PMC:2674207 / 12327-23162
Annnotations
2_test
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
19436703-15860753-86274485 | 246-248 | 15860753 | denotes | 34 |
19436703-17277157-86274486 | 1810-1812 | 17277157 | denotes | 12 |
19436703-15860753-86274487 | 1964-1966 | 15860753 | denotes | 34 |
19436703-17277157-86274488 | 2233-2235 | 17277157 | denotes | 12 |
19436703-11395507-86274489 | 2940-2942 | 11395507 | denotes | 35 |
19436703-17277157-86274490 | 3831-3833 | 17277157 | denotes | 12 |
19436703-10958685-86274491 | 4595-4597 | 10958685 | denotes | 36 |
19436703-15860753-86274492 | 6282-6284 | 15860753 | denotes | 34 |
T86367 | 246-248 | 15860753 | denotes | 34 |
T38919 | 1810-1812 | 17277157 | denotes | 12 |
T24071 | 1964-1966 | 15860753 | denotes | 34 |
T69573 | 2233-2235 | 17277157 | denotes | 12 |
T8362 | 2940-2942 | 11395507 | denotes | 35 |
T57036 | 3831-3833 | 17277157 | denotes | 12 |
T21764 | 4595-4597 | 10958685 | denotes | 36 |
T87031 | 6282-6284 | 15860753 | denotes | 34 |
pmc-enju-pas
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T3675 | 23-35 | NN | denotes | Participants |
T3676 | 36-39 | CC | denotes | and |
T3677 | 40-45 | NN | denotes | Study |
T3678 | 46-52 | NN | denotes | Design |
T3679 | 53-55 | PRP | denotes | We |
T3680 | 56-63 | VB | denotes | studied |
T3681 | 64-72 | NN | denotes | patients |
T3682 | 73-77 | IN | denotes | with |
T3683 | 78-82 | JJ | denotes | mild |
T3684 | 83-89 | NN | denotes | asthma |
T3685 | 90-93 | WP | denotes | who |
T3686 | 94-98 | VB | denotes | were |
T3687 | 99-102 | RB | denotes | not |
T3688 | 103-110 | VB | denotes | treated |
T3689 | 111-115 | IN | denotes | with |
T3690 | 116-123 | VB | denotes | inhaled |
T3691 | 124-139 | NN | denotes | corticosteroids |
T3692 | 140-143 | WP | denotes | who |
T3693 | 144-147 | VB | denotes | had |
T3694 | 148-152 | VB | denotes | been |
T3695 | 153-161 | VB | denotes | included |
T3696 | 162-164 | IN | denotes | in |
T3697 | 165-166 | DT | denotes | a |
T3698 | 167-177 | RB | denotes | previously |
T3699 | 178-186 | VB | denotes | reported |
T3700 | 187-199 | JJ | denotes | double-blind |
T3701 | 199-200 | -COMMA- | denotes | , |
T3702 | 201-219 | JJ | denotes | placebo-controlled |
T3703 | 219-220 | -COMMA- | denotes | , |
T3704 | 221-230 | JJ | denotes | crossover |
T3705 | 231-236 | NN | denotes | study |
T3706 | 237-241 | IN | denotes | with |
T3707 | 242-244 | NN | denotes | FP |
T3708 | 245-246 | -LRB- | denotes | [ |
T3709 | 246-248 | CD | denotes | 34 |
T3710 | 248-249 | -RRB- | denotes | ] |
T3711 | 251-256 | CD | denotes | Seven |
T3712 | 257-265 | NN | denotes | patients |
T3713 | 266-270 | IN | denotes | with |
T3714 | 271-275 | JJ | denotes | mild |
T3715 | 276-282 | NN | denotes | asthma |
T3716 | 283-290 | VB | denotes | entered |
T3717 | 291-294 | DT | denotes | the |
T3718 | 295-300 | NN | denotes | study |
T3719 | 301-304 | CC | denotes | and |
T3720 | 305-309 | VB | denotes | were |
T3721 | 310-320 | VB | denotes | randomized |
T3722 | 321-323 | TO | denotes | to |
T3723 | 324-331 | VB | denotes | receive |
T3724 | 332-333 | DT | denotes | a |
T3725 | 334-340 | JJ | denotes | single |
T3726 | 341-351 | NN | denotes | inhalation |
T3727 | 352-354 | IN | denotes | of |
T3728 | 355-357 | NN | denotes | FP |
T3729 | 358-359 | -LRB- | denotes | ( |
T3730 | 359-362 | CD | denotes | 100 |
T3731 | 363-366 | CC | denotes | and |
T3732 | 367-370 | CD | denotes | 500 |
T3733 | 371-373 | NN | denotes | µg |
T3734 | 373-374 | -RRB- | denotes | ) |
T3735 | 375-377 | CC | denotes | or |
T3736 | 378-379 | DT | denotes | a |
T3737 | 380-387 | JJ | denotes | matched |
T3738 | 388-395 | NN | denotes | placebo |
T3739 | 396-403 | NN | denotes | control |
T3740 | 404-407 | IN | denotes | via |
T3741 | 408-409 | DT | denotes | a |
T3742 | 410-416 | NN | denotes | spacer |
T3743 | 417-424 | NN | denotes | chamber |
T3744 | 424-425 | -COMMA- | denotes | , |
T3745 | 426-429 | CC | denotes | and |
T3746 | 430-433 | DT | denotes | the |
T3747 | 434-439 | JJ | denotes | other |
T3748 | 440-449 | NN | denotes | treatment |
T3749 | 450-453 | VB | denotes | was |
T3750 | 454-459 | VB | denotes | given |
T3751 | 460-465 | IN | denotes | after |
T3752 | 466-467 | DT | denotes | a |
T3753 | 468-476 | JJ | denotes | wash-out |
T3754 | 477-483 | NN | denotes | period |
T3755 | 484-486 | IN | denotes | of |
T3756 | 487-489 | IN | denotes | at |
T3757 | 490-495 | JJ | denotes | least |
T3758 | 496-497 | CD | denotes | 6 |
T3759 | 498-499 | NN | denotes | d |
T3760 | 501-506 | NN | denotes | Blood |
T3761 | 507-510 | VB | denotes | was |
T3762 | 511-516 | VB | denotes | taken |
T3763 | 517-520 | IN | denotes | for |
T3764 | 521-532 | NN | denotes | preparation |
T3765 | 533-535 | IN | denotes | of |
T3766 | 536-541 | NN | denotes | PBMCs |
T3767 | 542-544 | IN | denotes | at |
T3768 | 545-546 | CD | denotes | 1 |
T3769 | 547-550 | CC | denotes | and |
T3770 | 551-552 | CD | denotes | 2 |
T3771 | 553-554 | NN | denotes | h |
T3772 | 555-560 | IN | denotes | after |
T3773 | 561-565 | NN | denotes | drug |
T3774 | 566-580 | NN | denotes | administration |
T3775 | 582-585 | DT | denotes | All |
T3776 | 586-594 | NN | denotes | patients |
T3777 | 595-599 | VB | denotes | gave |
T3778 | 600-608 | VB | denotes | informed |
T3779 | 609-616 | NN | denotes | consent |
T3780 | 617-620 | CC | denotes | and |
T3781 | 621-624 | DT | denotes | the |
T3782 | 625-630 | NN | denotes | study |
T3783 | 631-634 | VB | denotes | was |
T3784 | 635-643 | VB | denotes | approved |
T3785 | 644-646 | IN | denotes | by |
T3786 | 647-650 | DT | denotes | the |
T3787 | 651-657 | NNP | denotes | Ethics |
T3788 | 658-667 | NNP | denotes | Committee |
T3789 | 668-670 | IN | denotes | of |
T3790 | 671-674 | DT | denotes | the |
T3791 | 675-680 | NNP | denotes | Royal |
T3792 | 681-689 | NNP | denotes | Brompton |
T3793 | 690-693 | CC | denotes | and |
T3794 | 694-703 | NNP | denotes | Harefield |
T3795 | 704-713 | NNP | denotes | Hospitals |
T3796 | 714-717 | NNP | denotes | NHS |
T3797 | 718-724 | NNP | denotes | Trust. |
T3798 | 725-728 | DT | denotes | The |
T3799 | 729-737 | JJ | denotes | clinical |
T3800 | 738-743 | NN | denotes | study |
T3801 | 744-747 | VB | denotes | was |
T3802 | 748-757 | VB | denotes | conducted |
T3803 | 758-764 | IN | denotes | before |
T3804 | 765-768 | DT | denotes | the |
T3805 | 769-780 | NN | denotes | requirement |
T3806 | 781-784 | IN | denotes | for |
T3807 | 785-793 | NNP | denotes | Clinical |
T3808 | 794-799 | NNP | denotes | Trial |
T3809 | 800-812 | NNP | denotes | Registration |
T3981 | 815-825 | NN | denotes | Antibodies |
T3982 | 826-829 | CC | denotes | and |
T3983 | 830-838 | NN | denotes | Reagents |
T3984 | 839-842 | DT | denotes | The |
T3985 | 843-853 | JJ | denotes | monoclonal |
T3986 | 854-864 | NN | denotes | antibodies |
T3987 | 865-872 | IN | denotes | against |
T3988 | 873-878 | JJ | denotes | human |
T3989 | 879-882 | NN | denotes | CD3 |
T3990 | 882-883 | -COMMA- | denotes | , |
T3991 | 884-888 | NN | denotes | CD28 |
T3992 | 888-889 | -COMMA- | denotes | , |
T3993 | 890-892 | NN | denotes | GR |
T3994 | 892-893 | -COMMA- | denotes | , |
T3995 | 894-897 | CC | denotes | and |
T3996 | 898-908 | NN | denotes | importin-α |
T3997 | 909-913 | VB | denotes | were |
T3998 | 914-923 | VB | denotes | purchased |
T3999 | 924-928 | IN | denotes | from |
T4000 | 929-931 | NN | denotes | BD |
T4001 | 932-943 | NNP | denotes | Biosciences |
T4002 | 944-945 | -LRB- | denotes | ( |
T4003 | 945-951 | NNP | denotes | Oxford |
T4004 | 951-952 | -COMMA- | denotes | , |
T4005 | 953-959 | NNP | denotes | United |
T4006 | 960-967 | NNP | denotes | Kingdom |
T4007 | 967-968 | -RRB- | denotes | ) |
T4008 | 970-976 | NN | denotes | Rabbit |
T4009 | 977-987 | NN | denotes | antibodies |
T4010 | 988-995 | IN | denotes | against |
T4011 | 996-1001 | JJ | denotes | human |
T4012 | 1002-1008 | NN | denotes | GATA-3 |
T4013 | 1009-1010 | -LRB- | denotes | ( |
T4014 | 1010-1014 | NN | denotes | H-48 |
T4015 | 1014-1015 | -RRB- | denotes | ) |
T4016 | 1016-1019 | CC | denotes | and |
T4017 | 1020-1022 | NN | denotes | GR |
T4018 | 1023-1024 | -LRB- | denotes | ( |
T4019 | 1024-1028 | NN | denotes | E-20 |
T4020 | 1028-1029 | -COMMA- | denotes | , |
T4021 | 1030-1037 | NN | denotes | sc-1003 |
T4022 | 1037-1038 | -RRB- | denotes | ) |
T4023 | 1039-1043 | VB | denotes | were |
T4024 | 1044-1052 | VB | denotes | obtained |
T4025 | 1053-1057 | IN | denotes | from |
T4026 | 1058-1063 | NNP | denotes | Santa |
T4027 | 1064-1068 | NNP | denotes | Cruz |
T4028 | 1069-1082 | NNP | denotes | Biotechnology |
T4029 | 1083-1084 | -LRB- | denotes | ( |
T4030 | 1084-1089 | NNP | denotes | Santa |
T4031 | 1090-1094 | NNP | denotes | Cruz |
T4032 | 1094-1095 | -COMMA- | denotes | , |
T4033 | 1096-1106 | NNP | denotes | California |
T4034 | 1106-1107 | -COMMA- | denotes | , |
T4035 | 1108-1114 | NNP | denotes | United |
T4036 | 1115-1121 | NNP | denotes | States |
T4037 | 1121-1122 | -RRB- | denotes | ) |
T4038 | 1122-1123 | -COMMA- | denotes | , |
T4039 | 1124-1134 | JJ | denotes | polyclonal |
T4040 | 1135-1141 | NN | denotes | rabbit |
T4041 | 1142-1152 | NN | denotes | antibodies |
T4042 | 1153-1160 | IN | denotes | against |
T4043 | 1161-1172 | JJ | denotes | phospho-p38 |
T4044 | 1173-1176 | NN | denotes | MAP |
T4045 | 1177-1183 | NN | denotes | kinase |
T4046 | 1184-1187 | CC | denotes | and |
T4047 | 1188-1201 | NN | denotes | phospho-ATF-2 |
T4048 | 1202-1206 | IN | denotes | from |
T4049 | 1207-1211 | NNP | denotes | Cell |
T4050 | 1212-1221 | NNP | denotes | Signaling |
T4051 | 1222-1232 | NNP | denotes | Technology |
T4052 | 1233-1234 | -LRB- | denotes | ( |
T4053 | 1234-1237 | NNP | denotes | New |
T4054 | 1238-1245 | NNP | denotes | England |
T4055 | 1246-1253 | NNP | denotes | Biolabs |
T4056 | 1253-1254 | -COMMA- | denotes | , |
T4057 | 1255-1263 | NNP | denotes | Hertford |
T4058 | 1263-1264 | -COMMA- | denotes | , |
T4059 | 1265-1267 | NNP | denotes | UK |
T4060 | 1267-1268 | -RRB- | denotes | ) |
T4061 | 1268-1269 | -COMMA- | denotes | , |
T4062 | 1270-1280 | JJ | denotes | monoclonal |
T4063 | 1281-1289 | NN | denotes | antibody |
T4064 | 1290-1297 | IN | denotes | against |
T4065 | 1298-1311 | NN | denotes | phosphoserine |
T4066 | 1312-1313 | -LRB- | denotes | ( |
T4067 | 1313-1318 | NN | denotes | clone |
T4068 | 1319-1322 | NN | denotes | 4H4 |
T4069 | 1322-1323 | -RRB- | denotes | ) |
T4070 | 1324-1328 | IN | denotes | from |
T4071 | 1329-1337 | NNP | denotes | Affiniti |
T4072 | 1338-1346 | NNP | denotes | Research |
T4073 | 1347-1355 | NNP | denotes | Products |
T4074 | 1356-1357 | -LRB- | denotes | ( |
T4075 | 1357-1363 | NNP | denotes | Exeter |
T4076 | 1363-1364 | -COMMA- | denotes | , |
T4077 | 1365-1367 | NNP | denotes | UK |
T4078 | 1367-1368 | -RRB- | denotes | ) |
T4079 | 1368-1369 | -COMMA- | denotes | , |
T4080 | 1370-1373 | CC | denotes | and |
T4081 | 1374-1384 | NN | denotes | antibodies |
T4082 | 1385-1392 | IN | denotes | against |
T4083 | 1393-1399 | NN | denotes | rabbit |
T4084 | 1400-1414 | JJ | denotes | IgG-conjugated |
T4085 | 1415-1420 | NN | denotes | TRITC |
T4086 | 1421-1425 | IN | denotes | from |
T4087 | 1426-1430 | NNP | denotes | Dako |
T4088 | 1431-1441 | NNP | denotes | Cytomation |
T4089 | 1442-1443 | -LRB- | denotes | ( |
T4090 | 1443-1452 | NNP | denotes | Cambridge |
T4091 | 1452-1453 | -COMMA- | denotes | , |
T4092 | 1454-1456 | NNP | denotes | UK |
T4093 | 1456-1457 | -RRB- | denotes | ) |
T4094 | 1459-1462 | DT | denotes | The |
T4095 | 1463-1470 | JJ | denotes | anti-GR |
T4096 | 1471-1479 | NN | denotes | antibody |
T4097 | 1480-1481 | -LRB- | denotes | ( |
T4098 | 1481-1486 | NN | denotes | Clone |
T4099 | 1487-1489 | CD | denotes | 41 |
T4100 | 1489-1490 | -RRB- | denotes | ) |
T4101 | 1491-1495 | IN | denotes | from |
T4102 | 1496-1498 | NN | denotes | BD |
T4103 | 1499-1511 | NN | denotes | Transduction |
T4104 | 1512-1524 | NN | denotes | Laboratories |
T4105 | 1525-1526 | -LRB- | denotes | ( |
T4106 | 1526-1532 | NNP | denotes | Oxford |
T4107 | 1532-1533 | -COMMA- | denotes | , |
T4108 | 1534-1536 | NNP | denotes | UK |
T4109 | 1536-1537 | -RRB- | denotes | ) |
T4110 | 1538-1541 | VB | denotes | was |
T4111 | 1542-1546 | VB | denotes | used |
T4112 | 1547-1550 | IN | denotes | for |
T4113 | 1551-1558 | JJ | denotes | Western |
T4114 | 1559-1563 | NN | denotes | blot |
T4115 | 1564-1572 | NN | denotes | analysis |
T4116 | 1574-1577 | DT | denotes | All |
T4117 | 1578-1583 | JJ | denotes | other |
T4118 | 1584-1592 | NN | denotes | reagents |
T4119 | 1593-1597 | VB | denotes | were |
T4120 | 1598-1607 | VB | denotes | purchased |
T4121 | 1608-1612 | IN | denotes | from |
T4122 | 1613-1618 | NN | denotes | Sigma |
T4123 | 1619-1620 | -LRB- | denotes | ( |
T4124 | 1620-1625 | NN | denotes | Poole |
T4125 | 1625-1626 | -COMMA- | denotes | , |
T4126 | 1627-1629 | NNP | denotes | UK |
T4127 | 1629-1630 | -RRB- | denotes | ) |
T4354 | 1633-1637 | NN | denotes | Cell |
T4355 | 1638-1645 | NN | denotes | Culture |
T4356 | 1646-1649 | CC | denotes | and |
T4357 | 1650-1654 | NN | denotes | PBMC |
T4358 | 1655-1664 | NN | denotes | Isolation |
T4359 | 1665-1666 | DT | denotes | A |
T4360 | 1667-1672 | JJ | denotes | human |
T4361 | 1673-1674 | NN | denotes | T |
T4362 | 1675-1679 | NN | denotes | cell |
T4363 | 1680-1684 | NN | denotes | line |
T4364 | 1685-1686 | -LRB- | denotes | ( |
T4365 | 1686-1692 | NN | denotes | HuT-78 |
T4366 | 1692-1693 | -RRB- | denotes | ) |
T4367 | 1694-1697 | VB | denotes | was |
T4368 | 1698-1707 | VB | denotes | purchased |
T4369 | 1708-1712 | IN | denotes | from |
T4370 | 1713-1718 | NN | denotes | ECACC |
T4371 | 1719-1727 | NNP | denotes | European |
T4372 | 1728-1738 | NNP | denotes | Collection |
T4373 | 1739-1741 | IN | denotes | of |
T4374 | 1742-1746 | NNP | denotes | Cell |
T4375 | 1747-1754 | NNP | denotes | Culture |
T4376 | 1755-1756 | -LRB- | denotes | ( |
T4377 | 1756-1765 | NNP | denotes | Wiltshire |
T4378 | 1765-1766 | -COMMA- | denotes | , |
T4379 | 1767-1769 | NNP | denotes | UK |
T4380 | 1769-1770 | -RRB- | denotes | ) |
T4381 | 1771-1775 | VB | denotes | were |
T4382 | 1776-1784 | VB | denotes | cultured |
T4383 | 1785-1787 | IN | denotes | as |
T4384 | 1788-1798 | RB | denotes | previously |
T4385 | 1799-1808 | VB | denotes | described |
T4386 | 1809-1810 | -LRB- | denotes | [ |
T4387 | 1810-1812 | CD | denotes | 12 |
T4388 | 1812-1813 | -RRB- | denotes | ] |
T4389 | 1815-1820 | NN | denotes | PBMCs |
T4390 | 1821-1825 | VB | denotes | were |
T4391 | 1826-1834 | VB | denotes | isolated |
T4392 | 1835-1837 | IN | denotes | by |
T4393 | 1838-1845 | NN | denotes | density |
T4394 | 1846-1860 | NN | denotes | centrifugation |
T4395 | 1861-1865 | IN | denotes | over |
T4396 | 1866-1880 | JJ | denotes | Ficoll-Hypaque |
T4397 | 1881-1882 | -LRB- | denotes | ( |
T4398 | 1882-1889 | NN | denotes | density |
T4399 | 1889-1890 | -COMMA- | denotes | , |
T4400 | 1891-1896 | CD | denotes | 1.077 |
T4401 | 1897-1901 | NN | denotes | g/ml |
T4402 | 1901-1902 | -COLON- | denotes | ; |
T4403 | 1903-1911 | NNP | denotes | Amersham |
T4404 | 1912-1923 | NNP | denotes | Biosciences |
T4405 | 1923-1924 | -COMMA- | denotes | , |
T4406 | 1925-1933 | NNP | denotes | Amersham |
T4407 | 1933-1934 | -COMMA- | denotes | , |
T4408 | 1935-1937 | NNP | denotes | UK |
T4409 | 1937-1938 | -RRB- | denotes | ) |
T4410 | 1939-1941 | IN | denotes | as |
T4411 | 1942-1952 | RB | denotes | previously |
T4412 | 1953-1962 | VB | denotes | described |
T4413 | 1963-1964 | -LRB- | denotes | [ |
T4414 | 1964-1966 | CD | denotes | 34 |
T4415 | 1966-1967 | -RRB- | denotes | ] |
T4416 | 1969-1974 | NN | denotes | Cells |
T4417 | 1975-1979 | VB | denotes | were |
T4418 | 1980-1990 | VB | denotes | stimulated |
T4419 | 1991-1995 | IN | denotes | with |
T4420 | 1996-2009 | JJ | denotes | anti-CD3/CD28 |
T4421 | 2010-2011 | -LRB- | denotes | ( |
T4422 | 2011-2012 | CD | denotes | 1 |
T4423 | 2013-2018 | NN | denotes | µg/ml |
T4424 | 2019-2023 | DT | denotes | each |
T4425 | 2023-2024 | -RRB- | denotes | ) |
T4426 | 2025-2028 | IN | denotes | for |
T4427 | 2029-2030 | CD | denotes | 1 |
T4428 | 2031-2032 | NN | denotes | h |
T4429 | 2033-2035 | IN | denotes | at |
T4430 | 2036-2040 | NN | denotes | 37°C |
T4431 | 2041-2043 | TO | denotes | to |
T4432 | 2044-2053 | VB | denotes | stimulate |
T4433 | 2054-2057 | NN | denotes | Th2 |
T4434 | 2058-2066 | NN | denotes | cytokine |
T4435 | 2067-2074 | NN | denotes | release |
T4436 | 2075-2077 | IN | denotes | in |
T4437 | 2078-2081 | DT | denotes | the |
T4438 | 2082-2090 | NN | denotes | presence |
T4439 | 2091-2093 | CC | denotes | or |
T4440 | 2094-2101 | NN | denotes | absence |
T4441 | 2102-2104 | IN | denotes | of |
T4442 | 2105-2107 | NN | denotes | FP |
T4443 | 2108-2109 | -LRB- | denotes | ( |
T4444 | 2109-2114 | CD | denotes | 10−12 |
T4445 | 2115-2117 | TO | denotes | to |
T4446 | 2118-2123 | NN | denotes | 10−8M |
T4447 | 2123-2124 | -RRB- | denotes | ) |
T4448 | 2126-2135 | NN | denotes | Cytospins |
T4449 | 2136-2140 | VB | denotes | were |
T4450 | 2141-2149 | VB | denotes | prepared |
T4451 | 2150-2153 | CC | denotes | and |
T4452 | 2154-2160 | NN | denotes | GATA-3 |
T4453 | 2161-2173 | NN | denotes | localization |
T4454 | 2174-2184 | VB | denotes | determined |
T4455 | 2185-2187 | IN | denotes | by |
T4456 | 2188-2196 | JJ | denotes | confocal |
T4457 | 2197-2207 | NN | denotes | microscopy |
T4458 | 2208-2210 | IN | denotes | as |
T4459 | 2211-2221 | RB | denotes | previously |
T4460 | 2222-2231 | VB | denotes | described |
T4461 | 2232-2233 | -LRB- | denotes | [ |
T4462 | 2233-2235 | CD | denotes | 12 |
T4463 | 2235-2236 | -RRB- | denotes | ] |
T4622 | 2239-2246 | JJ | denotes | Reverse |
T4623 | 2247-2260 | NN | denotes | Transcription |
T4624 | 2261-2264 | NN | denotes | PCR |
T4625 | 2265-2270 | JJ | denotes | Total |
T4626 | 2271-2274 | NN | denotes | RNA |
T4627 | 2275-2278 | VB | denotes | was |
T4628 | 2279-2288 | VB | denotes | extracted |
T4629 | 2289-2294 | VB | denotes | using |
T4630 | 2295-2300 | NN | denotes | lysis |
T4631 | 2301-2307 | NN | denotes | buffer |
T4632 | 2308-2309 | -LRB- | denotes | ( |
T4633 | 2309-2315 | NN | denotes | RNeasy |
T4634 | 2316-2319 | NN | denotes | kit |
T4635 | 2319-2320 | -COLON- | denotes | ; |
T4636 | 2321-2327 | NNP | denotes | Qiagen |
T4637 | 2327-2328 | -COMMA- | denotes | , |
T4638 | 2329-2336 | NNP | denotes | Crawley |
T4639 | 2336-2337 | -COMMA- | denotes | , |
T4640 | 2338-2340 | NNP | denotes | UK |
T4641 | 2340-2341 | -RRB- | denotes | ) |
T4642 | 2343-2349 | IN | denotes | During |
T4643 | 2350-2353 | NN | denotes | RNA |
T4644 | 2354-2366 | NN | denotes | purification |
T4645 | 2366-2367 | -COMMA- | denotes | , |
T4646 | 2368-2375 | JJ | denotes | genomic |
T4647 | 2376-2379 | NN | denotes | DNA |
T4648 | 2380-2383 | VB | denotes | was |
T4649 | 2384-2392 | VB | denotes | digested |
T4650 | 2393-2397 | IN | denotes | with |
T4651 | 2398-2408 | JJ | denotes | RNase-free |
T4652 | 2409-2414 | NN | denotes | DNase |
T4653 | 2415-2416 | -LRB- | denotes | ( |
T4654 | 2416-2424 | NNP | denotes | Amersham |
T4655 | 2425-2436 | NNP | denotes | Biosciences |
T4656 | 2436-2437 | -RRB- | denotes | ) |
T4657 | 2439-2443 | RB | denotes | Next |
T4658 | 2443-2444 | -COMMA- | denotes | , |
T4659 | 2445-2448 | CD | denotes | 0.5 |
T4660 | 2449-2451 | NN | denotes | µg |
T4661 | 2452-2454 | IN | denotes | of |
T4662 | 2455-2460 | JJ | denotes | total |
T4663 | 2461-2464 | NN | denotes | RNA |
T4664 | 2465-2468 | VB | denotes | was |
T4665 | 2469-2477 | VB | denotes | reversed |
T4666 | 2478-2489 | VB | denotes | transcribed |
T4667 | 2490-2495 | VB | denotes | using |
T4668 | 2496-2499 | DT | denotes | the |
T4669 | 2500-2505 | JJ | denotes | avian |
T4670 | 2506-2520 | NN | denotes | myeloblastosis |
T4671 | 2521-2526 | NN | denotes | virus |
T4672 | 2527-2529 | NN | denotes | RT |
T4673 | 2530-2531 | -LRB- | denotes | ( |
T4674 | 2531-2538 | NNP | denotes | Promega |
T4675 | 2538-2539 | -COMMA- | denotes | , |
T4676 | 2540-2551 | NNP | denotes | Southampton |
T4677 | 2551-2552 | -COMMA- | denotes | , |
T4678 | 2553-2555 | NNP | denotes | UK |
T4679 | 2555-2556 | -RRB- | denotes | ) |
T4680 | 2558-2561 | IN | denotes | For |
T4681 | 2562-2570 | JJ | denotes | relative |
T4682 | 2571-2585 | NN | denotes | quantification |
T4683 | 2585-2586 | -COMMA- | denotes | , |
T4684 | 2587-2593 | NN | denotes | RT-PCR |
T4685 | 2594-2597 | VB | denotes | was |
T4686 | 2598-2605 | VB | denotes | carried |
T4687 | 2606-2609 | RP | denotes | out |
T4688 | 2610-2615 | VB | denotes | using |
T4689 | 2616-2620 | NN | denotes | cDNA |
T4690 | 2621-2627 | NN | denotes | probes |
T4691 | 2629-2636 | NN | denotes | Primers |
T4692 | 2637-2640 | IN | denotes | for |
T4693 | 2641-2645 | NN | denotes | IL-4 |
T4694 | 2646-2650 | VB | denotes | were |
T4695 | 2651-2655 | IN | denotes | from |
T4696 | 2656-2669 | NN | denotes | Sigma-Genosys |
T4697 | 2670-2671 | -LRB- | denotes | ( |
T4698 | 2671-2680 | NNP | denotes | Cambridge |
T4699 | 2680-2681 | -COMMA- | denotes | , |
T4700 | 2682-2684 | NNP | denotes | UK |
T4701 | 2684-2685 | -RRB- | denotes | ) |
T4702 | 2687-2696 | NN | denotes | Sequences |
T4703 | 2697-2699 | IN | denotes | of |
T4704 | 2700-2705 | NN | denotes | GADPH |
T4705 | 2706-2710 | VB | denotes | used |
T4706 | 2711-2714 | VB | denotes | are |
T4707 | 2715-2717 | IN | denotes | as |
T4708 | 2718-2725 | VB | denotes | follows |
T4709 | 2725-2726 | -COLON- | denotes | : |
T4710 | 2727-2734 | RB | denotes | forward |
T4711 | 2735-2761 | NN | denotes | 5′-CCACCCATGGCAAATTCCATGGC |
T4712 | 2761-2762 | -COMMA- | denotes | , |
T4713 | 2763-2770 | JJ | denotes | reverse |
T4714 | 2771-2797 | NN | denotes | 3′-TCTAGACGGCAGGTCAGGTCCAC |
T4853 | 2800-2804 | NNP | denotes | Cell |
T4854 | 2805-2818 | NNP | denotes | Fractionation |
T4855 | 2818-2819 | -COMMA- | denotes | , |
T4856 | 2820-2839 | NN | denotes | Immunoprecipitation |
T4857 | 2839-2840 | -COMMA- | denotes | , |
T4858 | 2841-2844 | CC | denotes | and |
T4859 | 2845-2852 | NNP | denotes | Western |
T4860 | 2853-2857 | NNP | denotes | Blot |
T4861 | 2858-2866 | NN | denotes | Analysis |
T4862 | 2867-2874 | JJ | denotes | Nuclear |
T4863 | 2875-2878 | CC | denotes | and |
T4864 | 2879-2890 | JJ | denotes | cytoplasmic |
T4865 | 2891-2900 | NN | denotes | fractions |
T4866 | 2901-2905 | VB | denotes | were |
T4867 | 2906-2914 | VB | denotes | prepared |
T4868 | 2915-2917 | IN | denotes | as |
T4869 | 2918-2928 | RB | denotes | previously |
T4870 | 2929-2938 | VB | denotes | described |
T4871 | 2939-2940 | -LRB- | denotes | [ |
T4872 | 2940-2942 | CD | denotes | 35 |
T4873 | 2942-2943 | -RRB- | denotes | ] |
T4874 | 2945-2950 | JJ | denotes | Whole |
T4875 | 2951-2955 | NN | denotes | cell |
T4876 | 2956-2963 | NN | denotes | lysates |
T4877 | 2964-2968 | VB | denotes | were |
T4878 | 2969-2977 | VB | denotes | prepared |
T4879 | 2978-2980 | IN | denotes | in |
T4880 | 2981-2986 | NN | denotes | NP-40 |
T4881 | 2987-2992 | NN | denotes | lysis |
T4882 | 2993-2999 | NN | denotes | buffer |
T4883 | 3000-3001 | -LRB- | denotes | ( |
T4884 | 3001-3004 | CD | denotes | 0.5 |
T4885 | 3004-3005 | NN | denotes | % |
T4886 | 3006-3013 | NN | denotes | Nonidet |
T4887 | 3014-3018 | NN | denotes | P-40 |
T4888 | 3018-3019 | -COMMA- | denotes | , |
T4889 | 3020-3022 | CD | denotes | 20 |
T4890 | 3023-3025 | NN | denotes | mM |
T4891 | 3026-3034 | NN | denotes | Tris-HCl |
T4892 | 3035-3036 | -LRB- | denotes | [ |
T4893 | 3036-3038 | NN | denotes | pH |
T4894 | 3039-3042 | CD | denotes | 7.5 |
T4895 | 3042-3043 | -RRB- | denotes | ] |
T4896 | 3043-3044 | -COMMA- | denotes | , |
T4897 | 3045-3048 | CD | denotes | 150 |
T4898 | 3049-3051 | NN | denotes | mM |
T4899 | 3052-3056 | NN | denotes | NaCl |
T4900 | 3056-3057 | -RRB- | denotes | ) |
T4901 | 3058-3060 | IN | denotes | in |
T4902 | 3061-3064 | DT | denotes | the |
T4903 | 3065-3073 | NN | denotes | presence |
T4904 | 3074-3076 | IN | denotes | of |
T4905 | 3077-3085 | JJ | denotes | complete |
T4906 | 3086-3094 | NN | denotes | protease |
T4907 | 3095-3103 | NN | denotes | cocktail |
T4908 | 3104-3113 | NN | denotes | inhibitor |
T4909 | 3115-3122 | NN | denotes | Lysates |
T4910 | 3123-3127 | VB | denotes | were |
T4911 | 3128-3139 | VB | denotes | centrifuged |
T4912 | 3140-3142 | IN | denotes | at |
T4913 | 3143-3146 | NN | denotes | 4°C |
T4914 | 3147-3150 | IN | denotes | for |
T4915 | 3151-3153 | CD | denotes | 10 |
T4916 | 3154-3157 | NN | denotes | min |
T4917 | 3158-3160 | IN | denotes | at |
T4918 | 3161-3167 | CD | denotes | 12,000 |
T4919 | 3168-3171 | NN | denotes | rpm |
T4920 | 3172-3174 | IN | denotes | in |
T4921 | 3175-3177 | DT | denotes | an |
T4922 | 3178-3187 | NNP | denotes | Eppendorf |
T4923 | 3188-3203 | NN | denotes | microcentrifuge |
T4924 | 3204-3206 | TO | denotes | to |
T4925 | 3207-3213 | VB | denotes | remove |
T4926 | 3214-3222 | JJ | denotes | cellular |
T4927 | 3223-3229 | NN | denotes | debris |
T4928 | 3231-3238 | NN | denotes | Samples |
T4929 | 3239-3243 | VB | denotes | were |
T4930 | 3244-3248 | RB | denotes | then |
T4931 | 3249-3267 | VB | denotes | immunoprecipitated |
T4932 | 3268-3272 | IN | denotes | with |
T4933 | 3273-3279 | CC | denotes | either |
T4934 | 3280-3282 | CD | denotes | 10 |
T4935 | 3283-3285 | NN | denotes | µl |
T4936 | 3286-3288 | IN | denotes | of |
T4937 | 3289-3297 | NN | denotes | antibody |
T4938 | 3298-3305 | IN | denotes | against |
T4939 | 3306-3312 | NN | denotes | GATA-3 |
T4940 | 3313-3315 | CC | denotes | or |
T4941 | 3316-3326 | NN | denotes | importin-α |
T4942 | 3327-3332 | VB | denotes | using |
T4943 | 3333-3336 | NN | denotes | A/G |
T4944 | 3337-3344 | VB | denotes | agarose |
T4945 | 3345-3351 | NN | denotes | slurry |
T4946 | 3352-3354 | IN | denotes | in |
T4947 | 3355-3358 | DT | denotes | the |
T4948 | 3359-3367 | NN | denotes | presence |
T4949 | 3368-3370 | IN | denotes | of |
T4950 | 3371-3379 | NN | denotes | protease |
T4951 | 3380-3389 | NN | denotes | inhibitor |
T4952 | 3390-3395 | VB | denotes | using |
T4953 | 3396-3399 | DT | denotes | the |
T4954 | 3400-3405 | NNP | denotes | Catch |
T4955 | 3406-3409 | CC | denotes | and |
T4956 | 3410-3417 | NN | denotes | Release |
T4957 | 3418-3429 | NN | denotes | methodology |
T4958 | 3430-3431 | -LRB- | denotes | ( |
T4959 | 3431-3438 | NNP | denotes | Upstate |
T4960 | 3439-3452 | NNP | denotes | Biotechnology |
T4961 | 3452-3453 | -COMMA- | denotes | , |
T4962 | 3454-3458 | NNP | denotes | Lake |
T4963 | 3459-3465 | NNP | denotes | Placid |
T4964 | 3465-3466 | -COMMA- | denotes | , |
T4965 | 3467-3470 | NNP | denotes | New |
T4966 | 3471-3475 | NNP | denotes | York |
T4967 | 3475-3476 | -COMMA- | denotes | , |
T4968 | 3477-3480 | NNP | denotes | USA |
T4969 | 3480-3481 | -RRB- | denotes | ) |
T4970 | 3483-3490 | NN | denotes | Western |
T4971 | 3491-3495 | NN | denotes | blot |
T4972 | 3496-3504 | NN | denotes | analysis |
T4973 | 3505-3508 | VB | denotes | was |
T4974 | 3509-3518 | VB | denotes | performed |
T4975 | 3519-3524 | VB | denotes | using |
T4976 | 3525-3536 | NN | denotes | anti-GATA-3 |
T4977 | 3536-3537 | -COMMA- | denotes | , |
T4978 | 3538-3553 | JJ | denotes | anti-importin-α |
T4979 | 3553-3554 | -COMMA- | denotes | , |
T4980 | 3555-3562 | JJ | denotes | anti-GR |
T4981 | 3562-3563 | -COMMA- | denotes | , |
T4982 | 3564-3574 | JJ | denotes | anti-p-p38 |
T4983 | 3575-3578 | NN | denotes | MAP |
T4984 | 3579-3585 | NN | denotes | kinase |
T4985 | 3585-3586 | -COMMA- | denotes | , |
T4986 | 3587-3599 | NN | denotes | anti-p-ATF-2 |
T4987 | 3599-3600 | -COMMA- | denotes | , |
T4988 | 3601-3604 | CC | denotes | and |
T4989 | 3605-3618 | JJ | denotes | anti-p-serine |
T4990 | 3620-3634 | JJ | denotes | Immunoreactive |
T4991 | 3635-3643 | NN | denotes | proteins |
T4992 | 3644-3648 | VB | denotes | were |
T4993 | 3649-3657 | VB | denotes | detected |
T4994 | 3658-3663 | VB | denotes | using |
T4995 | 3664-3666 | DT | denotes | an |
T4996 | 3667-3675 | VB | denotes | enhanced |
T4997 | 3676-3693 | NN | denotes | chemiluminescence |
T4998 | 3694-3697 | NN | denotes | ECL |
T4999 | 3698-3701 | NN | denotes | kit |
T5000 | 3702-3703 | -LRB- | denotes | ( |
T5001 | 3703-3711 | NNP | denotes | Amersham |
T5002 | 3712-3723 | NNP | denotes | Biosciences |
T5003 | 3723-3724 | -RRB- | denotes | ) |
T5206 | 3727-3736 | NN | denotes | Chromatin |
T5207 | 3737-3756 | NN | denotes | Immunoprecipitation |
T5208 | 3757-3766 | NN | denotes | Chromatin |
T5209 | 3767-3786 | NN | denotes | immunoprecipitation |
T5210 | 3787-3788 | -LRB- | denotes | ( |
T5211 | 3788-3790 | NN | denotes | IP |
T5212 | 3790-3791 | -RRB- | denotes | ) |
T5213 | 3792-3795 | VB | denotes | was |
T5214 | 3796-3805 | VB | denotes | performed |
T5215 | 3806-3808 | IN | denotes | as |
T5216 | 3809-3819 | RB | denotes | previously |
T5217 | 3820-3829 | VB | denotes | described |
T5218 | 3830-3831 | -LRB- | denotes | [ |
T5219 | 3831-3833 | CD | denotes | 12 |
T5220 | 3833-3834 | -RRB- | denotes | ] |
T5221 | 3835-3837 | IN | denotes | in |
T5222 | 3838-3844 | JJ | denotes | HuT-78 |
T5223 | 3845-3852 | NN | denotes | T-cells |
T5224 | 3853-3857 | IN | denotes | with |
T5225 | 3858-3859 | CD | denotes | 2 |
T5226 | 3860-3862 | NN | denotes | µg |
T5227 | 3863-3865 | IN | denotes | of |
T5228 | 3866-3877 | NN | denotes | anti-GATA-3 |
T5229 | 3878-3879 | -LRB- | denotes | ( |
T5230 | 3879-3884 | NNP | denotes | Santa |
T5231 | 3885-3889 | NNP | denotes | Cruz |
T5232 | 3890-3903 | NNP | denotes | Biotechnology |
T5233 | 3903-3904 | -RRB- | denotes | ) |
T5234 | 3904-3905 | -COMMA- | denotes | , |
T5235 | 3906-3908 | CC | denotes | or |
T5236 | 3909-3917 | JJ | denotes | isotypic |
T5237 | 3918-3932 | NN | denotes | immunoglobulin |
T5238 | 3933-3934 | NN | denotes | G |
T5239 | 3935-3937 | IN | denotes | as |
T5240 | 3938-3939 | DT | denotes | a |
T5241 | 3940-3952 | JJ | denotes | non-specific |
T5242 | 3953-3960 | NN | denotes | control |
T5243 | 3961-3962 | -LRB- | denotes | ( |
T5244 | 3962-3967 | NNP | denotes | Santa |
T5245 | 3968-3972 | NNP | denotes | Cruz |
T5246 | 3973-3986 | NNP | denotes | Biotechnology |
T5247 | 3986-3987 | -RRB- | denotes | ) |
T5248 | 3988-3997 | RB | denotes | overnight |
T5249 | 3998-4000 | IN | denotes | at |
T5250 | 4001-4005 | NNP | denotes | 4°C. |
T5251 | 4006-4014 | NNP | denotes | Promoter |
T5252 | 4015-4024 | NN | denotes | sequences |
T5253 | 4025-4029 | VB | denotes | were |
T5254 | 4030-4038 | VB | denotes | detected |
T5255 | 4039-4043 | IN | denotes | with |
T5256 | 4044-4047 | NN | denotes | PCR |
T5257 | 4048-4055 | NN | denotes | primers |
T5258 | 4056-4059 | IN | denotes | for |
T5259 | 4060-4063 | DT | denotes | the |
T5260 | 4064-4068 | NN | denotes | IL-5 |
T5261 | 4069-4077 | NN | denotes | promoter |
T5262 | 4078-4079 | -LRB- | denotes | ( |
T5263 | 4079-4083 | CD | denotes | −445 |
T5264 | 4084-4086 | TO | denotes | to |
T5265 | 4087-4089 | CD | denotes | +4 |
T5266 | 4089-4090 | -RRB- | denotes | ) |
T5267 | 4090-4091 | -COLON- | denotes | : |
T5268 | 4092-4099 | JJ | denotes | forward |
T5269 | 4100-4127 | NN | denotes | 5′-TTAATCTAGCCACAGTCATAG-3′ |
T5270 | 4128-4131 | CC | denotes | and |
T5271 | 4132-4139 | VB | denotes | reverse |
T5272 | 4139-4140 | -COLON- | denotes | : |
T5273 | 4141-4168 | NN | denotes | 5′-TCATGGCTCTGAAACGTTCTG-3′ |
T5274 | 4170-4173 | NN | denotes | PCR |
T5275 | 4174-4177 | VB | denotes | was |
T5276 | 4178-4187 | VB | denotes | performed |
T5277 | 4188-4193 | VB | denotes | using |
T5278 | 4194-4195 | DT | denotes | a |
T5279 | 4196-4202 | NNP | denotes | Hybaid |
T5280 | 4203-4211 | NNP | denotes | Omnigene |
T5281 | 4212-4219 | JJ | denotes | thermal |
T5282 | 4220-4226 | NN | denotes | cycler |
T5283 | 4227-4228 | -LRB- | denotes | ( |
T5284 | 4228-4234 | NNP | denotes | Hybaid |
T5285 | 4234-4235 | -COMMA- | denotes | , |
T5286 | 4236-4243 | NNP | denotes | Ashford |
T5287 | 4243-4244 | -COMMA- | denotes | , |
T5288 | 4245-4247 | NNP | denotes | UK |
T5289 | 4247-4248 | -RRB- | denotes | ) |
T5290 | 4249-4253 | IN | denotes | with |
T5291 | 4254-4261 | VB | denotes | cycling |
T5292 | 4262-4272 | NN | denotes | parameters |
T5293 | 4273-4275 | IN | denotes | of |
T5294 | 4276-4280 | NN | denotes | 72°C |
T5295 | 4281-4284 | IN | denotes | for |
T5296 | 4285-4287 | CD | denotes | 10 |
T5297 | 4288-4291 | NN | denotes | min |
T5298 | 4291-4292 | -COMMA- | denotes | , |
T5301 | 4303-4305 | IN | denotes | at |
T5302 | 4306-4310 | NN | denotes | 94°C |
T5303 | 4311-4314 | IN | denotes | for |
T5304 | 4315-4317 | CD | denotes | 45 |
T5305 | 4318-4319 | NN | denotes | s |
T5306 | 4319-4320 | -COMMA- | denotes | , |
T5307 | 4321-4325 | NN | denotes | 52°C |
T5308 | 4326-4329 | IN | denotes | for |
T5309 | 4330-4332 | CD | denotes | 45 |
T5310 | 4333-4334 | NN | denotes | s |
T5311 | 4334-4335 | -COMMA- | denotes | , |
T5312 | 4336-4340 | NN | denotes | 72°C |
T5313 | 4341-4344 | IN | denotes | for |
T5314 | 4345-4347 | CD | denotes | 45 |
T5315 | 4348-4349 | NN | denotes | s |
T5499 | 4352-4361 | NN | denotes | GR-GATA-3 |
T5500 | 4362-4364 | IN | denotes | In |
T5501 | 4365-4370 | NNP | denotes | Vitro |
T5502 | 4371-4382 | NNP | denotes | Competition |
T5503 | 4383-4388 | NNP | denotes | Assay |
T5504 | 4389-4392 | IN | denotes | for |
T5505 | 4393-4403 | NNP | denotes | Importin-α |
T5506 | 4404-4405 | -LRB- | denotes | ( |
T5507 | 4405-4416 | JJ | denotes | Far-Western |
T5508 | 4417-4422 | NN | denotes | ELISA |
T5509 | 4422-4423 | -RRB- | denotes | ) |
T5510 | 4424-4442 | VB | denotes | Immunoprecipitated |
T5511 | 4443-4453 | JJ | denotes | importin-α |
T5512 | 4454-4455 | -LRB- | denotes | ( |
T5513 | 4455-4470 | JJ | denotes | anti-importin-α |
T5514 | 4470-4471 | -COMMA- | denotes | , |
T5515 | 4472-4477 | NNP | denotes | Santa |
T5516 | 4478-4482 | NNP | denotes | Cruz |
T5517 | 4483-4496 | NNP | denotes | Biotechnology |
T5518 | 4496-4497 | -RRB- | denotes | ) |
T5519 | 4498-4502 | IN | denotes | from |
T5520 | 4503-4509 | NN | denotes | HuT-78 |
T5521 | 4510-4515 | NN | denotes | cells |
T5522 | 4516-4519 | VB | denotes | was |
T5523 | 4520-4529 | VB | denotes | separated |
T5524 | 4530-4532 | IN | denotes | by |
T5525 | 4533-4541 | NN | denotes | SDS-PAGE |
T5526 | 4542-4545 | CC | denotes | and |
T5527 | 4546-4554 | VB | denotes | purified |
T5528 | 4555-4559 | IN | denotes | from |
T5529 | 4560-4563 | DT | denotes | the |
T5530 | 4564-4571 | VB | denotes | excised |
T5531 | 4572-4575 | NN | denotes | gel |
T5532 | 4576-4578 | IN | denotes | by |
T5533 | 4579-4593 | NN | denotes | electroelution |
T5534 | 4594-4595 | -LRB- | denotes | [ |
T5535 | 4595-4597 | CD | denotes | 36 |
T5536 | 4597-4598 | -RRB- | denotes | ] |
T5537 | 4600-4609 | RB | denotes | Similarly |
T5538 | 4609-4610 | -COMMA- | denotes | , |
T5539 | 4611-4617 | NN | denotes | GATA-3 |
T5540 | 4618-4621 | VB | denotes | was |
T5541 | 4622-4630 | VB | denotes | isolated |
T5542 | 4631-4635 | IN | denotes | from |
T5543 | 4636-4649 | JJ | denotes | nonstimulated |
T5544 | 4650-4656 | NN | denotes | HuT-78 |
T5545 | 4657-4662 | NN | denotes | cells |
T5546 | 4663-4665 | CC | denotes | or |
T5547 | 4666-4671 | NN | denotes | cells |
T5548 | 4672-4682 | VB | denotes | stimulated |
T5549 | 4683-4686 | IN | denotes | for |
T5550 | 4687-4689 | CD | denotes | 30 |
T5551 | 4690-4693 | NN | denotes | min |
T5552 | 4694-4698 | IN | denotes | with |
T5553 | 4699-4712 | JJ | denotes | anti-CD3/CD28 |
T5554 | 4713-4716 | CC | denotes | and |
T5555 | 4717-4719 | NN | denotes | GR |
T5556 | 4720-4723 | VB | denotes | was |
T5557 | 4724-4732 | VB | denotes | isolated |
T5558 | 4733-4737 | IN | denotes | from |
T5559 | 4738-4740 | NN | denotes | FP |
T5560 | 4741-4742 | -LRB- | denotes | ( |
T5561 | 4742-4746 | CD | denotes | 10−8 |
T5562 | 4747-4748 | NN | denotes | M |
T5563 | 4748-4749 | -COMMA- | denotes | , |
T5564 | 4750-4752 | CD | denotes | 30 |
T5565 | 4753-4756 | NN | denotes | min |
T5566 | 4756-4757 | -RRB- | denotes | ) |
T5567 | 4758-4768 | VB | denotes | stimulated |
T5568 | 4769-4775 | NN | denotes | HuT-78 |
T5569 | 4776-4781 | NN | denotes | cells |
T5570 | 4783-4788 | DT | denotes | These |
T5571 | 4789-4797 | NN | denotes | proteins |
T5572 | 4798-4802 | VB | denotes | were |
T5573 | 4803-4815 | RB | denotes | subsequently |
T5574 | 4816-4824 | VB | denotes | refolded |
T5575 | 4825-4827 | IN | denotes | in |
T5576 | 4828-4835 | NN | denotes | glycine |
T5577 | 4836-4844 | NN | denotes | solution |
T5578 | 4846-4849 | CD | denotes | 100 |
T5579 | 4850-4852 | NN | denotes | µl |
T5580 | 4853-4855 | IN | denotes | of |
T5581 | 4856-4866 | JJ | denotes | importin-α |
T5582 | 4867-4875 | NN | denotes | solution |
T5583 | 4876-4877 | -LRB- | denotes | ( |
T5584 | 4877-4880 | CD | denotes | 100 |
T5585 | 4881-4886 | NN | denotes | ng/ml |
T5586 | 4887-4889 | IN | denotes | in |
T5587 | 4890-4893 | NN | denotes | TBS |
T5588 | 4893-4894 | -RRB- | denotes | ) |
T5589 | 4895-4898 | VB | denotes | was |
T5590 | 4899-4904 | VB | denotes | added |
T5591 | 4905-4907 | TO | denotes | to |
T5592 | 4908-4915 | JJ | denotes | 96-well |
T5593 | 4916-4922 | NN | denotes | plates |
T5594 | 4923-4929 | VB | denotes | coated |
T5595 | 4930-4934 | IN | denotes | with |
T5596 | 4935-4939 | NN | denotes | goat |
T5597 | 4940-4955 | JJ | denotes | anti-importin-α |
T5598 | 4956-4964 | NN | denotes | antibody |
T5599 | 4966-4971 | IN | denotes | After |
T5600 | 4972-4973 | CD | denotes | 1 |
T5601 | 4974-4975 | NN | denotes | h |
T5602 | 4976-4986 | NN | denotes | incubation |
T5603 | 4986-4987 | -COMMA- | denotes | , |
T5604 | 4988-4994 | NN | denotes | GATA-3 |
T5605 | 4995-4996 | -LRB- | denotes | ( |
T5606 | 4996-4999 | CD | denotes | 100 |
T5607 | 5000-5005 | NN | denotes | ng/ml |
T5608 | 5006-5008 | IN | denotes | in |
T5609 | 5009-5012 | NN | denotes | TBS |
T5610 | 5012-5013 | -RRB- | denotes | ) |
T5611 | 5014-5018 | IN | denotes | from |
T5612 | 5019-5029 | VB | denotes | stimulated |
T5613 | 5030-5032 | CC | denotes | or |
T5614 | 5033-5045 | JJ | denotes | unstimulated |
T5615 | 5046-5051 | NN | denotes | cells |
T5616 | 5052-5056 | VB | denotes | were |
T5617 | 5057-5062 | VB | denotes | added |
T5618 | 5063-5065 | TO | denotes | to |
T5619 | 5066-5069 | DT | denotes | the |
T5620 | 5070-5087 | JJ | denotes | importin-α-coated |
T5621 | 5088-5093 | NN | denotes | wells |
T5622 | 5095-5097 | NN | denotes | GR |
T5623 | 5098-5099 | -LRB- | denotes | ( |
T5624 | 5099-5101 | CD | denotes | 10 |
T5625 | 5102-5104 | CC | denotes | or |
T5626 | 5105-5108 | CD | denotes | 100 |
T5627 | 5109-5114 | NN | denotes | ng/ml |
T5628 | 5115-5117 | IN | denotes | in |
T5629 | 5118-5121 | NN | denotes | TBS |
T5630 | 5121-5122 | -RRB- | denotes | ) |
T5631 | 5123-5127 | IN | denotes | from |
T5632 | 5128-5138 | VB | denotes | stimulated |
T5633 | 5139-5141 | CC | denotes | or |
T5634 | 5142-5154 | JJ | denotes | unstimulated |
T5635 | 5155-5160 | NN | denotes | cells |
T5636 | 5161-5165 | VB | denotes | were |
T5637 | 5166-5171 | VB | denotes | added |
T5638 | 5172-5174 | TO | denotes | to |
T5639 | 5175-5179 | DT | denotes | some |
T5640 | 5180-5185 | NN | denotes | wells |
T5641 | 5187-5192 | IN | denotes | After |
T5642 | 5193-5194 | DT | denotes | a |
T5643 | 5195-5202 | JJ | denotes | further |
T5644 | 5203-5204 | CD | denotes | 1 |
T5645 | 5205-5206 | NN | denotes | h |
T5646 | 5207-5217 | NN | denotes | incubation |
T5647 | 5217-5218 | -COMMA- | denotes | , |
T5648 | 5219-5222 | DT | denotes | the |
T5649 | 5223-5228 | NN | denotes | plate |
T5650 | 5229-5232 | VB | denotes | was |
T5651 | 5233-5239 | VB | denotes | washed |
T5652 | 5240-5243 | CC | denotes | and |
T5653 | 5244-5253 | VB | denotes | incubated |
T5654 | 5254-5258 | IN | denotes | with |
T5655 | 5259-5266 | JJ | denotes | primary |
T5656 | 5267-5277 | NN | denotes | antibodies |
T5657 | 5278-5279 | -LRB- | denotes | ( |
T5658 | 5279-5280 | DT | denotes | a |
T5659 | 5281-5288 | NN | denotes | mixture |
T5660 | 5289-5291 | IN | denotes | of |
T5661 | 5292-5298 | NN | denotes | rabbit |
T5662 | 5299-5310 | NN | denotes | anti-GATA-3 |
T5663 | 5311-5314 | CC | denotes | and |
T5664 | 5315-5320 | NN | denotes | mouse |
T5665 | 5321-5328 | NN | denotes | anti-GR |
T5666 | 5328-5329 | -COMMA- | denotes | , |
T5667 | 5330-5335 | NNP | denotes | Santa |
T5668 | 5336-5340 | NNP | denotes | Cruz |
T5669 | 5341-5354 | NNP | denotes | Biotechnology |
T5670 | 5354-5355 | -RRB- | denotes | ) |
T5671 | 5356-5359 | IN | denotes | for |
T5672 | 5360-5363 | CD | denotes | 1.5 |
T5673 | 5364-5365 | NN | denotes | h |
T5674 | 5365-5366 | -COMMA- | denotes | , |
T5675 | 5367-5370 | CC | denotes | and |
T5676 | 5371-5375 | RB | denotes | then |
T5677 | 5376-5385 | VB | denotes | incubated |
T5678 | 5386-5390 | IN | denotes | with |
T5679 | 5391-5400 | JJ | denotes | secondary |
T5680 | 5401-5411 | NN | denotes | antibodies |
T5681 | 5413-5417 | NN | denotes | FITC |
T5682 | 5418-5423 | NN | denotes | swine |
T5683 | 5424-5435 | JJ | denotes | anti-rabbit |
T5684 | 5436-5439 | NN | denotes | IgG |
T5685 | 5440-5441 | -LRB- | denotes | ( |
T5686 | 5441-5445 | NNP | denotes | Dako |
T5687 | 5445-5446 | -COMMA- | denotes | , |
T5688 | 5447-5456 | NNP | denotes | Cambridge |
T5689 | 5456-5457 | -COMMA- | denotes | , |
T5690 | 5458-5460 | NNP | denotes | UK |
T5691 | 5460-5461 | -RRB- | denotes | ) |
T5692 | 5462-5465 | VB | denotes | was |
T5693 | 5466-5470 | VB | denotes | used |
T5694 | 5471-5474 | IN | denotes | for |
T5695 | 5475-5478 | DT | denotes | the |
T5696 | 5479-5488 | NN | denotes | detection |
T5697 | 5489-5491 | IN | denotes | of |
T5698 | 5492-5498 | NN | denotes | GATA-3 |
T5699 | 5498-5499 | -COMMA- | denotes | , |
T5700 | 5500-5503 | CC | denotes | and |
T5701 | 5504-5513 | NN | denotes | rhodamine |
T5702 | 5514-5520 | NN | denotes | donkey |
T5703 | 5521-5531 | JJ | denotes | anti-mouse |
T5704 | 5532-5535 | NN | denotes | IgG |
T5705 | 5536-5537 | -LRB- | denotes | ( |
T5706 | 5537-5542 | NNP | denotes | Novus |
T5707 | 5542-5543 | -COMMA- | denotes | , |
T5708 | 5544-5553 | NNP | denotes | Littleton |
T5709 | 5553-5554 | -COMMA- | denotes | , |
T5710 | 5555-5563 | NNP | denotes | Colorado |
T5711 | 5563-5564 | -COMMA- | denotes | , |
T5712 | 5565-5568 | NNP | denotes | USA |
T5713 | 5568-5569 | -RRB- | denotes | ) |
T5714 | 5570-5573 | VB | denotes | was |
T5715 | 5574-5578 | VB | denotes | used |
T5716 | 5579-5582 | IN | denotes | for |
T5717 | 5583-5586 | DT | denotes | the |
T5718 | 5587-5596 | NN | denotes | detection |
T5719 | 5597-5599 | IN | denotes | of |
T5720 | 5600-5602 | NN | denotes | GR |
T5721 | 5604-5608 | NN | denotes | FITC |
T5722 | 5609-5612 | CC | denotes | and |
T5723 | 5613-5622 | NN | denotes | rhodamine |
T5724 | 5623-5629 | NN | denotes | levels |
T5725 | 5630-5634 | VB | denotes | were |
T5726 | 5635-5643 | VB | denotes | measured |
T5727 | 5644-5648 | IN | denotes | with |
T5728 | 5649-5650 | DT | denotes | a |
T5729 | 5651-5662 | JJ | denotes | fluorescent |
T5730 | 5663-5674 | NN | denotes | micro-plate |
T5731 | 5675-5681 | NN | denotes | reader |
T5732 | 5682-5683 | -LRB- | denotes | ( |
T5733 | 5683-5690 | NNP | denotes | Bioline |
T5734 | 5690-5691 | -COMMA- | denotes | , |
T5735 | 5692-5698 | NNP | denotes | London |
T5736 | 5698-5699 | -COMMA- | denotes | , |
T5737 | 5700-5702 | NNP | denotes | UK |
T5738 | 5702-5703 | -RRB- | denotes | ) |
T6080 | 5706-5711 | NN | denotes | NF-κB |
T6081 | 5712-5722 | NN | denotes | Activation |
T6082 | 5723-5728 | NN | denotes | NF-κB |
T6083 | 5729-5736 | NN | denotes | binding |
T6084 | 5737-5745 | NN | denotes | activity |
T6085 | 5746-5748 | IN | denotes | in |
T6086 | 5749-5756 | JJ | denotes | nuclear |
T6087 | 5757-5765 | NN | denotes | extracts |
T6088 | 5766-5769 | VB | denotes | was |
T6089 | 5770-5780 | VB | denotes | determined |
T6090 | 5781-5786 | VB | denotes | using |
T6091 | 5787-5789 | DT | denotes | an |
T6092 | 5790-5801 | JJ | denotes | ELISA-based |
T6093 | 5802-5805 | NN | denotes | kit |
T6094 | 5806-5807 | -LRB- | denotes | ( |
T6095 | 5807-5815 | NN | denotes | Trans-AM |
T6096 | 5816-5819 | NN | denotes | p65 |
T6097 | 5819-5820 | -COMMA- | denotes | , |
T6098 | 5821-5827 | NNP | denotes | Active |
T6099 | 5828-5833 | NNP | denotes | Motif |
T6100 | 5833-5834 | -COMMA- | denotes | , |
T6101 | 5835-5844 | NNP | denotes | Rixensart |
T6102 | 5844-5845 | -COMMA- | denotes | , |
T6103 | 5846-5853 | NNP | denotes | Belgium |
T6104 | 5853-5854 | -RRB- | denotes | ) |
T6105 | 5856-5858 | IN | denotes | In |
T6106 | 5859-5864 | NN | denotes | brief |
T6107 | 5864-5865 | -COMMA- | denotes | , |
T6108 | 5866-5867 | CD | denotes | 5 |
T6109 | 5868-5870 | NN | denotes | µg |
T6110 | 5871-5873 | IN | denotes | of |
T6111 | 5874-5881 | JJ | denotes | nuclear |
T6112 | 5882-5890 | NN | denotes | extracts |
T6113 | 5891-5895 | VB | denotes | were |
T6114 | 5896-5905 | VB | denotes | incubated |
T6115 | 5906-5910 | IN | denotes | with |
T6116 | 5911-5912 | DT | denotes | a |
T6117 | 5913-5918 | NN | denotes | plate |
T6118 | 5919-5925 | VB | denotes | coated |
T6119 | 5926-5930 | IN | denotes | with |
T6120 | 5931-5933 | DT | denotes | an |
T6121 | 5934-5939 | NN | denotes | NF-κB |
T6122 | 5940-5949 | NN | denotes | consensus |
T6123 | 5950-5965 | NN | denotes | oligonucleotide |
T6124 | 5967-5973 | NN | denotes | Plates |
T6125 | 5974-5978 | VB | denotes | were |
T6126 | 5979-5985 | VB | denotes | washed |
T6127 | 5986-5992 | IN | denotes | before |
T6128 | 5993-6001 | NN | denotes | addition |
T6129 | 6002-6004 | IN | denotes | of |
T6130 | 6005-6007 | DT | denotes | an |
T6131 | 6008-6016 | JJ | denotes | anti-p65 |
T6132 | 6017-6025 | NN | denotes | antibody |
T6133 | 6027-6035 | NN | denotes | Antibody |
T6134 | 6036-6043 | NN | denotes | binding |
T6135 | 6044-6047 | VB | denotes | was |
T6136 | 6048-6056 | VB | denotes | detected |
T6137 | 6057-6061 | IN | denotes | with |
T6138 | 6062-6063 | DT | denotes | a |
T6139 | 6064-6073 | JJ | denotes | secondary |
T6140 | 6074-6088 | JJ | denotes | HRP-conjugated |
T6141 | 6089-6097 | NN | denotes | antibody |
T6142 | 6098-6101 | CC | denotes | and |
T6143 | 6102-6111 | VB | denotes | developed |
T6144 | 6112-6116 | IN | denotes | with |
T6145 | 6117-6120 | NN | denotes | TMB |
T6146 | 6121-6130 | NN | denotes | substrate |
T6147 | 6132-6135 | DT | denotes | The |
T6148 | 6136-6145 | NN | denotes | intensity |
T6149 | 6146-6148 | IN | denotes | of |
T6150 | 6149-6152 | DT | denotes | the |
T6151 | 6153-6161 | NN | denotes | reaction |
T6152 | 6162-6165 | VB | denotes | was |
T6153 | 6166-6174 | VB | denotes | measured |
T6154 | 6175-6177 | IN | denotes | at |
T6155 | 6178-6181 | CD | denotes | 450 |
T6156 | 6182-6184 | NN | denotes | nm |
T6283 | 6187-6205 | NN | denotes | Immunofluorescence |
T6284 | 6206-6214 | NN | denotes | Staining |
T6285 | 6215-6233 | NN | denotes | Immunofluorescence |
T6286 | 6234-6242 | NN | denotes | staining |
T6287 | 6243-6246 | VB | denotes | was |
T6288 | 6247-6256 | VB | denotes | performed |
T6289 | 6257-6259 | IN | denotes | as |
T6290 | 6260-6270 | RB | denotes | previously |
T6291 | 6271-6280 | VB | denotes | described |
T6292 | 6281-6282 | -LRB- | denotes | [ |
T6293 | 6282-6284 | CD | denotes | 34 |
T6294 | 6284-6285 | -RRB- | denotes | ] |
T6295 | 6287-6290 | DT | denotes | All |
T6296 | 6291-6299 | NN | denotes | staining |
T6297 | 6300-6303 | VB | denotes | was |
T6298 | 6304-6313 | VB | denotes | performed |
T6299 | 6314-6316 | IN | denotes | at |
T6300 | 6317-6321 | NN | denotes | room |
T6301 | 6322-6333 | NN | denotes | temperature |
T6302 | 6334-6337 | CC | denotes | and |
T6303 | 6338-6343 | IN | denotes | under |
T6304 | 6344-6358 | NN | denotes | humidification |
T6305 | 6360-6365 | NN | denotes | Cells |
T6306 | 6366-6370 | VB | denotes | were |
T6307 | 6371-6380 | VB | denotes | collected |
T6308 | 6381-6384 | CC | denotes | and |
T6309 | 6385-6394 | NN | denotes | cytospins |
T6310 | 6395-6403 | VB | denotes | prepared |
T6311 | 6404-6406 | IN | denotes | in |
T6312 | 6407-6408 | DT | denotes | a |
T6313 | 6409-6423 | NN | denotes | cytocentrifuge |
T6314 | 6424-6425 | -LRB- | denotes | ( |
T6315 | 6425-6432 | NNP | denotes | Shandon |
T6316 | 6433-6435 | NNP | denotes | II |
T6317 | 6435-6436 | -COMMA- | denotes | , |
T6318 | 6437-6444 | NNP | denotes | Shandon |
T6319 | 6444-6445 | -COMMA- | denotes | , |
T6320 | 6446-6453 | NNP | denotes | Runcorn |
T6321 | 6453-6454 | -COMMA- | denotes | , |
T6322 | 6455-6457 | NNP | denotes | UK |
T6323 | 6457-6458 | -RRB- | denotes | ) |
T6324 | 6460-6465 | NN | denotes | Cells |
T6325 | 6466-6470 | VB | denotes | were |
T6326 | 6471-6484 | VB | denotes | permeabilized |
T6327 | 6484-6485 | -COMMA- | denotes | , |
T6328 | 6486-6493 | VB | denotes | blocked |
T6329 | 6493-6494 | -COMMA- | denotes | , |
T6330 | 6495-6498 | CC | denotes | and |
T6331 | 6499-6503 | RB | denotes | then |
T6332 | 6504-6513 | VB | denotes | incubated |
T6333 | 6514-6518 | IN | denotes | with |
T6334 | 6519-6521 | NN | denotes | GR |
T6335 | 6522-6523 | -LRB- | denotes | ( |
T6336 | 6523-6527 | CD | denotes | 1∶50 |
T6337 | 6528-6532 | NN | denotes | E-20 |
T6338 | 6533-6538 | NNP | denotes | Santa |
T6339 | 6539-6543 | NNP | denotes | Cruz |
T6340 | 6544-6557 | NNP | denotes | Biotechnology |
T6341 | 6557-6558 | -RRB- | denotes | ) |
T6342 | 6559-6561 | CC | denotes | or |
T6343 | 6562-6573 | NN | denotes | anti-GATA-3 |
T6344 | 6574-6575 | -LRB- | denotes | ( |
T6345 | 6575-6579 | NN | denotes | H-48 |
T6346 | 6579-6580 | -COLON- | denotes | ; |
T6347 | 6581-6586 | NNP | denotes | Santa |
T6348 | 6587-6591 | NNP | denotes | Cruz |
T6349 | 6592-6605 | NNP | denotes | Biotechnology |
T6350 | 6605-6606 | -RRB- | denotes | ) |
T6351 | 6607-6615 | NN | denotes | antibody |
T6352 | 6616-6619 | IN | denotes | for |
T6353 | 6620-6621 | CD | denotes | 1 |
T6354 | 6622-6623 | NN | denotes | h |
T6355 | 6624-6626 | IN | denotes | at |
T6356 | 6627-6631 | NN | denotes | room |
T6357 | 6632-6643 | NN | denotes | temperature |
T6358 | 6645-6650 | IN | denotes | After |
T6359 | 6651-6656 | CD | denotes | three |
T6360 | 6657-6663 | NN | denotes | washes |
T6361 | 6664-6666 | IN | denotes | in |
T6362 | 6667-6685 | JJ | denotes | phosphate-buffered |
T6363 | 6686-6692 | NN | denotes | saline |
T6364 | 6693-6694 | -LRB- | denotes | ( |
T6365 | 6694-6697 | NN | denotes | PBS |
T6366 | 6697-6698 | -RRB- | denotes | ) |
T6367 | 6698-6699 | -COMMA- | denotes | , |
T6368 | 6700-6705 | NN | denotes | cells |
T6369 | 6706-6710 | VB | denotes | were |
T6370 | 6711-6720 | VB | denotes | incubated |
T6371 | 6721-6725 | IN | denotes | with |
T6372 | 6726-6740 | NN | denotes | tetrarhodamine |
T6373 | 6741-6766 | VB | denotes | isothiocyanate–conjugated |
T6374 | 6767-6771 | NN | denotes | goat |
T6375 | 6772-6783 | JJ | denotes | anti-rabbit |
T6376 | 6784-6792 | NN | denotes | antibody |
T6377 | 6793-6794 | -LRB- | denotes | ( |
T6378 | 6794-6798 | NN | denotes | Dako |
T6379 | 6798-6799 | -RRB- | denotes | ) |
T6380 | 6801-6810 | NN | denotes | Cytospins |
T6381 | 6811-6815 | VB | denotes | were |
T6382 | 6816-6830 | VB | denotes | counterstained |
T6383 | 6831-6835 | IN | denotes | with |
T6384 | 6836-6838 | NN | denotes | 4′ |
T6385 | 6838-6839 | -COMMA- | denotes | , |
T6386 | 6839-6865 | NN | denotes | 6-diamidino-2-phenylindole |
T6387 | 6866-6881 | NN | denotes | dihydrochloride |
T6388 | 6882-6883 | -LRB- | denotes | ( |
T6389 | 6883-6887 | NN | denotes | DAPI |
T6390 | 6887-6888 | -RRB- | denotes | ) |
T6391 | 6888-6889 | -COMMA- | denotes | , |
T6392 | 6890-6891 | DT | denotes | a |
T6393 | 6892-6903 | JJ | denotes | fluorescent |
T6394 | 6904-6908 | JJ | denotes | blue |
T6395 | 6909-6916 | JJ | denotes | nuclear |
T6396 | 6917-6923 | NN | denotes | indole |
T6397 | 6924-6933 | NN | denotes | chromatin |
T6398 | 6934-6939 | NN | denotes | stain |
T6399 | 6939-6940 | -COMMA- | denotes | , |
T6400 | 6941-6944 | CC | denotes | and |
T6401 | 6945-6952 | VB | denotes | mounted |
T6402 | 6953-6955 | IN | denotes | in |
T6403 | 6956-6959 | NNP | denotes | PBS |
T6404 | 6959-6960 | -COLON- | denotes | : |
T6405 | 6960-6968 | NN | denotes | glycerol |
T6406 | 6969-6970 | -LRB- | denotes | ( |
T6407 | 6970-6975 | CD | denotes | 50∶50 |
T6408 | 6975-6976 | -RRB- | denotes | ) |
T6409 | 6978-6981 | DT | denotes | The |
T6410 | 6982-6996 | JJ | denotes | immunopositive |
T6411 | 6997-7003 | NN | denotes | signal |
T6412 | 7004-7007 | VB | denotes | was |
T6413 | 7008-7021 | VB | denotes | characterised |
T6414 | 7022-7027 | VB | denotes | using |
T6415 | 7028-7033 | NN | denotes | laser |
T6416 | 7034-7042 | NN | denotes | scanning |
T6417 | 7043-7051 | JJ | denotes | confocal |
T6418 | 7052-7062 | NN | denotes | microscopy |
T6419 | 7063-7065 | IN | denotes | on |
T6420 | 7066-7067 | DT | denotes | a |
T6421 | 7068-7073 | NNP | denotes | Leica |
T6422 | 7074-7077 | NNP | denotes | TCS |
T6423 | 7078-7083 | NNP | denotes | NT/SP |
T6424 | 7084-7095 | JJ | denotes | interactive |
T6425 | 7096-7101 | NN | denotes | laser |
T6426 | 7102-7111 | NN | denotes | cytometer |
T6427 | 7112-7120 | VB | denotes | equipped |
T6428 | 7121-7125 | IN | denotes | with |
T6429 | 7126-7134 | JJ | denotes | confocal |
T6430 | 7135-7141 | NN | denotes | optics |
T6431 | 7142-7143 | -LRB- | denotes | ( |
T6432 | 7143-7148 | NNP | denotes | Leica |
T6433 | 7149-7161 | NNP | denotes | Microsystems |
T6434 | 7161-7162 | -COMMA- | denotes | , |
T6435 | 7163-7170 | NNP | denotes | Wetzlar |
T6436 | 7170-7171 | -COMMA- | denotes | , |
T6437 | 7172-7179 | NNP | denotes | Germany |
T6438 | 7179-7180 | -RRB- | denotes | ) |
T6439 | 7182-7184 | TO | denotes | To |
T6440 | 7185-7194 | VB | denotes | determine |
T6441 | 7195-7198 | DT | denotes | the |
T6442 | 7199-7210 | NN | denotes | specificity |
T6443 | 7211-7213 | IN | denotes | of |
T6444 | 7214-7217 | DT | denotes | the |
T6445 | 7218-7228 | NN | denotes | antibodies |
T6446 | 7228-7229 | -COMMA- | denotes | , |
T6447 | 7230-7236 | NN | denotes | rabbit |
T6448 | 7237-7242 | NN | denotes | serum |
T6449 | 7243-7257 | NN | denotes | immunoglobulin |
T6450 | 7258-7259 | -LRB- | denotes | ( |
T6451 | 7259-7263 | NN | denotes | Dako |
T6452 | 7263-7264 | -RRB- | denotes | ) |
T6453 | 7265-7268 | CC | denotes | and |
T6454 | 7269-7278 | JJ | denotes | secondary |
T6455 | 7279-7289 | NN | denotes | antibodies |
T6456 | 7290-7297 | IN | denotes | without |
T6457 | 7298-7301 | DT | denotes | the |
T6458 | 7302-7309 | JJ | denotes | primary |
T6459 | 7310-7314 | VB | denotes | were |
T6460 | 7315-7319 | VB | denotes | used |
T6461 | 7320-7322 | IN | denotes | as |
T6462 | 7323-7331 | NN | denotes | controls |
T6463 | 7333-7343 | RB | denotes | Positively |
T6464 | 7344-7351 | VB | denotes | stained |
T6465 | 7352-7358 | NN | denotes | nuclei |
T6466 | 7359-7362 | CC | denotes | and |
T6467 | 7363-7368 | JJ | denotes | total |
T6468 | 7369-7374 | NN | denotes | cells |
T6469 | 7375-7379 | VB | denotes | were |
T6470 | 7380-7387 | VB | denotes | counted |
T6471 | 7388-7389 | -LRB- | denotes | ( |
T6472 | 7389-7392 | CD | denotes | 500 |
T6473 | 7392-7393 | -RRB- | denotes | ) |
T6474 | 7394-7396 | IN | denotes | on |
T6475 | 7397-7401 | DT | denotes | each |
T6476 | 7402-7407 | NN | denotes | slide |
T6477 | 7408-7412 | IN | denotes | with |
T6478 | 7413-7416 | DT | denotes | the |
T6479 | 7417-7425 | NN | denotes | observer |
T6480 | 7426-7433 | VB | denotes | blinded |
T6481 | 7434-7436 | TO | denotes | to |
T6482 | 7437-7440 | DT | denotes | the |
T6483 | 7441-7450 | NN | denotes | treatment |
T6779 | 7453-7463 | NN | denotes | GATA-3-GFP |
T6780 | 7464-7473 | NN | denotes | Construct |
T6781 | 7474-7477 | DT | denotes | The |
T6782 | 7478-7484 | NN | denotes | GATA-3 |
T6783 | 7485-7490 | NN | denotes | clone |
T6784 | 7491-7492 | -LRB- | denotes | ( |
T6785 | 7492-7500 | NN | denotes | BC003070 |
T6786 | 7500-7501 | -RRB- | denotes | ) |
T6787 | 7502-7510 | JJ | denotes | complete |
T6788 | 7511-7515 | NN | denotes | cDNA |
T6789 | 7516-7519 | VB | denotes | was |
T6790 | 7520-7528 | VB | denotes | obtained |
T6791 | 7529-7533 | IN | denotes | from |
T6792 | 7534-7544 | NNP | denotes | Invitrogen |
T6793 | 7545-7549 | NNP | denotes | Life |
T6794 | 7550-7562 | NNP | denotes | Technologies |
T6795 | 7563-7565 | IN | denotes | as |
T6796 | 7566-7567 | DT | denotes | a |
T6797 | 7568-7571 | JJ | denotes | 5′- |
T6798 | 7572-7585 | NN | denotes | EcoRI/3′-XhoI |
T6799 | 7586-7592 | NN | denotes | insert |
T6800 | 7593-7595 | IN | denotes | of |
T6801 | 7596-7602 | NN | denotes | GATA-3 |
T6802 | 7603-7605 | IN | denotes | in |
T6803 | 7606-7609 | DT | denotes | the |
T6804 | 7610-7615 | NN | denotes | pOTB7 |
T6805 | 7616-7622 | NN | denotes | vector |
T6806 | 7624-7630 | NN | denotes | GATA-3 |
T6807 | 7631-7634 | VB | denotes | was |
T6808 | 7635-7642 | VB | denotes | excised |
T6809 | 7643-7647 | IN | denotes | from |
T6810 | 7648-7653 | NN | denotes | pOTB7 |
T6811 | 7654-7659 | VB | denotes | using |
T6812 | 7660-7664 | NN | denotes | XhoI |
T6813 | 7665-7674 | NN | denotes | digestion |
T6814 | 7675-7678 | CC | denotes | and |
T6815 | 7679-7687 | NN | denotes | pEGFP-C2 |
T6816 | 7688-7689 | -LRB- | denotes | ( |
T6817 | 7689-7697 | NNP | denotes | Clontech |
T6818 | 7697-7698 | -COMMA- | denotes | , |
T6819 | 7699-7720 | NNP | denotes | Saint-Germain-en-Laye |
T6820 | 7720-7721 | -COMMA- | denotes | , |
T6821 | 7722-7728 | NNP | denotes | France |
T6822 | 7728-7729 | -RRB- | denotes | ) |
T6823 | 7730-7733 | VB | denotes | was |
T6824 | 7734-7742 | VB | denotes | digested |
T6825 | 7743-7747 | IN | denotes | with |
T6826 | 7748-7753 | NN | denotes | BamHI |
T6827 | 7755-7758 | NN | denotes | DNA |
T6828 | 7759-7762 | VB | denotes | was |
T6829 | 7763-7772 | VB | denotes | recovered |
T6830 | 7773-7775 | IN | denotes | by |
T6831 | 7776-7782 | NN | denotes | phenol |
T6832 | 7783-7793 | NN | denotes | extraction |
T6833 | 7794-7797 | CC | denotes | and |
T6834 | 7798-7805 | NN | denotes | ethanol |
T6835 | 7806-7819 | NN | denotes | precipitation |
T6836 | 7819-7820 | -COMMA- | denotes | , |
T6837 | 7821-7824 | CC | denotes | and |
T6838 | 7825-7829 | CC | denotes | both |
T6839 | 7830-7833 | DT | denotes | the |
T6840 | 7834-7840 | NN | denotes | GATA-3 |
T6841 | 7841-7849 | NN | denotes | fragment |
T6842 | 7850-7853 | CC | denotes | and |
T6843 | 7854-7857 | DT | denotes | the |
T6844 | 7858-7866 | NN | denotes | pEGFP-C2 |
T6845 | 7867-7873 | NN | denotes | vector |
T6846 | 7874-7885 | JJ | denotes | blunt-ended |
T6847 | 7886-7888 | IN | denotes | by |
T6848 | 7889-7899 | NN | denotes | incubation |
T6849 | 7900-7904 | IN | denotes | with |
T6850 | 7905-7911 | NNP | denotes | Klenow |
T6851 | 7912-7913 | -LRB- | denotes | ( |
T6852 | 7913-7920 | NN | denotes | Bioline |
T6853 | 7921-7930 | NN | denotes | Bio-27029 |
T6854 | 7930-7931 | -RRB- | denotes | ) |
T6855 | 7932-7935 | IN | denotes | for |
T6856 | 7936-7938 | CD | denotes | 30 |
T6857 | 7939-7942 | NN | denotes | min |
T6858 | 7943-7945 | IN | denotes | at |
T6859 | 7946-7951 | NNP | denotes | 37°C. |
T6860 | 7952-7958 | NNP | denotes | Klenow |
T6861 | 7959-7962 | VB | denotes | was |
T6862 | 7963-7974 | VB | denotes | inactivated |
T6863 | 7975-7977 | IN | denotes | by |
T6864 | 7978-7988 | NN | denotes | incubation |
T6865 | 7989-7992 | IN | denotes | for |
T6866 | 7993-7995 | CD | denotes | 10 |
T6867 | 7996-7999 | NN | denotes | min |
T6868 | 8000-8002 | IN | denotes | at |
T6869 | 8003-8008 | NNP | denotes | 75°C. |
T6870 | 8009-8012 | NN | denotes | DNA |
T6871 | 8013-8016 | VB | denotes | was |
T6872 | 8017-8026 | VB | denotes | recovered |
T6873 | 8027-8029 | IN | denotes | by |
T6874 | 8030-8036 | NN | denotes | phenol |
T6875 | 8037-8047 | NN | denotes | extraction |
T6876 | 8048-8051 | CC | denotes | and |
T6877 | 8052-8059 | NN | denotes | ethanol |
T6878 | 8060-8073 | NN | denotes | precipitation |
T6879 | 8073-8074 | -COMMA- | denotes | , |
T6880 | 8075-8078 | CC | denotes | and |
T6881 | 8079-8083 | CC | denotes | both |
T6882 | 8084-8087 | DT | denotes | the |
T6883 | 8088-8099 | JJ | denotes | blunt-ended |
T6884 | 8100-8106 | NN | denotes | GATA-3 |
T6885 | 8107-8115 | NN | denotes | fragment |
T6886 | 8116-8119 | CC | denotes | and |
T6887 | 8120-8123 | DT | denotes | the |
T6888 | 8124-8127 | NN | denotes | GFP |
T6889 | 8128-8134 | NN | denotes | vector |
T6890 | 8135-8139 | VB | denotes | were |
T6891 | 8140-8152 | RB | denotes | subsequently |
T6892 | 8153-8161 | VB | denotes | digested |
T6893 | 8162-8166 | IN | denotes | with |
T6894 | 8167-8172 | NN | denotes | EcoRI |
T6895 | 8173-8179 | IN | denotes | before |
T6896 | 8180-8183 | DT | denotes | the |
T6897 | 8184-8201 | JJ | denotes | 5′-EcoRI/3′–blunt |
T6898 | 8202-8205 | NN | denotes | end |
T6899 | 8206-8212 | NN | denotes | GATA-3 |
T6900 | 8213-8221 | NN | denotes | fragment |
T6901 | 8222-8225 | VB | denotes | was |
T6902 | 8226-8234 | VB | denotes | inserted |
T6903 | 8235-8239 | IN | denotes | into |
T6904 | 8240-8243 | DT | denotes | the |
T6905 | 8244-8261 | NN | denotes | 5′-EcoRI/3′–blunt |
T6906 | 8262-8267 | VB | denotes | ended |
T6907 | 8268-8271 | NN | denotes | GFP |
T6908 | 8272-8278 | NN | denotes | vector |
T6909 | 8280-8288 | JJ | denotes | Positive |
T6910 | 8289-8295 | NN | denotes | clones |
T6911 | 8296-8300 | VB | denotes | were |
T6912 | 8301-8310 | VB | denotes | confirmed |
T6913 | 8311-8313 | IN | denotes | by |
T6914 | 8314-8323 | NN | denotes | digestion |
T6915 | 8324-8327 | CC | denotes | and |
T6916 | 8328-8332 | NN | denotes | size |
T6917 | 8333-8341 | NN | denotes | analysis |
T6918 | 8342-8344 | IN | denotes | by |
T6919 | 8345-8346 | CD | denotes | 1 |
T6920 | 8346-8347 | NN | denotes | % |
T6921 | 8348-8355 | NN | denotes | agarose |
T6922 | 8356-8359 | NN | denotes | gel |
T6923 | 8360-8375 | NN | denotes | electrophoresis |
T6924 | 8376-8379 | CC | denotes | and |
T6925 | 8380-8382 | IN | denotes | by |
T6926 | 8383-8393 | NN | denotes | sequencing |
T7172 | 8396-8408 | NN | denotes | Transfection |
T7173 | 8409-8415 | NN | denotes | HuT-78 |
T7174 | 8416-8421 | NN | denotes | cells |
T7175 | 8422-8426 | VB | denotes | were |
T7176 | 8427-8438 | VB | denotes | transfected |
T7177 | 8439-8443 | IN | denotes | with |
T7178 | 8444-8450 | CC | denotes | either |
T7179 | 8451-8454 | NN | denotes | EP8 |
T7180 | 8455-8457 | CC | denotes | or |
T7181 | 8458-8461 | NN | denotes | GFP |
T7182 | 8462-8468 | NN | denotes | vector |
T7183 | 8469-8473 | RB | denotes | only |
T7184 | 8474-8477 | NN | denotes | DNA |
T7185 | 8478-8483 | VB | denotes | using |
T7186 | 8484-8492 | NN | denotes | solution |
T7187 | 8493-8494 | NNP | denotes | R |
T7188 | 8494-8495 | -COMMA- | denotes | , |
T7189 | 8496-8505 | NN | denotes | programme |
T7190 | 8506-8511 | NN | denotes | V-001 |
T7191 | 8512-8514 | IN | denotes | at |
T7192 | 8515-8516 | DT | denotes | a |
T7193 | 8517-8522 | NN | denotes | ratio |
T7194 | 8523-8525 | IN | denotes | of |
T7195 | 8526-8531 | CD | denotes | 3×106 |
T7196 | 8532-8539 | NN | denotes | cells/4 |
T7197 | 8540-8542 | VB | denotes | µg |
T7198 | 8543-8546 | NN | denotes | DNA |
T7199 | 8547-8550 | IN | denotes | for |
T7200 | 8551-8554 | CD | denotes | 7–8 |
T7201 | 8555-8556 | NN | denotes | h |
T7202 | 8557-8559 | IN | denotes | in |
T7203 | 8560-8568 | JJ | denotes | complete |
T7204 | 8569-8575 | NN | denotes | medium |
T7205 | 8576-8577 | -LRB- | denotes | ( |
T7206 | 8577-8579 | CD | denotes | 10 |
T7207 | 8579-8580 | NN | denotes | % |
T7208 | 8581-8587 | JJ | denotes | bovine |
T7209 | 8588-8593 | NN | denotes | serum |
T7210 | 8594-8596 | IN | denotes | in |
T7211 | 8597-8608 | NN | denotes | RPMI1640+15 |
T7212 | 8609-8620 | NN | denotes | L-glutamine |
T7213 | 8620-8621 | -RRB- | denotes | ) |
T7214 | 8622-8631 | VB | denotes | according |
T7215 | 8632-8634 | TO | denotes | to |
T7216 | 8635-8638 | DT | denotes | the |
T7217 | 8639-8646 | JJ | denotes | general |
T7218 | 8647-8652 | NNP | denotes | Amaxa |
T7219 | 8653-8661 | NN | denotes | protocol |
T7220 | 8662-8665 | IN | denotes | for |
T7221 | 8666-8679 | NN | denotes | nucleofection |
T7222 | 8681-8684 | DT | denotes | The |
T7223 | 8685-8691 | NN | denotes | medium |
T7224 | 8692-8695 | VB | denotes | was |
T7225 | 8696-8708 | RB | denotes | subsequently |
T7226 | 8709-8716 | VB | denotes | changed |
T7227 | 8717-8719 | TO | denotes | to |
T7228 | 8720-8721 | CD | denotes | 1 |
T7229 | 8721-8722 | NN | denotes | % |
T7230 | 8723-8727 | NN | denotes | RPMI |
T7231 | 8728-8731 | IN | denotes | for |
T7232 | 8732-8734 | CD | denotes | 24 |
T7233 | 8735-8736 | NN | denotes | h |
T7234 | 8737-8743 | IN | denotes | before |
T7235 | 8744-8755 | VB | denotes | transfected |
T7236 | 8756-8761 | NN | denotes | cells |
T7237 | 8762-8766 | VB | denotes | were |
T7238 | 8767-8772 | VB | denotes | added |
T7239 | 8773-8775 | TO | denotes | to |
T7240 | 8776-8789 | JJ | denotes | anti-CD3/CD28 |
T7241 | 8790-8797 | VB | denotes | treated |
T7242 | 8798-8803 | NN | denotes | wells |
T7243 | 8804-8807 | CC | denotes | and |
T7244 | 8808-8812 | JJ | denotes | live |
T7245 | 8813-8817 | NN | denotes | cell |
T7246 | 8818-8833 | NN | denotes | videomicroscopy |
T7247 | 8834-8843 | VB | denotes | performed |
T7357 | 8846-8856 | NNP | denotes | Time-Lapse |
T7358 | 8857-8867 | NNP | denotes | Microscopy |
T7359 | 8868-8874 | NN | denotes | HuT-78 |
T7360 | 8875-8880 | NN | denotes | cells |
T7361 | 8881-8891 | VB | denotes | expressing |
T7362 | 8892-8902 | NN | denotes | GATA-3-GFP |
T7363 | 8903-8907 | VB | denotes | were |
T7364 | 8908-8918 | VB | denotes | maintained |
T7365 | 8919-8921 | IN | denotes | at |
T7366 | 8922-8926 | NN | denotes | 37°C |
T7367 | 8927-8929 | IN | denotes | in |
T7368 | 8930-8936 | NN | denotes | growth |
T7369 | 8937-8943 | NN | denotes | medium |
T7370 | 8944-8946 | IN | denotes | in |
T7371 | 8947-8948 | DT | denotes | a |
T7372 | 8949-8955 | JJ | denotes | closed |
T7373 | 8956-8960 | NN | denotes | FCS2 |
T7374 | 8961-8970 | NN | denotes | perfusion |
T7375 | 8971-8978 | NN | denotes | chamber |
T7376 | 8979-8980 | -LRB- | denotes | ( |
T7377 | 8980-8989 | NNP | denotes | Bioptechs |
T7378 | 8989-8990 | -COMMA- | denotes | , |
T7379 | 8991-8997 | NNP | denotes | Butler |
T7380 | 8997-8998 | -COMMA- | denotes | , |
T7381 | 8999-9011 | NNP | denotes | Pennsylvania |
T7382 | 9011-9012 | -COMMA- | denotes | , |
T7383 | 9013-9016 | NNP | denotes | USA |
T7384 | 9016-9017 | -RRB- | denotes | ) |
T7385 | 9018-9026 | VB | denotes | combined |
T7386 | 9027-9031 | IN | denotes | with |
T7387 | 9032-9034 | DT | denotes | an |
T7388 | 9035-9044 | JJ | denotes | objective |
T7389 | 9045-9051 | NN | denotes | heater |
T7390 | 9052-9053 | -LRB- | denotes | ( |
T7391 | 9053-9062 | NN | denotes | Bioptechs |
T7392 | 9062-9063 | -RRB- | denotes | ) |
T7393 | 9064-9066 | IN | denotes | on |
T7394 | 9067-9070 | DT | denotes | the |
T7395 | 9071-9076 | NN | denotes | stage |
T7396 | 9077-9078 | DT | denotes | a |
T7397 | 9079-9084 | NNP | denotes | Zeiss |
T7398 | 9085-9093 | NNP | denotes | Axiovert |
T7399 | 9094-9097 | CD | denotes | 200 |
T7400 | 9098-9108 | NN | denotes | microscope |
T7401 | 9109-9110 | -LRB- | denotes | ( |
T7402 | 9110-9119 | NNP | denotes | Thornwood |
T7403 | 9119-9120 | -COMMA- | denotes | , |
T7404 | 9121-9124 | NNP | denotes | New |
T7405 | 9125-9129 | NNP | denotes | York |
T7406 | 9129-9130 | -COMMA- | denotes | , |
T7407 | 9131-9134 | NNP | denotes | USA |
T7408 | 9134-9135 | -RRB- | denotes | ) |
T7409 | 9137-9149 | NN | denotes | Observations |
T7410 | 9150-9154 | VB | denotes | were |
T7411 | 9155-9159 | VB | denotes | made |
T7412 | 9160-9162 | IN | denotes | by |
T7413 | 9163-9169 | CD | denotes | 40×1.0 |
T7414 | 9170-9172 | NN | denotes | NA |
T7415 | 9173-9186 | NN | denotes | oil-immersion |
T7416 | 9187-9196 | JJ | denotes | objective |
T7417 | 9197-9201 | NN | denotes | lens |
T7418 | 9201-9202 | -COMMA- | denotes | , |
T7419 | 9203-9206 | CC | denotes | and |
T7420 | 9207-9219 | NN | denotes | fluorescence |
T7421 | 9220-9223 | CC | denotes | and |
T7422 | 9224-9229 | NN | denotes | phase |
T7423 | 9230-9238 | NN | denotes | contrast |
T7424 | 9239-9245 | NN | denotes | images |
T7425 | 9246-9250 | VB | denotes | were |
T7426 | 9251-9259 | VB | denotes | gathered |
T7427 | 9260-9265 | VB | denotes | using |
T7428 | 9266-9267 | DT | denotes | a |
T7429 | 9268-9277 | NNP | denotes | Hamamatsu |
T7430 | 9278-9285 | NNP | denotes | ORCA-ER |
T7431 | 9286-9293 | VB | denotes | charged |
T7432 | 9294-9301 | VB | denotes | coupled |
T7433 | 9302-9308 | NN | denotes | device |
T7434 | 9309-9315 | NN | denotes | camera |
T7435 | 9316-9317 | -LRB- | denotes | ( |
T7436 | 9317-9328 | NNP | denotes | Bridgewater |
T7437 | 9328-9329 | -COMMA- | denotes | , |
T7438 | 9330-9333 | NNP | denotes | New |
T7439 | 9334-9340 | NNP | denotes | Jersey |
T7440 | 9340-9341 | -COMMA- | denotes | , |
T7441 | 9342-9345 | NNP | denotes | USA |
T7442 | 9345-9346 | -RRB- | denotes | ) |
T7443 | 9347-9353 | VB | denotes | driven |
T7444 | 9354-9356 | IN | denotes | by |
T7445 | 9357-9364 | NN | denotes | Openlab |
T7446 | 9365-9373 | NN | denotes | software |
T7447 | 9374-9375 | -LRB- | denotes | ( |
T7448 | 9375-9386 | NNP | denotes | Improvision |
T7449 | 9386-9387 | -COMMA- | denotes | , |
T7450 | 9388-9396 | NNP | denotes | Coventry |
T7451 | 9396-9397 | -COMMA- | denotes | , |
T7452 | 9398-9400 | NNP | denotes | UK |
T7453 | 9400-9401 | -RRB- | denotes | ) |
T7454 | 9403-9414 | NN | denotes | Photographs |
T7455 | 9415-9419 | VB | denotes | were |
T7456 | 9420-9425 | VB | denotes | taken |
T7457 | 9426-9428 | IN | denotes | at |
T7458 | 9429-9430 | CD | denotes | 0 |
T7459 | 9430-9431 | -COMMA- | denotes | , |
T7460 | 9432-9434 | CD | denotes | 30 |
T7461 | 9434-9435 | -COMMA- | denotes | , |
T7462 | 9436-9438 | CD | denotes | 60 |
T7463 | 9438-9439 | -COMMA- | denotes | , |
T7464 | 9440-9443 | CD | denotes | 120 |
T7465 | 9443-9444 | -COMMA- | denotes | , |
T7466 | 9445-9448 | CC | denotes | and |
T7467 | 9449-9452 | CD | denotes | 240 |
T7468 | 9453-9456 | NN | denotes | min |
T7611 | 9459-9472 | JJ | denotes | Densitometric |
T7612 | 9473-9481 | NN | denotes | Analysis |
T7613 | 9482-9494 | NN | denotes | Densitometry |
T7614 | 9495-9497 | IN | denotes | of |
T7615 | 9498-9501 | NN | denotes | ECL |
T7616 | 9502-9513 | NN | denotes | immunoblots |
T7617 | 9514-9517 | VB | denotes | was |
T7618 | 9518-9527 | VB | denotes | performed |
T7619 | 9528-9533 | VB | denotes | using |
T7620 | 9534-9542 | NNP | denotes | Gelworks |
T7621 | 9543-9545 | NNP | denotes | ID |
T7622 | 9546-9558 | JJ | denotes | intermediate |
T7623 | 9559-9567 | NN | denotes | software |
T7624 | 9568-9569 | -LRB- | denotes | ( |
T7625 | 9569-9580 | NNP | denotes | Ultraviolet |
T7626 | 9581-9589 | NNP | denotes | Products |
T7627 | 9589-9590 | -COMMA- | denotes | , |
T7628 | 9591-9605 | NNP | denotes | Cambridgeshire |
T7629 | 9605-9606 | -COMMA- | denotes | , |
T7630 | 9607-9609 | NNP | denotes | UK |
T7631 | 9609-9610 | -RRB- | denotes | ) |
T7632 | 9612-9619 | RB | denotes | Briefly |
T7633 | 9619-9620 | -COMMA- | denotes | , |
T7634 | 9621-9632 | NN | denotes | immunoblots |
T7635 | 9633-9637 | VB | denotes | were |
T7636 | 9638-9645 | VB | denotes | scanned |
T7637 | 9646-9649 | CC | denotes | and |
T7638 | 9650-9655 | NN | denotes | gates |
T7639 | 9656-9660 | VB | denotes | were |
T7640 | 9661-9666 | VB | denotes | drawn |
T7641 | 9667-9674 | RB | denotes | tightly |
T7642 | 9675-9681 | IN | denotes | around |
T7643 | 9682-9686 | DT | denotes | each |
T7644 | 9687-9691 | NN | denotes | band |
T7645 | 9693-9703 | NN | denotes | Background |
T7646 | 9704-9710 | NN | denotes | values |
T7647 | 9711-9715 | IN | denotes | from |
T7648 | 9716-9720 | DT | denotes | each |
T7649 | 9721-9725 | NN | denotes | lane |
T7650 | 9726-9730 | VB | denotes | were |
T7651 | 9731-9741 | VB | denotes | subtracted |
T7652 | 9742-9744 | TO | denotes | to |
T7653 | 9745-9754 | VB | denotes | normalize |
T7654 | 9755-9759 | DT | denotes | each |
T7655 | 9760-9771 | NN | denotes | measurement |
T7656 | 9773-9776 | DT | denotes | The |
T7657 | 9777-9782 | NN | denotes | bands |
T7658 | 9783-9787 | VB | denotes | were |
T7659 | 9788-9798 | VB | denotes | quantified |
T7660 | 9799-9804 | VB | denotes | using |
T7661 | 9805-9808 | DT | denotes | the |
T7662 | 9809-9817 | NNP | denotes | Gelworks |
T7663 | 9818-9826 | NN | denotes | software |
T7664 | 9828-9831 | DT | denotes | All |
T7665 | 9832-9839 | JJ | denotes | Western |
T7666 | 9840-9845 | NN | denotes | blots |
T7667 | 9846-9850 | VB | denotes | were |
T7668 | 9851-9858 | VB | denotes | exposed |
T7669 | 9859-9861 | TO | denotes | to |
T7670 | 9862-9866 | VB | denotes | film |
T7671 | 9867-9870 | IN | denotes | for |
T7672 | 9871-9878 | VB | denotes | varying |
T7673 | 9879-9886 | NN | denotes | lengths |
T7674 | 9887-9889 | IN | denotes | of |
T7675 | 9890-9894 | NN | denotes | time |
T7676 | 9894-9895 | -COMMA- | denotes | , |
T7677 | 9896-9899 | CC | denotes | and |
T7678 | 9900-9904 | RB | denotes | only |
T7679 | 9905-9910 | NN | denotes | films |
T7680 | 9911-9921 | VB | denotes | generating |
T7681 | 9922-9935 | JJ | denotes | subsaturating |
T7682 | 9936-9942 | NN | denotes | levels |
T7683 | 9943-9945 | IN | denotes | of |
T7684 | 9946-9955 | NN | denotes | intensity |
T7685 | 9956-9960 | VB | denotes | were |
T7686 | 9961-9969 | VB | denotes | selected |
T7687 | 9970-9973 | IN | denotes | for |
T7688 | 9974-9987 | JJ | denotes | densitometric |
T7689 | 9988-9998 | NN | denotes | evaluation |
T7787 | 10001-10012 | JJ | denotes | Statistical |
T7788 | 10013-10021 | NN | denotes | Analysis |
T7789 | 10022-10026 | NN | denotes | Data |
T7790 | 10027-10031 | IN | denotes | from |
T7791 | 10032-10037 | CD | denotes | three |
T7792 | 10038-10040 | CC | denotes | or |
T7793 | 10041-10045 | JJ | denotes | more |
T7794 | 10046-10057 | JJ | denotes | independent |
T7795 | 10058-10069 | NN | denotes | experiments |
T7796 | 10070-10073 | VB | denotes | are |
T7797 | 10074-10083 | VB | denotes | presented |
T7798 | 10084-10086 | IN | denotes | as |
T7799 | 10087-10090 | DT | denotes | the |
T7800 | 10091-10104 | NN | denotes | mean±standard |
T7801 | 10105-10110 | NN | denotes | error |
T7802 | 10111-10113 | IN | denotes | of |
T7803 | 10114-10117 | DT | denotes | the |
T7804 | 10118-10122 | JJ | denotes | mean |
T7805 | 10123-10124 | -LRB- | denotes | ( |
T7806 | 10124-10127 | NN | denotes | SEM |
T7807 | 10127-10128 | -RRB- | denotes | ) |
T7808 | 10128-10129 | -COMMA- | denotes | , |
T7809 | 10130-10136 | IN | denotes | except |
T7810 | 10137-10142 | WRB | denotes | where |
T7811 | 10143-10149 | VB | denotes | stated |
T7812 | 10150-10153 | CC | denotes | and |
T7813 | 10154-10158 | VB | denotes | were |
T7814 | 10159-10167 | VB | denotes | compared |
T7815 | 10168-10173 | VB | denotes | using |
T7816 | 10174-10182 | NNP | denotes | GraphPad |
T7817 | 10183-10188 | NNP | denotes | Prism |
T7818 | 10189-10190 | CD | denotes | 4 |
T7819 | 10191-10192 | -LRB- | denotes | ( |
T7820 | 10192-10200 | NNP | denotes | GraphPad |
T7821 | 10201-10209 | NNP | denotes | Software |
T7822 | 10209-10210 | -COMMA- | denotes | , |
T7823 | 10211-10215 | NN | denotes | http |
T7824 | 10215-10216 | -COLON- | denotes | : |
T7825 | 10216-10234 | LS | denotes | //www.graphpad.com |
T7826 | 10234-10235 | -RRB- | denotes | ) |
T7827 | 10237-10244 | NN | denotes | Results |
T7828 | 10245-10249 | VB | denotes | were |
T7829 | 10250-10258 | VB | denotes | analysed |
T7830 | 10259-10264 | VB | denotes | using |
T7831 | 10265-10272 | JJ | denotes | one-way |
T7832 | 10273-10278 | NN | denotes | ANOVA |
T7833 | 10279-10283 | IN | denotes | with |
T7834 | 10284-10296 | NN | denotes | Newman-Keuls |
T7835 | 10297-10301 | NN | denotes | post |
T7836 | 10302-10306 | NN | denotes | test |
T7837 | 10307-10313 | IN | denotes | except |
T7838 | 10314-10317 | IN | denotes | for |
T7839 | 10318-10321 | DT | denotes | the |
T7840 | 10322-10326 | NN | denotes | data |
T7841 | 10327-10331 | IN | denotes | from |
T7842 | 10332-10335 | DT | denotes | the |
T7843 | 10336-10338 | FW | denotes | in |
T7844 | 10339-10343 | FW | denotes | vivo |
T7845 | 10344-10351 | VB | denotes | inhaled |
T7846 | 10352-10354 | NN | denotes | FP |
T7847 | 10355-10360 | NN | denotes | study |
T7848 | 10360-10361 | -COMMA- | denotes | , |
T7849 | 10362-10367 | WDT | denotes | which |
T7850 | 10368-10371 | VB | denotes | was |
T7851 | 10372-10380 | VB | denotes | analysed |
T7852 | 10381-10383 | IN | denotes | by |
T7853 | 10384-10392 | NNP | denotes | Friedman |
T7854 | 10392-10394 | POS | denotes | 's |
T7855 | 10395-10399 | NN | denotes | test |
T7856 | 10400-10404 | IN | denotes | with |
T7857 | 10405-10415 | JJ | denotes | subsequent |
T7858 | 10416-10425 | NNP | denotes | Wilcoxson |
T7859 | 10426-10433 | VB | denotes | matched |
T7860 | 10434-10438 | NN | denotes | pair |
T7861 | 10439-10445 | VB | denotes | signed |
T7862 | 10446-10450 | NN | denotes | rank |
T7863 | 10451-10454 | NN | denotes | sum |
T7864 | 10455-10459 | NN | denotes | test |
T7865 | 10461-10465 | NN | denotes | Data |
T7866 | 10466-10470 | IN | denotes | from |
T7867 | 10471-10475 | DT | denotes | this |
T7868 | 10476-10484 | NN | denotes | analysis |
T7869 | 10485-10488 | VB | denotes | are |
T7870 | 10489-10498 | VB | denotes | presented |
T7871 | 10499-10501 | IN | denotes | as |
T7872 | 10502-10503 | DT | denotes | a |
T7873 | 10504-10520 | NN | denotes | box-and-whiskers |
T7874 | 10521-10525 | NN | denotes | plot |
T7875 | 10527-10535 | NNP | denotes | Friedman |
T7876 | 10535-10537 | POS | denotes | 's |
T7877 | 10538-10542 | NN | denotes | test |
T7878 | 10543-10546 | VB | denotes | was |
T7879 | 10547-10551 | VB | denotes | used |
T7880 | 10552-10554 | IN | denotes | as |
T7881 | 10555-10560 | CD | denotes | three |
T7882 | 10561-10568 | JJ | denotes | matched |
T7883 | 10569-10577 | NN | denotes | measures |
T7884 | 10578-10582 | VB | denotes | were |
T7885 | 10583-10591 | VB | denotes | obtained |
T7886 | 10592-10597 | VB | denotes | using |
T7887 | 10598-10605 | NN | denotes | placebo |
T7888 | 10605-10606 | -COMMA- | denotes | , |
T7889 | 10607-10610 | CD | denotes | 100 |
T7890 | 10611-10613 | NN | denotes | µg |
T7891 | 10613-10614 | -COMMA- | denotes | , |
T7892 | 10615-10618 | CC | denotes | and |
T7893 | 10619-10622 | CD | denotes | 500 |
T7894 | 10623-10625 | NN | denotes | µg |
T7895 | 10626-10628 | IN | denotes | of |
T7896 | 10629-10636 | VB | denotes | inhaled |
T7897 | 10637-10639 | NN | denotes | FP |
T7898 | 10639-10640 | -COMMA- | denotes | , |
T7899 | 10641-10646 | WDT | denotes | which |
T7900 | 10647-10650 | VB | denotes | had |
T7901 | 10651-10659 | JJ | denotes | variable |
T7902 | 10660-10668 | NN | denotes | baseline |
T7903 | 10669-10675 | NN | denotes | levels |
T7904 | 10677-10679 | PRP | denotes | We |
T7905 | 10680-10683 | VB | denotes | did |
T7906 | 10684-10687 | RB | denotes | not |
T7907 | 10688-10694 | VB | denotes | assume |
T7908 | 10695-10696 | DT | denotes | a |
T7909 | 10697-10705 | JJ | denotes | Gaussian |
T7910 | 10706-10718 | NN | denotes | distribution |
T7911 | 10719-10721 | IN | denotes | of |
T7912 | 10722-10725 | DT | denotes | the |
T7913 | 10726-10730 | NN | denotes | data |
T7914 | 10731-10734 | JJ | denotes | due |
T7915 | 10735-10737 | TO | denotes | to |
T7916 | 10738-10741 | DT | denotes | the |
T7917 | 10742-10749 | JJ | denotes | limited |
T7918 | 10750-10757 | NN | denotes | numbers |
T7919 | 10758-10760 | IN | denotes | of |
T7920 | 10761-10773 | NN | denotes | participants |
T7921 | 10774-10782 | VB | denotes | analysed |
T7922 | 10783-10784 | -LRB- | denotes | ( |
T7923 | 10784-10789 | CD | denotes | seven |
T7924 | 10789-10790 | -RRB- | denotes | ) |
T7925 | 10790-10794 | NN | denotes | .The |
T7926 | 10795-10799 | JJ | denotes | null |
T7927 | 10800-10810 | NN | denotes | hypothesis |
T7928 | 10811-10814 | VB | denotes | was |
T7929 | 10815-10823 | VB | denotes | rejected |
T7930 | 10824-10826 | IN | denotes | at |
T7931 | 10827-10828 | NN | denotes | p |
T7932 | 10828-10829 | SYM | denotes | < |
T7933 | 10829-10833 | CD | denotes | 0.05 |
T5299 | 4293-4295 | CD | denotes | 35 |
T5300 | 4296-4302 | NN | denotes | cycles |
R3148 | T3675 | T3676 | arg1Of | Participants,and |
R3149 | T3678 | T3676 | arg2Of | Design,and |
R3150 | T3678 | T3677 | arg1Of | Design,Study |
R3151 | T3679 | T3680 | arg1Of | We,studied |
R3152 | T3680 | T3701 | arg1Of | studied,"," |
R3153 | T3680 | T3708 | arg1Of | studied,[ |
R3154 | T3681 | T3680 | arg2Of | patients,studied |
R3155 | T3681 | T3682 | arg1Of | patients,with |
R3156 | T3681 | T3685 | arg1Of | patients,who |
R3157 | T3681 | T3686 | arg1Of | patients,were |
R3158 | T3681 | T3688 | arg2Of | patients,treated |
R3159 | T3684 | T3682 | arg2Of | asthma,with |
R3160 | T3684 | T3683 | arg1Of | asthma,mild |
R3161 | T3688 | T3686 | arg2Of | treated,were |
R3162 | T3688 | T3687 | arg1Of | treated,not |
R3163 | T3688 | T3689 | arg1Of | treated,with |
R3164 | T3691 | T3689 | arg2Of | corticosteroids,with |
R3165 | T3691 | T3690 | arg2Of | corticosteroids,inhaled |
R3166 | T3691 | T3692 | arg1Of | corticosteroids,who |
R3167 | T3691 | T3693 | arg1Of | corticosteroids,had |
R3168 | T3691 | T3694 | arg1Of | corticosteroids,been |
R3169 | T3691 | T3695 | arg2Of | corticosteroids,included |
R3170 | T3695 | T3693 | arg2Of | included,had |
R3171 | T3695 | T3694 | arg2Of | included,been |
R3172 | T3695 | T3696 | arg1Of | included,in |
R3173 | T3699 | T3698 | arg1Of | reported,previously |
R3174 | T3700 | T3696 | arg2Of | double-blind,in |
R3175 | T3700 | T3697 | arg1Of | double-blind,a |
R3176 | T3700 | T3699 | arg1Of | double-blind,reported |
R3177 | T3702 | T3703 | arg1Of | placebo-controlled,"," |
R3178 | T3704 | T3703 | arg2Of | crossover,"," |
R3179 | T3705 | T3680 | arg3Of | study,studied |
R3180 | T3705 | T3702 | arg1Of | study,placebo-controlled |
R3181 | T3705 | T3704 | arg1Of | study,crossover |
R3182 | T3705 | T3706 | arg1Of | study,with |
R3183 | T3707 | T3706 | arg2Of | FP,with |
R3184 | T3709 | T3708 | arg2Of | 34,[ |
R3185 | T3710 | T3708 | arg3Of | ],[ |
R3186 | T3712 | T3711 | arg1Of | patients,Seven |
R3187 | T3712 | T3713 | arg1Of | patients,with |
R3188 | T3712 | T3716 | arg1Of | patients,entered |
R3189 | T3712 | T3720 | arg1Of | patients,were |
R3190 | T3712 | T3721 | arg2Of | patients,randomized |
R3191 | T3712 | T3723 | arg1Of | patients,receive |
R3192 | T3715 | T3713 | arg2Of | asthma,with |
R3193 | T3715 | T3714 | arg1Of | asthma,mild |
R3194 | T3716 | T3719 | arg1Of | entered,and |
R3195 | T3718 | T3716 | arg2Of | study,entered |
R3196 | T3718 | T3717 | arg1Of | study,the |
R3197 | T3719 | T3745 | arg1Of | and,and |
R3198 | T3721 | T3719 | arg2Of | randomized,and |
R3199 | T3721 | T3720 | arg2Of | randomized,were |
R3200 | T3723 | T3721 | arg3Of | receive,randomized |
R3201 | T3723 | T3722 | arg1Of | receive,to |
R3202 | T3723 | T3740 | arg1Of | receive,via |
R3203 | T3726 | T3724 | arg1Of | inhalation,a |
R3204 | T3726 | T3725 | arg1Of | inhalation,single |
R3205 | T3726 | T3727 | arg1Of | inhalation,of |
R3206 | T3726 | T3735 | arg1Of | inhalation,or |
R3207 | T3728 | T3727 | arg2Of | FP,of |
R3208 | T3728 | T3729 | arg1Of | FP,( |
R3209 | T3730 | T3731 | arg1Of | 100,and |
R3210 | T3732 | T3731 | arg2Of | 500,and |
R3211 | T3733 | T3729 | arg2Of | µg,( |
R3212 | T3733 | T3730 | arg1Of | µg,100 |
R3213 | T3733 | T3732 | arg1Of | µg,500 |
R3214 | T3734 | T3729 | arg3Of | ),( |
R3215 | T3735 | T3723 | arg2Of | or,receive |
R3216 | T3739 | T3735 | arg2Of | control,or |
R3217 | T3739 | T3736 | arg1Of | control,a |
R3218 | T3739 | T3737 | arg1Of | control,matched |
R3219 | T3739 | T3738 | arg1Of | control,placebo |
R3220 | T3743 | T3740 | arg2Of | chamber,via |
R3221 | T3743 | T3741 | arg1Of | chamber,a |
R3222 | T3743 | T3742 | arg1Of | chamber,spacer |
R3223 | T3745 | T3744 | arg1Of | and,"," |
R3224 | T3748 | T3746 | arg1Of | treatment,the |
R3225 | T3748 | T3747 | arg1Of | treatment,other |
R3226 | T3748 | T3749 | arg1Of | treatment,was |
R3227 | T3748 | T3750 | arg2Of | treatment,given |
R3228 | T3750 | T3745 | arg2Of | given,and |
R3229 | T3750 | T3749 | arg2Of | given,was |
R3230 | T3750 | T3751 | arg1Of | given,after |
R3231 | T3754 | T3751 | arg2Of | period,after |
R3232 | T3754 | T3752 | arg1Of | period,a |
R3233 | T3754 | T3753 | arg1Of | period,wash-out |
R3234 | T3754 | T3755 | arg1Of | period,of |
R3235 | T3758 | T3756 | arg1Of | 6,at |
R3236 | T3758 | T3757 | arg1Of | 6,least |
R3237 | T3759 | T3755 | arg2Of | d,of |
R3238 | T3759 | T3758 | arg1Of | d,6 |
R3239 | T3760 | T3761 | arg1Of | Blood,was |
R3240 | T3760 | T3762 | arg2Of | Blood,taken |
R3241 | T3762 | T3761 | arg2Of | taken,was |
R3242 | T3762 | T3763 | arg1Of | taken,for |
R3243 | T3764 | T3763 | arg2Of | preparation,for |
R3244 | T3764 | T3765 | arg1Of | preparation,of |
R3245 | T3764 | T3767 | arg1Of | preparation,at |
R3246 | T3766 | T3765 | arg2Of | PBMCs,of |
R3247 | T3768 | T3769 | arg1Of | 1,and |
R3248 | T3770 | T3769 | arg2Of | 2,and |
R3249 | T3771 | T3767 | arg2Of | h,at |
R3250 | T3771 | T3768 | arg1Of | h,1 |
R3251 | T3771 | T3770 | arg1Of | h,2 |
R3252 | T3771 | T3772 | arg1Of | h,after |
R3253 | T3774 | T3772 | arg2Of | administration,after |
R3254 | T3774 | T3773 | arg1Of | administration,drug |
R3255 | T3776 | T3775 | arg1Of | patients,All |
R3256 | T3776 | T3777 | arg1Of | patients,gave |
R3257 | T3776 | T3801 | arg1Of | patients,was |
R3258 | T3776 | T3802 | arg2Of | patients,conducted |
R3259 | T3777 | T3780 | arg1Of | gave,and |
R3260 | T3779 | T3777 | arg2Of | consent,gave |
R3261 | T3779 | T3778 | arg2Of | consent,informed |
R3262 | T3782 | T3781 | arg1Of | study,the |
R3263 | T3782 | T3783 | arg1Of | study,was |
R3264 | T3782 | T3784 | arg2Of | study,approved |
R3265 | T3784 | T3783 | arg2Of | approved,was |
R3266 | T3788 | T3786 | arg1Of | Committee,the |
R3267 | T3788 | T3787 | arg1Of | Committee,Ethics |
R3268 | T3788 | T3789 | arg1Of | Committee,of |
R3269 | T3788 | T3793 | arg1Of | Committee,and |
R3270 | T3792 | T3789 | arg2Of | Brompton,of |
R3271 | T3792 | T3790 | arg1Of | Brompton,the |
R3272 | T3792 | T3791 | arg1Of | Brompton,Royal |
R3273 | T3793 | T3784 | arg1Of | and,approved |
R3274 | T3793 | T3785 | arg2Of | and,by |
R3275 | T3797 | T3794 | arg1Of | Trust.,Harefield |
R3276 | T3797 | T3795 | arg1Of | Trust.,Hospitals |
R3277 | T3797 | T3796 | arg1Of | Trust.,NHS |
R3278 | T3800 | T3793 | arg2Of | study,and |
R3279 | T3800 | T3797 | arg1Of | study,Trust. |
R3280 | T3800 | T3798 | arg1Of | study,The |
R3281 | T3800 | T3799 | arg1Of | study,clinical |
R3282 | T3802 | T3780 | arg2Of | conducted,and |
R3283 | T3802 | T3783 | modOf | conducted,was |
R3284 | T3802 | T3801 | arg2Of | conducted,was |
R3285 | T3802 | T3803 | arg1Of | conducted,before |
R3286 | T3805 | T3803 | arg2Of | requirement,before |
R3287 | T3805 | T3804 | arg1Of | requirement,the |
R3288 | T3805 | T3806 | arg1Of | requirement,for |
R3289 | T3809 | T3806 | arg2Of | Registration,for |
R3290 | T3809 | T3807 | arg1Of | Registration,Clinical |
R3291 | T3809 | T3808 | arg1Of | Registration,Trial |
R3431 | T3981 | T3982 | arg1Of | Antibodies,and |
R3432 | T3983 | T3982 | arg2Of | Reagents,and |
R3433 | T3986 | T3984 | arg1Of | antibodies,The |
R3434 | T3986 | T3985 | arg1Of | antibodies,monoclonal |
R3435 | T3986 | T3987 | arg1Of | antibodies,against |
R3436 | T3986 | T3997 | arg1Of | antibodies,were |
R3437 | T3986 | T3998 | arg2Of | antibodies,purchased |
R3438 | T3989 | T3988 | arg1Of | CD3,human |
R3439 | T3989 | T3990 | arg1Of | CD3,"," |
R3440 | T3990 | T3992 | arg1Of | ",","," |
R3441 | T3991 | T3990 | arg2Of | CD28,"," |
R3442 | T3992 | T3995 | arg1Of | ",",and |
R3443 | T3993 | T3992 | arg2Of | GR,"," |
R3444 | T3995 | T3987 | arg2Of | and,against |
R3445 | T3995 | T3994 | arg1Of | and,"," |
R3446 | T3996 | T3995 | arg2Of | importin-α,and |
R3447 | T3998 | T3997 | arg2Of | purchased,were |
R3448 | T3998 | T3999 | arg1Of | purchased,from |
R3449 | T4001 | T3999 | arg2Of | Biosciences,from |
R3450 | T4001 | T4000 | arg1Of | Biosciences,BD |
R3451 | T4001 | T4002 | arg1Of | Biosciences,( |
R3452 | T4003 | T4002 | arg2Of | Oxford,( |
R3453 | T4003 | T4004 | arg1Of | Oxford,"," |
R3454 | T4006 | T4004 | arg2Of | Kingdom,"," |
R3455 | T4006 | T4005 | arg1Of | Kingdom,United |
R3456 | T4007 | T4002 | arg3Of | ),( |
R3457 | T4009 | T4008 | arg1Of | antibodies,Rabbit |
R3458 | T4009 | T4010 | arg1Of | antibodies,against |
R3459 | T4009 | T4023 | arg1Of | antibodies,were |
R3460 | T4009 | T4024 | arg2Of | antibodies,obtained |
R3461 | T4012 | T4011 | arg1Of | GATA-3,human |
R3462 | T4012 | T4013 | arg1Of | GATA-3,( |
R3463 | T4012 | T4016 | arg1Of | GATA-3,and |
R3464 | T4014 | T4013 | arg2Of | H-48,( |
R3465 | T4015 | T4013 | arg3Of | ),( |
R3466 | T4016 | T4010 | arg2Of | and,against |
R3467 | T4017 | T4016 | arg2Of | GR,and |
R3468 | T4017 | T4018 | arg1Of | GR,( |
R3469 | T4019 | T4018 | arg2Of | E-20,( |
R3470 | T4019 | T4020 | arg1Of | E-20,"," |
R3471 | T4021 | T4020 | arg2Of | sc-1003,"," |
R3472 | T4022 | T4018 | arg3Of | ),( |
R3473 | T4024 | T4023 | arg2Of | obtained,were |
R3474 | T4024 | T4025 | arg1Of | obtained,from |
R3475 | T4028 | T4026 | arg1Of | Biotechnology,Santa |
R3476 | T4028 | T4027 | arg1Of | Biotechnology,Cruz |
R3477 | T4028 | T4029 | arg1Of | Biotechnology,( |
R3478 | T4028 | T4038 | arg1Of | Biotechnology,"," |
R3479 | T4031 | T4030 | arg1Of | Cruz,Santa |
R3480 | T4031 | T4032 | arg1Of | Cruz,"," |
R3481 | T4032 | T4034 | arg1Of | ",","," |
R3482 | T4033 | T4032 | arg2Of | California,"," |
R3483 | T4034 | T4029 | arg2Of | ",",( |
R3484 | T4036 | T4034 | arg2Of | States,"," |
R3485 | T4036 | T4035 | arg1Of | States,United |
R3486 | T4037 | T4029 | arg3Of | ),( |
R3487 | T4038 | T4046 | arg1Of | ",",and |
R3488 | T4041 | T4038 | arg2Of | antibodies,"," |
R3489 | T4041 | T4039 | arg1Of | antibodies,polyclonal |
R3490 | T4041 | T4040 | arg1Of | antibodies,rabbit |
R3491 | T4041 | T4042 | arg1Of | antibodies,against |
R3492 | T4045 | T4042 | arg2Of | kinase,against |
R3493 | T4045 | T4043 | arg1Of | kinase,phospho-p38 |
R3494 | T4045 | T4044 | arg1Of | kinase,MAP |
R3495 | T4046 | T4080 | arg1Of | and,and |
R3496 | T4047 | T4046 | arg2Of | phospho-ATF-2,and |
R3497 | T4047 | T4048 | arg1Of | phospho-ATF-2,from |
R3498 | T4051 | T4049 | arg1Of | Technology,Cell |
R3499 | T4051 | T4050 | arg1Of | Technology,Signaling |
R3500 | T4051 | T4052 | arg1Of | Technology,( |
R3501 | T4051 | T4061 | arg1Of | Technology,"," |
R3502 | T4055 | T4052 | arg2Of | Biolabs,( |
R3503 | T4055 | T4053 | arg1Of | Biolabs,New |
R3504 | T4055 | T4054 | arg1Of | Biolabs,England |
R3505 | T4055 | T4056 | arg1Of | Biolabs,"," |
R3506 | T4057 | T4056 | arg2Of | Hertford,"," |
R3507 | T4057 | T4058 | arg1Of | Hertford,"," |
R3508 | T4057 | T4059 | arg1Of | Hertford,UK |
R3509 | T4060 | T4052 | arg3Of | ),( |
R3510 | T4061 | T4048 | arg2Of | ",",from |
R3511 | T4061 | T4070 | arg1Of | ",",from |
R3512 | T4063 | T4061 | arg2Of | antibody,"," |
R3513 | T4063 | T4062 | arg1Of | antibody,monoclonal |
R3514 | T4063 | T4064 | arg1Of | antibody,against |
R3515 | T4065 | T4064 | arg2Of | phosphoserine,against |
R3516 | T4065 | T4066 | arg1Of | phosphoserine,( |
R3517 | T4068 | T4066 | arg2Of | 4H4,( |
R3518 | T4068 | T4067 | arg1Of | 4H4,clone |
R3519 | T4069 | T4066 | arg3Of | ),( |
R3520 | T4073 | T4070 | arg2Of | Products,from |
R3521 | T4073 | T4071 | arg1Of | Products,Affiniti |
R3522 | T4073 | T4072 | arg1Of | Products,Research |
R3523 | T4073 | T4074 | arg1Of | Products,( |
R3524 | T4075 | T4074 | arg2Of | Exeter,( |
R3525 | T4075 | T4076 | arg1Of | Exeter,"," |
R3526 | T4075 | T4077 | arg1Of | Exeter,UK |
R3527 | T4078 | T4074 | arg3Of | ),( |
R3528 | T4080 | T4025 | arg2Of | and,from |
R3529 | T4080 | T4079 | arg1Of | and,"," |
R3530 | T4081 | T4080 | arg2Of | antibodies,and |
R3531 | T4081 | T4082 | arg1Of | antibodies,against |
R3532 | T4085 | T4082 | arg2Of | TRITC,against |
R3533 | T4085 | T4083 | arg1Of | TRITC,rabbit |
R3534 | T4085 | T4084 | arg1Of | TRITC,IgG-conjugated |
R3535 | T4085 | T4086 | arg1Of | TRITC,from |
R3536 | T4085 | T4089 | arg1Of | TRITC,( |
R3537 | T4088 | T4086 | arg2Of | Cytomation,from |
R3538 | T4088 | T4087 | arg1Of | Cytomation,Dako |
R3539 | T4090 | T4089 | arg2Of | Cambridge,( |
R3540 | T4090 | T4091 | arg1Of | Cambridge,"," |
R3541 | T4090 | T4092 | arg1Of | Cambridge,UK |
R3542 | T4093 | T4089 | arg3Of | ),( |
R3543 | T4096 | T4094 | arg1Of | antibody,The |
R3544 | T4096 | T4095 | arg1Of | antibody,anti-GR |
R3545 | T4096 | T4097 | arg1Of | antibody,( |
R3546 | T4096 | T4101 | arg1Of | antibody,from |
R3547 | T4096 | T4110 | arg1Of | antibody,was |
R3548 | T4096 | T4111 | arg2Of | antibody,used |
R3549 | T4098 | T4097 | arg2Of | Clone,( |
R3550 | T4098 | T4099 | arg1Of | Clone,41 |
R3551 | T4100 | T4097 | arg3Of | ),( |
R3552 | T4104 | T4101 | arg2Of | Laboratories,from |
R3553 | T4104 | T4102 | arg1Of | Laboratories,BD |
R3554 | T4104 | T4103 | arg1Of | Laboratories,Transduction |
R3555 | T4104 | T4105 | arg1Of | Laboratories,( |
R3556 | T4106 | T4105 | arg2Of | Oxford,( |
R3557 | T4106 | T4107 | arg1Of | Oxford,"," |
R3558 | T4106 | T4108 | arg1Of | Oxford,UK |
R3559 | T4109 | T4105 | arg3Of | ),( |
R3560 | T4111 | T4110 | arg2Of | used,was |
R3561 | T4111 | T4112 | arg1Of | used,for |
R3562 | T4115 | T4112 | arg2Of | analysis,for |
R3563 | T4115 | T4113 | arg1Of | analysis,Western |
R3564 | T4115 | T4114 | arg1Of | analysis,blot |
R3565 | T4118 | T4116 | arg1Of | reagents,All |
R3566 | T4118 | T4117 | arg1Of | reagents,other |
R3567 | T4118 | T4119 | arg1Of | reagents,were |
R3568 | T4118 | T4120 | arg2Of | reagents,purchased |
R3569 | T4120 | T4119 | arg2Of | purchased,were |
R3570 | T4120 | T4121 | arg1Of | purchased,from |
R3571 | T4122 | T4121 | arg2Of | Sigma,from |
R3572 | T4122 | T4123 | arg1Of | Sigma,( |
R3573 | T4124 | T4123 | arg2Of | Poole,( |
R3574 | T4124 | T4125 | arg1Of | Poole,"," |
R3575 | T4126 | T4125 | arg2Of | UK,"," |
R3576 | T4127 | T4123 | arg3Of | ),( |
R3731 | T4355 | T4354 | arg1Of | Culture,Cell |
R3732 | T4355 | T4356 | arg1Of | Culture,and |
R3733 | T4358 | T4356 | arg2Of | Isolation,and |
R3734 | T4358 | T4357 | arg1Of | Isolation,PBMC |
R3735 | T4363 | T4359 | arg1Of | line,A |
R3736 | T4363 | T4360 | arg1Of | line,human |
R3737 | T4363 | T4361 | arg1Of | line,T |
R3738 | T4363 | T4362 | arg1Of | line,cell |
R3739 | T4363 | T4364 | arg1Of | line,( |
R3740 | T4363 | T4367 | arg1Of | line,was |
R3741 | T4363 | T4368 | arg2Of | line,purchased |
R3742 | T4365 | T4364 | arg2Of | HuT-78,( |
R3743 | T4366 | T4364 | arg3Of | ),( |
R3744 | T4368 | T4367 | arg2Of | purchased,was |
R3745 | T4368 | T4369 | arg1Of | purchased,from |
R3746 | T4372 | T4370 | arg1Of | Collection,ECACC |
R3747 | T4372 | T4371 | arg1Of | Collection,European |
R3748 | T4372 | T4373 | arg1Of | Collection,of |
R3749 | T4372 | T4376 | arg1Of | Collection,( |
R3750 | T4372 | T4381 | arg1Of | Collection,were |
R3751 | T4372 | T4382 | arg2Of | Collection,cultured |
R3752 | T4375 | T4373 | arg2Of | Culture,of |
R3753 | T4375 | T4374 | arg1Of | Culture,Cell |
R3754 | T4377 | T4376 | arg2Of | Wiltshire,( |
R3755 | T4377 | T4378 | arg1Of | Wiltshire,"," |
R3756 | T4377 | T4379 | arg1Of | Wiltshire,UK |
R3757 | T4380 | T4376 | arg3Of | ),( |
R3758 | T4382 | T4367 | modOf | cultured,was |
R3759 | T4382 | T4381 | arg2Of | cultured,were |
R3760 | T4382 | T4383 | arg1Of | cultured,as |
R3761 | T4385 | T4384 | arg1Of | described,previously |
R3762 | T4387 | T4383 | arg2Of | 12,as |
R3763 | T4387 | T4385 | arg1Of | 12,described |
R3764 | T4387 | T4386 | arg2Of | 12,[ |
R3765 | T4388 | T4386 | arg3Of | ],[ |
R3766 | T4389 | T4390 | arg1Of | PBMCs,were |
R3767 | T4389 | T4391 | arg2Of | PBMCs,isolated |
R3768 | T4391 | T4390 | arg2Of | isolated,were |
R3769 | T4391 | T4392 | arg1Of | isolated,by |
R3770 | T4391 | T4395 | arg1Of | isolated,over |
R3771 | T4394 | T4392 | arg2Of | centrifugation,by |
R3772 | T4394 | T4393 | arg1Of | centrifugation,density |
R3773 | T4396 | T4395 | arg2Of | Ficoll-Hypaque,over |
R3774 | T4396 | T4397 | arg1Of | Ficoll-Hypaque,( |
R3775 | T4396 | T4410 | arg1Of | Ficoll-Hypaque,as |
R3776 | T4398 | T4399 | arg1Of | density,"," |
R3777 | T4398 | T4402 | arg1Of | density,; |
R3778 | T4401 | T4399 | arg2Of | g/ml,"," |
R3779 | T4401 | T4400 | arg1Of | g/ml,1.077 |
R3780 | T4402 | T4397 | arg2Of | ;,( |
R3781 | T4402 | T4407 | arg1Of | ;,"," |
R3782 | T4402 | T4408 | arg1Of | ;,UK |
R3783 | T4404 | T4402 | arg2Of | Biosciences,; |
R3784 | T4404 | T4403 | arg1Of | Biosciences,Amersham |
R3785 | T4404 | T4405 | arg1Of | Biosciences,"," |
R3786 | T4406 | T4405 | arg2Of | Amersham,"," |
R3787 | T4409 | T4397 | arg3Of | ),( |
R3788 | T4412 | T4411 | arg1Of | described,previously |
R3789 | T4414 | T4410 | arg2Of | 34,as |
R3790 | T4414 | T4412 | arg1Of | 34,described |
R3791 | T4414 | T4413 | arg2Of | 34,[ |
R3792 | T4415 | T4413 | arg3Of | ],[ |
R3793 | T4416 | T4417 | arg1Of | Cells,were |
R3794 | T4416 | T4418 | arg2Of | Cells,stimulated |
R3795 | T4418 | T4417 | arg2Of | stimulated,were |
R3796 | T4418 | T4419 | arg1Of | stimulated,with |
R3797 | T4418 | T4426 | arg1Of | stimulated,for |
R3798 | T4420 | T4419 | arg2Of | anti-CD3/CD28,with |
R3799 | T4420 | T4421 | arg1Of | anti-CD3/CD28,( |
R3800 | T4423 | T4421 | arg2Of | µg/ml,( |
R3801 | T4423 | T4422 | arg1Of | µg/ml,1 |
R3802 | T4423 | T4424 | arg1Of | µg/ml,each |
R3803 | T4425 | T4421 | arg3Of | ),( |
R3804 | T4428 | T4426 | arg2Of | h,for |
R3805 | T4428 | T4427 | arg1Of | h,1 |
R3806 | T4428 | T4429 | arg1Of | h,at |
R3807 | T4428 | T4431 | modOf | h,to |
R3808 | T4428 | T4443 | arg1Of | h,( |
R3809 | T4430 | T4429 | arg2Of | 37°C,at |
R3810 | T4432 | T4431 | arg1Of | stimulate,to |
R3811 | T4435 | T4432 | arg2Of | release,stimulate |
R3812 | T4435 | T4433 | arg1Of | release,Th2 |
R3813 | T4435 | T4434 | arg1Of | release,cytokine |
R3814 | T4435 | T4436 | arg1Of | release,in |
R3815 | T4435 | T4441 | arg1Of | release,of |
R3816 | T4438 | T4439 | arg1Of | presence,or |
R3817 | T4439 | T4436 | arg2Of | or,in |
R3818 | T4439 | T4437 | arg1Of | or,the |
R3819 | T4440 | T4439 | arg2Of | absence,or |
R3820 | T4442 | T4441 | arg2Of | FP,of |
R3821 | T4444 | T4443 | arg2Of | 10−12,( |
R3822 | T4444 | T4445 | arg1Of | 10−12,to |
R3823 | T4446 | T4445 | arg2Of | 10−8M,to |
R3824 | T4447 | T4443 | arg3Of | ),( |
R3825 | T4448 | T4449 | arg1Of | Cytospins,were |
R3826 | T4448 | T4450 | arg2Of | Cytospins,prepared |
R3827 | T4450 | T4449 | arg2Of | prepared,were |
R3828 | T4450 | T4451 | arg1Of | prepared,and |
R3829 | T4453 | T4452 | arg1Of | localization,GATA-3 |
R3830 | T4453 | T4454 | arg1Of | localization,determined |
R3831 | T4454 | T4451 | arg2Of | determined,and |
R3832 | T4457 | T4454 | arg2Of | microscopy,determined |
R3833 | T4457 | T4455 | arg2Of | microscopy,by |
R3834 | T4457 | T4456 | arg1Of | microscopy,confocal |
R3835 | T4457 | T4458 | arg1Of | microscopy,as |
R3836 | T4460 | T4459 | arg1Of | described,previously |
R3837 | T4462 | T4458 | arg2Of | 12,as |
R3838 | T4462 | T4460 | arg1Of | 12,described |
R3839 | T4462 | T4461 | arg2Of | 12,[ |
R3840 | T4463 | T4461 | arg3Of | ],[ |
R3969 | T4624 | T4622 | arg1Of | PCR,Reverse |
R3970 | T4624 | T4623 | arg1Of | PCR,Transcription |
R3971 | T4626 | T4625 | arg1Of | RNA,Total |
R3972 | T4626 | T4627 | arg1Of | RNA,was |
R3973 | T4626 | T4628 | arg2Of | RNA,extracted |
R3975 | T4628 | T4627 | arg2Of | extracted,was |
R3979 | T4634 | T4632 | arg2Of | kit,( |
R3980 | T4634 | T4633 | arg1Of | kit,RNeasy |
R3981 | T4634 | T4635 | arg1Of | kit,; |
R3982 | T4636 | T4635 | arg2Of | Qiagen,; |
R3983 | T4636 | T4637 | arg1Of | Qiagen,"," |
R3984 | T4638 | T4637 | arg2Of | Crawley,"," |
R3985 | T4638 | T4639 | arg1Of | Crawley,"," |
R3986 | T4640 | T4639 | arg2Of | UK,"," |
R3987 | T4641 | T4632 | arg3Of | ),( |
R3988 | T4644 | T4642 | arg2Of | purification,During |
R3989 | T4644 | T4643 | arg1Of | purification,RNA |
R3990 | T4647 | T4646 | arg1Of | DNA,genomic |
R3991 | T4647 | T4648 | arg1Of | DNA,was |
R3992 | T4647 | T4649 | arg2Of | DNA,digested |
R3993 | T4649 | T4642 | arg1Of | digested,During |
R3994 | T4649 | T4645 | arg1Of | digested,"," |
R3995 | T4649 | T4648 | arg2Of | digested,was |
R3996 | T4649 | T4650 | arg1Of | digested,with |
R3997 | T4652 | T4650 | arg2Of | DNase,with |
R3998 | T4652 | T4651 | arg1Of | DNase,RNase-free |
R3999 | T4652 | T4653 | arg1Of | DNase,( |
R4000 | T4655 | T4653 | arg2Of | Biosciences,( |
R4001 | T4655 | T4654 | arg1Of | Biosciences,Amersham |
R4002 | T4656 | T4653 | arg3Of | ),( |
R4003 | T4660 | T4659 | arg1Of | µg,0.5 |
R4004 | T4660 | T4661 | arg1Of | µg,of |
R4005 | T4660 | T4664 | arg1Of | µg,was |
R4006 | T4660 | T4665 | arg2Of | µg,reversed |
R4007 | T4663 | T4661 | arg2Of | RNA,of |
R4008 | T4663 | T4662 | arg1Of | RNA,total |
R4009 | T4665 | T4657 | arg1Of | reversed,Next |
R4010 | T4665 | T4658 | arg1Of | reversed,"," |
R4011 | T4665 | T4664 | arg2Of | reversed,was |
R4012 | T4665 | T4666 | modOf | reversed,transcribed |
R4013 | T4665 | T4667 | modOf | reversed,using |
R4014 | T4665 | T4673 | arg1Of | reversed,( |
R4015 | T4672 | T4667 | arg2Of | RT,using |
R4016 | T4672 | T4668 | arg1Of | RT,the |
R4017 | T4672 | T4669 | arg1Of | RT,avian |
R4018 | T4672 | T4670 | arg1Of | RT,myeloblastosis |
R4019 | T4672 | T4671 | arg1Of | RT,virus |
R4020 | T4674 | T4675 | arg1Of | Promega,"," |
R4021 | T4675 | T4673 | arg2Of | ",",( |
R4022 | T4675 | T4677 | arg1Of | ",","," |
R4023 | T4676 | T4675 | arg2Of | Southampton,"," |
R4024 | T4678 | T4677 | arg2Of | UK,"," |
R4025 | T4679 | T4673 | arg3Of | ),( |
R4026 | T4682 | T4680 | arg2Of | quantification,For |
R4027 | T4682 | T4681 | arg1Of | quantification,relative |
R4028 | T4684 | T4685 | arg1Of | RT-PCR,was |
R4029 | T4684 | T4686 | arg2Of | RT-PCR,carried |
R4030 | T4686 | T4680 | arg1Of | carried,For |
R4031 | T4686 | T4683 | arg1Of | carried,"," |
R4032 | T4686 | T4685 | arg2Of | carried,was |
R4033 | T4686 | T4687 | arg1Of | carried,out |
R4034 | T4686 | T4688 | modOf | carried,using |
R4035 | T4690 | T4688 | arg2Of | probes,using |
R4036 | T4690 | T4689 | arg1Of | probes,cDNA |
R4037 | T4691 | T4692 | arg1Of | Primers,for |
R4038 | T4691 | T4694 | arg1Of | Primers,were |
R4039 | T4691 | T4695 | arg1Of | Primers,from |
R4040 | T4693 | T4692 | arg2Of | IL-4,for |
R4041 | T4694 | T4697 | arg1Of | were,( |
R4042 | T4695 | T4694 | arg2Of | from,were |
R4043 | T4696 | T4695 | arg2Of | Sigma-Genosys,from |
R4044 | T4698 | T4697 | arg2Of | Cambridge,( |
R4045 | T4698 | T4699 | arg1Of | Cambridge,"," |
R4046 | T4698 | T4700 | arg1Of | Cambridge,UK |
R4047 | T4701 | T4697 | arg3Of | ),( |
R4048 | T4702 | T4703 | arg1Of | Sequences,of |
R4049 | T4702 | T4706 | arg1Of | Sequences,are |
R4050 | T4702 | T4708 | arg1Of | Sequences,follows |
R4051 | T4704 | T4703 | arg2Of | GADPH,of |
R4052 | T4704 | T4705 | arg2Of | GADPH,used |
R4053 | T4706 | T4707 | arg1Of | are,as |
R4054 | T4708 | T4707 | arg2Of | follows,as |
R4055 | T4708 | T4709 | arg1Of | follows,: |
R4056 | T4711 | T4708 | arg2Of | 5′-CCACCCATGGCAAATTCCATGGC,follows |
R4057 | T4711 | T4710 | arg1Of | 5′-CCACCCATGGCAAATTCCATGGC,forward |
R4058 | T4711 | T4712 | arg1Of | 5′-CCACCCATGGCAAATTCCATGGC,"," |
R4059 | T4714 | T4712 | arg2Of | 3′-TCTAGACGGCAGGTCAGGTCCAC,"," |
R4060 | T4714 | T4713 | arg1Of | 3′-TCTAGACGGCAGGTCAGGTCCAC,reverse |
R4166 | T4854 | T4853 | arg1Of | Fractionation,Cell |
R4167 | T4854 | T4855 | arg1Of | Fractionation,"," |
R4168 | T4855 | T4858 | arg1Of | ",",and |
R4169 | T4856 | T4855 | arg2Of | Immunoprecipitation,"," |
R4170 | T4858 | T4857 | arg1Of | and,"," |
R4171 | T4860 | T4859 | arg1Of | Blot,Western |
R4172 | T4861 | T4858 | arg2Of | Analysis,and |
R4173 | T4861 | T4860 | arg1Of | Analysis,Blot |
R4174 | T4862 | T4863 | arg1Of | Nuclear,and |
R4175 | T4864 | T4863 | arg2Of | cytoplasmic,and |
R4176 | T4865 | T4862 | arg1Of | fractions,Nuclear |
R4177 | T4865 | T4864 | arg1Of | fractions,cytoplasmic |
R4178 | T4865 | T4866 | arg1Of | fractions,were |
R4179 | T4865 | T4867 | arg2Of | fractions,prepared |
R4180 | T4867 | T4866 | arg2Of | prepared,were |
R4181 | T4867 | T4868 | arg1Of | prepared,as |
R4182 | T4870 | T4869 | arg1Of | described,previously |
R4183 | T4872 | T4868 | arg2Of | 35,as |
R4184 | T4872 | T4870 | arg1Of | 35,described |
R4185 | T4872 | T4871 | arg2Of | 35,[ |
R4186 | T4873 | T4871 | arg3Of | ],[ |
R4187 | T4876 | T4874 | arg1Of | lysates,Whole |
R4188 | T4876 | T4875 | arg1Of | lysates,cell |
R4189 | T4876 | T4877 | arg1Of | lysates,were |
R4190 | T4876 | T4878 | arg2Of | lysates,prepared |
R4191 | T4878 | T4877 | arg2Of | prepared,were |
R4192 | T4878 | T4879 | arg1Of | prepared,in |
R4193 | T4882 | T4879 | arg2Of | buffer,in |
R4194 | T4882 | T4880 | arg1Of | buffer,NP-40 |
R4195 | T4882 | T4881 | arg1Of | buffer,lysis |
R4196 | T4882 | T4883 | arg1Of | buffer,( |
R4197 | T4882 | T4901 | arg1Of | buffer,in |
R4198 | T4884 | T4885 | arg1Of | 0.5,% |
R4199 | T4887 | T4884 | arg1Of | P-40,0.5 |
R4200 | T4887 | T4886 | arg1Of | P-40,Nonidet |
R4201 | T4887 | T4888 | arg1Of | P-40,"," |
R4202 | T4888 | T4896 | arg1Of | ",","," |
R4203 | T4889 | T4890 | arg1Of | 20,mM |
R4204 | T4891 | T4888 | arg2Of | Tris-HCl,"," |
R4205 | T4891 | T4889 | arg1Of | Tris-HCl,20 |
R4206 | T4891 | T4892 | arg1Of | Tris-HCl,[ |
R4207 | T4893 | T4892 | arg2Of | pH,[ |
R4208 | T4893 | T4894 | arg1Of | pH,7.5 |
R4209 | T4895 | T4892 | arg3Of | ],[ |
R4210 | T4896 | T4883 | arg2Of | ",",( |
R4211 | T4897 | T4898 | arg1Of | 150,mM |
R4212 | T4899 | T4896 | arg2Of | NaCl,"," |
R4213 | T4899 | T4897 | arg1Of | NaCl,150 |
R4214 | T4900 | T4883 | arg3Of | ),( |
R4215 | T4903 | T4901 | arg2Of | presence,in |
R4216 | T4903 | T4902 | arg1Of | presence,the |
R4217 | T4903 | T4904 | arg1Of | presence,of |
R4218 | T4908 | T4904 | arg2Of | inhibitor,of |
R4219 | T4908 | T4905 | arg1Of | inhibitor,complete |
R4220 | T4908 | T4906 | arg1Of | inhibitor,protease |
R4221 | T4908 | T4907 | arg1Of | inhibitor,cocktail |
R4222 | T4909 | T4910 | arg1Of | Lysates,were |
R4223 | T4909 | T4911 | arg2Of | Lysates,centrifuged |
R4224 | T4909 | T4925 | arg1Of | Lysates,remove |
R4225 | T4911 | T4910 | arg2Of | centrifuged,were |
R4226 | T4911 | T4912 | arg1Of | centrifuged,at |
R4227 | T4911 | T4914 | arg1Of | centrifuged,for |
R4228 | T4911 | T4917 | arg1Of | centrifuged,at |
R4229 | T4911 | T4920 | arg1Of | centrifuged,in |
R4230 | T4911 | T4924 | modOf | centrifuged,to |
R4231 | T4913 | T4912 | arg2Of | 4°C,at |
R4232 | T4916 | T4914 | arg2Of | min,for |
R4233 | T4916 | T4915 | arg1Of | min,10 |
R4234 | T4919 | T4917 | arg2Of | rpm,at |
R4235 | T4919 | T4918 | arg1Of | rpm,"12,000" |
R4236 | T4923 | T4920 | arg2Of | microcentrifuge,in |
R4237 | T4923 | T4921 | arg1Of | microcentrifuge,an |
R4238 | T4923 | T4922 | arg1Of | microcentrifuge,Eppendorf |
R4239 | T4925 | T4924 | arg1Of | remove,to |
R4240 | T4927 | T4925 | arg2Of | debris,remove |
R4241 | T4927 | T4926 | arg1Of | debris,cellular |
R4242 | T4928 | T4929 | arg1Of | Samples,were |
R4243 | T4928 | T4931 | arg2Of | Samples,immunoprecipitated |
R4244 | T4931 | T4929 | arg2Of | immunoprecipitated,were |
R4245 | T4931 | T4930 | arg1Of | immunoprecipitated,then |
R4246 | T4931 | T4932 | arg1Of | immunoprecipitated,with |
R4247 | T4935 | T4932 | arg2Of | µl,with |
R4248 | T4935 | T4933 | arg1Of | µl,either |
R4249 | T4935 | T4934 | arg1Of | µl,10 |
R4250 | T4935 | T4936 | arg1Of | µl,of |
R4251 | T4935 | T4942 | arg1Of | µl,using |
R4252 | T4935 | T4952 | arg1Of | µl,using |
R4253 | T4935 | T4958 | arg1Of | µl,( |
R4254 | T4937 | T4936 | arg2Of | antibody,of |
R4255 | T4937 | T4938 | arg1Of | antibody,against |
R4256 | T4939 | T4940 | arg1Of | GATA-3,or |
R4257 | T4940 | T4938 | arg2Of | or,against |
R4258 | T4941 | T4940 | arg2Of | importin-α,or |
R4259 | T4942 | T4946 | arg1Of | using,in |
R4260 | T4942 | T4952 | modOf | using,using |
R4261 | T4945 | T4942 | arg2Of | slurry,using |
R4262 | T4945 | T4943 | arg1Of | slurry,A/G |
R4263 | T4945 | T4944 | arg2Of | slurry,agarose |
R4264 | T4948 | T4946 | arg2Of | presence,in |
R4265 | T4948 | T4947 | arg1Of | presence,the |
R4266 | T4948 | T4949 | arg1Of | presence,of |
R4267 | T4951 | T4949 | arg2Of | inhibitor,of |
R4268 | T4951 | T4950 | arg1Of | inhibitor,protease |
R4269 | T4954 | T4955 | arg1Of | Catch,and |
R4270 | T4956 | T4955 | arg2Of | Release,and |
R4271 | T4957 | T4952 | arg2Of | methodology,using |
R4272 | T4957 | T4953 | arg1Of | methodology,the |
R4273 | T4957 | T4954 | arg1Of | methodology,Catch |
R4274 | T4957 | T4956 | arg1Of | methodology,Release |
R4275 | T4960 | T4959 | arg1Of | Biotechnology,Upstate |
R4276 | T4960 | T4961 | arg1Of | Biotechnology,"," |
R4277 | T4961 | T4964 | arg1Of | ",","," |
R4278 | T4963 | T4961 | arg2Of | Placid,"," |
R4279 | T4963 | T4962 | arg1Of | Placid,Lake |
R4280 | T4964 | T4958 | arg2Of | ",",( |
R4281 | T4964 | T4967 | arg1Of | ",","," |
R4282 | T4964 | T4968 | arg1Of | ",",USA |
R4283 | T4966 | T4964 | arg2Of | York,"," |
R4284 | T4966 | T4965 | arg1Of | York,New |
R4285 | T4969 | T4958 | arg3Of | ),( |
R4286 | T4972 | T4970 | arg1Of | analysis,Western |
R4287 | T4972 | T4971 | arg1Of | analysis,blot |
R4288 | T4972 | T4973 | arg1Of | analysis,was |
R4289 | T4972 | T4974 | arg2Of | analysis,performed |
R4290 | T4974 | T4973 | arg2Of | performed,was |
R4291 | T4975 | T4974 | arg3Of | using,performed |
R4292 | T4976 | T4975 | arg2Of | anti-GATA-3,using |
R4293 | T4976 | T4977 | arg1Of | anti-GATA-3,"," |
R4294 | T4978 | T4979 | arg1Of | anti-importin-α,"," |
R4295 | T4979 | T4981 | arg1Of | ",","," |
R4296 | T4980 | T4979 | arg2Of | anti-GR,"," |
R4297 | T4982 | T4981 | arg2Of | anti-p-p38,"," |
R4298 | T4984 | T4978 | arg1Of | kinase,anti-importin-α |
R4299 | T4984 | T4980 | arg1Of | kinase,anti-GR |
R4300 | T4984 | T4982 | arg1Of | kinase,anti-p-p38 |
R4301 | T4984 | T4983 | arg1Of | kinase,MAP |
R4302 | T4984 | T4985 | arg1Of | kinase,"," |
R4303 | T4985 | T4988 | arg1Of | ",",and |
R4304 | T4986 | T4985 | arg2Of | anti-p-ATF-2,"," |
R4305 | T4988 | T4977 | arg2Of | and,"," |
R4306 | T4988 | T4987 | arg1Of | and,"," |
R4307 | T4989 | T4988 | arg2Of | anti-p-serine,and |
R4308 | T4991 | T4990 | arg1Of | proteins,Immunoreactive |
R4309 | T4991 | T4992 | arg1Of | proteins,were |
R4310 | T4991 | T4993 | arg2Of | proteins,detected |
R4311 | T4993 | T4992 | arg2Of | detected,were |
R4312 | T4994 | T4993 | arg3Of | using,detected |
R4313 | T4999 | T4994 | arg2Of | kit,using |
R4314 | T4999 | T4995 | arg1Of | kit,an |
R4315 | T4999 | T4996 | arg2Of | kit,enhanced |
R4316 | T4999 | T4997 | arg1Of | kit,chemiluminescence |
R4317 | T4999 | T4998 | arg1Of | kit,ECL |
R4318 | T4999 | T5000 | arg1Of | kit,( |
R4319 | T5002 | T5000 | arg2Of | Biosciences,( |
R4320 | T5002 | T5001 | arg1Of | Biosciences,Amersham |
R4321 | T5003 | T5000 | arg3Of | ),( |
R4483 | T5207 | T5206 | arg1Of | Immunoprecipitation,Chromatin |
R4484 | T5209 | T5208 | arg1Of | immunoprecipitation,Chromatin |
R4485 | T5209 | T5210 | arg1Of | immunoprecipitation,( |
R4486 | T5209 | T5213 | arg1Of | immunoprecipitation,was |
R4487 | T5209 | T5214 | arg2Of | immunoprecipitation,performed |
R4488 | T5211 | T5210 | arg2Of | IP,( |
R4489 | T5212 | T5210 | arg3Of | ),( |
R4490 | T5214 | T5213 | arg2Of | performed,was |
R4491 | T5214 | T5215 | arg1Of | performed,as |
R4492 | T5214 | T5239 | arg1Of | performed,as |
R4493 | T5214 | T5248 | arg1Of | performed,overnight |
R4494 | T5217 | T5216 | arg1Of | described,previously |
R4495 | T5219 | T5215 | arg2Of | 12,as |
R4496 | T5219 | T5217 | arg1Of | 12,described |
R4497 | T5219 | T5218 | arg2Of | 12,[ |
R4498 | T5219 | T5221 | arg1Of | 12,in |
R4499 | T5219 | T5224 | arg1Of | 12,with |
R4500 | T5220 | T5218 | arg3Of | ],[ |
R4501 | T5223 | T5221 | arg2Of | T-cells,in |
R4502 | T5223 | T5222 | arg1Of | T-cells,HuT-78 |
R4503 | T5226 | T5224 | arg2Of | µg,with |
R4504 | T5226 | T5225 | arg1Of | µg,2 |
R4505 | T5226 | T5227 | arg1Of | µg,of |
R4506 | T5228 | T5229 | arg1Of | anti-GATA-3,( |
R4507 | T5228 | T5235 | arg1Of | anti-GATA-3,or |
R4508 | T5232 | T5229 | arg2Of | Biotechnology,( |
R4509 | T5232 | T5230 | arg1Of | Biotechnology,Santa |
R4510 | T5232 | T5231 | arg1Of | Biotechnology,Cruz |
R4511 | T5233 | T5229 | arg3Of | ),( |
R4512 | T5235 | T5227 | arg2Of | or,of |
R4513 | T5235 | T5234 | arg1Of | or,"," |
R4514 | T5238 | T5235 | arg2Of | G,or |
R4515 | T5238 | T5236 | arg1Of | G,isotypic |
R4516 | T5238 | T5237 | arg1Of | G,immunoglobulin |
R4517 | T5242 | T5239 | arg2Of | control,as |
R4518 | T5242 | T5240 | arg1Of | control,a |
R4519 | T5242 | T5241 | arg1Of | control,non-specific |
R4520 | T5242 | T5243 | arg1Of | control,( |
R4521 | T5246 | T5243 | arg2Of | Biotechnology,( |
R4522 | T5246 | T5244 | arg1Of | Biotechnology,Santa |
R4523 | T5246 | T5245 | arg1Of | Biotechnology,Cruz |
R4524 | T5247 | T5243 | arg3Of | ),( |
R4525 | T5251 | T5250 | arg1Of | Promoter,4°C. |
R4526 | T5252 | T5251 | arg1Of | sequences,Promoter |
R4527 | T5252 | T5253 | arg1Of | sequences,were |
R4528 | T5252 | T5254 | arg2Of | sequences,detected |
R4529 | T5252 | T5271 | arg1Of | sequences,reverse |
R4530 | T5254 | T5253 | arg2Of | detected,were |
R4531 | T5254 | T5255 | arg1Of | detected,with |
R4532 | T5254 | T5270 | arg1Of | detected,and |
R4533 | T5257 | T5255 | arg2Of | primers,with |
R4534 | T5257 | T5256 | arg1Of | primers,PCR |
R4535 | T5257 | T5258 | arg1Of | primers,for |
R4536 | T5261 | T5259 | arg1Of | promoter,the |
R4537 | T5261 | T5260 | arg1Of | promoter,IL-5 |
R4538 | T5261 | T5262 | arg1Of | promoter,( |
R4539 | T5261 | T5267 | arg1Of | promoter,: |
R4540 | T5265 | T5262 | arg2Of | +4,( |
R4541 | T5265 | T5263 | arg1Of | +4,−445 |
R4542 | T5265 | T5264 | arg1Of | +4,to |
R4543 | T5266 | T5262 | arg3Of | ),( |
R4544 | T5269 | T5258 | arg2Of | 5′-TTAATCTAGCCACAGTCATAG-3′,for |
R4545 | T5269 | T5261 | arg1Of | 5′-TTAATCTAGCCACAGTCATAG-3′,promoter |
R4546 | T5269 | T5268 | arg1Of | 5′-TTAATCTAGCCACAGTCATAG-3′,forward |
R4547 | T5270 | T5213 | modOf | and,was |
R4548 | T5270 | T5249 | arg1Of | and,at |
R4549 | T5270 | T5272 | arg1Of | and,: |
R4550 | T5271 | T5270 | arg2Of | reverse,and |
R4551 | T5274 | T5275 | arg1Of | PCR,was |
R4552 | T5274 | T5276 | arg2Of | PCR,performed |
R4553 | T5276 | T5275 | arg2Of | performed,was |
R4554 | T5277 | T5276 | arg3Of | using,performed |
R4555 | T5280 | T5279 | arg1Of | Omnigene,Hybaid |
R4556 | T5282 | T5277 | arg2Of | cycler,using |
R4557 | T5282 | T5278 | arg1Of | cycler,a |
R4558 | T5282 | T5280 | arg1Of | cycler,Omnigene |
R4559 | T5282 | T5281 | arg1Of | cycler,thermal |
R4560 | T5282 | T5283 | arg1Of | cycler,( |
R4561 | T5282 | T5290 | arg1Of | cycler,with |
R4562 | T5284 | T5285 | arg1Of | Hybaid,"," |
R4563 | T5285 | T5283 | arg2Of | ",",( |
R4564 | T5285 | T5287 | arg1Of | ",","," |
R4565 | T5286 | T5285 | arg2Of | Ashford,"," |
R4566 | T5288 | T5287 | arg2Of | UK,"," |
R4567 | T5289 | T5283 | arg3Of | ),( |
R4568 | T5292 | T5290 | arg2Of | parameters,with |
R4569 | T5292 | T5291 | arg1Of | parameters,cycling |
R4570 | T5292 | T5293 | arg1Of | parameters,of |
R4571 | T5292 | T5301 | arg1Of | parameters,at |
R4572 | T5294 | T5295 | arg1Of | 72°C,for |
R4573 | T5294 | T5298 | arg1Of | 72°C,"," |
R4574 | T5297 | T5295 | arg2Of | min,for |
R4575 | T5297 | T5296 | arg1Of | min,10 |
R4576 | T5298 | T5293 | arg2Of | ",",of |
R4577 | T5300 | T5298 | arg2Of | cycles,"," |
R4578 | T5300 | T5299 | arg1Of | cycles,35 |
R4579 | T5302 | T5301 | arg2Of | 94°C,at |
R4580 | T5302 | T5303 | arg1Of | 94°C,for |
R4581 | T5305 | T5304 | arg1Of | s,45 |
R4582 | T5305 | T5306 | arg1Of | s,"," |
R4583 | T5306 | T5311 | arg1Of | ",","," |
R4584 | T5307 | T5306 | arg2Of | 52°C,"," |
R4585 | T5307 | T5308 | arg1Of | 52°C,for |
R4586 | T5310 | T5308 | arg2Of | s,for |
R4587 | T5310 | T5309 | arg1Of | s,45 |
R4588 | T5311 | T5303 | arg2Of | ",",for |
R4589 | T5311 | T5313 | arg1Of | ",",for |
R4590 | T5312 | T5311 | arg2Of | 72°C,"," |
R4591 | T5315 | T5313 | arg2Of | s,for |
R4592 | T5315 | T5314 | arg1Of | s,45 |
R4724 | T5499 | T5500 | arg1Of | GR-GATA-3,In |
R4725 | T5499 | T5504 | arg1Of | GR-GATA-3,for |
R4726 | T5503 | T5500 | arg2Of | Assay,In |
R4727 | T5503 | T5501 | arg1Of | Assay,Vitro |
R4728 | T5503 | T5502 | arg1Of | Assay,Competition |
R4729 | T5505 | T5504 | arg2Of | Importin-α,for |
R4730 | T5505 | T5506 | arg1Of | Importin-α,( |
R4731 | T5508 | T5506 | arg2Of | ELISA,( |
R4732 | T5508 | T5507 | arg1Of | ELISA,Far-Western |
R4733 | T5509 | T5506 | arg3Of | ),( |
R4734 | T5513 | T5510 | arg2Of | anti-importin-α,Immunoprecipitated |
R4735 | T5513 | T5511 | arg1Of | anti-importin-α,importin-α |
R4736 | T5513 | T5512 | arg2Of | anti-importin-α,( |
R4737 | T5513 | T5514 | arg1Of | anti-importin-α,"," |
R4738 | T5513 | T5519 | arg1Of | anti-importin-α,from |
R4739 | T5513 | T5522 | arg1Of | anti-importin-α,was |
R4740 | T5513 | T5523 | arg2Of | anti-importin-α,separated |
R4741 | T5513 | T5527 | arg2Of | anti-importin-α,purified |
R4742 | T5517 | T5514 | arg2Of | Biotechnology,"," |
R4743 | T5517 | T5515 | arg1Of | Biotechnology,Santa |
R4744 | T5517 | T5516 | arg1Of | Biotechnology,Cruz |
R4745 | T5518 | T5512 | arg3Of | ),( |
R4746 | T5521 | T5519 | arg2Of | cells,from |
R4747 | T5521 | T5520 | arg1Of | cells,HuT-78 |
R4748 | T5523 | T5526 | arg1Of | separated,and |
R4749 | T5525 | T5523 | arg1Of | SDS-PAGE,separated |
R4750 | T5525 | T5524 | arg2Of | SDS-PAGE,by |
R4751 | T5526 | T5522 | arg2Of | and,was |
R4752 | T5527 | T5526 | arg2Of | purified,and |
R4753 | T5527 | T5528 | arg1Of | purified,from |
R4754 | T5527 | T5534 | arg1Of | purified,[ |
R4755 | T5531 | T5528 | arg2Of | gel,from |
R4756 | T5531 | T5529 | arg1Of | gel,the |
R4757 | T5531 | T5530 | arg2Of | gel,excised |
R4758 | T5533 | T5527 | arg1Of | electroelution,purified |
R4759 | T5533 | T5532 | arg2Of | electroelution,by |
R4760 | T5535 | T5534 | arg2Of | 36,[ |
R4761 | T5536 | T5534 | arg3Of | ],[ |
R4762 | T5539 | T5540 | arg1Of | GATA-3,was |
R4763 | T5539 | T5541 | arg2Of | GATA-3,isolated |
R4764 | T5541 | T5537 | arg1Of | isolated,Similarly |
R4765 | T5541 | T5538 | arg1Of | isolated,"," |
R4766 | T5541 | T5540 | arg2Of | isolated,was |
R4767 | T5541 | T5542 | arg1Of | isolated,from |
R4768 | T5541 | T5554 | arg1Of | isolated,and |
R4769 | T5545 | T5543 | arg1Of | cells,nonstimulated |
R4770 | T5545 | T5544 | arg1Of | cells,HuT-78 |
R4771 | T5545 | T5546 | arg1Of | cells,or |
R4772 | T5546 | T5542 | arg2Of | or,from |
R4773 | T5547 | T5546 | arg2Of | cells,or |
R4774 | T5547 | T5548 | arg2Of | cells,stimulated |
R4775 | T5548 | T5549 | arg1Of | stimulated,for |
R4776 | T5551 | T5549 | arg2Of | min,for |
R4777 | T5551 | T5550 | arg1Of | min,30 |
R4778 | T5551 | T5552 | arg1Of | min,with |
R4779 | T5553 | T5552 | arg2Of | anti-CD3/CD28,with |
R4780 | T5555 | T5556 | arg1Of | GR,was |
R4781 | T5555 | T5557 | arg2Of | GR,isolated |
R4782 | T5557 | T5554 | arg2Of | isolated,and |
R4783 | T5557 | T5556 | arg2Of | isolated,was |
R4784 | T5557 | T5558 | arg1Of | isolated,from |
R4785 | T5559 | T5560 | arg1Of | FP,( |
R4786 | T5562 | T5560 | arg2Of | M,( |
R4787 | T5562 | T5561 | arg1Of | M,10−8 |
R4788 | T5562 | T5563 | arg1Of | M,"," |
R4789 | T5565 | T5563 | arg2Of | min,"," |
R4790 | T5565 | T5564 | arg1Of | min,30 |
R4791 | T5566 | T5560 | arg3Of | ),( |
R4792 | T5569 | T5558 | arg2Of | cells,from |
R4793 | T5569 | T5559 | arg1Of | cells,FP |
R4794 | T5569 | T5567 | arg1Of | cells,stimulated |
R4795 | T5569 | T5568 | arg1Of | cells,HuT-78 |
R4796 | T5571 | T5570 | arg1Of | proteins,These |
R4797 | T5571 | T5572 | arg1Of | proteins,were |
R4798 | T5571 | T5574 | arg2Of | proteins,refolded |
R4799 | T5574 | T5572 | arg2Of | refolded,were |
R4800 | T5574 | T5573 | arg1Of | refolded,subsequently |
R4801 | T5574 | T5575 | arg1Of | refolded,in |
R4802 | T5577 | T5575 | arg2Of | solution,in |
R4803 | T5577 | T5576 | arg1Of | solution,glycine |
R4804 | T5579 | T5578 | arg1Of | µl,100 |
R4805 | T5579 | T5580 | arg1Of | µl,of |
R4806 | T5579 | T5583 | arg1Of | µl,( |
R4807 | T5579 | T5589 | arg1Of | µl,was |
R4808 | T5579 | T5590 | arg2Of | µl,added |
R4809 | T5582 | T5580 | arg2Of | solution,of |
R4810 | T5582 | T5581 | arg1Of | solution,importin-α |
R4811 | T5585 | T5583 | arg2Of | ng/ml,( |
R4812 | T5585 | T5584 | arg1Of | ng/ml,100 |
R4813 | T5585 | T5586 | arg1Of | ng/ml,in |
R4814 | T5587 | T5586 | arg2Of | TBS,in |
R4815 | T5588 | T5583 | arg3Of | ),( |
R4816 | T5590 | T5589 | arg2Of | added,was |
R4817 | T5590 | T5591 | arg1Of | added,to |
R4818 | T5593 | T5591 | arg2Of | plates,to |
R4819 | T5593 | T5592 | arg1Of | plates,96-well |
R4820 | T5593 | T5594 | arg2Of | plates,coated |
R4821 | T5594 | T5595 | arg1Of | coated,with |
R4822 | T5598 | T5595 | arg2Of | antibody,with |
R4823 | T5598 | T5596 | arg1Of | antibody,goat |
R4824 | T5598 | T5597 | arg1Of | antibody,anti-importin-α |
R4825 | T5602 | T5599 | arg2Of | incubation,After |
R4826 | T5602 | T5600 | arg1Of | incubation,1 |
R4827 | T5602 | T5601 | arg1Of | incubation,h |
R4828 | T5604 | T5605 | arg1Of | GATA-3,( |
R4829 | T5604 | T5611 | arg1Of | GATA-3,from |
R4830 | T5604 | T5616 | arg1Of | GATA-3,were |
R4831 | T5604 | T5617 | arg2Of | GATA-3,added |
R4832 | T5607 | T5605 | arg2Of | ng/ml,( |
R4833 | T5607 | T5606 | arg1Of | ng/ml,100 |
R4834 | T5607 | T5608 | arg1Of | ng/ml,in |
R4835 | T5609 | T5608 | arg2Of | TBS,in |
R4836 | T5610 | T5605 | arg3Of | ),( |
R4837 | T5615 | T5611 | arg2Of | cells,from |
R4838 | T5615 | T5612 | arg2Of | cells,stimulated |
R4839 | T5615 | T5613 | arg1Of | cells,or |
R4840 | T5615 | T5614 | arg1Of | cells,unstimulated |
R4841 | T5617 | T5599 | arg1Of | added,After |
R4842 | T5617 | T5603 | arg1Of | added,"," |
R4843 | T5617 | T5616 | arg2Of | added,were |
R4844 | T5617 | T5618 | arg1Of | added,to |
R4845 | T5621 | T5618 | arg2Of | wells,to |
R4846 | T5621 | T5619 | arg1Of | wells,the |
R4847 | T5621 | T5620 | arg1Of | wells,importin-α-coated |
R4848 | T5622 | T5623 | arg1Of | GR,( |
R4849 | T5622 | T5631 | arg1Of | GR,from |
R4850 | T5622 | T5636 | arg1Of | GR,were |
R4851 | T5622 | T5637 | arg2Of | GR,added |
R4852 | T5624 | T5625 | arg1Of | 10,or |
R4853 | T5626 | T5625 | arg2Of | 100,or |
R4854 | T5627 | T5623 | arg2Of | ng/ml,( |
R4855 | T5627 | T5624 | arg1Of | ng/ml,10 |
R4856 | T5627 | T5626 | arg1Of | ng/ml,100 |
R4857 | T5627 | T5628 | arg1Of | ng/ml,in |
R4858 | T5629 | T5628 | arg2Of | TBS,in |
R4859 | T5630 | T5623 | arg3Of | ),( |
R4860 | T5635 | T5631 | arg2Of | cells,from |
R4861 | T5635 | T5632 | arg2Of | cells,stimulated |
R4862 | T5635 | T5633 | arg1Of | cells,or |
R4863 | T5635 | T5634 | arg1Of | cells,unstimulated |
R4864 | T5637 | T5636 | arg2Of | added,were |
R4865 | T5637 | T5638 | arg1Of | added,to |
R4866 | T5640 | T5638 | arg2Of | wells,to |
R4867 | T5640 | T5639 | arg1Of | wells,some |
R4868 | T5644 | T5645 | arg1Of | 1,h |
R4869 | T5646 | T5641 | arg2Of | incubation,After |
R4870 | T5646 | T5642 | arg1Of | incubation,a |
R4871 | T5646 | T5643 | arg1Of | incubation,further |
R4872 | T5646 | T5644 | arg1Of | incubation,1 |
R4873 | T5649 | T5648 | arg1Of | plate,the |
R4874 | T5649 | T5650 | arg1Of | plate,was |
R4875 | T5649 | T5651 | arg2Of | plate,washed |
R4876 | T5649 | T5653 | arg2Of | plate,incubated |
R4877 | T5649 | T5677 | arg2Of | plate,incubated |
R4878 | T5651 | T5652 | arg1Of | washed,and |
R4879 | T5652 | T5654 | arg1Of | and,with |
R4880 | T5652 | T5675 | arg1Of | and,and |
R4881 | T5653 | T5652 | arg2Of | incubated,and |
R4882 | T5656 | T5654 | arg2Of | antibodies,with |
R4883 | T5656 | T5655 | arg1Of | antibodies,primary |
R4884 | T5656 | T5657 | arg1Of | antibodies,( |
R4885 | T5656 | T5671 | arg1Of | antibodies,for |
R4886 | T5659 | T5657 | arg2Of | mixture,( |
R4887 | T5659 | T5658 | arg1Of | mixture,a |
R4888 | T5659 | T5660 | arg1Of | mixture,of |
R4889 | T5662 | T5661 | arg1Of | anti-GATA-3,rabbit |
R4890 | T5662 | T5663 | arg1Of | anti-GATA-3,and |
R4891 | T5663 | T5660 | arg2Of | and,of |
R4892 | T5663 | T5666 | arg1Of | and,"," |
R4893 | T5665 | T5663 | arg2Of | anti-GR,and |
R4894 | T5665 | T5664 | arg1Of | anti-GR,mouse |
R4895 | T5669 | T5666 | arg2Of | Biotechnology,"," |
R4896 | T5669 | T5667 | arg1Of | Biotechnology,Santa |
R4897 | T5669 | T5668 | arg1Of | Biotechnology,Cruz |
R4898 | T5670 | T5657 | arg3Of | ),( |
R4899 | T5673 | T5671 | arg2Of | h,for |
R4900 | T5673 | T5672 | arg1Of | h,1.5 |
R4901 | T5675 | T5641 | arg1Of | and,After |
R4902 | T5675 | T5647 | arg1Of | and,"," |
R4903 | T5675 | T5650 | arg2Of | and,was |
R4904 | T5675 | T5674 | arg1Of | and,"," |
R4905 | T5677 | T5675 | arg2Of | incubated,and |
R4906 | T5677 | T5676 | arg1Of | incubated,then |
R4907 | T5677 | T5678 | arg1Of | incubated,with |
R4908 | T5680 | T5678 | arg2Of | antibodies,with |
R4909 | T5680 | T5679 | arg1Of | antibodies,secondary |
R4910 | T5684 | T5681 | arg1Of | IgG,FITC |
R4911 | T5684 | T5682 | arg1Of | IgG,swine |
R4912 | T5684 | T5683 | arg1Of | IgG,anti-rabbit |
R4913 | T5684 | T5685 | arg1Of | IgG,( |
R4914 | T5684 | T5692 | arg1Of | IgG,was |
R4915 | T5684 | T5693 | arg2Of | IgG,used |
R4916 | T5686 | T5685 | arg2Of | Dako,( |
R4917 | T5686 | T5687 | arg1Of | Dako,"," |
R4918 | T5688 | T5687 | arg2Of | Cambridge,"," |
R4919 | T5688 | T5689 | arg1Of | Cambridge,"," |
R4920 | T5690 | T5689 | arg2Of | UK,"," |
R4921 | T5691 | T5685 | arg3Of | ),( |
R4922 | T5693 | T5692 | arg2Of | used,was |
R4923 | T5693 | T5694 | arg1Of | used,for |
R4924 | T5693 | T5700 | arg1Of | used,and |
R4925 | T5696 | T5694 | arg2Of | detection,for |
R4926 | T5696 | T5695 | arg1Of | detection,the |
R4927 | T5696 | T5697 | arg1Of | detection,of |
R4928 | T5698 | T5697 | arg2Of | GATA-3,of |
R4929 | T5700 | T5699 | arg1Of | and,"," |
R4930 | T5704 | T5701 | arg1Of | IgG,rhodamine |
R4931 | T5704 | T5702 | arg1Of | IgG,donkey |
R4932 | T5704 | T5703 | arg1Of | IgG,anti-mouse |
R4933 | T5704 | T5705 | arg1Of | IgG,( |
R4934 | T5704 | T5714 | arg1Of | IgG,was |
R4935 | T5704 | T5715 | arg2Of | IgG,used |
R4936 | T5706 | T5707 | arg1Of | Novus,"," |
R4937 | T5707 | T5709 | arg1Of | ",","," |
R4938 | T5708 | T5707 | arg2Of | Littleton,"," |
R4939 | T5709 | T5705 | arg2Of | ",",( |
R4940 | T5709 | T5711 | arg1Of | ",","," |
R4941 | T5709 | T5712 | arg1Of | ",",USA |
R4942 | T5710 | T5709 | arg2Of | Colorado,"," |
R4943 | T5713 | T5705 | arg3Of | ),( |
R4944 | T5715 | T5700 | arg2Of | used,and |
R4945 | T5715 | T5714 | arg2Of | used,was |
R4946 | T5715 | T5716 | arg1Of | used,for |
R4947 | T5718 | T5716 | arg2Of | detection,for |
R4948 | T5718 | T5717 | arg1Of | detection,the |
R4949 | T5718 | T5719 | arg1Of | detection,of |
R4950 | T5720 | T5719 | arg2Of | GR,of |
R4951 | T5721 | T5722 | arg1Of | FITC,and |
R4952 | T5723 | T5722 | arg2Of | rhodamine,and |
R4953 | T5724 | T5721 | arg1Of | levels,FITC |
R4954 | T5724 | T5723 | arg1Of | levels,rhodamine |
R4955 | T5724 | T5725 | arg1Of | levels,were |
R4956 | T5724 | T5726 | arg2Of | levels,measured |
R4957 | T5726 | T5725 | arg2Of | measured,were |
R4958 | T5726 | T5727 | arg1Of | measured,with |
R4959 | T5726 | T5732 | arg1Of | measured,( |
R4960 | T5731 | T5727 | arg2Of | reader,with |
R4961 | T5731 | T5728 | arg1Of | reader,a |
R4962 | T5731 | T5729 | arg1Of | reader,fluorescent |
R4963 | T5731 | T5730 | arg1Of | reader,micro-plate |
R4964 | T5733 | T5732 | arg2Of | Bioline,( |
R4965 | T5733 | T5734 | arg1Of | Bioline,"," |
R4966 | T5735 | T5734 | arg2Of | London,"," |
R4967 | T5735 | T5736 | arg1Of | London,"," |
R4968 | T5737 | T5736 | arg2Of | UK,"," |
R4969 | T5738 | T5732 | arg3Of | ),( |
R5227 | T6081 | T6080 | arg1Of | Activation,NF-κB |
R5228 | T6084 | T6082 | arg1Of | activity,NF-κB |
R5229 | T6084 | T6083 | arg1Of | activity,binding |
R5230 | T6084 | T6085 | arg1Of | activity,in |
R5231 | T6084 | T6088 | arg1Of | activity,was |
R5232 | T6084 | T6089 | arg2Of | activity,determined |
R5233 | T6087 | T6085 | arg2Of | extracts,in |
R5234 | T6087 | T6086 | arg1Of | extracts,nuclear |
R5235 | T6089 | T6088 | arg2Of | determined,was |
R5236 | T6090 | T6089 | arg3Of | using,determined |
R5237 | T6093 | T6090 | arg2Of | kit,using |
R5238 | T6093 | T6091 | arg1Of | kit,an |
R5239 | T6093 | T6092 | arg1Of | kit,ELISA-based |
R5240 | T6093 | T6094 | arg1Of | kit,( |
R5241 | T6096 | T6095 | arg1Of | p65,Trans-AM |
R5242 | T6096 | T6097 | arg1Of | p65,"," |
R5243 | T6096 | T6100 | arg1Of | p65,"," |
R5244 | T6099 | T6097 | arg2Of | Motif,"," |
R5245 | T6099 | T6098 | arg1Of | Motif,Active |
R5246 | T6100 | T6094 | arg2Of | ",",( |
R5247 | T6101 | T6100 | arg2Of | Rixensart,"," |
R5248 | T6101 | T6102 | arg1Of | Rixensart,"," |
R5249 | T6103 | T6102 | arg2Of | Belgium,"," |
R5250 | T6104 | T6094 | arg3Of | ),( |
R5251 | T6106 | T6105 | arg2Of | brief,In |
R5252 | T6109 | T6108 | arg1Of | µg,5 |
R5253 | T6109 | T6110 | arg1Of | µg,of |
R5254 | T6109 | T6113 | arg1Of | µg,were |
R5255 | T6109 | T6114 | arg2Of | µg,incubated |
R5256 | T6112 | T6110 | arg2Of | extracts,of |
R5257 | T6112 | T6111 | arg1Of | extracts,nuclear |
R5258 | T6114 | T6105 | arg1Of | incubated,In |
R5259 | T6114 | T6107 | arg1Of | incubated,"," |
R5260 | T6114 | T6113 | arg2Of | incubated,were |
R5261 | T6114 | T6115 | arg1Of | incubated,with |
R5262 | T6117 | T6115 | arg2Of | plate,with |
R5263 | T6117 | T6116 | arg1Of | plate,a |
R5264 | T6117 | T6118 | arg2Of | plate,coated |
R5265 | T6118 | T6119 | arg1Of | coated,with |
R5266 | T6123 | T6119 | arg2Of | oligonucleotide,with |
R5267 | T6123 | T6120 | arg1Of | oligonucleotide,an |
R5268 | T6123 | T6121 | arg1Of | oligonucleotide,NF-κB |
R5269 | T6123 | T6122 | arg1Of | oligonucleotide,consensus |
R5270 | T6124 | T6125 | arg1Of | Plates,were |
R5271 | T6124 | T6126 | arg2Of | Plates,washed |
R5272 | T6126 | T6125 | arg2Of | washed,were |
R5273 | T6126 | T6127 | arg1Of | washed,before |
R5274 | T6128 | T6127 | arg2Of | addition,before |
R5275 | T6128 | T6129 | arg1Of | addition,of |
R5276 | T6132 | T6129 | arg2Of | antibody,of |
R5277 | T6132 | T6130 | arg1Of | antibody,an |
R5278 | T6132 | T6131 | arg1Of | antibody,anti-p65 |
R5279 | T6134 | T6133 | arg1Of | binding,Antibody |
R5280 | T6134 | T6135 | arg1Of | binding,was |
R5281 | T6134 | T6136 | arg2Of | binding,detected |
R5282 | T6134 | T6143 | arg2Of | binding,developed |
R5283 | T6136 | T6137 | arg1Of | detected,with |
R5284 | T6136 | T6142 | arg1Of | detected,and |
R5285 | T6141 | T6137 | arg2Of | antibody,with |
R5286 | T6141 | T6138 | arg1Of | antibody,a |
R5287 | T6141 | T6139 | arg1Of | antibody,secondary |
R5288 | T6141 | T6140 | arg1Of | antibody,HRP-conjugated |
R5289 | T6142 | T6135 | arg2Of | and,was |
R5290 | T6143 | T6142 | arg2Of | developed,and |
R5291 | T6143 | T6144 | arg1Of | developed,with |
R5292 | T6146 | T6144 | arg2Of | substrate,with |
R5293 | T6146 | T6145 | arg1Of | substrate,TMB |
R5294 | T6148 | T6147 | arg1Of | intensity,The |
R5295 | T6148 | T6149 | arg1Of | intensity,of |
R5296 | T6148 | T6152 | arg1Of | intensity,was |
R5297 | T6148 | T6153 | arg2Of | intensity,measured |
R5298 | T6151 | T6149 | arg2Of | reaction,of |
R5299 | T6151 | T6150 | arg1Of | reaction,the |
R5300 | T6153 | T6152 | arg2Of | measured,was |
R5301 | T6153 | T6154 | arg1Of | measured,at |
R5302 | T6156 | T6154 | arg2Of | nm,at |
R5303 | T6156 | T6155 | arg1Of | nm,450 |
R5389 | T6284 | T6283 | arg1Of | Staining,Immunofluorescence |
R5390 | T6286 | T6285 | arg1Of | staining,Immunofluorescence |
R5391 | T6286 | T6287 | arg1Of | staining,was |
R5392 | T6286 | T6288 | arg2Of | staining,performed |
R5393 | T6288 | T6287 | arg2Of | performed,was |
R5394 | T6288 | T6289 | arg1Of | performed,as |
R5395 | T6291 | T6290 | arg1Of | described,previously |
R5396 | T6293 | T6289 | arg2Of | 34,as |
R5397 | T6293 | T6291 | arg1Of | 34,described |
R5398 | T6293 | T6292 | arg2Of | 34,[ |
R5399 | T6294 | T6292 | arg3Of | ],[ |
R5400 | T6296 | T6295 | arg1Of | staining,All |
R5401 | T6296 | T6297 | arg1Of | staining,was |
R5402 | T6296 | T6298 | arg2Of | staining,performed |
R5403 | T6298 | T6297 | arg2Of | performed,was |
R5404 | T6298 | T6299 | arg1Of | performed,at |
R5405 | T6298 | T6303 | arg1Of | performed,under |
R5406 | T6299 | T6302 | arg1Of | at,and |
R5407 | T6301 | T6299 | arg2Of | temperature,at |
R5408 | T6301 | T6300 | arg1Of | temperature,room |
R5409 | T6303 | T6302 | arg2Of | under,and |
R5410 | T6304 | T6303 | arg2Of | humidification,under |
R5411 | T6305 | T6306 | arg1Of | Cells,were |
R5412 | T6305 | T6307 | arg2Of | Cells,collected |
R5413 | T6307 | T6306 | arg2Of | collected,were |
R5414 | T6307 | T6308 | arg1Of | collected,and |
R5415 | T6308 | T6314 | arg1Of | and,( |
R5416 | T6309 | T6310 | arg2Of | cytospins,prepared |
R5417 | T6310 | T6308 | arg2Of | prepared,and |
R5418 | T6310 | T6311 | arg1Of | prepared,in |
R5419 | T6313 | T6311 | arg2Of | cytocentrifuge,in |
R5420 | T6313 | T6312 | arg1Of | cytocentrifuge,a |
R5421 | T6316 | T6315 | arg1Of | II,Shandon |
R5422 | T6316 | T6317 | arg1Of | II,"," |
R5423 | T6317 | T6319 | arg1Of | ",","," |
R5424 | T6318 | T6317 | arg2Of | Shandon,"," |
R5425 | T6319 | T6314 | arg2Of | ",",( |
R5426 | T6319 | T6321 | arg1Of | ",","," |
R5427 | T6320 | T6319 | arg2Of | Runcorn,"," |
R5428 | T6322 | T6321 | arg2Of | UK,"," |
R5429 | T6323 | T6314 | arg3Of | ),( |
R5430 | T6324 | T6325 | arg1Of | Cells,were |
R5431 | T6324 | T6326 | arg2Of | Cells,permeabilized |
R5432 | T6324 | T6328 | arg2Of | Cells,blocked |
R5433 | T6324 | T6332 | arg2Of | Cells,incubated |
R5434 | T6326 | T6327 | arg1Of | permeabilized,"," |
R5435 | T6327 | T6330 | arg1Of | ",",and |
R5436 | T6328 | T6327 | arg2Of | blocked,"," |
R5437 | T6330 | T6325 | arg2Of | and,were |
R5438 | T6330 | T6329 | arg1Of | and,"," |
R5439 | T6332 | T6330 | arg2Of | incubated,and |
R5440 | T6332 | T6331 | arg1Of | incubated,then |
R5441 | T6332 | T6333 | arg1Of | incubated,with |
R5442 | T6334 | T6335 | arg1Of | GR,( |
R5443 | T6334 | T6342 | arg1Of | GR,or |
R5444 | T6340 | T6335 | arg2Of | Biotechnology,( |
R5445 | T6340 | T6336 | arg1Of | Biotechnology,1∶50 |
R5446 | T6340 | T6337 | arg1Of | Biotechnology,E-20 |
R5447 | T6340 | T6338 | arg1Of | Biotechnology,Santa |
R5448 | T6340 | T6339 | arg1Of | Biotechnology,Cruz |
R5449 | T6341 | T6335 | arg3Of | ),( |
R5450 | T6342 | T6333 | arg2Of | or,with |
R5451 | T6343 | T6344 | arg1Of | anti-GATA-3,( |
R5452 | T6345 | T6344 | arg2Of | H-48,( |
R5453 | T6345 | T6346 | arg1Of | H-48,; |
R5454 | T6349 | T6346 | arg2Of | Biotechnology,; |
R5455 | T6349 | T6347 | arg1Of | Biotechnology,Santa |
R5456 | T6349 | T6348 | arg1Of | Biotechnology,Cruz |
R5457 | T6350 | T6344 | arg3Of | ),( |
R5458 | T6351 | T6342 | arg2Of | antibody,or |
R5459 | T6351 | T6343 | arg1Of | antibody,anti-GATA-3 |
R5460 | T6351 | T6352 | arg1Of | antibody,for |
R5461 | T6354 | T6352 | arg2Of | h,for |
R5462 | T6354 | T6353 | arg1Of | h,1 |
R5463 | T6354 | T6355 | arg1Of | h,at |
R5464 | T6357 | T6355 | arg2Of | temperature,at |
R5465 | T6357 | T6356 | arg1Of | temperature,room |
R5466 | T6360 | T6358 | arg2Of | washes,After |
R5467 | T6360 | T6359 | arg1Of | washes,three |
R5468 | T6360 | T6361 | arg1Of | washes,in |
R5469 | T6363 | T6361 | arg2Of | saline,in |
R5470 | T6363 | T6362 | arg1Of | saline,phosphate-buffered |
R5471 | T6363 | T6364 | arg1Of | saline,( |
R5472 | T6365 | T6364 | arg2Of | PBS,( |
R5473 | T6366 | T6364 | arg3Of | ),( |
R5474 | T6368 | T6369 | arg1Of | cells,were |
R5475 | T6368 | T6370 | arg2Of | cells,incubated |
R5476 | T6370 | T6358 | arg1Of | incubated,After |
R5477 | T6370 | T6367 | arg1Of | incubated,"," |
R5478 | T6370 | T6369 | arg2Of | incubated,were |
R5479 | T6370 | T6371 | arg1Of | incubated,with |
R5480 | T6372 | T6371 | arg2Of | tetrarhodamine,with |
R5481 | T6372 | T6373 | arg2Of | tetrarhodamine,isothiocyanate–conjugated |
R5482 | T6376 | T6373 | arg3Of | antibody,isothiocyanate–conjugated |
R5483 | T6376 | T6374 | arg1Of | antibody,goat |
R5484 | T6376 | T6375 | arg1Of | antibody,anti-rabbit |
R5485 | T6376 | T6377 | arg1Of | antibody,( |
R5486 | T6378 | T6377 | arg2Of | Dako,( |
R5487 | T6379 | T6377 | arg3Of | ),( |
R5488 | T6380 | T6381 | arg1Of | Cytospins,were |
R5489 | T6380 | T6382 | arg2Of | Cytospins,counterstained |
R5490 | T6380 | T6401 | arg1Of | Cytospins,mounted |
R5491 | T6382 | T6381 | arg2Of | counterstained,were |
R5492 | T6382 | T6383 | arg1Of | counterstained,with |
R5493 | T6382 | T6400 | arg1Of | counterstained,and |
R5494 | T6384 | T6383 | arg2Of | 4′,with |
R5495 | T6384 | T6385 | arg1Of | 4′,"," |
R5496 | T6384 | T6391 | arg1Of | 4′,"," |
R5497 | T6387 | T6385 | arg2Of | dihydrochloride,"," |
R5498 | T6387 | T6386 | arg1Of | dihydrochloride,6-diamidino-2-phenylindole |
R5499 | T6387 | T6388 | arg1Of | dihydrochloride,( |
R5500 | T6389 | T6388 | arg2Of | DAPI,( |
R5501 | T6390 | T6388 | arg3Of | ),( |
R5502 | T6398 | T6391 | arg2Of | stain,"," |
R5503 | T6398 | T6392 | arg1Of | stain,a |
R5504 | T6398 | T6393 | arg1Of | stain,fluorescent |
R5505 | T6398 | T6394 | arg1Of | stain,blue |
R5506 | T6398 | T6395 | arg1Of | stain,nuclear |
R5507 | T6398 | T6396 | arg1Of | stain,indole |
R5508 | T6398 | T6397 | arg1Of | stain,chromatin |
R5509 | T6400 | T6399 | arg1Of | and,"," |
R5510 | T6401 | T6400 | arg2Of | mounted,and |
R5511 | T6401 | T6402 | arg1Of | mounted,in |
R5512 | T6401 | T6404 | arg1Of | mounted,: |
R5513 | T6403 | T6402 | arg2Of | PBS,in |
R5514 | T6405 | T6401 | arg2Of | glycerol,mounted |
R5515 | T6405 | T6406 | arg1Of | glycerol,( |
R5516 | T6407 | T6406 | arg2Of | 50∶50,( |
R5517 | T6408 | T6406 | arg3Of | ),( |
R5518 | T6411 | T6409 | arg1Of | signal,The |
R5519 | T6411 | T6410 | arg1Of | signal,immunopositive |
R5520 | T6411 | T6412 | arg1Of | signal,was |
R5521 | T6411 | T6413 | arg2Of | signal,characterised |
R5522 | T6411 | T6414 | arg1Of | signal,using |
R5523 | T6413 | T6412 | arg2Of | characterised,was |
R5524 | T6414 | T6413 | arg3Of | using,characterised |
R5525 | T6414 | T6419 | arg1Of | using,on |
R5526 | T6418 | T6414 | arg2Of | microscopy,using |
R5527 | T6418 | T6415 | arg1Of | microscopy,laser |
R5528 | T6418 | T6416 | arg1Of | microscopy,scanning |
R5529 | T6418 | T6417 | arg1Of | microscopy,confocal |
R5530 | T6423 | T6421 | arg1Of | NT/SP,Leica |
R5531 | T6423 | T6422 | arg1Of | NT/SP,TCS |
R5532 | T6426 | T6419 | arg2Of | cytometer,on |
R5533 | T6426 | T6420 | arg1Of | cytometer,a |
R5534 | T6426 | T6423 | arg1Of | cytometer,NT/SP |
R5535 | T6426 | T6424 | arg1Of | cytometer,interactive |
R5536 | T6426 | T6425 | arg1Of | cytometer,laser |
R5537 | T6426 | T6427 | arg2Of | cytometer,equipped |
R5538 | T6427 | T6428 | arg1Of | equipped,with |
R5539 | T6430 | T6428 | arg2Of | optics,with |
R5540 | T6430 | T6429 | arg1Of | optics,confocal |
R5541 | T6430 | T6431 | arg1Of | optics,( |
R5542 | T6433 | T6431 | arg2Of | Microsystems,( |
R5543 | T6433 | T6432 | arg1Of | Microsystems,Leica |
R5544 | T6433 | T6434 | arg1Of | Microsystems,"," |
R5545 | T6435 | T6434 | arg2Of | Wetzlar,"," |
R5546 | T6435 | T6436 | arg1Of | Wetzlar,"," |
R5547 | T6437 | T6436 | arg2Of | Germany,"," |
R5548 | T6438 | T6431 | arg3Of | ),( |
R5549 | T6440 | T6439 | arg1Of | determine,To |
R5550 | T6442 | T6440 | arg2Of | specificity,determine |
R5551 | T6442 | T6441 | arg1Of | specificity,the |
R5552 | T6442 | T6443 | arg1Of | specificity,of |
R5553 | T6445 | T6443 | arg2Of | antibodies,of |
R5554 | T6445 | T6444 | arg1Of | antibodies,the |
R5555 | T6449 | T6447 | arg1Of | immunoglobulin,rabbit |
R5556 | T6449 | T6448 | arg1Of | immunoglobulin,serum |
R5557 | T6449 | T6450 | arg1Of | immunoglobulin,( |
R5558 | T6449 | T6453 | arg1Of | immunoglobulin,and |
R5559 | T6451 | T6450 | arg2Of | Dako,( |
R5560 | T6452 | T6450 | arg3Of | ),( |
R5561 | T6453 | T6456 | arg1Of | and,without |
R5562 | T6453 | T6459 | arg1Of | and,were |
R5563 | T6453 | T6460 | arg2Of | and,used |
R5564 | T6455 | T6453 | arg2Of | antibodies,and |
R5565 | T6455 | T6454 | arg1Of | antibodies,secondary |
R5566 | T6458 | T6456 | arg2Of | primary,without |
R5567 | T6458 | T6457 | arg1Of | primary,the |
R5568 | T6460 | T6439 | modOf | used,To |
R5569 | T6460 | T6446 | arg1Of | used,"," |
R5570 | T6460 | T6459 | arg2Of | used,were |
R5571 | T6460 | T6461 | arg1Of | used,as |
R5572 | T6462 | T6461 | arg2Of | controls,as |
R5573 | T6464 | T6463 | arg1Of | stained,Positively |
R5574 | T6465 | T6464 | arg1Of | nuclei,stained |
R5575 | T6465 | T6466 | arg1Of | nuclei,and |
R5576 | T6466 | T6469 | arg1Of | and,were |
R5577 | T6466 | T6470 | arg2Of | and,counted |
R5578 | T6468 | T6466 | arg2Of | cells,and |
R5579 | T6468 | T6467 | arg1Of | cells,total |
R5580 | T6470 | T6469 | arg2Of | counted,were |
R5581 | T6470 | T6471 | arg1Of | counted,( |
R5582 | T6470 | T6474 | arg1Of | counted,on |
R5583 | T6472 | T6471 | arg2Of | 500,( |
R5584 | T6473 | T6471 | arg3Of | ),( |
R5585 | T6476 | T6474 | arg2Of | slide,on |
R5586 | T6476 | T6475 | arg1Of | slide,each |
R5587 | T6476 | T6477 | arg1Of | slide,with |
R5588 | T6479 | T6477 | arg2Of | observer,with |
R5589 | T6479 | T6478 | arg1Of | observer,the |
R5590 | T6479 | T6480 | arg2Of | observer,blinded |
R5591 | T6480 | T6481 | arg1Of | blinded,to |
R5592 | T6483 | T6481 | arg2Of | treatment,to |
R5593 | T6483 | T6482 | arg1Of | treatment,the |
R5815 | T6780 | T6779 | arg1Of | Construct,GATA-3-GFP |
R5816 | T6785 | T6784 | arg2Of | BC003070,( |
R5817 | T6786 | T6784 | arg3Of | ),( |
R5818 | T6788 | T6781 | arg1Of | cDNA,The |
R5819 | T6788 | T6782 | arg1Of | cDNA,GATA-3 |
R5820 | T6788 | T6783 | arg1Of | cDNA,clone |
R5821 | T6788 | T6784 | arg1Of | cDNA,( |
R5822 | T6788 | T6787 | arg1Of | cDNA,complete |
R5823 | T6788 | T6789 | arg1Of | cDNA,was |
R5824 | T6788 | T6790 | arg2Of | cDNA,obtained |
R5825 | T6790 | T6789 | arg2Of | obtained,was |
R5826 | T6790 | T6791 | arg1Of | obtained,from |
R5827 | T6790 | T6795 | arg1Of | obtained,as |
R5828 | T6794 | T6791 | arg2Of | Technologies,from |
R5829 | T6794 | T6792 | arg1Of | Technologies,Invitrogen |
R5830 | T6794 | T6793 | arg1Of | Technologies,Life |
R5831 | T6799 | T6795 | arg2Of | insert,as |
R5832 | T6799 | T6796 | arg1Of | insert,a |
R5833 | T6799 | T6797 | arg1Of | insert,5′- |
R5834 | T6799 | T6798 | arg1Of | insert,EcoRI/3′-XhoI |
R5835 | T6799 | T6800 | arg1Of | insert,of |
R5836 | T6799 | T6802 | arg1Of | insert,in |
R5837 | T6801 | T6800 | arg2Of | GATA-3,of |
R5838 | T6805 | T6802 | arg2Of | vector,in |
R5839 | T6805 | T6803 | arg1Of | vector,the |
R5840 | T6805 | T6804 | arg1Of | vector,pOTB7 |
R5841 | T6806 | T6807 | arg1Of | GATA-3,was |
R5842 | T6806 | T6808 | arg2Of | GATA-3,excised |
R5843 | T6808 | T6807 | arg2Of | excised,was |
R5844 | T6808 | T6809 | arg1Of | excised,from |
R5845 | T6810 | T6809 | arg2Of | pOTB7,from |
R5846 | T6813 | T6811 | arg1Of | digestion,using |
R5847 | T6813 | T6812 | arg1Of | digestion,XhoI |
R5848 | T6813 | T6814 | arg1Of | digestion,and |
R5849 | T6814 | T6823 | arg1Of | and,was |
R5850 | T6814 | T6824 | arg2Of | and,digested |
R5851 | T6815 | T6814 | arg2Of | pEGFP-C2,and |
R5852 | T6815 | T6816 | arg1Of | pEGFP-C2,( |
R5853 | T6817 | T6818 | arg1Of | Clontech,"," |
R5854 | T6818 | T6820 | arg1Of | ",","," |
R5855 | T6819 | T6818 | arg2Of | Saint-Germain-en-Laye,"," |
R5856 | T6820 | T6816 | arg2Of | ",",( |
R5857 | T6821 | T6820 | arg2Of | France,"," |
R5858 | T6822 | T6816 | arg3Of | ),( |
R5859 | T6824 | T6807 | modOf | digested,was |
R5860 | T6824 | T6823 | arg2Of | digested,was |
R5861 | T6824 | T6825 | arg1Of | digested,with |
R5862 | T6826 | T6825 | arg2Of | BamHI,with |
R5863 | T6827 | T6828 | arg1Of | DNA,was |
R5864 | T6827 | T6829 | arg2Of | DNA,recovered |
R5865 | T6829 | T6828 | arg2Of | recovered,was |
R5866 | T6832 | T6831 | arg1Of | extraction,phenol |
R5867 | T6832 | T6833 | arg1Of | extraction,and |
R5868 | T6833 | T6829 | arg1Of | and,recovered |
R5869 | T6833 | T6830 | arg2Of | and,by |
R5870 | T6835 | T6833 | arg2Of | precipitation,and |
R5871 | T6835 | T6834 | arg1Of | precipitation,ethanol |
R5872 | T6837 | T6836 | arg1Of | and,"," |
R5873 | T6841 | T6839 | arg1Of | fragment,the |
R5874 | T6841 | T6840 | arg1Of | fragment,GATA-3 |
R5875 | T6841 | T6842 | arg1Of | fragment,and |
R5876 | T6842 | T6838 | arg1Of | and,both |
R5877 | T6845 | T6842 | arg2Of | vector,and |
R5878 | T6845 | T6843 | arg1Of | vector,the |
R5879 | T6845 | T6844 | arg1Of | vector,pEGFP-C2 |
R5880 | T6845 | T6846 | arg1Of | vector,blunt-ended |
R5881 | T6848 | T6847 | arg2Of | incubation,by |
R5882 | T6850 | T6849 | arg2Of | Klenow,with |
R5883 | T6852 | T6851 | arg2Of | Bioline,( |
R5884 | T6852 | T6853 | arg1Of | Bioline,Bio-27029 |
R5885 | T6854 | T6851 | arg3Of | ),( |
R5886 | T6857 | T6855 | arg2Of | min,for |
R5887 | T6857 | T6856 | arg1Of | min,30 |
R5888 | T6860 | T6859 | arg1Of | Klenow,37°C. |
R5889 | T6860 | T6861 | arg1Of | Klenow,was |
R5890 | T6860 | T6862 | arg2Of | Klenow,inactivated |
R5891 | T6862 | T6861 | arg2Of | inactivated,was |
R5892 | T6862 | T6863 | arg1Of | inactivated,by |
R5893 | T6864 | T6863 | arg2Of | incubation,by |
R5894 | T6864 | T6865 | arg1Of | incubation,for |
R5895 | T6867 | T6865 | arg2Of | min,for |
R5896 | T6867 | T6866 | arg1Of | min,10 |
R5897 | T6867 | T6868 | arg1Of | min,at |
R5898 | T6870 | T6868 | arg2Of | DNA,at |
R5899 | T6870 | T6869 | arg1Of | DNA,75°C. |
R5900 | T6872 | T6871 | arg2Of | recovered,was |
R5901 | T6875 | T6874 | arg1Of | extraction,phenol |
R5902 | T6875 | T6876 | arg1Of | extraction,and |
R5903 | T6876 | T6872 | arg1Of | and,recovered |
R5904 | T6876 | T6873 | arg2Of | and,by |
R5905 | T6878 | T6876 | arg2Of | precipitation,and |
R5906 | T6878 | T6877 | arg1Of | precipitation,ethanol |
R5907 | T6880 | T6879 | arg1Of | and,"," |
R5908 | T6885 | T6882 | arg1Of | fragment,the |
R5909 | T6885 | T6883 | arg1Of | fragment,blunt-ended |
R5910 | T6885 | T6884 | arg1Of | fragment,GATA-3 |
R5911 | T6885 | T6886 | arg1Of | fragment,and |
R5912 | T6886 | T6881 | arg1Of | and,both |
R5913 | T6886 | T6890 | arg1Of | and,were |
R5914 | T6886 | T6892 | arg2Of | and,digested |
R5915 | T6889 | T6886 | arg2Of | vector,and |
R5916 | T6889 | T6887 | arg1Of | vector,the |
R5917 | T6889 | T6888 | arg1Of | vector,GFP |
R5918 | T6892 | T6880 | arg2Of | digested,and |
R5919 | T6892 | T6890 | arg2Of | digested,were |
R5920 | T6892 | T6891 | arg1Of | digested,subsequently |
R5921 | T6892 | T6893 | arg1Of | digested,with |
R5922 | T6892 | T6895 | arg1Of | digested,before |
R5923 | T6894 | T6893 | arg2Of | EcoRI,with |
R5924 | T6900 | T6896 | arg1Of | fragment,the |
R5925 | T6900 | T6897 | arg1Of | fragment,5′-EcoRI/3′–blunt |
R5926 | T6900 | T6898 | arg1Of | fragment,end |
R5927 | T6900 | T6899 | arg1Of | fragment,GATA-3 |
R5928 | T6900 | T6901 | arg1Of | fragment,was |
R5929 | T6900 | T6902 | arg2Of | fragment,inserted |
R5930 | T6902 | T6895 | arg2Of | inserted,before |
R5931 | T6902 | T6901 | arg2Of | inserted,was |
R5932 | T6902 | T6903 | arg1Of | inserted,into |
R5933 | T6906 | T6905 | arg1Of | ended,5′-EcoRI/3′–blunt |
R5934 | T6908 | T6903 | arg2Of | vector,into |
R5935 | T6908 | T6904 | arg1Of | vector,the |
R5936 | T6908 | T6906 | arg1Of | vector,ended |
R5937 | T6908 | T6907 | arg1Of | vector,GFP |
R5938 | T6910 | T6909 | arg1Of | clones,Positive |
R5939 | T6910 | T6911 | arg1Of | clones,were |
R5940 | T6910 | T6912 | arg2Of | clones,confirmed |
R5941 | T6912 | T6911 | arg2Of | confirmed,were |
R5942 | T6912 | T6918 | arg1Of | confirmed,by |
R5943 | T6912 | T6925 | arg1Of | confirmed,by |
R5944 | T6914 | T6915 | arg1Of | digestion,and |
R5945 | T6916 | T6915 | arg2Of | size,and |
R5946 | T6917 | T6912 | arg1Of | analysis,confirmed |
R5947 | T6917 | T6913 | arg2Of | analysis,by |
R5948 | T6917 | T6914 | arg1Of | analysis,digestion |
R5949 | T6917 | T6916 | arg1Of | analysis,size |
R5950 | T6918 | T6924 | arg1Of | by,and |
R5951 | T6919 | T6920 | arg1Of | 1,% |
R5952 | T6923 | T6918 | arg2Of | electrophoresis,by |
R5953 | T6923 | T6919 | arg1Of | electrophoresis,1 |
R5954 | T6923 | T6921 | arg1Of | electrophoresis,agarose |
R5955 | T6923 | T6922 | arg1Of | electrophoresis,gel |
R5956 | T6925 | T6924 | arg2Of | by,and |
R5957 | T6926 | T6925 | arg2Of | sequencing,by |
R6131 | T7174 | T7173 | arg1Of | cells,HuT-78 |
R6132 | T7174 | T7175 | arg1Of | cells,were |
R6133 | T7174 | T7176 | arg2Of | cells,transfected |
R6134 | T7176 | T7175 | arg2Of | transfected,were |
R6135 | T7176 | T7177 | arg1Of | transfected,with |
R6136 | T7179 | T7180 | arg1Of | EP8,or |
R6137 | T7180 | T7177 | arg2Of | or,with |
R6138 | T7180 | T7178 | arg1Of | or,either |
R6139 | T7182 | T7180 | arg2Of | vector,or |
R6140 | T7182 | T7181 | arg1Of | vector,GFP |
R6141 | T7184 | T7183 | arg1Of | DNA,only |
R6142 | T7184 | T7185 | arg1Of | DNA,using |
R6143 | T7184 | T7197 | arg1Of | DNA,µg |
R6144 | T7187 | T7185 | arg2Of | R,using |
R6145 | T7187 | T7186 | arg1Of | R,solution |
R6146 | T7187 | T7188 | arg1Of | R,"," |
R6147 | T7190 | T7188 | arg2Of | V-001,"," |
R6148 | T7190 | T7189 | arg1Of | V-001,programme |
R6149 | T7190 | T7191 | arg1Of | V-001,at |
R6150 | T7193 | T7191 | arg2Of | ratio,at |
R6151 | T7193 | T7192 | arg1Of | ratio,a |
R6152 | T7193 | T7194 | arg1Of | ratio,of |
R6153 | T7196 | T7194 | arg2Of | cells/4,of |
R6154 | T7196 | T7195 | arg1Of | cells/4,3×106 |
R6155 | T7197 | T7175 | modOf | µg,were |
R6156 | T7197 | T7199 | arg1Of | µg,for |
R6157 | T7197 | T7202 | arg1Of | µg,in |
R6158 | T7197 | T7214 | arg1Of | µg,according |
R6159 | T7198 | T7197 | arg2Of | DNA,µg |
R6160 | T7201 | T7199 | arg2Of | h,for |
R6161 | T7201 | T7200 | arg1Of | h,7–8 |
R6162 | T7204 | T7202 | arg2Of | medium,in |
R6163 | T7204 | T7203 | arg1Of | medium,complete |
R6164 | T7204 | T7205 | arg1Of | medium,( |
R6165 | T7206 | T7207 | arg1Of | 10,% |
R6166 | T7209 | T7205 | arg2Of | serum,( |
R6167 | T7209 | T7206 | arg1Of | serum,10 |
R6168 | T7209 | T7208 | arg1Of | serum,bovine |
R6169 | T7209 | T7210 | arg1Of | serum,in |
R6170 | T7212 | T7210 | arg2Of | L-glutamine,in |
R6171 | T7212 | T7211 | arg1Of | L-glutamine,RPMI1640+15 |
R6172 | T7213 | T7205 | arg3Of | ),( |
R6173 | T7215 | T7214 | arg2Of | to,according |
R6174 | T7219 | T7215 | arg2Of | protocol,to |
R6175 | T7219 | T7216 | arg1Of | protocol,the |
R6176 | T7219 | T7217 | arg1Of | protocol,general |
R6177 | T7219 | T7218 | arg1Of | protocol,Amaxa |
R6178 | T7219 | T7220 | arg1Of | protocol,for |
R6179 | T7221 | T7220 | arg2Of | nucleofection,for |
R6180 | T7223 | T7222 | arg1Of | medium,The |
R6181 | T7223 | T7224 | arg1Of | medium,was |
R6182 | T7223 | T7226 | arg2Of | medium,changed |
R6183 | T7226 | T7224 | arg2Of | changed,was |
R6184 | T7226 | T7225 | arg1Of | changed,subsequently |
R6185 | T7226 | T7227 | arg1Of | changed,to |
R6186 | T7226 | T7231 | arg1Of | changed,for |
R6187 | T7228 | T7229 | arg1Of | 1,% |
R6188 | T7230 | T7227 | arg2Of | RPMI,to |
R6189 | T7230 | T7228 | arg1Of | RPMI,1 |
R6190 | T7233 | T7232 | arg1Of | h,24 |
R6191 | T7233 | T7234 | arg1Of | h,before |
R6192 | T7233 | T7243 | arg1Of | h,and |
R6193 | T7236 | T7235 | arg2Of | cells,transfected |
R6194 | T7236 | T7237 | arg1Of | cells,were |
R6195 | T7236 | T7238 | arg2Of | cells,added |
R6196 | T7238 | T7234 | arg2Of | added,before |
R6197 | T7238 | T7237 | arg2Of | added,were |
R6198 | T7238 | T7239 | arg1Of | added,to |
R6199 | T7242 | T7239 | arg2Of | wells,to |
R6200 | T7242 | T7240 | arg1Of | wells,anti-CD3/CD28 |
R6201 | T7242 | T7241 | arg2Of | wells,treated |
R6202 | T7243 | T7231 | arg2Of | and,for |
R6203 | T7246 | T7243 | arg2Of | videomicroscopy,and |
R6204 | T7246 | T7244 | arg1Of | videomicroscopy,live |
R6205 | T7246 | T7245 | arg1Of | videomicroscopy,cell |
R6206 | T7246 | T7247 | arg2Of | videomicroscopy,performed |
R6294 | T7358 | T7357 | arg1Of | Microscopy,Time-Lapse |
R6295 | T7360 | T7359 | arg1Of | cells,HuT-78 |
R6296 | T7360 | T7361 | arg1Of | cells,expressing |
R6297 | T7360 | T7363 | arg1Of | cells,were |
R6298 | T7360 | T7364 | arg2Of | cells,maintained |
R6299 | T7362 | T7361 | arg2Of | GATA-3-GFP,expressing |
R6300 | T7364 | T7363 | arg2Of | maintained,were |
R6301 | T7364 | T7365 | arg1Of | maintained,at |
R6302 | T7364 | T7367 | arg1Of | maintained,in |
R6303 | T7366 | T7365 | arg2Of | 37°C,at |
R6304 | T7369 | T7367 | arg2Of | medium,in |
R6305 | T7369 | T7368 | arg1Of | medium,growth |
R6306 | T7369 | T7370 | arg1Of | medium,in |
R6307 | T7369 | T7376 | arg1Of | medium,( |
R6308 | T7369 | T7385 | arg2Of | medium,combined |
R6309 | T7375 | T7370 | arg2Of | chamber,in |
R6310 | T7375 | T7371 | arg1Of | chamber,a |
R6311 | T7375 | T7372 | arg1Of | chamber,closed |
R6312 | T7375 | T7373 | arg1Of | chamber,FCS2 |
R6313 | T7375 | T7374 | arg1Of | chamber,perfusion |
R6314 | T7377 | T7378 | arg1Of | Bioptechs,"," |
R6315 | T7378 | T7380 | arg1Of | ",","," |
R6316 | T7379 | T7378 | arg2Of | Butler,"," |
R6317 | T7380 | T7376 | arg2Of | ",",( |
R6318 | T7380 | T7382 | arg1Of | ",","," |
R6319 | T7380 | T7383 | arg1Of | ",",USA |
R6320 | T7381 | T7380 | arg2Of | Pennsylvania,"," |
R6321 | T7384 | T7376 | arg3Of | ),( |
R6322 | T7385 | T7386 | arg1Of | combined,with |
R6323 | T7385 | T7393 | arg1Of | combined,on |
R6324 | T7385 | T7401 | arg1Of | combined,( |
R6325 | T7389 | T7386 | arg2Of | heater,with |
R6326 | T7389 | T7387 | arg1Of | heater,an |
R6327 | T7389 | T7388 | arg1Of | heater,objective |
R6328 | T7389 | T7390 | arg1Of | heater,( |
R6329 | T7391 | T7390 | arg2Of | Bioptechs,( |
R6330 | T7392 | T7390 | arg3Of | ),( |
R6331 | T7395 | T7393 | arg2Of | stage,on |
R6332 | T7395 | T7394 | arg1Of | stage,the |
R6333 | T7398 | T7397 | arg1Of | Axiovert,Zeiss |
R6334 | T7398 | T7399 | arg1Of | Axiovert,200 |
R6335 | T7400 | T7393 | arg3Of | microscope,on |
R6336 | T7400 | T7396 | arg1Of | microscope,a |
R6337 | T7400 | T7398 | arg1Of | microscope,Axiovert |
R6338 | T7402 | T7401 | arg2Of | Thornwood,( |
R6339 | T7402 | T7403 | arg1Of | Thornwood,"," |
R6340 | T7405 | T7403 | arg2Of | York,"," |
R6341 | T7405 | T7404 | arg1Of | York,New |
R6342 | T7405 | T7406 | arg1Of | York,"," |
R6343 | T7407 | T7406 | arg2Of | USA,"," |
R6344 | T7408 | T7401 | arg3Of | ),( |
R6345 | T7409 | T7410 | arg1Of | Observations,were |
R6346 | T7409 | T7411 | arg2Of | Observations,made |
R6347 | T7411 | T7410 | arg2Of | made,were |
R6348 | T7411 | T7419 | arg1Of | made,and |
R6349 | T7417 | T7411 | arg1Of | lens,made |
R6350 | T7417 | T7412 | arg2Of | lens,by |
R6351 | T7417 | T7413 | arg1Of | lens,40×1.0 |
R6352 | T7417 | T7414 | arg1Of | lens,NA |
R6353 | T7417 | T7415 | arg1Of | lens,oil-immersion |
R6354 | T7417 | T7416 | arg1Of | lens,objective |
R6355 | T7419 | T7418 | arg1Of | and,"," |
R6356 | T7420 | T7421 | arg1Of | fluorescence,and |
R6357 | T7422 | T7421 | arg2Of | phase,and |
R6358 | T7424 | T7420 | arg1Of | images,fluorescence |
R6359 | T7424 | T7422 | arg1Of | images,phase |
R6360 | T7424 | T7423 | arg1Of | images,contrast |
R6361 | T7424 | T7425 | arg1Of | images,were |
R6362 | T7424 | T7426 | arg2Of | images,gathered |
R6363 | T7426 | T7419 | arg2Of | gathered,and |
R6364 | T7426 | T7425 | arg2Of | gathered,were |
R6365 | T7426 | T7427 | modOf | gathered,using |
R6366 | T7427 | T7431 | arg2Of | using,charged |
R6367 | T7430 | T7428 | arg1Of | ORCA-ER,a |
R6368 | T7430 | T7429 | arg1Of | ORCA-ER,Hamamatsu |
R6369 | T7430 | T7431 | arg1Of | ORCA-ER,charged |
R6370 | T7434 | T7427 | arg2Of | camera,using |
R6371 | T7434 | T7432 | arg2Of | camera,coupled |
R6372 | T7434 | T7433 | arg1Of | camera,device |
R6373 | T7434 | T7435 | arg1Of | camera,( |
R6374 | T7434 | T7443 | arg2Of | camera,driven |
R6375 | T7436 | T7435 | arg2Of | Bridgewater,( |
R6376 | T7436 | T7437 | arg1Of | Bridgewater,"," |
R6377 | T7439 | T7437 | arg2Of | Jersey,"," |
R6378 | T7439 | T7438 | arg1Of | Jersey,New |
R6379 | T7439 | T7440 | arg1Of | Jersey,"," |
R6380 | T7441 | T7440 | arg2Of | USA,"," |
R6381 | T7442 | T7435 | arg3Of | ),( |
R6382 | T7443 | T7447 | arg1Of | driven,( |
R6383 | T7446 | T7443 | arg1Of | software,driven |
R6384 | T7446 | T7444 | arg2Of | software,by |
R6385 | T7446 | T7445 | arg1Of | software,Openlab |
R6386 | T7448 | T7449 | arg1Of | Improvision,"," |
R6387 | T7449 | T7447 | arg2Of | ",",( |
R6388 | T7449 | T7451 | arg1Of | ",","," |
R6389 | T7450 | T7449 | arg2Of | Coventry,"," |
R6390 | T7452 | T7451 | arg2Of | UK,"," |
R6391 | T7453 | T7447 | arg3Of | ),( |
R6392 | T7454 | T7455 | arg1Of | Photographs,were |
R6393 | T7454 | T7456 | arg2Of | Photographs,taken |
R6394 | T7456 | T7455 | arg2Of | taken,were |
R6395 | T7456 | T7457 | arg1Of | taken,at |
R6396 | T7458 | T7459 | arg1Of | 0,"," |
R6397 | T7459 | T7461 | arg1Of | ",","," |
R6398 | T7460 | T7459 | arg2Of | 30,"," |
R6399 | T7461 | T7463 | arg1Of | ",","," |
R6400 | T7462 | T7461 | arg2Of | 60,"," |
R6401 | T7463 | T7466 | arg1Of | ",",and |
R6402 | T7464 | T7463 | arg2Of | 120,"," |
R6403 | T7466 | T7465 | arg1Of | and,"," |
R6404 | T7467 | T7466 | arg2Of | 240,and |
R6405 | T7468 | T7457 | arg2Of | min,at |
R6406 | T7468 | T7458 | arg1Of | min,0 |
R6407 | T7468 | T7460 | arg1Of | min,30 |
R6408 | T7468 | T7462 | arg1Of | min,60 |
R6409 | T7468 | T7464 | arg1Of | min,120 |
R6410 | T7468 | T7467 | arg1Of | min,240 |
R6533 | T7612 | T7611 | arg1Of | Analysis,Densitometric |
R6534 | T7613 | T7614 | arg1Of | Densitometry,of |
R6535 | T7613 | T7617 | arg1Of | Densitometry,was |
R6536 | T7613 | T7618 | arg2Of | Densitometry,performed |
R6537 | T7616 | T7614 | arg2Of | immunoblots,of |
R6538 | T7616 | T7615 | arg1Of | immunoblots,ECL |
R6539 | T7618 | T7617 | arg2Of | performed,was |
R6540 | T7619 | T7618 | arg3Of | using,performed |
R6541 | T7621 | T7620 | arg1Of | ID,Gelworks |
R6542 | T7623 | T7619 | arg2Of | software,using |
R6543 | T7623 | T7621 | arg1Of | software,ID |
R6544 | T7623 | T7622 | arg1Of | software,intermediate |
R6545 | T7623 | T7624 | arg1Of | software,( |
R6546 | T7626 | T7624 | arg2Of | Products,( |
R6547 | T7626 | T7625 | arg1Of | Products,Ultraviolet |
R6548 | T7626 | T7627 | arg1Of | Products,"," |
R6549 | T7628 | T7627 | arg2Of | Cambridgeshire,"," |
R6550 | T7628 | T7629 | arg1Of | Cambridgeshire,"," |
R6551 | T7630 | T7629 | arg2Of | UK,"," |
R6552 | T7631 | T7624 | arg3Of | ),( |
R6553 | T7634 | T7635 | arg1Of | immunoblots,were |
R6554 | T7634 | T7636 | arg2Of | immunoblots,scanned |
R6555 | T7636 | T7635 | arg2Of | scanned,were |
R6556 | T7636 | T7637 | arg1Of | scanned,and |
R6557 | T7637 | T7632 | arg1Of | and,Briefly |
R6558 | T7637 | T7633 | arg1Of | and,"," |
R6559 | T7638 | T7639 | arg1Of | gates,were |
R6560 | T7638 | T7640 | arg2Of | gates,drawn |
R6561 | T7640 | T7637 | arg2Of | drawn,and |
R6562 | T7640 | T7639 | arg2Of | drawn,were |
R6563 | T7640 | T7641 | arg1Of | drawn,tightly |
R6564 | T7640 | T7642 | arg1Of | drawn,around |
R6565 | T7644 | T7642 | arg2Of | band,around |
R6566 | T7644 | T7643 | arg1Of | band,each |
R6567 | T7646 | T7645 | arg1Of | values,Background |
R6568 | T7646 | T7647 | arg1Of | values,from |
R6572 | T7649 | T7647 | arg2Of | lane,from |
R6604 | T7679 | T7686 | arg2Of | films,selected |
R6605 | T7682 | T7680 | arg2Of | levels,generating |
R6606 | T7682 | T7681 | arg1Of | levels,subsaturating |
R6607 | T7682 | T7683 | arg1Of | levels,of |
R6608 | T7684 | T7683 | arg2Of | intensity,of |
R6609 | T7686 | T7677 | arg2Of | selected,and |
R6610 | T7686 | T7685 | arg2Of | selected,were |
R6611 | T7686 | T7687 | arg1Of | selected,for |
R6612 | T7689 | T7687 | arg2Of | evaluation,for |
R6613 | T7689 | T7688 | arg1Of | evaluation,densitometric |
R6698 | T7788 | T7787 | arg1Of | Analysis,Statistical |
R6699 | T7789 | T7790 | arg1Of | Data,from |
R6700 | T7789 | T7796 | arg1Of | Data,are |
R6701 | T7789 | T7797 | arg2Of | Data,presented |
R6702 | T7789 | T7813 | arg1Of | Data,were |
R6703 | T7789 | T7814 | arg2Of | Data,compared |
R6704 | T7789 | T7815 | arg1Of | Data,using |
R6705 | T7791 | T7792 | arg1Of | three,or |
R6706 | T7791 | T7793 | arg1Of | three,more |
R6707 | T7795 | T7790 | arg2Of | experiments,from |
R6708 | T7795 | T7791 | arg1Of | experiments,three |
R6709 | T7795 | T7794 | arg1Of | experiments,independent |
R6710 | T7797 | T7796 | arg2Of | presented,are |
R6711 | T7797 | T7798 | arg1Of | presented,as |
R6712 | T7797 | T7812 | arg1Of | presented,and |
R6713 | T7801 | T7798 | arg2Of | error,as |
R6714 | T7801 | T7799 | arg1Of | error,the |
R6715 | T7801 | T7800 | arg1Of | error,mean±standard |
R6716 | T7801 | T7802 | arg1Of | error,of |
R6717 | T7801 | T7808 | arg1Of | error,"," |
R6718 | T7801 | T7809 | arg1Of | error,except |
R6719 | T7801 | T7811 | arg2Of | error,stated |
R6720 | T7804 | T7802 | arg2Of | mean,of |
R6721 | T7804 | T7803 | arg1Of | mean,the |
R6722 | T7804 | T7805 | arg1Of | mean,( |
R6723 | T7806 | T7805 | arg2Of | SEM,( |
R6724 | T7807 | T7805 | arg3Of | ),( |
R6725 | T7811 | T7810 | arg1Of | stated,where |
R6726 | T7814 | T7812 | arg2Of | compared,and |
R6727 | T7814 | T7813 | arg2Of | compared,were |
R6728 | T7815 | T7814 | arg3Of | using,compared |
R6729 | T7815 | T7821 | arg1Of | using,Software |
R6730 | T7815 | T7825 | arg1Of | using,//www.graphpad.com |
R6731 | T7817 | T7815 | arg2Of | Prism,using |
R6732 | T7817 | T7816 | arg1Of | Prism,GraphPad |
R6733 | T7817 | T7818 | arg1Of | Prism,4 |
R6734 | T7821 | T7820 | arg1Of | Software,GraphPad |
R6735 | T7821 | T7822 | arg1Of | Software,"," |
R6736 | T7822 | T7819 | arg1Of | ",",( |
R6737 | T7822 | T7826 | arg1Of | ",",) |
R6738 | T7823 | T7824 | arg1Of | http,: |
R6739 | T7825 | T7822 | arg2Of | //www.graphpad.com,"," |
R6740 | T7825 | T7823 | arg1Of | //www.graphpad.com,http |
R6741 | T7827 | T7828 | arg1Of | Results,were |
R6742 | T7827 | T7829 | arg2Of | Results,analysed |
R6743 | T7829 | T7828 | arg2Of | analysed,were |
R6744 | T7829 | T7830 | modOf | analysed,using |
R6745 | T7830 | T7833 | arg1Of | using,with |
R6746 | T7832 | T7830 | arg2Of | ANOVA,using |
R6747 | T7832 | T7831 | arg1Of | ANOVA,one-way |
R6748 | T7834 | T7833 | arg2Of | Newman-Keuls,with |
R6749 | T7836 | T7835 | arg1Of | test,post |
R6750 | T7836 | T7837 | arg1Of | test,except |
R6751 | T7836 | T7859 | arg2Of | test,matched |
R6752 | T7836 | T7861 | arg2Of | test,signed |
R6753 | T7837 | T7838 | arg1Of | except,for |
R6754 | T7840 | T7839 | arg1Of | data,the |
R6755 | T7840 | T7841 | arg1Of | data,from |
R6756 | T7840 | T7859 | arg1Of | data,matched |
R6757 | T7844 | T7843 | arg1Of | vivo,in |
R6758 | T7845 | T7844 | arg1Of | inhaled,vivo |
R6759 | T7847 | T7841 | arg2Of | study,from |
R6760 | T7847 | T7842 | arg1Of | study,the |
R6761 | T7847 | T7845 | arg1Of | study,inhaled |
R6762 | T7847 | T7846 | arg1Of | study,FP |
R6763 | T7847 | T7848 | arg1Of | study,"," |
R6764 | T7847 | T7849 | arg1Of | study,which |
R6765 | T7847 | T7850 | arg1Of | study,was |
R6766 | T7847 | T7851 | arg2Of | study,analysed |
R6767 | T7851 | T7850 | arg2Of | analysed,was |
R6768 | T7853 | T7854 | arg2Of | Friedman,'s |
R6769 | T7855 | T7851 | arg1Of | test,analysed |
R6770 | T7855 | T7852 | arg2Of | test,by |
R6771 | T7855 | T7854 | arg1Of | test,'s |
R6772 | T7855 | T7856 | arg1Of | test,with |
R6773 | T7858 | T7856 | arg2Of | Wilcoxson,with |
R6774 | T7858 | T7857 | arg1Of | Wilcoxson,subsequent |
R6775 | T7860 | T7861 | arg1Of | pair,signed |
R6776 | T7861 | T7828 | modOf | signed,were |
R6777 | T7864 | T7861 | arg3Of | test,signed |
R6778 | T7864 | T7862 | arg1Of | test,rank |
R6779 | T7864 | T7863 | arg1Of | test,sum |
R6780 | T7865 | T7866 | arg1Of | Data,from |
R6781 | T7865 | T7869 | arg1Of | Data,are |
R6782 | T7865 | T7870 | arg2Of | Data,presented |
R6783 | T7868 | T7866 | arg2Of | analysis,from |
R6784 | T7868 | T7867 | arg1Of | analysis,this |
R6785 | T7870 | T7869 | arg2Of | presented,are |
R6786 | T7870 | T7871 | arg1Of | presented,as |
R6787 | T7874 | T7871 | arg2Of | plot,as |
R6788 | T7874 | T7872 | arg1Of | plot,a |
R6789 | T7874 | T7873 | arg1Of | plot,box-and-whiskers |
R6790 | T7875 | T7876 | arg2Of | Friedman,'s |
R6791 | T7877 | T7876 | arg1Of | test,'s |
R6792 | T7877 | T7878 | arg1Of | test,was |
R6793 | T7877 | T7879 | arg2Of | test,used |
R6794 | T7879 | T7878 | arg2Of | used,was |
R6795 | T7879 | T7880 | arg1Of | used,as |
R6796 | T7883 | T7881 | arg1Of | measures,three |
R6797 | T7883 | T7882 | arg1Of | measures,matched |
R6798 | T7883 | T7884 | arg1Of | measures,were |
R6799 | T7883 | T7885 | arg2Of | measures,obtained |
R6800 | T7883 | T7886 | arg1Of | measures,using |
R6801 | T7885 | T7880 | arg2Of | obtained,as |
R6802 | T7885 | T7884 | arg2Of | obtained,were |
R6803 | T7886 | T7885 | arg3Of | using,obtained |
R6804 | T7887 | T7888 | arg1Of | placebo,"," |
R6805 | T7888 | T7892 | arg1Of | ",",and |
R6806 | T7890 | T7888 | arg2Of | µg,"," |
R6807 | T7890 | T7889 | arg1Of | µg,100 |
R6808 | T7892 | T7886 | arg2Of | and,using |
R6809 | T7892 | T7891 | arg1Of | and,"," |
R6810 | T7894 | T7892 | arg2Of | µg,and |
R6811 | T7894 | T7893 | arg1Of | µg,500 |
R6812 | T7894 | T7895 | arg1Of | µg,of |
R6813 | T7894 | T7898 | arg1Of | µg,"," |
R6814 | T7894 | T7899 | arg1Of | µg,which |
R6815 | T7894 | T7900 | arg1Of | µg,had |
R6816 | T7897 | T7895 | arg2Of | FP,of |
R6817 | T7897 | T7896 | arg2Of | FP,inhaled |
R6818 | T7903 | T7900 | arg2Of | levels,had |
R6819 | T7903 | T7901 | arg1Of | levels,variable |
R6820 | T7903 | T7902 | arg1Of | levels,baseline |
R6821 | T7904 | T7905 | arg1Of | We,did |
R6822 | T7904 | T7907 | arg1Of | We,assume |
R6823 | T7907 | T7905 | arg2Of | assume,did |
R6824 | T7907 | T7906 | arg1Of | assume,not |
R6825 | T7910 | T7907 | arg2Of | distribution,assume |
R6826 | T7910 | T7908 | arg1Of | distribution,a |
R6827 | T7910 | T7909 | arg1Of | distribution,Gaussian |
R6828 | T7910 | T7911 | arg1Of | distribution,of |
R6829 | T7910 | T7922 | arg1Of | distribution,( |
R6830 | T7913 | T7911 | arg2Of | data,of |
R6831 | T7913 | T7912 | arg1Of | data,the |
R6832 | T7913 | T7914 | arg1Of | data,due |
R6833 | T7914 | T7915 | arg1Of | due,to |
R6834 | T7918 | T7915 | arg2Of | numbers,to |
R6835 | T7918 | T7916 | arg1Of | numbers,the |
R6836 | T7918 | T7917 | arg1Of | numbers,limited |
R6837 | T7918 | T7919 | arg1Of | numbers,of |
R6838 | T7920 | T7919 | arg2Of | participants,of |
R6839 | T7920 | T7921 | arg2Of | participants,analysed |
R6840 | T7923 | T7922 | arg2Of | seven,( |
R6841 | T7924 | T7922 | arg3Of | ),( |
R6842 | T7927 | T7925 | arg1Of | hypothesis,.The |
R6843 | T7927 | T7926 | arg1Of | hypothesis,null |
R6844 | T7927 | T7928 | arg1Of | hypothesis,was |
R6845 | T7927 | T7929 | arg2Of | hypothesis,rejected |
R6846 | T7929 | T7907 | arg3Of | rejected,assume |
R6847 | T7929 | T7928 | arg2Of | rejected,was |
R6848 | T7929 | T7930 | arg1Of | rejected,at |
R6849 | T7933 | T7930 | arg2Of | 0.05,at |
R6850 | T7933 | T7931 | arg1Of | 0.05,p |
R6851 | T7933 | T7932 | arg1Of | 0.05,< |
R3974 | T4628 | T4629 | modOf | extracted,using |
R3976 | T4631 | T4629 | arg2Of | buffer,using |
R3977 | T4631 | T4630 | arg1Of | buffer,lysis |
R3978 | T4631 | T4632 | arg1Of | buffer,( |
R6569 | T7646 | T7650 | arg1Of | values,were |
R6570 | T7646 | T7651 | arg2Of | values,subtracted |
R6571 | T7646 | T7653 | arg1Of | values,normalize |
R6573 | T7649 | T7648 | arg1Of | lane,each |
R6574 | T7651 | T7650 | arg2Of | subtracted,were |
R6575 | T7653 | T7651 | arg3Of | normalize,subtracted |
R6576 | T7653 | T7652 | arg1Of | normalize,to |
R6577 | T7655 | T7653 | arg2Of | measurement,normalize |
R6578 | T7655 | T7654 | arg1Of | measurement,each |
R6579 | T7657 | T7656 | arg1Of | bands,The |
R6580 | T7657 | T7658 | arg1Of | bands,were |
R6581 | T7657 | T7659 | arg2Of | bands,quantified |
R6582 | T7659 | T7658 | arg2Of | quantified,were |
R6583 | T7660 | T7659 | arg3Of | using,quantified |
R6584 | T7663 | T7660 | arg2Of | software,using |
R6585 | T7663 | T7661 | arg1Of | software,the |
R6586 | T7663 | T7662 | arg1Of | software,Gelworks |
R6587 | T7666 | T7664 | arg1Of | blots,All |
R6588 | T7666 | T7665 | arg1Of | blots,Western |
R6589 | T7666 | T7667 | arg1Of | blots,were |
R6590 | T7666 | T7668 | arg2Of | blots,exposed |
R6591 | T7668 | T7667 | arg2Of | exposed,were |
R6592 | T7668 | T7669 | modOf | exposed,to |
R6593 | T7668 | T7677 | arg1Of | exposed,and |
R6594 | T7670 | T7669 | arg1Of | film,to |
R6595 | T7670 | T7671 | arg1Of | film,for |
R6596 | T7673 | T7671 | arg2Of | lengths,for |
R6597 | T7673 | T7672 | arg1Of | lengths,varying |
R6598 | T7673 | T7674 | arg1Of | lengths,of |
R6599 | T7675 | T7674 | arg2Of | time,of |
R6600 | T7677 | T7676 | arg1Of | and,"," |
R6601 | T7679 | T7678 | arg1Of | films,only |
R6602 | T7679 | T7680 | arg1Of | films,generating |
R6603 | T7679 | T7685 | arg1Of | films,were |
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T3810 | 23-35 | NNS | denotes | Participants |
T3811 | 36-39 | CC | denotes | and |
T3812 | 40-45 | NNP | denotes | Study |
T3813 | 46-52 | NNP | denotes | Design |
T3814 | 53-55 | PRP | denotes | We |
T3815 | 56-63 | VBD | denotes | studied |
T3816 | 64-72 | NNS | denotes | patients |
T3817 | 73-77 | IN | denotes | with |
T3818 | 78-82 | JJ | denotes | mild |
T3819 | 83-89 | NN | denotes | asthma |
T3820 | 90-93 | WP | denotes | who |
T3821 | 94-98 | VBD | denotes | were |
T3822 | 99-102 | RB | denotes | not |
T3823 | 103-110 | VBN | denotes | treated |
T3824 | 111-115 | IN | denotes | with |
T3825 | 116-123 | JJ | denotes | inhaled |
T3826 | 124-139 | NNS | denotes | corticosteroids |
T3827 | 140-143 | WP | denotes | who |
T3828 | 144-147 | VBD | denotes | had |
T3829 | 148-152 | VBN | denotes | been |
T3830 | 153-161 | VBN | denotes | included |
T3831 | 162-164 | IN | denotes | in |
T3832 | 165-166 | DT | denotes | a |
T3833 | 167-177 | RB | denotes | previously |
T3834 | 178-186 | VBN | denotes | reported |
T3835 | 187-199 | NN | denotes | double-blind |
T3836 | 199-200 | , | denotes | , |
T3837 | 201-219 | JJ | denotes | placebo-controlled |
T3838 | 219-220 | , | denotes | , |
T3839 | 221-230 | JJ | denotes | crossover |
T3840 | 231-236 | NN | denotes | study |
T3841 | 237-241 | IN | denotes | with |
T3842 | 242-244 | NNP | denotes | FP |
T3843 | 245-246 | NNP | denotes | [ |
T3844 | 246-248 | CD | denotes | 34 |
T3845 | 248-249 | NNP | denotes | ] |
T3846 | 249-250 | . | denotes | . |
T3847 | 251-256 | CD | denotes | Seven |
T3848 | 257-265 | NNS | denotes | patients |
T3849 | 266-270 | IN | denotes | with |
T3850 | 271-275 | JJ | denotes | mild |
T3851 | 276-282 | NN | denotes | asthma |
T3852 | 283-290 | VBD | denotes | entered |
T3853 | 291-294 | DT | denotes | the |
T3854 | 295-300 | NN | denotes | study |
T3855 | 301-304 | CC | denotes | and |
T3856 | 305-309 | VBD | denotes | were |
T3857 | 310-320 | VBN | denotes | randomized |
T3858 | 321-323 | TO | denotes | to |
T3859 | 324-331 | VB | denotes | receive |
T3860 | 332-333 | DT | denotes | a |
T3861 | 334-340 | JJ | denotes | single |
T3862 | 341-351 | NN | denotes | inhalation |
T3863 | 352-354 | IN | denotes | of |
T3864 | 355-357 | NNP | denotes | FP |
T3865 | 358-359 | -LRB- | denotes | ( |
T3866 | 359-362 | CD | denotes | 100 |
T3867 | 363-366 | CC | denotes | and |
T3868 | 367-370 | CD | denotes | 500 |
T3869 | 371-373 | NN | denotes | µg |
T3870 | 373-374 | -RRB- | denotes | ) |
T3871 | 375-377 | CC | denotes | or |
T3872 | 378-379 | DT | denotes | a |
T3873 | 380-387 | VBN | denotes | matched |
T3874 | 388-395 | NN | denotes | placebo |
T3875 | 396-403 | NN | denotes | control |
T3876 | 404-407 | IN | denotes | via |
T3877 | 408-409 | DT | denotes | a |
T3878 | 410-416 | NN | denotes | spacer |
T3879 | 417-424 | NN | denotes | chamber |
T3880 | 424-425 | , | denotes | , |
T3881 | 426-429 | CC | denotes | and |
T3882 | 430-433 | DT | denotes | the |
T3883 | 434-439 | JJ | denotes | other |
T3884 | 440-449 | NN | denotes | treatment |
T3885 | 450-453 | VBD | denotes | was |
T3886 | 454-459 | VBN | denotes | given |
T3887 | 460-465 | IN | denotes | after |
T3888 | 466-467 | DT | denotes | a |
T3889 | 468-476 | JJ | denotes | wash-out |
T3890 | 477-483 | NN | denotes | period |
T3891 | 484-486 | IN | denotes | of |
T3892 | 487-489 | IN | denotes | at |
T3893 | 490-495 | JJS | denotes | least |
T3894 | 496-497 | CD | denotes | 6 |
T3895 | 498-500 | NN | denotes | d. |
T3896 | 501-506 | NNP | denotes | Blood |
T3897 | 507-510 | VBD | denotes | was |
T3898 | 511-516 | VBN | denotes | taken |
T3899 | 517-520 | IN | denotes | for |
T3900 | 521-532 | NN | denotes | preparation |
T3901 | 533-535 | IN | denotes | of |
T3902 | 536-541 | NNS | denotes | PBMCs |
T3903 | 542-544 | IN | denotes | at |
T3904 | 545-546 | CD | denotes | 1 |
T3905 | 547-550 | CC | denotes | and |
T3906 | 551-552 | CD | denotes | 2 |
T3907 | 553-554 | NN | denotes | h |
T3908 | 555-560 | IN | denotes | after |
T3909 | 561-565 | NN | denotes | drug |
T3910 | 566-580 | NN | denotes | administration |
T3911 | 580-581 | . | denotes | . |
T3912 | 582-585 | DT | denotes | All |
T3913 | 586-594 | NNS | denotes | patients |
T3914 | 595-599 | VBD | denotes | gave |
T3915 | 600-608 | VBN | denotes | informed |
T3916 | 609-616 | NN | denotes | consent |
T3917 | 617-620 | CC | denotes | and |
T3918 | 621-624 | DT | denotes | the |
T3919 | 625-630 | NN | denotes | study |
T3920 | 631-634 | VBD | denotes | was |
T3921 | 635-643 | VBN | denotes | approved |
T3922 | 644-646 | IN | denotes | by |
T3923 | 647-650 | DT | denotes | the |
T3924 | 651-657 | NNPS | denotes | Ethics |
T3925 | 658-667 | NNP | denotes | Committee |
T3926 | 668-670 | IN | denotes | of |
T3927 | 671-674 | DT | denotes | the |
T3928 | 675-680 | NNP | denotes | Royal |
T3929 | 681-689 | NNP | denotes | Brompton |
T3930 | 690-693 | CC | denotes | and |
T3931 | 694-703 | NNP | denotes | Harefield |
T3932 | 704-713 | NNPS | denotes | Hospitals |
T3933 | 714-717 | NNP | denotes | NHS |
T3934 | 718-723 | NNP | denotes | Trust |
T3935 | 723-724 | . | denotes | . |
T3936 | 725-728 | DT | denotes | The |
T3937 | 729-737 | JJ | denotes | clinical |
T3938 | 738-743 | NN | denotes | study |
T3939 | 744-747 | VBD | denotes | was |
T3940 | 748-757 | VBN | denotes | conducted |
T3941 | 758-764 | IN | denotes | before |
T3942 | 765-768 | DT | denotes | the |
T3943 | 769-780 | NN | denotes | requirement |
T3944 | 781-784 | IN | denotes | for |
T3945 | 785-793 | NNP | denotes | Clinical |
T3946 | 794-799 | NNP | denotes | Trial |
T3947 | 800-812 | NNP | denotes | Registration |
T3948 | 812-813 | . | denotes | . |
T4142 | 815-825 | NNS | denotes | Antibodies |
T4143 | 826-829 | CC | denotes | and |
T4144 | 830-838 | NNS | denotes | Reagents |
T4145 | 839-842 | DT | denotes | The |
T4146 | 843-853 | JJ | denotes | monoclonal |
T4147 | 854-864 | NNS | denotes | antibodies |
T4148 | 865-872 | IN | denotes | against |
T4149 | 873-878 | JJ | denotes | human |
T4150 | 879-882 | NNP | denotes | CD3 |
T4151 | 882-883 | , | denotes | , |
T4152 | 884-888 | NNP | denotes | CD28 |
T4153 | 888-889 | , | denotes | , |
T4154 | 890-892 | NNP | denotes | GR |
T4155 | 892-893 | , | denotes | , |
T4156 | 894-897 | CC | denotes | and |
T4157 | 898-908 | JJ | denotes | importin-α |
T4158 | 909-913 | VBD | denotes | were |
T4159 | 914-923 | VBN | denotes | purchased |
T4160 | 924-928 | IN | denotes | from |
T4161 | 929-931 | NNP | denotes | BD |
T4162 | 932-943 | NNP | denotes | Biosciences |
T4163 | 944-945 | -LRB- | denotes | ( |
T4164 | 945-951 | NNP | denotes | Oxford |
T4165 | 951-952 | , | denotes | , |
T4166 | 953-959 | NNP | denotes | United |
T4167 | 960-967 | NNP | denotes | Kingdom |
T4168 | 967-968 | -RRB- | denotes | ) |
T4169 | 968-969 | . | denotes | . |
T4170 | 970-976 | NN | denotes | Rabbit |
T4171 | 977-987 | NNS | denotes | antibodies |
T4172 | 988-995 | IN | denotes | against |
T4173 | 996-1001 | JJ | denotes | human |
T4174 | 1002-1008 | NNP | denotes | GATA-3 |
T4175 | 1009-1010 | -LRB- | denotes | ( |
T4176 | 1010-1014 | NNP | denotes | H-48 |
T4177 | 1014-1015 | -RRB- | denotes | ) |
T4178 | 1016-1019 | CC | denotes | and |
T4179 | 1020-1022 | NNP | denotes | GR |
T4180 | 1023-1024 | -LRB- | denotes | ( |
T4181 | 1024-1028 | NNP | denotes | E-20 |
T4182 | 1028-1029 | , | denotes | , |
T4183 | 1030-1037 | JJ | denotes | sc-1003 |
T4184 | 1037-1038 | -RRB- | denotes | ) |
T4185 | 1039-1043 | VBD | denotes | were |
T4186 | 1044-1052 | VBN | denotes | obtained |
T4187 | 1053-1057 | IN | denotes | from |
T4188 | 1058-1063 | NNP | denotes | Santa |
T4189 | 1064-1068 | NNP | denotes | Cruz |
T4190 | 1069-1082 | NNP | denotes | Biotechnology |
T4191 | 1083-1084 | -LRB- | denotes | ( |
T4192 | 1084-1089 | NNP | denotes | Santa |
T4193 | 1090-1094 | NNP | denotes | Cruz |
T4194 | 1094-1095 | , | denotes | , |
T4195 | 1096-1106 | NNP | denotes | California |
T4196 | 1106-1107 | , | denotes | , |
T4197 | 1108-1114 | NNP | denotes | United |
T4198 | 1115-1121 | NNPS | denotes | States |
T4199 | 1121-1122 | -RRB- | denotes | ) |
T4200 | 1122-1123 | , | denotes | , |
T4201 | 1124-1134 | JJ | denotes | polyclonal |
T4202 | 1135-1141 | NN | denotes | rabbit |
T4203 | 1142-1152 | NNS | denotes | antibodies |
T4204 | 1153-1160 | IN | denotes | against |
T4205 | 1161-1172 | JJ | denotes | phospho-p38 |
T4206 | 1173-1176 | NNP | denotes | MAP |
T4207 | 1177-1183 | NN | denotes | kinase |
T4208 | 1184-1187 | CC | denotes | and |
T4209 | 1188-1201 | NN | denotes | phospho-ATF-2 |
T4210 | 1202-1206 | IN | denotes | from |
T4211 | 1207-1211 | NNP | denotes | Cell |
T4212 | 1212-1221 | NNP | denotes | Signaling |
T4213 | 1222-1232 | NNP | denotes | Technology |
T4214 | 1233-1234 | -LRB- | denotes | ( |
T4215 | 1234-1237 | NNP | denotes | New |
T4216 | 1238-1245 | NNP | denotes | England |
T4217 | 1246-1253 | NNPS | denotes | Biolabs |
T4218 | 1253-1254 | , | denotes | , |
T4219 | 1255-1263 | NNP | denotes | Hertford |
T4220 | 1263-1264 | , | denotes | , |
T4221 | 1265-1267 | NNP | denotes | UK |
T4222 | 1267-1268 | -RRB- | denotes | ) |
T4223 | 1268-1269 | , | denotes | , |
T4224 | 1270-1280 | JJ | denotes | monoclonal |
T4225 | 1281-1289 | NN | denotes | antibody |
T4226 | 1290-1297 | IN | denotes | against |
T4227 | 1298-1311 | NN | denotes | phosphoserine |
T4228 | 1312-1313 | -LRB- | denotes | ( |
T4229 | 1313-1318 | JJ | denotes | clone |
T4230 | 1319-1322 | NNP | denotes | 4H4 |
T4231 | 1322-1323 | -RRB- | denotes | ) |
T4232 | 1324-1328 | IN | denotes | from |
T4233 | 1329-1337 | NNP | denotes | Affiniti |
T4234 | 1338-1346 | NNP | denotes | Research |
T4235 | 1347-1355 | NNP | denotes | Products |
T4236 | 1356-1357 | -LRB- | denotes | ( |
T4237 | 1357-1363 | NNP | denotes | Exeter |
T4238 | 1363-1364 | , | denotes | , |
T4239 | 1365-1367 | NNP | denotes | UK |
T4240 | 1367-1368 | -RRB- | denotes | ) |
T4241 | 1368-1369 | , | denotes | , |
T4242 | 1370-1373 | CC | denotes | and |
T4243 | 1374-1384 | NNS | denotes | antibodies |
T4244 | 1385-1392 | IN | denotes | against |
T4245 | 1393-1399 | NN | denotes | rabbit |
T4246 | 1400-1414 | NNP | denotes | IgG-conjugated |
T4247 | 1415-1420 | NNP | denotes | TRITC |
T4248 | 1421-1425 | IN | denotes | from |
T4249 | 1426-1430 | NNP | denotes | Dako |
T4250 | 1431-1441 | NNP | denotes | Cytomation |
T4251 | 1442-1443 | -LRB- | denotes | ( |
T4252 | 1443-1452 | NNP | denotes | Cambridge |
T4253 | 1452-1453 | , | denotes | , |
T4254 | 1454-1456 | NNP | denotes | UK |
T4255 | 1456-1457 | -RRB- | denotes | ) |
T4256 | 1457-1458 | . | denotes | . |
T4257 | 1459-1462 | DT | denotes | The |
T4258 | 1463-1470 | JJ | denotes | anti-GR |
T4259 | 1471-1479 | NN | denotes | antibody |
T4260 | 1480-1481 | -LRB- | denotes | ( |
T4261 | 1481-1486 | NNP | denotes | Clone |
T4262 | 1487-1489 | CD | denotes | 41 |
T4263 | 1489-1490 | -RRB- | denotes | ) |
T4264 | 1491-1495 | IN | denotes | from |
T4265 | 1496-1498 | NNP | denotes | BD |
T4266 | 1499-1511 | NNP | denotes | Transduction |
T4267 | 1512-1524 | NNP | denotes | Laboratories |
T4268 | 1525-1526 | -LRB- | denotes | ( |
T4269 | 1526-1532 | NNP | denotes | Oxford |
T4270 | 1532-1533 | , | denotes | , |
T4271 | 1534-1536 | NNP | denotes | UK |
T4272 | 1536-1537 | -RRB- | denotes | ) |
T4273 | 1538-1541 | VBD | denotes | was |
T4274 | 1542-1546 | VBN | denotes | used |
T4275 | 1547-1550 | IN | denotes | for |
T4276 | 1551-1558 | JJ | denotes | Western |
T4277 | 1559-1563 | NN | denotes | blot |
T4278 | 1564-1572 | NN | denotes | analysis |
T4279 | 1572-1573 | . | denotes | . |
T4280 | 1574-1577 | DT | denotes | All |
T4281 | 1578-1583 | JJ | denotes | other |
T4282 | 1584-1592 | NNS | denotes | reagents |
T4283 | 1593-1597 | VBD | denotes | were |
T4284 | 1598-1607 | VBN | denotes | purchased |
T4285 | 1608-1612 | IN | denotes | from |
T4286 | 1613-1618 | NNP | denotes | Sigma |
T4287 | 1619-1620 | -LRB- | denotes | ( |
T4288 | 1620-1625 | NNP | denotes | Poole |
T4289 | 1625-1626 | , | denotes | , |
T4290 | 1627-1629 | NNP | denotes | UK |
T4291 | 1629-1630 | -RRB- | denotes | ) |
T4292 | 1630-1631 | . | denotes | . |
T4470 | 1633-1637 | NNP | denotes | Cell |
T4471 | 1638-1645 | NNP | denotes | Culture |
T4472 | 1646-1649 | CC | denotes | and |
T4473 | 1650-1654 | NNP | denotes | PBMC |
T4474 | 1655-1664 | NNP | denotes | Isolation |
T4475 | 1665-1666 | NNP | denotes | A |
T4476 | 1667-1672 | JJ | denotes | human |
T4477 | 1673-1674 | NNP | denotes | T |
T4478 | 1675-1679 | NN | denotes | cell |
T4479 | 1680-1684 | NN | denotes | line |
T4480 | 1685-1686 | -LRB- | denotes | ( |
T4481 | 1686-1692 | JJ | denotes | HuT-78 |
T4482 | 1692-1693 | -RRB- | denotes | ) |
T4483 | 1694-1697 | VBD | denotes | was |
T4484 | 1698-1707 | VBN | denotes | purchased |
T4485 | 1708-1712 | IN | denotes | from |
T4486 | 1713-1718 | NNP | denotes | ECACC |
T4487 | 1719-1727 | NNP | denotes | European |
T4488 | 1728-1738 | NNP | denotes | Collection |
T4489 | 1739-1741 | IN | denotes | of |
T4490 | 1742-1746 | NNP | denotes | Cell |
T4491 | 1747-1754 | NNP | denotes | Culture |
T4492 | 1755-1756 | -LRB- | denotes | ( |
T4493 | 1756-1765 | NNP | denotes | Wiltshire |
T4494 | 1765-1766 | , | denotes | , |
T4495 | 1767-1769 | NNP | denotes | UK |
T4496 | 1769-1770 | -RRB- | denotes | ) |
T4497 | 1771-1775 | VBD | denotes | were |
T4498 | 1776-1784 | VBN | denotes | cultured |
T4499 | 1785-1787 | IN | denotes | as |
T4500 | 1788-1798 | RB | denotes | previously |
T4501 | 1799-1808 | VBN | denotes | described |
T4502 | 1809-1810 | NNP | denotes | [ |
T4503 | 1810-1812 | CD | denotes | 12 |
T4504 | 1812-1813 | NNP | denotes | ] |
T4505 | 1813-1814 | . | denotes | . |
T4506 | 1815-1820 | NNS | denotes | PBMCs |
T4507 | 1821-1825 | VBD | denotes | were |
T4508 | 1826-1834 | VBN | denotes | isolated |
T4509 | 1835-1837 | IN | denotes | by |
T4510 | 1838-1845 | NN | denotes | density |
T4511 | 1846-1860 | NN | denotes | centrifugation |
T4512 | 1861-1865 | IN | denotes | over |
T4513 | 1866-1880 | NNP | denotes | Ficoll-Hypaque |
T4514 | 1881-1882 | -LRB- | denotes | ( |
T4515 | 1882-1889 | NN | denotes | density |
T4516 | 1889-1890 | , | denotes | , |
T4517 | 1891-1896 | CD | denotes | 1.077 |
T4518 | 1897-1901 | NN | denotes | g/ml |
T4519 | 1901-1902 | : | denotes | ; |
T4520 | 1903-1911 | NNP | denotes | Amersham |
T4521 | 1912-1923 | NNP | denotes | Biosciences |
T4522 | 1923-1924 | , | denotes | , |
T4523 | 1925-1933 | NNP | denotes | Amersham |
T4524 | 1933-1934 | , | denotes | , |
T4525 | 1935-1937 | NNP | denotes | UK |
T4526 | 1937-1938 | -RRB- | denotes | ) |
T4527 | 1939-1941 | IN | denotes | as |
T4528 | 1942-1952 | RB | denotes | previously |
T4529 | 1953-1962 | VBN | denotes | described |
T4530 | 1963-1964 | NNP | denotes | [ |
T4531 | 1964-1966 | CD | denotes | 34 |
T4532 | 1966-1967 | NNP | denotes | ] |
T4533 | 1967-1968 | . | denotes | . |
T4534 | 1969-1974 | NNS | denotes | Cells |
T4535 | 1975-1979 | VBD | denotes | were |
T4536 | 1980-1990 | VBN | denotes | stimulated |
T4537 | 1991-1995 | IN | denotes | with |
T4538 | 1996-2004 | JJ | denotes | anti-CD3 |
T4539 | 2004-2005 | NN | denotes | / |
T4540 | 2005-2009 | NNP | denotes | CD28 |
T4541 | 2010-2011 | -LRB- | denotes | ( |
T4542 | 2011-2012 | CD | denotes | 1 |
T4543 | 2013-2015 | NN | denotes | µg |
T4544 | 2015-2016 | NN | denotes | / |
T4545 | 2016-2018 | NN | denotes | ml |
T4546 | 2019-2023 | DT | denotes | each |
T4547 | 2023-2024 | -RRB- | denotes | ) |
T4548 | 2025-2028 | IN | denotes | for |
T4549 | 2029-2030 | CD | denotes | 1 |
T4550 | 2031-2032 | NN | denotes | h |
T4551 | 2033-2035 | IN | denotes | at |
T4552 | 2036-2038 | CD | denotes | 37 |
T4553 | 2038-2039 | CD | denotes | ° |
T4554 | 2039-2040 | NNP | denotes | C |
T4555 | 2041-2043 | TO | denotes | to |
T4556 | 2044-2053 | VB | denotes | stimulate |
T4557 | 2054-2057 | JJ | denotes | Th2 |
T4558 | 2058-2066 | NN | denotes | cytokine |
T4559 | 2067-2074 | NN | denotes | release |
T4560 | 2075-2077 | IN | denotes | in |
T4561 | 2078-2081 | DT | denotes | the |
T4562 | 2082-2090 | NN | denotes | presence |
T4563 | 2091-2093 | CC | denotes | or |
T4564 | 2094-2101 | NN | denotes | absence |
T4565 | 2102-2104 | IN | denotes | of |
T4566 | 2105-2107 | NNP | denotes | FP |
T4567 | 2108-2109 | -LRB- | denotes | ( |
T4568 | 2109-2111 | CD | denotes | 10 |
T4569 | 2111-2112 | NN | denotes | − |
T4570 | 2112-2114 | CD | denotes | 12 |
T4571 | 2115-2117 | TO | denotes | to |
T4572 | 2118-2120 | CD | denotes | 10 |
T4573 | 2120-2121 | CD | denotes | − |
T4574 | 2121-2123 | NNP | denotes | 8M |
T4575 | 2123-2124 | -RRB- | denotes | ) |
T4576 | 2124-2125 | . | denotes | . |
T4577 | 2126-2135 | NNS | denotes | Cytospins |
T4578 | 2136-2140 | VBD | denotes | were |
T4579 | 2141-2149 | JJ | denotes | prepared |
T4580 | 2150-2153 | CC | denotes | and |
T4581 | 2154-2160 | JJ | denotes | GATA-3 |
T4582 | 2161-2173 | NN | denotes | localization |
T4583 | 2174-2184 | VBN | denotes | determined |
T4584 | 2185-2187 | IN | denotes | by |
T4585 | 2188-2196 | JJ | denotes | confocal |
T4586 | 2197-2207 | NN | denotes | microscopy |
T4587 | 2208-2210 | IN | denotes | as |
T4588 | 2211-2221 | RB | denotes | previously |
T4589 | 2222-2231 | VBN | denotes | described |
T4590 | 2232-2233 | NNP | denotes | [ |
T4591 | 2233-2235 | CD | denotes | 12 |
T4592 | 2235-2236 | NNP | denotes | ] |
T4593 | 2236-2237 | . | denotes | . |
T4717 | 2239-2246 | VB | denotes | Reverse |
T4718 | 2247-2260 | NNP | denotes | Transcription |
T4719 | 2261-2264 | NNP | denotes | PCR |
T4720 | 2265-2270 | NNP | denotes | Total |
T4721 | 2271-2274 | NNP | denotes | RNA |
T4722 | 2275-2278 | VBD | denotes | was |
T4723 | 2279-2288 | VBN | denotes | extracted |
T4724 | 2289-2294 | VBG | denotes | using |
T4725 | 2295-2300 | NN | denotes | lysis |
T4726 | 2301-2307 | NN | denotes | buffer |
T4727 | 2308-2309 | -LRB- | denotes | ( |
T4728 | 2309-2315 | NNP | denotes | RNeasy |
T4729 | 2316-2319 | NN | denotes | kit |
T4730 | 2319-2320 | : | denotes | ; |
T4731 | 2321-2327 | NNP | denotes | Qiagen |
T4732 | 2327-2328 | , | denotes | , |
T4733 | 2329-2336 | NNP | denotes | Crawley |
T4734 | 2336-2337 | , | denotes | , |
T4735 | 2338-2340 | NNP | denotes | UK |
T4736 | 2340-2341 | -RRB- | denotes | ) |
T4737 | 2341-2342 | . | denotes | . |
T4738 | 2343-2349 | IN | denotes | During |
T4739 | 2350-2353 | NNP | denotes | RNA |
T4740 | 2354-2366 | NN | denotes | purification |
T4741 | 2366-2367 | , | denotes | , |
T4742 | 2368-2375 | JJ | denotes | genomic |
T4743 | 2376-2379 | NN | denotes | DNA |
T4744 | 2380-2383 | VBD | denotes | was |
T4745 | 2384-2392 | VBN | denotes | digested |
T4746 | 2393-2397 | IN | denotes | with |
T4747 | 2398-2408 | JJ | denotes | RNase-free |
T4748 | 2409-2414 | NNP | denotes | DNase |
T4749 | 2415-2416 | -LRB- | denotes | ( |
T4750 | 2416-2424 | NNP | denotes | Amersham |
T4751 | 2425-2436 | NNPS | denotes | Biosciences |
T4752 | 2436-2437 | -RRB- | denotes | ) |
T4753 | 2437-2438 | . | denotes | . |
T4754 | 2439-2443 | JJ | denotes | Next |
T4755 | 2443-2444 | , | denotes | , |
T4756 | 2445-2448 | CD | denotes | 0.5 |
T4757 | 2449-2451 | NN | denotes | µg |
T4758 | 2452-2454 | IN | denotes | of |
T4759 | 2455-2460 | JJ | denotes | total |
T4760 | 2461-2464 | NNP | denotes | RNA |
T4761 | 2465-2468 | VBD | denotes | was |
T4762 | 2469-2477 | JJ | denotes | reversed |
T4763 | 2478-2489 | VBN | denotes | transcribed |
T4764 | 2490-2495 | VBG | denotes | using |
T4765 | 2496-2499 | DT | denotes | the |
T4766 | 2500-2505 | JJ | denotes | avian |
T4767 | 2506-2520 | NN | denotes | myeloblastosis |
T4768 | 2521-2526 | NN | denotes | virus |
T4769 | 2527-2529 | NNP | denotes | RT |
T4770 | 2530-2531 | -LRB- | denotes | ( |
T4771 | 2531-2538 | NNP | denotes | Promega |
T4772 | 2538-2539 | , | denotes | , |
T4773 | 2540-2551 | NNP | denotes | Southampton |
T4774 | 2551-2552 | , | denotes | , |
T4775 | 2553-2555 | NNP | denotes | UK |
T4776 | 2555-2556 | -RRB- | denotes | ) |
T4777 | 2556-2557 | . | denotes | . |
T4778 | 2558-2561 | IN | denotes | For |
T4779 | 2562-2570 | JJ | denotes | relative |
T4780 | 2571-2585 | NN | denotes | quantification |
T4781 | 2585-2586 | , | denotes | , |
T4782 | 2587-2593 | NN | denotes | RT-PCR |
T4783 | 2594-2597 | VBD | denotes | was |
T4784 | 2598-2605 | VBN | denotes | carried |
T4785 | 2606-2609 | IN | denotes | out |
T4786 | 2610-2615 | VBG | denotes | using |
T4787 | 2616-2620 | NNP | denotes | cDNA |
T4788 | 2621-2627 | NNS | denotes | probes |
T4789 | 2627-2628 | . | denotes | . |
T4790 | 2629-2636 | NNS | denotes | Primers |
T4791 | 2637-2640 | IN | denotes | for |
T4792 | 2641-2645 | NN | denotes | IL-4 |
T4793 | 2646-2650 | VBD | denotes | were |
T4794 | 2651-2655 | IN | denotes | from |
T4795 | 2656-2669 | NNP | denotes | Sigma-Genosys |
T4796 | 2670-2671 | -LRB- | denotes | ( |
T4797 | 2671-2680 | NNP | denotes | Cambridge |
T4798 | 2680-2681 | , | denotes | , |
T4799 | 2682-2684 | NNP | denotes | UK |
T4800 | 2684-2685 | -RRB- | denotes | ) |
T4801 | 2685-2686 | . | denotes | . |
T4802 | 2687-2696 | NNS | denotes | Sequences |
T4803 | 2697-2699 | IN | denotes | of |
T4804 | 2700-2705 | NNP | denotes | GADPH |
T4805 | 2706-2710 | VBD | denotes | used |
T4806 | 2711-2714 | VBP | denotes | are |
T4807 | 2715-2717 | IN | denotes | as |
T4808 | 2718-2725 | VBZ | denotes | follows |
T4809 | 2725-2726 | : | denotes | : |
T4810 | 2727-2734 | RB | denotes | forward |
T4811 | 2735-2736 | CD | denotes | 5 |
T4812 | 2736-2737 | SYM | denotes | ′ |
T4813 | 2737-2738 | : | denotes | - |
T4814 | 2738-2761 | NNP | denotes | CCACCCATGGCAAATTCCATGGC |
T4815 | 2761-2762 | , | denotes | , |
T4816 | 2763-2770 | VB | denotes | reverse |
T4817 | 2771-2772 | CD | denotes | 3 |
T4818 | 2772-2773 | SYM | denotes | ′ |
T4819 | 2773-2774 | : | denotes | - |
T4820 | 2774-2797 | NNP | denotes | TCTAGACGGCAGGTCAGGTCCAC |
T4821 | 2797-2798 | . | denotes | . |
T5013 | 2800-2804 | NNP | denotes | Cell |
T5014 | 2805-2818 | NNP | denotes | Fractionation |
T5015 | 2818-2819 | , | denotes | , |
T5016 | 2820-2839 | NNP | denotes | Immunoprecipitation |
T5017 | 2839-2840 | , | denotes | , |
T5018 | 2841-2844 | CC | denotes | and |
T5019 | 2845-2852 | JJ | denotes | Western |
T5020 | 2853-2857 | NNP | denotes | Blot |
T5021 | 2858-2866 | NNP | denotes | Analysis |
T5022 | 2867-2874 | NNP | denotes | Nuclear |
T5023 | 2875-2878 | CC | denotes | and |
T5024 | 2879-2890 | JJ | denotes | cytoplasmic |
T5025 | 2891-2900 | NNS | denotes | fractions |
T5026 | 2901-2905 | VBD | denotes | were |
T5027 | 2906-2914 | VBN | denotes | prepared |
T5028 | 2915-2917 | IN | denotes | as |
T5029 | 2918-2928 | RB | denotes | previously |
T5030 | 2929-2938 | VBN | denotes | described |
T5031 | 2939-2940 | NNP | denotes | [ |
T5032 | 2940-2942 | CD | denotes | 35 |
T5033 | 2942-2943 | NNP | denotes | ] |
T5034 | 2943-2944 | . | denotes | . |
T5035 | 2945-2950 | JJ | denotes | Whole |
T5036 | 2951-2955 | NN | denotes | cell |
T5037 | 2956-2963 | NNS | denotes | lysates |
T5038 | 2964-2968 | VBD | denotes | were |
T5039 | 2969-2977 | VBN | denotes | prepared |
T5040 | 2978-2980 | IN | denotes | in |
T5041 | 2981-2986 | NN | denotes | NP-40 |
T5042 | 2987-2992 | NN | denotes | lysis |
T5043 | 2993-2999 | NN | denotes | buffer |
T5044 | 3000-3001 | -LRB- | denotes | ( |
T5045 | 3001-3004 | CD | denotes | 0.5 |
T5046 | 3004-3005 | NN | denotes | % |
T5047 | 3006-3013 | NNP | denotes | Nonidet |
T5048 | 3014-3018 | NNP | denotes | P-40 |
T5049 | 3018-3019 | , | denotes | , |
T5050 | 3020-3022 | CD | denotes | 20 |
T5051 | 3023-3025 | NNP | denotes | mM |
T5052 | 3026-3034 | NNP | denotes | Tris-HCl |
T5053 | 3035-3036 | NNP | denotes | [ |
T5054 | 3036-3038 | NNP | denotes | pH |
T5055 | 3039-3042 | CD | denotes | 7.5 |
T5056 | 3042-3043 | NNP | denotes | ] |
T5057 | 3043-3044 | , | denotes | , |
T5058 | 3045-3048 | CD | denotes | 150 |
T5059 | 3049-3051 | NNP | denotes | mM |
T5060 | 3052-3056 | NNP | denotes | NaCl |
T5061 | 3056-3057 | -RRB- | denotes | ) |
T5062 | 3058-3060 | IN | denotes | in |
T5063 | 3061-3064 | DT | denotes | the |
T5064 | 3065-3073 | NN | denotes | presence |
T5065 | 3074-3076 | IN | denotes | of |
T5066 | 3077-3085 | JJ | denotes | complete |
T5067 | 3086-3094 | NN | denotes | protease |
T5068 | 3095-3103 | NN | denotes | cocktail |
T5069 | 3104-3113 | NN | denotes | inhibitor |
T5070 | 3113-3114 | . | denotes | . |
T5071 | 3115-3122 | NNS | denotes | Lysates |
T5072 | 3123-3127 | VBD | denotes | were |
T5073 | 3128-3139 | VBN | denotes | centrifuged |
T5074 | 3140-3142 | IN | denotes | at |
T5075 | 3143-3144 | CD | denotes | 4 |
T5076 | 3144-3145 | CD | denotes | ° |
T5077 | 3145-3146 | NNP | denotes | C |
T5078 | 3147-3150 | IN | denotes | for |
T5079 | 3151-3153 | CD | denotes | 10 |
T5080 | 3154-3157 | NN | denotes | min |
T5081 | 3158-3160 | IN | denotes | at |
T5082 | 3161-3167 | CD | denotes | 12,000 |
T5083 | 3168-3171 | NN | denotes | rpm |
T5084 | 3172-3174 | IN | denotes | in |
T5085 | 3175-3177 | DT | denotes | an |
T5086 | 3178-3187 | NNP | denotes | Eppendorf |
T5087 | 3188-3203 | NN | denotes | microcentrifuge |
T5088 | 3204-3206 | TO | denotes | to |
T5089 | 3207-3213 | VB | denotes | remove |
T5090 | 3214-3222 | JJ | denotes | cellular |
T5091 | 3223-3229 | NN | denotes | debris |
T5092 | 3229-3230 | . | denotes | . |
T5093 | 3231-3238 | NNS | denotes | Samples |
T5094 | 3239-3243 | VBD | denotes | were |
T5095 | 3244-3248 | RB | denotes | then |
T5096 | 3249-3267 | VBN | denotes | immunoprecipitated |
T5097 | 3268-3272 | IN | denotes | with |
T5098 | 3273-3279 | DT | denotes | either |
T5099 | 3280-3282 | CD | denotes | 10 |
T5100 | 3283-3285 | NN | denotes | µl |
T5101 | 3286-3288 | IN | denotes | of |
T5102 | 3289-3297 | NN | denotes | antibody |
T5103 | 3298-3305 | IN | denotes | against |
T5104 | 3306-3312 | NNP | denotes | GATA-3 |
T5105 | 3313-3315 | CC | denotes | or |
T5106 | 3316-3326 | JJ | denotes | importin-α |
T5107 | 3327-3332 | VBG | denotes | using |
T5108 | 3333-3336 | NNP | denotes | A/G |
T5109 | 3337-3344 | JJ | denotes | agarose |
T5110 | 3345-3351 | NN | denotes | slurry |
T5111 | 3352-3354 | IN | denotes | in |
T5112 | 3355-3358 | DT | denotes | the |
T5113 | 3359-3367 | NN | denotes | presence |
T5114 | 3368-3370 | IN | denotes | of |
T5115 | 3371-3379 | NN | denotes | protease |
T5116 | 3380-3389 | NN | denotes | inhibitor |
T5117 | 3390-3395 | VBG | denotes | using |
T5118 | 3396-3399 | DT | denotes | the |
T5119 | 3400-3405 | NNP | denotes | Catch |
T5120 | 3406-3409 | CC | denotes | and |
T5121 | 3410-3417 | NNP | denotes | Release |
T5122 | 3418-3429 | NN | denotes | methodology |
T5123 | 3430-3431 | -LRB- | denotes | ( |
T5124 | 3431-3438 | NNP | denotes | Upstate |
T5125 | 3439-3452 | NNP | denotes | Biotechnology |
T5126 | 3452-3453 | , | denotes | , |
T5127 | 3454-3458 | NNP | denotes | Lake |
T5128 | 3459-3465 | NNP | denotes | Placid |
T5129 | 3465-3466 | , | denotes | , |
T5130 | 3467-3470 | NNP | denotes | New |
T5131 | 3471-3475 | NNP | denotes | York |
T5132 | 3475-3476 | , | denotes | , |
T5133 | 3477-3480 | NNP | denotes | USA |
T5134 | 3480-3481 | -RRB- | denotes | ) |
T5135 | 3481-3482 | . | denotes | . |
T5136 | 3483-3490 | JJ | denotes | Western |
T5137 | 3491-3495 | NN | denotes | blot |
T5138 | 3496-3504 | NN | denotes | analysis |
T5139 | 3505-3508 | VBD | denotes | was |
T5140 | 3509-3518 | VBN | denotes | performed |
T5141 | 3519-3524 | VBG | denotes | using |
T5142 | 3525-3536 | JJ | denotes | anti-GATA-3 |
T5143 | 3536-3537 | , | denotes | , |
T5144 | 3538-3553 | JJ | denotes | anti-importin-α |
T5145 | 3553-3554 | , | denotes | , |
T5146 | 3555-3562 | JJ | denotes | anti-GR |
T5147 | 3562-3563 | , | denotes | , |
T5148 | 3564-3574 | JJ | denotes | anti-p-p38 |
T5149 | 3575-3578 | NNP | denotes | MAP |
T5150 | 3579-3585 | NN | denotes | kinase |
T5151 | 3585-3586 | , | denotes | , |
T5152 | 3587-3599 | JJ | denotes | anti-p-ATF-2 |
T5153 | 3599-3600 | , | denotes | , |
T5154 | 3601-3604 | CC | denotes | and |
T5155 | 3605-3618 | JJ | denotes | anti-p-serine |
T5156 | 3618-3619 | . | denotes | . |
T5157 | 3620-3634 | JJ | denotes | Immunoreactive |
T5158 | 3635-3643 | NNS | denotes | proteins |
T5159 | 3644-3648 | VBD | denotes | were |
T5160 | 3649-3657 | VBN | denotes | detected |
T5161 | 3658-3663 | VBG | denotes | using |
T5162 | 3664-3666 | DT | denotes | an |
T5163 | 3667-3675 | JJ | denotes | enhanced |
T5164 | 3676-3693 | NN | denotes | chemiluminescence |
T5165 | 3694-3697 | NNP | denotes | ECL |
T5166 | 3698-3701 | NN | denotes | kit |
T5167 | 3702-3703 | -LRB- | denotes | ( |
T5168 | 3703-3711 | NNP | denotes | Amersham |
T5169 | 3712-3723 | NNPS | denotes | Biosciences |
T5170 | 3723-3724 | -RRB- | denotes | ) |
T5171 | 3724-3725 | . | denotes | . |
T5318 | 3727-3736 | NNP | denotes | Chromatin |
T5319 | 3737-3756 | NNP | denotes | Immunoprecipitation |
T5320 | 3757-3766 | NNP | denotes | Chromatin |
T5321 | 3767-3786 | NN | denotes | immunoprecipitation |
T5322 | 3787-3788 | -LRB- | denotes | ( |
T5323 | 3788-3790 | NNP | denotes | IP |
T5324 | 3790-3791 | -RRB- | denotes | ) |
T5325 | 3792-3795 | VBD | denotes | was |
T5326 | 3796-3805 | VBN | denotes | performed |
T5327 | 3806-3808 | IN | denotes | as |
T5328 | 3809-3819 | RB | denotes | previously |
T5329 | 3820-3829 | VBN | denotes | described |
T5330 | 3830-3831 | NNP | denotes | [ |
T5331 | 3831-3833 | CD | denotes | 12 |
T5332 | 3833-3834 | NNP | denotes | ] |
T5333 | 3835-3837 | IN | denotes | in |
T5334 | 3838-3844 | NNP | denotes | HuT-78 |
T5335 | 3845-3852 | NNS | denotes | T-cells |
T5336 | 3853-3857 | IN | denotes | with |
T5337 | 3858-3859 | CD | denotes | 2 |
T5338 | 3860-3862 | NN | denotes | µg |
T5339 | 3863-3865 | IN | denotes | of |
T5340 | 3866-3877 | JJ | denotes | anti-GATA-3 |
T5341 | 3878-3879 | -LRB- | denotes | ( |
T5342 | 3879-3884 | NNP | denotes | Santa |
T5343 | 3885-3889 | NNP | denotes | Cruz |
T5344 | 3890-3903 | NNP | denotes | Biotechnology |
T5345 | 3903-3904 | -RRB- | denotes | ) |
T5346 | 3904-3905 | , | denotes | , |
T5347 | 3906-3908 | CC | denotes | or |
T5348 | 3909-3917 | JJ | denotes | isotypic |
T5349 | 3918-3932 | NN | denotes | immunoglobulin |
T5350 | 3933-3934 | NNP | denotes | G |
T5351 | 3935-3937 | IN | denotes | as |
T5352 | 3938-3939 | DT | denotes | a |
T5353 | 3940-3952 | JJ | denotes | non-specific |
T5354 | 3953-3960 | NN | denotes | control |
T5355 | 3961-3962 | -LRB- | denotes | ( |
T5356 | 3962-3967 | NNP | denotes | Santa |
T5357 | 3968-3972 | NNP | denotes | Cruz |
T5358 | 3973-3986 | NNP | denotes | Biotechnology |
T5359 | 3986-3987 | -RRB- | denotes | ) |
T5360 | 3988-3997 | RB | denotes | overnight |
T5361 | 3998-4000 | IN | denotes | at |
T5362 | 4001-4002 | CD | denotes | 4 |
T5363 | 4002-4003 | CD | denotes | ° |
T5364 | 4003-4005 | NNP | denotes | C. |
T5365 | 4006-4014 | NNP | denotes | Promoter |
T5366 | 4015-4024 | NNS | denotes | sequences |
T5367 | 4025-4029 | VBD | denotes | were |
T5368 | 4030-4038 | VBN | denotes | detected |
T5369 | 4039-4043 | IN | denotes | with |
T5370 | 4044-4047 | NNP | denotes | PCR |
T5371 | 4048-4055 | NNS | denotes | primers |
T5372 | 4056-4059 | IN | denotes | for |
T5373 | 4060-4063 | DT | denotes | the |
T5374 | 4064-4068 | NN | denotes | IL-5 |
T5375 | 4069-4077 | NN | denotes | promoter |
T5376 | 4078-4079 | -LRB- | denotes | ( |
T5377 | 4079-4080 | FW | denotes | − |
T5378 | 4080-4083 | CD | denotes | 445 |
T5379 | 4084-4086 | TO | denotes | to |
T5380 | 4087-4089 | CD | denotes | +4 |
T5381 | 4089-4090 | -RRB- | denotes | ) |
T5382 | 4090-4091 | : | denotes | : |
T5383 | 4092-4099 | RB | denotes | forward |
T5384 | 4100-4101 | CD | denotes | 5 |
T5385 | 4101-4102 | SYM | denotes | ′ |
T5386 | 4102-4103 | : | denotes | - |
T5387 | 4103-4126 | NN | denotes | TTAATCTAGCCACAGTCATAG-3 |
T5388 | 4126-4127 | NN | denotes | ′ |
T5389 | 4128-4131 | CC | denotes | and |
T5390 | 4132-4139 | NN | denotes | reverse |
T5391 | 4139-4140 | : | denotes | : |
T5392 | 4141-4142 | CD | denotes | 5 |
T5393 | 4142-4143 | SYM | denotes | ′ |
T5394 | 4143-4144 | : | denotes | - |
T5395 | 4144-4167 | NN | denotes | TCATGGCTCTGAAACGTTCTG-3 |
T5396 | 4167-4168 | NN | denotes | ′ |
T5397 | 4168-4169 | . | denotes | . |
T5398 | 4170-4173 | NNP | denotes | PCR |
T5399 | 4174-4177 | VBD | denotes | was |
T5400 | 4178-4187 | VBN | denotes | performed |
T5401 | 4188-4193 | VBG | denotes | using |
T5402 | 4194-4195 | DT | denotes | a |
T5403 | 4196-4202 | NNP | denotes | Hybaid |
T5404 | 4203-4211 | NNP | denotes | Omnigene |
T5405 | 4212-4219 | JJ | denotes | thermal |
T5406 | 4220-4226 | NN | denotes | cycler |
T5407 | 4227-4228 | -LRB- | denotes | ( |
T5408 | 4228-4234 | NNP | denotes | Hybaid |
T5409 | 4234-4235 | , | denotes | , |
T5410 | 4236-4243 | NNP | denotes | Ashford |
T5411 | 4243-4244 | , | denotes | , |
T5412 | 4245-4247 | NNP | denotes | UK |
T5413 | 4247-4248 | -RRB- | denotes | ) |
T5414 | 4249-4253 | IN | denotes | with |
T5415 | 4254-4261 | NN | denotes | cycling |
T5416 | 4262-4272 | NNS | denotes | parameters |
T5417 | 4273-4275 | IN | denotes | of |
T5418 | 4276-4278 | CD | denotes | 72 |
T5419 | 4278-4279 | CD | denotes | ° |
T5420 | 4279-4280 | NNP | denotes | C |
T5421 | 4281-4284 | IN | denotes | for |
T5422 | 4285-4287 | CD | denotes | 10 |
T5423 | 4288-4291 | NN | denotes | min |
T5424 | 4291-4292 | , | denotes | , |
T5425 | 4293-4295 | CD | denotes | 35 |
T5426 | 4296-4302 | NNS | denotes | cycles |
T5427 | 4303-4305 | IN | denotes | at |
T5428 | 4306-4308 | CD | denotes | 94 |
T5429 | 4308-4309 | CD | denotes | ° |
T5430 | 4309-4310 | NNP | denotes | C |
T5431 | 4311-4314 | IN | denotes | for |
T5432 | 4315-4317 | CD | denotes | 45 |
T5433 | 4318-4319 | PRP | denotes | s |
T5434 | 4319-4320 | , | denotes | , |
T5435 | 4321-4323 | CD | denotes | 52 |
T5436 | 4323-4324 | NN | denotes | ° |
T5437 | 4324-4325 | NNP | denotes | C |
T5438 | 4326-4329 | IN | denotes | for |
T5439 | 4330-4332 | CD | denotes | 45 |
T5440 | 4333-4334 | PRP | denotes | s |
T5441 | 4334-4335 | , | denotes | , |
T5442 | 4336-4338 | CD | denotes | 72 |
T5443 | 4338-4339 | NN | denotes | ° |
T5444 | 4339-4340 | NNP | denotes | C |
T5445 | 4341-4344 | IN | denotes | for |
T5446 | 4345-4347 | CD | denotes | 45 |
T5447 | 4348-4350 | NN | denotes | s. |
T5754 | 4352-4361 | CD | denotes | GR-GATA-3 |
T5755 | 4362-4364 | IN | denotes | In |
T5756 | 4365-4370 | NNP | denotes | Vitro |
T5757 | 4371-4382 | NNP | denotes | Competition |
T5758 | 4383-4388 | NNP | denotes | Assay |
T5759 | 4389-4392 | IN | denotes | for |
T5760 | 4393-4403 | NNP | denotes | Importin-α |
T5761 | 4404-4405 | -LRB- | denotes | ( |
T5762 | 4405-4416 | NNP | denotes | Far-Western |
T5763 | 4417-4422 | NNP | denotes | ELISA |
T5764 | 4422-4423 | -RRB- | denotes | ) |
T5765 | 4424-4442 | NNP | denotes | Immunoprecipitated |
T5766 | 4443-4453 | NN | denotes | importin-α |
T5767 | 4454-4455 | -LRB- | denotes | ( |
T5768 | 4455-4470 | JJ | denotes | anti-importin-α |
T5769 | 4470-4471 | , | denotes | , |
T5770 | 4472-4477 | NNP | denotes | Santa |
T5771 | 4478-4482 | NNP | denotes | Cruz |
T5772 | 4483-4496 | NNP | denotes | Biotechnology |
T5773 | 4496-4497 | -RRB- | denotes | ) |
T5774 | 4498-4502 | IN | denotes | from |
T5775 | 4503-4509 | JJ | denotes | HuT-78 |
T5776 | 4510-4515 | NNS | denotes | cells |
T5777 | 4516-4519 | VBD | denotes | was |
T5778 | 4520-4529 | VBN | denotes | separated |
T5779 | 4530-4532 | IN | denotes | by |
T5780 | 4533-4541 | NNP | denotes | SDS-PAGE |
T5781 | 4542-4545 | CC | denotes | and |
T5782 | 4546-4554 | VBN | denotes | purified |
T5783 | 4555-4559 | IN | denotes | from |
T5784 | 4560-4563 | DT | denotes | the |
T5785 | 4564-4571 | VBN | denotes | excised |
T5786 | 4572-4575 | NN | denotes | gel |
T5787 | 4576-4578 | IN | denotes | by |
T5788 | 4579-4593 | NN | denotes | electroelution |
T5789 | 4594-4595 | NNP | denotes | [ |
T5790 | 4595-4597 | CD | denotes | 36 |
T5791 | 4597-4598 | NNP | denotes | ] |
T5792 | 4598-4599 | . | denotes | . |
T5793 | 4600-4609 | RB | denotes | Similarly |
T5794 | 4609-4610 | , | denotes | , |
T5795 | 4611-4617 | NN | denotes | GATA-3 |
T5796 | 4618-4621 | VBD | denotes | was |
T5797 | 4622-4630 | VBN | denotes | isolated |
T5798 | 4631-4635 | IN | denotes | from |
T5799 | 4636-4649 | JJ | denotes | nonstimulated |
T5800 | 4650-4656 | JJ | denotes | HuT-78 |
T5801 | 4657-4662 | NNS | denotes | cells |
T5802 | 4663-4665 | CC | denotes | or |
T5803 | 4666-4671 | NNS | denotes | cells |
T5804 | 4672-4682 | VBD | denotes | stimulated |
T5805 | 4683-4686 | IN | denotes | for |
T5806 | 4687-4689 | CD | denotes | 30 |
T5807 | 4690-4693 | NN | denotes | min |
T5808 | 4694-4698 | IN | denotes | with |
T5809 | 4699-4707 | JJ | denotes | anti-CD3 |
T5810 | 4707-4708 | NN | denotes | / |
T5811 | 4708-4712 | CD | denotes | CD28 |
T5812 | 4713-4716 | CC | denotes | and |
T5813 | 4717-4719 | NNP | denotes | GR |
T5814 | 4720-4723 | VBD | denotes | was |
T5815 | 4724-4732 | VBN | denotes | isolated |
T5816 | 4733-4737 | IN | denotes | from |
T5817 | 4738-4740 | NNP | denotes | FP |
T5818 | 4741-4742 | -LRB- | denotes | ( |
T5819 | 4742-4744 | CD | denotes | 10 |
T5820 | 4744-4745 | NN | denotes | − |
T5821 | 4745-4746 | CD | denotes | 8 |
T5822 | 4747-4748 | NNP | denotes | M |
T5823 | 4748-4749 | , | denotes | , |
T5824 | 4750-4752 | CD | denotes | 30 |
T5825 | 4753-4756 | NN | denotes | min |
T5826 | 4756-4757 | -RRB- | denotes | ) |
T5827 | 4758-4768 | VBD | denotes | stimulated |
T5828 | 4769-4775 | JJ | denotes | HuT-78 |
T5829 | 4776-4781 | NNS | denotes | cells |
T5830 | 4781-4782 | . | denotes | . |
T5831 | 4783-4788 | DT | denotes | These |
T5832 | 4789-4797 | NNS | denotes | proteins |
T5833 | 4798-4802 | VBD | denotes | were |
T5834 | 4803-4815 | RB | denotes | subsequently |
T5835 | 4816-4824 | VBN | denotes | refolded |
T5836 | 4825-4827 | IN | denotes | in |
T5837 | 4828-4835 | NN | denotes | glycine |
T5838 | 4836-4844 | NN | denotes | solution |
T5839 | 4844-4845 | . | denotes | . |
T5840 | 4846-4849 | CD | denotes | 100 |
T5841 | 4850-4852 | NN | denotes | µl |
T5842 | 4853-4855 | IN | denotes | of |
T5843 | 4856-4866 | JJ | denotes | importin-α |
T5844 | 4867-4875 | NN | denotes | solution |
T5845 | 4876-4877 | -LRB- | denotes | ( |
T5846 | 4877-4880 | CD | denotes | 100 |
T5847 | 4881-4886 | NN | denotes | ng/ml |
T5848 | 4887-4889 | IN | denotes | in |
T5849 | 4890-4893 | NNP | denotes | TBS |
T5850 | 4893-4894 | -RRB- | denotes | ) |
T5851 | 4895-4898 | VBD | denotes | was |
T5852 | 4899-4904 | VBN | denotes | added |
T5853 | 4905-4907 | TO | denotes | to |
T5854 | 4908-4915 | JJ | denotes | 96-well |
T5855 | 4916-4922 | NNS | denotes | plates |
T5856 | 4923-4929 | VBN | denotes | coated |
T5857 | 4930-4934 | IN | denotes | with |
T5858 | 4935-4939 | NN | denotes | goat |
T5859 | 4940-4955 | JJ | denotes | anti-importin-α |
T5860 | 4956-4964 | NN | denotes | antibody |
T5861 | 4964-4965 | . | denotes | . |
T5862 | 4966-4971 | IN | denotes | After |
T5863 | 4972-4973 | CD | denotes | 1 |
T5864 | 4974-4975 | NN | denotes | h |
T5865 | 4976-4986 | NN | denotes | incubation |
T5866 | 4986-4987 | , | denotes | , |
T5867 | 4988-4994 | NNP | denotes | GATA-3 |
T5868 | 4995-4996 | -LRB- | denotes | ( |
T5869 | 4996-4999 | CD | denotes | 100 |
T5870 | 5000-5005 | NN | denotes | ng/ml |
T5871 | 5006-5008 | IN | denotes | in |
T5872 | 5009-5012 | NNP | denotes | TBS |
T5873 | 5012-5013 | -RRB- | denotes | ) |
T5874 | 5014-5018 | IN | denotes | from |
T5875 | 5019-5029 | VBN | denotes | stimulated |
T5876 | 5030-5032 | CC | denotes | or |
T5877 | 5033-5045 | JJ | denotes | unstimulated |
T5878 | 5046-5051 | NNS | denotes | cells |
T5879 | 5052-5056 | VBD | denotes | were |
T5880 | 5057-5062 | VBN | denotes | added |
T5881 | 5063-5065 | TO | denotes | to |
T5882 | 5066-5069 | DT | denotes | the |
T5883 | 5070-5087 | JJ | denotes | importin-α-coated |
T5884 | 5088-5093 | NNS | denotes | wells |
T5885 | 5093-5094 | . | denotes | . |
T5886 | 5095-5097 | NNP | denotes | GR |
T5887 | 5098-5099 | -LRB- | denotes | ( |
T5888 | 5099-5101 | CD | denotes | 10 |
T5889 | 5102-5104 | CC | denotes | or |
T5890 | 5105-5108 | CD | denotes | 100 |
T5891 | 5109-5114 | NN | denotes | ng/ml |
T5892 | 5115-5117 | IN | denotes | in |
T5893 | 5118-5121 | NNP | denotes | TBS |
T5894 | 5121-5122 | -RRB- | denotes | ) |
T5895 | 5123-5127 | IN | denotes | from |
T5896 | 5128-5138 | VBN | denotes | stimulated |
T5897 | 5139-5141 | CC | denotes | or |
T5898 | 5142-5154 | JJ | denotes | unstimulated |
T5899 | 5155-5160 | NNS | denotes | cells |
T5900 | 5161-5165 | VBD | denotes | were |
T5901 | 5166-5171 | VBN | denotes | added |
T5902 | 5172-5174 | TO | denotes | to |
T5903 | 5175-5179 | DT | denotes | some |
T5904 | 5180-5185 | NNS | denotes | wells |
T5905 | 5185-5186 | . | denotes | . |
T5906 | 5187-5192 | IN | denotes | After |
T5907 | 5193-5194 | DT | denotes | a |
T5908 | 5195-5202 | JJ | denotes | further |
T5909 | 5203-5204 | CD | denotes | 1 |
T5910 | 5205-5206 | NN | denotes | h |
T5911 | 5207-5217 | NN | denotes | incubation |
T5912 | 5217-5218 | , | denotes | , |
T5913 | 5219-5222 | DT | denotes | the |
T5914 | 5223-5228 | NN | denotes | plate |
T5915 | 5229-5232 | VBD | denotes | was |
T5916 | 5233-5239 | VBN | denotes | washed |
T5917 | 5240-5243 | CC | denotes | and |
T5918 | 5244-5253 | VBN | denotes | incubated |
T5919 | 5254-5258 | IN | denotes | with |
T5920 | 5259-5266 | JJ | denotes | primary |
T5921 | 5267-5277 | NNS | denotes | antibodies |
T5922 | 5278-5279 | -LRB- | denotes | ( |
T5923 | 5279-5280 | DT | denotes | a |
T5924 | 5281-5288 | NN | denotes | mixture |
T5925 | 5289-5291 | IN | denotes | of |
T5926 | 5292-5298 | NN | denotes | rabbit |
T5927 | 5299-5310 | JJ | denotes | anti-GATA-3 |
T5928 | 5311-5314 | CC | denotes | and |
T5929 | 5315-5320 | NN | denotes | mouse |
T5930 | 5321-5328 | JJ | denotes | anti-GR |
T5931 | 5328-5329 | , | denotes | , |
T5932 | 5330-5335 | NNP | denotes | Santa |
T5933 | 5336-5340 | NNP | denotes | Cruz |
T5934 | 5341-5354 | NNP | denotes | Biotechnology |
T5935 | 5354-5355 | -RRB- | denotes | ) |
T5936 | 5356-5359 | IN | denotes | for |
T5937 | 5360-5363 | CD | denotes | 1.5 |
T5938 | 5364-5365 | NN | denotes | h |
T5939 | 5365-5366 | , | denotes | , |
T5940 | 5367-5370 | CC | denotes | and |
T5941 | 5371-5375 | RB | denotes | then |
T5942 | 5376-5385 | VBN | denotes | incubated |
T5943 | 5386-5390 | IN | denotes | with |
T5944 | 5391-5400 | JJ | denotes | secondary |
T5945 | 5401-5411 | NNS | denotes | antibodies |
T5946 | 5411-5412 | . | denotes | . |
T5947 | 5413-5417 | CD | denotes | FITC |
T5948 | 5418-5423 | NNS | denotes | swine |
T5949 | 5424-5435 | JJ | denotes | anti-rabbit |
T5950 | 5436-5439 | NNP | denotes | IgG |
T5951 | 5440-5441 | -LRB- | denotes | ( |
T5952 | 5441-5445 | NNP | denotes | Dako |
T5953 | 5445-5446 | , | denotes | , |
T5954 | 5447-5456 | NNP | denotes | Cambridge |
T5955 | 5456-5457 | , | denotes | , |
T5956 | 5458-5460 | NNP | denotes | UK |
T5957 | 5460-5461 | -RRB- | denotes | ) |
T5958 | 5462-5465 | VBD | denotes | was |
T5959 | 5466-5470 | VBN | denotes | used |
T5960 | 5471-5474 | IN | denotes | for |
T5961 | 5475-5478 | DT | denotes | the |
T5962 | 5479-5488 | NN | denotes | detection |
T5963 | 5489-5491 | IN | denotes | of |
T5964 | 5492-5498 | NNP | denotes | GATA-3 |
T5965 | 5498-5499 | , | denotes | , |
T5966 | 5500-5503 | CC | denotes | and |
T5967 | 5504-5513 | JJ | denotes | rhodamine |
T5968 | 5514-5520 | NN | denotes | donkey |
T5969 | 5521-5531 | JJ | denotes | anti-mouse |
T5970 | 5532-5535 | NNP | denotes | IgG |
T5971 | 5536-5537 | -LRB- | denotes | ( |
T5972 | 5537-5542 | NNP | denotes | Novus |
T5973 | 5542-5543 | , | denotes | , |
T5974 | 5544-5553 | NNP | denotes | Littleton |
T5975 | 5553-5554 | , | denotes | , |
T5976 | 5555-5563 | NNP | denotes | Colorado |
T5977 | 5563-5564 | , | denotes | , |
T5978 | 5565-5568 | NNP | denotes | USA |
T5979 | 5568-5569 | -RRB- | denotes | ) |
T5980 | 5570-5573 | VBD | denotes | was |
T5981 | 5574-5578 | VBN | denotes | used |
T5982 | 5579-5582 | IN | denotes | for |
T5983 | 5583-5586 | DT | denotes | the |
T5984 | 5587-5596 | NN | denotes | detection |
T5985 | 5597-5599 | IN | denotes | of |
T5986 | 5600-5602 | NNP | denotes | GR |
T5987 | 5602-5603 | . | denotes | . |
T5988 | 5604-5608 | NNP | denotes | FITC |
T5989 | 5609-5612 | CC | denotes | and |
T5990 | 5613-5622 | JJ | denotes | rhodamine |
T5991 | 5623-5629 | NNS | denotes | levels |
T5992 | 5630-5634 | VBD | denotes | were |
T5993 | 5635-5643 | VBN | denotes | measured |
T5994 | 5644-5648 | IN | denotes | with |
T5995 | 5649-5650 | DT | denotes | a |
T5996 | 5651-5662 | JJ | denotes | fluorescent |
T5997 | 5663-5674 | JJ | denotes | micro-plate |
T5998 | 5675-5681 | NN | denotes | reader |
T5999 | 5682-5683 | -LRB- | denotes | ( |
T6000 | 5683-5690 | NNP | denotes | Bioline |
T6001 | 5690-5691 | , | denotes | , |
T6002 | 5692-5698 | NNP | denotes | London |
T6003 | 5698-5699 | , | denotes | , |
T6004 | 5700-5702 | NNP | denotes | UK |
T6005 | 5702-5703 | -RRB- | denotes | ) |
T6006 | 5703-5704 | . | denotes | . |
T6161 | 5706-5711 | NNP | denotes | NF-κB |
T6162 | 5712-5722 | NNP | denotes | Activation |
T6163 | 5723-5728 | NNP | denotes | NF-κB |
T6164 | 5729-5736 | JJ | denotes | binding |
T6165 | 5737-5745 | NN | denotes | activity |
T6166 | 5746-5748 | IN | denotes | in |
T6167 | 5749-5756 | JJ | denotes | nuclear |
T6168 | 5757-5765 | NNS | denotes | extracts |
T6169 | 5766-5769 | VBD | denotes | was |
T6170 | 5770-5780 | VBN | denotes | determined |
T6171 | 5781-5786 | VBG | denotes | using |
T6172 | 5787-5789 | DT | denotes | an |
T6173 | 5790-5801 | JJ | denotes | ELISA-based |
T6174 | 5802-5805 | NN | denotes | kit |
T6175 | 5806-5807 | -LRB- | denotes | ( |
T6176 | 5807-5815 | JJ | denotes | Trans-AM |
T6177 | 5816-5819 | NNS | denotes | p65 |
T6178 | 5819-5820 | , | denotes | , |
T6179 | 5821-5827 | NNP | denotes | Active |
T6180 | 5828-5833 | NNP | denotes | Motif |
T6181 | 5833-5834 | , | denotes | , |
T6182 | 5835-5844 | NNP | denotes | Rixensart |
T6183 | 5844-5845 | , | denotes | , |
T6184 | 5846-5853 | NNP | denotes | Belgium |
T6185 | 5853-5854 | -RRB- | denotes | ) |
T6186 | 5854-5855 | . | denotes | . |
T6187 | 5856-5858 | IN | denotes | In |
T6188 | 5859-5864 | NN | denotes | brief |
T6189 | 5864-5865 | , | denotes | , |
T6190 | 5866-5867 | CD | denotes | 5 |
T6191 | 5868-5870 | NN | denotes | µg |
T6192 | 5871-5873 | IN | denotes | of |
T6193 | 5874-5881 | JJ | denotes | nuclear |
T6194 | 5882-5890 | NNS | denotes | extracts |
T6195 | 5891-5895 | VBD | denotes | were |
T6196 | 5896-5905 | VBN | denotes | incubated |
T6197 | 5906-5910 | IN | denotes | with |
T6198 | 5911-5912 | DT | denotes | a |
T6199 | 5913-5918 | NN | denotes | plate |
T6200 | 5919-5925 | VBN | denotes | coated |
T6201 | 5926-5930 | IN | denotes | with |
T6202 | 5931-5933 | DT | denotes | an |
T6203 | 5934-5939 | JJ | denotes | NF-κB |
T6204 | 5940-5949 | NN | denotes | consensus |
T6205 | 5950-5965 | NN | denotes | oligonucleotide |
T6206 | 5965-5966 | . | denotes | . |
T6207 | 5967-5973 | NNS | denotes | Plates |
T6208 | 5974-5978 | VBD | denotes | were |
T6209 | 5979-5985 | VBN | denotes | washed |
T6210 | 5986-5992 | IN | denotes | before |
T6211 | 5993-6001 | NN | denotes | addition |
T6212 | 6002-6004 | IN | denotes | of |
T6213 | 6005-6007 | DT | denotes | an |
T6214 | 6008-6016 | JJ | denotes | anti-p65 |
T6215 | 6017-6025 | NN | denotes | antibody |
T6216 | 6025-6026 | . | denotes | . |
T6217 | 6027-6035 | NN | denotes | Antibody |
T6218 | 6036-6043 | JJ | denotes | binding |
T6219 | 6044-6047 | VBD | denotes | was |
T6220 | 6048-6056 | VBN | denotes | detected |
T6221 | 6057-6061 | IN | denotes | with |
T6222 | 6062-6063 | DT | denotes | a |
T6223 | 6064-6073 | JJ | denotes | secondary |
T6224 | 6074-6088 | JJ | denotes | HRP-conjugated |
T6225 | 6089-6097 | NN | denotes | antibody |
T6226 | 6098-6101 | CC | denotes | and |
T6227 | 6102-6111 | VBN | denotes | developed |
T6228 | 6112-6116 | IN | denotes | with |
T6229 | 6117-6120 | NNP | denotes | TMB |
T6230 | 6121-6130 | NN | denotes | substrate |
T6231 | 6130-6131 | . | denotes | . |
T6232 | 6132-6135 | DT | denotes | The |
T6233 | 6136-6145 | NN | denotes | intensity |
T6234 | 6146-6148 | IN | denotes | of |
T6235 | 6149-6152 | DT | denotes | the |
T6236 | 6153-6161 | NN | denotes | reaction |
T6237 | 6162-6165 | VBD | denotes | was |
T6238 | 6166-6174 | VBN | denotes | measured |
T6239 | 6175-6177 | IN | denotes | at |
T6240 | 6178-6181 | CD | denotes | 450 |
T6241 | 6182-6184 | NN | denotes | nm |
T6242 | 6184-6185 | . | denotes | . |
T6486 | 6187-6205 | NNP | denotes | Immunofluorescence |
T6487 | 6206-6214 | NNP | denotes | Staining |
T6488 | 6215-6233 | NNP | denotes | Immunofluorescence |
T6489 | 6234-6242 | VBG | denotes | staining |
T6490 | 6243-6246 | VBD | denotes | was |
T6491 | 6247-6256 | VBN | denotes | performed |
T6492 | 6257-6259 | IN | denotes | as |
T6493 | 6260-6270 | RB | denotes | previously |
T6494 | 6271-6280 | VBN | denotes | described |
T6495 | 6281-6282 | NNP | denotes | [ |
T6496 | 6282-6284 | CD | denotes | 34 |
T6497 | 6284-6285 | NNP | denotes | ] |
T6498 | 6285-6286 | . | denotes | . |
T6499 | 6287-6290 | DT | denotes | All |
T6500 | 6291-6299 | VBG | denotes | staining |
T6501 | 6300-6303 | VBD | denotes | was |
T6502 | 6304-6313 | VBN | denotes | performed |
T6503 | 6314-6316 | IN | denotes | at |
T6504 | 6317-6321 | NN | denotes | room |
T6505 | 6322-6333 | NN | denotes | temperature |
T6506 | 6334-6337 | CC | denotes | and |
T6507 | 6338-6343 | IN | denotes | under |
T6508 | 6344-6358 | NN | denotes | humidification |
T6509 | 6358-6359 | . | denotes | . |
T6510 | 6360-6365 | NNS | denotes | Cells |
T6511 | 6366-6370 | VBD | denotes | were |
T6512 | 6371-6380 | VBN | denotes | collected |
T6513 | 6381-6384 | CC | denotes | and |
T6514 | 6385-6394 | NNS | denotes | cytospins |
T6515 | 6395-6403 | VBN | denotes | prepared |
T6516 | 6404-6406 | IN | denotes | in |
T6517 | 6407-6408 | DT | denotes | a |
T6518 | 6409-6423 | NN | denotes | cytocentrifuge |
T6519 | 6424-6425 | -LRB- | denotes | ( |
T6520 | 6425-6432 | NNP | denotes | Shandon |
T6521 | 6433-6435 | NNP | denotes | II |
T6522 | 6435-6436 | , | denotes | , |
T6523 | 6437-6444 | NNP | denotes | Shandon |
T6524 | 6444-6445 | , | denotes | , |
T6525 | 6446-6453 | NNP | denotes | Runcorn |
T6526 | 6453-6454 | , | denotes | , |
T6527 | 6455-6457 | NNP | denotes | UK |
T6528 | 6457-6458 | -RRB- | denotes | ) |
T6529 | 6458-6459 | . | denotes | . |
T6530 | 6460-6465 | NNS | denotes | Cells |
T6531 | 6466-6470 | VBD | denotes | were |
T6532 | 6471-6484 | VBN | denotes | permeabilized |
T6533 | 6484-6485 | , | denotes | , |
T6534 | 6486-6493 | VBN | denotes | blocked |
T6535 | 6493-6494 | , | denotes | , |
T6536 | 6495-6498 | CC | denotes | and |
T6537 | 6499-6503 | RB | denotes | then |
T6538 | 6504-6513 | VBN | denotes | incubated |
T6539 | 6514-6518 | IN | denotes | with |
T6540 | 6519-6521 | NNP | denotes | GR |
T6541 | 6522-6523 | -LRB- | denotes | ( |
T6542 | 6523-6524 | CD | denotes | 1 |
T6543 | 6524-6525 | CD | denotes | ∶ |
T6544 | 6525-6527 | CD | denotes | 50 |
T6545 | 6528-6532 | NN | denotes | E-20 |
T6546 | 6533-6538 | NNP | denotes | Santa |
T6547 | 6539-6543 | NNP | denotes | Cruz |
T6548 | 6544-6557 | NNP | denotes | Biotechnology |
T6549 | 6557-6558 | -RRB- | denotes | ) |
T6550 | 6559-6561 | CC | denotes | or |
T6551 | 6562-6573 | JJ | denotes | anti-GATA-3 |
T6552 | 6574-6575 | -LRB- | denotes | ( |
T6553 | 6575-6579 | JJ | denotes | H-48 |
T6554 | 6579-6580 | : | denotes | ; |
T6555 | 6581-6586 | NNP | denotes | Santa |
T6556 | 6587-6591 | NNP | denotes | Cruz |
T6557 | 6592-6605 | NNP | denotes | Biotechnology |
T6558 | 6605-6606 | -RRB- | denotes | ) |
T6559 | 6607-6615 | NN | denotes | antibody |
T6560 | 6616-6619 | IN | denotes | for |
T6561 | 6620-6621 | CD | denotes | 1 |
T6562 | 6622-6623 | NN | denotes | h |
T6563 | 6624-6626 | IN | denotes | at |
T6564 | 6627-6631 | NN | denotes | room |
T6565 | 6632-6643 | NN | denotes | temperature |
T6566 | 6643-6644 | . | denotes | . |
T6567 | 6645-6650 | IN | denotes | After |
T6568 | 6651-6656 | CD | denotes | three |
T6569 | 6657-6663 | NNS | denotes | washes |
T6570 | 6664-6666 | IN | denotes | in |
T6571 | 6667-6685 | JJ | denotes | phosphate-buffered |
T6572 | 6686-6692 | NN | denotes | saline |
T6573 | 6693-6694 | -LRB- | denotes | ( |
T6574 | 6694-6697 | NNP | denotes | PBS |
T6575 | 6697-6698 | -RRB- | denotes | ) |
T6576 | 6698-6699 | , | denotes | , |
T6577 | 6700-6705 | NNS | denotes | cells |
T6578 | 6706-6710 | VBD | denotes | were |
T6579 | 6711-6720 | VBN | denotes | incubated |
T6580 | 6721-6725 | IN | denotes | with |
T6581 | 6726-6740 | JJ | denotes | tetrarhodamine |
T6582 | 6741-6755 | NN | denotes | isothiocyanate |
T6583 | 6756-6766 | VBN | denotes | conjugated |
T6584 | 6767-6771 | NN | denotes | goat |
T6585 | 6772-6783 | JJ | denotes | anti-rabbit |
T6586 | 6784-6792 | NN | denotes | antibody |
T6587 | 6793-6794 | -LRB- | denotes | ( |
T6588 | 6794-6798 | NNP | denotes | Dako |
T6589 | 6798-6799 | -RRB- | denotes | ) |
T6590 | 6799-6800 | . | denotes | . |
T6591 | 6801-6810 | NNS | denotes | Cytospins |
T6592 | 6811-6815 | VBD | denotes | were |
T6593 | 6816-6830 | VBN | denotes | counterstained |
T6594 | 6831-6835 | IN | denotes | with |
T6595 | 6836-6837 | CD | denotes | 4 |
T6596 | 6837-6838 | CD | denotes | ′ |
T6597 | 6838-6840 | SYM | denotes | ,6 |
T6598 | 6840-6841 | : | denotes | - |
T6599 | 6841-6865 | JJ | denotes | diamidino-2-phenylindole |
T6600 | 6866-6881 | NN | denotes | dihydrochloride |
T6601 | 6882-6883 | -LRB- | denotes | ( |
T6602 | 6883-6887 | NNP | denotes | DAPI |
T6603 | 6887-6888 | -RRB- | denotes | ) |
T6604 | 6888-6889 | , | denotes | , |
T6605 | 6890-6891 | DT | denotes | a |
T6606 | 6892-6903 | JJ | denotes | fluorescent |
T6607 | 6904-6908 | JJ | denotes | blue |
T6608 | 6909-6916 | JJ | denotes | nuclear |
T6609 | 6917-6923 | NN | denotes | indole |
T6610 | 6924-6933 | NN | denotes | chromatin |
T6611 | 6934-6939 | VBP | denotes | stain |
T6612 | 6939-6940 | , | denotes | , |
T6613 | 6941-6944 | CC | denotes | and |
T6614 | 6945-6952 | VBD | denotes | mounted |
T6615 | 6953-6955 | IN | denotes | in |
T6616 | 6956-6959 | NNP | denotes | PBS |
T6617 | 6959-6960 | : | denotes | : |
T6618 | 6960-6968 | NN | denotes | glycerol |
T6619 | 6969-6970 | -LRB- | denotes | ( |
T6620 | 6970-6972 | CD | denotes | 50 |
T6621 | 6972-6973 | NN | denotes | ∶ |
T6622 | 6973-6975 | CD | denotes | 50 |
T6623 | 6975-6976 | -RRB- | denotes | ) |
T6624 | 6976-6977 | . | denotes | . |
T6625 | 6978-6981 | DT | denotes | The |
T6626 | 6982-6996 | JJ | denotes | immunopositive |
T6627 | 6997-7003 | NN | denotes | signal |
T6628 | 7004-7007 | VBD | denotes | was |
T6629 | 7008-7021 | VBN | denotes | characterised |
T6630 | 7022-7027 | VBG | denotes | using |
T6631 | 7028-7033 | NN | denotes | laser |
T6632 | 7034-7042 | VBG | denotes | scanning |
T6633 | 7043-7051 | JJ | denotes | confocal |
T6634 | 7052-7062 | NN | denotes | microscopy |
T6635 | 7063-7065 | IN | denotes | on |
T6636 | 7066-7067 | DT | denotes | a |
T6637 | 7068-7073 | NNP | denotes | Leica |
T6638 | 7074-7077 | NNP | denotes | TCS |
T6639 | 7078-7083 | NNP | denotes | NT/SP |
T6640 | 7084-7095 | JJ | denotes | interactive |
T6641 | 7096-7101 | NN | denotes | laser |
T6642 | 7102-7111 | NN | denotes | cytometer |
T6643 | 7112-7120 | VBN | denotes | equipped |
T6644 | 7121-7125 | IN | denotes | with |
T6645 | 7126-7134 | JJ | denotes | confocal |
T6646 | 7135-7141 | NNS | denotes | optics |
T6647 | 7142-7143 | -LRB- | denotes | ( |
T6648 | 7143-7148 | NNP | denotes | Leica |
T6649 | 7149-7161 | NNP | denotes | Microsystems |
T6650 | 7161-7162 | , | denotes | , |
T6651 | 7163-7170 | NNP | denotes | Wetzlar |
T6652 | 7170-7171 | , | denotes | , |
T6653 | 7172-7179 | NNP | denotes | Germany |
T6654 | 7179-7180 | -RRB- | denotes | ) |
T6655 | 7180-7181 | . | denotes | . |
T6656 | 7182-7184 | TO | denotes | To |
T6657 | 7185-7194 | VB | denotes | determine |
T6658 | 7195-7198 | DT | denotes | the |
T6659 | 7199-7210 | NN | denotes | specificity |
T6660 | 7211-7213 | IN | denotes | of |
T6661 | 7214-7217 | DT | denotes | the |
T6662 | 7218-7228 | NNS | denotes | antibodies |
T6663 | 7228-7229 | , | denotes | , |
T6664 | 7230-7236 | NN | denotes | rabbit |
T6665 | 7237-7242 | NN | denotes | serum |
T6666 | 7243-7257 | NN | denotes | immunoglobulin |
T6667 | 7258-7259 | -LRB- | denotes | ( |
T6668 | 7259-7263 | NNP | denotes | Dako |
T6669 | 7263-7264 | -RRB- | denotes | ) |
T6670 | 7265-7268 | CC | denotes | and |
T6671 | 7269-7278 | JJ | denotes | secondary |
T6672 | 7279-7289 | NNS | denotes | antibodies |
T6673 | 7290-7297 | IN | denotes | without |
T6674 | 7298-7301 | DT | denotes | the |
T6675 | 7302-7309 | JJ | denotes | primary |
T6676 | 7310-7314 | VBD | denotes | were |
T6677 | 7315-7319 | VBN | denotes | used |
T6678 | 7320-7322 | IN | denotes | as |
T6679 | 7323-7331 | NNS | denotes | controls |
T6680 | 7331-7332 | . | denotes | . |
T6681 | 7333-7343 | RB | denotes | Positively |
T6682 | 7344-7351 | VBN | denotes | stained |
T6683 | 7352-7358 | NNS | denotes | nuclei |
T6684 | 7359-7362 | CC | denotes | and |
T6685 | 7363-7368 | JJ | denotes | total |
T6686 | 7369-7374 | NNS | denotes | cells |
T6687 | 7375-7379 | VBD | denotes | were |
T6688 | 7380-7387 | VBN | denotes | counted |
T6689 | 7388-7389 | -LRB- | denotes | ( |
T6690 | 7389-7392 | CD | denotes | 500 |
T6691 | 7392-7393 | -RRB- | denotes | ) |
T6692 | 7394-7396 | IN | denotes | on |
T6693 | 7397-7401 | DT | denotes | each |
T6694 | 7402-7407 | NN | denotes | slide |
T6695 | 7408-7412 | IN | denotes | with |
T6696 | 7413-7416 | DT | denotes | the |
T6697 | 7417-7425 | NN | denotes | observer |
T6698 | 7426-7433 | VBD | denotes | blinded |
T6699 | 7434-7436 | TO | denotes | to |
T6700 | 7437-7440 | DT | denotes | the |
T6701 | 7441-7450 | NN | denotes | treatment |
T6702 | 7450-7451 | . | denotes | . |
T6937 | 7453-7463 | NNP | denotes | GATA-3-GFP |
T6938 | 7464-7473 | NNP | denotes | Construct |
T6939 | 7474-7477 | NNP | denotes | The |
T6940 | 7478-7484 | NNP | denotes | GATA-3 |
T6941 | 7485-7490 | NN | denotes | clone |
T6942 | 7491-7492 | -LRB- | denotes | ( |
T6943 | 7492-7500 | NNP | denotes | BC003070 |
T6944 | 7500-7501 | -RRB- | denotes | ) |
T6945 | 7502-7510 | JJ | denotes | complete |
T6946 | 7511-7515 | NNP | denotes | cDNA |
T6947 | 7516-7519 | VBD | denotes | was |
T6948 | 7520-7528 | VBN | denotes | obtained |
T6949 | 7529-7533 | IN | denotes | from |
T6950 | 7534-7544 | NNP | denotes | Invitrogen |
T6951 | 7545-7549 | NNP | denotes | Life |
T6952 | 7550-7562 | NNPS | denotes | Technologies |
T6953 | 7563-7565 | IN | denotes | as |
T6954 | 7566-7567 | DT | denotes | a |
T6955 | 7568-7569 | CD | denotes | 5 |
T6956 | 7569-7570 | SYM | denotes | ′ |
T6957 | 7570-7571 | : | denotes | - |
T6958 | 7572-7579 | JJ | denotes | EcoRI/3 |
T6959 | 7579-7580 | SYM | denotes | ′ |
T6960 | 7580-7581 | : | denotes | - |
T6961 | 7581-7585 | NNP | denotes | XhoI |
T6962 | 7586-7592 | NN | denotes | insert |
T6963 | 7593-7595 | IN | denotes | of |
T6964 | 7596-7602 | NN | denotes | GATA-3 |
T6965 | 7603-7605 | IN | denotes | in |
T6966 | 7606-7609 | DT | denotes | the |
T6967 | 7610-7615 | NNP | denotes | pOTB7 |
T6968 | 7616-7622 | NN | denotes | vector |
T6969 | 7622-7623 | . | denotes | . |
T6970 | 7624-7630 | NN | denotes | GATA-3 |
T6971 | 7631-7634 | VBD | denotes | was |
T6972 | 7635-7642 | VBN | denotes | excised |
T6973 | 7643-7647 | IN | denotes | from |
T6974 | 7648-7653 | NNP | denotes | pOTB7 |
T6975 | 7654-7659 | VBG | denotes | using |
T6976 | 7660-7664 | NNP | denotes | XhoI |
T6977 | 7665-7674 | NN | denotes | digestion |
T6978 | 7675-7678 | CC | denotes | and |
T6979 | 7679-7687 | NN | denotes | pEGFP-C2 |
T6980 | 7688-7689 | -LRB- | denotes | ( |
T6981 | 7689-7697 | NNP | denotes | Clontech |
T6982 | 7697-7698 | , | denotes | , |
T6983 | 7699-7720 | NNP | denotes | Saint-Germain-en-Laye |
T6984 | 7720-7721 | , | denotes | , |
T6985 | 7722-7728 | NNP | denotes | France |
T6986 | 7728-7729 | -RRB- | denotes | ) |
T6987 | 7730-7733 | VBD | denotes | was |
T6988 | 7734-7742 | VBN | denotes | digested |
T6989 | 7743-7747 | IN | denotes | with |
T6990 | 7748-7753 | NNP | denotes | BamHI |
T6991 | 7753-7754 | . | denotes | . |
T6992 | 7755-7758 | NNP | denotes | DNA |
T6993 | 7759-7762 | VBD | denotes | was |
T6994 | 7763-7772 | VBN | denotes | recovered |
T6995 | 7773-7775 | IN | denotes | by |
T6996 | 7776-7782 | NN | denotes | phenol |
T6997 | 7783-7793 | NN | denotes | extraction |
T6998 | 7794-7797 | CC | denotes | and |
T6999 | 7798-7805 | NN | denotes | ethanol |
T7000 | 7806-7819 | NN | denotes | precipitation |
T7001 | 7819-7820 | , | denotes | , |
T7002 | 7821-7824 | CC | denotes | and |
T7003 | 7825-7829 | DT | denotes | both |
T7004 | 7830-7833 | DT | denotes | the |
T7005 | 7834-7840 | NNP | denotes | GATA-3 |
T7006 | 7841-7849 | NN | denotes | fragment |
T7007 | 7850-7853 | CC | denotes | and |
T7008 | 7854-7857 | DT | denotes | the |
T7009 | 7858-7866 | NN | denotes | pEGFP-C2 |
T7010 | 7867-7873 | NN | denotes | vector |
T7011 | 7874-7885 | JJ | denotes | blunt-ended |
T7012 | 7886-7888 | IN | denotes | by |
T7013 | 7889-7899 | NN | denotes | incubation |
T7014 | 7900-7904 | IN | denotes | with |
T7015 | 7905-7911 | NNP | denotes | Klenow |
T7016 | 7912-7913 | -LRB- | denotes | ( |
T7017 | 7913-7920 | NNP | denotes | Bioline |
T7018 | 7921-7930 | NNP | denotes | Bio-27029 |
T7019 | 7930-7931 | -RRB- | denotes | ) |
T7020 | 7932-7935 | IN | denotes | for |
T7021 | 7936-7938 | CD | denotes | 30 |
T7022 | 7939-7942 | NN | denotes | min |
T7023 | 7943-7945 | IN | denotes | at |
T7024 | 7946-7948 | CD | denotes | 37 |
T7025 | 7948-7949 | CD | denotes | ° |
T7026 | 7949-7951 | NNP | denotes | C. |
T7027 | 7952-7958 | NNP | denotes | Klenow |
T7028 | 7959-7962 | VBD | denotes | was |
T7029 | 7963-7974 | VBN | denotes | inactivated |
T7030 | 7975-7977 | IN | denotes | by |
T7031 | 7978-7988 | NN | denotes | incubation |
T7032 | 7989-7992 | IN | denotes | for |
T7033 | 7993-7995 | CD | denotes | 10 |
T7034 | 7996-7999 | NN | denotes | min |
T7035 | 8000-8002 | IN | denotes | at |
T7036 | 8003-8005 | CD | denotes | 75 |
T7037 | 8005-8006 | CD | denotes | ° |
T7038 | 8006-8008 | NNP | denotes | C. |
T7039 | 8009-8012 | NNP | denotes | DNA |
T7040 | 8013-8016 | VBD | denotes | was |
T7041 | 8017-8026 | VBN | denotes | recovered |
T7042 | 8027-8029 | IN | denotes | by |
T7043 | 8030-8036 | NN | denotes | phenol |
T7044 | 8037-8047 | NN | denotes | extraction |
T7045 | 8048-8051 | CC | denotes | and |
T7046 | 8052-8059 | NN | denotes | ethanol |
T7047 | 8060-8073 | NN | denotes | precipitation |
T7048 | 8073-8074 | , | denotes | , |
T7049 | 8075-8078 | CC | denotes | and |
T7050 | 8079-8083 | DT | denotes | both |
T7051 | 8084-8087 | DT | denotes | the |
T7052 | 8088-8099 | JJ | denotes | blunt-ended |
T7053 | 8100-8106 | JJ | denotes | GATA-3 |
T7054 | 8107-8115 | NN | denotes | fragment |
T7055 | 8116-8119 | CC | denotes | and |
T7056 | 8120-8123 | DT | denotes | the |
T7057 | 8124-8127 | NNP | denotes | GFP |
T7058 | 8128-8134 | NN | denotes | vector |
T7059 | 8135-8139 | VBD | denotes | were |
T7060 | 8140-8152 | RB | denotes | subsequently |
T7061 | 8153-8161 | VBN | denotes | digested |
T7062 | 8162-8166 | IN | denotes | with |
T7063 | 8167-8172 | NNP | denotes | EcoRI |
T7064 | 8173-8179 | IN | denotes | before |
T7065 | 8180-8183 | DT | denotes | the |
T7066 | 8184-8185 | CD | denotes | 5 |
T7067 | 8185-8186 | SYM | denotes | ′ |
T7068 | 8186-8187 | : | denotes | - |
T7069 | 8187-8194 | JJ | denotes | EcoRI/3 |
T7070 | 8194-8195 | NN | denotes | ′ |
T7071 | 8196-8201 | JJ | denotes | blunt |
T7072 | 8202-8205 | NN | denotes | end |
T7073 | 8206-8212 | NN | denotes | GATA-3 |
T7074 | 8213-8221 | NN | denotes | fragment |
T7075 | 8222-8225 | VBD | denotes | was |
T7076 | 8226-8234 | VBN | denotes | inserted |
T7077 | 8235-8239 | IN | denotes | into |
T7078 | 8240-8243 | DT | denotes | the |
T7079 | 8244-8245 | CD | denotes | 5 |
T7080 | 8245-8246 | SYM | denotes | ′ |
T7081 | 8246-8247 | : | denotes | - |
T7082 | 8247-8254 | JJ | denotes | EcoRI/3 |
T7083 | 8254-8255 | NN | denotes | ′ |
T7084 | 8256-8261 | JJ | denotes | blunt |
T7085 | 8262-8267 | VBN | denotes | ended |
T7086 | 8268-8271 | NNP | denotes | GFP |
T7087 | 8272-8278 | NN | denotes | vector |
T7088 | 8278-8279 | . | denotes | . |
T7089 | 8280-8288 | JJ | denotes | Positive |
T7090 | 8289-8295 | NNS | denotes | clones |
T7091 | 8296-8300 | VBD | denotes | were |
T7092 | 8301-8310 | VBN | denotes | confirmed |
T7093 | 8311-8313 | IN | denotes | by |
T7094 | 8314-8323 | NN | denotes | digestion |
T7095 | 8324-8327 | CC | denotes | and |
T7096 | 8328-8332 | NN | denotes | size |
T7097 | 8333-8341 | NN | denotes | analysis |
T7098 | 8342-8344 | IN | denotes | by |
T7099 | 8345-8346 | CD | denotes | 1 |
T7100 | 8346-8347 | NN | denotes | % |
T7101 | 8348-8355 | JJ | denotes | agarose |
T7102 | 8356-8359 | NN | denotes | gel |
T7103 | 8360-8375 | NN | denotes | electrophoresis |
T7104 | 8376-8379 | CC | denotes | and |
T7105 | 8380-8382 | IN | denotes | by |
T7106 | 8383-8393 | VBG | denotes | sequencing |
T7107 | 8393-8394 | . | denotes | . |
T7254 | 8396-8408 | NNP | denotes | Transfection |
T7255 | 8409-8415 | NNP | denotes | HuT-78 |
T7256 | 8416-8421 | NNS | denotes | cells |
T7257 | 8422-8426 | VBD | denotes | were |
T7258 | 8427-8438 | VBN | denotes | transfected |
T7259 | 8439-8443 | IN | denotes | with |
T7260 | 8444-8450 | DT | denotes | either |
T7261 | 8451-8454 | CD | denotes | EP8 |
T7262 | 8455-8457 | CC | denotes | or |
T7263 | 8458-8461 | NNP | denotes | GFP |
T7264 | 8462-8468 | NN | denotes | vector |
T7265 | 8469-8473 | RB | denotes | only |
T7266 | 8474-8477 | NNP | denotes | DNA |
T7267 | 8478-8483 | VBG | denotes | using |
T7268 | 8484-8492 | NN | denotes | solution |
T7269 | 8493-8494 | NN | denotes | R |
T7270 | 8494-8495 | , | denotes | , |
T7271 | 8496-8505 | NN | denotes | programme |
T7272 | 8506-8511 | NN | denotes | V-001 |
T7273 | 8512-8514 | IN | denotes | at |
T7274 | 8515-8516 | DT | denotes | a |
T7275 | 8517-8522 | NN | denotes | ratio |
T7276 | 8523-8525 | IN | denotes | of |
T7277 | 8526-8527 | CD | denotes | 3 |
T7278 | 8527-8528 | CD | denotes | × |
T7279 | 8528-8531 | CD | denotes | 106 |
T7280 | 8532-8539 | CD | denotes | cells/4 |
T7281 | 8540-8542 | NN | denotes | µg |
T7282 | 8543-8546 | NN | denotes | DNA |
T7283 | 8547-8550 | IN | denotes | for |
T7284 | 8551-8552 | CD | denotes | 7 |
T7285 | 8553-8554 | CD | denotes | 8 |
T7286 | 8555-8556 | NN | denotes | h |
T7287 | 8557-8559 | IN | denotes | in |
T7288 | 8560-8568 | JJ | denotes | complete |
T7289 | 8569-8575 | NN | denotes | medium |
T7290 | 8576-8577 | -LRB- | denotes | ( |
T7291 | 8577-8579 | CD | denotes | 10 |
T7292 | 8579-8580 | NN | denotes | % |
T7293 | 8581-8587 | JJ | denotes | bovine |
T7294 | 8588-8593 | NN | denotes | serum |
T7295 | 8594-8596 | IN | denotes | in |
T7296 | 8597-8605 | NNP | denotes | RPMI1640 |
T7297 | 8605-8608 | CD | denotes | +15 |
T7298 | 8609-8620 | NN | denotes | L-glutamine |
T7299 | 8620-8621 | -RRB- | denotes | ) |
T7300 | 8622-8631 | VBG | denotes | according |
T7301 | 8632-8634 | TO | denotes | to |
T7302 | 8635-8638 | DT | denotes | the |
T7303 | 8639-8646 | JJ | denotes | general |
T7304 | 8647-8652 | NNP | denotes | Amaxa |
T7305 | 8653-8661 | NN | denotes | protocol |
T7306 | 8662-8665 | IN | denotes | for |
T7307 | 8666-8679 | NN | denotes | nucleofection |
T7308 | 8679-8680 | . | denotes | . |
T7309 | 8681-8684 | DT | denotes | The |
T7310 | 8685-8691 | NN | denotes | medium |
T7311 | 8692-8695 | VBD | denotes | was |
T7312 | 8696-8708 | RB | denotes | subsequently |
T7313 | 8709-8716 | VBN | denotes | changed |
T7314 | 8717-8719 | TO | denotes | to |
T7315 | 8720-8721 | CD | denotes | 1 |
T7316 | 8721-8722 | NN | denotes | % |
T7317 | 8723-8727 | NNP | denotes | RPMI |
T7318 | 8728-8731 | IN | denotes | for |
T7319 | 8732-8734 | CD | denotes | 24 |
T7320 | 8735-8736 | NN | denotes | h |
T7321 | 8737-8743 | IN | denotes | before |
T7322 | 8744-8755 | VBN | denotes | transfected |
T7323 | 8756-8761 | NNS | denotes | cells |
T7324 | 8762-8766 | VBD | denotes | were |
T7325 | 8767-8772 | VBN | denotes | added |
T7326 | 8773-8775 | TO | denotes | to |
T7327 | 8776-8784 | JJ | denotes | anti-CD3 |
T7328 | 8784-8785 | NN | denotes | / |
T7329 | 8785-8789 | CD | denotes | CD28 |
T7330 | 8790-8797 | VBN | denotes | treated |
T7331 | 8798-8803 | NNS | denotes | wells |
T7332 | 8804-8807 | CC | denotes | and |
T7333 | 8808-8812 | VBP | denotes | live |
T7334 | 8813-8817 | NN | denotes | cell |
T7335 | 8818-8833 | JJ | denotes | videomicroscopy |
T7336 | 8834-8843 | VBN | denotes | performed |
T7337 | 8843-8844 | . | denotes | . |
T7473 | 8846-8856 | NNP | denotes | Time-Lapse |
T7474 | 8857-8867 | NNP | denotes | Microscopy |
T7475 | 8868-8874 | NNP | denotes | HuT-78 |
T7476 | 8875-8880 | NNS | denotes | cells |
T7477 | 8881-8891 | VBG | denotes | expressing |
T7478 | 8892-8902 | NNP | denotes | GATA-3-GFP |
T7479 | 8903-8907 | VBD | denotes | were |
T7480 | 8908-8918 | VBN | denotes | maintained |
T7481 | 8919-8921 | IN | denotes | at |
T7482 | 8922-8924 | CD | denotes | 37 |
T7483 | 8924-8925 | CD | denotes | ° |
T7484 | 8925-8926 | NNP | denotes | C |
T7485 | 8927-8929 | IN | denotes | in |
T7486 | 8930-8936 | NN | denotes | growth |
T7487 | 8937-8943 | NN | denotes | medium |
T7488 | 8944-8946 | IN | denotes | in |
T7489 | 8947-8948 | DT | denotes | a |
T7490 | 8949-8955 | JJ | denotes | closed |
T7491 | 8956-8960 | CD | denotes | FCS2 |
T7492 | 8961-8970 | NN | denotes | perfusion |
T7493 | 8971-8978 | NN | denotes | chamber |
T7494 | 8979-8980 | -LRB- | denotes | ( |
T7495 | 8980-8989 | NNPS | denotes | Bioptechs |
T7496 | 8989-8990 | , | denotes | , |
T7497 | 8991-8997 | NNP | denotes | Butler |
T7498 | 8997-8998 | , | denotes | , |
T7499 | 8999-9011 | NNP | denotes | Pennsylvania |
T7500 | 9011-9012 | , | denotes | , |
T7501 | 9013-9016 | NNP | denotes | USA |
T7502 | 9016-9017 | -RRB- | denotes | ) |
T7503 | 9018-9026 | VBN | denotes | combined |
T7504 | 9027-9031 | IN | denotes | with |
T7505 | 9032-9034 | DT | denotes | an |
T7506 | 9035-9044 | JJ | denotes | objective |
T7507 | 9045-9051 | NN | denotes | heater |
T7508 | 9052-9053 | -LRB- | denotes | ( |
T7509 | 9053-9062 | NNPS | denotes | Bioptechs |
T7510 | 9062-9063 | -RRB- | denotes | ) |
T7511 | 9064-9066 | IN | denotes | on |
T7512 | 9067-9070 | DT | denotes | the |
T7513 | 9071-9076 | NN | denotes | stage |
T7514 | 9077-9078 | DT | denotes | a |
T7515 | 9079-9084 | NNP | denotes | Zeiss |
T7516 | 9085-9093 | NNP | denotes | Axiovert |
T7517 | 9094-9097 | CD | denotes | 200 |
T7518 | 9098-9108 | NN | denotes | microscope |
T7519 | 9109-9110 | -LRB- | denotes | ( |
T7520 | 9110-9119 | NNP | denotes | Thornwood |
T7521 | 9119-9120 | , | denotes | , |
T7522 | 9121-9124 | NNP | denotes | New |
T7523 | 9125-9129 | NNP | denotes | York |
T7524 | 9129-9130 | , | denotes | , |
T7525 | 9131-9134 | NNP | denotes | USA |
T7526 | 9134-9135 | -RRB- | denotes | ) |
T7527 | 9135-9136 | . | denotes | . |
T7528 | 9137-9149 | NNS | denotes | Observations |
T7529 | 9150-9154 | VBD | denotes | were |
T7530 | 9155-9159 | VBN | denotes | made |
T7531 | 9160-9162 | IN | denotes | by |
T7532 | 9163-9165 | CD | denotes | 40 |
T7533 | 9165-9166 | CD | denotes | × |
T7534 | 9166-9169 | CD | denotes | 1.0 |
T7535 | 9170-9172 | NNP | denotes | NA |
T7536 | 9173-9186 | NN | denotes | oil-immersion |
T7537 | 9187-9196 | NN | denotes | objective |
T7538 | 9197-9201 | NN | denotes | lens |
T7539 | 9201-9202 | , | denotes | , |
T7540 | 9203-9206 | CC | denotes | and |
T7541 | 9207-9219 | NN | denotes | fluorescence |
T7542 | 9220-9223 | CC | denotes | and |
T7543 | 9224-9229 | NN | denotes | phase |
T7544 | 9230-9238 | NN | denotes | contrast |
T7545 | 9239-9245 | NNS | denotes | images |
T7546 | 9246-9250 | VBD | denotes | were |
T7547 | 9251-9259 | VBN | denotes | gathered |
T7548 | 9260-9265 | VBG | denotes | using |
T7549 | 9266-9267 | DT | denotes | a |
T7550 | 9268-9277 | NNP | denotes | Hamamatsu |
T7551 | 9278-9285 | NNP | denotes | ORCA-ER |
T7552 | 9286-9293 | VBD | denotes | charged |
T7553 | 9294-9301 | VBN | denotes | coupled |
T7554 | 9302-9308 | NN | denotes | device |
T7555 | 9309-9315 | NN | denotes | camera |
T7556 | 9316-9317 | -LRB- | denotes | ( |
T7557 | 9317-9328 | NNP | denotes | Bridgewater |
T7558 | 9328-9329 | , | denotes | , |
T7559 | 9330-9333 | NNP | denotes | New |
T7560 | 9334-9340 | NNP | denotes | Jersey |
T7561 | 9340-9341 | , | denotes | , |
T7562 | 9342-9345 | NNP | denotes | USA |
T7563 | 9345-9346 | -RRB- | denotes | ) |
T7564 | 9347-9353 | VBN | denotes | driven |
T7565 | 9354-9356 | IN | denotes | by |
T7566 | 9357-9364 | NNP | denotes | Openlab |
T7567 | 9365-9373 | NN | denotes | software |
T7568 | 9374-9375 | -LRB- | denotes | ( |
T7569 | 9375-9386 | NNP | denotes | Improvision |
T7570 | 9386-9387 | , | denotes | , |
T7571 | 9388-9396 | NNP | denotes | Coventry |
T7572 | 9396-9397 | , | denotes | , |
T7573 | 9398-9400 | NNP | denotes | UK |
T7574 | 9400-9401 | -RRB- | denotes | ) |
T7575 | 9401-9402 | . | denotes | . |
T7576 | 9403-9414 | NNS | denotes | Photographs |
T7577 | 9415-9419 | VBD | denotes | were |
T7578 | 9420-9425 | VBN | denotes | taken |
T7579 | 9426-9428 | IN | denotes | at |
T7580 | 9429-9430 | CD | denotes | 0 |
T7581 | 9430-9431 | , | denotes | , |
T7582 | 9432-9434 | CD | denotes | 30 |
T7583 | 9434-9435 | , | denotes | , |
T7584 | 9436-9438 | CD | denotes | 60 |
T7585 | 9438-9439 | , | denotes | , |
T7586 | 9440-9443 | CD | denotes | 120 |
T7587 | 9443-9444 | , | denotes | , |
T7588 | 9445-9448 | CC | denotes | and |
T7589 | 9449-9452 | CD | denotes | 240 |
T7590 | 9453-9456 | NN | denotes | min |
T7591 | 9456-9457 | . | denotes | . |
T7691 | 9459-9472 | NNP | denotes | Densitometric |
T7692 | 9473-9481 | NNP | denotes | Analysis |
T7693 | 9482-9494 | NNP | denotes | Densitometry |
T7694 | 9495-9497 | IN | denotes | of |
T7695 | 9498-9501 | NNP | denotes | ECL |
T7696 | 9502-9513 | NNS | denotes | immunoblots |
T7697 | 9514-9517 | VBD | denotes | was |
T7698 | 9518-9527 | VBN | denotes | performed |
T7699 | 9528-9533 | VBG | denotes | using |
T7700 | 9534-9542 | NNP | denotes | Gelworks |
T7701 | 9543-9545 | NNP | denotes | ID |
T7702 | 9546-9558 | JJ | denotes | intermediate |
T7703 | 9559-9567 | NN | denotes | software |
T7704 | 9568-9569 | -LRB- | denotes | ( |
T7705 | 9569-9580 | NNP | denotes | Ultraviolet |
T7706 | 9581-9589 | NNPS | denotes | Products |
T7707 | 9589-9590 | , | denotes | , |
T7708 | 9591-9605 | NNP | denotes | Cambridgeshire |
T7709 | 9605-9606 | , | denotes | , |
T7710 | 9607-9609 | NNP | denotes | UK |
T7711 | 9609-9610 | -RRB- | denotes | ) |
T7712 | 9610-9611 | . | denotes | . |
T7713 | 9612-9619 | RB | denotes | Briefly |
T7714 | 9619-9620 | , | denotes | , |
T7715 | 9621-9632 | NNS | denotes | immunoblots |
T7716 | 9633-9637 | VBD | denotes | were |
T7717 | 9638-9645 | VBN | denotes | scanned |
T7718 | 9646-9649 | CC | denotes | and |
T7719 | 9650-9655 | NNS | denotes | gates |
T7720 | 9656-9660 | VBD | denotes | were |
T7721 | 9661-9666 | VBN | denotes | drawn |
T7722 | 9667-9674 | RB | denotes | tightly |
T7723 | 9675-9681 | IN | denotes | around |
T7724 | 9682-9686 | DT | denotes | each |
T7725 | 9687-9691 | NN | denotes | band |
T7726 | 9691-9692 | . | denotes | . |
T7727 | 9693-9703 | NN | denotes | Background |
T7728 | 9704-9710 | NNS | denotes | values |
T7729 | 9711-9715 | IN | denotes | from |
T7730 | 9716-9720 | DT | denotes | each |
T7731 | 9721-9725 | NN | denotes | lane |
T7732 | 9726-9730 | VBD | denotes | were |
T7733 | 9731-9741 | VBN | denotes | subtracted |
T7734 | 9742-9744 | TO | denotes | to |
T7735 | 9745-9754 | VB | denotes | normalize |
T7736 | 9755-9759 | DT | denotes | each |
T7737 | 9760-9771 | NN | denotes | measurement |
T7738 | 9771-9772 | . | denotes | . |
T7739 | 9773-9776 | DT | denotes | The |
T7740 | 9777-9782 | NNS | denotes | bands |
T7741 | 9783-9787 | VBD | denotes | were |
T7742 | 9788-9798 | VBN | denotes | quantified |
T7743 | 9799-9804 | VBG | denotes | using |
T7744 | 9805-9808 | DT | denotes | the |
T7745 | 9809-9817 | NNPS | denotes | Gelworks |
T7746 | 9818-9826 | NN | denotes | software |
T7747 | 9826-9827 | . | denotes | . |
T7748 | 9828-9831 | DT | denotes | All |
T7749 | 9832-9839 | JJ | denotes | Western |
T7750 | 9840-9845 | NNS | denotes | blots |
T7751 | 9846-9850 | VBD | denotes | were |
T7752 | 9851-9858 | VBN | denotes | exposed |
T7753 | 9859-9861 | TO | denotes | to |
T7754 | 9862-9866 | NN | denotes | film |
T7755 | 9867-9870 | IN | denotes | for |
T7756 | 9871-9878 | VBG | denotes | varying |
T7757 | 9879-9886 | NNS | denotes | lengths |
T7758 | 9887-9889 | IN | denotes | of |
T7759 | 9890-9894 | NN | denotes | time |
T7760 | 9894-9895 | , | denotes | , |
T7761 | 9896-9899 | CC | denotes | and |
T7762 | 9900-9904 | RB | denotes | only |
T7763 | 9905-9910 | NNS | denotes | films |
T7764 | 9911-9921 | VBG | denotes | generating |
T7765 | 9922-9935 | JJ | denotes | subsaturating |
T7766 | 9936-9942 | NNS | denotes | levels |
T7767 | 9943-9945 | IN | denotes | of |
T7768 | 9946-9955 | NN | denotes | intensity |
T7769 | 9956-9960 | VBD | denotes | were |
T7770 | 9961-9969 | VBN | denotes | selected |
T7771 | 9970-9973 | IN | denotes | for |
T7772 | 9974-9987 | JJ | denotes | densitometric |
T7773 | 9988-9998 | NN | denotes | evaluation |
T7774 | 9998-9999 | . | denotes | . |
T7934 | 10001-10012 | NNP | denotes | Statistical |
T7935 | 10013-10021 | NNP | denotes | Analysis |
T7936 | 10022-10026 | NNP | denotes | Data |
T7937 | 10027-10031 | IN | denotes | from |
T7938 | 10032-10037 | CD | denotes | three |
T7939 | 10038-10040 | CC | denotes | or |
T7940 | 10041-10045 | JJR | denotes | more |
T7941 | 10046-10057 | JJ | denotes | independent |
T7942 | 10058-10069 | NNS | denotes | experiments |
T7943 | 10070-10073 | VBP | denotes | are |
T7944 | 10074-10083 | VBN | denotes | presented |
T7945 | 10084-10086 | IN | denotes | as |
T7946 | 10087-10090 | DT | denotes | the |
T7947 | 10091-10095 | JJ | denotes | mean |
T7948 | 10095-10096 | NN | denotes | ± |
T7949 | 10096-10104 | NN | denotes | standard |
T7950 | 10105-10110 | NN | denotes | error |
T7951 | 10111-10113 | IN | denotes | of |
T7952 | 10114-10117 | DT | denotes | the |
T7953 | 10118-10122 | NN | denotes | mean |
T7954 | 10123-10124 | -LRB- | denotes | ( |
T7955 | 10124-10127 | NNP | denotes | SEM |
T7956 | 10127-10128 | -RRB- | denotes | ) |
T7957 | 10128-10129 | , | denotes | , |
T7958 | 10130-10136 | IN | denotes | except |
T7959 | 10137-10142 | WRB | denotes | where |
T7960 | 10143-10149 | VBN | denotes | stated |
T7961 | 10150-10153 | CC | denotes | and |
T7962 | 10154-10158 | VBD | denotes | were |
T7963 | 10159-10167 | VBN | denotes | compared |
T7964 | 10168-10173 | VBG | denotes | using |
T7965 | 10174-10182 | NNP | denotes | GraphPad |
T7966 | 10183-10188 | NNP | denotes | Prism |
T7967 | 10189-10190 | CD | denotes | 4 |
T7968 | 10191-10192 | -LRB- | denotes | ( |
T7969 | 10192-10200 | NNP | denotes | GraphPad |
T7970 | 10201-10209 | NNP | denotes | Software |
T7971 | 10209-10210 | , | denotes | , |
T7972 | 10211-10234 | NN | denotes | http://www.graphpad.com |
T7973 | 10234-10235 | -RRB- | denotes | ) |
T7974 | 10235-10236 | . | denotes | . |
T7975 | 10237-10244 | NNS | denotes | Results |
T7976 | 10245-10249 | VBD | denotes | were |
T7977 | 10250-10258 | JJ | denotes | analysed |
T7978 | 10259-10264 | VBG | denotes | using |
T7979 | 10265-10272 | JJ | denotes | one-way |
T7980 | 10273-10278 | NNP | denotes | ANOVA |
T7981 | 10279-10283 | IN | denotes | with |
T7982 | 10284-10296 | NNP | denotes | Newman-Keuls |
T7983 | 10297-10301 | NN | denotes | post |
T7984 | 10302-10306 | NN | denotes | test |
T7985 | 10307-10313 | IN | denotes | except |
T7986 | 10314-10317 | IN | denotes | for |
T7987 | 10318-10321 | DT | denotes | the |
T7988 | 10322-10326 | NNS | denotes | data |
T7989 | 10327-10331 | IN | denotes | from |
T7990 | 10332-10335 | DT | denotes | the |
T7991 | 10336-10338 | IN | denotes | in |
T7992 | 10339-10343 | NN | denotes | vivo |
T7993 | 10344-10351 | VBD | denotes | inhaled |
T7994 | 10352-10354 | NNP | denotes | FP |
T7995 | 10355-10360 | NN | denotes | study |
T7996 | 10360-10361 | , | denotes | , |
T7997 | 10362-10367 | WDT | denotes | which |
T7998 | 10368-10371 | VBD | denotes | was |
T7999 | 10372-10380 | VBN | denotes | analysed |
T8000 | 10381-10383 | IN | denotes | by |
T8001 | 10384-10392 | NNP | denotes | Friedman |
T8002 | 10392-10394 | POS | denotes | 's |
T8003 | 10395-10399 | NN | denotes | test |
T8004 | 10400-10404 | IN | denotes | with |
T8005 | 10405-10415 | JJ | denotes | subsequent |
T8006 | 10416-10425 | NNP | denotes | Wilcoxson |
T8007 | 10426-10433 | VBD | denotes | matched |
T8008 | 10434-10438 | NN | denotes | pair |
T8009 | 10439-10445 | VBD | denotes | signed |
T8010 | 10446-10450 | NN | denotes | rank |
T8011 | 10451-10454 | NN | denotes | sum |
T8012 | 10455-10459 | NN | denotes | test |
T8013 | 10459-10460 | . | denotes | . |
T8014 | 10461-10465 | NNP | denotes | Data |
T8015 | 10466-10470 | IN | denotes | from |
T8016 | 10471-10475 | DT | denotes | this |
T8017 | 10476-10484 | NN | denotes | analysis |
T8018 | 10485-10488 | VBP | denotes | are |
T8019 | 10489-10498 | VBN | denotes | presented |
T8020 | 10499-10501 | IN | denotes | as |
T8021 | 10502-10503 | DT | denotes | a |
T8022 | 10504-10520 | NNS | denotes | box-and-whiskers |
T8023 | 10521-10525 | NN | denotes | plot |
T8024 | 10525-10526 | . | denotes | . |
T8025 | 10527-10535 | NNP | denotes | Friedman |
T8026 | 10535-10537 | POS | denotes | 's |
T8027 | 10538-10542 | NN | denotes | test |
T8028 | 10543-10546 | VBD | denotes | was |
T8029 | 10547-10551 | VBN | denotes | used |
T8030 | 10552-10554 | IN | denotes | as |
T8031 | 10555-10560 | CD | denotes | three |
T8032 | 10561-10568 | VBN | denotes | matched |
T8033 | 10569-10577 | NNS | denotes | measures |
T8034 | 10578-10582 | VBD | denotes | were |
T8035 | 10583-10591 | VBN | denotes | obtained |
T8036 | 10592-10597 | VBG | denotes | using |
T8037 | 10598-10605 | NN | denotes | placebo |
T8038 | 10605-10606 | , | denotes | , |
T8039 | 10607-10610 | CD | denotes | 100 |
T8040 | 10611-10613 | NN | denotes | µg |
T8041 | 10613-10614 | , | denotes | , |
T8042 | 10615-10618 | CC | denotes | and |
T8043 | 10619-10622 | CD | denotes | 500 |
T8044 | 10623-10625 | NN | denotes | µg |
T8045 | 10626-10628 | IN | denotes | of |
T8046 | 10629-10636 | JJ | denotes | inhaled |
T8047 | 10637-10639 | NNP | denotes | FP |
T8048 | 10639-10640 | , | denotes | , |
T8049 | 10641-10646 | WDT | denotes | which |
T8050 | 10647-10650 | VBD | denotes | had |
T8051 | 10651-10659 | JJ | denotes | variable |
T8052 | 10660-10668 | NN | denotes | baseline |
T8053 | 10669-10675 | NNS | denotes | levels |
T8054 | 10675-10676 | . | denotes | . |
T8055 | 10677-10679 | PRP | denotes | We |
T8056 | 10680-10683 | VBD | denotes | did |
T8057 | 10684-10687 | RB | denotes | not |
T8058 | 10688-10694 | VB | denotes | assume |
T8059 | 10695-10696 | DT | denotes | a |
T8060 | 10697-10705 | JJ | denotes | Gaussian |
T8061 | 10706-10718 | NN | denotes | distribution |
T8062 | 10719-10721 | IN | denotes | of |
T8063 | 10722-10725 | DT | denotes | the |
T8064 | 10726-10730 | NNS | denotes | data |
T8065 | 10731-10734 | JJ | denotes | due |
T8066 | 10735-10737 | TO | denotes | to |
T8067 | 10738-10741 | DT | denotes | the |
T8068 | 10742-10749 | JJ | denotes | limited |
T8069 | 10750-10757 | NNS | denotes | numbers |
T8070 | 10758-10760 | IN | denotes | of |
T8071 | 10761-10773 | NNS | denotes | participants |
T8072 | 10774-10782 | VBN | denotes | analysed |
T8073 | 10783-10784 | -LRB- | denotes | ( |
T8074 | 10784-10789 | CD | denotes | seven |
T8075 | 10789-10790 | -RRB- | denotes | ) |
T8076 | 10790-10791 | . | denotes | . |
T8077 | 10791-10794 | DT | denotes | The |
T8078 | 10795-10799 | NN | denotes | null |
T8079 | 10800-10810 | NN | denotes | hypothesis |
T8080 | 10811-10814 | VBD | denotes | was |
T8081 | 10815-10823 | VBN | denotes | rejected |
T8082 | 10824-10826 | IN | denotes | at |
T8083 | 10827-10828 | NN | denotes | p |
T8084 | 10828-10829 | NN | denotes | < |
T8085 | 10829-10833 | CD | denotes | 0.05 |
T8086 | 10833-10834 | . | denotes | . |
R3612 | T4177 | T4174 | punct | ),GATA-3 |
R3613 | T4178 | T4174 | cc | and,GATA-3 |
R3614 | T4179 | T4174 | conj | GR,GATA-3 |
R3615 | T4180 | T4181 | punct | (,E-20 |
R3616 | T4181 | T4174 | conj | E-20,GATA-3 |
R3617 | T4182 | T4181 | punct | ",",E-20 |
R3618 | T4183 | T4181 | amod | sc-1003,E-20 |
R3619 | T4184 | T4181 | punct | ),E-20 |
R3620 | T4185 | T4186 | auxpass | were,obtained |
R3621 | T4186 | T4186 | ROOT | obtained,obtained |
R3622 | T4187 | T4186 | prep | from,obtained |
R3623 | T4188 | T4190 | compound | Santa,Biotechnology |
R3624 | T4189 | T4190 | compound | Cruz,Biotechnology |
R3625 | T4190 | T4187 | pobj | Biotechnology,from |
R3626 | T4191 | T4190 | punct | (,Biotechnology |
R3627 | T4192 | T4193 | compound | Santa,Cruz |
R3628 | T4193 | T4190 | appos | Cruz,Biotechnology |
R3629 | T4194 | T4193 | punct | ",",Cruz |
R3630 | T4195 | T4193 | conj | California,Cruz |
R3631 | T4196 | T4195 | punct | ",",California |
R3632 | T4197 | T4198 | compound | United,States |
R3633 | T4198 | T4195 | appos | States,California |
R3634 | T4199 | T4195 | punct | ),California |
R3635 | T4200 | T4190 | punct | ",",Biotechnology |
R3636 | T4201 | T4203 | amod | polyclonal,antibodies |
R3637 | T4202 | T4203 | compound | rabbit,antibodies |
R3638 | T4203 | T4186 | dobj | antibodies,obtained |
R3639 | T4204 | T4186 | prep | against,obtained |
R3640 | T4205 | T4207 | amod | phospho-p38,kinase |
R3641 | T4206 | T4207 | compound | MAP,kinase |
R3642 | T4207 | T4204 | pobj | kinase,against |
R3643 | T4208 | T4207 | cc | and,kinase |
R3644 | T4209 | T4207 | conj | phospho-ATF-2,kinase |
R3645 | T4210 | T4207 | prep | from,kinase |
R3646 | T4211 | T4212 | compound | Cell,Signaling |
R3647 | T4212 | T4210 | pobj | Signaling,from |
R3648 | T4213 | T4225 | nmod | Technology,antibody |
R3649 | T4214 | T4217 | punct | (,Biolabs |
R3650 | T4215 | T4217 | compound | New,Biolabs |
R3651 | T4216 | T4217 | compound | England,Biolabs |
R3652 | T4217 | T4213 | appos | Biolabs,Technology |
R3653 | T4218 | T4217 | punct | ",",Biolabs |
R3654 | T4219 | T4217 | conj | Hertford,Biolabs |
R3655 | T4220 | T4219 | punct | ",",Hertford |
R3656 | T4221 | T4219 | conj | UK,Hertford |
R3657 | T4222 | T4217 | punct | ),Biolabs |
R3658 | T4223 | T4217 | punct | ",",Biolabs |
R3659 | T4224 | T4225 | amod | monoclonal,antibody |
R3660 | T4225 | T4243 | nsubj | antibody,antibodies |
R3661 | T4226 | T4225 | prep | against,antibody |
R3662 | T4227 | T4226 | pobj | phosphoserine,against |
R3663 | T4228 | T4230 | punct | (,4H4 |
R3664 | T4229 | T4230 | compound | clone,4H4 |
R3665 | T4230 | T4227 | appos | 4H4,phosphoserine |
R3666 | T4231 | T4230 | punct | ),4H4 |
R3667 | T4232 | T4230 | prep | from,4H4 |
R3668 | T4233 | T4235 | compound | Affiniti,Products |
R3669 | T4234 | T4235 | compound | Research,Products |
R3670 | T4235 | T4232 | pobj | Products,from |
R3671 | T4236 | T4235 | punct | (,Products |
R3672 | T4237 | T4235 | npadvmod | Exeter,Products |
R3673 | T4238 | T4237 | punct | ",",Exeter |
R3674 | T4239 | T4237 | appos | UK,Exeter |
R3675 | T4240 | T4237 | punct | ),Exeter |
R3676 | T4241 | T4235 | punct | ",",Products |
R3677 | T4242 | T4227 | cc | and,phosphoserine |
R3678 | T4243 | T4212 | dobj | antibodies,Signaling |
R3679 | T4244 | T4243 | prep | against,antibodies |
R3680 | T4245 | T4247 | compound | rabbit,TRITC |
R3681 | T4246 | T4247 | compound | IgG-conjugated,TRITC |
R3682 | T4247 | T4244 | pobj | TRITC,against |
R3683 | T4248 | T4247 | prep | from,TRITC |
R3684 | T4249 | T4250 | compound | Dako,Cytomation |
R3685 | T4250 | T4248 | pobj | Cytomation,from |
R3686 | T4251 | T4250 | punct | (,Cytomation |
R3687 | T4252 | T4250 | appos | Cambridge,Cytomation |
R3688 | T4253 | T4252 | punct | ",",Cambridge |
R3689 | T4254 | T4252 | appos | UK,Cambridge |
R3690 | T4255 | T4252 | punct | ),Cambridge |
R3691 | T4256 | T4186 | punct | .,obtained |
R3692 | T4257 | T4259 | det | The,antibody |
R3693 | T4258 | T4259 | amod | anti-GR,antibody |
R3694 | T4259 | T4274 | nsubjpass | antibody,used |
R3695 | T4260 | T4259 | punct | (,antibody |
R3696 | T4261 | T4259 | appos | Clone,antibody |
R3697 | T4262 | T4261 | nummod | 41,Clone |
R3698 | T4263 | T4261 | punct | ),Clone |
R3699 | T4264 | T4259 | prep | from,antibody |
R3700 | T4265 | T4267 | compound | BD,Laboratories |
R3701 | T4266 | T4267 | compound | Transduction,Laboratories |
R3292 | T3810 | T3815 | npadvmod | Participants,studied |
R3293 | T3811 | T3810 | cc | and,Participants |
R3294 | T3812 | T3813 | compound | Study,Design |
R3295 | T3813 | T3810 | conj | Design,Participants |
R3296 | T3814 | T3815 | nsubj | We,studied |
R3297 | T3815 | T3815 | ROOT | studied,studied |
R3298 | T3816 | T3815 | dobj | patients,studied |
R3299 | T3817 | T3816 | prep | with,patients |
R3300 | T3818 | T3819 | amod | mild,asthma |
R3301 | T3819 | T3817 | pobj | asthma,with |
R3302 | T3820 | T3823 | nsubjpass | who,treated |
R3303 | T3821 | T3823 | auxpass | were,treated |
R3304 | T3822 | T3823 | neg | not,treated |
R3305 | T3823 | T3816 | relcl | treated,patients |
R3306 | T3824 | T3823 | prep | with,treated |
R3307 | T3825 | T3826 | amod | inhaled,corticosteroids |
R3308 | T3826 | T3824 | pobj | corticosteroids,with |
R3309 | T3827 | T3830 | nsubjpass | who,included |
R3310 | T3828 | T3830 | aux | had,included |
R3311 | T3829 | T3830 | auxpass | been,included |
R3312 | T3830 | T3826 | relcl | included,corticosteroids |
R3313 | T3831 | T3830 | prep | in,included |
R3314 | T3832 | T3840 | det | a,study |
R3315 | T3833 | T3834 | advmod | previously,reported |
R3316 | T3834 | T3835 | amod | reported,double-blind |
R3317 | T3835 | T3840 | amod | double-blind,study |
R3318 | T3836 | T3840 | punct | ",",study |
R3319 | T3837 | T3840 | amod | placebo-controlled,study |
R3320 | T3838 | T3840 | punct | ",",study |
R3321 | T3839 | T3840 | amod | crossover,study |
R3322 | T3840 | T3831 | pobj | study,in |
R3323 | T3841 | T3840 | prep | with,study |
R3324 | T3842 | T3843 | compound | FP,[ |
R3325 | T3843 | T3841 | pobj | [,with |
R3326 | T3844 | T3845 | nummod | 34,] |
R3327 | T3845 | T3843 | appos | ],[ |
R3328 | T3846 | T3815 | punct | .,studied |
R3329 | T3847 | T3848 | nummod | Seven,patients |
R3330 | T3848 | T3852 | nsubj | patients,entered |
R3331 | T3849 | T3848 | prep | with,patients |
R3332 | T3850 | T3851 | amod | mild,asthma |
R3333 | T3851 | T3849 | pobj | asthma,with |
R3334 | T3852 | T3852 | ROOT | entered,entered |
R3335 | T3853 | T3854 | det | the,study |
R3336 | T3854 | T3852 | dobj | study,entered |
R3337 | T3855 | T3852 | cc | and,entered |
R3338 | T3856 | T3857 | auxpass | were,randomized |
R3339 | T3857 | T3852 | conj | randomized,entered |
R3340 | T3858 | T3859 | aux | to,receive |
R3341 | T3859 | T3857 | xcomp | receive,randomized |
R3342 | T3860 | T3862 | det | a,inhalation |
R3343 | T3861 | T3862 | amod | single,inhalation |
R3344 | T3862 | T3859 | dobj | inhalation,receive |
R3345 | T3863 | T3862 | prep | of,inhalation |
R3346 | T3864 | T3863 | pobj | FP,of |
R3347 | T3865 | T3864 | punct | (,FP |
R3348 | T3866 | T3864 | nummod | 100,FP |
R3349 | T3867 | T3864 | cc | and,FP |
R3350 | T3868 | T3869 | nummod | 500,µg |
R3351 | T3869 | T3864 | conj | µg,FP |
R3352 | T3870 | T3869 | punct | ),µg |
R3353 | T3871 | T3869 | cc | or,µg |
R3354 | T3872 | T3875 | det | a,control |
R3355 | T3873 | T3875 | amod | matched,control |
R3356 | T3874 | T3875 | compound | placebo,control |
R3357 | T3875 | T3869 | conj | control,µg |
R3358 | T3876 | T3859 | prep | via,receive |
R3359 | T3877 | T3879 | det | a,chamber |
R3360 | T3878 | T3879 | compound | spacer,chamber |
R3361 | T3879 | T3876 | pobj | chamber,via |
R3362 | T3880 | T3857 | punct | ",",randomized |
R3363 | T3881 | T3857 | cc | and,randomized |
R3364 | T3882 | T3884 | det | the,treatment |
R3365 | T3883 | T3884 | amod | other,treatment |
R3366 | T3884 | T3886 | nsubjpass | treatment,given |
R3367 | T3885 | T3886 | auxpass | was,given |
R3368 | T3886 | T3857 | conj | given,randomized |
R3369 | T3887 | T3898 | mark | after,taken |
R3370 | T3888 | T3890 | det | a,period |
R3371 | T3889 | T3890 | amod | wash-out,period |
R3372 | T3890 | T3898 | nsubjpass | period,taken |
R3373 | T3891 | T3890 | prep | of,period |
R3374 | T3892 | T3893 | advmod | at,least |
R3375 | T3893 | T3894 | advmod | least,6 |
R3376 | T3894 | T3895 | nummod | 6,d. |
R3377 | T3895 | T3896 | compound | d.,Blood |
R3378 | T3896 | T3891 | pobj | Blood,of |
R3389 | T3907 | T3898 | conj | h,taken |
R3390 | T3908 | T3907 | prep | after,h |
R3391 | T3909 | T3910 | compound | drug,administration |
R3392 | T3910 | T3908 | pobj | administration,after |
R3393 | T3911 | T3852 | punct | .,entered |
R3394 | T3912 | T3913 | det | All,patients |
R3395 | T3913 | T3914 | nsubj | patients,gave |
R3396 | T3914 | T3914 | ROOT | gave,gave |
R3397 | T3915 | T3916 | amod | informed,consent |
R3398 | T3916 | T3914 | dobj | consent,gave |
R3399 | T3917 | T3916 | cc | and,consent |
R3400 | T3918 | T3919 | det | the,study |
R3401 | T3919 | T3921 | nsubjpass | study,approved |
R3402 | T3920 | T3921 | auxpass | was,approved |
R3403 | T3921 | T3914 | conj | approved,gave |
R3404 | T3922 | T3921 | agent | by,approved |
R3405 | T3923 | T3925 | det | the,Committee |
R3406 | T3924 | T3925 | compound | Ethics,Committee |
R3407 | T3925 | T3922 | pobj | Committee,by |
R3408 | T3926 | T3925 | prep | of,Committee |
R3409 | T3927 | T3929 | det | the,Brompton |
R3410 | T3928 | T3929 | compound | Royal,Brompton |
R3411 | T3929 | T3926 | pobj | Brompton,of |
R3412 | T3930 | T3929 | cc | and,Brompton |
R3413 | T3931 | T3934 | compound | Harefield,Trust |
R3414 | T3932 | T3934 | compound | Hospitals,Trust |
R3415 | T3933 | T3934 | compound | NHS,Trust |
R3416 | T3934 | T3929 | conj | Trust,Brompton |
R3417 | T3935 | T3921 | punct | .,approved |
R3418 | T3936 | T3938 | det | The,study |
R3419 | T3937 | T3938 | amod | clinical,study |
R3420 | T3938 | T3940 | nsubjpass | study,conducted |
R3421 | T3939 | T3940 | auxpass | was,conducted |
R3422 | T3940 | T3940 | ROOT | conducted,conducted |
R3423 | T3941 | T3940 | prep | before,conducted |
R3424 | T3942 | T3943 | det | the,requirement |
R3425 | T3943 | T3941 | pobj | requirement,before |
R3426 | T3944 | T3943 | prep | for,requirement |
R3427 | T3945 | T3947 | compound | Clinical,Registration |
R3428 | T3946 | T3947 | compound | Trial,Registration |
R3429 | T3947 | T3944 | pobj | Registration,for |
R3430 | T3948 | T3940 | punct | .,conducted |
R3577 | T4142 | T4142 | ROOT | Antibodies,Antibodies |
R3578 | T4143 | T4142 | cc | and,Antibodies |
R3579 | T4144 | T4142 | conj | Reagents,Antibodies |
R3580 | T4145 | T4147 | det | The,antibodies |
R3581 | T4146 | T4147 | amod | monoclonal,antibodies |
R3582 | T4147 | T4159 | nsubjpass | antibodies,purchased |
R3583 | T4148 | T4147 | prep | against,antibodies |
R3584 | T4149 | T4150 | compound | human,CD3 |
R3585 | T4150 | T4148 | pobj | CD3,against |
R3586 | T4151 | T4150 | punct | ",",CD3 |
R3587 | T4152 | T4150 | conj | CD28,CD3 |
R3588 | T4153 | T4152 | punct | ",",CD28 |
R3589 | T4154 | T4152 | conj | GR,CD28 |
R3590 | T4155 | T4154 | punct | ",",GR |
R3591 | T4156 | T4154 | cc | and,GR |
R3592 | T4157 | T4154 | conj | importin-α,GR |
R3593 | T4158 | T4159 | auxpass | were,purchased |
R3594 | T4159 | T4159 | ROOT | purchased,purchased |
R3595 | T4160 | T4159 | prep | from,purchased |
R3596 | T4161 | T4162 | compound | BD,Biosciences |
R3597 | T4162 | T4160 | pobj | Biosciences,from |
R3598 | T4163 | T4162 | punct | (,Biosciences |
R3599 | T4164 | T4162 | npadvmod | Oxford,Biosciences |
R3600 | T4165 | T4164 | punct | ",",Oxford |
R3601 | T4166 | T4167 | compound | United,Kingdom |
R3602 | T4167 | T4164 | appos | Kingdom,Oxford |
R3604 | T4169 | T4159 | punct | .,purchased |
R3605 | T4170 | T4171 | compound | Rabbit,antibodies |
R3606 | T4171 | T4186 | nsubjpass | antibodies,obtained |
R3607 | T4172 | T4171 | prep | against,antibodies |
R3608 | T4173 | T4174 | compound | human,GATA-3 |
R3609 | T4174 | T4172 | pobj | GATA-3,against |
R3610 | T4175 | T4174 | punct | (,GATA-3 |
R3611 | T4176 | T4174 | appos | H-48,GATA-3 |
R3702 | T4267 | T4264 | pobj | Laboratories,from |
R3703 | T4268 | T4267 | punct | (,Laboratories |
R3704 | T4269 | T4267 | npadvmod | Oxford,Laboratories |
R3705 | T4270 | T4269 | punct | ",",Oxford |
R3706 | T4271 | T4269 | appos | UK,Oxford |
R3707 | T4272 | T4269 | punct | ),Oxford |
R3708 | T4273 | T4274 | auxpass | was,used |
R3709 | T4274 | T4274 | ROOT | used,used |
R3710 | T4275 | T4274 | prep | for,used |
R3711 | T4276 | T4278 | amod | Western,analysis |
R3712 | T4277 | T4278 | compound | blot,analysis |
R3713 | T4278 | T4275 | pobj | analysis,for |
R3714 | T4279 | T4274 | punct | .,used |
R3715 | T4280 | T4282 | det | All,reagents |
R3716 | T4281 | T4282 | amod | other,reagents |
R3727 | T4292 | T4284 | punct | .,purchased |
R3841 | T4470 | T4471 | compound | Cell,Culture |
R3842 | T4471 | T4474 | nsubj | Culture,Isolation |
R3843 | T4472 | T4471 | cc | and,Culture |
R3844 | T4473 | T4471 | conj | PBMC,Culture |
R3845 | T4474 | T4498 | nsubjpass | Isolation,cultured |
R3846 | T4475 | T4479 | det | A,line |
R3847 | T4476 | T4478 | amod | human,cell |
R3848 | T4477 | T4478 | compound | T,cell |
R3849 | T4478 | T4479 | compound | cell,line |
R3850 | T4479 | T4474 | dobj | line,Isolation |
R3851 | T4480 | T4484 | punct | (,purchased |
R3852 | T4481 | T4484 | nsubjpass | HuT-78,purchased |
R3853 | T4482 | T4481 | punct | ),HuT-78 |
R3854 | T4483 | T4484 | auxpass | was,purchased |
R3855 | T4484 | T4474 | relcl | purchased,Isolation |
R3856 | T4485 | T4484 | prep | from,purchased |
R3857 | T4486 | T4488 | compound | ECACC,Collection |
R3858 | T4487 | T4488 | compound | European,Collection |
R3859 | T4488 | T4485 | pobj | Collection,from |
R3860 | T4489 | T4488 | prep | of,Collection |
R3861 | T4490 | T4491 | compound | Cell,Culture |
R3862 | T4491 | T4489 | pobj | Culture,of |
R3863 | T4492 | T4488 | punct | (,Collection |
R3864 | T4493 | T4488 | appos | Wiltshire,Collection |
R3865 | T4494 | T4493 | punct | ",",Wiltshire |
R3866 | T4495 | T4493 | appos | UK,Wiltshire |
R3867 | T4496 | T4493 | punct | ),Wiltshire |
R3868 | T4497 | T4498 | auxpass | were,cultured |
R3869 | T4498 | T4498 | ROOT | cultured,cultured |
R3870 | T4499 | T4501 | mark | as,described |
R3871 | T4500 | T4501 | advmod | previously,described |
R3872 | T4501 | T4498 | advcl | described,cultured |
R3873 | T4502 | T4504 | nmod | [,] |
R3874 | T4503 | T4504 | nummod | 12,] |
R3875 | T4504 | T4501 | dobj | ],described |
R3876 | T4505 | T4498 | punct | .,cultured |
R3877 | T4506 | T4508 | nsubjpass | PBMCs,isolated |
R3878 | T4507 | T4508 | auxpass | were,isolated |
R3879 | T4508 | T4529 | ccomp | isolated,described |
R3880 | T4509 | T4508 | agent | by,isolated |
R3881 | T4510 | T4511 | compound | density,centrifugation |
R3882 | T4511 | T4509 | pobj | centrifugation,by |
R3883 | T4512 | T4511 | prep | over,centrifugation |
R3884 | T4513 | T4512 | pobj | Ficoll-Hypaque,over |
R3885 | T4514 | T4515 | punct | (,density |
R3886 | T4515 | T4513 | appos | density,Ficoll-Hypaque |
R3887 | T4516 | T4515 | punct | ",",density |
R3888 | T4517 | T4518 | nummod | 1.077,g/ml |
R3889 | T4518 | T4515 | appos | g/ml,density |
R3890 | T4519 | T4529 | punct | ;,described |
R3891 | T4520 | T4521 | compound | Amersham,Biosciences |
R3892 | T4521 | T4529 | nsubj | Biosciences,described |
R3893 | T4522 | T4521 | punct | ",",Biosciences |
R3894 | T4523 | T4521 | conj | Amersham,Biosciences |
R3895 | T4524 | T4523 | punct | ",",Amersham |
R3896 | T4525 | T4523 | conj | UK,Amersham |
R3897 | T4526 | T4521 | punct | ),Biosciences |
R3898 | T4527 | T4529 | mark | as,described |
R3899 | T4528 | T4529 | advmod | previously,described |
R3900 | T4529 | T4529 | ROOT | described,described |
R3901 | T4530 | T4532 | nmod | [,] |
R3902 | T4531 | T4532 | nummod | 34,] |
R3903 | T4532 | T4529 | dobj | ],described |
R3904 | T4533 | T4529 | punct | .,described |
R3905 | T4534 | T4536 | nsubjpass | Cells,stimulated |
R3906 | T4535 | T4536 | auxpass | were,stimulated |
R3907 | T4536 | T4536 | ROOT | stimulated,stimulated |
R3908 | T4537 | T4536 | prep | with,stimulated |
R3909 | T4538 | T4540 | amod | anti-CD3,CD28 |
R3910 | T4539 | T4540 | compound | /,CD28 |
R3911 | T4540 | T4537 | pobj | CD28,with |
R3912 | T4541 | T4540 | punct | (,CD28 |
R3913 | T4542 | T4543 | nummod | 1,µg |
R3914 | T4543 | T4545 | nmod | µg,ml |
R3915 | T4544 | T4545 | compound | /,ml |
R3916 | T4545 | T4540 | appos | ml,CD28 |
R3917 | T4546 | T4545 | npadvmod | each,ml |
R3918 | T4547 | T4540 | punct | ),CD28 |
R3919 | T4548 | T4536 | prep | for,stimulated |
R3920 | T4549 | T4550 | nummod | 1,h |
R3921 | T4550 | T4548 | pobj | h,for |
R3922 | T4551 | T4550 | prep | at,h |
R3923 | T4552 | T4553 | nummod | 37,° |
R3924 | T4553 | T4551 | pobj | °,at |
R3925 | T4554 | T4550 | npadvmod | C,h |
R3926 | T4555 | T4556 | aux | to,stimulate |
R3927 | T4556 | T4536 | advcl | stimulate,stimulated |
R3928 | T4557 | T4559 | amod | Th2,release |
R3929 | T4558 | T4559 | compound | cytokine,release |
R3930 | T4559 | T4556 | dobj | release,stimulate |
R3931 | T4560 | T4559 | prep | in,release |
R3932 | T4561 | T4562 | det | the,presence |
R3933 | T4562 | T4560 | pobj | presence,in |
R3934 | T4563 | T4562 | cc | or,presence |
R3935 | T4564 | T4562 | conj | absence,presence |
R3936 | T4565 | T4562 | prep | of,presence |
R3937 | T4566 | T4565 | pobj | FP,of |
R3938 | T4567 | T4569 | punct | (,− |
R3939 | T4568 | T4569 | nummod | 10,− |
R3940 | T4569 | T4566 | appos | −,FP |
R3941 | T4570 | T4572 | quantmod | 12,10 |
R3942 | T4571 | T4572 | quantmod | to,10 |
R3943 | T4572 | T4574 | nummod | 10,8M |
R3944 | T4573 | T4574 | nummod | −,8M |
R3945 | T4574 | T4569 | npadvmod | 8M,− |
R3946 | T4575 | T4569 | punct | ),− |
R3947 | T4576 | T4536 | punct | .,stimulated |
R3948 | T4577 | T4579 | nsubjpass | Cytospins,prepared |
R3949 | T4578 | T4579 | auxpass | were,prepared |
R3950 | T4579 | T4582 | amod | prepared,localization |
R3951 | T4580 | T4579 | cc | and,prepared |
R3952 | T4581 | T4579 | conj | GATA-3,prepared |
R3953 | T4582 | T4582 | ROOT | localization,localization |
R3954 | T4583 | T4582 | acl | determined,localization |
R3955 | T4584 | T4583 | agent | by,determined |
R3956 | T4585 | T4586 | amod | confocal,microscopy |
R3957 | T4586 | T4584 | pobj | microscopy,by |
R3958 | T4587 | T4589 | mark | as,described |
R3959 | T4588 | T4589 | advmod | previously,described |
R3960 | T4589 | T4582 | advcl | described,localization |
R3961 | T4590 | T4592 | nmod | [,] |
R3962 | T4591 | T4592 | nummod | 12,] |
R3963 | T4592 | T4589 | dobj | ],described |
R3964 | T4593 | T4582 | punct | .,localization |
R4061 | T4717 | T4721 | amod | Reverse,RNA |
R4062 | T4718 | T4721 | compound | Transcription,RNA |
R4063 | T4719 | T4721 | compound | PCR,RNA |
R4064 | T4720 | T4721 | compound | Total,RNA |
R4065 | T4721 | T4723 | nsubjpass | RNA,extracted |
R4066 | T4722 | T4723 | auxpass | was,extracted |
R4067 | T4723 | T4723 | ROOT | extracted,extracted |
R4068 | T4724 | T4723 | advcl | using,extracted |
R4069 | T4725 | T4726 | compound | lysis,buffer |
R4070 | T4726 | T4724 | dobj | buffer,using |
R4071 | T4727 | T4726 | punct | (,buffer |
R4072 | T4728 | T4729 | compound | RNeasy,kit |
R4073 | T4729 | T4726 | appos | kit,buffer |
R4074 | T4730 | T4726 | punct | ;,buffer |
R4075 | T4731 | T4726 | conj | Qiagen,buffer |
R4076 | T4732 | T4731 | punct | ",",Qiagen |
R4077 | T4733 | T4731 | conj | Crawley,Qiagen |
R4078 | T4734 | T4733 | punct | ",",Crawley |
R4079 | T4735 | T4733 | conj | UK,Crawley |
R4080 | T4736 | T4731 | punct | ),Qiagen |
R4081 | T4737 | T4723 | punct | .,extracted |
R4082 | T4738 | T4745 | prep | During,digested |
R4083 | T4739 | T4740 | compound | RNA,purification |
R4084 | T4740 | T4738 | pobj | purification,During |
R4085 | T4741 | T4745 | punct | ",",digested |
R4086 | T4742 | T4743 | amod | genomic,DNA |
R4087 | T4743 | T4745 | nsubjpass | DNA,digested |
R4088 | T4744 | T4745 | auxpass | was,digested |
R4089 | T4745 | T4745 | ROOT | digested,digested |
R4090 | T4746 | T4745 | prep | with,digested |
R4091 | T4747 | T4748 | compound | RNase-free,DNase |
R4092 | T4748 | T4746 | pobj | DNase,with |
R4093 | T4749 | T4751 | punct | (,Biosciences |
R4094 | T4750 | T4751 | compound | Amersham,Biosciences |
R4095 | T4751 | T4748 | appos | Biosciences,DNase |
R4096 | T4752 | T4751 | punct | ),Biosciences |
R4097 | T4753 | T4745 | punct | .,digested |
R4098 | T4754 | T4757 | advmod | Next,µg |
R4099 | T4755 | T4757 | punct | ",",µg |
R4100 | T4756 | T4757 | nummod | 0.5,µg |
R4101 | T4757 | T4763 | nsubjpass | µg,transcribed |
R4102 | T4758 | T4757 | prep | of,µg |
R4103 | T4759 | T4760 | amod | total,RNA |
R4104 | T4760 | T4758 | pobj | RNA,of |
R4105 | T4761 | T4763 | auxpass | was,transcribed |
R4106 | T4762 | T4763 | advmod | reversed,transcribed |
R4107 | T4763 | T4763 | ROOT | transcribed,transcribed |
R4108 | T4764 | T4763 | advcl | using,transcribed |
R4109 | T4765 | T4768 | det | the,virus |
R4110 | T4766 | T4767 | amod | avian,myeloblastosis |
R4111 | T4767 | T4768 | compound | myeloblastosis,virus |
R4134 | T4790 | T4793 | nsubj | Primers,were |
R4135 | T4791 | T4790 | prep | for,Primers |
R4136 | T4792 | T4791 | pobj | IL-4,for |
R4137 | T4793 | T4793 | ROOT | were,were |
R4138 | T4794 | T4793 | prep | from,were |
R4139 | T4795 | T4794 | pobj | Sigma-Genosys,from |
R4140 | T4796 | T4795 | punct | (,Sigma-Genosys |
R4141 | T4797 | T4795 | appos | Cambridge,Sigma-Genosys |
R4142 | T4798 | T4797 | punct | ",",Cambridge |
R4143 | T4799 | T4797 | appos | UK,Cambridge |
R4144 | T4800 | T4797 | punct | ),Cambridge |
R4145 | T4801 | T4793 | punct | .,were |
R4146 | T4802 | T4806 | nsubj | Sequences,are |
R4147 | T4803 | T4802 | prep | of,Sequences |
R4148 | T4804 | T4803 | pobj | GADPH,of |
R4149 | T4805 | T4802 | acl | used,Sequences |
R4150 | T4806 | T4806 | ROOT | are,are |
R4151 | T4807 | T4808 | mark | as,follows |
R4152 | T4808 | T4806 | advcl | follows,are |
R4153 | T4809 | T4806 | punct | :,are |
R4154 | T4810 | T4816 | advmod | forward,reverse |
R4155 | T4811 | T4814 | nummod | 5,CCACCCATGGCAAATTCCATGGC |
R4156 | T4812 | T4814 | punct | ′,CCACCCATGGCAAATTCCATGGC |
R4157 | T4813 | T4814 | punct | -,CCACCCATGGCAAATTCCATGGC |
R4158 | T4814 | T4816 | npadvmod | CCACCCATGGCAAATTCCATGGC,reverse |
R4159 | T4815 | T4816 | punct | ",",reverse |
R4160 | T4816 | T4820 | dep | reverse,TCTAGACGGCAGGTCAGGTCCAC |
R4161 | T4817 | T4816 | dobj | 3,reverse |
R4162 | T4818 | T4820 | punct | ′,TCTAGACGGCAGGTCAGGTCCAC |
R4163 | T4819 | T4820 | punct | -,TCTAGACGGCAGGTCAGGTCCAC |
R4164 | T4820 | T4820 | ROOT | TCTAGACGGCAGGTCAGGTCCAC,TCTAGACGGCAGGTCAGGTCCAC |
R4165 | T4821 | T4820 | punct | .,TCTAGACGGCAGGTCAGGTCCAC |
R4322 | T5013 | T5014 | compound | Cell,Fractionation |
R4323 | T5014 | T5027 | nsubjpass | Fractionation,prepared |
R4324 | T5015 | T5014 | punct | ",",Fractionation |
R4325 | T5016 | T5014 | conj | Immunoprecipitation,Fractionation |
R4326 | T5017 | T5016 | punct | ",",Immunoprecipitation |
R4327 | T5018 | T5016 | cc | and,Immunoprecipitation |
R4328 | T5019 | T5022 | amod | Western,Nuclear |
R4329 | T5020 | T5022 | compound | Blot,Nuclear |
R4330 | T5021 | T5022 | compound | Analysis,Nuclear |
R4331 | T5022 | T5016 | conj | Nuclear,Immunoprecipitation |
R4332 | T5023 | T5022 | cc | and,Nuclear |
R4333 | T5024 | T5022 | conj | cytoplasmic,Nuclear |
R4334 | T5025 | T5014 | appos | fractions,Fractionation |
R4335 | T5026 | T5027 | auxpass | were,prepared |
R4336 | T5027 | T5027 | ROOT | prepared,prepared |
R4337 | T5028 | T5030 | mark | as,described |
R4338 | T5029 | T5030 | advmod | previously,described |
R4339 | T5030 | T5027 | advcl | described,prepared |
R4340 | T5031 | T5033 | nmod | [,] |
R4341 | T5032 | T5033 | nummod | 35,] |
R4342 | T5033 | T5030 | dobj | ],described |
R4343 | T5034 | T5027 | punct | .,prepared |
R4344 | T5035 | T5037 | amod | Whole,lysates |
R4345 | T5036 | T5037 | compound | cell,lysates |
R4346 | T5037 | T5039 | nsubjpass | lysates,prepared |
R4347 | T5038 | T5039 | auxpass | were,prepared |
R4348 | T5039 | T5039 | ROOT | prepared,prepared |
R4349 | T5040 | T5039 | prep | in,prepared |
R4350 | T5041 | T5043 | compound | NP-40,buffer |
R4351 | T5042 | T5043 | compound | lysis,buffer |
R4352 | T5043 | T5040 | pobj | buffer,in |
R4353 | T5044 | T5048 | punct | (,P-40 |
R4354 | T5045 | T5046 | nummod | 0.5,% |
R4355 | T5046 | T5048 | compound | %,P-40 |
R4356 | T5047 | T5048 | compound | Nonidet,P-40 |
R4357 | T5048 | T5043 | appos | P-40,buffer |
R4358 | T5049 | T5048 | punct | ",",P-40 |
R4359 | T5050 | T5054 | nummod | 20,pH |
R4360 | T5051 | T5054 | compound | mM,pH |
R4361 | T5052 | T5054 | compound | Tris-HCl,pH |
R4415 | T5106 | T5104 | conj | importin-α,GATA-3 |
R4438 | T5129 | T5128 | punct | ",",Placid |
R4439 | T5130 | T5131 | compound | New,York |
R4440 | T5131 | T5128 | conj | York,Placid |
R4441 | T5132 | T5131 | punct | ",",York |
R4442 | T5133 | T5131 | conj | USA,York |
R4443 | T5134 | T5125 | punct | ),Biotechnology |
R4444 | T5135 | T5096 | punct | .,immunoprecipitated |
R4445 | T5136 | T5138 | amod | Western,analysis |
R4446 | T5137 | T5138 | compound | blot,analysis |
R4447 | T5138 | T5140 | nsubjpass | analysis,performed |
R4448 | T5139 | T5140 | auxpass | was,performed |
R4449 | T5140 | T5140 | ROOT | performed,performed |
R4450 | T5141 | T5140 | advcl | using,performed |
R4451 | T5142 | T5141 | dobj | anti-GATA-3,using |
R4452 | T5143 | T5142 | punct | ",",anti-GATA-3 |
R4453 | T5144 | T5142 | conj | anti-importin-α,anti-GATA-3 |
R4454 | T5145 | T5144 | punct | ",",anti-importin-α |
R4455 | T5146 | T5144 | conj | anti-GR,anti-importin-α |
R4456 | T5147 | T5146 | punct | ",",anti-GR |
R4457 | T5148 | T5150 | amod | anti-p-p38,kinase |
R4458 | T5149 | T5150 | compound | MAP,kinase |
R4459 | T5150 | T5146 | conj | kinase,anti-GR |
R4460 | T5151 | T5150 | punct | ",",kinase |
R4461 | T5152 | T5150 | conj | anti-p-ATF-2,kinase |
R4462 | T5153 | T5152 | punct | ",",anti-p-ATF-2 |
R4463 | T5154 | T5152 | cc | and,anti-p-ATF-2 |
R4464 | T5155 | T5152 | conj | anti-p-serine,anti-p-ATF-2 |
R4465 | T5156 | T5140 | punct | .,performed |
R4466 | T5157 | T5158 | amod | Immunoreactive,proteins |
R4467 | T5158 | T5160 | nsubjpass | proteins,detected |
R4468 | T5159 | T5160 | auxpass | were,detected |
R4469 | T5160 | T5160 | ROOT | detected,detected |
R4470 | T5161 | T5160 | advcl | using,detected |
R4471 | T5162 | T5166 | det | an,kit |
R4472 | T5163 | T5166 | amod | enhanced,kit |
R4473 | T5164 | T5165 | compound | chemiluminescence,ECL |
R4474 | T5165 | T5166 | compound | ECL,kit |
R4475 | T5166 | T5161 | dobj | kit,using |
R4476 | T5167 | T5166 | punct | (,kit |
R4477 | T5168 | T5169 | compound | Amersham,Biosciences |
R4478 | T5169 | T5166 | appos | Biosciences,kit |
R4479 | T5170 | T5166 | punct | ),kit |
R4480 | T5171 | T5160 | punct | .,detected |
R4593 | T5318 | T5321 | compound | Chromatin,immunoprecipitation |
R4594 | T5319 | T5321 | compound | Immunoprecipitation,immunoprecipitation |
R4595 | T5320 | T5321 | compound | Chromatin,immunoprecipitation |
R4596 | T5321 | T5326 | nsubjpass | immunoprecipitation,performed |
R4597 | T5322 | T5323 | punct | (,IP |
R4598 | T5323 | T5321 | appos | IP,immunoprecipitation |
R4599 | T5324 | T5321 | punct | ),immunoprecipitation |
R4600 | T5325 | T5326 | auxpass | was,performed |
R4601 | T5326 | T5326 | ROOT | performed,performed |
R4602 | T5327 | T5329 | mark | as,described |
R4603 | T5328 | T5329 | advmod | previously,described |
R4604 | T5329 | T5326 | advcl | described,performed |
R4605 | T5330 | T5332 | nmod | [,] |
R4606 | T5331 | T5332 | nummod | 12,] |
R4607 | T5332 | T5329 | dobj | ],described |
R4608 | T5333 | T5329 | prep | in,described |
R4609 | T5334 | T5335 | compound | HuT-78,T-cells |
R4610 | T5335 | T5333 | pobj | T-cells,in |
R4611 | T5336 | T5335 | prep | with,T-cells |
R4612 | T5337 | T5338 | nummod | 2,µg |
R4613 | T5338 | T5336 | pobj | µg,with |
R4614 | T5339 | T5338 | prep | of,µg |
R4615 | T5340 | T5339 | pobj | anti-GATA-3,of |
R4616 | T5341 | T5344 | punct | (,Biotechnology |
R4617 | T5342 | T5344 | compound | Santa,Biotechnology |
R4618 | T5343 | T5344 | compound | Cruz,Biotechnology |
R4619 | T5344 | T5340 | appos | Biotechnology,anti-GATA-3 |
R4620 | T5345 | T5344 | punct | ),Biotechnology |
R4621 | T5346 | T5344 | punct | ",",Biotechnology |
R4622 | T5347 | T5344 | cc | or,Biotechnology |
R4623 | T5348 | T5350 | amod | isotypic,G |
R4624 | T5349 | T5350 | compound | immunoglobulin,G |
R4625 | T5350 | T5344 | conj | G,Biotechnology |
R4626 | T5351 | T5338 | prep | as,µg |
R4627 | T5352 | T5354 | det | a,control |
R4628 | T5353 | T5354 | amod | non-specific,control |
R4629 | T5354 | T5351 | pobj | control,as |
R4630 | T5355 | T5358 | punct | (,Biotechnology |
R4631 | T5356 | T5357 | compound | Santa,Cruz |
R4632 | T5357 | T5358 | compound | Cruz,Biotechnology |
R4633 | T5358 | T5354 | appos | Biotechnology,control |
R4634 | T5359 | T5354 | punct | ),control |
R4635 | T5360 | T5329 | advmod | overnight,described |
R4636 | T5361 | T5329 | prep | at,described |
R4637 | T5362 | T5363 | nummod | 4,° |
R4638 | T5363 | T5366 | nummod | °,sequences |
R4639 | T5364 | T5365 | compound | C.,Promoter |
R4640 | T5365 | T5366 | compound | Promoter,sequences |
R4641 | T5366 | T5368 | nsubjpass | sequences,detected |
R4642 | T5367 | T5368 | auxpass | were,detected |
R4643 | T5368 | T5326 | conj | detected,performed |
R4644 | T5369 | T5368 | prep | with,detected |
R4645 | T5370 | T5371 | compound | PCR,primers |
R4646 | T5371 | T5369 | pobj | primers,with |
R4647 | T5372 | T5371 | prep | for,primers |
R4648 | T5373 | T5375 | det | the,promoter |
R4649 | T5374 | T5375 | compound | IL-5,promoter |
R4650 | T5375 | T5372 | pobj | promoter,for |
R4651 | T5376 | T5375 | punct | (,promoter |
R4652 | T5377 | T5388 | advmod | −,′ |
R4653 | T5378 | T5388 | meta | 445,′ |
R4654 | T5379 | T5378 | prep | to,445 |
R4655 | T5380 | T5379 | pobj | +4,to |
R4656 | T5381 | T5378 | punct | ),445 |
R4657 | T5382 | T5388 | punct | :,′ |
R4658 | T5383 | T5388 | advmod | forward,′ |
R4659 | T5384 | T5388 | nummod | 5,′ |
R4660 | T5385 | T5387 | punct | ′,TTAATCTAGCCACAGTCATAG-3 |
R4661 | T5386 | T5387 | punct | -,TTAATCTAGCCACAGTCATAG-3 |
R4662 | T5387 | T5388 | compound | TTAATCTAGCCACAGTCATAG-3,′ |
R4663 | T5388 | T5375 | appos | ′,promoter |
R4664 | T5389 | T5388 | cc | and,′ |
R4665 | T5390 | T5388 | conj | reverse,′ |
R4666 | T5391 | T5388 | punct | :,′ |
R4667 | T5392 | T5395 | nummod | 5,TCATGGCTCTGAAACGTTCTG-3 |
R4687 | T5412 | T5410 | appos | UK,Ashford |
R4688 | T5413 | T5408 | punct | ),Hybaid |
R4689 | T5414 | T5408 | prep | with,Hybaid |
R4690 | T5415 | T5416 | compound | cycling,parameters |
R4691 | T5416 | T5414 | pobj | parameters,with |
R4692 | T5417 | T5416 | prep | of,parameters |
R4693 | T5418 | T5420 | nummod | 72,C |
R4694 | T5419 | T5420 | compound | °,C |
R4695 | T5420 | T5417 | pobj | C,of |
R4696 | T5421 | T5401 | prep | for,using |
R4697 | T5422 | T5423 | nummod | 10,min |
R4698 | T5423 | T5421 | pobj | min,for |
R4699 | T5424 | T5423 | punct | ",",min |
R4700 | T5425 | T5426 | nummod | 35,cycles |
R4701 | T5426 | T5423 | appos | cycles,min |
R4702 | T5427 | T5401 | prep | at,using |
R4703 | T5428 | T5429 | nummod | 94,° |
R4704 | T5429 | T5427 | pobj | °,at |
R4705 | T5430 | T5401 | dobj | C,using |
R4706 | T5431 | T5401 | prep | for,using |
R4707 | T5432 | T5433 | nummod | 45,s |
R4708 | T5433 | T5431 | pobj | s,for |
R4709 | T5434 | T5433 | punct | ",",s |
R4710 | T5435 | T5437 | nummod | 52,C |
R4711 | T5436 | T5437 | compound | °,C |
R4712 | T5437 | T5433 | appos | C,s |
R4713 | T5438 | T5401 | prep | for,using |
R4714 | T5439 | T5438 | pobj | 45,for |
R4715 | T5440 | T5401 | dobj | s,using |
R4716 | T5441 | T5440 | punct | ",",s |
R4717 | T5442 | T5444 | nummod | 72,C |
R4718 | T5443 | T5444 | compound | °,C |
R4719 | T5444 | T5440 | appos | C,s |
R4720 | T5445 | T5401 | prep | for,using |
R4721 | T5446 | T5447 | nummod | 45,s. |
R4722 | T5447 | T5445 | pobj | s.,for |
R4970 | T5754 | T5754 | ROOT | GR-GATA-3,GR-GATA-3 |
R4971 | T5755 | T5778 | prep | In,separated |
R4972 | T5756 | T5758 | compound | Vitro,Assay |
R4973 | T5757 | T5758 | compound | Competition,Assay |
R4976 | T5760 | T5759 | pobj | Importin-α,for |
R4977 | T5761 | T5760 | punct | (,Importin-α |
R4978 | T5762 | T5763 | compound | Far-Western,ELISA |
R4979 | T5763 | T5760 | appos | ELISA,Importin-α |
R4980 | T5764 | T5760 | punct | ),Importin-α |
R4981 | T5765 | T5766 | compound | Immunoprecipitated,importin-α |
R4982 | T5766 | T5778 | nsubjpass | importin-α,separated |
R4983 | T5767 | T5772 | punct | (,Biotechnology |
R4984 | T5768 | T5772 | npadvmod | anti-importin-α,Biotechnology |
R4985 | T5769 | T5772 | punct | ",",Biotechnology |
R4986 | T5770 | T5771 | compound | Santa,Cruz |
R4987 | T5771 | T5772 | compound | Cruz,Biotechnology |
R4988 | T5772 | T5766 | appos | Biotechnology,importin-α |
R4989 | T5773 | T5772 | punct | ),Biotechnology |
R4990 | T5774 | T5772 | prep | from,Biotechnology |
R4991 | T5775 | T5776 | amod | HuT-78,cells |
R4992 | T5776 | T5774 | pobj | cells,from |
R4993 | T5777 | T5778 | auxpass | was,separated |
R4994 | T5778 | T5778 | ROOT | separated,separated |
R4995 | T5779 | T5778 | agent | by,separated |
R4996 | T5780 | T5779 | pobj | SDS-PAGE,by |
R4997 | T5781 | T5778 | cc | and,separated |
R4998 | T5782 | T5778 | conj | purified,separated |
R4999 | T5783 | T5782 | prep | from,purified |
R5000 | T5784 | T5786 | det | the,gel |
R5001 | T5785 | T5786 | amod | excised,gel |
R5002 | T5786 | T5783 | pobj | gel,from |
R5003 | T5787 | T5786 | prep | by,gel |
R5004 | T5788 | T5789 | compound | electroelution,[ |
R5005 | T5789 | T5787 | pobj | [,by |
R5006 | T5790 | T5791 | nummod | 36,] |
R5007 | T5791 | T5789 | appos | ],[ |
R5008 | T5792 | T5778 | punct | .,separated |
R5009 | T5793 | T5796 | advmod | Similarly,was |
R5010 | T5794 | T5796 | punct | ",",was |
R5011 | T5795 | T5796 | nsubj | GATA-3,was |
R5012 | T5796 | T5796 | ROOT | was,was |
R5013 | T5797 | T5796 | acomp | isolated,was |
R5014 | T5798 | T5797 | prep | from,isolated |
R5015 | T5799 | T5801 | amod | nonstimulated,cells |
R5016 | T5800 | T5801 | amod | HuT-78,cells |
R5017 | T5801 | T5798 | pobj | cells,from |
R5018 | T5802 | T5801 | cc | or,cells |
R5019 | T5803 | T5801 | conj | cells,cells |
R5020 | T5804 | T5796 | conj | stimulated,was |
R5021 | T5805 | T5804 | prep | for,stimulated |
R5022 | T5806 | T5807 | nummod | 30,min |
R5023 | T5807 | T5805 | pobj | min,for |
R5024 | T5808 | T5807 | prep | with,min |
R5025 | T5809 | T5810 | compound | anti-CD3,/ |
R5026 | T5810 | T5808 | pobj | /,with |
R5027 | T5811 | T5810 | nummod | CD28,/ |
R5028 | T5812 | T5810 | cc | and,/ |
R5029 | T5813 | T5814 | nsubj | GR,was |
R5030 | T5814 | T5796 | conj | was,was |
R5031 | T5815 | T5814 | acomp | isolated,was |
R5032 | T5816 | T5815 | prep | from,isolated |
R5033 | T5817 | T5816 | pobj | FP,from |
R5034 | T5818 | T5817 | punct | (,FP |
R5035 | T5819 | T5820 | nummod | 10,− |
R5036 | T5820 | T5817 | appos | −,FP |
R5037 | T5821 | T5822 | nummod | 8,M |
R5038 | T5822 | T5817 | conj | M,FP |
R5039 | T5823 | T5822 | punct | ",",M |
R5040 | T5824 | T5825 | nummod | 30,min |
R5041 | T5825 | T5822 | appos | min,M |
R5042 | T5826 | T5822 | punct | ),M |
R5043 | T5827 | T5814 | conj | stimulated,was |
R5044 | T5828 | T5829 | amod | HuT-78,cells |
R5045 | T5829 | T5827 | dobj | cells,stimulated |
R5046 | T5830 | T5814 | punct | .,was |
R5047 | T5831 | T5832 | det | These,proteins |
R5048 | T5832 | T5835 | nsubjpass | proteins,refolded |
R5049 | T5833 | T5835 | auxpass | were,refolded |
R5050 | T5834 | T5835 | advmod | subsequently,refolded |
R5051 | T5835 | T5835 | ROOT | refolded,refolded |
R5052 | T5836 | T5835 | prep | in,refolded |
R5053 | T5837 | T5838 | amod | glycine,solution |
R5054 | T5838 | T5836 | pobj | solution,in |
R5055 | T5839 | T5835 | punct | .,refolded |
R5056 | T5840 | T5841 | nummod | 100,µl |
R5057 | T5841 | T5852 | nsubjpass | µl,added |
R5058 | T5842 | T5841 | prep | of,µl |
R5059 | T5843 | T5844 | amod | importin-α,solution |
R5060 | T5844 | T5842 | pobj | solution,of |
R5061 | T5845 | T5844 | punct | (,solution |
R5062 | T5846 | T5847 | nummod | 100,ng/ml |
R5063 | T5847 | T5844 | appos | ng/ml,solution |
R5064 | T5848 | T5847 | prep | in,ng/ml |
R5065 | T5849 | T5848 | pobj | TBS,in |
R5066 | T5850 | T5844 | punct | ),solution |
R5067 | T5851 | T5852 | auxpass | was,added |
R5068 | T5852 | T5852 | ROOT | added,added |
R5069 | T5853 | T5852 | prep | to,added |
R5071 | T5855 | T5854 | dobj | plates,96-well |
R5072 | T5856 | T5855 | acl | coated,plates |
R5073 | T5857 | T5856 | prep | with,coated |
R5074 | T5858 | T5860 | amod | goat,antibody |
R5075 | T5859 | T5860 | amod | anti-importin-α,antibody |
R5085 | T5869 | T5870 | nummod | 100,ng/ml |
R5086 | T5870 | T5867 | appos | ng/ml,GATA-3 |
R5087 | T5871 | T5870 | prep | in,ng/ml |
R5088 | T5872 | T5871 | pobj | TBS,in |
R5089 | T5873 | T5870 | punct | ),ng/ml |
R5090 | T5874 | T5870 | prep | from,ng/ml |
R5091 | T5875 | T5878 | amod | stimulated,cells |
R5092 | T5876 | T5875 | cc | or,stimulated |
R5093 | T5877 | T5875 | conj | unstimulated,stimulated |
R5094 | T5878 | T5874 | pobj | cells,from |
R5095 | T5879 | T5880 | auxpass | were,added |
R5096 | T5880 | T5880 | ROOT | added,added |
R5097 | T5881 | T5880 | prep | to,added |
R5098 | T5882 | T5884 | det | the,wells |
R5099 | T5883 | T5884 | amod | importin-α-coated,wells |
R5100 | T5884 | T5881 | pobj | wells,to |
R5101 | T5885 | T5880 | punct | .,added |
R5102 | T5886 | T5901 | nsubjpass | GR,added |
R5103 | T5887 | T5886 | punct | (,GR |
R5104 | T5888 | T5891 | nummod | 10,ng/ml |
R5105 | T5889 | T5888 | cc | or,10 |
R5106 | T5890 | T5888 | conj | 100,10 |
R5107 | T5891 | T5886 | appos | ng/ml,GR |
R5108 | T5892 | T5891 | prep | in,ng/ml |
R5109 | T5893 | T5892 | pobj | TBS,in |
R5110 | T5894 | T5891 | punct | ),ng/ml |
R5111 | T5895 | T5891 | prep | from,ng/ml |
R5112 | T5896 | T5899 | amod | stimulated,cells |
R5113 | T5897 | T5896 | cc | or,stimulated |
R5114 | T5898 | T5896 | conj | unstimulated,stimulated |
R5115 | T5899 | T5895 | pobj | cells,from |
R5116 | T5900 | T5901 | auxpass | were,added |
R5117 | T5901 | T5901 | ROOT | added,added |
R5118 | T5902 | T5901 | prep | to,added |
R5119 | T5903 | T5904 | det | some,wells |
R5120 | T5904 | T5902 | pobj | wells,to |
R5121 | T5905 | T5901 | punct | .,added |
R5122 | T5906 | T5916 | prep | After,washed |
R5123 | T5907 | T5911 | det | a,incubation |
R5124 | T5908 | T5911 | amod | further,incubation |
R5125 | T5909 | T5910 | nummod | 1,h |
R5126 | T5910 | T5911 | compound | h,incubation |
R5127 | T5911 | T5906 | pobj | incubation,After |
R5128 | T5912 | T5916 | punct | ",",washed |
R5129 | T5913 | T5914 | det | the,plate |
R5130 | T5914 | T5916 | nsubjpass | plate,washed |
R5131 | T5915 | T5916 | auxpass | was,washed |
R5132 | T5916 | T5916 | ROOT | washed,washed |
R5133 | T5917 | T5916 | cc | and,washed |
R5134 | T5918 | T5916 | conj | incubated,washed |
R5135 | T5919 | T5918 | prep | with,incubated |
R5136 | T5920 | T5921 | amod | primary,antibodies |
R5137 | T5921 | T5919 | pobj | antibodies,with |
R5138 | T5922 | T5921 | punct | (,antibodies |
R5139 | T5923 | T5924 | det | a,mixture |
R5140 | T5924 | T5921 | appos | mixture,antibodies |
R5141 | T5925 | T5924 | prep | of,mixture |
R5142 | T5926 | T5927 | compound | rabbit,anti-GATA-3 |
R5143 | T5927 | T5925 | pobj | anti-GATA-3,of |
R5144 | T5928 | T5927 | cc | and,anti-GATA-3 |
R5145 | T5929 | T5927 | conj | mouse,anti-GATA-3 |
R5146 | T5930 | T5927 | conj | anti-GR,anti-GATA-3 |
R5147 | T5931 | T5930 | punct | ",",anti-GR |
R5148 | T5932 | T5934 | compound | Santa,Biotechnology |
R5149 | T5933 | T5934 | compound | Cruz,Biotechnology |
R5150 | T5934 | T5927 | appos | Biotechnology,anti-GATA-3 |
R5151 | T5935 | T5921 | punct | ),antibodies |
R5152 | T5936 | T5918 | prep | for,incubated |
R5153 | T5937 | T5938 | nummod | 1.5,h |
R5154 | T5938 | T5936 | pobj | h,for |
R5155 | T5939 | T5918 | punct | ",",incubated |
R5156 | T5940 | T5918 | cc | and,incubated |
R5157 | T5941 | T5942 | advmod | then,incubated |
R5158 | T5942 | T5918 | conj | incubated,incubated |
R5159 | T5943 | T5942 | prep | with,incubated |
R5160 | T5944 | T5945 | amod | secondary,antibodies |
R5161 | T5945 | T5943 | pobj | antibodies,with |
R5162 | T5946 | T5916 | punct | .,washed |
R5163 | T5947 | T5948 | nummod | FITC,swine |
R5164 | T5948 | T5949 | nsubj | swine,anti-rabbit |
R5165 | T5949 | T5959 | nsubjpass | anti-rabbit,used |
R5166 | T5950 | T5949 | dobj | IgG,anti-rabbit |
R5167 | T5951 | T5952 | punct | (,Dako |
R5168 | T5952 | T5950 | appos | Dako,IgG |
R5169 | T5953 | T5952 | punct | ",",Dako |
R5170 | T5954 | T5952 | npadvmod | Cambridge,Dako |
R5171 | T5955 | T5954 | punct | ",",Cambridge |
R5172 | T5956 | T5954 | appos | UK,Cambridge |
R5173 | T5957 | T5954 | punct | ),Cambridge |
R5174 | T5958 | T5959 | auxpass | was,used |
R5175 | T5959 | T5959 | ROOT | used,used |
R5176 | T5960 | T5959 | prep | for,used |
R5177 | T5961 | T5962 | det | the,detection |
R5178 | T5962 | T5960 | pobj | detection,for |
R5179 | T5963 | T5962 | prep | of,detection |
R5207 | T5991 | T5993 | nsubjpass | levels,measured |
R5208 | T5992 | T5993 | auxpass | were,measured |
R5209 | T5993 | T5993 | ROOT | measured,measured |
R5210 | T5994 | T5993 | prep | with,measured |
R5211 | T5995 | T5998 | det | a,reader |
R5212 | T5996 | T5998 | amod | fluorescent,reader |
R5213 | T5997 | T5998 | amod | micro-plate,reader |
R5214 | T5998 | T5994 | pobj | reader,with |
R5215 | T5999 | T5998 | punct | (,reader |
R5216 | T6000 | T5998 | appos | Bioline,reader |
R5217 | T6001 | T6000 | punct | ",",Bioline |
R5218 | T6002 | T6000 | conj | London,Bioline |
R5219 | T6003 | T6002 | punct | ",",London |
R5220 | T6004 | T6002 | conj | UK,London |
R5221 | T6005 | T5998 | punct | ),reader |
R5222 | T6006 | T5993 | punct | .,measured |
R5304 | T6161 | T6163 | compound | NF-κB,NF-κB |
R5305 | T6162 | T6163 | compound | Activation,NF-κB |
R5306 | T6163 | T6170 | nsubjpass | NF-κB,determined |
R5307 | T6164 | T6165 | amod | binding,activity |
R5308 | T6165 | T6163 | dobj | activity,NF-κB |
R5309 | T6166 | T6165 | prep | in,activity |
R5310 | T6167 | T6168 | amod | nuclear,extracts |
R5311 | T6168 | T6166 | pobj | extracts,in |
R5312 | T6169 | T6170 | auxpass | was,determined |
R5313 | T6170 | T6170 | ROOT | determined,determined |
R5342 | T6199 | T6197 | pobj | plate,with |
R5343 | T6200 | T6199 | acl | coated,plate |
R5344 | T6201 | T6200 | prep | with,coated |
R5345 | T6202 | T6204 | det | an,consensus |
R5346 | T6203 | T6204 | amod | NF-κB,consensus |
R5347 | T6204 | T6205 | compound | consensus,oligonucleotide |
R5348 | T6205 | T6201 | pobj | oligonucleotide,with |
R5349 | T6206 | T6196 | punct | .,incubated |
R5350 | T6207 | T6209 | nsubjpass | Plates,washed |
R5351 | T6208 | T6209 | auxpass | were,washed |
R5352 | T6209 | T6209 | ROOT | washed,washed |
R5353 | T6210 | T6209 | prep | before,washed |
R5354 | T6211 | T6210 | pobj | addition,before |
R5355 | T6212 | T6211 | prep | of,addition |
R5356 | T6213 | T6215 | det | an,antibody |
R5357 | T6214 | T6215 | amod | anti-p65,antibody |
R5358 | T6215 | T6212 | pobj | antibody,of |
R5359 | T6216 | T6209 | punct | .,washed |
R5360 | T6217 | T6218 | compound | Antibody,binding |
R5361 | T6218 | T6220 | nsubjpass | binding,detected |
R5362 | T6219 | T6220 | auxpass | was,detected |
R5363 | T6220 | T6220 | ROOT | detected,detected |
R5364 | T6221 | T6220 | prep | with,detected |
R5365 | T6222 | T6225 | det | a,antibody |
R5366 | T6223 | T6225 | amod | secondary,antibody |
R5367 | T6224 | T6225 | amod | HRP-conjugated,antibody |
R5368 | T6225 | T6221 | pobj | antibody,with |
R5369 | T6226 | T6220 | cc | and,detected |
R5370 | T6227 | T6220 | conj | developed,detected |
R5371 | T6228 | T6227 | prep | with,developed |
R5372 | T6229 | T6230 | compound | TMB,substrate |
R5373 | T6230 | T6228 | pobj | substrate,with |
R5374 | T6231 | T6220 | punct | .,detected |
R5375 | T6232 | T6233 | det | The,intensity |
R5376 | T6233 | T6238 | nsubjpass | intensity,measured |
R5377 | T6234 | T6233 | prep | of,intensity |
R5378 | T6235 | T6236 | det | the,reaction |
R5379 | T6236 | T6234 | pobj | reaction,of |
R5380 | T6237 | T6238 | auxpass | was,measured |
R5381 | T6238 | T6238 | ROOT | measured,measured |
R5382 | T6239 | T6238 | prep | at,measured |
R5383 | T6240 | T6241 | nummod | 450,nm |
R5384 | T6241 | T6239 | pobj | nm,at |
R5385 | T6242 | T6238 | punct | .,measured |
R5594 | T6486 | T6488 | compound | Immunofluorescence,Immunofluorescence |
R5595 | T6487 | T6488 | compound | Staining,Immunofluorescence |
R5596 | T6488 | T6491 | nsubjpass | Immunofluorescence,performed |
R5597 | T6489 | T6488 | acl | staining,Immunofluorescence |
R5598 | T6490 | T6491 | auxpass | was,performed |
R5599 | T6491 | T6491 | ROOT | performed,performed |
R5600 | T6492 | T6494 | mark | as,described |
R5601 | T6493 | T6494 | advmod | previously,described |
R5602 | T6494 | T6491 | advcl | described,performed |
R5603 | T6495 | T6497 | nmod | [,] |
R5604 | T6496 | T6497 | nummod | 34,] |
R5605 | T6497 | T6494 | dobj | ],described |
R5606 | T6498 | T6491 | punct | .,performed |
R5607 | T6499 | T6500 | det | All,staining |
R5608 | T6500 | T6502 | nsubjpass | staining,performed |
R5609 | T6501 | T6502 | auxpass | was,performed |
R5610 | T6502 | T6502 | ROOT | performed,performed |
R5611 | T6503 | T6502 | prep | at,performed |
R5612 | T6504 | T6505 | compound | room,temperature |
R5613 | T6505 | T6503 | pobj | temperature,at |
R5614 | T6506 | T6503 | cc | and,at |
R5615 | T6507 | T6503 | conj | under,at |
R5616 | T6508 | T6507 | pobj | humidification,under |
R5617 | T6509 | T6502 | punct | .,performed |
R5618 | T6510 | T6512 | nsubjpass | Cells,collected |
R5619 | T6511 | T6512 | auxpass | were,collected |
R5620 | T6512 | T6512 | ROOT | collected,collected |
R5621 | T6513 | T6512 | cc | and,collected |
R5622 | T6514 | T6512 | conj | cytospins,collected |
R5623 | T6515 | T6514 | acl | prepared,cytospins |
R5624 | T6516 | T6515 | prep | in,prepared |
R5625 | T6517 | T6518 | det | a,cytocentrifuge |
R5626 | T6518 | T6516 | pobj | cytocentrifuge,in |
R5627 | T6519 | T6521 | punct | (,II |
R5628 | T6520 | T6521 | compound | Shandon,II |
R5629 | T6521 | T6518 | appos | II,cytocentrifuge |
R5630 | T6522 | T6521 | punct | ",",II |
R5631 | T6523 | T6521 | conj | Shandon,II |
R5632 | T6524 | T6523 | punct | ",",Shandon |
R5633 | T6525 | T6523 | conj | Runcorn,Shandon |
R5634 | T6526 | T6525 | punct | ",",Runcorn |
R5635 | T6527 | T6525 | conj | UK,Runcorn |
R5636 | T6528 | T6521 | punct | ),II |
R5637 | T6529 | T6512 | punct | .,collected |
R5638 | T6530 | T6532 | nsubjpass | Cells,permeabilized |
R5639 | T6531 | T6532 | auxpass | were,permeabilized |
R5640 | T6532 | T6532 | ROOT | permeabilized,permeabilized |
R5641 | T6533 | T6532 | punct | ",",permeabilized |
R5642 | T6534 | T6532 | conj | blocked,permeabilized |
R5643 | T6535 | T6534 | punct | ",",blocked |
R5644 | T6536 | T6532 | cc | and,permeabilized |
R5645 | T6537 | T6538 | advmod | then,incubated |
R5646 | T6538 | T6532 | conj | incubated,permeabilized |
R5647 | T6539 | T6538 | prep | with,incubated |
R5648 | T6540 | T6539 | pobj | GR,with |
R5649 | T6541 | T6542 | punct | (,1 |
R5650 | T6542 | T6548 | nummod | 1,Biotechnology |
R5651 | T6543 | T6548 | nummod | ∶,Biotechnology |
R5652 | T6544 | T6545 | nummod | 50,E-20 |
R5653 | T6545 | T6548 | compound | E-20,Biotechnology |
R5654 | T6546 | T6547 | compound | Santa,Cruz |
R5655 | T6547 | T6548 | compound | Cruz,Biotechnology |
R5656 | T6548 | T6540 | appos | Biotechnology,GR |
R5657 | T6549 | T6538 | punct | ),incubated |
R5658 | T6550 | T6538 | cc | or,incubated |
R5659 | T6551 | T6538 | conj | anti-GATA-3,incubated |
R5660 | T6552 | T6559 | punct | (,antibody |
R5661 | T6553 | T6559 | amod | H-48,antibody |
R5662 | T6554 | T6559 | punct | ;,antibody |
R5663 | T6555 | T6556 | compound | Santa,Cruz |
R5664 | T6556 | T6557 | compound | Cruz,Biotechnology |
R5665 | T6557 | T6559 | compound | Biotechnology,antibody |
R5666 | T6558 | T6557 | punct | ),Biotechnology |
R5667 | T6559 | T6559 | ROOT | antibody,antibody |
R5668 | T6560 | T6559 | prep | for,antibody |
R5669 | T6561 | T6562 | nummod | 1,h |
R5670 | T6562 | T6560 | pobj | h,for |
R5671 | T6563 | T6562 | prep | at,h |
R5672 | T6564 | T6565 | compound | room,temperature |
R5673 | T6565 | T6563 | pobj | temperature,at |
R5674 | T6566 | T6532 | punct | .,permeabilized |
R5675 | T6567 | T6579 | prep | After,incubated |
R5676 | T6568 | T6569 | nummod | three,washes |
R5677 | T6569 | T6567 | pobj | washes,After |
R5678 | T6570 | T6569 | prep | in,washes |
R5679 | T6571 | T6572 | amod | phosphate-buffered,saline |
R5680 | T6572 | T6570 | pobj | saline,in |
R5681 | T6573 | T6574 | punct | (,PBS |
R5682 | T6574 | T6569 | appos | PBS,washes |
R5683 | T6575 | T6569 | punct | ),washes |
R5684 | T6576 | T6579 | punct | ",",incubated |
R5685 | T6577 | T6579 | nsubjpass | cells,incubated |
R5686 | T6578 | T6579 | auxpass | were,incubated |
R5687 | T6579 | T6579 | ROOT | incubated,incubated |
R5688 | T6580 | T6579 | prep | with,incubated |
R5689 | T6581 | T6582 | amod | tetrarhodamine,isothiocyanate |
R5690 | T6582 | T6580 | pobj | isothiocyanate,with |
R5691 | T6583 | T6586 | amod | conjugated,antibody |
R5692 | T6584 | T6586 | nmod | goat,antibody |
R5693 | T6585 | T6586 | amod | anti-rabbit,antibody |
R5694 | T6586 | T6586 | ROOT | antibody,antibody |
R5695 | T6587 | T6588 | punct | (,Dako |
R5696 | T6588 | T6586 | appos | Dako,antibody |
R5697 | T6589 | T6588 | punct | ),Dako |
R5698 | T6590 | T6586 | punct | .,antibody |
R5699 | T6591 | T6593 | nsubjpass | Cytospins,counterstained |
R5700 | T6592 | T6593 | auxpass | were,counterstained |
R5701 | T6593 | T6593 | ROOT | counterstained,counterstained |
R5702 | T6594 | T6593 | prep | with,counterstained |
R5703 | T6595 | T6596 | nummod | 4,′ |
R5704 | T6596 | T6600 | nummod | ′,dihydrochloride |
R5705 | T6597 | T6599 | punct | ",6",diamidino-2-phenylindole |
R5706 | T6598 | T6599 | punct | -,diamidino-2-phenylindole |
R5707 | T6599 | T6600 | compound | diamidino-2-phenylindole,dihydrochloride |
R5708 | T6600 | T6594 | pobj | dihydrochloride,with |
R5709 | T6601 | T6600 | punct | (,dihydrochloride |
R5710 | T6602 | T6600 | appos | DAPI,dihydrochloride |
R5711 | T6603 | T6600 | punct | ),dihydrochloride |
R5712 | T6604 | T6600 | punct | ",",dihydrochloride |
R5713 | T6605 | T6611 | det | a,stain |
R5714 | T6606 | T6611 | amod | fluorescent,stain |
R5715 | T6607 | T6609 | amod | blue,indole |
R5716 | T6608 | T6609 | amod | nuclear,indole |
R5717 | T6609 | T6611 | compound | indole,stain |
R5718 | T6610 | T6611 | compound | chromatin,stain |
R5719 | T6611 | T6600 | appos | stain,dihydrochloride |
R5720 | T6612 | T6593 | punct | ",",counterstained |
R5721 | T6613 | T6593 | cc | and,counterstained |
R5722 | T6614 | T6593 | conj | mounted,counterstained |
R5723 | T6615 | T6614 | prep | in,mounted |
R5724 | T6616 | T6615 | pobj | PBS,in |
R5725 | T6617 | T6614 | punct | :,mounted |
R5726 | T6618 | T6614 | conj | glycerol,mounted |
R5727 | T6619 | T6618 | punct | (,glycerol |
R5728 | T6620 | T6621 | nummod | 50,∶ |
R5729 | T6621 | T6618 | appos | ∶,glycerol |
R5730 | T6622 | T6621 | nummod | 50,∶ |
R5731 | T6623 | T6618 | punct | ),glycerol |
R5732 | T6624 | T6593 | punct | .,counterstained |
R5733 | T6625 | T6627 | det | The,signal |
R5734 | T6626 | T6627 | amod | immunopositive,signal |
R5735 | T6627 | T6629 | nsubjpass | signal,characterised |
R5736 | T6628 | T6629 | auxpass | was,characterised |
R5737 | T6629 | T6629 | ROOT | characterised,characterised |
R5738 | T6630 | T6629 | advcl | using,characterised |
R5739 | T6631 | T6632 | nmod | laser,scanning |
R5740 | T6632 | T6630 | dobj | scanning,using |
R5741 | T6633 | T6634 | amod | confocal,microscopy |
R5742 | T6634 | T6632 | dobj | microscopy,scanning |
R5743 | T6635 | T6632 | prep | on,scanning |
R5744 | T6636 | T6642 | det | a,cytometer |
R5745 | T6637 | T6639 | nmod | Leica,NT/SP |
R5746 | T6638 | T6639 | compound | TCS,NT/SP |
R5747 | T6639 | T6642 | nmod | NT/SP,cytometer |
R5748 | T6640 | T6642 | amod | interactive,cytometer |
R5749 | T6641 | T6642 | compound | laser,cytometer |
R5750 | T6642 | T6635 | pobj | cytometer,on |
R5751 | T6643 | T6642 | acl | equipped,cytometer |
R5752 | T6644 | T6643 | prep | with,equipped |
R5753 | T6645 | T6646 | compound | confocal,optics |
R5754 | T6646 | T6644 | pobj | optics,with |
R5782 | T6674 | T6675 | det | the,primary |
R5783 | T6675 | T6673 | pobj | primary,without |
R5784 | T6676 | T6677 | auxpass | were,used |
R5785 | T6677 | T6677 | ROOT | used,used |
R5786 | T6678 | T6677 | prep | as,used |
R5787 | T6679 | T6678 | pobj | controls,as |
R5788 | T6680 | T6677 | punct | .,used |
R5789 | T6681 | T6682 | advmod | Positively,stained |
R5790 | T6682 | T6683 | amod | stained,nuclei |
R5791 | T6683 | T6688 | nsubjpass | nuclei,counted |
R5792 | T6684 | T6683 | cc | and,nuclei |
R5793 | T6685 | T6686 | amod | total,cells |
R5794 | T6686 | T6683 | conj | cells,nuclei |
R5795 | T6687 | T6688 | auxpass | were,counted |
R5796 | T6688 | T6688 | ROOT | counted,counted |
R5797 | T6689 | T6688 | punct | (,counted |
R5798 | T6690 | T6688 | npadvmod | 500,counted |
R5799 | T6691 | T6688 | punct | ),counted |
R5800 | T6692 | T6688 | prep | on,counted |
R5801 | T6693 | T6694 | det | each,slide |
R5802 | T6694 | T6692 | pobj | slide,on |
R5803 | T6695 | T6694 | prep | with,slide |
R5804 | T6696 | T6697 | det | the,observer |
R5805 | T6697 | T6695 | pobj | observer,with |
R5806 | T6698 | T6688 | conj | blinded,counted |
R5807 | T6699 | T6698 | prep | to,blinded |
R5808 | T6700 | T6701 | det | the,treatment |
R5809 | T6701 | T6699 | pobj | treatment,to |
R5810 | T6702 | T6688 | punct | .,counted |
R5958 | T6937 | T6938 | compound | GATA-3-GFP,Construct |
R5959 | T6938 | T6948 | nsubjpass | Construct,obtained |
R5960 | T6939 | T6941 | det | The,clone |
R5961 | T6940 | T6941 | compound | GATA-3,clone |
R5962 | T6941 | T6938 | appos | clone,Construct |
R5963 | T6942 | T6943 | punct | (,BC003070 |
R5964 | T6943 | T6941 | appos | BC003070,clone |
R5965 | T6944 | T6941 | punct | ),clone |
R5966 | T6945 | T6946 | amod | complete,cDNA |
R5967 | T6946 | T6948 | nsubjpass | cDNA,obtained |
R5968 | T6947 | T6948 | auxpass | was,obtained |
R5969 | T6948 | T6948 | ROOT | obtained,obtained |
R5970 | T6949 | T6948 | prep | from,obtained |
R5971 | T6950 | T6952 | compound | Invitrogen,Technologies |
R5972 | T6951 | T6952 | compound | Life,Technologies |
R5973 | T6952 | T6949 | pobj | Technologies,from |
R5974 | T6953 | T6948 | prep | as,obtained |
R5975 | T6954 | T6962 | det | a,insert |
R5976 | T6955 | T6958 | nummod | 5,EcoRI/3 |
R5977 | T6956 | T6958 | punct | ′,EcoRI/3 |
R5978 | T6957 | T6958 | punct | -,EcoRI/3 |
R5979 | T6958 | T6962 | compound | EcoRI/3,insert |
R5980 | T6959 | T6961 | punct | ′,XhoI |
R5981 | T6960 | T6961 | punct | -,XhoI |
R5982 | T6961 | T6962 | compound | XhoI,insert |
R5983 | T6962 | T6953 | pobj | insert,as |
R5984 | T6963 | T6962 | prep | of,insert |
R5985 | T6964 | T6963 | pobj | GATA-3,of |
R5986 | T6965 | T6962 | prep | in,insert |
R5987 | T6966 | T6968 | det | the,vector |
R5988 | T6967 | T6968 | compound | pOTB7,vector |
R5989 | T6968 | T6965 | pobj | vector,in |
R5990 | T6969 | T6948 | punct | .,obtained |
R5991 | T6970 | T6972 | nsubjpass | GATA-3,excised |
R5992 | T6971 | T6972 | auxpass | was,excised |
R5993 | T6972 | T6972 | ROOT | excised,excised |
R5994 | T6973 | T6972 | prep | from,excised |
R5995 | T6974 | T6973 | pobj | pOTB7,from |
R5996 | T6975 | T6972 | advcl | using,excised |
R5997 | T6976 | T6977 | compound | XhoI,digestion |
R5998 | T6977 | T6975 | dobj | digestion,using |
R5999 | T6978 | T6977 | cc | and,digestion |
R6000 | T6979 | T6977 | conj | pEGFP-C2,digestion |
R6001 | T6980 | T6981 | punct | (,Clontech |
R6002 | T6981 | T6977 | appos | Clontech,digestion |
R6003 | T6982 | T6981 | punct | ",",Clontech |
R6004 | T6983 | T6981 | conj | Saint-Germain-en-Laye,Clontech |
R6005 | T6984 | T6983 | punct | ",",Saint-Germain-en-Laye |
R6006 | T6985 | T6983 | conj | France,Saint-Germain-en-Laye |
R6007 | T6986 | T6981 | punct | ),Clontech |
R6008 | T6987 | T6988 | auxpass | was,digested |
R6009 | T6988 | T6972 | advcl | digested,excised |
R6010 | T6989 | T6988 | prep | with,digested |
R6011 | T6990 | T6989 | pobj | BamHI,with |
R6012 | T6991 | T6972 | punct | .,excised |
R6013 | T6992 | T6994 | nsubjpass | DNA,recovered |
R6014 | T6993 | T6994 | auxpass | was,recovered |
R6015 | T6994 | T6994 | ROOT | recovered,recovered |
R6016 | T6995 | T6994 | agent | by,recovered |
R6017 | T6996 | T6997 | compound | phenol,extraction |
R6018 | T6997 | T6995 | pobj | extraction,by |
R6019 | T6998 | T6997 | cc | and,extraction |
R6020 | T6999 | T7000 | compound | ethanol,precipitation |
R6021 | T7000 | T6997 | conj | precipitation,extraction |
R6022 | T7001 | T6994 | punct | ",",recovered |
R6023 | T7002 | T6994 | cc | and,recovered |
R6024 | T7003 | T7006 | preconj | both,fragment |
R6025 | T7004 | T7006 | det | the,fragment |
R6026 | T7005 | T7006 | compound | GATA-3,fragment |
R6027 | T7006 | T7029 | nsubjpass | fragment,inactivated |
R6028 | T7007 | T7006 | cc | and,fragment |
R6029 | T7008 | T7010 | det | the,vector |
R6030 | T7009 | T7010 | compound | pEGFP-C2,vector |
R6031 | T7010 | T7006 | conj | vector,fragment |
R6032 | T7011 | T7006 | acl | blunt-ended,fragment |
R6033 | T7012 | T7011 | agent | by,blunt-ended |
R6034 | T7013 | T7012 | pobj | incubation,by |
R6035 | T7014 | T7011 | prep | with,blunt-ended |
R6036 | T7015 | T7014 | pobj | Klenow,with |
R6037 | T7016 | T7015 | punct | (,Klenow |
R6038 | T7017 | T7018 | compound | Bioline,Bio-27029 |
R6039 | T7018 | T7015 | appos | Bio-27029,Klenow |
R6040 | T7019 | T7015 | punct | ),Klenow |
R6041 | T7020 | T7011 | prep | for,blunt-ended |
R6042 | T7021 | T7022 | nummod | 30,min |
R6043 | T7022 | T7020 | pobj | min,for |
R6044 | T7023 | T7022 | prep | at,min |
R6045 | T7024 | T7025 | nummod | 37,° |
R6046 | T7025 | T7027 | nummod | °,Klenow |
R6047 | T7026 | T7027 | compound | C.,Klenow |
R6048 | T7027 | T7023 | pobj | Klenow,at |
R6049 | T7028 | T7029 | auxpass | was,inactivated |
R6050 | T7029 | T6994 | conj | inactivated,recovered |
R6051 | T7030 | T7029 | agent | by,inactivated |
R6052 | T7031 | T7030 | pobj | incubation,by |
R6053 | T7032 | T7029 | prep | for,inactivated |
R6054 | T7033 | T7034 | nummod | 10,min |
R6055 | T7034 | T7032 | pobj | min,for |
R6056 | T7035 | T7034 | prep | at,min |
R6057 | T7036 | T7037 | nummod | 75,° |
R6058 | T7037 | T7039 | nummod | °,DNA |
R6059 | T7038 | T7039 | compound | C.,DNA |
R6060 | T7039 | T7035 | pobj | DNA,at |
R6061 | T7040 | T7041 | auxpass | was,recovered |
R6062 | T7041 | T6994 | conj | recovered,recovered |
R6063 | T7042 | T7041 | agent | by,recovered |
R6064 | T7043 | T7044 | compound | phenol,extraction |
R6065 | T7044 | T7042 | pobj | extraction,by |
R6066 | T7045 | T7044 | cc | and,extraction |
R6067 | T7046 | T7047 | compound | ethanol,precipitation |
R6068 | T7047 | T7044 | conj | precipitation,extraction |
R6069 | T7048 | T7041 | punct | ",",recovered |
R6070 | T7049 | T6994 | cc | and,recovered |
R6071 | T7050 | T7054 | preconj | both,fragment |
R6072 | T7051 | T7054 | det | the,fragment |
R6073 | T7052 | T7054 | amod | blunt-ended,fragment |
R6074 | T7053 | T7054 | compound | GATA-3,fragment |
R6075 | T7054 | T7061 | nsubjpass | fragment,digested |
R6076 | T7055 | T7054 | cc | and,fragment |
R6077 | T7056 | T7058 | det | the,vector |
R6078 | T7057 | T7058 | compound | GFP,vector |
R6079 | T7058 | T7054 | conj | vector,fragment |
R6080 | T7059 | T7061 | auxpass | were,digested |
R6081 | T7060 | T7061 | advmod | subsequently,digested |
R6082 | T7061 | T6994 | conj | digested,recovered |
R6083 | T7062 | T7061 | prep | with,digested |
R6084 | T7063 | T7062 | pobj | EcoRI,with |
R6085 | T7064 | T7061 | prep | before,digested |
R6086 | T7065 | T7070 | det | the,′ |
R6087 | T7066 | T7070 | nummod | 5,′ |
R6088 | T7067 | T7069 | punct | ′,EcoRI/3 |
R6089 | T7068 | T7069 | punct | -,EcoRI/3 |
R6090 | T7069 | T7070 | compound | EcoRI/3,′ |
R6091 | T7070 | T7064 | pobj | ′,before |
R6092 | T7071 | T7074 | amod | blunt,fragment |
R6093 | T7072 | T7074 | compound | end,fragment |
R6094 | T7073 | T7074 | compound | GATA-3,fragment |
R6095 | T7074 | T7076 | nsubjpass | fragment,inserted |
R6096 | T7075 | T7076 | auxpass | was,inserted |
R6097 | T7076 | T6994 | conj | inserted,recovered |
R6098 | T7077 | T7076 | prep | into,inserted |
R6099 | T7078 | T7083 | det | the,′ |
R6100 | T7079 | T7082 | nummod | 5,EcoRI/3 |
R6101 | T7080 | T7082 | punct | ′,EcoRI/3 |
R6247 | T7294 | T7286 | appos | serum,h |
R6248 | T7295 | T7294 | prep | in,serum |
R6249 | T7296 | T7295 | pobj | RPMI1640,in |
R6250 | T7297 | T7298 | nummod | +15,L-glutamine |
R6251 | T7298 | T7294 | appos | L-glutamine,serum |
R6252 | T7299 | T7286 | punct | ),h |
R6253 | T7300 | T7258 | prep | according,transfected |
R6254 | T7301 | T7300 | prep | to,according |
R6255 | T7302 | T7305 | det | the,protocol |
R6256 | T7303 | T7305 | amod | general,protocol |
R6257 | T7304 | T7305 | compound | Amaxa,protocol |
R6258 | T7305 | T7301 | pobj | protocol,to |
R6412 | T7474 | T7475 | compound | Microscopy,HuT-78 |
R6413 | T7475 | T7476 | compound | HuT-78,cells |
R6414 | T7476 | T7480 | nsubjpass | cells,maintained |
R6415 | T7477 | T7476 | acl | expressing,cells |
R6416 | T7478 | T7477 | dobj | GATA-3-GFP,expressing |
R6417 | T7479 | T7480 | auxpass | were,maintained |
R6418 | T7480 | T7480 | ROOT | maintained,maintained |
R6419 | T7481 | T7480 | prep | at,maintained |
R6420 | T7482 | T7483 | nummod | 37,° |
R6421 | T7483 | T7484 | nummod | °,C |
R6422 | T7484 | T7481 | pobj | C,at |
R6423 | T7485 | T7484 | prep | in,C |
R6424 | T7486 | T7487 | compound | growth,medium |
R6425 | T7487 | T7485 | pobj | medium,in |
R6426 | T7488 | T7480 | prep | in,maintained |
R6427 | T7489 | T7493 | det | a,chamber |
R6428 | T7490 | T7493 | amod | closed,chamber |
R6429 | T7491 | T7493 | nummod | FCS2,chamber |
R6430 | T7492 | T7493 | compound | perfusion,chamber |
R6431 | T7493 | T7488 | pobj | chamber,in |
R6432 | T7494 | T7495 | punct | (,Bioptechs |
R6433 | T7495 | T7493 | appos | Bioptechs,chamber |
R6434 | T7496 | T7495 | punct | ",",Bioptechs |
R6435 | T7497 | T7495 | conj | Butler,Bioptechs |
R6436 | T7498 | T7497 | punct | ",",Butler |
R6437 | T7499 | T7497 | conj | Pennsylvania,Butler |
R6438 | T7500 | T7499 | punct | ",",Pennsylvania |
R6439 | T7501 | T7499 | conj | USA,Pennsylvania |
R6440 | T7502 | T7480 | punct | ),maintained |
R6441 | T7503 | T7480 | conj | combined,maintained |
R6442 | T7504 | T7503 | prep | with,combined |
R6443 | T7505 | T7507 | det | an,heater |
R6444 | T7506 | T7507 | amod | objective,heater |
R6445 | T7507 | T7504 | pobj | heater,with |
R6446 | T7508 | T7507 | punct | (,heater |
R6447 | T7509 | T7507 | appos | Bioptechs,heater |
R6448 | T7510 | T7507 | punct | ),heater |
R6449 | T7511 | T7503 | prep | on,combined |
R6450 | T7512 | T7513 | det | the,stage |
R6451 | T7513 | T7511 | pobj | stage,on |
R6452 | T7514 | T7518 | det | a,microscope |
R6453 | T7515 | T7516 | compound | Zeiss,Axiovert |
R6454 | T7516 | T7518 | nmod | Axiovert,microscope |
R6455 | T7517 | T7518 | nummod | 200,microscope |
R6456 | T7518 | T7503 | npadvmod | microscope,combined |
R6457 | T7519 | T7520 | punct | (,Thornwood |
R6458 | T7520 | T7518 | appos | Thornwood,microscope |
R6459 | T7521 | T7520 | punct | ",",Thornwood |
R6460 | T7522 | T7523 | compound | New,York |
R6461 | T7523 | T7520 | npadvmod | York,Thornwood |
R6462 | T7524 | T7523 | punct | ",",York |
R6463 | T7525 | T7520 | appos | USA,Thornwood |
R6464 | T7526 | T7520 | punct | ),Thornwood |
R6465 | T7527 | T7480 | punct | .,maintained |
R6466 | T7528 | T7530 | nsubjpass | Observations,made |
R6467 | T7529 | T7530 | auxpass | were,made |
R6468 | T7530 | T7530 | ROOT | made,made |
R6469 | T7531 | T7530 | agent | by,made |
R6470 | T7532 | T7534 | nummod | 40,1.0 |
R6471 | T7533 | T7534 | nummod | ×,1.0 |
R6472 | T7534 | T7531 | pobj | 1.0,by |
R6473 | T7535 | T7538 | nmod | NA,lens |
R6474 | T7536 | T7538 | amod | oil-immersion,lens |
R6475 | T7537 | T7538 | amod | objective,lens |
R6476 | T7538 | T7545 | nmod | lens,images |
R6477 | T7539 | T7538 | punct | ",",lens |
R6478 | T7540 | T7538 | cc | and,lens |
R6479 | T7541 | T7538 | conj | fluorescence,lens |
R6480 | T7542 | T7541 | cc | and,fluorescence |
R6481 | T7543 | T7541 | conj | phase,fluorescence |
R6482 | T7544 | T7545 | compound | contrast,images |
R6483 | T7545 | T7547 | nsubjpass | images,gathered |
R6484 | T7546 | T7547 | auxpass | were,gathered |
R6485 | T7547 | T7530 | conj | gathered,made |
R6486 | T7548 | T7547 | advcl | using,gathered |
R6487 | T7549 | T7551 | det | a,ORCA-ER |
R6488 | T7550 | T7551 | compound | Hamamatsu,ORCA-ER |
R6489 | T7551 | T7548 | dobj | ORCA-ER,using |
R6490 | T7552 | T7547 | conj | charged,gathered |
R6491 | T7553 | T7555 | amod | coupled,camera |
R6492 | T7554 | T7555 | compound | device,camera |
R6493 | T7555 | T7552 | dobj | camera,charged |
R6494 | T7556 | T7564 | punct | (,driven |
R6495 | T7557 | T7564 | dep | Bridgewater,driven |
R6496 | T7558 | T7557 | punct | ",",Bridgewater |
R6497 | T7559 | T7560 | compound | New,Jersey |
R6498 | T7560 | T7557 | conj | Jersey,Bridgewater |
R6499 | T7561 | T7560 | punct | ",",Jersey |
R6500 | T7562 | T7560 | conj | USA,Jersey |
R6501 | T7563 | T7564 | punct | ),driven |
R6502 | T7564 | T7552 | advcl | driven,charged |
R6503 | T7565 | T7564 | agent | by,driven |
R6504 | T7566 | T7567 | compound | Openlab,software |
R6505 | T7567 | T7565 | pobj | software,by |
R6506 | T7568 | T7569 | punct | (,Improvision |
R6507 | T7569 | T7567 | appos | Improvision,software |
R6508 | T7570 | T7569 | punct | ",",Improvision |
R6509 | T7571 | T7569 | npadvmod | Coventry,Improvision |
R6510 | T7572 | T7571 | punct | ",",Coventry |
R6511 | T7573 | T7571 | appos | UK,Coventry |
R6512 | T7574 | T7571 | punct | ),Coventry |
R6513 | T7575 | T7547 | punct | .,gathered |
R6514 | T7576 | T7578 | nsubjpass | Photographs,taken |
R6515 | T7577 | T7578 | auxpass | were,taken |
R6516 | T7578 | T7578 | ROOT | taken,taken |
R6517 | T7579 | T7578 | prep | at,taken |
R6518 | T7580 | T7579 | pobj | 0,at |
R6519 | T7581 | T7580 | punct | ",",0 |
R6520 | T7582 | T7580 | appos | 30,0 |
R6521 | T7583 | T7580 | punct | ",",0 |
R6522 | T7584 | T7580 | appos | 60,0 |
R6523 | T7585 | T7584 | punct | ",",60 |
R6524 | T7586 | T7584 | conj | 120,60 |
R6525 | T7587 | T7578 | punct | ",",taken |
R6526 | T7588 | T7578 | cc | and,taken |
R6527 | T7589 | T7590 | nummod | 240,min |
R6528 | T7590 | T7578 | conj | min,taken |
R6529 | T7591 | T7578 | punct | .,taken |
R6614 | T7691 | T7693 | compound | Densitometric,Densitometry |
R6615 | T7692 | T7693 | compound | Analysis,Densitometry |
R6616 | T7693 | T7698 | nsubjpass | Densitometry,performed |
R6617 | T7694 | T7693 | prep | of,Densitometry |
R6618 | T7695 | T7696 | compound | ECL,immunoblots |
R6619 | T7696 | T7694 | pobj | immunoblots,of |
R6620 | T7697 | T7698 | auxpass | was,performed |
R6621 | T7698 | T7698 | ROOT | performed,performed |
R6622 | T7699 | T7698 | advcl | using,performed |
R6623 | T7700 | T7703 | nmod | Gelworks,software |
R6624 | T7701 | T7703 | nmod | ID,software |
R6625 | T7702 | T7703 | amod | intermediate,software |
R6626 | T7703 | T7699 | dobj | software,using |
R6627 | T7704 | T7706 | punct | (,Products |
R6628 | T7705 | T7706 | compound | Ultraviolet,Products |
R6629 | T7706 | T7703 | appos | Products,software |
R6630 | T7707 | T7706 | punct | ",",Products |
R6631 | T7708 | T7706 | conj | Cambridgeshire,Products |
R6632 | T7709 | T7708 | punct | ",",Cambridgeshire |
R6633 | T7710 | T7708 | appos | UK,Cambridgeshire |
R6634 | T7711 | T7708 | punct | ),Cambridgeshire |
R6635 | T7712 | T7698 | punct | .,performed |
R6636 | T7713 | T7717 | advmod | Briefly,scanned |
R6637 | T7714 | T7717 | punct | ",",scanned |
R6638 | T7715 | T7717 | nsubjpass | immunoblots,scanned |
R6639 | T7716 | T7717 | auxpass | were,scanned |
R6640 | T7717 | T7717 | ROOT | scanned,scanned |
R6641 | T7718 | T7717 | cc | and,scanned |
R6642 | T7719 | T7721 | nsubjpass | gates,drawn |
R6643 | T7720 | T7721 | auxpass | were,drawn |
R6644 | T7721 | T7717 | conj | drawn,scanned |
R6645 | T7722 | T7721 | advmod | tightly,drawn |
R6646 | T7723 | T7721 | prep | around,drawn |
R6647 | T7724 | T7725 | det | each,band |
R6648 | T7725 | T7723 | pobj | band,around |
R6649 | T7726 | T7721 | punct | .,drawn |
R6650 | T7727 | T7728 | compound | Background,values |
R6651 | T7728 | T7733 | nsubjpass | values,subtracted |
R6652 | T7729 | T7728 | prep | from,values |
R6653 | T7730 | T7731 | det | each,lane |
R6654 | T7731 | T7729 | pobj | lane,from |
R6655 | T7732 | T7733 | auxpass | were,subtracted |
R6656 | T7733 | T7733 | ROOT | subtracted,subtracted |
R6657 | T7734 | T7735 | aux | to,normalize |
R6658 | T7735 | T7733 | xcomp | normalize,subtracted |
R6659 | T7736 | T7737 | det | each,measurement |
R6660 | T7737 | T7735 | dobj | measurement,normalize |
R6661 | T7738 | T7733 | punct | .,subtracted |
R6662 | T7739 | T7740 | det | The,bands |
R6663 | T7740 | T7742 | nsubjpass | bands,quantified |
R6664 | T7741 | T7742 | auxpass | were,quantified |
R6665 | T7742 | T7742 | ROOT | quantified,quantified |
R6666 | T7743 | T7742 | advcl | using,quantified |
R6667 | T7744 | T7746 | det | the,software |
R6668 | T7745 | T7746 | compound | Gelworks,software |
R6669 | T7746 | T7743 | dobj | software,using |
R6670 | T7747 | T7742 | punct | .,quantified |
R6671 | T7748 | T7750 | det | All,blots |
R6672 | T7749 | T7750 | amod | Western,blots |
R6673 | T7750 | T7752 | nsubjpass | blots,exposed |
R6674 | T7751 | T7752 | auxpass | were,exposed |
R6675 | T7752 | T7752 | ROOT | exposed,exposed |
R6676 | T7753 | T7752 | prep | to,exposed |
R6677 | T7754 | T7753 | pobj | film,to |
R6678 | T7755 | T7754 | prep | for,film |
R6679 | T7756 | T7757 | amod | varying,lengths |
R6680 | T7757 | T7755 | pobj | lengths,for |
R6681 | T7758 | T7757 | prep | of,lengths |
R6682 | T7759 | T7758 | pobj | time,of |
R6683 | T7760 | T7752 | punct | ",",exposed |
R6684 | T7761 | T7752 | cc | and,exposed |
R6685 | T7762 | T7763 | advmod | only,films |
R6686 | T7763 | T7770 | nsubjpass | films,selected |
R6687 | T7764 | T7763 | acl | generating,films |
R6688 | T7765 | T7766 | amod | subsaturating,levels |
R6689 | T7766 | T7764 | dobj | levels,generating |
R6690 | T7767 | T7766 | prep | of,levels |
R6691 | T7768 | T7767 | pobj | intensity,of |
R6692 | T7769 | T7770 | auxpass | were,selected |
R6693 | T7770 | T7752 | conj | selected,exposed |
R6694 | T7771 | T7770 | prep | for,selected |
R6695 | T7772 | T7773 | amod | densitometric,evaluation |
R6696 | T7773 | T7771 | pobj | evaluation,for |
R6697 | T7774 | T7770 | punct | .,selected |
R6852 | T7934 | T7935 | compound | Statistical,Analysis |
R6853 | T7935 | T7936 | compound | Analysis,Data |
R6854 | T7936 | T7944 | nsubjpass | Data,presented |
R6855 | T7937 | T7936 | prep | from,Data |
R6856 | T7938 | T7942 | nummod | three,experiments |
R6857 | T7939 | T7938 | cc | or,three |
R6858 | T7940 | T7938 | conj | more,three |
R6859 | T7941 | T7942 | amod | independent,experiments |
R6860 | T7942 | T7937 | pobj | experiments,from |
R6861 | T7943 | T7944 | auxpass | are,presented |
R6862 | T7944 | T7944 | ROOT | presented,presented |
R6863 | T7945 | T7944 | prep | as,presented |
R6864 | T7946 | T7950 | det | the,error |
R6865 | T7947 | T7950 | amod | mean,error |
R6866 | T7948 | T7950 | compound | ±,error |
R6867 | T7949 | T7950 | compound | standard,error |
R6868 | T7950 | T7945 | pobj | error,as |
R6869 | T7951 | T7950 | prep | of,error |
R6870 | T7952 | T7953 | det | the,mean |
R6871 | T7953 | T7951 | pobj | mean,of |
R6872 | T7954 | T7955 | punct | (,SEM |
R6873 | T7955 | T7953 | appos | SEM,mean |
R6874 | T7956 | T7955 | punct | ),SEM |
R6875 | T7957 | T7950 | punct | ",",error |
R6876 | T7958 | T7950 | prep | except,error |
R6877 | T7959 | T7960 | advmod | where,stated |
R6878 | T7960 | T7958 | pcomp | stated,except |
R6879 | T7961 | T7944 | cc | and,presented |
R6880 | T7962 | T7963 | auxpass | were,compared |
R6881 | T7963 | T7944 | conj | compared,presented |
R6882 | T7964 | T7963 | advcl | using,compared |
R6930 | T8012 | T8009 | dobj | test,signed |
R6931 | T8013 | T8009 | punct | .,signed |
R6932 | T8014 | T8019 | nsubjpass | Data,presented |
R6933 | T8015 | T8014 | prep | from,Data |
R6934 | T8016 | T8017 | det | this,analysis |
R6935 | T8017 | T8015 | pobj | analysis,from |
R6936 | T8018 | T8019 | auxpass | are,presented |
R6937 | T8019 | T8019 | ROOT | presented,presented |
R6938 | T8020 | T8019 | prep | as,presented |
R6939 | T8021 | T8023 | det | a,plot |
R6940 | T8022 | T8023 | compound | box-and-whiskers,plot |
R6941 | T8023 | T8020 | pobj | plot,as |
R6942 | T8024 | T8019 | punct | .,presented |
R6943 | T8025 | T8027 | poss | Friedman,test |
R6944 | T8026 | T8025 | case | 's,Friedman |
R6945 | T8027 | T8029 | nsubjpass | test,used |
R6946 | T8028 | T8029 | auxpass | was,used |
R6947 | T8029 | T8029 | ROOT | used,used |
R6948 | T8030 | T8035 | mark | as,obtained |
R6949 | T8031 | T8033 | nummod | three,measures |
R6950 | T8032 | T8033 | amod | matched,measures |
R6951 | T8033 | T8035 | nsubjpass | measures,obtained |
R6952 | T8034 | T8035 | auxpass | were,obtained |
R6953 | T8035 | T8029 | advcl | obtained,used |
R6954 | T8036 | T8035 | advcl | using,obtained |
R6955 | T8037 | T8036 | dobj | placebo,using |
R6956 | T8038 | T8037 | punct | ",",placebo |
R6957 | T8039 | T8040 | nummod | 100,µg |
R6958 | T8040 | T8037 | conj | µg,placebo |
R6959 | T8041 | T8040 | punct | ",",µg |
R6960 | T8042 | T8040 | cc | and,µg |
R6986 | T8068 | T8069 | amod | limited,numbers |
R6987 | T8069 | T8065 | pobj | numbers,due |
R6988 | T8070 | T8069 | prep | of,numbers |
R6989 | T8071 | T8070 | pobj | participants,of |
R6990 | T8072 | T8071 | acl | analysed,participants |
R6991 | T8073 | T8061 | punct | (,distribution |
R6992 | T8074 | T8061 | appos | seven,distribution |
R6993 | T8075 | T8061 | punct | ),distribution |
R6994 | T8076 | T8058 | punct | .,assume |
R6995 | T8077 | T8079 | det | The,hypothesis |
R6996 | T8078 | T8079 | amod | null,hypothesis |
R6997 | T8079 | T8081 | nsubjpass | hypothesis,rejected |
R6998 | T8080 | T8081 | auxpass | was,rejected |
R6999 | T8081 | T8081 | ROOT | rejected,rejected |
R7000 | T8082 | T8081 | prep | at,rejected |
R7001 | T8083 | T8084 | compound | p,< |
R7002 | T8084 | T8085 | compound | <,0.05 |
R7003 | T8085 | T8082 | pobj | 0.05,at |
R7004 | T8086 | T8081 | punct | .,rejected |
R3379 | T3897 | T3898 | auxpass | was,taken |
R3380 | T3898 | T3886 | advcl | taken,given |
R3381 | T3899 | T3898 | prep | for,taken |
R3382 | T3900 | T3899 | pobj | preparation,for |
R3383 | T3901 | T3900 | prep | of,preparation |
R3384 | T3902 | T3901 | pobj | PBMCs,of |
R3385 | T3903 | T3898 | prep | at,taken |
R3386 | T3904 | T3903 | pobj | 1,at |
R3387 | T3905 | T3898 | cc | and,taken |
R3388 | T3906 | T3907 | nummod | 2,h |
R3603 | T4168 | T4164 | punct | ),Oxford |
R3717 | T4282 | T4284 | nsubjpass | reagents,purchased |
R3718 | T4283 | T4284 | auxpass | were,purchased |
R3719 | T4284 | T4284 | ROOT | purchased,purchased |
R3720 | T4285 | T4284 | prep | from,purchased |
R3721 | T4286 | T4285 | pobj | Sigma,from |
R3722 | T4287 | T4288 | punct | (,Poole |
R3723 | T4288 | T4284 | npadvmod | Poole,purchased |
R3724 | T4289 | T4288 | punct | ",",Poole |
R3725 | T4290 | T4288 | appos | UK,Poole |
R3726 | T4291 | T4288 | punct | ),Poole |
R4112 | T4768 | T4764 | dobj | virus,using |
R4113 | T4769 | T4771 | nmod | RT,Promega |
R4114 | T4770 | T4771 | punct | (,Promega |
R4115 | T4771 | T4768 | appos | Promega,virus |
R4116 | T4772 | T4771 | punct | ",",Promega |
R4117 | T4773 | T4771 | conj | Southampton,Promega |
R4118 | T4774 | T4773 | punct | ",",Southampton |
R4119 | T4775 | T4773 | conj | UK,Southampton |
R4120 | T4776 | T4771 | punct | ),Promega |
R4121 | T4777 | T4763 | punct | .,transcribed |
R4122 | T4778 | T4784 | prep | For,carried |
R4123 | T4779 | T4780 | amod | relative,quantification |
R4124 | T4780 | T4778 | pobj | quantification,For |
R4125 | T4781 | T4784 | punct | ",",carried |
R4126 | T4782 | T4784 | nsubjpass | RT-PCR,carried |
R4127 | T4783 | T4784 | auxpass | was,carried |
R4128 | T4784 | T4784 | ROOT | carried,carried |
R4129 | T4785 | T4784 | prt | out,carried |
R4130 | T4786 | T4784 | advcl | using,carried |
R4131 | T4787 | T4788 | compound | cDNA,probes |
R4132 | T4788 | T4786 | dobj | probes,using |
R4133 | T4789 | T4784 | punct | .,carried |
R4362 | T5053 | T5054 | compound | [,pH |
R4363 | T5054 | T5048 | appos | pH,P-40 |
R4364 | T5055 | T5056 | nummod | 7.5,] |
R4365 | T5056 | T5056 | ROOT | ],] |
R4366 | T5057 | T5056 | punct | ",",] |
R4367 | T5058 | T5060 | nummod | 150,NaCl |
R4368 | T5059 | T5060 | compound | mM,NaCl |
R4369 | T5060 | T5056 | appos | NaCl,] |
R4370 | T5061 | T5056 | punct | ),] |
R4371 | T5062 | T5056 | prep | in,] |
R4372 | T5063 | T5064 | det | the,presence |
R4373 | T5064 | T5062 | pobj | presence,in |
R4374 | T5065 | T5064 | prep | of,presence |
R4375 | T5066 | T5069 | amod | complete,inhibitor |
R4376 | T5067 | T5069 | compound | protease,inhibitor |
R4377 | T5068 | T5069 | compound | cocktail,inhibitor |
R4378 | T5069 | T5065 | pobj | inhibitor,of |
R4379 | T5070 | T5039 | punct | .,prepared |
R4380 | T5071 | T5073 | nsubjpass | Lysates,centrifuged |
R4381 | T5072 | T5073 | auxpass | were,centrifuged |
R4382 | T5073 | T5073 | ROOT | centrifuged,centrifuged |
R4383 | T5074 | T5073 | prep | at,centrifuged |
R4384 | T5075 | T5076 | nummod | 4,° |
R4385 | T5076 | T5074 | pobj | °,at |
R4386 | T5077 | T5073 | conj | C,centrifuged |
R4387 | T5078 | T5077 | prep | for,C |
R4388 | T5079 | T5080 | nummod | 10,min |
R4389 | T5080 | T5078 | pobj | min,for |
R4390 | T5081 | T5080 | prep | at,min |
R4391 | T5082 | T5083 | nummod | "12,000",rpm |
R4392 | T5083 | T5081 | pobj | rpm,at |
R4393 | T5084 | T5073 | prep | in,centrifuged |
R4394 | T5085 | T5087 | det | an,microcentrifuge |
R4395 | T5086 | T5087 | compound | Eppendorf,microcentrifuge |
R4396 | T5087 | T5084 | pobj | microcentrifuge,in |
R4397 | T5088 | T5089 | aux | to,remove |
R4398 | T5089 | T5073 | advcl | remove,centrifuged |
R4399 | T5090 | T5091 | amod | cellular,debris |
R4400 | T5091 | T5089 | dobj | debris,remove |
R4401 | T5092 | T5073 | punct | .,centrifuged |
R4402 | T5093 | T5096 | nsubjpass | Samples,immunoprecipitated |
R4403 | T5094 | T5096 | auxpass | were,immunoprecipitated |
R4404 | T5095 | T5096 | advmod | then,immunoprecipitated |
R4405 | T5096 | T5096 | ROOT | immunoprecipitated,immunoprecipitated |
R4406 | T5097 | T5096 | prep | with,immunoprecipitated |
R4407 | T5098 | T5100 | preconj | either,µl |
R4408 | T5099 | T5100 | nummod | 10,µl |
R4409 | T5100 | T5107 | nsubj | µl,using |
R4410 | T5101 | T5100 | prep | of,µl |
R4411 | T5102 | T5101 | pobj | antibody,of |
R4412 | T5103 | T5102 | prep | against,antibody |
R4413 | T5104 | T5103 | pobj | GATA-3,against |
R4414 | T5105 | T5104 | cc | or,GATA-3 |
R4416 | T5107 | T5097 | pcomp | using,with |
R4417 | T5108 | T5110 | nmod | A/G,slurry |
R4418 | T5109 | T5110 | amod | agarose,slurry |
R4419 | T5110 | T5107 | dobj | slurry,using |
R4420 | T5111 | T5107 | prep | in,using |
R4421 | T5112 | T5113 | det | the,presence |
R4422 | T5113 | T5111 | pobj | presence,in |
R4423 | T5114 | T5113 | prep | of,presence |
R4424 | T5115 | T5116 | amod | protease,inhibitor |
R4425 | T5116 | T5114 | pobj | inhibitor,of |
R4426 | T5117 | T5107 | advcl | using,using |
R4427 | T5118 | T5119 | det | the,Catch |
R4428 | T5119 | T5117 | dobj | Catch,using |
R4429 | T5120 | T5119 | cc | and,Catch |
R4430 | T5121 | T5119 | conj | Release,Catch |
R4431 | T5122 | T5119 | conj | methodology,Catch |
R4432 | T5123 | T5125 | punct | (,Biotechnology |
R4433 | T5124 | T5125 | compound | Upstate,Biotechnology |
R4434 | T5125 | T5119 | conj | Biotechnology,Catch |
R4435 | T5126 | T5125 | punct | ",",Biotechnology |
R4436 | T5127 | T5128 | compound | Lake,Placid |
R4437 | T5128 | T5125 | conj | Placid,Biotechnology |
R4974 | T5758 | T5755 | pobj | Assay,In |
R4975 | T5759 | T5758 | prep | for,Assay |
R4668 | T5393 | T5395 | punct | ′,TCATGGCTCTGAAACGTTCTG-3 |
R4669 | T5394 | T5395 | punct | -,TCATGGCTCTGAAACGTTCTG-3 |
R4670 | T5395 | T5396 | compound | TCATGGCTCTGAAACGTTCTG-3,′ |
R4671 | T5396 | T5388 | appos | ′,′ |
R4672 | T5397 | T5368 | punct | .,detected |
R4673 | T5398 | T5400 | nsubjpass | PCR,performed |
R4674 | T5399 | T5400 | auxpass | was,performed |
R4675 | T5400 | T5400 | ROOT | performed,performed |
R4676 | T5401 | T5400 | advcl | using,performed |
R4677 | T5402 | T5406 | det | a,cycler |
R4678 | T5403 | T5404 | nmod | Hybaid,Omnigene |
R4679 | T5404 | T5406 | nmod | Omnigene,cycler |
R4680 | T5405 | T5406 | amod | thermal,cycler |
R4681 | T5406 | T5401 | dobj | cycler,using |
R4682 | T5407 | T5408 | punct | (,Hybaid |
R4683 | T5408 | T5406 | appos | Hybaid,cycler |
R4684 | T5409 | T5408 | punct | ",",Hybaid |
R4685 | T5410 | T5408 | npadvmod | Ashford,Hybaid |
R4686 | T5411 | T5410 | punct | ",",Ashford |
R5070 | T5854 | T5853 | pobj | 96-well,to |
R5076 | T5860 | T5857 | pobj | antibody,with |
R5077 | T5861 | T5852 | punct | .,added |
R5078 | T5862 | T5880 | prep | After,added |
R5079 | T5863 | T5865 | nummod | 1,incubation |
R5080 | T5864 | T5865 | compound | h,incubation |
R5081 | T5865 | T5862 | pobj | incubation,After |
R5082 | T5866 | T5880 | punct | ",",added |
R5083 | T5867 | T5880 | nsubjpass | GATA-3,added |
R5084 | T5868 | T5870 | punct | (,ng/ml |
R5180 | T5964 | T5963 | pobj | GATA-3,of |
R5181 | T5965 | T5959 | punct | ",",used |
R5182 | T5966 | T5959 | cc | and,used |
R5183 | T5967 | T5968 | compound | rhodamine,donkey |
R5184 | T5968 | T5981 | nsubjpass | donkey,used |
R5185 | T5969 | T5970 | compound | anti-mouse,IgG |
R5186 | T5970 | T5981 | nsubjpass | IgG,used |
R5187 | T5971 | T5972 | punct | (,Novus |
R5188 | T5972 | T5970 | appos | Novus,IgG |
R5189 | T5973 | T5972 | punct | ",",Novus |
R5190 | T5974 | T5972 | npadvmod | Littleton,Novus |
R5191 | T5975 | T5974 | punct | ",",Littleton |
R5192 | T5976 | T5974 | conj | Colorado,Littleton |
R5193 | T5977 | T5976 | punct | ",",Colorado |
R5194 | T5978 | T5976 | conj | USA,Colorado |
R5195 | T5979 | T5976 | punct | ),Colorado |
R5196 | T5980 | T5981 | auxpass | was,used |
R5197 | T5981 | T5959 | conj | used,used |
R5198 | T5982 | T5981 | prep | for,used |
R5199 | T5983 | T5984 | det | the,detection |
R5200 | T5984 | T5982 | pobj | detection,for |
R5201 | T5985 | T5984 | prep | of,detection |
R5202 | T5986 | T5985 | pobj | GR,of |
R5203 | T5987 | T5981 | punct | .,used |
R5204 | T5988 | T5991 | nmod | FITC,levels |
R5205 | T5989 | T5988 | cc | and,FITC |
R5206 | T5990 | T5988 | conj | rhodamine,FITC |
R5314 | T6171 | T6170 | advcl | using,determined |
R5315 | T6172 | T6174 | det | an,kit |
R5316 | T6173 | T6174 | amod | ELISA-based,kit |
R5317 | T6174 | T6171 | dobj | kit,using |
R5318 | T6175 | T6174 | punct | (,kit |
R5319 | T6176 | T6177 | amod | Trans-AM,p65 |
R5320 | T6177 | T6174 | appos | p65,kit |
R5321 | T6178 | T6177 | punct | ",",p65 |
R5322 | T6179 | T6180 | compound | Active,Motif |
R5323 | T6180 | T6177 | appos | Motif,p65 |
R5324 | T6181 | T6180 | punct | ",",Motif |
R5325 | T6182 | T6180 | conj | Rixensart,Motif |
R5326 | T6183 | T6182 | punct | ",",Rixensart |
R5327 | T6184 | T6182 | conj | Belgium,Rixensart |
R5328 | T6185 | T6174 | punct | ),kit |
R5329 | T6186 | T6170 | punct | .,determined |
R5330 | T6187 | T6196 | prep | In,incubated |
R5331 | T6188 | T6187 | pobj | brief,In |
R5332 | T6189 | T6196 | punct | ",",incubated |
R5333 | T6190 | T6191 | nummod | 5,µg |
R5334 | T6191 | T6196 | nsubjpass | µg,incubated |
R5335 | T6192 | T6191 | prep | of,µg |
R5336 | T6193 | T6194 | amod | nuclear,extracts |
R5337 | T6194 | T6192 | pobj | extracts,of |
R5338 | T6195 | T6196 | auxpass | were,incubated |
R5339 | T6196 | T6196 | ROOT | incubated,incubated |
R5340 | T6197 | T6196 | prep | with,incubated |
R5341 | T6198 | T6199 | det | a,plate |
R5755 | T6647 | T6646 | punct | (,optics |
R5756 | T6648 | T6649 | compound | Leica,Microsystems |
R5757 | T6649 | T6646 | appos | Microsystems,optics |
R5758 | T6650 | T6649 | punct | ",",Microsystems |
R5759 | T6651 | T6649 | conj | Wetzlar,Microsystems |
R5760 | T6652 | T6651 | punct | ",",Wetzlar |
R5761 | T6653 | T6651 | conj | Germany,Wetzlar |
R5762 | T6654 | T6646 | punct | ),optics |
R5763 | T6655 | T6629 | punct | .,characterised |
R5764 | T6656 | T6657 | aux | To,determine |
R5765 | T6657 | T6677 | advcl | determine,used |
R5766 | T6658 | T6659 | det | the,specificity |
R5767 | T6659 | T6657 | dobj | specificity,determine |
R5768 | T6660 | T6659 | prep | of,specificity |
R5769 | T6661 | T6662 | det | the,antibodies |
R5770 | T6662 | T6660 | pobj | antibodies,of |
R5771 | T6663 | T6662 | punct | ",",antibodies |
R5772 | T6664 | T6665 | compound | rabbit,serum |
R5773 | T6665 | T6666 | compound | serum,immunoglobulin |
R5774 | T6666 | T6659 | conj | immunoglobulin,specificity |
R5775 | T6667 | T6666 | punct | (,immunoglobulin |
R5776 | T6668 | T6666 | appos | Dako,immunoglobulin |
R5777 | T6669 | T6666 | punct | ),immunoglobulin |
R5778 | T6670 | T6666 | cc | and,immunoglobulin |
R5779 | T6671 | T6672 | amod | secondary,antibodies |
R5780 | T6672 | T6666 | conj | antibodies,immunoglobulin |
R5781 | T6673 | T6657 | prep | without,determine |
R6102 | T7081 | T7082 | punct | -,EcoRI/3 |
R6103 | T7082 | T7083 | compound | EcoRI/3,′ |
R6104 | T7083 | T7077 | pobj | ′,into |
R6105 | T7084 | T7085 | nsubj | blunt,ended |
R6106 | T7085 | T7076 | advcl | ended,inserted |
R6107 | T7086 | T7087 | compound | GFP,vector |
R6108 | T7087 | T7085 | dobj | vector,ended |
R6109 | T7088 | T7085 | punct | .,ended |
R6110 | T7089 | T7090 | amod | Positive,clones |
R6111 | T7090 | T7092 | nsubjpass | clones,confirmed |
R6112 | T7091 | T7092 | auxpass | were,confirmed |
R6113 | T7092 | T7092 | ROOT | confirmed,confirmed |
R6114 | T7093 | T7092 | agent | by,confirmed |
R6115 | T7094 | T7093 | pobj | digestion,by |
R6116 | T7095 | T7094 | cc | and,digestion |
R6117 | T7096 | T7094 | conj | size,digestion |
R6118 | T7097 | T7094 | conj | analysis,digestion |
R6119 | T7098 | T7092 | prep | by,confirmed |
R6120 | T7099 | T7100 | nummod | 1,% |
R6121 | T7100 | T7103 | compound | %,electrophoresis |
R6122 | T7101 | T7102 | amod | agarose,gel |
R6123 | T7102 | T7103 | compound | gel,electrophoresis |
R6124 | T7103 | T7098 | pobj | electrophoresis,by |
R6125 | T7104 | T7098 | cc | and,by |
R6126 | T7105 | T7098 | conj | by,by |
R6127 | T7106 | T7105 | pcomp | sequencing,by |
R6128 | T7107 | T7092 | punct | .,confirmed |
R6207 | T7254 | T7255 | compound | Transfection,HuT-78 |
R6208 | T7255 | T7256 | compound | HuT-78,cells |
R6209 | T7256 | T7258 | nsubjpass | cells,transfected |
R6210 | T7257 | T7258 | auxpass | were,transfected |
R6211 | T7258 | T7258 | ROOT | transfected,transfected |
R6212 | T7259 | T7258 | prep | with,transfected |
R6213 | T7260 | T7261 | det | either,EP8 |
R6214 | T7261 | T7259 | pobj | EP8,with |
R6215 | T7262 | T7261 | cc | or,EP8 |
R6216 | T7263 | T7264 | compound | GFP,vector |
R6217 | T7264 | T7261 | conj | vector,EP8 |
R6218 | T7265 | T7266 | advmod | only,DNA |
R6219 | T7266 | T7267 | nsubj | DNA,using |
R6220 | T7267 | T7258 | advcl | using,transfected |
R6221 | T7268 | T7269 | compound | solution,R |
R6222 | T7269 | T7267 | dobj | R,using |
R6223 | T7270 | T7269 | punct | ",",R |
R6224 | T7271 | T7272 | compound | programme,V-001 |
R6225 | T7272 | T7269 | appos | V-001,R |
R6226 | T7273 | T7267 | prep | at,using |
R6227 | T7274 | T7275 | det | a,ratio |
R6228 | T7275 | T7282 | nmod | ratio,DNA |
R6229 | T7276 | T7275 | prep | of,ratio |
R6230 | T7277 | T7280 | nummod | 3,cells/4 |
R6231 | T7278 | T7280 | nummod | ×,cells/4 |
R6232 | T7279 | T7280 | nummod | 106,cells/4 |
R6233 | T7280 | T7276 | pobj | cells/4,of |
R6234 | T7281 | T7282 | compound | µg,DNA |
R6235 | T7282 | T7273 | pobj | DNA,at |
R6236 | T7283 | T7267 | prep | for,using |
R6237 | T7284 | T7283 | pobj | 7,for |
R6238 | T7285 | T7286 | nummod | 8,h |
R6239 | T7286 | T7284 | appos | h,7 |
R6240 | T7287 | T7286 | prep | in,h |
R6241 | T7288 | T7289 | amod | complete,medium |
R6242 | T7289 | T7287 | pobj | medium,in |
R6243 | T7290 | T7286 | punct | (,h |
R6244 | T7291 | T7292 | nummod | 10,% |
R6245 | T7292 | T7294 | nmod | %,serum |
R6246 | T7293 | T7294 | amod | bovine,serum |
R6259 | T7306 | T7305 | prep | for,protocol |
R6260 | T7307 | T7306 | pobj | nucleofection,for |
R6261 | T7308 | T7258 | punct | .,transfected |
R6262 | T7309 | T7310 | det | The,medium |
R6263 | T7310 | T7313 | nsubjpass | medium,changed |
R6264 | T7311 | T7313 | auxpass | was,changed |
R6265 | T7312 | T7313 | advmod | subsequently,changed |
R6266 | T7313 | T7313 | ROOT | changed,changed |
R6267 | T7314 | T7313 | prep | to,changed |
R6268 | T7315 | T7317 | nummod | 1,RPMI |
R6269 | T7316 | T7315 | quantmod | %,1 |
R6270 | T7317 | T7314 | pobj | RPMI,to |
R6271 | T7318 | T7313 | prep | for,changed |
R6272 | T7319 | T7320 | nummod | 24,h |
R6273 | T7320 | T7318 | pobj | h,for |
R6274 | T7321 | T7325 | mark | before,added |
R6275 | T7322 | T7323 | amod | transfected,cells |
R6276 | T7323 | T7325 | nsubjpass | cells,added |
R6277 | T7324 | T7325 | auxpass | were,added |
R6278 | T7325 | T7313 | advcl | added,changed |
R6279 | T7326 | T7325 | prep | to,added |
R6280 | T7327 | T7336 | amod | anti-CD3,performed |
R6281 | T7328 | T7331 | nummod | /,wells |
R6282 | T7329 | T7331 | nummod | CD28,wells |
R6283 | T7330 | T7331 | amod | treated,wells |
R6284 | T7331 | T7327 | dobj | wells,anti-CD3 |
R6285 | T7332 | T7327 | cc | and,anti-CD3 |
R6286 | T7333 | T7335 | amod | live,videomicroscopy |
R6287 | T7334 | T7335 | compound | cell,videomicroscopy |
R6288 | T7335 | T7327 | conj | videomicroscopy,anti-CD3 |
R6289 | T7336 | T7326 | pobj | performed,to |
R6290 | T7337 | T7313 | punct | .,changed |
R6411 | T7473 | T7476 | compound | Time-Lapse,cells |
R6883 | T7965 | T7966 | compound | GraphPad,Prism |
R6884 | T7966 | T7964 | dobj | Prism,using |
R6885 | T7967 | T7966 | nummod | 4,Prism |
R6886 | T7968 | T7970 | punct | (,Software |
R6887 | T7969 | T7970 | compound | GraphPad,Software |
R6888 | T7970 | T7966 | conj | Software,Prism |
R6889 | T7971 | T7970 | punct | ",",Software |
R6890 | T7972 | T7970 | appos | http://www.graphpad.com,Software |
R6891 | T7973 | T7970 | punct | ),Software |
R6892 | T7974 | T7944 | punct | .,presented |
R6893 | T7975 | T7976 | nsubj | Results,were |
R6894 | T7976 | T7976 | ROOT | were,were |
R6895 | T7977 | T7976 | acomp | analysed,were |
R6896 | T7978 | T7976 | advcl | using,were |
R6897 | T7979 | T7980 | amod | one-way,ANOVA |
R6898 | T7980 | T7978 | dobj | ANOVA,using |
R6899 | T7981 | T7978 | prep | with,using |
R6900 | T7982 | T7984 | compound | Newman-Keuls,test |
R6901 | T7983 | T7984 | compound | post,test |
R6902 | T7984 | T7981 | pobj | test,with |
R6903 | T7985 | T7978 | prep | except,using |
R6904 | T7986 | T7985 | prep | for,except |
R6905 | T7987 | T7988 | det | the,data |
R6906 | T7988 | T7986 | pobj | data,for |
R6907 | T7989 | T7988 | prep | from,data |
R6908 | T7990 | T7995 | det | the,study |
R6909 | T7991 | T7993 | prep | in,inhaled |
R6910 | T7992 | T7991 | pobj | vivo,in |
R6911 | T7993 | T7995 | amod | inhaled,study |
R6912 | T7994 | T7995 | compound | FP,study |
R6913 | T7995 | T7989 | pobj | study,from |
R6914 | T7996 | T7995 | punct | ",",study |
R6915 | T7997 | T7999 | nsubjpass | which,analysed |
R6916 | T7998 | T7999 | auxpass | was,analysed |
R6917 | T7999 | T7995 | relcl | analysed,study |
R6918 | T8000 | T7999 | agent | by,analysed |
R6919 | T8001 | T8003 | poss | Friedman,test |
R6920 | T8002 | T8001 | case | 's,Friedman |
R6921 | T8003 | T8000 | pobj | test,by |
R6922 | T8004 | T8003 | prep | with,test |
R6923 | T8005 | T8006 | amod | subsequent,Wilcoxson |
R6924 | T8006 | T8004 | pobj | Wilcoxson,with |
R6925 | T8007 | T8008 | amod | matched,pair |
R6926 | T8008 | T8009 | nsubj | pair,signed |
R6927 | T8009 | T7976 | conj | signed,were |
R6928 | T8010 | T8012 | compound | rank,test |
R6929 | T8011 | T8012 | compound | sum,test |
R6961 | T8043 | T8044 | nummod | 500,µg |
R6962 | T8044 | T8040 | conj | µg,µg |
R6963 | T8045 | T8044 | prep | of,µg |
R6964 | T8046 | T8047 | amod | inhaled,FP |
R6965 | T8047 | T8045 | pobj | FP,of |
R6966 | T8048 | T8047 | punct | ",",FP |
R6967 | T8049 | T8050 | nsubj | which,had |
R6968 | T8050 | T8047 | relcl | had,FP |
R6969 | T8051 | T8053 | amod | variable,levels |
R6970 | T8052 | T8053 | compound | baseline,levels |
R6971 | T8053 | T8050 | dobj | levels,had |
R6972 | T8054 | T8029 | punct | .,used |
R6973 | T8055 | T8058 | nsubj | We,assume |
R6974 | T8056 | T8058 | aux | did,assume |
R6975 | T8057 | T8058 | neg | not,assume |
R6976 | T8058 | T8058 | ROOT | assume,assume |
R6977 | T8059 | T8061 | det | a,distribution |
R6978 | T8060 | T8061 | amod | Gaussian,distribution |
R6979 | T8061 | T8058 | dobj | distribution,assume |
R6980 | T8062 | T8061 | prep | of,distribution |
R6981 | T8063 | T8064 | det | the,data |
R6982 | T8064 | T8062 | pobj | data,of |
R6983 | T8065 | T8061 | amod | due,distribution |
R6984 | T8066 | T8065 | pcomp | to,due |
R6985 | T8067 | T8069 | det | the,numbers |
UBERON-AE
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T6271 | 7237-7242 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
T7168 | 8588-8593 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
GO-BP
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4298 | 1169-1172 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T4299 | 1499-1511 | http://purl.obolibrary.org/obo/GO_0009293 | denotes | Transduction |
T4599 | 2161-2173 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
T4829 | 2239-2260 | http://purl.obolibrary.org/obo/GO_0001171 | denotes | Reverse Transcription |
T4830 | 2247-2260 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | Transcription |
T4831 | 2295-2300 | http://purl.obolibrary.org/obo/GO_0019835 | denotes | lysis |
T4832 | 2527-2529 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T4833 | 2587-2589 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T5179 | 2987-2992 | http://purl.obolibrary.org/obo/GO_0019835 | denotes | lysis |
T5180 | 3214-3222 | http://purl.obolibrary.org/obo/GO_0007349 | denotes | cellular |
T6713 | 6997-7003 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signal |
T7113 | 7665-7674 | http://purl.obolibrary.org/obo/GO_0007586 | denotes | digestion |
T7114 | 8314-8323 | http://purl.obolibrary.org/obo/GO_0007586 | denotes | digestion |
T7596 | 8930-8936 | http://purl.obolibrary.org/obo/GO_0040007 | denotes | growth |
GO-MF
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4300 | 854-864 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T4301 | 977-987 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T4302 | 1142-1152 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T4303 | 1374-1384 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T4304 | 1471-1479 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T4305 | 1169-1172 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T4834 | 2527-2529 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T4835 | 2587-2589 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T4836 | 2641-2645 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T5181 | 3289-3297 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T5452 | 3918-3932 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | immunoglobulin |
T5453 | 4064-4068 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T6017 | 4956-4964 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T6018 | 5267-5277 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T6019 | 5401-5411 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T6249 | 5723-5736 | http://purl.obolibrary.org/obo/GO_0051059 | denotes | NF-κB binding |
T6250 | 5729-5736 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T6251 | 6036-6043 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T6252 | 6017-6025 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T6253 | 6089-6097 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T6714 | 6607-6615 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T6715 | 6784-6792 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T6716 | 7218-7228 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T6717 | 7243-7257 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | immunoglobulin |
GO-CC
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4306 | 854-864 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T4307 | 977-987 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T4308 | 1142-1152 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T4309 | 1374-1384 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T4310 | 1471-1479 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T4311 | 854-864 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T4312 | 977-987 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T4313 | 1142-1152 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T4314 | 1374-1384 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T4315 | 1471-1479 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T4316 | 1207-1211 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T5182 | 2800-2804 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T5183 | 2951-2955 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
T5184 | 3289-3297 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T5185 | 3289-3297 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T5454 | 3727-3736 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | Chromatin |
T5455 | 3757-3766 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | Chromatin |
T5456 | 3847-3852 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6020 | 4510-4515 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6021 | 4657-4662 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6022 | 4666-4671 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6023 | 4776-4781 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6024 | 5046-5051 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6025 | 5155-5160 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6026 | 4956-4964 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T6027 | 5267-5277 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T6028 | 5401-5411 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T6029 | 4956-4964 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T6030 | 5267-5277 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T6031 | 5401-5411 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T6254 | 6017-6025 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T6255 | 6089-6097 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T6256 | 6017-6025 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T6257 | 6089-6097 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T6718 | 6607-6615 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T6719 | 6784-6792 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T6720 | 7218-7228 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T6721 | 7279-7289 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T6722 | 6607-6615 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T6723 | 6784-6792 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T6724 | 7218-7228 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T6725 | 7279-7289 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T6726 | 6700-6705 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6727 | 7369-7374 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6728 | 6924-6933 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | chromatin |
T7341 | 8416-8421 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T7342 | 8532-8537 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T7343 | 8756-8761 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T7344 | 8813-8817 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
T7597 | 8875-8880 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T7598 | 9283-9285 | http://purl.obolibrary.org/obo/GO_0005783 | denotes | ER |
T4600 | 1633-1637 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T4601 | 1742-1746 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
sentences
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T3670 | 23-52 | Sentence | denotes | Participants and Study Design |
T3671 | 53-250 | Sentence | denotes | We studied patients with mild asthma who were not treated with inhaled corticosteroids who had been included in a previously reported double-blind, placebo-controlled, crossover study with FP [34]. |
T3672 | 251-500 | Sentence | denotes | Seven patients with mild asthma entered the study and were randomized to receive a single inhalation of FP (100 and 500 µg) or a matched placebo control via a spacer chamber, and the other treatment was given after a wash-out period of at least 6 d. |
T3673 | 501-581 | Sentence | denotes | Blood was taken for preparation of PBMCs at 1 and 2 h after drug administration. |
T3674 | 582-813 | Sentence | denotes | All patients gave informed consent and the study was approved by the Ethics Committee of the Royal Brompton and Harefield Hospitals NHS Trust. The clinical study was conducted before the requirement for Clinical Trial Registration. |
T3976 | 815-838 | Sentence | denotes | Antibodies and Reagents |
T3977 | 839-969 | Sentence | denotes | The monoclonal antibodies against human CD3, CD28, GR, and importin-α were purchased from BD Biosciences (Oxford, United Kingdom). |
T3978 | 970-1458 | Sentence | denotes | Rabbit antibodies against human GATA-3 (H-48) and GR (E-20, sc-1003) were obtained from Santa Cruz Biotechnology (Santa Cruz, California, United States), polyclonal rabbit antibodies against phospho-p38 MAP kinase and phospho-ATF-2 from Cell Signaling Technology (New England Biolabs, Hertford, UK), monoclonal antibody against phosphoserine (clone 4H4) from Affiniti Research Products (Exeter, UK), and antibodies against rabbit IgG-conjugated TRITC from Dako Cytomation (Cambridge, UK). |
T3979 | 1459-1573 | Sentence | denotes | The anti-GR antibody (Clone 41) from BD Transduction Laboratories (Oxford, UK) was used for Western blot analysis. |
T3980 | 1574-1631 | Sentence | denotes | All other reagents were purchased from Sigma (Poole, UK). |
T4615 | 2239-2264 | Sentence | denotes | Reverse Transcription PCR |
T4616 | 2265-2342 | Sentence | denotes | Total RNA was extracted using lysis buffer (RNeasy kit; Qiagen, Crawley, UK). |
T4617 | 2343-2438 | Sentence | denotes | During RNA purification, genomic DNA was digested with RNase-free DNase (Amersham Biosciences). |
T4618 | 2439-2557 | Sentence | denotes | Next, 0.5 µg of total RNA was reversed transcribed using the avian myeloblastosis virus RT (Promega, Southampton, UK). |
T4619 | 2558-2628 | Sentence | denotes | For relative quantification, RT-PCR was carried out using cDNA probes. |
T4620 | 2629-2686 | Sentence | denotes | Primers for IL-4 were from Sigma-Genosys (Cambridge, UK). |
T4621 | 2687-2798 | Sentence | denotes | Sequences of GADPH used are as follows: forward 5′-CCACCCATGGCAAATTCCATGGC, reverse 3′-TCTAGACGGCAGGTCAGGTCCAC. |
T4846 | 2800-2866 | Sentence | denotes | Cell Fractionation, Immunoprecipitation, and Western Blot Analysis |
T4847 | 2867-2944 | Sentence | denotes | Nuclear and cytoplasmic fractions were prepared as previously described [35]. |
T4848 | 2945-3114 | Sentence | denotes | Whole cell lysates were prepared in NP-40 lysis buffer (0.5% Nonidet P-40, 20 mM Tris-HCl [pH 7.5], 150 mM NaCl) in the presence of complete protease cocktail inhibitor. |
T4849 | 3115-3230 | Sentence | denotes | Lysates were centrifuged at 4°C for 10 min at 12,000 rpm in an Eppendorf microcentrifuge to remove cellular debris. |
T4850 | 3231-3482 | Sentence | denotes | Samples were then immunoprecipitated with either 10 µl of antibody against GATA-3 or importin-α using A/G agarose slurry in the presence of protease inhibitor using the Catch and Release methodology (Upstate Biotechnology, Lake Placid, New York, USA). |
T4851 | 3483-3619 | Sentence | denotes | Western blot analysis was performed using anti-GATA-3, anti-importin-α, anti-GR, anti-p-p38 MAP kinase, anti-p-ATF-2, and anti-p-serine. |
T4852 | 3620-3725 | Sentence | denotes | Immunoreactive proteins were detected using an enhanced chemiluminescence ECL kit (Amersham Biosciences). |
T5202 | 3727-3756 | Sentence | denotes | Chromatin Immunoprecipitation |
T5203 | 3757-4140 | Sentence | denotes | Chromatin immunoprecipitation (IP) was performed as previously described [12] in HuT-78 T-cells with 2 µg of anti-GATA-3 (Santa Cruz Biotechnology), or isotypic immunoglobulin G as a non-specific control (Santa Cruz Biotechnology) overnight at 4°C. Promoter sequences were detected with PCR primers for the IL-5 promoter (−445 to +4): forward 5′-TTAATCTAGCCACAGTCATAG-3′ and reverse: |
T5204 | 4141-4169 | Sentence | denotes | 5′-TCATGGCTCTGAAACGTTCTG-3′. |
T5205 | 4170-4350 | Sentence | denotes | PCR was performed using a Hybaid Omnigene thermal cycler (Hybaid, Ashford, UK) with cycling parameters of 72°C for 10 min, 35 cycles at 94°C for 45 s, 52°C for 45 s, 72°C for 45 s. |
T5489 | 4352-4423 | Sentence | denotes | GR-GATA-3 In Vitro Competition Assay for Importin-α (Far-Western ELISA) |
T5490 | 4424-4599 | Sentence | denotes | Immunoprecipitated importin-α (anti-importin-α, Santa Cruz Biotechnology) from HuT-78 cells was separated by SDS-PAGE and purified from the excised gel by electroelution [36]. |
T5491 | 4600-4782 | Sentence | denotes | Similarly, GATA-3 was isolated from nonstimulated HuT-78 cells or cells stimulated for 30 min with anti-CD3/CD28 and GR was isolated from FP (10−8 M, 30 min) stimulated HuT-78 cells. |
T5492 | 4783-4845 | Sentence | denotes | These proteins were subsequently refolded in glycine solution. |
T5493 | 4846-4965 | Sentence | denotes | 100 µl of importin-α solution (100 ng/ml in TBS) was added to 96-well plates coated with goat anti-importin-α antibody. |
T5494 | 4966-5094 | Sentence | denotes | After 1 h incubation, GATA-3 (100 ng/ml in TBS) from stimulated or unstimulated cells were added to the importin-α-coated wells. |
T5495 | 5095-5186 | Sentence | denotes | GR (10 or 100 ng/ml in TBS) from stimulated or unstimulated cells were added to some wells. |
T5496 | 5187-5412 | Sentence | denotes | After a further 1 h incubation, the plate was washed and incubated with primary antibodies (a mixture of rabbit anti-GATA-3 and mouse anti-GR, Santa Cruz Biotechnology) for 1.5 h, and then incubated with secondary antibodies. |
T5497 | 5413-5603 | Sentence | denotes | FITC swine anti-rabbit IgG (Dako, Cambridge, UK) was used for the detection of GATA-3, and rhodamine donkey anti-mouse IgG (Novus, Littleton, Colorado, USA) was used for the detection of GR. |
T5498 | 5604-5704 | Sentence | denotes | FITC and rhodamine levels were measured with a fluorescent micro-plate reader (Bioline, London, UK). |
T6074 | 5706-5722 | Sentence | denotes | NF-κB Activation |
T6075 | 5723-5855 | Sentence | denotes | NF-κB binding activity in nuclear extracts was determined using an ELISA-based kit (Trans-AM p65, Active Motif, Rixensart, Belgium). |
T6076 | 5856-5966 | Sentence | denotes | In brief, 5 µg of nuclear extracts were incubated with a plate coated with an NF-κB consensus oligonucleotide. |
T6077 | 5967-6026 | Sentence | denotes | Plates were washed before addition of an anti-p65 antibody. |
T6078 | 6027-6131 | Sentence | denotes | Antibody binding was detected with a secondary HRP-conjugated antibody and developed with TMB substrate. |
T6079 | 6132-6185 | Sentence | denotes | The intensity of the reaction was measured at 450 nm. |
T6273 | 6187-6214 | Sentence | denotes | Immunofluorescence Staining |
T6274 | 6215-6286 | Sentence | denotes | Immunofluorescence staining was performed as previously described [34]. |
T6275 | 6287-6359 | Sentence | denotes | All staining was performed at room temperature and under humidification. |
T6276 | 6360-6459 | Sentence | denotes | Cells were collected and cytospins prepared in a cytocentrifuge (Shandon II, Shandon, Runcorn, UK). |
T6277 | 6460-6644 | Sentence | denotes | Cells were permeabilized, blocked, and then incubated with GR (1∶50 E-20 Santa Cruz Biotechnology) or anti-GATA-3 (H-48; Santa Cruz Biotechnology) antibody for 1 h at room temperature. |
T6278 | 6645-6800 | Sentence | denotes | After three washes in phosphate-buffered saline (PBS), cells were incubated with tetrarhodamine isothiocyanate–conjugated goat anti-rabbit antibody (Dako). |
T6279 | 6801-6977 | Sentence | denotes | Cytospins were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI), a fluorescent blue nuclear indole chromatin stain, and mounted in PBS:glycerol (50∶50). |
T6280 | 6978-7181 | Sentence | denotes | The immunopositive signal was characterised using laser scanning confocal microscopy on a Leica TCS NT/SP interactive laser cytometer equipped with confocal optics (Leica Microsystems, Wetzlar, Germany). |
T6281 | 7182-7332 | Sentence | denotes | To determine the specificity of the antibodies, rabbit serum immunoglobulin (Dako) and secondary antibodies without the primary were used as controls. |
T6282 | 7333-7451 | Sentence | denotes | Positively stained nuclei and total cells were counted (500) on each slide with the observer blinded to the treatment. |
T7169 | 8396-8408 | Sentence | denotes | Transfection |
T7170 | 8409-8680 | Sentence | denotes | HuT-78 cells were transfected with either EP8 or GFP vector only DNA using solution R, programme V-001 at a ratio of 3×106 cells/4 µg DNA for 7–8 h in complete medium (10% bovine serum in RPMI1640+15 L-glutamine) according to the general Amaxa protocol for nucleofection. |
T7171 | 8681-8844 | Sentence | denotes | The medium was subsequently changed to 1% RPMI for 24 h before transfected cells were added to anti-CD3/CD28 treated wells and live cell videomicroscopy performed. |
T7353 | 8846-8867 | Sentence | denotes | Time-Lapse Microscopy |
T7354 | 8868-9136 | Sentence | denotes | HuT-78 cells expressing GATA-3-GFP were maintained at 37°C in growth medium in a closed FCS2 perfusion chamber (Bioptechs, Butler, Pennsylvania, USA) combined with an objective heater (Bioptechs) on the stage a Zeiss Axiovert 200 microscope (Thornwood, New York, USA). |
T7355 | 9137-9402 | Sentence | denotes | Observations were made by 40×1.0 NA oil-immersion objective lens, and fluorescence and phase contrast images were gathered using a Hamamatsu ORCA-ER charged coupled device camera (Bridgewater, New Jersey, USA) driven by Openlab software (Improvision, Coventry, UK). |
T7356 | 9403-9457 | Sentence | denotes | Photographs were taken at 0, 30, 60, 120, and 240 min. |
T7605 | 9459-9481 | Sentence | denotes | Densitometric Analysis |
T7606 | 9482-9611 | Sentence | denotes | Densitometry of ECL immunoblots was performed using Gelworks ID intermediate software (Ultraviolet Products, Cambridgeshire, UK). |
T7607 | 9612-9692 | Sentence | denotes | Briefly, immunoblots were scanned and gates were drawn tightly around each band. |
T7608 | 9693-9772 | Sentence | denotes | Background values from each lane were subtracted to normalize each measurement. |
T7609 | 9773-9827 | Sentence | denotes | The bands were quantified using the Gelworks software. |
T7610 | 9828-9999 | Sentence | denotes | All Western blots were exposed to film for varying lengths of time, and only films generating subsaturating levels of intensity were selected for densitometric evaluation. |
T7781 | 10001-10021 | Sentence | denotes | Statistical Analysis |
T7782 | 10022-10236 | Sentence | denotes | Data from three or more independent experiments are presented as the mean±standard error of the mean (SEM), except where stated and were compared using GraphPad Prism 4 (GraphPad Software, http://www.graphpad.com). |
T7783 | 10237-10460 | Sentence | denotes | Results were analysed using one-way ANOVA with Newman-Keuls post test except for the data from the in vivo inhaled FP study, which was analysed by Friedman's test with subsequent Wilcoxson matched pair signed rank sum test. |
T7784 | 10461-10526 | Sentence | denotes | Data from this analysis are presented as a box-and-whiskers plot. |
T7785 | 10527-10676 | Sentence | denotes | Friedman's test was used as three matched measures were obtained using placebo, 100 µg, and 500 µg of inhaled FP, which had variable baseline levels. |
T7786 | 10677-10834 | Sentence | denotes | We did not assume a Gaussian distribution of the data due to the limited numbers of participants analysed (seven).The null hypothesis was rejected at p<0.05. |
T4349 | 1633-1664 | Sentence | denotes | Cell Culture and PBMC Isolation |
T4350 | 1665-1814 | Sentence | denotes | A human T cell line (HuT-78) was purchased from ECACC European Collection of Cell Culture (Wiltshire, UK) were cultured as previously described [12]. |
T4351 | 1815-1968 | Sentence | denotes | PBMCs were isolated by density centrifugation over Ficoll-Hypaque (density, 1.077 g/ml; Amersham Biosciences, Amersham, UK) as previously described [34]. |
T4352 | 1969-2125 | Sentence | denotes | Cells were stimulated with anti-CD3/CD28 (1 µg/ml each) for 1 h at 37°C to stimulate Th2 cytokine release in the presence or absence of FP (10−12 to 10−8M). |
T4353 | 2126-2237 | Sentence | denotes | Cytospins were prepared and GATA-3 localization determined by confocal microscopy as previously described [12]. |
T6774 | 7453-7473 | Sentence | denotes | GATA-3-GFP Construct |
T6775 | 7474-7623 | Sentence | denotes | The GATA-3 clone (BC003070) complete cDNA was obtained from Invitrogen Life Technologies as a 5′- EcoRI/3′-XhoI insert of GATA-3 in the pOTB7 vector. |
T6776 | 7624-7754 | Sentence | denotes | GATA-3 was excised from pOTB7 using XhoI digestion and pEGFP-C2 (Clontech, Saint-Germain-en-Laye, France) was digested with BamHI. |
T6777 | 7755-8279 | Sentence | denotes | DNA was recovered by phenol extraction and ethanol precipitation, and both the GATA-3 fragment and the pEGFP-C2 vector blunt-ended by incubation with Klenow (Bioline Bio-27029) for 30 min at 37°C. Klenow was inactivated by incubation for 10 min at 75°C. DNA was recovered by phenol extraction and ethanol precipitation, and both the blunt-ended GATA-3 fragment and the GFP vector were subsequently digested with EcoRI before the 5′-EcoRI/3′–blunt end GATA-3 fragment was inserted into the 5′-EcoRI/3′–blunt ended GFP vector. |
T6778 | 8280-8394 | Sentence | denotes | Positive clones were confirmed by digestion and size analysis by 1% agarose gel electrophoresis and by sequencing. |
T78 | 0-21 | Sentence | denotes | Materials and Methods |
T79 | 23-52 | Sentence | denotes | Participants and Study Design |
T80 | 53-250 | Sentence | denotes | We studied patients with mild asthma who were not treated with inhaled corticosteroids who had been included in a previously reported double-blind, placebo-controlled, crossover study with FP [34]. |
T81 | 251-500 | Sentence | denotes | Seven patients with mild asthma entered the study and were randomized to receive a single inhalation of FP (100 and 500 µg) or a matched placebo control via a spacer chamber, and the other treatment was given after a wash-out period of at least 6 d. |
T82 | 501-581 | Sentence | denotes | Blood was taken for preparation of PBMCs at 1 and 2 h after drug administration. |
T83 | 582-724 | Sentence | denotes | All patients gave informed consent and the study was approved by the Ethics Committee of the Royal Brompton and Harefield Hospitals NHS Trust. |
T84 | 725-813 | Sentence | denotes | The clinical study was conducted before the requirement for Clinical Trial Registration. |
T85 | 815-838 | Sentence | denotes | Antibodies and Reagents |
T86 | 839-969 | Sentence | denotes | The monoclonal antibodies against human CD3, CD28, GR, and importin-α were purchased from BD Biosciences (Oxford, United Kingdom). |
T87 | 970-1458 | Sentence | denotes | Rabbit antibodies against human GATA-3 (H-48) and GR (E-20, sc-1003) were obtained from Santa Cruz Biotechnology (Santa Cruz, California, United States), polyclonal rabbit antibodies against phospho-p38 MAP kinase and phospho-ATF-2 from Cell Signaling Technology (New England Biolabs, Hertford, UK), monoclonal antibody against phosphoserine (clone 4H4) from Affiniti Research Products (Exeter, UK), and antibodies against rabbit IgG-conjugated TRITC from Dako Cytomation (Cambridge, UK). |
T88 | 1459-1573 | Sentence | denotes | The anti-GR antibody (Clone 41) from BD Transduction Laboratories (Oxford, UK) was used for Western blot analysis. |
T89 | 1574-1631 | Sentence | denotes | All other reagents were purchased from Sigma (Poole, UK). |
T90 | 1633-1664 | Sentence | denotes | Cell Culture and PBMC Isolation |
T91 | 1665-1814 | Sentence | denotes | A human T cell line (HuT-78) was purchased from ECACC European Collection of Cell Culture (Wiltshire, UK) were cultured as previously described [12]. |
T92 | 1815-1968 | Sentence | denotes | PBMCs were isolated by density centrifugation over Ficoll-Hypaque (density, 1.077 g/ml; Amersham Biosciences, Amersham, UK) as previously described [34]. |
T93 | 1969-2125 | Sentence | denotes | Cells were stimulated with anti-CD3/CD28 (1 µg/ml each) for 1 h at 37°C to stimulate Th2 cytokine release in the presence or absence of FP (10−12 to 10−8M). |
T94 | 2126-2237 | Sentence | denotes | Cytospins were prepared and GATA-3 localization determined by confocal microscopy as previously described [12]. |
T95 | 2239-2264 | Sentence | denotes | Reverse Transcription PCR |
T96 | 2265-2342 | Sentence | denotes | Total RNA was extracted using lysis buffer (RNeasy kit; Qiagen, Crawley, UK). |
T97 | 2343-2438 | Sentence | denotes | During RNA purification, genomic DNA was digested with RNase-free DNase (Amersham Biosciences). |
T98 | 2439-2557 | Sentence | denotes | Next, 0.5 µg of total RNA was reversed transcribed using the avian myeloblastosis virus RT (Promega, Southampton, UK). |
T99 | 2558-2628 | Sentence | denotes | For relative quantification, RT-PCR was carried out using cDNA probes. |
T100 | 2629-2686 | Sentence | denotes | Primers for IL-4 were from Sigma-Genosys (Cambridge, UK). |
T101 | 2687-2798 | Sentence | denotes | Sequences of GADPH used are as follows: forward 5′-CCACCCATGGCAAATTCCATGGC, reverse 3′-TCTAGACGGCAGGTCAGGTCCAC. |
T102 | 2800-2866 | Sentence | denotes | Cell Fractionation, Immunoprecipitation, and Western Blot Analysis |
T103 | 2867-2944 | Sentence | denotes | Nuclear and cytoplasmic fractions were prepared as previously described [35]. |
T104 | 2945-3114 | Sentence | denotes | Whole cell lysates were prepared in NP-40 lysis buffer (0.5% Nonidet P-40, 20 mM Tris-HCl [pH 7.5], 150 mM NaCl) in the presence of complete protease cocktail inhibitor. |
T105 | 3115-3230 | Sentence | denotes | Lysates were centrifuged at 4°C for 10 min at 12,000 rpm in an Eppendorf microcentrifuge to remove cellular debris. |
T106 | 3231-3482 | Sentence | denotes | Samples were then immunoprecipitated with either 10 µl of antibody against GATA-3 or importin-α using A/G agarose slurry in the presence of protease inhibitor using the Catch and Release methodology (Upstate Biotechnology, Lake Placid, New York, USA). |
T107 | 3483-3619 | Sentence | denotes | Western blot analysis was performed using anti-GATA-3, anti-importin-α, anti-GR, anti-p-p38 MAP kinase, anti-p-ATF-2, and anti-p-serine. |
T108 | 3620-3725 | Sentence | denotes | Immunoreactive proteins were detected using an enhanced chemiluminescence ECL kit (Amersham Biosciences). |
T109 | 3727-3756 | Sentence | denotes | Chromatin Immunoprecipitation |
T110 | 3757-4005 | Sentence | denotes | Chromatin immunoprecipitation (IP) was performed as previously described [12] in HuT-78 T-cells with 2 µg of anti-GATA-3 (Santa Cruz Biotechnology), or isotypic immunoglobulin G as a non-specific control (Santa Cruz Biotechnology) overnight at 4°C. |
T111 | 4006-4140 | Sentence | denotes | Promoter sequences were detected with PCR primers for the IL-5 promoter (−445 to +4): forward 5′-TTAATCTAGCCACAGTCATAG-3′ and reverse: |
T112 | 4141-4169 | Sentence | denotes | 5′-TCATGGCTCTGAAACGTTCTG-3′. |
T113 | 4170-4350 | Sentence | denotes | PCR was performed using a Hybaid Omnigene thermal cycler (Hybaid, Ashford, UK) with cycling parameters of 72°C for 10 min, 35 cycles at 94°C for 45 s, 52°C for 45 s, 72°C for 45 s. |
T114 | 4352-4423 | Sentence | denotes | GR-GATA-3 In Vitro Competition Assay for Importin-α (Far-Western ELISA) |
T115 | 4424-4599 | Sentence | denotes | Immunoprecipitated importin-α (anti-importin-α, Santa Cruz Biotechnology) from HuT-78 cells was separated by SDS-PAGE and purified from the excised gel by electroelution [36]. |
T116 | 4600-4782 | Sentence | denotes | Similarly, GATA-3 was isolated from nonstimulated HuT-78 cells or cells stimulated for 30 min with anti-CD3/CD28 and GR was isolated from FP (10−8 M, 30 min) stimulated HuT-78 cells. |
T117 | 4783-4845 | Sentence | denotes | These proteins were subsequently refolded in glycine solution. |
T118 | 4846-4965 | Sentence | denotes | 100 µl of importin-α solution (100 ng/ml in TBS) was added to 96-well plates coated with goat anti-importin-α antibody. |
T119 | 4966-5094 | Sentence | denotes | After 1 h incubation, GATA-3 (100 ng/ml in TBS) from stimulated or unstimulated cells were added to the importin-α-coated wells. |
T120 | 5095-5186 | Sentence | denotes | GR (10 or 100 ng/ml in TBS) from stimulated or unstimulated cells were added to some wells. |
T121 | 5187-5412 | Sentence | denotes | After a further 1 h incubation, the plate was washed and incubated with primary antibodies (a mixture of rabbit anti-GATA-3 and mouse anti-GR, Santa Cruz Biotechnology) for 1.5 h, and then incubated with secondary antibodies. |
T122 | 5413-5603 | Sentence | denotes | FITC swine anti-rabbit IgG (Dako, Cambridge, UK) was used for the detection of GATA-3, and rhodamine donkey anti-mouse IgG (Novus, Littleton, Colorado, USA) was used for the detection of GR. |
T123 | 5604-5704 | Sentence | denotes | FITC and rhodamine levels were measured with a fluorescent micro-plate reader (Bioline, London, UK). |
T124 | 5706-5722 | Sentence | denotes | NF-κB Activation |
T125 | 5723-5855 | Sentence | denotes | NF-κB binding activity in nuclear extracts was determined using an ELISA-based kit (Trans-AM p65, Active Motif, Rixensart, Belgium). |
T126 | 5856-5966 | Sentence | denotes | In brief, 5 µg of nuclear extracts were incubated with a plate coated with an NF-κB consensus oligonucleotide. |
T127 | 5967-6026 | Sentence | denotes | Plates were washed before addition of an anti-p65 antibody. |
T128 | 6027-6131 | Sentence | denotes | Antibody binding was detected with a secondary HRP-conjugated antibody and developed with TMB substrate. |
T129 | 6132-6185 | Sentence | denotes | The intensity of the reaction was measured at 450 nm. |
T130 | 6187-6214 | Sentence | denotes | Immunofluorescence Staining |
T131 | 6215-6286 | Sentence | denotes | Immunofluorescence staining was performed as previously described [34]. |
T132 | 6287-6359 | Sentence | denotes | All staining was performed at room temperature and under humidification. |
T133 | 6360-6459 | Sentence | denotes | Cells were collected and cytospins prepared in a cytocentrifuge (Shandon II, Shandon, Runcorn, UK). |
T134 | 6460-6644 | Sentence | denotes | Cells were permeabilized, blocked, and then incubated with GR (1∶50 E-20 Santa Cruz Biotechnology) or anti-GATA-3 (H-48; Santa Cruz Biotechnology) antibody for 1 h at room temperature. |
T135 | 6645-6800 | Sentence | denotes | After three washes in phosphate-buffered saline (PBS), cells were incubated with tetrarhodamine isothiocyanate–conjugated goat anti-rabbit antibody (Dako). |
T136 | 6801-6977 | Sentence | denotes | Cytospins were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI), a fluorescent blue nuclear indole chromatin stain, and mounted in PBS:glycerol (50∶50). |
T137 | 6978-7181 | Sentence | denotes | The immunopositive signal was characterised using laser scanning confocal microscopy on a Leica TCS NT/SP interactive laser cytometer equipped with confocal optics (Leica Microsystems, Wetzlar, Germany). |
T138 | 7182-7332 | Sentence | denotes | To determine the specificity of the antibodies, rabbit serum immunoglobulin (Dako) and secondary antibodies without the primary were used as controls. |
T139 | 7333-7451 | Sentence | denotes | Positively stained nuclei and total cells were counted (500) on each slide with the observer blinded to the treatment. |
T140 | 7453-7473 | Sentence | denotes | GATA-3-GFP Construct |
T141 | 7474-7623 | Sentence | denotes | The GATA-3 clone (BC003070) complete cDNA was obtained from Invitrogen Life Technologies as a 5′- EcoRI/3′-XhoI insert of GATA-3 in the pOTB7 vector. |
T142 | 7624-7754 | Sentence | denotes | GATA-3 was excised from pOTB7 using XhoI digestion and pEGFP-C2 (Clontech, Saint-Germain-en-Laye, France) was digested with BamHI. |
T143 | 7755-7951 | Sentence | denotes | DNA was recovered by phenol extraction and ethanol precipitation, and both the GATA-3 fragment and the pEGFP-C2 vector blunt-ended by incubation with Klenow (Bioline Bio-27029) for 30 min at 37°C. |
T144 | 7952-8008 | Sentence | denotes | Klenow was inactivated by incubation for 10 min at 75°C. |
T145 | 8009-8279 | Sentence | denotes | DNA was recovered by phenol extraction and ethanol precipitation, and both the blunt-ended GATA-3 fragment and the GFP vector were subsequently digested with EcoRI before the 5′-EcoRI/3′–blunt end GATA-3 fragment was inserted into the 5′-EcoRI/3′–blunt ended GFP vector. |
T146 | 8280-8394 | Sentence | denotes | Positive clones were confirmed by digestion and size analysis by 1% agarose gel electrophoresis and by sequencing. |
T147 | 8396-8408 | Sentence | denotes | Transfection |
T148 | 8409-8680 | Sentence | denotes | HuT-78 cells were transfected with either EP8 or GFP vector only DNA using solution R, programme V-001 at a ratio of 3×106 cells/4 µg DNA for 7–8 h in complete medium (10% bovine serum in RPMI1640+15 L-glutamine) according to the general Amaxa protocol for nucleofection. |
T149 | 8681-8844 | Sentence | denotes | The medium was subsequently changed to 1% RPMI for 24 h before transfected cells were added to anti-CD3/CD28 treated wells and live cell videomicroscopy performed. |
T150 | 8846-8867 | Sentence | denotes | Time-Lapse Microscopy |
T151 | 8868-9136 | Sentence | denotes | HuT-78 cells expressing GATA-3-GFP were maintained at 37°C in growth medium in a closed FCS2 perfusion chamber (Bioptechs, Butler, Pennsylvania, USA) combined with an objective heater (Bioptechs) on the stage a Zeiss Axiovert 200 microscope (Thornwood, New York, USA). |
T152 | 9137-9402 | Sentence | denotes | Observations were made by 40×1.0 NA oil-immersion objective lens, and fluorescence and phase contrast images were gathered using a Hamamatsu ORCA-ER charged coupled device camera (Bridgewater, New Jersey, USA) driven by Openlab software (Improvision, Coventry, UK). |
T153 | 9403-9457 | Sentence | denotes | Photographs were taken at 0, 30, 60, 120, and 240 min. |
T154 | 9459-9481 | Sentence | denotes | Densitometric Analysis |
T155 | 9482-9611 | Sentence | denotes | Densitometry of ECL immunoblots was performed using Gelworks ID intermediate software (Ultraviolet Products, Cambridgeshire, UK). |
T156 | 9612-9692 | Sentence | denotes | Briefly, immunoblots were scanned and gates were drawn tightly around each band. |
T157 | 9693-9772 | Sentence | denotes | Background values from each lane were subtracted to normalize each measurement. |
T158 | 9773-9827 | Sentence | denotes | The bands were quantified using the Gelworks software. |
T159 | 9828-9999 | Sentence | denotes | All Western blots were exposed to film for varying lengths of time, and only films generating subsaturating levels of intensity were selected for densitometric evaluation. |
T160 | 10001-10021 | Sentence | denotes | Statistical Analysis |
T161 | 10022-10236 | Sentence | denotes | Data from three or more independent experiments are presented as the mean±standard error of the mean (SEM), except where stated and were compared using GraphPad Prism 4 (GraphPad Software, http://www.graphpad.com). |
T162 | 10237-10460 | Sentence | denotes | Results were analysed using one-way ANOVA with Newman-Keuls post test except for the data from the in vivo inhaled FP study, which was analysed by Friedman's test with subsequent Wilcoxson matched pair signed rank sum test. |
T163 | 10461-10526 | Sentence | denotes | Data from this analysis are presented as a box-and-whiskers plot. |
T164 | 10527-10676 | Sentence | denotes | Friedman's test was used as three matched measures were obtained using placebo, 100 µg, and 500 µg of inhaled FP, which had variable baseline levels. |
T165 | 10677-10834 | Sentence | denotes | We did not assume a Gaussian distribution of the data due to the limited numbers of participants analysed (seven).The null hypothesis was rejected at p<0.05. |
ICD10
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T3954 | 83-89 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T3955 | 276-282 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T3956 | 83-89 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T3957 | 276-282 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
events-check-again
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T6048 | 4352-4354 | Protein | denotes | GR |
T6049 | 4355-4361 | Protein | denotes | GATA-3 |
T6050 | 4611-4617 | Protein | denotes | GATA-3 |
T6051 | 4717-4719 | Protein | denotes | GR |
T6052 | 4988-4994 | Protein | denotes | GATA-3 |
T6053 | 5095-5097 | Protein | denotes | GR |
T6054 | 5492-5498 | Protein | denotes | GATA-3 |
T6055 | 5600-5602 | Protein | denotes | GR |
T6731 | 6519-6521 | Protein | denotes | GR |
T4329 | 879-882 | Protein | denotes | CD3 |
T4330 | 884-888 | Protein | denotes | CD28 |
T4331 | 890-892 | Protein | denotes | GR |
T4332 | 1002-1008 | Protein | denotes | GATA-3 |
T4333 | 1020-1022 | Protein | denotes | GR |
T4334 | 1196-1201 | Protein | denotes | ATF-2 |
T4606 | 2154-2160 | Protein | denotes | GATA-3 |
T4607 | 2161-2173 | Localization | denotes | localization |
T4842 | 2641-2645 | Protein | denotes | IL-4 |
T5188 | 3306-3312 | Protein | denotes | GATA-3 |
T5459 | 4064-4068 | Protein | denotes | IL-5 |
T6260 | 5816-5819 | Protein | denotes | p65 |
T7155 | 7453-7459 | Protein | denotes | GATA-3 |
T7156 | 7460-7463 | Protein | denotes | GFP |
T7157 | 7478-7484 | Protein | denotes | GATA-3 |
T7158 | 7596-7602 | Protein | denotes | GATA-3 |
T7159 | 7624-7630 | Protein | denotes | GATA-3 |
T7160 | 7660-7664 | Protein | denotes | XhoI |
T7161 | 7748-7753 | Protein | denotes | BamHI |
T7162 | 7834-7840 | Protein | denotes | GATA-3 |
T7163 | 8100-8106 | Protein | denotes | GATA-3 |
T7164 | 8124-8127 | Protein | denotes | GFP |
T7165 | 8167-8172 | Protein | denotes | EcoRI |
T7166 | 8206-8212 | Protein | denotes | GATA-3 |
T7167 | 8268-8271 | Protein | denotes | GFP |
T7603 | 8881-8891 | Gene_expression | denotes | expressing |
T7604 | 8892-8902 | Protein | denotes | GATA-3-GFP |
R3967 | T4606 | T4607 | themeOf | GATA-3,localization |
R6532 | T7604 | T7603 | themeOf | GATA-3-GFP,expressing |
bionlp-st-ge-2016-reference-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4335 | 873-882 | Protein | denotes | human CD3 |
T4336 | 884-888 | Protein | denotes | CD28 |
T4337 | 890-892 | Protein | denotes | GR |
T4338 | 898-908 | Protein | denotes | importin-α |
T4339 | 1020-1022 | Protein | denotes | GR |
T4839 | 2398-2403 | Protein | denotes | RNase |
T4840 | 2641-2645 | Protein | denotes | IL-4 |
T4841 | 2700-2705 | Protein | denotes | GADPH |
T6056 | 4393-4403 | Protein | denotes | Importin-α |
T6057 | 4443-4453 | Protein | denotes | importin-α |
T6058 | 4611-4617 | Protein | denotes | GATA-3 |
T6059 | 4704-4707 | Protein | denotes | CD3 |
T6060 | 4708-4712 | Protein | denotes | CD28 |
T6061 | 4717-4719 | Protein | denotes | GR |
T6062 | 4935-4964 | Protein | denotes | goat anti-importin-α antibody |
T6063 | 5070-5080 | Protein | denotes | importin-α |
T6064 | 5413-5439 | Protein | denotes | FITC swine anti-rabbit IgG |
T6065 | 5492-5498 | Protein | denotes | GATA-3 |
T6066 | 5532-5535 | Protein | denotes | IgG |
T6067 | 5600-5602 | Protein | denotes | GR |
T6068 | 5479-5488 | Gene_expression | denotes | detection |
T6069 | 5587-5596 | Gene_expression | denotes | detection |
T6070 | 5466-5470 | Positive_regulation | denotes | used |
T6732 | 7237-7257 | Protein | denotes | serum immunoglobulin |
T6733 | 7259-7263 | Protein | denotes | Dako |
T7141 | 7581-7585 | Protein | denotes | XhoI |
T7142 | 7596-7602 | Protein | denotes | GATA-3 |
T7143 | 7610-7622 | Protein | denotes | pOTB7 vector |
T7144 | 7624-7630 | Protein | denotes | GATA-3 |
T7145 | 7648-7664 | Protein | denotes | pOTB7 using XhoI |
T7146 | 7679-7687 | Protein | denotes | pEGFP-C2 |
T7147 | 7748-7753 | Protein | denotes | BamHI |
T7148 | 7635-7642 | Negative_regulation | denotes | excised |
T7149 | 7635-7642 | Negative_regulation | denotes | excised |
T7150 | 7834-7849 | Protein | denotes | GATA-3 fragment |
T7151 | 7858-7863 | Protein | denotes | pEGFP |
T7152 | 7864-7866 | Protein | denotes | C2 |
T7153 | 8167-8172 | Protein | denotes | EcoRI |
T7154 | 8206-8221 | Protein | denotes | GATA-3 fragment |
T8093 | 10637-10639 | Protein | denotes | FP |
T4610 | 2054-2074 | Protein | denotes | Th2 cytokine release |
T4340 | 1173-1183 | Protein | denotes | MAP kinase |
T4341 | 1188-1201 | Protein | denotes | phospho-ATF-2 |
T4342 | 1400-1403 | Protein | denotes | IgG |
T4608 | 1996-2004 | Protein | denotes | anti-CD3 |
T4609 | 2005-2009 | Protein | denotes | CD28 |
T4611 | 2044-2053 | Positive_regulation | denotes | stimulate |
T5189 | 3077-3094 | Protein | denotes | complete protease |
T5190 | 3104-3113 | Negative_regulation | denotes | inhibitor |
T5191 | 3306-3312 | Protein | denotes | GATA-3 |
T5192 | 3316-3326 | Protein | denotes | importin-α |
T5193 | 3525-3536 | Protein | denotes | anti-GATA-3 |
T5194 | 3538-3553 | Protein | denotes | anti-importin-α |
T5195 | 3555-3562 | Protein | denotes | anti-GR |
T5196 | 3564-3574 | Protein | denotes | anti-p-p38 |
T5197 | 3575-3585 | Protein | denotes | MAP kinase |
T5198 | 3519-3524 | Positive_regulation | denotes | using |
T5460 | 3727-3736 | Protein | denotes | Chromatin |
T5461 | 3737-3756 | Localization | denotes | Immunoprecipitation |
T5462 | 3757-3766 | Protein | denotes | Chromatin |
T5463 | 3918-3934 | Protein | denotes | immunoglobulin G |
T5464 | 4064-4077 | Protein | denotes | IL-5 promoter |
T6261 | 5706-5711 | Protein | denotes | NF-κB |
T6262 | 5712-5722 | Positive_regulation | denotes | Activation |
T6263 | 5723-5728 | Protein | denotes | NF-κB |
T6264 | 5729-5736 | Binding | denotes | binding |
T6265 | 5934-5965 | Protein | denotes | NF-κB consensus oligonucleotide |
T6266 | 6008-6025 | Protein | denotes | anti-p65 antibody |
T6267 | 6074-6097 | Protein | denotes | HRP-conjugated antibody |
T6268 | 6036-6043 | Binding | denotes | binding |
T7345 | 8776-8784 | Protein | denotes | anti-CD3 |
T7346 | 8785-8789 | Protein | denotes | CD28 |
R3968 | T4610 | T4611 | themeOf | Th2 cytokine release,stimulate |
R4481 | T5189 | T5190 | themeOf | complete protease,inhibitor |
R4482 | T5196 | T5198 | themeOf | anti-p-p38,using |
R4723 | T5460 | T5461 | themeOf | Chromatin,Immunoprecipitation |
R5223 | T6064 | T6070 | causeOf | FITC swine anti-rabbit IgG,used |
R5224 | T6065 | T6068 | themeOf | GATA-3,detection |
R5225 | T6067 | T6069 | themeOf | GR,detection |
R5226 | T6068 | T6070 | themeOf | detection,used |
R5386 | T6261 | T6262 | themeOf | NF-κB,Activation |
R5387 | T6263 | T6264 | themeOf | NF-κB,binding |
R5388 | T6267 | T6268 | themeOf | HRP-conjugated antibody,binding |
R6129 | T7144 | T7148 | themeOf | GATA-3,excised |
R6130 | T7145 | T7149 | themeOf | pOTB7 using XhoI,excised |
bionlp-st-ge-2016-reference
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T3970 | 879-882 | Protein | denotes | CD3 |
T3971 | 884-888 | Protein | denotes | CD28 |
T3972 | 890-892 | Protein | denotes | GR |
T3973 | 1002-1008 | Protein | denotes | GATA-3 |
T3974 | 1020-1022 | Protein | denotes | GR |
T3975 | 1196-1201 | Protein | denotes | ATF-2 |
T5481 | 4352-4354 | Protein | denotes | GR |
T5482 | 4355-4361 | Protein | denotes | GATA-3 |
T5483 | 4611-4617 | Protein | denotes | GATA-3 |
T5484 | 4717-4719 | Protein | denotes | GR |
T5485 | 4988-4994 | Protein | denotes | GATA-3 |
T5486 | 5095-5097 | Protein | denotes | GR |
T5487 | 5492-5498 | Protein | denotes | GATA-3 |
T5488 | 5600-5602 | Protein | denotes | GR |
T7351 | 8881-8891 | Gene_expression | denotes | expressing |
T7352 | 8892-8902 | Protein | denotes | GATA-3-GFP |
T4614 | 2641-2645 | Protein | denotes | IL-4 |
T6272 | 6519-6521 | Protein | denotes | GR |
T6761 | 7453-7459 | Protein | denotes | GATA-3 |
T6762 | 7460-7463 | Protein | denotes | GFP |
T6763 | 7478-7484 | Protein | denotes | GATA-3 |
T6764 | 7596-7602 | Protein | denotes | GATA-3 |
T6765 | 7624-7630 | Protein | denotes | GATA-3 |
T6766 | 7660-7664 | Protein | denotes | XhoI |
T6767 | 7748-7753 | Protein | denotes | BamHI |
T6768 | 7834-7840 | Protein | denotes | GATA-3 |
T6769 | 8100-8106 | Protein | denotes | GATA-3 |
T6770 | 8124-8127 | Protein | denotes | GFP |
T6771 | 8167-8172 | Protein | denotes | EcoRI |
T6772 | 8206-8212 | Protein | denotes | GATA-3 |
T6773 | 8268-8271 | Protein | denotes | GFP |
T6073 | 5816-5819 | Protein | denotes | p65 |
T4347 | 2154-2160 | Protein | denotes | GATA-3 |
T4348 | 2161-2173 | Localization | denotes | localization |
T5201 | 4064-4068 | Protein | denotes | IL-5 |
T4845 | 3306-3312 | Protein | denotes | GATA-3 |
R6293 | T7352 | T7351 | themeOf | GATA-3-GFP,expressing |
R3730 | T4347 | T4348 | themeOf | GATA-3,localization |
bionlp-st-ge-2016-uniprot
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4128 | 879-882 | P09693 | denotes | CD3 |
T4129 | 879-882 | P07766 | denotes | CD3 |
T4130 | 879-882 | P04234 | denotes | CD3 |
T4131 | 879-882 | P20963 | denotes | CD3 |
T4132 | 884-888 | P10747 | denotes | CD28 |
T4133 | 890-892 | P04150 | denotes | GR |
T4134 | 1002-1008 | P23771 | denotes | GATA-3 |
T4135 | 1020-1022 | P04150 | denotes | GR |
T4136 | 1169-1172 | Q16539 | denotes | p38 |
T4137 | 1169-1172 | P53778 | denotes | p38 |
T4138 | 1169-1172 | Q15759 | denotes | p38 |
T4139 | 1169-1172 | O15264 | denotes | p38 |
T4140 | 1196-1201 | P15336 | denotes | ATF-2 |
T4141 | 1468-1470 | P04150 | denotes | GR |
T5739 | 4352-4354 | P04150 | denotes | GR |
T5740 | 4355-4361 | P23771 | denotes | GATA-3 |
T5741 | 4611-4617 | P23771 | denotes | GATA-3 |
T5742 | 4704-4707 | P04234 | denotes | CD3 |
T5743 | 4704-4707 | P09693 | denotes | CD3 |
T5744 | 4704-4707 | P20963 | denotes | CD3 |
T5745 | 4704-4707 | P07766 | denotes | CD3 |
T5746 | 4708-4712 | P10747 | denotes | CD28 |
T5747 | 4717-4719 | P04150 | denotes | GR |
T5748 | 4988-4994 | P23771 | denotes | GATA-3 |
T5749 | 5095-5097 | P04150 | denotes | GR |
T5750 | 5304-5310 | P23771 | denotes | GATA-3 |
T5751 | 5326-5328 | P04150 | denotes | GR |
T5752 | 5492-5498 | P23771 | denotes | GATA-3 |
T5753 | 5600-5602 | P04150 | denotes | GR |
T6927 | 7453-7459 | P23771 | denotes | GATA-3 |
T6928 | 7460-7463 | Q9U6Y4 | denotes | GFP |
T6929 | 7478-7484 | P23771 | denotes | GATA-3 |
T6930 | 7596-7602 | P23771 | denotes | GATA-3 |
T6931 | 7624-7630 | P23771 | denotes | GATA-3 |
T6932 | 7834-7840 | P23771 | denotes | GATA-3 |
T6933 | 8100-8106 | P23771 | denotes | GATA-3 |
T6934 | 8124-8127 | Q9U6Y4 | denotes | GFP |
T6935 | 8206-8212 | P23771 | denotes | GATA-3 |
T6936 | 8268-8271 | Q9U6Y4 | denotes | GFP |
T4464 | 2001-2004 | P04234 | denotes | CD3 |
T4465 | 2001-2004 | P20963 | denotes | CD3 |
T4466 | 2001-2004 | P09693 | denotes | CD3 |
T4467 | 2001-2004 | P07766 | denotes | CD3 |
T4468 | 2005-2009 | P10747 | denotes | CD28 |
T4469 | 2154-2160 | P23771 | denotes | GATA-3 |
T4715 | 2562-2570 | Q04864 | denotes | relative |
T4716 | 2641-2645 | P05112 | denotes | IL-4 |
T5004 | 3036-3038 | P0A7Z4 | denotes | pH |
T5005 | 3306-3312 | P23771 | denotes | GATA-3 |
T5006 | 3530-3536 | P23771 | denotes | GATA-3 |
T5007 | 3560-3562 | P04150 | denotes | GR |
T5008 | 3571-3574 | Q16539 | denotes | p38 |
T5009 | 3571-3574 | Q15759 | denotes | p38 |
T5010 | 3571-3574 | P53778 | denotes | p38 |
T5011 | 3571-3574 | O15264 | denotes | p38 |
T5012 | 3594-3599 | P15336 | denotes | ATF-2 |
T5316 | 3871-3877 | P23771 | denotes | GATA-3 |
T5317 | 4064-4068 | P05113 | denotes | IL-5 |
T6157 | 5816-5819 | Q04206 | denotes | p65 |
T6158 | 5816-5819 | P21579 | denotes | p65 |
T6159 | 6013-6016 | Q04206 | denotes | p65 |
T6160 | 6013-6016 | P21579 | denotes | p65 |
T6484 | 6519-6521 | P04150 | denotes | GR |
T6485 | 6567-6573 | P23771 | denotes | GATA-3 |
T7248 | 8458-8461 | Q9U6Y4 | denotes | GFP |
T7249 | 8781-8784 | P20963 | denotes | CD3 |
T7250 | 8781-8784 | P09693 | denotes | CD3 |
T7251 | 8781-8784 | P07766 | denotes | CD3 |
T7252 | 8781-8784 | P04234 | denotes | CD3 |
T7253 | 8785-8789 | P10747 | denotes | CD28 |
T7469 | 8892-8898 | P23771 | denotes | GATA-3 |
T7470 | 8899-8902 | Q9U6Y4 | denotes | GFP |
T7471 | 9278-9282 | Q13501 | denotes | ORCA |
T7472 | 9283-9285 | P03372 | denotes | ER |
T7690 | 9543-9545 | P41134 | denotes | ID |
test2
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T3964 | 879-882 | Protein | denotes | CD3 |
T3965 | 884-888 | Protein | denotes | CD28 |
T3966 | 890-892 | Protein | denotes | GR |
T3967 | 1002-1008 | Protein | denotes | GATA-3 |
T3968 | 1020-1022 | Protein | denotes | GR |
T3969 | 1196-1201 | Protein | denotes | ATF-2 |
T4345 | 2154-2160 | Protein | denotes | GATA-3 |
T4346 | 2161-2173 | Localization | denotes | localization |
T4613 | 2641-2645 | Protein | denotes | IL-4 |
T4844 | 3306-3312 | Protein | denotes | GATA-3 |
T5200 | 4064-4068 | Protein | denotes | IL-5 |
T5473 | 4352-4354 | Protein | denotes | GR |
T5474 | 4355-4361 | Protein | denotes | GATA-3 |
T5475 | 4611-4617 | Protein | denotes | GATA-3 |
T5476 | 4717-4719 | Protein | denotes | GR |
T5477 | 4988-4994 | Protein | denotes | GATA-3 |
T5478 | 5095-5097 | Protein | denotes | GR |
T5479 | 5492-5498 | Protein | denotes | GATA-3 |
T5480 | 5600-5602 | Protein | denotes | GR |
T6072 | 5816-5819 | Protein | denotes | p65 |
T6270 | 6519-6521 | Protein | denotes | GR |
T6747 | 7453-7459 | Protein | denotes | GATA-3 |
T6748 | 7460-7463 | Protein | denotes | GFP |
T6749 | 7478-7484 | Protein | denotes | GATA-3 |
T6750 | 7596-7602 | Protein | denotes | GATA-3 |
T6751 | 7624-7630 | Protein | denotes | GATA-3 |
T6752 | 7635-7642 | Negative_regulation | denotes | excised |
T6753 | 7660-7664 | Protein | denotes | XhoI |
T6754 | 7748-7753 | Protein | denotes | BamHI |
T6755 | 7834-7840 | Protein | denotes | GATA-3 |
T6756 | 8100-8106 | Protein | denotes | GATA-3 |
T6757 | 8124-8127 | Protein | denotes | GFP |
T6758 | 8167-8172 | Protein | denotes | EcoRI |
T6759 | 8206-8212 | Protein | denotes | GATA-3 |
T6760 | 8268-8271 | Protein | denotes | GFP |
T7349 | 8881-8891 | Gene_expression | denotes | expressing |
T7350 | 8892-8902 | Protein | denotes | GATA-3-GFP |
R5811 | T6751 | T6752 | themeOf | GATA-3,excised |
R5812 | T6756 | T6758 | themeOf | GATA-3,EcoRI |
R5813 | T6757 | T6758 | themeOf | GFP,EcoRI |
R5814 | T6759 | T6758 | themeOf | GATA-3,EcoRI |
R6292 | T7350 | T7349 | themeOf | GATA-3-GFP,expressing |
R3729 | T4345 | T4346 | themeOf | GATA-3,localization |