R5995 | T7504 | T7506 | arg1Of | phosphorylation,due |
| R5996 | T7505 | T7500 | arg1Of | was,Thus |
| R5997 | T7505 | T7501 | arg1Of | was,"," |
| R5998 | T7506 | T7505 | arg2Of | due,was |
| R5999 | T7506 | T7507 | arg1Of | due,to |
| R6000 | T7510 | T7508 | arg1Of | specificity,the |
| R6001 | T7510 | T7509 | arg1Of | specificity,alternate |
| R6002 | T7510 | T7511 | arg1Of | specificity,of |
| R6003 | T7510 | T7516 | arg1Of | specificity,than |
| R6004 | T7514 | T7511 | arg2Of | kinase,of |
| R6005 | T7514 | T7512 | arg1Of | kinase,the |
| R6006 | T7514 | T7513 | arg1Of | kinase,IKKβ |
| R6007 | T7516 | T7507 | arg2Of | than,to |
| R6008 | T7516 | T7515 | arg1Of | than,rather |
| R6009 | T7519 | T7516 | arg2Of | amount,than |
| R6010 | T7519 | T7517 | arg1Of | amount,any |
| R6011 | T7519 | T7518 | arg1Of | amount,trace |
| R6012 | T7519 | T7520 | arg1Of | amount,of |
| R6013 | T7519 | T7522 | arg2Of | amount,bound |
| R6014 | T7521 | T7520 | arg2Of | CK2,of |
| R6015 | T7522 | T7523 | arg1Of | bound,to |
| R6016 | T7524 | T7523 | arg2Of | IKKs,to |
| R6017 | T7526 | T7525 | arg1Of | determine,To |
| R6018 | T7528 | T7529 | arg1Of | S209,is |
| R6019 | T7529 | T7526 | arg2Of | is,determine |
| R6020 | T7529 | T7527 | arg1Of | is,whether |
| R6021 | T7532 | T7529 | arg2Of | site,is |
| R6022 | T7532 | T7530 | arg1Of | site,the |
| R6023 | T7532 | T7531 | arg1Of | site,critical |
| R6024 | T7532 | T7533 | arg2Of | site,at |
| R6025 | T7532 | T7534 | arg1Of | site,which |
| R6026 | T7535 | T7536 | arg1Of | IKKβ,phosphorylates |
| R6027 | T7536 | T7533 | arg1Of | phosphorylates,at |
| R6028 | T7536 | T7538 | arg1Of | phosphorylates,in |
| R6029 | T7537 | T7536 | arg2Of | RPS3,phosphorylates |
| R6030 | T7540 | T7538 | arg2Of | cells,in |
| R6031 | T7540 | T7539 | arg1Of | cells,living |
| R6032 | T7542 | T7526 | arg1Of | we,determine |
| R6033 | T7542 | T7543 | arg1Of | we,transfected |
| R6034 | T7543 | T7525 | modOf | transfected,To |
| R6035 | T7543 | T7541 | arg1Of | transfected,"," |
| R6036 | T7549 | T7543 | arg2Of | Flag-RPS3,transfected |
| R6037 | T7549 | T7544 | arg1Of | Flag-RPS3,the |
| R6038 | T7549 | T7545 | arg1Of | Flag-RPS3,wild-type |
| R6039 | T7549 | T7546 | arg1Of | Flag-RPS3,or |
| R6040 | T7549 | T7547 | arg1Of | Flag-RPS3,S209A |
| R6041 | T7549 | T7548 | arg1Of | Flag-RPS3,mutant |
| R6042 | T7549 | T7550 | arg1Of | Flag-RPS3,alone |
| R6043 | T7549 | T7553 | arg1Of | Flag-RPS3,together |
| R6044 | T7549 | T7556 | arg1Of | Flag-RPS3,into |
| R6045 | T7550 | T7552 | arg1Of | alone,or |
| R6046 | T7552 | T7551 | arg1Of | or,"," |
| R6047 | T7552 | T7554 | arg1Of | or,with |
| R6048 | T7553 | T7552 | arg2Of | together,or |
| R6049 | T7555 | T7554 | arg2Of | IKKβ,with |
| R6050 | T7557 | T7556 | arg2Of | cells,into |
| R6051 | T7560 | T7561 | arg1Of | we,observed |
| R6052 | T7561 | T7558 | arg1Of | observed,Indeed |
| R6053 | T7561 | T7559 | arg1Of | observed,"," |
| R6054 | T7564 | T7563 | arg1Of | IKKβ,overexpressing |
| R6055 | T7564 | T7565 | arg1Of | IKKβ,enhanced |
| R6056 | T7565 | T7569 | arg1Of | enhanced,but |
| R6057 | T7567 | T7565 | arg2Of | phosphorylation,enhanced |
| R6058 | T7567 | T7566 | arg1Of | phosphorylation,Flag-RPS3 |
| R6059 | T7569 | T7561 | arg2Of | but,observed |
| R6060 | T7569 | T7562 | arg1Of | but,that |
| R6061 | T7569 | T7568 | arg1Of | but,"," |
| R6062 | T7570 | T7571 | arg1Of | phosphorylation,was |
| R6063 | T7570 | T7573 | arg2Of | phosphorylation,eliminated |
| R6064 | T7573 | T7569 | arg2Of | eliminated,but |
| R6065 | T7573 | T7571 | arg2Of | eliminated,was |
| R6066 | T7573 | T7572 | arg1Of | eliminated,effectively |
| R6067 | T7576 | T7573 | arg1Of | substitution,eliminated |
| R6068 | T7576 | T7574 | arg2Of | substitution,by |
| R6069 | T7576 | T7575 | arg1Of | substitution,alanine |
| R6070 | T7576 | T7577 | arg1Of | substitution,indicating |
| R6071 | T7579 | T7580 | arg1Of | S209,is |
| R6072 | T7580 | T7577 | arg2Of | is,indicating |
| R6073 | T7580 | T7578 | arg1Of | is,that |
| R6074 | T7584 | T7580 | arg2Of | site,is |
| R6075 | T7584 | T7581 | arg1Of | site,the |
| R6076 | T7584 | T7582 | arg1Of | site,predominant |
| R6077 | T7584 | T7583 | arg1Of | site,target |
| R6078 | T7584 | T7585 | arg1Of | site,for |
| R6079 | T7587 | T7585 | arg2Of | phosphorylation,for |
| R6080 | T7587 | T7586 | arg1Of | phosphorylation,IKKβ |
| R6081 | T7587 | T7588 | arg1Of | phosphorylation,( |
| R6082 | T7590 | T7588 | arg2Of | 4d,( |
| R6083 | T7590 | T7589 | arg1Of | 4d,Fig. |
| R6084 | T7591 | T7588 | arg3Of | ),( |
| R6085 | T7592 | T7594 | arg1Of | We,generated |
| R6086 | T7592 | T7600 | arg1Of | We,confirmed |
| R6087 | T7594 | T7599 | arg1Of | generated,and |
| R6088 | T7598 | T7594 | arg2Of | antibody,generated |
| R6089 | T7598 | T7595 | arg1Of | antibody,a |
| R6090 | T7598 | T7596 | arg1Of | antibody,phospho-S209 |
| R6091 | T7598 | T7597 | arg1Of | antibody,RPS3 |
| R6092 | T7599 | T7593 | arg1Of | and,next |
| R6093 | T7600 | T7599 | arg2Of | confirmed,and |
| R6094 | T7603 | T7602 | arg1Of | RPS3,endogenous |
| R6095 | T7603 | T7604 | arg1Of | RPS3,was |
| R6096 | T7603 | T7605 | arg2Of | RPS3,phosphorylated |
| R6097 | T7605 | T7600 | arg2Of | phosphorylated,confirmed |
| R6098 | T7605 | T7601 | arg1Of | phosphorylated,that |
| R6099 | T7605 | T7604 | arg2Of | phosphorylated,was |
| R6100 | T7605 | T7606 | arg1Of | phosphorylated,at |
| R6101 | T7605 | T7608 | arg1Of | phosphorylated,in |
| R6102 | T7605 | T7612 | arg1Of | phosphorylated,upon |
| R6103 | T7607 | T7606 | arg2Of | S209,at |
| R6104 | T7611 | T7608 | arg2Of | manner,in |
| R6105 | T7611 | T7609 | arg1Of | manner,a |
| R6106 | T7611 | T7610 | arg1Of | manner,time-dependent |
| R6107 | T7614 | T7612 | arg2Of | stimulation,upon |
| R6108 | T7614 | T7613 | arg1Of | stimulation,TNF |
| R6109 | T7614 | T7615 | arg1Of | stimulation,( |
| R6110 | T7617 | T7615 | arg2Of | 4e,( |
| R6111 | T7617 | T7616 | arg1Of | 4e,Fig. |
| R6112 | T7618 | T7615 | arg3Of | ),( |
| R6113 | T7624 | T7621 | arg1Of | tail,the |
| R6114 | T7624 | T7622 | arg1Of | tail,RPS3 |
| R6115 | T7624 | T7623 | arg1Of | tail,C-terminal |
| R6116 | T7624 | T7626 | arg1Of | tail,contains |
| R6117 | T7626 | T7619 | arg1Of | contains,Thus |
| R6118 | T7626 | T7620 | arg1Of | contains,"," |
| R6119 | T7626 | T7625 | arg1Of | contains,potentially |
| R6120 | T7630 | T7626 | arg2Of | site,contains |
| R6121 | T7630 | T7627 | arg1Of | site,an |
| R6122 | T7630 | T7628 | arg1Of | site,important |
| R6123 | T7630 | T7629 | arg1Of | site,regulatory |
| R7354 | T9234 | T9229 | arg2Of | polymerase,and |
| R7297 | T9178 | T9179 | arg1Of | Phosphorylation,of |
| R7298 | T9178 | T9181 | arg1Of | Phosphorylation,and |
| R7299 | T9180 | T9179 | arg2Of | RPS3,of |
| R7300 | T9184 | T9181 | arg2Of | function,and |
| R7301 | T9184 | T9182 | arg1Of | function,its |
| R7302 | T9184 | T9183 | arg1Of | function,NF-κB |
| R7303 | T9185 | T9187 | arg1Of | We,examined |
| R7304 | T9187 | T9186 | arg1Of | examined,next |
| R7305 | T9190 | T9189 | arg1Of | phosphorylation,S209 |
| R7306 | T9190 | T9191 | arg1Of | phosphorylation,plays |
| R7307 | T9191 | T9187 | arg2Of | plays,examined |
| R7308 | T9191 | T9188 | arg1Of | plays,whether |
| R7309 | T9191 | T9194 | arg1Of | plays,in |
| R7310 | T9193 | T9191 | arg2Of | role,plays |
| R7311 | T9193 | T9192 | arg1Of | role,a |
| R7312 | T9197 | T9194 | arg2Of | translocation,in |
| R7313 | T9197 | T9195 | arg1Of | translocation,the |
| R7314 | T9197 | T9196 | arg1Of | translocation,nuclear |
| R7315 | T9197 | T9198 | arg1Of | translocation,of |
| R7316 | T9197 | T9200 | arg1Of | translocation,during |
| R7317 | T9199 | T9198 | arg2Of | RPS3,of |
| R7318 | T9202 | T9200 | arg2Of | activation,during |
| R7319 | T9202 | T9201 | arg1Of | activation,NF-κB |
| R7320 | T9204 | T9203 | arg1Of | fractions,Subcellular |
| R7321 | T9204 | T9205 | arg1Of | fractions,from |
| R7322 | T9204 | T9213 | arg1Of | fractions,were |
| R7323 | T9204 | T9214 | arg2Of | fractions,prepared |
| R7324 | T9204 | T9216 | arg2Of | fractions,blotted |
| R7325 | T9207 | T9208 | arg1Of | wild-type,or |
| R7326 | T9209 | T9208 | arg2Of | S209A,or |
| R7327 | T9212 | T9205 | arg2Of | cells,from |
| R7328 | T9212 | T9206 | arg1Of | cells,either |
| R7329 | T9212 | T9207 | arg1Of | cells,wild-type |
| R7330 | T9212 | T9209 | arg1Of | cells,S209A |
| R7331 | T9212 | T9210 | arg1Of | cells,mutant |
| R7332 | T9212 | T9211 | arg1Of | cells,RPS3-transfected |
| R7333 | T9214 | T9215 | arg1Of | prepared,and |
| R7334 | T9215 | T9213 | arg2Of | and,were |
| R7335 | T9215 | T9217 | arg1Of | and,for |
| R7336 | T9215 | T9242 | arg1Of | and,"," |
| R7337 | T9215 | T9243 | modOf | and,confirming |
| R7338 | T9216 | T9215 | arg2Of | blotted,and |
| R7339 | T9219 | T9218 | arg1Of | protein,heat-shock |
| R7340 | T9219 | T9220 | arg1Of | protein,90 |
| R7341 | T9219 | T9221 | arg1Of | protein,( |
| R7342 | T9219 | T9224 | arg1Of | protein,"," |
| R7343 | T9219 | T9229 | arg1Of | protein,and |
| R7344 | T9222 | T9221 | arg2Of | hsp90,( |
| R7345 | T9223 | T9221 | arg3Of | ),( |
| R7346 | T9227 | T9224 | arg2Of | protein,"," |
| R7347 | T9227 | T9225 | arg1Of | protein,a |
| R7348 | T9227 | T9226 | arg1Of | protein,cytoplasmic |
| R7349 | T9229 | T9217 | arg2Of | and,for |
| R7350 | T9229 | T9228 | arg1Of | and,"," |
| R7351 | T9229 | T9238 | arg1Of | and,"," |
| R7352 | T9232 | T9231 | arg2Of | ADP-ribose,( |
| R7353 | T9233 | T9231 | arg3Of | ),( |
| R7355 | T9234 | T9230 | arg1Of | polymerase,poly |
| R7356 | T9234 | T9231 | arg1Of | polymerase,( |
| R7357 | T9234 | T9235 | arg1Of | polymerase,( |
| R7358 | T9236 | T9235 | arg2Of | PARP,( |
| R7359 | T9237 | T9235 | arg3Of | ),( |
| R7360 | T9241 | T9238 | arg2Of | protein,"," |
| R7361 | T9241 | T9239 | arg1Of | protein,a |
| R7362 | T9241 | T9240 | arg1Of | protein,nuclear |
| R7363 | T9246 | T9243 | arg2Of | separation,confirming |
| R7364 | T9246 | T9244 | arg1Of | separation,a |
| R7365 | T9246 | T9245 | arg1Of | separation,clean |
| R7366 | T9246 | T9247 | arg1Of | separation,( |
| R7367 | T9249 | T9247 | arg2Of | 5a,( |
| R7368 | T9249 | T9248 | arg1Of | 5a,Fig. |
| R7369 | T9250 | T9247 | arg3Of | ),( |
| R7370 | T9252 | T9251 | arg2Of | expected,As |
| R7371 | T9255 | T9254 | arg1Of | stimulation,PMA+I |
| R7372 | T9255 | T9256 | arg1Of | stimulation,triggered |
| R7373 | T9256 | T9251 | arg1Of | triggered,As |
| R7374 | T9256 | T9253 | arg1Of | triggered,"," |
| R7375 | T9260 | T9256 | arg2Of | translocation,triggered |
| R7376 | T9260 | T9257 | arg1Of | translocation,wild-type |
| R7377 | T9260 | T9258 | arg1Of | translocation,Flag-RPS3 |
| R7378 | T9260 | T9259 | arg1Of | translocation,nuclear |
| R7379 | T9260 | T9261 | arg1Of | translocation,( |
| R7380 | T9263 | T9261 | arg2Of | 5a,( |
| R7381 | T9263 | T9262 | arg1Of | 5a,Fig. |
| R7382 | T9264 | T9261 | arg3Of | ),( |
| R7383 | T9269 | T9268 | arg2Of | S209A,( |
| R7384 | T9270 | T9268 | arg3Of | ),( |
| R7385 | T9272 | T9267 | arg1Of | translocation,RPS3 |
| R7386 | T9272 | T9268 | arg1Of | translocation,( |
| R7387 | T9272 | T9271 | arg1Of | translocation,nuclear |
| R7388 | T9272 | T9273 | arg1Of | translocation,was |
| R7389 | T9272 | T9274 | arg2Of | translocation,attenuated |
| R7390 | T9274 | T9265 | arg1Of | attenuated,However |
| R7391 | T9274 | T9266 | arg1Of | attenuated,"," |
| R7392 | T9274 | T9273 | arg2Of | attenuated,was |
| R7393 | T9274 | T9275 | arg1Of | attenuated,( |
| R7394 | T9277 | T9275 | arg2Of | 5a,( |
| R7395 | T9277 | T9276 | arg1Of | 5a,Fig. |
| R7396 | T9278 | T9275 | arg3Of | ),( |
| R7397 | T9279 | T9281 | arg1Of | We,tested |
| R7398 | T9281 | T9280 | arg1Of | tested,also |
| R7399 | T9283 | T9281 | arg2Of | impact,tested |
| R7400 | T9283 | T9282 | arg1Of | impact,the |
| R7401 | T9283 | T9284 | arg1Of | impact,of |
| R7402 | T9285 | T9284 | arg2Of | activating,of |
| R7403 | T9285 | T9287 | arg1Of | activating,by |
| R7404 | T9286 | T9285 | arg2Of | NF-κB,activating |
| R7405 | T9288 | T9287 | arg2Of | overexpressing,by |
| R7406 | T9288 | T9290 | arg1Of | overexpressing,on |
| R7407 | T9289 | T9288 | arg2Of | IKKβ,overexpressing |
| R7408 | T9293 | T9290 | arg2Of | translocation,on |
| R7409 | T9293 | T9291 | arg1Of | translocation,RPS3 |
| R7410 | T9293 | T9292 | arg1Of | translocation,nuclear |
| R7411 | T9295 | T9294 | arg1Of | overexpression,IKKβ |
| R7412 | T9295 | T9296 | arg1Of | overexpression,activated |
| R7413 | T9295 | T9310 | arg1Of | overexpression,induced |
| R7414 | T9296 | T9308 | arg1Of | activated,and |
| R7415 | T9297 | T9296 | arg2Of | NF-κB,activated |
| R7416 | T9297 | T9298 | arg2Of | NF-κB,measured |
| R7417 | T9298 | T9299 | arg1Of | measured,by |
| R7418 | T9301 | T9299 | arg2Of | assays,by |
| R7419 | T9301 | T9300 | arg1Of | assays,luciferase |
| R7420 | T9301 | T9302 | arg1Of | assays,( |
| R7421 | T9304 | T9302 | arg2Of | Fig.,( |
| R7422 | T9304 | T9303 | arg1Of | Fig.,Supplementary |
| R7423 | T9304 | T9305 | arg1Of | Fig.,7 |
| R7424 | T9306 | T9302 | arg3Of | ),( |
| R7425 | T9308 | T9307 | arg1Of | and,"," |
| R7426 | T9310 | T9308 | arg2Of | induced,and |
| R7427 | T9310 | T9309 | arg1Of | induced,also |
| R7428 | T9313 | T9310 | arg2Of | translocation,induced |
| R7429 | T9313 | T9311 | arg1Of | translocation,the |
| R7430 | T9313 | T9312 | arg1Of | translocation,nuclear |
| R7431 | T9313 | T9314 | arg1Of | translocation,of |
| R7432 | T9315 | T9317 | arg1Of | wild-type,but |
| R7433 | T9317 | T9316 | arg1Of | but,"," |
| R7434 | T9317 | T9318 | arg1Of | but,not |
| R7435 | T9317 | T9320 | arg1Of | but,"," |
| R7436 | T9319 | T9317 | arg2Of | S209A,but |
| R7437 | T9320 | T9314 | arg2Of | ",",of |
| R7438 | T9321 | T9320 | arg2Of | RPS3,"," |
| R7439 | T9321 | T9322 | arg1Of | RPS3,( |
| R7440 | T9324 | T9322 | arg2Of | 5b,( |
| R7441 | T9324 | T9323 | arg1Of | 5b,Fig. |
| R7442 | T9325 | T9322 | arg3Of | ),( |
| R7443 | T9327 | T9326 | arg1Of | data,These |
| R7444 | T9327 | T9328 | arg1Of | data,suggest |
| R7445 | T9331 | T9330 | arg1Of | phosphorylation,S209 |
| R7446 | T9331 | T9332 | arg1Of | phosphorylation,is |
| R7447 | T9331 | T9333 | arg1Of | phosphorylation,critical |
| R7448 | T9332 | T9328 | arg2Of | is,suggest |
| R7449 | T9332 | T9329 | arg1Of | is,that |
| R7450 | T9333 | T9332 | arg2Of | critical,is |
| R7451 | T9333 | T9334 | arg1Of | critical,for |
| R7452 | T9340 | T9334 | arg2Of | translocation,for |
| R7453 | T9340 | T9335 | arg1Of | translocation,the |
| R7454 | T9340 | T9336 | arg1Of | translocation,NF-κB |
| R7455 | T9340 | T9337 | arg1Of | translocation,activation-induced |
| R7456 | T9340 | T9338 | arg1Of | translocation,RPS3 |
| R7457 | T9340 | T9339 | arg1Of | translocation,nuclear |
| R7458 | T9342 | T9341 | arg1Of | examine,To |
| R7459 | T9344 | T9342 | arg2Of | role,examine |
| R7460 | T9344 | T9343 | arg1Of | role,the |
| R7461 | T9344 | T9345 | arg1Of | role,of |
| R7462 | T9347 | T9345 | arg2Of | phosphorylation,of |
| R7463 | T9347 | T9346 | arg1Of | phosphorylation,S209 |
| R7464 | T9347 | T9348 | arg1Of | phosphorylation,of |
| R7465 | T9349 | T9348 | arg2Of | RPS3,of |
| R7466 | T9349 | T9350 | arg1Of | RPS3,to |
| R7467 | T9353 | T9350 | arg2Of | function6,to |
| R7468 | T9353 | T9351 | arg1Of | function6,its |
| R7469 | T9353 | T9352 | arg1Of | function6,NF-κB |
| R7470 | T9353 | T9354 | arg1Of | function6,"," |
| R7471 | T9353 | T9356 | arg1Of | function6,"," |
| R7472 | T9355 | T9354 | arg2Of | 7,"," |
| R7473 | T9357 | T9356 | arg2Of | 30,"," |
| R7474 | T9359 | T9360 | arg1Of | we,silenced |
| R7475 | T9360 | T9341 | modOf | silenced,To |
| R7476 | T9360 | T9358 | arg1Of | silenced,"," |
| R7477 | T9363 | T9360 | arg2Of | expression,silenced |
| R7478 | T9363 | T9361 | arg1Of | expression,endogenous |
| R7479 | T9363 | T9362 | arg1Of | expression,RPS3 |
| R7480 | T9363 | T9364 | arg1Of | expression,using |
| R7481 | T9366 | T9364 | arg2Of | siRNA,using |
| R7482 | T9366 | T9365 | arg1Of | siRNA,an |
| R7483 | T9366 | T9367 | arg1Of | siRNA,that |
| R7484 | T9366 | T9368 | arg1Of | siRNA,targets |
| R7485 | T9368 | T9380 | arg1Of | targets,"," |
| R7486 | T9368 | T9381 | modOf | targets,followed |
| R7487 | T9372 | T9368 | arg2Of | region,targets |
| R7488 | T9372 | T9369 | arg1Of | region,the |
| R7489 | T9372 | T9370 | arg1Of | region,3′ |
| R7490 | T9372 | T9371 | arg1Of | region,untranslated |
| R7491 | T9372 | T9373 | arg1Of | region,( |
| R7492 | T9372 | T9377 | arg1Of | region,of |
| R7493 | T9375 | T9373 | arg2Of | UTR,( |
| R7494 | T9375 | T9374 | arg1Of | UTR,3′ |
| R7495 | T9376 | T9373 | arg3Of | ),( |
| R7496 | T9379 | T9377 | arg2Of | mRNA,of |
| R7497 | T9379 | T9378 | arg1Of | mRNA,RPS3 |
| R7498 | T9381 | T9391 | arg1Of | followed,via |
| R7499 | T9383 | T9381 | arg1Of | complementation,followed |
| R7500 | T9383 | T9382 | arg2Of | complementation,by |
| R7501 | T9383 | T9384 | arg1Of | complementation,with |
| R7502 | T9390 | T9384 | arg2Of | RPS3,with |
| R7503 | T9390 | T9385 | arg1Of | RPS3,either |
| R7504 | T9390 | T9386 | arg1Of | RPS3,wild-type |
| R7505 | T9390 | T9387 | arg1Of | RPS3,or |
| R7506 | T9390 | T9388 | arg1Of | RPS3,S209A |
| R7507 | T9390 | T9389 | arg1Of | RPS3,mutant |
| R7508 | T9392 | T9391 | arg2Of | transfection,via |
| R7509 | T9394 | T9393 | arg2Of | expected,As |
| R7510 | T9397 | T9396 | arg1Of | siRNA,RPS3 |
| R7511 | T9397 | T9399 | arg1Of | siRNA,reduced |
| R7512 | T9397 | T9409 | arg1Of | siRNA,did |
| R7513 | T9397 | T9411 | arg1Of | siRNA,affect |
| R7514 | T9399 | T9403 | arg1Of | reduced,compared |
| R7515 | T9399 | T9408 | arg1Of | reduced,but |
| R7516 | T9402 | T9399 | arg2Of | abundance,reduced |
| R7517 | T9402 | T9400 | arg1Of | abundance,endogenous |
| R7518 | T9402 | T9401 | arg1Of | abundance,RPS3 |
| R7519 | T9404 | T9403 | arg2Of | to,compared |
| R7520 | T9406 | T9404 | arg2Of | siRNA,to |
| R7521 | T9406 | T9405 | arg1Of | siRNA,NS |
| R7522 | T9408 | T9393 | arg1Of | but,As |
| R7523 | T9408 | T9395 | arg1Of | but,"," |
| R7524 | T9408 | T9398 | arg1Of | but,severely |
| R7525 | T9408 | T9407 | arg1Of | but,"," |
| R7526 | T9411 | T9408 | arg2Of | affect,but |
| R7527 | T9411 | T9409 | arg2Of | affect,did |
| R7528 | T9411 | T9410 | arg1Of | affect,not |
| R7529 | T9414 | T9411 | arg2Of | expression,affect |
| R7530 | T9414 | T9412 | arg1Of | expression,the |
| R7531 | T9414 | T9413 | arg1Of | expression,robust |
| R7532 | T9414 | T9415 | arg1Of | expression,of |
| R7533 | T9417 | T9415 | arg2Of | RPS3,of |
| R7534 | T9417 | T9416 | arg1Of | RPS3,Flag-tagged |
| R7535 | T9417 | T9418 | arg1Of | RPS3,from |
| R7536 | T9421 | T9418 | arg2Of | construct,from |
| R7537 | T9421 | T9419 | arg1Of | construct,a |
| R7538 | T9421 | T9420 | arg2Of | construct,transfected |
| R7539 | T9421 | T9422 | arg1Of | construct,lacking |
| R7540 | T9425 | T9422 | arg2Of | UTR,lacking |
| R7541 | T9425 | T9423 | arg1Of | UTR,the |
| R7542 | T9425 | T9424 | arg1Of | UTR,3′ |
| R7543 | T9425 | T9426 | arg1Of | UTR,( |
| R7544 | T9428 | T9426 | arg2Of | 5c,( |
| R7545 | T9428 | T9427 | arg1Of | 5c,Fig. |
| R7546 | T9429 | T9426 | arg3Of | ),( |
| R7547 | T9430 | T9432 | arg1Of | We,found |
| R7548 | T9432 | T9431 | arg1Of | found,also |
| R7549 | T9435 | T9434 | arg1Of | knockdown,RPS3 |
| R7550 | T9435 | T9436 | arg1Of | knockdown,reduced |
| R7551 | T9436 | T9432 | arg2Of | reduced,found |
| R7552 | T9436 | T9433 | arg1Of | reduced,that |
| R7553 | T9438 | T9436 | arg2Of | expression,reduced |
| R7554 | T9438 | T9437 | arg1Of | expression,TNF-induced |
| R7555 | T9438 | T9439 | arg1Of | expression,of |
| R7556 | T9444 | T9439 | arg2Of | construct6,of |
| R7557 | T9444 | T9440 | arg1Of | construct6,an |
| R7558 | T9444 | T9441 | arg1Of | construct6,Ig |
| R7559 | T9444 | T9442 | arg1Of | construct6,κB-driven |
| R7560 | T9444 | T9443 | arg1Of | construct6,luciferase |
| R7561 | T9444 | T9445 | arg1Of | construct6,( |
| R7562 | T9447 | T9445 | arg2Of | 5d,( |
| R7563 | T9447 | T9446 | arg1Of | 5d,Fig. |
| R7564 | T9448 | T9445 | arg3Of | ),( |
| R7565 | T9452 | T9449 | arg1Of | signal,The |
| R7566 | T9452 | T9450 | arg1Of | signal,impaired |
| R7567 | T9452 | T9451 | arg1Of | signal,luciferase |
| R7568 | T9452 | T9453 | arg2Of | signal,caused |
| R7569 | T9452 | T9457 | arg1Of | signal,was |
| R7570 | T9452 | T9459 | arg2Of | signal,restored |
| R7571 | T9456 | T9453 | arg1Of | deficiency,caused |
| R7572 | T9456 | T9454 | arg2Of | deficiency,by |
| R7573 | T9456 | T9455 | arg1Of | deficiency,RPS3 |
| R7574 | T9459 | T9457 | arg2Of | restored,was |
| R7575 | T9459 | T9458 | arg1Of | restored,completely |
| R7576 | T9459 | T9460 | arg1Of | restored,by |
| R7577 | T9459 | T9466 | arg1Of | restored,by |
| R7578 | T9459 | T9473 | arg1Of | restored,"," |
| R7579 | T9459 | T9474 | arg1Of | restored,despite |
| R7580 | T9460 | T9464 | arg1Of | by,but |
| R7581 | T9461 | T9460 | arg2Of | transfecting,by |
| R7582 | T9462 | T9461 | arg2Of | wild-type,transfecting |
| R7583 | T9464 | T9463 | arg1Of | but,"," |
| R7584 | T9466 | T9464 | arg2Of | by,but |
| R7585 | T9466 | T9465 | arg1Of | by,not |
| R7586 | T9468 | T9466 | arg2Of | RPS3,by |
| R7587 | T9468 | T9467 | arg1Of | RPS3,S209A |
| R7588 | T9468 | T9469 | arg1Of | RPS3,( |
| R7589 | T9471 | T9469 | arg2Of | 5d,( |
| R7590 | T9471 | T9470 | arg1Of | 5d,Fig. |
| R7591 | T9472 | T9469 | arg3Of | ),( |
| R7592 | T9476 | T9474 | arg2Of | expression,despite |
| R7593 | T9476 | T9475 | arg1Of | expression,equivalent |
| R7594 | T9476 | T9477 | arg1Of | expression,( |
| R7595 | T9479 | T9477 | arg2Of | 5c,( |
| R7596 | T9479 | T9478 | arg1Of | 5c,Fig. |
| R7597 | T9480 | T9477 | arg3Of | ),( |
| R7598 | T9484 | T9483 | arg1Of | failure,the |
| R7599 | T9484 | T9485 | arg1Of | failure,of |
| R7600 | T9484 | T9488 | modOf | failure,to |
| R7601 | T9484 | T9492 | arg1Of | failure,did |
| R7602 | T9484 | T9494 | arg1Of | failure,result |
| R7603 | T9487 | T9485 | arg2Of | RPS3,of |
| R7604 | T9487 | T9486 | arg1Of | RPS3,S209A |
| R7605 | T9489 | T9488 | arg1Of | restore,to |
| R7606 | T9491 | T9489 | arg2Of | activity,restore |
| R7607 | T9491 | T9490 | arg1Of | activity,luciferase |
| R7608 | T9494 | T9481 | arg1Of | result,Moreover |
| R7609 | T9494 | T9482 | arg1Of | result,"," |
| R7610 | T9494 | T9492 | arg2Of | result,did |
| R7611 | T9494 | T9493 | arg1Of | result,not |
| R7612 | T9494 | T9495 | arg1Of | result,from |
| R7613 | T9494 | T9498 | arg1Of | result,because |
| R7614 | T9497 | T9495 | arg2Of | translation,from |
| R7615 | T9497 | T9496 | arg1Of | translation,defective |
| R7616 | T9501 | T9499 | arg1Of | overexpression,the |
| R7617 | T9501 | T9500 | arg1Of | overexpression,transient |
| R7618 | T9501 | T9502 | arg1Of | overexpression,of |
| R7619 | T9501 | T9509 | arg1Of | overexpression,was |
| R7620 | T9501 | T9510 | arg1Of | overexpression,comparable |
| R7621 | T9505 | T9502 | arg2Of | protein,of |
| R7622 | T9505 | T9503 | arg1Of | protein,green |
| R7623 | T9505 | T9504 | arg1Of | protein,fluorescent |
| R7624 | T9505 | T9506 | arg1Of | protein,( |
| R7625 | T9507 | T9506 | arg2Of | GFP,( |
| R7626 | T9508 | T9506 | arg3Of | ),( |
| R7627 | T9509 | T9498 | arg2Of | was,because |
| R7628 | T9509 | T9511 | arg1Of | was,in |
| R7629 | T9510 | T9509 | arg2Of | comparable,was |
| R7630 | T9512 | T9511 | arg2Of | cells,in |
| R7631 | T9512 | T9513 | arg2Of | cells,complemented |
| R7632 | T9513 | T9514 | arg1Of | complemented,with |
| R7633 | T9518 | T9514 | arg2Of | RPS3,with |
| R7634 | T9518 | T9515 | arg1Of | RPS3,wild-type |
| R7635 | T9518 | T9516 | arg1Of | RPS3,or |
| R7636 | T9518 | T9517 | arg1Of | RPS3,S029A |
| R7637 | T9518 | T9519 | arg1Of | RPS3,( |
| R7638 | T9521 | T9519 | arg2Of | Fig.,( |
| R7639 | T9521 | T9520 | arg1Of | Fig.,Supplementary |
| R7640 | T9521 | T9522 | arg1Of | Fig.,8 |
| R7641 | T9523 | T9519 | arg3Of | ),( |
| R7642 | T9524 | T9525 | arg1Of | Taken,together |
| R7643 | T9528 | T9527 | arg1Of | data,these |
| R7644 | T9528 | T9529 | arg1Of | data,suggest |
| R7645 | T9529 | T9524 | modOf | suggest,Taken |
| R7646 | T9529 | T9526 | arg1Of | suggest,"," |
| R7647 | T9533 | T9531 | arg1Of | phosphorylation,RPS3 |
| R7648 | T9533 | T9532 | arg1Of | phosphorylation,S209 |
| R7649 | T9533 | T9534 | arg1Of | phosphorylation,is |
| R7650 | T9533 | T9535 | arg1Of | phosphorylation,critical |
| R7651 | T9534 | T9529 | arg2Of | is,suggest |
| R7652 | T9534 | T9530 | arg1Of | is,that |
| R7653 | T9535 | T9534 | arg2Of | critical,is |
| R7654 | T9535 | T9536 | arg1Of | critical,for |
| R7655 | T9538 | T9536 | arg2Of | activity,for |
| R7656 | T9538 | T9537 | arg1Of | activity,NF-κB |
| R7657 | T9538 | T9539 | arg1Of | activity,involving |
| R7658 | T9544 | T9539 | arg2Of | site,involving |
| R7659 | T9544 | T9540 | arg1Of | site,the |
| R7660 | T9544 | T9541 | arg1Of | site,canonical |
| R7661 | T9544 | T9542 | arg1Of | site,Ig |
| R7662 | T9544 | T9543 | arg1Of | site,κB |
| R7663 | T9545 | T9547 | arg1Of | We,used |
| R7664 | T9545 | T9551 | arg1Of | We,determine |
| R7665 | T9547 | T9546 | arg1Of | used,next |
| R7666 | T9549 | T9547 | arg2Of | immunoprecipitation,used |
| R7667 | T9549 | T9548 | arg1Of | immunoprecipitation,chromatin |
| R7668 | T9551 | T9547 | arg3Of | determine,used |
| R7669 | T9551 | T9550 | arg1Of | determine,to |
| R7670 | T9554 | T9553 | arg1Of | phosphorylation,S209 |
| R7671 | T9554 | T9555 | arg1Of | phosphorylation,affects |
| R7672 | T9555 | T9551 | arg2Of | affects,determine |
| R7673 | T9555 | T9552 | arg1Of | affects,whether |
| R7674 | T9555 | T9564 | arg1Of | affects,in |
| R7675 | T9556 | T9557 | arg1Of | RPS3,and |
| R7676 | T9558 | T9557 | arg2Of | p65,and |
| R7677 | T9559 | T9555 | arg2Of | recruitment,affects |
| R7678 | T9559 | T9556 | arg1Of | recruitment,RPS3 |
| R7679 | T9559 | T9558 | arg1Of | recruitment,p65 |
| R7680 | T9559 | T9560 | arg1Of | recruitment,to |
| R7681 | T9563 | T9560 | arg2Of | sites,to |
| R7682 | T9563 | T9561 | arg1Of | sites,specific |
| R7683 | T9563 | T9562 | arg1Of | sites,κB |
| R7684 | T9566 | T9564 | arg2Of | chromatin,in |
| R7685 | T9566 | T9565 | arg1Of | chromatin,intact |
| R7686 | T9566 | T9567 | arg1Of | chromatin,during |
| R7687 | T9569 | T9567 | arg2Of | activation,during |
| R7688 | T9569 | T9568 | arg1Of | activation,NF-κB |
| R7689 | T9573 | T9570 | arg2Of | cells,In |
| R7690 | T9573 | T9571 | arg1Of | cells,RPS3 |
| R7691 | T9573 | T9572 | arg1Of | cells,knockdown |
| R7692 | T9575 | T9576 | arg1Of | PMA+I,stimulated |
| R7693 | T9576 | T9570 | arg1Of | stimulated,In |
| R7694 | T9576 | T9574 | arg1Of | stimulated,"," |
| R7695 | T9576 | T9590 | arg1Of | stimulated,to |
| R7696 | T9578 | T9576 | arg2Of | recruitment,stimulated |
| R7697 | T9578 | T9577 | arg1Of | recruitment,the |
| R7698 | T9578 | T9579 | arg1Of | recruitment,of |
| R7699 | T9581 | T9580 | arg1Of | expressed,ectopically |
| R7700 | T9581 | T9582 | arg1Of | expressed,"," |
| R7701 | T9583 | T9582 | arg2Of | Flag-tagged,"," |
| R7702 | T9584 | T9581 | arg1Of | wild-type,expressed |
| R7703 | T9584 | T9583 | arg1Of | wild-type,Flag-tagged |
| R7704 | T9584 | T9586 | arg1Of | wild-type,but |
| R7705 | T9586 | T9579 | arg2Of | but,of |
| R7706 | T9586 | T9585 | arg1Of | but,"," |
| R7707 | T9586 | T9587 | arg1Of | but,not |
| R7708 | T9589 | T9586 | arg2Of | RPS3,but |
| R7709 | T9589 | T9588 | arg1Of | RPS3,S209A |
| R7710 | T9593 | T9590 | arg2Of | sites,to |
| R7711 | T9593 | T9591 | arg1Of | sites,the |
| R7712 | T9593 | T9592 | arg1Of | sites,κB |
| R7713 | T9593 | T9594 | arg1Of | sites,of |
| R7714 | T9596 | T9597 | arg1Of | NFKBIA,and |
| R7715 | T9598 | T9597 | arg2Of | IL8,and |
| R7716 | T9599 | T9594 | arg2Of | promoters,of |
| R7717 | T9599 | T9595 | arg1Of | promoters,the |
| R7718 | T9599 | T9596 | arg1Of | promoters,NFKBIA |
| R7719 | T9599 | T9598 | arg1Of | promoters,IL8 |
| R7720 | T9599 | T9600 | arg1Of | promoters,( |
| R7721 | T9602 | T9600 | arg2Of | 5e,( |
| R7722 | T9602 | T9601 | arg1Of | 5e,Fig. |
| R7723 | T9603 | T9600 | arg3Of | ),( |
| R7724 | T9605 | T9604 | arg2Of | expressing,While |
| R7725 | T9607 | T9605 | arg2Of | S209A,expressing |
| R7726 | T9607 | T9606 | arg1Of | S209A,RPS3 |
| R7727 | T9607 | T9608 | arg1Of | S209A,had |
| R7728 | T9608 | T9605 | arg3Of | had,expressing |
| R7729 | T9610 | T9608 | arg2Of | impact,had |
| R7730 | T9610 | T9609 | arg1Of | impact,no |
| R7731 | T9610 | T9611 | arg1Of | impact,on |
| R7732 | T9614 | T9611 | arg2Of | translocation,on |
| R7733 | T9614 | T9612 | arg1Of | translocation,p65 |
| R7734 | T9614 | T9613 | arg1Of | translocation,nuclear |
| R7735 | T9616 | T9605 | arg1Of | it,expressing |
| R7736 | T9616 | T9618 | arg1Of | it,attenuated |
| R7737 | T9618 | T9604 | arg1Of | attenuated,While |
| R7738 | T9618 | T9615 | arg1Of | attenuated,"," |
| R7739 | T9618 | T9617 | arg1Of | attenuated,substantially |
| R7740 | T9620 | T9618 | arg2Of | recruitment,attenuated |
| R7741 | T9620 | T9619 | arg1Of | recruitment,p65 |
| R7742 | T9620 | T9621 | arg1Of | recruitment,( |
| R7743 | T9623 | T9621 | arg2Of | 5e,( |
| R7744 | T9623 | T9622 | arg1Of | 5e,Fig. |
| R7745 | T9624 | T9621 | arg3Of | ),( |
| R7746 | T9626 | T9625 | arg1Of | experiments,Additional |
| R7747 | T9626 | T9627 | arg1Of | experiments,revealed |
| R7748 | T9630 | T9629 | arg1Of | attraction,p65 |
| R7749 | T9630 | T9631 | arg1Of | attraction,to |
| R7750 | T9630 | T9640 | arg1Of | attraction,was |
| R7751 | T9630 | T9641 | arg2Of | attraction,increased |
| R7752 | T9630 | T9648 | arg1Of | attraction,consistent |
| R7753 | T9636 | T9631 | arg2Of | promoters,to |
| R7754 | T9636 | T9632 | arg1Of | promoters,RPS3-independent |
| R7755 | T9636 | T9633 | arg1Of | promoters,NF-κB |
| R7756 | T9636 | T9634 | arg1Of | promoters,target |
| R7757 | T9636 | T9635 | arg1Of | promoters,gene |
| R7758 | T9636 | T9638 | arg1Of | promoters,as |
| R7759 | T9638 | T9637 | arg1Of | as,such |
| R7760 | T9639 | T9638 | arg2Of | CD25,as |
| R7761 | T9641 | T9627 | arg2Of | increased,revealed |
| R7762 | T9641 | T9628 | arg1Of | increased,that |
| R7763 | T9641 | T9640 | arg2Of | increased,was |
| R7764 | T9641 | T9642 | arg1Of | increased,( |
| R7765 | T9641 | T9647 | arg1Of | increased,"," |
| R7766 | T9641 | T9648 | modOf | increased,consistent |
| R7767 | T9644 | T9642 | arg2Of | Fig.,( |
| R7768 | T9644 | T9643 | arg1Of | Fig.,Supplementary |
| R7769 | T9644 | T9645 | arg1Of | Fig.,9 |
| R7770 | T9646 | T9642 | arg3Of | ),( |
| R7771 | T9648 | T9649 | arg1Of | consistent,with |
| R7772 | T9652 | T9649 | arg2Of | observations6,with |
| R7773 | T9652 | T9650 | arg1Of | observations6,our |
| R7774 | T9652 | T9651 | arg1Of | observations6,previous |
| R7775 | T9653 | T9654 | arg1Of | There,was |
| R7776 | T9657 | T9656 | arg1Of | Flag-RPS3,significant |
| R7777 | T9657 | T9658 | arg1Of | Flag-RPS3,or |
| R7778 | T9658 | T9654 | arg2Of | or,was |
| R7779 | T9658 | T9655 | arg1Of | or,no |
| R7780 | T9658 | T9661 | arg1Of | or,to |
| R7781 | T9660 | T9658 | arg2Of | recruitment,or |
| R7782 | T9660 | T9659 | arg1Of | recruitment,p65 |
| R7783 | T9663 | T9661 | arg2Of | promoter,to |
| R7784 | T9663 | T9662 | arg1Of | promoter,ACTB |
| R7785 | T9663 | T9664 | arg1Of | promoter,lacking |
| R7786 | T9663 | T9672 | arg1Of | promoter,suggesting |
| R7787 | T9664 | T9671 | arg1Of | lacking,"," |
| R7788 | T9664 | T9672 | modOf | lacking,suggesting |
| R7789 | T9666 | T9664 | arg2Of | sites,lacking |
| R7790 | T9666 | T9665 | arg1Of | sites,κB |
| R7791 | T9666 | T9667 | arg1Of | sites,( |
| R7792 | T9669 | T9667 | arg2Of | 5e,( |
| R7793 | T9669 | T9668 | arg1Of | 5e,Fig. |
| R7794 | T9670 | T9667 | arg3Of | ),( |
| R7795 | T9674 | T9673 | arg1Of | recruitment,the |
| R7796 | T9674 | T9675 | arg1Of | recruitment,was |
| R7797 | T9674 | T9677 | arg1Of | recruitment,site-specific |
| R7798 | T9675 | T9672 | arg2Of | was,suggesting |
| R7799 | T9677 | T9675 | arg2Of | site-specific,was |
| R7800 | T9677 | T9676 | arg1Of | site-specific,κB |
| R7801 | T9681 | T9680 | arg1Of | recruitment,the |
| R7802 | T9681 | T9682 | arg1Of | recruitment,of |
| R7803 | T9681 | T9686 | arg1Of | recruitment,as |
| R7804 | T9683 | T9682 | arg2Of | RPS3,of |
| R7805 | T9686 | T9684 | arg1Of | as,as |
| R7806 | T9686 | T9685 | arg1Of | as,well |
| R7807 | T9686 | T9695 | arg1Of | as,depended |
| R7808 | T9689 | T9686 | arg2Of | recruitment,as |
| R7809 | T9689 | T9687 | arg1Of | recruitment,the |
| R7810 | T9689 | T9688 | arg1Of | recruitment,contingent |
| R7811 | T9689 | T9690 | arg1Of | recruitment,of |
| R7812 | T9689 | T9692 | arg1Of | recruitment,to |
| R7813 | T9691 | T9690 | arg2Of | p65,of |
| R7814 | T9694 | T9692 | arg2Of | promoters,to |
| R7815 | T9694 | T9693 | arg1Of | promoters,key |
| R7816 | T9695 | T9678 | arg1Of | depended,Thus |
| R7817 | T9695 | T9679 | arg1Of | depended,"," |
| R7818 | T9695 | T9696 | arg1Of | depended,on |
| R7819 | T9697 | T9696 | arg2Of | S209,on |
| R7820 | T9698 | T9699 | arg1Of | Interleukin,8 |
| R7821 | T9698 | T9700 | arg1Of | Interleukin,( |
| R7822 | T9701 | T9700 | arg2Of | IL-8,( |
| R7823 | T9702 | T9700 | arg3Of | ),( |
| R7824 | T9703 | T9698 | arg1Of | secretion,Interleukin |
| R7825 | T9703 | T9704 | arg2Of | secretion,induced |
| R7826 | T9703 | T9717 | arg1Of | secretion,was |
| R7827 | T9703 | T9718 | arg2Of | secretion,decreased |
| R7828 | T9709 | T9707 | arg1Of | receptor,T |
| R7829 | T9709 | T9708 | arg1Of | receptor,cell |
| R7830 | T9709 | T9710 | arg1Of | receptor,( |
| R7831 | T9711 | T9710 | arg2Of | TCR,( |
| R7832 | T9712 | T9710 | arg3Of | ),( |
| R7833 | T9714 | T9713 | arg1Of | stimulation,agonist |
| R7834 | T9714 | T9715 | arg1Of | stimulation,or |
| R7835 | T9715 | T9704 | arg1Of | or,induced |
| R7836 | T9715 | T9705 | arg2Of | or,by |
| R7837 | T9715 | T9706 | arg1Of | or,either |
| R7838 | T9715 | T9709 | arg1Of | or,receptor |
| R7839 | T9716 | T9715 | arg2Of | PMA+I,or |
| R7840 | T9718 | T9717 | arg2Of | decreased,was |
| R7841 | T9718 | T9719 | arg1Of | decreased,as |
| R7842 | T9718 | T9731 | arg1Of | decreased,in |
| R7843 | T9718 | T9737 | arg1Of | decreased,compared |
| R7844 | T9721 | T9719 | arg2Of | consequence,as |
| R7845 | T9721 | T9720 | arg1Of | consequence,a |
| R7846 | T9721 | T9722 | arg1Of | consequence,of |
| R7847 | T9721 | T9726 | arg1Of | consequence,to |
| R7848 | T9725 | T9722 | arg2Of | recruitment,of |
| R7849 | T9725 | T9723 | arg2Of | recruitment,reduced |
| R7850 | T9725 | T9724 | arg1Of | recruitment,RPS3/p65 |
| R7851 | T9730 | T9726 | arg2Of | sites,to |
| R7852 | T9730 | T9727 | arg1Of | sites,the |
| R7853 | T9730 | T9728 | arg1Of | sites,IL8 |
| R7854 | T9730 | T9729 | arg1Of | sites,κB |
| R7855 | T9733 | T9731 | arg2Of | presence,in |
| R7856 | T9733 | T9732 | arg1Of | presence,the |
| R7857 | T9733 | T9734 | arg1Of | presence,of |
| R7858 | T9736 | T9734 | arg2Of | mutant,of |
| R7859 | T9736 | T9735 | arg1Of | mutant,S209A |
| R7860 | T9738 | T9737 | arg2Of | to,compared |
| R7861 | T9740 | T9738 | arg2Of | RPS3,to |
| R7862 | T9740 | T9739 | arg1Of | RPS3,wild-type |
| R7863 | T9740 | T9741 | arg1Of | RPS3,( |
| R7864 | T9743 | T9741 | arg2Of | Fig.,( |
| R7865 | T9743 | T9742 | arg1Of | Fig.,Supplementary |
| R7866 | T9743 | T9744 | arg1Of | Fig.,10 |
| R7867 | T9745 | T9741 | arg3Of | ),( |
| R7868 | T9751 | T9748 | arg1Of | expression,cell |
| R7869 | T9751 | T9749 | arg1Of | expression,surface |
| R7870 | T9751 | T9750 | arg1Of | expression,CD25 |
| R7871 | T9751 | T9752 | arg1Of | expression,was |
| R7872 | T9751 | T9753 | arg1Of | expression,comparable |
| R7873 | T9752 | T9746 | arg1Of | was,However |
| R7874 | T9752 | T9747 | arg1Of | was,"," |
| R7875 | T9753 | T9752 | arg2Of | comparable,was |
| R7876 | T9753 | T9754 | arg1Of | comparable,between |
| R7877 | T9761 | T9754 | arg2Of | cells,between |
| R7878 | T9761 | T9755 | arg1Of | cells,the |
| R7879 | T9761 | T9756 | arg1Of | cells,wild-type |
| R7880 | T9761 | T9757 | arg1Of | cells,and |
| R7881 | T9761 | T9758 | arg1Of | cells,S209A |
| R7882 | T9761 | T9759 | arg1Of | cells,RPS3 |
| R7883 | T9761 | T9760 | arg2Of | cells,transfected |
| R7884 | T9761 | T9762 | arg1Of | cells,( |
| R7885 | T9764 | T9762 | arg2Of | Fig.,( |
| R7886 | T9764 | T9763 | arg1Of | Fig.,Supplementary |
| R7887 | T9764 | T9765 | arg1Of | Fig.,11 |
| R7888 | T9766 | T9762 | arg3Of | ),( |
| R7889 | T9771 | T9769 | arg1Of | phosphorylation,RPS3 |
| R7890 | T9771 | T9770 | arg1Of | phosphorylation,S209 |
| R7891 | T9771 | T9772 | arg1Of | phosphorylation,by |
| R7892 | T9771 | T9774 | arg1Of | phosphorylation,is |
| R7893 | T9771 | T9776 | arg2Of | phosphorylation,required |
| R7894 | T9773 | T9772 | arg2Of | IKKβ,by |
| R7895 | T9776 | T9767 | arg1Of | required,Therefore |
| R7896 | T9776 | T9768 | arg1Of | required,"," |
| R7897 | T9776 | T9774 | arg2Of | required,is |
| R7898 | T9776 | T9775 | arg1Of | required,apparently |
| R7899 | T9776 | T9777 | arg1Of | required,for |
| R7900 | T9776 | T9779 | arg1Of | required,in |
| R7901 | T9778 | T9777 | arg2Of | RPS3,for |
| R7902 | T9780 | T9779 | arg2Of | directing,in |
| R7903 | T9780 | T9782 | arg1Of | directing,to |
| R7904 | T9781 | T9780 | arg2Of | NF-κB,directing |
| R7905 | T9785 | T9782 | arg2Of | subset,to |
| R7906 | T9785 | T9783 | arg1Of | subset,a |
| R7907 | T9785 | T9784 | arg1Of | subset,specific |
| R7908 | T9785 | T9786 | arg1Of | subset,of |
| R7909 | T9788 | T9786 | arg2Of | genes,of |
| R7910 | T9788 | T9787 | arg1Of | genes,target |
| R9582 | T11955 | T11956 | arg1Of | NleH1,inhibits |
| R9583 | T11956 | T11960 | arg1Of | inhibits,vitro |
| R9584 | T11958 | T11956 | arg2Of | phosphorylation,inhibits |
| R9585 | T11958 | T11957 | arg1Of | phosphorylation,RPS3 |
| R9586 | T11960 | T11959 | arg1Of | vitro,in |
| R9587 | T11962 | T11961 | arg1Of | pathogens,EHEC |
| R9588 | T11962 | T11963 | arg1Of | pathogens,are |
| R9589 | T11966 | T11963 | arg2Of | agents,are |
| R9590 | T11966 | T11964 | arg1Of | agents,important |
| R9591 | T11966 | T11965 | arg1Of | agents,causative |
| R9592 | T11966 | T11967 | arg1Of | agents,of |
| R9593 | T11970 | T11969 | arg1Of | disease,foodborne |
| R9594 | T11970 | T11971 | arg1Of | disease,and |
| R9595 | T11971 | T11967 | arg2Of | and,of |
| R9596 | T11971 | T11968 | arg1Of | and,both |
| R9597 | T11974 | T11971 | arg2Of | failure31,and |
| R9598 | T11974 | T11972 | arg1Of | failure31,pediatric |
| R9599 | T11974 | T11973 | arg1Of | failure31,renal |
| R9600 | T11975 | T11976 | arg1Of | EHEC,utilize |
| R9601 | T11977 | T11976 | arg2Of | T3SS,utilize |
| R9602 | T11977 | T11978 | modOf | T3SS,to |
| R9603 | T11979 | T11978 | arg1Of | inject,to |
| R9604 | T11979 | T11982 | arg1Of | inject,directly |
| R9605 | T11979 | T11983 | arg1Of | inject,into |
| R9606 | T11981 | T11979 | arg2Of | proteins,inject |
| R9607 | T11981 | T11980 | arg1Of | proteins,effector |
| R9608 | T11986 | T11983 | arg2Of | cells32,into |
| R9609 | T11986 | T11984 | arg1Of | cells32,intestinal |
| R9610 | T11986 | T11985 | arg1Of | cells32,epithelial |
| R9611 | T11986 | T11990 | arg2Of | cells32,of |
| R9612 | T11986 | T11991 | arg1Of | cells32,which |
| R9613 | T11989 | T11988 | arg1Of | subset,a |
| R9614 | T11989 | T11990 | arg1Of | subset,of |
| R9615 | T11989 | T11992 | arg1Of | subset,inhibit |
| R9616 | T11992 | T11987 | arg1Of | inhibit,"," |
| R9617 | T11995 | T11992 | arg2Of | responses9,inhibit |
| R9618 | T11995 | T11993 | arg1Of | responses9,NF-κB-dependent |
| R9619 | T11995 | T11994 | arg1Of | responses9,innate |
| R9620 | T11995 | T11996 | arg1Of | responses9,"," |
| R9621 | T11997 | T11996 | arg2Of | 33-38,"," |
| R9622 | T12001 | T12002 | arg1Of | O157,: |
| R9623 | T12002 | T11999 | arg1Of | :,E. |
| R9624 | T12002 | T12000 | arg1Of | :,coli |
| R9625 | T12003 | T12002 | arg2Of | H7,: |
| R9626 | T12007 | T11998 | arg1Of | NleH1,The |
| R9627 | T12007 | T12001 | arg1Of | NleH1,O157 |
| R9628 | T12007 | T12003 | arg1Of | NleH1,H7 |
| R9629 | T12007 | T12004 | arg1Of | NleH1,EDL933 |
| R9630 | T12007 | T12005 | arg1Of | NleH1,effector |
| R9631 | T12007 | T12006 | arg1Of | NleH1,protein |
| R9632 | T12007 | T12008 | arg1Of | NleH1,binds |
| R9633 | T12007 | T12011 | arg1Of | NleH1,attenuates |
| R9634 | T12007 | T12017 | arg1Of | NleH1,impairing |
| R9635 | T12008 | T12009 | arg1Of | binds,to |
| R9636 | T12008 | T12010 | arg1Of | binds,and |
| R9637 | T12010 | T12015 | arg1Of | and,"," |
| R9638 | T12010 | T12017 | modOf | and,impairing |
| R9639 | T12011 | T12010 | arg2Of | attenuates,and |
| R9640 | T12014 | T12011 | arg2Of | translocation,attenuates |
| R9641 | T12014 | T12012 | arg1Of | translocation,RPS3 |
| R9642 | T12014 | T12013 | arg1Of | translocation,nuclear |
| R9643 | T12017 | T12016 | arg1Of | impairing,thus |
| R9644 | T12020 | T12017 | arg2Of | signaling9,impairing |
| R9645 | T12020 | T12018 | arg1Of | signaling9,RPS3-dependent |
| R9646 | T12020 | T12019 | arg1Of | signaling9,NF-κB |
| R9647 | T12021 | T12023 | arg1Of | We,hypothesized |
| R9648 | T12023 | T12022 | arg1Of | hypothesized,therefore |
| R9649 | T12025 | T12026 | arg1Of | NleH1,may |
| R9650 | T12025 | T12027 | arg1Of | NleH1,function |
| R9651 | T12025 | T12029 | arg1Of | NleH1,inhibiting |
| R9652 | T12027 | T12023 | arg2Of | function,hypothesized |
| R9653 | T12027 | T12024 | arg1Of | function,that |
| R9654 | T12027 | T12026 | arg2Of | function,may |
| R9655 | T12027 | T12028 | arg1Of | function,by |
| R9656 | T12029 | T12028 | arg2Of | inhibiting,by |
| R9657 | T12032 | T12029 | arg2Of | phosphorylation,inhibiting |
| R9658 | T12032 | T12030 | arg1Of | phosphorylation,RPS3 |
| R9659 | T12032 | T12031 | arg1Of | phosphorylation,S209 |
| R9660 | T12034 | T12033 | arg2Of | expected,As |
| R9661 | T12038 | T12036 | arg1Of | amounts,transfecting |
| R9662 | T12038 | T12037 | arg1Of | amounts,increasing |
| R9663 | T12038 | T12039 | arg1Of | amounts,of |
| R9664 | T12038 | T12042 | arg1Of | amounts,blocked |
| R9665 | T12041 | T12039 | arg2Of | plasmid,of |
| R9666 | T12041 | T12040 | arg1Of | plasmid,NleH1-HA |
| R9667 | T12042 | T12033 | arg1Of | blocked,As |
| R9668 | T12042 | T12035 | arg1Of | blocked,"," |
| R9669 | T12042 | T12046 | arg1Of | blocked,in |
| R9670 | T12045 | T12042 | arg2Of | activation,blocked |
| R9671 | T12045 | T12043 | arg1Of | activation,TNFα-induced |
| R9672 | T12045 | T12044 | arg1Of | activation,NF-κB |
| R9673 | T12051 | T12050 | arg2Of | Fig.,( |
| R9674 | T12051 | T12052 | arg1Of | Fig.,6a-b |
| R9675 | T12053 | T12050 | arg3Of | ),( |
| R9676 | T12054 | T12046 | arg2Of | 9,in |
| R9677 | T12054 | T12047 | arg1Of | 9,a |
| R9678 | T12054 | T12048 | arg1Of | 9,dose-dependent |
| R9679 | T12054 | T12049 | arg1Of | 9,manner |
| R9680 | T12054 | T12050 | arg1Of | 9,( |
| R9681 | T12057 | T12058 | arg1Of | NleH1,reduced |
| R9682 | T12058 | T12055 | arg1Of | reduced,Remarkably |
| R9683 | T12058 | T12056 | arg1Of | reduced,"," |
| R9684 | T12058 | T12068 | arg1Of | reduced,to |
| R9685 | T12060 | T12064 | arg1Of | TNF-induced,as |
| R9686 | T12064 | T12059 | arg1Of | as,both |
| R9687 | T12064 | T12061 | arg1Of | as,"," |
| R9688 | T12064 | T12062 | arg1Of | as,as |
| R9689 | T12064 | T12063 | arg1Of | as,well |
| R9690 | T12065 | T12064 | arg2Of | basal,as |
| R9691 | T12067 | T12058 | arg2Of | phosphorylation,reduced |
| R9692 | T12067 | T12060 | arg1Of | phosphorylation,TNF-induced |
| R9693 | T12067 | T12065 | arg1Of | phosphorylation,basal |
| R9694 | T12067 | T12066 | arg1Of | phosphorylation,RPS3 |
| R9695 | T12070 | T12069 | arg1Of | 20,roughly |
| R9696 | T12071 | T12068 | arg2Of | %,to |
| R9697 | T12071 | T12070 | arg1Of | %,20 |
| R9698 | T12071 | T12072 | arg1Of | %,of |
| R9699 | T12074 | T12072 | arg2Of | control,of |
| R9700 | T12074 | T12073 | arg1Of | control,vehicle |
| R9701 | T12074 | T12075 | arg1Of | control,( |
| R9702 | T12077 | T12075 | arg2Of | 6c,( |
| R9703 | T12077 | T12076 | arg1Of | 6c,Fig. |
| R9704 | T12078 | T12075 | arg3Of | ),( |
| R9705 | T12080 | T12079 | arg1Of | NleH1,Expressing |
| R9706 | T12080 | T12081 | arg1Of | NleH1,does |
| R9707 | T12080 | T12083 | arg1Of | NleH1,interfere |
| R9708 | T12083 | T12081 | arg2Of | interfere,does |
| R9709 | T12083 | T12082 | arg1Of | interfere,not |
| R9710 | T12083 | T12084 | arg1Of | interfere,with |
| R9711 | T12083 | T12092 | arg1Of | interfere,"," |
| R9712 | T12083 | T12093 | arg1Of | interfere,consistent |
| R9713 | T12088 | T12086 | arg1Of | activation,TNF-induced |
| R9714 | T12088 | T12087 | arg1Of | activation,IKK |
| R9715 | T12088 | T12089 | arg1Of | activation,or |
| R9716 | T12089 | T12084 | arg2Of | or,with |
| R9717 | T12089 | T12085 | arg1Of | or,either |
| R9718 | T12091 | T12089 | arg2Of | degradation,or |
| R9719 | T12091 | T12090 | arg1Of | degradation,IκBα |
| R9720 | T12093 | T12094 | arg1Of | consistent,with |
| R9721 | T12096 | T12094 | arg2Of | lack,with |
| R9722 | T12096 | T12095 | arg1Of | lack,the |
| R9723 | T12096 | T12097 | arg1Of | lack,of |
| R9724 | T12096 | T12100 | arg1Of | lack,on |
| R9725 | T12099 | T12097 | arg2Of | impact,of |
| R9726 | T12099 | T12098 | arg1Of | impact,NleH1 |
| R9727 | T12103 | T12100 | arg2Of | translocation9,on |
| R9728 | T12103 | T12101 | arg1Of | translocation9,p65 |
| R9729 | T12103 | T12102 | arg1Of | translocation9,nuclear |
| R9730 | T12103 | T12104 | arg1Of | translocation9,( |
| R9731 | T12106 | T12104 | arg2Of | 6c,( |
| R9732 | T12106 | T12105 | arg1Of | 6c,Fig. |
| R9733 | T12107 | T12104 | arg3Of | ),( |
| R9734 | T12109 | T12108 | arg1Of | determine,To |
| R9735 | T12111 | T12112 | arg1Of | NleH1,inhibits |
| R9736 | T12112 | T12109 | arg2Of | inhibits,determine |
| R9737 | T12112 | T12110 | arg1Of | inhibits,if |
| R9738 | T12114 | T12112 | arg2Of | phosphorylation,inhibits |
| R9739 | T12114 | T12113 | arg1Of | phosphorylation,RPS3 |
| R9740 | T12116 | T12109 | arg1Of | we,determine |
| R9741 | T12116 | T12117 | arg1Of | we,infected |
| R9742 | T12117 | T12108 | modOf | infected,To |
| R9743 | T12117 | T12115 | arg1Of | infected,"," |
| R9744 | T12117 | T12120 | arg1Of | infected,with |
| R9745 | T12117 | T12136 | arg1Of | infected,with |
| R9746 | T12119 | T12117 | arg2Of | cells,infected |
| R9747 | T12119 | T12118 | arg1Of | cells,HeLa |
| R9748 | T12120 | T12135 | arg1Of | with,or |
| R9749 | T12123 | T12121 | arg1Of | O157,E. |
| R9750 | T12123 | T12122 | arg1Of | O157,coli |
| R9751 | T12123 | T12124 | arg1Of | O157,: |
| R9752 | T12124 | T12120 | arg2Of | :,with |
| R9753 | T12126 | T12124 | arg2Of | strains,: |
| R9754 | T12126 | T12125 | arg1Of | strains,H7 |
| R9755 | T12126 | T12127 | arg1Of | strains,possessing |
| R9756 | T12126 | T12129 | arg1Of | strains,lacking |
| R9757 | T12127 | T12128 | arg1Of | possessing,or |
| R9758 | T12129 | T12128 | arg2Of | lacking,or |
| R9759 | T12131 | T12127 | arg2Of | nleH1,possessing |
| R9760 | T12131 | T12129 | arg2Of | nleH1,lacking |
| R9761 | T12131 | T12130 | arg1Of | nleH1,either |
| R9762 | T12131 | T12132 | arg1Of | nleH1,( |
| R9763 | T12133 | T12132 | arg2Of | ΔnleH1,( |
| R9764 | T12134 | T12132 | arg3Of | ),( |
| R9765 | T12136 | T12135 | arg2Of | with,or |
| R9766 | T12138 | T12136 | arg2Of | strain,with |
| R9767 | T12138 | T12137 | arg1Of | strain,a |
| R9768 | T12138 | T12139 | arg1Of | strain,lacking |
| R9769 | T12142 | T12139 | arg2Of | T3SS,lacking |
| R9770 | T12142 | T12140 | arg1Of | T3SS,a |
| R9771 | T12142 | T12141 | arg1Of | T3SS,functional |
| R9772 | T12142 | T12143 | arg1Of | T3SS,unable |
| R9773 | T12145 | T12143 | arg2Of | inject,unable |
| R9774 | T12145 | T12144 | arg1Of | inject,to |
| R9775 | T12146 | T12145 | arg2Of | NleH1,inject |
| R9776 | T12146 | T12147 | arg1Of | NleH1,into |
| R9777 | T12149 | T12147 | arg2Of | cells,into |
| R9778 | T12149 | T12148 | arg1Of | cells,mammalian |
| R9779 | T12149 | T12150 | arg1Of | cells,( |
| R9780 | T12151 | T12150 | arg2Of | ΔescN,( |
| R9781 | T12152 | T12150 | arg3Of | ),( |
| R9782 | T12155 | T12153 | arg2Of | cells,In |
| R9783 | T12155 | T12154 | arg1Of | cells,uninfected |
| R9784 | T12157 | T12158 | arg1Of | TNF-treatment,stimulated |
| R9785 | T12157 | T12167 | arg1Of | TNF-treatment,peaking |
| R9786 | T12158 | T12153 | arg1Of | stimulated,In |
| R9787 | T12158 | T12156 | arg1Of | stimulated,"," |
| R9788 | T12158 | T12166 | arg1Of | stimulated,"," |
| R9789 | T12158 | T12167 | modOf | stimulated,peaking |
| R9790 | T12161 | T12158 | arg2Of | increase,stimulated |
| R9791 | T12161 | T12159 | arg1Of | increase,a |
| R9792 | T12161 | T12160 | arg1Of | increase,∼7-fold |
| R9793 | T12161 | T12162 | arg1Of | increase,in |
| R9794 | T12165 | T12162 | arg2Of | phosphorylation,in |
| R9795 | T12165 | T12163 | arg1Of | phosphorylation,RPS3 |
| R9796 | T12165 | T12164 | arg1Of | phosphorylation,S209 |
| R9797 | T12167 | T12168 | arg1Of | peaking,at |
| R9798 | T12167 | T12171 | arg1Of | peaking,( |
| R9799 | T12170 | T12168 | arg2Of | minutes,at |
| R9800 | T12170 | T12169 | arg1Of | minutes,30 |
| R9801 | T12172 | T12171 | arg2Of | Fig.,( |
| R9802 | T12172 | T12173 | arg1Of | Fig.,6d |
| R9803 | T12174 | T12171 | arg3Of | ),( |
| R9804 | T12176 | T12175 | arg2Of | contrast,By |
| R9805 | T12180 | T12178 | arg1Of | phosphorylation,RPS3 |
| R9806 | T12180 | T12179 | arg1Of | phosphorylation,S209 |
| R9807 | T12180 | T12181 | arg1Of | phosphorylation,was |
| R9808 | T12180 | T12183 | arg1Of | phosphorylation,impaired |
| R9809 | T12181 | T12175 | arg1Of | was,By |
| R9810 | T12181 | T12177 | arg1Of | was,"," |
| R9811 | T12181 | T12184 | arg1Of | was,in |
| R9812 | T12181 | T12194 | arg1Of | was,( |
| R9813 | T12183 | T12181 | arg2Of | impaired,was |
| R9814 | T12183 | T12182 | arg1Of | impaired,substantially |
| R9815 | T12185 | T12184 | arg2Of | cells,in |
| R9816 | T12185 | T12186 | arg2Of | cells,infected |
| R9817 | T12185 | T12192 | arg1Of | cells,: |
| R9818 | T12186 | T12187 | arg1Of | infected,with |
| R9819 | T12191 | T12187 | arg2Of | O157,with |
| R9820 | T12191 | T12188 | arg1Of | O157,wild-type |
| R9821 | T12191 | T12189 | arg1Of | O157,E. |
| R9822 | T12191 | T12190 | arg1Of | O157,coli |
| R9823 | T12193 | T12192 | arg2Of | H7,: |
| R9824 | T12195 | T12194 | arg2Of | Fig.,( |
| R9825 | T12195 | T12196 | arg1Of | Fig.,6d |
| R9826 | T12197 | T12194 | arg3Of | ),( |
| R9827 | T12203 | T12200 | arg1Of | phosphorylation,TNF-induced |
| R9828 | T12203 | T12201 | arg1Of | phosphorylation,RPS3 |
| R9829 | T12203 | T12202 | arg1Of | phosphorylation,S209 |
| R9830 | T12203 | T12204 | arg1Of | phosphorylation,was |
| R9831 | T12203 | T12205 | arg1Of | phosphorylation,unimpaired |
| R9832 | T12204 | T12198 | arg1Of | was,However |
| R9833 | T12204 | T12199 | arg1Of | was,"," |
| R9834 | T12204 | T12206 | arg1Of | was,in |
| R9835 | T12205 | T12204 | arg2Of | unimpaired,was |
| R9836 | T12207 | T12206 | arg2Of | cells,in |
| R9837 | T12207 | T12208 | arg2Of | cells,infected |
| R9838 | T12208 | T12209 | arg1Of | infected,with |
| R9839 | T12208 | T12214 | arg1Of | infected,( |
| R9840 | T12211 | T12212 | arg1Of | ΔnleH1,or |
| R9841 | T12212 | T12209 | arg2Of | or,with |
| R9842 | T12212 | T12210 | arg1Of | or,either |
| R9843 | T12213 | T12212 | arg2Of | ΔescN,or |
| R9844 | T12215 | T12214 | arg2Of | Fig.,( |
| R9845 | T12215 | T12216 | arg1Of | Fig.,6d |
| R9846 | T12217 | T12214 | arg3Of | ),( |
| R9847 | T12218 | T12219 | arg1Of | We,showed |
| R9848 | T12219 | T12220 | arg1Of | showed,previously |
| R9849 | T12222 | T12224 | arg1Of | wild-type,but |
| R9850 | T12224 | T12223 | arg1Of | but,"," |
| R9851 | T12224 | T12225 | arg1Of | but,not |
| R9852 | T12224 | T12227 | arg1Of | but,or |
| R9853 | T12226 | T12224 | arg2Of | ΔnleH1,but |
| R9854 | T12227 | T12232 | arg1Of | or,: |
| R9855 | T12231 | T12227 | arg2Of | O157,or |
| R9856 | T12231 | T12228 | arg1Of | O157,ΔescN |
| R9857 | T12231 | T12229 | arg1Of | O157,E. |
| R9858 | T12231 | T12230 | arg1Of | O157,coli |
| R9859 | T12232 | T12235 | arg1Of | :,attenuated |
| R9860 | T12233 | T12232 | arg2Of | H7,: |
| R9861 | T12235 | T12219 | arg2Of | attenuated,showed |
| R9862 | T12235 | T12221 | arg1Of | attenuated,that |
| R9863 | T12235 | T12234 | arg1Of | attenuated,significantly |
| R9864 | T12239 | T12235 | arg2Of | translocation9,attenuated |
| R9865 | T12239 | T12236 | arg1Of | translocation9,TNF-induced |
| R9866 | T12239 | T12237 | arg1Of | translocation9,RPS3 |
| R9867 | T12239 | T12238 | arg1Of | translocation9,nuclear |
| R9868 | T12241 | T12240 | arg1Of | parallel,The |
| R9869 | T12241 | T12242 | arg1Of | parallel,between |
| R9870 | T12241 | T12249 | arg1Of | parallel,during |
| R9871 | T12241 | T12253 | arg1Of | parallel,provides |
| R9872 | T12244 | T12243 | arg1Of | phosphorylation,RPS3 |
| R9873 | T12244 | T12245 | arg1Of | phosphorylation,and |
| R9874 | T12245 | T12242 | arg2Of | and,between |
| R9875 | T12248 | T12245 | arg2Of | translocation,and |
| R9876 | T12248 | T12246 | arg1Of | translocation,its |
| R9877 | T12248 | T12247 | arg1Of | translocation,nuclear |
| R9878 | T12252 | T12249 | arg2Of | infection,during |
| R9879 | T12252 | T12250 | arg1Of | infection,E. |
| R9880 | T12252 | T12251 | arg1Of | infection,coli |
| R9881 | T12254 | T12253 | arg2Of | evidence,provides |
| R9882 | T12254 | T12255 | arg1Of | evidence,in |
| R9883 | T12257 | T12255 | arg2Of | context,in |
| R9884 | T12257 | T12256 | arg1Of | context,the |
| R9885 | T12257 | T12258 | arg1Of | context,of |
| R9886 | T12262 | T12258 | arg2Of | process,of |
| R9887 | T12262 | T12259 | arg1Of | process,an |
| R9888 | T12262 | T12260 | arg1Of | process,NF-κB-dependent |
| R9889 | T12262 | T12261 | arg1Of | process,disease |
| R9890 | T12266 | T12263 | arg1Of | phosphorylation,that |
| R9891 | T12266 | T12264 | arg1Of | phosphorylation,RPS3 |
| R9892 | T12266 | T12265 | arg1Of | phosphorylation,S209 |
| R9893 | T12266 | T12267 | arg1Of | phosphorylation,is |
| R9894 | T12266 | T12268 | arg1Of | phosphorylation,important |
| R9895 | T12267 | T12253 | arg3Of | is,provides |
| R9896 | T12268 | T12267 | arg2Of | important,is |
| R9897 | T12268 | T12269 | arg1Of | important,for |
| R9898 | T12271 | T12269 | arg2Of | translocation,for |
| R9899 | T12271 | T12270 | arg1Of | translocation,nuclear |
| R9900 | T12273 | T12272 | arg1Of | discovery,Our |
| R9901 | T12273 | T12280 | arg1Of | discovery,suggested |
| R9902 | T12275 | T12276 | arg1Of | NleH1,inhibits |
| R9903 | T12276 | T12273 | arg2Of | inhibits,discovery |
| R9904 | T12276 | T12274 | arg1Of | inhibits,that |
| R9905 | T12279 | T12276 | arg2Of | phosphorylation,inhibits |
| R9906 | T12279 | T12277 | arg1Of | phosphorylation,RPS3 |
| R9907 | T12279 | T12278 | arg1Of | phosphorylation,S209 |
| R9908 | T12282 | T12283 | arg1Of | it,should |
| R9909 | T12282 | T12285 | arg1Of | it,blocks |
| R9910 | T12285 | T12280 | arg2Of | blocks,suggested |
| R9911 | T12285 | T12281 | arg1Of | blocks,that |
| R9912 | T12285 | T12283 | arg2Of | blocks,should |
| R9913 | T12285 | T12284 | arg1Of | blocks,also |
| R9914 | T12290 | T12285 | arg2Of | transcription,blocks |
| R9915 | T12290 | T12286 | arg1Of | transcription,RPS3-dependent |
| R9916 | T12290 | T12287 | arg1Of | transcription,NF-κB |
| R9917 | T12290 | T12288 | arg1Of | transcription,target |
| R9918 | T12290 | T12289 | arg1Of | transcription,gene |
| R9919 | T12290 | T12291 | arg1Of | transcription,( |
| R9920 | T12293 | T12294 | arg1Of | IL8,"," |
| R9921 | T12294 | T12297 | arg1Of | ",",and |
| R9922 | T12295 | T12294 | arg2Of | NFKBIA,"," |
| R9923 | T12297 | T12291 | arg2Of | and,( |
| R9924 | T12297 | T12292 | arg1Of | and,e.g. |
| R9925 | T12297 | T12296 | arg1Of | and,"," |
| R9926 | T12298 | T12297 | arg2Of | TNFAIP3,and |
| R9927 | T12299 | T12291 | arg3Of | ),( |
| R9928 | T12303 | T12302 | arg1Of | genes,these |
| R9929 | T12303 | T12304 | arg1Of | genes,were |
| R9930 | T12303 | T12307 | arg2Of | genes,upregulated |
| R9931 | T12303 | T12321 | arg2Of | genes,induced |
| R9932 | T12306 | T12305 | arg1Of | modestly,only |
| R9933 | T12307 | T12308 | arg1Of | upregulated,in |
| R9934 | T12307 | T12316 | arg1Of | upregulated,: |
| R9935 | T12307 | T12319 | arg1Of | upregulated,but |
| R9936 | T12309 | T12308 | arg2Of | cells,in |
| R9937 | T12309 | T12310 | arg2Of | cells,infected |
| R9938 | T12310 | T12311 | arg1Of | infected,with |
| R9939 | T12315 | T12311 | arg2Of | O157,with |
| R9940 | T12315 | T12312 | arg1Of | O157,wild-type |
| R9941 | T12315 | T12313 | arg1Of | O157,E. |
| R9942 | T12315 | T12314 | arg1Of | O157,coli |
| R9943 | T12317 | T12307 | arg3Of | H7,upregulated |
| R9944 | T12319 | T12300 | arg1Of | but,Indeed |
| R9945 | T12319 | T12301 | arg1Of | but,"," |
| R9946 | T12319 | T12304 | arg2Of | but,were |
| R9947 | T12319 | T12306 | arg1Of | but,modestly |
| R9948 | T12319 | T12318 | arg1Of | but,"," |
| R9949 | T12321 | T12319 | arg2Of | induced,but |
| R9950 | T12321 | T12320 | arg1Of | induced,significantly |
| R9951 | T12321 | T12322 | arg1Of | induced,in |
| R9952 | T12323 | T12322 | arg2Of | cells,in |
| R9953 | T12323 | T12324 | arg2Of | cells,infected |
| R9954 | T12324 | T12325 | arg1Of | infected,with |
| R9955 | T12327 | T12328 | arg1Of | ΔnleH1,or |
| R9956 | T12329 | T12328 | arg2Of | ΔescN,or |
| R9957 | T12330 | T12325 | arg2Of | strains,with |
| R9958 | T12330 | T12326 | arg1Of | strains,either |
| R9959 | T12330 | T12327 | arg1Of | strains,ΔnleH1 |
| R9960 | T12330 | T12329 | arg1Of | strains,ΔescN |
| R9961 | T12330 | T12331 | arg1Of | strains,( |
| R9962 | T12333 | T12331 | arg2Of | 6e,( |
| R9963 | T12333 | T12332 | arg1Of | 6e,Fig. |
| R9964 | T12334 | T12331 | arg3Of | ),( |
| R9965 | T12336 | T12335 | arg2Of | contrast,In |
| R9966 | T12338 | T12340 | arg1Of | deleting,had |
| R9967 | T12339 | T12338 | arg2Of | nleH1,deleting |
| R9968 | T12340 | T12335 | arg1Of | had,In |
| R9969 | T12340 | T12337 | arg1Of | had,"," |
| R9970 | T12340 | T12343 | arg1Of | had,on |
| R9971 | T12342 | T12340 | arg2Of | impact,had |
| R9972 | T12342 | T12341 | arg1Of | impact,no |
| R9973 | T12345 | T12343 | arg2Of | expression,on |
| R9974 | T12345 | T12344 | arg1Of | expression,the |
| R9975 | T12345 | T12346 | arg1Of | expression,of |
| R9976 | T12348 | T12346 | arg2Of | genes,of |
| R9977 | T12348 | T12347 | arg1Of | genes,RPS3-independent |
| R9978 | T12348 | T12349 | arg1Of | genes,"," |
| R9979 | T12348 | T12350 | arg1Of | genes,including |
| R9980 | T12351 | T12352 | arg1Of | CD25,and |
| R9981 | T12352 | T12350 | arg2Of | and,including |
| R9982 | T12352 | T12354 | arg1Of | and,( |
| R9983 | T12353 | T12352 | arg2Of | TNFSF13B,and |
| R9984 | T12356 | T12354 | arg2Of | Fig.,( |
| R9985 | T12356 | T12355 | arg1Of | Fig.,Supplementary |
| R9986 | T12356 | T12357 | arg1Of | Fig.,12 |
| R9987 | T12358 | T12354 | arg3Of | ),( |
| R9988 | T12361 | T12360 | arg1Of | results,these |
| R9989 | T12361 | T12362 | arg1Of | results,demonstrate |
| R9990 | T12362 | T12359 | arg1Of | demonstrate,Together |
| R9991 | T12364 | T12366 | arg1Of | NleH1,inhibits |
| R9992 | T12366 | T12362 | arg2Of | inhibits,demonstrate |
| R9993 | T12366 | T12363 | arg1Of | inhibits,that |
| R9994 | T12366 | T12365 | arg1Of | inhibits,specifically |
| R9995 | T12366 | T12371 | arg1Of | inhibits,by |
| R9996 | T12370 | T12366 | arg2Of | response,inhibits |
| R9997 | T12370 | T12367 | arg1Of | response,the |
| R9998 | T12370 | T12368 | arg1Of | response,protective |
| R9999 | T12370 | T12369 | arg1Of | response,immune |
| R10000 | T12373 | T12372 | arg1Of | blocking,directly |
| R10001 | T12373 | T12377 | arg1Of | blocking,and |
| R10002 | T12376 | T12373 | arg2Of | phosphorylation,blocking |
| R10003 | T12376 | T12374 | arg1Of | phosphorylation,RPS3 |
| R10004 | T12376 | T12375 | arg1Of | phosphorylation,S209 |
| R10005 | T12377 | T12371 | arg2Of | and,by |
| R10006 | T12379 | T12377 | arg2Of | impairing,and |
| R10007 | T12379 | T12378 | arg1Of | impairing,thereby |
| R10008 | T12384 | T12379 | arg2Of | genes,impairing |
| R10009 | T12384 | T12380 | arg1Of | genes,critical |
| R10010 | T12384 | T12381 | arg1Of | genes,RPS3-dependent |
| R10011 | T12384 | T12382 | arg1Of | genes,NF-κB |
| R10012 | T12384 | T12383 | arg1Of | genes,target |
| R11032 | T13762 | T13763 | arg1Of | NleH1,inhibits |
| R11033 | T13763 | T13768 | arg1Of | inhibits,vivo |
| R11034 | T13766 | T13763 | arg2Of | phosphorylation,inhibits |
| R11035 | T13766 | T13764 | arg1Of | phosphorylation,RPS3 |
| R11036 | T13766 | T13765 | arg1Of | phosphorylation,S209 |
| R11037 | T13768 | T13767 | arg1Of | vivo,in |
| R11038 | T13769 | T13771 | arg1Of | We,utilized |
| R11039 | T13769 | T13778 | arg1Of | We,determine |
| R11040 | T13771 | T13770 | arg1Of | utilized,previously |
| R11041 | T13771 | T13777 | modOf | utilized,to |
| R11042 | T13776 | T13771 | arg2Of | model,utilized |
| R11043 | T13776 | T13772 | arg1Of | model,a |
| R11044 | T13776 | T13773 | arg1Of | model,gnotobiotic |
| R11045 | T13776 | T13774 | arg1Of | model,piglet |
| R11046 | T13776 | T13775 | arg1Of | model,infection |
| R11047 | T13778 | T13777 | arg1Of | determine,to |
| R11048 | T13780 | T13781 | arg2Of | piglets,infected |
| R11049 | T13780 | T13785 | arg1Of | piglets,died |
| R11050 | T13781 | T13782 | arg1Of | infected,with |
| R11051 | T13784 | T13782 | arg2Of | mutant,with |
| R11052 | T13784 | T13783 | arg1Of | mutant,ΔnleH1 |
| R11053 | T13785 | T13778 | arg2Of | died,determine |
| R11054 | T13785 | T13779 | arg1Of | died,that |
| R11055 | T13785 | T13787 | arg1Of | died,rapidly |
| R11056 | T13785 | T13796 | arg1Of | died,: |
| R11057 | T13787 | T13786 | arg1Of | rapidly,more |
| R11058 | T13787 | T13788 | arg1Of | rapidly,than |
| R11059 | T13789 | T13788 | arg2Of | those,than |
| R11060 | T13789 | T13790 | arg2Of | those,infected |
| R11061 | T13790 | T13791 | arg1Of | infected,with |
| R11062 | T13795 | T13791 | arg2Of | O157,with |
| R11063 | T13795 | T13792 | arg1Of | O157,wild-type |
| R11064 | T13795 | T13793 | arg1Of | O157,E. |
| R11065 | T13795 | T13794 | arg1Of | O157,coli |
| R11066 | T13797 | T13785 | arg2Of | H7,died |
| R11067 | T13798 | T13799 | arg2Of | Piglets,infected |
| R11068 | T13798 | T13802 | arg1Of | Piglets,displayed |
| R11069 | T13799 | T13800 | arg1Of | infected,with |
| R11070 | T13801 | T13800 | arg2Of | ΔnleH1,with |
| R11071 | T13804 | T13802 | arg2Of | disease,displayed |
| R11072 | T13804 | T13803 | arg1Of | disease,clinical |
| R11073 | T13804 | T13805 | arg1Of | disease,consistent |
| R11074 | T13805 | T13806 | arg1Of | consistent,with |
| R11075 | T13805 | T13813 | arg1Of | consistent,with |
| R11076 | T13806 | T13812 | arg1Of | with,but |
| R11077 | T13810 | T13806 | arg2Of | response,with |
| R11078 | T13810 | T13807 | arg1Of | response,a |
| R11079 | T13810 | T13808 | arg1Of | response,robust |
| R11080 | T13810 | T13809 | arg1Of | response,inflammatory |
| R11081 | T13812 | T13811 | arg1Of | but,"," |
| R11082 | T13813 | T13812 | arg2Of | with,but |
| R11083 | T13816 | T13814 | arg2Of | colonization,reduced |
| R11084 | T13816 | T13815 | arg1Of | colonization,bacterial |
| R11085 | T13816 | T13817 | arg1Of | colonization,and |
| R11086 | T13817 | T13813 | arg2Of | and,with |
| R11087 | T13819 | T13817 | arg2Of | diarrhea9,and |
| R11088 | T13819 | T13818 | arg1Of | diarrhea9,little |
| R11089 | T13822 | T13820 | arg2Of | paradoxical,While |
| R11090 | T13822 | T13821 | arg1Of | paradoxical,seemingly |
| R11091 | T13822 | T13823 | arg1Of | paradoxical,"," |
| R11092 | T13822 | T13824 | arg1Of | paradoxical,based |
| R11093 | T13825 | T13824 | arg2Of | on,based |
| R11094 | T13829 | T13825 | arg2Of | data,on |
| R11095 | T13829 | T13826 | arg1Of | data,our |
| R11096 | T13829 | T13827 | arg1Of | data,cell |
| R11097 | T13829 | T13828 | arg1Of | data,culture |
| R11098 | T13829 | T13830 | arg1Of | data,( |
| R11099 | T13832 | T13830 | arg2Of | 6d,( |
| R11100 | T13832 | T13831 | arg1Of | 6d,Fig. |
| R11101 | T13833 | T13830 | arg3Of | ),( |
| R11102 | T13835 | T13836 | arg1Of | we,hypothesized |
| R11103 | T13836 | T13820 | arg1Of | hypothesized,While |
| R11104 | T13836 | T13834 | arg1Of | hypothesized,"," |
| R11105 | T13838 | T13839 | arg1Of | NleH1,blocked |
| R11106 | T13839 | T13836 | arg2Of | blocked,hypothesized |
| R11107 | T13839 | T13837 | arg1Of | blocked,that |
| R11108 | T13839 | T13844 | arg1Of | blocked,vivo |
| R11109 | T13839 | T13845 | arg1Of | blocked,"," |
| R11110 | T13839 | T13847 | modOf | blocked,preventing |
| R11111 | T13842 | T13839 | arg2Of | phosphorylation,blocked |
| R11112 | T13842 | T13840 | arg1Of | phosphorylation,RPS3 |
| R11113 | T13842 | T13841 | arg1Of | phosphorylation,S209 |
| R11114 | T13844 | T13843 | arg1Of | vivo,in |
| R11115 | T13847 | T13846 | arg1Of | preventing,thereby |
| R11116 | T13850 | T13847 | arg2Of | translocation,preventing |
| R11117 | T13850 | T13848 | arg1Of | translocation,RPS3 |
| R11118 | T13850 | T13849 | arg1Of | translocation,nuclear |
| R11119 | T13850 | T13851 | arg1Of | translocation,in |
| R11120 | T13853 | T13851 | arg2Of | piglets,in |
| R11121 | T13853 | T13852 | arg1Of | piglets,infected |
| R11122 | T13854 | T13855 | arg1Of | We,isolated |
| R11123 | T13854 | T13862 | arg1Of | We,subjected |
| R11124 | T13854 | T13866 | arg1Of | We,using |
| R11125 | T13855 | T13858 | arg1Of | isolated,at |
| R11126 | T13855 | T13861 | arg1Of | isolated,and |
| R11127 | T13857 | T13855 | arg2Of | colons,isolated |
| R11128 | T13857 | T13856 | arg1Of | colons,piglet |
| R11129 | T13859 | T13858 | arg2Of | necropsy,at |
| R11130 | T13861 | T13860 | arg1Of | and,"," |
| R11131 | T13862 | T13861 | arg2Of | subjected,and |
| R11132 | T13862 | T13864 | arg1Of | subjected,to |
| R11133 | T13862 | T13866 | modOf | subjected,using |
| R11134 | T13863 | T13862 | arg2Of | them,subjected |
| R11135 | T13865 | T13864 | arg2Of | immunohistochemistry,to |
| R11136 | T13869 | T13866 | arg2Of | antibody,using |
| R11137 | T13869 | T13867 | arg1Of | antibody,our |
| R11138 | T13869 | T13868 | arg1Of | antibody,phospho-RPS3 |
| R11139 | T13870 | T13871 | arg1Of | Consistent,with |
| R11140 | T13873 | T13872 | arg1Of | vitro,in |
| R11141 | T13874 | T13871 | arg2Of | data,with |
| R11142 | T13874 | T13873 | arg1Of | data,vitro |
| R11143 | T13876 | T13870 | arg1Of | piglets,Consistent |
| R11144 | T13876 | T13877 | arg2Of | piglets,infected |
| R11145 | T13876 | T13885 | arg1Of | piglets,exhibited |
| R11146 | T13877 | T13878 | arg1Of | infected,with |
| R11147 | T13882 | T13879 | arg1Of | O157,wild-type |
| R11148 | T13882 | T13880 | arg1Of | O157,E. |
| R11149 | T13882 | T13881 | arg1Of | O157,coli |
| R11150 | T13882 | T13883 | arg1Of | O157,: |
| R11151 | T13883 | T13878 | arg2Of | :,with |
| R11152 | T13884 | T13883 | arg2Of | H7,: |
| R11153 | T13885 | T13870 | modOf | exhibited,Consistent |
| R11154 | T13885 | T13875 | arg1Of | exhibited,"," |
| R11155 | T13885 | T13892 | arg1Of | exhibited,"," |
| R11156 | T13885 | T13893 | arg1Of | exhibited,whereas |
| R11157 | T13886 | T13887 | arg1Of | diffuse,and |
| R11158 | T13888 | T13887 | arg2Of | low,and |
| R11159 | T13891 | T13885 | arg2Of | staining,exhibited |
| R11160 | T13891 | T13886 | arg1Of | staining,diffuse |
| R11161 | T13891 | T13888 | arg1Of | staining,low |
| R11162 | T13891 | T13889 | arg1Of | staining,intensity |
| R11163 | T13891 | T13890 | arg1Of | staining,phospho-RPS3 |
| R11164 | T13895 | T13894 | arg2Of | piglets,in |
| R11165 | T13895 | T13896 | arg2Of | piglets,infected |
| R11166 | T13896 | T13897 | arg1Of | infected,with |
| R11167 | T13899 | T13897 | arg2Of | mutant,with |
| R11168 | T13899 | T13898 | arg1Of | mutant,ΔnleH1 |
| R11169 | T13902 | T13901 | arg1Of | expression,phospho-RPS3 |
| R11170 | T13902 | T13903 | arg1Of | expression,was |
| R11171 | T13902 | T13904 | arg1Of | expression,florid |
| R11172 | T13902 | T13906 | arg1Of | expression,intense |
| R11173 | T13903 | T13893 | arg2Of | was,whereas |
| R11174 | T13903 | T13894 | arg1Of | was,in |
| R11175 | T13903 | T13900 | arg1Of | was,"," |
| R11176 | T13903 | T13907 | arg1Of | was,( |
| R11177 | T13904 | T13905 | arg1Of | florid,and |
| R11178 | T13905 | T13903 | arg2Of | and,was |
| R11179 | T13906 | T13905 | arg2Of | intense,and |
| R11180 | T13908 | T13907 | arg2Of | Fig.,( |
| R11181 | T13908 | T13909 | arg1Of | Fig.,6f |
| R11182 | T13910 | T13907 | arg3Of | ),( |
| R11183 | T13912 | T13911 | arg1Of | data,These |
| R11184 | T13912 | T13913 | arg1Of | data,demonstrate |
| R11185 | T13915 | T13916 | arg1Of | NleH1,inhibits |
| R11186 | T13916 | T13913 | arg2Of | inhibits,demonstrate |
| R11187 | T13916 | T13914 | arg1Of | inhibits,that |
| R11188 | T13916 | T13922 | arg1Of | inhibits,vitro |
| R11189 | T13916 | T13925 | arg1Of | inhibits,vivo |
| R11190 | T13916 | T13926 | arg1Of | inhibits,"," |
| R11191 | T13916 | T13927 | arg1Of | inhibits,which |
| R11192 | T13916 | T13928 | arg1Of | inhibits,might |
| R11193 | T13916 | T13929 | arg1Of | inhibits,benefit |
| R11194 | T13919 | T13916 | arg2Of | phosphorylation,inhibits |
| R11195 | T13919 | T13917 | arg1Of | phosphorylation,RPS3 |
| R11196 | T13919 | T13918 | arg1Of | phosphorylation,S209 |
| R11197 | T13922 | T13921 | arg1Of | vitro,in |
| R11198 | T13922 | T13923 | arg1Of | vitro,and |
| R11199 | T13923 | T13920 | arg1Of | and,both |
| R11200 | T13925 | T13923 | arg2Of | vivo,and |
| R11201 | T13925 | T13924 | arg1Of | vivo,in |
| R11202 | T13929 | T13928 | arg2Of | benefit,might |
| R11203 | T13931 | T13929 | arg2Of | bacterium,benefit |
| R11204 | T13931 | T13930 | arg1Of | bacterium,the |
| R11205 | T13931 | T13932 | arg1Of | bacterium,in |
| R11206 | T13933 | T13934 | arg1Of | colonization,and |
| R11207 | T13934 | T13932 | arg2Of | and,in |
| R11208 | T13935 | T13934 | arg2Of | transmission,and |
| R11926 | T14935 | T14934 | arg1Of | steers,NleH1 |
| R11927 | T14935 | T14937 | arg1Of | steers,IKKβ |
| R11928 | T14937 | T14936 | arg1Of | IKKβ,the |
| R11929 | T14939 | T14935 | arg1Of | specificities,steers |
| R11930 | T14939 | T14938 | arg1Of | specificities,substrate |
| R11931 | T14940 | T14941 | arg1Of | NleH1,is |
| R11932 | T14945 | T14941 | arg2Of | kinase,is |
| R11933 | T14945 | T14942 | arg1Of | kinase,an |
| R11934 | T14945 | T14943 | arg2Of | kinase,autophosphorylated |
| R11935 | T14945 | T14944 | arg1Of | kinase,serine-threonine |
| R11936 | T14945 | T14946 | arg1Of | kinase,"," |
| R11937 | T14945 | T14947 | arg1Of | kinase,which |
| R11938 | T14945 | T14948 | arg1Of | kinase,depends |
| R11939 | T14948 | T14949 | arg1Of | depends,on |
| R11940 | T14951 | T14949 | arg2Of | lysine,on |
| R11941 | T14951 | T14950 | arg1Of | lysine,the |
| R11942 | T14951 | T14952 | arg1Of | lysine,159 |
| R11943 | T14951 | T14953 | arg1Of | lysine,( |
| R11944 | T14951 | T14956 | arg1Of | lysine,9 |
| R11945 | T14954 | T14953 | arg2Of | K159,( |
| R11946 | T14955 | T14953 | arg3Of | ),( |
| R11947 | T14958 | T14957 | arg1Of | explore,To |
| R11948 | T14960 | T14958 | arg2Of | mechanism,explore |
| R11949 | T14960 | T14959 | arg1Of | mechanism,the |
| R11950 | T14960 | T14961 | arg2Of | mechanism,by |
| R11951 | T14960 | T14962 | arg1Of | mechanism,which |
| R11952 | T14963 | T14964 | arg1Of | NleH1,inhibits |
| R11953 | T14964 | T14961 | arg1Of | inhibits,by |
| R11954 | T14967 | T14964 | arg2Of | phosphorylation,inhibits |
| R11955 | T14967 | T14965 | arg1Of | phosphorylation,RPS3 |
| R11956 | T14967 | T14966 | arg1Of | phosphorylation,S209 |
| R11957 | T14969 | T14958 | arg1Of | we,explore |
| R11958 | T14969 | T14971 | arg1Of | we,performed |
| R11959 | T14971 | T14957 | modOf | performed,To |
| R11960 | T14971 | T14968 | arg1Of | performed,"," |
| R11961 | T14971 | T14970 | arg1Of | performed,first |
| R11962 | T14971 | T14990 | arg1Of | performed,"," |
| R11963 | T14971 | T14991 | modOf | performed,confirming |
| R11964 | T14974 | T14973 | arg1Of | vitro,in |
| R11965 | T14976 | T14971 | arg2Of | assay,performed |
| R11966 | T14976 | T14972 | arg1Of | assay,an |
| R11967 | T14976 | T14974 | arg1Of | assay,vitro |
| R11968 | T14976 | T14975 | arg1Of | assay,kinase |
| R11969 | T14976 | T14977 | arg1Of | assay,with |
| R11970 | T14981 | T14978 | arg2Of | protein,purified |
| R11971 | T14981 | T14979 | arg1Of | protein,wild-type |
| R11972 | T14981 | T14980 | arg1Of | protein,His-NleH1 |
| R11973 | T14981 | T14982 | arg1Of | protein,and |
| R11974 | T14982 | T14977 | arg2Of | and,with |
| R11975 | T14987 | T14986 | arg2Of | K159A,( |
| R11976 | T14988 | T14986 | arg3Of | ),( |
| R11977 | T14989 | T14982 | arg2Of | protein,and |
| R11978 | T14989 | T14983 | arg1Of | protein,a |
| R11979 | T14989 | T14984 | arg1Of | protein,mutant |
| R11980 | T14989 | T14985 | arg1Of | protein,His-NleH1 |
| R11981 | T14989 | T14986 | arg1Of | protein,( |
| R11982 | T14993 | T14994 | arg1Of | NleH1,is |
| R11983 | T14993 | T14995 | arg2Of | NleH1,autophosphorylated |
| R11984 | T14995 | T14994 | arg2Of | autophosphorylated,is |
| R11985 | T14995 | T14996 | arg1Of | autophosphorylated,and |
| R11986 | T14996 | T14991 | arg2Of | and,confirming |
| R11987 | T14996 | T14992 | arg1Of | and,that |
| R11988 | T14998 | T14997 | arg1Of | K159A,the |
| R11989 | T14998 | T14999 | arg1Of | K159A,is |
| R11990 | T14999 | T14996 | arg2Of | is,and |
| R11991 | T15003 | T14999 | arg2Of | mutant,is |
| R11992 | T15003 | T15000 | arg1Of | mutant,an |
| R11993 | T15003 | T15001 | arg1Of | mutant,NleH1 |
| R11994 | T15003 | T15002 | arg1Of | mutant,kinase-dead |
| R11995 | T15003 | T15004 | arg1Of | mutant,( |
| R11996 | T15006 | T15004 | arg2Of | 7a,( |
| R11997 | T15006 | T15005 | arg1Of | 7a,Fig. |
| R11998 | T15007 | T15004 | arg3Of | ),( |
| R11999 | T15009 | T15008 | arg1Of | examine,To |
| R12000 | T15013 | T15011 | arg1Of | activity,the |
| R12001 | T15013 | T15012 | arg1Of | activity,kinase |
| R12002 | T15013 | T15014 | arg1Of | activity,is |
| R12003 | T15013 | T15015 | arg2Of | activity,required |
| R12004 | T15015 | T15009 | arg2Of | required,examine |
| R12005 | T15015 | T15010 | arg1Of | required,whether |
| R12006 | T15015 | T15014 | arg2Of | required,is |
| R12007 | T15015 | T15016 | arg1Of | required,for |
| R12008 | T15015 | T15018 | modOf | required,to |
| R12009 | T15017 | T15016 | arg2Of | NleH1,for |
| R12010 | T15019 | T15018 | arg1Of | inhibit,to |
| R12011 | T15021 | T15019 | arg2Of | phosphorlyation,inhibit |
| R12012 | T15021 | T15020 | arg1Of | phosphorlyation,IKKβ |
| R12013 | T15021 | T15022 | arg1Of | phosphorlyation,of |
| R12014 | T15021 | T15024 | arg1Of | phosphorlyation,on |
| R12015 | T15023 | T15022 | arg2Of | RPS3,of |
| R12016 | T15025 | T15024 | arg2Of | S209,on |
| R12017 | T15027 | T15029 | arg1Of | we,expressing |
| R12018 | T15029 | T15008 | modOf | expressing,To |
| R12019 | T15029 | T15026 | arg1Of | expressing,"," |
| R12020 | T15029 | T15028 | arg1Of | expressing,ectopically |
| R12021 | T15031 | T15032 | arg1Of | wild-type,or |
| R12022 | T15032 | T15030 | arg1Of | or,either |
| R12023 | T15033 | T15032 | arg2Of | K159A,or |
| R12024 | T15034 | T15029 | arg2Of | NleH1,expressing |
| R12025 | T15034 | T15031 | arg1Of | NleH1,wild-type |
| R12026 | T15034 | T15033 | arg1Of | NleH1,K159A |
| R12027 | T15034 | T15035 | arg1Of | NleH1,in |
| R12028 | T15037 | T15035 | arg2Of | cells,in |
| R12029 | T15037 | T15036 | arg1Of | cells,293T |
| R12030 | T15040 | T15038 | arg1Of | expression,Wild-type |
| R12031 | T15040 | T15039 | arg1Of | expression,NleH1 |
| R12032 | T15040 | T15042 | arg1Of | expression,reduced |
| R12033 | T15042 | T15041 | arg1Of | reduced,significantly |
| R12034 | T15042 | T15047 | arg1Of | reduced,"," |
| R12035 | T15042 | T15048 | arg1Of | reduced,whereas |
| R12036 | T15046 | T15042 | arg2Of | phosphorylation,reduced |
| R12037 | T15046 | T15043 | arg1Of | phosphorylation,TNF-induced |
| R12038 | T15046 | T15044 | arg1Of | phosphorylation,RPS3 |
| R12039 | T15046 | T15045 | arg1Of | phosphorylation,S209 |
| R12040 | T15051 | T15049 | arg1Of | mutant,the |
| R12041 | T15051 | T15050 | arg1Of | mutant,K159A |
| R12042 | T15051 | T15052 | arg1Of | mutant,failed |
| R12043 | T15051 | T15054 | arg1Of | mutant,do |
| R12044 | T15051 | T15055 | arg1Of | mutant,so |
| R12045 | T15052 | T15048 | arg2Of | failed,whereas |
| R12046 | T15052 | T15056 | arg1Of | failed,( |
| R12047 | T15054 | T15052 | arg2Of | do,failed |
| R12048 | T15054 | T15053 | arg1Of | do,to |
| R12049 | T15055 | T15054 | arg2Of | so,do |
| R12050 | T15058 | T15056 | arg2Of | 7b,( |
| R12051 | T15058 | T15057 | arg1Of | 7b,Fig. |
| R12052 | T15059 | T15056 | arg3Of | ),( |
| R12053 | T15063 | T15061 | arg1Of | activity,NleH1 |
| R12054 | T15063 | T15062 | arg1Of | activity,kinase |
| R12055 | T15063 | T15064 | arg1Of | activity,is |
| R12056 | T15063 | T15065 | arg2Of | activity,required |
| R12057 | T15065 | T15060 | arg1Of | required,Thus |
| R12058 | T15065 | T15064 | arg2Of | required,is |
| R12059 | T15065 | T15066 | modOf | required,to |
| R12060 | T15067 | T15066 | arg1Of | protect,to |
| R12061 | T15067 | T15069 | arg1Of | protect,from |
| R12062 | T15068 | T15067 | arg2Of | RPS3,protect |
| R12063 | T15071 | T15069 | arg2Of | phosphorylation,from |
| R12064 | T15071 | T15070 | arg1Of | phosphorylation,IKKβ-mediated |
| R12065 | T15073 | T15072 | arg1Of | rodentium,Citrobacter |
| R12066 | T15073 | T15074 | arg1Of | rodentium,is |
| R12067 | T15074 | T15092 | arg1Of | is,"," |
| R12068 | T15077 | T15074 | arg2Of | pathogen,is |
| R12069 | T15077 | T15075 | arg1Of | pathogen,a |
| R12070 | T15077 | T15076 | arg1Of | pathogen,mouse |
| R12071 | T15077 | T15078 | arg1Of | pathogen,that |
| R12072 | T15077 | T15079 | arg1Of | pathogen,shares |
| R12073 | T15079 | T15086 | arg1Of | shares,"," |
| R12074 | T15079 | T15089 | arg1Of | shares,for |
| R12075 | T15081 | T15079 | arg2Of | strategies,shares |
| R12076 | T15081 | T15080 | arg1Of | strategies,pathogenic |
| R12077 | T15081 | T15082 | arg1Of | strategies,with |
| R12078 | T15084 | T15082 | arg2Of | coli,with |
| R12079 | T15084 | T15083 | arg1Of | coli,E. |
| R12080 | T15084 | T15085 | arg1Of | coli,39 |
| R12081 | T15088 | T15087 | arg1Of | notably,most |
| R12082 | T15089 | T15088 | arg1Of | for,notably |
| R12083 | T15091 | T15089 | arg2Of | investigation,for |
| R12084 | T15091 | T15090 | arg1Of | investigation,our |
| R12085 | T15095 | T15093 | arg1Of | NleH,C. |
| R12086 | T15095 | T15094 | arg1Of | NleH,rodentium |
| R12087 | T15095 | T15096 | arg1Of | NleH,inhibited |
| R12088 | T15096 | T15092 | arg2Of | inhibited,"," |
| R12089 | T15099 | T15097 | arg1Of | translocation,RPS3 |
| R12090 | T15099 | T15098 | arg1Of | translocation,nuclear |
| R12091 | T15099 | T15100 | arg1Of | translocation,and |
| R12092 | T15100 | T15096 | arg2Of | and,inhibited |
| R12093 | T15100 | T15105 | arg1Of | and,to |
| R12094 | T15104 | T15100 | arg2Of | activity,and |
| R12095 | T15104 | T15101 | arg1Of | activity,RPS3-dependent |
| R12096 | T15104 | T15102 | arg1Of | activity,NF-κB |
| R12097 | T15104 | T15103 | arg1Of | activity,luciferase |
| R12098 | T15107 | T15105 | arg2Of | extent,to |
| R12099 | T15107 | T15106 | arg1Of | extent,an |
| R12100 | T15107 | T15108 | arg1Of | extent,equivalent |
| R12101 | T15108 | T15109 | arg1Of | equivalent,to |
| R12102 | T15112 | T15109 | arg2Of | NleH1,to |
| R12103 | T15112 | T15110 | arg1Of | NleH1,E. |
| R12104 | T15112 | T15111 | arg1Of | NleH1,coli |
| R12105 | T15114 | T15096 | arg3Of | ref,inhibited |
| R12106 | T15114 | T15113 | arg1Of | ref,( |
| R12107 | T15115 | T15116 | arg1Of | 9,) |
| R12108 | T15117 | T15118 | arg1Of | We,assayed |
| R12109 | T15118 | T15122 | arg1Of | assayed,in |
| R12110 | T15121 | T15118 | arg2Of | phosphorylation,assayed |
| R12111 | T15121 | T15119 | arg1Of | phosphorylation,RPS3 |
| R12112 | T15121 | T15120 | arg1Of | phosphorylation,S209 |
| R12113 | T15124 | T15122 | arg2Of | cells,in |
| R12114 | T15124 | T15123 | arg1Of | cells,HeLa |
| R12115 | T15124 | T15125 | arg2Of | cells,infected |
| R12116 | T15125 | T15126 | arg1Of | infected,with |
| R12117 | T15130 | T15126 | arg2Of | strains,with |
| R12118 | T15130 | T15127 | arg1Of | strains,different |
| R12119 | T15130 | T15128 | arg1Of | strains,C. |
| R12120 | T15130 | T15129 | arg1Of | strains,rodentium |
| R12121 | T15133 | T15131 | arg2Of | cells,In |
| R12122 | T15133 | T15132 | arg1Of | cells,uninfected |
| R12123 | T15135 | T15136 | arg1Of | TNF-treatment,stimulated |
| R12124 | T15136 | T15131 | arg1Of | stimulated,In |
| R12125 | T15136 | T15134 | arg1Of | stimulated,"," |
| R12126 | T15139 | T15136 | arg2Of | increase,stimulated |
| R12127 | T15139 | T15137 | arg1Of | increase,a |
| R12128 | T15139 | T15138 | arg1Of | increase,∼3.5-fold |
| R12129 | T15139 | T15140 | arg1Of | increase,in |
| R12130 | T15143 | T15140 | arg2Of | phosphorylation,in |
| R12131 | T15143 | T15141 | arg1Of | phosphorylation,RPS3 |
| R12132 | T15143 | T15142 | arg1Of | phosphorylation,S209 |
| R12133 | T15143 | T15144 | arg1Of | phosphorylation,( |
| R12134 | T15146 | T15144 | arg2Of | 7c,( |
| R12135 | T15146 | T15145 | arg1Of | 7c,Fig. |
| R12136 | T15147 | T15144 | arg3Of | ),( |
| R12137 | T15149 | T15148 | arg1Of | augmentation,Such |
| R12138 | T15149 | T15150 | arg1Of | augmentation,of |
| R12139 | T15149 | T15153 | arg1Of | augmentation,was |
| R12140 | T15149 | T15154 | arg2Of | augmentation,reduced |
| R12141 | T15152 | T15150 | arg2Of | phosphorylation,of |
| R12142 | T15152 | T15151 | arg1Of | phosphorylation,RPS3 |
| R12143 | T15154 | T15153 | arg2Of | reduced,was |
| R12144 | T15154 | T15155 | arg1Of | reduced,by |
| R12145 | T15157 | T15156 | arg1Of | 60,about |
| R12146 | T15158 | T15155 | arg2Of | %,by |
| R12147 | T15158 | T15157 | arg1Of | %,60 |
| R12148 | T15163 | T15154 | arg1Of | infection,reduced |
| R12149 | T15163 | T15159 | arg2Of | infection,by |
| R12150 | T15163 | T15160 | arg1Of | infection,wild-type |
| R12151 | T15163 | T15161 | arg1Of | infection,C. |
| R12152 | T15163 | T15162 | arg1Of | infection,rodentium |
| R12153 | T15163 | T15164 | arg1Of | infection,( |
| R12154 | T15166 | T15164 | arg2Of | 7c,( |
| R12155 | T15166 | T15165 | arg1Of | 7c,Fig. |
| R12156 | T15167 | T15164 | arg3Of | ),( |
| R12157 | T15171 | T15170 | arg1Of | phosphorylation,RPS3 |
| R12158 | T15171 | T15172 | arg1Of | phosphorylation,was |
| R12159 | T15171 | T15173 | arg2Of | phosphorylation,enhanced |
| R12160 | T15173 | T15168 | arg1Of | enhanced,However |
| R12161 | T15173 | T15169 | arg1Of | enhanced,"," |
| R12162 | T15173 | T15172 | arg2Of | enhanced,was |
| R12163 | T15173 | T15174 | arg1Of | enhanced,when |
| R12164 | T15175 | T15176 | arg1Of | cells,were |
| R12165 | T15175 | T15177 | arg2Of | cells,infected |
| R12166 | T15177 | T15174 | arg2Of | infected,when |
| R12167 | T15177 | T15176 | arg2Of | infected,were |
| R12168 | T15177 | T15178 | arg1Of | infected,with |
| R12169 | T15182 | T15178 | arg2Of | strain,with |
| R12170 | T15182 | T15179 | arg1Of | strain,a |
| R12171 | T15182 | T15180 | arg1Of | strain,C. |
| R12172 | T15182 | T15181 | arg1Of | strain,rodentium |
| R12173 | T15182 | T15183 | arg1Of | strain,lacking |
| R12174 | T15184 | T15183 | arg2Of | NleH,lacking |
| R12175 | T15184 | T15185 | arg1Of | NleH,( |
| R12176 | T15187 | T15185 | arg2Of | 7c,( |
| R12177 | T15187 | T15186 | arg1Of | 7c,Fig. |
| R12178 | T15187 | T15188 | arg1Of | 7c,"," |
| R12179 | T15189 | T15188 | arg2Of | ΔnleH,"," |
| R12180 | T15190 | T15185 | arg3Of | ),( |
| R12181 | T15191 | T15193 | arg1Of | We,examined |
| R12182 | T15193 | T15192 | arg1Of | examined,further |
| R12183 | T15195 | T15193 | arg2Of | role,examined |
| R12184 | T15195 | T15194 | arg1Of | role,the |
| R12185 | T15195 | T15196 | arg1Of | role,of |
| R12186 | T15195 | T15200 | arg1Of | role,using |
| R12187 | T15199 | T15196 | arg2Of | activity,of |
| R12188 | T15199 | T15197 | arg1Of | activity,NleH1 |
| R12189 | T15199 | T15198 | arg1Of | activity,kinase |
| R12190 | T15200 | T15206 | arg1Of | using,as |
| R12191 | T15205 | T15200 | arg2Of | strain,using |
| R12192 | T15205 | T15201 | arg1Of | strain,the |
| R12193 | T15205 | T15202 | arg1Of | strain,C. |
| R12194 | T15205 | T15203 | arg1Of | strain,rodentium |
| R12195 | T15205 | T15204 | arg1Of | strain,ΔnleH |
| R12196 | T15208 | T15206 | arg2Of | background,as |
| R12197 | T15208 | T15207 | arg1Of | background,a |
| R12198 | T15208 | T15209 | arg1Of | background,on |
| R12199 | T15210 | T15209 | arg2Of | which,on |
| R12200 | T15210 | T15213 | arg2Of | which,either |
| R12201 | T15212 | T15211 | arg1Of | express,to |
| R12202 | T15212 | T15213 | arg1Of | express,either |
| R12203 | T15214 | T15215 | arg1Of | wild-type,or |
| R12204 | T15215 | T15212 | arg2Of | or,express |
| R12205 | T15219 | T15215 | arg2Of | NleH1,or |
| R12206 | T15219 | T15216 | arg1Of | NleH1,K159A |
| R12207 | T15219 | T15217 | arg1Of | NleH1,E. |
| R12208 | T15219 | T15218 | arg1Of | NleH1,coli |
| R12209 | T15222 | T15220 | arg1Of | mutant,Complementing |
| R12210 | T15222 | T15221 | arg1Of | mutant,ΔnleH |
| R12211 | T15222 | T15223 | arg1Of | mutant,with |
| R12212 | T15222 | T15227 | arg1Of | mutant,abolished |
| R12213 | T15225 | T15223 | arg2Of | NleH1,with |
| R12214 | T15225 | T15224 | arg1Of | NleH1,wild-type |
| R12215 | T15227 | T15226 | arg1Of | abolished,almost |
| R12216 | T15227 | T15232 | arg1Of | abolished,whereas |
| R12217 | T15231 | T15227 | arg2Of | phosphorylation,abolished |
| R12218 | T15231 | T15228 | arg1Of | phosphorylation,TNF-induced |
| R12219 | T15231 | T15229 | arg1Of | phosphorylation,RPS3 |
| R12220 | T15231 | T15230 | arg1Of | phosphorylation,S209 |
| R12221 | T15233 | T15234 | arg1Of | complementing,with |
| R12222 | T15233 | T15236 | arg1Of | complementing,failed |
| R12223 | T15233 | T15238 | arg1Of | complementing,inhibit |
| R12224 | T15235 | T15234 | arg2Of | K159A,with |
| R12225 | T15236 | T15232 | arg2Of | failed,whereas |
| R12226 | T15238 | T15236 | arg2Of | inhibit,failed |
| R12227 | T15238 | T15237 | arg1Of | inhibit,to |
| R12228 | T15240 | T15238 | arg2Of | phosphorylation,inhibit |
| R12229 | T15240 | T15239 | arg1Of | phosphorylation,RPS3 |
| R12230 | T15240 | T15241 | arg1Of | phosphorylation,( |
| R12231 | T15243 | T15241 | arg2Of | 7c,( |
| R12232 | T15243 | T15242 | arg1Of | 7c,Fig. |
| R12233 | T15244 | T15241 | arg3Of | ),( |
| R12234 | T15248 | T15247 | arg1Of | results,these |
| R12235 | T15248 | T15249 | arg1Of | results,demonstrate |
| R12236 | T15249 | T15245 | arg1Of | demonstrate,Collectively |
| R12237 | T15249 | T15246 | arg1Of | demonstrate,"," |
| R12238 | T15253 | T15251 | arg1Of | activity,NleH1 |
| R12239 | T15253 | T15252 | arg1Of | activity,kinase |
| R12240 | T15253 | T15254 | arg1Of | activity,is |
| R12241 | T15253 | T15255 | arg2Of | activity,required |
| R12242 | T15253 | T15257 | arg1Of | activity,block |
| R12243 | T15255 | T15249 | arg2Of | required,demonstrate |
| R12244 | T15255 | T15250 | arg1Of | required,that |
| R12245 | T15255 | T15254 | arg2Of | required,is |
| R12246 | T15257 | T15255 | arg3Of | block,required |
| R12247 | T15257 | T15256 | arg1Of | block,to |
| R12248 | T15260 | T15257 | arg2Of | phosphorylation,block |
| R12249 | T15260 | T15258 | arg1Of | phosphorylation,RPS3 |
| R12250 | T15260 | T15259 | arg1Of | phosphorylation,S209 |
| R12251 | T15261 | T15263 | arg1Of | We,examined |
| R12252 | T15263 | T15262 | arg1Of | examined,next |
| R12253 | T15267 | T15265 | arg1Of | activity,the |
| R12254 | T15267 | T15266 | arg1Of | activity,inhibitory |
| R12255 | T15267 | T15268 | arg1Of | activity,of |
| R12256 | T15267 | T15270 | arg1Of | activity,is |
| R12257 | T15267 | T15272 | arg1Of | activity,robust |
| R12258 | T15269 | T15268 | arg2Of | NleH1,of |
| R12259 | T15270 | T15263 | arg2Of | is,examined |
| R12260 | T15270 | T15264 | arg1Of | is,whether |
| R12261 | T15272 | T15270 | arg2Of | robust,is |
| R12262 | T15272 | T15271 | arg1Of | robust,sufficiently |
| R12263 | T15272 | T15273 | modOf | robust,to |
| R12264 | T15274 | T15273 | arg1Of | impair,to |
| R12265 | T15278 | T15274 | arg2Of | translocation,impair |
| R12266 | T15278 | T15275 | arg1Of | translocation,the |
| R12267 | T15278 | T15276 | arg1Of | translocation,strong |
| R12268 | T15278 | T15277 | arg1Of | translocation,nuclear |
| R12269 | T15278 | T15279 | arg1Of | translocation,of |
| R12270 | T15280 | T15279 | arg2Of | RPS3,of |
| R12271 | T15280 | T15281 | arg2Of | RPS3,trigged |
| R12272 | T15281 | T15292 | arg1Of | trigged,( |
| R12273 | T15285 | T15281 | arg1Of | IKKβ,trigged |
| R12274 | T15285 | T15282 | arg2Of | IKKβ,by |
| R12275 | T15285 | T15283 | arg1Of | IKKβ,the |
| R12276 | T15285 | T15284 | arg1Of | IKKβ,constitutively-active |
| R12277 | T15285 | T15286 | arg1Of | IKKβ,( |
| R12278 | T15287 | T15286 | arg2Of | IKKβ,( |
| R12279 | T15287 | T15288 | arg1Of | IKKβ,[ |
| R12280 | T15289 | T15288 | arg2Of | SSEE,[ |
| R12281 | T15290 | T15288 | arg3Of | ],[ |
| R12282 | T15291 | T15286 | arg3Of | ),( |
| R12283 | T15294 | T15292 | arg2Of | 2d,( |
| R12284 | T15294 | T15293 | arg1Of | 2d,Fig. |
| R12285 | T15295 | T15292 | arg3Of | ),( |
| R12286 | T15296 | T15297 | arg1Of | We,found |
| R12287 | T15300 | T15299 | arg2Of | expressing,ectopically |
| R12288 | T15300 | T15301 | arg1Of | expressing,either |
| R12289 | T15302 | T15303 | arg1Of | wild-type,or |
| R12290 | T15303 | T15300 | arg1Of | or,expressing |
| R12291 | T15303 | T15308 | arg1Of | or,triggered |
| R12292 | T15306 | T15303 | arg2Of | proteins,or |
| R12293 | T15306 | T15304 | arg1Of | proteins,SSEE |
| R12294 | T15306 | T15305 | arg1Of | proteins,IKKβ |
| R12295 | T15308 | T15297 | arg2Of | triggered,found |
| R12296 | T15308 | T15298 | arg1Of | triggered,that |
| R12297 | T15308 | T15299 | arg1Of | triggered,ectopically |
| R12298 | T15308 | T15307 | arg1Of | triggered,"," |
| R12299 | T15312 | T15308 | arg2Of | translocation,triggered |
| R12300 | T15312 | T15309 | arg1Of | translocation,more |
| R12301 | T15312 | T15310 | arg1Of | translocation,RPS3 |
| R12302 | T15312 | T15311 | arg1Of | translocation,nuclear |
| R12303 | T15312 | T15313 | arg1Of | translocation,than |
| R12304 | T15318 | T15317 | arg2Of | SSAA,( |
| R12305 | T15319 | T15317 | arg3Of | ),( |
| R12306 | T15320 | T15313 | arg2Of | protein,than |
| R12307 | T15320 | T15314 | arg1Of | protein,the |
| R12308 | T15320 | T15315 | arg1Of | protein,kinase-dead |
| R12309 | T15320 | T15316 | arg1Of | protein,IKKβ |
| R12310 | T15320 | T15317 | arg1Of | protein,( |
| R12311 | T15320 | T15321 | arg1Of | protein,( |
| R12312 | T15323 | T15321 | arg2Of | 7d,( |
| R12313 | T15323 | T15322 | arg1Of | 7d,Fig. |
| R12314 | T15324 | T15321 | arg3Of | ),( |
| R12315 | T15327 | T15325 | arg1Of | accumulation,RPS3 |
| R12316 | T15327 | T15326 | arg1Of | accumulation,nuclear |
| R12317 | T15327 | T15328 | arg1Of | accumulation,was |
| R12318 | T15327 | T15330 | arg2Of | accumulation,retarded |
| R12319 | T15330 | T15328 | arg2Of | retarded,was |
| R12320 | T15330 | T15329 | arg1Of | retarded,substantially |
| R12321 | T15330 | T15331 | arg1Of | retarded,by |
| R12322 | T15332 | T15331 | arg2Of | infecting,by |
| R12323 | T15332 | T15334 | arg1Of | infecting,with |
| R12324 | T15333 | T15332 | arg2Of | cells,infecting |
| R12325 | T15338 | T15335 | arg1Of | O157,wild-type |
| R12326 | T15338 | T15336 | arg1Of | O157,E. |
| R12327 | T15338 | T15337 | arg1Of | O157,coli |
| R12328 | T15338 | T15339 | arg1Of | O157,: |
| R12329 | T15339 | T15334 | arg2Of | :,with |
| R12330 | T15340 | T15339 | arg2Of | H7,: |
| R12331 | T15340 | T15341 | arg1Of | H7,( |
| R12332 | T15343 | T15341 | arg2Of | 7d,( |
| R12333 | T15343 | T15342 | arg1Of | 7d,Fig. |
| R12334 | T15344 | T15341 | arg3Of | ),( |
| R12335 | T15346 | T15345 | arg2Of | contrast,In |
| R12336 | T15348 | T15345 | arg1Of | infecting,In |
| R12337 | T15348 | T15347 | arg1Of | infecting,"," |
| R12338 | T15348 | T15349 | arg1Of | infecting,with |
| R12339 | T15351 | T15352 | arg1Of | ΔnleH1,or |
| R12340 | T15352 | T15349 | arg2Of | or,with |
| R12341 | T15352 | T15350 | arg1Of | or,either |
| R12342 | T15352 | T15361 | arg1Of | or,in |
| R12343 | T15356 | T15355 | arg1Of | slightly,only |
| R12344 | T15357 | T15356 | arg1Of | impaired,slightly |
| R12345 | T15360 | T15352 | arg2Of | translocation,or |
| R12346 | T15360 | T15353 | arg1Of | translocation,ΔescN |
| R12347 | T15360 | T15354 | arg1Of | translocation,strains |
| R12348 | T15360 | T15357 | arg1Of | translocation,impaired |
| R12349 | T15360 | T15358 | arg1Of | translocation,RPS3 |
| R12350 | T15360 | T15359 | arg1Of | translocation,nuclear |
| R12351 | T15363 | T15364 | arg1Of | IKKβ-,or |
| R12352 | T15364 | T15361 | arg2Of | or,in |
| R12353 | T15364 | T15362 | arg1Of | or,either |
| R12354 | T15367 | T15366 | arg2Of | SSEE,( |
| R12355 | T15368 | T15366 | arg3Of | ),( |
| R12356 | T15370 | T15364 | arg2Of | cells,or |
| R12357 | T15370 | T15365 | arg1Of | cells,IKKβ |
| R12358 | T15370 | T15366 | arg1Of | cells,( |
| R12359 | T15370 | T15369 | arg1Of | cells,-expressing |
| R12360 | T15370 | T15371 | arg1Of | cells,( |
| R12361 | T15373 | T15371 | arg2Of | 7d,( |
| R12362 | T15373 | T15372 | arg1Of | 7d,Fig. |
| R12363 | T15374 | T15371 | arg3Of | ),( |
| R12364 | T15376 | T15375 | arg2Of | expected,As |
| R12365 | T15379 | T15378 | arg1Of | coli,E. |
| R12366 | T15380 | T15379 | arg1Of | infections,coli |
| R12367 | T15380 | T15381 | arg1Of | infections,did |
| R12368 | T15380 | T15383 | arg1Of | infections,affect |
| R12369 | T15383 | T15375 | arg1Of | affect,As |
| R12370 | T15383 | T15377 | arg1Of | affect,"," |
| R12371 | T15383 | T15381 | arg2Of | affect,did |
| R12372 | T15383 | T15382 | arg1Of | affect,not |
| R12373 | T15387 | T15383 | arg2Of | translocation,affect |
| R12374 | T15387 | T15384 | arg1Of | translocation,the |
| R12375 | T15387 | T15385 | arg1Of | translocation,RPS3 |
| R12376 | T15387 | T15386 | arg1Of | translocation,nuclear |
| R12377 | T15387 | T15388 | arg1Of | translocation,in |
| R12378 | T15391 | T15390 | arg2Of | SSAA,( |
| R12379 | T15392 | T15390 | arg3Of | ),( |
| R12380 | T15394 | T15388 | arg2Of | cells,in |
| R12381 | T15394 | T15389 | arg1Of | cells,IKKβ |
| R12382 | T15394 | T15390 | arg1Of | cells,( |
| R12383 | T15394 | T15393 | arg1Of | cells,-expressing |
| R12384 | T15394 | T15395 | arg1Of | cells,"," |
| R12385 | T15394 | T15396 | arg1Of | cells,where |
| R12386 | T15394 | T15401 | arg1Of | cells,( |
| R12387 | T15398 | T15397 | arg1Of | signaling,NF-κB |
| R12388 | T15398 | T15399 | arg1Of | signaling,was |
| R12389 | T15398 | T15400 | arg1Of | signaling,low |
| R12390 | T15399 | T15396 | arg2Of | was,where |
| R12391 | T15400 | T15399 | arg2Of | low,was |
| R12392 | T15403 | T15401 | arg2Of | 7d,( |
| R12393 | T15403 | T15402 | arg1Of | 7d,Fig. |
| R12394 | T15404 | T15401 | arg3Of | ),( |
| R12395 | T15408 | T15407 | arg2Of | infection,during |
| R12396 | T15409 | T15410 | arg1Of | NleH1,is |
| R12397 | T15409 | T15412 | arg1Of | NleH1,potent |
| R12398 | T15410 | T15405 | arg1Of | is,Thus |
| R12399 | T15410 | T15406 | arg1Of | is,"," |
| R12400 | T15410 | T15407 | arg1Of | is,during |
| R12401 | T15412 | T15410 | arg2Of | potent,is |
| R12402 | T15412 | T15411 | arg1Of | potent,sufficiently |
| R12403 | T15412 | T15413 | modOf | potent,to |
| R12404 | T15414 | T15413 | arg1Of | inhibit,to |
| R12405 | T15414 | T15419 | arg1Of | inhibit,in |
| R12406 | T15417 | T15414 | arg2Of | translocation,inhibit |
| R12407 | T15417 | T15415 | arg1Of | translocation,RPS3 |
| R12408 | T15417 | T15416 | arg1Of | translocation,nuclear |
| R12409 | T15419 | T15418 | arg1Of | in,even |
| R12410 | T15420 | T15419 | arg2Of | cells,in |
| R12411 | T15420 | T15421 | arg1Of | cells,expressing |
| R12412 | T15423 | T15421 | arg2Of | IKKβ,expressing |
| R12413 | T15423 | T15422 | arg1Of | IKKβ,constitutively-activated |
| R12414 | T15424 | T15425 | arg1Of | We,examined |
| R12415 | T15427 | T15428 | arg1Of | NleH1,could |
| R12416 | T15427 | T15430 | arg1Of | NleH1,phosphorylate |
| R12417 | T15430 | T15425 | arg2Of | phosphorylate,examined |
| R12418 | T15430 | T15426 | arg1Of | phosphorylate,whether |
| R12419 | T15430 | T15428 | arg2Of | phosphorylate,could |
| R12420 | T15430 | T15429 | arg1Of | phosphorylate,directly |
| R12421 | T15431 | T15430 | arg2Of | IKKβ,phosphorylate |
| R12422 | T15431 | T15433 | arg1Of | IKKβ,inhibiting |
| R12423 | T15433 | T15432 | arg1Of | inhibiting,thus |
| R12424 | T15437 | T15433 | arg2Of | phosphorylation,inhibiting |
| R12425 | T15437 | T15434 | arg1Of | phosphorylation,IKKβ-mediated |
| R12426 | T15437 | T15435 | arg1Of | phosphorylation,RPS3 |
| R12427 | T15437 | T15436 | arg1Of | phosphorylation,S209 |
| R12428 | T15438 | T15439 | arg1Of | We,performed |
| R12429 | T15439 | T15450 | arg1Of | performed,as |
| R12430 | T15439 | T15457 | arg1Of | performed,"," |
| R12431 | T15439 | T15458 | arg1Of | performed,so |
| R12432 | T15441 | T15440 | arg1Of | vitro,in |
| R12433 | T15443 | T15439 | arg2Of | assays,performed |
| R12434 | T15443 | T15441 | arg1Of | assays,vitro |
| R12435 | T15443 | T15442 | arg1Of | assays,kinase |
| R12436 | T15443 | T15444 | arg1Of | assays,using |
| R12437 | T15446 | T15444 | arg2Of | Flag-IKKβ,using |
| R12438 | T15446 | T15445 | arg2Of | Flag-IKKβ,immunoprecipitated |
| R12439 | T15446 | T15447 | arg1Of | Flag-IKKβ,( |
| R12440 | T15448 | T15447 | arg2Of | K44A,( |
| R12441 | T15449 | T15447 | arg3Of | ),( |
| R12442 | T15451 | T15452 | arg1Of | substrate,and |
| R12443 | T15452 | T15450 | arg2Of | and,as |
| R12444 | T15452 | T15455 | arg1Of | and,as |
| R12445 | T15454 | T15452 | arg2Of | His-NleH1,and |
| R12446 | T15454 | T15453 | arg1Of | His-NleH1,recombinant |
| R12447 | T15456 | T15455 | arg2Of | kinase,as |
| R12448 | T15458 | T15459 | arg1Of | so,that |
| R12449 | T15461 | T15460 | arg1Of | autophosphorylation,IKKβ |
| R12450 | T15461 | T15462 | arg1Of | autophosphorylation,would |
| R12451 | T15461 | T15464 | arg1Of | autophosphorylation,obscure |
| R12452 | T15464 | T15458 | arg2Of | obscure,so |
| R12453 | T15464 | T15462 | arg2Of | obscure,would |
| R12454 | T15464 | T15463 | arg1Of | obscure,not |
| R12455 | T15466 | T15464 | arg2Of | phosphorylation,obscure |
| R12456 | T15466 | T15465 | arg1Of | phosphorylation,NleH1-induced |
| R12457 | T15469 | T15470 | arg1Of | we,did |
| R12458 | T15469 | T15472 | arg1Of | we,observe |
| R12459 | T15469 | T15486 | arg1Of | we,ruling |
| R12460 | T15472 | T15467 | arg1Of | observe,However |
| R12461 | T15472 | T15468 | arg1Of | observe,"," |
| R12462 | T15472 | T15470 | arg2Of | observe,did |
| R12463 | T15472 | T15471 | arg1Of | observe,not |
| R12464 | T15472 | T15477 | arg1Of | observe,in |
| R12465 | T15472 | T15484 | arg1Of | observe,"," |
| R12466 | T15472 | T15486 | modOf | observe,ruling |
| R12467 | T15476 | T15472 | arg2Of | incorporation,observe |
| R12468 | T15476 | T15473 | arg1Of | incorporation,any |
| R12469 | T15476 | T15474 | arg1Of | incorporation,detectable |
| R12470 | T15476 | T15475 | arg1Of | incorporation,32P |
| R12471 | T15478 | T15477 | arg2Of | IKKβ,in |
| R12472 | T15478 | T15479 | arg1Of | IKKβ,( |
| R12473 | T15481 | T15479 | arg2Of | Fig.,( |
| R12474 | T15481 | T15480 | arg1Of | Fig.,Supplementary |
| R12475 | T15481 | T15482 | arg1Of | Fig.,13 |
| R12476 | T15483 | T15479 | arg3Of | ),( |
| R12477 | T15486 | T15485 | arg1Of | ruling,thus |
| R12478 | T15486 | T15487 | arg1Of | ruling,out |
| R12479 | T15489 | T15486 | arg2Of | possibility,ruling |
| R12480 | T15489 | T15488 | arg1Of | possibility,this |
| R12481 | T15490 | T15492 | arg1Of | We,tested |
| R12482 | T15492 | T15491 | arg1Of | tested,then |
| R12483 | T15494 | T15492 | arg2Of | hypothesis,tested |
| R12484 | T15494 | T15493 | arg1Of | hypothesis,the |
| R12485 | T15496 | T15497 | arg1Of | NleH1,could |
| R12486 | T15496 | T15498 | arg1Of | NleH1,alter |
| R12487 | T15498 | T15494 | arg2Of | alter,hypothesis |
| R12488 | T15498 | T15495 | arg1Of | alter,that |
| R12489 | T15498 | T15497 | arg2Of | alter,could |
| R12490 | T15502 | T15498 | arg2Of | specificities,alter |
| R12491 | T15502 | T15499 | arg1Of | specificities,the |
| R12492 | T15502 | T15500 | arg1Of | specificities,IKKβ |
| R12493 | T15502 | T15501 | arg1Of | specificities,substrate |
| R12494 | T15505 | T15503 | arg2Of | end,To |
| R12495 | T15505 | T15504 | arg1Of | end,this |
| R12496 | T15507 | T15508 | arg1Of | we,performed |
| R12497 | T15508 | T15503 | arg1Of | performed,To |
| R12498 | T15508 | T15506 | arg1Of | performed,"," |
| R12499 | T15510 | T15509 | arg1Of | vitro,in |
| R12500 | T15512 | T15508 | arg2Of | assays,performed |
| R12501 | T15512 | T15510 | arg1Of | assays,vitro |
| R12502 | T15512 | T15511 | arg1Of | assays,kinase |
| R12503 | T15512 | T15513 | arg1Of | assays,using |
| R12504 | T15515 | T15516 | arg1Of | CK2,and |
| R12505 | T15517 | T15516 | arg2Of | IKK,and |
| R12506 | T15518 | T15513 | arg2Of | substrates,using |
| R12507 | T15518 | T15514 | arg1Of | substrates,both |
| R12508 | T15518 | T15515 | arg1Of | substrates,CK2 |
| R12509 | T15518 | T15517 | arg1Of | substrates,IKK |
| R12510 | T15518 | T15519 | arg1Of | substrates,for |
| R12511 | T15520 | T15519 | arg2Of | IKKβ,for |
| R12512 | T15522 | T15521 | arg2Of | expected,As |
| R12513 | T15526 | T15524 | arg1Of | RPS3,IKKβ |
| R12514 | T15526 | T15525 | arg2Of | RPS3,phosphorylated |
| R12515 | T15526 | T15527 | arg1Of | RPS3,( |
| R12516 | T15526 | T15534 | arg1Of | RPS3,and |
| R12517 | T15529 | T15527 | arg2Of | 7e,( |
| R12518 | T15529 | T15528 | arg1Of | 7e,Fig. |
| R12519 | T15529 | T15530 | arg1Of | 7e,"," |
| R12520 | T15531 | T15530 | arg2Of | lane,"," |
| R12521 | T15531 | T15532 | arg1Of | lane,7 |
| R12522 | T15533 | T15527 | arg3Of | ),( |
| R12523 | T15534 | T15540 | arg1Of | and,( |
| R12524 | T15534 | T15548 | arg1Of | and,demonstrating |
| R12525 | T15537 | T15536 | arg2Of | 1-54,( |
| R12526 | T15538 | T15536 | arg3Of | ),( |
| R12527 | T15539 | T15534 | arg2Of | protein,and |
| R12528 | T15539 | T15535 | arg1Of | protein,GST-IκBα |
| R12529 | T15539 | T15536 | arg1Of | protein,( |
| R12530 | T15542 | T15540 | arg2Of | 7e,( |
| R12531 | T15542 | T15541 | arg1Of | 7e,Fig. |
| R12532 | T15542 | T15543 | arg1Of | 7e,"," |
| R12533 | T15544 | T15543 | arg2Of | lane,"," |
| R12534 | T15544 | T15545 | arg1Of | lane,9 |
| R12535 | T15546 | T15540 | arg3Of | ),( |
| R12536 | T15548 | T15521 | arg1Of | demonstrating,As |
| R12537 | T15548 | T15523 | arg1Of | demonstrating,"," |
| R12538 | T15548 | T15547 | arg1Of | demonstrating,"," |
| R12539 | T15549 | T15550 | arg1Of | it,harbors |
| R12540 | T15550 | T15548 | arg2Of | harbors,demonstrating |
| R12541 | T15552 | T15553 | arg1Of | CK2,or |
| R12542 | T15553 | T15550 | arg2Of | or,harbors |
| R12543 | T15553 | T15551 | arg1Of | or,either |
| R12544 | T15556 | T15553 | arg2Of | specificity,or |
| R12545 | T15556 | T15554 | arg1Of | specificity,IKK |
| R12546 | T15556 | T15555 | arg1Of | specificity,substrate |
| R12547 | T15557 | T15558 | arg1Of | Preincubation,of |
| R12548 | T15557 | T15560 | arg1Of | Preincubation,with |
| R12549 | T15557 | T15562 | arg1Of | Preincubation,reduced |
| R12550 | T15559 | T15558 | arg2Of | IKKβ,of |
| R12551 | T15561 | T15560 | arg2Of | NleH1,with |
| R12552 | T15565 | T15563 | arg1Of | phosphorylation,IKKβ-mediated |
| R12553 | T15565 | T15564 | arg1Of | phosphorylation,RPS3 |
| R12554 | T15565 | T15566 | arg1Of | phosphorylation,"," |
| R12555 | T15565 | T15573 | arg1Of | phosphorylation,but |
| R12556 | T15571 | T15566 | arg2Of | specificity,"," |
| R12557 | T15571 | T15567 | arg1Of | specificity,i.e. |
| R12558 | T15571 | T15568 | arg1Of | specificity,the |
| R12559 | T15571 | T15569 | arg1Of | specificity,CK2 |
| R12560 | T15571 | T15570 | arg1Of | specificity,kinase |
| R12561 | T15573 | T15562 | arg2Of | but,reduced |
| R12562 | T15573 | T15572 | arg1Of | but,"," |
| R12563 | T15573 | T15574 | arg1Of | but,not |
| R12564 | T15577 | T15573 | arg2Of | phosphorylation,but |
| R12565 | T15577 | T15575 | arg1Of | phosphorylation,IKKβ-mediated |
| R12566 | T15577 | T15576 | arg1Of | phosphorylation,GST-IκBα |
| R12567 | T15577 | T15578 | arg1Of | phosphorylation,"," |
| R12568 | T15583 | T15578 | arg2Of | specificity,"," |
| R12569 | T15583 | T15579 | arg1Of | specificity,i.e. |
| R12570 | T15583 | T15580 | arg1Of | specificity,the |
| R12571 | T15583 | T15581 | arg1Of | specificity,IKK |
| R12572 | T15583 | T15582 | arg1Of | specificity,kinase |
| R12573 | T15583 | T15584 | arg1Of | specificity,( |
| R12574 | T15586 | T15584 | arg2Of | 7e,( |
| R12575 | T15586 | T15585 | arg1Of | 7e,Fig. |
| R12576 | T15587 | T15584 | arg3Of | ),( |
| R12577 | T15589 | T15588 | arg1Of | experiments,Control |
| R12578 | T15589 | T15590 | arg1Of | experiments,revealed |
| R12579 | T15593 | T15592 | arg1Of | phosphorylation,NleH1-mediated |
| R12580 | T15593 | T15594 | arg1Of | phosphorylation,or |
| R12581 | T15594 | T15591 | arg1Of | or,no |
| R12582 | T15594 | T15598 | arg1Of | or,or |
| R12583 | T15595 | T15594 | arg2Of | autophosphorylation,or |
| R12584 | T15595 | T15596 | arg1Of | autophosphorylation,of |
| R12585 | T15597 | T15596 | arg2Of | RPS3,of |
| R12586 | T15598 | T15590 | arg2Of | or,revealed |
| R12587 | T15599 | T15598 | arg2Of | GST-IκBα,or |
| R12588 | T15599 | T15600 | arg1Of | GST-IκBα,( |
| R12589 | T15602 | T15600 | arg2Of | 7e,( |
| R12590 | T15602 | T15601 | arg1Of | 7e,Fig. |
| R12591 | T15603 | T15600 | arg3Of | ),( |
| R12592 | T15604 | T15605 | arg1Of | Taken,together |
| R12593 | T15607 | T15608 | arg1Of | NleH1,blocks |
| R12594 | T15608 | T15604 | modOf | blocks,Taken |
| R12595 | T15608 | T15606 | arg1Of | blocks,"," |
| R12596 | T15612 | T15608 | arg2Of | specificity,blocks |
| R12597 | T15612 | T15609 | arg1Of | specificity,the |
| R12598 | T15612 | T15610 | arg1Of | specificity,CK2 |
| R12599 | T15612 | T15611 | arg1Of | specificity,substrate |
| R12600 | T15612 | T15613 | arg1Of | specificity,of |
| R12601 | T15614 | T15613 | arg2Of | IKKβ,of |
| R12602 | T15616 | T15608 | arg3Of | inhibiting,blocks |
| R12603 | T15616 | T15615 | arg1Of | inhibiting,thus |
| R12604 | T15621 | T15616 | arg2Of | phosphorylation,inhibiting |
| R12605 | T15621 | T15617 | arg1Of | phosphorylation,the |
| R12606 | T15621 | T15618 | arg1Of | phosphorylation,IKKβ-mediated |
| R12607 | T15621 | T15619 | arg1Of | phosphorylation,RPS3 |
| R12608 | T15621 | T15620 | arg1Of | phosphorylation,S209 |
| R12609 | T15621 | T15623 | arg1Of | phosphorylation,representing |
| R12610 | T15623 | T15622 | arg1Of | representing,thus |
| R12611 | T15623 | T15626 | arg1Of | representing,strategy |
| R12612 | T15623 | T15627 | arg1Of | representing,by |
| R12613 | T15623 | T15631 | arg1Of | representing,: |
| R12614 | T15626 | T15624 | arg1Of | strategy,a |
| R12615 | T15626 | T15625 | arg1Of | strategy,novel |
| R12616 | T15630 | T15627 | arg2Of | O157,by |
| R12617 | T15630 | T15628 | arg1Of | O157,E. |
| R12618 | T15630 | T15629 | arg1Of | O157,coli |
| R12619 | T15632 | T15623 | arg2Of | H7,representing |
| R12620 | T15632 | T15633 | modOf | H7,to |
| R12621 | T15634 | T15633 | arg1Of | alter,to |
| R12622 | T15639 | T15634 | arg2Of | response,alter |
| R12623 | T15639 | T15635 | arg1Of | response,the |
| R12624 | T15639 | T15636 | arg1Of | response,host |
| R12625 | T15639 | T15637 | arg1Of | response,innate |
| R12626 | T15639 | T15638 | arg1Of | response,immune |
| R14406 | T18146 | T18147 | arg1Of | RPS3,was |
| R14407 | T18146 | T18149 | arg2Of | RPS3,demonstrated |
| R14408 | T18146 | T18151 | arg1Of | RPS3,function |
| R14409 | T18149 | T18147 | arg2Of | demonstrated,was |
| R14410 | T18149 | T18148 | arg1Of | demonstrated,previously |
| R14411 | T18151 | T18149 | arg3Of | function,demonstrated |
| R14412 | T18151 | T18150 | arg1Of | function,to |
| R14413 | T18151 | T18152 | arg1Of | function,as |
| R14414 | T18155 | T18152 | arg2Of | subunit,as |
| R14415 | T18155 | T18153 | arg1Of | subunit,an |
| R14416 | T18155 | T18154 | arg1Of | subunit,integral |
| R14417 | T18155 | T18156 | arg1Of | subunit,conferring |
| R14418 | T18159 | T18156 | arg2Of | specificity6,conferring |
| R14419 | T18159 | T18157 | arg1Of | specificity6,NF-κB |
| R14420 | T18159 | T18158 | arg1Of | specificity6,regulatory |
| R14421 | T18161 | T18162 | arg1Of | we,sought |
| R14422 | T18161 | T18164 | arg1Of | we,elucidate |
| R14423 | T18162 | T18160 | arg1Of | sought,Here |
| R14424 | T18164 | T18162 | arg2Of | elucidate,sought |
| R14425 | T18164 | T18163 | arg1Of | elucidate,to |
| R14426 | T18165 | T18164 | arg2Of | how,elucidate |
| R14427 | T18168 | T18166 | arg1Of | signaling,NF-κB |
| R14428 | T18168 | T18167 | arg1Of | signaling,activation |
| R14429 | T18168 | T18169 | arg1Of | signaling,triggers |
| R14430 | T18169 | T18165 | arg1Of | triggers,how |
| R14431 | T18169 | T18171 | modOf | triggers,to |
| R14432 | T18170 | T18169 | arg2Of | RPS3,triggers |
| R14433 | T18172 | T18173 | arg1Of | translocate,and |
| R14434 | T18173 | T18171 | arg1Of | and,to |
| R14435 | T18174 | T18173 | arg2Of | participate,and |
| R14436 | T18174 | T18175 | arg1Of | participate,in |
| R14437 | T18177 | T18172 | arg2Of | function,translocate |
| R14438 | T18177 | T18174 | arg2Of | function,participate |
| R14439 | T18177 | T18176 | arg1Of | function,NF-κB |
| R14440 | T18177 | T18178 | arg1Of | function,in |
| R14441 | T18180 | T18178 | arg2Of | nucleus,in |
| R14442 | T18180 | T18179 | arg1Of | nucleus,the |
| R14443 | T18181 | T18182 | arg1Of | We,demonstrate |
| R14444 | T18187 | T18184 | arg1Of | phosphorylation,IKKβ-mediated |
| R14445 | T18187 | T18185 | arg1Of | phosphorylation,RPS3 |
| R14446 | T18187 | T18186 | arg1Of | phosphorylation,S209 |
| R14447 | T18187 | T18188 | arg1Of | phosphorylation,represents |
| R14448 | T18188 | T18182 | arg2Of | represents,demonstrate |
| R14449 | T18188 | T18183 | arg1Of | represents,that |
| R14450 | T18191 | T18188 | arg2Of | determinant,represents |
| R14451 | T18191 | T18189 | arg1Of | determinant,a |
| R14452 | T18191 | T18190 | arg1Of | determinant,critical |
| R14453 | T18191 | T18192 | arg1Of | determinant,in |
| R14454 | T18193 | T18192 | arg2Of | governing,in |
| R14455 | T18196 | T18193 | arg2Of | import,governing |
| R14456 | T18196 | T18194 | arg1Of | import,its |
| R14457 | T18196 | T18195 | arg1Of | import,nuclear |
| R14458 | T18196 | T18198 | arg1Of | import,unveiling |
| R14459 | T18198 | T18197 | arg1Of | unveiling,thus |
| R14460 | T18201 | T18198 | arg2Of | mechanism,unveiling |
| R14461 | T18201 | T18199 | arg1Of | mechanism,a |
| R14462 | T18201 | T18200 | arg1Of | mechanism,novel |
| R14463 | T18201 | T18202 | arg1Of | mechanism,behind |
| R14464 | T18205 | T18202 | arg2Of | specificity,behind |
| R14465 | T18205 | T18203 | arg1Of | specificity,NF-κB |
| R14466 | T18205 | T18204 | arg1Of | specificity,regulatory |
| R14467 | T18206 | T18207 | arg1Of | IKKβ,is |
| R14468 | T18210 | T18207 | arg2Of | kinase,is |
| R14469 | T18210 | T18208 | arg1Of | kinase,the |
| R14470 | T18210 | T18209 | arg1Of | kinase,major |
| R14471 | T18210 | T18211 | arg1Of | kinase,that |
| R14472 | T18210 | T18212 | arg1Of | kinase,phosphorylates |
| R14473 | T18212 | T18214 | arg1Of | phosphorylates,in |
| R14474 | T18212 | T18219 | arg1Of | phosphorylates,"," |
| R14475 | T18212 | T18220 | modOf | phosphorylates,leading |
| R14476 | T18213 | T18212 | arg2Of | IκBs,phosphorylates |
| R14477 | T18218 | T18214 | arg2Of | pathway,in |
| R14478 | T18218 | T18215 | arg1Of | pathway,the |
| R14479 | T18218 | T18216 | arg1Of | pathway,classical |
| R14480 | T18218 | T18217 | arg1Of | pathway,NF-κB |
| R14481 | T18220 | T18221 | arg1Of | leading,to |
| R14482 | T18224 | T18221 | arg2Of | degradation40,to |
| R14483 | T18224 | T18222 | arg1Of | degradation40,their |
| R14484 | T18224 | T18223 | arg1Of | degradation40,subsequent |
| R14485 | T18227 | T18228 | arg1Of | RPS3,possesses |
| R14486 | T18228 | T18225 | arg1Of | possesses,Strikingly |
| R14487 | T18228 | T18226 | arg1Of | possesses,"," |
| R14488 | T18228 | T18234 | arg1Of | possesses,; |
| R14489 | T18233 | T18228 | arg2Of | motif,possesses |
| R14490 | T18233 | T18229 | arg1Of | motif,not |
| R14491 | T18233 | T18230 | arg1Of | motif,any |
| R14492 | T18233 | T18231 | arg1Of | motif,consensus |
| R14493 | T18233 | T18232 | arg1Of | motif,IKK |
| R14494 | T18237 | T18238 | arg1Of | S209,is |
| R14495 | T18237 | T18239 | arg2Of | S209,centered |
| R14496 | T18239 | T18234 | arg2Of | centered,; |
| R14497 | T18239 | T18235 | arg1Of | centered,instead |
| R14498 | T18239 | T18236 | arg1Of | centered,"," |
| R14499 | T18239 | T18238 | arg2Of | centered,is |
| R14500 | T18239 | T18240 | arg1Of | centered,in |
| R14501 | T18244 | T18240 | arg2Of | motif,in |
| R14502 | T18244 | T18241 | arg1Of | motif,a |
| R14503 | T18244 | T18242 | arg1Of | motif,consensus |
| R14504 | T18244 | T18243 | arg1Of | motif,CK2 |
| R14505 | T18247 | T18245 | arg1Of | observation,The |
| R14506 | T18247 | T18246 | arg1Of | observation,recent |
| R14507 | T18250 | T18249 | arg1Of | IKKβ,human |
| R14508 | T18250 | T18251 | arg1Of | IKKβ,displayed |
| R14509 | T18251 | T18247 | arg2Of | displayed,observation |
| R14510 | T18251 | T18248 | arg1Of | displayed,that |
| R14511 | T18251 | T18256 | arg1Of | displayed,with |
| R14512 | T18255 | T18251 | arg2Of | coincides,displayed |
| R14513 | T18255 | T18252 | arg1Of | coincides,CK2-like |
| R14514 | T18255 | T18253 | arg1Of | coincides,phosphorylation |
| R14515 | T18255 | T18254 | arg1Of | coincides,specificity29 |
| R14516 | T18261 | T18257 | arg1Of | IKKβ,our |
| R14517 | T18261 | T18258 | arg1Of | IKKβ,evidence |
| R14518 | T18261 | T18259 | arg1Of | IKKβ,that |
| R14519 | T18261 | T18260 | arg1Of | IKKβ,recombinant |
| R14520 | T18261 | T18263 | arg1Of | IKKβ,but |
| R14521 | T18263 | T18256 | arg2Of | but,with |
| R14522 | T18263 | T18262 | arg1Of | but,"," |
| R14523 | T18263 | T18264 | arg1Of | but,not |
| R14524 | T18263 | T18266 | arg1Of | but,"," |
| R14525 | T18265 | T18263 | arg2Of | IKKα,but |
| R14526 | T18268 | T18266 | arg2Of | RPS3,"," |
| R14527 | T18268 | T18267 | arg2Of | RPS3,phosphorylated |
| R14528 | T18269 | T18270 | arg1Of | We,found |
| R14529 | T18272 | T18271 | arg1Of | phosphorylation,this |
| R14530 | T18272 | T18273 | arg1Of | phosphorylation,is |
| R14531 | T18273 | T18270 | arg2Of | is,found |
| R14532 | T18276 | T18273 | arg2Of | modulation,is |
| R14533 | T18276 | T18274 | arg1Of | modulation,a |
| R14534 | T18276 | T18275 | arg1Of | modulation,critical |
| R14535 | T18276 | T18277 | arg1Of | modulation,for |
| R14536 | T18280 | T18278 | arg1Of | translocation,RPS3 |
| R14537 | T18280 | T18279 | arg1Of | translocation,nuclear |
| R14538 | T18280 | T18281 | arg1Of | translocation,( |
| R14539 | T18280 | T18285 | arg1Of | translocation,and |
| R14540 | T18282 | T18281 | arg2Of | via,( |
| R14541 | T18283 | T18282 | arg2Of | importin-α,via |
| R14542 | T18284 | T18281 | arg3Of | ),( |
| R14543 | T18285 | T18277 | arg2Of | and,for |
| R14544 | T18286 | T18285 | arg2Of | engagement,and |
| R14545 | T18286 | T18287 | arg1Of | engagement,in |
| R14546 | T18290 | T18287 | arg2Of | transcription,in |
| R14547 | T18290 | T18288 | arg1Of | transcription,specific |
| R14548 | T18290 | T18289 | arg1Of | transcription,NF-κB |
| R14549 | T18291 | T18292 | arg1Of | CK2,was |
| R14550 | T18291 | T18294 | arg2Of | CK2,shown |
| R14551 | T18291 | T18296 | arg1Of | CK2,phosphorylate |
| R14552 | T18291 | T18300 | arg1Of | CK2,bind |
| R14553 | T18291 | T18303 | arg1Of | CK2,phosphorylate |
| R14554 | T18294 | T18292 | arg2Of | shown,was |
| R14555 | T18294 | T18293 | arg1Of | shown,previously |
| R14556 | T18294 | T18305 | arg1Of | shown,"," |
| R14557 | T18294 | T18306 | arg1Of | shown,however |
| R14558 | T18294 | T18307 | arg1Of | shown,"," |
| R14559 | T18296 | T18295 | arg1Of | phosphorylate,to |
| R14560 | T18296 | T18298 | arg1Of | phosphorylate,and |
| R14561 | T18297 | T18296 | arg2Of | p65,phosphorylate |
| R14562 | T18298 | T18294 | arg3Of | and,shown |
| R14563 | T18300 | T18301 | arg1Of | bind,to |
| R14564 | T18300 | T18302 | arg1Of | bind,and |
| R14565 | T18302 | T18298 | arg2Of | and,and |
| R14566 | T18302 | T18299 | arg1Of | and,to |
| R14567 | T18303 | T18302 | arg2Of | phosphorylate,and |
| R14568 | T18304 | T18303 | arg2Of | IKKβ41-43,phosphorylate |
| R14569 | T18307 | T18329 | arg1Of | ",",in |
| R14570 | T18308 | T18309 | arg1Of | we,ruled |
| R14571 | T18309 | T18307 | arg2Of | ruled,"," |
| R14572 | T18309 | T18310 | arg1Of | ruled,out |
| R14573 | T18309 | T18324 | arg1Of | ruled,because |
| R14574 | T18312 | T18309 | arg2Of | possibility,ruled |
| R14575 | T18312 | T18311 | arg1Of | possibility,the |
| R14576 | T18316 | T18314 | arg1Of | CK2,the |
| R14577 | T18316 | T18315 | arg1Of | CK2,IKKβ-bound |
| R14578 | T18316 | T18317 | arg1Of | CK2,could |
| R14579 | T18316 | T18318 | arg1Of | CK2,account |
| R14580 | T18318 | T18312 | arg2Of | account,possibility |
| R14581 | T18318 | T18313 | arg1Of | account,that |
| R14582 | T18318 | T18317 | arg2Of | account,could |
| R14583 | T18318 | T18319 | arg1Of | account,for |
| R14584 | T18323 | T18319 | arg2Of | phosphorylation,for |
| R14585 | T18323 | T18320 | arg1Of | phosphorylation,the |
| R14586 | T18323 | T18321 | arg2Of | phosphorylation,observed |
| R14587 | T18323 | T18322 | arg1Of | phosphorylation,RPS3 |
| R14588 | T18326 | T18325 | arg1Of | CK2,no |
| R14589 | T18326 | T18327 | arg1Of | CK2,was |
| R14590 | T18326 | T18328 | arg2Of | CK2,detected |
| R14591 | T18328 | T18324 | arg2Of | detected,because |
| R14592 | T18328 | T18327 | arg2Of | detected,was |
| R14593 | T18332 | T18329 | arg2Of | preparations,in |
| R14594 | T18332 | T18330 | arg1Of | preparations,the |
| R14595 | T18332 | T18331 | arg1Of | preparations,IKKβ |
| R14596 | T18332 | T18333 | arg2Of | preparations,used |
| R14597 | T18333 | T18334 | arg1Of | used,for |
| R14598 | T18337 | T18336 | arg1Of | vitro,in |
| R14599 | T18339 | T18334 | arg2Of | assay,for |
| R14600 | T18339 | T18335 | arg1Of | assay,the |
| R14601 | T18339 | T18337 | arg1Of | assay,vitro |
| R14602 | T18339 | T18338 | arg1Of | assay,kinase |
| R14603 | T18341 | T18343 | arg1Of | RPS3,harbors |
| R14604 | T18343 | T18340 | arg2Of | harbors,Because |
| R14605 | T18343 | T18342 | arg1Of | harbors,only |
| R14606 | T18346 | T18344 | arg1Of | motif,the |
| R14607 | T18346 | T18345 | arg1Of | motif,CK2 |
| R14608 | T18346 | T18347 | arg1Of | motif,and |
| R14609 | T18347 | T18343 | arg2Of | and,harbors |
| R14610 | T18352 | T18347 | arg2Of | motif,and |
| R14611 | T18352 | T18348 | arg1Of | motif,not |
| R14612 | T18352 | T18349 | arg1Of | motif,a |
| R14613 | T18352 | T18350 | arg1Of | motif,traditional |
| R14614 | T18352 | T18351 | arg1Of | motif,IKK |
| R14615 | T18357 | T18354 | arg1Of | function,this |
| R14616 | T18357 | T18355 | arg1Of | function,RPS3 |
| R14617 | T18357 | T18356 | arg1Of | function,regulatory |
| R14618 | T18357 | T18358 | arg1Of | function,could |
| R14619 | T18357 | T18359 | arg1Of | function,explain |
| R14620 | T18359 | T18340 | arg1Of | explain,Because |
| R14621 | T18359 | T18353 | arg1Of | explain,"," |
| R14622 | T18359 | T18358 | arg2Of | explain,could |
| R14623 | T18360 | T18359 | arg2Of | why,explain |
| R14624 | T18361 | T18362 | arg1Of | IKK,harbors |
| R14625 | T18362 | T18360 | arg1Of | harbors,why |
| R14626 | T18367 | T18362 | arg2Of | capability,harbors |
| R14627 | T18367 | T18363 | arg1Of | capability,the |
| R14628 | T18367 | T18364 | arg1Of | capability,alternative |
| R14629 | T18367 | T18365 | arg1Of | capability,substrate |
| R14630 | T18367 | T18366 | arg1Of | capability,phosphorylation |
| R14631 | T18369 | T18368 | arg1Of | importantly,More |
| R14632 | T18372 | T18371 | arg1Of | study,our |
| R14633 | T18372 | T18373 | arg1Of | study,has |
| R14634 | T18372 | T18374 | arg1Of | study,elucidated |
| R14635 | T18374 | T18369 | arg1Of | elucidated,importantly |
| R14636 | T18374 | T18370 | arg1Of | elucidated,"," |
| R14637 | T18374 | T18373 | arg2Of | elucidated,has |
| R14638 | T18375 | T18374 | arg2Of | how,elucidated |
| R14639 | T18376 | T18377 | arg1Of | RPS3,is |
| R14640 | T18376 | T18379 | arg2Of | RPS3,integrated |
| R14641 | T18379 | T18375 | arg1Of | integrated,how |
| R14642 | T18379 | T18377 | arg2Of | integrated,is |
| R14643 | T18379 | T18378 | arg1Of | integrated,biochemically |
| R14644 | T18379 | T18380 | arg1Of | integrated,into |
| R14645 | T18379 | T18384 | arg1Of | integrated,in |
| R14646 | T18383 | T18380 | arg2Of | signaling,into |
| R14647 | T18383 | T18381 | arg1Of | signaling,NF-κB |
| R14648 | T18383 | T18382 | arg1Of | signaling,activation |
| R14649 | T18386 | T18384 | arg2Of | manner,in |
| R14650 | T18386 | T18385 | arg1Of | manner,a |
| R14651 | T18386 | T18387 | arg1Of | manner,that |
| R14652 | T18386 | T18388 | arg1Of | manner,is |
| R14653 | T18386 | T18389 | arg1Of | manner,pivotal |
| R14654 | T18389 | T18388 | arg2Of | pivotal,is |
| R14655 | T18389 | T18390 | arg1Of | pivotal,for |
| R14656 | T18392 | T18390 | arg2Of | pathogenesis,for |
| R14657 | T18392 | T18391 | arg1Of | pathogenesis,the |
| R14658 | T18392 | T18393 | arg1Of | pathogenesis,of |
| R14659 | T18392 | T18399 | arg1Of | pathogenesis,: |
| R14660 | T18398 | T18393 | arg2Of | O157,of |
| R14661 | T18398 | T18394 | arg1Of | O157,foodborne |
| R14662 | T18398 | T18395 | arg1Of | O157,pathogen |
| R14663 | T18398 | T18396 | arg1Of | O157,E. |
| R14664 | T18398 | T18397 | arg1Of | O157,coli |
| R14665 | T18400 | T18399 | arg2Of | H7,: |
| R14666 | T18404 | T18401 | arg1Of | phosphorylation,IKKβ-mediated |
| R14667 | T18404 | T18402 | arg1Of | phosphorylation,RPS3 |
| R14668 | T18404 | T18403 | arg1Of | phosphorylation,S209 |
| R14669 | T18404 | T18405 | arg1Of | phosphorylation,is |
| R14670 | T18408 | T18405 | arg2Of | target,is |
| R14671 | T18408 | T18406 | arg1Of | target,a |
| R14672 | T18408 | T18407 | arg1Of | target,critical |
| R14673 | T18408 | T18409 | arg2Of | target,modulated |
| R14674 | T18412 | T18409 | arg1Of | pathogen,modulated |
| R14675 | T18412 | T18410 | arg2Of | pathogen,by |
| R14676 | T18412 | T18411 | arg1Of | pathogen,this |
| R14677 | T18412 | T18413 | modOf | pathogen,to |
| R14678 | T18414 | T18413 | arg1Of | subvert,to |
| R14679 | T18417 | T18414 | arg2Of | signaling,subvert |
| R14680 | T18417 | T18415 | arg1Of | signaling,host |
| R14681 | T18417 | T18416 | arg1Of | signaling,NF-κB |
| R14682 | T18421 | T18418 | arg1Of | NleH1,The |
| R14683 | T18421 | T18419 | arg1Of | NleH1,bacterial |
| R14684 | T18421 | T18420 | arg1Of | NleH1,effector |
| R14685 | T18421 | T18423 | arg1Of | NleH1,binds |
| R14686 | T18421 | T18433 | arg1Of | NleH1,suppresses |
| R14687 | T18423 | T18424 | arg1Of | binds,to |
| R14688 | T18423 | T18431 | arg1Of | binds,and |
| R14689 | T18425 | T18424 | arg2Of | RPS3,to |
| R14690 | T18425 | T18427 | arg2Of | RPS3,injected |
| R14691 | T18427 | T18426 | arg1Of | injected,once |
| R14692 | T18427 | T18428 | arg1Of | injected,into |
| R14693 | T18430 | T18428 | arg2Of | cells,into |
| R14694 | T18430 | T18429 | arg1Of | cells,host |
| R14695 | T18431 | T18422 | arg1Of | and,specifically |
| R14696 | T18433 | T18431 | arg2Of | suppresses,and |
| R14697 | T18433 | T18432 | arg1Of | suppresses,profoundly |
| R14698 | T18434 | T18435 | arg1Of | NF-κB,and |
| R14699 | T18435 | T18433 | arg2Of | and,suppresses |
| R14700 | T18440 | T18435 | arg2Of | responses9,and |
| R14701 | T18440 | T18436 | arg1Of | responses9,its |
| R14702 | T18440 | T18437 | arg1Of | responses9,attendant |
| R14703 | T18440 | T18438 | arg1Of | responses9,protective |
| R14704 | T18440 | T18439 | arg1Of | responses9,immune |
| R14705 | T18442 | T18441 | arg1Of | data,Our |
| R14706 | T18442 | T18444 | arg1Of | data,show |
| R14707 | T18444 | T18443 | arg1Of | show,now |
| R14708 | T18446 | T18448 | arg1Of | NleH1,inhibits |
| R14709 | T18448 | T18444 | arg2Of | inhibits,show |
| R14710 | T18448 | T18445 | arg1Of | inhibits,that |
| R14711 | T18448 | T18447 | arg1Of | inhibits,selectively |
| R14712 | T18448 | T18451 | arg1Of | inhibits,"," |
| R14713 | T18450 | T18448 | arg2Of | phosphorylation,inhibits |
| R14714 | T18450 | T18449 | arg1Of | phosphorylation,RPS3 |
| R14715 | T18453 | T18448 | arg3Of | retarding,inhibits |
| R14716 | T18453 | T18452 | arg1Of | retarding,thus |
| R14717 | T18453 | T18461 | arg1Of | retarding,"," |
| R14718 | T18453 | T18462 | arg1Of | retarding,without |
| R14719 | T18456 | T18455 | arg1Of | translocation,nuclear |
| R14720 | T18456 | T18457 | arg1Of | translocation,and |
| R14721 | T18457 | T18453 | arg2Of | and,retarding |
| R14722 | T18457 | T18454 | arg1Of | and,its |
| R14723 | T18460 | T18457 | arg2Of | function,and |
| R14724 | T18460 | T18458 | arg1Of | function,subsequent |
| R14725 | T18460 | T18459 | arg1Of | function,NF-κB |
| R14726 | T18463 | T18462 | arg2Of | altering,without |
| R14727 | T18466 | T18463 | arg2Of | signaling,altering |
| R14728 | T18466 | T18464 | arg1Of | signaling,other |
| R14729 | T18466 | T18465 | arg1Of | signaling,NF-κB |
| R14730 | T18468 | T18469 | arg1Of | NleH1,did |
| R14731 | T18468 | T18472 | arg1Of | NleH1,phosphorylate |
| R14732 | T18472 | T18467 | arg2Of | phosphorylate,Although |
| R14733 | T18472 | T18469 | arg2Of | phosphorylate,did |
| R14734 | T18472 | T18470 | arg1Of | phosphorylate,not |
| R14735 | T18472 | T18471 | arg1Of | phosphorylate,directly |
| R14736 | T18473 | T18472 | arg2Of | IKKβ,phosphorylate |
| R14737 | T18477 | T18475 | arg1Of | activity,its |
| R14738 | T18477 | T18476 | arg1Of | activity,kinase |
| R14739 | T18477 | T18478 | arg1Of | activity,was |
| R14740 | T18477 | T18479 | arg2Of | activity,required |
| R14741 | T18477 | T18481 | arg1Of | activity,inhibit |
| R14742 | T18479 | T18467 | arg1Of | required,Although |
| R14743 | T18479 | T18474 | arg1Of | required,"," |
| R14744 | T18479 | T18478 | arg2Of | required,was |
| R14745 | T18481 | T18479 | arg3Of | inhibit,required |
| R14746 | T18481 | T18480 | arg1Of | inhibit,to |
| R14747 | T18485 | T18481 | arg2Of | phosphorylation,inhibit |
| R14748 | T18485 | T18482 | arg1Of | phosphorylation,IKKβ-mediated |
| R14749 | T18485 | T18483 | arg1Of | phosphorylation,RPS3 |
| R14750 | T18485 | T18484 | arg1Of | phosphorylation,S209 |
| R14751 | T18488 | T18486 | arg1Of | pathogens,Many |
| R14752 | T18488 | T18487 | arg1Of | pathogens,bacteria |
| R14753 | T18488 | T18489 | arg1Of | pathogens,have |
| R14754 | T18489 | T18501 | arg1Of | have,"," |
| R14755 | T18489 | T18502 | arg1Of | have,whereas |
| R14756 | T18490 | T18489 | arg2Of | products,have |
| R14757 | T18490 | T18491 | arg1Of | products,that |
| R14758 | T18490 | T18492 | arg1Of | products,target |
| R14759 | T18494 | T18492 | arg2Of | kinases,target |
| R14760 | T18494 | T18493 | arg1Of | kinases,key |
| R14761 | T18494 | T18496 | arg1Of | kinases,inactivate |
| R14762 | T18496 | T18492 | arg3Of | inactivate,target |
| R14763 | T18496 | T18495 | arg1Of | inactivate,to |
| R14764 | T18496 | T18498 | arg1Of | inactivate,in |
| R14765 | T18497 | T18496 | arg2Of | them,inactivate |
| R14766 | T18500 | T18498 | arg2Of | cells,in |
| R14767 | T18500 | T18499 | arg1Of | cells,host |
| R14768 | T18505 | T18503 | arg1Of | O157,E. |
| R14769 | T18505 | T18504 | arg1Of | O157,coli |
| R14770 | T18507 | T18508 | arg1Of | H7,employed |
| R14771 | T18507 | T18511 | arg1Of | H7,steer |
| R14772 | T18508 | T18502 | arg2Of | employed,whereas |
| R14773 | T18508 | T18505 | arg1Of | employed,O157 |
| R14774 | T18508 | T18506 | arg1Of | employed,: |
| R14775 | T18509 | T18508 | arg2Of | NleH1,employed |
| R14776 | T18511 | T18508 | arg3Of | steer,employed |
| R14777 | T18511 | T18510 | arg1Of | steer,to |
| R14778 | T18514 | T18511 | arg2Of | specificity,steer |
| R14779 | T18514 | T18512 | arg1Of | specificity,the |
| R14780 | T18514 | T18513 | arg1Of | specificity,substrate |
| R14781 | T18514 | T18515 | arg1Of | specificity,of |
| R14782 | T18518 | T18517 | arg1Of | specifically,thus |
| R14783 | T18519 | T18516 | arg1Of | fine-tuning,IKKβ |
| R14784 | T18519 | T18518 | arg1Of | fine-tuning,specifically |
| R14785 | T18522 | T18515 | arg2Of | signaling,of |
| R14786 | T18522 | T18519 | arg1Of | signaling,fine-tuning |
| R14787 | T18522 | T18520 | arg1Of | signaling,host |
| R14788 | T18522 | T18521 | arg1Of | signaling,NF-κB |
| R14789 | T18523 | T18524 | arg1Of | This,could |
| R14790 | T18523 | T18525 | arg1Of | This,represent |
| R14791 | T18525 | T18524 | arg2Of | represent,could |
| R14792 | T18528 | T18525 | arg2Of | strategy,represent |
| R14793 | T18528 | T18526 | arg1Of | strategy,a |
| R14794 | T18528 | T18527 | arg1Of | strategy,novel |
| R14795 | T18528 | T18529 | modOf | strategy,to |
| R14796 | T18530 | T18529 | arg1Of | fine-tune,to |
| R14797 | T18533 | T18530 | arg2Of | signaling,fine-tune |
| R14798 | T18533 | T18531 | arg1Of | signaling,host |
| R14799 | T18533 | T18532 | arg1Of | signaling,NF-κB |
| R14800 | T18533 | T18534 | arg1Of | signaling,that |
| R14801 | T18533 | T18535 | arg1Of | signaling,could |
| R14802 | T18533 | T18536 | arg1Of | signaling,be |
| R14803 | T18533 | T18537 | arg2Of | signaling,shared |
| R14804 | T18537 | T18535 | arg2Of | shared,could |
| R14805 | T18537 | T18536 | arg2Of | shared,be |
| R14806 | T18540 | T18537 | arg1Of | pathogens,shared |
| R14807 | T18540 | T18538 | arg2Of | pathogens,by |
| R14808 | T18540 | T18539 | arg1Of | pathogens,other |
| R14809 | T18542 | T18541 | arg1Of | data,These |
| R14810 | T18542 | T18543 | arg1Of | data,provide |
| R14811 | T18545 | T18543 | arg2Of | insights,provide |
| R14812 | T18545 | T18544 | arg1Of | insights,new |
| R14813 | T18545 | T18546 | arg1Of | insights,into |
| R14814 | T18549 | T18548 | arg1Of | understood,poorly |
| R14815 | T18551 | T18546 | arg2Of | mechanism,into |
| R14816 | T18551 | T18547 | arg1Of | mechanism,the |
| R14817 | T18551 | T18549 | arg1Of | mechanism,understood |
| R14818 | T18551 | T18550 | arg1Of | mechanism,action |
| R14819 | T18551 | T18552 | arg1Of | mechanism,for |
| R14820 | T18555 | T18552 | arg2Of | effectors,for |
| R14821 | T18555 | T18553 | arg1Of | effectors,most |
| R14822 | T18555 | T18554 | arg1Of | effectors,T3SS |
| R14823 | T18556 | T18557 | arg1Of | NleH1,attenuates |
| R14824 | T18557 | T18570 | arg1Of | attenuates,"," |
| R14825 | T18559 | T18557 | arg2Of | transcription,attenuates |
| R14826 | T18559 | T18558 | arg1Of | transcription,the |
| R14827 | T18559 | T18560 | arg1Of | transcription,of |
| R14828 | T18561 | T18563 | arg1Of | RPS3-dependent,but |
| R14829 | T18563 | T18560 | arg2Of | but,of |
| R14830 | T18563 | T18562 | arg1Of | but,"," |
| R14831 | T18563 | T18564 | arg1Of | but,not |
| R14832 | T18569 | T18563 | arg2Of | genes,but |
| R14833 | T18569 | T18565 | arg1Of | genes,all |
| R14834 | T18569 | T18566 | arg1Of | genes,"," |
| R14835 | T18569 | T18567 | arg1Of | genes,NF-κB |
| R14836 | T18569 | T18568 | arg1Of | genes,target |
| R14837 | T18572 | T18571 | arg2Of | particular,in |
| R14838 | T18574 | T18557 | arg3Of | genes,attenuates |
| R14839 | T18574 | T18571 | arg1Of | genes,in |
| R14840 | T18574 | T18573 | arg1Of | genes,those |
| R14841 | T18574 | T18575 | arg2Of | genes,associated |
| R14842 | T18575 | T18576 | arg1Of | associated,with |
| R14843 | T18579 | T18576 | arg2Of | responses,with |
| R14844 | T18579 | T18577 | arg1Of | responses,acute |
| R14845 | T18579 | T18578 | arg1Of | responses,proinflammatory |
| R14846 | T18579 | T18580 | arg1Of | responses,"," |
| R14847 | T18579 | T18581 | arg1Of | responses,including |
| R14848 | T18582 | T18583 | arg1Of | IL8,and |
| R14849 | T18583 | T18581 | arg2Of | and,including |
| R14850 | T18584 | T18583 | arg2Of | TNF,and |
| R14851 | T18586 | T18585 | arg2Of | contrast,In |
| R14852 | T18588 | T18589 | arg1Of | NleH1,does |
| R14853 | T18588 | T18591 | arg1Of | NleH1,block |
| R14854 | T18591 | T18585 | arg1Of | block,In |
| R14855 | T18591 | T18587 | arg1Of | block,"," |
| R14856 | T18591 | T18589 | arg2Of | block,does |
| R14857 | T18591 | T18590 | arg1Of | block,not |
| R14858 | T18595 | T18591 | arg2Of | translocation,block |
| R14859 | T18595 | T18592 | arg1Of | translocation,NF-κB |
| R14860 | T18595 | T18593 | arg1Of | translocation,p65 |
| R14861 | T18595 | T18594 | arg1Of | translocation,nuclear |
| R14862 | T18595 | T18596 | arg1Of | translocation,"," |
| R14863 | T18595 | T18597 | arg1Of | translocation,which |
| R14864 | T18595 | T18598 | arg1Of | translocation,suggests |
| R14865 | T18601 | T18602 | arg1Of | p65-dependent,but |
| R14866 | T18603 | T18602 | arg2Of | RPS3-independent,but |
| R14867 | T18606 | T18600 | arg1Of | genes,certain |
| R14868 | T18606 | T18601 | arg1Of | genes,p65-dependent |
| R14869 | T18606 | T18603 | arg1Of | genes,RPS3-independent |
| R14870 | T18606 | T18604 | arg1Of | genes,NF-κB |
| R14871 | T18606 | T18605 | arg1Of | genes,target |
| R14872 | T18606 | T18607 | arg1Of | genes,might |
| R14873 | T18606 | T18609 | arg1Of | genes,be |
| R14874 | T18606 | T18610 | arg1Of | genes,beneficial |
| R14875 | T18609 | T18598 | arg2Of | be,suggests |
| R14876 | T18609 | T18599 | arg1Of | be,that |
| R14877 | T18609 | T18607 | arg2Of | be,might |
| R14878 | T18609 | T18608 | arg1Of | be,thus |
| R14879 | T18610 | T18609 | arg2Of | beneficial,be |
| R14880 | T18610 | T18611 | arg1Of | beneficial,for |
| R14881 | T18614 | T18611 | arg2Of | O157,for |
| R14882 | T18614 | T18612 | arg1Of | O157,E. |
| R14883 | T18614 | T18613 | arg1Of | O157,coli |
| R14884 | T18614 | T18615 | arg1Of | O157,: |
| R14885 | T18614 | T18617 | modOf | O157,to |
| R14886 | T18616 | T18618 | arg2Of | H7,replicate |
| R14887 | T18616 | T18620 | arg2Of | H7,disseminate |
| R14888 | T18618 | T18619 | arg1Of | replicate,and |
| R14889 | T18619 | T18617 | arg1Of | and,to |
| R14890 | T18619 | T18621 | arg1Of | and,in |
| R14891 | T18620 | T18619 | arg2Of | disseminate,and |
| R14892 | T18623 | T18621 | arg2Of | host,in |
| R14893 | T18623 | T18622 | arg1Of | host,the |
| R14894 | T18626 | T18624 | arg2Of | inhibiting,By |
| R14895 | T18626 | T18625 | arg1Of | inhibiting,selectively |
| R14896 | T18627 | T18628 | arg1Of | RPS3,and |
| R14897 | T18628 | T18626 | arg2Of | and,inhibiting |
| R14898 | T18632 | T18628 | arg2Of | function,and |
| R14899 | T18632 | T18629 | arg1Of | function,its |
| R14900 | T18632 | T18630 | arg1Of | function,attendant |
| R14901 | T18632 | T18631 | arg1Of | function,NF-κB |
| R14902 | T18632 | T18633 | arg1Of | function,with |
| R14903 | T18634 | T18633 | arg2Of | NleH1,with |
| R14904 | T18637 | T18626 | arg1Of | pathogen,inhibiting |
| R14905 | T18637 | T18636 | arg1Of | pathogen,the |
| R14906 | T18637 | T18638 | arg1Of | pathogen,achieves |
| R14907 | T18638 | T18624 | arg1Of | achieves,By |
| R14908 | T18638 | T18635 | arg1Of | achieves,"," |
| R14909 | T18640 | T18638 | arg2Of | ability,achieves |
| R14910 | T18640 | T18639 | arg1Of | ability,the |
| R14911 | T18640 | T18641 | modOf | ability,to |
| R14912 | T18642 | T18641 | arg1Of | increase,to |
| R14913 | T18643 | T18644 | arg1Of | colonization,and |
| R14914 | T18644 | T18642 | arg2Of | and,increase |
| R14915 | T18644 | T18647 | arg1Of | and,limiting |
| R14916 | T18645 | T18644 | arg2Of | diarrhea,and |
| R14917 | T18647 | T18646 | arg1Of | limiting,yet |
| R14918 | T18649 | T18647 | arg2Of | mortality,limiting |
| R14919 | T18649 | T18648 | arg1Of | mortality,the |
| R14920 | T18649 | T18650 | arg1Of | mortality,of |
| R14921 | T18652 | T18650 | arg2Of | host,of |
| R14922 | T18652 | T18651 | arg1Of | host,the |
| R14923 | T18655 | T18654 | arg1Of | paradoxical,seemingly |
| R14924 | T18656 | T18653 | arg1Of | combination,This |
| R14925 | T18656 | T18655 | arg1Of | combination,paradoxical |
| R14926 | T18656 | T18657 | arg1Of | combination,of |
| R14927 | T18656 | T18659 | arg1Of | combination,make |
| R14928 | T18658 | T18657 | arg2Of | effects,of |
| R14929 | T18659 | T18661 | arg1Of | make,when |
| R14930 | T18660 | T18659 | arg2Of | sense,make |
| R14931 | T18662 | T18663 | arg1Of | one,considers |
| R14932 | T18663 | T18661 | arg2Of | considers,when |
| R14933 | T18667 | T18665 | arg2Of | load,increased |
| R14934 | T18667 | T18666 | arg1Of | load,bacterial |
| R14935 | T18667 | T18668 | arg1Of | load,and |
| R14936 | T18668 | T18671 | arg1Of | and,with |
| R14937 | T18668 | T18677 | arg1Of | and,would |
| R14938 | T18668 | T18678 | arg1Of | and,promote |
| R14939 | T18669 | T18668 | arg2Of | diarrhea,and |
| R14940 | T18671 | T18670 | arg1Of | with,together |
| R14941 | T18672 | T18671 | arg2Of | survival,with |
| R14942 | T18672 | T18673 | arg1Of | survival,of |
| R14943 | T18676 | T18673 | arg2Of | host,of |
| R14944 | T18676 | T18674 | arg1Of | host,the |
| R14945 | T18676 | T18675 | arg1Of | host,infected |
| R14946 | T18678 | T18663 | arg2Of | promote,considers |
| R14947 | T18678 | T18664 | arg1Of | promote,that |
| R14948 | T18678 | T18677 | arg2Of | promote,would |
| R14949 | T18678 | T18684 | arg1Of | promote,among |
| R14950 | T18680 | T18678 | arg2Of | spreading,promote |
| R14951 | T18680 | T18679 | arg1Of | spreading,the |
| R14952 | T18680 | T18681 | arg1Of | spreading,of |
| R14953 | T18683 | T18681 | arg2Of | bacteria,of |
| R14954 | T18683 | T18682 | arg1Of | bacteria,the |
| R14955 | T18686 | T18684 | arg2Of | population,among |
| R14956 | T18686 | T18685 | arg1Of | population,a |
| R14957 | T18686 | T18687 | arg1Of | population,of |
| R14958 | T18689 | T18687 | arg2Of | individuals,of |
| R14959 | T18689 | T18688 | arg1Of | individuals,susceptible |
| R14960 | T18691 | T18690 | arg1Of | complex,Such |
| R14961 | T18691 | T18692 | arg1Of | complex,and |
| R14962 | T18692 | T18702 | arg1Of | and,are |
| R14963 | T18692 | T18705 | arg2Of | and,understood |
| R14964 | T18695 | T18692 | arg2Of | effects,and |
| R14965 | T18695 | T18693 | arg1Of | effects,paradoxical |
| R14966 | T18695 | T18694 | arg1Of | effects,pathological |
| R14967 | T18695 | T18696 | arg1Of | effects,that |
| R14968 | T18695 | T18697 | arg1Of | effects,influence |
| R14969 | T18699 | T18697 | arg2Of | spread,influence |
| R14970 | T18699 | T18698 | arg1Of | spread,the |
| R14971 | T18699 | T18700 | arg1Of | spread,of |
| R14972 | T18701 | T18700 | arg2Of | disease,of |
| R14973 | T18705 | T18702 | arg2Of | understood,are |
| R14974 | T18705 | T18703 | arg1Of | understood,often |
| R14975 | T18705 | T18704 | arg1Of | understood,poorly |
| R14976 | T18705 | T18706 | arg1Of | understood,at |
| R14977 | T18709 | T18706 | arg2Of | level,at |
| R14978 | T18709 | T18707 | arg1Of | level,the |
| R14979 | T18709 | T18708 | arg1Of | level,molecular |
| R14980 | T18711 | T18710 | arg1Of | data,Our |
| R14981 | T18711 | T18712 | arg1Of | data,elucidate |
| R14982 | T18713 | T18712 | arg2Of | how,elucidate |
| R14983 | T18714 | T18715 | arg1Of | alterations,in |
| R14984 | T18714 | T18719 | arg1Of | alterations,"," |
| R14985 | T18714 | T18720 | arg2Of | alterations,achieved |
| R14986 | T18714 | T18732 | arg1Of | alterations,can |
| R14987 | T18714 | T18733 | arg1Of | alterations,influence |
| R14988 | T18718 | T18715 | arg2Of | function,in |
| R14989 | T18718 | T18716 | arg1Of | function,selective |
| R14990 | T18718 | T18717 | arg1Of | function,NF-κB |
| R14991 | T18720 | T18721 | arg1Of | achieved,by |
| R14992 | T18722 | T18725 | arg1Of | impeding,but |
| R14993 | T18723 | T18722 | arg2Of | RPS3,impeding |
| R14994 | T18725 | T18721 | arg2Of | but,by |
| R14995 | T18725 | T18724 | arg1Of | but,"," |
| R14996 | T18725 | T18726 | arg1Of | but,not |
| R14997 | T18727 | T18725 | arg2Of | altering,but |
| R14998 | T18730 | T18727 | arg2Of | translocation,altering |
| R14999 | T18730 | T18728 | arg1Of | translocation,p65 |
| R15000 | T18730 | T18729 | arg1Of | translocation,nuclear |
| R15001 | T18733 | T18713 | arg1Of | influence,how |
| R15002 | T18733 | T18731 | arg1Of | influence,"," |
| R15003 | T18733 | T18732 | arg2Of | influence,can |
| R15004 | T18735 | T18733 | arg2Of | cytokines,influence |
| R15005 | T18735 | T18734 | arg1Of | cytokines,specific |
| R15006 | T18735 | T18736 | arg1Of | cytokines,that |
| R15007 | T18735 | T18737 | arg1Of | cytokines,affect |
| R15008 | T18739 | T18738 | arg1Of | colonization,bacterial |
| R15009 | T18739 | T18740 | arg1Of | colonization,"," |
| R15010 | T18740 | T18743 | arg1Of | ",",and |
| R15011 | T18742 | T18740 | arg2Of | diseases,"," |
| R15012 | T18742 | T18741 | arg1Of | diseases,diarrhea |
| R15013 | T18743 | T18737 | arg2Of | and,affect |
| R15014 | T18744 | T18743 | arg2Of | mortality,and |
| R15015 | T18747 | T18746 | arg2Of | be,may |
| R15016 | T18748 | T18747 | arg2Of | fruitful,be |
| R15017 | T18748 | T18749 | arg1Of | fruitful,in |
| R15018 | T18750 | T18749 | arg2Of | attempting,in |
| R15019 | T18752 | T18750 | arg2Of | understand,attempting |
| R15020 | T18752 | T18751 | arg1Of | understand,to |
| R15021 | T18754 | T18755 | arg1Of | infectious,and |
| R15022 | T18756 | T18755 | arg2Of | autoimmune,and |
| R15023 | T18757 | T18752 | arg2Of | diseases,understand |
| R15024 | T18757 | T18753 | arg1Of | diseases,other |
| R15025 | T18757 | T18754 | arg1Of | diseases,infectious |
| R15026 | T18757 | T18756 | arg1Of | diseases,autoimmune |
| R15027 | T18757 | T18758 | arg1Of | diseases,involving |
| R15028 | T18759 | T18758 | arg2Of | NF-κB,involving |
| R15029 | T18761 | T18745 | arg1Of | consider,It |
| R15030 | T18761 | T18746 | arg1Of | consider,may |
| R15031 | T18761 | T18747 | arg1Of | consider,be |
| R15032 | T18761 | T18748 | arg1Of | consider,fruitful |
| R15033 | T18761 | T18760 | arg1Of | consider,to |
| R15034 | T18761 | T18769 | arg1Of | consider,in |
| R15035 | T18763 | T18761 | arg2Of | effects,consider |
| R15036 | T18763 | T18762 | arg1Of | effects,selective |
| R15037 | T18763 | T18764 | arg1Of | effects,of |
| R15038 | T18765 | T18764 | arg2Of | subunits,of |
| R15039 | T18765 | T18767 | arg1Of | subunits,as |
| R15040 | T18767 | T18766 | arg1Of | as,such |
| R15041 | T18768 | T18767 | arg2Of | RPS3,as |
| R15042 | T18770 | T18769 | arg2Of | addition,in |
| R15043 | T18770 | T18771 | arg1Of | addition,to |
| R15044 | T18774 | T18771 | arg2Of | inhibition,to |
| R15045 | T18774 | T18772 | arg1Of | inhibition,global |
| R15046 | T18774 | T18773 | arg1Of | inhibition,NF-κB |
| R16346 | T20522 | T20521 | arg1Of | Constructs,Plasmid |
| R16347 | T20524 | T20525 | arg1Of | Flag-IKKβ,( |
| R16348 | T20524 | T20528 | arg1Of | Flag-IKKβ,"," |
| R16349 | T20526 | T20525 | arg2Of | SSEE,( |
| R16350 | T20527 | T20525 | arg3Of | ),( |
| R16351 | T20528 | T20534 | arg1Of | ",",and |
| R16352 | T20529 | T20528 | arg2Of | Flag-IKKβ,"," |
| R16353 | T20529 | T20530 | arg1Of | Flag-IKKβ,( |
| R16354 | T20531 | T20530 | arg2Of | SSAA,( |
| R16355 | T20532 | T20530 | arg3Of | ),( |
| R16356 | T20534 | T20523 | arg1Of | and,The |
| R16357 | T20534 | T20533 | arg1Of | and,"," |
| R16358 | T20534 | T20540 | arg1Of | and,were |
| R16359 | T20534 | T20541 | arg2Of | and,provided |
| R16360 | T20537 | T20536 | arg2Of | SSAA,( |
| R16361 | T20538 | T20536 | arg3Of | ),( |
| R16362 | T20539 | T20534 | arg2Of | constructs,and |
| R16363 | T20539 | T20535 | arg1Of | constructs,HA-IκBα |
| R16364 | T20539 | T20536 | arg1Of | constructs,( |
| R16365 | T20541 | T20540 | arg2Of | provided,were |
| R16366 | T20541 | T20558 | arg1Of | provided,"," |
| R16367 | T20541 | T20559 | arg1Of | provided,respectively |
| R16368 | T20544 | T20543 | arg1Of | Wu,C. |
| R16369 | T20544 | T20545 | arg1Of | Wu,( |
| R16370 | T20544 | T20550 | arg1Of | Wu,and |
| R16371 | T20546 | T20545 | arg2Of | NCI,( |
| R16372 | T20546 | T20547 | arg1Of | NCI,"," |
| R16373 | T20546 | T20548 | arg1Of | NCI,Bethesda |
| R16374 | T20549 | T20545 | arg3Of | ),( |
| R16375 | T20550 | T20541 | arg1Of | and,provided |
| R16376 | T20550 | T20542 | arg2Of | and,by |
| R16377 | T20550 | T20553 | arg1Of | and,( |
| R16378 | T20552 | T20550 | arg2Of | Siebenlist,and |
| R16379 | T20552 | T20551 | arg1Of | Siebenlist,U. |
| R16380 | T20554 | T20553 | arg2Of | NIAID,( |
| R16381 | T20554 | T20555 | arg1Of | NIAID,"," |
| R16382 | T20554 | T20556 | arg1Of | NIAID,Bethesda |
| R16383 | T20557 | T20553 | arg3Of | ),( |
| R16384 | T20561 | T20562 | arg1Of | HA-IκBα,and |
| R16385 | T20565 | T20564 | arg2Of | K44A,( |
| R16386 | T20566 | T20564 | arg3Of | ),( |
| R16387 | T20567 | T20562 | arg2Of | -Flag,and |
| R16388 | T20567 | T20563 | arg1Of | -Flag,IKKβ |
| R16389 | T20567 | T20564 | arg1Of | -Flag,( |
| R16390 | T20568 | T20560 | arg1Of | plasmids,The |
| R16391 | T20568 | T20561 | arg1Of | plasmids,HA-IκBα |
| R16392 | T20568 | T20567 | arg1Of | plasmids,-Flag |
| R16393 | T20568 | T20569 | arg1Of | plasmids,were |
| R16394 | T20568 | T20570 | arg2Of | plasmids,purchased |
| R16395 | T20570 | T20569 | arg2Of | purchased,were |
| R16396 | T20570 | T20571 | arg1Of | purchased,from |
| R16397 | T20572 | T20571 | arg2Of | Addgene44,from |
| R16398 | T20572 | T20573 | arg1Of | Addgene44,"," |
| R16399 | T20574 | T20573 | arg2Of | 45,"," |
| R16400 | T20576 | T20577 | arg1Of | Flag-RPS3,"," |
| R16401 | T20577 | T20579 | arg1Of | ",","," |
| R16402 | T20578 | T20577 | arg2Of | GST-RPS3,"," |
| R16403 | T20579 | T20581 | arg1Of | ",","," |
| R16404 | T20580 | T20579 | arg2Of | HA-RPS3,"," |
| R16405 | T20581 | T20583 | arg1Of | ",","," |
| R16406 | T20582 | T20581 | arg2Of | VN-HA,"," |
| R16407 | T20583 | T20575 | arg1Of | ",",The |
| R16408 | T20583 | T20589 | arg1Of | ",","," |
| R16409 | T20584 | T20586 | modOf | NleH1-HA,were |
| R16410 | T20585 | T20586 | arg1Of | plasmids,were |
| R16411 | T20585 | T20587 | arg2Of | plasmids,described |
| R16412 | T20587 | T20586 | arg2Of | described,were |
| R16413 | T20588 | T20583 | arg2Of | previously6,"," |
| R16414 | T20588 | T20584 | arg1Of | previously6,NleH1-HA |
| R16415 | T20590 | T20589 | arg2Of | 9,"," |
| R16416 | T20593 | T20591 | arg1Of | mutants,The |
| R16417 | T20593 | T20592 | arg1Of | mutants,point |
| R16418 | T20593 | T20594 | arg1Of | mutants,of |
| R16419 | T20593 | T20596 | arg1Of | mutants,were |
| R16420 | T20593 | T20597 | arg2Of | mutants,generated |
| R16421 | T20593 | T20601 | arg1Of | mutants,using |
| R16422 | T20595 | T20594 | arg2Of | RPS3,of |
| R16423 | T20597 | T20596 | arg2Of | generated,were |
| R16424 | T20597 | T20598 | arg1Of | generated,by |
| R16425 | T20597 | T20601 | modOf | generated,using |
| R16426 | T20600 | T20598 | arg2Of | mutagenesis,by |
| R16427 | T20600 | T20599 | arg1Of | mutagenesis,site-directed |
| R16428 | T20604 | T20603 | arg1Of | Change,Quick |
| R16429 | T20605 | T20601 | arg2Of | Kit,using |
| R16430 | T20605 | T20602 | arg1Of | Kit,the |
| R16431 | T20605 | T20604 | arg1Of | Kit,Change |
| R16432 | T20605 | T20606 | arg1Of | Kit,( |
| R16433 | T20605 | T20609 | arg1Of | Kit,with |
| R16434 | T20607 | T20606 | arg2Of | Stratagene,( |
| R16435 | T20608 | T20606 | arg3Of | ),( |
| R16436 | T20612 | T20613 | arg1Of | 5′-CTGCCTGACCACGTGGCCATTGTGGAACCCAAA-3′,and |
| R16437 | T20613 | T20611 | arg1Of | and,forward |
| R16438 | T20614 | T20613 | arg2Of | reverse,and |
| R16439 | T20615 | T20609 | arg2Of | 5′-TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3′,with |
| R16440 | T20615 | T20610 | arg1Of | 5′-TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3′,primers |
| R16441 | T20615 | T20612 | arg1Of | 5′-TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3′,5′-CTGCCTGACCACGTGGCCATTGTGGAACCCAAA-3′ |
| R16442 | T20615 | T20614 | arg1Of | 5′-TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3′,reverse |
| R16443 | T20615 | T20616 | arg1Of | 5′-TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3′,for |
| R16444 | T20617 | T20616 | arg2Of | S209A,for |
| R16445 | T20619 | T20618 | arg1Of | mutants,All |
| R16446 | T20619 | T20620 | arg1Of | mutants,were |
| R16447 | T20619 | T20621 | arg2Of | mutants,verified |
| R16448 | T20621 | T20620 | arg2Of | verified,were |
| R16449 | T20624 | T20621 | arg1Of | sequencing,verified |
| R16450 | T20624 | T20622 | arg2Of | sequencing,by |
| R16451 | T20624 | T20623 | arg1Of | sequencing,DNA |
| R16570 | T20849 | T20848 | arg1Of | vivo,in |
| R16571 | T20850 | T20847 | arg1Of | Labeling,32P |
| R16572 | T20850 | T20849 | arg1Of | Labeling,vivo |
| R16573 | T20853 | T20851 | arg1Of | cells,HEK |
| R16574 | T20853 | T20852 | arg1Of | cells,293T |
| R16575 | T20853 | T20854 | arg1Of | cells,were |
| R16576 | T20853 | T20855 | arg2Of | cells,labeled |
| R16577 | T20855 | T20854 | arg2Of | labeled,were |
| R16578 | T20855 | T20856 | arg1Of | labeled,with |
| R16579 | T20859 | T20856 | arg2Of | 32P-orthophosphate,with |
| R16580 | T20859 | T20857 | arg1Of | 32P-orthophosphate,2 |
| R16581 | T20859 | T20858 | arg1Of | 32P-orthophosphate,mCi/ml |
| R16582 | T20859 | T20860 | arg1Of | 32P-orthophosphate,( |
| R16583 | T20859 | T20864 | arg1Of | 32P-orthophosphate,in |
| R16584 | T20862 | T20860 | arg2Of | Elmer,( |
| R16585 | T20862 | T20861 | arg1Of | Elmer,Perkin |
| R16586 | T20863 | T20860 | arg3Of | ),( |
| R16587 | T20866 | T20864 | arg2Of | medium,in |
| R16588 | T20866 | T20865 | arg1Of | medium,phosphate-free |
| R16589 | T20866 | T20867 | arg1Of | medium,( |
| R16590 | T20866 | T20870 | arg1Of | medium,for |
| R16591 | T20868 | T20867 | arg2Of | Invitrogen,( |
| R16592 | T20869 | T20867 | arg3Of | ),( |
| R16593 | T20872 | T20870 | arg2Of | h,for |
| R16594 | T20872 | T20871 | arg1Of | h,2 |
| R16595 | T20873 | T20874 | arg1Of | Cells,were |
| R16596 | T20873 | T20876 | arg2Of | Cells,left |
| R16597 | T20873 | T20877 | arg1Of | Cells,untreated |
| R16598 | T20873 | T20879 | arg2Of | Cells,treated |
| R16599 | T20876 | T20874 | arg2Of | left,were |
| R16600 | T20876 | T20875 | arg1Of | left,then |
| R16601 | T20877 | T20878 | arg1Of | untreated,or |
| R16602 | T20878 | T20876 | arg3Of | or,left |
| R16603 | T20879 | T20878 | arg2Of | treated,or |
| R16604 | T20879 | T20880 | arg1Of | treated,with |
| R16605 | T20881 | T20880 | arg2Of | TNF,with |
| R16606 | T20881 | T20882 | arg1Of | TNF,( |
| R16607 | T20881 | T20891 | arg1Of | TNF,for |
| R16608 | T20884 | T20883 | arg1Of | ng/ml,50 |
| R16609 | T20884 | T20885 | arg1Of | ng/ml,"," |
| R16610 | T20885 | T20882 | arg2Of | ",",( |
| R16611 | T20889 | T20885 | arg2Of | Systems,"," |
| R16612 | T20889 | T20886 | arg1Of | Systems,R |
| R16613 | T20889 | T20887 | arg1Of | Systems,& |
| R16614 | T20889 | T20888 | arg1Of | Systems,D |
| R16615 | T20890 | T20882 | arg3Of | ),( |
| R16616 | T20893 | T20891 | arg2Of | periods,for |
| R16617 | T20893 | T20892 | arg2Of | periods,indicated |
| R16618 | T20895 | T20894 | arg1Of | lysates,Cell |
| R16619 | T20895 | T20896 | arg1Of | lysates,were |
| R16620 | T20895 | T20897 | arg2Of | lysates,prepared |
| R16621 | T20895 | T20899 | arg2Of | lysates,used |
| R16622 | T20897 | T20898 | arg1Of | prepared,and |
| R16623 | T20898 | T20896 | arg2Of | and,were |
| R16624 | T20898 | T20900 | arg1Of | and,for |
| R16625 | T20899 | T20898 | arg2Of | used,and |
| R16626 | T20901 | T20900 | arg2Of | immunoprecipitations,for |
| R16627 | T20901 | T20902 | arg1Of | immunoprecipitations,with |
| R16628 | T20904 | T20902 | arg2Of | antibody,with |
| R16629 | T20904 | T20903 | arg1Of | antibody,RPS3 |
| R16688 | T20998 | T20995 | arg2Of | Assay,In |
| R16689 | T20998 | T20996 | arg1Of | Assay,Vitro |
| R16690 | T20998 | T20997 | arg1Of | Assay,Kinase |
| R16691 | T21001 | T21002 | arg1Of | IKKβ,and |
| R16694 | T21004 | T21005 | arg1Of | proteins,were |
| R16695 | T21004 | T20999 | arg1Of | proteins,Kinase-active |
| R16696 | T21004 | T21000 | arg1Of | proteins,recombinant |
| R16697 | T21004 | T21001 | arg1Of | proteins,IKKβ |
| R16698 | T21004 | T21006 | arg2Of | proteins,purchased |
| R16699 | T21006 | T21005 | arg2Of | purchased,were |
| R16700 | T21006 | T21007 | arg1Of | purchased,from |
| R16701 | T21009 | T21008 | arg1Of | Motif,Active |
| R16702 | T21009 | T21010 | arg1Of | Motif,and |
| R16703 | T21010 | T21007 | arg2Of | and,from |
| R16704 | T21010 | T21012 | arg1Of | and,"," |
| R16705 | T21010 | T21013 | arg1Of | and,respectively |
| R16706 | T21011 | T21010 | arg2Of | Millipore,and |
| R16707 | T21015 | T21014 | arg1Of | purified,Bacterially |
| R16708 | T21017 | T21015 | arg1Of | S-transferase,purified |
| R16709 | T21017 | T21016 | arg1Of | S-transferase,glutathione |
| R16710 | T21017 | T21018 | arg1Of | S-transferase,( |
| R16711 | T21017 | T21021 | arg1Of | S-transferase,"," |
| R16712 | T21019 | T21018 | arg2Of | GST,( |
| R16713 | T21020 | T21018 | arg3Of | ),( |
| R16714 | T21021 | T21026 | arg1Of | ",","," |
| R16715 | T21022 | T21021 | arg2Of | GST-IκBα,"," |
| R16716 | T21022 | T21023 | arg1Of | GST-IκBα,( |
| R16717 | T21024 | T21023 | arg2Of | 1-54,( |
| R16718 | T21025 | T21023 | arg3Of | ),( |
| R16719 | T21026 | T21029 | arg1Of | ",","," |
| R16720 | T21028 | T21026 | arg2Of | type,"," |
| R16721 | T21028 | T21027 | arg1Of | type,wild |
| R16722 | T21029 | T21033 | arg1Of | ",",or |
| R16723 | T21031 | T21029 | arg2Of | GST-RPS3,"," |
| R16724 | T21031 | T21030 | arg1Of | GST-RPS3,mutant |
| R16725 | T21033 | T21032 | arg1Of | or,"," |
| R16726 | T21033 | T21036 | arg1Of | or,were |
| R16727 | T21033 | T21037 | arg2Of | or,used |
| R16728 | T21035 | T21033 | arg2Of | proteins,or |
| R16729 | T21035 | T21034 | arg1Of | proteins,RPS3 |
| R16730 | T21037 | T21036 | arg2Of | used,were |
| R16731 | T21037 | T21038 | arg1Of | used,as |
| R16732 | T21039 | T21038 | arg2Of | substrates,as |
| R16733 | T21042 | T21041 | arg1Of | vitro,in |
| R16734 | T21044 | T21040 | arg1Of | assay,The |
| R16735 | T21044 | T21042 | arg1Of | assay,vitro |
| R16736 | T21044 | T21043 | arg1Of | assay,kinase |
| R16737 | T21044 | T21045 | arg1Of | assay,was |
| R16738 | T21044 | T21046 | arg2Of | assay,performed |
| R16739 | T21046 | T21045 | arg2Of | performed,was |
| R16740 | T21046 | T21047 | arg1Of | performed,as |
| R16741 | T21049 | T21047 | arg2Of | described29,as |
| R16742 | T21049 | T21048 | arg1Of | described29,previously |
| R16743 | T21052 | T21053 | arg1Of | enzyme,( |
| R16744 | T21052 | T21057 | arg1Of | enzyme,and |
| R16745 | T21055 | T21053 | arg2Of | ng,( |
| R16746 | T21055 | T21054 | arg1Of | ng,100 |
| R16747 | T21056 | T21053 | arg3Of | ),( |
| R16748 | T21057 | T21063 | arg1Of | and,were |
| R16749 | T21057 | T21064 | arg2Of | and,co-incubated |
| R16750 | T21058 | T21057 | arg2Of | substrate,and |
| R16751 | T21058 | T21059 | arg1Of | substrate,( |
| R16752 | T21061 | T21059 | arg2Of | μg,( |
| R16753 | T21061 | T21060 | arg1Of | μg,2 |
| R16754 | T21062 | T21059 | arg3Of | ),( |
| R16755 | T21064 | T21051 | arg1Of | co-incubated,"," |
| R16756 | T21064 | T21063 | arg2Of | co-incubated,were |
| R16757 | T21064 | T21065 | arg1Of | co-incubated,in |
| R16758 | T21068 | T21065 | arg2Of | buffer,in |
| R16759 | T21068 | T21066 | arg1Of | buffer,IKK |
| R16760 | T21068 | T21067 | arg1Of | buffer,reaction |
| R16761 | T21070 | T21071 | arg1Of | 25,mM |
| R16762 | T21072 | T21069 | arg2Of | Tris–HCl,( |
| R16763 | T21072 | T21070 | arg1Of | Tris–HCl,25 |
| R16764 | T21072 | T21073 | arg1Of | Tris–HCl,[ |
| R16765 | T21074 | T21073 | arg2Of | pH,[ |
| R16766 | T21074 | T21075 | arg1Of | pH,8.0 |
| R16767 | T21076 | T21073 | arg3Of | ],[ |
| R16768 | T21078 | T21079 | arg1Of | 50,mM |
| R16769 | T21080 | T21078 | arg1Of | KCl,50 |
| R16770 | T21080 | T21081 | arg1Of | KCl,"," |
| R16771 | T21081 | T21085 | arg1Of | ",","," |
| R16772 | T21082 | T21083 | arg1Of | 10,mM |
| R16773 | T21084 | T21081 | arg2Of | MgCl2,"," |
| R16774 | T21084 | T21082 | arg1Of | MgCl2,10 |
| R16775 | T21085 | T21089 | arg1Of | ",","," |
| R16776 | T21086 | T21087 | arg1Of | 1,mM |
| R16777 | T21088 | T21085 | arg2Of | DTT,"," |
| R16778 | T21088 | T21086 | arg1Of | DTT,1 |
| R16779 | T21090 | T21091 | arg1Of | 1,mM |
| R16780 | T21092 | T21089 | arg2Of | Na3VO4,"," |
| R16781 | T21092 | T21090 | arg1Of | Na3VO4,1 |
| R16782 | T21095 | T21093 | arg2Of | mM,"," |
| R16783 | T21095 | T21094 | arg1Of | mM,1 |
| R16784 | T21101 | T21098 | arg2Of | buffer,or |
| R16785 | T21101 | T21099 | arg1Of | buffer,NleH1 |
| R16786 | T21101 | T21100 | arg1Of | buffer,reaction |
| R16787 | T21101 | T21102 | arg1Of | buffer,( |
| R16788 | T21103 | T21104 | arg1Of | 50,mM |
| R16789 | T21105 | T21103 | arg1Of | Tris-HCl,50 |
| R16790 | T21105 | T21106 | arg1Of | Tris-HCl,[ |
| R16791 | T21105 | T21110 | arg1Of | Tris-HCl,"," |
| R16792 | T21107 | T21106 | arg2Of | pH,[ |
| R16793 | T21107 | T21108 | arg1Of | pH,7.6 |
| R16794 | T21109 | T21106 | arg3Of | ],[ |
| R16795 | T21110 | T21114 | arg1Of | ",","," |
| R16796 | T21111 | T21112 | arg1Of | 5,mM |
| R16797 | T21113 | T21110 | arg2Of | MgCl2,"," |
| R16798 | T21113 | T21111 | arg1Of | MgCl2,5 |
| R16799 | T21114 | T21118 | arg1Of | ",","," |
| R16800 | T21115 | T21116 | arg1Of | 1,mM |
| R16801 | T21117 | T21114 | arg2Of | DTT,"," |
| R16802 | T21117 | T21115 | arg1Of | DTT,1 |
| R16803 | T21118 | T21102 | arg2Of | ",",( |
| R16804 | T21119 | T21120 | arg1Of | 1,mM |
| R16805 | T21121 | T21118 | arg2Of | ATP,"," |
| R16806 | T21121 | T21119 | arg1Of | ATP,1 |
| R16807 | T21122 | T21102 | arg3Of | ),( |
| R16808 | T21126 | T21123 | arg2Of | 32P-γ-ATP,with |
| R16809 | T21126 | T21124 | arg1Of | 32P-γ-ATP,0.5 |
| R16810 | T21126 | T21125 | arg1Of | 32P-γ-ATP,μCi |
| R16811 | T21126 | T21127 | arg1Of | 32P-γ-ATP,( |
| R16812 | T21129 | T21127 | arg2Of | Healthcare,( |
| R16813 | T21129 | T21128 | arg1Of | Healthcare,GE |
| R16814 | T21130 | T21127 | arg3Of | ),( |
| R16815 | T21131 | T21132 | arg1Of | added,at |
| R16816 | T21131 | T21135 | arg1Of | added,for |
| R16817 | T21134 | T21132 | arg2Of | °C,at |
| R16818 | T21134 | T21133 | arg1Of | °C,37 |
| R16819 | T21137 | T21135 | arg2Of | min,for |
| R16820 | T21137 | T21136 | arg1Of | min,30 |
| R16821 | T21139 | T21138 | arg1Of | reactions,The |
| R16822 | T21139 | T21140 | arg1Of | reactions,were |
| R16823 | T21139 | T21141 | arg2Of | reactions,resolved |
| R16824 | T21139 | T21145 | arg2Of | reactions,visualized |
| R16825 | T21141 | T21142 | arg1Of | resolved,by |
| R16826 | T21141 | T21144 | arg1Of | resolved,and |
| R16827 | T21143 | T21142 | arg2Of | SDS–PAGE,by |
| R16828 | T21144 | T21140 | arg2Of | and,were |
| R16829 | T21145 | T21144 | arg2Of | visualized,and |
| R16830 | T21147 | T21145 | arg1Of | autoradiography,visualized |
| R16831 | T21147 | T21146 | arg2Of | autoradiography,by |
| R16993 | T21368 | T21367 | arg1Of | Analysis,LC-MS/MS |
| R16994 | T21369 | T21370 | arg1Of | GST,or |
| R16995 | T21370 | T21372 | arg1Of | or,was |
| R16996 | T21370 | T21373 | arg2Of | or,incubated |
| R16997 | T21371 | T21370 | arg2Of | GST-RPS3,or |
| R16998 | T21373 | T21372 | arg2Of | incubated,was |
| R16999 | T21373 | T21374 | arg1Of | incubated,with |
| R17000 | T21373 | T21378 | arg1Of | incubated,as |
| R17001 | T21377 | T21374 | arg2Of | protein,with |
| R17002 | T21377 | T21375 | arg1Of | protein,recombinant |
| R17003 | T21377 | T21376 | arg1Of | protein,IKKβ |
| R17004 | T21379 | T21378 | arg2Of | described,as |
| R17005 | T21379 | T21380 | arg1Of | described,above |
| R17006 | T21379 | T21381 | arg1Of | described,in |
| R17007 | T21384 | T21383 | arg1Of | vitro,in |
| R17008 | T21387 | T21381 | arg2Of | reaction,in |
| R17009 | T21387 | T21382 | arg1Of | reaction,an |
| R17010 | T21387 | T21384 | arg1Of | reaction,vitro |
| R17011 | T21387 | T21385 | arg1Of | reaction,kinase |
| R17012 | T21387 | T21386 | arg1Of | reaction,assay |
| R17013 | T21387 | T21388 | arg2Of | reaction,conducted |
| R17014 | T21388 | T21389 | arg1Of | conducted,without |
| R17015 | T21391 | T21389 | arg2Of | labeling,without |
| R17016 | T21391 | T21390 | arg1Of | labeling,32P-γ-ATP |
| R17017 | T21393 | T21392 | arg1Of | reaction,The |
| R17018 | T21393 | T21394 | arg1Of | reaction,was |
| R17019 | T21393 | T21395 | arg2Of | reaction,separated |
| R17020 | T21395 | T21394 | arg2Of | separated,was |
| R17021 | T21395 | T21399 | arg1Of | separated,and |
| R17022 | T21397 | T21395 | arg1Of | SDS-PAGE,separated |
| R17023 | T21397 | T21396 | arg2Of | SDS-PAGE,by |
| R17024 | T21399 | T21398 | arg1Of | and,"," |
| R17025 | T21402 | T21400 | arg1Of | gel,the |
| R17026 | T21402 | T21401 | arg1Of | gel,protein |
| R17027 | T21402 | T21403 | arg1Of | gel,was |
| R17028 | T21402 | T21404 | arg2Of | gel,stained |
| R17029 | T21404 | T21399 | arg2Of | stained,and |
| R17030 | T21404 | T21403 | arg2Of | stained,was |
| R17031 | T21404 | T21405 | arg1Of | stained,with |
| R17032 | T21407 | T21405 | arg2Of | Blue,with |
| R17033 | T21407 | T21406 | arg1Of | Blue,Colloidal |
| R17034 | T21407 | T21408 | arg1Of | Blue,( |
| R17035 | T21409 | T21408 | arg2Of | Invitrogen,( |
| R17036 | T21410 | T21408 | arg3Of | ),( |
| R17037 | T21414 | T21411 | arg1Of | fragments,The |
| R17038 | T21414 | T21412 | arg1Of | fragments,corresponding |
| R17039 | T21414 | T21413 | arg1Of | fragments,protein |
| R17040 | T21414 | T21415 | arg1Of | fragments,were |
| R17041 | T21414 | T21416 | arg2Of | fragments,excised |
| R17042 | T21414 | T21418 | arg2Of | fragments,subjected |
| R17043 | T21416 | T21417 | arg1Of | excised,and |
| R17044 | T21417 | T21415 | arg2Of | and,were |
| R17045 | T21418 | T21417 | arg2Of | subjected,and |
| R17046 | T21418 | T21419 | arg1Of | subjected,to |
| R17047 | T21421 | T21420 | arg1Of | digestion,trypsin |
| R17048 | T21421 | T21422 | arg1Of | digestion,and |
| R17049 | T21422 | T21419 | arg2Of | and,to |
| R17050 | T21422 | T21424 | arg1Of | and,at |
| R17051 | T21423 | T21422 | arg2Of | LC-MS/MS,and |
| R17052 | T21431 | T21424 | arg2Of | Resource,at |
| R17053 | T21431 | T21425 | arg1Of | Resource,the |
| R17054 | T21431 | T21426 | arg1Of | Resource,Yale |
| R17055 | T21431 | T21427 | arg1Of | Resource,Cancer |
| R17056 | T21431 | T21428 | arg1Of | Resource,Center |
| R17057 | T21431 | T21429 | arg1Of | Resource,Mass |
| R17058 | T21431 | T21430 | arg1Of | Resource,Spectrometry |
| R17059 | T21431 | T21432 | arg1Of | Resource,( |
| R17060 | T21434 | T21432 | arg2Of | Haven,( |
| R17061 | T21434 | T21433 | arg1Of | Haven,New |
| R17062 | T21434 | T21435 | arg1Of | Haven,"," |
| R17063 | T21436 | T21435 | arg2Of | CT,"," |
| R17064 | T21437 | T21432 | arg3Of | ),( |
| R17139 | T21551 | T21552 | arg1Of | RNAi,and |
| R17140 | T21553 | T21552 | arg2Of | Transfection,and |
| R17141 | T21555 | T21556 | arg1Of | siRNA,( |
| R17142 | T21558 | T21556 | arg2Of | sequence,( |
| R17143 | T21558 | T21557 | arg1Of | sequence,sense-strand |
| R17144 | T21559 | T21556 | arg3Of | ),( |
| R17145 | T21560 | T21554 | arg1Of | IKKα,The |
| R17146 | T21560 | T21555 | arg1Of | IKKα,siRNA |
| R17147 | T21560 | T21561 | arg1Of | IKKα,"," |
| R17148 | T21560 | T21564 | arg1Of | IKKα,; |
| R17149 | T21563 | T21561 | arg2Of | -3′,"," |
| R17150 | T21563 | T21562 | arg1Of | -3′,5′-AUGACAGAGAAUGAUCAUGUUCUGC |
| R17151 | T21565 | T21564 | arg2Of | IKKβ,; |
| R17152 | T21565 | T21566 | arg1Of | IKKβ,"," |
| R17153 | T21565 | T21569 | arg1Of | IKKβ,; |
| R17154 | T21565 | T21577 | arg1Of | IKKβ,"," |
| R17155 | T21567 | T21566 | arg2Of | 5′-GCAGCAAGGAGAACAGAGGUUAAUA,"," |
| R17156 | T21567 | T21568 | arg1Of | 5′-GCAGCAAGGAGAACAGAGGUUAAUA,-3′ |
| R17157 | T21570 | T21569 | arg2Of | IκBα,; |
| R17158 | T21570 | T21571 | arg1Of | IκBα,"," |
| R17159 | T21573 | T21572 | arg1Of | -3′,5′-GAGCUCCGAGACUUUCGAGGAAAUA |
| R17160 | T21573 | T21574 | arg1Of | -3′,; |
| R17161 | T21574 | T21571 | arg2Of | ;,"," |
| R17162 | T21576 | T21574 | arg2Of | UTR,; |
| R17163 | T21576 | T21575 | arg1Of | UTR,RPS3-3′ |
| R17164 | T21579 | T21577 | arg2Of | -3′,"," |
| R17165 | T21579 | T21578 | arg1Of | -3′,5′-GGAUGUUGCUCUCUAAAGACC |
| R17166 | T21579 | T21580 | arg1Of | -3′,( |
| R17167 | T21581 | T21580 | arg2Of | Invitrogen,( |
| R17168 | T21582 | T21580 | arg3Of | ),( |
| R17169 | T21584 | T21583 | arg1Of | transfection,Transient |
| R17170 | T21584 | T21585 | arg1Of | transfection,of |
| R17171 | T21584 | T21590 | arg1Of | transfection,into |
| R17172 | T21584 | T21596 | arg1Of | transfection,was |
| R17173 | T21586 | T21587 | arg1Of | siRNA,and |
| R17174 | T21588 | T21587 | arg2Of | DNA,and |
| R17175 | T21589 | T21585 | arg2Of | constructs,of |
| R17176 | T21589 | T21586 | arg1Of | constructs,siRNA |
| R17177 | T21589 | T21588 | arg1Of | constructs,DNA |
| R17178 | T21592 | T21591 | arg1Of | cells,Jurkat |
| R17179 | T21592 | T21593 | arg1Of | cells,and |
| R17180 | T21593 | T21590 | arg2Of | and,into |
| R17181 | T21595 | T21593 | arg2Of | cells,and |
| R17182 | T21595 | T21594 | arg1Of | cells,293T |
| R17183 | T21598 | T21596 | arg2Of | previously6,was |
| R17184 | T21598 | T21597 | arg2Of | previously6,described |
| R17254 | T21713 | T21712 | arg1Of | Fractionation,Subcellular |
| R17255 | T21715 | T21714 | arg1Of | fractionation,Subcellular |
| R17256 | T21715 | T21716 | arg1Of | fractionation,was |
| R17257 | T21715 | T21717 | arg2Of | fractionation,performed |
| R17258 | T21717 | T21716 | arg2Of | performed,was |
| R17259 | T21717 | T21721 | arg1Of | performed,as |
| R17260 | T21720 | T21717 | arg1Of | centrifugation,performed |
| R17261 | T21720 | T21718 | arg2Of | centrifugation,by |
| R17262 | T21720 | T21719 | arg1Of | centrifugation,differential |
| R17263 | T21723 | T21721 | arg2Of | described6,as |
| R17264 | T21723 | T21722 | arg1Of | described6,previously |
| R17265 | T21726 | T21727 | arg1Of | cells,were |
| R17266 | T21726 | T21728 | arg2Of | cells,resuspended |
| R17267 | T21728 | T21724 | arg1Of | resuspended,Briefly |
| R17268 | T21728 | T21725 | arg1Of | resuspended,"," |
| R17269 | T21728 | T21727 | arg2Of | resuspended,were |
| R17270 | T21728 | T21729 | arg1Of | resuspended,in |
| R17271 | T21728 | T21733 | arg1Of | resuspended,( |
| R17272 | T21728 | T21769 | arg1Of | resuspended,at |
| R17273 | T21728 | T21772 | arg1Of | resuspended,for |
| R17274 | T21732 | T21729 | arg2Of | A,in |
| R17275 | T21732 | T21730 | arg1Of | A,ice-cold |
| R17276 | T21732 | T21731 | arg1Of | A,Buffer |
| R17277 | T21734 | T21735 | arg1Of | 10,mM |
| R17278 | T21737 | T21736 | arg1Of | pH,HEPES |
| R17279 | T21737 | T21738 | arg1Of | pH,7.9 |
| R17280 | T21737 | T21739 | arg1Of | pH,"," |
| R17281 | T21739 | T21743 | arg1Of | ",","," |
| R17282 | T21740 | T21741 | arg1Of | 10,mM |
| R17283 | T21742 | T21739 | arg2Of | KCl,"," |
| R17284 | T21742 | T21740 | arg1Of | KCl,10 |
| R17285 | T21743 | T21747 | arg1Of | ",","," |
| R17286 | T21744 | T21745 | arg1Of | 1.5,mM |
| R17287 | T21746 | T21743 | arg2Of | MgCl2,"," |
| R17288 | T21746 | T21744 | arg1Of | MgCl2,1.5 |
| R17289 | T21747 | T21751 | arg1Of | ",","," |
| R17290 | T21748 | T21749 | arg1Of | 0.1,mM |
| R17291 | T21750 | T21747 | arg2Of | EDTA,"," |
| R17292 | T21750 | T21748 | arg1Of | EDTA,0.1 |
| R17293 | T21751 | T21733 | arg2Of | ",",( |
| R17294 | T21751 | T21734 | arg1Of | ",",10 |
| R17295 | T21752 | T21753 | arg1Of | 0.5,mM |
| R17296 | T21754 | T21752 | arg1Of | DTT,0.5 |
| R17297 | T21754 | T21755 | arg1Of | DTT,"," |
| R17298 | T21755 | T21759 | arg1Of | ",","," |
| R17299 | T21756 | T21757 | arg1Of | 0.4,% |
| R17300 | T21758 | T21755 | arg2Of | NP-40,"," |
| R17301 | T21758 | T21756 | arg1Of | NP-40,0.4 |
| R17302 | T21759 | T21763 | arg1Of | ",","," |
| R17303 | T21760 | T21761 | arg1Of | 0.5,mM |
| R17304 | T21762 | T21759 | arg2Of | PMSF,"," |
| R17305 | T21762 | T21760 | arg1Of | PMSF,0.5 |
| R17306 | T21763 | T21751 | arg2Of | ",","," |
| R17307 | T21767 | T21763 | arg2Of | cocktail,"," |
| R17308 | T21767 | T21764 | arg1Of | cocktail,complete |
| R17309 | T21767 | T21765 | arg1Of | cocktail,protease |
| R17310 | T21767 | T21766 | arg1Of | cocktail,inhibitor |
| R17311 | T21768 | T21733 | arg3Of | ),( |
| R17312 | T21771 | T21769 | arg2Of | °C,at |
| R17313 | T21771 | T21770 | arg1Of | °C,4 |
| R17314 | T21774 | T21772 | arg2Of | min,for |
| R17315 | T21774 | T21773 | arg1Of | min,5 |
| R17316 | T21775 | T21776 | arg1Of | Lysates,were |
| R17317 | T21775 | T21777 | arg2Of | Lysates,centrifuged |
| R17318 | T21777 | T21776 | arg2Of | centrifuged,were |
| R17319 | T21777 | T21778 | arg1Of | centrifuged,at |
| R17320 | T21777 | T21789 | arg1Of | centrifuged,and |
| R17321 | T21780 | T21779 | arg1Of | °C,4 |
| R17322 | T21780 | T21781 | arg1Of | °C,"," |
| R17323 | T21781 | T21778 | arg2Of | ",",at |
| R17324 | T21784 | T21781 | arg2Of | g,"," |
| R17325 | T21784 | T21782 | arg1Of | g,500 |
| R17326 | T21784 | T21783 | arg1Of | g,× |
| R17327 | T21784 | T21785 | arg1Of | g,for |
| R17328 | T21787 | T21785 | arg2Of | min,for |
| R17329 | T21787 | T21786 | arg1Of | min,3 |
| R17330 | T21789 | T21788 | arg1Of | and,"," |
| R17331 | T21790 | T21791 | arg1Of | supernatants,were |
| R17332 | T21790 | T21792 | arg2Of | supernatants,collected |
| R17333 | T21792 | T21789 | arg2Of | collected,and |
| R17334 | T21792 | T21791 | arg2Of | collected,were |
| R17335 | T21792 | T21793 | arg1Of | collected,as |
| R17336 | T21795 | T21793 | arg2Of | fractions,as |
| R17337 | T21795 | T21794 | arg1Of | fractions,cytosolic |
| R17338 | T21796 | T21797 | arg1Of | Pellets,were |
| R17339 | T21796 | T21798 | arg2Of | Pellets,incubated |
| R17340 | T21798 | T21797 | arg2Of | incubated,were |
| R17341 | T21798 | T21799 | arg1Of | incubated,in |
| R17342 | T21801 | T21799 | arg2Of | C,in |
| R17343 | T21801 | T21800 | arg1Of | C,Buffer |
| R17344 | T21801 | T21802 | arg1Of | C,( |
| R17345 | T21801 | T21837 | arg1Of | C,at |
| R17346 | T21806 | T21803 | arg1Of | pH7.9,20 |
| R17347 | T21806 | T21804 | arg1Of | pH7.9,mM |
| R17348 | T21806 | T21805 | arg1Of | pH7.9,HEPES |
| R17349 | T21806 | T21807 | arg1Of | pH7.9,"," |
| R17350 | T21807 | T21811 | arg1Of | ",","," |
| R17351 | T21808 | T21809 | arg1Of | 420,mM |
| R17352 | T21810 | T21807 | arg2Of | NaCl,"," |
| R17353 | T21810 | T21808 | arg1Of | NaCl,420 |
| R17354 | T21811 | T21815 | arg1Of | ",","," |
| R17355 | T21812 | T21813 | arg1Of | 1.5,mM |
| R17356 | T21814 | T21811 | arg2Of | MgCl2,"," |
| R17357 | T21814 | T21812 | arg1Of | MgCl2,1.5 |
| R17358 | T21815 | T21819 | arg1Of | ",","," |
| R17359 | T21816 | T21817 | arg1Of | 25,% |
| R17360 | T21818 | T21815 | arg2Of | glycerol,"," |
| R17361 | T21818 | T21816 | arg1Of | glycerol,25 |
| R17362 | T21819 | T21802 | arg2Of | ",",( |
| R17363 | T21820 | T21821 | arg1Of | 0.5,mM |
| R17364 | T21822 | T21820 | arg1Of | PMSF,0.5 |
| R17365 | T21822 | T21823 | arg1Of | PMSF,"," |
| R17366 | T21823 | T21827 | arg1Of | ",","," |
| R17367 | T21824 | T21825 | arg1Of | 0.2,mM |
| R17368 | T21826 | T21823 | arg2Of | EDTA,"," |
| R17369 | T21826 | T21824 | arg1Of | EDTA,0.2 |
| R17370 | T21827 | T21831 | arg1Of | ",","," |
| R17371 | T21828 | T21829 | arg1Of | 0.5,mM |
| R17372 | T21830 | T21827 | arg2Of | DTT,"," |
| R17373 | T21830 | T21828 | arg1Of | DTT,0.5 |
| R17374 | T21831 | T21819 | arg2Of | ",","," |
| R17375 | T21835 | T21831 | arg2Of | cocktail,"," |
| R17376 | T21835 | T21832 | arg1Of | cocktail,complete |
| R17377 | T21835 | T21833 | arg1Of | cocktail,protease |
| R17378 | T21835 | T21834 | arg1Of | cocktail,inhibitor |
| R17379 | T21836 | T21802 | arg3Of | ),( |
| R17380 | T21839 | T21837 | arg2Of | °C,at |
| R17381 | T21839 | T21838 | arg1Of | °C,4 |
| R17382 | T21839 | T21840 | arg1Of | °C,for |
| R17383 | T21842 | T21840 | arg2Of | min,for |
| R17384 | T21842 | T21841 | arg1Of | min,10 |
| R17385 | T21843 | T21844 | arg1Of | Supernatants,were |
| R17386 | T21843 | T21845 | arg2Of | Supernatants,collected |
| R17387 | T21845 | T21844 | arg2Of | collected,were |
| R17388 | T21845 | T21846 | arg1Of | collected,as |
| R17389 | T21845 | T21849 | arg1Of | collected,following |
| R17390 | T21845 | T21852 | arg1Of | collected,at |
| R17391 | T21848 | T21846 | arg2Of | fractions,as |
| R17392 | T21848 | T21847 | arg1Of | fractions,nuclear |
| R17393 | T21851 | T21849 | arg2Of | centrifuge,following |
| R17394 | T21851 | T21850 | arg1Of | centrifuge,a |
| R17395 | T21854 | T21852 | arg2Of | °C,at |
| R17396 | T21854 | T21853 | arg1Of | °C,4 |
| R17397 | T21854 | T21855 | arg1Of | °C,"," |
| R17398 | T21858 | T21855 | arg2Of | g,"," |
| R17399 | T21858 | T21856 | arg1Of | g,"13,800" |
| R17400 | T21858 | T21857 | arg1Of | g,× |
| R17401 | T21858 | T21859 | arg1Of | g,for |
| R17402 | T21861 | T21859 | arg2Of | min,for |
| R17403 | T21861 | T21860 | arg1Of | min,10 |
| R17564 | T22043 | T22041 | arg1Of | Gene,Luciferase |
| R17565 | T22043 | T22042 | arg1Of | Gene,Reporter |
| R17566 | T22044 | T22043 | arg1Of | Assays,Gene |
| R17567 | T22048 | T22045 | arg1Of | assays,Luciferase |
| R17568 | T22048 | T22046 | arg1Of | assays,reporter |
| R17569 | T22048 | T22047 | arg1Of | assays,gene |
| R17570 | T22048 | T22049 | arg1Of | assays,were |
| R17571 | T22048 | T22050 | arg2Of | assays,performed |
| R17572 | T22050 | T22049 | arg2Of | performed,were |
| R17573 | T22050 | T22051 | arg1Of | performed,as |
| R17574 | T22053 | T22051 | arg2Of | described6,as |
| R17575 | T22053 | T22052 | arg1Of | described6,previously |
| R17576 | T22056 | T22057 | arg1Of | cells,were |
| R17577 | T22056 | T22058 | arg2Of | cells,cotransfected |
| R17578 | T22058 | T22054 | arg1Of | cotransfected,Briefly |
| R17579 | T22058 | T22055 | arg1Of | cotransfected,"," |
| R17580 | T22058 | T22057 | arg2Of | cotransfected,were |
| R17581 | T22058 | T22059 | arg1Of | cotransfected,at |
| R17582 | T22061 | T22059 | arg2Of | ratio,at |
| R17583 | T22061 | T22060 | arg1Of | ratio,a |
| R17584 | T22061 | T22062 | arg1Of | ratio,of |
| R17585 | T22061 | T22064 | arg1Of | ratio,: |
| R17586 | T22063 | T22062 | arg2Of | 10,of |
| R17587 | T22065 | T22064 | arg2Of | 1,: |
| R17588 | T22065 | T22066 | arg1Of | 1,with |
| R17589 | T22071 | T22066 | arg2Of | constructs,with |
| R17590 | T22071 | T22067 | arg1Of | constructs,various |
| R17591 | T22071 | T22068 | arg1Of | constructs,promoter-driven |
| R17592 | T22071 | T22069 | arg1Of | constructs,firefly |
| R17593 | T22071 | T22070 | arg1Of | constructs,luciferase |
| R17594 | T22071 | T22072 | arg1Of | constructs,to |
| R17595 | T22077 | T22072 | arg2Of | plasmid,to |
| R17596 | T22077 | T22073 | arg1Of | plasmid,the |
| R17597 | T22077 | T22074 | arg1Of | plasmid,Renilla |
| R17598 | T22077 | T22075 | arg1Of | plasmid,luciferase |
| R17599 | T22077 | T22076 | arg1Of | plasmid,pTKRL |
| R17600 | T22077 | T22078 | arg1Of | plasmid,"," |
| R17601 | T22077 | T22080 | arg1Of | plasmid,with |
| R17602 | T22080 | T22079 | arg1Of | with,together |
| R17603 | T22082 | T22080 | arg2Of | plasmids,with |
| R17604 | T22082 | T22081 | arg2Of | plasmids,indicated |
| R17605 | T22083 | T22084 | arg1Of | Cells,were |
| R17606 | T22083 | T22085 | arg2Of | Cells,cultured |
| R17607 | T22083 | T22091 | arg2Of | Cells,stimulated |
| R17608 | T22085 | T22086 | arg1Of | cultured,for |
| R17609 | T22085 | T22089 | arg1Of | cultured,and |
| R17610 | T22088 | T22086 | arg2Of | days,for |
| R17611 | T22088 | T22087 | arg1Of | days,1–2 |
| R17612 | T22089 | T22084 | arg2Of | and,were |
| R17613 | T22091 | T22089 | arg2Of | stimulated,and |
| R17614 | T22091 | T22090 | arg1Of | stimulated,then |
| R17615 | T22091 | T22092 | arg1Of | stimulated,in |
| R17616 | T22093 | T22092 | arg2Of | triplicate,in |
| R17617 | T22093 | T22094 | arg1Of | triplicate,before |
| R17618 | T22095 | T22094 | arg2Of | harvest,before |
| R17619 | T22096 | T22097 | arg1Of | Lysates,were |
| R17620 | T22096 | T22098 | arg2Of | Lysates,analyzed |
| R17621 | T22098 | T22097 | arg2Of | analyzed,were |
| R17622 | T22099 | T22098 | arg3Of | using,analyzed |
| R17623 | T22102 | T22099 | arg2Of | Kit,using |
| R17624 | T22102 | T22100 | arg1Of | Kit,the |
| R17625 | T22102 | T22101 | arg1Of | Kit,Dual-Luciferase |
| R17626 | T22102 | T22103 | arg1Of | Kit,( |
| R17627 | T22104 | T22103 | arg2Of | Promega,( |
| R17628 | T22105 | T22103 | arg3Of | ),( |
| R17699 | T22218 | T22217 | arg1Of | Immunoprecipitation,Chromatin |
| R17700 | T22218 | T22219 | arg1Of | Immunoprecipitation,( |
| R17701 | T22220 | T22219 | arg2Of | ChIP,( |
| R17702 | T22221 | T22219 | arg3Of | ),( |
| R17703 | T22223 | T22222 | arg1Of | assays,ChIP |
| R17704 | T22223 | T22224 | arg1Of | assays,was |
| R17705 | T22223 | T22225 | arg2Of | assays,performed |
| R17706 | T22225 | T22224 | arg2Of | performed,was |
| R17707 | T22225 | T22226 | arg1Of | performed,as |
| R17708 | T22228 | T22226 | arg2Of | described6,as |
| R17709 | T22228 | T22227 | arg1Of | described6,previously |
| R17710 | T22230 | T22231 | arg2Of | primers,used |
| R17711 | T22230 | T22249 | arg1Of | primers,as |
| R17712 | T22233 | T22231 | arg3Of | amplify,used |
| R17713 | T22233 | T22232 | arg1Of | amplify,to |
| R17714 | T22236 | T22233 | arg2Of | region,amplify |
| R17715 | T22236 | T22234 | arg1Of | region,the |
| R17716 | T22236 | T22235 | arg1Of | region,promoter |
| R17717 | T22236 | T22237 | arg1Of | region,adjacent |
| R17718 | T22237 | T22238 | arg1Of | adjacent,to |
| R17719 | T22241 | T22238 | arg2Of | sites,to |
| R17720 | T22241 | T22239 | arg1Of | sites,the |
| R17721 | T22241 | T22240 | arg1Of | sites,κB |
| R17722 | T22241 | T22242 | arg1Of | sites,of |
| R17723 | T22243 | T22244 | arg1Of | IL8,and |
| R17724 | T22244 | T22242 | arg2Of | and,of |
| R17725 | T22245 | T22244 | arg2Of | NFKBIA,and |
| R17726 | T22249 | T22229 | arg1Of | as,The |
| R17727 | T22249 | T22246 | arg1Of | as,"," |
| R17728 | T22249 | T22247 | arg1Of | as,as |
| R17729 | T22249 | T22248 | arg1Of | as,well |
| R17730 | T22249 | T22251 | arg1Of | as,have |
| R17731 | T22249 | T22252 | arg1Of | as,been |
| R17732 | T22250 | T22249 | arg2Of | ACTB,as |
| R17733 | T22252 | T22251 | arg2Of | been,have |
| R17734 | T22253 | T22252 | arg2Of | described6,been |
| R17778 | T22329 | T22328 | arg1Of | Microscopy,Immunofluorescence |
| R17779 | T22331 | T22330 | arg1Of | microscopy,Confocal |
| R17780 | T22331 | T22332 | arg1Of | microscopy,was |
| R17781 | T22331 | T22333 | arg2Of | microscopy,performed |
| R17782 | T22333 | T22332 | arg2Of | performed,was |
| R17783 | T22333 | T22334 | arg1Of | performed,as |
| R17784 | T22336 | T22334 | arg2Of | described6,as |
| R17785 | T22336 | T22335 | arg1Of | described6,previously |
| R17786 | T22339 | T22340 | arg1Of | cells,were |
| R17787 | T22339 | T22341 | arg2Of | cells,fixed |
| R17788 | T22341 | T22340 | arg2Of | fixed,were |
| R17789 | T22341 | T22342 | arg1Of | fixed,with |
| R17790 | T22341 | T22348 | arg1Of | fixed,and |
| R17791 | T22343 | T22344 | arg1Of | 4,% |
| R17792 | T22345 | T22342 | arg2Of | paraformaldehyde,with |
| R17793 | T22345 | T22343 | arg1Of | paraformaldehyde,4 |
| R17794 | T22345 | T22346 | arg1Of | paraformaldehyde,in |
| R17795 | T22347 | T22346 | arg2Of | PBS,in |
| R17796 | T22348 | T22337 | arg1Of | and,Briefly |
| R17797 | T22348 | T22338 | arg1Of | and,"," |
| R17798 | T22350 | T22351 | arg1Of | Cellspin,mounted |
| R17799 | T22351 | T22348 | arg2Of | mounted,and |
| R17800 | T22351 | T22349 | arg1Of | mounted,then |
| R17801 | T22351 | T22352 | arg1Of | mounted,onto |
| R17802 | T22353 | T22352 | arg2Of | slides,onto |
| R17803 | T22356 | T22354 | arg1Of | cells,The |
| R17804 | T22356 | T22355 | arg2Of | cells,fixed |
| R17805 | T22356 | T22357 | arg1Of | cells,were |
| R17806 | T22356 | T22359 | arg2Of | cells,permeabilized |
| R17807 | T22356 | T22368 | arg2Of | cells,stained |
| R17808 | T22359 | T22360 | arg1Of | permeabilized,with |
| R17809 | T22359 | T22367 | arg1Of | permeabilized,and |
| R17810 | T22364 | T22360 | arg2Of | X-100,with |
| R17811 | T22364 | T22361 | arg1Of | X-100,0.05 |
| R17812 | T22364 | T22362 | arg1Of | X-100,% |
| R17813 | T22364 | T22363 | arg1Of | X-100,Triton |
| R17814 | T22364 | T22365 | arg1Of | X-100,in |
| R17815 | T22366 | T22365 | arg2Of | PBS,in |
| R17816 | T22367 | T22357 | arg2Of | and,were |
| R17817 | T22367 | T22358 | arg1Of | and,then |
| R17818 | T22368 | T22367 | arg2Of | stained,and |
| R17819 | T22368 | T22369 | arg1Of | stained,with |
| R17820 | T22373 | T22369 | arg2Of | antibodies,with |
| R17821 | T22373 | T22370 | arg1Of | antibodies,FITC-conjugated |
| R17822 | T22373 | T22371 | arg1Of | antibodies,rabbit |
| R17823 | T22373 | T22372 | arg1Of | antibodies,anti-RPS3 |
| R17824 | T22373 | T22374 | arg1Of | antibodies,( |
| R17825 | T22376 | T22374 | arg2Of | Biotech,( |
| R17826 | T22376 | T22375 | arg1Of | Biotech,Primm |
| R17827 | T22377 | T22374 | arg3Of | ),( |
| R17828 | T22379 | T22378 | arg1Of | or,"," |
| R17829 | T22384 | T22379 | arg2Of | antibodies,or |
| R17830 | T22384 | T22380 | arg1Of | antibodies,AlexaFluor |
| R17831 | T22384 | T22381 | arg1Of | antibodies,594-conjugated |
| R17832 | T22384 | T22382 | arg1Of | antibodies,rat |
| R17833 | T22384 | T22383 | arg1Of | antibodies,anti-Flag |
| R17834 | T22384 | T22385 | arg1Of | antibodies,( |
| R17835 | T22385 | T22388 | arg1Of | (,for |
| R17836 | T22386 | T22385 | arg2Of | BD,( |
| R17837 | T22387 | T22385 | arg3Of | ),( |
| R17838 | T22390 | T22388 | arg2Of | min,for |
| R17839 | T22390 | T22389 | arg1Of | min,40 |
| R17840 | T22391 | T22392 | arg1Of | together,with |
| R17841 | T22394 | T22392 | arg2Of | μg/ml,with |
| R17842 | T22394 | T22393 | arg1Of | μg/ml,1 |
| R17843 | T22394 | T22395 | arg1Of | μg/ml,of |
| R17844 | T22394 | T22401 | arg1Of | μg/ml,for |
| R17845 | T22394 | T22404 | arg1Of | μg/ml,at |
| R17846 | T22396 | T22395 | arg2Of | Hoechst,of |
| R17847 | T22396 | T22397 | arg1Of | Hoechst,33342 |
| R17848 | T22396 | T22398 | arg1Of | Hoechst,( |
| R17849 | T22399 | T22398 | arg2Of | Sigma,( |
| R17850 | T22400 | T22398 | arg3Of | ),( |
| R17851 | T22403 | T22401 | arg2Of | min,for |
| R17852 | T22403 | T22402 | arg1Of | min,5 |
| R17853 | T22406 | T22404 | arg2Of | °C.,at |
| R17854 | T22406 | T22405 | arg1Of | °C.,25 |
| R17855 | T22408 | T22407 | arg1Of | slides,The |
| R17856 | T22408 | T22409 | arg1Of | slides,were |
| R17857 | T22408 | T22411 | arg2Of | slides,rinsed |
| R17858 | T22411 | T22409 | arg2Of | rinsed,were |
| R17859 | T22411 | T22410 | arg1Of | rinsed,then |
| R17860 | T22411 | T22412 | arg1Of | rinsed,with |
| R17861 | T22411 | T22416 | arg1Of | rinsed,and |
| R17862 | T22415 | T22412 | arg2Of | times,with |
| R17863 | T22415 | T22413 | arg1Of | times,PBS |
| R17864 | T22415 | T22414 | arg1Of | times,three |
| R17865 | T22417 | T22418 | arg1Of | cover,mounted |
| R17866 | T22418 | T22416 | arg2Of | mounted,and |
| R17867 | T22418 | T22419 | arg1Of | mounted,for |
| R17868 | T22421 | T22419 | arg2Of | microscopy,for |
| R17869 | T22421 | T22420 | arg1Of | microscopy,fluorescence |
| R17971 | T22550 | T22551 | arg1Of | Immunoprecipitation,and |
| R17972 | T22552 | T22551 | arg2Of | immunoblot,and |
| R17973 | T22554 | T22553 | arg1Of | cells,The |
| R17974 | T22554 | T22555 | arg1Of | cells,were |
| R17975 | T22554 | T22556 | arg2Of | cells,harvested |
| R17976 | T22554 | T22558 | arg2Of | cells,lysed |
| R17977 | T22556 | T22557 | arg1Of | harvested,and |
| R17978 | T22557 | T22555 | arg2Of | and,were |
| R17979 | T22558 | T22557 | arg2Of | lysed,and |
| R17980 | T22558 | T22559 | arg1Of | lysed,on |
| R17981 | T22558 | T22561 | arg1Of | lysed,by |
| R17982 | T22560 | T22559 | arg2Of | ice,on |
| R17983 | T22563 | T22561 | arg2Of | ml,by |
| R17984 | T22563 | T22562 | arg1Of | ml,0.4 |
| R17985 | T22563 | T22564 | arg1Of | ml,of |
| R17986 | T22568 | T22564 | arg2Of | buffer,of |
| R17987 | T22568 | T22565 | arg1Of | buffer,the |
| R17988 | T22568 | T22566 | arg2Of | buffer,modified |
| R17989 | T22568 | T22567 | arg1Of | buffer,RIPA |
| R17990 | T22568 | T22569 | arg1Of | buffer,( |
| R17991 | T22568 | T22606 | arg2Of | buffer,supplemented |
| R17992 | T22570 | T22571 | arg1Of | 50,mM |
| R17993 | T22572 | T22570 | arg1Of | Tris-HCl,50 |
| R17994 | T22572 | T22573 | arg1Of | Tris-HCl,[ |
| R17995 | T22572 | T22577 | arg1Of | Tris-HCl,"," |
| R17996 | T22574 | T22573 | arg2Of | pH,[ |
| R17997 | T22574 | T22575 | arg1Of | pH,7.4 |
| R17998 | T22576 | T22573 | arg3Of | ],[ |
| R17999 | T22577 | T22569 | arg2Of | ",",( |
| R18000 | T22577 | T22581 | arg1Of | ",","," |
| R18001 | T22578 | T22579 | arg1Of | 1,% |
| R18002 | T22580 | T22577 | arg2Of | NP-40,"," |
| R18003 | T22580 | T22578 | arg1Of | NP-40,1 |
| R18004 | T22582 | T22583 | arg1Of | 0.25,% |
| R18005 | T22582 | T22584 | arg1Of | 0.25,Na-deoxycholate |
| R18006 | T22582 | T22585 | arg1Of | 0.25,"," |
| R18007 | T22586 | T22585 | arg2Of | 150,"," |
| R18008 | T22586 | T22587 | arg1Of | 150,mM |
| R18009 | T22588 | T22582 | arg1Of | NaCl,0.25 |
| R18010 | T22588 | T22586 | arg1Of | NaCl,150 |
| R18011 | T22588 | T22589 | arg1Of | NaCl,"," |
| R18012 | T22589 | T22593 | arg1Of | ",","," |
| R18013 | T22590 | T22591 | arg1Of | 1,mM |
| R18014 | T22592 | T22589 | arg2Of | EDTA,"," |
| R18015 | T22592 | T22590 | arg1Of | EDTA,1 |
| R18016 | T22593 | T22597 | arg1Of | ",","," |
| R18017 | T22594 | T22595 | arg1Of | 1,mM |
| R18018 | T22596 | T22593 | arg2Of | PMSF,"," |
| R18019 | T22596 | T22594 | arg1Of | PMSF,1 |
| R18020 | T22597 | T22601 | arg1Of | ",","," |
| R18021 | T22598 | T22599 | arg1Of | 1,mM |
| R18022 | T22600 | T22597 | arg2Of | Na3VO4,"," |
| R18023 | T22600 | T22598 | arg1Of | Na3VO4,1 |
| R18024 | T22601 | T22581 | arg2Of | ",","," |
| R18025 | T22602 | T22603 | arg1Of | 1,mM |
| R18026 | T22604 | T22601 | arg2Of | NaF,"," |
| R18027 | T22604 | T22602 | arg1Of | NaF,1 |
| R18028 | T22605 | T22569 | arg3Of | ),( |
| R18029 | T22606 | T22607 | arg1Of | supplemented,with |
| R18030 | T22606 | T22628 | arg1Of | supplemented,for |
| R18031 | T22612 | T22608 | arg1Of | cocktail,1 |
| R18032 | T22612 | T22609 | arg1Of | cocktail,× |
| R18033 | T22612 | T22610 | arg1Of | cocktail,protease |
| R18034 | T22612 | T22611 | arg1Of | cocktail,inhibitor |
| R18035 | T22612 | T22613 | arg1Of | cocktail,( |
| R18036 | T22612 | T22616 | arg1Of | cocktail,and |
| R18037 | T22614 | T22613 | arg2Of | Roche,( |
| R18038 | T22615 | T22613 | arg3Of | ),( |
| R18039 | T22616 | T22607 | arg2Of | and,with |
| R18040 | T22617 | T22618 | arg1Of | 1,× |
| R18041 | T22619 | T22618 | arg2Of | phosphatase,× |
| R18042 | T22622 | T22616 | arg2Of | set,and |
| R18043 | T22622 | T22617 | arg1Of | set,1 |
| R18044 | T22622 | T22619 | arg1Of | set,phosphatase |
| R18045 | T22622 | T22620 | arg1Of | set,inhibitor |
| R18046 | T22622 | T22621 | arg1Of | set,cocktail |
| R18047 | T22622 | T22623 | arg1Of | set,I |
| R18048 | T22622 | T22624 | arg1Of | set,( |
| R18049 | T22626 | T22624 | arg2Of | Biosciences,( |
| R18050 | T22626 | T22625 | arg1Of | Biosciences,EMD |
| R18051 | T22627 | T22624 | arg3Of | ),( |
| R18052 | T22630 | T22628 | arg2Of | min,for |
| R18053 | T22630 | T22629 | arg1Of | min,30 |
| R18054 | T22632 | T22631 | arg1Of | lysates,The |
| R18055 | T22632 | T22633 | arg1Of | lysates,were |
| R18056 | T22632 | T22634 | arg2Of | lysates,centrifuged |
| R18057 | T22634 | T22633 | arg2Of | centrifuged,were |
| R18058 | T22634 | T22635 | arg1Of | centrifuged,at |
| R18059 | T22638 | T22635 | arg2Of | g,at |
| R18060 | T22638 | T22636 | arg1Of | g,"10,000" |
| R18061 | T22638 | T22637 | arg1Of | g,× |
| R18062 | T22638 | T22639 | arg1Of | g,at |
| R18063 | T22638 | T22642 | arg1Of | g,for |
| R18064 | T22641 | T22639 | arg2Of | °C,at |
| R18065 | T22641 | T22640 | arg1Of | °C,4 |
| R18066 | T22644 | T22642 | arg2Of | min,for |
| R18067 | T22644 | T22643 | arg1Of | min,10 |
| R18068 | T22644 | T22646 | arg1Of | min,remove |
| R18069 | T22646 | T22642 | arg3Of | remove,for |
| R18070 | T22646 | T22645 | arg1Of | remove,to |
| R18071 | T22648 | T22646 | arg2Of | material,remove |
| R18072 | T22648 | T22647 | arg1Of | material,insoluble |
| R18073 | T22650 | T22649 | arg2Of | normalizing,After |
| R18074 | T22652 | T22650 | arg2Of | concentrations,normalizing |
| R18075 | T22652 | T22651 | arg1Of | concentrations,protein |
| R18076 | T22654 | T22650 | arg1Of | lysates,normalizing |
| R18077 | T22654 | T22655 | arg1Of | lysates,were |
| R18078 | T22654 | T22656 | arg2Of | lysates,subjected |
| R18079 | T22654 | T22660 | arg1Of | lysates,adding |
| R18080 | T22654 | T22676 | arg2Of | lysates,rotated |
| R18081 | T22656 | T22657 | arg1Of | subjected,to |
| R18082 | T22656 | T22659 | arg1Of | subjected,by |
| R18083 | T22656 | T22675 | arg1Of | subjected,and |
| R18084 | T22658 | T22657 | arg2Of | immunoprecipitation,to |
| R18085 | T22660 | T22659 | arg2Of | adding,by |
| R18086 | T22660 | T22671 | arg1Of | adding,( |
| R18087 | T22664 | T22661 | arg1Of | antibody,10 |
| R18088 | T22664 | T22662 | arg1Of | antibody,mg/ml |
| R18089 | T22664 | T22663 | arg1Of | antibody,appropriate |
| R18090 | T22664 | T22665 | arg1Of | antibody,plus |
| R18091 | T22665 | T22660 | arg2Of | plus,adding |
| R18092 | T22667 | T22665 | arg2Of | ml,plus |
| R18093 | T22667 | T22666 | arg1Of | ml,30 |
| R18094 | T22667 | T22668 | arg1Of | ml,of |
| R18095 | T22670 | T22668 | arg2Of | G-agarose,of |
| R18096 | T22670 | T22669 | arg1Of | G-agarose,protein |
| R18097 | T22672 | T22671 | arg2Of | Roche,( |
| R18098 | T22673 | T22671 | arg3Of | ),( |
| R18099 | T22675 | T22649 | arg1Of | and,After |
| R18100 | T22675 | T22653 | arg1Of | and,"," |
| R18101 | T22675 | T22655 | arg2Of | and,were |
| R18102 | T22675 | T22674 | arg1Of | and,"," |
| R18103 | T22676 | T22675 | arg2Of | rotated,and |
| R18104 | T22676 | T22677 | arg1Of | rotated,for |
| R18105 | T22676 | T22691 | arg1Of | rotated,times |
| R18106 | T22680 | T22678 | arg1Of | 2,at |
| R18107 | T22680 | T22679 | arg1Of | 2,least |
| R18108 | T22681 | T22677 | arg2Of | h,for |
| R18109 | T22681 | T22680 | arg1Of | h,2 |
| R18110 | T22681 | T22682 | arg1Of | h,at |
| R18111 | T22683 | T22682 | arg2Of | 4°C.,at |
| R18112 | T22683 | T22686 | modOf | 4°C.,were |
| R18113 | T22685 | T22684 | arg1Of | precipitates,The |
| R18114 | T22685 | T22686 | arg1Of | precipitates,were |
| R18115 | T22685 | T22687 | arg2Of | precipitates,washed |
| R18116 | T22687 | T22686 | arg2Of | washed,were |
| R18117 | T22690 | T22688 | arg1Of | five,at |
| R18118 | T22690 | T22689 | arg1Of | five,least |
| R18119 | T22691 | T22690 | arg1Of | times,five |
| R18120 | T22691 | T22692 | arg1Of | times,with |
| R18121 | T22695 | T22692 | arg2Of | buffer,with |
| R18122 | T22695 | T22693 | arg1Of | buffer,cold |
| R18123 | T22695 | T22694 | arg1Of | buffer,lysis |
| R18124 | T22695 | T22696 | arg2Of | buffer,followed |
| R18125 | T22696 | T22697 | arg1Of | followed,by |
| R18126 | T22696 | T22701 | arg1Of | followed,under |
| R18127 | T22698 | T22697 | arg2Of | separation,by |
| R18128 | T22700 | T22696 | arg1Of | SDS-PAGE,followed |
| R18129 | T22700 | T22699 | arg2Of | SDS-PAGE,by |
| R18130 | T22705 | T22701 | arg2Of | conditions,under |
| R18131 | T22705 | T22702 | arg2Of | conditions,reduced |
| R18132 | T22705 | T22703 | arg1Of | conditions,and |
| R18133 | T22705 | T22704 | arg1Of | conditions,denaturing |
| R18134 | T22707 | T22706 | arg1Of | membranes,Nitrocellulose |
| R18135 | T22707 | T22708 | arg1Of | membranes,were |
| R18136 | T22707 | T22709 | arg2Of | membranes,blocked |
| R18137 | T22709 | T22708 | arg2Of | blocked,were |
| R18138 | T22709 | T22710 | arg1Of | blocked,in |
| R18139 | T22711 | T22712 | arg1Of | 5,% |
| R18140 | T22714 | T22710 | arg2Of | milk,in |
| R18141 | T22714 | T22711 | arg1Of | milk,5 |
| R18142 | T22714 | T22713 | arg1Of | milk,nonfat |
| R18143 | T22714 | T22715 | arg1Of | milk,in |
| R18144 | T22716 | T22717 | arg1Of | 0.1,% |
| R18145 | T22719 | T22715 | arg2Of | 20,in |
| R18146 | T22719 | T22716 | arg1Of | 20,0.1 |
| R18147 | T22719 | T22718 | arg1Of | 20,PBS-Tween |
| R18148 | T22719 | T22720 | arg1Of | 20,( |
| R18149 | T22719 | T22723 | arg1Of | 20,"," |
| R18150 | T22719 | T22724 | arg2Of | 20,probed |
| R18151 | T22721 | T22720 | arg2Of | PBS-T,( |
| R18152 | T22722 | T22720 | arg3Of | ),( |
| R18153 | T22724 | T22725 | arg1Of | probed,with |
| R18154 | T22727 | T22725 | arg2Of | antibodies,with |
| R18155 | T22727 | T22726 | arg1Of | antibodies,specific |
| R18156 | T22727 | T22728 | arg1Of | antibodies,as |
| R18157 | T22730 | T22728 | arg2Of | previously6,as |
| R18158 | T22730 | T22729 | arg2Of | previously6,described |
| R18159 | T22732 | T22731 | arg2Of | immunoblotting,For |
| R18160 | T22732 | T22733 | arg1Of | immunoblotting,of |
| R18161 | T22735 | T22733 | arg2Of | proteins,of |
| R18162 | T22735 | T22734 | arg2Of | proteins,phosphorylated |
| R18163 | T22737 | T22738 | arg1Of | gels,were |
| R18164 | T22737 | T22739 | arg2Of | gels,transferred |
| R18165 | T22737 | T22751 | arg1Of | gels,dried |
| R18166 | T22739 | T22738 | arg2Of | transferred,were |
| R18167 | T22739 | T22740 | arg1Of | transferred,to |
| R18168 | T22739 | T22750 | arg1Of | transferred,and |
| R18169 | T22744 | T22740 | arg2Of | membranes,to |
| R18170 | T22744 | T22741 | arg1Of | membranes,methanol-treated |
| R18171 | T22744 | T22742 | arg1Of | membranes,polyvinylidene |
| R18172 | T22744 | T22743 | arg1Of | membranes,chloride |
| R18173 | T22744 | T22745 | arg1Of | membranes,"," |
| R18174 | T22744 | T22746 | arg2Of | membranes,retreated |
| R18175 | T22746 | T22747 | arg1Of | retreated,with |
| R18176 | T22748 | T22747 | arg2Of | methanol,with |
| R18177 | T22750 | T22731 | arg1Of | and,For |
| R18178 | T22750 | T22736 | arg1Of | and,"," |
| R18179 | T22750 | T22749 | arg1Of | and,"," |
| R18180 | T22751 | T22750 | arg2Of | dried,and |
| R18181 | T22751 | T22752 | arg1Of | dried,for |
| R18182 | T22754 | T22752 | arg2Of | min,for |
| R18183 | T22754 | T22753 | arg1Of | min,30 |
| R18184 | T22755 | T22756 | arg1Of | Blots,were |
| R18185 | T22755 | T22757 | arg2Of | Blots,blocked |
| R18186 | T22755 | T22776 | arg2Of | Blots,probed |
| R18187 | T22757 | T22758 | arg1Of | blocked,in |
| R18188 | T22757 | T22764 | arg1Of | blocked,in |
| R18189 | T22757 | T22770 | arg1Of | blocked,20 |
| R18190 | T22757 | T22775 | arg1Of | blocked,and |
| R18191 | T22759 | T22760 | arg1Of | 5,% |
| R18192 | T22763 | T22758 | arg2Of | albumin,in |
| R18193 | T22763 | T22759 | arg1Of | albumin,5 |
| R18194 | T22763 | T22761 | arg1Of | albumin,bovine |
| R18195 | T22763 | T22762 | arg1Of | albumin,serum |
| R18196 | T22766 | T22764 | arg2Of | %,in |
| R18197 | T22766 | T22765 | arg1Of | %,0.1 |
| R18198 | T22766 | T22768 | arg2Of | %,buffered |
| R18199 | T22767 | T22768 | arg1Of | Tris,buffered |
| R18200 | T22770 | T22769 | arg1Of | 20,saline-Tween |
| R18201 | T22770 | T22771 | arg1Of | 20,( |
| R18202 | T22772 | T22771 | arg2Of | TBS-T,( |
| R18203 | T22773 | T22771 | arg3Of | ),( |
| R18204 | T22775 | T22756 | arg2Of | and,were |
| R18205 | T22775 | T22774 | arg1Of | and,"," |
| R18206 | T22776 | T22775 | arg2Of | probed,and |
| R18207 | T22776 | T22777 | arg1Of | probed,with |
| R18208 | T22776 | T22780 | arg1Of | probed,as |
| R18209 | T22779 | T22777 | arg2Of | antibodies,with |
| R18210 | T22779 | T22778 | arg1Of | antibodies,specific |
| R18211 | T22782 | T22780 | arg2Of | previously46,as |
| R18212 | T22782 | T22781 | arg2Of | previously46,described |
| R18213 | T22783 | T22784 | arg1Of | Bands,were |
| R18214 | T22783 | T22785 | arg2Of | Bands,imaged |
| R18215 | T22785 | T22784 | arg2Of | imaged,were |
| R18216 | T22785 | T22794 | arg1Of | imaged,according |
| R18217 | T22790 | T22785 | arg1Of | system,imaged |
| R18218 | T22790 | T22786 | arg2Of | system,by |
| R18219 | T22790 | T22787 | arg1Of | system,the |
| R18220 | T22790 | T22788 | arg1Of | system,Super |
| R18221 | T22790 | T22789 | arg1Of | system,Signaling |
| R18222 | T22790 | T22791 | arg1Of | system,( |
| R18223 | T22792 | T22791 | arg2Of | Pierce,( |
| R18224 | T22793 | T22791 | arg3Of | ),( |
| R18225 | T22795 | T22794 | arg2Of | to,according |
| R18226 | T22797 | T22796 | arg1Of | manufacturer,the |
| R18227 | T22797 | T22798 | arg2Of | manufacturer,'s |
| R18228 | T22799 | T22795 | arg2Of | instructions,to |
| R18229 | T22799 | T22798 | arg1Of | instructions,'s |
| R18491 | T23107 | T23106 | arg1Of | amount,The |
| R18492 | T23107 | T23108 | arg1Of | amount,of |
| R18493 | T23107 | T23110 | arg1Of | amount,present |
| R18494 | T23107 | T23118 | arg1Of | amount,was |
| R18495 | T23107 | T23119 | arg2Of | amount,measured |
| R18496 | T23109 | T23108 | arg2Of | IL-8,of |
| R18497 | T23110 | T23111 | arg1Of | present,in |
| R18498 | T23112 | T23111 | arg2Of | supernatants,in |
| R18499 | T23112 | T23113 | arg2Of | supernatants,collected |
| R18500 | T23113 | T23114 | arg1Of | collected,from |
| R18501 | T23117 | T23114 | arg2Of | culture,from |
| R18502 | T23117 | T23115 | arg1Of | culture,Jurkat |
| R18503 | T23117 | T23116 | arg1Of | culture,cell |
| R18504 | T23119 | T23118 | arg2Of | measured,was |
| R18505 | T23120 | T23119 | arg3Of | using,measured |
| R18506 | T23120 | T23130 | arg1Of | using,according |
| R18507 | T23126 | T23120 | arg2Of | kit,using |
| R18508 | T23126 | T23121 | arg1Of | kit,a |
| R18509 | T23126 | T23122 | arg1Of | kit,Human |
| R18510 | T23126 | T23123 | arg1Of | kit,Interleukin-8 |
| R18511 | T23126 | T23124 | arg1Of | kit,ELISA |
| R18512 | T23126 | T23125 | arg1Of | kit,Ready-SET-Go |
| R18513 | T23126 | T23127 | arg1Of | kit,( |
| R18514 | T23128 | T23127 | arg2Of | eBioscience,( |
| R18515 | T23129 | T23127 | arg3Of | ),( |
| R18516 | T23131 | T23130 | arg2Of | to,according |
| R18517 | T23133 | T23132 | arg1Of | manufacturer,the |
| R18518 | T23133 | T23134 | arg2Of | manufacturer,'s |
| R18519 | T23135 | T23131 | arg2Of | instructions,to |
| R18520 | T23135 | T23134 | arg1Of | instructions,'s |
| R18553 | T23196 | T23195 | arg1Of | Infections,Cell |
| R18554 | T23198 | T23197 | arg1Of | cells,HeLa |
| R18555 | T23198 | T23199 | arg1Of | cells,were |
| R18556 | T23198 | T23200 | arg2Of | cells,infected |
| R18557 | T23200 | T23199 | arg2Of | infected,were |
| R18558 | T23200 | T23201 | arg1Of | infected,with |
| R18559 | T23200 | T23205 | arg1Of | infected,: |
| R18560 | T23204 | T23201 | arg2Of | O157,with |
| R18561 | T23204 | T23202 | arg1Of | O157,E. |
| R18562 | T23204 | T23203 | arg1Of | O157,coli |
| R18563 | T23205 | T23211 | arg1Of | :,as |
| R18564 | T23206 | T23207 | arg1Of | H7,or |
| R18565 | T23207 | T23205 | arg2Of | or,: |
| R18566 | T23210 | T23207 | arg2Of | strains,or |
| R18567 | T23210 | T23208 | arg1Of | strains,C. |
| R18568 | T23210 | T23209 | arg1Of | strains,rodentium |
| R18569 | T23213 | T23211 | arg2Of | previously9,as |
| R18570 | T23213 | T23212 | arg2Of | previously9,described |
| R18591 | T23245 | T23244 | arg1Of | piglets,Gnotobiotic |
| R18592 | T23245 | T23246 | arg1Of | piglets,were |
| R18593 | T23245 | T23247 | arg2Of | piglets,infected |
| R18594 | T23247 | T23246 | arg2Of | infected,were |
| R18595 | T23247 | T23248 | arg1Of | infected,with |
| R18596 | T23247 | T23255 | arg1Of | infected,as |
| R18597 | T23251 | T23249 | arg1Of | O157,E. |
| R18598 | T23251 | T23250 | arg1Of | O157,coli |
| R18599 | T23251 | T23252 | arg1Of | O157,: |
| R18600 | T23252 | T23248 | arg2Of | :,with |
| R18601 | T23254 | T23252 | arg2Of | strains,: |
| R18602 | T23254 | T23253 | arg1Of | strains,H7 |
| R18603 | T23257 | T23255 | arg2Of | previously9,as |
| R18604 | T23257 | T23256 | arg2Of | previously9,described |
| R18605 | T23260 | T23258 | arg1Of | specimens,Spiral |
| R18606 | T23260 | T23259 | arg1Of | specimens,colon |
| R18607 | T23260 | T23261 | arg1Of | specimens,were |
| R18608 | T23260 | T23262 | arg2Of | specimens,collected |
| R18609 | T23260 | T23266 | arg2Of | specimens,embedded |
| R18610 | T23262 | T23263 | arg1Of | collected,at |
| R18611 | T23262 | T23265 | arg1Of | collected,and |
| R18612 | T23264 | T23263 | arg2Of | necropsy,at |
| R18613 | T23265 | T23261 | arg2Of | and,were |
| R18614 | T23266 | T23265 | arg2Of | embedded,and |
| R18615 | T23266 | T23267 | arg1Of | embedded,in |
| R18616 | T23268 | T23267 | arg2Of | paraffin,in |
| R18617 | T23270 | T23269 | arg1Of | sectioning,Paraffin |
| R18618 | T23270 | T23271 | arg1Of | sectioning,and |
| R18619 | T23271 | T23274 | arg1Of | and,using |
| R18620 | T23271 | T23277 | arg1Of | and,were |
| R18621 | T23271 | T23278 | arg2Of | and,performed |
| R18622 | T23273 | T23271 | arg2Of | staining,and |
| R18623 | T23273 | T23272 | arg1Of | staining,immunohistochemical |
| R18624 | T23276 | T23274 | arg2Of | antibody,using |
| R18625 | T23276 | T23275 | arg1Of | antibody,phospho-RPS3 |
| R18626 | T23278 | T23277 | arg2Of | performed,were |
| R18627 | T23281 | T23278 | arg1Of | Inc,performed |
| R18628 | T23281 | T23279 | arg2Of | Inc,by |
| R18629 | T23281 | T23280 | arg1Of | Inc,Histoserv |
| R4098 | T5170 | T5169 | arg1Of | import,nuclear |
| R4099 | T5170 | T5171 | arg1Of | import,of |
| R16692 | T21003 | T21002 | arg2Of | IKKα,and |
| R16693 | T21004 | T21003 | arg1Of | proteins,IKKα |
bionlp-st-ge-2016-coref
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T9792 | 14850-14860 | Antecedent | denotes | attraction |
| T15644 | 23400-23402 | Anaphor | denotes | it |
| T15645 | 23316-23320 | Antecedent | denotes | RPS3 |
| T7631 | 11710-11725 | Anaphor | denotes | phosphorylation |
| T18775 | 24360-24363 | Anaphor | denotes | its |
| T18776 | 24287-24291 | Antecedent | denotes | RPS3 |
| T18777 | 24865-24885 | Anaphor | denotes | this phosphorylation |
| T18778 | 24835-24849 | Antecedent | denotes | phosphorylated |
| T18779 | 26061-26064 | Anaphor | denotes | its |
| T18780 | 26024-26028 | Antecedent | denotes | RPS3 |
| T7632 | 11689-11704 | Antecedent | denotes | phosphorylation |
| T5565 | 6887-6890 | Anaphor | denotes | its |
| T5566 | 6825-6829 | Antecedent | denotes | RPS3 |
| T12385 | 17601-17604 | Anaphor | denotes | its |
| T12386 | 17576-17580 | Antecedent | denotes | RPS3 |
| T15640 | 20398-20400 | Anaphor | denotes | do |
| T15641 | 20316-20323 | Antecedent | denotes | reduced |
| T15642 | 21727-21746 | Anaphor | denotes | inhibitory activity |
| T15643 | 21665-21670 | Antecedent | denotes | block |
| T9789 | 14754-14756 | Anaphor | denotes | it |
| T9790 | 14704-14709 | Antecedent | denotes | S209A |
| T9791 | 15114-15129 | Anaphor | denotes | the recruitment |
| R6124 | T7631 | T7632 | boundBy | phosphorylation,phosphorylation |
| R15047 | T18775 | T18776 | boundBy | its,RPS3 |
| R15048 | T18777 | T18778 | boundBy | this phosphorylation,phosphorylated |
| R15049 | T18779 | T18780 | boundBy | its,RPS3 |
| R10013 | T12385 | T12386 | boundBy | its,RPS3 |
| R4495 | T5565 | T5566 | boundBy | its,RPS3 |
| R12627 | T15640 | T15641 | boundBy | do,reduced |
| R12628 | T15642 | T15643 | boundBy | inhibitory activity,block |
| R12629 | T15644 | T15645 | boundBy | it,RPS3 |
| R7911 | T9789 | T9790 | boundBy | it,S209A |
| R7912 | T9791 | T9792 | boundBy | the recruitment,attraction |
bionlp-st-ge-2016-spacy-parsed
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T284 | 234-238 | WDT | denotes | that |
| T285 | 239-246 | VBZ | denotes | directs |
| T286 | 247-255 | JJ | denotes | specific |
| T287 | 256-260 | NN | denotes | gene |
| T288 | 261-274 | NN | denotes | transcription |
| T289 | 274-275 | . | denotes | . |
| T290 | 276-283 | RB | denotes | However |
| T291 | 283-284 | , | denotes | , |
| T292 | 285-287 | PRP | denotes | it |
| T293 | 288-290 | VBZ | denotes | is |
| T294 | 291-298 | JJ | denotes | unknown |
| T295 | 299-302 | WRB | denotes | how |
| T296 | 303-307 | JJ | denotes | RPS3 |
| T297 | 308-315 | JJ | denotes | nuclear |
| T298 | 316-329 | NN | denotes | translocation |
| T299 | 330-332 | VBZ | denotes | is |
| T300 | 333-342 | VBN | denotes | regulated |
| T301 | 342-343 | . | denotes | . |
| T302 | 344-348 | RB | denotes | Here |
| T303 | 349-351 | PRP | denotes | we |
| T304 | 352-358 | VBP | denotes | report |
| T305 | 359-363 | IN | denotes | that |
| T306 | 364-368 | NNP | denotes | IKKβ |
| T307 | 369-384 | NN | denotes | phosphorylation |
| T308 | 385-387 | IN | denotes | of |
| T309 | 388-394 | NN | denotes | serine |
| T310 | 395-398 | CD | denotes | 209 |
| T311 | 399-400 | -LRB- | denotes | ( |
| T312 | 400-404 | CD | denotes | S209 |
| T313 | 404-405 | -RRB- | denotes | ) |
| T314 | 406-409 | VBD | denotes | was |
| T315 | 410-417 | JJ | denotes | crucial |
| T316 | 418-421 | IN | denotes | for |
| T317 | 422-426 | JJ | denotes | RPS3 |
| T318 | 427-434 | JJ | denotes | nuclear |
| T319 | 435-447 | NN | denotes | localization |
| T320 | 448-450 | IN | denotes | in |
| T321 | 451-459 | NN | denotes | response |
| T322 | 460-462 | TO | denotes | to |
| T323 | 463-473 | VBG | denotes | activating |
| T324 | 474-481 | NNS | denotes | stimuli |
| T325 | 481-482 | . | denotes | . |
| T326 | 483-491 | RB | denotes | Moreover |
| T327 | 491-492 | , | denotes | , |
| T328 | 493-496 | DT | denotes | the |
| T329 | 497-506 | NN | denotes | foodborne |
| T330 | 507-515 | NN | denotes | pathogen |
| T331 | 516-527 | NNP | denotes | Escherichia |
| T332 | 528-532 | NNS | denotes | coli |
| T333 | 533-537 | NNP | denotes | O157 |
| T334 | 537-538 | : | denotes | : |
| T335 | 538-540 | NNP | denotes | H7 |
| T336 | 541-550 | NN | denotes | virulence |
| T337 | 551-558 | NN | denotes | protein |
| T338 | 559-564 | NNP | denotes | NleH1 |
| T339 | 565-577 | RB | denotes | specifically |
| T340 | 578-587 | VBD | denotes | inhibited |
| T341 | 588-592 | NNP | denotes | RPS3 |
| T342 | 593-597 | NNP | denotes | S209 |
| T343 | 598-613 | NN | denotes | phosphorylation |
| T344 | 614-617 | CC | denotes | and |
| T345 | 618-625 | VBD | denotes | blocked |
| T346 | 626-630 | CD | denotes | RPS3 |
| T347 | 631-639 | NN | denotes | function |
| T348 | 639-640 | , | denotes | , |
| T349 | 641-648 | RB | denotes | thereby |
| T350 | 649-658 | VBG | denotes | promoting |
| T351 | 659-668 | JJ | denotes | bacterial |
| T352 | 669-681 | NN | denotes | colonization |
| T353 | 682-685 | CC | denotes | and |
| T354 | 686-694 | NN | denotes | diarrhea |
| T355 | 695-698 | CC | denotes | but |
| T356 | 699-709 | VBG | denotes | decreasing |
| T357 | 710-719 | NN | denotes | mortality |
| T358 | 720-722 | IN | denotes | in |
| T359 | 723-724 | DT | denotes | a |
| T360 | 725-736 | JJ | denotes | gnotobiotic |
| T361 | 737-743 | NN | denotes | piglet |
| T362 | 744-753 | NN | denotes | infection |
| T363 | 754-759 | NN | denotes | model |
| T364 | 759-760 | . | denotes | . |
| T365 | 761-765 | RB | denotes | Thus |
| T366 | 765-766 | , | denotes | , |
| T367 | 767-770 | DT | denotes | the |
| T368 | 771-785 | JJ | denotes | IKKβ-dependent |
| T369 | 786-798 | NN | denotes | modification |
| T370 | 799-801 | IN | denotes | of |
| T371 | 802-803 | DT | denotes | a |
| T372 | 804-812 | JJ | denotes | specific |
| T373 | 813-818 | JJ | denotes | amino |
| T374 | 819-823 | NN | denotes | acid |
| T375 | 824-826 | IN | denotes | in |
| T376 | 827-831 | CD | denotes | RPS3 |
| T377 | 832-840 | VBZ | denotes | promotes |
| T378 | 841-849 | JJ | denotes | specific |
| T379 | 850-855 | NN | denotes | NF-κB |
| T380 | 856-865 | NNS | denotes | functions |
| T381 | 866-870 | WDT | denotes | that |
| T382 | 871-879 | VBP | denotes | underlie |
| T383 | 880-883 | DT | denotes | the |
| T384 | 884-893 | JJ | denotes | molecular |
| T385 | 894-906 | JJ | denotes | pathogenetic |
| T386 | 907-917 | NNS | denotes | mechanisms |
| T387 | 918-920 | IN | denotes | of |
| T388 | 921-923 | NNP | denotes | E. |
| T389 | 924-928 | NNS | denotes | coli |
| T390 | 929-933 | NNP | denotes | O157 |
| T391 | 933-934 | : | denotes | : |
| T392 | 934-936 | NNP | denotes | H7 |
| T393 | 936-937 | . | denotes | . |
| T1161 | 939-946 | NNP | denotes | Nuclear |
| T1162 | 947-959 | NNP | denotes | Factor-kappa |
| T1163 | 960-961 | NNP | denotes | B |
| T1164 | 962-963 | -LRB- | denotes | ( |
| T1165 | 963-968 | NNP | denotes | NF-κB |
| T1166 | 968-969 | -RRB- | denotes | ) |
| T1167 | 970-979 | VBZ | denotes | regulates |
| T1168 | 980-987 | JJ | denotes | crucial |
| T1169 | 988-996 | JJ | denotes | cellular |
| T1170 | 997-1006 | NNS | denotes | functions |
| T1171 | 1007-1010 | CC | denotes | and |
| T1172 | 1011-1018 | JJ | denotes | diverse |
| T1173 | 1019-1026 | NNS | denotes | stimuli |
| T1174 | 1027-1035 | VBP | denotes | activate |
| T1175 | 1036-1040 | DT | denotes | this |
| T1176 | 1041-1052 | JJ | denotes | pleiotropic |
| T1177 | 1053-1066 | NN | denotes | transcription |
| T1178 | 1067-1073 | NN | denotes | factor |
| T1179 | 1073-1074 | , | denotes | , |
| T1180 | 1075-1080 | WDT | denotes | which |
| T1181 | 1081-1083 | IN | denotes | in |
| T1182 | 1084-1088 | NN | denotes | turn |
| T1183 | 1089-1098 | VBZ | denotes | regulates |
| T1184 | 1099-1100 | DT | denotes | a |
| T1185 | 1101-1105 | JJ | denotes | vast |
| T1186 | 1106-1111 | NN | denotes | array |
| T1187 | 1112-1114 | IN | denotes | of |
| T1188 | 1115-1122 | JJ | denotes | genetic |
| T1189 | 1123-1133 | JJ | denotes | targets1-3 |
| T1190 | 1133-1134 | . | denotes | . |
| T1191 | 1135-1138 | DT | denotes | The |
| T1192 | 1139-1149 | JJ | denotes | best-known |
| T1193 | 1150-1159 | JJ | denotes | mammalian |
| T1194 | 1160-1165 | NN | denotes | NF-κB |
| T1195 | 1166-1174 | NNS | denotes | subunits |
| T1196 | 1175-1178 | VBP | denotes | are |
| T1197 | 1179-1182 | NNP | denotes | Rel |
| T1198 | 1183-1191 | NNS | denotes | proteins |
| T1199 | 1191-1192 | , | denotes | , |
| T1200 | 1193-1202 | VBG | denotes | including |
| T1201 | 1203-1207 | NNP | denotes | RelA |
| T1202 | 1208-1209 | -LRB- | denotes | ( |
| T1203 | 1209-1212 | NNS | denotes | p65 |
| T1204 | 1212-1213 | -RRB- | denotes | ) |
| T1205 | 1213-1214 | , | denotes | , |
| T1206 | 1215-1219 | NNP | denotes | RelB |
| T1207 | 1219-1220 | , | denotes | , |
| T1208 | 1221-1226 | NNP | denotes | c-Rel |
| T1209 | 1226-1227 | , | denotes | , |
| T1210 | 1228-1231 | CD | denotes | p50 |
| T1211 | 1231-1232 | , | denotes | , |
| T1212 | 1233-1236 | CC | denotes | and |
| T1213 | 1237-1240 | CD | denotes | p52 |
| T1214 | 1241-1242 | -LRB- | denotes | ( |
| T1215 | 1242-1246 | NNS | denotes | refs |
| T1216 | 1246-1247 | . | denotes | . |
| T1217 | 1248-1252 | CD | denotes | 4, 5 |
| T1218 | 1252-1253 | -RRB- | denotes | ) |
| T1219 | 1253-1254 | . | denotes | . |
| T1220 | 1255-1262 | RB | denotes | However |
| T1221 | 1262-1263 | , | denotes | , |
| T1222 | 1264-1266 | PRP | denotes | we |
| T1223 | 1267-1275 | RB | denotes | recently |
| T1224 | 1276-1288 | VBD | denotes | demonstrated |
| T1225 | 1289-1293 | IN | denotes | that |
| T1226 | 1294-1303 | JJ | denotes | ribosomal |
| T1227 | 1304-1311 | NN | denotes | protein |
| T1228 | 1312-1314 | NNP | denotes | S3 |
| T1229 | 1315-1316 | -LRB- | denotes | ( |
| T1230 | 1316-1320 | NNP | denotes | RPS3 |
| T1231 | 1320-1321 | -RRB- | denotes | ) |
| T1232 | 1322-1324 | VBZ | denotes | is |
| T1233 | 1325-1326 | DT | denotes | a |
| T1234 | 1327-1330 | JJ | denotes | key |
| T1235 | 1331-1338 | JJ | denotes | non-Rel |
| T1236 | 1339-1346 | NN | denotes | subunit |
| T1237 | 1347-1349 | IN | denotes | of |
| T1238 | 1350-1357 | JJ | denotes | certain |
| T1239 | 1358-1364 | JJ | denotes | native |
| T1240 | 1365-1370 | NN | denotes | NF-κB |
| T1241 | 1371-1381 | NNS | denotes | complexes6 |
| T1242 | 1381-1382 | . | denotes | . |
| T1243 | 1383-1387 | CD | denotes | RPS3 |
| T1244 | 1388-1390 | VBZ | denotes | is |
| T1245 | 1391-1398 | VBN | denotes | defined |
| T1246 | 1399-1401 | IN | denotes | as |
| T1247 | 1402-1403 | DT | denotes | a |
| T1248 | 1405-1414 | NN | denotes | specifier |
| T1249 | 1416-1423 | NN | denotes | subunit |
| T1250 | 1424-1426 | IN | denotes | of |
| T1251 | 1427-1432 | NNP | denotes | NF-κB |
| T1252 | 1432-1433 | , | denotes | , |
| T1253 | 1434-1441 | IN | denotes | because |
| T1254 | 1442-1444 | PRP | denotes | it |
| T1255 | 1445-1456 | VBZ | denotes | facilitates |
| T1256 | 1457-1461 | JJ | denotes | high |
| T1257 | 1462-1470 | NN | denotes | affinity |
| T1258 | 1471-1474 | NNP | denotes | DNA |
| T1259 | 1475-1482 | JJ | denotes | binding |
| T1260 | 1483-1487 | RB | denotes | thus |
| T1261 | 1488-1499 | VBG | denotes | determining |
| T1262 | 1500-1503 | DT | denotes | the |
| T1263 | 1504-1514 | JJ | denotes | regulatory |
| T1264 | 1515-1526 | NN | denotes | specificity |
| T1265 | 1527-1529 | IN | denotes | of |
| T1266 | 1530-1535 | NN | denotes | NF-κB |
| T1267 | 1536-1539 | IN | denotes | for |
| T1268 | 1540-1548 | VBN | denotes | selected |
| T1269 | 1549-1555 | NN | denotes | target |
| T1270 | 1556-1562 | NNS | denotes | genes7 |
| T1271 | 1562-1563 | . | denotes | . |
| T1272 | 1564-1568 | CD | denotes | RPS3 |
| T1273 | 1569-1579 | NN | denotes | regulation |
| T1274 | 1580-1582 | IN | denotes | of |
| T1275 | 1583-1588 | JJ | denotes | NF-κB |
| T1276 | 1589-1596 | NNS | denotes | governs |
| T1277 | 1597-1600 | JJ | denotes | key |
| T1278 | 1601-1614 | JJ | denotes | physiological |
| T1279 | 1615-1624 | NNS | denotes | processes |
| T1280 | 1624-1625 | , | denotes | , |
| T1281 | 1626-1635 | VBG | denotes | including |
| T1282 | 1636-1650 | NN | denotes | immunoglobulin |
| T1283 | 1651-1652 | NN | denotes | κ |
| T1284 | 1653-1658 | NN | denotes | light |
| T1285 | 1659-1664 | NN | denotes | chain |
| T1286 | 1665-1669 | NN | denotes | gene |
| T1287 | 1670-1680 | NN | denotes | expression |
| T1288 | 1681-1684 | CC | denotes | and |
| T1289 | 1685-1693 | NN | denotes | receptor |
| T1290 | 1694-1701 | NN | denotes | editing |
| T1291 | 1702-1704 | IN | denotes | in |
| T1292 | 1705-1706 | NNP | denotes | B |
| T1293 | 1707-1713 | CD | denotes | cells6 |
| T1294 | 1713-1716 | CD | denotes | , 8 |
| T1295 | 1716-1717 | , | denotes | , |
| T1296 | 1718-1726 | NN | denotes | cytokine |
| T1297 | 1727-1737 | NN | denotes | production |
| T1298 | 1738-1740 | IN | denotes | in |
| T1299 | 1741-1742 | NNP | denotes | T |
| T1300 | 1743-1749 | CD | denotes | cells6 |
| T1301 | 1749-1750 | , | denotes | , |
| T1302 | 1751-1754 | CC | denotes | and |
| T1303 | 1755-1757 | IN | denotes | in |
| T1304 | 1758-1762 | NN | denotes | host |
| T1305 | 1763-1770 | NN | denotes | defense |
| T1306 | 1771-1778 | IN | denotes | against |
| T1307 | 1779-1808 | NNP | denotes | enterohemorrhagic Escherichia |
| T1308 | 1809-1813 | NNS | denotes | coli |
| T1309 | 1814-1815 | -LRB- | denotes | ( |
| T1310 | 1815-1819 | NNP | denotes | EHEC |
| T1311 | 1819-1820 | -RRB- | denotes | ) |
| T1312 | 1820-1821 | CD | denotes | 9 |
| T1313 | 1821-1822 | . | denotes | . |
| T1314 | 1823-1825 | IN | denotes | In |
| T1315 | 1826-1836 | JJ | denotes | particular |
| T1316 | 1836-1837 | , | denotes | , |
| T1317 | 1838-1843 | NNP | denotes | the E |
| T1318 | 1843-1844 | . | denotes | . |
| T1319 | 1845-1854 | NNP | denotes | coli O157 |
| T1320 | 1854-1855 | : | denotes | : |
| T1321 | 1855-1857 | NNP | denotes | H7 |
| T1322 | 1858-1862 | NN | denotes | type |
| T1323 | 1863-1866 | NNP | denotes | III |
| T1324 | 1867-1876 | NN | denotes | secretion |
| T1325 | 1877-1883 | NN | denotes | system |
| T1326 | 1884-1885 | -LRB- | denotes | ( |
| T1327 | 1885-1889 | CD | denotes | T3SS |
| T1328 | 1889-1890 | -RRB- | denotes | ) |
| T1329 | 1891-1899 | NN | denotes | effector |
| T1330 | 1900-1907 | NN | denotes | protein |
| T1331 | 1908-1913 | NNP | denotes | NleH1 |
| T1332 | 1914-1925 | RB | denotes | selectively |
| T1333 | 1926-1932 | NNS | denotes | blocks |
| T1334 | 1933-1938 | JJ | denotes | NF-κB |
| T1335 | 1939-1945 | NN | denotes | target |
| T1336 | 1946-1950 | NN | denotes | gene |
| T1337 | 1951-1964 | NN | denotes | transcription |
| T1338 | 1965-1967 | IN | denotes | by |
| T1339 | 1968-1979 | VBG | denotes | attenuating |
| T1340 | 1980-1984 | JJ | denotes | RPS3 |
| T1341 | 1985-1992 | JJ | denotes | nuclear |
| T1342 | 1993-2006 | NN | denotes | translocation |
| T1343 | 2006-2007 | , | denotes | , |
| T1344 | 2008-2015 | IN | denotes | without |
| T1345 | 2016-2025 | VBG | denotes | affecting |
| T1346 | 2026-2029 | CD | denotes | p65 |
| T1347 | 2030-2043 | CD | denotes | localization9 |
| T1348 | 2043-2044 | . | denotes | . |
| T1349 | 2045-2056 | RB | denotes | Nonetheless |
| T1350 | 2056-2057 | , | denotes | , |
| T1351 | 2058-2061 | WRB | denotes | how |
| T1352 | 2062-2070 | JJ | denotes | specific |
| T1353 | 2071-2076 | NN | denotes | NF-κB |
| T1354 | 2077-2087 | VBG | denotes | activating |
| T1355 | 2088-2095 | NNS | denotes | signals |
| T1356 | 2096-2102 | VB | denotes | induce |
| T1357 | 2103-2107 | NNP | denotes | RPS3 |
| T1358 | 2108-2115 | JJ | denotes | nuclear |
| T1359 | 2116-2129 | NN | denotes | translocation |
| T1360 | 2130-2132 | VBZ | denotes | is |
| T1361 | 2133-2157 | JJ | denotes | unknown. Extra-ribosomal |
| T1362 | 2158-2167 | NNS | denotes | functions |
| T1363 | 2168-2172 | VBP | denotes | have |
| T1364 | 2173-2177 | VBN | denotes | been |
| T1365 | 2178-2186 | VBN | denotes | ascribed |
| T1366 | 2187-2189 | TO | denotes | to |
| T1367 | 2190-2199 | JJ | denotes | ribosomal |
| T1368 | 2200-2210 | NNS | denotes | proteins10 |
| T1369 | 2210-2211 | . | denotes | . |
| T1370 | 2212-2219 | IN | denotes | Besides |
| T1371 | 2220-2227 | JJ | denotes | binding |
| T1372 | 2228-2231 | NNP | denotes | RNA |
| T1373 | 2232-2238 | IN | denotes | within |
| T1374 | 2239-2242 | DT | denotes | the |
| T1375 | 2243-2246 | NNP | denotes | 40S |
| T1376 | 2247-2256 | JJ | denotes | ribosomal |
| T1377 | 2257-2264 | NN | denotes | subunit |
| T1378 | 2264-2265 | , | denotes | , |
| T1379 | 2266-2270 | JJ | denotes | RPS3 |
| T1380 | 2271-2283 | VBZ | denotes | participates |
| T1381 | 2284-2286 | IN | denotes | in |
| T1382 | 2287-2301 | CD | denotes | transcription6 |
| T1383 | 2301-2302 | , | denotes | , |
| T1384 | 2303-2306 | NNP | denotes | DNA |
| T1385 | 2307-2315 | CD | denotes | repair11 |
| T1386 | 2315-2319 | CD | denotes | , 12 |
| T1387 | 2319-2320 | , | denotes | , |
| T1388 | 2321-2324 | CC | denotes | and |
| T1389 | 2325-2336 | CD | denotes | apoptosis13 |
| T1390 | 2336-2337 | . | denotes | . |
| T1391 | 2338-2345 | IN | denotes | Whether |
| T1392 | 2346-2348 | CC | denotes | or |
| T1393 | 2349-2352 | RB | denotes | not |
| T1394 | 2353-2357 | NNP | denotes | RPS3 |
| T1395 | 2358-2360 | VBZ | denotes | is |
| T1396 | 2361-2375 | VBN | denotes | phosphorylated |
| T1397 | 2376-2379 | VBD | denotes | had |
| T1398 | 2380-2384 | VBN | denotes | been |
| T1399 | 2385-2403 | JJ | denotes | controversial14-18 |
| T1400 | 2403-2404 | . | denotes | . |
| T1401 | 2405-2410 | IN | denotes | Since |
| T1402 | 2411-2417 | NN | denotes | kinase |
| T1403 | 2418-2426 | NNS | denotes | cascades |
| T1404 | 2427-2431 | VBP | denotes | play |
| T1405 | 2432-2433 | DT | denotes | a |
| T1406 | 2434-2442 | JJ | denotes | critical |
| T1407 | 2443-2447 | NN | denotes | role |
| T1408 | 2448-2450 | IN | denotes | in |
| T1409 | 2451-2456 | JJ | denotes | NF-κB |
| T1410 | 2457-2467 | NN | denotes | regulation |
| T1411 | 2467-2468 | , | denotes | , |
| T1412 | 2469-2471 | PRP | denotes | we |
| T1413 | 2472-2478 | VBD | denotes | tested |
| T1414 | 2479-2486 | IN | denotes | whether |
| T1415 | 2487-2491 | NNP | denotes | RPS3 |
| T1416 | 2492-2494 | VBZ | denotes | is |
| T1417 | 2495-2509 | VBN | denotes | phosphorylated |
| T1418 | 2510-2512 | IN | denotes | in |
| T1419 | 2513-2516 | DT | denotes | the |
| T1420 | 2517-2524 | NN | denotes | context |
| T1421 | 2525-2527 | IN | denotes | of |
| T1422 | 2528-2533 | JJ | denotes | NF-κB |
| T1423 | 2534-2544 | NN | denotes | activation |
| T1424 | 2545-2548 | CC | denotes | and |
| T1425 | 2549-2555 | VBD | denotes | sought |
| T1426 | 2556-2558 | TO | denotes | to |
| T1427 | 2559-2567 | VB | denotes | identify |
| T1428 | 2568-2571 | DT | denotes | the |
| T1429 | 2572-2583 | JJ | denotes | responsible |
| T1430 | 2584-2592 | NN | denotes | kinase19 |
| T1431 | 2592-2593 | . | denotes | . |
| T1432 | 2594-2606 | RB | denotes | Additionally |
| T1433 | 2606-2607 | , | denotes | , |
| T1434 | 2608-2610 | PRP | denotes | we |
| T1435 | 2611-2616 | VBD | denotes | aimed |
| T1436 | 2617-2619 | TO | denotes | to |
| T1437 | 2620-2626 | VB | denotes | define |
| T1438 | 2627-2628 | DT | denotes | a |
| T1439 | 2629-2639 | JJ | denotes | regulatory |
| T1440 | 2640-2644 | NN | denotes | role |
| T1441 | 2645-2648 | IN | denotes | for |
| T1442 | 2649-2652 | DT | denotes | the |
| T1443 | 2653-2663 | JJ | denotes | C-terminal |
| T1444 | 2664-2668 | NN | denotes | tail |
| T1445 | 2669-2671 | IN | denotes | of |
| T1446 | 2672-2676 | CD | denotes | RPS3 |
| T1447 | 2677-2682 | WP$ | denotes | whose |
| T1448 | 2683-2691 | NN | denotes | function |
| T1449 | 2692-2695 | VBD | denotes | was |
| T1450 | 2696-2709 | JJ | denotes | unknown. Here |
| T1451 | 2710-2712 | PRP | denotes | we |
| T1452 | 2713-2717 | VBP | denotes | show |
| T1453 | 2718-2722 | IN | denotes | that |
| T1454 | 2723-2726 | DT | denotes | the |
| T1455 | 2727-2736 | NNP | denotes | Inhibitor |
| T1456 | 2737-2739 | IN | denotes | of |
| T1457 | 2740-2742 | NNP | denotes | κB |
| T1458 | 2743-2744 | -LRB- | denotes | ( |
| T1459 | 2744-2747 | NNP | denotes | IκB |
| T1460 | 2747-2748 | -RRB- | denotes | ) |
| T1461 | 2749-2755 | NN | denotes | kinase |
| T1462 | 2756-2760 | NN | denotes | beta |
| T1463 | 2761-2762 | -LRB- | denotes | ( |
| T1464 | 2762-2766 | NNP | denotes | IKKβ |
| T1465 | 2766-2767 | -RRB- | denotes | ) |
| T1466 | 2768-2782 | VBD | denotes | phosphorylated |
| T1467 | 2783-2787 | CD | denotes | RPS3 |
| T1468 | 2788-2790 | IN | denotes | at |
| T1469 | 2791-2797 | NN | denotes | serine |
| T1470 | 2798-2801 | CD | denotes | 209 |
| T1471 | 2802-2803 | -LRB- | denotes | ( |
| T1472 | 2803-2807 | CD | denotes | S209 |
| T1473 | 2807-2808 | -RRB- | denotes | ) |
| T1474 | 2808-2809 | . | denotes | . |
| T1475 | 2810-2814 | CD | denotes | RPS3 |
| T1476 | 2815-2819 | CD | denotes | S209 |
| T1477 | 2820-2835 | NN | denotes | phosphorylation |
| T1478 | 2836-2844 | VBD | denotes | enhanced |
| T1479 | 2845-2848 | PRP$ | denotes | its |
| T1480 | 2849-2860 | NN | denotes | association |
| T1481 | 2861-2865 | IN | denotes | with |
| T1482 | 2866-2876 | JJ | denotes | importin-α |
| T1483 | 2876-2877 | , | denotes | , |
| T1484 | 2878-2887 | VBG | denotes | mediating |
| T1485 | 2888-2892 | CD | denotes | RPS3 |
| T1486 | 2893-2898 | NN | denotes | entry |
| T1487 | 2899-2903 | IN | denotes | into |
| T1488 | 2904-2907 | DT | denotes | the |
| T1489 | 2908-2919 | NN | denotes | karyopherin |
| T1490 | 2920-2927 | NN | denotes | pathway |
| T1491 | 2928-2931 | IN | denotes | for |
| T1492 | 2932-2939 | JJ | denotes | nuclear |
| T1493 | 2940-2953 | NN | denotes | translocation |
| T1494 | 2953-2954 | . | denotes | . |
| T1495 | 2955-2966 | RB | denotes | Furthermore |
| T1496 | 2966-2967 | , | denotes | , |
| T1497 | 2968-2973 | NNP | denotes | the E |
| T1498 | 2973-2974 | . | denotes | . |
| T1499 | 2975-2985 | CD | denotes | coli NleH1 |
| T1500 | 2986-2994 | NN | denotes | effector |
| T1501 | 2995-3007 | RB | denotes | specifically |
| T1502 | 3008-3017 | VBD | denotes | inhibited |
| T1503 | 3018-3022 | NNP | denotes | RPS3 |
| T1504 | 3023-3027 | NNP | denotes | S209 |
| T1505 | 3028-3037 | VBG | denotes | revealing |
| T1506 | 3038-3043 | NNP | denotes | how E |
| T1507 | 3043-3044 | . | denotes | . |
| T1508 | 3045-3054 | NNP | denotes | coli O157 |
| T1509 | 3054-3055 | : | denotes | : |
| T1510 | 3055-3057 | NNP | denotes | H7 |
| T1511 | 3058-3066 | VBZ | denotes | inhibits |
| T1512 | 3067-3071 | DT | denotes | this |
| T1513 | 3072-3081 | JJ | denotes | important |
| T1514 | 3082-3088 | NN | denotes | innate |
| T1515 | 3089-3095 | JJ | denotes | immune |
| T1516 | 3096-3104 | NN | denotes | response |
| T1517 | 3105-3114 | NN | denotes | mechanism |
| T1518 | 3114-3115 | . | denotes | . |
| T2170 | 3126-3130 | CD | denotes | RPS3 |
| T2171 | 3131-3146 | NN | denotes | phosphorylation |
| T2172 | 3147-3149 | IN | denotes | in |
| T2173 | 3150-3158 | NN | denotes | response |
| T2174 | 3159-3161 | TO | denotes | to |
| T2175 | 3162-3167 | JJ | denotes | NF-κB |
| T2176 | 3168-3178 | NN | denotes | activation |
| T2177 | 3179-3181 | TO | denotes | To |
| T2178 | 3182-3186 | NN | denotes | test |
| T2179 | 3187-3194 | IN | denotes | whether |
| T2180 | 3195-3199 | NNP | denotes | RPS3 |
| T2181 | 3200-3202 | VBZ | denotes | is |
| T2182 | 3203-3217 | VBN | denotes | phosphorylated |
| T2183 | 3218-3224 | IN | denotes | during |
| T2184 | 3225-3230 | NNP | denotes | NF-κB |
| T2185 | 3231-3241 | NN | denotes | activation |
| T2186 | 3241-3242 | , | denotes | , |
| T2187 | 3243-3245 | PRP | denotes | we |
| T2188 | 3246-3255 | VBD | denotes | performed |
| T2189 | 3256-3268 | JJ | denotes | 32P-labeling |
| T2190 | 3269-3280 | NNS | denotes | experiments |
| T2191 | 3281-3283 | IN | denotes | in |
| T2192 | 3284-3289 | NN | denotes | tumor |
| T2193 | 3290-3298 | NN | denotes | necrosis |
| T2194 | 3299-3305 | NN | denotes | factor |
| T2195 | 3306-3307 | -LRB- | denotes | ( |
| T2196 | 3307-3310 | NNP | denotes | TNF |
| T2197 | 3310-3311 | -RRB- | denotes | ) |
| T2198 | 3311-3312 | : | denotes | - |
| T2199 | 3312-3322 | VBN | denotes | stimulated |
| T2200 | 3323-3326 | NNP | denotes | HEK |
| T2201 | 3327-3331 | CD | denotes | 293T |
| T2202 | 3332-3337 | NNS | denotes | cells |
| T2203 | 3337-3338 | . | denotes | . |
| T2204 | 3339-3344 | IN | denotes | While |
| T2205 | 3345-3349 | NNP | denotes | RPS3 |
| T2206 | 3350-3353 | VBD | denotes | was |
| T2207 | 3354-3362 | RB | denotes | scarcely |
| T2208 | 3363-3377 | VBN | denotes | phosphorylated |
| T2209 | 3378-3380 | IN | denotes | in |
| T2210 | 3381-3393 | JJ | denotes | unstimulated |
| T2211 | 3394-3399 | NNS | denotes | cells |
| T2212 | 3399-3400 | , | denotes | , |
| T2213 | 3401-3403 | PRP | denotes | we |
| T2214 | 3404-3412 | VBD | denotes | observed |
| T2215 | 3413-3414 | DT | denotes | a |
| T2216 | 3415-3421 | JJ | denotes | marked |
| T2217 | 3422-3430 | NN | denotes | increase |
| T2218 | 3431-3433 | IN | denotes | in |
| T2219 | 3434-3451 | NN | denotes | 32P-incorporation |
| T2220 | 3452-3457 | IN | denotes | after |
| T2221 | 3458-3461 | NNP | denotes | TNF |
| T2222 | 3462-3473 | NN | denotes | stimulation |
| T2223 | 3474-3481 | IN | denotes | despite |
| T2224 | 3482-3484 | DT | denotes | no |
| T2225 | 3485-3493 | NN | denotes | increase |
| T2226 | 3494-3496 | IN | denotes | in |
| T2227 | 3497-3501 | CD | denotes | RPS3 |
| T2228 | 3502-3509 | NN | denotes | protein |
| T2229 | 3510-3511 | -LRB- | denotes | ( |
| T2230 | 3511-3515 | NNP | denotes | Fig. |
| T2231 | 3516-3518 | CD | denotes | 1a |
| T2232 | 3518-3519 | -RRB- | denotes | ) |
| T2233 | 3519-3520 | . | denotes | . |
| T2234 | 3521-3523 | TO | denotes | To |
| T2235 | 3524-3533 | VB | denotes | determine |
| T2236 | 3534-3539 | WDT | denotes | which |
| T2237 | 3540-3544 | NNP | denotes | RPS3 |
| T2238 | 3545-3553 | NNS | denotes | residues |
| T2239 | 3554-3558 | VBD | denotes | were |
| T2240 | 3559-3573 | VBN | denotes | phosphorylated |
| T2241 | 3573-3574 | , | denotes | , |
| T2242 | 3575-3577 | PRP | denotes | we |
| T2243 | 3578-3596 | VBD | denotes | immunoprecipitated |
| T2244 | 3597-3601 | CD | denotes | RPS3 |
| T2245 | 3602-3606 | IN | denotes | from |
| T2246 | 3607-3613 | CC | denotes | either |
| T2247 | 3614-3621 | VBG | denotes | resting |
| T2248 | 3622-3624 | CC | denotes | or |
| T2249 | 3625-3635 | VBN | denotes | stimulated |
| T2250 | 3636-3641 | NNS | denotes | cells |
| T2251 | 3642-3645 | CC | denotes | and |
| T2252 | 3646-3655 | VBN | denotes | performed |
| T2253 | 3656-3670 | VBG | denotes | immunoblotting |
| T2254 | 3671-3675 | IN | denotes | with |
| T2255 | 3676-3700 | JJ | denotes | phosphorylation-specific |
| T2256 | 3701-3711 | NNS | denotes | antibodies |
| T2257 | 3711-3712 | . | denotes | . |
| T2258 | 3713-3717 | DT | denotes | Both |
| T2259 | 3718-3721 | NNP | denotes | TNF |
| T2260 | 3722-3725 | CC | denotes | and |
| T2261 | 3726-3733 | JJ | denotes | phorbol |
| T2262 | 3734-3743 | NN | denotes | myristate |
| T2263 | 3744-3761 | NN | denotes | acetate/ionomycin |
| T2264 | 3762-3763 | -LRB- | denotes | ( |
| T2265 | 3763-3768 | NNP | denotes | PMA+I |
| T2266 | 3768-3769 | -RRB- | denotes | ) |
| T2267 | 3770-3780 | VBD | denotes | stimulated |
| T2268 | 3781-3786 | JJ | denotes | rapid |
| T2269 | 3787-3802 | NN | denotes | phosphorylation |
| T2270 | 3803-3806 | CC | denotes | and |
| T2271 | 3807-3817 | NN | denotes | degradaion |
| T2272 | 3818-3820 | IN | denotes | of |
| T2273 | 3821-3825 | NNP | denotes | IκBα |
| T2274 | 3826-3832 | IN | denotes | within |
| T2275 | 3833-3834 | CD | denotes | 5 |
| T2276 | 3835-3838 | NN | denotes | min |
| T2277 | 3839-3844 | WDT | denotes | which |
| T2278 | 3845-3848 | VBD | denotes | was |
| T2279 | 3849-3860 | VBN | denotes | accompanied |
| T2280 | 3861-3863 | IN | denotes | by |
| T2281 | 3864-3868 | CD | denotes | RPS3 |
| T2282 | 3869-3884 | NN | denotes | phosphorylation |
| T2283 | 3885-3887 | IN | denotes | on |
| T2284 | 3888-3894 | NN | denotes | serine |
| T2285 | 3895-3903 | NNS | denotes | residues |
| T2286 | 3904-3905 | -LRB- | denotes | ( |
| T2287 | 3905-3909 | NNP | denotes | Fig. |
| T2288 | 3910-3912 | CD | denotes | 1b |
| T2289 | 3913-3916 | CC | denotes | and |
| T2290 | 3917-3921 | NNS | denotes | data |
| T2291 | 3922-3925 | RB | denotes | not |
| T2292 | 3926-3931 | VBN | denotes | shown |
| T2293 | 3931-3932 | -RRB- | denotes | ) |
| T2294 | 3932-3933 | , | denotes | , |
| T2295 | 3934-3941 | JJ | denotes | similar |
| T2296 | 3942-3944 | TO | denotes | to |
| T2297 | 3945-3948 | DT | denotes | the |
| T2298 | 3949-3951 | IN | denotes | in |
| T2299 | 3952-3956 | NN | denotes | vivo |
| T2300 | 3957-3965 | VBG | denotes | labeling |
| T2301 | 3965-3966 | . | denotes | . |
| T2302 | 3967-3969 | PRP | denotes | We |
| T2303 | 3970-3973 | VBD | denotes | did |
| T2304 | 3974-3977 | RB | denotes | not |
| T2305 | 3978-3984 | VB | denotes | detect |
| T2306 | 3985-3993 | NN | denotes | tyrosine |
| T2307 | 3993-3994 | : | denotes | - |
| T2308 | 3995-3997 | CC | denotes | or |
| T2309 | 3998-4023 | NN | denotes | threonine-phosphorylation |
| T2310 | 4024-4026 | IN | denotes | of |
| T2311 | 4027-4031 | NNP | denotes | RPS3 |
| T2312 | 4032-4033 | -LRB- | denotes | ( |
| T2313 | 4033-4037 | NNP | denotes | Fig. |
| T2314 | 4038-4040 | CD | denotes | 1b |
| T2315 | 4040-4041 | -RRB- | denotes | ) |
| T2316 | 4041-4042 | . | denotes | . |
| T2826 | 4044-4048 | CD | denotes | RPS3 |
| T2827 | 4049-4052 | CC | denotes | and |
| T2828 | 4053-4057 | NNP | denotes | IKKβ |
| T2829 | 4058-4069 | NN | denotes | interaction |
| T2830 | 4070-4073 | DT | denotes | The |
| T2831 | 4074-4084 | NN | denotes | activation |
| T2832 | 4085-4087 | IN | denotes | of |
| T2833 | 4088-4091 | DT | denotes | the |
| T2834 | 4092-4101 | NN | denotes | inhibitor |
| T2835 | 4102-4104 | IN | denotes | of |
| T2836 | 4105-4107 | NN | denotes | κB |
| T2837 | 4108-4114 | NN | denotes | kinase |
| T2838 | 4115-4116 | -LRB- | denotes | ( |
| T2839 | 4116-4119 | NNP | denotes | IKK |
| T2840 | 4119-4120 | -RRB- | denotes | ) |
| T2841 | 4120-4121 | , | denotes | , |
| T2842 | 4122-4132 | VBG | denotes | consisting |
| T2843 | 4133-4135 | IN | denotes | of |
| T2844 | 4136-4137 | DT | denotes | a |
| T2845 | 4138-4148 | JJ | denotes | regulatory |
| T2846 | 4149-4156 | NN | denotes | subunit |
| T2847 | 4157-4161 | NNP | denotes | IKKγ |
| T2848 | 4162-4165 | CC | denotes | and |
| T2849 | 4166-4169 | CD | denotes | two |
| T2850 | 4170-4179 | JJ | denotes | catalytic |
| T2851 | 4180-4188 | NNS | denotes | subunits |
| T2852 | 4188-4189 | , | denotes | , |
| T2853 | 4190-4194 | NNP | denotes | IKKα |
| T2854 | 4195-4198 | CC | denotes | and |
| T2855 | 4199-4203 | NNP | denotes | IKKβ |
| T2856 | 4203-4204 | , | denotes | , |
| T2857 | 4205-4207 | VBZ | denotes | is |
| T2858 | 4208-4216 | JJ | denotes | critical |
| T2859 | 4217-4220 | IN | denotes | for |
| T2860 | 4221-4224 | DT | denotes | the |
| T2861 | 4225-4240 | NN | denotes | phosphorylation |
| T2862 | 4241-4244 | CC | denotes | and |
| T2863 | 4245-4253 | VB | denotes | dispatch |
| T2864 | 4254-4256 | IN | denotes | of |
| T2865 | 4257-4260 | DT | denotes | the |
| T2866 | 4261-4271 | JJ | denotes | inhibitory |
| T2867 | 4272-4276 | NNS | denotes | IκBs |
| T2868 | 4277-4280 | CC | denotes | and |
| T2869 | 4281-4284 | DT | denotes | the |
| T2870 | 4285-4295 | NN | denotes | liberation |
| T2871 | 4296-4298 | IN | denotes | of |
| T2872 | 4299-4309 | NN | denotes | NF-κB20-22 |
| T2873 | 4309-4310 | . | denotes | . |
| T2874 | 4311-4316 | VBN | denotes | Given |
| T2875 | 4317-4321 | IN | denotes | that |
| T2876 | 4322-4326 | NNP | denotes | RPS3 |
| T2877 | 4327-4330 | MD | denotes | can |
| T2878 | 4331-4333 | VB | denotes | be |
| T2879 | 4334-4339 | VBN | denotes | found |
| T2880 | 4340-4342 | IN | denotes | in |
| T2881 | 4343-4346 | DT | denotes | the |
| T2882 | 4347-4358 | JJ | denotes | cytoplasmic |
| T2883 | 4359-4371 | NN | denotes | p65-p50-IκBα |
| T2884 | 4372-4382 | NN | denotes | inhibitory |
| T2885 | 4383-4390 | NN | denotes | complex |
| T2886 | 4391-4393 | IN | denotes | in |
| T2887 | 4394-4401 | VBG | denotes | resting |
| T2888 | 4402-4408 | CD | denotes | cells6 |
| T2889 | 4408-4409 | , | denotes | , |
| T2890 | 4410-4412 | PRP | denotes | we |
| T2891 | 4413-4425 | VBD | denotes | hypothesized |
| T2892 | 4426-4430 | IN | denotes | that |
| T2893 | 4431-4440 | VBN | denotes | activated |
| T2894 | 4441-4445 | NNP | denotes | IKKβ |
| T2895 | 4446-4451 | MD | denotes | might |
| T2896 | 4452-4456 | RB | denotes | also |
| T2897 | 4457-4461 | NN | denotes | bind |
| T2898 | 4462-4464 | TO | denotes | to |
| T2899 | 4465-4468 | CC | denotes | and |
| T2900 | 4469-4482 | VB | denotes | phosphorylate |
| T2901 | 4483-4487 | NNP | denotes | RPS3 |
| T2902 | 4487-4488 | . | denotes | . |
| T2903 | 4489-4494 | RB | denotes | First |
| T2904 | 4494-4495 | , | denotes | , |
| T2905 | 4496-4498 | PRP | denotes | we |
| T2906 | 4499-4504 | VBD | denotes | found |
| T2907 | 4505-4509 | IN | denotes | that |
| T2908 | 4510-4521 | RB | denotes | ectopically |
| T2909 | 4522-4531 | VBN | denotes | expressed |
| T2910 | 4532-4536 | NNP | denotes | IKKβ |
| T2911 | 4537-4540 | CC | denotes | and |
| T2912 | 4541-4545 | NNP | denotes | RPS3 |
| T2913 | 4546-4556 | VBD | denotes | interacted |
| T2914 | 4557-4558 | -LRB- | denotes | ( |
| T2915 | 4558-4562 | NNP | denotes | Fig. |
| T2916 | 4563-4565 | CD | denotes | 1c |
| T2917 | 4565-4566 | -RRB- | denotes | ) |
| T2918 | 4566-4567 | . | denotes | . |
| T2919 | 4568-4570 | PRP | denotes | We |
| T2920 | 4571-4575 | JJ | denotes | next |
| T2921 | 4576-4584 | VBD | denotes | examined |
| T2922 | 4585-4592 | VBG | denotes | resting |
| T2923 | 4593-4599 | NNP | denotes | Jurkat |
| T2924 | 4600-4605 | NNS | denotes | cells |
| T2925 | 4606-4609 | CC | denotes | and |
| T2926 | 4610-4618 | VBD | denotes | detected |
| T2927 | 4619-4620 | DT | denotes | a |
| T2928 | 4621-4627 | JJ | denotes | modest |
| T2929 | 4628-4638 | JJ | denotes | endogenous |
| T2930 | 4639-4648 | JJ | denotes | IKKβ-RPS3 |
| T2931 | 4649-4660 | NN | denotes | interaction |
| T2932 | 4661-4662 | -LRB- | denotes | ( |
| T2933 | 4662-4666 | NNP | denotes | Fig. |
| T2934 | 4667-4669 | CD | denotes | 1d |
| T2935 | 4669-4670 | -RRB- | denotes | ) |
| T2936 | 4670-4671 | , | denotes | , |
| T2937 | 4672-4683 | RB | denotes | potentially |
| T2938 | 4684-4694 | VBG | denotes | accounting |
| T2939 | 4695-4698 | IN | denotes | for |
| T2940 | 4699-4702 | DT | denotes | the |
| T2941 | 4703-4708 | JJ | denotes | basal |
| T2942 | 4709-4714 | NN | denotes | NF-κB |
| T2943 | 4715-4728 | NN | denotes | transcription |
| T2944 | 4729-4737 | VBN | denotes | required |
| T2945 | 4738-4741 | IN | denotes | for |
| T2946 | 4742-4746 | NN | denotes | cell |
| T2947 | 4747-4760 | NN | denotes | proliferation |
| T2948 | 4761-4764 | CC | denotes | and |
| T2949 | 4765-4773 | NN | denotes | survival |
| T2950 | 4773-4774 | . | denotes | . |
| T2951 | 4775-4784 | JJ | denotes | RPS3-IKKβ |
| T2952 | 4785-4796 | NN | denotes | association |
| T2953 | 4797-4800 | VBD | denotes | was |
| T2954 | 4801-4808 | RB | denotes | clearly |
| T2955 | 4809-4818 | VBN | denotes | augmented |
| T2956 | 4819-4823 | IN | denotes | upon |
| T2957 | 4824-4827 | NNP | denotes | TNF |
| T2958 | 4828-4839 | NN | denotes | stimulation |
| T2959 | 4839-4840 | , | denotes | , |
| T2960 | 4841-4848 | VBG | denotes | peaking |
| T2961 | 4849-4851 | IN | denotes | at |
| T2962 | 4852-4854 | CD | denotes | 10 |
| T2963 | 4855-4858 | NN | denotes | min |
| T2964 | 4858-4859 | . | denotes | . |
| T2965 | 4860-4861 | -LRB- | denotes | ( |
| T2966 | 4861-4865 | NNP | denotes | Fig. |
| T2967 | 4866-4868 | CD | denotes | 1d |
| T2968 | 4868-4869 | -RRB- | denotes | ) |
| T2969 | 4869-4870 | , | denotes | , |
| T2970 | 4871-4880 | VBG | denotes | following |
| T2971 | 4881-4888 | JJ | denotes | similar |
| T2972 | 4889-4897 | NNS | denotes | kinetics |
| T2973 | 4898-4900 | TO | denotes | to |
| T2974 | 4901-4905 | CD | denotes | RPS3 |
| T2975 | 4906-4912 | NN | denotes | serine |
| T2976 | 4913-4928 | NN | denotes | phosphorylation |
| T2977 | 4929-4930 | -LRB- | denotes | ( |
| T2978 | 4930-4934 | NNP | denotes | Fig. |
| T2979 | 4935-4937 | CD | denotes | 1b |
| T2980 | 4937-4938 | -RRB- | denotes | ) |
| T2981 | 4938-4939 | . | denotes | . |
| T2982 | 4940-4942 | IN | denotes | By |
| T2983 | 4943-4951 | NN | denotes | contrast |
| T2984 | 4951-4952 | , | denotes | , |
| T2985 | 4953-4958 | EX | denotes | there |
| T2986 | 4959-4962 | VBD | denotes | was |
| T2987 | 4963-4965 | DT | denotes | no |
| T2988 | 4966-4976 | JJ | denotes | detectable |
| T2989 | 4977-4988 | NN | denotes | interaction |
| T2990 | 4989-4996 | IN | denotes | between |
| T2991 | 4997-5001 | CD | denotes | RPS3 |
| T2992 | 5002-5005 | CC | denotes | and |
| T2993 | 5006-5010 | NNP | denotes | IKKα |
| T2994 | 5011-5012 | -LRB- | denotes | ( |
| T2995 | 5012-5016 | NNP | denotes | Fig. |
| T2996 | 5017-5019 | CD | denotes | 1d |
| T2997 | 5019-5020 | -RRB- | denotes | ) |
| T2998 | 5020-5021 | . | denotes | . |
| T3859 | 5023-5027 | NNP | denotes | IKKβ |
| T3860 | 5028-5030 | VBZ | denotes | is |
| T3861 | 5031-5039 | VBN | denotes | required |
| T3862 | 5040-5043 | IN | denotes | for |
| T3863 | 5044-5048 | NNP | denotes | RPS3 |
| T3864 | 5049-5056 | JJ | denotes | nuclear |
| T3865 | 5057-5070 | NN | denotes | translocation |
| T3866 | 5071-5073 | TO | denotes | To |
| T3867 | 5074-5081 | VB | denotes | examine |
| T3868 | 5082-5089 | IN | denotes | whether |
| T3869 | 5090-5093 | DT | denotes | the |
| T3870 | 5094-5103 | NN | denotes | RPS3-IKKβ |
| T3871 | 5104-5115 | NN | denotes | interaction |
| T3872 | 5116-5118 | VBZ | denotes | is |
| T3873 | 5119-5127 | VBN | denotes | required |
| T3874 | 5128-5131 | IN | denotes | for |
| T3875 | 5132-5136 | NNP | denotes | RPS3 |
| T3876 | 5137-5144 | JJ | denotes | nuclear |
| T3877 | 5145-5158 | NN | denotes | translocation |
| T3878 | 5158-5159 | , | denotes | , |
| T3879 | 5160-5162 | PRP | denotes | we |
| T3880 | 5163-5170 | VBD | denotes | knocked |
| T3881 | 5171-5175 | RP | denotes | down |
| T3882 | 5176-5180 | NNP | denotes | IKKα |
| T3883 | 5181-5183 | CC | denotes | or |
| T3884 | 5184-5188 | NNP | denotes | IKKβ |
| T3885 | 5189-5199 | NN | denotes | expression |
| T3886 | 5200-5204 | IN | denotes | with |
| T3887 | 5205-5211 | NNS | denotes | siRNAs |
| T3888 | 5212-5213 | -LRB- | denotes | ( |
| T3889 | 5213-5226 | NNP | denotes | Supplementary |
| T3890 | 5227-5231 | NNP | denotes | Fig. |
| T3891 | 5232-5233 | CD | denotes | 1 |
| T3892 | 5233-5234 | -RRB- | denotes | ) |
| T3893 | 5235-5238 | CC | denotes | and |
| T3894 | 5239-5243 | RB | denotes | then |
| T3895 | 5244-5252 | VBD | denotes | observed |
| T3896 | 5253-5272 | JJ | denotes | stimulation-induced |
| T3897 | 5273-5277 | NNP | denotes | RPS3 |
| T3898 | 5278-5285 | JJ | denotes | nuclear |
| T3899 | 5286-5295 | NN | denotes | migration |
| T3900 | 5296-5298 | IN | denotes | by |
| T3901 | 5299-5307 | JJ | denotes | confocal |
| T3902 | 5308-5318 | NN | denotes | microscopy |
| T3903 | 5318-5319 | . | denotes | . |
| T3904 | 5320-5324 | DT | denotes | Both |
| T3905 | 5325-5328 | NNP | denotes | TNF |
| T3906 | 5329-5332 | CC | denotes | and |
| T3907 | 5333-5338 | NNP | denotes | PMA+I |
| T3908 | 5339-5348 | VBD | denotes | triggered |
| T3909 | 5349-5353 | CD | denotes | RPS3 |
| T3910 | 5354-5361 | JJ | denotes | nuclear |
| T3911 | 5362-5375 | NN | denotes | translocation |
| T3912 | 5376-5378 | IN | denotes | in |
| T3913 | 5379-5385 | NNP | denotes | Jurkat |
| T3914 | 5386-5391 | NNS | denotes | cells |
| T3915 | 5392-5403 | VBN | denotes | transfected |
| T3916 | 5404-5408 | IN | denotes | with |
| T3917 | 5409-5410 | DT | denotes | a |
| T3918 | 5411-5420 | VBN | denotes | scrambled |
| T3919 | 5421-5432 | JJ | denotes | nonspecific |
| T3920 | 5433-5434 | -LRB- | denotes | ( |
| T3921 | 5434-5436 | NNP | denotes | NS |
| T3922 | 5436-5437 | -RRB- | denotes | ) |
| T3923 | 5438-5443 | NNP | denotes | siRNA |
| T3924 | 5444-5445 | -LRB- | denotes | ( |
| T3925 | 5445-5449 | NNP | denotes | Fig. |
| T3926 | 5450-5452 | CD | denotes | 2a |
| T3927 | 5452-5453 | -RRB- | denotes | ) |
| T3928 | 5453-5454 | CD | denotes | 6 |
| T3929 | 5454-5455 | . | denotes | . |
| T3930 | 5456-5460 | CD | denotes | RPS3 |
| T3931 | 5461-5468 | JJ | denotes | nuclear |
| T3932 | 5469-5482 | NN | denotes | translocation |
| T3933 | 5483-5486 | VBD | denotes | was |
| T3934 | 5487-5491 | RB | denotes | only |
| T3935 | 5492-5500 | RB | denotes | slightly |
| T3936 | 5500-5501 | , | denotes | , |
| T3937 | 5502-5504 | IN | denotes | if |
| T3938 | 5505-5507 | IN | denotes | at |
| T3939 | 5508-5511 | DT | denotes | all |
| T3940 | 5511-5512 | , | denotes | , |
| T3941 | 5513-5521 | VBN | denotes | impaired |
| T3942 | 5522-5524 | IN | denotes | by |
| T3943 | 5525-5539 | JJ | denotes | IKKα-silencing |
| T3944 | 5539-5540 | . | denotes | . |
| T3945 | 5541-5551 | RB | denotes | Conversely |
| T3946 | 5551-5552 | , | denotes | , |
| T3947 | 5553-5562 | NN | denotes | knockdown |
| T3948 | 5563-5565 | IN | denotes | of |
| T3949 | 5566-5570 | NNP | denotes | IKKβ |
| T3950 | 5571-5581 | VBD | denotes | attenuated |
| T3951 | 5582-5587 | CD | denotes | 60-70 |
| T3952 | 5587-5588 | NN | denotes | % |
| T3953 | 5589-5591 | IN | denotes | of |
| T3954 | 5592-5596 | CD | denotes | RPS3 |
| T3955 | 5597-5604 | JJ | denotes | nuclear |
| T3956 | 5605-5617 | NN | denotes | accumulation |
| T3957 | 5618-5627 | VBG | denotes | following |
| T3958 | 5628-5639 | NN | denotes | stimulation |
| T3959 | 5640-5641 | -LRB- | denotes | ( |
| T3960 | 5641-5645 | NNP | denotes | Fig. |
| T3961 | 5646-5648 | CD | denotes | 2a |
| T3962 | 5648-5649 | -RRB- | denotes | ) |
| T3963 | 5649-5650 | . | denotes | . |
| T3964 | 5651-5665 | VBG | denotes | Immunoblotting |
| T3965 | 5666-5668 | IN | denotes | of |
| T3966 | 5669-5676 | JJ | denotes | nuclear |
| T3967 | 5677-5686 | NNS | denotes | fractions |
| T3968 | 5687-5696 | VBD | denotes | confirmed |
| T3969 | 5697-5701 | IN | denotes | that |
| T3970 | 5702-5706 | JJ | denotes | full |
| T3971 | 5707-5717 | NN | denotes | expression |
| T3972 | 5718-5720 | IN | denotes | of |
| T3973 | 5721-5725 | NNP | denotes | IKKβ |
| T3974 | 5725-5726 | , | denotes | , |
| T3975 | 5727-5730 | CC | denotes | but |
| T3976 | 5731-5734 | RB | denotes | not |
| T3977 | 5735-5739 | NNP | denotes | IKKα |
| T3978 | 5739-5740 | , | denotes | , |
| T3979 | 5741-5744 | VBD | denotes | was |
| T3980 | 5745-5754 | JJ | denotes | necessary |
| T3981 | 5755-5758 | IN | denotes | for |
| T3982 | 5759-5777 | JJ | denotes | activation-induced |
| T3983 | 5778-5782 | JJ | denotes | RPS3 |
| T3984 | 5783-5790 | JJ | denotes | nuclear |
| T3985 | 5791-5804 | NN | denotes | translocation |
| T3986 | 5805-5806 | -LRB- | denotes | ( |
| T3987 | 5806-5810 | NNP | denotes | Fig. |
| T3988 | 5811-5813 | CD | denotes | 2b |
| T3989 | 5813-5814 | -RRB- | denotes | ) |
| T3990 | 5814-5815 | . | denotes | . |
| T3991 | 5816-5823 | NNP | denotes | Control |
| T3992 | 5824-5835 | NNS | denotes | immunoblots |
| T3993 | 5836-5844 | VBD | denotes | revealed |
| T3994 | 5845-5849 | IN | denotes | that |
| T3995 | 5850-5853 | CD | denotes | p65 |
| T3996 | 5854-5861 | JJ | denotes | nuclear |
| T3997 | 5862-5875 | NN | denotes | translocation |
| T3998 | 5876-5879 | VBD | denotes | was |
| T3999 | 5880-5887 | VBN | denotes | blocked |
| T4000 | 5888-5893 | IN | denotes | under |
| T4001 | 5894-5897 | DT | denotes | the |
| T4002 | 5898-5902 | JJ | denotes | same |
| T4003 | 5903-5913 | NNS | denotes | conditions |
| T4004 | 5914-5915 | -LRB- | denotes | ( |
| T4005 | 5915-5919 | NNP | denotes | Fig. |
| T4006 | 5920-5922 | CD | denotes | 2b |
| T4007 | 5922-5923 | -RRB- | denotes | ) |
| T4008 | 5923-5924 | . | denotes | . |
| T4009 | 5925-5927 | PRP | denotes | We |
| T4010 | 5928-5932 | JJ | denotes | next |
| T4011 | 5933-5941 | VBD | denotes | examined |
| T4012 | 5942-5945 | DT | denotes | the |
| T4013 | 5946-5953 | JJ | denotes | nuclear |
| T4014 | 5954-5967 | NN | denotes | translocation |
| T4015 | 5968-5970 | IN | denotes | of |
| T4016 | 5971-5975 | CD | denotes | RPS3 |
| T4017 | 5976-5978 | IN | denotes | in |
| T4018 | 5979-5984 | NNS | denotes | cells |
| T4019 | 5985-5996 | RB | denotes | ectopically |
| T4020 | 5997-6007 | VBG | denotes | expressing |
| T4021 | 6008-6014 | CC | denotes | either |
| T4022 | 6015-6026 | NN | denotes | kinase-dead |
| T4023 | 6027-6028 | -LRB- | denotes | ( |
| T4024 | 6028-6032 | NNP | denotes | SSAA |
| T4025 | 6032-6033 | -RRB- | denotes | ) |
| T4026 | 6034-6036 | CC | denotes | or |
| T4027 | 6037-6058 | JJ | denotes | constitutively-active |
| T4028 | 6059-6060 | -LRB- | denotes | ( |
| T4029 | 6060-6064 | NNP | denotes | SSEE |
| T4030 | 6064-6065 | -RRB- | denotes | ) |
| T4031 | 6066-6072 | JJ | denotes | mutant |
| T4032 | 6073-6077 | NNP | denotes | IKKβ |
| T4033 | 6078-6086 | NNS | denotes | proteins |
| T4034 | 6086-6087 | . | denotes | . |
| T4035 | 6088-6090 | IN | denotes | As |
| T4036 | 6091-6099 | VBN | denotes | expected |
| T4037 | 6099-6100 | , | denotes | , |
| T4038 | 6101-6104 | DT | denotes | the |
| T4039 | 6105-6109 | NNP | denotes | SSEE |
| T4040 | 6109-6110 | , | denotes | , |
| T4041 | 6111-6114 | CC | denotes | but |
| T4042 | 6115-6118 | RB | denotes | not |
| T4043 | 6119-6123 | NNP | denotes | SSAA |
| T4044 | 6123-6124 | , | denotes | , |
| T4045 | 6125-6131 | JJ | denotes | mutant |
| T4046 | 6132-6134 | IN | denotes | of |
| T4047 | 6135-6139 | NNP | denotes | IKKβ |
| T4048 | 6140-6147 | VBD | denotes | induced |
| T4049 | 6148-6163 | JJ | denotes | NF-κB-dependent |
| T4050 | 6164-6174 | NN | denotes | luciferase |
| T4051 | 6175-6183 | NN | denotes | reporter |
| T4052 | 6184-6192 | NN | denotes | activity |
| T4053 | 6193-6194 | -LRB- | denotes | ( |
| T4054 | 6194-6198 | NNP | denotes | Fig. |
| T4055 | 6199-6201 | CD | denotes | 2c |
| T4056 | 6201-6202 | , | denotes | , |
| T4057 | 6203-6207 | VBD | denotes | left |
| T4058 | 6207-6208 | -RRB- | denotes | ) |
| T4059 | 6208-6209 | . | denotes | . |
| T4060 | 6210-6217 | IN | denotes | Whereas |
| T4061 | 6218-6222 | CD | denotes | RPS3 |
| T4062 | 6223-6231 | VBD | denotes | remained |
| T4063 | 6232-6241 | JJ | denotes | cytosolic |
| T4064 | 6242-6244 | IN | denotes | in |
| T4065 | 6245-6249 | NNP | denotes | IKKβ |
| T4066 | 6250-6251 | -LRB- | denotes | ( |
| T4067 | 6251-6255 | NNP | denotes | SSAA |
| T4068 | 6255-6256 | -RRB- | denotes | ) |
| T4069 | 6256-6257 | : | denotes | - |
| T4070 | 6257-6267 | VBG | denotes | expressing |
| T4071 | 6268-6273 | NNS | denotes | cells |
| T4072 | 6274-6275 | -LRB- | denotes | ( |
| T4073 | 6275-6279 | NNP | denotes | Fig. |
| T4074 | 6280-6282 | CD | denotes | 2c |
| T4075 | 6282-6283 | , | denotes | , |
| T4076 | 6284-6289 | NN | denotes | right |
| T4077 | 6289-6290 | -RRB- | denotes | ) |
| T4078 | 6290-6291 | , | denotes | , |
| T4079 | 6292-6293 | DT | denotes | a |
| T4080 | 6294-6305 | JJ | denotes | substantial |
| T4081 | 6306-6316 | NN | denotes | proportion |
| T4082 | 6317-6319 | IN | denotes | of |
| T4083 | 6320-6324 | CD | denotes | RPS3 |
| T4084 | 6325-6337 | VBN | denotes | translocated |
| T4085 | 6338-6340 | TO | denotes | to |
| T4086 | 6341-6344 | DT | denotes | the |
| T4087 | 6345-6352 | NN | denotes | nucleus |
| T4088 | 6353-6355 | IN | denotes | in |
| T4089 | 6356-6361 | NNS | denotes | cells |
| T4090 | 6362-6372 | VBG | denotes | expressing |
| T4091 | 6373-6377 | NNP | denotes | IKKβ |
| T4092 | 6378-6379 | -LRB- | denotes | ( |
| T4093 | 6379-6383 | NNP | denotes | SSEE |
| T4094 | 6383-6384 | -RRB- | denotes | ) |
| T4095 | 6385-6386 | -LRB- | denotes | ( |
| T4096 | 6386-6390 | NNP | denotes | Fig. |
| T4097 | 6391-6393 | CD | denotes | 2c |
| T4098 | 6393-6394 | , | denotes | , |
| T4099 | 6395-6400 | NN | denotes | right |
| T4100 | 6400-6401 | -RRB- | denotes | ) |
| T4101 | 6401-6402 | . | denotes | . |
| T4102 | 6403-6406 | DT | denotes | The |
| T4103 | 6407-6417 | NN | denotes | percentage |
| T4104 | 6418-6420 | IN | denotes | of |
| T4105 | 6421-6426 | NNS | denotes | cells |
| T4106 | 6427-6437 | VBG | denotes | containing |
| T4107 | 6438-6448 | JJ | denotes | detectable |
| T4108 | 6449-6456 | JJ | denotes | nuclear |
| T4109 | 6457-6461 | NN | denotes | RPS3 |
| T4110 | 6462-6471 | VBD | denotes | increased |
| T4111 | 6472-6478 | JJ | denotes | 5-fold |
| T4112 | 6479-6481 | IN | denotes | in |
| T4113 | 6482-6486 | NNP | denotes | IKKβ |
| T4114 | 6487-6488 | -LRB- | denotes | ( |
| T4115 | 6488-6492 | NNP | denotes | SSEE |
| T4116 | 6492-6493 | -RRB- | denotes | ) |
| T4117 | 6493-6494 | : | denotes | - |
| T4118 | 6494-6504 | VBG | denotes | expressing |
| T4119 | 6505-6510 | NNS | denotes | cells |
| T4120 | 6510-6511 | , | denotes | , |
| T4121 | 6512-6515 | CC | denotes | but |
| T4122 | 6516-6519 | RB | denotes | not |
| T4123 | 6520-6522 | IN | denotes | in |
| T4124 | 6523-6527 | NNP | denotes | IKKβ |
| T4125 | 6528-6529 | -LRB- | denotes | ( |
| T4126 | 6529-6533 | NNP | denotes | SSAA |
| T4127 | 6533-6534 | -RRB- | denotes | ) |
| T4128 | 6534-6535 | : | denotes | - |
| T4129 | 6535-6545 | VBG | denotes | expressing |
| T4130 | 6546-6550 | NNS | denotes | ones |
| T4131 | 6551-6552 | -LRB- | denotes | ( |
| T4132 | 6552-6556 | NNP | denotes | Fig. |
| T4133 | 6557-6559 | CD | denotes | 2d |
| T4134 | 6560-6563 | CC | denotes | and |
| T4135 | 6564-6577 | NNP | denotes | Supplementary |
| T4136 | 6578-6582 | NNP | denotes | Fig. |
| T4137 | 6583-6584 | CD | denotes | 2 |
| T4138 | 6584-6585 | -RRB- | denotes | ) |
| T4139 | 6585-6586 | . | denotes | . |
| T4140 | 6587-6591 | RB | denotes | Thus |
| T4141 | 6591-6592 | , | denotes | , |
| T4142 | 6593-6597 | JJ | denotes | IKKβ |
| T4143 | 6598-6606 | NN | denotes | activity |
| T4144 | 6607-6609 | VBZ | denotes | is |
| T4145 | 6610-6619 | JJ | denotes | necessary |
| T4146 | 6620-6623 | CC | denotes | and |
| T4147 | 6624-6634 | JJ | denotes | sufficient |
| T4148 | 6635-6638 | IN | denotes | for |
| T4149 | 6639-6643 | JJ | denotes | RPS3 |
| T4150 | 6644-6651 | JJ | denotes | nuclear |
| T4151 | 6652-6665 | NN | denotes | translocation |
| T4152 | 6666-6668 | IN | denotes | in |
| T4153 | 6669-6677 | NN | denotes | response |
| T4154 | 6678-6680 | TO | denotes | to |
| T4155 | 6681-6686 | NNP | denotes | NF-κB |
| T4156 | 6687-6697 | VBG | denotes | activating |
| T4157 | 6698-6705 | NNS | denotes | stimuli |
| T4158 | 6705-6706 | . | denotes | . |
| T5617 | 6708-6712 | NNP | denotes | IκBα |
| T5618 | 6713-6724 | NN | denotes | degradation |
| T5619 | 6725-6728 | CC | denotes | and |
| T5620 | 6729-6733 | JJ | denotes | RPS3 |
| T5621 | 6734-6741 | JJ | denotes | nuclear |
| T5622 | 6742-6755 | NN | denotes | translocation |
| T5623 | 6756-6766 | NNP | denotes | Importin-α |
| T5624 | 6767-6776 | VBZ | denotes | regulates |
| T5625 | 6777-6780 | DT | denotes | the |
| T5626 | 6781-6788 | JJ | denotes | nuclear |
| T5627 | 6789-6795 | NN | denotes | import |
| T5628 | 6796-6798 | IN | denotes | of |
| T5629 | 6799-6804 | NNP | denotes | NF-κB |
| T5630 | 6805-6808 | NNP | denotes | Rel |
| T5631 | 6809-6819 | CD | denotes | subunits23 |
| T5632 | 6819-6820 | , | denotes | , |
| T5633 | 6821-6823 | CD | denotes | 24 |
| T5634 | 6823-6824 | . | denotes | . |
| T5635 | 6825-6829 | CD | denotes | RPS3 |
| T5636 | 6830-6837 | NNS | denotes | harbors |
| T5637 | 6838-6839 | DT | denotes | a |
| T5638 | 6840-6847 | JJ | denotes | nuclear |
| T5639 | 6848-6860 | NN | denotes | localization |
| T5640 | 6861-6867 | NN | denotes | signal |
| T5641 | 6868-6869 | -LRB- | denotes | ( |
| T5642 | 6869-6872 | NNP | denotes | NLS |
| T5643 | 6872-6873 | -RRB- | denotes | ) |
| T5644 | 6874-6882 | NN | denotes | sequence |
| T5645 | 6883-6886 | CC | denotes | and |
| T5646 | 6887-6890 | PRP$ | denotes | its |
| T5647 | 6891-6898 | JJ | denotes | nuclear |
| T5648 | 6899-6912 | NN | denotes | translocation |
| T5649 | 6913-6919 | VBZ | denotes | occurs |
| T5650 | 6920-6922 | IN | denotes | in |
| T5651 | 6923-6931 | NN | denotes | parallel |
| T5652 | 6932-6934 | TO | denotes | to |
| T5653 | 6934-6935 | , | denotes | , |
| T5654 | 6936-6939 | CC | denotes | but |
| T5655 | 6940-6953 | RB | denotes | independently |
| T5656 | 6954-6956 | IN | denotes | of |
| T5657 | 6956-6957 | , | denotes | , |
| T5658 | 6958-6961 | CD | denotes | p65 |
| T5659 | 6962-6976 | NNS | denotes | translocation6 |
| T5660 | 6976-6977 | . | denotes | . |
| T5661 | 6978-6980 | PRP | denotes | We |
| T5662 | 6981-6991 | VBD | denotes | envisioned |
| T5663 | 6992-6996 | IN | denotes | that |
| T5664 | 6997-7001 | NNP | denotes | RPS3 |
| T5665 | 7002-7007 | MD | denotes | could |
| T5666 | 7008-7012 | RB | denotes | also |
| T5667 | 7013-7020 | VB | denotes | utilize |
| T5668 | 7021-7024 | DT | denotes | the |
| T5669 | 7025-7035 | JJ | denotes | importin-α |
| T5670 | 7035-7036 | NN | denotes | / |
| T5671 | 7036-7037 | NN | denotes | β |
| T5672 | 7038-7045 | NN | denotes | pathway |
| T5673 | 7045-7046 | . | denotes | . |
| T5674 | 7047-7057 | JJ | denotes | Consistent |
| T5675 | 7058-7062 | IN | denotes | with |
| T5676 | 7063-7067 | DT | denotes | this |
| T5677 | 7068-7074 | NN | denotes | notion |
| T5678 | 7074-7075 | , | denotes | , |
| T5679 | 7076-7080 | JJ | denotes | RPS3 |
| T5680 | 7081-7092 | NN | denotes | association |
| T5681 | 7093-7097 | IN | denotes | with |
| T5682 | 7098-7108 | JJ | denotes | importin-α |
| T5683 | 7108-7109 | , | denotes | , |
| T5684 | 7110-7113 | CC | denotes | but |
| T5685 | 7114-7117 | RB | denotes | not |
| T5686 | 7118-7128 | JJ | denotes | importin-β |
| T5687 | 7128-7129 | , | denotes | , |
| T5688 | 7130-7133 | VBD | denotes | was |
| T5689 | 7134-7142 | VBN | denotes | enhanced |
| T5690 | 7143-7145 | IN | denotes | in |
| T5691 | 7146-7149 | NNP | denotes | TNF |
| T5692 | 7150-7160 | VBD | denotes | stimulated |
| T5693 | 7161-7166 | NNS | denotes | cells |
| T5694 | 7167-7168 | -LRB- | denotes | ( |
| T5695 | 7168-7172 | NNP | denotes | Fig. |
| T5696 | 7173-7175 | CD | denotes | 3a |
| T5697 | 7175-7176 | -RRB- | denotes | ) |
| T5698 | 7176-7177 | . | denotes | . |
| T5699 | 7178-7187 | RB | denotes | Therefore |
| T5700 | 7187-7188 | , | denotes | , |
| T5701 | 7189-7191 | PRP | denotes | we |
| T5702 | 7192-7200 | VBD | denotes | examined |
| T5703 | 7201-7208 | IN | denotes | whether |
| T5704 | 7209-7213 | NNP | denotes | RPS3 |
| T5705 | 7214-7221 | JJ | denotes | binding |
| T5706 | 7222-7224 | TO | denotes | to |
| T5707 | 7225-7235 | NN | denotes | importin-α |
| T5708 | 7236-7238 | VBZ | denotes | is |
| T5709 | 7239-7248 | JJ | denotes | essential |
| T5710 | 7249-7252 | IN | denotes | for |
| T5711 | 7253-7260 | JJ | denotes | nuclear |
| T5712 | 7261-7274 | NN | denotes | translocation |
| T5713 | 7275-7281 | IN | denotes | during |
| T5714 | 7282-7287 | NNP | denotes | NF-κB |
| T5715 | 7288-7298 | NN | denotes | activation |
| T5716 | 7298-7299 | . | denotes | . |
| T5717 | 7300-7305 | IN | denotes | Since |
| T5718 | 7306-7310 | NNP | denotes | IκBα |
| T5719 | 7311-7322 | NN | denotes | degradation |
| T5720 | 7323-7325 | VBZ | denotes | is |
| T5721 | 7326-7327 | DT | denotes | a |
| T5722 | 7328-7340 | NN | denotes | prerequisite |
| T5723 | 7341-7343 | TO | denotes | to |
| T5724 | 7344-7350 | VB | denotes | unmask |
| T5725 | 7351-7354 | DT | denotes | the |
| T5726 | 7355-7358 | NNP | denotes | NLS |
| T5727 | 7359-7361 | IN | denotes | of |
| T5728 | 7362-7365 | CD | denotes | p65 |
| T5729 | 7365-7366 | , | denotes | , |
| T5730 | 7367-7370 | CC | denotes | and |
| T5731 | 7371-7375 | DT | denotes | both |
| T5732 | 7376-7380 | CD | denotes | RPS3 |
| T5733 | 7381-7384 | CC | denotes | and |
| T5734 | 7385-7389 | NNP | denotes | IκBα |
| T5735 | 7390-7394 | NN | denotes | bind |
| T5736 | 7395-7397 | TO | denotes | to |
| T5737 | 7398-7401 | VB | denotes | p65 |
| T5738 | 7402-7404 | IN | denotes | in |
| T5739 | 7405-7408 | DT | denotes | the |
| T5740 | 7409-7420 | JJ | denotes | cytoplasmic |
| T5741 | 7421-7431 | NN | denotes | inhibitory |
| T5742 | 7432-7439 | NN | denotes | complex |
| T5743 | 7439-7440 | , | denotes | , |
| T5744 | 7441-7443 | PRP | denotes | we |
| T5745 | 7444-7450 | VBD | denotes | tested |
| T5746 | 7451-7458 | IN | denotes | whether |
| T5747 | 7459-7463 | NNP | denotes | IκBα |
| T5748 | 7464-7475 | NN | denotes | degradation |
| T5749 | 7476-7478 | VBZ | denotes | is |
| T5750 | 7479-7487 | VBN | denotes | required |
| T5751 | 7488-7491 | IN | denotes | for |
| T5752 | 7492-7495 | DT | denotes | the |
| T5753 | 7496-7506 | NN | denotes | liberation |
| T5754 | 7507-7509 | IN | denotes | of |
| T5755 | 7510-7514 | NNP | denotes | RPS3 |
| T5756 | 7514-7515 | . | denotes | . |
| T5757 | 7516-7518 | PRP | denotes | We |
| T5758 | 7519-7527 | VBD | denotes | measured |
| T5759 | 7528-7531 | DT | denotes | the |
| T5760 | 7532-7543 | NN | denotes | association |
| T5761 | 7544-7546 | IN | denotes | of |
| T5762 | 7547-7551 | CD | denotes | RPS3 |
| T5763 | 7552-7556 | IN | denotes | with |
| T5764 | 7557-7567 | JJ | denotes | importin-α |
| T5765 | 7568-7570 | IN | denotes | in |
| T5766 | 7571-7575 | JJ | denotes | 293T |
| T5767 | 7576-7581 | NNS | denotes | cells |
| T5768 | 7582-7596 | VBG | denotes | overexpressing |
| T5769 | 7597-7606 | JJ | denotes | wild-type |
| T5770 | 7607-7611 | NNP | denotes | IκBα |
| T5771 | 7612-7614 | CC | denotes | or |
| T5772 | 7615-7617 | DT | denotes | an |
| T5773 | 7618-7622 | NNP | denotes | IκBα |
| T5774 | 7623-7629 | JJ | denotes | mutant |
| T5775 | 7630-7631 | -LRB- | denotes | ( |
| T5776 | 7631-7635 | NNP | denotes | SSAA |
| T5777 | 7635-7636 | -RRB- | denotes | ) |
| T5778 | 7637-7646 | NN | denotes | resistant |
| T5779 | 7647-7649 | TO | denotes | to |
| T5780 | 7650-7662 | JJ | denotes | IKKβ-induced |
| T5781 | 7663-7678 | NN | denotes | phosphorylation |
| T5782 | 7679-7682 | CC | denotes | and |
| T5783 | 7683-7694 | NN | denotes | degradation |
| T5784 | 7694-7695 | . | denotes | . |
| T5785 | 7696-7698 | IN | denotes | In |
| T5786 | 7699-7704 | NNS | denotes | cells |
| T5787 | 7705-7716 | VBN | denotes | transfected |
| T5788 | 7717-7721 | IN | denotes | with |
| T5789 | 7722-7731 | JJ | denotes | wild-type |
| T5790 | 7732-7736 | NNP | denotes | IκBα |
| T5791 | 7736-7737 | , | denotes | , |
| T5792 | 7738-7741 | NNP | denotes | TNF |
| T5793 | 7742-7753 | NN | denotes | stimulation |
| T5794 | 7754-7763 | VBD | denotes | augmented |
| T5795 | 7764-7767 | DT | denotes | the |
| T5796 | 7768-7779 | NN | denotes | interaction |
| T5797 | 7780-7782 | IN | denotes | of |
| T5798 | 7783-7787 | NNP | denotes | RPS3 |
| T5799 | 7788-7791 | CC | denotes | and |
| T5800 | 7792-7802 | JJ | denotes | importin-α |
| T5801 | 7803-7805 | TO | denotes | to |
| T5802 | 7806-7807 | DT | denotes | a |
| T5803 | 7808-7815 | JJ | denotes | similar |
| T5804 | 7816-7822 | NN | denotes | degree |
| T5805 | 7823-7825 | IN | denotes | as |
| T5806 | 7826-7828 | IN | denotes | in |
| T5807 | 7829-7844 | JJ | denotes | non-transfected |
| T5808 | 7845-7850 | NNS | denotes | cells |
| T5809 | 7850-7851 | . | denotes | . |
| T5810 | 7852-7854 | IN | denotes | By |
| T5811 | 7855-7863 | NN | denotes | contrast |
| T5812 | 7863-7864 | , | denotes | , |
| T5813 | 7865-7867 | PRP | denotes | we |
| T5814 | 7868-7876 | VBD | denotes | observed |
| T5815 | 7877-7881 | IN | denotes | that |
| T5816 | 7882-7885 | DT | denotes | the |
| T5817 | 7886-7901 | JJ | denotes | RPS3-importin-α |
| T5818 | 7902-7913 | NN | denotes | association |
| T5819 | 7914-7917 | VBD | denotes | was |
| T5820 | 7918-7927 | VBN | denotes | abolished |
| T5821 | 7928-7930 | IN | denotes | by |
| T5822 | 7931-7934 | DT | denotes | the |
| T5823 | 7935-7943 | NN | denotes | presence |
| T5824 | 7944-7946 | IN | denotes | of |
| T5825 | 7947-7961 | JJ | denotes | non-degradable |
| T5826 | 7962-7966 | NNP | denotes | IκBα |
| T5827 | 7967-7968 | -LRB- | denotes | ( |
| T5828 | 7968-7972 | NNP | denotes | Fig. |
| T5829 | 7973-7975 | CD | denotes | 3b |
| T5830 | 7975-7976 | -RRB- | denotes | ) |
| T5831 | 7976-7977 | . | denotes | . |
| T5832 | 7978-7980 | TO | denotes | To |
| T5833 | 7981-7988 | VB | denotes | examine |
| T5834 | 7989-7996 | IN | denotes | whether |
| T5835 | 7997-8001 | NNP | denotes | IκBα |
| T5836 | 8002-8004 | VBZ | denotes | is |
| T5837 | 8005-8008 | DT | denotes | the |
| T5838 | 8009-8013 | JJ | denotes | only |
| T5839 | 8014-8025 | JJ | denotes | cytoplasmic |
| T5840 | 8026-8033 | NN | denotes | barrier |
| T5841 | 8034-8044 | VBG | denotes | precluding |
| T5842 | 8045-8049 | NNP | denotes | RPS3 |
| T5843 | 8050-8057 | JJ | denotes | nuclear |
| T5844 | 8058-8071 | NN | denotes | translocation |
| T5845 | 8071-8072 | , | denotes | , |
| T5846 | 8073-8075 | PRP | denotes | we |
| T5847 | 8076-8084 | VBD | denotes | measured |
| T5848 | 8085-8089 | DT | denotes | both |
| T5849 | 8090-8105 | JJ | denotes | RPS3-importin-α |
| T5850 | 8106-8117 | NN | denotes | association |
| T5851 | 8118-8121 | CC | denotes | and |
| T5852 | 8122-8129 | JJ | denotes | nuclear |
| T5853 | 8130-8134 | NN | denotes | RPS3 |
| T5854 | 8135-8140 | IN | denotes | after |
| T5855 | 8141-8149 | VBG | denotes | reducing |
| T5856 | 8150-8154 | NNP | denotes | IκBα |
| T5857 | 8155-8165 | NN | denotes | expression |
| T5858 | 8165-8166 | . | denotes | . |
| T5859 | 8167-8175 | VBN | denotes | Compared |
| T5860 | 8176-8180 | IN | denotes | with |
| T5861 | 8181-8192 | JJ | denotes | nonspecific |
| T5862 | 8193-8198 | NNP | denotes | siRNA |
| T5863 | 8198-8199 | , | denotes | , |
| T5864 | 8200-8205 | NNP | denotes | siRNA |
| T5865 | 8206-8215 | VBG | denotes | targeting |
| T5866 | 8216-8218 | IN | denotes | of |
| T5867 | 8219-8223 | NNP | denotes | IκBα |
| T5868 | 8224-8234 | RB | denotes | completely |
| T5869 | 8235-8243 | VBD | denotes | depleted |
| T5870 | 8244-8248 | NNP | denotes | IκBα |
| T5871 | 8249-8251 | IN | denotes | in |
| T5872 | 8252-8258 | NNP | denotes | Jurkat |
| T5873 | 8259-8264 | NNS | denotes | cells |
| T5874 | 8265-8266 | -LRB- | denotes | ( |
| T5875 | 8266-8270 | NNP | denotes | Fig. |
| T5876 | 8271-8273 | CD | denotes | 3c |
| T5877 | 8273-8274 | , | denotes | , |
| T5878 | 8275-8280 | NN | denotes | input |
| T5879 | 8280-8281 | -RRB- | denotes | ) |
| T5880 | 8281-8282 | . | denotes | . |
| T5881 | 8283-8295 | RB | denotes | Nevertheless |
| T5882 | 8295-8296 | , | denotes | , |
| T5883 | 8297-8300 | DT | denotes | the |
| T5884 | 8301-8316 | JJ | denotes | RPS3-importin-α |
| T5885 | 8317-8328 | NN | denotes | association |
| T5886 | 8329-8332 | VBD | denotes | was |
| T5887 | 8333-8336 | RB | denotes | not |
| T5888 | 8337-8346 | VBN | denotes | augmented |
| T5889 | 8347-8348 | -LRB- | denotes | ( |
| T5890 | 8348-8352 | NNP | denotes | Fig. |
| T5891 | 8353-8355 | CD | denotes | 3c |
| T5892 | 8355-8356 | -RRB- | denotes | ) |
| T5893 | 8356-8357 | , | denotes | , |
| T5894 | 8358-8361 | CC | denotes | nor |
| T5895 | 8362-8365 | VBD | denotes | was |
| T5896 | 8366-8377 | JJ | denotes | significant |
| T5897 | 8378-8385 | JJ | denotes | nuclear |
| T5898 | 8386-8390 | JJ | denotes | RPS3 |
| T5899 | 8391-8399 | VBN | denotes | detected |
| T5900 | 8400-8401 | -LRB- | denotes | ( |
| T5901 | 8401-8405 | NNP | denotes | Fig. |
| T5902 | 8406-8408 | CD | denotes | 3d |
| T5903 | 8408-8409 | -RRB- | denotes | ) |
| T5904 | 8409-8410 | . | denotes | . |
| T5905 | 8411-8419 | RB | denotes | Moreover |
| T5906 | 8419-8420 | , | denotes | , |
| T5907 | 8421-8426 | NNS | denotes | cells |
| T5908 | 8427-8434 | VBN | denotes | treated |
| T5909 | 8435-8439 | IN | denotes | with |
| T5910 | 8440-8446 | NN | denotes | sodium |
| T5911 | 8447-8458 | NN | denotes | pervanadate |
| T5912 | 8459-8460 | -LRB- | denotes | ( |
| T5913 | 8460-8462 | NNP | denotes | Pv |
| T5914 | 8462-8463 | -RRB- | denotes | ) |
| T5915 | 8464-8466 | TO | denotes | to |
| T5916 | 8467-8473 | VB | denotes | induce |
| T5917 | 8474-8478 | NNP | denotes | IκBα |
| T5918 | 8479-8490 | NN | denotes | degradation |
| T5919 | 8491-8498 | IN | denotes | through |
| T5920 | 8499-8501 | DT | denotes | an |
| T5921 | 8502-8517 | JJ | denotes | IKK-independent |
| T5922 | 8518-8532 | NN | denotes | mechanism25-27 |
| T5923 | 8533-8536 | VBD | denotes | did |
| T5924 | 8537-8540 | RB | denotes | not |
| T5925 | 8541-8545 | VB | denotes | show |
| T5926 | 8546-8555 | JJ | denotes | increased |
| T5927 | 8556-8567 | NN | denotes | association |
| T5928 | 8568-8575 | IN | denotes | between |
| T5929 | 8576-8580 | CD | denotes | RPS3 |
| T5930 | 8581-8584 | CC | denotes | and |
| T5931 | 8585-8595 | JJ | denotes | importin-α |
| T5932 | 8596-8597 | -LRB- | denotes | ( |
| T5933 | 8597-8601 | NNP | denotes | Fig. |
| T5934 | 8602-8604 | CD | denotes | 3e |
| T5935 | 8605-8608 | CC | denotes | and |
| T5936 | 8609-8622 | NNP | denotes | Supplementary |
| T5937 | 8623-8627 | NNP | denotes | Fig. |
| T5938 | 8628-8630 | CD | denotes | 3b |
| T5939 | 8630-8631 | -RRB- | denotes | ) |
| T5940 | 8632-8634 | CC | denotes | or |
| T5941 | 8635-8642 | JJ | denotes | nuclear |
| T5942 | 8643-8655 | NN | denotes | accumulation |
| T5943 | 8656-8658 | IN | denotes | of |
| T5944 | 8659-8663 | NNP | denotes | RPS3 |
| T5945 | 8663-8664 | , | denotes | , |
| T5946 | 8665-8672 | IN | denotes | despite |
| T5947 | 8673-8681 | JJ | denotes | complete |
| T5948 | 8682-8686 | NNP | denotes | IκBα |
| T5949 | 8687-8698 | NN | denotes | degradation |
| T5950 | 8699-8700 | -LRB- | denotes | ( |
| T5951 | 8700-8713 | NNP | denotes | Supplementary |
| T5952 | 8714-8718 | NNP | denotes | Fig. |
| T5953 | 8719-8721 | CD | denotes | 3c |
| T5954 | 8721-8722 | -RRB- | denotes | ) |
| T5955 | 8722-8723 | . | denotes | . |
| T5956 | 8724-8726 | PRP | denotes | We |
| T5957 | 8727-8734 | RB | denotes | further |
| T5958 | 8735-8743 | VBD | denotes | examined |
| T5959 | 8744-8751 | IN | denotes | whether |
| T5960 | 8752-8753 | DT | denotes | a |
| T5961 | 8754-8764 | JJ | denotes | subsequent |
| T5962 | 8765-8770 | NN | denotes | NF-κB |
| T5963 | 8771-8781 | NN | denotes | activation |
| T5964 | 8782-8788 | NN | denotes | signal |
| T5965 | 8789-8802 | RB | denotes | independently |
| T5966 | 8803-8811 | VBZ | denotes | promotes |
| T5967 | 8812-8815 | DT | denotes | the |
| T5968 | 8816-8826 | JJ | denotes | importin-α |
| T5969 | 8827-8838 | NN | denotes | association |
| T5970 | 8839-8842 | CC | denotes | and |
| T5971 | 8843-8850 | JJ | denotes | nuclear |
| T5972 | 8851-8860 | NN | denotes | transport |
| T5973 | 8861-8863 | IN | denotes | of |
| T5974 | 8864-8868 | CD | denotes | RPS3 |
| T5975 | 8869-8874 | IN | denotes | after |
| T5976 | 8875-8879 | NNP | denotes | IκBα |
| T5977 | 8880-8891 | NN | denotes | degradation |
| T5978 | 8891-8892 | . | denotes | . |
| T5979 | 8893-8895 | PRP | denotes | We |
| T5980 | 8896-8901 | VBD | denotes | found |
| T5981 | 8902-8906 | IN | denotes | that |
| T5982 | 8907-8910 | NNP | denotes | TNF |
| T5983 | 8911-8922 | NN | denotes | stimulation |
| T5984 | 8923-8932 | VBG | denotes | following |
| T5985 | 8933-8935 | NNP | denotes | Pv |
| T5986 | 8936-8945 | NN | denotes | treatment |
| T5987 | 8946-8949 | VBD | denotes | was |
| T5988 | 8950-8958 | VBN | denotes | required |
| T5989 | 8959-8962 | IN | denotes | for |
| T5990 | 8963-8966 | DT | denotes | the |
| T5991 | 8967-8982 | JJ | denotes | RPS3-importin-α |
| T5992 | 8983-8994 | NN | denotes | association |
| T5993 | 8994-8995 | , | denotes | , |
| T5994 | 8996-9006 | JJ | denotes | comparable |
| T5995 | 9007-9009 | TO | denotes | to |
| T5996 | 9010-9013 | NNP | denotes | TNF |
| T5997 | 9014-9025 | NN | denotes | stimulation |
| T5998 | 9026-9031 | RB | denotes | alone |
| T5999 | 9032-9033 | -LRB- | denotes | ( |
| T6000 | 9033-9037 | NNP | denotes | Fig. |
| T6001 | 9038-9040 | CD | denotes | 3e |
| T6002 | 9040-9041 | -RRB- | denotes | ) |
| T6003 | 9041-9042 | . | denotes | . |
| T6004 | 9043-9047 | RB | denotes | Thus |
| T6005 | 9047-9048 | , | denotes | , |
| T6006 | 9049-9053 | NNP | denotes | IκBα |
| T6007 | 9054-9069 | NN | denotes | phosphorylation |
| T6008 | 9070-9073 | CC | denotes | and |
| T6009 | 9074-9085 | NN | denotes | degradation |
| T6010 | 9086-9092 | PRP | denotes | itself |
| T6011 | 9093-9095 | VBZ | denotes | is |
| T6012 | 9096-9104 | VBN | denotes | required |
| T6013 | 9105-9108 | CC | denotes | but |
| T6014 | 9109-9112 | RB | denotes | not |
| T6015 | 9113-9123 | JJ | denotes | sufficient |
| T6016 | 9124-9126 | TO | denotes | to |
| T6017 | 9127-9132 | VB | denotes | cause |
| T6018 | 9133-9137 | JJ | denotes | RPS3 |
| T6019 | 9138-9149 | NN | denotes | association |
| T6020 | 9150-9154 | IN | denotes | with |
| T6021 | 9155-9165 | JJ | denotes | importin-α |
| T6022 | 9166-9174 | VBN | denotes | followed |
| T6023 | 9175-9177 | IN | denotes | by |
| T6024 | 9178-9185 | JJ | denotes | nuclear |
| T6025 | 9186-9199 | NN | denotes | translocation |
| T6026 | 9199-9200 | . | denotes | . |
| T6027 | 9201-9207 | RB | denotes | Rather |
| T6028 | 9207-9208 | , | denotes | , |
| T6029 | 9209-9211 | DT | denotes | an |
| T6030 | 9212-9222 | JJ | denotes | additional |
| T6031 | 9223-9229 | NN | denotes | signal |
| T6032 | 9229-9230 | , | denotes | , |
| T6033 | 9231-9242 | RB | denotes | potentially |
| T6034 | 9243-9247 | NNP | denotes | IKKβ |
| T6035 | 9248-9263 | NN | denotes | phosphorylation |
| T6036 | 9264-9266 | IN | denotes | of |
| T6037 | 9267-9271 | NNP | denotes | RPS3 |
| T6038 | 9271-9272 | , | denotes | , |
| T6039 | 9273-9275 | VBZ | denotes | is |
| T6040 | 9276-9284 | VBN | denotes | required |
| T6041 | 9284-9285 | . | denotes | . |
| T7671 | 9287-9291 | NNP | denotes | IKKβ |
| T7672 | 9292-9306 | VBZ | denotes | phosphorylates |
| T7673 | 9307-9311 | CD | denotes | RPS3 |
| T7674 | 9312-9314 | IN | denotes | at |
| T7675 | 9315-9321 | NN | denotes | serine |
| T7676 | 9322-9325 | CD | denotes | 209 |
| T7677 | 9326-9334 | IN | denotes | Although |
| T7678 | 9335-9345 | RB | denotes | originally |
| T7679 | 9346-9353 | VBN | denotes | defined |
| T7680 | 9354-9356 | IN | denotes | as |
| T7681 | 9357-9360 | DT | denotes | the |
| T7682 | 9361-9367 | NN | denotes | kinase |
| T7683 | 9368-9372 | WDT | denotes | that |
| T7684 | 9373-9387 | VBZ | denotes | phosphorylates |
| T7685 | 9388-9393 | NNP | denotes | IκB19 |
| T7686 | 9393-9394 | , | denotes | , |
| T7687 | 9395-9399 | NNP | denotes | IKKβ |
| T7688 | 9400-9404 | RB | denotes | also |
| T7689 | 9405-9419 | VBZ | denotes | phosphorylates |
| T7690 | 9420-9429 | JJ | denotes | unrelated |
| T7691 | 9430-9440 | NNS | denotes | substrates |
| T7692 | 9441-9450 | VBG | denotes | including |
| T7693 | 9451-9458 | JJ | denotes | 14-3-3β |
| T7694 | 9459-9462 | CC | denotes | and |
| T7695 | 9463-9468 | JJ | denotes | Bcl10 |
| T7696 | 9468-9469 | , | denotes | , |
| T7697 | 9470-9475 | WDT | denotes | which |
| T7698 | 9476-9480 | VBP | denotes | lack |
| T7699 | 9481-9484 | DT | denotes | the |
| T7700 | 9485-9488 | NNP | denotes | IKK |
| T7701 | 9489-9498 | NN | denotes | consensus |
| T7702 | 9499-9504 | NN | denotes | motif |
| T7703 | 9505-9506 | -LRB- | denotes | ( |
| T7704 | 9506-9516 | NNP | denotes | DpSGYXpS/T |
| T7705 | 9516-9517 | -RRB- | denotes | ) |
| T7706 | 9517-9519 | CD | denotes | 28 |
| T7707 | 9519-9520 | . | denotes | . |
| T7708 | 9521-9523 | PRP | denotes | We |
| T7709 | 9524-9533 | RB | denotes | therefore |
| T7710 | 9534-9546 | VBD | denotes | hypothesized |
| T7711 | 9547-9551 | IN | denotes | that |
| T7712 | 9552-9556 | NNP | denotes | IKKβ |
| T7713 | 9557-9562 | MD | denotes | could |
| T7714 | 9563-9571 | RB | denotes | directly |
| T7715 | 9572-9585 | VB | denotes | phosphorylate |
| T7716 | 9586-9590 | NNP | denotes | RPS3 |
| T7717 | 9590-9591 | . | denotes | . |
| T7718 | 9592-9594 | IN | denotes | By |
| T7719 | 9595-9597 | IN | denotes | in |
| T7720 | 9598-9603 | NN | denotes | vitro |
| T7721 | 9604-9610 | NN | denotes | kinase |
| T7722 | 9611-9617 | VBZ | denotes | assays |
| T7723 | 9618-9623 | VBG | denotes | using |
| T7724 | 9624-9635 | JJ | denotes | recombinant |
| T7725 | 9636-9639 | NNP | denotes | IKK |
| T7726 | 9640-9643 | CC | denotes | and |
| T7727 | 9644-9648 | NNP | denotes | RPS3 |
| T7728 | 9649-9657 | NNS | denotes | proteins |
| T7729 | 9657-9658 | , | denotes | , |
| T7730 | 9659-9661 | PRP | denotes | we |
| T7731 | 9662-9670 | VBD | denotes | observed |
| T7732 | 9671-9677 | JJ | denotes | strong |
| T7733 | 9678-9691 | NN | denotes | incorporation |
| T7734 | 9692-9694 | IN | denotes | of |
| T7735 | 9695-9698 | NNP | denotes | 32P |
| T7736 | 9699-9701 | IN | denotes | in |
| T7737 | 9702-9719 | NN | denotes | autophosphorylatd |
| T7738 | 9720-9724 | NNP | denotes | IKKα |
| T7739 | 9725-9728 | CC | denotes | and |
| T7740 | 9729-9733 | NNP | denotes | IKKβ |
| T7741 | 9734-9735 | -LRB- | denotes | ( |
| T7742 | 9735-9739 | NNP | denotes | Fig. |
| T7743 | 9740-9742 | CD | denotes | 4a |
| T7744 | 9742-9743 | , | denotes | , |
| T7745 | 9744-9749 | NNS | denotes | lanes |
| T7746 | 9750-9753 | JJ | denotes | 2-7 |
| T7747 | 9753-9754 | -RRB- | denotes | ) |
| T7748 | 9755-9757 | RB | denotes | as |
| T7749 | 9758-9762 | RB | denotes | well |
| T7750 | 9763-9765 | IN | denotes | as |
| T7751 | 9766-9779 | VBN | denotes | phosporylated |
| T7752 | 9780-9788 | NNP | denotes | GST-IκBα |
| T7753 | 9789-9790 | -LRB- | denotes | ( |
| T7754 | 9790-9794 | CD | denotes | 1-54 |
| T7755 | 9794-9795 | -RRB- | denotes | ) |
| T7756 | 9796-9797 | -LRB- | denotes | ( |
| T7757 | 9797-9810 | NNP | denotes | Supplementary |
| T7758 | 9811-9815 | NNP | denotes | Fig. |
| T7759 | 9816-9817 | LS | denotes | 4 |
| T7760 | 9817-9818 | -RRB- | denotes | ) |
| T7761 | 9818-9819 | , | denotes | , |
| T7762 | 9820-9823 | CC | denotes | but |
| T7763 | 9824-9827 | RB | denotes | not |
| T7764 | 9828-9831 | DT | denotes | the |
| T7765 | 9832-9835 | NNP | denotes | GST |
| T7766 | 9836-9843 | NN | denotes | protein |
| T7767 | 9844-9849 | RB | denotes | alone |
| T7768 | 9850-9851 | -LRB- | denotes | ( |
| T7769 | 9851-9855 | NNP | denotes | Fig. |
| T7770 | 9856-9858 | CD | denotes | 4a |
| T7771 | 9858-9859 | , | denotes | , |
| T7772 | 9860-9865 | NNS | denotes | lanes |
| T7773 | 9866-9867 | CD | denotes | 3 |
| T7774 | 9868-9871 | CC | denotes | and |
| T7775 | 9872-9873 | CD | denotes | 6 |
| T7776 | 9873-9874 | -RRB- | denotes | ) |
| T7777 | 9874-9875 | , | denotes | , |
| T7778 | 9876-9880 | WRB | denotes | when |
| T7779 | 9881-9887 | CC | denotes | either |
| T7780 | 9888-9892 | NNP | denotes | IKKα |
| T7781 | 9893-9895 | CC | denotes | or |
| T7782 | 9896-9900 | NNP | denotes | IKKβ |
| T7783 | 9901-9904 | VBD | denotes | was |
| T7784 | 9905-9909 | VBN | denotes | used |
| T7785 | 9909-9910 | . | denotes | . |
| T7786 | 9911-9913 | PRP | denotes | We |
| T7787 | 9914-9924 | VBD | denotes | discovered |
| T7788 | 9925-9929 | IN | denotes | that |
| T7789 | 9930-9938 | NN | denotes | GST-RPS3 |
| T7790 | 9939-9944 | MD | denotes | could |
| T7791 | 9945-9947 | VB | denotes | be |
| T7792 | 9948-9962 | VBN | denotes | phosphorylated |
| T7793 | 9963-9965 | IN | denotes | by |
| T7794 | 9966-9970 | NNP | denotes | IKKβ |
| T7795 | 9970-9971 | , | denotes | , |
| T7796 | 9972-9975 | CC | denotes | but |
| T7797 | 9976-9979 | RB | denotes | not |
| T7798 | 9980-9984 | NNP | denotes | IKKα |
| T7799 | 9984-9985 | , | denotes | , |
| T7800 | 9986-9988 | IN | denotes | in |
| T7801 | 9989-9994 | NN | denotes | vitro |
| T7802 | 9995-9996 | -LRB- | denotes | ( |
| T7803 | 9996-10000 | NNP | denotes | Fig. |
| T7804 | 10001-10003 | CD | denotes | 4a |
| T7805 | 10003-10004 | , | denotes | , |
| T7806 | 10005-10012 | VBP | denotes | compare |
| T7807 | 10013-10018 | NNS | denotes | lanes |
| T7808 | 10019-10020 | CD | denotes | 4 |
| T7809 | 10021-10024 | CC | denotes | and |
| T7810 | 10025-10026 | CD | denotes | 7 |
| T7811 | 10026-10027 | -RRB- | denotes | ) |
| T7812 | 10027-10028 | . | denotes | . |
| T7813 | 10029-10031 | TO | denotes | To |
| T7814 | 10032-10040 | VB | denotes | identify |
| T7815 | 10041-10044 | DT | denotes | the |
| T7816 | 10045-10049 | JJ | denotes | RPS3 |
| T7817 | 10050-10055 | JJ | denotes | amino |
| T7818 | 10056-10060 | NN | denotes | acid |
| T7819 | 10061-10068 | NN | denotes | residue |
| T7820 | 10068-10069 | -LRB- | denotes | ( |
| T7821 | 10069-10070 | PRP | denotes | s |
| T7822 | 10070-10071 | -RRB- | denotes | ) |
| T7823 | 10072-10086 | VBN | denotes | phosphorylated |
| T7824 | 10087-10089 | IN | denotes | by |
| T7825 | 10090-10094 | NNP | denotes | IKKβ |
| T7826 | 10094-10095 | , | denotes | , |
| T7827 | 10096-10098 | PRP | denotes | we |
| T7828 | 10099-10108 | VBD | denotes | performed |
| T7829 | 10109-10115 | JJ | denotes | liquid |
| T7830 | 10116-10137 | NN | denotes | chromatography-tandem |
| T7831 | 10138-10142 | NN | denotes | mass |
| T7832 | 10143-10155 | NN | denotes | spectrometry |
| T7833 | 10156-10164 | VBZ | denotes | analyses |
| T7834 | 10165-10170 | VBG | denotes | using |
| T7835 | 10171-10173 | IN | denotes | in |
| T7836 | 10174-10179 | NN | denotes | vitro |
| T7837 | 10180-10194 | VBN | denotes | phosphorylated |
| T7838 | 10195-10199 | NNP | denotes | RPS3 |
| T7839 | 10199-10200 | . | denotes | . |
| T7840 | 10201-10204 | DT | denotes | The |
| T7841 | 10205-10212 | NNS | denotes | results |
| T7842 | 10213-10222 | VBD | denotes | indicated |
| T7843 | 10223-10227 | IN | denotes | that |
| T7844 | 10228-10232 | NNP | denotes | IKKβ |
| T7845 | 10233-10247 | VBD | denotes | phosphorylated |
| T7846 | 10248-10252 | CD | denotes | S209 |
| T7847 | 10252-10253 | , | denotes | , |
| T7848 | 10254-10261 | VBN | denotes | located |
| T7849 | 10262-10264 | IN | denotes | in |
| T7850 | 10265-10268 | DT | denotes | the |
| T7851 | 10269-10273 | NNP | denotes | RPS3 |
| T7852 | 10274-10284 | NNP | denotes | C-terminus |
| T7853 | 10285-10286 | -LRB- | denotes | ( |
| T7854 | 10286-10290 | NNP | denotes | Fig. |
| T7855 | 10291-10293 | CD | denotes | 4b |
| T7856 | 10293-10294 | -RRB- | denotes | ) |
| T7857 | 10294-10295 | . | denotes | . |
| T7858 | 10296-10300 | CD | denotes | RPS3 |
| T7859 | 10301-10306 | JJ | denotes | amino |
| T7860 | 10307-10311 | NN | denotes | acid |
| T7861 | 10312-10320 | NN | denotes | sequence |
| T7862 | 10321-10330 | NN | denotes | alignment |
| T7863 | 10331-10339 | VBD | denotes | revealed |
| T7864 | 10340-10344 | IN | denotes | that |
| T7865 | 10345-10349 | CD | denotes | S209 |
| T7866 | 10350-10352 | VBZ | denotes | is |
| T7867 | 10353-10362 | VBN | denotes | conserved |
| T7868 | 10363-10365 | IN | denotes | in |
| T7869 | 10366-10370 | JJ | denotes | many |
| T7870 | 10371-10378 | NNS | denotes | species |
| T7871 | 10379-10389 | IN | denotes | throughout |
| T7872 | 10390-10399 | NN | denotes | phylogeny |
| T7873 | 10400-10404 | IN | denotes | with |
| T7874 | 10405-10408 | DT | denotes | the |
| T7875 | 10409-10418 | NN | denotes | exception |
| T7876 | 10419-10421 | IN | denotes | of |
| T7877 | 10422-10436 | NNP | denotes | Caenorhabditis |
| T7878 | 10437-10444 | NNS | denotes | elegans |
| T7879 | 10445-10448 | CC | denotes | and |
| T7880 | 10449-10468 | NNS | denotes | Schizosaccharomyces |
| T7881 | 10469-10474 | VBP | denotes | pombe |
| T7882 | 10474-10475 | , | denotes | , |
| T7883 | 10476-10479 | CD | denotes | two |
| T7884 | 10480-10489 | NNS | denotes | organisms |
| T7885 | 10490-10494 | WDT | denotes | that |
| T7886 | 10495-10497 | VBP | denotes | do |
| T7887 | 10498-10501 | RB | denotes | not |
| T7888 | 10502-10509 | VB | denotes | possess |
| T7889 | 10510-10513 | DT | denotes | the |
| T7890 | 10514-10519 | JJ | denotes | NF-κB |
| T7891 | 10520-10526 | NN | denotes | signal |
| T7892 | 10527-10534 | NN | denotes | pathway |
| T7893 | 10535-10536 | -LRB- | denotes | ( |
| T7894 | 10536-10549 | NNP | denotes | Supplementary |
| T7895 | 10550-10554 | NNP | denotes | Fig. |
| T7896 | 10555-10556 | CD | denotes | 5 |
| T7897 | 10556-10557 | -RRB- | denotes | ) |
| T7898 | 10557-10558 | . | denotes | . |
| T7899 | 10559-10561 | TO | denotes | To |
| T7900 | 10562-10568 | VB | denotes | verify |
| T7901 | 10569-10582 | RB | denotes | biochemically |
| T7902 | 10583-10587 | IN | denotes | that |
| T7903 | 10588-10592 | CD | denotes | S209 |
| T7904 | 10593-10595 | VBZ | denotes | is |
| T7905 | 10596-10598 | DT | denotes | an |
| T7906 | 10599-10603 | JJ | denotes | IKKβ |
| T7907 | 10604-10613 | NN | denotes | substrate |
| T7908 | 10613-10614 | , | denotes | , |
| T7909 | 10615-10617 | PRP | denotes | we |
| T7910 | 10618-10627 | VBD | denotes | performed |
| T7911 | 10628-10640 | NN | denotes | 32P-labeling |
| T7912 | 10641-10643 | IN | denotes | in |
| T7913 | 10644-10649 | NN | denotes | vitro |
| T7914 | 10650-10656 | NN | denotes | kinase |
| T7915 | 10657-10663 | NNS | denotes | assays |
| T7916 | 10664-10668 | IN | denotes | with |
| T7917 | 10669-10680 | JJ | denotes | recombinant |
| T7918 | 10681-10690 | JJ | denotes | wild-type |
| T7919 | 10691-10693 | CC | denotes | or |
| T7920 | 10694-10699 | JJ | denotes | S209A |
| T7921 | 10700-10706 | JJ | denotes | mutant |
| T7922 | 10707-10711 | NN | denotes | RPS3 |
| T7923 | 10712-10720 | NNS | denotes | proteins |
| T7924 | 10720-10721 | . | denotes | . |
| T7925 | 10722-10730 | VBN | denotes | Compared |
| T7926 | 10731-10735 | IN | denotes | with |
| T7927 | 10736-10739 | DT | denotes | the |
| T7928 | 10740-10749 | JJ | denotes | wild-type |
| T7929 | 10750-10757 | NN | denotes | protein |
| T7930 | 10757-10758 | , | denotes | , |
| T7931 | 10759-10762 | DT | denotes | the |
| T7932 | 10763-10768 | NNP | denotes | S209A |
| T7933 | 10769-10777 | NN | denotes | mutation |
| T7934 | 10778-10785 | VBD | denotes | reduced |
| T7935 | 10786-10790 | NNP | denotes | IKKβ |
| T7936 | 10791-10799 | VBD | denotes | mediated |
| T7937 | 10800-10804 | JJ | denotes | RPS3 |
| T7938 | 10805-10820 | NN | denotes | phosphorylation |
| T7939 | 10821-10822 | -LRB- | denotes | ( |
| T7940 | 10822-10826 | NNP | denotes | Fig. |
| T7941 | 10827-10829 | CD | denotes | 4c |
| T7942 | 10829-10830 | -RRB- | denotes | ) |
| T7943 | 10830-10831 | . | denotes | . |
| T7944 | 10832-10837 | EX | denotes | There |
| T7945 | 10838-10843 | MD | denotes | might |
| T7946 | 10844-10846 | VB | denotes | be |
| T7947 | 10847-10858 | JJ | denotes | alternative |
| T7948 | 10859-10874 | NN | denotes | phosphorylation |
| T7949 | 10875-10879 | NN | denotes | site |
| T7950 | 10879-10880 | -LRB- | denotes | ( |
| T7951 | 10880-10881 | PRP | denotes | s |
| T7952 | 10881-10882 | -RRB- | denotes | ) |
| T7953 | 10883-10888 | IN | denotes | under |
| T7954 | 10889-10894 | DT | denotes | these |
| T7955 | 10895-10905 | NNS | denotes | conditions |
| T7956 | 10906-10911 | VBN | denotes | given |
| T7957 | 10912-10918 | JJ | denotes | modest |
| T7958 | 10919-10927 | JJ | denotes | residual |
| T7959 | 10928-10942 | VBN | denotes | phosphorylated |
| T7960 | 10943-10947 | NNP | denotes | RPS3 |
| T7961 | 10948-10949 | -LRB- | denotes | ( |
| T7962 | 10949-10953 | NNP | denotes | Fig. |
| T7963 | 10954-10956 | CD | denotes | 4c |
| T7964 | 10956-10957 | -RRB- | denotes | ) |
| T7965 | 10957-10958 | . | denotes | . |
| T7966 | 10959-10963 | CD | denotes | RPS3 |
| T7967 | 10964-10968 | CD | denotes | S209 |
| T7968 | 10969-10973 | VBZ | denotes | does |
| T7969 | 10974-10977 | RB | denotes | not |
| T7970 | 10978-10982 | VB | denotes | fall |
| T7971 | 10983-10989 | IN | denotes | within |
| T7972 | 10990-10991 | DT | denotes | a |
| T7973 | 10992-11004 | JJ | denotes | conventional |
| T7974 | 11005-11008 | NNP | denotes | IKK |
| T7975 | 11009-11020 | NN | denotes | recognition |
| T7976 | 11021-11026 | NN | denotes | motif |
| T7977 | 11026-11027 | , | denotes | , |
| T7978 | 11028-11031 | CC | denotes | but |
| T7979 | 11032-11038 | RB | denotes | rather |
| T7980 | 11039-11046 | VBZ | denotes | resides |
| T7981 | 11047-11049 | IN | denotes | in |
| T7982 | 11050-11051 | DT | denotes | a |
| T7983 | 11052-11060 | NN | denotes | sequence |
| T7984 | 11061-11066 | NN | denotes | motif |
| T7985 | 11067-11068 | -LRB- | denotes | ( |
| T7986 | 11068-11078 | NNP | denotes | XXXpS/TXXE |
| T7987 | 11078-11079 | -RRB- | denotes | ) |
| T7988 | 11079-11080 | , | denotes | , |
| T7989 | 11081-11092 | RB | denotes | potentially |
| T7990 | 11093-11103 | VBN | denotes | recognized |
| T7991 | 11104-11106 | IN | denotes | by |
| T7992 | 11107-11113 | NN | denotes | casein |
| T7993 | 11114-11120 | NN | denotes | kinase |
| T7994 | 11121-11123 | NNP | denotes | II |
| T7995 | 11124-11125 | -LRB- | denotes | ( |
| T7996 | 11125-11128 | NNP | denotes | CK2 |
| T7997 | 11128-11129 | -RRB- | denotes | ) |
| T7998 | 11129-11130 | . | denotes | . |
| T7999 | 11131-11139 | IN | denotes | Although |
| T8000 | 11140-11144 | NNP | denotes | IKKβ |
| T8001 | 11145-11151 | NN | denotes | kinase |
| T8002 | 11152-11155 | MD | denotes | can |
| T8003 | 11156-11163 | VB | denotes | display |
| T8004 | 11164-11165 | DT | denotes | a |
| T8005 | 11166-11174 | JJ | denotes | CK2-like |
| T8006 | 11175-11190 | NN | denotes | phosphorylation |
| T8007 | 11191-11204 | NNS | denotes | specificity29 |
| T8008 | 11204-11205 | , | denotes | , |
| T8009 | 11206-11208 | DT | denotes | no |
| T8010 | 11209-11212 | NN | denotes | CK2 |
| T8011 | 11213-11220 | NN | denotes | protein |
| T8012 | 11221-11224 | VBD | denotes | was |
| T8013 | 11225-11235 | JJ | denotes | detectable |
| T8014 | 11236-11238 | IN | denotes | in |
| T8015 | 11239-11242 | PRP$ | denotes | our |
| T8016 | 11243-11254 | JJ | denotes | recombinant |
| T8017 | 11255-11258 | NNP | denotes | IKK |
| T8018 | 11259-11267 | NNS | denotes | proteins |
| T8019 | 11268-11269 | -LRB- | denotes | ( |
| T8020 | 11269-11282 | NNP | denotes | Supplementary |
| T8021 | 11283-11287 | NNP | denotes | Fig. |
| T8022 | 11288-11289 | CD | denotes | 6 |
| T8023 | 11289-11290 | -RRB- | denotes | ) |
| T8024 | 11290-11291 | . | denotes | . |
| T8025 | 11292-11296 | RB | denotes | Thus |
| T8026 | 11296-11297 | , | denotes | , |
| T8027 | 11298-11302 | NNP | denotes | RPS3 |
| T8028 | 11303-11307 | NNP | denotes | S209 |
| T8029 | 11308-11323 | NN | denotes | phosphorylation |
| T8030 | 11324-11327 | VBD | denotes | was |
| T8031 | 11328-11331 | JJ | denotes | due |
| T8032 | 11332-11334 | TO | denotes | to |
| T8033 | 11335-11338 | DT | denotes | the |
| T8034 | 11339-11348 | JJ | denotes | alternate |
| T8035 | 11349-11360 | NN | denotes | specificity |
| T8036 | 11361-11363 | IN | denotes | of |
| T8037 | 11364-11367 | DT | denotes | the |
| T8038 | 11368-11372 | NNP | denotes | IKKβ |
| T8039 | 11373-11379 | NN | denotes | kinase |
| T8040 | 11380-11386 | RB | denotes | rather |
| T8041 | 11387-11391 | IN | denotes | than |
| T8042 | 11392-11395 | DT | denotes | any |
| T8043 | 11396-11401 | VBP | denotes | trace |
| T8044 | 11402-11408 | NN | denotes | amount |
| T8045 | 11409-11411 | IN | denotes | of |
| T8046 | 11412-11415 | CD | denotes | CK2 |
| T8047 | 11416-11421 | VBN | denotes | bound |
| T8048 | 11422-11424 | TO | denotes | to |
| T8049 | 11425-11429 | NNS | denotes | IKKs |
| T8050 | 11429-11430 | . | denotes | . |
| T8051 | 11431-11433 | TO | denotes | To |
| T8052 | 11434-11443 | VB | denotes | determine |
| T8053 | 11444-11451 | IN | denotes | whether |
| T8054 | 11452-11456 | NNP | denotes | S209 |
| T8055 | 11457-11459 | VBZ | denotes | is |
| T8056 | 11460-11463 | DT | denotes | the |
| T8057 | 11464-11472 | JJ | denotes | critical |
| T8058 | 11473-11477 | NN | denotes | site |
| T8059 | 11478-11480 | IN | denotes | at |
| T8060 | 11481-11486 | WDT | denotes | which |
| T8061 | 11487-11491 | NNP | denotes | IKKβ |
| T8062 | 11492-11506 | VBZ | denotes | phosphorylates |
| T8063 | 11507-11511 | NNP | denotes | RPS3 |
| T8064 | 11512-11514 | IN | denotes | in |
| T8065 | 11515-11521 | VBG | denotes | living |
| T8066 | 11522-11527 | NNS | denotes | cells |
| T8067 | 11527-11528 | , | denotes | , |
| T8068 | 11529-11531 | PRP | denotes | we |
| T8069 | 11532-11543 | VBD | denotes | transfected |
| T8070 | 11544-11547 | DT | denotes | the |
| T8071 | 11548-11557 | JJ | denotes | wild-type |
| T8072 | 11558-11560 | CC | denotes | or |
| T8073 | 11561-11566 | JJ | denotes | S209A |
| T8074 | 11567-11573 | JJ | denotes | mutant |
| T8075 | 11574-11583 | NN | denotes | Flag-RPS3 |
| T8076 | 11584-11589 | RB | denotes | alone |
| T8077 | 11589-11590 | , | denotes | , |
| T8078 | 11591-11593 | CC | denotes | or |
| T8079 | 11594-11602 | RB | denotes | together |
| T8080 | 11603-11607 | IN | denotes | with |
| T8081 | 11608-11612 | NNP | denotes | IKKβ |
| T8082 | 11613-11617 | IN | denotes | into |
| T8083 | 11618-11623 | NNS | denotes | cells |
| T8084 | 11623-11624 | . | denotes | . |
| T8085 | 11625-11631 | RB | denotes | Indeed |
| T8086 | 11631-11632 | , | denotes | , |
| T8087 | 11633-11635 | PRP | denotes | we |
| T8088 | 11636-11644 | VBD | denotes | observed |
| T8089 | 11645-11649 | IN | denotes | that |
| T8090 | 11650-11664 | VBG | denotes | overexpressing |
| T8091 | 11665-11669 | NNP | denotes | IKKβ |
| T8092 | 11670-11678 | JJ | denotes | enhanced |
| T8093 | 11679-11688 | NN | denotes | Flag-RPS3 |
| T8094 | 11689-11704 | NN | denotes | phosphorylation |
| T8095 | 11704-11705 | , | denotes | , |
| T8096 | 11706-11709 | CC | denotes | but |
| T8097 | 11710-11725 | NN | denotes | phosphorylation |
| T8098 | 11726-11729 | VBD | denotes | was |
| T8099 | 11730-11741 | RB | denotes | effectively |
| T8100 | 11742-11752 | VBN | denotes | eliminated |
| T8101 | 11753-11755 | IN | denotes | by |
| T8102 | 11756-11763 | JJ | denotes | alanine |
| T8103 | 11764-11776 | NN | denotes | substitution |
| T8104 | 11777-11787 | VBG | denotes | indicating |
| T8105 | 11788-11792 | IN | denotes | that |
| T8106 | 11793-11797 | CD | denotes | S209 |
| T8107 | 11798-11800 | VBZ | denotes | is |
| T8108 | 11801-11804 | DT | denotes | the |
| T8109 | 11805-11816 | JJ | denotes | predominant |
| T8110 | 11817-11823 | NN | denotes | target |
| T8111 | 11824-11828 | NN | denotes | site |
| T8112 | 11829-11832 | IN | denotes | for |
| T8113 | 11833-11837 | NNP | denotes | IKKβ |
| T8114 | 11838-11853 | NN | denotes | phosphorylation |
| T8115 | 11854-11855 | -LRB- | denotes | ( |
| T8116 | 11855-11859 | NNP | denotes | Fig. |
| T8117 | 11860-11862 | CD | denotes | 4d |
| T8118 | 11862-11863 | -RRB- | denotes | ) |
| T8119 | 11863-11864 | . | denotes | . |
| T8120 | 11865-11867 | PRP | denotes | We |
| T8121 | 11868-11872 | JJ | denotes | next |
| T8122 | 11873-11882 | VBD | denotes | generated |
| T8123 | 11883-11884 | DT | denotes | a |
| T8124 | 11885-11897 | JJ | denotes | phospho-S209 |
| T8125 | 11898-11902 | NN | denotes | RPS3 |
| T8126 | 11903-11911 | NN | denotes | antibody |
| T8127 | 11912-11915 | CC | denotes | and |
| T8128 | 11916-11925 | VBD | denotes | confirmed |
| T8129 | 11926-11930 | IN | denotes | that |
| T8130 | 11931-11941 | JJ | denotes | endogenous |
| T8131 | 11942-11946 | NN | denotes | RPS3 |
| T8132 | 11947-11950 | VBD | denotes | was |
| T8133 | 11951-11965 | VBN | denotes | phosphorylated |
| T8134 | 11966-11968 | IN | denotes | at |
| T8135 | 11969-11973 | CD | denotes | S209 |
| T8136 | 11974-11976 | IN | denotes | in |
| T8137 | 11977-11978 | DT | denotes | a |
| T8138 | 11979-11993 | JJ | denotes | time-dependent |
| T8139 | 11994-12000 | NN | denotes | manner |
| T8140 | 12001-12005 | IN | denotes | upon |
| T8141 | 12006-12009 | NNP | denotes | TNF |
| T8142 | 12010-12021 | NN | denotes | stimulation |
| T8143 | 12022-12023 | -LRB- | denotes | ( |
| T8144 | 12023-12027 | NNP | denotes | Fig. |
| T8145 | 12028-12030 | CD | denotes | 4e |
| T8146 | 12030-12031 | -RRB- | denotes | ) |
| T8147 | 12031-12032 | . | denotes | . |
| T8148 | 12033-12037 | RB | denotes | Thus |
| T8149 | 12037-12038 | , | denotes | , |
| T8150 | 12039-12042 | DT | denotes | the |
| T8151 | 12043-12047 | NNP | denotes | RPS3 |
| T8152 | 12048-12058 | NNP | denotes | C-terminal |
| T8153 | 12059-12063 | NN | denotes | tail |
| T8154 | 12064-12075 | RB | denotes | potentially |
| T8155 | 12076-12084 | VBZ | denotes | contains |
| T8156 | 12085-12087 | DT | denotes | an |
| T8157 | 12088-12097 | JJ | denotes | important |
| T8158 | 12098-12108 | JJ | denotes | regulatory |
| T8159 | 12109-12113 | NN | denotes | site |
| T8160 | 12113-12114 | . | denotes | . |
| T9857 | 12116-12131 | NNP | denotes | Phosphorylation |
| T9858 | 12132-12134 | IN | denotes | of |
| T9859 | 12135-12139 | NNP | denotes | RPS3 |
| T9860 | 12140-12143 | CC | denotes | and |
| T9861 | 12144-12147 | PRP$ | denotes | its |
| T9862 | 12148-12153 | JJ | denotes | NF-κB |
| T9863 | 12154-12162 | NN | denotes | function |
| T9864 | 12163-12165 | PRP | denotes | We |
| T9865 | 12166-12170 | JJ | denotes | next |
| T9866 | 12171-12179 | VBD | denotes | examined |
| T9867 | 12180-12187 | IN | denotes | whether |
| T9868 | 12188-12192 | NNP | denotes | S209 |
| T9869 | 12193-12208 | NN | denotes | phosphorylation |
| T9870 | 12209-12214 | VBZ | denotes | plays |
| T9871 | 12215-12216 | DT | denotes | a |
| T9872 | 12217-12221 | NN | denotes | role |
| T9873 | 12222-12224 | IN | denotes | in |
| T9874 | 12225-12228 | DT | denotes | the |
| T9875 | 12229-12236 | JJ | denotes | nuclear |
| T9876 | 12237-12250 | NN | denotes | translocation |
| T9877 | 12251-12253 | IN | denotes | of |
| T9878 | 12254-12258 | CD | denotes | RPS3 |
| T9879 | 12259-12265 | IN | denotes | during |
| T9880 | 12266-12271 | JJ | denotes | NF-κB |
| T9881 | 12272-12282 | NN | denotes | activation |
| T9882 | 12282-12283 | . | denotes | . |
| T9883 | 12284-12295 | JJ | denotes | Subcellular |
| T9884 | 12296-12305 | NNS | denotes | fractions |
| T9885 | 12306-12310 | IN | denotes | from |
| T9886 | 12311-12317 | DT | denotes | either |
| T9887 | 12318-12327 | JJ | denotes | wild-type |
| T9888 | 12328-12330 | CC | denotes | or |
| T9889 | 12331-12336 | JJ | denotes | S209A |
| T9890 | 12337-12343 | JJ | denotes | mutant |
| T9891 | 12344-12360 | JJ | denotes | RPS3-transfected |
| T9892 | 12361-12366 | NNS | denotes | cells |
| T9893 | 12367-12371 | VBD | denotes | were |
| T9894 | 12372-12380 | VBN | denotes | prepared |
| T9895 | 12381-12384 | CC | denotes | and |
| T9896 | 12385-12392 | VBN | denotes | blotted |
| T9897 | 12393-12396 | IN | denotes | for |
| T9898 | 12397-12407 | JJ | denotes | heat-shock |
| T9899 | 12408-12415 | NN | denotes | protein |
| T9900 | 12416-12418 | CD | denotes | 90 |
| T9901 | 12419-12420 | -LRB- | denotes | ( |
| T9902 | 12420-12425 | CD | denotes | hsp90 |
| T9903 | 12425-12426 | -RRB- | denotes | ) |
| T9904 | 12426-12427 | , | denotes | , |
| T9905 | 12428-12429 | DT | denotes | a |
| T9906 | 12430-12441 | JJ | denotes | cytoplasmic |
| T9907 | 12442-12449 | NN | denotes | protein |
| T9908 | 12449-12450 | , | denotes | , |
| T9909 | 12451-12454 | CC | denotes | and |
| T9910 | 12455-12459 | NN | denotes | poly |
| T9911 | 12460-12461 | -LRB- | denotes | ( |
| T9912 | 12461-12471 | JJ | denotes | ADP-ribose |
| T9913 | 12471-12472 | -RRB- | denotes | ) |
| T9914 | 12473-12483 | NN | denotes | polymerase |
| T9915 | 12484-12485 | -LRB- | denotes | ( |
| T9916 | 12485-12489 | NNP | denotes | PARP |
| T9917 | 12489-12490 | -RRB- | denotes | ) |
| T9918 | 12490-12491 | , | denotes | , |
| T9919 | 12492-12493 | DT | denotes | a |
| T9920 | 12494-12501 | JJ | denotes | nuclear |
| T9921 | 12502-12509 | NN | denotes | protein |
| T9922 | 12509-12510 | , | denotes | , |
| T9923 | 12511-12521 | VBG | denotes | confirming |
| T9924 | 12522-12523 | DT | denotes | a |
| T9925 | 12524-12529 | JJ | denotes | clean |
| T9926 | 12530-12540 | NN | denotes | separation |
| T9927 | 12541-12542 | -LRB- | denotes | ( |
| T9928 | 12542-12546 | NNP | denotes | Fig. |
| T9929 | 12547-12549 | CD | denotes | 5a |
| T9930 | 12549-12550 | -RRB- | denotes | ) |
| T9931 | 12550-12551 | . | denotes | . |
| T9932 | 12552-12554 | IN | denotes | As |
| T9933 | 12555-12563 | VBN | denotes | expected |
| T9934 | 12563-12564 | , | denotes | , |
| T9935 | 12565-12570 | NNP | denotes | PMA+I |
| T9936 | 12571-12582 | NN | denotes | stimulation |
| T9937 | 12583-12592 | VBD | denotes | triggered |
| T9938 | 12593-12602 | JJ | denotes | wild-type |
| T9939 | 12603-12612 | NN | denotes | Flag-RPS3 |
| T9940 | 12613-12620 | JJ | denotes | nuclear |
| T9941 | 12621-12634 | NN | denotes | translocation |
| T9942 | 12635-12636 | -LRB- | denotes | ( |
| T9943 | 12636-12640 | NNP | denotes | Fig. |
| T9944 | 12641-12643 | CD | denotes | 5a |
| T9945 | 12643-12644 | -RRB- | denotes | ) |
| T9946 | 12644-12645 | . | denotes | . |
| T9947 | 12646-12653 | RB | denotes | However |
| T9948 | 12653-12654 | , | denotes | , |
| T9949 | 12655-12659 | NNP | denotes | RPS3 |
| T9950 | 12660-12661 | -LRB- | denotes | ( |
| T9951 | 12661-12666 | NNP | denotes | S209A |
| T9952 | 12666-12667 | -RRB- | denotes | ) |
| T9953 | 12668-12675 | JJ | denotes | nuclear |
| T9954 | 12676-12689 | NN | denotes | translocation |
| T9955 | 12690-12693 | VBD | denotes | was |
| T9956 | 12694-12704 | VBN | denotes | attenuated |
| T9957 | 12705-12706 | -LRB- | denotes | ( |
| T9958 | 12706-12710 | NNP | denotes | Fig. |
| T9959 | 12711-12713 | CD | denotes | 5a |
| T9960 | 12713-12714 | -RRB- | denotes | ) |
| T9961 | 12714-12715 | . | denotes | . |
| T9962 | 12716-12718 | PRP | denotes | We |
| T9963 | 12719-12723 | RB | denotes | also |
| T9964 | 12724-12730 | VBD | denotes | tested |
| T9965 | 12731-12734 | DT | denotes | the |
| T9966 | 12735-12741 | NN | denotes | impact |
| T9967 | 12742-12744 | IN | denotes | of |
| T9968 | 12745-12755 | VBG | denotes | activating |
| T9969 | 12756-12761 | NN | denotes | NF-κB |
| T9970 | 12762-12764 | IN | denotes | by |
| T9971 | 12765-12779 | VBG | denotes | overexpressing |
| T9972 | 12780-12784 | NNP | denotes | IKKβ |
| T9973 | 12785-12787 | IN | denotes | on |
| T9974 | 12788-12792 | NNP | denotes | RPS3 |
| T9975 | 12793-12800 | JJ | denotes | nuclear |
| T9976 | 12801-12814 | NN | denotes | translocation |
| T9977 | 12814-12815 | . | denotes | . |
| T9978 | 12816-12820 | NNP | denotes | IKKβ |
| T9979 | 12821-12835 | NN | denotes | overexpression |
| T9980 | 12836-12845 | VBD | denotes | activated |
| T9981 | 12846-12851 | JJ | denotes | NF-κB |
| T9982 | 12852-12860 | VBN | denotes | measured |
| T9983 | 12861-12863 | IN | denotes | by |
| T9984 | 12864-12874 | NN | denotes | luciferase |
| T9985 | 12875-12881 | NNS | denotes | assays |
| T9986 | 12882-12883 | -LRB- | denotes | ( |
| T9987 | 12883-12896 | NNP | denotes | Supplementary |
| T9988 | 12897-12901 | NNP | denotes | Fig. |
| T9989 | 12902-12903 | CD | denotes | 7 |
| T9990 | 12903-12904 | -RRB- | denotes | ) |
| T9991 | 12904-12905 | , | denotes | , |
| T9992 | 12906-12909 | CC | denotes | and |
| T9993 | 12910-12914 | RB | denotes | also |
| T9994 | 12915-12922 | VBD | denotes | induced |
| T9995 | 12923-12926 | DT | denotes | the |
| T9996 | 12927-12934 | JJ | denotes | nuclear |
| T9997 | 12935-12948 | NN | denotes | translocation |
| T9998 | 12949-12951 | IN | denotes | of |
| T9999 | 12952-12961 | JJ | denotes | wild-type |
| T10000 | 12961-12962 | , | denotes | , |
| T10001 | 12963-12966 | CC | denotes | but |
| T10002 | 12967-12970 | RB | denotes | not |
| T10003 | 12971-12976 | NNP | denotes | S209A |
| T10004 | 12976-12977 | , | denotes | , |
| T10005 | 12978-12982 | NNP | denotes | RPS3 |
| T10006 | 12983-12984 | -LRB- | denotes | ( |
| T10007 | 12984-12988 | NNP | denotes | Fig. |
| T10008 | 12989-12991 | CD | denotes | 5b |
| T10009 | 12991-12992 | -RRB- | denotes | ) |
| T10010 | 12992-12993 | . | denotes | . |
| T10011 | 12994-12999 | DT | denotes | These |
| T10012 | 13000-13004 | NNS | denotes | data |
| T10013 | 13005-13012 | VBP | denotes | suggest |
| T10014 | 13013-13017 | IN | denotes | that |
| T10015 | 13018-13022 | CD | denotes | S209 |
| T10016 | 13023-13038 | NN | denotes | phosphorylation |
| T10017 | 13039-13041 | VBZ | denotes | is |
| T10018 | 13042-13050 | JJ | denotes | critical |
| T10019 | 13051-13054 | IN | denotes | for |
| T10020 | 13055-13058 | DT | denotes | the |
| T10021 | 13059-13064 | NNP | denotes | NF-κB |
| T10022 | 13065-13083 | VBD | denotes | activation-induced |
| T10023 | 13084-13088 | CD | denotes | RPS3 |
| T10024 | 13089-13096 | JJ | denotes | nuclear |
| T10025 | 13097-13110 | NN | denotes | translocation |
| T10026 | 13110-13111 | . | denotes | . |
| T10027 | 13112-13114 | TO | denotes | To |
| T10028 | 13115-13122 | VB | denotes | examine |
| T10029 | 13123-13126 | DT | denotes | the |
| T10030 | 13127-13131 | NN | denotes | role |
| T10031 | 13132-13134 | IN | denotes | of |
| T10032 | 13135-13139 | CD | denotes | S209 |
| T10033 | 13140-13155 | NN | denotes | phosphorylation |
| T10034 | 13156-13158 | IN | denotes | of |
| T10035 | 13159-13163 | CD | denotes | RPS3 |
| T10036 | 13164-13166 | TO | denotes | to |
| T10037 | 13167-13170 | PRP$ | denotes | its |
| T10038 | 13171-13176 | NNP | denotes | NF-κB |
| T10039 | 13177-13186 | CD | denotes | function6 |
| T10040 | 13186-13187 | , | denotes | , |
| T10041 | 13188-13189 | CD | denotes | 7 |
| T10042 | 13189-13190 | , | denotes | , |
| T10043 | 13191-13193 | CD | denotes | 30 |
| T10044 | 13193-13194 | , | denotes | , |
| T10045 | 13195-13197 | PRP | denotes | we |
| T10046 | 13198-13206 | VBD | denotes | silenced |
| T10047 | 13207-13217 | JJ | denotes | endogenous |
| T10048 | 13218-13222 | NNP | denotes | RPS3 |
| T10049 | 13223-13233 | NN | denotes | expression |
| T10050 | 13234-13239 | VBG | denotes | using |
| T10051 | 13240-13242 | DT | denotes | an |
| T10052 | 13243-13248 | NN | denotes | siRNA |
| T10053 | 13249-13253 | WDT | denotes | that |
| T10054 | 13254-13261 | VBZ | denotes | targets |
| T10055 | 13262-13265 | DT | denotes | the |
| T10056 | 13266-13267 | CD | denotes | 3 |
| T10057 | 13267-13268 | NN | denotes | ′ |
| T10058 | 13269-13281 | JJ | denotes | untranslated |
| T10059 | 13282-13288 | NN | denotes | region |
| T10060 | 13289-13290 | -LRB- | denotes | ( |
| T10061 | 13290-13291 | CD | denotes | 3 |
| T10062 | 13291-13292 | CD | denotes | ′ |
| T10063 | 13293-13296 | NNP | denotes | UTR |
| T10064 | 13296-13297 | -RRB- | denotes | ) |
| T10065 | 13298-13300 | IN | denotes | of |
| T10066 | 13301-13305 | CD | denotes | RPS3 |
| T10067 | 13306-13310 | NNP | denotes | mRNA |
| T10068 | 13310-13311 | , | denotes | , |
| T10069 | 13312-13320 | VBN | denotes | followed |
| T10070 | 13321-13323 | IN | denotes | by |
| T10071 | 13324-13339 | NN | denotes | complementation |
| T10072 | 13340-13344 | IN | denotes | with |
| T10073 | 13345-13351 | DT | denotes | either |
| T10074 | 13352-13361 | JJ | denotes | wild-type |
| T10075 | 13362-13364 | CC | denotes | or |
| T10076 | 13365-13370 | JJ | denotes | S209A |
| T10077 | 13371-13377 | JJ | denotes | mutant |
| T10078 | 13378-13382 | NN | denotes | RPS3 |
| T10079 | 13383-13386 | IN | denotes | via |
| T10080 | 13387-13399 | NN | denotes | transfection |
| T10081 | 13399-13400 | . | denotes | . |
| T10082 | 13401-13403 | IN | denotes | As |
| T10083 | 13404-13412 | VBN | denotes | expected |
| T10084 | 13412-13413 | , | denotes | , |
| T10085 | 13414-13418 | NNP | denotes | RPS3 |
| T10086 | 13419-13424 | NNP | denotes | siRNA |
| T10087 | 13425-13433 | RB | denotes | severely |
| T10088 | 13434-13441 | VBD | denotes | reduced |
| T10089 | 13442-13452 | JJ | denotes | endogenous |
| T10090 | 13453-13457 | NNP | denotes | RPS3 |
| T10091 | 13458-13467 | NN | denotes | abundance |
| T10092 | 13468-13476 | VBN | denotes | compared |
| T10093 | 13477-13479 | TO | denotes | to |
| T10094 | 13480-13482 | NNP | denotes | NS |
| T10095 | 13483-13488 | NNP | denotes | siRNA |
| T10096 | 13488-13489 | , | denotes | , |
| T10097 | 13490-13493 | CC | denotes | but |
| T10098 | 13494-13497 | VBD | denotes | did |
| T10099 | 13498-13501 | RB | denotes | not |
| T10100 | 13502-13508 | VB | denotes | affect |
| T10101 | 13509-13512 | DT | denotes | the |
| T10102 | 13513-13519 | JJ | denotes | robust |
| T10103 | 13520-13530 | NN | denotes | expression |
| T10104 | 13531-13533 | IN | denotes | of |
| T10105 | 13534-13545 | JJ | denotes | Flag-tagged |
| T10106 | 13546-13550 | NN | denotes | RPS3 |
| T10107 | 13551-13555 | IN | denotes | from |
| T10108 | 13556-13557 | DT | denotes | a |
| T10109 | 13558-13569 | VBN | denotes | transfected |
| T10110 | 13570-13579 | VBP | denotes | construct |
| T10111 | 13580-13587 | VBG | denotes | lacking |
| T10112 | 13588-13591 | DT | denotes | the |
| T10113 | 13592-13593 | CD | denotes | 3 |
| T10114 | 13593-13594 | NN | denotes | ′ |
| T10115 | 13595-13598 | NNP | denotes | UTR |
| T10116 | 13599-13600 | -LRB- | denotes | ( |
| T10117 | 13600-13604 | NNP | denotes | Fig. |
| T10118 | 13605-13607 | CD | denotes | 5c |
| T10119 | 13607-13608 | -RRB- | denotes | ) |
| T10120 | 13608-13609 | . | denotes | . |
| T10121 | 13610-13612 | PRP | denotes | We |
| T10122 | 13613-13617 | RB | denotes | also |
| T10123 | 13618-13623 | VBD | denotes | found |
| T10124 | 13624-13628 | IN | denotes | that |
| T10125 | 13629-13633 | CD | denotes | RPS3 |
| T10126 | 13634-13643 | JJ | denotes | knockdown |
| T10127 | 13644-13651 | VBN | denotes | reduced |
| T10128 | 13652-13663 | JJ | denotes | TNF-induced |
| T10129 | 13664-13674 | NN | denotes | expression |
| T10130 | 13675-13677 | IN | denotes | of |
| T10131 | 13678-13680 | DT | denotes | an |
| T10132 | 13681-13683 | NNP | denotes | Ig |
| T10133 | 13684-13693 | NNP | denotes | κB-driven |
| T10134 | 13694-13704 | VBD | denotes | luciferase |
| T10135 | 13705-13715 | CD | denotes | construct6 |
| T10136 | 13716-13717 | -LRB- | denotes | ( |
| T10137 | 13717-13721 | NNP | denotes | Fig. |
| T10138 | 13722-13724 | CD | denotes | 5d |
| T10139 | 13724-13725 | -RRB- | denotes | ) |
| T10140 | 13725-13726 | . | denotes | . |
| T10141 | 13727-13730 | DT | denotes | The |
| T10142 | 13731-13739 | VBN | denotes | impaired |
| T10143 | 13740-13750 | NN | denotes | luciferase |
| T10144 | 13751-13757 | NN | denotes | signal |
| T10145 | 13758-13764 | VBN | denotes | caused |
| T10146 | 13765-13767 | IN | denotes | by |
| T10147 | 13768-13772 | CD | denotes | RPS3 |
| T10148 | 13773-13783 | NN | denotes | deficiency |
| T10149 | 13784-13787 | VBD | denotes | was |
| T10150 | 13788-13798 | RB | denotes | completely |
| T10151 | 13799-13807 | VBN | denotes | restored |
| T10152 | 13808-13810 | IN | denotes | by |
| T10153 | 13811-13823 | VBG | denotes | transfecting |
| T10154 | 13824-13833 | JJ | denotes | wild-type |
| T10155 | 13833-13834 | , | denotes | , |
| T10156 | 13835-13838 | CC | denotes | but |
| T10157 | 13839-13842 | RB | denotes | not |
| T10158 | 13843-13845 | IN | denotes | by |
| T10159 | 13846-13851 | NNP | denotes | S209A |
| T10160 | 13852-13856 | NNP | denotes | RPS3 |
| T10161 | 13857-13858 | -LRB- | denotes | ( |
| T10162 | 13858-13862 | NNP | denotes | Fig. |
| T10163 | 13863-13865 | CD | denotes | 5d |
| T10164 | 13865-13866 | -RRB- | denotes | ) |
| T10165 | 13866-13867 | , | denotes | , |
| T10166 | 13868-13875 | IN | denotes | despite |
| T10167 | 13876-13886 | JJ | denotes | equivalent |
| T10168 | 13887-13897 | NN | denotes | expression |
| T10169 | 13898-13899 | -LRB- | denotes | ( |
| T10170 | 13899-13903 | NNP | denotes | Fig. |
| T10171 | 13904-13906 | CD | denotes | 5c |
| T10172 | 13906-13907 | -RRB- | denotes | ) |
| T10173 | 13907-13908 | . | denotes | . |
| T10174 | 13909-13917 | RB | denotes | Moreover |
| T10175 | 13917-13918 | , | denotes | , |
| T10176 | 13919-13922 | DT | denotes | the |
| T10177 | 13923-13930 | NN | denotes | failure |
| T10178 | 13931-13933 | IN | denotes | of |
| T10179 | 13934-13939 | NNP | denotes | S209A |
| T10180 | 13940-13944 | NNP | denotes | RPS3 |
| T10181 | 13945-13947 | TO | denotes | to |
| T10182 | 13948-13955 | VB | denotes | restore |
| T10183 | 13956-13966 | NN | denotes | luciferase |
| T10184 | 13967-13975 | NN | denotes | activity |
| T10185 | 13976-13979 | VBD | denotes | did |
| T10186 | 13980-13983 | RB | denotes | not |
| T10187 | 13984-13990 | VB | denotes | result |
| T10188 | 13991-13995 | IN | denotes | from |
| T10189 | 13996-14005 | JJ | denotes | defective |
| T10190 | 14006-14017 | NN | denotes | translation |
| T10191 | 14018-14025 | IN | denotes | because |
| T10192 | 14026-14029 | DT | denotes | the |
| T10193 | 14030-14039 | NN | denotes | transient |
| T10194 | 14040-14054 | NN | denotes | overexpression |
| T10195 | 14055-14057 | IN | denotes | of |
| T10196 | 14058-14063 | JJ | denotes | green |
| T10197 | 14064-14075 | JJ | denotes | fluorescent |
| T10198 | 14076-14083 | NN | denotes | protein |
| T10199 | 14084-14085 | -LRB- | denotes | ( |
| T10200 | 14085-14088 | NNP | denotes | GFP |
| T10201 | 14088-14089 | -RRB- | denotes | ) |
| T10202 | 14090-14093 | VBD | denotes | was |
| T10203 | 14094-14104 | JJ | denotes | comparable |
| T10204 | 14105-14107 | IN | denotes | in |
| T10205 | 14108-14113 | NNS | denotes | cells |
| T10206 | 14114-14126 | VBN | denotes | complemented |
| T10207 | 14127-14131 | IN | denotes | with |
| T10208 | 14132-14141 | JJ | denotes | wild-type |
| T10209 | 14142-14144 | CC | denotes | or |
| T10210 | 14145-14150 | NNP | denotes | S029A |
| T10211 | 14151-14155 | NNP | denotes | RPS3 |
| T10212 | 14156-14157 | -LRB- | denotes | ( |
| T10213 | 14157-14170 | NNP | denotes | Supplementary |
| T10214 | 14171-14175 | NNP | denotes | Fig. |
| T10215 | 14176-14177 | CD | denotes | 8 |
| T10216 | 14177-14178 | -RRB- | denotes | ) |
| T10217 | 14178-14179 | . | denotes | . |
| T10218 | 14180-14185 | VBN | denotes | Taken |
| T10219 | 14186-14194 | RB | denotes | together |
| T10220 | 14194-14195 | , | denotes | , |
| T10221 | 14196-14201 | DT | denotes | these |
| T10222 | 14202-14206 | NNS | denotes | data |
| T10223 | 14207-14214 | VBP | denotes | suggest |
| T10224 | 14215-14219 | IN | denotes | that |
| T10225 | 14220-14224 | CD | denotes | RPS3 |
| T10226 | 14225-14229 | CD | denotes | S209 |
| T10227 | 14230-14245 | NN | denotes | phosphorylation |
| T10228 | 14246-14248 | VBZ | denotes | is |
| T10229 | 14249-14257 | JJ | denotes | critical |
| T10230 | 14258-14261 | IN | denotes | for |
| T10231 | 14262-14267 | JJ | denotes | NF-κB |
| T10232 | 14268-14276 | NN | denotes | activity |
| T10233 | 14277-14286 | VBG | denotes | involving |
| T10234 | 14287-14290 | DT | denotes | the |
| T10235 | 14291-14300 | JJ | denotes | canonical |
| T10236 | 14301-14303 | NNP | denotes | Ig |
| T10237 | 14304-14306 | NNP | denotes | κB |
| T10238 | 14307-14311 | NN | denotes | site |
| T10239 | 14311-14312 | . | denotes | . |
| T10240 | 14313-14315 | PRP | denotes | We |
| T10241 | 14316-14320 | JJ | denotes | next |
| T10242 | 14321-14325 | VBN | denotes | used |
| T10243 | 14326-14335 | NN | denotes | chromatin |
| T10244 | 14336-14355 | NN | denotes | immunoprecipitation |
| T10245 | 14356-14358 | TO | denotes | to |
| T10246 | 14359-14368 | VB | denotes | determine |
| T10247 | 14369-14376 | IN | denotes | whether |
| T10248 | 14377-14381 | NNP | denotes | S209 |
| T10249 | 14382-14397 | NN | denotes | phosphorylation |
| T10250 | 14398-14405 | VBZ | denotes | affects |
| T10251 | 14406-14410 | CD | denotes | RPS3 |
| T10252 | 14411-14414 | CC | denotes | and |
| T10253 | 14415-14418 | CD | denotes | p65 |
| T10254 | 14419-14430 | NN | denotes | recruitment |
| T10255 | 14431-14433 | TO | denotes | to |
| T10256 | 14434-14442 | JJ | denotes | specific |
| T10257 | 14443-14445 | NN | denotes | κB |
| T10258 | 14446-14451 | NNS | denotes | sites |
| T10259 | 14452-14454 | IN | denotes | in |
| T10260 | 14455-14461 | JJ | denotes | intact |
| T10261 | 14462-14471 | NN | denotes | chromatin |
| T10262 | 14472-14478 | IN | denotes | during |
| T10263 | 14479-14484 | NNP | denotes | NF-κB |
| T10264 | 14485-14495 | NN | denotes | activation |
| T10265 | 14495-14496 | . | denotes | . |
| T10266 | 14497-14499 | IN | denotes | In |
| T10267 | 14500-14504 | CD | denotes | RPS3 |
| T10268 | 14505-14514 | JJ | denotes | knockdown |
| T10269 | 14515-14520 | NNS | denotes | cells |
| T10270 | 14520-14521 | , | denotes | , |
| T10271 | 14522-14527 | NNP | denotes | PMA+I |
| T10272 | 14528-14538 | VBD | denotes | stimulated |
| T10273 | 14539-14542 | DT | denotes | the |
| T10274 | 14543-14554 | NN | denotes | recruitment |
| T10275 | 14555-14557 | IN | denotes | of |
| T10276 | 14558-14569 | RB | denotes | ectopically |
| T10277 | 14570-14579 | VBN | denotes | expressed |
| T10278 | 14579-14580 | , | denotes | , |
| T10279 | 14581-14592 | JJ | denotes | Flag-tagged |
| T10280 | 14593-14602 | JJ | denotes | wild-type |
| T10281 | 14602-14603 | , | denotes | , |
| T10282 | 14604-14607 | CC | denotes | but |
| T10283 | 14608-14611 | RB | denotes | not |
| T10284 | 14612-14617 | NNP | denotes | S209A |
| T10285 | 14618-14622 | NNP | denotes | RPS3 |
| T10286 | 14623-14625 | TO | denotes | to |
| T10287 | 14626-14629 | DT | denotes | the |
| T10288 | 14630-14632 | NN | denotes | κB |
| T10289 | 14633-14638 | NNS | denotes | sites |
| T10290 | 14639-14641 | IN | denotes | of |
| T10291 | 14642-14645 | DT | denotes | the |
| T10292 | 14646-14652 | NNP | denotes | NFKBIA |
| T10293 | 14653-14656 | CC | denotes | and |
| T10294 | 14657-14660 | NNP | denotes | IL8 |
| T10295 | 14661-14670 | NNS | denotes | promoters |
| T10296 | 14671-14672 | -LRB- | denotes | ( |
| T10297 | 14672-14676 | NNP | denotes | Fig. |
| T10298 | 14677-14679 | CD | denotes | 5e |
| T10299 | 14679-14680 | -RRB- | denotes | ) |
| T10300 | 14680-14681 | . | denotes | . |
| T10301 | 14682-14687 | IN | denotes | While |
| T10302 | 14688-14698 | VBG | denotes | expressing |
| T10303 | 14699-14703 | NNP | denotes | RPS3 |
| T10304 | 14704-14709 | NNP | denotes | S209A |
| T10305 | 14710-14713 | VBD | denotes | had |
| T10306 | 14714-14716 | DT | denotes | no |
| T10307 | 14717-14723 | NN | denotes | impact |
| T10308 | 14724-14726 | IN | denotes | on |
| T10309 | 14727-14730 | CD | denotes | p65 |
| T10310 | 14731-14738 | JJ | denotes | nuclear |
| T10311 | 14739-14752 | NN | denotes | translocation |
| T10312 | 14752-14753 | , | denotes | , |
| T10313 | 14754-14756 | PRP | denotes | it |
| T10314 | 14757-14770 | RB | denotes | substantially |
| T10315 | 14771-14781 | VBD | denotes | attenuated |
| T10316 | 14782-14785 | CD | denotes | p65 |
| T10317 | 14786-14797 | NN | denotes | recruitment |
| T10318 | 14798-14799 | -LRB- | denotes | ( |
| T10319 | 14799-14803 | NNP | denotes | Fig. |
| T10320 | 14804-14806 | CD | denotes | 5e |
| T10321 | 14806-14807 | -RRB- | denotes | ) |
| T10322 | 14807-14808 | . | denotes | . |
| T10323 | 14809-14819 | JJ | denotes | Additional |
| T10324 | 14820-14831 | NNS | denotes | experiments |
| T10325 | 14832-14840 | VBD | denotes | revealed |
| T10326 | 14841-14845 | IN | denotes | that |
| T10327 | 14846-14849 | CD | denotes | p65 |
| T10328 | 14850-14860 | NN | denotes | attraction |
| T10329 | 14861-14863 | TO | denotes | to |
| T10330 | 14864-14880 | JJ | denotes | RPS3-independent |
| T10331 | 14881-14886 | NN | denotes | NF-κB |
| T10332 | 14887-14893 | NN | denotes | target |
| T10333 | 14894-14898 | NN | denotes | gene |
| T10334 | 14899-14908 | NNS | denotes | promoters |
| T10335 | 14909-14913 | JJ | denotes | such |
| T10336 | 14914-14916 | IN | denotes | as |
| T10337 | 14917-14921 | NNP | denotes | CD25 |
| T10338 | 14922-14925 | VBD | denotes | was |
| T10339 | 14926-14935 | VBN | denotes | increased |
| T10340 | 14936-14937 | -LRB- | denotes | ( |
| T10341 | 14937-14950 | NNP | denotes | Supplementary |
| T10342 | 14951-14955 | NNP | denotes | Fig. |
| T10343 | 14956-14957 | CD | denotes | 9 |
| T10344 | 14957-14958 | -RRB- | denotes | ) |
| T10345 | 14958-14959 | , | denotes | , |
| T10346 | 14960-14970 | JJ | denotes | consistent |
| T10347 | 14971-14975 | IN | denotes | with |
| T10348 | 14976-14979 | PRP$ | denotes | our |
| T10349 | 14980-14988 | JJ | denotes | previous |
| T10350 | 14989-15002 | NNS | denotes | observations6 |
| T10351 | 15002-15003 | . | denotes | . |
| T10352 | 15004-15009 | EX | denotes | There |
| T10353 | 15010-15013 | VBD | denotes | was |
| T10354 | 15014-15016 | DT | denotes | no |
| T10355 | 15017-15028 | JJ | denotes | significant |
| T10356 | 15029-15038 | NN | denotes | Flag-RPS3 |
| T10357 | 15039-15041 | CC | denotes | or |
| T10358 | 15042-15045 | CD | denotes | p65 |
| T10359 | 15046-15057 | NN | denotes | recruitment |
| T10360 | 15058-15060 | TO | denotes | to |
| T10361 | 15061-15065 | NNP | denotes | ACTB |
| T10362 | 15066-15074 | NN | denotes | promoter |
| T10363 | 15075-15082 | VBG | denotes | lacking |
| T10364 | 15083-15085 | NNP | denotes | κB |
| T10365 | 15086-15091 | NNS | denotes | sites |
| T10366 | 15092-15093 | -LRB- | denotes | ( |
| T10367 | 15093-15097 | NNP | denotes | Fig. |
| T10368 | 15098-15100 | CD | denotes | 5e |
| T10369 | 15100-15101 | -RRB- | denotes | ) |
| T10370 | 15101-15102 | , | denotes | , |
| T10371 | 15103-15113 | VBG | denotes | suggesting |
| T10372 | 15114-15117 | DT | denotes | the |
| T10373 | 15118-15129 | NN | denotes | recruitment |
| T10374 | 15130-15133 | VBD | denotes | was |
| T10375 | 15134-15136 | NNP | denotes | κB |
| T10376 | 15137-15150 | JJ | denotes | site-specific |
| T10377 | 15150-15151 | . | denotes | . |
| T10378 | 15152-15156 | RB | denotes | Thus |
| T10379 | 15156-15157 | , | denotes | , |
| T10380 | 15158-15161 | DT | denotes | the |
| T10381 | 15162-15173 | NN | denotes | recruitment |
| T10382 | 15174-15176 | IN | denotes | of |
| T10383 | 15177-15181 | CD | denotes | RPS3 |
| T10384 | 15182-15184 | RB | denotes | as |
| T10385 | 15185-15189 | RB | denotes | well |
| T10386 | 15190-15192 | IN | denotes | as |
| T10387 | 15193-15196 | DT | denotes | the |
| T10388 | 15197-15207 | JJ | denotes | contingent |
| T10389 | 15208-15219 | NN | denotes | recruitment |
| T10390 | 15220-15222 | IN | denotes | of |
| T10391 | 15223-15226 | CD | denotes | p65 |
| T10392 | 15227-15229 | TO | denotes | to |
| T10393 | 15230-15233 | JJ | denotes | key |
| T10394 | 15234-15243 | NNS | denotes | promoters |
| T10395 | 15244-15252 | VBD | denotes | depended |
| T10396 | 15253-15255 | IN | denotes | on |
| T10397 | 15256-15260 | NNP | denotes | S209 |
| T10398 | 15260-15261 | . | denotes | . |
| T10399 | 15262-15273 | NNP | denotes | Interleukin |
| T10400 | 15274-15275 | CD | denotes | 8 |
| T10401 | 15276-15277 | -LRB- | denotes | ( |
| T10402 | 15277-15281 | NN | denotes | IL-8 |
| T10403 | 15281-15282 | -RRB- | denotes | ) |
| T10404 | 15283-15292 | NN | denotes | secretion |
| T10405 | 15293-15300 | VBN | denotes | induced |
| T10406 | 15301-15303 | IN | denotes | by |
| T10407 | 15304-15310 | DT | denotes | either |
| T10408 | 15311-15312 | NNP | denotes | T |
| T10409 | 15313-15317 | NN | denotes | cell |
| T10410 | 15318-15326 | NN | denotes | receptor |
| T10411 | 15327-15328 | -LRB- | denotes | ( |
| T10412 | 15328-15331 | NNP | denotes | TCR |
| T10413 | 15331-15332 | -RRB- | denotes | ) |
| T10414 | 15333-15340 | JJ | denotes | agonist |
| T10415 | 15341-15352 | NN | denotes | stimulation |
| T10416 | 15353-15355 | CC | denotes | or |
| T10417 | 15356-15361 | NNP | denotes | PMA+I |
| T10418 | 15362-15365 | VBD | denotes | was |
| T10419 | 15366-15375 | VBN | denotes | decreased |
| T10420 | 15376-15378 | IN | denotes | as |
| T10421 | 15379-15380 | DT | denotes | a |
| T10422 | 15381-15392 | NN | denotes | consequence |
| T10423 | 15393-15395 | IN | denotes | of |
| T10424 | 15396-15403 | JJ | denotes | reduced |
| T10425 | 15404-15412 | NNS | denotes | RPS3/p65 |
| T10426 | 15413-15424 | NN | denotes | recruitment |
| T10427 | 15425-15427 | TO | denotes | to |
| T10428 | 15428-15431 | DT | denotes | the |
| T10429 | 15432-15435 | NNP | denotes | IL8 |
| T10430 | 15436-15438 | NNP | denotes | κB |
| T10431 | 15439-15444 | NNS | denotes | sites |
| T10432 | 15445-15447 | IN | denotes | in |
| T10433 | 15448-15451 | DT | denotes | the |
| T10434 | 15452-15460 | NN | denotes | presence |
| T10435 | 15461-15463 | IN | denotes | of |
| T10436 | 15464-15469 | CD | denotes | S209A |
| T10437 | 15470-15476 | JJ | denotes | mutant |
| T10438 | 15477-15485 | VBN | denotes | compared |
| T10439 | 15486-15488 | TO | denotes | to |
| T10440 | 15489-15498 | JJ | denotes | wild-type |
| T10441 | 15499-15503 | NNP | denotes | RPS3 |
| T10442 | 15504-15505 | -LRB- | denotes | ( |
| T10443 | 15505-15518 | NNP | denotes | Supplementary |
| T10444 | 15519-15523 | NNP | denotes | Fig. |
| T10445 | 15524-15526 | CD | denotes | 10 |
| T10446 | 15526-15527 | -RRB- | denotes | ) |
| T10447 | 15527-15528 | . | denotes | . |
| T10448 | 15529-15536 | RB | denotes | However |
| T10449 | 15536-15537 | , | denotes | , |
| T10450 | 15538-15542 | NN | denotes | cell |
| T10451 | 15543-15550 | NN | denotes | surface |
| T10452 | 15551-15555 | NNP | denotes | CD25 |
| T10453 | 15556-15566 | NN | denotes | expression |
| T10454 | 15567-15570 | VBD | denotes | was |
| T10455 | 15571-15581 | JJ | denotes | comparable |
| T10456 | 15582-15589 | IN | denotes | between |
| T10457 | 15590-15593 | DT | denotes | the |
| T10458 | 15594-15603 | JJ | denotes | wild-type |
| T10459 | 15604-15607 | CC | denotes | and |
| T10460 | 15608-15613 | NNP | denotes | S209A |
| T10461 | 15614-15618 | NNP | denotes | RPS3 |
| T10462 | 15619-15630 | VBD | denotes | transfected |
| T10463 | 15631-15636 | NNS | denotes | cells |
| T10464 | 15637-15638 | -LRB- | denotes | ( |
| T10465 | 15638-15651 | NNP | denotes | Supplementary |
| T10466 | 15652-15656 | NNP | denotes | Fig. |
| T10467 | 15657-15659 | CD | denotes | 11 |
| T10468 | 15659-15660 | -RRB- | denotes | ) |
| T10469 | 15660-15661 | . | denotes | . |
| T10470 | 15662-15671 | RB | denotes | Therefore |
| T10471 | 15671-15672 | , | denotes | , |
| T10472 | 15673-15677 | NNP | denotes | RPS3 |
| T10473 | 15678-15682 | NNP | denotes | S209 |
| T10474 | 15683-15698 | NN | denotes | phosphorylation |
| T10475 | 15699-15701 | IN | denotes | by |
| T10476 | 15702-15706 | NNP | denotes | IKKβ |
| T10477 | 15707-15709 | VBZ | denotes | is |
| T10478 | 15710-15720 | RB | denotes | apparently |
| T10479 | 15721-15729 | VBN | denotes | required |
| T10480 | 15730-15733 | IN | denotes | for |
| T10481 | 15734-15738 | NNP | denotes | RPS3 |
| T10482 | 15739-15741 | IN | denotes | in |
| T10483 | 15742-15751 | VBG | denotes | directing |
| T10484 | 15752-15757 | NN | denotes | NF-κB |
| T10485 | 15758-15760 | TO | denotes | to |
| T10486 | 15761-15762 | DT | denotes | a |
| T10487 | 15763-15771 | JJ | denotes | specific |
| T10488 | 15772-15778 | NN | denotes | subset |
| T10489 | 15779-15781 | IN | denotes | of |
| T10490 | 15782-15788 | NN | denotes | target |
| T10491 | 15789-15794 | NNS | denotes | genes |
| T10492 | 15794-15795 | . | denotes | . |
| T12437 | 15797-15802 | CD | denotes | NleH1 |
| T12438 | 15803-15811 | NNS | denotes | inhibits |
| T12439 | 15812-15816 | JJ | denotes | RPS3 |
| T12440 | 15817-15832 | NN | denotes | phosphorylation |
| T12441 | 15833-15835 | IN | denotes | in |
| T12442 | 15836-15841 | NN | denotes | vitro |
| T12443 | 15842-15846 | NNP | denotes | EHEC |
| T12444 | 15847-15856 | NNS | denotes | pathogens |
| T12445 | 15857-15860 | VBP | denotes | are |
| T12446 | 15861-15870 | JJ | denotes | important |
| T12447 | 15871-15880 | JJ | denotes | causative |
| T12448 | 15881-15887 | NNS | denotes | agents |
| T12449 | 15888-15890 | IN | denotes | of |
| T12450 | 15891-15895 | DT | denotes | both |
| T12451 | 15896-15905 | JJ | denotes | foodborne |
| T12452 | 15906-15913 | NN | denotes | disease |
| T12453 | 15914-15917 | CC | denotes | and |
| T12454 | 15918-15927 | JJ | denotes | pediatric |
| T12455 | 15928-15933 | JJ | denotes | renal |
| T12456 | 15934-15943 | NN | denotes | failure31 |
| T12457 | 15943-15944 | . | denotes | . |
| T12458 | 15945-15949 | NNP | denotes | EHEC |
| T12459 | 15950-15957 | VB | denotes | utilize |
| T12460 | 15958-15962 | CD | denotes | T3SS |
| T12461 | 15963-15965 | TO | denotes | to |
| T12462 | 15966-15972 | VB | denotes | inject |
| T12463 | 15973-15981 | NN | denotes | effector |
| T12464 | 15982-15990 | NNS | denotes | proteins |
| T12465 | 15991-15999 | RB | denotes | directly |
| T12466 | 16000-16004 | IN | denotes | into |
| T12467 | 16005-16015 | JJ | denotes | intestinal |
| T12468 | 16016-16026 | JJ | denotes | epithelial |
| T12469 | 16027-16034 | NN | denotes | cells32 |
| T12470 | 16034-16035 | , | denotes | , |
| T12471 | 16036-16037 | DT | denotes | a |
| T12472 | 16038-16044 | NN | denotes | subset |
| T12473 | 16045-16047 | IN | denotes | of |
| T12474 | 16048-16053 | WDT | denotes | which |
| T12475 | 16054-16061 | VBP | denotes | inhibit |
| T12476 | 16062-16077 | JJ | denotes | NF-κB-dependent |
| T12477 | 16078-16084 | NN | denotes | innate |
| T12478 | 16085-16095 | CD | denotes | responses9 |
| T12479 | 16095-16096 | , | denotes | , |
| T12480 | 16097-16102 | CD | denotes | 33-38 |
| T12481 | 16102-16103 | . | denotes | . |
| T12482 | 16104-16107 | DT | denotes | The |
| T12483 | 16108-16110 | NNP | denotes | E. |
| T12484 | 16111-16115 | NNS | denotes | coli |
| T12485 | 16116-16120 | NNP | denotes | O157 |
| T12486 | 16120-16121 | : | denotes | : |
| T12487 | 16121-16123 | NNP | denotes | H7 |
| T12488 | 16124-16130 | NNP | denotes | EDL933 |
| T12489 | 16131-16139 | NN | denotes | effector |
| T12490 | 16140-16147 | NN | denotes | protein |
| T12491 | 16148-16153 | NNP | denotes | NleH1 |
| T12492 | 16154-16159 | VBZ | denotes | binds |
| T12493 | 16160-16162 | TO | denotes | to |
| T12494 | 16163-16166 | CC | denotes | and |
| T12495 | 16167-16177 | VBZ | denotes | attenuates |
| T12496 | 16178-16182 | NNP | denotes | RPS3 |
| T12497 | 16183-16190 | JJ | denotes | nuclear |
| T12498 | 16191-16204 | NN | denotes | translocation |
| T12499 | 16204-16205 | , | denotes | , |
| T12500 | 16206-16210 | RB | denotes | thus |
| T12501 | 16211-16220 | VBG | denotes | impairing |
| T12502 | 16221-16235 | JJ | denotes | RPS3-dependent |
| T12503 | 16236-16241 | NNP | denotes | NF-κB |
| T12504 | 16242-16252 | CD | denotes | signaling9 |
| T12505 | 16252-16253 | . | denotes | . |
| T12506 | 16254-16256 | PRP | denotes | We |
| T12507 | 16257-16266 | RB | denotes | therefore |
| T12508 | 16267-16279 | VBD | denotes | hypothesized |
| T12509 | 16280-16284 | IN | denotes | that |
| T12510 | 16285-16290 | NNP | denotes | NleH1 |
| T12511 | 16291-16294 | MD | denotes | may |
| T12512 | 16295-16303 | VB | denotes | function |
| T12513 | 16304-16306 | IN | denotes | by |
| T12514 | 16307-16317 | VBG | denotes | inhibiting |
| T12515 | 16318-16322 | NNP | denotes | RPS3 |
| T12516 | 16323-16327 | NNP | denotes | S209 |
| T12517 | 16328-16343 | NN | denotes | phosphorylation |
| T12518 | 16343-16344 | . | denotes | . |
| T12519 | 16345-16347 | IN | denotes | As |
| T12520 | 16348-16356 | VBN | denotes | expected |
| T12521 | 16356-16357 | , | denotes | , |
| T12522 | 16358-16370 | VBG | denotes | transfecting |
| T12523 | 16371-16381 | VBG | denotes | increasing |
| T12524 | 16382-16389 | NNS | denotes | amounts |
| T12525 | 16390-16392 | IN | denotes | of |
| T12526 | 16393-16401 | JJ | denotes | NleH1-HA |
| T12527 | 16402-16409 | JJ | denotes | plasmid |
| T12528 | 16410-16417 | VBN | denotes | blocked |
| T12529 | 16418-16430 | JJ | denotes | TNFα-induced |
| T12530 | 16431-16436 | NN | denotes | NF-κB |
| T12531 | 16437-16447 | NN | denotes | activation |
| T12532 | 16448-16450 | IN | denotes | in |
| T12533 | 16451-16452 | DT | denotes | a |
| T12534 | 16453-16467 | JJ | denotes | dose-dependent |
| T12535 | 16468-16474 | NN | denotes | manner |
| T12536 | 16475-16476 | -LRB- | denotes | ( |
| T12537 | 16476-16480 | NNP | denotes | Fig. |
| T12538 | 16481-16485 | JJ | denotes | 6a-b |
| T12539 | 16485-16486 | -RRB- | denotes | ) |
| T12540 | 16486-16487 | CD | denotes | 9 |
| T12541 | 16487-16488 | . | denotes | . |
| T12542 | 16489-16499 | RB | denotes | Remarkably |
| T12543 | 16499-16500 | , | denotes | , |
| T12544 | 16501-16506 | NNP | denotes | NleH1 |
| T12545 | 16507-16514 | VBD | denotes | reduced |
| T12546 | 16515-16519 | DT | denotes | both |
| T12547 | 16520-16531 | JJ | denotes | TNF-induced |
| T12548 | 16531-16532 | , | denotes | , |
| T12549 | 16533-16535 | RB | denotes | as |
| T12550 | 16536-16540 | RB | denotes | well |
| T12551 | 16541-16543 | IN | denotes | as |
| T12552 | 16544-16549 | JJ | denotes | basal |
| T12553 | 16550-16554 | JJ | denotes | RPS3 |
| T12554 | 16555-16570 | NN | denotes | phosphorylation |
| T12555 | 16571-16573 | TO | denotes | to |
| T12556 | 16574-16581 | RB | denotes | roughly |
| T12557 | 16582-16584 | CD | denotes | 20 |
| T12558 | 16584-16585 | NN | denotes | % |
| T12559 | 16586-16588 | IN | denotes | of |
| T12560 | 16589-16596 | NN | denotes | vehicle |
| T12561 | 16597-16604 | NN | denotes | control |
| T12562 | 16605-16606 | -LRB- | denotes | ( |
| T12563 | 16606-16610 | NNP | denotes | Fig. |
| T12564 | 16611-16613 | CD | denotes | 6c |
| T12565 | 16613-16614 | -RRB- | denotes | ) |
| T12566 | 16614-16615 | . | denotes | . |
| T12567 | 16616-16626 | VBG | denotes | Expressing |
| T12568 | 16627-16632 | NN | denotes | NleH1 |
| T12569 | 16633-16637 | VBZ | denotes | does |
| T12570 | 16638-16641 | RB | denotes | not |
| T12571 | 16642-16651 | VB | denotes | interfere |
| T12572 | 16652-16656 | IN | denotes | with |
| T12573 | 16657-16663 | DT | denotes | either |
| T12574 | 16664-16675 | JJ | denotes | TNF-induced |
| T12575 | 16676-16679 | NNP | denotes | IKK |
| T12576 | 16680-16690 | NN | denotes | activation |
| T12577 | 16691-16693 | CC | denotes | or |
| T12578 | 16694-16698 | NN | denotes | IκBα |
| T12579 | 16699-16710 | NN | denotes | degradation |
| T12580 | 16710-16711 | , | denotes | , |
| T12581 | 16712-16722 | JJ | denotes | consistent |
| T12582 | 16723-16727 | IN | denotes | with |
| T12583 | 16728-16731 | DT | denotes | the |
| T12584 | 16732-16736 | NN | denotes | lack |
| T12585 | 16737-16739 | IN | denotes | of |
| T12586 | 16740-16745 | JJ | denotes | NleH1 |
| T12587 | 16746-16752 | NN | denotes | impact |
| T12588 | 16753-16755 | IN | denotes | on |
| T12589 | 16756-16759 | CD | denotes | p65 |
| T12590 | 16760-16767 | JJ | denotes | nuclear |
| T12591 | 16768-16782 | NNS | denotes | translocation9 |
| T12592 | 16783-16784 | -LRB- | denotes | ( |
| T12593 | 16784-16788 | NNP | denotes | Fig. |
| T12594 | 16789-16791 | CD | denotes | 6c |
| T12595 | 16791-16792 | -RRB- | denotes | ) |
| T12596 | 16792-16793 | . | denotes | . |
| T12597 | 16794-16796 | TO | denotes | To |
| T12598 | 16797-16806 | VB | denotes | determine |
| T12599 | 16807-16809 | IN | denotes | if |
| T12600 | 16810-16815 | JJ | denotes | NleH1 |
| T12601 | 16816-16824 | NNS | denotes | inhibits |
| T12602 | 16825-16829 | JJ | denotes | RPS3 |
| T12603 | 16830-16845 | NN | denotes | phosphorylation |
| T12604 | 16845-16846 | , | denotes | , |
| T12605 | 16847-16849 | PRP | denotes | we |
| T12606 | 16850-16858 | VBD | denotes | infected |
| T12607 | 16859-16863 | NNP | denotes | HeLa |
| T12608 | 16864-16869 | NNS | denotes | cells |
| T12609 | 16870-16874 | IN | denotes | with |
| T12610 | 16875-16877 | NNP | denotes | E. |
| T12611 | 16878-16882 | NNS | denotes | coli |
| T12612 | 16883-16887 | NNP | denotes | O157 |
| T12613 | 16887-16888 | : | denotes | : |
| T12614 | 16888-16890 | NNP | denotes | H7 |
| T12615 | 16891-16898 | NNS | denotes | strains |
| T12616 | 16899-16909 | VBG | denotes | possessing |
| T12617 | 16910-16912 | CC | denotes | or |
| T12618 | 16913-16920 | VBG | denotes | lacking |
| T12619 | 16921-16927 | CC | denotes | either |
| T12620 | 16928-16933 | NNP | denotes | nleH1 |
| T12621 | 16934-16935 | -LRB- | denotes | ( |
| T12622 | 16935-16941 | NNP | denotes | ΔnleH1 |
| T12623 | 16941-16942 | -RRB- | denotes | ) |
| T12624 | 16943-16945 | CC | denotes | or |
| T12625 | 16946-16950 | IN | denotes | with |
| T12626 | 16951-16952 | DT | denotes | a |
| T12627 | 16953-16959 | NN | denotes | strain |
| T12628 | 16960-16967 | VBG | denotes | lacking |
| T12629 | 16968-16969 | DT | denotes | a |
| T12630 | 16970-16980 | JJ | denotes | functional |
| T12631 | 16981-16985 | CD | denotes | T3SS |
| T12632 | 16986-16992 | JJ | denotes | unable |
| T12633 | 16993-16995 | TO | denotes | to |
| T12634 | 16996-17002 | VB | denotes | inject |
| T12635 | 17003-17008 | NNP | denotes | NleH1 |
| T12636 | 17009-17013 | IN | denotes | into |
| T12637 | 17014-17023 | JJ | denotes | mammalian |
| T12638 | 17024-17029 | NNS | denotes | cells |
| T12639 | 17030-17031 | -LRB- | denotes | ( |
| T12640 | 17031-17036 | NNP | denotes | ΔescN |
| T12641 | 17036-17037 | -RRB- | denotes | ) |
| T12642 | 17037-17038 | . | denotes | . |
| T12643 | 17039-17041 | IN | denotes | In |
| T12644 | 17042-17052 | JJ | denotes | uninfected |
| T12645 | 17053-17058 | NNS | denotes | cells |
| T12646 | 17058-17059 | , | denotes | , |
| T12647 | 17060-17073 | JJ | denotes | TNF-treatment |
| T12648 | 17074-17084 | VBD | denotes | stimulated |
| T12649 | 17085-17086 | DT | denotes | a |
| T12650 | 17087-17088 | NN | denotes | ∼ |
| T12651 | 17088-17094 | JJ | denotes | 7-fold |
| T12652 | 17095-17103 | NN | denotes | increase |
| T12653 | 17104-17106 | IN | denotes | in |
| T12654 | 17107-17111 | NNP | denotes | RPS3 |
| T12655 | 17112-17116 | NNP | denotes | S209 |
| T12656 | 17117-17132 | NN | denotes | phosphorylation |
| T12657 | 17132-17133 | , | denotes | , |
| T12658 | 17134-17141 | VBG | denotes | peaking |
| T12659 | 17142-17144 | IN | denotes | at |
| T12660 | 17145-17147 | CD | denotes | 30 |
| T12661 | 17148-17155 | NNS | denotes | minutes |
| T12662 | 17156-17157 | -LRB- | denotes | ( |
| T12663 | 17157-17161 | NNP | denotes | Fig. |
| T12664 | 17162-17164 | CD | denotes | 6d |
| T12665 | 17164-17165 | -RRB- | denotes | ) |
| T12666 | 17165-17166 | . | denotes | . |
| T12667 | 17167-17169 | IN | denotes | By |
| T12668 | 17170-17178 | NN | denotes | contrast |
| T12669 | 17178-17179 | , | denotes | , |
| T12670 | 17180-17184 | NNP | denotes | RPS3 |
| T12671 | 17185-17189 | NNP | denotes | S209 |
| T12672 | 17190-17205 | NN | denotes | phosphorylation |
| T12673 | 17206-17209 | VBD | denotes | was |
| T12674 | 17210-17223 | RB | denotes | substantially |
| T12675 | 17224-17232 | VBN | denotes | impaired |
| T12676 | 17233-17235 | IN | denotes | in |
| T12677 | 17236-17241 | NNS | denotes | cells |
| T12678 | 17242-17250 | VBN | denotes | infected |
| T12679 | 17251-17255 | IN | denotes | with |
| T12680 | 17256-17265 | JJ | denotes | wild-type |
| T12681 | 17266-17268 | NNP | denotes | E. |
| T12682 | 17269-17273 | NNS | denotes | coli |
| T12683 | 17274-17278 | NNP | denotes | O157 |
| T12684 | 17278-17279 | : | denotes | : |
| T12685 | 17279-17281 | NNP | denotes | H7 |
| T12686 | 17282-17283 | -LRB- | denotes | ( |
| T12687 | 17283-17287 | NNP | denotes | Fig. |
| T12688 | 17288-17290 | CD | denotes | 6d |
| T12689 | 17290-17291 | -RRB- | denotes | ) |
| T12690 | 17291-17292 | . | denotes | . |
| T12691 | 17293-17300 | RB | denotes | However |
| T12692 | 17300-17301 | , | denotes | , |
| T12693 | 17302-17313 | JJ | denotes | TNF-induced |
| T12694 | 17314-17318 | NNP | denotes | RPS3 |
| T12695 | 17319-17323 | NNP | denotes | S209 |
| T12696 | 17324-17339 | NN | denotes | phosphorylation |
| T12697 | 17340-17343 | VBD | denotes | was |
| T12698 | 17344-17354 | VBN | denotes | unimpaired |
| T12699 | 17355-17357 | IN | denotes | in |
| T12700 | 17358-17363 | NNS | denotes | cells |
| T12701 | 17364-17372 | VBN | denotes | infected |
| T12702 | 17373-17377 | IN | denotes | with |
| T12703 | 17378-17384 | DT | denotes | either |
| T12704 | 17385-17391 | NNP | denotes | ΔnleH1 |
| T12705 | 17392-17394 | CC | denotes | or |
| T12706 | 17395-17400 | NNP | denotes | ΔescN |
| T12707 | 17401-17402 | -LRB- | denotes | ( |
| T12708 | 17402-17406 | NNP | denotes | Fig. |
| T12709 | 17407-17409 | CD | denotes | 6d |
| T12710 | 17409-17410 | -RRB- | denotes | ) |
| T12711 | 17410-17411 | . | denotes | . |
| T12712 | 17412-17414 | PRP | denotes | We |
| T12713 | 17415-17421 | VBD | denotes | showed |
| T12714 | 17422-17432 | RB | denotes | previously |
| T12715 | 17433-17437 | IN | denotes | that |
| T12716 | 17438-17447 | JJ | denotes | wild-type |
| T12717 | 17447-17448 | , | denotes | , |
| T12718 | 17449-17452 | CC | denotes | but |
| T12719 | 17453-17456 | RB | denotes | not |
| T12720 | 17457-17463 | JJ | denotes | ΔnleH1 |
| T12721 | 17464-17466 | CC | denotes | or |
| T12722 | 17467-17472 | NNP | denotes | ΔescN |
| T12723 | 17473-17475 | NNP | denotes | E. |
| T12724 | 17476-17480 | NNS | denotes | coli |
| T12725 | 17481-17485 | NNP | denotes | O157 |
| T12726 | 17485-17486 | : | denotes | : |
| T12727 | 17486-17488 | NNP | denotes | H7 |
| T12728 | 17489-17502 | RB | denotes | significantly |
| T12729 | 17503-17513 | VBD | denotes | attenuated |
| T12730 | 17514-17525 | JJ | denotes | TNF-induced |
| T12731 | 17526-17530 | JJ | denotes | RPS3 |
| T12732 | 17531-17538 | JJ | denotes | nuclear |
| T12733 | 17539-17553 | NNS | denotes | translocation9 |
| T12734 | 17553-17554 | . | denotes | . |
| T12735 | 17555-17558 | DT | denotes | The |
| T12736 | 17559-17567 | NN | denotes | parallel |
| T12737 | 17568-17575 | IN | denotes | between |
| T12738 | 17576-17580 | CD | denotes | RPS3 |
| T12739 | 17581-17596 | NN | denotes | phosphorylation |
| T12740 | 17597-17600 | CC | denotes | and |
| T12741 | 17601-17604 | PRP$ | denotes | its |
| T12742 | 17605-17612 | JJ | denotes | nuclear |
| T12743 | 17613-17626 | NN | denotes | translocation |
| T12744 | 17627-17633 | IN | denotes | during |
| T12745 | 17634-17636 | NNP | denotes | E. |
| T12746 | 17637-17641 | NNS | denotes | coli |
| T12747 | 17642-17651 | NN | denotes | infection |
| T12748 | 17652-17660 | VBZ | denotes | provides |
| T12749 | 17661-17669 | NN | denotes | evidence |
| T12750 | 17670-17672 | IN | denotes | in |
| T12751 | 17673-17676 | DT | denotes | the |
| T12752 | 17677-17684 | NN | denotes | context |
| T12753 | 17685-17687 | IN | denotes | of |
| T12754 | 17688-17690 | DT | denotes | an |
| T12755 | 17691-17706 | JJ | denotes | NF-κB-dependent |
| T12756 | 17707-17714 | NN | denotes | disease |
| T12757 | 17715-17722 | NN | denotes | process |
| T12758 | 17723-17727 | WDT | denotes | that |
| T12759 | 17728-17732 | NNP | denotes | RPS3 |
| T12760 | 17733-17737 | NNP | denotes | S209 |
| T12761 | 17738-17753 | NN | denotes | phosphorylation |
| T12762 | 17754-17756 | VBZ | denotes | is |
| T12763 | 17757-17766 | JJ | denotes | important |
| T12764 | 17767-17770 | IN | denotes | for |
| T12765 | 17771-17778 | JJ | denotes | nuclear |
| T12766 | 17779-17792 | NN | denotes | translocation |
| T12767 | 17792-17793 | . | denotes | . |
| T12768 | 17794-17797 | PRP$ | denotes | Our |
| T12769 | 17798-17807 | NN | denotes | discovery |
| T12770 | 17808-17812 | IN | denotes | that |
| T12771 | 17813-17818 | NNP | denotes | NleH1 |
| T12772 | 17819-17827 | VBZ | denotes | inhibits |
| T12773 | 17828-17832 | NNP | denotes | RPS3 |
| T12774 | 17833-17837 | NNP | denotes | S209 |
| T12775 | 17838-17853 | NN | denotes | phosphorylation |
| T12776 | 17854-17863 | VBD | denotes | suggested |
| T12777 | 17864-17868 | IN | denotes | that |
| T12778 | 17869-17871 | PRP | denotes | it |
| T12779 | 17872-17878 | MD | denotes | should |
| T12780 | 17879-17883 | RB | denotes | also |
| T12781 | 17884-17890 | NNS | denotes | blocks |
| T12782 | 17891-17905 | JJ | denotes | RPS3-dependent |
| T12783 | 17906-17911 | NN | denotes | NF-κB |
| T12784 | 17912-17918 | NN | denotes | target |
| T12785 | 17919-17923 | NN | denotes | gene |
| T12786 | 17924-17937 | NN | denotes | transcription |
| T12787 | 17938-17939 | -LRB- | denotes | ( |
| T12788 | 17939-17943 | FW | denotes | e.g. |
| T12789 | 17944-17947 | FW | denotes | IL8 |
| T12790 | 17947-17948 | , | denotes | , |
| T12791 | 17949-17955 | NNP | denotes | NFKBIA |
| T12792 | 17955-17956 | , | denotes | , |
| T12793 | 17957-17960 | CC | denotes | and |
| T12794 | 17961-17968 | CD | denotes | TNFAIP3 |
| T12795 | 17968-17969 | -RRB- | denotes | ) |
| T12796 | 17969-17970 | . | denotes | . |
| T12797 | 17971-17977 | RB | denotes | Indeed |
| T12798 | 17977-17978 | , | denotes | , |
| T12799 | 17979-17984 | DT | denotes | these |
| T12800 | 17985-17990 | NNS | denotes | genes |
| T12801 | 17991-17995 | VBD | denotes | were |
| T12802 | 17996-18000 | RB | denotes | only |
| T12803 | 18001-18009 | RB | denotes | modestly |
| T12804 | 18010-18021 | VBN | denotes | upregulated |
| T12805 | 18022-18024 | IN | denotes | in |
| T12806 | 18025-18030 | NNS | denotes | cells |
| T12807 | 18031-18039 | VBN | denotes | infected |
| T12808 | 18040-18044 | IN | denotes | with |
| T12809 | 18045-18054 | JJ | denotes | wild-type |
| T12810 | 18055-18057 | NNP | denotes | E. |
| T12811 | 18058-18062 | NNS | denotes | coli |
| T12812 | 18063-18067 | NNP | denotes | O157 |
| T12813 | 18067-18068 | : | denotes | : |
| T12814 | 18068-18070 | NNP | denotes | H7 |
| T12815 | 18070-18071 | , | denotes | , |
| T12816 | 18072-18075 | CC | denotes | but |
| T12817 | 18076-18089 | RB | denotes | significantly |
| T12818 | 18090-18097 | VBD | denotes | induced |
| T12819 | 18098-18100 | IN | denotes | in |
| T12820 | 18101-18106 | NNS | denotes | cells |
| T12821 | 18107-18115 | VBN | denotes | infected |
| T12822 | 18116-18120 | IN | denotes | with |
| T12823 | 18121-18127 | DT | denotes | either |
| T12824 | 18128-18134 | NNP | denotes | ΔnleH1 |
| T12825 | 18135-18137 | CC | denotes | or |
| T12826 | 18138-18143 | NNP | denotes | ΔescN |
| T12827 | 18144-18151 | NNS | denotes | strains |
| T12828 | 18152-18153 | -LRB- | denotes | ( |
| T12829 | 18153-18157 | NNP | denotes | Fig. |
| T12830 | 18158-18160 | CD | denotes | 6e |
| T12831 | 18160-18161 | -RRB- | denotes | ) |
| T12832 | 18161-18162 | . | denotes | . |
| T12833 | 18163-18165 | IN | denotes | In |
| T12834 | 18166-18174 | NN | denotes | contrast |
| T12835 | 18174-18175 | , | denotes | , |
| T12836 | 18176-18184 | VBG | denotes | deleting |
| T12837 | 18185-18190 | NNP | denotes | nleH1 |
| T12838 | 18191-18194 | VBD | denotes | had |
| T12839 | 18195-18197 | DT | denotes | no |
| T12840 | 18198-18204 | NN | denotes | impact |
| T12841 | 18205-18207 | IN | denotes | on |
| T12842 | 18208-18211 | DT | denotes | the |
| T12843 | 18212-18222 | NN | denotes | expression |
| T12844 | 18223-18225 | IN | denotes | of |
| T12845 | 18226-18242 | JJ | denotes | RPS3-independent |
| T12846 | 18243-18248 | NNS | denotes | genes |
| T12847 | 18248-18249 | , | denotes | , |
| T12848 | 18250-18259 | VBG | denotes | including |
| T12849 | 18260-18264 | NNP | denotes | CD25 |
| T12850 | 18265-18268 | CC | denotes | and |
| T12851 | 18269-18277 | NNP | denotes | TNFSF13B |
| T12852 | 18278-18279 | -LRB- | denotes | ( |
| T12853 | 18279-18292 | NNP | denotes | Supplementary |
| T12854 | 18293-18297 | NNP | denotes | Fig. |
| T12855 | 18298-18300 | CD | denotes | 12 |
| T12856 | 18300-18301 | -RRB- | denotes | ) |
| T12857 | 18301-18302 | . | denotes | . |
| T12858 | 18303-18311 | RB | denotes | Together |
| T12859 | 18312-18317 | DT | denotes | these |
| T12860 | 18318-18325 | NNS | denotes | results |
| T12861 | 18326-18337 | VBP | denotes | demonstrate |
| T12862 | 18338-18342 | IN | denotes | that |
| T12863 | 18343-18348 | JJ | denotes | NleH1 |
| T12864 | 18349-18361 | RB | denotes | specifically |
| T12865 | 18362-18370 | VBZ | denotes | inhibits |
| T12866 | 18371-18374 | DT | denotes | the |
| T12867 | 18375-18385 | JJ | denotes | protective |
| T12868 | 18386-18392 | JJ | denotes | immune |
| T12869 | 18393-18401 | NN | denotes | response |
| T12870 | 18402-18404 | IN | denotes | by |
| T12871 | 18405-18413 | RB | denotes | directly |
| T12872 | 18414-18422 | VBG | denotes | blocking |
| T12873 | 18423-18427 | NNP | denotes | RPS3 |
| T12874 | 18428-18432 | NNP | denotes | S209 |
| T12875 | 18433-18448 | NN | denotes | phosphorylation |
| T12876 | 18449-18452 | CC | denotes | and |
| T12877 | 18453-18460 | RB | denotes | thereby |
| T12878 | 18461-18470 | VBG | denotes | impairing |
| T12879 | 18471-18479 | JJ | denotes | critical |
| T12880 | 18480-18494 | JJ | denotes | RPS3-dependent |
| T12881 | 18495-18500 | NN | denotes | NF-κB |
| T12882 | 18501-18507 | NN | denotes | target |
| T12883 | 18508-18513 | NNS | denotes | genes |
| T12884 | 18513-18514 | . | denotes | . |
| T13949 | 18516-18521 | JJ | denotes | NleH1 |
| T13950 | 18522-18530 | NNS | denotes | inhibits |
| T13951 | 18531-18535 | NNP | denotes | RPS3 |
| T13952 | 18536-18540 | NNP | denotes | S209 |
| T13953 | 18541-18556 | NN | denotes | phosphorylation |
| T13954 | 18557-18559 | IN | denotes | in |
| T13955 | 18560-18564 | NN | denotes | vivo |
| T13956 | 18565-18567 | PRP | denotes | We |
| T13957 | 18568-18578 | RB | denotes | previously |
| T13958 | 18579-18587 | VBD | denotes | utilized |
| T13959 | 18588-18589 | DT | denotes | a |
| T13960 | 18590-18601 | JJ | denotes | gnotobiotic |
| T13961 | 18602-18608 | NN | denotes | piglet |
| T13962 | 18609-18618 | NN | denotes | infection |
| T13963 | 18619-18624 | NN | denotes | model |
| T13964 | 18625-18627 | TO | denotes | to |
| T13965 | 18628-18637 | VB | denotes | determine |
| T13966 | 18638-18642 | DT | denotes | that |
| T13967 | 18643-18650 | NNS | denotes | piglets |
| T13968 | 18651-18659 | VBN | denotes | infected |
| T13969 | 18660-18664 | IN | denotes | with |
| T13970 | 18665-18671 | JJ | denotes | ΔnleH1 |
| T13971 | 18672-18678 | JJ | denotes | mutant |
| T13972 | 18679-18683 | VBD | denotes | died |
| T13973 | 18684-18688 | RBR | denotes | more |
| T13974 | 18689-18696 | RB | denotes | rapidly |
| T13975 | 18697-18701 | IN | denotes | than |
| T13976 | 18702-18707 | DT | denotes | those |
| T13977 | 18708-18716 | VBN | denotes | infected |
| T13978 | 18717-18721 | IN | denotes | with |
| T13979 | 18722-18731 | JJ | denotes | wild-type |
| T13980 | 18732-18734 | NNP | denotes | E. |
| T13981 | 18735-18739 | NNS | denotes | coli |
| T13982 | 18740-18744 | NNP | denotes | O157 |
| T13983 | 18744-18745 | : | denotes | : |
| T13984 | 18745-18747 | NNP | denotes | H7 |
| T13985 | 18747-18748 | . | denotes | . |
| T13986 | 18749-18756 | NNS | denotes | Piglets |
| T13987 | 18757-18765 | VBN | denotes | infected |
| T13988 | 18766-18770 | IN | denotes | with |
| T13989 | 18771-18777 | NNP | denotes | ΔnleH1 |
| T13990 | 18778-18787 | VBD | denotes | displayed |
| T13991 | 18788-18796 | JJ | denotes | clinical |
| T13992 | 18797-18804 | NN | denotes | disease |
| T13993 | 18805-18815 | JJ | denotes | consistent |
| T13994 | 18816-18820 | IN | denotes | with |
| T13995 | 18821-18822 | DT | denotes | a |
| T13996 | 18823-18829 | JJ | denotes | robust |
| T13997 | 18830-18842 | JJ | denotes | inflammatory |
| T13998 | 18843-18851 | NN | denotes | response |
| T13999 | 18851-18852 | , | denotes | , |
| T14000 | 18853-18856 | CC | denotes | but |
| T14001 | 18857-18861 | IN | denotes | with |
| T14002 | 18862-18869 | JJ | denotes | reduced |
| T14003 | 18870-18879 | JJ | denotes | bacterial |
| T14004 | 18880-18892 | NN | denotes | colonization |
| T14005 | 18893-18896 | CC | denotes | and |
| T14006 | 18897-18903 | JJ | denotes | little |
| T14007 | 18904-18913 | NN | denotes | diarrhea9 |
| T14008 | 18913-18914 | . | denotes | . |
| T14009 | 18915-18920 | IN | denotes | While |
| T14010 | 18921-18930 | RB | denotes | seemingly |
| T14011 | 18931-18942 | JJ | denotes | paradoxical |
| T14012 | 18942-18943 | , | denotes | , |
| T14013 | 18944-18949 | VBN | denotes | based |
| T14014 | 18950-18952 | IN | denotes | on |
| T14015 | 18953-18956 | PRP$ | denotes | our |
| T14016 | 18957-18961 | NN | denotes | cell |
| T14017 | 18962-18969 | NN | denotes | culture |
| T14018 | 18970-18974 | NNS | denotes | data |
| T14019 | 18975-18976 | -LRB- | denotes | ( |
| T14020 | 18976-18980 | NNP | denotes | Fig. |
| T14021 | 18981-18983 | CD | denotes | 6d |
| T14022 | 18983-18984 | -RRB- | denotes | ) |
| T14023 | 18984-18985 | , | denotes | , |
| T14024 | 18986-18988 | PRP | denotes | we |
| T14025 | 18989-19001 | VBD | denotes | hypothesized |
| T14026 | 19002-19006 | IN | denotes | that |
| T14027 | 19007-19012 | NNP | denotes | NleH1 |
| T14028 | 19013-19020 | VBD | denotes | blocked |
| T14029 | 19021-19025 | CD | denotes | RPS3 |
| T14030 | 19026-19030 | CD | denotes | S209 |
| T14031 | 19031-19046 | NN | denotes | phosphorylation |
| T14032 | 19047-19049 | IN | denotes | in |
| T14033 | 19050-19054 | NN | denotes | vivo |
| T14034 | 19054-19055 | , | denotes | , |
| T14035 | 19056-19063 | RB | denotes | thereby |
| T14036 | 19064-19074 | VBG | denotes | preventing |
| T14037 | 19075-19079 | JJ | denotes | RPS3 |
| T14038 | 19080-19087 | JJ | denotes | nuclear |
| T14039 | 19088-19101 | NN | denotes | translocation |
| T14040 | 19102-19104 | IN | denotes | in |
| T14041 | 19105-19113 | JJ | denotes | infected |
| T14042 | 19114-19121 | NNS | denotes | piglets |
| T14043 | 19121-19122 | . | denotes | . |
| T14044 | 19123-19125 | PRP | denotes | We |
| T14045 | 19126-19134 | VBD | denotes | isolated |
| T14046 | 19135-19141 | NN | denotes | piglet |
| T14047 | 19142-19148 | NNS | denotes | colons |
| T14048 | 19149-19151 | IN | denotes | at |
| T14049 | 19152-19160 | NN | denotes | necropsy |
| T14050 | 19160-19161 | , | denotes | , |
| T14051 | 19162-19165 | CC | denotes | and |
| T14052 | 19166-19175 | VBD | denotes | subjected |
| T14053 | 19176-19180 | PRP | denotes | them |
| T14054 | 19181-19183 | TO | denotes | to |
| T14055 | 19184-19204 | NN | denotes | immunohistochemistry |
| T14056 | 19205-19210 | VBG | denotes | using |
| T14057 | 19211-19214 | PRP$ | denotes | our |
| T14058 | 19215-19227 | JJ | denotes | phospho-RPS3 |
| T14059 | 19228-19236 | NN | denotes | antibody |
| T14060 | 19236-19237 | . | denotes | . |
| T14061 | 19238-19248 | JJ | denotes | Consistent |
| T14062 | 19249-19253 | IN | denotes | with |
| T14063 | 19254-19256 | IN | denotes | in |
| T14064 | 19257-19262 | NN | denotes | vitro |
| T14065 | 19263-19267 | NNS | denotes | data |
| T14066 | 19267-19268 | , | denotes | , |
| T14067 | 19269-19276 | NNS | denotes | piglets |
| T14068 | 19277-19285 | VBN | denotes | infected |
| T14069 | 19286-19290 | IN | denotes | with |
| T14070 | 19291-19300 | JJ | denotes | wild-type |
| T14071 | 19301-19303 | NNP | denotes | E. |
| T14072 | 19304-19308 | NNS | denotes | coli |
| T14073 | 19309-19313 | NNP | denotes | O157 |
| T14074 | 19313-19314 | : | denotes | : |
| T14075 | 19314-19316 | NNP | denotes | H7 |
| T14076 | 19317-19326 | VBD | denotes | exhibited |
| T14077 | 19327-19334 | NN | denotes | diffuse |
| T14078 | 19335-19338 | CC | denotes | and |
| T14079 | 19339-19342 | JJ | denotes | low |
| T14080 | 19343-19352 | NN | denotes | intensity |
| T14081 | 19353-19365 | NN | denotes | phospho-RPS3 |
| T14082 | 19366-19374 | NN | denotes | staining |
| T14083 | 19374-19375 | , | denotes | , |
| T14084 | 19376-19383 | IN | denotes | whereas |
| T14085 | 19384-19386 | IN | denotes | in |
| T14086 | 19387-19394 | NNS | denotes | piglets |
| T14087 | 19395-19403 | VBN | denotes | infected |
| T14088 | 19404-19408 | IN | denotes | with |
| T14089 | 19409-19415 | JJ | denotes | ΔnleH1 |
| T14090 | 19416-19422 | JJ | denotes | mutant |
| T14091 | 19422-19423 | , | denotes | , |
| T14092 | 19424-19436 | JJ | denotes | phospho-RPS3 |
| T14093 | 19437-19447 | NN | denotes | expression |
| T14094 | 19448-19451 | VBD | denotes | was |
| T14095 | 19452-19458 | JJ | denotes | florid |
| T14096 | 19459-19462 | CC | denotes | and |
| T14097 | 19463-19470 | JJ | denotes | intense |
| T14098 | 19471-19472 | -LRB- | denotes | ( |
| T14099 | 19472-19476 | NNP | denotes | Fig. |
| T14100 | 19477-19479 | CD | denotes | 6f |
| T14101 | 19479-19480 | -RRB- | denotes | ) |
| T14102 | 19480-19481 | . | denotes | . |
| T14103 | 19482-19487 | DT | denotes | These |
| T14104 | 19488-19492 | NNS | denotes | data |
| T14105 | 19493-19504 | VBP | denotes | demonstrate |
| T14106 | 19505-19509 | IN | denotes | that |
| T14107 | 19510-19515 | JJ | denotes | NleH1 |
| T14108 | 19516-19524 | NNS | denotes | inhibits |
| T14109 | 19525-19529 | NNP | denotes | RPS3 |
| T14110 | 19530-19534 | NNP | denotes | S209 |
| T14111 | 19535-19550 | NN | denotes | phosphorylation |
| T14112 | 19551-19555 | DT | denotes | both |
| T14113 | 19556-19558 | IN | denotes | in |
| T14114 | 19559-19564 | NN | denotes | vitro |
| T14115 | 19565-19568 | CC | denotes | and |
| T14116 | 19569-19571 | IN | denotes | in |
| T14117 | 19572-19576 | NN | denotes | vivo |
| T14118 | 19576-19577 | , | denotes | , |
| T14119 | 19578-19583 | WDT | denotes | which |
| T14120 | 19584-19589 | MD | denotes | might |
| T14121 | 19590-19597 | VB | denotes | benefit |
| T14122 | 19598-19601 | DT | denotes | the |
| T14123 | 19602-19611 | NN | denotes | bacterium |
| T14124 | 19612-19614 | IN | denotes | in |
| T14125 | 19615-19627 | NN | denotes | colonization |
| T14126 | 19628-19631 | CC | denotes | and |
| T14127 | 19632-19644 | NN | denotes | transmission |
| T14128 | 19644-19645 | . | denotes | . |
| T15728 | 19647-19652 | JJ | denotes | NleH1 |
| T15729 | 19653-19659 | VBZ | denotes | steers |
| T15730 | 19660-19663 | DT | denotes | the |
| T15731 | 19664-19668 | NNP | denotes | IKKβ |
| T15732 | 19669-19678 | VB | denotes | substrate |
| T15733 | 19679-19692 | NNS | denotes | specificities |
| T15734 | 19693-19698 | NNP | denotes | NleH1 |
| T15735 | 19699-19701 | VBZ | denotes | is |
| T15736 | 19702-19704 | DT | denotes | an |
| T15737 | 19705-19723 | JJ | denotes | autophosphorylated |
| T15738 | 19724-19740 | JJ | denotes | serine-threonine |
| T15739 | 19741-19747 | NN | denotes | kinase |
| T15740 | 19747-19748 | , | denotes | , |
| T15741 | 19749-19754 | WDT | denotes | which |
| T15742 | 19755-19762 | VBZ | denotes | depends |
| T15743 | 19763-19765 | IN | denotes | on |
| T15744 | 19766-19769 | DT | denotes | the |
| T15745 | 19770-19776 | NN | denotes | lysine |
| T15746 | 19777-19780 | CD | denotes | 159 |
| T15747 | 19781-19782 | -LRB- | denotes | ( |
| T15748 | 19782-19786 | NNP | denotes | K159 |
| T15749 | 19786-19787 | -RRB- | denotes | ) |
| T15750 | 19787-19788 | CD | denotes | 9 |
| T15751 | 19788-19789 | . | denotes | . |
| T15752 | 19790-19792 | TO | denotes | To |
| T15753 | 19793-19800 | VB | denotes | explore |
| T15754 | 19801-19804 | DT | denotes | the |
| T15755 | 19805-19814 | NN | denotes | mechanism |
| T15756 | 19815-19817 | IN | denotes | by |
| T15757 | 19818-19823 | WDT | denotes | which |
| T15758 | 19824-19829 | NNP | denotes | NleH1 |
| T15759 | 19830-19838 | VBZ | denotes | inhibits |
| T15760 | 19839-19843 | NNP | denotes | RPS3 |
| T15761 | 19844-19848 | NNP | denotes | S209 |
| T15762 | 19849-19864 | NN | denotes | phosphorylation |
| T15763 | 19864-19865 | , | denotes | , |
| T15764 | 19866-19868 | PRP | denotes | we |
| T15765 | 19869-19874 | RB | denotes | first |
| T15766 | 19875-19884 | VBD | denotes | performed |
| T15767 | 19885-19887 | DT | denotes | an |
| T15768 | 19888-19890 | IN | denotes | in |
| T15769 | 19891-19896 | NN | denotes | vitro |
| T15770 | 19897-19903 | NN | denotes | kinase |
| T15771 | 19904-19909 | NN | denotes | assay |
| T15772 | 19910-19914 | IN | denotes | with |
| T15773 | 19915-19923 | JJ | denotes | purified |
| T15774 | 19924-19933 | JJ | denotes | wild-type |
| T15775 | 19934-19943 | NN | denotes | His-NleH1 |
| T15776 | 19944-19951 | NN | denotes | protein |
| T15777 | 19952-19955 | CC | denotes | and |
| T15778 | 19956-19957 | DT | denotes | a |
| T15779 | 19958-19964 | JJ | denotes | mutant |
| T15780 | 19965-19974 | NN | denotes | His-NleH1 |
| T15781 | 19975-19976 | -LRB- | denotes | ( |
| T15782 | 19976-19981 | NNP | denotes | K159A |
| T15783 | 19981-19982 | -RRB- | denotes | ) |
| T15784 | 19983-19990 | NN | denotes | protein |
| T15785 | 19990-19991 | , | denotes | , |
| T15786 | 19992-20002 | VBG | denotes | confirming |
| T15787 | 20003-20007 | IN | denotes | that |
| T15788 | 20008-20013 | NNP | denotes | NleH1 |
| T15789 | 20014-20016 | VBZ | denotes | is |
| T15790 | 20017-20035 | VBN | denotes | autophosphorylated |
| T15791 | 20036-20039 | CC | denotes | and |
| T15792 | 20040-20043 | DT | denotes | the |
| T15793 | 20044-20049 | NNP | denotes | K159A |
| T15794 | 20050-20052 | VBZ | denotes | is |
| T15795 | 20053-20055 | DT | denotes | an |
| T15796 | 20056-20061 | JJ | denotes | NleH1 |
| T15797 | 20062-20073 | NN | denotes | kinase-dead |
| T15798 | 20074-20080 | JJ | denotes | mutant |
| T15799 | 20081-20082 | -LRB- | denotes | ( |
| T15800 | 20082-20086 | NNP | denotes | Fig. |
| T15801 | 20087-20089 | CD | denotes | 7a |
| T15802 | 20089-20090 | -RRB- | denotes | ) |
| T15803 | 20090-20091 | . | denotes | . |
| T15804 | 20092-20094 | TO | denotes | To |
| T15805 | 20095-20102 | VB | denotes | examine |
| T15806 | 20103-20110 | IN | denotes | whether |
| T15807 | 20111-20114 | DT | denotes | the |
| T15808 | 20115-20121 | NN | denotes | kinase |
| T15809 | 20122-20130 | NN | denotes | activity |
| T15810 | 20131-20133 | VBZ | denotes | is |
| T15811 | 20134-20142 | VBN | denotes | required |
| T15812 | 20143-20146 | IN | denotes | for |
| T15813 | 20147-20152 | NNP | denotes | NleH1 |
| T15814 | 20153-20155 | TO | denotes | to |
| T15815 | 20156-20163 | VB | denotes | inhibit |
| T15816 | 20164-20168 | NNP | denotes | IKKβ |
| T15817 | 20169-20184 | NN | denotes | phosphorlyation |
| T15818 | 20185-20187 | IN | denotes | of |
| T15819 | 20188-20192 | NNP | denotes | RPS3 |
| T15820 | 20193-20195 | IN | denotes | on |
| T15821 | 20196-20200 | NNP | denotes | S209 |
| T15822 | 20200-20201 | , | denotes | , |
| T15823 | 20202-20204 | PRP | denotes | we |
| T15824 | 20205-20216 | RB | denotes | ectopically |
| T15825 | 20217-20227 | VBG | denotes | expressing |
| T15826 | 20228-20234 | CC | denotes | either |
| T15827 | 20235-20244 | JJ | denotes | wild-type |
| T15828 | 20245-20247 | CC | denotes | or |
| T15829 | 20248-20253 | NNP | denotes | K159A |
| T15830 | 20254-20259 | NNP | denotes | NleH1 |
| T15831 | 20260-20262 | IN | denotes | in |
| T15832 | 20263-20267 | NNP | denotes | 293T |
| T15833 | 20268-20273 | NNS | denotes | cells |
| T15834 | 20273-20274 | . | denotes | . |
| T15835 | 20275-20284 | JJ | denotes | Wild-type |
| T15836 | 20285-20290 | NNP | denotes | NleH1 |
| T15837 | 20291-20301 | NN | denotes | expression |
| T15838 | 20302-20315 | RB | denotes | significantly |
| T15839 | 20316-20323 | VBD | denotes | reduced |
| T15840 | 20324-20335 | JJ | denotes | TNF-induced |
| T15841 | 20336-20340 | NNP | denotes | RPS3 |
| T15842 | 20341-20345 | NNP | denotes | S209 |
| T15843 | 20346-20361 | NN | denotes | phosphorylation |
| T15844 | 20361-20362 | , | denotes | , |
| T15845 | 20363-20370 | IN | denotes | whereas |
| T15846 | 20371-20374 | DT | denotes | the |
| T15847 | 20375-20380 | NNP | denotes | K159A |
| T15848 | 20381-20387 | JJ | denotes | mutant |
| T15849 | 20388-20394 | VBD | denotes | failed |
| T15850 | 20395-20397 | TO | denotes | to |
| T15851 | 20398-20400 | VB | denotes | do |
| T15852 | 20401-20403 | RB | denotes | so |
| T15853 | 20404-20405 | -LRB- | denotes | ( |
| T15854 | 20405-20409 | NNP | denotes | Fig. |
| T15855 | 20410-20412 | CD | denotes | 7b |
| T15856 | 20412-20413 | -RRB- | denotes | ) |
| T15857 | 20413-20414 | . | denotes | . |
| T15858 | 20415-20419 | RB | denotes | Thus |
| T15859 | 20420-20425 | JJ | denotes | NleH1 |
| T15860 | 20426-20432 | NN | denotes | kinase |
| T15861 | 20433-20441 | NN | denotes | activity |
| T15862 | 20442-20444 | VBZ | denotes | is |
| T15863 | 20445-20453 | VBN | denotes | required |
| T15864 | 20454-20456 | TO | denotes | to |
| T15865 | 20457-20464 | VB | denotes | protect |
| T15866 | 20465-20469 | CD | denotes | RPS3 |
| T15867 | 20470-20474 | IN | denotes | from |
| T15868 | 20475-20488 | JJ | denotes | IKKβ-mediated |
| T15869 | 20489-20504 | NN | denotes | phosphorylation |
| T15870 | 20504-20505 | . | denotes | . |
| T15871 | 20506-20517 | NNP | denotes | Citrobacter |
| T15872 | 20518-20527 | NN | denotes | rodentium |
| T15873 | 20528-20530 | VBZ | denotes | is |
| T15874 | 20531-20532 | DT | denotes | a |
| T15875 | 20533-20538 | NN | denotes | mouse |
| T15876 | 20539-20547 | NN | denotes | pathogen |
| T15877 | 20548-20552 | WDT | denotes | that |
| T15878 | 20553-20559 | VBZ | denotes | shares |
| T15879 | 20560-20570 | JJ | denotes | pathogenic |
| T15880 | 20571-20581 | NNS | denotes | strategies |
| T15881 | 20582-20586 | IN | denotes | with |
| T15882 | 20587-20589 | NNP | denotes | E. |
| T15883 | 20590-20594 | NNS | denotes | coli |
| T15884 | 20595-20597 | CD | denotes | 39 |
| T15885 | 20597-20598 | , | denotes | , |
| T15886 | 20599-20603 | RBS | denotes | most |
| T15887 | 20604-20611 | RB | denotes | notably |
| T15888 | 20612-20615 | IN | denotes | for |
| T15889 | 20616-20619 | PRP$ | denotes | our |
| T15890 | 20620-20633 | NN | denotes | investigation |
| T15891 | 20633-20634 | , | denotes | , |
| T15892 | 20635-20637 | NNP | denotes | C. |
| T15893 | 20638-20647 | NN | denotes | rodentium |
| T15894 | 20648-20652 | NNP | denotes | NleH |
| T15895 | 20653-20662 | VBD | denotes | inhibited |
| T15896 | 20663-20667 | CD | denotes | RPS3 |
| T15897 | 20668-20675 | JJ | denotes | nuclear |
| T15898 | 20676-20689 | NN | denotes | translocation |
| T15899 | 20690-20693 | CC | denotes | and |
| T15900 | 20694-20708 | JJ | denotes | RPS3-dependent |
| T15901 | 20709-20714 | NN | denotes | NF-κB |
| T15902 | 20715-20725 | NN | denotes | luciferase |
| T15903 | 20726-20734 | NN | denotes | activity |
| T15904 | 20735-20737 | TO | denotes | to |
| T15905 | 20738-20740 | DT | denotes | an |
| T15906 | 20741-20747 | NN | denotes | extent |
| T15907 | 20748-20758 | NN | denotes | equivalent |
| T15908 | 20759-20761 | TO | denotes | to |
| T15909 | 20762-20764 | NNP | denotes | E. |
| T15910 | 20765-20769 | NNS | denotes | coli |
| T15911 | 20770-20775 | NNP | denotes | NleH1 |
| T15912 | 20776-20777 | -LRB- | denotes | ( |
| T15913 | 20777-20780 | NN | denotes | ref |
| T15914 | 20780-20781 | . | denotes | . |
| T15915 | 20782-20783 | CD | denotes | 9 |
| T15916 | 20783-20784 | -RRB- | denotes | ) |
| T15917 | 20784-20785 | . | denotes | . |
| T15918 | 20786-20788 | PRP | denotes | We |
| T15919 | 20789-20796 | VBD | denotes | assayed |
| T15920 | 20797-20801 | NNP | denotes | RPS3 |
| T15921 | 20802-20806 | NNP | denotes | S209 |
| T15922 | 20807-20822 | NN | denotes | phosphorylation |
| T15923 | 20823-20825 | IN | denotes | in |
| T15924 | 20826-20830 | NNP | denotes | HeLa |
| T15925 | 20831-20836 | NNS | denotes | cells |
| T15926 | 20837-20845 | VBN | denotes | infected |
| T15927 | 20846-20850 | IN | denotes | with |
| T15928 | 20851-20860 | JJ | denotes | different |
| T15929 | 20861-20863 | NNP | denotes | C. |
| T15930 | 20864-20873 | NN | denotes | rodentium |
| T15931 | 20874-20881 | NNS | denotes | strains |
| T15932 | 20881-20882 | . | denotes | . |
| T15933 | 20883-20885 | IN | denotes | In |
| T15934 | 20886-20896 | JJ | denotes | uninfected |
| T15935 | 20897-20902 | NNS | denotes | cells |
| T15936 | 20902-20903 | , | denotes | , |
| T15937 | 20904-20917 | JJ | denotes | TNF-treatment |
| T15938 | 20918-20928 | VBD | denotes | stimulated |
| T15939 | 20929-20930 | DT | denotes | a |
| T15940 | 20931-20932 | NN | denotes | ∼ |
| T15941 | 20932-20940 | JJ | denotes | 3.5-fold |
| T15942 | 20941-20949 | NN | denotes | increase |
| T15943 | 20950-20952 | IN | denotes | in |
| T15944 | 20953-20957 | NNP | denotes | RPS3 |
| T15945 | 20958-20962 | NNP | denotes | S209 |
| T15946 | 20963-20978 | NN | denotes | phosphorylation |
| T15947 | 20979-20980 | -LRB- | denotes | ( |
| T15948 | 20980-20984 | NNP | denotes | Fig. |
| T15949 | 20985-20987 | CD | denotes | 7c |
| T15950 | 20987-20988 | -RRB- | denotes | ) |
| T15951 | 20988-20989 | . | denotes | . |
| T15952 | 20990-20994 | JJ | denotes | Such |
| T15953 | 20995-21007 | NN | denotes | augmentation |
| T15954 | 21008-21010 | IN | denotes | of |
| T15955 | 21011-21015 | CD | denotes | RPS3 |
| T15956 | 21016-21031 | NN | denotes | phosphorylation |
| T15957 | 21032-21035 | VBD | denotes | was |
| T15958 | 21036-21043 | VBN | denotes | reduced |
| T15959 | 21044-21046 | IN | denotes | by |
| T15960 | 21047-21052 | RB | denotes | about |
| T15961 | 21053-21055 | CD | denotes | 60 |
| T15962 | 21055-21056 | NN | denotes | % |
| T15963 | 21057-21059 | IN | denotes | by |
| T15964 | 21060-21069 | JJ | denotes | wild-type |
| T15965 | 21070-21072 | NNP | denotes | C. |
| T15966 | 21073-21082 | NN | denotes | rodentium |
| T15967 | 21083-21092 | NN | denotes | infection |
| T15968 | 21093-21094 | -LRB- | denotes | ( |
| T15969 | 21094-21098 | NNP | denotes | Fig. |
| T15970 | 21099-21101 | CD | denotes | 7c |
| T15971 | 21101-21102 | -RRB- | denotes | ) |
| T15972 | 21102-21103 | . | denotes | . |
| T15973 | 21104-21111 | RB | denotes | However |
| T15974 | 21111-21112 | , | denotes | , |
| T15975 | 21113-21117 | JJ | denotes | RPS3 |
| T15976 | 21118-21133 | NN | denotes | phosphorylation |
| T15977 | 21134-21137 | VBD | denotes | was |
| T15978 | 21138-21146 | VBN | denotes | enhanced |
| T15979 | 21147-21151 | WRB | denotes | when |
| T15980 | 21152-21157 | NNS | denotes | cells |
| T15981 | 21158-21162 | VBD | denotes | were |
| T15982 | 21163-21171 | VBN | denotes | infected |
| T15983 | 21172-21176 | IN | denotes | with |
| T15984 | 21177-21178 | DT | denotes | a |
| T15985 | 21179-21181 | NNP | denotes | C. |
| T15986 | 21182-21191 | NN | denotes | rodentium |
| T15987 | 21192-21198 | NN | denotes | strain |
| T15988 | 21199-21206 | VBG | denotes | lacking |
| T15989 | 21207-21211 | NNP | denotes | NleH |
| T15990 | 21212-21213 | -LRB- | denotes | ( |
| T15991 | 21213-21217 | NNP | denotes | Fig. |
| T15992 | 21218-21220 | CD | denotes | 7c |
| T15993 | 21220-21221 | , | denotes | , |
| T15994 | 21222-21227 | NNP | denotes | ΔnleH |
| T15995 | 21227-21228 | -RRB- | denotes | ) |
| T15996 | 21228-21229 | . | denotes | . |
| T15997 | 21230-21232 | PRP | denotes | We |
| T15998 | 21233-21240 | RB | denotes | further |
| T15999 | 21241-21249 | VBD | denotes | examined |
| T16000 | 21250-21253 | DT | denotes | the |
| T16001 | 21254-21258 | NN | denotes | role |
| T16002 | 21259-21261 | IN | denotes | of |
| T16003 | 21262-21267 | JJ | denotes | NleH1 |
| T16004 | 21268-21274 | NN | denotes | kinase |
| T16005 | 21275-21283 | NN | denotes | activity |
| T16006 | 21284-21289 | VBG | denotes | using |
| T16007 | 21290-21293 | DT | denotes | the |
| T16008 | 21294-21296 | NNP | denotes | C. |
| T16009 | 21297-21306 | NN | denotes | rodentium |
| T16010 | 21307-21312 | NNP | denotes | ΔnleH |
| T16011 | 21313-21319 | NN | denotes | strain |
| T16012 | 21320-21322 | IN | denotes | as |
| T16013 | 21323-21324 | DT | denotes | a |
| T16014 | 21325-21335 | NN | denotes | background |
| T16015 | 21336-21338 | IN | denotes | on |
| T16016 | 21339-21344 | WDT | denotes | which |
| T16017 | 21345-21347 | TO | denotes | to |
| T16018 | 21348-21355 | VB | denotes | express |
| T16019 | 21356-21362 | DT | denotes | either |
| T16020 | 21363-21372 | JJ | denotes | wild-type |
| T16021 | 21373-21375 | CC | denotes | or |
| T16022 | 21376-21381 | NNP | denotes | K159A |
| T16023 | 21382-21384 | NNP | denotes | E. |
| T16024 | 21385-21389 | NNS | denotes | coli |
| T16025 | 21390-21395 | NNP | denotes | NleH1 |
| T16026 | 21395-21396 | . | denotes | . |
| T16027 | 21397-21410 | VBG | denotes | Complementing |
| T16028 | 21411-21416 | NNP | denotes | ΔnleH |
| T16029 | 21417-21423 | JJ | denotes | mutant |
| T16030 | 21424-21428 | IN | denotes | with |
| T16031 | 21429-21438 | JJ | denotes | wild-type |
| T16032 | 21439-21444 | NNP | denotes | NleH1 |
| T16033 | 21445-21451 | RB | denotes | almost |
| T16034 | 21452-21461 | VBD | denotes | abolished |
| T16035 | 21462-21473 | JJ | denotes | TNF-induced |
| T16036 | 21474-21478 | NNP | denotes | RPS3 |
| T16037 | 21479-21483 | NNP | denotes | S209 |
| T16038 | 21484-21499 | NN | denotes | phosphorylation |
| T16039 | 21500-21507 | IN | denotes | whereas |
| T16040 | 21508-21521 | VBG | denotes | complementing |
| T16041 | 21522-21526 | IN | denotes | with |
| T16042 | 21527-21532 | NNP | denotes | K159A |
| T16043 | 21533-21539 | VBD | denotes | failed |
| T16044 | 21540-21542 | TO | denotes | to |
| T16045 | 21543-21550 | VB | denotes | inhibit |
| T16046 | 21551-21555 | JJ | denotes | RPS3 |
| T16047 | 21556-21571 | NN | denotes | phosphorylation |
| T16048 | 21572-21573 | -LRB- | denotes | ( |
| T16049 | 21573-21577 | NNP | denotes | Fig. |
| T16050 | 21578-21580 | CD | denotes | 7c |
| T16051 | 21580-21581 | -RRB- | denotes | ) |
| T16052 | 21581-21582 | . | denotes | . |
| T16053 | 21583-21595 | RB | denotes | Collectively |
| T16054 | 21595-21596 | , | denotes | , |
| T16055 | 21597-21602 | DT | denotes | these |
| T16056 | 21603-21610 | NNS | denotes | results |
| T16057 | 21611-21622 | VBP | denotes | demonstrate |
| T16058 | 21623-21627 | IN | denotes | that |
| T16059 | 21628-21633 | JJ | denotes | NleH1 |
| T16060 | 21634-21640 | NN | denotes | kinase |
| T16061 | 21641-21649 | NN | denotes | activity |
| T16062 | 21650-21652 | VBZ | denotes | is |
| T16063 | 21653-21661 | VBN | denotes | required |
| T16064 | 21662-21664 | TO | denotes | to |
| T16065 | 21665-21670 | VB | denotes | block |
| T16066 | 21671-21675 | NNP | denotes | RPS3 |
| T16067 | 21676-21680 | NNP | denotes | S209 |
| T16068 | 21681-21696 | NN | denotes | phosphorylation |
| T16069 | 21696-21697 | . | denotes | . |
| T16070 | 21698-21700 | PRP | denotes | We |
| T16071 | 21701-21705 | JJ | denotes | next |
| T16072 | 21706-21714 | VBD | denotes | examined |
| T16073 | 21715-21722 | IN | denotes | whether |
| T16074 | 21723-21726 | DT | denotes | the |
| T16075 | 21727-21737 | JJ | denotes | inhibitory |
| T16076 | 21738-21746 | NN | denotes | activity |
| T16077 | 21747-21749 | IN | denotes | of |
| T16078 | 21750-21755 | NNP | denotes | NleH1 |
| T16079 | 21756-21758 | VBZ | denotes | is |
| T16080 | 21759-21771 | RB | denotes | sufficiently |
| T16081 | 21772-21778 | JJ | denotes | robust |
| T16082 | 21779-21781 | TO | denotes | to |
| T16083 | 21782-21788 | VB | denotes | impair |
| T16084 | 21789-21792 | DT | denotes | the |
| T16085 | 21793-21799 | JJ | denotes | strong |
| T16086 | 21800-21807 | JJ | denotes | nuclear |
| T16087 | 21808-21821 | NN | denotes | translocation |
| T16088 | 21822-21824 | IN | denotes | of |
| T16089 | 21825-21829 | CD | denotes | RPS3 |
| T16090 | 21830-21837 | VBN | denotes | trigged |
| T16091 | 21838-21840 | IN | denotes | by |
| T16092 | 21841-21844 | DT | denotes | the |
| T16093 | 21845-21866 | JJ | denotes | constitutively-active |
| T16094 | 21867-21871 | NNP | denotes | IKKβ |
| T16095 | 21872-21873 | -LRB- | denotes | ( |
| T16096 | 21873-21877 | NNP | denotes | IKKβ |
| T16097 | 21878-21879 | NNP | denotes | [ |
| T16098 | 21879-21883 | NNP | denotes | SSEE |
| T16099 | 21883-21884 | NNP | denotes | ] |
| T16100 | 21884-21885 | -RRB- | denotes | ) |
| T16101 | 21886-21887 | -LRB- | denotes | ( |
| T16102 | 21887-21891 | NNP | denotes | Fig. |
| T16103 | 21892-21894 | CD | denotes | 2d |
| T16104 | 21894-21895 | -RRB- | denotes | ) |
| T16105 | 21895-21896 | . | denotes | . |
| T16106 | 21897-21899 | PRP | denotes | We |
| T16107 | 21900-21905 | VBD | denotes | found |
| T16108 | 21906-21910 | IN | denotes | that |
| T16109 | 21911-21922 | RB | denotes | ectopically |
| T16110 | 21923-21933 | VBG | denotes | expressing |
| T16111 | 21934-21940 | CC | denotes | either |
| T16112 | 21941-21950 | JJ | denotes | wild-type |
| T16113 | 21951-21953 | CC | denotes | or |
| T16114 | 21954-21958 | NNP | denotes | SSEE |
| T16115 | 21959-21963 | NNP | denotes | IKKβ |
| T16116 | 21964-21972 | NNS | denotes | proteins |
| T16117 | 21972-21973 | , | denotes | , |
| T16118 | 21974-21983 | VBD | denotes | triggered |
| T16119 | 21984-21988 | RBR | denotes | more |
| T16120 | 21989-21993 | JJ | denotes | RPS3 |
| T16121 | 21994-22001 | JJ | denotes | nuclear |
| T16122 | 22002-22015 | NN | denotes | translocation |
| T16123 | 22016-22020 | IN | denotes | than |
| T16124 | 22021-22024 | DT | denotes | the |
| T16125 | 22025-22036 | JJ | denotes | kinase-dead |
| T16126 | 22037-22041 | NNP | denotes | IKKβ |
| T16127 | 22042-22043 | -LRB- | denotes | ( |
| T16128 | 22043-22047 | NNP | denotes | SSAA |
| T16129 | 22047-22048 | -RRB- | denotes | ) |
| T16130 | 22049-22056 | NN | denotes | protein |
| T16131 | 22057-22058 | -LRB- | denotes | ( |
| T16132 | 22058-22062 | NNP | denotes | Fig. |
| T16133 | 22063-22065 | CD | denotes | 7d |
| T16134 | 22065-22066 | -RRB- | denotes | ) |
| T16135 | 22066-22067 | . | denotes | . |
| T16136 | 22068-22072 | CD | denotes | RPS3 |
| T16137 | 22073-22080 | JJ | denotes | nuclear |
| T16138 | 22081-22093 | NN | denotes | accumulation |
| T16139 | 22094-22097 | VBD | denotes | was |
| T16140 | 22098-22111 | RB | denotes | substantially |
| T16141 | 22112-22120 | JJ | denotes | retarded |
| T16142 | 22121-22123 | IN | denotes | by |
| T16143 | 22124-22133 | VBG | denotes | infecting |
| T16144 | 22134-22139 | NNS | denotes | cells |
| T16145 | 22140-22144 | IN | denotes | with |
| T16146 | 22145-22154 | JJ | denotes | wild-type |
| T16147 | 22155-22157 | NNP | denotes | E. |
| T16148 | 22158-22162 | NNS | denotes | coli |
| T16149 | 22163-22167 | NNP | denotes | O157 |
| T16150 | 22167-22168 | : | denotes | : |
| T16151 | 22168-22170 | NNP | denotes | H7 |
| T16152 | 22171-22172 | -LRB- | denotes | ( |
| T16153 | 22172-22176 | NNP | denotes | Fig. |
| T16154 | 22177-22179 | CD | denotes | 7d |
| T16155 | 22179-22180 | -RRB- | denotes | ) |
| T16156 | 22180-22181 | . | denotes | . |
| T16157 | 22182-22184 | IN | denotes | In |
| T16158 | 22185-22193 | NN | denotes | contrast |
| T16159 | 22193-22194 | , | denotes | , |
| T16160 | 22195-22204 | VBG | denotes | infecting |
| T16161 | 22205-22209 | IN | denotes | with |
| T16162 | 22210-22216 | DT | denotes | either |
| T16163 | 22217-22223 | NNP | denotes | ΔnleH1 |
| T16164 | 22224-22226 | CC | denotes | or |
| T16165 | 22227-22232 | NNP | denotes | ΔescN |
| T16166 | 22233-22240 | NNS | denotes | strains |
| T16167 | 22241-22245 | RB | denotes | only |
| T16168 | 22246-22254 | RB | denotes | slightly |
| T16169 | 22255-22263 | VBN | denotes | impaired |
| T16170 | 22264-22268 | NNP | denotes | RPS3 |
| T16171 | 22269-22276 | JJ | denotes | nuclear |
| T16172 | 22277-22290 | NN | denotes | translocation |
| T16173 | 22291-22293 | IN | denotes | in |
| T16174 | 22294-22300 | CC | denotes | either |
| T16175 | 22301-22305 | SYM | denotes | IKKβ |
| T16176 | 22305-22306 | : | denotes | - |
| T16177 | 22307-22309 | CC | denotes | or |
| T16178 | 22310-22314 | NNP | denotes | IKKβ |
| T16179 | 22315-22316 | -LRB- | denotes | ( |
| T16180 | 22316-22320 | NNP | denotes | SSEE |
| T16181 | 22320-22321 | -RRB- | denotes | ) |
| T16182 | 22321-22322 | : | denotes | - |
| T16183 | 22322-22332 | VBG | denotes | expressing |
| T16184 | 22333-22338 | NNS | denotes | cells |
| T16185 | 22339-22340 | -LRB- | denotes | ( |
| T16186 | 22340-22344 | NNP | denotes | Fig. |
| T16187 | 22345-22347 | CD | denotes | 7d |
| T16188 | 22347-22348 | -RRB- | denotes | ) |
| T16189 | 22348-22349 | . | denotes | . |
| T16190 | 22350-22352 | IN | denotes | As |
| T16191 | 22353-22361 | VBN | denotes | expected |
| T16192 | 22361-22362 | , | denotes | , |
| T16193 | 22363-22365 | NNP | denotes | E. |
| T16194 | 22366-22370 | NNS | denotes | coli |
| T16195 | 22371-22381 | NNS | denotes | infections |
| T16196 | 22382-22385 | VBD | denotes | did |
| T16197 | 22386-22389 | RB | denotes | not |
| T16198 | 22390-22396 | VB | denotes | affect |
| T16199 | 22397-22400 | DT | denotes | the |
| T16200 | 22401-22405 | JJ | denotes | RPS3 |
| T16201 | 22406-22413 | JJ | denotes | nuclear |
| T16202 | 22414-22427 | NN | denotes | translocation |
| T16203 | 22428-22430 | IN | denotes | in |
| T16204 | 22431-22435 | NNP | denotes | IKKβ |
| T16205 | 22436-22437 | -LRB- | denotes | ( |
| T16206 | 22437-22441 | NNP | denotes | SSAA |
| T16207 | 22441-22442 | -RRB- | denotes | ) |
| T16208 | 22442-22443 | : | denotes | - |
| T16209 | 22443-22453 | VBG | denotes | expressing |
| T16210 | 22454-22459 | NNS | denotes | cells |
| T16211 | 22459-22460 | , | denotes | , |
| T16212 | 22461-22466 | WRB | denotes | where |
| T16213 | 22467-22472 | JJ | denotes | NF-κB |
| T16214 | 22473-22482 | VBG | denotes | signaling |
| T16215 | 22483-22486 | VBD | denotes | was |
| T16216 | 22487-22490 | JJ | denotes | low |
| T16217 | 22491-22492 | -LRB- | denotes | ( |
| T16218 | 22492-22496 | NNP | denotes | Fig. |
| T16219 | 22497-22499 | CD | denotes | 7d |
| T16220 | 22499-22500 | -RRB- | denotes | ) |
| T16221 | 22500-22501 | . | denotes | . |
| T16222 | 22502-22506 | RB | denotes | Thus |
| T16223 | 22506-22507 | , | denotes | , |
| T16224 | 22508-22514 | IN | denotes | during |
| T16225 | 22515-22524 | NN | denotes | infection |
| T16226 | 22525-22530 | NNP | denotes | NleH1 |
| T16227 | 22531-22533 | VBZ | denotes | is |
| T16228 | 22534-22546 | RB | denotes | sufficiently |
| T16229 | 22547-22553 | JJ | denotes | potent |
| T16230 | 22554-22556 | TO | denotes | to |
| T16231 | 22557-22564 | VB | denotes | inhibit |
| T16232 | 22565-22569 | JJ | denotes | RPS3 |
| T16233 | 22570-22577 | JJ | denotes | nuclear |
| T16234 | 22578-22591 | NN | denotes | translocation |
| T16235 | 22592-22596 | RB | denotes | even |
| T16236 | 22597-22599 | IN | denotes | in |
| T16237 | 22600-22605 | NNS | denotes | cells |
| T16238 | 22606-22616 | VBG | denotes | expressing |
| T16239 | 22617-22641 | JJ | denotes | constitutively-activated |
| T16240 | 22642-22646 | NNP | denotes | IKKβ |
| T16241 | 22646-22647 | . | denotes | . |
| T16242 | 22648-22650 | PRP | denotes | We |
| T16243 | 22651-22659 | VBD | denotes | examined |
| T16244 | 22660-22667 | IN | denotes | whether |
| T16245 | 22668-22673 | NNP | denotes | NleH1 |
| T16246 | 22674-22679 | MD | denotes | could |
| T16247 | 22680-22688 | RB | denotes | directly |
| T16248 | 22689-22702 | VB | denotes | phosphorylate |
| T16249 | 22703-22707 | NNP | denotes | IKKβ |
| T16250 | 22708-22712 | RB | denotes | thus |
| T16251 | 22713-22723 | VBG | denotes | inhibiting |
| T16252 | 22724-22737 | JJ | denotes | IKKβ-mediated |
| T16253 | 22738-22742 | CD | denotes | RPS3 |
| T16254 | 22743-22747 | CD | denotes | S209 |
| T16255 | 22748-22763 | NN | denotes | phosphorylation |
| T16256 | 22763-22764 | . | denotes | . |
| T16257 | 22765-22767 | PRP | denotes | We |
| T16258 | 22768-22777 | VBD | denotes | performed |
| T16259 | 22778-22780 | IN | denotes | in |
| T16260 | 22781-22786 | NN | denotes | vitro |
| T16261 | 22787-22793 | NN | denotes | kinase |
| T16262 | 22794-22800 | VBZ | denotes | assays |
| T16263 | 22801-22806 | VBG | denotes | using |
| T16264 | 22807-22825 | VBN | denotes | immunoprecipitated |
| T16265 | 22826-22835 | NNP | denotes | Flag-IKKβ |
| T16266 | 22836-22837 | -LRB- | denotes | ( |
| T16267 | 22837-22841 | NNP | denotes | K44A |
| T16268 | 22841-22842 | -RRB- | denotes | ) |
| T16269 | 22843-22845 | IN | denotes | as |
| T16270 | 22846-22855 | NN | denotes | substrate |
| T16271 | 22856-22859 | CC | denotes | and |
| T16272 | 22860-22871 | JJ | denotes | recombinant |
| T16273 | 22872-22881 | NN | denotes | His-NleH1 |
| T16274 | 22882-22884 | IN | denotes | as |
| T16275 | 22885-22891 | NN | denotes | kinase |
| T16276 | 22891-22892 | , | denotes | , |
| T16277 | 22893-22895 | RB | denotes | so |
| T16278 | 22896-22900 | IN | denotes | that |
| T16279 | 22901-22905 | NNP | denotes | IKKβ |
| T16280 | 22906-22925 | NN | denotes | autophosphorylation |
| T16281 | 22926-22931 | MD | denotes | would |
| T16282 | 22932-22935 | RB | denotes | not |
| T16283 | 22936-22943 | VB | denotes | obscure |
| T16284 | 22944-22957 | JJ | denotes | NleH1-induced |
| T16285 | 22958-22973 | NN | denotes | phosphorylation |
| T16286 | 22973-22974 | . | denotes | . |
| T16287 | 22975-22982 | RB | denotes | However |
| T16288 | 22982-22983 | , | denotes | , |
| T16289 | 22984-22986 | PRP | denotes | we |
| T16290 | 22987-22990 | VBD | denotes | did |
| T16291 | 22991-22994 | RB | denotes | not |
| T16292 | 22995-23002 | VB | denotes | observe |
| T16293 | 23003-23006 | DT | denotes | any |
| T16294 | 23007-23017 | JJ | denotes | detectable |
| T16295 | 23018-23021 | NNP | denotes | 32P |
| T16296 | 23022-23035 | NN | denotes | incorporation |
| T16297 | 23036-23038 | IN | denotes | in |
| T16298 | 23039-23043 | NNP | denotes | IKKβ |
| T16299 | 23044-23045 | -LRB- | denotes | ( |
| T16300 | 23045-23058 | NNP | denotes | Supplementary |
| T16301 | 23059-23063 | NNP | denotes | Fig. |
| T16302 | 23064-23066 | CD | denotes | 13 |
| T16303 | 23066-23067 | -RRB- | denotes | ) |
| T16304 | 23067-23068 | , | denotes | , |
| T16305 | 23069-23073 | RB | denotes | thus |
| T16306 | 23074-23080 | VBG | denotes | ruling |
| T16307 | 23081-23084 | RP | denotes | out |
| T16308 | 23085-23089 | DT | denotes | this |
| T16309 | 23090-23101 | NN | denotes | possibility |
| T16310 | 23101-23102 | . | denotes | . |
| T16311 | 23103-23105 | PRP | denotes | We |
| T16312 | 23106-23110 | RB | denotes | then |
| T16313 | 23111-23117 | VBD | denotes | tested |
| T16314 | 23118-23121 | DT | denotes | the |
| T16315 | 23122-23132 | NN | denotes | hypothesis |
| T16316 | 23133-23137 | WDT | denotes | that |
| T16317 | 23138-23143 | NNP | denotes | NleH1 |
| T16318 | 23144-23149 | MD | denotes | could |
| T16319 | 23150-23155 | VB | denotes | alter |
| T16320 | 23156-23159 | DT | denotes | the |
| T16321 | 23160-23164 | NNP | denotes | IKKβ |
| T16322 | 23165-23174 | NN | denotes | substrate |
| T16323 | 23175-23188 | NNS | denotes | specificities |
| T16324 | 23188-23189 | . | denotes | . |
| T16325 | 23190-23192 | TO | denotes | To |
| T16326 | 23193-23197 | DT | denotes | this |
| T16327 | 23198-23201 | NN | denotes | end |
| T16328 | 23201-23202 | , | denotes | , |
| T16329 | 23203-23205 | PRP | denotes | we |
| T16330 | 23206-23215 | VBD | denotes | performed |
| T16331 | 23216-23218 | IN | denotes | in |
| T16332 | 23219-23224 | NN | denotes | vitro |
| T16333 | 23225-23231 | NN | denotes | kinase |
| T16334 | 23232-23238 | VBZ | denotes | assays |
| T16335 | 23239-23244 | VBG | denotes | using |
| T16336 | 23245-23249 | DT | denotes | both |
| T16337 | 23250-23253 | CD | denotes | CK2 |
| T16338 | 23254-23257 | CC | denotes | and |
| T16339 | 23258-23261 | NNP | denotes | IKK |
| T16340 | 23262-23272 | VBZ | denotes | substrates |
| T16341 | 23273-23276 | IN | denotes | for |
| T16342 | 23277-23281 | NNP | denotes | IKKβ |
| T16343 | 23281-23282 | . | denotes | . |
| T16344 | 23283-23285 | IN | denotes | As |
| T16345 | 23286-23294 | VBN | denotes | expected |
| T16346 | 23294-23295 | , | denotes | , |
| T16347 | 23296-23300 | NNP | denotes | IKKβ |
| T16348 | 23301-23315 | VBD | denotes | phosphorylated |
| T16349 | 23316-23320 | NNP | denotes | RPS3 |
| T16350 | 23321-23322 | -LRB- | denotes | ( |
| T16351 | 23322-23326 | NNP | denotes | Fig. |
| T16352 | 23327-23329 | CD | denotes | 7e |
| T16353 | 23329-23330 | , | denotes | , |
| T16354 | 23331-23335 | NN | denotes | lane |
| T16355 | 23336-23337 | CD | denotes | 7 |
| T16356 | 23337-23338 | -RRB- | denotes | ) |
| T16357 | 23339-23342 | CC | denotes | and |
| T16358 | 23343-23351 | NNP | denotes | GST-IκBα |
| T16359 | 23352-23353 | -LRB- | denotes | ( |
| T16360 | 23353-23357 | CD | denotes | 1-54 |
| T16361 | 23357-23358 | -RRB- | denotes | ) |
| T16362 | 23359-23366 | NN | denotes | protein |
| T16363 | 23367-23368 | -LRB- | denotes | ( |
| T16364 | 23368-23372 | NNP | denotes | Fig. |
| T16365 | 23373-23375 | CD | denotes | 7e |
| T16366 | 23375-23376 | , | denotes | , |
| T16367 | 23377-23381 | NN | denotes | lane |
| T16368 | 23382-23383 | CD | denotes | 9 |
| T16369 | 23383-23384 | -RRB- | denotes | ) |
| T16370 | 23384-23385 | , | denotes | , |
| T16371 | 23386-23399 | VBG | denotes | demonstrating |
| T16372 | 23400-23402 | PRP | denotes | it |
| T16373 | 23403-23410 | VBZ | denotes | harbors |
| T16374 | 23411-23417 | CC | denotes | either |
| T16375 | 23418-23421 | CD | denotes | CK2 |
| T16376 | 23422-23424 | CC | denotes | or |
| T16377 | 23425-23428 | NNP | denotes | IKK |
| T16378 | 23429-23438 | VBP | denotes | substrate |
| T16379 | 23439-23450 | NN | denotes | specificity |
| T16380 | 23450-23451 | . | denotes | . |
| T16381 | 23452-23465 | NNP | denotes | Preincubation |
| T16382 | 23466-23468 | IN | denotes | of |
| T16383 | 23469-23473 | NNP | denotes | IKKβ |
| T16384 | 23474-23478 | IN | denotes | with |
| T16385 | 23479-23484 | NNP | denotes | NleH1 |
| T16386 | 23485-23492 | VBD | denotes | reduced |
| T16387 | 23493-23506 | JJ | denotes | IKKβ-mediated |
| T16388 | 23507-23511 | JJ | denotes | RPS3 |
| T16389 | 23512-23527 | NN | denotes | phosphorylation |
| T16390 | 23527-23528 | , | denotes | , |
| T16391 | 23529-23533 | FW | denotes | i.e. |
| T16392 | 23534-23537 | DT | denotes | the |
| T16393 | 23538-23541 | NNP | denotes | CK2 |
| T16394 | 23542-23548 | NN | denotes | kinase |
| T16395 | 23549-23560 | NN | denotes | specificity |
| T16396 | 23560-23561 | , | denotes | , |
| T16397 | 23562-23565 | CC | denotes | but |
| T16398 | 23566-23569 | RB | denotes | not |
| T16399 | 23570-23583 | JJ | denotes | IKKβ-mediated |
| T16400 | 23584-23592 | JJ | denotes | GST-IκBα |
| T16401 | 23593-23608 | NN | denotes | phosphorylation |
| T16402 | 23608-23609 | , | denotes | , |
| T16403 | 23610-23614 | FW | denotes | i.e. |
| T16404 | 23615-23618 | DT | denotes | the |
| T16405 | 23619-23622 | NNP | denotes | IKK |
| T16406 | 23623-23629 | NN | denotes | kinase |
| T16407 | 23630-23641 | NN | denotes | specificity |
| T16408 | 23642-23643 | -LRB- | denotes | ( |
| T16409 | 23643-23647 | NNP | denotes | Fig. |
| T16410 | 23648-23650 | CD | denotes | 7e |
| T16411 | 23650-23651 | -RRB- | denotes | ) |
| T16412 | 23651-23652 | . | denotes | . |
| T16413 | 23653-23660 | NNP | denotes | Control |
| T16414 | 23661-23672 | NNS | denotes | experiments |
| T16415 | 23673-23681 | VBD | denotes | revealed |
| T16416 | 23682-23684 | DT | denotes | no |
| T16417 | 23685-23699 | JJ | denotes | NleH1-mediated |
| T16418 | 23700-23715 | NN | denotes | phosphorylation |
| T16419 | 23716-23718 | CC | denotes | or |
| T16420 | 23719-23738 | NN | denotes | autophosphorylation |
| T16421 | 23739-23741 | IN | denotes | of |
| T16422 | 23742-23746 | CD | denotes | RPS3 |
| T16423 | 23747-23749 | CC | denotes | or |
| T16424 | 23750-23758 | NNP | denotes | GST-IκBα |
| T16425 | 23759-23760 | -LRB- | denotes | ( |
| T16426 | 23760-23764 | NNP | denotes | Fig. |
| T16427 | 23765-23767 | CD | denotes | 7e |
| T16428 | 23767-23768 | -RRB- | denotes | ) |
| T16429 | 23768-23769 | . | denotes | . |
| T16430 | 23770-23775 | VBN | denotes | Taken |
| T16431 | 23776-23784 | RB | denotes | together |
| T16432 | 23784-23785 | , | denotes | , |
| T16433 | 23786-23791 | JJ | denotes | NleH1 |
| T16434 | 23792-23798 | NNS | denotes | blocks |
| T16435 | 23799-23802 | DT | denotes | the |
| T16436 | 23803-23806 | NNP | denotes | CK2 |
| T16437 | 23807-23816 | NN | denotes | substrate |
| T16438 | 23817-23828 | NN | denotes | specificity |
| T16439 | 23829-23831 | IN | denotes | of |
| T16440 | 23832-23836 | NNP | denotes | IKKβ |
| T16441 | 23837-23841 | RB | denotes | thus |
| T16442 | 23842-23852 | VBG | denotes | inhibiting |
| T16443 | 23853-23856 | DT | denotes | the |
| T16444 | 23857-23870 | JJ | denotes | IKKβ-mediated |
| T16445 | 23871-23875 | CD | denotes | RPS3 |
| T16446 | 23876-23880 | CD | denotes | S209 |
| T16447 | 23881-23896 | NN | denotes | phosphorylation |
| T16448 | 23897-23901 | RB | denotes | thus |
| T16449 | 23902-23914 | VBG | denotes | representing |
| T16450 | 23915-23916 | DT | denotes | a |
| T16451 | 23917-23922 | NN | denotes | novel |
| T16452 | 23923-23931 | NN | denotes | strategy |
| T16453 | 23932-23934 | IN | denotes | by |
| T16454 | 23935-23937 | NNP | denotes | E. |
| T16455 | 23938-23942 | NNS | denotes | coli |
| T16456 | 23943-23947 | NNP | denotes | O157 |
| T16457 | 23947-23948 | : | denotes | : |
| T16458 | 23948-23950 | NNP | denotes | H7 |
| T16459 | 23951-23953 | TO | denotes | to |
| T16460 | 23954-23959 | VB | denotes | alter |
| T16461 | 23960-23963 | DT | denotes | the |
| T16462 | 23964-23968 | NN | denotes | host |
| T16463 | 23969-23975 | NN | denotes | innate |
| T16464 | 23976-23982 | JJ | denotes | immune |
| T16465 | 23983-23991 | NN | denotes | response |
| T16466 | 23991-23992 | . | denotes | . |
| T18827 | 24005-24009 | CD | denotes | RPS3 |
| T18828 | 24010-24013 | VBD | denotes | was |
| T18829 | 24014-24024 | RB | denotes | previously |
| T18830 | 24025-24037 | VBN | denotes | demonstrated |
| T18831 | 24038-24040 | TO | denotes | to |
| T18832 | 24041-24049 | VB | denotes | function |
| T18833 | 24050-24052 | IN | denotes | as |
| T18834 | 24053-24055 | DT | denotes | an |
| T18835 | 24056-24064 | JJ | denotes | integral |
| T18836 | 24065-24072 | NN | denotes | subunit |
| T18837 | 24073-24083 | VBG | denotes | conferring |
| T18838 | 24084-24089 | JJ | denotes | NF-κB |
| T18839 | 24090-24100 | JJ | denotes | regulatory |
| T18840 | 24101-24113 | NN | denotes | specificity6 |
| T18841 | 24113-24114 | . | denotes | . |
| T18842 | 24115-24119 | RB | denotes | Here |
| T18843 | 24120-24122 | PRP | denotes | we |
| T18844 | 24123-24129 | VBD | denotes | sought |
| T18845 | 24130-24132 | TO | denotes | to |
| T18846 | 24133-24142 | VB | denotes | elucidate |
| T18847 | 24143-24146 | WRB | denotes | how |
| T18848 | 24147-24152 | JJ | denotes | NF-κB |
| T18849 | 24153-24163 | NN | denotes | activation |
| T18850 | 24164-24173 | VBG | denotes | signaling |
| T18851 | 24174-24182 | VBZ | denotes | triggers |
| T18852 | 24183-24187 | CD | denotes | RPS3 |
| T18853 | 24188-24190 | TO | denotes | to |
| T18854 | 24191-24202 | VB | denotes | translocate |
| T18855 | 24203-24206 | CC | denotes | and |
| T18856 | 24207-24218 | VB | denotes | participate |
| T18857 | 24219-24221 | IN | denotes | in |
| T18858 | 24222-24227 | JJ | denotes | NF-κB |
| T18859 | 24228-24236 | NN | denotes | function |
| T18860 | 24237-24239 | IN | denotes | in |
| T18861 | 24240-24243 | DT | denotes | the |
| T18862 | 24244-24251 | NN | denotes | nucleus |
| T18863 | 24251-24252 | . | denotes | . |
| T18864 | 24253-24255 | PRP | denotes | We |
| T18865 | 24256-24267 | VBP | denotes | demonstrate |
| T18866 | 24268-24272 | IN | denotes | that |
| T18867 | 24273-24286 | JJ | denotes | IKKβ-mediated |
| T18868 | 24287-24291 | CD | denotes | RPS3 |
| T18869 | 24292-24296 | CD | denotes | S209 |
| T18870 | 24297-24312 | NN | denotes | phosphorylation |
| T18871 | 24313-24323 | VBZ | denotes | represents |
| T18872 | 24324-24325 | DT | denotes | a |
| T18873 | 24326-24334 | JJ | denotes | critical |
| T18874 | 24335-24346 | NN | denotes | determinant |
| T18875 | 24347-24349 | IN | denotes | in |
| T18876 | 24350-24359 | VBG | denotes | governing |
| T18877 | 24360-24363 | PRP$ | denotes | its |
| T18878 | 24364-24371 | JJ | denotes | nuclear |
| T18879 | 24372-24378 | NN | denotes | import |
| T18880 | 24379-24383 | RB | denotes | thus |
| T18881 | 24384-24393 | VBG | denotes | unveiling |
| T18882 | 24394-24395 | DT | denotes | a |
| T18883 | 24396-24401 | NN | denotes | novel |
| T18884 | 24402-24411 | NN | denotes | mechanism |
| T18885 | 24412-24418 | IN | denotes | behind |
| T18886 | 24419-24424 | JJ | denotes | NF-κB |
| T18887 | 24425-24435 | JJ | denotes | regulatory |
| T18888 | 24436-24447 | NN | denotes | specificity |
| T18889 | 24447-24448 | . | denotes | . |
| T18890 | 24449-24453 | NNP | denotes | IKKβ |
| T18891 | 24454-24456 | VBZ | denotes | is |
| T18892 | 24457-24460 | DT | denotes | the |
| T18893 | 24461-24466 | JJ | denotes | major |
| T18894 | 24467-24473 | NN | denotes | kinase |
| T18895 | 24474-24478 | WDT | denotes | that |
| T18896 | 24479-24493 | VBZ | denotes | phosphorylates |
| T18897 | 24494-24498 | NNS | denotes | IκBs |
| T18898 | 24499-24501 | IN | denotes | in |
| T18899 | 24502-24505 | DT | denotes | the |
| T18900 | 24506-24515 | JJ | denotes | classical |
| T18901 | 24516-24521 | NN | denotes | NF-κB |
| T18902 | 24522-24529 | NN | denotes | pathway |
| T18903 | 24529-24530 | , | denotes | , |
| T18904 | 24531-24538 | VBG | denotes | leading |
| T18905 | 24539-24541 | TO | denotes | to |
| T18906 | 24542-24547 | PRP$ | denotes | their |
| T18907 | 24548-24558 | JJ | denotes | subsequent |
| T18908 | 24559-24572 | NN | denotes | degradation40 |
| T18909 | 24572-24573 | . | denotes | . |
| T18910 | 24574-24584 | RB | denotes | Strikingly |
| T18911 | 24584-24585 | , | denotes | , |
| T18912 | 24586-24590 | JJ | denotes | RPS3 |
| T18913 | 24591-24600 | VBZ | denotes | possesses |
| T18914 | 24601-24604 | RB | denotes | not |
| T18915 | 24605-24608 | DT | denotes | any |
| T18916 | 24609-24618 | NN | denotes | consensus |
| T18917 | 24619-24622 | NNP | denotes | IKK |
| T18918 | 24623-24628 | NN | denotes | motif |
| T18919 | 24628-24629 | : | denotes | ; |
| T18920 | 24630-24637 | RB | denotes | instead |
| T18921 | 24637-24638 | , | denotes | , |
| T18922 | 24639-24643 | NNP | denotes | S209 |
| T18923 | 24644-24646 | VBZ | denotes | is |
| T18924 | 24647-24655 | VBN | denotes | centered |
| T18925 | 24656-24658 | IN | denotes | in |
| T18926 | 24659-24660 | DT | denotes | a |
| T18927 | 24661-24670 | NN | denotes | consensus |
| T18928 | 24671-24674 | NNP | denotes | CK2 |
| T18929 | 24675-24680 | NN | denotes | motif |
| T18930 | 24680-24681 | . | denotes | . |
| T18931 | 24682-24685 | DT | denotes | The |
| T18932 | 24686-24692 | JJ | denotes | recent |
| T18933 | 24693-24704 | NN | denotes | observation |
| T18934 | 24705-24709 | WDT | denotes | that |
| T18935 | 24710-24715 | JJ | denotes | human |
| T18936 | 24716-24720 | NNP | denotes | IKKβ |
| T18937 | 24721-24730 | VBD | denotes | displayed |
| T18938 | 24731-24739 | JJ | denotes | CK2-like |
| T18939 | 24740-24755 | NN | denotes | phosphorylation |
| T18940 | 24756-24769 | CD | denotes | specificity29 |
| T18941 | 24770-24779 | NNS | denotes | coincides |
| T18942 | 24780-24784 | IN | denotes | with |
| T18943 | 24785-24788 | PRP$ | denotes | our |
| T18944 | 24789-24797 | NN | denotes | evidence |
| T18945 | 24798-24802 | IN | denotes | that |
| T18946 | 24803-24814 | JJ | denotes | recombinant |
| T18947 | 24815-24819 | NNP | denotes | IKKβ |
| T18948 | 24819-24820 | , | denotes | , |
| T18949 | 24821-24824 | CC | denotes | but |
| T18950 | 24825-24828 | RB | denotes | not |
| T18951 | 24829-24833 | NNP | denotes | IKKα |
| T18952 | 24833-24834 | , | denotes | , |
| T18953 | 24835-24849 | VBD | denotes | phosphorylated |
| T18954 | 24850-24854 | NNP | denotes | RPS3 |
| T18955 | 24854-24855 | . | denotes | . |
| T18956 | 24856-24858 | PRP | denotes | We |
| T18957 | 24859-24864 | VBD | denotes | found |
| T18958 | 24865-24869 | DT | denotes | this |
| T18959 | 24870-24885 | NN | denotes | phosphorylation |
| T18960 | 24886-24888 | VBZ | denotes | is |
| T18961 | 24889-24890 | DT | denotes | a |
| T18962 | 24891-24899 | JJ | denotes | critical |
| T18963 | 24900-24910 | NN | denotes | modulation |
| T18964 | 24911-24914 | IN | denotes | for |
| T18965 | 24915-24919 | NNP | denotes | RPS3 |
| T18966 | 24920-24927 | JJ | denotes | nuclear |
| T18967 | 24928-24941 | NN | denotes | translocation |
| T18968 | 24942-24943 | -LRB- | denotes | ( |
| T18969 | 24943-24946 | IN | denotes | via |
| T18970 | 24947-24957 | JJ | denotes | importin-α |
| T18971 | 24957-24958 | -RRB- | denotes | ) |
| T18972 | 24959-24962 | CC | denotes | and |
| T18973 | 24963-24973 | NN | denotes | engagement |
| T18974 | 24974-24976 | IN | denotes | in |
| T18975 | 24977-24985 | JJ | denotes | specific |
| T18976 | 24986-24991 | NN | denotes | NF-κB |
| T18977 | 24992-25005 | NN | denotes | transcription |
| T18978 | 25005-25006 | . | denotes | . |
| T18979 | 25007-25010 | CD | denotes | CK2 |
| T18980 | 25011-25014 | VBD | denotes | was |
| T18981 | 25015-25025 | RB | denotes | previously |
| T18982 | 25026-25031 | VBN | denotes | shown |
| T18983 | 25032-25034 | TO | denotes | to |
| T18984 | 25035-25048 | VB | denotes | phosphorylate |
| T18985 | 25049-25052 | NNS | denotes | p65 |
| T18986 | 25053-25056 | CC | denotes | and |
| T18987 | 25057-25059 | TO | denotes | to |
| T18988 | 25060-25064 | NN | denotes | bind |
| T18989 | 25065-25067 | TO | denotes | to |
| T18990 | 25068-25071 | CC | denotes | and |
| T18991 | 25072-25085 | VB | denotes | phosphorylate |
| T18992 | 25086-25095 | JJ | denotes | IKKβ41-43 |
| T18993 | 25095-25096 | , | denotes | , |
| T18994 | 25097-25104 | RB | denotes | however |
| T18995 | 25104-25105 | , | denotes | , |
| T18996 | 25106-25108 | PRP | denotes | we |
| T18997 | 25109-25114 | VBD | denotes | ruled |
| T18998 | 25115-25118 | RP | denotes | out |
| T18999 | 25119-25122 | DT | denotes | the |
| T19000 | 25123-25134 | NN | denotes | possibility |
| T19001 | 25135-25139 | IN | denotes | that |
| T19002 | 25140-25143 | DT | denotes | the |
| T19003 | 25144-25154 | JJ | denotes | IKKβ-bound |
| T19004 | 25155-25158 | NN | denotes | CK2 |
| T19005 | 25159-25164 | MD | denotes | could |
| T19006 | 25165-25172 | VB | denotes | account |
| T19007 | 25173-25176 | IN | denotes | for |
| T19008 | 25177-25180 | DT | denotes | the |
| T19009 | 25181-25189 | JJ | denotes | observed |
| T19010 | 25190-25194 | NN | denotes | RPS3 |
| T19011 | 25195-25210 | NN | denotes | phosphorylation |
| T19012 | 25211-25218 | IN | denotes | because |
| T19013 | 25219-25221 | DT | denotes | no |
| T19014 | 25222-25225 | NN | denotes | CK2 |
| T19015 | 25226-25229 | VBD | denotes | was |
| T19016 | 25230-25238 | VBN | denotes | detected |
| T19017 | 25239-25241 | IN | denotes | in |
| T19018 | 25242-25245 | DT | denotes | the |
| T19019 | 25246-25250 | NNP | denotes | IKKβ |
| T19020 | 25251-25263 | NNS | denotes | preparations |
| T19021 | 25264-25268 | VBD | denotes | used |
| T19022 | 25269-25272 | IN | denotes | for |
| T19023 | 25273-25276 | DT | denotes | the |
| T19024 | 25277-25279 | IN | denotes | in |
| T19025 | 25280-25285 | NN | denotes | vitro |
| T19026 | 25286-25292 | NN | denotes | kinase |
| T19027 | 25293-25298 | NN | denotes | assay |
| T19028 | 25298-25299 | . | denotes | . |
| T19029 | 25300-25307 | IN | denotes | Because |
| T19030 | 25308-25312 | CD | denotes | RPS3 |
| T19031 | 25313-25317 | RB | denotes | only |
| T19032 | 25318-25325 | VBZ | denotes | harbors |
| T19033 | 25326-25329 | DT | denotes | the |
| T19034 | 25330-25333 | NNP | denotes | CK2 |
| T19035 | 25334-25339 | NN | denotes | motif |
| T19036 | 25340-25343 | CC | denotes | and |
| T19037 | 25344-25347 | RB | denotes | not |
| T19038 | 25348-25349 | DT | denotes | a |
| T19039 | 25350-25361 | JJ | denotes | traditional |
| T19040 | 25362-25365 | NNP | denotes | IKK |
| T19041 | 25366-25371 | NN | denotes | motif |
| T19042 | 25371-25372 | , | denotes | , |
| T19043 | 25373-25377 | DT | denotes | this |
| T19044 | 25378-25382 | JJ | denotes | RPS3 |
| T19045 | 25383-25393 | JJ | denotes | regulatory |
| T19046 | 25394-25402 | NN | denotes | function |
| T19047 | 25403-25408 | MD | denotes | could |
| T19048 | 25409-25416 | VB | denotes | explain |
| T19049 | 25417-25420 | WRB | denotes | why |
| T19050 | 25421-25424 | NNP | denotes | IKK |
| T19051 | 25425-25432 | VBZ | denotes | harbors |
| T19052 | 25433-25436 | DT | denotes | the |
| T19053 | 25437-25448 | JJ | denotes | alternative |
| T19054 | 25449-25458 | JJ | denotes | substrate |
| T19055 | 25459-25474 | NN | denotes | phosphorylation |
| T19056 | 25475-25485 | NN | denotes | capability |
| T19057 | 25485-25486 | . | denotes | . |
| T19058 | 25487-25491 | RBR | denotes | More |
| T19059 | 25492-25503 | RB | denotes | importantly |
| T19060 | 25503-25504 | , | denotes | , |
| T19061 | 25505-25508 | PRP$ | denotes | our |
| T19062 | 25509-25514 | NN | denotes | study |
| T19063 | 25515-25518 | VBZ | denotes | has |
| T19064 | 25519-25529 | VBN | denotes | elucidated |
| T19065 | 25530-25533 | WRB | denotes | how |
| T19066 | 25534-25538 | NNP | denotes | RPS3 |
| T19067 | 25539-25541 | VBZ | denotes | is |
| T19068 | 25542-25555 | RB | denotes | biochemically |
| T19069 | 25556-25566 | VBN | denotes | integrated |
| T19070 | 25567-25571 | IN | denotes | into |
| T19071 | 25572-25577 | JJ | denotes | NF-κB |
| T19072 | 25578-25588 | NN | denotes | activation |
| T19073 | 25589-25598 | VBG | denotes | signaling |
| T19074 | 25599-25601 | IN | denotes | in |
| T19075 | 25602-25603 | DT | denotes | a |
| T19076 | 25604-25610 | NN | denotes | manner |
| T19077 | 25611-25615 | WDT | denotes | that |
| T19078 | 25616-25618 | VBZ | denotes | is |
| T19079 | 25619-25626 | JJ | denotes | pivotal |
| T19080 | 25627-25630 | IN | denotes | for |
| T19081 | 25631-25634 | DT | denotes | the |
| T19082 | 25635-25647 | NN | denotes | pathogenesis |
| T19083 | 25648-25650 | IN | denotes | of |
| T19084 | 25651-25660 | NN | denotes | foodborne |
| T19085 | 25661-25669 | NN | denotes | pathogen |
| T19086 | 25670-25672 | NNP | denotes | E. |
| T19087 | 25673-25677 | NNS | denotes | coli |
| T19088 | 25678-25682 | NNP | denotes | O157 |
| T19089 | 25682-25683 | : | denotes | : |
| T19090 | 25683-25685 | NNP | denotes | H7 |
| T19091 | 25685-25686 | . | denotes | . |
| T19092 | 25687-25700 | JJ | denotes | IKKβ-mediated |
| T19093 | 25701-25705 | NNP | denotes | RPS3 |
| T19094 | 25706-25710 | NNP | denotes | S209 |
| T19095 | 25711-25726 | NN | denotes | phosphorylation |
| T19096 | 25727-25729 | VBZ | denotes | is |
| T19097 | 25730-25731 | DT | denotes | a |
| T19098 | 25732-25740 | JJ | denotes | critical |
| T19099 | 25741-25747 | NN | denotes | target |
| T19100 | 25748-25757 | VBN | denotes | modulated |
| T19101 | 25758-25760 | IN | denotes | by |
| T19102 | 25761-25765 | DT | denotes | this |
| T19103 | 25766-25774 | NN | denotes | pathogen |
| T19104 | 25775-25777 | TO | denotes | to |
| T19105 | 25778-25785 | VB | denotes | subvert |
| T19106 | 25786-25790 | NN | denotes | host |
| T19107 | 25791-25796 | NN | denotes | NF-κB |
| T19108 | 25797-25806 | VBG | denotes | signaling |
| T19109 | 25806-25807 | . | denotes | . |
| T19110 | 25808-25811 | DT | denotes | The |
| T19111 | 25812-25821 | JJ | denotes | bacterial |
| T19112 | 25822-25830 | NN | denotes | effector |
| T19113 | 25831-25836 | NNP | denotes | NleH1 |
| T19114 | 25837-25849 | RB | denotes | specifically |
| T19115 | 25850-25855 | VBZ | denotes | binds |
| T19116 | 25856-25858 | TO | denotes | to |
| T19117 | 25859-25863 | CD | denotes | RPS3 |
| T19118 | 25864-25868 | RB | denotes | once |
| T19119 | 25869-25877 | VBD | denotes | injected |
| T19120 | 25878-25882 | IN | denotes | into |
| T19121 | 25883-25887 | NN | denotes | host |
| T19122 | 25888-25893 | NNS | denotes | cells |
| T19123 | 25894-25897 | CC | denotes | and |
| T19124 | 25898-25908 | RB | denotes | profoundly |
| T19125 | 25909-25919 | VBZ | denotes | suppresses |
| T19126 | 25920-25925 | NNP | denotes | NF-κB |
| T19127 | 25926-25929 | CC | denotes | and |
| T19128 | 25930-25933 | PRP$ | denotes | its |
| T19129 | 25934-25943 | JJ | denotes | attendant |
| T19130 | 25944-25954 | JJ | denotes | protective |
| T19131 | 25955-25961 | JJ | denotes | immune |
| T19132 | 25962-25972 | NN | denotes | responses9 |
| T19133 | 25972-25973 | . | denotes | . |
| T19134 | 25974-25977 | PRP$ | denotes | Our |
| T19135 | 25978-25982 | NNS | denotes | data |
| T19136 | 25983-25986 | RB | denotes | now |
| T19137 | 25987-25991 | VBP | denotes | show |
| T19138 | 25992-25996 | IN | denotes | that |
| T19139 | 25997-26002 | JJ | denotes | NleH1 |
| T19140 | 26003-26014 | RB | denotes | selectively |
| T19141 | 26015-26023 | VBZ | denotes | inhibits |
| T19142 | 26024-26028 | CD | denotes | RPS3 |
| T19143 | 26029-26044 | NN | denotes | phosphorylation |
| T19144 | 26044-26045 | , | denotes | , |
| T19145 | 26046-26050 | RB | denotes | thus |
| T19146 | 26051-26060 | VBG | denotes | retarding |
| T19147 | 26061-26064 | PRP$ | denotes | its |
| T19148 | 26065-26072 | JJ | denotes | nuclear |
| T19149 | 26073-26086 | NN | denotes | translocation |
| T19150 | 26087-26090 | CC | denotes | and |
| T19151 | 26091-26101 | JJ | denotes | subsequent |
| T19152 | 26102-26107 | NN | denotes | NF-κB |
| T19153 | 26108-26116 | NN | denotes | function |
| T19154 | 26116-26117 | , | denotes | , |
| T19155 | 26118-26125 | IN | denotes | without |
| T19156 | 26126-26134 | VBG | denotes | altering |
| T19157 | 26135-26140 | JJ | denotes | other |
| T19158 | 26141-26146 | JJ | denotes | NF-κB |
| T19159 | 26147-26156 | VBG | denotes | signaling |
| T19160 | 26156-26157 | . | denotes | . |
| T19161 | 26158-26166 | IN | denotes | Although |
| T19162 | 26167-26172 | NNP | denotes | NleH1 |
| T19163 | 26173-26176 | VBD | denotes | did |
| T19164 | 26177-26180 | RB | denotes | not |
| T19165 | 26181-26189 | RB | denotes | directly |
| T19166 | 26190-26203 | VB | denotes | phosphorylate |
| T19167 | 26204-26208 | NNP | denotes | IKKβ |
| T19168 | 26208-26209 | , | denotes | , |
| T19169 | 26210-26213 | PRP$ | denotes | its |
| T19170 | 26214-26220 | NN | denotes | kinase |
| T19171 | 26221-26229 | NN | denotes | activity |
| T19172 | 26230-26233 | VBD | denotes | was |
| T19173 | 26234-26242 | VBN | denotes | required |
| T19174 | 26243-26245 | TO | denotes | to |
| T19175 | 26246-26253 | VB | denotes | inhibit |
| T19176 | 26254-26267 | JJ | denotes | IKKβ-mediated |
| T19177 | 26268-26272 | NNP | denotes | RPS3 |
| T19178 | 26273-26277 | NNP | denotes | S209 |
| T19179 | 26278-26293 | NN | denotes | phosphorylation |
| T19180 | 26293-26294 | . | denotes | . |
| T19181 | 26295-26299 | JJ | denotes | Many |
| T19182 | 26300-26308 | NNS | denotes | bacteria |
| T19183 | 26309-26318 | NNS | denotes | pathogens |
| T19184 | 26319-26323 | VBP | denotes | have |
| T19185 | 26324-26332 | NNS | denotes | products |
| T19186 | 26333-26337 | WDT | denotes | that |
| T19187 | 26338-26344 | VBP | denotes | target |
| T19188 | 26345-26348 | JJ | denotes | key |
| T19189 | 26349-26356 | NNS | denotes | kinases |
| T19190 | 26357-26359 | TO | denotes | to |
| T19191 | 26360-26370 | VB | denotes | inactivate |
| T19192 | 26371-26375 | PRP | denotes | them |
| T19193 | 26376-26378 | IN | denotes | in |
| T19194 | 26379-26383 | NN | denotes | host |
| T19195 | 26384-26389 | NNS | denotes | cells |
| T19196 | 26389-26390 | , | denotes | , |
| T19197 | 26391-26398 | IN | denotes | whereas |
| T19198 | 26399-26401 | NNP | denotes | E. |
| T19199 | 26402-26406 | NNS | denotes | coli |
| T19200 | 26407-26411 | NNP | denotes | O157 |
| T19201 | 26411-26412 | : | denotes | : |
| T19202 | 26412-26414 | NNP | denotes | H7 |
| T19203 | 26415-26423 | VBN | denotes | employed |
| T19204 | 26424-26429 | NNP | denotes | NleH1 |
| T19205 | 26430-26432 | TO | denotes | to |
| T19206 | 26433-26438 | VB | denotes | steer |
| T19207 | 26439-26442 | DT | denotes | the |
| T19208 | 26443-26452 | JJ | denotes | substrate |
| T19209 | 26453-26464 | NN | denotes | specificity |
| T19210 | 26465-26467 | IN | denotes | of |
| T19211 | 26468-26472 | NNP | denotes | IKKβ |
| T19212 | 26473-26477 | RB | denotes | thus |
| T19213 | 26478-26490 | RB | denotes | specifically |
| T19214 | 26491-26502 | VB | denotes | fine-tuning |
| T19215 | 26503-26507 | NN | denotes | host |
| T19216 | 26508-26513 | NN | denotes | NF-κB |
| T19217 | 26514-26523 | VBG | denotes | signaling |
| T19218 | 26523-26524 | . | denotes | . |
| T19219 | 26525-26529 | DT | denotes | This |
| T19220 | 26530-26535 | MD | denotes | could |
| T19221 | 26536-26545 | VB | denotes | represent |
| T19222 | 26546-26547 | DT | denotes | a |
| T19223 | 26548-26553 | NN | denotes | novel |
| T19224 | 26554-26562 | NN | denotes | strategy |
| T19225 | 26563-26565 | TO | denotes | to |
| T19226 | 26566-26575 | VB | denotes | fine-tune |
| T19227 | 26576-26580 | NN | denotes | host |
| T19228 | 26581-26586 | NN | denotes | NF-κB |
| T19229 | 26587-26596 | VBG | denotes | signaling |
| T19230 | 26597-26601 | DT | denotes | that |
| T19231 | 26602-26607 | MD | denotes | could |
| T19232 | 26608-26610 | VB | denotes | be |
| T19233 | 26611-26617 | VBN | denotes | shared |
| T19234 | 26618-26620 | IN | denotes | by |
| T19235 | 26621-26626 | JJ | denotes | other |
| T19236 | 26627-26636 | NNS | denotes | pathogens |
| T19237 | 26636-26637 | . | denotes | . |
| T19238 | 26638-26643 | DT | denotes | These |
| T19239 | 26644-26648 | NNS | denotes | data |
| T19240 | 26649-26656 | VBP | denotes | provide |
| T19241 | 26657-26660 | JJ | denotes | new |
| T19242 | 26661-26669 | NNS | denotes | insights |
| T19243 | 26670-26674 | IN | denotes | into |
| T19244 | 26675-26678 | DT | denotes | the |
| T19245 | 26679-26685 | RB | denotes | poorly |
| T19246 | 26686-26696 | VBN | denotes | understood |
| T19247 | 26697-26703 | NN | denotes | action |
| T19248 | 26704-26713 | NN | denotes | mechanism |
| T19249 | 26714-26717 | IN | denotes | for |
| T19250 | 26718-26722 | JJS | denotes | most |
| T19251 | 26723-26727 | CD | denotes | T3SS |
| T19252 | 26728-26737 | NNS | denotes | effectors |
| T19253 | 26737-26738 | . | denotes | . |
| T19254 | 26739-26744 | CD | denotes | NleH1 |
| T19255 | 26745-26755 | VBZ | denotes | attenuates |
| T19256 | 26756-26759 | DT | denotes | the |
| T19257 | 26760-26773 | NN | denotes | transcription |
| T19258 | 26774-26776 | IN | denotes | of |
| T19259 | 26777-26791 | NN | denotes | RPS3-dependent |
| T19260 | 26791-26792 | , | denotes | , |
| T19261 | 26793-26796 | CC | denotes | but |
| T19262 | 26797-26800 | RB | denotes | not |
| T19263 | 26801-26804 | DT | denotes | all |
| T19264 | 26804-26805 | , | denotes | , |
| T19265 | 26806-26811 | JJ | denotes | NF-κB |
| T19266 | 26812-26818 | NN | denotes | target |
| T19267 | 26819-26824 | NNS | denotes | genes |
| T19268 | 26824-26825 | , | denotes | , |
| T19269 | 26826-26828 | IN | denotes | in |
| T19270 | 26829-26839 | JJ | denotes | particular |
| T19271 | 26840-26845 | DT | denotes | those |
| T19272 | 26846-26851 | NNS | denotes | genes |
| T19273 | 26852-26862 | VBN | denotes | associated |
| T19274 | 26863-26867 | IN | denotes | with |
| T19275 | 26868-26873 | JJ | denotes | acute |
| T19276 | 26874-26889 | JJ | denotes | proinflammatory |
| T19277 | 26890-26899 | NNS | denotes | responses |
| T19278 | 26899-26900 | , | denotes | , |
| T19279 | 26901-26910 | VBG | denotes | including |
| T19280 | 26911-26914 | NNP | denotes | IL8 |
| T19281 | 26915-26918 | CC | denotes | and |
| T19282 | 26919-26922 | NNP | denotes | TNF |
| T19283 | 26922-26923 | . | denotes | . |
| T19284 | 26924-26926 | IN | denotes | In |
| T19285 | 26927-26935 | NN | denotes | contrast |
| T19286 | 26935-26936 | , | denotes | , |
| T19287 | 26937-26942 | NNP | denotes | NleH1 |
| T19288 | 26943-26947 | VBZ | denotes | does |
| T19289 | 26948-26951 | RB | denotes | not |
| T19290 | 26952-26957 | VB | denotes | block |
| T19291 | 26958-26963 | NNP | denotes | NF-κB |
| T19292 | 26964-26967 | CD | denotes | p65 |
| T19293 | 26968-26975 | JJ | denotes | nuclear |
| T19294 | 26976-26989 | NN | denotes | translocation |
| T19295 | 26989-26990 | , | denotes | , |
| T19296 | 26991-26996 | WDT | denotes | which |
| T19297 | 26997-27005 | VBZ | denotes | suggests |
| T19298 | 27006-27010 | IN | denotes | that |
| T19299 | 27011-27018 | JJ | denotes | certain |
| T19300 | 27019-27032 | JJ | denotes | p65-dependent |
| T19301 | 27033-27036 | CC | denotes | but |
| T19302 | 27037-27053 | JJ | denotes | RPS3-independent |
| T19303 | 27054-27059 | NN | denotes | NF-κB |
| T19304 | 27060-27066 | NN | denotes | target |
| T19305 | 27067-27072 | NNS | denotes | genes |
| T19306 | 27073-27078 | MD | denotes | might |
| T19307 | 27079-27083 | RB | denotes | thus |
| T19308 | 27084-27086 | VB | denotes | be |
| T19309 | 27087-27097 | JJ | denotes | beneficial |
| T19310 | 27098-27101 | IN | denotes | for |
| T19311 | 27102-27104 | NNP | denotes | E. |
| T19312 | 27105-27109 | NNS | denotes | coli |
| T19313 | 27110-27114 | NNP | denotes | O157 |
| T19314 | 27114-27115 | : | denotes | : |
| T19315 | 27115-27117 | NNP | denotes | H7 |
| T19316 | 27118-27120 | TO | denotes | to |
| T19317 | 27121-27130 | VB | denotes | replicate |
| T19318 | 27131-27134 | CC | denotes | and |
| T19319 | 27135-27146 | VB | denotes | disseminate |
| T19320 | 27147-27149 | IN | denotes | in |
| T19321 | 27150-27153 | DT | denotes | the |
| T19322 | 27154-27158 | NN | denotes | host |
| T19323 | 27158-27159 | . | denotes | . |
| T19324 | 27160-27162 | IN | denotes | By |
| T19325 | 27163-27174 | RB | denotes | selectively |
| T19326 | 27175-27185 | VBG | denotes | inhibiting |
| T19327 | 27186-27190 | CD | denotes | RPS3 |
| T19328 | 27191-27194 | CC | denotes | and |
| T19329 | 27195-27198 | PRP$ | denotes | its |
| T19330 | 27199-27208 | JJ | denotes | attendant |
| T19331 | 27209-27214 | NN | denotes | NF-κB |
| T19332 | 27215-27223 | NN | denotes | function |
| T19333 | 27224-27228 | IN | denotes | with |
| T19334 | 27229-27234 | NNP | denotes | NleH1 |
| T19335 | 27234-27235 | , | denotes | , |
| T19336 | 27236-27239 | DT | denotes | the |
| T19337 | 27240-27248 | NN | denotes | pathogen |
| T19338 | 27249-27257 | VBZ | denotes | achieves |
| T19339 | 27258-27261 | DT | denotes | the |
| T19340 | 27262-27269 | NN | denotes | ability |
| T19341 | 27270-27272 | TO | denotes | to |
| T19342 | 27273-27281 | VB | denotes | increase |
| T19343 | 27282-27294 | NN | denotes | colonization |
| T19344 | 27295-27298 | CC | denotes | and |
| T19345 | 27299-27307 | NN | denotes | diarrhea |
| T19346 | 27308-27311 | RB | denotes | yet |
| T19347 | 27312-27320 | VBG | denotes | limiting |
| T19348 | 27321-27324 | DT | denotes | the |
| T19349 | 27325-27334 | NN | denotes | mortality |
| T19350 | 27335-27337 | IN | denotes | of |
| T19351 | 27338-27341 | DT | denotes | the |
| T19352 | 27342-27346 | NN | denotes | host |
| T19353 | 27346-27347 | . | denotes | . |
| T19354 | 27348-27352 | DT | denotes | This |
| T19355 | 27353-27362 | RB | denotes | seemingly |
| T19356 | 27363-27374 | JJ | denotes | paradoxical |
| T19357 | 27375-27386 | NN | denotes | combination |
| T19358 | 27387-27389 | IN | denotes | of |
| T19359 | 27390-27397 | NNS | denotes | effects |
| T19360 | 27398-27402 | VBP | denotes | make |
| T19361 | 27403-27408 | NN | denotes | sense |
| T19362 | 27409-27413 | WRB | denotes | when |
| T19363 | 27414-27417 | CD | denotes | one |
| T19364 | 27418-27427 | VBZ | denotes | considers |
| T19365 | 27428-27432 | IN | denotes | that |
| T19366 | 27433-27442 | VBN | denotes | increased |
| T19367 | 27443-27452 | JJ | denotes | bacterial |
| T19368 | 27453-27457 | NN | denotes | load |
| T19369 | 27458-27461 | CC | denotes | and |
| T19370 | 27462-27470 | NN | denotes | diarrhea |
| T19371 | 27471-27479 | RB | denotes | together |
| T19372 | 27480-27484 | IN | denotes | with |
| T19373 | 27485-27493 | NN | denotes | survival |
| T19374 | 27494-27496 | IN | denotes | of |
| T19375 | 27497-27500 | DT | denotes | the |
| T19376 | 27501-27509 | JJ | denotes | infected |
| T19377 | 27510-27514 | NN | denotes | host |
| T19378 | 27515-27520 | MD | denotes | would |
| T19379 | 27521-27528 | VB | denotes | promote |
| T19380 | 27529-27532 | DT | denotes | the |
| T19381 | 27533-27542 | VBG | denotes | spreading |
| T19382 | 27543-27545 | IN | denotes | of |
| T19383 | 27546-27549 | DT | denotes | the |
| T19384 | 27550-27558 | NNS | denotes | bacteria |
| T19385 | 27559-27564 | IN | denotes | among |
| T19386 | 27565-27566 | DT | denotes | a |
| T19387 | 27567-27577 | NN | denotes | population |
| T19388 | 27578-27580 | IN | denotes | of |
| T19389 | 27581-27592 | JJ | denotes | susceptible |
| T19390 | 27593-27604 | NNS | denotes | individuals |
| T19391 | 27604-27605 | . | denotes | . |
| T19392 | 27606-27610 | JJ | denotes | Such |
| T19393 | 27611-27618 | NN | denotes | complex |
| T19394 | 27619-27622 | CC | denotes | and |
| T19395 | 27623-27634 | JJ | denotes | paradoxical |
| T19396 | 27635-27647 | JJ | denotes | pathological |
| T19397 | 27648-27655 | NNS | denotes | effects |
| T19398 | 27656-27660 | WDT | denotes | that |
| T19399 | 27661-27670 | VBP | denotes | influence |
| T19400 | 27671-27674 | DT | denotes | the |
| T19401 | 27675-27681 | NN | denotes | spread |
| T19402 | 27682-27684 | IN | denotes | of |
| T19403 | 27685-27692 | NN | denotes | disease |
| T19404 | 27693-27696 | VBP | denotes | are |
| T19405 | 27697-27702 | RB | denotes | often |
| T19406 | 27703-27709 | RB | denotes | poorly |
| T19407 | 27710-27720 | VBN | denotes | understood |
| T19408 | 27721-27723 | IN | denotes | at |
| T19409 | 27724-27727 | DT | denotes | the |
| T19410 | 27728-27737 | JJ | denotes | molecular |
| T19411 | 27738-27743 | NN | denotes | level |
| T19412 | 27743-27744 | . | denotes | . |
| T19413 | 27745-27748 | PRP$ | denotes | Our |
| T19414 | 27749-27753 | NNS | denotes | data |
| T19415 | 27754-27763 | VB | denotes | elucidate |
| T19416 | 27764-27767 | WRB | denotes | how |
| T19417 | 27768-27779 | NNS | denotes | alterations |
| T19418 | 27780-27782 | IN | denotes | in |
| T19419 | 27783-27792 | JJ | denotes | selective |
| T19420 | 27793-27798 | NN | denotes | NF-κB |
| T19421 | 27799-27807 | NN | denotes | function |
| T19422 | 27807-27808 | , | denotes | , |
| T19423 | 27809-27817 | VBN | denotes | achieved |
| T19424 | 27818-27820 | IN | denotes | by |
| T19425 | 27821-27829 | VBG | denotes | impeding |
| T19426 | 27830-27834 | NNP | denotes | RPS3 |
| T19427 | 27834-27835 | , | denotes | , |
| T19428 | 27836-27839 | CC | denotes | but |
| T19429 | 27840-27843 | RB | denotes | not |
| T19430 | 27844-27852 | VBG | denotes | altering |
| T19431 | 27853-27856 | CD | denotes | p65 |
| T19432 | 27857-27864 | JJ | denotes | nuclear |
| T19433 | 27865-27878 | NN | denotes | translocation |
| T19434 | 27878-27879 | , | denotes | , |
| T19435 | 27880-27883 | MD | denotes | can |
| T19436 | 27884-27893 | VB | denotes | influence |
| T19437 | 27894-27902 | JJ | denotes | specific |
| T19438 | 27903-27912 | NNS | denotes | cytokines |
| T19439 | 27913-27917 | WDT | denotes | that |
| T19440 | 27918-27924 | VBP | denotes | affect |
| T19441 | 27925-27934 | JJ | denotes | bacterial |
| T19442 | 27935-27947 | NN | denotes | colonization |
| T19443 | 27947-27948 | , | denotes | , |
| T19444 | 27949-27957 | NN | denotes | diarrhea |
| T19445 | 27958-27966 | NNS | denotes | diseases |
| T19446 | 27967-27970 | CC | denotes | and |
| T19447 | 27971-27980 | NN | denotes | mortality |
| T19448 | 27980-27981 | . | denotes | . |
| T19449 | 27982-27984 | PRP | denotes | It |
| T19450 | 27985-27988 | MD | denotes | may |
| T19451 | 27989-27991 | VB | denotes | be |
| T19452 | 27992-28000 | JJ | denotes | fruitful |
| T19453 | 28001-28003 | IN | denotes | in |
| T19454 | 28004-28014 | VBG | denotes | attempting |
| T19455 | 28015-28017 | TO | denotes | to |
| T19456 | 28018-28028 | VB | denotes | understand |
| T19457 | 28029-28034 | JJ | denotes | other |
| T19458 | 28035-28045 | JJ | denotes | infectious |
| T19459 | 28046-28049 | CC | denotes | and |
| T19460 | 28050-28060 | JJ | denotes | autoimmune |
| T19461 | 28061-28069 | NNS | denotes | diseases |
| T19462 | 28070-28079 | VBG | denotes | involving |
| T19463 | 28080-28085 | NN | denotes | NF-κB |
| T19464 | 28086-28088 | TO | denotes | to |
| T19465 | 28089-28097 | VB | denotes | consider |
| T19466 | 28098-28107 | JJ | denotes | selective |
| T19467 | 28108-28115 | NNS | denotes | effects |
| T19468 | 28116-28118 | IN | denotes | of |
| T19469 | 28119-28127 | NNS | denotes | subunits |
| T19470 | 28128-28132 | JJ | denotes | such |
| T19471 | 28133-28135 | IN | denotes | as |
| T19472 | 28136-28140 | CD | denotes | RPS3 |
| T19473 | 28141-28143 | IN | denotes | in |
| T19474 | 28144-28152 | NN | denotes | addition |
| T19475 | 28153-28155 | TO | denotes | to |
| T19476 | 28156-28162 | JJ | denotes | global |
| T19477 | 28163-28168 | NN | denotes | NF-κB |
| T19478 | 28169-28179 | NN | denotes | inhibition |
| T19479 | 28179-28180 | . | denotes | . |
| T20213 | 28191-28196 | NNS | denotes | Cells |
| T20214 | 28197-28200 | CC | denotes | and |
| T20215 | 28201-28209 | NNP | denotes | Reagents |
| T20216 | 28210-28216 | NNP | denotes | Jurkat |
| T20217 | 28217-28219 | NNP | denotes | E6 |
| T20218 | 28219-28221 | CD | denotes | .1 |
| T20219 | 28221-28222 | , | denotes | , |
| T20220 | 28223-28230 | CD | denotes | HEK293T |
| T20221 | 28231-28234 | CC | denotes | and |
| T20222 | 28235-28239 | NNP | denotes | HeLa |
| T20223 | 28240-28245 | NNS | denotes | cells |
| T20224 | 28246-28250 | VBD | denotes | were |
| T20225 | 28251-28259 | VBN | denotes | cultured |
| T20226 | 28260-28262 | IN | denotes | in |
| T20227 | 28263-28267 | NNP | denotes | RPMI |
| T20228 | 28268-28272 | CD | denotes | 1640 |
| T20229 | 28273-28276 | CC | denotes | and |
| T20230 | 28277-28281 | NNP | denotes | DMEM |
| T20231 | 28282-28294 | VBD | denotes | supplemented |
| T20232 | 28295-28299 | IN | denotes | with |
| T20233 | 28300-28302 | CD | denotes | 10 |
| T20234 | 28302-28303 | NN | denotes | % |
| T20235 | 28304-28309 | JJ | denotes | fetal |
| T20236 | 28310-28314 | NN | denotes | calf |
| T20237 | 28315-28320 | NN | denotes | serum |
| T20238 | 28320-28321 | , | denotes | , |
| T20239 | 28322-28323 | CD | denotes | 2 |
| T20240 | 28324-28326 | NNP | denotes | mM |
| T20241 | 28327-28336 | NN | denotes | glutamine |
| T20242 | 28336-28337 | , | denotes | , |
| T20243 | 28338-28341 | CC | denotes | and |
| T20244 | 28342-28345 | CD | denotes | 100 |
| T20245 | 28346-28350 | NNP | denotes | U/ml |
| T20246 | 28351-28355 | DT | denotes | each |
| T20247 | 28356-28358 | IN | denotes | of |
| T20248 | 28359-28369 | NN | denotes | penicillin |
| T20249 | 28370-28373 | CC | denotes | and |
| T20250 | 28374-28386 | NN | denotes | streptomycin |
| T20251 | 28386-28387 | , | denotes | , |
| T20252 | 28388-28400 | RB | denotes | respectively |
| T20253 | 28400-28401 | . | denotes | . |
| T20254 | 28402-28406 | NNP | denotes | IκBα |
| T20255 | 28407-28408 | -LRB- | denotes | ( |
| T20256 | 28408-28412 | NNP | denotes | C-21 |
| T20257 | 28412-28413 | , | denotes | , |
| T20258 | 28414-28420 | JJ | denotes | sc-371 |
| T20259 | 28420-28421 | -RRB- | denotes | ) |
| T20260 | 28421-28422 | , | denotes | , |
| T20261 | 28423-28426 | NNS | denotes | p65 |
| T20262 | 28427-28428 | -LRB- | denotes | ( |
| T20263 | 28428-28432 | NN | denotes | C-20 |
| T20264 | 28432-28433 | , | denotes | , |
| T20265 | 28434-28440 | JJ | denotes | sc-372 |
| T20266 | 28440-28441 | -RRB- | denotes | ) |
| T20267 | 28441-28442 | , | denotes | , |
| T20268 | 28443-28446 | CC | denotes | and |
| T20269 | 28447-28464 | NN | denotes | phospho-threonine |
| T20270 | 28465-28466 | -LRB- | denotes | ( |
| T20271 | 28466-28469 | NN | denotes | H-2 |
| T20272 | 28469-28470 | , | denotes | , |
| T20273 | 28471-28478 | JJ | denotes | sc-5267 |
| T20274 | 28478-28479 | -RRB- | denotes | ) |
| T20275 | 28480-28490 | NNS | denotes | antibodies |
| T20276 | 28491-28495 | VBD | denotes | were |
| T20277 | 28496-28500 | IN | denotes | from |
| T20278 | 28501-28506 | NNP | denotes | Santa |
| T20279 | 28507-28511 | NNP | denotes | Cruz |
| T20280 | 28512-28525 | NNP | denotes | Biotechnology |
| T20281 | 28525-28526 | : | denotes | ; |
| T20282 | 28527-28534 | NN | denotes | β-actin |
| T20283 | 28535-28536 | -LRB- | denotes | ( |
| T20284 | 28536-28541 | NNP | denotes | AC-15 |
| T20285 | 28541-28542 | , | denotes | , |
| T20286 | 28543-28548 | NNP | denotes | A5441 |
| T20287 | 28548-28549 | -RRB- | denotes | ) |
| T20288 | 28549-28550 | , | denotes | , |
| T20289 | 28551-28555 | NNP | denotes | Flag |
| T20290 | 28556-28557 | -LRB- | denotes | ( |
| T20291 | 28557-28559 | NNP | denotes | M2 |
| T20292 | 28559-28560 | , | denotes | , |
| T20293 | 28561-28566 | NNP | denotes | F3165 |
| T20294 | 28566-28567 | -RRB- | denotes | ) |
| T20295 | 28567-28568 | , | denotes | , |
| T20296 | 28569-28571 | NNP | denotes | HA |
| T20297 | 28572-28573 | -LRB- | denotes | ( |
| T20298 | 28573-28577 | NNP | denotes | HA-7 |
| T20299 | 28577-28578 | , | denotes | , |
| T20300 | 28579-28584 | NNP | denotes | H3663 |
| T20301 | 28584-28585 | -RRB- | denotes | ) |
| T20302 | 28585-28586 | , | denotes | , |
| T20303 | 28587-28597 | JJ | denotes | importin-α |
| T20304 | 28598-28599 | -LRB- | denotes | ( |
| T20305 | 28599-28604 | NN | denotes | IM-75 |
| T20306 | 28604-28605 | , | denotes | , |
| T20307 | 28606-28611 | NNP | denotes | I1784 |
| T20308 | 28611-28612 | -RRB- | denotes | ) |
| T20309 | 28612-28613 | , | denotes | , |
| T20310 | 28614-28617 | CC | denotes | and |
| T20311 | 28618-28628 | JJ | denotes | importin-β |
| T20312 | 28629-28630 | -LRB- | denotes | ( |
| T20313 | 28630-28634 | NNP | denotes | 31H4 |
| T20314 | 28634-28635 | , | denotes | , |
| T20315 | 28636-28641 | NNP | denotes | I2534 |
| T20316 | 28641-28642 | -RRB- | denotes | ) |
| T20317 | 28643-28653 | NNS | denotes | antibodies |
| T20318 | 28654-28658 | VBD | denotes | were |
| T20319 | 28659-28663 | IN | denotes | from |
| T20320 | 28664-28669 | NNP | denotes | Sigma |
| T20321 | 28669-28670 | : | denotes | ; |
| T20322 | 28671-28675 | NNP | denotes | PARP |
| T20323 | 28676-28677 | -LRB- | denotes | ( |
| T20324 | 28677-28682 | NNP | denotes | C2-10 |
| T20325 | 28682-28683 | , | denotes | , |
| T20326 | 28684-28690 | CD | denotes | 556362 |
| T20327 | 28690-28691 | -RRB- | denotes | ) |
| T20328 | 28691-28692 | , | denotes | , |
| T20329 | 28693-28697 | NNP | denotes | IKKα |
| T20330 | 28698-28699 | -LRB- | denotes | ( |
| T20331 | 28699-28704 | NNP | denotes | B78-1 |
| T20332 | 28704-28705 | , | denotes | , |
| T20333 | 28706-28712 | CD | denotes | 556532 |
| T20334 | 28712-28713 | -RRB- | denotes | ) |
| T20335 | 28713-28714 | , | denotes | , |
| T20336 | 28715-28718 | CC | denotes | and |
| T20337 | 28719-28723 | NNP | denotes | IKKβ |
| T20338 | 28724-28725 | -LRB- | denotes | ( |
| T20339 | 28725-28727 | CD | denotes | 24 |
| T20340 | 28727-28728 | , | denotes | , |
| T20341 | 28729-28735 | CD | denotes | 611254 |
| T20342 | 28735-28736 | -RRB- | denotes | ) |
| T20343 | 28737-28747 | NNS | denotes | antibodies |
| T20344 | 28748-28752 | VBD | denotes | were |
| T20345 | 28753-28757 | IN | denotes | from |
| T20346 | 28758-28760 | NNP | denotes | BD |
| T20347 | 28761-28771 | NNP | denotes | Pharmingen |
| T20348 | 28771-28772 | : | denotes | ; |
| T20349 | 28773-28777 | NNP | denotes | CK2α |
| T20350 | 28778-28779 | -LRB- | denotes | ( |
| T20351 | 28779-28781 | CD | denotes | 31 |
| T20352 | 28781-28782 | , | denotes | , |
| T20353 | 28783-28789 | CD | denotes | 611610 |
| T20354 | 28789-28790 | -RRB- | denotes | ) |
| T20355 | 28791-28794 | CC | denotes | and |
| T20356 | 28795-28800 | NNP | denotes | Hsp90 |
| T20357 | 28801-28802 | -LRB- | denotes | ( |
| T20358 | 28802-28804 | CD | denotes | 68 |
| T20359 | 28804-28805 | , | denotes | , |
| T20360 | 28806-28812 | CD | denotes | 610418 |
| T20361 | 28812-28813 | -RRB- | denotes | ) |
| T20362 | 28814-28824 | NNS | denotes | antibodies |
| T20363 | 28825-28829 | VBD | denotes | were |
| T20364 | 28830-28834 | IN | denotes | from |
| T20365 | 28835-28837 | NNP | denotes | BD |
| T20366 | 28838-28850 | NNP | denotes | Transduction |
| T20367 | 28851-28863 | NNPS | denotes | Laboratories |
| T20368 | 28863-28864 | : | denotes | ; |
| T20369 | 28865-28877 | NNP | denotes | phospho-IκBα |
| T20370 | 28878-28879 | -LRB- | denotes | ( |
| T20371 | 28879-28882 | NNP | denotes | 5A5 |
| T20372 | 28882-28883 | , | denotes | , |
| T20373 | 28884-28889 | NNP | denotes | 9246S |
| T20374 | 28889-28890 | -RRB- | denotes | ) |
| T20375 | 28891-28894 | CC | denotes | and |
| T20376 | 28895-28907 | JJ | denotes | phospho-IKKα |
| T20377 | 28907-28908 | NN | denotes | / |
| T20378 | 28908-28909 | NN | denotes | β |
| T20379 | 28910-28911 | -LRB- | denotes | ( |
| T20380 | 28911-28915 | NNP | denotes | 16A6 |
| T20381 | 28915-28916 | , | denotes | , |
| T20382 | 28917-28922 | NNP | denotes | 2697S |
| T20383 | 28922-28923 | -RRB- | denotes | ) |
| T20384 | 28924-28934 | NNS | denotes | antibodies |
| T20385 | 28935-28939 | VBD | denotes | were |
| T20386 | 28940-28944 | IN | denotes | from |
| T20387 | 28945-28949 | NNP | denotes | Cell |
| T20388 | 28950-28959 | NNP | denotes | Signaling |
| T20389 | 28960-28970 | NNP | denotes | Technology |
| T20390 | 28970-28971 | : | denotes | ; |
| T20391 | 28972-28986 | NN | denotes | phospho-serine |
| T20392 | 28987-28988 | -LRB- | denotes | ( |
| T20393 | 28988-28994 | NNP | denotes | AB1603 |
| T20394 | 28994-28995 | -RRB- | denotes | ) |
| T20395 | 28996-28999 | CC | denotes | and |
| T20396 | 29000-29016 | JJ | denotes | phospho-tyrosine |
| T20397 | 29017-29018 | -LRB- | denotes | ( |
| T20398 | 29018-29022 | NNP | denotes | 4G10 |
| T20399 | 29022-29023 | , | denotes | , |
| T20400 | 29024-29030 | CD | denotes | 05-777 |
| T20401 | 29030-29031 | -RRB- | denotes | ) |
| T20402 | 29032-29042 | NNS | denotes | antibodies |
| T20403 | 29043-29047 | VBD | denotes | were |
| T20404 | 29048-29052 | IN | denotes | from |
| T20405 | 29053-29062 | NNP | denotes | Millipore |
| T20406 | 29062-29063 | . | denotes | . |
| T20407 | 29064-29067 | DT | denotes | The |
| T20408 | 29068-29074 | NN | denotes | rabbit |
| T20409 | 29075-29085 | NN | denotes | polyclonal |
| T20410 | 29086-29090 | NNP | denotes | RPS3 |
| T20411 | 29091-29100 | NN | denotes | antiserum |
| T20412 | 29101-29104 | VBD | denotes | was |
| T20413 | 29105-29107 | IN | denotes | as |
| T20414 | 29108-29117 | VBN | denotes | described |
| T20415 | 29118-29129 | NNS | denotes | previously6 |
| T20416 | 29129-29130 | . | denotes | . |
| T20417 | 29131-29134 | DT | denotes | The |
| T20418 | 29135-29141 | NN | denotes | rabbit |
| T20419 | 29142-29152 | NN | denotes | polyclonal |
| T20420 | 29153-29161 | NN | denotes | antibody |
| T20421 | 29162-29170 | NN | denotes | specific |
| T20422 | 29171-29174 | IN | denotes | for |
| T20423 | 29175-29179 | NNP | denotes | S209 |
| T20424 | 29180-29194 | VBD | denotes | phosphorylated |
| T20425 | 29195-29199 | CD | denotes | RPS3 |
| T20426 | 29200-29203 | VBD | denotes | was |
| T20427 | 29204-29213 | VBN | denotes | generated |
| T20428 | 29214-29217 | CC | denotes | and |
| T20429 | 29218-29226 | NN | denotes | affinity |
| T20430 | 29227-29235 | VBN | denotes | purified |
| T20431 | 29236-29238 | IN | denotes | by |
| T20432 | 29239-29244 | NNP | denotes | Primm |
| T20433 | 29245-29252 | NNP | denotes | Biotech |
| T20434 | 29253-29258 | VBG | denotes | using |
| T20435 | 29259-29262 | DT | denotes | the |
| T20436 | 29263-29270 | NN | denotes | peptide |
| T20437 | 29271-29283 | NN | denotes | NH2-CKPLPDHV |
| T20438 | 29283-29284 | -LRB- | denotes | ( |
| T20439 | 29284-29286 | NNP | denotes | Sp |
| T20440 | 29286-29287 | -RRB- | denotes | ) |
| T20441 | 29287-29295 | NNP | denotes | IVE-COOH |
| T20442 | 29295-29296 | . | denotes | . |
| T20635 | 29298-29305 | NNP | denotes | Plasmid |
| T20636 | 29306-29316 | NNP | denotes | Constructs |
| T20637 | 29317-29320 | NNP | denotes | The |
| T20638 | 29321-29330 | NNP | denotes | Flag-IKKβ |
| T20639 | 29331-29332 | -LRB- | denotes | ( |
| T20640 | 29332-29336 | NNP | denotes | SSEE |
| T20641 | 29336-29337 | -RRB- | denotes | ) |
| T20642 | 29337-29338 | , | denotes | , |
| T20643 | 29339-29348 | NNP | denotes | Flag-IKKβ |
| T20644 | 29349-29350 | -LRB- | denotes | ( |
| T20645 | 29350-29354 | NNP | denotes | SSAA |
| T20646 | 29354-29355 | -RRB- | denotes | ) |
| T20647 | 29355-29356 | , | denotes | , |
| T20648 | 29357-29360 | CC | denotes | and |
| T20649 | 29361-29368 | NNP | denotes | HA-IκBα |
| T20650 | 29369-29370 | -LRB- | denotes | ( |
| T20651 | 29370-29374 | NNP | denotes | SSAA |
| T20652 | 29374-29375 | -RRB- | denotes | ) |
| T20653 | 29376-29386 | NNS | denotes | constructs |
| T20654 | 29387-29391 | VBD | denotes | were |
| T20655 | 29392-29400 | VBN | denotes | provided |
| T20656 | 29401-29403 | IN | denotes | by |
| T20657 | 29404-29406 | NNP | denotes | C. |
| T20658 | 29407-29409 | NNP | denotes | Wu |
| T20659 | 29410-29411 | -LRB- | denotes | ( |
| T20660 | 29411-29414 | NNP | denotes | NCI |
| T20661 | 29414-29415 | , | denotes | , |
| T20662 | 29416-29424 | NNP | denotes | Bethesda |
| T20663 | 29424-29425 | -RRB- | denotes | ) |
| T20664 | 29426-29429 | CC | denotes | and |
| T20665 | 29430-29432 | NNP | denotes | U. |
| T20666 | 29433-29443 | NNP | denotes | Siebenlist |
| T20667 | 29444-29445 | -LRB- | denotes | ( |
| T20668 | 29445-29450 | NNP | denotes | NIAID |
| T20669 | 29450-29451 | , | denotes | , |
| T20670 | 29452-29460 | NNP | denotes | Bethesda |
| T20671 | 29460-29461 | -RRB- | denotes | ) |
| T20672 | 29461-29462 | , | denotes | , |
| T20673 | 29463-29475 | RB | denotes | respectively |
| T20674 | 29475-29476 | . | denotes | . |
| T20675 | 29477-29480 | DT | denotes | The |
| T20676 | 29481-29488 | NNP | denotes | HA-IκBα |
| T20677 | 29489-29492 | CC | denotes | and |
| T20678 | 29493-29497 | NNP | denotes | IKKβ |
| T20679 | 29498-29499 | -LRB- | denotes | ( |
| T20680 | 29499-29503 | NNP | denotes | K44A |
| T20681 | 29503-29504 | -RRB- | denotes | ) |
| T20682 | 29504-29505 | : | denotes | - |
| T20683 | 29505-29509 | NN | denotes | Flag |
| T20684 | 29510-29518 | NNS | denotes | plasmids |
| T20685 | 29519-29523 | VBD | denotes | were |
| T20686 | 29524-29533 | VBN | denotes | purchased |
| T20687 | 29534-29538 | IN | denotes | from |
| T20688 | 29539-29548 | NNP | denotes | Addgene44 |
| T20689 | 29548-29549 | , | denotes | , |
| T20690 | 29550-29552 | CD | denotes | 45 |
| T20691 | 29552-29553 | . | denotes | . |
| T20692 | 29554-29557 | DT | denotes | The |
| T20693 | 29558-29567 | NN | denotes | Flag-RPS3 |
| T20694 | 29567-29568 | , | denotes | , |
| T20695 | 29569-29577 | NNP | denotes | GST-RPS3 |
| T20696 | 29577-29578 | , | denotes | , |
| T20697 | 29579-29586 | NNP | denotes | HA-RPS3 |
| T20698 | 29586-29587 | , | denotes | , |
| T20699 | 29588-29593 | NNP | denotes | VN-HA |
| T20700 | 29593-29594 | , | denotes | , |
| T20701 | 29595-29603 | NNP | denotes | NleH1-HA |
| T20702 | 29604-29612 | NNS | denotes | plasmids |
| T20703 | 29613-29617 | VBD | denotes | were |
| T20704 | 29618-29627 | VBN | denotes | described |
| T20705 | 29628-29639 | CD | denotes | previously6 |
| T20706 | 29639-29640 | , | denotes | , |
| T20707 | 29641-29642 | CD | denotes | 9 |
| T20708 | 29642-29643 | . | denotes | . |
| T20709 | 29644-29647 | DT | denotes | The |
| T20710 | 29648-29653 | NN | denotes | point |
| T20711 | 29654-29661 | NNS | denotes | mutants |
| T20712 | 29662-29664 | IN | denotes | of |
| T20713 | 29665-29669 | CD | denotes | RPS3 |
| T20714 | 29670-29674 | VBD | denotes | were |
| T20715 | 29675-29684 | VBN | denotes | generated |
| T20716 | 29685-29687 | IN | denotes | by |
| T20717 | 29688-29701 | JJ | denotes | site-directed |
| T20718 | 29702-29713 | NNS | denotes | mutagenesis |
| T20719 | 29714-29719 | VBG | denotes | using |
| T20720 | 29720-29723 | DT | denotes | the |
| T20721 | 29724-29729 | NNP | denotes | Quick |
| T20722 | 29730-29736 | NNP | denotes | Change |
| T20723 | 29737-29740 | NNP | denotes | Kit |
| T20724 | 29741-29742 | -LRB- | denotes | ( |
| T20725 | 29742-29752 | NNP | denotes | Stratagene |
| T20726 | 29752-29753 | -RRB- | denotes | ) |
| T20727 | 29754-29758 | IN | denotes | with |
| T20728 | 29759-29766 | NNS | denotes | primers |
| T20729 | 29767-29774 | RB | denotes | forward |
| T20730 | 29775-29776 | CD | denotes | 5 |
| T20731 | 29776-29777 | SYM | denotes | ′ |
| T20732 | 29777-29778 | : | denotes | - |
| T20733 | 29778-29813 | NN | denotes | CTGCCTGACCACGTGGCCATTGTGGAACCCAAA-3 |
| T20734 | 29813-29814 | NN | denotes | ′ |
| T20735 | 29815-29818 | CC | denotes | and |
| T20736 | 29819-29826 | VB | denotes | reverse |
| T20737 | 29827-29828 | CD | denotes | 5 |
| T20738 | 29828-29829 | SYM | denotes | ′ |
| T20739 | 29829-29830 | : | denotes | - |
| T20740 | 29830-29865 | NN | denotes | TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3 |
| T20741 | 29865-29866 | NN | denotes | ′ |
| T20742 | 29867-29870 | IN | denotes | for |
| T20743 | 29871-29876 | NNP | denotes | S209A |
| T20744 | 29876-29877 | . | denotes | . |
| T20745 | 29878-29881 | DT | denotes | All |
| T20746 | 29882-29889 | NNS | denotes | mutants |
| T20747 | 29890-29894 | VBD | denotes | were |
| T20748 | 29895-29903 | VBN | denotes | verified |
| T20749 | 29904-29906 | IN | denotes | by |
| T20750 | 29907-29910 | NNP | denotes | DNA |
| T20751 | 29911-29921 | VBG | denotes | sequencing |
| T20752 | 29921-29922 | . | denotes | . |
| T20907 | 29924-29927 | CD | denotes | 32P |
| T20908 | 29928-29930 | IN | denotes | in |
| T20909 | 29931-29935 | NN | denotes | vivo |
| T20910 | 29936-29944 | VBG | denotes | Labeling |
| T20911 | 29945-29948 | NNP | denotes | HEK |
| T20912 | 29949-29953 | CD | denotes | 293T |
| T20913 | 29954-29959 | NNS | denotes | cells |
| T20914 | 29960-29964 | VBD | denotes | were |
| T20915 | 29965-29972 | VBN | denotes | labeled |
| T20916 | 29973-29977 | IN | denotes | with |
| T20917 | 29978-29979 | CD | denotes | 2 |
| T20918 | 29980-29986 | NNP | denotes | mCi/ml |
| T20919 | 29987-30005 | NNP | denotes | 32P-orthophosphate |
| T20920 | 30006-30007 | -LRB- | denotes | ( |
| T20921 | 30007-30013 | NNP | denotes | Perkin |
| T20922 | 30014-30019 | NNP | denotes | Elmer |
| T20923 | 30019-30020 | -RRB- | denotes | ) |
| T20924 | 30021-30023 | IN | denotes | in |
| T20925 | 30024-30038 | JJ | denotes | phosphate-free |
| T20926 | 30039-30045 | NN | denotes | medium |
| T20927 | 30046-30047 | -LRB- | denotes | ( |
| T20928 | 30047-30057 | NNP | denotes | Invitrogen |
| T20929 | 30057-30058 | -RRB- | denotes | ) |
| T20930 | 30059-30062 | IN | denotes | for |
| T20931 | 30063-30064 | CD | denotes | 2 |
| T20932 | 30065-30067 | NN | denotes | h. |
| T20933 | 30068-30073 | NNS | denotes | Cells |
| T20934 | 30074-30078 | VBD | denotes | were |
| T20935 | 30079-30083 | RB | denotes | then |
| T20936 | 30084-30088 | VBN | denotes | left |
| T20937 | 30089-30098 | JJ | denotes | untreated |
| T20938 | 30099-30101 | CC | denotes | or |
| T20939 | 30102-30109 | VBN | denotes | treated |
| T20940 | 30110-30114 | IN | denotes | with |
| T20941 | 30115-30118 | NNP | denotes | TNF |
| T20942 | 30119-30120 | -LRB- | denotes | ( |
| T20943 | 30120-30122 | CD | denotes | 50 |
| T20944 | 30123-30128 | NN | denotes | ng/ml |
| T20945 | 30128-30129 | , | denotes | , |
| T20946 | 30130-30133 | NNP | denotes | R&D |
| T20947 | 30134-30141 | NNPS | denotes | Systems |
| T20948 | 30141-30142 | -RRB- | denotes | ) |
| T20949 | 30143-30146 | IN | denotes | for |
| T20950 | 30147-30156 | VBN | denotes | indicated |
| T20951 | 30157-30164 | NNS | denotes | periods |
| T20952 | 30164-30165 | . | denotes | . |
| T20953 | 30166-30170 | NN | denotes | Cell |
| T20954 | 30171-30178 | NNS | denotes | lysates |
| T20955 | 30179-30183 | VBD | denotes | were |
| T20956 | 30184-30192 | VBN | denotes | prepared |
| T20957 | 30193-30196 | CC | denotes | and |
| T20958 | 30197-30201 | VBN | denotes | used |
| T20959 | 30202-30205 | IN | denotes | for |
| T20960 | 30206-30226 | NNS | denotes | immunoprecipitations |
| T20961 | 30227-30231 | IN | denotes | with |
| T20962 | 30232-30236 | JJ | denotes | RPS3 |
| T20963 | 30237-30245 | NN | denotes | antibody |
| T20964 | 30245-30246 | . | denotes | . |
| T21155 | 30248-30250 | IN | denotes | In |
| T21156 | 30251-30256 | NNP | denotes | Vitro |
| T21157 | 30257-30263 | NNP | denotes | Kinase |
| T21158 | 30264-30269 | NNP | denotes | Assay |
| T21159 | 30270-30283 | JJ | denotes | Kinase-active |
| T21160 | 30284-30295 | JJ | denotes | recombinant |
| T21161 | 30296-30300 | NNP | denotes | IKKβ |
| T21162 | 30301-30304 | CC | denotes | and |
| T21163 | 30305-30309 | NNP | denotes | IKKα |
| T21164 | 30310-30318 | NNS | denotes | proteins |
| T21165 | 30319-30323 | VBD | denotes | were |
| T21166 | 30324-30333 | VBN | denotes | purchased |
| T21167 | 30334-30338 | IN | denotes | from |
| T21168 | 30339-30345 | NNP | denotes | Active |
| T21169 | 30346-30351 | NNP | denotes | Motif |
| T21170 | 30352-30355 | CC | denotes | and |
| T21171 | 30356-30365 | NNP | denotes | Millipore |
| T21172 | 30365-30366 | , | denotes | , |
| T21173 | 30367-30379 | RB | denotes | respectively |
| T21174 | 30379-30380 | . | denotes | . |
| T21175 | 30381-30392 | RB | denotes | Bacterially |
| T21176 | 30393-30401 | VBN | denotes | purified |
| T21177 | 30402-30413 | NN | denotes | glutathione |
| T21178 | 30414-30427 | NN | denotes | S-transferase |
| T21179 | 30428-30429 | -LRB- | denotes | ( |
| T21180 | 30429-30432 | NNP | denotes | GST |
| T21181 | 30432-30433 | -RRB- | denotes | ) |
| T21182 | 30433-30434 | , | denotes | , |
| T21183 | 30435-30443 | NNP | denotes | GST-IκBα |
| T21184 | 30444-30445 | -LRB- | denotes | ( |
| T21185 | 30445-30449 | CD | denotes | 1-54 |
| T21186 | 30449-30450 | -RRB- | denotes | ) |
| T21187 | 30450-30451 | , | denotes | , |
| T21188 | 30452-30456 | JJ | denotes | wild |
| T21189 | 30457-30461 | NN | denotes | type |
| T21190 | 30461-30462 | , | denotes | , |
| T21191 | 30463-30469 | JJ | denotes | mutant |
| T21192 | 30470-30478 | NN | denotes | GST-RPS3 |
| T21193 | 30478-30479 | , | denotes | , |
| T21194 | 30480-30482 | CC | denotes | or |
| T21195 | 30483-30487 | CD | denotes | RPS3 |
| T21196 | 30488-30496 | NNS | denotes | proteins |
| T21197 | 30497-30501 | VBD | denotes | were |
| T21198 | 30502-30506 | VBN | denotes | used |
| T21199 | 30507-30509 | IN | denotes | as |
| T21200 | 30510-30520 | NNS | denotes | substrates |
| T21201 | 30520-30521 | . | denotes | . |
| T21202 | 30522-30525 | DT | denotes | The |
| T21203 | 30526-30528 | IN | denotes | in |
| T21204 | 30529-30534 | NN | denotes | vitro |
| T21205 | 30535-30541 | NN | denotes | kinase |
| T21206 | 30542-30547 | NN | denotes | assay |
| T21207 | 30548-30551 | VBD | denotes | was |
| T21208 | 30552-30561 | VBN | denotes | performed |
| T21209 | 30562-30564 | IN | denotes | as |
| T21210 | 30565-30575 | RB | denotes | previously |
| T21211 | 30576-30587 | CD | denotes | described29 |
| T21212 | 30587-30588 | . | denotes | . |
| T21213 | 30589-30596 | RB | denotes | Briefly |
| T21214 | 30596-30597 | , | denotes | , |
| T21215 | 30598-30604 | NN | denotes | enzyme |
| T21216 | 30605-30606 | -LRB- | denotes | ( |
| T21217 | 30606-30609 | CD | denotes | 100 |
| T21218 | 30610-30612 | NN | denotes | ng |
| T21219 | 30612-30613 | -RRB- | denotes | ) |
| T21220 | 30614-30617 | CC | denotes | and |
| T21221 | 30618-30627 | VB | denotes | substrate |
| T21222 | 30628-30629 | -LRB- | denotes | ( |
| T21223 | 30629-30630 | CD | denotes | 2 |
| T21224 | 30631-30633 | NN | denotes | μg |
| T21225 | 30633-30634 | -RRB- | denotes | ) |
| T21226 | 30635-30639 | VBD | denotes | were |
| T21227 | 30640-30652 | VBN | denotes | co-incubated |
| T21228 | 30653-30655 | IN | denotes | in |
| T21229 | 30656-30659 | NNP | denotes | IKK |
| T21230 | 30660-30668 | NN | denotes | reaction |
| T21231 | 30669-30675 | NN | denotes | buffer |
| T21232 | 30676-30677 | -LRB- | denotes | ( |
| T21233 | 30677-30679 | CD | denotes | 25 |
| T21234 | 30680-30682 | NNP | denotes | mM |
| T21235 | 30683-30687 | NNP | denotes | Tris |
| T21236 | 30688-30691 | NNP | denotes | HCl |
| T21237 | 30692-30693 | NNP | denotes | [ |
| T21238 | 30693-30695 | NNP | denotes | pH |
| T21239 | 30696-30699 | CD | denotes | 8.0 |
| T21240 | 30699-30700 | NNP | denotes | ] |
| T21241 | 30700-30701 | , | denotes | , |
| T21242 | 30702-30704 | CD | denotes | 50 |
| T21243 | 30705-30707 | NNP | denotes | mM |
| T21244 | 30708-30711 | NNP | denotes | KCl |
| T21245 | 30711-30712 | , | denotes | , |
| T21246 | 30713-30715 | CD | denotes | 10 |
| T21247 | 30716-30718 | NNP | denotes | mM |
| T21248 | 30719-30724 | NNP | denotes | MgCl2 |
| T21249 | 30724-30725 | , | denotes | , |
| T21250 | 30726-30727 | CD | denotes | 1 |
| T21251 | 30728-30730 | NNP | denotes | mM |
| T21252 | 30731-30734 | NNP | denotes | DTT |
| T21253 | 30734-30735 | , | denotes | , |
| T21254 | 30736-30737 | CD | denotes | 1 |
| T21255 | 30738-30740 | NNP | denotes | mM |
| T21256 | 30741-30747 | NNP | denotes | Na3VO4 |
| T21257 | 30747-30748 | , | denotes | , |
| T21258 | 30749-30750 | CD | denotes | 1 |
| T21259 | 30751-30753 | NNP | denotes | mM |
| T21260 | 30754-30757 | NNP | denotes | ATP |
| T21261 | 30757-30758 | -RRB- | denotes | ) |
| T21262 | 30759-30761 | CC | denotes | or |
| T21263 | 30762-30767 | JJ | denotes | NleH1 |
| T21264 | 30768-30776 | NN | denotes | reaction |
| T21265 | 30777-30783 | NN | denotes | buffer |
| T21266 | 30784-30785 | -LRB- | denotes | ( |
| T21267 | 30785-30787 | CD | denotes | 50 |
| T21268 | 30788-30790 | NNP | denotes | mM |
| T21269 | 30791-30799 | NNP | denotes | Tris-HCl |
| T21270 | 30800-30801 | NNP | denotes | [ |
| T21271 | 30801-30803 | NNP | denotes | pH |
| T21272 | 30804-30807 | CD | denotes | 7.6 |
| T21273 | 30807-30808 | NNP | denotes | ] |
| T21274 | 30808-30809 | , | denotes | , |
| T21275 | 30810-30811 | CD | denotes | 5 |
| T21276 | 30812-30814 | NNP | denotes | mM |
| T21277 | 30815-30820 | NNP | denotes | MgCl2 |
| T21278 | 30820-30821 | , | denotes | , |
| T21279 | 30822-30823 | CD | denotes | 1 |
| T21280 | 30824-30826 | NNP | denotes | mM |
| T21281 | 30827-30830 | NNP | denotes | DTT |
| T21282 | 30830-30831 | , | denotes | , |
| T21283 | 30832-30833 | CD | denotes | 1 |
| T21284 | 30834-30836 | NNP | denotes | mM |
| T21285 | 30837-30840 | NNP | denotes | ATP |
| T21286 | 30840-30841 | -RRB- | denotes | ) |
| T21287 | 30842-30846 | IN | denotes | with |
| T21288 | 30847-30850 | CD | denotes | 0.5 |
| T21289 | 30851-30854 | NNP | denotes | μCi |
| T21290 | 30855-30864 | NNP | denotes | 32P-γ-ATP |
| T21291 | 30865-30866 | -LRB- | denotes | ( |
| T21292 | 30866-30868 | NNP | denotes | GE |
| T21293 | 30869-30879 | NNP | denotes | Healthcare |
| T21294 | 30879-30880 | -RRB- | denotes | ) |
| T21295 | 30881-30886 | VBD | denotes | added |
| T21296 | 30887-30889 | IN | denotes | at |
| T21297 | 30890-30892 | CD | denotes | 37 |
| T21298 | 30893-30894 | CD | denotes | ° |
| T21299 | 30894-30895 | NNP | denotes | C |
| T21300 | 30896-30899 | IN | denotes | for |
| T21301 | 30900-30902 | CD | denotes | 30 |
| T21302 | 30903-30906 | NN | denotes | min |
| T21303 | 30906-30907 | . | denotes | . |
| T21304 | 30908-30911 | DT | denotes | The |
| T21305 | 30912-30921 | NNS | denotes | reactions |
| T21306 | 30922-30926 | VBD | denotes | were |
| T21307 | 30927-30935 | VBN | denotes | resolved |
| T21308 | 30936-30938 | IN | denotes | by |
| T21309 | 30939-30942 | NNP | denotes | SDS |
| T21310 | 30943-30947 | NNP | denotes | PAGE |
| T21311 | 30948-30951 | CC | denotes | and |
| T21312 | 30952-30962 | VBN | denotes | visualized |
| T21313 | 30963-30965 | IN | denotes | by |
| T21314 | 30966-30981 | NN | denotes | autoradiography |
| T21315 | 30981-30982 | . | denotes | . |
| T21440 | 30984-30992 | NNP | denotes | LC-MS/MS |
| T21441 | 30993-31001 | NNP | denotes | Analysis |
| T21442 | 31002-31005 | NNP | denotes | GST |
| T21443 | 31006-31008 | CC | denotes | or |
| T21444 | 31009-31017 | NNP | denotes | GST-RPS3 |
| T21445 | 31018-31021 | VBD | denotes | was |
| T21446 | 31022-31031 | VBN | denotes | incubated |
| T21447 | 31032-31036 | IN | denotes | with |
| T21448 | 31037-31048 | JJ | denotes | recombinant |
| T21449 | 31049-31053 | NNP | denotes | IKKβ |
| T21450 | 31054-31061 | NN | denotes | protein |
| T21451 | 31062-31064 | IN | denotes | as |
| T21452 | 31065-31074 | VBN | denotes | described |
| T21453 | 31075-31080 | IN | denotes | above |
| T21454 | 31081-31083 | IN | denotes | in |
| T21455 | 31084-31086 | DT | denotes | an |
| T21456 | 31087-31089 | IN | denotes | in |
| T21457 | 31090-31095 | NN | denotes | vitro |
| T21458 | 31096-31102 | NN | denotes | kinase |
| T21459 | 31103-31108 | NN | denotes | assay |
| T21460 | 31109-31117 | NN | denotes | reaction |
| T21461 | 31118-31127 | VBN | denotes | conducted |
| T21462 | 31128-31135 | IN | denotes | without |
| T21463 | 31136-31145 | NNP | denotes | 32P-γ-ATP |
| T21464 | 31146-31154 | VBG | denotes | labeling |
| T21465 | 31154-31155 | . | denotes | . |
| T21466 | 31156-31159 | DT | denotes | The |
| T21467 | 31160-31168 | NN | denotes | reaction |
| T21468 | 31169-31172 | VBD | denotes | was |
| T21469 | 31173-31182 | VBN | denotes | separated |
| T21470 | 31183-31185 | IN | denotes | by |
| T21471 | 31186-31194 | NNP | denotes | SDS-PAGE |
| T21472 | 31194-31195 | , | denotes | , |
| T21473 | 31196-31199 | CC | denotes | and |
| T21474 | 31200-31203 | DT | denotes | the |
| T21475 | 31204-31211 | NN | denotes | protein |
| T21476 | 31212-31215 | NN | denotes | gel |
| T21477 | 31216-31219 | VBD | denotes | was |
| T21478 | 31220-31227 | VBN | denotes | stained |
| T21479 | 31228-31232 | IN | denotes | with |
| T21480 | 31233-31242 | NNP | denotes | Colloidal |
| T21481 | 31243-31247 | NNP | denotes | Blue |
| T21482 | 31248-31249 | -LRB- | denotes | ( |
| T21483 | 31249-31259 | NNP | denotes | Invitrogen |
| T21484 | 31259-31260 | -RRB- | denotes | ) |
| T21485 | 31260-31261 | . | denotes | . |
| T21486 | 31262-31265 | DT | denotes | The |
| T21487 | 31266-31279 | JJ | denotes | corresponding |
| T21488 | 31280-31287 | NN | denotes | protein |
| T21489 | 31288-31297 | NNS | denotes | fragments |
| T21490 | 31298-31302 | VBD | denotes | were |
| T21491 | 31303-31310 | VBN | denotes | excised |
| T21492 | 31311-31314 | CC | denotes | and |
| T21493 | 31315-31324 | VBN | denotes | subjected |
| T21494 | 31325-31327 | TO | denotes | to |
| T21495 | 31328-31335 | VB | denotes | trypsin |
| T21496 | 31336-31345 | NN | denotes | digestion |
| T21497 | 31346-31349 | CC | denotes | and |
| T21498 | 31350-31358 | NN | denotes | LC-MS/MS |
| T21499 | 31359-31361 | IN | denotes | at |
| T21500 | 31362-31365 | DT | denotes | the |
| T21501 | 31366-31370 | NNP | denotes | Yale |
| T21502 | 31371-31377 | NNP | denotes | Cancer |
| T21503 | 31378-31384 | NNP | denotes | Center |
| T21504 | 31385-31389 | NNP | denotes | Mass |
| T21505 | 31390-31402 | NNP | denotes | Spectrometry |
| T21506 | 31403-31411 | NNP | denotes | Resource |
| T21507 | 31412-31413 | -LRB- | denotes | ( |
| T21508 | 31413-31416 | NNP | denotes | New |
| T21509 | 31417-31422 | NNP | denotes | Haven |
| T21510 | 31422-31423 | , | denotes | , |
| T21511 | 31424-31426 | NNP | denotes | CT |
| T21512 | 31426-31427 | -RRB- | denotes | ) |
| T21513 | 31427-31428 | . | denotes | . |
| T21602 | 31430-31434 | NNS | denotes | RNAi |
| T21603 | 31435-31438 | CC | denotes | and |
| T21604 | 31439-31451 | NNP | denotes | Transfection |
| T21605 | 31452-31455 | DT | denotes | The |
| T21606 | 31456-31461 | NNP | denotes | siRNA |
| T21607 | 31462-31463 | -LRB- | denotes | ( |
| T21608 | 31463-31475 | JJ | denotes | sense-strand |
| T21609 | 31476-31484 | NN | denotes | sequence |
| T21610 | 31484-31485 | -RRB- | denotes | ) |
| T21611 | 31486-31490 | NNP | denotes | IKKα |
| T21612 | 31490-31491 | , | denotes | , |
| T21613 | 31492-31493 | CD | denotes | 5 |
| T21614 | 31493-31494 | SYM | denotes | ′ |
| T21615 | 31494-31495 | : | denotes | - |
| T21616 | 31495-31520 | NNP | denotes | AUGACAGAGAAUGAUCAUGUUCUGC |
| T21617 | 31521-31523 | CD | denotes | -3 |
| T21618 | 31523-31524 | NN | denotes | ′ |
| T21619 | 31524-31525 | : | denotes | ; |
| T21620 | 31526-31530 | NNP | denotes | IKKβ |
| T21621 | 31530-31531 | , | denotes | , |
| T21622 | 31532-31533 | CD | denotes | 5 |
| T21623 | 31533-31534 | SYM | denotes | ′ |
| T21624 | 31534-31535 | : | denotes | - |
| T21625 | 31535-31560 | NNP | denotes | GCAGCAAGGAGAACAGAGGUUAAUA |
| T21626 | 31561-31563 | CD | denotes | -3 |
| T21627 | 31563-31564 | NN | denotes | ′ |
| T21628 | 31564-31565 | : | denotes | ; |
| T21629 | 31566-31570 | NNP | denotes | IκBα |
| T21630 | 31570-31571 | , | denotes | , |
| T21631 | 31572-31573 | CD | denotes | 5 |
| T21632 | 31573-31574 | SYM | denotes | ′ |
| T21633 | 31574-31575 | : | denotes | - |
| T21634 | 31575-31600 | NNP | denotes | GAGCUCCGAGACUUUCGAGGAAAUA |
| T21635 | 31601-31603 | CD | denotes | -3 |
| T21636 | 31603-31604 | NN | denotes | ′ |
| T21637 | 31604-31605 | : | denotes | ; |
| T21638 | 31606-31612 | NNP | denotes | RPS3-3 |
| T21639 | 31612-31613 | NNP | denotes | ′ |
| T21640 | 31614-31617 | NNP | denotes | UTR |
| T21641 | 31617-31618 | , | denotes | , |
| T21642 | 31619-31620 | CD | denotes | 5 |
| T21643 | 31620-31621 | SYM | denotes | ′ |
| T21644 | 31621-31622 | : | denotes | - |
| T21645 | 31622-31643 | NNP | denotes | GGAUGUUGCUCUCUAAAGACC |
| T21646 | 31644-31646 | CD | denotes | -3 |
| T21647 | 31646-31647 | NN | denotes | ′ |
| T21648 | 31648-31649 | -LRB- | denotes | ( |
| T21649 | 31649-31659 | NNP | denotes | Invitrogen |
| T21650 | 31659-31660 | -RRB- | denotes | ) |
| T21651 | 31660-31661 | . | denotes | . |
| T21652 | 31662-31671 | JJ | denotes | Transient |
| T21653 | 31672-31684 | NN | denotes | transfection |
| T21654 | 31685-31687 | IN | denotes | of |
| T21655 | 31688-31693 | NNP | denotes | siRNA |
| T21656 | 31694-31697 | CC | denotes | and |
| T21657 | 31698-31701 | NNP | denotes | DNA |
| T21658 | 31702-31712 | VBZ | denotes | constructs |
| T21659 | 31713-31717 | IN | denotes | into |
| T21660 | 31718-31724 | NNP | denotes | Jurkat |
| T21661 | 31725-31730 | NNS | denotes | cells |
| T21662 | 31731-31734 | CC | denotes | and |
| T21663 | 31735-31739 | JJ | denotes | 293T |
| T21664 | 31740-31745 | NNS | denotes | cells |
| T21665 | 31746-31749 | VBD | denotes | was |
| T21666 | 31750-31759 | VBN | denotes | described |
| T21667 | 31760-31771 | CD | denotes | previously6 |
| T21668 | 31771-31772 | . | denotes | . |
| T21863 | 31774-31785 | NNP | denotes | Subcellular |
| T21864 | 31786-31799 | NNP | denotes | Fractionation |
| T21865 | 31800-31811 | NNP | denotes | Subcellular |
| T21866 | 31812-31825 | NN | denotes | fractionation |
| T21867 | 31826-31829 | VBD | denotes | was |
| T21868 | 31830-31839 | VBN | denotes | performed |
| T21869 | 31840-31842 | IN | denotes | by |
| T21870 | 31843-31855 | JJ | denotes | differential |
| T21871 | 31856-31870 | NN | denotes | centrifugation |
| T21872 | 31871-31873 | IN | denotes | as |
| T21873 | 31874-31884 | RB | denotes | previously |
| T21874 | 31885-31895 | CD | denotes | described6 |
| T21875 | 31895-31896 | . | denotes | . |
| T21876 | 31897-31904 | RB | denotes | Briefly |
| T21877 | 31904-31905 | , | denotes | , |
| T21878 | 31906-31911 | NNS | denotes | cells |
| T21879 | 31912-31916 | VBD | denotes | were |
| T21880 | 31917-31928 | VBN | denotes | resuspended |
| T21881 | 31929-31931 | IN | denotes | in |
| T21882 | 31932-31940 | JJ | denotes | ice-cold |
| T21883 | 31941-31947 | NNP | denotes | Buffer |
| T21884 | 31948-31949 | NNP | denotes | A |
| T21885 | 31950-31951 | -LRB- | denotes | ( |
| T21886 | 31951-31953 | CD | denotes | 10 |
| T21887 | 31954-31956 | NNP | denotes | mM |
| T21888 | 31957-31962 | NNP | denotes | HEPES |
| T21889 | 31963-31965 | NNP | denotes | pH |
| T21890 | 31966-31969 | CD | denotes | 7.9 |
| T21891 | 31969-31970 | , | denotes | , |
| T21892 | 31971-31973 | CD | denotes | 10 |
| T21893 | 31974-31976 | NNP | denotes | mM |
| T21894 | 31977-31980 | NNP | denotes | KCl |
| T21895 | 31980-31981 | , | denotes | , |
| T21896 | 31982-31985 | CD | denotes | 1.5 |
| T21897 | 31986-31988 | NNP | denotes | mM |
| T21898 | 31989-31994 | NNP | denotes | MgCl2 |
| T21899 | 31994-31995 | , | denotes | , |
| T21900 | 31996-31999 | CD | denotes | 0.1 |
| T21901 | 32000-32002 | NNP | denotes | mM |
| T21902 | 32003-32007 | NNP | denotes | EDTA |
| T21903 | 32007-32008 | , | denotes | , |
| T21904 | 32009-32012 | CD | denotes | 0.5 |
| T21905 | 32013-32015 | NNP | denotes | mM |
| T21906 | 32016-32019 | NNP | denotes | DTT |
| T21907 | 32019-32020 | , | denotes | , |
| T21908 | 32021-32024 | CD | denotes | 0.4 |
| T21909 | 32025-32026 | NN | denotes | % |
| T21910 | 32027-32032 | NN | denotes | NP-40 |
| T21911 | 32032-32033 | , | denotes | , |
| T21912 | 32034-32037 | CD | denotes | 0.5 |
| T21913 | 32038-32040 | NNP | denotes | mM |
| T21914 | 32041-32045 | NNP | denotes | PMSF |
| T21915 | 32045-32046 | , | denotes | , |
| T21916 | 32047-32055 | JJ | denotes | complete |
| T21917 | 32056-32064 | NN | denotes | protease |
| T21918 | 32065-32074 | NN | denotes | inhibitor |
| T21919 | 32075-32083 | NN | denotes | cocktail |
| T21920 | 32083-32084 | -RRB- | denotes | ) |
| T21921 | 32085-32087 | IN | denotes | at |
| T21922 | 32088-32089 | CD | denotes | 4 |
| T21923 | 32090-32091 | CD | denotes | ° |
| T21924 | 32091-32092 | NNP | denotes | C |
| T21925 | 32093-32096 | IN | denotes | for |
| T21926 | 32097-32098 | CD | denotes | 5 |
| T21927 | 32099-32102 | NN | denotes | min |
| T21928 | 32102-32103 | . | denotes | . |
| T21929 | 32104-32111 | NNS | denotes | Lysates |
| T21930 | 32112-32116 | VBD | denotes | were |
| T21931 | 32117-32128 | VBN | denotes | centrifuged |
| T21932 | 32129-32131 | IN | denotes | at |
| T21933 | 32132-32133 | CD | denotes | 4 |
| T21934 | 32134-32135 | CD | denotes | ° |
| T21935 | 32135-32136 | NNP | denotes | C |
| T21936 | 32136-32137 | , | denotes | , |
| T21937 | 32138-32141 | CD | denotes | 500 |
| T21938 | 32142-32143 | NN | denotes | × |
| T21939 | 32144-32145 | NN | denotes | g |
| T21940 | 32146-32149 | IN | denotes | for |
| T21941 | 32150-32151 | CD | denotes | 3 |
| T21942 | 32152-32155 | NN | denotes | min |
| T21943 | 32155-32156 | , | denotes | , |
| T21944 | 32157-32160 | CC | denotes | and |
| T21945 | 32161-32173 | NNS | denotes | supernatants |
| T21946 | 32174-32178 | VBD | denotes | were |
| T21947 | 32179-32188 | VBN | denotes | collected |
| T21948 | 32189-32191 | RB | denotes | as |
| T21949 | 32192-32201 | JJ | denotes | cytosolic |
| T21950 | 32202-32211 | NNS | denotes | fractions |
| T21951 | 32211-32212 | . | denotes | . |
| T21952 | 32213-32220 | NNS | denotes | Pellets |
| T21953 | 32221-32225 | VBD | denotes | were |
| T21954 | 32226-32235 | VBN | denotes | incubated |
| T21955 | 32236-32238 | IN | denotes | in |
| T21956 | 32239-32245 | NNP | denotes | Buffer |
| T21957 | 32246-32247 | NNP | denotes | C |
| T21958 | 32248-32249 | -LRB- | denotes | ( |
| T21959 | 32249-32251 | CD | denotes | 20 |
| T21960 | 32252-32254 | NNP | denotes | mM |
| T21961 | 32255-32260 | NNP | denotes | HEPES |
| T21962 | 32261-32264 | NNP | denotes | pH7 |
| T21963 | 32264-32266 | CD | denotes | .9 |
| T21964 | 32266-32267 | , | denotes | , |
| T21965 | 32268-32271 | CD | denotes | 420 |
| T21966 | 32272-32274 | NNP | denotes | mM |
| T21967 | 32275-32279 | NNP | denotes | NaCl |
| T21968 | 32279-32280 | , | denotes | , |
| T21969 | 32281-32284 | CD | denotes | 1.5 |
| T21970 | 32285-32287 | NNP | denotes | mM |
| T21971 | 32288-32293 | NNP | denotes | MgCl2 |
| T21972 | 32293-32294 | , | denotes | , |
| T21973 | 32295-32297 | CD | denotes | 25 |
| T21974 | 32297-32298 | NN | denotes | % |
| T21975 | 32299-32307 | NN | denotes | glycerol |
| T21976 | 32307-32308 | , | denotes | , |
| T21977 | 32309-32312 | CD | denotes | 0.5 |
| T21978 | 32313-32315 | NNP | denotes | mM |
| T21979 | 32316-32320 | NNP | denotes | PMSF |
| T21980 | 32320-32321 | , | denotes | , |
| T21981 | 32322-32325 | CD | denotes | 0.2 |
| T21982 | 32326-32328 | NNP | denotes | mM |
| T21983 | 32329-32333 | NNP | denotes | EDTA |
| T21984 | 32333-32334 | , | denotes | , |
| T21985 | 32335-32338 | CD | denotes | 0.5 |
| T21986 | 32339-32341 | NNP | denotes | mM |
| T21987 | 32342-32345 | NNP | denotes | DTT |
| T21988 | 32345-32346 | , | denotes | , |
| T21989 | 32347-32355 | JJ | denotes | complete |
| T21990 | 32356-32364 | NN | denotes | protease |
| T21991 | 32365-32374 | NN | denotes | inhibitor |
| T21992 | 32375-32383 | NN | denotes | cocktail |
| T21993 | 32383-32384 | -RRB- | denotes | ) |
| T21994 | 32385-32387 | IN | denotes | at |
| T21995 | 32388-32389 | CD | denotes | 4 |
| T21996 | 32390-32391 | CD | denotes | ° |
| T21997 | 32391-32392 | NNP | denotes | C |
| T21998 | 32393-32396 | IN | denotes | for |
| T21999 | 32397-32399 | CD | denotes | 10 |
| T22000 | 32400-32403 | NN | denotes | min |
| T22001 | 32403-32404 | . | denotes | . |
| T22002 | 32405-32417 | NNS | denotes | Supernatants |
| T22003 | 32418-32422 | VBD | denotes | were |
| T22004 | 32423-32432 | VBN | denotes | collected |
| T22005 | 32433-32435 | IN | denotes | as |
| T22006 | 32436-32443 | JJ | denotes | nuclear |
| T22007 | 32444-32453 | NNS | denotes | fractions |
| T22008 | 32454-32463 | VBG | denotes | following |
| T22009 | 32464-32465 | DT | denotes | a |
| T22010 | 32466-32476 | NN | denotes | centrifuge |
| T22011 | 32477-32479 | IN | denotes | at |
| T22012 | 32480-32481 | CD | denotes | 4 |
| T22013 | 32482-32483 | CD | denotes | ° |
| T22014 | 32483-32484 | NNP | denotes | C |
| T22015 | 32484-32485 | , | denotes | , |
| T22016 | 32486-32492 | CD | denotes | 13,800 |
| T22017 | 32493-32494 | NN | denotes | × |
| T22018 | 32495-32496 | NN | denotes | g |
| T22019 | 32497-32500 | IN | denotes | for |
| T22020 | 32501-32503 | CD | denotes | 10 |
| T22021 | 32504-32507 | NN | denotes | min |
| T22022 | 32507-32508 | . | denotes | . |
| T22111 | 32510-32520 | NNP | denotes | Luciferase |
| T22112 | 32521-32529 | NNP | denotes | Reporter |
| T22113 | 32530-32534 | NNP | denotes | Gene |
| T22114 | 32535-32541 | NNP | denotes | Assays |
| T22115 | 32542-32552 | NNP | denotes | Luciferase |
| T22116 | 32553-32561 | NN | denotes | reporter |
| T22117 | 32562-32566 | NN | denotes | gene |
| T22118 | 32567-32573 | NNS | denotes | assays |
| T22119 | 32574-32578 | VBD | denotes | were |
| T22120 | 32579-32588 | VBN | denotes | performed |
| T22121 | 32589-32591 | IN | denotes | as |
| T22122 | 32592-32602 | RB | denotes | previously |
| T22123 | 32603-32613 | CD | denotes | described6 |
| T22124 | 32613-32614 | . | denotes | . |
| T22125 | 32615-32622 | RB | denotes | Briefly |
| T22126 | 32622-32623 | , | denotes | , |
| T22127 | 32624-32629 | NNS | denotes | cells |
| T22128 | 32630-32634 | VBD | denotes | were |
| T22129 | 32635-32648 | VBN | denotes | cotransfected |
| T22130 | 32649-32651 | IN | denotes | at |
| T22131 | 32652-32653 | DT | denotes | a |
| T22132 | 32654-32659 | NN | denotes | ratio |
| T22133 | 32660-32662 | IN | denotes | of |
| T22134 | 32663-32667 | CD | denotes | 10:1 |
| T22135 | 32668-32672 | IN | denotes | with |
| T22136 | 32673-32680 | JJ | denotes | various |
| T22137 | 32681-32696 | JJ | denotes | promoter-driven |
| T22138 | 32697-32704 | RB | denotes | firefly |
| T22139 | 32705-32715 | JJ | denotes | luciferase |
| T22140 | 32716-32726 | NNS | denotes | constructs |
| T22141 | 32727-32729 | TO | denotes | to |
| T22142 | 32730-32733 | DT | denotes | the |
| T22143 | 32734-32741 | NNP | denotes | Renilla |
| T22144 | 32742-32752 | NN | denotes | luciferase |
| T22145 | 32753-32758 | NNP | denotes | pTKRL |
| T22146 | 32759-32766 | NN | denotes | plasmid |
| T22147 | 32766-32767 | , | denotes | , |
| T22148 | 32768-32776 | RB | denotes | together |
| T22149 | 32777-32781 | IN | denotes | with |
| T22150 | 32782-32791 | JJ | denotes | indicated |
| T22151 | 32792-32800 | NNS | denotes | plasmids |
| T22152 | 32800-32801 | . | denotes | . |
| T22153 | 32802-32807 | NNS | denotes | Cells |
| T22154 | 32808-32812 | VBD | denotes | were |
| T22155 | 32813-32821 | VBN | denotes | cultured |
| T22156 | 32822-32825 | IN | denotes | for |
| T22157 | 32826-32827 | CD | denotes | 1 |
| T22158 | 32828-32829 | CD | denotes | 2 |
| T22159 | 32830-32834 | NNS | denotes | days |
| T22160 | 32835-32838 | CC | denotes | and |
| T22161 | 32839-32843 | RB | denotes | then |
| T22162 | 32844-32854 | VBD | denotes | stimulated |
| T22163 | 32855-32857 | IN | denotes | in |
| T22164 | 32858-32868 | NN | denotes | triplicate |
| T22165 | 32869-32875 | IN | denotes | before |
| T22166 | 32876-32883 | NN | denotes | harvest |
| T22167 | 32883-32884 | . | denotes | . |
| T22168 | 32885-32892 | NNS | denotes | Lysates |
| T22169 | 32893-32897 | VBD | denotes | were |
| T22170 | 32898-32906 | VBN | denotes | analyzed |
| T22171 | 32907-32912 | VBG | denotes | using |
| T22172 | 32913-32916 | DT | denotes | the |
| T22173 | 32917-32932 | NNP | denotes | Dual-Luciferase |
| T22174 | 32933-32936 | NNP | denotes | Kit |
| T22175 | 32937-32938 | -LRB- | denotes | ( |
| T22176 | 32938-32945 | NNP | denotes | Promega |
| T22177 | 32945-32946 | -RRB- | denotes | ) |
| T22178 | 32946-32947 | . | denotes | . |
| T22257 | 32949-32958 | NNP | denotes | Chromatin |
| T22258 | 32959-32978 | NNP | denotes | Immunoprecipitation |
| T22259 | 32979-32980 | -LRB- | denotes | ( |
| T22260 | 32980-32984 | NNP | denotes | ChIP |
| T22261 | 32984-32985 | -RRB- | denotes | ) |
| T22262 | 32986-32990 | NNP | denotes | ChIP |
| T22263 | 32991-32997 | NNS | denotes | assays |
| T22264 | 32998-33001 | VBD | denotes | was |
| T22265 | 33002-33011 | VBN | denotes | performed |
| T22266 | 33012-33014 | IN | denotes | as |
| T22267 | 33015-33025 | RB | denotes | previously |
| T22268 | 33026-33036 | CD | denotes | described6 |
| T22269 | 33036-33037 | . | denotes | . |
| T22270 | 33038-33041 | DT | denotes | The |
| T22271 | 33042-33049 | NNS | denotes | primers |
| T22272 | 33050-33054 | VBN | denotes | used |
| T22273 | 33055-33057 | TO | denotes | to |
| T22274 | 33058-33065 | VB | denotes | amplify |
| T22275 | 33066-33069 | DT | denotes | the |
| T22276 | 33070-33078 | NN | denotes | promoter |
| T22277 | 33079-33085 | NN | denotes | region |
| T22278 | 33086-33094 | JJ | denotes | adjacent |
| T22279 | 33095-33097 | TO | denotes | to |
| T22280 | 33098-33101 | DT | denotes | the |
| T22281 | 33102-33104 | NN | denotes | κB |
| T22282 | 33105-33110 | NNS | denotes | sites |
| T22283 | 33111-33113 | IN | denotes | of |
| T22284 | 33114-33117 | CD | denotes | IL8 |
| T22285 | 33118-33121 | CC | denotes | and |
| T22286 | 33122-33128 | NNP | denotes | NFKBIA |
| T22287 | 33128-33129 | , | denotes | , |
| T22288 | 33130-33132 | RB | denotes | as |
| T22289 | 33133-33137 | RB | denotes | well |
| T22290 | 33138-33140 | IN | denotes | as |
| T22291 | 33141-33145 | NNP | denotes | ACTB |
| T22292 | 33146-33150 | VBP | denotes | have |
| T22293 | 33151-33155 | VBN | denotes | been |
| T22294 | 33156-33166 | JJ | denotes | described6 |
| T22295 | 33166-33167 | . | denotes | . |
| T22423 | 33169-33187 | NNP | denotes | Immunofluorescence |
| T22424 | 33188-33198 | NNP | denotes | Microscopy |
| T22425 | 33199-33207 | NNP | denotes | Confocal |
| T22426 | 33208-33218 | NN | denotes | microscopy |
| T22427 | 33219-33222 | VBD | denotes | was |
| T22428 | 33223-33232 | VBN | denotes | performed |
| T22429 | 33233-33235 | IN | denotes | as |
| T22430 | 33236-33246 | RB | denotes | previously |
| T22431 | 33247-33257 | CD | denotes | described6 |
| T22432 | 33257-33258 | . | denotes | . |
| T22433 | 33259-33266 | RB | denotes | Briefly |
| T22434 | 33266-33267 | , | denotes | , |
| T22435 | 33268-33273 | NNS | denotes | cells |
| T22436 | 33274-33278 | VBD | denotes | were |
| T22437 | 33279-33284 | VBN | denotes | fixed |
| T22438 | 33285-33289 | IN | denotes | with |
| T22439 | 33290-33291 | CD | denotes | 4 |
| T22440 | 33292-33293 | NN | denotes | % |
| T22441 | 33294-33310 | NN | denotes | paraformaldehyde |
| T22442 | 33311-33313 | IN | denotes | in |
| T22443 | 33314-33317 | NNP | denotes | PBS |
| T22444 | 33318-33321 | CC | denotes | and |
| T22445 | 33322-33326 | RB | denotes | then |
| T22446 | 33327-33335 | NNP | denotes | Cellspin |
| T22447 | 33336-33343 | VBD | denotes | mounted |
| T22448 | 33344-33348 | IN | denotes | onto |
| T22449 | 33349-33355 | NNS | denotes | slides |
| T22450 | 33355-33356 | . | denotes | . |
| T22451 | 33357-33360 | DT | denotes | The |
| T22452 | 33361-33366 | JJ | denotes | fixed |
| T22453 | 33367-33372 | NNS | denotes | cells |
| T22454 | 33373-33377 | VBD | denotes | were |
| T22455 | 33378-33382 | RB | denotes | then |
| T22456 | 33383-33396 | VBN | denotes | permeabilized |
| T22457 | 33397-33401 | IN | denotes | with |
| T22458 | 33402-33406 | CD | denotes | 0.05 |
| T22459 | 33407-33408 | NN | denotes | % |
| T22460 | 33409-33415 | NNP | denotes | Triton |
| T22461 | 33416-33421 | NNP | denotes | X-100 |
| T22462 | 33422-33424 | IN | denotes | in |
| T22463 | 33425-33428 | NNP | denotes | PBS |
| T22464 | 33429-33432 | CC | denotes | and |
| T22465 | 33433-33440 | VBN | denotes | stained |
| T22466 | 33441-33445 | IN | denotes | with |
| T22467 | 33446-33461 | JJ | denotes | FITC-conjugated |
| T22468 | 33462-33468 | NN | denotes | rabbit |
| T22469 | 33469-33478 | JJ | denotes | anti-RPS3 |
| T22470 | 33479-33489 | NNS | denotes | antibodies |
| T22471 | 33490-33491 | -LRB- | denotes | ( |
| T22472 | 33491-33496 | NNP | denotes | Primm |
| T22473 | 33497-33504 | NNP | denotes | Biotech |
| T22474 | 33504-33505 | -RRB- | denotes | ) |
| T22475 | 33505-33506 | , | denotes | , |
| T22476 | 33507-33509 | CC | denotes | or |
| T22477 | 33510-33520 | NNP | denotes | AlexaFluor |
| T22478 | 33521-33535 | JJ | denotes | 594-conjugated |
| T22479 | 33536-33539 | NN | denotes | rat |
| T22480 | 33540-33549 | JJ | denotes | anti-Flag |
| T22481 | 33550-33560 | NNS | denotes | antibodies |
| T22482 | 33561-33562 | -LRB- | denotes | ( |
| T22483 | 33562-33564 | NNP | denotes | BD |
| T22484 | 33564-33565 | -RRB- | denotes | ) |
| T22485 | 33566-33569 | IN | denotes | for |
| T22486 | 33570-33572 | CD | denotes | 40 |
| T22487 | 33573-33576 | NN | denotes | min |
| T22488 | 33577-33585 | RB | denotes | together |
| T22489 | 33586-33590 | IN | denotes | with |
| T22490 | 33591-33592 | CD | denotes | 1 |
| T22491 | 33593-33595 | NN | denotes | μg |
| T22492 | 33595-33596 | NN | denotes | / |
| T22493 | 33596-33598 | NN | denotes | ml |
| T22494 | 33599-33601 | IN | denotes | of |
| T22495 | 33602-33609 | NNP | denotes | Hoechst |
| T22496 | 33610-33615 | CD | denotes | 33342 |
| T22497 | 33616-33617 | -LRB- | denotes | ( |
| T22498 | 33617-33622 | NNP | denotes | Sigma |
| T22499 | 33622-33623 | -RRB- | denotes | ) |
| T22500 | 33624-33627 | IN | denotes | for |
| T22501 | 33628-33629 | CD | denotes | 5 |
| T22502 | 33630-33633 | NN | denotes | min |
| T22503 | 33634-33636 | IN | denotes | at |
| T22504 | 33637-33639 | CD | denotes | 25 |
| T22505 | 33640-33641 | CD | denotes | ° |
| T22506 | 33641-33642 | NNP | denotes | C |
| T22507 | 33642-33643 | . | denotes | . |
| T22508 | 33644-33647 | DT | denotes | The |
| T22509 | 33648-33654 | NNS | denotes | slides |
| T22510 | 33655-33659 | VBD | denotes | were |
| T22511 | 33660-33664 | RB | denotes | then |
| T22512 | 33665-33671 | VBN | denotes | rinsed |
| T22513 | 33672-33676 | IN | denotes | with |
| T22514 | 33677-33680 | NNP | denotes | PBS |
| T22515 | 33681-33686 | CD | denotes | three |
| T22516 | 33687-33692 | NNS | denotes | times |
| T22517 | 33693-33696 | CC | denotes | and |
| T22518 | 33697-33702 | VB | denotes | cover |
| T22519 | 33703-33710 | VBN | denotes | mounted |
| T22520 | 33711-33714 | IN | denotes | for |
| T22521 | 33715-33727 | NN | denotes | fluorescence |
| T22522 | 33728-33738 | NN | denotes | microscopy |
| T22523 | 33738-33739 | . | denotes | . |
| T22801 | 33741-33760 | NNP | denotes | Immunoprecipitation |
| T22802 | 33761-33764 | CC | denotes | and |
| T22803 | 33765-33775 | JJ | denotes | immunoblot |
| T22804 | 33776-33779 | DT | denotes | The |
| T22805 | 33780-33785 | NNS | denotes | cells |
| T22806 | 33786-33790 | VBD | denotes | were |
| T22807 | 33791-33800 | VBN | denotes | harvested |
| T22808 | 33801-33804 | CC | denotes | and |
| T22809 | 33805-33810 | VBN | denotes | lysed |
| T22810 | 33811-33813 | IN | denotes | on |
| T22811 | 33814-33817 | NN | denotes | ice |
| T22812 | 33818-33820 | IN | denotes | by |
| T22813 | 33821-33824 | CD | denotes | 0.4 |
| T22814 | 33825-33827 | NN | denotes | ml |
| T22815 | 33828-33830 | IN | denotes | of |
| T22816 | 33831-33834 | DT | denotes | the |
| T22817 | 33835-33843 | VBN | denotes | modified |
| T22818 | 33844-33848 | NNP | denotes | RIPA |
| T22819 | 33849-33855 | NN | denotes | buffer |
| T22820 | 33856-33857 | -LRB- | denotes | ( |
| T22821 | 33857-33859 | CD | denotes | 50 |
| T22822 | 33860-33862 | NNP | denotes | mM |
| T22823 | 33863-33871 | NNP | denotes | Tris-HCl |
| T22824 | 33872-33873 | NNP | denotes | [ |
| T22825 | 33873-33875 | NNP | denotes | pH |
| T22826 | 33876-33879 | CD | denotes | 7.4 |
| T22827 | 33879-33880 | NNP | denotes | ] |
| T22828 | 33880-33881 | , | denotes | , |
| T22829 | 33882-33883 | CD | denotes | 1 |
| T22830 | 33883-33884 | NN | denotes | % |
| T22831 | 33885-33890 | NN | denotes | NP-40 |
| T22832 | 33890-33891 | , | denotes | , |
| T22833 | 33892-33896 | CD | denotes | 0.25 |
| T22834 | 33896-33897 | NN | denotes | % |
| T22835 | 33898-33913 | JJ | denotes | Na-deoxycholate |
| T22836 | 33913-33914 | , | denotes | , |
| T22837 | 33915-33918 | CD | denotes | 150 |
| T22838 | 33919-33921 | NNP | denotes | mM |
| T22839 | 33922-33926 | NNP | denotes | NaCl |
| T22840 | 33926-33927 | , | denotes | , |
| T22841 | 33928-33929 | CD | denotes | 1 |
| T22842 | 33930-33932 | NNP | denotes | mM |
| T22843 | 33933-33937 | NNP | denotes | EDTA |
| T22844 | 33937-33938 | , | denotes | , |
| T22845 | 33939-33940 | CD | denotes | 1 |
| T22846 | 33941-33943 | NNP | denotes | mM |
| T22847 | 33944-33948 | NNP | denotes | PMSF |
| T22848 | 33948-33949 | , | denotes | , |
| T22849 | 33950-33951 | CD | denotes | 1 |
| T22850 | 33952-33954 | NNP | denotes | mM |
| T22851 | 33955-33961 | NNP | denotes | Na3VO4 |
| T22852 | 33961-33962 | , | denotes | , |
| T22853 | 33963-33964 | CD | denotes | 1 |
| T22854 | 33965-33967 | NNP | denotes | mM |
| T22855 | 33968-33971 | NNP | denotes | NaF |
| T22856 | 33971-33972 | -RRB- | denotes | ) |
| T22857 | 33973-33985 | VBN | denotes | supplemented |
| T22858 | 33986-33990 | IN | denotes | with |
| T22859 | 33991-33992 | CD | denotes | 1 |
| T22860 | 33993-33994 | CD | denotes | × |
| T22861 | 33995-34003 | NN | denotes | protease |
| T22862 | 34004-34013 | NN | denotes | inhibitor |
| T22863 | 34014-34022 | NN | denotes | cocktail |
| T22864 | 34023-34024 | -LRB- | denotes | ( |
| T22865 | 34024-34029 | NNP | denotes | Roche |
| T22866 | 34029-34030 | -RRB- | denotes | ) |
| T22867 | 34031-34034 | CC | denotes | and |
| T22868 | 34035-34036 | CD | denotes | 1 |
| T22869 | 34037-34038 | CD | denotes | × |
| T22870 | 34039-34050 | NN | denotes | phosphatase |
| T22871 | 34051-34060 | NN | denotes | inhibitor |
| T22872 | 34061-34069 | NN | denotes | cocktail |
| T22873 | 34070-34073 | VBN | denotes | set |
| T22874 | 34074-34075 | PRP | denotes | I |
| T22875 | 34076-34077 | -LRB- | denotes | ( |
| T22876 | 34077-34080 | NNP | denotes | EMD |
| T22877 | 34081-34092 | NNPS | denotes | Biosciences |
| T22878 | 34092-34093 | -RRB- | denotes | ) |
| T22879 | 34094-34097 | IN | denotes | for |
| T22880 | 34098-34100 | CD | denotes | 30 |
| T22881 | 34101-34104 | NN | denotes | min |
| T22882 | 34104-34105 | . | denotes | . |
| T22883 | 34106-34109 | DT | denotes | The |
| T22884 | 34110-34117 | NNS | denotes | lysates |
| T22885 | 34118-34122 | VBD | denotes | were |
| T22886 | 34123-34134 | VBN | denotes | centrifuged |
| T22887 | 34135-34137 | IN | denotes | at |
| T22888 | 34138-34144 | CD | denotes | 10,000 |
| T22889 | 34145-34146 | CD | denotes | × |
| T22890 | 34147-34148 | NN | denotes | g |
| T22891 | 34149-34151 | IN | denotes | at |
| T22892 | 34152-34153 | CD | denotes | 4 |
| T22893 | 34154-34155 | CD | denotes | ° |
| T22894 | 34155-34156 | NNP | denotes | C |
| T22895 | 34157-34160 | IN | denotes | for |
| T22896 | 34161-34163 | CD | denotes | 10 |
| T22897 | 34164-34167 | NN | denotes | min |
| T22898 | 34168-34170 | TO | denotes | to |
| T22899 | 34171-34177 | VB | denotes | remove |
| T22900 | 34178-34187 | JJ | denotes | insoluble |
| T22901 | 34188-34196 | NN | denotes | material |
| T22902 | 34196-34197 | . | denotes | . |
| T22903 | 34198-34203 | IN | denotes | After |
| T22904 | 34204-34215 | VBG | denotes | normalizing |
| T22905 | 34216-34223 | NN | denotes | protein |
| T22906 | 34224-34238 | NNS | denotes | concentrations |
| T22907 | 34238-34239 | , | denotes | , |
| T22908 | 34240-34247 | NNS | denotes | lysates |
| T22909 | 34248-34252 | VBD | denotes | were |
| T22910 | 34253-34262 | VBN | denotes | subjected |
| T22911 | 34263-34265 | TO | denotes | to |
| T22912 | 34266-34285 | NN | denotes | immunoprecipitation |
| T22913 | 34286-34288 | IN | denotes | by |
| T22914 | 34289-34295 | VBG | denotes | adding |
| T22915 | 34296-34298 | CD | denotes | 10 |
| T22916 | 34299-34304 | JJ | denotes | mg/ml |
| T22917 | 34305-34316 | JJ | denotes | appropriate |
| T22918 | 34317-34325 | NN | denotes | antibody |
| T22919 | 34326-34330 | CC | denotes | plus |
| T22920 | 34331-34333 | CD | denotes | 30 |
| T22921 | 34334-34336 | NN | denotes | ml |
| T22922 | 34337-34339 | IN | denotes | of |
| T22923 | 34340-34347 | NN | denotes | protein |
| T22924 | 34348-34357 | NN | denotes | G-agarose |
| T22925 | 34358-34359 | -LRB- | denotes | ( |
| T22926 | 34359-34364 | NNP | denotes | Roche |
| T22927 | 34364-34365 | -RRB- | denotes | ) |
| T22928 | 34365-34366 | , | denotes | , |
| T22929 | 34367-34370 | CC | denotes | and |
| T22930 | 34371-34378 | VBD | denotes | rotated |
| T22931 | 34379-34382 | IN | denotes | for |
| T22932 | 34383-34385 | IN | denotes | at |
| T22933 | 34386-34391 | JJS | denotes | least |
| T22934 | 34392-34393 | CD | denotes | 2 |
| T22935 | 34394-34395 | NN | denotes | h |
| T22936 | 34396-34398 | IN | denotes | at |
| T22937 | 34399-34400 | CD | denotes | 4 |
| T22938 | 34400-34401 | CD | denotes | ° |
| T22939 | 34401-34402 | NNP | denotes | C |
| T22940 | 34402-34403 | . | denotes | . |
| T22941 | 34404-34407 | DT | denotes | The |
| T22942 | 34408-34420 | NNS | denotes | precipitates |
| T22943 | 34421-34425 | VBD | denotes | were |
| T22944 | 34426-34432 | VBN | denotes | washed |
| T22945 | 34433-34435 | IN | denotes | at |
| T22946 | 34436-34441 | JJS | denotes | least |
| T22947 | 34442-34446 | CD | denotes | five |
| T22948 | 34447-34452 | NNS | denotes | times |
| T22949 | 34453-34457 | IN | denotes | with |
| T22950 | 34458-34462 | JJ | denotes | cold |
| T22951 | 34463-34468 | NN | denotes | lysis |
| T22952 | 34469-34475 | NN | denotes | buffer |
| T22953 | 34476-34484 | VBN | denotes | followed |
| T22954 | 34485-34487 | IN | denotes | by |
| T22955 | 34488-34498 | NN | denotes | separation |
| T22956 | 34499-34501 | IN | denotes | by |
| T22957 | 34502-34510 | NNP | denotes | SDS-PAGE |
| T22958 | 34511-34516 | IN | denotes | under |
| T22959 | 34517-34524 | VBN | denotes | reduced |
| T22960 | 34525-34528 | CC | denotes | and |
| T22961 | 34529-34539 | VBG | denotes | denaturing |
| T22962 | 34540-34550 | NNS | denotes | conditions |
| T22963 | 34550-34551 | . | denotes | . |
| T22964 | 34552-34566 | NNP | denotes | Nitrocellulose |
| T22965 | 34567-34576 | NNS | denotes | membranes |
| T22966 | 34577-34581 | VBD | denotes | were |
| T22967 | 34582-34589 | VBN | denotes | blocked |
| T22968 | 34590-34592 | IN | denotes | in |
| T22969 | 34593-34594 | CD | denotes | 5 |
| T22970 | 34595-34596 | NN | denotes | % |
| T22971 | 34597-34603 | JJ | denotes | nonfat |
| T22972 | 34604-34608 | NN | denotes | milk |
| T22973 | 34609-34611 | IN | denotes | in |
| T22974 | 34612-34615 | CD | denotes | 0.1 |
| T22975 | 34616-34617 | NN | denotes | % |
| T22976 | 34618-34627 | JJ | denotes | PBS-Tween |
| T22977 | 34628-34630 | CD | denotes | 20 |
| T22978 | 34631-34632 | -LRB- | denotes | ( |
| T22979 | 34632-34637 | NN | denotes | PBS-T |
| T22980 | 34637-34638 | -RRB- | denotes | ) |
| T22981 | 34638-34639 | , | denotes | , |
| T22982 | 34640-34646 | VBN | denotes | probed |
| T22983 | 34647-34651 | IN | denotes | with |
| T22984 | 34652-34660 | JJ | denotes | specific |
| T22985 | 34661-34671 | NNS | denotes | antibodies |
| T22986 | 34672-34674 | IN | denotes | as |
| T22987 | 34675-34684 | VBN | denotes | described |
| T22988 | 34685-34696 | NNS | denotes | previously6 |
| T22989 | 34696-34697 | . | denotes | . |
| T22990 | 34698-34701 | IN | denotes | For |
| T22991 | 34702-34716 | VBG | denotes | immunoblotting |
| T22992 | 34717-34719 | IN | denotes | of |
| T22993 | 34720-34734 | JJ | denotes | phosphorylated |
| T22994 | 34735-34743 | NNS | denotes | proteins |
| T22995 | 34743-34744 | , | denotes | , |
| T22996 | 34745-34749 | NNS | denotes | gels |
| T22997 | 34750-34754 | VBD | denotes | were |
| T22998 | 34755-34766 | VBN | denotes | transferred |
| T22999 | 34767-34769 | TO | denotes | to |
| T23000 | 34770-34786 | JJ | denotes | methanol-treated |
| T23001 | 34787-34801 | NN | denotes | polyvinylidene |
| T23002 | 34802-34810 | NN | denotes | chloride |
| T23003 | 34811-34820 | NNS | denotes | membranes |
| T23004 | 34820-34821 | , | denotes | , |
| T23005 | 34822-34831 | VBD | denotes | retreated |
| T23006 | 34832-34836 | IN | denotes | with |
| T23007 | 34837-34845 | NN | denotes | methanol |
| T23008 | 34845-34846 | , | denotes | , |
| T23009 | 34847-34850 | CC | denotes | and |
| T23010 | 34851-34856 | VBD | denotes | dried |
| T23011 | 34857-34860 | IN | denotes | for |
| T23012 | 34861-34863 | CD | denotes | 30 |
| T23013 | 34864-34867 | NN | denotes | min |
| T23014 | 34867-34868 | . | denotes | . |
| T23015 | 34869-34874 | NNS | denotes | Blots |
| T23016 | 34875-34879 | VBD | denotes | were |
| T23017 | 34880-34887 | VBN | denotes | blocked |
| T23018 | 34888-34890 | IN | denotes | in |
| T23019 | 34891-34892 | CD | denotes | 5 |
| T23020 | 34893-34894 | NN | denotes | % |
| T23021 | 34895-34901 | JJ | denotes | bovine |
| T23022 | 34902-34907 | NN | denotes | serum |
| T23023 | 34908-34915 | NN | denotes | albumin |
| T23024 | 34916-34918 | IN | denotes | in |
| T23025 | 34919-34922 | CD | denotes | 0.1 |
| T23026 | 34923-34924 | NN | denotes | % |
| T23027 | 34925-34929 | NNP | denotes | Tris |
| T23028 | 34930-34938 | VBD | denotes | buffered |
| T23029 | 34939-34951 | JJ | denotes | saline-Tween |
| T23030 | 34952-34954 | CD | denotes | 20 |
| T23031 | 34955-34956 | -LRB- | denotes | ( |
| T23032 | 34956-34961 | NN | denotes | TBS-T |
| T23033 | 34961-34962 | -RRB- | denotes | ) |
| T23034 | 34962-34963 | , | denotes | , |
| T23035 | 34964-34967 | CC | denotes | and |
| T23036 | 34968-34974 | VBD | denotes | probed |
| T23037 | 34975-34979 | IN | denotes | with |
| T23038 | 34980-34988 | JJ | denotes | specific |
| T23039 | 34989-34999 | NNS | denotes | antibodies |
| T23040 | 35000-35002 | IN | denotes | as |
| T23041 | 35003-35012 | VBN | denotes | described |
| T23042 | 35013-35025 | NNS | denotes | previously46 |
| T23043 | 35025-35026 | . | denotes | . |
| T23044 | 35027-35032 | NNS | denotes | Bands |
| T23045 | 35033-35037 | VBD | denotes | were |
| T23046 | 35038-35044 | VBN | denotes | imaged |
| T23047 | 35045-35047 | IN | denotes | by |
| T23048 | 35048-35051 | DT | denotes | the |
| T23049 | 35052-35057 | NNP | denotes | Super |
| T23050 | 35058-35067 | VBG | denotes | Signaling |
| T23051 | 35068-35074 | NN | denotes | system |
| T23052 | 35075-35076 | -LRB- | denotes | ( |
| T23053 | 35076-35082 | NNP | denotes | Pierce |
| T23054 | 35082-35083 | -RRB- | denotes | ) |
| T23055 | 35084-35093 | VBG | denotes | according |
| T23056 | 35094-35096 | TO | denotes | to |
| T23057 | 35097-35100 | DT | denotes | the |
| T23058 | 35101-35113 | NN | denotes | manufacturer |
| T23059 | 35113-35115 | POS | denotes | 's |
| T23060 | 35116-35128 | NNS | denotes | instructions |
| T23061 | 35128-35129 | . | denotes | . |
| T23138 | 35131-35136 | NNP | denotes | ELISA |
| T23139 | 35137-35140 | DT | denotes | The |
| T23140 | 35141-35147 | NN | denotes | amount |
| T23141 | 35148-35150 | IN | denotes | of |
| T23142 | 35151-35155 | NN | denotes | IL-8 |
| T23143 | 35156-35163 | NN | denotes | present |
| T23144 | 35164-35166 | IN | denotes | in |
| T23145 | 35167-35179 | NNS | denotes | supernatants |
| T23146 | 35180-35189 | VBN | denotes | collected |
| T23147 | 35190-35194 | IN | denotes | from |
| T23148 | 35195-35201 | NNP | denotes | Jurkat |
| T23149 | 35202-35206 | NN | denotes | cell |
| T23150 | 35207-35214 | NN | denotes | culture |
| T23151 | 35215-35218 | VBD | denotes | was |
| T23152 | 35219-35227 | VBN | denotes | measured |
| T23153 | 35228-35233 | VBG | denotes | using |
| T23154 | 35234-35235 | DT | denotes | a |
| T23155 | 35236-35241 | JJ | denotes | Human |
| T23156 | 35242-35255 | NN | denotes | Interleukin-8 |
| T23157 | 35256-35261 | NNP | denotes | ELISA |
| T23158 | 35262-35274 | NNP | denotes | Ready-SET-Go |
| T23159 | 35275-35278 | NN | denotes | kit |
| T23160 | 35279-35280 | -LRB- | denotes | ( |
| T23161 | 35280-35291 | NNP | denotes | eBioscience |
| T23162 | 35291-35292 | -RRB- | denotes | ) |
| T23163 | 35293-35302 | VBG | denotes | according |
| T23164 | 35303-35305 | TO | denotes | to |
| T23165 | 35306-35309 | DT | denotes | the |
| T23166 | 35310-35322 | NN | denotes | manufacturer |
| T23167 | 35322-35324 | POS | denotes | 's |
| T23168 | 35325-35337 | NNS | denotes | instructions |
| T23169 | 35337-35338 | . | denotes | . |
| T23214 | 35340-35344 | NNP | denotes | Cell |
| T23215 | 35345-35355 | NNP | denotes | Infections |
| T23216 | 35356-35360 | NNP | denotes | HeLa |
| T23217 | 35361-35366 | NNS | denotes | cells |
| T23218 | 35367-35371 | VBD | denotes | were |
| T23219 | 35372-35380 | VBN | denotes | infected |
| T23220 | 35381-35385 | IN | denotes | with |
| T23221 | 35386-35388 | NNP | denotes | E. |
| T23222 | 35389-35393 | NNS | denotes | coli |
| T23223 | 35394-35398 | NNP | denotes | O157 |
| T23224 | 35398-35399 | : | denotes | : |
| T23225 | 35399-35401 | NNP | denotes | H7 |
| T23226 | 35402-35404 | CC | denotes | or |
| T23227 | 35405-35407 | NNP | denotes | C. |
| T23228 | 35408-35417 | NN | denotes | rodentium |
| T23229 | 35418-35425 | NNS | denotes | strains |
| T23230 | 35426-35428 | IN | denotes | as |
| T23231 | 35429-35438 | VBN | denotes | described |
| T23232 | 35439-35450 | CD | denotes | previously9 |
| T23233 | 35450-35451 | . | denotes | . |
| T23283 | 35453-35473 | NNP | denotes | Immunohistochemistry |
| T23284 | 35474-35485 | NNP | denotes | Gnotobiotic |
| T23285 | 35486-35493 | NNS | denotes | piglets |
| T23286 | 35494-35498 | VBD | denotes | were |
| T23287 | 35499-35507 | VBN | denotes | infected |
| T23288 | 35508-35512 | IN | denotes | with |
| T23289 | 35513-35515 | NNP | denotes | E. |
| T23290 | 35516-35520 | NNS | denotes | coli |
| T23291 | 35521-35525 | NNP | denotes | O157 |
| T23292 | 35525-35526 | : | denotes | : |
| T23293 | 35526-35528 | NNP | denotes | H7 |
| T23294 | 35529-35536 | NNS | denotes | strains |
| T23295 | 35537-35539 | IN | denotes | as |
| T23296 | 35540-35549 | VBN | denotes | described |
| T23297 | 35550-35561 | CD | denotes | previously9 |
| T23298 | 35561-35562 | . | denotes | . |
| T23299 | 35563-35569 | NN | denotes | Spiral |
| T23300 | 35570-35575 | NN | denotes | colon |
| T23301 | 35576-35585 | NNS | denotes | specimens |
| T23302 | 35586-35590 | VBD | denotes | were |
| T23303 | 35591-35600 | VBN | denotes | collected |
| T23304 | 35601-35603 | IN | denotes | at |
| T23305 | 35604-35612 | NN | denotes | necropsy |
| T23306 | 35613-35616 | CC | denotes | and |
| T23307 | 35617-35625 | VBN | denotes | embedded |
| T23308 | 35626-35628 | IN | denotes | in |
| T23309 | 35629-35637 | NN | denotes | paraffin |
| T23310 | 35637-35638 | . | denotes | . |
| T23311 | 35639-35647 | NNP | denotes | Paraffin |
| T23312 | 35648-35658 | NN | denotes | sectioning |
| T23313 | 35659-35662 | CC | denotes | and |
| T23314 | 35663-35682 | JJ | denotes | immunohistochemical |
| T23315 | 35683-35691 | NN | denotes | staining |
| T23316 | 35692-35697 | VBG | denotes | using |
| T23317 | 35698-35710 | JJ | denotes | phospho-RPS3 |
| T23318 | 35711-35719 | NN | denotes | antibody |
| T23319 | 35720-35724 | VBD | denotes | were |
| T23320 | 35725-35734 | VBN | denotes | performed |
| T23321 | 35735-35737 | IN | denotes | by |
| T23322 | 35738-35747 | NNP | denotes | Histoserv |
| T23323 | 35748-35752 | NNP | denotes | Inc. |
| T250 | 0-4 | NNP | denotes | IKKβ |
| T251 | 5-20 | NN | denotes | phosphorylation |
| T252 | 21-30 | VBZ | denotes | regulates |
| T253 | 31-35 | CD | denotes | RPS3 |
| T254 | 36-43 | JJ | denotes | nuclear |
| T255 | 44-57 | NN | denotes | translocation |
| T256 | 58-61 | CC | denotes | and |
| T257 | 62-67 | JJ | denotes | NF-κB |
| T258 | 68-76 | NN | denotes | function |
| T259 | 77-95 | NNP | denotes | during Escherichia |
| T260 | 96-105 | NNP | denotes | coli O157 |
| T261 | 105-106 | : | denotes | : |
| T262 | 106-108 | NNP | denotes | H7 |
| T263 | 109-118 | NN | denotes | infection |
| T264 | 130-135 | NN | denotes | NF-κB |
| T265 | 136-138 | VBZ | denotes | is |
| T266 | 139-140 | DT | denotes | a |
| T267 | 141-146 | JJ | denotes | major |
| T268 | 147-151 | NN | denotes | gene |
| T269 | 152-161 | NN | denotes | regulator |
| T270 | 162-164 | IN | denotes | in |
| T271 | 165-171 | JJ | denotes | immune |
| T272 | 172-181 | NNS | denotes | responses |
| T273 | 182-185 | CC | denotes | and |
| T274 | 186-195 | JJ | denotes | ribosomal |
| T275 | 196-203 | NN | denotes | protein |
| T276 | 204-206 | NNP | denotes | S3 |
| T277 | 207-208 | -LRB- | denotes | ( |
| T278 | 208-212 | NNP | denotes | RPS3 |
| T279 | 212-213 | -RRB- | denotes | ) |
| T280 | 214-216 | VBZ | denotes | is |
| T281 | 217-219 | DT | denotes | an |
| T282 | 220-225 | JJ | denotes | NF-κB |
| T283 | 226-233 | NN | denotes | subunit |
| R228 | T294 | T298 | amod | unknown,translocation |
| R229 | T295 | T296 | advmod | how,RPS3 |
| R230 | T296 | T298 | amod | RPS3,translocation |
| R231 | T297 | T298 | amod | nuclear,translocation |
| R232 | T298 | T300 | nsubjpass | translocation,regulated |
| R233 | T299 | T300 | auxpass | is,regulated |
| R234 | T300 | T293 | ccomp | regulated,is |
| R235 | T301 | T293 | punct | .,is |
| R236 | T302 | T304 | advmod | Here,report |
| R237 | T303 | T304 | nsubj | we,report |
| R238 | T304 | T304 | ROOT | report,report |
| R239 | T305 | T314 | mark | that,was |
| R240 | T306 | T307 | compound | IKKβ,phosphorylation |
| R241 | T307 | T314 | nsubj | phosphorylation,was |
| R242 | T308 | T307 | prep | of,phosphorylation |
| R243 | T309 | T308 | pobj | serine,of |
| R244 | T310 | T309 | nummod | 209,serine |
| R245 | T311 | T309 | punct | (,serine |
| R246 | T312 | T309 | appos | S209,serine |
| R247 | T313 | T309 | punct | ),serine |
| R248 | T314 | T304 | ccomp | was,report |
| R249 | T315 | T314 | acomp | crucial,was |
| R250 | T316 | T315 | prep | for,crucial |
| R251 | T317 | T319 | amod | RPS3,localization |
| R252 | T318 | T319 | amod | nuclear,localization |
| R253 | T319 | T316 | pobj | localization,for |
| R254 | T320 | T319 | prep | in,localization |
| R255 | T321 | T320 | pobj | response,in |
| R256 | T322 | T321 | prep | to,response |
| R257 | T323 | T322 | pcomp | activating,to |
| R258 | T324 | T323 | dobj | stimuli,activating |
| R259 | T325 | T304 | punct | .,report |
| R260 | T326 | T340 | advmod | Moreover,inhibited |
| R261 | T327 | T340 | punct | ",",inhibited |
| R262 | T328 | T330 | det | the,pathogen |
| R263 | T329 | T330 | compound | foodborne,pathogen |
| R264 | T330 | T340 | nsubj | pathogen,inhibited |
| R265 | T331 | T332 | compound | Escherichia,coli |
| R266 | T332 | T333 | compound | coli,O157 |
| R267 | T333 | T330 | appos | O157,pathogen |
| R268 | T334 | T333 | punct | :,O157 |
| R269 | T335 | T337 | compound | H7,protein |
| R270 | T336 | T337 | compound | virulence,protein |
| R271 | T337 | T330 | conj | protein,pathogen |
| R272 | T338 | T340 | nsubj | NleH1,inhibited |
| R273 | T339 | T340 | advmod | specifically,inhibited |
| R274 | T340 | T340 | ROOT | inhibited,inhibited |
| R275 | T341 | T343 | compound | RPS3,phosphorylation |
| R276 | T342 | T343 | compound | S209,phosphorylation |
| R277 | T343 | T340 | dobj | phosphorylation,inhibited |
| R278 | T344 | T340 | cc | and,inhibited |
| R279 | T345 | T340 | conj | blocked,inhibited |
| R280 | T346 | T347 | nummod | RPS3,function |
| R281 | T347 | T345 | dobj | function,blocked |
| R282 | T348 | T345 | punct | ",",blocked |
| R283 | T349 | T350 | advmod | thereby,promoting |
| R284 | T350 | T345 | advcl | promoting,blocked |
| R285 | T351 | T352 | amod | bacterial,colonization |
| R286 | T352 | T350 | dobj | colonization,promoting |
| R287 | T353 | T352 | cc | and,colonization |
| R288 | T354 | T352 | conj | diarrhea,colonization |
| R289 | T355 | T350 | cc | but,promoting |
| R290 | T356 | T350 | conj | decreasing,promoting |
| R291 | T357 | T356 | dobj | mortality,decreasing |
| R292 | T358 | T356 | prep | in,decreasing |
| R293 | T359 | T363 | det | a,model |
| R294 | T360 | T363 | amod | gnotobiotic,model |
| R295 | T361 | T363 | compound | piglet,model |
| R296 | T362 | T363 | compound | infection,model |
| R297 | T363 | T358 | pobj | model,in |
| R298 | T364 | T340 | punct | .,inhibited |
| R299 | T365 | T377 | advmod | Thus,promotes |
| R300 | T366 | T377 | punct | ",",promotes |
| R301 | T367 | T369 | det | the,modification |
| R302 | T368 | T369 | amod | IKKβ-dependent,modification |
| R303 | T369 | T377 | nsubj | modification,promotes |
| R304 | T370 | T369 | prep | of,modification |
| R305 | T371 | T374 | det | a,acid |
| R306 | T372 | T374 | amod | specific,acid |
| R307 | T373 | T374 | compound | amino,acid |
| R308 | T374 | T370 | pobj | acid,of |
| R309 | T375 | T369 | prep | in,modification |
| R310 | T376 | T375 | pobj | RPS3,in |
| R311 | T377 | T377 | ROOT | promotes,promotes |
| R312 | T378 | T380 | amod | specific,functions |
| R313 | T379 | T380 | amod | NF-κB,functions |
| R314 | T380 | T377 | dobj | functions,promotes |
| R315 | T381 | T382 | nsubj | that,underlie |
| R316 | T382 | T380 | relcl | underlie,functions |
| R317 | T383 | T386 | det | the,mechanisms |
| R318 | T384 | T386 | amod | molecular,mechanisms |
| R319 | T385 | T386 | amod | pathogenetic,mechanisms |
| R320 | T386 | T382 | dobj | mechanisms,underlie |
| R321 | T387 | T386 | prep | of,mechanisms |
| R322 | T388 | T390 | compound | E.,O157 |
| R323 | T389 | T390 | compound | coli,O157 |
| R324 | T390 | T387 | pobj | O157,of |
| R325 | T391 | T390 | punct | :,O157 |
| R326 | T392 | T390 | appos | H7,O157 |
| R327 | T393 | T377 | punct | .,promotes |
| R506 | T263 | T264 | compound | infection,NF-κB |
| R507 | T264 | T265 | nsubj | NF-κB,is |
| R508 | T265 | T265 | ROOT | is,is |
| R509 | T266 | T269 | det | a,regulator |
| R510 | T267 | T269 | amod | major,regulator |
| R511 | T268 | T269 | compound | gene,regulator |
| R512 | T269 | T265 | attr | regulator,is |
| R513 | T270 | T269 | prep | in,regulator |
| R514 | T271 | T272 | amod | immune,responses |
| R515 | T272 | T270 | pobj | responses,in |
| R516 | T273 | T272 | cc | and,responses |
| R517 | T274 | T276 | amod | ribosomal,S3 |
| R518 | T275 | T276 | compound | protein,S3 |
| R519 | T276 | T269 | appos | S3,regulator |
| R520 | T277 | T278 | punct | (,RPS3 |
| R521 | T278 | T276 | appos | RPS3,S3 |
| R522 | T279 | T276 | punct | ),S3 |
| R523 | T280 | T265 | conj | is,is |
| R524 | T281 | T283 | det | an,subunit |
| R525 | T282 | T283 | amod | NF-κB,subunit |
| R526 | T283 | T280 | attr | subunit,is |
| R963 | T1161 | T1163 | compound | Nuclear,B |
| R964 | T1162 | T1163 | compound | Factor-kappa,B |
| R965 | T1163 | T1167 | nsubj | B,regulates |
| R966 | T1164 | T1163 | punct | (,B |
| R967 | T1165 | T1163 | appos | NF-κB,B |
| R968 | T1166 | T1163 | punct | ),B |
| R969 | T1167 | T1167 | ROOT | regulates,regulates |
| R970 | T1168 | T1170 | amod | crucial,functions |
| R971 | T1169 | T1170 | amod | cellular,functions |
| R972 | T1170 | T1167 | dobj | functions,regulates |
| R973 | T1171 | T1170 | cc | and,functions |
| R974 | T1172 | T1173 | amod | diverse,stimuli |
| R975 | T1173 | T1170 | conj | stimuli,functions |
| R976 | T1174 | T1167 | conj | activate,regulates |
| R977 | T1175 | T1178 | det | this,factor |
| R978 | T1176 | T1178 | amod | pleiotropic,factor |
| R979 | T1177 | T1178 | compound | transcription,factor |
| R980 | T1178 | T1174 | dobj | factor,activate |
| R981 | T1179 | T1178 | punct | ",",factor |
| R982 | T1180 | T1183 | nsubj | which,regulates |
| R983 | T1181 | T1183 | prep | in,regulates |
| R984 | T1182 | T1181 | pobj | turn,in |
| R985 | T1183 | T1178 | relcl | regulates,factor |
| R986 | T1184 | T1186 | det | a,array |
| R987 | T1185 | T1186 | amod | vast,array |
| R988 | T1186 | T1183 | dobj | array,regulates |
| R989 | T1187 | T1186 | prep | of,array |
| R990 | T1188 | T1189 | amod | genetic,targets1-3 |
| R991 | T1189 | T1187 | pobj | targets1-3,of |
| R992 | T1190 | T1167 | punct | .,regulates |
| R993 | T1191 | T1195 | det | The,subunits |
| R994 | T1192 | T1195 | amod | best-known,subunits |
| R995 | T1193 | T1195 | amod | mammalian,subunits |
| R996 | T1194 | T1195 | compound | NF-κB,subunits |
| R997 | T1195 | T1196 | nsubj | subunits,are |
| R998 | T1196 | T1196 | ROOT | are,are |
| R999 | T1197 | T1198 | compound | Rel,proteins |
| R1000 | T1198 | T1196 | attr | proteins,are |
| R1001 | T1199 | T1198 | punct | ",",proteins |
| R1002 | T1200 | T1198 | prep | including,proteins |
| R1003 | T1201 | T1200 | pobj | RelA,including |
| R1004 | T1202 | T1203 | punct | (,p65 |
| R1005 | T1203 | T1201 | appos | p65,RelA |
| R1006 | T1204 | T1201 | punct | ),RelA |
| R1007 | T1205 | T1201 | punct | ",",RelA |
| R1008 | T1206 | T1201 | conj | RelB,RelA |
| R1009 | T1207 | T1206 | punct | ",",RelB |
| R1010 | T1208 | T1206 | conj | c-Rel,RelB |
| R1011 | T1209 | T1208 | punct | ",",c-Rel |
| R1012 | T1210 | T1208 | appos | p50,c-Rel |
| R1013 | T1211 | T1208 | punct | ",",c-Rel |
| R1014 | T1212 | T1208 | cc | and,c-Rel |
| R1015 | T1213 | T1208 | conj | p52,c-Rel |
| R1016 | T1214 | T1215 | punct | (,refs |
| R1017 | T1215 | T1206 | appos | refs,RelB |
| R1018 | T1216 | T1217 | punct | .,"4, 5" |
| R1019 | T1217 | T1215 | nummod | "4, 5",refs |
| R1020 | T1218 | T1215 | punct | ),refs |
| R1021 | T1219 | T1196 | punct | .,are |
| R1022 | T1220 | T1224 | advmod | However,demonstrated |
| R1023 | T1221 | T1224 | punct | ",",demonstrated |
| R1024 | T1222 | T1224 | nsubj | we,demonstrated |
| R1025 | T1223 | T1224 | advmod | recently,demonstrated |
| R1026 | T1224 | T1224 | ROOT | demonstrated,demonstrated |
| R1027 | T1225 | T1232 | mark | that,is |
| R1028 | T1226 | T1232 | nsubj | ribosomal,is |
| R1029 | T1227 | T1232 | nsubj | protein,is |
| R1030 | T1228 | T1232 | nsubj | S3,is |
| R1031 | T1229 | T1230 | punct | (,RPS3 |
| R1032 | T1230 | T1228 | appos | RPS3,S3 |
| R1033 | T1231 | T1228 | punct | ),S3 |
| R1034 | T1232 | T1224 | ccomp | is,demonstrated |
| R1035 | T1233 | T1236 | det | a,subunit |
| R1036 | T1234 | T1236 | amod | key,subunit |
| R1037 | T1235 | T1236 | amod | non-Rel,subunit |
| R1038 | T1236 | T1232 | attr | subunit,is |
| R1039 | T1237 | T1236 | prep | of,subunit |
| R1040 | T1238 | T1241 | amod | certain,complexes6 |
| R1041 | T1239 | T1240 | amod | native,NF-κB |
| R1042 | T1240 | T1241 | compound | NF-κB,complexes6 |
| R1043 | T1241 | T1237 | pobj | complexes6,of |
| R1044 | T1242 | T1224 | punct | .,demonstrated |
| R1045 | T1243 | T1245 | nsubjpass | RPS3,defined |
| R1046 | T1244 | T1245 | auxpass | is,defined |
| R1047 | T1245 | T1245 | ROOT | defined,defined |
| R1048 | T1246 | T1245 | prep | as,defined |
| R1049 | T1247 | T1249 | det | a,subunit |
| R1050 | T1248 | T1249 | nmod | specifier,subunit |
| R1051 | T1249 | T1246 | pobj | subunit,as |
| R1052 | T1250 | T1249 | prep | of,subunit |
| R1053 | T1251 | T1250 | pobj | NF-κB,of |
| R1054 | T1252 | T1245 | punct | ",",defined |
| R1055 | T1253 | T1255 | mark | because,facilitates |
| R1056 | T1254 | T1255 | nsubj | it,facilitates |
| R1057 | T1255 | T1245 | advcl | facilitates,defined |
| R1058 | T1256 | T1257 | amod | high,affinity |
| R1059 | T1257 | T1258 | compound | affinity,DNA |
| R1060 | T1258 | T1259 | nsubj | DNA,binding |
| R1061 | T1259 | T1255 | ccomp | binding,facilitates |
| R1062 | T1260 | T1261 | advmod | thus,determining |
| R1063 | T1261 | T1259 | xcomp | determining,binding |
| R1064 | T1262 | T1264 | det | the,specificity |
| R1065 | T1263 | T1264 | amod | regulatory,specificity |
| R1066 | T1264 | T1261 | dobj | specificity,determining |
| R1067 | T1265 | T1264 | prep | of,specificity |
| R1068 | T1266 | T1265 | pobj | NF-κB,of |
| R1069 | T1267 | T1264 | prep | for,specificity |
| R1070 | T1268 | T1269 | amod | selected,target |
| R1071 | T1269 | T1270 | compound | target,genes7 |
| R1072 | T1270 | T1267 | pobj | genes7,for |
| R1073 | T1271 | T1245 | punct | .,defined |
| R1074 | T1272 | T1273 | nummod | RPS3,regulation |
| R1075 | T1273 | T1312 | nsubj | regulation,9 |
| R1076 | T1274 | T1273 | prep | of,regulation |
| R1077 | T1275 | T1276 | amod | NF-κB,governs |
| R1078 | T1276 | T1274 | pobj | governs,of |
| R1079 | T1277 | T1279 | amod | key,processes |
| R1080 | T1278 | T1279 | amod | physiological,processes |
| R1081 | T1279 | T1276 | dobj | processes,governs |
| R1082 | T1280 | T1279 | punct | ",",processes |
| R1083 | T1281 | T1279 | prep | including,processes |
| R1084 | T1282 | T1287 | nmod | immunoglobulin,expression |
| R1085 | T1283 | T1287 | nmod | κ,expression |
| R1086 | T1284 | T1287 | nmod | light,expression |
| R1087 | T1285 | T1287 | compound | chain,expression |
| R1088 | T1286 | T1287 | compound | gene,expression |
| R1089 | T1287 | T1297 | nmod | expression,production |
| R1090 | T1288 | T1287 | cc | and,expression |
| R1091 | T1289 | T1290 | compound | receptor,editing |
| R1092 | T1290 | T1287 | conj | editing,expression |
| R1093 | T1291 | T1287 | prep | in,expression |
| R1094 | T1292 | T1291 | pobj | B,in |
| R1095 | T1293 | T1292 | nummod | cells6,B |
| R1096 | T1294 | T1292 | appos | ", 8",B |
| R1097 | T1295 | T1287 | punct | ",",expression |
| R1098 | T1296 | T1297 | compound | cytokine,production |
| R1099 | T1297 | T1281 | pobj | production,including |
| R1100 | T1298 | T1297 | prep | in,production |
| R1101 | T1299 | T1298 | pobj | T,in |
| R1102 | T1300 | T1299 | appos | cells6,T |
| R1103 | T1301 | T1297 | punct | ",",production |
| R1104 | T1302 | T1273 | cc | and,regulation |
| R1105 | T1303 | T1273 | conj | in,regulation |
| R1106 | T1304 | T1305 | compound | host,defense |
| R1107 | T1305 | T1303 | pobj | defense,in |
| R1108 | T1306 | T1305 | prep | against,defense |
| R1109 | T1307 | T1308 | compound | enterohemorrhagic Escherichia,coli |
| R1110 | T1308 | T1306 | pobj | coli,against |
| R1111 | T1309 | T1310 | punct | (,EHEC |
| R1112 | T1310 | T1308 | appos | EHEC,coli |
| R1113 | T1311 | T1312 | punct | ),9 |
| R1114 | T1312 | T1312 | ROOT | 9,9 |
| R1115 | T1313 | T1312 | punct | .,9 |
| R1116 | T1314 | T1317 | prep | In,the E |
| R1117 | T1315 | T1314 | amod | particular,In |
| R1118 | T1316 | T1317 | punct | ",",the E |
| R1119 | T1317 | T1317 | ROOT | the E,the E |
| R1120 | T1318 | T1317 | punct | .,the E |
| R1121 | T1319 | T1319 | ROOT | coli O157,coli O157 |
| R1122 | T1320 | T1319 | punct | :,coli O157 |
| R1123 | T1321 | T1325 | compound | H7,system |
| R1124 | T1322 | T1325 | compound | type,system |
| R1125 | T1323 | T1325 | compound | III,system |
| R1126 | T1324 | T1325 | compound | secretion,system |
| R1127 | T1325 | T1325 | ROOT | system,system |
| R1128 | T1326 | T1325 | punct | (,system |
| R1129 | T1327 | T1325 | appos | T3SS,system |
| R1130 | T1328 | T1325 | punct | ),system |
| R1131 | T1329 | T1330 | compound | effector,protein |
| R1132 | T1330 | T1333 | compound | protein,blocks |
| R1133 | T1331 | T1333 | nsubj | NleH1,blocks |
| R1134 | T1332 | T1333 | advmod | selectively,blocks |
| R1135 | T1333 | T1333 | ROOT | blocks,blocks |
| R1136 | T1334 | T1337 | compound | NF-κB,transcription |
| R1137 | T1335 | T1336 | compound | target,gene |
| R1138 | T1336 | T1337 | compound | gene,transcription |
| R1139 | T1337 | T1333 | dobj | transcription,blocks |
| R1140 | T1338 | T1333 | prep | by,blocks |
| R1141 | T1339 | T1338 | pcomp | attenuating,by |
| R1142 | T1340 | T1342 | amod | RPS3,translocation |
| R1143 | T1341 | T1342 | amod | nuclear,translocation |
| R1144 | T1342 | T1339 | dobj | translocation,attenuating |
| R1145 | T1343 | T1333 | punct | ",",blocks |
| R1146 | T1344 | T1333 | prep | without,blocks |
| R1147 | T1345 | T1344 | pcomp | affecting,without |
| R1148 | T1346 | T1347 | nummod | p65,localization9 |
| R1149 | T1347 | T1345 | dobj | localization9,affecting |
| R1150 | T1348 | T1333 | punct | .,blocks |
| R1151 | T1349 | T1356 | advmod | Nonetheless,induce |
| R1152 | T1350 | T1356 | punct | ",",induce |
| R1153 | T1351 | T1352 | advmod | how,specific |
| R1154 | T1352 | T1355 | amod | specific,signals |
| R1155 | T1353 | T1354 | npadvmod | NF-κB,activating |
| R1156 | T1354 | T1355 | amod | activating,signals |
| R1157 | T1355 | T1356 | nsubj | signals,induce |
| R1158 | T1356 | T1356 | ROOT | induce,induce |
| R1159 | T1357 | T1356 | dobj | RPS3,induce |
| R1160 | T1358 | T1359 | amod | nuclear,translocation |
| R1161 | T1359 | T1360 | nsubj | translocation,is |
| R1162 | T1360 | T1356 | advcl | is,induce |
| R1163 | T1361 | T1362 | amod | "unknown. Extra-ribosomal",functions |
| R1164 | T1362 | T1365 | nsubjpass | functions,ascribed |
| R1165 | T1363 | T1365 | aux | have,ascribed |
| R1166 | T1364 | T1365 | auxpass | been,ascribed |
| R1167 | T1365 | T1360 | ccomp | ascribed,is |
| R1168 | T1366 | T1365 | prep | to,ascribed |
| R1169 | T1367 | T1368 | amod | ribosomal,proteins10 |
| R1170 | T1368 | T1366 | pobj | proteins10,to |
| R1171 | T1369 | T1360 | punct | .,is |
| R1172 | T1370 | T1380 | prep | Besides,participates |
| R1173 | T1371 | T1372 | amod | binding,RNA |
| R1174 | T1372 | T1370 | pobj | RNA,Besides |
| R1175 | T1373 | T1372 | prep | within,RNA |
| R1176 | T1374 | T1377 | det | the,subunit |
| R1177 | T1375 | T1377 | nmod | 40S,subunit |
| R1178 | T1376 | T1377 | amod | ribosomal,subunit |
| R1179 | T1377 | T1373 | pobj | subunit,within |
| R1180 | T1378 | T1380 | punct | ",",participates |
| R1181 | T1379 | T1380 | nsubj | RPS3,participates |
| R1182 | T1380 | T1380 | ROOT | participates,participates |
| R1183 | T1381 | T1380 | prep | in,participates |
| R1184 | T1382 | T1381 | pobj | transcription6,in |
| R1185 | T1383 | T1380 | punct | ",",participates |
| R1186 | T1384 | T1380 | npadvmod | DNA,participates |
| R1187 | T1385 | T1384 | nummod | repair11,DNA |
| R1188 | T1386 | T1384 | appos | ", 12",DNA |
| R1189 | T1387 | T1384 | punct | ",",DNA |
| R1190 | T1388 | T1384 | cc | and,DNA |
| R1191 | T1389 | T1384 | conj | apoptosis13,DNA |
| R1192 | T1390 | T1380 | punct | .,participates |
| R1193 | T1391 | T1395 | mark | Whether,is |
| R1194 | T1392 | T1395 | cc | or,is |
| R1195 | T1393 | T1395 | neg | not,is |
| R1196 | T1394 | T1395 | nsubj | RPS3,is |
| R1197 | T1395 | T1395 | ROOT | is,is |
| R1198 | T1396 | T1399 | nsubjpass | phosphorylated,controversial14-18 |
| R1199 | T1397 | T1398 | aux | had,been |
| R1200 | T1398 | T1399 | auxpass | been,controversial14-18 |
| R1201 | T1399 | T1395 | attr | controversial14-18,is |
| R1202 | T1400 | T1395 | punct | .,is |
| R1203 | T1401 | T1404 | mark | Since,play |
| R1204 | T1402 | T1403 | compound | kinase,cascades |
| R1205 | T1403 | T1404 | nsubj | cascades,play |
| R1206 | T1404 | T1413 | advcl | play,tested |
| R1207 | T1405 | T1407 | det | a,role |
| R1208 | T1406 | T1407 | amod | critical,role |
| R1209 | T1407 | T1404 | dobj | role,play |
| R1210 | T1408 | T1407 | prep | in,role |
| R1211 | T1409 | T1410 | amod | NF-κB,regulation |
| R1212 | T1410 | T1408 | pobj | regulation,in |
| R1213 | T1411 | T1413 | punct | ",",tested |
| R1214 | T1412 | T1413 | nsubj | we,tested |
| R1215 | T1413 | T1413 | ROOT | tested,tested |
| R1216 | T1414 | T1416 | mark | whether,is |
| R1217 | T1415 | T1416 | nsubj | RPS3,is |
| R1218 | T1416 | T1413 | ccomp | is,tested |
| R1219 | T1417 | T1416 | acomp | phosphorylated,is |
| R1220 | T1418 | T1417 | prep | in,phosphorylated |
| R1221 | T1419 | T1420 | det | the,context |
| R1222 | T1420 | T1418 | pobj | context,in |
| R1223 | T1421 | T1420 | prep | of,context |
| R1224 | T1422 | T1423 | amod | NF-κB,activation |
| R1225 | T1423 | T1421 | pobj | activation,of |
| R1226 | T1424 | T1417 | cc | and,phosphorylated |
| R1227 | T1425 | T1417 | conj | sought,phosphorylated |
| R1228 | T1426 | T1427 | aux | to,identify |
| R1229 | T1427 | T1425 | xcomp | identify,sought |
| R1230 | T1428 | T1430 | det | the,kinase19 |
| R1231 | T1429 | T1430 | amod | responsible,kinase19 |
| R1232 | T1430 | T1427 | dobj | kinase19,identify |
| R1233 | T1431 | T1413 | punct | .,tested |
| R1234 | T1432 | T1435 | advmod | Additionally,aimed |
| R1235 | T1433 | T1435 | punct | ",",aimed |
| R1236 | T1434 | T1435 | nsubj | we,aimed |
| R1237 | T1435 | T1435 | ROOT | aimed,aimed |
| R1238 | T1436 | T1437 | aux | to,define |
| R1239 | T1437 | T1435 | xcomp | define,aimed |
| R1240 | T1438 | T1440 | det | a,role |
| R1241 | T1439 | T1440 | amod | regulatory,role |
| R1242 | T1440 | T1437 | dobj | role,define |
| R1243 | T1441 | T1440 | prep | for,role |
| R1244 | T1442 | T1444 | det | the,tail |
| R1245 | T1443 | T1444 | amod | C-terminal,tail |
| R1246 | T1444 | T1441 | pobj | tail,for |
| R1247 | T1445 | T1444 | prep | of,tail |
| R1248 | T1446 | T1445 | pobj | RPS3,of |
| R1249 | T1447 | T1448 | poss | whose,function |
| R1250 | T1448 | T1449 | nsubj | function,was |
| R1251 | T1449 | T1435 | conj | was,aimed |
| R1252 | T1450 | T1449 | acomp | "unknown. Here",was |
| R1253 | T1451 | T1452 | nsubj | we,show |
| R1254 | T1452 | T1449 | ccomp | show,was |
| R1255 | T1453 | T1466 | mark | that,phosphorylated |
| R1256 | T1454 | T1455 | det | the,Inhibitor |
| R1257 | T1455 | T1462 | nmod | Inhibitor,beta |
| R1258 | T1456 | T1455 | prep | of,Inhibitor |
| R1259 | T1457 | T1456 | pobj | κB,of |
| R1260 | T1458 | T1457 | punct | (,κB |
| R1261 | T1459 | T1457 | appos | IκB,κB |
| R1262 | T1460 | T1457 | punct | ),κB |
| R1263 | T1461 | T1462 | compound | kinase,beta |
| R1264 | T1462 | T1466 | nsubj | beta,phosphorylated |
| R1265 | T1463 | T1462 | punct | (,beta |
| R1266 | T1464 | T1462 | appos | IKKβ,beta |
| R1267 | T1465 | T1462 | punct | ),beta |
| R1268 | T1466 | T1452 | ccomp | phosphorylated,show |
| R1269 | T1467 | T1466 | dobj | RPS3,phosphorylated |
| R1270 | T1468 | T1466 | prep | at,phosphorylated |
| R1271 | T1469 | T1468 | pobj | serine,at |
| R1272 | T1470 | T1469 | nummod | 209,serine |
| R1273 | T1471 | T1472 | punct | (,S209 |
| R1274 | T1472 | T1469 | appos | S209,serine |
| R1275 | T1473 | T1466 | punct | ),phosphorylated |
| R1276 | T1474 | T1449 | punct | .,was |
| R1277 | T1475 | T1478 | nsubj | RPS3,enhanced |
| R1278 | T1476 | T1477 | nummod | S209,phosphorylation |
| R1279 | T1477 | T1478 | nsubj | phosphorylation,enhanced |
| R1280 | T1478 | T1478 | ROOT | enhanced,enhanced |
| R1281 | T1479 | T1480 | poss | its,association |
| R1282 | T1480 | T1478 | dobj | association,enhanced |
| R1283 | T1481 | T1480 | prep | with,association |
| R1284 | T1482 | T1481 | pobj | importin-α,with |
| R1285 | T1483 | T1478 | punct | ",",enhanced |
| R1286 | T1484 | T1478 | advcl | mediating,enhanced |
| R1287 | T1485 | T1486 | nummod | RPS3,entry |
| R1288 | T1486 | T1484 | dobj | entry,mediating |
| R1289 | T1487 | T1486 | prep | into,entry |
| R1290 | T1488 | T1490 | det | the,pathway |
| R1291 | T1489 | T1490 | compound | karyopherin,pathway |
| R1292 | T1490 | T1487 | pobj | pathway,into |
| R1293 | T1491 | T1484 | prep | for,mediating |
| R1294 | T1492 | T1493 | amod | nuclear,translocation |
| R1295 | T1493 | T1491 | pobj | translocation,for |
| R1296 | T1494 | T1478 | punct | .,enhanced |
| R1297 | T1495 | T1497 | advmod | Furthermore,the E |
| R1298 | T1496 | T1497 | punct | ",",the E |
| R1299 | T1497 | T1497 | ROOT | the E,the E |
| R1300 | T1498 | T1497 | punct | .,the E |
| R1301 | T1499 | T1500 | nummod | coli NleH1,effector |
| R1302 | T1500 | T1502 | nsubj | effector,inhibited |
| R1303 | T1501 | T1502 | advmod | specifically,inhibited |
| R1304 | T1502 | T1502 | ROOT | inhibited,inhibited |
| R1305 | T1503 | T1504 | compound | RPS3,S209 |
| R1306 | T1504 | T1502 | dobj | S209,inhibited |
| R1307 | T1505 | T1502 | advcl | revealing,inhibited |
| R1308 | T1506 | T1505 | dobj | how E,revealing |
| R1309 | T1507 | T1502 | punct | .,inhibited |
| R1310 | T1508 | T1508 | ROOT | coli O157,coli O157 |
| R1311 | T1509 | T1508 | punct | :,coli O157 |
| R1312 | T1510 | T1511 | nsubj | H7,inhibits |
| R1313 | T1511 | T1511 | ROOT | inhibits,inhibits |
| R1314 | T1512 | T1517 | det | this,mechanism |
| R1315 | T1513 | T1517 | amod | important,mechanism |
| R1316 | T1514 | T1517 | amod | innate,mechanism |
| R1317 | T1515 | T1516 | amod | immune,response |
| R1318 | T1516 | T1517 | compound | response,mechanism |
| R1319 | T1517 | T1511 | dobj | mechanism,inhibits |
| R1320 | T1518 | T1511 | punct | .,inhibits |
| R1727 | T2170 | T2171 | nummod | RPS3,phosphorylation |
| R1728 | T2171 | T2178 | nsubj | phosphorylation,test |
| R1729 | T2172 | T2171 | prep | in,phosphorylation |
| R1730 | T2173 | T2172 | pobj | response,in |
| R1731 | T2174 | T2173 | prep | to,response |
| R1732 | T2175 | T2176 | amod | NF-κB,activation |
| R1733 | T2176 | T2174 | pobj | activation,to |
| R1734 | T2177 | T2178 | aux | To,test |
| R1735 | T2178 | T2188 | npadvmod | test,performed |
| R1736 | T2179 | T2181 | mark | whether,is |
| R1737 | T2180 | T2181 | nsubj | RPS3,is |
| R1738 | T2181 | T2188 | advcl | is,performed |
| R1739 | T2182 | T2181 | acomp | phosphorylated,is |
| R1740 | T2183 | T2182 | prep | during,phosphorylated |
| R1741 | T2184 | T2185 | compound | NF-κB,activation |
| R1742 | T2185 | T2183 | pobj | activation,during |
| R1743 | T2186 | T2188 | punct | ",",performed |
| R1744 | T2187 | T2188 | nsubj | we,performed |
| R1745 | T2188 | T2199 | ccomp | performed,stimulated |
| R1746 | T2189 | T2190 | amod | 32P-labeling,experiments |
| R1747 | T2190 | T2188 | dobj | experiments,performed |
| R1748 | T2191 | T2188 | prep | in,performed |
| R1749 | T2192 | T2193 | compound | tumor,necrosis |
| R1750 | T2193 | T2194 | compound | necrosis,factor |
| R1751 | T2194 | T2191 | pobj | factor,in |
| R1752 | T2195 | T2196 | punct | (,TNF |
| R1753 | T2196 | T2194 | appos | TNF,factor |
| R1754 | T2197 | T2188 | punct | ),performed |
| R1755 | T2198 | T2199 | punct | -,stimulated |
| R1756 | T2199 | T2199 | ROOT | stimulated,stimulated |
| R1757 | T2200 | T2201 | compound | HEK,293T |
| R1758 | T2201 | T2202 | nummod | 293T,cells |
| R1759 | T2202 | T2199 | dobj | cells,stimulated |
| R1760 | T2203 | T2199 | punct | .,stimulated |
| R1761 | T2204 | T2208 | mark | While,phosphorylated |
| R1762 | T2205 | T2208 | nsubjpass | RPS3,phosphorylated |
| R1763 | T2206 | T2208 | auxpass | was,phosphorylated |
| R1764 | T2207 | T2208 | advmod | scarcely,phosphorylated |
| R1765 | T2208 | T2214 | advcl | phosphorylated,observed |
| R1766 | T2209 | T2208 | prep | in,phosphorylated |
| R1767 | T2210 | T2211 | amod | unstimulated,cells |
| R1768 | T2211 | T2209 | pobj | cells,in |
| R1769 | T2212 | T2214 | punct | ",",observed |
| R1770 | T2213 | T2214 | nsubj | we,observed |
| R1771 | T2214 | T2214 | ROOT | observed,observed |
| R1772 | T2215 | T2217 | det | a,increase |
| R1773 | T2216 | T2217 | amod | marked,increase |
| R1774 | T2217 | T2214 | dobj | increase,observed |
| R1775 | T2218 | T2217 | prep | in,increase |
| R1776 | T2219 | T2218 | pobj | 32P-incorporation,in |
| R1777 | T2220 | T2217 | prep | after,increase |
| R1778 | T2221 | T2222 | compound | TNF,stimulation |
| R1779 | T2222 | T2220 | pobj | stimulation,after |
| R1780 | T2223 | T2214 | prep | despite,observed |
| R1781 | T2224 | T2225 | det | no,increase |
| R1782 | T2225 | T2223 | pobj | increase,despite |
| R1783 | T2226 | T2225 | prep | in,increase |
| R1784 | T2227 | T2228 | nummod | RPS3,protein |
| R1785 | T2228 | T2226 | pobj | protein,in |
| R1786 | T2229 | T2230 | punct | (,Fig. |
| R1787 | T2230 | T2225 | appos | Fig.,increase |
| R1788 | T2231 | T2230 | nummod | 1a,Fig. |
| R1789 | T2232 | T2214 | punct | ),observed |
| R1790 | T2233 | T2214 | punct | .,observed |
| R1791 | T2234 | T2235 | aux | To,determine |
| R1792 | T2235 | T2243 | advcl | determine,immunoprecipitated |
| R1793 | T2236 | T2238 | det | which,residues |
| R1794 | T2237 | T2238 | compound | RPS3,residues |
| R1795 | T2238 | T2239 | nsubj | residues,were |
| R1796 | T2239 | T2235 | ccomp | were,determine |
| R1797 | T2240 | T2239 | attr | phosphorylated,were |
| R1798 | T2241 | T2243 | punct | ",",immunoprecipitated |
| R1799 | T2242 | T2243 | nsubj | we,immunoprecipitated |
| R1800 | T2243 | T2243 | ROOT | immunoprecipitated,immunoprecipitated |
| R1801 | T2244 | T2243 | dobj | RPS3,immunoprecipitated |
| R1802 | T2245 | T2243 | prep | from,immunoprecipitated |
| R1803 | T2246 | T2247 | preconj | either,resting |
| R1804 | T2247 | T2245 | pobj | resting,from |
| R1805 | T2248 | T2247 | cc | or,resting |
| R1806 | T2249 | T2250 | amod | stimulated,cells |
| R1807 | T2250 | T2247 | conj | cells,resting |
| R1808 | T2251 | T2243 | cc | and,immunoprecipitated |
| R1809 | T2252 | T2243 | conj | performed,immunoprecipitated |
| R1810 | T2253 | T2252 | xcomp | immunoblotting,performed |
| R1811 | T2254 | T2253 | prep | with,immunoblotting |
| R1812 | T2255 | T2256 | amod | phosphorylation-specific,antibodies |
| R1813 | T2256 | T2254 | pobj | antibodies,with |
| R1814 | T2257 | T2243 | punct | .,immunoprecipitated |
| R1815 | T2258 | T2259 | det | Both,TNF |
| R1816 | T2259 | T2263 | nmod | TNF,acetate/ionomycin |
| R1817 | T2260 | T2259 | cc | and,TNF |
| R1818 | T2261 | T2259 | conj | phorbol,TNF |
| R1819 | T2262 | T2263 | compound | myristate,acetate/ionomycin |
| R1820 | T2263 | T2267 | nsubj | acetate/ionomycin,stimulated |
| R1821 | T2264 | T2265 | punct | (,PMA+I |
| R1822 | T2265 | T2263 | appos | PMA+I,acetate/ionomycin |
| R1823 | T2266 | T2263 | punct | ),acetate/ionomycin |
| R1824 | T2267 | T2267 | ROOT | stimulated,stimulated |
| R1825 | T2268 | T2269 | amod | rapid,phosphorylation |
| R1826 | T2269 | T2267 | dobj | phosphorylation,stimulated |
| R1827 | T2270 | T2269 | cc | and,phosphorylation |
| R1828 | T2271 | T2269 | conj | degradaion,phosphorylation |
| R1829 | T2272 | T2269 | prep | of,phosphorylation |
| R1830 | T2273 | T2272 | pobj | IκBα,of |
| R1831 | T2274 | T2267 | prep | within,stimulated |
| R1832 | T2275 | T2276 | nummod | 5,min |
| R1833 | T2276 | T2274 | pobj | min,within |
| R1834 | T2277 | T2279 | nsubjpass | which,accompanied |
| R1835 | T2278 | T2279 | auxpass | was,accompanied |
| R1836 | T2279 | T2276 | relcl | accompanied,min |
| R1837 | T2280 | T2279 | agent | by,accompanied |
| R1838 | T2281 | T2282 | nummod | RPS3,phosphorylation |
| R1839 | T2282 | T2280 | pobj | phosphorylation,by |
| R1840 | T2283 | T2282 | prep | on,phosphorylation |
| R1841 | T2284 | T2285 | compound | serine,residues |
| R1842 | T2285 | T2283 | pobj | residues,on |
| R1843 | T2286 | T2282 | punct | (,phosphorylation |
| R1844 | T2287 | T2282 | appos | Fig.,phosphorylation |
| R1845 | T2288 | T2287 | nummod | 1b,Fig. |
| R1846 | T2289 | T2282 | cc | and,phosphorylation |
| R1847 | T2290 | T2282 | conj | data,phosphorylation |
| R1848 | T2291 | T2292 | neg | not,shown |
| R1849 | T2292 | T2279 | conj | shown,accompanied |
| R1850 | T2293 | T2292 | punct | ),shown |
| R1851 | T2294 | T2292 | punct | ",",shown |
| R1852 | T2295 | T2292 | conj | similar,shown |
| R1853 | T2296 | T2295 | prep | to,similar |
| R1854 | T2297 | T2296 | pobj | the,to |
| R1855 | T2298 | T2297 | prep | in,the |
| R1856 | T2299 | T2300 | compound | vivo,labeling |
| R1857 | T2300 | T2267 | advcl | labeling,stimulated |
| R1858 | T2301 | T2267 | punct | .,stimulated |
| R1859 | T2302 | T2305 | nsubj | We,detect |
| R1860 | T2303 | T2305 | aux | did,detect |
| R1861 | T2304 | T2305 | neg | not,detect |
| R1862 | T2305 | T2305 | ROOT | detect,detect |
| R1863 | T2306 | T2305 | dobj | tyrosine,detect |
| R1864 | T2307 | T2306 | punct | -,tyrosine |
| R1865 | T2308 | T2306 | cc | or,tyrosine |
| R1866 | T2309 | T2306 | conj | threonine-phosphorylation,tyrosine |
| R1867 | T2310 | T2306 | prep | of,tyrosine |
| R1868 | T2311 | T2310 | pobj | RPS3,of |
| R1869 | T2312 | T2313 | punct | (,Fig. |
| R1870 | T2313 | T2311 | appos | Fig.,RPS3 |
| R1871 | T2314 | T2313 | nummod | 1b,Fig. |
| R1872 | T2315 | T2311 | punct | ),RPS3 |
| R1873 | T2316 | T2305 | punct | .,detect |
| R2231 | T2826 | T2829 | nummod | RPS3,interaction |
| R2232 | T2827 | T2826 | cc | and,RPS3 |
| R2233 | T2828 | T2829 | compound | IKKβ,interaction |
| R2234 | T2829 | T2857 | nsubj | interaction,is |
| R2235 | T2830 | T2831 | det | The,activation |
| R2236 | T2831 | T2842 | nsubj | activation,consisting |
| R2237 | T2832 | T2831 | prep | of,activation |
| R2238 | T2833 | T2834 | det | the,inhibitor |
| R2239 | T2834 | T2832 | pobj | inhibitor,of |
| R2240 | T2835 | T2834 | prep | of,inhibitor |
| R2241 | T2836 | T2837 | compound | κB,kinase |
| R2242 | T2837 | T2835 | pobj | kinase,of |
| R2243 | T2838 | T2839 | punct | (,IKK |
| R2244 | T2839 | T2837 | appos | IKK,kinase |
| R2245 | T2840 | T2839 | punct | ),IKK |
| R2246 | T2841 | T2831 | punct | ",",activation |
| R2247 | T2842 | T2829 | acl | consisting,interaction |
| R2248 | T2843 | T2842 | prep | of,consisting |
| R2249 | T2844 | T2846 | det | a,subunit |
| R2250 | T2845 | T2846 | amod | regulatory,subunit |
| R2251 | T2846 | T2843 | pobj | subunit,of |
| R2252 | T2847 | T2846 | appos | IKKγ,subunit |
| R2253 | T2848 | T2842 | cc | and,consisting |
| R2254 | T2849 | T2851 | nummod | two,subunits |
| R2255 | T2850 | T2851 | amod | catalytic,subunits |
| R2256 | T2851 | T2842 | conj | subunits,consisting |
| R2257 | T2852 | T2851 | punct | ",",subunits |
| R2258 | T2853 | T2851 | appos | IKKα,subunits |
| R2259 | T2854 | T2853 | cc | and,IKKα |
| R2260 | T2855 | T2853 | conj | IKKβ,IKKα |
| R2261 | T2856 | T2857 | punct | ",",is |
| R2262 | T2857 | T2857 | ROOT | is,is |
| R2263 | T2858 | T2857 | acomp | critical,is |
| R2264 | T2859 | T2858 | prep | for,critical |
| R2265 | T2860 | T2861 | det | the,phosphorylation |
| R2266 | T2861 | T2859 | pobj | phosphorylation,for |
| R2267 | T2862 | T2861 | cc | and,phosphorylation |
| R2268 | T2863 | T2861 | conj | dispatch,phosphorylation |
| R2269 | T2864 | T2861 | prep | of,phosphorylation |
| R2270 | T2865 | T2867 | det | the,IκBs |
| R2271 | T2866 | T2867 | amod | inhibitory,IκBs |
| R2272 | T2867 | T2864 | pobj | IκBs,of |
| R2273 | T2868 | T2867 | cc | and,IκBs |
| R2348 | T2943 | T2939 | pobj | transcription,for |
| R2349 | T2944 | T2943 | acl | required,transcription |
| R2350 | T2945 | T2944 | prep | for,required |
| R2351 | T2946 | T2947 | compound | cell,proliferation |
| R2352 | T2947 | T2945 | pobj | proliferation,for |
| R2353 | T2948 | T2947 | cc | and,proliferation |
| R2354 | T2949 | T2947 | conj | survival,proliferation |
| R2355 | T2950 | T2921 | punct | .,examined |
| R2356 | T2951 | T2952 | amod | RPS3-IKKβ,association |
| R2357 | T2952 | T2955 | nsubjpass | association,augmented |
| R2358 | T2953 | T2955 | auxpass | was,augmented |
| R2359 | T2954 | T2955 | advmod | clearly,augmented |
| R2360 | T2955 | T2955 | ROOT | augmented,augmented |
| R2361 | T2956 | T2955 | prep | upon,augmented |
| R2362 | T2957 | T2958 | compound | TNF,stimulation |
| R2363 | T2958 | T2956 | pobj | stimulation,upon |
| R2364 | T2959 | T2955 | punct | ",",augmented |
| R2365 | T2960 | T2955 | advcl | peaking,augmented |
| R2366 | T2961 | T2960 | prep | at,peaking |
| R2367 | T2962 | T2963 | nummod | 10,min |
| R2368 | T2963 | T2961 | pobj | min,at |
| R2369 | T2964 | T2955 | punct | .,augmented |
| R2370 | T2965 | T2970 | punct | (,following |
| R2371 | T2966 | T2966 | ROOT | Fig.,Fig. |
| R2372 | T2967 | T2966 | nummod | 1d,Fig. |
| R2373 | T2968 | T2966 | punct | ),Fig. |
| R2374 | T2969 | T2970 | punct | ",",following |
| R2375 | T2970 | T2970 | ROOT | following,following |
| R2376 | T2971 | T2972 | amod | similar,kinetics |
| R2377 | T2972 | T2970 | dobj | kinetics,following |
| R2378 | T2973 | T2970 | prep | to,following |
| R2379 | T2974 | T2976 | nummod | RPS3,phosphorylation |
| R2380 | T2975 | T2976 | compound | serine,phosphorylation |
| R2381 | T2976 | T2973 | pobj | phosphorylation,to |
| R2382 | T2977 | T2976 | punct | (,phosphorylation |
| R2383 | T2978 | T2976 | appos | Fig.,phosphorylation |
| R2384 | T2979 | T2978 | nummod | 1b,Fig. |
| R2385 | T2980 | T2976 | punct | ),phosphorylation |
| R2386 | T2981 | T2970 | punct | .,following |
| R2387 | T2982 | T2986 | prep | By,was |
| R2388 | T2983 | T2982 | pobj | contrast,By |
| R2389 | T2984 | T2986 | punct | ",",was |
| R2390 | T2985 | T2986 | expl | there,was |
| R2391 | T2986 | T2986 | ROOT | was,was |
| R2392 | T2987 | T2989 | det | no,interaction |
| R2393 | T2988 | T2989 | amod | detectable,interaction |
| R2394 | T2989 | T2986 | attr | interaction,was |
| R2395 | T2990 | T2989 | prep | between,interaction |
| R2396 | T2991 | T2990 | pobj | RPS3,between |
| R2397 | T2992 | T2991 | cc | and,RPS3 |
| R2398 | T2993 | T2991 | conj | IKKα,RPS3 |
| R2399 | T2994 | T2995 | punct | (,Fig. |
| R2400 | T2995 | T2993 | appos | Fig.,IKKα |
| R2401 | T2996 | T2995 | nummod | 1d,Fig. |
| R2402 | T2997 | T2993 | punct | ),IKKα |
| R2403 | T2998 | T2986 | punct | .,was |
| R3096 | T3905 | T3908 | nsubj | TNF,triggered |
| R3097 | T3906 | T3905 | cc | and,TNF |
| R3098 | T3907 | T3905 | conj | PMA+I,TNF |
| R3099 | T3908 | T3908 | ROOT | triggered,triggered |
| R3100 | T3909 | T3911 | nummod | RPS3,translocation |
| R3101 | T3910 | T3911 | amod | nuclear,translocation |
| R3102 | T3911 | T3908 | dobj | translocation,triggered |
| R3103 | T3912 | T3911 | prep | in,translocation |
| R3104 | T3913 | T3914 | compound | Jurkat,cells |
| R3105 | T3914 | T3912 | pobj | cells,in |
| R3106 | T3915 | T3908 | conj | transfected,triggered |
| R3107 | T3916 | T3915 | prep | with,transfected |
| R3108 | T3917 | T3919 | det | a,nonspecific |
| R3109 | T3918 | T3919 | amod | scrambled,nonspecific |
| R3110 | T3919 | T3916 | pobj | nonspecific,with |
| R3111 | T3920 | T3923 | punct | (,siRNA |
| R3112 | T3921 | T3923 | nmod | NS,siRNA |
| R3113 | T3922 | T3923 | punct | ),siRNA |
| R3114 | T3923 | T3919 | appos | siRNA,nonspecific |
| R3115 | T3924 | T3923 | punct | (,siRNA |
| R3116 | T3925 | T3923 | appos | Fig.,siRNA |
| R3117 | T3926 | T3925 | nummod | 2a,Fig. |
| R3118 | T3927 | T3925 | punct | ),Fig. |
| R3119 | T3928 | T3923 | npadvmod | 6,siRNA |
| R3120 | T3929 | T3923 | punct | .,siRNA |
| R3121 | T3930 | T3932 | nummod | RPS3,translocation |
| R3122 | T3931 | T3932 | amod | nuclear,translocation |
| R3123 | T3932 | T3933 | nsubj | translocation,was |
| R3124 | T3933 | T3933 | ROOT | was,was |
| R3125 | T3934 | T3935 | advmod | only,slightly |
| R3126 | T3935 | T3933 | advmod | slightly,was |
| R3127 | T3936 | T3933 | punct | ",",was |
| R3128 | T3937 | T3941 | mark | if,impaired |
| R3129 | T3938 | T3939 | advmod | at,all |
| R3130 | T3939 | T3941 | dep | all,impaired |
| R3131 | T3940 | T3941 | punct | ",",impaired |
| R2274 | T2869 | T2870 | det | the,liberation |
| R2275 | T2870 | T2867 | conj | liberation,IκBs |
| R2276 | T2871 | T2870 | prep | of,liberation |
| R2277 | T2872 | T2871 | pobj | NF-κB20-22,of |
| R2278 | T2873 | T2857 | punct | .,is |
| R2279 | T2874 | T2891 | prep | Given,hypothesized |
| R2280 | T2875 | T2879 | mark | that,found |
| R2281 | T2876 | T2879 | nsubjpass | RPS3,found |
| R2282 | T2877 | T2879 | aux | can,found |
| R2283 | T2878 | T2879 | auxpass | be,found |
| R2284 | T2879 | T2874 | pcomp | found,Given |
| R2285 | T2880 | T2879 | prep | in,found |
| R2286 | T2881 | T2885 | det | the,complex |
| R2287 | T2882 | T2885 | amod | cytoplasmic,complex |
| R2288 | T2883 | T2885 | compound | p65-p50-IκBα,complex |
| R2289 | T2884 | T2885 | compound | inhibitory,complex |
| R2290 | T2885 | T2880 | pobj | complex,in |
| R2291 | T2886 | T2885 | prep | in,complex |
| R2292 | T2887 | T2886 | pcomp | resting,in |
| R2293 | T2888 | T2887 | dobj | cells6,resting |
| R2294 | T2889 | T2891 | punct | ",",hypothesized |
| R2295 | T2890 | T2891 | nsubj | we,hypothesized |
| R2296 | T2891 | T2891 | ROOT | hypothesized,hypothesized |
| R2297 | T2892 | T2897 | mark | that,bind |
| R2298 | T2893 | T2894 | amod | activated,IKKβ |
| R2299 | T2894 | T2897 | nsubj | IKKβ,bind |
| R2300 | T2895 | T2897 | aux | might,bind |
| R2301 | T2896 | T2897 | advmod | also,bind |
| R2302 | T2897 | T2891 | ccomp | bind,hypothesized |
| R2303 | T2898 | T2897 | prep | to,bind |
| R2304 | T2899 | T2897 | cc | and,bind |
| R2305 | T2900 | T2901 | compound | phosphorylate,RPS3 |
| R2306 | T2901 | T2897 | conj | RPS3,bind |
| R2307 | T2902 | T2891 | punct | .,hypothesized |
| R2308 | T2903 | T2906 | advmod | First,found |
| R2309 | T2904 | T2906 | punct | ",",found |
| R2310 | T2905 | T2906 | nsubj | we,found |
| R2311 | T2906 | T2906 | ROOT | found,found |
| R2312 | T2907 | T2909 | mark | that,expressed |
| R2313 | T2908 | T2909 | nsubj | ectopically,expressed |
| R2314 | T2909 | T2906 | ccomp | expressed,found |
| R2315 | T2910 | T2913 | nsubj | IKKβ,interacted |
| R2316 | T2911 | T2910 | cc | and,IKKβ |
| R2317 | T2912 | T2910 | conj | RPS3,IKKβ |
| R2318 | T2913 | T2906 | conj | interacted,found |
| R2319 | T2914 | T2913 | punct | (,interacted |
| R2320 | T2915 | T2913 | dobj | Fig.,interacted |
| R2321 | T2916 | T2915 | nummod | 1c,Fig. |
| R2322 | T2917 | T2915 | punct | ),Fig. |
| R2323 | T2918 | T2913 | punct | .,interacted |
| R2324 | T2919 | T2921 | nsubj | We,examined |
| R2325 | T2920 | T2921 | advmod | next,examined |
| R2326 | T2921 | T2921 | ROOT | examined,examined |
| R2327 | T2922 | T2921 | xcomp | resting,examined |
| R2328 | T2923 | T2924 | compound | Jurkat,cells |
| R2329 | T2924 | T2922 | dobj | cells,resting |
| R2330 | T2925 | T2921 | cc | and,examined |
| R2331 | T2926 | T2921 | conj | detected,examined |
| R2332 | T2927 | T2931 | det | a,interaction |
| R2333 | T2928 | T2931 | amod | modest,interaction |
| R2334 | T2929 | T2931 | amod | endogenous,interaction |
| R2335 | T2930 | T2931 | amod | IKKβ-RPS3,interaction |
| R2336 | T2931 | T2926 | dobj | interaction,detected |
| R2337 | T2932 | T2931 | punct | (,interaction |
| R2338 | T2933 | T2931 | appos | Fig.,interaction |
| R2339 | T2934 | T2933 | nummod | 1d,Fig. |
| R2340 | T2935 | T2933 | punct | ),Fig. |
| R2341 | T2936 | T2931 | punct | ",",interaction |
| R2342 | T2937 | T2938 | advmod | potentially,accounting |
| R2343 | T2938 | T2926 | advcl | accounting,detected |
| R2344 | T2939 | T2938 | prep | for,accounting |
| R2345 | T2940 | T2943 | det | the,transcription |
| R2346 | T2941 | T2943 | amod | basal,transcription |
| R2347 | T2942 | T2943 | compound | NF-κB,transcription |
| R3050 | T3859 | T3861 | nsubjpass | IKKβ,required |
| R3051 | T3860 | T3861 | auxpass | is,required |
| R3052 | T3861 | T3880 | ccomp | required,knocked |
| R3053 | T3862 | T3861 | prep | for,required |
| R3054 | T3863 | T3865 | nmod | RPS3,translocation |
| R3055 | T3864 | T3865 | amod | nuclear,translocation |
| R3056 | T3865 | T3867 | nsubj | translocation,examine |
| R3057 | T3866 | T3867 | aux | To,examine |
| R3058 | T3867 | T3861 | advcl | examine,required |
| R3059 | T3868 | T3873 | mark | whether,required |
| R3060 | T3869 | T3871 | det | the,interaction |
| R3061 | T3870 | T3871 | compound | RPS3-IKKβ,interaction |
| R3062 | T3871 | T3873 | nsubjpass | interaction,required |
| R3063 | T3872 | T3873 | auxpass | is,required |
| R3064 | T3873 | T3867 | ccomp | required,examine |
| R3065 | T3874 | T3873 | prep | for,required |
| R3066 | T3875 | T3877 | nmod | RPS3,translocation |
| R3067 | T3876 | T3877 | amod | nuclear,translocation |
| R3068 | T3877 | T3874 | pobj | translocation,for |
| R3069 | T3878 | T3880 | punct | ",",knocked |
| R3070 | T3879 | T3880 | nsubj | we,knocked |
| R3071 | T3880 | T3880 | ROOT | knocked,knocked |
| R3072 | T3881 | T3880 | prt | down,knocked |
| R3073 | T3882 | T3885 | poss | IKKα,expression |
| R3074 | T3883 | T3882 | cc | or,IKKα |
| R3075 | T3884 | T3882 | conj | IKKβ,IKKα |
| R3076 | T3885 | T3880 | dobj | expression,knocked |
| R3077 | T3886 | T3880 | prep | with,knocked |
| R3078 | T3887 | T3886 | pobj | siRNAs,with |
| R3079 | T3888 | T3890 | punct | (,Fig. |
| R3080 | T3889 | T3890 | compound | Supplementary,Fig. |
| R3081 | T3890 | T3880 | parataxis | Fig.,knocked |
| R3082 | T3891 | T3890 | nummod | 1,Fig. |
| R3083 | T3892 | T3890 | punct | ),Fig. |
| R3084 | T3893 | T3880 | cc | and,knocked |
| R3085 | T3894 | T3895 | advmod | then,observed |
| R3086 | T3895 | T3880 | conj | observed,knocked |
| R3087 | T3896 | T3899 | amod | stimulation-induced,migration |
| R3088 | T3897 | T3899 | nmod | RPS3,migration |
| R3089 | T3898 | T3899 | amod | nuclear,migration |
| R3090 | T3899 | T3895 | dobj | migration,observed |
| R3091 | T3900 | T3899 | prep | by,migration |
| R3092 | T3901 | T3902 | amod | confocal,microscopy |
| R3093 | T3902 | T3900 | pobj | microscopy,by |
| R3094 | T3903 | T3880 | punct | .,knocked |
| R3095 | T3904 | T3905 | det | Both,TNF |
| R3171 | T3980 | T3979 | acomp | necessary,was |
| R3172 | T3981 | T3980 | prep | for,necessary |
| R3173 | T3982 | T3985 | amod | activation-induced,translocation |
| R3174 | T3983 | T3985 | amod | RPS3,translocation |
| R3175 | T3984 | T3985 | amod | nuclear,translocation |
| R3176 | T3985 | T3981 | pobj | translocation,for |
| R3177 | T3986 | T3985 | punct | (,translocation |
| R3178 | T3987 | T3985 | appos | Fig.,translocation |
| R3179 | T3988 | T3987 | nummod | 2b,Fig. |
| R3180 | T3989 | T3985 | punct | ),translocation |
| R3181 | T3990 | T3979 | punct | .,was |
| R3182 | T3991 | T3992 | compound | Control,immunoblots |
| R3183 | T3992 | T3993 | nsubj | immunoblots,revealed |
| R3184 | T3993 | T3993 | ROOT | revealed,revealed |
| R3185 | T3994 | T3999 | mark | that,blocked |
| R3186 | T3995 | T3997 | nummod | p65,translocation |
| R3187 | T3996 | T3997 | amod | nuclear,translocation |
| R3188 | T3997 | T3999 | nsubjpass | translocation,blocked |
| R3189 | T3998 | T3999 | auxpass | was,blocked |
| R3190 | T3999 | T3993 | ccomp | blocked,revealed |
| R3191 | T4000 | T3999 | prep | under,blocked |
| R3192 | T4001 | T4003 | det | the,conditions |
| R3193 | T4002 | T4003 | amod | same,conditions |
| R3194 | T4003 | T4000 | pobj | conditions,under |
| R3195 | T4004 | T3999 | punct | (,blocked |
| R3196 | T4005 | T4007 | nmod | Fig.,) |
| R3197 | T4006 | T4005 | nummod | 2b,Fig. |
| R3198 | T4007 | T3999 | punct | ),blocked |
| R3199 | T4008 | T3993 | punct | .,revealed |
| R3200 | T4009 | T4011 | nsubj | We,examined |
| R3201 | T4010 | T4011 | advmod | next,examined |
| R3202 | T4011 | T4011 | ROOT | examined,examined |
| R3203 | T4012 | T4014 | det | the,translocation |
| R3204 | T4013 | T4014 | amod | nuclear,translocation |
| R3205 | T4014 | T4011 | dobj | translocation,examined |
| R3206 | T4015 | T4014 | prep | of,translocation |
| R3207 | T4016 | T4015 | pobj | RPS3,of |
| R3208 | T4017 | T4014 | prep | in,translocation |
| R3132 | T3941 | T3933 | advcl | impaired,was |
| R3133 | T3942 | T3941 | agent | by,impaired |
| R3134 | T3943 | T3942 | pobj | IKKα-silencing,by |
| R3135 | T3944 | T3941 | punct | .,impaired |
| R3136 | T3945 | T3950 | advmod | Conversely,attenuated |
| R3137 | T3946 | T3950 | punct | ",",attenuated |
| R3138 | T3947 | T3950 | nsubj | knockdown,attenuated |
| R3139 | T3948 | T3947 | prep | of,knockdown |
| R3140 | T3949 | T3948 | pobj | IKKβ,of |
| R3141 | T3950 | T3950 | ROOT | attenuated,attenuated |
| R3142 | T3951 | T3952 | nummod | 60-70,% |
| R3143 | T3952 | T3950 | dobj | %,attenuated |
| R3144 | T3953 | T3952 | prep | of,% |
| R3145 | T3954 | T3956 | nummod | RPS3,accumulation |
| R3146 | T3955 | T3956 | amod | nuclear,accumulation |
| R3147 | T3956 | T3953 | pobj | accumulation,of |
| R3148 | T3957 | T3950 | prep | following,attenuated |
| R3149 | T3958 | T3957 | pobj | stimulation,following |
| R3150 | T3959 | T3957 | punct | (,following |
| R3151 | T3960 | T3962 | nmod | Fig.,) |
| R3152 | T3961 | T3960 | nummod | 2a,Fig. |
| R3153 | T3962 | T3950 | punct | ),attenuated |
| R3154 | T3963 | T3950 | punct | .,attenuated |
| R3155 | T3964 | T3968 | nsubj | Immunoblotting,confirmed |
| R3156 | T3965 | T3964 | prep | of,Immunoblotting |
| R3157 | T3966 | T3967 | amod | nuclear,fractions |
| R3158 | T3967 | T3965 | pobj | fractions,of |
| R3159 | T3968 | T3968 | ROOT | confirmed,confirmed |
| R3160 | T3969 | T3971 | det | that,expression |
| R3161 | T3970 | T3971 | amod | full,expression |
| R3162 | T3971 | T3968 | dobj | expression,confirmed |
| R3163 | T3972 | T3971 | prep | of,expression |
| R3164 | T3973 | T3972 | pobj | IKKβ,of |
| R3165 | T3974 | T3971 | punct | ",",expression |
| R3166 | T3975 | T3971 | cc | but,expression |
| R3167 | T3976 | T3977 | neg | not,IKKα |
| R3168 | T3977 | T3971 | conj | IKKα,expression |
| R3169 | T3978 | T3979 | punct | ",",was |
| R3170 | T3979 | T3971 | conj | was,expression |
| R3321 | T4130 | T4129 | dobj | ones,expressing |
| R3322 | T4131 | T4129 | punct | (,expressing |
| R3323 | T4132 | T4133 | compound | Fig.,2d |
| R3324 | T4133 | T4129 | npadvmod | 2d,expressing |
| R3325 | T4134 | T4129 | cc | and,expressing |
| R3326 | T4135 | T4136 | compound | Supplementary,Fig. |
| R3327 | T4136 | T4129 | conj | Fig.,expressing |
| R3328 | T4137 | T4136 | nummod | 2,Fig. |
| R3329 | T4138 | T4136 | punct | ),Fig. |
| R3330 | T4139 | T4110 | punct | .,increased |
| R3331 | T4140 | T4144 | advmod | Thus,is |
| R3332 | T4141 | T4144 | punct | ",",is |
| R3333 | T4142 | T4143 | amod | IKKβ,activity |
| R3343 | T4152 | T4144 | prep | in,is |
| R3344 | T4153 | T4152 | pobj | response,in |
| R3345 | T4154 | T4153 | prep | to,response |
| R3346 | T4155 | T4156 | nsubj | NF-κB,activating |
| R3347 | T4156 | T4154 | pcomp | activating,to |
| R3348 | T4157 | T4156 | dobj | stimuli,activating |
| R3349 | T4158 | T4144 | punct | .,is |
| R4530 | T5651 | T5650 | pobj | parallel,in |
| R4531 | T5652 | T5651 | prep | to,parallel |
| R4532 | T5653 | T5649 | punct | ",",occurs |
| R4533 | T5654 | T5649 | cc | but,occurs |
| R4534 | T5655 | T5656 | advmod | independently,of |
| R4535 | T5656 | T5649 | conj | of,occurs |
| R4536 | T5657 | T5656 | punct | ",",of |
| R4537 | T5658 | T5659 | nummod | p65,translocation6 |
| R4538 | T5659 | T5656 | pobj | translocation6,of |
| R4539 | T5660 | T5649 | punct | .,occurs |
| R4540 | T5661 | T5662 | nsubj | We,envisioned |
| R4541 | T5662 | T5662 | ROOT | envisioned,envisioned |
| R4542 | T5663 | T5667 | mark | that,utilize |
| R4543 | T5664 | T5667 | nsubj | RPS3,utilize |
| R4544 | T5665 | T5667 | aux | could,utilize |
| R4545 | T5666 | T5667 | advmod | also,utilize |
| R4546 | T5667 | T5662 | ccomp | utilize,envisioned |
| R4547 | T5668 | T5672 | det | the,pathway |
| R4548 | T5669 | T5672 | amod | importin-α,pathway |
| R4549 | T5670 | T5672 | nmod | /,pathway |
| R4550 | T5671 | T5672 | compound | β,pathway |
| R4551 | T5672 | T5667 | dobj | pathway,utilize |
| R4552 | T5673 | T5662 | punct | .,envisioned |
| R4553 | T5674 | T5689 | advmod | Consistent,enhanced |
| R4554 | T5675 | T5674 | prep | with,Consistent |
| R3209 | T4018 | T4017 | pobj | cells,in |
| R3210 | T4019 | T4020 | advmod | ectopically,expressing |
| R3211 | T4020 | T4011 | advcl | expressing,examined |
| R3212 | T4021 | T4022 | preconj | either,kinase-dead |
| R3213 | T4022 | T4020 | dobj | kinase-dead,expressing |
| R3214 | T4023 | T4022 | punct | (,kinase-dead |
| R3215 | T4024 | T4022 | appos | SSAA,kinase-dead |
| R3216 | T4025 | T4024 | punct | ),SSAA |
| R3217 | T4026 | T4022 | cc | or,kinase-dead |
| R3218 | T4027 | T4022 | conj | constitutively-active,kinase-dead |
| R3219 | T4028 | T4027 | punct | (,constitutively-active |
| R3220 | T4029 | T4027 | appos | SSEE,constitutively-active |
| R3221 | T4030 | T4027 | punct | ),constitutively-active |
| R3222 | T4031 | T4033 | amod | mutant,proteins |
| R3223 | T4032 | T4033 | compound | IKKβ,proteins |
| R3224 | T4033 | T4022 | conj | proteins,kinase-dead |
| R3225 | T4034 | T4011 | punct | .,examined |
| R3226 | T4035 | T4036 | mark | As,expected |
| R3227 | T4036 | T4048 | advcl | expected,induced |
| R3228 | T4037 | T4048 | punct | ",",induced |
| R3229 | T4038 | T4039 | det | the,SSEE |
| R3230 | T4039 | T4048 | nsubj | SSEE,induced |
| R3231 | T4040 | T4039 | punct | ",",SSEE |
| R3232 | T4041 | T4039 | cc | but,SSEE |
| R3233 | T4042 | T4041 | neg | not,but |
| R3234 | T4043 | T4048 | nsubj | SSAA,induced |
| R3235 | T4044 | T4043 | punct | ",",SSAA |
| R3236 | T4045 | T4048 | nsubj | mutant,induced |
| R3237 | T4046 | T4045 | prep | of,mutant |
| R3238 | T4047 | T4046 | pobj | IKKβ,of |
| R3239 | T4048 | T4048 | ROOT | induced,induced |
| R3240 | T4049 | T4052 | amod | NF-κB-dependent,activity |
| R3241 | T4050 | T4052 | compound | luciferase,activity |
| R3242 | T4051 | T4052 | compound | reporter,activity |
| R3243 | T4052 | T4048 | dobj | activity,induced |
| R3244 | T4053 | T4054 | punct | (,Fig. |
| R3245 | T4054 | T4052 | appos | Fig.,activity |
| R3246 | T4055 | T4054 | nummod | 2c,Fig. |
| R3247 | T4056 | T4057 | punct | ",",left |
| R3248 | T4057 | T4048 | conj | left,induced |
| R3249 | T4058 | T4057 | punct | ),left |
| R3250 | T4059 | T4048 | punct | .,induced |
| R3251 | T4060 | T4062 | mark | Whereas,remained |
| R3252 | T4061 | T4062 | nsubj | RPS3,remained |
| R3253 | T4062 | T4062 | ROOT | remained,remained |
| R3254 | T4063 | T4062 | acomp | cytosolic,remained |
| R3255 | T4064 | T4062 | prep | in,remained |
| R3256 | T4065 | T4064 | pobj | IKKβ,in |
| R3257 | T4066 | T4065 | punct | (,IKKβ |
| R3258 | T4067 | T4065 | appos | SSAA,IKKβ |
| R3259 | T4068 | T4065 | punct | ),IKKβ |
| R3260 | T4069 | T4070 | punct | -,expressing |
| R3261 | T4070 | T4062 | advcl | expressing,remained |
| R3262 | T4071 | T4070 | dobj | cells,expressing |
| R3263 | T4072 | T4070 | punct | (,expressing |
| R3264 | T4073 | T4074 | compound | Fig.,2c |
| R3265 | T4074 | T4070 | npadvmod | 2c,expressing |
| R3266 | T4075 | T4076 | punct | ",",right |
| R3267 | T4076 | T4070 | conj | right,expressing |
| R3268 | T4077 | T4076 | punct | ),right |
| R3269 | T4078 | T4076 | punct | ",",right |
| R3270 | T4079 | T4081 | det | a,proportion |
| R3271 | T4080 | T4081 | amod | substantial,proportion |
| R3272 | T4081 | T4076 | appos | proportion,right |
| R3273 | T4082 | T4081 | prep | of,proportion |
| R3274 | T4083 | T4084 | nummod | RPS3,translocated |
| R3275 | T4084 | T4082 | pobj | translocated,of |
| R3276 | T4085 | T4084 | prep | to,translocated |
| R3277 | T4086 | T4087 | det | the,nucleus |
| R3278 | T4087 | T4085 | pobj | nucleus,to |
| R3279 | T4088 | T4087 | prep | in,nucleus |
| R3280 | T4089 | T4088 | pobj | cells,in |
| R3281 | T4090 | T4089 | acl | expressing,cells |
| R3282 | T4091 | T4090 | dobj | IKKβ,expressing |
| R3283 | T4092 | T4091 | punct | (,IKKβ |
| R3284 | T4093 | T4091 | appos | SSEE,IKKβ |
| R3285 | T4094 | T4091 | punct | ),IKKβ |
| R3286 | T4095 | T4096 | punct | (,Fig. |
| R3287 | T4096 | T4091 | nmod | Fig.,IKKβ |
| R3288 | T4097 | T4090 | npadvmod | 2c,expressing |
| R3289 | T4098 | T4099 | punct | ",",right |
| R3290 | T4099 | T4081 | conj | right,proportion |
| R3291 | T4100 | T4099 | punct | ),right |
| R3292 | T4101 | T4062 | punct | .,remained |
| R3293 | T4102 | T4103 | det | The,percentage |
| R3294 | T4103 | T4110 | nsubj | percentage,increased |
| R3295 | T4104 | T4103 | prep | of,percentage |
| R3296 | T4105 | T4104 | pobj | cells,of |
| R3297 | T4106 | T4105 | acl | containing,cells |
| R3298 | T4107 | T4109 | amod | detectable,RPS3 |
| R3299 | T4108 | T4109 | amod | nuclear,RPS3 |
| R3300 | T4109 | T4106 | dobj | RPS3,containing |
| R3301 | T4110 | T4110 | ROOT | increased,increased |
| R3302 | T4111 | T4110 | dobj | 5-fold,increased |
| R3303 | T4112 | T4110 | prep | in,increased |
| R3304 | T4113 | T4112 | pobj | IKKβ,in |
| R3305 | T4114 | T4113 | punct | (,IKKβ |
| R3306 | T4115 | T4113 | appos | SSEE,IKKβ |
| R3307 | T4116 | T4113 | punct | ),IKKβ |
| R3308 | T4117 | T4110 | punct | -,increased |
| R3309 | T4118 | T4110 | advcl | expressing,increased |
| R3310 | T4119 | T4118 | dobj | cells,expressing |
| R3311 | T4120 | T4110 | punct | ",",increased |
| R3312 | T4121 | T4110 | cc | but,increased |
| R3313 | T4122 | T4123 | neg | not,in |
| R3314 | T4123 | T4129 | prep | in,expressing |
| R3315 | T4124 | T4123 | pobj | IKKβ,in |
| R3316 | T4125 | T4124 | punct | (,IKKβ |
| R3317 | T4126 | T4124 | appos | SSAA,IKKβ |
| R3318 | T4127 | T4124 | punct | ),IKKβ |
| R3319 | T4128 | T4129 | punct | -,expressing |
| R3320 | T4129 | T4110 | conj | expressing,increased |
| R4496 | T5617 | T5618 | compound | IκBα,degradation |
| R4497 | T5618 | T5624 | nsubj | degradation,regulates |
| R4498 | T5619 | T5618 | cc | and,degradation |
| R4499 | T5620 | T5622 | amod | RPS3,translocation |
| R4500 | T5621 | T5622 | amod | nuclear,translocation |
| R4501 | T5622 | T5623 | compound | translocation,Importin-α |
| R4502 | T5623 | T5624 | nsubj | Importin-α,regulates |
| R4503 | T5624 | T5624 | ROOT | regulates,regulates |
| R4504 | T5625 | T5627 | det | the,import |
| R4505 | T5626 | T5627 | amod | nuclear,import |
| R4506 | T5627 | T5624 | dobj | import,regulates |
| R4507 | T5628 | T5627 | prep | of,import |
| R4508 | T5629 | T5630 | compound | NF-κB,Rel |
| R4509 | T5630 | T5628 | pobj | Rel,of |
| R4510 | T5631 | T5630 | appos | subunits23,Rel |
| R4511 | T5632 | T5630 | punct | ",",Rel |
| R4512 | T5633 | T5630 | appos | 24,Rel |
| R4513 | T5634 | T5624 | punct | .,regulates |
| R4514 | T5635 | T5636 | nummod | RPS3,harbors |
| R4515 | T5636 | T5649 | dep | harbors,occurs |
| R4516 | T5637 | T5640 | det | a,signal |
| R4517 | T5638 | T5639 | amod | nuclear,localization |
| R4518 | T5639 | T5640 | compound | localization,signal |
| R4519 | T5640 | T5636 | dobj | signal,harbors |
| R4520 | T5641 | T5642 | punct | (,NLS |
| R4521 | T5642 | T5640 | appos | NLS,signal |
| R4522 | T5643 | T5642 | punct | ),NLS |
| R4523 | T5644 | T5640 | conj | sequence,signal |
| R4524 | T5645 | T5644 | cc | and,sequence |
| R4525 | T5646 | T5648 | poss | its,translocation |
| R4526 | T5647 | T5648 | amod | nuclear,translocation |
| R4527 | T5648 | T5649 | nsubj | translocation,occurs |
| R4528 | T5649 | T5649 | ROOT | occurs,occurs |
| R4529 | T5650 | T5649 | prep | in,occurs |
| R4618 | T5739 | T5742 | det | the,complex |
| R4619 | T5740 | T5742 | amod | cytoplasmic,complex |
| R4620 | T5741 | T5742 | compound | inhibitory,complex |
| R4621 | T5742 | T5738 | pobj | complex,in |
| R4622 | T5743 | T5745 | punct | ",",tested |
| R4623 | T5744 | T5745 | nsubj | we,tested |
| R4624 | T5745 | T5720 | conj | tested,is |
| R4625 | T5746 | T5750 | mark | whether,required |
| R4626 | T5747 | T5748 | compound | IκBα,degradation |
| R4627 | T5748 | T5750 | nsubjpass | degradation,required |
| R4628 | T5749 | T5750 | auxpass | is,required |
| R4629 | T5750 | T5745 | ccomp | required,tested |
| R4555 | T5676 | T5677 | det | this,notion |
| R4556 | T5677 | T5675 | pobj | notion,with |
| R4557 | T5678 | T5689 | punct | ",",enhanced |
| R4558 | T5679 | T5680 | amod | RPS3,association |
| R4559 | T5680 | T5689 | nsubjpass | association,enhanced |
| R4560 | T5681 | T5680 | prep | with,association |
| R4561 | T5682 | T5681 | pobj | importin-α,with |
| R4562 | T5683 | T5680 | punct | ",",association |
| R4563 | T5684 | T5680 | cc | but,association |
| R4564 | T5685 | T5686 | neg | not,importin-β |
| R4565 | T5686 | T5680 | conj | importin-β,association |
| R4566 | T5687 | T5689 | punct | ",",enhanced |
| R4567 | T5688 | T5689 | auxpass | was,enhanced |
| R4568 | T5689 | T5689 | ROOT | enhanced,enhanced |
| R4569 | T5690 | T5689 | prep | in,enhanced |
| R4570 | T5691 | T5690 | pobj | TNF,in |
| R4584 | T5705 | T5702 | ccomp | binding,examined |
| R4585 | T5706 | T5707 | aux | to,importin-α |
| R4586 | T5707 | T5705 | xcomp | importin-α,binding |
| R4587 | T5708 | T5708 | ROOT | is,is |
| R4588 | T5709 | T5708 | acomp | essential,is |
| R4589 | T5710 | T5708 | prep | for,is |
| R4590 | T5711 | T5712 | amod | nuclear,translocation |
| R4591 | T5712 | T5710 | pobj | translocation,for |
| R4592 | T5713 | T5712 | prep | during,translocation |
| R4593 | T5714 | T5715 | compound | NF-κB,activation |
| R4594 | T5715 | T5713 | pobj | activation,during |
| R4595 | T5716 | T5708 | punct | .,is |
| R4596 | T5717 | T5720 | mark | Since,is |
| R4597 | T5718 | T5719 | compound | IκBα,degradation |
| R4598 | T5719 | T5720 | nsubj | degradation,is |
| R4599 | T5720 | T5720 | ROOT | is,is |
| R4600 | T5721 | T5722 | det | a,prerequisite |
| R4601 | T5722 | T5720 | attr | prerequisite,is |
| R4602 | T5723 | T5724 | aux | to,unmask |
| R4603 | T5724 | T5722 | acl | unmask,prerequisite |
| R4604 | T5725 | T5726 | det | the,NLS |
| R4605 | T5726 | T5724 | dobj | NLS,unmask |
| R4606 | T5727 | T5726 | prep | of,NLS |
| R4607 | T5728 | T5727 | pobj | p65,of |
| R4608 | T5729 | T5720 | punct | ",",is |
| R4609 | T5730 | T5720 | cc | and,is |
| R4610 | T5731 | T5732 | det | both,RPS3 |
| R4611 | T5732 | T5737 | dep | RPS3,p65 |
| R4612 | T5733 | T5732 | cc | and,RPS3 |
| R4613 | T5734 | T5735 | compound | IκBα,bind |
| R4614 | T5735 | T5732 | conj | bind,RPS3 |
| R4615 | T5736 | T5737 | aux | to,p65 |
| R4616 | T5737 | T5745 | advcl | p65,tested |
| R4617 | T5738 | T5737 | prep | in,p65 |
| R4782 | T5903 | T5899 | punct | ),detected |
| R4783 | T5904 | T5888 | punct | .,augmented |
| R4784 | T5905 | T5925 | advmod | Moreover,show |
| R4785 | T5906 | T5925 | punct | ",",show |
| R4786 | T5907 | T5925 | nsubj | cells,show |
| R4787 | T5908 | T5907 | acl | treated,cells |
| R4788 | T5909 | T5908 | prep | with,treated |
| R4789 | T5910 | T5911 | compound | sodium,pervanadate |
| R4790 | T5911 | T5909 | pobj | pervanadate,with |
| R4791 | T5912 | T5913 | punct | (,Pv |
| R4792 | T5913 | T5911 | appos | Pv,pervanadate |
| R4793 | T5914 | T5908 | punct | ),treated |
| R4794 | T5915 | T5916 | aux | to,induce |
| R4795 | T5916 | T5908 | advcl | induce,treated |
| R4796 | T5917 | T5918 | compound | IκBα,degradation |
| R4797 | T5918 | T5916 | dobj | degradation,induce |
| R4798 | T5919 | T5916 | prep | through,induce |
| R4799 | T5920 | T5922 | det | an,mechanism25-27 |
| R4800 | T5921 | T5922 | amod | IKK-independent,mechanism25-27 |
| R4801 | T5922 | T5919 | pobj | mechanism25-27,through |
| R4802 | T5923 | T5925 | aux | did,show |
| R4803 | T5924 | T5925 | neg | not,show |
| R4804 | T5925 | T5925 | ROOT | show,show |
| R4805 | T5926 | T5927 | amod | increased,association |
| R4806 | T5927 | T5925 | dobj | association,show |
| R4807 | T5928 | T5927 | prep | between,association |
| R4808 | T5929 | T5928 | pobj | RPS3,between |
| R4809 | T5930 | T5929 | cc | and,RPS3 |
| R4810 | T5931 | T5929 | conj | importin-α,RPS3 |
| R4811 | T5932 | T5927 | punct | (,association |
| R4812 | T5933 | T5927 | appos | Fig.,association |
| R4813 | T5934 | T5933 | nummod | 3e,Fig. |
| R4814 | T5935 | T5933 | cc | and,Fig. |
| R4815 | T5936 | T5937 | compound | Supplementary,Fig. |
| R4816 | T5937 | T5933 | conj | Fig.,Fig. |
| R4817 | T5938 | T5937 | nummod | 3b,Fig. |
| R4818 | T5939 | T5937 | punct | ),Fig. |
| R4819 | T5940 | T5933 | cc | or,Fig. |
| R4820 | T5941 | T5942 | amod | nuclear,accumulation |
| R4821 | T5942 | T5933 | conj | accumulation,Fig. |
| R4630 | T5751 | T5750 | prep | for,required |
| R4631 | T5752 | T5753 | det | the,liberation |
| R4632 | T5753 | T5751 | pobj | liberation,for |
| R4633 | T5754 | T5753 | prep | of,liberation |
| R4634 | T5755 | T5754 | pobj | RPS3,of |
| R4635 | T5756 | T5745 | punct | .,tested |
| R4650 | T5771 | T5770 | cc | or,IκBα |
| R4651 | T5772 | T5774 | det | an,mutant |
| R4652 | T5773 | T5774 | compound | IκBα,mutant |
| R4653 | T5774 | T5770 | conj | mutant,IκBα |
| R4654 | T5775 | T5776 | punct | (,SSAA |
| R4655 | T5776 | T5774 | appos | SSAA,mutant |
| R4656 | T5777 | T5774 | punct | ),mutant |
| R4657 | T5778 | T5768 | conj | resistant,overexpressing |
| R4658 | T5779 | T5778 | prep | to,resistant |
| R4659 | T5780 | T5781 | advmod | IKKβ-induced,phosphorylation |
| R4660 | T5781 | T5779 | pobj | phosphorylation,to |
| R4661 | T5782 | T5781 | cc | and,phosphorylation |
| R4662 | T5783 | T5781 | conj | degradation,phosphorylation |
| R4663 | T5784 | T5758 | punct | .,measured |
| R4664 | T5785 | T5794 | prep | In,augmented |
| R4665 | T5786 | T5785 | pobj | cells,In |
| R4666 | T5787 | T5786 | acl | transfected,cells |
| R4667 | T5788 | T5787 | prep | with,transfected |
| R4668 | T5789 | T5790 | compound | wild-type,IκBα |
| R4669 | T5790 | T5788 | pobj | IκBα,with |
| R4670 | T5791 | T5794 | punct | ",",augmented |
| R4671 | T5792 | T5793 | compound | TNF,stimulation |
| R4672 | T5793 | T5794 | nsubj | stimulation,augmented |
| R4673 | T5794 | T5794 | ROOT | augmented,augmented |
| R4674 | T5795 | T5796 | det | the,interaction |
| R4675 | T5796 | T5794 | dobj | interaction,augmented |
| R4676 | T5797 | T5796 | prep | of,interaction |
| R4677 | T5798 | T5797 | pobj | RPS3,of |
| R4678 | T5799 | T5798 | cc | and,RPS3 |
| R4679 | T5800 | T5794 | oprd | importin-α,augmented |
| R4680 | T5801 | T5794 | prep | to,augmented |
| R4681 | T5802 | T5804 | det | a,degree |
| R4682 | T5803 | T5804 | amod | similar,degree |
| R4683 | T5804 | T5801 | pobj | degree,to |
| R4684 | T5805 | T5804 | prep | as,degree |
| R4685 | T5806 | T5805 | prep | in,as |
| R4686 | T5807 | T5808 | amod | non-transfected,cells |
| R4687 | T5808 | T5806 | pobj | cells,in |
| R4688 | T5809 | T5794 | punct | .,augmented |
| R4689 | T5810 | T5814 | prep | By,observed |
| R4690 | T5811 | T5810 | pobj | contrast,By |
| R4691 | T5812 | T5814 | punct | ",",observed |
| R4692 | T5813 | T5814 | nsubj | we,observed |
| R4693 | T5814 | T5814 | ROOT | observed,observed |
| R4694 | T5815 | T5820 | mark | that,abolished |
| R4695 | T5816 | T5818 | det | the,association |
| R4696 | T5817 | T5818 | amod | RPS3-importin-α,association |
| R4697 | T5818 | T5820 | nsubjpass | association,abolished |
| R4698 | T5819 | T5820 | auxpass | was,abolished |
| R4699 | T5820 | T5814 | ccomp | abolished,observed |
| R4700 | T5821 | T5820 | agent | by,abolished |
| R4701 | T5822 | T5823 | det | the,presence |
| R4702 | T5823 | T5821 | pobj | presence,by |
| R4703 | T5824 | T5823 | prep | of,presence |
| R4704 | T5825 | T5826 | compound | non-degradable,IκBα |
| R4705 | T5826 | T5824 | pobj | IκBα,of |
| R4706 | T5827 | T5830 | punct | (,) |
| R4707 | T5828 | T5830 | nmod | Fig.,) |
| R4708 | T5829 | T5828 | nummod | 3b,Fig. |
| R4709 | T5830 | T5820 | punct | ),abolished |
| R4710 | T5831 | T5814 | punct | .,observed |
| R4711 | T5832 | T5833 | aux | To,examine |
| R4712 | T5833 | T5836 | csubj | examine,is |
| R4713 | T5834 | T5836 | mark | whether,is |
| R4714 | T5835 | T5836 | nsubj | IκBα,is |
| R4715 | T5836 | T5847 | advcl | is,measured |
| R4716 | T5837 | T5840 | det | the,barrier |
| R4717 | T5838 | T5840 | amod | only,barrier |
| R4718 | T5839 | T5840 | amod | cytoplasmic,barrier |
| R4719 | T5840 | T5836 | attr | barrier,is |
| R4720 | T5841 | T5840 | acl | precluding,barrier |
| R4721 | T5842 | T5844 | nmod | RPS3,translocation |
| R4722 | T5843 | T5844 | amod | nuclear,translocation |
| R4723 | T5844 | T5841 | dobj | translocation,precluding |
| R4724 | T5845 | T5847 | punct | ",",measured |
| R4725 | T5846 | T5847 | nsubj | we,measured |
| R4726 | T5847 | T5847 | ROOT | measured,measured |
| R4727 | T5848 | T5850 | preconj | both,association |
| R4728 | T5849 | T5850 | compound | RPS3-importin-α,association |
| R4729 | T5850 | T5847 | dobj | association,measured |
| R4730 | T5851 | T5850 | cc | and,association |
| R4731 | T5852 | T5853 | amod | nuclear,RPS3 |
| R4732 | T5853 | T5850 | conj | RPS3,association |
| R4733 | T5854 | T5847 | prep | after,measured |
| R4734 | T5855 | T5854 | pcomp | reducing,after |
| R4735 | T5856 | T5857 | compound | IκBα,expression |
| R4736 | T5857 | T5855 | dobj | expression,reducing |
| R4737 | T5858 | T5847 | punct | .,measured |
| R4738 | T5859 | T5865 | amod | Compared,targeting |
| R4739 | T5860 | T5859 | prep | with,Compared |
| R4740 | T5861 | T5862 | compound | nonspecific,siRNA |
| R4741 | T5862 | T5860 | pobj | siRNA,with |
| R4742 | T5863 | T5862 | punct | ",",siRNA |
| R4743 | T5864 | T5865 | compound | siRNA,targeting |
| R4744 | T5865 | T5869 | nsubj | targeting,depleted |
| R4745 | T5866 | T5865 | prep | of,targeting |
| R4746 | T5867 | T5866 | pobj | IκBα,of |
| R4747 | T5868 | T5869 | advmod | completely,depleted |
| R4748 | T5869 | T5869 | ROOT | depleted,depleted |
| R4749 | T5870 | T5869 | dobj | IκBα,depleted |
| R4750 | T5871 | T5869 | prep | in,depleted |
| R4751 | T5872 | T5873 | compound | Jurkat,cells |
| R4752 | T5873 | T5871 | pobj | cells,in |
| R4753 | T5874 | T5878 | punct | (,input |
| R4754 | T5875 | T5876 | compound | Fig.,3c |
| R4755 | T5876 | T5878 | nummod | 3c,input |
| R4756 | T5877 | T5878 | punct | ",",input |
| R4757 | T5878 | T5869 | parataxis | input,depleted |
| R4758 | T5879 | T5878 | punct | ),input |
| R4759 | T5880 | T5869 | punct | .,depleted |
| R4760 | T5881 | T5888 | advmod | Nevertheless,augmented |
| R4761 | T5882 | T5888 | punct | ",",augmented |
| R4762 | T5883 | T5885 | det | the,association |
| R4763 | T5884 | T5885 | amod | RPS3-importin-α,association |
| R4764 | T5885 | T5888 | nsubjpass | association,augmented |
| R4765 | T5886 | T5888 | auxpass | was,augmented |
| R4766 | T5887 | T5888 | neg | not,augmented |
| R4767 | T5888 | T5888 | ROOT | augmented,augmented |
| R4768 | T5889 | T5888 | punct | (,augmented |
| R4769 | T5890 | T5888 | dobj | Fig.,augmented |
| R4770 | T5891 | T5890 | nummod | 3c,Fig. |
| R4771 | T5892 | T5888 | punct | ),augmented |
| R4772 | T5893 | T5888 | punct | ",",augmented |
| R4773 | T5894 | T5888 | cc | nor,augmented |
| R4774 | T5895 | T5899 | auxpass | was,detected |
| R4775 | T5896 | T5899 | amod | significant,detected |
| R4776 | T5897 | T5898 | amod | nuclear,RPS3 |
| R4777 | T5898 | T5899 | amod | RPS3,detected |
| R4778 | T5899 | T5888 | conj | detected,augmented |
| R4779 | T5900 | T5899 | punct | (,detected |
| R4780 | T5901 | T5902 | compound | Fig.,3d |
| R4781 | T5902 | T5899 | appos | 3d,detected |
| R4857 | T5978 | T5958 | punct | .,examined |
| R4858 | T5979 | T5980 | nsubj | We,found |
| R4859 | T5980 | T5980 | ROOT | found,found |
| R4860 | T5981 | T5988 | mark | that,required |
| R4861 | T5982 | T5983 | compound | TNF,stimulation |
| R4862 | T5983 | T5988 | nsubjpass | stimulation,required |
| R4863 | T5984 | T5983 | acl | following,stimulation |
| R4864 | T5985 | T5986 | compound | Pv,treatment |
| R4865 | T5986 | T5984 | pobj | treatment,following |
| R4866 | T5987 | T5988 | auxpass | was,required |
| R4867 | T5988 | T5980 | ccomp | required,found |
| R4868 | T5989 | T5988 | prep | for,required |
| R4869 | T5990 | T5992 | det | the,association |
| R4870 | T5991 | T5992 | compound | RPS3-importin-α,association |
| R4871 | T5992 | T5989 | pobj | association,for |
| R4872 | T5993 | T5992 | punct | ",",association |
| R4873 | T5994 | T5997 | amod | comparable,stimulation |
| R4874 | T5995 | T5994 | prep | to,comparable |
| R4875 | T5996 | T5995 | pobj | TNF,to |
| R4876 | T5997 | T5988 | dobj | stimulation,required |
| R4822 | T5943 | T5942 | prep | of,accumulation |
| R4823 | T5944 | T5943 | pobj | RPS3,of |
| R4824 | T5945 | T5942 | punct | ",",accumulation |
| R4825 | T5946 | T5925 | prep | despite,show |
| R4826 | T5947 | T5949 | amod | complete,degradation |
| R4827 | T5948 | T5949 | compound | IκBα,degradation |
| R4828 | T5949 | T5946 | pobj | degradation,despite |
| R4829 | T5950 | T5952 | punct | (,Fig. |
| R4830 | T5951 | T5952 | compound | Supplementary,Fig. |
| R4831 | T5952 | T5949 | appos | Fig.,degradation |
| R4832 | T5953 | T5952 | nummod | 3c,Fig. |
| R4833 | T5954 | T5952 | punct | ),Fig. |
| R4834 | T5955 | T5925 | punct | .,show |
| R4835 | T5956 | T5958 | nsubj | We,examined |
| R4836 | T5957 | T5958 | advmod | further,examined |
| R4837 | T5958 | T5958 | ROOT | examined,examined |
| R4838 | T5959 | T5966 | mark | whether,promotes |
| R4839 | T5960 | T5964 | det | a,signal |
| R4840 | T5961 | T5964 | amod | subsequent,signal |
| R4841 | T5962 | T5964 | compound | NF-κB,signal |
| R4842 | T5963 | T5964 | compound | activation,signal |
| R4843 | T5964 | T5966 | nsubj | signal,promotes |
| R4844 | T5965 | T5966 | advmod | independently,promotes |
| R4845 | T5966 | T5958 | ccomp | promotes,examined |
| R4846 | T5967 | T5969 | det | the,association |
| R4847 | T5968 | T5969 | amod | importin-α,association |
| R4848 | T5969 | T5966 | dobj | association,promotes |
| R4849 | T5970 | T5969 | cc | and,association |
| R4850 | T5971 | T5972 | amod | nuclear,transport |
| R4851 | T5972 | T5969 | conj | transport,association |
| R4852 | T5973 | T5972 | prep | of,transport |
| R4853 | T5974 | T5973 | pobj | RPS3,of |
| R4854 | T5975 | T5969 | prep | after,association |
| R4855 | T5976 | T5977 | compound | IκBα,degradation |
| R4856 | T5977 | T5975 | pobj | degradation,after |
| R6220 | T7766 | T7772 | nsubj | protein,lanes |
| R6221 | T7767 | T7766 | advmod | alone,protein |
| R6222 | T7768 | T7766 | punct | (,protein |
| R6223 | T7769 | T7770 | compound | Fig.,4a |
| R6224 | T7770 | T7766 | appos | 4a,protein |
| R6225 | T7771 | T7770 | punct | ",",4a |
| R6226 | T7772 | T7731 | conj | lanes,observed |
| R6227 | T7773 | T7776 | nmod | 3,) |
| R6228 | T7774 | T7773 | cc | and,3 |
| R6229 | T7775 | T7773 | conj | 6,3 |
| R6230 | T7776 | T7772 | punct | ),lanes |
| R6231 | T7777 | T7772 | punct | ",",lanes |
| R6232 | T7778 | T7784 | advmod | when,used |
| R6233 | T7779 | T7780 | preconj | either,IKKα |
| R6234 | T7780 | T7784 | nsubjpass | IKKα,used |
| R6235 | T7781 | T7780 | cc | or,IKKα |
| R6236 | T7782 | T7780 | conj | IKKβ,IKKα |
| R6237 | T7783 | T7784 | auxpass | was,used |
| R6238 | T7784 | T7772 | advcl | used,lanes |
| R6239 | T7785 | T7731 | punct | .,observed |
| R6240 | T7786 | T7787 | nsubj | We,discovered |
| R6241 | T7787 | T7787 | ROOT | discovered,discovered |
| R6242 | T7788 | T7792 | mark | that,phosphorylated |
| R6243 | T7789 | T7792 | nsubjpass | GST-RPS3,phosphorylated |
| R6244 | T7790 | T7792 | aux | could,phosphorylated |
| R6245 | T7791 | T7792 | auxpass | be,phosphorylated |
| R6246 | T7792 | T7787 | ccomp | phosphorylated,discovered |
| R6247 | T7793 | T7792 | agent | by,phosphorylated |
| R6248 | T7794 | T7793 | pobj | IKKβ,by |
| R6249 | T7795 | T7792 | punct | ",",phosphorylated |
| R6250 | T7796 | T7792 | cc | but,phosphorylated |
| R6251 | T7797 | T7798 | neg | not,IKKα |
| R6252 | T7798 | T7806 | nsubj | IKKα,compare |
| R6253 | T7799 | T7798 | punct | ",",IKKα |
| R6254 | T7800 | T7798 | prep | in,IKKα |
| R6255 | T7801 | T7800 | amod | vitro,in |
| R6256 | T7802 | T7798 | punct | (,IKKα |
| R6257 | T7803 | T7798 | conj | Fig.,IKKα |
| R6258 | T7804 | T7803 | nummod | 4a,Fig. |
| R6259 | T7805 | T7798 | punct | ",",IKKα |
| R6260 | T7806 | T7792 | conj | compare,phosphorylated |
| R6261 | T7807 | T7806 | dobj | lanes,compare |
| R6262 | T7808 | T7807 | nummod | 4,lanes |
| R6263 | T7809 | T7808 | cc | and,4 |
| R6264 | T7810 | T7808 | conj | 7,4 |
| R6265 | T7811 | T7806 | punct | ),compare |
| R6266 | T7812 | T7787 | punct | .,discovered |
| R6267 | T7813 | T7814 | aux | To,identify |
| R6268 | T7814 | T7823 | advcl | identify,phosphorylated |
| R6269 | T7815 | T7819 | det | the,residue |
| R6270 | T7816 | T7819 | amod | RPS3,residue |
| R6271 | T7817 | T7819 | amod | amino,residue |
| R6272 | T7818 | T7819 | compound | acid,residue |
| R6273 | T7819 | T7814 | dobj | residue,identify |
| R6274 | T7820 | T7819 | punct | (,residue |
| R4877 | T5998 | T5997 | advmod | alone,stimulation |
| R4878 | T5999 | T5997 | punct | (,stimulation |
| R4879 | T6000 | T5997 | appos | Fig.,stimulation |
| R4880 | T6001 | T6000 | nummod | 3e,Fig. |
| R4881 | T6002 | T5997 | punct | ),stimulation |
| R4882 | T6003 | T5980 | punct | .,found |
| R4883 | T6004 | T6012 | advmod | Thus,required |
| R4884 | T6005 | T6012 | punct | ",",required |
| R4885 | T6006 | T6007 | compound | IκBα,phosphorylation |
| R4886 | T6007 | T6012 | nsubjpass | phosphorylation,required |
| R4887 | T6008 | T6007 | cc | and,phosphorylation |
| R4888 | T6009 | T6007 | conj | degradation,phosphorylation |
| R4889 | T6010 | T6009 | appos | itself,degradation |
| R4890 | T6011 | T6012 | auxpass | is,required |
| R4891 | T6012 | T6012 | ROOT | required,required |
| R4892 | T6013 | T6012 | cc | but,required |
| R4893 | T6014 | T6015 | neg | not,sufficient |
| R4894 | T6015 | T6012 | conj | sufficient,required |
| R4895 | T6016 | T6017 | aux | to,cause |
| R4896 | T6017 | T6015 | xcomp | cause,sufficient |
| R4897 | T6018 | T6019 | amod | RPS3,association |
| R4898 | T6019 | T6017 | dobj | association,cause |
| R4899 | T6020 | T6019 | prep | with,association |
| R4900 | T6021 | T6022 | amod | importin-α,followed |
| R4901 | T6022 | T6020 | pcomp | followed,with |
| R4902 | T6023 | T6022 | agent | by,followed |
| R4903 | T6024 | T6025 | amod | nuclear,translocation |
| R4904 | T6025 | T6023 | pobj | translocation,by |
| R4905 | T6026 | T6012 | punct | .,required |
| R4906 | T6027 | T6040 | advmod | Rather,required |
| R4907 | T6028 | T6040 | punct | ",",required |
| R4908 | T6029 | T6031 | det | an,signal |
| R4909 | T6030 | T6031 | amod | additional,signal |
| R4910 | T6031 | T6040 | nsubjpass | signal,required |
| R4911 | T6032 | T6035 | punct | ",",phosphorylation |
| R4912 | T6033 | T6035 | advmod | potentially,phosphorylation |
| R4913 | T6034 | T6035 | compound | IKKβ,phosphorylation |
| R4914 | T6035 | T6031 | appos | phosphorylation,signal |
| R4915 | T6036 | T6035 | prep | of,phosphorylation |
| R4916 | T6037 | T6036 | pobj | RPS3,of |
| R4917 | T6038 | T6040 | punct | ",",required |
| R4918 | T6039 | T6040 | auxpass | is,required |
| R4919 | T6040 | T6040 | ROOT | required,required |
| R4920 | T6041 | T6040 | punct | .,required |
| R6125 | T7671 | T7672 | nsubj | IKKβ,phosphorylates |
| R6126 | T7672 | T7672 | ROOT | phosphorylates,phosphorylates |
| R6127 | T7673 | T7672 | dobj | RPS3,phosphorylates |
| R6128 | T7674 | T7672 | prep | at,phosphorylates |
| R6129 | T7675 | T7674 | pobj | serine,at |
| R6130 | T7676 | T7675 | nummod | 209,serine |
| R6131 | T7677 | T7679 | mark | Although,defined |
| R6132 | T7678 | T7679 | advmod | originally,defined |
| R6133 | T7679 | T7689 | advcl | defined,phosphorylates |
| R6134 | T7680 | T7679 | prep | as,defined |
| R6135 | T7681 | T7682 | det | the,kinase |
| R6136 | T7682 | T7680 | pobj | kinase,as |
| R6137 | T7683 | T7684 | nsubj | that,phosphorylates |
| R6138 | T7684 | T7682 | relcl | phosphorylates,kinase |
| R6139 | T7685 | T7684 | dobj | IκB19,phosphorylates |
| R6140 | T7686 | T7689 | punct | ",",phosphorylates |
| R6141 | T7687 | T7689 | nsubj | IKKβ,phosphorylates |
| R6142 | T7688 | T7689 | advmod | also,phosphorylates |
| R6143 | T7689 | T7689 | ROOT | phosphorylates,phosphorylates |
| R6144 | T7690 | T7691 | amod | unrelated,substrates |
| R6145 | T7691 | T7689 | dobj | substrates,phosphorylates |
| R6146 | T7692 | T7691 | prep | including,substrates |
| R6147 | T7693 | T7692 | pobj | 14-3-3β,including |
| R6148 | T7694 | T7693 | cc | and,14-3-3β |
| R6149 | T7695 | T7693 | conj | Bcl10,14-3-3β |
| R6150 | T7696 | T7693 | punct | ",",14-3-3β |
| R6151 | T7697 | T7698 | nsubj | which,lack |
| R6152 | T7698 | T7693 | relcl | lack,14-3-3β |
| R6153 | T7699 | T7702 | det | the,motif |
| R6154 | T7700 | T7702 | compound | IKK,motif |
| R6155 | T7701 | T7702 | compound | consensus,motif |
| R6156 | T7702 | T7698 | dobj | motif,lack |
| R6157 | T7703 | T7704 | punct | (,DpSGYXpS/T |
| R6158 | T7704 | T7702 | appos | DpSGYXpS/T,motif |
| R6159 | T7705 | T7704 | punct | ),DpSGYXpS/T |
| R6160 | T7706 | T7702 | appos | 28,motif |
| R6161 | T7707 | T7689 | punct | .,phosphorylates |
| R6162 | T7708 | T7710 | nsubj | We,hypothesized |
| R6163 | T7709 | T7710 | advmod | therefore,hypothesized |
| R6164 | T7710 | T7710 | ROOT | hypothesized,hypothesized |
| R6165 | T7711 | T7715 | mark | that,phosphorylate |
| R6166 | T7712 | T7715 | nsubj | IKKβ,phosphorylate |
| R6167 | T7713 | T7715 | aux | could,phosphorylate |
| R6168 | T7714 | T7715 | advmod | directly,phosphorylate |
| R6169 | T7715 | T7710 | ccomp | phosphorylate,hypothesized |
| R6170 | T7716 | T7715 | dobj | RPS3,phosphorylate |
| R6171 | T7717 | T7710 | punct | .,hypothesized |
| R6172 | T7718 | T7731 | prep | By,observed |
| R6173 | T7719 | T7731 | prep | in,observed |
| R6174 | T7720 | T7722 | amod | vitro,assays |
| R6175 | T7721 | T7722 | compound | kinase,assays |
| R6176 | T7722 | T7719 | pobj | assays,in |
| R6177 | T7723 | T7722 | acl | using,assays |
| R6178 | T7724 | T7725 | amod | recombinant,IKK |
| R6179 | T7725 | T7728 | nmod | IKK,proteins |
| R6180 | T7726 | T7725 | cc | and,IKK |
| R6181 | T7727 | T7725 | conj | RPS3,IKK |
| R6182 | T7728 | T7723 | dobj | proteins,using |
| R6183 | T7729 | T7731 | punct | ",",observed |
| R6184 | T7730 | T7731 | nsubj | we,observed |
| R6185 | T7731 | T7731 | ROOT | observed,observed |
| R6186 | T7732 | T7733 | amod | strong,incorporation |
| R6187 | T7733 | T7731 | dobj | incorporation,observed |
| R6188 | T7734 | T7733 | prep | of,incorporation |
| R6189 | T7735 | T7734 | pobj | 32P,of |
| R6190 | T7736 | T7731 | prep | in,observed |
| R6191 | T7737 | T7738 | compound | autophosphorylatd,IKKα |
| R6192 | T7738 | T7745 | nmod | IKKα,lanes |
| R6193 | T7739 | T7738 | cc | and,IKKα |
| R6194 | T7740 | T7738 | conj | IKKβ,IKKα |
| R6195 | T7741 | T7742 | punct | (,Fig. |
| R6196 | T7742 | T7740 | appos | Fig.,IKKβ |
| R6197 | T7743 | T7742 | nummod | 4a,Fig. |
| R6198 | T7744 | T7740 | punct | ",",IKKβ |
| R6199 | T7745 | T7736 | pobj | lanes,in |
| R6200 | T7746 | T7731 | advcl | 2-7,observed |
| R6201 | T7747 | T7746 | punct | ),2-7 |
| R6202 | T7748 | T7750 | advmod | as,as |
| R6203 | T7749 | T7750 | advmod | well,as |
| R6204 | T7750 | T7746 | cc | as,2-7 |
| R6205 | T7751 | T7752 | compound | phosporylated,GST-IκBα |
| R6206 | T7752 | T7752 | ROOT | GST-IκBα,GST-IκBα |
| R6207 | T7753 | T7752 | punct | (,GST-IκBα |
| R6208 | T7754 | T7752 | appos | 1-54,GST-IκBα |
| R6209 | T7755 | T7752 | punct | ),GST-IκBα |
| R6210 | T7756 | T7752 | punct | (,GST-IκBα |
| R6211 | T7757 | T7758 | compound | Supplementary,Fig. |
| R6212 | T7758 | T7752 | appos | Fig.,GST-IκBα |
| R6213 | T7759 | T7758 | nummod | 4,Fig. |
| R6214 | T7760 | T7752 | punct | ),GST-IκBα |
| R6215 | T7761 | T7752 | punct | ",",GST-IκBα |
| R6216 | T7762 | T7731 | cc | but,observed |
| R6217 | T7763 | T7766 | neg | not,protein |
| R6218 | T7764 | T7766 | det | the,protein |
| R6219 | T7765 | T7766 | compound | GST,protein |
| R6295 | T7841 | T7842 | nsubj | results,indicated |
| R6296 | T7842 | T7842 | ROOT | indicated,indicated |
| R6297 | T7843 | T7845 | mark | that,phosphorylated |
| R6298 | T7844 | T7845 | nsubj | IKKβ,phosphorylated |
| R6299 | T7845 | T7842 | ccomp | phosphorylated,indicated |
| R6300 | T7846 | T7845 | dobj | S209,phosphorylated |
| R6301 | T7847 | T7846 | punct | ",",S209 |
| R6302 | T7848 | T7846 | acl | located,S209 |
| R6303 | T7849 | T7848 | prep | in,located |
| R6304 | T7850 | T7852 | det | the,C-terminus |
| R6305 | T7851 | T7852 | compound | RPS3,C-terminus |
| R6306 | T7852 | T7849 | pobj | C-terminus,in |
| R6307 | T7853 | T7852 | punct | (,C-terminus |
| R6308 | T7854 | T7852 | appos | Fig.,C-terminus |
| R6309 | T7855 | T7854 | nummod | 4b,Fig. |
| R6310 | T7856 | T7852 | punct | ),C-terminus |
| R6311 | T7857 | T7842 | punct | .,indicated |
| R6312 | T7858 | T7862 | nummod | RPS3,alignment |
| R6313 | T7859 | T7862 | compound | amino,alignment |
| R6275 | T7821 | T7819 | appos | s,residue |
| R6276 | T7822 | T7819 | punct | ),residue |
| R6277 | T7823 | T7828 | advcl | phosphorylated,performed |
| R6278 | T7824 | T7823 | agent | by,phosphorylated |
| R6279 | T7825 | T7824 | pobj | IKKβ,by |
| R6280 | T7826 | T7828 | punct | ",",performed |
| R6281 | T7827 | T7828 | nsubj | we,performed |
| R6282 | T7828 | T7828 | ROOT | performed,performed |
| R6283 | T7829 | T7833 | amod | liquid,analyses |
| R6284 | T7830 | T7833 | nmod | chromatography-tandem,analyses |
| R6285 | T7831 | T7833 | nmod | mass,analyses |
| R6286 | T7832 | T7833 | compound | spectrometry,analyses |
| R6287 | T7833 | T7828 | dobj | analyses,performed |
| R6288 | T7834 | T7833 | acl | using,analyses |
| R6289 | T7835 | T7834 | prep | in,using |
| R6290 | T7836 | T7835 | pobj | vitro,in |
| R6291 | T7837 | T7838 | amod | phosphorylated,RPS3 |
| R6292 | T7838 | T7834 | dobj | RPS3,using |
| R6293 | T7839 | T7828 | punct | .,performed |
| R6294 | T7840 | T7841 | det | The,results |
| R6370 | T7916 | T7915 | prep | with,assays |
| R6371 | T7917 | T7923 | amod | recombinant,proteins |
| R6372 | T7918 | T7923 | amod | wild-type,proteins |
| R6373 | T7919 | T7918 | cc | or,wild-type |
| R6374 | T7920 | T7918 | conj | S209A,wild-type |
| R6375 | T7921 | T7923 | amod | mutant,proteins |
| R6376 | T7922 | T7923 | compound | RPS3,proteins |
| R6377 | T7923 | T7916 | pobj | proteins,with |
| R6378 | T7924 | T7910 | punct | .,performed |
| R6379 | T7925 | T7934 | prep | Compared,reduced |
| R6380 | T7926 | T7925 | prep | with,Compared |
| R6381 | T7927 | T7929 | det | the,protein |
| R6382 | T7928 | T7929 | amod | wild-type,protein |
| R6383 | T7929 | T7926 | pobj | protein,with |
| R6384 | T7930 | T7934 | punct | ",",reduced |
| R6385 | T7931 | T7933 | det | the,mutation |
| R6386 | T7932 | T7933 | compound | S209A,mutation |
| R6387 | T7933 | T7934 | nsubj | mutation,reduced |
| R6388 | T7934 | T7934 | ROOT | reduced,reduced |
| R6389 | T7935 | T7934 | dobj | IKKβ,reduced |
| R6390 | T7936 | T7934 | conj | mediated,reduced |
| R6391 | T7937 | T7938 | amod | RPS3,phosphorylation |
| R6392 | T7938 | T7936 | dobj | phosphorylation,mediated |
| R6393 | T7939 | T7940 | punct | (,Fig. |
| R6394 | T7940 | T7938 | appos | Fig.,phosphorylation |
| R6395 | T7941 | T7940 | nummod | 4c,Fig. |
| R6396 | T7942 | T7938 | punct | ),phosphorylation |
| R6397 | T7943 | T7934 | punct | .,reduced |
| R6398 | T7944 | T7946 | expl | There,be |
| R6399 | T7945 | T7946 | aux | might,be |
| R6400 | T7946 | T7946 | ROOT | be,be |
| R6401 | T7947 | T7949 | amod | alternative,site |
| R6402 | T7948 | T7949 | compound | phosphorylation,site |
| R6403 | T7949 | T7946 | attr | site,be |
| R6404 | T7950 | T7949 | punct | (,site |
| R6405 | T7951 | T7949 | appos | s,site |
| R6406 | T7952 | T7949 | punct | ),site |
| R6407 | T7953 | T7946 | prep | under,be |
| R6408 | T7954 | T7955 | det | these,conditions |
| R6409 | T7955 | T7953 | pobj | conditions,under |
| R6410 | T7956 | T7946 | prep | given,be |
| R6411 | T7957 | T7960 | amod | modest,RPS3 |
| R6412 | T7958 | T7960 | amod | residual,RPS3 |
| R6413 | T7959 | T7960 | amod | phosphorylated,RPS3 |
| R6414 | T7960 | T7956 | pobj | RPS3,given |
| R6415 | T7961 | T7960 | punct | (,RPS3 |
| R6416 | T7962 | T7960 | appos | Fig.,RPS3 |
| R6417 | T7963 | T7962 | nummod | 4c,Fig. |
| R6418 | T7964 | T7960 | punct | ),RPS3 |
| R6419 | T7965 | T7946 | punct | .,be |
| R6420 | T7966 | T7967 | nummod | RPS3,S209 |
| R6421 | T7967 | T7970 | nsubj | S209,fall |
| R6422 | T7968 | T7970 | aux | does,fall |
| R6423 | T7969 | T7970 | neg | not,fall |
| R6424 | T7970 | T7970 | ROOT | fall,fall |
| R6425 | T7971 | T7970 | prep | within,fall |
| R6426 | T7972 | T7976 | det | a,motif |
| R6427 | T7973 | T7976 | amod | conventional,motif |
| R6428 | T7974 | T7976 | compound | IKK,motif |
| R6429 | T7975 | T7976 | compound | recognition,motif |
| R6430 | T7976 | T7971 | pobj | motif,within |
| R6431 | T7977 | T7970 | punct | ",",fall |
| R6432 | T7978 | T7970 | cc | but,fall |
| R6433 | T7979 | T7980 | advmod | rather,resides |
| R6434 | T7980 | T7970 | conj | resides,fall |
| R6435 | T7981 | T7980 | prep | in,resides |
| R6436 | T7982 | T7984 | det | a,motif |
| R6437 | T7983 | T7984 | compound | sequence,motif |
| R6438 | T7984 | T7981 | pobj | motif,in |
| R6439 | T7985 | T7986 | punct | (,XXXpS/TXXE |
| R6440 | T7986 | T7984 | appos | XXXpS/TXXE,motif |
| R6441 | T7987 | T7986 | punct | ),XXXpS/TXXE |
| R6442 | T7988 | T7980 | punct | ",",resides |
| R6443 | T7989 | T7990 | advmod | potentially,recognized |
| R6314 | T7860 | T7861 | compound | acid,sequence |
| R6315 | T7861 | T7862 | compound | sequence,alignment |
| R6316 | T7862 | T7863 | nsubj | alignment,revealed |
| R6317 | T7863 | T7863 | ROOT | revealed,revealed |
| R6318 | T7864 | T7867 | mark | that,conserved |
| R6319 | T7865 | T7867 | nsubjpass | S209,conserved |
| R6320 | T7866 | T7867 | auxpass | is,conserved |
| R6321 | T7867 | T7863 | ccomp | conserved,revealed |
| R6322 | T7868 | T7867 | prep | in,conserved |
| R6323 | T7869 | T7870 | amod | many,species |
| R6324 | T7870 | T7868 | pobj | species,in |
| R6325 | T7871 | T7870 | prep | throughout,species |
| R6326 | T7872 | T7871 | pobj | phylogeny,throughout |
| R6327 | T7873 | T7867 | prep | with,conserved |
| R6328 | T7874 | T7875 | det | the,exception |
| R6329 | T7875 | T7873 | pobj | exception,with |
| R6330 | T7876 | T7875 | prep | of,exception |
| R6331 | T7877 | T7878 | compound | Caenorhabditis,elegans |
| R6332 | T7878 | T7876 | pobj | elegans,of |
| R6333 | T7879 | T7878 | cc | and,elegans |
| R6334 | T7880 | T7878 | conj | Schizosaccharomyces,elegans |
| R6335 | T7881 | T7878 | conj | pombe,elegans |
| R6336 | T7882 | T7881 | punct | ",",pombe |
| R6337 | T7883 | T7884 | nummod | two,organisms |
| R6338 | T7884 | T7878 | appos | organisms,elegans |
| R6339 | T7885 | T7888 | nsubj | that,possess |
| R6340 | T7886 | T7888 | aux | do,possess |
| R6341 | T7887 | T7888 | neg | not,possess |
| R6342 | T7888 | T7884 | relcl | possess,organisms |
| R6343 | T7889 | T7892 | det | the,pathway |
| R6344 | T7890 | T7892 | amod | NF-κB,pathway |
| R6345 | T7891 | T7892 | compound | signal,pathway |
| R6346 | T7892 | T7888 | dobj | pathway,possess |
| R6347 | T7893 | T7892 | punct | (,pathway |
| R6348 | T7894 | T7895 | compound | Supplementary,Fig. |
| R6349 | T7895 | T7892 | appos | Fig.,pathway |
| R6350 | T7896 | T7895 | nummod | 5,Fig. |
| R6351 | T7897 | T7892 | punct | ),pathway |
| R6352 | T7898 | T7863 | punct | .,revealed |
| R6353 | T7899 | T7900 | aux | To,verify |
| R6354 | T7900 | T7910 | advcl | verify,performed |
| R6355 | T7901 | T7900 | advmod | biochemically,verify |
| R6356 | T7902 | T7904 | mark | that,is |
| R6357 | T7903 | T7904 | nsubj | S209,is |
| R6358 | T7904 | T7901 | ccomp | is,biochemically |
| R6359 | T7905 | T7907 | det | an,substrate |
| R6360 | T7906 | T7907 | amod | IKKβ,substrate |
| R6361 | T7907 | T7904 | attr | substrate,is |
| R6362 | T7908 | T7910 | punct | ",",performed |
| R6363 | T7909 | T7910 | nsubj | we,performed |
| R6364 | T7910 | T7910 | ROOT | performed,performed |
| R6365 | T7911 | T7910 | dobj | 32P-labeling,performed |
| R6366 | T7912 | T7910 | prep | in,performed |
| R6367 | T7913 | T7915 | amod | vitro,assays |
| R6368 | T7914 | T7915 | compound | kinase,assays |
| R6369 | T7915 | T7912 | pobj | assays,in |
| R6445 | T7991 | T7990 | agent | by,recognized |
| R6446 | T7992 | T7994 | amod | casein,II |
| R6447 | T7993 | T7994 | compound | kinase,II |
| R6448 | T7994 | T7991 | pobj | II,by |
| R6449 | T7995 | T7994 | punct | (,II |
| R6450 | T7996 | T7994 | appos | CK2,II |
| R6451 | T7997 | T7994 | punct | ),II |
| R6452 | T7998 | T7970 | punct | .,fall |
| R6453 | T7999 | T8003 | mark | Although,display |
| R6454 | T8000 | T8001 | compound | IKKβ,kinase |
| R6455 | T8001 | T8003 | nsubj | kinase,display |
| R6456 | T8002 | T8003 | aux | can,display |
| R6457 | T8003 | T8012 | advcl | display,was |
| R6458 | T8004 | T8007 | det | a,specificity29 |
| R6459 | T8005 | T8007 | nummod | CK2-like,specificity29 |
| R6460 | T8006 | T8007 | compound | phosphorylation,specificity29 |
| R6461 | T8007 | T8003 | dobj | specificity29,display |
| R6462 | T8008 | T8012 | punct | ",",was |
| R6463 | T8009 | T8011 | det | no,protein |
| R6501 | T8047 | T8044 | acl | bound,amount |
| R6502 | T8048 | T8047 | prep | to,bound |
| R6503 | T8049 | T8048 | pobj | IKKs,to |
| R6504 | T8050 | T8030 | punct | .,was |
| R6505 | T8051 | T8052 | aux | To,determine |
| R6506 | T8052 | T8069 | advcl | determine,transfected |
| R6507 | T8053 | T8055 | mark | whether,is |
| R6508 | T8054 | T8055 | nsubj | S209,is |
| R6509 | T8055 | T8052 | ccomp | is,determine |
| R6510 | T8056 | T8058 | det | the,site |
| R6511 | T8057 | T8058 | amod | critical,site |
| R6512 | T8058 | T8055 | attr | site,is |
| R6513 | T8059 | T8062 | prep | at,phosphorylates |
| R6514 | T8060 | T8059 | pobj | which,at |
| R6515 | T8061 | T8062 | nsubj | IKKβ,phosphorylates |
| R6516 | T8062 | T8058 | relcl | phosphorylates,site |
| R6517 | T8063 | T8062 | dobj | RPS3,phosphorylates |
| R6518 | T8064 | T8062 | prep | in,phosphorylates |
| R6519 | T8065 | T8066 | amod | living,cells |
| R6520 | T8066 | T8064 | pobj | cells,in |
| R6521 | T8067 | T8069 | punct | ",",transfected |
| R6522 | T8068 | T8069 | nsubj | we,transfected |
| R6523 | T8069 | T8069 | ROOT | transfected,transfected |
| R6524 | T8070 | T8075 | det | the,Flag-RPS3 |
| R6525 | T8071 | T8075 | amod | wild-type,Flag-RPS3 |
| R6526 | T8072 | T8071 | cc | or,wild-type |
| R6527 | T8073 | T8071 | conj | S209A,wild-type |
| R6528 | T8074 | T8075 | amod | mutant,Flag-RPS3 |
| R6529 | T8075 | T8069 | dobj | Flag-RPS3,transfected |
| R6530 | T8076 | T8069 | advmod | alone,transfected |
| R6531 | T8077 | T8069 | punct | ",",transfected |
| R6532 | T8078 | T8069 | cc | or,transfected |
| R6533 | T8079 | T8080 | advmod | together,with |
| R6534 | T8080 | T8069 | conj | with,transfected |
| R6535 | T8081 | T8080 | pobj | IKKβ,with |
| R6536 | T8082 | T8080 | conj | into,with |
| R6537 | T8083 | T8082 | pobj | cells,into |
| R6538 | T8084 | T8069 | punct | .,transfected |
| R6539 | T8085 | T8088 | advmod | Indeed,observed |
| R6540 | T8086 | T8088 | punct | ",",observed |
| R6541 | T8087 | T8088 | nsubj | we,observed |
| R6560 | T8106 | T8107 | nsubj | S209,is |
| R6561 | T8107 | T8104 | ccomp | is,indicating |
| R6562 | T8108 | T8111 | det | the,site |
| R6563 | T8109 | T8111 | amod | predominant,site |
| R6564 | T8110 | T8111 | compound | target,site |
| R6565 | T8111 | T8107 | attr | site,is |
| R6566 | T8112 | T8111 | prep | for,site |
| R6567 | T8113 | T8114 | compound | IKKβ,phosphorylation |
| R6568 | T8114 | T8112 | pobj | phosphorylation,for |
| R6569 | T8115 | T8116 | punct | (,Fig. |
| R6570 | T8116 | T8114 | appos | Fig.,phosphorylation |
| R6571 | T8117 | T8116 | nummod | 4d,Fig. |
| R6572 | T8118 | T8100 | punct | ),eliminated |
| R6573 | T8119 | T8088 | punct | .,observed |
| R6574 | T8120 | T8122 | nsubj | We,generated |
| R6575 | T8121 | T8122 | advmod | next,generated |
| R6576 | T8122 | T8122 | ROOT | generated,generated |
| R6577 | T8123 | T8126 | det | a,antibody |
| R6578 | T8124 | T8126 | amod | phospho-S209,antibody |
| R6579 | T8125 | T8126 | compound | RPS3,antibody |
| R6580 | T8126 | T8122 | dobj | antibody,generated |
| R6581 | T8127 | T8122 | cc | and,generated |
| R6582 | T8128 | T8122 | conj | confirmed,generated |
| R6583 | T8129 | T8133 | mark | that,phosphorylated |
| R6584 | T8130 | T8131 | amod | endogenous,RPS3 |
| R6585 | T8131 | T8133 | nsubjpass | RPS3,phosphorylated |
| R6586 | T8132 | T8133 | auxpass | was,phosphorylated |
| R6587 | T8133 | T8128 | ccomp | phosphorylated,confirmed |
| R6588 | T8134 | T8133 | prep | at,phosphorylated |
| R6589 | T8135 | T8134 | pobj | S209,at |
| R6590 | T8136 | T8133 | prep | in,phosphorylated |
| R6591 | T8137 | T8139 | det | a,manner |
| R6592 | T8138 | T8139 | amod | time-dependent,manner |
| R6593 | T8139 | T8136 | pobj | manner,in |
| R6594 | T8140 | T8139 | prep | upon,manner |
| R6595 | T8141 | T8142 | compound | TNF,stimulation |
| R6596 | T8142 | T8140 | pobj | stimulation,upon |
| R6597 | T8143 | T8133 | punct | (,phosphorylated |
| R6598 | T8144 | T8133 | dep | Fig.,phosphorylated |
| R6599 | T8145 | T8144 | nummod | 4e,Fig. |
| R6600 | T8146 | T8133 | punct | ),phosphorylated |
| R6601 | T8147 | T8122 | punct | .,generated |
| R6444 | T7990 | T7970 | conj | recognized,fall |
| R7947 | T9891 | T9892 | amod | RPS3-transfected,cells |
| R7948 | T9892 | T9885 | pobj | cells,from |
| R7949 | T9893 | T9894 | auxpass | were,prepared |
| R7950 | T9894 | T9894 | ROOT | prepared,prepared |
| R7951 | T9895 | T9894 | cc | and,prepared |
| R7952 | T9896 | T9894 | conj | blotted,prepared |
| R7953 | T9897 | T9896 | prep | for,blotted |
| R7954 | T9898 | T9899 | compound | heat-shock,protein |
| R7955 | T9899 | T9897 | pobj | protein,for |
| R7956 | T9900 | T9899 | nummod | 90,protein |
| R7957 | T9901 | T9899 | punct | (,protein |
| R7958 | T9902 | T9899 | appos | hsp90,protein |
| R7959 | T9903 | T9899 | punct | ),protein |
| R7960 | T9904 | T9896 | punct | ",",blotted |
| R7961 | T9905 | T9907 | det | a,protein |
| R7962 | T9906 | T9907 | amod | cytoplasmic,protein |
| R7963 | T9907 | T9896 | conj | protein,blotted |
| R7964 | T9908 | T9907 | punct | ",",protein |
| R7965 | T9909 | T9907 | cc | and,protein |
| R7966 | T9910 | T9907 | conj | poly,protein |
| R7967 | T9911 | T9910 | punct | (,poly |
| R7968 | T9912 | T9910 | appos | ADP-ribose,poly |
| R7969 | T9913 | T9910 | punct | ),poly |
| R7970 | T9914 | T9907 | conj | polymerase,protein |
| R7971 | T9915 | T9914 | punct | (,polymerase |
| R7972 | T9916 | T9914 | appos | PARP,polymerase |
| R7973 | T9917 | T9914 | punct | ),polymerase |
| R7974 | T9918 | T9914 | punct | ",",polymerase |
| R7975 | T9919 | T9921 | det | a,protein |
| R7976 | T9920 | T9921 | amod | nuclear,protein |
| R7977 | T9921 | T9907 | appos | protein,protein |
| R7978 | T9922 | T9907 | punct | ",",protein |
| R7979 | T9923 | T9907 | acl | confirming,protein |
| R7980 | T9924 | T9926 | det | a,separation |
| R7981 | T9925 | T9926 | amod | clean,separation |
| R7982 | T9926 | T9923 | dobj | separation,confirming |
| R7983 | T9927 | T9926 | punct | (,separation |
| R7984 | T9928 | T9926 | appos | Fig.,separation |
| R7985 | T9929 | T9928 | nummod | 5a,Fig. |
| R7986 | T9930 | T9926 | punct | ),separation |
| R7987 | T9931 | T9894 | punct | .,prepared |
| R7988 | T9932 | T9933 | mark | As,expected |
| R7989 | T9933 | T9937 | advcl | expected,triggered |
| R7990 | T9934 | T9937 | punct | ",",triggered |
| R7991 | T9935 | T9936 | compound | PMA+I,stimulation |
| R7992 | T9936 | T9937 | nsubj | stimulation,triggered |
| R7993 | T9937 | T9937 | ROOT | triggered,triggered |
| R7994 | T9938 | T9941 | nmod | wild-type,translocation |
| R7995 | T9939 | T9941 | nmod | Flag-RPS3,translocation |
| R7996 | T9940 | T9941 | amod | nuclear,translocation |
| R7997 | T9941 | T9937 | dobj | translocation,triggered |
| R7998 | T9942 | T9941 | punct | (,translocation |
| R7999 | T9943 | T9941 | appos | Fig.,translocation |
| R8000 | T9944 | T9943 | nummod | 5a,Fig. |
| R8001 | T9945 | T9941 | punct | ),translocation |
| R8002 | T9946 | T9937 | punct | .,triggered |
| R8003 | T9947 | T9955 | advmod | However,was |
| R8004 | T9948 | T9955 | punct | ",",was |
| R8005 | T9949 | T9954 | nmod | RPS3,translocation |
| R8006 | T9950 | T9951 | punct | (,S209A |
| R8007 | T9951 | T9954 | nmod | S209A,translocation |
| R8008 | T9952 | T9951 | punct | ),S209A |
| R8009 | T9953 | T9954 | amod | nuclear,translocation |
| R8010 | T9954 | T9955 | nsubj | translocation,was |
| R8011 | T9955 | T9955 | ROOT | was,was |
| R8012 | T9956 | T9955 | acomp | attenuated,was |
| R8013 | T9957 | T9956 | punct | (,attenuated |
| R8014 | T9958 | T9960 | nmod | Fig.,) |
| R8015 | T9959 | T9958 | nummod | 5a,Fig. |
| R8016 | T9960 | T9956 | punct | ),attenuated |
| R8017 | T9961 | T9955 | punct | .,was |
| R8018 | T9962 | T9964 | nsubj | We,tested |
| R8019 | T9963 | T9964 | advmod | also,tested |
| R8020 | T9964 | T9964 | ROOT | tested,tested |
| R8021 | T9965 | T9966 | det | the,impact |
| R8171 | T10115 | T10111 | dobj | UTR,lacking |
| R8172 | T10116 | T10117 | punct | (,Fig. |
| R8173 | T10117 | T10115 | appos | Fig.,UTR |
| R8174 | T10118 | T10117 | nummod | 5c,Fig. |
| R8175 | T10119 | T10115 | punct | ),UTR |
| R8176 | T10120 | T10088 | punct | .,reduced |
| R8177 | T10121 | T10123 | nsubj | We,found |
| R8178 | T10122 | T10123 | advmod | also,found |
| R8179 | T10123 | T10123 | ROOT | found,found |
| R8180 | T10124 | T10134 | mark | that,luciferase |
| R8181 | T10125 | T10129 | nummod | RPS3,expression |
| R8182 | T10126 | T10129 | amod | knockdown,expression |
| R8183 | T10127 | T10129 | amod | reduced,expression |
| R8184 | T10128 | T10129 | amod | TNF-induced,expression |
| R8185 | T10129 | T10134 | nsubj | expression,luciferase |
| R8186 | T10130 | T10129 | prep | of,expression |
| R6602 | T8148 | T8155 | advmod | Thus,contains |
| R6603 | T8149 | T8155 | punct | ",",contains |
| R6604 | T8150 | T8155 | advmod | the,contains |
| R6605 | T8151 | T8155 | nsubj | RPS3,contains |
| R6606 | T8152 | T8155 | nsubj | C-terminal,contains |
| R6607 | T8153 | T8155 | nsubj | tail,contains |
| R6608 | T8154 | T8155 | advmod | potentially,contains |
| R6609 | T8155 | T8155 | ROOT | contains,contains |
| R6610 | T8156 | T8159 | det | an,site |
| R6611 | T8157 | T8159 | amod | important,site |
| R6612 | T8158 | T8159 | amod | regulatory,site |
| R6613 | T8159 | T8155 | dobj | site,contains |
| R6614 | T8160 | T8155 | punct | .,contains |
| R7913 | T9857 | T9870 | nsubj | Phosphorylation,plays |
| R7914 | T9858 | T9857 | prep | of,Phosphorylation |
| R7915 | T9859 | T9858 | pobj | RPS3,of |
| R7916 | T9860 | T9857 | cc | and,Phosphorylation |
| R7917 | T9861 | T9863 | poss | its,function |
| R7918 | T9862 | T9863 | amod | NF-κB,function |
| R7919 | T9863 | T9857 | conj | function,Phosphorylation |
| R7920 | T9864 | T9866 | nsubj | We,examined |
| R7921 | T9865 | T9866 | advmod | next,examined |
| R7922 | T9866 | T9857 | relcl | examined,Phosphorylation |
| R7923 | T9867 | T9870 | mark | whether,plays |
| R7924 | T9868 | T9869 | compound | S209,phosphorylation |
| R7925 | T9869 | T9870 | nsubj | phosphorylation,plays |
| R7926 | T9870 | T9870 | ROOT | plays,plays |
| R7927 | T9871 | T9872 | det | a,role |
| R7928 | T9872 | T9870 | dobj | role,plays |
| R7929 | T9873 | T9872 | prep | in,role |
| R7930 | T9874 | T9876 | det | the,translocation |
| R7931 | T9875 | T9876 | amod | nuclear,translocation |
| R7932 | T9876 | T9873 | pobj | translocation,in |
| R7933 | T9877 | T9876 | prep | of,translocation |
| R7934 | T9878 | T9877 | pobj | RPS3,of |
| R7935 | T9879 | T9872 | prep | during,role |
| R7936 | T9880 | T9881 | amod | NF-κB,activation |
| R7937 | T9881 | T9879 | pobj | activation,during |
| R7938 | T9882 | T9870 | punct | .,plays |
| R7939 | T9883 | T9884 | amod | Subcellular,fractions |
| R7940 | T9884 | T9894 | nsubjpass | fractions,prepared |
| R7941 | T9885 | T9884 | prep | from,fractions |
| R7942 | T9886 | T9887 | preconj | either,wild-type |
| R7943 | T9887 | T9892 | nmod | wild-type,cells |
| R7944 | T9888 | T9887 | cc | or,wild-type |
| R7945 | T9889 | T9890 | advmod | S209A,mutant |
| R7946 | T9890 | T9887 | conj | mutant,wild-type |
| R8022 | T9966 | T9964 | dobj | impact,tested |
| R8023 | T9967 | T9966 | prep | of,impact |
| R8024 | T9968 | T9967 | pcomp | activating,of |
| R8025 | T9969 | T9968 | dobj | NF-κB,activating |
| R8026 | T9970 | T9968 | prep | by,activating |
| R8027 | T9971 | T9970 | pcomp | overexpressing,by |
| R8028 | T9972 | T9971 | dobj | IKKβ,overexpressing |
| R8029 | T9973 | T9971 | prep | on,overexpressing |
| R8030 | T9974 | T9976 | nmod | RPS3,translocation |
| R8031 | T9975 | T9976 | amod | nuclear,translocation |
| R8032 | T9976 | T9973 | pobj | translocation,on |
| R8033 | T9977 | T9964 | punct | .,tested |
| R8034 | T9978 | T9979 | compound | IKKβ,overexpression |
| R8035 | T9979 | T9982 | nsubjpass | overexpression,measured |
| R8036 | T9980 | T9982 | aux | activated,measured |
| R8037 | T9981 | T9982 | advmod | NF-κB,measured |
| R8038 | T9982 | T9982 | ROOT | measured,measured |
| R8039 | T9983 | T9982 | agent | by,measured |
| R8040 | T9984 | T9985 | compound | luciferase,assays |
| R8041 | T9985 | T9983 | pobj | assays,by |
| R8042 | T9986 | T9988 | punct | (,Fig. |
| R8043 | T9987 | T9988 | compound | Supplementary,Fig. |
| R8044 | T9988 | T9985 | appos | Fig.,assays |
| R8045 | T9989 | T9988 | nummod | 7,Fig. |
| R8046 | T9990 | T9988 | punct | ),Fig. |
| R8047 | T9991 | T9985 | punct | ",",assays |
| R8048 | T9992 | T9982 | cc | and,measured |
| R8049 | T9993 | T9994 | advmod | also,induced |
| R8050 | T9994 | T9982 | conj | induced,measured |
| R8051 | T9995 | T9997 | det | the,translocation |
| R8052 | T9996 | T9997 | amod | nuclear,translocation |
| R8053 | T9997 | T9994 | dobj | translocation,induced |
| R8054 | T9998 | T9997 | prep | of,translocation |
| R8055 | T9999 | T9998 | pobj | wild-type,of |
| R8056 | T10000 | T9994 | punct | ",",induced |
| R8057 | T10001 | T9994 | cc | but,induced |
| R8058 | T10002 | T10003 | neg | not,S209A |
| R8059 | T10003 | T9994 | conj | S209A,induced |
| R8060 | T10004 | T10003 | punct | ",",S209A |
| R8061 | T10005 | T10003 | conj | RPS3,S209A |
| R8062 | T10006 | T10005 | punct | (,RPS3 |
| R8063 | T10007 | T10005 | appos | Fig.,RPS3 |
| R8064 | T10008 | T10007 | nummod | 5b,Fig. |
| R8065 | T10009 | T10005 | punct | ),RPS3 |
| R8066 | T10010 | T9982 | punct | .,measured |
| R8067 | T10011 | T10012 | det | These,data |
| R8068 | T10012 | T10013 | nsubj | data,suggest |
| R8069 | T10013 | T10013 | ROOT | suggest,suggest |
| R8070 | T10014 | T10017 | mark | that,is |
| R8071 | T10015 | T10016 | nummod | S209,phosphorylation |
| R8072 | T10016 | T10017 | nsubj | phosphorylation,is |
| R8073 | T10017 | T10013 | ccomp | is,suggest |
| R8074 | T10018 | T10017 | acomp | critical,is |
| R8075 | T10019 | T10018 | prep | for,critical |
| R8076 | T10020 | T10021 | det | the,NF-κB |
| R8077 | T10021 | T10019 | pobj | NF-κB,for |
| R8078 | T10022 | T10025 | amod | activation-induced,translocation |
| R8079 | T10023 | T10025 | nummod | RPS3,translocation |
| R8080 | T10024 | T10025 | amod | nuclear,translocation |
| R8081 | T10025 | T10017 | dobj | translocation,is |
| R8082 | T10026 | T10013 | punct | .,suggest |
| R8083 | T10027 | T10028 | aux | To,examine |
| R8084 | T10028 | T10046 | advcl | examine,silenced |
| R8085 | T10029 | T10030 | det | the,role |
| R8086 | T10030 | T10028 | dobj | role,examine |
| R8087 | T10031 | T10030 | prep | of,role |
| R8088 | T10032 | T10033 | nummod | S209,phosphorylation |
| R8089 | T10033 | T10031 | pobj | phosphorylation,of |
| R8090 | T10034 | T10033 | prep | of,phosphorylation |
| R8091 | T10035 | T10034 | pobj | RPS3,of |
| R8092 | T10036 | T10046 | prep | to,silenced |
| R8093 | T10037 | T10039 | poss | its,function6 |
| R8094 | T10038 | T10039 | compound | NF-κB,function6 |
| R8095 | T10039 | T10036 | pobj | function6,to |
| R8096 | T10040 | T10039 | punct | ",",function6 |
| R8097 | T10041 | T10039 | appos | 7,function6 |
| R8098 | T10042 | T10039 | punct | ",",function6 |
| R8099 | T10043 | T10039 | appos | 30,function6 |
| R8100 | T10044 | T10046 | punct | ",",silenced |
| R8101 | T10045 | T10046 | nsubj | we,silenced |
| R8102 | T10046 | T10046 | ROOT | silenced,silenced |
| R8103 | T10047 | T10049 | amod | endogenous,expression |
| R8104 | T10048 | T10049 | compound | RPS3,expression |
| R8105 | T10049 | T10046 | dobj | expression,silenced |
| R8106 | T10050 | T10046 | advcl | using,silenced |
| R8107 | T10051 | T10052 | det | an,siRNA |
| R8108 | T10052 | T10050 | dobj | siRNA,using |
| R8109 | T10053 | T10054 | nsubj | that,targets |
| R8110 | T10054 | T10052 | relcl | targets,siRNA |
| R8111 | T10055 | T10059 | det | the,region |
| R8112 | T10056 | T10057 | nummod | 3,′ |
| R8113 | T10057 | T10059 | nmod | ′,region |
| R8114 | T10058 | T10059 | amod | untranslated,region |
| R8115 | T10059 | T10054 | dobj | region,targets |
| R8116 | T10060 | T10059 | punct | (,region |
| R8117 | T10061 | T10062 | nummod | 3,′ |
| R8118 | T10062 | T10063 | nummod | ′,UTR |
| R8119 | T10063 | T10059 | appos | UTR,region |
| R8120 | T10064 | T10059 | punct | ),region |
| R8121 | T10065 | T10059 | prep | of,region |
| R8122 | T10066 | T10067 | nummod | RPS3,mRNA |
| R8123 | T10067 | T10065 | pobj | mRNA,of |
| R8124 | T10068 | T10046 | punct | ",",silenced |
| R8125 | T10069 | T10046 | advcl | followed,silenced |
| R8126 | T10070 | T10069 | agent | by,followed |
| R8127 | T10071 | T10070 | pobj | complementation,by |
| R8128 | T10072 | T10069 | prep | with,followed |
| R8129 | T10073 | T10074 | preconj | either,wild-type |
| R8130 | T10074 | T10078 | amod | wild-type,RPS3 |
| R8131 | T10075 | T10074 | cc | or,wild-type |
| R8132 | T10076 | T10074 | conj | S209A,wild-type |
| R8187 | T10131 | T10133 | det | an,κB-driven |
| R8188 | T10132 | T10133 | compound | Ig,κB-driven |
| R8189 | T10133 | T10130 | pobj | κB-driven,of |
| R8190 | T10134 | T10123 | ccomp | luciferase,found |
| R8191 | T10135 | T10134 | npadvmod | construct6,luciferase |
| R8192 | T10136 | T10139 | punct | (,) |
| R8193 | T10137 | T10139 | nmod | Fig.,) |
| R8194 | T10138 | T10137 | nummod | 5d,Fig. |
| R8195 | T10139 | T10123 | punct | ),found |
| R8196 | T10140 | T10123 | punct | .,found |
| R8197 | T10141 | T10144 | det | The,signal |
| R8198 | T10142 | T10144 | amod | impaired,signal |
| R8199 | T10143 | T10144 | compound | luciferase,signal |
| R8200 | T10144 | T10151 | nsubjpass | signal,restored |
| R8201 | T10145 | T10144 | acl | caused,signal |
| R8202 | T10146 | T10145 | agent | by,caused |
| R8230 | T10174 | T10187 | advmod | Moreover,result |
| R8231 | T10175 | T10187 | punct | ",",result |
| R8232 | T10176 | T10177 | det | the,failure |
| R8233 | T10177 | T10187 | nsubj | failure,result |
| R8234 | T10178 | T10177 | prep | of,failure |
| R8235 | T10179 | T10180 | compound | S209A,RPS3 |
| R8236 | T10180 | T10178 | pobj | RPS3,of |
| R8237 | T10181 | T10182 | aux | to,restore |
| R8238 | T10182 | T10177 | acl | restore,failure |
| R8239 | T10183 | T10184 | compound | luciferase,activity |
| R8240 | T10184 | T10182 | dobj | activity,restore |
| R8241 | T10185 | T10187 | aux | did,result |
| R8242 | T10186 | T10187 | neg | not,result |
| R8243 | T10187 | T10187 | ROOT | result,result |
| R8244 | T10188 | T10187 | prep | from,result |
| R8245 | T10189 | T10190 | amod | defective,translation |
| R8246 | T10190 | T10188 | pobj | translation,from |
| R8247 | T10191 | T10202 | mark | because,was |
| R8248 | T10192 | T10194 | det | the,overexpression |
| R8249 | T10193 | T10194 | amod | transient,overexpression |
| R8250 | T10194 | T10202 | nsubj | overexpression,was |
| R8251 | T10195 | T10194 | prep | of,overexpression |
| R8252 | T10196 | T10198 | amod | green,protein |
| R8253 | T10197 | T10198 | amod | fluorescent,protein |
| R8254 | T10198 | T10195 | pobj | protein,of |
| R8255 | T10199 | T10200 | punct | (,GFP |
| R8256 | T10200 | T10198 | appos | GFP,protein |
| R8257 | T10201 | T10198 | punct | ),protein |
| R8258 | T10202 | T10187 | advcl | was,result |
| R8259 | T10203 | T10202 | acomp | comparable,was |
| R8260 | T10204 | T10202 | prep | in,was |
| R8261 | T10205 | T10204 | pobj | cells,in |
| R8262 | T10206 | T10205 | acl | complemented,cells |
| R8263 | T10207 | T10206 | prep | with,complemented |
| R8264 | T10208 | T10207 | pobj | wild-type,with |
| R8265 | T10209 | T10208 | cc | or,wild-type |
| R8266 | T10210 | T10211 | compound | S029A,RPS3 |
| R8267 | T10211 | T10208 | conj | RPS3,wild-type |
| R8268 | T10212 | T10214 | punct | (,Fig. |
| R8269 | T10213 | T10214 | compound | Supplementary,Fig. |
| R8270 | T10214 | T10211 | appos | Fig.,RPS3 |
| R8271 | T10215 | T10214 | nummod | 8,Fig. |
| R8272 | T10216 | T10214 | punct | ),Fig. |
| R8348 | T10292 | T10295 | nmod | NFKBIA,promoters |
| R8349 | T10293 | T10292 | cc | and,NFKBIA |
| R8350 | T10294 | T10292 | conj | IL8,NFKBIA |
| R8351 | T10295 | T10290 | pobj | promoters,of |
| R8352 | T10296 | T10299 | punct | (,) |
| R8353 | T10297 | T10299 | nmod | Fig.,) |
| R8354 | T10298 | T10297 | nummod | 5e,Fig. |
| R8355 | T10299 | T10280 | punct | ),wild-type |
| R8356 | T10300 | T10272 | punct | .,stimulated |
| R8357 | T10301 | T10302 | mark | While,expressing |
| R8358 | T10302 | T10305 | advcl | expressing,had |
| R8359 | T10303 | T10304 | compound | RPS3,S209A |
| R8360 | T10304 | T10302 | dobj | S209A,expressing |
| R8361 | T10305 | T10315 | advcl | had,attenuated |
| R8362 | T10306 | T10307 | det | no,impact |
| R8363 | T10307 | T10305 | dobj | impact,had |
| R8364 | T10308 | T10307 | prep | on,impact |
| R8365 | T10309 | T10311 | nummod | p65,translocation |
| R8366 | T10310 | T10311 | amod | nuclear,translocation |
| R8367 | T10311 | T10308 | pobj | translocation,on |
| R8368 | T10312 | T10315 | punct | ",",attenuated |
| R8369 | T10313 | T10315 | nsubj | it,attenuated |
| R8370 | T10314 | T10315 | advmod | substantially,attenuated |
| R8371 | T10315 | T10315 | ROOT | attenuated,attenuated |
| R8372 | T10316 | T10317 | nummod | p65,recruitment |
| R8373 | T10317 | T10315 | dobj | recruitment,attenuated |
| R8374 | T10318 | T10319 | punct | (,Fig. |
| R8375 | T10319 | T10317 | appos | Fig.,recruitment |
| R8376 | T10320 | T10319 | nummod | 5e,Fig. |
| R8377 | T10321 | T10317 | punct | ),recruitment |
| R8378 | T10322 | T10315 | punct | .,attenuated |
| R8379 | T10323 | T10324 | amod | Additional,experiments |
| R8380 | T10324 | T10325 | nsubj | experiments,revealed |
| R8381 | T10325 | T10325 | ROOT | revealed,revealed |
| R8133 | T10077 | T10078 | amod | mutant,RPS3 |
| R8134 | T10078 | T10072 | pobj | RPS3,with |
| R8135 | T10079 | T10078 | prep | via,RPS3 |
| R8136 | T10080 | T10079 | pobj | transfection,via |
| R8137 | T10081 | T10046 | punct | .,silenced |
| R8138 | T10082 | T10083 | mark | As,expected |
| R8139 | T10083 | T10088 | advcl | expected,reduced |
| R8140 | T10084 | T10088 | punct | ",",reduced |
| R8141 | T10085 | T10086 | compound | RPS3,siRNA |
| R8142 | T10086 | T10088 | nsubj | siRNA,reduced |
| R8143 | T10087 | T10088 | advmod | severely,reduced |
| R8144 | T10088 | T10088 | ROOT | reduced,reduced |
| R8145 | T10089 | T10091 | amod | endogenous,abundance |
| R8146 | T10090 | T10091 | compound | RPS3,abundance |
| R8147 | T10091 | T10088 | dobj | abundance,reduced |
| R8148 | T10092 | T10088 | prep | compared,reduced |
| R8149 | T10093 | T10092 | prep | to,compared |
| R8150 | T10094 | T10095 | compound | NS,siRNA |
| R8151 | T10095 | T10093 | pobj | siRNA,to |
| R8152 | T10096 | T10088 | punct | ",",reduced |
| R8153 | T10097 | T10088 | cc | but,reduced |
| R8154 | T10098 | T10100 | aux | did,affect |
| R8155 | T10099 | T10100 | neg | not,affect |
| R8156 | T10100 | T10088 | conj | affect,reduced |
| R8157 | T10101 | T10103 | det | the,expression |
| R8158 | T10102 | T10103 | amod | robust,expression |
| R8159 | T10103 | T10100 | dobj | expression,affect |
| R8160 | T10104 | T10103 | prep | of,expression |
| R8161 | T10105 | T10106 | amod | Flag-tagged,RPS3 |
| R8162 | T10106 | T10104 | pobj | RPS3,of |
| R8163 | T10107 | T10100 | prep | from,affect |
| R8164 | T10108 | T10110 | det | a,construct |
| R8165 | T10109 | T10110 | amod | transfected,construct |
| R8166 | T10110 | T10100 | conj | construct,affect |
| R8167 | T10111 | T10110 | advcl | lacking,construct |
| R8168 | T10112 | T10115 | det | the,UTR |
| R8169 | T10113 | T10114 | nummod | 3,′ |
| R8170 | T10114 | T10115 | compound | ′,UTR |
| R8273 | T10217 | T10187 | punct | .,result |
| R8274 | T10218 | T10223 | advcl | Taken,suggest |
| R8275 | T10219 | T10218 | advmod | together,Taken |
| R8276 | T10220 | T10223 | punct | ",",suggest |
| R8277 | T10221 | T10222 | det | these,data |
| R8278 | T10222 | T10223 | nsubj | data,suggest |
| R8279 | T10223 | T10223 | ROOT | suggest,suggest |
| R8280 | T10224 | T10228 | mark | that,is |
| R8281 | T10225 | T10227 | nummod | RPS3,phosphorylation |
| R8282 | T10226 | T10227 | nummod | S209,phosphorylation |
| R8283 | T10227 | T10228 | nsubj | phosphorylation,is |
| R8284 | T10228 | T10223 | ccomp | is,suggest |
| R8285 | T10229 | T10228 | acomp | critical,is |
| R8286 | T10230 | T10229 | prep | for,critical |
| R8287 | T10231 | T10232 | amod | NF-κB,activity |
| R8288 | T10232 | T10230 | pobj | activity,for |
| R8289 | T10233 | T10232 | acl | involving,activity |
| R8290 | T10234 | T10238 | det | the,site |
| R8291 | T10235 | T10238 | amod | canonical,site |
| R8292 | T10236 | T10237 | compound | Ig,κB |
| R8293 | T10237 | T10238 | compound | κB,site |
| R8294 | T10238 | T10233 | dobj | site,involving |
| R8295 | T10239 | T10223 | punct | .,suggest |
| R8296 | T10240 | T10242 | nsubj | We,used |
| R8297 | T10241 | T10242 | advmod | next,used |
| R8298 | T10242 | T10242 | ROOT | used,used |
| R8299 | T10243 | T10244 | compound | chromatin,immunoprecipitation |
| R8300 | T10244 | T10242 | dobj | immunoprecipitation,used |
| R8301 | T10245 | T10246 | aux | to,determine |
| R8302 | T10246 | T10242 | xcomp | determine,used |
| R8303 | T10247 | T10250 | mark | whether,affects |
| R8304 | T10248 | T10249 | compound | S209,phosphorylation |
| R8305 | T10249 | T10250 | nsubj | phosphorylation,affects |
| R8306 | T10250 | T10246 | ccomp | affects,determine |
| R8307 | T10251 | T10250 | dobj | RPS3,affects |
| R8308 | T10252 | T10251 | cc | and,RPS3 |
| R8309 | T10253 | T10254 | nummod | p65,recruitment |
| R8310 | T10254 | T10251 | conj | recruitment,RPS3 |
| R8311 | T10255 | T10250 | prep | to,affects |
| R8312 | T10256 | T10258 | amod | specific,sites |
| R8313 | T10257 | T10258 | compound | κB,sites |
| R8314 | T10258 | T10255 | pobj | sites,to |
| R8315 | T10259 | T10258 | prep | in,sites |
| R8316 | T10260 | T10261 | amod | intact,chromatin |
| R8317 | T10261 | T10259 | pobj | chromatin,in |
| R8318 | T10262 | T10250 | prep | during,affects |
| R8319 | T10263 | T10264 | compound | NF-κB,activation |
| R8320 | T10264 | T10262 | pobj | activation,during |
| R8321 | T10265 | T10242 | punct | .,used |
| R8322 | T10266 | T10272 | prep | In,stimulated |
| R8323 | T10267 | T10269 | nummod | RPS3,cells |
| R8324 | T10268 | T10269 | amod | knockdown,cells |
| R8325 | T10269 | T10266 | pobj | cells,In |
| R8326 | T10270 | T10272 | punct | ",",stimulated |
| R8327 | T10271 | T10272 | nsubj | PMA+I,stimulated |
| R8328 | T10272 | T10272 | ROOT | stimulated,stimulated |
| R8329 | T10273 | T10274 | det | the,recruitment |
| R8330 | T10274 | T10272 | dobj | recruitment,stimulated |
| R8331 | T10275 | T10274 | prep | of,recruitment |
| R8332 | T10276 | T10277 | advmod | ectopically,expressed |
| R8333 | T10277 | T10280 | amod | expressed,wild-type |
| R8334 | T10278 | T10277 | punct | ",",expressed |
| R8335 | T10279 | T10280 | compound | Flag-tagged,wild-type |
| R8336 | T10280 | T10275 | pobj | wild-type,of |
| R8337 | T10281 | T10280 | punct | ",",wild-type |
| R8338 | T10282 | T10285 | cc | but,RPS3 |
| R8339 | T10283 | T10285 | neg | not,RPS3 |
| R8340 | T10284 | T10285 | compound | S209A,RPS3 |
| R8341 | T10285 | T10280 | conj | RPS3,wild-type |
| R8342 | T10286 | T10280 | prep | to,wild-type |
| R8343 | T10287 | T10289 | det | the,sites |
| R8344 | T10288 | T10289 | amod | κB,sites |
| R8345 | T10289 | T10286 | pobj | sites,to |
| R8346 | T10290 | T10289 | prep | of,sites |
| R8347 | T10291 | T10292 | det | the,NFKBIA |
| R8423 | T10367 | T10365 | appos | Fig.,sites |
| R8424 | T10368 | T10367 | nummod | 5e,Fig. |
| R8425 | T10369 | T10365 | punct | ),sites |
| R8426 | T10370 | T10353 | punct | ",",was |
| R8427 | T10371 | T10353 | advcl | suggesting,was |
| R8428 | T10372 | T10373 | det | the,recruitment |
| R8429 | T10373 | T10374 | nsubj | recruitment,was |
| R8430 | T10374 | T10371 | ccomp | was,suggesting |
| R8431 | T10375 | T10376 | advmod | κB,site-specific |
| R8432 | T10376 | T10374 | acomp | site-specific,was |
| R8433 | T10377 | T10353 | punct | .,was |
| R8434 | T10378 | T10395 | advmod | Thus,depended |
| R8435 | T10379 | T10395 | punct | ",",depended |
| R8436 | T10380 | T10381 | det | the,recruitment |
| R8437 | T10381 | T10395 | nsubj | recruitment,depended |
| R8438 | T10382 | T10381 | prep | of,recruitment |
| R8439 | T10383 | T10382 | pobj | RPS3,of |
| R8440 | T10384 | T10386 | advmod | as,as |
| R8441 | T10385 | T10386 | advmod | well,as |
| R8442 | T10386 | T10381 | cc | as,recruitment |
| R8443 | T10387 | T10389 | det | the,recruitment |
| R8444 | T10388 | T10389 | amod | contingent,recruitment |
| R8445 | T10389 | T10381 | conj | recruitment,recruitment |
| R8446 | T10390 | T10389 | prep | of,recruitment |
| R8447 | T10391 | T10390 | pobj | p65,of |
| R8448 | T10392 | T10389 | prep | to,recruitment |
| R8449 | T10393 | T10394 | amod | key,promoters |
| R8450 | T10394 | T10392 | pobj | promoters,to |
| R8451 | T10395 | T10395 | ROOT | depended,depended |
| R8452 | T10396 | T10395 | prep | on,depended |
| R8453 | T10397 | T10396 | pobj | S209,on |
| R8454 | T10398 | T10395 | punct | .,depended |
| R8455 | T10399 | T10399 | ROOT | Interleukin,Interleukin |
| R8456 | T10400 | T10399 | nummod | 8,Interleukin |
| R8457 | T10401 | T10404 | punct | (,secretion |
| R8458 | T10402 | T10404 | nmod | IL-8,secretion |
| R8459 | T10403 | T10404 | punct | ),secretion |
| R8460 | T10404 | T10415 | nmod | secretion,stimulation |
| R8461 | T10405 | T10404 | acl | induced,secretion |
| R8462 | T10406 | T10405 | agent | by,induced |
| R8463 | T10407 | T10410 | det | either,receptor |
| R8464 | T10408 | T10410 | compound | T,receptor |
| R8465 | T10409 | T10410 | compound | cell,receptor |
| R8466 | T10410 | T10406 | pobj | receptor,by |
| R8467 | T10411 | T10412 | punct | (,TCR |
| R8382 | T10326 | T10339 | mark | that,increased |
| R8383 | T10327 | T10328 | nummod | p65,attraction |
| R8384 | T10328 | T10339 | nsubjpass | attraction,increased |
| R8385 | T10329 | T10328 | prep | to,attraction |
| R8386 | T10330 | T10334 | amod | RPS3-independent,promoters |
| R8387 | T10331 | T10333 | amod | NF-κB,gene |
| R8388 | T10332 | T10333 | compound | target,gene |
| R8389 | T10333 | T10334 | compound | gene,promoters |
| R8390 | T10334 | T10329 | pobj | promoters,to |
| R8391 | T10335 | T10336 | amod | such,as |
| R8392 | T10336 | T10334 | prep | as,promoters |
| R8393 | T10337 | T10336 | pobj | CD25,as |
| R8394 | T10338 | T10339 | auxpass | was,increased |
| R8395 | T10339 | T10325 | ccomp | increased,revealed |
| R8396 | T10340 | T10339 | punct | (,increased |
| R8397 | T10341 | T10342 | compound | Supplementary,Fig. |
| R8398 | T10342 | T10339 | npadvmod | Fig.,increased |
| R8399 | T10343 | T10342 | nummod | 9,Fig. |
| R8400 | T10344 | T10339 | punct | ),increased |
| R8401 | T10345 | T10339 | punct | ",",increased |
| R8402 | T10346 | T10339 | advcl | consistent,increased |
| R8403 | T10347 | T10346 | prep | with,consistent |
| R8404 | T10348 | T10350 | poss | our,observations6 |
| R8405 | T10349 | T10350 | amod | previous,observations6 |
| R8406 | T10350 | T10347 | pobj | observations6,with |
| R8407 | T10351 | T10325 | punct | .,revealed |
| R8408 | T10352 | T10353 | expl | There,was |
| R8409 | T10353 | T10353 | ROOT | was,was |
| R8410 | T10354 | T10356 | det | no,Flag-RPS3 |
| R8411 | T10355 | T10356 | amod | significant,Flag-RPS3 |
| R8412 | T10356 | T10353 | attr | Flag-RPS3,was |
| R8413 | T10357 | T10356 | cc | or,Flag-RPS3 |
| R8414 | T10358 | T10359 | nummod | p65,recruitment |
| R8415 | T10359 | T10356 | conj | recruitment,Flag-RPS3 |
| R8416 | T10360 | T10359 | prep | to,recruitment |
| R8417 | T10361 | T10362 | compound | ACTB,promoter |
| R8418 | T10362 | T10360 | pobj | promoter,to |
| R8419 | T10363 | T10359 | acl | lacking,recruitment |
| R8420 | T10364 | T10365 | compound | κB,sites |
| R8421 | T10365 | T10363 | dobj | sites,lacking |
| R8422 | T10366 | T10365 | punct | (,sites |
| R10014 | T12437 | T12438 | nummod | NleH1,inhibits |
| R10015 | T12438 | T12445 | nsubj | inhibits,are |
| R10016 | T12439 | T12440 | compound | RPS3,phosphorylation |
| R10017 | T12440 | T12438 | dobj | phosphorylation,inhibits |
| R10018 | T12441 | T12438 | prep | in,inhibits |
| R10019 | T12442 | T12444 | amod | vitro,pathogens |
| R10020 | T12443 | T12444 | compound | EHEC,pathogens |
| R10021 | T12444 | T12441 | pobj | pathogens,in |
| R10022 | T12445 | T12445 | ROOT | are,are |
| R10023 | T12446 | T12448 | amod | important,agents |
| R10024 | T12447 | T12448 | amod | causative,agents |
| R10025 | T12448 | T12445 | attr | agents,are |
| R10026 | T12449 | T12448 | prep | of,agents |
| R10027 | T12450 | T12452 | det | both,disease |
| R10028 | T12451 | T12452 | amod | foodborne,disease |
| R10029 | T12452 | T12449 | pobj | disease,of |
| R10030 | T12453 | T12452 | cc | and,disease |
| R10031 | T12454 | T12456 | amod | pediatric,failure31 |
| R10032 | T12455 | T12456 | amod | renal,failure31 |
| R10033 | T12456 | T12452 | conj | failure31,disease |
| R10034 | T12457 | T12445 | punct | .,are |
| R10035 | T12458 | T12459 | nsubj | EHEC,utilize |
| R10036 | T12459 | T12459 | ROOT | utilize,utilize |
| R10037 | T12460 | T12459 | dobj | T3SS,utilize |
| R10038 | T12461 | T12462 | aux | to,inject |
| R10039 | T12462 | T12459 | xcomp | inject,utilize |
| R10040 | T12463 | T12464 | compound | effector,proteins |
| R10041 | T12464 | T12462 | dobj | proteins,inject |
| R10042 | T12465 | T12466 | advmod | directly,into |
| R10043 | T12466 | T12462 | prep | into,inject |
| R10044 | T12467 | T12469 | amod | intestinal,cells32 |
| R10045 | T12468 | T12469 | amod | epithelial,cells32 |
| R10046 | T12469 | T12466 | pobj | cells32,into |
| R10047 | T12470 | T12475 | punct | ",",inhibit |
| R10048 | T12471 | T12472 | det | a,subset |
| R10049 | T12472 | T12475 | nsubj | subset,inhibit |
| R10050 | T12473 | T12472 | prep | of,subset |
| R10051 | T12474 | T12473 | pobj | which,of |
| R10052 | T12475 | T12459 | conj | inhibit,utilize |
| R10053 | T12476 | T12477 | advmod | NF-κB-dependent,innate |
| R10054 | T12477 | T12480 | amod | innate,33-38 |
| R10055 | T12478 | T12477 | appos | responses9,innate |
| R10056 | T12479 | T12477 | punct | ",",innate |
| R10057 | T12480 | T12475 | dobj | 33-38,inhibit |
| R10058 | T12481 | T12475 | punct | .,inhibit |
| R10059 | T12482 | T12485 | det | The,O157 |
| R10060 | T12483 | T12485 | compound | E.,O157 |
| R10061 | T12484 | T12485 | compound | coli,O157 |
| R10062 | T12485 | T12485 | ROOT | O157,O157 |
| R10063 | T12486 | T12485 | punct | :,O157 |
| R10064 | T12487 | T12490 | compound | H7,protein |
| R10065 | T12488 | T12490 | compound | EDL933,protein |
| R10066 | T12489 | T12490 | compound | effector,protein |
| R10067 | T12490 | T12492 | nsubj | protein,binds |
| R10068 | T12491 | T12492 | nsubj | NleH1,binds |
| R10069 | T12492 | T12492 | ROOT | binds,binds |
| R10070 | T12493 | T12492 | prep | to,binds |
| R10071 | T12494 | T12492 | cc | and,binds |
| R10072 | T12495 | T12492 | conj | attenuates,binds |
| R8468 | T10412 | T10410 | appos | TCR,receptor |
| R8469 | T10413 | T10405 | punct | ),induced |
| R8470 | T10414 | T10415 | amod | agonist,stimulation |
| R8471 | T10415 | T10419 | nsubjpass | stimulation,decreased |
| R8472 | T10416 | T10415 | cc | or,stimulation |
| R8473 | T10417 | T10415 | conj | PMA+I,stimulation |
| R8474 | T10418 | T10419 | auxpass | was,decreased |
| R8475 | T10419 | T10419 | ROOT | decreased,decreased |
| R8476 | T10420 | T10419 | prep | as,decreased |
| R8477 | T10421 | T10422 | det | a,consequence |
| R8478 | T10422 | T10420 | pobj | consequence,as |
| R8479 | T10423 | T10422 | prep | of,consequence |
| R8480 | T10424 | T10425 | amod | reduced,RPS3/p65 |
| R8481 | T10425 | T10426 | compound | RPS3/p65,recruitment |
| R8482 | T10426 | T10423 | pobj | recruitment,of |
| R8483 | T10427 | T10422 | prep | to,consequence |
| R8484 | T10428 | T10431 | det | the,sites |
| R8485 | T10429 | T10430 | compound | IL8,κB |
| R8486 | T10430 | T10431 | compound | κB,sites |
| R8487 | T10431 | T10427 | pobj | sites,to |
| R8488 | T10432 | T10431 | prep | in,sites |
| R8489 | T10433 | T10434 | det | the,presence |
| R8490 | T10434 | T10432 | pobj | presence,in |
| R8491 | T10435 | T10434 | prep | of,presence |
| R8492 | T10436 | T10438 | nummod | S209A,compared |
| R8493 | T10437 | T10438 | amod | mutant,compared |
| R8494 | T10438 | T10419 | prep | compared,decreased |
| R8495 | T10439 | T10438 | prep | to,compared |
| R8496 | T10440 | T10441 | compound | wild-type,RPS3 |
| R8497 | T10441 | T10439 | pobj | RPS3,to |
| R8498 | T10442 | T10444 | punct | (,Fig. |
| R8499 | T10443 | T10444 | compound | Supplementary,Fig. |
| R8500 | T10444 | T10441 | appos | Fig.,RPS3 |
| R8501 | T10445 | T10444 | nummod | 10,Fig. |
| R8502 | T10446 | T10444 | punct | ),Fig. |
| R8503 | T10447 | T10419 | punct | .,decreased |
| R8504 | T10448 | T10454 | advmod | However,was |
| R8505 | T10449 | T10454 | punct | ",",was |
| R8506 | T10450 | T10451 | compound | cell,surface |
| R8507 | T10451 | T10453 | compound | surface,expression |
| R8508 | T10452 | T10453 | compound | CD25,expression |
| R8509 | T10453 | T10454 | nsubj | expression,was |
| R8510 | T10454 | T10454 | ROOT | was,was |
| R8511 | T10455 | T10454 | acomp | comparable,was |
| R8512 | T10456 | T10455 | prep | between,comparable |
| R8513 | T10457 | T10458 | det | the,wild-type |
| R8514 | T10458 | T10456 | pobj | wild-type,between |
| R8515 | T10459 | T10458 | cc | and,wild-type |
| R8516 | T10460 | T10461 | compound | S209A,RPS3 |
| R8517 | T10461 | T10458 | conj | RPS3,wild-type |
| R8518 | T10462 | T10463 | amod | transfected,cells |
| R8519 | T10463 | T10456 | pobj | cells,between |
| R8520 | T10464 | T10466 | punct | (,Fig. |
| R8521 | T10465 | T10466 | compound | Supplementary,Fig. |
| R8522 | T10466 | T10454 | attr | Fig.,was |
| R8523 | T10467 | T10466 | nummod | 11,Fig. |
| R8524 | T10468 | T10466 | punct | ),Fig. |
| R8525 | T10469 | T10454 | punct | .,was |
| R8526 | T10470 | T10479 | advmod | Therefore,required |
| R8527 | T10471 | T10479 | punct | ",",required |
| R8528 | T10472 | T10474 | compound | RPS3,phosphorylation |
| R8529 | T10473 | T10474 | compound | S209,phosphorylation |
| R8530 | T10474 | T10479 | nsubjpass | phosphorylation,required |
| R8531 | T10475 | T10474 | prep | by,phosphorylation |
| R8532 | T10476 | T10475 | pobj | IKKβ,by |
| R8533 | T10477 | T10479 | auxpass | is,required |
| R8534 | T10478 | T10479 | advmod | apparently,required |
| R8535 | T10479 | T10479 | ROOT | required,required |
| R8536 | T10480 | T10479 | prep | for,required |
| R8537 | T10481 | T10480 | pobj | RPS3,for |
| R8538 | T10482 | T10479 | prep | in,required |
| R8539 | T10483 | T10482 | pcomp | directing,in |
| R8540 | T10484 | T10483 | dobj | NF-κB,directing |
| R8541 | T10485 | T10483 | prep | to,directing |
| R8542 | T10486 | T10488 | det | a,subset |
| R8543 | T10487 | T10488 | amod | specific,subset |
| R8544 | T10488 | T10485 | pobj | subset,to |
| R8545 | T10489 | T10488 | prep | of,subset |
| R8546 | T10490 | T10491 | compound | target,genes |
| R8547 | T10491 | T10489 | pobj | genes,of |
| R8548 | T10492 | T10479 | punct | .,required |
| R10076 | T12499 | T12492 | punct | ",",binds |
| R10077 | T12500 | T12501 | advmod | thus,impairing |
| R10078 | T12501 | T12492 | advcl | impairing,binds |
| R10079 | T12502 | T12503 | compound | RPS3-dependent,NF-κB |
| R10080 | T12503 | T12504 | compound | NF-κB,signaling9 |
| R10081 | T12504 | T12501 | dobj | signaling9,impairing |
| R10082 | T12505 | T12492 | punct | .,binds |
| R10083 | T12506 | T12508 | nsubj | We,hypothesized |
| R10084 | T12507 | T12508 | advmod | therefore,hypothesized |
| R10085 | T12508 | T12508 | ROOT | hypothesized,hypothesized |
| R10086 | T12509 | T12512 | mark | that,function |
| R10087 | T12510 | T12512 | nsubj | NleH1,function |
| R10088 | T12511 | T12512 | aux | may,function |
| R10089 | T12512 | T12508 | ccomp | function,hypothesized |
| R10090 | T12513 | T12512 | prep | by,function |
| R10091 | T12514 | T12513 | pcomp | inhibiting,by |
| R10092 | T12515 | T12517 | compound | RPS3,phosphorylation |
| R10093 | T12516 | T12517 | compound | S209,phosphorylation |
| R10094 | T12517 | T12514 | dobj | phosphorylation,inhibiting |
| R10095 | T12518 | T12508 | punct | .,hypothesized |
| R10096 | T12519 | T12520 | mark | As,expected |
| R10097 | T12520 | T12520 | ROOT | expected,expected |
| R10098 | T12521 | T12520 | punct | ",",expected |
| R10099 | T12522 | T12520 | advcl | transfecting,expected |
| R10100 | T12523 | T12524 | amod | increasing,amounts |
| R10101 | T12524 | T12522 | dobj | amounts,transfecting |
| R10102 | T12525 | T12524 | prep | of,amounts |
| R10103 | T12526 | T12527 | amod | NleH1-HA,plasmid |
| R10104 | T12527 | T12525 | pobj | plasmid,of |
| R10105 | T12528 | T12524 | acl | blocked,amounts |
| R10106 | T12529 | T12531 | amod | TNFα-induced,activation |
| R10107 | T12530 | T12531 | compound | NF-κB,activation |
| R10108 | T12531 | T12528 | dobj | activation,blocked |
| R10109 | T12532 | T12528 | prep | in,blocked |
| R10110 | T12533 | T12535 | det | a,manner |
| R10111 | T12534 | T12535 | amod | dose-dependent,manner |
| R10112 | T12535 | T12532 | pobj | manner,in |
| R10113 | T12536 | T12538 | punct | (,6a-b |
| R10114 | T12537 | T12538 | compound | Fig.,6a-b |
| R10115 | T12538 | T12535 | appos | 6a-b,manner |
| R10116 | T12539 | T12540 | punct | ),9 |
| R10117 | T12540 | T12538 | advmod | 9,6a-b |
| R10118 | T12541 | T12520 | punct | .,expected |
| R10119 | T12542 | T12545 | advmod | Remarkably,reduced |
| R10120 | T12543 | T12545 | punct | ",",reduced |
| R10121 | T12544 | T12545 | nsubj | NleH1,reduced |
| R10122 | T12545 | T12545 | ROOT | reduced,reduced |
| R10123 | T12546 | T12554 | det | both,phosphorylation |
| R10124 | T12547 | T12554 | amod | TNF-induced,phosphorylation |
| R10125 | T12548 | T12547 | punct | ",",TNF-induced |
| R10126 | T12549 | T12551 | advmod | as,as |
| R10127 | T12550 | T12551 | advmod | well,as |
| R10128 | T12551 | T12547 | cc | as,TNF-induced |
| R10129 | T12552 | T12553 | amod | basal,RPS3 |
| R10130 | T12553 | T12547 | conj | RPS3,TNF-induced |
| R10131 | T12554 | T12545 | dobj | phosphorylation,reduced |
| R10132 | T12555 | T12545 | prep | to,reduced |
| R10133 | T12556 | T12557 | advmod | roughly,20 |
| R10134 | T12557 | T12558 | nummod | 20,% |
| R10135 | T12558 | T12555 | pobj | %,to |
| R10136 | T12559 | T12558 | prep | of,% |
| R10137 | T12560 | T12561 | compound | vehicle,control |
| R10138 | T12561 | T12559 | pobj | control,of |
| R10139 | T12562 | T12545 | punct | (,reduced |
| R10140 | T12563 | T12565 | nmod | Fig.,) |
| R10141 | T12564 | T12563 | nummod | 6c,Fig. |
| R10142 | T12565 | T12545 | punct | ),reduced |
| R10143 | T12566 | T12545 | punct | .,reduced |
| R10144 | T12567 | T12571 | csubj | Expressing,interfere |
| R10145 | T12568 | T12567 | dobj | NleH1,Expressing |
| R10146 | T12569 | T12571 | aux | does,interfere |
| R10147 | T12570 | T12571 | neg | not,interfere |
| R10148 | T12571 | T12571 | ROOT | interfere,interfere |
| R10149 | T12572 | T12571 | prep | with,interfere |
| R10150 | T12573 | T12576 | det | either,activation |
| R10151 | T12574 | T12576 | amod | TNF-induced,activation |
| R10152 | T12575 | T12576 | compound | IKK,activation |
| R10073 | T12496 | T12498 | nmod | RPS3,translocation |
| R10074 | T12497 | T12498 | amod | nuclear,translocation |
| R10075 | T12498 | T12495 | dobj | translocation,attenuates |
| R10226 | T12649 | T12652 | det | a,increase |
| R10227 | T12650 | T12652 | amod | ∼,increase |
| R10228 | T12651 | T12652 | amod | 7-fold,increase |
| R10229 | T12652 | T12648 | dobj | increase,stimulated |
| R10230 | T12653 | T12652 | prep | in,increase |
| R10231 | T12654 | T12656 | compound | RPS3,phosphorylation |
| R10232 | T12655 | T12656 | compound | S209,phosphorylation |
| R10233 | T12656 | T12653 | pobj | phosphorylation,in |
| R10234 | T12657 | T12648 | punct | ",",stimulated |
| R10235 | T12658 | T12648 | advcl | peaking,stimulated |
| R10236 | T12659 | T12658 | prep | at,peaking |
| R10237 | T12660 | T12661 | nummod | 30,minutes |
| R10238 | T12661 | T12659 | pobj | minutes,at |
| R10239 | T12662 | T12661 | punct | (,minutes |
| R10240 | T12663 | T12661 | appos | Fig.,minutes |
| R10241 | T12664 | T12663 | nummod | 6d,Fig. |
| R10242 | T12665 | T12661 | punct | ),minutes |
| R10243 | T12666 | T12648 | punct | .,stimulated |
| R10244 | T12667 | T12675 | prep | By,impaired |
| R10245 | T12668 | T12667 | pobj | contrast,By |
| R10246 | T12669 | T12675 | punct | ",",impaired |
| R10247 | T12670 | T12672 | compound | RPS3,phosphorylation |
| R10248 | T12671 | T12672 | compound | S209,phosphorylation |
| R10249 | T12672 | T12675 | nsubjpass | phosphorylation,impaired |
| R10250 | T12673 | T12675 | auxpass | was,impaired |
| R10251 | T12674 | T12675 | advmod | substantially,impaired |
| R10252 | T12675 | T12675 | ROOT | impaired,impaired |
| R10253 | T12676 | T12675 | prep | in,impaired |
| R10254 | T12677 | T12676 | pobj | cells,in |
| R10255 | T12678 | T12677 | acl | infected,cells |
| R10256 | T12679 | T12678 | prep | with,infected |
| R10257 | T12680 | T12683 | amod | wild-type,O157 |
| R10258 | T12681 | T12683 | compound | E.,O157 |
| R10259 | T12682 | T12683 | compound | coli,O157 |
| R10260 | T12683 | T12679 | pobj | O157,with |
| R10261 | T12684 | T12675 | punct | :,impaired |
| R10262 | T12685 | T12685 | ROOT | H7,H7 |
| R10263 | T12686 | T12687 | punct | (,Fig. |
| R10264 | T12687 | T12685 | appos | Fig.,H7 |
| R10265 | T12688 | T12687 | nummod | 6d,Fig. |
| R10266 | T12689 | T12685 | punct | ),H7 |
| R10267 | T12690 | T12685 | punct | .,H7 |
| R10268 | T12691 | T12698 | advmod | However,unimpaired |
| R10269 | T12692 | T12698 | punct | ",",unimpaired |
| R10270 | T12693 | T12696 | amod | TNF-induced,phosphorylation |
| R10271 | T12694 | T12696 | compound | RPS3,phosphorylation |
| R10272 | T12695 | T12696 | compound | S209,phosphorylation |
| R10273 | T12696 | T12698 | nsubjpass | phosphorylation,unimpaired |
| R10274 | T12697 | T12698 | auxpass | was,unimpaired |
| R10275 | T12698 | T12698 | ROOT | unimpaired,unimpaired |
| R10276 | T12699 | T12698 | prep | in,unimpaired |
| R10277 | T12700 | T12699 | pobj | cells,in |
| R10278 | T12701 | T12700 | acl | infected,cells |
| R10279 | T12702 | T12701 | prep | with,infected |
| R10280 | T12703 | T12704 | det | either,ΔnleH1 |
| R10281 | T12704 | T12702 | pobj | ΔnleH1,with |
| R10282 | T12705 | T12704 | cc | or,ΔnleH1 |
| R10283 | T12706 | T12704 | conj | ΔescN,ΔnleH1 |
| R10284 | T12707 | T12706 | punct | (,ΔescN |
| R10285 | T12708 | T12706 | appos | Fig.,ΔescN |
| R10286 | T12709 | T12708 | nummod | 6d,Fig. |
| R10287 | T12710 | T12706 | punct | ),ΔescN |
| R10288 | T12711 | T12698 | punct | .,unimpaired |
| R10289 | T12712 | T12713 | nsubj | We,showed |
| R10290 | T12713 | T12713 | ROOT | showed,showed |
| R10291 | T12714 | T12713 | advmod | previously,showed |
| R10292 | T12715 | T12716 | mark | that,wild-type |
| R10293 | T12716 | T12713 | ccomp | wild-type,showed |
| R10294 | T12717 | T12716 | punct | ",",wild-type |
| R10295 | T12718 | T12716 | cc | but,wild-type |
| R10296 | T12719 | T12720 | neg | not,ΔnleH1 |
| R10297 | T12720 | T12716 | conj | ΔnleH1,wild-type |
| R10298 | T12721 | T12720 | cc | or,ΔnleH1 |
| R10299 | T12722 | T12725 | compound | ΔescN,O157 |
| R10300 | T12723 | T12725 | compound | E.,O157 |
| R10376 | T12799 | T12800 | det | these,genes |
| R10377 | T12800 | T12801 | nsubj | genes,were |
| R10378 | T12801 | T12801 | ROOT | were,were |
| R10379 | T12802 | T12803 | advmod | only,modestly |
| R10380 | T12803 | T12804 | advmod | modestly,upregulated |
| R10381 | T12804 | T12801 | acomp | upregulated,were |
| R10382 | T12805 | T12804 | prep | in,upregulated |
| R10383 | T12806 | T12805 | pobj | cells,in |
| R10384 | T12807 | T12806 | acl | infected,cells |
| R10385 | T12808 | T12807 | prep | with,infected |
| R10386 | T12809 | T12811 | compound | wild-type,coli |
| R10387 | T12810 | T12811 | compound | E.,coli |
| R10388 | T12811 | T12808 | pobj | coli,with |
| R10389 | T12812 | T12812 | ROOT | O157,O157 |
| R10390 | T12813 | T12812 | punct | :,O157 |
| R10391 | T12814 | T12818 | nsubj | H7,induced |
| R10392 | T12815 | T12814 | punct | ",",H7 |
| R10393 | T12816 | T12814 | cc | but,H7 |
| R10394 | T12817 | T12818 | advmod | significantly,induced |
| R10395 | T12818 | T12818 | ROOT | induced,induced |
| R10396 | T12819 | T12818 | prep | in,induced |
| R10153 | T12576 | T12572 | pobj | activation,with |
| R10154 | T12577 | T12576 | cc | or,activation |
| R10155 | T12578 | T12576 | conj | IκBα,activation |
| R10156 | T12579 | T12576 | conj | degradation,activation |
| R10157 | T12580 | T12576 | punct | ",",activation |
| R10158 | T12581 | T12576 | amod | consistent,activation |
| R10159 | T12582 | T12581 | prep | with,consistent |
| R10160 | T12583 | T12584 | det | the,lack |
| R10161 | T12584 | T12582 | pobj | lack,with |
| R10162 | T12585 | T12584 | prep | of,lack |
| R10163 | T12586 | T12587 | amod | NleH1,impact |
| R10164 | T12587 | T12585 | pobj | impact,of |
| R10165 | T12588 | T12587 | prep | on,impact |
| R10166 | T12589 | T12591 | nummod | p65,translocation9 |
| R10167 | T12590 | T12591 | amod | nuclear,translocation9 |
| R10168 | T12591 | T12588 | pobj | translocation9,on |
| R10169 | T12592 | T12584 | punct | (,lack |
| R10170 | T12593 | T12584 | appos | Fig.,lack |
| R10171 | T12594 | T12593 | nummod | 6c,Fig. |
| R10172 | T12595 | T12584 | punct | ),lack |
| R10173 | T12596 | T12571 | punct | .,interfere |
| R10174 | T12597 | T12598 | aux | To,determine |
| R10175 | T12598 | T12606 | advcl | determine,infected |
| R10176 | T12599 | T12601 | mark | if,inhibits |
| R10177 | T12600 | T12601 | nsubj | NleH1,inhibits |
| R10178 | T12601 | T12606 | advcl | inhibits,infected |
| R10179 | T12602 | T12603 | compound | RPS3,phosphorylation |
| R10180 | T12603 | T12601 | dobj | phosphorylation,inhibits |
| R10181 | T12604 | T12606 | punct | ",",infected |
| R10182 | T12605 | T12606 | nsubj | we,infected |
| R10183 | T12606 | T12606 | ROOT | infected,infected |
| R10184 | T12607 | T12608 | compound | HeLa,cells |
| R10185 | T12608 | T12606 | dobj | cells,infected |
| R10186 | T12609 | T12606 | prep | with,infected |
| R10187 | T12610 | T12612 | compound | E.,O157 |
| R10188 | T12611 | T12612 | compound | coli,O157 |
| R10189 | T12612 | T12609 | pobj | O157,with |
| R10190 | T12613 | T12612 | punct | :,O157 |
| R10191 | T12614 | T12615 | compound | H7,strains |
| R10192 | T12615 | T12612 | appos | strains,O157 |
| R10193 | T12616 | T12615 | acl | possessing,strains |
| R10194 | T12617 | T12616 | cc | or,possessing |
| R10195 | T12618 | T12616 | conj | lacking,possessing |
| R10196 | T12619 | T12620 | preconj | either,nleH1 |
| R10197 | T12620 | T12618 | dobj | nleH1,lacking |
| R10198 | T12621 | T12622 | punct | (,ΔnleH1 |
| R10199 | T12622 | T12620 | appos | ΔnleH1,nleH1 |
| R10200 | T12623 | T12622 | punct | ),ΔnleH1 |
| R10201 | T12624 | T12620 | cc | or,nleH1 |
| R10202 | T12625 | T12620 | conj | with,nleH1 |
| R10203 | T12626 | T12627 | det | a,strain |
| R10204 | T12627 | T12625 | pobj | strain,with |
| R10205 | T12628 | T12627 | acl | lacking,strain |
| R10206 | T12629 | T12630 | det | a,functional |
| R10207 | T12630 | T12628 | dobj | functional,lacking |
| R10208 | T12631 | T12632 | nummod | T3SS,unable |
| R10209 | T12632 | T12630 | amod | unable,functional |
| R10210 | T12633 | T12634 | aux | to,inject |
| R10211 | T12634 | T12632 | xcomp | inject,unable |
| R10212 | T12635 | T12634 | dobj | NleH1,inject |
| R10213 | T12636 | T12634 | prep | into,inject |
| R10214 | T12637 | T12638 | amod | mammalian,cells |
| R10215 | T12638 | T12636 | pobj | cells,into |
| R10216 | T12639 | T12640 | punct | (,ΔescN |
| R10217 | T12640 | T12638 | appos | ΔescN,cells |
| R10218 | T12641 | T12630 | punct | ),functional |
| R10219 | T12642 | T12606 | punct | .,infected |
| R10220 | T12643 | T12648 | prep | In,stimulated |
| R10221 | T12644 | T12645 | amod | uninfected,cells |
| R10222 | T12645 | T12643 | pobj | cells,In |
| R10223 | T12646 | T12648 | punct | ",",stimulated |
| R10224 | T12647 | T12648 | nsubj | TNF-treatment,stimulated |
| R10225 | T12648 | T12648 | ROOT | stimulated,stimulated |
| R10301 | T12724 | T12725 | compound | coli,O157 |
| R10302 | T12725 | T12720 | conj | O157,ΔnleH1 |
| R10303 | T12726 | T12725 | punct | :,O157 |
| R10304 | T12727 | T12729 | nsubj | H7,attenuated |
| R10305 | T12728 | T12729 | advmod | significantly,attenuated |
| R10306 | T12729 | T12729 | ROOT | attenuated,attenuated |
| R10307 | T12730 | T12733 | amod | TNF-induced,translocation9 |
| R10308 | T12731 | T12733 | amod | RPS3,translocation9 |
| R10309 | T12732 | T12733 | amod | nuclear,translocation9 |
| R10310 | T12733 | T12729 | dobj | translocation9,attenuated |
| R10311 | T12734 | T12729 | punct | .,attenuated |
| R10312 | T12735 | T12736 | det | The,parallel |
| R10313 | T12736 | T12748 | nsubj | parallel,provides |
| R10314 | T12737 | T12736 | prep | between,parallel |
| R10315 | T12738 | T12739 | nummod | RPS3,phosphorylation |
| R10316 | T12739 | T12737 | pobj | phosphorylation,between |
| R10317 | T12740 | T12739 | cc | and,phosphorylation |
| R10318 | T12741 | T12743 | poss | its,translocation |
| R10319 | T12742 | T12743 | amod | nuclear,translocation |
| R10320 | T12743 | T12739 | conj | translocation,phosphorylation |
| R10321 | T12744 | T12743 | prep | during,translocation |
| R10322 | T12745 | T12746 | compound | E.,coli |
| R10323 | T12746 | T12747 | compound | coli,infection |
| R10324 | T12747 | T12744 | pobj | infection,during |
| R10325 | T12748 | T12748 | ROOT | provides,provides |
| R10326 | T12749 | T12748 | dobj | evidence,provides |
| R10327 | T12750 | T12748 | prep | in,provides |
| R10328 | T12751 | T12752 | det | the,context |
| R10329 | T12752 | T12750 | pobj | context,in |
| R10330 | T12753 | T12752 | prep | of,context |
| R10331 | T12754 | T12757 | det | an,process |
| R10332 | T12755 | T12757 | amod | NF-κB-dependent,process |
| R10333 | T12756 | T12757 | compound | disease,process |
| R10334 | T12757 | T12753 | pobj | process,of |
| R10335 | T12758 | T12762 | mark | that,is |
| R10336 | T12759 | T12761 | compound | RPS3,phosphorylation |
| R10337 | T12760 | T12761 | compound | S209,phosphorylation |
| R10338 | T12761 | T12762 | nsubj | phosphorylation,is |
| R10339 | T12762 | T12748 | advcl | is,provides |
| R10340 | T12763 | T12762 | acomp | important,is |
| R10341 | T12764 | T12763 | prep | for,important |
| R10342 | T12765 | T12766 | amod | nuclear,translocation |
| R10343 | T12766 | T12764 | pobj | translocation,for |
| R10344 | T12767 | T12748 | punct | .,provides |
| R10345 | T12768 | T12769 | poss | Our,discovery |
| R10346 | T12769 | T12776 | nsubj | discovery,suggested |
| R10347 | T12770 | T12772 | mark | that,inhibits |
| R10348 | T12771 | T12772 | nsubj | NleH1,inhibits |
| R10349 | T12772 | T12769 | acl | inhibits,discovery |
| R10350 | T12773 | T12775 | compound | RPS3,phosphorylation |
| R10351 | T12774 | T12775 | compound | S209,phosphorylation |
| R10352 | T12775 | T12776 | nsubj | phosphorylation,suggested |
| R10353 | T12776 | T12776 | ROOT | suggested,suggested |
| R10354 | T12777 | T12781 | mark | that,blocks |
| R10355 | T12778 | T12781 | nsubj | it,blocks |
| R10356 | T12779 | T12781 | aux | should,blocks |
| R10357 | T12780 | T12781 | advmod | also,blocks |
| R10358 | T12781 | T12776 | ccomp | blocks,suggested |
| R10359 | T12782 | T12786 | nmod | RPS3-dependent,transcription |
| R10360 | T12783 | T12786 | compound | NF-κB,transcription |
| R10361 | T12784 | T12786 | compound | target,transcription |
| R10362 | T12785 | T12786 | compound | gene,transcription |
| R10363 | T12786 | T12781 | dobj | transcription,blocks |
| R10364 | T12787 | T12789 | punct | (,IL8 |
| R10365 | T12788 | T12789 | nmod | e.g.,IL8 |
| R10366 | T12789 | T12791 | nmod | IL8,NFKBIA |
| R10367 | T12790 | T12791 | punct | ",",NFKBIA |
| R10368 | T12791 | T12781 | conj | NFKBIA,blocks |
| R10369 | T12792 | T12791 | punct | ",",NFKBIA |
| R10370 | T12793 | T12791 | cc | and,NFKBIA |
| R10371 | T12794 | T12791 | conj | TNFAIP3,NFKBIA |
| R10372 | T12795 | T12791 | punct | ),NFKBIA |
| R10373 | T12796 | T12776 | punct | .,suggested |
| R10374 | T12797 | T12801 | advmod | Indeed,were |
| R10375 | T12798 | T12801 | punct | ",",were |
| R10452 | T12875 | T12872 | dobj | phosphorylation,blocking |
| R10453 | T12876 | T12872 | cc | and,blocking |
| R10454 | T12877 | T12878 | advmod | thereby,impairing |
| R10455 | T12878 | T12872 | conj | impairing,blocking |
| R10456 | T12879 | T12883 | amod | critical,genes |
| R10457 | T12880 | T12883 | amod | RPS3-dependent,genes |
| R10458 | T12881 | T12883 | compound | NF-κB,genes |
| R10459 | T12882 | T12883 | compound | target,genes |
| R10460 | T12883 | T12878 | dobj | genes,impairing |
| R10461 | T12884 | T12861 | punct | .,demonstrate |
| R10397 | T12820 | T12819 | pobj | cells,in |
| R10398 | T12821 | T12820 | acl | infected,cells |
| R10399 | T12822 | T12821 | prep | with,infected |
| R10400 | T12823 | T12824 | det | either,ΔnleH1 |
| R10401 | T12824 | T12827 | nmod | ΔnleH1,strains |
| R10402 | T12825 | T12824 | cc | or,ΔnleH1 |
| R10403 | T12826 | T12824 | conj | ΔescN,ΔnleH1 |
| R10404 | T12827 | T12822 | pobj | strains,with |
| R10405 | T12828 | T12818 | punct | (,induced |
| R10406 | T12829 | T12818 | dobj | Fig.,induced |
| R10407 | T12830 | T12829 | nummod | 6e,Fig. |
| R10408 | T12831 | T12829 | punct | ),Fig. |
| R10409 | T12832 | T12818 | punct | .,induced |
| R10410 | T12833 | T12838 | prep | In,had |
| R10411 | T12834 | T12833 | pobj | contrast,In |
| R10412 | T12835 | T12838 | punct | ",",had |
| R10413 | T12836 | T12838 | advcl | deleting,had |
| R10414 | T12837 | T12838 | nsubj | nleH1,had |
| R10415 | T12838 | T12838 | ROOT | had,had |
| R10416 | T12839 | T12840 | det | no,impact |
| R10417 | T12840 | T12838 | dobj | impact,had |
| R10418 | T12841 | T12840 | prep | on,impact |
| R10419 | T12842 | T12843 | det | the,expression |
| R10420 | T12843 | T12841 | pobj | expression,on |
| R10421 | T12844 | T12843 | prep | of,expression |
| R10423 | T12846 | T12844 | pobj | genes,of |
| R10424 | T12847 | T12846 | punct | ",",genes |
| R10425 | T12848 | T12846 | prep | including,genes |
| R10426 | T12849 | T12848 | pobj | CD25,including |
| R10427 | T12850 | T12849 | cc | and,CD25 |
| R10428 | T12851 | T12849 | conj | TNFSF13B,CD25 |
| R10429 | T12852 | T12851 | punct | (,TNFSF13B |
| R10430 | T12853 | T12854 | compound | Supplementary,Fig. |
| R10431 | T12854 | T12849 | conj | Fig.,CD25 |
| R10432 | T12855 | T12854 | nummod | 12,Fig. |
| R10433 | T12856 | T12838 | punct | ),had |
| R10434 | T12857 | T12838 | punct | .,had |
| R10435 | T12858 | T12861 | advmod | Together,demonstrate |
| R10436 | T12859 | T12860 | det | these,results |
| R10437 | T12860 | T12861 | nsubj | results,demonstrate |
| R10438 | T12861 | T12861 | ROOT | demonstrate,demonstrate |
| R10439 | T12862 | T12865 | mark | that,inhibits |
| R10440 | T12863 | T12865 | nsubj | NleH1,inhibits |
| R10441 | T12864 | T12865 | advmod | specifically,inhibits |
| R10442 | T12865 | T12861 | ccomp | inhibits,demonstrate |
| R10443 | T12866 | T12869 | det | the,response |
| R10444 | T12867 | T12869 | amod | protective,response |
| R10445 | T12868 | T12869 | amod | immune,response |
| R10446 | T12869 | T12865 | dobj | response,inhibits |
| R10447 | T12870 | T12865 | prep | by,inhibits |
| R10448 | T12871 | T12872 | advmod | directly,blocking |
| R10449 | T12872 | T12870 | pcomp | blocking,by |
| R10450 | T12873 | T12875 | compound | RPS3,phosphorylation |
| R10451 | T12874 | T12875 | compound | S209,phosphorylation |
| R11306 | T14046 | T14047 | compound | piglet,colons |
| R11307 | T14047 | T14045 | dobj | colons,isolated |
| R11308 | T14048 | T14045 | prep | at,isolated |
| R11309 | T14049 | T14048 | pobj | necropsy,at |
| R11310 | T14050 | T14045 | punct | ",",isolated |
| R11311 | T14051 | T14045 | cc | and,isolated |
| R11312 | T14052 | T14045 | conj | subjected,isolated |
| R11313 | T14053 | T14052 | dobj | them,subjected |
| R11314 | T14054 | T14055 | aux | to,immunohistochemistry |
| R11315 | T14055 | T14052 | advcl | immunohistochemistry,subjected |
| R11316 | T14056 | T14052 | advcl | using,subjected |
| R11317 | T14057 | T14059 | poss | our,antibody |
| R11318 | T14058 | T14059 | amod | phospho-RPS3,antibody |
| R11319 | T14059 | T14056 | dobj | antibody,using |
| R11320 | T14060 | T14045 | punct | .,isolated |
| R11321 | T14061 | T14076 | advmod | Consistent,exhibited |
| R11322 | T14062 | T14061 | prep | with,Consistent |
| R11323 | T14063 | T14076 | prep | in,exhibited |
| R11324 | T14064 | T14065 | amod | vitro,data |
| R11325 | T14065 | T14063 | pobj | data,in |
| R11326 | T14066 | T14076 | punct | ",",exhibited |
| R11327 | T14067 | T14076 | nsubj | piglets,exhibited |
| R11328 | T14068 | T14067 | acl | infected,piglets |
| R11329 | T14069 | T14068 | prep | with,infected |
| R11330 | T14070 | T14073 | amod | wild-type,O157 |
| R11331 | T14071 | T14073 | compound | E.,O157 |
| R11332 | T14072 | T14073 | compound | coli,O157 |
| R11333 | T14073 | T14069 | pobj | O157,with |
| R11334 | T14074 | T14076 | punct | :,exhibited |
| R11335 | T14075 | T14076 | nsubj | H7,exhibited |
| R11336 | T14076 | T14076 | ROOT | exhibited,exhibited |
| R11337 | T14077 | T14076 | dobj | diffuse,exhibited |
| R11338 | T14078 | T14077 | cc | and,diffuse |
| R11339 | T14079 | T14080 | amod | low,intensity |
| R11340 | T14080 | T14082 | nmod | intensity,staining |
| R11341 | T14081 | T14082 | compound | phospho-RPS3,staining |
| R11342 | T14082 | T14077 | conj | staining,diffuse |
| R11343 | T14083 | T14076 | punct | ",",exhibited |
| R11344 | T14084 | T14094 | mark | whereas,was |
| R11345 | T14085 | T14094 | prep | in,was |
| R11346 | T14086 | T14085 | pobj | piglets,in |
| R11347 | T14087 | T14086 | acl | infected,piglets |
| R11348 | T14088 | T14087 | prep | with,infected |
| R11349 | T14089 | T14093 | amod | ΔnleH1,expression |
| R11350 | T14090 | T14093 | amod | mutant,expression |
| R11351 | T14091 | T14093 | punct | ",",expression |
| R11352 | T14092 | T14093 | amod | phospho-RPS3,expression |
| R11353 | T14093 | T14088 | pobj | expression,with |
| R11354 | T14094 | T14076 | advcl | was,exhibited |
| R11355 | T14095 | T14094 | acomp | florid,was |
| R11209 | T13949 | T13950 | nsubj | NleH1,inhibits |
| R11210 | T13950 | T13950 | ROOT | inhibits,inhibits |
| R11211 | T13951 | T13953 | compound | RPS3,phosphorylation |
| R11212 | T13952 | T13953 | compound | S209,phosphorylation |
| R11213 | T13953 | T13950 | dobj | phosphorylation,inhibits |
| R11214 | T13954 | T13950 | prep | in,inhibits |
| R11215 | T13955 | T13954 | pobj | vivo,in |
| R11216 | T13956 | T13958 | nsubj | We,utilized |
| R11217 | T13957 | T13958 | advmod | previously,utilized |
| R11218 | T13958 | T13950 | ccomp | utilized,inhibits |
| R11219 | T13959 | T13963 | det | a,model |
| R11220 | T13960 | T13963 | amod | gnotobiotic,model |
| R11221 | T13961 | T13963 | amod | piglet,model |
| R11222 | T13962 | T13963 | compound | infection,model |
| R11223 | T13963 | T13958 | dobj | model,utilized |
| R11224 | T13964 | T13965 | aux | to,determine |
| R11225 | T13965 | T13963 | relcl | determine,model |
| R11226 | T13966 | T13972 | mark | that,died |
| R11227 | T13967 | T13972 | nsubj | piglets,died |
| R11228 | T13968 | T13967 | acl | infected,piglets |
| R11229 | T13969 | T13968 | prep | with,infected |
| R11230 | T13970 | T13971 | amod | ΔnleH1,mutant |
| R11231 | T13971 | T13972 | nsubj | mutant,died |
| R11232 | T13972 | T13965 | ccomp | died,determine |
| R11233 | T13973 | T13974 | advmod | more,rapidly |
| R11234 | T13974 | T13972 | advmod | rapidly,died |
| R11235 | T13975 | T13974 | prep | than,rapidly |
| R11236 | T13976 | T13975 | pobj | those,than |
| R11237 | T13977 | T13976 | acl | infected,those |
| R11238 | T13978 | T13977 | prep | with,infected |
| R11239 | T13979 | T13982 | amod | wild-type,O157 |
| R11240 | T13980 | T13982 | compound | E.,O157 |
| R11241 | T13981 | T13982 | compound | coli,O157 |
| R11242 | T13982 | T13978 | pobj | O157,with |
| R11243 | T13983 | T13972 | punct | :,died |
| R11244 | T13984 | T13972 | intj | H7,died |
| R11245 | T13985 | T13950 | punct | .,inhibits |
| R11246 | T13986 | T13990 | nsubj | Piglets,displayed |
| R11247 | T13987 | T13986 | acl | infected,Piglets |
| R11248 | T13988 | T13987 | prep | with,infected |
| R11249 | T13989 | T13988 | pobj | ΔnleH1,with |
| R11250 | T13990 | T13990 | ROOT | displayed,displayed |
| R11251 | T13991 | T13992 | amod | clinical,disease |
| R11252 | T13992 | T13990 | dobj | disease,displayed |
| R11253 | T13993 | T13992 | amod | consistent,disease |
| R11254 | T13994 | T13993 | prep | with,consistent |
| R11255 | T13995 | T13998 | det | a,response |
| R11256 | T13996 | T13998 | amod | robust,response |
| R11257 | T13997 | T13998 | amod | inflammatory,response |
| R11258 | T13998 | T13994 | pobj | response,with |
| R11259 | T13999 | T13990 | punct | ",",displayed |
| R11260 | T14000 | T13990 | cc | but,displayed |
| R11261 | T14001 | T13990 | conj | with,displayed |
| R11262 | T14002 | T14004 | amod | reduced,colonization |
| R11263 | T14003 | T14004 | amod | bacterial,colonization |
| R11264 | T14004 | T14001 | pobj | colonization,with |
| R11265 | T14005 | T14004 | cc | and,colonization |
| R11266 | T14006 | T14007 | amod | little,diarrhea9 |
| R11267 | T14007 | T14004 | conj | diarrhea9,colonization |
| R11268 | T14008 | T13990 | punct | .,displayed |
| R11269 | T14009 | T14025 | mark | While,hypothesized |
| R11270 | T14010 | T14011 | advmod | seemingly,paradoxical |
| R11271 | T14011 | T14025 | advcl | paradoxical,hypothesized |
| R11272 | T14012 | T14013 | punct | ",",based |
| R11273 | T14013 | T14011 | prep | based,paradoxical |
| R11274 | T14014 | T14013 | prep | on,based |
| R11275 | T14015 | T14018 | poss | our,data |
| R11276 | T14016 | T14017 | compound | cell,culture |
| R11277 | T14017 | T14018 | compound | culture,data |
| R11278 | T14018 | T14014 | pobj | data,on |
| R11279 | T14019 | T14020 | punct | (,Fig. |
| R11280 | T14020 | T14011 | appos | Fig.,paradoxical |
| R11281 | T14021 | T14020 | nummod | 6d,Fig. |
| R11282 | T14022 | T14020 | punct | ),Fig. |
| R11283 | T14023 | T14025 | punct | ",",hypothesized |
| R11284 | T14024 | T14025 | nsubj | we,hypothesized |
| R11285 | T14025 | T14025 | ROOT | hypothesized,hypothesized |
| R11286 | T14026 | T14028 | mark | that,blocked |
| R11287 | T14027 | T14028 | nsubj | NleH1,blocked |
| R11288 | T14028 | T14025 | ccomp | blocked,hypothesized |
| R11289 | T14029 | T14031 | nummod | RPS3,phosphorylation |
| R11290 | T14030 | T14031 | nummod | S209,phosphorylation |
| R11291 | T14031 | T14028 | dobj | phosphorylation,blocked |
| R11292 | T14032 | T14031 | prep | in,phosphorylation |
| R11293 | T14033 | T14032 | pobj | vivo,in |
| R11294 | T14034 | T14028 | punct | ",",blocked |
| R11295 | T14035 | T14036 | advmod | thereby,preventing |
| R11296 | T14036 | T14028 | advcl | preventing,blocked |
| R11297 | T14037 | T14039 | amod | RPS3,translocation |
| R11298 | T14038 | T14039 | amod | nuclear,translocation |
| R11299 | T14039 | T14036 | dobj | translocation,preventing |
| R11300 | T14040 | T14036 | prep | in,preventing |
| R11301 | T14041 | T14042 | amod | infected,piglets |
| R11302 | T14042 | T14040 | pobj | piglets,in |
| R11303 | T14043 | T14025 | punct | .,hypothesized |
| R11304 | T14044 | T14045 | nsubj | We,isolated |
| R11305 | T14045 | T14045 | ROOT | isolated,isolated |
| R11381 | T14121 | T14108 | relcl | benefit,inhibits |
| R11382 | T14122 | T14123 | det | the,bacterium |
| R11383 | T14123 | T14121 | dobj | bacterium,benefit |
| R11384 | T14124 | T14121 | prep | in,benefit |
| R11385 | T14125 | T14124 | pobj | colonization,in |
| R11386 | T14126 | T14125 | cc | and,colonization |
| R11387 | T14127 | T14125 | conj | transmission,colonization |
| R11388 | T14128 | T14105 | punct | .,demonstrate |
| R12630 | T15728 | T15729 | nsubj | NleH1,steers |
| R12631 | T15729 | T15729 | ROOT | steers,steers |
| R12632 | T15730 | T15733 | det | the,specificities |
| R12633 | T15731 | T15732 | compound | IKKβ,substrate |
| R12634 | T15732 | T15733 | compound | substrate,specificities |
| R12635 | T15733 | T15729 | dobj | specificities,steers |
| R12636 | T15734 | T15735 | nsubj | NleH1,is |
| R12637 | T15735 | T15729 | conj | is,steers |
| R12638 | T15736 | T15739 | det | an,kinase |
| R12639 | T15737 | T15739 | amod | autophosphorylated,kinase |
| R12640 | T15738 | T15739 | amod | serine-threonine,kinase |
| R12641 | T15739 | T15735 | attr | kinase,is |
| R12642 | T15740 | T15739 | punct | ",",kinase |
| R12643 | T15741 | T15742 | nsubj | which,depends |
| R12644 | T15742 | T15739 | relcl | depends,kinase |
| R12645 | T15743 | T15742 | prep | on,depends |
| R12646 | T15744 | T15750 | det | the,9 |
| R12647 | T15745 | T15750 | nmod | lysine,9 |
| R12648 | T15746 | T15745 | nummod | 159,lysine |
| R12649 | T15747 | T15745 | punct | (,lysine |
| R12650 | T15748 | T15745 | appos | K159,lysine |
| R12651 | T15749 | T15750 | punct | ),9 |
| R12652 | T15750 | T15743 | pobj | 9,on |
| R12653 | T15751 | T15735 | punct | .,is |
| R12654 | T15752 | T15753 | aux | To,explore |
| R12655 | T15753 | T15766 | advcl | explore,performed |
| R12656 | T15754 | T15755 | det | the,mechanism |
| R12657 | T15755 | T15753 | dobj | mechanism,explore |
| R12658 | T15756 | T15759 | prep | by,inhibits |
| R12659 | T15757 | T15756 | pobj | which,by |
| R12660 | T15758 | T15759 | nsubj | NleH1,inhibits |
| R12661 | T15759 | T15755 | relcl | inhibits,mechanism |
| R12662 | T15760 | T15762 | compound | RPS3,phosphorylation |
| R12663 | T15761 | T15762 | compound | S209,phosphorylation |
| R12664 | T15762 | T15759 | dobj | phosphorylation,inhibits |
| R12665 | T15763 | T15766 | punct | ",",performed |
| R12666 | T15764 | T15766 | nsubj | we,performed |
| R12667 | T15765 | T15766 | advmod | first,performed |
| R12668 | T15766 | T15766 | ROOT | performed,performed |
| R12669 | T15767 | T15771 | det | an,assay |
| R12670 | T15768 | T15771 | nmod | in,assay |
| R12671 | T15769 | T15771 | amod | vitro,assay |
| R12672 | T15770 | T15771 | compound | kinase,assay |
| R12673 | T15771 | T15766 | dobj | assay,performed |
| R12674 | T15772 | T15766 | prep | with,performed |
| R12675 | T15773 | T15776 | amod | purified,protein |
| R12676 | T15774 | T15776 | amod | wild-type,protein |
| R12677 | T15775 | T15776 | compound | His-NleH1,protein |
| R12678 | T15776 | T15772 | pobj | protein,with |
| R12679 | T15777 | T15776 | cc | and,protein |
| R12680 | T15778 | T15780 | det | a,His-NleH1 |
| R12681 | T15779 | T15780 | amod | mutant,His-NleH1 |
| R12682 | T15780 | T15776 | conj | His-NleH1,protein |
| R11356 | T14096 | T14095 | cc | and,florid |
| R11357 | T14097 | T14095 | conj | intense,florid |
| R11358 | T14098 | T14099 | punct | (,Fig. |
| R11359 | T14099 | T14094 | appos | Fig.,was |
| R11360 | T14100 | T14099 | nummod | 6f,Fig. |
| R11361 | T14101 | T14099 | punct | ),Fig. |
| R11362 | T14102 | T14076 | punct | .,exhibited |
| R11363 | T14103 | T14104 | det | These,data |
| R11364 | T14104 | T14105 | nsubj | data,demonstrate |
| R11365 | T14105 | T14105 | ROOT | demonstrate,demonstrate |
| R11366 | T14106 | T14108 | mark | that,inhibits |
| R11367 | T14107 | T14108 | nsubj | NleH1,inhibits |
| R11368 | T14108 | T14105 | ccomp | inhibits,demonstrate |
| R11369 | T14109 | T14111 | compound | RPS3,phosphorylation |
| R11370 | T14110 | T14111 | compound | S209,phosphorylation |
| R11371 | T14111 | T14108 | dobj | phosphorylation,inhibits |
| R11372 | T14112 | T14113 | preconj | both,in |
| R11373 | T14113 | T14108 | prep | in,inhibits |
| R11374 | T14114 | T14113 | pobj | vitro,in |
| R11375 | T14115 | T14113 | cc | and,in |
| R11376 | T14116 | T14113 | conj | in,in |
| R11377 | T14117 | T14116 | pobj | vivo,in |
| R11378 | T14118 | T14117 | punct | ",",vivo |
| R11379 | T14119 | T14121 | nsubj | which,benefit |
| R11380 | T14120 | T14121 | aux | might,benefit |
| R12756 | T15854 | T15856 | nmod | Fig.,) |
| R12757 | T15855 | T15854 | nummod | 7b,Fig. |
| R12758 | T15856 | T15849 | punct | ),failed |
| R12759 | T15857 | T15839 | punct | .,reduced |
| R12764 | T15862 | T15863 | auxpass | is,required |
| R12765 | T15863 | T15863 | ROOT | required,required |
| R12766 | T15864 | T15865 | aux | to,protect |
| R12767 | T15865 | T15863 | xcomp | protect,required |
| R12768 | T15866 | T15865 | dobj | RPS3,protect |
| R12769 | T15867 | T15865 | prep | from,protect |
| R12770 | T15868 | T15869 | amod | IKKβ-mediated,phosphorylation |
| R12771 | T15869 | T15867 | pobj | phosphorylation,from |
| R12772 | T15870 | T15863 | punct | .,required |
| R12773 | T15871 | T15872 | compound | Citrobacter,rodentium |
| R12774 | T15872 | T15873 | nsubj | rodentium,is |
| R12775 | T15873 | T15895 | ccomp | is,inhibited |
| R12776 | T15874 | T15876 | det | a,pathogen |
| R12777 | T15875 | T15876 | compound | mouse,pathogen |
| R12778 | T15876 | T15873 | attr | pathogen,is |
| R12779 | T15877 | T15878 | nsubj | that,shares |
| R12780 | T15878 | T15876 | relcl | shares,pathogen |
| R12781 | T15879 | T15880 | amod | pathogenic,strategies |
| R12782 | T15880 | T15878 | dobj | strategies,shares |
| R12783 | T15881 | T15880 | prep | with,strategies |
| R12784 | T15882 | T15883 | compound | E.,coli |
| R12785 | T15883 | T15881 | pobj | coli,with |
| R12786 | T15884 | T15883 | appos | 39,coli |
| R12787 | T15885 | T15883 | punct | ",",coli |
| R12788 | T15886 | T15887 | advmod | most,notably |
| R12789 | T15887 | T15888 | advmod | notably,for |
| R12790 | T15888 | T15878 | prep | for,shares |
| R12791 | T15889 | T15890 | poss | our,investigation |
| R12792 | T15890 | T15888 | pobj | investigation,for |
| R12793 | T15891 | T15895 | punct | ",",inhibited |
| R12794 | T15892 | T15894 | compound | C.,NleH |
| R12795 | T15893 | T15894 | compound | rodentium,NleH |
| R12796 | T15894 | T15895 | nsubj | NleH,inhibited |
| R12797 | T15895 | T15895 | ROOT | inhibited,inhibited |
| R12798 | T15896 | T15898 | nummod | RPS3,translocation |
| R12799 | T15897 | T15898 | amod | nuclear,translocation |
| R12800 | T15898 | T15895 | dobj | translocation,inhibited |
| R12801 | T15899 | T15898 | cc | and,translocation |
| R12802 | T15900 | T15903 | amod | RPS3-dependent,activity |
| R12803 | T15901 | T15903 | compound | NF-κB,activity |
| R12804 | T15902 | T15903 | compound | luciferase,activity |
| R12805 | T15903 | T15898 | conj | activity,translocation |
| R12806 | T15904 | T15895 | prep | to,inhibited |
| R12807 | T15905 | T15906 | det | an,extent |
| R12808 | T15906 | T15904 | pobj | extent,to |
| R12809 | T15907 | T15906 | amod | equivalent,extent |
| R12810 | T15908 | T15907 | prep | to,equivalent |
| R12811 | T15909 | T15911 | compound | E.,NleH1 |
| R12812 | T15910 | T15911 | compound | coli,NleH1 |
| R12813 | T15911 | T15908 | pobj | NleH1,to |
| R12814 | T15912 | T15911 | punct | (,NleH1 |
| R12815 | T15913 | T15911 | appos | ref,NleH1 |
| R12816 | T15914 | T15915 | punct | .,9 |
| R12817 | T15915 | T15915 | ROOT | 9,9 |
| R12818 | T15916 | T15915 | punct | ),9 |
| R12819 | T15917 | T15895 | punct | .,inhibited |
| R12820 | T15918 | T15919 | nsubj | We,assayed |
| R12821 | T15919 | T15919 | ROOT | assayed,assayed |
| R12822 | T15920 | T15922 | compound | RPS3,phosphorylation |
| R12823 | T15921 | T15922 | compound | S209,phosphorylation |
| R12824 | T15922 | T15919 | dobj | phosphorylation,assayed |
| R12825 | T15923 | T15919 | prep | in,assayed |
| R12826 | T15924 | T15925 | compound | HeLa,cells |
| R12827 | T15925 | T15923 | pobj | cells,in |
| R12828 | T15926 | T15925 | acl | infected,cells |
| R12829 | T15927 | T15926 | prep | with,infected |
| R12830 | T15928 | T15931 | amod | different,strains |
| R12831 | T15929 | T15931 | nmod | C.,strains |
| R12832 | T15930 | T15931 | compound | rodentium,strains |
| R12833 | T15931 | T15927 | pobj | strains,with |
| R12834 | T15932 | T15919 | punct | .,assayed |
| R12985 | T16083 | T16079 | xcomp | impair,is |
| R12986 | T16084 | T16087 | det | the,translocation |
| R12987 | T16085 | T16087 | amod | strong,translocation |
| R12988 | T16086 | T16087 | amod | nuclear,translocation |
| R12683 | T15781 | T15780 | punct | (,His-NleH1 |
| R12684 | T15782 | T15780 | appos | K159A,His-NleH1 |
| R12685 | T15783 | T15782 | punct | ),K159A |
| R12686 | T15784 | T15780 | conj | protein,His-NleH1 |
| R12687 | T15785 | T15766 | punct | ",",performed |
| R12688 | T15786 | T15766 | advcl | confirming,performed |
| R12689 | T15787 | T15789 | mark | that,is |
| R12690 | T15788 | T15789 | nsubj | NleH1,is |
| R12691 | T15789 | T15786 | ccomp | is,confirming |
| R12692 | T15790 | T15789 | acomp | autophosphorylated,is |
| R12693 | T15791 | T15790 | cc | and,autophosphorylated |
| R12694 | T15792 | T15793 | det | the,K159A |
| R12695 | T15793 | T15794 | nsubj | K159A,is |
| R12696 | T15794 | T15790 | conj | is,autophosphorylated |
| R12697 | T15795 | T15798 | det | an,mutant |
| R12698 | T15796 | T15798 | amod | NleH1,mutant |
| R12699 | T15797 | T15798 | compound | kinase-dead,mutant |
| R12700 | T15798 | T15794 | attr | mutant,is |
| R12701 | T15799 | T15802 | punct | (,) |
| R12702 | T15800 | T15802 | nmod | Fig.,) |
| R12703 | T15801 | T15800 | nummod | 7a,Fig. |
| R12704 | T15802 | T15794 | punct | ),is |
| R12705 | T15803 | T15766 | punct | .,performed |
| R12706 | T15804 | T15805 | aux | To,examine |
| R12707 | T15805 | T15825 | advcl | examine,expressing |
| R12708 | T15806 | T15811 | mark | whether,required |
| R12709 | T15807 | T15809 | det | the,activity |
| R12710 | T15808 | T15809 | compound | kinase,activity |
| R12711 | T15809 | T15811 | nsubjpass | activity,required |
| R12712 | T15810 | T15811 | auxpass | is,required |
| R12713 | T15811 | T15805 | ccomp | required,examine |
| R12714 | T15812 | T15815 | mark | for,inhibit |
| R12715 | T15813 | T15815 | nsubj | NleH1,inhibit |
| R12716 | T15814 | T15815 | aux | to,inhibit |
| R12717 | T15815 | T15811 | advcl | inhibit,required |
| R12718 | T15816 | T15817 | compound | IKKβ,phosphorlyation |
| R12719 | T15817 | T15815 | dobj | phosphorlyation,inhibit |
| R12720 | T15818 | T15817 | prep | of,phosphorlyation |
| R12721 | T15819 | T15818 | pobj | RPS3,of |
| R12722 | T15820 | T15817 | prep | on,phosphorlyation |
| R12723 | T15821 | T15820 | pobj | S209,on |
| R12724 | T15822 | T15825 | punct | ",",expressing |
| R12725 | T15823 | T15825 | nsubj | we,expressing |
| R12726 | T15824 | T15825 | advmod | ectopically,expressing |
| R12727 | T15825 | T15825 | ROOT | expressing,expressing |
| R12728 | T15826 | T15827 | preconj | either,wild-type |
| R12729 | T15827 | T15825 | dobj | wild-type,expressing |
| R12730 | T15828 | T15827 | cc | or,wild-type |
| R12731 | T15829 | T15830 | compound | K159A,NleH1 |
| R12732 | T15830 | T15827 | conj | NleH1,wild-type |
| R12733 | T15831 | T15830 | prep | in,NleH1 |
| R12734 | T15832 | T15833 | compound | 293T,cells |
| R12735 | T15833 | T15831 | pobj | cells,in |
| R12736 | T15834 | T15825 | punct | .,expressing |
| R12737 | T15835 | T15837 | amod | Wild-type,expression |
| R12738 | T15836 | T15837 | compound | NleH1,expression |
| R12739 | T15837 | T15839 | nsubj | expression,reduced |
| R12740 | T15838 | T15839 | advmod | significantly,reduced |
| R12741 | T15839 | T15839 | ROOT | reduced,reduced |
| R12742 | T15840 | T15843 | amod | TNF-induced,phosphorylation |
| R12743 | T15841 | T15843 | compound | RPS3,phosphorylation |
| R12744 | T15842 | T15843 | compound | S209,phosphorylation |
| R12745 | T15843 | T15839 | dobj | phosphorylation,reduced |
| R12746 | T15844 | T15839 | punct | ",",reduced |
| R12747 | T15845 | T15849 | mark | whereas,failed |
| R12748 | T15846 | T15848 | det | the,mutant |
| R12749 | T15847 | T15848 | compound | K159A,mutant |
| R12750 | T15848 | T15849 | nsubj | mutant,failed |
| R12751 | T15849 | T15839 | advcl | failed,reduced |
| R12752 | T15850 | T15851 | aux | to,do |
| R12753 | T15851 | T15849 | xcomp | do,failed |
| R12754 | T15852 | T15851 | advmod | so,do |
| R12755 | T15853 | T15854 | punct | (,Fig. |
| R12835 | T15933 | T15938 | prep | In,stimulated |
| R12836 | T15934 | T15935 | amod | uninfected,cells |
| R12837 | T15935 | T15933 | pobj | cells,In |
| R12838 | T15936 | T15938 | punct | ",",stimulated |
| R12839 | T15937 | T15938 | nsubj | TNF-treatment,stimulated |
| R12840 | T15938 | T15938 | ROOT | stimulated,stimulated |
| R12841 | T15939 | T15942 | det | a,increase |
| R12842 | T15940 | T15942 | nmod | ∼,increase |
| R12843 | T15941 | T15942 | amod | 3.5-fold,increase |
| R12844 | T15942 | T15938 | dobj | increase,stimulated |
| R12845 | T15943 | T15942 | prep | in,increase |
| R12846 | T15944 | T15946 | compound | RPS3,phosphorylation |
| R12847 | T15945 | T15946 | compound | S209,phosphorylation |
| R12848 | T15946 | T15943 | pobj | phosphorylation,in |
| R12849 | T15947 | T15948 | punct | (,Fig. |
| R12850 | T15948 | T15942 | appos | Fig.,increase |
| R12851 | T15949 | T15948 | nummod | 7c,Fig. |
| R12852 | T15950 | T15948 | punct | ),Fig. |
| R12853 | T15951 | T15938 | punct | .,stimulated |
| R12854 | T15952 | T15953 | amod | Such,augmentation |
| R12855 | T15953 | T15958 | nsubjpass | augmentation,reduced |
| R12856 | T15954 | T15953 | prep | of,augmentation |
| R12857 | T15955 | T15956 | nummod | RPS3,phosphorylation |
| R12858 | T15956 | T15954 | pobj | phosphorylation,of |
| R12859 | T15957 | T15958 | auxpass | was,reduced |
| R12860 | T15958 | T15958 | ROOT | reduced,reduced |
| R12861 | T15959 | T15958 | prep | by,reduced |
| R12862 | T15960 | T15961 | advmod | about,60 |
| R12863 | T15961 | T15962 | nummod | 60,% |
| R12864 | T15962 | T15959 | pobj | %,by |
| R12865 | T15963 | T15958 | agent | by,reduced |
| R12866 | T15964 | T15967 | amod | wild-type,infection |
| R12867 | T15965 | T15966 | compound | C.,rodentium |
| R12868 | T15966 | T15967 | compound | rodentium,infection |
| R12869 | T15967 | T15963 | pobj | infection,by |
| R12870 | T15968 | T15969 | punct | (,Fig. |
| R12871 | T15969 | T15970 | compound | Fig.,7c |
| R12872 | T15970 | T15967 | appos | 7c,infection |
| R12873 | T15971 | T15967 | punct | ),infection |
| R12874 | T15972 | T15958 | punct | .,reduced |
| R12875 | T15973 | T15978 | advmod | However,enhanced |
| R12876 | T15974 | T15978 | punct | ",",enhanced |
| R12877 | T15975 | T15976 | amod | RPS3,phosphorylation |
| R12878 | T15976 | T15978 | nsubjpass | phosphorylation,enhanced |
| R12879 | T15977 | T15978 | auxpass | was,enhanced |
| R12880 | T15978 | T15978 | ROOT | enhanced,enhanced |
| R12881 | T15979 | T15982 | advmod | when,infected |
| R12882 | T15980 | T15982 | nsubjpass | cells,infected |
| R12883 | T15981 | T15982 | auxpass | were,infected |
| R12884 | T15982 | T15978 | advcl | infected,enhanced |
| R12885 | T15983 | T15982 | prep | with,infected |
| R12886 | T15984 | T15987 | det | a,strain |
| R12887 | T15985 | T15987 | compound | C.,strain |
| R12888 | T15986 | T15987 | compound | rodentium,strain |
| R12889 | T15987 | T15983 | pobj | strain,with |
| R12890 | T15988 | T15987 | acl | lacking,strain |
| R12891 | T15989 | T15988 | dobj | NleH,lacking |
| R12892 | T15990 | T15989 | punct | (,NleH |
| R12893 | T15991 | T15992 | compound | Fig.,7c |
| R12894 | T15992 | T15989 | appos | 7c,NleH |
| R12895 | T15993 | T15989 | punct | ",",NleH |
| R12896 | T15994 | T15989 | appos | ΔnleH,NleH |
| R12897 | T15995 | T15989 | punct | ),NleH |
| R12898 | T15996 | T15978 | punct | .,enhanced |
| R12899 | T15997 | T15999 | nsubj | We,examined |
| R12900 | T15998 | T15999 | advmod | further,examined |
| R12901 | T15999 | T15999 | ROOT | examined,examined |
| R12902 | T16000 | T16001 | det | the,role |
| R12903 | T16001 | T15999 | dobj | role,examined |
| R12904 | T16002 | T16001 | prep | of,role |
| R12905 | T16003 | T16005 | amod | NleH1,activity |
| R12906 | T16004 | T16005 | compound | kinase,activity |
| R12907 | T16005 | T16002 | pobj | activity,of |
| R12908 | T16006 | T15999 | advcl | using,examined |
| R12909 | T16007 | T16011 | det | the,strain |
| R12910 | T16008 | T16010 | compound | C.,ΔnleH |
| R12911 | T16009 | T16010 | compound | rodentium,ΔnleH |
| R12912 | T16010 | T16011 | compound | ΔnleH,strain |
| R12913 | T16011 | T16006 | dobj | strain,using |
| R12914 | T16012 | T16006 | prep | as,using |
| R12915 | T16013 | T16014 | det | a,background |
| R12916 | T16014 | T16012 | pobj | background,as |
| R12917 | T16015 | T16018 | prep | on,express |
| R12918 | T16016 | T16015 | pobj | which,on |
| R12919 | T16017 | T16018 | aux | to,express |
| R12989 | T16087 | T16083 | dobj | translocation,impair |
| R12990 | T16088 | T16087 | prep | of,translocation |
| R12991 | T16089 | T16088 | pobj | RPS3,of |
| R12992 | T16090 | T16087 | acl | trigged,translocation |
| R12993 | T16091 | T16090 | agent | by,trigged |
| R12994 | T16092 | T16094 | det | the,IKKβ |
| R12995 | T16093 | T16094 | compound | constitutively-active,IKKβ |
| R12996 | T16094 | T16091 | pobj | IKKβ,by |
| R12997 | T16095 | T16099 | punct | (,] |
| R12998 | T16096 | T16099 | compound | IKKβ,] |
| R12999 | T16097 | T16099 | compound | [,] |
| R13000 | T16098 | T16099 | compound | SSEE,] |
| R13001 | T16099 | T16094 | appos | ],IKKβ |
| R13002 | T16100 | T16099 | punct | ),] |
| R13003 | T16101 | T16102 | punct | (,Fig. |
| R13004 | T16102 | T16094 | appos | Fig.,IKKβ |
| R13005 | T16103 | T16102 | nummod | 2d,Fig. |
| R13006 | T16104 | T16094 | punct | ),IKKβ |
| R13007 | T16105 | T16072 | punct | .,examined |
| R13008 | T16106 | T16107 | nsubj | We,found |
| R13009 | T16107 | T16107 | ROOT | found,found |
| R13010 | T16108 | T16118 | mark | that,triggered |
| R13011 | T16109 | T16110 | advmod | ectopically,expressing |
| R13012 | T16110 | T16118 | advcl | expressing,triggered |
| R13013 | T16111 | T16112 | preconj | either,wild-type |
| R13014 | T16112 | T16110 | dobj | wild-type,expressing |
| R13015 | T16113 | T16112 | cc | or,wild-type |
| R13016 | T16114 | T16115 | compound | SSEE,IKKβ |
| R13017 | T16115 | T16112 | conj | IKKβ,wild-type |
| R13018 | T16116 | T16112 | conj | proteins,wild-type |
| R13019 | T16117 | T16118 | punct | ",",triggered |
| R13020 | T16118 | T16107 | ccomp | triggered,found |
| R13021 | T16119 | T16120 | advmod | more,RPS3 |
| R13022 | T16120 | T16122 | amod | RPS3,translocation |
| R13023 | T16121 | T16122 | amod | nuclear,translocation |
| R13024 | T16122 | T16118 | dobj | translocation,triggered |
| R13025 | T16123 | T16122 | prep | than,translocation |
| R13026 | T16124 | T16126 | det | the,IKKβ |
| R13027 | T16125 | T16126 | compound | kinase-dead,IKKβ |
| R13028 | T16126 | T16130 | nmod | IKKβ,protein |
| R13029 | T16127 | T16126 | punct | (,IKKβ |
| R13030 | T16128 | T16126 | appos | SSAA,IKKβ |
| R13031 | T16129 | T16126 | punct | ),IKKβ |
| R13032 | T16130 | T16123 | pobj | protein,than |
| R13033 | T16131 | T16130 | punct | (,protein |
| R13034 | T16132 | T16130 | appos | Fig.,protein |
| R13035 | T16133 | T16132 | nummod | 7d,Fig. |
| R13036 | T16134 | T16130 | punct | ),protein |
| R13037 | T16135 | T16107 | punct | .,found |
| R13038 | T16136 | T16138 | nummod | RPS3,accumulation |
| R13039 | T16137 | T16138 | amod | nuclear,accumulation |
| R13040 | T16138 | T16139 | nsubj | accumulation,was |
| R13041 | T16139 | T16139 | ROOT | was,was |
| R13042 | T16140 | T16141 | advmod | substantially,retarded |
| R13043 | T16141 | T16139 | acomp | retarded,was |
| R13044 | T16142 | T16139 | prep | by,was |
| R13045 | T16143 | T16142 | pcomp | infecting,by |
| R13046 | T16144 | T16143 | dobj | cells,infecting |
| R13047 | T16145 | T16143 | prep | with,infecting |
| R13048 | T16146 | T16149 | amod | wild-type,O157 |
| R13049 | T16147 | T16149 | compound | E.,O157 |
| R13050 | T16148 | T16149 | compound | coli,O157 |
| R13051 | T16149 | T16145 | pobj | O157,with |
| R13052 | T16150 | T16149 | punct | :,O157 |
| R13053 | T16151 | T16149 | appos | H7,O157 |
| R13054 | T16152 | T16153 | punct | (,Fig. |
| R13055 | T16153 | T16151 | appos | Fig.,H7 |
| R13056 | T16154 | T16153 | nummod | 7d,Fig. |
| R13057 | T16155 | T16151 | punct | ),H7 |
| R13058 | T16156 | T16139 | punct | .,was |
| R13059 | T16157 | T16160 | prep | In,infecting |
| R13135 | T16233 | T16234 | amod | nuclear,translocation |
| R13136 | T16234 | T16231 | dobj | translocation,inhibit |
| R13137 | T16235 | T16236 | advmod | even,in |
| R13138 | T16236 | T16231 | prep | in,inhibit |
| R13139 | T16237 | T16236 | pobj | cells,in |
| R13140 | T16238 | T16237 | acl | expressing,cells |
| R13141 | T16239 | T16240 | compound | constitutively-activated,IKKβ |
| R13142 | T16240 | T16238 | dobj | IKKβ,expressing |
| R13143 | T16241 | T16227 | punct | .,is |
| R13144 | T16242 | T16243 | nsubj | We,examined |
| R13145 | T16243 | T16243 | ROOT | examined,examined |
| R13146 | T16244 | T16248 | mark | whether,phosphorylate |
| R13147 | T16245 | T16248 | nsubj | NleH1,phosphorylate |
| R13148 | T16246 | T16248 | aux | could,phosphorylate |
| R13149 | T16247 | T16248 | advmod | directly,phosphorylate |
| R13150 | T16248 | T16243 | ccomp | phosphorylate,examined |
| R13151 | T16249 | T16248 | dobj | IKKβ,phosphorylate |
| R13152 | T16250 | T16251 | advmod | thus,inhibiting |
| R13153 | T16251 | T16248 | advcl | inhibiting,phosphorylate |
| R13154 | T16252 | T16255 | amod | IKKβ-mediated,phosphorylation |
| R13155 | T16253 | T16255 | nummod | RPS3,phosphorylation |
| R13156 | T16254 | T16255 | nummod | S209,phosphorylation |
| R13157 | T16255 | T16251 | dobj | phosphorylation,inhibiting |
| R13158 | T16256 | T16243 | punct | .,examined |
| R13159 | T16257 | T16258 | nsubj | We,performed |
| R13160 | T16258 | T16258 | ROOT | performed,performed |
| R13161 | T16259 | T16258 | prep | in,performed |
| R13162 | T16260 | T16261 | amod | vitro,kinase |
| R13163 | T16261 | T16262 | compound | kinase,assays |
| R13164 | T16262 | T16259 | pobj | assays,in |
| R13165 | T16263 | T16262 | advcl | using,assays |
| R13166 | T16264 | T16265 | amod | immunoprecipitated,Flag-IKKβ |
| R13167 | T16265 | T16263 | dobj | Flag-IKKβ,using |
| R12920 | T16018 | T16014 | relcl | express,background |
| R12921 | T16019 | T16020 | preconj | either,wild-type |
| R12922 | T16020 | T16018 | dobj | wild-type,express |
| R12923 | T16021 | T16020 | cc | or,wild-type |
| R12924 | T16022 | T16025 | compound | K159A,NleH1 |
| R12925 | T16023 | T16025 | compound | E.,NleH1 |
| R12926 | T16024 | T16025 | compound | coli,NleH1 |
| R12927 | T16025 | T16020 | conj | NleH1,wild-type |
| R12928 | T16026 | T15999 | punct | .,examined |
| R12929 | T16027 | T16027 | ROOT | Complementing,Complementing |
| R12930 | T16028 | T16034 | nsubj | ΔnleH,abolished |
| R12931 | T16029 | T16028 | amod | mutant,ΔnleH |
| R12932 | T16030 | T16029 | prep | with,mutant |
| R12933 | T16031 | T16032 | compound | wild-type,NleH1 |
| R12934 | T16032 | T16030 | pobj | NleH1,with |
| R12935 | T16033 | T16034 | advmod | almost,abolished |
| R12936 | T16034 | T16034 | ROOT | abolished,abolished |
| R12937 | T16035 | T16038 | amod | TNF-induced,phosphorylation |
| R12938 | T16036 | T16037 | compound | RPS3,S209 |
| R12939 | T16037 | T16038 | compound | S209,phosphorylation |
| R12940 | T16038 | T16034 | dobj | phosphorylation,abolished |
| R12941 | T16039 | T16043 | mark | whereas,failed |
| R12942 | T16040 | T16039 | pcomp | complementing,whereas |
| R12943 | T16041 | T16040 | prep | with,complementing |
| R12944 | T16042 | T16041 | pobj | K159A,with |
| R12945 | T16043 | T16034 | advcl | failed,abolished |
| R12946 | T16044 | T16045 | aux | to,inhibit |
| R12947 | T16045 | T16043 | xcomp | inhibit,failed |
| R12948 | T16046 | T16047 | amod | RPS3,phosphorylation |
| R12949 | T16047 | T16045 | dobj | phosphorylation,inhibit |
| R12950 | T16048 | T16049 | punct | (,Fig. |
| R12951 | T16049 | T16047 | appos | Fig.,phosphorylation |
| R12952 | T16050 | T16049 | nummod | 7c,Fig. |
| R12953 | T16051 | T16049 | punct | ),Fig. |
| R12954 | T16052 | T16034 | punct | .,abolished |
| R12955 | T16053 | T16057 | advmod | Collectively,demonstrate |
| R12956 | T16054 | T16057 | punct | ",",demonstrate |
| R12957 | T16055 | T16056 | det | these,results |
| R12958 | T16056 | T16057 | nsubj | results,demonstrate |
| R12959 | T16057 | T16057 | ROOT | demonstrate,demonstrate |
| R12960 | T16058 | T16063 | mark | that,required |
| R12961 | T16059 | T16061 | amod | NleH1,activity |
| R12962 | T16060 | T16061 | compound | kinase,activity |
| R12963 | T16061 | T16063 | nsubjpass | activity,required |
| R12964 | T16062 | T16063 | auxpass | is,required |
| R12965 | T16063 | T16057 | ccomp | required,demonstrate |
| R12966 | T16064 | T16065 | aux | to,block |
| R12967 | T16065 | T16063 | xcomp | block,required |
| R12968 | T16066 | T16068 | compound | RPS3,phosphorylation |
| R12969 | T16067 | T16068 | compound | S209,phosphorylation |
| R12970 | T16068 | T16065 | dobj | phosphorylation,block |
| R12971 | T16069 | T16057 | punct | .,demonstrate |
| R12972 | T16070 | T16072 | nsubj | We,examined |
| R12973 | T16071 | T16072 | advmod | next,examined |
| R12974 | T16072 | T16072 | ROOT | examined,examined |
| R12975 | T16073 | T16079 | mark | whether,is |
| R12976 | T16074 | T16076 | det | the,activity |
| R12977 | T16075 | T16076 | amod | inhibitory,activity |
| R12978 | T16076 | T16079 | nsubj | activity,is |
| R12979 | T16077 | T16076 | prep | of,activity |
| R12980 | T16078 | T16077 | pobj | NleH1,of |
| R12981 | T16079 | T16072 | ccomp | is,examined |
| R12982 | T16080 | T16081 | advmod | sufficiently,robust |
| R12983 | T16081 | T16079 | acomp | robust,is |
| R12984 | T16082 | T16083 | aux | to,impair |
| R13060 | T16158 | T16157 | pobj | contrast,In |
| R13061 | T16159 | T16160 | punct | ",",infecting |
| R13062 | T16160 | T16160 | ROOT | infecting,infecting |
| R13063 | T16161 | T16160 | prep | with,infecting |
| R13064 | T16162 | T16163 | det | either,ΔnleH1 |
| R13065 | T16163 | T16161 | pobj | ΔnleH1,with |
| R13066 | T16164 | T16163 | cc | or,ΔnleH1 |
| R13067 | T16165 | T16163 | conj | ΔescN,ΔnleH1 |
| R13068 | T16166 | T16160 | dobj | strains,infecting |
| R13069 | T16167 | T16168 | advmod | only,slightly |
| R13070 | T16168 | T16169 | advmod | slightly,impaired |
| R13071 | T16169 | T16166 | acl | impaired,strains |
| R13072 | T16170 | T16172 | nmod | RPS3,translocation |
| R13073 | T16171 | T16172 | amod | nuclear,translocation |
| R13074 | T16172 | T16169 | dobj | translocation,impaired |
| R13075 | T16173 | T16169 | prep | in,impaired |
| R13076 | T16174 | T16175 | preconj | either,IKKβ |
| R13077 | T16175 | T16173 | pobj | IKKβ,in |
| R13078 | T16176 | T16175 | punct | -,IKKβ |
| R13079 | T16177 | T16175 | cc | or,IKKβ |
| R13080 | T16178 | T16175 | conj | IKKβ,IKKβ |
| R13081 | T16179 | T16178 | punct | (,IKKβ |
| R13082 | T16180 | T16178 | appos | SSEE,IKKβ |
| R13083 | T16181 | T16178 | punct | ),IKKβ |
| R13084 | T16182 | T16183 | punct | -,expressing |
| R13085 | T16183 | T16166 | acl | expressing,strains |
| R13086 | T16184 | T16183 | dobj | cells,expressing |
| R13087 | T16185 | T16183 | punct | (,expressing |
| R13088 | T16186 | T16188 | nmod | Fig.,) |
| R13089 | T16187 | T16186 | nummod | 7d,Fig. |
| R13090 | T16188 | T16183 | punct | ),expressing |
| R13091 | T16189 | T16160 | punct | .,infecting |
| R13092 | T16190 | T16191 | mark | As,expected |
| R13093 | T16191 | T16198 | advcl | expected,affect |
| R13094 | T16192 | T16198 | punct | ",",affect |
| R13095 | T16193 | T16195 | compound | E.,infections |
| R13096 | T16194 | T16195 | compound | coli,infections |
| R13097 | T16195 | T16198 | nsubj | infections,affect |
| R13098 | T16196 | T16198 | aux | did,affect |
| R13099 | T16197 | T16198 | neg | not,affect |
| R13100 | T16198 | T16198 | ROOT | affect,affect |
| R13101 | T16199 | T16202 | det | the,translocation |
| R13102 | T16200 | T16202 | amod | RPS3,translocation |
| R13103 | T16201 | T16202 | amod | nuclear,translocation |
| R13104 | T16202 | T16198 | dobj | translocation,affect |
| R13105 | T16203 | T16202 | prep | in,translocation |
| R13106 | T16204 | T16203 | pobj | IKKβ,in |
| R13107 | T16205 | T16204 | punct | (,IKKβ |
| R13108 | T16206 | T16204 | appos | SSAA,IKKβ |
| R13109 | T16207 | T16204 | punct | ),IKKβ |
| R13110 | T16208 | T16202 | punct | -,translocation |
| R13111 | T16209 | T16202 | acl | expressing,translocation |
| R13112 | T16210 | T16209 | dobj | cells,expressing |
| R13113 | T16211 | T16209 | punct | ",",expressing |
| R13114 | T16212 | T16215 | advmod | where,was |
| R13115 | T16213 | T16214 | amod | NF-κB,signaling |
| R13116 | T16214 | T16215 | nsubj | signaling,was |
| R13117 | T16215 | T16202 | relcl | was,translocation |
| R13118 | T16216 | T16215 | acomp | low,was |
| R13119 | T16217 | T16218 | punct | (,Fig. |
| R13120 | T16218 | T16202 | appos | Fig.,translocation |
| R13121 | T16219 | T16218 | nummod | 7d,Fig. |
| R13122 | T16220 | T16218 | punct | ),Fig. |
| R13123 | T16221 | T16198 | punct | .,affect |
| R13124 | T16222 | T16227 | advmod | Thus,is |
| R13125 | T16223 | T16227 | punct | ",",is |
| R13126 | T16224 | T16227 | prep | during,is |
| R13127 | T16225 | T16224 | pobj | infection,during |
| R13128 | T16226 | T16227 | nsubj | NleH1,is |
| R13129 | T16227 | T16227 | ROOT | is,is |
| R13130 | T16228 | T16229 | advmod | sufficiently,potent |
| R13131 | T16229 | T16227 | acomp | potent,is |
| R13132 | T16230 | T16231 | aux | to,inhibit |
| R13133 | T16231 | T16229 | xcomp | inhibit,potent |
| R13134 | T16232 | T16234 | amod | RPS3,translocation |
| R13209 | T16307 | T16306 | prt | out,ruling |
| R13210 | T16308 | T16309 | det | this,possibility |
| R13211 | T16309 | T16306 | dobj | possibility,ruling |
| R13212 | T16310 | T16292 | punct | .,observe |
| R13213 | T16311 | T16313 | nsubj | We,tested |
| R13214 | T16312 | T16313 | advmod | then,tested |
| R13215 | T16313 | T16313 | ROOT | tested,tested |
| R13216 | T16314 | T16315 | det | the,hypothesis |
| R13217 | T16315 | T16313 | dobj | hypothesis,tested |
| R13218 | T16316 | T16319 | mark | that,alter |
| R13219 | T16317 | T16319 | nsubj | NleH1,alter |
| R13220 | T16318 | T16319 | aux | could,alter |
| R13221 | T16319 | T16315 | acl | alter,hypothesis |
| R13222 | T16320 | T16322 | det | the,substrate |
| R13223 | T16321 | T16322 | compound | IKKβ,substrate |
| R13224 | T16322 | T16323 | compound | substrate,specificities |
| R13225 | T16323 | T16319 | dobj | specificities,alter |
| R13226 | T16324 | T16313 | punct | .,tested |
| R13168 | T16266 | T16267 | punct | (,K44A |
| R13169 | T16267 | T16265 | appos | K44A,Flag-IKKβ |
| R13170 | T16268 | T16265 | punct | ),Flag-IKKβ |
| R13171 | T16269 | T16263 | prep | as,using |
| R13172 | T16270 | T16269 | pobj | substrate,as |
| R13173 | T16271 | T16270 | cc | and,substrate |
| R13174 | T16272 | T16273 | amod | recombinant,His-NleH1 |
| R13175 | T16273 | T16270 | conj | His-NleH1,substrate |
| R13176 | T16274 | T16263 | prep | as,using |
| R13177 | T16275 | T16274 | pobj | kinase,as |
| R13178 | T16276 | T16262 | punct | ",",assays |
| R13179 | T16277 | T16283 | mark | so,obscure |
| R13180 | T16278 | T16283 | mark | that,obscure |
| R13181 | T16279 | T16280 | compound | IKKβ,autophosphorylation |
| R13182 | T16280 | T16283 | nsubj | autophosphorylation,obscure |
| R13183 | T16281 | T16283 | aux | would,obscure |
| R13184 | T16282 | T16283 | neg | not,obscure |
| R13185 | T16283 | T16258 | advcl | obscure,performed |
| R13186 | T16284 | T16285 | amod | NleH1-induced,phosphorylation |
| R13187 | T16285 | T16283 | dobj | phosphorylation,obscure |
| R13188 | T16286 | T16258 | punct | .,performed |
| R13189 | T16287 | T16292 | advmod | However,observe |
| R13190 | T16288 | T16292 | punct | ",",observe |
| R13191 | T16289 | T16292 | nsubj | we,observe |
| R13192 | T16290 | T16292 | aux | did,observe |
| R13193 | T16291 | T16292 | neg | not,observe |
| R13194 | T16292 | T16292 | ROOT | observe,observe |
| R13195 | T16293 | T16296 | det | any,incorporation |
| R13196 | T16294 | T16296 | amod | detectable,incorporation |
| R13197 | T16295 | T16296 | compound | 32P,incorporation |
| R13198 | T16296 | T16292 | dobj | incorporation,observe |
| R13199 | T16297 | T16296 | prep | in,incorporation |
| R13200 | T16298 | T16297 | pobj | IKKβ,in |
| R13201 | T16299 | T16301 | punct | (,Fig. |
| R13202 | T16300 | T16301 | compound | Supplementary,Fig. |
| R13203 | T16301 | T16298 | appos | Fig.,IKKβ |
| R13204 | T16302 | T16301 | nummod | 13,Fig. |
| R13205 | T16303 | T16301 | punct | ),Fig. |
| R13206 | T16304 | T16292 | punct | ",",observe |
| R13207 | T16305 | T16306 | advmod | thus,ruling |
| R13208 | T16306 | T16292 | advcl | ruling,observe |
| R13359 | T16457 | T16438 | punct | :,specificity |
| R13360 | T16458 | T16438 | appos | H7,specificity |
| R13361 | T16459 | T16460 | aux | to,alter |
| R13362 | T16460 | T16438 | acl | alter,specificity |
| R13363 | T16461 | T16462 | det | the,host |
| R13364 | T16462 | T16465 | amod | host,response |
| R13365 | T16463 | T16465 | amod | innate,response |
| R13366 | T16464 | T16465 | amod | immune,response |
| R13367 | T16465 | T16460 | dobj | response,alter |
| R13368 | T16466 | T16434 | punct | .,blocks |
| R15050 | T18827 | T18830 | nsubjpass | RPS3,demonstrated |
| R15051 | T18828 | T18830 | auxpass | was,demonstrated |
| R15052 | T18829 | T18830 | advmod | previously,demonstrated |
| R15053 | T18830 | T18830 | ROOT | demonstrated,demonstrated |
| R15054 | T18831 | T18832 | aux | to,function |
| R15055 | T18832 | T18830 | xcomp | function,demonstrated |
| R15056 | T18833 | T18832 | prep | as,function |
| R15057 | T18834 | T18836 | det | an,subunit |
| R15058 | T18835 | T18836 | amod | integral,subunit |
| R15059 | T18836 | T18833 | pobj | subunit,as |
| R15060 | T18837 | T18836 | acl | conferring,subunit |
| R15061 | T18838 | T18840 | amod | NF-κB,specificity6 |
| R15062 | T18839 | T18840 | amod | regulatory,specificity6 |
| R15063 | T18840 | T18837 | dobj | specificity6,conferring |
| R15064 | T18841 | T18830 | punct | .,demonstrated |
| R15065 | T18842 | T18844 | advmod | Here,sought |
| R15066 | T18843 | T18844 | nsubj | we,sought |
| R15067 | T18844 | T18844 | ROOT | sought,sought |
| R15068 | T18845 | T18846 | aux | to,elucidate |
| R15069 | T18846 | T18844 | xcomp | elucidate,sought |
| R15070 | T18847 | T18851 | advmod | how,triggers |
| R15071 | T18848 | T18849 | amod | NF-κB,activation |
| R15072 | T18849 | T18851 | nsubj | activation,triggers |
| R15073 | T18850 | T18851 | nsubj | signaling,triggers |
| R15074 | T18851 | T18846 | ccomp | triggers,elucidate |
| R15075 | T18852 | T18851 | dobj | RPS3,triggers |
| R15076 | T18853 | T18854 | aux | to,translocate |
| R15077 | T18854 | T18846 | advcl | translocate,elucidate |
| R15078 | T18855 | T18854 | cc | and,translocate |
| R15079 | T18856 | T18854 | conj | participate,translocate |
| R15080 | T18857 | T18856 | prep | in,participate |
| R15081 | T18858 | T18859 | amod | NF-κB,function |
| R15082 | T18859 | T18857 | pobj | function,in |
| R15083 | T18860 | T18859 | prep | in,function |
| R15084 | T18861 | T18862 | det | the,nucleus |
| R15085 | T18862 | T18860 | pobj | nucleus,in |
| R15086 | T18863 | T18844 | punct | .,sought |
| R15087 | T18864 | T18865 | nsubj | We,demonstrate |
| R15163 | T18940 | T18941 | nummod | specificity29,coincides |
| R15164 | T18941 | T18933 | appos | coincides,observation |
| R15165 | T18942 | T18941 | prep | with,coincides |
| R15166 | T18943 | T18944 | poss | our,evidence |
| R15167 | T18944 | T18942 | pobj | evidence,with |
| R15168 | T18945 | T18944 | mark | that,evidence |
| R15169 | T18946 | T18947 | compound | recombinant,IKKβ |
| R15170 | T18947 | T18945 | nsubj | IKKβ,that |
| R15171 | T18948 | T18947 | punct | ",",IKKβ |
| R15172 | T18949 | T18947 | cc | but,IKKβ |
| R15173 | T18950 | T18949 | neg | not,but |
| R15174 | T18951 | T18947 | conj | IKKα,IKKβ |
| R15175 | T18952 | T18953 | punct | ",",phosphorylated |
| R15176 | T18953 | T18954 | compound | phosphorylated,RPS3 |
| R15177 | T18954 | T18947 | conj | RPS3,IKKβ |
| R15178 | T18955 | T18933 | punct | .,observation |
| R15179 | T18956 | T18957 | nsubj | We,found |
| R15180 | T18957 | T18957 | ROOT | found,found |
| R13227 | T16325 | T16330 | prep | To,performed |
| R13228 | T16326 | T16327 | det | this,end |
| R13229 | T16327 | T16325 | pobj | end,To |
| R13230 | T16328 | T16330 | punct | ",",performed |
| R13231 | T16329 | T16330 | nsubj | we,performed |
| R13232 | T16330 | T16330 | ROOT | performed,performed |
| R13233 | T16331 | T16330 | prep | in,performed |
| R13234 | T16332 | T16333 | amod | vitro,kinase |
| R13235 | T16333 | T16334 | compound | kinase,assays |
| R13236 | T16334 | T16331 | pobj | assays,in |
| R13237 | T16335 | T16334 | advcl | using,assays |
| R13238 | T16336 | T16337 | det | both,CK2 |
| R13239 | T16337 | T16335 | dobj | CK2,using |
| R13240 | T16338 | T16337 | cc | and,CK2 |
| R13241 | T16339 | T16340 | compound | IKK,substrates |
| R13242 | T16340 | T16337 | conj | substrates,CK2 |
| R13243 | T16341 | T16340 | prep | for,substrates |
| R13244 | T16342 | T16341 | pobj | IKKβ,for |
| R13245 | T16343 | T16330 | punct | .,performed |
| R13246 | T16344 | T16345 | mark | As,expected |
| R13247 | T16345 | T16348 | advcl | expected,phosphorylated |
| R13248 | T16346 | T16348 | punct | ",",phosphorylated |
| R13249 | T16347 | T16348 | nsubj | IKKβ,phosphorylated |
| R13250 | T16348 | T16348 | ROOT | phosphorylated,phosphorylated |
| R13251 | T16349 | T16348 | dobj | RPS3,phosphorylated |
| R13252 | T16350 | T16351 | punct | (,Fig. |
| R13253 | T16351 | T16352 | compound | Fig.,7e |
| R13254 | T16352 | T16349 | appos | 7e,RPS3 |
| R13255 | T16353 | T16352 | punct | ",",7e |
| R13256 | T16354 | T16352 | appos | lane,7e |
| R13257 | T16355 | T16354 | nummod | 7,lane |
| R13258 | T16356 | T16352 | punct | ),7e |
| R13259 | T16357 | T16349 | cc | and,RPS3 |
| R13260 | T16358 | T16349 | conj | GST-IκBα,RPS3 |
| R13261 | T16359 | T16358 | punct | (,GST-IκBα |
| R13262 | T16360 | T16358 | parataxis | 1-54,GST-IκBα |
| R13263 | T16361 | T16358 | punct | ),GST-IκBα |
| R13264 | T16362 | T16349 | conj | protein,RPS3 |
| R13265 | T16363 | T16362 | punct | (,protein |
| R13266 | T16364 | T16365 | compound | Fig.,7e |
| R13267 | T16365 | T16362 | appos | 7e,protein |
| R13268 | T16366 | T16365 | punct | ",",7e |
| R13269 | T16367 | T16368 | nmod | lane,9 |
| R13270 | T16368 | T16365 | conj | 9,7e |
| R13271 | T16369 | T16365 | punct | ),7e |
| R13272 | T16370 | T16362 | punct | ",",protein |
| R13273 | T16371 | T16348 | advcl | demonstrating,phosphorylated |
| R13274 | T16372 | T16373 | nsubj | it,harbors |
| R13275 | T16373 | T16371 | ccomp | harbors,demonstrating |
| R13276 | T16374 | T16375 | preconj | either,CK2 |
| R13277 | T16375 | T16373 | dobj | CK2,harbors |
| R13278 | T16376 | T16375 | cc | or,CK2 |
| R13279 | T16377 | T16379 | compound | IKK,specificity |
| R13280 | T16378 | T16379 | compound | substrate,specificity |
| R13281 | T16379 | T16375 | conj | specificity,CK2 |
| R13282 | T16380 | T16348 | punct | .,phosphorylated |
| R13283 | T16381 | T16386 | nsubj | Preincubation,reduced |
| R13284 | T16382 | T16381 | prep | of,Preincubation |
| R13285 | T16383 | T16382 | pobj | IKKβ,of |
| R13286 | T16384 | T16381 | prep | with,Preincubation |
| R13287 | T16385 | T16384 | pobj | NleH1,with |
| R13288 | T16386 | T16386 | ROOT | reduced,reduced |
| R13289 | T16387 | T16389 | nmod | IKKβ-mediated,phosphorylation |
| R13290 | T16388 | T16389 | amod | RPS3,phosphorylation |
| R13291 | T16389 | T16386 | dobj | phosphorylation,reduced |
| R13292 | T16390 | T16389 | punct | ",",phosphorylation |
| R13293 | T16391 | T16395 | advmod | i.e.,specificity |
| R13294 | T16392 | T16395 | det | the,specificity |
| R13295 | T16393 | T16395 | compound | CK2,specificity |
| R13296 | T16394 | T16395 | compound | kinase,specificity |
| R13297 | T16395 | T16389 | appos | specificity,phosphorylation |
| R13298 | T16396 | T16395 | punct | ",",specificity |
| R13299 | T16397 | T16395 | cc | but,specificity |
| R13300 | T16398 | T16399 | neg | not,IKKβ-mediated |
| R13301 | T16399 | T16401 | amod | IKKβ-mediated,phosphorylation |
| R13302 | T16400 | T16401 | amod | GST-IκBα,phosphorylation |
| R13303 | T16401 | T16395 | conj | phosphorylation,specificity |
| R13304 | T16402 | T16401 | punct | ",",phosphorylation |
| R13305 | T16403 | T16407 | advmod | i.e.,specificity |
| R13306 | T16404 | T16407 | det | the,specificity |
| R13307 | T16405 | T16407 | nmod | IKK,specificity |
| R13308 | T16406 | T16407 | compound | kinase,specificity |
| R13309 | T16407 | T16401 | appos | specificity,phosphorylation |
| R13310 | T16408 | T16407 | punct | (,specificity |
| R13311 | T16409 | T16407 | appos | Fig.,specificity |
| R13312 | T16410 | T16409 | nummod | 7e,Fig. |
| R13313 | T16411 | T16407 | punct | ),specificity |
| R13314 | T16412 | T16386 | punct | .,reduced |
| R13315 | T16413 | T16414 | compound | Control,experiments |
| R13316 | T16414 | T16415 | nsubj | experiments,revealed |
| R13317 | T16415 | T16415 | ROOT | revealed,revealed |
| R13318 | T16416 | T16418 | det | no,phosphorylation |
| R13319 | T16417 | T16418 | amod | NleH1-mediated,phosphorylation |
| R13320 | T16418 | T16415 | dobj | phosphorylation,revealed |
| R13321 | T16419 | T16418 | cc | or,phosphorylation |
| R13322 | T16420 | T16418 | conj | autophosphorylation,phosphorylation |
| R13323 | T16421 | T16418 | prep | of,phosphorylation |
| R13324 | T16422 | T16421 | pobj | RPS3,of |
| R13325 | T16423 | T16422 | cc | or,RPS3 |
| R13326 | T16424 | T16422 | conj | GST-IκBα,RPS3 |
| R13327 | T16425 | T16426 | punct | (,Fig. |
| R13328 | T16426 | T16424 | appos | Fig.,GST-IκBα |
| R13329 | T16427 | T16426 | nummod | 7e,Fig. |
| R13330 | T16428 | T16424 | punct | ),GST-IκBα |
| R13331 | T16429 | T16415 | punct | .,revealed |
| R13332 | T16430 | T16434 | advcl | Taken,blocks |
| R13333 | T16431 | T16430 | advmod | together,Taken |
| R13334 | T16432 | T16434 | punct | ",",blocks |
| R13335 | T16433 | T16434 | nsubj | NleH1,blocks |
| R13336 | T16434 | T16434 | ROOT | blocks,blocks |
| R13337 | T16435 | T16438 | det | the,specificity |
| R13338 | T16436 | T16438 | compound | CK2,specificity |
| R13339 | T16437 | T16438 | compound | substrate,specificity |
| R13340 | T16438 | T16434 | dobj | specificity,blocks |
| R13341 | T16439 | T16438 | prep | of,specificity |
| R13342 | T16440 | T16439 | pobj | IKKβ,of |
| R13343 | T16441 | T16442 | advmod | thus,inhibiting |
| R13344 | T16442 | T16438 | acl | inhibiting,specificity |
| R13345 | T16443 | T16447 | det | the,phosphorylation |
| R13346 | T16444 | T16447 | amod | IKKβ-mediated,phosphorylation |
| R13347 | T16445 | T16446 | nummod | RPS3,S209 |
| R13348 | T16446 | T16447 | nummod | S209,phosphorylation |
| R13349 | T16447 | T16442 | dobj | phosphorylation,inhibiting |
| R13350 | T16448 | T16449 | advmod | thus,representing |
| R13351 | T16449 | T16438 | acl | representing,specificity |
| R13352 | T16450 | T16452 | det | a,strategy |
| R13353 | T16451 | T16452 | compound | novel,strategy |
| R13354 | T16452 | T16449 | dobj | strategy,representing |
| R13355 | T16453 | T16452 | prep | by,strategy |
| R13356 | T16454 | T16456 | compound | E.,O157 |
| R13357 | T16455 | T16456 | compound | coli,O157 |
| R13358 | T16456 | T16453 | pobj | O157,by |
| R15088 | T18865 | T18865 | ROOT | demonstrate,demonstrate |
| R15089 | T18866 | T18871 | mark | that,represents |
| R15090 | T18867 | T18871 | advmod | IKKβ-mediated,represents |
| R15091 | T18868 | T18870 | nummod | RPS3,phosphorylation |
| R15092 | T18869 | T18870 | nummod | S209,phosphorylation |
| R15093 | T18870 | T18871 | nsubj | phosphorylation,represents |
| R15094 | T18871 | T18865 | ccomp | represents,demonstrate |
| R15095 | T18872 | T18874 | det | a,determinant |
| R15096 | T18873 | T18874 | amod | critical,determinant |
| R15097 | T18874 | T18871 | dobj | determinant,represents |
| R15098 | T18875 | T18874 | prep | in,determinant |
| R15099 | T18876 | T18875 | pcomp | governing,in |
| R15100 | T18877 | T18879 | poss | its,import |
| R15101 | T18878 | T18879 | amod | nuclear,import |
| R15102 | T18879 | T18876 | dobj | import,governing |
| R15103 | T18880 | T18881 | advmod | thus,unveiling |
| R15104 | T18881 | T18871 | advcl | unveiling,represents |
| R15105 | T18882 | T18884 | det | a,mechanism |
| R15106 | T18883 | T18884 | compound | novel,mechanism |
| R15107 | T18884 | T18881 | dobj | mechanism,unveiling |
| R15108 | T18885 | T18884 | prep | behind,mechanism |
| R15109 | T18886 | T18888 | amod | NF-κB,specificity |
| R15110 | T18887 | T18888 | amod | regulatory,specificity |
| R15111 | T18888 | T18885 | pobj | specificity,behind |
| R15112 | T18889 | T18865 | punct | .,demonstrate |
| R15113 | T18890 | T18891 | nsubj | IKKβ,is |
| R15181 | T18958 | T18959 | det | this,phosphorylation |
| R15182 | T18959 | T18960 | nsubj | phosphorylation,is |
| R15183 | T18960 | T18957 | ccomp | is,found |
| R15184 | T18961 | T18963 | det | a,modulation |
| R15185 | T18962 | T18963 | amod | critical,modulation |
| R15186 | T18963 | T18960 | attr | modulation,is |
| R15187 | T18964 | T18963 | prep | for,modulation |
| R15188 | T18965 | T18967 | nmod | RPS3,translocation |
| R15189 | T18966 | T18967 | amod | nuclear,translocation |
| R15190 | T18967 | T18964 | pobj | translocation,for |
| R15191 | T18968 | T18967 | punct | (,translocation |
| R15192 | T18969 | T18967 | prep | via,translocation |
| R15193 | T18970 | T18969 | pobj | importin-α,via |
| R15194 | T18971 | T18967 | punct | ),translocation |
| R15195 | T18972 | T18967 | cc | and,translocation |
| R15196 | T18973 | T18963 | conj | engagement,modulation |
| R15197 | T18974 | T18973 | prep | in,engagement |
| R15198 | T18975 | T18977 | amod | specific,transcription |
| R15199 | T18976 | T18977 | compound | NF-κB,transcription |
| R15200 | T18977 | T18974 | pobj | transcription,in |
| R15201 | T18978 | T18957 | punct | .,found |
| R15202 | T18979 | T18982 | nsubjpass | CK2,shown |
| R15203 | T18980 | T18982 | auxpass | was,shown |
| R15204 | T18981 | T18982 | advmod | previously,shown |
| R15205 | T18982 | T18982 | ROOT | shown,shown |
| R15206 | T18983 | T18984 | aux | to,phosphorylate |
| R15207 | T18984 | T18982 | xcomp | phosphorylate,shown |
| R15208 | T18985 | T18984 | dobj | p65,phosphorylate |
| R15209 | T18986 | T18984 | cc | and,phosphorylate |
| R15210 | T18987 | T18988 | aux | to,bind |
| R15211 | T18988 | T18982 | advcl | bind,shown |
| R15212 | T18989 | T18988 | prep | to,bind |
| R15213 | T18990 | T18988 | cc | and,bind |
| R15214 | T18991 | T18992 | compound | phosphorylate,IKKβ41-43 |
| R15215 | T18992 | T18988 | conj | IKKβ41-43,bind |
| R15216 | T18993 | T18997 | punct | ",",ruled |
| R15217 | T18994 | T18997 | advmod | however,ruled |
| R15218 | T18995 | T18997 | punct | ",",ruled |
| R15219 | T18996 | T18997 | nsubj | we,ruled |
| R15220 | T18997 | T18982 | advcl | ruled,shown |
| R15221 | T18998 | T18997 | prt | out,ruled |
| R15222 | T18999 | T19000 | det | the,possibility |
| R15223 | T19000 | T18997 | dobj | possibility,ruled |
| R15224 | T19001 | T19006 | mark | that,account |
| R15225 | T19002 | T19004 | det | the,CK2 |
| R15226 | T19003 | T19004 | amod | IKKβ-bound,CK2 |
| R15227 | T19004 | T19006 | nsubj | CK2,account |
| R15228 | T19005 | T19006 | aux | could,account |
| R15229 | T19006 | T19000 | acl | account,possibility |
| R15230 | T19007 | T19006 | prep | for,account |
| R15231 | T19008 | T19011 | det | the,phosphorylation |
| R15232 | T19009 | T19011 | amod | observed,phosphorylation |
| R15233 | T19010 | T19011 | compound | RPS3,phosphorylation |
| R15234 | T19011 | T19007 | pobj | phosphorylation,for |
| R15235 | T19012 | T19016 | mark | because,detected |
| R15236 | T19013 | T19014 | det | no,CK2 |
| R15237 | T19014 | T19016 | nsubjpass | CK2,detected |
| R15313 | T19090 | T19082 | appos | H7,pathogenesis |
| R15314 | T19091 | T19064 | punct | .,elucidated |
| R15315 | T19092 | T19095 | amod | IKKβ-mediated,phosphorylation |
| R15316 | T19093 | T19095 | compound | RPS3,phosphorylation |
| R15317 | T19094 | T19095 | compound | S209,phosphorylation |
| R15318 | T19095 | T19096 | nsubj | phosphorylation,is |
| R15319 | T19096 | T19096 | ROOT | is,is |
| R15320 | T19097 | T19099 | det | a,target |
| R15321 | T19098 | T19099 | amod | critical,target |
| R15322 | T19099 | T19096 | attr | target,is |
| R15323 | T19100 | T19099 | acl | modulated,target |
| R15324 | T19101 | T19100 | agent | by,modulated |
| R15325 | T19102 | T19103 | det | this,pathogen |
| R15326 | T19103 | T19101 | pobj | pathogen,by |
| R15327 | T19104 | T19105 | aux | to,subvert |
| R15328 | T19105 | T19100 | advcl | subvert,modulated |
| R15329 | T19106 | T19105 | dobj | host,subvert |
| R15330 | T19107 | T19108 | compound | NF-κB,signaling |
| R15331 | T19108 | T19096 | advcl | signaling,is |
| R15332 | T19109 | T19096 | punct | .,is |
| R15333 | T19110 | T19115 | det | The,binds |
| R15334 | T19111 | T19112 | amod | bacterial,effector |
| R15335 | T19112 | T19115 | nsubj | effector,binds |
| R15336 | T19113 | T19112 | appos | NleH1,effector |
| R15337 | T19114 | T19115 | advmod | specifically,binds |
| R15338 | T19115 | T19119 | nsubj | binds,injected |
| R15339 | T19116 | T19115 | prep | to,binds |
| R15340 | T19117 | T19116 | pobj | RPS3,to |
| R15341 | T19118 | T19119 | advmod | once,injected |
| R15342 | T19119 | T19119 | ROOT | injected,injected |
| R15343 | T19120 | T19119 | prep | into,injected |
| R15344 | T19121 | T19122 | compound | host,cells |
| R15345 | T19122 | T19120 | pobj | cells,into |
| R15346 | T19123 | T19119 | cc | and,injected |
| R15347 | T19124 | T19125 | advmod | profoundly,suppresses |
| R15348 | T19125 | T19119 | conj | suppresses,injected |
| R15349 | T19126 | T19125 | dobj | NF-κB,suppresses |
| R15350 | T19127 | T19126 | cc | and,NF-κB |
| R15351 | T19128 | T19132 | poss | its,responses9 |
| R15352 | T19129 | T19132 | amod | attendant,responses9 |
| R15353 | T19130 | T19132 | amod | protective,responses9 |
| R15354 | T19131 | T19132 | amod | immune,responses9 |
| R15355 | T19132 | T19126 | conj | responses9,NF-κB |
| R15356 | T19133 | T19119 | punct | .,injected |
| R15357 | T19134 | T19135 | poss | Our,data |
| R15358 | T19135 | T19137 | nsubj | data,show |
| R15359 | T19136 | T19137 | advmod | now,show |
| R15360 | T19137 | T19137 | ROOT | show,show |
| R15361 | T19138 | T19141 | mark | that,inhibits |
| R15362 | T19139 | T19141 | nsubj | NleH1,inhibits |
| R15363 | T19140 | T19141 | advmod | selectively,inhibits |
| R15364 | T19141 | T19137 | ccomp | inhibits,show |
| R15365 | T19142 | T19143 | nummod | RPS3,phosphorylation |
| R15366 | T19143 | T19141 | dobj | phosphorylation,inhibits |
| R15367 | T19144 | T19141 | punct | ",",inhibits |
| R15114 | T18891 | T18891 | ROOT | is,is |
| R15115 | T18892 | T18894 | det | the,kinase |
| R15116 | T18893 | T18894 | amod | major,kinase |
| R15117 | T18894 | T18891 | attr | kinase,is |
| R15118 | T18895 | T18896 | nsubj | that,phosphorylates |
| R15119 | T18896 | T18894 | relcl | phosphorylates,kinase |
| R15120 | T18897 | T18896 | dobj | IκBs,phosphorylates |
| R15121 | T18898 | T18897 | prep | in,IκBs |
| R15122 | T18899 | T18902 | det | the,pathway |
| R15123 | T18900 | T18902 | amod | classical,pathway |
| R15124 | T18901 | T18902 | compound | NF-κB,pathway |
| R15125 | T18902 | T18898 | pobj | pathway,in |
| R15126 | T18903 | T18891 | punct | ",",is |
| R15127 | T18904 | T18891 | advcl | leading,is |
| R15128 | T18905 | T18904 | prep | to,leading |
| R15129 | T18906 | T18908 | poss | their,degradation40 |
| R15130 | T18907 | T18908 | amod | subsequent,degradation40 |
| R15131 | T18908 | T18905 | pobj | degradation40,to |
| R15132 | T18909 | T18891 | punct | .,is |
| R15133 | T18910 | T18913 | advmod | Strikingly,possesses |
| R15134 | T18911 | T18913 | punct | ",",possesses |
| R15135 | T18912 | T18913 | nsubj | RPS3,possesses |
| R15136 | T18913 | T18924 | ccomp | possesses,centered |
| R15137 | T18914 | T18913 | neg | not,possesses |
| R15138 | T18915 | T18918 | det | any,motif |
| R15139 | T18916 | T18918 | compound | consensus,motif |
| R15140 | T18917 | T18918 | compound | IKK,motif |
| R15141 | T18918 | T18913 | dobj | motif,possesses |
| R15142 | T18919 | T18924 | punct | ;,centered |
| R15143 | T18920 | T18924 | advmod | instead,centered |
| R15144 | T18921 | T18924 | punct | ",",centered |
| R15145 | T18922 | T18924 | nsubjpass | S209,centered |
| R15146 | T18923 | T18924 | auxpass | is,centered |
| R15147 | T18924 | T18924 | ROOT | centered,centered |
| R15148 | T18925 | T18924 | prep | in,centered |
| R15149 | T18926 | T18929 | det | a,motif |
| R15150 | T18927 | T18929 | compound | consensus,motif |
| R15151 | T18928 | T18929 | compound | CK2,motif |
| R15152 | T18929 | T18925 | pobj | motif,in |
| R15153 | T18930 | T18924 | punct | .,centered |
| R15154 | T18931 | T18933 | det | The,observation |
| R15155 | T18932 | T18933 | amod | recent,observation |
| R15156 | T18933 | T18933 | ROOT | observation,observation |
| R15157 | T18934 | T18937 | dobj | that,displayed |
| R15158 | T18935 | T18936 | compound | human,IKKβ |
| R15159 | T18936 | T18937 | nsubj | IKKβ,displayed |
| R15160 | T18937 | T18933 | relcl | displayed,observation |
| R15161 | T18938 | T18939 | amod | CK2-like,phosphorylation |
| R15162 | T18939 | T18933 | appos | phosphorylation,observation |
| R15238 | T19015 | T19016 | auxpass | was,detected |
| R15239 | T19016 | T19006 | advcl | detected,account |
| R15240 | T19017 | T19016 | prep | in,detected |
| R15241 | T19018 | T19020 | det | the,preparations |
| R15242 | T19019 | T19020 | compound | IKKβ,preparations |
| R15243 | T19020 | T19017 | pobj | preparations,in |
| R15244 | T19021 | T19020 | acl | used,preparations |
| R15245 | T19022 | T19021 | prep | for,used |
| R15246 | T19023 | T19027 | det | the,assay |
| R15247 | T19024 | T19027 | nmod | in,assay |
| R15248 | T19025 | T19027 | amod | vitro,assay |
| R15249 | T19026 | T19027 | compound | kinase,assay |
| R15250 | T19027 | T19022 | pobj | assay,for |
| R15251 | T19028 | T18982 | punct | .,shown |
| R15252 | T19029 | T19032 | mark | Because,harbors |
| R15253 | T19030 | T19032 | nsubj | RPS3,harbors |
| R15254 | T19031 | T19032 | advmod | only,harbors |
| R15255 | T19032 | T19048 | advcl | harbors,explain |
| R15256 | T19033 | T19035 | det | the,motif |
| R15257 | T19034 | T19035 | compound | CK2,motif |
| R15258 | T19035 | T19032 | dobj | motif,harbors |
| R15259 | T19036 | T19035 | cc | and,motif |
| R15260 | T19037 | T19041 | neg | not,motif |
| R15261 | T19038 | T19041 | det | a,motif |
| R15262 | T19039 | T19041 | amod | traditional,motif |
| R15263 | T19040 | T19041 | compound | IKK,motif |
| R15264 | T19041 | T19035 | conj | motif,motif |
| R15265 | T19042 | T19048 | punct | ",",explain |
| R15266 | T19043 | T19046 | det | this,function |
| R15267 | T19044 | T19046 | amod | RPS3,function |
| R15268 | T19045 | T19046 | amod | regulatory,function |
| R15269 | T19046 | T19048 | nsubj | function,explain |
| R15270 | T19047 | T19048 | aux | could,explain |
| R15271 | T19048 | T19048 | ROOT | explain,explain |
| R15272 | T19049 | T19051 | advmod | why,harbors |
| R15273 | T19050 | T19051 | nsubj | IKK,harbors |
| R15274 | T19051 | T19048 | ccomp | harbors,explain |
| R15275 | T19052 | T19056 | det | the,capability |
| R15276 | T19053 | T19056 | amod | alternative,capability |
| R15277 | T19054 | T19056 | compound | substrate,capability |
| R15278 | T19055 | T19056 | compound | phosphorylation,capability |
| R15279 | T19056 | T19051 | dobj | capability,harbors |
| R15280 | T19057 | T19048 | punct | .,explain |
| R15281 | T19058 | T19059 | advmod | More,importantly |
| R15282 | T19059 | T19064 | advmod | importantly,elucidated |
| R15283 | T19060 | T19064 | punct | ",",elucidated |
| R15284 | T19061 | T19062 | poss | our,study |
| R15285 | T19062 | T19064 | nsubj | study,elucidated |
| R15286 | T19063 | T19064 | aux | has,elucidated |
| R15287 | T19064 | T19064 | ROOT | elucidated,elucidated |
| R15288 | T19065 | T19069 | advmod | how,integrated |
| R15289 | T19066 | T19069 | nsubjpass | RPS3,integrated |
| R15290 | T19067 | T19069 | auxpass | is,integrated |
| R15291 | T19068 | T19069 | advmod | biochemically,integrated |
| R15292 | T19069 | T19064 | ccomp | integrated,elucidated |
| R15293 | T19070 | T19069 | prep | into,integrated |
| R15294 | T19071 | T19072 | amod | NF-κB,activation |
| R15295 | T19072 | T19070 | pobj | activation,into |
| R15296 | T19073 | T19069 | advcl | signaling,integrated |
| R15297 | T19074 | T19073 | prep | in,signaling |
| R15298 | T19075 | T19076 | det | a,manner |
| R15299 | T19076 | T19074 | pobj | manner,in |
| R15300 | T19077 | T19078 | nsubj | that,is |
| R15301 | T19078 | T19076 | relcl | is,manner |
| R15302 | T19079 | T19078 | acomp | pivotal,is |
| R15303 | T19080 | T19079 | prep | for,pivotal |
| R15304 | T19081 | T19082 | det | the,pathogenesis |
| R15305 | T19082 | T19080 | pobj | pathogenesis,for |
| R15306 | T19083 | T19082 | prep | of,pathogenesis |
| R15307 | T19084 | T19087 | compound | foodborne,coli |
| R15308 | T19085 | T19087 | compound | pathogen,coli |
| R15309 | T19086 | T19087 | compound | E.,coli |
| R15310 | T19087 | T19088 | compound | coli,O157 |
| R15311 | T19088 | T19083 | pobj | O157,of |
| R15312 | T19089 | T19082 | punct | :,pathogenesis |
| R15388 | T19165 | T19166 | advmod | directly,phosphorylate |
| R15389 | T19166 | T19173 | advcl | phosphorylate,required |
| R15390 | T19167 | T19166 | dobj | IKKβ,phosphorylate |
| R15391 | T19168 | T19173 | punct | ",",required |
| R15392 | T19169 | T19171 | poss | its,activity |
| R15393 | T19170 | T19171 | compound | kinase,activity |
| R15394 | T19171 | T19173 | nsubjpass | activity,required |
| R15395 | T19172 | T19173 | auxpass | was,required |
| R15396 | T19173 | T19173 | ROOT | required,required |
| R15397 | T19174 | T19175 | aux | to,inhibit |
| R15398 | T19175 | T19173 | advcl | inhibit,required |
| R15399 | T19176 | T19179 | amod | IKKβ-mediated,phosphorylation |
| R15400 | T19177 | T19179 | compound | RPS3,phosphorylation |
| R15401 | T19178 | T19179 | compound | S209,phosphorylation |
| R15402 | T19179 | T19175 | dobj | phosphorylation,inhibit |
| R15403 | T19180 | T19173 | punct | .,required |
| R15404 | T19181 | T19182 | amod | Many,bacteria |
| R15405 | T19182 | T19183 | compound | bacteria,pathogens |
| R15406 | T19183 | T19184 | nsubj | pathogens,have |
| R15407 | T19184 | T19184 | ROOT | have,have |
| R15408 | T19185 | T19184 | dobj | products,have |
| R15409 | T19186 | T19187 | nsubj | that,target |
| R15410 | T19187 | T19185 | relcl | target,products |
| R15411 | T19188 | T19189 | amod | key,kinases |
| R15412 | T19189 | T19187 | dobj | kinases,target |
| R15413 | T19190 | T19191 | aux | to,inactivate |
| R15414 | T19191 | T19187 | advcl | inactivate,target |
| R15415 | T19192 | T19191 | dobj | them,inactivate |
| R15416 | T19193 | T19191 | prep | in,inactivate |
| R15417 | T19194 | T19195 | compound | host,cells |
| R15418 | T19195 | T19193 | pobj | cells,in |
| R15419 | T19196 | T19184 | punct | ",",have |
| R15420 | T19197 | T19203 | mark | whereas,employed |
| R15421 | T19198 | T19200 | compound | E.,O157 |
| R15368 | T19145 | T19146 | advmod | thus,retarding |
| R15369 | T19146 | T19141 | advcl | retarding,inhibits |
| R15370 | T19147 | T19149 | poss | its,translocation |
| R15371 | T19148 | T19149 | amod | nuclear,translocation |
| R15372 | T19149 | T19146 | dobj | translocation,retarding |
| R15373 | T19150 | T19149 | cc | and,translocation |
| R15374 | T19151 | T19153 | amod | subsequent,function |
| R15375 | T19152 | T19153 | compound | NF-κB,function |
| R15376 | T19153 | T19149 | conj | function,translocation |
| R15377 | T19154 | T19146 | punct | ",",retarding |
| R15378 | T19155 | T19146 | prep | without,retarding |
| R15379 | T19156 | T19155 | pcomp | altering,without |
| R15380 | T19157 | T19159 | amod | other,signaling |
| R15381 | T19158 | T19159 | amod | NF-κB,signaling |
| R15382 | T19159 | T19141 | advcl | signaling,inhibits |
| R15383 | T19160 | T19137 | punct | .,show |
| R15384 | T19161 | T19166 | mark | Although,phosphorylate |
| R15385 | T19162 | T19166 | nsubj | NleH1,phosphorylate |
| R15386 | T19163 | T19166 | aux | did,phosphorylate |
| R15387 | T19164 | T19166 | neg | not,phosphorylate |
| R15463 | T19240 | T19240 | ROOT | provide,provide |
| R15464 | T19241 | T19242 | amod | new,insights |
| R15465 | T19242 | T19240 | dobj | insights,provide |
| R15466 | T19243 | T19242 | prep | into,insights |
| R15467 | T19244 | T19248 | det | the,mechanism |
| R15468 | T19245 | T19246 | advmod | poorly,understood |
| R15469 | T19246 | T19248 | amod | understood,mechanism |
| R15470 | T19247 | T19248 | compound | action,mechanism |
| R15471 | T19248 | T19243 | pobj | mechanism,into |
| R15472 | T19249 | T19240 | prep | for,provide |
| R15473 | T19250 | T19252 | amod | most,effectors |
| R15474 | T19251 | T19252 | nummod | T3SS,effectors |
| R15475 | T19252 | T19249 | pobj | effectors,for |
| R15476 | T19253 | T19240 | punct | .,provide |
| R15477 | T19254 | T19255 | nummod | NleH1,attenuates |
| R15478 | T19255 | T19255 | ROOT | attenuates,attenuates |
| R15479 | T19256 | T19257 | det | the,transcription |
| R15480 | T19257 | T19255 | dobj | transcription,attenuates |
| R15481 | T19258 | T19257 | prep | of,transcription |
| R15482 | T19259 | T19258 | pobj | RPS3-dependent,of |
| R15483 | T19260 | T19255 | punct | ",",attenuates |
| R15484 | T19261 | T19255 | cc | but,attenuates |
| R15485 | T19262 | T19263 | neg | not,all |
| R15486 | T19263 | T19255 | conj | all,attenuates |
| R15487 | T19264 | T19267 | punct | ",",genes |
| R15488 | T19265 | T19267 | amod | NF-κB,genes |
| R15489 | T19266 | T19267 | compound | target,genes |
| R15490 | T19267 | T19255 | conj | genes,attenuates |
| R15491 | T19268 | T19267 | punct | ",",genes |
| R15492 | T19269 | T19272 | prep | in,genes |
| R15493 | T19270 | T19269 | amod | particular,in |
| R15494 | T19271 | T19272 | det | those,genes |
| R15495 | T19272 | T19267 | conj | genes,genes |
| R15496 | T19273 | T19272 | acl | associated,genes |
| R15497 | T19274 | T19273 | prep | with,associated |
| R15498 | T19275 | T19277 | amod | acute,responses |
| R15499 | T19276 | T19277 | amod | proinflammatory,responses |
| R15500 | T19277 | T19274 | pobj | responses,with |
| R15501 | T19278 | T19277 | punct | ",",responses |
| R15502 | T19279 | T19277 | prep | including,responses |
| R15503 | T19280 | T19279 | pobj | IL8,including |
| R15504 | T19281 | T19280 | cc | and,IL8 |
| R15505 | T19282 | T19280 | conj | TNF,IL8 |
| R15506 | T19283 | T19255 | punct | .,attenuates |
| R15507 | T19284 | T19290 | prep | In,block |
| R15508 | T19285 | T19284 | pobj | contrast,In |
| R15509 | T19286 | T19290 | punct | ",",block |
| R15510 | T19287 | T19290 | nsubj | NleH1,block |
| R15511 | T19288 | T19290 | aux | does,block |
| R15512 | T19289 | T19290 | neg | not,block |
| R15513 | T19290 | T19290 | ROOT | block,block |
| R15514 | T19291 | T19294 | nmod | NF-κB,translocation |
| R15515 | T19292 | T19291 | nummod | p65,NF-κB |
| R15516 | T19293 | T19294 | amod | nuclear,translocation |
| R15517 | T19294 | T19290 | dobj | translocation,block |
| R15518 | T19295 | T19294 | punct | ",",translocation |
| R15519 | T19296 | T19297 | nsubj | which,suggests |
| R15520 | T19297 | T19294 | relcl | suggests,translocation |
| R15521 | T19298 | T19308 | mark | that,be |
| R15522 | T19299 | T19305 | amod | certain,genes |
| R15523 | T19300 | T19304 | nmod | p65-dependent,target |
| R15524 | T19301 | T19300 | cc | but,p65-dependent |
| R15525 | T19302 | T19300 | conj | RPS3-independent,p65-dependent |
| R15526 | T19303 | T19304 | compound | NF-κB,target |
| R15527 | T19304 | T19305 | compound | target,genes |
| R15528 | T19305 | T19308 | nsubj | genes,be |
| R15529 | T19306 | T19308 | aux | might,be |
| R15530 | T19307 | T19308 | advmod | thus,be |
| R15531 | T19308 | T19297 | ccomp | be,suggests |
| R15532 | T19309 | T19308 | acomp | beneficial,be |
| R15533 | T19310 | T19309 | prep | for,beneficial |
| R15534 | T19311 | T19313 | compound | E.,O157 |
| R15535 | T19312 | T19313 | compound | coli,O157 |
| R15536 | T19313 | T19310 | pobj | O157,for |
| R15537 | T19314 | T19294 | punct | :,translocation |
| R16114 | T20213 | T20224 | nsubj | Cells,were |
| R16115 | T20214 | T20213 | cc | and,Cells |
| R16116 | T20215 | T20223 | nmod | Reagents,cells |
| R16117 | T20216 | T20217 | compound | Jurkat,E6 |
| R16118 | T20217 | T20215 | dobj | E6,Reagents |
| R16119 | T20218 | T20217 | appos | .1,E6 |
| R16120 | T20219 | T20217 | punct | ",",E6 |
| R16121 | T20220 | T20217 | appos | HEK293T,E6 |
| R16122 | T20221 | T20217 | cc | and,E6 |
| R16123 | T20222 | T20217 | conj | HeLa,E6 |
| R16124 | T20223 | T20213 | conj | cells,Cells |
| R16125 | T20224 | T20224 | ROOT | were,were |
| R16126 | T20225 | T20224 | acomp | cultured,were |
| R16127 | T20226 | T20225 | prep | in,cultured |
| R16128 | T20227 | T20228 | compound | RPMI,1640 |
| R16129 | T20228 | T20226 | pobj | 1640,in |
| R16130 | T20229 | T20224 | cc | and,were |
| R16131 | T20230 | T20231 | nsubj | DMEM,supplemented |
| R16132 | T20231 | T20224 | conj | supplemented,were |
| R16133 | T20232 | T20231 | prep | with,supplemented |
| R16134 | T20233 | T20234 | nummod | 10,% |
| R16135 | T20234 | T20237 | compound | %,serum |
| R16136 | T20235 | T20236 | amod | fetal,calf |
| R15422 | T19199 | T19200 | compound | coli,O157 |
| R15423 | T19200 | T19203 | nsubj | O157,employed |
| R15424 | T19201 | T19200 | punct | :,O157 |
| R15425 | T19202 | T19203 | nsubj | H7,employed |
| R15426 | T19203 | T19184 | advcl | employed,have |
| R15427 | T19204 | T19203 | dobj | NleH1,employed |
| R15428 | T19205 | T19206 | aux | to,steer |
| R15429 | T19206 | T19203 | advcl | steer,employed |
| R15430 | T19207 | T19209 | det | the,specificity |
| R15431 | T19208 | T19209 | compound | substrate,specificity |
| R15432 | T19209 | T19206 | dobj | specificity,steer |
| R15433 | T19210 | T19209 | prep | of,specificity |
| R15434 | T19211 | T19210 | pobj | IKKβ,of |
| R15435 | T19212 | T19214 | advmod | thus,fine-tuning |
| R15436 | T19213 | T19214 | advmod | specifically,fine-tuning |
| R15437 | T19214 | T19215 | advmod | fine-tuning,host |
| R15438 | T19215 | T19217 | dep | host,signaling |
| R15439 | T19216 | T19217 | compound | NF-κB,signaling |
| R15440 | T19217 | T19203 | advcl | signaling,employed |
| R15441 | T19218 | T19184 | punct | .,have |
| R15442 | T19219 | T19221 | nsubj | This,represent |
| R15443 | T19220 | T19221 | aux | could,represent |
| R15444 | T19221 | T19221 | ROOT | represent,represent |
| R15445 | T19222 | T19224 | det | a,strategy |
| R15446 | T19223 | T19224 | compound | novel,strategy |
| R15447 | T19224 | T19221 | dobj | strategy,represent |
| R15448 | T19225 | T19226 | aux | to,fine-tune |
| R15449 | T19226 | T19224 | acl | fine-tune,strategy |
| R15450 | T19227 | T19228 | compound | host,NF-κB |
| R15451 | T19228 | T19226 | dobj | NF-κB,fine-tune |
| R15452 | T19229 | T19221 | advcl | signaling,represent |
| R15453 | T19230 | T19233 | nsubjpass | that,shared |
| R15454 | T19231 | T19233 | aux | could,shared |
| R15455 | T19232 | T19233 | auxpass | be,shared |
| R15456 | T19233 | T19229 | ccomp | shared,signaling |
| R15457 | T19234 | T19233 | agent | by,shared |
| R15458 | T19235 | T19236 | amod | other,pathogens |
| R15459 | T19236 | T19234 | pobj | pathogens,by |
| R15460 | T19237 | T19221 | punct | .,represent |
| R15461 | T19238 | T19239 | det | These,data |
| R15462 | T19239 | T19240 | nsubj | data,provide |
| R15538 | T19315 | T19294 | appos | H7,translocation |
| R15539 | T19316 | T19317 | aux | to,replicate |
| R15540 | T19317 | T19290 | advcl | replicate,block |
| R15541 | T19318 | T19317 | cc | and,replicate |
| R15542 | T19319 | T19317 | conj | disseminate,replicate |
| R15543 | T19320 | T19319 | prep | in,disseminate |
| R15544 | T19321 | T19322 | det | the,host |
| R15545 | T19322 | T19320 | pobj | host,in |
| R15546 | T19323 | T19290 | punct | .,block |
| R15547 | T19324 | T19338 | prep | By,achieves |
| R15548 | T19325 | T19326 | advmod | selectively,inhibiting |
| R15549 | T19326 | T19324 | pcomp | inhibiting,By |
| R15550 | T19327 | T19326 | dobj | RPS3,inhibiting |
| R15551 | T19328 | T19327 | cc | and,RPS3 |
| R15552 | T19329 | T19332 | poss | its,function |
| R15553 | T19330 | T19332 | amod | attendant,function |
| R15554 | T19331 | T19332 | compound | NF-κB,function |
| R15555 | T19332 | T19327 | conj | function,RPS3 |
| R15556 | T19333 | T19326 | prep | with,inhibiting |
| R15557 | T19334 | T19333 | pobj | NleH1,with |
| R15558 | T19335 | T19338 | punct | ",",achieves |
| R15559 | T19336 | T19337 | det | the,pathogen |
| R15560 | T19337 | T19338 | nsubj | pathogen,achieves |
| R15561 | T19338 | T19338 | ROOT | achieves,achieves |
| R15562 | T19339 | T19340 | det | the,ability |
| R15563 | T19340 | T19338 | dobj | ability,achieves |
| R15564 | T19341 | T19342 | aux | to,increase |
| R15565 | T19342 | T19340 | acl | increase,ability |
| R15566 | T19343 | T19342 | dobj | colonization,increase |
| R15567 | T19344 | T19343 | cc | and,colonization |
| R15568 | T19345 | T19343 | conj | diarrhea,colonization |
| R15569 | T19346 | T19347 | advmod | yet,limiting |
| R15570 | T19347 | T19338 | advcl | limiting,achieves |
| R15571 | T19348 | T19349 | det | the,mortality |
| R15572 | T19349 | T19347 | dobj | mortality,limiting |
| R15573 | T19350 | T19349 | prep | of,mortality |
| R15574 | T19351 | T19352 | det | the,host |
| R15575 | T19352 | T19350 | pobj | host,of |
| R15576 | T19353 | T19338 | punct | .,achieves |
| R15577 | T19354 | T19357 | det | This,combination |
| R15578 | T19355 | T19356 | advmod | seemingly,paradoxical |
| R15579 | T19356 | T19357 | amod | paradoxical,combination |
| R15580 | T19357 | T19360 | nsubj | combination,make |
| R15581 | T19358 | T19357 | prep | of,combination |
| R15582 | T19359 | T19358 | pobj | effects,of |
| R15583 | T19360 | T19360 | ROOT | make,make |
| R15584 | T19361 | T19360 | dobj | sense,make |
| R15585 | T19362 | T19364 | advmod | when,considers |
| R15586 | T19363 | T19364 | nsubj | one,considers |
| R15587 | T19364 | T19360 | advcl | considers,make |
| R15588 | T19365 | T19379 | mark | that,promote |
| R15589 | T19366 | T19368 | amod | increased,load |
| R15590 | T19367 | T19368 | amod | bacterial,load |
| R15591 | T19368 | T19379 | nsubj | load,promote |
| R15592 | T19369 | T19368 | cc | and,load |
| R15593 | T19370 | T19368 | conj | diarrhea,load |
| R15594 | T19371 | T19372 | advmod | together,with |
| R15595 | T19372 | T19368 | prep | with,load |
| R15596 | T19373 | T19372 | pobj | survival,with |
| R15597 | T19374 | T19373 | prep | of,survival |
| R15598 | T19375 | T19377 | det | the,host |
| R15599 | T19376 | T19377 | amod | infected,host |
| R15600 | T19377 | T19374 | pobj | host,of |
| R15601 | T19378 | T19379 | aux | would,promote |
| R15602 | T19379 | T19364 | ccomp | promote,considers |
| R15603 | T19380 | T19381 | det | the,spreading |
| R15604 | T19381 | T19379 | dobj | spreading,promote |
| R15605 | T19382 | T19381 | prep | of,spreading |
| R15606 | T19383 | T19384 | det | the,bacteria |
| R15607 | T19384 | T19382 | pobj | bacteria,of |
| R15608 | T19385 | T19381 | prep | among,spreading |
| R15609 | T19386 | T19387 | det | a,population |
| R15610 | T19387 | T19385 | pobj | population,among |
| R15611 | T19388 | T19387 | prep | of,population |
| R15612 | T19389 | T19390 | amod | susceptible,individuals |
| R15613 | T19390 | T19388 | pobj | individuals,of |
| R15614 | T19391 | T19360 | punct | .,make |
| R15615 | T19392 | T19393 | amod | Such,complex |
| R15616 | T19393 | T19404 | nsubj | complex,are |
| R15617 | T19394 | T19393 | cc | and,complex |
| R15618 | T19395 | T19397 | amod | paradoxical,effects |
| R15619 | T19396 | T19397 | amod | pathological,effects |
| R15620 | T19397 | T19393 | conj | effects,complex |
| R15649 | T19426 | T19425 | dobj | RPS3,impeding |
| R15650 | T19427 | T19417 | punct | ",",alterations |
| R15651 | T19428 | T19417 | cc | but,alterations |
| R15652 | T19429 | T19430 | neg | not,altering |
| R15653 | T19430 | T19436 | advcl | altering,influence |
| R15654 | T19431 | T19433 | nummod | p65,translocation |
| R15655 | T19432 | T19433 | amod | nuclear,translocation |
| R15656 | T19433 | T19430 | dobj | translocation,altering |
| R15657 | T19434 | T19436 | punct | ",",influence |
| R15658 | T19435 | T19436 | aux | can,influence |
| R15659 | T19436 | T19415 | ccomp | influence,elucidate |
| R15660 | T19437 | T19438 | amod | specific,cytokines |
| R15661 | T19438 | T19436 | dobj | cytokines,influence |
| R15662 | T19439 | T19440 | nsubj | that,affect |
| R15663 | T19440 | T19438 | relcl | affect,cytokines |
| R15664 | T19441 | T19442 | amod | bacterial,colonization |
| R15665 | T19442 | T19440 | dobj | colonization,affect |
| R15666 | T19443 | T19442 | punct | ",",colonization |
| R15667 | T19444 | T19445 | compound | diarrhea,diseases |
| R15668 | T19445 | T19442 | conj | diseases,colonization |
| R15669 | T19446 | T19445 | cc | and,diseases |
| R15670 | T19447 | T19445 | conj | mortality,diseases |
| R15671 | T19448 | T19415 | punct | .,elucidate |
| R15672 | T19449 | T19451 | nsubj | It,be |
| R15673 | T19450 | T19451 | aux | may,be |
| R15674 | T19451 | T19451 | ROOT | be,be |
| R15675 | T19452 | T19451 | acomp | fruitful,be |
| R15676 | T19453 | T19451 | prep | in,be |
| R15677 | T19454 | T19453 | pcomp | attempting,in |
| R15678 | T19455 | T19456 | aux | to,understand |
| R15679 | T19456 | T19454 | xcomp | understand,attempting |
| R15680 | T19457 | T19461 | amod | other,diseases |
| R15681 | T19458 | T19461 | amod | infectious,diseases |
| R15682 | T19459 | T19458 | cc | and,infectious |
| R16137 | T20236 | T20237 | compound | calf,serum |
| R16138 | T20237 | T20232 | pobj | serum,with |
| R16139 | T20238 | T20237 | punct | ",",serum |
| R16140 | T20239 | T20241 | nummod | 2,glutamine |
| R16141 | T20240 | T20241 | compound | mM,glutamine |
| R16142 | T20241 | T20237 | conj | glutamine,serum |
| R16143 | T20242 | T20241 | punct | ",",glutamine |
| R16144 | T20243 | T20241 | cc | and,glutamine |
| R16145 | T20244 | T20245 | nummod | 100,U/ml |
| R16146 | T20245 | T20241 | conj | U/ml,glutamine |
| R16147 | T20246 | T20245 | npadvmod | each,U/ml |
| R16148 | T20247 | T20246 | prep | of,each |
| R16149 | T20248 | T20247 | pobj | penicillin,of |
| R16150 | T20249 | T20248 | cc | and,penicillin |
| R16151 | T20250 | T20248 | conj | streptomycin,penicillin |
| R16152 | T20251 | T20246 | punct | ",",each |
| R16153 | T20252 | T20246 | conj | respectively,each |
| R16154 | T20253 | T20231 | punct | .,supplemented |
| R16155 | T20254 | T20256 | nmod | IκBα,C-21 |
| R16156 | T20255 | T20256 | punct | (,C-21 |
| R16157 | T20256 | T20276 | nsubj | C-21,were |
| R16158 | T20257 | T20256 | punct | ",",C-21 |
| R16159 | T20258 | T20256 | amod | sc-371,C-21 |
| R16160 | T20259 | T20258 | punct | ),sc-371 |
| R16161 | T20260 | T20256 | punct | ",",C-21 |
| R16162 | T20261 | T20256 | conj | p65,C-21 |
| R16163 | T20262 | T20261 | punct | (,p65 |
| R16239 | T20338 | T20337 | punct | (,IKKβ |
| R16240 | T20339 | T20337 | appos | 24,IKKβ |
| R16241 | T20340 | T20337 | punct | ",",IKKβ |
| R16242 | T20341 | T20337 | appos | 611254,IKKβ |
| R16243 | T20342 | T20337 | punct | ),IKKβ |
| R16244 | T20343 | T20344 | nsubj | antibodies,were |
| R16245 | T20344 | T20363 | ccomp | were,were |
| R16246 | T20345 | T20344 | prep | from,were |
| R16247 | T20346 | T20347 | compound | BD,Pharmingen |
| R16248 | T20347 | T20345 | pobj | Pharmingen,from |
| R16249 | T20348 | T20363 | punct | ;,were |
| R16250 | T20349 | T20363 | nsubj | CK2α,were |
| R16251 | T20350 | T20351 | punct | (,31 |
| R16252 | T20351 | T20349 | nummod | 31,CK2α |
| R16253 | T20352 | T20349 | punct | ",",CK2α |
| R16254 | T20353 | T20349 | appos | 611610,CK2α |
| R16255 | T20354 | T20349 | punct | ),CK2α |
| R16256 | T20355 | T20349 | cc | and,CK2α |
| R16257 | T20356 | T20349 | conj | Hsp90,CK2α |
| R16258 | T20357 | T20356 | punct | (,Hsp90 |
| R16259 | T20358 | T20356 | appos | 68,Hsp90 |
| R16260 | T20359 | T20356 | punct | ",",Hsp90 |
| R16261 | T20360 | T20356 | appos | 610418,Hsp90 |
| R16262 | T20361 | T20356 | punct | ),Hsp90 |
| R16263 | T20362 | T20363 | nsubj | antibodies,were |
| R16264 | T20363 | T20385 | ccomp | were,were |
| R16265 | T20364 | T20363 | prep | from,were |
| R16266 | T20365 | T20367 | compound | BD,Laboratories |
| R16267 | T20366 | T20367 | compound | Transduction,Laboratories |
| R16268 | T20367 | T20364 | pobj | Laboratories,from |
| R16269 | T20368 | T20385 | punct | ;,were |
| R16270 | T20369 | T20385 | nsubj | phospho-IκBα,were |
| R16271 | T20370 | T20371 | punct | (,5A5 |
| R16272 | T20371 | T20369 | appos | 5A5,phospho-IκBα |
| R16273 | T20372 | T20371 | punct | ",",5A5 |
| R16274 | T20373 | T20371 | appos | 9246S,5A5 |
| R16275 | T20374 | T20371 | punct | ),5A5 |
| R16276 | T20375 | T20371 | cc | and,5A5 |
| R16277 | T20376 | T20378 | amod | phospho-IKKα,β |
| R16278 | T20377 | T20378 | compound | /,β |
| R16279 | T20378 | T20369 | conj | β,phospho-IκBα |
| R16280 | T20379 | T20380 | punct | (,16A6 |
| R16281 | T20380 | T20378 | appos | 16A6,β |
| R16282 | T20381 | T20380 | punct | ",",16A6 |
| R16283 | T20382 | T20380 | appos | 2697S,16A6 |
| R16284 | T20383 | T20380 | punct | ),16A6 |
| R16285 | T20384 | T20385 | nsubj | antibodies,were |
| R16286 | T20385 | T20403 | ccomp | were,were |
| R16287 | T20386 | T20385 | prep | from,were |
| R16288 | T20387 | T20389 | compound | Cell,Technology |
| R16289 | T20388 | T20389 | compound | Signaling,Technology |
| R16290 | T20389 | T20386 | pobj | Technology,from |
| R16291 | T20390 | T20403 | punct | ;,were |
| R16292 | T20391 | T20402 | nmod | phospho-serine,antibodies |
| R16293 | T20392 | T20393 | punct | (,AB1603 |
| R16294 | T20393 | T20391 | appos | AB1603,phospho-serine |
| R16295 | T20394 | T20393 | punct | ),AB1603 |
| R16296 | T20395 | T20391 | cc | and,phospho-serine |
| R16297 | T20396 | T20391 | conj | phospho-tyrosine,phospho-serine |
| R16298 | T20397 | T20398 | punct | (,4G10 |
| R16299 | T20398 | T20402 | nmod | 4G10,antibodies |
| R16300 | T20399 | T20398 | punct | ",",4G10 |
| R16301 | T20400 | T20398 | appos | 05-777,4G10 |
| R16302 | T20401 | T20398 | punct | ),4G10 |
| R16303 | T20402 | T20403 | nsubj | antibodies,were |
| R16304 | T20403 | T20403 | ROOT | were,were |
| R16305 | T20404 | T20403 | prep | from,were |
| R16306 | T20405 | T20404 | pobj | Millipore,from |
| R16307 | T20406 | T20403 | punct | .,were |
| R16308 | T20407 | T20411 | det | The,antiserum |
| R16309 | T20408 | T20411 | nmod | rabbit,antiserum |
| R16310 | T20409 | T20411 | compound | polyclonal,antiserum |
| R16311 | T20410 | T20411 | compound | RPS3,antiserum |
| R16312 | T20411 | T20412 | nsubj | antiserum,was |
| R16313 | T20412 | T20412 | ROOT | was,was |
| R16464 | T20647 | T20643 | punct | ",",Flag-IKKβ |
| R16465 | T20648 | T20643 | cc | and,Flag-IKKβ |
| R16466 | T20649 | T20643 | conj | HA-IκBα,Flag-IKKβ |
| R16467 | T20650 | T20651 | punct | (,SSAA |
| R16468 | T20651 | T20649 | appos | SSAA,HA-IκBα |
| R16469 | T20652 | T20649 | punct | ),HA-IκBα |
| R16470 | T20653 | T20655 | nsubjpass | constructs,provided |
| R16471 | T20654 | T20655 | auxpass | were,provided |
| R16472 | T20655 | T20655 | ROOT | provided,provided |
| R16473 | T20656 | T20655 | agent | by,provided |
| R16474 | T20657 | T20658 | compound | C.,Wu |
| R16475 | T20658 | T20656 | pobj | Wu,by |
| R16476 | T20659 | T20660 | punct | (,NCI |
| R16477 | T20660 | T20658 | appos | NCI,Wu |
| R16478 | T20661 | T20660 | punct | ",",NCI |
| R16479 | T20662 | T20660 | npadvmod | Bethesda,NCI |
| R16480 | T20663 | T20660 | punct | ),NCI |
| R16481 | T20664 | T20658 | cc | and,Wu |
| R16482 | T20665 | T20666 | compound | U.,Siebenlist |
| R15683 | T19460 | T19458 | conj | autoimmune,infectious |
| R15684 | T19461 | T19456 | dobj | diseases,understand |
| R15685 | T19462 | T19461 | acl | involving,diseases |
| R15686 | T19463 | T19462 | dobj | NF-κB,involving |
| R15687 | T19464 | T19465 | aux | to,consider |
| R15688 | T19465 | T19456 | advcl | consider,understand |
| R15689 | T19466 | T19467 | amod | selective,effects |
| R15690 | T19467 | T19465 | dobj | effects,consider |
| R15691 | T19468 | T19467 | prep | of,effects |
| R15692 | T19469 | T19468 | pobj | subunits,of |
| R15693 | T19470 | T19471 | amod | such,as |
| R15694 | T19471 | T19469 | prep | as,subunits |
| R15695 | T19472 | T19471 | pobj | RPS3,as |
| R15696 | T19473 | T19465 | prep | in,consider |
| R15697 | T19474 | T19473 | pobj | addition,in |
| R15698 | T19475 | T19474 | prep | to,addition |
| R15699 | T19476 | T19478 | amod | global,inhibition |
| R15700 | T19477 | T19478 | compound | NF-κB,inhibition |
| R15701 | T19478 | T19475 | pobj | inhibition,to |
| R15702 | T19479 | T19451 | punct | .,be |
| R16164 | T20263 | T20271 | nmod | C-20,H-2 |
| R16165 | T20264 | T20263 | punct | ",",C-20 |
| R16166 | T20265 | T20263 | conj | sc-372,C-20 |
| R16167 | T20266 | T20265 | punct | ),sc-372 |
| R16168 | T20267 | T20263 | punct | ",",C-20 |
| R16169 | T20268 | T20263 | cc | and,C-20 |
| R16170 | T20269 | T20263 | conj | phospho-threonine,C-20 |
| R16171 | T20270 | T20271 | punct | (,H-2 |
| R16172 | T20271 | T20261 | appos | H-2,p65 |
| R16173 | T20272 | T20271 | punct | ",",H-2 |
| R16174 | T20273 | T20271 | conj | sc-5267,H-2 |
| R16175 | T20274 | T20273 | punct | ),sc-5267 |
| R16176 | T20275 | T20271 | conj | antibodies,H-2 |
| R16177 | T20276 | T20318 | ccomp | were,were |
| R16178 | T20277 | T20276 | prep | from,were |
| R16179 | T20278 | T20279 | compound | Santa,Cruz |
| R16180 | T20279 | T20280 | compound | Cruz,Biotechnology |
| R16181 | T20280 | T20277 | pobj | Biotechnology,from |
| R16182 | T20281 | T20318 | punct | ;,were |
| R16183 | T20282 | T20318 | nsubj | β-actin,were |
| R16184 | T20283 | T20284 | punct | (,AC-15 |
| R16185 | T20284 | T20282 | appos | AC-15,β-actin |
| R16186 | T20285 | T20284 | punct | ",",AC-15 |
| R16187 | T20286 | T20284 | appos | A5441,AC-15 |
| R16188 | T20287 | T20284 | punct | ),AC-15 |
| R16189 | T20288 | T20284 | punct | ",",AC-15 |
| R16190 | T20289 | T20298 | nmod | Flag,HA-7 |
| R16191 | T20290 | T20291 | punct | (,M2 |
| R16192 | T20291 | T20289 | appos | M2,Flag |
| R16193 | T20292 | T20291 | punct | ",",M2 |
| R16194 | T20293 | T20291 | appos | F3165,M2 |
| R16195 | T20294 | T20291 | punct | ),M2 |
| R16196 | T20295 | T20289 | punct | ",",Flag |
| R16197 | T20296 | T20298 | nmod | HA,HA-7 |
| R16198 | T20297 | T20298 | punct | (,HA-7 |
| R16199 | T20298 | T20284 | conj | HA-7,AC-15 |
| R16200 | T20299 | T20298 | punct | ",",HA-7 |
| R16201 | T20300 | T20298 | conj | H3663,HA-7 |
| R16202 | T20301 | T20298 | punct | ),HA-7 |
| R16203 | T20302 | T20298 | punct | ",",HA-7 |
| R16204 | T20303 | T20298 | conj | importin-α,HA-7 |
| R16205 | T20304 | T20305 | punct | (,IM-75 |
| R16206 | T20305 | T20303 | appos | IM-75,importin-α |
| R16207 | T20306 | T20305 | punct | ",",IM-75 |
| R16208 | T20307 | T20305 | appos | I1784,IM-75 |
| R16209 | T20308 | T20305 | punct | ),IM-75 |
| R16210 | T20309 | T20305 | punct | ",",IM-75 |
| R16211 | T20310 | T20303 | cc | and,importin-α |
| R16212 | T20311 | T20303 | conj | importin-β,importin-α |
| R16213 | T20312 | T20317 | punct | (,antibodies |
| R16214 | T20313 | T20317 | nmod | 31H4,antibodies |
| R16215 | T20314 | T20313 | punct | ",",31H4 |
| R16216 | T20315 | T20313 | conj | I2534,31H4 |
| R16217 | T20316 | T20317 | punct | ),antibodies |
| R16218 | T20317 | T20284 | appos | antibodies,AC-15 |
| R16219 | T20318 | T20344 | ccomp | were,were |
| R16220 | T20319 | T20318 | prep | from,were |
| R16221 | T20320 | T20319 | pobj | Sigma,from |
| R16222 | T20321 | T20344 | punct | ;,were |
| R16223 | T20322 | T20343 | compound | PARP,antibodies |
| R16224 | T20323 | T20324 | punct | (,C2-10 |
| R16225 | T20324 | T20322 | appos | C2-10,PARP |
| R16226 | T20325 | T20324 | punct | ",",C2-10 |
| R16227 | T20326 | T20324 | appos | 556362,C2-10 |
| R16228 | T20327 | T20324 | punct | ),C2-10 |
| R16229 | T20328 | T20324 | punct | ",",C2-10 |
| R16230 | T20329 | T20324 | conj | IKKα,C2-10 |
| R16231 | T20330 | T20331 | punct | (,B78-1 |
| R16232 | T20331 | T20329 | appos | B78-1,IKKα |
| R16233 | T20332 | T20331 | punct | ",",B78-1 |
| R16234 | T20333 | T20331 | appos | 556532,B78-1 |
| R16235 | T20334 | T20331 | punct | ),B78-1 |
| R16236 | T20335 | T20329 | punct | ",",IKKα |
| R16237 | T20336 | T20329 | cc | and,IKKα |
| R16238 | T20337 | T20329 | conj | IKKβ,IKKα |
| R16314 | T20413 | T20414 | mark | as,described |
| R16315 | T20414 | T20415 | amod | described,previously6 |
| R16316 | T20415 | T20412 | attr | previously6,was |
| R16317 | T20416 | T20412 | punct | .,was |
| R16318 | T20417 | T20421 | det | The,specific |
| R16319 | T20418 | T20420 | nmod | rabbit,antibody |
| R16320 | T20419 | T20420 | compound | polyclonal,antibody |
| R16321 | T20420 | T20421 | compound | antibody,specific |
| R16322 | T20421 | T20424 | nsubj | specific,phosphorylated |
| R16323 | T20422 | T20421 | prep | for,specific |
| R16324 | T20423 | T20422 | pobj | S209,for |
| R16325 | T20424 | T20424 | ROOT | phosphorylated,phosphorylated |
| R16326 | T20425 | T20427 | nsubjpass | RPS3,generated |
| R16327 | T20426 | T20427 | auxpass | was,generated |
| R16328 | T20427 | T20424 | ccomp | generated,phosphorylated |
| R16329 | T20428 | T20427 | cc | and,generated |
| R16330 | T20429 | T20427 | conj | affinity,generated |
| R16331 | T20430 | T20429 | acl | purified,affinity |
| R16332 | T20431 | T20430 | agent | by,purified |
| R16333 | T20432 | T20433 | compound | Primm,Biotech |
| R16334 | T20433 | T20431 | pobj | Biotech,by |
| R16335 | T20434 | T20429 | conj | using,affinity |
| R16336 | T20435 | T20437 | det | the,NH2-CKPLPDHV |
| R16337 | T20436 | T20437 | compound | peptide,NH2-CKPLPDHV |
| R16338 | T20437 | T20434 | dobj | NH2-CKPLPDHV,using |
| R16339 | T20438 | T20437 | punct | (,NH2-CKPLPDHV |
| R16340 | T20439 | T20441 | nmod | Sp,IVE-COOH |
| R16341 | T20440 | T20441 | punct | ),IVE-COOH |
| R16342 | T20441 | T20437 | appos | IVE-COOH,NH2-CKPLPDHV |
| R16343 | T20442 | T20424 | punct | .,phosphorylated |
| R16452 | T20635 | T20636 | amod | Plasmid,Constructs |
| R16453 | T20636 | T20653 | nmod | Constructs,constructs |
| R16454 | T20637 | T20638 | det | The,Flag-IKKβ |
| R16455 | T20638 | T20653 | nmod | Flag-IKKβ,constructs |
| R16456 | T20639 | T20640 | punct | (,SSEE |
| R16457 | T20640 | T20638 | appos | SSEE,Flag-IKKβ |
| R16458 | T20641 | T20640 | punct | ),SSEE |
| R16459 | T20642 | T20638 | punct | ",",Flag-IKKβ |
| R16460 | T20643 | T20638 | conj | Flag-IKKβ,Flag-IKKβ |
| R16461 | T20644 | T20645 | punct | (,SSAA |
| R16462 | T20645 | T20643 | appos | SSAA,Flag-IKKβ |
| R16463 | T20646 | T20643 | punct | ),Flag-IKKβ |
| R16539 | T20722 | T20723 | compound | Change,Kit |
| R16540 | T20723 | T20719 | dobj | Kit,using |
| R16541 | T20724 | T20723 | punct | (,Kit |
| R16542 | T20725 | T20723 | appos | Stratagene,Kit |
| R16543 | T20726 | T20723 | punct | ),Kit |
| R16544 | T20727 | T20719 | prep | with,using |
| R16545 | T20728 | T20727 | pobj | primers,with |
| R16546 | T20729 | T20719 | advmod | forward,using |
| R16547 | T20730 | T20734 | nummod | 5,′ |
| R16548 | T20731 | T20733 | punct | ′,CTGCCTGACCACGTGGCCATTGTGGAACCCAAA-3 |
| R16549 | T20732 | T20733 | punct | -,CTGCCTGACCACGTGGCCATTGTGGAACCCAAA-3 |
| R16550 | T20733 | T20734 | compound | CTGCCTGACCACGTGGCCATTGTGGAACCCAAA-3,′ |
| R16551 | T20734 | T20719 | dobj | ′,using |
| R16552 | T20735 | T20715 | cc | and,generated |
| R16553 | T20736 | T20715 | conj | reverse,generated |
| R16554 | T20737 | T20740 | nummod | 5,TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3 |
| R16555 | T20738 | T20740 | punct | ′,TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3 |
| R16556 | T20739 | T20740 | punct | -,TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3 |
| R16557 | T20740 | T20741 | compound | TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3,′ |
| R16558 | T20741 | T20736 | dobj | ′,reverse |
| R16559 | T20742 | T20741 | prep | for,′ |
| R16483 | T20666 | T20658 | conj | Siebenlist,Wu |
| R16484 | T20667 | T20668 | punct | (,NIAID |
| R16485 | T20668 | T20666 | appos | NIAID,Siebenlist |
| R16486 | T20669 | T20668 | punct | ",",NIAID |
| R16487 | T20670 | T20668 | npadvmod | Bethesda,NIAID |
| R16488 | T20671 | T20668 | punct | ),NIAID |
| R16489 | T20672 | T20666 | punct | ",",Siebenlist |
| R16490 | T20673 | T20666 | advmod | respectively,Siebenlist |
| R16491 | T20674 | T20655 | punct | .,provided |
| R16492 | T20675 | T20676 | det | The,HA-IκBα |
| R16493 | T20676 | T20684 | nmod | HA-IκBα,plasmids |
| R16494 | T20677 | T20676 | cc | and,HA-IκBα |
| R16495 | T20678 | T20676 | conj | IKKβ,HA-IκBα |
| R16496 | T20679 | T20678 | punct | (,IKKβ |
| R16497 | T20680 | T20678 | appos | K44A,IKKβ |
| R16498 | T20681 | T20678 | punct | ),IKKβ |
| R16499 | T20682 | T20678 | punct | -,IKKβ |
| R16500 | T20683 | T20684 | compound | Flag,plasmids |
| R16501 | T20684 | T20686 | nsubjpass | plasmids,purchased |
| R16502 | T20685 | T20686 | auxpass | were,purchased |
| R16503 | T20686 | T20686 | ROOT | purchased,purchased |
| R16504 | T20687 | T20686 | prep | from,purchased |
| R16505 | T20688 | T20687 | pobj | Addgene44,from |
| R16506 | T20689 | T20688 | punct | ",",Addgene44 |
| R16507 | T20690 | T20688 | appos | 45,Addgene44 |
| R16508 | T20691 | T20686 | punct | .,purchased |
| R16509 | T20692 | T20693 | det | The,Flag-RPS3 |
| R16510 | T20693 | T20704 | nsubjpass | Flag-RPS3,described |
| R16511 | T20694 | T20693 | punct | ",",Flag-RPS3 |
| R16512 | T20695 | T20693 | appos | GST-RPS3,Flag-RPS3 |
| R16513 | T20696 | T20695 | punct | ",",GST-RPS3 |
| R16514 | T20697 | T20695 | conj | HA-RPS3,GST-RPS3 |
| R16515 | T20698 | T20697 | punct | ",",HA-RPS3 |
| R16516 | T20699 | T20697 | conj | VN-HA,HA-RPS3 |
| R16517 | T20700 | T20699 | punct | ",",VN-HA |
| R16518 | T20701 | T20702 | compound | NleH1-HA,plasmids |
| R16519 | T20702 | T20704 | nsubjpass | plasmids,described |
| R16520 | T20703 | T20704 | auxpass | were,described |
| R16521 | T20704 | T20704 | ROOT | described,described |
| R16522 | T20705 | T20704 | dobj | previously6,described |
| R16523 | T20706 | T20705 | punct | ",",previously6 |
| R16524 | T20707 | T20705 | conj | 9,previously6 |
| R16525 | T20708 | T20704 | punct | .,described |
| R16526 | T20709 | T20711 | det | The,mutants |
| R16527 | T20710 | T20711 | compound | point,mutants |
| R16528 | T20711 | T20715 | nsubjpass | mutants,generated |
| R16529 | T20712 | T20711 | prep | of,mutants |
| R16530 | T20713 | T20712 | pobj | RPS3,of |
| R16531 | T20714 | T20715 | auxpass | were,generated |
| R16532 | T20715 | T20715 | ROOT | generated,generated |
| R16533 | T20716 | T20715 | agent | by,generated |
| R16534 | T20717 | T20718 | amod | site-directed,mutagenesis |
| R16535 | T20718 | T20716 | pobj | mutagenesis,by |
| R16536 | T20719 | T20715 | advcl | using,generated |
| R16537 | T20720 | T20723 | det | the,Kit |
| R16538 | T20721 | T20723 | compound | Quick,Kit |
| R16841 | T21164 | T21166 | nsubjpass | proteins,purchased |
| R16842 | T21165 | T21166 | auxpass | were,purchased |
| R16843 | T21166 | T21166 | ROOT | purchased,purchased |
| R16844 | T21167 | T21166 | prep | from,purchased |
| R16845 | T21168 | T21169 | compound | Active,Motif |
| R16846 | T21169 | T21167 | pobj | Motif,from |
| R16847 | T21170 | T21169 | cc | and,Motif |
| R16848 | T21171 | T21169 | conj | Millipore,Motif |
| R16849 | T21172 | T21166 | punct | ",",purchased |
| R16850 | T21173 | T21166 | advmod | respectively,purchased |
| R16851 | T21174 | T21166 | punct | .,purchased |
| R16852 | T21175 | T21178 | advmod | Bacterially,S-transferase |
| R16853 | T21176 | T21178 | amod | purified,S-transferase |
| R16854 | T21177 | T21178 | compound | glutathione,S-transferase |
| R16855 | T21178 | T21198 | nsubjpass | S-transferase,used |
| R16856 | T21179 | T21180 | punct | (,GST |
| R16857 | T21180 | T21178 | appos | GST,S-transferase |
| R16858 | T21181 | T21180 | punct | ),GST |
| R16859 | T21182 | T21178 | punct | ",",S-transferase |
| R16860 | T21183 | T21178 | appos | GST-IκBα,S-transferase |
| R16861 | T21184 | T21185 | punct | (,1-54 |
| R16862 | T21185 | T21183 | parataxis | 1-54,GST-IκBα |
| R16863 | T21186 | T21183 | punct | ),GST-IκBα |
| R16864 | T21187 | T21178 | punct | ",",S-transferase |
| R16865 | T21188 | T21189 | amod | wild,type |
| R16866 | T21189 | T21178 | conj | type,S-transferase |
| R16867 | T21190 | T21189 | punct | ",",type |
| R16868 | T21191 | T21192 | amod | mutant,GST-RPS3 |
| R16869 | T21192 | T21189 | conj | GST-RPS3,type |
| R16870 | T21193 | T21192 | punct | ",",GST-RPS3 |
| R16871 | T21194 | T21192 | cc | or,GST-RPS3 |
| R16872 | T21195 | T21196 | nummod | RPS3,proteins |
| R16873 | T21196 | T21192 | conj | proteins,GST-RPS3 |
| R16874 | T21197 | T21198 | auxpass | were,used |
| R16875 | T21198 | T21198 | ROOT | used,used |
| R16876 | T21199 | T21198 | prep | as,used |
| R16877 | T21200 | T21199 | pobj | substrates,as |
| R16878 | T21201 | T21198 | punct | .,used |
| R16879 | T21202 | T21206 | det | The,assay |
| R16880 | T21203 | T21206 | nmod | in,assay |
| R16881 | T21204 | T21206 | amod | vitro,assay |
| R16882 | T21205 | T21206 | compound | kinase,assay |
| R16883 | T21206 | T21208 | nsubjpass | assay,performed |
| R16884 | T21207 | T21208 | auxpass | was,performed |
| R16885 | T21208 | T21208 | ROOT | performed,performed |
| R16886 | T21209 | T21208 | prep | as,performed |
| R16887 | T21210 | T21211 | advmod | previously,described29 |
| R16888 | T21211 | T21209 | pobj | described29,as |
| R16889 | T21212 | T21208 | punct | .,performed |
| R16890 | T21213 | T21221 | advmod | Briefly,substrate |
| R16891 | T21214 | T21221 | punct | ",",substrate |
| R16892 | T21215 | T21221 | nsubj | enzyme,substrate |
| R16893 | T21216 | T21218 | punct | (,ng |
| R16894 | T21217 | T21218 | nummod | 100,ng |
| R16895 | T21218 | T21215 | appos | ng,enzyme |
| R16896 | T21219 | T21218 | punct | ),ng |
| R16897 | T21220 | T21218 | cc | and,ng |
| R16898 | T21221 | T21221 | ROOT | substrate,substrate |
| R16899 | T21222 | T21224 | punct | (,μg |
| R16900 | T21223 | T21224 | nummod | 2,μg |
| R16901 | T21224 | T21221 | appos | μg,substrate |
| R16902 | T21225 | T21221 | punct | ),substrate |
| R16903 | T21226 | T21227 | auxpass | were,co-incubated |
| R16904 | T21227 | T21227 | ROOT | co-incubated,co-incubated |
| R16905 | T21228 | T21227 | prep | in,co-incubated |
| R16906 | T21229 | T21231 | compound | IKK,buffer |
| R16907 | T21230 | T21231 | compound | reaction,buffer |
| R16908 | T21231 | T21228 | pobj | buffer,in |
| R16909 | T21232 | T21240 | punct | (,] |
| R16910 | T21233 | T21235 | nummod | 25,Tris |
| R16911 | T21234 | T21235 | compound | mM,Tris |
| R16560 | T20743 | T20742 | pobj | S209A,for |
| R16561 | T20744 | T20715 | punct | .,generated |
| R16562 | T20745 | T20746 | det | All,mutants |
| R16563 | T20746 | T20748 | nsubjpass | mutants,verified |
| R16564 | T20747 | T20748 | auxpass | were,verified |
| R16565 | T20748 | T20748 | ROOT | verified,verified |
| R16566 | T20749 | T20748 | agent | by,verified |
| R16567 | T20750 | T20751 | compound | DNA,sequencing |
| R16568 | T20751 | T20749 | pobj | sequencing,by |
| R16569 | T20752 | T20748 | punct | .,verified |
| R16630 | T20907 | T20915 | nsubjpass | 32P,labeled |
| R16631 | T20908 | T20907 | prep | in,32P |
| R16632 | T20909 | T20908 | pobj | vivo,in |
| R16633 | T20910 | T20915 | prep | Labeling,labeled |
| R16634 | T20911 | T20910 | dobj | HEK,Labeling |
| R16635 | T20912 | T20913 | nummod | 293T,cells |
| R16636 | T20913 | T20915 | nsubjpass | cells,labeled |
| R16637 | T20914 | T20915 | auxpass | were,labeled |
| R16638 | T20915 | T20915 | ROOT | labeled,labeled |
| R16639 | T20916 | T20915 | prep | with,labeled |
| R16640 | T20917 | T20919 | nummod | 2,32P-orthophosphate |
| R16641 | T20918 | T20919 | compound | mCi/ml,32P-orthophosphate |
| R16642 | T20919 | T20916 | pobj | 32P-orthophosphate,with |
| R16643 | T20920 | T20919 | punct | (,32P-orthophosphate |
| R16644 | T20921 | T20922 | compound | Perkin,Elmer |
| R16645 | T20922 | T20919 | appos | Elmer,32P-orthophosphate |
| R16646 | T20923 | T20919 | punct | ),32P-orthophosphate |
| R16647 | T20924 | T20915 | prep | in,labeled |
| R16648 | T20925 | T20926 | amod | phosphate-free,medium |
| R16649 | T20926 | T20924 | pobj | medium,in |
| R16650 | T20927 | T20928 | punct | (,Invitrogen |
| R16651 | T20928 | T20926 | appos | Invitrogen,medium |
| R16652 | T20929 | T20915 | punct | ),labeled |
| R16653 | T20930 | T20915 | prep | for,labeled |
| R16654 | T20931 | T20933 | nummod | 2,Cells |
| R16655 | T20932 | T20933 | compound | h.,Cells |
| R16656 | T20933 | T20930 | pobj | Cells,for |
| R16657 | T20934 | T20936 | auxpass | were,left |
| R16658 | T20935 | T20936 | advmod | then,left |
| R16659 | T20936 | T20915 | conj | left,labeled |
| R16660 | T20937 | T20936 | oprd | untreated,left |
| R16661 | T20938 | T20937 | cc | or,untreated |
| R16662 | T20939 | T20937 | conj | treated,untreated |
| R16663 | T20940 | T20939 | prep | with,treated |
| R16664 | T20941 | T20940 | pobj | TNF,with |
| R16665 | T20942 | T20944 | punct | (,ng/ml |
| R16666 | T20943 | T20944 | nummod | 50,ng/ml |
| R16667 | T20944 | T20937 | appos | ng/ml,untreated |
| R16668 | T20945 | T20944 | punct | ",",ng/ml |
| R16669 | T20946 | T20947 | compound | R&D,Systems |
| R16670 | T20947 | T20944 | appos | Systems,ng/ml |
| R16671 | T20948 | T20944 | punct | ),ng/ml |
| R16672 | T20949 | T20936 | prep | for,left |
| R16673 | T20950 | T20951 | amod | indicated,periods |
| R16674 | T20951 | T20949 | pobj | periods,for |
| R16675 | T20952 | T20936 | punct | .,left |
| R16676 | T20953 | T20954 | compound | Cell,lysates |
| R16677 | T20954 | T20956 | nsubjpass | lysates,prepared |
| R16678 | T20955 | T20956 | auxpass | were,prepared |
| R16679 | T20956 | T20956 | ROOT | prepared,prepared |
| R16680 | T20957 | T20956 | cc | and,prepared |
| R16681 | T20958 | T20956 | conj | used,prepared |
| R16682 | T20959 | T20958 | prep | for,used |
| R16683 | T20960 | T20959 | pobj | immunoprecipitations,for |
| R16684 | T20961 | T20960 | prep | with,immunoprecipitations |
| R16685 | T20962 | T20963 | amod | RPS3,antibody |
| R16686 | T20963 | T20961 | pobj | antibody,with |
| R16687 | T20964 | T20956 | punct | .,prepared |
| R16832 | T21155 | T21166 | prep | In,purchased |
| R16833 | T21156 | T21161 | compound | Vitro,IKKβ |
| R16834 | T21157 | T21161 | compound | Kinase,IKKβ |
| R16835 | T21158 | T21161 | compound | Assay,IKKβ |
| R16836 | T21159 | T21160 | compound | Kinase-active,recombinant |
| R16837 | T21160 | T21161 | compound | recombinant,IKKβ |
| R16838 | T21161 | T21155 | pobj | IKKβ,In |
| R16839 | T21162 | T21161 | cc | and,IKKβ |
| R16840 | T21163 | T21164 | compound | IKKα,proteins |
| R16916 | T21239 | T21240 | nummod | 8.0,] |
| R16917 | T21240 | T21227 | appos | ],co-incubated |
| R16918 | T21241 | T21240 | punct | ",",] |
| R16919 | T21242 | T21244 | nummod | 50,KCl |
| R16920 | T21243 | T21244 | compound | mM,KCl |
| R16921 | T21244 | T21240 | conj | KCl,] |
| R16922 | T21245 | T21244 | punct | ",",KCl |
| R16923 | T21246 | T21248 | nummod | 10,MgCl2 |
| R16924 | T21247 | T21248 | compound | mM,MgCl2 |
| R16925 | T21248 | T21244 | conj | MgCl2,KCl |
| R16926 | T21249 | T21248 | punct | ",",MgCl2 |
| R16927 | T21250 | T21252 | nummod | 1,DTT |
| R16928 | T21251 | T21252 | compound | mM,DTT |
| R16929 | T21252 | T21265 | nmod | DTT,buffer |
| R16930 | T21253 | T21252 | punct | ",",DTT |
| R16931 | T21254 | T21256 | nummod | 1,Na3VO4 |
| R16932 | T21255 | T21256 | compound | mM,Na3VO4 |
| R16933 | T21256 | T21252 | conj | Na3VO4,DTT |
| R16934 | T21257 | T21256 | punct | ",",Na3VO4 |
| R16935 | T21258 | T21260 | nummod | 1,ATP |
| R16936 | T21259 | T21260 | compound | mM,ATP |
| R16937 | T21260 | T21256 | appos | ATP,Na3VO4 |
| R16938 | T21261 | T21256 | punct | ),Na3VO4 |
| R16939 | T21262 | T21256 | cc | or,Na3VO4 |
| R16940 | T21263 | T21265 | amod | NleH1,buffer |
| R16941 | T21264 | T21265 | compound | reaction,buffer |
| R16942 | T21265 | T21248 | appos | buffer,MgCl2 |
| R16943 | T21266 | T21273 | punct | (,] |
| R16944 | T21267 | T21273 | nummod | 50,] |
| R16945 | T21268 | T21271 | compound | mM,pH |
| R16946 | T21269 | T21271 | compound | Tris-HCl,pH |
| R16947 | T21270 | T21271 | compound | [,pH |
| R16948 | T21271 | T21273 | compound | pH,] |
| R16949 | T21272 | T21273 | compound | 7.6,] |
| R16950 | T21273 | T21248 | conj | ],MgCl2 |
| R16951 | T21274 | T21273 | punct | ",",] |
| R16952 | T21275 | T21277 | nummod | 5,MgCl2 |
| R16953 | T21276 | T21277 | compound | mM,MgCl2 |
| R16954 | T21277 | T21273 | conj | MgCl2,] |
| R16955 | T21278 | T21277 | punct | ",",MgCl2 |
| R16956 | T21279 | T21281 | nummod | 1,DTT |
| R16957 | T21280 | T21281 | compound | mM,DTT |
| R16958 | T21281 | T21277 | conj | DTT,MgCl2 |
| R16959 | T21282 | T21281 | punct | ",",DTT |
| R16960 | T21283 | T21285 | nummod | 1,ATP |
| R16961 | T21284 | T21285 | compound | mM,ATP |
| R16962 | T21285 | T21281 | appos | ATP,DTT |
| R16963 | T21286 | T21281 | punct | ),DTT |
| R16964 | T21287 | T21281 | prep | with,DTT |
| R16965 | T21288 | T21290 | nummod | 0.5,32P-γ-ATP |
| R16966 | T21289 | T21290 | compound | μCi,32P-γ-ATP |
| R16967 | T21290 | T21287 | pobj | 32P-γ-ATP,with |
| R16968 | T21291 | T21293 | punct | (,Healthcare |
| R16969 | T21292 | T21293 | compound | GE,Healthcare |
| R16970 | T21293 | T21290 | appos | Healthcare,32P-γ-ATP |
| R16971 | T21294 | T21290 | punct | ),32P-γ-ATP |
| R16972 | T21295 | T21295 | ROOT | added,added |
| R16973 | T21296 | T21295 | prep | at,added |
| R16974 | T21297 | T21298 | nummod | 37,° |
| R16975 | T21298 | T21296 | pobj | °,at |
| R16976 | T21299 | T21295 | npadvmod | C,added |
| R16977 | T21300 | T21295 | prep | for,added |
| R16978 | T21301 | T21302 | nummod | 30,min |
| R16979 | T21302 | T21300 | pobj | min,for |
| R16980 | T21303 | T21295 | punct | .,added |
| R16981 | T21304 | T21305 | det | The,reactions |
| R16982 | T21305 | T21307 | nsubjpass | reactions,resolved |
| R16983 | T21306 | T21307 | auxpass | were,resolved |
| R16984 | T21307 | T21307 | ROOT | resolved,resolved |
| R16985 | T21308 | T21307 | agent | by,resolved |
| R16986 | T21309 | T21308 | pobj | SDS,by |
| R16987 | T21310 | T21307 | npadvmod | PAGE,resolved |
| R16988 | T21311 | T21310 | cc | and,PAGE |
| R16989 | T21312 | T21310 | conj | visualized,PAGE |
| R16990 | T21313 | T21312 | agent | by,visualized |
| R16991 | T21314 | T21313 | pobj | autoradiography,by |
| R16992 | T21315 | T21307 | punct | .,resolved |
| R17065 | T21440 | T21442 | compound | LC-MS/MS,GST |
| R17066 | T21441 | T21442 | compound | Analysis,GST |
| R17067 | T21442 | T21446 | nsubjpass | GST,incubated |
| R16912 | T21235 | T21240 | nmod | Tris,] |
| R16913 | T21236 | T21238 | compound | HCl,pH |
| R16914 | T21237 | T21238 | compound | [,pH |
| R16915 | T21238 | T21235 | appos | pH,Tris |
| R17185 | T21602 | T21602 | ROOT | RNAi,RNAi |
| R17186 | T21603 | T21602 | cc | and,RNAi |
| R17187 | T21604 | T21602 | conj | Transfection,RNAi |
| R17188 | T21605 | T21606 | det | The,siRNA |
| R17189 | T21606 | T21611 | nmod | siRNA,IKKα |
| R17190 | T21607 | T21606 | punct | (,siRNA |
| R17191 | T21608 | T21609 | amod | sense-strand,sequence |
| R17192 | T21609 | T21606 | appos | sequence,siRNA |
| R17193 | T21610 | T21611 | punct | ),IKKα |
| R17194 | T21611 | T21611 | ROOT | IKKα,IKKα |
| R17195 | T21612 | T21611 | punct | ",",IKKα |
| R17196 | T21613 | T21618 | nummod | 5,′ |
| R17197 | T21614 | T21616 | punct | ′,AUGACAGAGAAUGAUCAUGUUCUGC |
| R17198 | T21615 | T21616 | punct | -,AUGACAGAGAAUGAUCAUGUUCUGC |
| R17199 | T21616 | T21618 | nmod | AUGACAGAGAAUGAUCAUGUUCUGC,′ |
| R17200 | T21617 | T21618 | nummod | -3,′ |
| R17201 | T21618 | T21611 | appos | ′,IKKα |
| R17202 | T21619 | T21611 | punct | ;,IKKα |
| R17203 | T21620 | T21611 | conj | IKKβ,IKKα |
| R17204 | T21621 | T21620 | punct | ",",IKKβ |
| R17205 | T21622 | T21627 | nummod | 5,′ |
| R17206 | T21623 | T21625 | punct | ′,GCAGCAAGGAGAACAGAGGUUAAUA |
| R17207 | T21624 | T21625 | punct | -,GCAGCAAGGAGAACAGAGGUUAAUA |
| R17208 | T21625 | T21627 | nmod | GCAGCAAGGAGAACAGAGGUUAAUA,′ |
| R17209 | T21626 | T21627 | nummod | -3,′ |
| R17210 | T21627 | T21627 | ROOT | ′,′ |
| R17211 | T21628 | T21627 | punct | ;,′ |
| R17212 | T21629 | T21627 | conj | IκBα,′ |
| R17213 | T21630 | T21629 | punct | ",",IκBα |
| R17214 | T21631 | T21636 | nummod | 5,′ |
| R17215 | T21632 | T21634 | punct | ′,GAGCUCCGAGACUUUCGAGGAAAUA |
| R17216 | T21633 | T21634 | punct | -,GAGCUCCGAGACUUUCGAGGAAAUA |
| R17217 | T21634 | T21636 | nmod | GAGCUCCGAGACUUUCGAGGAAAUA,′ |
| R17218 | T21635 | T21636 | nummod | -3,′ |
| R17219 | T21636 | T21629 | appos | ′,IκBα |
| R17220 | T21637 | T21629 | punct | ;,IκBα |
| R17221 | T21638 | T21640 | compound | RPS3-3,UTR |
| R17222 | T21639 | T21640 | compound | ′,UTR |
| R17223 | T21640 | T21627 | appos | UTR,′ |
| R17224 | T21641 | T21640 | punct | ",",UTR |
| R17225 | T21642 | T21647 | nummod | 5,′ |
| R17226 | T21643 | T21645 | punct | ′,GGAUGUUGCUCUCUAAAGACC |
| R17227 | T21644 | T21645 | punct | -,GGAUGUUGCUCUCUAAAGACC |
| R17228 | T21645 | T21647 | nmod | GGAUGUUGCUCUCUAAAGACC,′ |
| R17229 | T21646 | T21647 | nummod | -3,′ |
| R17230 | T21647 | T21640 | appos | ′,UTR |
| R17231 | T21648 | T21649 | punct | (,Invitrogen |
| R17232 | T21649 | T21647 | appos | Invitrogen,′ |
| R17233 | T21650 | T21649 | punct | ),Invitrogen |
| R17234 | T21651 | T21627 | punct | .,′ |
| R17235 | T21652 | T21653 | amod | Transient,transfection |
| R17236 | T21653 | T21658 | nsubj | transfection,constructs |
| R17237 | T21654 | T21653 | prep | of,transfection |
| R17238 | T21655 | T21654 | pobj | siRNA,of |
| R17239 | T21656 | T21655 | cc | and,siRNA |
| R17240 | T21657 | T21655 | conj | DNA,siRNA |
| R17241 | T21658 | T21666 | nsubjpass | constructs,described |
| R17242 | T21659 | T21658 | prep | into,constructs |
| R17243 | T21660 | T21661 | compound | Jurkat,cells |
| R17244 | T21661 | T21659 | pobj | cells,into |
| R17245 | T21662 | T21661 | cc | and,cells |
| R17246 | T21663 | T21664 | amod | 293T,cells |
| R17247 | T21664 | T21661 | conj | cells,cells |
| R17248 | T21665 | T21666 | auxpass | was,described |
| R17249 | T21666 | T21666 | ROOT | described,described |
| R17250 | T21667 | T21666 | dobj | previously6,described |
| R17251 | T21668 | T21666 | punct | .,described |
| R17441 | T21900 | T21902 | nummod | 0.1,EDTA |
| R17442 | T21901 | T21902 | compound | mM,EDTA |
| R17443 | T21902 | T21898 | appos | EDTA,MgCl2 |
| R17444 | T21903 | T21902 | punct | ",",EDTA |
| R17445 | T21904 | T21906 | nummod | 0.5,DTT |
| R17446 | T21905 | T21906 | compound | mM,DTT |
| R17447 | T21906 | T21902 | appos | DTT,EDTA |
| R17448 | T21907 | T21906 | punct | ",",DTT |
| R17449 | T21908 | T21909 | nummod | 0.4,% |
| R17450 | T21909 | T21910 | compound | %,NP-40 |
| R17451 | T21910 | T21906 | appos | NP-40,DTT |
| R17452 | T21911 | T21910 | punct | ",",NP-40 |
| R17453 | T21912 | T21914 | nummod | 0.5,PMSF |
| R17454 | T21913 | T21914 | compound | mM,PMSF |
| R17455 | T21914 | T21910 | appos | PMSF,NP-40 |
| R17456 | T21915 | T21914 | punct | ",",PMSF |
| R17457 | T21916 | T21919 | amod | complete,cocktail |
| R17458 | T21917 | T21919 | compound | protease,cocktail |
| R17459 | T21918 | T21919 | compound | inhibitor,cocktail |
| R17460 | T21919 | T21914 | appos | cocktail,PMSF |
| R17461 | T21920 | T21914 | punct | ),PMSF |
| R17462 | T21921 | T21906 | prep | at,DTT |
| R17463 | T21922 | T21923 | nummod | 4,° |
| R17464 | T21923 | T21921 | pobj | °,at |
| R17465 | T21924 | T21906 | conj | C,DTT |
| R17466 | T21925 | T21906 | prep | for,DTT |
| R17467 | T21926 | T21927 | nummod | 5,min |
| R17468 | T21927 | T21925 | pobj | min,for |
| R17469 | T21928 | T21880 | punct | .,resuspended |
| R17470 | T21929 | T21931 | nsubjpass | Lysates,centrifuged |
| R17471 | T21930 | T21931 | auxpass | were,centrifuged |
| R17472 | T21931 | T21931 | ROOT | centrifuged,centrifuged |
| R17473 | T21932 | T21931 | prep | at,centrifuged |
| R17474 | T21933 | T21934 | nummod | 4,° |
| R17475 | T21934 | T21935 | nummod | °,C |
| R17476 | T21935 | T21932 | pobj | C,at |
| R17477 | T21936 | T21935 | punct | ",",C |
| R17478 | T21937 | T21938 | nummod | 500,× |
| R17479 | T21938 | T21939 | compound | ×,g |
| R17480 | T21939 | T21947 | nsubjpass | g,collected |
| R17481 | T21940 | T21939 | prep | for,g |
| R17482 | T21941 | T21942 | nummod | 3,min |
| R17483 | T21942 | T21940 | pobj | min,for |
| R17484 | T21943 | T21939 | punct | ",",g |
| R17485 | T21944 | T21939 | cc | and,g |
| R17486 | T21945 | T21939 | conj | supernatants,g |
| R17487 | T21946 | T21947 | auxpass | were,collected |
| R17488 | T21947 | T21931 | conj | collected,centrifuged |
| R17489 | T21948 | T21947 | prep | as,collected |
| R17490 | T21949 | T21950 | amod | cytosolic,fractions |
| R17491 | T21950 | T21948 | pobj | fractions,as |
| R17492 | T21951 | T21947 | punct | .,collected |
| R17493 | T21952 | T21954 | nsubjpass | Pellets,incubated |
| R17494 | T21953 | T21954 | auxpass | were,incubated |
| R17495 | T21954 | T21954 | ROOT | incubated,incubated |
| R17496 | T21955 | T21954 | prep | in,incubated |
| R17497 | T21956 | T21957 | compound | Buffer,C |
| R17068 | T21443 | T21442 | cc | or,GST |
| R17069 | T21444 | T21442 | conj | GST-RPS3,GST |
| R17070 | T21445 | T21446 | auxpass | was,incubated |
| R17071 | T21446 | T21446 | ROOT | incubated,incubated |
| R17072 | T21447 | T21446 | prep | with,incubated |
| R17073 | T21448 | T21450 | compound | recombinant,protein |
| R17074 | T21449 | T21450 | compound | IKKβ,protein |
| R17075 | T21450 | T21447 | pobj | protein,with |
| R17076 | T21451 | T21452 | mark | as,described |
| R17077 | T21452 | T21446 | advcl | described,incubated |
| R17078 | T21453 | T21452 | advmod | above,described |
| R17079 | T21454 | T21452 | prep | in,described |
| R17080 | T21455 | T21454 | pcomp | an,in |
| R17081 | T21456 | T21455 | prep | in,an |
| R17082 | T21457 | T21460 | amod | vitro,reaction |
| R17083 | T21458 | T21460 | amod | kinase,reaction |
| R17084 | T21459 | T21460 | compound | assay,reaction |
| R17085 | T21460 | T21456 | pobj | reaction,in |
| R17086 | T21461 | T21460 | acl | conducted,reaction |
| R17087 | T21462 | T21461 | prep | without,conducted |
| R17088 | T21463 | T21464 | compound | 32P-γ-ATP,labeling |
| R17089 | T21464 | T21462 | pobj | labeling,without |
| R17090 | T21465 | T21446 | punct | .,incubated |
| R17091 | T21466 | T21467 | det | The,reaction |
| R17092 | T21467 | T21469 | nsubjpass | reaction,separated |
| R17093 | T21468 | T21469 | auxpass | was,separated |
| R17094 | T21469 | T21469 | ROOT | separated,separated |
| R17095 | T21470 | T21469 | agent | by,separated |
| R17096 | T21471 | T21470 | pobj | SDS-PAGE,by |
| R17097 | T21472 | T21469 | punct | ",",separated |
| R17098 | T21473 | T21469 | cc | and,separated |
| R17099 | T21474 | T21476 | det | the,gel |
| R17100 | T21475 | T21476 | compound | protein,gel |
| R17101 | T21476 | T21478 | nsubjpass | gel,stained |
| R17102 | T21477 | T21478 | auxpass | was,stained |
| R17103 | T21478 | T21469 | conj | stained,separated |
| R17104 | T21479 | T21478 | prep | with,stained |
| R17105 | T21480 | T21481 | compound | Colloidal,Blue |
| R17106 | T21481 | T21479 | pobj | Blue,with |
| R17107 | T21482 | T21481 | punct | (,Blue |
| R17108 | T21483 | T21481 | appos | Invitrogen,Blue |
| R17109 | T21484 | T21481 | punct | ),Blue |
| R17110 | T21485 | T21478 | punct | .,stained |
| R17111 | T21486 | T21489 | det | The,fragments |
| R17112 | T21487 | T21489 | amod | corresponding,fragments |
| R17113 | T21488 | T21489 | compound | protein,fragments |
| R17114 | T21489 | T21491 | nsubjpass | fragments,excised |
| R17115 | T21490 | T21491 | auxpass | were,excised |
| R17116 | T21491 | T21491 | ROOT | excised,excised |
| R17117 | T21492 | T21491 | cc | and,excised |
| R17118 | T21493 | T21491 | conj | subjected,excised |
| R17119 | T21494 | T21495 | aux | to,trypsin |
| R17120 | T21495 | T21493 | xcomp | trypsin,subjected |
| R17121 | T21496 | T21495 | dobj | digestion,trypsin |
| R17122 | T21497 | T21496 | cc | and,digestion |
| R17123 | T21498 | T21496 | conj | LC-MS/MS,digestion |
| R17124 | T21499 | T21495 | prep | at,trypsin |
| R17125 | T21500 | T21503 | det | the,Center |
| R17126 | T21501 | T21503 | compound | Yale,Center |
| R17127 | T21502 | T21503 | compound | Cancer,Center |
| R17128 | T21503 | T21506 | compound | Center,Resource |
| R17129 | T21504 | T21506 | compound | Mass,Resource |
| R17130 | T21505 | T21506 | compound | Spectrometry,Resource |
| R17131 | T21506 | T21499 | pobj | Resource,at |
| R17132 | T21507 | T21506 | punct | (,Resource |
| R17133 | T21508 | T21509 | compound | New,Haven |
| R17134 | T21509 | T21506 | appos | Haven,Resource |
| R17135 | T21510 | T21509 | punct | ",",Haven |
| R17136 | T21511 | T21509 | conj | CT,Haven |
| R17137 | T21512 | T21506 | punct | ),Resource |
| R17138 | T21513 | T21491 | punct | .,excised |
| R17404 | T21863 | T21866 | compound | Subcellular,fractionation |
| R17405 | T21864 | T21866 | compound | Fractionation,fractionation |
| R17406 | T21865 | T21866 | compound | Subcellular,fractionation |
| R17407 | T21866 | T21868 | nsubjpass | fractionation,performed |
| R17408 | T21867 | T21868 | auxpass | was,performed |
| R17409 | T21868 | T21868 | ROOT | performed,performed |
| R17410 | T21869 | T21868 | agent | by,performed |
| R17411 | T21870 | T21871 | compound | differential,centrifugation |
| R17412 | T21871 | T21869 | pobj | centrifugation,by |
| R17413 | T21872 | T21868 | prep | as,performed |
| R17414 | T21873 | T21874 | advmod | previously,described6 |
| R17415 | T21874 | T21872 | pobj | described6,as |
| R17416 | T21875 | T21868 | punct | .,performed |
| R17417 | T21876 | T21880 | advmod | Briefly,resuspended |
| R17418 | T21877 | T21880 | punct | ",",resuspended |
| R17419 | T21878 | T21880 | nsubjpass | cells,resuspended |
| R17420 | T21879 | T21880 | auxpass | were,resuspended |
| R17421 | T21880 | T21880 | ROOT | resuspended,resuspended |
| R17422 | T21881 | T21880 | prep | in,resuspended |
| R17423 | T21882 | T21884 | amod | ice-cold,A |
| R17424 | T21883 | T21884 | compound | Buffer,A |
| R17425 | T21884 | T21881 | pobj | A,in |
| R17426 | T21885 | T21884 | punct | (,A |
| R17427 | T21886 | T21889 | nummod | 10,pH |
| R17428 | T21887 | T21889 | compound | mM,pH |
| R17429 | T21888 | T21889 | compound | HEPES,pH |
| R17430 | T21889 | T21884 | appos | pH,A |
| R17431 | T21890 | T21889 | nummod | 7.9,pH |
| R17432 | T21891 | T21889 | punct | ",",pH |
| R17433 | T21892 | T21894 | nummod | 10,KCl |
| R17434 | T21893 | T21894 | compound | mM,KCl |
| R17435 | T21894 | T21889 | appos | KCl,pH |
| R17436 | T21895 | T21894 | punct | ",",KCl |
| R17437 | T21896 | T21898 | nummod | 1.5,MgCl2 |
| R17438 | T21897 | T21898 | compound | mM,MgCl2 |
| R17439 | T21898 | T21894 | appos | MgCl2,KCl |
| R17440 | T21899 | T21898 | punct | ",",MgCl2 |
| R17516 | T21975 | T21971 | appos | glycerol,MgCl2 |
| R17517 | T21976 | T21971 | punct | ",",MgCl2 |
| R17518 | T21977 | T21979 | nummod | 0.5,PMSF |
| R17519 | T21978 | T21979 | compound | mM,PMSF |
| R17520 | T21979 | T21971 | appos | PMSF,MgCl2 |
| R17521 | T21980 | T21979 | punct | ",",PMSF |
| R17522 | T21981 | T21983 | nummod | 0.2,EDTA |
| R17523 | T21982 | T21983 | compound | mM,EDTA |
| R17524 | T21983 | T21979 | appos | EDTA,PMSF |
| R17525 | T21984 | T21983 | punct | ",",EDTA |
| R17526 | T21985 | T21987 | nummod | 0.5,DTT |
| R17527 | T21986 | T21987 | compound | mM,DTT |
| R17528 | T21987 | T21983 | appos | DTT,EDTA |
| R17529 | T21988 | T21987 | punct | ",",DTT |
| R17530 | T21989 | T21992 | amod | complete,cocktail |
| R17531 | T21990 | T21992 | compound | protease,cocktail |
| R17532 | T21991 | T21992 | compound | inhibitor,cocktail |
| R17533 | T21992 | T21987 | appos | cocktail,DTT |
| R17534 | T21993 | T21987 | punct | ),DTT |
| R17535 | T21994 | T21979 | prep | at,PMSF |
| R17536 | T21995 | T21996 | nummod | 4,° |
| R17537 | T21996 | T21994 | pobj | °,at |
| R17538 | T21997 | T21979 | conj | C,PMSF |
| R17539 | T21998 | T21979 | prep | for,PMSF |
| R17540 | T21999 | T22000 | nummod | 10,min |
| R17541 | T22000 | T21998 | pobj | min,for |
| R17542 | T22001 | T21954 | punct | .,incubated |
| R17543 | T22002 | T22004 | nsubjpass | Supernatants,collected |
| R17544 | T22003 | T22004 | auxpass | were,collected |
| R17545 | T22004 | T22004 | ROOT | collected,collected |
| R17546 | T22005 | T22004 | prep | as,collected |
| R17547 | T22006 | T22007 | amod | nuclear,fractions |
| R17548 | T22007 | T22005 | pobj | fractions,as |
| R17549 | T22008 | T22004 | prep | following,collected |
| R17550 | T22009 | T22010 | det | a,centrifuge |
| R17551 | T22010 | T22008 | pobj | centrifuge,following |
| R17552 | T22011 | T22010 | prep | at,centrifuge |
| R17553 | T22012 | T22013 | nummod | 4,° |
| R17554 | T22013 | T22011 | pobj | °,at |
| R17555 | T22014 | T22018 | nmod | C,g |
| R17556 | T22015 | T22014 | punct | ",",C |
| R17557 | T22016 | T22017 | nummod | "13,800",× |
| R17558 | T22017 | T22018 | compound | ×,g |
| R17559 | T22018 | T22010 | npadvmod | g,centrifuge |
| R17560 | T22019 | T22018 | prep | for,g |
| R17561 | T22020 | T22021 | nummod | 10,min |
| R17562 | T22021 | T22019 | pobj | min,for |
| R17563 | T22022 | T22004 | punct | .,collected |
| R17629 | T22111 | T22112 | compound | Luciferase,Reporter |
| R17498 | T21957 | T21955 | pobj | C,in |
| R17499 | T21958 | T21957 | punct | (,C |
| R17500 | T21959 | T21962 | nummod | 20,pH7 |
| R17501 | T21960 | T21962 | compound | mM,pH7 |
| R17502 | T21961 | T21962 | compound | HEPES,pH7 |
| R17503 | T21962 | T21957 | appos | pH7,C |
| R17504 | T21963 | T21962 | nummod | .9,pH7 |
| R17505 | T21964 | T21962 | punct | ",",pH7 |
| R17506 | T21965 | T21967 | nummod | 420,NaCl |
| R17507 | T21966 | T21967 | compound | mM,NaCl |
| R17508 | T21967 | T21962 | appos | NaCl,pH7 |
| R17509 | T21968 | T21967 | punct | ",",NaCl |
| R17510 | T21969 | T21971 | nummod | 1.5,MgCl2 |
| R17511 | T21970 | T21971 | compound | mM,MgCl2 |
| R17512 | T21971 | T21967 | appos | MgCl2,NaCl |
| R17513 | T21972 | T21971 | punct | ",",MgCl2 |
| R17514 | T21973 | T21974 | nummod | 25,% |
| R17515 | T21974 | T21975 | compound | %,glycerol |
| R17666 | T22148 | T22149 | advmod | together,with |
| R17667 | T22149 | T22129 | prep | with,cotransfected |
| R17668 | T22150 | T22151 | amod | indicated,plasmids |
| R17669 | T22151 | T22149 | pobj | plasmids,with |
| R17670 | T22152 | T22129 | punct | .,cotransfected |
| R17671 | T22153 | T22154 | nsubj | Cells,were |
| R17672 | T22154 | T22154 | ROOT | were,were |
| R17673 | T22155 | T22154 | acomp | cultured,were |
| R17674 | T22156 | T22155 | prep | for,cultured |
| R17675 | T22157 | T22158 | quantmod | 1,2 |
| R17676 | T22158 | T22159 | nummod | 2,days |
| R17677 | T22159 | T22156 | pobj | days,for |
| R17678 | T22160 | T22155 | cc | and,cultured |
| R17679 | T22161 | T22162 | advmod | then,stimulated |
| R17680 | T22162 | T22155 | conj | stimulated,cultured |
| R17681 | T22163 | T22162 | prep | in,stimulated |
| R17682 | T22164 | T22163 | pobj | triplicate,in |
| R17683 | T22165 | T22162 | prep | before,stimulated |
| R17684 | T22166 | T22165 | pobj | harvest,before |
| R17685 | T22167 | T22154 | punct | .,were |
| R17686 | T22168 | T22170 | nsubjpass | Lysates,analyzed |
| R17687 | T22169 | T22170 | auxpass | were,analyzed |
| R17688 | T22170 | T22170 | ROOT | analyzed,analyzed |
| R17689 | T22171 | T22170 | advcl | using,analyzed |
| R17690 | T22172 | T22174 | det | the,Kit |
| R17691 | T22173 | T22174 | compound | Dual-Luciferase,Kit |
| R17692 | T22174 | T22171 | dobj | Kit,using |
| R17693 | T22175 | T22174 | punct | (,Kit |
| R17694 | T22176 | T22174 | appos | Promega,Kit |
| R17695 | T22177 | T22174 | punct | ),Kit |
| R17696 | T22178 | T22170 | punct | .,analyzed |
| R17735 | T22257 | T22258 | compound | Chromatin,Immunoprecipitation |
| R17736 | T22258 | T22258 | ROOT | Immunoprecipitation,Immunoprecipitation |
| R17737 | T22259 | T22260 | punct | (,ChIP |
| R17738 | T22260 | T22258 | appos | ChIP,Immunoprecipitation |
| R17739 | T22261 | T22258 | punct | ),Immunoprecipitation |
| R17740 | T22262 | T22263 | compound | ChIP,assays |
| R17870 | T22423 | T22426 | compound | Immunofluorescence,microscopy |
| R17871 | T22424 | T22426 | compound | Microscopy,microscopy |
| R17872 | T22425 | T22426 | compound | Confocal,microscopy |
| R17873 | T22426 | T22428 | nsubjpass | microscopy,performed |
| R17874 | T22427 | T22428 | auxpass | was,performed |
| R17875 | T22428 | T22428 | ROOT | performed,performed |
| R17876 | T22429 | T22428 | prep | as,performed |
| R17877 | T22430 | T22431 | advmod | previously,described6 |
| R17878 | T22431 | T22429 | pobj | described6,as |
| R17879 | T22432 | T22428 | punct | .,performed |
| R17880 | T22433 | T22437 | advmod | Briefly,fixed |
| R17881 | T22434 | T22437 | punct | ",",fixed |
| R17882 | T22435 | T22437 | nsubjpass | cells,fixed |
| R17883 | T22436 | T22437 | auxpass | were,fixed |
| R17884 | T22437 | T22437 | ROOT | fixed,fixed |
| R17885 | T22438 | T22437 | prep | with,fixed |
| R17886 | T22439 | T22440 | nummod | 4,% |
| R17887 | T22440 | T22441 | compound | %,paraformaldehyde |
| R17888 | T22441 | T22438 | pobj | paraformaldehyde,with |
| R17889 | T22442 | T22441 | prep | in,paraformaldehyde |
| R17890 | T22443 | T22442 | pobj | PBS,in |
| R17966 | T22519 | T22518 | acl | mounted,cover |
| R17967 | T22520 | T22519 | prep | for,mounted |
| R17968 | T22521 | T22522 | compound | fluorescence,microscopy |
| R17969 | T22522 | T22520 | pobj | microscopy,for |
| R17970 | T22523 | T22512 | punct | .,rinsed |
| R18230 | T22801 | T22807 | nsubjpass | Immunoprecipitation,harvested |
| R18231 | T22802 | T22801 | cc | and,Immunoprecipitation |
| R18232 | T22803 | T22801 | conj | immunoblot,Immunoprecipitation |
| R18233 | T22804 | T22805 | det | The,cells |
| R18234 | T22805 | T22807 | nsubjpass | cells,harvested |
| R18235 | T22806 | T22807 | auxpass | were,harvested |
| R18236 | T22807 | T22807 | ROOT | harvested,harvested |
| R18237 | T22808 | T22807 | cc | and,harvested |
| R18238 | T22809 | T22807 | conj | lysed,harvested |
| R18239 | T22810 | T22809 | prep | on,lysed |
| R18240 | T22811 | T22810 | pobj | ice,on |
| R18241 | T22812 | T22809 | prep | by,lysed |
| R18242 | T22813 | T22814 | nummod | 0.4,ml |
| R18243 | T22814 | T22812 | pobj | ml,by |
| R18244 | T22815 | T22814 | prep | of,ml |
| R18245 | T22816 | T22819 | det | the,buffer |
| R18246 | T22817 | T22819 | amod | modified,buffer |
| R18247 | T22818 | T22819 | compound | RIPA,buffer |
| R18248 | T22819 | T22815 | pobj | buffer,of |
| R18249 | T22820 | T22827 | punct | (,] |
| R18250 | T22821 | T22827 | nummod | 50,] |
| R18251 | T22822 | T22825 | compound | mM,pH |
| R18252 | T22823 | T22825 | compound | Tris-HCl,pH |
| R18253 | T22824 | T22825 | compound | [,pH |
| R18254 | T22825 | T22827 | nmod | pH,] |
| R18255 | T22826 | T22827 | nummod | 7.4,] |
| R18256 | T22827 | T22819 | appos | ],buffer |
| R18257 | T22828 | T22827 | punct | ",",] |
| R18258 | T22829 | T22830 | nummod | 1,% |
| R18259 | T22830 | T22831 | compound | %,NP-40 |
| R18260 | T22831 | T22827 | appos | NP-40,] |
| R18261 | T22832 | T22831 | punct | ",",NP-40 |
| R18262 | T22833 | T22834 | nummod | 0.25,% |
| R18263 | T22834 | T22835 | nsubj | %,Na-deoxycholate |
| R18264 | T22835 | T22831 | conj | Na-deoxycholate,NP-40 |
| R18265 | T22836 | T22835 | punct | ",",Na-deoxycholate |
| R18266 | T22837 | T22839 | nummod | 150,NaCl |
| R18267 | T22838 | T22839 | compound | mM,NaCl |
| R18268 | T22839 | T22835 | appos | NaCl,Na-deoxycholate |
| R18269 | T22840 | T22839 | punct | ",",NaCl |
| R18270 | T22841 | T22843 | nummod | 1,EDTA |
| R18271 | T22842 | T22843 | compound | mM,EDTA |
| R18272 | T22843 | T22839 | appos | EDTA,NaCl |
| R18273 | T22844 | T22843 | punct | ",",EDTA |
| R18274 | T22845 | T22847 | nummod | 1,PMSF |
| R18275 | T22846 | T22847 | compound | mM,PMSF |
| R18276 | T22847 | T22843 | appos | PMSF,EDTA |
| R18277 | T22848 | T22847 | punct | ",",PMSF |
| R18278 | T22849 | T22851 | nummod | 1,Na3VO4 |
| R18279 | T22850 | T22851 | compound | mM,Na3VO4 |
| R18280 | T22851 | T22847 | appos | Na3VO4,PMSF |
| R18281 | T22852 | T22851 | punct | ",",Na3VO4 |
| R18282 | T22853 | T22855 | nummod | 1,NaF |
| R18283 | T22854 | T22855 | compound | mM,NaF |
| R18284 | T22855 | T22851 | appos | NaF,Na3VO4 |
| R17630 | T22112 | T22118 | compound | Reporter,assays |
| R17631 | T22113 | T22118 | compound | Gene,assays |
| R17632 | T22114 | T22118 | compound | Assays,assays |
| R17633 | T22115 | T22118 | compound | Luciferase,assays |
| R17634 | T22116 | T22117 | compound | reporter,gene |
| R17635 | T22117 | T22118 | compound | gene,assays |
| R17636 | T22118 | T22120 | nsubjpass | assays,performed |
| R17637 | T22119 | T22120 | auxpass | were,performed |
| R17638 | T22120 | T22120 | ROOT | performed,performed |
| R17639 | T22121 | T22120 | prep | as,performed |
| R17640 | T22122 | T22123 | advmod | previously,described6 |
| R17641 | T22123 | T22121 | pobj | described6,as |
| R17642 | T22124 | T22120 | punct | .,performed |
| R17643 | T22125 | T22129 | advmod | Briefly,cotransfected |
| R17644 | T22126 | T22129 | punct | ",",cotransfected |
| R17645 | T22127 | T22129 | nsubjpass | cells,cotransfected |
| R17646 | T22128 | T22129 | auxpass | were,cotransfected |
| R17647 | T22129 | T22129 | ROOT | cotransfected,cotransfected |
| R17648 | T22130 | T22129 | prep | at,cotransfected |
| R17649 | T22131 | T22132 | det | a,ratio |
| R17650 | T22132 | T22130 | pobj | ratio,at |
| R17651 | T22133 | T22132 | prep | of,ratio |
| R17652 | T22134 | T22133 | pobj | 10:1,of |
| R17653 | T22135 | T22134 | prep | with,10:1 |
| R17654 | T22136 | T22140 | amod | various,constructs |
| R17655 | T22137 | T22140 | amod | promoter-driven,constructs |
| R17656 | T22138 | T22139 | advmod | firefly,luciferase |
| R17657 | T22139 | T22140 | amod | luciferase,constructs |
| R17658 | T22140 | T22135 | pobj | constructs,with |
| R17659 | T22141 | T22140 | prep | to,constructs |
| R17660 | T22142 | T22146 | det | the,plasmid |
| R17661 | T22143 | T22146 | compound | Renilla,plasmid |
| R17662 | T22144 | T22145 | compound | luciferase,pTKRL |
| R17663 | T22145 | T22146 | compound | pTKRL,plasmid |
| R17664 | T22146 | T22141 | pobj | plasmid,to |
| R17665 | T22147 | T22129 | punct | ",",cotransfected |
| R17741 | T22263 | T22265 | nsubjpass | assays,performed |
| R17742 | T22264 | T22265 | auxpass | was,performed |
| R17743 | T22265 | T22265 | ROOT | performed,performed |
| R17744 | T22266 | T22265 | prep | as,performed |
| R17745 | T22267 | T22268 | advmod | previously,described6 |
| R17746 | T22268 | T22266 | pobj | described6,as |
| R17747 | T22269 | T22265 | punct | .,performed |
| R17748 | T22270 | T22271 | det | The,primers |
| R17749 | T22271 | T22272 | nsubj | primers,used |
| R17750 | T22272 | T22272 | ROOT | used,used |
| R17751 | T22273 | T22274 | aux | to,amplify |
| R17752 | T22274 | T22272 | xcomp | amplify,used |
| R17753 | T22275 | T22277 | det | the,region |
| R17754 | T22276 | T22277 | compound | promoter,region |
| R17755 | T22277 | T22274 | dobj | region,amplify |
| R17756 | T22278 | T22293 | advmod | adjacent,been |
| R17757 | T22279 | T22278 | prep | to,adjacent |
| R17758 | T22280 | T22282 | det | the,sites |
| R17759 | T22281 | T22282 | amod | κB,sites |
| R17760 | T22282 | T22279 | pobj | sites,to |
| R17761 | T22283 | T22282 | prep | of,sites |
| R17762 | T22284 | T22283 | pobj | IL8,of |
| R17763 | T22285 | T22284 | cc | and,IL8 |
| R17764 | T22286 | T22284 | conj | NFKBIA,IL8 |
| R17765 | T22287 | T22282 | punct | ",",sites |
| R17766 | T22288 | T22290 | advmod | as,as |
| R17767 | T22289 | T22290 | advmod | well,as |
| R17768 | T22290 | T22282 | cc | as,sites |
| R17769 | T22291 | T22282 | conj | ACTB,sites |
| R17770 | T22292 | T22293 | aux | have,been |
| R17771 | T22293 | T22294 | auxpass | been,described6 |
| R17772 | T22294 | T22272 | conj | described6,used |
| R17773 | T22295 | T22272 | punct | .,used |
| R17891 | T22444 | T22437 | cc | and,fixed |
| R17892 | T22445 | T22447 | advmod | then,mounted |
| R17893 | T22446 | T22447 | nsubj | Cellspin,mounted |
| R17894 | T22447 | T22437 | conj | mounted,fixed |
| R17895 | T22448 | T22447 | prep | onto,mounted |
| R17896 | T22449 | T22448 | pobj | slides,onto |
| R17897 | T22450 | T22447 | punct | .,mounted |
| R17898 | T22451 | T22453 | det | The,cells |
| R17899 | T22452 | T22453 | amod | fixed,cells |
| R17900 | T22453 | T22456 | nsubjpass | cells,permeabilized |
| R17901 | T22454 | T22456 | auxpass | were,permeabilized |
| R17902 | T22455 | T22456 | advmod | then,permeabilized |
| R17903 | T22456 | T22456 | ROOT | permeabilized,permeabilized |
| R17904 | T22457 | T22456 | prep | with,permeabilized |
| R17905 | T22458 | T22459 | nummod | 0.05,% |
| R17906 | T22459 | T22461 | compound | %,X-100 |
| R17907 | T22460 | T22461 | compound | Triton,X-100 |
| R17908 | T22461 | T22457 | pobj | X-100,with |
| R17909 | T22462 | T22461 | prep | in,X-100 |
| R17910 | T22463 | T22462 | pobj | PBS,in |
| R17911 | T22464 | T22456 | cc | and,permeabilized |
| R17912 | T22465 | T22456 | conj | stained,permeabilized |
| R17913 | T22466 | T22465 | prep | with,stained |
| R17914 | T22467 | T22470 | amod | FITC-conjugated,antibodies |
| R17915 | T22468 | T22470 | nmod | rabbit,antibodies |
| R17916 | T22469 | T22470 | amod | anti-RPS3,antibodies |
| R17917 | T22470 | T22466 | pobj | antibodies,with |
| R17918 | T22471 | T22473 | punct | (,Biotech |
| R17919 | T22472 | T22473 | compound | Primm,Biotech |
| R17920 | T22473 | T22470 | appos | Biotech,antibodies |
| R17921 | T22474 | T22470 | punct | ),antibodies |
| R17922 | T22475 | T22465 | punct | ",",stained |
| R17923 | T22476 | T22465 | cc | or,stained |
| R17924 | T22477 | T22479 | nmod | AlexaFluor,rat |
| R17925 | T22478 | T22479 | amod | 594-conjugated,rat |
| R17926 | T22479 | T22481 | nmod | rat,antibodies |
| R17927 | T22480 | T22481 | amod | anti-Flag,antibodies |
| R17928 | T22481 | T22456 | conj | antibodies,permeabilized |
| R17929 | T22482 | T22481 | punct | (,antibodies |
| R17930 | T22483 | T22481 | appos | BD,antibodies |
| R17931 | T22484 | T22481 | punct | ),antibodies |
| R17932 | T22485 | T22481 | prep | for,antibodies |
| R17933 | T22486 | T22487 | nummod | 40,min |
| R17934 | T22487 | T22485 | pobj | min,for |
| R17935 | T22488 | T22489 | advmod | together,with |
| R17936 | T22489 | T22481 | prep | with,antibodies |
| R17937 | T22490 | T22491 | nummod | 1,μg |
| R17938 | T22491 | T22493 | compound | μg,ml |
| R17939 | T22492 | T22493 | compound | /,ml |
| R17940 | T22493 | T22489 | pobj | ml,with |
| R17941 | T22494 | T22493 | prep | of,ml |
| R17942 | T22495 | T22496 | compound | Hoechst,33342 |
| R17943 | T22496 | T22494 | pobj | 33342,of |
| R17944 | T22497 | T22498 | punct | (,Sigma |
| R17945 | T22498 | T22493 | appos | Sigma,ml |
| R17946 | T22499 | T22481 | punct | ),antibodies |
| R17947 | T22500 | T22481 | prep | for,antibodies |
| R17948 | T22501 | T22502 | nummod | 5,min |
| R17949 | T22502 | T22500 | pobj | min,for |
| R17950 | T22503 | T22502 | prep | at,min |
| R17951 | T22504 | T22505 | nummod | 25,° |
| R17952 | T22505 | T22503 | pobj | °,at |
| R17953 | T22506 | T22506 | ROOT | C,C |
| R17954 | T22507 | T22456 | punct | .,permeabilized |
| R17955 | T22508 | T22509 | det | The,slides |
| R17956 | T22509 | T22512 | nsubjpass | slides,rinsed |
| R17957 | T22510 | T22512 | auxpass | were,rinsed |
| R17958 | T22511 | T22512 | advmod | then,rinsed |
| R17959 | T22512 | T22512 | ROOT | rinsed,rinsed |
| R17960 | T22513 | T22512 | prep | with,rinsed |
| R17961 | T22514 | T22513 | pobj | PBS,with |
| R17962 | T22515 | T22516 | nummod | three,times |
| R17963 | T22516 | T22512 | npadvmod | times,rinsed |
| R17964 | T22517 | T22512 | cc | and,rinsed |
| R17965 | T22518 | T22512 | conj | cover,rinsed |
| R18341 | T22912 | T22911 | pobj | immunoprecipitation,to |
| R18342 | T22913 | T22910 | prep | by,subjected |
| R18343 | T22914 | T22913 | pcomp | adding,by |
| R18344 | T22915 | T22918 | nummod | 10,antibody |
| R18345 | T22916 | T22918 | amod | mg/ml,antibody |
| R18346 | T22917 | T22918 | amod | appropriate,antibody |
| R18347 | T22918 | T22914 | dobj | antibody,adding |
| R18348 | T22919 | T22918 | cc | plus,antibody |
| R18349 | T22920 | T22921 | nummod | 30,ml |
| R18350 | T22921 | T22918 | conj | ml,antibody |
| R18351 | T22922 | T22921 | prep | of,ml |
| R18352 | T22923 | T22922 | pobj | protein,of |
| R18353 | T22924 | T22921 | conj | G-agarose,ml |
| R18354 | T22925 | T22926 | punct | (,Roche |
| R18285 | T22856 | T22857 | punct | ),supplemented |
| R18286 | T22857 | T22807 | conj | supplemented,harvested |
| R18287 | T22858 | T22857 | prep | with,supplemented |
| R18288 | T22859 | T22863 | nummod | 1,cocktail |
| R18289 | T22860 | T22863 | nummod | ×,cocktail |
| R18290 | T22861 | T22863 | compound | protease,cocktail |
| R18291 | T22862 | T22863 | compound | inhibitor,cocktail |
| R18292 | T22863 | T22858 | pobj | cocktail,with |
| R18293 | T22864 | T22863 | punct | (,cocktail |
| R18294 | T22865 | T22863 | appos | Roche,cocktail |
| R18295 | T22866 | T22863 | punct | ),cocktail |
| R18296 | T22867 | T22863 | cc | and,cocktail |
| R18297 | T22868 | T22869 | nummod | 1,× |
| R18298 | T22869 | T22872 | nummod | ×,cocktail |
| R18299 | T22870 | T22872 | nmod | phosphatase,cocktail |
| R18300 | T22871 | T22872 | compound | inhibitor,cocktail |
| R18301 | T22872 | T22863 | conj | cocktail,cocktail |
| R18302 | T22873 | T22857 | conj | set,supplemented |
| R18303 | T22874 | T22873 | dobj | I,set |
| R18304 | T22875 | T22877 | punct | (,Biosciences |
| R18305 | T22876 | T22877 | compound | EMD,Biosciences |
| R18306 | T22877 | T22874 | appos | Biosciences,I |
| R18307 | T22878 | T22873 | punct | ),set |
| R18308 | T22879 | T22873 | prep | for,set |
| R18309 | T22880 | T22881 | nummod | 30,min |
| R18310 | T22881 | T22879 | pobj | min,for |
| R18311 | T22882 | T22807 | punct | .,harvested |
| R18312 | T22883 | T22884 | det | The,lysates |
| R18313 | T22884 | T22886 | nsubjpass | lysates,centrifuged |
| R18314 | T22885 | T22886 | auxpass | were,centrifuged |
| R18315 | T22886 | T22886 | ROOT | centrifuged,centrifuged |
| R18316 | T22887 | T22886 | prep | at,centrifuged |
| R18317 | T22888 | T22889 | nummod | "10,000",× |
| R18318 | T22889 | T22887 | pobj | ×,at |
| R18319 | T22890 | T22886 | advmod | g,centrifuged |
| R18320 | T22891 | T22886 | prep | at,centrifuged |
| R18321 | T22892 | T22893 | nummod | 4,° |
| R18322 | T22893 | T22891 | pobj | °,at |
| R18323 | T22894 | T22886 | conj | C,centrifuged |
| R18324 | T22895 | T22899 | mark | for,remove |
| R18325 | T22896 | T22897 | nummod | 10,min |
| R18326 | T22897 | T22899 | nsubj | min,remove |
| R18327 | T22898 | T22899 | aux | to,remove |
| R18328 | T22899 | T22886 | advcl | remove,centrifuged |
| R18329 | T22900 | T22901 | amod | insoluble,material |
| R18330 | T22901 | T22899 | dobj | material,remove |
| R18331 | T22902 | T22886 | punct | .,centrifuged |
| R18332 | T22903 | T22910 | prep | After,subjected |
| R18333 | T22904 | T22903 | pcomp | normalizing,After |
| R18334 | T22905 | T22906 | compound | protein,concentrations |
| R18335 | T22906 | T22904 | dobj | concentrations,normalizing |
| R18336 | T22907 | T22910 | punct | ",",subjected |
| R18337 | T22908 | T22910 | nsubjpass | lysates,subjected |
| R18338 | T22909 | T22910 | auxpass | were,subjected |
| R18339 | T22910 | T22910 | ROOT | subjected,subjected |
| R18340 | T22911 | T22910 | prep | to,subjected |
| R18521 | T23138 | T23152 | nsubjpass | ELISA,measured |
| R18522 | T23139 | T23140 | det | The,amount |
| R18523 | T23140 | T23152 | nsubjpass | amount,measured |
| R18524 | T23141 | T23140 | prep | of,amount |
| R18525 | T23142 | T23143 | compound | IL-8,present |
| R18526 | T23143 | T23141 | pobj | present,of |
| R18527 | T23144 | T23143 | prep | in,present |
| R18528 | T23145 | T23144 | pobj | supernatants,in |
| R18529 | T23146 | T23145 | acl | collected,supernatants |
| R18530 | T23147 | T23146 | prep | from,collected |
| R18531 | T23148 | T23150 | compound | Jurkat,culture |
| R18532 | T23149 | T23150 | compound | cell,culture |
| R18533 | T23150 | T23147 | pobj | culture,from |
| R18534 | T23151 | T23152 | auxpass | was,measured |
| R18535 | T23152 | T23152 | ROOT | measured,measured |
| R18536 | T23153 | T23152 | advcl | using,measured |
| R18537 | T23154 | T23156 | det | a,Interleukin-8 |
| R18538 | T23155 | T23156 | compound | Human,Interleukin-8 |
| R18539 | T23156 | T23153 | dobj | Interleukin-8,using |
| R18540 | T23157 | T23158 | compound | ELISA,Ready-SET-Go |
| R18541 | T23158 | T23159 | compound | Ready-SET-Go,kit |
| R18542 | T23159 | T23156 | appos | kit,Interleukin-8 |
| R18543 | T23160 | T23159 | punct | (,kit |
| R18544 | T23161 | T23159 | appos | eBioscience,kit |
| R18545 | T23162 | T23159 | punct | ),kit |
| R18546 | T23163 | T23152 | prep | according,measured |
| R18547 | T23164 | T23163 | prep | to,according |
| R18548 | T23165 | T23166 | det | the,manufacturer |
| R18549 | T23166 | T23168 | poss | manufacturer,instructions |
| R18550 | T23167 | T23166 | case | 's,manufacturer |
| R18551 | T23168 | T23164 | pobj | instructions,to |
| R18552 | T23169 | T23152 | punct | .,measured |
| R18571 | T23214 | T23216 | compound | Cell,HeLa |
| R18572 | T23215 | T23216 | compound | Infections,HeLa |
| R18573 | T23216 | T23217 | compound | HeLa,cells |
| R18574 | T23217 | T23219 | nsubjpass | cells,infected |
| R18575 | T23218 | T23219 | auxpass | were,infected |
| R18576 | T23219 | T23219 | ROOT | infected,infected |
| R18577 | T23220 | T23219 | prep | with,infected |
| R18578 | T23221 | T23223 | compound | E.,O157 |
| R18579 | T23222 | T23223 | compound | coli,O157 |
| R18580 | T23223 | T23220 | pobj | O157,with |
| R18581 | T23224 | T23223 | punct | :,O157 |
| R18582 | T23225 | T23223 | conj | H7,O157 |
| R18583 | T23226 | T23225 | cc | or,H7 |
| R18584 | T23227 | T23229 | compound | C.,strains |
| R18585 | T23228 | T23229 | compound | rodentium,strains |
| R18586 | T23229 | T23219 | npadvmod | strains,infected |
| R18587 | T23230 | T23231 | mark | as,described |
| R18588 | T23231 | T23219 | advcl | described,infected |
| R18589 | T23232 | T23231 | dobj | previously9,described |
| R18590 | T23233 | T23219 | punct | .,infected |
| R18630 | T23283 | T23284 | compound | Immunohistochemistry,Gnotobiotic |
| R18631 | T23284 | T23285 | compound | Gnotobiotic,piglets |
| R18632 | T23285 | T23287 | nsubjpass | piglets,infected |
| R18633 | T23286 | T23287 | auxpass | were,infected |
| R18634 | T23287 | T23287 | ROOT | infected,infected |
| R18635 | T23288 | T23287 | prep | with,infected |
| R18636 | T23289 | T23291 | compound | E.,O157 |
| R18637 | T23290 | T23291 | compound | coli,O157 |
| R18638 | T23291 | T23288 | pobj | O157,with |
| R18639 | T23292 | T23291 | punct | :,O157 |
| R18640 | T23293 | T23294 | compound | H7,strains |
| R18641 | T23294 | T23296 | nsubj | strains,described |
| R18642 | T23295 | T23296 | mark | as,described |
| R18643 | T23296 | T23287 | advcl | described,infected |
| R18644 | T23297 | T23296 | dobj | previously9,described |
| R18645 | T23298 | T23287 | punct | .,infected |
| R18646 | T23299 | T23301 | amod | Spiral,specimens |
| R18647 | T23300 | T23301 | compound | colon,specimens |
| R18648 | T23301 | T23303 | nsubjpass | specimens,collected |
| R18649 | T23302 | T23303 | auxpass | were,collected |
| R18650 | T23303 | T23303 | ROOT | collected,collected |
| R18651 | T23304 | T23303 | prep | at,collected |
| R18652 | T23305 | T23304 | pobj | necropsy,at |
| R18653 | T23306 | T23303 | cc | and,collected |
| R18654 | T23307 | T23303 | conj | embedded,collected |
| R18655 | T23308 | T23307 | prep | in,embedded |
| R18656 | T23309 | T23308 | pobj | paraffin,in |
| R18657 | T23310 | T23303 | punct | .,collected |
| R18658 | T23311 | T23312 | compound | Paraffin,sectioning |
| R18659 | T23312 | T23320 | nsubjpass | sectioning,performed |
| R18660 | T23313 | T23312 | cc | and,sectioning |
| R18661 | T23314 | T23320 | nsubjpass | immunohistochemical,performed |
| R18355 | T22926 | T22924 | appos | Roche,G-agarose |
| R18356 | T22927 | T22924 | punct | ),G-agarose |
| R18357 | T22928 | T22910 | punct | ",",subjected |
| R18358 | T22929 | T22910 | cc | and,subjected |
| R18359 | T22930 | T22910 | conj | rotated,subjected |
| R18360 | T22931 | T22930 | prep | for,rotated |
| R18361 | T22932 | T22933 | advmod | at,least |
| R18362 | T22933 | T22934 | advmod | least,2 |
| R18363 | T22934 | T22935 | nummod | 2,h |
| R18364 | T22935 | T22931 | pobj | h,for |
| R18365 | T22936 | T22930 | prep | at,rotated |
| R18366 | T22937 | T22938 | nummod | 4,° |
| R18367 | T22938 | T22936 | pobj | °,at |
| R18368 | T22939 | T22930 | conj | C,rotated |
| R18369 | T22940 | T22910 | punct | .,subjected |
| R18370 | T22941 | T22942 | det | The,precipitates |
| R18371 | T22942 | T22944 | nsubjpass | precipitates,washed |
| R18372 | T22943 | T22944 | auxpass | were,washed |
| R18373 | T22944 | T22944 | ROOT | washed,washed |
| R18374 | T22945 | T22946 | advmod | at,least |
| R18375 | T22946 | T22947 | advmod | least,five |
| R18376 | T22947 | T22949 | nummod | five,with |
| R18377 | T22948 | T22947 | quantmod | times,five |
| R18378 | T22949 | T22944 | prep | with,washed |
| R18379 | T22950 | T22952 | amod | cold,buffer |
| R18380 | T22951 | T22952 | compound | lysis,buffer |
| R18381 | T22952 | T22949 | pobj | buffer,with |
| R18382 | T22953 | T22952 | acl | followed,buffer |
| R18383 | T22954 | T22953 | agent | by,followed |
| R18384 | T22955 | T22954 | pobj | separation,by |
| R18385 | T22956 | T22955 | prep | by,separation |
| R18386 | T22957 | T22956 | pobj | SDS-PAGE,by |
| R18387 | T22958 | T22953 | prep | under,followed |
| R18388 | T22959 | T22962 | amod | reduced,conditions |
| R18389 | T22960 | T22959 | cc | and,reduced |
| R18390 | T22961 | T22962 | compound | denaturing,conditions |
| R18391 | T22962 | T22958 | pobj | conditions,under |
| R18392 | T22963 | T22944 | punct | .,washed |
| R18393 | T22964 | T22965 | compound | Nitrocellulose,membranes |
| R18394 | T22965 | T22967 | nsubjpass | membranes,blocked |
| R18395 | T22966 | T22967 | auxpass | were,blocked |
| R18396 | T22967 | T22967 | ROOT | blocked,blocked |
| R18397 | T22968 | T22967 | prep | in,blocked |
| R18398 | T22969 | T22970 | nummod | 5,% |
| R18399 | T22970 | T22972 | compound | %,milk |
| R18400 | T22971 | T22972 | compound | nonfat,milk |
| R18401 | T22972 | T22968 | pobj | milk,in |
| R18402 | T22973 | T22967 | prep | in,blocked |
| R18403 | T22974 | T22975 | nummod | 0.1,% |
| R18404 | T22975 | T22982 | npadvmod | %,probed |
| R18405 | T22976 | T22977 | quantmod | PBS-Tween,20 |
| R18406 | T22977 | T22982 | nsubj | 20,probed |
| R18407 | T22978 | T22977 | punct | (,20 |
| R18408 | T22979 | T22977 | quantmod | PBS-T,20 |
| R18409 | T22980 | T22977 | punct | ),20 |
| R18410 | T22981 | T22977 | punct | ",",20 |
| R18411 | T22982 | T22967 | conj | probed,blocked |
| R18412 | T22983 | T22982 | prep | with,probed |
| R18413 | T22984 | T22985 | amod | specific,antibodies |
| R18414 | T22985 | T22983 | pobj | antibodies,with |
| R18415 | T22986 | T22987 | mark | as,described |
| R18416 | T22987 | T22982 | advcl | described,probed |
| R18417 | T22988 | T22987 | dobj | previously6,described |
| R18418 | T22989 | T22982 | punct | .,probed |
| R18419 | T22990 | T22998 | prep | For,transferred |
| R18420 | T22991 | T22990 | pcomp | immunoblotting,For |
| R18421 | T22992 | T22991 | prep | of,immunoblotting |
| R18422 | T22993 | T22994 | amod | phosphorylated,proteins |
| R18423 | T22994 | T22992 | pobj | proteins,of |
| R18424 | T22995 | T22998 | punct | ",",transferred |
| R18425 | T22996 | T22998 | nsubjpass | gels,transferred |
| R18426 | T22997 | T22998 | auxpass | were,transferred |
| R18427 | T22998 | T22998 | ROOT | transferred,transferred |
| R18428 | T22999 | T22998 | prep | to,transferred |
| R18429 | T23000 | T23003 | amod | methanol-treated,membranes |
| R18430 | T23001 | T23003 | compound | polyvinylidene,membranes |
| R18431 | T23002 | T23003 | compound | chloride,membranes |
| R18432 | T23003 | T22999 | pobj | membranes,to |
| R18433 | T23004 | T22998 | punct | ",",transferred |
| R18434 | T23005 | T22998 | conj | retreated,transferred |
| R18435 | T23006 | T23005 | prep | with,retreated |
| R18436 | T23007 | T23006 | pobj | methanol,with |
| R18437 | T23008 | T23005 | punct | ",",retreated |
| R18438 | T23009 | T23005 | cc | and,retreated |
| R18439 | T23010 | T23005 | conj | dried,retreated |
| R18440 | T23011 | T23010 | prep | for,dried |
| R18441 | T23012 | T23013 | nummod | 30,min |
| R18442 | T23013 | T23011 | pobj | min,for |
| R18443 | T23014 | T22998 | punct | .,transferred |
| R18444 | T23015 | T23017 | nsubjpass | Blots,blocked |
| R18445 | T23016 | T23017 | auxpass | were,blocked |
| R18446 | T23017 | T23017 | ROOT | blocked,blocked |
| R18447 | T23018 | T23017 | prep | in,blocked |
| R18448 | T23019 | T23020 | nummod | 5,% |
| R18449 | T23020 | T23023 | compound | %,albumin |
| R18450 | T23021 | T23022 | amod | bovine,serum |
| R18451 | T23022 | T23023 | compound | serum,albumin |
| R18452 | T23023 | T23018 | pobj | albumin,in |
| R18453 | T23024 | T23017 | prep | in,blocked |
| R18454 | T23025 | T23026 | nummod | 0.1,% |
| R18455 | T23026 | T23024 | pobj | %,in |
| R18456 | T23027 | T23028 | nsubj | Tris,buffered |
| R18457 | T23028 | T23017 | advcl | buffered,blocked |
| R18458 | T23029 | T23028 | dobj | saline-Tween,buffered |
| R18459 | T23030 | T23029 | nummod | 20,saline-Tween |
| R18460 | T23031 | T23032 | punct | (,TBS-T |
| R18461 | T23032 | T23036 | nsubj | TBS-T,probed |
| R18462 | T23033 | T23032 | punct | ),TBS-T |
| R18463 | T23034 | T23032 | punct | ",",TBS-T |
| R18464 | T23035 | T23032 | cc | and,TBS-T |
| R18465 | T23036 | T23036 | ROOT | probed,probed |
| R18466 | T23037 | T23036 | prep | with,probed |
| R18467 | T23038 | T23039 | amod | specific,antibodies |
| R18468 | T23039 | T23037 | pobj | antibodies,with |
| R18469 | T23040 | T23041 | mark | as,described |
| R18470 | T23041 | T23042 | amod | described,previously46 |
| R18471 | T23042 | T23036 | dobj | previously46,probed |
| R18472 | T23043 | T23036 | punct | .,probed |
| R18473 | T23044 | T23046 | nsubjpass | Bands,imaged |
| R18474 | T23045 | T23046 | auxpass | were,imaged |
| R18475 | T23046 | T23046 | ROOT | imaged,imaged |
| R18476 | T23047 | T23046 | agent | by,imaged |
| R18477 | T23048 | T23051 | det | the,system |
| R18478 | T23049 | T23051 | compound | Super,system |
| R18479 | T23050 | T23051 | compound | Signaling,system |
| R18480 | T23051 | T23047 | pobj | system,by |
| R18481 | T23052 | T23051 | punct | (,system |
| R18482 | T23053 | T23051 | appos | Pierce,system |
| R18483 | T23054 | T23051 | punct | ),system |
| R18484 | T23055 | T23046 | prep | according,imaged |
| R18485 | T23056 | T23055 | prep | to,according |
| R18486 | T23057 | T23058 | det | the,manufacturer |
| R18487 | T23058 | T23060 | poss | manufacturer,instructions |
| R18488 | T23059 | T23058 | case | 's,manufacturer |
| R18489 | T23060 | T23056 | pobj | instructions,to |
| R18490 | T23061 | T23046 | punct | .,imaged |
| R223 | T289 | T265 | punct | .,is |
| R224 | T290 | T293 | advmod | However,is |
| R225 | T291 | T293 | punct | ",",is |
| R226 | T292 | T293 | nsubj | it,is |
| R227 | T293 | T293 | ROOT | is,is |
| R493 | T250 | T251 | compound | IKKβ,phosphorylation |
| R494 | T251 | T252 | nsubj | phosphorylation,regulates |
| R495 | T252 | T252 | ROOT | regulates,regulates |
| R496 | T253 | T255 | nummod | RPS3,translocation |
| R497 | T254 | T255 | amod | nuclear,translocation |
| R498 | T255 | T258 | nmod | translocation,function |
| R499 | T256 | T255 | cc | and,translocation |
| R500 | T257 | T258 | compound | NF-κB,function |
| R501 | T258 | T252 | dobj | function,regulates |
| R502 | T259 | T260 | compound | during Escherichia,coli O157 |
| R503 | T260 | T252 | npadvmod | coli O157,regulates |
| R504 | T261 | T260 | punct | :,coli O157 |
| R505 | T262 | T264 | compound | H7,NF-κB |
| R218 | T284 | T285 | nsubj | that,directs |
| R219 | T285 | T283 | relcl | directs,subunit |
| R220 | T286 | T288 | amod | specific,transcription |
| R221 | T287 | T288 | compound | gene,transcription |
| R18662 | T23315 | T23314 | prep | staining,immunohistochemical |
| R18663 | T23316 | T23314 | advcl | using,immunohistochemical |
| R18664 | T23317 | T23318 | amod | phospho-RPS3,antibody |
| R18665 | T23318 | T23316 | dobj | antibody,using |
| R18666 | T23319 | T23320 | auxpass | were,performed |
| R18667 | T23320 | T23320 | ROOT | performed,performed |
| R18668 | T23321 | T23320 | agent | by,performed |
| R18669 | T23322 | T23323 | compound | Histoserv,Inc. |
| R18670 | T23323 | T23321 | pobj | Inc.,by |
| R6542 | T8088 | T8088 | ROOT | observed,observed |
| R6543 | T8089 | T8100 | mark | that,eliminated |
| R6544 | T8090 | T8100 | nsubjpass | overexpressing,eliminated |
| R6545 | T8091 | T8094 | nmod | IKKβ,phosphorylation |
| R6546 | T8092 | T8094 | amod | enhanced,phosphorylation |
| R6547 | T8093 | T8094 | compound | Flag-RPS3,phosphorylation |
| R6548 | T8094 | T8090 | dobj | phosphorylation,overexpressing |
| R6549 | T8095 | T8090 | punct | ",",overexpressing |
| R6550 | T8096 | T8090 | cc | but,overexpressing |
| R6551 | T8097 | T8100 | nsubjpass | phosphorylation,eliminated |
| R6552 | T8098 | T8100 | auxpass | was,eliminated |
| R6553 | T8099 | T8100 | advmod | effectively,eliminated |
| R6554 | T8100 | T8088 | ccomp | eliminated,observed |
| R6555 | T8101 | T8100 | agent | by,eliminated |
| R6556 | T8102 | T8103 | amod | alanine,substitution |
| R6557 | T8103 | T8101 | pobj | substitution,by |
| R6558 | T8104 | T8100 | advcl | indicating,eliminated |
| R6559 | T8105 | T8107 | mark | that,is |
| R10422 | T12845 | T12846 | amod | RPS3-independent,genes |
| R12760 | T15858 | T15863 | advmod | Thus,required |
| R12761 | T15859 | T15861 | amod | NleH1,activity |
| R12762 | T15860 | T15861 | compound | kinase,activity |
| R12763 | T15861 | T15863 | nsubjpass | activity,required |
| R15621 | T19398 | T19399 | nsubj | that,influence |
| R15622 | T19399 | T19397 | relcl | influence,effects |
| R15623 | T19400 | T19401 | det | the,spread |
| R15624 | T19401 | T19399 | dobj | spread,influence |
| R15625 | T19402 | T19401 | prep | of,spread |
| R15626 | T19403 | T19402 | pobj | disease,of |
| R15627 | T19404 | T19407 | auxpass | are,understood |
| R15628 | T19405 | T19407 | advmod | often,understood |
| R15629 | T19406 | T19407 | advmod | poorly,understood |
| R15630 | T19407 | T19407 | ROOT | understood,understood |
| R15631 | T19408 | T19407 | prep | at,understood |
| R15632 | T19409 | T19411 | det | the,level |
| R15633 | T19410 | T19411 | amod | molecular,level |
| R222 | T288 | T285 | dobj | transcription,directs |
| R3334 | T4143 | T4144 | nsubj | activity,is |
| R3335 | T4144 | T4144 | ROOT | is,is |
| R3336 | T4145 | T4144 | acomp | necessary,is |
| R3337 | T4146 | T4145 | cc | and,necessary |
| R3338 | T4147 | T4145 | conj | sufficient,necessary |
| R3339 | T4148 | T4147 | prep | for,sufficient |
| R3340 | T4149 | T4151 | amod | RPS3,translocation |
| R3341 | T4150 | T4151 | amod | nuclear,translocation |
| R3342 | T4151 | T4148 | pobj | translocation,for |
| R4571 | T5692 | T5689 | conj | stimulated,enhanced |
| R4572 | T5693 | T5692 | dobj | cells,stimulated |
| R4573 | T5694 | T5696 | punct | (,3a |
| R4574 | T5695 | T5696 | compound | Fig.,3a |
| R4575 | T5696 | T5693 | appos | 3a,cells |
| R4576 | T5697 | T5693 | punct | ),cells |
| R4577 | T5698 | T5689 | punct | .,enhanced |
| R4578 | T5699 | T5702 | advmod | Therefore,examined |
| R4579 | T5700 | T5702 | punct | ",",examined |
| R4580 | T5701 | T5702 | nsubj | we,examined |
| R4581 | T5702 | T5702 | ROOT | examined,examined |
| R4582 | T5703 | T5705 | mark | whether,binding |
| R4583 | T5704 | T5705 | nsubj | RPS3,binding |
| R4636 | T5757 | T5758 | nsubj | We,measured |
| R4637 | T5758 | T5758 | ROOT | measured,measured |
| R4638 | T5759 | T5760 | det | the,association |
| R4639 | T5760 | T5758 | dobj | association,measured |
| R4640 | T5761 | T5760 | prep | of,association |
| R4641 | T5762 | T5761 | pobj | RPS3,of |
| R4642 | T5763 | T5762 | prep | with,RPS3 |
| R4643 | T5764 | T5763 | pobj | importin-α,with |
| R4644 | T5765 | T5764 | prep | in,importin-α |
| R4645 | T5766 | T5767 | amod | 293T,cells |
| R4646 | T5767 | T5765 | pobj | cells,in |
| R4647 | T5768 | T5758 | advcl | overexpressing,measured |
| R4648 | T5769 | T5770 | compound | wild-type,IκBα |
| R4649 | T5770 | T5768 | dobj | IκBα,overexpressing |
| R6464 | T8010 | T8011 | compound | CK2,protein |
| R6465 | T8011 | T8012 | nsubj | protein,was |
| R6466 | T8012 | T8012 | ROOT | was,was |
| R6467 | T8013 | T8012 | acomp | detectable,was |
| R6468 | T8014 | T8013 | prep | in,detectable |
| R6469 | T8015 | T8018 | poss | our,proteins |
| R6470 | T8016 | T8018 | amod | recombinant,proteins |
| R6471 | T8017 | T8018 | compound | IKK,proteins |
| R6472 | T8018 | T8014 | pobj | proteins,in |
| R6473 | T8019 | T8021 | punct | (,Fig. |
| R6474 | T8020 | T8021 | compound | Supplementary,Fig. |
| R6475 | T8021 | T8013 | appos | Fig.,detectable |
| R6476 | T8022 | T8021 | nummod | 6,Fig. |
| R6477 | T8023 | T8021 | punct | ),Fig. |
| R6478 | T8024 | T8012 | punct | .,was |
| R6479 | T8025 | T8030 | advmod | Thus,was |
| R6480 | T8026 | T8030 | punct | ",",was |
| R6481 | T8027 | T8029 | compound | RPS3,phosphorylation |
| R6482 | T8028 | T8029 | compound | S209,phosphorylation |
| R6483 | T8029 | T8030 | nsubj | phosphorylation,was |
| R6484 | T8030 | T8030 | ROOT | was,was |
| R6485 | T8031 | T8030 | acomp | due,was |
| R6486 | T8032 | T8031 | prep | to,due |
| R6487 | T8033 | T8035 | det | the,specificity |
| R6488 | T8034 | T8035 | amod | alternate,specificity |
| R6489 | T8035 | T8032 | pobj | specificity,to |
| R6490 | T8036 | T8035 | prep | of,specificity |
| R6491 | T8037 | T8039 | det | the,kinase |
| R6492 | T8038 | T8039 | compound | IKKβ,kinase |
| R6493 | T8039 | T8036 | pobj | kinase,of |
| R6494 | T8040 | T8041 | advmod | rather,than |
| R6495 | T8041 | T8039 | cc | than,kinase |
| R6496 | T8042 | T8044 | det | any,amount |
| R6497 | T8043 | T8044 | compound | trace,amount |
| R6498 | T8044 | T8031 | pobj | amount,due |
| R6499 | T8045 | T8044 | prep | of,amount |
| R6500 | T8046 | T8045 | pobj | CK2,of |
| R8203 | T10147 | T10148 | amod | RPS3,deficiency |
| R8204 | T10148 | T10146 | pobj | deficiency,by |
| R8205 | T10149 | T10151 | auxpass | was,restored |
| R8206 | T10150 | T10151 | advmod | completely,restored |
| R8207 | T10151 | T10151 | ROOT | restored,restored |
| R8208 | T10152 | T10151 | prep | by,restored |
| R8209 | T10153 | T10152 | pcomp | transfecting,by |
| R8210 | T10154 | T10153 | dobj | wild-type,transfecting |
| R8211 | T10155 | T10151 | punct | ",",restored |
| R8212 | T10156 | T10151 | cc | but,restored |
| R8213 | T10157 | T10158 | neg | not,by |
| R8214 | T10158 | T10151 | conj | by,restored |
| R8215 | T10159 | T10160 | compound | S209A,RPS3 |
| R8216 | T10160 | T10158 | pobj | RPS3,by |
| R8217 | T10161 | T10162 | punct | (,Fig. |
| R8218 | T10162 | T10160 | appos | Fig.,RPS3 |
| R8219 | T10163 | T10162 | nummod | 5d,Fig. |
| R8220 | T10164 | T10160 | punct | ),RPS3 |
| R8221 | T10165 | T10158 | punct | ",",by |
| R8222 | T10166 | T10158 | conj | despite,by |
| R8223 | T10167 | T10168 | amod | equivalent,expression |
| R8224 | T10168 | T10166 | pobj | expression,despite |
| R8225 | T10169 | T10170 | punct | (,Fig. |
| R8226 | T10170 | T10168 | appos | Fig.,expression |
| R8227 | T10171 | T10170 | nummod | 5c,Fig. |
| R8228 | T10172 | T10166 | punct | ),despite |
| R8229 | T10173 | T10151 | punct | .,restored |
| R15634 | T19411 | T19408 | pobj | level,at |
| R15635 | T19412 | T19407 | punct | .,understood |
| R15636 | T19413 | T19414 | poss | Our,data |
| R15637 | T19414 | T19415 | nsubj | data,elucidate |
| R15638 | T19415 | T19415 | ROOT | elucidate,elucidate |
| R15639 | T19416 | T19436 | advmod | how,influence |
| R15640 | T19417 | T19436 | dep | alterations,influence |
| R15641 | T19418 | T19417 | prep | in,alterations |
| R15642 | T19419 | T19421 | amod | selective,function |
| R15643 | T19420 | T19421 | compound | NF-κB,function |
| R15644 | T19421 | T19418 | pobj | function,in |
| R15645 | T19422 | T19421 | punct | ",",function |
| R15646 | T19423 | T19421 | acl | achieved,function |
| R15647 | T19424 | T19423 | prep | by,achieved |
| R15648 | T19425 | T19424 | pcomp | impeding,by |
UBERON-AE
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T728 | 2664-2668 | http://purl.obolibrary.org/obo/UBERON_0002415 | denotes | tail |
| T7049 | 10480-10489 | http://purl.obolibrary.org/obo/UBERON_0000062 | denotes | organisms |
| T7050 | 12059-12063 | http://purl.obolibrary.org/obo/UBERON_0002415 | denotes | tail |
| T11828 | 16005-16015 | http://purl.obolibrary.org/obo/UBERON_0000160 | denotes | intestinal |
| T11829 | 16005-16026 | http://purl.obolibrary.org/obo/UBERON_0001277 | denotes | intestinal epithelial |
| T13726 | 19142-19148 | http://purl.obolibrary.org/obo/UBERON_0001155 | denotes | colons |
| T20200 | 28315-28320 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
| T22539 | 34604-34608 | http://purl.obolibrary.org/obo/UBERON_0001913 | denotes | milk |
| T22540 | 34902-34907 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
| T23238 | 35570-35575 | http://purl.obolibrary.org/obo/UBERON_0001155 | denotes | colon |
GO-BP
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T1583 | 988-996 | http://purl.obolibrary.org/obo/GO_0007349 | denotes | cellular |
| T1584 | 1053-1066 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
| T1585 | 1951-1964 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
| T1586 | 1569-1579 | http://purl.obolibrary.org/obo/GO_0065007 | denotes | regulation |
| T1587 | 2457-2467 | http://purl.obolibrary.org/obo/GO_0065007 | denotes | regulation |
| T1588 | 1665-1680 | http://purl.obolibrary.org/obo/GO_0010467 | denotes | gene expression |
| T1589 | 1718-1737 | http://purl.obolibrary.org/obo/GO_0001816 | denotes | cytokine production |
| T1590 | 1867-1876 | http://purl.obolibrary.org/obo/GO_0046903 | denotes | secretion |
| T1591 | 1951-1979 | http://purl.obolibrary.org/obo/GO_0031555 | denotes | transcription by attenuating |
| T1592 | 2071-2087 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activating |
| T1593 | 2528-2544 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activation |
| T1594 | 2071-2095 | http://purl.obolibrary.org/obo/GO_1901224 | denotes | NF-κB activating signals |
| T1595 | 2088-2095 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signals |
| T1596 | 2820-2835 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T1597 | 3082-3104 | http://purl.obolibrary.org/obo/GO_0045087 | denotes | innate immune response |
| T1598 | 3082-3104 | http://purl.obolibrary.org/obo/GO_0002227 | denotes | innate immune response |
| T1599 | 3082-3104 | http://purl.obolibrary.org/obo/GO_0045088 | denotes | innate immune response |
| T1600 | 3082-3104 | http://purl.obolibrary.org/obo/GO_0002218 | denotes | innate immune response |
| T1601 | 3082-3104 | http://purl.obolibrary.org/obo/GO_0045089 | denotes | innate immune response |
| T1602 | 3082-3104 | http://purl.obolibrary.org/obo/GO_0045824 | denotes | innate immune response |
| T1603 | 3089-3104 | http://purl.obolibrary.org/obo/GO_0006955 | denotes | immune response |
| T2351 | 3131-3146 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T2352 | 3676-3691 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T2353 | 3787-3802 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T2354 | 3869-3884 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T2355 | 4008-4023 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T2356 | 3290-3298 | http://purl.obolibrary.org/obo/GO_0001906 | denotes | necrosis |
| T2357 | 3290-3298 | http://purl.obolibrary.org/obo/GO_0008219 | denotes | necrosis |
| T2358 | 3290-3298 | http://purl.obolibrary.org/obo/GO_0019835 | denotes | necrosis |
| T2359 | 3290-3298 | http://purl.obolibrary.org/obo/GO_0070265 | denotes | necrosis |
| T3039 | 4074-4107 | http://purl.obolibrary.org/obo/GO_1903721 | denotes | activation of the inhibitor of κB |
| T3040 | 4116-4119 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T3041 | 4225-4240 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T3042 | 4913-4928 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T3043 | 4715-4728 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
| T3044 | 4742-4760 | http://purl.obolibrary.org/obo/GO_0008283 | denotes | cell proliferation |
| T4265 | 5278-5295 | http://purl.obolibrary.org/obo/GO_0007097 | denotes | nuclear migration |
| T4266 | 6681-6697 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activating |
| T6175 | 6713-6724 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
| T6176 | 7311-7322 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
| T6177 | 7464-7475 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
| T6178 | 7683-7694 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
| T6179 | 8479-8490 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
| T6180 | 8687-8698 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
| T6181 | 8880-8891 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
| T6182 | 9074-9085 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
| T6183 | 6781-6795 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
| T6184 | 6848-6860 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
| T6185 | 6861-6867 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signal |
| T6186 | 8782-8788 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signal |
| T6187 | 9223-9229 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signal |
| T6188 | 7214-7235 | http://purl.obolibrary.org/obo/GO_0005049 | denotes | binding to importin-α |
| T6189 | 7282-7298 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activation |
| T6190 | 8765-8781 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activation |
| T6191 | 7663-7678 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T6192 | 9054-9069 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T6193 | 9248-9263 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T6194 | 8502-8505 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T6195 | 8765-8788 | http://purl.obolibrary.org/obo/GO_1901224 | denotes | NF-κB activation signal |
| T6196 | 8843-8860 | http://purl.obolibrary.org/obo/GO_0051169 | denotes | nuclear transport |
| T6197 | 8851-8860 | http://purl.obolibrary.org/obo/GO_0006810 | denotes | transport |
| T8269 | 9485-9488 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T8270 | 9636-9639 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T8271 | 11005-11008 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T8272 | 11255-11258 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T8273 | 10520-10526 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signal |
| T8274 | 10520-10534 | http://purl.obolibrary.org/obo/GO_0007165 | denotes | signal pathway |
| T8275 | 10805-10820 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T8276 | 10859-10874 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T8277 | 11175-11190 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T8278 | 11308-11323 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T8279 | 11689-11704 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T8280 | 11710-11725 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T8281 | 11838-11853 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T10669 | 12116-12131 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | Phosphorylation |
| T10670 | 12193-12208 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T10671 | 13023-13038 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T10672 | 13140-13155 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T10673 | 14230-14245 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T10677 | 13059-13075 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activation |
| T10678 | 14479-14495 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activation |
| T10679 | 12397-12415 | http://purl.obolibrary.org/obo/GO_0006986 | denotes | heat-shock protein |
| T10680 | 12397-12415 | http://purl.obolibrary.org/obo/GO_0034620 | denotes | heat-shock protein |
| T10681 | 12397-12415 | http://purl.obolibrary.org/obo/GO_0042026 | denotes | heat-shock protein |
| T10682 | 13751-13757 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signal |
| T10683 | 13956-13975 | http://purl.obolibrary.org/obo/GO_0045289 | denotes | luciferase activity |
| T10684 | 13956-13975 | http://purl.obolibrary.org/obo/GO_0047077 | denotes | luciferase activity |
| T10685 | 13956-13975 | http://purl.obolibrary.org/obo/GO_0047712 | denotes | luciferase activity |
| T10686 | 13956-13975 | http://purl.obolibrary.org/obo/GO_0050248 | denotes | luciferase activity |
| T10687 | 13956-13975 | http://purl.obolibrary.org/obo/GO_0050397 | denotes | luciferase activity |
| T10688 | 14006-14017 | http://purl.obolibrary.org/obo/GO_0006412 | denotes | translation |
| T10689 | 15277-15292 | http://purl.obolibrary.org/obo/GO_0072606 | denotes | IL-8) secretion |
| T10690 | 15277-15292 | http://purl.obolibrary.org/obo/GO_2000482 | denotes | IL-8) secretion |
| T10691 | 15283-15292 | http://purl.obolibrary.org/obo/GO_0046903 | denotes | secretion |
| T10692 | 15328-15331 | http://purl.obolibrary.org/obo/GO_0006283 | denotes | TCR |
| T13010 | 15817-15832 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13011 | 16328-16343 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13012 | 16555-16570 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13013 | 16830-16845 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13014 | 17117-17132 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13015 | 17190-17205 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13016 | 17324-17339 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13017 | 17581-17596 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13018 | 17738-17753 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13019 | 17838-17853 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13020 | 18433-18448 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T13021 | 16054-16067 | http://purl.obolibrary.org/obo/GO_0032088 | denotes | inhibit NF-κB |
| T13022 | 16054-16067 | http://purl.obolibrary.org/obo/GO_0007252 | denotes | inhibit NF-κB |
| T13023 | 16431-16447 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activation |
| T13024 | 16676-16679 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T13025 | 16699-16710 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
| T13026 | 17924-17937 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
| T13027 | 18386-18401 | http://purl.obolibrary.org/obo/GO_0006955 | denotes | immune response |
| T14164 | 18541-18556 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T14165 | 19031-19046 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T14166 | 19535-19550 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T14167 | 18830-18851 | http://purl.obolibrary.org/obo/GO_0006954 | denotes | inflammatory response |
| T16692 | 19849-19864 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16693 | 20346-20361 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16694 | 20489-20504 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16695 | 20807-20822 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16696 | 20963-20978 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16697 | 21016-21031 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16698 | 21118-21133 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16699 | 21484-21499 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16700 | 21556-21571 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16701 | 21681-21696 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16702 | 22748-22763 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16703 | 22958-22973 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16704 | 23512-23527 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16705 | 23593-23608 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16706 | 23700-23715 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16707 | 23881-23896 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T16708 | 20115-20130 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
| T16709 | 20426-20441 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
| T16710 | 21268-21283 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
| T16711 | 21634-21649 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
| T16712 | 20715-20734 | http://purl.obolibrary.org/obo/GO_0045289 | denotes | luciferase activity |
| T16713 | 20715-20734 | http://purl.obolibrary.org/obo/GO_0047077 | denotes | luciferase activity |
| T16714 | 20715-20734 | http://purl.obolibrary.org/obo/GO_0047712 | denotes | luciferase activity |
| T16715 | 20715-20734 | http://purl.obolibrary.org/obo/GO_0050248 | denotes | luciferase activity |
| T16716 | 20715-20734 | http://purl.obolibrary.org/obo/GO_0050397 | denotes | luciferase activity |
| T16717 | 22467-22482 | http://purl.obolibrary.org/obo/GO_0038061 | denotes | NF-κB signaling |
| T16718 | 22473-22482 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signaling |
| T16719 | 23258-23261 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T16720 | 23425-23428 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T16721 | 23619-23622 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T16722 | 23969-23991 | http://purl.obolibrary.org/obo/GO_0045087 | denotes | innate immune response |
| T16723 | 23969-23991 | http://purl.obolibrary.org/obo/GO_0002227 | denotes | innate immune response |
| T16724 | 23969-23991 | http://purl.obolibrary.org/obo/GO_0045088 | denotes | innate immune response |
| T16725 | 23969-23991 | http://purl.obolibrary.org/obo/GO_0002218 | denotes | innate immune response |
| T16726 | 23969-23991 | http://purl.obolibrary.org/obo/GO_0045089 | denotes | innate immune response |
| T16727 | 23969-23991 | http://purl.obolibrary.org/obo/GO_0045824 | denotes | innate immune response |
| T16728 | 23976-23991 | http://purl.obolibrary.org/obo/GO_0006955 | denotes | immune response |
| T19593 | 24147-24163 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activation |
| T19594 | 25572-25588 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activation |
| T19595 | 24147-24173 | http://purl.obolibrary.org/obo/GO_1901224 | denotes | NF-κB activation signaling |
| T19596 | 25572-25598 | http://purl.obolibrary.org/obo/GO_1901224 | denotes | NF-κB activation signaling |
| T19597 | 24164-24173 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signaling |
| T19598 | 25589-25598 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signaling |
| T19599 | 25797-25806 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signaling |
| T19600 | 26147-26156 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signaling |
| T19601 | 26514-26523 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signaling |
| T19602 | 26587-26596 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signaling |
| T19603 | 24297-24312 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T19604 | 24740-24755 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T19605 | 24870-24885 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T19606 | 25195-25210 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T19607 | 25459-25474 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T19608 | 25711-25726 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T19609 | 26029-26044 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T19610 | 26278-26293 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T19611 | 24364-24378 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
| T19612 | 24619-24622 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T19613 | 25362-25365 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T19614 | 25421-25424 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T19615 | 24992-25005 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
| T19616 | 26760-26773 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
| T19617 | 25635-25647 | http://purl.obolibrary.org/obo/GO_0009405 | denotes | pathogenesis |
| T19618 | 25791-25806 | http://purl.obolibrary.org/obo/GO_0038061 | denotes | NF-κB signaling |
| T19619 | 26141-26156 | http://purl.obolibrary.org/obo/GO_0038061 | denotes | NF-κB signaling |
| T19620 | 26508-26523 | http://purl.obolibrary.org/obo/GO_0038061 | denotes | NF-κB signaling |
| T19621 | 26581-26596 | http://purl.obolibrary.org/obo/GO_0038061 | denotes | NF-κB signaling |
| T19622 | 26214-26229 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
| T19623 | 26745-26773 | http://purl.obolibrary.org/obo/GO_0031555 | denotes | attenuates the transcription |
| T20447 | 28838-28850 | http://purl.obolibrary.org/obo/GO_0009293 | denotes | Transduction |
| T21326 | 30656-30659 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T21520 | 31336-31345 | http://purl.obolibrary.org/obo/GO_0007586 | denotes | digestion |
| T21676 | 31430-31434 | http://purl.obolibrary.org/obo/GO_0016246 | denotes | RNAi |
| T23071 | 34039-34050 | http://purl.obolibrary.org/obo/GO_0016791 | denotes | phosphatase |
| T23072 | 34463-34468 | http://purl.obolibrary.org/obo/GO_0019835 | denotes | lysis |
| T432 | 5-20 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T433 | 369-384 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T434 | 598-613 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T435 | 165-181 | http://purl.obolibrary.org/obo/GO_0006955 | denotes | immune responses |
| T436 | 261-274 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
| T437 | 435-447 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
| T438 | 541-550 | http://purl.obolibrary.org/obo/GO_0009405 | denotes | virulence |
| T439 | 541-550 | http://purl.obolibrary.org/obo/GO_0016032 | denotes | virulence |
| T10674 | 14382-14397 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T10675 | 15683-15698 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
| T10676 | 12266-12282 | http://purl.obolibrary.org/obo/GO_0051092 | denotes | NF-κB activation |
GO-MF
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T440 | 186-203 | http://purl.obolibrary.org/obo/GO_0003735 | denotes | ribosomal protein |
| T1604 | 1294-1311 | http://purl.obolibrary.org/obo/GO_0003735 | denotes | ribosomal protein |
| T1605 | 1471-1482 | http://purl.obolibrary.org/obo/GO_0003677 | denotes | DNA binding |
| T1606 | 1475-1482 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
| T1607 | 2220-2227 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
| T1608 | 1636-1650 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | immunoglobulin |
| T1609 | 2220-2231 | http://purl.obolibrary.org/obo/GO_0003723 | denotes | binding RNA |
| T2360 | 3701-3711 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T3045 | 4116-4119 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T6198 | 7214-7221 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
| T6199 | 7214-7235 | http://purl.obolibrary.org/obo/GO_0005049 | denotes | binding to importin-α |
| T6200 | 8502-8505 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T8282 | 9485-9488 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T8283 | 9636-9639 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T8284 | 11005-11008 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T8285 | 11255-11258 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T8286 | 11903-11911 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
| T13028 | 16676-16679 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T14168 | 19228-19236 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
| T16729 | 20115-20130 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
| T16730 | 20426-20441 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
| T16731 | 21268-21283 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
| T16732 | 21634-21649 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
| T16733 | 20715-20734 | http://purl.obolibrary.org/obo/GO_0045289 | denotes | luciferase activity |
| T16734 | 20715-20734 | http://purl.obolibrary.org/obo/GO_0047077 | denotes | luciferase activity |
| T16735 | 20715-20734 | http://purl.obolibrary.org/obo/GO_0047712 | denotes | luciferase activity |
| T20448 | 28480-28490 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T20449 | 28643-28653 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T20450 | 28737-28747 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T20451 | 28814-28824 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T20452 | 28924-28934 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T20453 | 29032-29042 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T20454 | 29153-29161 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
| T20969 | 30237-30245 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
| T21327 | 30656-30659 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T22528 | 33479-33489 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T22529 | 33550-33560 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T23073 | 34039-34050 | http://purl.obolibrary.org/obo/GO_0016791 | denotes | phosphatase |
| T23074 | 34317-34325 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
| T23075 | 34661-34671 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T23076 | 34989-34999 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
| T23175 | 35151-35155 | http://purl.obolibrary.org/obo/GO_0005153 | denotes | IL-8 |
| T23328 | 35711-35719 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
| T10694 | 13956-13975 | http://purl.obolibrary.org/obo/GO_0045289 | denotes | luciferase activity |
| T10695 | 13956-13975 | http://purl.obolibrary.org/obo/GO_0047077 | denotes | luciferase activity |
| T10696 | 13956-13975 | http://purl.obolibrary.org/obo/GO_0047712 | denotes | luciferase activity |
| T10697 | 13956-13975 | http://purl.obolibrary.org/obo/GO_0050248 | denotes | luciferase activity |
| T10698 | 13956-13975 | http://purl.obolibrary.org/obo/GO_0050397 | denotes | luciferase activity |
| T10699 | 15274-15279 | http://purl.obolibrary.org/obo/GO_0005153 | denotes | 8 (IL |
| T16736 | 20715-20734 | http://purl.obolibrary.org/obo/GO_0050248 | denotes | luciferase activity |
| T16737 | 20715-20734 | http://purl.obolibrary.org/obo/GO_0050397 | denotes | luciferase activity |
| T16738 | 23258-23261 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T16739 | 23425-23428 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T16740 | 23619-23622 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T19624 | 24619-24622 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T19625 | 25362-25365 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T19626 | 25421-25424 | http://purl.obolibrary.org/obo/GO_0008384 | denotes | IKK |
| T19627 | 26214-26229 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
GO-CC
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T2362 | 3394-3399 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T2363 | 3636-3641 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T2364 | 3701-3711 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T2365 | 3701-3711 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T3046 | 4600-4605 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T3047 | 4742-4746 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
| T4267 | 5386-5391 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T4268 | 5979-5984 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T4269 | 6268-6273 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T4270 | 6356-6361 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T4271 | 6421-6426 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T4272 | 6505-6510 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T4273 | 6345-6361 | http://purl.obolibrary.org/obo/GO_0005634 | denotes | nucleus in cells |
| T6201 | 7161-7166 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T6202 | 7576-7581 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T6203 | 7699-7704 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T6204 | 7845-7850 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T6205 | 8259-8264 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T6206 | 8421-8426 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T8287 | 11522-11527 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T8288 | 11618-11623 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T8289 | 11903-11911 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
| T8290 | 11903-11911 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
| T10700 | 12361-12366 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T10701 | 14108-14113 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T13029 | 16864-16869 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T13030 | 17024-17029 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T13031 | 17053-17058 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T13032 | 17236-17241 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T13033 | 17358-17363 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T13034 | 18025-18030 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T13035 | 18101-18106 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T14169 | 18957-18961 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
| T14170 | 19228-19236 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
| T14171 | 19228-19236 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
| T16741 | 20268-20273 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T16742 | 20831-20836 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T16743 | 20897-20902 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T16744 | 21152-21157 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T16745 | 22134-22139 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T16746 | 22333-22338 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T16747 | 22454-22459 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T16748 | 22600-22605 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T16749 | 23964-23968 | http://purl.obolibrary.org/obo/GO_0018995 | denotes | host |
| T19639 | 25888-25893 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T19640 | 26384-26389 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T20455 | 28240-28245 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T20456 | 28945-28949 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
| T20457 | 28480-28490 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T20458 | 28643-28653 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T20459 | 28737-28747 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T20460 | 28814-28824 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T20461 | 28924-28934 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T20462 | 29032-29042 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T20463 | 29153-29161 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
| T20464 | 28480-28490 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T20465 | 28643-28653 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T20466 | 28737-28747 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T20467 | 28814-28824 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T20468 | 28924-28934 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T20469 | 29032-29042 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T20470 | 29153-29161 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
| T20970 | 29954-29959 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T20971 | 30166-30170 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
| T20972 | 30237-30245 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
| T20973 | 30237-30245 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
| T21677 | 31725-31730 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T21678 | 31740-31745 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T22029 | 31906-31911 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T22186 | 32624-32629 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T22302 | 32949-32958 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | Chromatin |
| T22530 | 33268-33273 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T22531 | 33367-33372 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T22532 | 33479-33489 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T22533 | 33550-33560 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T22534 | 33479-33489 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T22535 | 33550-33560 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T23077 | 33780-33785 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T23078 | 34317-34325 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
| T23079 | 34661-34671 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T23080 | 34989-34999 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
| T23081 | 34317-34325 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
| T23082 | 34661-34671 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T23083 | 34989-34999 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
| T23084 | 34567-34576 | http://purl.obolibrary.org/obo/GO_0016020 | denotes | membranes |
| T23085 | 34811-34820 | http://purl.obolibrary.org/obo/GO_0016020 | denotes | membranes |
| T23176 | 35202-35206 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
| T23236 | 35340-35344 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
| T23237 | 35361-35366 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T23329 | 35711-35719 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
| T23330 | 35711-35719 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
| T1610 | 1758-1762 | http://purl.obolibrary.org/obo/GO_0018995 | denotes | host |
| T1611 | 2243-2264 | http://purl.obolibrary.org/obo/GO_0022627 | denotes | 40S ribosomal subunit |
| T1612 | 2247-2264 | http://purl.obolibrary.org/obo/GO_0044391 | denotes | ribosomal subunit |
| T2361 | 3332-3337 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T10702 | 14515-14520 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T10703 | 15631-15636 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
| T10704 | 14326-14335 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | chromatin |
| T10705 | 14462-14471 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | chromatin |
| T10706 | 15328-15331 | http://purl.obolibrary.org/obo/GO_0042101 | denotes | TCR |
| T10707 | 15538-15550 | http://purl.obolibrary.org/obo/GO_0009986 | denotes | cell surface |
| T19628 | 24244-24251 | http://purl.obolibrary.org/obo/GO_0005634 | denotes | nucleus |
| T19629 | 25786-25790 | http://purl.obolibrary.org/obo/GO_0018995 | denotes | host |
| T19630 | 25883-25887 | http://purl.obolibrary.org/obo/GO_0018995 | denotes | host |
| T19631 | 26379-26383 | http://purl.obolibrary.org/obo/GO_0018995 | denotes | host |
| T19632 | 26503-26507 | http://purl.obolibrary.org/obo/GO_0018995 | denotes | host |
| T19633 | 26576-26580 | http://purl.obolibrary.org/obo/GO_0018995 | denotes | host |
| T19634 | 27154-27158 | http://purl.obolibrary.org/obo/GO_0018995 | denotes | host |
| T19635 | 27342-27346 | http://purl.obolibrary.org/obo/GO_0018995 | denotes | host |
| T19636 | 27510-27514 | http://purl.obolibrary.org/obo/GO_0018995 | denotes | host |
| T19637 | 25883-25893 | http://purl.obolibrary.org/obo/GO_0043657 | denotes | host cells |
| T19638 | 26379-26389 | http://purl.obolibrary.org/obo/GO_0043657 | denotes | host cells |
sentences
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T779 | 939-1134 | Sentence | denotes | Nuclear Factor-kappa B (NF-κB) regulates crucial cellular functions and diverse stimuli activate this pleiotropic transcription factor, which in turn regulates a vast array of genetic targets1-3. |
| T780 | 1135-1247 | Sentence | denotes | The best-known mammalian NF-κB subunits are Rel proteins, including RelA (p65), RelB, c-Rel, p50, and p52 (refs. |
| T781 | 1248-1254 | Sentence | denotes | 4, 5). |
| T782 | 1255-1382 | Sentence | denotes | However, we recently demonstrated that ribosomal protein S3 (RPS3) is a key non-Rel subunit of certain native NF-κB complexes6. |
| T783 | 1383-1563 | Sentence | denotes | RPS3 is defined as a “specifier” subunit of NF-κB, because it facilitates high affinity DNA binding thus determining the regulatory specificity of NF-κB for selected target genes7. |
| T784 | 1564-1822 | Sentence | denotes | RPS3 regulation of NF-κB governs key physiological processes, including immunoglobulin κ light chain gene expression and receptor editing in B cells6, 8, cytokine production in T cells6, and in host defense against enterohemorrhagic Escherichia coli (EHEC)9. |
| T785 | 1823-2044 | Sentence | denotes | In particular, the E. coli O157:H7 type III secretion system (T3SS) effector protein NleH1 selectively blocks NF-κB target gene transcription by attenuating RPS3 nuclear translocation, without affecting p65 localization9. |
| T786 | 2045-2211 | Sentence | denotes | Nonetheless, how specific NF-κB activating signals induce RPS3 nuclear translocation is unknown. Extra-ribosomal functions have been ascribed to ribosomal proteins10. |
| T787 | 2212-2337 | Sentence | denotes | Besides binding RNA within the 40S ribosomal subunit, RPS3 participates in transcription6, DNA repair11, 12, and apoptosis13. |
| T788 | 2338-2404 | Sentence | denotes | Whether or not RPS3 is phosphorylated had been controversial14-18. |
| T789 | 2405-2593 | Sentence | denotes | Since kinase cascades play a critical role in NF-κB regulation, we tested whether RPS3 is phosphorylated in the context of NF-κB activation and sought to identify the responsible kinase19. |
| T790 | 2594-2809 | Sentence | denotes | Additionally, we aimed to define a regulatory role for the C-terminal tail of RPS3 whose function was unknown. Here we show that the Inhibitor of κB (IκB) kinase beta (IKKβ) phosphorylated RPS3 at serine 209 (S209). |
| T791 | 2810-2954 | Sentence | denotes | RPS3 S209 phosphorylation enhanced its association with importin-α, mediating RPS3 entry into the karyopherin pathway for nuclear translocation. |
| T792 | 2955-3115 | Sentence | denotes | Furthermore, the E. coli NleH1 effector specifically inhibited RPS3 S209 revealing how E. coli O157:H7 inhibits this important innate immune response mechanism. |
| T2011 | 3126-3178 | Sentence | denotes | RPS3 phosphorylation in response to NF-κB activation |
| T2012 | 3179-3338 | Sentence | denotes | To test whether RPS3 is phosphorylated during NF-κB activation, we performed 32P-labeling experiments in tumor necrosis factor (TNF)-stimulated HEK 293T cells. |
| T2013 | 3339-3520 | Sentence | denotes | While RPS3 was scarcely phosphorylated in unstimulated cells, we observed a marked increase in 32P-incorporation after TNF stimulation despite no increase in RPS3 protein (Fig. 1a). |
| T2014 | 3521-3712 | Sentence | denotes | To determine which RPS3 residues were phosphorylated, we immunoprecipitated RPS3 from either resting or stimulated cells and performed immunoblotting with phosphorylation-specific antibodies. |
| T2015 | 3713-3966 | Sentence | denotes | Both TNF and phorbol myristate acetate/ionomycin (PMA+I) stimulated rapid phosphorylation and degradaion of IκBα within 5 min which was accompanied by RPS3 phosphorylation on serine residues (Fig. 1b and data not shown), similar to the in vivo labeling. |
| T2016 | 3967-4042 | Sentence | denotes | We did not detect tyrosine- or threonine-phosphorylation of RPS3 (Fig. 1b). |
| T2634 | 4044-4069 | Sentence | denotes | RPS3 and IKKβ interaction |
| T2635 | 4070-4310 | Sentence | denotes | The activation of the inhibitor of κB kinase (IKK), consisting of a regulatory subunit IKKγ and two catalytic subunits, IKKα and IKKβ, is critical for the phosphorylation and dispatch of the inhibitory IκBs and the liberation of NF-κB20-22. |
| T2636 | 4311-4488 | Sentence | denotes | Given that RPS3 can be found in the cytoplasmic p65-p50-IκBα inhibitory complex in resting cells6, we hypothesized that activated IKKβ might also bind to and phosphorylate RPS3. |
| T2637 | 4489-4567 | Sentence | denotes | First, we found that ectopically expressed IKKβ and RPS3 interacted (Fig. 1c). |
| T2638 | 4568-4774 | Sentence | denotes | We next examined resting Jurkat cells and detected a modest endogenous IKKβ-RPS3 interaction (Fig. 1d), potentially accounting for the basal NF-κB transcription required for cell proliferation and survival. |
| T2639 | 4775-4939 | Sentence | denotes | RPS3-IKKβ association was clearly augmented upon TNF stimulation, peaking at 10 min. (Fig. 1d), following similar kinetics to RPS3 serine phosphorylation (Fig. 1b). |
| T2640 | 4940-5021 | Sentence | denotes | By contrast, there was no detectable interaction between RPS3 and IKKα (Fig. 1d). |
| T3532 | 5023-5070 | Sentence | denotes | IKKβ is required for RPS3 nuclear translocation |
| T3533 | 5071-5319 | Sentence | denotes | To examine whether the RPS3-IKKβ interaction is required for RPS3 nuclear translocation, we knocked down IKKα or IKKβ expression with siRNAs (Supplementary Fig. 1) and then observed stimulation-induced RPS3 nuclear migration by confocal microscopy. |
| T3534 | 5320-5455 | Sentence | denotes | Both TNF and PMA+I triggered RPS3 nuclear translocation in Jurkat cells transfected with a scrambled nonspecific (NS) siRNA (Fig. 2a)6. |
| T3535 | 5456-5540 | Sentence | denotes | RPS3 nuclear translocation was only slightly, if at all, impaired by IKKα-silencing. |
| T3536 | 5541-5650 | Sentence | denotes | Conversely, knockdown of IKKβ attenuated 60-70% of RPS3 nuclear accumulation following stimulation (Fig. 2a). |
| T3537 | 5651-5815 | Sentence | denotes | Immunoblotting of nuclear fractions confirmed that full expression of IKKβ, but not IKKα, was necessary for activation-induced RPS3 nuclear translocation (Fig. 2b). |
| T3538 | 5816-5924 | Sentence | denotes | Control immunoblots revealed that p65 nuclear translocation was blocked under the same conditions (Fig. 2b). |
| T3539 | 5925-6087 | Sentence | denotes | We next examined the nuclear translocation of RPS3 in cells ectopically expressing either kinase-dead (SSAA) or constitutively-active (SSEE) mutant IKKβ proteins. |
| T3540 | 6088-6209 | Sentence | denotes | As expected, the SSEE, but not SSAA, mutant of IKKβ induced NF-κB-dependent luciferase reporter activity (Fig. 2c, left). |
| T3541 | 6210-6402 | Sentence | denotes | Whereas RPS3 remained cytosolic in IKKβ (SSAA)-expressing cells (Fig. 2c, right), a substantial proportion of RPS3 translocated to the nucleus in cells expressing IKKβ (SSEE) (Fig. 2c, right). |
| T3542 | 6403-6586 | Sentence | denotes | The percentage of cells containing detectable nuclear RPS3 increased 5-fold in IKKβ (SSEE)-expressing cells, but not in IKKβ (SSAA)-expressing ones (Fig. 2d and Supplementary Fig. 2). |
| T3543 | 6587-6706 | Sentence | denotes | Thus, IKKβ activity is necessary and sufficient for RPS3 nuclear translocation in response to NF-κB activating stimuli. |
| T5142 | 6708-6755 | Sentence | denotes | IκBα degradation and RPS3 nuclear translocation |
| T5143 | 6756-6824 | Sentence | denotes | Importin-α regulates the nuclear import of NF-κB Rel subunits23, 24. |
| T5144 | 6825-6977 | Sentence | denotes | RPS3 harbors a nuclear localization signal (NLS) sequence and its nuclear translocation occurs in parallel to, but independently of, p65 translocation6. |
| T5145 | 6978-7046 | Sentence | denotes | We envisioned that RPS3 could also utilize the importin-α/β pathway. |
| T5146 | 7047-7177 | Sentence | denotes | Consistent with this notion, RPS3 association with importin-α, but not importin-β, was enhanced in TNF–stimulated cells (Fig. 3a). |
| T5147 | 7178-7299 | Sentence | denotes | Therefore, we examined whether RPS3 binding to importin-α is essential for nuclear translocation during NF-κB activation. |
| T5148 | 7300-7515 | Sentence | denotes | Since IκBα degradation is a prerequisite to unmask the NLS of p65, and both RPS3 and IκBα bind to p65 in the cytoplasmic inhibitory complex, we tested whether IκBα degradation is required for the liberation of RPS3. |
| T5149 | 7516-7695 | Sentence | denotes | We measured the association of RPS3 with importin-α in 293T cells overexpressing wild-type IκBα or an IκBα mutant (SSAA) resistant to IKKβ-induced phosphorylation and degradation. |
| T5150 | 7696-7851 | Sentence | denotes | In cells transfected with wild-type IκBα, TNF stimulation augmented the interaction of RPS3 and importin-α to a similar degree as in non-transfected cells. |
| T5151 | 7852-7977 | Sentence | denotes | By contrast, we observed that the RPS3-importin-α association was abolished by the presence of non-degradable IκBα (Fig. 3b). |
| T5152 | 7978-8166 | Sentence | denotes | To examine whether IκBα is the only cytoplasmic barrier precluding RPS3 nuclear translocation, we measured both RPS3-importin-α association and nuclear RPS3 after reducing IκBα expression. |
| T5153 | 8167-8282 | Sentence | denotes | Compared with nonspecific siRNA, siRNA targeting of IκBα completely depleted IκBα in Jurkat cells (Fig. 3c, input). |
| T5154 | 8283-8410 | Sentence | denotes | Nevertheless, the RPS3-importin-α association was not augmented (Fig. 3c), nor was significant nuclear RPS3 detected (Fig. 3d). |
| T5155 | 8411-8723 | Sentence | denotes | Moreover, cells treated with sodium pervanadate (Pv) to induce IκBα degradation through an IKK-independent mechanism25-27 did not show increased association between RPS3 and importin-α (Fig. 3e and Supplementary Fig. 3b) or nuclear accumulation of RPS3, despite complete IκBα degradation (Supplementary Fig. 3c). |
| T5156 | 8724-8892 | Sentence | denotes | We further examined whether a subsequent NF-κB activation signal independently promotes the importin-α association and nuclear transport of RPS3 after IκBα degradation. |
| T5157 | 8893-9042 | Sentence | denotes | We found that TNF stimulation following Pv treatment was required for the RPS3-importin-α association, comparable to TNF stimulation alone (Fig. 3e). |
| T5158 | 9043-9200 | Sentence | denotes | Thus, IκBα phosphorylation and degradation itself is required but not sufficient to cause RPS3 association with importin-α followed by nuclear translocation. |
| T5159 | 9201-9285 | Sentence | denotes | Rather, an additional signal, potentially IKKβ phosphorylation of RPS3, is required. |
| T7141 | 9287-9325 | Sentence | denotes | IKKβ phosphorylates RPS3 at serine 209 |
| T7142 | 9326-9520 | Sentence | denotes | Although originally defined as the kinase that phosphorylates IκB19, IKKβ also phosphorylates unrelated substrates including 14-3-3β and Bcl10, which lack the IKK consensus motif (DpSGYXpS/T)28. |
| T7143 | 9521-9591 | Sentence | denotes | We therefore hypothesized that IKKβ could directly phosphorylate RPS3. |
| T7144 | 9592-9910 | Sentence | denotes | By in vitro kinase assays using recombinant IKK and RPS3 proteins, we observed strong incorporation of 32P in autophosphorylatd IKKα and IKKβ (Fig. 4a, lanes 2-7) as well as phosporylated GST-IκBα (1-54) (Supplementary Fig. 4), but not the GST protein alone (Fig. 4a, lanes 3 and 6), when either IKKα or IKKβ was used. |
| T7145 | 9911-10028 | Sentence | denotes | We discovered that GST-RPS3 could be phosphorylated by IKKβ, but not IKKα, in vitro (Fig. 4a, compare lanes 4 and 7). |
| T7146 | 10029-10200 | Sentence | denotes | To identify the RPS3 amino acid residue(s) phosphorylated by IKKβ, we performed liquid chromatography-tandem mass spectrometry analyses using in vitro phosphorylated RPS3. |
| T7147 | 10201-10295 | Sentence | denotes | The results indicated that IKKβ phosphorylated S209, located in the RPS3 C-terminus (Fig. 4b). |
| T7148 | 10296-10558 | Sentence | denotes | RPS3 amino acid sequence alignment revealed that S209 is conserved in many species throughout phylogeny with the exception of Caenorhabditis elegans and Schizosaccharomyces pombe, two organisms that do not possess the NF-κB signal pathway (Supplementary Fig. 5). |
| T7149 | 10559-10721 | Sentence | denotes | To verify biochemically that S209 is an IKKβ substrate, we performed 32P-labeling in vitro kinase assays with recombinant wild-type or S209A mutant RPS3 proteins. |
| T7150 | 10722-10831 | Sentence | denotes | Compared with the wild-type protein, the S209A mutation reduced IKKβ–mediated RPS3 phosphorylation (Fig. 4c). |
| T7151 | 10832-10958 | Sentence | denotes | There might be alternative phosphorylation site(s) under these conditions given modest residual phosphorylated RPS3 (Fig. 4c). |
| T7152 | 10959-11130 | Sentence | denotes | RPS3 S209 does not fall within a conventional IKK recognition motif, but rather resides in a sequence motif (XXXpS/TXXE), potentially recognized by casein kinase II (CK2). |
| T7153 | 11131-11291 | Sentence | denotes | Although IKKβ kinase can display a CK2-like phosphorylation specificity29, no CK2 protein was detectable in our recombinant IKK proteins (Supplementary Fig. 6). |
| T7154 | 11292-11430 | Sentence | denotes | Thus, RPS3 S209 phosphorylation was due to the alternate specificity of the IKKβ kinase rather than any trace amount of CK2 bound to IKKs. |
| T7155 | 11431-11624 | Sentence | denotes | To determine whether S209 is the critical site at which IKKβ phosphorylates RPS3 in living cells, we transfected the wild-type or S209A mutant Flag-RPS3 alone, or together with IKKβ into cells. |
| T7156 | 11625-11864 | Sentence | denotes | Indeed, we observed that overexpressing IKKβ enhanced Flag-RPS3 phosphorylation, but phosphorylation was effectively eliminated by alanine substitution indicating that S209 is the predominant target site for IKKβ phosphorylation (Fig. 4d). |
| T7157 | 11865-12032 | Sentence | denotes | We next generated a phospho-S209 RPS3 antibody and confirmed that endogenous RPS3 was phosphorylated at S209 in a time-dependent manner upon TNF stimulation (Fig. 4e). |
| T7158 | 12033-12114 | Sentence | denotes | Thus, the RPS3 C-terminal tail potentially contains an important regulatory site. |
| T9155 | 12116-12162 | Sentence | denotes | Phosphorylation of RPS3 and its NF-κB function |
| T9156 | 12163-12283 | Sentence | denotes | We next examined whether S209 phosphorylation plays a role in the nuclear translocation of RPS3 during NF-κB activation. |
| T9157 | 12284-12551 | Sentence | denotes | Subcellular fractions from either wild-type or S209A mutant RPS3-transfected cells were prepared and blotted for heat-shock protein 90 (hsp90), a cytoplasmic protein, and poly (ADP-ribose) polymerase (PARP), a nuclear protein, confirming a clean separation (Fig. 5a). |
| T9158 | 12552-12645 | Sentence | denotes | As expected, PMA+I stimulation triggered wild-type Flag-RPS3 nuclear translocation (Fig. 5a). |
| T9159 | 12646-12715 | Sentence | denotes | However, RPS3 (S209A) nuclear translocation was attenuated (Fig. 5a). |
| T9160 | 12716-12815 | Sentence | denotes | We also tested the impact of activating NF-κB by overexpressing IKKβ on RPS3 nuclear translocation. |
| T9161 | 12816-12993 | Sentence | denotes | IKKβ overexpression activated NF-κB measured by luciferase assays (Supplementary Fig. 7), and also induced the nuclear translocation of wild-type, but not S209A, RPS3 (Fig. 5b). |
| T9162 | 12994-13111 | Sentence | denotes | These data suggest that S209 phosphorylation is critical for the NF-κB activation-induced RPS3 nuclear translocation. |
| T9163 | 13112-13400 | Sentence | denotes | To examine the role of S209 phosphorylation of RPS3 to its NF-κB function6, 7, 30, we silenced endogenous RPS3 expression using an siRNA that targets the 3′ untranslated region (3′ UTR) of RPS3 mRNA, followed by complementation with either wild-type or S209A mutant RPS3 via transfection. |
| T9164 | 13401-13609 | Sentence | denotes | As expected, RPS3 siRNA severely reduced endogenous RPS3 abundance compared to NS siRNA, but did not affect the robust expression of Flag-tagged RPS3 from a transfected construct lacking the 3′ UTR (Fig. 5c). |
| T9165 | 13610-13726 | Sentence | denotes | We also found that RPS3 knockdown reduced TNF-induced expression of an Ig κB-driven luciferase construct6 (Fig. 5d). |
| T9166 | 13727-13908 | Sentence | denotes | The impaired luciferase signal caused by RPS3 deficiency was completely restored by transfecting wild-type, but not by S209A RPS3 (Fig. 5d), despite equivalent expression (Fig. 5c). |
| T9167 | 13909-14179 | Sentence | denotes | Moreover, the failure of S209A RPS3 to restore luciferase activity did not result from defective translation because the transient overexpression of green fluorescent protein (GFP) was comparable in cells complemented with wild-type or S029A RPS3 (Supplementary Fig. 8). |
| T9168 | 14180-14312 | Sentence | denotes | Taken together, these data suggest that RPS3 S209 phosphorylation is critical for NF-κB activity involving the canonical Ig κB site. |
| T9169 | 14313-14496 | Sentence | denotes | We next used chromatin immunoprecipitation to determine whether S209 phosphorylation affects RPS3 and p65 recruitment to specific κB sites in intact chromatin during NF-κB activation. |
| T11937 | 15797-15841 | Sentence | denotes | NleH1 inhibits RPS3 phosphorylation in vitro |
| T11938 | 15842-15944 | Sentence | denotes | EHEC pathogens are important causative agents of both foodborne disease and pediatric renal failure31. |
| T11939 | 15945-16103 | Sentence | denotes | EHEC utilize T3SS to inject effector proteins directly into intestinal epithelial cells32, a subset of which inhibit NF-κB-dependent innate responses9, 33-38. |
| T11940 | 16104-16253 | Sentence | denotes | The E. coli O157:H7 EDL933 effector protein NleH1 binds to and attenuates RPS3 nuclear translocation, thus impairing RPS3-dependent NF-κB signaling9. |
| T11941 | 16254-16344 | Sentence | denotes | We therefore hypothesized that NleH1 may function by inhibiting RPS3 S209 phosphorylation. |
| T11942 | 16345-16488 | Sentence | denotes | As expected, transfecting increasing amounts of NleH1-HA plasmid blocked TNFα-induced NF-κB activation in a dose-dependent manner (Fig. 6a-b)9. |
| T11943 | 16489-16615 | Sentence | denotes | Remarkably, NleH1 reduced both TNF-induced, as well as basal RPS3 phosphorylation to roughly 20% of vehicle control (Fig. 6c). |
| T11944 | 16616-16793 | Sentence | denotes | Expressing NleH1 does not interfere with either TNF-induced IKK activation or IκBα degradation, consistent with the lack of NleH1 impact on p65 nuclear translocation9 (Fig. 6c). |
| T11945 | 16794-17038 | Sentence | denotes | To determine if NleH1 inhibits RPS3 phosphorylation, we infected HeLa cells with E. coli O157:H7 strains possessing or lacking either nleH1 (ΔnleH1) or with a strain lacking a functional T3SS unable to inject NleH1 into mammalian cells (ΔescN). |
| T11946 | 17039-17166 | Sentence | denotes | In uninfected cells, TNF-treatment stimulated a ∼7-fold increase in RPS3 S209 phosphorylation, peaking at 30 minutes (Fig. 6d). |
| T11947 | 17167-17292 | Sentence | denotes | By contrast, RPS3 S209 phosphorylation was substantially impaired in cells infected with wild-type E. coli O157:H7 (Fig. 6d). |
| T11948 | 17293-17411 | Sentence | denotes | However, TNF-induced RPS3 S209 phosphorylation was unimpaired in cells infected with either ΔnleH1 or ΔescN (Fig. 6d). |
| T11949 | 17412-17554 | Sentence | denotes | We showed previously that wild-type, but not ΔnleH1 or ΔescN E. coli O157:H7 significantly attenuated TNF-induced RPS3 nuclear translocation9. |
| T11950 | 17555-17793 | Sentence | denotes | The parallel between RPS3 phosphorylation and its nuclear translocation during E. coli infection provides evidence in the context of an NF-κB-dependent disease process that RPS3 S209 phosphorylation is important for nuclear translocation. |
| T11951 | 17794-17970 | Sentence | denotes | Our discovery that NleH1 inhibits RPS3 S209 phosphorylation suggested that it should also blocks RPS3-dependent NF-κB target gene transcription (e.g. IL8, NFKBIA, and TNFAIP3). |
| T11952 | 17971-18162 | Sentence | denotes | Indeed, these genes were only modestly upregulated in cells infected with wild-type E. coli O157:H7, but significantly induced in cells infected with either ΔnleH1 or ΔescN strains (Fig. 6e). |
| T11953 | 18163-18302 | Sentence | denotes | In contrast, deleting nleH1 had no impact on the expression of RPS3-independent genes, including CD25 and TNFSF13B (Supplementary Fig. 12). |
| T11954 | 18303-18514 | Sentence | denotes | Together these results demonstrate that NleH1 specifically inhibits the protective immune response by directly blocking RPS3 S209 phosphorylation and thereby impairing critical RPS3-dependent NF-κB target genes. |
| T13755 | 18516-18564 | Sentence | denotes | NleH1 inhibits RPS3 S209 phosphorylation in vivo |
| T13756 | 18565-18748 | Sentence | denotes | We previously utilized a gnotobiotic piglet infection model to determine that piglets infected with ΔnleH1 mutant died more rapidly than those infected with wild-type E. coli O157:H7. |
| T13757 | 18749-18914 | Sentence | denotes | Piglets infected with ΔnleH1 displayed clinical disease consistent with a robust inflammatory response, but with reduced bacterial colonization and little diarrhea9. |
| T13758 | 18915-19122 | Sentence | denotes | While seemingly paradoxical, based on our cell culture data (Fig. 6d), we hypothesized that NleH1 blocked RPS3 S209 phosphorylation in vivo, thereby preventing RPS3 nuclear translocation in infected piglets. |
| T13759 | 19123-19237 | Sentence | denotes | We isolated piglet colons at necropsy, and subjected them to immunohistochemistry using our phospho-RPS3 antibody. |
| T13760 | 19238-19481 | Sentence | denotes | Consistent with in vitro data, piglets infected with wild-type E. coli O157:H7 exhibited diffuse and low intensity phospho-RPS3 staining, whereas in piglets infected with ΔnleH1 mutant, phospho-RPS3 expression was florid and intense (Fig. 6f). |
| T13761 | 19482-19645 | Sentence | denotes | These data demonstrate that NleH1 inhibits RPS3 S209 phosphorylation both in vitro and in vivo, which might benefit the bacterium in colonization and transmission. |
| T14904 | 19647-19692 | Sentence | denotes | NleH1 steers the IKKβ substrate specificities |
| T14905 | 19693-19789 | Sentence | denotes | NleH1 is an autophosphorylated serine-threonine kinase, which depends on the lysine 159 (K159)9. |
| T14906 | 19790-20091 | Sentence | denotes | To explore the mechanism by which NleH1 inhibits RPS3 S209 phosphorylation, we first performed an in vitro kinase assay with purified wild-type His-NleH1 protein and a mutant His-NleH1 (K159A) protein, confirming that NleH1 is autophosphorylated and the K159A is an NleH1 kinase-dead mutant (Fig. 7a). |
| T14907 | 20092-20274 | Sentence | denotes | To examine whether the kinase activity is required for NleH1 to inhibit IKKβ phosphorlyation of RPS3 on S209, we ectopically expressing either wild-type or K159A NleH1 in 293T cells. |
| T14908 | 20275-20414 | Sentence | denotes | Wild-type NleH1 expression significantly reduced TNF-induced RPS3 S209 phosphorylation, whereas the K159A mutant failed to do so (Fig. 7b). |
| T14909 | 20415-20505 | Sentence | denotes | Thus NleH1 kinase activity is required to protect RPS3 from IKKβ-mediated phosphorylation. |
| T14910 | 20506-20781 | Sentence | denotes | Citrobacter rodentium is a mouse pathogen that shares pathogenic strategies with E. coli 39, most notably for our investigation, C. rodentium NleH inhibited RPS3 nuclear translocation and RPS3-dependent NF-κB luciferase activity to an extent equivalent to E. coli NleH1 (ref. |
| T14911 | 20782-20785 | Sentence | denotes | 9). |
| T14912 | 20786-20882 | Sentence | denotes | We assayed RPS3 S209 phosphorylation in HeLa cells infected with different C. rodentium strains. |
| T14913 | 20883-20989 | Sentence | denotes | In uninfected cells, TNF-treatment stimulated a ∼3.5-fold increase in RPS3 S209 phosphorylation (Fig. 7c). |
| T14914 | 20990-21103 | Sentence | denotes | Such augmentation of RPS3 phosphorylation was reduced by about 60% by wild-type C. rodentium infection (Fig. 7c). |
| T14915 | 21104-21229 | Sentence | denotes | However, RPS3 phosphorylation was enhanced when cells were infected with a C. rodentium strain lacking NleH (Fig. 7c, ΔnleH). |
| T14916 | 21230-21396 | Sentence | denotes | We further examined the role of NleH1 kinase activity using the C. rodentium ΔnleH strain as a background on which to express either wild-type or K159A E. coli NleH1. |
| T14917 | 21397-21582 | Sentence | denotes | Complementing ΔnleH mutant with wild-type NleH1 almost abolished TNF-induced RPS3 S209 phosphorylation whereas complementing with K159A failed to inhibit RPS3 phosphorylation (Fig. 7c). |
| T14918 | 21583-21697 | Sentence | denotes | Collectively, these results demonstrate that NleH1 kinase activity is required to block RPS3 S209 phosphorylation. |
| T14919 | 21698-21896 | Sentence | denotes | We next examined whether the inhibitory activity of NleH1 is sufficiently robust to impair the strong nuclear translocation of RPS3 trigged by the constitutively-active IKKβ (IKKβ [SSEE]) (Fig. 2d). |
| T14920 | 21897-22067 | Sentence | denotes | We found that ectopically expressing either wild-type or SSEE IKKβ proteins, triggered more RPS3 nuclear translocation than the kinase-dead IKKβ (SSAA) protein (Fig. 7d). |
| T14921 | 22068-22181 | Sentence | denotes | RPS3 nuclear accumulation was substantially retarded by infecting cells with wild-type E. coli O157:H7 (Fig. 7d). |
| T14922 | 22182-22349 | Sentence | denotes | In contrast, infecting with either ΔnleH1 or ΔescN strains only slightly impaired RPS3 nuclear translocation in either IKKβ- or IKKβ (SSEE)-expressing cells (Fig. 7d). |
| T14923 | 22350-22501 | Sentence | denotes | As expected, E. coli infections did not affect the RPS3 nuclear translocation in IKKβ (SSAA)-expressing cells, where NF-κB signaling was low (Fig. 7d). |
| T14924 | 22502-22647 | Sentence | denotes | Thus, during infection NleH1 is sufficiently potent to inhibit RPS3 nuclear translocation even in cells expressing constitutively-activated IKKβ. |
| T14925 | 22648-22764 | Sentence | denotes | We examined whether NleH1 could directly phosphorylate IKKβ thus inhibiting IKKβ-mediated RPS3 S209 phosphorylation. |
| T14926 | 22765-22974 | Sentence | denotes | We performed in vitro kinase assays using immunoprecipitated Flag-IKKβ (K44A) as substrate and recombinant His-NleH1 as kinase, so that IKKβ autophosphorylation would not obscure NleH1-induced phosphorylation. |
| T14927 | 22975-23102 | Sentence | denotes | However, we did not observe any detectable 32P incorporation in IKKβ (Supplementary Fig. 13), thus ruling out this possibility. |
| T14928 | 23103-23189 | Sentence | denotes | We then tested the hypothesis that NleH1 could alter the IKKβ substrate specificities. |
| T14929 | 23190-23282 | Sentence | denotes | To this end, we performed in vitro kinase assays using both CK2 and IKK substrates for IKKβ. |
| T14930 | 23283-23451 | Sentence | denotes | As expected, IKKβ phosphorylated RPS3 (Fig. 7e, lane 7) and GST-IκBα (1-54) protein (Fig. 7e, lane 9), demonstrating it harbors either CK2 or IKK substrate specificity. |
| T14931 | 23452-23652 | Sentence | denotes | Preincubation of IKKβ with NleH1 reduced IKKβ-mediated RPS3 phosphorylation, i.e. the CK2 kinase specificity, but not IKKβ-mediated GST-IκBα phosphorylation, i.e. the IKK kinase specificity (Fig. 7e). |
| T14932 | 23653-23769 | Sentence | denotes | Control experiments revealed no NleH1-mediated phosphorylation or autophosphorylation of RPS3 or GST-IκBα (Fig. 7e). |
| T14933 | 23770-23992 | Sentence | denotes | Taken together, NleH1 blocks the CK2 substrate specificity of IKKβ thus inhibiting the IKKβ-mediated RPS3 S209 phosphorylation thus representing a novel strategy by E. coli O157:H7 to alter the host innate immune response. |
| T20201 | 28191-28209 | Sentence | denotes | Cells and Reagents |
| T20202 | 28210-28401 | Sentence | denotes | Jurkat E6.1, HEK293T and HeLa cells were cultured in RPMI 1640 and DMEM supplemented with 10% fetal calf serum, 2 mM glutamine, and 100 U/ml each of penicillin and streptomycin, respectively. |
| T20203 | 28402-29130 | Sentence | denotes | IκBα (C-21, sc-371), p65 (C-20, sc-372), and phospho-threonine (H-2, sc-5267) antibodies were from Santa Cruz Biotechnology; β-actin (AC-15, A5441), Flag (M2, F3165), HA (HA-7, H3663), importin-α (IM-75, I1784), and importin-β (31H4, I2534) antibodies were from Sigma; PARP (C2-10, 556362), IKKα (B78-1, 556532), and IKKβ (24, 611254) antibodies were from BD Pharmingen; CK2α (31, 611610) and Hsp90 (68, 610418) antibodies were from BD Transduction Laboratories; phospho-IκBα (5A5, 9246S) and phospho-IKKα/β (16A6, 2697S) antibodies were from Cell Signaling Technology; phospho-serine (AB1603) and phospho-tyrosine (4G10, 05-777) antibodies were from Millipore. The rabbit polyclonal RPS3 antiserum was as described previously6. |
| T20204 | 29131-29296 | Sentence | denotes | The rabbit polyclonal antibody specific for S209 phosphorylated RPS3 was generated and affinity purified by Primm Biotech using the peptide NH2-CKPLPDHV(Sp)IVE-COOH. |
| T20515 | 29298-29316 | Sentence | denotes | Plasmid Constructs |
| T20516 | 29317-29476 | Sentence | denotes | The Flag-IKKβ (SSEE), Flag-IKKβ (SSAA), and HA-IκBα (SSAA) constructs were provided by C. Wu (NCI, Bethesda) and U. Siebenlist (NIAID, Bethesda), respectively. |
| T20517 | 29477-29553 | Sentence | denotes | The HA-IκBα and IKKβ (K44A)-Flag plasmids were purchased from Addgene44, 45. |
| T20518 | 29554-29643 | Sentence | denotes | The Flag-RPS3, GST-RPS3, HA-RPS3, VN-HA, NleH1-HA plasmids were described previously6, 9. |
| T20519 | 29644-29877 | Sentence | denotes | The point mutants of RPS3 were generated by site-directed mutagenesis using the Quick Change Kit (Stratagene) with primers forward 5′-CTGCCTGACCACGTGGCCATTGTGGAACCCAAA-3′ and reverse 5′-TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3′ for S209A. |
| T20520 | 29878-29922 | Sentence | denotes | All mutants were verified by DNA sequencing. |
| T20843 | 29924-29944 | Sentence | denotes | 32P in vivo Labeling |
| T20844 | 29945-30067 | Sentence | denotes | HEK 293T cells were labeled with 2 mCi/ml 32P-orthophosphate (Perkin Elmer) in phosphate-free medium (Invitrogen) for 2 h. |
| T20845 | 30068-30165 | Sentence | denotes | Cells were then left untreated or treated with TNF (50 ng/ml, R&D Systems) for indicated periods. |
| T20846 | 30166-30246 | Sentence | denotes | Cell lysates were prepared and used for immunoprecipitations with RPS3 antibody. |
| T20989 | 30248-30269 | Sentence | denotes | In Vitro Kinase Assay |
| T20990 | 30270-30380 | Sentence | denotes | Kinase-active recombinant IKKβ and IKKα proteins were purchased from Active Motif and Millipore, respectively. |
| T20991 | 30381-30521 | Sentence | denotes | Bacterially purified glutathione S-transferase (GST), GST-IκBα (1-54), wild type, mutant GST-RPS3, or RPS3 proteins were used as substrates. |
| T20992 | 30522-30588 | Sentence | denotes | The in vitro kinase assay was performed as previously described29. |
| T20993 | 30589-30907 | Sentence | denotes | Briefly, enzyme (100 ng) and substrate (2 μg) were co-incubated in IKK reaction buffer (25 mM Tris–HCl [pH 8.0], 50 mM KCl, 10 mM MgCl2, 1 mM DTT, 1 mM Na3VO4, 1 mM ATP) or NleH1 reaction buffer (50 mM Tris-HCl [pH 7.6], 5 mM MgCl2, 1 mM DTT, 1 mM ATP) with 0.5 μCi 32P-γ-ATP (GE Healthcare) added at 37 °C for 30 min. |
| T20994 | 30908-30982 | Sentence | denotes | The reactions were resolved by SDS–PAGE and visualized by autoradiography. |
| T21363 | 30984-31001 | Sentence | denotes | LC-MS/MS Analysis |
| T21364 | 31002-31155 | Sentence | denotes | GST or GST-RPS3 was incubated with recombinant IKKβ protein as described above in an in vitro kinase assay reaction conducted without 32P-γ-ATP labeling. |
| T21365 | 31156-31261 | Sentence | denotes | The reaction was separated by SDS-PAGE, and the protein gel was stained with Colloidal Blue (Invitrogen). |
| T21366 | 31262-31428 | Sentence | denotes | The corresponding protein fragments were excised and subjected to trypsin digestion and LC-MS/MS at the Yale Cancer Center Mass Spectrometry Resource (New Haven, CT). |
| T21706 | 31774-31799 | Sentence | denotes | Subcellular Fractionation |
| T21707 | 31800-31896 | Sentence | denotes | Subcellular fractionation was performed by differential centrifugation as previously described6. |
| T21708 | 31897-32103 | Sentence | denotes | Briefly, cells were resuspended in ice-cold Buffer A (10 mM HEPES pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT, 0.4 % NP-40, 0.5 mM PMSF, complete protease inhibitor cocktail) at 4 °C for 5 min. |
| T21709 | 32104-32212 | Sentence | denotes | Lysates were centrifuged at 4 °C, 500 × g for 3 min, and supernatants were collected as cytosolic fractions. |
| T21710 | 32213-32404 | Sentence | denotes | Pellets were incubated in Buffer C (20 mM HEPES pH7.9, 420 mM NaCl, 1.5 mM MgCl2, 25% glycerol, 0.5 mM PMSF, 0.2 mM EDTA, 0.5 mM DTT, complete protease inhibitor cocktail) at 4 °C for 10 min. |
| T21711 | 32405-32508 | Sentence | denotes | Supernatants were collected as nuclear fractions following a centrifuge at 4 °C, 13,800 × g for 10 min. |
| T22039 | 32802-32884 | Sentence | denotes | Cells were cultured for 1–2 days and then stimulated in triplicate before harvest. |
| T22040 | 32885-32947 | Sentence | denotes | Lysates were analyzed using the Dual-Luciferase Kit (Promega). |
| T22214 | 32949-32985 | Sentence | denotes | Chromatin Immunoprecipitation (ChIP) |
| T22215 | 32986-33037 | Sentence | denotes | ChIP assays was performed as previously described6. |
| T22216 | 33038-33167 | Sentence | denotes | The primers used to amplify the promoter region adjacent to the κB sites of IL8 and NFKBIA, as well as ACTB have been described6. |
| T22324 | 33169-33198 | Sentence | denotes | Immunofluorescence Microscopy |
| T22325 | 33199-33258 | Sentence | denotes | Confocal microscopy was performed as previously described6. |
| T22326 | 33259-33356 | Sentence | denotes | Briefly, cells were fixed with 4 % paraformaldehyde in PBS and then Cellspin mounted onto slides. |
| T22327 | 33357-33739 | Sentence | denotes | The fixed cells were then permeabilized with 0.05 % Triton X-100 in PBS and stained with FITC-conjugated rabbit anti-RPS3 antibodies (Primm Biotech), or AlexaFluor 594-conjugated rat anti-Flag antibodies (BD) for 40 min together with 1 μg/ml of Hoechst 33342 (Sigma) for 5 min at 25 °C. The slides were then rinsed with PBS three times and cover mounted for fluorescence microscopy. |
| T22542 | 33741-33775 | Sentence | denotes | Immunoprecipitation and immunoblot |
| T22543 | 33776-34105 | Sentence | denotes | The cells were harvested and lysed on ice by 0.4 ml of the modified RIPA buffer (50 mM Tris-HCl [pH 7.4], 1% NP-40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 mM Na3VO4, 1 mM NaF) supplemented with 1 × protease inhibitor cocktail (Roche) and 1 × phosphatase inhibitor cocktail set I (EMD Biosciences) for 30 min. |
| T22544 | 34106-34197 | Sentence | denotes | The lysates were centrifuged at 10,000 × g at 4 °C for 10 min to remove insoluble material. |
| T22545 | 34198-34551 | Sentence | denotes | After normalizing protein concentrations, lysates were subjected to immunoprecipitation by adding 10 mg/ml appropriate antibody plus 30 ml of protein G-agarose (Roche), and rotated for at least 2 h at 4°C. The precipitates were washed at least five times with cold lysis buffer followed by separation by SDS-PAGE under reduced and denaturing conditions. |
| T22546 | 34552-34697 | Sentence | denotes | Nitrocellulose membranes were blocked in 5 % nonfat milk in 0.1 % PBS-Tween 20 (PBS-T), probed with specific antibodies as described previously6. |
| T22547 | 34698-34868 | Sentence | denotes | For immunoblotting of phosphorylated proteins, gels were transferred to methanol-treated polyvinylidene chloride membranes, retreated with methanol, and dried for 30 min. |
| T22548 | 34869-35026 | Sentence | denotes | Blots were blocked in 5 % bovine serum albumin in 0.1 % Tris buffered saline-Tween 20 (TBS-T), and probed with specific antibodies as described previously46. |
| T22549 | 35027-35129 | Sentence | denotes | Bands were imaged by the Super Signaling system (Pierce) according to the manufacturer's instructions. |
| T23103 | 35131-35136 | Sentence | denotes | ELISA |
| T23104 | 35137-35338 | Sentence | denotes | The amount of IL-8 present in supernatants collected from Jurkat cell culture was measured using a Human Interleukin-8 ELISA Ready-SET-Go kit (eBioscience) according to the manufacturer's instructions. |
| T23193 | 35340-35355 | Sentence | denotes | Cell Infections |
| T23194 | 35356-35451 | Sentence | denotes | HeLa cells were infected with E. coli O157:H7 or C. rodentium strains as described previously9. |
| T23239 | 35453-35473 | Sentence | denotes | Immunohistochemistry |
| T23240 | 35474-35562 | Sentence | denotes | Gnotobiotic piglets were infected with E. coli O157:H7 strains as described previously9. |
| T23241 | 35563-35638 | Sentence | denotes | Spiral colon specimens were collected at necropsy and embedded in paraffin. |
| T23242 | 35639-35752 | Sentence | denotes | Paraffin sectioning and immunohistochemical staining using phospho-RPS3 antibody were performed by Histoserv Inc. |
| T94 | 0-118 | Sentence | denotes | IKKβ phosphorylation regulates RPS3 nuclear translocation and NF-κB function during Escherichia coli O157:H7 infection |
| T95 | 130-275 | Sentence | denotes | NF-κB is a major gene regulator in immune responses and ribosomal protein S3 (RPS3) is an NF-κB subunit that directs specific gene transcription. |
| T96 | 276-343 | Sentence | denotes | However, it is unknown how RPS3 nuclear translocation is regulated. |
| T97 | 344-482 | Sentence | denotes | Here we report that IKKβ phosphorylation of serine 209 (S209) was crucial for RPS3 nuclear localization in response to activating stimuli. |
| T98 | 483-760 | Sentence | denotes | Moreover, the foodborne pathogen Escherichia coli O157:H7 virulence protein NleH1 specifically inhibited RPS3 S209 phosphorylation and blocked RPS3 function, thereby promoting bacterial colonization and diarrhea but decreasing mortality in a gnotobiotic piglet infection model. |
| T99 | 761-937 | Sentence | denotes | Thus, the IKKβ-dependent modification of a specific amino acid in RPS3 promotes specific NF-κB functions that underlie the molecular pathogenetic mechanisms of E. coli O157:H7. |
| T9170 | 14497-14681 | Sentence | denotes | In RPS3 knockdown cells, PMA+I stimulated the recruitment of ectopically expressed, Flag-tagged wild-type, but not S209A RPS3 to the κB sites of the NFKBIA and IL8 promoters (Fig. 5e). |
| T9171 | 14682-14808 | Sentence | denotes | While expressing RPS3 S209A had no impact on p65 nuclear translocation, it substantially attenuated p65 recruitment (Fig. 5e). |
| T9172 | 14809-15003 | Sentence | denotes | Additional experiments revealed that p65 attraction to RPS3-independent NF-κB target gene promoters such as CD25 was increased (Supplementary Fig. 9), consistent with our previous observations6. |
| T9173 | 15004-15151 | Sentence | denotes | There was no significant Flag-RPS3 or p65 recruitment to ACTB promoter lacking κB sites (Fig. 5e), suggesting the recruitment was κB site-specific. |
| T9174 | 15152-15261 | Sentence | denotes | Thus, the recruitment of RPS3 as well as the contingent recruitment of p65 to key promoters depended on S209. |
| T9175 | 15262-15528 | Sentence | denotes | Interleukin 8 (IL-8) secretion induced by either T cell receptor (TCR) agonist stimulation or PMA+I was decreased as a consequence of reduced RPS3/p65 recruitment to the IL8 κB sites in the presence of S209A mutant compared to wild-type RPS3 (Supplementary Fig. 10). |
| T9176 | 15529-15661 | Sentence | denotes | However, cell surface CD25 expression was comparable between the wild-type and S209A RPS3 transfected cells (Supplementary Fig. 11). |
| T9177 | 15662-15795 | Sentence | denotes | Therefore, RPS3 S209 phosphorylation by IKKβ is apparently required for RPS3 in directing NF-κB to a specific subset of target genes. |
| T18122 | 24005-24114 | Sentence | denotes | RPS3 was previously demonstrated to function as an integral subunit conferring NF-κB regulatory specificity6. |
| T18123 | 24115-24252 | Sentence | denotes | Here we sought to elucidate how NF-κB activation signaling triggers RPS3 to translocate and participate in NF-κB function in the nucleus. |
| T18124 | 24253-24448 | Sentence | denotes | We demonstrate that IKKβ-mediated RPS3 S209 phosphorylation represents a critical determinant in governing its nuclear import thus unveiling a novel mechanism behind NF-κB regulatory specificity. |
| T18125 | 24449-24573 | Sentence | denotes | IKKβ is the major kinase that phosphorylates IκBs in the classical NF-κB pathway, leading to their subsequent degradation40. |
| T18126 | 24574-24681 | Sentence | denotes | Strikingly, RPS3 possesses not any consensus IKK motif; instead, S209 is centered in a consensus CK2 motif. |
| T18127 | 24682-24855 | Sentence | denotes | The recent observation that human IKKβ displayed CK2-like phosphorylation specificity29 coincides with our evidence that recombinant IKKβ, but not IKKα, phosphorylated RPS3. |
| T18128 | 24856-25006 | Sentence | denotes | We found this phosphorylation is a critical modulation for RPS3 nuclear translocation (via importin-α) and engagement in specific NF-κB transcription. |
| T18129 | 25007-25299 | Sentence | denotes | CK2 was previously shown to phosphorylate p65 and to bind to and phosphorylate IKKβ41-43, however, we ruled out the possibility that the IKKβ-bound CK2 could account for the observed RPS3 phosphorylation because no CK2 was detected in the IKKβ preparations used for the in vitro kinase assay. |
| T18130 | 25300-25486 | Sentence | denotes | Because RPS3 only harbors the CK2 motif and not a traditional IKK motif, this RPS3 regulatory function could explain why IKK harbors the alternative substrate phosphorylation capability. |
| T18131 | 25487-25686 | Sentence | denotes | More importantly, our study has elucidated how RPS3 is biochemically integrated into NF-κB activation signaling in a manner that is pivotal for the pathogenesis of foodborne pathogen E. coli O157:H7. |
| T18132 | 25687-25807 | Sentence | denotes | IKKβ-mediated RPS3 S209 phosphorylation is a critical target modulated by this pathogen to subvert host NF-κB signaling. |
| T18133 | 25808-25973 | Sentence | denotes | The bacterial effector NleH1 specifically binds to RPS3 once injected into host cells and profoundly suppresses NF-κB and its attendant protective immune responses9. |
| T18134 | 25974-26157 | Sentence | denotes | Our data now show that NleH1 selectively inhibits RPS3 phosphorylation, thus retarding its nuclear translocation and subsequent NF-κB function, without altering other NF-κB signaling. |
| T18135 | 26158-26294 | Sentence | denotes | Although NleH1 did not directly phosphorylate IKKβ, its kinase activity was required to inhibit IKKβ-mediated RPS3 S209 phosphorylation. |
| T18136 | 26295-26524 | Sentence | denotes | Many bacteria pathogens have products that target key kinases to inactivate them in host cells, whereas E. coli O157:H7 employed NleH1 to steer the substrate specificity of IKKβ thus specifically fine-tuning host NF-κB signaling. |
| T18137 | 26525-26637 | Sentence | denotes | This could represent a novel strategy to fine-tune host NF-κB signaling that could be shared by other pathogens. |
| T18138 | 26638-26738 | Sentence | denotes | These data provide new insights into the poorly understood action mechanism for most T3SS effectors. |
| T18139 | 26739-26923 | Sentence | denotes | NleH1 attenuates the transcription of RPS3-dependent, but not all, NF-κB target genes, in particular those genes associated with acute proinflammatory responses, including IL8 and TNF. |
| T18140 | 26924-27159 | Sentence | denotes | In contrast, NleH1 does not block NF-κB p65 nuclear translocation, which suggests that certain p65-dependent but RPS3-independent NF-κB target genes might thus be beneficial for E. coli O157:H7 to replicate and disseminate in the host. |
| T18141 | 27160-27347 | Sentence | denotes | By selectively inhibiting RPS3 and its attendant NF-κB function with NleH1, the pathogen achieves the ability to increase colonization and diarrhea yet limiting the mortality of the host. |
| T18142 | 27348-27605 | Sentence | denotes | This seemingly paradoxical combination of effects make sense when one considers that increased bacterial load and diarrhea together with survival of the infected host would promote the spreading of the bacteria among a population of susceptible individuals. |
| T18143 | 27606-27744 | Sentence | denotes | Such complex and paradoxical pathological effects that influence the spread of disease are often poorly understood at the molecular level. |
| T18144 | 27745-27981 | Sentence | denotes | Our data elucidate how alterations in selective NF-κB function, achieved by impeding RPS3, but not altering p65 nuclear translocation, can influence specific cytokines that affect bacterial colonization, diarrhea diseases and mortality. |
| T18145 | 27982-28180 | Sentence | denotes | It may be fruitful in attempting to understand other infectious and autoimmune diseases involving NF-κB to consider selective effects of subunits such as RPS3 in addition to global NF-κB inhibition. |
| T21548 | 31430-31451 | Sentence | denotes | RNAi and Transfection |
| T21549 | 31452-31661 | Sentence | denotes | The siRNA (sense-strand sequence) IKKα, 5′-AUGACAGAGAAUGAUCAUGUUCUGC -3′; IKKβ, 5′-GCAGCAAGGAGAACAGAGGUUAAUA -3′; IκBα, 5′-GAGCUCCGAGACUUUCGAGGAAAUA -3′; RPS3-3′ UTR, 5′-GGAUGUUGCUCUCUAAAGACC -3′ (Invitrogen). |
| T21550 | 31662-31772 | Sentence | denotes | Transient transfection of siRNA and DNA constructs into Jurkat cells and 293T cells was described previously6. |
| T22036 | 32510-32541 | Sentence | denotes | Luciferase Reporter Gene Assays |
| T22037 | 32542-32614 | Sentence | denotes | Luciferase reporter gene assays were performed as previously described6. |
| T22038 | 32615-32801 | Sentence | denotes | Briefly, cells were cotransfected at a ratio of 10:1 with various promoter-driven firefly luciferase constructs to the Renilla luciferase pTKRL plasmid, together with indicated plasmids. |
| T1 | 0-118 | Sentence | denotes | IKKβ phosphorylation regulates RPS3 nuclear translocation and NF-κB function during Escherichia coli O157:H7 infection |
| T2 | 121-129 | Sentence | denotes | Abstract |
| T3 | 130-275 | Sentence | denotes | NF-κB is a major gene regulator in immune responses and ribosomal protein S3 (RPS3) is an NF-κB subunit that directs specific gene transcription. |
| T4 | 276-343 | Sentence | denotes | However, it is unknown how RPS3 nuclear translocation is regulated. |
| T5 | 344-482 | Sentence | denotes | Here we report that IKKβ phosphorylation of serine 209 (S209) was crucial for RPS3 nuclear localization in response to activating stimuli. |
| T6 | 483-760 | Sentence | denotes | Moreover, the foodborne pathogen Escherichia coli O157:H7 virulence protein NleH1 specifically inhibited RPS3 S209 phosphorylation and blocked RPS3 function, thereby promoting bacterial colonization and diarrhea but decreasing mortality in a gnotobiotic piglet infection model. |
| T7 | 761-937 | Sentence | denotes | Thus, the IKKβ-dependent modification of a specific amino acid in RPS3 promotes specific NF-κB functions that underlie the molecular pathogenetic mechanisms of E. coli O157:H7. |
| T8 | 939-1134 | Sentence | denotes | Nuclear Factor-kappa B (NF-κB) regulates crucial cellular functions and diverse stimuli activate this pleiotropic transcription factor, which in turn regulates a vast array of genetic targets1-3. |
| T9 | 1135-1247 | Sentence | denotes | The best-known mammalian NF-κB subunits are Rel proteins, including RelA (p65), RelB, c-Rel, p50, and p52 (refs. |
| T10 | 1248-1254 | Sentence | denotes | 4, 5). |
| T11 | 1255-1382 | Sentence | denotes | However, we recently demonstrated that ribosomal protein S3 (RPS3) is a key non-Rel subunit of certain native NF-κB complexes6. |
| T12 | 1383-1563 | Sentence | denotes | RPS3 is defined as a “specifier” subunit of NF-κB, because it facilitates high affinity DNA binding thus determining the regulatory specificity of NF-κB for selected target genes7. |
| T13 | 1564-1822 | Sentence | denotes | RPS3 regulation of NF-κB governs key physiological processes, including immunoglobulin κ light chain gene expression and receptor editing in B cells6, 8, cytokine production in T cells6, and in host defense against enterohemorrhagic Escherichia coli (EHEC)9. |
| T14 | 1823-2044 | Sentence | denotes | In particular, the E. coli O157:H7 type III secretion system (T3SS) effector protein NleH1 selectively blocks NF-κB target gene transcription by attenuating RPS3 nuclear translocation, without affecting p65 localization9. |
| T15 | 2045-2141 | Sentence | denotes | Nonetheless, how specific NF-κB activating signals induce RPS3 nuclear translocation is unknown. |
| T16 | 2142-2211 | Sentence | denotes | Extra-ribosomal functions have been ascribed to ribosomal proteins10. |
| T17 | 2212-2337 | Sentence | denotes | Besides binding RNA within the 40S ribosomal subunit, RPS3 participates in transcription6, DNA repair11, 12, and apoptosis13. |
| T18 | 2338-2404 | Sentence | denotes | Whether or not RPS3 is phosphorylated had been controversial14-18. |
| T19 | 2405-2593 | Sentence | denotes | Since kinase cascades play a critical role in NF-κB regulation, we tested whether RPS3 is phosphorylated in the context of NF-κB activation and sought to identify the responsible kinase19. |
| T20 | 2594-2704 | Sentence | denotes | Additionally, we aimed to define a regulatory role for the C-terminal tail of RPS3 whose function was unknown. |
| T21 | 2705-2809 | Sentence | denotes | Here we show that the Inhibitor of κB (IκB) kinase beta (IKKβ) phosphorylated RPS3 at serine 209 (S209). |
| T22 | 2810-2954 | Sentence | denotes | RPS3 S209 phosphorylation enhanced its association with importin-α, mediating RPS3 entry into the karyopherin pathway for nuclear translocation. |
| T23 | 2955-3115 | Sentence | denotes | Furthermore, the E. coli NleH1 effector specifically inhibited RPS3 S209 revealing how E. coli O157:H7 inhibits this important innate immune response mechanism. |
| T24 | 3117-3124 | Sentence | denotes | Results |
| T25 | 3126-3178 | Sentence | denotes | RPS3 phosphorylation in response to NF-κB activation |
| T26 | 3179-3338 | Sentence | denotes | To test whether RPS3 is phosphorylated during NF-κB activation, we performed 32P-labeling experiments in tumor necrosis factor (TNF)-stimulated HEK 293T cells. |
| T27 | 3339-3520 | Sentence | denotes | While RPS3 was scarcely phosphorylated in unstimulated cells, we observed a marked increase in 32P-incorporation after TNF stimulation despite no increase in RPS3 protein (Fig. 1a). |
| T28 | 3521-3712 | Sentence | denotes | To determine which RPS3 residues were phosphorylated, we immunoprecipitated RPS3 from either resting or stimulated cells and performed immunoblotting with phosphorylation-specific antibodies. |
| T29 | 3713-3966 | Sentence | denotes | Both TNF and phorbol myristate acetate/ionomycin (PMA+I) stimulated rapid phosphorylation and degradaion of IκBα within 5 min which was accompanied by RPS3 phosphorylation on serine residues (Fig. 1b and data not shown), similar to the in vivo labeling. |
| T30 | 3967-4042 | Sentence | denotes | We did not detect tyrosine- or threonine-phosphorylation of RPS3 (Fig. 1b). |
| T31 | 4044-4069 | Sentence | denotes | RPS3 and IKKβ interaction |
| T32 | 4070-4310 | Sentence | denotes | The activation of the inhibitor of κB kinase (IKK), consisting of a regulatory subunit IKKγ and two catalytic subunits, IKKα and IKKβ, is critical for the phosphorylation and dispatch of the inhibitory IκBs and the liberation of NF-κB20-22. |
| T33 | 4311-4488 | Sentence | denotes | Given that RPS3 can be found in the cytoplasmic p65-p50-IκBα inhibitory complex in resting cells6, we hypothesized that activated IKKβ might also bind to and phosphorylate RPS3. |
| T34 | 4489-4567 | Sentence | denotes | First, we found that ectopically expressed IKKβ and RPS3 interacted (Fig. 1c). |
| T35 | 4568-4774 | Sentence | denotes | We next examined resting Jurkat cells and detected a modest endogenous IKKβ-RPS3 interaction (Fig. 1d), potentially accounting for the basal NF-κB transcription required for cell proliferation and survival. |
| T36 | 4775-4939 | Sentence | denotes | RPS3-IKKβ association was clearly augmented upon TNF stimulation, peaking at 10 min. (Fig. 1d), following similar kinetics to RPS3 serine phosphorylation (Fig. 1b). |
| T37 | 4940-5021 | Sentence | denotes | By contrast, there was no detectable interaction between RPS3 and IKKα (Fig. 1d). |
| T38 | 5023-5070 | Sentence | denotes | IKKβ is required for RPS3 nuclear translocation |
| T39 | 5071-5319 | Sentence | denotes | To examine whether the RPS3-IKKβ interaction is required for RPS3 nuclear translocation, we knocked down IKKα or IKKβ expression with siRNAs (Supplementary Fig. 1) and then observed stimulation-induced RPS3 nuclear migration by confocal microscopy. |
| T40 | 5320-5455 | Sentence | denotes | Both TNF and PMA+I triggered RPS3 nuclear translocation in Jurkat cells transfected with a scrambled nonspecific (NS) siRNA (Fig. 2a)6. |
| T41 | 5456-5540 | Sentence | denotes | RPS3 nuclear translocation was only slightly, if at all, impaired by IKKα-silencing. |
| T42 | 5541-5650 | Sentence | denotes | Conversely, knockdown of IKKβ attenuated 60-70% of RPS3 nuclear accumulation following stimulation (Fig. 2a). |
| T43 | 5651-5815 | Sentence | denotes | Immunoblotting of nuclear fractions confirmed that full expression of IKKβ, but not IKKα, was necessary for activation-induced RPS3 nuclear translocation (Fig. 2b). |
| T44 | 5816-5924 | Sentence | denotes | Control immunoblots revealed that p65 nuclear translocation was blocked under the same conditions (Fig. 2b). |
| T45 | 5925-6087 | Sentence | denotes | We next examined the nuclear translocation of RPS3 in cells ectopically expressing either kinase-dead (SSAA) or constitutively-active (SSEE) mutant IKKβ proteins. |
| T46 | 6088-6209 | Sentence | denotes | As expected, the SSEE, but not SSAA, mutant of IKKβ induced NF-κB-dependent luciferase reporter activity (Fig. 2c, left). |
| T47 | 6210-6402 | Sentence | denotes | Whereas RPS3 remained cytosolic in IKKβ (SSAA)-expressing cells (Fig. 2c, right), a substantial proportion of RPS3 translocated to the nucleus in cells expressing IKKβ (SSEE) (Fig. 2c, right). |
| T48 | 6403-6586 | Sentence | denotes | The percentage of cells containing detectable nuclear RPS3 increased 5-fold in IKKβ (SSEE)-expressing cells, but not in IKKβ (SSAA)-expressing ones (Fig. 2d and Supplementary Fig. 2). |
| T49 | 6587-6706 | Sentence | denotes | Thus, IKKβ activity is necessary and sufficient for RPS3 nuclear translocation in response to NF-κB activating stimuli. |
| T50 | 6708-6755 | Sentence | denotes | IκBα degradation and RPS3 nuclear translocation |
| T51 | 6756-6824 | Sentence | denotes | Importin-α regulates the nuclear import of NF-κB Rel subunits23, 24. |
| T52 | 6825-6977 | Sentence | denotes | RPS3 harbors a nuclear localization signal (NLS) sequence and its nuclear translocation occurs in parallel to, but independently of, p65 translocation6. |
| T53 | 6978-7046 | Sentence | denotes | We envisioned that RPS3 could also utilize the importin-α/β pathway. |
| T54 | 7047-7177 | Sentence | denotes | Consistent with this notion, RPS3 association with importin-α, but not importin-β, was enhanced in TNF–stimulated cells (Fig. 3a). |
| T55 | 7178-7299 | Sentence | denotes | Therefore, we examined whether RPS3 binding to importin-α is essential for nuclear translocation during NF-κB activation. |
| T56 | 7300-7515 | Sentence | denotes | Since IκBα degradation is a prerequisite to unmask the NLS of p65, and both RPS3 and IκBα bind to p65 in the cytoplasmic inhibitory complex, we tested whether IκBα degradation is required for the liberation of RPS3. |
| T57 | 7516-7695 | Sentence | denotes | We measured the association of RPS3 with importin-α in 293T cells overexpressing wild-type IκBα or an IκBα mutant (SSAA) resistant to IKKβ-induced phosphorylation and degradation. |
| T58 | 7696-7851 | Sentence | denotes | In cells transfected with wild-type IκBα, TNF stimulation augmented the interaction of RPS3 and importin-α to a similar degree as in non-transfected cells. |
| T59 | 7852-7977 | Sentence | denotes | By contrast, we observed that the RPS3-importin-α association was abolished by the presence of non-degradable IκBα (Fig. 3b). |
| T60 | 7978-8166 | Sentence | denotes | To examine whether IκBα is the only cytoplasmic barrier precluding RPS3 nuclear translocation, we measured both RPS3-importin-α association and nuclear RPS3 after reducing IκBα expression. |
| T61 | 8167-8282 | Sentence | denotes | Compared with nonspecific siRNA, siRNA targeting of IκBα completely depleted IκBα in Jurkat cells (Fig. 3c, input). |
| T62 | 8283-8410 | Sentence | denotes | Nevertheless, the RPS3-importin-α association was not augmented (Fig. 3c), nor was significant nuclear RPS3 detected (Fig. 3d). |
| T63 | 8411-8723 | Sentence | denotes | Moreover, cells treated with sodium pervanadate (Pv) to induce IκBα degradation through an IKK-independent mechanism25-27 did not show increased association between RPS3 and importin-α (Fig. 3e and Supplementary Fig. 3b) or nuclear accumulation of RPS3, despite complete IκBα degradation (Supplementary Fig. 3c). |
| T64 | 8724-8892 | Sentence | denotes | We further examined whether a subsequent NF-κB activation signal independently promotes the importin-α association and nuclear transport of RPS3 after IκBα degradation. |
| T65 | 8893-9042 | Sentence | denotes | We found that TNF stimulation following Pv treatment was required for the RPS3-importin-α association, comparable to TNF stimulation alone (Fig. 3e). |
| T66 | 9043-9200 | Sentence | denotes | Thus, IκBα phosphorylation and degradation itself is required but not sufficient to cause RPS3 association with importin-α followed by nuclear translocation. |
| T67 | 9201-9285 | Sentence | denotes | Rather, an additional signal, potentially IKKβ phosphorylation of RPS3, is required. |
| T68 | 9287-9325 | Sentence | denotes | IKKβ phosphorylates RPS3 at serine 209 |
| T69 | 9326-9520 | Sentence | denotes | Although originally defined as the kinase that phosphorylates IκB19, IKKβ also phosphorylates unrelated substrates including 14-3-3β and Bcl10, which lack the IKK consensus motif (DpSGYXpS/T)28. |
| T70 | 9521-9591 | Sentence | denotes | We therefore hypothesized that IKKβ could directly phosphorylate RPS3. |
| T71 | 9592-9910 | Sentence | denotes | By in vitro kinase assays using recombinant IKK and RPS3 proteins, we observed strong incorporation of 32P in autophosphorylatd IKKα and IKKβ (Fig. 4a, lanes 2-7) as well as phosporylated GST-IκBα (1-54) (Supplementary Fig. 4), but not the GST protein alone (Fig. 4a, lanes 3 and 6), when either IKKα or IKKβ was used. |
| T72 | 9911-10028 | Sentence | denotes | We discovered that GST-RPS3 could be phosphorylated by IKKβ, but not IKKα, in vitro (Fig. 4a, compare lanes 4 and 7). |
| T73 | 10029-10200 | Sentence | denotes | To identify the RPS3 amino acid residue(s) phosphorylated by IKKβ, we performed liquid chromatography-tandem mass spectrometry analyses using in vitro phosphorylated RPS3. |
| T74 | 10201-10295 | Sentence | denotes | The results indicated that IKKβ phosphorylated S209, located in the RPS3 C-terminus (Fig. 4b). |
| T75 | 10296-10558 | Sentence | denotes | RPS3 amino acid sequence alignment revealed that S209 is conserved in many species throughout phylogeny with the exception of Caenorhabditis elegans and Schizosaccharomyces pombe, two organisms that do not possess the NF-κB signal pathway (Supplementary Fig. 5). |
| T76 | 10559-10721 | Sentence | denotes | To verify biochemically that S209 is an IKKβ substrate, we performed 32P-labeling in vitro kinase assays with recombinant wild-type or S209A mutant RPS3 proteins. |
| T77 | 10722-10831 | Sentence | denotes | Compared with the wild-type protein, the S209A mutation reduced IKKβ–mediated RPS3 phosphorylation (Fig. 4c). |
| T78 | 10832-10958 | Sentence | denotes | There might be alternative phosphorylation site(s) under these conditions given modest residual phosphorylated RPS3 (Fig. 4c). |
| T79 | 10959-11130 | Sentence | denotes | RPS3 S209 does not fall within a conventional IKK recognition motif, but rather resides in a sequence motif (XXXpS/TXXE), potentially recognized by casein kinase II (CK2). |
| T80 | 11131-11291 | Sentence | denotes | Although IKKβ kinase can display a CK2-like phosphorylation specificity29, no CK2 protein was detectable in our recombinant IKK proteins (Supplementary Fig. 6). |
| T81 | 11292-11430 | Sentence | denotes | Thus, RPS3 S209 phosphorylation was due to the alternate specificity of the IKKβ kinase rather than any trace amount of CK2 bound to IKKs. |
| T82 | 11431-11624 | Sentence | denotes | To determine whether S209 is the critical site at which IKKβ phosphorylates RPS3 in living cells, we transfected the wild-type or S209A mutant Flag-RPS3 alone, or together with IKKβ into cells. |
| T83 | 11625-11864 | Sentence | denotes | Indeed, we observed that overexpressing IKKβ enhanced Flag-RPS3 phosphorylation, but phosphorylation was effectively eliminated by alanine substitution indicating that S209 is the predominant target site for IKKβ phosphorylation (Fig. 4d). |
| T84 | 11865-12032 | Sentence | denotes | We next generated a phospho-S209 RPS3 antibody and confirmed that endogenous RPS3 was phosphorylated at S209 in a time-dependent manner upon TNF stimulation (Fig. 4e). |
| T85 | 12033-12114 | Sentence | denotes | Thus, the RPS3 C-terminal tail potentially contains an important regulatory site. |
| T86 | 12116-12162 | Sentence | denotes | Phosphorylation of RPS3 and its NF-κB function |
| T87 | 12163-12283 | Sentence | denotes | We next examined whether S209 phosphorylation plays a role in the nuclear translocation of RPS3 during NF-κB activation. |
| T88 | 12284-12551 | Sentence | denotes | Subcellular fractions from either wild-type or S209A mutant RPS3-transfected cells were prepared and blotted for heat-shock protein 90 (hsp90), a cytoplasmic protein, and poly (ADP-ribose) polymerase (PARP), a nuclear protein, confirming a clean separation (Fig. 5a). |
| T89 | 12552-12645 | Sentence | denotes | As expected, PMA+I stimulation triggered wild-type Flag-RPS3 nuclear translocation (Fig. 5a). |
| T90 | 12646-12715 | Sentence | denotes | However, RPS3 (S209A) nuclear translocation was attenuated (Fig. 5a). |
| T91 | 12716-12815 | Sentence | denotes | We also tested the impact of activating NF-κB by overexpressing IKKβ on RPS3 nuclear translocation. |
| T92 | 12816-12993 | Sentence | denotes | IKKβ overexpression activated NF-κB measured by luciferase assays (Supplementary Fig. 7), and also induced the nuclear translocation of wild-type, but not S209A, RPS3 (Fig. 5b). |
| T93 | 12994-13111 | Sentence | denotes | These data suggest that S209 phosphorylation is critical for the NF-κB activation-induced RPS3 nuclear translocation. |
| T94 | 13112-13400 | Sentence | denotes | To examine the role of S209 phosphorylation of RPS3 to its NF-κB function6, 7, 30, we silenced endogenous RPS3 expression using an siRNA that targets the 3′ untranslated region (3′ UTR) of RPS3 mRNA, followed by complementation with either wild-type or S209A mutant RPS3 via transfection. |
| T95 | 13401-13609 | Sentence | denotes | As expected, RPS3 siRNA severely reduced endogenous RPS3 abundance compared to NS siRNA, but did not affect the robust expression of Flag-tagged RPS3 from a transfected construct lacking the 3′ UTR (Fig. 5c). |
| T96 | 13610-13726 | Sentence | denotes | We also found that RPS3 knockdown reduced TNF-induced expression of an Ig κB-driven luciferase construct6 (Fig. 5d). |
| T97 | 13727-13908 | Sentence | denotes | The impaired luciferase signal caused by RPS3 deficiency was completely restored by transfecting wild-type, but not by S209A RPS3 (Fig. 5d), despite equivalent expression (Fig. 5c). |
| T98 | 13909-14179 | Sentence | denotes | Moreover, the failure of S209A RPS3 to restore luciferase activity did not result from defective translation because the transient overexpression of green fluorescent protein (GFP) was comparable in cells complemented with wild-type or S029A RPS3 (Supplementary Fig. 8). |
| T99 | 14180-14312 | Sentence | denotes | Taken together, these data suggest that RPS3 S209 phosphorylation is critical for NF-κB activity involving the canonical Ig κB site. |
| T100 | 14313-14496 | Sentence | denotes | We next used chromatin immunoprecipitation to determine whether S209 phosphorylation affects RPS3 and p65 recruitment to specific κB sites in intact chromatin during NF-κB activation. |
| T101 | 14497-14681 | Sentence | denotes | In RPS3 knockdown cells, PMA+I stimulated the recruitment of ectopically expressed, Flag-tagged wild-type, but not S209A RPS3 to the κB sites of the NFKBIA and IL8 promoters (Fig. 5e). |
| T102 | 14682-14808 | Sentence | denotes | While expressing RPS3 S209A had no impact on p65 nuclear translocation, it substantially attenuated p65 recruitment (Fig. 5e). |
| T103 | 14809-15003 | Sentence | denotes | Additional experiments revealed that p65 attraction to RPS3-independent NF-κB target gene promoters such as CD25 was increased (Supplementary Fig. 9), consistent with our previous observations6. |
| T104 | 15004-15151 | Sentence | denotes | There was no significant Flag-RPS3 or p65 recruitment to ACTB promoter lacking κB sites (Fig. 5e), suggesting the recruitment was κB site-specific. |
| T105 | 15152-15261 | Sentence | denotes | Thus, the recruitment of RPS3 as well as the contingent recruitment of p65 to key promoters depended on S209. |
| T106 | 15262-15528 | Sentence | denotes | Interleukin 8 (IL-8) secretion induced by either T cell receptor (TCR) agonist stimulation or PMA+I was decreased as a consequence of reduced RPS3/p65 recruitment to the IL8 κB sites in the presence of S209A mutant compared to wild-type RPS3 (Supplementary Fig. 10). |
| T107 | 15529-15661 | Sentence | denotes | However, cell surface CD25 expression was comparable between the wild-type and S209A RPS3 transfected cells (Supplementary Fig. 11). |
| T108 | 15662-15795 | Sentence | denotes | Therefore, RPS3 S209 phosphorylation by IKKβ is apparently required for RPS3 in directing NF-κB to a specific subset of target genes. |
| T109 | 15797-15841 | Sentence | denotes | NleH1 inhibits RPS3 phosphorylation in vitro |
| T110 | 15842-15944 | Sentence | denotes | EHEC pathogens are important causative agents of both foodborne disease and pediatric renal failure31. |
| T111 | 15945-16103 | Sentence | denotes | EHEC utilize T3SS to inject effector proteins directly into intestinal epithelial cells32, a subset of which inhibit NF-κB-dependent innate responses9, 33-38. |
| T112 | 16104-16253 | Sentence | denotes | The E. coli O157:H7 EDL933 effector protein NleH1 binds to and attenuates RPS3 nuclear translocation, thus impairing RPS3-dependent NF-κB signaling9. |
| T113 | 16254-16344 | Sentence | denotes | We therefore hypothesized that NleH1 may function by inhibiting RPS3 S209 phosphorylation. |
| T114 | 16345-16488 | Sentence | denotes | As expected, transfecting increasing amounts of NleH1-HA plasmid blocked TNFα-induced NF-κB activation in a dose-dependent manner (Fig. 6a-b)9. |
| T115 | 16489-16615 | Sentence | denotes | Remarkably, NleH1 reduced both TNF-induced, as well as basal RPS3 phosphorylation to roughly 20% of vehicle control (Fig. 6c). |
| T116 | 16616-16793 | Sentence | denotes | Expressing NleH1 does not interfere with either TNF-induced IKK activation or IκBα degradation, consistent with the lack of NleH1 impact on p65 nuclear translocation9 (Fig. 6c). |
| T117 | 16794-17038 | Sentence | denotes | To determine if NleH1 inhibits RPS3 phosphorylation, we infected HeLa cells with E. coli O157:H7 strains possessing or lacking either nleH1 (ΔnleH1) or with a strain lacking a functional T3SS unable to inject NleH1 into mammalian cells (ΔescN). |
| T118 | 17039-17166 | Sentence | denotes | In uninfected cells, TNF-treatment stimulated a ∼7-fold increase in RPS3 S209 phosphorylation, peaking at 30 minutes (Fig. 6d). |
| T119 | 17167-17292 | Sentence | denotes | By contrast, RPS3 S209 phosphorylation was substantially impaired in cells infected with wild-type E. coli O157:H7 (Fig. 6d). |
| T120 | 17293-17411 | Sentence | denotes | However, TNF-induced RPS3 S209 phosphorylation was unimpaired in cells infected with either ΔnleH1 or ΔescN (Fig. 6d). |
| T121 | 17412-17554 | Sentence | denotes | We showed previously that wild-type, but not ΔnleH1 or ΔescN E. coli O157:H7 significantly attenuated TNF-induced RPS3 nuclear translocation9. |
| T122 | 17555-17793 | Sentence | denotes | The parallel between RPS3 phosphorylation and its nuclear translocation during E. coli infection provides evidence in the context of an NF-κB-dependent disease process that RPS3 S209 phosphorylation is important for nuclear translocation. |
| T123 | 17794-17970 | Sentence | denotes | Our discovery that NleH1 inhibits RPS3 S209 phosphorylation suggested that it should also blocks RPS3-dependent NF-κB target gene transcription (e.g. IL8, NFKBIA, and TNFAIP3). |
| T124 | 17971-18162 | Sentence | denotes | Indeed, these genes were only modestly upregulated in cells infected with wild-type E. coli O157:H7, but significantly induced in cells infected with either ΔnleH1 or ΔescN strains (Fig. 6e). |
| T125 | 18163-18302 | Sentence | denotes | In contrast, deleting nleH1 had no impact on the expression of RPS3-independent genes, including CD25 and TNFSF13B (Supplementary Fig. 12). |
| T126 | 18303-18514 | Sentence | denotes | Together these results demonstrate that NleH1 specifically inhibits the protective immune response by directly blocking RPS3 S209 phosphorylation and thereby impairing critical RPS3-dependent NF-κB target genes. |
| T127 | 18516-18564 | Sentence | denotes | NleH1 inhibits RPS3 S209 phosphorylation in vivo |
| T128 | 18565-18748 | Sentence | denotes | We previously utilized a gnotobiotic piglet infection model to determine that piglets infected with ΔnleH1 mutant died more rapidly than those infected with wild-type E. coli O157:H7. |
| T129 | 18749-18914 | Sentence | denotes | Piglets infected with ΔnleH1 displayed clinical disease consistent with a robust inflammatory response, but with reduced bacterial colonization and little diarrhea9. |
| T130 | 18915-19122 | Sentence | denotes | While seemingly paradoxical, based on our cell culture data (Fig. 6d), we hypothesized that NleH1 blocked RPS3 S209 phosphorylation in vivo, thereby preventing RPS3 nuclear translocation in infected piglets. |
| T131 | 19123-19237 | Sentence | denotes | We isolated piglet colons at necropsy, and subjected them to immunohistochemistry using our phospho-RPS3 antibody. |
| T132 | 19238-19481 | Sentence | denotes | Consistent with in vitro data, piglets infected with wild-type E. coli O157:H7 exhibited diffuse and low intensity phospho-RPS3 staining, whereas in piglets infected with ΔnleH1 mutant, phospho-RPS3 expression was florid and intense (Fig. 6f). |
| T133 | 19482-19645 | Sentence | denotes | These data demonstrate that NleH1 inhibits RPS3 S209 phosphorylation both in vitro and in vivo, which might benefit the bacterium in colonization and transmission. |
| T134 | 19647-19692 | Sentence | denotes | NleH1 steers the IKKβ substrate specificities |
| T135 | 19693-19789 | Sentence | denotes | NleH1 is an autophosphorylated serine-threonine kinase, which depends on the lysine 159 (K159)9. |
| T136 | 19790-20091 | Sentence | denotes | To explore the mechanism by which NleH1 inhibits RPS3 S209 phosphorylation, we first performed an in vitro kinase assay with purified wild-type His-NleH1 protein and a mutant His-NleH1 (K159A) protein, confirming that NleH1 is autophosphorylated and the K159A is an NleH1 kinase-dead mutant (Fig. 7a). |
| T137 | 20092-20274 | Sentence | denotes | To examine whether the kinase activity is required for NleH1 to inhibit IKKβ phosphorlyation of RPS3 on S209, we ectopically expressing either wild-type or K159A NleH1 in 293T cells. |
| T138 | 20275-20414 | Sentence | denotes | Wild-type NleH1 expression significantly reduced TNF-induced RPS3 S209 phosphorylation, whereas the K159A mutant failed to do so (Fig. 7b). |
| T139 | 20415-20505 | Sentence | denotes | Thus NleH1 kinase activity is required to protect RPS3 from IKKβ-mediated phosphorylation. |
| T140 | 20506-20781 | Sentence | denotes | Citrobacter rodentium is a mouse pathogen that shares pathogenic strategies with E. coli 39, most notably for our investigation, C. rodentium NleH inhibited RPS3 nuclear translocation and RPS3-dependent NF-κB luciferase activity to an extent equivalent to E. coli NleH1 (ref. |
| T141 | 20782-20785 | Sentence | denotes | 9). |
| T142 | 20786-20882 | Sentence | denotes | We assayed RPS3 S209 phosphorylation in HeLa cells infected with different C. rodentium strains. |
| T143 | 20883-20989 | Sentence | denotes | In uninfected cells, TNF-treatment stimulated a ∼3.5-fold increase in RPS3 S209 phosphorylation (Fig. 7c). |
| T144 | 20990-21103 | Sentence | denotes | Such augmentation of RPS3 phosphorylation was reduced by about 60% by wild-type C. rodentium infection (Fig. 7c). |
| T145 | 21104-21229 | Sentence | denotes | However, RPS3 phosphorylation was enhanced when cells were infected with a C. rodentium strain lacking NleH (Fig. 7c, ΔnleH). |
| T146 | 21230-21396 | Sentence | denotes | We further examined the role of NleH1 kinase activity using the C. rodentium ΔnleH strain as a background on which to express either wild-type or K159A E. coli NleH1. |
| T147 | 21397-21582 | Sentence | denotes | Complementing ΔnleH mutant with wild-type NleH1 almost abolished TNF-induced RPS3 S209 phosphorylation whereas complementing with K159A failed to inhibit RPS3 phosphorylation (Fig. 7c). |
| T148 | 21583-21697 | Sentence | denotes | Collectively, these results demonstrate that NleH1 kinase activity is required to block RPS3 S209 phosphorylation. |
| T149 | 21698-21896 | Sentence | denotes | We next examined whether the inhibitory activity of NleH1 is sufficiently robust to impair the strong nuclear translocation of RPS3 trigged by the constitutively-active IKKβ (IKKβ [SSEE]) (Fig. 2d). |
| T150 | 21897-22067 | Sentence | denotes | We found that ectopically expressing either wild-type or SSEE IKKβ proteins, triggered more RPS3 nuclear translocation than the kinase-dead IKKβ (SSAA) protein (Fig. 7d). |
| T151 | 22068-22181 | Sentence | denotes | RPS3 nuclear accumulation was substantially retarded by infecting cells with wild-type E. coli O157:H7 (Fig. 7d). |
| T152 | 22182-22349 | Sentence | denotes | In contrast, infecting with either ΔnleH1 or ΔescN strains only slightly impaired RPS3 nuclear translocation in either IKKβ- or IKKβ (SSEE)-expressing cells (Fig. 7d). |
| T153 | 22350-22501 | Sentence | denotes | As expected, E. coli infections did not affect the RPS3 nuclear translocation in IKKβ (SSAA)-expressing cells, where NF-κB signaling was low (Fig. 7d). |
| T154 | 22502-22647 | Sentence | denotes | Thus, during infection NleH1 is sufficiently potent to inhibit RPS3 nuclear translocation even in cells expressing constitutively-activated IKKβ. |
| T155 | 22648-22764 | Sentence | denotes | We examined whether NleH1 could directly phosphorylate IKKβ thus inhibiting IKKβ-mediated RPS3 S209 phosphorylation. |
| T156 | 22765-22974 | Sentence | denotes | We performed in vitro kinase assays using immunoprecipitated Flag-IKKβ (K44A) as substrate and recombinant His-NleH1 as kinase, so that IKKβ autophosphorylation would not obscure NleH1-induced phosphorylation. |
| T157 | 22975-23102 | Sentence | denotes | However, we did not observe any detectable 32P incorporation in IKKβ (Supplementary Fig. 13), thus ruling out this possibility. |
| T158 | 23103-23189 | Sentence | denotes | We then tested the hypothesis that NleH1 could alter the IKKβ substrate specificities. |
| T159 | 23190-23282 | Sentence | denotes | To this end, we performed in vitro kinase assays using both CK2 and IKK substrates for IKKβ. |
| T160 | 23283-23451 | Sentence | denotes | As expected, IKKβ phosphorylated RPS3 (Fig. 7e, lane 7) and GST-IκBα (1-54) protein (Fig. 7e, lane 9), demonstrating it harbors either CK2 or IKK substrate specificity. |
| T161 | 23452-23652 | Sentence | denotes | Preincubation of IKKβ with NleH1 reduced IKKβ-mediated RPS3 phosphorylation, i.e. the CK2 kinase specificity, but not IKKβ-mediated GST-IκBα phosphorylation, i.e. the IKK kinase specificity (Fig. 7e). |
| T162 | 23653-23769 | Sentence | denotes | Control experiments revealed no NleH1-mediated phosphorylation or autophosphorylation of RPS3 or GST-IκBα (Fig. 7e). |
| T163 | 23770-23992 | Sentence | denotes | Taken together, NleH1 blocks the CK2 substrate specificity of IKKβ thus inhibiting the IKKβ-mediated RPS3 S209 phosphorylation thus representing a novel strategy by E. coli O157:H7 to alter the host innate immune response. |
| T164 | 23994-24004 | Sentence | denotes | Discussion |
| T165 | 24005-24114 | Sentence | denotes | RPS3 was previously demonstrated to function as an integral subunit conferring NF-κB regulatory specificity6. |
| T166 | 24115-24252 | Sentence | denotes | Here we sought to elucidate how NF-κB activation signaling triggers RPS3 to translocate and participate in NF-κB function in the nucleus. |
| T167 | 24253-24448 | Sentence | denotes | We demonstrate that IKKβ-mediated RPS3 S209 phosphorylation represents a critical determinant in governing its nuclear import thus unveiling a novel mechanism behind NF-κB regulatory specificity. |
| T168 | 24449-24573 | Sentence | denotes | IKKβ is the major kinase that phosphorylates IκBs in the classical NF-κB pathway, leading to their subsequent degradation40. |
| T169 | 24574-24681 | Sentence | denotes | Strikingly, RPS3 possesses not any consensus IKK motif; instead, S209 is centered in a consensus CK2 motif. |
| T170 | 24682-24855 | Sentence | denotes | The recent observation that human IKKβ displayed CK2-like phosphorylation specificity29 coincides with our evidence that recombinant IKKβ, but not IKKα, phosphorylated RPS3. |
| T171 | 24856-25006 | Sentence | denotes | We found this phosphorylation is a critical modulation for RPS3 nuclear translocation (via importin-α) and engagement in specific NF-κB transcription. |
| T172 | 25007-25299 | Sentence | denotes | CK2 was previously shown to phosphorylate p65 and to bind to and phosphorylate IKKβ41-43, however, we ruled out the possibility that the IKKβ-bound CK2 could account for the observed RPS3 phosphorylation because no CK2 was detected in the IKKβ preparations used for the in vitro kinase assay. |
| T173 | 25300-25486 | Sentence | denotes | Because RPS3 only harbors the CK2 motif and not a traditional IKK motif, this RPS3 regulatory function could explain why IKK harbors the alternative substrate phosphorylation capability. |
| T174 | 25487-25686 | Sentence | denotes | More importantly, our study has elucidated how RPS3 is biochemically integrated into NF-κB activation signaling in a manner that is pivotal for the pathogenesis of foodborne pathogen E. coli O157:H7. |
| T175 | 25687-25807 | Sentence | denotes | IKKβ-mediated RPS3 S209 phosphorylation is a critical target modulated by this pathogen to subvert host NF-κB signaling. |
| T176 | 25808-25973 | Sentence | denotes | The bacterial effector NleH1 specifically binds to RPS3 once injected into host cells and profoundly suppresses NF-κB and its attendant protective immune responses9. |
| T177 | 25974-26157 | Sentence | denotes | Our data now show that NleH1 selectively inhibits RPS3 phosphorylation, thus retarding its nuclear translocation and subsequent NF-κB function, without altering other NF-κB signaling. |
| T178 | 26158-26294 | Sentence | denotes | Although NleH1 did not directly phosphorylate IKKβ, its kinase activity was required to inhibit IKKβ-mediated RPS3 S209 phosphorylation. |
| T179 | 26295-26524 | Sentence | denotes | Many bacteria pathogens have products that target key kinases to inactivate them in host cells, whereas E. coli O157:H7 employed NleH1 to steer the substrate specificity of IKKβ thus specifically fine-tuning host NF-κB signaling. |
| T180 | 26525-26637 | Sentence | denotes | This could represent a novel strategy to fine-tune host NF-κB signaling that could be shared by other pathogens. |
| T181 | 26638-26738 | Sentence | denotes | These data provide new insights into the poorly understood action mechanism for most T3SS effectors. |
| T182 | 26739-26923 | Sentence | denotes | NleH1 attenuates the transcription of RPS3-dependent, but not all, NF-κB target genes, in particular those genes associated with acute proinflammatory responses, including IL8 and TNF. |
| T183 | 26924-27159 | Sentence | denotes | In contrast, NleH1 does not block NF-κB p65 nuclear translocation, which suggests that certain p65-dependent but RPS3-independent NF-κB target genes might thus be beneficial for E. coli O157:H7 to replicate and disseminate in the host. |
| T184 | 27160-27347 | Sentence | denotes | By selectively inhibiting RPS3 and its attendant NF-κB function with NleH1, the pathogen achieves the ability to increase colonization and diarrhea yet limiting the mortality of the host. |
| T185 | 27348-27605 | Sentence | denotes | This seemingly paradoxical combination of effects make sense when one considers that increased bacterial load and diarrhea together with survival of the infected host would promote the spreading of the bacteria among a population of susceptible individuals. |
| T186 | 27606-27744 | Sentence | denotes | Such complex and paradoxical pathological effects that influence the spread of disease are often poorly understood at the molecular level. |
| T187 | 27745-27981 | Sentence | denotes | Our data elucidate how alterations in selective NF-κB function, achieved by impeding RPS3, but not altering p65 nuclear translocation, can influence specific cytokines that affect bacterial colonization, diarrhea diseases and mortality. |
| T188 | 27982-28180 | Sentence | denotes | It may be fruitful in attempting to understand other infectious and autoimmune diseases involving NF-κB to consider selective effects of subunits such as RPS3 in addition to global NF-κB inhibition. |
| T189 | 28182-28189 | Sentence | denotes | Methods |
| T190 | 28191-28209 | Sentence | denotes | Cells and Reagents |
| T191 | 28210-28401 | Sentence | denotes | Jurkat E6.1, HEK293T and HeLa cells were cultured in RPMI 1640 and DMEM supplemented with 10% fetal calf serum, 2 mM glutamine, and 100 U/ml each of penicillin and streptomycin, respectively. |
| T192 | 28402-29063 | Sentence | denotes | IκBα (C-21, sc-371), p65 (C-20, sc-372), and phospho-threonine (H-2, sc-5267) antibodies were from Santa Cruz Biotechnology; β-actin (AC-15, A5441), Flag (M2, F3165), HA (HA-7, H3663), importin-α (IM-75, I1784), and importin-β (31H4, I2534) antibodies were from Sigma; PARP (C2-10, 556362), IKKα (B78-1, 556532), and IKKβ (24, 611254) antibodies were from BD Pharmingen; CK2α (31, 611610) and Hsp90 (68, 610418) antibodies were from BD Transduction Laboratories; phospho-IκBα (5A5, 9246S) and phospho-IKKα/β (16A6, 2697S) antibodies were from Cell Signaling Technology; phospho-serine (AB1603) and phospho-tyrosine (4G10, 05-777) antibodies were from Millipore. |
| T193 | 29064-29130 | Sentence | denotes | The rabbit polyclonal RPS3 antiserum was as described previously6. |
| T194 | 29131-29296 | Sentence | denotes | The rabbit polyclonal antibody specific for S209 phosphorylated RPS3 was generated and affinity purified by Primm Biotech using the peptide NH2-CKPLPDHV(Sp)IVE-COOH. |
| T195 | 29298-29316 | Sentence | denotes | Plasmid Constructs |
| T196 | 29317-29406 | Sentence | denotes | The Flag-IKKβ (SSEE), Flag-IKKβ (SSAA), and HA-IκBα (SSAA) constructs were provided by C. |
| T197 | 29407-29432 | Sentence | denotes | Wu (NCI, Bethesda) and U. |
| T198 | 29433-29476 | Sentence | denotes | Siebenlist (NIAID, Bethesda), respectively. |
| T199 | 29477-29553 | Sentence | denotes | The HA-IκBα and IKKβ (K44A)-Flag plasmids were purchased from Addgene44, 45. |
| T200 | 29554-29643 | Sentence | denotes | The Flag-RPS3, GST-RPS3, HA-RPS3, VN-HA, NleH1-HA plasmids were described previously6, 9. |
| T201 | 29644-29877 | Sentence | denotes | The point mutants of RPS3 were generated by site-directed mutagenesis using the Quick Change Kit (Stratagene) with primers forward 5′-CTGCCTGACCACGTGGCCATTGTGGAACCCAAA-3′ and reverse 5′-TTTGGGTTCCACAATGGCCACGTGGTCAGGCAG-3′ for S209A. |
| T202 | 29878-29922 | Sentence | denotes | All mutants were verified by DNA sequencing. |
| T203 | 29924-29944 | Sentence | denotes | 32P in vivo Labeling |
| T204 | 29945-30067 | Sentence | denotes | HEK 293T cells were labeled with 2 mCi/ml 32P-orthophosphate (Perkin Elmer) in phosphate-free medium (Invitrogen) for 2 h. |
| T205 | 30068-30165 | Sentence | denotes | Cells were then left untreated or treated with TNF (50 ng/ml, R&D Systems) for indicated periods. |
| T206 | 30166-30246 | Sentence | denotes | Cell lysates were prepared and used for immunoprecipitations with RPS3 antibody. |
| T207 | 30248-30269 | Sentence | denotes | In Vitro Kinase Assay |
| T208 | 30270-30380 | Sentence | denotes | Kinase-active recombinant IKKβ and IKKα proteins were purchased from Active Motif and Millipore, respectively. |
| T209 | 30381-30521 | Sentence | denotes | Bacterially purified glutathione S-transferase (GST), GST-IκBα (1-54), wild type, mutant GST-RPS3, or RPS3 proteins were used as substrates. |
| T210 | 30522-30588 | Sentence | denotes | The in vitro kinase assay was performed as previously described29. |
| T211 | 30589-30907 | Sentence | denotes | Briefly, enzyme (100 ng) and substrate (2 μg) were co-incubated in IKK reaction buffer (25 mM Tris–HCl [pH 8.0], 50 mM KCl, 10 mM MgCl2, 1 mM DTT, 1 mM Na3VO4, 1 mM ATP) or NleH1 reaction buffer (50 mM Tris-HCl [pH 7.6], 5 mM MgCl2, 1 mM DTT, 1 mM ATP) with 0.5 μCi 32P-γ-ATP (GE Healthcare) added at 37 °C for 30 min. |
| T212 | 30908-30982 | Sentence | denotes | The reactions were resolved by SDS–PAGE and visualized by autoradiography. |
| T213 | 30984-31001 | Sentence | denotes | LC-MS/MS Analysis |
| T214 | 31002-31155 | Sentence | denotes | GST or GST-RPS3 was incubated with recombinant IKKβ protein as described above in an in vitro kinase assay reaction conducted without 32P-γ-ATP labeling. |
| T215 | 31156-31261 | Sentence | denotes | The reaction was separated by SDS-PAGE, and the protein gel was stained with Colloidal Blue (Invitrogen). |
| T216 | 31262-31428 | Sentence | denotes | The corresponding protein fragments were excised and subjected to trypsin digestion and LC-MS/MS at the Yale Cancer Center Mass Spectrometry Resource (New Haven, CT). |
| T217 | 31430-31451 | Sentence | denotes | RNAi and Transfection |
| T218 | 31452-31661 | Sentence | denotes | The siRNA (sense-strand sequence) IKKα, 5′-AUGACAGAGAAUGAUCAUGUUCUGC -3′; IKKβ, 5′-GCAGCAAGGAGAACAGAGGUUAAUA -3′; IκBα, 5′-GAGCUCCGAGACUUUCGAGGAAAUA -3′; RPS3-3′ UTR, 5′-GGAUGUUGCUCUCUAAAGACC -3′ (Invitrogen). |
| T219 | 31662-31772 | Sentence | denotes | Transient transfection of siRNA and DNA constructs into Jurkat cells and 293T cells was described previously6. |
| T220 | 31774-31799 | Sentence | denotes | Subcellular Fractionation |
| T221 | 31800-31896 | Sentence | denotes | Subcellular fractionation was performed by differential centrifugation as previously described6. |
| T222 | 31897-32103 | Sentence | denotes | Briefly, cells were resuspended in ice-cold Buffer A (10 mM HEPES pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT, 0.4 % NP-40, 0.5 mM PMSF, complete protease inhibitor cocktail) at 4 °C for 5 min. |
| T223 | 32104-32212 | Sentence | denotes | Lysates were centrifuged at 4 °C, 500 × g for 3 min, and supernatants were collected as cytosolic fractions. |
| T224 | 32213-32404 | Sentence | denotes | Pellets were incubated in Buffer C (20 mM HEPES pH7.9, 420 mM NaCl, 1.5 mM MgCl2, 25% glycerol, 0.5 mM PMSF, 0.2 mM EDTA, 0.5 mM DTT, complete protease inhibitor cocktail) at 4 °C for 10 min. |
| T225 | 32405-32508 | Sentence | denotes | Supernatants were collected as nuclear fractions following a centrifuge at 4 °C, 13,800 × g for 10 min. |
| T226 | 32510-32541 | Sentence | denotes | Luciferase Reporter Gene Assays |
| T227 | 32542-32614 | Sentence | denotes | Luciferase reporter gene assays were performed as previously described6. |
| T228 | 32615-32801 | Sentence | denotes | Briefly, cells were cotransfected at a ratio of 10:1 with various promoter-driven firefly luciferase constructs to the Renilla luciferase pTKRL plasmid, together with indicated plasmids. |
| T229 | 32802-32884 | Sentence | denotes | Cells were cultured for 1–2 days and then stimulated in triplicate before harvest. |
| T230 | 32885-32947 | Sentence | denotes | Lysates were analyzed using the Dual-Luciferase Kit (Promega). |
| T231 | 32949-32985 | Sentence | denotes | Chromatin Immunoprecipitation (ChIP) |
| T232 | 32986-33037 | Sentence | denotes | ChIP assays was performed as previously described6. |
| T233 | 33038-33167 | Sentence | denotes | The primers used to amplify the promoter region adjacent to the κB sites of IL8 and NFKBIA, as well as ACTB have been described6. |
| T234 | 33169-33198 | Sentence | denotes | Immunofluorescence Microscopy |
| T235 | 33199-33258 | Sentence | denotes | Confocal microscopy was performed as previously described6. |
| T236 | 33259-33356 | Sentence | denotes | Briefly, cells were fixed with 4 % paraformaldehyde in PBS and then Cellspin mounted onto slides. |
| T237 | 33357-33643 | Sentence | denotes | The fixed cells were then permeabilized with 0.05 % Triton X-100 in PBS and stained with FITC-conjugated rabbit anti-RPS3 antibodies (Primm Biotech), or AlexaFluor 594-conjugated rat anti-Flag antibodies (BD) for 40 min together with 1 μg/ml of Hoechst 33342 (Sigma) for 5 min at 25 °C. |
| T238 | 33644-33739 | Sentence | denotes | The slides were then rinsed with PBS three times and cover mounted for fluorescence microscopy. |
| T239 | 33741-33775 | Sentence | denotes | Immunoprecipitation and immunoblot |
| T240 | 33776-34105 | Sentence | denotes | The cells were harvested and lysed on ice by 0.4 ml of the modified RIPA buffer (50 mM Tris-HCl [pH 7.4], 1% NP-40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 mM Na3VO4, 1 mM NaF) supplemented with 1 × protease inhibitor cocktail (Roche) and 1 × phosphatase inhibitor cocktail set I (EMD Biosciences) for 30 min. |
| T241 | 34106-34197 | Sentence | denotes | The lysates were centrifuged at 10,000 × g at 4 °C for 10 min to remove insoluble material. |
| T242 | 34198-34403 | Sentence | denotes | After normalizing protein concentrations, lysates were subjected to immunoprecipitation by adding 10 mg/ml appropriate antibody plus 30 ml of protein G-agarose (Roche), and rotated for at least 2 h at 4°C. |
| T243 | 34404-34551 | Sentence | denotes | The precipitates were washed at least five times with cold lysis buffer followed by separation by SDS-PAGE under reduced and denaturing conditions. |
| T244 | 34552-34697 | Sentence | denotes | Nitrocellulose membranes were blocked in 5 % nonfat milk in 0.1 % PBS-Tween 20 (PBS-T), probed with specific antibodies as described previously6. |
| T245 | 34698-34868 | Sentence | denotes | For immunoblotting of phosphorylated proteins, gels were transferred to methanol-treated polyvinylidene chloride membranes, retreated with methanol, and dried for 30 min. |
| T246 | 34869-35026 | Sentence | denotes | Blots were blocked in 5 % bovine serum albumin in 0.1 % Tris buffered saline-Tween 20 (TBS-T), and probed with specific antibodies as described previously46. |
| T247 | 35027-35129 | Sentence | denotes | Bands were imaged by the Super Signaling system (Pierce) according to the manufacturer's instructions. |
| T248 | 35131-35136 | Sentence | denotes | ELISA |
| T249 | 35137-35338 | Sentence | denotes | The amount of IL-8 present in supernatants collected from Jurkat cell culture was measured using a Human Interleukin-8 ELISA Ready-SET-Go kit (eBioscience) according to the manufacturer's instructions. |
| T250 | 35340-35355 | Sentence | denotes | Cell Infections |
| T251 | 35356-35451 | Sentence | denotes | HeLa cells were infected with E. coli O157:H7 or C. rodentium strains as described previously9. |
| T252 | 35453-35473 | Sentence | denotes | Immunohistochemistry |
| T253 | 35474-35562 | Sentence | denotes | Gnotobiotic piglets were infected with E. coli O157:H7 strains as described previously9. |
| T254 | 35563-35638 | Sentence | denotes | Spiral colon specimens were collected at necropsy and embedded in paraffin. |
| T255 | 35639-35752 | Sentence | denotes | Paraffin sectioning and immunohistochemical staining using phospho-RPS3 antibody were performed by Histoserv Inc. |
| T256 | 35754-35776 | Sentence | denotes | Supplementary Material |
| T257 | 35777-35778 | Sentence | denotes | 1 |
ICD10
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T10693 | 12402-12407 | http://purl.bioontology.org/ontology/ICD10/R57.9 | denotes | shock |
events-check-again
| Id | Subject | Object | Predicate | Lexical cue | Negation | Speculation |
|---|---|---|---|---|---|---|
| T562 | 0-4 | Protein | denotes | IKKβ | ||
| T563 | 5-20 | Phosphorylation | denotes | phosphorylation | ||
| T564 | 21-30 | Regulation | denotes | regulates | ||
| T565 | 31-35 | Protein | denotes | RPS3 | ||
| T566 | 36-43 | Entity | denotes | nuclear | ||
| T567 | 44-57 | Localization | denotes | translocation | ||
| T568 | 186-206 | Protein | denotes | ribosomal protein S3 | ||
| T569 | 208-212 | Protein | denotes | RPS3 | ||
| T570 | 303-307 | Protein | denotes | RPS3 | ||
| T571 | 308-315 | Entity | denotes | nuclear | ||
| T572 | 316-329 | Localization | denotes | translocation | ||
| T573 | 333-342 | Regulation | denotes | regulated | true | |
| T574 | 364-368 | Protein | denotes | IKKβ | ||
| T575 | 369-384 | Phosphorylation | denotes | phosphorylation | ||
| T576 | 388-398 | Entity | denotes | serine 209 | ||
| T577 | 410-417 | Positive_regulation | denotes | crucial | ||
| T578 | 422-426 | Protein | denotes | RPS3 | ||
| T579 | 427-434 | Entity | denotes | nuclear | ||
| T580 | 435-447 | Localization | denotes | localization | ||
| T581 | 448-462 | Positive_regulation | denotes | in response to | ||
| T582 | 463-473 | Positive_regulation | denotes | activating | ||
| T583 | 559-564 | Protein | denotes | NleH1 | ||
| T584 | 578-587 | Negative_regulation | denotes | inhibited | ||
| T585 | 588-592 | Protein | denotes | RPS3 | ||
| T586 | 593-597 | Entity | denotes | S209 | ||
| T587 | 598-613 | Phosphorylation | denotes | phosphorylation | ||
| T588 | 618-625 | Negative_regulation | denotes | blocked | ||
| T589 | 626-630 | Protein | denotes | RPS3 | ||
| T590 | 771-775 | Protein | denotes | IKKβ | ||
| T591 | 776-785 | Regulation | denotes | dependent | ||
| T592 | 786-798 | Protein_modification | denotes | modification | ||
| T593 | 827-831 | Protein | denotes | RPS3 | ||
| T1834 | 1203-1207 | Protein | denotes | RelA | ||
| T1835 | 1209-1212 | Protein | denotes | p65 | ||
| T1836 | 1215-1219 | Protein | denotes | RelB | ||
| T1837 | 1221-1226 | Protein | denotes | c-Rel | ||
| T1838 | 1228-1231 | Protein | denotes | p50 | ||
| T1839 | 1237-1240 | Protein | denotes | p52 | ||
| T1840 | 1294-1314 | Protein | denotes | ribosomal protein S3 | ||
| T1841 | 1316-1320 | Protein | denotes | RPS3 | ||
| T1842 | 1335-1338 | Protein | denotes | Rel | ||
| T1843 | 1383-1387 | Protein | denotes | RPS3 | ||
| T1844 | 1564-1568 | Protein | denotes | RPS3 | ||
| T1845 | 1636-1664 | Protein | denotes | immunoglobulin κ light chain | ||
| T1846 | 1670-1680 | Gene_expression | denotes | expression | ||
| T1847 | 1908-1913 | Protein | denotes | NleH1 | ||
| T1848 | 1968-1979 | Negative_regulation | denotes | attenuating | ||
| T1849 | 1980-1984 | Protein | denotes | RPS3 | ||
| T1850 | 1985-1992 | Entity | denotes | nuclear | ||
| T1851 | 1993-2006 | Localization | denotes | translocation | ||
| T1852 | 2016-2025 | Regulation | denotes | affecting | true | |
| T1853 | 2026-2029 | Protein | denotes | p65 | ||
| T1854 | 2030-2042 | Localization | denotes | localization | ||
| T1855 | 2096-2102 | Positive_regulation | denotes | induce | true | |
| T1856 | 2103-2107 | Protein | denotes | RPS3 | ||
| T1857 | 2108-2115 | Entity | denotes | nuclear | ||
| T1858 | 2116-2129 | Localization | denotes | translocation | ||
| T1859 | 2220-2227 | Binding | denotes | binding | ||
| T1860 | 2266-2270 | Protein | denotes | RPS3 | ||
| T1861 | 2353-2357 | Protein | denotes | RPS3 | ||
| T1862 | 2361-2375 | Phosphorylation | denotes | phosphorylated | true | |
| T1863 | 2487-2491 | Protein | denotes | RPS3 | ||
| T1864 | 2495-2509 | Phosphorylation | denotes | phosphorylated | true | |
| T1865 | 2672-2676 | Protein | denotes | RPS3 | ||
| T1866 | 2727-2760 | Protein | denotes | Inhibitor of κB (IκB) kinase beta | ||
| T1867 | 2762-2766 | Protein | denotes | IKKβ | ||
| T1868 | 2768-2782 | Phosphorylation | denotes | phosphorylated | ||
| T1869 | 2783-2787 | Protein | denotes | RPS3 | ||
| T1870 | 2791-2801 | Entity | denotes | serine 209 | ||
| T1871 | 2810-2814 | Protein | denotes | RPS3 | ||
| T1872 | 2815-2819 | Entity | denotes | S209 | ||
| T1873 | 2820-2835 | Phosphorylation | denotes | phosphorylation | ||
| T1874 | 2836-2844 | Positive_regulation | denotes | enhanced | ||
| T1875 | 2849-2860 | Binding | denotes | association | ||
| T1876 | 2878-2887 | Positive_regulation | denotes | mediating | ||
| T1877 | 2888-2892 | Protein | denotes | RPS3 | ||
| T1878 | 2932-2939 | Entity | denotes | nuclear | ||
| T1879 | 2940-2953 | Localization | denotes | translocation | ||
| T1880 | 2980-2985 | Protein | denotes | NleH1 | ||
| T1881 | 3008-3017 | Negative_regulation | denotes | inhibited | ||
| T1882 | 3018-3022 | Protein | denotes | RPS3 | ||
| T1883 | 3023-3027 | Entity | denotes | S209 | ||
| T2479 | 3126-3130 | Protein | denotes | RPS3 | ||
| T2480 | 3131-3146 | Phosphorylation | denotes | phosphorylation | ||
| T2481 | 3147-3161 | Positive_regulation | denotes | in response to | true | |
| T2482 | 3195-3199 | Protein | denotes | RPS3 | ||
| T2483 | 3203-3217 | Phosphorylation | denotes | phosphorylated | true | |
| T2484 | 3345-3349 | Protein | denotes | RPS3 | ||
| T2485 | 3363-3377 | Phosphorylation | denotes | phosphorylated | true | |
| T2486 | 3422-3430 | Positive_regulation | denotes | increase | ||
| T2487 | 3434-3451 | Phosphorylation | denotes | 32P-incorporation | ||
| T2488 | 3485-3493 | Positive_regulation | denotes | increase | true | |
| T2489 | 3497-3501 | Protein | denotes | RPS3 | ||
| T2490 | 3540-3544 | Protein | denotes | RPS3 | ||
| T2491 | 3545-3553 | Entity | denotes | residues | ||
| T2492 | 3559-3573 | Phosphorylation | denotes | phosphorylated | true | |
| T2493 | 3597-3601 | Protein | denotes | RPS3 | ||
| T2494 | 3770-3780 | Positive_regulation | denotes | stimulated | ||
| T2495 | 3770-3780 | Positive_regulation | denotes | stimulated | ||
| T2496 | 3787-3802 | Phosphorylation | denotes | phosphorylation | ||
| T2497 | 3807-3817 | Protein_catabolism | denotes | degradaion | ||
| T2498 | 3821-3825 | Protein | denotes | IκBα | ||
| T2499 | 3864-3868 | Protein | denotes | RPS3 | ||
| T2500 | 3869-3884 | Phosphorylation | denotes | phosphorylation | ||
| T2501 | 3888-3903 | Entity | denotes | serine residues | ||
| T2502 | 3985-3993 | Entity | denotes | tyrosine | ||
| T2503 | 3998-4007 | Entity | denotes | threonine | ||
| T2504 | 4008-4023 | Phosphorylation | denotes | phosphorylation | true | |
| T2505 | 4008-4023 | Phosphorylation | denotes | phosphorylation | true | |
| T2506 | 4027-4031 | Protein | denotes | RPS3 | ||
| T3194 | 4044-4048 | Protein | denotes | RPS3 | ||
| T3195 | 4053-4057 | Protein | denotes | IKKβ | ||
| T3196 | 4058-4069 | Binding | denotes | interaction | true | |
| T3197 | 4157-4161 | Protein | denotes | IKKγ | ||
| T3198 | 4190-4194 | Protein | denotes | IKKα | ||
| T3199 | 4199-4203 | Protein | denotes | IKKβ | ||
| T3200 | 4322-4326 | Protein | denotes | RPS3 | ||
| T3201 | 4359-4362 | Protein | denotes | p65 | ||
| T3202 | 4363-4366 | Protein | denotes | p50 | ||
| T3203 | 4367-4371 | Protein | denotes | IκBα | ||
| T3204 | 4431-4440 | Positive_regulation | denotes | activated | ||
| T3205 | 4441-4445 | Protein | denotes | IKKβ | ||
| T3206 | 4457-4461 | Binding | denotes | bind | true | |
| T3207 | 4469-4482 | Phosphorylation | denotes | phosphorylate | true | |
| T3208 | 4483-4487 | Protein | denotes | RPS3 | ||
| T3209 | 4522-4531 | Gene_expression | denotes | expressed | ||
| T3210 | 4532-4536 | Protein | denotes | IKKβ | ||
| T3211 | 4541-4545 | Protein | denotes | RPS3 | ||
| T3212 | 4546-4556 | Binding | denotes | interacted | ||
| T3213 | 4639-4643 | Protein | denotes | IKKβ | ||
| T3214 | 4644-4648 | Protein | denotes | RPS3 | ||
| T3215 | 4649-4660 | Binding | denotes | interaction | ||
| T3216 | 4775-4779 | Protein | denotes | RPS3 | ||
| T3217 | 4780-4784 | Protein | denotes | IKKβ | ||
| T3218 | 4785-4796 | Binding | denotes | association | ||
| T3219 | 4809-4818 | Positive_regulation | denotes | augmented | ||
| T3220 | 4871-4880 | Positive_regulation | denotes | following | ||
| T3221 | 4901-4905 | Protein | denotes | RPS3 | ||
| T3222 | 4906-4912 | Entity | denotes | serine | ||
| T3223 | 4913-4928 | Phosphorylation | denotes | phosphorylation | ||
| T3224 | 4977-4988 | Binding | denotes | interaction | true | |
| T3225 | 4997-5001 | Protein | denotes | RPS3 | ||
| T3226 | 5006-5010 | Protein | denotes | IKKα | ||
| T4610 | 5023-5027 | Protein | denotes | IKKβ | ||
| T4611 | 5031-5039 | Positive_regulation | denotes | required | ||
| T4612 | 5044-5048 | Protein | denotes | RPS3 | ||
| T4613 | 5049-5056 | Entity | denotes | nuclear | ||
| T4614 | 5057-5070 | Localization | denotes | translocation | ||
| T4615 | 5094-5098 | Protein | denotes | RPS3 | ||
| T4616 | 5099-5103 | Protein | denotes | IKKβ | ||
| T4617 | 5104-5115 | Binding | denotes | interaction | ||
| T4618 | 5119-5127 | Positive_regulation | denotes | required | true | |
| T4619 | 5132-5136 | Protein | denotes | RPS3 | ||
| T4620 | 5137-5144 | Entity | denotes | nuclear | ||
| T4621 | 5145-5158 | Localization | denotes | translocation | ||
| T4622 | 5163-5175 | Negative_regulation | denotes | knocked down | ||
| T4623 | 5163-5175 | Negative_regulation | denotes | knocked down | ||
| T4624 | 5176-5180 | Protein | denotes | IKKα | ||
| T4625 | 5184-5188 | Protein | denotes | IKKβ | ||
| T4626 | 5189-5199 | Gene_expression | denotes | expression | ||
| T4627 | 5189-5199 | Gene_expression | denotes | expression | ||
| T4628 | 5265-5272 | Positive_regulation | denotes | induced | true | |
| T4629 | 5273-5277 | Protein | denotes | RPS3 | ||
| T4630 | 5278-5285 | Entity | denotes | nuclear | ||
| T4631 | 5286-5295 | Localization | denotes | migration | ||
| T4632 | 5339-5348 | Positive_regulation | denotes | triggered | ||
| T4633 | 5349-5353 | Protein | denotes | RPS3 | ||
| T4634 | 5354-5361 | Entity | denotes | nuclear | ||
| T4635 | 5362-5375 | Localization | denotes | translocation | ||
| T4636 | 5456-5460 | Protein | denotes | RPS3 | ||
| T4637 | 5461-5468 | Entity | denotes | nuclear | ||
| T4638 | 5469-5482 | Localization | denotes | translocation | ||
| T4639 | 5513-5521 | Negative_regulation | denotes | impaired | ||
| T4640 | 5525-5529 | Protein | denotes | IKKα | ||
| T4641 | 5530-5539 | Negative_regulation | denotes | silencing | ||
| T4642 | 5553-5562 | Negative_regulation | denotes | knockdown | ||
| T4643 | 5566-5570 | Protein | denotes | IKKβ | ||
| T4644 | 5571-5581 | Negative_regulation | denotes | attenuated | ||
| T4645 | 5592-5596 | Protein | denotes | RPS3 | ||
| T4646 | 5597-5604 | Entity | denotes | nuclear | ||
| T4647 | 5605-5617 | Localization | denotes | accumulation | ||
| T4648 | 5618-5627 | Positive_regulation | denotes | following | ||
| T4649 | 5707-5717 | Gene_expression | denotes | expression | ||
| T4650 | 5707-5717 | Gene_expression | denotes | expression | ||
| T4651 | 5721-5725 | Protein | denotes | IKKβ | ||
| T4652 | 5735-5739 | Protein | denotes | IKKα | ||
| T4653 | 5745-5754 | Positive_regulation | denotes | necessary | true | |
| T4654 | 5745-5754 | Positive_regulation | denotes | necessary | true | |
| T4655 | 5770-5777 | Positive_regulation | denotes | induced | ||
| T4656 | 5778-5782 | Protein | denotes | RPS3 | ||
| T4657 | 5783-5790 | Entity | denotes | nuclear | ||
| T4658 | 5791-5804 | Localization | denotes | translocation | ||
| T4659 | 5850-5853 | Protein | denotes | p65 | ||
| T4660 | 5854-5861 | Entity | denotes | nuclear | ||
| T4661 | 5862-5875 | Localization | denotes | translocation | ||
| T4662 | 5880-5887 | Negative_regulation | denotes | blocked | ||
| T4663 | 5946-5953 | Entity | denotes | nuclear | ||
| T4664 | 5954-5967 | Localization | denotes | translocation | true | |
| T4665 | 5971-5975 | Protein | denotes | RPS3 | ||
| T4666 | 5997-6007 | Gene_expression | denotes | expressing | ||
| T4667 | 6015-6026 | Negative_regulation | denotes | kinase-dead | ||
| T4668 | 6037-6058 | Positive_regulation | denotes | constitutively-active | ||
| T4669 | 6073-6077 | Protein | denotes | IKKβ | ||
| T4670 | 6105-6109 | Positive_regulation | denotes | SSEE | ||
| T4671 | 6119-6123 | Negative_regulation | denotes | SSAA | ||
| T4672 | 6135-6139 | Protein | denotes | IKKβ | ||
| T4673 | 6140-6147 | Positive_regulation | denotes | induced | true | |
| T4674 | 6140-6147 | Positive_regulation | denotes | induced | true | |
| T4675 | 6154-6163 | Regulation | denotes | dependent | ||
| T4676 | 6164-6174 | Protein | denotes | luciferase | ||
| T4677 | 6218-6222 | Protein | denotes | RPS3 | ||
| T4678 | 6223-6231 | Localization | denotes | remained | ||
| T4679 | 6232-6241 | Entity | denotes | cytosolic | ||
| T4680 | 6242-6244 | Positive_regulation | denotes | in | ||
| T4681 | 6245-6249 | Protein | denotes | IKKβ | ||
| T4682 | 6251-6255 | Negative_regulation | denotes | SSAA | ||
| T4683 | 6320-6324 | Protein | denotes | RPS3 | ||
| T4684 | 6325-6337 | Localization | denotes | translocated | ||
| T4685 | 6345-6352 | Entity | denotes | nucleus | ||
| T4686 | 6353-6355 | Positive_regulation | denotes | in | ||
| T4687 | 6373-6377 | Protein | denotes | IKKβ | ||
| T4688 | 6379-6383 | Positive_regulation | denotes | SSEE | ||
| T4690 | 6449-6456 | Entity | denotes | nuclear | ||
| T4691 | 6457-6461 | Protein | denotes | RPS3 | ||
| T4692 | 6462-6471 | Positive_regulation | denotes | increased | true | |
| T4693 | 6462-6471 | Positive_regulation | denotes | increased | true | |
| T4694 | 6482-6486 | Protein | denotes | IKKβ | ||
| T4695 | 6488-6492 | Positive_regulation | denotes | SSEE | ||
| T4696 | 6523-6527 | Protein | denotes | IKKβ | ||
| T4697 | 6529-6533 | Negative_regulation | denotes | SSAA | ||
| T4698 | 6593-6597 | Protein | denotes | IKKβ | ||
| T4699 | 6610-6619 | Positive_regulation | denotes | necessary | ||
| T4700 | 6639-6643 | Protein | denotes | RPS3 | ||
| T4701 | 6644-6651 | Entity | denotes | nuclear | ||
| T4702 | 6652-6665 | Localization | denotes | translocation | ||
| T4703 | 6666-6680 | Positive_regulation | denotes | in response to | ||
| T6649 | 6708-6712 | Protein | denotes | IκBα | ||
| T6650 | 6713-6724 | Protein_catabolism | denotes | degradation | true | |
| T6651 | 6729-6733 | Protein | denotes | RPS3 | ||
| T6652 | 6734-6741 | Entity | denotes | nuclear | ||
| T6653 | 6742-6755 | Localization | denotes | translocation | true | |
| T6654 | 6767-6776 | Regulation | denotes | regulates | ||
| T6655 | 6781-6788 | Entity | denotes | nuclear | ||
| T6656 | 6789-6795 | Localization | denotes | import | ||
| T6657 | 6805-6808 | Protein | denotes | Rel | ||
| T6658 | 6825-6829 | Protein | denotes | RPS3 | ||
| T6659 | 6891-6898 | Entity | denotes | nuclear | ||
| T6660 | 6899-6912 | Localization | denotes | translocation | ||
| T6661 | 6958-6961 | Protein | denotes | p65 | ||
| T6662 | 6962-6975 | Localization | denotes | translocation | ||
| T6663 | 6997-7001 | Protein | denotes | RPS3 | ||
| T6664 | 7076-7080 | Protein | denotes | RPS3 | ||
| T6665 | 7209-7213 | Protein | denotes | RPS3 | ||
| T6666 | 7214-7221 | Binding | denotes | binding | ||
| T6667 | 7239-7248 | Positive_regulation | denotes | essential | ||
| T6668 | 7253-7260 | Entity | denotes | nuclear | ||
| T6669 | 7261-7274 | Localization | denotes | translocation | ||
| T6670 | 7306-7310 | Protein | denotes | IκBα | ||
| T6671 | 7311-7322 | Protein_catabolism | denotes | degradation | ||
| T6672 | 7328-7340 | Positive_regulation | denotes | prerequisite | ||
| T6673 | 7344-7350 | Regulation | denotes | unmask | ||
| T6674 | 7355-7358 | Entity | denotes | NLS | ||
| T6675 | 7362-7365 | Protein | denotes | p65 | ||
| T6676 | 7376-7380 | Protein | denotes | RPS3 | ||
| T6677 | 7385-7389 | Protein | denotes | IκBα | ||
| T6678 | 7390-7394 | Binding | denotes | bind | ||
| T6679 | 7390-7394 | Binding | denotes | bind | ||
| T6680 | 7398-7401 | Protein | denotes | p65 | ||
| T6681 | 7459-7463 | Protein | denotes | IκBα | ||
| T6682 | 7464-7475 | Protein_catabolism | denotes | degradation | ||
| T6683 | 7479-7487 | Positive_regulation | denotes | required | true | |
| T6684 | 7496-7506 | Localization | denotes | liberation | ||
| T6685 | 7510-7514 | Protein | denotes | RPS3 | ||
| T6686 | 7532-7543 | Binding | denotes | association | true | |
| T6687 | 7547-7551 | Protein | denotes | RPS3 | ||
| T6688 | 7607-7611 | Protein | denotes | IκBα | ||
| T6689 | 7618-7622 | Protein | denotes | IκBα | ||
| T6690 | 7631-7635 | Negative_regulation | denotes | SSAA | ||
| T6691 | 7637-7646 | Negative_regulation | denotes | resistant | ||
| T6692 | 7637-7646 | Negative_regulation | denotes | resistant | ||
| T6693 | 7650-7654 | Protein | denotes | IKKβ | ||
| T6694 | 7655-7662 | Positive_regulation | denotes | induced | ||
| T6695 | 7655-7662 | Positive_regulation | denotes | induced | ||
| T6696 | 7663-7678 | Phosphorylation | denotes | phosphorylation | ||
| T6697 | 7683-7694 | Protein_catabolism | denotes | degradation | ||
| T6698 | 7732-7736 | Protein | denotes | IκBα | ||
| T6699 | 7754-7763 | Positive_regulation | denotes | augmented | ||
| T6700 | 7768-7779 | Binding | denotes | interaction | ||
| T6701 | 7783-7787 | Protein | denotes | RPS3 | ||
| T6702 | 7886-7890 | Protein | denotes | RPS3 | ||
| T6703 | 7902-7913 | Binding | denotes | association | ||
| T6704 | 7918-7927 | Negative_regulation | denotes | abolished | ||
| T6705 | 7951-7961 | Protein_catabolism | denotes | degradable | true | |
| T6706 | 7962-7966 | Protein | denotes | IκBα | ||
| T6707 | 7997-8001 | Protein | denotes | IκBα | ||
| T6708 | 8034-8044 | Negative_regulation | denotes | precluding | true | |
| T6709 | 8045-8049 | Protein | denotes | RPS3 | ||
| T6710 | 8050-8057 | Entity | denotes | nuclear | ||
| T6711 | 8058-8071 | Localization | denotes | translocation | ||
| T6712 | 8090-8094 | Protein | denotes | RPS3 | ||
| T6713 | 8106-8117 | Binding | denotes | association | true | |
| T6714 | 8130-8134 | Protein | denotes | RPS3 | ||
| T6715 | 8141-8149 | Negative_regulation | denotes | reducing | ||
| T6716 | 8150-8154 | Protein | denotes | IκBα | ||
| T6717 | 8155-8165 | Gene_expression | denotes | expression | ||
| T6718 | 8200-8205 | Protein | denotes | siRNA | ||
| T6719 | 8219-8223 | Protein | denotes | IκBα | ||
| T6720 | 8235-8243 | Negative_regulation | denotes | depleted | ||
| T6721 | 8244-8248 | Protein | denotes | IκBα | ||
| T6722 | 8301-8305 | Protein | denotes | RPS3 | ||
| T6723 | 8317-8328 | Binding | denotes | association | ||
| T6724 | 8337-8346 | Positive_regulation | denotes | augmented | true | |
| T6725 | 8378-8385 | Entity | denotes | nuclear | ||
| T6726 | 8386-8390 | Protein | denotes | RPS3 | ||
| T6727 | 8391-8399 | Localization | denotes | detected | true | |
| T6728 | 8467-8473 | Positive_regulation | denotes | induce | ||
| T6729 | 8474-8478 | Protein | denotes | IκBα | ||
| T6730 | 8479-8490 | Protein_catabolism | denotes | degradation | ||
| T6731 | 8546-8555 | Positive_regulation | denotes | increased | true | |
| T6732 | 8546-8555 | Positive_regulation | denotes | increased | true | |
| T6733 | 8556-8567 | Binding | denotes | association | ||
| T6734 | 8576-8580 | Protein | denotes | RPS3 | ||
| T6735 | 8635-8642 | Entity | denotes | nuclear | ||
| T6736 | 8643-8655 | Localization | denotes | accumulation | ||
| T6737 | 8659-8663 | Protein | denotes | RPS3 | ||
| T6738 | 8682-8686 | Protein | denotes | IκBα | ||
| T6739 | 8687-8698 | Protein_catabolism | denotes | degradation | ||
| T6740 | 8803-8811 | Positive_regulation | denotes | promotes | true | |
| T6741 | 8803-8811 | Positive_regulation | denotes | promotes | true | |
| T6742 | 8827-8838 | Binding | denotes | association | ||
| T6743 | 8843-8850 | Entity | denotes | nuclear | ||
| T6744 | 8851-8860 | Localization | denotes | transport | ||
| T6745 | 8864-8868 | Protein | denotes | RPS3 | ||
| T6746 | 8875-8879 | Protein | denotes | IκBα | ||
| T6747 | 8880-8891 | Protein_catabolism | denotes | degradation | ||
| T6748 | 8950-8958 | Positive_regulation | denotes | required | ||
| T6749 | 8967-8971 | Protein | denotes | RPS3 | ||
| T6750 | 8983-8994 | Binding | denotes | association | ||
| T6751 | 9049-9053 | Protein | denotes | IκBα | ||
| T6752 | 9054-9069 | Phosphorylation | denotes | phosphorylation | ||
| T6753 | 9074-9085 | Protein_catabolism | denotes | degradation | ||
| T6754 | 9127-9132 | Positive_regulation | denotes | cause | ||
| T6755 | 9127-9132 | Positive_regulation | denotes | cause | ||
| T6756 | 9133-9137 | Protein | denotes | RPS3 | ||
| T6757 | 9138-9149 | Binding | denotes | association | ||
| T6758 | 9166-9174 | Positive_regulation | denotes | followed | ||
| T6759 | 9178-9185 | Entity | denotes | nuclear | ||
| T6760 | 9186-9199 | Localization | denotes | translocation | ||
| T6761 | 9243-9247 | Protein | denotes | IKKβ | ||
| T6762 | 9248-9263 | Phosphorylation | denotes | phosphorylation | ||
| T6763 | 9267-9271 | Protein | denotes | RPS3 | ||
| T8531 | 9287-9291 | Protein | denotes | IKKβ | ||
| T8532 | 9292-9306 | Phosphorylation | denotes | phosphorylates | ||
| T8533 | 9307-9311 | Protein | denotes | RPS3 | ||
| T8534 | 9315-9325 | Entity | denotes | serine 209 | ||
| T8535 | 9395-9399 | Protein | denotes | IKKβ | ||
| T8536 | 9405-9419 | Phosphorylation | denotes | phosphorylates | ||
| T8537 | 9405-9419 | Phosphorylation | denotes | phosphorylates | ||
| T8538 | 9451-9458 | Protein | denotes | 14-3-3β | ||
| T8539 | 9463-9468 | Protein | denotes | Bcl10 | ||
| T8540 | 9552-9556 | Protein | denotes | IKKβ | ||
| T8541 | 9572-9585 | Phosphorylation | denotes | phosphorylate | true | |
| T8542 | 9586-9590 | Protein | denotes | RPS3 | ||
| T8543 | 9644-9648 | Protein | denotes | RPS3 | ||
| T8544 | 9678-9698 | Phosphorylation | denotes | incorporation of 32P | ||
| T8545 | 9678-9698 | Phosphorylation | denotes | incorporation of 32P | ||
| T8546 | 9702-9719 | Phosphorylation | denotes | autophosphorylatd | ||
| T8547 | 9702-9719 | Phosphorylation | denotes | autophosphorylatd | ||
| T8548 | 9720-9724 | Protein | denotes | IKKα | ||
| T8549 | 9729-9733 | Protein | denotes | IKKβ | ||
| T8550 | 9766-9779 | Phosphorylation | denotes | phosporylated | true | |
| T8551 | 9766-9779 | Phosphorylation | denotes | phosporylated | true | |
| T8552 | 9780-9788 | Protein | denotes | GST-IκBα | ||
| T8553 | 9832-9835 | Protein | denotes | GST | ||
| T8554 | 9888-9892 | Protein | denotes | IKKα | ||
| T8555 | 9896-9900 | Protein | denotes | IKKβ | ||
| T8556 | 9930-9938 | Protein | denotes | GST-RPS3 | ||
| T8557 | 9948-9962 | Phosphorylation | denotes | phosphorylated | true | true |
| T8558 | 9948-9962 | Phosphorylation | denotes | phosphorylated | true | |
| T8559 | 9966-9970 | Protein | denotes | IKKβ | ||
| T8560 | 9980-9984 | Protein | denotes | IKKα | ||
| T8561 | 10045-10049 | Protein | denotes | RPS3 | ||
| T8562 | 10050-10071 | Entity | denotes | amino acid residue(s) | ||
| T8563 | 10072-10086 | Phosphorylation | denotes | phosphorylated | ||
| T8564 | 10090-10094 | Protein | denotes | IKKβ | ||
| T8565 | 10180-10194 | Phosphorylation | denotes | phosphorylated | ||
| T8566 | 10195-10199 | Protein | denotes | RPS3 | ||
| T8567 | 10228-10232 | Protein | denotes | IKKβ | ||
| T8568 | 10233-10247 | Phosphorylation | denotes | phosphorylated | ||
| T8569 | 10248-10252 | Entity | denotes | S209 | ||
| T8570 | 10269-10273 | Protein | denotes | RPS3 | ||
| T8571 | 10296-10300 | Protein | denotes | RPS3 | ||
| T8572 | 10599-10603 | Protein | denotes | IKKβ | ||
| T8573 | 10650-10656 | Protein | denotes | kinase | ||
| T8574 | 10694-10699 | Entity | denotes | S209A | ||
| T8575 | 10700-10706 | Regulation | denotes | mutant | ||
| T8576 | 10707-10711 | Protein | denotes | RPS3 | ||
| T8577 | 10763-10768 | Entity | denotes | S209A | ||
| T8578 | 10769-10777 | Regulation | denotes | mutation | ||
| T8579 | 10778-10785 | Negative_regulation | denotes | reduced | ||
| T8580 | 10786-10791 | Protein | denotes | IKKβ– | ||
| T8581 | 10791-10799 | Positive_regulation | denotes | mediated | ||
| T8582 | 10800-10804 | Protein | denotes | RPS3 | ||
| T8583 | 10805-10820 | Phosphorylation | denotes | phosphorylation | ||
| T8584 | 10928-10942 | Phosphorylation | denotes | phosphorylated | ||
| T8585 | 10943-10947 | Protein | denotes | RPS3 | ||
| T8586 | 10959-10963 | Protein | denotes | RPS3 | ||
| T8587 | 11052-11066 | Entity | denotes | sequence motif | ||
| T8588 | 11093-11103 | Binding | denotes | recognized | ||
| T8589 | 11140-11144 | Protein | denotes | IKKβ | ||
| T8590 | 11298-11302 | Protein | denotes | RPS3 | ||
| T8591 | 11303-11307 | Entity | denotes | S209 | ||
| T8592 | 11308-11323 | Phosphorylation | denotes | phosphorylation | ||
| T8593 | 11328-11331 | Positive_regulation | denotes | due | true | |
| T8594 | 11368-11372 | Protein | denotes | IKKβ | ||
| T8595 | 11452-11456 | Entity | denotes | S209 | ||
| T8596 | 11464-11472 | Positive_regulation | denotes | critical | true | |
| T8597 | 11487-11491 | Protein | denotes | IKKβ | ||
| T8598 | 11492-11506 | Phosphorylation | denotes | phosphorylates | ||
| T8599 | 11507-11511 | Protein | denotes | RPS3 | ||
| T8600 | 11532-11543 | Gene_expression | denotes | transfected | ||
| T8601 | 11532-11543 | Gene_expression | denotes | transfected | ||
| T8602 | 11574-11583 | Protein | denotes | Flag-RPS3 | ||
| T8603 | 11608-11612 | Protein | denotes | IKKβ | ||
| T8604 | 11650-11664 | Positive_regulation | denotes | overexpressing | ||
| T8605 | 11665-11669 | Protein | denotes | IKKβ | ||
| T8606 | 11670-11678 | Positive_regulation | denotes | enhanced | ||
| T8607 | 11679-11688 | Protein | denotes | Flag-RPS3 | ||
| T8608 | 11689-11704 | Phosphorylation | denotes | phosphorylation | ||
| T8609 | 11742-11752 | Negative_regulation | denotes | eliminated | ||
| T8610 | 11756-11776 | Regulation | denotes | alanine substitution | ||
| T8611 | 11793-11797 | Entity | denotes | S209 | ||
| T8612 | 11833-11837 | Protein | denotes | IKKβ | ||
| T8613 | 11838-11853 | Phosphorylation | denotes | phosphorylation | ||
| T8614 | 11885-11911 | Protein | denotes | phospho-S209 RPS3 antibody | ||
| T8615 | 11942-11946 | Protein | denotes | RPS3 | ||
| T8616 | 11951-11965 | Phosphorylation | denotes | phosphorylated | ||
| T8617 | 11969-11973 | Entity | denotes | S209 | ||
| T8618 | 11984-11993 | Regulation | denotes | dependent | ||
| T8619 | 12001-12005 | Positive_regulation | denotes | upon | ||
| T8620 | 12043-12047 | Protein | denotes | RPS3 | ||
| T11311 | 12116-12131 | Phosphorylation | denotes | Phosphorylation | ||
| T11312 | 12135-12139 | Protein | denotes | RPS3 | ||
| T11313 | 12188-12192 | Entity | denotes | S209 | ||
| T11314 | 12193-12208 | Phosphorylation | denotes | phosphorylation | ||
| T11315 | 12209-12221 | Regulation | denotes | plays a role | true | |
| T11316 | 12229-12236 | Entity | denotes | nuclear | ||
| T11317 | 12237-12250 | Localization | denotes | translocation | ||
| T11319 | 12331-12336 | Entity | denotes | S209A | ||
| T11320 | 12337-12343 | Regulation | denotes | mutant | ||
| T11321 | 12344-12348 | Protein | denotes | RPS3 | ||
| T11322 | 12583-12592 | Positive_regulation | denotes | triggered | ||
| T11323 | 12603-12612 | Protein | denotes | Flag-RPS3 | ||
| T11324 | 12613-12620 | Entity | denotes | nuclear | ||
| T11325 | 12621-12634 | Localization | denotes | translocation | ||
| T11326 | 12655-12659 | Protein | denotes | RPS3 | ||
| T11327 | 12661-12666 | Entity | denotes | S209A | ||
| T11328 | 12668-12675 | Entity | denotes | nuclear | ||
| T11329 | 12676-12689 | Localization | denotes | translocation | ||
| T11330 | 12694-12704 | Negative_regulation | denotes | attenuated | ||
| T11331 | 12735-12741 | Regulation | denotes | impact | true | |
| T11332 | 12765-12779 | Positive_regulation | denotes | overexpressing | ||
| T11333 | 12780-12784 | Protein | denotes | IKKβ | ||
| T11334 | 12788-12792 | Protein | denotes | RPS3 | ||
| T11335 | 12793-12800 | Entity | denotes | nuclear | ||
| T11336 | 12801-12814 | Localization | denotes | translocation | ||
| T11337 | 12816-12820 | Protein | denotes | IKKβ | ||
| T11338 | 12864-12874 | Protein | denotes | luciferase | ||
| T11339 | 12915-12922 | Positive_regulation | denotes | induced | true | |
| T11340 | 12927-12934 | Entity | denotes | nuclear | ||
| T11341 | 12935-12948 | Localization | denotes | translocation | ||
| T11342 | 12978-12982 | Protein | denotes | RPS3 | ||
| T11343 | 13018-13022 | Entity | denotes | S209 | ||
| T11344 | 13023-13038 | Phosphorylation | denotes | phosphorylation | ||
| T11345 | 13042-13050 | Positive_regulation | denotes | critical | ||
| T11346 | 13076-13083 | Positive_regulation | denotes | induced | ||
| T11347 | 13084-13088 | Protein | denotes | RPS3 | ||
| T11348 | 13089-13096 | Entity | denotes | nuclear | ||
| T11349 | 13097-13110 | Localization | denotes | translocation | ||
| T11350 | 13135-13139 | Entity | denotes | S209 | ||
| T11351 | 13140-13155 | Phosphorylation | denotes | phosphorylation | ||
| T11352 | 13159-13163 | Protein | denotes | RPS3 | ||
| T11353 | 13198-13206 | Negative_regulation | denotes | silenced | ||
| T11354 | 13218-13222 | Protein | denotes | RPS3 | ||
| T11355 | 13223-13233 | Gene_expression | denotes | expression | ||
| T11356 | 13301-13305 | Protein | denotes | RPS3 | ||
| T11357 | 13378-13382 | Protein | denotes | RPS3 | ||
| T11358 | 13387-13399 | Gene_expression | denotes | transfection | ||
| T11359 | 13414-13424 | Protein | denotes | RPS3 siRNA | ||
| T11360 | 13434-13441 | Negative_regulation | denotes | reduced | ||
| T11361 | 13453-13457 | Protein | denotes | RPS3 | ||
| T11362 | 13502-13508 | Regulation | denotes | affect | true | |
| T11363 | 13520-13530 | Gene_expression | denotes | expression | ||
| T11364 | 13534-13550 | Protein | denotes | Flag-tagged RPS3 | ||
| T11365 | 13629-13633 | Protein | denotes | RPS3 | ||
| T11366 | 13634-13643 | Negative_regulation | denotes | knockdown | ||
| T11367 | 13644-13651 | Negative_regulation | denotes | reduced | ||
| T11368 | 13656-13663 | Positive_regulation | denotes | induced | ||
| T11369 | 13664-13674 | Gene_expression | denotes | expression | ||
| T11370 | 13687-13693 | Positive_regulation | denotes | driven | ||
| T11371 | 13694-13704 | Protein | denotes | luciferase | ||
| T11372 | 13731-13739 | Negative_regulation | denotes | impaired | ||
| T11373 | 13740-13750 | Protein | denotes | luciferase | ||
| T11374 | 13758-13764 | Positive_regulation | denotes | caused | ||
| T11375 | 13768-13772 | Protein | denotes | RPS3 | ||
| T11376 | 13773-13783 | Negative_regulation | denotes | deficiency | ||
| T11377 | 13811-13823 | Gene_expression | denotes | transfecting | ||
| T11378 | 13852-13856 | Protein | denotes | RPS3 | ||
| T11379 | 14040-14054 | Gene_expression | denotes | overexpression | ||
| T11380 | 14058-14083 | Protein | denotes | green fluorescent protein | ||
| T11381 | 14085-14088 | Protein | denotes | GFP | ||
| T11382 | 14151-14155 | Protein | denotes | RPS3 | ||
| T11383 | 14220-14224 | Protein | denotes | RPS3 | ||
| T11384 | 14225-14229 | Entity | denotes | S209 | ||
| T11385 | 14230-14245 | Phosphorylation | denotes | phosphorylation | ||
| T11386 | 14377-14381 | Entity | denotes | S209 | ||
| T11387 | 14382-14397 | Phosphorylation | denotes | phosphorylation | ||
| T11388 | 14398-14405 | Regulation | denotes | affects | true | |
| T11389 | 14398-14405 | Regulation | denotes | affects | true | |
| T11390 | 14406-14410 | Protein | denotes | RPS3 | ||
| T11391 | 14415-14418 | Protein | denotes | p65 | ||
| T11392 | 14419-14430 | Binding | denotes | recruitment | ||
| T11393 | 14419-14430 | Binding | denotes | recruitment | ||
| T11394 | 14500-14504 | Protein | denotes | RPS3 | ||
| T11395 | 14505-14514 | Negative_regulation | denotes | knockdown | ||
| T11396 | 14528-14538 | Positive_regulation | denotes | stimulated | true | |
| T11397 | 14528-14538 | Positive_regulation | denotes | stimulated | true | |
| T11398 | 14528-14538 | Positive_regulation | denotes | stimulated | true | |
| T11399 | 14528-14538 | Positive_regulation | denotes | stimulated | true | |
| T11400 | 14543-14554 | Binding | denotes | recruitment | ||
| T11401 | 14543-14554 | Binding | denotes | recruitment | ||
| T11402 | 14543-14554 | Binding | denotes | recruitment | ||
| T11403 | 14543-14554 | Binding | denotes | recruitment | ||
| T11404 | 14570-14579 | Gene_expression | denotes | expressed | ||
| T11405 | 14612-14617 | Entity | denotes | S209A | ||
| T11406 | 14618-14622 | Protein | denotes | RPS3 | ||
| T11407 | 14630-14638 | Entity | denotes | κB sites | ||
| T11408 | 14646-14652 | Protein | denotes | NFKBIA | ||
| T11409 | 14657-14660 | Protein | denotes | IL8 | ||
| T11410 | 14699-14703 | Protein | denotes | RPS3 | ||
| T11411 | 14704-14709 | Entity | denotes | S209A | ||
| T11412 | 14717-14723 | Regulation | denotes | impact | true | |
| T11413 | 14727-14730 | Protein | denotes | p65 | ||
| T11414 | 14731-14738 | Entity | denotes | nuclear | ||
| T11415 | 14739-14752 | Localization | denotes | translocation | ||
| T11416 | 14771-14781 | Negative_regulation | denotes | attenuated | ||
| T11417 | 14782-14785 | Protein | denotes | p65 | ||
| T11418 | 14786-14797 | Binding | denotes | recruitment | ||
| T11419 | 14846-14849 | Protein | denotes | p65 | ||
| T11420 | 14850-14860 | Localization | denotes | attraction | ||
| T11421 | 14864-14868 | Protein | denotes | RPS3 | ||
| T11422 | 14899-14908 | Entity | denotes | promoters | ||
| T11423 | 14917-14921 | Protein | denotes | CD25 | ||
| T11424 | 14926-14935 | Positive_regulation | denotes | increased | ||
| T11425 | 15029-15038 | Protein | denotes | Flag-RPS3 | ||
| T11426 | 15042-15045 | Protein | denotes | p65 | ||
| T11427 | 15046-15057 | Localization | denotes | recruitment | true | |
| T11428 | 15046-15057 | Localization | denotes | recruitment | true | |
| T11429 | 15061-15065 | Protein | denotes | ACTB | ||
| T11430 | 15066-15074 | Entity | denotes | promoter | ||
| T11431 | 15142-15150 | Regulation | denotes | specific | true | |
| T11432 | 15162-15173 | Localization | denotes | recruitment | ||
| T11433 | 15177-15181 | Protein | denotes | RPS3 | ||
| T11434 | 15208-15219 | Localization | denotes | recruitment | ||
| T11435 | 15223-15226 | Protein | denotes | p65 | ||
| T11436 | 15234-15243 | Entity | denotes | promoters | ||
| T11437 | 15244-15252 | Regulation | denotes | depended | ||
| T11438 | 15244-15252 | Regulation | denotes | depended | ||
| T11439 | 15256-15260 | Entity | denotes | S209 | ||
| T11440 | 15262-15275 | Protein | denotes | Interleukin 8 | ||
| T11441 | 15277-15281 | Protein | denotes | IL-8 | ||
| T11442 | 15283-15292 | Localization | denotes | secretion | ||
| T11443 | 15293-15300 | Positive_regulation | denotes | induced | ||
| T11444 | 15341-15352 | Positive_regulation | denotes | stimulation | ||
| T11445 | 15366-15375 | Negative_regulation | denotes | decreased | ||
| T11446 | 15396-15403 | Negative_regulation | denotes | reduced | ||
| T11447 | 15404-15408 | Protein | denotes | RPS3 | ||
| T11448 | 15409-15412 | Protein | denotes | p65 | ||
| T11449 | 15413-15424 | Binding | denotes | recruitment | ||
| T11450 | 15432-15435 | Protein | denotes | IL8 | ||
| T11451 | 15436-15444 | Entity | denotes | κB sites | ||
| T11452 | 15464-15469 | Entity | denotes | S209A | ||
| T11453 | 15499-15503 | Protein | denotes | RPS3 | ||
| T11454 | 15551-15555 | Protein | denotes | CD25 | ||
| T11455 | 15556-15566 | Gene_expression | denotes | expression | ||
| T11456 | 15614-15618 | Protein | denotes | RPS3 | ||
| T11457 | 15619-15630 | Gene_expression | denotes | transfected | ||
| T11458 | 15673-15677 | Protein | denotes | RPS3 | ||
| T11459 | 15678-15682 | Entity | denotes | S209 | ||
| T11460 | 15683-15698 | Phosphorylation | denotes | phosphorylation | ||
| T11461 | 15699-15701 | Positive_regulation | denotes | by | ||
| T11462 | 15702-15706 | Protein | denotes | IKKβ | ||
| T11463 | 15734-15738 | Protein | denotes | RPS3 | ||
| T13458 | 15797-15802 | Protein | denotes | NleH1 | ||
| T13459 | 15803-15811 | Negative_regulation | denotes | inhibits | ||
| T13460 | 15812-15816 | Protein | denotes | RPS3 | ||
| T13461 | 15817-15832 | Phosphorylation | denotes | phosphorylation | ||
| T13462 | 16148-16153 | Protein | denotes | NleH1 | ||
| T13463 | 16154-16159 | Binding | denotes | binds | ||
| T13464 | 16167-16177 | Negative_regulation | denotes | attenuates | ||
| T13465 | 16178-16182 | Protein | denotes | RPS3 | ||
| T13466 | 16183-16190 | Entity | denotes | nuclear | ||
| T13467 | 16191-16204 | Localization | denotes | translocation | ||
| T13468 | 16221-16225 | Protein | denotes | RPS3 | ||
| T13469 | 16285-16290 | Protein | denotes | NleH1 | ||
| T13470 | 16307-16317 | Negative_regulation | denotes | inhibiting | ||
| T13471 | 16318-16322 | Protein | denotes | RPS3 | ||
| T13472 | 16323-16327 | Entity | denotes | S209 | ||
| T13473 | 16328-16343 | Phosphorylation | denotes | phosphorylation | ||
| T13474 | 16371-16381 | Positive_regulation | denotes | increasing | ||
| T13475 | 16393-16401 | Protein | denotes | NleH1-HA | ||
| T13476 | 16418-16422 | Protein | denotes | TNFα | ||
| T13477 | 16501-16506 | Protein | denotes | NleH1 | ||
| T13478 | 16507-16514 | Negative_regulation | denotes | reduced | ||
| T13479 | 16507-16514 | Negative_regulation | denotes | reduced | ||
| T13480 | 16520-16523 | Protein | denotes | TNF | ||
| T13481 | 16524-16531 | Positive_regulation | denotes | induced | ||
| T13482 | 16550-16554 | Protein | denotes | RPS3 | ||
| T13483 | 16555-16570 | Phosphorylation | denotes | phosphorylation | ||
| T13484 | 16616-16626 | Gene_expression | denotes | Expressing | ||
| T13485 | 16627-16632 | Protein | denotes | NleH1 | ||
| T13486 | 16642-16651 | Negative_regulation | denotes | interfere | ||
| T13487 | 16642-16651 | Negative_regulation | denotes | interfere | ||
| T13488 | 16664-16667 | Protein | denotes | TNF | ||
| T13489 | 16680-16690 | Positive_regulation | denotes | activation | ||
| T13490 | 16694-16698 | Protein | denotes | IκBα | ||
| T13491 | 16699-16710 | Protein_catabolism | denotes | degradation | ||
| T13492 | 16732-16736 | Negative_regulation | denotes | lack | ||
| T13493 | 16740-16745 | Protein | denotes | NleH1 | ||
| T13494 | 16746-16752 | Regulation | denotes | impact | ||
| T13495 | 16756-16759 | Protein | denotes | p65 | ||
| T13496 | 16760-16767 | Entity | denotes | nuclear | ||
| T13497 | 16768-16781 | Localization | denotes | translocation | ||
| T13498 | 16810-16815 | Protein | denotes | NleH1 | ||
| T13499 | 16816-16824 | Negative_regulation | denotes | inhibits | true | |
| T13500 | 16825-16829 | Protein | denotes | RPS3 | ||
| T13501 | 16830-16845 | Phosphorylation | denotes | phosphorylation | ||
| T13502 | 16913-16920 | Negative_regulation | denotes | lacking | ||
| T13503 | 16928-16933 | Protein | denotes | nleH1 | ||
| T13504 | 16935-16941 | Protein | denotes | ΔnleH1 | ||
| T13505 | 17003-17008 | Protein | denotes | NleH1 | ||
| T13506 | 17031-17036 | Protein | denotes | ΔescN | ||
| T13507 | 17060-17063 | Protein | denotes | TNF | ||
| T13508 | 17095-17103 | Positive_regulation | denotes | increase | ||
| T13509 | 17107-17111 | Protein | denotes | RPS3 | ||
| T13510 | 17112-17116 | Entity | denotes | S209 | ||
| T13511 | 17117-17132 | Phosphorylation | denotes | phosphorylation | ||
| T13512 | 17180-17184 | Protein | denotes | RPS3 | ||
| T13513 | 17185-17189 | Entity | denotes | S209 | ||
| T13514 | 17190-17205 | Phosphorylation | denotes | phosphorylation | ||
| T13515 | 17224-17232 | Negative_regulation | denotes | impaired | ||
| T13516 | 17302-17305 | Protein | denotes | TNF | ||
| T13517 | 17306-17313 | Positive_regulation | denotes | induced | ||
| T13518 | 17314-17318 | Protein | denotes | RPS3 | ||
| T13519 | 17319-17323 | Entity | denotes | S209 | ||
| T13520 | 17324-17339 | Phosphorylation | denotes | phosphorylation | ||
| T13521 | 17344-17354 | Negative_regulation | denotes | unimpaired | true | |
| T13522 | 17344-17354 | Negative_regulation | denotes | unimpaired | true | |
| T13523 | 17385-17391 | Protein | denotes | ΔnleH1 | ||
| T13524 | 17395-17400 | Protein | denotes | ΔescN | ||
| T13525 | 17457-17463 | Protein | denotes | ΔnleH1 | ||
| T13526 | 17467-17472 | Protein | denotes | ΔescN | ||
| T13527 | 17503-17513 | Negative_regulation | denotes | attenuated | ||
| T13528 | 17503-17513 | Negative_regulation | denotes | attenuated | ||
| T13529 | 17514-17517 | Protein | denotes | TNF | ||
| T13530 | 17518-17525 | Positive_regulation | denotes | induced | ||
| T13531 | 17526-17530 | Protein | denotes | RPS3 | ||
| T13532 | 17531-17538 | Entity | denotes | nuclear | ||
| T13533 | 17539-17552 | Localization | denotes | translocation | ||
| T13534 | 17576-17580 | Protein | denotes | RPS3 | ||
| T13535 | 17581-17596 | Phosphorylation | denotes | phosphorylation | ||
| T13536 | 17605-17612 | Entity | denotes | nuclear | ||
| T13537 | 17613-17626 | Localization | denotes | translocation | ||
| T13538 | 17728-17732 | Protein | denotes | RPS3 | ||
| T13539 | 17733-17737 | Entity | denotes | S209 | ||
| T13540 | 17738-17753 | Phosphorylation | denotes | phosphorylation | ||
| T13541 | 17757-17766 | Regulation | denotes | important | ||
| T13542 | 17771-17778 | Entity | denotes | nuclear | ||
| T13543 | 17779-17792 | Localization | denotes | translocation | ||
| T13544 | 17813-17818 | Protein | denotes | NleH1 | ||
| T13545 | 17819-17827 | Negative_regulation | denotes | inhibits | ||
| T13546 | 17828-17832 | Protein | denotes | RPS3 | ||
| T13547 | 17833-17837 | Entity | denotes | S209 | ||
| T13548 | 17838-17853 | Phosphorylation | denotes | phosphorylation | ||
| T13549 | 17891-17895 | Protein | denotes | RPS3 | ||
| T13550 | 17944-17947 | Protein | denotes | IL8 | ||
| T13551 | 17949-17955 | Protein | denotes | NFKBIA | ||
| T13552 | 17961-17968 | Protein | denotes | TNFAIP3 | ||
| T13553 | 18128-18134 | Protein | denotes | ΔnleH1 | ||
| T13554 | 18138-18143 | Protein | denotes | ΔescN | ||
| T13555 | 18176-18184 | Negative_regulation | denotes | deleting | ||
| T13556 | 18185-18190 | Protein | denotes | nleH1 | ||
| T13557 | 18260-18264 | Protein | denotes | CD25 | ||
| T13558 | 18269-18277 | Protein | denotes | TNFSF13B | ||
| T13559 | 18343-18348 | Protein | denotes | NleH1 | ||
| T13560 | 18414-18422 | Negative_regulation | denotes | blocking | ||
| T13561 | 18423-18427 | Protein | denotes | RPS3 | ||
| T13562 | 18428-18432 | Entity | denotes | S209 | ||
| T13563 | 18433-18448 | Phosphorylation | denotes | phosphorylation | ||
| T13564 | 18480-18484 | Protein | denotes | RPS3 | ||
| T14274 | 18516-18521 | Protein | denotes | NleH1 | ||
| T14275 | 18522-18530 | Negative_regulation | denotes | inhibits | ||
| T14276 | 18531-18535 | Protein | denotes | RPS3 | ||
| T14277 | 18536-18540 | Entity | denotes | S209 | ||
| T14278 | 18541-18556 | Phosphorylation | denotes | phosphorylation | ||
| T14279 | 18665-18671 | Protein | denotes | ΔnleH1 | ||
| T14280 | 18771-18777 | Protein | denotes | ΔnleH1 | ||
| T14281 | 19007-19012 | Protein | denotes | NleH1 | ||
| T14282 | 19013-19020 | Negative_regulation | denotes | blocked | ||
| T14283 | 19021-19025 | Protein | denotes | RPS3 | ||
| T14284 | 19026-19030 | Entity | denotes | S209 | ||
| T14285 | 19031-19046 | Phosphorylation | denotes | phosphorylation | ||
| T14286 | 19064-19074 | Negative_regulation | denotes | preventing | true | |
| T14287 | 19075-19079 | Protein | denotes | RPS3 | ||
| T14288 | 19080-19087 | Entity | denotes | nuclear | ||
| T14289 | 19088-19101 | Localization | denotes | translocation | ||
| T14290 | 19339-19342 | Negative_regulation | denotes | low | ||
| T14291 | 19353-19360 | Phosphorylation | denotes | phospho | ||
| T14292 | 19361-19365 | Protein | denotes | RPS3 | ||
| T14293 | 19409-19415 | Protein | denotes | ΔnleH1 | ||
| T14294 | 19424-19431 | Phosphorylation | denotes | phospho | ||
| T14295 | 19432-19436 | Protein | denotes | RPS3 | ||
| T14296 | 19463-19470 | Positive_regulation | denotes | intense | ||
| T14297 | 19510-19515 | Protein | denotes | NleH1 | ||
| T14298 | 19516-19524 | Negative_regulation | denotes | inhibits | ||
| T14299 | 19525-19529 | Protein | denotes | RPS3 | ||
| T14300 | 19530-19534 | Entity | denotes | S209 | ||
| T14301 | 19535-19550 | Phosphorylation | denotes | phosphorylation | ||
| T17472 | 19647-19652 | Protein | denotes | NleH1 | ||
| T17473 | 19664-19668 | Protein | denotes | IKKβ | ||
| T17474 | 19693-19698 | Protein | denotes | NleH1 | ||
| T17475 | 19705-19723 | Phosphorylation | denotes | autophosphorylated | ||
| T17476 | 19755-19762 | Regulation | denotes | depends | ||
| T17477 | 19770-19780 | Entity | denotes | lysine 159 | ||
| T17478 | 19824-19829 | Protein | denotes | NleH1 | ||
| T17479 | 19830-19838 | Negative_regulation | denotes | inhibits | ||
| T17480 | 19839-19843 | Protein | denotes | RPS3 | ||
| T17481 | 19844-19848 | Entity | denotes | S209 | ||
| T17482 | 19849-19864 | Phosphorylation | denotes | phosphorylation | ||
| T17483 | 19934-19943 | Protein | denotes | His-NleH1 | ||
| T17484 | 19965-19974 | Protein | denotes | His-NleH1 | ||
| T17485 | 20008-20013 | Protein | denotes | NleH1 | ||
| T17486 | 20017-20035 | Phosphorylation | denotes | autophosphorylated | ||
| T17487 | 20044-20049 | Entity | denotes | K159A | ||
| T17488 | 20056-20061 | Protein | denotes | NleH1 | ||
| T17489 | 20062-20073 | Negative_regulation | denotes | kinase-dead | ||
| T17490 | 20134-20142 | Regulation | denotes | required | true | |
| T17491 | 20147-20152 | Protein | denotes | NleH1 | ||
| T17492 | 20156-20163 | Negative_regulation | denotes | inhibit | ||
| T17493 | 20164-20168 | Protein | denotes | IKKβ | ||
| T17494 | 20169-20184 | Phosphorylation | denotes | phosphorlyation | ||
| T17495 | 20188-20192 | Protein | denotes | RPS3 | ||
| T17496 | 20196-20200 | Entity | denotes | S209 | ||
| T17497 | 20254-20259 | Protein | denotes | NleH1 | ||
| T17498 | 20285-20290 | Protein | denotes | NleH1 | ||
| T17499 | 20291-20301 | Gene_expression | denotes | expression | ||
| T17500 | 20316-20323 | Negative_regulation | denotes | reduced | ||
| T17501 | 20328-20335 | Positive_regulation | denotes | induced | ||
| T17502 | 20336-20340 | Protein | denotes | RPS3 | ||
| T17503 | 20341-20345 | Entity | denotes | S209 | ||
| T17504 | 20346-20361 | Phosphorylation | denotes | phosphorylation | ||
| T17505 | 20388-20394 | Negative_regulation | denotes | failed | ||
| T17506 | 20420-20425 | Protein | denotes | NleH1 | ||
| T17507 | 20445-20453 | Positive_regulation | denotes | required | ||
| T17508 | 20457-20464 | Negative_regulation | denotes | protect | ||
| T17509 | 20465-20469 | Protein | denotes | RPS3 | ||
| T17510 | 20475-20479 | Protein | denotes | IKKβ | ||
| T17511 | 20480-20488 | Positive_regulation | denotes | mediated | ||
| T17512 | 20489-20504 | Phosphorylation | denotes | phosphorylation | ||
| T17513 | 20648-20652 | Protein | denotes | NleH | ||
| T17514 | 20653-20662 | Negative_regulation | denotes | inhibited | ||
| T17515 | 20653-20662 | Negative_regulation | denotes | inhibited | ||
| T17516 | 20663-20667 | Protein | denotes | RPS3 | ||
| T17517 | 20668-20675 | Entity | denotes | nuclear | ||
| T17518 | 20676-20689 | Localization | denotes | translocation | ||
| T17519 | 20694-20698 | Protein | denotes | RPS3 | ||
| T17520 | 20699-20708 | Regulation | denotes | dependent | ||
| T17521 | 20715-20725 | Protein | denotes | luciferase | ||
| T17522 | 20726-20734 | Positive_regulation | denotes | activity | ||
| T17523 | 20770-20775 | Protein | denotes | NleH1 | ||
| T17524 | 20797-20801 | Protein | denotes | RPS3 | ||
| T17525 | 20802-20806 | Entity | denotes | S209 | ||
| T17526 | 20807-20822 | Phosphorylation | denotes | phosphorylation | ||
| T17527 | 20941-20949 | Positive_regulation | denotes | increase | ||
| T17528 | 20953-20957 | Protein | denotes | RPS3 | ||
| T17529 | 20958-20962 | Entity | denotes | S209 | ||
| T17530 | 20963-20978 | Phosphorylation | denotes | phosphorylation | ||
| T17531 | 20995-21007 | Positive_regulation | denotes | augmentation | ||
| T17532 | 21011-21015 | Protein | denotes | RPS3 | ||
| T17533 | 21016-21031 | Phosphorylation | denotes | phosphorylation | ||
| T17534 | 21036-21043 | Negative_regulation | denotes | reduced | ||
| T17535 | 21113-21117 | Protein | denotes | RPS3 | ||
| T17536 | 21118-21133 | Phosphorylation | denotes | phosphorylation | ||
| T17537 | 21138-21146 | Positive_regulation | denotes | enhanced | ||
| T17538 | 21199-21206 | Negative_regulation | denotes | lacking | ||
| T17539 | 21207-21211 | Protein | denotes | NleH | ||
| T17540 | 21222-21227 | Protein | denotes | ΔnleH | ||
| T17541 | 21262-21267 | Protein | denotes | NleH1 | ||
| T17542 | 21307-21312 | Protein | denotes | ΔnleH | ||
| T17543 | 21348-21355 | Gene_expression | denotes | express | ||
| T17544 | 21390-21395 | Protein | denotes | NleH1 | ||
| T17545 | 21411-21416 | Protein | denotes | ΔnleH | ||
| T17546 | 21439-21444 | Protein | denotes | NleH1 | ||
| T17547 | 21452-21461 | Negative_regulation | denotes | abolished | ||
| T17548 | 21462-21465 | Protein | denotes | TNF | ||
| T17549 | 21466-21473 | Positive_regulation | denotes | induced | ||
| T17550 | 21474-21478 | Protein | denotes | RPS3 | ||
| T17551 | 21479-21483 | Entity | denotes | S209 | ||
| T17552 | 21484-21499 | Phosphorylation | denotes | phosphorylation | ||
| T17553 | 21543-21550 | Negative_regulation | denotes | inhibit | true | |
| T17554 | 21551-21555 | Protein | denotes | RPS3 | ||
| T17555 | 21556-21571 | Phosphorylation | denotes | phosphorylation | ||
| T17556 | 21628-21633 | Protein | denotes | NleH1 | ||
| T17557 | 21653-21661 | Positive_regulation | denotes | required | ||
| T17558 | 21665-21670 | Negative_regulation | denotes | block | ||
| T17559 | 21671-21675 | Protein | denotes | RPS3 | ||
| T17560 | 21676-21680 | Entity | denotes | S209 | ||
| T17561 | 21681-21696 | Phosphorylation | denotes | phosphorylation | ||
| T17562 | 21750-21755 | Protein | denotes | NleH1 | ||
| T17563 | 21782-21788 | Negative_regulation | denotes | impair | true | |
| T17564 | 21800-21807 | Entity | denotes | nuclear | ||
| T17565 | 21808-21821 | Localization | denotes | translocation | ||
| T17566 | 21825-21829 | Protein | denotes | RPS3 | ||
| T17567 | 21830-21837 | Positive_regulation | denotes | trigged | ||
| T17568 | 21845-21866 | Positive_regulation | denotes | constitutively-active | ||
| T17569 | 21867-21871 | Protein | denotes | IKKβ | ||
| T17570 | 21873-21877 | Protein | denotes | IKKβ | ||
| T17571 | 21879-21883 | Positive_regulation | denotes | SSEE | ||
| T17572 | 21954-21963 | Protein | denotes | SSEE IKKβ | ||
| T17573 | 21974-21983 | Positive_regulation | denotes | triggered | ||
| T17574 | 21989-21993 | Protein | denotes | RPS3 | ||
| T17575 | 21994-22001 | Entity | denotes | nuclear | ||
| T17576 | 22002-22015 | Localization | denotes | translocation | ||
| T17577 | 22025-22036 | Negative_regulation | denotes | kinase-dead | ||
| T17578 | 22037-22041 | Protein | denotes | IKKβ | ||
| T17579 | 22043-22047 | Negative_regulation | denotes | SSAA | ||
| T17580 | 22068-22072 | Protein | denotes | RPS3 | ||
| T17581 | 22073-22080 | Entity | denotes | nuclear | ||
| T17582 | 22081-22093 | Localization | denotes | accumulation | ||
| T17583 | 22112-22120 | Negative_regulation | denotes | retarded | ||
| T17584 | 22217-22223 | Protein | denotes | ΔnleH1 | ||
| T17585 | 22227-22232 | Protein | denotes | ΔescN | ||
| T17586 | 22264-22268 | Protein | denotes | RPS3 | ||
| T17587 | 22269-22276 | Entity | denotes | nuclear | ||
| T17588 | 22277-22290 | Localization | denotes | translocation | ||
| T17589 | 22301-22305 | Protein | denotes | IKKβ | ||
| T17590 | 22310-22314 | Protein | denotes | IKKβ | ||
| T17591 | 22316-22320 | Positive_regulation | denotes | SSEE | ||
| T17592 | 22322-22332 | Gene_expression | denotes | expressing | ||
| T17593 | 22322-22332 | Gene_expression | denotes | expressing | ||
| T17594 | 22390-22396 | Regulation | denotes | affect | true | |
| T17595 | 22401-22405 | Protein | denotes | RPS3 | ||
| T17596 | 22406-22413 | Entity | denotes | nuclear | ||
| T17597 | 22414-22427 | Localization | denotes | translocation | ||
| T17598 | 22431-22435 | Protein | denotes | IKKβ | ||
| T17599 | 22437-22441 | Negative_regulation | denotes | SSAA | ||
| T17600 | 22443-22453 | Gene_expression | denotes | expressing | ||
| T17601 | 22525-22530 | Protein | denotes | NleH1 | ||
| T17602 | 22557-22564 | Negative_regulation | denotes | inhibit | ||
| T17603 | 22565-22569 | Protein | denotes | RPS3 | ||
| T17604 | 22570-22577 | Entity | denotes | nuclear | ||
| T17605 | 22578-22591 | Localization | denotes | translocation | ||
| T17606 | 22606-22616 | Gene_expression | denotes | expressing | ||
| T17607 | 22632-22641 | Positive_regulation | denotes | activated | ||
| T17608 | 22642-22646 | Protein | denotes | IKKβ | ||
| T17609 | 22668-22673 | Protein | denotes | NleH1 | ||
| T17610 | 22689-22702 | Phosphorylation | denotes | phosphorylate | ||
| T17611 | 22703-22707 | Protein | denotes | IKKβ | ||
| T17612 | 22708-22712 | Positive_regulation | denotes | thus | true | |
| T17613 | 22713-22723 | Negative_regulation | denotes | inhibiting | ||
| T17614 | 22724-22728 | Protein | denotes | IKKβ | ||
| T17615 | 22729-22737 | Positive_regulation | denotes | mediated | ||
| T17616 | 22738-22742 | Protein | denotes | RPS3 | ||
| T17617 | 22743-22747 | Entity | denotes | S209 | ||
| T17618 | 22748-22763 | Phosphorylation | denotes | phosphorylation | ||
| T17619 | 22826-22842 | Protein | denotes | Flag-IKKβ (K44A) | ||
| T17620 | 22872-22881 | Protein | denotes | His-NleH1 | ||
| T17621 | 22901-22905 | Protein | denotes | IKKβ | ||
| T17622 | 22906-22925 | Phosphorylation | denotes | autophosphorylation | ||
| T17623 | 22944-22949 | Protein | denotes | NleH1 | ||
| T17624 | 22958-22973 | Phosphorylation | denotes | phosphorylation | ||
| T17625 | 23018-23035 | Phosphorylation | denotes | 32P incorporation | true | |
| T17626 | 23039-23043 | Protein | denotes | IKKβ | ||
| T17627 | 23138-23143 | Protein | denotes | NleH1 | ||
| T17628 | 23160-23164 | Protein | denotes | IKKβ | ||
| T17629 | 23277-23281 | Protein | denotes | IKKβ | ||
| T17630 | 23296-23300 | Protein | denotes | IKKβ | ||
| T17631 | 23301-23315 | Phosphorylation | denotes | phosphorylated | ||
| T17632 | 23301-23315 | Phosphorylation | denotes | phosphorylated | ||
| T17633 | 23316-23320 | Protein | denotes | RPS3 | ||
| T17634 | 23343-23351 | Protein | denotes | GST-IκBα | ||
| T17635 | 23429-23450 | Regulation | denotes | substrate specificity | ||
| T17636 | 23469-23473 | Protein | denotes | IKKβ | ||
| T17637 | 23479-23484 | Protein | denotes | NleH1 | ||
| T17638 | 23485-23492 | Negative_regulation | denotes | reduced | true | |
| T17639 | 23485-23492 | Negative_regulation | denotes | reduced | true | |
| T17640 | 23493-23497 | Protein | denotes | IKKβ | ||
| T17641 | 23498-23506 | Positive_regulation | denotes | mediated | ||
| T17642 | 23507-23511 | Protein | denotes | RPS3 | ||
| T17643 | 23512-23527 | Phosphorylation | denotes | phosphorylation | ||
| T17644 | 23570-23574 | Protein | denotes | IKKβ | ||
| T17645 | 23575-23583 | Positive_regulation | denotes | mediated | ||
| T17646 | 23584-23592 | Protein | denotes | GST-IκBα | ||
| T17647 | 23593-23608 | Phosphorylation | denotes | phosphorylation | ||
| T17648 | 23685-23690 | Protein | denotes | NleH1 | ||
| T17649 | 23691-23699 | Positive_regulation | denotes | mediated | true | |
| T17650 | 23691-23699 | Positive_regulation | denotes | mediated | true | |
| T17651 | 23691-23699 | Positive_regulation | denotes | mediated | true | |
| T17652 | 23691-23699 | Positive_regulation | denotes | mediated | true | |
| T17653 | 23700-23715 | Phosphorylation | denotes | phosphorylation | ||
| T17654 | 23700-23715 | Phosphorylation | denotes | phosphorylation | ||
| T17655 | 23719-23738 | Phosphorylation | denotes | autophosphorylation | ||
| T17656 | 23719-23738 | Phosphorylation | denotes | autophosphorylation | ||
| T17657 | 23742-23746 | Protein | denotes | RPS3 | ||
| T17658 | 23750-23758 | Protein | denotes | GST-IκBα | ||
| T17659 | 23786-23791 | Protein | denotes | NleH1 | ||
| T17660 | 23832-23836 | Protein | denotes | IKKβ | ||
| T17661 | 23842-23852 | Negative_regulation | denotes | inhibiting | ||
| T17662 | 23857-23861 | Protein | denotes | IKKβ | ||
| T17663 | 23862-23870 | Positive_regulation | denotes | mediated | ||
| T17664 | 23871-23875 | Protein | denotes | RPS3 | ||
| T17665 | 23876-23880 | Entity | denotes | S209 | ||
| T17666 | 23881-23896 | Phosphorylation | denotes | phosphorylation | ||
| T20021 | 24005-24009 | Protein | denotes | RPS3 | ||
| T20022 | 24174-24182 | Positive_regulation | denotes | triggers | true | |
| T20023 | 24183-24187 | Protein | denotes | RPS3 | ||
| T20024 | 24191-24202 | Localization | denotes | translocate | ||
| T20025 | 24244-24251 | Entity | denotes | nucleus | ||
| T20026 | 24273-24277 | Protein | denotes | IKKβ | ||
| T20027 | 24278-24286 | Positive_regulation | denotes | mediated | ||
| T20028 | 24287-24291 | Protein | denotes | RPS3 | ||
| T20029 | 24292-24296 | Entity | denotes | S209 | ||
| T20030 | 24297-24312 | Phosphorylation | denotes | phosphorylation | ||
| T20031 | 24326-24334 | Regulation | denotes | critical | ||
| T20032 | 24364-24371 | Entity | denotes | nuclear | ||
| T20033 | 24372-24378 | Localization | denotes | import | ||
| T20034 | 24449-24453 | Protein | denotes | IKKβ | ||
| T20035 | 24586-24590 | Protein | denotes | RPS3 | ||
| T20036 | 24716-24720 | Protein | denotes | IKKβ | ||
| T20037 | 24815-24819 | Protein | denotes | IKKβ | ||
| T20038 | 24829-24833 | Protein | denotes | IKKα | ||
| T20039 | 24835-24849 | Phosphorylation | denotes | phosphorylated | ||
| T20040 | 24835-24849 | Phosphorylation | denotes | phosphorylated | true | |
| T20041 | 24850-24854 | Protein | denotes | RPS3 | ||
| T20042 | 24900-24910 | Regulation | denotes | modulation | ||
| T20043 | 24900-24910 | Regulation | denotes | modulation | ||
| T20044 | 24915-24919 | Protein | denotes | RPS3 | ||
| T20045 | 24920-24927 | Entity | denotes | nuclear | ||
| T20046 | 24928-24941 | Localization | denotes | translocation | ||
| T20047 | 24943-24946 | Positive_regulation | denotes | via | ||
| T20048 | 25035-25048 | Phosphorylation | denotes | phosphorylate | ||
| T20049 | 25049-25052 | Protein | denotes | p65 | ||
| T20050 | 25060-25064 | Binding | denotes | bind | ||
| T20051 | 25072-25085 | Phosphorylation | denotes | phosphorylate | ||
| T20052 | 25086-25090 | Protein | denotes | IKKβ | ||
| T20053 | 25144-25148 | Protein | denotes | IKKβ | ||
| T20054 | 25149-25154 | Binding | denotes | bound | ||
| T20055 | 25165-25176 | Positive_regulation | denotes | account for | true | |
| T20056 | 25190-25194 | Protein | denotes | RPS3 | ||
| T20057 | 25195-25210 | Phosphorylation | denotes | phosphorylation | ||
| T20058 | 25246-25250 | Protein | denotes | IKKβ | ||
| T20059 | 25308-25312 | Protein | denotes | RPS3 | ||
| T20060 | 25534-25538 | Protein | denotes | RPS3 | ||
| T20061 | 25687-25691 | Protein | denotes | IKKβ | ||
| T20062 | 25692-25700 | Positive_regulation | denotes | mediated | ||
| T20063 | 25701-25705 | Protein | denotes | RPS3 | ||
| T20064 | 25706-25710 | Entity | denotes | S209 | ||
| T20065 | 25711-25726 | Phosphorylation | denotes | phosphorylation | ||
| T20066 | 25748-25757 | Regulation | denotes | modulated | ||
| T20067 | 25831-25836 | Protein | denotes | NleH1 | ||
| T20068 | 25850-25855 | Binding | denotes | binds | ||
| T20069 | 25859-25863 | Protein | denotes | RPS3 | ||
| T20070 | 25997-26002 | Protein | denotes | NleH1 | ||
| T20071 | 26015-26023 | Negative_regulation | denotes | inhibits | ||
| T20072 | 26024-26028 | Protein | denotes | RPS3 | ||
| T20073 | 26029-26044 | Phosphorylation | denotes | phosphorylation | ||
| T20074 | 26051-26060 | Negative_regulation | denotes | retarding | ||
| T20075 | 26065-26072 | Entity | denotes | nuclear | ||
| T20076 | 26073-26086 | Localization | denotes | translocation | ||
| T20077 | 26167-26172 | Protein | denotes | NleH1 | ||
| T20078 | 26190-26203 | Phosphorylation | denotes | phosphorylate | true | |
| T20079 | 26204-26208 | Protein | denotes | IKKβ | ||
| T20080 | 26246-26253 | Negative_regulation | denotes | inhibit | ||
| T20081 | 26254-26258 | Protein | denotes | IKKβ | ||
| T20082 | 26259-26267 | Positive_regulation | denotes | mediated | ||
| T20083 | 26268-26272 | Protein | denotes | RPS3 | ||
| T20084 | 26273-26277 | Entity | denotes | S209 | ||
| T20085 | 26278-26293 | Phosphorylation | denotes | phosphorylation | ||
| T20086 | 26424-26429 | Protein | denotes | NleH1 | ||
| T20087 | 26433-26438 | Regulation | denotes | steer | ||
| T20088 | 26468-26472 | Protein | denotes | IKKβ | ||
| T20089 | 26739-26744 | Protein | denotes | NleH1 | ||
| T20090 | 26777-26781 | Protein | denotes | RPS3 | ||
| T20091 | 26911-26914 | Protein | denotes | IL8 | ||
| T20092 | 26937-26942 | Protein | denotes | NleH1 | ||
| T20093 | 26952-26957 | Negative_regulation | denotes | block | true | |
| T20094 | 26964-26967 | Protein | denotes | p65 | ||
| T20095 | 26968-26975 | Entity | denotes | nuclear | ||
| T20096 | 26976-26989 | Localization | denotes | translocation | ||
| T20097 | 27019-27022 | Protein | denotes | p65 | ||
| T20098 | 27037-27041 | Protein | denotes | RPS3 | ||
| T20099 | 27175-27185 | Negative_regulation | denotes | inhibiting | ||
| T20100 | 27186-27190 | Protein | denotes | RPS3 | ||
| T20101 | 27229-27234 | Protein | denotes | NleH1 | ||
| T20102 | 27821-27829 | Negative_regulation | denotes | impeding | ||
| T20103 | 27830-27834 | Protein | denotes | RPS3 | ||
| T20104 | 27844-27852 | Regulation | denotes | altering | ||
| T20105 | 27853-27856 | Protein | denotes | p65 | ||
| T20106 | 27857-27864 | Entity | denotes | nuclear | ||
| T20107 | 27865-27878 | Localization | denotes | translocation | ||
| T20108 | 28108-28115 | Regulation | denotes | effects | ||
| T20109 | 28136-28140 | Protein | denotes | RPS3 | ||
| T20821 | 29321-29337 | Protein | denotes | Flag-IKKβ (SSEE) | ||
| T20822 | 29339-29355 | Protein | denotes | Flag-IKKβ (SSAA) | ||
| T20823 | 29361-29375 | Protein | denotes | HA-IκBα (SSAA) | ||
| T20824 | 29481-29488 | Protein | denotes | HA-IκBα | ||
| T20825 | 29493-29509 | Protein | denotes | IKKβ (K44A)-Flag | ||
| T20826 | 29558-29567 | Protein | denotes | Flag-RPS3 | ||
| T20827 | 29569-29577 | Protein | denotes | GST-RPS3 | ||
| T20828 | 29579-29586 | Protein | denotes | HA-RPS3 | ||
| T20829 | 29588-29593 | Protein | denotes | VN-HA | ||
| T20830 | 29595-29603 | Protein | denotes | NleH1-HA | ||
| T20831 | 29665-29669 | Protein | denotes | RPS3 | ||
| T21349 | 30296-30300 | Protein | denotes | IKKβ | ||
| T21350 | 30305-30309 | Protein | denotes | IKKα | ||
| T21351 | 30470-30478 | Protein | denotes | GST-RPS3 | ||
| T21352 | 30483-30487 | Protein | denotes | RPS3 | ||
| T21532 | 31009-31017 | Protein | denotes | GST-RPS3 | ||
| T21533 | 31049-31053 | Protein | denotes | IKKβ | ||
| T21698 | 31486-31490 | Protein | denotes | IKKα | ||
| T21699 | 31526-31530 | Protein | denotes | IKKβ | ||
| T21700 | 31566-31570 | Protein | denotes | IκBα | ||
| T21701 | 31606-31610 | Protein | denotes | RPS3 | ||
| T22201 | 32705-32715 | Protein | denotes | luciferase | ||
| T22202 | 32742-32752 | Protein | denotes | luciferase | ||
| T22318 | 33114-33117 | Protein | denotes | IL8 | ||
| T22319 | 33122-33128 | Protein | denotes | NFKBIA | ||
| T22320 | 33141-33145 | Protein | denotes | ACTB | ||
| T23092 | 34908-34915 | Protein | denotes | albumin | ||
| T23187 | 35151-35155 | Protein | denotes | IL-8 | ||
| T23188 | 35242-35255 | Protein | denotes | Interleukin-8 | ||
| T23189 | 35275-35278 | Protein | denotes | kit | ||
| T4689 | 6438-6448 | Localization | denotes | detectable | ||
| T11318 | 12254-12258 | Protein | denotes | RPS3 | ||
| R439 | T562 | T563 | themeOf | IKKβ,phosphorylation | ||
| R440 | T563 | T564 | causeOf | phosphorylation,regulates | ||
| R441 | T565 | T567 | themeOf | RPS3,translocation | ||
| R442 | T566 | T567 | locationOf | nuclear,translocation | ||
| R443 | T567 | T564 | themeOf | translocation,regulates | ||
| R444 | T569 | T568 | equivalentTo | RPS3,ribosomal protein S3 | ||
| R445 | T570 | T572 | themeOf | RPS3,translocation | ||
| R446 | T571 | T572 | locationOf | nuclear,translocation | ||
| R447 | T572 | T573 | themeOf | translocation,regulated | ||
| R448 | T575 | T577 | causeOf | phosphorylation,crucial | ||
| R449 | T576 | T575 | themeOf | serine 209,phosphorylation | ||
| R450 | T576 | T574 | partOf | serine 209,IKKβ | ||
| R451 | T578 | T580 | themeOf | RPS3,localization | ||
| R452 | T578 | T582 | themeOf | RPS3,activating | ||
| R453 | T579 | T580 | locationOf | nuclear,localization | ||
| R454 | T580 | T581 | themeOf | localization,in response to | ||
| R455 | T581 | T577 | themeOf | in response to,crucial | ||
| R456 | T582 | T581 | causeOf | activating,in response to | ||
| R457 | T583 | T584 | causeOf | NleH1,inhibited | ||
| R458 | T584 | T588 | causeOf | inhibited,blocked | ||
| R459 | T586 | T587 | themeOf | S209,phosphorylation | ||
| R460 | T586 | T585 | partOf | S209,RPS3 | ||
| R461 | T587 | T584 | themeOf | phosphorylation,inhibited | ||
| R462 | T589 | T588 | themeOf | RPS3,blocked | ||
| R463 | T590 | T591 | causeOf | IKKβ,dependent | ||
| R464 | T592 | T591 | themeOf | modification,dependent | ||
| R465 | T593 | T592 | themeOf | RPS3,modification | ||
| R1464 | T1835 | T1834 | equivalentTo | p65,RelA | ||
| R1468 | T1841 | T1840 | equivalentTo | RPS3,ribosomal protein S3 | ||
| R1473 | T1845 | T1846 | themeOf | immunoglobulin κ light chain,expression | ||
| R1475 | T1847 | T1852 | causeOf | NleH1,affecting | ||
| R1476 | T1847 | T1848 | causeOf | NleH1,attenuating | ||
| R1478 | T1849 | T1851 | themeOf | RPS3,translocation | ||
| R1480 | T1850 | T1851 | locationOf | nuclear,translocation | ||
| R1481 | T1851 | T1848 | themeOf | translocation,attenuating | ||
| R1482 | T1853 | T1854 | themeOf | p65,localization | ||
| R1483 | T1854 | T1852 | themeOf | localization,affecting | ||
| R1485 | T1861 | T1862 | themeOf | RPS3,phosphorylated | ||
| R1486 | T1856 | T1858 | themeOf | RPS3,translocation | ||
| R1487 | T1863 | T1864 | themeOf | RPS3,phosphorylated | ||
| R1488 | T1857 | T1858 | locationOf | nuclear,translocation | ||
| R1489 | T1858 | T1855 | themeOf | translocation,induce | ||
| R1490 | T1860 | T1859 | themeOf | RPS3,binding | ||
| R1491 | T1866 | T1868 | causeOf | Inhibitor of κB (IκB) kinase beta,phosphorylated | ||
| R1492 | T1867 | T1866 | equivalentTo | IKKβ,Inhibitor of κB (IκB) kinase beta | ||
| R1493 | T1877 | T1879 | themeOf | RPS3,translocation | ||
| R1494 | T1878 | T1879 | locationOf | nuclear,translocation | ||
| R1495 | T1879 | T1876 | themeOf | translocation,mediating | ||
| R1496 | T1880 | T1881 | causeOf | NleH1,inhibited | ||
| R1497 | T1870 | T1868 | themeOf | serine 209,phosphorylated | ||
| R1498 | T1883 | T1881 | themeOf | S209,inhibited | ||
| R1499 | T1883 | T1882 | partOf | S209,RPS3 | ||
| R1500 | T1870 | T1869 | partOf | serine 209,RPS3 | ||
| R1501 | T1871 | T1875 | themeOf | RPS3,association | ||
| R1502 | T1872 | T1873 | themeOf | S209,phosphorylation | ||
| R1503 | T1872 | T1871 | partOf | S209,RPS3 | ||
| R1504 | T1873 | T1874 | causeOf | phosphorylation,enhanced | ||
| R1505 | T1874 | T1876 | causeOf | enhanced,mediating | ||
| R1506 | T1875 | T1874 | themeOf | association,enhanced | ||
| R1965 | T2479 | T2480 | themeOf | RPS3,phosphorylation | ||
| R1966 | T2480 | T2481 | themeOf | phosphorylation,in response to | ||
| R1967 | T2482 | T2483 | themeOf | RPS3,phosphorylated | ||
| R1968 | T2484 | T2485 | themeOf | RPS3,phosphorylated | ||
| R1969 | T2487 | T2486 | themeOf | 32P-incorporation,increase | ||
| R1970 | T2489 | T2487 | themeOf | RPS3,32P-incorporation | ||
| R1971 | T2489 | T2488 | themeOf | RPS3,increase | ||
| R1972 | T2491 | T2492 | themeOf | residues,phosphorylated | ||
| R1973 | T2491 | T2490 | partOf | residues,RPS3 | ||
| R1974 | T2496 | T2495 | themeOf | phosphorylation,stimulated | ||
| R1975 | T2497 | T2494 | themeOf | degradaion,stimulated | ||
| R1976 | T2498 | T2496 | themeOf | IκBα,phosphorylation | ||
| R1977 | T2498 | T2497 | themeOf | IκBα,degradaion | ||
| R1978 | T2501 | T2500 | themeOf | serine residues,phosphorylation | ||
| R1979 | T2501 | T2499 | partOf | serine residues,RPS3 | ||
| R1980 | T2502 | T2505 | themeOf | tyrosine,phosphorylation | ||
| R1981 | T2502 | T2506 | partOf | tyrosine,RPS3 | ||
| R1982 | T2503 | T2504 | themeOf | threonine,phosphorylation | ||
| R1983 | T2503 | T2506 | partOf | threonine,RPS3 | ||
| R2507 | T3194 | T3196 | themeOf | RPS3,interaction | ||
| R2508 | T3195 | T3196 | themeOf | IKKβ,interaction | ||
| R2509 | T3205 | T3204 | themeOf | IKKβ,activated | ||
| R2510 | T3205 | T3206 | themeOf | IKKβ,bind | ||
| R2511 | T3208 | T3206 | themeOf | RPS3,bind | ||
| R2512 | T3208 | T3207 | themeOf | RPS3,phosphorylate | ||
| R2513 | T3210 | T3209 | themeOf | IKKβ,expressed | ||
| R2514 | T3210 | T3212 | themeOf | IKKβ,interacted | ||
| R2515 | T3211 | T3212 | themeOf | RPS3,interacted | ||
| R2516 | T3213 | T3215 | themeOf | IKKβ,interaction | ||
| R2517 | T3214 | T3215 | themeOf | RPS3,interaction | ||
| R2518 | T3216 | T3218 | themeOf | RPS3,association | ||
| R2519 | T3217 | T3218 | themeOf | IKKβ,association | ||
| R2520 | T3218 | T3219 | themeOf | association,augmented | ||
| R2521 | T3219 | T3220 | causeOf | augmented,following | ||
| R2522 | T3222 | T3223 | themeOf | serine,phosphorylation | ||
| R2523 | T3222 | T3221 | partOf | serine,RPS3 | ||
| R2524 | T3223 | T3220 | themeOf | phosphorylation,following | ||
| R2525 | T3225 | T3224 | themeOf | RPS3,interaction | ||
| R2526 | T3226 | T3224 | themeOf | IKKα,interaction | ||
| R3610 | T4610 | T4611 | causeOf | IKKβ,required | ||
| R3612 | T4612 | T4614 | themeOf | RPS3,translocation | ||
| R3615 | T4613 | T4614 | locationOf | nuclear,translocation | ||
| R3619 | T4614 | T4611 | themeOf | translocation,required | ||
| R3625 | T4615 | T4617 | themeOf | RPS3,interaction | ||
| R3629 | T4616 | T4617 | themeOf | IKKβ,interaction | ||
| R3632 | T4617 | T4618 | causeOf | interaction,required | ||
| R3636 | T4619 | T4621 | themeOf | RPS3,translocation | ||
| R3640 | T4620 | T4621 | locationOf | nuclear,translocation | ||
| R3642 | T4621 | T4618 | themeOf | translocation,required | ||
| R3647 | T4624 | T4626 | themeOf | IKKα,expression | ||
| R3654 | T4625 | T4627 | themeOf | IKKβ,expression | ||
| R3656 | T4626 | T4622 | themeOf | expression,knocked down | ||
| R3658 | T4627 | T4623 | themeOf | expression,knocked down | ||
| R3662 | T4629 | T4631 | themeOf | RPS3,migration | ||
| R3667 | T4630 | T4631 | locationOf | nuclear,migration | ||
| R3671 | T4631 | T4628 | themeOf | migration,induced | ||
| R3677 | T4633 | T4635 | themeOf | RPS3,translocation | ||
| R3682 | T4634 | T4635 | locationOf | nuclear,translocation | ||
| R3686 | T4635 | T4632 | themeOf | translocation,triggered | ||
| R3689 | T4636 | T4638 | themeOf | RPS3,translocation | ||
| R3693 | T4637 | T4638 | locationOf | nuclear,translocation | ||
| R3696 | T4638 | T4639 | themeOf | translocation,impaired | ||
| R3699 | T4640 | T4641 | themeOf | IKKα,silencing | ||
| R3700 | T4641 | T4639 | causeOf | silencing,impaired | ||
| R3701 | T4642 | T4644 | causeOf | knockdown,attenuated | ||
| R3702 | T4643 | T4642 | themeOf | IKKβ,knockdown | ||
| R3703 | T4645 | T4647 | themeOf | RPS3,accumulation | ||
| R3704 | T4682 | T4680 | causeOf | SSAA,in | ||
| R3705 | T4646 | T4647 | locationOf | nuclear,accumulation | ||
| R3706 | T4683 | T4684 | themeOf | RPS3,translocated | ||
| R3707 | T4684 | T4686 | themeOf | translocated,in | ||
| R3708 | T4685 | T4684 | locationOf | nucleus,translocated | ||
| R3709 | T4647 | T4648 | themeOf | accumulation,following | ||
| R3710 | T4687 | T4688 | themeOf | IKKβ,SSEE | ||
| R3711 | T4688 | T4686 | causeOf | SSEE,in | ||
| R3712 | T4648 | T4644 | themeOf | following,attenuated | ||
| R3713 | T4649 | T4654 | causeOf | expression,necessary | ||
| R3714 | T4650 | T4653 | causeOf | expression,necessary | ||
| R3715 | T4689 | T4693 | themeOf | detectable,increased | ||
| R3716 | T4651 | T4649 | themeOf | IKKβ,expression | ||
| R3717 | T4689 | T4692 | themeOf | detectable,increased | ||
| R3718 | T4652 | T4650 | themeOf | IKKα,expression | ||
| R3719 | T4690 | T4689 | locationOf | nuclear,detectable | ||
| R3720 | T4691 | T4689 | themeOf | RPS3,detectable | ||
| R3721 | T4655 | T4654 | themeOf | induced,necessary | ||
| R3722 | T4694 | T4695 | themeOf | IKKβ,SSEE | ||
| R3723 | T4695 | T4693 | causeOf | SSEE,increased | ||
| R3724 | T4696 | T4697 | themeOf | IKKβ,SSAA | ||
| R3725 | T4697 | T4692 | causeOf | SSAA,increased | ||
| R3726 | T4655 | T4653 | themeOf | induced,necessary | ||
| R3727 | T4656 | T4658 | themeOf | RPS3,translocation | ||
| R3728 | T4657 | T4658 | locationOf | nuclear,translocation | ||
| R3729 | T4698 | T4699 | causeOf | IKKβ,necessary | ||
| R3730 | T4658 | T4655 | themeOf | translocation,induced | ||
| R3731 | T4659 | T4661 | themeOf | p65,translocation | ||
| R3732 | T4660 | T4661 | locationOf | nuclear,translocation | ||
| R3733 | T4700 | T4702 | themeOf | RPS3,translocation | ||
| R3734 | T4701 | T4702 | locationOf | nuclear,translocation | ||
| R3735 | T4661 | T4662 | themeOf | translocation,blocked | ||
| R3736 | T4702 | T4703 | themeOf | translocation,in response to | ||
| R3737 | T4703 | T4699 | themeOf | in response to,necessary | ||
| R3738 | T4663 | T4664 | locationOf | nuclear,translocation | ||
| R3739 | T4665 | T4664 | themeOf | RPS3,translocation | ||
| R3740 | T4669 | T4666 | themeOf | IKKβ,expressing | ||
| R3741 | T4669 | T4667 | themeOf | IKKβ,kinase-dead | ||
| R3742 | T4669 | T4668 | themeOf | IKKβ,constitutively-active | ||
| R3743 | T4670 | T4674 | causeOf | SSEE,induced | ||
| R3745 | T4671 | T4673 | causeOf | SSAA,induced | ||
| R3746 | T4672 | T4670 | themeOf | IKKβ,SSEE | ||
| R3750 | T4672 | T4671 | themeOf | IKKβ,SSAA | ||
| R3753 | T4675 | T4674 | themeOf | dependent,induced | ||
| R3755 | T4675 | T4673 | themeOf | dependent,induced | ||
| R3756 | T4676 | T4675 | themeOf | luciferase,dependent | ||
| R3758 | T4677 | T4678 | themeOf | RPS3,remained | ||
| R3761 | T4678 | T4680 | themeOf | remained,in | ||
| R3763 | T4679 | T4678 | locationOf | cytosolic,remained | ||
| R3767 | T4681 | T4682 | themeOf | IKKβ,SSAA | ||
| R5232 | T6649 | T6650 | themeOf | IκBα,degradation | ||
| R5239 | T6651 | T6653 | themeOf | RPS3,translocation | ||
| R5243 | T6652 | T6653 | locationOf | nuclear,translocation | ||
| R5246 | T6655 | T6656 | locationOf | nuclear,import | ||
| R5250 | T6656 | T6654 | themeOf | import,regulates | ||
| R5255 | T6657 | T6656 | themeOf | Rel,import | ||
| R5260 | T6658 | T6660 | themeOf | RPS3,translocation | ||
| R5265 | T6659 | T6660 | locationOf | nuclear,translocation | ||
| R5269 | T6661 | T6662 | themeOf | p65,translocation | ||
| R5270 | T6665 | T6666 | themeOf | RPS3,binding | ||
| R5272 | T6665 | T6669 | themeOf | RPS3,translocation | ||
| R5274 | T6666 | T6667 | causeOf | binding,essential | ||
| R5277 | T6668 | T6669 | locationOf | nuclear,translocation | ||
| R5279 | T6669 | T6667 | themeOf | translocation,essential | ||
| R5282 | T6670 | T6671 | themeOf | IκBα,degradation | ||
| R5285 | T6671 | T6672 | causeOf | degradation,prerequisite | ||
| R5288 | T6673 | T6672 | themeOf | unmask,prerequisite | ||
| R5292 | T6674 | T6673 | themeOf | NLS,unmask | ||
| R5295 | T6674 | T6675 | partOf | NLS,p65 | ||
| R5297 | T6676 | T6678 | themeOf | RPS3,bind | ||
| R5302 | T6677 | T6679 | themeOf | IκBα,bind | ||
| R5304 | T6680 | T6678 | themeOf | p65,bind | ||
| R5311 | T6680 | T6679 | themeOf | p65,bind | ||
| R5312 | T6681 | T6682 | themeOf | IκBα,degradation | ||
| R5319 | T6682 | T6683 | causeOf | degradation,required | ||
| R5320 | T6684 | T6683 | themeOf | liberation,required | ||
| R5325 | T6685 | T6684 | themeOf | RPS3,liberation | ||
| R5328 | T6687 | T6686 | themeOf | RPS3,association | ||
| R5330 | T6689 | T6690 | themeOf | IκBα,SSAA | ||
| R5331 | T6689 | T6696 | themeOf | IκBα,phosphorylation | ||
| R5332 | T6689 | T6697 | themeOf | IκBα,degradation | ||
| R5333 | T6690 | T6692 | causeOf | SSAA,resistant | ||
| R5334 | T6690 | T6691 | causeOf | SSAA,resistant | ||
| R5335 | T6737 | T6736 | themeOf | RPS3,accumulation | ||
| R5336 | T6693 | T6695 | causeOf | IKKβ,induced | ||
| R5337 | T6738 | T6739 | themeOf | IκBα,degradation | ||
| R5338 | T6693 | T6694 | causeOf | IKKβ,induced | ||
| R5339 | T6742 | T6741 | themeOf | association,promotes | ||
| R5340 | T6694 | T6691 | themeOf | induced,resistant | ||
| R5341 | T6743 | T6744 | locationOf | nuclear,transport | ||
| R5342 | T6744 | T6740 | themeOf | transport,promotes | ||
| R5343 | T6695 | T6692 | themeOf | induced,resistant | ||
| R5344 | T6745 | T6742 | themeOf | RPS3,association | ||
| R5345 | T6745 | T6744 | themeOf | RPS3,transport | ||
| R5346 | T6746 | T6747 | themeOf | IκBα,degradation | ||
| R5347 | T6696 | T6695 | themeOf | phosphorylation,induced | ||
| R5348 | T6749 | T6750 | themeOf | RPS3,association | ||
| R5349 | T6697 | T6694 | themeOf | degradation,induced | ||
| R5350 | T6750 | T6748 | themeOf | association,required | ||
| R5351 | T6751 | T6752 | themeOf | IκBα,phosphorylation | ||
| R5352 | T6751 | T6753 | themeOf | IκBα,degradation | ||
| R5353 | T6752 | T6755 | causeOf | phosphorylation,cause | ||
| R5354 | T6753 | T6754 | causeOf | degradation,cause | ||
| R5355 | T6700 | T6699 | themeOf | interaction,augmented | ||
| R5356 | T6756 | T6757 | themeOf | RPS3,association | ||
| R5357 | T6756 | T6760 | themeOf | RPS3,translocation | ||
| R5358 | T6757 | T6758 | causeOf | association,followed | ||
| R5359 | T6758 | T6755 | themeOf | followed,cause | ||
| R5360 | T6758 | T6754 | themeOf | followed,cause | ||
| R5361 | T6701 | T6700 | themeOf | RPS3,interaction | ||
| R5362 | T6759 | T6760 | locationOf | nuclear,translocation | ||
| R5363 | T6760 | T6758 | themeOf | translocation,followed | ||
| R5364 | T6702 | T6703 | themeOf | RPS3,association | ||
| R5365 | T6763 | T6762 | themeOf | RPS3,phosphorylation | ||
| R5366 | T6703 | T6704 | themeOf | association,abolished | ||
| R5367 | T6705 | T6704 | causeOf | degradable,abolished | ||
| R5368 | T6706 | T6705 | themeOf | IκBα,degradable | ||
| R5369 | T6707 | T6708 | causeOf | IκBα,precluding | ||
| R5370 | T6709 | T6711 | themeOf | RPS3,translocation | ||
| R5372 | T6710 | T6711 | locationOf | nuclear,translocation | ||
| R5375 | T6711 | T6708 | themeOf | translocation,precluding | ||
| R5376 | T6712 | T6713 | themeOf | RPS3,association | ||
| R5380 | T6716 | T6717 | themeOf | IκBα,expression | ||
| R5383 | T6717 | T6715 | themeOf | expression,reducing | ||
| R5385 | T6718 | T6720 | causeOf | siRNA,depleted | ||
| R5388 | T6720 | T6724 | causeOf | depleted,augmented | ||
| R5392 | T6721 | T6720 | themeOf | IκBα,depleted | ||
| R5395 | T6722 | T6723 | themeOf | RPS3,association | ||
| R5399 | T6723 | T6724 | themeOf | association,augmented | ||
| R5402 | T6725 | T6727 | locationOf | nuclear,detected | ||
| R5406 | T6726 | T6727 | themeOf | RPS3,detected | ||
| R5409 | T6728 | T6731 | causeOf | induce,increased | ||
| R5412 | T6728 | T6732 | causeOf | induce,increased | ||
| R5416 | T6729 | T6730 | themeOf | IκBα,degradation | ||
| R5417 | T6730 | T6728 | themeOf | degradation,induce | ||
| R5420 | T6733 | T6731 | themeOf | association,increased | ||
| R5423 | T6734 | T6733 | themeOf | RPS3,association | ||
| R5425 | T6735 | T6736 | locationOf | nuclear,accumulation | ||
| R5427 | T6736 | T6732 | themeOf | accumulation,increased | ||
| R6820 | T8531 | T8532 | causeOf | IKKβ,phosphorylates | ||
| R6821 | T8534 | T8532 | themeOf | serine 209,phosphorylates | ||
| R6822 | T8534 | T8533 | partOf | serine 209,RPS3 | ||
| R6823 | T8535 | T8537 | causeOf | IKKβ,phosphorylates | ||
| R6824 | T8535 | T8536 | causeOf | IKKβ,phosphorylates | ||
| R6825 | T8538 | T8537 | themeOf | 14-3-3β,phosphorylates | ||
| R6826 | T8539 | T8536 | themeOf | Bcl10,phosphorylates | ||
| R6827 | T8540 | T8541 | causeOf | IKKβ,phosphorylate | ||
| R6828 | T8542 | T8541 | themeOf | RPS3,phosphorylate | ||
| R6829 | T8548 | T8544 | themeOf | IKKα,incorporation of 32P | ||
| R6830 | T8548 | T8547 | themeOf | IKKα,autophosphorylatd | ||
| R6831 | T8549 | T8545 | themeOf | IKKβ,incorporation of 32P | ||
| R6832 | T8549 | T8546 | themeOf | IKKβ,autophosphorylatd | ||
| R6833 | T8552 | T8550 | themeOf | GST-IκBα,phosporylated | ||
| R6834 | T8553 | T8551 | themeOf | GST,phosporylated | ||
| R6835 | T8556 | T8558 | themeOf | GST-RPS3,phosphorylated | ||
| R6836 | T8556 | T8557 | themeOf | GST-RPS3,phosphorylated | ||
| R6837 | T8559 | T8558 | causeOf | IKKβ,phosphorylated | ||
| R6838 | T8560 | T8557 | causeOf | IKKα,phosphorylated | ||
| R6839 | T8562 | T8563 | themeOf | amino acid residue(s),phosphorylated | ||
| R6840 | T8562 | T8561 | partOf | amino acid residue(s),RPS3 | ||
| R6841 | T8564 | T8563 | causeOf | IKKβ,phosphorylated | ||
| R6842 | T8566 | T8565 | themeOf | RPS3,phosphorylated | ||
| R6843 | T8567 | T8568 | causeOf | IKKβ,phosphorylated | ||
| R6844 | T8569 | T8568 | themeOf | S209,phosphorylated | ||
| R6845 | T8569 | T8570 | partOf | S209,RPS3 | ||
| R6846 | T8574 | T8575 | themeOf | S209A,mutant | ||
| R6847 | T8574 | T8576 | partOf | S209A,RPS3 | ||
| R6848 | T8577 | T8578 | themeOf | S209A,mutation | ||
| R6849 | T8577 | T8582 | partOf | S209A,RPS3 | ||
| R6850 | T8578 | T8579 | causeOf | mutation,reduced | ||
| R6851 | T8580 | T8581 | causeOf | IKKβ–,mediated | ||
| R6852 | T8581 | T8579 | themeOf | mediated,reduced | ||
| R6853 | T8582 | T8583 | themeOf | RPS3,phosphorylation | ||
| R6854 | T8583 | T8581 | themeOf | phosphorylation,mediated | ||
| R6855 | T8585 | T8584 | themeOf | RPS3,phosphorylated | ||
| R6856 | T8587 | T8588 | themeOf | sequence motif,recognized | ||
| R6857 | T8587 | T8586 | partOf | sequence motif,RPS3 | ||
| R6858 | T8591 | T8592 | themeOf | S209,phosphorylation | ||
| R6859 | T8591 | T8590 | partOf | S209,RPS3 | ||
| R6860 | T8592 | T8593 | themeOf | phosphorylation,due | ||
| R6861 | T8594 | T8593 | causeOf | IKKβ,due | ||
| R6862 | T8595 | T8596 | causeOf | S209,critical | ||
| R6863 | T8595 | T8599 | partOf | S209,RPS3 | ||
| R6864 | T8597 | T8598 | causeOf | IKKβ,phosphorylates | ||
| R6865 | T8598 | T8596 | themeOf | phosphorylates,critical | ||
| R6866 | T8599 | T8598 | themeOf | RPS3,phosphorylates | ||
| R6867 | T8602 | T8600 | themeOf | Flag-RPS3,transfected | ||
| R6868 | T8603 | T8601 | themeOf | IKKβ,transfected | ||
| R6869 | T8604 | T8606 | causeOf | overexpressing,enhanced | ||
| R6870 | T8605 | T8604 | themeOf | IKKβ,overexpressing | ||
| R6871 | T8607 | T8608 | themeOf | Flag-RPS3,phosphorylation | ||
| R6872 | T8608 | T8606 | themeOf | phosphorylation,enhanced | ||
| R6873 | T8608 | T8609 | themeOf | phosphorylation,eliminated | ||
| R6874 | T8610 | T8609 | causeOf | alanine substitution,eliminated | ||
| R6875 | T8611 | T8610 | themeOf | S209,alanine substitution | ||
| R6876 | T8611 | T8607 | partOf | S209,Flag-RPS3 | ||
| R6877 | T8611 | T8613 | themeOf | S209,phosphorylation | ||
| R6878 | T8616 | T8618 | themeOf | phosphorylated,dependent | ||
| R6879 | T8617 | T8616 | themeOf | S209,phosphorylated | ||
| R6880 | T8617 | T8615 | partOf | S209,RPS3 | ||
| R6881 | T8618 | T8619 | themeOf | dependent,upon | ||
| R9099 | T11312 | T11311 | themeOf | RPS3,Phosphorylation | ||
| R9100 | T11317 | T11315 | themeOf | translocation,plays a role | ||
| R9101 | T11313 | T11314 | themeOf | S209,phosphorylation | ||
| R9102 | T11313 | T11318 | partOf | S209,RPS3 | ||
| R9103 | T11318 | T11317 | themeOf | RPS3,translocation | ||
| R9104 | T11319 | T11320 | themeOf | S209A,mutant | ||
| R9105 | T11314 | T11315 | causeOf | phosphorylation,plays a role | ||
| R9106 | T11319 | T11321 | partOf | S209A,RPS3 | ||
| R9107 | T11323 | T11325 | themeOf | Flag-RPS3,translocation | ||
| R9108 | T11316 | T11317 | locationOf | nuclear,translocation | ||
| R9109 | T11324 | T11325 | locationOf | nuclear,translocation | ||
| R9110 | T11325 | T11322 | themeOf | translocation,triggered | ||
| R9111 | T11326 | T11329 | themeOf | RPS3,translocation | ||
| R9112 | T11413 | T11415 | themeOf | p65,translocation | ||
| R9113 | T11414 | T11415 | locationOf | nuclear,translocation | ||
| R9114 | T11327 | T11330 | causeOf | S209A,attenuated | ||
| R9115 | T11415 | T11412 | themeOf | translocation,impact | ||
| R9116 | T11417 | T11418 | themeOf | p65,recruitment | ||
| R9117 | T11327 | T11326 | partOf | S209A,RPS3 | ||
| R9118 | T11418 | T11416 | themeOf | recruitment,attenuated | ||
| R9119 | T11328 | T11329 | locationOf | nuclear,translocation | ||
| R9120 | T11419 | T11420 | themeOf | p65,attraction | ||
| R9121 | T11329 | T11330 | themeOf | translocation,attenuated | ||
| R9122 | T11420 | T11431 | themeOf | attraction,specific | ||
| R9123 | T11420 | T11424 | themeOf | attraction,increased | ||
| R9124 | T11333 | T11332 | themeOf | IKKβ,overexpressing | ||
| R9125 | T11422 | T11420 | locationOf | promoters,attraction | ||
| R9126 | T11425 | T11427 | themeOf | Flag-RPS3,recruitment | ||
| R9127 | T11334 | T11336 | themeOf | RPS3,translocation | ||
| R9128 | T11426 | T11428 | themeOf | p65,recruitment | ||
| R9129 | T11335 | T11336 | locationOf | nuclear,translocation | ||
| R9130 | T11430 | T11428 | locationOf | promoter,recruitment | ||
| R9131 | T11430 | T11427 | locationOf | promoter,recruitment | ||
| R9132 | T11432 | T11437 | themeOf | recruitment,depended | ||
| R9133 | T11336 | T11331 | themeOf | translocation,impact | ||
| R9134 | T11340 | T11341 | locationOf | nuclear,translocation | ||
| R9135 | T11433 | T11432 | themeOf | RPS3,recruitment | ||
| R9136 | T11434 | T11438 | themeOf | recruitment,depended | ||
| R9137 | T11435 | T11434 | themeOf | p65,recruitment | ||
| R9138 | T11436 | T11432 | locationOf | promoters,recruitment | ||
| R9139 | T11436 | T11434 | locationOf | promoters,recruitment | ||
| R9140 | T11341 | T11339 | themeOf | translocation,induced | ||
| R9141 | T11439 | T11437 | causeOf | S209,depended | ||
| R9142 | T11439 | T11433 | partOf | S209,RPS3 | ||
| R9143 | T11439 | T11438 | causeOf | S209,depended | ||
| R9144 | T11440 | T11442 | themeOf | Interleukin 8,secretion | ||
| R9145 | T11440 | T11444 | themeOf | Interleukin 8,stimulation | ||
| R9146 | T11342 | T11341 | themeOf | RPS3,translocation | ||
| R9147 | T11343 | T11344 | themeOf | S209,phosphorylation | ||
| R9148 | T11441 | T11440 | equivalentTo | IL-8,Interleukin 8 | ||
| R9149 | T11442 | T11443 | themeOf | secretion,induced | ||
| R9150 | T11443 | T11445 | themeOf | induced,decreased | ||
| R9151 | T11343 | T11347 | partOf | S209,RPS3 | ||
| R9152 | T11444 | T11443 | causeOf | stimulation,induced | ||
| R9153 | T11344 | T11345 | causeOf | phosphorylation,critical | ||
| R9154 | T11446 | T11445 | causeOf | reduced,decreased | ||
| R9155 | T11346 | T11345 | themeOf | induced,critical | ||
| R9156 | T11447 | T11449 | themeOf | RPS3,recruitment | ||
| R9157 | T11449 | T11446 | themeOf | recruitment,reduced | ||
| R9158 | T11347 | T11349 | themeOf | RPS3,translocation | ||
| R9159 | T11451 | T11449 | themeOf | κB sites,recruitment | ||
| R9160 | T11451 | T11450 | partOf | κB sites,IL8 | ||
| R9161 | T11452 | T11446 | causeOf | S209A,reduced | ||
| R9162 | T11452 | T11453 | partOf | S209A,RPS3 | ||
| R9163 | T11348 | T11349 | locationOf | nuclear,translocation | ||
| R9164 | T11454 | T11455 | themeOf | CD25,expression | ||
| R9165 | T11349 | T11346 | themeOf | translocation,induced | ||
| R9166 | T11456 | T11457 | themeOf | RPS3,transfected | ||
| R9167 | T11350 | T11351 | themeOf | S209,phosphorylation | ||
| R9168 | T11459 | T11460 | themeOf | S209,phosphorylation | ||
| R9169 | T11459 | T11458 | partOf | S209,RPS3 | ||
| R9170 | T11460 | T11461 | themeOf | phosphorylation,by | ||
| R9171 | T11350 | T11352 | partOf | S209,RPS3 | ||
| R9172 | T11354 | T11355 | themeOf | RPS3,expression | ||
| R9173 | T11462 | T11461 | causeOf | IKKβ,by | ||
| R9174 | T11355 | T11353 | themeOf | expression,silenced | ||
| R9175 | T11357 | T11358 | themeOf | RPS3,transfection | ||
| R9176 | T11359 | T11360 | causeOf | RPS3 siRNA,reduced | ||
| R9177 | T11359 | T11362 | causeOf | RPS3 siRNA,affect | ||
| R9178 | T11361 | T11360 | themeOf | RPS3,reduced | ||
| R9179 | T11363 | T11362 | themeOf | expression,affect | ||
| R9180 | T11364 | T11363 | themeOf | Flag-tagged RPS3,expression | ||
| R9181 | T11365 | T11366 | themeOf | RPS3,knockdown | ||
| R9183 | T11366 | T11367 | causeOf | knockdown,reduced | ||
| R9185 | T11368 | T11367 | themeOf | induced,reduced | ||
| R9187 | T11369 | T11368 | themeOf | expression,induced | ||
| R9191 | T11371 | T11369 | themeOf | luciferase,expression | ||
| R9195 | T11371 | T11370 | themeOf | luciferase,driven | ||
| R9196 | T11372 | T11374 | themeOf | impaired,caused | ||
| R9199 | T11373 | T11372 | themeOf | luciferase,impaired | ||
| R9204 | T11375 | T11376 | themeOf | RPS3,deficiency | ||
| R9207 | T11376 | T11374 | causeOf | deficiency,caused | ||
| R9208 | T11378 | T11377 | themeOf | RPS3,transfecting | ||
| R9213 | T11380 | T11379 | themeOf | green fluorescent protein,overexpression | ||
| R9215 | T11381 | T11380 | equivalentTo | GFP,green fluorescent protein | ||
| R9220 | T11384 | T11385 | themeOf | S209,phosphorylation | ||
| R9225 | T11384 | T11383 | partOf | S209,RPS3 | ||
| R9227 | T11386 | T11387 | themeOf | S209,phosphorylation | ||
| R9228 | T11386 | T11390 | partOf | S209,RPS3 | ||
| R9229 | T11387 | T11388 | causeOf | phosphorylation,affects | ||
| R9232 | T11387 | T11389 | causeOf | phosphorylation,affects | ||
| R9233 | T11390 | T11392 | themeOf | RPS3,recruitment | ||
| R9236 | T11391 | T11393 | themeOf | p65,recruitment | ||
| R9238 | T11392 | T11388 | themeOf | recruitment,affects | ||
| R9244 | T11393 | T11389 | themeOf | recruitment,affects | ||
| R9247 | T11394 | T11395 | themeOf | RPS3,knockdown | ||
| R9250 | T11400 | T11398 | themeOf | recruitment,stimulated | ||
| R9258 | T11401 | T11399 | themeOf | recruitment,stimulated | ||
| R9261 | T11402 | T11396 | themeOf | recruitment,stimulated | ||
| R9262 | T11403 | T11397 | themeOf | recruitment,stimulated | ||
| R9269 | T11405 | T11403 | themeOf | S209A,recruitment | ||
| R9273 | T11405 | T11406 | partOf | S209A,RPS3 | ||
| R9275 | T11405 | T11400 | themeOf | S209A,recruitment | ||
| R9276 | T11406 | T11402 | themeOf | RPS3,recruitment | ||
| R9277 | T11406 | T11401 | themeOf | RPS3,recruitment | ||
| R9278 | T11406 | T11404 | themeOf | RPS3,expressed | ||
| R9279 | T11407 | T11403 | themeOf | κB sites,recruitment | ||
| R9281 | T11407 | T11408 | partOf | κB sites,NFKBIA | ||
| R9282 | T11407 | T11402 | themeOf | κB sites,recruitment | ||
| R9283 | T11407 | T11400 | themeOf | κB sites,recruitment | ||
| R9284 | T11407 | T11409 | partOf | κB sites,IL8 | ||
| R9285 | T11407 | T11401 | themeOf | κB sites,recruitment | ||
| R9287 | T11411 | T11412 | causeOf | S209A,impact | ||
| R9306 | T11411 | T11410 | partOf | S209A,RPS3 | ||
| R9308 | T11411 | T11416 | causeOf | S209A,attenuated | ||
| R10816 | T13458 | T13459 | causeOf | NleH1,inhibits | ||
| R10817 | T13460 | T13461 | themeOf | RPS3,phosphorylation | ||
| R10818 | T13461 | T13459 | themeOf | phosphorylation,inhibits | ||
| R10819 | T13462 | T13463 | themeOf | NleH1,binds | ||
| R10820 | T13463 | T13464 | causeOf | binds,attenuates | ||
| R10821 | T13465 | T13467 | themeOf | RPS3,translocation | ||
| R10822 | T13465 | T13463 | themeOf | RPS3,binds | ||
| R10823 | T13466 | T13467 | locationOf | nuclear,translocation | ||
| R10824 | T13467 | T13464 | themeOf | translocation,attenuates | ||
| R10825 | T13469 | T13470 | causeOf | NleH1,inhibiting | ||
| R10826 | T13472 | T13473 | themeOf | S209,phosphorylation | ||
| R10827 | T13472 | T13471 | partOf | S209,RPS3 | ||
| R10828 | T13473 | T13470 | themeOf | phosphorylation,inhibiting | ||
| R10829 | T13475 | T13474 | themeOf | NleH1-HA,increasing | ||
| R10830 | T13477 | T13479 | causeOf | NleH1,reduced | ||
| R10831 | T13477 | T13478 | causeOf | NleH1,reduced | ||
| R10832 | T13480 | T13481 | causeOf | TNF,induced | ||
| R10833 | T13481 | T13479 | themeOf | induced,reduced | ||
| R10834 | T13482 | T13483 | themeOf | RPS3,phosphorylation | ||
| R10835 | T13483 | T13481 | themeOf | phosphorylation,induced | ||
| R10836 | T13483 | T13478 | themeOf | phosphorylation,reduced | ||
| R10837 | T13484 | T13487 | causeOf | Expressing,interfere | ||
| R10838 | T13484 | T13489 | themeOf | Expressing,activation | ||
| R10839 | T13484 | T13486 | causeOf | Expressing,interfere | ||
| R10840 | T13485 | T13484 | themeOf | NleH1,Expressing | ||
| R10841 | T13488 | T13489 | causeOf | TNF,activation | ||
| R10842 | T13489 | T13487 | themeOf | activation,interfere | ||
| R10843 | T13490 | T13491 | themeOf | IκBα,degradation | ||
| R10844 | T13491 | T13486 | themeOf | degradation,interfere | ||
| R10845 | T13492 | T13494 | causeOf | lack,impact | ||
| R10846 | T13493 | T13492 | themeOf | NleH1,lack | ||
| R10847 | T13495 | T13497 | themeOf | p65,translocation | ||
| R10848 | T13496 | T13497 | locationOf | nuclear,translocation | ||
| R10849 | T13497 | T13494 | themeOf | translocation,impact | ||
| R10850 | T13498 | T13499 | causeOf | NleH1,inhibits | ||
| R10851 | T13500 | T13501 | themeOf | RPS3,phosphorylation | ||
| R10852 | T13501 | T13499 | themeOf | phosphorylation,inhibits | ||
| R10853 | T13503 | T13502 | themeOf | nleH1,lacking | ||
| R10854 | T13507 | T13508 | causeOf | TNF,increase | ||
| R10855 | T13510 | T13511 | themeOf | S209,phosphorylation | ||
| R10856 | T13510 | T13509 | partOf | S209,RPS3 | ||
| R10857 | T13511 | T13508 | themeOf | phosphorylation,increase | ||
| R10858 | T13513 | T13514 | themeOf | S209,phosphorylation | ||
| R10859 | T13513 | T13512 | partOf | S209,RPS3 | ||
| R10860 | T13514 | T13515 | themeOf | phosphorylation,impaired | ||
| R10861 | T13516 | T13517 | causeOf | TNF,induced | ||
| R10862 | T13517 | T13521 | themeOf | induced,unimpaired | ||
| R10863 | T13517 | T13522 | themeOf | induced,unimpaired | ||
| R10864 | T13519 | T13520 | themeOf | S209,phosphorylation | ||
| R10865 | T13519 | T13518 | partOf | S209,RPS3 | ||
| R10866 | T13520 | T13517 | themeOf | phosphorylation,induced | ||
| R10867 | T13523 | T13521 | causeOf | ΔnleH1,unimpaired | ||
| R10868 | T13524 | T13522 | causeOf | ΔescN,unimpaired | ||
| R10869 | T13525 | T13527 | causeOf | ΔnleH1,attenuated | ||
| R10870 | T13526 | T13528 | causeOf | ΔescN,attenuated | ||
| R10871 | T13529 | T13530 | causeOf | TNF,induced | ||
| R10872 | T13530 | T13527 | themeOf | induced,attenuated | ||
| R10873 | T13530 | T13528 | themeOf | induced,attenuated | ||
| R10874 | T13531 | T13533 | themeOf | RPS3,translocation | ||
| R10875 | T13532 | T13533 | locationOf | nuclear,translocation | ||
| R10876 | T13533 | T13530 | themeOf | translocation,induced | ||
| R10877 | T13534 | T13535 | themeOf | RPS3,phosphorylation | ||
| R10878 | T13534 | T13537 | themeOf | RPS3,translocation | ||
| R10879 | T13536 | T13537 | locationOf | nuclear,translocation | ||
| R10880 | T13538 | T13543 | themeOf | RPS3,translocation | ||
| R10881 | T13539 | T13540 | themeOf | S209,phosphorylation | ||
| R10882 | T13539 | T13538 | partOf | S209,RPS3 | ||
| R10883 | T13540 | T13541 | causeOf | phosphorylation,important | ||
| R10884 | T13542 | T13543 | locationOf | nuclear,translocation | ||
| R10885 | T13543 | T13541 | themeOf | translocation,important | ||
| R10886 | T13544 | T13545 | causeOf | NleH1,inhibits | ||
| R10887 | T13547 | T13548 | themeOf | S209,phosphorylation | ||
| R10888 | T13547 | T13546 | partOf | S209,RPS3 | ||
| R10889 | T13548 | T13545 | themeOf | phosphorylation,inhibits | ||
| R10890 | T13556 | T13555 | themeOf | nleH1,deleting | ||
| R10891 | T13559 | T13560 | causeOf | NleH1,blocking | ||
| R10892 | T13562 | T13563 | themeOf | S209,phosphorylation | ||
| R10893 | T13562 | T13561 | partOf | S209,RPS3 | ||
| R10894 | T13563 | T13560 | themeOf | phosphorylation,blocking | ||
| R11478 | T14274 | T14275 | causeOf | NleH1,inhibits | ||
| R11479 | T14277 | T14278 | themeOf | S209,phosphorylation | ||
| R11480 | T14277 | T14276 | partOf | S209,RPS3 | ||
| R11481 | T14278 | T14275 | themeOf | phosphorylation,inhibits | ||
| R11482 | T14281 | T14282 | causeOf | NleH1,blocked | ||
| R11483 | T14282 | T14286 | causeOf | blocked,preventing | ||
| R11484 | T14284 | T14285 | themeOf | S209,phosphorylation | ||
| R11485 | T14284 | T14283 | partOf | S209,RPS3 | ||
| R11486 | T14285 | T14282 | themeOf | phosphorylation,blocked | ||
| R11487 | T14287 | T14289 | themeOf | RPS3,translocation | ||
| R11488 | T14288 | T14289 | locationOf | nuclear,translocation | ||
| R11489 | T14289 | T14286 | themeOf | translocation,preventing | ||
| R11490 | T14291 | T14290 | themeOf | phospho,low | ||
| R11491 | T14292 | T14291 | themeOf | RPS3,phospho | ||
| R11492 | T14293 | T14296 | causeOf | ΔnleH1,intense | ||
| R11493 | T14294 | T14296 | themeOf | phospho,intense | ||
| R11494 | T14295 | T14294 | themeOf | RPS3,phospho | ||
| R11495 | T14297 | T14298 | causeOf | NleH1,inhibits | ||
| R11496 | T14300 | T14301 | themeOf | S209,phosphorylation | ||
| R11497 | T14300 | T14299 | partOf | S209,RPS3 | ||
| R11498 | T14301 | T14298 | themeOf | phosphorylation,inhibits | ||
| R13949 | T17474 | T17475 | themeOf | NleH1,autophosphorylated | ||
| R13951 | T17475 | T17476 | themeOf | autophosphorylated,depends | ||
| R13953 | T17477 | T17476 | causeOf | lysine 159,depends | ||
| R13954 | T17477 | T17474 | partOf | lysine 159,NleH1 | ||
| R13957 | T17478 | T17479 | causeOf | NleH1,inhibits | ||
| R13959 | T17498 | T17499 | themeOf | NleH1,expression | ||
| R13960 | T17481 | T17482 | themeOf | S209,phosphorylation | ||
| R13961 | T17481 | T17480 | partOf | S209,RPS3 | ||
| R13962 | T17482 | T17479 | themeOf | phosphorylation,inhibits | ||
| R13963 | T17499 | T17500 | causeOf | expression,reduced | ||
| R13964 | T17485 | T17486 | themeOf | NleH1,autophosphorylated | ||
| R13965 | T17500 | T17505 | themeOf | reduced,failed | ||
| R13966 | T17487 | T17489 | causeOf | K159A,kinase-dead | ||
| R13967 | T17487 | T17488 | partOf | K159A,NleH1 | ||
| R13968 | T17488 | T17489 | themeOf | NleH1,kinase-dead | ||
| R13969 | T17501 | T17500 | themeOf | induced,reduced | ||
| R13970 | T17492 | T17490 | themeOf | inhibit,required | ||
| R13971 | T17503 | T17504 | themeOf | S209,phosphorylation | ||
| R13972 | T17494 | T17492 | themeOf | phosphorlyation,inhibit | ||
| R13973 | T17503 | T17502 | partOf | S209,RPS3 | ||
| R13974 | T17496 | T17494 | themeOf | S209,phosphorlyation | ||
| R13975 | T17496 | T17495 | partOf | S209,RPS3 | ||
| R13976 | T17504 | T17501 | themeOf | phosphorylation,induced | ||
| R13977 | T17508 | T17507 | themeOf | protect,required | ||
| R13978 | T17509 | T17512 | themeOf | RPS3,phosphorylation | ||
| R13979 | T17572 | T17573 | causeOf | SSEE IKKβ,triggered | ||
| R13980 | T17510 | T17511 | causeOf | IKKβ,mediated | ||
| R13981 | T17574 | T17576 | themeOf | RPS3,translocation | ||
| R13982 | T17511 | T17508 | themeOf | mediated,protect | ||
| R13983 | T17575 | T17576 | locationOf | nuclear,translocation | ||
| R13984 | T17576 | T17573 | themeOf | translocation,triggered | ||
| R13985 | T17512 | T17511 | themeOf | phosphorylation,mediated | ||
| R13986 | T17578 | T17577 | themeOf | IKKβ,kinase-dead | ||
| R13987 | T17578 | T17579 | themeOf | IKKβ,SSAA | ||
| R13988 | T17580 | T17582 | themeOf | RPS3,accumulation | ||
| R13989 | T17513 | T17514 | causeOf | NleH,inhibited | ||
| R13990 | T17581 | T17582 | locationOf | nuclear,accumulation | ||
| R13991 | T17582 | T17583 | themeOf | accumulation,retarded | ||
| R13992 | T17513 | T17515 | causeOf | NleH,inhibited | ||
| R13993 | T17516 | T17518 | themeOf | RPS3,translocation | ||
| R13994 | T17586 | T17588 | themeOf | RPS3,translocation | ||
| R13995 | T17587 | T17588 | locationOf | nuclear,translocation | ||
| R13996 | T17589 | T17593 | themeOf | IKKβ,expressing | ||
| R13997 | T17517 | T17518 | locationOf | nuclear,translocation | ||
| R13998 | T17590 | T17591 | themeOf | IKKβ,SSEE | ||
| R13999 | T17590 | T17592 | themeOf | IKKβ,expressing | ||
| R14000 | T17518 | T17514 | themeOf | translocation,inhibited | ||
| R14001 | T17519 | T17520 | causeOf | RPS3,dependent | ||
| R14002 | T17520 | T17515 | themeOf | dependent,inhibited | ||
| R14003 | T17521 | T17522 | themeOf | luciferase,activity | ||
| R14004 | T17595 | T17597 | themeOf | RPS3,translocation | ||
| R14005 | T17522 | T17520 | themeOf | activity,dependent | ||
| R14006 | T17596 | T17597 | locationOf | nuclear,translocation | ||
| R14007 | T17597 | T17594 | themeOf | translocation,affect | ||
| R14008 | T17598 | T17599 | themeOf | IKKβ,SSAA | ||
| R14009 | T17525 | T17526 | themeOf | S209,phosphorylation | ||
| R14010 | T17598 | T17600 | themeOf | IKKβ,expressing | ||
| R14011 | T17525 | T17524 | partOf | S209,RPS3 | ||
| R14012 | T17529 | T17530 | themeOf | S209,phosphorylation | ||
| R14013 | T17601 | T17602 | causeOf | NleH1,inhibit | ||
| R14014 | T17603 | T17605 | themeOf | RPS3,translocation | ||
| R14015 | T17604 | T17605 | locationOf | nuclear,translocation | ||
| R14016 | T17605 | T17602 | themeOf | translocation,inhibit | ||
| R14017 | T17529 | T17528 | partOf | S209,RPS3 | ||
| R14018 | T17530 | T17527 | themeOf | phosphorylation,increase | ||
| R14019 | T17608 | T17606 | themeOf | IKKβ,expressing | ||
| R14020 | T17608 | T17607 | themeOf | IKKβ,activated | ||
| R14021 | T17531 | T17534 | themeOf | augmentation,reduced | ||
| R14022 | T17532 | T17533 | themeOf | RPS3,phosphorylation | ||
| R14023 | T17609 | T17613 | causeOf | NleH1,inhibiting | ||
| R14024 | T17610 | T17612 | causeOf | phosphorylate,thus | ||
| R14025 | T17533 | T17531 | themeOf | phosphorylation,augmentation | ||
| R14026 | T17611 | T17610 | themeOf | IKKβ,phosphorylate | ||
| R14027 | T17613 | T17612 | themeOf | inhibiting,thus | ||
| R14028 | T17535 | T17536 | themeOf | RPS3,phosphorylation | ||
| R14029 | T17614 | T17615 | causeOf | IKKβ,mediated | ||
| R14030 | T17615 | T17613 | themeOf | mediated,inhibiting | ||
| R14031 | T17536 | T17537 | themeOf | phosphorylation,enhanced | ||
| R14032 | T17617 | T17618 | themeOf | S209,phosphorylation | ||
| R14033 | T17617 | T17616 | partOf | S209,RPS3 | ||
| R14034 | T17618 | T17615 | themeOf | phosphorylation,mediated | ||
| R14035 | T17538 | T17537 | causeOf | lacking,enhanced | ||
| R14036 | T17621 | T17622 | themeOf | IKKβ,autophosphorylation | ||
| R14037 | T17621 | T17624 | themeOf | IKKβ,phosphorylation | ||
| R14038 | T17539 | T17538 | themeOf | NleH,lacking | ||
| R14039 | T17626 | T17625 | themeOf | IKKβ,32P incorporation | ||
| R14040 | T17544 | T17543 | themeOf | NleH1,express | ||
| R14041 | T17630 | T17631 | causeOf | IKKβ,phosphorylated | ||
| R14042 | T17630 | T17632 | causeOf | IKKβ,phosphorylated | ||
| R14043 | T17633 | T17631 | themeOf | RPS3,phosphorylated | ||
| R14044 | T17633 | T17635 | themeOf | RPS3,substrate specificity | ||
| R14045 | T17546 | T17547 | causeOf | NleH1,abolished | ||
| R14046 | T17634 | T17632 | themeOf | GST-IκBα,phosphorylated | ||
| R14047 | T17637 | T17638 | causeOf | NleH1,reduced | ||
| R14048 | T17637 | T17639 | causeOf | NleH1,reduced | ||
| R14049 | T17548 | T17549 | causeOf | TNF,induced | ||
| R14050 | T17640 | T17641 | causeOf | IKKβ,mediated | ||
| R14051 | T17641 | T17638 | themeOf | mediated,reduced | ||
| R14052 | T17642 | T17643 | themeOf | RPS3,phosphorylation | ||
| R14053 | T17643 | T17641 | themeOf | phosphorylation,mediated | ||
| R14054 | T17549 | T17547 | themeOf | induced,abolished | ||
| R14055 | T17644 | T17645 | causeOf | IKKβ,mediated | ||
| R14056 | T17645 | T17639 | themeOf | mediated,reduced | ||
| R14057 | T17551 | T17552 | themeOf | S209,phosphorylation | ||
| R14058 | T17646 | T17647 | themeOf | GST-IκBα,phosphorylation | ||
| R14059 | T17647 | T17645 | themeOf | phosphorylation,mediated | ||
| R14060 | T17648 | T17651 | causeOf | NleH1,mediated | ||
| R14061 | T17648 | T17652 | causeOf | NleH1,mediated | ||
| R14062 | T17648 | T17650 | causeOf | NleH1,mediated | ||
| R14063 | T17648 | T17649 | causeOf | NleH1,mediated | ||
| R14064 | T17551 | T17550 | partOf | S209,RPS3 | ||
| R14065 | T17552 | T17549 | themeOf | phosphorylation,induced | ||
| R14066 | T17653 | T17652 | themeOf | phosphorylation,mediated | ||
| R14067 | T17654 | T17651 | themeOf | phosphorylation,mediated | ||
| R14068 | T17554 | T17555 | themeOf | RPS3,phosphorylation | ||
| R14069 | T17655 | T17649 | themeOf | autophosphorylation,mediated | ||
| R14070 | T17656 | T17650 | themeOf | autophosphorylation,mediated | ||
| R14071 | T17657 | T17654 | themeOf | RPS3,phosphorylation | ||
| R14072 | T17657 | T17656 | themeOf | RPS3,autophosphorylation | ||
| R14073 | T17658 | T17653 | themeOf | GST-IκBα,phosphorylation | ||
| R14074 | T17658 | T17655 | themeOf | GST-IκBα,autophosphorylation | ||
| R14075 | T17662 | T17663 | causeOf | IKKβ,mediated | ||
| R14076 | T17555 | T17553 | themeOf | phosphorylation,inhibit | ||
| R14077 | T17663 | T17661 | themeOf | mediated,inhibiting | ||
| R14078 | T17665 | T17666 | themeOf | S209,phosphorylation | ||
| R14079 | T17665 | T17664 | partOf | S209,RPS3 | ||
| R14080 | T17666 | T17663 | themeOf | phosphorylation,mediated | ||
| R14081 | T17558 | T17557 | themeOf | block,required | ||
| R14082 | T17558 | T17563 | causeOf | block,impair | ||
| R14083 | T17560 | T17561 | themeOf | S209,phosphorylation | ||
| R14084 | T17560 | T17559 | partOf | S209,RPS3 | ||
| R14085 | T17561 | T17558 | themeOf | phosphorylation,block | ||
| R14086 | T17564 | T17565 | locationOf | nuclear,translocation | ||
| R14089 | T17565 | T17567 | themeOf | translocation,trigged | ||
| R14090 | T17566 | T17565 | themeOf | RPS3,translocation | ||
| R14093 | T17567 | T17563 | themeOf | trigged,impair | ||
| R14095 | T17569 | T17567 | causeOf | IKKβ,trigged | ||
| R14099 | T17569 | T17568 | themeOf | IKKβ,constitutively-active | ||
| R14100 | T17570 | T17571 | themeOf | IKKβ,SSEE | ||
| R15990 | T20023 | T20024 | themeOf | RPS3,translocate | ||
| R15991 | T20024 | T20022 | themeOf | translocate,triggers | ||
| R15992 | T20025 | T20024 | locationOf | nucleus,translocate | ||
| R15993 | T20026 | T20027 | causeOf | IKKβ,mediated | ||
| R15994 | T20027 | T20031 | causeOf | mediated,critical | ||
| R15995 | T20028 | T20033 | themeOf | RPS3,import | ||
| R15996 | T20029 | T20030 | themeOf | S209,phosphorylation | ||
| R15997 | T20029 | T20028 | partOf | S209,RPS3 | ||
| R15998 | T20030 | T20027 | themeOf | phosphorylation,mediated | ||
| R15999 | T20032 | T20033 | locationOf | nuclear,import | ||
| R16000 | T20033 | T20031 | themeOf | import,critical | ||
| R16001 | T20037 | T20039 | causeOf | IKKβ,phosphorylated | ||
| R16002 | T20038 | T20040 | causeOf | IKKα,phosphorylated | ||
| R16003 | T20039 | T20043 | causeOf | phosphorylated,modulation | ||
| R16004 | T20040 | T20042 | causeOf | phosphorylated,modulation | ||
| R16005 | T20041 | T20039 | themeOf | RPS3,phosphorylated | ||
| R16006 | T20041 | T20040 | themeOf | RPS3,phosphorylated | ||
| R16007 | T20044 | T20046 | themeOf | RPS3,translocation | ||
| R16008 | T20045 | T20046 | locationOf | nuclear,translocation | ||
| R16009 | T20046 | T20043 | themeOf | translocation,modulation | ||
| R16010 | T20046 | T20042 | themeOf | translocation,modulation | ||
| R16011 | T20046 | T20047 | themeOf | translocation,via | ||
| R16012 | T20049 | T20048 | themeOf | p65,phosphorylate | ||
| R16013 | T20052 | T20050 | themeOf | IKKβ,bind | ||
| R16014 | T20052 | T20051 | themeOf | IKKβ,phosphorylate | ||
| R16015 | T20053 | T20054 | themeOf | IKKβ,bound | ||
| R16016 | T20054 | T20055 | causeOf | bound,account for | ||
| R16017 | T20056 | T20057 | themeOf | RPS3,phosphorylation | ||
| R16018 | T20057 | T20055 | themeOf | phosphorylation,account for | ||
| R16019 | T20061 | T20062 | causeOf | IKKβ,mediated | ||
| R16020 | T20062 | T20066 | themeOf | mediated,modulated | ||
| R16021 | T20064 | T20065 | themeOf | S209,phosphorylation | ||
| R16022 | T20064 | T20063 | partOf | S209,RPS3 | ||
| R16023 | T20065 | T20062 | themeOf | phosphorylation,mediated | ||
| R16024 | T20067 | T20068 | themeOf | NleH1,binds | ||
| R16025 | T20069 | T20068 | themeOf | RPS3,binds | ||
| R16026 | T20070 | T20071 | causeOf | NleH1,inhibits | ||
| R16027 | T20071 | T20074 | causeOf | inhibits,retarding | ||
| R16028 | T20072 | T20073 | themeOf | RPS3,phosphorylation | ||
| R16029 | T20072 | T20076 | themeOf | RPS3,translocation | ||
| R16030 | T20073 | T20071 | themeOf | phosphorylation,inhibits | ||
| R16031 | T20075 | T20076 | locationOf | nuclear,translocation | ||
| R16032 | T20076 | T20074 | themeOf | translocation,retarding | ||
| R16033 | T20079 | T20078 | themeOf | IKKβ,phosphorylate | ||
| R16034 | T20081 | T20082 | causeOf | IKKβ,mediated | ||
| R16035 | T20082 | T20080 | themeOf | mediated,inhibit | ||
| R16036 | T20084 | T20085 | themeOf | S209,phosphorylation | ||
| R16037 | T20084 | T20083 | partOf | S209,RPS3 | ||
| R16038 | T20085 | T20082 | themeOf | phosphorylation,mediated | ||
| R16039 | T20086 | T20087 | causeOf | NleH1,steer | ||
| R16040 | T20088 | T20087 | themeOf | IKKβ,steer | ||
| R16041 | T20092 | T20093 | causeOf | NleH1,block | ||
| R16042 | T20094 | T20096 | themeOf | p65,translocation | ||
| R16043 | T20095 | T20096 | locationOf | nuclear,translocation | ||
| R16044 | T20096 | T20093 | themeOf | translocation,block | ||
| R16045 | T20100 | T20099 | themeOf | RPS3,inhibiting | ||
| R16046 | T20101 | T20099 | causeOf | NleH1,inhibiting | ||
| R16047 | T20103 | T20102 | themeOf | RPS3,impeding | ||
| R16048 | T20105 | T20107 | themeOf | p65,translocation | ||
| R16049 | T20106 | T20107 | locationOf | nuclear,translocation | ||
| R16050 | T20107 | T20104 | themeOf | translocation,altering | ||
| R16051 | T20109 | T20108 | themeOf | RPS3,effects |
bionlp-st-ge-2016-reference-tees
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T499 | 0-4 | Protein | denotes | IKKβ |
| T500 | 31-35 | Protein | denotes | RPS3 |
| T501 | 62-67 | Protein | denotes | NF-κB |
| T502 | 5-20 | Phosphorylation | denotes | phosphorylation |
| T503 | 36-43 | Entity | denotes | nuclear |
| T504 | 44-57 | Localization | denotes | translocation |
| T505 | 21-30 | Regulation | denotes | regulates |
| T506 | 130-135 | Protein | denotes | NF-κB |
| T507 | 186-206 | Protein | denotes | ribosomal protein S3 |
| T508 | 208-212 | Protein | denotes | RPS3 |
| T509 | 220-225 | Protein | denotes | NF-κB |
| T510 | 303-307 | Protein | denotes | RPS3 |
| T511 | 308-315 | Entity | denotes | nuclear |
| T512 | 316-329 | Localization | denotes | translocation |
| T513 | 333-342 | Regulation | denotes | regulated |
| T514 | 364-368 | Protein | denotes | IKKβ |
| T515 | 422-426 | Protein | denotes | RPS3 |
| T516 | 369-384 | Phosphorylation | denotes | phosphorylation |
| T517 | 427-434 | Entity | denotes | nuclear |
| T518 | 435-447 | Localization | denotes | localization |
| T519 | 410-417 | Positive_regulation | denotes | crucial |
| T520 | 559-564 | Protein | denotes | NleH1 |
| T521 | 588-597 | Protein | denotes | RPS3 S209 |
| T522 | 626-630 | Protein | denotes | RPS3 |
| T523 | 598-613 | Phosphorylation | denotes | phosphorylation |
| T524 | 618-625 | Negative_regulation | denotes | blocked |
| T525 | 578-587 | Negative_regulation | denotes | inhibited |
| T526 | 771-775 | Protein | denotes | IKKβ |
| T527 | 827-831 | Protein | denotes | RPS3 |
| T528 | 850-855 | Protein | denotes | NF-κB |
| T529 | 832-840 | Positive_regulation | denotes | promotes |
| T1613 | 939-961 | Protein | denotes | Nuclear Factor-kappa B |
| T1614 | 963-968 | Protein | denotes | NF-κB |
| T1615 | 1150-1174 | Protein | denotes | mammalian NF-κB subunits |
| T1616 | 1179-1191 | Protein | denotes | Rel proteins |
| T1617 | 1203-1207 | Protein | denotes | RelA |
| T1618 | 1209-1212 | Protein | denotes | p65 |
| T1619 | 1215-1219 | Protein | denotes | RelB |
| T1620 | 1221-1226 | Protein | denotes | c-Rel |
| T1621 | 1228-1231 | Protein | denotes | p50 |
| T1622 | 1237-1240 | Protein | denotes | p52 |
| T1623 | 1294-1314 | Protein | denotes | ribosomal protein S3 |
| T1624 | 1316-1320 | Protein | denotes | RPS3 |
| T1625 | 1365-1381 | Protein | denotes | NF-κB complexes6 |
| T1626 | 1383-1387 | Protein | denotes | RPS3 |
| T1627 | 1427-1432 | Protein | denotes | NF-κB |
| T1628 | 1530-1535 | Protein | denotes | NF-κB |
| T1629 | 1564-1568 | Protein | denotes | RPS3 |
| T1630 | 1583-1588 | Protein | denotes | NF-κB |
| T1631 | 1636-1669 | Protein | denotes | immunoglobulin κ light chain gene |
| T1632 | 1569-1579 | Regulation | denotes | regulation |
| T1633 | 1569-1579 | Regulation | denotes | regulation |
| T1634 | 1670-1680 | Gene_expression | denotes | expression |
| T1635 | 1908-1913 | Protein | denotes | NleH1 |
| T1636 | 1933-1938 | Protein | denotes | NF-κB |
| T1637 | 1980-1984 | Protein | denotes | RPS3 |
| T1638 | 2026-2029 | Protein | denotes | p65 |
| T1639 | 2030-2043 | Protein | denotes | localization9 |
| T1640 | 1867-1876 | Localization | denotes | secretion |
| T1641 | 1951-1964 | Transcription | denotes | transcription |
| T1642 | 1985-1992 | Entity | denotes | nuclear |
| T1643 | 1993-2006 | Localization | denotes | translocation |
| T1644 | 1968-1979 | Negative_regulation | denotes | attenuating |
| T1645 | 2071-2076 | Protein | denotes | NF-κB |
| T1646 | 2103-2107 | Protein | denotes | RPS3 |
| T1647 | 2190-2210 | Protein | denotes | ribosomal proteins10 |
| T1648 | 2108-2115 | Entity | denotes | nuclear |
| T1649 | 2116-2129 | Localization | denotes | translocation |
| T1650 | 2096-2102 | Positive_regulation | denotes | induce |
| T1651 | 2243-2264 | Protein | denotes | 40S ribosomal subunit |
| T1652 | 2266-2270 | Protein | denotes | RPS3 |
| T1653 | 2353-2357 | Protein | denotes | RPS3 |
| T1654 | 2361-2375 | Phosphorylation | denotes | phosphorylated |
| T1655 | 2451-2456 | Protein | denotes | NF-κB |
| T1656 | 2487-2491 | Protein | denotes | RPS3 |
| T1657 | 2528-2533 | Protein | denotes | NF-κB |
| T1658 | 2457-2467 | Regulation | denotes | regulation |
| T1659 | 2495-2509 | Phosphorylation | denotes | phosphorylated |
| T1660 | 2534-2544 | Positive_regulation | denotes | activation |
| T1661 | 2672-2676 | Protein | denotes | RPS3 |
| T1662 | 2740-2760 | Protein | denotes | κB (IκB) kinase beta |
| T1663 | 2762-2766 | Protein | denotes | IKKβ |
| T1664 | 2783-2787 | Protein | denotes | RPS3 |
| T1665 | 2727-2736 | Negative_regulation | denotes | Inhibitor |
| T1666 | 2727-2736 | Negative_regulation | denotes | Inhibitor |
| T1667 | 2791-2797 | Entity | denotes | serine |
| T1668 | 2768-2782 | Phosphorylation | denotes | phosphorylated |
| T1669 | 2810-2819 | Protein | denotes | RPS3 S209 |
| T1670 | 2866-2876 | Protein | denotes | importin-α |
| T1671 | 2888-2892 | Protein | denotes | RPS3 |
| T1672 | 2908-2919 | Protein | denotes | karyopherin |
| T1673 | 2820-2835 | Phosphorylation | denotes | phosphorylation |
| T1674 | 2849-2860 | Binding | denotes | association |
| T1675 | 2878-2887 | Positive_regulation | denotes | mediating |
| T1677 | 2940-2953 | Localization | denotes | translocation |
| T1678 | 2940-2953 | Localization | denotes | translocation |
| T1679 | 2836-2844 | Positive_regulation | denotes | enhanced |
| T1680 | 2975-2994 | Protein | denotes | coli NleH1 effector |
| T1681 | 3018-3027 | Protein | denotes | RPS3 S209 |
| T1682 | 3045-3054 | Protein | denotes | coli O157 |
| T1683 | 3055-3057 | Protein | denotes | H7 |
| T1684 | 3008-3017 | Negative_regulation | denotes | inhibited |
| T2366 | 3126-3130 | Protein | denotes | RPS3 |
| T2367 | 3162-3167 | Protein | denotes | NF-κB |
| T2368 | 3131-3146 | Phosphorylation | denotes | phosphorylation |
| T2369 | 3168-3178 | Positive_regulation | denotes | activation |
| T2370 | 3168-3178 | Positive_regulation | denotes | activation |
| T2371 | 3150-3158 | Positive_regulation | denotes | response |
| T2372 | 3150-3158 | Positive_regulation | denotes | response |
| T2373 | 3195-3199 | Protein | denotes | RPS3 |
| T2374 | 3225-3230 | Protein | denotes | NF-κB |
| T2375 | 3284-3305 | Protein | denotes | tumor necrosis factor |
| T2376 | 3307-3310 | Protein | denotes | TNF |
| T2377 | 3323-3331 | Protein | denotes | HEK 293T |
| T2378 | 3203-3217 | Phosphorylation | denotes | phosphorylated |
| T2379 | 3231-3241 | Positive_regulation | denotes | activation |
| T2380 | 3345-3349 | Protein | denotes | RPS3 |
| T2381 | 3458-3461 | Protein | denotes | TNF |
| T2382 | 3497-3509 | Protein | denotes | RPS3 protein |
| T2383 | 3511-3518 | Protein | denotes | Fig. 1a |
| T2384 | 3363-3377 | Phosphorylation | denotes | phosphorylated |
| T2385 | 3462-3473 | Positive_regulation | denotes | stimulation |
| T2386 | 3485-3493 | Positive_regulation | denotes | increase |
| T2387 | 3485-3493 | Positive_regulation | denotes | increase |
| T2388 | 3540-3544 | Protein | denotes | RPS3 |
| T2389 | 3597-3601 | Protein | denotes | RPS3 |
| T2390 | 3559-3573 | Phosphorylation | denotes | phosphorylated |
| T2391 | 3718-3721 | Protein | denotes | TNF |
| T2392 | 3821-3825 | Protein | denotes | IκBα |
| T2393 | 3864-3868 | Protein | denotes | RPS3 |
| T2394 | 3787-3802 | Phosphorylation | denotes | phosphorylation |
| T2395 | 3807-3817 | Protein_catabolism | denotes | degradaion |
| T2396 | 3869-3884 | Phosphorylation | denotes | phosphorylation |
| T2397 | 3770-3780 | Positive_regulation | denotes | stimulated |
| T2398 | 3770-3780 | Positive_regulation | denotes | stimulated |
| T2399 | 3770-3780 | Positive_regulation | denotes | stimulated |
| T2400 | 3770-3780 | Positive_regulation | denotes | stimulated |
| T2401 | 4027-4031 | Protein | denotes | RPS3 |
| T2402 | 4033-4040 | Protein | denotes | Fig. 1b |
| T2403 | 3998-4023 | Phosphorylation | denotes | threonine-phosphorylation |
| T3048 | 4044-4048 | Protein | denotes | RPS3 |
| T3049 | 4053-4057 | Protein | denotes | IKKβ |
| T3050 | 4105-4114 | Protein | denotes | κB kinase |
| T3051 | 4116-4119 | Protein | denotes | IKK |
| T3052 | 4149-4161 | Protein | denotes | subunit IKKγ |
| T3053 | 4190-4194 | Protein | denotes | IKKα |
| T3054 | 4199-4203 | Protein | denotes | IKKβ |
| T3055 | 4092-4101 | Negative_regulation | denotes | inhibitor |
| T3056 | 4092-4101 | Negative_regulation | denotes | inhibitor |
| T3057 | 4122-4132 | Gene_expression | denotes | consisting |
| T3058 | 4122-4132 | Gene_expression | denotes | consisting |
| T3059 | 4122-4132 | Gene_expression | denotes | consisting |
| T3060 | 4074-4084 | Positive_regulation | denotes | activation |
| T3061 | 4074-4084 | Positive_regulation | denotes | activation |
| T3062 | 4092-4101 | Negative_regulation | denotes | inhibitor |
| T3063 | 4092-4101 | Negative_regulation | denotes | inhibitor |
| T3064 | 4092-4101 | Negative_regulation | denotes | inhibitor |
| T3065 | 4322-4326 | Protein | denotes | RPS3 |
| T3066 | 4359-4362 | Protein | denotes | p65 |
| T3067 | 4363-4366 | Protein | denotes | p50 |
| T3068 | 4367-4371 | Protein | denotes | IκBα |
| T3069 | 4441-4445 | Protein | denotes | IKKβ |
| T3070 | 4483-4487 | Protein | denotes | RPS3 |
| T3071 | 4334-4339 | Binding | denotes | found |
| T3072 | 4431-4440 | Positive_regulation | denotes | activated |
| T3073 | 4457-4461 | Binding | denotes | bind |
| T3074 | 4469-4482 | Phosphorylation | denotes | phosphorylate |
| T3075 | 4469-4482 | Phosphorylation | denotes | phosphorylate |
| T3076 | 4532-4536 | Protein | denotes | IKKβ |
| T3077 | 4541-4545 | Protein | denotes | RPS3 |
| T3078 | 4558-4565 | Protein | denotes | Fig. 1c |
| T3079 | 4522-4531 | Gene_expression | denotes | expressed |
| T3080 | 4522-4531 | Gene_expression | denotes | expressed |
| T3081 | 4546-4556 | Binding | denotes | interacted |
| T3082 | 4546-4556 | Binding | denotes | interacted |
| T3083 | 4546-4556 | Binding | denotes | interacted |
| T3084 | 4639-4643 | Protein | denotes | IKKβ |
| T3085 | 4644-4648 | Protein | denotes | RPS3 |
| T3086 | 4709-4714 | Protein | denotes | NF-κB |
| T3087 | 4649-4660 | Binding | denotes | interaction |
| T3088 | 4715-4728 | Transcription | denotes | transcription |
| T3089 | 4775-4779 | Protein | denotes | RPS3 |
| T3090 | 4780-4784 | Protein | denotes | IKKβ |
| T3091 | 4824-4827 | Protein | denotes | TNF |
| T3092 | 4901-4905 | Protein | denotes | RPS3 |
| T3093 | 4906-4912 | Entity | denotes | serine |
| T3094 | 4913-4928 | Phosphorylation | denotes | phosphorylation |
| T3095 | 4997-5001 | Protein | denotes | RPS3 |
| T3096 | 5006-5010 | Protein | denotes | IKKα |
| T3097 | 5012-5019 | Protein | denotes | Fig. 1d |
| T3098 | 4977-4988 | Binding | denotes | interaction |
| T4274 | 5023-5027 | Protein | denotes | IKKβ |
| T4275 | 5044-5048 | Protein | denotes | RPS3 |
| T4276 | 5049-5056 | Entity | denotes | nuclear |
| T4277 | 5057-5070 | Localization | denotes | translocation |
| T4278 | 5031-5039 | Positive_regulation | denotes | required |
| T4279 | 5094-5098 | Protein | denotes | RPS3 |
| T4280 | 5099-5103 | Protein | denotes | IKKβ |
| T4281 | 5132-5136 | Protein | denotes | RPS3 |
| T4282 | 5176-5180 | Protein | denotes | IKKα |
| T4283 | 5184-5188 | Protein | denotes | IKKβ |
| T4284 | 5273-5277 | Protein | denotes | RPS3 |
| T4285 | 5104-5115 | Binding | denotes | interaction |
| T4286 | 5137-5144 | Entity | denotes | nuclear |
| T4287 | 5145-5158 | Localization | denotes | translocation |
| T4288 | 5189-5199 | Gene_expression | denotes | expression |
| T4289 | 5189-5199 | Gene_expression | denotes | expression |
| T4290 | 5278-5285 | Entity | denotes | nuclear |
| T4291 | 5286-5295 | Localization | denotes | migration |
| T4292 | 5119-5127 | Positive_regulation | denotes | required |
| T4293 | 5253-5272 | Positive_regulation | denotes | stimulation-induced |
| T4294 | 5325-5328 | Protein | denotes | TNF |
| T4295 | 5333-5338 | Protein | denotes | PMA+I |
| T4296 | 5349-5353 | Protein | denotes | RPS3 |
| T4297 | 5354-5361 | Entity | denotes | nuclear |
| T4298 | 5362-5375 | Localization | denotes | translocation |
| T4299 | 5362-5375 | Localization | denotes | translocation |
| T4300 | 5362-5375 | Localization | denotes | translocation |
| T4301 | 5456-5460 | Protein | denotes | RPS3 |
| T4302 | 5525-5529 | Protein | denotes | IKKα |
| T4303 | 5461-5468 | Entity | denotes | nuclear |
| T4304 | 5469-5482 | Localization | denotes | translocation |
| T4305 | 5530-5539 | Negative_regulation | denotes | silencing |
| T4306 | 5566-5570 | Protein | denotes | IKKβ |
| T4307 | 5592-5596 | Protein | denotes | RPS3 |
| T4308 | 5641-5648 | Protein | denotes | Fig. 2a |
| T4309 | 5553-5562 | Negative_regulation | denotes | knockdown |
| T4310 | 5597-5604 | Entity | denotes | nuclear |
| T4311 | 5605-5617 | Localization | denotes | accumulation |
| T4312 | 5571-5581 | Negative_regulation | denotes | attenuated |
| T4313 | 5721-5725 | Protein | denotes | IKKβ |
| T4314 | 5735-5739 | Protein | denotes | IKKα |
| T4315 | 5778-5782 | Protein | denotes | RPS3 |
| T4316 | 5707-5717 | Gene_expression | denotes | expression |
| T4317 | 5707-5717 | Gene_expression | denotes | expression |
| T4318 | 5783-5790 | Entity | denotes | nuclear |
| T4319 | 5791-5804 | Localization | denotes | translocation |
| T4320 | 5759-5777 | Positive_regulation | denotes | activation-induced |
| T4321 | 5850-5853 | Protein | denotes | p65 |
| T4322 | 5854-5861 | Entity | denotes | nuclear |
| T4323 | 5862-5875 | Localization | denotes | translocation |
| T4324 | 5880-5887 | Negative_regulation | denotes | blocked |
| T4325 | 5971-5975 | Protein | denotes | RPS3 |
| T4326 | 6073-6077 | Protein | denotes | IKKβ |
| T4327 | 5946-5953 | Entity | denotes | nuclear |
| T4328 | 5954-5967 | Localization | denotes | translocation |
| T4329 | 5997-6007 | Gene_expression | denotes | expressing |
| T4330 | 6135-6139 | Protein | denotes | IKKβ |
| T4331 | 6148-6153 | Protein | denotes | NF-κB |
| T4332 | 6164-6174 | Protein | denotes | luciferase |
| T4333 | 6140-6147 | Positive_regulation | denotes | induced |
| T4334 | 6218-6222 | Protein | denotes | RPS3 |
| T4335 | 6245-6249 | Protein | denotes | IKKβ |
| T4336 | 6320-6324 | Protein | denotes | RPS3 |
| T4337 | 6373-6377 | Protein | denotes | IKKβ |
| T4338 | 6379-6383 | Protein | denotes | SSEE |
| T4339 | 6256-6267 | Gene_expression | denotes | -expressing |
| T4340 | 6306-6316 | Gene_expression | denotes | proportion |
| T4341 | 6345-6352 | Entity | denotes | nucleus |
| T4342 | 6362-6372 | Gene_expression | denotes | expressing |
| T4343 | 6362-6372 | Gene_expression | denotes | expressing |
| T4344 | 6325-6337 | Localization | denotes | translocated |
| T4345 | 6482-6486 | Protein | denotes | IKKβ |
| T4346 | 6488-6492 | Protein | denotes | SSEE |
| T4347 | 6523-6527 | Protein | denotes | IKKβ |
| T4348 | 6493-6504 | Gene_expression | denotes | -expressing |
| T4349 | 6493-6504 | Gene_expression | denotes | -expressing |
| T4350 | 6534-6545 | Gene_expression | denotes | -expressing |
| T4351 | 6462-6471 | Positive_regulation | denotes | increased |
| T4352 | 6593-6597 | Protein | denotes | IKKβ |
| T4353 | 6639-6643 | Protein | denotes | RPS3 |
| T4354 | 6681-6686 | Protein | denotes | NF-κB |
| T4355 | 6644-6651 | Entity | denotes | nuclear |
| T4356 | 6652-6665 | Localization | denotes | translocation |
| T4357 | 6610-6619 | Positive_regulation | denotes | necessary |
| T6207 | 6708-6712 | Protein | denotes | IκBα |
| T6208 | 6729-6733 | Protein | denotes | RPS3 |
| T6209 | 6713-6724 | Protein_catabolism | denotes | degradation |
| T6210 | 6734-6741 | Entity | denotes | nuclear |
| T6211 | 6742-6755 | Localization | denotes | translocation |
| T6212 | 6756-6766 | Protein | denotes | Importin-α |
| T6213 | 6799-6819 | Protein | denotes | NF-κB Rel subunits23 |
| T6214 | 6781-6788 | Entity | denotes | nuclear |
| T6215 | 6789-6795 | Localization | denotes | import |
| T6216 | 6767-6776 | Regulation | denotes | regulates |
| T6217 | 6825-6829 | Protein | denotes | RPS3 |
| T6218 | 6958-6961 | Protein | denotes | p65 |
| T6219 | 6962-6976 | Protein | denotes | translocation6 |
| T6220 | 6891-6898 | Entity | denotes | nuclear |
| T6221 | 6899-6912 | Localization | denotes | translocation |
| T6222 | 6899-6912 | Localization | denotes | translocation |
| T6223 | 6899-6912 | Localization | denotes | translocation |
| T6224 | 6997-7001 | Protein | denotes | RPS3 |
| T6225 | 7025-7037 | Protein | denotes | importin-α/β |
| T6226 | 7076-7080 | Protein | denotes | RPS3 |
| T6227 | 7098-7108 | Protein | denotes | importin-α |
| T6228 | 7146-7149 | Protein | denotes | TNF |
| T6229 | 7168-7175 | Protein | denotes | Fig. 3a |
| T6230 | 7081-7092 | Binding | denotes | association |
| T6231 | 7134-7142 | Positive_regulation | denotes | enhanced |
| T6232 | 7209-7213 | Protein | denotes | RPS3 |
| T6233 | 7225-7235 | Protein | denotes | importin-α |
| T6234 | 7282-7287 | Protein | denotes | NF-κB |
| T6235 | 7214-7221 | Binding | denotes | binding |
| T6236 | 7253-7260 | Entity | denotes | nuclear |
| T6237 | 7306-7310 | Protein | denotes | IκBα |
| T6238 | 7362-7365 | Protein | denotes | p65 |
| T6239 | 7376-7380 | Protein | denotes | RPS3 |
| T6240 | 7385-7389 | Protein | denotes | IκBα |
| T6241 | 7398-7401 | Protein | denotes | p65 |
| T6242 | 7459-7478 | Protein | denotes | IκBα degradation is |
| T6243 | 7510-7514 | Protein | denotes | RPS3 |
| T6244 | 7311-7322 | Protein_catabolism | denotes | degradation |
| T6245 | 7390-7394 | Binding | denotes | bind |
| T6246 | 7390-7394 | Binding | denotes | bind |
| T6247 | 7390-7394 | Binding | denotes | bind |
| T6248 | 7496-7506 | Protein_catabolism | denotes | liberation |
| T6249 | 7479-7487 | Positive_regulation | denotes | required |
| T6250 | 7547-7551 | Protein | denotes | RPS3 |
| T6251 | 7597-7611 | Protein | denotes | wild-type IκBα |
| T6252 | 7618-7629 | Protein | denotes | IκBα mutant |
| T6253 | 7631-7635 | Protein | denotes | SSAA |
| T6254 | 7650-7654 | Protein | denotes | IKKβ |
| T6255 | 7532-7543 | Binding | denotes | association |
| T6256 | 7582-7596 | Positive_regulation | denotes | overexpressing |
| T6257 | 7582-7596 | Positive_regulation | denotes | overexpressing |
| T6258 | 7582-7596 | Positive_regulation | denotes | overexpressing |
| T6259 | 7663-7678 | Phosphorylation | denotes | phosphorylation |
| T6260 | 7663-7678 | Phosphorylation | denotes | phosphorylation |
| T6261 | 7683-7694 | Protein_catabolism | denotes | degradation |
| T6262 | 7683-7694 | Protein_catabolism | denotes | degradation |
| T6263 | 7637-7646 | Positive_regulation | denotes | resistant |
| T6264 | 7637-7646 | Positive_regulation | denotes | resistant |
| T6265 | 7655-7662 | Positive_regulation | denotes | induced |
| T6266 | 7655-7662 | Positive_regulation | denotes | induced |
| T6267 | 7732-7736 | Protein | denotes | IκBα |
| T6268 | 7738-7741 | Protein | denotes | TNF |
| T6269 | 7783-7787 | Protein | denotes | RPS3 |
| T6270 | 7792-7802 | Protein | denotes | importin-α |
| T6271 | 7705-7716 | Gene_expression | denotes | transfected |
| T6272 | 7705-7716 | Positive_regulation | denotes | transfected |
| T6273 | 7768-7779 | Binding | denotes | interaction |
| T6274 | 7754-7763 | Positive_regulation | denotes | augmented |
| T6275 | 7886-7890 | Protein | denotes | RPS3 |
| T6276 | 7962-7966 | Protein | denotes | IκBα |
| T6277 | 7968-7975 | Protein | denotes | Fig. 3b |
| T6278 | 7947-7961 | Protein_catabolism | denotes | non-degradable |
| T6279 | 7947-7961 | Protein_catabolism | denotes | non-degradable |
| T6280 | 7997-8001 | Protein | denotes | IκBα |
| T6281 | 8045-8049 | Protein | denotes | RPS3 |
| T6282 | 8090-8094 | Protein | denotes | RPS3 |
| T6283 | 8095-8103 | Protein | denotes | importin |
| T6284 | 8130-8134 | Protein | denotes | RPS3 |
| T6285 | 8150-8154 | Protein | denotes | IκBα |
| T6286 | 8050-8057 | Entity | denotes | nuclear |
| T6287 | 8058-8071 | Localization | denotes | translocation |
| T6288 | 8155-8165 | Gene_expression | denotes | expression |
| T6289 | 8034-8044 | Positive_regulation | denotes | precluding |
| T6290 | 8141-8149 | Negative_regulation | denotes | reducing |
| T6291 | 8219-8223 | Protein | denotes | IκBα |
| T6292 | 8244-8248 | Protein | denotes | IκBα |
| T6293 | 8235-8243 | Negative_regulation | denotes | depleted |
| T6294 | 8301-8305 | Protein | denotes | RPS3 |
| T6295 | 8386-8390 | Protein | denotes | RPS3 |
| T6296 | 8337-8346 | Positive_regulation | denotes | augmented |
| T6297 | 8474-8478 | Protein | denotes | IκBα |
| T6298 | 8576-8580 | Protein | denotes | RPS3 |
| T6299 | 8585-8595 | Protein | denotes | importin-α |
| T6300 | 8597-8600 | Protein | denotes | Fig |
| T6301 | 8602-8604 | Protein | denotes | 3e |
| T6302 | 8609-8630 | Protein | denotes | Supplementary Fig. 3b |
| T6303 | 8659-8663 | Protein | denotes | RPS3 |
| T6304 | 8719-8721 | Protein | denotes | 3c |
| T6305 | 8479-8490 | Protein_catabolism | denotes | degradation |
| T6306 | 8635-8642 | Entity | denotes | nuclear |
| T6307 | 8643-8655 | Positive_regulation | denotes | accumulation |
| T6308 | 8467-8473 | Positive_regulation | denotes | induce |
| T6309 | 8546-8555 | Positive_regulation | denotes | increased |
| T6310 | 8768-8770 | Protein | denotes | κB |
| T6311 | 8816-8826 | Protein | denotes | importin-α |
| T6312 | 8864-8868 | Protein | denotes | RPS3 |
| T6313 | 8875-8879 | Protein | denotes | IκBα |
| T6314 | 8827-8838 | Binding | denotes | association |
| T6315 | 8880-8891 | Protein_catabolism | denotes | degradation |
| T6316 | 8880-8891 | Protein_catabolism | denotes | degradation |
| T6317 | 8803-8811 | Positive_regulation | denotes | promotes |
| T6318 | 8907-8910 | Protein | denotes | TNF |
| T6319 | 8967-8971 | Protein | denotes | RPS3 |
| T6320 | 9010-9013 | Protein | denotes | TNF |
| T6321 | 9049-9053 | Protein | denotes | IκBα |
| T6322 | 9133-9137 | Protein | denotes | RPS3 |
| T6323 | 9155-9165 | Protein | denotes | importin-α |
| T6324 | 9054-9069 | Phosphorylation | denotes | phosphorylation |
| T6325 | 9074-9085 | Protein_catabolism | denotes | degradation |
| T6326 | 9138-9149 | Binding | denotes | association |
| T6327 | 9178-9185 | Entity | denotes | nuclear |
| T6328 | 9186-9199 | Localization | denotes | translocation |
| T6329 | 9127-9132 | Positive_regulation | denotes | cause |
| T6330 | 9243-9247 | Protein | denotes | IKKβ |
| T6331 | 9267-9271 | Protein | denotes | RPS3 |
| T6332 | 9248-9263 | Phosphorylation | denotes | phosphorylation |
| T6333 | 9248-9263 | Phosphorylation | denotes | phosphorylation |
| T10980 | 12135-12139 | Protein | denotes | RPS3 |
| T10981 | 12148-12153 | Protein | denotes | NF-κB |
| T10982 | 12116-12131 | Phosphorylation | denotes | Phosphorylation |
| T10983 | 12154-12162 | Gene_expression | denotes | function |
| T10984 | 12154-12162 | Gene_expression | denotes | function |
| T10985 | 12254-12258 | Protein | denotes | RPS3 |
| T10986 | 12266-12271 | Protein | denotes | NF-κB |
| T10987 | 12229-12236 | Entity | denotes | nuclear |
| T10988 | 12237-12250 | Localization | denotes | translocation |
| T10989 | 12272-12282 | Positive_regulation | denotes | activation |
| T10990 | 12344-12348 | Protein | denotes | RPS3 |
| T10991 | 12397-12418 | Protein | denotes | heat-shock protein 90 |
| T10992 | 12420-12425 | Protein | denotes | hsp90 |
| T10993 | 12485-12489 | Protein | denotes | PARP |
| T10994 | 12349-12360 | Gene_expression | denotes | transfected |
| T10995 | 12603-12607 | Protein | denotes | Flag |
| T10996 | 12608-12612 | Protein | denotes | RPS3 |
| T10997 | 12636-12643 | Protein | denotes | Fig. 5a |
| T10998 | 12613-12620 | Entity | denotes | nuclear |
| T10999 | 12621-12634 | Localization | denotes | translocation |
| T11000 | 12621-12634 | Localization | denotes | translocation |
| T11001 | 12621-12634 | Localization | denotes | translocation |
| T11002 | 12655-12659 | Protein | denotes | RPS3 |
| T11003 | 12661-12666 | Protein | denotes | S209A |
| T11004 | 12706-12713 | Protein | denotes | Fig. 5a |
| T11005 | 12668-12675 | Entity | denotes | nuclear |
| T11006 | 12676-12689 | Localization | denotes | translocation |
| T11007 | 12676-12689 | Localization | denotes | translocation |
| T11008 | 12694-12704 | Negative_regulation | denotes | attenuated |
| T11009 | 12694-12704 | Negative_regulation | denotes | attenuated |
| T11010 | 12745-12761 | Protein | denotes | activating NF-κB |
| T11011 | 12780-12784 | Protein | denotes | IKKβ |
| T11012 | 12788-12792 | Protein | denotes | RPS3 |
| T11013 | 12765-12779 | Gene_expression | denotes | overexpressing |
| T11014 | 12793-12800 | Entity | denotes | nuclear |
| T11015 | 12801-12814 | Localization | denotes | translocation |
| T11016 | 12816-12820 | Protein | denotes | IKKβ |
| T11017 | 12846-12851 | Protein | denotes | NF-κB |
| T11018 | 12864-12874 | Protein | denotes | luciferase |
| T11019 | 12971-12976 | Protein | denotes | S209A |
| T11020 | 12978-12982 | Protein | denotes | RPS3 |
| T11021 | 12984-12991 | Protein | denotes | Fig. 5b |
| T11022 | 12821-12835 | Gene_expression | denotes | overexpression |
| T11023 | 12821-12835 | Positive_regulation | denotes | overexpression |
| T11024 | 12927-12934 | Entity | denotes | nuclear |
| T11025 | 12935-12948 | Localization | denotes | translocation |
| T11026 | 12935-12948 | Localization | denotes | translocation |
| T11027 | 12935-12948 | Localization | denotes | translocation |
| T11028 | 12915-12922 | Positive_regulation | denotes | induced |
| T11029 | 12915-12922 | Positive_regulation | denotes | induced |
| T11030 | 12915-12922 | Positive_regulation | denotes | induced |
| T11031 | 13059-13064 | Protein | denotes | NF-κB |
| T11032 | 13084-13088 | Protein | denotes | RPS3 |
| T11033 | 13089-13096 | Entity | denotes | nuclear |
| T11034 | 13097-13110 | Localization | denotes | translocation |
| T11035 | 13097-13110 | Localization | denotes | translocation |
| T11036 | 13065-13083 | Positive_regulation | denotes | activation-induced |
| T11037 | 13065-13083 | Positive_regulation | denotes | activation-induced |
| T11038 | 13135-13139 | Protein | denotes | S209 |
| T11039 | 13159-13163 | Protein | denotes | RPS3 |
| T11040 | 13171-13176 | Protein | denotes | NF-κB |
| T11041 | 13218-13222 | Protein | denotes | RPS3 |
| T11042 | 13301-13310 | Protein | denotes | RPS3 mRNA |
| T11043 | 13365-13377 | Protein | denotes | S209A mutant |
| T11044 | 13378-13382 | Protein | denotes | RPS3 |
| T11045 | 13140-13155 | Phosphorylation | denotes | phosphorylation |
| T11046 | 13140-13155 | Phosphorylation | denotes | phosphorylation |
| T11047 | 13223-13233 | Gene_expression | denotes | expression |
| T11203 | 13434-13441 | Negative_regulation | denotes | reduced |
| T11204 | 13520-13530 | Gene_expression | denotes | expression |
| T11205 | 13502-13508 | Regulation | denotes | affect |
| T11206 | 13629-13633 | Protein | denotes | RPS3 |
| T11207 | 13652-13655 | Protein | denotes | TNF |
| T11208 | 13681-13686 | Protein | denotes | Ig κB |
| T11209 | 13694-13715 | Protein | denotes | luciferase construct6 |
| T11210 | 13717-13720 | Protein | denotes | Fig |
| T11211 | 13722-13724 | Protein | denotes | 5d |
| T11212 | 13634-13643 | Negative_regulation | denotes | knockdown |
| T11213 | 13664-13674 | Gene_expression | denotes | expression |
| T11214 | 13664-13674 | Gene_expression | denotes | expression |
| T11215 | 13664-13674 | Gene_expression | denotes | expression |
| T11216 | 13656-13663 | Positive_regulation | denotes | induced |
| T11217 | 13656-13663 | Positive_regulation | denotes | induced |
| T11218 | 13656-13663 | Positive_regulation | denotes | induced |
| T11219 | 13644-13651 | Negative_regulation | denotes | reduced |
| T11220 | 13644-13651 | Negative_regulation | denotes | reduced |
| T11221 | 13644-13651 | Negative_regulation | denotes | reduced |
| T11222 | 13740-13750 | Protein | denotes | luciferase |
| T11223 | 13768-13772 | Protein | denotes | RPS3 |
| T11224 | 13846-13856 | Protein | denotes | S209A RPS3 |
| T11225 | 13858-13861 | Protein | denotes | Fig |
| T11226 | 13863-13865 | Protein | denotes | 5d |
| T11227 | 13899-13906 | Protein | denotes | Fig. 5c |
| T11228 | 13773-13783 | Negative_regulation | denotes | deficiency |
| T11229 | 13887-13897 | Gene_expression | denotes | expression |
| T11230 | 13940-13944 | Protein | denotes | RPS3 |
| T11231 | 13956-13966 | Protein | denotes | luciferase |
| T11232 | 14058-14083 | Protein | denotes | green fluorescent protein |
| T11233 | 14085-14088 | Protein | denotes | GFP |
| T11234 | 14151-14155 | Protein | denotes | RPS3 |
| T11235 | 13948-13955 | Negative_regulation | denotes | restore |
| T11236 | 14040-14054 | Gene_expression | denotes | overexpression |
| T11237 | 14040-14054 | Gene_expression | denotes | overexpression |
| T11238 | 14040-14054 | Positive_regulation | denotes | overexpression |
| T11239 | 14040-14054 | Positive_regulation | denotes | overexpression |
| T11240 | 14114-14126 | Binding | denotes | complemented |
| T11241 | 13984-13990 | Positive_regulation | denotes | result |
| T11242 | 13984-13990 | Positive_regulation | denotes | result |
| T11243 | 14220-14229 | Protein | denotes | RPS3 S209 |
| T11244 | 14262-14267 | Protein | denotes | NF-κB |
| T11245 | 14301-14311 | Protein | denotes | Ig κB site |
| T11246 | 14230-14245 | Phosphorylation | denotes | phosphorylation |
| T11247 | 14406-14410 | Protein | denotes | RPS3 |
| T11248 | 14415-14430 | Protein | denotes | p65 recruitment |
| T11249 | 14443-14451 | Protein | denotes | κB sites |
| T11250 | 14479-14484 | Protein | denotes | NF-κB |
| T11251 | 14377-14381 | Entity | denotes | S209 |
| T11252 | 14382-14397 | Phosphorylation | denotes | phosphorylation |
| T11253 | 14485-14495 | Positive_regulation | denotes | activation |
| T11254 | 14398-14405 | Regulation | denotes | affects |
| T11255 | 14500-14504 | Protein | denotes | RPS3 |
| T11256 | 14612-14622 | Protein | denotes | S209A RPS3 |
| T11257 | 14630-14638 | Protein | denotes | κB sites |
| T11258 | 14646-14652 | Protein | denotes | NFKBIA |
| T11259 | 14657-14670 | Protein | denotes | IL8 promoters |
| T11260 | 14672-14675 | Protein | denotes | Fig |
| T11261 | 14505-14514 | Negative_regulation | denotes | knockdown |
| T11262 | 14528-14538 | Positive_regulation | denotes | stimulated |
| T11263 | 14528-14538 | Positive_regulation | denotes | stimulated |
| T11264 | 14699-14709 | Protein | denotes | RPS3 S209A |
| T11265 | 14727-14730 | Protein | denotes | p65 |
| T11266 | 14688-14698 | Gene_expression | denotes | expressing |
| T11267 | 14717-14723 | Regulation | denotes | impact |
| T11268 | 14731-14738 | Entity | denotes | nuclear |
| T11269 | 14739-14752 | Localization | denotes | translocation |
| T11270 | 14739-14752 | Localization | denotes | translocation |
| T11271 | 14717-14723 | Regulation | denotes | impact |
| T11272 | 14717-14723 | Regulation | denotes | impact |
| T11273 | 14846-14849 | Protein | denotes | p65 |
| T11274 | 14864-14868 | Protein | denotes | RPS3 |
| T11275 | 14881-14886 | Protein | denotes | NF-κB |
| T11276 | 14917-14921 | Protein | denotes | CD25 |
| T11277 | 14899-14908 | Entity | denotes | promoters |
| T11278 | 14850-14860 | Positive_regulation | denotes | attraction |
| T11279 | 14926-14935 | Positive_regulation | denotes | increased |
| T11280 | 15029-15033 | Protein | denotes | Flag |
| T11281 | 15034-15038 | Protein | denotes | RPS3 |
| T11282 | 15042-15045 | Protein | denotes | p65 |
| T11283 | 15061-15074 | Protein | denotes | ACTB promoter |
| T11284 | 15083-15091 | Protein | denotes | κB sites |
| T11285 | 15093-15096 | Protein | denotes | Fig |
| T11286 | 15134-15141 | Protein | denotes | κB site |
| T11287 | 15075-15082 | Negative_regulation | denotes | lacking |
| T11288 | 15177-15181 | Protein | denotes | RPS3 |
| T11289 | 15223-15226 | Protein | denotes | p65 |
| T11290 | 15256-15260 | Protein | denotes | S209 |
| T11291 | 15162-15173 | Binding | denotes | recruitment |
| T11292 | 15208-15219 | Binding | denotes | recruitment |
| T11293 | 15311-15326 | Protein | denotes | T cell receptor |
| T11294 | 15328-15331 | Protein | denotes | TCR |
| T11295 | 15404-15408 | Protein | denotes | RPS3 |
| T11296 | 15409-15412 | Protein | denotes | p65 |
| T11297 | 15432-15444 | Protein | denotes | IL8 κB sites |
| T11298 | 15499-15503 | Protein | denotes | RPS3 |
| T11299 | 15551-15555 | Protein | denotes | CD25 |
| T11300 | 15608-15618 | Protein | denotes | S209A RPS3 |
| T11301 | 15556-15566 | Gene_expression | denotes | expression |
| T11302 | 15673-15682 | Protein | denotes | RPS3 S209 |
| T11303 | 15702-15706 | Protein | denotes | IKKβ |
| T11304 | 15734-15738 | Protein | denotes | RPS3 |
| T11305 | 15752-15757 | Protein | denotes | NF-κB |
| T11306 | 15683-15698 | Phosphorylation | denotes | phosphorylation |
| T11307 | 15683-15698 | Phosphorylation | denotes | phosphorylation |
| T11308 | 15721-15729 | Positive_regulation | denotes | required |
| T11309 | 15721-15729 | Positive_regulation | denotes | required |
| T11310 | 15742-15751 | Positive_regulation | denotes | directing |
| T13037 | 15817-15832 | Phosphorylation | denotes | phosphorylation |
| T13038 | 15803-15811 | Negative_regulation | denotes | inhibits |
| T13039 | 15842-15846 | Protein | denotes | EHEC |
| T13040 | 16062-16067 | Protein | denotes | NF-κB |
| T13041 | 16108-16120 | Protein | denotes | E. coli O157 |
| T13042 | 16121-16130 | Protein | denotes | H7 EDL933 |
| T13043 | 16148-16153 | Protein | denotes | NleH1 |
| T13044 | 16178-16182 | Protein | denotes | RPS3 |
| T13045 | 16221-16225 | Protein | denotes | RPS3 |
| T13046 | 16236-16252 | Protein | denotes | NF-κB signaling9 |
| T13047 | 16154-16159 | Binding | denotes | binds |
| T13048 | 16154-16159 | Binding | denotes | binds |
| T13049 | 16154-16159 | Binding | denotes | binds |
| T13050 | 16183-16190 | Entity | denotes | nuclear |
| T13051 | 16191-16204 | Localization | denotes | translocation |
| T13052 | 16226-16235 | Positive_regulation | denotes | dependent |
| T13053 | 16211-16220 | Negative_regulation | denotes | impairing |
| T13054 | 16285-16290 | Protein | denotes | NleH1 |
| T13055 | 16318-16327 | Protein | denotes | RPS3 S209 |
| T13056 | 16328-16343 | Phosphorylation | denotes | phosphorylation |
| T13057 | 16307-16317 | Negative_regulation | denotes | inhibiting |
| T13058 | 16393-16409 | Protein | denotes | NleH1-HA plasmid |
| T13059 | 16418-16422 | Protein | denotes | TNFα |
| T13060 | 16431-16436 | Protein | denotes | NF-κB |
| T13061 | 16501-16506 | Protein | denotes | NleH1 |
| T13062 | 16520-16523 | Protein | denotes | TNF |
| T13063 | 16550-16554 | Protein | denotes | RPS3 |
| T13064 | 16606-16613 | Protein | denotes | Fig. 6c |
| T13065 | 16555-16570 | Phosphorylation | denotes | phosphorylation |
| T13066 | 16524-16531 | Positive_regulation | denotes | induced |
| T13067 | 16507-16514 | Negative_regulation | denotes | reduced |
| T13068 | 16627-16632 | Protein | denotes | NleH1 |
| T13069 | 16664-16667 | Protein | denotes | TNF |
| T13070 | 16676-16679 | Protein | denotes | IKK |
| T13071 | 16694-16698 | Protein | denotes | IκBα |
| T13072 | 16740-16745 | Protein | denotes | NleH1 |
| T13073 | 16756-16782 | Protein | denotes | p65 nuclear translocation9 |
| T13074 | 16784-16791 | Protein | denotes | Fig. 6c |
| T13075 | 16616-16626 | Gene_expression | denotes | Expressing |
| T13076 | 16699-16710 | Protein_catabolism | denotes | degradation |
| T13077 | 16732-16736 | Negative_regulation | denotes | lack |
| T13078 | 16732-16736 | Negative_regulation | denotes | lack |
| T13079 | 16732-16736 | Negative_regulation | denotes | lack |
| T13080 | 16810-16815 | Protein | denotes | NleH1 |
| T13081 | 16825-16829 | Protein | denotes | RPS3 |
| T13082 | 16928-16933 | Protein | denotes | nleH1 |
| T13083 | 16935-16941 | Protein | denotes | ΔnleH1 |
| T13084 | 17003-17008 | Protein | denotes | NleH1 |
| T13085 | 16830-16845 | Phosphorylation | denotes | phosphorylation |
| T13086 | 16913-16920 | Negative_regulation | denotes | lacking |
| T13087 | 16913-16920 | Negative_regulation | denotes | lacking |
| T13088 | 16816-16824 | Negative_regulation | denotes | inhibits |
| T13089 | 17060-17063 | Protein | denotes | TNF |
| T13090 | 17107-17116 | Protein | denotes | RPS3 S209 |
| T13091 | 17117-17132 | Phosphorylation | denotes | phosphorylation |
| T13092 | 17095-17103 | Positive_regulation | denotes | increase |
| T13093 | 17180-17189 | Protein | denotes | RPS3 S209 |
| T13094 | 17190-17205 | Phosphorylation | denotes | phosphorylation |
| T13095 | 17224-17232 | Negative_regulation | denotes | impaired |
| T13096 | 17302-17305 | Protein | denotes | TNF |
| T13097 | 17314-17323 | Protein | denotes | RPS3 S209 |
| T13098 | 17385-17400 | Protein | denotes | ΔnleH1 or ΔescN |
| T13099 | 17402-17409 | Protein | denotes | Fig. 6d |
| T13100 | 17324-17339 | Phosphorylation | denotes | phosphorylation |
| T13101 | 17306-17313 | Positive_regulation | denotes | induced |
| T13102 | 17344-17354 | Negative_regulation | denotes | unimpaired |
| T13103 | 17457-17463 | Protein | denotes | ΔnleH1 |
| T13104 | 17467-17488 | Protein | denotes | ΔescN E. coli O157:H7 |
| T13105 | 17514-17517 | Protein | denotes | TNF |
| T13106 | 17526-17530 | Protein | denotes | RPS3 |
| T13107 | 17531-17538 | Entity | denotes | nuclear |
| T13108 | 17539-17553 | Localization | denotes | translocation9 |
| T13109 | 17518-17525 | Positive_regulation | denotes | induced |
| T13110 | 17503-17513 | Negative_regulation | denotes | attenuated |
| T13111 | 17503-17513 | Negative_regulation | denotes | attenuated |
| T13112 | 17576-17580 | Protein | denotes | RPS3 |
| T13113 | 17691-17696 | Protein | denotes | NF-κB |
| T13114 | 17728-17737 | Protein | denotes | RPS3 S209 |
| T13115 | 17581-17596 | Phosphorylation | denotes | phosphorylation |
| T13116 | 17605-17612 | Entity | denotes | nuclear |
| T13117 | 17613-17626 | Localization | denotes | translocation |
| T13118 | 17738-17753 | Phosphorylation | denotes | phosphorylation |
| T13119 | 17771-17778 | Entity | denotes | nuclear |
| T13120 | 17813-17818 | Protein | denotes | NleH1 |
| T13121 | 17828-17837 | Protein | denotes | RPS3 S209 |
| T13122 | 17891-17895 | Protein | denotes | RPS3 |
| T13123 | 17906-17911 | Protein | denotes | NF-κB |
| T13124 | 17944-17947 | Protein | denotes | IL8 |
| T13125 | 17949-17955 | Protein | denotes | NFKBIA |
| T13126 | 17961-17968 | Protein | denotes | TNFAIP3 |
| T13127 | 17838-17853 | Phosphorylation | denotes | phosphorylation |
| T13128 | 17924-17937 | Transcription | denotes | transcription |
| T13129 | 17924-17937 | Transcription | denotes | transcription |
| T13130 | 17924-17937 | Transcription | denotes | transcription |
| T13131 | 17924-17937 | Transcription | denotes | transcription |
| T13132 | 17819-17827 | Negative_regulation | denotes | inhibits |
| T13133 | 17884-17890 | Negative_regulation | denotes | blocks |
| T13134 | 17884-17890 | Negative_regulation | denotes | blocks |
| T13135 | 17884-17890 | Negative_regulation | denotes | blocks |
| T13136 | 17884-17890 | Negative_regulation | denotes | blocks |
| T13137 | 17896-17905 | Positive_regulation | denotes | dependent |
| T13138 | 17896-17905 | Positive_regulation | denotes | dependent |
| T13139 | 17896-17905 | Positive_regulation | denotes | dependent |
| T13140 | 17896-17905 | Positive_regulation | denotes | dependent |
| T13141 | 18185-18190 | Protein | denotes | nleH1 |
| T13142 | 18226-18230 | Protein | denotes | RPS3 |
| T13143 | 18260-18264 | Protein | denotes | CD25 |
| T13144 | 18269-18277 | Protein | denotes | TNFSF13B |
| T13145 | 18212-18222 | Gene_expression | denotes | expression |
| T13146 | 18212-18222 | Gene_expression | denotes | expression |
| T13147 | 18212-18222 | Gene_expression | denotes | expression |
| T13148 | 18343-18348 | Protein | denotes | NleH1 |
| T13149 | 18423-18432 | Protein | denotes | RPS3 S209 |
| T13150 | 18480-18500 | Protein | denotes | RPS3-dependent NF-κB |
| T13151 | 18433-18448 | Phosphorylation | denotes | phosphorylation |
| T13152 | 18461-18470 | Negative_regulation | denotes | impairing |
| T13153 | 18414-18422 | Negative_regulation | denotes | blocking |
| T14172 | 18531-18540 | Protein | denotes | RPS3 S209 |
| T14173 | 18541-18556 | Phosphorylation | denotes | phosphorylation |
| T14174 | 18522-18530 | Negative_regulation | denotes | inhibits |
| T14175 | 18771-18777 | Protein | denotes | ΔnleH1 |
| T14176 | 19007-19012 | Protein | denotes | NleH1 |
| T14177 | 19021-19030 | Protein | denotes | RPS3 S209 |
| T14178 | 19075-19079 | Protein | denotes | RPS3 |
| T14179 | 19031-19046 | Phosphorylation | denotes | phosphorylation |
| T14180 | 19080-19087 | Entity | denotes | nuclear |
| T14181 | 19088-19101 | Localization | denotes | translocation |
| T14182 | 19013-19020 | Negative_regulation | denotes | blocked |
| T14183 | 19064-19074 | Negative_regulation | denotes | preventing |
| T14184 | 19223-19227 | Protein | denotes | RPS3 |
| T14185 | 19361-19365 | Protein | denotes | RPS3 |
| T14186 | 19432-19436 | Protein | denotes | RPS3 |
| T14187 | 19437-19447 | Gene_expression | denotes | expression |
| T14188 | 19510-19515 | Protein | denotes | NleH1 |
| T14189 | 19525-19534 | Protein | denotes | RPS3 S209 |
| T14190 | 19535-19550 | Phosphorylation | denotes | phosphorylation |
| T14191 | 19516-19524 | Negative_regulation | denotes | inhibits |
| T16750 | 19647-19652 | Protein | denotes | NleH1 |
| T16751 | 19664-19668 | Protein | denotes | IKKβ |
| T16752 | 19693-19698 | Protein | denotes | NleH1 |
| T16753 | 19824-19829 | Protein | denotes | NleH1 |
| T16754 | 19839-19848 | Protein | denotes | RPS3 S209 |
| T16755 | 19938-19943 | Protein | denotes | NleH1 |
| T16756 | 20008-20013 | Protein | denotes | NleH1 |
| T16757 | 20056-20080 | Protein | denotes | NleH1 kinase-dead mutant |
| T16758 | 20082-20089 | Protein | denotes | Fig. 7a |
| T16759 | 19849-19864 | Phosphorylation | denotes | phosphorylation |
| T16760 | 20017-20035 | Phosphorylation | denotes | autophosphorylated |
| T16761 | 20017-20035 | Phosphorylation | denotes | autophosphorylated |
| T16762 | 20017-20035 | Phosphorylation | denotes | autophosphorylated |
| T16763 | 19830-19838 | Negative_regulation | denotes | inhibits |
| T16764 | 20147-20152 | Protein | denotes | NleH1 |
| T16765 | 20164-20168 | Protein | denotes | IKKβ |
| T16766 | 20188-20192 | Protein | denotes | RPS3 |
| T16767 | 20248-20259 | Protein | denotes | K159A NleH1 |
| T16768 | 20169-20184 | Phosphorylation | denotes | phosphorlyation |
| T16769 | 20169-20184 | Phosphorylation | denotes | phosphorlyation |
| T16770 | 20217-20227 | Gene_expression | denotes | expressing |
| T16771 | 20156-20163 | Negative_regulation | denotes | inhibit |
| T16772 | 20156-20163 | Negative_regulation | denotes | inhibit |
| T16773 | 20285-20290 | Protein | denotes | NleH1 |
| T16774 | 20324-20327 | Protein | denotes | TNF |
| T16775 | 20336-20345 | Protein | denotes | RPS3 S209 |
| T16776 | 20405-20412 | Protein | denotes | Fig. 7b |
| T16777 | 20291-20301 | Gene_expression | denotes | expression |
| T16778 | 20346-20361 | Phosphorylation | denotes | phosphorylation |
| T16779 | 20328-20335 | Positive_regulation | denotes | induced |
| T16780 | 20316-20323 | Negative_regulation | denotes | reduced |
| T16781 | 20420-20432 | Protein | denotes | NleH1 kinase |
| T16782 | 20465-20469 | Protein | denotes | RPS3 |
| T16783 | 20475-20479 | Protein | denotes | IKKβ |
| T16784 | 20489-20504 | Phosphorylation | denotes | phosphorylation |
| T16785 | 20635-20652 | Protein | denotes | C. rodentium NleH |
| T16786 | 20663-20667 | Protein | denotes | RPS3 |
| T16787 | 20694-20698 | Protein | denotes | RPS3 |
| T16788 | 20712-20725 | Protein | denotes | κB luciferase |
| T16789 | 20770-20775 | Protein | denotes | NleH1 |
| T16790 | 20668-20675 | Entity | denotes | nuclear |
| T16791 | 20676-20689 | Localization | denotes | translocation |
| T16792 | 20676-20689 | Localization | denotes | translocation |
| T16793 | 20653-20662 | Negative_regulation | denotes | inhibited |
| T16794 | 20653-20662 | Negative_regulation | denotes | inhibited |
| T16795 | 20797-20806 | Protein | denotes | RPS3 S209 |
| T16796 | 20807-20822 | Phosphorylation | denotes | phosphorylation |
| T16797 | 20904-20907 | Protein | denotes | TNF |
| T16798 | 20953-20962 | Protein | denotes | RPS3 S209 |
| T16799 | 20980-20987 | Protein | denotes | Fig. 7c |
| T16800 | 20963-20978 | Phosphorylation | denotes | phosphorylation |
| T16801 | 20941-20949 | Positive_regulation | denotes | increase |
| T16802 | 21011-21015 | Protein | denotes | RPS3 |
| T16803 | 21016-21031 | Phosphorylation | denotes | phosphorylation |
| T16804 | 20995-21007 | Positive_regulation | denotes | augmentation |
| T16805 | 21036-21043 | Negative_regulation | denotes | reduced |
| T16806 | 21113-21117 | Protein | denotes | RPS3 |
| T16807 | 21207-21228 | Protein | denotes | NleH (Fig. 7c, ΔnleH) |
| T16808 | 21118-21133 | Phosphorylation | denotes | phosphorylation |
| T16809 | 21138-21146 | Positive_regulation | denotes | enhanced |
| T16810 | 21199-21206 | Negative_regulation | denotes | lacking |
| T16811 | 21262-21274 | Protein | denotes | NleH1 kinase |
| T16812 | 21376-21395 | Protein | denotes | K159A E. coli NleH1 |
| T16813 | 21348-21355 | Gene_expression | denotes | express |
| T16814 | 21397-21423 | Protein | denotes | Complementing ΔnleH mutant |
| T16815 | 21462-21465 | Protein | denotes | TNF |
| T16816 | 21474-21483 | Protein | denotes | RPS3 S209 |
| T16817 | 21551-21555 | Protein | denotes | RPS3 |
| T16818 | 21573-21580 | Protein | denotes | Fig. 7c |
| T16819 | 21484-21499 | Phosphorylation | denotes | phosphorylation |
| T16820 | 21556-21571 | Phosphorylation | denotes | phosphorylation |
| T16821 | 21556-21571 | Phosphorylation | denotes | phosphorylation |
| T16822 | 21466-21473 | Positive_regulation | denotes | induced |
| T16823 | 21543-21550 | Negative_regulation | denotes | inhibit |
| T16824 | 21543-21550 | Negative_regulation | denotes | inhibit |
| T16825 | 21452-21461 | Negative_regulation | denotes | abolished |
| T16826 | 21628-21640 | Protein | denotes | NleH1 kinase |
| T16827 | 21671-21675 | Protein | denotes | RPS3 |
| T16828 | 21676-21680 | Protein | denotes | S209 |
| T16829 | 21681-21696 | Phosphorylation | denotes | phosphorylation |
| T16830 | 21681-21696 | Phosphorylation | denotes | phosphorylation |
| T16831 | 21665-21670 | Negative_regulation | denotes | block |
| T16832 | 21665-21670 | Negative_regulation | denotes | block |
| T16833 | 21750-21755 | Protein | denotes | NleH1 |
| T16834 | 21825-21829 | Protein | denotes | RPS3 |
| T16835 | 21867-21871 | Protein | denotes | IKKβ |
| T16836 | 21873-21877 | Protein | denotes | IKKβ |
| T16837 | 21800-21807 | Entity | denotes | nuclear |
| T16838 | 21808-21821 | Localization | denotes | translocation |
| T16839 | 21782-21788 | Negative_regulation | denotes | impair |
| T16840 | 21954-21972 | Protein | denotes | SSEE IKKβ proteins |
| T16841 | 21989-21993 | Protein | denotes | RPS3 |
| T16842 | 22037-22041 | Protein | denotes | IKKβ |
| T16843 | 21923-21933 | Gene_expression | denotes | expressing |
| T16844 | 21994-22001 | Entity | denotes | nuclear |
| T16845 | 22002-22015 | Localization | denotes | translocation |
| T16846 | 22002-22015 | Localization | denotes | translocation |
| T16847 | 22068-22072 | Protein | denotes | RPS3 |
| T16848 | 22073-22080 | Entity | denotes | nuclear |
| T16849 | 22081-22093 | Localization | denotes | accumulation |
| T16850 | 22264-22268 | Protein | denotes | RPS3 |
| T16851 | 22301-22314 | Protein | denotes | IKKβ- or IKKβ |
| T16852 | 22316-22320 | Protein | denotes | SSEE |
| T16853 | 22269-22276 | Entity | denotes | nuclear |
| T16854 | 22277-22290 | Localization | denotes | translocation |
| T16855 | 22321-22332 | Gene_expression | denotes | -expressing |
| T16856 | 22321-22332 | Gene_expression | denotes | -expressing |
| T16857 | 22255-22263 | Negative_regulation | denotes | impaired |
| T16858 | 22401-22405 | Protein | denotes | RPS3 |
| T16859 | 22431-22435 | Protein | denotes | IKKβ |
| T16860 | 22467-22472 | Protein | denotes | NF-κB |
| T16861 | 22406-22413 | Entity | denotes | nuclear |
| T16862 | 22414-22427 | Localization | denotes | translocation |
| T16863 | 22442-22453 | Gene_expression | denotes | -expressing |
| T16864 | 22390-22396 | Regulation | denotes | affect |
| T16865 | 22565-22569 | Protein | denotes | RPS3 |
| T16866 | 22642-22646 | Protein | denotes | IKKβ |
| T16867 | 22570-22577 | Entity | denotes | nuclear |
| T16868 | 22578-22591 | Localization | denotes | translocation |
| T16869 | 22606-22616 | Gene_expression | denotes | expressing |
| T16870 | 22557-22564 | Negative_regulation | denotes | inhibit |
| T16871 | 22668-22673 | Protein | denotes | NleH1 |
| T16872 | 22703-22707 | Protein | denotes | IKKβ |
| T16873 | 22724-22728 | Protein | denotes | IKKβ |
| T16874 | 22738-22742 | Protein | denotes | RPS3 |
| T16875 | 22743-22747 | Protein | denotes | S209 |
| T16876 | 22689-22702 | Phosphorylation | denotes | phosphorylate |
| T16877 | 22748-22763 | Phosphorylation | denotes | phosphorylation |
| T16878 | 22748-22763 | Phosphorylation | denotes | phosphorylation |
| T16879 | 22713-22723 | Negative_regulation | denotes | inhibiting |
| T16880 | 22713-22723 | Negative_regulation | denotes | inhibiting |
| T16881 | 22729-22737 | Positive_regulation | denotes | mediated |
| T16882 | 22729-22737 | Positive_regulation | denotes | mediated |
| T16883 | 22826-22830 | Protein | denotes | Flag |
| T16884 | 22831-22835 | Protein | denotes | IKKβ |
| T16885 | 22876-22881 | Protein | denotes | NleH1 |
| T16886 | 22901-22905 | Protein | denotes | IKKβ |
| T16887 | 22906-22925 | Phosphorylation | denotes | autophosphorylation |
| T16888 | 22958-22973 | Phosphorylation | denotes | phosphorylation |
| T16889 | 22958-22973 | Phosphorylation | denotes | phosphorylation |
| T16890 | 23039-23043 | Protein | denotes | IKKβ |
| T16891 | 23138-23143 | Protein | denotes | NleH1 |
| T16892 | 23160-23164 | Protein | denotes | IKKβ |
| T16893 | 23250-23253 | Protein | denotes | CK2 |
| T16894 | 23258-23261 | Protein | denotes | IKK |
| T16895 | 23277-23281 | Protein | denotes | IKKβ |
| T16896 | 23296-23300 | Protein | denotes | IKKβ |
| T16897 | 23316-23320 | Protein | denotes | RPS3 |
| T16898 | 23322-23325 | Protein | denotes | Fig |
| T16899 | 23343-23366 | Protein | denotes | GST-IκBα (1-54) protein |
| T16900 | 23368-23371 | Protein | denotes | Fig |
| T16901 | 23418-23421 | Protein | denotes | CK2 |
| T16902 | 23425-23428 | Protein | denotes | IKK |
| T16903 | 23301-23315 | Phosphorylation | denotes | phosphorylated |
| T16904 | 23301-23315 | Phosphorylation | denotes | phosphorylated |
| T16905 | 23301-23315 | Phosphorylation | denotes | phosphorylated |
| T16906 | 23301-23315 | Phosphorylation | denotes | phosphorylated |
| T16907 | 23469-23473 | Protein | denotes | IKKβ |
| T16908 | 23479-23484 | Protein | denotes | NleH1 |
| T16909 | 23493-23497 | Protein | denotes | IKKβ |
| T16910 | 23507-23511 | Protein | denotes | RPS3 |
| T16911 | 23538-23548 | Protein | denotes | CK2 kinase |
| T16920 | 23498-23506 | Positive_regulation | denotes | mediated |
| T16921 | 23575-23583 | Positive_regulation | denotes | mediated |
| T16922 | 23575-23583 | Positive_regulation | denotes | mediated |
| T16923 | 23685-23690 | Protein | denotes | NleH1 |
| T16924 | 23742-23746 | Protein | denotes | RPS3 |
| T16925 | 23750-23758 | Protein | denotes | GST-IκBα |
| T16926 | 23760-23767 | Protein | denotes | Fig. 7e |
| T16927 | 23700-23715 | Phosphorylation | denotes | phosphorylation |
| T16928 | 23700-23715 | Phosphorylation | denotes | phosphorylation |
| T16929 | 23700-23715 | Phosphorylation | denotes | phosphorylation |
| T16930 | 23700-23715 | Phosphorylation | denotes | phosphorylation |
| T16931 | 23719-23738 | Phosphorylation | denotes | autophosphorylation |
| T17276 | 23719-23738 | Phosphorylation | denotes | autophosphorylation |
| T17277 | 23719-23738 | Phosphorylation | denotes | autophosphorylation |
| T17278 | 23786-23791 | Protein | denotes | NleH1 |
| T17279 | 23803-23806 | Protein | denotes | CK2 |
| T17280 | 23832-23836 | Protein | denotes | IKKβ |
| T17281 | 23857-23861 | Protein | denotes | IKKβ |
| T17282 | 23871-23880 | Protein | denotes | RPS3 S209 |
| T17283 | 23881-23896 | Phosphorylation | denotes | phosphorylation |
| T17284 | 23842-23852 | Negative_regulation | denotes | inhibiting |
| T17285 | 23862-23870 | Positive_regulation | denotes | mediated |
| T19641 | 24005-24009 | Protein | denotes | RPS3 |
| T19642 | 24084-24113 | Protein | denotes | NF-κB regulatory specificity6 |
| T19643 | 24073-24083 | Positive_regulation | denotes | conferring |
| T19644 | 24147-24152 | Protein | denotes | NF-κB |
| T19645 | 24183-24187 | Protein | denotes | RPS3 |
| T19646 | 24222-24227 | Protein | denotes | NF-κB |
| T19647 | 24273-24277 | Protein | denotes | IKKβ |
| T19648 | 24287-24296 | Protein | denotes | RPS3 S209 |
| T19649 | 24419-24424 | Protein | denotes | NF-κB |
| T19650 | 24297-24312 | Phosphorylation | denotes | phosphorylation |
| T19651 | 24364-24371 | Entity | denotes | nuclear |
| T19652 | 24278-24286 | Positive_regulation | denotes | mediated |
| T19653 | 24449-24453 | Protein | denotes | IKKβ |
| T19654 | 24494-24498 | Protein | denotes | IκBs |
| T19655 | 24516-24521 | Protein | denotes | NF-κB |
| T19656 | 24479-24493 | Phosphorylation | denotes | phosphorylates |
| T19657 | 24479-24493 | Phosphorylation | denotes | phosphorylates |
| T19658 | 24559-24572 | Protein_catabolism | denotes | degradation40 |
| T19659 | 24559-24572 | Protein_catabolism | denotes | degradation40 |
| T19660 | 24586-24590 | Protein | denotes | RPS3 |
| T19661 | 24710-24720 | Protein | denotes | human IKKβ |
| T19662 | 24731-24734 | Protein | denotes | CK2 |
| T19663 | 24815-24819 | Protein | denotes | IKKβ |
| T19664 | 24829-24833 | Protein | denotes | IKKα |
| T19665 | 24850-24854 | Protein | denotes | RPS3 |
| T19666 | 24740-24755 | Phosphorylation | denotes | phosphorylation |
| T19667 | 24740-24755 | Phosphorylation | denotes | phosphorylation |
| T19668 | 24835-24849 | Phosphorylation | denotes | phosphorylated |
| T19669 | 24835-24849 | Phosphorylation | denotes | phosphorylated |
| T19670 | 24835-24849 | Phosphorylation | denotes | phosphorylated |
| T19671 | 24915-24919 | Protein | denotes | RPS3 |
| T19672 | 24947-24957 | Protein | denotes | importin-α |
| T19673 | 24986-24991 | Protein | denotes | NF-κB |
| T19674 | 24920-24927 | Entity | denotes | nuclear |
| T19675 | 24928-24941 | Localization | denotes | translocation |
| T19676 | 24992-25005 | Transcription | denotes | transcription |
| T19677 | 24900-24910 | Regulation | denotes | modulation |
| T19678 | 25007-25010 | Protein | denotes | CK2 |
| T19679 | 25049-25052 | Protein | denotes | p65 |
| T19680 | 25144-25148 | Protein | denotes | IKKβ |
| T19681 | 25155-25158 | Protein | denotes | CK2 |
| T19682 | 25190-25194 | Protein | denotes | RPS3 |
| T19683 | 25222-25225 | Protein | denotes | CK2 |
| T19684 | 25246-25250 | Protein | denotes | IKKβ |
| T19685 | 25035-25048 | Phosphorylation | denotes | phosphorylate |
| T19686 | 25060-25064 | Binding | denotes | bind |
| T19687 | 25149-25154 | Binding | denotes | bound |
| T19688 | 25149-25154 | Binding | denotes | bound |
| T19689 | 25195-25210 | Phosphorylation | denotes | phosphorylation |
| T19690 | 25230-25238 | Gene_expression | denotes | detected |
| T19691 | 25165-25172 | Positive_regulation | denotes | account |
| T19692 | 25308-25312 | Protein | denotes | RPS3 |
| T19693 | 25330-25339 | Protein | denotes | CK2 motif |
| T19694 | 25378-25382 | Protein | denotes | RPS3 |
| T19695 | 25421-25424 | Protein | denotes | IKK |
| T19696 | 25459-25474 | Phosphorylation | denotes | phosphorylation |
| T19697 | 25534-25538 | Protein | denotes | RPS3 |
| T19698 | 25572-25577 | Protein | denotes | NF-κB |
| T19699 | 25687-25691 | Protein | denotes | IKKβ |
| T19700 | 25701-25710 | Protein | denotes | RPS3 S209 |
| T19701 | 25791-25796 | Protein | denotes | NF-κB |
| T19702 | 25711-25726 | Phosphorylation | denotes | phosphorylation |
| T19703 | 25692-25700 | Positive_regulation | denotes | mediated |
| T19704 | 25831-25836 | Protein | denotes | NleH1 |
| T19705 | 25859-25863 | Protein | denotes | RPS3 |
| T19706 | 25920-25925 | Protein | denotes | NF-κB |
| T19707 | 25850-25855 | Binding | denotes | binds |
| T19708 | 25909-25919 | Negative_regulation | denotes | suppresses |
| T19709 | 25997-26002 | Protein | denotes | NleH1 |
| T19710 | 26024-26028 | Protein | denotes | RPS3 |
| T19711 | 26102-26107 | Protein | denotes | NF-κB |
| T19712 | 26141-26146 | Protein | denotes | NF-κB |
| T19713 | 26029-26044 | Phosphorylation | denotes | phosphorylation |
| T19714 | 26073-26086 | Localization | denotes | translocation |
| T19715 | 26073-26086 | Localization | denotes | translocation |
| T19716 | 26015-26023 | Negative_regulation | denotes | inhibits |
| T19717 | 26167-26180 | Protein | denotes | NleH1 did not |
| T19718 | 26204-26208 | Protein | denotes | IKKβ |
| T19719 | 26254-26258 | Protein | denotes | IKKβ |
| T19720 | 26268-26272 | Protein | denotes | RPS3 |
| T19721 | 26273-26277 | Protein | denotes | S209 |
| T19722 | 26190-26203 | Phosphorylation | denotes | phosphorylate |
| T19723 | 26190-26203 | Phosphorylation | denotes | phosphorylate |
| T19724 | 26278-26293 | Phosphorylation | denotes | phosphorylation |
| T19725 | 26278-26293 | Phosphorylation | denotes | phosphorylation |
| T19726 | 26246-26253 | Negative_regulation | denotes | inhibit |
| T19727 | 26246-26253 | Negative_regulation | denotes | inhibit |
| T19728 | 26259-26267 | Positive_regulation | denotes | mediated |
| T19729 | 26259-26267 | Positive_regulation | denotes | mediated |
| T19730 | 26338-26356 | Protein | denotes | target key kinases |
| T19731 | 26424-26429 | Protein | denotes | NleH1 |
| T19732 | 26468-26472 | Protein | denotes | IKKβ |
| T19733 | 26508-26513 | Protein | denotes | NF-κB |
| T19734 | 26324-26332 | Gene_expression | denotes | products |
| T19735 | 26581-26586 | Protein | denotes | NF-κB |
| T19736 | 26739-26744 | Protein | denotes | NleH1 |
| T19737 | 26777-26781 | Protein | denotes | RPS3 |
| T19738 | 26806-26811 | Protein | denotes | NF-κB |
| T19739 | 26911-26914 | Protein | denotes | IL8 |
| T19740 | 26919-26922 | Protein | denotes | TNF |
| T19741 | 26760-26773 | Transcription | denotes | transcription |
| T19742 | 26760-26773 | Transcription | denotes | transcription |
| T19743 | 26760-26773 | Transcription | denotes | transcription |
| T19744 | 26937-26942 | Protein | denotes | NleH1 |
| T19745 | 26958-26963 | Protein | denotes | NF-κB |
| T19746 | 26964-26967 | Protein | denotes | p65 |
| T19747 | 27037-27041 | Protein | denotes | RPS3 |
| T19748 | 27054-27059 | Protein | denotes | NF-κB |
| T19749 | 26968-26975 | Entity | denotes | nuclear |
| T19750 | 26976-26989 | Localization | denotes | translocation |
| T19751 | 26976-26989 | Localization | denotes | translocation |
| T19752 | 26952-26957 | Negative_regulation | denotes | block |
| T19753 | 26952-26957 | Negative_regulation | denotes | block |
| T19754 | 27186-27190 | Protein | denotes | RPS3 |
| T19755 | 27209-27214 | Protein | denotes | NF-κB |
| T19756 | 27229-27234 | Protein | denotes | NleH1 |
| T19757 | 27175-27185 | Negative_regulation | denotes | inhibiting |
| T19758 | 27175-27185 | Negative_regulation | denotes | inhibiting |
| T19759 | 27175-27185 | Negative_regulation | denotes | inhibiting |
| T19760 | 27793-27798 | Protein | denotes | NF-κB |
| T19761 | 27830-27834 | Protein | denotes | RPS3 |
| T19762 | 27853-27856 | Protein | denotes | p65 |
| T19763 | 27857-27864 | Entity | denotes | nuclear |
| T19764 | 27865-27878 | Localization | denotes | translocation |
| T19765 | 27844-27852 | Regulation | denotes | altering |
| T19766 | 28080-28085 | Protein | denotes | NF-κB |
| T19767 | 28136-28140 | Protein | denotes | RPS3 |
| T19768 | 28163-28168 | Protein | denotes | NF-κB |
| T19769 | 28169-28179 | Negative_regulation | denotes | inhibition |
| T20471 | 28423-28426 | Protein | denotes | p65 |
| T20472 | 28428-28432 | Protein | denotes | C-20 |
| T20473 | 28587-28653 | Protein | denotes | importin-α (IM-75, I1784), and importin-β (31H4, I2534) antibodies |
| T20474 | 28671-28675 | Protein | denotes | PARP |
| T20475 | 28795-28824 | Protein | denotes | Hsp90 (68, 610418) antibodies |
| T20476 | 28895-28934 | Protein | denotes | phospho-IKKα/β (16A6, 2697S) antibodies |
| T20477 | 29075-29100 | Protein | denotes | polyclonal RPS3 antiserum |
| T20478 | 29175-29179 | Protein | denotes | S209 |
| T20479 | 29195-29199 | Protein | denotes | RPS3 |
| T20480 | 29180-29194 | Phosphorylation | denotes | phosphorylated |
| T20481 | 29180-29194 | Phosphorylation | denotes | phosphorylated |
| T20770 | 29321-29330 | Protein | denotes | Flag-IKKβ |
| T20771 | 29332-29336 | Protein | denotes | SSEE |
| T20772 | 29339-29343 | Protein | denotes | Flag |
| T20773 | 29344-29348 | Protein | denotes | IKKβ |
| T20774 | 29361-29368 | Protein | denotes | HA-IκBα |
| T20775 | 29370-29374 | Protein | denotes | SSAA |
| T20776 | 29481-29488 | Protein | denotes | HA-IκBα |
| T20777 | 29493-29497 | Protein | denotes | IKKβ |
| T20778 | 29558-29562 | Protein | denotes | Flag |
| T20779 | 29563-29567 | Protein | denotes | RPS3 |
| T20780 | 29569-29572 | Protein | denotes | GST |
| T20781 | 29573-29577 | Protein | denotes | RPS3 |
| T20782 | 29579-29581 | Protein | denotes | HA |
| T20783 | 29582-29586 | Protein | denotes | RPS3 |
| T20784 | 29588-29590 | Protein | denotes | VN |
| T20785 | 29591-29593 | Protein | denotes | HA |
| T20786 | 29595-29603 | Protein | denotes | NleH1-HA |
| T20787 | 29665-29669 | Protein | denotes | RPS3 |
| T20974 | 30115-30118 | Protein | denotes | TNF |
| T20975 | 30232-30236 | Protein | denotes | RPS3 |
| T21328 | 30251-30263 | Protein | denotes | Vitro Kinase |
| T21329 | 30270-30300 | Protein | denotes | Kinase-active recombinant IKKβ |
| T21330 | 30305-30318 | Protein | denotes | IKKα proteins |
| T21331 | 30402-30427 | Protein | denotes | glutathione S-transferase |
| T21332 | 30429-30432 | Protein | denotes | GST |
| T21333 | 30470-30473 | Protein | denotes | GST |
| T21334 | 30474-30478 | Protein | denotes | RPS3 |
| T21335 | 30483-30496 | Protein | denotes | RPS3 proteins |
| T21336 | 30762-30767 | Protein | denotes | NleH1 |
| T21521 | 31002-31005 | Protein | denotes | GST |
| T21522 | 31009-31012 | Protein | denotes | GST |
| T21523 | 31013-31017 | Protein | denotes | RPS3 |
| T21524 | 31037-31061 | Protein | denotes | recombinant IKKβ protein |
| T21525 | 31328-31335 | Protein | denotes | trypsin |
| T21691 | 31430-31434 | Protein | denotes | RNAi |
| T21692 | 31439-31451 | Gene_expression | denotes | Transfection |
| T21693 | 31439-31451 | Positive_regulation | denotes | Transfection |
| T21694 | 31486-31490 | Protein | denotes | IKKα |
| T21695 | 31526-31530 | Protein | denotes | IKKβ |
| T21696 | 31566-31570 | Protein | denotes | IκBα |
| T21697 | 31606-31610 | Protein | denotes | RPS3 |
| T22187 | 32510-32520 | Protein | denotes | Luciferase |
| T22188 | 32542-32552 | Protein | denotes | Luciferase |
| T22189 | 32697-32726 | Protein | denotes | firefly luciferase constructs |
| T22190 | 32734-32758 | Protein | denotes | Renilla luciferase pTKRL |
| T22191 | 32917-32936 | Protein | denotes | Dual-Luciferase Kit |
| T22192 | 32938-32945 | Protein | denotes | Promega |
| T22193 | 32907-32912 | Gene_expression | denotes | using |
| T22194 | 32907-32912 | Gene_expression | denotes | using |
| T22309 | 32949-32958 | Protein | denotes | Chromatin |
| T22310 | 33102-33110 | Protein | denotes | κB sites |
| T22311 | 33114-33117 | Protein | denotes | IL8 |
| T22312 | 33122-33128 | Protein | denotes | NFKBIA |
| T22313 | 33141-33145 | Protein | denotes | ACTB |
| T22314 | 33079-33085 | Entity | denotes | region |
| T22536 | 33474-33478 | Protein | denotes | RPS3 |
| T23086 | 33965-33971 | Protein | denotes | mM NaF |
| T23087 | 34035-34050 | Protein | denotes | 1 × phosphatase |
| T23088 | 34902-34915 | Protein | denotes | serum albumin |
| T23177 | 35151-35155 | Protein | denotes | IL-8 |
| T23331 | 35629-35637 | Protein | denotes | paraffin |
| T23332 | 35706-35710 | Protein | denotes | RPS3 |
| T23333 | 35738-35751 | Protein | denotes | Histoserv Inc |
| T13036 | 15812-15816 | Protein | denotes | RPS3 |
| T1676 | 2932-2939 | Entity | denotes | nuclear |
| T16912 | 23570-23574 | Protein | denotes | IKKβ |
| T16913 | 23584-23587 | Protein | denotes | GST |
| T16914 | 23588-23592 | Protein | denotes | IκBα |
| T16915 | 23619-23629 | Protein | denotes | IKK kinase |
| T16916 | 23643-23650 | Protein | denotes | Fig. 7e |
| T16917 | 23512-23527 | Phosphorylation | denotes | phosphorylation |
| T16918 | 23593-23608 | Phosphorylation | denotes | phosphorylation |
| T16919 | 23593-23608 | Phosphorylation | denotes | phosphorylation |
| T11191 | 13324-13339 | Binding | denotes | complementation |
| T11192 | 13324-13339 | Binding | denotes | complementation |
| T11193 | 13127-13131 | Positive_regulation | denotes | role |
| T11194 | 13127-13131 | Positive_regulation | denotes | role |
| T11195 | 13198-13206 | Positive_regulation | denotes | silenced |
| T11196 | 13254-13261 | Regulation | denotes | targets |
| T11197 | 13254-13261 | Regulation | denotes | targets |
| T11198 | 13414-13424 | Protein | denotes | RPS3 siRNA |
| T11199 | 13453-13457 | Protein | denotes | RPS3 |
| T11200 | 13480-13488 | Protein | denotes | NS siRNA |
| T11201 | 13534-13538 | Protein | denotes | Flag |
| T11202 | 13546-13550 | Protein | denotes | RPS3 |
| R395 | T499 | T502 | themeOf | IKKβ,phosphorylation |
| R396 | T500 | T504 | themeOf | RPS3,translocation |
| R397 | T502 | T505 | causeOf | phosphorylation,regulates |
| R398 | T503 | T504 | locationOf | nuclear,translocation |
| R399 | T504 | T505 | themeOf | translocation,regulates |
| R400 | T510 | T512 | themeOf | RPS3,translocation |
| R401 | T511 | T512 | locationOf | nuclear,translocation |
| R402 | T512 | T513 | themeOf | translocation,regulated |
| R403 | T514 | T516 | themeOf | IKKβ,phosphorylation |
| R404 | T515 | T518 | themeOf | RPS3,localization |
| R405 | T516 | T519 | causeOf | phosphorylation,crucial |
| R406 | T517 | T518 | locationOf | nuclear,localization |
| R407 | T518 | T519 | themeOf | localization,crucial |
| R408 | T521 | T523 | themeOf | RPS3 S209,phosphorylation |
| R409 | T522 | T524 | themeOf | RPS3,blocked |
| R410 | T523 | T525 | themeOf | phosphorylation,inhibited |
| R411 | T528 | T529 | themeOf | NF-κB,promotes |
| R1353 | T1676 | T1677 | locationOf | nuclear,translocation |
| R1354 | T1676 | T1678 | locationOf | nuclear,translocation |
| R1355 | T1680 | T1684 | causeOf | coli NleH1 effector,inhibited |
| R1356 | T1681 | T1684 | themeOf | RPS3 S209,inhibited |
| R1371 | T1629 | T1632 | themeOf | RPS3,regulation |
| R1373 | T1630 | T1633 | themeOf | NF-κB,regulation |
| R1375 | T1631 | T1634 | themeOf | immunoglobulin κ light chain gene,expression |
| R1377 | T1635 | T1640 | themeOf | NleH1,secretion |
| R1378 | T1636 | T1641 | themeOf | NF-κB,transcription |
| R1379 | T1637 | T1643 | themeOf | RPS3,translocation |
| R1382 | T1642 | T1643 | locationOf | nuclear,translocation |
| R1383 | T1643 | T1644 | themeOf | translocation,attenuating |
| R1386 | T1646 | T1649 | themeOf | RPS3,translocation |
| R1387 | T1648 | T1649 | locationOf | nuclear,translocation |
| R1388 | T1649 | T1650 | themeOf | translocation,induce |
| R1391 | T1653 | T1654 | themeOf | RPS3,phosphorylated |
| R1392 | T1655 | T1658 | themeOf | NF-κB,regulation |
| R1393 | T1656 | T1659 | themeOf | RPS3,phosphorylated |
| R1394 | T1657 | T1660 | themeOf | NF-κB,activation |
| R1397 | T1662 | T1665 | themeOf | κB (IκB) kinase beta,Inhibitor |
| R1398 | T1662 | T1667 | partOf | κB (IκB) kinase beta,serine |
| R1399 | T1663 | T1666 | themeOf | IKKβ,Inhibitor |
| R1400 | T1663 | T1667 | partOf | IKKβ,serine |
| R1402 | T1664 | T1668 | themeOf | RPS3,phosphorylated |
| R1403 | T1664 | T1667 | partOf | RPS3,serine |
| R1405 | T1667 | T1668 | Site | serine,phosphorylated |
| R1406 | T1669 | T1673 | themeOf | RPS3 S209,phosphorylation |
| R1407 | T1670 | T1674 | themeOf | importin-α,association |
| R1409 | T1671 | T1675 | themeOf | RPS3,mediating |
| R1410 | T1671 | T1677 | themeOf | RPS3,translocation |
| R1411 | T1672 | T1678 | themeOf | karyopherin,translocation |
| R1412 | T1673 | T1679 | causeOf | phosphorylation,enhanced |
| R1415 | T1674 | T1679 | themeOf | association,enhanced |
| R1893 | T2366 | T2368 | themeOf | RPS3,phosphorylation |
| R1894 | T2367 | T2369 | themeOf | NF-κB,activation |
| R1895 | T2368 | T2370 | themeOf | phosphorylation,activation |
| R1896 | T2369 | T2371 | themeOf | activation,response |
| R1897 | T2370 | T2372 | themeOf | activation,response |
| R1898 | T2373 | T2378 | themeOf | RPS3,phosphorylated |
| R1899 | T2374 | T2379 | themeOf | NF-κB,activation |
| R1900 | T2380 | T2384 | themeOf | RPS3,phosphorylated |
| R1901 | T2381 | T2385 | themeOf | TNF,stimulation |
| R1902 | T2382 | T2386 | themeOf | RPS3 protein,increase |
| R1903 | T2383 | T2387 | themeOf | Fig. 1a,increase |
| R1904 | T2388 | T2390 | themeOf | RPS3,phosphorylated |
| R1905 | T2391 | T2399 | causeOf | TNF,stimulated |
| R1906 | T2391 | T2400 | causeOf | TNF,stimulated |
| R1907 | T2392 | T2394 | themeOf | IκBα,phosphorylation |
| R1908 | T2392 | T2395 | themeOf | IκBα,degradaion |
| R1909 | T2393 | T2396 | themeOf | RPS3,phosphorylation |
| R1910 | T2394 | T2397 | themeOf | phosphorylation,stimulated |
| R1911 | T2394 | T2399 | themeOf | phosphorylation,stimulated |
| R1912 | T2395 | T2398 | themeOf | degradaion,stimulated |
| R1913 | T2395 | T2400 | themeOf | degradaion,stimulated |
| R1914 | T2401 | T2403 | themeOf | RPS3,threonine-phosphorylation |
| R2424 | T3050 | T3055 | themeOf | κB kinase,inhibitor |
| R2425 | T3051 | T3056 | themeOf | IKK,inhibitor |
| R2426 | T3052 | T3057 | themeOf | subunit IKKγ,consisting |
| R2427 | T3053 | T3058 | themeOf | IKKα,consisting |
| R2428 | T3054 | T3059 | themeOf | IKKβ,consisting |
| R2429 | T3055 | T3060 | themeOf | inhibitor,activation |
| R2430 | T3056 | T3061 | themeOf | inhibitor,activation |
| R2431 | T3057 | T3062 | themeOf | consisting,inhibitor |
| R2432 | T3058 | T3063 | themeOf | consisting,inhibitor |
| R2433 | T3059 | T3064 | themeOf | consisting,inhibitor |
| R2434 | T3065 | T3071 | themeOf | RPS3,found |
| R2435 | T3068 | T3071 | themeOf | IκBα,found |
| R2436 | T3069 | T3072 | themeOf | IKKβ,activated |
| R2437 | T3069 | T3073 | themeOf | IKKβ,bind |
| R2438 | T3069 | T3074 | themeOf | IKKβ,phosphorylate |
| R2439 | T3070 | T3075 | themeOf | RPS3,phosphorylate |
| R2440 | T3076 | T3079 | themeOf | IKKβ,expressed |
| R2441 | T3076 | T3081 | themeOf | IKKβ,interacted |
| R2442 | T3077 | T3080 | themeOf | RPS3,expressed |
| R2443 | T3077 | T3082 | themeOf | RPS3,interacted |
| R2444 | T3078 | T3083 | themeOf | Fig. 1c,interacted |
| R2445 | T3084 | T3087 | themeOf | IKKβ,interaction |
| R2446 | T3085 | T3087 | themeOf | RPS3,interaction |
| R2447 | T3086 | T3088 | themeOf | NF-κB,transcription |
| R2448 | T3092 | T3094 | themeOf | RPS3,phosphorylation |
| R2449 | T3092 | T3093 | partOf | RPS3,serine |
| R2450 | T3093 | T3094 | Site | serine,phosphorylation |
| R2451 | T3095 | T3098 | themeOf | RPS3,interaction |
| R2452 | T3096 | T3098 | themeOf | IKKα,interaction |
| R3428 | T4274 | T4278 | causeOf | IKKβ,required |
| R3429 | T4275 | T4277 | themeOf | RPS3,translocation |
| R3430 | T4276 | T4277 | locationOf | nuclear,translocation |
| R3431 | T4277 | T4278 | themeOf | translocation,required |
| R3432 | T4279 | T4285 | themeOf | RPS3,interaction |
| R3433 | T4280 | T4285 | themeOf | IKKβ,interaction |
| R3434 | T4281 | T4287 | themeOf | RPS3,translocation |
| R3435 | T4282 | T4288 | themeOf | IKKα,expression |
| R3436 | T4283 | T4289 | themeOf | IKKβ,expression |
| R3437 | T4284 | T4291 | themeOf | RPS3,migration |
| R3438 | T4285 | T4292 | causeOf | interaction,required |
| R3439 | T4286 | T4287 | locationOf | nuclear,translocation |
| R3440 | T4287 | T4292 | themeOf | translocation,required |
| R3441 | T4290 | T4291 | locationOf | nuclear,migration |
| R3442 | T4291 | T4293 | themeOf | migration,stimulation-induced |
| R3443 | T4294 | T4298 | themeOf | TNF,translocation |
| R3444 | T4295 | T4299 | themeOf | PMA+I,translocation |
| R3445 | T4296 | T4300 | themeOf | RPS3,translocation |
| R3446 | T4297 | T4298 | locationOf | nuclear,translocation |
| R3447 | T4297 | T4299 | locationOf | nuclear,translocation |
| R3448 | T4297 | T4300 | locationOf | nuclear,translocation |
| R3449 | T4301 | T4304 | themeOf | RPS3,translocation |
| R3450 | T4302 | T4305 | themeOf | IKKα,silencing |
| R3451 | T4303 | T4304 | locationOf | nuclear,translocation |
| R3452 | T4306 | T4309 | themeOf | IKKβ,knockdown |
| R3453 | T4307 | T4311 | themeOf | RPS3,accumulation |
| R3454 | T4309 | T4312 | causeOf | knockdown,attenuated |
| R3455 | T4310 | T4311 | locationOf | nuclear,accumulation |
| R3456 | T4311 | T4312 | themeOf | accumulation,attenuated |
| R3457 | T4313 | T4316 | themeOf | IKKβ,expression |
| R3458 | T4314 | T4317 | themeOf | IKKα,expression |
| R3459 | T4315 | T4319 | themeOf | RPS3,translocation |
| R3460 | T4318 | T4319 | locationOf | nuclear,translocation |
| R3461 | T4319 | T4320 | themeOf | translocation,activation-induced |
| R3462 | T4321 | T4323 | themeOf | p65,translocation |
| R3463 | T4322 | T4323 | locationOf | nuclear,translocation |
| R3464 | T4323 | T4324 | themeOf | translocation,blocked |
| R3465 | T4325 | T4328 | themeOf | RPS3,translocation |
| R3466 | T4326 | T4329 | themeOf | IKKβ,expressing |
| R3467 | T4327 | T4328 | locationOf | nuclear,translocation |
| R3468 | T4332 | T4333 | themeOf | luciferase,induced |
| R3469 | T4334 | T4344 | themeOf | RPS3,translocated |
| R3470 | T4335 | T4339 | themeOf | IKKβ,-expressing |
| R3471 | T4336 | T4340 | themeOf | RPS3,proportion |
| R3472 | T4337 | T4342 | themeOf | IKKβ,expressing |
| R3473 | T4338 | T4343 | themeOf | SSEE,expressing |
| R3474 | T4341 | T4344 | locationOf | nucleus,translocated |
| R3475 | T4345 | T4348 | themeOf | IKKβ,-expressing |
| R3476 | T4346 | T4349 | themeOf | SSEE,-expressing |
| R3477 | T4347 | T4350 | themeOf | IKKβ,-expressing |
| R3478 | T4350 | T4351 | themeOf | -expressing,increased |
| R3479 | T4353 | T4356 | themeOf | RPS3,translocation |
| R3480 | T4355 | T4356 | locationOf | nuclear,translocation |
| R3481 | T4356 | T4357 | themeOf | translocation,necessary |
| R5010 | T6207 | T6209 | themeOf | IκBα,degradation |
| R5011 | T6208 | T6211 | themeOf | RPS3,translocation |
| R5012 | T6210 | T6211 | locationOf | nuclear,translocation |
| R5013 | T6212 | T6216 | causeOf | Importin-α,regulates |
| R5014 | T6213 | T6215 | themeOf | NF-κB Rel subunits23,import |
| R5015 | T6214 | T6215 | locationOf | nuclear,import |
| R5016 | T6215 | T6216 | themeOf | import,regulates |
| R5017 | T6217 | T6221 | themeOf | RPS3,translocation |
| R5018 | T6218 | T6222 | themeOf | p65,translocation |
| R5019 | T6219 | T6223 | themeOf | translocation6,translocation |
| R5020 | T6220 | T6221 | locationOf | nuclear,translocation |
| R5021 | T6220 | T6222 | locationOf | nuclear,translocation |
| R5022 | T6220 | T6223 | locationOf | nuclear,translocation |
| R5023 | T6226 | T6230 | themeOf | RPS3,association |
| R5024 | T6227 | T6230 | themeOf | importin-α,association |
| R5025 | T6230 | T6231 | themeOf | association,enhanced |
| R5026 | T6232 | T6235 | themeOf | RPS3,binding |
| R5027 | T6233 | T6235 | themeOf | importin-α,binding |
| R5028 | T6237 | T6244 | themeOf | IκBα,degradation |
| R5029 | T6239 | T6246 | themeOf | RPS3,bind |
| R5030 | T6240 | T6247 | themeOf | IκBα,bind |
| R5031 | T6241 | T6245 | themeOf | p65,bind |
| R5032 | T6241 | T6246 | themeOf | p65,bind |
| R5033 | T6241 | T6247 | themeOf | p65,bind |
| R5034 | T6242 | T6249 | causeOf | IκBα degradation is,required |
| R5035 | T6243 | T6248 | themeOf | RPS3,liberation |
| R5036 | T6248 | T6249 | themeOf | liberation,required |
| R5037 | T6250 | T6255 | themeOf | RPS3,association |
| R5038 | T6251 | T6256 | themeOf | wild-type IκBα,overexpressing |
| R5039 | T6252 | T6257 | themeOf | IκBα mutant,overexpressing |
| R5040 | T6252 | T6259 | themeOf | IκBα mutant,phosphorylation |
| R5041 | T6252 | T6261 | themeOf | IκBα mutant,degradation |
| R5042 | T6253 | T6258 | themeOf | SSAA,overexpressing |
| R5043 | T6253 | T6260 | themeOf | SSAA,phosphorylation |
| R5044 | T6253 | T6262 | themeOf | SSAA,degradation |
| R5045 | T6254 | T6265 | causeOf | IKKβ,induced |
| R5046 | T6254 | T6266 | causeOf | IKKβ,induced |
| R5047 | T6259 | T6265 | themeOf | phosphorylation,induced |
| R5048 | T6260 | T6266 | themeOf | phosphorylation,induced |
| R5049 | T6261 | T6263 | themeOf | degradation,resistant |
| R5050 | T6262 | T6264 | themeOf | degradation,resistant |
| R5051 | T6267 | T6271 | themeOf | IκBα,transfected |
| R5052 | T6269 | T6273 | themeOf | RPS3,interaction |
| R5053 | T6271 | T6272 | themeOf | transfected,transfected |
| R5054 | T6273 | T6274 | themeOf | interaction,augmented |
| R5055 | T6295 | T6296 | themeOf | RPS3,augmented |
| R5056 | T6276 | T6278 | themeOf | IκBα,non-degradable |
| R5057 | T6297 | T6305 | themeOf | IκBα,degradation |
| R5058 | T6277 | T6279 | themeOf | Fig. 3b,non-degradable |
| R5059 | T6303 | T6307 | themeOf | RPS3,accumulation |
| R5060 | T6281 | T6287 | themeOf | RPS3,translocation |
| R5061 | T6305 | T6308 | themeOf | degradation,induce |
| R5062 | T6306 | T6307 | Site | nuclear,accumulation |
| R5063 | T6307 | T6309 | themeOf | accumulation,increased |
| R5064 | T6285 | T6288 | themeOf | IκBα,expression |
| R5065 | T6311 | T6314 | themeOf | importin-α,association |
| R5066 | T6312 | T6314 | themeOf | RPS3,association |
| R5067 | T6312 | T6315 | themeOf | RPS3,degradation |
| R5068 | T6313 | T6316 | themeOf | IκBα,degradation |
| R5069 | T6314 | T6317 | themeOf | association,promotes |
| R5070 | T6286 | T6287 | locationOf | nuclear,translocation |
| R5071 | T6287 | T6289 | themeOf | translocation,precluding |
| R5072 | T6288 | T6290 | themeOf | expression,reducing |
| R5073 | T6321 | T6324 | themeOf | IκBα,phosphorylation |
| R5074 | T6321 | T6325 | themeOf | IκBα,degradation |
| R5075 | T6322 | T6326 | themeOf | RPS3,association |
| R5076 | T6323 | T6326 | themeOf | importin-α,association |
| R5077 | T6323 | T6328 | themeOf | importin-α,translocation |
| R5078 | T6292 | T6293 | themeOf | IκBα,depleted |
| R5079 | T6326 | T6329 | themeOf | association,cause |
| R5080 | T6327 | T6328 | locationOf | nuclear,translocation |
| R5082 | T6330 | T6332 | themeOf | IKKβ,phosphorylation |
| R5083 | T6331 | T6333 | themeOf | RPS3,phosphorylation |
| R8845 | T10980 | T10982 | themeOf | RPS3,Phosphorylation |
| R8851 | T10980 | T10983 | themeOf | RPS3,function |
| R8855 | T10981 | T10984 | themeOf | NF-κB,function |
| R8858 | T10985 | T10988 | themeOf | RPS3,translocation |
| R8863 | T10987 | T10988 | locationOf | nuclear,translocation |
| R8866 | T10988 | T10989 | themeOf | translocation,activation |
| R8867 | T10990 | T10994 | themeOf | RPS3,transfected |
| R8868 | T11005 | T11006 | locationOf | nuclear,translocation |
| R8869 | T11005 | T11007 | locationOf | nuclear,translocation |
| R8870 | T11006 | T11008 | themeOf | translocation,attenuated |
| R8871 | T11007 | T11009 | themeOf | translocation,attenuated |
| R8872 | T10995 | T10999 | themeOf | Flag,translocation |
| R8873 | T10996 | T11000 | themeOf | RPS3,translocation |
| R8874 | T11011 | T11013 | themeOf | IKKβ,overexpressing |
| R8875 | T10997 | T11001 | themeOf | Fig. 5a,translocation |
| R8876 | T10998 | T10999 | locationOf | nuclear,translocation |
| R8877 | T10998 | T11000 | locationOf | nuclear,translocation |
| R8878 | T10998 | T11001 | locationOf | nuclear,translocation |
| R8879 | T11002 | T11006 | themeOf | RPS3,translocation |
| R8880 | T11012 | T11015 | themeOf | RPS3,translocation |
| R8881 | T11003 | T11007 | themeOf | S209A,translocation |
| R8882 | T11014 | T11015 | locationOf | nuclear,translocation |
| R8883 | T11016 | T11022 | themeOf | IKKβ,overexpression |
| R8884 | T11019 | T11025 | themeOf | S209A,translocation |
| R8885 | T11020 | T11026 | themeOf | RPS3,translocation |
| R8887 | T11021 | T11027 | themeOf | Fig. 5b,translocation |
| R8890 | T11022 | T11023 | themeOf | overexpression,overexpression |
| R8893 | T11023 | T11028 | causeOf | overexpression,induced |
| R8894 | T11023 | T11029 | causeOf | overexpression,induced |
| R8896 | T11023 | T11030 | causeOf | overexpression,induced |
| R8898 | T11024 | T11025 | locationOf | nuclear,translocation |
| R8901 | T11024 | T11026 | locationOf | nuclear,translocation |
| R8902 | T11024 | T11027 | locationOf | nuclear,translocation |
| R8904 | T11025 | T11028 | themeOf | translocation,induced |
| R8908 | T11026 | T11029 | themeOf | translocation,induced |
| R8913 | T11027 | T11030 | themeOf | translocation,induced |
| R8914 | T11031 | T11034 | themeOf | NF-κB,translocation |
| R8919 | T11032 | T11035 | themeOf | RPS3,translocation |
| R8920 | T11033 | T11034 | locationOf | nuclear,translocation |
| R8921 | T11033 | T11035 | locationOf | nuclear,translocation |
| R8922 | T11034 | T11036 | themeOf | translocation,activation-induced |
| R8923 | T11035 | T11037 | themeOf | translocation,activation-induced |
| R8924 | T11038 | T11045 | themeOf | S209,phosphorylation |
| R8927 | T11039 | T11046 | themeOf | RPS3,phosphorylation |
| R8932 | T11041 | T11047 | themeOf | RPS3,expression |
| R8939 | T11042 | T11196 | themeOf | RPS3 mRNA,targets |
| R8941 | T11042 | T11197 | themeOf | RPS3 mRNA,targets |
| R8943 | T11043 | T11191 | themeOf | S209A mutant,complementation |
| R8947 | T11044 | T11192 | themeOf | RPS3,complementation |
| R8949 | T11045 | T11193 | themeOf | phosphorylation,role |
| R8952 | T11046 | T11194 | themeOf | phosphorylation,role |
| R8955 | T11047 | T11195 | themeOf | expression,silenced |
| R9004 | T11191 | T11196 | causeOf | complementation,targets |
| R9008 | T11192 | T11197 | causeOf | complementation,targets |
| R9010 | T11198 | T11203 | causeOf | RPS3 siRNA,reduced |
| R9016 | T11198 | T11205 | causeOf | RPS3 siRNA,affect |
| R9018 | T11200 | T11203 | themeOf | NS siRNA,reduced |
| R9019 | T11202 | T11204 | themeOf | RPS3,expression |
| R9022 | T11204 | T11205 | themeOf | expression,affect |
| R9030 | T11206 | T11212 | themeOf | RPS3,knockdown |
| R9034 | T11207 | T11216 | causeOf | TNF,induced |
| R9035 | T11207 | T11217 | causeOf | TNF,induced |
| R9036 | T11207 | T11218 | causeOf | TNF,induced |
| R9037 | T11209 | T11213 | themeOf | luciferase construct6,expression |
| R9038 | T11210 | T11214 | themeOf | Fig,expression |
| R9039 | T11255 | T11261 | themeOf | RPS3,knockdown |
| R9040 | T11211 | T11215 | themeOf | 5d,expression |
| R9041 | T11256 | T11262 | themeOf | S209A RPS3,stimulated |
| R9042 | T11257 | T11262 | causeOf | κB sites,stimulated |
| R9043 | T11257 | T11263 | causeOf | κB sites,stimulated |
| R9044 | T11212 | T11219 | causeOf | knockdown,reduced |
| R9045 | T11212 | T11220 | causeOf | knockdown,reduced |
| R9046 | T11260 | T11263 | themeOf | Fig,stimulated |
| R9047 | T11212 | T11221 | causeOf | knockdown,reduced |
| R9048 | T11213 | T11216 | themeOf | expression,induced |
| R9049 | T11214 | T11217 | themeOf | expression,induced |
| R9050 | T11215 | T11218 | themeOf | expression,induced |
| R9051 | T11216 | T11219 | themeOf | induced,reduced |
| R9052 | T11217 | T11220 | themeOf | induced,reduced |
| R9053 | T11264 | T11266 | themeOf | RPS3 S209A,expressing |
| R9054 | T11264 | T11267 | causeOf | RPS3 S209A,impact |
| R9055 | T11264 | T11269 | themeOf | RPS3 S209A,translocation |
| R9056 | T11264 | T11271 | causeOf | RPS3 S209A,impact |
| R9057 | T11264 | T11272 | causeOf | RPS3 S209A,impact |
| R9058 | T11218 | T11221 | themeOf | induced,reduced |
| R9059 | T11265 | T11270 | themeOf | p65,translocation |
| R9060 | T11266 | T11267 | themeOf | expressing,impact |
| R9061 | T11223 | T11228 | themeOf | RPS3,deficiency |
| R9062 | T11268 | T11269 | locationOf | nuclear,translocation |
| R9063 | T11268 | T11270 | locationOf | nuclear,translocation |
| R9064 | T11269 | T11271 | themeOf | translocation,impact |
| R9065 | T11270 | T11272 | themeOf | translocation,impact |
| R9066 | T11273 | T11278 | themeOf | p65,attraction |
| R9067 | T11275 | T11277 | partOf | NF-κB,promoters |
| R9068 | T11227 | T11229 | themeOf | Fig. 5c,expression |
| R9069 | T11276 | T11277 | partOf | CD25,promoters |
| R9070 | T11277 | T11278 | Site | promoters,attraction |
| R9071 | T11278 | T11279 | themeOf | attraction,increased |
| R9072 | T11230 | T11235 | causeOf | RPS3,restore |
| R9073 | T11284 | T11287 | themeOf | κB sites,lacking |
| R9074 | T11231 | T11235 | themeOf | luciferase,restore |
| R9075 | T11288 | T11291 | themeOf | RPS3,recruitment |
| R9076 | T11288 | T11292 | themeOf | RPS3,recruitment |
| R9077 | T11289 | T11292 | themeOf | p65,recruitment |
| R9078 | T11232 | T11236 | themeOf | green fluorescent protein,overexpression |
| R9079 | T11233 | T11237 | themeOf | GFP,overexpression |
| R9080 | T11234 | T11240 | themeOf | RPS3,complemented |
| R9081 | T11236 | T11238 | themeOf | overexpression,overexpression |
| R9082 | T11299 | T11301 | themeOf | CD25,expression |
| R9083 | T11236 | T11241 | themeOf | overexpression,result |
| R9084 | T11302 | T11306 | themeOf | RPS3 S209,phosphorylation |
| R9085 | T11303 | T11307 | themeOf | IKKβ,phosphorylation |
| R9086 | T11304 | T11308 | causeOf | RPS3,required |
| R9087 | T11304 | T11309 | causeOf | RPS3,required |
| R9088 | T11305 | T11310 | themeOf | NF-κB,directing |
| R9089 | T11237 | T11239 | themeOf | overexpression,overexpression |
| R9090 | T11306 | T11308 | themeOf | phosphorylation,required |
| R9091 | T11307 | T11309 | themeOf | phosphorylation,required |
| R9092 | T11237 | T11242 | themeOf | overexpression,result |
| R9093 | T11243 | T11246 | themeOf | RPS3 S209,phosphorylation |
| R9094 | T11248 | T11252 | themeOf | p65 recruitment,phosphorylation |
| R9095 | T11250 | T11253 | themeOf | NF-κB,activation |
| R9096 | T11251 | T11252 | Site | S209,phosphorylation |
| R9097 | T11252 | T11254 | causeOf | phosphorylation,affects |
| R9098 | T11253 | T11254 | themeOf | activation,affects |
| R10541 | T13036 | T13037 | themeOf | RPS3,phosphorylation |
| R10542 | T13037 | T13038 | themeOf | phosphorylation,inhibits |
| R10543 | T13041 | T13047 | themeOf | E. coli O157,binds |
| R10544 | T13042 | T13048 | themeOf | H7 EDL933,binds |
| R10545 | T13043 | T13049 | themeOf | NleH1,binds |
| R10546 | T13044 | T13051 | themeOf | RPS3,translocation |
| R10547 | T13045 | T13052 | causeOf | RPS3,dependent |
| R10548 | T13046 | T13052 | themeOf | NF-κB signaling9,dependent |
| R10549 | T13050 | T13051 | locationOf | nuclear,translocation |
| R10550 | T13052 | T13053 | themeOf | dependent,impairing |
| R10551 | T13054 | T13057 | causeOf | NleH1,inhibiting |
| R10552 | T13055 | T13056 | themeOf | RPS3 S209,phosphorylation |
| R10553 | T13056 | T13057 | themeOf | phosphorylation,inhibiting |
| R10554 | T13061 | T13067 | causeOf | NleH1,reduced |
| R10555 | T13062 | T13066 | causeOf | TNF,induced |
| R10556 | T13063 | T13065 | themeOf | RPS3,phosphorylation |
| R10557 | T13065 | T13066 | themeOf | phosphorylation,induced |
| R10558 | T13066 | T13067 | themeOf | induced,reduced |
| R10559 | T13068 | T13075 | themeOf | NleH1,Expressing |
| R10560 | T13071 | T13076 | themeOf | IκBα,degradation |
| R10561 | T13072 | T13077 | themeOf | NleH1,lack |
| R10562 | T13073 | T13078 | themeOf | p65 nuclear translocation9,lack |
| R10563 | T13074 | T13079 | themeOf | Fig. 6c,lack |
| R10564 | T13080 | T13088 | causeOf | NleH1,inhibits |
| R10565 | T13081 | T13085 | themeOf | RPS3,phosphorylation |
| R10566 | T13082 | T13086 | themeOf | nleH1,lacking |
| R10567 | T13083 | T13087 | themeOf | ΔnleH1,lacking |
| R10568 | T13085 | T13088 | themeOf | phosphorylation,inhibits |
| R10569 | T13090 | T13091 | themeOf | RPS3 S209,phosphorylation |
| R10570 | T13091 | T13092 | themeOf | phosphorylation,increase |
| R10571 | T13093 | T13094 | themeOf | RPS3 S209,phosphorylation |
| R10572 | T13094 | T13095 | themeOf | phosphorylation,impaired |
| R10573 | T13096 | T13101 | causeOf | TNF,induced |
| R10574 | T13097 | T13100 | themeOf | RPS3 S209,phosphorylation |
| R10575 | T13100 | T13101 | themeOf | phosphorylation,induced |
| R10576 | T13101 | T13102 | themeOf | induced,unimpaired |
| R10577 | T13103 | T13110 | causeOf | ΔnleH1,attenuated |
| R10578 | T13104 | T13111 | causeOf | ΔescN E. coli O157:H7,attenuated |
| R10579 | T13105 | T13109 | causeOf | TNF,induced |
| R10580 | T13106 | T13108 | themeOf | RPS3,translocation9 |
| R10581 | T13107 | T13108 | locationOf | nuclear,translocation9 |
| R10582 | T13108 | T13109 | themeOf | translocation9,induced |
| R10583 | T13109 | T13110 | themeOf | induced,attenuated |
| R10584 | T13109 | T13111 | themeOf | induced,attenuated |
| R10585 | T13112 | T13115 | themeOf | RPS3,phosphorylation |
| R10586 | T13112 | T13117 | themeOf | RPS3,translocation |
| R10587 | T13114 | T13118 | themeOf | RPS3 S209,phosphorylation |
| R10588 | T13116 | T13117 | locationOf | nuclear,translocation |
| R10589 | T13120 | T13132 | causeOf | NleH1,inhibits |
| R10590 | T13121 | T13127 | themeOf | RPS3 S209,phosphorylation |
| R10591 | T13122 | T13137 | causeOf | RPS3,dependent |
| R10592 | T13122 | T13138 | causeOf | RPS3,dependent |
| R10593 | T13122 | T13139 | causeOf | RPS3,dependent |
| R10594 | T13122 | T13140 | causeOf | RPS3,dependent |
| R10595 | T13123 | T13128 | themeOf | NF-κB,transcription |
| R10596 | T13124 | T13129 | themeOf | IL8,transcription |
| R10597 | T13125 | T13130 | themeOf | NFKBIA,transcription |
| R10598 | T13126 | T13131 | themeOf | TNFAIP3,transcription |
| R10599 | T13127 | T13132 | themeOf | phosphorylation,inhibits |
| R10600 | T13128 | T13133 | themeOf | transcription,blocks |
| R10601 | T13128 | T13137 | themeOf | transcription,dependent |
| R10602 | T13129 | T13134 | themeOf | transcription,blocks |
| R10603 | T13129 | T13138 | themeOf | transcription,dependent |
| R10604 | T13130 | T13135 | themeOf | transcription,blocks |
| R10605 | T13130 | T13139 | themeOf | transcription,dependent |
| R10606 | T13131 | T13136 | themeOf | transcription,blocks |
| R10607 | T13131 | T13140 | themeOf | transcription,dependent |
| R10608 | T13142 | T13145 | themeOf | RPS3,expression |
| R10609 | T13143 | T13146 | themeOf | CD25,expression |
| R10610 | T13144 | T13147 | themeOf | TNFSF13B,expression |
| R10611 | T13148 | T13152 | causeOf | NleH1,impairing |
| R10612 | T13149 | T13151 | themeOf | RPS3 S209,phosphorylation |
| R10613 | T13150 | T13152 | themeOf | RPS3-dependent NF-κB,impairing |
| R10614 | T13151 | T13153 | themeOf | phosphorylation,blocking |
| R11410 | T14172 | T14173 | themeOf | RPS3 S209,phosphorylation |
| R11411 | T14173 | T14174 | themeOf | phosphorylation,inhibits |
| R11412 | T14176 | T14182 | causeOf | NleH1,blocked |
| R11413 | T14177 | T14179 | themeOf | RPS3 S209,phosphorylation |
| R11414 | T14178 | T14181 | themeOf | RPS3,translocation |
| R11415 | T14179 | T14182 | themeOf | phosphorylation,blocked |
| R11416 | T14180 | T14181 | locationOf | nuclear,translocation |
| R11417 | T14181 | T14183 | themeOf | translocation,preventing |
| R11418 | T14186 | T14187 | themeOf | RPS3,expression |
| R11419 | T14188 | T14191 | causeOf | NleH1,inhibits |
| R11420 | T14189 | T14190 | themeOf | RPS3 S209,phosphorylation |
| R11421 | T14190 | T14191 | themeOf | phosphorylation,inhibits |
| R13508 | T16753 | T16763 | causeOf | NleH1,inhibits |
| R13509 | T16754 | T16759 | themeOf | RPS3 S209,phosphorylation |
| R13510 | T16756 | T16760 | themeOf | NleH1,autophosphorylated |
| R13511 | T16757 | T16761 | themeOf | NleH1 kinase-dead mutant,autophosphorylated |
| R13512 | T16758 | T16762 | themeOf | Fig. 7a,autophosphorylated |
| R13513 | T16759 | T16763 | themeOf | phosphorylation,inhibits |
| R13514 | T16764 | T16771 | causeOf | NleH1,inhibit |
| R13515 | T16764 | T16772 | causeOf | NleH1,inhibit |
| R13516 | T16765 | T16768 | themeOf | IKKβ,phosphorlyation |
| R13517 | T16766 | T16769 | themeOf | RPS3,phosphorlyation |
| R13518 | T16767 | T16770 | themeOf | K159A NleH1,expressing |
| R13519 | T16768 | T16771 | themeOf | phosphorlyation,inhibit |
| R13520 | T16769 | T16772 | themeOf | phosphorlyation,inhibit |
| R13521 | T16773 | T16777 | themeOf | NleH1,expression |
| R13522 | T16774 | T16779 | causeOf | TNF,induced |
| R13523 | T16775 | T16778 | themeOf | RPS3 S209,phosphorylation |
| R13524 | T16777 | T16780 | causeOf | expression,reduced |
| R13525 | T16778 | T16779 | themeOf | phosphorylation,induced |
| R13526 | T16779 | T16780 | themeOf | induced,reduced |
| R13527 | T16783 | T16784 | themeOf | IKKβ,phosphorylation |
| R13528 | T16786 | T16791 | themeOf | RPS3,translocation |
| R13529 | T16788 | T16792 | themeOf | κB luciferase,translocation |
| R13530 | T16790 | T16791 | locationOf | nuclear,translocation |
| R13531 | T16790 | T16792 | locationOf | nuclear,translocation |
| R13532 | T16791 | T16793 | themeOf | translocation,inhibited |
| R13533 | T16792 | T16794 | themeOf | translocation,inhibited |
| R13534 | T16795 | T16796 | themeOf | RPS3 S209,phosphorylation |
| R13535 | T16798 | T16800 | themeOf | RPS3 S209,phosphorylation |
| R13536 | T16800 | T16801 | themeOf | phosphorylation,increase |
| R13537 | T16802 | T16803 | themeOf | RPS3,phosphorylation |
| R13538 | T16803 | T16804 | themeOf | phosphorylation,augmentation |
| R13539 | T16804 | T16805 | themeOf | augmentation,reduced |
| R13540 | T16806 | T16808 | themeOf | RPS3,phosphorylation |
| R13541 | T16807 | T16810 | themeOf | "NleH (Fig. 7c, ΔnleH)",lacking |
| R13542 | T16808 | T16809 | themeOf | phosphorylation,enhanced |
| R13543 | T16812 | T16813 | themeOf | K159A E. coli NleH1,express |
| R13544 | T16814 | T16825 | causeOf | Complementing ΔnleH mutant,abolished |
| R13545 | T16815 | T16822 | causeOf | TNF,induced |
| R13546 | T16816 | T16819 | themeOf | RPS3 S209,phosphorylation |
| R13547 | T16817 | T16820 | themeOf | RPS3,phosphorylation |
| R13548 | T16818 | T16821 | themeOf | Fig. 7c,phosphorylation |
| R13549 | T16819 | T16822 | themeOf | phosphorylation,induced |
| R13550 | T16820 | T16823 | themeOf | phosphorylation,inhibit |
| R13551 | T16821 | T16824 | themeOf | phosphorylation,inhibit |
| R13552 | T16822 | T16825 | themeOf | induced,abolished |
| R13553 | T16827 | T16829 | themeOf | RPS3,phosphorylation |
| R13554 | T16828 | T16830 | themeOf | S209,phosphorylation |
| R13555 | T16829 | T16831 | themeOf | phosphorylation,block |
| R13556 | T16830 | T16832 | themeOf | phosphorylation,block |
| R13557 | T16834 | T16838 | themeOf | RPS3,translocation |
| R13558 | T16837 | T16838 | locationOf | nuclear,translocation |
| R13559 | T16838 | T16839 | themeOf | translocation,impair |
| R13560 | T16840 | T16843 | themeOf | SSEE IKKβ proteins,expressing |
| R13561 | T16841 | T16845 | themeOf | RPS3,translocation |
| R13562 | T16842 | T16846 | themeOf | IKKβ,translocation |
| R13563 | T16844 | T16845 | locationOf | nuclear,translocation |
| R13564 | T16844 | T16846 | locationOf | nuclear,translocation |
| R13565 | T16847 | T16849 | themeOf | RPS3,accumulation |
| R13566 | T16848 | T16849 | locationOf | nuclear,accumulation |
| R13567 | T16850 | T16854 | themeOf | RPS3,translocation |
| R13568 | T16851 | T16855 | themeOf | IKKβ- or IKKβ,-expressing |
| R13569 | T16852 | T16856 | themeOf | SSEE,-expressing |
| R13570 | T16853 | T16854 | locationOf | nuclear,translocation |
| R13571 | T16854 | T16857 | themeOf | translocation,impaired |
| R13572 | T16858 | T16862 | themeOf | RPS3,translocation |
| R13573 | T16859 | T16863 | themeOf | IKKβ,-expressing |
| R13574 | T16861 | T16862 | locationOf | nuclear,translocation |
| R13575 | T16862 | T16864 | themeOf | translocation,affect |
| R13576 | T16865 | T16868 | themeOf | RPS3,translocation |
| R13577 | T16866 | T16869 | themeOf | IKKβ,expressing |
| R13578 | T16867 | T16868 | locationOf | nuclear,translocation |
| R13579 | T16868 | T16870 | themeOf | translocation,inhibit |
| R13580 | T16871 | T16876 | themeOf | NleH1,phosphorylate |
| R13581 | T16873 | T16881 | causeOf | IKKβ,mediated |
| R13582 | T16873 | T16882 | causeOf | IKKβ,mediated |
| R13583 | T16874 | T16877 | themeOf | RPS3,phosphorylation |
| R13584 | T16875 | T16878 | themeOf | S209,phosphorylation |
| R13585 | T16877 | T16879 | themeOf | phosphorylation,inhibiting |
| R13586 | T16877 | T16881 | themeOf | phosphorylation,mediated |
| R13587 | T16878 | T16880 | themeOf | phosphorylation,inhibiting |
| R13588 | T16878 | T16882 | themeOf | phosphorylation,mediated |
| R13589 | T16883 | T16888 | themeOf | Flag,phosphorylation |
| R13590 | T16886 | T16887 | themeOf | IKKβ,autophosphorylation |
| R13591 | T16886 | T16889 | themeOf | IKKβ,phosphorylation |
| R13592 | T16897 | T16903 | themeOf | RPS3,phosphorylated |
| R13593 | T16898 | T16904 | themeOf | Fig,phosphorylated |
| R13594 | T16899 | T16905 | themeOf | GST-IκBα (1-54) protein,phosphorylated |
| R13595 | T16900 | T16906 | themeOf | Fig,phosphorylated |
| R13596 | T16909 | T16920 | causeOf | IKKβ,mediated |
| R13597 | T16910 | T16917 | themeOf | RPS3,phosphorylation |
| R13598 | T16912 | T16921 | causeOf | IKKβ,mediated |
| R13599 | T16912 | T16922 | causeOf | IKKβ,mediated |
| R13600 | T16913 | T16918 | themeOf | GST,phosphorylation |
| R13601 | T16914 | T16919 | themeOf | IκBα,phosphorylation |
| R13602 | T16917 | T16920 | themeOf | phosphorylation,mediated |
| R13603 | T16918 | T16921 | themeOf | phosphorylation,mediated |
| R13604 | T16919 | T16922 | themeOf | phosphorylation,mediated |
| R13605 | T16923 | T16927 | themeOf | NleH1,phosphorylation |
| R13606 | T16924 | T16928 | themeOf | RPS3,phosphorylation |
| R13607 | T16924 | T16931 | themeOf | RPS3,autophosphorylation |
| R13608 | T16925 | T16929 | themeOf | GST-IκBα,phosphorylation |
| R13609 | T16925 | T17276 | themeOf | GST-IκBα,autophosphorylation |
| R13610 | T16926 | T16930 | themeOf | Fig. 7e,phosphorylation |
| R13611 | T16926 | T17277 | themeOf | Fig. 7e,autophosphorylation |
| R13785 | T17281 | T17285 | causeOf | IKKβ,mediated |
| R13795 | T17282 | T17283 | themeOf | RPS3 S209,phosphorylation |
| R13799 | T17283 | T17284 | themeOf | phosphorylation,inhibiting |
| R13802 | T17283 | T17285 | themeOf | phosphorylation,mediated |
| R15765 | T19642 | T19643 | themeOf | NF-κB regulatory specificity6,conferring |
| R15766 | T19647 | T19652 | causeOf | IKKβ,mediated |
| R15767 | T19648 | T19650 | themeOf | RPS3 S209,phosphorylation |
| R15768 | T19650 | T19652 | themeOf | phosphorylation,mediated |
| R15769 | T19653 | T19656 | themeOf | IKKβ,phosphorylates |
| R15770 | T19653 | T19658 | themeOf | IKKβ,degradation40 |
| R15771 | T19654 | T19657 | themeOf | IκBs,phosphorylates |
| R15772 | T19654 | T19659 | themeOf | IκBs,degradation40 |
| R15773 | T19661 | T19666 | themeOf | human IKKβ,phosphorylation |
| R15774 | T19662 | T19667 | themeOf | CK2,phosphorylation |
| R15775 | T19663 | T19668 | themeOf | IKKβ,phosphorylated |
| R15776 | T19664 | T19669 | themeOf | IKKα,phosphorylated |
| R15777 | T19665 | T19670 | themeOf | RPS3,phosphorylated |
| R15778 | T19671 | T19675 | themeOf | RPS3,translocation |
| R15779 | T19673 | T19676 | themeOf | NF-κB,transcription |
| R15780 | T19674 | T19675 | locationOf | nuclear,translocation |
| R15781 | T19675 | T19677 | themeOf | translocation,modulation |
| R15782 | T19678 | T19686 | themeOf | CK2,bind |
| R15783 | T19679 | T19685 | themeOf | p65,phosphorylate |
| R15784 | T19680 | T19687 | themeOf | IKKβ,bound |
| R15785 | T19680 | T19688 | themeOf | IKKβ,bound |
| R15786 | T19681 | T19688 | themeOf | CK2,bound |
| R15787 | T19681 | T19691 | causeOf | CK2,account |
| R15788 | T19682 | T19689 | themeOf | RPS3,phosphorylation |
| R15789 | T19683 | T19690 | themeOf | CK2,detected |
| R15790 | T19689 | T19691 | themeOf | phosphorylation,account |
| R15791 | T19695 | T19696 | themeOf | IKK,phosphorylation |
| R15792 | T19699 | T19703 | causeOf | IKKβ,mediated |
| R15793 | T19700 | T19702 | themeOf | RPS3 S209,phosphorylation |
| R15794 | T19702 | T19703 | themeOf | phosphorylation,mediated |
| R15795 | T19704 | T19707 | themeOf | NleH1,binds |
| R15796 | T19704 | T19708 | causeOf | NleH1,suppresses |
| R15797 | T19705 | T19707 | themeOf | RPS3,binds |
| R15798 | T19706 | T19708 | themeOf | NF-κB,suppresses |
| R15799 | T19709 | T19716 | causeOf | NleH1,inhibits |
| R15800 | T19710 | T19713 | themeOf | RPS3,phosphorylation |
| R15801 | T19710 | T19714 | themeOf | RPS3,translocation |
| R15802 | T19711 | T19715 | themeOf | NF-κB,translocation |
| R15803 | T19713 | T19716 | themeOf | phosphorylation,inhibits |
| R15804 | T19717 | T19722 | themeOf | NleH1 did not,phosphorylate |
| R15805 | T19718 | T19723 | themeOf | IKKβ,phosphorylate |
| R15806 | T19719 | T19728 | causeOf | IKKβ,mediated |
| R15807 | T19719 | T19729 | causeOf | IKKβ,mediated |
| R15808 | T19720 | T19724 | themeOf | RPS3,phosphorylation |
| R15809 | T19721 | T19725 | themeOf | S209,phosphorylation |
| R15810 | T19724 | T19726 | themeOf | phosphorylation,inhibit |
| R15811 | T19724 | T19728 | themeOf | phosphorylation,mediated |
| R15812 | T19725 | T19727 | themeOf | phosphorylation,inhibit |
| R15813 | T19725 | T19729 | themeOf | phosphorylation,mediated |
| R15814 | T19730 | T19734 | themeOf | target key kinases,products |
| R15815 | T19736 | T19741 | themeOf | NleH1,transcription |
| R15816 | T19737 | T19742 | themeOf | RPS3,transcription |
| R15817 | T19738 | T19743 | themeOf | NF-κB,transcription |
| R15818 | T19744 | T19752 | causeOf | NleH1,block |
| R15819 | T19744 | T19753 | causeOf | NleH1,block |
| R15820 | T19745 | T19750 | themeOf | NF-κB,translocation |
| R15821 | T19746 | T19751 | themeOf | p65,translocation |
| R15822 | T19749 | T19750 | locationOf | nuclear,translocation |
| R15823 | T19749 | T19751 | locationOf | nuclear,translocation |
| R15824 | T19750 | T19752 | themeOf | translocation,block |
| R15825 | T19751 | T19753 | themeOf | translocation,block |
| R15826 | T19754 | T19757 | themeOf | RPS3,inhibiting |
| R15827 | T19755 | T19758 | themeOf | NF-κB,inhibiting |
| R15828 | T19756 | T19759 | themeOf | NleH1,inhibiting |
| R15829 | T19762 | T19764 | themeOf | p65,translocation |
| R15830 | T19763 | T19764 | locationOf | nuclear,translocation |
| R15831 | T19764 | T19765 | themeOf | translocation,altering |
| R15832 | T19768 | T19769 | themeOf | NF-κB,inhibition |
| R16344 | T20478 | T20480 | themeOf | S209,phosphorylated |
| R16345 | T20479 | T20481 | themeOf | RPS3,phosphorylated |
| R17252 | T21691 | T21692 | themeOf | RNAi,Transfection |
| R17253 | T21692 | T21693 | themeOf | Transfection,Transfection |
| R17697 | T22191 | T22193 | themeOf | Dual-Luciferase Kit,using |
| R17698 | T22192 | T22194 | themeOf | Promega,using |
| R17774 | T22310 | T22314 | partOf | κB sites,region |
| R17775 | T22311 | T22314 | partOf | IL8,region |
| R17776 | T22312 | T22314 | partOf | NFKBIA,region |
| R17777 | T22313 | T22314 | partOf | ACTB,region |
bionlp-st-ge-2016-reference
| Id | Subject | Object | Predicate | Lexical cue | Negation | Speculation |
|---|---|---|---|---|---|---|
| T62 | 0-4 | Protein | denotes | IKKβ | ||
| T63 | 5-20 | Phosphorylation | denotes | phosphorylation | ||
| T64 | 21-30 | Regulation | denotes | regulates | ||
| T65 | 31-35 | Protein | denotes | RPS3 | ||
| T66 | 36-43 | Entity | denotes | nuclear | ||
| T67 | 44-57 | Localization | denotes | translocation | ||
| T68 | 186-206 | Protein | denotes | ribosomal protein S3 | ||
| T69 | 208-212 | Protein | denotes | RPS3 | ||
| T70 | 303-307 | Protein | denotes | RPS3 | ||
| T71 | 308-315 | Entity | denotes | nuclear | ||
| T72 | 316-329 | Localization | denotes | translocation | ||
| T73 | 333-342 | Regulation | denotes | regulated | true | |
| T74 | 364-368 | Protein | denotes | IKKβ | ||
| T75 | 369-384 | Phosphorylation | denotes | phosphorylation | ||
| T76 | 388-398 | Entity | denotes | serine 209 | ||
| T77 | 410-417 | Positive_regulation | denotes | crucial | ||
| T78 | 422-426 | Protein | denotes | RPS3 | ||
| T79 | 427-434 | Entity | denotes | nuclear | ||
| T80 | 435-447 | Localization | denotes | localization | ||
| T81 | 448-462 | Positive_regulation | denotes | in response to | ||
| T82 | 463-473 | Positive_regulation | denotes | activating | ||
| T83 | 559-564 | Protein | denotes | NleH1 | ||
| T84 | 578-587 | Negative_regulation | denotes | inhibited | ||
| T85 | 588-592 | Protein | denotes | RPS3 | ||
| T86 | 593-597 | Entity | denotes | S209 | ||
| T87 | 598-613 | Phosphorylation | denotes | phosphorylation | ||
| T88 | 618-625 | Negative_regulation | denotes | blocked | ||
| T89 | 626-630 | Protein | denotes | RPS3 | ||
| T90 | 771-775 | Protein | denotes | IKKβ | ||
| T91 | 776-785 | Regulation | denotes | dependent | ||
| T92 | 786-798 | Protein_modification | denotes | modification | ||
| T93 | 827-831 | Protein | denotes | RPS3 | ||
| T729 | 1203-1207 | Protein | denotes | RelA | ||
| T730 | 1209-1212 | Protein | denotes | p65 | ||
| T731 | 1215-1219 | Protein | denotes | RelB | ||
| T732 | 1221-1226 | Protein | denotes | c-Rel | ||
| T733 | 1228-1231 | Protein | denotes | p50 | ||
| T734 | 1237-1240 | Protein | denotes | p52 | ||
| T735 | 1294-1314 | Protein | denotes | ribosomal protein S3 | ||
| T736 | 1316-1320 | Protein | denotes | RPS3 | ||
| T737 | 1335-1338 | Protein | denotes | Rel | ||
| T738 | 1383-1387 | Protein | denotes | RPS3 | ||
| T739 | 1564-1568 | Protein | denotes | RPS3 | ||
| T740 | 1636-1664 | Protein | denotes | immunoglobulin κ light chain | ||
| T741 | 1670-1680 | Gene_expression | denotes | expression | ||
| T742 | 1908-1913 | Protein | denotes | NleH1 | ||
| T743 | 1968-1979 | Negative_regulation | denotes | attenuating | ||
| T744 | 1980-1984 | Protein | denotes | RPS3 | ||
| T745 | 1985-1992 | Entity | denotes | nuclear | ||
| T746 | 1993-2006 | Localization | denotes | translocation | ||
| T747 | 2016-2025 | Regulation | denotes | affecting | true | |
| T748 | 2026-2029 | Protein | denotes | p65 | ||
| T749 | 2030-2042 | Localization | denotes | localization | ||
| T750 | 2096-2102 | Positive_regulation | denotes | induce | true | |
| T751 | 2103-2107 | Protein | denotes | RPS3 | ||
| T752 | 2108-2115 | Entity | denotes | nuclear | ||
| T753 | 2116-2129 | Localization | denotes | translocation | ||
| T754 | 2220-2227 | Binding | denotes | binding | ||
| T755 | 2266-2270 | Protein | denotes | RPS3 | ||
| T756 | 2353-2357 | Protein | denotes | RPS3 | ||
| T757 | 2361-2375 | Phosphorylation | denotes | phosphorylated | true | |
| T758 | 2487-2491 | Protein | denotes | RPS3 | ||
| T759 | 2495-2509 | Phosphorylation | denotes | phosphorylated | true | |
| T760 | 2672-2676 | Protein | denotes | RPS3 | ||
| T761 | 2727-2760 | Protein | denotes | Inhibitor of κB (IκB) kinase beta | ||
| T762 | 2762-2766 | Protein | denotes | IKKβ | ||
| T763 | 2768-2782 | Phosphorylation | denotes | phosphorylated | ||
| T764 | 2783-2787 | Protein | denotes | RPS3 | ||
| T765 | 2791-2801 | Entity | denotes | serine 209 | ||
| T766 | 2810-2814 | Protein | denotes | RPS3 | ||
| T767 | 2815-2819 | Entity | denotes | S209 | ||
| T768 | 2820-2835 | Phosphorylation | denotes | phosphorylation | ||
| T769 | 2836-2844 | Positive_regulation | denotes | enhanced | ||
| T770 | 2849-2860 | Binding | denotes | association | ||
| T771 | 2878-2887 | Positive_regulation | denotes | mediating | ||
| T772 | 2888-2892 | Protein | denotes | RPS3 | ||
| T773 | 2932-2939 | Entity | denotes | nuclear | ||
| T774 | 2940-2953 | Localization | denotes | translocation | ||
| T775 | 2980-2985 | Protein | denotes | NleH1 | ||
| T776 | 3008-3017 | Negative_regulation | denotes | inhibited | ||
| T777 | 3018-3022 | Protein | denotes | RPS3 | ||
| T778 | 3023-3027 | Entity | denotes | S209 | ||
| T1983 | 3126-3130 | Protein | denotes | RPS3 | ||
| T1984 | 3131-3146 | Phosphorylation | denotes | phosphorylation | ||
| T1985 | 3147-3161 | Positive_regulation | denotes | in response to | true | |
| T1986 | 3195-3199 | Protein | denotes | RPS3 | ||
| T1987 | 3203-3217 | Phosphorylation | denotes | phosphorylated | true | |
| T1988 | 3345-3349 | Protein | denotes | RPS3 | ||
| T1989 | 3363-3377 | Phosphorylation | denotes | phosphorylated | true | |
| T1990 | 3422-3430 | Positive_regulation | denotes | increase | ||
| T1991 | 3434-3451 | Phosphorylation | denotes | 32P-incorporation | ||
| T1992 | 3485-3493 | Positive_regulation | denotes | increase | true | |
| T1993 | 3497-3501 | Protein | denotes | RPS3 | ||
| T1994 | 3540-3544 | Protein | denotes | RPS3 | ||
| T1995 | 3545-3553 | Entity | denotes | residues | ||
| T1996 | 3559-3573 | Phosphorylation | denotes | phosphorylated | true | |
| T1997 | 3597-3601 | Protein | denotes | RPS3 | ||
| T1998 | 3770-3780 | Positive_regulation | denotes | stimulated | ||
| T1999 | 3770-3780 | Positive_regulation | denotes | stimulated | ||
| T2000 | 3787-3802 | Phosphorylation | denotes | phosphorylation | ||
| T2001 | 3807-3817 | Protein_catabolism | denotes | degradaion | ||
| T2002 | 3821-3825 | Protein | denotes | IκBα | ||
| T2003 | 3864-3868 | Protein | denotes | RPS3 | ||
| T2004 | 3869-3884 | Phosphorylation | denotes | phosphorylation | ||
| T2005 | 3888-3903 | Entity | denotes | serine residues | ||
| T2006 | 3985-3993 | Entity | denotes | tyrosine | ||
| T2007 | 3998-4007 | Entity | denotes | threonine | ||
| T2008 | 4008-4023 | Phosphorylation | denotes | phosphorylation | true | |
| T2009 | 4008-4023 | Phosphorylation | denotes | phosphorylation | true | |
| T2010 | 4027-4031 | Protein | denotes | RPS3 | ||
| T2601 | 4044-4048 | Protein | denotes | RPS3 | ||
| T2602 | 4053-4057 | Protein | denotes | IKKβ | ||
| T2603 | 4058-4069 | Binding | denotes | interaction | true | |
| T2604 | 4157-4161 | Protein | denotes | IKKγ | ||
| T2605 | 4190-4194 | Protein | denotes | IKKα | ||
| T2606 | 4199-4203 | Protein | denotes | IKKβ | ||
| T2607 | 4322-4326 | Protein | denotes | RPS3 | ||
| T2608 | 4359-4362 | Protein | denotes | p65 | ||
| T2609 | 4363-4366 | Protein | denotes | p50 | ||
| T2610 | 4367-4371 | Protein | denotes | IκBα | ||
| T2611 | 4431-4440 | Positive_regulation | denotes | activated | ||
| T2612 | 4441-4445 | Protein | denotes | IKKβ | ||
| T2613 | 4457-4461 | Binding | denotes | bind | true | |
| T2614 | 4469-4482 | Phosphorylation | denotes | phosphorylate | true | |
| T2615 | 4483-4487 | Protein | denotes | RPS3 | ||
| T2616 | 4522-4531 | Gene_expression | denotes | expressed | ||
| T2617 | 4532-4536 | Protein | denotes | IKKβ | ||
| T2618 | 4541-4545 | Protein | denotes | RPS3 | ||
| T2619 | 4546-4556 | Binding | denotes | interacted | ||
| T2620 | 4639-4643 | Protein | denotes | IKKβ | ||
| T2621 | 4644-4648 | Protein | denotes | RPS3 | ||
| T2622 | 4649-4660 | Binding | denotes | interaction | ||
| T2623 | 4775-4779 | Protein | denotes | RPS3 | ||
| T2624 | 4780-4784 | Protein | denotes | IKKβ | ||
| T2625 | 4785-4796 | Binding | denotes | association | ||
| T2626 | 4809-4818 | Positive_regulation | denotes | augmented | ||
| T2627 | 4871-4880 | Positive_regulation | denotes | following | ||
| T2628 | 4901-4905 | Protein | denotes | RPS3 | ||
| T2629 | 4906-4912 | Entity | denotes | serine | ||
| T2630 | 4913-4928 | Phosphorylation | denotes | phosphorylation | ||
| T2631 | 4977-4988 | Binding | denotes | interaction | true | |
| T2632 | 4997-5001 | Protein | denotes | RPS3 | ||
| T2633 | 5006-5010 | Protein | denotes | IKKα | ||
| T3438 | 5023-5027 | Protein | denotes | IKKβ | ||
| T3439 | 5031-5039 | Positive_regulation | denotes | required | ||
| T3440 | 5044-5048 | Protein | denotes | RPS3 | ||
| T3441 | 5049-5056 | Entity | denotes | nuclear | ||
| T3442 | 5057-5070 | Localization | denotes | translocation | ||
| T3443 | 5094-5098 | Protein | denotes | RPS3 | ||
| T3444 | 5099-5103 | Protein | denotes | IKKβ | ||
| T3445 | 5104-5115 | Binding | denotes | interaction | ||
| T3446 | 5119-5127 | Positive_regulation | denotes | required | true | |
| T3447 | 5132-5136 | Protein | denotes | RPS3 | ||
| T3448 | 5137-5144 | Entity | denotes | nuclear | ||
| T3449 | 5145-5158 | Localization | denotes | translocation | ||
| T3450 | 5163-5175 | Negative_regulation | denotes | knocked down | ||
| T3451 | 5163-5175 | Negative_regulation | denotes | knocked down | ||
| T3452 | 5176-5180 | Protein | denotes | IKKα | ||
| T3453 | 5184-5188 | Protein | denotes | IKKβ | ||
| T3454 | 5189-5199 | Gene_expression | denotes | expression | ||
| T3455 | 5189-5199 | Gene_expression | denotes | expression | ||
| T3456 | 5265-5272 | Positive_regulation | denotes | induced | true | |
| T3457 | 5273-5277 | Protein | denotes | RPS3 | ||
| T3458 | 5278-5285 | Entity | denotes | nuclear | ||
| T3459 | 5286-5295 | Localization | denotes | migration | ||
| T3460 | 5339-5348 | Positive_regulation | denotes | triggered | ||
| T3461 | 5349-5353 | Protein | denotes | RPS3 | ||
| T3462 | 5354-5361 | Entity | denotes | nuclear | ||
| T3463 | 5362-5375 | Localization | denotes | translocation | ||
| T3464 | 5456-5460 | Protein | denotes | RPS3 | ||
| T3465 | 5461-5468 | Entity | denotes | nuclear | ||
| T3466 | 5469-5482 | Localization | denotes | translocation | ||
| T3467 | 5513-5521 | Negative_regulation | denotes | impaired | ||
| T3468 | 5525-5529 | Protein | denotes | IKKα | ||
| T3469 | 5530-5539 | Negative_regulation | denotes | silencing | ||
| T3470 | 5553-5562 | Negative_regulation | denotes | knockdown | ||
| T3471 | 5566-5570 | Protein | denotes | IKKβ | ||
| T3472 | 5571-5581 | Negative_regulation | denotes | attenuated | ||
| T3473 | 5592-5596 | Protein | denotes | RPS3 | ||
| T3474 | 5597-5604 | Entity | denotes | nuclear | ||
| T3475 | 5605-5617 | Localization | denotes | accumulation | ||
| T3476 | 5618-5627 | Positive_regulation | denotes | following | ||
| T3477 | 5707-5717 | Gene_expression | denotes | expression | ||
| T3478 | 5707-5717 | Gene_expression | denotes | expression | ||
| T3479 | 5721-5725 | Protein | denotes | IKKβ | ||
| T3480 | 5735-5739 | Protein | denotes | IKKα | ||
| T3481 | 5745-5754 | Positive_regulation | denotes | necessary | true | |
| T3482 | 5745-5754 | Positive_regulation | denotes | necessary | true | |
| T3483 | 5770-5777 | Positive_regulation | denotes | induced | ||
| T3484 | 5778-5782 | Protein | denotes | RPS3 | ||
| T3485 | 5783-5790 | Entity | denotes | nuclear | ||
| T3486 | 5791-5804 | Localization | denotes | translocation | ||
| T3487 | 5850-5853 | Protein | denotes | p65 | ||
| T3488 | 5854-5861 | Entity | denotes | nuclear | ||
| T3489 | 5862-5875 | Localization | denotes | translocation | ||
| T3490 | 5880-5887 | Negative_regulation | denotes | blocked | ||
| T3491 | 5946-5953 | Entity | denotes | nuclear | ||
| T3492 | 5954-5967 | Localization | denotes | translocation | true | |
| T3493 | 5971-5975 | Protein | denotes | RPS3 | ||
| T3494 | 5997-6007 | Gene_expression | denotes | expressing | ||
| T3495 | 6015-6026 | Negative_regulation | denotes | kinase-dead | ||
| T3496 | 6037-6058 | Positive_regulation | denotes | constitutively-active | ||
| T3497 | 6073-6077 | Protein | denotes | IKKβ | ||
| T3498 | 6105-6109 | Positive_regulation | denotes | SSEE | ||
| T3499 | 6119-6123 | Negative_regulation | denotes | SSAA | ||
| T3500 | 6135-6139 | Protein | denotes | IKKβ | ||
| T3501 | 6140-6147 | Positive_regulation | denotes | induced | true | |
| T3502 | 6140-6147 | Positive_regulation | denotes | induced | true | |
| T3503 | 6154-6163 | Regulation | denotes | dependent | ||
| T3504 | 6164-6174 | Protein | denotes | luciferase | ||
| T3505 | 6218-6222 | Protein | denotes | RPS3 | ||
| T3506 | 6223-6231 | Localization | denotes | remained | ||
| T3507 | 6232-6241 | Entity | denotes | cytosolic | ||
| T3508 | 6242-6244 | Positive_regulation | denotes | in | ||
| T3509 | 6245-6249 | Protein | denotes | IKKβ | ||
| T3510 | 6251-6255 | Negative_regulation | denotes | SSAA | ||
| T3511 | 6320-6324 | Protein | denotes | RPS3 | ||
| T3512 | 6325-6337 | Localization | denotes | translocated | ||
| T3513 | 6345-6352 | Entity | denotes | nucleus | ||
| T3514 | 6353-6355 | Positive_regulation | denotes | in | ||
| T3515 | 6373-6377 | Protein | denotes | IKKβ | ||
| T3516 | 6379-6383 | Positive_regulation | denotes | SSEE | ||
| T3517 | 6438-6448 | Localization | denotes | detectable | ||
| T3518 | 6449-6456 | Entity | denotes | nuclear | ||
| T3519 | 6457-6461 | Protein | denotes | RPS3 | ||
| T3520 | 6462-6471 | Positive_regulation | denotes | increased | true | |
| T3521 | 6462-6471 | Positive_regulation | denotes | increased | true | |
| T3522 | 6482-6486 | Protein | denotes | IKKβ | ||
| T3523 | 6488-6492 | Positive_regulation | denotes | SSEE | ||
| T3524 | 6523-6527 | Protein | denotes | IKKβ | ||
| T3525 | 6529-6533 | Negative_regulation | denotes | SSAA | ||
| T3526 | 6593-6597 | Protein | denotes | IKKβ | ||
| T3527 | 6610-6619 | Positive_regulation | denotes | necessary | ||
| T3528 | 6639-6643 | Protein | denotes | RPS3 | ||
| T3529 | 6644-6651 | Entity | denotes | nuclear | ||
| T3530 | 6652-6665 | Localization | denotes | translocation | ||
| T3531 | 6666-6680 | Positive_regulation | denotes | in response to | ||
| T5027 | 6708-6712 | Protein | denotes | IκBα | ||
| T5028 | 6713-6724 | Protein_catabolism | denotes | degradation | true | |
| T5029 | 6729-6733 | Protein | denotes | RPS3 | ||
| T5030 | 6734-6741 | Entity | denotes | nuclear | ||
| T5031 | 6742-6755 | Localization | denotes | translocation | true | |
| T5032 | 6767-6776 | Regulation | denotes | regulates | ||
| T5033 | 6781-6788 | Entity | denotes | nuclear | ||
| T5034 | 6789-6795 | Localization | denotes | import | ||
| T5035 | 6805-6808 | Protein | denotes | Rel | ||
| T5036 | 6825-6829 | Protein | denotes | RPS3 | ||
| T5037 | 6891-6898 | Entity | denotes | nuclear | ||
| T5038 | 6899-6912 | Localization | denotes | translocation | ||
| T5039 | 6958-6961 | Protein | denotes | p65 | ||
| T5040 | 6962-6975 | Localization | denotes | translocation | ||
| T5041 | 6997-7001 | Protein | denotes | RPS3 | ||
| T5042 | 7076-7080 | Protein | denotes | RPS3 | ||
| T5043 | 7209-7213 | Protein | denotes | RPS3 | ||
| T5044 | 7214-7221 | Binding | denotes | binding | ||
| T5045 | 7239-7248 | Positive_regulation | denotes | essential | ||
| T5046 | 7253-7260 | Entity | denotes | nuclear | ||
| T5047 | 7261-7274 | Localization | denotes | translocation | ||
| T5048 | 7306-7310 | Protein | denotes | IκBα | ||
| T5049 | 7311-7322 | Protein_catabolism | denotes | degradation | ||
| T5050 | 7328-7340 | Positive_regulation | denotes | prerequisite | ||
| T5051 | 7344-7350 | Regulation | denotes | unmask | ||
| T5052 | 7355-7358 | Entity | denotes | NLS | ||
| T5053 | 7362-7365 | Protein | denotes | p65 | ||
| T5054 | 7376-7380 | Protein | denotes | RPS3 | ||
| T5055 | 7385-7389 | Protein | denotes | IκBα | ||
| T5056 | 7390-7394 | Binding | denotes | bind | ||
| T5057 | 7390-7394 | Binding | denotes | bind | ||
| T5058 | 7398-7401 | Protein | denotes | p65 | ||
| T5059 | 7459-7463 | Protein | denotes | IκBα | ||
| T5060 | 7464-7475 | Protein_catabolism | denotes | degradation | ||
| T5061 | 7479-7487 | Positive_regulation | denotes | required | true | |
| T5062 | 7496-7506 | Localization | denotes | liberation | ||
| T5063 | 7510-7514 | Protein | denotes | RPS3 | ||
| T5064 | 7532-7543 | Binding | denotes | association | true | |
| T5065 | 7547-7551 | Protein | denotes | RPS3 | ||
| T5066 | 7607-7611 | Protein | denotes | IκBα | ||
| T5067 | 7618-7622 | Protein | denotes | IκBα | ||
| T5068 | 7631-7635 | Negative_regulation | denotes | SSAA | ||
| T5069 | 7637-7646 | Negative_regulation | denotes | resistant | ||
| T5070 | 7637-7646 | Negative_regulation | denotes | resistant | ||
| T5071 | 7650-7654 | Protein | denotes | IKKβ | ||
| T5072 | 7655-7662 | Positive_regulation | denotes | induced | ||
| T5073 | 7655-7662 | Positive_regulation | denotes | induced | ||
| T5074 | 7663-7678 | Phosphorylation | denotes | phosphorylation | ||
| T5075 | 7683-7694 | Protein_catabolism | denotes | degradation | ||
| T5076 | 7732-7736 | Protein | denotes | IκBα | ||
| T5077 | 7754-7763 | Positive_regulation | denotes | augmented | ||
| T5078 | 7768-7779 | Binding | denotes | interaction | ||
| T5079 | 7783-7787 | Protein | denotes | RPS3 | ||
| T5080 | 7886-7890 | Protein | denotes | RPS3 | ||
| T5081 | 7902-7913 | Binding | denotes | association | ||
| T5082 | 7918-7927 | Negative_regulation | denotes | abolished | ||
| T5083 | 7951-7961 | Protein_catabolism | denotes | degradable | true | |
| T5084 | 7962-7966 | Protein | denotes | IκBα | ||
| T5085 | 7997-8001 | Protein | denotes | IκBα | ||
| T5086 | 8034-8044 | Negative_regulation | denotes | precluding | true | |
| T5087 | 8045-8049 | Protein | denotes | RPS3 | ||
| T5088 | 8050-8057 | Entity | denotes | nuclear | ||
| T5089 | 8058-8071 | Localization | denotes | translocation | ||
| T5090 | 8090-8094 | Protein | denotes | RPS3 | ||
| T5091 | 8106-8117 | Binding | denotes | association | true | |
| T5092 | 8130-8134 | Protein | denotes | RPS3 | ||
| T5093 | 8141-8149 | Negative_regulation | denotes | reducing | ||
| T5094 | 8150-8154 | Protein | denotes | IκBα | ||
| T5095 | 8155-8165 | Gene_expression | denotes | expression | ||
| T5096 | 8200-8205 | Protein | denotes | siRNA | ||
| T5097 | 8219-8223 | Protein | denotes | IκBα | ||
| T5098 | 8235-8243 | Negative_regulation | denotes | depleted | ||
| T5099 | 8244-8248 | Protein | denotes | IκBα | ||
| T5100 | 8301-8305 | Protein | denotes | RPS3 | ||
| T5101 | 8317-8328 | Binding | denotes | association | ||
| T5102 | 8337-8346 | Positive_regulation | denotes | augmented | true | |
| T5103 | 8378-8385 | Entity | denotes | nuclear | ||
| T5104 | 8386-8390 | Protein | denotes | RPS3 | ||
| T5105 | 8391-8399 | Localization | denotes | detected | true | |
| T5106 | 8467-8473 | Positive_regulation | denotes | induce | ||
| T5107 | 8474-8478 | Protein | denotes | IκBα | ||
| T5108 | 8479-8490 | Protein_catabolism | denotes | degradation | ||
| T5109 | 8546-8555 | Positive_regulation | denotes | increased | true | |
| T5110 | 8546-8555 | Positive_regulation | denotes | increased | true | |
| T5111 | 8556-8567 | Binding | denotes | association | ||
| T5112 | 8576-8580 | Protein | denotes | RPS3 | ||
| T5113 | 8635-8642 | Entity | denotes | nuclear | ||
| T5114 | 8643-8655 | Localization | denotes | accumulation | ||
| T5115 | 8659-8663 | Protein | denotes | RPS3 | ||
| T5116 | 8682-8686 | Protein | denotes | IκBα | ||
| T5117 | 8687-8698 | Protein_catabolism | denotes | degradation | ||
| T5118 | 8803-8811 | Positive_regulation | denotes | promotes | true | |
| T5119 | 8803-8811 | Positive_regulation | denotes | promotes | true | |
| T5120 | 8827-8838 | Binding | denotes | association | ||
| T5121 | 8843-8850 | Entity | denotes | nuclear | ||
| T5122 | 8851-8860 | Localization | denotes | transport | ||
| T5123 | 8864-8868 | Protein | denotes | RPS3 | ||
| T5124 | 8875-8879 | Protein | denotes | IκBα | ||
| T5125 | 8880-8891 | Protein_catabolism | denotes | degradation | ||
| T5126 | 8950-8958 | Positive_regulation | denotes | required | ||
| T5127 | 8967-8971 | Protein | denotes | RPS3 | ||
| T5128 | 8983-8994 | Binding | denotes | association | ||
| T5129 | 9049-9053 | Protein | denotes | IκBα | ||
| T5130 | 9054-9069 | Phosphorylation | denotes | phosphorylation | ||
| T5131 | 9074-9085 | Protein_catabolism | denotes | degradation | ||
| T5132 | 9127-9132 | Positive_regulation | denotes | cause | ||
| T5133 | 9127-9132 | Positive_regulation | denotes | cause | ||
| T5134 | 9133-9137 | Protein | denotes | RPS3 | ||
| T5135 | 9138-9149 | Binding | denotes | association | ||
| T5136 | 9166-9174 | Positive_regulation | denotes | followed | ||
| T5137 | 9178-9185 | Entity | denotes | nuclear | ||
| T5138 | 9186-9199 | Localization | denotes | translocation | ||
| T5139 | 9243-9247 | Protein | denotes | IKKβ | ||
| T5140 | 9248-9263 | Phosphorylation | denotes | phosphorylation | ||
| T5141 | 9267-9271 | Protein | denotes | RPS3 | ||
| T7051 | 9287-9291 | Protein | denotes | IKKβ | ||
| T7052 | 9292-9306 | Phosphorylation | denotes | phosphorylates | ||
| T7053 | 9307-9311 | Protein | denotes | RPS3 | ||
| T7054 | 9315-9325 | Entity | denotes | serine 209 | ||
| T7055 | 9395-9399 | Protein | denotes | IKKβ | ||
| T7056 | 9405-9419 | Phosphorylation | denotes | phosphorylates | ||
| T7057 | 9405-9419 | Phosphorylation | denotes | phosphorylates | ||
| T7058 | 9451-9458 | Protein | denotes | 14-3-3β | ||
| T7059 | 9463-9468 | Protein | denotes | Bcl10 | ||
| T7060 | 9552-9556 | Protein | denotes | IKKβ | ||
| T7061 | 9572-9585 | Phosphorylation | denotes | phosphorylate | true | |
| T7062 | 9586-9590 | Protein | denotes | RPS3 | ||
| T7063 | 9644-9648 | Protein | denotes | RPS3 | ||
| T7064 | 9678-9698 | Phosphorylation | denotes | incorporation of 32P | ||
| T7065 | 9678-9698 | Phosphorylation | denotes | incorporation of 32P | ||
| T7066 | 9702-9719 | Phosphorylation | denotes | autophosphorylatd | ||
| T7067 | 9702-9719 | Phosphorylation | denotes | autophosphorylatd | ||
| T7068 | 9720-9724 | Protein | denotes | IKKα | ||
| T7069 | 9729-9733 | Protein | denotes | IKKβ | ||
| T7070 | 9766-9779 | Phosphorylation | denotes | phosporylated | true | |
| T7071 | 9766-9779 | Phosphorylation | denotes | phosporylated | true | |
| T7072 | 9780-9788 | Protein | denotes | GST-IκBα | ||
| T7073 | 9832-9835 | Protein | denotes | GST | ||
| T7074 | 9888-9892 | Protein | denotes | IKKα | ||
| T7075 | 9896-9900 | Protein | denotes | IKKβ | ||
| T7076 | 9930-9938 | Protein | denotes | GST-RPS3 | ||
| T7077 | 9948-9962 | Phosphorylation | denotes | phosphorylated | true | true |
| T7078 | 9948-9962 | Phosphorylation | denotes | phosphorylated | true | |
| T7079 | 9966-9970 | Protein | denotes | IKKβ | ||
| T7080 | 9980-9984 | Protein | denotes | IKKα | ||
| T7081 | 10045-10049 | Protein | denotes | RPS3 | ||
| T7082 | 10050-10071 | Entity | denotes | amino acid residue(s) | ||
| T7083 | 10072-10086 | Phosphorylation | denotes | phosphorylated | ||
| T7084 | 10090-10094 | Protein | denotes | IKKβ | ||
| T7085 | 10180-10194 | Phosphorylation | denotes | phosphorylated | ||
| T7086 | 10195-10199 | Protein | denotes | RPS3 | ||
| T7087 | 10228-10232 | Protein | denotes | IKKβ | ||
| T7088 | 10233-10247 | Phosphorylation | denotes | phosphorylated | ||
| T7089 | 10248-10252 | Entity | denotes | S209 | ||
| T7090 | 10269-10273 | Protein | denotes | RPS3 | ||
| T7091 | 10296-10300 | Protein | denotes | RPS3 | ||
| T7092 | 10599-10603 | Protein | denotes | IKKβ | ||
| T7093 | 10650-10656 | Protein | denotes | kinase | ||
| T7094 | 10694-10699 | Entity | denotes | S209A | ||
| T7095 | 10700-10706 | Regulation | denotes | mutant | ||
| T7096 | 10707-10711 | Protein | denotes | RPS3 | ||
| T7097 | 10763-10768 | Entity | denotes | S209A | ||
| T7098 | 10769-10777 | Regulation | denotes | mutation | ||
| T7099 | 10778-10785 | Negative_regulation | denotes | reduced | ||
| T7100 | 10786-10791 | Protein | denotes | IKKβ– | ||
| T7101 | 10791-10799 | Positive_regulation | denotes | mediated | ||
| T7102 | 10800-10804 | Protein | denotes | RPS3 | ||
| T7103 | 10805-10820 | Phosphorylation | denotes | phosphorylation | ||
| T7104 | 10928-10942 | Phosphorylation | denotes | phosphorylated | ||
| T7105 | 10943-10947 | Protein | denotes | RPS3 | ||
| T7106 | 10959-10963 | Protein | denotes | RPS3 | ||
| T7107 | 11052-11066 | Entity | denotes | sequence motif | ||
| T7108 | 11093-11103 | Binding | denotes | recognized | ||
| T7109 | 11140-11144 | Protein | denotes | IKKβ | ||
| T7110 | 11298-11302 | Protein | denotes | RPS3 | ||
| T7111 | 11303-11307 | Entity | denotes | S209 | ||
| T7112 | 11308-11323 | Phosphorylation | denotes | phosphorylation | ||
| T7113 | 11328-11331 | Positive_regulation | denotes | due | true | |
| T7114 | 11368-11372 | Protein | denotes | IKKβ | ||
| T7115 | 11452-11456 | Entity | denotes | S209 | ||
| T7116 | 11464-11472 | Positive_regulation | denotes | critical | true | |
| T7117 | 11487-11491 | Protein | denotes | IKKβ | ||
| T7118 | 11492-11506 | Phosphorylation | denotes | phosphorylates | ||
| T7119 | 11507-11511 | Protein | denotes | RPS3 | ||
| T7120 | 11532-11543 | Gene_expression | denotes | transfected | ||
| T7121 | 11532-11543 | Gene_expression | denotes | transfected | ||
| T7122 | 11574-11583 | Protein | denotes | Flag-RPS3 | ||
| T7123 | 11608-11612 | Protein | denotes | IKKβ | ||
| T7124 | 11650-11664 | Positive_regulation | denotes | overexpressing | ||
| T7125 | 11665-11669 | Protein | denotes | IKKβ | ||
| T7126 | 11670-11678 | Positive_regulation | denotes | enhanced | ||
| T7127 | 11679-11688 | Protein | denotes | Flag-RPS3 | ||
| T7128 | 11689-11704 | Phosphorylation | denotes | phosphorylation | ||
| T7129 | 11742-11752 | Negative_regulation | denotes | eliminated | ||
| T7130 | 11756-11776 | Regulation | denotes | alanine substitution | ||
| T7131 | 11793-11797 | Entity | denotes | S209 | ||
| T7132 | 11833-11837 | Protein | denotes | IKKβ | ||
| T7133 | 11838-11853 | Phosphorylation | denotes | phosphorylation | ||
| T7134 | 11885-11911 | Protein | denotes | phospho-S209 RPS3 antibody | ||
| T7135 | 11942-11946 | Protein | denotes | RPS3 | ||
| T7136 | 11951-11965 | Phosphorylation | denotes | phosphorylated | ||
| T7137 | 11969-11973 | Entity | denotes | S209 | ||
| T7138 | 11984-11993 | Regulation | denotes | dependent | ||
| T7139 | 12001-12005 | Positive_regulation | denotes | upon | ||
| T7140 | 12043-12047 | Protein | denotes | RPS3 | ||
| T9002 | 12116-12131 | Phosphorylation | denotes | Phosphorylation | ||
| T9003 | 12135-12139 | Protein | denotes | RPS3 | ||
| T9004 | 12188-12192 | Entity | denotes | S209 | ||
| T9005 | 12193-12208 | Phosphorylation | denotes | phosphorylation | ||
| T9006 | 12209-12221 | Regulation | denotes | plays a role | true | |
| T9007 | 12229-12236 | Entity | denotes | nuclear | ||
| T9008 | 12237-12250 | Localization | denotes | translocation | ||
| T9009 | 12254-12258 | Protein | denotes | RPS3 | ||
| T9010 | 12331-12336 | Entity | denotes | S209A | ||
| T9011 | 12337-12343 | Regulation | denotes | mutant | ||
| T9012 | 12344-12348 | Protein | denotes | RPS3 | ||
| T9013 | 12583-12592 | Positive_regulation | denotes | triggered | ||
| T9014 | 12603-12612 | Protein | denotes | Flag-RPS3 | ||
| T9015 | 12613-12620 | Entity | denotes | nuclear | ||
| T9016 | 12621-12634 | Localization | denotes | translocation | ||
| T9017 | 12655-12659 | Protein | denotes | RPS3 | ||
| T9018 | 12661-12666 | Entity | denotes | S209A | ||
| T9019 | 12668-12675 | Entity | denotes | nuclear | ||
| T9020 | 12676-12689 | Localization | denotes | translocation | ||
| T9021 | 12694-12704 | Negative_regulation | denotes | attenuated | ||
| T9022 | 12735-12741 | Regulation | denotes | impact | true | |
| T9023 | 12765-12779 | Positive_regulation | denotes | overexpressing | ||
| T9024 | 12780-12784 | Protein | denotes | IKKβ | ||
| T9025 | 12788-12792 | Protein | denotes | RPS3 | ||
| T9026 | 12793-12800 | Entity | denotes | nuclear | ||
| T9027 | 12801-12814 | Localization | denotes | translocation | ||
| T9028 | 12816-12820 | Protein | denotes | IKKβ | ||
| T9029 | 12864-12874 | Protein | denotes | luciferase | ||
| T9030 | 12915-12922 | Positive_regulation | denotes | induced | true | |
| T9031 | 12927-12934 | Entity | denotes | nuclear | ||
| T9032 | 12935-12948 | Localization | denotes | translocation | ||
| T9033 | 12978-12982 | Protein | denotes | RPS3 | ||
| T9034 | 13018-13022 | Entity | denotes | S209 | ||
| T9035 | 13023-13038 | Phosphorylation | denotes | phosphorylation | ||
| T9036 | 13042-13050 | Positive_regulation | denotes | critical | ||
| T9037 | 13076-13083 | Positive_regulation | denotes | induced | ||
| T9038 | 13084-13088 | Protein | denotes | RPS3 | ||
| T9039 | 13089-13096 | Entity | denotes | nuclear | ||
| T9040 | 13097-13110 | Localization | denotes | translocation | ||
| T9041 | 13135-13139 | Entity | denotes | S209 | ||
| T9042 | 13140-13155 | Phosphorylation | denotes | phosphorylation | ||
| T9043 | 13159-13163 | Protein | denotes | RPS3 | ||
| T9044 | 13198-13206 | Negative_regulation | denotes | silenced | ||
| T9045 | 13218-13222 | Protein | denotes | RPS3 | ||
| T9046 | 13223-13233 | Gene_expression | denotes | expression | ||
| T9047 | 13301-13305 | Protein | denotes | RPS3 | ||
| T9048 | 13378-13382 | Protein | denotes | RPS3 | ||
| T9049 | 13387-13399 | Gene_expression | denotes | transfection | ||
| T9050 | 13414-13424 | Protein | denotes | RPS3 siRNA | ||
| T9051 | 13434-13441 | Negative_regulation | denotes | reduced | ||
| T9052 | 13453-13457 | Protein | denotes | RPS3 | ||
| T9053 | 13502-13508 | Regulation | denotes | affect | true | |
| T9054 | 13520-13530 | Gene_expression | denotes | expression | ||
| T9055 | 13534-13550 | Protein | denotes | Flag-tagged RPS3 | ||
| T9056 | 13629-13633 | Protein | denotes | RPS3 | ||
| T9057 | 13634-13643 | Negative_regulation | denotes | knockdown | ||
| T9058 | 13644-13651 | Negative_regulation | denotes | reduced | ||
| T9059 | 13656-13663 | Positive_regulation | denotes | induced | ||
| T9060 | 13664-13674 | Gene_expression | denotes | expression | ||
| T9061 | 13687-13693 | Positive_regulation | denotes | driven | ||
| T9062 | 13694-13704 | Protein | denotes | luciferase | ||
| T9063 | 13731-13739 | Negative_regulation | denotes | impaired | ||
| T9064 | 13740-13750 | Protein | denotes | luciferase | ||
| T9065 | 13758-13764 | Positive_regulation | denotes | caused | ||
| T9066 | 13768-13772 | Protein | denotes | RPS3 | ||
| T9067 | 13773-13783 | Negative_regulation | denotes | deficiency | ||
| T9068 | 13811-13823 | Gene_expression | denotes | transfecting | ||
| T9069 | 13852-13856 | Protein | denotes | RPS3 | ||
| T9070 | 14040-14054 | Gene_expression | denotes | overexpression | ||
| T9071 | 14058-14083 | Protein | denotes | green fluorescent protein | ||
| T9072 | 14085-14088 | Protein | denotes | GFP | ||
| T9073 | 14151-14155 | Protein | denotes | RPS3 | ||
| T9074 | 14220-14224 | Protein | denotes | RPS3 | ||
| T9075 | 14225-14229 | Entity | denotes | S209 | ||
| T9076 | 14230-14245 | Phosphorylation | denotes | phosphorylation | ||
| T9077 | 14377-14381 | Entity | denotes | S209 | ||
| T9078 | 14382-14397 | Phosphorylation | denotes | phosphorylation | ||
| T9079 | 14398-14405 | Regulation | denotes | affects | true | |
| T9080 | 14398-14405 | Regulation | denotes | affects | true | |
| T9081 | 14406-14410 | Protein | denotes | RPS3 | ||
| T9082 | 14415-14418 | Protein | denotes | p65 | ||
| T9083 | 14419-14430 | Binding | denotes | recruitment | ||
| T9084 | 14419-14430 | Binding | denotes | recruitment | ||
| T9085 | 14500-14504 | Protein | denotes | RPS3 | ||
| T9086 | 14505-14514 | Negative_regulation | denotes | knockdown | ||
| T9087 | 14528-14538 | Positive_regulation | denotes | stimulated | true | |
| T9088 | 14528-14538 | Positive_regulation | denotes | stimulated | true | |
| T9089 | 14528-14538 | Positive_regulation | denotes | stimulated | true | |
| T9090 | 14528-14538 | Positive_regulation | denotes | stimulated | true | |
| T9091 | 14543-14554 | Binding | denotes | recruitment | ||
| T9092 | 14543-14554 | Binding | denotes | recruitment | ||
| T9093 | 14543-14554 | Binding | denotes | recruitment | ||
| T9094 | 14543-14554 | Binding | denotes | recruitment | ||
| T9095 | 14570-14579 | Gene_expression | denotes | expressed | ||
| T9096 | 14612-14617 | Entity | denotes | S209A | ||
| T9097 | 14618-14622 | Protein | denotes | RPS3 | ||
| T9098 | 14630-14638 | Entity | denotes | κB sites | ||
| T9099 | 14646-14652 | Protein | denotes | NFKBIA | ||
| T9100 | 14657-14660 | Protein | denotes | IL8 | ||
| T9101 | 14699-14703 | Protein | denotes | RPS3 | ||
| T9102 | 14704-14709 | Entity | denotes | S209A | ||
| T9103 | 14717-14723 | Regulation | denotes | impact | true | |
| T9104 | 14727-14730 | Protein | denotes | p65 | ||
| T9105 | 14731-14738 | Entity | denotes | nuclear | ||
| T9106 | 14739-14752 | Localization | denotes | translocation | ||
| T9107 | 14771-14781 | Negative_regulation | denotes | attenuated | ||
| T9108 | 14782-14785 | Protein | denotes | p65 | ||
| T9109 | 14786-14797 | Binding | denotes | recruitment | ||
| T9110 | 14846-14849 | Protein | denotes | p65 | ||
| T9111 | 14850-14860 | Localization | denotes | attraction | ||
| T9112 | 14864-14868 | Protein | denotes | RPS3 | ||
| T9113 | 14899-14908 | Entity | denotes | promoters | ||
| T9114 | 14917-14921 | Protein | denotes | CD25 | ||
| T9115 | 14926-14935 | Positive_regulation | denotes | increased | ||
| T9116 | 15029-15038 | Protein | denotes | Flag-RPS3 | ||
| T9117 | 15042-15045 | Protein | denotes | p65 | ||
| T9118 | 15046-15057 | Localization | denotes | recruitment | true | |
| T9119 | 15046-15057 | Localization | denotes | recruitment | true | |
| T9120 | 15061-15065 | Protein | denotes | ACTB | ||
| T9121 | 15066-15074 | Entity | denotes | promoter | ||
| T9122 | 15142-15150 | Regulation | denotes | specific | true | |
| T9123 | 15162-15173 | Localization | denotes | recruitment | ||
| T9124 | 15177-15181 | Protein | denotes | RPS3 | ||
| T9125 | 15208-15219 | Localization | denotes | recruitment | ||
| T9126 | 15223-15226 | Protein | denotes | p65 | ||
| T9127 | 15234-15243 | Entity | denotes | promoters | ||
| T9128 | 15244-15252 | Regulation | denotes | depended | ||
| T9129 | 15244-15252 | Regulation | denotes | depended | ||
| T9130 | 15256-15260 | Entity | denotes | S209 | ||
| T9131 | 15262-15275 | Protein | denotes | Interleukin 8 | ||
| T9132 | 15277-15281 | Protein | denotes | IL-8 | ||
| T9133 | 15283-15292 | Localization | denotes | secretion | ||
| T9134 | 15293-15300 | Positive_regulation | denotes | induced | ||
| T9135 | 15341-15352 | Positive_regulation | denotes | stimulation | ||
| T9136 | 15366-15375 | Negative_regulation | denotes | decreased | ||
| T9137 | 15396-15403 | Negative_regulation | denotes | reduced | ||
| T9138 | 15404-15408 | Protein | denotes | RPS3 | ||
| T9139 | 15409-15412 | Protein | denotes | p65 | ||
| T9140 | 15413-15424 | Binding | denotes | recruitment | ||
| T9141 | 15432-15435 | Protein | denotes | IL8 | ||
| T9142 | 15436-15444 | Entity | denotes | κB sites | ||
| T9143 | 15464-15469 | Entity | denotes | S209A | ||
| T9144 | 15499-15503 | Protein | denotes | RPS3 | ||
| T9145 | 15551-15555 | Protein | denotes | CD25 | ||
| T9146 | 15556-15566 | Gene_expression | denotes | expression | ||
| T9147 | 15614-15618 | Protein | denotes | RPS3 | ||
| T9148 | 15619-15630 | Gene_expression | denotes | transfected | ||
| T9149 | 15673-15677 | Protein | denotes | RPS3 | ||
| T9150 | 15678-15682 | Entity | denotes | S209 | ||
| T9151 | 15683-15698 | Phosphorylation | denotes | phosphorylation | ||
| T9152 | 15699-15701 | Positive_regulation | denotes | by | ||
| T9153 | 15702-15706 | Protein | denotes | IKKβ | ||
| T9154 | 15734-15738 | Protein | denotes | RPS3 | ||
| T11830 | 15797-15802 | Protein | denotes | NleH1 | ||
| T11831 | 15803-15811 | Negative_regulation | denotes | inhibits | ||
| T11832 | 15812-15816 | Protein | denotes | RPS3 | ||
| T11833 | 15817-15832 | Phosphorylation | denotes | phosphorylation | ||
| T11834 | 16148-16153 | Protein | denotes | NleH1 | ||
| T11835 | 16154-16159 | Binding | denotes | binds | ||
| T11836 | 16167-16177 | Negative_regulation | denotes | attenuates | ||
| T11837 | 16178-16182 | Protein | denotes | RPS3 | ||
| T11838 | 16183-16190 | Entity | denotes | nuclear | ||
| T11839 | 16191-16204 | Localization | denotes | translocation | ||
| T11840 | 16221-16225 | Protein | denotes | RPS3 | ||
| T11841 | 16285-16290 | Protein | denotes | NleH1 | ||
| T11842 | 16307-16317 | Negative_regulation | denotes | inhibiting | ||
| T11843 | 16318-16322 | Protein | denotes | RPS3 | ||
| T11844 | 16323-16327 | Entity | denotes | S209 | ||
| T11845 | 16328-16343 | Phosphorylation | denotes | phosphorylation | ||
| T11846 | 16371-16381 | Positive_regulation | denotes | increasing | ||
| T11847 | 16393-16401 | Protein | denotes | NleH1-HA | ||
| T11848 | 16418-16422 | Protein | denotes | TNFα | ||
| T11849 | 16501-16506 | Protein | denotes | NleH1 | ||
| T11850 | 16507-16514 | Negative_regulation | denotes | reduced | ||
| T11851 | 16507-16514 | Negative_regulation | denotes | reduced | ||
| T11852 | 16520-16523 | Protein | denotes | TNF | ||
| T11853 | 16524-16531 | Positive_regulation | denotes | induced | ||
| T11854 | 16550-16554 | Protein | denotes | RPS3 | ||
| T11855 | 16555-16570 | Phosphorylation | denotes | phosphorylation | ||
| T11856 | 16616-16626 | Gene_expression | denotes | Expressing | ||
| T11857 | 16627-16632 | Protein | denotes | NleH1 | ||
| T11858 | 16642-16651 | Negative_regulation | denotes | interfere | ||
| T11859 | 16642-16651 | Negative_regulation | denotes | interfere | ||
| T11860 | 16664-16667 | Protein | denotes | TNF | ||
| T11861 | 16680-16690 | Positive_regulation | denotes | activation | ||
| T11862 | 16694-16698 | Protein | denotes | IκBα | ||
| T11863 | 16699-16710 | Protein_catabolism | denotes | degradation | ||
| T11864 | 16732-16736 | Negative_regulation | denotes | lack | ||
| T11865 | 16740-16745 | Protein | denotes | NleH1 | ||
| T11866 | 16746-16752 | Regulation | denotes | impact | ||
| T11867 | 16756-16759 | Protein | denotes | p65 | ||
| T11868 | 16760-16767 | Entity | denotes | nuclear | ||
| T11869 | 16768-16781 | Localization | denotes | translocation | ||
| T11870 | 16810-16815 | Protein | denotes | NleH1 | ||
| T11871 | 16816-16824 | Negative_regulation | denotes | inhibits | true | |
| T11872 | 16825-16829 | Protein | denotes | RPS3 | ||
| T11873 | 16830-16845 | Phosphorylation | denotes | phosphorylation | ||
| T11874 | 16913-16920 | Negative_regulation | denotes | lacking | ||
| T11875 | 16928-16933 | Protein | denotes | nleH1 | ||
| T11876 | 16935-16941 | Protein | denotes | ΔnleH1 | ||
| T11877 | 17003-17008 | Protein | denotes | NleH1 | ||
| T11878 | 17031-17036 | Protein | denotes | ΔescN | ||
| T11879 | 17060-17063 | Protein | denotes | TNF | ||
| T11880 | 17095-17103 | Positive_regulation | denotes | increase | ||
| T11881 | 17107-17111 | Protein | denotes | RPS3 | ||
| T11882 | 17112-17116 | Entity | denotes | S209 | ||
| T11883 | 17117-17132 | Phosphorylation | denotes | phosphorylation | ||
| T11884 | 17180-17184 | Protein | denotes | RPS3 | ||
| T11885 | 17185-17189 | Entity | denotes | S209 | ||
| T11886 | 17190-17205 | Phosphorylation | denotes | phosphorylation | ||
| T11887 | 17224-17232 | Negative_regulation | denotes | impaired | ||
| T11888 | 17302-17305 | Protein | denotes | TNF | ||
| T11889 | 17306-17313 | Positive_regulation | denotes | induced | ||
| T11890 | 17314-17318 | Protein | denotes | RPS3 | ||
| T11891 | 17319-17323 | Entity | denotes | S209 | ||
| T11892 | 17324-17339 | Phosphorylation | denotes | phosphorylation | ||
| T11893 | 17344-17354 | Negative_regulation | denotes | unimpaired | true | |
| T11894 | 17344-17354 | Negative_regulation | denotes | unimpaired | true | |
| T11895 | 17385-17391 | Protein | denotes | ΔnleH1 | ||
| T11896 | 17395-17400 | Protein | denotes | ΔescN | ||
| T11897 | 17457-17463 | Protein | denotes | ΔnleH1 | ||
| T11898 | 17467-17472 | Protein | denotes | ΔescN | ||
| T11899 | 17503-17513 | Negative_regulation | denotes | attenuated | ||
| T11900 | 17503-17513 | Negative_regulation | denotes | attenuated | ||
| T11901 | 17514-17517 | Protein | denotes | TNF | ||
| T11902 | 17518-17525 | Positive_regulation | denotes | induced | ||
| T11903 | 17526-17530 | Protein | denotes | RPS3 | ||
| T11904 | 17531-17538 | Entity | denotes | nuclear | ||
| T11905 | 17539-17552 | Localization | denotes | translocation | ||
| T11906 | 17576-17580 | Protein | denotes | RPS3 | ||
| T11907 | 17581-17596 | Phosphorylation | denotes | phosphorylation | ||
| T11908 | 17605-17612 | Entity | denotes | nuclear | ||
| T11909 | 17613-17626 | Localization | denotes | translocation | ||
| T11910 | 17728-17732 | Protein | denotes | RPS3 | ||
| T11911 | 17733-17737 | Entity | denotes | S209 | ||
| T11912 | 17738-17753 | Phosphorylation | denotes | phosphorylation | ||
| T11913 | 17757-17766 | Regulation | denotes | important | ||
| T11914 | 17771-17778 | Entity | denotes | nuclear | ||
| T11915 | 17779-17792 | Localization | denotes | translocation | ||
| T11916 | 17813-17818 | Protein | denotes | NleH1 | ||
| T11917 | 17819-17827 | Negative_regulation | denotes | inhibits | ||
| T11918 | 17828-17832 | Protein | denotes | RPS3 | ||
| T11919 | 17833-17837 | Entity | denotes | S209 | ||
| T11920 | 17838-17853 | Phosphorylation | denotes | phosphorylation | ||
| T11921 | 17891-17895 | Protein | denotes | RPS3 | ||
| T11922 | 17944-17947 | Protein | denotes | IL8 | ||
| T11923 | 17949-17955 | Protein | denotes | NFKBIA | ||
| T11924 | 17961-17968 | Protein | denotes | TNFAIP3 | ||
| T11925 | 18128-18134 | Protein | denotes | ΔnleH1 | ||
| T11926 | 18138-18143 | Protein | denotes | ΔescN | ||
| T11927 | 18176-18184 | Negative_regulation | denotes | deleting | ||
| T11928 | 18185-18190 | Protein | denotes | nleH1 | ||
| T11929 | 18260-18264 | Protein | denotes | CD25 | ||
| T11930 | 18269-18277 | Protein | denotes | TNFSF13B | ||
| T11931 | 18343-18348 | Protein | denotes | NleH1 | ||
| T11932 | 18414-18422 | Negative_regulation | denotes | blocking | ||
| T11933 | 18423-18427 | Protein | denotes | RPS3 | ||
| T11934 | 18428-18432 | Entity | denotes | S209 | ||
| T11935 | 18433-18448 | Phosphorylation | denotes | phosphorylation | ||
| T11936 | 18480-18484 | Protein | denotes | RPS3 | ||
| T14712 | 19705-19723 | Phosphorylation | denotes | autophosphorylated | ||
| T14713 | 19755-19762 | Regulation | denotes | depends | ||
| T14714 | 19770-19780 | Entity | denotes | lysine 159 | ||
| T14715 | 19824-19829 | Protein | denotes | NleH1 | ||
| T14716 | 19830-19838 | Negative_regulation | denotes | inhibits | ||
| T14717 | 19839-19843 | Protein | denotes | RPS3 | ||
| T14718 | 19844-19848 | Entity | denotes | S209 | ||
| T14719 | 19849-19864 | Phosphorylation | denotes | phosphorylation | ||
| T14720 | 19934-19943 | Protein | denotes | His-NleH1 | ||
| T14721 | 19965-19974 | Protein | denotes | His-NleH1 | ||
| T14722 | 20008-20013 | Protein | denotes | NleH1 | ||
| T14723 | 20017-20035 | Phosphorylation | denotes | autophosphorylated | ||
| T14724 | 20044-20049 | Entity | denotes | K159A | ||
| T14725 | 20056-20061 | Protein | denotes | NleH1 | ||
| T14726 | 20062-20073 | Negative_regulation | denotes | kinase-dead | ||
| T14727 | 20134-20142 | Regulation | denotes | required | true | |
| T14728 | 20147-20152 | Protein | denotes | NleH1 | ||
| T14729 | 20156-20163 | Negative_regulation | denotes | inhibit | ||
| T14730 | 20164-20168 | Protein | denotes | IKKβ | ||
| T14731 | 20169-20184 | Phosphorylation | denotes | phosphorlyation | ||
| T14732 | 20188-20192 | Protein | denotes | RPS3 | ||
| T14733 | 20196-20200 | Entity | denotes | S209 | ||
| T14734 | 20254-20259 | Protein | denotes | NleH1 | ||
| T14735 | 20285-20290 | Protein | denotes | NleH1 | ||
| T14736 | 20291-20301 | Gene_expression | denotes | expression | ||
| T14737 | 20316-20323 | Negative_regulation | denotes | reduced | ||
| T14738 | 20328-20335 | Positive_regulation | denotes | induced | ||
| T14739 | 20336-20340 | Protein | denotes | RPS3 | ||
| T14740 | 20341-20345 | Entity | denotes | S209 | ||
| T14741 | 20346-20361 | Phosphorylation | denotes | phosphorylation | ||
| T14742 | 20388-20394 | Negative_regulation | denotes | failed | ||
| T14743 | 20420-20425 | Protein | denotes | NleH1 | ||
| T14744 | 20445-20453 | Positive_regulation | denotes | required | ||
| T14745 | 20457-20464 | Negative_regulation | denotes | protect | ||
| T14746 | 20465-20469 | Protein | denotes | RPS3 | ||
| T14747 | 20475-20479 | Protein | denotes | IKKβ | ||
| T14748 | 20480-20488 | Positive_regulation | denotes | mediated | ||
| T14749 | 20489-20504 | Phosphorylation | denotes | phosphorylation | ||
| T14750 | 20648-20652 | Protein | denotes | NleH | ||
| T14751 | 20653-20662 | Negative_regulation | denotes | inhibited | ||
| T14752 | 20653-20662 | Negative_regulation | denotes | inhibited | ||
| T14753 | 20663-20667 | Protein | denotes | RPS3 | ||
| T14754 | 20668-20675 | Entity | denotes | nuclear | ||
| T14755 | 20676-20689 | Localization | denotes | translocation | ||
| T14756 | 20694-20698 | Protein | denotes | RPS3 | ||
| T14757 | 20699-20708 | Regulation | denotes | dependent | ||
| T14758 | 20715-20725 | Protein | denotes | luciferase | ||
| T14759 | 20726-20734 | Positive_regulation | denotes | activity | ||
| T14760 | 20770-20775 | Protein | denotes | NleH1 | ||
| T14761 | 20797-20801 | Protein | denotes | RPS3 | ||
| T14762 | 20802-20806 | Entity | denotes | S209 | ||
| T14763 | 20807-20822 | Phosphorylation | denotes | phosphorylation | ||
| T14764 | 20941-20949 | Positive_regulation | denotes | increase | ||
| T14765 | 20953-20957 | Protein | denotes | RPS3 | ||
| T14766 | 20958-20962 | Entity | denotes | S209 | ||
| T14767 | 20963-20978 | Phosphorylation | denotes | phosphorylation | ||
| T14768 | 20995-21007 | Positive_regulation | denotes | augmentation | ||
| T14769 | 21011-21015 | Protein | denotes | RPS3 | ||
| T14770 | 21016-21031 | Phosphorylation | denotes | phosphorylation | ||
| T14771 | 21036-21043 | Negative_regulation | denotes | reduced | ||
| T14772 | 21113-21117 | Protein | denotes | RPS3 | ||
| T14773 | 21118-21133 | Phosphorylation | denotes | phosphorylation | ||
| T14774 | 21138-21146 | Positive_regulation | denotes | enhanced | ||
| T14775 | 21199-21206 | Negative_regulation | denotes | lacking | ||
| T14776 | 21207-21211 | Protein | denotes | NleH | ||
| T14777 | 21222-21227 | Protein | denotes | ΔnleH | ||
| T14778 | 21262-21267 | Protein | denotes | NleH1 | ||
| T14779 | 21307-21312 | Protein | denotes | ΔnleH | ||
| T14780 | 21348-21355 | Gene_expression | denotes | express | ||
| T14781 | 21390-21395 | Protein | denotes | NleH1 | ||
| T14782 | 21411-21416 | Protein | denotes | ΔnleH | ||
| T14783 | 21439-21444 | Protein | denotes | NleH1 | ||
| T14784 | 21452-21461 | Negative_regulation | denotes | abolished | ||
| T14785 | 21462-21465 | Protein | denotes | TNF | ||
| T14786 | 21466-21473 | Positive_regulation | denotes | induced | ||
| T14787 | 21474-21478 | Protein | denotes | RPS3 | ||
| T14788 | 21479-21483 | Entity | denotes | S209 | ||
| T14789 | 21484-21499 | Phosphorylation | denotes | phosphorylation | ||
| T14790 | 21543-21550 | Negative_regulation | denotes | inhibit | true | |
| T14791 | 21551-21555 | Protein | denotes | RPS3 | ||
| T14792 | 21556-21571 | Phosphorylation | denotes | phosphorylation | ||
| T14793 | 21628-21633 | Protein | denotes | NleH1 | ||
| T14794 | 21653-21661 | Positive_regulation | denotes | required | ||
| T14795 | 21665-21670 | Negative_regulation | denotes | block | ||
| T14796 | 21671-21675 | Protein | denotes | RPS3 | ||
| T14797 | 21676-21680 | Entity | denotes | S209 | ||
| T14798 | 21681-21696 | Phosphorylation | denotes | phosphorylation | ||
| T14799 | 21750-21755 | Protein | denotes | NleH1 | ||
| T14800 | 21782-21788 | Negative_regulation | denotes | impair | true | |
| T14801 | 21800-21807 | Entity | denotes | nuclear | ||
| T14802 | 21808-21821 | Localization | denotes | translocation | ||
| T14803 | 21825-21829 | Protein | denotes | RPS3 | ||
| T14804 | 21830-21837 | Positive_regulation | denotes | trigged | ||
| T14805 | 21845-21866 | Positive_regulation | denotes | constitutively-active | ||
| T14806 | 21867-21871 | Protein | denotes | IKKβ | ||
| T14807 | 21873-21877 | Protein | denotes | IKKβ | ||
| T14808 | 21879-21883 | Positive_regulation | denotes | SSEE | ||
| T14809 | 21954-21963 | Protein | denotes | SSEE IKKβ | ||
| T14810 | 21974-21983 | Positive_regulation | denotes | triggered | ||
| T14811 | 21989-21993 | Protein | denotes | RPS3 | ||
| T14812 | 21994-22001 | Entity | denotes | nuclear | ||
| T14813 | 22002-22015 | Localization | denotes | translocation | ||
| T14814 | 22025-22036 | Negative_regulation | denotes | kinase-dead | ||
| T14815 | 22037-22041 | Protein | denotes | IKKβ | ||
| T14816 | 22043-22047 | Negative_regulation | denotes | SSAA | ||
| T14817 | 22068-22072 | Protein | denotes | RPS3 | ||
| T14818 | 22073-22080 | Entity | denotes | nuclear | ||
| T14819 | 22081-22093 | Localization | denotes | accumulation | ||
| T14820 | 22112-22120 | Negative_regulation | denotes | retarded | ||
| T14821 | 22217-22223 | Protein | denotes | ΔnleH1 | ||
| T14822 | 22227-22232 | Protein | denotes | ΔescN | ||
| T14823 | 22264-22268 | Protein | denotes | RPS3 | ||
| T14824 | 22269-22276 | Entity | denotes | nuclear | ||
| T14825 | 22277-22290 | Localization | denotes | translocation | ||
| T14826 | 22301-22305 | Protein | denotes | IKKβ | ||
| T14827 | 22310-22314 | Protein | denotes | IKKβ | ||
| T14828 | 22316-22320 | Positive_regulation | denotes | SSEE | ||
| T14829 | 22322-22332 | Gene_expression | denotes | expressing | ||
| T14830 | 22322-22332 | Gene_expression | denotes | expressing | ||
| T14831 | 22390-22396 | Regulation | denotes | affect | true | |
| T14832 | 22401-22405 | Protein | denotes | RPS3 | ||
| T14833 | 22406-22413 | Entity | denotes | nuclear | ||
| T14834 | 22414-22427 | Localization | denotes | translocation | ||
| T14835 | 22431-22435 | Protein | denotes | IKKβ | ||
| T14836 | 22437-22441 | Negative_regulation | denotes | SSAA | ||
| T14837 | 22443-22453 | Gene_expression | denotes | expressing | ||
| T14838 | 22525-22530 | Protein | denotes | NleH1 | ||
| T14839 | 22557-22564 | Negative_regulation | denotes | inhibit | ||
| T14840 | 22565-22569 | Protein | denotes | RPS3 | ||
| T14841 | 22570-22577 | Entity | denotes | nuclear | ||
| T14842 | 22578-22591 | Localization | denotes | translocation | ||
| T14843 | 22606-22616 | Gene_expression | denotes | expressing | ||
| T14844 | 22632-22641 | Positive_regulation | denotes | activated | ||
| T14845 | 22642-22646 | Protein | denotes | IKKβ | ||
| T14846 | 22668-22673 | Protein | denotes | NleH1 | ||
| T14847 | 22689-22702 | Phosphorylation | denotes | phosphorylate | ||
| T14848 | 22703-22707 | Protein | denotes | IKKβ | ||
| T14849 | 22708-22712 | Positive_regulation | denotes | thus | true | |
| T14850 | 22713-22723 | Negative_regulation | denotes | inhibiting | ||
| T14851 | 22724-22728 | Protein | denotes | IKKβ | ||
| T14852 | 22729-22737 | Positive_regulation | denotes | mediated | ||
| T14853 | 22738-22742 | Protein | denotes | RPS3 | ||
| T14854 | 22743-22747 | Entity | denotes | S209 | ||
| T14855 | 22748-22763 | Phosphorylation | denotes | phosphorylation | ||
| T14856 | 22826-22842 | Protein | denotes | Flag-IKKβ (K44A) | ||
| T14857 | 22872-22881 | Protein | denotes | His-NleH1 | ||
| T14858 | 22901-22905 | Protein | denotes | IKKβ | ||
| T14859 | 22906-22925 | Phosphorylation | denotes | autophosphorylation | ||
| T14860 | 22944-22949 | Protein | denotes | NleH1 | ||
| T14861 | 22958-22973 | Phosphorylation | denotes | phosphorylation | ||
| T14862 | 23018-23035 | Phosphorylation | denotes | 32P incorporation | true | |
| T14863 | 23039-23043 | Protein | denotes | IKKβ | ||
| T14864 | 23138-23143 | Protein | denotes | NleH1 | ||
| T14865 | 23160-23164 | Protein | denotes | IKKβ | ||
| T14866 | 23277-23281 | Protein | denotes | IKKβ | ||
| T14867 | 23296-23300 | Protein | denotes | IKKβ | ||
| T14868 | 23301-23315 | Phosphorylation | denotes | phosphorylated | ||
| T14869 | 23301-23315 | Phosphorylation | denotes | phosphorylated | ||
| T14870 | 23316-23320 | Protein | denotes | RPS3 | ||
| T14871 | 23343-23351 | Protein | denotes | GST-IκBα | ||
| T14872 | 23429-23450 | Regulation | denotes | substrate specificity | ||
| T14873 | 23469-23473 | Protein | denotes | IKKβ | ||
| T14874 | 23479-23484 | Protein | denotes | NleH1 | ||
| T14875 | 23485-23492 | Negative_regulation | denotes | reduced | true | |
| T14876 | 23485-23492 | Negative_regulation | denotes | reduced | true | |
| T14877 | 23493-23497 | Protein | denotes | IKKβ | ||
| T14878 | 23498-23506 | Positive_regulation | denotes | mediated | ||
| T14879 | 23507-23511 | Protein | denotes | RPS3 | ||
| T14880 | 23512-23527 | Phosphorylation | denotes | phosphorylation | ||
| T14881 | 23570-23574 | Protein | denotes | IKKβ | ||
| T14882 | 23575-23583 | Positive_regulation | denotes | mediated | ||
| T14883 | 23584-23592 | Protein | denotes | GST-IκBα | ||
| T14884 | 23593-23608 | Phosphorylation | denotes | phosphorylation | ||
| T14885 | 23685-23690 | Protein | denotes | NleH1 | ||
| T14886 | 23691-23699 | Positive_regulation | denotes | mediated | true | |
| T14887 | 23691-23699 | Positive_regulation | denotes | mediated | true | |
| T14888 | 23691-23699 | Positive_regulation | denotes | mediated | true | |
| T14889 | 23691-23699 | Positive_regulation | denotes | mediated | true | |
| T14890 | 23700-23715 | Phosphorylation | denotes | phosphorylation | ||
| T14891 | 23700-23715 | Phosphorylation | denotes | phosphorylation | ||
| T14892 | 23719-23738 | Phosphorylation | denotes | autophosphorylation | ||
| T14893 | 23719-23738 | Phosphorylation | denotes | autophosphorylation | ||
| T14894 | 23742-23746 | Protein | denotes | RPS3 | ||
| T14895 | 23750-23758 | Protein | denotes | GST-IκBα | ||
| T14896 | 23786-23791 | Protein | denotes | NleH1 | ||
| T14897 | 23832-23836 | Protein | denotes | IKKβ | ||
| T14898 | 23842-23852 | Negative_regulation | denotes | inhibiting | ||
| T14899 | 23857-23861 | Protein | denotes | IKKβ | ||
| T14900 | 23862-23870 | Positive_regulation | denotes | mediated | ||
| T14901 | 23871-23875 | Protein | denotes | RPS3 | ||
| T14902 | 23876-23880 | Entity | denotes | S209 | ||
| T14903 | 23881-23896 | Phosphorylation | denotes | phosphorylation | ||
| T18033 | 24005-24009 | Protein | denotes | RPS3 | ||
| T18034 | 24174-24182 | Positive_regulation | denotes | triggers | true | |
| T18035 | 24183-24187 | Protein | denotes | RPS3 | ||
| T18036 | 24191-24202 | Localization | denotes | translocate | ||
| T18037 | 24244-24251 | Entity | denotes | nucleus | ||
| T18038 | 24273-24277 | Protein | denotes | IKKβ | ||
| T18039 | 24278-24286 | Positive_regulation | denotes | mediated | ||
| T18040 | 24287-24291 | Protein | denotes | RPS3 | ||
| T18041 | 24292-24296 | Entity | denotes | S209 | ||
| T18042 | 24297-24312 | Phosphorylation | denotes | phosphorylation | ||
| T18043 | 24326-24334 | Regulation | denotes | critical | ||
| T18044 | 24364-24371 | Entity | denotes | nuclear | ||
| T18045 | 24372-24378 | Localization | denotes | import | ||
| T18046 | 24449-24453 | Protein | denotes | IKKβ | ||
| T18047 | 24586-24590 | Protein | denotes | RPS3 | ||
| T18048 | 24716-24720 | Protein | denotes | IKKβ | ||
| T18049 | 24815-24819 | Protein | denotes | IKKβ | ||
| T18050 | 24829-24833 | Protein | denotes | IKKα | ||
| T18051 | 24835-24849 | Phosphorylation | denotes | phosphorylated | ||
| T18052 | 24835-24849 | Phosphorylation | denotes | phosphorylated | true | |
| T18053 | 24850-24854 | Protein | denotes | RPS3 | ||
| T18054 | 24900-24910 | Regulation | denotes | modulation | ||
| T18055 | 24900-24910 | Regulation | denotes | modulation | ||
| T18056 | 24915-24919 | Protein | denotes | RPS3 | ||
| T18057 | 24920-24927 | Entity | denotes | nuclear | ||
| T18058 | 24928-24941 | Localization | denotes | translocation | ||
| T18059 | 24943-24946 | Positive_regulation | denotes | via | ||
| T18060 | 25035-25048 | Phosphorylation | denotes | phosphorylate | ||
| T18061 | 25049-25052 | Protein | denotes | p65 | ||
| T18062 | 25060-25064 | Binding | denotes | bind | ||
| T18063 | 25072-25085 | Phosphorylation | denotes | phosphorylate | ||
| T18064 | 25086-25090 | Protein | denotes | IKKβ | ||
| T18065 | 25144-25148 | Protein | denotes | IKKβ | ||
| T18066 | 25149-25154 | Binding | denotes | bound | ||
| T18067 | 25165-25176 | Positive_regulation | denotes | account for | true | |
| T18068 | 25190-25194 | Protein | denotes | RPS3 | ||
| T18069 | 25195-25210 | Phosphorylation | denotes | phosphorylation | ||
| T18070 | 25246-25250 | Protein | denotes | IKKβ | ||
| T18071 | 25308-25312 | Protein | denotes | RPS3 | ||
| T18072 | 25534-25538 | Protein | denotes | RPS3 | ||
| T18073 | 25687-25691 | Protein | denotes | IKKβ | ||
| T18074 | 25692-25700 | Positive_regulation | denotes | mediated | ||
| T18075 | 25701-25705 | Protein | denotes | RPS3 | ||
| T18076 | 25706-25710 | Entity | denotes | S209 | ||
| T18077 | 25711-25726 | Phosphorylation | denotes | phosphorylation | ||
| T18078 | 25748-25757 | Regulation | denotes | modulated | ||
| T18079 | 25831-25836 | Protein | denotes | NleH1 | ||
| T18080 | 25850-25855 | Binding | denotes | binds | ||
| T18081 | 25859-25863 | Protein | denotes | RPS3 | ||
| T18082 | 25997-26002 | Protein | denotes | NleH1 | ||
| T18083 | 26015-26023 | Negative_regulation | denotes | inhibits | ||
| T18084 | 26024-26028 | Protein | denotes | RPS3 | ||
| T18085 | 26029-26044 | Phosphorylation | denotes | phosphorylation | ||
| T18086 | 26051-26060 | Negative_regulation | denotes | retarding | ||
| T18087 | 26065-26072 | Entity | denotes | nuclear | ||
| T18088 | 26073-26086 | Localization | denotes | translocation | ||
| T18089 | 26167-26172 | Protein | denotes | NleH1 | ||
| T18090 | 26190-26203 | Phosphorylation | denotes | phosphorylate | true | |
| T18091 | 26204-26208 | Protein | denotes | IKKβ | ||
| T18092 | 26246-26253 | Negative_regulation | denotes | inhibit | ||
| T18093 | 26254-26258 | Protein | denotes | IKKβ | ||
| T18094 | 26259-26267 | Positive_regulation | denotes | mediated | ||
| T18095 | 26268-26272 | Protein | denotes | RPS3 | ||
| T18096 | 26273-26277 | Entity | denotes | S209 | ||
| T18097 | 26278-26293 | Phosphorylation | denotes | phosphorylation | ||
| T18098 | 26424-26429 | Protein | denotes | NleH1 | ||
| T18099 | 26433-26438 | Regulation | denotes | steer | ||
| T18100 | 26468-26472 | Protein | denotes | IKKβ | ||
| T18101 | 26739-26744 | Protein | denotes | NleH1 | ||
| T18102 | 26777-26781 | Protein | denotes | RPS3 | ||
| T18103 | 26911-26914 | Protein | denotes | IL8 | ||
| T18104 | 26937-26942 | Protein | denotes | NleH1 | ||
| T18105 | 26952-26957 | Negative_regulation | denotes | block | true | |
| T18106 | 26964-26967 | Protein | denotes | p65 | ||
| T18107 | 26968-26975 | Entity | denotes | nuclear | ||
| T18108 | 26976-26989 | Localization | denotes | translocation | ||
| T18109 | 27019-27022 | Protein | denotes | p65 | ||
| T18110 | 27037-27041 | Protein | denotes | RPS3 | ||
| T18111 | 27175-27185 | Negative_regulation | denotes | inhibiting | ||
| T18112 | 27186-27190 | Protein | denotes | RPS3 | ||
| T18113 | 27229-27234 | Protein | denotes | NleH1 | ||
| T18114 | 27821-27829 | Negative_regulation | denotes | impeding | ||
| T18115 | 27830-27834 | Protein | denotes | RPS3 | ||
| T18116 | 27844-27852 | Regulation | denotes | altering | ||
| T18117 | 27853-27856 | Protein | denotes | p65 | ||
| T18118 | 27857-27864 | Entity | denotes | nuclear | ||
| T18119 | 27865-27878 | Localization | denotes | translocation | ||
| T18120 | 28108-28115 | Regulation | denotes | effects | ||
| T18121 | 28136-28140 | Protein | denotes | RPS3 | ||
| T20504 | 29321-29337 | Protein | denotes | Flag-IKKβ (SSEE) | ||
| T20505 | 29339-29355 | Protein | denotes | Flag-IKKβ (SSAA) | ||
| T20506 | 29361-29375 | Protein | denotes | HA-IκBα (SSAA) | ||
| T20507 | 29481-29488 | Protein | denotes | HA-IκBα | ||
| T20508 | 29493-29509 | Protein | denotes | IKKβ (K44A)-Flag | ||
| T20509 | 29558-29567 | Protein | denotes | Flag-RPS3 | ||
| T20510 | 29569-29577 | Protein | denotes | GST-RPS3 | ||
| T20511 | 29579-29586 | Protein | denotes | HA-RPS3 | ||
| T20512 | 29588-29593 | Protein | denotes | VN-HA | ||
| T20513 | 29595-29603 | Protein | denotes | NleH1-HA | ||
| T20514 | 29665-29669 | Protein | denotes | RPS3 | ||
| T20986 | 30305-30309 | Protein | denotes | IKKα | ||
| T20987 | 30470-30478 | Protein | denotes | GST-RPS3 | ||
| T20988 | 30483-30487 | Protein | denotes | RPS3 | ||
| T21544 | 31486-31490 | Protein | denotes | IKKα | ||
| T21545 | 31526-31530 | Protein | denotes | IKKβ | ||
| T21546 | 31566-31570 | Protein | denotes | IκBα | ||
| T21547 | 31606-31610 | Protein | denotes | RPS3 | ||
| T22035 | 32742-32752 | Protein | denotes | luciferase | ||
| T22211 | 33114-33117 | Protein | denotes | IL8 | ||
| T22212 | 33122-33128 | Protein | denotes | NFKBIA | ||
| T22213 | 33141-33145 | Protein | denotes | ACTB | ||
| T22541 | 34908-34915 | Protein | denotes | albumin | ||
| T23100 | 35151-35155 | Protein | denotes | IL-8 | ||
| T23101 | 35242-35255 | Protein | denotes | Interleukin-8 | ||
| T23102 | 35275-35278 | Protein | denotes | kit | ||
| T20985 | 30296-30300 | Protein | denotes | IKKβ | ||
| T22034 | 32705-32715 | Protein | denotes | luciferase | ||
| T21361 | 31009-31017 | Protein | denotes | GST-RPS3 | ||
| T21362 | 31049-31053 | Protein | denotes | IKKβ | ||
| T14709 | 19647-19652 | Protein | denotes | NleH1 | ||
| T14710 | 19664-19668 | Protein | denotes | IKKβ | ||
| T14711 | 19693-19698 | Protein | denotes | NleH1 | ||
| T13727 | 18516-18521 | Protein | denotes | NleH1 | ||
| T13728 | 18522-18530 | Negative_regulation | denotes | inhibits | ||
| T13729 | 18531-18535 | Protein | denotes | RPS3 | ||
| T13730 | 18536-18540 | Entity | denotes | S209 | ||
| T13731 | 18541-18556 | Phosphorylation | denotes | phosphorylation | ||
| T13732 | 18665-18671 | Protein | denotes | ΔnleH1 | ||
| T13733 | 18771-18777 | Protein | denotes | ΔnleH1 | ||
| T13734 | 19007-19012 | Protein | denotes | NleH1 | ||
| T13735 | 19013-19020 | Negative_regulation | denotes | blocked | ||
| T13736 | 19021-19025 | Protein | denotes | RPS3 | ||
| T13737 | 19026-19030 | Entity | denotes | S209 | ||
| T13738 | 19031-19046 | Phosphorylation | denotes | phosphorylation | ||
| T13739 | 19064-19074 | Negative_regulation | denotes | preventing | true | |
| T13740 | 19075-19079 | Protein | denotes | RPS3 | ||
| T13741 | 19080-19087 | Entity | denotes | nuclear | ||
| T13742 | 19088-19101 | Localization | denotes | translocation | ||
| T13743 | 19339-19342 | Negative_regulation | denotes | low | ||
| T13744 | 19353-19360 | Phosphorylation | denotes | phospho | ||
| T13745 | 19361-19365 | Protein | denotes | RPS3 | ||
| T13746 | 19409-19415 | Protein | denotes | ΔnleH1 | ||
| T13747 | 19424-19431 | Phosphorylation | denotes | phospho | ||
| T13748 | 19432-19436 | Protein | denotes | RPS3 | ||
| T13749 | 19463-19470 | Positive_regulation | denotes | intense | ||
| T13750 | 19510-19515 | Protein | denotes | NleH1 | ||
| T13751 | 19516-19524 | Negative_regulation | denotes | inhibits | ||
| T13752 | 19525-19529 | Protein | denotes | RPS3 | ||
| T13753 | 19530-19534 | Entity | denotes | S209 | ||
| T13754 | 19535-19550 | Phosphorylation | denotes | phosphorylation | ||
| R51 | T62 | T63 | themeOf | IKKβ,phosphorylation | ||
| R52 | T63 | T64 | causeOf | phosphorylation,regulates | ||
| R53 | T65 | T67 | themeOf | RPS3,translocation | ||
| R54 | T66 | T67 | locationOf | nuclear,translocation | ||
| R55 | T67 | T64 | themeOf | translocation,regulates | ||
| R56 | T69 | T68 | equivalentTo | RPS3,ribosomal protein S3 | ||
| R57 | T70 | T72 | themeOf | RPS3,translocation | ||
| R58 | T71 | T72 | locationOf | nuclear,translocation | ||
| R59 | T72 | T73 | themeOf | translocation,regulated | ||
| R60 | T75 | T77 | causeOf | phosphorylation,crucial | ||
| R61 | T76 | T75 | themeOf | serine 209,phosphorylation | ||
| R62 | T76 | T74 | partOf | serine 209,IKKβ | ||
| R63 | T78 | T80 | themeOf | RPS3,localization | ||
| R64 | T78 | T82 | themeOf | RPS3,activating | ||
| R65 | T79 | T80 | locationOf | nuclear,localization | ||
| R66 | T80 | T81 | themeOf | localization,in response to | ||
| R67 | T81 | T77 | themeOf | in response to,crucial | ||
| R68 | T82 | T81 | causeOf | activating,in response to | ||
| R69 | T83 | T84 | causeOf | NleH1,inhibited | ||
| R70 | T84 | T88 | causeOf | inhibited,blocked | ||
| R71 | T86 | T87 | themeOf | S209,phosphorylation | ||
| R72 | T86 | T85 | partOf | S209,RPS3 | ||
| R73 | T87 | T84 | themeOf | phosphorylation,inhibited | ||
| R74 | T89 | T88 | themeOf | RPS3,blocked | ||
| R75 | T90 | T91 | causeOf | IKKβ,dependent | ||
| R76 | T92 | T91 | themeOf | modification,dependent | ||
| R77 | T93 | T92 | themeOf | RPS3,modification | ||
| R594 | T730 | T729 | equivalentTo | p65,RelA | ||
| R595 | T736 | T735 | equivalentTo | RPS3,ribosomal protein S3 | ||
| R596 | T740 | T741 | themeOf | immunoglobulin κ light chain,expression | ||
| R597 | T742 | T747 | causeOf | NleH1,affecting | ||
| R598 | T742 | T743 | causeOf | NleH1,attenuating | ||
| R599 | T744 | T746 | themeOf | RPS3,translocation | ||
| R600 | T745 | T746 | locationOf | nuclear,translocation | ||
| R601 | T746 | T743 | themeOf | translocation,attenuating | ||
| R602 | T748 | T749 | themeOf | p65,localization | ||
| R603 | T749 | T747 | themeOf | localization,affecting | ||
| R604 | T751 | T753 | themeOf | RPS3,translocation | ||
| R605 | T752 | T753 | locationOf | nuclear,translocation | ||
| R606 | T753 | T750 | themeOf | translocation,induce | ||
| R607 | T755 | T754 | themeOf | RPS3,binding | ||
| R608 | T756 | T757 | themeOf | RPS3,phosphorylated | ||
| R609 | T758 | T759 | themeOf | RPS3,phosphorylated | ||
| R610 | T761 | T763 | causeOf | Inhibitor of κB (IκB) kinase beta,phosphorylated | ||
| R611 | T762 | T761 | equivalentTo | IKKβ,Inhibitor of κB (IκB) kinase beta | ||
| R612 | T765 | T763 | themeOf | serine 209,phosphorylated | ||
| R613 | T765 | T764 | partOf | serine 209,RPS3 | ||
| R614 | T766 | T770 | themeOf | RPS3,association | ||
| R615 | T767 | T768 | themeOf | S209,phosphorylation | ||
| R616 | T767 | T766 | partOf | S209,RPS3 | ||
| R617 | T768 | T769 | causeOf | phosphorylation,enhanced | ||
| R618 | T769 | T771 | causeOf | enhanced,mediating | ||
| R619 | T770 | T769 | themeOf | association,enhanced | ||
| R620 | T772 | T774 | themeOf | RPS3,translocation | ||
| R621 | T773 | T774 | locationOf | nuclear,translocation | ||
| R622 | T774 | T771 | themeOf | translocation,mediating | ||
| R623 | T775 | T776 | causeOf | NleH1,inhibited | ||
| R624 | T778 | T776 | themeOf | S209,inhibited | ||
| R625 | T778 | T777 | partOf | S209,RPS3 | ||
| R1571 | T1988 | T1989 | themeOf | RPS3,phosphorylated | ||
| R1572 | T1991 | T1990 | themeOf | 32P-incorporation,increase | ||
| R1573 | T1993 | T1991 | themeOf | RPS3,32P-incorporation | ||
| R1574 | T1993 | T1992 | themeOf | RPS3,increase | ||
| R1575 | T1995 | T1996 | themeOf | residues,phosphorylated | ||
| R1576 | T1995 | T1994 | partOf | residues,RPS3 | ||
| R1577 | T2000 | T1999 | themeOf | phosphorylation,stimulated | ||
| R1578 | T2001 | T1998 | themeOf | degradaion,stimulated | ||
| R1579 | T2002 | T2000 | themeOf | IκBα,phosphorylation | ||
| R1580 | T2002 | T2001 | themeOf | IκBα,degradaion | ||
| R1581 | T2005 | T2004 | themeOf | serine residues,phosphorylation | ||
| R1582 | T2005 | T2003 | partOf | serine residues,RPS3 | ||
| R1583 | T2006 | T2009 | themeOf | tyrosine,phosphorylation | ||
| R1584 | T2006 | T2010 | partOf | tyrosine,RPS3 | ||
| R1585 | T2007 | T2008 | themeOf | threonine,phosphorylation | ||
| R1586 | T2007 | T2010 | partOf | threonine,RPS3 | ||
| R2042 | T2601 | T2603 | themeOf | RPS3,interaction | ||
| R2043 | T2602 | T2603 | themeOf | IKKβ,interaction | ||
| R2044 | T2612 | T2611 | themeOf | IKKβ,activated | ||
| R2045 | T2612 | T2613 | themeOf | IKKβ,bind | ||
| R2046 | T2615 | T2613 | themeOf | RPS3,bind | ||
| R2047 | T2615 | T2614 | themeOf | RPS3,phosphorylate | ||
| R2048 | T2617 | T2616 | themeOf | IKKβ,expressed | ||
| R2049 | T2617 | T2619 | themeOf | IKKβ,interacted | ||
| R2050 | T2618 | T2619 | themeOf | RPS3,interacted | ||
| R2051 | T2620 | T2622 | themeOf | IKKβ,interaction | ||
| R2052 | T2621 | T2622 | themeOf | RPS3,interaction | ||
| R2053 | T2623 | T2625 | themeOf | RPS3,association | ||
| R2054 | T2624 | T2625 | themeOf | IKKβ,association | ||
| R2055 | T2625 | T2626 | themeOf | association,augmented | ||
| R2056 | T2626 | T2627 | causeOf | augmented,following | ||
| R2057 | T2629 | T2630 | themeOf | serine,phosphorylation | ||
| R2058 | T2629 | T2628 | partOf | serine,RPS3 | ||
| R2059 | T2630 | T2627 | themeOf | phosphorylation,following | ||
| R2060 | T2632 | T2631 | themeOf | RPS3,interaction | ||
| R2061 | T2633 | T2631 | themeOf | IKKα,interaction | ||
| R2688 | T3438 | T3439 | causeOf | IKKβ,required | ||
| R2689 | T3440 | T3442 | themeOf | RPS3,translocation | ||
| R2690 | T3441 | T3442 | locationOf | nuclear,translocation | ||
| R2691 | T3442 | T3439 | themeOf | translocation,required | ||
| R2692 | T3443 | T3445 | themeOf | RPS3,interaction | ||
| R2693 | T3444 | T3445 | themeOf | IKKβ,interaction | ||
| R2694 | T3445 | T3446 | causeOf | interaction,required | ||
| R2695 | T3447 | T3449 | themeOf | RPS3,translocation | ||
| R2696 | T3448 | T3449 | locationOf | nuclear,translocation | ||
| R2697 | T3449 | T3446 | themeOf | translocation,required | ||
| R2698 | T3452 | T3454 | themeOf | IKKα,expression | ||
| R2699 | T3453 | T3455 | themeOf | IKKβ,expression | ||
| R2700 | T3454 | T3450 | themeOf | expression,knocked down | ||
| R2701 | T3455 | T3451 | themeOf | expression,knocked down | ||
| R2702 | T3457 | T3459 | themeOf | RPS3,migration | ||
| R2703 | T3458 | T3459 | locationOf | nuclear,migration | ||
| R2704 | T3459 | T3456 | themeOf | migration,induced | ||
| R2705 | T3461 | T3463 | themeOf | RPS3,translocation | ||
| R2706 | T3462 | T3463 | locationOf | nuclear,translocation | ||
| R2707 | T3463 | T3460 | themeOf | translocation,triggered | ||
| R2708 | T3464 | T3466 | themeOf | RPS3,translocation | ||
| R2709 | T3465 | T3466 | locationOf | nuclear,translocation | ||
| R2710 | T3466 | T3467 | themeOf | translocation,impaired | ||
| R2711 | T3468 | T3469 | themeOf | IKKα,silencing | ||
| R2712 | T3469 | T3467 | causeOf | silencing,impaired | ||
| R2713 | T3470 | T3472 | causeOf | knockdown,attenuated | ||
| R2714 | T3471 | T3470 | themeOf | IKKβ,knockdown | ||
| R2715 | T3473 | T3475 | themeOf | RPS3,accumulation | ||
| R2716 | T3474 | T3475 | locationOf | nuclear,accumulation | ||
| R2717 | T3475 | T3476 | themeOf | accumulation,following | ||
| R2718 | T3476 | T3472 | themeOf | following,attenuated | ||
| R2719 | T3477 | T3482 | causeOf | expression,necessary | ||
| R2720 | T3478 | T3481 | causeOf | expression,necessary | ||
| R2721 | T3479 | T3477 | themeOf | IKKβ,expression | ||
| R2722 | T3480 | T3478 | themeOf | IKKα,expression | ||
| R2723 | T3483 | T3482 | themeOf | induced,necessary | ||
| R2724 | T3483 | T3481 | themeOf | induced,necessary | ||
| R2725 | T3484 | T3486 | themeOf | RPS3,translocation | ||
| R2726 | T3485 | T3486 | locationOf | nuclear,translocation | ||
| R2727 | T3486 | T3483 | themeOf | translocation,induced | ||
| R2728 | T3487 | T3489 | themeOf | p65,translocation | ||
| R2729 | T3488 | T3489 | locationOf | nuclear,translocation | ||
| R2730 | T3489 | T3490 | themeOf | translocation,blocked | ||
| R2731 | T3491 | T3492 | locationOf | nuclear,translocation | ||
| R2732 | T3493 | T3492 | themeOf | RPS3,translocation | ||
| R2733 | T3497 | T3494 | themeOf | IKKβ,expressing | ||
| R2734 | T3497 | T3495 | themeOf | IKKβ,kinase-dead | ||
| R2735 | T3497 | T3496 | themeOf | IKKβ,constitutively-active | ||
| R2736 | T3498 | T3502 | causeOf | SSEE,induced | ||
| R2737 | T3499 | T3501 | causeOf | SSAA,induced | ||
| R2738 | T3500 | T3498 | themeOf | IKKβ,SSEE | ||
| R2739 | T3500 | T3499 | themeOf | IKKβ,SSAA | ||
| R2740 | T3503 | T3502 | themeOf | dependent,induced | ||
| R2741 | T3503 | T3501 | themeOf | dependent,induced | ||
| R2742 | T3504 | T3503 | themeOf | luciferase,dependent | ||
| R2743 | T3505 | T3506 | themeOf | RPS3,remained | ||
| R2744 | T3506 | T3508 | themeOf | remained,in | ||
| R2745 | T3507 | T3506 | locationOf | cytosolic,remained | ||
| R2746 | T3509 | T3510 | themeOf | IKKβ,SSAA | ||
| R2747 | T3510 | T3508 | causeOf | SSAA,in | ||
| R2748 | T3511 | T3512 | themeOf | RPS3,translocated | ||
| R2749 | T3512 | T3514 | themeOf | translocated,in | ||
| R2750 | T3513 | T3512 | locationOf | nucleus,translocated | ||
| R2751 | T3515 | T3516 | themeOf | IKKβ,SSEE | ||
| R2752 | T3516 | T3514 | causeOf | SSEE,in | ||
| R2753 | T3517 | T3521 | themeOf | detectable,increased | ||
| R2754 | T3517 | T3520 | themeOf | detectable,increased | ||
| R2755 | T3518 | T3517 | locationOf | nuclear,detectable | ||
| R2756 | T3519 | T3517 | themeOf | RPS3,detectable | ||
| R2757 | T3522 | T3523 | themeOf | IKKβ,SSEE | ||
| R2758 | T3523 | T3521 | causeOf | SSEE,increased | ||
| R2759 | T3524 | T3525 | themeOf | IKKβ,SSAA | ||
| R2760 | T3525 | T3520 | causeOf | SSAA,increased | ||
| R2761 | T3526 | T3527 | causeOf | IKKβ,necessary | ||
| R2762 | T3528 | T3530 | themeOf | RPS3,translocation | ||
| R2763 | T3529 | T3530 | locationOf | nuclear,translocation | ||
| R2764 | T3530 | T3531 | themeOf | translocation,in response to | ||
| R2765 | T3531 | T3527 | themeOf | in response to,necessary | ||
| R4003 | T5027 | T5028 | themeOf | IκBα,degradation | ||
| R4004 | T5029 | T5031 | themeOf | RPS3,translocation | ||
| R4005 | T5030 | T5031 | locationOf | nuclear,translocation | ||
| R4006 | T5033 | T5034 | locationOf | nuclear,import | ||
| R4007 | T5034 | T5032 | themeOf | import,regulates | ||
| R4008 | T5035 | T5034 | themeOf | Rel,import | ||
| R4009 | T5036 | T5038 | themeOf | RPS3,translocation | ||
| R4010 | T5037 | T5038 | locationOf | nuclear,translocation | ||
| R4011 | T5039 | T5040 | themeOf | p65,translocation | ||
| R4012 | T5043 | T5044 | themeOf | RPS3,binding | ||
| R4013 | T5043 | T5047 | themeOf | RPS3,translocation | ||
| R4014 | T5044 | T5045 | causeOf | binding,essential | ||
| R4015 | T5046 | T5047 | locationOf | nuclear,translocation | ||
| R4016 | T5047 | T5045 | themeOf | translocation,essential | ||
| R4017 | T5048 | T5049 | themeOf | IκBα,degradation | ||
| R4018 | T5049 | T5050 | causeOf | degradation,prerequisite | ||
| R4019 | T5051 | T5050 | themeOf | unmask,prerequisite | ||
| R4020 | T5052 | T5051 | themeOf | NLS,unmask | ||
| R4021 | T5052 | T5053 | partOf | NLS,p65 | ||
| R4022 | T5054 | T5056 | themeOf | RPS3,bind | ||
| R4023 | T5055 | T5057 | themeOf | IκBα,bind | ||
| R4024 | T5058 | T5056 | themeOf | p65,bind | ||
| R4025 | T5058 | T5057 | themeOf | p65,bind | ||
| R4026 | T5059 | T5060 | themeOf | IκBα,degradation | ||
| R4027 | T5060 | T5061 | causeOf | degradation,required | ||
| R4028 | T5062 | T5061 | themeOf | liberation,required | ||
| R4029 | T5063 | T5062 | themeOf | RPS3,liberation | ||
| R4030 | T5065 | T5064 | themeOf | RPS3,association | ||
| R4031 | T5067 | T5068 | themeOf | IκBα,SSAA | ||
| R4032 | T5067 | T5074 | themeOf | IκBα,phosphorylation | ||
| R4033 | T5067 | T5075 | themeOf | IκBα,degradation | ||
| R4034 | T5068 | T5070 | causeOf | SSAA,resistant | ||
| R4035 | T5068 | T5069 | causeOf | SSAA,resistant | ||
| R4036 | T5071 | T5073 | causeOf | IKKβ,induced | ||
| R4037 | T5071 | T5072 | causeOf | IKKβ,induced | ||
| R4038 | T5072 | T5069 | themeOf | induced,resistant | ||
| R4039 | T5073 | T5070 | themeOf | induced,resistant | ||
| R4040 | T5074 | T5073 | themeOf | phosphorylation,induced | ||
| R4041 | T5075 | T5072 | themeOf | degradation,induced | ||
| R4042 | T5078 | T5077 | themeOf | interaction,augmented | ||
| R4043 | T5079 | T5078 | themeOf | RPS3,interaction | ||
| R4044 | T5080 | T5081 | themeOf | RPS3,association | ||
| R4045 | T5081 | T5082 | themeOf | association,abolished | ||
| R4046 | T5083 | T5082 | causeOf | degradable,abolished | ||
| R4047 | T5084 | T5083 | themeOf | IκBα,degradable | ||
| R4048 | T5085 | T5086 | causeOf | IκBα,precluding | ||
| R4049 | T5087 | T5089 | themeOf | RPS3,translocation | ||
| R4050 | T5088 | T5089 | locationOf | nuclear,translocation | ||
| R4051 | T5089 | T5086 | themeOf | translocation,precluding | ||
| R4052 | T5090 | T5091 | themeOf | RPS3,association | ||
| R4053 | T5094 | T5095 | themeOf | IκBα,expression | ||
| R4054 | T5095 | T5093 | themeOf | expression,reducing | ||
| R4055 | T5096 | T5098 | causeOf | siRNA,depleted | ||
| R4056 | T5098 | T5102 | causeOf | depleted,augmented | ||
| R4057 | T5099 | T5098 | themeOf | IκBα,depleted | ||
| R4058 | T5100 | T5101 | themeOf | RPS3,association | ||
| R4059 | T5101 | T5102 | themeOf | association,augmented | ||
| R4060 | T5103 | T5105 | locationOf | nuclear,detected | ||
| R4061 | T5104 | T5105 | themeOf | RPS3,detected | ||
| R4062 | T5106 | T5109 | causeOf | induce,increased | ||
| R4063 | T5106 | T5110 | causeOf | induce,increased | ||
| R4064 | T5107 | T5108 | themeOf | IκBα,degradation | ||
| R4065 | T5108 | T5106 | themeOf | degradation,induce | ||
| R4066 | T5111 | T5109 | themeOf | association,increased | ||
| R4067 | T5112 | T5111 | themeOf | RPS3,association | ||
| R4068 | T5113 | T5114 | locationOf | nuclear,accumulation | ||
| R4069 | T5114 | T5110 | themeOf | accumulation,increased | ||
| R4070 | T5115 | T5114 | themeOf | RPS3,accumulation | ||
| R4071 | T5116 | T5117 | themeOf | IκBα,degradation | ||
| R4072 | T5120 | T5119 | themeOf | association,promotes | ||
| R4073 | T5121 | T5122 | locationOf | nuclear,transport | ||
| R4074 | T5122 | T5118 | themeOf | transport,promotes | ||
| R4075 | T5123 | T5120 | themeOf | RPS3,association | ||
| R4076 | T5123 | T5122 | themeOf | RPS3,transport | ||
| R4077 | T5124 | T5125 | themeOf | IκBα,degradation | ||
| R4078 | T5127 | T5128 | themeOf | RPS3,association | ||
| R4079 | T5128 | T5126 | themeOf | association,required | ||
| R4080 | T5129 | T5130 | themeOf | IκBα,phosphorylation | ||
| R4081 | T5129 | T5131 | themeOf | IκBα,degradation | ||
| R4082 | T5130 | T5133 | causeOf | phosphorylation,cause | ||
| R4083 | T5131 | T5132 | causeOf | degradation,cause | ||
| R4084 | T5134 | T5135 | themeOf | RPS3,association | ||
| R4085 | T5134 | T5138 | themeOf | RPS3,translocation | ||
| R4086 | T5135 | T5136 | causeOf | association,followed | ||
| R4087 | T5136 | T5133 | themeOf | followed,cause | ||
| R4088 | T5136 | T5132 | themeOf | followed,cause | ||
| R4089 | T5137 | T5138 | locationOf | nuclear,translocation | ||
| R4090 | T5138 | T5136 | themeOf | translocation,followed | ||
| R4091 | T5141 | T5140 | themeOf | RPS3,phosphorylation | ||
| R5588 | T7051 | T7052 | causeOf | IKKβ,phosphorylates | ||
| R5589 | T7054 | T7052 | themeOf | serine 209,phosphorylates | ||
| R5590 | T7054 | T7053 | partOf | serine 209,RPS3 | ||
| R5591 | T7055 | T7057 | causeOf | IKKβ,phosphorylates | ||
| R5592 | T7055 | T7056 | causeOf | IKKβ,phosphorylates | ||
| R5593 | T7058 | T7057 | themeOf | 14-3-3β,phosphorylates | ||
| R5594 | T7059 | T7056 | themeOf | Bcl10,phosphorylates | ||
| R5595 | T7060 | T7061 | causeOf | IKKβ,phosphorylate | ||
| R5596 | T7062 | T7061 | themeOf | RPS3,phosphorylate | ||
| R5597 | T7068 | T7064 | themeOf | IKKα,incorporation of 32P | ||
| R5598 | T7068 | T7067 | themeOf | IKKα,autophosphorylatd | ||
| R5599 | T7069 | T7065 | themeOf | IKKβ,incorporation of 32P | ||
| R5600 | T7069 | T7066 | themeOf | IKKβ,autophosphorylatd | ||
| R5601 | T7072 | T7070 | themeOf | GST-IκBα,phosporylated | ||
| R5602 | T7073 | T7071 | themeOf | GST,phosporylated | ||
| R5603 | T7076 | T7078 | themeOf | GST-RPS3,phosphorylated | ||
| R5604 | T7076 | T7077 | themeOf | GST-RPS3,phosphorylated | ||
| R5605 | T7079 | T7078 | causeOf | IKKβ,phosphorylated | ||
| R5606 | T7080 | T7077 | causeOf | IKKα,phosphorylated | ||
| R5607 | T7082 | T7083 | themeOf | amino acid residue(s),phosphorylated | ||
| R5608 | T7082 | T7081 | partOf | amino acid residue(s),RPS3 | ||
| R5609 | T7084 | T7083 | causeOf | IKKβ,phosphorylated | ||
| R5610 | T7086 | T7085 | themeOf | RPS3,phosphorylated | ||
| R5611 | T7087 | T7088 | causeOf | IKKβ,phosphorylated | ||
| R5612 | T7089 | T7088 | themeOf | S209,phosphorylated | ||
| R5613 | T7089 | T7090 | partOf | S209,RPS3 | ||
| R5614 | T7094 | T7095 | themeOf | S209A,mutant | ||
| R5615 | T7094 | T7096 | partOf | S209A,RPS3 | ||
| R5616 | T7097 | T7098 | themeOf | S209A,mutation | ||
| R5617 | T7097 | T7102 | partOf | S209A,RPS3 | ||
| R5618 | T7098 | T7099 | causeOf | mutation,reduced | ||
| R5619 | T7100 | T7101 | causeOf | IKKβ–,mediated | ||
| R5620 | T7101 | T7099 | themeOf | mediated,reduced | ||
| R5621 | T7102 | T7103 | themeOf | RPS3,phosphorylation | ||
| R5622 | T7103 | T7101 | themeOf | phosphorylation,mediated | ||
| R5623 | T7105 | T7104 | themeOf | RPS3,phosphorylated | ||
| R5624 | T7107 | T7108 | themeOf | sequence motif,recognized | ||
| R5625 | T7107 | T7106 | partOf | sequence motif,RPS3 | ||
| R5626 | T7111 | T7112 | themeOf | S209,phosphorylation | ||
| R5627 | T7111 | T7110 | partOf | S209,RPS3 | ||
| R5628 | T7112 | T7113 | themeOf | phosphorylation,due | ||
| R5629 | T7114 | T7113 | causeOf | IKKβ,due | ||
| R5630 | T7115 | T7116 | causeOf | S209,critical | ||
| R5631 | T7115 | T7119 | partOf | S209,RPS3 | ||
| R5632 | T7117 | T7118 | causeOf | IKKβ,phosphorylates | ||
| R5633 | T7118 | T7116 | themeOf | phosphorylates,critical | ||
| R5634 | T7119 | T7118 | themeOf | RPS3,phosphorylates | ||
| R5635 | T7122 | T7120 | themeOf | Flag-RPS3,transfected | ||
| R5636 | T7123 | T7121 | themeOf | IKKβ,transfected | ||
| R5637 | T7124 | T7126 | causeOf | overexpressing,enhanced | ||
| R5638 | T7125 | T7124 | themeOf | IKKβ,overexpressing | ||
| R5639 | T7127 | T7128 | themeOf | Flag-RPS3,phosphorylation | ||
| R5640 | T7128 | T7126 | themeOf | phosphorylation,enhanced | ||
| R5641 | T7128 | T7129 | themeOf | phosphorylation,eliminated | ||
| R5642 | T7130 | T7129 | causeOf | alanine substitution,eliminated | ||
| R5643 | T7131 | T7130 | themeOf | S209,alanine substitution | ||
| R5644 | T7131 | T7127 | partOf | S209,Flag-RPS3 | ||
| R5645 | T7131 | T7133 | themeOf | S209,phosphorylation | ||
| R5646 | T7136 | T7138 | themeOf | phosphorylated,dependent | ||
| R5647 | T7137 | T7136 | themeOf | S209,phosphorylated | ||
| R5648 | T7137 | T7135 | partOf | S209,RPS3 | ||
| R5649 | T7138 | T7139 | themeOf | dependent,upon | ||
| R7172 | T9003 | T9002 | themeOf | RPS3,Phosphorylation | ||
| R7173 | T9004 | T9005 | themeOf | S209,phosphorylation | ||
| R7174 | T9004 | T9009 | partOf | S209,RPS3 | ||
| R7176 | T9007 | T9008 | locationOf | nuclear,translocation | ||
| R7177 | T9008 | T9006 | themeOf | translocation,plays a role | ||
| R7179 | T9010 | T9011 | themeOf | S209A,mutant | ||
| R7180 | T9010 | T9012 | partOf | S209A,RPS3 | ||
| R7181 | T9014 | T9016 | themeOf | Flag-RPS3,translocation | ||
| R7182 | T9015 | T9016 | locationOf | nuclear,translocation | ||
| R7183 | T9016 | T9013 | themeOf | translocation,triggered | ||
| R7184 | T9017 | T9020 | themeOf | RPS3,translocation | ||
| R7185 | T9018 | T9021 | causeOf | S209A,attenuated | ||
| R7186 | T9018 | T9017 | partOf | S209A,RPS3 | ||
| R7187 | T9019 | T9020 | locationOf | nuclear,translocation | ||
| R7188 | T9020 | T9021 | themeOf | translocation,attenuated | ||
| R7189 | T9024 | T9023 | themeOf | IKKβ,overexpressing | ||
| R7190 | T9025 | T9027 | themeOf | RPS3,translocation | ||
| R7191 | T9026 | T9027 | locationOf | nuclear,translocation | ||
| R7192 | T9027 | T9022 | themeOf | translocation,impact | ||
| R7193 | T9031 | T9032 | locationOf | nuclear,translocation | ||
| R7194 | T9032 | T9030 | themeOf | translocation,induced | ||
| R7195 | T9033 | T9032 | themeOf | RPS3,translocation | ||
| R7196 | T9034 | T9035 | themeOf | S209,phosphorylation | ||
| R7197 | T9034 | T9038 | partOf | S209,RPS3 | ||
| R7198 | T9035 | T9036 | causeOf | phosphorylation,critical | ||
| R7199 | T9037 | T9036 | themeOf | induced,critical | ||
| R7200 | T9038 | T9040 | themeOf | RPS3,translocation | ||
| R7201 | T9039 | T9040 | locationOf | nuclear,translocation | ||
| R7202 | T9040 | T9037 | themeOf | translocation,induced | ||
| R7203 | T9041 | T9042 | themeOf | S209,phosphorylation | ||
| R7204 | T9041 | T9043 | partOf | S209,RPS3 | ||
| R7205 | T9045 | T9046 | themeOf | RPS3,expression | ||
| R7206 | T9046 | T9044 | themeOf | expression,silenced | ||
| R7207 | T9048 | T9049 | themeOf | RPS3,transfection | ||
| R7208 | T9050 | T9051 | causeOf | RPS3 siRNA,reduced | ||
| R7209 | T9050 | T9053 | causeOf | RPS3 siRNA,affect | ||
| R7210 | T9052 | T9051 | themeOf | RPS3,reduced | ||
| R7211 | T9054 | T9053 | themeOf | expression,affect | ||
| R7212 | T9055 | T9054 | themeOf | Flag-tagged RPS3,expression | ||
| R7213 | T9056 | T9057 | themeOf | RPS3,knockdown | ||
| R7214 | T9057 | T9058 | causeOf | knockdown,reduced | ||
| R7215 | T9059 | T9058 | themeOf | induced,reduced | ||
| R7216 | T9060 | T9059 | themeOf | expression,induced | ||
| R7217 | T9062 | T9060 | themeOf | luciferase,expression | ||
| R7218 | T9062 | T9061 | themeOf | luciferase,driven | ||
| R7219 | T9063 | T9065 | themeOf | impaired,caused | ||
| R7220 | T9064 | T9063 | themeOf | luciferase,impaired | ||
| R7221 | T9066 | T9067 | themeOf | RPS3,deficiency | ||
| R7222 | T9067 | T9065 | causeOf | deficiency,caused | ||
| R7223 | T9069 | T9068 | themeOf | RPS3,transfecting | ||
| R7224 | T9071 | T9070 | themeOf | green fluorescent protein,overexpression | ||
| R7225 | T9072 | T9071 | equivalentTo | GFP,green fluorescent protein | ||
| R7226 | T9075 | T9076 | themeOf | S209,phosphorylation | ||
| R7227 | T9075 | T9074 | partOf | S209,RPS3 | ||
| R7228 | T9077 | T9078 | themeOf | S209,phosphorylation | ||
| R7229 | T9077 | T9081 | partOf | S209,RPS3 | ||
| R7230 | T9078 | T9079 | causeOf | phosphorylation,affects | ||
| R7231 | T9078 | T9080 | causeOf | phosphorylation,affects | ||
| R7232 | T9081 | T9083 | themeOf | RPS3,recruitment | ||
| R7233 | T9082 | T9084 | themeOf | p65,recruitment | ||
| R7234 | T9083 | T9079 | themeOf | recruitment,affects | ||
| R7235 | T9084 | T9080 | themeOf | recruitment,affects | ||
| R7236 | T9085 | T9086 | themeOf | RPS3,knockdown | ||
| R7237 | T9091 | T9089 | themeOf | recruitment,stimulated | ||
| R7238 | T9092 | T9090 | themeOf | recruitment,stimulated | ||
| R7239 | T9093 | T9087 | themeOf | recruitment,stimulated | ||
| R7240 | T9094 | T9088 | themeOf | recruitment,stimulated | ||
| R7241 | T9096 | T9094 | themeOf | S209A,recruitment | ||
| R7242 | T9096 | T9097 | partOf | S209A,RPS3 | ||
| R7243 | T9096 | T9091 | themeOf | S209A,recruitment | ||
| R7244 | T9097 | T9093 | themeOf | RPS3,recruitment | ||
| R7245 | T9097 | T9092 | themeOf | RPS3,recruitment | ||
| R7246 | T9097 | T9095 | themeOf | RPS3,expressed | ||
| R7247 | T9098 | T9094 | themeOf | κB sites,recruitment | ||
| R7248 | T9098 | T9099 | partOf | κB sites,NFKBIA | ||
| R7249 | T9098 | T9093 | themeOf | κB sites,recruitment | ||
| R7250 | T9098 | T9091 | themeOf | κB sites,recruitment | ||
| R7251 | T9098 | T9100 | partOf | κB sites,IL8 | ||
| R7252 | T9098 | T9092 | themeOf | κB sites,recruitment | ||
| R7253 | T9102 | T9103 | causeOf | S209A,impact | ||
| R7254 | T9102 | T9101 | partOf | S209A,RPS3 | ||
| R7255 | T9102 | T9107 | causeOf | S209A,attenuated | ||
| R7256 | T9104 | T9106 | themeOf | p65,translocation | ||
| R7257 | T9105 | T9106 | locationOf | nuclear,translocation | ||
| R7258 | T9106 | T9103 | themeOf | translocation,impact | ||
| R7259 | T9108 | T9109 | themeOf | p65,recruitment | ||
| R7260 | T9109 | T9107 | themeOf | recruitment,attenuated | ||
| R7261 | T9110 | T9111 | themeOf | p65,attraction | ||
| R7263 | T9111 | T9115 | themeOf | attraction,increased | ||
| R7264 | T9113 | T9111 | locationOf | promoters,attraction | ||
| R7265 | T9116 | T9118 | themeOf | Flag-RPS3,recruitment | ||
| R7266 | T9117 | T9119 | themeOf | p65,recruitment | ||
| R7268 | T9121 | T9118 | locationOf | promoter,recruitment | ||
| R7273 | T9127 | T9123 | locationOf | promoters,recruitment | ||
| R7274 | T9127 | T9125 | locationOf | promoters,recruitment | ||
| R7275 | T9130 | T9128 | causeOf | S209,depended | ||
| R7276 | T9130 | T9124 | partOf | S209,RPS3 | ||
| R7277 | T9130 | T9129 | causeOf | S209,depended | ||
| R7278 | T9131 | T9133 | themeOf | Interleukin 8,secretion | ||
| R7279 | T9131 | T9135 | themeOf | Interleukin 8,stimulation | ||
| R7280 | T9132 | T9131 | equivalentTo | IL-8,Interleukin 8 | ||
| R7281 | T9133 | T9134 | themeOf | secretion,induced | ||
| R7282 | T9134 | T9136 | themeOf | induced,decreased | ||
| R7283 | T9135 | T9134 | causeOf | stimulation,induced | ||
| R7284 | T9137 | T9136 | causeOf | reduced,decreased | ||
| R7285 | T9138 | T9140 | themeOf | RPS3,recruitment | ||
| R7286 | T9140 | T9137 | themeOf | recruitment,reduced | ||
| R7287 | T9142 | T9140 | themeOf | κB sites,recruitment | ||
| R7288 | T9142 | T9141 | partOf | κB sites,IL8 | ||
| R7289 | T9143 | T9137 | causeOf | S209A,reduced | ||
| R7290 | T9143 | T9144 | partOf | S209A,RPS3 | ||
| R7291 | T9145 | T9146 | themeOf | CD25,expression | ||
| R7292 | T9147 | T9148 | themeOf | RPS3,transfected | ||
| R7293 | T9150 | T9151 | themeOf | S209,phosphorylation | ||
| R7294 | T9150 | T9149 | partOf | S209,RPS3 | ||
| R7295 | T9151 | T9152 | themeOf | phosphorylation,by | ||
| R7296 | T9153 | T9152 | causeOf | IKKβ,by | ||
| R9503 | T11830 | T11831 | causeOf | NleH1,inhibits | ||
| R9504 | T11832 | T11833 | themeOf | RPS3,phosphorylation | ||
| R9505 | T11833 | T11831 | themeOf | phosphorylation,inhibits | ||
| R9506 | T11834 | T11835 | themeOf | NleH1,binds | ||
| R9507 | T11835 | T11836 | causeOf | binds,attenuates | ||
| R9509 | T11837 | T11835 | themeOf | RPS3,binds | ||
| R9511 | T11839 | T11836 | themeOf | translocation,attenuates | ||
| R9512 | T11841 | T11842 | causeOf | NleH1,inhibiting | ||
| R9513 | T11844 | T11845 | themeOf | S209,phosphorylation | ||
| R9514 | T11844 | T11843 | partOf | S209,RPS3 | ||
| R9516 | T11847 | T11846 | themeOf | NleH1-HA,increasing | ||
| R9517 | T11849 | T11851 | causeOf | NleH1,reduced | ||
| R9518 | T11849 | T11850 | causeOf | NleH1,reduced | ||
| R9519 | T11852 | T11853 | causeOf | TNF,induced | ||
| R9520 | T11853 | T11851 | themeOf | induced,reduced | ||
| R9521 | T11854 | T11855 | themeOf | RPS3,phosphorylation | ||
| R9522 | T11855 | T11853 | themeOf | phosphorylation,induced | ||
| R9523 | T11855 | T11850 | themeOf | phosphorylation,reduced | ||
| R9524 | T11856 | T11859 | causeOf | Expressing,interfere | ||
| R9525 | T11856 | T11861 | themeOf | Expressing,activation | ||
| R9526 | T11856 | T11858 | causeOf | Expressing,interfere | ||
| R9527 | T11857 | T11856 | themeOf | NleH1,Expressing | ||
| R9528 | T11860 | T11861 | causeOf | TNF,activation | ||
| R9529 | T11861 | T11859 | themeOf | activation,interfere | ||
| R9530 | T11862 | T11863 | themeOf | IκBα,degradation | ||
| R9531 | T11863 | T11858 | themeOf | degradation,interfere | ||
| R9532 | T11864 | T11866 | causeOf | lack,impact | ||
| R9533 | T11865 | T11864 | themeOf | NleH1,lack | ||
| R9534 | T11867 | T11869 | themeOf | p65,translocation | ||
| R9535 | T11868 | T11869 | locationOf | nuclear,translocation | ||
| R9536 | T11869 | T11866 | themeOf | translocation,impact | ||
| R9537 | T11870 | T11871 | causeOf | NleH1,inhibits | ||
| R9538 | T11872 | T11873 | themeOf | RPS3,phosphorylation | ||
| R9539 | T11873 | T11871 | themeOf | phosphorylation,inhibits | ||
| R9540 | T11875 | T11874 | themeOf | nleH1,lacking | ||
| R9541 | T11879 | T11880 | causeOf | TNF,increase | ||
| R9542 | T11882 | T11883 | themeOf | S209,phosphorylation | ||
| R9543 | T11882 | T11881 | partOf | S209,RPS3 | ||
| R9544 | T11883 | T11880 | themeOf | phosphorylation,increase | ||
| R9545 | T11885 | T11886 | themeOf | S209,phosphorylation | ||
| R9546 | T11885 | T11884 | partOf | S209,RPS3 | ||
| R9547 | T11886 | T11887 | themeOf | phosphorylation,impaired | ||
| R9548 | T11888 | T11889 | causeOf | TNF,induced | ||
| R9549 | T11889 | T11893 | themeOf | induced,unimpaired | ||
| R9550 | T11889 | T11894 | themeOf | induced,unimpaired | ||
| R9551 | T11891 | T11892 | themeOf | S209,phosphorylation | ||
| R9552 | T11891 | T11890 | partOf | S209,RPS3 | ||
| R9553 | T11892 | T11889 | themeOf | phosphorylation,induced | ||
| R9554 | T11895 | T11893 | causeOf | ΔnleH1,unimpaired | ||
| R9555 | T11896 | T11894 | causeOf | ΔescN,unimpaired | ||
| R9556 | T11897 | T11899 | causeOf | ΔnleH1,attenuated | ||
| R9557 | T11898 | T11900 | causeOf | ΔescN,attenuated | ||
| R9558 | T11901 | T11902 | causeOf | TNF,induced | ||
| R9559 | T11902 | T11899 | themeOf | induced,attenuated | ||
| R9560 | T11902 | T11900 | themeOf | induced,attenuated | ||
| R9561 | T11903 | T11905 | themeOf | RPS3,translocation | ||
| R9562 | T11904 | T11905 | locationOf | nuclear,translocation | ||
| R9563 | T11905 | T11902 | themeOf | translocation,induced | ||
| R9564 | T11906 | T11907 | themeOf | RPS3,phosphorylation | ||
| R9565 | T11906 | T11909 | themeOf | RPS3,translocation | ||
| R9566 | T11908 | T11909 | locationOf | nuclear,translocation | ||
| R9567 | T11910 | T11915 | themeOf | RPS3,translocation | ||
| R9568 | T11911 | T11912 | themeOf | S209,phosphorylation | ||
| R9569 | T11911 | T11910 | partOf | S209,RPS3 | ||
| R9570 | T11912 | T11913 | causeOf | phosphorylation,important | ||
| R9571 | T11914 | T11915 | locationOf | nuclear,translocation | ||
| R9572 | T11915 | T11913 | themeOf | translocation,important | ||
| R9573 | T11916 | T11917 | causeOf | NleH1,inhibits | ||
| R9574 | T11919 | T11920 | themeOf | S209,phosphorylation | ||
| R9575 | T11919 | T11918 | partOf | S209,RPS3 | ||
| R9576 | T11920 | T11917 | themeOf | phosphorylation,inhibits | ||
| R9577 | T11928 | T11927 | themeOf | nleH1,deleting | ||
| R9578 | T11931 | T11932 | causeOf | NleH1,blocking | ||
| R9579 | T11934 | T11935 | themeOf | S209,phosphorylation | ||
| R9580 | T11934 | T11933 | partOf | S209,RPS3 | ||
| R9581 | T11935 | T11932 | themeOf | phosphorylation,blocking | ||
| R11014 | T13731 | T13728 | themeOf | phosphorylation,inhibits | ||
| R11015 | T13734 | T13735 | causeOf | NleH1,blocked | ||
| R11016 | T13735 | T13739 | causeOf | blocked,preventing | ||
| R11017 | T13737 | T13738 | themeOf | S209,phosphorylation | ||
| R11018 | T13737 | T13736 | partOf | S209,RPS3 | ||
| R11019 | T13738 | T13735 | themeOf | phosphorylation,blocked | ||
| R11020 | T13740 | T13742 | themeOf | RPS3,translocation | ||
| R11021 | T13741 | T13742 | locationOf | nuclear,translocation | ||
| R11022 | T13742 | T13739 | themeOf | translocation,preventing | ||
| R11023 | T13744 | T13743 | themeOf | phospho,low | ||
| R11024 | T13745 | T13744 | themeOf | RPS3,phospho | ||
| R11025 | T13746 | T13749 | causeOf | ΔnleH1,intense | ||
| R11026 | T13747 | T13749 | themeOf | phospho,intense | ||
| R11027 | T13748 | T13747 | themeOf | RPS3,phospho | ||
| R11028 | T13750 | T13751 | causeOf | NleH1,inhibits | ||
| R11029 | T13753 | T13754 | themeOf | S209,phosphorylation | ||
| R11030 | T13753 | T13752 | partOf | S209,RPS3 | ||
| R11031 | T13754 | T13751 | themeOf | phosphorylation,inhibits | ||
| R11787 | T14711 | T14712 | themeOf | NleH1,autophosphorylated | ||
| R11788 | T14712 | T14713 | themeOf | autophosphorylated,depends | ||
| R11789 | T14714 | T14713 | causeOf | lysine 159,depends | ||
| R11790 | T14714 | T14711 | partOf | lysine 159,NleH1 | ||
| R11793 | T14718 | T14717 | partOf | S209,RPS3 | ||
| R11794 | T14719 | T14716 | themeOf | phosphorylation,inhibits | ||
| R11795 | T14722 | T14723 | themeOf | NleH1,autophosphorylated | ||
| R11796 | T14724 | T14726 | causeOf | K159A,kinase-dead | ||
| R11797 | T14724 | T14725 | partOf | K159A,NleH1 | ||
| R11798 | T14725 | T14726 | themeOf | NleH1,kinase-dead | ||
| R11799 | T14729 | T14727 | themeOf | inhibit,required | ||
| R11800 | T14731 | T14729 | themeOf | phosphorlyation,inhibit | ||
| R11801 | T14733 | T14731 | themeOf | S209,phosphorlyation | ||
| R11802 | T14733 | T14732 | partOf | S209,RPS3 | ||
| R11803 | T14735 | T14736 | themeOf | NleH1,expression | ||
| R11804 | T14736 | T14737 | causeOf | expression,reduced | ||
| R11805 | T14737 | T14742 | themeOf | reduced,failed | ||
| R11806 | T14738 | T14737 | themeOf | induced,reduced | ||
| R11807 | T14740 | T14741 | themeOf | S209,phosphorylation | ||
| R11808 | T14740 | T14739 | partOf | S209,RPS3 | ||
| R11809 | T14741 | T14738 | themeOf | phosphorylation,induced | ||
| R11810 | T14745 | T14744 | themeOf | protect,required | ||
| R11811 | T14746 | T14749 | themeOf | RPS3,phosphorylation | ||
| R11812 | T14747 | T14748 | causeOf | IKKβ,mediated | ||
| R11813 | T14748 | T14745 | themeOf | mediated,protect | ||
| R11814 | T14749 | T14748 | themeOf | phosphorylation,mediated | ||
| R11815 | T14750 | T14751 | causeOf | NleH,inhibited | ||
| R11816 | T14750 | T14752 | causeOf | NleH,inhibited | ||
| R11817 | T14753 | T14755 | themeOf | RPS3,translocation | ||
| R11818 | T14754 | T14755 | locationOf | nuclear,translocation | ||
| R11819 | T14755 | T14751 | themeOf | translocation,inhibited | ||
| R11820 | T14756 | T14757 | causeOf | RPS3,dependent | ||
| R11821 | T14757 | T14752 | themeOf | dependent,inhibited | ||
| R11822 | T14758 | T14759 | themeOf | luciferase,activity | ||
| R11823 | T14759 | T14757 | themeOf | activity,dependent | ||
| R11824 | T14762 | T14763 | themeOf | S209,phosphorylation | ||
| R11825 | T14762 | T14761 | partOf | S209,RPS3 | ||
| R11826 | T14766 | T14767 | themeOf | S209,phosphorylation | ||
| R11827 | T14766 | T14765 | partOf | S209,RPS3 | ||
| R11828 | T14767 | T14764 | themeOf | phosphorylation,increase | ||
| R11829 | T14768 | T14771 | themeOf | augmentation,reduced | ||
| R11830 | T14769 | T14770 | themeOf | RPS3,phosphorylation | ||
| R11831 | T14770 | T14768 | themeOf | phosphorylation,augmentation | ||
| R11832 | T14772 | T14773 | themeOf | RPS3,phosphorylation | ||
| R11833 | T14773 | T14774 | themeOf | phosphorylation,enhanced | ||
| R11834 | T14775 | T14774 | causeOf | lacking,enhanced | ||
| R11835 | T14776 | T14775 | themeOf | NleH,lacking | ||
| R11836 | T14781 | T14780 | themeOf | NleH1,express | ||
| R11837 | T14783 | T14784 | causeOf | NleH1,abolished | ||
| R11838 | T14785 | T14786 | causeOf | TNF,induced | ||
| R11839 | T14786 | T14784 | themeOf | induced,abolished | ||
| R11840 | T14788 | T14789 | themeOf | S209,phosphorylation | ||
| R11841 | T14788 | T14787 | partOf | S209,RPS3 | ||
| R11842 | T14789 | T14786 | themeOf | phosphorylation,induced | ||
| R11843 | T14791 | T14792 | themeOf | RPS3,phosphorylation | ||
| R11844 | T14792 | T14790 | themeOf | phosphorylation,inhibit | ||
| R11845 | T14795 | T14794 | themeOf | block,required | ||
| R11846 | T14795 | T14800 | causeOf | block,impair | ||
| R11847 | T14797 | T14798 | themeOf | S209,phosphorylation | ||
| R11848 | T14797 | T14796 | partOf | S209,RPS3 | ||
| R11849 | T14798 | T14795 | themeOf | phosphorylation,block | ||
| R11850 | T14801 | T14802 | locationOf | nuclear,translocation | ||
| R11851 | T14802 | T14804 | themeOf | translocation,trigged | ||
| R11852 | T14803 | T14802 | themeOf | RPS3,translocation | ||
| R11853 | T14804 | T14800 | themeOf | trigged,impair | ||
| R11854 | T14806 | T14804 | causeOf | IKKβ,trigged | ||
| R11855 | T14806 | T14805 | themeOf | IKKβ,constitutively-active | ||
| R11856 | T14807 | T14808 | themeOf | IKKβ,SSEE | ||
| R11857 | T14809 | T14810 | causeOf | SSEE IKKβ,triggered | ||
| R11858 | T14811 | T14813 | themeOf | RPS3,translocation | ||
| R11859 | T14812 | T14813 | locationOf | nuclear,translocation | ||
| R11860 | T14813 | T14810 | themeOf | translocation,triggered | ||
| R11861 | T14815 | T14814 | themeOf | IKKβ,kinase-dead | ||
| R11862 | T14815 | T14816 | themeOf | IKKβ,SSAA | ||
| R11863 | T14817 | T14819 | themeOf | RPS3,accumulation | ||
| R11864 | T14818 | T14819 | locationOf | nuclear,accumulation | ||
| R11865 | T14819 | T14820 | themeOf | accumulation,retarded | ||
| R11866 | T14823 | T14825 | themeOf | RPS3,translocation | ||
| R11867 | T14824 | T14825 | locationOf | nuclear,translocation | ||
| R11868 | T14826 | T14830 | themeOf | IKKβ,expressing | ||
| R11869 | T14827 | T14828 | themeOf | IKKβ,SSEE | ||
| R11870 | T14827 | T14829 | themeOf | IKKβ,expressing | ||
| R11871 | T14832 | T14834 | themeOf | RPS3,translocation | ||
| R11872 | T14833 | T14834 | locationOf | nuclear,translocation | ||
| R11873 | T14834 | T14831 | themeOf | translocation,affect | ||
| R11874 | T14835 | T14836 | themeOf | IKKβ,SSAA | ||
| R11875 | T14835 | T14837 | themeOf | IKKβ,expressing | ||
| R11876 | T14838 | T14839 | causeOf | NleH1,inhibit | ||
| R11877 | T14840 | T14842 | themeOf | RPS3,translocation | ||
| R11878 | T14841 | T14842 | locationOf | nuclear,translocation | ||
| R11879 | T14842 | T14839 | themeOf | translocation,inhibit | ||
| R11880 | T14845 | T14843 | themeOf | IKKβ,expressing | ||
| R11881 | T14845 | T14844 | themeOf | IKKβ,activated | ||
| R11882 | T14846 | T14850 | causeOf | NleH1,inhibiting | ||
| R11883 | T14847 | T14849 | causeOf | phosphorylate,thus | ||
| R11884 | T14848 | T14847 | themeOf | IKKβ,phosphorylate | ||
| R11885 | T14850 | T14849 | themeOf | inhibiting,thus | ||
| R11886 | T14851 | T14852 | causeOf | IKKβ,mediated | ||
| R11887 | T14852 | T14850 | themeOf | mediated,inhibiting | ||
| R11888 | T14854 | T14855 | themeOf | S209,phosphorylation | ||
| R11889 | T14854 | T14853 | partOf | S209,RPS3 | ||
| R11890 | T14855 | T14852 | themeOf | phosphorylation,mediated | ||
| R11891 | T14858 | T14859 | themeOf | IKKβ,autophosphorylation | ||
| R11892 | T14858 | T14861 | themeOf | IKKβ,phosphorylation | ||
| R11893 | T14863 | T14862 | themeOf | IKKβ,32P incorporation | ||
| R11894 | T14867 | T14868 | causeOf | IKKβ,phosphorylated | ||
| R11895 | T14867 | T14869 | causeOf | IKKβ,phosphorylated | ||
| R11896 | T14870 | T14868 | themeOf | RPS3,phosphorylated | ||
| R11897 | T14870 | T14872 | themeOf | RPS3,substrate specificity | ||
| R11898 | T14871 | T14869 | themeOf | GST-IκBα,phosphorylated | ||
| R11899 | T14874 | T14875 | causeOf | NleH1,reduced | ||
| R11900 | T14874 | T14876 | causeOf | NleH1,reduced | ||
| R11901 | T14877 | T14878 | causeOf | IKKβ,mediated | ||
| R11902 | T14878 | T14875 | themeOf | mediated,reduced | ||
| R11903 | T14879 | T14880 | themeOf | RPS3,phosphorylation | ||
| R11904 | T14880 | T14878 | themeOf | phosphorylation,mediated | ||
| R11905 | T14881 | T14882 | causeOf | IKKβ,mediated | ||
| R11906 | T14882 | T14876 | themeOf | mediated,reduced | ||
| R11907 | T14883 | T14884 | themeOf | GST-IκBα,phosphorylation | ||
| R11908 | T14884 | T14882 | themeOf | phosphorylation,mediated | ||
| R11909 | T14885 | T14888 | causeOf | NleH1,mediated | ||
| R11910 | T14885 | T14889 | causeOf | NleH1,mediated | ||
| R11911 | T14885 | T14887 | causeOf | NleH1,mediated | ||
| R11912 | T14885 | T14886 | causeOf | NleH1,mediated | ||
| R11913 | T14890 | T14889 | themeOf | phosphorylation,mediated | ||
| R11914 | T14891 | T14888 | themeOf | phosphorylation,mediated | ||
| R11915 | T14892 | T14886 | themeOf | autophosphorylation,mediated | ||
| R11916 | T14893 | T14887 | themeOf | autophosphorylation,mediated | ||
| R11917 | T14894 | T14891 | themeOf | RPS3,phosphorylation | ||
| R11918 | T14894 | T14893 | themeOf | RPS3,autophosphorylation | ||
| R11919 | T14895 | T14890 | themeOf | GST-IκBα,phosphorylation | ||
| R11920 | T14895 | T14892 | themeOf | GST-IκBα,autophosphorylation | ||
| R11921 | T14899 | T14900 | causeOf | IKKβ,mediated | ||
| R11922 | T14900 | T14898 | themeOf | mediated,inhibiting | ||
| R11923 | T14902 | T14903 | themeOf | S209,phosphorylation | ||
| R11924 | T14902 | T14901 | partOf | S209,RPS3 | ||
| R11925 | T14903 | T14900 | themeOf | phosphorylation,mediated | ||
| R14344 | T18035 | T18036 | themeOf | RPS3,translocate | ||
| R14345 | T18036 | T18034 | themeOf | translocate,triggers | ||
| R14346 | T18037 | T18036 | locationOf | nucleus,translocate | ||
| R14347 | T18038 | T18039 | causeOf | IKKβ,mediated | ||
| R14348 | T18039 | T18043 | causeOf | mediated,critical | ||
| R14349 | T18040 | T18045 | themeOf | RPS3,import | ||
| R14350 | T18041 | T18042 | themeOf | S209,phosphorylation | ||
| R14351 | T18041 | T18040 | partOf | S209,RPS3 | ||
| R14352 | T18042 | T18039 | themeOf | phosphorylation,mediated | ||
| R14353 | T18044 | T18045 | locationOf | nuclear,import | ||
| R14354 | T18045 | T18043 | themeOf | import,critical | ||
| R14355 | T18049 | T18051 | causeOf | IKKβ,phosphorylated | ||
| R14356 | T18050 | T18052 | causeOf | IKKα,phosphorylated | ||
| R14357 | T18051 | T18055 | causeOf | phosphorylated,modulation | ||
| R14358 | T18052 | T18054 | causeOf | phosphorylated,modulation | ||
| R14359 | T18053 | T18051 | themeOf | RPS3,phosphorylated | ||
| R14360 | T18053 | T18052 | themeOf | RPS3,phosphorylated | ||
| R14361 | T18056 | T18058 | themeOf | RPS3,translocation | ||
| R14362 | T18057 | T18058 | locationOf | nuclear,translocation | ||
| R14363 | T18058 | T18055 | themeOf | translocation,modulation | ||
| R14364 | T18058 | T18054 | themeOf | translocation,modulation | ||
| R14365 | T18058 | T18059 | themeOf | translocation,via | ||
| R14366 | T18061 | T18060 | themeOf | p65,phosphorylate | ||
| R14367 | T18064 | T18062 | themeOf | IKKβ,bind | ||
| R14368 | T18064 | T18063 | themeOf | IKKβ,phosphorylate | ||
| R14369 | T18065 | T18066 | themeOf | IKKβ,bound | ||
| R14370 | T18066 | T18067 | causeOf | bound,account for | ||
| R14371 | T18068 | T18069 | themeOf | RPS3,phosphorylation | ||
| R14372 | T18069 | T18067 | themeOf | phosphorylation,account for | ||
| R14373 | T18073 | T18074 | causeOf | IKKβ,mediated | ||
| R14374 | T18074 | T18078 | themeOf | mediated,modulated | ||
| R14375 | T18076 | T18077 | themeOf | S209,phosphorylation | ||
| R14376 | T18076 | T18075 | partOf | S209,RPS3 | ||
| R14377 | T18077 | T18074 | themeOf | phosphorylation,mediated | ||
| R14378 | T18079 | T18080 | themeOf | NleH1,binds | ||
| R14379 | T18081 | T18080 | themeOf | RPS3,binds | ||
| R14380 | T18082 | T18083 | causeOf | NleH1,inhibits | ||
| R14381 | T18083 | T18086 | causeOf | inhibits,retarding | ||
| R14382 | T18084 | T18085 | themeOf | RPS3,phosphorylation | ||
| R14383 | T18084 | T18088 | themeOf | RPS3,translocation | ||
| R14384 | T18085 | T18083 | themeOf | phosphorylation,inhibits | ||
| R14385 | T18087 | T18088 | locationOf | nuclear,translocation | ||
| R14386 | T18088 | T18086 | themeOf | translocation,retarding | ||
| R14387 | T18091 | T18090 | themeOf | IKKβ,phosphorylate | ||
| R14388 | T18093 | T18094 | causeOf | IKKβ,mediated | ||
| R14389 | T18094 | T18092 | themeOf | mediated,inhibit | ||
| R14390 | T18096 | T18097 | themeOf | S209,phosphorylation | ||
| R14391 | T18096 | T18095 | partOf | S209,RPS3 | ||
| R14392 | T18097 | T18094 | themeOf | phosphorylation,mediated | ||
| R14393 | T18098 | T18099 | causeOf | NleH1,steer | ||
| R14394 | T18100 | T18099 | themeOf | IKKβ,steer | ||
| R14395 | T18104 | T18105 | causeOf | NleH1,block | ||
| R14396 | T18106 | T18108 | themeOf | p65,translocation | ||
| R14397 | T18107 | T18108 | locationOf | nuclear,translocation | ||
| R14398 | T18108 | T18105 | themeOf | translocation,block | ||
| R14399 | T18112 | T18111 | themeOf | RPS3,inhibiting | ||
| R14400 | T18113 | T18111 | causeOf | NleH1,inhibiting | ||
| R14401 | T18115 | T18114 | themeOf | RPS3,impeding | ||
| R14402 | T18117 | T18119 | themeOf | p65,translocation | ||
| R14403 | T18118 | T18119 | locationOf | nuclear,translocation | ||
| R14404 | T18119 | T18116 | themeOf | translocation,altering | ||
| R14405 | T18121 | T18120 | themeOf | RPS3,effects | ||
| R1568 | T1983 | T1984 | themeOf | RPS3,phosphorylation | ||
| R1569 | T1984 | T1985 | themeOf | phosphorylation,in response to | ||
| R1570 | T1986 | T1987 | themeOf | RPS3,phosphorylated | ||
| R7175 | T9005 | T9006 | causeOf | phosphorylation,plays a role | ||
| R7178 | T9009 | T9008 | themeOf | RPS3,translocation | ||
| R7262 | T9111 | T9122 | themeOf | attraction,specific | ||
| R7267 | T9121 | T9119 | locationOf | promoter,recruitment | ||
| R7269 | T9123 | T9128 | themeOf | recruitment,depended | ||
| R7270 | T9124 | T9123 | themeOf | RPS3,recruitment | ||
| R7271 | T9125 | T9129 | themeOf | recruitment,depended | ||
| R7272 | T9126 | T9125 | themeOf | p65,recruitment | ||
| R11791 | T14715 | T14716 | causeOf | NleH1,inhibits | ||
| R11792 | T14718 | T14719 | themeOf | S209,phosphorylation | ||
| R9508 | T11837 | T11839 | themeOf | RPS3,translocation | ||
| R9510 | T11838 | T11839 | locationOf | nuclear,translocation | ||
| R9515 | T11845 | T11842 | themeOf | phosphorylation,inhibiting | ||
| R11011 | T13727 | T13728 | causeOf | NleH1,inhibits | ||
| R11012 | T13730 | T13731 | themeOf | S209,phosphorylation | ||
| R11013 | T13730 | T13729 | partOf | S209,RPS3 |
test2
| Id | Subject | Object | Predicate | Lexical cue | Negation | Speculation |
|---|---|---|---|---|---|---|
| T33 | 0-4 | Protein | denotes | IKKβ | ||
| T34 | 5-20 | Phosphorylation | denotes | phosphorylation | ||
| T35 | 21-30 | Regulation | denotes | regulates | ||
| T36 | 31-35 | Protein | denotes | RPS3 | ||
| T37 | 36-43 | Entity | denotes | nuclear | true | |
| T38 | 44-57 | Localization | denotes | translocation | ||
| T39 | 186-206 | Protein | denotes | ribosomal protein S3 | ||
| T40 | 208-212 | Protein | denotes | RPS3 | ||
| T41 | 303-307 | Protein | denotes | RPS3 | ||
| T42 | 308-315 | Entity | denotes | nuclear | ||
| T43 | 316-329 | Localization | denotes | translocation | ||
| T44 | 333-342 | Regulation | denotes | regulated | ||
| T45 | 364-368 | Protein | denotes | IKKβ | ||
| T46 | 369-384 | Phosphorylation | denotes | phosphorylation | ||
| T47 | 388-398 | Entity | denotes | serine 209 | ||
| T48 | 410-417 | Positive_regulation | denotes | crucial | ||
| T49 | 422-426 | Protein | denotes | RPS3 | ||
| T50 | 427-434 | Entity | denotes | nuclear | ||
| T51 | 435-447 | Localization | denotes | localization | ||
| T52 | 448-462 | Positive_regulation | denotes | in response to | ||
| T53 | 559-564 | Protein | denotes | NleH1 | ||
| T54 | 578-587 | Negative_regulation | denotes | inhibited | ||
| T55 | 588-592 | Protein | denotes | RPS3 | ||
| T56 | 593-597 | Entity | denotes | S209 | ||
| T57 | 598-613 | Phosphorylation | denotes | phosphorylation | ||
| T58 | 618-625 | Negative_regulation | denotes | blocked | ||
| T59 | 626-630 | Protein | denotes | RPS3 | ||
| T60 | 771-775 | Protein | denotes | IKKβ | ||
| T61 | 827-831 | Protein | denotes | RPS3 | ||
| T676 | 1203-1207 | Protein | denotes | RelA | ||
| T677 | 1209-1212 | Protein | denotes | p65 | ||
| T678 | 1215-1219 | Protein | denotes | RelB | ||
| T679 | 1221-1226 | Protein | denotes | c-Rel | true | |
| T680 | 1228-1231 | Protein | denotes | p50 | ||
| T681 | 1237-1240 | Protein | denotes | p52 | true | |
| T682 | 1294-1314 | Protein | denotes | ribosomal protein S3 | ||
| T683 | 1316-1320 | Protein | denotes | RPS3 | ||
| T684 | 1335-1338 | Protein | denotes | Rel | true | |
| T685 | 1383-1387 | Protein | denotes | RPS3 | true | |
| T686 | 1564-1568 | Protein | denotes | RPS3 | ||
| T687 | 1636-1664 | Protein | denotes | immunoglobulin κ light chain | ||
| T688 | 1670-1680 | Gene_expression | denotes | expression | ||
| T689 | 1908-1913 | Protein | denotes | NleH1 | ||
| T690 | 1968-1979 | Negative_regulation | denotes | attenuating | ||
| T691 | 1980-1984 | Protein | denotes | RPS3 | ||
| T692 | 1985-1992 | Entity | denotes | nuclear | ||
| T693 | 1993-2006 | Localization | denotes | translocation | ||
| T694 | 2016-2025 | Regulation | denotes | affecting | ||
| T695 | 2026-2029 | Protein | denotes | p65 | ||
| T696 | 2030-2043 | Localization | denotes | localization9 | ||
| T697 | 2096-2102 | Positive_regulation | denotes | induce | ||
| T698 | 2103-2107 | Protein | denotes | RPS3 | ||
| T699 | 2108-2115 | Entity | denotes | nuclear | ||
| T700 | 2116-2129 | Localization | denotes | translocation | ||
| T701 | 2220-2227 | Binding | denotes | binding | ||
| T702 | 2266-2270 | Protein | denotes | RPS3 | ||
| T703 | 2271-2283 | Binding | denotes | participates | ||
| T704 | 2353-2357 | Protein | denotes | RPS3 | ||
| T705 | 2361-2375 | Phosphorylation | denotes | phosphorylated | ||
| T706 | 2487-2491 | Protein | denotes | RPS3 | ||
| T707 | 2495-2509 | Phosphorylation | denotes | phosphorylated | ||
| T708 | 2672-2676 | Protein | denotes | RPS3 | ||
| T709 | 2727-2760 | Protein | denotes | Inhibitor of κB (IκB) kinase beta | ||
| T710 | 2762-2766 | Protein | denotes | IKKβ | ||
| T711 | 2768-2782 | Phosphorylation | denotes | phosphorylated | ||
| T712 | 2783-2787 | Protein | denotes | RPS3 | ||
| T713 | 2791-2801 | Entity | denotes | serine 209 | ||
| T714 | 2810-2814 | Protein | denotes | RPS3 | ||
| T715 | 2815-2819 | Entity | denotes | S209 | ||
| T716 | 2820-2835 | Phosphorylation | denotes | phosphorylation | ||
| T717 | 2836-2844 | Positive_regulation | denotes | enhanced | ||
| T718 | 2849-2860 | Binding | denotes | association | ||
| T719 | 2878-2887 | Positive_regulation | denotes | mediating | ||
| T720 | 2888-2892 | Protein | denotes | RPS3 | ||
| T721 | 2893-2898 | Binding | denotes | entry | ||
| T722 | 2932-2939 | Entity | denotes | nuclear | ||
| T723 | 2940-2953 | Localization | denotes | translocation | ||
| T724 | 2975-2985 | Protein | denotes | coli NleH1 | ||
| T725 | 3008-3017 | Negative_regulation | denotes | inhibited | ||
| T726 | 3018-3022 | Protein | denotes | RPS3 | ||
| T727 | 3023-3027 | Entity | denotes | S209 | ||
| T1962 | 3126-3130 | Protein | denotes | RPS3 | ||
| T1963 | 3131-3146 | Phosphorylation | denotes | phosphorylation | true | |
| T1964 | 3195-3199 | Protein | denotes | RPS3 | true | |
| T1965 | 3203-3217 | Phosphorylation | denotes | phosphorylated | true | |
| T1966 | 3345-3349 | Protein | denotes | RPS3 | ||
| T1967 | 3363-3377 | Phosphorylation | denotes | phosphorylated | ||
| T1968 | 3422-3430 | Positive_regulation | denotes | increase | true | |
| T1969 | 3485-3493 | Positive_regulation | denotes | increase | true | |
| T1970 | 3497-3501 | Protein | denotes | RPS3 | ||
| T1971 | 3540-3544 | Protein | denotes | RPS3 | ||
| T1972 | 3545-3553 | Entity | denotes | residues | ||
| T1973 | 3559-3573 | Phosphorylation | denotes | phosphorylated | ||
| T1974 | 3597-3601 | Protein | denotes | RPS3 | ||
| T1975 | 3770-3780 | Positive_regulation | denotes | stimulated | true | |
| T1976 | 3787-3802 | Phosphorylation | denotes | phosphorylation | true | |
| T1977 | 3821-3825 | Protein | denotes | IκBα | ||
| T1978 | 3864-3868 | Protein | denotes | RPS3 | ||
| T1979 | 3869-3884 | Phosphorylation | denotes | phosphorylation | ||
| T1980 | 3888-3894 | Entity | denotes | serine | ||
| T1981 | 4008-4023 | Phosphorylation | denotes | phosphorylation | ||
| T1982 | 4027-4031 | Protein | denotes | RPS3 | ||
| T2568 | 4044-4048 | Protein | denotes | RPS3 | true | |
| T2569 | 4053-4057 | Protein | denotes | IKKβ | ||
| T2570 | 4058-4069 | Binding | denotes | interaction | true | |
| T2571 | 4157-4161 | Protein | denotes | IKKγ | true | |
| T2572 | 4190-4194 | Protein | denotes | IKKα | ||
| T2573 | 4199-4203 | Protein | denotes | IKKβ | ||
| T2574 | 4208-4216 | Positive_regulation | denotes | critical | ||
| T2575 | 4322-4326 | Protein | denotes | RPS3 | ||
| T2576 | 4359-4362 | Protein | denotes | p65 | ||
| T2577 | 4363-4366 | Protein | denotes | p50 | ||
| T2578 | 4367-4371 | Protein | denotes | IκBα | ||
| T2579 | 4431-4440 | Positive_regulation | denotes | activated | true | |
| T2580 | 4441-4445 | Protein | denotes | IKKβ | ||
| T2581 | 4457-4461 | Binding | denotes | bind | ||
| T2582 | 4469-4482 | Phosphorylation | denotes | phosphorylate | ||
| T2583 | 4483-4487 | Protein | denotes | RPS3 | ||
| T2584 | 4522-4531 | Gene_expression | denotes | expressed | ||
| T2585 | 4532-4536 | Protein | denotes | IKKβ | ||
| T2586 | 4541-4545 | Protein | denotes | RPS3 | ||
| T2587 | 4546-4556 | Binding | denotes | interacted | ||
| T2588 | 4639-4643 | Protein | denotes | IKKβ | ||
| T2589 | 4644-4648 | Protein | denotes | RPS3 | ||
| T2590 | 4649-4660 | Binding | denotes | interaction | ||
| T2591 | 4775-4779 | Protein | denotes | RPS3 | ||
| T2592 | 4780-4784 | Protein | denotes | IKKβ | ||
| T2593 | 4785-4796 | Binding | denotes | association | ||
| T2594 | 4809-4818 | Positive_regulation | denotes | augmented | ||
| T2595 | 4901-4905 | Protein | denotes | RPS3 | ||
| T2596 | 4906-4912 | Entity | denotes | serine | ||
| T2597 | 4913-4928 | Phosphorylation | denotes | phosphorylation | ||
| T2598 | 4977-4988 | Binding | denotes | interaction | ||
| T2599 | 4997-5001 | Protein | denotes | RPS3 | ||
| T2600 | 5006-5010 | Protein | denotes | IKKα | ||
| T3354 | 5023-5027 | Protein | denotes | IKKβ | ||
| T3355 | 5031-5039 | Positive_regulation | denotes | required | ||
| T3356 | 5044-5048 | Protein | denotes | RPS3 | ||
| T3357 | 5049-5056 | Entity | denotes | nuclear | true | |
| T3358 | 5057-5070 | Localization | denotes | translocation | ||
| T3359 | 5094-5098 | Protein | denotes | RPS3 | ||
| T3360 | 5099-5103 | Protein | denotes | IKKβ | ||
| T3361 | 5104-5115 | Binding | denotes | interaction | ||
| T3362 | 5119-5127 | Positive_regulation | denotes | required | ||
| T3363 | 5132-5136 | Protein | denotes | RPS3 | true | |
| T3364 | 5137-5144 | Entity | denotes | nuclear | ||
| T3365 | 5145-5158 | Localization | denotes | translocation | ||
| T3366 | 5163-5175 | Negative_regulation | denotes | knocked down | ||
| T3367 | 5176-5180 | Protein | denotes | IKKα | ||
| T3368 | 5184-5188 | Protein | denotes | IKKβ | ||
| T3369 | 5189-5199 | Gene_expression | denotes | expression | ||
| T3370 | 5265-5272 | Positive_regulation | denotes | induced | ||
| T3371 | 5273-5277 | Protein | denotes | RPS3 | ||
| T3372 | 5278-5285 | Entity | denotes | nuclear | ||
| T3373 | 5286-5295 | Localization | denotes | migration | ||
| T3374 | 5339-5348 | Positive_regulation | denotes | triggered | ||
| T3375 | 5349-5353 | Protein | denotes | RPS3 | ||
| T3376 | 5354-5361 | Entity | denotes | nuclear | true | |
| T3377 | 5362-5375 | Localization | denotes | translocation | ||
| T3378 | 5456-5460 | Protein | denotes | RPS3 | true | |
| T3379 | 5461-5468 | Entity | denotes | nuclear | ||
| T3380 | 5469-5482 | Localization | denotes | translocation | ||
| T3381 | 5513-5521 | Negative_regulation | denotes | impaired | ||
| T3382 | 5525-5529 | Protein | denotes | IKKα | true | |
| T3383 | 5530-5539 | Negative_regulation | denotes | silencing | ||
| T3384 | 5553-5562 | Negative_regulation | denotes | knockdown | ||
| T3385 | 5566-5570 | Protein | denotes | IKKβ | ||
| T3386 | 5571-5581 | Negative_regulation | denotes | attenuated | ||
| T3387 | 5592-5596 | Protein | denotes | RPS3 | ||
| T3388 | 5597-5604 | Entity | denotes | nuclear | true | |
| T3389 | 5605-5617 | Localization | denotes | accumulation | ||
| T3390 | 5618-5627 | Positive_regulation | denotes | following | true | |
| T3391 | 5707-5717 | Gene_expression | denotes | expression | ||
| T3392 | 5721-5725 | Protein | denotes | IKKβ | ||
| T3393 | 5735-5739 | Protein | denotes | IKKα | ||
| T3394 | 5745-5754 | Positive_regulation | denotes | necessary | ||
| T3395 | 5770-5777 | Positive_regulation | denotes | induced | ||
| T3396 | 5778-5782 | Protein | denotes | RPS3 | ||
| T3397 | 5783-5790 | Entity | denotes | nuclear | ||
| T3398 | 5791-5804 | Localization | denotes | translocation | true | |
| T3399 | 5850-5853 | Protein | denotes | p65 | ||
| T3400 | 5854-5861 | Entity | denotes | nuclear | true | |
| T3401 | 5862-5875 | Localization | denotes | translocation | ||
| T3402 | 5880-5887 | Negative_regulation | denotes | blocked | ||
| T3403 | 5946-5953 | Entity | denotes | nuclear | ||
| T3404 | 5954-5967 | Localization | denotes | translocation | ||
| T3405 | 5971-5975 | Protein | denotes | RPS3 | ||
| T3406 | 5997-6007 | Gene_expression | denotes | expressing | ||
| T3407 | 6015-6026 | Negative_regulation | denotes | kinase-dead | ||
| T3408 | 6037-6058 | Positive_regulation | denotes | constitutively-active | ||
| T3409 | 6073-6077 | Protein | denotes | IKKβ | ||
| T3410 | 6135-6139 | Protein | denotes | IKKβ | ||
| T3411 | 6140-6147 | Positive_regulation | denotes | induced | ||
| T3412 | 6154-6163 | Regulation | denotes | dependent | ||
| T3413 | 6164-6174 | Protein | denotes | luciferase | ||
| T3414 | 6218-6222 | Protein | denotes | RPS3 | ||
| T3415 | 6232-6241 | Entity | denotes | cytosolic | ||
| T3416 | 6245-6249 | Protein | denotes | IKKβ | ||
| T3417 | 6251-6255 | Negative_regulation | denotes | SSAA | ||
| T3418 | 6257-6267 | Gene_expression | denotes | expressing | ||
| T3419 | 6320-6324 | Protein | denotes | RPS3 | ||
| T3420 | 6325-6337 | Localization | denotes | translocated | ||
| T3421 | 6345-6352 | Entity | denotes | nucleus | ||
| T3422 | 6362-6372 | Gene_expression | denotes | expressing | ||
| T3423 | 6373-6377 | Protein | denotes | IKKβ | ||
| T3424 | 6457-6461 | Protein | denotes | RPS3 | ||
| T3425 | 6462-6471 | Positive_regulation | denotes | increased | ||
| T3426 | 6482-6486 | Protein | denotes | IKKβ | ||
| T3427 | 6494-6504 | Gene_expression | denotes | expressing | ||
| T3428 | 6523-6527 | Protein | denotes | IKKβ | ||
| T3429 | 6529-6533 | Negative_regulation | denotes | SSAA | ||
| T3430 | 6535-6545 | Gene_expression | denotes | expressing | ||
| T3431 | 6593-6597 | Protein | denotes | IKKβ | ||
| T3432 | 6610-6619 | Positive_regulation | denotes | necessary | ||
| T3433 | 6624-6634 | Positive_regulation | denotes | sufficient | ||
| T3434 | 6639-6643 | Protein | denotes | RPS3 | ||
| T3435 | 6644-6651 | Entity | denotes | nuclear | ||
| T3436 | 6652-6665 | Localization | denotes | translocation | ||
| T3437 | 6666-6680 | Positive_regulation | denotes | in response to | ||
| T4913 | 6708-6712 | Protein | denotes | IκBα | true | |
| T4914 | 6713-6724 | Protein_catabolism | denotes | degradation | true | |
| T4915 | 6729-6733 | Protein | denotes | RPS3 | ||
| T4916 | 6734-6741 | Entity | denotes | nuclear | ||
| T4917 | 6742-6755 | Localization | denotes | translocation | ||
| T4918 | 6767-6776 | Regulation | denotes | regulates | ||
| T4919 | 6781-6788 | Entity | denotes | nuclear | ||
| T4920 | 6789-6795 | Localization | denotes | import | ||
| T4921 | 6805-6808 | Protein | denotes | Rel | ||
| T4922 | 6825-6829 | Protein | denotes | RPS3 | ||
| T4923 | 6840-6847 | Entity | denotes | nuclear | ||
| T4924 | 6848-6860 | Localization | denotes | localization | ||
| T4925 | 6891-6898 | Entity | denotes | nuclear | ||
| T4926 | 6899-6912 | Localization | denotes | translocation | ||
| T4927 | 6958-6961 | Protein | denotes | p65 | ||
| T4928 | 6962-6976 | Localization | denotes | translocation6 | true | |
| T4929 | 6997-7001 | Protein | denotes | RPS3 | ||
| T4930 | 7076-7080 | Protein | denotes | RPS3 | true | |
| T4931 | 7081-7092 | Binding | denotes | association | ||
| T4932 | 7134-7142 | Positive_regulation | denotes | enhanced | ||
| T4933 | 7209-7213 | Protein | denotes | RPS3 | ||
| T4934 | 7214-7221 | Binding | denotes | binding | ||
| T4935 | 7239-7248 | Positive_regulation | denotes | essential | ||
| T4936 | 7253-7260 | Entity | denotes | nuclear | ||
| T4937 | 7261-7274 | Localization | denotes | translocation | ||
| T4938 | 7306-7310 | Protein | denotes | IκBα | ||
| T4939 | 7311-7322 | Protein_catabolism | denotes | degradation | ||
| T4940 | 7328-7340 | Positive_regulation | denotes | prerequisite | ||
| T4941 | 7344-7350 | Negative_regulation | denotes | unmask | ||
| T4942 | 7355-7358 | Entity | denotes | NLS | true | |
| T4943 | 7362-7365 | Protein | denotes | p65 | true | |
| T4944 | 7376-7380 | Protein | denotes | RPS3 | ||
| T4945 | 7385-7389 | Protein | denotes | IκBα | true | |
| T4946 | 7390-7394 | Binding | denotes | bind | ||
| T4947 | 7398-7401 | Protein | denotes | p65 | ||
| T4948 | 7459-7463 | Protein | denotes | IκBα | ||
| T4949 | 7464-7475 | Protein_catabolism | denotes | degradation | ||
| T4950 | 7479-7487 | Positive_regulation | denotes | required | true | |
| T4951 | 7510-7514 | Protein | denotes | RPS3 | true | |
| T4952 | 7532-7543 | Binding | denotes | association | ||
| T4953 | 7547-7551 | Protein | denotes | RPS3 | ||
| T4954 | 7582-7596 | Gene_expression | denotes | overexpressing | true | |
| T4955 | 7607-7611 | Protein | denotes | IκBα | ||
| T4956 | 7618-7622 | Protein | denotes | IκBα | true | |
| T4957 | 7631-7635 | Negative_regulation | denotes | SSAA | ||
| T4958 | 7650-7654 | Protein | denotes | IKKβ | ||
| T4959 | 7655-7662 | Positive_regulation | denotes | induced | true | |
| T4960 | 7663-7678 | Phosphorylation | denotes | phosphorylation | ||
| T4961 | 7683-7694 | Protein_catabolism | denotes | degradation | true | |
| T4962 | 7705-7716 | Gene_expression | denotes | transfected | ||
| T4963 | 7732-7736 | Protein | denotes | IκBα | ||
| T4964 | 7754-7763 | Positive_regulation | denotes | augmented | ||
| T4965 | 7768-7779 | Binding | denotes | interaction | ||
| T4966 | 7783-7787 | Protein | denotes | RPS3 | ||
| T4967 | 7886-7890 | Protein | denotes | RPS3 | ||
| T4968 | 7902-7913 | Binding | denotes | association | ||
| T4969 | 7918-7927 | Negative_regulation | denotes | abolished | ||
| T4970 | 7951-7961 | Protein_catabolism | denotes | degradable | ||
| T4971 | 7962-7966 | Protein | denotes | IκBα | ||
| T4972 | 7997-8001 | Protein | denotes | IκBα | ||
| T4973 | 8045-8049 | Protein | denotes | RPS3 | ||
| T4974 | 8050-8057 | Entity | denotes | nuclear | ||
| T4975 | 8058-8071 | Localization | denotes | translocation | ||
| T4976 | 8090-8094 | Protein | denotes | RPS3 | ||
| T4977 | 8106-8117 | Binding | denotes | association | ||
| T4978 | 8122-8129 | Entity | denotes | nuclear | ||
| T4979 | 8130-8134 | Protein | denotes | RPS3 | ||
| T4980 | 8141-8149 | Negative_regulation | denotes | reducing | ||
| T4981 | 8150-8154 | Protein | denotes | IκBα | ||
| T4982 | 8155-8165 | Gene_expression | denotes | expression | ||
| T4983 | 8200-8205 | Protein | denotes | siRNA | ||
| T4984 | 8219-8223 | Protein | denotes | IκBα | ||
| T4985 | 8235-8243 | Negative_regulation | denotes | depleted | ||
| T4986 | 8244-8248 | Protein | denotes | IκBα | ||
| T4987 | 8301-8305 | Protein | denotes | RPS3 | ||
| T4988 | 8317-8328 | Binding | denotes | association | ||
| T4989 | 8337-8346 | Positive_regulation | denotes | augmented | ||
| T4990 | 8386-8390 | Protein | denotes | RPS3 | ||
| T4991 | 8391-8399 | Localization | denotes | detected | ||
| T4992 | 8467-8473 | Positive_regulation | denotes | induce | ||
| T4993 | 8474-8478 | Protein | denotes | IκBα | ||
| T4994 | 8479-8490 | Protein_catabolism | denotes | degradation | ||
| T4995 | 8546-8555 | Positive_regulation | denotes | increased | ||
| T4996 | 8556-8567 | Binding | denotes | association | ||
| T4997 | 8576-8580 | Protein | denotes | RPS3 | ||
| T4998 | 8635-8642 | Entity | denotes | nuclear | ||
| T4999 | 8643-8655 | Localization | denotes | accumulation | ||
| T5000 | 8659-8663 | Protein | denotes | RPS3 | ||
| T5001 | 8682-8686 | Protein | denotes | IκBα | ||
| T5002 | 8687-8698 | Protein_catabolism | denotes | degradation | ||
| T5003 | 8803-8811 | Positive_regulation | denotes | promotes | ||
| T5004 | 8827-8838 | Binding | denotes | association | ||
| T5005 | 8851-8860 | Localization | denotes | transport | ||
| T5006 | 8864-8868 | Protein | denotes | RPS3 | ||
| T5007 | 8875-8879 | Protein | denotes | IκBα | ||
| T5008 | 8880-8891 | Protein_catabolism | denotes | degradation | ||
| T5009 | 8923-8932 | Positive_regulation | denotes | following | ||
| T5010 | 8950-8958 | Positive_regulation | denotes | required | ||
| T5011 | 8967-8971 | Protein | denotes | RPS3 | ||
| T5012 | 8983-8994 | Binding | denotes | association | ||
| T5013 | 9049-9053 | Protein | denotes | IκBα | ||
| T5014 | 9054-9069 | Phosphorylation | denotes | phosphorylation | ||
| T5015 | 9074-9085 | Protein_catabolism | denotes | degradation | ||
| T5016 | 9096-9104 | Positive_regulation | denotes | required | ||
| T5017 | 9127-9132 | Positive_regulation | denotes | cause | ||
| T5018 | 9133-9137 | Protein | denotes | RPS3 | ||
| T5019 | 9138-9149 | Binding | denotes | association | ||
| T5020 | 9166-9174 | Positive_regulation | denotes | followed | ||
| T5021 | 9178-9185 | Entity | denotes | nuclear | ||
| T5022 | 9186-9199 | Localization | denotes | translocation | ||
| T5023 | 9243-9247 | Protein | denotes | IKKβ | ||
| T5024 | 9248-9263 | Phosphorylation | denotes | phosphorylation | ||
| T5025 | 9267-9271 | Protein | denotes | RPS3 | ||
| T5026 | 9276-9284 | Positive_regulation | denotes | required | ||
| T6969 | 9287-9291 | Protein | denotes | IKKβ | ||
| T6970 | 9292-9306 | Phosphorylation | denotes | phosphorylates | ||
| T6971 | 9307-9311 | Protein | denotes | RPS3 | ||
| T6972 | 9395-9399 | Protein | denotes | IKKβ | true | |
| T6973 | 9405-9419 | Phosphorylation | denotes | phosphorylates | ||
| T6974 | 9451-9458 | Protein | denotes | 14-3-3β | ||
| T6975 | 9463-9468 | Protein | denotes | Bcl10 | ||
| T6976 | 9476-9480 | Negative_regulation | denotes | lack | ||
| T6977 | 9552-9556 | Protein | denotes | IKKβ | true | |
| T6978 | 9572-9585 | Phosphorylation | denotes | phosphorylate | true | |
| T6979 | 9586-9590 | Protein | denotes | RPS3 | true | |
| T6980 | 9644-9648 | Protein | denotes | RPS3 | true | true |
| T6981 | 9702-9719 | Phosphorylation | denotes | autophosphorylatd | ||
| T6982 | 9720-9724 | Protein | denotes | IKKα | ||
| T6983 | 9729-9733 | Protein | denotes | IKKβ | ||
| T6984 | 9766-9779 | Phosphorylation | denotes | phosporylated | ||
| T6985 | 9780-9788 | Protein | denotes | GST-IκBα | ||
| T6986 | 9832-9835 | Protein | denotes | GST | ||
| T6987 | 9888-9892 | Protein | denotes | IKKα | ||
| T6988 | 9896-9900 | Protein | denotes | IKKβ | ||
| T6989 | 9930-9938 | Protein | denotes | GST-RPS3 | ||
| T6990 | 9948-9962 | Phosphorylation | denotes | phosphorylated | ||
| T6991 | 9966-9970 | Protein | denotes | IKKβ | ||
| T6992 | 9980-9984 | Protein | denotes | IKKα | true | |
| T6993 | 10045-10049 | Protein | denotes | RPS3 | true | |
| T6994 | 10050-10070 | Entity | denotes | amino acid residue(s | ||
| T6995 | 10072-10086 | Phosphorylation | denotes | phosphorylated | ||
| T6996 | 10090-10094 | Protein | denotes | IKKβ | ||
| T6997 | 10180-10194 | Phosphorylation | denotes | phosphorylated | ||
| T6998 | 10195-10199 | Protein | denotes | RPS3 | ||
| T6999 | 10228-10232 | Protein | denotes | IKKβ | ||
| T7000 | 10233-10247 | Phosphorylation | denotes | phosphorylated | ||
| T7001 | 10248-10252 | Entity | denotes | S209 | ||
| T7002 | 10269-10273 | Protein | denotes | RPS3 | ||
| T7003 | 10296-10300 | Protein | denotes | RPS3 | ||
| T7004 | 10345-10349 | Entity | denotes | S209 | ||
| T7005 | 10588-10592 | Entity | denotes | S209 | ||
| T7006 | 10599-10603 | Protein | denotes | IKKβ | ||
| T7007 | 10650-10656 | Protein | denotes | kinase | ||
| T7008 | 10707-10711 | Protein | denotes | RPS3 | ||
| T7009 | 10778-10785 | Negative_regulation | denotes | reduced | ||
| T7010 | 10786-10791 | Protein | denotes | IKKβ– | ||
| T7011 | 10791-10799 | Positive_regulation | denotes | mediated | ||
| T7012 | 10800-10804 | Protein | denotes | RPS3 | ||
| T7013 | 10805-10820 | Phosphorylation | denotes | phosphorylation | ||
| T7014 | 10928-10942 | Phosphorylation | denotes | phosphorylated | ||
| T7015 | 10943-10947 | Protein | denotes | RPS3 | ||
| T7016 | 10959-10963 | Protein | denotes | RPS3 | ||
| T7017 | 10964-10968 | Entity | denotes | S209 | ||
| T7018 | 11052-11066 | Entity | denotes | sequence motif | ||
| T7019 | 11093-11103 | Binding | denotes | recognized | ||
| T7020 | 11140-11144 | Protein | denotes | IKKβ | ||
| T7021 | 11298-11302 | Protein | denotes | RPS3 | ||
| T7022 | 11303-11307 | Entity | denotes | S209 | ||
| T7023 | 11308-11323 | Phosphorylation | denotes | phosphorylation | ||
| T7024 | 11328-11331 | Positive_regulation | denotes | due | ||
| T7025 | 11368-11372 | Protein | denotes | IKKβ | ||
| T7026 | 11416-11421 | Binding | denotes | bound | ||
| T7027 | 11452-11456 | Entity | denotes | S209 | ||
| T7028 | 11487-11491 | Protein | denotes | IKKβ | ||
| T7029 | 11492-11506 | Phosphorylation | denotes | phosphorylates | ||
| T7030 | 11507-11511 | Protein | denotes | RPS3 | ||
| T7031 | 11574-11583 | Protein | denotes | Flag-RPS3 | ||
| T7032 | 11608-11612 | Protein | denotes | IKKβ | ||
| T7033 | 11650-11664 | Positive_regulation | denotes | overexpressing | ||
| T7034 | 11665-11669 | Protein | denotes | IKKβ | ||
| T7035 | 11670-11678 | Positive_regulation | denotes | enhanced | ||
| T7036 | 11679-11688 | Protein | denotes | Flag-RPS3 | ||
| T7037 | 11689-11704 | Phosphorylation | denotes | phosphorylation | ||
| T7038 | 11710-11725 | Phosphorylation | denotes | phosphorylation | ||
| T7039 | 11742-11752 | Negative_regulation | denotes | eliminated | ||
| T7040 | 11793-11797 | Entity | denotes | S209 | ||
| T7041 | 11833-11837 | Protein | denotes | IKKβ | ||
| T7042 | 11838-11853 | Phosphorylation | denotes | phosphorylation | ||
| T7043 | 11885-11911 | Protein | denotes | phospho-S209 RPS3 antibody | ||
| T7044 | 11942-11946 | Protein | denotes | RPS3 | ||
| T7045 | 11951-11965 | Phosphorylation | denotes | phosphorylated | ||
| T7046 | 11969-11973 | Entity | denotes | S209 | ||
| T7047 | 11984-11993 | Regulation | denotes | dependent | ||
| T7048 | 12043-12047 | Protein | denotes | RPS3 | ||
| T8864 | 12116-12131 | Phosphorylation | denotes | Phosphorylation | ||
| T8865 | 12135-12139 | Protein | denotes | RPS3 | ||
| T8866 | 12188-12192 | Entity | denotes | S209 | true | |
| T8867 | 12193-12208 | Phosphorylation | denotes | phosphorylation | ||
| T8868 | 12217-12221 | Regulation | denotes | role | ||
| T8869 | 12229-12236 | Entity | denotes | nuclear | ||
| T8870 | 12237-12250 | Localization | denotes | translocation | ||
| T8871 | 12254-12258 | Protein | denotes | RPS3 | ||
| T8872 | 12344-12348 | Protein | denotes | RPS3 | ||
| T8873 | 12349-12360 | Gene_expression | denotes | transfected | true | |
| T8874 | 12583-12592 | Positive_regulation | denotes | triggered | ||
| T8875 | 12603-12612 | Protein | denotes | Flag-RPS3 | ||
| T8876 | 12613-12620 | Entity | denotes | nuclear | true | |
| T8877 | 12621-12634 | Localization | denotes | translocation | ||
| T8878 | 12655-12659 | Protein | denotes | RPS3 | ||
| T8879 | 12668-12675 | Entity | denotes | nuclear | ||
| T8880 | 12676-12689 | Localization | denotes | translocation | ||
| T8881 | 12694-12704 | Negative_regulation | denotes | attenuated | ||
| T8882 | 12765-12779 | Positive_regulation | denotes | overexpressing | ||
| T8883 | 12780-12784 | Protein | denotes | IKKβ | ||
| T8884 | 12788-12792 | Protein | denotes | RPS3 | ||
| T8885 | 12793-12800 | Entity | denotes | nuclear | ||
| T8886 | 12801-12814 | Localization | denotes | translocation | ||
| T8887 | 12816-12820 | Protein | denotes | IKKβ | true | |
| T8888 | 12864-12874 | Protein | denotes | luciferase | ||
| T8889 | 12915-12922 | Positive_regulation | denotes | induced | ||
| T8890 | 12927-12934 | Entity | denotes | nuclear | ||
| T8891 | 12935-12948 | Localization | denotes | translocation | ||
| T8892 | 12978-12982 | Protein | denotes | RPS3 | ||
| T8893 | 13018-13022 | Entity | denotes | S209 | ||
| T8894 | 13023-13038 | Phosphorylation | denotes | phosphorylation | ||
| T8895 | 13042-13050 | Positive_regulation | denotes | critical | ||
| T8896 | 13076-13083 | Positive_regulation | denotes | induced | ||
| T8897 | 13084-13088 | Protein | denotes | RPS3 | ||
| T8898 | 13089-13096 | Entity | denotes | nuclear | ||
| T8899 | 13097-13110 | Localization | denotes | translocation | ||
| T8900 | 13127-13131 | Regulation | denotes | role | ||
| T8901 | 13135-13139 | Entity | denotes | S209 | true | |
| T8902 | 13140-13155 | Phosphorylation | denotes | phosphorylation | ||
| T8903 | 13159-13163 | Protein | denotes | RPS3 | true | |
| T8904 | 13198-13206 | Negative_regulation | denotes | silenced | ||
| T8905 | 13218-13222 | Protein | denotes | RPS3 | ||
| T8906 | 13223-13233 | Gene_expression | denotes | expression | true | |
| T8907 | 13301-13305 | Protein | denotes | RPS3 | ||
| T8908 | 13378-13382 | Protein | denotes | RPS3 | true | |
| T8909 | 13414-13424 | Protein | denotes | RPS3 siRNA | ||
| T8910 | 13434-13441 | Negative_regulation | denotes | reduced | true | |
| T8911 | 13453-13457 | Protein | denotes | RPS3 | ||
| T8912 | 13502-13508 | Regulation | denotes | affect | true | |
| T8913 | 13520-13530 | Gene_expression | denotes | expression | ||
| T8914 | 13534-13550 | Protein | denotes | Flag-tagged RPS3 | ||
| T8915 | 13580-13587 | Negative_regulation | denotes | lacking | true | |
| T8916 | 13629-13633 | Protein | denotes | RPS3 | ||
| T8917 | 13634-13643 | Negative_regulation | denotes | knockdown | ||
| T8918 | 13644-13651 | Negative_regulation | denotes | reduced | ||
| T8919 | 13656-13663 | Positive_regulation | denotes | induced | ||
| T8920 | 13664-13674 | Gene_expression | denotes | expression | ||
| T8921 | 13687-13693 | Positive_regulation | denotes | driven | true | |
| T8922 | 13694-13704 | Protein | denotes | luciferase | true | |
| T8923 | 13731-13739 | Negative_regulation | denotes | impaired | true | |
| T8924 | 13740-13750 | Protein | denotes | luciferase | ||
| T8925 | 13758-13764 | Positive_regulation | denotes | caused | ||
| T8926 | 13768-13772 | Protein | denotes | RPS3 | ||
| T8927 | 13773-13783 | Negative_regulation | denotes | deficiency | ||
| T8928 | 13799-13807 | Negative_regulation | denotes | restored | ||
| T8929 | 13852-13856 | Protein | denotes | RPS3 | ||
| T8930 | 13923-13930 | Negative_regulation | denotes | failure | ||
| T8931 | 13948-13955 | Positive_regulation | denotes | restore | ||
| T8932 | 14040-14054 | Positive_regulation | denotes | overexpression | ||
| T8933 | 14058-14083 | Protein | denotes | green fluorescent protein | ||
| T8934 | 14085-14088 | Protein | denotes | GFP | ||
| T8935 | 14151-14155 | Protein | denotes | RPS3 | ||
| T8936 | 14220-14224 | Protein | denotes | RPS3 | ||
| T8937 | 14225-14229 | Entity | denotes | S209 | ||
| T8938 | 14230-14245 | Phosphorylation | denotes | phosphorylation | ||
| T8939 | 14377-14381 | Entity | denotes | S209 | ||
| T8940 | 14382-14397 | Phosphorylation | denotes | phosphorylation | ||
| T8941 | 14398-14405 | Regulation | denotes | affects | ||
| T8942 | 14406-14410 | Protein | denotes | RPS3 | ||
| T8943 | 14415-14418 | Protein | denotes | p65 | ||
| T8944 | 14419-14430 | Binding | denotes | recruitment | ||
| T8945 | 14500-14504 | Protein | denotes | RPS3 | ||
| T8946 | 14505-14514 | Negative_regulation | denotes | knockdown | ||
| T8947 | 14543-14554 | Binding | denotes | recruitment | ||
| T8948 | 14570-14579 | Gene_expression | denotes | expressed | ||
| T8949 | 14618-14622 | Protein | denotes | RPS3 | ||
| T8950 | 14630-14638 | Entity | denotes | κB sites | ||
| T8951 | 14646-14652 | Protein | denotes | NFKBIA | ||
| T8952 | 14657-14660 | Protein | denotes | IL8 | ||
| T8953 | 14661-14670 | Entity | denotes | promoters | ||
| T8954 | 14688-14698 | Gene_expression | denotes | expressing | ||
| T8955 | 14699-14703 | Protein | denotes | RPS3 | ||
| T8956 | 14704-14709 | Entity | denotes | S209A | ||
| T8957 | 14717-14723 | Regulation | denotes | impact | ||
| T8958 | 14727-14730 | Protein | denotes | p65 | ||
| T8959 | 14731-14738 | Entity | denotes | nuclear | ||
| T8960 | 14739-14752 | Localization | denotes | translocation | ||
| T8961 | 14771-14781 | Negative_regulation | denotes | attenuated | ||
| T8962 | 14782-14785 | Protein | denotes | p65 | ||
| T8963 | 14786-14797 | Binding | denotes | recruitment | ||
| T8964 | 14846-14849 | Protein | denotes | p65 | ||
| T8965 | 14850-14860 | Localization | denotes | attraction | ||
| T8966 | 14864-14868 | Protein | denotes | RPS3 | ||
| T8967 | 14917-14921 | Protein | denotes | CD25 | ||
| T8968 | 14926-14935 | Positive_regulation | denotes | increased | ||
| T8969 | 15029-15038 | Protein | denotes | Flag-RPS3 | ||
| T8970 | 15042-15045 | Protein | denotes | p65 | ||
| T8971 | 15046-15057 | Binding | denotes | recruitment | ||
| T8972 | 15061-15065 | Protein | denotes | ACTB | ||
| T8973 | 15066-15074 | Entity | denotes | promoter | ||
| T8974 | 15162-15173 | Binding | denotes | recruitment | ||
| T8975 | 15177-15181 | Protein | denotes | RPS3 | ||
| T8976 | 15208-15219 | Binding | denotes | recruitment | ||
| T8977 | 15223-15226 | Protein | denotes | p65 | ||
| T8978 | 15234-15243 | Entity | denotes | promoters | ||
| T8979 | 15256-15260 | Entity | denotes | S209 | ||
| T8980 | 15262-15275 | Protein | denotes | Interleukin 8 | ||
| T8981 | 15277-15281 | Protein | denotes | IL-8 | ||
| T8982 | 15283-15292 | Localization | denotes | secretion | ||
| T8983 | 15293-15300 | Positive_regulation | denotes | induced | ||
| T8984 | 15366-15375 | Negative_regulation | denotes | decreased | ||
| T8985 | 15396-15403 | Negative_regulation | denotes | reduced | ||
| T8986 | 15404-15408 | Protein | denotes | RPS3 | ||
| T8987 | 15409-15412 | Protein | denotes | p65 | ||
| T8988 | 15413-15424 | Binding | denotes | recruitment | ||
| T8989 | 15432-15435 | Protein | denotes | IL8 | ||
| T8990 | 15436-15444 | Entity | denotes | κB sites | ||
| T8991 | 15464-15469 | Entity | denotes | S209A | ||
| T8992 | 15499-15503 | Protein | denotes | RPS3 | ||
| T8993 | 15551-15555 | Protein | denotes | CD25 | ||
| T8994 | 15556-15566 | Gene_expression | denotes | expression | ||
| T8995 | 15614-15618 | Protein | denotes | RPS3 | ||
| T8996 | 15673-15677 | Protein | denotes | RPS3 | ||
| T8997 | 15678-15682 | Entity | denotes | S209 | ||
| T8998 | 15683-15698 | Phosphorylation | denotes | phosphorylation | ||
| T8999 | 15702-15706 | Protein | denotes | IKKβ | ||
| T9000 | 15721-15729 | Positive_regulation | denotes | required | ||
| T9001 | 15734-15738 | Protein | denotes | RPS3 | ||
| T11724 | 15797-15802 | Protein | denotes | NleH1 | ||
| T11725 | 15803-15811 | Negative_regulation | denotes | inhibits | ||
| T11726 | 15812-15816 | Protein | denotes | RPS3 | ||
| T11727 | 15817-15832 | Phosphorylation | denotes | phosphorylation | ||
| T11728 | 16148-16153 | Protein | denotes | NleH1 | ||
| T11729 | 16154-16159 | Binding | denotes | binds | ||
| T11730 | 16167-16177 | Negative_regulation | denotes | attenuates | ||
| T11731 | 16178-16182 | Protein | denotes | RPS3 | ||
| T11732 | 16183-16190 | Entity | denotes | nuclear | ||
| T11733 | 16191-16204 | Localization | denotes | translocation | ||
| T11734 | 16221-16225 | Protein | denotes | RPS3 | ||
| T11735 | 16285-16290 | Protein | denotes | NleH1 | ||
| T11736 | 16307-16317 | Negative_regulation | denotes | inhibiting | ||
| T11737 | 16318-16322 | Protein | denotes | RPS3 | ||
| T11738 | 16323-16327 | Entity | denotes | S209 | ||
| T11739 | 16328-16343 | Phosphorylation | denotes | phosphorylation | ||
| T11740 | 16393-16401 | Protein | denotes | NleH1-HA | ||
| T11741 | 16418-16422 | Protein | denotes | TNFα | ||
| T11742 | 16501-16506 | Protein | denotes | NleH1 | ||
| T11743 | 16507-16514 | Negative_regulation | denotes | reduced | ||
| T11744 | 16520-16523 | Protein | denotes | TNF | true | |
| T11745 | 16524-16531 | Positive_regulation | denotes | induced | ||
| T11746 | 16550-16554 | Protein | denotes | RPS3 | ||
| T11747 | 16555-16570 | Phosphorylation | denotes | phosphorylation | ||
| T11748 | 16616-16626 | Gene_expression | denotes | Expressing | ||
| T11749 | 16627-16632 | Protein | denotes | NleH1 | ||
| T11750 | 16664-16667 | Protein | denotes | TNF | ||
| T11751 | 16668-16675 | Positive_regulation | denotes | induced | ||
| T11752 | 16680-16690 | Positive_regulation | denotes | activation | ||
| T11753 | 16694-16698 | Protein | denotes | IκBα | true | |
| T11754 | 16699-16710 | Protein_catabolism | denotes | degradation | true | |
| T11755 | 16732-16736 | Negative_regulation | denotes | lack | ||
| T11756 | 16740-16745 | Protein | denotes | NleH1 | ||
| T11757 | 16746-16752 | Regulation | denotes | impact | ||
| T11758 | 16756-16759 | Protein | denotes | p65 | ||
| T11759 | 16760-16767 | Entity | denotes | nuclear | ||
| T11760 | 16768-16782 | Localization | denotes | translocation9 | ||
| T11761 | 16810-16815 | Protein | denotes | NleH1 | ||
| T11762 | 16816-16824 | Negative_regulation | denotes | inhibits | ||
| T11763 | 16825-16829 | Protein | denotes | RPS3 | ||
| T11764 | 16830-16845 | Phosphorylation | denotes | phosphorylation | ||
| T11765 | 16913-16920 | Negative_regulation | denotes | lacking | ||
| T11766 | 16928-16933 | Protein | denotes | nleH1 | ||
| T11767 | 16935-16941 | Protein | denotes | ΔnleH1 | ||
| T11768 | 17003-17008 | Protein | denotes | NleH1 | ||
| T11769 | 17031-17036 | Protein | denotes | ΔescN | ||
| T11770 | 17060-17063 | Protein | denotes | TNF | ||
| T11771 | 17095-17103 | Positive_regulation | denotes | increase | ||
| T11772 | 17107-17111 | Protein | denotes | RPS3 | ||
| T11773 | 17112-17116 | Entity | denotes | S209 | ||
| T11774 | 17117-17132 | Phosphorylation | denotes | phosphorylation | ||
| T11775 | 17180-17184 | Protein | denotes | RPS3 | ||
| T11776 | 17185-17189 | Entity | denotes | S209 | ||
| T11777 | 17190-17205 | Phosphorylation | denotes | phosphorylation | ||
| T11778 | 17224-17232 | Negative_regulation | denotes | impaired | ||
| T11779 | 17302-17305 | Protein | denotes | TNF | ||
| T11780 | 17306-17313 | Positive_regulation | denotes | induced | ||
| T11781 | 17314-17318 | Protein | denotes | RPS3 | ||
| T11782 | 17319-17323 | Entity | denotes | S209 | ||
| T11783 | 17324-17339 | Phosphorylation | denotes | phosphorylation | ||
| T11784 | 17344-17354 | Negative_regulation | denotes | unimpaired | ||
| T11785 | 17385-17391 | Protein | denotes | ΔnleH1 | ||
| T11786 | 17395-17400 | Protein | denotes | ΔescN | ||
| T11787 | 17457-17463 | Protein | denotes | ΔnleH1 | ||
| T11788 | 17467-17472 | Protein | denotes | ΔescN | ||
| T11789 | 17503-17513 | Negative_regulation | denotes | attenuated | ||
| T11790 | 17514-17517 | Protein | denotes | TNF | ||
| T11791 | 17518-17525 | Positive_regulation | denotes | induced | ||
| T11792 | 17526-17530 | Protein | denotes | RPS3 | ||
| T11793 | 17531-17538 | Entity | denotes | nuclear | ||
| T11794 | 17539-17553 | Localization | denotes | translocation9 | ||
| T11795 | 17576-17580 | Protein | denotes | RPS3 | ||
| T11796 | 17581-17596 | Phosphorylation | denotes | phosphorylation | ||
| T11797 | 17605-17612 | Entity | denotes | nuclear | ||
| T11798 | 17613-17626 | Localization | denotes | translocation | ||
| T11799 | 17728-17732 | Protein | denotes | RPS3 | ||
| T11800 | 17733-17737 | Entity | denotes | S209 | ||
| T11801 | 17738-17753 | Phosphorylation | denotes | phosphorylation | ||
| T13717 | 19409-19415 | Protein | denotes | ΔnleH1 | ||
| T13718 | 19424-19431 | Phosphorylation | denotes | phospho | ||
| T13719 | 19432-19436 | Protein | denotes | RPS3 | ||
| T13720 | 19437-19447 | Gene_expression | denotes | expression | ||
| T13721 | 19510-19515 | Protein | denotes | NleH1 | ||
| T13722 | 19516-19524 | Negative_regulation | denotes | inhibits | ||
| T13723 | 19525-19529 | Protein | denotes | RPS3 | ||
| T13724 | 19530-19534 | Entity | denotes | S209 | ||
| T13725 | 19535-19550 | Phosphorylation | denotes | phosphorylation | ||
| T14525 | 19647-19652 | Protein | denotes | NleH1 | ||
| T14526 | 19664-19668 | Protein | denotes | IKKβ | ||
| T14527 | 19693-19698 | Protein | denotes | NleH1 | ||
| T14528 | 19770-19780 | Entity | denotes | lysine 159 | ||
| T14529 | 19824-19829 | Protein | denotes | NleH1 | ||
| T14530 | 19830-19838 | Negative_regulation | denotes | inhibits | ||
| T14531 | 19839-19843 | Protein | denotes | RPS3 | true | |
| T14532 | 19844-19848 | Entity | denotes | S209 | ||
| T14533 | 19849-19864 | Phosphorylation | denotes | phosphorylation | ||
| T14534 | 19934-19943 | Protein | denotes | His-NleH1 | ||
| T14535 | 19965-19974 | Protein | denotes | His-NleH1 | ||
| T14536 | 20008-20013 | Protein | denotes | NleH1 | ||
| T14537 | 20017-20035 | Phosphorylation | denotes | autophosphorylated | ||
| T14538 | 20056-20061 | Protein | denotes | NleH1 | ||
| T14539 | 20062-20073 | Negative_regulation | denotes | kinase-dead | ||
| T14540 | 20134-20142 | Positive_regulation | denotes | required | ||
| T14541 | 20147-20152 | Protein | denotes | NleH1 | ||
| T14542 | 20156-20163 | Negative_regulation | denotes | inhibit | ||
| T14543 | 20164-20168 | Protein | denotes | IKKβ | ||
| T14544 | 20169-20184 | Phosphorylation | denotes | phosphorlyation | ||
| T14545 | 20188-20192 | Protein | denotes | RPS3 | ||
| T14546 | 20196-20200 | Entity | denotes | S209 | ||
| T14547 | 20217-20227 | Gene_expression | denotes | expressing | ||
| T14548 | 20254-20259 | Protein | denotes | NleH1 | ||
| T14549 | 20285-20290 | Protein | denotes | NleH1 | ||
| T14550 | 20291-20301 | Gene_expression | denotes | expression | ||
| T14551 | 20316-20323 | Negative_regulation | denotes | reduced | ||
| T14552 | 20328-20335 | Positive_regulation | denotes | induced | ||
| T14553 | 20336-20340 | Protein | denotes | RPS3 | ||
| T14554 | 20341-20345 | Entity | denotes | S209 | ||
| T14555 | 20346-20361 | Phosphorylation | denotes | phosphorylation | ||
| T14556 | 20420-20425 | Protein | denotes | NleH1 | ||
| T14557 | 20445-20453 | Positive_regulation | denotes | required | ||
| T14558 | 20457-20464 | Negative_regulation | denotes | protect | ||
| T14559 | 20465-20469 | Protein | denotes | RPS3 | ||
| T14560 | 20475-20479 | Protein | denotes | IKKβ | ||
| T14561 | 20480-20488 | Positive_regulation | denotes | mediated | true | |
| T14562 | 20489-20504 | Phosphorylation | denotes | phosphorylation | ||
| T14563 | 20648-20652 | Protein | denotes | NleH | ||
| T14564 | 20653-20662 | Negative_regulation | denotes | inhibited | ||
| T14565 | 20663-20667 | Protein | denotes | RPS3 | ||
| T14566 | 20668-20675 | Entity | denotes | nuclear | true | |
| T14567 | 20676-20689 | Localization | denotes | translocation | ||
| T14568 | 20694-20698 | Protein | denotes | RPS3 | ||
| T14569 | 20699-20708 | Regulation | denotes | dependent | ||
| T14570 | 20715-20725 | Protein | denotes | luciferase | ||
| T14571 | 20770-20775 | Protein | denotes | NleH1 | ||
| T14572 | 20797-20801 | Protein | denotes | RPS3 | ||
| T14573 | 20802-20806 | Entity | denotes | S209 | ||
| T14574 | 20807-20822 | Phosphorylation | denotes | phosphorylation | ||
| T14575 | 20918-20928 | Positive_regulation | denotes | stimulated | ||
| T14576 | 20941-20949 | Positive_regulation | denotes | increase | ||
| T14577 | 20953-20957 | Protein | denotes | RPS3 | ||
| T14578 | 20958-20962 | Entity | denotes | S209 | ||
| T14579 | 20963-20978 | Phosphorylation | denotes | phosphorylation | ||
| T14580 | 20995-21007 | Positive_regulation | denotes | augmentation | ||
| T14581 | 21011-21015 | Protein | denotes | RPS3 | true | |
| T14582 | 21016-21031 | Phosphorylation | denotes | phosphorylation | ||
| T14583 | 21036-21043 | Negative_regulation | denotes | reduced | ||
| T14584 | 21113-21117 | Protein | denotes | RPS3 | ||
| T14585 | 21118-21133 | Phosphorylation | denotes | phosphorylation | ||
| T14586 | 21138-21146 | Positive_regulation | denotes | enhanced | ||
| T14587 | 21199-21206 | Negative_regulation | denotes | lacking | ||
| T14588 | 21207-21211 | Protein | denotes | NleH | ||
| T14589 | 21222-21227 | Protein | denotes | ΔnleH | ||
| T14590 | 21262-21267 | Protein | denotes | NleH1 | true | |
| T14591 | 21307-21312 | Protein | denotes | ΔnleH | ||
| T14592 | 21348-21355 | Gene_expression | denotes | express | ||
| T14593 | 21390-21395 | Protein | denotes | NleH1 | ||
| T14594 | 21411-21416 | Protein | denotes | ΔnleH | ||
| T14595 | 21439-21444 | Protein | denotes | NleH1 | ||
| T14596 | 21452-21461 | Negative_regulation | denotes | abolished | true | |
| T14597 | 21462-21465 | Protein | denotes | TNF | ||
| T14598 | 21466-21473 | Positive_regulation | denotes | induced | ||
| T14599 | 21474-21478 | Protein | denotes | RPS3 | ||
| T14600 | 21479-21483 | Entity | denotes | S209 | true | |
| T14601 | 21484-21499 | Phosphorylation | denotes | phosphorylation | ||
| T14602 | 21543-21550 | Negative_regulation | denotes | inhibit | true | |
| T14603 | 21551-21555 | Protein | denotes | RPS3 | ||
| T14604 | 21556-21571 | Phosphorylation | denotes | phosphorylation | ||
| T14605 | 21628-21633 | Protein | denotes | NleH1 | ||
| T14606 | 21653-21661 | Positive_regulation | denotes | required | true | |
| T14607 | 21665-21670 | Negative_regulation | denotes | block | ||
| T14608 | 21671-21675 | Protein | denotes | RPS3 | true | |
| T14609 | 21676-21680 | Entity | denotes | S209 | ||
| T14610 | 21681-21696 | Phosphorylation | denotes | phosphorylation | true | |
| T14611 | 21750-21755 | Protein | denotes | NleH1 | ||
| T14612 | 21782-21788 | Negative_regulation | denotes | impair | true | |
| T14613 | 21800-21807 | Entity | denotes | nuclear | ||
| T14614 | 21808-21821 | Localization | denotes | translocation | ||
| T14615 | 21825-21829 | Protein | denotes | RPS3 | ||
| T14616 | 21830-21837 | Positive_regulation | denotes | trigged | ||
| T14617 | 21845-21866 | Positive_regulation | denotes | constitutively-active | ||
| T14618 | 21867-21871 | Protein | denotes | IKKβ | ||
| T14619 | 21873-21877 | Protein | denotes | IKKβ | ||
| T14620 | 21923-21933 | Gene_expression | denotes | expressing | ||
| T14621 | 21954-21963 | Protein | denotes | SSEE IKKβ | ||
| T14622 | 21974-21983 | Positive_regulation | denotes | triggered | ||
| T14623 | 21989-21993 | Protein | denotes | RPS3 | ||
| T14624 | 21994-22001 | Entity | denotes | nuclear | ||
| T14625 | 22002-22015 | Localization | denotes | translocation | ||
| T14626 | 22025-22036 | Negative_regulation | denotes | kinase-dead | ||
| T14627 | 22037-22041 | Protein | denotes | IKKβ | ||
| T14628 | 22043-22047 | Negative_regulation | denotes | SSAA | ||
| T14629 | 22068-22072 | Protein | denotes | RPS3 | ||
| T14630 | 22073-22080 | Entity | denotes | nuclear | ||
| T14631 | 22081-22093 | Localization | denotes | accumulation | ||
| T14632 | 22112-22120 | Negative_regulation | denotes | retarded | ||
| T14633 | 22217-22223 | Protein | denotes | ΔnleH1 | ||
| T14634 | 22227-22232 | Protein | denotes | ΔescN | ||
| T14635 | 22255-22263 | Negative_regulation | denotes | impaired | ||
| T14636 | 22264-22268 | Protein | denotes | RPS3 | ||
| T14637 | 22269-22276 | Entity | denotes | nuclear | ||
| T14638 | 22277-22290 | Localization | denotes | translocation | ||
| T14639 | 22301-22305 | Protein | denotes | IKKβ | ||
| T14640 | 22310-22314 | Protein | denotes | IKKβ | ||
| T14641 | 22316-22320 | Negative_regulation | denotes | SSEE | ||
| T14642 | 22322-22332 | Gene_expression | denotes | expressing | ||
| T14643 | 22390-22396 | Regulation | denotes | affect | ||
| T14644 | 22401-22405 | Protein | denotes | RPS3 | ||
| T14645 | 22406-22413 | Entity | denotes | nuclear | ||
| T14646 | 22414-22427 | Localization | denotes | translocation | ||
| T14647 | 22431-22435 | Protein | denotes | IKKβ | ||
| T14648 | 22437-22441 | Negative_regulation | denotes | SSAA | ||
| T14649 | 22443-22453 | Gene_expression | denotes | expressing | ||
| T14650 | 22525-22530 | Protein | denotes | NleH1 | ||
| T14651 | 22557-22564 | Negative_regulation | denotes | inhibit | ||
| T14652 | 22565-22569 | Protein | denotes | RPS3 | ||
| T14653 | 22570-22577 | Entity | denotes | nuclear | ||
| T14654 | 22578-22591 | Localization | denotes | translocation | ||
| T14655 | 22606-22616 | Gene_expression | denotes | expressing | ||
| T14656 | 22617-22632 | Positive_regulation | denotes | constitutively- | ||
| T14657 | 22632-22641 | Positive_regulation | denotes | activated | ||
| T14658 | 22642-22646 | Protein | denotes | IKKβ | ||
| T14659 | 22668-22673 | Protein | denotes | NleH1 | ||
| T14660 | 22689-22702 | Phosphorylation | denotes | phosphorylate | ||
| T14661 | 22703-22707 | Protein | denotes | IKKβ | ||
| T14662 | 22713-22723 | Negative_regulation | denotes | inhibiting | ||
| T14663 | 22724-22728 | Protein | denotes | IKKβ | ||
| T14664 | 22729-22737 | Positive_regulation | denotes | mediated | ||
| T14665 | 22738-22742 | Protein | denotes | RPS3 | ||
| T14666 | 22743-22747 | Entity | denotes | S209 | ||
| T14667 | 22748-22763 | Phosphorylation | denotes | phosphorylation | ||
| T14668 | 22826-22842 | Protein | denotes | Flag-IKKβ (K44A) | ||
| T14669 | 22872-22881 | Protein | denotes | His-NleH1 | ||
| T14670 | 22901-22905 | Protein | denotes | IKKβ | ||
| T14671 | 22906-22925 | Phosphorylation | denotes | autophosphorylation | ||
| T14672 | 22944-22949 | Protein | denotes | NleH1 | ||
| T14673 | 22950-22957 | Positive_regulation | denotes | induced | ||
| T14674 | 22958-22973 | Phosphorylation | denotes | phosphorylation | ||
| T14675 | 23039-23043 | Protein | denotes | IKKβ | ||
| T14676 | 23138-23143 | Protein | denotes | NleH1 | ||
| T14677 | 23150-23155 | Regulation | denotes | alter | ||
| T14678 | 23160-23164 | Protein | denotes | IKKβ | ||
| T14679 | 23277-23281 | Protein | denotes | IKKβ | ||
| T14680 | 23296-23300 | Protein | denotes | IKKβ | ||
| T14681 | 23301-23315 | Phosphorylation | denotes | phosphorylated | ||
| T14682 | 23316-23320 | Protein | denotes | RPS3 | ||
| T14683 | 23343-23351 | Protein | denotes | GST-IκBα | ||
| T14684 | 23469-23473 | Protein | denotes | IKKβ | ||
| T14685 | 23479-23484 | Protein | denotes | NleH1 | ||
| T14686 | 23485-23492 | Negative_regulation | denotes | reduced | ||
| T14687 | 23493-23497 | Protein | denotes | IKKβ | ||
| T14688 | 23498-23506 | Positive_regulation | denotes | mediated | ||
| T14689 | 23507-23511 | Protein | denotes | RPS3 | ||
| T14690 | 23512-23527 | Phosphorylation | denotes | phosphorylation | ||
| T14691 | 23570-23574 | Protein | denotes | IKKβ | ||
| T14692 | 23575-23583 | Positive_regulation | denotes | mediated | ||
| T14693 | 23584-23592 | Protein | denotes | GST-IκBα | ||
| T14694 | 23593-23608 | Phosphorylation | denotes | phosphorylation | ||
| T14695 | 23685-23690 | Protein | denotes | NleH1 | ||
| T14696 | 23691-23699 | Positive_regulation | denotes | mediated | ||
| T14697 | 23700-23715 | Phosphorylation | denotes | phosphorylation | ||
| T14698 | 23719-23738 | Phosphorylation | denotes | autophosphorylation | ||
| T14699 | 23742-23746 | Protein | denotes | RPS3 | ||
| T14700 | 23750-23758 | Protein | denotes | GST-IκBα | ||
| T14701 | 23786-23791 | Protein | denotes | NleH1 | ||
| T14702 | 23832-23836 | Protein | denotes | IKKβ | ||
| T14703 | 23842-23852 | Negative_regulation | denotes | inhibiting | ||
| T14704 | 23857-23861 | Protein | denotes | IKKβ | ||
| T14705 | 23862-23870 | Positive_regulation | denotes | mediated | ||
| T14706 | 23871-23875 | Protein | denotes | RPS3 | ||
| T14707 | 23876-23880 | Entity | denotes | S209 | ||
| T14708 | 23881-23896 | Phosphorylation | denotes | phosphorylation | ||
| T17951 | 24005-24009 | Protein | denotes | RPS3 | true | |
| T17952 | 24174-24182 | Positive_regulation | denotes | triggers | ||
| T17953 | 24183-24187 | Protein | denotes | RPS3 | ||
| T17954 | 24191-24202 | Localization | denotes | translocate | ||
| T17955 | 24273-24277 | Protein | denotes | IKKβ | ||
| T17956 | 24278-24286 | Positive_regulation | denotes | mediated | ||
| T17957 | 24287-24291 | Protein | denotes | RPS3 | ||
| T17958 | 24292-24296 | Entity | denotes | S209 | true | |
| T17959 | 24297-24312 | Phosphorylation | denotes | phosphorylation | ||
| T17960 | 24364-24371 | Entity | denotes | nuclear | ||
| T17961 | 24372-24378 | Localization | denotes | import | ||
| T17962 | 24449-24453 | Protein | denotes | IKKβ | ||
| T17963 | 24586-24590 | Protein | denotes | RPS3 | ||
| T17964 | 24716-24720 | Protein | denotes | IKKβ | ||
| T17965 | 24815-24819 | Protein | denotes | IKKβ | ||
| T17966 | 24829-24833 | Protein | denotes | IKKα | ||
| T17967 | 24835-24849 | Phosphorylation | denotes | phosphorylated | true | |
| T17968 | 24850-24854 | Protein | denotes | RPS3 | ||
| T17969 | 24900-24910 | Regulation | denotes | modulation | ||
| T17970 | 24915-24919 | Protein | denotes | RPS3 | ||
| T17971 | 24920-24927 | Entity | denotes | nuclear | ||
| T17972 | 24928-24941 | Localization | denotes | translocation | ||
| T17973 | 24943-24946 | Positive_regulation | denotes | via | ||
| T17974 | 24963-24973 | Binding | denotes | engagement | ||
| T17975 | 25035-25048 | Phosphorylation | denotes | phosphorylate | ||
| T17976 | 25049-25052 | Protein | denotes | p65 | ||
| T17977 | 25060-25064 | Binding | denotes | bind | true | |
| T17978 | 25072-25085 | Phosphorylation | denotes | phosphorylate | ||
| T17979 | 25086-25090 | Protein | denotes | IKKβ | ||
| T17980 | 25144-25148 | Protein | denotes | IKKβ | ||
| T17981 | 25149-25154 | Binding | denotes | bound | ||
| T17982 | 25165-25172 | Regulation | denotes | account | true | |
| T17983 | 25190-25194 | Protein | denotes | RPS3 | ||
| T17984 | 25195-25210 | Phosphorylation | denotes | phosphorylation | ||
| T17985 | 25246-25250 | Protein | denotes | IKKβ | ||
| T17986 | 25308-25312 | Protein | denotes | RPS3 | ||
| T17987 | 25534-25538 | Protein | denotes | RPS3 | ||
| T17988 | 25687-25691 | Protein | denotes | IKKβ | ||
| T17989 | 25692-25700 | Positive_regulation | denotes | mediated | ||
| T17990 | 25701-25705 | Protein | denotes | RPS3 | ||
| T17991 | 25706-25710 | Entity | denotes | S209 | ||
| T17992 | 25711-25726 | Phosphorylation | denotes | phosphorylation | ||
| T17993 | 25831-25836 | Protein | denotes | NleH1 | ||
| T17994 | 25850-25855 | Binding | denotes | binds | ||
| T17995 | 25859-25863 | Protein | denotes | RPS3 | ||
| T17996 | 25997-26002 | Protein | denotes | NleH1 | ||
| T17997 | 26015-26023 | Negative_regulation | denotes | inhibits | ||
| T17998 | 26024-26028 | Protein | denotes | RPS3 | ||
| T17999 | 26029-26044 | Phosphorylation | denotes | phosphorylation | ||
| T18000 | 26065-26072 | Entity | denotes | nuclear | ||
| T18001 | 26073-26086 | Localization | denotes | translocation | ||
| T18002 | 26167-26172 | Protein | denotes | NleH1 | ||
| T18003 | 26190-26203 | Phosphorylation | denotes | phosphorylate | ||
| T18004 | 26204-26208 | Protein | denotes | IKKβ | ||
| T18005 | 26234-26242 | Positive_regulation | denotes | required | ||
| T18006 | 26246-26253 | Negative_regulation | denotes | inhibit | ||
| T18007 | 26254-26258 | Protein | denotes | IKKβ | ||
| T18008 | 26259-26267 | Positive_regulation | denotes | mediated | ||
| T18009 | 26268-26272 | Protein | denotes | RPS3 | ||
| T18010 | 26273-26277 | Entity | denotes | S209 | ||
| T18011 | 26278-26293 | Phosphorylation | denotes | phosphorylation | ||
| T18012 | 26424-26429 | Protein | denotes | NleH1 | ||
| T18013 | 26468-26472 | Protein | denotes | IKKβ | ||
| T18014 | 26739-26744 | Protein | denotes | NleH1 | ||
| T18015 | 26777-26781 | Protein | denotes | RPS3 | ||
| T18016 | 26911-26914 | Protein | denotes | IL8 | ||
| T18017 | 26937-26942 | Protein | denotes | NleH1 | ||
| T18018 | 26952-26957 | Negative_regulation | denotes | block | ||
| T18019 | 26964-26967 | Protein | denotes | p65 | ||
| T18020 | 26968-26975 | Entity | denotes | nuclear | ||
| T18021 | 26976-26989 | Localization | denotes | translocation | ||
| T18022 | 27019-27022 | Protein | denotes | p65 | ||
| T18023 | 27023-27032 | Regulation | denotes | dependent | ||
| T18024 | 27037-27041 | Protein | denotes | RPS3 | ||
| T18025 | 27175-27185 | Negative_regulation | denotes | inhibiting | ||
| T18026 | 27186-27190 | Protein | denotes | RPS3 | ||
| T18027 | 27229-27234 | Protein | denotes | NleH1 | ||
| T18028 | 27830-27834 | Protein | denotes | RPS3 | ||
| T18029 | 27853-27856 | Protein | denotes | p65 | ||
| T18030 | 27857-27864 | Entity | denotes | nuclear | ||
| T18031 | 27865-27878 | Localization | denotes | translocation | ||
| T18032 | 28136-28140 | Protein | denotes | RPS3 | ||
| T20199 | 29180-29194 | Phosphorylation | denotes | phosphorylated | ||
| T20493 | 29321-29338 | Protein | denotes | Flag-IKKβ (SSEE), | ||
| T20494 | 29339-29356 | Protein | denotes | Flag-IKKβ (SSAA), | ||
| T20495 | 29361-29375 | Protein | denotes | HA-IκBα (SSAA) | ||
| T20496 | 29481-29488 | Protein | denotes | HA-IκBα | ||
| T20497 | 29493-29509 | Protein | denotes | IKKβ (K44A)-Flag | ||
| T20498 | 29558-29567 | Protein | denotes | Flag-RPS3 | ||
| T20499 | 29569-29577 | Protein | denotes | GST-RPS3 | ||
| T20500 | 29579-29586 | Protein | denotes | HA-RPS3 | ||
| T20501 | 29588-29593 | Protein | denotes | VN-HA | ||
| T20502 | 29595-29603 | Protein | denotes | NleH1-HA | ||
| T20503 | 29665-29669 | Protein | denotes | RPS3 | ||
| T20980 | 30276-30277 | Negative_regulation | denotes | - | ||
| T20981 | 30296-30300 | Protein | denotes | IKKβ | ||
| T20982 | 30305-30309 | Protein | denotes | IKKα | ||
| T20983 | 30470-30478 | Protein | denotes | GST-RPS3 | ||
| T20984 | 30483-30487 | Protein | denotes | RPS3 | ||
| T21359 | 31009-31017 | Protein | denotes | GST-RPS3 | ||
| T21360 | 31049-31053 | Protein | denotes | IKKβ | ||
| T21540 | 31486-31490 | Protein | denotes | IKKα | ||
| T21541 | 31526-31530 | Protein | denotes | IKKβ | ||
| T21542 | 31566-31570 | Protein | denotes | IκBα | ||
| T21543 | 31606-31610 | Protein | denotes | RPS3 | ||
| T22032 | 32705-32715 | Protein | denotes | luciferase | ||
| T22033 | 32742-32752 | Protein | denotes | luciferase | ||
| T22208 | 33114-33117 | Protein | denotes | IL8 | ||
| T22209 | 33122-33128 | Protein | denotes | NFKBIA | ||
| T22210 | 33141-33145 | Protein | denotes | ACTB | ||
| T22538 | 34908-34915 | Protein | denotes | albumin | ||
| T23097 | 35151-35155 | Protein | denotes | IL-8 | ||
| T23098 | 35242-35255 | Protein | denotes | Interleukin-8 | ||
| T23099 | 35275-35278 | Protein | denotes | kit | ||
| T11802 | 17757-17766 | Positive_regulation | denotes | important | ||
| T11803 | 17771-17778 | Entity | denotes | nuclear | ||
| T11804 | 17779-17792 | Localization | denotes | translocation | ||
| T11805 | 17813-17818 | Protein | denotes | NleH1 | ||
| T11806 | 17819-17827 | Negative_regulation | denotes | inhibits | ||
| T11807 | 17828-17832 | Protein | denotes | RPS3 | ||
| T11808 | 17833-17837 | Entity | denotes | S209 | ||
| T11809 | 17838-17853 | Phosphorylation | denotes | phosphorylation | ||
| T11810 | 17891-17895 | Protein | denotes | RPS3 | ||
| T11811 | 17944-17947 | Protein | denotes | IL8 | ||
| T11812 | 17949-17955 | Protein | denotes | NFKBIA | ||
| T11813 | 17961-17968 | Protein | denotes | TNFAIP3 | ||
| T11814 | 18128-18134 | Protein | denotes | ΔnleH1 | ||
| T11815 | 18138-18143 | Protein | denotes | ΔescN | ||
| T11816 | 18176-18184 | Negative_regulation | denotes | deleting | ||
| T11817 | 18185-18190 | Protein | denotes | nleH1 | ||
| T11818 | 18198-18204 | Regulation | denotes | impact | ||
| T11819 | 18212-18222 | Gene_expression | denotes | expression | ||
| T11820 | 18260-18264 | Protein | denotes | CD25 | ||
| T11821 | 18269-18277 | Protein | denotes | TNFSF13B | ||
| T11822 | 18343-18348 | Protein | denotes | NleH1 | ||
| T11823 | 18414-18422 | Negative_regulation | denotes | blocking | ||
| T11824 | 18423-18427 | Protein | denotes | RPS3 | ||
| T11825 | 18428-18432 | Entity | denotes | S209 | ||
| T11826 | 18433-18448 | Phosphorylation | denotes | phosphorylation | ||
| T11827 | 18480-18484 | Protein | denotes | RPS3 | ||
| T13700 | 18516-18521 | Protein | denotes | NleH1 | ||
| T13701 | 18522-18530 | Negative_regulation | denotes | inhibits | ||
| T13702 | 18531-18535 | Protein | denotes | RPS3 | ||
| T13703 | 18536-18540 | Entity | denotes | S209 | ||
| T13704 | 18541-18556 | Phosphorylation | denotes | phosphorylation | true | |
| T13705 | 18665-18671 | Protein | denotes | ΔnleH1 | ||
| T13706 | 18771-18777 | Protein | denotes | ΔnleH1 | ||
| T13707 | 19007-19012 | Protein | denotes | NleH1 | ||
| T13708 | 19013-19020 | Negative_regulation | denotes | blocked | ||
| T13709 | 19021-19025 | Protein | denotes | RPS3 | ||
| T13710 | 19026-19030 | Entity | denotes | S209 | ||
| T13711 | 19031-19046 | Phosphorylation | denotes | phosphorylation | ||
| T13712 | 19064-19074 | Negative_regulation | denotes | preventing | ||
| T13713 | 19075-19079 | Protein | denotes | RPS3 | ||
| T13714 | 19080-19087 | Entity | denotes | nuclear | ||
| T13715 | 19088-19101 | Localization | denotes | translocation | ||
| T13716 | 19361-19365 | Protein | denotes | RPS3 | ||
| R28 | T33 | T34 | themeOf | IKKβ,phosphorylation | ||
| R29 | T34 | T35 | causeOf | phosphorylation,regulates | ||
| R30 | T36 | T38 | themeOf | RPS3,translocation | ||
| R31 | T37 | T38 | locationOf | nuclear,translocation | ||
| R32 | T38 | T35 | themeOf | translocation,regulates | ||
| R33 | T40 | T39 | equivalentTo | RPS3,ribosomal protein S3 | ||
| R34 | T41 | T43 | themeOf | RPS3,translocation | ||
| R35 | T42 | T43 | locationOf | nuclear,translocation | ||
| R36 | T43 | T44 | themeOf | translocation,regulated | ||
| R37 | T46 | T48 | causeOf | phosphorylation,crucial | ||
| R38 | T47 | T46 | themeOf | serine 209,phosphorylation | ||
| R39 | T47 | T45 | partOf | serine 209,IKKβ | ||
| R40 | T49 | T51 | themeOf | RPS3,localization | ||
| R41 | T50 | T51 | locationOf | nuclear,localization | ||
| R42 | T51 | T52 | themeOf | localization,in response to | ||
| R43 | T51 | T48 | themeOf | localization,crucial | ||
| R44 | T52 | T48 | themeOf | in response to,crucial | ||
| R45 | T53 | T54 | causeOf | NleH1,inhibited | ||
| R46 | T54 | T58 | causeOf | inhibited,blocked | ||
| R47 | T56 | T55 | partOf | S209,RPS3 | ||
| R48 | T56 | T57 | themeOf | S209,phosphorylation | ||
| R49 | T57 | T54 | themeOf | phosphorylation,inhibited | ||
| R50 | T59 | T58 | themeOf | RPS3,blocked | ||
| R561 | T677 | T676 | equivalentTo | p65,RelA | ||
| R562 | T683 | T682 | equivalentTo | RPS3,ribosomal protein S3 | ||
| R563 | T687 | T688 | themeOf | immunoglobulin κ light chain,expression | ||
| R564 | T689 | T690 | causeOf | NleH1,attenuating | ||
| R565 | T689 | T694 | causeOf | NleH1,affecting | ||
| R566 | T691 | T693 | themeOf | RPS3,translocation | ||
| R567 | T692 | T693 | locationOf | nuclear,translocation | ||
| R568 | T693 | T690 | themeOf | translocation,attenuating | ||
| R569 | T695 | T696 | themeOf | p65,localization9 | ||
| R570 | T696 | T694 | themeOf | localization9,affecting | ||
| R571 | T698 | T700 | themeOf | RPS3,translocation | ||
| R572 | T699 | T700 | locationOf | nuclear,translocation | ||
| R573 | T700 | T697 | themeOf | translocation,induce | ||
| R574 | T702 | T703 | themeOf | RPS3,participates | ||
| R575 | T702 | T701 | themeOf | RPS3,binding | ||
| R576 | T704 | T705 | themeOf | RPS3,phosphorylated | ||
| R577 | T706 | T707 | themeOf | RPS3,phosphorylated | ||
| R578 | T709 | T711 | causeOf | Inhibitor of κB (IκB) kinase beta,phosphorylated | ||
| R579 | T710 | T709 | equivalentTo | IKKβ,Inhibitor of κB (IκB) kinase beta | ||
| R580 | T713 | T712 | partOf | serine 209,RPS3 | ||
| R581 | T713 | T711 | themeOf | serine 209,phosphorylated | ||
| R582 | T714 | T718 | themeOf | RPS3,association | ||
| R583 | T715 | T716 | themeOf | S209,phosphorylation | ||
| R584 | T715 | T714 | partOf | S209,RPS3 | ||
| R585 | T716 | T717 | causeOf | phosphorylation,enhanced | ||
| R586 | T718 | T717 | themeOf | association,enhanced | ||
| R587 | T720 | T721 | themeOf | RPS3,entry | ||
| R588 | T720 | T723 | themeOf | RPS3,translocation | ||
| R589 | T721 | T719 | themeOf | entry,mediating | ||
| R590 | T722 | T723 | locationOf | nuclear,translocation | ||
| R591 | T723 | T719 | themeOf | translocation,mediating | ||
| R592 | T724 | T725 | causeOf | coli NleH1,inhibited | ||
| R593 | T727 | T726 | partOf | S209,RPS3 | ||
| R1558 | T1962 | T1963 | themeOf | RPS3,phosphorylation | ||
| R1559 | T1964 | T1965 | themeOf | RPS3,phosphorylated | ||
| R1560 | T1966 | T1967 | themeOf | RPS3,phosphorylated | ||
| R1561 | T1970 | T1969 | themeOf | RPS3,increase | ||
| R1562 | T1972 | T1971 | partOf | residues,RPS3 | ||
| R1563 | T1972 | T1973 | themeOf | residues,phosphorylated | ||
| R1564 | T1976 | T1975 | themeOf | phosphorylation,stimulated | ||
| R1565 | T1977 | T1976 | themeOf | IκBα,phosphorylation | ||
| R1566 | T1978 | T1979 | themeOf | RPS3,phosphorylation | ||
| R1567 | T1982 | T1981 | themeOf | RPS3,phosphorylation | ||
| R2023 | T2568 | T2570 | themeOf | RPS3,interaction | ||
| R2024 | T2569 | T2570 | themeOf | IKKβ,interaction | ||
| R2025 | T2580 | T2579 | themeOf | IKKβ,activated | ||
| R2026 | T2580 | T2581 | themeOf | IKKβ,bind | ||
| R2027 | T2583 | T2582 | themeOf | RPS3,phosphorylate | ||
| R2028 | T2583 | T2581 | themeOf | RPS3,bind | ||
| R2029 | T2585 | T2584 | themeOf | IKKβ,expressed | ||
| R2030 | T2585 | T2587 | themeOf | IKKβ,interacted | ||
| R2031 | T2586 | T2587 | themeOf | RPS3,interacted | ||
| R2032 | T2586 | T2584 | themeOf | RPS3,expressed | ||
| R2033 | T2588 | T2590 | themeOf | IKKβ,interaction | ||
| R2034 | T2589 | T2590 | themeOf | RPS3,interaction | ||
| R2035 | T2591 | T2593 | themeOf | RPS3,association | ||
| R2036 | T2592 | T2593 | themeOf | IKKβ,association | ||
| R2037 | T2593 | T2594 | themeOf | association,augmented | ||
| R2038 | T2596 | T2597 | themeOf | serine,phosphorylation | ||
| R2039 | T2596 | T2595 | partOf | serine,RPS3 | ||
| R2040 | T2599 | T2598 | themeOf | RPS3,interaction | ||
| R2041 | T2600 | T2598 | themeOf | IKKα,interaction | ||
| R2625 | T3354 | T3355 | causeOf | IKKβ,required | ||
| R2626 | T3356 | T3358 | themeOf | RPS3,translocation | ||
| R2627 | T3357 | T3358 | locationOf | nuclear,translocation | ||
| R2628 | T3358 | T3355 | themeOf | translocation,required | ||
| R2629 | T3359 | T3361 | themeOf | RPS3,interaction | ||
| R2630 | T3360 | T3361 | themeOf | IKKβ,interaction | ||
| R2631 | T3361 | T3362 | causeOf | interaction,required | ||
| R2632 | T3363 | T3365 | themeOf | RPS3,translocation | ||
| R2633 | T3364 | T3365 | locationOf | nuclear,translocation | ||
| R2634 | T3365 | T3362 | themeOf | translocation,required | ||
| R2635 | T3367 | T3369 | themeOf | IKKα,expression | ||
| R2636 | T3368 | T3369 | themeOf | IKKβ,expression | ||
| R2637 | T3369 | T3366 | themeOf | expression,knocked down | ||
| R2638 | T3371 | T3373 | themeOf | RPS3,migration | ||
| R2639 | T3372 | T3373 | locationOf | nuclear,migration | ||
| R2640 | T3373 | T3370 | themeOf | migration,induced | ||
| R2641 | T3375 | T3377 | themeOf | RPS3,translocation | ||
| R2642 | T3376 | T3377 | locationOf | nuclear,translocation | ||
| R2643 | T3377 | T3374 | themeOf | translocation,triggered | ||
| R2644 | T3378 | T3380 | themeOf | RPS3,translocation | ||
| R2645 | T3379 | T3380 | locationOf | nuclear,translocation | ||
| R2646 | T3380 | T3381 | themeOf | translocation,impaired | ||
| R2647 | T3382 | T3383 | themeOf | IKKα,silencing | ||
| R2648 | T3383 | T3381 | causeOf | silencing,impaired | ||
| R2649 | T3385 | T3384 | themeOf | IKKβ,knockdown | ||
| R2650 | T3385 | T3386 | causeOf | IKKβ,attenuated | ||
| R2651 | T3387 | T3389 | themeOf | RPS3,accumulation | ||
| R2652 | T3388 | T3389 | locationOf | nuclear,accumulation | ||
| R2653 | T3389 | T3386 | themeOf | accumulation,attenuated | ||
| R2654 | T3389 | T3390 | themeOf | accumulation,following | ||
| R2655 | T3391 | T3394 | causeOf | expression,necessary | ||
| R2656 | T3392 | T3391 | themeOf | IKKβ,expression | ||
| R2657 | T3393 | T3391 | themeOf | IKKα,expression | ||
| R2658 | T3395 | T3394 | themeOf | induced,necessary | ||
| R2659 | T3396 | T3398 | themeOf | RPS3,translocation | ||
| R2660 | T3397 | T3398 | locationOf | nuclear,translocation | ||
| R2661 | T3398 | T3395 | themeOf | translocation,induced | ||
| R2662 | T3399 | T3401 | themeOf | p65,translocation | ||
| R2663 | T3400 | T3401 | locationOf | nuclear,translocation | ||
| R2664 | T3401 | T3402 | themeOf | translocation,blocked | ||
| R2665 | T3403 | T3404 | locationOf | nuclear,translocation | ||
| R2666 | T3405 | T3404 | themeOf | RPS3,translocation | ||
| R2667 | T3406 | T3407 | themeOf | expressing,kinase-dead | ||
| R2668 | T3409 | T3406 | themeOf | IKKβ,expressing | ||
| R2669 | T3409 | T3407 | themeOf | IKKβ,kinase-dead | ||
| R2670 | T3409 | T3408 | themeOf | IKKβ,constitutively-active | ||
| R2671 | T3410 | T3411 | causeOf | IKKβ,induced | ||
| R2672 | T3412 | T3411 | themeOf | dependent,induced | ||
| R2673 | T3416 | T3417 | themeOf | IKKβ,SSAA | ||
| R2674 | T3416 | T3418 | themeOf | IKKβ,expressing | ||
| R2675 | T3419 | T3420 | themeOf | RPS3,translocated | ||
| R2676 | T3421 | T3420 | locationOf | nucleus,translocated | ||
| R2677 | T3424 | T3425 | themeOf | RPS3,increased | ||
| R2678 | T3426 | T3427 | themeOf | IKKβ,expressing | ||
| R2679 | T3428 | T3430 | themeOf | IKKβ,expressing | ||
| R2680 | T3428 | T3429 | themeOf | IKKβ,SSAA | ||
| R2681 | T3431 | T3432 | causeOf | IKKβ,necessary | ||
| R2682 | T3431 | T3433 | causeOf | IKKβ,sufficient | ||
| R2683 | T3434 | T3436 | themeOf | RPS3,translocation | ||
| R2684 | T3435 | T3436 | locationOf | nuclear,translocation | ||
| R2685 | T3436 | T3433 | themeOf | translocation,sufficient | ||
| R2686 | T3436 | T3437 | themeOf | translocation,in response to | ||
| R2687 | T3437 | T3433 | themeOf | in response to,sufficient | ||
| R3921 | T4913 | T4914 | themeOf | IκBα,degradation | ||
| R3922 | T4915 | T4917 | themeOf | RPS3,translocation | ||
| R3923 | T4916 | T4917 | locationOf | nuclear,translocation | ||
| R3924 | T4919 | T4920 | locationOf | nuclear,import | ||
| R3925 | T4920 | T4918 | themeOf | import,regulates | ||
| R3926 | T4921 | T4920 | themeOf | Rel,import | ||
| R3927 | T4922 | T4926 | themeOf | RPS3,translocation | ||
| R3928 | T4923 | T4926 | locationOf | nuclear,translocation | ||
| R3929 | T4923 | T4924 | locationOf | nuclear,localization | ||
| R3930 | T4925 | T4926 | locationOf | nuclear,translocation | ||
| R3931 | T4927 | T4928 | themeOf | p65,translocation6 | ||
| R3932 | T4930 | T4931 | themeOf | RPS3,association | ||
| R3933 | T4931 | T4932 | themeOf | association,enhanced | ||
| R3934 | T4933 | T4937 | themeOf | RPS3,translocation | ||
| R3935 | T4933 | T4934 | themeOf | RPS3,binding | ||
| R3936 | T4934 | T4935 | causeOf | binding,essential | ||
| R3937 | T4936 | T4937 | locationOf | nuclear,translocation | ||
| R3938 | T4937 | T4935 | themeOf | translocation,essential | ||
| R3939 | T4938 | T4939 | themeOf | IκBα,degradation | ||
| R3940 | T4939 | T4940 | causeOf | degradation,prerequisite | ||
| R3941 | T4941 | T4940 | themeOf | unmask,prerequisite | ||
| R3942 | T4942 | T4943 | partOf | NLS,p65 | ||
| R3943 | T4942 | T4941 | themeOf | NLS,unmask | ||
| R3944 | T4942 | T4944 | partOf | NLS,RPS3 | ||
| R3945 | T4944 | T4946 | themeOf | RPS3,bind | ||
| R3946 | T4945 | T4946 | themeOf | IκBα,bind | ||
| R3947 | T4947 | T4946 | themeOf | p65,bind | ||
| R3948 | T4948 | T4949 | themeOf | IκBα,degradation | ||
| R3949 | T4949 | T4950 | causeOf | degradation,required | ||
| R3950 | T4953 | T4952 | themeOf | RPS3,association | ||
| R3951 | T4955 | T4954 | themeOf | IκBα,overexpressing | ||
| R3952 | T4956 | T4957 | themeOf | IκBα,SSAA | ||
| R3953 | T4956 | T4961 | themeOf | IκBα,degradation | ||
| R3954 | T4956 | T4960 | themeOf | IκBα,phosphorylation | ||
| R3955 | T4958 | T4959 | causeOf | IKKβ,induced | ||
| R3956 | T4960 | T4959 | themeOf | phosphorylation,induced | ||
| R3957 | T4961 | T4959 | themeOf | degradation,induced | ||
| R3958 | T4963 | T4962 | themeOf | IκBα,transfected | ||
| R3959 | T4965 | T4964 | themeOf | interaction,augmented | ||
| R3960 | T4966 | T4965 | themeOf | RPS3,interaction | ||
| R3961 | T4967 | T4968 | themeOf | RPS3,association | ||
| R3962 | T4968 | T4969 | themeOf | association,abolished | ||
| R3963 | T4970 | T4969 | causeOf | degradable,abolished | ||
| R3964 | T4971 | T4970 | themeOf | IκBα,degradable | ||
| R3965 | T4971 | T4969 | causeOf | IκBα,abolished | ||
| R3966 | T4973 | T4975 | themeOf | RPS3,translocation | ||
| R3967 | T4974 | T4975 | locationOf | nuclear,translocation | ||
| R3968 | T4976 | T4977 | themeOf | RPS3,association | ||
| R3969 | T4979 | T4977 | themeOf | RPS3,association | ||
| R3970 | T4981 | T4982 | themeOf | IκBα,expression | ||
| R3971 | T4982 | T4980 | themeOf | expression,reducing | ||
| R3972 | T4983 | T4985 | causeOf | siRNA,depleted | ||
| R3973 | T4986 | T4985 | themeOf | IκBα,depleted | ||
| R3974 | T4987 | T4988 | themeOf | RPS3,association | ||
| R3975 | T4988 | T4989 | themeOf | association,augmented | ||
| R3976 | T4990 | T4991 | themeOf | RPS3,detected | ||
| R3977 | T4993 | T4994 | themeOf | IκBα,degradation | ||
| R3978 | T4994 | T4992 | themeOf | degradation,induce | ||
| R3979 | T4996 | T4995 | themeOf | association,increased | ||
| R3980 | T4997 | T4996 | themeOf | RPS3,association | ||
| R3981 | T4998 | T4999 | locationOf | nuclear,accumulation | ||
| R3982 | T5000 | T4999 | themeOf | RPS3,accumulation | ||
| R3983 | T5001 | T5002 | themeOf | IκBα,degradation | ||
| R3984 | T5004 | T5003 | themeOf | association,promotes | ||
| R3985 | T5005 | T5003 | themeOf | transport,promotes | ||
| R3986 | T5006 | T5005 | themeOf | RPS3,transport | ||
| R3987 | T5007 | T5008 | themeOf | IκBα,degradation | ||
| R3988 | T5011 | T5012 | themeOf | RPS3,association | ||
| R3989 | T5012 | T5010 | themeOf | association,required | ||
| R3990 | T5013 | T5014 | themeOf | IκBα,phosphorylation | ||
| R3991 | T5013 | T5015 | themeOf | IκBα,degradation | ||
| R3992 | T5014 | T5017 | causeOf | phosphorylation,cause | ||
| R3993 | T5015 | T5017 | causeOf | degradation,cause | ||
| R3994 | T5015 | T5016 | causeOf | degradation,required | ||
| R3995 | T5018 | T5019 | themeOf | RPS3,association | ||
| R3996 | T5018 | T5022 | themeOf | RPS3,translocation | ||
| R3997 | T5019 | T5017 | themeOf | association,cause | ||
| R3998 | T5019 | T5020 | causeOf | association,followed | ||
| R3999 | T5021 | T5022 | locationOf | nuclear,translocation | ||
| R4000 | T5022 | T5020 | themeOf | translocation,followed | ||
| R4001 | T5024 | T5026 | themeOf | phosphorylation,required | ||
| R4002 | T5025 | T5024 | themeOf | RPS3,phosphorylation | ||
| R5542 | T6969 | T6970 | causeOf | IKKβ,phosphorylates | ||
| R5543 | T6972 | T6973 | themeOf | IKKβ,phosphorylates | ||
| R5544 | T6974 | T6973 | themeOf | 14-3-3β,phosphorylates | ||
| R5545 | T6975 | T6973 | themeOf | Bcl10,phosphorylates | ||
| R5546 | T6979 | T6978 | themeOf | RPS3,phosphorylate | ||
| R5547 | T6982 | T6981 | themeOf | IKKα,autophosphorylatd | ||
| R5548 | T6983 | T6981 | themeOf | IKKβ,autophosphorylatd | ||
| R5549 | T6985 | T6984 | themeOf | GST-IκBα,phosporylated | ||
| R5550 | T6989 | T6990 | themeOf | GST-RPS3,phosphorylated | ||
| R5551 | T6991 | T6990 | causeOf | IKKβ,phosphorylated | ||
| R5552 | T6994 | T6993 | partOf | amino acid residue(s,RPS3 | ||
| R5553 | T6996 | T6995 | causeOf | IKKβ,phosphorylated | ||
| R5554 | T6998 | T6997 | themeOf | RPS3,phosphorylated | ||
| R5555 | T6999 | T7000 | causeOf | IKKβ,phosphorylated | ||
| R5556 | T7001 | T7000 | themeOf | S209,phosphorylated | ||
| R5557 | T7010 | T7011 | causeOf | IKKβ–,mediated | ||
| R5558 | T7011 | T7009 | themeOf | mediated,reduced | ||
| R5559 | T7012 | T7013 | themeOf | RPS3,phosphorylation | ||
| R5560 | T7013 | T7011 | themeOf | phosphorylation,mediated | ||
| R5561 | T7015 | T7014 | themeOf | RPS3,phosphorylated | ||
| R5562 | T7016 | T7019 | themeOf | RPS3,recognized | ||
| R5563 | T7017 | T7019 | themeOf | S209,recognized | ||
| R5564 | T7017 | T7016 | partOf | S209,RPS3 | ||
| R5565 | T7018 | T7016 | partOf | sequence motif,RPS3 | ||
| R5566 | T7018 | T7019 | themeOf | sequence motif,recognized | ||
| R5567 | T7022 | T7023 | themeOf | S209,phosphorylation | ||
| R5568 | T7022 | T7021 | partOf | S209,RPS3 | ||
| R5569 | T7023 | T7024 | themeOf | phosphorylation,due | ||
| R5570 | T7025 | T7024 | causeOf | IKKβ,due | ||
| R5571 | T7026 | T7024 | causeOf | bound,due | ||
| R5572 | T7027 | T7030 | partOf | S209,RPS3 | ||
| R5573 | T7028 | T7029 | causeOf | IKKβ,phosphorylates | ||
| R5574 | T7030 | T7029 | themeOf | RPS3,phosphorylates | ||
| R5575 | T7033 | T7035 | causeOf | overexpressing,enhanced | ||
| R5576 | T7034 | T7035 | causeOf | IKKβ,enhanced | ||
| R5577 | T7034 | T7033 | themeOf | IKKβ,overexpressing | ||
| R5578 | T7036 | T7037 | themeOf | Flag-RPS3,phosphorylation | ||
| R5579 | T7037 | T7035 | themeOf | phosphorylation,enhanced | ||
| R5580 | T7037 | T7039 | themeOf | phosphorylation,eliminated | ||
| R5581 | T7038 | T7039 | themeOf | phosphorylation,eliminated | ||
| R5582 | T7040 | T7039 | causeOf | S209,eliminated | ||
| R5583 | T7040 | T7042 | themeOf | S209,phosphorylation | ||
| R5584 | T7040 | T7036 | partOf | S209,Flag-RPS3 | ||
| R5585 | T7045 | T7047 | themeOf | phosphorylated,dependent | ||
| R5586 | T7046 | T7045 | themeOf | S209,phosphorylated | ||
| R5587 | T7046 | T7044 | partOf | S209,RPS3 | ||
| R7069 | T8865 | T8864 | themeOf | RPS3,Phosphorylation | ||
| R7070 | T8866 | T8871 | partOf | S209,RPS3 | ||
| R7071 | T8866 | T8867 | themeOf | S209,phosphorylation | ||
| R7072 | T8867 | T8868 | causeOf | phosphorylation,role | ||
| R7073 | T8869 | T8870 | locationOf | nuclear,translocation | ||
| R7074 | T8870 | T8868 | themeOf | translocation,role | ||
| R7075 | T8871 | T8870 | themeOf | RPS3,translocation | ||
| R7076 | T8872 | T8873 | themeOf | RPS3,transfected | ||
| R7077 | T8875 | T8877 | themeOf | Flag-RPS3,translocation | ||
| R7078 | T8876 | T8877 | locationOf | nuclear,translocation | ||
| R7079 | T8877 | T8874 | themeOf | translocation,triggered | ||
| R7080 | T8878 | T8880 | themeOf | RPS3,translocation | ||
| R7081 | T8879 | T8880 | locationOf | nuclear,translocation | ||
| R7082 | T8880 | T8881 | themeOf | translocation,attenuated | ||
| R7083 | T8883 | T8882 | themeOf | IKKβ,overexpressing | ||
| R7084 | T8884 | T8886 | themeOf | RPS3,translocation | ||
| R7085 | T8885 | T8886 | locationOf | nuclear,translocation | ||
| R7086 | T8890 | T8891 | locationOf | nuclear,translocation | ||
| R7087 | T8891 | T8889 | themeOf | translocation,induced | ||
| R7088 | T8892 | T8891 | themeOf | RPS3,translocation | ||
| R7089 | T8893 | T8897 | partOf | S209,RPS3 | ||
| R7090 | T8893 | T8894 | themeOf | S209,phosphorylation | ||
| R7091 | T8894 | T8895 | causeOf | phosphorylation,critical | ||
| R7092 | T8896 | T8895 | themeOf | induced,critical | ||
| R7093 | T8897 | T8899 | themeOf | RPS3,translocation | ||
| R7094 | T8898 | T8899 | locationOf | nuclear,translocation | ||
| R7095 | T8899 | T8896 | themeOf | translocation,induced | ||
| R7096 | T8901 | T8902 | themeOf | S209,phosphorylation | ||
| R7097 | T8901 | T8903 | partOf | S209,RPS3 | ||
| R7098 | T8903 | T8902 | themeOf | RPS3,phosphorylation | ||
| R7099 | T8905 | T8906 | themeOf | RPS3,expression | ||
| R7100 | T8906 | T8904 | themeOf | expression,silenced | ||
| R7101 | T8909 | T8910 | causeOf | RPS3 siRNA,reduced | ||
| R7102 | T8909 | T8912 | causeOf | RPS3 siRNA,affect | ||
| R7103 | T8911 | T8910 | themeOf | RPS3,reduced | ||
| R7104 | T8913 | T8912 | themeOf | expression,affect | ||
| R7105 | T8914 | T8913 | themeOf | Flag-tagged RPS3,expression | ||
| R7106 | T8916 | T8917 | themeOf | RPS3,knockdown | ||
| R7107 | T8917 | T8918 | causeOf | knockdown,reduced | ||
| R7108 | T8919 | T8918 | themeOf | induced,reduced | ||
| R7109 | T8920 | T8919 | themeOf | expression,induced | ||
| R7110 | T8922 | T8920 | themeOf | luciferase,expression | ||
| R7111 | T8922 | T8921 | themeOf | luciferase,driven | ||
| R7112 | T8923 | T8928 | themeOf | impaired,restored | ||
| R7113 | T8924 | T8923 | themeOf | luciferase,impaired | ||
| R7114 | T8926 | T8927 | themeOf | RPS3,deficiency | ||
| R7115 | T8927 | T8923 | causeOf | deficiency,impaired | ||
| R7116 | T8927 | T8925 | causeOf | deficiency,caused | ||
| R7117 | T8927 | T8928 | themeOf | deficiency,restored | ||
| R7118 | T8929 | T8928 | causeOf | RPS3,restored | ||
| R7119 | T8933 | T8932 | themeOf | green fluorescent protein,overexpression | ||
| R7120 | T8934 | T8933 | equivalentTo | GFP,green fluorescent protein | ||
| R7121 | T8937 | T8936 | partOf | S209,RPS3 | ||
| R7122 | T8937 | T8938 | themeOf | S209,phosphorylation | ||
| R7123 | T8939 | T8943 | partOf | S209,p65 | ||
| R7124 | T8939 | T8942 | partOf | S209,RPS3 | ||
| R7125 | T8939 | T8940 | themeOf | S209,phosphorylation | ||
| R7126 | T8940 | T8941 | causeOf | phosphorylation,affects | ||
| R7127 | T8942 | T8944 | themeOf | RPS3,recruitment | ||
| R7128 | T8943 | T8944 | themeOf | p65,recruitment | ||
| R7129 | T8944 | T8941 | themeOf | recruitment,affects | ||
| R7130 | T8945 | T8946 | themeOf | RPS3,knockdown | ||
| R7131 | T8950 | T8952 | partOf | κB sites,IL8 | ||
| R7132 | T8950 | T8948 | themeOf | κB sites,expressed | ||
| R7133 | T8950 | T8947 | themeOf | κB sites,recruitment | ||
| R7134 | T8950 | T8951 | partOf | κB sites,NFKBIA | ||
| R7135 | T8956 | T8957 | causeOf | S209A,impact | ||
| R7136 | T8956 | T8954 | themeOf | S209A,expressing | ||
| R7137 | T8956 | T8961 | causeOf | S209A,attenuated | ||
| R7138 | T8956 | T8955 | partOf | S209A,RPS3 | ||
| R7139 | T8958 | T8960 | themeOf | p65,translocation | ||
| R7140 | T8959 | T8960 | locationOf | nuclear,translocation | ||
| R7141 | T8960 | T8957 | themeOf | translocation,impact | ||
| R7142 | T8962 | T8963 | themeOf | p65,recruitment | ||
| R7143 | T8963 | T8961 | themeOf | recruitment,attenuated | ||
| R7144 | T8964 | T8965 | themeOf | p65,attraction | ||
| R7145 | T8965 | T8968 | themeOf | attraction,increased | ||
| R7146 | T8969 | T8971 | themeOf | Flag-RPS3,recruitment | ||
| R7147 | T8970 | T8971 | themeOf | p65,recruitment | ||
| R7148 | T8973 | T8971 | locationOf | promoter,recruitment | ||
| R7149 | T8975 | T8974 | themeOf | RPS3,recruitment | ||
| R7150 | T8977 | T8976 | themeOf | p65,recruitment | ||
| R7151 | T8978 | T8974 | locationOf | promoters,recruitment | ||
| R7152 | T8978 | T8976 | locationOf | promoters,recruitment | ||
| R7153 | T8979 | T8975 | partOf | S209,RPS3 | ||
| R7154 | T8980 | T8982 | themeOf | Interleukin 8,secretion | ||
| R7155 | T8981 | T8980 | equivalentTo | IL-8,Interleukin 8 | ||
| R7156 | T8982 | T8983 | themeOf | secretion,induced | ||
| R7157 | T8982 | T8984 | themeOf | secretion,decreased | ||
| R7158 | T8983 | T8984 | themeOf | induced,decreased | ||
| R7159 | T8985 | T8984 | causeOf | reduced,decreased | ||
| R7160 | T8986 | T8988 | themeOf | RPS3,recruitment | ||
| R7161 | T8987 | T8988 | themeOf | p65,recruitment | ||
| R7162 | T8988 | T8985 | themeOf | recruitment,reduced | ||
| R7163 | T8990 | T8989 | partOf | κB sites,IL8 | ||
| R7164 | T8990 | T8988 | themeOf | κB sites,recruitment | ||
| R7165 | T8991 | T8985 | causeOf | S209A,reduced | ||
| R7166 | T8991 | T8992 | partOf | S209A,RPS3 | ||
| R7167 | T8993 | T8994 | themeOf | CD25,expression | ||
| R7168 | T8997 | T8998 | themeOf | S209,phosphorylation | ||
| R7169 | T8997 | T8996 | partOf | S209,RPS3 | ||
| R7170 | T8999 | T8998 | causeOf | IKKβ,phosphorylation | ||
| R7171 | T9001 | T9000 | themeOf | RPS3,required | ||
| R9428 | T11724 | T11725 | causeOf | NleH1,inhibits | ||
| R9429 | T11726 | T11727 | themeOf | RPS3,phosphorylation | ||
| R9430 | T11727 | T11725 | themeOf | phosphorylation,inhibits | ||
| R9431 | T11728 | T11729 | themeOf | NleH1,binds | ||
| R9432 | T11729 | T11730 | causeOf | binds,attenuates | ||
| R9433 | T11731 | T11733 | themeOf | RPS3,translocation | ||
| R9434 | T11732 | T11733 | locationOf | nuclear,translocation | ||
| R9435 | T11733 | T11730 | themeOf | translocation,attenuates | ||
| R9436 | T11735 | T11736 | causeOf | NleH1,inhibiting | ||
| R9437 | T11738 | T11737 | partOf | S209,RPS3 | ||
| R9438 | T11738 | T11739 | themeOf | S209,phosphorylation | ||
| R9439 | T11739 | T11736 | themeOf | phosphorylation,inhibiting | ||
| R9440 | T11742 | T11743 | causeOf | NleH1,reduced | ||
| R9441 | T11744 | T11745 | causeOf | TNF,induced | ||
| R9442 | T11745 | T11743 | themeOf | induced,reduced | ||
| R9443 | T11746 | T11747 | themeOf | RPS3,phosphorylation | ||
| R9444 | T11747 | T11745 | themeOf | phosphorylation,induced | ||
| R9445 | T11747 | T11743 | themeOf | phosphorylation,reduced | ||
| R9446 | T11749 | T11748 | themeOf | NleH1,Expressing | ||
| R9447 | T11750 | T11751 | causeOf | TNF,induced | ||
| R9448 | T11752 | T11751 | themeOf | activation,induced | ||
| R9449 | T11753 | T11754 | themeOf | IκBα,degradation | ||
| R9450 | T11754 | T11751 | themeOf | degradation,induced | ||
| R9451 | T11756 | T11755 | themeOf | NleH1,lack | ||
| R9452 | T11758 | T11760 | themeOf | p65,translocation9 | ||
| R9453 | T11759 | T11760 | locationOf | nuclear,translocation9 | ||
| R9454 | T11760 | T11757 | themeOf | translocation9,impact | ||
| R9455 | T11761 | T11762 | causeOf | NleH1,inhibits | ||
| R9456 | T11763 | T11764 | themeOf | RPS3,phosphorylation | ||
| R9457 | T11764 | T11762 | themeOf | phosphorylation,inhibits | ||
| R9458 | T11766 | T11765 | themeOf | nleH1,lacking | ||
| R9459 | T11770 | T11771 | causeOf | TNF,increase | ||
| R9460 | T11773 | T11772 | partOf | S209,RPS3 | ||
| R9461 | T11773 | T11774 | themeOf | S209,phosphorylation | ||
| R9462 | T11774 | T11771 | themeOf | phosphorylation,increase | ||
| R9463 | T11776 | T11775 | partOf | S209,RPS3 | ||
| R9464 | T11776 | T11777 | themeOf | S209,phosphorylation | ||
| R9465 | T11777 | T11778 | themeOf | phosphorylation,impaired | ||
| R9466 | T11779 | T11780 | causeOf | TNF,induced | ||
| R9467 | T11780 | T11784 | themeOf | induced,unimpaired | ||
| R9468 | T11782 | T11783 | themeOf | S209,phosphorylation | ||
| R9469 | T11782 | T11781 | partOf | S209,RPS3 | ||
| R9470 | T11783 | T11784 | themeOf | phosphorylation,unimpaired | ||
| R9471 | T11783 | T11780 | themeOf | phosphorylation,induced | ||
| R9472 | T11785 | T11784 | causeOf | ΔnleH1,unimpaired | ||
| R9473 | T11786 | T11784 | causeOf | ΔescN,unimpaired | ||
| R9474 | T11787 | T11789 | causeOf | ΔnleH1,attenuated | ||
| R9475 | T11788 | T11789 | causeOf | ΔescN,attenuated | ||
| R9476 | T11790 | T11791 | causeOf | TNF,induced | ||
| R9477 | T11791 | T11789 | themeOf | induced,attenuated | ||
| R9478 | T11792 | T11794 | themeOf | RPS3,translocation9 | ||
| R9479 | T11793 | T11794 | locationOf | nuclear,translocation9 | ||
| R9480 | T11794 | T11791 | themeOf | translocation9,induced | ||
| R9481 | T11795 | T11796 | themeOf | RPS3,phosphorylation | ||
| R9482 | T11795 | T11798 | themeOf | RPS3,translocation | ||
| R9483 | T11797 | T11798 | locationOf | nuclear,translocation | ||
| R9484 | T11799 | T11804 | themeOf | RPS3,translocation | ||
| R9485 | T11800 | T11799 | partOf | S209,RPS3 | ||
| R9486 | T11800 | T11801 | themeOf | S209,phosphorylation | ||
| R9487 | T11801 | T11802 | causeOf | phosphorylation,important | ||
| R9488 | T11803 | T11804 | locationOf | nuclear,translocation | ||
| R9489 | T11804 | T11802 | themeOf | translocation,important | ||
| R9490 | T11805 | T11806 | causeOf | NleH1,inhibits | ||
| R9491 | T11808 | T11807 | partOf | S209,RPS3 | ||
| R9492 | T11808 | T11809 | themeOf | S209,phosphorylation | ||
| R9493 | T11809 | T11806 | themeOf | phosphorylation,inhibits | ||
| R9494 | T11811 | T11813 | themeOf | IL8,TNFAIP3 | ||
| R9495 | T11812 | T11813 | themeOf | NFKBIA,TNFAIP3 | ||
| R9496 | T11817 | T11816 | themeOf | nleH1,deleting | ||
| R9497 | T11817 | T11818 | causeOf | nleH1,impact | ||
| R9498 | T11819 | T11818 | themeOf | expression,impact | ||
| R9499 | T11822 | T11823 | causeOf | NleH1,blocking | ||
| R9500 | T11825 | T11824 | partOf | S209,RPS3 | ||
| R9502 | T11826 | T11823 | themeOf | phosphorylation,blocking | ||
| R11659 | T14528 | T14527 | partOf | lysine 159,NleH1 | ||
| R11660 | T14529 | T14530 | causeOf | NleH1,inhibits | ||
| R11661 | T14532 | T14533 | themeOf | S209,phosphorylation | ||
| R11662 | T14532 | T14531 | partOf | S209,RPS3 | ||
| R11663 | T14533 | T14530 | themeOf | phosphorylation,inhibits | ||
| R11664 | T14536 | T14539 | themeOf | NleH1,kinase-dead | ||
| R11665 | T14536 | T14537 | themeOf | NleH1,autophosphorylated | ||
| R11666 | T14538 | T14539 | themeOf | NleH1,kinase-dead | ||
| R11667 | T14542 | T14540 | themeOf | inhibit,required | ||
| R11668 | T14544 | T14542 | themeOf | phosphorlyation,inhibit | ||
| R11669 | T14546 | T14545 | partOf | S209,RPS3 | ||
| R11670 | T14546 | T14544 | themeOf | S209,phosphorlyation | ||
| R11671 | T14548 | T14547 | themeOf | NleH1,expressing | ||
| R11672 | T14549 | T14550 | themeOf | NleH1,expression | ||
| R11673 | T14550 | T14551 | causeOf | expression,reduced | ||
| R11674 | T14552 | T14551 | themeOf | induced,reduced | ||
| R11675 | T14554 | T14555 | themeOf | S209,phosphorylation | ||
| R11676 | T14554 | T14553 | partOf | S209,RPS3 | ||
| R11677 | T14555 | T14552 | themeOf | phosphorylation,induced | ||
| R11678 | T14558 | T14557 | themeOf | protect,required | ||
| R11679 | T14559 | T14562 | themeOf | RPS3,phosphorylation | ||
| R11680 | T14560 | T14561 | causeOf | IKKβ,mediated | ||
| R11681 | T14561 | T14558 | themeOf | mediated,protect | ||
| R11682 | T14562 | T14561 | themeOf | phosphorylation,mediated | ||
| R11683 | T14563 | T14564 | causeOf | NleH,inhibited | ||
| R11684 | T14565 | T14567 | themeOf | RPS3,translocation | ||
| R11685 | T14566 | T14567 | locationOf | nuclear,translocation | ||
| R11686 | T14567 | T14564 | themeOf | translocation,inhibited | ||
| R11687 | T14568 | T14569 | causeOf | RPS3,dependent | ||
| R11688 | T14569 | T14564 | themeOf | dependent,inhibited | ||
| R11689 | T14573 | T14574 | themeOf | S209,phosphorylation | ||
| R11690 | T14573 | T14572 | partOf | S209,RPS3 | ||
| R11691 | T14578 | T14577 | partOf | S209,RPS3 | ||
| R11692 | T14578 | T14579 | themeOf | S209,phosphorylation | ||
| R11693 | T14579 | T14576 | themeOf | phosphorylation,increase | ||
| R11694 | T14580 | T14583 | themeOf | augmentation,reduced | ||
| R11695 | T14581 | T14582 | themeOf | RPS3,phosphorylation | ||
| R11696 | T14582 | T14583 | themeOf | phosphorylation,reduced | ||
| R11697 | T14582 | T14580 | themeOf | phosphorylation,augmentation | ||
| R11698 | T14584 | T14585 | themeOf | RPS3,phosphorylation | ||
| R11699 | T14585 | T14586 | themeOf | phosphorylation,enhanced | ||
| R11700 | T14587 | T14586 | causeOf | lacking,enhanced | ||
| R11701 | T14588 | T14587 | themeOf | NleH,lacking | ||
| R11702 | T14590 | T14592 | themeOf | NleH1,express | ||
| R11703 | T14591 | T14592 | themeOf | ΔnleH,express | ||
| R11704 | T14593 | T14592 | themeOf | NleH1,express | ||
| R11705 | T14595 | T14596 | causeOf | NleH1,abolished | ||
| R11706 | T14597 | T14598 | causeOf | TNF,induced | ||
| R11707 | T14598 | T14596 | themeOf | induced,abolished | ||
| R11708 | T14600 | T14601 | themeOf | S209,phosphorylation | ||
| R11709 | T14600 | T14599 | partOf | S209,RPS3 | ||
| R11710 | T14601 | T14598 | themeOf | phosphorylation,induced | ||
| R11711 | T14603 | T14604 | themeOf | RPS3,phosphorylation | ||
| R11712 | T14604 | T14602 | themeOf | phosphorylation,inhibit | ||
| R11713 | T14607 | T14606 | themeOf | block,required | ||
| R11714 | T14609 | T14608 | partOf | S209,RPS3 | ||
| R11715 | T14609 | T14610 | themeOf | S209,phosphorylation | ||
| R11716 | T14610 | T14607 | themeOf | phosphorylation,block | ||
| R11717 | T14613 | T14614 | locationOf | nuclear,translocation | ||
| R11718 | T14614 | T14612 | themeOf | translocation,impair | ||
| R11719 | T14614 | T14616 | themeOf | translocation,trigged | ||
| R11720 | T14615 | T14614 | themeOf | RPS3,translocation | ||
| R11721 | T14618 | T14616 | causeOf | IKKβ,trigged | ||
| R11722 | T14618 | T14617 | themeOf | IKKβ,constitutively-active | ||
| R11723 | T14619 | T14616 | causeOf | IKKβ,trigged | ||
| R11724 | T14619 | T14617 | themeOf | IKKβ,constitutively-active | ||
| R11725 | T14620 | T14622 | causeOf | expressing,triggered | ||
| R11726 | T14621 | T14620 | themeOf | SSEE IKKβ,expressing | ||
| R11727 | T14623 | T14625 | themeOf | RPS3,translocation | ||
| R11728 | T14624 | T14625 | locationOf | nuclear,translocation | ||
| R11729 | T14625 | T14622 | themeOf | translocation,triggered | ||
| R11730 | T14627 | T14626 | themeOf | IKKβ,kinase-dead | ||
| R11731 | T14627 | T14628 | themeOf | IKKβ,SSAA | ||
| R11732 | T14629 | T14631 | themeOf | RPS3,accumulation | ||
| R11733 | T14630 | T14631 | locationOf | nuclear,accumulation | ||
| R11734 | T14631 | T14632 | themeOf | accumulation,retarded | ||
| R11735 | T14633 | T14635 | causeOf | ΔnleH1,impaired | ||
| R11736 | T14634 | T14635 | causeOf | ΔescN,impaired | ||
| R11737 | T14636 | T14638 | themeOf | RPS3,translocation | ||
| R11738 | T14637 | T14638 | locationOf | nuclear,translocation | ||
| R11739 | T14638 | T14635 | themeOf | translocation,impaired | ||
| R11740 | T14639 | T14641 | themeOf | IKKβ,SSEE | ||
| R11741 | T14640 | T14641 | themeOf | IKKβ,SSEE | ||
| R11742 | T14640 | T14642 | themeOf | IKKβ,expressing | ||
| R11743 | T14644 | T14646 | themeOf | RPS3,translocation | ||
| R11744 | T14645 | T14646 | locationOf | nuclear,translocation | ||
| R11745 | T14646 | T14643 | themeOf | translocation,affect | ||
| R11746 | T14647 | T14649 | themeOf | IKKβ,expressing | ||
| R11747 | T14647 | T14648 | themeOf | IKKβ,SSAA | ||
| R11748 | T14650 | T14651 | causeOf | NleH1,inhibit | ||
| R11749 | T14652 | T14654 | themeOf | RPS3,translocation | ||
| R11750 | T14653 | T14654 | locationOf | nuclear,translocation | ||
| R11751 | T14654 | T14651 | themeOf | translocation,inhibit | ||
| R11752 | T14658 | T14655 | themeOf | IKKβ,expressing | ||
| R11753 | T14658 | T14657 | themeOf | IKKβ,activated | ||
| R11754 | T14659 | T14662 | causeOf | NleH1,inhibiting | ||
| R11755 | T14661 | T14660 | themeOf | IKKβ,phosphorylate | ||
| R11756 | T14663 | T14664 | causeOf | IKKβ,mediated | ||
| R11757 | T14664 | T14662 | themeOf | mediated,inhibiting | ||
| R11758 | T14666 | T14665 | partOf | S209,RPS3 | ||
| R11759 | T14666 | T14667 | themeOf | S209,phosphorylation | ||
| R11760 | T14667 | T14664 | themeOf | phosphorylation,mediated | ||
| R11761 | T14670 | T14671 | themeOf | IKKβ,autophosphorylation | ||
| R11762 | T14672 | T14673 | causeOf | NleH1,induced | ||
| R11763 | T14674 | T14673 | themeOf | phosphorylation,induced | ||
| R11764 | T14676 | T14677 | causeOf | NleH1,alter | ||
| R11765 | T14680 | T14681 | causeOf | IKKβ,phosphorylated | ||
| R11766 | T14682 | T14681 | themeOf | RPS3,phosphorylated | ||
| R11767 | T14687 | T14688 | causeOf | IKKβ,mediated | ||
| R11768 | T14688 | T14686 | themeOf | mediated,reduced | ||
| R11769 | T14689 | T14690 | themeOf | RPS3,phosphorylation | ||
| R11770 | T14690 | T14688 | themeOf | phosphorylation,mediated | ||
| R11771 | T14691 | T14692 | causeOf | IKKβ,mediated | ||
| R11772 | T14693 | T14694 | themeOf | GST-IκBα,phosphorylation | ||
| R11773 | T14694 | T14692 | themeOf | phosphorylation,mediated | ||
| R11774 | T14695 | T14696 | causeOf | NleH1,mediated | ||
| R11775 | T14697 | T14696 | themeOf | phosphorylation,mediated | ||
| R11776 | T14698 | T14696 | themeOf | autophosphorylation,mediated | ||
| R11777 | T14699 | T14698 | themeOf | RPS3,autophosphorylation | ||
| R11778 | T14699 | T14697 | themeOf | RPS3,phosphorylation | ||
| R11779 | T14700 | T14697 | themeOf | GST-IκBα,phosphorylation | ||
| R11780 | T14700 | T14698 | themeOf | GST-IκBα,autophosphorylation | ||
| R11781 | T14701 | T14703 | causeOf | NleH1,inhibiting | ||
| R11782 | T14704 | T14705 | causeOf | IKKβ,mediated | ||
| R11783 | T14705 | T14703 | themeOf | mediated,inhibiting | ||
| R11784 | T14707 | T14708 | themeOf | S209,phosphorylation | ||
| R11785 | T14707 | T14706 | partOf | S209,RPS3 | ||
| R11786 | T14708 | T14705 | themeOf | phosphorylation,mediated | ||
| R14294 | T17953 | T17954 | themeOf | RPS3,translocate | ||
| R14295 | T17954 | T17952 | themeOf | translocate,triggers | ||
| R14296 | T17955 | T17956 | causeOf | IKKβ,mediated | ||
| R14297 | T17957 | T17961 | themeOf | RPS3,import | ||
| R14298 | T17958 | T17957 | partOf | S209,RPS3 | ||
| R14299 | T17958 | T17959 | themeOf | S209,phosphorylation | ||
| R14300 | T17959 | T17956 | themeOf | phosphorylation,mediated | ||
| R14301 | T17960 | T17961 | locationOf | nuclear,import | ||
| R14302 | T17965 | T17967 | causeOf | IKKβ,phosphorylated | ||
| R14303 | T17966 | T17967 | causeOf | IKKα,phosphorylated | ||
| R14304 | T17968 | T17967 | themeOf | RPS3,phosphorylated | ||
| R14305 | T17970 | T17972 | themeOf | RPS3,translocation | ||
| R14306 | T17971 | T17972 | locationOf | nuclear,translocation | ||
| R14307 | T17972 | T17973 | themeOf | translocation,via | ||
| R14308 | T17972 | T17969 | themeOf | translocation,modulation | ||
| R14309 | T17974 | T17969 | causeOf | engagement,modulation | ||
| R14310 | T17976 | T17975 | themeOf | p65,phosphorylate | ||
| R14311 | T17976 | T17977 | themeOf | p65,bind | ||
| R14312 | T17979 | T17977 | themeOf | IKKβ,bind | ||
| R14313 | T17979 | T17978 | themeOf | IKKβ,phosphorylate | ||
| R14314 | T17980 | T17982 | causeOf | IKKβ,account | ||
| R14315 | T17980 | T17981 | themeOf | IKKβ,bound | ||
| R14316 | T17981 | T17982 | causeOf | bound,account | ||
| R14317 | T17983 | T17984 | themeOf | RPS3,phosphorylation | ||
| R14318 | T17984 | T17982 | themeOf | phosphorylation,account | ||
| R14319 | T17988 | T17989 | causeOf | IKKβ,mediated | ||
| R14320 | T17991 | T17990 | partOf | S209,RPS3 | ||
| R14321 | T17991 | T17992 | themeOf | S209,phosphorylation | ||
| R14322 | T17992 | T17989 | themeOf | phosphorylation,mediated | ||
| R14323 | T17993 | T17994 | themeOf | NleH1,binds | ||
| R14324 | T17995 | T17994 | themeOf | RPS3,binds | ||
| R14325 | T17996 | T17997 | causeOf | NleH1,inhibits | ||
| R14326 | T17998 | T18001 | themeOf | RPS3,translocation | ||
| R14327 | T17998 | T17999 | themeOf | RPS3,phosphorylation | ||
| R14328 | T17999 | T17997 | themeOf | phosphorylation,inhibits | ||
| R14329 | T18000 | T18001 | locationOf | nuclear,translocation | ||
| R14330 | T18004 | T18003 | themeOf | IKKβ,phosphorylate | ||
| R14331 | T18007 | T18008 | causeOf | IKKβ,mediated | ||
| R14332 | T18008 | T18006 | themeOf | mediated,inhibit | ||
| R14333 | T18010 | T18009 | partOf | S209,RPS3 | ||
| R14334 | T18010 | T18011 | themeOf | S209,phosphorylation | ||
| R14335 | T18011 | T18008 | themeOf | phosphorylation,mediated | ||
| R14336 | T18017 | T18018 | causeOf | NleH1,block | ||
| R14337 | T18019 | T18021 | themeOf | p65,translocation | ||
| R14338 | T18020 | T18021 | locationOf | nuclear,translocation | ||
| R14339 | T18021 | T18018 | themeOf | translocation,block | ||
| R14340 | T18026 | T18025 | themeOf | RPS3,inhibiting | ||
| R14341 | T18027 | T18025 | causeOf | NleH1,inhibiting | ||
| R14342 | T18029 | T18031 | themeOf | p65,translocation | ||
| R14343 | T18030 | T18031 | locationOf | nuclear,translocation | ||
| R9501 | T11825 | T11826 | themeOf | S209,phosphorylation | ||
| R10995 | T13700 | T13701 | causeOf | NleH1,inhibits | ||
| R10996 | T13703 | T13704 | themeOf | S209,phosphorylation | ||
| R10997 | T13703 | T13702 | partOf | S209,RPS3 | ||
| R10998 | T13704 | T13701 | themeOf | phosphorylation,inhibits | ||
| R10999 | T13707 | T13708 | causeOf | NleH1,blocked | ||
| R11000 | T13708 | T13712 | causeOf | blocked,preventing | ||
| R11001 | T13710 | T13709 | partOf | S209,RPS3 | ||
| R11002 | T13710 | T13711 | themeOf | S209,phosphorylation | ||
| R11003 | T13711 | T13708 | themeOf | phosphorylation,blocked | ||
| R11004 | T13713 | T13715 | themeOf | RPS3,translocation | ||
| R11005 | T13714 | T13715 | locationOf | nuclear,translocation | ||
| R11006 | T13715 | T13712 | themeOf | translocation,preventing | ||
| R11007 | T13721 | T13722 | causeOf | NleH1,inhibits | ||
| R11008 | T13724 | T13725 | themeOf | S209,phosphorylation | ||
| R11009 | T13724 | T13723 | partOf | S209,RPS3 | ||
| R11010 | T13725 | T13722 | themeOf | phosphorylation,inhibits |