PMC:2889865 / 26063-32795 JSON TXT

Annnotations TAB JSON ListView MergeView

pmc-enju-pas

bionlp-st-ge-2016-spacy-parsed

UBERON-AE

{"project":"UBERON-AE","denotations":[{"id":"T14124","span":{"begin":5291,"end":5295},"obj":"http://purl.obolibrary.org/obo/UBERON_0000025"},{"id":"T14961","span":{"begin":6669,"end":6675},"obj":"http://purl.obolibrary.org/obo/UBERON_0002415"},{"id":"T12467","span":{"begin":1321,"end":1326},"obj":"http://purl.obolibrary.org/obo/UBERON_0001977"},{"id":"T13791","span":{"begin":4346,"end":4351},"obj":"http://purl.obolibrary.org/obo/UBERON_0000025"}],"text":"Materials and methods\n\nChemicals\nThe following chemicals were used in the present study: PMA (Phorbol 12-myristate 13-acetate, (Sigma #P1585, USA)); NF-κB activation inhibitor (NAI), (InSolution™ NF-κB Activation Inhibitor, Calbiochem #481407, USA); JNK inhibitor, (InSolution™ JNK Inhibitor II, Calbiochem #420128, USA); PKC Inhibitor, (InSolution™ Bisindolylmaleimide I, Calbiochem #203293, USA); Calcium Ionophore, (Calcium Ionophore A23187 mixed calcium magnesium salt, Sigma #C5149, USA).\n\nHeat killed (HK) Escherichia coli\nE. coli MG1655 were grown on Luria-Bertani (LB) agar and incubated at 37°C overnight. One colony was inoculated into 10 ml LB broth and incubated on a shaker (200 rpm) at 37°C overnight. The bacteria were centrifuged for 10 min at 3000 × g, washed with 3 ml phosphate buffered saline (PBS; 8 g NaCl, 1.16 g Na2HPO4, 0.2 g KH2PO4, 0.2 g KCl, pH7) and resuspended in 50 μl PBS. The bacteria were killed by heating to 70°C for 1 h. To ensure that the bacteria were killed; 10 μl of the heat-killed suspension was spread on a LB plate and incubated overnight at 37°C.\n\nCell culturing, transfection and stimulation\nJurkat T-cells (wild type and TCR deficient- TCR-/-) were maintained in 90% RPMI 1640 medium (PAA laboratories, Austria) with 1.5 mM L-glutamine (Invitrogen, USA), 10% foetal bovine serum (Invitrogen, USA) and 1% antibiotic-antimycotic (Invitrogen, USA) and incubated in a stable environment of 5% CO2 at 37°C.\nThe cells were centrifuged at 1000 × g for 8 min and resuspended in fresh media to a final cell density of 1.6 × 107 cells/ml in a 24-well plate. Reporter plasmid (pNFκB-Luc, pAP1 (PMA)-TA-Luc, pNFκB-SEAP), internal control plasmid (pRL) (Promega, USA) and lipofectamine 2000 (Invitrogen, USA) were added to each well at 0.54 μg/well, 0.06 μg/well and 1.5 μl/well, respectively. Initially, the reporter plasmid and pRL were mixed separately with OptiMEM (Gibco, USA). After 5 min of incubation at room temperature, lipofectamine 2000 was added and the mixture was incubated further for 20 min at room temperature. The transfection was allowed to proceed overnight at 37°C, after which, the cells were centrifuged, the media removed and fresh pre-warmed media added. The cells were pre-incubated with NF-κB, JNK and PKC inhibitors and stimulated in 24-well plates with different concentrations of PMA, HK E. coli MG1655 and Calcium Ionophore A23187.\nThe cells were lysed and luciferase activity (NF-κB and AP-1) was measured using the Dual-Luciferase® reporter assay system (Promega, USA) according to the manufacturer's instructions on a TD 20/20 luminometer (Turner Designs, Sunnyvale, CA). Secreted alkaline phosphatase (NFκB-SEAP, figure 4a, b) levels were measured using Great EscAPe™ SEAP Detection Kit (Clontech, USA).\n\nMultiplex cytokine assay\nQuantification of the levels of cytokines IL-2, IL-6, IL-10 and TNF and the chemokine CXCL8 was performed on culture supernatants using multiplexed biomarker immunoassay kits according to manufacturer's instructions (Bio-Rad Laboratories, Hercules, CA). A Bio-Plex™ 200 readout System was used (Bio-Rad), which utilizes Luminex® xMAP™ fluorescent bead-based technology (Luminex Corp., Austin). Levels were automatically calculated from standard curves using Bio-Plex Manager software (v.4.1.1, Bio-Rad).\n\nEnzyme-linked immunosorbent assay (ELISA)\nELISA was performed on supernatants from challenged Jurkat T-cells to quantify IL-6, CXCL8 and TNF (BD OptEIA Human IL-6 Elisa Set, BD OptEIA Human CXCL8 Elisa Set and BD OptEIA Human TNF Elisa Set, Biosciences, USA) according to the manufacturer's instructions. Briefly, Jurkat T-cells were stimulated with PMA (162 nM) for 1 h, centrifuged (1000 × g, 8 min) and the supernatants were collected and stored at -80°C until use. Following centrifugation, the cells were resuspended in 1 h aged media, where cells have been grown in, containing PMA. The same procedure was performed to collect media after 2 h and 6 h. The final collection of media was performed after 24 h.\n\nWestern blot analysis\nFollowing stimulation, Jurkat T-cells were centrifuged at 1000 × g for 8 min and lysed on ice for 2 h using sodium hydroxide with the addition of a protease inhibitor cocktail (Roche, Mannheim). The cells were further centrifuged at 8000 × g, 4°C for 10 min and the supernatants were transferred to new tubes. Cytoplasmic proteins (~8 μg) were separated by SDS-PAGE (10%) followed by western blotting using anti-IκBβ, phospho-PKC (pan)(ζ Thr410)(190D10), anti-Bcl10 (Cell Signalling Technology, Boston) and beta-actin (Abcam, Cambridge). Detection was performed following incubation with ECL™ Anti-rabbit IgG, horseradish peroxidase linked whole antibodies (Amersham Biosciences, Buckinghamshire) and developed using ECL™ Western Blotting Detection Reagents (GE Healthcare, UK).\n\nRNA extraction\nJurkat T-cells were treated with NF-κB, JNK and PKC inhibitors for 2 h in 6-well plates followed by stimulation with 162 nM PMA for 24 h. At sampling the cells were pelleted followed by RNA extraction using 100 μl TRI-reagent (Sigma, USA). This was followed by addition of 100 μl chloroform/isoamylalcohol (24/1). The solutions were mixed by vortexing followed by centrifugation at 12,000 rpm for 15 min at 4°C. The upper phase was transferred to a new tube followed by addition of 100 μl iso-propanol and incubated at room temperature for 10 min. RNA was then pelleted by centrifugation at 12,000 rpm for 15 min at 4°C and washed with 70% ethanol. The RNA pellet was dissolved in 25 μl RNase free water and the yield and ratio (A260/A280) was determined using NanoVue (GE Healthcare, UK). The samples were stored at -80°C until further use.\n\nReverse transcription quantitative PCR (RT-qPCR)\nRT-qPCR was used to determine gene expression levels of il-6 and cxcl8 in response to PMA following inhibition of NF-κB, JNK and PKC. The following primer sequences were used, il-6: forward- TGTGAAAGCAGCAAAGAGGCACTG, reverse- ACAGCTCTGGCTTGTTCCTCACTA; cxcl8: forward- ACCACACTGCGCCAACACAGAAAT, reverse- AAACTTCTCCACAACCCTCTGCAC. Thermocycling conditions for CYBR Green (Quanta, USA) consisted of a denaturation step for 10 min at 95 °C followed by 60 cycles of 95°C for 1s and 60°C for 30s. Gene expression was analysed using Stratagene (Mx3000p™) (AH diagnostics). The obtained Ct values were normalized against 18S. Initially, all measured 18S Ct values were used to calculate a mean Ct value that was used to determine the ΔCt values for each sample. Gene expression patterns for il-6 and cxcl8 were then normalized with regard to the samples 18S ΔCt.\n\nStatistical analysis\nStatistical significant differences were determined using two-tailed Student's t-test (*p \u003c 0.05; **p \u003c 0.01; ***p \u003c 0.001).\n"}

GO-BP

GO-MF

GO-CC

sentences

events-check-again

bionlp-st-ge-2016-reference-tees

bionlp-st-ge-2016-reference

bionlp-st-ge-2016-uniprot

{"project":"bionlp-st-ge-2016-uniprot","denotations":[{"id":"T13140","span":{"begin":2424,"end":2434},"obj":"P08659"},{"id":"T13141","span":{"begin":2455,"end":2459},"obj":"P05412"},{"id":"T13142","span":{"begin":2489,"end":2499},"obj":"P08659"},{"id":"T13385","span":{"begin":2843,"end":2847},"obj":"P60568"},{"id":"T13386","span":{"begin":2849,"end":2853},"obj":"P05231"},{"id":"T13387","span":{"begin":2855,"end":2860},"obj":"P22301"},{"id":"T13388","span":{"begin":2865,"end":2868},"obj":"P01375"},{"id":"T13389","span":{"begin":2887,"end":2892},"obj":"P10145"},{"id":"T13734","span":{"begin":3427,"end":3431},"obj":"P05231"},{"id":"T13735","span":{"begin":3433,"end":3438},"obj":"P10145"},{"id":"T13736","span":{"begin":3443,"end":3446},"obj":"P01375"},{"id":"T13737","span":{"begin":3464,"end":3468},"obj":"P05231"},{"id":"T13738","span":{"begin":3496,"end":3501},"obj":"P10145"},{"id":"T13739","span":{"begin":3532,"end":3535},"obj":"P01375"},{"id":"T14097","span":{"begin":4455,"end":4459},"obj":"Q15653"},{"id":"T14098","span":{"begin":4503,"end":4508},"obj":"O95999"},{"id":"T14099","span":{"begin":4550,"end":4560},"obj":"P60709"},{"id":"T14849","span":{"begin":5786,"end":5790},"obj":"P05231"},{"id":"T14850","span":{"begin":5795,"end":5800},"obj":"P10145"},{"id":"T14851","span":{"begin":5906,"end":5910},"obj":"P05231"},{"id":"T14852","span":{"begin":5982,"end":5987},"obj":"P10145"},{"id":"T14853","span":{"begin":6513,"end":6517},"obj":"P05231"},{"id":"T14854","span":{"begin":6522,"end":6527},"obj":"P10145"}],"namespaces":[{"prefix":"_base","uri":"http://www.uniprot.org/uniprot/"}],"text":"Materials and methods\n\nChemicals\nThe following chemicals were used in the present study: PMA (Phorbol 12-myristate 13-acetate, (Sigma #P1585, USA)); NF-κB activation inhibitor (NAI), (InSolution™ NF-κB Activation Inhibitor, Calbiochem #481407, USA); JNK inhibitor, (InSolution™ JNK Inhibitor II, Calbiochem #420128, USA); PKC Inhibitor, (InSolution™ Bisindolylmaleimide I, Calbiochem #203293, USA); Calcium Ionophore, (Calcium Ionophore A23187 mixed calcium magnesium salt, Sigma #C5149, USA).\n\nHeat killed (HK) Escherichia coli\nE. coli MG1655 were grown on Luria-Bertani (LB) agar and incubated at 37°C overnight. One colony was inoculated into 10 ml LB broth and incubated on a shaker (200 rpm) at 37°C overnight. The bacteria were centrifuged for 10 min at 3000 × g, washed with 3 ml phosphate buffered saline (PBS; 8 g NaCl, 1.16 g Na2HPO4, 0.2 g KH2PO4, 0.2 g KCl, pH7) and resuspended in 50 μl PBS. The bacteria were killed by heating to 70°C for 1 h. To ensure that the bacteria were killed; 10 μl of the heat-killed suspension was spread on a LB plate and incubated overnight at 37°C.\n\nCell culturing, transfection and stimulation\nJurkat T-cells (wild type and TCR deficient- TCR-/-) were maintained in 90% RPMI 1640 medium (PAA laboratories, Austria) with 1.5 mM L-glutamine (Invitrogen, USA), 10% foetal bovine serum (Invitrogen, USA) and 1% antibiotic-antimycotic (Invitrogen, USA) and incubated in a stable environment of 5% CO2 at 37°C.\nThe cells were centrifuged at 1000 × g for 8 min and resuspended in fresh media to a final cell density of 1.6 × 107 cells/ml in a 24-well plate. Reporter plasmid (pNFκB-Luc, pAP1 (PMA)-TA-Luc, pNFκB-SEAP), internal control plasmid (pRL) (Promega, USA) and lipofectamine 2000 (Invitrogen, USA) were added to each well at 0.54 μg/well, 0.06 μg/well and 1.5 μl/well, respectively. Initially, the reporter plasmid and pRL were mixed separately with OptiMEM (Gibco, USA). After 5 min of incubation at room temperature, lipofectamine 2000 was added and the mixture was incubated further for 20 min at room temperature. The transfection was allowed to proceed overnight at 37°C, after which, the cells were centrifuged, the media removed and fresh pre-warmed media added. The cells were pre-incubated with NF-κB, JNK and PKC inhibitors and stimulated in 24-well plates with different concentrations of PMA, HK E. coli MG1655 and Calcium Ionophore A23187.\nThe cells were lysed and luciferase activity (NF-κB and AP-1) was measured using the Dual-Luciferase® reporter assay system (Promega, USA) according to the manufacturer's instructions on a TD 20/20 luminometer (Turner Designs, Sunnyvale, CA). Secreted alkaline phosphatase (NFκB-SEAP, figure 4a, b) levels were measured using Great EscAPe™ SEAP Detection Kit (Clontech, USA).\n\nMultiplex cytokine assay\nQuantification of the levels of cytokines IL-2, IL-6, IL-10 and TNF and the chemokine CXCL8 was performed on culture supernatants using multiplexed biomarker immunoassay kits according to manufacturer's instructions (Bio-Rad Laboratories, Hercules, CA). A Bio-Plex™ 200 readout System was used (Bio-Rad), which utilizes Luminex® xMAP™ fluorescent bead-based technology (Luminex Corp., Austin). Levels were automatically calculated from standard curves using Bio-Plex Manager software (v.4.1.1, Bio-Rad).\n\nEnzyme-linked immunosorbent assay (ELISA)\nELISA was performed on supernatants from challenged Jurkat T-cells to quantify IL-6, CXCL8 and TNF (BD OptEIA Human IL-6 Elisa Set, BD OptEIA Human CXCL8 Elisa Set and BD OptEIA Human TNF Elisa Set, Biosciences, USA) according to the manufacturer's instructions. Briefly, Jurkat T-cells were stimulated with PMA (162 nM) for 1 h, centrifuged (1000 × g, 8 min) and the supernatants were collected and stored at -80°C until use. Following centrifugation, the cells were resuspended in 1 h aged media, where cells have been grown in, containing PMA. The same procedure was performed to collect media after 2 h and 6 h. The final collection of media was performed after 24 h.\n\nWestern blot analysis\nFollowing stimulation, Jurkat T-cells were centrifuged at 1000 × g for 8 min and lysed on ice for 2 h using sodium hydroxide with the addition of a protease inhibitor cocktail (Roche, Mannheim). The cells were further centrifuged at 8000 × g, 4°C for 10 min and the supernatants were transferred to new tubes. Cytoplasmic proteins (~8 μg) were separated by SDS-PAGE (10%) followed by western blotting using anti-IκBβ, phospho-PKC (pan)(ζ Thr410)(190D10), anti-Bcl10 (Cell Signalling Technology, Boston) and beta-actin (Abcam, Cambridge). Detection was performed following incubation with ECL™ Anti-rabbit IgG, horseradish peroxidase linked whole antibodies (Amersham Biosciences, Buckinghamshire) and developed using ECL™ Western Blotting Detection Reagents (GE Healthcare, UK).\n\nRNA extraction\nJurkat T-cells were treated with NF-κB, JNK and PKC inhibitors for 2 h in 6-well plates followed by stimulation with 162 nM PMA for 24 h. At sampling the cells were pelleted followed by RNA extraction using 100 μl TRI-reagent (Sigma, USA). This was followed by addition of 100 μl chloroform/isoamylalcohol (24/1). The solutions were mixed by vortexing followed by centrifugation at 12,000 rpm for 15 min at 4°C. The upper phase was transferred to a new tube followed by addition of 100 μl iso-propanol and incubated at room temperature for 10 min. RNA was then pelleted by centrifugation at 12,000 rpm for 15 min at 4°C and washed with 70% ethanol. The RNA pellet was dissolved in 25 μl RNase free water and the yield and ratio (A260/A280) was determined using NanoVue (GE Healthcare, UK). The samples were stored at -80°C until further use.\n\nReverse transcription quantitative PCR (RT-qPCR)\nRT-qPCR was used to determine gene expression levels of il-6 and cxcl8 in response to PMA following inhibition of NF-κB, JNK and PKC. The following primer sequences were used, il-6: forward- TGTGAAAGCAGCAAAGAGGCACTG, reverse- ACAGCTCTGGCTTGTTCCTCACTA; cxcl8: forward- ACCACACTGCGCCAACACAGAAAT, reverse- AAACTTCTCCACAACCCTCTGCAC. Thermocycling conditions for CYBR Green (Quanta, USA) consisted of a denaturation step for 10 min at 95 °C followed by 60 cycles of 95°C for 1s and 60°C for 30s. Gene expression was analysed using Stratagene (Mx3000p™) (AH diagnostics). The obtained Ct values were normalized against 18S. Initially, all measured 18S Ct values were used to calculate a mean Ct value that was used to determine the ΔCt values for each sample. Gene expression patterns for il-6 and cxcl8 were then normalized with regard to the samples 18S ΔCt.\n\nStatistical analysis\nStatistical significant differences were determined using two-tailed Student's t-test (*p \u003c 0.05; **p \u003c 0.01; ***p \u003c 0.001).\n"}

test2

PMC:2889865 / 26063-32795 JSONTXT

Annnotations TAB JSON ListView MergeView

PMC:2889865 / 26063-32795 JSON TXT