
PMC:2674207
Annnotations
2_test
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
19436703-16903918-86274449 | 7563-7564 | 16903918 | denotes | 1 |
19436703-10525032-86274450 | 7690-7691 | 10525032 | denotes | 2 |
19436703-16467870-86274451 | 7694-7695 | 16467870 | denotes | 3 |
19436703-11336690-86274452 | 7837-7838 | 11336690 | denotes | 4 |
19436703-11893731-86274453 | 7841-7842 | 11893731 | denotes | 7 |
19436703-10549629-86274454 | 8096-8097 | 10549629 | denotes | 8 |
19436703-11390432-86274455 | 8100-8101 | 11390432 | denotes | 9 |
19436703-14769923-86274456 | 8223-8225 | 14769923 | denotes | 10 |
19436703-15087456-86274457 | 8304-8306 | 15087456 | denotes | 11 |
19436703-17277157-86274458 | 8445-8447 | 17277157 | denotes | 12 |
19436703-11751746-86274459 | 8700-8702 | 11751746 | denotes | 13 |
19436703-17277157-86274460 | 8803-8805 | 17277157 | denotes | 12 |
19436703-8114750-86274461 | 8859-8861 | 8114750 | denotes | 14 |
19436703-17277157-86274462 | 8971-8973 | 17277157 | denotes | 12 |
19436703-17277157-86274463 | 9125-9127 | 17277157 | denotes | 12 |
19436703-8114750-86274464 | 9130-9132 | 8114750 | denotes | 14 |
19436703-15350979-86274465 | 9215-9217 | 15350979 | denotes | 15 |
19436703-17277157-86274466 | 9421-9423 | 17277157 | denotes | 12 |
19436703-7510080-86274467 | 9583-9585 | 7510080 | denotes | 16 |
19436703-16236742-86274468 | 10145-10147 | 16236742 | denotes | 17 |
19436703-16604091-86274469 | 10150-10152 | 16604091 | denotes | 18 |
19436703-3123217-86274470 | 10264-10266 | 3123217 | denotes | 19 |
19436703-17314103-86274471 | 10299-10301 | 17314103 | denotes | 20 |
19436703-15110988-86274472 | 10403-10405 | 15110988 | denotes | 21 |
19436703-9891038-86274473 | 10468-10470 | 9891038 | denotes | 22 |
19436703-15004228-86274474 | 10640-10642 | 15004228 | denotes | 23 |
19436703-15004228-86274475 | 10833-10835 | 15004228 | denotes | 23 |
19436703-16610357-86274476 | 10957-10959 | 16610357 | denotes | 24 |
19436703-16610357-86274477 | 11123-11125 | 16610357 | denotes | 24 |
19436703-18049904-86274478 | 11128-11130 | 18049904 | denotes | 26 |
19436703-15591061-86274479 | 11221-11223 | 15591061 | denotes | 27 |
19436703-15496417-86274480 | 11226-11228 | 15496417 | denotes | 28 |
19436703-8532532-86274481 | 11431-11433 | 8532532 | denotes | 29 |
19436703-9780145-86274482 | 11490-11492 | 9780145 | denotes | 30 |
19436703-12876556-86274483 | 11495-11497 | 12876556 | denotes | 32 |
19436703-15826950-86274484 | 11570-11572 | 15826950 | denotes | 33 |
19436703-15860753-86274485 | 12573-12575 | 15860753 | denotes | 34 |
19436703-17277157-86274486 | 14137-14139 | 17277157 | denotes | 12 |
19436703-15860753-86274487 | 14291-14293 | 15860753 | denotes | 34 |
19436703-17277157-86274488 | 14560-14562 | 17277157 | denotes | 12 |
19436703-11395507-86274489 | 15267-15269 | 11395507 | denotes | 35 |
19436703-17277157-86274490 | 16158-16160 | 17277157 | denotes | 12 |
19436703-10958685-86274491 | 16922-16924 | 10958685 | denotes | 36 |
19436703-15860753-86274492 | 18609-18611 | 15860753 | denotes | 34 |
19436703-12876556-86274493 | 23352-23354 | 12876556 | denotes | 32 |
19436703-17277157-86274494 | 23612-23614 | 17277157 | denotes | 12 |
19436703-11140432-86274495 | 23954-23956 | 11140432 | denotes | 37 |
19436703-17314103-86274496 | 25921-25923 | 17314103 | denotes | 20 |
19436703-15496417-86274497 | 28464-28466 | 15496417 | denotes | 28 |
19436703-15591061-86274498 | 35990-35992 | 15591061 | denotes | 27 |
19436703-17277157-86274499 | 40816-40818 | 17277157 | denotes | 12 |
19436703-17277157-86274500 | 41048-41050 | 17277157 | denotes | 12 |
19436703-9891038-86274501 | 41150-41152 | 9891038 | denotes | 22 |
19436703-12391149-86274502 | 42665-42667 | 12391149 | denotes | 38 |
19436703-17099067-86274503 | 42670-42672 | 17099067 | denotes | 39 |
19436703-11140432-86274504 | 43736-43738 | 11140432 | denotes | 37 |
19436703-12001789-86274505 | 44443-44445 | 12001789 | denotes | 40 |
19436703-10887335-86274506 | 44448-44450 | 10887335 | denotes | 42 |
19436703-16266385-86274507 | 45231-45233 | 16266385 | denotes | 43 |
T43001 | 7563-7564 | 16903918 | denotes | 1 |
T70873 | 7690-7691 | 10525032 | denotes | 2 |
T67559 | 7694-7695 | 16467870 | denotes | 3 |
T42453 | 7837-7838 | 11336690 | denotes | 4 |
T56933 | 7841-7842 | 11893731 | denotes | 7 |
T99552 | 8096-8097 | 10549629 | denotes | 8 |
T78387 | 8100-8101 | 11390432 | denotes | 9 |
T31861 | 8223-8225 | 14769923 | denotes | 10 |
T54483 | 8304-8306 | 15087456 | denotes | 11 |
T49366 | 8445-8447 | 17277157 | denotes | 12 |
T50729 | 8700-8702 | 11751746 | denotes | 13 |
T71477 | 8803-8805 | 17277157 | denotes | 12 |
T49898 | 8859-8861 | 8114750 | denotes | 14 |
T29972 | 8971-8973 | 17277157 | denotes | 12 |
T24249 | 9125-9127 | 17277157 | denotes | 12 |
T62255 | 9130-9132 | 8114750 | denotes | 14 |
T15669 | 9215-9217 | 15350979 | denotes | 15 |
T56526 | 9421-9423 | 17277157 | denotes | 12 |
T37660 | 9583-9585 | 7510080 | denotes | 16 |
T62921 | 10145-10147 | 16236742 | denotes | 17 |
T62400 | 10150-10152 | 16604091 | denotes | 18 |
T78453 | 10264-10266 | 3123217 | denotes | 19 |
T63706 | 10299-10301 | 17314103 | denotes | 20 |
T47506 | 10403-10405 | 15110988 | denotes | 21 |
T32938 | 10468-10470 | 9891038 | denotes | 22 |
T41384 | 10640-10642 | 15004228 | denotes | 23 |
T57828 | 10833-10835 | 15004228 | denotes | 23 |
T19733 | 10957-10959 | 16610357 | denotes | 24 |
T68074 | 11123-11125 | 16610357 | denotes | 24 |
T88055 | 11128-11130 | 18049904 | denotes | 26 |
T58328 | 11221-11223 | 15591061 | denotes | 27 |
T37253 | 11226-11228 | 15496417 | denotes | 28 |
T40125 | 11431-11433 | 8532532 | denotes | 29 |
T36194 | 11490-11492 | 9780145 | denotes | 30 |
T8767 | 11495-11497 | 12876556 | denotes | 32 |
T27072 | 11570-11572 | 15826950 | denotes | 33 |
T86367 | 12573-12575 | 15860753 | denotes | 34 |
T38919 | 14137-14139 | 17277157 | denotes | 12 |
T24071 | 14291-14293 | 15860753 | denotes | 34 |
T69573 | 14560-14562 | 17277157 | denotes | 12 |
T8362 | 15267-15269 | 11395507 | denotes | 35 |
T57036 | 16158-16160 | 17277157 | denotes | 12 |
T21764 | 16922-16924 | 10958685 | denotes | 36 |
T87031 | 18609-18611 | 15860753 | denotes | 34 |
T38523 | 23352-23354 | 12876556 | denotes | 32 |
T73484 | 23612-23614 | 17277157 | denotes | 12 |
T58090 | 23954-23956 | 11140432 | denotes | 37 |
T64889 | 25921-25923 | 17314103 | denotes | 20 |
T59134 | 28464-28466 | 15496417 | denotes | 28 |
T7645 | 35990-35992 | 15591061 | denotes | 27 |
T69957 | 40816-40818 | 17277157 | denotes | 12 |
T58723 | 41048-41050 | 17277157 | denotes | 12 |
T89702 | 41150-41152 | 9891038 | denotes | 22 |
T56173 | 42665-42667 | 12391149 | denotes | 38 |
T354 | 42670-42672 | 17099067 | denotes | 39 |
T43358 | 43736-43738 | 11140432 | denotes | 37 |
T80830 | 44443-44445 | 12001789 | denotes | 40 |
T19947 | 44448-44450 | 10887335 | denotes | 42 |
T80216 | 45231-45233 | 16266385 | denotes | 43 |
pmc-enju-pas
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T149 | 0-11 | NN | denotes | Suppression |
T150 | 12-14 | IN | denotes | of |
T151 | 15-21 | NN | denotes | GATA-3 |
T152 | 22-29 | JJ | denotes | Nuclear |
T153 | 30-36 | NN | denotes | Import |
T154 | 37-40 | CC | denotes | and |
T155 | 41-56 | NN | denotes | Phosphorylation |
T156 | 56-57 | -COLON- | denotes | : |
T157 | 58-59 | DT | denotes | A |
T158 | 60-65 | NNP | denotes | Novel |
T159 | 66-75 | NNP | denotes | Mechanism |
T160 | 76-78 | IN | denotes | of |
T161 | 79-93 | NN | denotes | Corticosteroid |
T162 | 94-100 | NN | denotes | Action |
T163 | 101-103 | IN | denotes | in |
T164 | 104-112 | JJ | denotes | Allergic |
T165 | 113-120 | NN | denotes | Disease |
T166 | 455-465 | NN | denotes | Background |
T167 | 466-472 | NN | denotes | GATA-3 |
T168 | 473-478 | VB | denotes | plays |
T169 | 479-480 | DT | denotes | a |
T170 | 481-489 | JJ | denotes | critical |
T171 | 490-494 | NN | denotes | role |
T172 | 495-497 | IN | denotes | in |
T173 | 498-508 | VB | denotes | regulating |
T174 | 509-512 | DT | denotes | the |
T175 | 513-523 | NN | denotes | expression |
T176 | 524-526 | IN | denotes | of |
T177 | 527-530 | DT | denotes | the |
T178 | 531-540 | NN | denotes | cytokines |
T179 | 541-552 | NN | denotes | interleukin |
T180 | 553-554 | -LRB- | denotes | ( |
T181 | 554-556 | NN | denotes | IL |
T182 | 556-557 | -RRB- | denotes | ) |
T183 | 557-559 | CD | denotes | -4 |
T184 | 559-560 | -COMMA- | denotes | , |
T185 | 561-565 | NN | denotes | IL-5 |
T186 | 565-566 | -COMMA- | denotes | , |
T187 | 567-570 | CC | denotes | and |
T188 | 571-576 | NN | denotes | IL-13 |
T189 | 577-581 | IN | denotes | from |
T190 | 582-583 | NN | denotes | T |
T191 | 584-592 | NN | denotes | helper-2 |
T192 | 593-594 | -LRB- | denotes | ( |
T193 | 594-597 | NN | denotes | Th2 |
T194 | 597-598 | -RRB- | denotes | ) |
T195 | 599-604 | NN | denotes | cells |
T196 | 605-608 | CC | denotes | and |
T197 | 609-618 | RB | denotes | therefore |
T198 | 619-621 | VB | denotes | is |
T199 | 622-623 | DT | denotes | a |
T200 | 624-627 | JJ | denotes | key |
T201 | 628-636 | NN | denotes | mediator |
T202 | 637-639 | IN | denotes | of |
T203 | 640-648 | JJ | denotes | allergic |
T204 | 649-657 | NN | denotes | diseases |
T205 | 659-674 | NN | denotes | Corticosteroids |
T206 | 675-678 | VB | denotes | are |
T207 | 679-685 | RB | denotes | highly |
T208 | 686-695 | JJ | denotes | effective |
T209 | 696-698 | IN | denotes | in |
T210 | 699-710 | VB | denotes | suppressing |
T211 | 711-719 | JJ | denotes | allergic |
T212 | 720-732 | NN | denotes | inflammation |
T213 | 732-733 | -COMMA- | denotes | , |
T214 | 734-737 | CC | denotes | but |
T215 | 738-743 | PRP-DOLLAR- | denotes | their |
T216 | 744-751 | NN | denotes | effects |
T217 | 752-754 | IN | denotes | on |
T218 | 755-761 | NN | denotes | GATA-3 |
T219 | 762-765 | VB | denotes | are |
T220 | 766-773 | JJ | denotes | unknown |
T221 | 775-777 | PRP | denotes | We |
T222 | 778-790 | VB | denotes | investigated |
T223 | 791-794 | DT | denotes | the |
T224 | 795-801 | NN | denotes | effect |
T225 | 802-804 | IN | denotes | of |
T226 | 805-808 | DT | denotes | the |
T227 | 809-823 | NN | denotes | corticosteroid |
T228 | 824-835 | NN | denotes | fluticasone |
T229 | 836-846 | NN | denotes | propionate |
T230 | 847-849 | IN | denotes | on |
T231 | 850-856 | NN | denotes | GATA-3 |
T232 | 857-867 | NN | denotes | regulation |
T233 | 868-870 | IN | denotes | in |
T234 | 871-876 | JJ | denotes | human |
T235 | 877-890 | NN | denotes | T-lymphocytes |
T236 | 891-893 | FW | denotes | in |
T237 | 894-899 | FW | denotes | vitro |
T238 | 900-903 | CC | denotes | and |
T239 | 904-906 | FW | denotes | in |
T240 | 907-911 | FW | denotes | vivo |
T241 | 914-921 | NN | denotes | Methods |
T242 | 922-925 | CC | denotes | and |
T243 | 926-934 | NN | denotes | Findings |
T244 | 935-937 | IN | denotes | In |
T245 | 938-939 | DT | denotes | a |
T246 | 940-941 | NN | denotes | T |
T247 | 942-952 | NN | denotes | lymphocyte |
T248 | 953-957 | NN | denotes | cell |
T249 | 958-962 | NN | denotes | line |
T250 | 963-964 | -LRB- | denotes | ( |
T251 | 964-970 | NN | denotes | HuT-78 |
T252 | 970-971 | -RRB- | denotes | ) |
T253 | 972-975 | CC | denotes | and |
T254 | 976-986 | JJ | denotes | peripheral |
T255 | 987-992 | NN | denotes | blood |
T256 | 993-1004 | JJ | denotes | mononuclear |
T257 | 1005-1010 | NN | denotes | cells |
T258 | 1011-1021 | VB | denotes | stimulated |
T259 | 1022-1024 | IN | denotes | by |
T260 | 1025-1033 | JJ | denotes | anti-CD3 |
T261 | 1034-1037 | CC | denotes | and |
T262 | 1038-1047 | JJ | denotes | anti-CD28 |
T263 | 1048-1050 | FW | denotes | in |
T264 | 1051-1056 | FW | denotes | vitro |
T265 | 1057-1059 | PRP | denotes | we |
T266 | 1060-1072 | VB | denotes | demonstrated |
T267 | 1073-1077 | IN | denotes | that |
T268 | 1078-1089 | NN | denotes | fluticasone |
T269 | 1090-1098 | VB | denotes | inhibits |
T270 | 1099-1106 | JJ | denotes | nuclear |
T271 | 1107-1120 | NN | denotes | translocation |
T272 | 1121-1123 | IN | denotes | of |
T273 | 1124-1130 | NN | denotes | GATA-3 |
T274 | 1131-1134 | CC | denotes | and |
T275 | 1135-1145 | NN | denotes | expression |
T276 | 1146-1148 | IN | denotes | of |
T277 | 1149-1152 | NN | denotes | Th2 |
T278 | 1153-1162 | NN | denotes | cytokines |
T279 | 1163-1166 | IN | denotes | via |
T280 | 1167-1168 | DT | denotes | a |
T281 | 1169-1178 | NN | denotes | mechanism |
T282 | 1179-1190 | JJ | denotes | independent |
T283 | 1191-1193 | IN | denotes | of |
T284 | 1194-1201 | JJ | denotes | nuclear |
T285 | 1202-1211 | NN | denotes | factor-κB |
T286 | 1212-1215 | CC | denotes | and |
T287 | 1216-1218 | VB | denotes | is |
T288 | 1219-1222 | JJ | denotes | due |
T289 | 1222-1223 | -COMMA- | denotes | , |
T290 | 1224-1226 | IN | denotes | in |
T291 | 1227-1231 | NN | denotes | part |
T292 | 1231-1232 | -COMMA- | denotes | , |
T293 | 1233-1235 | TO | denotes | to |
T294 | 1236-1247 | NN | denotes | competition |
T295 | 1248-1255 | IN | denotes | between |
T296 | 1256-1262 | NN | denotes | GATA-3 |
T297 | 1263-1266 | CC | denotes | and |
T298 | 1267-1270 | DT | denotes | the |
T299 | 1271-1287 | JJ | denotes | ligand-activated |
T300 | 1288-1302 | NN | denotes | glucocorticoid |
T301 | 1303-1311 | NN | denotes | receptor |
T302 | 1312-1315 | IN | denotes | for |
T303 | 1316-1323 | JJ | denotes | nuclear |
T304 | 1324-1333 | NN | denotes | transport |
T305 | 1334-1341 | IN | denotes | through |
T306 | 1342-1345 | DT | denotes | the |
T307 | 1346-1353 | JJ | denotes | nuclear |
T308 | 1354-1362 | NN | denotes | importer |
T309 | 1363-1373 | NN | denotes | importin-α |
T310 | 1375-1377 | IN | denotes | In |
T311 | 1378-1386 | NN | denotes | addition |
T312 | 1386-1387 | -COMMA- | denotes | , |
T313 | 1388-1399 | NN | denotes | fluticasone |
T314 | 1400-1407 | VB | denotes | induces |
T315 | 1408-1411 | DT | denotes | the |
T316 | 1412-1422 | NN | denotes | expression |
T317 | 1423-1425 | IN | denotes | of |
T318 | 1426-1443 | JJ | denotes | mitogen-activated |
T319 | 1444-1451 | NN | denotes | protein |
T320 | 1452-1458 | NN | denotes | kinase |
T321 | 1459-1460 | -LRB- | denotes | ( |
T322 | 1460-1464 | NN | denotes | MAPK |
T323 | 1464-1465 | -RRB- | denotes | ) |
T324 | 1466-1479 | NN | denotes | phosphatase-1 |
T325 | 1480-1481 | -LRB- | denotes | ( |
T326 | 1481-1486 | NN | denotes | MKP-1 |
T327 | 1486-1487 | -RRB- | denotes | ) |
T328 | 1487-1488 | -COMMA- | denotes | , |
T329 | 1489-1492 | DT | denotes | the |
T330 | 1493-1503 | JJ | denotes | endogenous |
T331 | 1504-1513 | NN | denotes | inhibitor |
T332 | 1514-1516 | IN | denotes | of |
T333 | 1517-1520 | NN | denotes | p38 |
T334 | 1521-1525 | NN | denotes | MAPK |
T335 | 1525-1526 | -COMMA- | denotes | , |
T336 | 1527-1532 | WDT | denotes | which |
T337 | 1533-1535 | VB | denotes | is |
T338 | 1536-1545 | JJ | denotes | necessary |
T339 | 1546-1549 | IN | denotes | for |
T340 | 1550-1556 | NN | denotes | GATA-3 |
T341 | 1557-1564 | JJ | denotes | nuclear |
T342 | 1565-1578 | NN | denotes | translocation |
T343 | 1580-1585 | DT | denotes | These |
T344 | 1586-1596 | JJ | denotes | inhibitory |
T345 | 1597-1604 | NN | denotes | effects |
T346 | 1605-1607 | IN | denotes | of |
T347 | 1608-1619 | NN | denotes | fluticasone |
T348 | 1620-1623 | VB | denotes | are |
T349 | 1624-1629 | JJ | denotes | rapid |
T350 | 1629-1630 | -COMMA- | denotes | , |
T351 | 1631-1637 | JJ | denotes | potent |
T352 | 1637-1638 | -COMMA- | denotes | , |
T353 | 1639-1642 | CC | denotes | and |
T354 | 1643-1652 | VB | denotes | prolonged |
T355 | 1654-1656 | PRP | denotes | We |
T356 | 1657-1661 | RB | denotes | also |
T357 | 1662-1674 | VB | denotes | demonstrated |
T358 | 1675-1679 | IN | denotes | that |
T359 | 1680-1687 | VB | denotes | inhaled |
T360 | 1688-1699 | NN | denotes | fluticasone |
T361 | 1700-1708 | VB | denotes | inhibits |
T362 | 1709-1715 | NN | denotes | GATA-3 |
T363 | 1716-1723 | JJ | denotes | nuclear |
T364 | 1724-1737 | NN | denotes | translocation |
T365 | 1738-1740 | IN | denotes | in |
T366 | 1741-1751 | JJ | denotes | peripheral |
T367 | 1752-1757 | NN | denotes | blood |
T368 | 1758-1769 | NN | denotes | lymphocytes |
T369 | 1770-1772 | IN | denotes | of |
T370 | 1773-1781 | NN | denotes | patients |
T371 | 1782-1786 | IN | denotes | with |
T372 | 1787-1793 | NN | denotes | asthma |
T373 | 1794-1796 | FW | denotes | in |
T374 | 1797-1801 | FW | denotes | vivo |
T375 | 1804-1815 | NN | denotes | Conclusions |
T376 | 1816-1831 | NN | denotes | Corticosteroids |
T377 | 1832-1836 | VB | denotes | have |
T378 | 1837-1838 | DT | denotes | a |
T379 | 1839-1845 | JJ | denotes | potent |
T380 | 1846-1856 | JJ | denotes | inhibitory |
T381 | 1857-1863 | NN | denotes | effect |
T382 | 1864-1866 | IN | denotes | on |
T383 | 1867-1873 | NN | denotes | GATA-3 |
T384 | 1874-1877 | IN | denotes | via |
T385 | 1878-1881 | CD | denotes | two |
T386 | 1882-1893 | VB | denotes | interacting |
T387 | 1894-1904 | NN | denotes | mechanisms |
T388 | 1905-1909 | WDT | denotes | that |
T389 | 1910-1918 | RB | denotes | potently |
T390 | 1919-1927 | VB | denotes | suppress |
T391 | 1928-1931 | NN | denotes | Th2 |
T392 | 1932-1940 | NN | denotes | cytokine |
T393 | 1941-1951 | NN | denotes | expression |
T394 | 1953-1957 | DT | denotes | This |
T395 | 1958-1963 | JJ | denotes | novel |
T396 | 1964-1973 | NN | denotes | mechanism |
T397 | 1974-1976 | IN | denotes | of |
T398 | 1977-1983 | NN | denotes | action |
T399 | 1984-1986 | IN | denotes | of |
T400 | 1987-2002 | NN | denotes | corticosteroids |
T401 | 2003-2006 | MD | denotes | may |
T402 | 2007-2014 | VB | denotes | account |
T403 | 2015-2018 | IN | denotes | for |
T404 | 2019-2022 | DT | denotes | the |
T405 | 2023-2031 | JJ | denotes | striking |
T406 | 2032-2040 | JJ | denotes | clinical |
T407 | 2041-2049 | NN | denotes | efficacy |
T408 | 2050-2052 | IN | denotes | of |
T409 | 2053-2068 | NN | denotes | corticosteroids |
T410 | 2069-2071 | IN | denotes | in |
T411 | 2072-2075 | DT | denotes | the |
T412 | 2076-2085 | NN | denotes | treatment |
T413 | 2086-2088 | IN | denotes | of |
T414 | 2089-2097 | JJ | denotes | allergic |
T415 | 2098-2106 | NN | denotes | diseases |
T416 | 2109-2115 | VB | denotes | Please |
T417 | 2116-2119 | VB | denotes | see |
T418 | 2120-2125 | RB | denotes | later |
T419 | 2126-2128 | IN | denotes | in |
T420 | 2129-2132 | DT | denotes | the |
T421 | 2133-2140 | NN | denotes | article |
T422 | 2141-2144 | IN | denotes | for |
T423 | 2145-2152 | NN | denotes | Editors |
T424 | 2152-2153 | POS | denotes | ' |
T425 | 2154-2161 | JJ | denotes | Summary |
T1321 | 7246-7258 | NN | denotes | Inflammation |
T1322 | 7259-7261 | IN | denotes | in |
T1323 | 7262-7270 | JJ | denotes | allergic |
T1324 | 7271-7279 | NN | denotes | diseases |
T1325 | 7280-7284 | JJ | denotes | such |
T1326 | 7285-7287 | IN | denotes | as |
T1327 | 7288-7294 | NN | denotes | asthma |
T1328 | 7294-7295 | -COMMA- | denotes | , |
T1329 | 7296-7304 | NN | denotes | rhinitis |
T1330 | 7304-7305 | -COMMA- | denotes | , |
T1331 | 7306-7309 | CC | denotes | and |
T1332 | 7310-7316 | JJ | denotes | atopic |
T1333 | 7317-7327 | NN | denotes | dermatitis |
T1334 | 7328-7330 | VB | denotes | is |
T1335 | 7331-7339 | VB | denotes | mediated |
T1336 | 7340-7343 | IN | denotes | via |
T1337 | 7344-7354 | NN | denotes | expression |
T1338 | 7355-7357 | IN | denotes | of |
T1339 | 7358-7361 | DT | denotes | the |
T1340 | 7362-7371 | NN | denotes | cytokines |
T1341 | 7372-7383 | NN | denotes | interleukin |
T1342 | 7384-7385 | -LRB- | denotes | ( |
T1343 | 7385-7387 | NN | denotes | IL |
T1344 | 7387-7388 | -RRB- | denotes | ) |
T1345 | 7388-7390 | CD | denotes | -4 |
T1346 | 7390-7391 | -COMMA- | denotes | , |
T1347 | 7392-7396 | NN | denotes | IL-5 |
T1348 | 7396-7397 | -COMMA- | denotes | , |
T1349 | 7398-7401 | CC | denotes | and |
T1350 | 7402-7407 | NN | denotes | IL-13 |
T1351 | 7408-7412 | IN | denotes | from |
T1352 | 7413-7414 | NN | denotes | T |
T1353 | 7415-7423 | NN | denotes | helper-2 |
T1354 | 7424-7425 | -LRB- | denotes | ( |
T1355 | 7425-7428 | NN | denotes | Th2 |
T1356 | 7428-7429 | -RRB- | denotes | ) |
T1357 | 7430-7435 | NN | denotes | cells |
T1358 | 7437-7441 | NN | denotes | IL-4 |
T1359 | 7442-7445 | CC | denotes | and |
T1360 | 7446-7451 | NN | denotes | IL-13 |
T1361 | 7452-7460 | VB | denotes | regulate |
T1362 | 7461-7464 | DT | denotes | the |
T1363 | 7465-7475 | NN | denotes | expression |
T1364 | 7476-7478 | IN | denotes | of |
T1365 | 7479-7482 | NN | denotes | IgE |
T1366 | 7483-7487 | IN | denotes | from |
T1367 | 7488-7489 | NN | denotes | B |
T1368 | 7490-7501 | NN | denotes | lymphocytes |
T1369 | 7501-7502 | -COMMA- | denotes | , |
T1370 | 7503-7510 | IN | denotes | whereas |
T1371 | 7511-7515 | NN | denotes | IL-5 |
T1372 | 7516-7521 | VB | denotes | plays |
T1373 | 7522-7523 | DT | denotes | a |
T1374 | 7524-7527 | JJ | denotes | key |
T1375 | 7528-7532 | NN | denotes | role |
T1376 | 7533-7535 | IN | denotes | in |
T1377 | 7536-7548 | JJ | denotes | eosinophilic |
T1378 | 7549-7561 | NN | denotes | inflammation |
T1379 | 7562-7563 | -LRB- | denotes | [ |
T1380 | 7563-7564 | CD | denotes | 1 |
T1381 | 7564-7565 | -RRB- | denotes | ] |
T1382 | 7567-7570 | NN | denotes | Th2 |
T1383 | 7571-7580 | NN | denotes | cytokines |
T1384 | 7581-7584 | VB | denotes | are |
T1385 | 7585-7594 | VB | denotes | regulated |
T1386 | 7595-7597 | IN | denotes | by |
T1387 | 7598-7601 | DT | denotes | the |
T1388 | 7602-7606 | NN | denotes | zinc |
T1389 | 7607-7613 | NN | denotes | finger |
T1390 | 7614-7627 | NN | denotes | transcription |
T1391 | 7628-7634 | NN | denotes | factor |
T1392 | 7635-7641 | NN | denotes | GATA-3 |
T1393 | 7641-7642 | -COMMA- | denotes | , |
T1394 | 7643-7648 | WDT | denotes | which |
T1395 | 7649-7651 | VB | denotes | is |
T1396 | 7652-7665 | RB | denotes | predominantly |
T1397 | 7666-7675 | VB | denotes | expressed |
T1398 | 7676-7678 | IN | denotes | in |
T1399 | 7679-7682 | NN | denotes | Th2 |
T1400 | 7683-7688 | NN | denotes | cells |
T1401 | 7689-7690 | -LRB- | denotes | [ |
T1402 | 7690-7691 | CD | denotes | 2 |
T1403 | 7691-7692 | -RRB- | denotes | ] |
T1404 | 7692-7693 | -COMMA- | denotes | , |
T1405 | 7693-7694 | -LRB- | denotes | [ |
T1406 | 7694-7695 | CD | denotes | 3 |
T1407 | 7695-7696 | -RRB- | denotes | ] |
T1408 | 7698-7704 | NN | denotes | GATA-3 |
T1409 | 7705-7715 | VB | denotes | determines |
T1410 | 7716-7719 | NN | denotes | Th2 |
T1411 | 7720-7724 | NN | denotes | cell |
T1412 | 7725-7740 | NN | denotes | differentiation |
T1413 | 7741-7744 | CC | denotes | and |
T1414 | 7745-7756 | RB | denotes | selectively |
T1415 | 7757-7766 | VB | denotes | activates |
T1416 | 7767-7770 | DT | denotes | the |
T1417 | 7771-7780 | NN | denotes | promoters |
T1418 | 7781-7783 | IN | denotes | of |
T1419 | 7784-7788 | NN | denotes | IL-4 |
T1420 | 7788-7789 | -COMMA- | denotes | , |
T1421 | 7790-7794 | NN | denotes | IL-5 |
T1422 | 7794-7795 | -COMMA- | denotes | , |
T1423 | 7796-7799 | CC | denotes | and |
T1424 | 7800-7805 | NN | denotes | IL-13 |
T1425 | 7806-7813 | IN | denotes | through |
T1426 | 7814-7823 | NN | denotes | chromatin |
T1427 | 7824-7835 | VB | denotes | remodelling |
T1428 | 7836-7837 | -LRB- | denotes | [ |
T1429 | 7837-7838 | CD | denotes | 4 |
T1430 | 7838-7839 | -RRB- | denotes | ] |
T1431 | 7839-7840 | NN | denotes | – |
T1432 | 7840-7841 | -LRB- | denotes | [ |
T1433 | 7841-7842 | CD | denotes | 7 |
T1434 | 7842-7843 | -RRB- | denotes | ] |
T1435 | 7845-7848 | DT | denotes | The |
T1436 | 7849-7852 | JJ | denotes | key |
T1437 | 7853-7857 | NN | denotes | role |
T1438 | 7858-7860 | IN | denotes | of |
T1439 | 7861-7867 | NN | denotes | GATA-3 |
T1440 | 7868-7870 | IN | denotes | in |
T1441 | 7871-7879 | JJ | denotes | allergic |
T1442 | 7880-7886 | NN | denotes | airway |
T1443 | 7887-7899 | NN | denotes | inflammation |
T1444 | 7900-7903 | VB | denotes | has |
T1445 | 7904-7908 | VB | denotes | been |
T1446 | 7909-7921 | VB | denotes | demonstrated |
T1447 | 7922-7924 | IN | denotes | in |
T1448 | 7925-7929 | NN | denotes | mice |
T1449 | 7930-7932 | IN | denotes | by |
T1450 | 7933-7936 | DT | denotes | the |
T1451 | 7937-7944 | VB | denotes | reduced |
T1452 | 7945-7952 | NN | denotes | release |
T1453 | 7953-7955 | IN | denotes | of |
T1454 | 7956-7959 | NN | denotes | Th2 |
T1455 | 7960-7969 | NN | denotes | cytokines |
T1456 | 7970-7972 | IN | denotes | in |
T1457 | 7973-7980 | NN | denotes | animals |
T1458 | 7981-7988 | VB | denotes | treated |
T1459 | 7989-7993 | IN | denotes | with |
T1460 | 7994-8011 | JJ | denotes | dominant-negative |
T1461 | 8012-8019 | NN | denotes | mutants |
T1462 | 8020-8022 | IN | denotes | of |
T1463 | 8023-8029 | NN | denotes | GATA-3 |
T1464 | 8030-8033 | CC | denotes | and |
T1465 | 8034-8036 | IN | denotes | by |
T1466 | 8037-8042 | JJ | denotes | local |
T1467 | 8043-8054 | NN | denotes | application |
T1468 | 8055-8057 | IN | denotes | of |
T1469 | 8058-8067 | JJ | denotes | antisense |
T1470 | 8068-8084 | NN | denotes | oligonucleotides |
T1471 | 8085-8087 | TO | denotes | to |
T1472 | 8088-8094 | NN | denotes | GATA-3 |
T1473 | 8095-8096 | -LRB- | denotes | [ |
T1474 | 8096-8097 | CD | denotes | 8 |
T1475 | 8097-8098 | -RRB- | denotes | ] |
T1476 | 8098-8099 | -COMMA- | denotes | , |
T1477 | 8099-8100 | -LRB- | denotes | [ |
T1478 | 8100-8101 | CD | denotes | 9 |
T1479 | 8101-8102 | -RRB- | denotes | ] |
T1480 | 8104-8115 | RB | denotes | Furthermore |
T1481 | 8115-8116 | -COMMA- | denotes | , |
T1482 | 8117-8128 | JJ | denotes | conditional |
T1483 | 8129-8138 | NN | denotes | knock-out |
T1484 | 8139-8141 | IN | denotes | of |
T1485 | 8142-8145 | DT | denotes | the |
T1486 | 8146-8151 | NN | denotes | Gata3 |
T1487 | 8152-8156 | NN | denotes | gene |
T1488 | 8157-8159 | IN | denotes | in |
T1489 | 8160-8164 | NN | denotes | mice |
T1490 | 8165-8172 | VB | denotes | reduces |
T1491 | 8173-8183 | NN | denotes | expression |
T1492 | 8184-8186 | IN | denotes | of |
T1493 | 8187-8190 | NN | denotes | Th2 |
T1494 | 8191-8200 | NN | denotes | cytokines |
T1495 | 8201-8203 | FW | denotes | in |
T1496 | 8204-8209 | FW | denotes | vitro |
T1497 | 8210-8213 | CC | denotes | and |
T1498 | 8214-8216 | FW | denotes | in |
T1499 | 8217-8221 | FW | denotes | vivo |
T1500 | 8222-8223 | -LRB- | denotes | [ |
T1501 | 8223-8225 | CD | denotes | 10 |
T1502 | 8225-8226 | -RRB- | denotes | ] |
T1503 | 8226-8227 | -COMMA- | denotes | , |
T1504 | 8228-8231 | CC | denotes | and |
T1505 | 8232-8239 | JJ | denotes | similar |
T1506 | 8240-8247 | NN | denotes | results |
T1507 | 8248-8252 | VB | denotes | have |
T1508 | 8253-8257 | VB | denotes | been |
T1509 | 8258-8266 | VB | denotes | reported |
T1510 | 8267-8269 | IN | denotes | in |
T1511 | 8270-8278 | VB | denotes | isolated |
T1512 | 8279-8285 | JJ | denotes | murine |
T1513 | 8286-8290 | JJ | denotes | CD4+ |
T1514 | 8291-8302 | NN | denotes | lymphocytes |
T1515 | 8303-8304 | -LRB- | denotes | [ |
T1516 | 8304-8306 | CD | denotes | 11 |
T1517 | 8306-8307 | -RRB- | denotes | ] |
T1518 | 8309-8316 | RB | denotes | Finally |
T1519 | 8316-8317 | -COMMA- | denotes | , |
T1520 | 8318-8327 | NN | denotes | knockdown |
T1521 | 8328-8330 | IN | denotes | of |
T1522 | 8331-8337 | NN | denotes | GATA-3 |
T1523 | 8338-8348 | NN | denotes | expression |
T1524 | 8349-8354 | VB | denotes | using |
T1525 | 8355-8360 | NN | denotes | siRNA |
T1526 | 8361-8363 | IN | denotes | in |
T1527 | 8364-8369 | JJ | denotes | human |
T1528 | 8370-8371 | NN | denotes | T |
T1529 | 8372-8377 | NN | denotes | cells |
T1530 | 8378-8385 | VB | denotes | results |
T1531 | 8386-8388 | IN | denotes | in |
T1532 | 8389-8393 | NN | denotes | loss |
T1533 | 8394-8396 | IN | denotes | of |
T1534 | 8397-8419 | JJ | denotes | anti-CD3/CD28-mediated |
T1535 | 8420-8423 | NN | denotes | Th2 |
T1536 | 8424-8432 | NN | denotes | cytokine |
T1537 | 8433-8443 | NN | denotes | expression |
T1538 | 8444-8445 | -LRB- | denotes | [ |
T1539 | 8445-8447 | CD | denotes | 12 |
T1540 | 8447-8448 | -RRB- | denotes | ] |
T1541 | 8450-8452 | IN | denotes | In |
T1542 | 8453-8458 | NN | denotes | order |
T1543 | 8459-8462 | IN | denotes | for |
T1544 | 8463-8469 | NN | denotes | GATA-3 |
T1545 | 8470-8472 | TO | denotes | to |
T1546 | 8473-8481 | VB | denotes | regulate |
T1547 | 8482-8486 | NN | denotes | gene |
T1548 | 8487-8497 | NN | denotes | expression |
T1549 | 8497-8498 | -COMMA- | denotes | , |
T1550 | 8499-8501 | PRP | denotes | it |
T1551 | 8502-8506 | MD | denotes | must |
T1552 | 8507-8518 | VB | denotes | translocate |
T1553 | 8519-8523 | IN | denotes | from |
T1554 | 8524-8527 | DT | denotes | the |
T1555 | 8528-8537 | NN | denotes | cytoplasm |
T1556 | 8538-8542 | IN | denotes | into |
T1557 | 8543-8546 | DT | denotes | the |
T1558 | 8547-8554 | NN | denotes | nucleus |
T1559 | 8555-8557 | TO | denotes | to |
T1560 | 8558-8564 | VB | denotes | access |
T1561 | 8565-8568 | PRP-DOLLAR- | denotes | its |
T1562 | 8569-8575 | NN | denotes | target |
T1563 | 8576-8581 | NN | denotes | genes |
T1564 | 8583-8591 | VB | denotes | Enhanced |
T1565 | 8592-8599 | JJ | denotes | nuclear |
T1566 | 8600-8610 | NN | denotes | expression |
T1567 | 8611-8613 | IN | denotes | of |
T1568 | 8614-8620 | NN | denotes | GATA-3 |
T1569 | 8621-8630 | VB | denotes | following |
T1570 | 8631-8632 | NN | denotes | T |
T1571 | 8633-8637 | NN | denotes | cell |
T1572 | 8638-8646 | NN | denotes | receptor |
T1573 | 8647-8657 | NN | denotes | activation |
T1574 | 8658-8661 | VB | denotes | was |
T1575 | 8662-8667 | RB | denotes | first |
T1576 | 8668-8680 | VB | denotes | demonstrated |
T1577 | 8681-8683 | IN | denotes | in |
T1578 | 8684-8690 | JJ | denotes | murine |
T1579 | 8691-8692 | NN | denotes | T |
T1580 | 8693-8698 | NN | denotes | cells |
T1581 | 8699-8700 | -LRB- | denotes | [ |
T1582 | 8700-8702 | CD | denotes | 13 |
T1583 | 8702-8703 | -RRB- | denotes | ] |
T1584 | 8704-8707 | CC | denotes | and |
T1585 | 8708-8711 | VB | denotes | was |
T1586 | 8712-8720 | RB | denotes | recently |
T1587 | 8721-8730 | VB | denotes | confirmed |
T1588 | 8731-8733 | IN | denotes | in |
T1589 | 8734-8739 | JJ | denotes | human |
T1590 | 8740-8741 | NN | denotes | T |
T1591 | 8742-8747 | NN | denotes | cells |
T1592 | 8748-8757 | VB | denotes | following |
T1593 | 8758-8759 | NN | denotes | T |
T1594 | 8760-8764 | NN | denotes | cell |
T1595 | 8765-8773 | NN | denotes | receptor |
T1596 | 8774-8777 | CC | denotes | and |
T1597 | 8778-8789 | NN | denotes | co-receptor |
T1598 | 8790-8801 | NN | denotes | stimulation |
T1599 | 8802-8803 | -LRB- | denotes | [ |
T1600 | 8803-8805 | CD | denotes | 12 |
T1601 | 8805-8806 | -RRB- | denotes | ] |
T1602 | 8808-8814 | NN | denotes | GATA-3 |
T1603 | 8815-8823 | VB | denotes | contains |
T1604 | 8824-8825 | DT | denotes | a |
T1605 | 8826-8835 | JJ | denotes | classical |
T1606 | 8836-8843 | JJ | denotes | nuclear |
T1607 | 8844-8850 | NN | denotes | import |
T1608 | 8851-8857 | NN | denotes | signal |
T1609 | 8858-8859 | -LRB- | denotes | [ |
T1610 | 8859-8861 | CD | denotes | 14 |
T1611 | 8861-8862 | -RRB- | denotes | ] |
T1612 | 8863-8866 | CC | denotes | and |
T1613 | 8867-8869 | VB | denotes | is |
T1614 | 8870-8881 | VB | denotes | transported |
T1615 | 8882-8886 | IN | denotes | into |
T1616 | 8887-8890 | DT | denotes | the |
T1617 | 8891-8898 | NN | denotes | nucleus |
T1618 | 8899-8901 | IN | denotes | by |
T1619 | 8902-8905 | DT | denotes | the |
T1620 | 8906-8913 | JJ | denotes | nuclear |
T1621 | 8914-8920 | NN | denotes | import |
T1622 | 8921-8928 | NN | denotes | protein |
T1623 | 8929-8939 | NN | denotes | importin-α |
T1624 | 8940-8941 | -LRB- | denotes | ( |
T1625 | 8941-8945 | RB | denotes | also |
T1626 | 8946-8951 | VB | denotes | known |
T1627 | 8952-8954 | IN | denotes | as |
T1628 | 8955-8968 | NN | denotes | karyopherin-α |
T1629 | 8968-8969 | -RRB- | denotes | ) |
T1630 | 8970-8971 | -LRB- | denotes | [ |
T1631 | 8971-8973 | CD | denotes | 12 |
T1632 | 8973-8974 | -RRB- | denotes | ] |
T1633 | 8976-8984 | NN | denotes | Deletion |
T1634 | 8985-8987 | IN | denotes | of |
T1635 | 8988-8989 | DT | denotes | a |
T1636 | 8990-8996 | NN | denotes | region |
T1637 | 8997-9009 | VB | denotes | encompassing |
T1638 | 9010-9013 | DT | denotes | the |
T1639 | 9014-9020 | NN | denotes | GATA-3 |
T1640 | 9021-9028 | JJ | denotes | nuclear |
T1641 | 9029-9041 | NN | denotes | localisation |
T1642 | 9042-9050 | NN | denotes | sequence |
T1643 | 9051-9052 | -LRB- | denotes | ( |
T1644 | 9052-9055 | NN | denotes | NLS |
T1645 | 9055-9056 | -RRB- | denotes | ) |
T1646 | 9057-9063 | NN | denotes | region |
T1647 | 9064-9066 | IN | denotes | in |
T1648 | 9067-9073 | JJ | denotes | murine |
T1649 | 9074-9077 | CC | denotes | and |
T1650 | 9078-9083 | JJ | denotes | human |
T1651 | 9084-9089 | NN | denotes | cells |
T1652 | 9090-9098 | VB | denotes | prevents |
T1653 | 9099-9102 | PRP-DOLLAR- | denotes | its |
T1654 | 9103-9110 | JJ | denotes | nuclear |
T1655 | 9111-9123 | NN | denotes | localisation |
T1656 | 9124-9125 | -LRB- | denotes | [ |
T1657 | 9125-9127 | CD | denotes | 12 |
T1658 | 9127-9128 | -RRB- | denotes | ] |
T1659 | 9128-9129 | -COMMA- | denotes | , |
T1660 | 9129-9130 | -LRB- | denotes | [ |
T1661 | 9130-9132 | CD | denotes | 14 |
T1662 | 9132-9133 | -RRB- | denotes | ] |
T1663 | 9135-9138 | DT | denotes | The |
T1664 | 9139-9147 | NN | denotes | affinity |
T1665 | 9148-9150 | IN | denotes | of |
T1666 | 9151-9154 | DT | denotes | the |
T1667 | 9155-9169 | JJ | denotes | importin-α–NLS |
T1668 | 9170-9181 | NN | denotes | interaction |
T1669 | 9182-9184 | VB | denotes | is |
T1670 | 9185-9194 | VB | denotes | regulated |
T1671 | 9195-9197 | IN | denotes | by |
T1672 | 9198-9213 | NN | denotes | phosphorylation |
T1673 | 9214-9215 | -LRB- | denotes | [ |
T1674 | 9215-9217 | CD | denotes | 15 |
T1675 | 9217-9218 | -RRB- | denotes | ] |
T1676 | 9218-9219 | -COMMA- | denotes | , |
T1677 | 9220-9223 | CC | denotes | and |
T1678 | 9224-9226 | PRP | denotes | we |
T1679 | 9227-9231 | VB | denotes | have |
T1680 | 9232-9237 | VB | denotes | shown |
T1681 | 9238-9242 | IN | denotes | that |
T1682 | 9243-9246 | NN | denotes | p38 |
T1683 | 9247-9264 | JJ | denotes | mitogen-activated |
T1684 | 9265-9272 | NN | denotes | protein |
T1685 | 9273-9279 | NN | denotes | kinase |
T1686 | 9280-9281 | -LRB- | denotes | ( |
T1687 | 9281-9285 | NN | denotes | MAPK |
T1688 | 9285-9286 | -RRB- | denotes | ) |
T1689 | 9287-9292 | VB | denotes | plays |
T1690 | 9293-9294 | DT | denotes | a |
T1691 | 9295-9303 | JJ | denotes | critical |
T1692 | 9304-9308 | NN | denotes | role |
T1693 | 9309-9311 | IN | denotes | in |
T1694 | 9312-9327 | VB | denotes | phosphorylating |
T1695 | 9328-9334 | NN | denotes | GATA-3 |
T1696 | 9335-9337 | TO | denotes | to |
T1697 | 9338-9345 | VB | denotes | enhance |
T1698 | 9346-9349 | PRP-DOLLAR- | denotes | its |
T1699 | 9350-9361 | NN | denotes | interaction |
T1700 | 9362-9366 | IN | denotes | with |
T1701 | 9367-9377 | JJ | denotes | importin-α |
T1702 | 9378-9381 | CC | denotes | and |
T1703 | 9382-9392 | JJ | denotes | subsequent |
T1704 | 9393-9402 | NN | denotes | transport |
T1705 | 9403-9407 | IN | denotes | into |
T1706 | 9408-9411 | DT | denotes | the |
T1707 | 9412-9419 | NN | denotes | nucleus |
T1708 | 9420-9421 | -LRB- | denotes | [ |
T1709 | 9421-9423 | CD | denotes | 12 |
T1710 | 9423-9424 | -RRB- | denotes | ] |
T1711 | 9426-9441 | NN | denotes | Corticosteroids |
T1712 | 9442-9445 | VB | denotes | are |
T1713 | 9446-9452 | RB | denotes | highly |
T1714 | 9453-9462 | JJ | denotes | effective |
T1715 | 9463-9465 | IN | denotes | in |
T1716 | 9466-9469 | DT | denotes | the |
T1717 | 9470-9479 | NN | denotes | treatment |
T1718 | 9480-9482 | IN | denotes | of |
T1719 | 9483-9491 | JJ | denotes | allergic |
T1720 | 9492-9504 | NN | denotes | inflammation |
T1721 | 9504-9505 | -COMMA- | denotes | , |
T1722 | 9506-9510 | IN | denotes | with |
T1723 | 9511-9517 | JJ | denotes | marked |
T1724 | 9518-9529 | NN | denotes | suppression |
T1725 | 9530-9532 | IN | denotes | of |
T1726 | 9533-9536 | NN | denotes | Th2 |
T1727 | 9537-9546 | NN | denotes | cytokines |
T1728 | 9547-9549 | IN | denotes | in |
T1729 | 9550-9557 | NN | denotes | airways |
T1730 | 9558-9560 | IN | denotes | of |
T1731 | 9561-9569 | NN | denotes | patients |
T1732 | 9570-9574 | IN | denotes | with |
T1733 | 9575-9581 | NN | denotes | asthma |
T1734 | 9582-9583 | -LRB- | denotes | [ |
T1735 | 9583-9585 | CD | denotes | 16 |
T1736 | 9585-9586 | -RRB- | denotes | ] |
T1737 | 9588-9603 | NN | denotes | Corticosteroids |
T1738 | 9604-9611 | VB | denotes | mediate |
T1739 | 9612-9617 | PRP-DOLLAR- | denotes | their |
T1740 | 9618-9635 | JJ | denotes | anti-inflammatory |
T1741 | 9636-9643 | NN | denotes | effects |
T1742 | 9644-9651 | IN | denotes | through |
T1743 | 9652-9659 | NN | denotes | binding |
T1744 | 9660-9662 | TO | denotes | to |
T1745 | 9663-9677 | NN | denotes | glucocorticoid |
T1746 | 9678-9687 | NN | denotes | receptors |
T1747 | 9688-9689 | -LRB- | denotes | ( |
T1748 | 9689-9692 | NN | denotes | GRs |
T1749 | 9692-9693 | -RRB- | denotes | ) |
T1750 | 9693-9694 | -COMMA- | denotes | , |
T1751 | 9695-9700 | WDT | denotes | which |
T1752 | 9701-9705 | RB | denotes | then |
T1753 | 9706-9717 | VB | denotes | translocate |
T1754 | 9718-9720 | TO | denotes | to |
T1755 | 9721-9724 | DT | denotes | the |
T1756 | 9725-9732 | NN | denotes | nucleus |
T1757 | 9733-9738 | WRB | denotes | where |
T1758 | 9739-9743 | PRP | denotes | they |
T1759 | 9744-9752 | VB | denotes | interact |
T1760 | 9753-9757 | IN | denotes | with |
T1761 | 9758-9772 | NN | denotes | glucocorticoid |
T1762 | 9773-9781 | NN | denotes | response |
T1763 | 9782-9790 | NN | denotes | elements |
T1764 | 9791-9792 | -LRB- | denotes | ( |
T1765 | 9792-9796 | NN | denotes | GREs |
T1766 | 9796-9797 | -RRB- | denotes | ) |
T1767 | 9798-9800 | IN | denotes | in |
T1768 | 9801-9804 | DT | denotes | the |
T1769 | 9805-9813 | NN | denotes | promoter |
T1770 | 9814-9821 | NN | denotes | regions |
T1771 | 9822-9824 | IN | denotes | of |
T1772 | 9825-9842 | JJ | denotes | steroid-sensitive |
T1773 | 9843-9848 | NN | denotes | genes |
T1774 | 9850-9863 | RB | denotes | Alternatively |
T1775 | 9863-9864 | -COMMA- | denotes | , |
T1776 | 9865-9874 | VB | denotes | activated |
T1777 | 9875-9877 | NN | denotes | GR |
T1778 | 9878-9887 | VB | denotes | interacts |
T1779 | 9888-9892 | IN | denotes | with |
T1780 | 9893-9904 | NN | denotes | coactivator |
T1781 | 9905-9914 | NN | denotes | molecules |
T1782 | 9915-9917 | TO | denotes | to |
T1783 | 9918-9926 | VB | denotes | suppress |
T1784 | 9927-9930 | DT | denotes | the |
T1785 | 9931-9941 | NN | denotes | expression |
T1786 | 9942-9944 | IN | denotes | of |
T1787 | 9945-9957 | JJ | denotes | inflammatory |
T1788 | 9958-9963 | NN | denotes | genes |
T1789 | 9964-9966 | IN | denotes | by |
T1790 | 9967-9977 | VB | denotes | inhibiting |
T1791 | 9978-9981 | DT | denotes | the |
T1792 | 9982-9988 | NN | denotes | action |
T1793 | 9989-9991 | IN | denotes | of |
T1794 | 9992-10007 | JJ | denotes | proinflammatory |
T1795 | 10008-10021 | NN | denotes | transcription |
T1796 | 10022-10029 | NN | denotes | factors |
T1797 | 10030-10034 | JJ | denotes | such |
T1798 | 10035-10037 | IN | denotes | as |
T1799 | 10038-10045 | JJ | denotes | nuclear |
T1800 | 10046-10055 | NN | denotes | factor-κB |
T1801 | 10056-10057 | -LRB- | denotes | ( |
T1802 | 10057-10062 | NN | denotes | NF-κB |
T1803 | 10062-10063 | -RRB- | denotes | ) |
T1804 | 10064-10071 | IN | denotes | through |
T1805 | 10072-10075 | DT | denotes | the |
T1806 | 10076-10087 | NN | denotes | recruitment |
T1807 | 10088-10090 | IN | denotes | of |
T1808 | 10091-10103 | NN | denotes | co-repressor |
T1809 | 10104-10113 | NN | denotes | molecules |
T1810 | 10114-10118 | JJ | denotes | such |
T1811 | 10119-10121 | IN | denotes | as |
T1812 | 10122-10129 | NN | denotes | histone |
T1813 | 10130-10143 | NN | denotes | deacetylase-2 |
T1814 | 10144-10145 | -LRB- | denotes | [ |
T1815 | 10145-10147 | CD | denotes | 17 |
T1816 | 10147-10148 | -RRB- | denotes | ] |
T1817 | 10148-10149 | -COMMA- | denotes | , |
T1818 | 10149-10150 | -LRB- | denotes | [ |
T1819 | 10150-10152 | CD | denotes | 18 |
T1820 | 10152-10153 | -RRB- | denotes | ] |
T1821 | 10155-10162 | JJ | denotes | Nuclear |
T1822 | 10163-10175 | NN | denotes | localisation |
T1823 | 10176-10179 | CC | denotes | and |
T1824 | 10180-10189 | NN | denotes | retention |
T1825 | 10190-10192 | IN | denotes | of |
T1826 | 10193-10195 | NN | denotes | GR |
T1827 | 10196-10198 | VB | denotes | is |
T1828 | 10199-10207 | VB | denotes | mediated |
T1829 | 10208-10215 | IN | denotes | through |
T1830 | 10216-10219 | DT | denotes | the |
T1831 | 10220-10227 | JJ | denotes | nuclear |
T1832 | 10228-10240 | NN | denotes | localisation |
T1833 | 10241-10250 | NN | denotes | sequences |
T1834 | 10251-10254 | NN | denotes | NL1 |
T1835 | 10255-10258 | CC | denotes | and |
T1836 | 10259-10262 | NN | denotes | NL2 |
T1837 | 10263-10264 | -LRB- | denotes | [ |
T1838 | 10264-10266 | CD | denotes | 19 |
T1839 | 10266-10267 | -RRB- | denotes | ] |
T1840 | 10267-10268 | -COMMA- | denotes | , |
T1841 | 10269-10271 | IN | denotes | by |
T1842 | 10272-10279 | JJ | denotes | nuclear |
T1843 | 10280-10289 | NN | denotes | retention |
T1844 | 10290-10297 | NN | denotes | signals |
T1845 | 10298-10299 | -LRB- | denotes | [ |
T1846 | 10299-10301 | CD | denotes | 20 |
T1847 | 10301-10302 | -RRB- | denotes | ] |
T1848 | 10302-10303 | -COMMA- | denotes | , |
T1849 | 10304-10307 | CC | denotes | and |
T1850 | 10308-10310 | IN | denotes | by |
T1851 | 10311-10318 | NN | denotes | control |
T1852 | 10319-10321 | IN | denotes | of |
T1853 | 10322-10329 | JJ | denotes | nuclear |
T1854 | 10330-10336 | NN | denotes | export |
T1855 | 10337-10340 | IN | denotes | via |
T1856 | 10341-10342 | DT | denotes | a |
T1857 | 10343-10354 | JJ | denotes | chromosomal |
T1858 | 10355-10361 | NN | denotes | region |
T1859 | 10362-10373 | NN | denotes | maintenance |
T1860 | 10374-10375 | CD | denotes | 1 |
T1861 | 10376-10377 | -LRB- | denotes | ( |
T1862 | 10377-10382 | NN | denotes | CRM-1 |
T1863 | 10382-10383 | -RRB- | denotes | ) |
T1864 | 10384-10393 | JJ | denotes | dependent |
T1865 | 10394-10401 | NN | denotes | pathway |
T1866 | 10402-10403 | -LRB- | denotes | [ |
T1867 | 10403-10405 | CD | denotes | 21 |
T1868 | 10405-10406 | -RRB- | denotes | ] |
T1869 | 10408-10411 | NN | denotes | NL1 |
T1870 | 10411-10412 | -COMMA- | denotes | , |
T1871 | 10413-10418 | WDT | denotes | which |
T1872 | 10419-10421 | VB | denotes | is |
T1873 | 10422-10429 | JJ | denotes | similar |
T1874 | 10430-10432 | TO | denotes | to |
T1875 | 10433-10436 | DT | denotes | the |
T1876 | 10437-10441 | NN | denotes | SV40 |
T1877 | 10442-10445 | NN | denotes | NLS |
T1878 | 10445-10446 | -COMMA- | denotes | , |
T1879 | 10447-10452 | VB | denotes | binds |
T1880 | 10453-10455 | TO | denotes | to |
T1881 | 10456-10466 | JJ | denotes | importin-α |
T1882 | 10467-10468 | -LRB- | denotes | [ |
T1883 | 10468-10470 | CD | denotes | 22 |
T1884 | 10470-10471 | -RRB- | denotes | ] |
T1885 | 10473-10476 | NN | denotes | NL1 |
T1886 | 10477-10479 | VB | denotes | is |
T1887 | 10480-10489 | VB | denotes | activated |
T1888 | 10490-10494 | CC | denotes | both |
T1889 | 10495-10497 | IN | denotes | by |
T1890 | 10498-10512 | NN | denotes | glucocorticoid |
T1891 | 10513-10521 | NN | denotes | agonists |
T1892 | 10522-10526 | JJ | denotes | such |
T1893 | 10527-10529 | IN | denotes | as |
T1894 | 10530-10543 | NN | denotes | dexamethasone |
T1895 | 10544-10547 | CC | denotes | and |
T1896 | 10548-10559 | NN | denotes | fluticasone |
T1897 | 10560-10570 | NN | denotes | propionate |
T1898 | 10571-10572 | -LRB- | denotes | ( |
T1899 | 10572-10574 | NN | denotes | FP |
T1900 | 10574-10575 | -RRB- | denotes | ) |
T1901 | 10576-10579 | CC | denotes | and |
T1902 | 10580-10582 | IN | denotes | by |
T1903 | 10583-10597 | NN | denotes | glucocorticoid |
T1904 | 10598-10609 | NN | denotes | antagonists |
T1905 | 10610-10614 | JJ | denotes | such |
T1906 | 10615-10617 | IN | denotes | as |
T1907 | 10618-10630 | NN | denotes | mifepristone |
T1908 | 10631-10632 | -LRB- | denotes | ( |
T1909 | 10632-10637 | NN | denotes | RU486 |
T1910 | 10637-10638 | -RRB- | denotes | ) |
T1911 | 10639-10640 | -LRB- | denotes | [ |
T1912 | 10640-10642 | CD | denotes | 23 |
T1913 | 10642-10643 | -RRB- | denotes | ] |
T1914 | 10645-10648 | NN | denotes | NL1 |
T1915 | 10649-10652 | MD | denotes | can |
T1916 | 10653-10655 | VB | denotes | be |
T1917 | 10656-10663 | VB | denotes | mutated |
T1918 | 10663-10664 | -COMMA- | denotes | , |
T1919 | 10665-10668 | CC | denotes | and |
T1920 | 10669-10672 | DT | denotes | the |
T1921 | 10673-10682 | VB | denotes | resulting |
T1922 | 10683-10685 | NN | denotes | GR |
T1923 | 10686-10691 | RB | denotes | still |
T1924 | 10692-10704 | VB | denotes | translocates |
T1925 | 10705-10707 | TO | denotes | to |
T1926 | 10708-10711 | DT | denotes | the |
T1927 | 10712-10719 | NN | denotes | nucleus |
T1928 | 10720-10722 | IN | denotes | in |
T1929 | 10723-10731 | NN | denotes | response |
T1930 | 10732-10734 | TO | denotes | to |
T1931 | 10735-10742 | NN | denotes | ligands |
T1932 | 10742-10743 | -COMMA- | denotes | , |
T1933 | 10744-10747 | CC | denotes | but |
T1934 | 10748-10751 | IN | denotes | via |
T1935 | 10752-10763 | NN | denotes | interaction |
T1936 | 10764-10768 | IN | denotes | with |
T1937 | 10769-10777 | NN | denotes | importin |
T1938 | 10778-10779 | CD | denotes | 7 |
T1939 | 10779-10780 | -COMMA- | denotes | , |
T1940 | 10781-10783 | DT | denotes | an |
T1941 | 10784-10789 | NN | denotes | event |
T1942 | 10790-10794 | WDT | denotes | that |
T1943 | 10795-10803 | VB | denotes | requires |
T1944 | 10804-10806 | DT | denotes | an |
T1945 | 10807-10813 | JJ | denotes | as-yet |
T1946 | 10814-10821 | JJ | denotes | unknown |
T1947 | 10822-10831 | NN | denotes | component |
T1948 | 10832-10833 | -LRB- | denotes | [ |
T1949 | 10833-10835 | CD | denotes | 23 |
T1950 | 10835-10836 | -RRB- | denotes | ] |
T1951 | 10838-10841 | NN | denotes | NL2 |
T1952 | 10842-10844 | VB | denotes | is |
T1953 | 10845-10851 | RB | denotes | poorly |
T1954 | 10852-10859 | VB | denotes | defined |
T1955 | 10859-10860 | -COMMA- | denotes | , |
T1956 | 10861-10869 | VB | denotes | residing |
T1957 | 10870-10872 | IN | denotes | in |
T1958 | 10873-10876 | DT | denotes | the |
T1959 | 10877-10891 | JJ | denotes | ligand-binding |
T1960 | 10892-10898 | NN | denotes | domain |
T1961 | 10898-10899 | -COMMA- | denotes | , |
T1962 | 10900-10903 | CC | denotes | and |
T1963 | 10904-10908 | RB | denotes | much |
T1964 | 10909-10913 | JJ | denotes | less |
T1965 | 10914-10916 | VB | denotes | is |
T1966 | 10917-10922 | VB | denotes | known |
T1967 | 10923-10928 | IN | denotes | about |
T1968 | 10929-10932 | PRP-DOLLAR- | denotes | its |
T1969 | 10933-10942 | NN | denotes | mechanism |
T1970 | 10943-10945 | IN | denotes | of |
T1971 | 10946-10948 | NN | denotes | GR |
T1972 | 10949-10955 | NN | denotes | import |
T1973 | 10956-10957 | -LRB- | denotes | [ |
T1974 | 10957-10959 | CD | denotes | 24 |
T1975 | 10959-10960 | -RRB- | denotes | ] |
T1976 | 10962-10963 | DT | denotes | A |
T1977 | 10964-10971 | NN | denotes | variety |
T1978 | 10972-10974 | IN | denotes | of |
T1979 | 10975-10980 | JJ | denotes | other |
T1980 | 10981-10988 | NN | denotes | factors |
T1981 | 10989-10992 | VB | denotes | are |
T1982 | 10993-10997 | RB | denotes | also |
T1983 | 10998-11007 | JJ | denotes | important |
T1984 | 11008-11011 | IN | denotes | for |
T1985 | 11012-11015 | DT | denotes | the |
T1986 | 11016-11026 | NN | denotes | regulation |
T1987 | 11027-11029 | IN | denotes | of |
T1988 | 11030-11032 | NN | denotes | GR |
T1989 | 11033-11043 | NN | denotes | activation |
T1990 | 11044-11047 | CC | denotes | and |
T1991 | 11048-11055 | JJ | denotes | nuclear |
T1992 | 11056-11062 | NN | denotes | import |
T1993 | 11063-11072 | VB | denotes | including |
T1994 | 11073-11083 | NN | denotes | chaperones |
T1995 | 11084-11088 | JJ | denotes | such |
T1996 | 11089-11091 | IN | denotes | as |
T1997 | 11092-11097 | NN | denotes | Hsp90 |
T1998 | 11098-11101 | CC | denotes | and |
T1999 | 11102-11107 | JJ | denotes | other |
T2000 | 11108-11121 | NN | denotes | immunophilins |
T2001 | 11122-11123 | -LRB- | denotes | [ |
T2002 | 11123-11125 | CD | denotes | 24 |
T2003 | 11125-11126 | -RRB- | denotes | ] |
T2004 | 11126-11127 | CD | denotes | – |
T2005 | 11127-11128 | -LRB- | denotes | [ |
T2006 | 11128-11130 | CD | denotes | 26 |
T2007 | 11130-11131 | -RRB- | denotes | ] |
T2008 | 11132-11135 | CC | denotes | and |
T2009 | 11136-11149 | JJ | denotes | FK506-binding |
T2010 | 11150-11158 | NN | denotes | proteins |
T2011 | 11159-11163 | WDT | denotes | that |
T2012 | 11164-11167 | MD | denotes | may |
T2013 | 11168-11170 | VB | denotes | be |
T2014 | 11171-11177 | VB | denotes | linked |
T2015 | 11178-11180 | TO | denotes | to |
T2016 | 11181-11187 | NN | denotes | dynein |
T2017 | 11188-11194 | CC | denotes | and/or |
T2018 | 11195-11209 | JJ | denotes | peptidylprolyl |
T2019 | 11210-11219 | NN | denotes | isomerase |
T2020 | 11220-11221 | -LRB- | denotes | [ |
T2021 | 11221-11223 | CD | denotes | 27 |
T2022 | 11223-11224 | -RRB- | denotes | ] |
T2023 | 11224-11225 | -COMMA- | denotes | , |
T2024 | 11225-11226 | -LRB- | denotes | [ |
T2025 | 11226-11228 | CD | denotes | 28 |
T2026 | 11228-11229 | -RRB- | denotes | ] |
T2027 | 11231-11238 | RB | denotes | However |
T2028 | 11238-11239 | -COMMA- | denotes | , |
T2029 | 11240-11243 | DT | denotes | the |
T2030 | 11244-11253 | JJ | denotes | molecular |
T2031 | 11254-11259 | NN | denotes | basis |
T2032 | 11260-11263 | IN | denotes | for |
T2033 | 11264-11267 | DT | denotes | the |
T2034 | 11268-11278 | NN | denotes | inhibition |
T2035 | 11279-11281 | IN | denotes | of |
T2036 | 11282-11285 | NN | denotes | Th2 |
T2037 | 11286-11295 | NN | denotes | cytokines |
T2038 | 11296-11298 | IN | denotes | by |
T2039 | 11299-11314 | NN | denotes | corticosteroids |
T2040 | 11315-11317 | VB | denotes | is |
T2041 | 11318-11321 | RB | denotes | not |
T2042 | 11322-11326 | RB | denotes | well |
T2043 | 11327-11337 | VB | denotes | understood |
T2044 | 11337-11338 | -COMMA- | denotes | , |
T2045 | 11339-11346 | IN | denotes | because |
T2046 | 11347-11350 | DT | denotes | the |
T2047 | 11351-11356 | NN | denotes | genes |
T2048 | 11357-11365 | VB | denotes | encoding |
T2049 | 11366-11370 | NN | denotes | IL-4 |
T2050 | 11370-11371 | -COMMA- | denotes | , |
T2051 | 11372-11376 | NN | denotes | IL-5 |
T2052 | 11376-11377 | -COMMA- | denotes | , |
T2053 | 11378-11381 | CC | denotes | and |
T2054 | 11382-11387 | NN | denotes | IL-13 |
T2055 | 11388-11390 | VB | denotes | do |
T2056 | 11391-11394 | RB | denotes | not |
T2057 | 11395-11399 | VB | denotes | have |
T2058 | 11400-11403 | DT | denotes | any |
T2059 | 11404-11416 | JJ | denotes | recognisable |
T2060 | 11417-11420 | NN | denotes | GRE |
T2061 | 11421-11429 | NN | denotes | sequence |
T2062 | 11430-11431 | -LRB- | denotes | [ |
T2063 | 11431-11433 | CD | denotes | 29 |
T2064 | 11433-11434 | -RRB- | denotes | ] |
T2065 | 11435-11438 | CC | denotes | and |
T2066 | 11439-11442 | VB | denotes | are |
T2067 | 11443-11447 | RB | denotes | only |
T2068 | 11448-11454 | RB | denotes | partly |
T2069 | 11455-11464 | VB | denotes | regulated |
T2070 | 11465-11467 | IN | denotes | by |
T2071 | 11468-11473 | NN | denotes | NF-κB |
T2072 | 11474-11476 | IN | denotes | in |
T2073 | 11477-11482 | JJ | denotes | human |
T2074 | 11483-11488 | NN | denotes | cells |
T2075 | 11489-11490 | -LRB- | denotes | [ |
T2076 | 11490-11492 | CD | denotes | 30 |
T2077 | 11492-11493 | -RRB- | denotes | ] |
T2078 | 11493-11494 | CD | denotes | – |
T2079 | 11494-11495 | -LRB- | denotes | [ |
T2080 | 11495-11497 | CD | denotes | 32 |
T2081 | 11497-11498 | -RRB- | denotes | ] |
T2082 | 11500-11505 | VB | denotes | Using |
T2083 | 11506-11520 | NN | denotes | overexpression |
T2084 | 11521-11524 | CC | denotes | and |
T2085 | 11525-11537 | NN | denotes | CAT-reporter |
T2086 | 11538-11543 | NN | denotes | genes |
T2087 | 11543-11544 | -COMMA- | denotes | , |
T2088 | 11545-11553 | NNP | denotes | Lavender |
T2089 | 11554-11557 | CC | denotes | and |
T2090 | 11558-11568 | NN | denotes | colleagues |
T2091 | 11569-11570 | -LRB- | denotes | [ |
T2092 | 11570-11572 | CD | denotes | 33 |
T2093 | 11572-11573 | -RRB- | denotes | ] |
T2094 | 11574-11578 | VB | denotes | have |
T2095 | 11579-11584 | VB | denotes | shown |
T2096 | 11585-11589 | IN | denotes | that |
T2097 | 11590-11592 | NN | denotes | GR |
T2098 | 11593-11600 | VB | denotes | reduced |
T2099 | 11601-11616 | JJ | denotes | GATA-3-mediated |
T2100 | 11617-11621 | NN | denotes | IL-5 |
T2101 | 11622-11625 | CC | denotes | and |
T2102 | 11626-11629 | CD | denotes | -13 |
T2103 | 11630-11638 | NN | denotes | promoter |
T2104 | 11639-11647 | NN | denotes | activity |
T2105 | 11648-11650 | IN | denotes | in |
T2106 | 11651-11656 | JJ | denotes | human |
T2107 | 11657-11661 | JJ | denotes | CD4+ |
T2108 | 11662-11663 | NN | denotes | T |
T2109 | 11664-11669 | NN | denotes | cells |
T2110 | 11671-11674 | DT | denotes | The |
T2111 | 11675-11682 | NN | denotes | authors |
T2112 | 11683-11693 | VB | denotes | postulated |
T2113 | 11694-11698 | IN | denotes | that |
T2114 | 11699-11704 | JJ | denotes | local |
T2115 | 11705-11716 | NN | denotes | recruitment |
T2116 | 11717-11719 | IN | denotes | of |
T2117 | 11720-11722 | NN | denotes | GR |
T2118 | 11723-11726 | MD | denotes | may |
T2119 | 11727-11732 | VB | denotes | alter |
T2120 | 11733-11736 | DT | denotes | the |
T2121 | 11737-11744 | NN | denotes | ability |
T2122 | 11745-11747 | IN | denotes | of |
T2123 | 11748-11754 | NN | denotes | GATA-3 |
T2124 | 11755-11761 | CC | denotes | either |
T2125 | 11762-11764 | TO | denotes | to |
T2126 | 11765-11769 | VB | denotes | bind |
T2127 | 11770-11772 | TO | denotes | to |
T2128 | 11773-11776 | PRP-DOLLAR- | denotes | its |
T2129 | 11777-11783 | NN | denotes | target |
T2130 | 11784-11788 | NN | denotes | site |
T2131 | 11788-11789 | -COMMA- | denotes | , |
T2132 | 11790-11792 | TO | denotes | to |
T2133 | 11793-11798 | VB | denotes | cause |
T2134 | 11799-11814 | JJ | denotes | transcriptional |
T2135 | 11815-11828 | NN | denotes | up-regulation |
T2136 | 11828-11829 | -COMMA- | denotes | , |
T2137 | 11830-11832 | CC | denotes | or |
T2138 | 11833-11835 | TO | denotes | to |
T2139 | 11836-11844 | VB | denotes | maintain |
T2140 | 11845-11847 | DT | denotes | an |
T2141 | 11848-11859 | NN | denotes | environment |
T2142 | 11860-11864 | WDT | denotes | that |
T2143 | 11865-11867 | VB | denotes | is |
T2144 | 11868-11878 | JJ | denotes | permissive |
T2145 | 11879-11882 | IN | denotes | for |
T2146 | 11883-11896 | NN | denotes | transcription |
T2147 | 11898-11900 | PRP | denotes | We |
T2148 | 11901-11910 | RB | denotes | therefore |
T2149 | 11911-11923 | VB | denotes | investigated |
T2150 | 11924-11927 | DT | denotes | the |
T2151 | 11928-11935 | NN | denotes | effects |
T2152 | 11936-11938 | IN | denotes | of |
T2153 | 11939-11940 | DT | denotes | a |
T2154 | 11941-11950 | JJ | denotes | synthetic |
T2155 | 11951-11965 | NN | denotes | corticosteroid |
T2156 | 11965-11966 | -COMMA- | denotes | , |
T2157 | 11967-11969 | NN | denotes | FP |
T2158 | 11969-11970 | -COMMA- | denotes | , |
T2159 | 11971-11973 | IN | denotes | on |
T2160 | 11974-11980 | NN | denotes | GATA-3 |
T2161 | 11981-11996 | NN | denotes | phosphorylation |
T2162 | 11997-12000 | CC | denotes | and |
T2163 | 12001-12008 | JJ | denotes | nuclear |
T2164 | 12009-12022 | NN | denotes | translocation |
T2165 | 12023-12025 | IN | denotes | in |
T2166 | 12026-12027 | DT | denotes | a |
T2167 | 12028-12029 | NN | denotes | T |
T2168 | 12030-12040 | NN | denotes | lymphocyte |
T2169 | 12041-12045 | NN | denotes | cell |
T2170 | 12046-12050 | NN | denotes | line |
T2171 | 12051-12052 | -LRB- | denotes | ( |
T2172 | 12052-12058 | NN | denotes | HuT-78 |
T2173 | 12058-12059 | -RRB- | denotes | ) |
T2174 | 12060-12063 | CC | denotes | and |
T2175 | 12064-12066 | IN | denotes | in |
T2176 | 12067-12077 | JJ | denotes | peripheral |
T2177 | 12078-12083 | NN | denotes | blood |
T2178 | 12084-12095 | JJ | denotes | mononuclear |
T2179 | 12096-12101 | NN | denotes | cells |
T2180 | 12102-12111 | VB | denotes | activated |
T2181 | 12112-12114 | IN | denotes | by |
T2182 | 12115-12123 | JJ | denotes | anti-CD3 |
T2183 | 12124-12127 | CC | denotes | and |
T2184 | 12128-12137 | JJ | denotes | anti-CD28 |
T2185 | 12138-12148 | NN | denotes | antibodies |
T2186 | 12149-12151 | FW | denotes | in |
T2187 | 12152-12157 | FW | denotes | vitro |
T2188 | 12159-12161 | PRP | denotes | We |
T2189 | 12162-12166 | RB | denotes | also |
T2190 | 12167-12174 | VB | denotes | studied |
T2191 | 12175-12178 | DT | denotes | the |
T2192 | 12179-12186 | NN | denotes | effects |
T2193 | 12187-12189 | IN | denotes | of |
T2194 | 12190-12197 | VB | denotes | inhaled |
T2195 | 12198-12209 | NN | denotes | fluticasone |
T2196 | 12210-12217 | NN | denotes | therapy |
T2197 | 12218-12220 | IN | denotes | on |
T2198 | 12221-12227 | NN | denotes | GATA-3 |
T2199 | 12228-12239 | JJ | denotes | subcellular |
T2200 | 12240-12252 | NN | denotes | localization |
T2201 | 12253-12255 | IN | denotes | in |
T2202 | 12256-12266 | JJ | denotes | peripheral |
T2203 | 12267-12272 | NN | denotes | blood |
T2204 | 12273-12284 | JJ | denotes | mononuclear |
T2205 | 12285-12290 | NN | denotes | cells |
T2206 | 12291-12292 | -LRB- | denotes | ( |
T2207 | 12292-12297 | NN | denotes | PBMCs |
T2208 | 12297-12298 | -RRB- | denotes | ) |
T2209 | 12299-12303 | IN | denotes | from |
T2210 | 12304-12312 | NN | denotes | patients |
T2211 | 12313-12317 | IN | denotes | with |
T2212 | 12318-12324 | NN | denotes | asthma |
T3675 | 12350-12362 | NN | denotes | Participants |
T3676 | 12363-12366 | CC | denotes | and |
T3677 | 12367-12372 | NN | denotes | Study |
T3678 | 12373-12379 | NN | denotes | Design |
T3679 | 12380-12382 | PRP | denotes | We |
T3680 | 12383-12390 | VB | denotes | studied |
T3681 | 12391-12399 | NN | denotes | patients |
T3682 | 12400-12404 | IN | denotes | with |
T3683 | 12405-12409 | JJ | denotes | mild |
T3684 | 12410-12416 | NN | denotes | asthma |
T3685 | 12417-12420 | WP | denotes | who |
T3686 | 12421-12425 | VB | denotes | were |
T3687 | 12426-12429 | RB | denotes | not |
T3688 | 12430-12437 | VB | denotes | treated |
T3689 | 12438-12442 | IN | denotes | with |
T3690 | 12443-12450 | VB | denotes | inhaled |
T3691 | 12451-12466 | NN | denotes | corticosteroids |
T3692 | 12467-12470 | WP | denotes | who |
T3693 | 12471-12474 | VB | denotes | had |
T3694 | 12475-12479 | VB | denotes | been |
T3695 | 12480-12488 | VB | denotes | included |
T3696 | 12489-12491 | IN | denotes | in |
T3697 | 12492-12493 | DT | denotes | a |
T3698 | 12494-12504 | RB | denotes | previously |
T3699 | 12505-12513 | VB | denotes | reported |
T3700 | 12514-12526 | JJ | denotes | double-blind |
T3701 | 12526-12527 | -COMMA- | denotes | , |
T3702 | 12528-12546 | JJ | denotes | placebo-controlled |
T3703 | 12546-12547 | -COMMA- | denotes | , |
T3704 | 12548-12557 | JJ | denotes | crossover |
T3705 | 12558-12563 | NN | denotes | study |
T3706 | 12564-12568 | IN | denotes | with |
T3707 | 12569-12571 | NN | denotes | FP |
T3708 | 12572-12573 | -LRB- | denotes | [ |
T3709 | 12573-12575 | CD | denotes | 34 |
T3710 | 12575-12576 | -RRB- | denotes | ] |
T3711 | 12578-12583 | CD | denotes | Seven |
T3712 | 12584-12592 | NN | denotes | patients |
T3713 | 12593-12597 | IN | denotes | with |
T3714 | 12598-12602 | JJ | denotes | mild |
T3715 | 12603-12609 | NN | denotes | asthma |
T3716 | 12610-12617 | VB | denotes | entered |
T3717 | 12618-12621 | DT | denotes | the |
T3718 | 12622-12627 | NN | denotes | study |
T3719 | 12628-12631 | CC | denotes | and |
T3720 | 12632-12636 | VB | denotes | were |
T3721 | 12637-12647 | VB | denotes | randomized |
T3722 | 12648-12650 | TO | denotes | to |
T3723 | 12651-12658 | VB | denotes | receive |
T3724 | 12659-12660 | DT | denotes | a |
T3725 | 12661-12667 | JJ | denotes | single |
T3726 | 12668-12678 | NN | denotes | inhalation |
T3727 | 12679-12681 | IN | denotes | of |
T3728 | 12682-12684 | NN | denotes | FP |
T3729 | 12685-12686 | -LRB- | denotes | ( |
T3730 | 12686-12689 | CD | denotes | 100 |
T3731 | 12690-12693 | CC | denotes | and |
T3732 | 12694-12697 | CD | denotes | 500 |
T3733 | 12698-12700 | NN | denotes | µg |
T3734 | 12700-12701 | -RRB- | denotes | ) |
T3735 | 12702-12704 | CC | denotes | or |
T3736 | 12705-12706 | DT | denotes | a |
T3737 | 12707-12714 | JJ | denotes | matched |
T3738 | 12715-12722 | NN | denotes | placebo |
T3739 | 12723-12730 | NN | denotes | control |
T3740 | 12731-12734 | IN | denotes | via |
T3741 | 12735-12736 | DT | denotes | a |
T3742 | 12737-12743 | NN | denotes | spacer |
T3743 | 12744-12751 | NN | denotes | chamber |
T3744 | 12751-12752 | -COMMA- | denotes | , |
T3745 | 12753-12756 | CC | denotes | and |
T3746 | 12757-12760 | DT | denotes | the |
T3747 | 12761-12766 | JJ | denotes | other |
T3748 | 12767-12776 | NN | denotes | treatment |
T3749 | 12777-12780 | VB | denotes | was |
T3750 | 12781-12786 | VB | denotes | given |
T3751 | 12787-12792 | IN | denotes | after |
T3752 | 12793-12794 | DT | denotes | a |
T3753 | 12795-12803 | JJ | denotes | wash-out |
T3754 | 12804-12810 | NN | denotes | period |
T3755 | 12811-12813 | IN | denotes | of |
T3756 | 12814-12816 | IN | denotes | at |
T3757 | 12817-12822 | JJ | denotes | least |
T3758 | 12823-12824 | CD | denotes | 6 |
T3759 | 12825-12826 | NN | denotes | d |
T3760 | 12828-12833 | NN | denotes | Blood |
T3761 | 12834-12837 | VB | denotes | was |
T3762 | 12838-12843 | VB | denotes | taken |
T3763 | 12844-12847 | IN | denotes | for |
T3764 | 12848-12859 | NN | denotes | preparation |
T3765 | 12860-12862 | IN | denotes | of |
T3766 | 12863-12868 | NN | denotes | PBMCs |
T3767 | 12869-12871 | IN | denotes | at |
T3768 | 12872-12873 | CD | denotes | 1 |
T3769 | 12874-12877 | CC | denotes | and |
T3770 | 12878-12879 | CD | denotes | 2 |
T3771 | 12880-12881 | NN | denotes | h |
T3772 | 12882-12887 | IN | denotes | after |
T3773 | 12888-12892 | NN | denotes | drug |
T3774 | 12893-12907 | NN | denotes | administration |
T3775 | 12909-12912 | DT | denotes | All |
T3776 | 12913-12921 | NN | denotes | patients |
T3777 | 12922-12926 | VB | denotes | gave |
T3778 | 12927-12935 | VB | denotes | informed |
T3779 | 12936-12943 | NN | denotes | consent |
T3780 | 12944-12947 | CC | denotes | and |
T3781 | 12948-12951 | DT | denotes | the |
T3782 | 12952-12957 | NN | denotes | study |
T3783 | 12958-12961 | VB | denotes | was |
T3784 | 12962-12970 | VB | denotes | approved |
T3785 | 12971-12973 | IN | denotes | by |
T3786 | 12974-12977 | DT | denotes | the |
T3787 | 12978-12984 | NNP | denotes | Ethics |
T3788 | 12985-12994 | NNP | denotes | Committee |
T3789 | 12995-12997 | IN | denotes | of |
T3790 | 12998-13001 | DT | denotes | the |
T3791 | 13002-13007 | NNP | denotes | Royal |
T3792 | 13008-13016 | NNP | denotes | Brompton |
T3793 | 13017-13020 | CC | denotes | and |
T3794 | 13021-13030 | NNP | denotes | Harefield |
T3795 | 13031-13040 | NNP | denotes | Hospitals |
T3796 | 13041-13044 | NNP | denotes | NHS |
T3797 | 13045-13051 | NNP | denotes | Trust. |
T3798 | 13052-13055 | DT | denotes | The |
T3799 | 13056-13064 | JJ | denotes | clinical |
T3800 | 13065-13070 | NN | denotes | study |
T3801 | 13071-13074 | VB | denotes | was |
T3802 | 13075-13084 | VB | denotes | conducted |
T3803 | 13085-13091 | IN | denotes | before |
T3804 | 13092-13095 | DT | denotes | the |
T3805 | 13096-13107 | NN | denotes | requirement |
T3806 | 13108-13111 | IN | denotes | for |
T3807 | 13112-13120 | NNP | denotes | Clinical |
T3808 | 13121-13126 | NNP | denotes | Trial |
T3809 | 13127-13139 | NNP | denotes | Registration |
T3981 | 13142-13152 | NN | denotes | Antibodies |
T3982 | 13153-13156 | CC | denotes | and |
T3983 | 13157-13165 | NN | denotes | Reagents |
T3984 | 13166-13169 | DT | denotes | The |
T3985 | 13170-13180 | JJ | denotes | monoclonal |
T3986 | 13181-13191 | NN | denotes | antibodies |
T3987 | 13192-13199 | IN | denotes | against |
T3988 | 13200-13205 | JJ | denotes | human |
T3989 | 13206-13209 | NN | denotes | CD3 |
T3990 | 13209-13210 | -COMMA- | denotes | , |
T3991 | 13211-13215 | NN | denotes | CD28 |
T3992 | 13215-13216 | -COMMA- | denotes | , |
T3993 | 13217-13219 | NN | denotes | GR |
T3994 | 13219-13220 | -COMMA- | denotes | , |
T3995 | 13221-13224 | CC | denotes | and |
T3996 | 13225-13235 | NN | denotes | importin-α |
T3997 | 13236-13240 | VB | denotes | were |
T3998 | 13241-13250 | VB | denotes | purchased |
T3999 | 13251-13255 | IN | denotes | from |
T4000 | 13256-13258 | NN | denotes | BD |
T4001 | 13259-13270 | NNP | denotes | Biosciences |
T4002 | 13271-13272 | -LRB- | denotes | ( |
T4003 | 13272-13278 | NNP | denotes | Oxford |
T4004 | 13278-13279 | -COMMA- | denotes | , |
T4005 | 13280-13286 | NNP | denotes | United |
T4006 | 13287-13294 | NNP | denotes | Kingdom |
T4007 | 13294-13295 | -RRB- | denotes | ) |
T4008 | 13297-13303 | NN | denotes | Rabbit |
T4009 | 13304-13314 | NN | denotes | antibodies |
T4010 | 13315-13322 | IN | denotes | against |
T4011 | 13323-13328 | JJ | denotes | human |
T4012 | 13329-13335 | NN | denotes | GATA-3 |
T4013 | 13336-13337 | -LRB- | denotes | ( |
T4014 | 13337-13341 | NN | denotes | H-48 |
T4015 | 13341-13342 | -RRB- | denotes | ) |
T4016 | 13343-13346 | CC | denotes | and |
T4017 | 13347-13349 | NN | denotes | GR |
T4018 | 13350-13351 | -LRB- | denotes | ( |
T4019 | 13351-13355 | NN | denotes | E-20 |
T4020 | 13355-13356 | -COMMA- | denotes | , |
T4021 | 13357-13364 | NN | denotes | sc-1003 |
T4022 | 13364-13365 | -RRB- | denotes | ) |
T4023 | 13366-13370 | VB | denotes | were |
T4024 | 13371-13379 | VB | denotes | obtained |
T4025 | 13380-13384 | IN | denotes | from |
T4026 | 13385-13390 | NNP | denotes | Santa |
T4027 | 13391-13395 | NNP | denotes | Cruz |
T4028 | 13396-13409 | NNP | denotes | Biotechnology |
T4029 | 13410-13411 | -LRB- | denotes | ( |
T4030 | 13411-13416 | NNP | denotes | Santa |
T4031 | 13417-13421 | NNP | denotes | Cruz |
T4032 | 13421-13422 | -COMMA- | denotes | , |
T4033 | 13423-13433 | NNP | denotes | California |
T4034 | 13433-13434 | -COMMA- | denotes | , |
T4035 | 13435-13441 | NNP | denotes | United |
T4036 | 13442-13448 | NNP | denotes | States |
T4037 | 13448-13449 | -RRB- | denotes | ) |
T4038 | 13449-13450 | -COMMA- | denotes | , |
T4039 | 13451-13461 | JJ | denotes | polyclonal |
T4040 | 13462-13468 | NN | denotes | rabbit |
T4041 | 13469-13479 | NN | denotes | antibodies |
T4042 | 13480-13487 | IN | denotes | against |
T4043 | 13488-13499 | JJ | denotes | phospho-p38 |
T4044 | 13500-13503 | NN | denotes | MAP |
T4045 | 13504-13510 | NN | denotes | kinase |
T4046 | 13511-13514 | CC | denotes | and |
T4047 | 13515-13528 | NN | denotes | phospho-ATF-2 |
T4048 | 13529-13533 | IN | denotes | from |
T4049 | 13534-13538 | NNP | denotes | Cell |
T4050 | 13539-13548 | NNP | denotes | Signaling |
T4051 | 13549-13559 | NNP | denotes | Technology |
T4052 | 13560-13561 | -LRB- | denotes | ( |
T4053 | 13561-13564 | NNP | denotes | New |
T4054 | 13565-13572 | NNP | denotes | England |
T4055 | 13573-13580 | NNP | denotes | Biolabs |
T4056 | 13580-13581 | -COMMA- | denotes | , |
T4057 | 13582-13590 | NNP | denotes | Hertford |
T4058 | 13590-13591 | -COMMA- | denotes | , |
T4059 | 13592-13594 | NNP | denotes | UK |
T4060 | 13594-13595 | -RRB- | denotes | ) |
T4061 | 13595-13596 | -COMMA- | denotes | , |
T4062 | 13597-13607 | JJ | denotes | monoclonal |
T4063 | 13608-13616 | NN | denotes | antibody |
T4064 | 13617-13624 | IN | denotes | against |
T4065 | 13625-13638 | NN | denotes | phosphoserine |
T4066 | 13639-13640 | -LRB- | denotes | ( |
T4067 | 13640-13645 | NN | denotes | clone |
T4068 | 13646-13649 | NN | denotes | 4H4 |
T4069 | 13649-13650 | -RRB- | denotes | ) |
T4070 | 13651-13655 | IN | denotes | from |
T4071 | 13656-13664 | NNP | denotes | Affiniti |
T4072 | 13665-13673 | NNP | denotes | Research |
T4073 | 13674-13682 | NNP | denotes | Products |
T4074 | 13683-13684 | -LRB- | denotes | ( |
T4075 | 13684-13690 | NNP | denotes | Exeter |
T4076 | 13690-13691 | -COMMA- | denotes | , |
T4077 | 13692-13694 | NNP | denotes | UK |
T4078 | 13694-13695 | -RRB- | denotes | ) |
T4079 | 13695-13696 | -COMMA- | denotes | , |
T4080 | 13697-13700 | CC | denotes | and |
T4081 | 13701-13711 | NN | denotes | antibodies |
T4082 | 13712-13719 | IN | denotes | against |
T4083 | 13720-13726 | NN | denotes | rabbit |
T4084 | 13727-13741 | JJ | denotes | IgG-conjugated |
T4085 | 13742-13747 | NN | denotes | TRITC |
T4086 | 13748-13752 | IN | denotes | from |
T4087 | 13753-13757 | NNP | denotes | Dako |
T4088 | 13758-13768 | NNP | denotes | Cytomation |
T4089 | 13769-13770 | -LRB- | denotes | ( |
T4090 | 13770-13779 | NNP | denotes | Cambridge |
T4091 | 13779-13780 | -COMMA- | denotes | , |
T4092 | 13781-13783 | NNP | denotes | UK |
T4093 | 13783-13784 | -RRB- | denotes | ) |
T4094 | 13786-13789 | DT | denotes | The |
T4095 | 13790-13797 | JJ | denotes | anti-GR |
T4096 | 13798-13806 | NN | denotes | antibody |
T4097 | 13807-13808 | -LRB- | denotes | ( |
T4098 | 13808-13813 | NN | denotes | Clone |
T4099 | 13814-13816 | CD | denotes | 41 |
T4100 | 13816-13817 | -RRB- | denotes | ) |
T4101 | 13818-13822 | IN | denotes | from |
T4102 | 13823-13825 | NN | denotes | BD |
T4103 | 13826-13838 | NN | denotes | Transduction |
T4104 | 13839-13851 | NN | denotes | Laboratories |
T4105 | 13852-13853 | -LRB- | denotes | ( |
T4106 | 13853-13859 | NNP | denotes | Oxford |
T4107 | 13859-13860 | -COMMA- | denotes | , |
T4108 | 13861-13863 | NNP | denotes | UK |
T4109 | 13863-13864 | -RRB- | denotes | ) |
T4110 | 13865-13868 | VB | denotes | was |
T4111 | 13869-13873 | VB | denotes | used |
T4112 | 13874-13877 | IN | denotes | for |
T4113 | 13878-13885 | JJ | denotes | Western |
T4114 | 13886-13890 | NN | denotes | blot |
T4115 | 13891-13899 | NN | denotes | analysis |
T4116 | 13901-13904 | DT | denotes | All |
T4117 | 13905-13910 | JJ | denotes | other |
T4118 | 13911-13919 | NN | denotes | reagents |
T4119 | 13920-13924 | VB | denotes | were |
T4120 | 13925-13934 | VB | denotes | purchased |
T4121 | 13935-13939 | IN | denotes | from |
T4122 | 13940-13945 | NN | denotes | Sigma |
T4123 | 13946-13947 | -LRB- | denotes | ( |
T4124 | 13947-13952 | NN | denotes | Poole |
T4125 | 13952-13953 | -COMMA- | denotes | , |
T4126 | 13954-13956 | NNP | denotes | UK |
T4127 | 13956-13957 | -RRB- | denotes | ) |
T4354 | 13960-13964 | NN | denotes | Cell |
T4355 | 13965-13972 | NN | denotes | Culture |
T4356 | 13973-13976 | CC | denotes | and |
T4357 | 13977-13981 | NN | denotes | PBMC |
T4358 | 13982-13991 | NN | denotes | Isolation |
T4359 | 13992-13993 | DT | denotes | A |
T4360 | 13994-13999 | JJ | denotes | human |
T4361 | 14000-14001 | NN | denotes | T |
T4362 | 14002-14006 | NN | denotes | cell |
T4363 | 14007-14011 | NN | denotes | line |
T4364 | 14012-14013 | -LRB- | denotes | ( |
T4365 | 14013-14019 | NN | denotes | HuT-78 |
T4366 | 14019-14020 | -RRB- | denotes | ) |
T4367 | 14021-14024 | VB | denotes | was |
T4368 | 14025-14034 | VB | denotes | purchased |
T4369 | 14035-14039 | IN | denotes | from |
T4370 | 14040-14045 | NN | denotes | ECACC |
T4371 | 14046-14054 | NNP | denotes | European |
T4372 | 14055-14065 | NNP | denotes | Collection |
T4373 | 14066-14068 | IN | denotes | of |
T4374 | 14069-14073 | NNP | denotes | Cell |
T4375 | 14074-14081 | NNP | denotes | Culture |
T4376 | 14082-14083 | -LRB- | denotes | ( |
T4377 | 14083-14092 | NNP | denotes | Wiltshire |
T4378 | 14092-14093 | -COMMA- | denotes | , |
T4379 | 14094-14096 | NNP | denotes | UK |
T4380 | 14096-14097 | -RRB- | denotes | ) |
T4381 | 14098-14102 | VB | denotes | were |
T4382 | 14103-14111 | VB | denotes | cultured |
T4383 | 14112-14114 | IN | denotes | as |
T4384 | 14115-14125 | RB | denotes | previously |
T4385 | 14126-14135 | VB | denotes | described |
T4386 | 14136-14137 | -LRB- | denotes | [ |
T4387 | 14137-14139 | CD | denotes | 12 |
T4388 | 14139-14140 | -RRB- | denotes | ] |
T4389 | 14142-14147 | NN | denotes | PBMCs |
T4390 | 14148-14152 | VB | denotes | were |
T4391 | 14153-14161 | VB | denotes | isolated |
T4392 | 14162-14164 | IN | denotes | by |
T4393 | 14165-14172 | NN | denotes | density |
T4394 | 14173-14187 | NN | denotes | centrifugation |
T4395 | 14188-14192 | IN | denotes | over |
T4396 | 14193-14207 | JJ | denotes | Ficoll-Hypaque |
T4397 | 14208-14209 | -LRB- | denotes | ( |
T4398 | 14209-14216 | NN | denotes | density |
T4399 | 14216-14217 | -COMMA- | denotes | , |
T4400 | 14218-14223 | CD | denotes | 1.077 |
T4401 | 14224-14228 | NN | denotes | g/ml |
T4402 | 14228-14229 | -COLON- | denotes | ; |
T4403 | 14230-14238 | NNP | denotes | Amersham |
T4404 | 14239-14250 | NNP | denotes | Biosciences |
T4405 | 14250-14251 | -COMMA- | denotes | , |
T4406 | 14252-14260 | NNP | denotes | Amersham |
T4407 | 14260-14261 | -COMMA- | denotes | , |
T4408 | 14262-14264 | NNP | denotes | UK |
T4409 | 14264-14265 | -RRB- | denotes | ) |
T4410 | 14266-14268 | IN | denotes | as |
T4411 | 14269-14279 | RB | denotes | previously |
T4412 | 14280-14289 | VB | denotes | described |
T4413 | 14290-14291 | -LRB- | denotes | [ |
T4414 | 14291-14293 | CD | denotes | 34 |
T4415 | 14293-14294 | -RRB- | denotes | ] |
T4416 | 14296-14301 | NN | denotes | Cells |
T4417 | 14302-14306 | VB | denotes | were |
T4418 | 14307-14317 | VB | denotes | stimulated |
T4419 | 14318-14322 | IN | denotes | with |
T4420 | 14323-14336 | JJ | denotes | anti-CD3/CD28 |
T4421 | 14337-14338 | -LRB- | denotes | ( |
T4422 | 14338-14339 | CD | denotes | 1 |
T4423 | 14340-14345 | NN | denotes | µg/ml |
T4424 | 14346-14350 | DT | denotes | each |
T4425 | 14350-14351 | -RRB- | denotes | ) |
T4426 | 14352-14355 | IN | denotes | for |
T4427 | 14356-14357 | CD | denotes | 1 |
T4428 | 14358-14359 | NN | denotes | h |
T4429 | 14360-14362 | IN | denotes | at |
T4430 | 14363-14367 | NN | denotes | 37°C |
T4431 | 14368-14370 | TO | denotes | to |
T4432 | 14371-14380 | VB | denotes | stimulate |
T4433 | 14381-14384 | NN | denotes | Th2 |
T4434 | 14385-14393 | NN | denotes | cytokine |
T4435 | 14394-14401 | NN | denotes | release |
T4436 | 14402-14404 | IN | denotes | in |
T4437 | 14405-14408 | DT | denotes | the |
T4438 | 14409-14417 | NN | denotes | presence |
T4439 | 14418-14420 | CC | denotes | or |
T4440 | 14421-14428 | NN | denotes | absence |
T4441 | 14429-14431 | IN | denotes | of |
T4442 | 14432-14434 | NN | denotes | FP |
T4443 | 14435-14436 | -LRB- | denotes | ( |
T4444 | 14436-14441 | CD | denotes | 10−12 |
T4445 | 14442-14444 | TO | denotes | to |
T4446 | 14445-14450 | NN | denotes | 10−8M |
T4447 | 14450-14451 | -RRB- | denotes | ) |
T4448 | 14453-14462 | NN | denotes | Cytospins |
T4449 | 14463-14467 | VB | denotes | were |
T4450 | 14468-14476 | VB | denotes | prepared |
T4451 | 14477-14480 | CC | denotes | and |
T4452 | 14481-14487 | NN | denotes | GATA-3 |
T4453 | 14488-14500 | NN | denotes | localization |
T4454 | 14501-14511 | VB | denotes | determined |
T4455 | 14512-14514 | IN | denotes | by |
T4456 | 14515-14523 | JJ | denotes | confocal |
T4457 | 14524-14534 | NN | denotes | microscopy |
T4458 | 14535-14537 | IN | denotes | as |
T4459 | 14538-14548 | RB | denotes | previously |
T4460 | 14549-14558 | VB | denotes | described |
T4461 | 14559-14560 | -LRB- | denotes | [ |
T4462 | 14560-14562 | CD | denotes | 12 |
T4463 | 14562-14563 | -RRB- | denotes | ] |
T4622 | 14566-14573 | JJ | denotes | Reverse |
T4623 | 14574-14587 | NN | denotes | Transcription |
T4624 | 14588-14591 | NN | denotes | PCR |
T4625 | 14592-14597 | JJ | denotes | Total |
T4626 | 14598-14601 | NN | denotes | RNA |
T4627 | 14602-14605 | VB | denotes | was |
T4628 | 14606-14615 | VB | denotes | extracted |
T4629 | 14616-14621 | VB | denotes | using |
T4630 | 14622-14627 | NN | denotes | lysis |
T4631 | 14628-14634 | NN | denotes | buffer |
T4632 | 14635-14636 | -LRB- | denotes | ( |
T4633 | 14636-14642 | NN | denotes | RNeasy |
T4634 | 14643-14646 | NN | denotes | kit |
T4635 | 14646-14647 | -COLON- | denotes | ; |
T4636 | 14648-14654 | NNP | denotes | Qiagen |
T4637 | 14654-14655 | -COMMA- | denotes | , |
T4638 | 14656-14663 | NNP | denotes | Crawley |
T4639 | 14663-14664 | -COMMA- | denotes | , |
T4640 | 14665-14667 | NNP | denotes | UK |
T4641 | 14667-14668 | -RRB- | denotes | ) |
T4642 | 14670-14676 | IN | denotes | During |
T4643 | 14677-14680 | NN | denotes | RNA |
T4644 | 14681-14693 | NN | denotes | purification |
T4645 | 14693-14694 | -COMMA- | denotes | , |
T4646 | 14695-14702 | JJ | denotes | genomic |
T4647 | 14703-14706 | NN | denotes | DNA |
T4648 | 14707-14710 | VB | denotes | was |
T4649 | 14711-14719 | VB | denotes | digested |
T4650 | 14720-14724 | IN | denotes | with |
T4651 | 14725-14735 | JJ | denotes | RNase-free |
T4652 | 14736-14741 | NN | denotes | DNase |
T4653 | 14742-14743 | -LRB- | denotes | ( |
T4654 | 14743-14751 | NNP | denotes | Amersham |
T4655 | 14752-14763 | NNP | denotes | Biosciences |
T4656 | 14763-14764 | -RRB- | denotes | ) |
T4657 | 14766-14770 | RB | denotes | Next |
T4658 | 14770-14771 | -COMMA- | denotes | , |
T4659 | 14772-14775 | CD | denotes | 0.5 |
T4660 | 14776-14778 | NN | denotes | µg |
T4661 | 14779-14781 | IN | denotes | of |
T4662 | 14782-14787 | JJ | denotes | total |
T4663 | 14788-14791 | NN | denotes | RNA |
T4664 | 14792-14795 | VB | denotes | was |
T4665 | 14796-14804 | VB | denotes | reversed |
T4666 | 14805-14816 | VB | denotes | transcribed |
T4667 | 14817-14822 | VB | denotes | using |
T4668 | 14823-14826 | DT | denotes | the |
T4669 | 14827-14832 | JJ | denotes | avian |
T4670 | 14833-14847 | NN | denotes | myeloblastosis |
T4671 | 14848-14853 | NN | denotes | virus |
T4672 | 14854-14856 | NN | denotes | RT |
T4673 | 14857-14858 | -LRB- | denotes | ( |
T4674 | 14858-14865 | NNP | denotes | Promega |
T4675 | 14865-14866 | -COMMA- | denotes | , |
T4676 | 14867-14878 | NNP | denotes | Southampton |
T4677 | 14878-14879 | -COMMA- | denotes | , |
T4678 | 14880-14882 | NNP | denotes | UK |
T4679 | 14882-14883 | -RRB- | denotes | ) |
T4680 | 14885-14888 | IN | denotes | For |
T4681 | 14889-14897 | JJ | denotes | relative |
T4682 | 14898-14912 | NN | denotes | quantification |
T4683 | 14912-14913 | -COMMA- | denotes | , |
T4684 | 14914-14920 | NN | denotes | RT-PCR |
T4685 | 14921-14924 | VB | denotes | was |
T4686 | 14925-14932 | VB | denotes | carried |
T4687 | 14933-14936 | RP | denotes | out |
T4688 | 14937-14942 | VB | denotes | using |
T4689 | 14943-14947 | NN | denotes | cDNA |
T4690 | 14948-14954 | NN | denotes | probes |
T4691 | 14956-14963 | NN | denotes | Primers |
T4692 | 14964-14967 | IN | denotes | for |
T4693 | 14968-14972 | NN | denotes | IL-4 |
T4694 | 14973-14977 | VB | denotes | were |
T4695 | 14978-14982 | IN | denotes | from |
T4696 | 14983-14996 | NN | denotes | Sigma-Genosys |
T4697 | 14997-14998 | -LRB- | denotes | ( |
T4698 | 14998-15007 | NNP | denotes | Cambridge |
T4699 | 15007-15008 | -COMMA- | denotes | , |
T4700 | 15009-15011 | NNP | denotes | UK |
T4701 | 15011-15012 | -RRB- | denotes | ) |
T4702 | 15014-15023 | NN | denotes | Sequences |
T4703 | 15024-15026 | IN | denotes | of |
T4704 | 15027-15032 | NN | denotes | GADPH |
T4705 | 15033-15037 | VB | denotes | used |
T4706 | 15038-15041 | VB | denotes | are |
T4707 | 15042-15044 | IN | denotes | as |
T4708 | 15045-15052 | VB | denotes | follows |
T4709 | 15052-15053 | -COLON- | denotes | : |
T4710 | 15054-15061 | RB | denotes | forward |
T4711 | 15062-15088 | NN | denotes | 5′-CCACCCATGGCAAATTCCATGGC |
T4712 | 15088-15089 | -COMMA- | denotes | , |
T4713 | 15090-15097 | JJ | denotes | reverse |
T4714 | 15098-15124 | NN | denotes | 3′-TCTAGACGGCAGGTCAGGTCCAC |
T4853 | 15127-15131 | NNP | denotes | Cell |
T4854 | 15132-15145 | NNP | denotes | Fractionation |
T4855 | 15145-15146 | -COMMA- | denotes | , |
T4856 | 15147-15166 | NN | denotes | Immunoprecipitation |
T4857 | 15166-15167 | -COMMA- | denotes | , |
T4858 | 15168-15171 | CC | denotes | and |
T4859 | 15172-15179 | NNP | denotes | Western |
T4860 | 15180-15184 | NNP | denotes | Blot |
T4861 | 15185-15193 | NN | denotes | Analysis |
T4862 | 15194-15201 | JJ | denotes | Nuclear |
T4863 | 15202-15205 | CC | denotes | and |
T4864 | 15206-15217 | JJ | denotes | cytoplasmic |
T4865 | 15218-15227 | NN | denotes | fractions |
T4866 | 15228-15232 | VB | denotes | were |
T4867 | 15233-15241 | VB | denotes | prepared |
T4868 | 15242-15244 | IN | denotes | as |
T4869 | 15245-15255 | RB | denotes | previously |
T4870 | 15256-15265 | VB | denotes | described |
T4871 | 15266-15267 | -LRB- | denotes | [ |
T4872 | 15267-15269 | CD | denotes | 35 |
T4873 | 15269-15270 | -RRB- | denotes | ] |
T4874 | 15272-15277 | JJ | denotes | Whole |
T4875 | 15278-15282 | NN | denotes | cell |
T4876 | 15283-15290 | NN | denotes | lysates |
T4877 | 15291-15295 | VB | denotes | were |
T4878 | 15296-15304 | VB | denotes | prepared |
T4879 | 15305-15307 | IN | denotes | in |
T4880 | 15308-15313 | NN | denotes | NP-40 |
T4881 | 15314-15319 | NN | denotes | lysis |
T4882 | 15320-15326 | NN | denotes | buffer |
T4883 | 15327-15328 | -LRB- | denotes | ( |
T4884 | 15328-15331 | CD | denotes | 0.5 |
T4885 | 15331-15332 | NN | denotes | % |
T4886 | 15333-15340 | NN | denotes | Nonidet |
T4887 | 15341-15345 | NN | denotes | P-40 |
T4888 | 15345-15346 | -COMMA- | denotes | , |
T4889 | 15347-15349 | CD | denotes | 20 |
T4890 | 15350-15352 | NN | denotes | mM |
T4891 | 15353-15361 | NN | denotes | Tris-HCl |
T4892 | 15362-15363 | -LRB- | denotes | [ |
T4893 | 15363-15365 | NN | denotes | pH |
T4894 | 15366-15369 | CD | denotes | 7.5 |
T4895 | 15369-15370 | -RRB- | denotes | ] |
T4896 | 15370-15371 | -COMMA- | denotes | , |
T4897 | 15372-15375 | CD | denotes | 150 |
T4898 | 15376-15378 | NN | denotes | mM |
T4899 | 15379-15383 | NN | denotes | NaCl |
T4900 | 15383-15384 | -RRB- | denotes | ) |
T4901 | 15385-15387 | IN | denotes | in |
T4902 | 15388-15391 | DT | denotes | the |
T4903 | 15392-15400 | NN | denotes | presence |
T4904 | 15401-15403 | IN | denotes | of |
T4905 | 15404-15412 | JJ | denotes | complete |
T4906 | 15413-15421 | NN | denotes | protease |
T4907 | 15422-15430 | NN | denotes | cocktail |
T4908 | 15431-15440 | NN | denotes | inhibitor |
T4909 | 15442-15449 | NN | denotes | Lysates |
T4910 | 15450-15454 | VB | denotes | were |
T4911 | 15455-15466 | VB | denotes | centrifuged |
T4912 | 15467-15469 | IN | denotes | at |
T4913 | 15470-15473 | NN | denotes | 4°C |
T4914 | 15474-15477 | IN | denotes | for |
T4915 | 15478-15480 | CD | denotes | 10 |
T4916 | 15481-15484 | NN | denotes | min |
T4917 | 15485-15487 | IN | denotes | at |
T4918 | 15488-15494 | CD | denotes | 12,000 |
T4919 | 15495-15498 | NN | denotes | rpm |
T4920 | 15499-15501 | IN | denotes | in |
T4921 | 15502-15504 | DT | denotes | an |
T4922 | 15505-15514 | NNP | denotes | Eppendorf |
T4923 | 15515-15530 | NN | denotes | microcentrifuge |
T4924 | 15531-15533 | TO | denotes | to |
T4925 | 15534-15540 | VB | denotes | remove |
T4926 | 15541-15549 | JJ | denotes | cellular |
T4927 | 15550-15556 | NN | denotes | debris |
T4928 | 15558-15565 | NN | denotes | Samples |
T4929 | 15566-15570 | VB | denotes | were |
T4930 | 15571-15575 | RB | denotes | then |
T4931 | 15576-15594 | VB | denotes | immunoprecipitated |
T4932 | 15595-15599 | IN | denotes | with |
T4933 | 15600-15606 | CC | denotes | either |
T4934 | 15607-15609 | CD | denotes | 10 |
T4935 | 15610-15612 | NN | denotes | µl |
T4936 | 15613-15615 | IN | denotes | of |
T4937 | 15616-15624 | NN | denotes | antibody |
T4938 | 15625-15632 | IN | denotes | against |
T4939 | 15633-15639 | NN | denotes | GATA-3 |
T4940 | 15640-15642 | CC | denotes | or |
T4941 | 15643-15653 | NN | denotes | importin-α |
T4942 | 15654-15659 | VB | denotes | using |
T4943 | 15660-15663 | NN | denotes | A/G |
T4944 | 15664-15671 | VB | denotes | agarose |
T4945 | 15672-15678 | NN | denotes | slurry |
T4946 | 15679-15681 | IN | denotes | in |
T4947 | 15682-15685 | DT | denotes | the |
T4948 | 15686-15694 | NN | denotes | presence |
T4949 | 15695-15697 | IN | denotes | of |
T4950 | 15698-15706 | NN | denotes | protease |
T4951 | 15707-15716 | NN | denotes | inhibitor |
T4952 | 15717-15722 | VB | denotes | using |
T4953 | 15723-15726 | DT | denotes | the |
T4954 | 15727-15732 | NNP | denotes | Catch |
T4955 | 15733-15736 | CC | denotes | and |
T4956 | 15737-15744 | NN | denotes | Release |
T4957 | 15745-15756 | NN | denotes | methodology |
T4958 | 15757-15758 | -LRB- | denotes | ( |
T4959 | 15758-15765 | NNP | denotes | Upstate |
T4960 | 15766-15779 | NNP | denotes | Biotechnology |
T4961 | 15779-15780 | -COMMA- | denotes | , |
T4962 | 15781-15785 | NNP | denotes | Lake |
T4963 | 15786-15792 | NNP | denotes | Placid |
T4964 | 15792-15793 | -COMMA- | denotes | , |
T4965 | 15794-15797 | NNP | denotes | New |
T4966 | 15798-15802 | NNP | denotes | York |
T4967 | 15802-15803 | -COMMA- | denotes | , |
T4968 | 15804-15807 | NNP | denotes | USA |
T4969 | 15807-15808 | -RRB- | denotes | ) |
T4970 | 15810-15817 | NN | denotes | Western |
T4971 | 15818-15822 | NN | denotes | blot |
T4972 | 15823-15831 | NN | denotes | analysis |
T4973 | 15832-15835 | VB | denotes | was |
T4974 | 15836-15845 | VB | denotes | performed |
T4975 | 15846-15851 | VB | denotes | using |
T4976 | 15852-15863 | NN | denotes | anti-GATA-3 |
T4977 | 15863-15864 | -COMMA- | denotes | , |
T4978 | 15865-15880 | JJ | denotes | anti-importin-α |
T4979 | 15880-15881 | -COMMA- | denotes | , |
T4980 | 15882-15889 | JJ | denotes | anti-GR |
T4981 | 15889-15890 | -COMMA- | denotes | , |
T4982 | 15891-15901 | JJ | denotes | anti-p-p38 |
T4983 | 15902-15905 | NN | denotes | MAP |
T4984 | 15906-15912 | NN | denotes | kinase |
T4985 | 15912-15913 | -COMMA- | denotes | , |
T4986 | 15914-15926 | NN | denotes | anti-p-ATF-2 |
T4987 | 15926-15927 | -COMMA- | denotes | , |
T4988 | 15928-15931 | CC | denotes | and |
T4989 | 15932-15945 | JJ | denotes | anti-p-serine |
T4990 | 15947-15961 | JJ | denotes | Immunoreactive |
T4991 | 15962-15970 | NN | denotes | proteins |
T4992 | 15971-15975 | VB | denotes | were |
T4993 | 15976-15984 | VB | denotes | detected |
T4994 | 15985-15990 | VB | denotes | using |
T4995 | 15991-15993 | DT | denotes | an |
T4996 | 15994-16002 | VB | denotes | enhanced |
T4997 | 16003-16020 | NN | denotes | chemiluminescence |
T4998 | 16021-16024 | NN | denotes | ECL |
T4999 | 16025-16028 | NN | denotes | kit |
T5000 | 16029-16030 | -LRB- | denotes | ( |
T5001 | 16030-16038 | NNP | denotes | Amersham |
T5002 | 16039-16050 | NNP | denotes | Biosciences |
T5003 | 16050-16051 | -RRB- | denotes | ) |
T5206 | 16054-16063 | NN | denotes | Chromatin |
T5207 | 16064-16083 | NN | denotes | Immunoprecipitation |
T5208 | 16084-16093 | NN | denotes | Chromatin |
T5209 | 16094-16113 | NN | denotes | immunoprecipitation |
T5210 | 16114-16115 | -LRB- | denotes | ( |
T5211 | 16115-16117 | NN | denotes | IP |
T5212 | 16117-16118 | -RRB- | denotes | ) |
T5213 | 16119-16122 | VB | denotes | was |
T5214 | 16123-16132 | VB | denotes | performed |
T5215 | 16133-16135 | IN | denotes | as |
T5216 | 16136-16146 | RB | denotes | previously |
T5217 | 16147-16156 | VB | denotes | described |
T5218 | 16157-16158 | -LRB- | denotes | [ |
T5219 | 16158-16160 | CD | denotes | 12 |
T5220 | 16160-16161 | -RRB- | denotes | ] |
T5221 | 16162-16164 | IN | denotes | in |
T5222 | 16165-16171 | JJ | denotes | HuT-78 |
T5223 | 16172-16179 | NN | denotes | T-cells |
T5224 | 16180-16184 | IN | denotes | with |
T5225 | 16185-16186 | CD | denotes | 2 |
T5226 | 16187-16189 | NN | denotes | µg |
T5227 | 16190-16192 | IN | denotes | of |
T5228 | 16193-16204 | NN | denotes | anti-GATA-3 |
T5229 | 16205-16206 | -LRB- | denotes | ( |
T5230 | 16206-16211 | NNP | denotes | Santa |
T5231 | 16212-16216 | NNP | denotes | Cruz |
T5232 | 16217-16230 | NNP | denotes | Biotechnology |
T5233 | 16230-16231 | -RRB- | denotes | ) |
T5234 | 16231-16232 | -COMMA- | denotes | , |
T5235 | 16233-16235 | CC | denotes | or |
T5236 | 16236-16244 | JJ | denotes | isotypic |
T5237 | 16245-16259 | NN | denotes | immunoglobulin |
T5238 | 16260-16261 | NN | denotes | G |
T5239 | 16262-16264 | IN | denotes | as |
T5240 | 16265-16266 | DT | denotes | a |
T5241 | 16267-16279 | JJ | denotes | non-specific |
T5242 | 16280-16287 | NN | denotes | control |
T5243 | 16288-16289 | -LRB- | denotes | ( |
T5244 | 16289-16294 | NNP | denotes | Santa |
T5245 | 16295-16299 | NNP | denotes | Cruz |
T5246 | 16300-16313 | NNP | denotes | Biotechnology |
T5247 | 16313-16314 | -RRB- | denotes | ) |
T5248 | 16315-16324 | RB | denotes | overnight |
T5249 | 16325-16327 | IN | denotes | at |
T5250 | 16328-16332 | NNP | denotes | 4°C. |
T5251 | 16333-16341 | NNP | denotes | Promoter |
T5252 | 16342-16351 | NN | denotes | sequences |
T5253 | 16352-16356 | VB | denotes | were |
T5254 | 16357-16365 | VB | denotes | detected |
T5255 | 16366-16370 | IN | denotes | with |
T5256 | 16371-16374 | NN | denotes | PCR |
T5257 | 16375-16382 | NN | denotes | primers |
T5258 | 16383-16386 | IN | denotes | for |
T5259 | 16387-16390 | DT | denotes | the |
T5260 | 16391-16395 | NN | denotes | IL-5 |
T5261 | 16396-16404 | NN | denotes | promoter |
T5262 | 16405-16406 | -LRB- | denotes | ( |
T5263 | 16406-16410 | CD | denotes | −445 |
T5264 | 16411-16413 | TO | denotes | to |
T5265 | 16414-16416 | CD | denotes | +4 |
T5266 | 16416-16417 | -RRB- | denotes | ) |
T5267 | 16417-16418 | -COLON- | denotes | : |
T5268 | 16419-16426 | JJ | denotes | forward |
T5269 | 16427-16454 | NN | denotes | 5′-TTAATCTAGCCACAGTCATAG-3′ |
T5270 | 16455-16458 | CC | denotes | and |
T5271 | 16459-16466 | VB | denotes | reverse |
T5272 | 16466-16467 | -COLON- | denotes | : |
T5273 | 16468-16495 | NN | denotes | 5′-TCATGGCTCTGAAACGTTCTG-3′ |
T5274 | 16497-16500 | NN | denotes | PCR |
T5275 | 16501-16504 | VB | denotes | was |
T5276 | 16505-16514 | VB | denotes | performed |
T5277 | 16515-16520 | VB | denotes | using |
T5278 | 16521-16522 | DT | denotes | a |
T5279 | 16523-16529 | NNP | denotes | Hybaid |
T5280 | 16530-16538 | NNP | denotes | Omnigene |
T5281 | 16539-16546 | JJ | denotes | thermal |
T5282 | 16547-16553 | NN | denotes | cycler |
T5283 | 16554-16555 | -LRB- | denotes | ( |
T5284 | 16555-16561 | NNP | denotes | Hybaid |
T5285 | 16561-16562 | -COMMA- | denotes | , |
T5286 | 16563-16570 | NNP | denotes | Ashford |
T5287 | 16570-16571 | -COMMA- | denotes | , |
T5288 | 16572-16574 | NNP | denotes | UK |
T5289 | 16574-16575 | -RRB- | denotes | ) |
T5290 | 16576-16580 | IN | denotes | with |
T5291 | 16581-16588 | VB | denotes | cycling |
T5292 | 16589-16599 | NN | denotes | parameters |
T5293 | 16600-16602 | IN | denotes | of |
T5294 | 16603-16607 | NN | denotes | 72°C |
T5295 | 16608-16611 | IN | denotes | for |
T5296 | 16612-16614 | CD | denotes | 10 |
T5297 | 16615-16618 | NN | denotes | min |
T5298 | 16618-16619 | -COMMA- | denotes | , |
T5301 | 16630-16632 | IN | denotes | at |
T5302 | 16633-16637 | NN | denotes | 94°C |
T5303 | 16638-16641 | IN | denotes | for |
T5304 | 16642-16644 | CD | denotes | 45 |
T5305 | 16645-16646 | NN | denotes | s |
T5306 | 16646-16647 | -COMMA- | denotes | , |
T5307 | 16648-16652 | NN | denotes | 52°C |
T5308 | 16653-16656 | IN | denotes | for |
T5309 | 16657-16659 | CD | denotes | 45 |
T5310 | 16660-16661 | NN | denotes | s |
T5311 | 16661-16662 | -COMMA- | denotes | , |
T5312 | 16663-16667 | NN | denotes | 72°C |
T5313 | 16668-16671 | IN | denotes | for |
T5314 | 16672-16674 | CD | denotes | 45 |
T5315 | 16675-16676 | NN | denotes | s |
T5499 | 16679-16688 | NN | denotes | GR-GATA-3 |
T5500 | 16689-16691 | IN | denotes | In |
T5501 | 16692-16697 | NNP | denotes | Vitro |
T5502 | 16698-16709 | NNP | denotes | Competition |
T5503 | 16710-16715 | NNP | denotes | Assay |
T5504 | 16716-16719 | IN | denotes | for |
T5505 | 16720-16730 | NNP | denotes | Importin-α |
T5506 | 16731-16732 | -LRB- | denotes | ( |
T5507 | 16732-16743 | JJ | denotes | Far-Western |
T5508 | 16744-16749 | NN | denotes | ELISA |
T5509 | 16749-16750 | -RRB- | denotes | ) |
T5510 | 16751-16769 | VB | denotes | Immunoprecipitated |
T5511 | 16770-16780 | JJ | denotes | importin-α |
T5512 | 16781-16782 | -LRB- | denotes | ( |
T5513 | 16782-16797 | JJ | denotes | anti-importin-α |
T5514 | 16797-16798 | -COMMA- | denotes | , |
T5515 | 16799-16804 | NNP | denotes | Santa |
T5516 | 16805-16809 | NNP | denotes | Cruz |
T5517 | 16810-16823 | NNP | denotes | Biotechnology |
T5518 | 16823-16824 | -RRB- | denotes | ) |
T5519 | 16825-16829 | IN | denotes | from |
T5520 | 16830-16836 | NN | denotes | HuT-78 |
T5521 | 16837-16842 | NN | denotes | cells |
T5522 | 16843-16846 | VB | denotes | was |
T5523 | 16847-16856 | VB | denotes | separated |
T5524 | 16857-16859 | IN | denotes | by |
T5525 | 16860-16868 | NN | denotes | SDS-PAGE |
T5526 | 16869-16872 | CC | denotes | and |
T5527 | 16873-16881 | VB | denotes | purified |
T5528 | 16882-16886 | IN | denotes | from |
T5529 | 16887-16890 | DT | denotes | the |
T5530 | 16891-16898 | VB | denotes | excised |
T5531 | 16899-16902 | NN | denotes | gel |
T5532 | 16903-16905 | IN | denotes | by |
T5533 | 16906-16920 | NN | denotes | electroelution |
T5534 | 16921-16922 | -LRB- | denotes | [ |
T5535 | 16922-16924 | CD | denotes | 36 |
T5536 | 16924-16925 | -RRB- | denotes | ] |
T5537 | 16927-16936 | RB | denotes | Similarly |
T5538 | 16936-16937 | -COMMA- | denotes | , |
T5539 | 16938-16944 | NN | denotes | GATA-3 |
T5540 | 16945-16948 | VB | denotes | was |
T5541 | 16949-16957 | VB | denotes | isolated |
T5542 | 16958-16962 | IN | denotes | from |
T5543 | 16963-16976 | JJ | denotes | nonstimulated |
T5544 | 16977-16983 | NN | denotes | HuT-78 |
T5545 | 16984-16989 | NN | denotes | cells |
T5546 | 16990-16992 | CC | denotes | or |
T5547 | 16993-16998 | NN | denotes | cells |
T5548 | 16999-17009 | VB | denotes | stimulated |
T5549 | 17010-17013 | IN | denotes | for |
T5550 | 17014-17016 | CD | denotes | 30 |
T5551 | 17017-17020 | NN | denotes | min |
T5552 | 17021-17025 | IN | denotes | with |
T5553 | 17026-17039 | JJ | denotes | anti-CD3/CD28 |
T5554 | 17040-17043 | CC | denotes | and |
T5555 | 17044-17046 | NN | denotes | GR |
T5556 | 17047-17050 | VB | denotes | was |
T5557 | 17051-17059 | VB | denotes | isolated |
T5558 | 17060-17064 | IN | denotes | from |
T5559 | 17065-17067 | NN | denotes | FP |
T5560 | 17068-17069 | -LRB- | denotes | ( |
T5561 | 17069-17073 | CD | denotes | 10−8 |
T5562 | 17074-17075 | NN | denotes | M |
T5563 | 17075-17076 | -COMMA- | denotes | , |
T5564 | 17077-17079 | CD | denotes | 30 |
T5565 | 17080-17083 | NN | denotes | min |
T5566 | 17083-17084 | -RRB- | denotes | ) |
T5567 | 17085-17095 | VB | denotes | stimulated |
T5568 | 17096-17102 | NN | denotes | HuT-78 |
T5569 | 17103-17108 | NN | denotes | cells |
T5570 | 17110-17115 | DT | denotes | These |
T5571 | 17116-17124 | NN | denotes | proteins |
T5572 | 17125-17129 | VB | denotes | were |
T5573 | 17130-17142 | RB | denotes | subsequently |
T5574 | 17143-17151 | VB | denotes | refolded |
T5575 | 17152-17154 | IN | denotes | in |
T5576 | 17155-17162 | NN | denotes | glycine |
T5577 | 17163-17171 | NN | denotes | solution |
T5578 | 17173-17176 | CD | denotes | 100 |
T5579 | 17177-17179 | NN | denotes | µl |
T5580 | 17180-17182 | IN | denotes | of |
T5581 | 17183-17193 | JJ | denotes | importin-α |
T5582 | 17194-17202 | NN | denotes | solution |
T5583 | 17203-17204 | -LRB- | denotes | ( |
T5584 | 17204-17207 | CD | denotes | 100 |
T5585 | 17208-17213 | NN | denotes | ng/ml |
T5586 | 17214-17216 | IN | denotes | in |
T5587 | 17217-17220 | NN | denotes | TBS |
T5588 | 17220-17221 | -RRB- | denotes | ) |
T5589 | 17222-17225 | VB | denotes | was |
T5590 | 17226-17231 | VB | denotes | added |
T5591 | 17232-17234 | TO | denotes | to |
T5592 | 17235-17242 | JJ | denotes | 96-well |
T5593 | 17243-17249 | NN | denotes | plates |
T5594 | 17250-17256 | VB | denotes | coated |
T5595 | 17257-17261 | IN | denotes | with |
T5596 | 17262-17266 | NN | denotes | goat |
T5597 | 17267-17282 | JJ | denotes | anti-importin-α |
T5598 | 17283-17291 | NN | denotes | antibody |
T5599 | 17293-17298 | IN | denotes | After |
T5600 | 17299-17300 | CD | denotes | 1 |
T5601 | 17301-17302 | NN | denotes | h |
T5602 | 17303-17313 | NN | denotes | incubation |
T5603 | 17313-17314 | -COMMA- | denotes | , |
T5604 | 17315-17321 | NN | denotes | GATA-3 |
T5605 | 17322-17323 | -LRB- | denotes | ( |
T5606 | 17323-17326 | CD | denotes | 100 |
T5607 | 17327-17332 | NN | denotes | ng/ml |
T5608 | 17333-17335 | IN | denotes | in |
T5609 | 17336-17339 | NN | denotes | TBS |
T5610 | 17339-17340 | -RRB- | denotes | ) |
T5611 | 17341-17345 | IN | denotes | from |
T5612 | 17346-17356 | VB | denotes | stimulated |
T5613 | 17357-17359 | CC | denotes | or |
T5614 | 17360-17372 | JJ | denotes | unstimulated |
T5615 | 17373-17378 | NN | denotes | cells |
T5616 | 17379-17383 | VB | denotes | were |
T5617 | 17384-17389 | VB | denotes | added |
T5618 | 17390-17392 | TO | denotes | to |
T5619 | 17393-17396 | DT | denotes | the |
T5620 | 17397-17414 | JJ | denotes | importin-α-coated |
T5621 | 17415-17420 | NN | denotes | wells |
T5622 | 17422-17424 | NN | denotes | GR |
T5623 | 17425-17426 | -LRB- | denotes | ( |
T5624 | 17426-17428 | CD | denotes | 10 |
T5625 | 17429-17431 | CC | denotes | or |
T5626 | 17432-17435 | CD | denotes | 100 |
T5627 | 17436-17441 | NN | denotes | ng/ml |
T5628 | 17442-17444 | IN | denotes | in |
T5629 | 17445-17448 | NN | denotes | TBS |
T5630 | 17448-17449 | -RRB- | denotes | ) |
T5631 | 17450-17454 | IN | denotes | from |
T5632 | 17455-17465 | VB | denotes | stimulated |
T5633 | 17466-17468 | CC | denotes | or |
T5634 | 17469-17481 | JJ | denotes | unstimulated |
T5635 | 17482-17487 | NN | denotes | cells |
T5636 | 17488-17492 | VB | denotes | were |
T5637 | 17493-17498 | VB | denotes | added |
T5638 | 17499-17501 | TO | denotes | to |
T5639 | 17502-17506 | DT | denotes | some |
T5640 | 17507-17512 | NN | denotes | wells |
T5641 | 17514-17519 | IN | denotes | After |
T5642 | 17520-17521 | DT | denotes | a |
T5643 | 17522-17529 | JJ | denotes | further |
T5644 | 17530-17531 | CD | denotes | 1 |
T5645 | 17532-17533 | NN | denotes | h |
T5646 | 17534-17544 | NN | denotes | incubation |
T5647 | 17544-17545 | -COMMA- | denotes | , |
T5648 | 17546-17549 | DT | denotes | the |
T5649 | 17550-17555 | NN | denotes | plate |
T5650 | 17556-17559 | VB | denotes | was |
T5651 | 17560-17566 | VB | denotes | washed |
T5652 | 17567-17570 | CC | denotes | and |
T5653 | 17571-17580 | VB | denotes | incubated |
T5654 | 17581-17585 | IN | denotes | with |
T5655 | 17586-17593 | JJ | denotes | primary |
T5656 | 17594-17604 | NN | denotes | antibodies |
T5657 | 17605-17606 | -LRB- | denotes | ( |
T5658 | 17606-17607 | DT | denotes | a |
T5659 | 17608-17615 | NN | denotes | mixture |
T5660 | 17616-17618 | IN | denotes | of |
T5661 | 17619-17625 | NN | denotes | rabbit |
T5662 | 17626-17637 | NN | denotes | anti-GATA-3 |
T5663 | 17638-17641 | CC | denotes | and |
T5664 | 17642-17647 | NN | denotes | mouse |
T5665 | 17648-17655 | NN | denotes | anti-GR |
T5666 | 17655-17656 | -COMMA- | denotes | , |
T5667 | 17657-17662 | NNP | denotes | Santa |
T5668 | 17663-17667 | NNP | denotes | Cruz |
T5669 | 17668-17681 | NNP | denotes | Biotechnology |
T5670 | 17681-17682 | -RRB- | denotes | ) |
T5671 | 17683-17686 | IN | denotes | for |
T5672 | 17687-17690 | CD | denotes | 1.5 |
T5673 | 17691-17692 | NN | denotes | h |
T5674 | 17692-17693 | -COMMA- | denotes | , |
T5675 | 17694-17697 | CC | denotes | and |
T5676 | 17698-17702 | RB | denotes | then |
T5677 | 17703-17712 | VB | denotes | incubated |
T5678 | 17713-17717 | IN | denotes | with |
T5679 | 17718-17727 | JJ | denotes | secondary |
T5680 | 17728-17738 | NN | denotes | antibodies |
T5681 | 17740-17744 | NN | denotes | FITC |
T5682 | 17745-17750 | NN | denotes | swine |
T5683 | 17751-17762 | JJ | denotes | anti-rabbit |
T5684 | 17763-17766 | NN | denotes | IgG |
T5685 | 17767-17768 | -LRB- | denotes | ( |
T5686 | 17768-17772 | NNP | denotes | Dako |
T5687 | 17772-17773 | -COMMA- | denotes | , |
T5688 | 17774-17783 | NNP | denotes | Cambridge |
T5689 | 17783-17784 | -COMMA- | denotes | , |
T5690 | 17785-17787 | NNP | denotes | UK |
T5691 | 17787-17788 | -RRB- | denotes | ) |
T5692 | 17789-17792 | VB | denotes | was |
T5693 | 17793-17797 | VB | denotes | used |
T5694 | 17798-17801 | IN | denotes | for |
T5695 | 17802-17805 | DT | denotes | the |
T5696 | 17806-17815 | NN | denotes | detection |
T5697 | 17816-17818 | IN | denotes | of |
T5698 | 17819-17825 | NN | denotes | GATA-3 |
T5699 | 17825-17826 | -COMMA- | denotes | , |
T5700 | 17827-17830 | CC | denotes | and |
T5701 | 17831-17840 | NN | denotes | rhodamine |
T5702 | 17841-17847 | NN | denotes | donkey |
T5703 | 17848-17858 | JJ | denotes | anti-mouse |
T5704 | 17859-17862 | NN | denotes | IgG |
T5705 | 17863-17864 | -LRB- | denotes | ( |
T5706 | 17864-17869 | NNP | denotes | Novus |
T5707 | 17869-17870 | -COMMA- | denotes | , |
T5708 | 17871-17880 | NNP | denotes | Littleton |
T5709 | 17880-17881 | -COMMA- | denotes | , |
T5710 | 17882-17890 | NNP | denotes | Colorado |
T5711 | 17890-17891 | -COMMA- | denotes | , |
T5712 | 17892-17895 | NNP | denotes | USA |
T5713 | 17895-17896 | -RRB- | denotes | ) |
T5714 | 17897-17900 | VB | denotes | was |
T5715 | 17901-17905 | VB | denotes | used |
T5716 | 17906-17909 | IN | denotes | for |
T5717 | 17910-17913 | DT | denotes | the |
T5718 | 17914-17923 | NN | denotes | detection |
T5719 | 17924-17926 | IN | denotes | of |
T5720 | 17927-17929 | NN | denotes | GR |
T5721 | 17931-17935 | NN | denotes | FITC |
T5722 | 17936-17939 | CC | denotes | and |
T5723 | 17940-17949 | NN | denotes | rhodamine |
T5724 | 17950-17956 | NN | denotes | levels |
T5725 | 17957-17961 | VB | denotes | were |
T5726 | 17962-17970 | VB | denotes | measured |
T5727 | 17971-17975 | IN | denotes | with |
T5728 | 17976-17977 | DT | denotes | a |
T5729 | 17978-17989 | JJ | denotes | fluorescent |
T5730 | 17990-18001 | NN | denotes | micro-plate |
T5731 | 18002-18008 | NN | denotes | reader |
T5732 | 18009-18010 | -LRB- | denotes | ( |
T5733 | 18010-18017 | NNP | denotes | Bioline |
T5734 | 18017-18018 | -COMMA- | denotes | , |
T5735 | 18019-18025 | NNP | denotes | London |
T5736 | 18025-18026 | -COMMA- | denotes | , |
T5737 | 18027-18029 | NNP | denotes | UK |
T5738 | 18029-18030 | -RRB- | denotes | ) |
T6080 | 18033-18038 | NN | denotes | NF-κB |
T6081 | 18039-18049 | NN | denotes | Activation |
T6082 | 18050-18055 | NN | denotes | NF-κB |
T6083 | 18056-18063 | NN | denotes | binding |
T6084 | 18064-18072 | NN | denotes | activity |
T6085 | 18073-18075 | IN | denotes | in |
T6086 | 18076-18083 | JJ | denotes | nuclear |
T6087 | 18084-18092 | NN | denotes | extracts |
T6088 | 18093-18096 | VB | denotes | was |
T6089 | 18097-18107 | VB | denotes | determined |
T6090 | 18108-18113 | VB | denotes | using |
T6091 | 18114-18116 | DT | denotes | an |
T6092 | 18117-18128 | JJ | denotes | ELISA-based |
T6093 | 18129-18132 | NN | denotes | kit |
T6094 | 18133-18134 | -LRB- | denotes | ( |
T6095 | 18134-18142 | NN | denotes | Trans-AM |
T6096 | 18143-18146 | NN | denotes | p65 |
T6097 | 18146-18147 | -COMMA- | denotes | , |
T6098 | 18148-18154 | NNP | denotes | Active |
T6099 | 18155-18160 | NNP | denotes | Motif |
T6100 | 18160-18161 | -COMMA- | denotes | , |
T6101 | 18162-18171 | NNP | denotes | Rixensart |
T6102 | 18171-18172 | -COMMA- | denotes | , |
T6103 | 18173-18180 | NNP | denotes | Belgium |
T6104 | 18180-18181 | -RRB- | denotes | ) |
T6105 | 18183-18185 | IN | denotes | In |
T6106 | 18186-18191 | NN | denotes | brief |
T6107 | 18191-18192 | -COMMA- | denotes | , |
T6108 | 18193-18194 | CD | denotes | 5 |
T6109 | 18195-18197 | NN | denotes | µg |
T6110 | 18198-18200 | IN | denotes | of |
T6111 | 18201-18208 | JJ | denotes | nuclear |
T6112 | 18209-18217 | NN | denotes | extracts |
T6113 | 18218-18222 | VB | denotes | were |
T6114 | 18223-18232 | VB | denotes | incubated |
T6115 | 18233-18237 | IN | denotes | with |
T6116 | 18238-18239 | DT | denotes | a |
T6117 | 18240-18245 | NN | denotes | plate |
T6118 | 18246-18252 | VB | denotes | coated |
T6119 | 18253-18257 | IN | denotes | with |
T6120 | 18258-18260 | DT | denotes | an |
T6121 | 18261-18266 | NN | denotes | NF-κB |
T6122 | 18267-18276 | NN | denotes | consensus |
T6123 | 18277-18292 | NN | denotes | oligonucleotide |
T6124 | 18294-18300 | NN | denotes | Plates |
T6125 | 18301-18305 | VB | denotes | were |
T6126 | 18306-18312 | VB | denotes | washed |
T6127 | 18313-18319 | IN | denotes | before |
T6128 | 18320-18328 | NN | denotes | addition |
T6129 | 18329-18331 | IN | denotes | of |
T6130 | 18332-18334 | DT | denotes | an |
T6131 | 18335-18343 | JJ | denotes | anti-p65 |
T6132 | 18344-18352 | NN | denotes | antibody |
T6133 | 18354-18362 | NN | denotes | Antibody |
T6134 | 18363-18370 | NN | denotes | binding |
T6135 | 18371-18374 | VB | denotes | was |
T6136 | 18375-18383 | VB | denotes | detected |
T6137 | 18384-18388 | IN | denotes | with |
T6138 | 18389-18390 | DT | denotes | a |
T6139 | 18391-18400 | JJ | denotes | secondary |
T6140 | 18401-18415 | JJ | denotes | HRP-conjugated |
T6141 | 18416-18424 | NN | denotes | antibody |
T6142 | 18425-18428 | CC | denotes | and |
T6143 | 18429-18438 | VB | denotes | developed |
T6144 | 18439-18443 | IN | denotes | with |
T6145 | 18444-18447 | NN | denotes | TMB |
T6146 | 18448-18457 | NN | denotes | substrate |
T6147 | 18459-18462 | DT | denotes | The |
T6148 | 18463-18472 | NN | denotes | intensity |
T6149 | 18473-18475 | IN | denotes | of |
T6150 | 18476-18479 | DT | denotes | the |
T6151 | 18480-18488 | NN | denotes | reaction |
T6152 | 18489-18492 | VB | denotes | was |
T6153 | 18493-18501 | VB | denotes | measured |
T6154 | 18502-18504 | IN | denotes | at |
T6155 | 18505-18508 | CD | denotes | 450 |
T6156 | 18509-18511 | NN | denotes | nm |
T6283 | 18514-18532 | NN | denotes | Immunofluorescence |
T6284 | 18533-18541 | NN | denotes | Staining |
T6285 | 18542-18560 | NN | denotes | Immunofluorescence |
T6286 | 18561-18569 | NN | denotes | staining |
T6287 | 18570-18573 | VB | denotes | was |
T6288 | 18574-18583 | VB | denotes | performed |
T6289 | 18584-18586 | IN | denotes | as |
T6290 | 18587-18597 | RB | denotes | previously |
T6291 | 18598-18607 | VB | denotes | described |
T6292 | 18608-18609 | -LRB- | denotes | [ |
T6293 | 18609-18611 | CD | denotes | 34 |
T6294 | 18611-18612 | -RRB- | denotes | ] |
T6295 | 18614-18617 | DT | denotes | All |
T6296 | 18618-18626 | NN | denotes | staining |
T6297 | 18627-18630 | VB | denotes | was |
T6298 | 18631-18640 | VB | denotes | performed |
T6299 | 18641-18643 | IN | denotes | at |
T6300 | 18644-18648 | NN | denotes | room |
T6301 | 18649-18660 | NN | denotes | temperature |
T6302 | 18661-18664 | CC | denotes | and |
T6303 | 18665-18670 | IN | denotes | under |
T6304 | 18671-18685 | NN | denotes | humidification |
T6305 | 18687-18692 | NN | denotes | Cells |
T6306 | 18693-18697 | VB | denotes | were |
T6307 | 18698-18707 | VB | denotes | collected |
T6308 | 18708-18711 | CC | denotes | and |
T6309 | 18712-18721 | NN | denotes | cytospins |
T6310 | 18722-18730 | VB | denotes | prepared |
T6311 | 18731-18733 | IN | denotes | in |
T6312 | 18734-18735 | DT | denotes | a |
T6313 | 18736-18750 | NN | denotes | cytocentrifuge |
T6314 | 18751-18752 | -LRB- | denotes | ( |
T6315 | 18752-18759 | NNP | denotes | Shandon |
T6316 | 18760-18762 | NNP | denotes | II |
T6317 | 18762-18763 | -COMMA- | denotes | , |
T6318 | 18764-18771 | NNP | denotes | Shandon |
T6319 | 18771-18772 | -COMMA- | denotes | , |
T6320 | 18773-18780 | NNP | denotes | Runcorn |
T6321 | 18780-18781 | -COMMA- | denotes | , |
T6322 | 18782-18784 | NNP | denotes | UK |
T6323 | 18784-18785 | -RRB- | denotes | ) |
T6324 | 18787-18792 | NN | denotes | Cells |
T6325 | 18793-18797 | VB | denotes | were |
T6326 | 18798-18811 | VB | denotes | permeabilized |
T6327 | 18811-18812 | -COMMA- | denotes | , |
T6328 | 18813-18820 | VB | denotes | blocked |
T6329 | 18820-18821 | -COMMA- | denotes | , |
T6330 | 18822-18825 | CC | denotes | and |
T6331 | 18826-18830 | RB | denotes | then |
T6332 | 18831-18840 | VB | denotes | incubated |
T6333 | 18841-18845 | IN | denotes | with |
T6334 | 18846-18848 | NN | denotes | GR |
T6335 | 18849-18850 | -LRB- | denotes | ( |
T6336 | 18850-18854 | CD | denotes | 1∶50 |
T6337 | 18855-18859 | NN | denotes | E-20 |
T6338 | 18860-18865 | NNP | denotes | Santa |
T6339 | 18866-18870 | NNP | denotes | Cruz |
T6340 | 18871-18884 | NNP | denotes | Biotechnology |
T6341 | 18884-18885 | -RRB- | denotes | ) |
T6342 | 18886-18888 | CC | denotes | or |
T6343 | 18889-18900 | NN | denotes | anti-GATA-3 |
T6344 | 18901-18902 | -LRB- | denotes | ( |
T6345 | 18902-18906 | NN | denotes | H-48 |
T6346 | 18906-18907 | -COLON- | denotes | ; |
T6347 | 18908-18913 | NNP | denotes | Santa |
T6348 | 18914-18918 | NNP | denotes | Cruz |
T6349 | 18919-18932 | NNP | denotes | Biotechnology |
T6350 | 18932-18933 | -RRB- | denotes | ) |
T6351 | 18934-18942 | NN | denotes | antibody |
T6352 | 18943-18946 | IN | denotes | for |
T6353 | 18947-18948 | CD | denotes | 1 |
T6354 | 18949-18950 | NN | denotes | h |
T6355 | 18951-18953 | IN | denotes | at |
T6356 | 18954-18958 | NN | denotes | room |
T6357 | 18959-18970 | NN | denotes | temperature |
T6358 | 18972-18977 | IN | denotes | After |
T6359 | 18978-18983 | CD | denotes | three |
T6360 | 18984-18990 | NN | denotes | washes |
T6361 | 18991-18993 | IN | denotes | in |
T6362 | 18994-19012 | JJ | denotes | phosphate-buffered |
T6363 | 19013-19019 | NN | denotes | saline |
T6364 | 19020-19021 | -LRB- | denotes | ( |
T6365 | 19021-19024 | NN | denotes | PBS |
T6366 | 19024-19025 | -RRB- | denotes | ) |
T6367 | 19025-19026 | -COMMA- | denotes | , |
T6368 | 19027-19032 | NN | denotes | cells |
T6369 | 19033-19037 | VB | denotes | were |
T6370 | 19038-19047 | VB | denotes | incubated |
T6371 | 19048-19052 | IN | denotes | with |
T6372 | 19053-19067 | NN | denotes | tetrarhodamine |
T6373 | 19068-19093 | VB | denotes | isothiocyanate–conjugated |
T6374 | 19094-19098 | NN | denotes | goat |
T6375 | 19099-19110 | JJ | denotes | anti-rabbit |
T6376 | 19111-19119 | NN | denotes | antibody |
T6377 | 19120-19121 | -LRB- | denotes | ( |
T6378 | 19121-19125 | NN | denotes | Dako |
T6379 | 19125-19126 | -RRB- | denotes | ) |
T6380 | 19128-19137 | NN | denotes | Cytospins |
T6381 | 19138-19142 | VB | denotes | were |
T6382 | 19143-19157 | VB | denotes | counterstained |
T6383 | 19158-19162 | IN | denotes | with |
T6384 | 19163-19165 | NN | denotes | 4′ |
T6385 | 19165-19166 | -COMMA- | denotes | , |
T6386 | 19166-19192 | NN | denotes | 6-diamidino-2-phenylindole |
T6387 | 19193-19208 | NN | denotes | dihydrochloride |
T6388 | 19209-19210 | -LRB- | denotes | ( |
T6389 | 19210-19214 | NN | denotes | DAPI |
T6390 | 19214-19215 | -RRB- | denotes | ) |
T6391 | 19215-19216 | -COMMA- | denotes | , |
T6392 | 19217-19218 | DT | denotes | a |
T6393 | 19219-19230 | JJ | denotes | fluorescent |
T6394 | 19231-19235 | JJ | denotes | blue |
T6395 | 19236-19243 | JJ | denotes | nuclear |
T6396 | 19244-19250 | NN | denotes | indole |
T6397 | 19251-19260 | NN | denotes | chromatin |
T6398 | 19261-19266 | NN | denotes | stain |
T6399 | 19266-19267 | -COMMA- | denotes | , |
T6400 | 19268-19271 | CC | denotes | and |
T6401 | 19272-19279 | VB | denotes | mounted |
T6402 | 19280-19282 | IN | denotes | in |
T6403 | 19283-19286 | NNP | denotes | PBS |
T6404 | 19286-19287 | -COLON- | denotes | : |
T6405 | 19287-19295 | NN | denotes | glycerol |
T6406 | 19296-19297 | -LRB- | denotes | ( |
T6407 | 19297-19302 | CD | denotes | 50∶50 |
T6408 | 19302-19303 | -RRB- | denotes | ) |
T6409 | 19305-19308 | DT | denotes | The |
T6410 | 19309-19323 | JJ | denotes | immunopositive |
T6411 | 19324-19330 | NN | denotes | signal |
T6412 | 19331-19334 | VB | denotes | was |
T6413 | 19335-19348 | VB | denotes | characterised |
T6414 | 19349-19354 | VB | denotes | using |
T6415 | 19355-19360 | NN | denotes | laser |
T6416 | 19361-19369 | NN | denotes | scanning |
T6417 | 19370-19378 | JJ | denotes | confocal |
T6418 | 19379-19389 | NN | denotes | microscopy |
T6419 | 19390-19392 | IN | denotes | on |
T6420 | 19393-19394 | DT | denotes | a |
T6421 | 19395-19400 | NNP | denotes | Leica |
T6422 | 19401-19404 | NNP | denotes | TCS |
T6423 | 19405-19410 | NNP | denotes | NT/SP |
T6424 | 19411-19422 | JJ | denotes | interactive |
T6425 | 19423-19428 | NN | denotes | laser |
T6426 | 19429-19438 | NN | denotes | cytometer |
T6427 | 19439-19447 | VB | denotes | equipped |
T6428 | 19448-19452 | IN | denotes | with |
T6429 | 19453-19461 | JJ | denotes | confocal |
T6430 | 19462-19468 | NN | denotes | optics |
T6431 | 19469-19470 | -LRB- | denotes | ( |
T6432 | 19470-19475 | NNP | denotes | Leica |
T6433 | 19476-19488 | NNP | denotes | Microsystems |
T6434 | 19488-19489 | -COMMA- | denotes | , |
T6435 | 19490-19497 | NNP | denotes | Wetzlar |
T6436 | 19497-19498 | -COMMA- | denotes | , |
T6437 | 19499-19506 | NNP | denotes | Germany |
T6438 | 19506-19507 | -RRB- | denotes | ) |
T6439 | 19509-19511 | TO | denotes | To |
T6440 | 19512-19521 | VB | denotes | determine |
T6441 | 19522-19525 | DT | denotes | the |
T6442 | 19526-19537 | NN | denotes | specificity |
T6443 | 19538-19540 | IN | denotes | of |
T6444 | 19541-19544 | DT | denotes | the |
T6445 | 19545-19555 | NN | denotes | antibodies |
T6446 | 19555-19556 | -COMMA- | denotes | , |
T6447 | 19557-19563 | NN | denotes | rabbit |
T6448 | 19564-19569 | NN | denotes | serum |
T6449 | 19570-19584 | NN | denotes | immunoglobulin |
T6450 | 19585-19586 | -LRB- | denotes | ( |
T6451 | 19586-19590 | NN | denotes | Dako |
T6452 | 19590-19591 | -RRB- | denotes | ) |
T6453 | 19592-19595 | CC | denotes | and |
T6454 | 19596-19605 | JJ | denotes | secondary |
T6455 | 19606-19616 | NN | denotes | antibodies |
T6456 | 19617-19624 | IN | denotes | without |
T6457 | 19625-19628 | DT | denotes | the |
T6458 | 19629-19636 | JJ | denotes | primary |
T6459 | 19637-19641 | VB | denotes | were |
T6460 | 19642-19646 | VB | denotes | used |
T6461 | 19647-19649 | IN | denotes | as |
T6462 | 19650-19658 | NN | denotes | controls |
T6463 | 19660-19670 | RB | denotes | Positively |
T6464 | 19671-19678 | VB | denotes | stained |
T6465 | 19679-19685 | NN | denotes | nuclei |
T6466 | 19686-19689 | CC | denotes | and |
T6467 | 19690-19695 | JJ | denotes | total |
T6468 | 19696-19701 | NN | denotes | cells |
T6469 | 19702-19706 | VB | denotes | were |
T6470 | 19707-19714 | VB | denotes | counted |
T6471 | 19715-19716 | -LRB- | denotes | ( |
T6472 | 19716-19719 | CD | denotes | 500 |
T6473 | 19719-19720 | -RRB- | denotes | ) |
T6474 | 19721-19723 | IN | denotes | on |
T6475 | 19724-19728 | DT | denotes | each |
T6476 | 19729-19734 | NN | denotes | slide |
T6477 | 19735-19739 | IN | denotes | with |
T6478 | 19740-19743 | DT | denotes | the |
T6479 | 19744-19752 | NN | denotes | observer |
T6480 | 19753-19760 | VB | denotes | blinded |
T6481 | 19761-19763 | TO | denotes | to |
T6482 | 19764-19767 | DT | denotes | the |
T6483 | 19768-19777 | NN | denotes | treatment |
T6779 | 19780-19790 | NN | denotes | GATA-3-GFP |
T6780 | 19791-19800 | NN | denotes | Construct |
T6781 | 19801-19804 | DT | denotes | The |
T6782 | 19805-19811 | NN | denotes | GATA-3 |
T6783 | 19812-19817 | NN | denotes | clone |
T6784 | 19818-19819 | -LRB- | denotes | ( |
T6785 | 19819-19827 | NN | denotes | BC003070 |
T6786 | 19827-19828 | -RRB- | denotes | ) |
T6787 | 19829-19837 | JJ | denotes | complete |
T6788 | 19838-19842 | NN | denotes | cDNA |
T6789 | 19843-19846 | VB | denotes | was |
T6790 | 19847-19855 | VB | denotes | obtained |
T6791 | 19856-19860 | IN | denotes | from |
T6792 | 19861-19871 | NNP | denotes | Invitrogen |
T6793 | 19872-19876 | NNP | denotes | Life |
T6794 | 19877-19889 | NNP | denotes | Technologies |
T6795 | 19890-19892 | IN | denotes | as |
T6796 | 19893-19894 | DT | denotes | a |
T6797 | 19895-19898 | JJ | denotes | 5′- |
T6798 | 19899-19912 | NN | denotes | EcoRI/3′-XhoI |
T6799 | 19913-19919 | NN | denotes | insert |
T6800 | 19920-19922 | IN | denotes | of |
T6801 | 19923-19929 | NN | denotes | GATA-3 |
T6802 | 19930-19932 | IN | denotes | in |
T6803 | 19933-19936 | DT | denotes | the |
T6804 | 19937-19942 | NN | denotes | pOTB7 |
T6805 | 19943-19949 | NN | denotes | vector |
T6806 | 19951-19957 | NN | denotes | GATA-3 |
T6807 | 19958-19961 | VB | denotes | was |
T6808 | 19962-19969 | VB | denotes | excised |
T6809 | 19970-19974 | IN | denotes | from |
T6810 | 19975-19980 | NN | denotes | pOTB7 |
T6811 | 19981-19986 | VB | denotes | using |
T6812 | 19987-19991 | NN | denotes | XhoI |
T6813 | 19992-20001 | NN | denotes | digestion |
T6814 | 20002-20005 | CC | denotes | and |
T6815 | 20006-20014 | NN | denotes | pEGFP-C2 |
T6816 | 20015-20016 | -LRB- | denotes | ( |
T6817 | 20016-20024 | NNP | denotes | Clontech |
T6818 | 20024-20025 | -COMMA- | denotes | , |
T6819 | 20026-20047 | NNP | denotes | Saint-Germain-en-Laye |
T6820 | 20047-20048 | -COMMA- | denotes | , |
T6821 | 20049-20055 | NNP | denotes | France |
T6822 | 20055-20056 | -RRB- | denotes | ) |
T6823 | 20057-20060 | VB | denotes | was |
T6824 | 20061-20069 | VB | denotes | digested |
T6825 | 20070-20074 | IN | denotes | with |
T6826 | 20075-20080 | NN | denotes | BamHI |
T6827 | 20082-20085 | NN | denotes | DNA |
T6828 | 20086-20089 | VB | denotes | was |
T6829 | 20090-20099 | VB | denotes | recovered |
T6830 | 20100-20102 | IN | denotes | by |
T6831 | 20103-20109 | NN | denotes | phenol |
T6832 | 20110-20120 | NN | denotes | extraction |
T6833 | 20121-20124 | CC | denotes | and |
T6834 | 20125-20132 | NN | denotes | ethanol |
T6835 | 20133-20146 | NN | denotes | precipitation |
T6836 | 20146-20147 | -COMMA- | denotes | , |
T6837 | 20148-20151 | CC | denotes | and |
T6838 | 20152-20156 | CC | denotes | both |
T6839 | 20157-20160 | DT | denotes | the |
T6840 | 20161-20167 | NN | denotes | GATA-3 |
T6841 | 20168-20176 | NN | denotes | fragment |
T6842 | 20177-20180 | CC | denotes | and |
T6843 | 20181-20184 | DT | denotes | the |
T6844 | 20185-20193 | NN | denotes | pEGFP-C2 |
T6845 | 20194-20200 | NN | denotes | vector |
T6846 | 20201-20212 | JJ | denotes | blunt-ended |
T6847 | 20213-20215 | IN | denotes | by |
T6848 | 20216-20226 | NN | denotes | incubation |
T6849 | 20227-20231 | IN | denotes | with |
T6850 | 20232-20238 | NNP | denotes | Klenow |
T6851 | 20239-20240 | -LRB- | denotes | ( |
T6852 | 20240-20247 | NN | denotes | Bioline |
T6853 | 20248-20257 | NN | denotes | Bio-27029 |
T6854 | 20257-20258 | -RRB- | denotes | ) |
T6855 | 20259-20262 | IN | denotes | for |
T6856 | 20263-20265 | CD | denotes | 30 |
T6857 | 20266-20269 | NN | denotes | min |
T6858 | 20270-20272 | IN | denotes | at |
T6859 | 20273-20278 | NNP | denotes | 37°C. |
T6860 | 20279-20285 | NNP | denotes | Klenow |
T6861 | 20286-20289 | VB | denotes | was |
T6862 | 20290-20301 | VB | denotes | inactivated |
T6863 | 20302-20304 | IN | denotes | by |
T6864 | 20305-20315 | NN | denotes | incubation |
T6865 | 20316-20319 | IN | denotes | for |
T6866 | 20320-20322 | CD | denotes | 10 |
T6867 | 20323-20326 | NN | denotes | min |
T6868 | 20327-20329 | IN | denotes | at |
T6869 | 20330-20335 | NNP | denotes | 75°C. |
T6870 | 20336-20339 | NN | denotes | DNA |
T6871 | 20340-20343 | VB | denotes | was |
T6872 | 20344-20353 | VB | denotes | recovered |
T6873 | 20354-20356 | IN | denotes | by |
T6874 | 20357-20363 | NN | denotes | phenol |
T6875 | 20364-20374 | NN | denotes | extraction |
T6876 | 20375-20378 | CC | denotes | and |
T6877 | 20379-20386 | NN | denotes | ethanol |
T6878 | 20387-20400 | NN | denotes | precipitation |
T6879 | 20400-20401 | -COMMA- | denotes | , |
T6880 | 20402-20405 | CC | denotes | and |
T6881 | 20406-20410 | CC | denotes | both |
T6882 | 20411-20414 | DT | denotes | the |
T6883 | 20415-20426 | JJ | denotes | blunt-ended |
T6884 | 20427-20433 | NN | denotes | GATA-3 |
T6885 | 20434-20442 | NN | denotes | fragment |
T6886 | 20443-20446 | CC | denotes | and |
T6887 | 20447-20450 | DT | denotes | the |
T6888 | 20451-20454 | NN | denotes | GFP |
T6889 | 20455-20461 | NN | denotes | vector |
T6890 | 20462-20466 | VB | denotes | were |
T6891 | 20467-20479 | RB | denotes | subsequently |
T6892 | 20480-20488 | VB | denotes | digested |
T6893 | 20489-20493 | IN | denotes | with |
T6894 | 20494-20499 | NN | denotes | EcoRI |
T6895 | 20500-20506 | IN | denotes | before |
T6896 | 20507-20510 | DT | denotes | the |
T6897 | 20511-20528 | JJ | denotes | 5′-EcoRI/3′–blunt |
T6898 | 20529-20532 | NN | denotes | end |
T6899 | 20533-20539 | NN | denotes | GATA-3 |
T6900 | 20540-20548 | NN | denotes | fragment |
T6901 | 20549-20552 | VB | denotes | was |
T6902 | 20553-20561 | VB | denotes | inserted |
T6903 | 20562-20566 | IN | denotes | into |
T6904 | 20567-20570 | DT | denotes | the |
T6905 | 20571-20588 | NN | denotes | 5′-EcoRI/3′–blunt |
T6906 | 20589-20594 | VB | denotes | ended |
T6907 | 20595-20598 | NN | denotes | GFP |
T6908 | 20599-20605 | NN | denotes | vector |
T6909 | 20607-20615 | JJ | denotes | Positive |
T6910 | 20616-20622 | NN | denotes | clones |
T6911 | 20623-20627 | VB | denotes | were |
T6912 | 20628-20637 | VB | denotes | confirmed |
T6913 | 20638-20640 | IN | denotes | by |
T6914 | 20641-20650 | NN | denotes | digestion |
T6915 | 20651-20654 | CC | denotes | and |
T6916 | 20655-20659 | NN | denotes | size |
T6917 | 20660-20668 | NN | denotes | analysis |
T6918 | 20669-20671 | IN | denotes | by |
T6919 | 20672-20673 | CD | denotes | 1 |
T6920 | 20673-20674 | NN | denotes | % |
T6921 | 20675-20682 | NN | denotes | agarose |
T6922 | 20683-20686 | NN | denotes | gel |
T6923 | 20687-20702 | NN | denotes | electrophoresis |
T6924 | 20703-20706 | CC | denotes | and |
T6925 | 20707-20709 | IN | denotes | by |
T6926 | 20710-20720 | NN | denotes | sequencing |
T7172 | 20723-20735 | NN | denotes | Transfection |
T7173 | 20736-20742 | NN | denotes | HuT-78 |
T7174 | 20743-20748 | NN | denotes | cells |
T7175 | 20749-20753 | VB | denotes | were |
T7176 | 20754-20765 | VB | denotes | transfected |
T7177 | 20766-20770 | IN | denotes | with |
T7178 | 20771-20777 | CC | denotes | either |
T7179 | 20778-20781 | NN | denotes | EP8 |
T7180 | 20782-20784 | CC | denotes | or |
T7181 | 20785-20788 | NN | denotes | GFP |
T7182 | 20789-20795 | NN | denotes | vector |
T7183 | 20796-20800 | RB | denotes | only |
T7184 | 20801-20804 | NN | denotes | DNA |
T7185 | 20805-20810 | VB | denotes | using |
T7186 | 20811-20819 | NN | denotes | solution |
T7187 | 20820-20821 | NNP | denotes | R |
T7188 | 20821-20822 | -COMMA- | denotes | , |
T7189 | 20823-20832 | NN | denotes | programme |
T7190 | 20833-20838 | NN | denotes | V-001 |
T7191 | 20839-20841 | IN | denotes | at |
T7192 | 20842-20843 | DT | denotes | a |
T7193 | 20844-20849 | NN | denotes | ratio |
T7194 | 20850-20852 | IN | denotes | of |
T7195 | 20853-20858 | CD | denotes | 3×106 |
T7196 | 20859-20866 | NN | denotes | cells/4 |
T7197 | 20867-20869 | VB | denotes | µg |
T7198 | 20870-20873 | NN | denotes | DNA |
T7199 | 20874-20877 | IN | denotes | for |
T7200 | 20878-20881 | CD | denotes | 7–8 |
T7201 | 20882-20883 | NN | denotes | h |
T7202 | 20884-20886 | IN | denotes | in |
T7203 | 20887-20895 | JJ | denotes | complete |
T7204 | 20896-20902 | NN | denotes | medium |
T7205 | 20903-20904 | -LRB- | denotes | ( |
T7206 | 20904-20906 | CD | denotes | 10 |
T7207 | 20906-20907 | NN | denotes | % |
T7208 | 20908-20914 | JJ | denotes | bovine |
T7209 | 20915-20920 | NN | denotes | serum |
T7210 | 20921-20923 | IN | denotes | in |
T7211 | 20924-20935 | NN | denotes | RPMI1640+15 |
T7212 | 20936-20947 | NN | denotes | L-glutamine |
T7213 | 20947-20948 | -RRB- | denotes | ) |
T7214 | 20949-20958 | VB | denotes | according |
T7215 | 20959-20961 | TO | denotes | to |
T7216 | 20962-20965 | DT | denotes | the |
T7217 | 20966-20973 | JJ | denotes | general |
T7218 | 20974-20979 | NNP | denotes | Amaxa |
T7219 | 20980-20988 | NN | denotes | protocol |
T7220 | 20989-20992 | IN | denotes | for |
T7221 | 20993-21006 | NN | denotes | nucleofection |
T7222 | 21008-21011 | DT | denotes | The |
T7223 | 21012-21018 | NN | denotes | medium |
T7224 | 21019-21022 | VB | denotes | was |
T7225 | 21023-21035 | RB | denotes | subsequently |
T7226 | 21036-21043 | VB | denotes | changed |
T7227 | 21044-21046 | TO | denotes | to |
T7228 | 21047-21048 | CD | denotes | 1 |
T7229 | 21048-21049 | NN | denotes | % |
T7230 | 21050-21054 | NN | denotes | RPMI |
T7231 | 21055-21058 | IN | denotes | for |
T7232 | 21059-21061 | CD | denotes | 24 |
T7233 | 21062-21063 | NN | denotes | h |
T7234 | 21064-21070 | IN | denotes | before |
T7235 | 21071-21082 | VB | denotes | transfected |
T7236 | 21083-21088 | NN | denotes | cells |
T7237 | 21089-21093 | VB | denotes | were |
T7238 | 21094-21099 | VB | denotes | added |
T7239 | 21100-21102 | TO | denotes | to |
T7240 | 21103-21116 | JJ | denotes | anti-CD3/CD28 |
T7241 | 21117-21124 | VB | denotes | treated |
T7242 | 21125-21130 | NN | denotes | wells |
T7243 | 21131-21134 | CC | denotes | and |
T7244 | 21135-21139 | JJ | denotes | live |
T7245 | 21140-21144 | NN | denotes | cell |
T7246 | 21145-21160 | NN | denotes | videomicroscopy |
T7247 | 21161-21170 | VB | denotes | performed |
T7357 | 21173-21183 | NNP | denotes | Time-Lapse |
T7358 | 21184-21194 | NNP | denotes | Microscopy |
T7359 | 21195-21201 | NN | denotes | HuT-78 |
T7360 | 21202-21207 | NN | denotes | cells |
T7361 | 21208-21218 | VB | denotes | expressing |
T7362 | 21219-21229 | NN | denotes | GATA-3-GFP |
T7363 | 21230-21234 | VB | denotes | were |
T7364 | 21235-21245 | VB | denotes | maintained |
T7365 | 21246-21248 | IN | denotes | at |
T7366 | 21249-21253 | NN | denotes | 37°C |
T7367 | 21254-21256 | IN | denotes | in |
T7368 | 21257-21263 | NN | denotes | growth |
T7369 | 21264-21270 | NN | denotes | medium |
T7370 | 21271-21273 | IN | denotes | in |
T7371 | 21274-21275 | DT | denotes | a |
T7372 | 21276-21282 | JJ | denotes | closed |
T7373 | 21283-21287 | NN | denotes | FCS2 |
T7374 | 21288-21297 | NN | denotes | perfusion |
T7375 | 21298-21305 | NN | denotes | chamber |
T7376 | 21306-21307 | -LRB- | denotes | ( |
T7377 | 21307-21316 | NNP | denotes | Bioptechs |
T7378 | 21316-21317 | -COMMA- | denotes | , |
T7379 | 21318-21324 | NNP | denotes | Butler |
T7380 | 21324-21325 | -COMMA- | denotes | , |
T7381 | 21326-21338 | NNP | denotes | Pennsylvania |
T7382 | 21338-21339 | -COMMA- | denotes | , |
T7383 | 21340-21343 | NNP | denotes | USA |
T7384 | 21343-21344 | -RRB- | denotes | ) |
T7385 | 21345-21353 | VB | denotes | combined |
T7386 | 21354-21358 | IN | denotes | with |
T7387 | 21359-21361 | DT | denotes | an |
T7388 | 21362-21371 | JJ | denotes | objective |
T7389 | 21372-21378 | NN | denotes | heater |
T7390 | 21379-21380 | -LRB- | denotes | ( |
T7391 | 21380-21389 | NN | denotes | Bioptechs |
T7392 | 21389-21390 | -RRB- | denotes | ) |
T7393 | 21391-21393 | IN | denotes | on |
T7394 | 21394-21397 | DT | denotes | the |
T7395 | 21398-21403 | NN | denotes | stage |
T7396 | 21404-21405 | DT | denotes | a |
T7397 | 21406-21411 | NNP | denotes | Zeiss |
T7398 | 21412-21420 | NNP | denotes | Axiovert |
T7399 | 21421-21424 | CD | denotes | 200 |
T7400 | 21425-21435 | NN | denotes | microscope |
T7401 | 21436-21437 | -LRB- | denotes | ( |
T7402 | 21437-21446 | NNP | denotes | Thornwood |
T7403 | 21446-21447 | -COMMA- | denotes | , |
T7404 | 21448-21451 | NNP | denotes | New |
T7405 | 21452-21456 | NNP | denotes | York |
T7406 | 21456-21457 | -COMMA- | denotes | , |
T7407 | 21458-21461 | NNP | denotes | USA |
T7408 | 21461-21462 | -RRB- | denotes | ) |
T7409 | 21464-21476 | NN | denotes | Observations |
T7410 | 21477-21481 | VB | denotes | were |
T7411 | 21482-21486 | VB | denotes | made |
T7412 | 21487-21489 | IN | denotes | by |
T7413 | 21490-21496 | CD | denotes | 40×1.0 |
T7414 | 21497-21499 | NN | denotes | NA |
T7415 | 21500-21513 | NN | denotes | oil-immersion |
T7416 | 21514-21523 | JJ | denotes | objective |
T7417 | 21524-21528 | NN | denotes | lens |
T7418 | 21528-21529 | -COMMA- | denotes | , |
T7419 | 21530-21533 | CC | denotes | and |
T7420 | 21534-21546 | NN | denotes | fluorescence |
T7421 | 21547-21550 | CC | denotes | and |
T7422 | 21551-21556 | NN | denotes | phase |
T7423 | 21557-21565 | NN | denotes | contrast |
T7424 | 21566-21572 | NN | denotes | images |
T7425 | 21573-21577 | VB | denotes | were |
T7426 | 21578-21586 | VB | denotes | gathered |
T7427 | 21587-21592 | VB | denotes | using |
T7428 | 21593-21594 | DT | denotes | a |
T7429 | 21595-21604 | NNP | denotes | Hamamatsu |
T7430 | 21605-21612 | NNP | denotes | ORCA-ER |
T7431 | 21613-21620 | VB | denotes | charged |
T7432 | 21621-21628 | VB | denotes | coupled |
T7433 | 21629-21635 | NN | denotes | device |
T7434 | 21636-21642 | NN | denotes | camera |
T7435 | 21643-21644 | -LRB- | denotes | ( |
T7436 | 21644-21655 | NNP | denotes | Bridgewater |
T7437 | 21655-21656 | -COMMA- | denotes | , |
T7438 | 21657-21660 | NNP | denotes | New |
T7439 | 21661-21667 | NNP | denotes | Jersey |
T7440 | 21667-21668 | -COMMA- | denotes | , |
T7441 | 21669-21672 | NNP | denotes | USA |
T7442 | 21672-21673 | -RRB- | denotes | ) |
T7443 | 21674-21680 | VB | denotes | driven |
T7444 | 21681-21683 | IN | denotes | by |
T7445 | 21684-21691 | NN | denotes | Openlab |
T7446 | 21692-21700 | NN | denotes | software |
T7447 | 21701-21702 | -LRB- | denotes | ( |
T7448 | 21702-21713 | NNP | denotes | Improvision |
T7449 | 21713-21714 | -COMMA- | denotes | , |
T7450 | 21715-21723 | NNP | denotes | Coventry |
T7451 | 21723-21724 | -COMMA- | denotes | , |
T7452 | 21725-21727 | NNP | denotes | UK |
T7453 | 21727-21728 | -RRB- | denotes | ) |
T7454 | 21730-21741 | NN | denotes | Photographs |
T7455 | 21742-21746 | VB | denotes | were |
T7456 | 21747-21752 | VB | denotes | taken |
T7457 | 21753-21755 | IN | denotes | at |
T7458 | 21756-21757 | CD | denotes | 0 |
T7459 | 21757-21758 | -COMMA- | denotes | , |
T7460 | 21759-21761 | CD | denotes | 30 |
T7461 | 21761-21762 | -COMMA- | denotes | , |
T7462 | 21763-21765 | CD | denotes | 60 |
T7463 | 21765-21766 | -COMMA- | denotes | , |
T7464 | 21767-21770 | CD | denotes | 120 |
T7465 | 21770-21771 | -COMMA- | denotes | , |
T7466 | 21772-21775 | CC | denotes | and |
T7467 | 21776-21779 | CD | denotes | 240 |
T7468 | 21780-21783 | NN | denotes | min |
T7611 | 21786-21799 | JJ | denotes | Densitometric |
T7612 | 21800-21808 | NN | denotes | Analysis |
T7613 | 21809-21821 | NN | denotes | Densitometry |
T7614 | 21822-21824 | IN | denotes | of |
T7615 | 21825-21828 | NN | denotes | ECL |
T7616 | 21829-21840 | NN | denotes | immunoblots |
T7617 | 21841-21844 | VB | denotes | was |
T7618 | 21845-21854 | VB | denotes | performed |
T7619 | 21855-21860 | VB | denotes | using |
T7620 | 21861-21869 | NNP | denotes | Gelworks |
T7621 | 21870-21872 | NNP | denotes | ID |
T7622 | 21873-21885 | JJ | denotes | intermediate |
T7623 | 21886-21894 | NN | denotes | software |
T7624 | 21895-21896 | -LRB- | denotes | ( |
T7625 | 21896-21907 | NNP | denotes | Ultraviolet |
T7626 | 21908-21916 | NNP | denotes | Products |
T7627 | 21916-21917 | -COMMA- | denotes | , |
T7628 | 21918-21932 | NNP | denotes | Cambridgeshire |
T7629 | 21932-21933 | -COMMA- | denotes | , |
T7630 | 21934-21936 | NNP | denotes | UK |
T7631 | 21936-21937 | -RRB- | denotes | ) |
T7632 | 21939-21946 | RB | denotes | Briefly |
T7633 | 21946-21947 | -COMMA- | denotes | , |
T7634 | 21948-21959 | NN | denotes | immunoblots |
T7635 | 21960-21964 | VB | denotes | were |
T7636 | 21965-21972 | VB | denotes | scanned |
T7637 | 21973-21976 | CC | denotes | and |
T7638 | 21977-21982 | NN | denotes | gates |
T7639 | 21983-21987 | VB | denotes | were |
T7640 | 21988-21993 | VB | denotes | drawn |
T7641 | 21994-22001 | RB | denotes | tightly |
T7642 | 22002-22008 | IN | denotes | around |
T7643 | 22009-22013 | DT | denotes | each |
T7644 | 22014-22018 | NN | denotes | band |
T7645 | 22020-22030 | NN | denotes | Background |
T7646 | 22031-22037 | NN | denotes | values |
T7647 | 22038-22042 | IN | denotes | from |
T7648 | 22043-22047 | DT | denotes | each |
T7649 | 22048-22052 | NN | denotes | lane |
T7650 | 22053-22057 | VB | denotes | were |
T7651 | 22058-22068 | VB | denotes | subtracted |
T7652 | 22069-22071 | TO | denotes | to |
T7653 | 22072-22081 | VB | denotes | normalize |
T7654 | 22082-22086 | DT | denotes | each |
T7655 | 22087-22098 | NN | denotes | measurement |
T7656 | 22100-22103 | DT | denotes | The |
T7657 | 22104-22109 | NN | denotes | bands |
T7658 | 22110-22114 | VB | denotes | were |
T7659 | 22115-22125 | VB | denotes | quantified |
T7660 | 22126-22131 | VB | denotes | using |
T7661 | 22132-22135 | DT | denotes | the |
T7662 | 22136-22144 | NNP | denotes | Gelworks |
T7663 | 22145-22153 | NN | denotes | software |
T7664 | 22155-22158 | DT | denotes | All |
T7665 | 22159-22166 | JJ | denotes | Western |
T7666 | 22167-22172 | NN | denotes | blots |
T7667 | 22173-22177 | VB | denotes | were |
T7668 | 22178-22185 | VB | denotes | exposed |
T7669 | 22186-22188 | TO | denotes | to |
T7670 | 22189-22193 | VB | denotes | film |
T7671 | 22194-22197 | IN | denotes | for |
T7672 | 22198-22205 | VB | denotes | varying |
T7673 | 22206-22213 | NN | denotes | lengths |
T7674 | 22214-22216 | IN | denotes | of |
T7675 | 22217-22221 | NN | denotes | time |
T7676 | 22221-22222 | -COMMA- | denotes | , |
T7677 | 22223-22226 | CC | denotes | and |
T7678 | 22227-22231 | RB | denotes | only |
T7679 | 22232-22237 | NN | denotes | films |
T7680 | 22238-22248 | VB | denotes | generating |
T7681 | 22249-22262 | JJ | denotes | subsaturating |
T7682 | 22263-22269 | NN | denotes | levels |
T7683 | 22270-22272 | IN | denotes | of |
T7684 | 22273-22282 | NN | denotes | intensity |
T7685 | 22283-22287 | VB | denotes | were |
T7686 | 22288-22296 | VB | denotes | selected |
T7687 | 22297-22300 | IN | denotes | for |
T7688 | 22301-22314 | JJ | denotes | densitometric |
T7689 | 22315-22325 | NN | denotes | evaluation |
T7787 | 22328-22339 | JJ | denotes | Statistical |
T7788 | 22340-22348 | NN | denotes | Analysis |
T7789 | 22349-22353 | NN | denotes | Data |
T7790 | 22354-22358 | IN | denotes | from |
T7791 | 22359-22364 | CD | denotes | three |
T7792 | 22365-22367 | CC | denotes | or |
T7793 | 22368-22372 | JJ | denotes | more |
T7794 | 22373-22384 | JJ | denotes | independent |
T7795 | 22385-22396 | NN | denotes | experiments |
T7796 | 22397-22400 | VB | denotes | are |
T7797 | 22401-22410 | VB | denotes | presented |
T7798 | 22411-22413 | IN | denotes | as |
T7799 | 22414-22417 | DT | denotes | the |
T7800 | 22418-22431 | NN | denotes | mean±standard |
T7801 | 22432-22437 | NN | denotes | error |
T7802 | 22438-22440 | IN | denotes | of |
T7803 | 22441-22444 | DT | denotes | the |
T7804 | 22445-22449 | JJ | denotes | mean |
T7805 | 22450-22451 | -LRB- | denotes | ( |
T7806 | 22451-22454 | NN | denotes | SEM |
T7807 | 22454-22455 | -RRB- | denotes | ) |
T7808 | 22455-22456 | -COMMA- | denotes | , |
T7809 | 22457-22463 | IN | denotes | except |
T7810 | 22464-22469 | WRB | denotes | where |
T7811 | 22470-22476 | VB | denotes | stated |
T7812 | 22477-22480 | CC | denotes | and |
T7813 | 22481-22485 | VB | denotes | were |
T7814 | 22486-22494 | VB | denotes | compared |
T7815 | 22495-22500 | VB | denotes | using |
T7816 | 22501-22509 | NNP | denotes | GraphPad |
T7817 | 22510-22515 | NNP | denotes | Prism |
T7818 | 22516-22517 | CD | denotes | 4 |
T7819 | 22518-22519 | -LRB- | denotes | ( |
T7820 | 22519-22527 | NNP | denotes | GraphPad |
T7821 | 22528-22536 | NNP | denotes | Software |
T7822 | 22536-22537 | -COMMA- | denotes | , |
T7823 | 22538-22542 | NN | denotes | http |
T7824 | 22542-22543 | -COLON- | denotes | : |
T7825 | 22543-22561 | LS | denotes | //www.graphpad.com |
T7826 | 22561-22562 | -RRB- | denotes | ) |
T7827 | 22564-22571 | NN | denotes | Results |
T7828 | 22572-22576 | VB | denotes | were |
T7829 | 22577-22585 | VB | denotes | analysed |
T7830 | 22586-22591 | VB | denotes | using |
T7831 | 22592-22599 | JJ | denotes | one-way |
T7832 | 22600-22605 | NN | denotes | ANOVA |
T7833 | 22606-22610 | IN | denotes | with |
T7834 | 22611-22623 | NN | denotes | Newman-Keuls |
T7835 | 22624-22628 | NN | denotes | post |
T7836 | 22629-22633 | NN | denotes | test |
T7837 | 22634-22640 | IN | denotes | except |
T7838 | 22641-22644 | IN | denotes | for |
T7839 | 22645-22648 | DT | denotes | the |
T7840 | 22649-22653 | NN | denotes | data |
T7841 | 22654-22658 | IN | denotes | from |
T7842 | 22659-22662 | DT | denotes | the |
T7843 | 22663-22665 | FW | denotes | in |
T7844 | 22666-22670 | FW | denotes | vivo |
T7845 | 22671-22678 | VB | denotes | inhaled |
T7846 | 22679-22681 | NN | denotes | FP |
T7847 | 22682-22687 | NN | denotes | study |
T7848 | 22687-22688 | -COMMA- | denotes | , |
T7849 | 22689-22694 | WDT | denotes | which |
T7850 | 22695-22698 | VB | denotes | was |
T7851 | 22699-22707 | VB | denotes | analysed |
T7852 | 22708-22710 | IN | denotes | by |
T7853 | 22711-22719 | NNP | denotes | Friedman |
T7854 | 22719-22721 | POS | denotes | 's |
T7855 | 22722-22726 | NN | denotes | test |
T7856 | 22727-22731 | IN | denotes | with |
T7857 | 22732-22742 | JJ | denotes | subsequent |
T7858 | 22743-22752 | NNP | denotes | Wilcoxson |
T7859 | 22753-22760 | VB | denotes | matched |
T7860 | 22761-22765 | NN | denotes | pair |
T7861 | 22766-22772 | VB | denotes | signed |
T7862 | 22773-22777 | NN | denotes | rank |
T7863 | 22778-22781 | NN | denotes | sum |
T7864 | 22782-22786 | NN | denotes | test |
T7865 | 22788-22792 | NN | denotes | Data |
T7866 | 22793-22797 | IN | denotes | from |
T7867 | 22798-22802 | DT | denotes | this |
T7868 | 22803-22811 | NN | denotes | analysis |
T7869 | 22812-22815 | VB | denotes | are |
T7870 | 22816-22825 | VB | denotes | presented |
T7871 | 22826-22828 | IN | denotes | as |
T7872 | 22829-22830 | DT | denotes | a |
T7873 | 22831-22847 | NN | denotes | box-and-whiskers |
T7874 | 22848-22852 | NN | denotes | plot |
T7875 | 22854-22862 | NNP | denotes | Friedman |
T7876 | 22862-22864 | POS | denotes | 's |
T7877 | 22865-22869 | NN | denotes | test |
T7878 | 22870-22873 | VB | denotes | was |
T7879 | 22874-22878 | VB | denotes | used |
T7880 | 22879-22881 | IN | denotes | as |
T7881 | 22882-22887 | CD | denotes | three |
T7882 | 22888-22895 | JJ | denotes | matched |
T7883 | 22896-22904 | NN | denotes | measures |
T7884 | 22905-22909 | VB | denotes | were |
T7885 | 22910-22918 | VB | denotes | obtained |
T7886 | 22919-22924 | VB | denotes | using |
T7887 | 22925-22932 | NN | denotes | placebo |
T7888 | 22932-22933 | -COMMA- | denotes | , |
T7889 | 22934-22937 | CD | denotes | 100 |
T7890 | 22938-22940 | NN | denotes | µg |
T7891 | 22940-22941 | -COMMA- | denotes | , |
T7892 | 22942-22945 | CC | denotes | and |
T7893 | 22946-22949 | CD | denotes | 500 |
T7894 | 22950-22952 | NN | denotes | µg |
T7895 | 22953-22955 | IN | denotes | of |
T7896 | 22956-22963 | VB | denotes | inhaled |
T7897 | 22964-22966 | NN | denotes | FP |
T7898 | 22966-22967 | -COMMA- | denotes | , |
T7899 | 22968-22973 | WDT | denotes | which |
T7900 | 22974-22977 | VB | denotes | had |
T7901 | 22978-22986 | JJ | denotes | variable |
T7902 | 22987-22995 | NN | denotes | baseline |
T7903 | 22996-23002 | NN | denotes | levels |
T7904 | 23004-23006 | PRP | denotes | We |
T7905 | 23007-23010 | VB | denotes | did |
T7906 | 23011-23014 | RB | denotes | not |
T7907 | 23015-23021 | VB | denotes | assume |
T7908 | 23022-23023 | DT | denotes | a |
T7909 | 23024-23032 | JJ | denotes | Gaussian |
T7910 | 23033-23045 | NN | denotes | distribution |
T7911 | 23046-23048 | IN | denotes | of |
T7912 | 23049-23052 | DT | denotes | the |
T7913 | 23053-23057 | NN | denotes | data |
T7914 | 23058-23061 | JJ | denotes | due |
T7915 | 23062-23064 | TO | denotes | to |
T7916 | 23065-23068 | DT | denotes | the |
T7917 | 23069-23076 | JJ | denotes | limited |
T7918 | 23077-23084 | NN | denotes | numbers |
T7919 | 23085-23087 | IN | denotes | of |
T7920 | 23088-23100 | NN | denotes | participants |
T7921 | 23101-23109 | VB | denotes | analysed |
T7922 | 23110-23111 | -LRB- | denotes | ( |
T7923 | 23111-23116 | CD | denotes | seven |
T7924 | 23116-23117 | -RRB- | denotes | ) |
T7925 | 23117-23121 | NN | denotes | .The |
T7926 | 23122-23126 | JJ | denotes | null |
T7927 | 23127-23137 | NN | denotes | hypothesis |
T7928 | 23138-23141 | VB | denotes | was |
T7929 | 23142-23150 | VB | denotes | rejected |
T7930 | 23151-23153 | IN | denotes | at |
T7931 | 23154-23155 | NN | denotes | p |
T7932 | 23155-23156 | SYM | denotes | < |
T7933 | 23156-23160 | CD | denotes | 0.05 |
T8245 | 23172-23175 | DT | denotes | The |
T8246 | 23176-23182 | NN | denotes | Effect |
T8247 | 23183-23185 | IN | denotes | of |
T8248 | 23186-23201 | NN | denotes | Corticosteroids |
T8249 | 23202-23204 | IN | denotes | on |
T8250 | 23205-23211 | NN | denotes | GATA-3 |
T8251 | 23212-23219 | JJ | denotes | Nuclear |
T8252 | 23220-23233 | NN | denotes | Translocation |
T8253 | 23234-23237 | CC | denotes | and |
T8254 | 23238-23242 | NN | denotes | IL-4 |
T8255 | 23243-23247 | NN | denotes | mRNA |
T8256 | 23248-23263 | NN | denotes | Corticosteroids |
T8257 | 23264-23267 | VB | denotes | are |
T8258 | 23268-23277 | JJ | denotes | effective |
T8259 | 23278-23280 | IN | denotes | in |
T8260 | 23281-23291 | VB | denotes | inhibiting |
T8261 | 23292-23308 | JJ | denotes | GATA-3-regulated |
T8262 | 23309-23313 | NN | denotes | IL-4 |
T8263 | 23314-23318 | NN | denotes | gene |
T8264 | 23319-23329 | NN | denotes | expression |
T8265 | 23330-23332 | FW | denotes | in |
T8266 | 23333-23338 | FW | denotes | vitro |
T8267 | 23339-23342 | CC | denotes | and |
T8268 | 23343-23345 | FW | denotes | in |
T8269 | 23346-23350 | FW | denotes | vivo |
T8270 | 23351-23352 | -LRB- | denotes | [ |
T8271 | 23352-23354 | CD | denotes | 32 |
T8272 | 23354-23355 | -RRB- | denotes | ] |
T8273 | 23357-23359 | PRP | denotes | We |
T8274 | 23360-23369 | RB | denotes | therefore |
T8275 | 23370-23382 | VB | denotes | investigated |
T8276 | 23383-23390 | IN | denotes | whether |
T8277 | 23391-23406 | NN | denotes | corticosteroids |
T8278 | 23407-23413 | VB | denotes | affect |
T8279 | 23414-23438 | JJ | denotes | anti-CD3/CD28–stimulated |
T8280 | 23439-23446 | JJ | denotes | nuclear |
T8281 | 23447-23453 | NN | denotes | import |
T8282 | 23454-23456 | IN | denotes | of |
T8283 | 23457-23463 | NN | denotes | GATA-3 |
T8284 | 23465-23476 | NN | denotes | Stimulation |
T8285 | 23477-23479 | IN | denotes | of |
T8286 | 23480-23485 | NN | denotes | cells |
T8287 | 23486-23490 | IN | denotes | with |
T8288 | 23491-23504 | NN | denotes | anti-CD3/CD28 |
T8289 | 23505-23513 | VB | denotes | resulted |
T8290 | 23514-23516 | IN | denotes | in |
T8291 | 23517-23518 | DT | denotes | a |
T8292 | 23519-23524 | JJ | denotes | rapid |
T8293 | 23525-23544 | JJ | denotes | cytoplasmic/nuclear |
T8294 | 23545-23551 | NN | denotes | GATA-3 |
T8295 | 23552-23565 | NN | denotes | translocation |
T8296 | 23566-23567 | -LRB- | denotes | ( |
T8297 | 23567-23573 | NN | denotes | Figure |
T8298 | 23574-23576 | NN | denotes | 1A |
T8299 | 23576-23577 | -RRB- | denotes | ) |
T8300 | 23577-23578 | -COMMA- | denotes | , |
T8301 | 23579-23589 | VB | denotes | confirming |
T8302 | 23590-23593 | PRP-DOLLAR- | denotes | our |
T8303 | 23594-23602 | JJ | denotes | previous |
T8304 | 23603-23610 | NN | denotes | results |
T8305 | 23611-23612 | -LRB- | denotes | [ |
T8306 | 23612-23614 | CD | denotes | 12 |
T8307 | 23614-23615 | -RRB- | denotes | ] |
T8308 | 23617-23619 | PRP | denotes | We |
T8309 | 23620-23624 | RB | denotes | also |
T8310 | 23625-23634 | VB | denotes | confirmed |
T8311 | 23635-23636 | DT | denotes | a |
T8312 | 23637-23642 | JJ | denotes | clear |
T8313 | 23643-23653 | NN | denotes | separation |
T8314 | 23654-23656 | IN | denotes | of |
T8315 | 23657-23664 | JJ | denotes | nuclear |
T8316 | 23665-23668 | CC | denotes | and |
T8317 | 23669-23678 | JJ | denotes | cytosolic |
T8318 | 23679-23688 | NN | denotes | fractions |
T8319 | 23689-23691 | IN | denotes | as |
T8320 | 23692-23701 | VB | denotes | indicated |
T8321 | 23702-23704 | IN | denotes | by |
T8322 | 23705-23712 | NN | denotes | histone |
T8323 | 23713-23715 | NN | denotes | H1 |
T8324 | 23716-23719 | CC | denotes | and |
T8325 | 23720-23725 | NN | denotes | MEK-1 |
T8326 | 23726-23733 | NN | denotes | markers |
T8327 | 23734-23735 | -LRB- | denotes | ( |
T8328 | 23735-23741 | NN | denotes | Figure |
T8329 | 23742-23744 | NN | denotes | 1B |
T8330 | 23744-23745 | -RRB- | denotes | ) |
T8331 | 23747-23750 | DT | denotes | The |
T8332 | 23751-23757 | JJ | denotes | potent |
T8333 | 23758-23765 | JJ | denotes | topical |
T8334 | 23766-23780 | NN | denotes | corticosteroid |
T8335 | 23781-23783 | NN | denotes | FP |
T8336 | 23784-23790 | VB | denotes | caused |
T8337 | 23791-23800 | JJ | denotes | sustained |
T8338 | 23801-23805 | NN | denotes | loss |
T8339 | 23806-23808 | IN | denotes | of |
T8340 | 23809-23816 | JJ | denotes | nuclear |
T8341 | 23817-23823 | NN | denotes | GATA-3 |
T8342 | 23824-23834 | NN | denotes | expression |
T8343 | 23835-23838 | CC | denotes | and |
T8344 | 23839-23850 | JJ | denotes | cytoplasmic |
T8345 | 23851-23860 | NN | denotes | retention |
T8346 | 23861-23863 | IN | denotes | of |
T8347 | 23864-23870 | NN | denotes | GATA-3 |
T8348 | 23871-23873 | IN | denotes | at |
T8349 | 23874-23888 | NN | denotes | concentrations |
T8350 | 23889-23896 | VB | denotes | ranging |
T8351 | 23897-23901 | IN | denotes | from |
T8352 | 23902-23907 | CD | denotes | 10−12 |
T8353 | 23908-23910 | TO | denotes | to |
T8354 | 23911-23915 | CD | denotes | 10−8 |
T8355 | 23916-23917 | NN | denotes | M |
T8356 | 23917-23918 | -COMMA- | denotes | , |
T8357 | 23919-23924 | WDT | denotes | which |
T8358 | 23925-23930 | VB | denotes | cover |
T8359 | 23931-23934 | DT | denotes | the |
T8360 | 23935-23946 | JJ | denotes | therapeutic |
T8361 | 23947-23952 | NN | denotes | range |
T8362 | 23953-23954 | -LRB- | denotes | [ |
T8363 | 23954-23956 | CD | denotes | 37 |
T8364 | 23956-23957 | -RRB- | denotes | ] |
T8365 | 23959-23963 | DT | denotes | This |
T8366 | 23964-23970 | NN | denotes | effect |
T8367 | 23971-23974 | VB | denotes | was |
T8368 | 23975-23989 | NN | denotes | concentration- |
T8369 | 23990-23993 | CC | denotes | and |
T8370 | 23994-24008 | JJ | denotes | time-dependent |
T8371 | 24008-24009 | -COMMA- | denotes | , |
T8372 | 24010-24014 | IN | denotes | with |
T8373 | 24015-24016 | DT | denotes | a |
T8374 | 24017-24021 | JJ | denotes | peak |
T8375 | 24022-24028 | NN | denotes | effect |
T8376 | 24029-24031 | IN | denotes | of |
T8377 | 24032-24041 | RB | denotes | 11.6-fold |
T8378 | 24042-24044 | IN | denotes | at |
T8379 | 24045-24047 | CD | denotes | 30 |
T8380 | 24048-24051 | NN | denotes | min |
T8381 | 24052-24054 | IN | denotes | at |
T8382 | 24055-24056 | DT | denotes | a |
T8383 | 24057-24070 | NN | denotes | concentration |
T8384 | 24071-24073 | IN | denotes | of |
T8385 | 24074-24078 | CD | denotes | 10−8 |
T8386 | 24079-24080 | NN | denotes | M |
T8387 | 24081-24082 | -LRB- | denotes | ( |
T8388 | 24082-24088 | NN | denotes | Figure |
T8389 | 24089-24091 | NN | denotes | 1C |
T8390 | 24091-24092 | -RRB- | denotes | ) |
T8391 | 24093-24096 | CC | denotes | and |
T8392 | 24097-24100 | VB | denotes | was |
T8393 | 24101-24111 | VB | denotes | associated |
T8394 | 24112-24116 | IN | denotes | with |
T8395 | 24117-24123 | JJ | denotes | marked |
T8396 | 24124-24134 | NN | denotes | reductions |
T8397 | 24135-24137 | IN | denotes | in |
T8398 | 24138-24162 | JJ | denotes | anti-CD3/CD28–stimulated |
T8399 | 24163-24167 | NN | denotes | IL-4 |
T8400 | 24168-24171 | CC | denotes | and |
T8401 | 24172-24176 | NN | denotes | IL-5 |
T8402 | 24177-24181 | NN | denotes | mRNA |
T8403 | 24182-24192 | NN | denotes | expression |
T8404 | 24193-24194 | -LRB- | denotes | ( |
T8405 | 24194-24200 | NN | denotes | Figure |
T8406 | 24201-24203 | NN | denotes | 1D |
T8407 | 24203-24204 | -RRB- | denotes | ) |
T8408 | 24205-24208 | CC | denotes | and |
T8409 | 24209-24210 | DT | denotes | a |
T8410 | 24211-24215 | NN | denotes | loss |
T8411 | 24216-24218 | IN | denotes | of |
T8412 | 24219-24225 | NN | denotes | GATA-3 |
T8413 | 24226-24233 | NN | denotes | binding |
T8414 | 24234-24236 | TO | denotes | to |
T8415 | 24237-24240 | DT | denotes | the |
T8416 | 24241-24247 | JJ | denotes | native |
T8417 | 24248-24252 | NN | denotes | IL-5 |
T8418 | 24253-24261 | NN | denotes | promoter |
T8419 | 24262-24263 | -LRB- | denotes | ( |
T8420 | 24263-24269 | NN | denotes | Figure |
T8421 | 24270-24272 | NN | denotes | 1E |
T8422 | 24272-24273 | -RRB- | denotes | ) |
T8946 | 25824-25840 | JJ | denotes | Ligand-Activated |
T8947 | 25841-25843 | NN | denotes | GR |
T8948 | 25844-25852 | VB | denotes | Competes |
T8949 | 25853-25857 | IN | denotes | with |
T8950 | 25858-25864 | NN | denotes | GATA-3 |
T8951 | 25865-25868 | IN | denotes | for |
T8952 | 25869-25879 | NN | denotes | Importin-α |
T8953 | 25880-25882 | PRP | denotes | We |
T8954 | 25883-25892 | VB | denotes | confirmed |
T8955 | 25893-25896 | CC | denotes | and |
T8956 | 25897-25905 | VB | denotes | extended |
T8957 | 25906-25914 | JJ | denotes | previous |
T8958 | 25915-25919 | NN | denotes | data |
T8959 | 25920-25921 | -LRB- | denotes | [ |
T8960 | 25921-25923 | CD | denotes | 20 |
T8961 | 25923-25924 | -RRB- | denotes | ] |
T8962 | 25925-25927 | TO | denotes | to |
T8963 | 25928-25932 | VB | denotes | show |
T8964 | 25933-25937 | IN | denotes | that |
T8965 | 25938-25954 | JJ | denotes | ligand-activated |
T8966 | 25955-25957 | NN | denotes | GR |
T8967 | 25958-25960 | RB | denotes | as |
T8968 | 25961-25965 | RB | denotes | well |
T8969 | 25966-25968 | IN | denotes | as |
T8970 | 25969-25975 | NN | denotes | GATA-3 |
T8971 | 25976-25980 | VB | denotes | uses |
T8972 | 25981-25991 | JJ | denotes | importin-α |
T8973 | 25992-25995 | IN | denotes | for |
T8974 | 25996-25999 | PRP-DOLLAR- | denotes | its |
T8975 | 26000-26007 | JJ | denotes | nuclear |
T8976 | 26008-26014 | NN | denotes | import |
T8977 | 26015-26016 | -LRB- | denotes | ( |
T8978 | 26016-26022 | NN | denotes | Figure |
T8979 | 26023-26025 | NN | denotes | 2A |
T8980 | 26026-26029 | CC | denotes | and |
T8981 | 26030-26032 | NN | denotes | 2B |
T8982 | 26032-26033 | -RRB- | denotes | ) |
T8983 | 26035-26039 | DT | denotes | This |
T8984 | 26040-26051 | NN | denotes | interaction |
T8985 | 26052-26059 | IN | denotes | between |
T8986 | 26060-26062 | NN | denotes | GR |
T8987 | 26063-26066 | CC | denotes | and |
T8988 | 26067-26077 | NN | denotes | importin-α |
T8989 | 26078-26081 | VB | denotes | was |
T8990 | 26082-26093 | JJ | denotes | significant |
T8991 | 26094-26096 | IN | denotes | at |
T8992 | 26097-26111 | NN | denotes | concentrations |
T8993 | 26112-26114 | RB | denotes | as |
T8994 | 26115-26118 | JJ | denotes | low |
T8995 | 26119-26121 | IN | denotes | as |
T8996 | 26122-26127 | CD | denotes | 10−12 |
T8997 | 26128-26129 | NN | denotes | M |
T8998 | 26130-26133 | CC | denotes | and |
T8999 | 26134-26137 | VB | denotes | was |
T9000 | 26138-26145 | JJ | denotes | maximal |
T9001 | 26146-26150 | IN | denotes | with |
T9002 | 26151-26155 | CD | denotes | 10−8 |
T9003 | 26156-26157 | NN | denotes | M |
T9004 | 26158-26160 | NN | denotes | FP |
T9005 | 26162-26172 | JJ | denotes | Subsequent |
T9006 | 26173-26175 | NN | denotes | GR |
T9007 | 26176-26183 | JJ | denotes | nuclear |
T9008 | 26184-26197 | NN | denotes | translocation |
T9009 | 26198-26201 | VB | denotes | was |
T9010 | 26202-26207 | JJ | denotes | rapid |
T9011 | 26208-26211 | CC | denotes | and |
T9012 | 26212-26221 | JJ | denotes | sustained |
T9013 | 26222-26224 | IN | denotes | at |
T9014 | 26225-26236 | JJ | denotes | significant |
T9015 | 26237-26243 | NN | denotes | levels |
T9016 | 26244-26247 | IN | denotes | for |
T9017 | 26248-26250 | IN | denotes | at |
T9018 | 26251-26256 | JJ | denotes | least |
T9019 | 26257-26259 | CD | denotes | 14 |
T9020 | 26260-26261 | NN | denotes | h |
T9021 | 26262-26263 | -LRB- | denotes | ( |
T9022 | 26263-26269 | NN | denotes | Figure |
T9023 | 26270-26272 | NN | denotes | 2B |
T9024 | 26272-26273 | -RRB- | denotes | ) |
T9025 | 26275-26280 | VB | denotes | Using |
T9026 | 26281-26291 | JJ | denotes | IP-Western |
T9027 | 26292-26300 | NN | denotes | blotting |
T9028 | 26301-26303 | PRP | denotes | we |
T9029 | 26304-26310 | VB | denotes | showed |
T9030 | 26311-26315 | IN | denotes | that |
T9031 | 26316-26318 | NN | denotes | FP |
T9032 | 26319-26321 | IN | denotes | at |
T9033 | 26322-26332 | CD | denotes | 10−12–10−8 |
T9034 | 26333-26334 | NN | denotes | M |
T9035 | 26335-26344 | VB | denotes | decreased |
T9036 | 26345-26348 | DT | denotes | the |
T9037 | 26349-26360 | NN | denotes | association |
T9038 | 26361-26368 | IN | denotes | between |
T9039 | 26369-26375 | NN | denotes | GATA-3 |
T9040 | 26376-26379 | CC | denotes | and |
T9041 | 26380-26390 | NN | denotes | importin-α |
T9042 | 26391-26398 | VB | denotes | induced |
T9043 | 26399-26401 | IN | denotes | by |
T9044 | 26402-26415 | JJ | denotes | anti-CD3/CD28 |
T9045 | 26416-26427 | NN | denotes | stimulation |
T9046 | 26428-26430 | IN | denotes | in |
T9047 | 26431-26432 | DT | denotes | a |
T9048 | 26433-26456 | JJ | denotes | concentration-dependent |
T9049 | 26457-26463 | NN | denotes | manner |
T9050 | 26464-26465 | -LRB- | denotes | ( |
T9051 | 26465-26471 | NN | denotes | Figure |
T9052 | 26472-26474 | NN | denotes | 2C |
T9053 | 26474-26475 | -RRB- | denotes | ) |
T9054 | 26477-26479 | IN | denotes | In |
T9055 | 26480-26488 | NN | denotes | addition |
T9056 | 26488-26489 | -COMMA- | denotes | , |
T9057 | 26490-26495 | VB | denotes | using |
T9058 | 26496-26508 | JJ | denotes | GFP-labelled |
T9059 | 26509-26515 | NN | denotes | GATA-3 |
T9060 | 26516-26519 | CC | denotes | and |
T9061 | 26520-26528 | JJ | denotes | confocal |
T9062 | 26529-26539 | NN | denotes | microscopy |
T9063 | 26540-26542 | PRP | denotes | we |
T9064 | 26543-26555 | VB | denotes | demonstrated |
T9065 | 26556-26560 | IN | denotes | that |
T9066 | 26561-26567 | NN | denotes | GATA-3 |
T9067 | 26568-26575 | JJ | denotes | nuclear |
T9068 | 26576-26582 | NN | denotes | import |
T9069 | 26583-26592 | VB | denotes | following |
T9070 | 26593-26606 | JJ | denotes | anti-CD3/CD28 |
T9071 | 26607-26618 | NN | denotes | stimulation |
T9072 | 26619-26622 | IN | denotes | for |
T9073 | 26623-26625 | CD | denotes | 30 |
T9074 | 26626-26629 | NN | denotes | min |
T9075 | 26630-26633 | VB | denotes | was |
T9076 | 26634-26644 | VB | denotes | attenuated |
T9077 | 26645-26647 | IN | denotes | by |
T9078 | 26648-26660 | NN | denotes | pretreatment |
T9079 | 26661-26665 | IN | denotes | with |
T9080 | 26666-26668 | NN | denotes | FP |
T9081 | 26669-26670 | -LRB- | denotes | ( |
T9082 | 26670-26674 | CD | denotes | 10−8 |
T9083 | 26675-26676 | NN | denotes | M |
T9084 | 26676-26677 | -RRB- | denotes | ) |
T9085 | 26678-26679 | -LRB- | denotes | ( |
T9086 | 26679-26685 | NN | denotes | Figure |
T9087 | 26686-26688 | NN | denotes | 2D |
T9088 | 26688-26689 | -RRB- | denotes | ) |
T9702 | 28251-28257 | NN | denotes | Effect |
T9703 | 28258-28260 | IN | denotes | on |
T9704 | 28261-28266 | NN | denotes | MKP-1 |
T9705 | 28267-28280 | NN | denotes | Dexamethasone |
T9706 | 28281-28289 | VB | denotes | inhibits |
T9707 | 28290-28293 | NN | denotes | p38 |
T9708 | 28294-28298 | NN | denotes | MAPK |
T9709 | 28299-28307 | NN | denotes | function |
T9710 | 28308-28310 | IN | denotes | in |
T9711 | 28311-28312 | DT | denotes | a |
T9712 | 28313-28317 | NN | denotes | cell |
T9713 | 28318-28331 | JJ | denotes | type–specific |
T9714 | 28332-28338 | NN | denotes | manner |
T9715 | 28339-28346 | IN | denotes | through |
T9716 | 28347-28350 | DT | denotes | the |
T9717 | 28351-28356 | JJ | denotes | rapid |
T9718 | 28357-28366 | NN | denotes | induction |
T9719 | 28367-28369 | IN | denotes | of |
T9720 | 28370-28373 | DT | denotes | the |
T9721 | 28374-28378 | JJ | denotes | dual |
T9722 | 28379-28385 | NN | denotes | kinase |
T9723 | 28386-28397 | NN | denotes | phosphatase |
T9724 | 28398-28403 | NN | denotes | MKP-1 |
T9725 | 28404-28405 | -LRB- | denotes | ( |
T9726 | 28405-28409 | NN | denotes | MAPK |
T9727 | 28410-28423 | NN | denotes | phosphatase-1 |
T9728 | 28423-28424 | -RRB- | denotes | ) |
T9729 | 28424-28425 | -COMMA- | denotes | , |
T9730 | 28426-28429 | CC | denotes | and |
T9731 | 28430-28434 | DT | denotes | this |
T9732 | 28435-28441 | NN | denotes | effect |
T9733 | 28442-28447 | VB | denotes | lasts |
T9734 | 28448-28451 | IN | denotes | for |
T9735 | 28452-28454 | RB | denotes | up |
T9736 | 28455-28457 | TO | denotes | to |
T9737 | 28458-28460 | CD | denotes | 24 |
T9738 | 28461-28462 | NN | denotes | h |
T9739 | 28463-28464 | -LRB- | denotes | [ |
T9740 | 28464-28466 | CD | denotes | 28 |
T9741 | 28466-28467 | -RRB- | denotes | ] |
T9742 | 28469-28471 | NN | denotes | FP |
T9743 | 28472-28473 | -LRB- | denotes | ( |
T9744 | 28473-28477 | CD | denotes | 10−8 |
T9745 | 28478-28479 | NN | denotes | M |
T9746 | 28479-28480 | -RRB- | denotes | ) |
T9747 | 28481-28490 | NN | denotes | treatment |
T9748 | 28491-28493 | IN | denotes | of |
T9749 | 28494-28500 | NN | denotes | HuT-78 |
T9750 | 28501-28506 | NN | denotes | cells |
T9751 | 28507-28516 | VB | denotes | activated |
T9752 | 28517-28519 | IN | denotes | by |
T9753 | 28520-28533 | JJ | denotes | anti-CD3/CD28 |
T9754 | 28534-28536 | FW | denotes | in |
T9755 | 28537-28542 | FW | denotes | vitro |
T9756 | 28543-28556 | RB | denotes | significantly |
T9757 | 28557-28566 | VB | denotes | decreased |
T9758 | 28567-28570 | NN | denotes | p38 |
T9759 | 28571-28575 | NN | denotes | MAPK |
T9760 | 28576-28591 | NN | denotes | phosphorylation |
T9761 | 28592-28593 | -LRB- | denotes | ( |
T9762 | 28593-28599 | NN | denotes | Figure |
T9763 | 28600-28602 | NN | denotes | 3A |
T9764 | 28602-28603 | -RRB- | denotes | ) |
T9765 | 28604-28607 | CC | denotes | and |
T9766 | 28608-28616 | NN | denotes | activity |
T9767 | 28617-28625 | VB | denotes | measured |
T9768 | 28626-28628 | IN | denotes | by |
T9769 | 28629-28644 | NN | denotes | phosphorylation |
T9770 | 28645-28647 | IN | denotes | of |
T9771 | 28648-28651 | DT | denotes | the |
T9772 | 28652-28662 | JJ | denotes | downstream |
T9773 | 28663-28669 | NN | denotes | target |
T9774 | 28670-28675 | NN | denotes | ATF-2 |
T9775 | 28676-28677 | -LRB- | denotes | ( |
T9776 | 28677-28683 | NN | denotes | Figure |
T9777 | 28684-28686 | NN | denotes | 3B |
T9778 | 28686-28687 | -RRB- | denotes | ) |
T9779 | 28689-28693 | DT | denotes | This |
T9780 | 28694-28700 | NN | denotes | effect |
T9781 | 28701-28704 | VB | denotes | was |
T9782 | 28705-28713 | VB | denotes | detected |
T9783 | 28714-28716 | IN | denotes | at |
T9784 | 28717-28719 | CD | denotes | 30 |
T9785 | 28720-28723 | NN | denotes | min |
T9786 | 28724-28727 | CC | denotes | and |
T9787 | 28728-28734 | VB | denotes | lasted |
T9788 | 28735-28738 | IN | denotes | for |
T9789 | 28739-28741 | IN | denotes | at |
T9790 | 28742-28747 | JJ | denotes | least |
T9791 | 28748-28750 | CD | denotes | 14 |
T9792 | 28751-28752 | NN | denotes | h |
T9793 | 28753-28754 | -LRB- | denotes | ( |
T9794 | 28754-28760 | NN | denotes | Figure |
T9795 | 28761-28763 | NN | denotes | 3B |
T9796 | 28763-28764 | -RRB- | denotes | ) |
T9797 | 28766-28768 | NN | denotes | FP |
T9798 | 28769-28770 | -LRB- | denotes | ( |
T9799 | 28770-28774 | CD | denotes | 10−8 |
T9800 | 28775-28776 | NN | denotes | M |
T9801 | 28776-28777 | -RRB- | denotes | ) |
T9802 | 28778-28782 | RB | denotes | also |
T9803 | 28783-28796 | RB | denotes | significantly |
T9804 | 28797-28804 | VB | denotes | reduced |
T9805 | 28805-28811 | NN | denotes | GATA-3 |
T9806 | 28812-28818 | NN | denotes | serine |
T9807 | 28819-28834 | NN | denotes | phosphorylation |
T9808 | 28835-28842 | VB | denotes | induced |
T9809 | 28843-28845 | IN | denotes | by |
T9810 | 28846-28859 | JJ | denotes | anti-CD3/CD28 |
T9811 | 28860-28871 | NN | denotes | stimulation |
T9812 | 28872-28874 | IN | denotes | in |
T9813 | 28875-28879 | CC | denotes | both |
T9814 | 28880-28881 | DT | denotes | a |
T9815 | 28882-28887 | NN | denotes | time- |
T9816 | 28888-28891 | CC | denotes | and |
T9817 | 28892-28915 | JJ | denotes | concentration-dependent |
T9818 | 28916-28922 | NN | denotes | manner |
T9819 | 28923-28924 | -LRB- | denotes | ( |
T9820 | 28924-28930 | NN | denotes | Figure |
T9821 | 28931-28933 | NN | denotes | 3C |
T9822 | 28933-28934 | -RRB- | denotes | ) |
T9823 | 28936-28940 | DT | denotes | This |
T9824 | 28941-28950 | NN | denotes | reduction |
T9825 | 28951-28953 | IN | denotes | in |
T9826 | 28954-28960 | NN | denotes | GATA-3 |
T9827 | 28961-28976 | NN | denotes | phosphorylation |
T9828 | 28977-28980 | VB | denotes | was |
T9829 | 28981-28985 | RB | denotes | also |
T9830 | 28986-28990 | VB | denotes | seen |
T9831 | 28991-28995 | IN | denotes | with |
T9832 | 28996-29001 | JJ | denotes | lower |
T9833 | 29002-29016 | NN | denotes | concentrations |
T9834 | 29017-29019 | IN | denotes | of |
T9835 | 29020-29022 | NN | denotes | FP |
T9836 | 29024-29026 | PRP | denotes | We |
T9837 | 29027-29032 | VB | denotes | found |
T9838 | 29033-29037 | IN | denotes | that |
T9839 | 29038-29040 | NN | denotes | FP |
T9840 | 29041-29054 | RB | denotes | significantly |
T9841 | 29055-29062 | VB | denotes | induced |
T9842 | 29063-29068 | NN | denotes | MKP-1 |
T9843 | 29069-29073 | NN | denotes | mRNA |
T9844 | 29074-29076 | IN | denotes | in |
T9845 | 29077-29081 | CC | denotes | both |
T9846 | 29082-29083 | DT | denotes | a |
T9847 | 29084-29089 | NN | denotes | time- |
T9848 | 29090-29093 | CC | denotes | and |
T9849 | 29094-29117 | JJ | denotes | concentration-dependent |
T9850 | 29118-29124 | NN | denotes | manner |
T9851 | 29124-29125 | -COMMA- | denotes | , |
T9852 | 29126-29134 | VB | denotes | reaching |
T9853 | 29135-29136 | DT | denotes | a |
T9854 | 29137-29144 | NN | denotes | plateau |
T9855 | 29145-29147 | IN | denotes | at |
T9856 | 29148-29152 | CD | denotes | 10−8 |
T9857 | 29153-29154 | NN | denotes | M |
T9858 | 29155-29160 | IN | denotes | after |
T9859 | 29161-29163 | CD | denotes | 10 |
T9860 | 29164-29167 | NN | denotes | min |
T9861 | 29168-29169 | -LRB- | denotes | ( |
T9862 | 29169-29175 | NN | denotes | Figure |
T9863 | 29176-29178 | NN | denotes | 3D |
T9864 | 29179-29182 | CC | denotes | and |
T9865 | 29183-29185 | NN | denotes | 3E |
T9866 | 29185-29186 | -RRB- | denotes | ) |
T9867 | 29188-29195 | RB | denotes | However |
T9868 | 29195-29196 | -COMMA- | denotes | , |
T9869 | 29197-29200 | DT | denotes | the |
T9870 | 29201-29208 | NN | denotes | effects |
T9871 | 29209-29211 | IN | denotes | of |
T9872 | 29212-29214 | NN | denotes | FP |
T9873 | 29215-29217 | IN | denotes | on |
T9874 | 29218-29224 | NN | denotes | GATA-3 |
T9875 | 29225-29232 | JJ | denotes | nuclear |
T9876 | 29233-29239 | NN | denotes | import |
T9877 | 29239-29240 | -COMMA- | denotes | , |
T9878 | 29241-29251 | JJ | denotes | importin-α |
T9879 | 29252-29263 | NN | denotes | association |
T9880 | 29264-29267 | CC | denotes | and |
T9881 | 29268-29272 | NN | denotes | IL-4 |
T9882 | 29273-29277 | NN | denotes | mRNA |
T9883 | 29278-29288 | NN | denotes | expression |
T9884 | 29289-29292 | VB | denotes | are |
T9885 | 29293-29297 | VB | denotes | seen |
T9886 | 29298-29300 | IN | denotes | at |
T9887 | 29301-29312 | RB | denotes | 10,000-fold |
T9888 | 29313-29318 | JJ | denotes | lower |
T9889 | 29319-29333 | NN | denotes | concentrations |
T9890 | 29334-29335 | -LRB- | denotes | ( |
T9891 | 29335-29340 | CD | denotes | 10−12 |
T9892 | 29341-29342 | NN | denotes | M |
T9893 | 29342-29343 | -COMMA- | denotes | , |
T9894 | 29344-29347 | VB | denotes | see |
T9895 | 29348-29354 | NN | denotes | Figure |
T9896 | 29355-29356 | CD | denotes | 2 |
T9897 | 29356-29357 | -RRB- | denotes | ) |
T9898 | 30668-30673 | VB | denotes | Using |
T9899 | 30674-30676 | DT | denotes | an |
T9900 | 30677-30679 | FW | denotes | in |
T9901 | 30680-30685 | FW | denotes | vitro |
T9902 | 30686-30697 | NN | denotes | competition |
T9903 | 30698-30703 | NN | denotes | assay |
T9904 | 30704-30705 | -LRB- | denotes | ( |
T9905 | 30705-30711 | NN | denotes | Figure |
T9906 | 30712-30714 | NN | denotes | 4A |
T9907 | 30714-30715 | -RRB- | denotes | ) |
T9908 | 30716-30725 | VB | denotes | utilizing |
T9909 | 30726-30734 | VB | denotes | purified |
T9910 | 30735-30744 | VB | denotes | activated |
T9911 | 30745-30751 | NN | denotes | GATA-3 |
T9912 | 30751-30752 | -COMMA- | denotes | , |
T9913 | 30753-30763 | NN | denotes | importin-α |
T9914 | 30763-30764 | -COMMA- | denotes | , |
T9915 | 30765-30768 | CC | denotes | and |
T9916 | 30769-30778 | VB | denotes | activated |
T9917 | 30779-30781 | NN | denotes | GR |
T9918 | 30781-30782 | -COMMA- | denotes | , |
T9919 | 30783-30785 | PRP | denotes | we |
T9920 | 30786-30798 | VB | denotes | demonstrated |
T9921 | 30799-30803 | IN | denotes | that |
T9922 | 30804-30813 | VB | denotes | activated |
T9923 | 30814-30816 | NN | denotes | GR |
T9924 | 30817-30830 | RB | denotes | significantly |
T9925 | 30831-30840 | VB | denotes | increased |
T9926 | 30841-30854 | JJ | denotes | GR-importin-α |
T9927 | 30855-30866 | NN | denotes | association |
T9928 | 30867-30869 | IN | denotes | in |
T9929 | 30870-30873 | DT | denotes | the |
T9930 | 30874-30882 | NN | denotes | presence |
T9931 | 30883-30886 | CC | denotes | and |
T9932 | 30887-30894 | NN | denotes | absence |
T9933 | 30895-30897 | IN | denotes | of |
T9934 | 30898-30907 | VB | denotes | activated |
T9935 | 30908-30914 | NN | denotes | GATA-3 |
T9936 | 30915-30916 | -LRB- | denotes | ( |
T9937 | 30916-30922 | NN | denotes | Figure |
T9938 | 30923-30925 | NN | denotes | 4B |
T9939 | 30925-30926 | -RRB- | denotes | ) |
T9940 | 30928-30932 | DT | denotes | This |
T9941 | 30933-30939 | NN | denotes | effect |
T9942 | 30940-30942 | VB | denotes | is |
T9943 | 30943-30946 | RB | denotes | not |
T9944 | 30947-30953 | JJ | denotes | mutual |
T9945 | 30953-30954 | -COMMA- | denotes | , |
T9946 | 30955-30960 | IN | denotes | since |
T9947 | 30961-30970 | VB | denotes | activated |
T9948 | 30971-30977 | NN | denotes | GATA-3 |
T9949 | 30978-30981 | VB | denotes | did |
T9950 | 30982-30985 | RB | denotes | not |
T9951 | 30986-30991 | VB | denotes | block |
T9952 | 30992-31005 | JJ | denotes | GR–importin-α |
T9953 | 31006-31017 | NN | denotes | association |
T9954 | 31018-31019 | -LRB- | denotes | ( |
T9955 | 31019-31025 | NN | denotes | Figure |
T9956 | 31026-31028 | NN | denotes | 4C |
T9957 | 31028-31029 | -RRB- | denotes | ) |
T9958 | 31031-31036 | DT | denotes | These |
T9959 | 31037-31041 | NN | denotes | data |
T9960 | 31042-31046 | RB | denotes | also |
T9961 | 31047-31054 | VB | denotes | suggest |
T9962 | 31055-31059 | IN | denotes | that |
T9963 | 31060-31064 | CC | denotes | both |
T9964 | 31065-31074 | VB | denotes | activated |
T9965 | 31075-31077 | NN | denotes | GR |
T9966 | 31078-31081 | CC | denotes | and |
T9967 | 31082-31096 | NN | denotes | phospho-GATA-3 |
T9968 | 31097-31100 | MD | denotes | can |
T9969 | 31101-31109 | RB | denotes | directly |
T9970 | 31110-31119 | VB | denotes | associate |
T9971 | 31120-31124 | IN | denotes | with |
T9972 | 31125-31135 | JJ | denotes | importin-α |
T9973 | 31136-31137 | -LRB- | denotes | ( |
T9974 | 31137-31143 | NN | denotes | Figure |
T9975 | 31144-31146 | NN | denotes | 4D |
T9976 | 31146-31147 | -RRB- | denotes | ) |
T9977 | 31148-31151 | CC | denotes | and |
T9978 | 31152-31156 | IN | denotes | that |
T9979 | 31157-31166 | VB | denotes | activated |
T9980 | 31167-31169 | NN | denotes | GR |
T9981 | 31170-31180 | VB | denotes | attenuates |
T9982 | 31181-31184 | DT | denotes | the |
T9983 | 31185-31210 | JJ | denotes | phospho-GATA-3/importin-α |
T9984 | 31211-31222 | NN | denotes | interaction |
T9985 | 31223-31225 | IN | denotes | in |
T9986 | 31226-31227 | DT | denotes | a |
T9987 | 31228-31251 | JJ | denotes | concentration-dependent |
T9988 | 31252-31258 | NN | denotes | manner |
T9989 | 31259-31260 | -LRB- | denotes | ( |
T9990 | 31260-31266 | NN | denotes | Figure |
T9991 | 31267-31269 | NN | denotes | 4E |
T9992 | 31269-31270 | -RRB- | denotes | ) |
T9993 | 31272-31280 | RB | denotes | Together |
T9994 | 31280-31281 | -COMMA- | denotes | , |
T9995 | 31282-31286 | DT | denotes | this |
T9996 | 31287-31295 | VB | denotes | suggests |
T9997 | 31296-31300 | IN | denotes | that |
T9998 | 31301-31317 | JJ | denotes | ligand-activated |
T9999 | 31318-31320 | NN | denotes | GR |
T10000 | 31321-31324 | MD | denotes | may |
T10001 | 31325-31332 | VB | denotes | compete |
T10002 | 31333-31337 | IN | denotes | with |
T10003 | 31338-31352 | NN | denotes | phospho-GATA-3 |
T10004 | 31353-31356 | IN | denotes | for |
T10005 | 31357-31367 | JJ | denotes | importin-α |
T10006 | 31368-31371 | CC | denotes | and |
T10007 | 31372-31379 | RB | denotes | thereby |
T10008 | 31380-31385 | VB | denotes | limit |
T10009 | 31386-31392 | NN | denotes | GATA-3 |
T10010 | 31393-31400 | JJ | denotes | nuclear |
T10011 | 31401-31407 | NN | denotes | import |
T10012 | 32497-32502 | JJ | denotes | Other |
T10013 | 32503-32511 | JJ | denotes | possible |
T10014 | 32512-32527 | NN | denotes | interpretations |
T10015 | 32528-32530 | IN | denotes | of |
T10016 | 32531-32534 | PRP-DOLLAR- | denotes | our |
T10017 | 32535-32542 | NN | denotes | results |
T10018 | 32543-32548 | MD | denotes | could |
T10019 | 32549-32556 | VB | denotes | include |
T10020 | 32557-32559 | DT | denotes | an |
T10021 | 32560-32566 | NN | denotes | effect |
T10022 | 32567-32569 | IN | denotes | of |
T10023 | 32570-32572 | NN | denotes | FP |
T10024 | 32573-32575 | IN | denotes | on |
T10025 | 32576-32582 | NN | denotes | GATA-3 |
T10026 | 32583-32590 | JJ | denotes | nuclear |
T10027 | 32591-32597 | NN | denotes | export |
T10028 | 32598-32604 | CC | denotes | and/or |
T10029 | 32605-32616 | NN | denotes | degradation |
T10030 | 32618-32628 | NNP | denotes | Leptomycin |
T10031 | 32629-32630 | NNP | denotes | B |
T10032 | 32630-32631 | -COMMA- | denotes | , |
T10033 | 32632-32637 | WDT | denotes | which |
T10034 | 32638-32646 | VB | denotes | inhibits |
T10035 | 32647-32654 | JJ | denotes | nuclear |
T10036 | 32655-32661 | NN | denotes | export |
T10037 | 32661-32662 | -COMMA- | denotes | , |
T10038 | 32663-32666 | VB | denotes | did |
T10039 | 32667-32670 | RB | denotes | not |
T10040 | 32671-32677 | VB | denotes | affect |
T10041 | 32678-32681 | DT | denotes | the |
T10042 | 32682-32689 | NN | denotes | ability |
T10043 | 32690-32692 | IN | denotes | of |
T10044 | 32693-32695 | NN | denotes | FP |
T10045 | 32696-32698 | TO | denotes | to |
T10046 | 32699-32704 | VB | denotes | block |
T10047 | 32705-32711 | NN | denotes | GATA-3 |
T10048 | 32712-32719 | JJ | denotes | nuclear |
T10049 | 32720-32732 | NN | denotes | localization |
T10050 | 32733-32734 | -LRB- | denotes | ( |
T10051 | 32734-32740 | NN | denotes | Figure |
T10052 | 32741-32743 | NN | denotes | 5A |
T10053 | 32743-32744 | -RRB- | denotes | ) |
T10054 | 32746-32758 | RB | denotes | Additionally |
T10055 | 32758-32759 | -COMMA- | denotes | , |
T10056 | 32760-32762 | NN | denotes | FP |
T10057 | 32763-32766 | VB | denotes | had |
T10058 | 32767-32769 | DT | denotes | no |
T10059 | 32770-32776 | NN | denotes | effect |
T10060 | 32777-32779 | IN | denotes | on |
T10061 | 32780-32785 | JJ | denotes | whole |
T10062 | 32786-32790 | NN | denotes | cell |
T10063 | 32791-32797 | NN | denotes | GATA-3 |
T10064 | 32798-32808 | NN | denotes | expression |
T10065 | 32809-32815 | IN | denotes | during |
T10066 | 32816-32819 | DT | denotes | the |
T10067 | 32820-32824 | NN | denotes | time |
T10068 | 32825-32831 | NN | denotes | course |
T10069 | 32832-32834 | IN | denotes | of |
T10070 | 32835-32840 | DT | denotes | these |
T10071 | 32841-32852 | NN | denotes | experiments |
T10072 | 32853-32854 | -LRB- | denotes | ( |
T10073 | 32854-32860 | NN | denotes | Figure |
T10074 | 32861-32863 | NN | denotes | 5B |
T10075 | 32863-32864 | -RRB- | denotes | ) |
T10076 | 32866-32869 | CC | denotes | Nor |
T10077 | 32870-32873 | VB | denotes | did |
T10078 | 32874-32882 | NN | denotes | addition |
T10079 | 32883-32885 | IN | denotes | of |
T10080 | 32886-32888 | NN | denotes | FP |
T10081 | 32889-32899 | JJ | denotes | subsequent |
T10082 | 32900-32902 | TO | denotes | to |
T10083 | 32903-32916 | JJ | denotes | anti-CD3/CD28 |
T10084 | 32917-32924 | JJ | denotes | nuclear |
T10085 | 32925-32938 | NN | denotes | translocation |
T10086 | 32939-32945 | VB | denotes | affect |
T10087 | 32946-32952 | NN | denotes | GATA-3 |
T10088 | 32953-32960 | JJ | denotes | nuclear |
T10089 | 32961-32970 | NN | denotes | residency |
T10090 | 32971-32972 | -LRB- | denotes | ( |
T10091 | 32972-32978 | NN | denotes | Figure |
T10092 | 32979-32981 | NN | denotes | 5C |
T10093 | 32981-32982 | -RRB- | denotes | ) |
T10094 | 32982-32983 | -COMMA- | denotes | , |
T10095 | 32984-32994 | VB | denotes | suggesting |
T10096 | 32995-32999 | IN | denotes | that |
T10097 | 33000-33009 | VB | denotes | activated |
T10098 | 33010-33012 | NN | denotes | GR |
T10099 | 33013-33017 | VB | denotes | does |
T10100 | 33018-33021 | RB | denotes | not |
T10101 | 33022-33029 | VB | denotes | enhance |
T10102 | 33030-33036 | NN | denotes | GATA-3 |
T10103 | 33037-33044 | JJ | denotes | nuclear |
T10104 | 33045-33051 | NN | denotes | export |
T10105 | 33053-33060 | RB | denotes | Finally |
T10106 | 33060-33061 | -COMMA- | denotes | , |
T10107 | 33062-33065 | DT | denotes | the |
T10108 | 33066-33072 | NN | denotes | effect |
T10109 | 33073-33075 | IN | denotes | of |
T10110 | 33076-33078 | NN | denotes | FP |
T10111 | 33079-33081 | IN | denotes | on |
T10112 | 33082-33088 | NN | denotes | GATA-3 |
T10113 | 33089-33096 | JJ | denotes | nuclear |
T10114 | 33097-33103 | NN | denotes | import |
T10115 | 33104-33107 | VB | denotes | was |
T10116 | 33108-33111 | RB | denotes | not |
T10117 | 33112-33123 | JJ | denotes | nonspecific |
T10118 | 33123-33124 | -COMMA- | denotes | , |
T10119 | 33125-33130 | IN | denotes | since |
T10120 | 33131-33133 | NN | denotes | FP |
T10121 | 33134-33135 | -LRB- | denotes | ( |
T10122 | 33135-33139 | CD | denotes | 10−8 |
T10123 | 33140-33141 | NN | denotes | M |
T10124 | 33141-33142 | -RRB- | denotes | ) |
T10125 | 33143-33146 | VB | denotes | had |
T10126 | 33147-33149 | DT | denotes | no |
T10127 | 33150-33156 | NN | denotes | effect |
T10128 | 33157-33159 | IN | denotes | on |
T10129 | 33160-33163 | NN | denotes | p65 |
T10130 | 33164-33171 | JJ | denotes | nuclear |
T10131 | 33172-33185 | NN | denotes | translocation |
T10132 | 33186-33194 | VB | denotes | measured |
T10133 | 33195-33197 | IN | denotes | at |
T10134 | 33198-33200 | CD | denotes | 60 |
T10135 | 33201-33204 | NN | denotes | min |
T10136 | 33205-33206 | -LRB- | denotes | ( |
T10137 | 33206-33212 | NN | denotes | Figure |
T10138 | 33213-33215 | NN | denotes | 5D |
T10139 | 33215-33216 | -RRB- | denotes | ) |
T11309 | 34269-34272 | DT | denotes | The |
T11310 | 34273-34283 | JJ | denotes | Inhibitory |
T11311 | 34284-34290 | NN | denotes | Effect |
T11312 | 34291-34293 | IN | denotes | of |
T11313 | 34294-34309 | NN | denotes | Corticosteroids |
T11314 | 34310-34312 | IN | denotes | on |
T11315 | 34313-34319 | NN | denotes | GATA-3 |
T11316 | 34320-34327 | JJ | denotes | Nuclear |
T11317 | 34328-34340 | NN | denotes | Localization |
T11318 | 34341-34343 | IN | denotes | in |
T11319 | 34344-34351 | JJ | denotes | Primary |
T11320 | 34352-34353 | NN | denotes | T |
T11321 | 34354-34365 | NN | denotes | Lymphocytes |
T11322 | 34366-34368 | NNP | denotes | Ex |
T11323 | 34369-34373 | NNP | denotes | Vivo |
T11324 | 34374-34377 | CC | denotes | and |
T11325 | 34378-34380 | IN | denotes | In |
T11326 | 34381-34385 | FW | denotes | Vivo |
T11327 | 34386-34395 | NN | denotes | Treatment |
T11328 | 34396-34400 | IN | denotes | with |
T11329 | 34401-34403 | NN | denotes | FP |
T11330 | 34404-34406 | FW | denotes | ex |
T11331 | 34407-34411 | FW | denotes | vivo |
T11332 | 34412-34424 | VB | denotes | demonstrated |
T11333 | 34425-34426 | DT | denotes | a |
T11334 | 34427-34450 | JJ | denotes | concentration-dependent |
T11335 | 34451-34459 | NN | denotes | decrease |
T11336 | 34460-34462 | IN | denotes | in |
T11337 | 34463-34466 | DT | denotes | the |
T11338 | 34467-34473 | JJ | denotes | direct |
T11339 | 34474-34485 | NN | denotes | interaction |
T11340 | 34486-34493 | IN | denotes | between |
T11341 | 34494-34508 | NN | denotes | phospho-GATA-3 |
T11342 | 34509-34512 | CC | denotes | and |
T11343 | 34513-34523 | NN | denotes | importin-α |
T11344 | 34524-34526 | IN | denotes | in |
T11345 | 34527-34532 | NN | denotes | PBMCs |
T11346 | 34533-34537 | IN | denotes | from |
T11347 | 34538-34546 | NN | denotes | patients |
T11348 | 34547-34551 | IN | denotes | with |
T11349 | 34552-34558 | NN | denotes | asthma |
T11350 | 34559-34560 | -LRB- | denotes | ( |
T11351 | 34560-34566 | NN | denotes | Figure |
T11352 | 34567-34569 | NN | denotes | 6A |
T11353 | 34570-34573 | CC | denotes | and |
T11354 | 34574-34576 | NN | denotes | 6B |
T11355 | 34576-34577 | -RRB- | denotes | ) |
T11356 | 34577-34578 | -COMMA- | denotes | , |
T11357 | 34579-34584 | WDT | denotes | which |
T11358 | 34585-34588 | VB | denotes | was |
T11359 | 34589-34602 | RB | denotes | significantly |
T11360 | 34603-34612 | VB | denotes | inhibited |
T11361 | 34613-34615 | IN | denotes | at |
T11362 | 34616-34621 | CD | denotes | 10−12 |
T11363 | 34622-34623 | NN | denotes | M |
T11364 | 34624-34626 | NN | denotes | FP |
T11365 | 34627-34628 | -LRB- | denotes | ( |
T11366 | 34628-34629 | NN | denotes | p |
T11367 | 34629-34630 | JJ | denotes | < |
T11368 | 34630-34635 | CD | denotes | 0.001 |
T11369 | 34635-34636 | -COMMA- | denotes | , |
T11370 | 34637-34642 | NN | denotes | ANOVA |
T11371 | 34643-34646 | CC | denotes | and |
T11372 | 34647-34659 | NNP | denotes | Newman-Keuls |
T11373 | 34660-34664 | NN | denotes | test |
T11374 | 34664-34665 | -RRB- | denotes | ) |
T11375 | 34666-34669 | CC | denotes | and |
T11376 | 34670-34680 | RB | denotes | completely |
T11377 | 34681-34691 | VB | denotes | attenuated |
T11378 | 34692-34694 | IN | denotes | by |
T11379 | 34695-34699 | CD | denotes | 10−8 |
T11380 | 34700-34701 | NN | denotes | M |
T11381 | 34702-34704 | NN | denotes | FP |
T11382 | 34705-34706 | -LRB- | denotes | ( |
T11383 | 34706-34707 | NN | denotes | p |
T11384 | 34707-34708 | JJ | denotes | < |
T11385 | 34708-34713 | CD | denotes | 0.001 |
T11386 | 34713-34714 | -COMMA- | denotes | , |
T11387 | 34715-34720 | NN | denotes | ANOVA |
T11388 | 34721-34724 | CC | denotes | and |
T11389 | 34725-34737 | NNP | denotes | Newman-Keuls |
T11390 | 34738-34742 | NN | denotes | test |
T11391 | 34742-34743 | -RRB- | denotes | ) |
T11392 | 35694-35697 | PRP-DOLLAR- | denotes | Our |
T11393 | 35698-35706 | JJ | denotes | previous |
T11394 | 35707-35708 | NN | denotes | T |
T11395 | 35709-35713 | NN | denotes | cell |
T11396 | 35714-35718 | NN | denotes | line |
T11397 | 35719-35726 | NN | denotes | studies |
T11398 | 35727-35736 | VB | denotes | indicated |
T11399 | 35737-35741 | IN | denotes | that |
T11400 | 35742-35747 | CD | denotes | 10−12 |
T11401 | 35748-35749 | NN | denotes | M |
T11402 | 35750-35752 | NN | denotes | FP |
T11403 | 35753-35763 | VB | denotes | suppresses |
T11404 | 35764-35768 | NN | denotes | IL-4 |
T11405 | 35769-35772 | CC | denotes | and |
T11406 | 35773-35775 | CD | denotes | -5 |
T11407 | 35776-35780 | NN | denotes | gene |
T11408 | 35781-35791 | NN | denotes | expression |
T11409 | 35792-35795 | CC | denotes | and |
T11410 | 35796-35806 | VB | denotes | attenuated |
T11411 | 35807-35810 | DT | denotes | the |
T11412 | 35811-35822 | NN | denotes | interaction |
T11413 | 35823-35825 | IN | denotes | of |
T11414 | 35826-35832 | NN | denotes | GATA-3 |
T11415 | 35833-35837 | IN | denotes | with |
T11416 | 35838-35848 | NN | denotes | importin-α |
T11417 | 35849-35850 | -LRB- | denotes | ( |
T11418 | 35850-35853 | VB | denotes | see |
T11419 | 35854-35861 | NN | denotes | Figures |
T11420 | 35862-35864 | NN | denotes | 1D |
T11421 | 35865-35868 | CC | denotes | and |
T11422 | 35869-35870 | CD | denotes | 2 |
T11423 | 35870-35871 | -RRB- | denotes | ) |
T11424 | 35873-35877 | DT | denotes | This |
T11425 | 35878-35891 | NN | denotes | concentration |
T11426 | 35892-35894 | VB | denotes | is |
T11427 | 35895-35900 | JJ | denotes | close |
T11428 | 35901-35903 | TO | denotes | to |
T11429 | 35904-35908 | JJ | denotes | peak |
T11430 | 35909-35915 | NN | denotes | plasma |
T11431 | 35916-35922 | NN | denotes | levels |
T11432 | 35923-35931 | VB | denotes | obtained |
T11433 | 35932-35936 | IN | denotes | from |
T11434 | 35937-35946 | JJ | denotes | asthmatic |
T11435 | 35947-35955 | NN | denotes | patients |
T11436 | 35956-35963 | VB | denotes | treated |
T11437 | 35964-35968 | IN | denotes | with |
T11438 | 35969-35976 | VB | denotes | inhaled |
T11439 | 35977-35979 | NN | denotes | FP |
T11440 | 35980-35981 | -LRB- | denotes | ( |
T11441 | 35981-35984 | CD | denotes | 500 |
T11442 | 35985-35987 | NN | denotes | µg |
T11443 | 35987-35988 | -RRB- | denotes | ) |
T11444 | 35989-35990 | -LRB- | denotes | [ |
T11445 | 35990-35992 | CD | denotes | 27 |
T11446 | 35992-35993 | -RRB- | denotes | ] |
T11447 | 35995-36002 | VB | denotes | Inhaled |
T11448 | 36003-36005 | NN | denotes | FP |
T11449 | 36006-36007 | -LRB- | denotes | ( |
T11450 | 36007-36010 | CD | denotes | 500 |
T11451 | 36011-36013 | NN | denotes | µg |
T11452 | 36013-36014 | -RRB- | denotes | ) |
T11453 | 36015-36024 | NN | denotes | treatment |
T11454 | 36025-36027 | IN | denotes | of |
T11455 | 36028-36033 | CD | denotes | seven |
T11456 | 36034-36047 | JJ | denotes | steroid-naive |
T11457 | 36048-36054 | NN | denotes | asthma |
T11458 | 36055-36063 | NN | denotes | patients |
T11459 | 36064-36077 | RB | denotes | significantly |
T11460 | 36078-36085 | VB | denotes | reduced |
T11461 | 36086-36103 | NN | denotes | GATA-3–importin-α |
T11462 | 36104-36115 | NN | denotes | interaction |
T11463 | 36116-36118 | FW | denotes | in |
T11464 | 36119-36123 | FW | denotes | vivo |
T11465 | 36124-36126 | IN | denotes | in |
T11466 | 36127-36128 | DT | denotes | a |
T11467 | 36129-36143 | JJ | denotes | time-dependent |
T11468 | 36144-36150 | NN | denotes | manner |
T11469 | 36152-36156 | DT | denotes | This |
T11470 | 36157-36165 | VB | denotes | produced |
T11471 | 36166-36167 | DT | denotes | a |
T11472 | 36168-36169 | JJ | denotes | > |
T11473 | 36169-36171 | CD | denotes | 90 |
T11474 | 36171-36172 | NN | denotes | % |
T11475 | 36173-36181 | NN | denotes | decrease |
T11476 | 36182-36184 | IN | denotes | in |
T11477 | 36185-36202 | NN | denotes | GATA-3–importin-α |
T11478 | 36203-36214 | NN | denotes | association |
T11479 | 36215-36217 | IN | denotes | at |
T11480 | 36218-36219 | CD | denotes | 2 |
T11481 | 36220-36221 | NN | denotes | h |
T11482 | 36222-36223 | -LRB- | denotes | ( |
T11483 | 36223-36229 | NN | denotes | median |
T11484 | 36230-36231 | -LRB- | denotes | [ |
T11485 | 36231-36233 | CD | denotes | 95 |
T11486 | 36233-36234 | NN | denotes | % |
T11487 | 36235-36237 | NN | denotes | CI |
T11488 | 36237-36238 | -RRB- | denotes | ] |
T11489 | 36238-36239 | -COMMA- | denotes | , |
T11490 | 36240-36246 | CD | denotes | 13,494 |
T11491 | 36247-36248 | -LRB- | denotes | [ |
T11492 | 36248-36260 | CD | denotes | 6,828–17,829 |
T11493 | 36260-36261 | -RRB- | denotes | ] |
T11494 | 36262-36268 | IN | denotes | versus |
T11495 | 36269-36272 | CD | denotes | 879 |
T11496 | 36273-36274 | -LRB- | denotes | [ |
T11497 | 36274-36283 | CD | denotes | 597–1,165 |
T11498 | 36283-36284 | -RRB- | denotes | ] |
T11499 | 36284-36285 | -COLON- | denotes | ; |
T11500 | 36286-36287 | NN | denotes | p |
T11501 | 36287-36288 | SYM | denotes | < |
T11502 | 36288-36292 | CD | denotes | 0.05 |
T11503 | 36293-36301 | NNP | denotes | Friedman |
T11504 | 36301-36303 | POS | denotes | 's |
T11505 | 36304-36312 | NN | denotes | analysis |
T11506 | 36312-36313 | -RRB- | denotes | ) |
T11507 | 36315-36322 | RB | denotes | However |
T11508 | 36322-36323 | -COMMA- | denotes | , |
T11509 | 36324-36328 | DT | denotes | this |
T11510 | 36329-36332 | VB | denotes | did |
T11511 | 36333-36336 | RB | denotes | not |
T11512 | 36337-36342 | VB | denotes | reach |
T11513 | 36343-36355 | NN | denotes | significance |
T11514 | 36356-36361 | VB | denotes | using |
T11515 | 36362-36370 | NNP | denotes | Wilcoxon |
T11516 | 36370-36372 | POS | denotes | 's |
T11517 | 36373-36382 | JJ | denotes | post-test |
T11518 | 36383-36391 | NN | denotes | analysis |
T11519 | 36392-36393 | -LRB- | denotes | ( |
T11520 | 36393-36401 | NN | denotes | W = 6.00 |
T11521 | 36401-36402 | -RRB- | denotes | ) |
T11522 | 36403-36411 | RB | denotes | probably |
T11523 | 36412-36415 | JJ | denotes | due |
T11524 | 36416-36418 | TO | denotes | to |
T11525 | 36419-36422 | JJ | denotes | low |
T11526 | 36423-36430 | NN | denotes | numbers |
T11527 | 36431-36433 | IN | denotes | of |
T11528 | 36434-36446 | NN | denotes | participants |
T11529 | 36448-36455 | JJ | denotes | Similar |
T11530 | 36456-36463 | NN | denotes | results |
T11531 | 36464-36468 | VB | denotes | were |
T11532 | 36469-36477 | VB | denotes | observed |
T11533 | 36478-36482 | WRB | denotes | when |
T11534 | 36483-36500 | NN | denotes | GATA-3–importin-α |
T11535 | 36501-36512 | NN | denotes | association |
T11536 | 36513-36516 | VB | denotes | was |
T11537 | 36517-36525 | VB | denotes | measured |
T11538 | 36526-36527 | -LRB- | denotes | ( |
T11539 | 36527-36533 | NN | denotes | Figure |
T11540 | 36534-36536 | NN | denotes | 6C |
T11541 | 36537-36540 | CC | denotes | and |
T11542 | 36541-36543 | NN | denotes | 6D |
T11543 | 36543-36544 | -RRB- | denotes | ) |
T11544 | 36546-36549 | DT | denotes | The |
T11545 | 36550-36555 | JJ | denotes | lower |
T11546 | 36556-36560 | NN | denotes | dose |
T11547 | 36561-36563 | IN | denotes | of |
T11548 | 36564-36566 | NN | denotes | FP |
T11549 | 36567-36568 | -LRB- | denotes | ( |
T11550 | 36568-36571 | CD | denotes | 100 |
T11551 | 36572-36574 | NN | denotes | µg |
T11552 | 36574-36575 | -RRB- | denotes | ) |
T11553 | 36576-36579 | VB | denotes | was |
T11554 | 36580-36583 | RB | denotes | not |
T11555 | 36584-36593 | JJ | denotes | effective |
T11556 | 36595-36598 | DT | denotes | The |
T11557 | 36599-36609 | JJ | denotes | attenuated |
T11558 | 36610-36621 | NN | denotes | interaction |
T11559 | 36622-36624 | IN | denotes | of |
T11560 | 36625-36631 | NN | denotes | GATA-3 |
T11561 | 36632-36635 | VB | denotes | did |
T11562 | 36636-36639 | RB | denotes | not |
T11563 | 36640-36646 | VB | denotes | result |
T11564 | 36647-36651 | IN | denotes | from |
T11565 | 36652-36655 | DT | denotes | the |
T11566 | 36656-36665 | JJ | denotes | defective |
T11567 | 36666-36675 | NN | denotes | recycling |
T11568 | 36676-36678 | IN | denotes | of |
T11569 | 36679-36689 | NN | denotes | importin-α |
T11570 | 36689-36690 | -COMMA- | denotes | , |
T11571 | 36691-36693 | IN | denotes | as |
T11572 | 36694-36695 | DT | denotes | a |
T11573 | 36696-36707 | JJ | denotes | significant |
T11574 | 36708-36716 | NN | denotes | decrease |
T11575 | 36717-36719 | IN | denotes | in |
T11576 | 36720-36723 | DT | denotes | the |
T11577 | 36724-36733 | NN | denotes | abundance |
T11578 | 36734-36736 | IN | denotes | of |
T11579 | 36737-36747 | NN | denotes | importin-α |
T11580 | 36748-36750 | IN | denotes | in |
T11581 | 36751-36754 | DT | denotes | the |
T11582 | 36755-36766 | JJ | denotes | cytoplasmic |
T11583 | 36767-36771 | NN | denotes | pool |
T11584 | 36772-36775 | VB | denotes | was |
T11585 | 36776-36779 | RB | denotes | not |
T11586 | 36780-36788 | VB | denotes | detected |
T11587 | 36789-36790 | -LRB- | denotes | ( |
T11588 | 36790-36796 | NN | denotes | Figure |
T11589 | 36797-36799 | NN | denotes | 6E |
T11590 | 36799-36800 | -RRB- | denotes | ) |
T11591 | 36802-36804 | PRP | denotes | We |
T11592 | 36805-36812 | RB | denotes | further |
T11593 | 36813-36821 | VB | denotes | examined |
T11594 | 36822-36829 | IN | denotes | whether |
T11595 | 36830-36837 | VB | denotes | inhaled |
T11596 | 36838-36840 | NN | denotes | FP |
T11597 | 36841-36846 | MD | denotes | could |
T11598 | 36847-36853 | VB | denotes | affect |
T11599 | 36854-36862 | JJ | denotes | cellular |
T11600 | 36863-36875 | NN | denotes | localization |
T11601 | 36876-36878 | IN | denotes | of |
T11602 | 36879-36885 | NN | denotes | GATA-3 |
T11603 | 36886-36888 | IN | denotes | in |
T11604 | 36889-36899 | JJ | denotes | peripheral |
T11605 | 36900-36905 | NN | denotes | blood |
T11606 | 36906-36907 | NN | denotes | T |
T11607 | 36908-36913 | NN | denotes | cells |
T11608 | 36915-36924 | NN | denotes | Treatment |
T11609 | 36925-36929 | IN | denotes | with |
T11610 | 36930-36937 | VB | denotes | inhaled |
T11611 | 36938-36940 | NN | denotes | FP |
T11612 | 36941-36942 | -LRB- | denotes | ( |
T11613 | 36942-36945 | CD | denotes | 500 |
T11614 | 36946-36948 | NN | denotes | µg |
T11615 | 36948-36949 | -RRB- | denotes | ) |
T11616 | 36950-36953 | IN | denotes | for |
T11617 | 36954-36955 | CD | denotes | 2 |
T11618 | 36956-36957 | NN | denotes | h |
T11619 | 36958-36971 | RB | denotes | significantly |
T11620 | 36972-36981 | VB | denotes | increased |
T11621 | 36982-36984 | NN | denotes | GR |
T11622 | 36985-36992 | JJ | denotes | nuclear |
T11623 | 36993-37006 | NN | denotes | translocation |
T11624 | 37007-37008 | -LRB- | denotes | ( |
T11625 | 37008-37014 | NN | denotes | Figure |
T11626 | 37015-37017 | NN | denotes | 7A |
T11627 | 37017-37018 | -RRB- | denotes | ) |
T11628 | 37019-37022 | CC | denotes | and |
T11629 | 37023-37036 | RB | denotes | concomitantly |
T11630 | 37037-37046 | VB | denotes | decreased |
T11631 | 37047-37050 | DT | denotes | the |
T11632 | 37051-37057 | NN | denotes | number |
T11633 | 37058-37060 | IN | denotes | of |
T11634 | 37061-37068 | JJ | denotes | nuclear |
T11635 | 37069-37075 | NN | denotes | GATA-3 |
T11636 | 37076-37090 | JJ | denotes | immunoreactive |
T11637 | 37091-37101 | JJ | denotes | peripheral |
T11638 | 37102-37107 | NN | denotes | blood |
T11639 | 37108-37109 | NN | denotes | T |
T11640 | 37110-37115 | NN | denotes | cells |
T11641 | 37116-37117 | -LRB- | denotes | ( |
T11642 | 37117-37119 | CD | denotes | 37 |
T11643 | 37119-37120 | NN | denotes | % |
T11644 | 37120-37124 | CD | denotes | ±4.2 |
T11645 | 37124-37125 | NN | denotes | % |
T11646 | 37126-37132 | IN | denotes | versus |
T11647 | 37133-37137 | CD | denotes | 58.2 |
T11648 | 37137-37138 | NN | denotes | % |
T11649 | 37138-37143 | CD | denotes | ±4.95 |
T11650 | 37143-37144 | NN | denotes | % |
T11651 | 37144-37145 | -COMMA- | denotes | , |
T11652 | 37146-37155 | NN | denotes | p = 0.016 |
T11653 | 37155-37156 | -COMMA- | denotes | , |
T11654 | 37157-37165 | NN | denotes | W = 28.0 |
T11655 | 37165-37166 | -COMMA- | denotes | , |
T11656 | 37167-37175 | NNP | denotes | Wilcoxon |
T11657 | 37175-37177 | POS | denotes | 's |
T11658 | 37178-37182 | NN | denotes | rank |
T11659 | 37183-37187 | NN | denotes | test |
T11660 | 37187-37188 | -RRB- | denotes | ) |
T11661 | 37189-37197 | VB | denotes | compared |
T11662 | 37198-37202 | IN | denotes | with |
T11663 | 37203-37210 | NN | denotes | placebo |
T11664 | 37211-37213 | IN | denotes | as |
T11665 | 37214-37222 | VB | denotes | measured |
T11666 | 37223-37225 | IN | denotes | by |
T11667 | 37226-37245 | NN | denotes | immunocytochemistry |
T11668 | 37246-37247 | -LRB- | denotes | ( |
T11669 | 37247-37253 | NN | denotes | Figure |
T11670 | 37254-37256 | NN | denotes | 7A |
T11671 | 37257-37260 | CC | denotes | and |
T11672 | 37261-37263 | NN | denotes | 7B |
T11673 | 37263-37264 | -RRB- | denotes | ) |
T11674 | 37266-37270 | DT | denotes | This |
T11675 | 37271-37274 | VB | denotes | was |
T11676 | 37275-37284 | VB | denotes | confirmed |
T11677 | 37285-37287 | IN | denotes | by |
T11678 | 37288-37295 | JJ | denotes | Western |
T11679 | 37296-37304 | NN | denotes | blotting |
T11680 | 37304-37305 | -COMMA- | denotes | , |
T11681 | 37306-37311 | WDT | denotes | which |
T11682 | 37312-37316 | RB | denotes | also |
T11683 | 37317-37326 | VB | denotes | indicated |
T11684 | 37327-37331 | IN | denotes | that |
T11685 | 37332-37336 | DT | denotes | this |
T11686 | 37337-37343 | NN | denotes | effect |
T11687 | 37344-37347 | VB | denotes | was |
T11688 | 37348-37352 | CC | denotes | both |
T11689 | 37353-37358 | NN | denotes | time- |
T11690 | 37359-37362 | CC | denotes | and |
T11691 | 37363-37377 | JJ | denotes | dose-dependent |
T11692 | 37378-37379 | -LRB- | denotes | ( |
T11693 | 37379-37385 | NN | denotes | Figure |
T11694 | 37386-37388 | NN | denotes | 7C |
T11695 | 37389-37392 | CC | denotes | and |
T11696 | 37393-37395 | NN | denotes | 7D |
T11697 | 37395-37396 | -RRB- | denotes | ) |
T11698 | 37398-37402 | RB | denotes | Thus |
T11699 | 37402-37403 | -COMMA- | denotes | , |
T11700 | 37404-37411 | VB | denotes | inhaled |
T11701 | 37412-37414 | NN | denotes | FP |
T11702 | 37415-37416 | -LRB- | denotes | ( |
T11703 | 37416-37419 | CD | denotes | 500 |
T11704 | 37420-37422 | NN | denotes | µg |
T11705 | 37422-37423 | -RRB- | denotes | ) |
T11706 | 37424-37431 | VB | denotes | induced |
T11707 | 37432-37443 | JJ | denotes | significant |
T11708 | 37444-37448 | NN | denotes | loss |
T11709 | 37449-37451 | IN | denotes | in |
T11710 | 37452-37459 | JJ | denotes | nuclear |
T11711 | 37460-37466 | NN | denotes | GATA-3 |
T11712 | 37467-37469 | IN | denotes | at |
T11713 | 37470-37471 | CD | denotes | 2 |
T11714 | 37472-37473 | NN | denotes | h |
T11715 | 37474-37475 | -LRB- | denotes | ( |
T11716 | 37475-37481 | NN | denotes | median |
T11717 | 37482-37483 | -LRB- | denotes | [ |
T11718 | 37483-37485 | CD | denotes | 95 |
T11719 | 37485-37486 | NN | denotes | % |
T11720 | 37487-37489 | NN | denotes | CI |
T11721 | 37489-37490 | -RRB- | denotes | ] |
T11722 | 37490-37491 | -COMMA- | denotes | , |
T11723 | 37492-37496 | CD | denotes | 0.40 |
T11724 | 37497-37498 | -LRB- | denotes | [ |
T11725 | 37498-37507 | CD | denotes | 0.27–0.53 |
T11726 | 37507-37508 | -RRB- | denotes | ] |
T11727 | 37509-37515 | IN | denotes | versus |
T11728 | 37516-37520 | CD | denotes | 0.14 |
T11729 | 37521-37522 | -LRB- | denotes | [ |
T11730 | 37522-37531 | CD | denotes | 0.11–0.19 |
T11731 | 37531-37532 | -RRB- | denotes | ] |
T11732 | 37532-37533 | -COMMA- | denotes | , |
T11733 | 37534-37535 | NN | denotes | p |
T11734 | 37535-37536 | SYM | denotes | < |
T11735 | 37536-37540 | CD | denotes | 0.05 |
T11736 | 37540-37541 | -COMMA- | denotes | , |
T11737 | 37542-37551 | NN | denotes | W = 21.00 |
T11738 | 37551-37552 | -COMMA- | denotes | , |
T11739 | 37553-37561 | NNP | denotes | Wilcoxon |
T11740 | 37561-37563 | POS | denotes | 's |
T11741 | 37564-37568 | NN | denotes | rank |
T11742 | 37569-37573 | NN | denotes | test |
T11743 | 37573-37574 | -RRB- | denotes | ) |
T11744 | 37575-37576 | -LRB- | denotes | ( |
T11745 | 37576-37582 | NN | denotes | Figure |
T11746 | 37583-37585 | NN | denotes | 7C |
T11747 | 37585-37586 | -RRB- | denotes | ) |
T11748 | 37587-37590 | CC | denotes | and |
T11749 | 37591-37602 | JJ | denotes | cytoplasmic |
T11750 | 37603-37609 | NN | denotes | GATA-3 |
T11751 | 37610-37616 | NN | denotes | levels |
T11752 | 37617-37621 | VB | denotes | were |
T11753 | 37622-37630 | VB | denotes | enhanced |
T11754 | 37631-37633 | IN | denotes | by |
T11755 | 37634-37641 | VB | denotes | inhaled |
T11756 | 37642-37644 | NN | denotes | FP |
T11757 | 37645-37647 | IN | denotes | in |
T11758 | 37648-37649 | DT | denotes | a |
T11759 | 37650-37664 | JJ | denotes | dose-dependent |
T11760 | 37665-37671 | NN | denotes | manner |
T11761 | 37672-37673 | -LRB- | denotes | ( |
T11762 | 37673-37679 | NN | denotes | median |
T11763 | 37680-37681 | -LRB- | denotes | [ |
T11764 | 37681-37683 | CD | denotes | 95 |
T11765 | 37683-37684 | NN | denotes | % |
T11766 | 37685-37687 | NN | denotes | CI |
T11767 | 37687-37688 | -RRB- | denotes | ] |
T11768 | 37688-37689 | -COMMA- | denotes | , |
T11769 | 37690-37696 | CD | denotes | 0.0032 |
T11770 | 37697-37698 | -LRB- | denotes | [ |
T11771 | 37698-37711 | CD | denotes | 0.0026–0.0039 |
T11772 | 37711-37712 | -RRB- | denotes | ] |
T11773 | 37713-37719 | IN | denotes | versus |
T11774 | 37720-37725 | CD | denotes | 0.658 |
T11775 | 37726-37727 | -LRB- | denotes | [ |
T11776 | 37727-37738 | CD | denotes | 0.592–0.720 |
T11777 | 37738-37739 | -RRB- | denotes | ] |
T11778 | 37739-37740 | -COMMA- | denotes | , |
T11779 | 37741-37742 | NN | denotes | p |
T11780 | 37742-37743 | SYM | denotes | < |
T11781 | 37743-37747 | CD | denotes | 0.05 |
T11782 | 37747-37748 | -COMMA- | denotes | , |
T11783 | 37749-37759 | NN | denotes | W = −21.00 |
T11784 | 37759-37760 | -COMMA- | denotes | , |
T11785 | 37761-37769 | NNP | denotes | Wilcoxon |
T11786 | 37769-37771 | POS | denotes | 's |
T11787 | 37772-37776 | NN | denotes | rank |
T11788 | 37777-37781 | NN | denotes | test |
T11789 | 37781-37782 | -RRB- | denotes | ) |
T11790 | 37783-37784 | -LRB- | denotes | ( |
T11791 | 37784-37790 | NN | denotes | Figure |
T11792 | 37791-37793 | NN | denotes | 7D |
T11793 | 37793-37794 | -RRB- | denotes | ) |
T11794 | 37796-37798 | IN | denotes | In |
T11795 | 37799-37807 | NN | denotes | addition |
T11796 | 37807-37808 | -COMMA- | denotes | , |
T11797 | 37809-37811 | NN | denotes | FP |
T11798 | 37812-37813 | -LRB- | denotes | ( |
T11799 | 37813-37816 | CD | denotes | 500 |
T11800 | 37817-37819 | NN | denotes | µg |
T11801 | 37819-37820 | -RRB- | denotes | ) |
T11802 | 37821-37830 | VB | denotes | inhibited |
T11803 | 37831-37834 | NN | denotes | p38 |
T11804 | 37835-37839 | NN | denotes | MAPK |
T11805 | 37840-37855 | NN | denotes | phosphorylation |
T11806 | 37856-37858 | IN | denotes | in |
T11807 | 37859-37866 | JJ | denotes | primary |
T11808 | 37867-37868 | NN | denotes | T |
T11809 | 37869-37874 | NN | denotes | cells |
T11810 | 37875-37877 | FW | denotes | in |
T11811 | 37878-37882 | FW | denotes | vivo |
T11812 | 37883-37885 | IN | denotes | at |
T11813 | 37886-37887 | CD | denotes | 2 |
T11814 | 37888-37889 | NN | denotes | h |
T11815 | 37890-37892 | IN | denotes | in |
T11816 | 37893-37900 | NN | denotes | samples |
T11817 | 37901-37905 | IN | denotes | from |
T11818 | 37906-37909 | CD | denotes | two |
T11819 | 37910-37918 | NN | denotes | patients |
T11820 | 37919-37920 | -LRB- | denotes | ( |
T11821 | 37920-37926 | NN | denotes | Figure |
T11822 | 37927-37929 | NN | denotes | 7E |
T11823 | 37929-37930 | -RRB- | denotes | ) |
T11824 | 39418-39423 | VB | denotes | Taken |
T11825 | 39424-39432 | RB | denotes | together |
T11826 | 39432-39433 | -COMMA- | denotes | , |
T11827 | 39434-39437 | PRP-DOLLAR- | denotes | our |
T11828 | 39438-39442 | NN | denotes | data |
T11829 | 39443-39450 | VB | denotes | suggest |
T11830 | 39451-39455 | IN | denotes | that |
T11831 | 39456-39463 | VB | denotes | inhaled |
T11832 | 39464-39466 | NN | denotes | FP |
T11833 | 39467-39474 | VB | denotes | reduces |
T11834 | 39475-39482 | JJ | denotes | nuclear |
T11835 | 39483-39495 | NN | denotes | localization |
T11836 | 39496-39498 | IN | denotes | of |
T11837 | 39499-39505 | NN | denotes | GATA-3 |
T11838 | 39506-39508 | FW | denotes | in |
T11839 | 39509-39513 | FW | denotes | vivo |
T11840 | 39514-39516 | IN | denotes | by |
T11841 | 39517-39524 | RB | denotes | acutely |
T11842 | 39525-39535 | VB | denotes | inhibiting |
T11843 | 39536-39559 | NN | denotes | phospho-GATA-3–importin |
T11844 | 39560-39571 | NN | denotes | association |
T11845 | 39573-39577 | DT | denotes | This |
T11846 | 39578-39584 | NN | denotes | effect |
T11847 | 39585-39588 | MD | denotes | may |
T11848 | 39589-39591 | VB | denotes | be |
T11849 | 39592-39598 | JJ | denotes | direct |
T11850 | 39598-39599 | -COMMA- | denotes | , |
T11851 | 39600-39607 | IN | denotes | through |
T11852 | 39608-39619 | NN | denotes | competition |
T11853 | 39620-39623 | IN | denotes | for |
T11854 | 39624-39634 | JJ | denotes | importin-α |
T11855 | 39635-39637 | CC | denotes | or |
T11856 | 39638-39648 | VB | denotes | associated |
T11857 | 39649-39658 | NN | denotes | molecules |
T11858 | 39658-39659 | -COMMA- | denotes | , |
T11859 | 39660-39662 | CC | denotes | or |
T11860 | 39663-39672 | JJ | denotes | secondary |
T11861 | 39673-39675 | TO | denotes | to |
T11862 | 39676-39678 | DT | denotes | an |
T11863 | 39679-39685 | NN | denotes | effect |
T11864 | 39686-39688 | IN | denotes | on |
T11865 | 39689-39692 | NN | denotes | p38 |
T11866 | 39693-39706 | JJ | denotes | MAPK-mediated |
T11867 | 39707-39713 | NN | denotes | GATA-3 |
T11868 | 39714-39729 | NN | denotes | phosphorylation |
T11869 | 39730-39733 | IN | denotes | via |
T11870 | 39734-39739 | JJ | denotes | rapid |
T11871 | 39740-39749 | NN | denotes | induction |
T11872 | 39750-39752 | IN | denotes | of |
T11873 | 39753-39758 | NN | denotes | MKP-1 |
T11874 | 39760-39763 | DT | denotes | The |
T11875 | 39764-39775 | NN | denotes | combination |
T11876 | 39776-39778 | IN | denotes | of |
T11877 | 39779-39784 | DT | denotes | these |
T11878 | 39785-39788 | CD | denotes | two |
T11879 | 39789-39800 | VB | denotes | interacting |
T11880 | 39801-39808 | NN | denotes | effects |
T11881 | 39809-39812 | MD | denotes | can |
T11882 | 39813-39819 | VB | denotes | result |
T11883 | 39820-39822 | IN | denotes | in |
T11884 | 39823-39831 | JJ | denotes | complete |
T11885 | 39832-39843 | NN | denotes | suppression |
T11886 | 39844-39846 | IN | denotes | of |
T11887 | 39847-39853 | NN | denotes | GATA-3 |
T11888 | 39854-39861 | JJ | denotes | nuclear |
T11889 | 39862-39868 | NN | denotes | import |
T11890 | 39869-39872 | CC | denotes | and |
T11891 | 39873-39877 | RB | denotes | thus |
T11892 | 39878-39881 | NN | denotes | Th2 |
T11893 | 39882-39890 | NN | denotes | cytokine |
T11894 | 39891-39895 | NN | denotes | gene |
T11895 | 39896-39906 | NN | denotes | expression |
T13351 | 39920-39924 | RB | denotes | Here |
T13352 | 39925-39927 | PRP | denotes | we |
T13353 | 39928-39932 | VB | denotes | have |
T13354 | 39933-39945 | VB | denotes | demonstrated |
T13355 | 39945-39946 | -COMMA- | denotes | , |
T13356 | 39947-39949 | TO | denotes | to |
T13357 | 39950-39953 | PRP-DOLLAR- | denotes | our |
T13358 | 39954-39963 | NN | denotes | knowledge |
T13359 | 39964-39967 | IN | denotes | for |
T13360 | 39968-39971 | DT | denotes | the |
T13361 | 39972-39977 | JJ | denotes | first |
T13362 | 39978-39982 | NN | denotes | time |
T13363 | 39982-39983 | -COMMA- | denotes | , |
T13364 | 39984-39988 | IN | denotes | that |
T13365 | 39989-40004 | NN | denotes | corticosteroids |
T13366 | 40005-40008 | MD | denotes | may |
T13367 | 40009-40016 | VB | denotes | inhibit |
T13368 | 40017-40023 | NN | denotes | GATA-3 |
T13369 | 40024-40032 | NN | denotes | function |
T13370 | 40033-40036 | CC | denotes | and |
T13371 | 40037-40046 | RB | denotes | therefore |
T13372 | 40047-40050 | DT | denotes | the |
T13373 | 40051-40064 | NN | denotes | transcription |
T13374 | 40065-40067 | IN | denotes | of |
T13375 | 40068-40071 | NN | denotes | Th2 |
T13376 | 40072-40077 | NN | denotes | genes |
T13377 | 40078-40081 | IN | denotes | via |
T13378 | 40082-40085 | CD | denotes | two |
T13379 | 40086-40094 | JJ | denotes | distinct |
T13380 | 40095-40098 | CC | denotes | but |
T13381 | 40099-40110 | VB | denotes | interacting |
T13382 | 40111-40120 | JJ | denotes | molecular |
T13383 | 40121-40131 | NN | denotes | mechanisms |
T13384 | 40133-40140 | RB | denotes | Firstly |
T13385 | 40140-40141 | -COMMA- | denotes | , |
T13386 | 40142-40166 | JJ | denotes | corticosteroid-activated |
T13387 | 40167-40169 | NN | denotes | GR |
T13388 | 40170-40177 | VB | denotes | appears |
T13389 | 40178-40180 | TO | denotes | to |
T13390 | 40181-40188 | VB | denotes | compete |
T13391 | 40189-40193 | IN | denotes | with |
T13392 | 40194-40203 | VB | denotes | activated |
T13393 | 40204-40210 | NN | denotes | GATA-3 |
T13394 | 40211-40214 | IN | denotes | for |
T13395 | 40215-40222 | JJ | denotes | nuclear |
T13396 | 40223-40229 | NN | denotes | import |
T13397 | 40230-40233 | IN | denotes | via |
T13398 | 40234-40244 | NN | denotes | importin-α |
T13399 | 40244-40245 | -COMMA- | denotes | , |
T13400 | 40246-40251 | WDT | denotes | which |
T13401 | 40252-40254 | VB | denotes | is |
T13402 | 40255-40263 | VB | denotes | required |
T13403 | 40264-40267 | IN | denotes | for |
T13404 | 40268-40271 | DT | denotes | the |
T13405 | 40272-40279 | JJ | denotes | nuclear |
T13406 | 40280-40289 | NN | denotes | transport |
T13407 | 40290-40292 | IN | denotes | of |
T13408 | 40293-40297 | CC | denotes | both |
T13409 | 40298-40304 | NN | denotes | GATA-3 |
T13410 | 40305-40308 | CC | denotes | and |
T13411 | 40309-40311 | NN | denotes | GR |
T13412 | 40313-40321 | RB | denotes | Secondly |
T13413 | 40321-40322 | -COMMA- | denotes | , |
T13414 | 40323-40338 | NN | denotes | corticosteroids |
T13415 | 40339-40341 | IN | denotes | at |
T13416 | 40342-40348 | JJ | denotes | higher |
T13417 | 40349-40363 | NN | denotes | concentrations |
T13418 | 40364-40372 | VB | denotes | increase |
T13419 | 40373-40376 | DT | denotes | the |
T13420 | 40377-40387 | NN | denotes | expression |
T13421 | 40388-40390 | IN | denotes | of |
T13422 | 40391-40396 | NN | denotes | MKP-1 |
T13423 | 40396-40397 | -COMMA- | denotes | , |
T13424 | 40398-40399 | DT | denotes | a |
T13425 | 40400-40406 | JJ | denotes | potent |
T13426 | 40407-40416 | NN | denotes | inhibitor |
T13427 | 40417-40419 | IN | denotes | of |
T13428 | 40420-40423 | NN | denotes | p38 |
T13429 | 40424-40428 | NN | denotes | MAPK |
T13430 | 40429-40437 | NN | denotes | activity |
T13431 | 40438-40441 | CC | denotes | and |
T13432 | 40442-40449 | RB | denotes | thereby |
T13433 | 40450-40457 | VB | denotes | prevent |
T13434 | 40458-40459 | NN | denotes | T |
T13435 | 40460-40464 | NN | denotes | cell |
T13436 | 40465-40485 | NN | denotes | receptor/co-receptor |
T13437 | 40486-40496 | NN | denotes | activation |
T13438 | 40497-40499 | IN | denotes | of |
T13439 | 40500-40503 | NN | denotes | p38 |
T13440 | 40504-40508 | NN | denotes | MAPK |
T13441 | 40509-40511 | TO | denotes | to |
T13442 | 40512-40519 | VB | denotes | prevent |
T13443 | 40520-40523 | DT | denotes | the |
T13444 | 40524-40539 | NN | denotes | phosphorylation |
T13445 | 40540-40542 | IN | denotes | of |
T13446 | 40543-40549 | NN | denotes | GATA-3 |
T13447 | 40550-40554 | WDT | denotes | that |
T13448 | 40555-40557 | VB | denotes | is |
T13449 | 40558-40567 | JJ | denotes | necessary |
T13450 | 40568-40571 | IN | denotes | for |
T13451 | 40572-40583 | NN | denotes | interaction |
T13452 | 40584-40588 | IN | denotes | with |
T13453 | 40589-40599 | JJ | denotes | importin-α |
T13454 | 40600-40603 | CC | denotes | and |
T13455 | 40604-40614 | JJ | denotes | subsequent |
T13456 | 40615-40622 | JJ | denotes | nuclear |
T13457 | 40623-40629 | NN | denotes | import |
T13458 | 40631-40633 | PRP | denotes | We |
T13459 | 40634-40638 | VB | denotes | have |
T13460 | 40639-40649 | RB | denotes | previously |
T13461 | 40650-40655 | VB | denotes | shown |
T13462 | 40656-40660 | IN | denotes | that |
T13463 | 40661-40674 | NN | denotes | translocation |
T13464 | 40675-40677 | IN | denotes | of |
T13465 | 40678-40684 | NN | denotes | GATA-3 |
T13466 | 40685-40689 | IN | denotes | from |
T13467 | 40690-40693 | DT | denotes | the |
T13468 | 40694-40703 | NN | denotes | cytoplasm |
T13469 | 40704-40706 | TO | denotes | to |
T13470 | 40707-40710 | DT | denotes | the |
T13471 | 40711-40718 | NN | denotes | nucleus |
T13472 | 40719-40727 | VB | denotes | involves |
T13473 | 40728-40731 | DT | denotes | the |
T13474 | 40732-40739 | JJ | denotes | nuclear |
T13475 | 40740-40751 | NN | denotes | transporter |
T13476 | 40752-40759 | NN | denotes | protein |
T13477 | 40760-40770 | NN | denotes | importin-α |
T13478 | 40770-40771 | -COMMA- | denotes | , |
T13479 | 40772-40777 | WDT | denotes | which |
T13480 | 40778-40787 | VB | denotes | interacts |
T13481 | 40788-40792 | IN | denotes | with |
T13482 | 40793-40807 | VB | denotes | phosphorylated |
T13483 | 40808-40814 | NN | denotes | GATA-3 |
T13484 | 40815-40816 | -LRB- | denotes | [ |
T13485 | 40816-40818 | CD | denotes | 12 |
T13486 | 40818-40819 | -RRB- | denotes | ] |
T13487 | 40821-40823 | PRP | denotes | We |
T13488 | 40824-40828 | VB | denotes | have |
T13489 | 40829-40833 | RB | denotes | also |
T13490 | 40834-40844 | RB | denotes | previously |
T13491 | 40845-40853 | VB | denotes | reported |
T13492 | 40854-40858 | IN | denotes | that |
T13493 | 40859-40865 | NN | denotes | GATA-3 |
T13494 | 40866-40875 | NN | denotes | knockdown |
T13495 | 40876-40881 | VB | denotes | using |
T13496 | 40882-40887 | NN | denotes | siRNA |
T13497 | 40888-40895 | VB | denotes | results |
T13498 | 40896-40898 | IN | denotes | in |
T13499 | 40899-40910 | NN | denotes | suppression |
T13500 | 40911-40913 | IN | denotes | of |
T13501 | 40914-40938 | JJ | denotes | anti-CD3/CD28–stimulated |
T13502 | 40939-40948 | NN | denotes | IL-4/IL-5 |
T13503 | 40949-40953 | NN | denotes | mRNA |
T13504 | 40954-40963 | NN | denotes | induction |
T13505 | 40963-40964 | -COMMA- | denotes | , |
T13506 | 40965-40969 | RB | denotes | thus |
T13507 | 40970-40981 | VB | denotes | implicating |
T13508 | 40982-40984 | DT | denotes | an |
T13509 | 40985-40994 | JJ | denotes | essential |
T13510 | 40995-40999 | NN | denotes | role |
T13511 | 41000-41003 | IN | denotes | for |
T13512 | 41004-41010 | NN | denotes | GATA-3 |
T13513 | 41011-41013 | IN | denotes | in |
T13514 | 41014-41017 | DT | denotes | the |
T13515 | 41018-41031 | NN | denotes | transcription |
T13516 | 41032-41034 | IN | denotes | of |
T13517 | 41035-41040 | DT | denotes | these |
T13518 | 41041-41046 | NN | denotes | genes |
T13519 | 41047-41048 | -LRB- | denotes | [ |
T13520 | 41048-41050 | CD | denotes | 12 |
T13521 | 41050-41051 | -RRB- | denotes | ] |
T13522 | 41053-41055 | PRP | denotes | We |
T13523 | 41056-41059 | RB | denotes | now |
T13524 | 41060-41067 | VB | denotes | confirm |
T13525 | 41067-41068 | -COMMA- | denotes | , |
T13526 | 41069-41071 | IN | denotes | in |
T13527 | 41072-41077 | JJ | denotes | human |
T13528 | 41078-41079 | NN | denotes | T |
T13529 | 41080-41085 | NN | denotes | cells |
T13530 | 41085-41086 | -COMMA- | denotes | , |
T13531 | 41087-41091 | IN | denotes | that |
T13532 | 41092-41094 | NN | denotes | GR |
T13533 | 41095-41099 | RB | denotes | also |
T13534 | 41100-41104 | VB | denotes | uses |
T13535 | 41105-41108 | DT | denotes | the |
T13536 | 41109-41113 | JJ | denotes | same |
T13537 | 41114-41121 | JJ | denotes | nuclear |
T13538 | 41122-41128 | NN | denotes | import |
T13539 | 41129-41138 | NN | denotes | mechanism |
T13540 | 41139-41141 | IN | denotes | as |
T13541 | 41142-41148 | NN | denotes | GATA-3 |
T13542 | 41149-41150 | -LRB- | denotes | [ |
T13543 | 41150-41152 | CD | denotes | 22 |
T13544 | 41152-41153 | -RRB- | denotes | ] |
T13545 | 41155-41157 | PRP | denotes | We |
T13546 | 41158-41167 | RB | denotes | therefore |
T13547 | 41168-41175 | VB | denotes | propose |
T13548 | 41176-41180 | IN | denotes | that |
T13549 | 41181-41186 | EX | denotes | there |
T13550 | 41187-41189 | VB | denotes | is |
T13551 | 41190-41201 | NN | denotes | competition |
T13552 | 41202-41209 | IN | denotes | between |
T13553 | 41210-41226 | JJ | denotes | ligand-activated |
T13554 | 41227-41229 | NN | denotes | GR |
T13555 | 41230-41233 | CC | denotes | and |
T13556 | 41234-41248 | NN | denotes | phospho-GATA-3 |
T13557 | 41249-41252 | IN | denotes | for |
T13558 | 41253-41260 | JJ | denotes | nuclear |
T13559 | 41261-41267 | NN | denotes | import |
T13560 | 41269-41280 | RB | denotes | Furthermore |
T13561 | 41280-41281 | -COMMA- | denotes | , |
T13562 | 41282-41284 | PRP | denotes | we |
T13563 | 41285-41289 | VB | denotes | have |
T13564 | 41290-41295 | VB | denotes | shown |
T13565 | 41296-41300 | IN | denotes | that |
T13566 | 41301-41306 | EX | denotes | there |
T13567 | 41307-41309 | VB | denotes | is |
T13568 | 41310-41322 | JJ | denotes | preferential |
T13569 | 41323-41330 | NN | denotes | binding |
T13570 | 41331-41333 | IN | denotes | of |
T13571 | 41334-41344 | NN | denotes | importin-α |
T13572 | 41345-41347 | TO | denotes | to |
T13573 | 41348-41357 | VB | denotes | activated |
T13574 | 41358-41360 | NN | denotes | GR |
T13575 | 41361-41365 | IN | denotes | over |
T13576 | 41366-41380 | NN | denotes | phospho-GATA-3 |
T13577 | 41380-41381 | -COMMA- | denotes | , |
T13578 | 41382-41384 | IN | denotes | so |
T13579 | 41385-41389 | IN | denotes | that |
T13580 | 41390-41405 | NN | denotes | corticosteroids |
T13581 | 41406-41411 | MD | denotes | would |
T13582 | 41412-41426 | RB | denotes | preferentially |
T13583 | 41427-41433 | VB | denotes | reduce |
T13584 | 41434-41440 | NN | denotes | GATA-3 |
T13585 | 41441-41446 | NN | denotes | entry |
T13586 | 41447-41450 | CC | denotes | and |
T13587 | 41451-41455 | RB | denotes | thus |
T13588 | 41456-41463 | RB | denotes | rapidly |
T13589 | 41464-41470 | VB | denotes | switch |
T13590 | 41471-41474 | RP | denotes | off |
T13591 | 41475-41478 | NN | denotes | Th2 |
T13592 | 41479-41483 | NN | denotes | gene |
T13593 | 41484-41497 | NN | denotes | transcription |
T13594 | 41498-41505 | IN | denotes | without |
T13595 | 41506-41509 | DT | denotes | any |
T13596 | 41510-41514 | NN | denotes | need |
T13597 | 41515-41518 | IN | denotes | for |
T13598 | 41519-41522 | DT | denotes | any |
T13599 | 41523-41535 | JJ | denotes | intermediate |
T13600 | 41536-41541 | NN | denotes | steps |
T13601 | 41543-41554 | RB | denotes | Furthermore |
T13602 | 41554-41555 | -COMMA- | denotes | , |
T13603 | 41556-41561 | EX | denotes | there |
T13604 | 41562-41565 | VB | denotes | was |
T13605 | 41566-41570 | DT | denotes | some |
T13606 | 41571-41577 | NN | denotes | degree |
T13607 | 41578-41580 | IN | denotes | of |
T13608 | 41581-41592 | NN | denotes | specificity |
T13609 | 41593-41596 | IN | denotes | for |
T13610 | 41597-41603 | NN | denotes | GATA-3 |
T13611 | 41603-41604 | -COMMA- | denotes | , |
T13612 | 41605-41607 | IN | denotes | as |
T13613 | 41608-41615 | JJ | denotes | nuclear |
T13614 | 41616-41629 | NN | denotes | translocation |
T13615 | 41630-41632 | IN | denotes | of |
T13616 | 41633-41636 | DT | denotes | the |
T13617 | 41637-41640 | NN | denotes | p65 |
T13618 | 41641-41648 | NN | denotes | subunit |
T13619 | 41649-41651 | IN | denotes | of |
T13620 | 41652-41657 | NN | denotes | NF-κB |
T13621 | 41658-41661 | VB | denotes | was |
T13622 | 41662-41665 | RB | denotes | not |
T13623 | 41666-41674 | VB | denotes | affected |
T13624 | 41675-41677 | IN | denotes | by |
T13625 | 41678-41692 | NN | denotes | corticosteroid |
T13626 | 41693-41701 | NN | denotes | exposure |
T13627 | 41703-41705 | PRP | denotes | We |
T13628 | 41706-41712 | VB | denotes | tested |
T13629 | 41713-41717 | DT | denotes | some |
T13630 | 41718-41729 | JJ | denotes | alternative |
T13631 | 41730-41742 | NN | denotes | explanations |
T13632 | 41743-41746 | IN | denotes | for |
T13633 | 41747-41751 | DT | denotes | this |
T13634 | 41752-41758 | NN | denotes | effect |
T13635 | 41759-41761 | IN | denotes | of |
T13636 | 41762-41764 | NN | denotes | FP |
T13637 | 41765-41767 | IN | denotes | on |
T13638 | 41768-41774 | NN | denotes | GATA-3 |
T13639 | 41775-41782 | JJ | denotes | nuclear |
T13640 | 41783-41792 | NN | denotes | exclusion |
T13641 | 41793-41796 | CC | denotes | and |
T13642 | 41797-41803 | VB | denotes | failed |
T13643 | 41804-41806 | TO | denotes | to |
T13644 | 41807-41811 | VB | denotes | show |
T13645 | 41812-41816 | IN | denotes | that |
T13646 | 41817-41819 | NN | denotes | FP |
T13647 | 41820-41826 | CC | denotes | either |
T13648 | 41827-41835 | VB | denotes | enhances |
T13649 | 41836-41842 | NN | denotes | GATA-3 |
T13650 | 41843-41850 | JJ | denotes | nuclear |
T13651 | 41851-41857 | NN | denotes | export |
T13652 | 41858-41866 | RB | denotes | directly |
T13653 | 41867-41869 | CC | denotes | or |
T13654 | 41870-41877 | VB | denotes | induces |
T13655 | 41878-41884 | NN | denotes | GATA-3 |
T13656 | 41885-41896 | NN | denotes | degradation |
T13657 | 41898-41901 | DT | denotes | The |
T13658 | 41902-41910 | NN | denotes | evidence |
T13659 | 41911-41915 | IN | denotes | from |
T13660 | 41916-41919 | DT | denotes | the |
T13661 | 41920-41922 | FW | denotes | in |
T13662 | 41923-41928 | FW | denotes | vitro |
T13663 | 41929-41940 | NN | denotes | competition |
T13664 | 41941-41947 | NN | denotes | assays |
T13665 | 41948-41952 | VB | denotes | does |
T13666 | 41952-41953 | -COMMA- | denotes | , |
T13667 | 41954-41961 | RB | denotes | however |
T13668 | 41961-41962 | -COMMA- | denotes | , |
T13669 | 41963-41970 | VB | denotes | suggest |
T13670 | 41971-41975 | IN | denotes | that |
T13671 | 41976-41984 | VB | denotes | purified |
T13672 | 41985-41994 | VB | denotes | activated |
T13673 | 41995-41997 | NN | denotes | GR |
T13674 | 41998-42001 | MD | denotes | can |
T13675 | 42002-42009 | RB | denotes | clearly |
T13676 | 42010-42019 | VB | denotes | attenuate |
T13677 | 42020-42028 | VB | denotes | purified |
T13678 | 42029-42054 | NN | denotes | phospho-GATA-3–importin-α |
T13679 | 42055-42066 | NN | denotes | association |
T13680 | 42067-42070 | CC | denotes | and |
T13681 | 42071-42075 | IN | denotes | that |
T13682 | 42076-42079 | DT | denotes | the |
T13683 | 42080-42088 | NN | denotes | converse |
T13684 | 42089-42093 | VB | denotes | does |
T13685 | 42094-42097 | RB | denotes | not |
T13686 | 42098-42103 | VB | denotes | occur |
T13687 | 42105-42116 | RB | denotes | Furthermore |
T13688 | 42116-42117 | -COMMA- | denotes | , |
T13689 | 42118-42120 | PRP | denotes | we |
T13690 | 42121-42125 | VB | denotes | have |
T13691 | 42126-42131 | VB | denotes | shown |
T13692 | 42132-42136 | IN | denotes | that |
T13693 | 42137-42141 | RB | denotes | only |
T13694 | 42142-42156 | NN | denotes | phospho-GATA-3 |
T13695 | 42157-42160 | MD | denotes | can |
T13696 | 42161-42170 | VB | denotes | associate |
T13697 | 42171-42175 | IN | denotes | with |
T13698 | 42176-42186 | NN | denotes | importin-α |
T13699 | 42188-42192 | DT | denotes | This |
T13700 | 42193-42202 | NN | denotes | mechanism |
T13701 | 42203-42205 | VB | denotes | is |
T13702 | 42206-42215 | JJ | denotes | sensitive |
T13703 | 42216-42218 | TO | denotes | to |
T13704 | 42219-42223 | RB | denotes | very |
T13705 | 42224-42227 | JJ | denotes | low |
T13706 | 42228-42242 | NN | denotes | concentrations |
T13707 | 42243-42245 | IN | denotes | of |
T13708 | 42246-42260 | NN | denotes | corticosteroid |
T13709 | 42261-42264 | CC | denotes | and |
T13710 | 42265-42270 | MD | denotes | would |
T13711 | 42271-42273 | VB | denotes | be |
T13712 | 42274-42279 | JJ | denotes | rapid |
T13713 | 42280-42282 | IN | denotes | in |
T13714 | 42283-42288 | NN | denotes | onset |
T13715 | 42289-42291 | IN | denotes | as |
T13716 | 42292-42294 | DT | denotes | no |
T13717 | 42295-42302 | NN | denotes | changes |
T13718 | 42303-42305 | IN | denotes | in |
T13719 | 42306-42313 | NN | denotes | protein |
T13720 | 42314-42323 | NN | denotes | synthesis |
T13721 | 42324-42327 | VB | denotes | are |
T13722 | 42328-42336 | VB | denotes | required |
T13723 | 42338-42342 | DT | denotes | This |
T13724 | 42343-42348 | JJ | denotes | acute |
T13725 | 42349-42358 | NN | denotes | mechanism |
T13726 | 42359-42362 | MD | denotes | may |
T13727 | 42363-42367 | RB | denotes | also |
T13728 | 42368-42378 | VB | denotes | contribute |
T13729 | 42379-42381 | TO | denotes | to |
T13730 | 42382-42385 | DT | denotes | the |
T13731 | 42386-42395 | NN | denotes | reduction |
T13732 | 42396-42398 | IN | denotes | in |
T13733 | 42399-42405 | NN | denotes | GATA-3 |
T13734 | 42406-42413 | JJ | denotes | nuclear |
T13735 | 42414-42420 | NN | denotes | import |
T13736 | 42421-42424 | CC | denotes | and |
T13737 | 42425-42428 | MD | denotes | may |
T13738 | 42429-42433 | VB | denotes | play |
T13739 | 42434-42435 | DT | denotes | a |
T13740 | 42436-42441 | JJ | denotes | major |
T13741 | 42442-42446 | NN | denotes | role |
T13742 | 42447-42449 | IN | denotes | at |
T13743 | 42450-42453 | JJ | denotes | low |
T13744 | 42454-42468 | NN | denotes | corticosteroid |
T13745 | 42469-42483 | NN | denotes | concentrations |
T13746 | 42484-42490 | CC | denotes | and/or |
T13747 | 42491-42493 | IN | denotes | at |
T13748 | 42494-42499 | JJ | denotes | early |
T13749 | 42500-42504 | NN | denotes | time |
T13750 | 42505-42511 | NN | denotes | points |
T13751 | 42512-42517 | RB | denotes | prior |
T13752 | 42518-42520 | TO | denotes | to |
T13753 | 42521-42526 | NN | denotes | MKP-1 |
T13754 | 42527-42536 | NN | denotes | induction |
T13755 | 42538-42553 | NN | denotes | Corticosteroids |
T13756 | 42554-42557 | MD | denotes | can |
T13757 | 42558-42566 | VB | denotes | modulate |
T13758 | 42567-42570 | NN | denotes | p38 |
T13759 | 42571-42575 | NN | denotes | MAPK |
T13760 | 42576-42584 | NN | denotes | activity |
T13761 | 42585-42592 | IN | denotes | through |
T13762 | 42593-42596 | DT | denotes | the |
T13763 | 42597-42606 | NN | denotes | induction |
T13764 | 42607-42609 | IN | denotes | of |
T13765 | 42610-42615 | NN | denotes | MKP-1 |
T13766 | 42615-42616 | -COMMA- | denotes | , |
T13767 | 42617-42618 | DT | denotes | a |
T13768 | 42619-42625 | JJ | denotes | potent |
T13769 | 42626-42636 | JJ | denotes | endogenous |
T13770 | 42637-42646 | NN | denotes | inhibitor |
T13771 | 42647-42649 | IN | denotes | of |
T13772 | 42650-42654 | NN | denotes | MAPK |
T13773 | 42655-42663 | NN | denotes | function |
T13774 | 42664-42665 | -LRB- | denotes | [ |
T13775 | 42665-42667 | CD | denotes | 38 |
T13776 | 42667-42668 | -RRB- | denotes | ] |
T13777 | 42668-42669 | -COMMA- | denotes | , |
T13778 | 42669-42670 | -LRB- | denotes | [ |
T13779 | 42670-42672 | CD | denotes | 39 |
T13780 | 42672-42673 | -RRB- | denotes | ] |
T13781 | 42675-42677 | PRP | denotes | We |
T13782 | 42678-42684 | VB | denotes | report |
T13783 | 42685-42689 | RB | denotes | here |
T13784 | 42690-42691 | DT | denotes | a |
T13785 | 42692-42697 | JJ | denotes | rapid |
T13786 | 42698-42707 | NN | denotes | induction |
T13787 | 42708-42710 | IN | denotes | of |
T13788 | 42711-42716 | NN | denotes | MKP-1 |
T13789 | 42717-42721 | NN | denotes | mRNA |
T13790 | 42722-42731 | VB | denotes | following |
T13791 | 42732-42743 | NN | denotes | stimulation |
T13792 | 42744-42746 | IN | denotes | of |
T13793 | 42747-42752 | NN | denotes | cells |
T13794 | 42753-42757 | IN | denotes | with |
T13795 | 42758-42768 | RB | denotes | relatively |
T13796 | 42769-42773 | JJ | denotes | high |
T13797 | 42774-42788 | NN | denotes | concentrations |
T13798 | 42789-42791 | IN | denotes | of |
T13799 | 42792-42794 | NN | denotes | FP |
T13800 | 42796-42798 | PRP | denotes | We |
T13801 | 42799-42810 | VB | denotes | hypothesize |
T13802 | 42811-42815 | IN | denotes | that |
T13803 | 42816-42820 | DT | denotes | this |
T13804 | 42821-42826 | JJ | denotes | rapid |
T13805 | 42827-42836 | NN | denotes | induction |
T13806 | 42837-42839 | IN | denotes | of |
T13807 | 42840-42845 | NN | denotes | MKP-1 |
T13808 | 42846-42849 | MD | denotes | can |
T13809 | 42850-42856 | VB | denotes | reduce |
T13810 | 42857-42863 | NN | denotes | GATA-3 |
T13811 | 42864-42871 | JJ | denotes | nuclear |
T13812 | 42872-42878 | NN | denotes | import |
T13813 | 42879-42881 | IN | denotes | by |
T13814 | 42882-42893 | VB | denotes | attenuating |
T13815 | 42894-42897 | NN | denotes | p38 |
T13816 | 42898-42902 | NN | denotes | MAPK |
T13817 | 42903-42911 | NN | denotes | activity |
T13818 | 42912-42915 | CC | denotes | and |
T13819 | 42916-42926 | JJ | denotes | subsequent |
T13820 | 42927-42933 | NN | denotes | GATA-3 |
T13821 | 42934-42949 | NN | denotes | phosphorylation |
T13822 | 42949-42950 | -COMMA- | denotes | , |
T13823 | 42951-42955 | RB | denotes | thus |
T13824 | 42956-42966 | VB | denotes | preventing |
T13825 | 42967-42974 | JJ | denotes | nuclear |
T13826 | 42975-42988 | NN | denotes | translocation |
T13827 | 42990-42993 | DT | denotes | The |
T13828 | 42994-43002 | NN | denotes | location |
T13829 | 43003-43005 | IN | denotes | of |
T13830 | 43006-43009 | DT | denotes | the |
T13831 | 43010-43016 | NN | denotes | serine |
T13832 | 43017-43024 | NN | denotes | residue |
T13833 | 43024-43025 | -LRB- | denotes | ( |
T13834 | 43025-43026 | NN | denotes | s |
T13835 | 43026-43027 | -RRB- | denotes | ) |
T13836 | 43028-43030 | IN | denotes | of |
T13837 | 43031-43037 | NN | denotes | GATA-3 |
T13838 | 43038-43042 | WDT | denotes | that |
T13839 | 43043-43046 | VB | denotes | are |
T13840 | 43047-43061 | VB | denotes | phosphorylated |
T13841 | 43062-43064 | IN | denotes | by |
T13842 | 43065-43068 | NN | denotes | p38 |
T13843 | 43069-43073 | NN | denotes | MAPK |
T13844 | 43074-43077 | VB | denotes | are |
T13845 | 43078-43087 | RB | denotes | currently |
T13846 | 43088-43095 | JJ | denotes | unknown |
T13847 | 43095-43096 | -COMMA- | denotes | , |
T13848 | 43097-43100 | CC | denotes | but |
T13849 | 43101-43102 | DT | denotes | a |
T13850 | 43103-43117 | NN | denotes | bioinformatics |
T13851 | 43118-43124 | NN | denotes | search |
T13852 | 43125-43126 | -LRB- | denotes | ( |
T13853 | 43126-43131 | NNP | denotes | Motif |
T13854 | 43132-43139 | NNP | denotes | Scanner |
T13855 | 43139-43140 | -COMMA- | denotes | , |
T13856 | 43141-43145 | NN | denotes | http |
T13857 | 43145-43146 | -COLON- | denotes | : |
T13858 | 43146-43184 | LS | denotes | //scansite.mit.edu/motifscan_seq.phtml |
T13859 | 43184-43185 | -RRB- | denotes | ) |
T13860 | 43186-43195 | VB | denotes | indicates |
T13861 | 43196-43198 | IN | denotes | at |
T13862 | 43199-43204 | JJ | denotes | least |
T13863 | 43205-43210 | CD | denotes | three |
T13864 | 43211-43220 | JJ | denotes | potential |
T13865 | 43221-43224 | NN | denotes | p38 |
T13866 | 43225-43239 | JJ | denotes | MAPK-sensitive |
T13867 | 43240-43246 | NN | denotes | serine |
T13868 | 43247-43255 | NN | denotes | residues |
T13869 | 43257-43259 | IN | denotes | As |
T13870 | 43260-43269 | VB | denotes | predicted |
T13871 | 43270-43274 | IN | denotes | from |
T13872 | 43275-43280 | DT | denotes | these |
T13873 | 43281-43283 | FW | denotes | in |
T13874 | 43284-43289 | FW | denotes | vitro |
T13875 | 43290-43294 | NN | denotes | data |
T13876 | 43294-43295 | -COMMA- | denotes | , |
T13877 | 43296-43306 | NN | denotes | impairment |
T13878 | 43307-43309 | IN | denotes | of |
T13879 | 43310-43316 | NN | denotes | GATA-3 |
T13880 | 43317-43324 | JJ | denotes | nuclear |
T13881 | 43325-43331 | NN | denotes | import |
T13882 | 43332-43334 | IN | denotes | by |
T13883 | 43335-43337 | NN | denotes | FP |
T13884 | 43338-43341 | MD | denotes | may |
T13885 | 43341-43342 | -COMMA- | denotes | , |
T13886 | 43343-43345 | IN | denotes | at |
T13887 | 43346-43351 | JJ | denotes | least |
T13888 | 43352-43354 | IN | denotes | in |
T13889 | 43355-43359 | NN | denotes | part |
T13890 | 43359-43360 | -COMMA- | denotes | , |
T13891 | 43361-43369 | VB | denotes | underlie |
T13892 | 43370-43373 | DT | denotes | the |
T13893 | 43374-43382 | NN | denotes | efficacy |
T13894 | 43383-43385 | IN | denotes | of |
T13895 | 43386-43401 | NN | denotes | corticosteroids |
T13896 | 43402-43404 | IN | denotes | in |
T13897 | 43405-43416 | VB | denotes | suppressing |
T13898 | 43417-43425 | JJ | denotes | allergic |
T13899 | 43426-43438 | NN | denotes | inflammation |
T13900 | 43440-43448 | IN | denotes | Although |
T13901 | 43449-43451 | PRP | denotes | we |
T13902 | 43452-43455 | VB | denotes | did |
T13903 | 43456-43459 | RB | denotes | not |
T13904 | 43460-43466 | VB | denotes | assess |
T13905 | 43467-43470 | DT | denotes | the |
T13906 | 43471-43476 | JJ | denotes | acute |
T13907 | 43477-43487 | JJ | denotes | inhibitory |
T13908 | 43488-43494 | NN | denotes | effect |
T13909 | 43495-43497 | IN | denotes | of |
T13910 | 43498-43500 | NN | denotes | FP |
T13911 | 43501-43503 | IN | denotes | on |
T13912 | 43504-43507 | DT | denotes | the |
T13913 | 43508-43518 | NN | denotes | expression |
T13914 | 43519-43521 | IN | denotes | of |
T13915 | 43522-43526 | NN | denotes | IL-4 |
T13916 | 43527-43531 | NN | denotes | mRNA |
T13917 | 43532-43534 | FW | denotes | in |
T13918 | 43535-43539 | FW | denotes | vivo |
T13919 | 43539-43540 | -COMMA- | denotes | , |
T13920 | 43541-43542 | DT | denotes | a |
T13921 | 43543-43549 | JJ | denotes | single |
T13922 | 43550-43560 | NN | denotes | inhalation |
T13923 | 43561-43563 | IN | denotes | of |
T13924 | 43564-43566 | NN | denotes | FP |
T13925 | 43567-43568 | -LRB- | denotes | ( |
T13926 | 43568-43571 | CD | denotes | 500 |
T13927 | 43572-43574 | NN | denotes | µg |
T13928 | 43574-43575 | -RRB- | denotes | ) |
T13929 | 43576-43579 | MD | denotes | may |
T13930 | 43580-43584 | VB | denotes | have |
T13931 | 43585-43595 | JJ | denotes | comparable |
T13932 | 43596-43603 | NN | denotes | effects |
T13933 | 43603-43604 | -COMMA- | denotes | , |
T13934 | 43605-43607 | IN | denotes | as |
T13935 | 43608-43610 | PRP | denotes | it |
T13936 | 43611-43619 | VB | denotes | provides |
T13937 | 43620-43626 | NN | denotes | plasma |
T13938 | 43627-43633 | NN | denotes | levels |
T13939 | 43634-43640 | IN | denotes | within |
T13940 | 43641-43642 | DT | denotes | a |
T13941 | 43643-43651 | JJ | denotes | relevant |
T13942 | 43652-43657 | NN | denotes | range |
T13943 | 43658-43660 | IN | denotes | of |
T13944 | 43661-43675 | NN | denotes | concentrations |
T13945 | 43676-43680 | VB | denotes | used |
T13946 | 43681-43683 | TO | denotes | to |
T13947 | 43684-43692 | VB | denotes | suppress |
T13948 | 43693-43697 | NN | denotes | IL-4 |
T13949 | 43698-43711 | NN | denotes | transcription |
T13950 | 43712-43714 | IN | denotes | in |
T13951 | 43715-43718 | PRP-DOLLAR- | denotes | our |
T13952 | 43719-43721 | FW | denotes | in |
T13953 | 43722-43727 | FW | denotes | vitro |
T13954 | 43728-43734 | NN | denotes | system |
T13955 | 43735-43736 | -LRB- | denotes | [ |
T13956 | 43736-43738 | CD | denotes | 37 |
T13957 | 43738-43739 | -RRB- | denotes | ] |
T13958 | 43741-43742 | DT | denotes | A |
T13959 | 43743-43748 | JJ | denotes | lower |
T13960 | 43749-43753 | NN | denotes | dose |
T13961 | 43754-43756 | IN | denotes | of |
T13962 | 43757-43764 | VB | denotes | inhaled |
T13963 | 43765-43767 | NN | denotes | FP |
T13964 | 43768-43769 | -LRB- | denotes | ( |
T13965 | 43769-43772 | CD | denotes | 100 |
T13966 | 43773-43775 | NN | denotes | µg |
T13967 | 43775-43776 | -RRB- | denotes | ) |
T13968 | 43777-43780 | VB | denotes | was |
T13969 | 43781-43784 | RB | denotes | not |
T13970 | 43785-43794 | JJ | denotes | effective |
T13971 | 43794-43795 | -COMMA- | denotes | , |
T13972 | 43796-43799 | CC | denotes | but |
T13973 | 43800-43806 | NN | denotes | plasma |
T13974 | 43807-43821 | NN | denotes | concentrations |
T13975 | 43822-43825 | MD | denotes | may |
T13976 | 43826-43828 | VB | denotes | be |
T13977 | 43829-43834 | IN | denotes | below |
T13978 | 43835-43840 | DT | denotes | those |
T13979 | 43841-43849 | VB | denotes | required |
T13980 | 43850-43853 | IN | denotes | for |
T13981 | 43854-43860 | NN | denotes | GATA-3 |
T13982 | 43861-43871 | NN | denotes | inhibition |
T13983 | 43873-43880 | RB | denotes | However |
T13984 | 43880-43881 | -COMMA- | denotes | , |
T13985 | 43882-43884 | PRP | denotes | it |
T13986 | 43885-43887 | VB | denotes | is |
T13987 | 43888-43894 | JJ | denotes | likely |
T13988 | 43895-43899 | IN | denotes | that |
T13989 | 43900-43903 | DT | denotes | the |
T13990 | 43904-43910 | JJ | denotes | higher |
T13991 | 43911-43925 | NN | denotes | concentrations |
T13992 | 43926-43928 | IN | denotes | of |
T13993 | 43929-43931 | NN | denotes | FP |
T13994 | 43932-43934 | IN | denotes | in |
T13995 | 43935-43938 | DT | denotes | the |
T13996 | 43939-43946 | NN | denotes | airways |
T13997 | 43947-43952 | IN | denotes | after |
T13998 | 43953-43960 | VB | denotes | inhaled |
T13999 | 43961-43975 | NN | denotes | administration |
T14000 | 43976-43981 | MD | denotes | would |
T14001 | 43982-43984 | VB | denotes | be |
T14002 | 43985-43994 | JJ | denotes | effective |
T14003 | 43995-43997 | IN | denotes | in |
T14004 | 43998-44008 | VB | denotes | inhibiting |
T14005 | 44009-44015 | NN | denotes | GATA-3 |
T14006 | 44016-44018 | IN | denotes | in |
T14007 | 44019-44025 | NN | denotes | airway |
T14008 | 44026-44027 | NN | denotes | T |
T14009 | 44028-44033 | NN | denotes | cells |
T14010 | 44034-44036 | IN | denotes | of |
T14011 | 44037-44043 | NN | denotes | asthma |
T14012 | 44044-44052 | NN | denotes | patients |
T14013 | 44054-44057 | DT | denotes | The |
T14014 | 44058-44063 | NN | denotes | study |
T14015 | 44064-44066 | IN | denotes | of |
T14016 | 44067-44072 | NN | denotes | PBMCs |
T14017 | 44073-44077 | IN | denotes | from |
T14018 | 44078-44084 | NN | denotes | asthma |
T14019 | 44085-44093 | NN | denotes | patients |
T14020 | 44094-44101 | VB | denotes | treated |
T14021 | 44102-44106 | IN | denotes | with |
T14022 | 44107-44114 | VB | denotes | inhaled |
T14023 | 44115-44129 | NN | denotes | corticosteroid |
T14024 | 44130-44137 | NN | denotes | therapy |
T14025 | 44138-44145 | RB | denotes | clearly |
T14026 | 44146-44158 | VB | denotes | demonstrates |
T14027 | 44159-44163 | IN | denotes | that |
T14028 | 44164-44169 | DT | denotes | these |
T14029 | 44170-44179 | JJ | denotes | molecular |
T14030 | 44180-44190 | NN | denotes | mechanisms |
T14031 | 44191-44194 | VB | denotes | are |
T14032 | 44195-44201 | JJ | denotes | likely |
T14033 | 44202-44204 | TO | denotes | to |
T14034 | 44205-44209 | RB | denotes | also |
T14035 | 44210-44215 | VB | denotes | occur |
T14036 | 44216-44218 | IN | denotes | in |
T14037 | 44219-44227 | NN | denotes | patients |
T14038 | 44228-44230 | IN | denotes | at |
T14039 | 44231-44242 | JJ | denotes | therapeutic |
T14040 | 44243-44248 | NN | denotes | doses |
T14041 | 44249-44251 | IN | denotes | of |
T14042 | 44252-44259 | VB | denotes | inhaled |
T14043 | 44260-44275 | NN | denotes | corticosteroids |
T14044 | 44277-44279 | IN | denotes | In |
T14045 | 44280-44288 | NN | denotes | addition |
T14046 | 44288-44289 | -COMMA- | denotes | , |
T14047 | 44290-44298 | JJ | denotes | previous |
T14048 | 44299-44306 | NN | denotes | studies |
T14049 | 44307-44311 | VB | denotes | have |
T14050 | 44312-44317 | VB | denotes | shown |
T14051 | 44318-44322 | IN | denotes | that |
T14052 | 44323-44338 | NN | denotes | corticosteroids |
T14053 | 44339-44342 | MD | denotes | can |
T14054 | 44343-44351 | VB | denotes | suppress |
T14055 | 44352-44356 | NN | denotes | IL-4 |
T14056 | 44357-44360 | CC | denotes | and |
T14057 | 44361-44365 | NN | denotes | IL-5 |
T14058 | 44366-44373 | NN | denotes | release |
T14059 | 44374-44378 | IN | denotes | from |
T14060 | 44379-44389 | JJ | denotes | peripheral |
T14061 | 44390-44395 | NN | denotes | blood |
T14062 | 44396-44401 | NN | denotes | cells |
T14063 | 44402-44404 | IN | denotes | of |
T14064 | 44405-44411 | NN | denotes | asthma |
T14065 | 44412-44420 | NN | denotes | patients |
T14066 | 44421-44423 | FW | denotes | in |
T14067 | 44424-44429 | FW | denotes | vitro |
T14068 | 44430-44433 | CC | denotes | and |
T14069 | 44434-44436 | FW | denotes | in |
T14070 | 44437-44441 | FW | denotes | vivo |
T14071 | 44442-44443 | -LRB- | denotes | [ |
T14072 | 44443-44445 | CD | denotes | 40 |
T14073 | 44445-44446 | -RRB- | denotes | ] |
T14074 | 44446-44447 | CD | denotes | – |
T14075 | 44447-44448 | -LRB- | denotes | [ |
T14076 | 44448-44450 | CD | denotes | 42 |
T14077 | 44450-44451 | -RRB- | denotes | ] |
T14078 | 44453-44455 | IN | denotes | In |
T14079 | 44456-44463 | NN | denotes | summary |
T14080 | 44463-44464 | -COMMA- | denotes | , |
T14081 | 44465-44468 | PRP-DOLLAR- | denotes | our |
T14082 | 44469-44473 | NN | denotes | data |
T14083 | 44474-44481 | VB | denotes | provide |
T14084 | 44482-44490 | NN | denotes | evidence |
T14085 | 44491-44494 | IN | denotes | for |
T14086 | 44495-44496 | DT | denotes | a |
T14087 | 44497-44502 | JJ | denotes | novel |
T14088 | 44503-44509 | NN | denotes | action |
T14089 | 44510-44512 | IN | denotes | of |
T14090 | 44513-44528 | NN | denotes | corticosteroids |
T14091 | 44528-44529 | -COLON- | denotes | : |
T14092 | 44530-44541 | NN | denotes | suppression |
T14093 | 44542-44544 | IN | denotes | of |
T14094 | 44545-44553 | JJ | denotes | allergic |
T14095 | 44554-44566 | NN | denotes | inflammation |
T14096 | 44567-44574 | IN | denotes | through |
T14097 | 44575-44576 | DT | denotes | a |
T14098 | 44577-44582 | JJ | denotes | rapid |
T14099 | 44583-44593 | JJ | denotes | inhibitory |
T14100 | 44594-44600 | NN | denotes | effect |
T14101 | 44601-44603 | IN | denotes | on |
T14102 | 44604-44610 | NN | denotes | GATA-3 |
T14103 | 44611-44618 | JJ | denotes | nuclear |
T14104 | 44619-44632 | NN | denotes | translocation |
T14105 | 44633-44635 | IN | denotes | by |
T14106 | 44636-44648 | JJ | denotes | preferential |
T14107 | 44649-44656 | NN | denotes | binding |
T14108 | 44657-44659 | TO | denotes | to |
T14109 | 44660-44663 | DT | denotes | the |
T14110 | 44664-44670 | JJ | denotes | shared |
T14111 | 44671-44678 | JJ | denotes | nuclear |
T14112 | 44679-44685 | NN | denotes | import |
T14113 | 44686-44693 | NN | denotes | protein |
T14114 | 44694-44704 | NN | denotes | importin-α |
T14115 | 44705-44708 | CC | denotes | and |
T14116 | 44709-44711 | IN | denotes | by |
T14117 | 44712-44713 | DT | denotes | a |
T14118 | 44714-44720 | JJ | denotes | second |
T14119 | 44721-44730 | NN | denotes | mechanism |
T14120 | 44731-44740 | VB | denotes | involving |
T14121 | 44741-44750 | VB | denotes | increased |
T14122 | 44751-44760 | NN | denotes | synthesis |
T14123 | 44761-44763 | IN | denotes | of |
T14124 | 44764-44769 | NN | denotes | MKP-1 |
T14125 | 44769-44770 | -COMMA- | denotes | , |
T14126 | 44771-44776 | WDT | denotes | which |
T14127 | 44777-44785 | VB | denotes | inhibits |
T14128 | 44786-44789 | NN | denotes | p38 |
T14129 | 44790-44794 | NN | denotes | MAPK |
T14130 | 44794-44795 | -COMMA- | denotes | , |
T14131 | 44796-44800 | RB | denotes | thus |
T14132 | 44801-44811 | VB | denotes | preventing |
T14133 | 44812-44815 | DT | denotes | the |
T14134 | 44816-44831 | NN | denotes | phosphorylation |
T14135 | 44832-44834 | IN | denotes | of |
T14136 | 44835-44841 | NN | denotes | GATA-3 |
T14137 | 44842-44846 | WDT | denotes | that |
T14138 | 44847-44849 | VB | denotes | is |
T14139 | 44850-44859 | JJ | denotes | necessary |
T14140 | 44860-44863 | IN | denotes | for |
T14141 | 44864-44871 | JJ | denotes | nuclear |
T14142 | 44872-44885 | NN | denotes | translocation |
T14143 | 44886-44888 | IN | denotes | of |
T14144 | 44889-44895 | NN | denotes | GATA-3 |
T14145 | 44897-44902 | DT | denotes | These |
T14146 | 44903-44906 | CD | denotes | two |
T14147 | 44907-44917 | NN | denotes | mechanisms |
T14148 | 44918-44921 | VB | denotes | are |
T14149 | 44922-44928 | JJ | denotes | likely |
T14150 | 44929-44931 | TO | denotes | to |
T14151 | 44932-44934 | VB | denotes | be |
T14152 | 44935-44946 | JJ | denotes | synergistic |
T14153 | 44946-44947 | -COMMA- | denotes | , |
T14154 | 44948-44958 | VB | denotes | accounting |
T14155 | 44959-44962 | IN | denotes | for |
T14156 | 44963-44966 | DT | denotes | the |
T14157 | 44967-44972 | JJ | denotes | rapid |
T14158 | 44973-44976 | CC | denotes | and |
T14159 | 44977-44983 | JJ | denotes | potent |
T14160 | 44984-44990 | NN | denotes | effect |
T14161 | 44991-44993 | IN | denotes | of |
T14162 | 44994-45009 | NN | denotes | corticosteroids |
T14163 | 45010-45012 | IN | denotes | on |
T14164 | 45013-45021 | JJ | denotes | allergic |
T14165 | 45022-45034 | NN | denotes | inflammation |
T14166 | 45036-45040 | DT | denotes | This |
T14167 | 45041-45043 | VB | denotes | is |
T14168 | 45044-45055 | VB | denotes | exemplified |
T14169 | 45056-45058 | IN | denotes | by |
T14170 | 45059-45062 | DT | denotes | the |
T14171 | 45063-45068 | JJ | denotes | rapid |
T14172 | 45069-45079 | JJ | denotes | inhibitory |
T14173 | 45080-45086 | NN | denotes | effect |
T14174 | 45087-45089 | IN | denotes | of |
T14175 | 45090-45097 | JJ | denotes | topical |
T14176 | 45098-45113 | NN | denotes | corticosteroids |
T14177 | 45114-45116 | IN | denotes | on |
T14178 | 45117-45122 | JJ | denotes | nasal |
T14179 | 45123-45126 | NN | denotes | Th2 |
T14180 | 45127-45135 | NN | denotes | cytokine |
T14181 | 45136-45143 | NN | denotes | release |
T14182 | 45144-45149 | IN | denotes | after |
T14183 | 45150-45158 | NN | denotes | allergen |
T14184 | 45159-45170 | NN | denotes | provocation |
T14185 | 45171-45173 | IN | denotes | in |
T14186 | 45174-45185 | NN | denotes | individuals |
T14187 | 45186-45190 | IN | denotes | with |
T14188 | 45191-45199 | JJ | denotes | seasonal |
T14189 | 45200-45208 | JJ | denotes | allergic |
T14190 | 45209-45217 | NN | denotes | rhinitis |
T14191 | 45218-45219 | -LRB- | denotes | ( |
T14192 | 45219-45222 | NN | denotes | hay |
T14193 | 45223-45228 | NN | denotes | fever |
T14194 | 45228-45229 | -RRB- | denotes | ) |
T14195 | 45230-45231 | -LRB- | denotes | [ |
T14196 | 45231-45233 | CD | denotes | 43 |
T14197 | 45233-45234 | -RRB- | denotes | ] |
T14198 | 45236-45246 | NN | denotes | Prevention |
T14199 | 45247-45249 | IN | denotes | of |
T14200 | 45250-45264 | NN | denotes | phospho-GATA-3 |
T14201 | 45265-45276 | NN | denotes | interaction |
T14202 | 45277-45281 | IN | denotes | with |
T14203 | 45282-45292 | NN | denotes | importin-α |
T14204 | 45293-45296 | MD | denotes | may |
T14205 | 45297-45304 | VB | denotes | provide |
T14206 | 45305-45306 | DT | denotes | a |
T14207 | 45307-45310 | JJ | denotes | new |
T14208 | 45311-45319 | NN | denotes | approach |
T14209 | 45320-45323 | IN | denotes | for |
T14210 | 45324-45327 | DT | denotes | the |
T14211 | 45328-45339 | NN | denotes | development |
T14212 | 45340-45342 | IN | denotes | of |
T14213 | 45343-45348 | JJ | denotes | novel |
T14214 | 45349-45358 | NN | denotes | therapies |
T14215 | 45359-45362 | IN | denotes | for |
T14216 | 45363-45366 | DT | denotes | the |
T14217 | 45367-45376 | NN | denotes | treatment |
T14218 | 45377-45379 | IN | denotes | of |
T14219 | 45380-45388 | JJ | denotes | allergic |
T14220 | 45389-45397 | NN | denotes | diseases |
T16038 | 24319-24330 | NN | denotes | Fluticasone |
T16039 | 24331-24341 | NN | denotes | propionate |
T16040 | 24342-24356 | VB | denotes | down-regulates |
T16041 | 24357-24360 | NN | denotes | Th2 |
T16042 | 24361-24369 | NN | denotes | cytokine |
T16043 | 24370-24374 | NN | denotes | gene |
T16044 | 24375-24385 | NN | denotes | expression |
T16045 | 24386-24389 | CC | denotes | and |
T16046 | 24390-24398 | VB | denotes | inhibits |
T16047 | 24399-24405 | NN | denotes | GATA-3 |
T16048 | 24406-24413 | JJ | denotes | nuclear |
T16049 | 24414-24420 | NN | denotes | import |
T16050 | 24422-24423 | -LRB- | denotes | ( |
T16051 | 24423-24424 | NN | denotes | A |
T16052 | 24424-24425 | -RRB- | denotes | ) |
T16053 | 24426-24439 | JJ | denotes | Anti-CD3/CD28 |
T16054 | 24440-24449 | NN | denotes | treatment |
T16055 | 24450-24452 | IN | denotes | of |
T16056 | 24453-24459 | NN | denotes | HuT-78 |
T16057 | 24460-24465 | NN | denotes | cells |
T16058 | 24466-24473 | VB | denotes | results |
T16059 | 24474-24476 | IN | denotes | in |
T16060 | 24477-24490 | NN | denotes | translocation |
T16061 | 24491-24493 | IN | denotes | of |
T16062 | 24494-24500 | NN | denotes | GATA-3 |
T16063 | 24501-24505 | IN | denotes | from |
T16064 | 24506-24509 | DT | denotes | the |
T16065 | 24510-24519 | NN | denotes | cytoplasm |
T16066 | 24520-24522 | TO | denotes | to |
T16067 | 24523-24526 | DT | denotes | the |
T16068 | 24527-24534 | NN | denotes | nucleus |
T16069 | 24535-24541 | IN | denotes | within |
T16070 | 24542-24544 | CD | denotes | 30 |
T16071 | 24545-24549 | NN | denotes | min. |
T16072 | 24550-24551 | -LRB- | denotes | ( |
T16073 | 24551-24552 | NN | denotes | B |
T16074 | 24552-24553 | -RRB- | denotes | ) |
T16075 | 24554-24561 | NN | denotes | Histone |
T16076 | 24562-24564 | NN | denotes | H1 |
T16077 | 24565-24568 | CC | denotes | and |
T16078 | 24569-24574 | NN | denotes | MEK-1 |
T16079 | 24575-24579 | VB | denotes | were |
T16080 | 24580-24584 | VB | denotes | used |
T16081 | 24585-24587 | TO | denotes | to |
T16082 | 24588-24595 | VB | denotes | confirm |
T16083 | 24596-24604 | JJ | denotes | distinct |
T16084 | 24605-24615 | NN | denotes | separation |
T16085 | 24616-24618 | IN | denotes | of |
T16086 | 24619-24630 | JJ | denotes | cytoplasmic |
T16087 | 24631-24634 | CC | denotes | and |
T16088 | 24635-24642 | JJ | denotes | nuclear |
T16089 | 24643-24651 | NN | denotes | extracts |
T16090 | 24652-24654 | IN | denotes | in |
T16091 | 24655-24660 | CD | denotes | three |
T16092 | 24661-24669 | JJ | denotes | separate |
T16093 | 24670-24682 | NN | denotes | experiments. |
T16094 | 24683-24684 | -LRB- | denotes | ( |
T16095 | 24684-24685 | NN | denotes | C |
T16096 | 24685-24686 | -RRB- | denotes | ) |
T16097 | 24687-24694 | JJ | denotes | Western |
T16098 | 24695-24699 | NN | denotes | blot |
T16099 | 24700-24708 | NN | denotes | analysis |
T16100 | 24709-24711 | IN | denotes | of |
T16101 | 24712-24722 | JJ | denotes | FP-treated |
T16102 | 24723-24729 | NN | denotes | HuT-78 |
T16103 | 24730-24735 | NN | denotes | cells |
T16104 | 24736-24748 | VB | denotes | demonstrated |
T16105 | 24749-24757 | JJ | denotes | impaired |
T16106 | 24758-24765 | JJ | denotes | nuclear |
T16107 | 24766-24778 | NN | denotes | localization |
T16108 | 24779-24781 | IN | denotes | of |
T16109 | 24782-24788 | NN | denotes | GATA-3 |
T16110 | 24789-24796 | VB | denotes | induced |
T16111 | 24797-24799 | IN | denotes | by |
T16112 | 24800-24813 | JJ | denotes | anti-CD3/CD28 |
T16113 | 24814-24828 | NN | denotes | co-stimulation |
T16114 | 24829-24831 | IN | denotes | in |
T16115 | 24832-24833 | DT | denotes | a |
T16116 | 24834-24839 | NN | denotes | time- |
T16117 | 24840-24841 | -LRB- | denotes | ( |
T16118 | 24841-24843 | IN | denotes | at |
T16119 | 24844-24848 | CD | denotes | 10−8 |
T16120 | 24849-24850 | NN | denotes | M |
T16121 | 24851-24853 | NN | denotes | FP |
T16122 | 24853-24854 | -RRB- | denotes | ) |
T16123 | 24855-24858 | CC | denotes | and |
T16124 | 24859-24873 | NN | denotes | concentration- |
T16125 | 24874-24875 | -LRB- | denotes | ( |
T16126 | 24875-24877 | IN | denotes | at |
T16127 | 24878-24880 | CD | denotes | 60 |
T16128 | 24881-24884 | NN | denotes | min |
T16129 | 24885-24890 | IN | denotes | after |
T16130 | 24891-24902 | NN | denotes | stimulation |
T16131 | 24902-24903 | -RRB- | denotes | ) |
T16132 | 24904-24913 | JJ | denotes | dependent |
T16133 | 24914-24920 | NN | denotes | manner |
T16134 | 24922-24927 | NN | denotes | Cells |
T16135 | 24928-24932 | VB | denotes | were |
T16136 | 24933-24943 | VB | denotes | pretreated |
T16137 | 24944-24948 | IN | denotes | with |
T16138 | 24949-24951 | NN | denotes | FP |
T16139 | 24952-24955 | IN | denotes | for |
T16140 | 24956-24958 | CD | denotes | 30 |
T16141 | 24959-24962 | NN | denotes | min |
T16142 | 24963-24968 | JJ | denotes | prior |
T16143 | 24969-24971 | TO | denotes | to |
T16144 | 24972-24983 | NN | denotes | stimulation |
T16145 | 24985-24989 | NN | denotes | MEK1 |
T16146 | 24990-24993 | CC | denotes | and |
T16147 | 24994-25001 | NN | denotes | histone |
T16148 | 25002-25004 | NN | denotes | H1 |
T16149 | 25005-25009 | VB | denotes | were |
T16150 | 25010-25014 | VB | denotes | used |
T16151 | 25015-25017 | TO | denotes | to |
T16152 | 25018-25029 | VB | denotes | demonstrate |
T16153 | 25030-25035 | JJ | denotes | equal |
T16154 | 25036-25047 | JJ | denotes | cytoplasmic |
T16155 | 25048-25051 | CC | denotes | and |
T16156 | 25052-25059 | JJ | denotes | nuclear |
T16157 | 25060-25067 | NN | denotes | loading |
T16158 | 25068-25080 | RB | denotes | respectively |
T16159 | 25082-25089 | NN | denotes | Results |
T16160 | 25090-25093 | VB | denotes | are |
T16161 | 25094-25103 | VB | denotes | presented |
T16162 | 25104-25115 | RB | denotes | graphically |
T16163 | 25116-25121 | IN | denotes | below |
T16164 | 25122-25124 | IN | denotes | as |
T16165 | 25125-25133 | NN | denotes | mean±SEM |
T16166 | 25134-25136 | IN | denotes | of |
T16167 | 25137-25139 | IN | denotes | at |
T16168 | 25140-25145 | JJ | denotes | least |
T16169 | 25146-25151 | CD | denotes | three |
T16170 | 25152-25163 | JJ | denotes | independent |
T16171 | 25164-25176 | NN | denotes | experiments. |
T16172 | 25177-25180 | SYM | denotes | *** |
T16173 | 25181-25182 | NN | denotes | p |
T16174 | 25182-25183 | SYM | denotes | < |
T16175 | 25183-25188 | CD | denotes | 0.001 |
T16176 | 25189-25197 | VB | denotes | compared |
T16177 | 25198-25200 | TO | denotes | to |
T16178 | 25201-25207 | NN | denotes | t = 0. |
T16179 | 25208-25209 | -LRB- | denotes | ( |
T16180 | 25209-25210 | NN | denotes | D |
T16181 | 25210-25211 | -RRB- | denotes | ) |
T16182 | 25212-25218 | NN | denotes | RT-PCR |
T16183 | 25219-25226 | VB | denotes | showing |
T16184 | 25227-25231 | IN | denotes | that |
T16185 | 25232-25234 | NN | denotes | FP |
T16186 | 25235-25243 | VB | denotes | inhibits |
T16187 | 25244-25248 | NN | denotes | IL-4 |
T16188 | 25249-25252 | CC | denotes | and |
T16189 | 25253-25257 | NN | denotes | IL-5 |
T16190 | 25258-25262 | NN | denotes | mRNA |
T16191 | 25263-25273 | NN | denotes | expression |
T16192 | 25274-25276 | IN | denotes | in |
T16193 | 25277-25298 | JJ | denotes | CD3/CD28-costimulated |
T16194 | 25299-25304 | NN | denotes | cells |
T16195 | 25306-25311 | NN | denotes | GAPDH |
T16196 | 25312-25315 | VB | denotes | was |
T16197 | 25316-25320 | VB | denotes | used |
T16198 | 25321-25323 | IN | denotes | as |
T16199 | 25324-25325 | DT | denotes | a |
T16200 | 25326-25333 | NN | denotes | loading |
T16201 | 25334-25341 | NN | denotes | control |
T16202 | 25343-25348 | JJ | denotes | Lower |
T16203 | 25349-25355 | NN | denotes | panels |
T16204 | 25356-25360 | VB | denotes | show |
T16205 | 25361-25370 | JJ | denotes | graphical |
T16206 | 25371-25379 | NN | denotes | analysis |
T16207 | 25380-25382 | IN | denotes | of |
T16208 | 25383-25390 | NN | denotes | results |
T16209 | 25391-25400 | VB | denotes | presented |
T16210 | 25401-25403 | IN | denotes | as |
T16211 | 25404-25412 | NN | denotes | mean±SEM |
T16212 | 25413-25415 | IN | denotes | of |
T16213 | 25416-25418 | IN | denotes | at |
T16214 | 25419-25424 | JJ | denotes | least |
T16215 | 25425-25430 | CD | denotes | three |
T16216 | 25431-25442 | JJ | denotes | independent |
T16217 | 25443-25455 | NN | denotes | experiments. |
T16218 | 25456-25457 | -SHARP- | denotes | # |
T16219 | 25457-25458 | -SHARP- | denotes | # |
T16220 | 25458-25459 | -SHARP- | denotes | # |
T16221 | 25181-25182 | NN | denotes | p |
T16222 | 25182-25183 | SYM | denotes | < |
T16223 | 25183-25188 | CD | denotes | 0.001 |
T16224 | 25189-25197 | VB | denotes | compared |
T16225 | 25198-25200 | TO | denotes | to |
T16226 | 25480-25487 | NN | denotes | control |
T16227 | 25487-25488 | -COMMA- | denotes | , |
T16228 | 25489-25493 | NN | denotes | ***p |
T16229 | 25493-25494 | SYM | denotes | < |
T16230 | 25494-25499 | CD | denotes | 0.001 |
T16231 | 25500-25508 | VB | denotes | compared |
T16232 | 25509-25511 | TO | denotes | to |
T16233 | 25512-25537 | JJ | denotes | anti-CD3/CD28–stimulated. |
T16234 | 25538-25539 | -LRB- | denotes | ( |
T16235 | 25539-25540 | NN | denotes | E |
T16236 | 25540-25541 | -RRB- | denotes | ) |
T16237 | 25542-25544 | NN | denotes | FP |
T16238 | 25545-25546 | -LRB- | denotes | ( |
T16239 | 25546-25548 | CD | denotes | 10 |
T16240 | 25549-25551 | NN | denotes | nM |
T16241 | 25551-25552 | -RRB- | denotes | ) |
T16242 | 25553-25560 | VB | denotes | reduces |
T16243 | 25561-25564 | DT | denotes | the |
T16244 | 25565-25572 | NN | denotes | ability |
T16245 | 25573-25575 | IN | denotes | of |
T16246 | 25576-25600 | JJ | denotes | anti-CD3/CD28-stimulated |
T16247 | 25601-25607 | NN | denotes | GATA-3 |
T16248 | 25608-25610 | TO | denotes | to |
T16249 | 25611-25620 | VB | denotes | associate |
T16250 | 25621-25625 | IN | denotes | with |
T16251 | 25626-25629 | DT | denotes | the |
T16252 | 25630-25636 | JJ | denotes | native |
T16253 | 25637-25641 | NN | denotes | IL-5 |
T16254 | 25642-25650 | NN | denotes | promoter |
T16255 | 25651-25653 | CD | denotes | 60 |
T16256 | 25654-25657 | NN | denotes | min |
T16257 | 25658-25663 | IN | denotes | after |
T16258 | 25664-25675 | NN | denotes | stimulation |
T16259 | 25677-25681 | NN | denotes | Data |
T16260 | 25682-25685 | VB | denotes | are |
T16261 | 25686-25690 | RB | denotes | also |
T16262 | 25691-25696 | VB | denotes | shown |
T16263 | 25697-25708 | RB | denotes | graphically |
T16264 | 25709-25711 | IN | denotes | as |
T16265 | 25712-25720 | NN | denotes | mean±SEM |
T16266 | 25721-25723 | IN | denotes | of |
T16267 | 25724-25729 | CD | denotes | three |
T16268 | 25730-25741 | JJ | denotes | independent |
T16269 | 25742-25753 | NN | denotes | experiments |
T16270 | 25755-25758 | DT | denotes | All |
T16271 | 25759-25763 | NN | denotes | data |
T16272 | 25764-25768 | VB | denotes | were |
T16273 | 25769-25777 | VB | denotes | analysed |
T16274 | 25778-25780 | IN | denotes | by |
T16275 | 25781-25786 | NN | denotes | ANOVA |
T16276 | 25787-25795 | VB | denotes | followed |
T16277 | 25796-25798 | IN | denotes | by |
T16278 | 25799-25811 | NN | denotes | Newman-Keuls |
T16279 | 25812-25821 | JJ | denotes | post-test |
T16826 | 26735-26746 | NN | denotes | Fluticasone |
T16827 | 26747-26757 | NN | denotes | propionate |
T16828 | 26758-26765 | VB | denotes | reduces |
T16829 | 26766-26772 | NN | denotes | GATA-3 |
T16830 | 26773-26784 | NN | denotes | association |
T16831 | 26785-26789 | IN | denotes | with |
T16832 | 26790-26800 | NN | denotes | importin-α |
T16833 | 26801-26804 | CC | denotes | and |
T16834 | 26805-26811 | NN | denotes | GATA-3 |
T16835 | 26812-26819 | JJ | denotes | nuclear |
T16836 | 26820-26826 | NN | denotes | import |
T16837 | 26828-26829 | -LRB- | denotes | ( |
T16838 | 26829-26830 | NN | denotes | A |
T16839 | 26830-26831 | -RRB- | denotes | ) |
T16840 | 26832-26839 | JJ | denotes | Western |
T16841 | 26840-26844 | NN | denotes | blot |
T16842 | 26845-26853 | NN | denotes | analysis |
T16843 | 26854-26866 | VB | denotes | demonstrates |
T16844 | 26867-26868 | DT | denotes | a |
T16845 | 26869-26874 | NN | denotes | time- |
T16846 | 26875-26876 | -LRB- | denotes | ( |
T16847 | 26876-26878 | IN | denotes | at |
T16848 | 26879-26883 | CD | denotes | 10−8 |
T16849 | 26884-26885 | NN | denotes | M |
T16850 | 26886-26888 | NN | denotes | FP |
T16851 | 26888-26889 | -RRB- | denotes | ) |
T16852 | 26890-26893 | CC | denotes | and |
T16853 | 26894-26908 | NN | denotes | concentration- |
T16854 | 26909-26910 | -LRB- | denotes | ( |
T16855 | 26910-26912 | IN | denotes | at |
T16856 | 26913-26915 | CD | denotes | 60 |
T16857 | 26916-26919 | NN | denotes | min |
T16858 | 26920-26925 | IN | denotes | after |
T16859 | 26926-26937 | NN | denotes | stimulation |
T16860 | 26937-26938 | -RRB- | denotes | ) |
T16861 | 26939-26948 | JJ | denotes | dependent |
T16862 | 26949-26958 | NN | denotes | induction |
T16863 | 26959-26961 | IN | denotes | of |
T16864 | 26962-26974 | JJ | denotes | FP-activated |
T16865 | 26975-26977 | NN | denotes | GR |
T16866 | 26978-26989 | NN | denotes | interaction |
T16867 | 26990-26994 | IN | denotes | with |
T16868 | 26995-27005 | NN | denotes | importin-α |
T16869 | 27006-27007 | -LRB- | denotes | ( |
T16870 | 27007-27012 | NN | denotes | Imp-α |
T16871 | 27012-27013 | -RRB- | denotes | ) |
T16872 | 27015-27016 | DT | denotes | A |
T16873 | 27017-27025 | JJ | denotes | positive |
T16874 | 27026-27033 | NN | denotes | control |
T16875 | 27034-27037 | IN | denotes | for |
T16876 | 27038-27040 | NN | denotes | GR |
T16877 | 27041-27052 | NN | denotes | association |
T16878 | 27053-27057 | IN | denotes | with |
T16879 | 27058-27066 | NN | denotes | importin |
T16880 | 27067-27069 | VB | denotes | is |
T16881 | 27070-27075 | VB | denotes | shown |
T16882 | 27077-27091 | NN | denotes | Quantification |
T16883 | 27092-27094 | IN | denotes | of |
T16884 | 27095-27098 | DT | denotes | the |
T16885 | 27099-27111 | NN | denotes | densitometry |
T16886 | 27112-27116 | NN | denotes | data |
T16887 | 27117-27119 | VB | denotes | is |
T16888 | 27120-27125 | VB | denotes | shown |
T16889 | 27126-27131 | IN | denotes | below |
T16890 | 27133-27137 | DT | denotes | Each |
T16891 | 27138-27141 | NN | denotes | bar |
T16892 | 27142-27152 | VB | denotes | represents |
T16893 | 27153-27161 | NN | denotes | mean±SEM |
T16894 | 27162-27164 | IN | denotes | of |
T16895 | 27165-27167 | IN | denotes | at |
T16896 | 27168-27173 | JJ | denotes | least |
T16897 | 27174-27179 | CD | denotes | three |
T16898 | 27180-27191 | JJ | denotes | independent |
T16899 | 27192-27204 | NN | denotes | experiments. |
T16900 | 27205-27208 | SYM | denotes | *** |
T16901 | 27209-27210 | NN | denotes | p |
T16902 | 27210-27211 | SYM | denotes | < |
T16903 | 27211-27216 | CD | denotes | 0.001 |
T16904 | 27217-27225 | VB | denotes | compared |
T16905 | 27226-27228 | TO | denotes | to |
T16906 | 27229-27236 | NN | denotes | control |
T16907 | 27236-27237 | -COMMA- | denotes | , |
T16908 | 27238-27239 | -SHARP- | denotes | # |
T16909 | 27239-27240 | -SHARP- | denotes | # |
T16910 | 27240-27241 | -SHARP- | denotes | # |
T16911 | 27242-27243 | NN | denotes | p |
T16912 | 27243-27244 | SYM | denotes | < |
T16913 | 27244-27250 | CD | denotes | 0.001. |
T16914 | 27251-27252 | -LRB- | denotes | ( |
T16915 | 27252-27253 | NN | denotes | B |
T16916 | 27253-27254 | -RRB- | denotes | ) |
T16917 | 27255-27262 | JJ | denotes | Western |
T16918 | 27263-27267 | NN | denotes | blot |
T16919 | 27268-27276 | NN | denotes | analysis |
T16920 | 27277-27289 | VB | denotes | demonstrated |
T16921 | 27290-27291 | DT | denotes | a |
T16922 | 27292-27297 | NN | denotes | time- |
T16923 | 27298-27299 | -LRB- | denotes | ( |
T16924 | 27299-27301 | IN | denotes | at |
T16925 | 27302-27306 | CD | denotes | 10−8 |
T16926 | 27307-27308 | NN | denotes | M |
T16927 | 27309-27311 | NN | denotes | FP |
T16928 | 27311-27312 | -RRB- | denotes | ) |
T16929 | 27313-27316 | CC | denotes | and |
T16930 | 27317-27331 | NN | denotes | concentration- |
T16931 | 27332-27333 | -LRB- | denotes | ( |
T16932 | 27333-27335 | IN | denotes | at |
T16933 | 27336-27338 | CD | denotes | 60 |
T16934 | 27339-27342 | NN | denotes | min |
T16935 | 27343-27348 | IN | denotes | after |
T16936 | 27349-27360 | NN | denotes | stimulation |
T16937 | 27360-27361 | -RRB- | denotes | ) |
T16938 | 27362-27371 | JJ | denotes | dependent |
T16939 | 27372-27381 | NN | denotes | induction |
T16940 | 27382-27384 | IN | denotes | of |
T16941 | 27385-27397 | JJ | denotes | FP-activated |
T16942 | 27398-27400 | NN | denotes | GR |
T16943 | 27401-27408 | JJ | denotes | nuclear |
T16944 | 27409-27422 | NN | denotes | translocation |
T16945 | 27423-27431 | VB | denotes | measured |
T16946 | 27432-27434 | IN | denotes | by |
T16947 | 27435-27437 | NN | denotes | IP |
T16948 | 27439-27453 | NN | denotes | Quantification |
T16949 | 27454-27456 | IN | denotes | of |
T16950 | 27457-27460 | DT | denotes | the |
T16951 | 27461-27473 | NN | denotes | densitometry |
T16952 | 27474-27478 | NN | denotes | data |
T16953 | 27479-27481 | VB | denotes | is |
T16954 | 27482-27487 | VB | denotes | shown |
T16955 | 27488-27493 | IN | denotes | below |
T16956 | 27495-27499 | DT | denotes | Each |
T16957 | 27500-27503 | NN | denotes | bar |
T16958 | 27504-27514 | VB | denotes | represents |
T16959 | 27515-27523 | NN | denotes | mean±SEM |
T16960 | 27524-27526 | IN | denotes | of |
T16961 | 27527-27529 | IN | denotes | at |
T16962 | 27530-27535 | JJ | denotes | least |
T16963 | 27536-27541 | CD | denotes | three |
T16964 | 27542-27553 | JJ | denotes | independent |
T16965 | 27554-27566 | NN | denotes | experiments. |
T16966 | 27567-27571 | NN | denotes | ***p |
T16967 | 27571-27572 | SYM | denotes | < |
T16968 | 27572-27577 | CD | denotes | 0.001 |
T16969 | 27578-27586 | VB | denotes | compared |
T16970 | 27587-27589 | TO | denotes | to |
T16971 | 27590-27598 | NN | denotes | control. |
T16972 | 27599-27600 | -LRB- | denotes | ( |
T16973 | 27600-27601 | NN | denotes | C |
T16974 | 27601-27602 | -RRB- | denotes | ) |
T16975 | 27603-27610 | JJ | denotes | Western |
T16976 | 27611-27615 | NN | denotes | blot |
T16977 | 27616-27624 | NN | denotes | analysis |
T16978 | 27625-27627 | IN | denotes | of |
T16979 | 27628-27634 | NN | denotes | HuT-78 |
T16980 | 27635-27640 | NN | denotes | cells |
T16981 | 27641-27648 | VB | denotes | treated |
T16982 | 27649-27653 | IN | denotes | with |
T16983 | 27654-27656 | NN | denotes | FP |
T16984 | 27657-27660 | CC | denotes | and |
T16985 | 27661-27674 | JJ | denotes | anti-CD3/CD28 |
T16986 | 27675-27689 | NN | denotes | co-stimulation |
T16987 | 27690-27702 | VB | denotes | demonstrated |
T16988 | 27703-27704 | DT | denotes | a |
T16989 | 27705-27728 | JJ | denotes | concentration-dependent |
T16990 | 27729-27737 | NN | denotes | decrease |
T16991 | 27738-27740 | IN | denotes | in |
T16992 | 27741-27758 | NN | denotes | GATA-3–importin-α |
T16993 | 27759-27770 | NN | denotes | association |
T16994 | 27771-27773 | IN | denotes | at |
T16995 | 27774-27776 | CD | denotes | 20 |
T16996 | 27777-27780 | NN | denotes | min |
T16997 | 27782-27796 | NN | denotes | Quantification |
T16998 | 27797-27799 | IN | denotes | of |
T16999 | 27800-27803 | DT | denotes | the |
T17000 | 27804-27816 | NN | denotes | densitometry |
T17001 | 27817-27821 | NN | denotes | data |
T17002 | 27822-27824 | VB | denotes | is |
T17003 | 27825-27830 | VB | denotes | shown |
T17004 | 27831-27836 | IN | denotes | below |
T17005 | 27838-27842 | DT | denotes | Each |
T17006 | 27843-27846 | NN | denotes | bar |
T17007 | 27847-27857 | VB | denotes | represents |
T17008 | 27858-27866 | NN | denotes | mean±SEM |
T17009 | 27867-27869 | IN | denotes | of |
T17010 | 27870-27872 | IN | denotes | at |
T17011 | 27873-27878 | JJ | denotes | least |
T17012 | 27879-27884 | CD | denotes | three |
T17013 | 27885-27896 | JJ | denotes | independent |
T17014 | 27897-27909 | NN | denotes | experiments. |
T17015 | 27910-27911 | -SHARP- | denotes | # |
T17016 | 27911-27912 | -SHARP- | denotes | # |
T17017 | 27912-27913 | -SHARP- | denotes | # |
T17018 | 25181-25182 | NN | denotes | p |
T17019 | 25182-25183 | SYM | denotes | < |
T17020 | 25183-25188 | CD | denotes | 0.001 |
T17021 | 25189-25197 | VB | denotes | compared |
T17022 | 25198-25200 | TO | denotes | to |
T17023 | 25480-25487 | NN | denotes | control |
T17024 | 25487-25488 | -COMMA- | denotes | , |
T17025 | 25489-25493 | NN | denotes | ***p |
T17026 | 25493-25494 | SYM | denotes | < |
T17027 | 25494-25499 | CD | denotes | 0.001 |
T17028 | 25500-25508 | VB | denotes | compared |
T17029 | 25509-25511 | TO | denotes | to |
T17030 | 27966-27986 | JJ | denotes | αCD3/CD28-stimulated |
T17031 | 27987-27993 | NN | denotes | cells. |
T17032 | 27994-27995 | -LRB- | denotes | ( |
T17033 | 27995-27996 | NN | denotes | D |
T17034 | 27996-27997 | -RRB- | denotes | ) |
T17035 | 27998-28008 | JJ | denotes | GFP-tagged |
T17036 | 28009-28015 | NN | denotes | GATA-3 |
T17037 | 28016-28019 | VB | denotes | was |
T17038 | 28020-28033 | VB | denotes | overexpressed |
T17039 | 28034-28037 | CC | denotes | and |
T17040 | 28038-28043 | NN | denotes | cells |
T17041 | 28044-28054 | VB | denotes | stimulated |
T17042 | 28055-28056 | -LRB- | denotes | ( |
T17043 | 28056-28057 | NN | denotes | b |
T17044 | 28057-28058 | -COMMA- | denotes | , |
T17045 | 28059-28060 | NN | denotes | c |
T17046 | 28060-28061 | -RRB- | denotes | ) |
T17047 | 28062-28064 | CC | denotes | or |
T17048 | 28065-28068 | RB | denotes | not |
T17049 | 28069-28070 | -LRB- | denotes | ( |
T17050 | 28070-28071 | DT | denotes | a |
T17051 | 28071-28072 | -RRB- | denotes | ) |
T17052 | 28073-28076 | IN | denotes | for |
T17053 | 28077-28079 | CD | denotes | 30 |
T17054 | 28080-28083 | NN | denotes | min |
T17055 | 28084-28088 | IN | denotes | with |
T17056 | 28089-28102 | NN | denotes | anti-CD3/CD28 |
T17057 | 28104-28107 | DT | denotes | The |
T17058 | 28108-28114 | NN | denotes | effect |
T17059 | 28115-28117 | IN | denotes | of |
T17060 | 28118-28120 | CD | denotes | 30 |
T17061 | 28121-28124 | NN | denotes | min |
T17062 | 28125-28137 | NN | denotes | pretreatment |
T17063 | 28138-28140 | IN | denotes | of |
T17064 | 28141-28146 | NN | denotes | cells |
T17065 | 28147-28151 | IN | denotes | with |
T17066 | 28152-28154 | NN | denotes | FP |
T17067 | 28155-28156 | -LRB- | denotes | ( |
T17068 | 28156-28160 | CD | denotes | 10−8 |
T17069 | 28161-28162 | NN | denotes | M |
T17070 | 28162-28163 | -COMMA- | denotes | , |
T17071 | 28164-28165 | NN | denotes | c |
T17072 | 28165-28166 | -RRB- | denotes | ) |
T17073 | 28167-28169 | VB | denotes | is |
T17074 | 28170-28174 | RB | denotes | also |
T17075 | 28175-28180 | VB | denotes | shown |
T17076 | 28182-28185 | DT | denotes | All |
T17077 | 28186-28190 | NN | denotes | data |
T17078 | 28191-28195 | VB | denotes | were |
T17079 | 28196-28204 | VB | denotes | analysed |
T17080 | 28205-28207 | IN | denotes | by |
T17081 | 28208-28213 | NN | denotes | ANOVA |
T17082 | 28214-28222 | VB | denotes | followed |
T17083 | 28223-28225 | IN | denotes | by |
T17084 | 28226-28238 | NN | denotes | Newman-Keuls |
T17085 | 28239-28248 | JJ | denotes | post-test |
T17610 | 29403-29414 | NN | denotes | Fluticasone |
T17611 | 29415-29434 | VB | denotes | propionate–mediated |
T17612 | 29435-29445 | NN | denotes | inhibition |
T17613 | 29446-29448 | IN | denotes | of |
T17614 | 29449-29452 | NN | denotes | p38 |
T17615 | 29453-29456 | NN | denotes | MAP |
T17616 | 29457-29463 | NN | denotes | kinase |
T17617 | 29464-29479 | NN | denotes | phosphorylation |
T17618 | 29480-29483 | CC | denotes | and |
T17619 | 29484-29494 | NN | denotes | activation |
T17620 | 29495-29497 | VB | denotes | is |
T17621 | 29498-29508 | VB | denotes | associated |
T17622 | 29509-29513 | IN | denotes | with |
T17623 | 29514-29515 | DT | denotes | a |
T17624 | 29516-29522 | JJ | denotes | marked |
T17625 | 29523-29538 | NN | denotes | down-regulation |
T17626 | 29539-29541 | IN | denotes | of |
T17627 | 29542-29548 | NN | denotes | GATA-3 |
T17628 | 29549-29555 | NN | denotes | serine |
T17629 | 29556-29571 | NN | denotes | phosphorylation |
T17630 | 29573-29574 | -LRB- | denotes | ( |
T17631 | 29574-29575 | NN | denotes | A |
T17632 | 29575-29576 | -RRB- | denotes | ) |
T17633 | 29577-29584 | JJ | denotes | Western |
T17634 | 29585-29589 | NN | denotes | blot |
T17635 | 29590-29598 | NN | denotes | analysis |
T17636 | 29599-29604 | VB | denotes | shows |
T17637 | 29605-29609 | IN | denotes | that |
T17638 | 29610-29612 | NN | denotes | FP |
T17639 | 29613-29614 | -LRB- | denotes | ( |
T17640 | 29614-29618 | CD | denotes | 10−8 |
T17641 | 29619-29620 | NN | denotes | M |
T17642 | 29620-29621 | -COMMA- | denotes | , |
T17643 | 29622-29624 | CD | denotes | 30 |
T17644 | 29625-29628 | NN | denotes | min |
T17645 | 29628-29629 | -RRB- | denotes | ) |
T17646 | 29630-29639 | NN | denotes | treatment |
T17647 | 29640-29647 | VB | denotes | reduced |
T17648 | 29648-29652 | JJ | denotes | dual |
T17649 | 29653-29668 | NN | denotes | phosphorylation |
T17650 | 29669-29670 | -LRB- | denotes | ( |
T17651 | 29670-29683 | CD | denotes | threonine-180 |
T17652 | 29684-29687 | CC | denotes | and |
T17653 | 29688-29700 | NN | denotes | tyrosine-182 |
T17654 | 29700-29701 | -RRB- | denotes | ) |
T17655 | 29702-29704 | IN | denotes | of |
T17656 | 29705-29708 | NN | denotes | p38 |
T17657 | 29709-29713 | NN | denotes | MAPK |
T17658 | 29714-29716 | IN | denotes | in |
T17659 | 29717-29744 | JJ | denotes | anti-CD3/CD28–co-stimulated |
T17660 | 29745-29751 | NN | denotes | HuT-78 |
T17661 | 29752-29758 | NN | denotes | cells. |
T17662 | 29759-29760 | -LRB- | denotes | ( |
T17663 | 29760-29761 | NN | denotes | B |
T17664 | 29761-29762 | -RRB- | denotes | ) |
T17665 | 29763-29767 | NN | denotes | Time |
T17666 | 29768-29774 | NN | denotes | course |
T17667 | 29775-29777 | IN | denotes | of |
T17668 | 29778-29781 | DT | denotes | the |
T17669 | 29782-29788 | NN | denotes | effect |
T17670 | 29789-29791 | IN | denotes | of |
T17671 | 29792-29794 | NN | denotes | FP |
T17672 | 29795-29796 | -LRB- | denotes | ( |
T17673 | 29796-29800 | CD | denotes | 10−8 |
T17674 | 29801-29802 | NN | denotes | M |
T17675 | 29802-29803 | -RRB- | denotes | ) |
T17676 | 29804-29806 | IN | denotes | on |
T17677 | 29807-29822 | NN | denotes | phosphorylation |
T17678 | 29823-29825 | IN | denotes | of |
T17679 | 29826-29835 | VB | denotes | activated |
T17680 | 29836-29849 | NN | denotes | transcription |
T17681 | 29850-29856 | NN | denotes | factor |
T17682 | 29857-29858 | CD | denotes | 2 |
T17683 | 29859-29860 | -LRB- | denotes | ( |
T17684 | 29860-29865 | NN | denotes | ATF-2 |
T17685 | 29865-29866 | -RRB- | denotes | ) |
T17686 | 29866-29867 | -COMMA- | denotes | , |
T17687 | 29868-29869 | DT | denotes | a |
T17688 | 29870-29877 | NN | denotes | measure |
T17689 | 29878-29880 | IN | denotes | of |
T17690 | 29881-29884 | NN | denotes | p38 |
T17691 | 29885-29889 | NN | denotes | MAPK |
T17692 | 29890-29899 | NN | denotes | activity. |
T17693 | 29900-29901 | -LRB- | denotes | ( |
T17694 | 29901-29902 | NN | denotes | C |
T17695 | 29902-29903 | -RRB- | denotes | ) |
T17696 | 29904-29914 | JJ | denotes | FP-induced |
T17697 | 29915-29925 | NN | denotes | inhibition |
T17698 | 29926-29928 | IN | denotes | of |
T17699 | 29929-29932 | NN | denotes | p38 |
T17700 | 29933-29937 | NN | denotes | MAPK |
T17701 | 29938-29946 | NN | denotes | activity |
T17702 | 29947-29949 | VB | denotes | is |
T17703 | 29950-29960 | VB | denotes | associated |
T17704 | 29961-29965 | IN | denotes | with |
T17705 | 29966-29969 | DT | denotes | the |
T17706 | 29970-29978 | NN | denotes | decrease |
T17707 | 29979-29981 | IN | denotes | of |
T17708 | 29982-29995 | JJ | denotes | anti-CD3/CD28 |
T17709 | 29996-30018 | JJ | denotes | co-stimulation–induced |
T17710 | 30019-30025 | NN | denotes | serine |
T17711 | 30026-30041 | NN | denotes | phosphorylation |
T17712 | 30042-30043 | -LRB- | denotes | ( |
T17713 | 30043-30048 | NN | denotes | P-Ser |
T17714 | 30048-30049 | -RRB- | denotes | ) |
T17715 | 30050-30052 | IN | denotes | of |
T17716 | 30053-30059 | NN | denotes | GATA-3 |
T17717 | 30061-30064 | IN | denotes | For |
T17718 | 30065-30066 | -LRB- | denotes | ( |
T17719 | 30066-30069 | NN | denotes | A–C |
T17720 | 30069-30070 | -RRB- | denotes | ) |
T17721 | 30070-30071 | -COMMA- | denotes | , |
T17722 | 30072-30086 | NN | denotes | quantification |
T17723 | 30087-30089 | IN | denotes | of |
T17724 | 30090-30093 | DT | denotes | the |
T17725 | 30094-30106 | NN | denotes | densitometry |
T17726 | 30107-30111 | NN | denotes | data |
T17727 | 30112-30114 | VB | denotes | is |
T17728 | 30115-30119 | RB | denotes | also |
T17729 | 30120-30125 | VB | denotes | shown |
T17730 | 30127-30131 | DT | denotes | Each |
T17731 | 30132-30135 | NN | denotes | bar |
T17732 | 30136-30146 | VB | denotes | represents |
T17733 | 30147-30155 | NN | denotes | mean±SEM |
T17734 | 30156-30158 | IN | denotes | of |
T17735 | 30159-30161 | IN | denotes | at |
T17736 | 30162-30167 | JJ | denotes | least |
T17737 | 30168-30173 | CD | denotes | three |
T17738 | 30174-30185 | JJ | denotes | independent |
T17739 | 30186-30198 | NN | denotes | experiments. |
T17740 | 30199-30200 | -SHARP- | denotes | # |
T17741 | 30200-30201 | -SHARP- | denotes | # |
T17742 | 30201-30202 | -SHARP- | denotes | # |
T17743 | 25181-25182 | NN | denotes | p |
T17744 | 25182-25183 | SYM | denotes | < |
T17745 | 25183-25188 | CD | denotes | 0.001 |
T17746 | 25189-25197 | VB | denotes | compared |
T17747 | 25198-25200 | TO | denotes | to |
T17748 | 25480-25487 | NN | denotes | control |
T17749 | 25487-25488 | -COMMA- | denotes | , |
T17750 | 25489-25493 | NN | denotes | ***p |
T17751 | 25493-25494 | SYM | denotes | < |
T17752 | 25494-25499 | CD | denotes | 0.001 |
T17753 | 25500-25508 | VB | denotes | compared |
T17754 | 25509-25511 | TO | denotes | to |
T17755 | 27966-27986 | JJ | denotes | αCD3/CD28-stimulated |
T17756 | 27987-27993 | NN | denotes | cells. |
T17757 | 27994-27995 | -LRB- | denotes | ( |
T17758 | 27995-27996 | NN | denotes | D |
T17759 | 27996-27997 | -RRB- | denotes | ) |
T17760 | 30287-30289 | NN | denotes | FP |
T17761 | 30290-30297 | VB | denotes | induced |
T17762 | 30298-30303 | NN | denotes | MKP-1 |
T17763 | 30304-30308 | NN | denotes | mRNA |
T17764 | 30309-30311 | IN | denotes | in |
T17765 | 30312-30313 | DT | denotes | a |
T17766 | 30314-30337 | JJ | denotes | concentration-dependent |
T17767 | 30338-30344 | NN | denotes | manner |
T17768 | 30346-30349 | DT | denotes | All |
T17769 | 30350-30357 | NN | denotes | results |
T17770 | 30358-30361 | VB | denotes | are |
T17771 | 30362-30376 | JJ | denotes | representative |
T17772 | 30377-30379 | IN | denotes | of |
T17773 | 30380-30382 | IN | denotes | at |
T17774 | 30383-30388 | JJ | denotes | least |
T17775 | 30389-30394 | CD | denotes | three |
T17776 | 30395-30406 | JJ | denotes | independent |
T17777 | 30407-30418 | NN | denotes | experiments |
T17778 | 30419-30422 | CC | denotes | and |
T17779 | 30423-30428 | WRB | denotes | where |
T17780 | 30429-30440 | JJ | denotes | appropriate |
T17781 | 30441-30450 | VB | denotes | expressed |
T17782 | 30451-30453 | IN | denotes | as |
T17783 | 30454-30463 | NN | denotes | means±SEM |
T17784 | 30463-30464 | -COMMA- | denotes | , |
T17785 | 30465-30467 | NN | denotes | *p |
T17786 | 30467-30468 | SYM | denotes | < |
T17787 | 30468-30473 | CD | denotes | 0.05. |
T17788 | 30474-30475 | -LRB- | denotes | ( |
T17789 | 30475-30476 | NN | denotes | E |
T17790 | 30476-30477 | -RRB- | denotes | ) |
T17791 | 30478-30480 | NN | denotes | FP |
T17792 | 30481-30488 | VB | denotes | induces |
T17793 | 30489-30494 | NN | denotes | MKP-1 |
T17794 | 30495-30499 | NN | denotes | mRNA |
T17795 | 30500-30502 | IN | denotes | in |
T17796 | 30503-30504 | DT | denotes | a |
T17797 | 30505-30519 | JJ | denotes | time-dependent |
T17798 | 30520-30526 | NN | denotes | manner |
T17799 | 30528-30535 | NN | denotes | Results |
T17800 | 30536-30539 | VB | denotes | are |
T17801 | 30540-30554 | JJ | denotes | representative |
T17802 | 30555-30557 | IN | denotes | of |
T17803 | 30558-30561 | CD | denotes | two |
T17804 | 30562-30573 | JJ | denotes | independent |
T17805 | 30574-30585 | NN | denotes | experiments |
T17806 | 30587-30590 | DT | denotes | All |
T17807 | 30591-30595 | NN | denotes | data |
T17808 | 30596-30602 | IN | denotes | except |
T17809 | 30603-30604 | -LRB- | denotes | ( |
T17810 | 30604-30605 | NN | denotes | E |
T17811 | 30605-30606 | -RRB- | denotes | ) |
T17812 | 30607-30611 | VB | denotes | were |
T17813 | 30612-30620 | VB | denotes | analysed |
T17814 | 30621-30623 | IN | denotes | by |
T17815 | 30624-30629 | NN | denotes | ANOVA |
T17816 | 30630-30638 | VB | denotes | followed |
T17817 | 30639-30641 | IN | denotes | by |
T17818 | 30642-30654 | NN | denotes | Newman-Keuls |
T17819 | 30655-30664 | JJ | denotes | post-test |
T18718 | 33262-33273 | NN | denotes | Fluticasone |
T18719 | 33274-33284 | NN | denotes | propionate |
T18720 | 33285-33289 | VB | denotes | does |
T18721 | 33290-33293 | RB | denotes | not |
T18722 | 33294-33300 | VB | denotes | affect |
T18723 | 33301-33307 | NN | denotes | GATA-3 |
T18724 | 33308-33315 | JJ | denotes | nuclear |
T18725 | 33316-33322 | NN | denotes | export |
T18726 | 33324-33325 | -LRB- | denotes | ( |
T18727 | 33325-33326 | NN | denotes | A |
T18728 | 33326-33327 | -RRB- | denotes | ) |
T18729 | 33328-33335 | JJ | denotes | Western |
T18730 | 33336-33340 | NN | denotes | blot |
T18731 | 33341-33349 | NN | denotes | analysis |
T18732 | 33350-33357 | VB | denotes | showing |
T18733 | 33358-33362 | IN | denotes | that |
T18734 | 33363-33366 | DT | denotes | the |
T18735 | 33367-33374 | JJ | denotes | nuclear |
T18736 | 33375-33381 | NN | denotes | export |
T18737 | 33382-33391 | NN | denotes | inhibitor |
T18738 | 33392-33402 | NN | denotes | leptomycin |
T18739 | 33403-33404 | NN | denotes | B |
T18740 | 33405-33406 | -LRB- | denotes | ( |
T18741 | 33406-33407 | CD | denotes | 2 |
T18742 | 33408-33410 | NN | denotes | nM |
T18743 | 33410-33411 | -RRB- | denotes | ) |
T18744 | 33412-33416 | VB | denotes | does |
T18745 | 33417-33420 | RB | denotes | not |
T18746 | 33421-33427 | VB | denotes | affect |
T18747 | 33428-33431 | DT | denotes | the |
T18748 | 33432-33439 | NN | denotes | ability |
T18749 | 33440-33442 | IN | denotes | of |
T18750 | 33443-33445 | NN | denotes | FP |
T18751 | 33446-33447 | -LRB- | denotes | ( |
T18752 | 33447-33451 | CD | denotes | 10−8 |
T18753 | 33452-33453 | NN | denotes | M |
T18754 | 33453-33454 | -RRB- | denotes | ) |
T18755 | 33455-33457 | TO | denotes | to |
T18756 | 33458-33465 | VB | denotes | prevent |
T18757 | 33466-33490 | JJ | denotes | anti-CD3/CD28–stimulated |
T18758 | 33491-33497 | NN | denotes | GATA-3 |
T18759 | 33498-33505 | JJ | denotes | nuclear |
T18760 | 33506-33518 | NN | denotes | localization |
T18761 | 33519-33527 | VB | denotes | measured |
T18762 | 33528-33530 | IN | denotes | at |
T18763 | 33531-33533 | CD | denotes | 60 |
T18764 | 33534-33538 | NN | denotes | min. |
T18765 | 33539-33543 | NN | denotes | ***p |
T18766 | 33543-33544 | SYM | denotes | < |
T18767 | 33544-33549 | CD | denotes | 0.001 |
T18768 | 33550-33558 | VB | denotes | compared |
T18769 | 33559-33561 | TO | denotes | to |
T18770 | 33562-33574 | JJ | denotes | unstimulated |
T18771 | 33575-33580 | NN | denotes | cells |
T18772 | 33580-33581 | -COMMA- | denotes | , |
T18773 | 33582-33583 | -SHARP- | denotes | # |
T18774 | 33583-33584 | -SHARP- | denotes | # |
T18775 | 33584-33585 | -SHARP- | denotes | # |
T18776 | 25492-25493 | NN | denotes | p |
T18777 | 25493-25494 | SYM | denotes | < |
T18778 | 25494-25499 | CD | denotes | 0.001 |
T18779 | 25500-25508 | VB | denotes | compared |
T18780 | 25509-25511 | TO | denotes | to |
T18781 | 25512-25536 | JJ | denotes | anti-CD3/CD28–stimulated |
T18782 | 33631-33637 | NN | denotes | cells. |
T18783 | 33638-33639 | -LRB- | denotes | ( |
T18784 | 33639-33640 | NN | denotes | B |
T18785 | 33640-33641 | -RRB- | denotes | ) |
T18786 | 33642-33649 | JJ | denotes | Western |
T18787 | 33650-33654 | NN | denotes | blot |
T18788 | 33655-33663 | NN | denotes | analysis |
T18789 | 33664-33671 | VB | denotes | showing |
T18790 | 33672-33676 | IN | denotes | that |
T18791 | 33677-33679 | NN | denotes | FP |
T18792 | 33680-33681 | -LRB- | denotes | ( |
T18793 | 33681-33685 | CD | denotes | 10−8 |
T18794 | 33686-33687 | NN | denotes | M |
T18795 | 33687-33688 | -RRB- | denotes | ) |
T18796 | 33689-33693 | VB | denotes | does |
T18797 | 33694-33697 | RB | denotes | not |
T18798 | 33698-33704 | VB | denotes | affect |
T18799 | 33705-33715 | JJ | denotes | whole-cell |
T18800 | 33716-33722 | NN | denotes | GATA-3 |
T18801 | 33723-33734 | NN | denotes | degradation |
T18802 | 33735-33739 | IN | denotes | over |
T18803 | 33740-33742 | CD | denotes | 17 |
T18804 | 33743-33745 | NN | denotes | h. |
T18805 | 33746-33747 | -LRB- | denotes | ( |
T18806 | 33747-33748 | NN | denotes | C |
T18807 | 33748-33749 | -RRB- | denotes | ) |
T18808 | 33750-33760 | JJ | denotes | GFP-tagged |
T18809 | 33761-33767 | NN | denotes | GATA-3 |
T18810 | 33768-33770 | VB | denotes | is |
T18811 | 33771-33784 | VB | denotes | overexpressed |
T18812 | 33785-33788 | CC | denotes | and |
T18813 | 33789-33794 | NN | denotes | cells |
T18814 | 33795-33805 | VB | denotes | stimulated |
T18815 | 33806-33807 | -LRB- | denotes | ( |
T18816 | 33807-33810 | NN | denotes | b–j |
T18817 | 33810-33811 | -RRB- | denotes | ) |
T18818 | 33812-33814 | CC | denotes | or |
T18819 | 33815-33818 | RB | denotes | not |
T18820 | 33819-33820 | -LRB- | denotes | ( |
T18821 | 33820-33821 | DT | denotes | a |
T18822 | 33821-33822 | -RRB- | denotes | ) |
T18823 | 33823-33827 | IN | denotes | with |
T18824 | 33828-33841 | NN | denotes | anti-CD3/CD28 |
T18825 | 33843-33846 | DT | denotes | The |
T18826 | 33847-33853 | NN | denotes | effect |
T18827 | 33854-33856 | IN | denotes | of |
T18828 | 33857-33865 | VB | denotes | treating |
T18829 | 33866-33871 | NN | denotes | cells |
T18830 | 33872-33876 | IN | denotes | with |
T18831 | 33877-33879 | NN | denotes | FP |
T18832 | 33880-33881 | -LRB- | denotes | ( |
T18833 | 33881-33885 | CD | denotes | 10−8 |
T18834 | 33886-33887 | NN | denotes | M |
T18835 | 33887-33888 | -COMMA- | denotes | , |
T18836 | 33889-33892 | NN | denotes | f–j |
T18837 | 33892-33893 | -RRB- | denotes | ) |
T18838 | 33894-33899 | IN | denotes | after |
T18839 | 33900-33902 | CD | denotes | 30 |
T18840 | 33903-33906 | NN | denotes | min |
T18841 | 33907-33918 | NN | denotes | stimulation |
T18842 | 33919-33923 | IN | denotes | with |
T18843 | 33924-33937 | NN | denotes | anti-CD3/CD28 |
T18844 | 33938-33940 | VB | denotes | is |
T18845 | 33941-33945 | RB | denotes | also |
T18846 | 33946-33952 | NN | denotes | shown. |
T18847 | 33953-33954 | -LRB- | denotes | ( |
T18848 | 33954-33955 | NN | denotes | D |
T18849 | 33955-33956 | -RRB- | denotes | ) |
T18850 | 33957-33959 | NN | denotes | FP |
T18851 | 33960-33961 | -LRB- | denotes | ( |
T18852 | 33961-33965 | CD | denotes | 10−8 |
T18853 | 33966-33967 | NN | denotes | M |
T18854 | 33967-33968 | -RRB- | denotes | ) |
T18855 | 33969-33973 | VB | denotes | does |
T18856 | 33974-33977 | RB | denotes | not |
T18857 | 33978-33985 | VB | denotes | prevent |
T18858 | 33986-34010 | JJ | denotes | anti-CD3/CD28–stimulated |
T18859 | 34011-34014 | NN | denotes | p65 |
T18860 | 34015-34022 | JJ | denotes | nuclear |
T18861 | 34023-34036 | NN | denotes | translocation |
T18862 | 34037-34039 | IN | denotes | at |
T18863 | 34040-34042 | CD | denotes | 60 |
T18864 | 34043-34046 | NN | denotes | min |
T18865 | 34047-34052 | IN | denotes | after |
T18866 | 34053-34065 | NN | denotes | stimulation. |
T18867 | 34066-34069 | NN | denotes | **p |
T18868 | 34069-34070 | SYM | denotes | < |
T18869 | 34070-34074 | CD | denotes | 0.01 |
T18870 | 34075-34083 | VB | denotes | compared |
T18871 | 34084-34086 | TO | denotes | to |
T18872 | 34087-34099 | JJ | denotes | unstimulated |
T18873 | 34100-34105 | NN | denotes | cells |
T18874 | 34107-34110 | DT | denotes | All |
T18875 | 34111-34118 | NN | denotes | results |
T18876 | 34119-34122 | VB | denotes | are |
T18877 | 34123-34137 | JJ | denotes | representative |
T18878 | 34138-34140 | IN | denotes | of |
T18879 | 34141-34143 | IN | denotes | at |
T18880 | 34144-34149 | JJ | denotes | least |
T18881 | 34150-34154 | CD | denotes | four |
T18882 | 34155-34166 | JJ | denotes | independent |
T18883 | 34167-34178 | NN | denotes | experiments |
T18884 | 34179-34182 | CC | denotes | and |
T18885 | 34183-34186 | VB | denotes | are |
T18886 | 34187-34192 | VB | denotes | shown |
T18887 | 34193-34195 | IN | denotes | as |
T18888 | 34196-34204 | NN | denotes | mean±SEM |
T18889 | 34206-34213 | NN | denotes | Results |
T18890 | 34214-34218 | VB | denotes | were |
T18891 | 34219-34227 | VB | denotes | analysed |
T18892 | 34228-34230 | IN | denotes | by |
T18893 | 34231-34236 | NN | denotes | ANOVA |
T18894 | 34237-34245 | VB | denotes | followed |
T18895 | 34246-34248 | IN | denotes | by |
T18896 | 34249-34261 | JJ | denotes | Newman-Keuls |
T18897 | 34262-34266 | NN | denotes | test |
T19291 | 34789-34800 | NN | denotes | Fluticasone |
T19292 | 34801-34811 | NN | denotes | propionate |
T19293 | 34812-34819 | VB | denotes | impairs |
T19294 | 34820-34826 | NN | denotes | GATA-3 |
T19295 | 34827-34838 | NN | denotes | interaction |
T19296 | 34839-34843 | IN | denotes | with |
T19297 | 34844-34854 | NN | denotes | importin-α |
T19298 | 34855-34858 | CC | denotes | and |
T19299 | 34859-34865 | NN | denotes | GATA-3 |
T19300 | 34866-34873 | JJ | denotes | nuclear |
T19301 | 34874-34886 | NN | denotes | localization |
T19302 | 34887-34889 | FW | denotes | in |
T19303 | 34890-34894 | FW | denotes | vivo |
T19304 | 34895-34898 | CC | denotes | and |
T19305 | 34899-34901 | FW | denotes | ex |
T19306 | 34902-34906 | FW | denotes | vivo |
T19307 | 34908-34909 | -LRB- | denotes | ( |
T19308 | 34909-34910 | NN | denotes | A |
T19309 | 34911-34914 | CC | denotes | and |
T19310 | 34915-34916 | NN | denotes | B |
T19311 | 34916-34917 | -RRB- | denotes | ) |
T19312 | 34918-34940 | NN | denotes | Co-immunoprecipitation |
T19313 | 34941-34949 | NN | denotes | analysis |
T19314 | 34950-34952 | IN | denotes | of |
T19315 | 34953-34958 | NN | denotes | PBMCs |
T19316 | 34959-34963 | IN | denotes | from |
T19317 | 34964-34977 | JJ | denotes | steroid-naïve |
T19318 | 34978-34984 | NN | denotes | asthma |
T19319 | 34985-34993 | NN | denotes | patients |
T19320 | 34994-35001 | VB | denotes | treated |
T19321 | 35002-35006 | IN | denotes | with |
T19322 | 35007-35009 | NN | denotes | FP |
T19323 | 35010-35012 | FW | denotes | in |
T19324 | 35013-35018 | FW | denotes | vitro |
T19325 | 35019-35031 | VB | denotes | demonstrated |
T19326 | 35032-35040 | JJ | denotes | impaired |
T19327 | 35041-35052 | NN | denotes | interaction |
T19328 | 35053-35060 | IN | denotes | between |
T19329 | 35061-35067 | NN | denotes | GATA-3 |
T19330 | 35068-35071 | CC | denotes | and |
T19331 | 35072-35082 | NN | denotes | importin-α |
T19332 | 35083-35091 | VB | denotes | measured |
T19333 | 35092-35094 | IN | denotes | at |
T19334 | 35095-35097 | CD | denotes | 60 |
T19335 | 35098-35101 | NN | denotes | min |
T19336 | 35103-35107 | DT | denotes | Each |
T19337 | 35108-35111 | NN | denotes | bar |
T19338 | 35112-35122 | VB | denotes | represents |
T19339 | 35123-35126 | DT | denotes | the |
T19340 | 35127-35135 | NN | denotes | mean±SEM |
T19341 | 35136-35138 | IN | denotes | of |
T19342 | 35139-35141 | IN | denotes | at |
T19343 | 35142-35147 | JJ | denotes | least |
T19344 | 35148-35153 | CD | denotes | three |
T19345 | 35154-35165 | JJ | denotes | independent |
T19346 | 35166-35177 | NN | denotes | experiments |
T19347 | 35177-35178 | -COLON- | denotes | ; |
T19348 | 35179-35182 | SYM | denotes | *** |
T19349 | 35183-35184 | NN | denotes | p |
T19350 | 35184-35185 | SYM | denotes | < |
T19351 | 35185-35190 | CD | denotes | 0.001 |
T19352 | 35191-35199 | VB | denotes | compared |
T19353 | 35200-35204 | IN | denotes | with |
T19354 | 35205-35212 | NN | denotes | control |
T19355 | 35213-35215 | IN | denotes | as |
T19356 | 35216-35226 | VB | denotes | determined |
T19357 | 35227-35229 | IN | denotes | by |
T19358 | 35230-35248 | JJ | denotes | ANOVA/Newman-Keuls |
T19359 | 35249-35258 | NN | denotes | analysis. |
T19360 | 35259-35260 | -LRB- | denotes | ( |
T19361 | 35260-35261 | NN | denotes | C |
T19362 | 35262-35265 | CC | denotes | and |
T19363 | 35266-35267 | NN | denotes | D |
T19364 | 35267-35268 | -RRB- | denotes | ) |
T19365 | 35269-35291 | NN | denotes | Co-immunoprecipitation |
T19366 | 35292-35300 | NN | denotes | analyses |
T19367 | 35301-35303 | IN | denotes | of |
T19368 | 35304-35309 | NN | denotes | PBMCs |
T19369 | 35310-35314 | IN | denotes | from |
T19370 | 35315-35328 | JJ | denotes | steroid-naïve |
T19371 | 35329-35335 | NN | denotes | asthma |
T19372 | 35336-35344 | NN | denotes | patients |
T19373 | 35345-35352 | VB | denotes | treated |
T19374 | 35353-35357 | IN | denotes | with |
T19375 | 35358-35365 | VB | denotes | inhaled |
T19376 | 35366-35368 | NN | denotes | FP |
T19377 | 35369-35370 | -LRB- | denotes | ( |
T19378 | 35370-35373 | CD | denotes | 500 |
T19379 | 35374-35376 | NN | denotes | µg |
T19380 | 35377-35380 | IN | denotes | via |
T19381 | 35381-35382 | DT | denotes | a |
T19382 | 35383-35389 | NN | denotes | spacer |
T19383 | 35389-35390 | -RRB- | denotes | ) |
T19384 | 35391-35393 | FW | denotes | in |
T19385 | 35394-35398 | FW | denotes | vivo |
T19386 | 35399-35411 | VB | denotes | demonstrated |
T19387 | 35412-35421 | VB | denotes | decreased |
T19388 | 35422-35433 | NN | denotes | association |
T19389 | 35434-35441 | IN | denotes | between |
T19390 | 35442-35448 | NN | denotes | GATA-3 |
T19391 | 35449-35452 | CC | denotes | and |
T19392 | 35453-35463 | NN | denotes | importin-α |
T19393 | 35465-35468 | DT | denotes | The |
T19394 | 35469-35479 | JJ | denotes | individual |
T19395 | 35480-35486 | NN | denotes | values |
T19396 | 35487-35490 | IN | denotes | for |
T19397 | 35491-35495 | DT | denotes | each |
T19398 | 35496-35505 | NN | denotes | treatment |
T19399 | 35506-35509 | VB | denotes | are |
T19400 | 35510-35519 | VB | denotes | presented |
T19401 | 35520-35532 | NN | denotes | graphically. |
T19402 | 35533-35534 | -LRB- | denotes | ( |
T19403 | 35534-35535 | NN | denotes | E |
T19404 | 35535-35536 | -RRB- | denotes | ) |
T19405 | 35537-35551 | JJ | denotes | Representative |
T19406 | 35552-35559 | JJ | denotes | Western |
T19407 | 35560-35564 | NN | denotes | blot |
T19408 | 35565-35572 | VB | denotes | showing |
T19409 | 35573-35577 | IN | denotes | that |
T19410 | 35578-35588 | JJ | denotes | importin-α |
T19411 | 35589-35599 | NN | denotes | expression |
T19412 | 35600-35603 | VB | denotes | was |
T19413 | 35604-35614 | JJ | denotes | unaffected |
T19414 | 35615-35617 | IN | denotes | by |
T19415 | 35618-35628 | NN | denotes | inhalation |
T19416 | 35629-35631 | IN | denotes | of |
T19417 | 35632-35634 | NN | denotes | FP |
T19418 | 35636-35640 | NN | denotes | Blot |
T19419 | 35641-35643 | VB | denotes | is |
T19420 | 35644-35658 | JJ | denotes | representative |
T19421 | 35659-35661 | IN | denotes | of |
T19422 | 35662-35666 | NN | denotes | gels |
T19423 | 35667-35671 | IN | denotes | from |
T19424 | 35672-35677 | CD | denotes | three |
T19425 | 35678-35690 | NN | denotes | participants |
T19732 | 37976-37983 | VB | denotes | Inhaled |
T19733 | 37984-37995 | NN | denotes | fluticasone |
T19734 | 37996-38006 | NN | denotes | propionate |
T19735 | 38007-38014 | VB | denotes | impairs |
T19736 | 38015-38021 | NN | denotes | GATA-3 |
T19737 | 38022-38029 | JJ | denotes | nuclear |
T19738 | 38030-38042 | NN | denotes | localization |
T19739 | 38043-38045 | IN | denotes | in |
T19740 | 38046-38051 | NN | denotes | PBMCs |
T19741 | 38053-38054 | -LRB- | denotes | ( |
T19742 | 38054-38055 | NN | denotes | A |
T19743 | 38055-38056 | -RRB- | denotes | ) |
T19744 | 38057-38071 | JJ | denotes | Representative |
T19745 | 38072-38091 | NN | denotes | immunocytochemistry |
T19746 | 38092-38094 | IN | denotes | of |
T19747 | 38095-38102 | VB | denotes | showing |
T19748 | 38103-38106 | DT | denotes | the |
T19749 | 38107-38113 | NN | denotes | effect |
T19750 | 38114-38116 | IN | denotes | of |
T19751 | 38117-38124 | VB | denotes | inhaled |
T19752 | 38125-38127 | NN | denotes | FP |
T19753 | 38128-38129 | -LRB- | denotes | ( |
T19754 | 38129-38132 | CD | denotes | 500 |
T19755 | 38133-38135 | NN | denotes | µg |
T19756 | 38135-38136 | -RRB- | denotes | ) |
T19757 | 38137-38139 | IN | denotes | on |
T19758 | 38140-38142 | NN | denotes | GR |
T19759 | 38143-38146 | CC | denotes | and |
T19760 | 38147-38153 | NN | denotes | GATA-3 |
T19761 | 38154-38161 | JJ | denotes | nuclear |
T19762 | 38162-38175 | NN | denotes | localisation. |
T19763 | 38176-38177 | -LRB- | denotes | ( |
T19764 | 38177-38178 | NN | denotes | B |
T19765 | 38178-38179 | -RRB- | denotes | ) |
T19766 | 38180-38187 | JJ | denotes | Nuclear |
T19767 | 38188-38194 | NN | denotes | GATA-3 |
T19768 | 38195-38211 | NN | denotes | immunoreactivity |
T19769 | 38212-38214 | IN | denotes | in |
T19770 | 38215-38220 | NN | denotes | PBMCs |
T19771 | 38221-38225 | IN | denotes | from |
T19772 | 38226-38231 | CD | denotes | seven |
T19773 | 38232-38245 | JJ | denotes | steroid-naïve |
T19774 | 38246-38252 | NN | denotes | asthma |
T19775 | 38253-38261 | NN | denotes | patients |
T19776 | 38262-38263 | CD | denotes | 2 |
T19777 | 38264-38265 | NN | denotes | h |
T19778 | 38266-38275 | VB | denotes | following |
T19779 | 38276-38283 | VB | denotes | inhaled |
T19780 | 38284-38286 | NN | denotes | FP |
T19781 | 38287-38296 | NN | denotes | treatment |
T19782 | 38297-38298 | -LRB- | denotes | ( |
T19783 | 38298-38301 | CD | denotes | 100 |
T19784 | 38302-38304 | CC | denotes | or |
T19785 | 38305-38308 | CD | denotes | 500 |
T19786 | 38309-38311 | NN | denotes | µg |
T19787 | 38312-38315 | IN | denotes | via |
T19788 | 38316-38322 | NN | denotes | spacer |
T19789 | 38322-38323 | -RRB- | denotes | ) |
T19790 | 38325-38328 | DT | denotes | The |
T19791 | 38329-38335 | JJ | denotes | median |
T19792 | 38336-38339 | CC | denotes | and |
T19793 | 38340-38353 | JJ | denotes | interquartile |
T19794 | 38354-38360 | NN | denotes | ranges |
T19795 | 38361-38364 | IN | denotes | for |
T19796 | 38365-38369 | DT | denotes | each |
T19797 | 38370-38379 | NN | denotes | treatment |
T19798 | 38380-38383 | VB | denotes | are |
T19799 | 38384-38393 | VB | denotes | presented |
T19800 | 38394-38396 | IN | denotes | as |
T19801 | 38397-38398 | DT | denotes | a |
T19802 | 38399-38415 | NN | denotes | box-and-whiskers |
T19803 | 38416-38420 | NN | denotes | plot |
T19804 | 38421-38422 | -LRB- | denotes | ( |
T19805 | 38422-38427 | NN | denotes | n = 7 |
T19806 | 38427-38428 | -RRB- | denotes | ) |
T19807 | 38428-38429 | -COLON- | denotes | ; |
T19808 | 38430-38431 | SYM | denotes | * |
T19809 | 38432-38433 | NN | denotes | p |
T19810 | 38433-38434 | SYM | denotes | < |
T19811 | 38434-38438 | CD | denotes | 0.05 |
T19812 | 38439-38447 | NNP | denotes | Wilcoxon |
T19813 | 38447-38449 | POS | denotes | 's |
T19814 | 38450-38454 | NN | denotes | rank |
T19815 | 38455-38459 | NN | denotes | test |
T19816 | 38460-38468 | VB | denotes | compared |
T19817 | 38469-38473 | IN | denotes | with |
T19818 | 38474-38482 | NN | denotes | placebo. |
T19819 | 38483-38484 | -LRB- | denotes | ( |
T19820 | 38484-38485 | NN | denotes | C |
T19821 | 38485-38486 | -RRB- | denotes | ) |
T19822 | 38487-38501 | NN | denotes | Immunoblotting |
T19823 | 38502-38510 | NN | denotes | analyses |
T19824 | 38511-38513 | IN | denotes | of |
T19825 | 38514-38519 | NN | denotes | PBMCs |
T19826 | 38520-38532 | VB | denotes | demonstrated |
T19827 | 38533-38534 | DT | denotes | a |
T19828 | 38535-38549 | JJ | denotes | time-dependent |
T19829 | 38550-38558 | NN | denotes | decrease |
T19830 | 38559-38561 | IN | denotes | in |
T19831 | 38562-38569 | JJ | denotes | nuclear |
T19832 | 38570-38580 | NN | denotes | expression |
T19833 | 38581-38583 | IN | denotes | of |
T19834 | 38584-38590 | NN | denotes | GATA-3 |
T19835 | 38590-38591 | -COMMA- | denotes | , |
T19836 | 38592-38595 | CC | denotes | and |
T19837 | 38596-38605 | VB | denotes | increased |
T19838 | 38606-38617 | JJ | denotes | cytoplasmic |
T19839 | 38618-38624 | NN | denotes | GATA-3 |
T19840 | 38625-38635 | NN | denotes | expression |
T19841 | 38636-38641 | IN | denotes | after |
T19842 | 38642-38652 | NN | denotes | inhalation |
T19843 | 38653-38655 | IN | denotes | of |
T19844 | 38656-38659 | NNP | denotes | FP. |
T19845 | 38660-38661 | -LRB- | denotes | ( |
T19846 | 38661-38662 | NN | denotes | D |
T19847 | 38662-38663 | -RRB- | denotes | ) |
T19848 | 38664-38678 | NN | denotes | Immunoblotting |
T19849 | 38679-38687 | NN | denotes | analyses |
T19850 | 38688-38690 | IN | denotes | of |
T19851 | 38691-38696 | NN | denotes | PBMCs |
T19852 | 38697-38709 | VB | denotes | demonstrated |
T19853 | 38710-38711 | DT | denotes | a |
T19854 | 38712-38726 | JJ | denotes | dose-dependent |
T19855 | 38727-38735 | NN | denotes | decrease |
T19856 | 38736-38738 | IN | denotes | in |
T19857 | 38739-38746 | JJ | denotes | nuclear |
T19858 | 38747-38757 | NN | denotes | expression |
T19859 | 38758-38760 | IN | denotes | of |
T19860 | 38761-38767 | NN | denotes | GATA-3 |
T19861 | 38767-38768 | -COMMA- | denotes | , |
T19862 | 38769-38772 | CC | denotes | and |
T19863 | 38773-38782 | VB | denotes | increased |
T19864 | 38783-38794 | JJ | denotes | cytoplasmic |
T19865 | 38795-38801 | NN | denotes | GATA-3 |
T19866 | 38802-38812 | NN | denotes | expression |
T19867 | 38813-38814 | CD | denotes | 2 |
T19868 | 38815-38816 | NN | denotes | h |
T19869 | 38817-38822 | IN | denotes | after |
T19870 | 38823-38833 | NN | denotes | inhalation |
T19871 | 38834-38836 | IN | denotes | of |
T19872 | 38837-38839 | NN | denotes | FP |
T19873 | 38841-38848 | NN | denotes | Histone |
T19874 | 38849-38851 | NN | denotes | H1 |
T19875 | 38852-38855 | CC | denotes | and |
T19876 | 38856-38861 | NN | denotes | MEK-1 |
T19877 | 38862-38876 | NN | denotes | immunoblotting |
T19878 | 38877-38886 | VB | denotes | confirmed |
T19879 | 38887-38897 | JJ | denotes | equivalent |
T19880 | 38898-38903 | JJ | denotes | total |
T19881 | 38904-38911 | NN | denotes | protein |
T19882 | 38912-38919 | VB | denotes | loading |
T19883 | 38920-38923 | IN | denotes | for |
T19884 | 38924-38927 | DT | denotes | the |
T19885 | 38928-38935 | JJ | denotes | nuclear |
T19886 | 38936-38939 | CC | denotes | and |
T19887 | 38940-38951 | JJ | denotes | cytoplasmic |
T19888 | 38952-38961 | NN | denotes | fractions |
T19889 | 38962-38974 | RB | denotes | respectively |
T19890 | 38976-38990 | NN | denotes | Quantification |
T19891 | 38991-38993 | IN | denotes | of |
T19892 | 38994-38997 | DT | denotes | the |
T19893 | 38998-39010 | NN | denotes | densitometry |
T19894 | 39011-39015 | NN | denotes | data |
T19895 | 39016-39018 | IN | denotes | in |
T19896 | 39019-39020 | -LRB- | denotes | ( |
T19897 | 39020-39021 | NN | denotes | C |
T19898 | 39021-39022 | -RRB- | denotes | ) |
T19899 | 39023-39026 | CC | denotes | and |
T19900 | 39027-39028 | -LRB- | denotes | ( |
T19901 | 39028-39029 | NN | denotes | D |
T19902 | 39029-39030 | -RRB- | denotes | ) |
T19903 | 39031-39033 | VB | denotes | is |
T19904 | 39034-39039 | VB | denotes | shown |
T19905 | 39040-39042 | IN | denotes | as |
T19906 | 39043-39044 | DT | denotes | a |
T19907 | 39045-39061 | JJ | denotes | box-and-whiskers |
T19908 | 39062-39066 | NN | denotes | plot |
T19909 | 39067-39069 | IN | denotes | of |
T19910 | 39070-39077 | NN | denotes | results |
T19911 | 39078-39082 | IN | denotes | from |
T19912 | 39083-39088 | NN | denotes | n = 6 |
T19913 | 39089-39101 | NN | denotes | participants |
T19914 | 39102-39105 | IN | denotes | for |
T19915 | 39106-39111 | WDT | denotes | which |
T19916 | 39112-39116 | NN | denotes | data |
T19917 | 39117-39121 | VB | denotes | were |
T19918 | 39122-39132 | JJ | denotes | available. |
T19919 | 39133-39135 | NN | denotes | *p |
T19920 | 39135-39136 | SYM | denotes | < |
T19921 | 39136-39140 | CD | denotes | 0.05 |
T19922 | 39141-39149 | VB | denotes | compared |
T19923 | 39150-39152 | TO | denotes | to |
T19924 | 39153-39161 | VB | denotes | control. |
T19925 | 39162-39163 | -LRB- | denotes | ( |
T19926 | 39163-39164 | NN | denotes | E |
T19927 | 39164-39165 | -RRB- | denotes | ) |
T19928 | 39166-39173 | JJ | denotes | Western |
T19929 | 39174-39178 | NN | denotes | blot |
T19930 | 39179-39187 | NN | denotes | analyses |
T19931 | 39188-39190 | IN | denotes | of |
T19932 | 39191-39196 | NN | denotes | PBMCs |
T19933 | 39197-39209 | VB | denotes | demonstrated |
T19934 | 39210-39211 | DT | denotes | a |
T19935 | 39212-39226 | JJ | denotes | time-dependent |
T19936 | 39227-39235 | NN | denotes | decrease |
T19937 | 39236-39238 | IN | denotes | in |
T19938 | 39239-39243 | JJ | denotes | dual |
T19939 | 39244-39259 | NN | denotes | phosphorylation |
T19940 | 39260-39261 | -LRB- | denotes | ( |
T19941 | 39261-39274 | CD | denotes | threonine-180 |
T19942 | 39275-39278 | CC | denotes | and |
T19943 | 39279-39291 | NN | denotes | tyrosine-182 |
T19944 | 39291-39292 | -RRB- | denotes | ) |
T19945 | 39293-39295 | IN | denotes | of |
T19946 | 39296-39299 | NN | denotes | p38 |
T19947 | 39300-39304 | NN | denotes | MAPK |
T19948 | 39305-39310 | IN | denotes | after |
T19949 | 39311-39321 | NN | denotes | inhalation |
T19950 | 39322-39324 | IN | denotes | of |
T19951 | 39325-39327 | NN | denotes | FP |
T19952 | 39328-39329 | -LRB- | denotes | ( |
T19953 | 39329-39332 | CD | denotes | 500 |
T19954 | 39333-39335 | NN | denotes | µg |
T19955 | 39335-39336 | -RRB- | denotes | ) |
T19956 | 39338-39341 | DT | denotes | The |
T19957 | 39342-39349 | NN | denotes | results |
T19958 | 39350-39355 | VB | denotes | shown |
T19959 | 39356-39358 | IN | denotes | in |
T19960 | 39359-39360 | -LRB- | denotes | ( |
T19961 | 39360-39361 | NN | denotes | E |
T19962 | 39361-39362 | -RRB- | denotes | ) |
T19963 | 39363-39366 | VB | denotes | are |
T19964 | 39367-39381 | JJ | denotes | representative |
T19965 | 39382-39384 | IN | denotes | of |
T19966 | 39385-39392 | NN | denotes | samples |
T19967 | 39393-39397 | IN | denotes | from |
T19968 | 39398-39401 | CD | denotes | two |
T19969 | 39402-39414 | NN | denotes | participants |
T5299 | 16620-16622 | CD | denotes | 35 |
T5300 | 16623-16629 | NN | denotes | cycles |
R99 | T149 | T150 | arg1Of | Suppression,of |
R100 | T149 | T156 | arg1Of | Suppression,: |
R101 | T153 | T151 | arg1Of | Import,GATA-3 |
R102 | T153 | T152 | arg1Of | Import,Nuclear |
R103 | T153 | T154 | arg1Of | Import,and |
R104 | T154 | T150 | arg2Of | and,of |
R105 | T155 | T154 | arg2Of | Phosphorylation,and |
R106 | T159 | T156 | arg2Of | Mechanism,: |
R107 | T159 | T157 | arg1Of | Mechanism,A |
R108 | T159 | T158 | arg1Of | Mechanism,Novel |
R109 | T159 | T160 | arg1Of | Mechanism,of |
R110 | T162 | T160 | arg2Of | Action,of |
R111 | T162 | T161 | arg1Of | Action,Corticosteroid |
R112 | T162 | T163 | arg1Of | Action,in |
R113 | T165 | T163 | arg2Of | Disease,in |
R114 | T165 | T164 | arg1Of | Disease,Allergic |
R115 | T167 | T168 | arg1Of | GATA-3,plays |
R116 | T167 | T173 | arg1Of | GATA-3,regulating |
R117 | T167 | T198 | arg1Of | GATA-3,is |
R118 | T168 | T172 | arg1Of | plays,in |
R119 | T168 | T196 | arg1Of | plays,and |
R120 | T171 | T168 | arg2Of | role,plays |
R121 | T171 | T169 | arg1Of | role,a |
R122 | T171 | T170 | arg1Of | role,critical |
R123 | T173 | T172 | arg2Of | regulating,in |
R124 | T175 | T173 | arg2Of | expression,regulating |
R125 | T175 | T174 | arg1Of | expression,the |
R126 | T175 | T176 | arg1Of | expression,of |
R127 | T175 | T189 | arg1Of | expression,from |
R128 | T178 | T177 | arg1Of | cytokines,the |
R129 | T179 | T180 | arg1Of | interleukin,( |
R130 | T179 | T183 | arg1Of | interleukin,-4 |
R131 | T179 | T184 | arg1Of | interleukin,"," |
R132 | T181 | T180 | arg2Of | IL,( |
R133 | T182 | T180 | arg3Of | ),( |
R134 | T184 | T187 | arg1Of | ",",and |
R135 | T185 | T184 | arg2Of | IL-5,"," |
R136 | T187 | T176 | arg2Of | and,of |
R137 | T187 | T178 | arg1Of | and,cytokines |
R138 | T187 | T186 | arg1Of | and,"," |
R139 | T188 | T187 | arg2Of | IL-13,and |
R140 | T193 | T192 | arg2Of | Th2,( |
R141 | T194 | T192 | arg3Of | ),( |
R142 | T195 | T189 | arg2Of | cells,from |
R143 | T195 | T190 | arg1Of | cells,T |
R144 | T195 | T191 | arg1Of | cells,helper-2 |
R145 | T195 | T192 | arg1Of | cells,( |
R146 | T198 | T196 | arg2Of | is,and |
R147 | T198 | T197 | arg1Of | is,therefore |
R148 | T201 | T198 | arg2Of | mediator,is |
R149 | T201 | T199 | arg1Of | mediator,a |
R150 | T201 | T200 | arg1Of | mediator,key |
R151 | T201 | T202 | arg1Of | mediator,of |
R152 | T204 | T202 | arg2Of | diseases,of |
R153 | T204 | T203 | arg1Of | diseases,allergic |
R154 | T205 | T206 | arg1Of | Corticosteroids,are |
R155 | T205 | T208 | arg1Of | Corticosteroids,effective |
R156 | T206 | T214 | arg1Of | are,but |
R157 | T208 | T206 | arg2Of | effective,are |
R158 | T208 | T207 | arg1Of | effective,highly |
R159 | T208 | T209 | arg1Of | effective,in |
R160 | T210 | T209 | arg2Of | suppressing,in |
R161 | T212 | T210 | arg2Of | inflammation,suppressing |
R162 | T212 | T211 | arg1Of | inflammation,allergic |
R163 | T214 | T213 | arg1Of | but,"," |
R164 | T216 | T215 | arg1Of | effects,their |
R165 | T216 | T217 | arg1Of | effects,on |
R166 | T216 | T219 | arg1Of | effects,are |
R167 | T216 | T220 | arg1Of | effects,unknown |
R168 | T218 | T217 | arg2Of | GATA-3,on |
R169 | T219 | T214 | arg2Of | are,but |
R170 | T220 | T219 | arg2Of | unknown,are |
R171 | T221 | T222 | arg1Of | We,investigated |
R172 | T222 | T237 | arg1Of | investigated,vitro |
R173 | T222 | T240 | arg1Of | investigated,vivo |
R174 | T224 | T222 | arg2Of | effect,investigated |
R175 | T224 | T223 | arg1Of | effect,the |
R176 | T224 | T225 | arg1Of | effect,of |
R177 | T224 | T230 | arg1Of | effect,on |
R178 | T229 | T225 | arg2Of | propionate,of |
R179 | T229 | T226 | arg1Of | propionate,the |
R180 | T229 | T227 | arg1Of | propionate,corticosteroid |
R181 | T229 | T228 | arg1Of | propionate,fluticasone |
R182 | T232 | T230 | arg2Of | regulation,on |
R183 | T232 | T231 | arg1Of | regulation,GATA-3 |
R184 | T232 | T233 | arg1Of | regulation,in |
R185 | T235 | T233 | arg2Of | T-lymphocytes,in |
R186 | T235 | T234 | arg1Of | T-lymphocytes,human |
R187 | T237 | T236 | arg1Of | vitro,in |
R188 | T237 | T238 | arg1Of | vitro,and |
R189 | T240 | T238 | arg2Of | vivo,and |
R190 | T240 | T239 | arg1Of | vivo,in |
R191 | T241 | T242 | arg1Of | Methods,and |
R192 | T243 | T242 | arg2Of | Findings,and |
R193 | T249 | T246 | arg1Of | line,T |
R194 | T249 | T247 | arg1Of | line,lymphocyte |
R195 | T249 | T248 | arg1Of | line,cell |
R196 | T249 | T250 | arg1Of | line,( |
R197 | T249 | T253 | arg1Of | line,and |
R198 | T251 | T250 | arg2Of | HuT-78,( |
R199 | T252 | T250 | arg3Of | ),( |
R200 | T253 | T244 | arg2Of | and,In |
R201 | T253 | T245 | arg1Of | and,a |
R202 | T253 | T264 | arg1Of | and,vitro |
R203 | T257 | T253 | arg2Of | cells,and |
R204 | T257 | T254 | arg1Of | cells,peripheral |
R205 | T257 | T255 | arg1Of | cells,blood |
R206 | T257 | T256 | arg1Of | cells,mononuclear |
R207 | T257 | T258 | arg2Of | cells,stimulated |
R208 | T260 | T261 | arg1Of | anti-CD3,and |
R209 | T261 | T258 | arg1Of | and,stimulated |
R210 | T261 | T259 | arg2Of | and,by |
R211 | T262 | T261 | arg2Of | anti-CD28,and |
R212 | T264 | T263 | arg1Of | vitro,in |
R213 | T265 | T266 | arg1Of | we,demonstrated |
R214 | T266 | T244 | arg1Of | demonstrated,In |
R215 | T268 | T269 | arg1Of | fluticasone,inhibits |
R216 | T268 | T287 | arg1Of | fluticasone,is |
R217 | T268 | T288 | arg1Of | fluticasone,due |
R218 | T269 | T279 | arg1Of | inhibits,via |
R219 | T269 | T286 | arg1Of | inhibits,and |
R220 | T271 | T270 | arg1Of | translocation,nuclear |
R221 | T271 | T272 | arg1Of | translocation,of |
R222 | T271 | T274 | arg1Of | translocation,and |
R223 | T273 | T272 | arg2Of | GATA-3,of |
R224 | T274 | T269 | arg2Of | and,inhibits |
R225 | T275 | T274 | arg2Of | expression,and |
R226 | T275 | T276 | arg1Of | expression,of |
R227 | T278 | T276 | arg2Of | cytokines,of |
R228 | T278 | T277 | arg1Of | cytokines,Th2 |
R229 | T281 | T279 | arg2Of | mechanism,via |
R230 | T281 | T280 | arg1Of | mechanism,a |
R231 | T281 | T282 | arg1Of | mechanism,independent |
R232 | T282 | T283 | arg1Of | independent,of |
R233 | T285 | T283 | arg2Of | factor-κB,of |
R234 | T285 | T284 | arg1Of | factor-κB,nuclear |
R235 | T286 | T266 | arg2Of | and,demonstrated |
R236 | T286 | T267 | arg1Of | and,that |
R237 | T287 | T286 | arg2Of | is,and |
R238 | T287 | T292 | arg1Of | is,"," |
R239 | T287 | T293 | arg1Of | is,to |
R240 | T288 | T287 | arg2Of | due,is |
R241 | T288 | T289 | arg1Of | due,"," |
R242 | T288 | T290 | arg1Of | due,in |
R243 | T291 | T290 | arg2Of | part,in |
R244 | T294 | T293 | arg2Of | competition,to |
R245 | T294 | T295 | arg1Of | competition,between |
R246 | T296 | T297 | arg1Of | GATA-3,and |
R247 | T297 | T295 | arg2Of | and,between |
R248 | T301 | T297 | arg2Of | receptor,and |
R249 | T301 | T298 | arg1Of | receptor,the |
R250 | T301 | T299 | arg1Of | receptor,ligand-activated |
R251 | T301 | T300 | arg1Of | receptor,glucocorticoid |
R252 | T353 | T348 | arg2Of | and,are |
R253 | T353 | T352 | arg1Of | and,"," |
R254 | T301 | T302 | arg1Of | receptor,for |
R255 | T301 | T305 | arg1Of | receptor,through |
R256 | T304 | T302 | arg2Of | transport,for |
R257 | T354 | T353 | arg2Of | prolonged,and |
R258 | T355 | T357 | arg1Of | We,demonstrated |
R259 | T357 | T356 | arg1Of | demonstrated,also |
R260 | T360 | T359 | arg2Of | fluticasone,inhaled |
R261 | T360 | T361 | arg1Of | fluticasone,inhibits |
R262 | T304 | T303 | arg1Of | transport,nuclear |
R263 | T361 | T357 | arg2Of | inhibits,demonstrated |
R264 | T361 | T358 | arg1Of | inhibits,that |
R265 | T309 | T305 | arg2Of | importin-α,through |
R266 | T364 | T361 | arg2Of | translocation,inhibits |
R267 | T364 | T362 | arg1Of | translocation,GATA-3 |
R268 | T364 | T363 | arg1Of | translocation,nuclear |
R269 | T364 | T365 | arg1Of | translocation,in |
R270 | T368 | T365 | arg2Of | lymphocytes,in |
R271 | T368 | T366 | arg1Of | lymphocytes,peripheral |
R272 | T368 | T367 | arg1Of | lymphocytes,blood |
R273 | T368 | T369 | arg1Of | lymphocytes,of |
R274 | T370 | T369 | arg2Of | patients,of |
R275 | T370 | T371 | arg1Of | patients,with |
R276 | T309 | T306 | arg1Of | importin-α,the |
R277 | T372 | T371 | arg2Of | asthma,with |
R278 | T372 | T374 | arg1Of | asthma,vivo |
R279 | T309 | T307 | arg1Of | importin-α,nuclear |
R280 | T309 | T308 | arg1Of | importin-α,importer |
R281 | T374 | T373 | arg1Of | vivo,in |
R282 | T311 | T310 | arg2Of | addition,In |
R283 | T376 | T377 | arg1Of | Corticosteroids,have |
R284 | T377 | T384 | arg1Of | have,via |
R285 | T313 | T314 | arg1Of | fluticasone,induces |
R286 | T380 | T379 | arg1Of | inhibitory,potent |
R287 | T381 | T377 | arg2Of | effect,have |
R288 | T381 | T378 | arg1Of | effect,a |
R289 | T381 | T380 | arg1Of | effect,inhibitory |
R290 | T314 | T310 | arg1Of | induces,In |
R291 | T381 | T382 | arg1Of | effect,on |
R292 | T383 | T382 | arg2Of | GATA-3,on |
R293 | T314 | T312 | arg1Of | induces,"," |
R294 | T316 | T314 | arg2Of | expression,induces |
R295 | T387 | T384 | arg2Of | mechanisms,via |
R296 | T387 | T385 | arg1Of | mechanisms,two |
R297 | T387 | T386 | arg1Of | mechanisms,interacting |
R298 | T387 | T388 | arg1Of | mechanisms,that |
R299 | T387 | T390 | arg1Of | mechanisms,suppress |
R300 | T390 | T389 | arg1Of | suppress,potently |
R301 | T316 | T315 | arg1Of | expression,the |
R302 | T316 | T317 | arg1Of | expression,of |
R303 | T320 | T318 | arg1Of | kinase,mitogen-activated |
R304 | T393 | T390 | arg2Of | expression,suppress |
R305 | T393 | T391 | arg1Of | expression,Th2 |
R306 | T393 | T392 | arg1Of | expression,cytokine |
R307 | T396 | T394 | arg1Of | mechanism,This |
R308 | T396 | T395 | arg1Of | mechanism,novel |
R309 | T396 | T397 | arg1Of | mechanism,of |
R310 | T396 | T401 | arg1Of | mechanism,may |
R311 | T396 | T402 | arg1Of | mechanism,account |
R312 | T398 | T397 | arg2Of | action,of |
R313 | T398 | T399 | arg1Of | action,of |
R314 | T400 | T399 | arg2Of | corticosteroids,of |
R315 | T402 | T401 | arg2Of | account,may |
R316 | T402 | T403 | arg1Of | account,for |
R317 | T320 | T319 | arg1Of | kinase,protein |
R318 | T320 | T321 | arg1Of | kinase,( |
R319 | T322 | T321 | arg2Of | MAPK,( |
R320 | T407 | T403 | arg2Of | efficacy,for |
R321 | T407 | T404 | arg1Of | efficacy,the |
R322 | T407 | T405 | arg1Of | efficacy,striking |
R323 | T407 | T406 | arg1Of | efficacy,clinical |
R324 | T407 | T408 | arg1Of | efficacy,of |
R325 | T407 | T410 | arg1Of | efficacy,in |
R326 | T409 | T408 | arg2Of | corticosteroids,of |
R327 | T323 | T321 | arg3Of | ),( |
R328 | T412 | T410 | arg2Of | treatment,in |
R329 | T412 | T411 | arg1Of | treatment,the |
R330 | T412 | T413 | arg1Of | treatment,of |
R331 | T324 | T317 | arg2Of | phosphatase-1,of |
R332 | T415 | T413 | arg2Of | diseases,of |
R333 | T415 | T414 | arg1Of | diseases,allergic |
R334 | T417 | T416 | arg1Of | see,Please |
R335 | T324 | T320 | arg1Of | phosphatase-1,kinase |
R336 | T324 | T325 | arg1Of | phosphatase-1,( |
R337 | T324 | T328 | arg1Of | phosphatase-1,"," |
R338 | T326 | T325 | arg2Of | MKP-1,( |
R339 | T327 | T325 | arg3Of | ),( |
R340 | T331 | T328 | arg2Of | inhibitor,"," |
R341 | T417 | T418 | arg1Of | see,later |
R342 | T331 | T329 | arg1Of | inhibitor,the |
R343 | T331 | T330 | arg1Of | inhibitor,endogenous |
R344 | T331 | T332 | arg1Of | inhibitor,of |
R345 | T334 | T332 | arg2Of | MAPK,of |
R346 | T334 | T333 | arg1Of | MAPK,p38 |
R347 | T334 | T335 | arg1Of | MAPK,"," |
R348 | T334 | T336 | arg1Of | MAPK,which |
R349 | T334 | T337 | arg1Of | MAPK,is |
R350 | T334 | T338 | arg1Of | MAPK,necessary |
R351 | T338 | T337 | arg2Of | necessary,is |
R352 | T417 | T419 | arg1Of | see,in |
R353 | T338 | T339 | arg1Of | necessary,for |
R354 | T342 | T339 | arg2Of | translocation,for |
R355 | T421 | T419 | arg2Of | article,in |
R356 | T421 | T420 | arg1Of | article,the |
R357 | T421 | T422 | arg1Of | article,for |
R358 | T423 | T422 | arg2Of | Editors,for |
R359 | T424 | T417 | arg2Of | ',see |
R360 | T424 | T425 | arg1Of | ',Summary |
R361 | T342 | T340 | arg1Of | translocation,GATA-3 |
R362 | T342 | T341 | arg1Of | translocation,nuclear |
R363 | T345 | T343 | arg1Of | effects,These |
R364 | T345 | T344 | arg1Of | effects,inhibitory |
R365 | T345 | T346 | arg1Of | effects,of |
R366 | T345 | T348 | arg1Of | effects,are |
R367 | T345 | T349 | arg1Of | effects,rapid |
R368 | T345 | T351 | arg1Of | effects,potent |
R369 | T345 | T354 | arg1Of | effects,prolonged |
R370 | T347 | T346 | arg2Of | fluticasone,of |
R371 | T349 | T350 | arg1Of | rapid,"," |
R372 | T350 | T353 | arg1Of | ",",and |
R373 | T351 | T350 | arg2Of | potent,"," |
R1046 | T1321 | T1322 | arg1Of | Inflammation,in |
R1047 | T1321 | T1334 | arg1Of | Inflammation,is |
R1048 | T1321 | T1335 | arg2Of | Inflammation,mediated |
R1049 | T1324 | T1322 | arg2Of | diseases,in |
R1050 | T1324 | T1323 | arg1Of | diseases,allergic |
R1051 | T1324 | T1326 | arg1Of | diseases,as |
R1052 | T1326 | T1325 | arg1Of | as,such |
R1053 | T1327 | T1328 | arg1Of | asthma,"," |
R1054 | T1328 | T1331 | arg1Of | ",",and |
R1055 | T1329 | T1328 | arg2Of | rhinitis,"," |
R1056 | T1331 | T1326 | arg2Of | and,as |
R1057 | T1331 | T1330 | arg1Of | and,"," |
R1058 | T1333 | T1331 | arg2Of | dermatitis,and |
R1059 | T1333 | T1332 | arg1Of | dermatitis,atopic |
R1060 | T1335 | T1334 | arg2Of | mediated,is |
R1061 | T1335 | T1336 | arg1Of | mediated,via |
R1062 | T1337 | T1336 | arg2Of | expression,via |
R1063 | T1337 | T1338 | arg1Of | expression,of |
R1064 | T1340 | T1339 | arg1Of | cytokines,the |
R1065 | T1341 | T1342 | arg1Of | interleukin,( |
R1066 | T1341 | T1345 | arg1Of | interleukin,-4 |
R1067 | T1341 | T1346 | arg1Of | interleukin,"," |
R1068 | T1343 | T1342 | arg2Of | IL,( |
R1069 | T1344 | T1342 | arg3Of | ),( |
R1070 | T1346 | T1349 | arg1Of | ",",and |
R1071 | T1347 | T1346 | arg2Of | IL-5,"," |
R1072 | T1349 | T1338 | arg2Of | and,of |
R1073 | T1349 | T1340 | arg1Of | and,cytokines |
R1074 | T1349 | T1348 | arg1Of | and,"," |
R1075 | T1349 | T1351 | arg1Of | and,from |
R1076 | T1350 | T1349 | arg2Of | IL-13,and |
R1077 | T1355 | T1354 | arg2Of | Th2,( |
R1078 | T1356 | T1354 | arg3Of | ),( |
R1079 | T1357 | T1351 | arg2Of | cells,from |
R1080 | T1357 | T1352 | arg1Of | cells,T |
R1081 | T1357 | T1353 | arg1Of | cells,helper-2 |
R1082 | T1357 | T1354 | arg1Of | cells,( |
R1083 | T1358 | T1359 | arg1Of | IL-4,and |
R1084 | T1359 | T1361 | arg1Of | and,regulate |
R1085 | T1360 | T1359 | arg2Of | IL-13,and |
R1086 | T1361 | T1370 | arg1Of | regulate,whereas |
R1087 | T1363 | T1361 | arg2Of | expression,regulate |
R1088 | T1363 | T1362 | arg1Of | expression,the |
R1089 | T1363 | T1364 | arg1Of | expression,of |
R1090 | T1363 | T1366 | arg1Of | expression,from |
R1091 | T1365 | T1364 | arg2Of | IgE,of |
R1092 | T1368 | T1366 | arg2Of | lymphocytes,from |
R1093 | T1368 | T1367 | arg1Of | lymphocytes,B |
R1094 | T1370 | T1369 | arg1Of | whereas,"," |
R1095 | T1371 | T1372 | arg1Of | IL-5,plays |
R1096 | T1372 | T1370 | arg2Of | plays,whereas |
R1097 | T1372 | T1376 | arg1Of | plays,in |
R1098 | T1375 | T1372 | arg2Of | role,plays |
R1099 | T1375 | T1373 | arg1Of | role,a |
R1100 | T1375 | T1374 | arg1Of | role,key |
R1101 | T1378 | T1376 | arg2Of | inflammation,in |
R1102 | T1378 | T1377 | arg1Of | inflammation,eosinophilic |
R1103 | T1378 | T1379 | arg1Of | inflammation,[ |
R1104 | T1380 | T1379 | arg2Of | 1,[ |
R1105 | T1381 | T1379 | arg3Of | ],[ |
R1106 | T1383 | T1382 | arg1Of | cytokines,Th2 |
R1107 | T1383 | T1384 | arg1Of | cytokines,are |
R1108 | T1383 | T1385 | arg2Of | cytokines,regulated |
R1109 | T1385 | T1384 | arg2Of | regulated,are |
R1110 | T1392 | T1385 | arg1Of | GATA-3,regulated |
R1111 | T1392 | T1386 | arg2Of | GATA-3,by |
R1112 | T1392 | T1387 | arg1Of | GATA-3,the |
R1113 | T1392 | T1388 | arg1Of | GATA-3,zinc |
R1114 | T1392 | T1389 | arg1Of | GATA-3,finger |
R1115 | T1392 | T1390 | arg1Of | GATA-3,transcription |
R1116 | T1392 | T1391 | arg1Of | GATA-3,factor |
R1117 | T1392 | T1393 | arg1Of | GATA-3,"," |
R1118 | T1392 | T1394 | arg1Of | GATA-3,which |
R1119 | T1392 | T1395 | arg1Of | GATA-3,is |
R1120 | T1392 | T1397 | arg2Of | GATA-3,expressed |
R1121 | T1397 | T1395 | arg2Of | expressed,is |
R1122 | T1397 | T1396 | arg1Of | expressed,predominantly |
R1123 | T1397 | T1398 | arg1Of | expressed,in |
R1124 | T1397 | T1404 | arg1Of | expressed,"," |
R1125 | T1397 | T1405 | arg1Of | expressed,[ |
R1126 | T1400 | T1398 | arg2Of | cells,in |
R1127 | T1400 | T1399 | arg1Of | cells,Th2 |
R1128 | T1400 | T1401 | arg1Of | cells,[ |
R1129 | T1402 | T1401 | arg2Of | 2,[ |
R1130 | T1403 | T1401 | arg3Of | ],[ |
R1131 | T1406 | T1405 | arg2Of | 3,[ |
R1132 | T1407 | T1405 | arg3Of | ],[ |
R1133 | T1408 | T1409 | arg1Of | GATA-3,determines |
R1134 | T1408 | T1415 | arg1Of | GATA-3,activates |
R1135 | T1409 | T1413 | arg1Of | determines,and |
R1136 | T1412 | T1409 | arg2Of | differentiation,determines |
R1137 | T1412 | T1410 | arg1Of | differentiation,Th2 |
R1138 | T1412 | T1411 | arg1Of | differentiation,cell |
R1139 | T1413 | T1432 | arg1Of | and,[ |
R1140 | T1415 | T1413 | arg2Of | activates,and |
R1141 | T1415 | T1414 | arg1Of | activates,selectively |
R1142 | T1415 | T1425 | arg1Of | activates,through |
R1143 | T1417 | T1415 | arg2Of | promoters,activates |
R1144 | T1417 | T1416 | arg1Of | promoters,the |
R1145 | T1417 | T1418 | arg1Of | promoters,of |
R1146 | T1419 | T1420 | arg1Of | IL-4,"," |
R1147 | T1420 | T1423 | arg1Of | ",",and |
R1148 | T1421 | T1420 | arg2Of | IL-5,"," |
R1149 | T1423 | T1418 | arg2Of | and,of |
R1150 | T1423 | T1422 | arg1Of | and,"," |
R1151 | T1424 | T1423 | arg2Of | IL-13,and |
R1152 | T1426 | T1425 | arg2Of | chromatin,through |
R1153 | T1426 | T1427 | arg1Of | chromatin,remodelling |
R1154 | T1429 | T1428 | arg2Of | 4,[ |
R1155 | T1430 | T1428 | arg3Of | ],[ |
R1156 | T1431 | T1427 | arg2Of | –,remodelling |
R1157 | T1431 | T1428 | arg1Of | –,[ |
R1158 | T1433 | T1432 | arg2Of | 7,[ |
R1159 | T1434 | T1432 | arg3Of | ],[ |
R1160 | T1437 | T1435 | arg1Of | role,The |
R1161 | T1437 | T1436 | arg1Of | role,key |
R1162 | T1437 | T1438 | arg1Of | role,of |
R1163 | T1437 | T1440 | arg1Of | role,in |
R1164 | T1437 | T1444 | arg1Of | role,has |
R1165 | T1437 | T1445 | arg1Of | role,been |
R1166 | T1437 | T1446 | arg2Of | role,demonstrated |
R1167 | T1439 | T1438 | arg2Of | GATA-3,of |
R1168 | T1443 | T1440 | arg2Of | inflammation,in |
R1169 | T1443 | T1441 | arg1Of | inflammation,allergic |
R1170 | T1443 | T1442 | arg1Of | inflammation,airway |
R1171 | T1446 | T1444 | arg2Of | demonstrated,has |
R1172 | T1446 | T1445 | arg2Of | demonstrated,been |
R1173 | T1446 | T1447 | arg1Of | demonstrated,in |
R1174 | T1446 | T1456 | arg1Of | demonstrated,in |
R1175 | T1446 | T1465 | arg1Of | demonstrated,by |
R1176 | T1446 | T1476 | arg1Of | demonstrated,"," |
R1177 | T1446 | T1477 | arg1Of | demonstrated,[ |
R1178 | T1448 | T1447 | arg2Of | mice,in |
R1179 | T1452 | T1446 | arg1Of | release,demonstrated |
R1180 | T1452 | T1449 | arg2Of | release,by |
R1181 | T1452 | T1450 | arg1Of | release,the |
R1182 | T1452 | T1451 | arg2Of | release,reduced |
R1183 | T1452 | T1453 | arg1Of | release,of |
R1184 | T1455 | T1453 | arg2Of | cytokines,of |
R1185 | T1455 | T1454 | arg1Of | cytokines,Th2 |
R1186 | T1456 | T1464 | arg1Of | in,and |
R1187 | T1457 | T1456 | arg2Of | animals,in |
R1188 | T1457 | T1458 | arg2Of | animals,treated |
R1189 | T1458 | T1459 | arg1Of | treated,with |
R1190 | T1461 | T1459 | arg2Of | mutants,with |
R1191 | T1461 | T1460 | arg1Of | mutants,dominant-negative |
R1192 | T1461 | T1462 | arg1Of | mutants,of |
R1193 | T1463 | T1462 | arg2Of | GATA-3,of |
R1194 | T1465 | T1464 | arg2Of | by,and |
R1195 | T1467 | T1465 | arg2Of | application,by |
R1196 | T1467 | T1466 | arg1Of | application,local |
R1197 | T1467 | T1468 | arg1Of | application,of |
R1198 | T1467 | T1471 | arg1Of | application,to |
R1199 | T1470 | T1468 | arg2Of | oligonucleotides,of |
R1200 | T1470 | T1469 | arg1Of | oligonucleotides,antisense |
R1201 | T1472 | T1471 | arg2Of | GATA-3,to |
R1202 | T1472 | T1473 | arg1Of | GATA-3,[ |
R1203 | T1474 | T1473 | arg2Of | 8,[ |
R1204 | T1475 | T1473 | arg3Of | ],[ |
R1205 | T1478 | T1477 | arg2Of | 9,[ |
R1206 | T1479 | T1477 | arg3Of | ],[ |
R1207 | T1483 | T1482 | arg1Of | knock-out,conditional |
R1208 | T1483 | T1484 | arg1Of | knock-out,of |
R1209 | T1483 | T1488 | arg1Of | knock-out,in |
R1210 | T1483 | T1490 | arg1Of | knock-out,reduces |
R1211 | T1487 | T1484 | arg2Of | gene,of |
R1212 | T1487 | T1485 | arg1Of | gene,the |
R1213 | T1487 | T1486 | arg1Of | gene,Gata3 |
R1214 | T1489 | T1488 | arg2Of | mice,in |
R1215 | T1490 | T1480 | arg1Of | reduces,Furthermore |
R1216 | T1490 | T1481 | arg1Of | reduces,"," |
R1217 | T1490 | T1504 | arg1Of | reduces,and |
R1218 | T1491 | T1490 | arg2Of | expression,reduces |
R1219 | T1491 | T1492 | arg1Of | expression,of |
R1220 | T1491 | T1496 | arg1Of | expression,vitro |
R1221 | T1491 | T1499 | arg1Of | expression,vivo |
R1222 | T1491 | T1500 | arg1Of | expression,[ |
R1223 | T1494 | T1492 | arg2Of | cytokines,of |
R1224 | T1494 | T1493 | arg1Of | cytokines,Th2 |
R1225 | T1496 | T1495 | arg1Of | vitro,in |
R1226 | T1496 | T1497 | arg1Of | vitro,and |
R1227 | T1499 | T1497 | arg2Of | vivo,and |
R1228 | T1499 | T1498 | arg1Of | vivo,in |
R1229 | T1501 | T1500 | arg2Of | 10,[ |
R1230 | T1502 | T1500 | arg3Of | ],[ |
R1231 | T1504 | T1503 | arg1Of | and,"," |
R1232 | T1506 | T1505 | arg1Of | results,similar |
R1233 | T1506 | T1507 | arg1Of | results,have |
R1234 | T1506 | T1508 | arg1Of | results,been |
R1235 | T1506 | T1509 | arg2Of | results,reported |
R1236 | T1509 | T1504 | arg2Of | reported,and |
R1237 | T1509 | T1507 | arg2Of | reported,have |
R1238 | T1509 | T1508 | arg2Of | reported,been |
R1239 | T1509 | T1510 | arg1Of | reported,in |
R1240 | T1514 | T1510 | arg2Of | lymphocytes,in |
R1241 | T1514 | T1511 | arg2Of | lymphocytes,isolated |
R1242 | T1514 | T1512 | arg1Of | lymphocytes,murine |
R1243 | T1514 | T1513 | arg1Of | lymphocytes,CD4+ |
R1244 | T1514 | T1515 | arg1Of | lymphocytes,[ |
R1245 | T1516 | T1515 | arg2Of | 11,[ |
R1246 | T1517 | T1515 | arg3Of | ],[ |
R1247 | T1520 | T1521 | arg1Of | knockdown,of |
R1248 | T1520 | T1530 | arg1Of | knockdown,results |
R1249 | T1523 | T1521 | arg2Of | expression,of |
R1250 | T1523 | T1522 | arg1Of | expression,GATA-3 |
R1251 | T1523 | T1524 | arg1Of | expression,using |
R1252 | T1524 | T1526 | arg1Of | using,in |
R1253 | T1525 | T1524 | arg2Of | siRNA,using |
R1254 | T1529 | T1526 | arg2Of | cells,in |
R1255 | T1529 | T1527 | arg1Of | cells,human |
R1256 | T1529 | T1528 | arg1Of | cells,T |
R1257 | T1530 | T1518 | arg1Of | results,Finally |
R1258 | T1530 | T1519 | arg1Of | results,"," |
R1259 | T1530 | T1531 | arg1Of | results,in |
R1260 | T1530 | T1538 | arg1Of | results,[ |
R1261 | T1532 | T1531 | arg2Of | loss,in |
R1262 | T1532 | T1533 | arg1Of | loss,of |
R1263 | T1537 | T1533 | arg2Of | expression,of |
R1264 | T1537 | T1534 | arg1Of | expression,anti-CD3/CD28-mediated |
R1265 | T1537 | T1535 | arg1Of | expression,Th2 |
R1266 | T1537 | T1536 | arg1Of | expression,cytokine |
R1267 | T1539 | T1538 | arg2Of | 12,[ |
R1268 | T1540 | T1538 | arg3Of | ],[ |
R1269 | T1542 | T1541 | arg2Of | order,In |
R1270 | T1542 | T1543 | arg1Of | order,for |
R1271 | T1544 | T1543 | arg2Of | GATA-3,for |
R1272 | T1544 | T1546 | arg1Of | GATA-3,regulate |
R1273 | T1546 | T1543 | arg3Of | regulate,for |
R1274 | T1546 | T1545 | arg1Of | regulate,to |
R1275 | T1548 | T1546 | arg2Of | expression,regulate |
R1276 | T1548 | T1547 | arg1Of | expression,gene |
R1277 | T1550 | T1551 | arg1Of | it,must |
R1278 | T1550 | T1552 | arg1Of | it,translocate |
R1279 | T1552 | T1541 | arg1Of | translocate,In |
R1280 | T1552 | T1549 | arg1Of | translocate,"," |
R1281 | T1552 | T1551 | arg2Of | translocate,must |
R1282 | T1552 | T1553 | arg1Of | translocate,from |
R1283 | T1555 | T1553 | arg2Of | cytoplasm,from |
R1284 | T1555 | T1554 | arg1Of | cytoplasm,the |
R1285 | T1555 | T1556 | arg1Of | cytoplasm,into |
R1286 | T1558 | T1556 | arg2Of | nucleus,into |
R1287 | T1558 | T1557 | arg1Of | nucleus,the |
R1288 | T1558 | T1559 | modOf | nucleus,to |
R1289 | T1560 | T1559 | arg1Of | access,to |
R1290 | T1563 | T1560 | arg2Of | genes,access |
R1291 | T1563 | T1561 | arg1Of | genes,its |
R1292 | T1563 | T1562 | arg1Of | genes,target |
R1293 | T1566 | T1564 | arg2Of | expression,Enhanced |
R1294 | T1566 | T1565 | arg1Of | expression,nuclear |
R1295 | T1566 | T1567 | arg1Of | expression,of |
R1296 | T1566 | T1574 | arg1Of | expression,was |
R1297 | T1566 | T1576 | arg2Of | expression,demonstrated |
R1298 | T1566 | T1585 | arg1Of | expression,was |
R1299 | T1566 | T1587 | arg2Of | expression,confirmed |
R1300 | T1568 | T1567 | arg2Of | GATA-3,of |
R1301 | T1568 | T1569 | arg1Of | GATA-3,following |
R1302 | T1573 | T1569 | arg2Of | activation,following |
R1303 | T1573 | T1570 | arg1Of | activation,T |
R1304 | T1573 | T1571 | arg1Of | activation,cell |
R1305 | T1573 | T1572 | arg1Of | activation,receptor |
R1306 | T1576 | T1574 | arg2Of | demonstrated,was |
R1307 | T1576 | T1575 | arg1Of | demonstrated,first |
R1308 | T1576 | T1577 | arg1Of | demonstrated,in |
R1309 | T1576 | T1581 | arg1Of | demonstrated,[ |
R1310 | T1576 | T1584 | arg1Of | demonstrated,and |
R1311 | T1580 | T1577 | arg2Of | cells,in |
R1312 | T1580 | T1578 | arg1Of | cells,murine |
R1313 | T1580 | T1579 | arg1Of | cells,T |
R1314 | T1582 | T1581 | arg2Of | 13,[ |
R1315 | T1583 | T1581 | arg3Of | ],[ |
R1316 | T1587 | T1584 | arg2Of | confirmed,and |
R1317 | T1587 | T1585 | arg2Of | confirmed,was |
R1318 | T1587 | T1586 | arg1Of | confirmed,recently |
R1319 | T1587 | T1588 | arg1Of | confirmed,in |
R1320 | T1587 | T1592 | arg1Of | confirmed,following |
R1321 | T1591 | T1588 | arg2Of | cells,in |
R1322 | T1591 | T1589 | arg1Of | cells,human |
R1323 | T1591 | T1590 | arg1Of | cells,T |
R1324 | T1595 | T1593 | arg1Of | receptor,T |
R1325 | T1595 | T1594 | arg1Of | receptor,cell |
R1326 | T1595 | T1596 | arg1Of | receptor,and |
R1327 | T1596 | T1592 | arg2Of | and,following |
R1328 | T1598 | T1596 | arg2Of | stimulation,and |
R1329 | T1598 | T1597 | arg1Of | stimulation,co-receptor |
R1330 | T1598 | T1599 | arg1Of | stimulation,[ |
R1331 | T1600 | T1599 | arg2Of | 12,[ |
R1332 | T1601 | T1599 | arg3Of | ],[ |
R1333 | T1602 | T1603 | arg1Of | GATA-3,contains |
R1334 | T1602 | T1613 | arg1Of | GATA-3,is |
R1335 | T1602 | T1614 | arg2Of | GATA-3,transported |
R1336 | T1603 | T1609 | arg1Of | contains,[ |
R1337 | T1603 | T1612 | arg1Of | contains,and |
R1338 | T1608 | T1603 | arg2Of | signal,contains |
R1339 | T1608 | T1604 | arg1Of | signal,a |
R1340 | T1608 | T1605 | arg1Of | signal,classical |
R1341 | T1608 | T1606 | arg1Of | signal,nuclear |
R1342 | T1608 | T1607 | arg1Of | signal,import |
R1343 | T1610 | T1609 | arg2Of | 14,[ |
R1344 | T1611 | T1609 | arg3Of | ],[ |
R1345 | T1614 | T1612 | arg2Of | transported,and |
R1346 | T1614 | T1613 | arg2Of | transported,is |
R1347 | T1614 | T1615 | arg1Of | transported,into |
R1348 | T1614 | T1618 | arg1Of | transported,by |
R1349 | T1614 | T1630 | arg1Of | transported,[ |
R1350 | T1617 | T1615 | arg2Of | nucleus,into |
R1351 | T1617 | T1616 | arg1Of | nucleus,the |
R1352 | T1623 | T1618 | arg2Of | importin-α,by |
R1353 | T1623 | T1619 | arg1Of | importin-α,the |
R1354 | T1623 | T1620 | arg1Of | importin-α,nuclear |
R1355 | T1623 | T1621 | arg1Of | importin-α,import |
R1356 | T1623 | T1622 | arg1Of | importin-α,protein |
R1357 | T1623 | T1624 | arg1Of | importin-α,( |
R1358 | T1626 | T1624 | arg2Of | known,( |
R1359 | T1626 | T1625 | arg1Of | known,also |
R1360 | T1626 | T1627 | arg1Of | known,as |
R1361 | T1628 | T1627 | arg2Of | karyopherin-α,as |
R1362 | T1629 | T1624 | arg3Of | ),( |
R1363 | T1631 | T1630 | arg2Of | 12,[ |
R1364 | T1632 | T1630 | arg3Of | ],[ |
R1365 | T1633 | T1634 | arg1Of | Deletion,of |
R1366 | T1633 | T1652 | arg1Of | Deletion,prevents |
R1367 | T1636 | T1634 | arg2Of | region,of |
R1368 | T1636 | T1635 | arg1Of | region,a |
R1369 | T1636 | T1637 | arg1Of | region,encompassing |
R1370 | T1642 | T1639 | arg1Of | sequence,GATA-3 |
R1371 | T1642 | T1640 | arg1Of | sequence,nuclear |
R1372 | T1642 | T1641 | arg1Of | sequence,localisation |
R1373 | T1642 | T1643 | arg1Of | sequence,( |
R1374 | T1644 | T1643 | arg2Of | NLS,( |
R1375 | T1645 | T1643 | arg3Of | ),( |
R1376 | T1646 | T1637 | arg2Of | region,encompassing |
R1377 | T1646 | T1638 | arg1Of | region,the |
R1378 | T1646 | T1642 | arg1Of | region,sequence |
R1379 | T1646 | T1647 | arg1Of | region,in |
R1380 | T1648 | T1649 | arg1Of | murine,and |
R1381 | T1650 | T1649 | arg2Of | human,and |
R1382 | T1651 | T1647 | arg2Of | cells,in |
R1383 | T1651 | T1648 | arg1Of | cells,murine |
R1384 | T1651 | T1650 | arg1Of | cells,human |
R1385 | T1652 | T1659 | arg1Of | prevents,"," |
R1386 | T1652 | T1660 | arg1Of | prevents,[ |
R1387 | T1655 | T1652 | arg2Of | localisation,prevents |
R1388 | T1655 | T1653 | arg1Of | localisation,its |
R1389 | T1655 | T1654 | arg1Of | localisation,nuclear |
R1390 | T1655 | T1656 | arg1Of | localisation,[ |
R1391 | T1657 | T1656 | arg2Of | 12,[ |
R1392 | T1658 | T1656 | arg3Of | ],[ |
R1393 | T1661 | T1660 | arg2Of | 14,[ |
R1394 | T1662 | T1660 | arg3Of | ],[ |
R1395 | T1664 | T1663 | arg1Of | affinity,The |
R1396 | T1664 | T1665 | arg1Of | affinity,of |
R1397 | T1664 | T1669 | arg1Of | affinity,is |
R1398 | T1664 | T1670 | arg2Of | affinity,regulated |
R1399 | T1668 | T1665 | arg2Of | interaction,of |
R1400 | T1668 | T1666 | arg1Of | interaction,the |
R1401 | T1668 | T1667 | arg1Of | interaction,importin-α–NLS |
R1402 | T1670 | T1669 | arg2Of | regulated,is |
R1403 | T1670 | T1677 | arg1Of | regulated,and |
R1404 | T1672 | T1670 | arg1Of | phosphorylation,regulated |
R1405 | T1672 | T1671 | arg2Of | phosphorylation,by |
R1406 | T1672 | T1673 | arg1Of | phosphorylation,[ |
R1407 | T1674 | T1673 | arg2Of | 15,[ |
R1408 | T1675 | T1673 | arg3Of | ],[ |
R1409 | T1677 | T1676 | arg1Of | and,"," |
R1410 | T1678 | T1679 | arg1Of | we,have |
R1411 | T1678 | T1680 | arg1Of | we,shown |
R1412 | T1680 | T1677 | arg2Of | shown,and |
R1413 | T1680 | T1679 | arg2Of | shown,have |
R1414 | T1685 | T1682 | arg1Of | kinase,p38 |
R1415 | T1685 | T1683 | arg1Of | kinase,mitogen-activated |
R1416 | T1685 | T1684 | arg1Of | kinase,protein |
R1417 | T1685 | T1686 | arg1Of | kinase,( |
R1418 | T1685 | T1689 | arg1Of | kinase,plays |
R1419 | T1687 | T1686 | arg2Of | MAPK,( |
R1420 | T1688 | T1686 | arg3Of | ),( |
R1421 | T1689 | T1680 | arg2Of | plays,shown |
R1422 | T1689 | T1681 | arg1Of | plays,that |
R1423 | T1689 | T1693 | arg1Of | plays,in |
R1424 | T1689 | T1708 | arg1Of | plays,[ |
R1425 | T1692 | T1689 | arg2Of | role,plays |
R1426 | T1692 | T1690 | arg1Of | role,a |
R1427 | T1692 | T1691 | arg1Of | role,critical |
R1428 | T1694 | T1693 | arg2Of | phosphorylating,in |
R1429 | T1694 | T1696 | modOf | phosphorylating,to |
R1430 | T1695 | T1694 | arg2Of | GATA-3,phosphorylating |
R1431 | T1697 | T1696 | arg1Of | enhance,to |
R1432 | T1699 | T1697 | arg2Of | interaction,enhance |
R1433 | T1699 | T1698 | arg1Of | interaction,its |
R1434 | T1699 | T1700 | arg1Of | interaction,with |
R1435 | T1699 | T1705 | arg1Of | interaction,into |
R1436 | T1701 | T1702 | arg1Of | importin-α,and |
R1437 | T1703 | T1702 | arg2Of | subsequent,and |
R1438 | T1704 | T1700 | arg2Of | transport,with |
R1439 | T1704 | T1701 | arg1Of | transport,importin-α |
R1440 | T1704 | T1703 | arg1Of | transport,subsequent |
R1441 | T1707 | T1705 | arg2Of | nucleus,into |
R1442 | T1707 | T1706 | arg1Of | nucleus,the |
R1443 | T1709 | T1708 | arg2Of | 12,[ |
R1444 | T1710 | T1708 | arg3Of | ],[ |
R1445 | T1711 | T1712 | arg1Of | Corticosteroids,are |
R1446 | T1711 | T1714 | arg1Of | Corticosteroids,effective |
R1447 | T1712 | T1721 | arg1Of | are,"," |
R1448 | T1712 | T1722 | arg1Of | are,with |
R1449 | T1712 | T1734 | arg1Of | are,[ |
R1450 | T1714 | T1712 | arg2Of | effective,are |
R1451 | T1714 | T1713 | arg1Of | effective,highly |
R1452 | T1714 | T1715 | arg1Of | effective,in |
R1453 | T1717 | T1715 | arg2Of | treatment,in |
R1454 | T1717 | T1716 | arg1Of | treatment,the |
R1455 | T1717 | T1718 | arg1Of | treatment,of |
R1456 | T1720 | T1718 | arg2Of | inflammation,of |
R1457 | T1720 | T1719 | arg1Of | inflammation,allergic |
R1458 | T1724 | T1722 | arg2Of | suppression,with |
R1459 | T1724 | T1723 | arg1Of | suppression,marked |
R1460 | T1724 | T1725 | arg1Of | suppression,of |
R1461 | T1724 | T1728 | arg1Of | suppression,in |
R1462 | T1727 | T1725 | arg2Of | cytokines,of |
R1463 | T1727 | T1726 | arg1Of | cytokines,Th2 |
R1464 | T1729 | T1728 | arg2Of | airways,in |
R1465 | T1729 | T1730 | arg1Of | airways,of |
R1466 | T1731 | T1730 | arg2Of | patients,of |
R1467 | T1731 | T1732 | arg1Of | patients,with |
R1468 | T1733 | T1732 | arg2Of | asthma,with |
R1469 | T1735 | T1734 | arg2Of | 16,[ |
R1470 | T1736 | T1734 | arg3Of | ],[ |
R1471 | T1737 | T1738 | arg1Of | Corticosteroids,mediate |
R1472 | T1738 | T1742 | arg1Of | mediate,through |
R1473 | T1741 | T1738 | arg2Of | effects,mediate |
R1474 | T1741 | T1739 | arg1Of | effects,their |
R1475 | T1741 | T1740 | arg1Of | effects,anti-inflammatory |
R1476 | T1743 | T1742 | arg2Of | binding,through |
R1477 | T1743 | T1744 | arg1Of | binding,to |
R1478 | T1746 | T1744 | arg2Of | receptors,to |
R1479 | T1746 | T1745 | arg1Of | receptors,glucocorticoid |
R1480 | T1746 | T1747 | arg1Of | receptors,( |
R1481 | T1746 | T1750 | arg1Of | receptors,"," |
R1482 | T1746 | T1751 | arg1Of | receptors,which |
R1483 | T1746 | T1753 | arg1Of | receptors,translocate |
R1484 | T1748 | T1747 | arg2Of | GRs,( |
R1485 | T1749 | T1747 | arg3Of | ),( |
R1486 | T1753 | T1752 | arg1Of | translocate,then |
R1487 | T1753 | T1754 | arg1Of | translocate,to |
R1488 | T1756 | T1754 | arg2Of | nucleus,to |
R1489 | T1756 | T1755 | arg1Of | nucleus,the |
R1490 | T1756 | T1757 | arg1Of | nucleus,where |
R1491 | T1758 | T1759 | arg1Of | they,interact |
R1492 | T1759 | T1757 | arg2Of | interact,where |
R1493 | T1759 | T1760 | arg1Of | interact,with |
R1494 | T1763 | T1760 | arg2Of | elements,with |
R1495 | T1763 | T1761 | arg1Of | elements,glucocorticoid |
R1496 | T1763 | T1762 | arg1Of | elements,response |
R1497 | T1763 | T1764 | arg1Of | elements,( |
R1498 | T1763 | T1767 | arg1Of | elements,in |
R1499 | T1765 | T1764 | arg2Of | GREs,( |
R1500 | T1766 | T1764 | arg3Of | ),( |
R1501 | T1770 | T1767 | arg2Of | regions,in |
R1502 | T1770 | T1768 | arg1Of | regions,the |
R1503 | T1770 | T1769 | arg1Of | regions,promoter |
R1504 | T1770 | T1771 | arg1Of | regions,of |
R1505 | T1773 | T1771 | arg2Of | genes,of |
R1506 | T1773 | T1772 | arg1Of | genes,steroid-sensitive |
R1507 | T1777 | T1776 | arg2Of | GR,activated |
R1508 | T1777 | T1778 | arg1Of | GR,interacts |
R1509 | T1777 | T1783 | arg1Of | GR,suppress |
R1510 | T1777 | T1790 | arg1Of | GR,inhibiting |
R1511 | T1778 | T1774 | arg1Of | interacts,Alternatively |
R1512 | T1778 | T1775 | arg1Of | interacts,"," |
R1513 | T1778 | T1779 | arg1Of | interacts,with |
R1514 | T1778 | T1817 | arg1Of | interacts,"," |
R1515 | T1778 | T1818 | arg1Of | interacts,[ |
R1516 | T1781 | T1779 | arg2Of | molecules,with |
R1517 | T1781 | T1780 | arg1Of | molecules,coactivator |
R1518 | T1783 | T1778 | arg2Of | suppress,interacts |
R1519 | T1783 | T1782 | arg1Of | suppress,to |
R1520 | T1783 | T1789 | arg1Of | suppress,by |
R1521 | T1785 | T1783 | arg2Of | expression,suppress |
R1522 | T1785 | T1784 | arg1Of | expression,the |
R1523 | T1785 | T1786 | arg1Of | expression,of |
R1524 | T1788 | T1786 | arg2Of | genes,of |
R1525 | T1788 | T1787 | arg1Of | genes,inflammatory |
R1526 | T1790 | T1789 | arg2Of | inhibiting,by |
R1527 | T1790 | T1804 | arg1Of | inhibiting,through |
R1528 | T1792 | T1790 | arg2Of | action,inhibiting |
R1529 | T1792 | T1791 | arg1Of | action,the |
R1530 | T1792 | T1793 | arg1Of | action,of |
R1531 | T1796 | T1793 | arg2Of | factors,of |
R1532 | T1796 | T1794 | arg1Of | factors,proinflammatory |
R1533 | T1796 | T1795 | arg1Of | factors,transcription |
R1534 | T1796 | T1798 | arg1Of | factors,as |
R1535 | T1798 | T1797 | arg1Of | as,such |
R1536 | T1800 | T1798 | arg2Of | factor-κB,as |
R1537 | T1800 | T1799 | arg1Of | factor-κB,nuclear |
R1538 | T1800 | T1801 | arg1Of | factor-κB,( |
R1539 | T1802 | T1801 | arg2Of | NF-κB,( |
R1540 | T1803 | T1801 | arg3Of | ),( |
R1541 | T1806 | T1804 | arg2Of | recruitment,through |
R1542 | T1806 | T1805 | arg1Of | recruitment,the |
R1543 | T1806 | T1807 | arg1Of | recruitment,of |
R1544 | T1809 | T1807 | arg2Of | molecules,of |
R1545 | T1809 | T1808 | arg1Of | molecules,co-repressor |
R1546 | T1809 | T1811 | arg1Of | molecules,as |
R1547 | T1811 | T1810 | arg1Of | as,such |
R1548 | T1813 | T1811 | arg2Of | deacetylase-2,as |
R1549 | T1813 | T1812 | arg1Of | deacetylase-2,histone |
R1550 | T1813 | T1814 | arg1Of | deacetylase-2,[ |
R1551 | T1815 | T1814 | arg2Of | 17,[ |
R1552 | T1816 | T1814 | arg3Of | ],[ |
R1553 | T1819 | T1818 | arg2Of | 18,[ |
R1554 | T1820 | T1818 | arg3Of | ],[ |
R1555 | T1822 | T1821 | arg1Of | localisation,Nuclear |
R1556 | T1822 | T1823 | arg1Of | localisation,and |
R1557 | T1823 | T1827 | arg1Of | and,is |
R1558 | T1823 | T1828 | arg2Of | and,mediated |
R1559 | T1824 | T1823 | arg2Of | retention,and |
R1560 | T1824 | T1825 | arg1Of | retention,of |
R1561 | T1826 | T1825 | arg2Of | GR,of |
R1562 | T1828 | T1827 | arg2Of | mediated,is |
R1563 | T1828 | T1829 | arg1Of | mediated,through |
R1564 | T1828 | T1840 | arg1Of | mediated,"," |
R1565 | T1828 | T1841 | arg1Of | mediated,by |
R1566 | T1828 | T1850 | arg1Of | mediated,by |
R1567 | T1828 | T1855 | arg1Of | mediated,via |
R1568 | T1828 | T1866 | arg1Of | mediated,[ |
R1569 | T1834 | T1830 | arg1Of | NL1,the |
R1570 | T1834 | T1831 | arg1Of | NL1,nuclear |
R1571 | T1834 | T1832 | arg1Of | NL1,localisation |
R1572 | T1834 | T1833 | arg1Of | NL1,sequences |
R1573 | T1834 | T1835 | arg1Of | NL1,and |
R1574 | T1835 | T1829 | arg2Of | and,through |
R1575 | T1836 | T1835 | arg2Of | NL2,and |
R1576 | T1836 | T1837 | arg1Of | NL2,[ |
R1577 | T1838 | T1837 | arg2Of | 19,[ |
R1578 | T1839 | T1837 | arg3Of | ],[ |
R1579 | T1841 | T1849 | arg1Of | by,and |
R1580 | T1844 | T1841 | arg2Of | signals,by |
R1581 | T1844 | T1842 | arg1Of | signals,nuclear |
R1582 | T1844 | T1843 | arg1Of | signals,retention |
R1583 | T1844 | T1845 | arg1Of | signals,[ |
R1584 | T1846 | T1845 | arg2Of | 20,[ |
R1585 | T1847 | T1845 | arg3Of | ],[ |
R1586 | T1849 | T1848 | arg1Of | and,"," |
R1587 | T1850 | T1849 | arg2Of | by,and |
R1588 | T1851 | T1850 | arg2Of | control,by |
R1589 | T1851 | T1852 | arg1Of | control,of |
R1590 | T1854 | T1852 | arg2Of | export,of |
R1591 | T1854 | T1853 | arg1Of | export,nuclear |
R1592 | T1862 | T1861 | arg2Of | CRM-1,( |
R1593 | T1863 | T1861 | arg3Of | ),( |
R1594 | T1865 | T1855 | arg2Of | pathway,via |
R1595 | T1865 | T1856 | arg1Of | pathway,a |
R1596 | T1865 | T1857 | arg1Of | pathway,chromosomal |
R1597 | T1865 | T1858 | arg1Of | pathway,region |
R1598 | T1865 | T1859 | arg1Of | pathway,maintenance |
R1599 | T1865 | T1860 | arg1Of | pathway,1 |
R1600 | T1865 | T1861 | arg1Of | pathway,( |
R1601 | T1865 | T1864 | arg1Of | pathway,dependent |
R1602 | T1867 | T1866 | arg2Of | 21,[ |
R1603 | T1868 | T1866 | arg3Of | ],[ |
R1604 | T1869 | T1870 | arg1Of | NL1,"," |
R1605 | T1869 | T1871 | arg1Of | NL1,which |
R1606 | T1869 | T1872 | arg1Of | NL1,is |
R1607 | T1869 | T1873 | arg1Of | NL1,similar |
R1608 | T1869 | T1879 | arg1Of | NL1,binds |
R1609 | T1873 | T1872 | arg2Of | similar,is |
R1610 | T1873 | T1874 | arg1Of | similar,to |
R1611 | T1877 | T1874 | arg2Of | NLS,to |
R1612 | T1877 | T1875 | arg1Of | NLS,the |
R1613 | T1877 | T1876 | arg1Of | NLS,SV40 |
R1614 | T1879 | T1878 | arg1Of | binds,"," |
R1615 | T1879 | T1880 | arg1Of | binds,to |
R1616 | T1881 | T1880 | arg2Of | importin-α,to |
R1617 | T1881 | T1882 | arg1Of | importin-α,[ |
R1618 | T1883 | T1882 | arg2Of | 22,[ |
R1619 | T1884 | T1882 | arg3Of | ],[ |
R1620 | T1885 | T1886 | arg1Of | NL1,is |
R1621 | T1885 | T1887 | arg2Of | NL1,activated |
R1622 | T1887 | T1886 | arg2Of | activated,is |
R1623 | T1887 | T1889 | arg1Of | activated,by |
R1624 | T1887 | T1902 | arg1Of | activated,by |
R1625 | T1889 | T1888 | arg1Of | by,both |
R1626 | T1889 | T1901 | arg1Of | by,and |
R1627 | T1891 | T1889 | arg2Of | agonists,by |
R1628 | T1891 | T1890 | arg1Of | agonists,glucocorticoid |
R1629 | T1891 | T1893 | arg1Of | agonists,as |
R1630 | T1893 | T1892 | arg1Of | as,such |
R1631 | T1894 | T1895 | arg1Of | dexamethasone,and |
R1632 | T1895 | T1893 | arg2Of | and,as |
R1633 | T1897 | T1895 | arg2Of | propionate,and |
R1634 | T1897 | T1896 | arg1Of | propionate,fluticasone |
R1635 | T1897 | T1898 | arg1Of | propionate,( |
R1636 | T1899 | T1898 | arg2Of | FP,( |
R1637 | T1900 | T1898 | arg3Of | ),( |
R1638 | T1902 | T1901 | arg2Of | by,and |
R1639 | T1904 | T1902 | arg2Of | antagonists,by |
R1640 | T1904 | T1903 | arg1Of | antagonists,glucocorticoid |
R1641 | T1904 | T1906 | arg1Of | antagonists,as |
R1642 | T1906 | T1905 | arg1Of | as,such |
R1643 | T1907 | T1906 | arg2Of | mifepristone,as |
R1644 | T1907 | T1908 | arg1Of | mifepristone,( |
R1645 | T1907 | T1911 | arg1Of | mifepristone,[ |
R1646 | T1909 | T1908 | arg2Of | RU486,( |
R1647 | T1910 | T1908 | arg3Of | ),( |
R1648 | T1912 | T1911 | arg2Of | 23,[ |
R1649 | T1913 | T1911 | arg3Of | ],[ |
R1650 | T1914 | T1915 | arg1Of | NL1,can |
R1651 | T1914 | T1916 | arg1Of | NL1,be |
R1652 | T1914 | T1917 | arg2Of | NL1,mutated |
R1653 | T1917 | T1915 | arg2Of | mutated,can |
R1654 | T1917 | T1916 | arg2Of | mutated,be |
R1655 | T1917 | T1919 | arg1Of | mutated,and |
R1656 | T1919 | T1918 | arg1Of | and,"," |
R1657 | T1922 | T1920 | arg1Of | GR,the |
R1658 | T1922 | T1921 | arg1Of | GR,resulting |
R1659 | T1922 | T1924 | arg1Of | GR,translocates |
R1660 | T1924 | T1919 | arg2Of | translocates,and |
R1661 | T1924 | T1923 | arg1Of | translocates,still |
R1662 | T1924 | T1925 | arg1Of | translocates,to |
R1663 | T1924 | T1928 | arg1Of | translocates,in |
R1664 | T1924 | T1934 | arg1Of | translocates,via |
R1665 | T1927 | T1925 | arg2Of | nucleus,to |
R1666 | T1927 | T1926 | arg1Of | nucleus,the |
R1667 | T1928 | T1933 | arg1Of | in,but |
R1668 | T1929 | T1928 | arg2Of | response,in |
R1669 | T1929 | T1930 | arg1Of | response,to |
R1670 | T1931 | T1930 | arg2Of | ligands,to |
R1671 | T1933 | T1932 | arg1Of | but,"," |
R1672 | T1934 | T1933 | arg2Of | via,but |
R1673 | T1935 | T1934 | arg2Of | interaction,via |
R1674 | T1935 | T1936 | arg1Of | interaction,with |
R1675 | T1937 | T1936 | arg2Of | importin,with |
R1676 | T1937 | T1938 | arg1Of | importin,7 |
R1677 | T1937 | T1939 | arg1Of | importin,"," |
R1678 | T1941 | T1939 | arg2Of | event,"," |
R1679 | T1941 | T1940 | arg1Of | event,an |
R1680 | T1941 | T1942 | arg1Of | event,that |
R1681 | T1941 | T1943 | arg1Of | event,requires |
R1682 | T1943 | T1948 | arg1Of | requires,[ |
R1683 | T1990 | T1987 | arg2Of | and,of |
R1684 | T1947 | T1943 | arg2Of | component,requires |
R1685 | T1992 | T1993 | arg1Of | import,including |
R1686 | T1994 | T1993 | arg2Of | chaperones,including |
R1687 | T1994 | T1996 | arg1Of | chaperones,as |
R1688 | T1947 | T1944 | arg1Of | component,an |
R1689 | T1996 | T1995 | arg1Of | as,such |
R1690 | T1997 | T1998 | arg1Of | Hsp90,and |
R1691 | T1947 | T1945 | arg1Of | component,as-yet |
R1692 | T1998 | T1996 | arg2Of | and,as |
R1693 | T1998 | T2001 | arg1Of | and,[ |
R1694 | T1947 | T1946 | arg1Of | component,unknown |
R1695 | T2000 | T1998 | arg2Of | immunophilins,and |
R1696 | T2000 | T1999 | arg1Of | immunophilins,other |
R1697 | T1949 | T1948 | arg2Of | 23,[ |
R1698 | T2002 | T2001 | arg2Of | 24,[ |
R1699 | T2003 | T2001 | arg3Of | ],[ |
R1700 | T2004 | T2005 | arg1Of | –,[ |
R1701 | T2004 | T2008 | arg1Of | –,and |
R1702 | T1950 | T1948 | arg3Of | ],[ |
R1703 | T2006 | T2005 | arg2Of | 26,[ |
R1704 | T2007 | T2005 | arg3Of | ],[ |
R1705 | T2008 | T1990 | arg2Of | and,and |
R1706 | T2008 | T1991 | arg1Of | and,nuclear |
R1707 | T2008 | T1992 | arg1Of | and,import |
R1708 | T1951 | T1952 | arg1Of | NL2,is |
R1709 | T2010 | T2008 | arg2Of | proteins,and |
R1710 | T2010 | T2009 | arg1Of | proteins,FK506-binding |
R1711 | T2010 | T2011 | arg1Of | proteins,that |
R1712 | T2010 | T2012 | arg1Of | proteins,may |
R1713 | T2010 | T2013 | arg1Of | proteins,be |
R1714 | T2010 | T2014 | arg2Of | proteins,linked |
R1715 | T1951 | T1954 | arg2Of | NL2,defined |
R1716 | T2014 | T2012 | arg2Of | linked,may |
R1717 | T2014 | T2013 | arg2Of | linked,be |
R1718 | T2014 | T2015 | arg1Of | linked,to |
R1719 | T1954 | T1952 | arg2Of | defined,is |
R1720 | T2016 | T2017 | arg1Of | dynein,and/or |
R1721 | T2017 | T2015 | arg2Of | and/or,to |
R1722 | T2017 | T2020 | arg1Of | and/or,[ |
R1723 | T2019 | T2017 | arg2Of | isomerase,and/or |
R1724 | T2019 | T2018 | arg1Of | isomerase,peptidylprolyl |
R1725 | T2021 | T2020 | arg2Of | 27,[ |
R1726 | T2022 | T2020 | arg3Of | ],[ |
R1727 | T1954 | T1953 | arg1Of | defined,poorly |
R1728 | T1954 | T1955 | arg1Of | defined,"," |
R1729 | T2025 | T2024 | arg2Of | 28,[ |
R1730 | T1954 | T1956 | modOf | defined,residing |
R1731 | T2026 | T2024 | arg3Of | ],[ |
R1732 | T1954 | T1962 | arg1Of | defined,and |
R1733 | T1956 | T1957 | arg1Of | residing,in |
R1734 | T2031 | T2029 | arg1Of | basis,the |
R1735 | T2031 | T2030 | arg1Of | basis,molecular |
R1736 | T2031 | T2032 | arg1Of | basis,for |
R1737 | T2031 | T2040 | arg1Of | basis,is |
R1738 | T2031 | T2043 | arg2Of | basis,understood |
R1739 | T1960 | T1957 | arg2Of | domain,in |
R1740 | T2034 | T2032 | arg2Of | inhibition,for |
R1741 | T2034 | T2033 | arg1Of | inhibition,the |
R1742 | T2034 | T2035 | arg1Of | inhibition,of |
R1743 | T2034 | T2038 | arg1Of | inhibition,by |
R1744 | T2037 | T2035 | arg2Of | cytokines,of |
R1745 | T2037 | T2036 | arg1Of | cytokines,Th2 |
R1746 | T2039 | T2038 | arg2Of | corticosteroids,by |
R1747 | T1960 | T1958 | arg1Of | domain,the |
R1748 | T1960 | T1959 | arg1Of | domain,ligand-binding |
R1749 | T2043 | T2027 | arg1Of | understood,However |
R1750 | T2043 | T2028 | arg1Of | understood,"," |
R1751 | T2043 | T2040 | arg2Of | understood,is |
R1752 | T2043 | T2041 | arg1Of | understood,not |
R1753 | T2043 | T2042 | arg1Of | understood,well |
R1754 | T2043 | T2044 | arg1Of | understood,"," |
R1755 | T2043 | T2045 | arg1Of | understood,because |
R1756 | T1962 | T1961 | arg1Of | and,"," |
R1757 | T2047 | T2046 | arg1Of | genes,the |
R1758 | T2047 | T2048 | arg1Of | genes,encoding |
R1759 | T2047 | T2055 | arg1Of | genes,do |
R1760 | T2047 | T2057 | arg1Of | genes,have |
R1761 | T1964 | T1963 | arg1Of | less,much |
R1762 | T2047 | T2066 | arg1Of | genes,are |
R1763 | T2047 | T2069 | arg2Of | genes,regulated |
R1764 | T2049 | T2050 | arg1Of | IL-4,"," |
R1765 | T2050 | T2053 | arg1Of | ",",and |
R1766 | T1964 | T1965 | arg1Of | less,is |
R1767 | T1964 | T1966 | arg2Of | less,known |
R1768 | T1966 | T1962 | arg2Of | known,and |
R1769 | T2051 | T2050 | arg2Of | IL-5,"," |
R1770 | T2053 | T2048 | arg2Of | and,encoding |
R1771 | T2053 | T2052 | arg1Of | and,"," |
R1772 | T2054 | T2053 | arg2Of | IL-13,and |
R1773 | T2057 | T2055 | arg2Of | have,do |
R1774 | T2057 | T2056 | arg1Of | have,not |
R1775 | T2057 | T2065 | arg1Of | have,and |
R1776 | T1966 | T1965 | arg2Of | known,is |
R1777 | T1966 | T1967 | arg1Of | known,about |
R1778 | T2061 | T2057 | arg2Of | sequence,have |
R1779 | T2061 | T2058 | arg1Of | sequence,any |
R1780 | T2061 | T2059 | arg1Of | sequence,recognisable |
R1781 | T2061 | T2060 | arg1Of | sequence,GRE |
R1782 | T2061 | T2062 | arg1Of | sequence,[ |
R1783 | T2063 | T2062 | arg2Of | 29,[ |
R1784 | T1969 | T1967 | arg2Of | mechanism,about |
R1785 | T2064 | T2062 | arg3Of | ],[ |
R1786 | T2065 | T2045 | arg2Of | and,because |
R1787 | T2065 | T2079 | arg1Of | and,[ |
R1788 | T2068 | T2067 | arg1Of | partly,only |
R1789 | T1969 | T1968 | arg1Of | mechanism,its |
R1790 | T2069 | T2065 | arg2Of | regulated,and |
R1791 | T2069 | T2066 | arg2Of | regulated,are |
R1792 | T2069 | T2068 | arg1Of | regulated,partly |
R1793 | T2069 | T2072 | arg1Of | regulated,in |
R1794 | T2069 | T2075 | arg1Of | regulated,[ |
R1795 | T2069 | T2078 | arg1Of | regulated,– |
R1796 | T2071 | T2069 | arg1Of | NF-κB,regulated |
R1797 | T2071 | T2070 | arg2Of | NF-κB,by |
R1798 | T1969 | T1970 | arg1Of | mechanism,of |
R1799 | T1972 | T1970 | arg2Of | import,of |
R1800 | T2074 | T2072 | arg2Of | cells,in |
R1801 | T2074 | T2073 | arg1Of | cells,human |
R1802 | T2076 | T2075 | arg2Of | 30,[ |
R1803 | T2077 | T2075 | arg3Of | ],[ |
R1804 | T1972 | T1971 | arg1Of | import,GR |
R1805 | T1972 | T1973 | arg1Of | import,[ |
R1806 | T2080 | T2079 | arg2Of | 32,[ |
R1807 | T1974 | T1973 | arg2Of | 24,[ |
R1808 | T2081 | T2079 | arg3Of | ],[ |
R1809 | T2083 | T2084 | arg1Of | overexpression,and |
R1810 | T1975 | T1973 | arg3Of | ],[ |
R1811 | T2085 | T2084 | arg2Of | CAT-reporter,and |
R1812 | T2086 | T2082 | arg2Of | genes,Using |
R1813 | T2086 | T2083 | arg1Of | genes,overexpression |
R1814 | T2086 | T2085 | arg1Of | genes,CAT-reporter |
R1815 | T1977 | T1976 | arg1Of | variety,A |
R1816 | T1977 | T1978 | arg1Of | variety,of |
R1817 | T1977 | T1981 | arg1Of | variety,are |
R1818 | T1977 | T1983 | arg1Of | variety,important |
R1819 | T1980 | T1978 | arg2Of | factors,of |
R1820 | T2088 | T2089 | arg1Of | Lavender,and |
R1821 | T2089 | T2082 | arg1Of | and,Using |
R1822 | T2089 | T2094 | arg1Of | and,have |
R1823 | T2089 | T2095 | arg1Of | and,shown |
R1824 | T2090 | T2089 | arg2Of | colleagues,and |
R1825 | T2090 | T2091 | arg1Of | colleagues,[ |
R1826 | T2092 | T2091 | arg2Of | 33,[ |
R1827 | T2093 | T2091 | arg3Of | ],[ |
R1828 | T1980 | T1979 | arg1Of | factors,other |
R1829 | T2095 | T2082 | modOf | shown,Using |
R1830 | T1981 | T1982 | arg1Of | are,also |
R1831 | T1981 | T2023 | arg1Of | are,"," |
R1832 | T1981 | T2024 | arg1Of | are,[ |
R1833 | T2095 | T2087 | arg1Of | shown,"," |
R1834 | T2095 | T2094 | arg2Of | shown,have |
R1835 | T1983 | T1981 | arg2Of | important,are |
R1836 | T2097 | T2098 | arg1Of | GR,reduced |
R1837 | T2098 | T2095 | arg2Of | reduced,shown |
R1838 | T2098 | T2096 | arg1Of | reduced,that |
R1839 | T1983 | T1984 | arg1Of | important,for |
R1840 | T2100 | T2101 | arg1Of | IL-5,and |
R1841 | T1986 | T1984 | arg2Of | regulation,for |
R1842 | T2102 | T2101 | arg2Of | -13,and |
R1843 | T2104 | T2098 | arg2Of | activity,reduced |
R1844 | T2104 | T2099 | arg1Of | activity,GATA-3-mediated |
R1845 | T2104 | T2100 | arg1Of | activity,IL-5 |
R1846 | T2104 | T2102 | arg1Of | activity,-13 |
R1847 | T2104 | T2103 | arg1Of | activity,promoter |
R1848 | T2104 | T2105 | arg1Of | activity,in |
R1849 | T1986 | T1985 | arg1Of | regulation,the |
R1850 | T1986 | T1987 | arg1Of | regulation,of |
R1851 | T2109 | T2105 | arg2Of | cells,in |
R1852 | T2109 | T2106 | arg1Of | cells,human |
R1853 | T2109 | T2107 | arg1Of | cells,CD4+ |
R1854 | T2109 | T2108 | arg1Of | cells,T |
R1855 | T1989 | T1988 | arg1Of | activation,GR |
R1856 | T2111 | T2110 | arg1Of | authors,The |
R1857 | T2111 | T2112 | arg1Of | authors,postulated |
R1858 | T2115 | T2114 | arg1Of | recruitment,local |
R1859 | T2115 | T2116 | arg1Of | recruitment,of |
R1860 | T2115 | T2118 | arg1Of | recruitment,may |
R1861 | T2115 | T2119 | arg1Of | recruitment,alter |
R1862 | T1989 | T1990 | arg1Of | activation,and |
R1863 | T2117 | T2116 | arg2Of | GR,of |
R1864 | T2184 | T2183 | arg2Of | anti-CD28,and |
R1865 | T2119 | T2112 | arg2Of | alter,postulated |
R1866 | T2119 | T2113 | arg1Of | alter,that |
R1867 | T2119 | T2118 | arg2Of | alter,may |
R1868 | T2121 | T2119 | arg2Of | ability,alter |
R1869 | T2121 | T2120 | arg1Of | ability,the |
R1870 | T2185 | T2180 | arg1Of | antibodies,activated |
R1871 | T2121 | T2122 | arg1Of | ability,of |
R1872 | T2123 | T2122 | arg2Of | GATA-3,of |
R1873 | T2123 | T2125 | modOf | GATA-3,to |
R1874 | T2126 | T2124 | arg1Of | bind,either |
R1875 | T2126 | T2125 | arg1Of | bind,to |
R1876 | T2126 | T2127 | arg1Of | bind,to |
R1877 | T2185 | T2181 | arg2Of | antibodies,by |
R1878 | T2185 | T2182 | arg1Of | antibodies,anti-CD3 |
R1879 | T2130 | T2127 | arg2Of | site,to |
R1880 | T2185 | T2184 | arg1Of | antibodies,anti-CD28 |
R1881 | T2130 | T2128 | arg1Of | site,its |
R1882 | T2130 | T2129 | arg1Of | site,target |
R1883 | T2130 | T2131 | arg1Of | site,"," |
R1884 | T2187 | T2186 | arg1Of | vitro,in |
R1885 | T2133 | T2132 | arg1Of | cause,to |
R1886 | T2133 | T2137 | arg1Of | cause,or |
R1887 | T2135 | T2133 | arg2Of | up-regulation,cause |
R1888 | T2135 | T2134 | arg1Of | up-regulation,transcriptional |
R1889 | T2188 | T2190 | arg1Of | We,studied |
R1890 | T2137 | T2131 | arg2Of | or,"," |
R1891 | T2137 | T2136 | arg1Of | or,"," |
R1892 | T2139 | T2137 | arg2Of | maintain,or |
R1893 | T2139 | T2138 | arg1Of | maintain,to |
R1894 | T2190 | T2189 | arg1Of | studied,also |
R1895 | T2141 | T2139 | arg2Of | environment,maintain |
R1896 | T2141 | T2140 | arg1Of | environment,an |
R1897 | T2141 | T2142 | arg1Of | environment,that |
R1898 | T2141 | T2143 | arg1Of | environment,is |
R1899 | T2141 | T2144 | arg1Of | environment,permissive |
R1900 | T2144 | T2143 | arg2Of | permissive,is |
R1901 | T2144 | T2145 | arg1Of | permissive,for |
R1902 | T2192 | T2190 | arg2Of | effects,studied |
R1903 | T2146 | T2145 | arg2Of | transcription,for |
R1904 | T2147 | T2149 | arg1Of | We,investigated |
R1905 | T2192 | T2191 | arg1Of | effects,the |
R1906 | T2149 | T2148 | arg1Of | investigated,therefore |
R1907 | T2149 | T2158 | arg1Of | investigated,"," |
R1908 | T2149 | T2159 | arg1Of | investigated,on |
R1909 | T2192 | T2193 | arg1Of | effects,of |
R1910 | T2151 | T2149 | arg2Of | effects,investigated |
R1911 | T2151 | T2150 | arg1Of | effects,the |
R1912 | T2151 | T2152 | arg1Of | effects,of |
R1913 | T2192 | T2197 | arg1Of | effects,on |
R1914 | T2155 | T2152 | arg2Of | corticosteroid,of |
R1915 | T2155 | T2153 | arg1Of | corticosteroid,a |
R1916 | T2155 | T2154 | arg1Of | corticosteroid,synthetic |
R1917 | T2155 | T2156 | arg1Of | corticosteroid,"," |
R1918 | T2157 | T2156 | arg2Of | FP,"," |
R1919 | T2196 | T2193 | arg2Of | therapy,of |
R1920 | T2161 | T2160 | arg1Of | phosphorylation,GATA-3 |
R1921 | T2161 | T2162 | arg1Of | phosphorylation,and |
R1922 | T2162 | T2159 | arg2Of | and,on |
R1923 | T2162 | T2165 | arg1Of | and,in |
R1924 | T2162 | T2175 | arg1Of | and,in |
R1925 | T2164 | T2162 | arg2Of | translocation,and |
R1926 | T2164 | T2163 | arg1Of | translocation,nuclear |
R1927 | T2165 | T2174 | arg1Of | in,and |
R1928 | T2196 | T2194 | arg2Of | therapy,inhaled |
R1929 | T2196 | T2195 | arg1Of | therapy,fluticasone |
R1930 | T2170 | T2165 | arg2Of | line,in |
R1931 | T2170 | T2166 | arg1Of | line,a |
R1932 | T2170 | T2167 | arg1Of | line,T |
R1933 | T2170 | T2168 | arg1Of | line,lymphocyte |
R1934 | T2170 | T2169 | arg1Of | line,cell |
R1935 | T2170 | T2171 | arg1Of | line,( |
R1936 | T2172 | T2171 | arg2Of | HuT-78,( |
R1937 | T2200 | T2197 | arg2Of | localization,on |
R1938 | T2173 | T2171 | arg3Of | ),( |
R1939 | T2175 | T2174 | arg2Of | in,and |
R1940 | T2200 | T2198 | arg1Of | localization,GATA-3 |
R1941 | T2179 | T2175 | arg2Of | cells,in |
R1942 | T2179 | T2176 | arg1Of | cells,peripheral |
R1943 | T2179 | T2177 | arg1Of | cells,blood |
R1944 | T2179 | T2178 | arg1Of | cells,mononuclear |
R1945 | T2179 | T2180 | arg2Of | cells,activated |
R1946 | T2180 | T2187 | arg1Of | activated,vitro |
R1947 | T2200 | T2199 | arg1Of | localization,subcellular |
R1948 | T2182 | T2183 | arg1Of | anti-CD3,and |
R1949 | T2200 | T2201 | arg1Of | localization,in |
R1950 | T2205 | T2201 | arg2Of | cells,in |
R1951 | T2205 | T2202 | arg1Of | cells,peripheral |
R1952 | T2205 | T2203 | arg1Of | cells,blood |
R1953 | T2205 | T2204 | arg1Of | cells,mononuclear |
R1954 | T2205 | T2206 | arg1Of | cells,( |
R1955 | T2205 | T2209 | arg1Of | cells,from |
R1956 | T2207 | T2206 | arg2Of | PBMCs,( |
R1957 | T2208 | T2206 | arg3Of | ),( |
R1959 | T2210 | T2209 | arg2Of | patients,from |
R1962 | T2210 | T2211 | arg1Of | patients,with |
R1964 | T2212 | T2211 | arg2Of | asthma,with |
R3148 | T3675 | T3676 | arg1Of | Participants,and |
R3149 | T3678 | T3676 | arg2Of | Design,and |
R3150 | T3678 | T3677 | arg1Of | Design,Study |
R3151 | T3679 | T3680 | arg1Of | We,studied |
R3152 | T3680 | T3701 | arg1Of | studied,"," |
R3153 | T3680 | T3708 | arg1Of | studied,[ |
R3154 | T3681 | T3680 | arg2Of | patients,studied |
R3155 | T3681 | T3682 | arg1Of | patients,with |
R3156 | T3681 | T3685 | arg1Of | patients,who |
R3157 | T3681 | T3686 | arg1Of | patients,were |
R3158 | T3681 | T3688 | arg2Of | patients,treated |
R3159 | T3684 | T3682 | arg2Of | asthma,with |
R3160 | T3684 | T3683 | arg1Of | asthma,mild |
R3161 | T3688 | T3686 | arg2Of | treated,were |
R3162 | T3688 | T3687 | arg1Of | treated,not |
R3163 | T3688 | T3689 | arg1Of | treated,with |
R3164 | T3691 | T3689 | arg2Of | corticosteroids,with |
R3165 | T3691 | T3690 | arg2Of | corticosteroids,inhaled |
R3166 | T3691 | T3692 | arg1Of | corticosteroids,who |
R3167 | T3691 | T3693 | arg1Of | corticosteroids,had |
R3168 | T3691 | T3694 | arg1Of | corticosteroids,been |
R3169 | T3691 | T3695 | arg2Of | corticosteroids,included |
R3170 | T3695 | T3693 | arg2Of | included,had |
R3171 | T3695 | T3694 | arg2Of | included,been |
R3172 | T3695 | T3696 | arg1Of | included,in |
R3173 | T3699 | T3698 | arg1Of | reported,previously |
R3174 | T3700 | T3696 | arg2Of | double-blind,in |
R3175 | T3700 | T3697 | arg1Of | double-blind,a |
R3176 | T3700 | T3699 | arg1Of | double-blind,reported |
R3177 | T3702 | T3703 | arg1Of | placebo-controlled,"," |
R3178 | T3704 | T3703 | arg2Of | crossover,"," |
R3179 | T3705 | T3680 | arg3Of | study,studied |
R3180 | T3705 | T3702 | arg1Of | study,placebo-controlled |
R3181 | T3705 | T3704 | arg1Of | study,crossover |
R3182 | T3705 | T3706 | arg1Of | study,with |
R3183 | T3707 | T3706 | arg2Of | FP,with |
R3184 | T3709 | T3708 | arg2Of | 34,[ |
R3185 | T3710 | T3708 | arg3Of | ],[ |
R3186 | T3712 | T3711 | arg1Of | patients,Seven |
R3187 | T3712 | T3713 | arg1Of | patients,with |
R3188 | T3712 | T3716 | arg1Of | patients,entered |
R3189 | T3712 | T3720 | arg1Of | patients,were |
R3190 | T3712 | T3721 | arg2Of | patients,randomized |
R3191 | T3712 | T3723 | arg1Of | patients,receive |
R3192 | T3715 | T3713 | arg2Of | asthma,with |
R3193 | T3715 | T3714 | arg1Of | asthma,mild |
R3194 | T3716 | T3719 | arg1Of | entered,and |
R3195 | T3718 | T3716 | arg2Of | study,entered |
R3196 | T3718 | T3717 | arg1Of | study,the |
R3197 | T3719 | T3745 | arg1Of | and,and |
R3198 | T3721 | T3719 | arg2Of | randomized,and |
R3199 | T3721 | T3720 | arg2Of | randomized,were |
R3200 | T3723 | T3721 | arg3Of | receive,randomized |
R3201 | T3723 | T3722 | arg1Of | receive,to |
R3202 | T3723 | T3740 | arg1Of | receive,via |
R3203 | T3726 | T3724 | arg1Of | inhalation,a |
R3204 | T3726 | T3725 | arg1Of | inhalation,single |
R3205 | T3726 | T3727 | arg1Of | inhalation,of |
R3206 | T3726 | T3735 | arg1Of | inhalation,or |
R3207 | T3728 | T3727 | arg2Of | FP,of |
R3208 | T3728 | T3729 | arg1Of | FP,( |
R3209 | T3730 | T3731 | arg1Of | 100,and |
R3210 | T3732 | T3731 | arg2Of | 500,and |
R3211 | T3733 | T3729 | arg2Of | µg,( |
R3212 | T3733 | T3730 | arg1Of | µg,100 |
R3213 | T3733 | T3732 | arg1Of | µg,500 |
R3214 | T3734 | T3729 | arg3Of | ),( |
R3215 | T3735 | T3723 | arg2Of | or,receive |
R3216 | T3739 | T3735 | arg2Of | control,or |
R3217 | T3739 | T3736 | arg1Of | control,a |
R3218 | T3739 | T3737 | arg1Of | control,matched |
R3219 | T3739 | T3738 | arg1Of | control,placebo |
R3220 | T3743 | T3740 | arg2Of | chamber,via |
R3221 | T3743 | T3741 | arg1Of | chamber,a |
R3222 | T3743 | T3742 | arg1Of | chamber,spacer |
R3223 | T3745 | T3744 | arg1Of | and,"," |
R3224 | T3748 | T3746 | arg1Of | treatment,the |
R3225 | T3748 | T3747 | arg1Of | treatment,other |
R3226 | T3748 | T3749 | arg1Of | treatment,was |
R3227 | T3748 | T3750 | arg2Of | treatment,given |
R3228 | T3750 | T3745 | arg2Of | given,and |
R3229 | T3750 | T3749 | arg2Of | given,was |
R3230 | T3750 | T3751 | arg1Of | given,after |
R3231 | T3754 | T3751 | arg2Of | period,after |
R3232 | T3754 | T3752 | arg1Of | period,a |
R3233 | T3754 | T3753 | arg1Of | period,wash-out |
R3234 | T3754 | T3755 | arg1Of | period,of |
R3235 | T3758 | T3756 | arg1Of | 6,at |
R3236 | T3758 | T3757 | arg1Of | 6,least |
R3237 | T3759 | T3755 | arg2Of | d,of |
R3238 | T3759 | T3758 | arg1Of | d,6 |
R3239 | T3760 | T3761 | arg1Of | Blood,was |
R3240 | T3760 | T3762 | arg2Of | Blood,taken |
R3241 | T3762 | T3761 | arg2Of | taken,was |
R3242 | T3762 | T3763 | arg1Of | taken,for |
R3243 | T3764 | T3763 | arg2Of | preparation,for |
R3244 | T3764 | T3765 | arg1Of | preparation,of |
R3245 | T3764 | T3767 | arg1Of | preparation,at |
R3246 | T3766 | T3765 | arg2Of | PBMCs,of |
R3247 | T3768 | T3769 | arg1Of | 1,and |
R3248 | T3770 | T3769 | arg2Of | 2,and |
R3249 | T3771 | T3767 | arg2Of | h,at |
R3250 | T3771 | T3768 | arg1Of | h,1 |
R3251 | T3771 | T3770 | arg1Of | h,2 |
R3252 | T3771 | T3772 | arg1Of | h,after |
R3253 | T3774 | T3772 | arg2Of | administration,after |
R3254 | T3774 | T3773 | arg1Of | administration,drug |
R3255 | T3776 | T3775 | arg1Of | patients,All |
R3256 | T3776 | T3777 | arg1Of | patients,gave |
R3257 | T3776 | T3801 | arg1Of | patients,was |
R3258 | T3776 | T3802 | arg2Of | patients,conducted |
R3259 | T3777 | T3780 | arg1Of | gave,and |
R3260 | T3779 | T3777 | arg2Of | consent,gave |
R3261 | T3779 | T3778 | arg2Of | consent,informed |
R3262 | T3782 | T3781 | arg1Of | study,the |
R3263 | T3782 | T3783 | arg1Of | study,was |
R3264 | T3782 | T3784 | arg2Of | study,approved |
R3265 | T3784 | T3783 | arg2Of | approved,was |
R3266 | T3788 | T3786 | arg1Of | Committee,the |
R3267 | T3788 | T3787 | arg1Of | Committee,Ethics |
R3268 | T3788 | T3789 | arg1Of | Committee,of |
R3269 | T3788 | T3793 | arg1Of | Committee,and |
R3270 | T3792 | T3789 | arg2Of | Brompton,of |
R3271 | T3792 | T3790 | arg1Of | Brompton,the |
R3272 | T3792 | T3791 | arg1Of | Brompton,Royal |
R3273 | T3793 | T3784 | arg1Of | and,approved |
R3274 | T3793 | T3785 | arg2Of | and,by |
R3275 | T3797 | T3794 | arg1Of | Trust.,Harefield |
R3276 | T3797 | T3795 | arg1Of | Trust.,Hospitals |
R3277 | T3797 | T3796 | arg1Of | Trust.,NHS |
R3278 | T3800 | T3793 | arg2Of | study,and |
R3279 | T3800 | T3797 | arg1Of | study,Trust. |
R3280 | T3800 | T3798 | arg1Of | study,The |
R3281 | T3800 | T3799 | arg1Of | study,clinical |
R3282 | T3802 | T3780 | arg2Of | conducted,and |
R3283 | T3802 | T3783 | modOf | conducted,was |
R3284 | T3802 | T3801 | arg2Of | conducted,was |
R3285 | T3802 | T3803 | arg1Of | conducted,before |
R3286 | T3805 | T3803 | arg2Of | requirement,before |
R3287 | T3805 | T3804 | arg1Of | requirement,the |
R3288 | T3805 | T3806 | arg1Of | requirement,for |
R3289 | T3809 | T3806 | arg2Of | Registration,for |
R3290 | T3809 | T3807 | arg1Of | Registration,Clinical |
R3291 | T3809 | T3808 | arg1Of | Registration,Trial |
R3431 | T3981 | T3982 | arg1Of | Antibodies,and |
R3432 | T3983 | T3982 | arg2Of | Reagents,and |
R3433 | T3986 | T3984 | arg1Of | antibodies,The |
R3434 | T3986 | T3985 | arg1Of | antibodies,monoclonal |
R3435 | T3986 | T3987 | arg1Of | antibodies,against |
R3436 | T3986 | T3997 | arg1Of | antibodies,were |
R3437 | T3986 | T3998 | arg2Of | antibodies,purchased |
R3438 | T3989 | T3988 | arg1Of | CD3,human |
R3439 | T3989 | T3990 | arg1Of | CD3,"," |
R3440 | T3990 | T3992 | arg1Of | ",","," |
R3441 | T3991 | T3990 | arg2Of | CD28,"," |
R3442 | T3992 | T3995 | arg1Of | ",",and |
R3443 | T3993 | T3992 | arg2Of | GR,"," |
R3444 | T3995 | T3987 | arg2Of | and,against |
R3445 | T3995 | T3994 | arg1Of | and,"," |
R3446 | T3996 | T3995 | arg2Of | importin-α,and |
R3447 | T3998 | T3997 | arg2Of | purchased,were |
R3448 | T3998 | T3999 | arg1Of | purchased,from |
R3449 | T4001 | T3999 | arg2Of | Biosciences,from |
R3450 | T4001 | T4000 | arg1Of | Biosciences,BD |
R3451 | T4001 | T4002 | arg1Of | Biosciences,( |
R3452 | T4003 | T4002 | arg2Of | Oxford,( |
R3453 | T4003 | T4004 | arg1Of | Oxford,"," |
R3454 | T4006 | T4004 | arg2Of | Kingdom,"," |
R3455 | T4006 | T4005 | arg1Of | Kingdom,United |
R3456 | T4007 | T4002 | arg3Of | ),( |
R3457 | T4009 | T4008 | arg1Of | antibodies,Rabbit |
R3458 | T4009 | T4010 | arg1Of | antibodies,against |
R3459 | T4009 | T4023 | arg1Of | antibodies,were |
R3460 | T4009 | T4024 | arg2Of | antibodies,obtained |
R3461 | T4012 | T4011 | arg1Of | GATA-3,human |
R3462 | T4012 | T4013 | arg1Of | GATA-3,( |
R3463 | T4012 | T4016 | arg1Of | GATA-3,and |
R3464 | T4014 | T4013 | arg2Of | H-48,( |
R3465 | T4015 | T4013 | arg3Of | ),( |
R3466 | T4016 | T4010 | arg2Of | and,against |
R3467 | T4017 | T4016 | arg2Of | GR,and |
R3468 | T4017 | T4018 | arg1Of | GR,( |
R3469 | T4019 | T4018 | arg2Of | E-20,( |
R3470 | T4019 | T4020 | arg1Of | E-20,"," |
R3471 | T4021 | T4020 | arg2Of | sc-1003,"," |
R3472 | T4022 | T4018 | arg3Of | ),( |
R3473 | T4024 | T4023 | arg2Of | obtained,were |
R3474 | T4024 | T4025 | arg1Of | obtained,from |
R3475 | T4028 | T4026 | arg1Of | Biotechnology,Santa |
R3476 | T4028 | T4027 | arg1Of | Biotechnology,Cruz |
R3477 | T4028 | T4029 | arg1Of | Biotechnology,( |
R3478 | T4028 | T4038 | arg1Of | Biotechnology,"," |
R3479 | T4031 | T4030 | arg1Of | Cruz,Santa |
R3480 | T4031 | T4032 | arg1Of | Cruz,"," |
R3481 | T4032 | T4034 | arg1Of | ",","," |
R3482 | T4033 | T4032 | arg2Of | California,"," |
R3483 | T4034 | T4029 | arg2Of | ",",( |
R3484 | T4036 | T4034 | arg2Of | States,"," |
R3485 | T4036 | T4035 | arg1Of | States,United |
R3486 | T4037 | T4029 | arg3Of | ),( |
R3487 | T4038 | T4046 | arg1Of | ",",and |
R3488 | T4041 | T4038 | arg2Of | antibodies,"," |
R3489 | T4041 | T4039 | arg1Of | antibodies,polyclonal |
R3490 | T4041 | T4040 | arg1Of | antibodies,rabbit |
R3491 | T4041 | T4042 | arg1Of | antibodies,against |
R3492 | T4045 | T4042 | arg2Of | kinase,against |
R3493 | T4045 | T4043 | arg1Of | kinase,phospho-p38 |
R3494 | T4045 | T4044 | arg1Of | kinase,MAP |
R3495 | T4046 | T4080 | arg1Of | and,and |
R3496 | T4047 | T4046 | arg2Of | phospho-ATF-2,and |
R3497 | T4047 | T4048 | arg1Of | phospho-ATF-2,from |
R3498 | T4051 | T4049 | arg1Of | Technology,Cell |
R3499 | T4051 | T4050 | arg1Of | Technology,Signaling |
R3500 | T4051 | T4052 | arg1Of | Technology,( |
R3501 | T4051 | T4061 | arg1Of | Technology,"," |
R3502 | T4055 | T4052 | arg2Of | Biolabs,( |
R3503 | T4055 | T4053 | arg1Of | Biolabs,New |
R3504 | T4055 | T4054 | arg1Of | Biolabs,England |
R3505 | T4055 | T4056 | arg1Of | Biolabs,"," |
R3506 | T4057 | T4056 | arg2Of | Hertford,"," |
R3507 | T4057 | T4058 | arg1Of | Hertford,"," |
R3508 | T4057 | T4059 | arg1Of | Hertford,UK |
R3509 | T4060 | T4052 | arg3Of | ),( |
R3510 | T4061 | T4048 | arg2Of | ",",from |
R3511 | T4061 | T4070 | arg1Of | ",",from |
R3512 | T4063 | T4061 | arg2Of | antibody,"," |
R3513 | T4063 | T4062 | arg1Of | antibody,monoclonal |
R3514 | T4063 | T4064 | arg1Of | antibody,against |
R3515 | T4065 | T4064 | arg2Of | phosphoserine,against |
R3516 | T4065 | T4066 | arg1Of | phosphoserine,( |
R3517 | T4068 | T4066 | arg2Of | 4H4,( |
R3518 | T4068 | T4067 | arg1Of | 4H4,clone |
R3519 | T4069 | T4066 | arg3Of | ),( |
R3520 | T4073 | T4070 | arg2Of | Products,from |
R3521 | T4073 | T4071 | arg1Of | Products,Affiniti |
R3522 | T4073 | T4072 | arg1Of | Products,Research |
R3523 | T4073 | T4074 | arg1Of | Products,( |
R3524 | T4075 | T4074 | arg2Of | Exeter,( |
R3525 | T4075 | T4076 | arg1Of | Exeter,"," |
R3526 | T4075 | T4077 | arg1Of | Exeter,UK |
R3527 | T4078 | T4074 | arg3Of | ),( |
R3528 | T4080 | T4025 | arg2Of | and,from |
R3529 | T4080 | T4079 | arg1Of | and,"," |
R3530 | T4081 | T4080 | arg2Of | antibodies,and |
R3531 | T4081 | T4082 | arg1Of | antibodies,against |
R3532 | T4085 | T4082 | arg2Of | TRITC,against |
R3533 | T4085 | T4083 | arg1Of | TRITC,rabbit |
R3534 | T4085 | T4084 | arg1Of | TRITC,IgG-conjugated |
R3535 | T4085 | T4086 | arg1Of | TRITC,from |
R3536 | T4085 | T4089 | arg1Of | TRITC,( |
R3537 | T4088 | T4086 | arg2Of | Cytomation,from |
R3538 | T4088 | T4087 | arg1Of | Cytomation,Dako |
R3539 | T4090 | T4089 | arg2Of | Cambridge,( |
R3540 | T4090 | T4091 | arg1Of | Cambridge,"," |
R3541 | T4090 | T4092 | arg1Of | Cambridge,UK |
R3542 | T4093 | T4089 | arg3Of | ),( |
R3543 | T4096 | T4094 | arg1Of | antibody,The |
R3544 | T4096 | T4095 | arg1Of | antibody,anti-GR |
R3545 | T4096 | T4097 | arg1Of | antibody,( |
R3546 | T4096 | T4101 | arg1Of | antibody,from |
R3547 | T4096 | T4110 | arg1Of | antibody,was |
R3548 | T4096 | T4111 | arg2Of | antibody,used |
R3549 | T4098 | T4097 | arg2Of | Clone,( |
R3550 | T4098 | T4099 | arg1Of | Clone,41 |
R3551 | T4100 | T4097 | arg3Of | ),( |
R3552 | T4104 | T4101 | arg2Of | Laboratories,from |
R3553 | T4104 | T4102 | arg1Of | Laboratories,BD |
R3554 | T4104 | T4103 | arg1Of | Laboratories,Transduction |
R3555 | T4104 | T4105 | arg1Of | Laboratories,( |
R3556 | T4106 | T4105 | arg2Of | Oxford,( |
R3557 | T4106 | T4107 | arg1Of | Oxford,"," |
R3558 | T4106 | T4108 | arg1Of | Oxford,UK |
R3559 | T4109 | T4105 | arg3Of | ),( |
R3560 | T4111 | T4110 | arg2Of | used,was |
R3561 | T4111 | T4112 | arg1Of | used,for |
R3562 | T4115 | T4112 | arg2Of | analysis,for |
R3563 | T4115 | T4113 | arg1Of | analysis,Western |
R3564 | T4115 | T4114 | arg1Of | analysis,blot |
R3565 | T4118 | T4116 | arg1Of | reagents,All |
R3566 | T4118 | T4117 | arg1Of | reagents,other |
R3567 | T4118 | T4119 | arg1Of | reagents,were |
R3568 | T4118 | T4120 | arg2Of | reagents,purchased |
R3569 | T4120 | T4119 | arg2Of | purchased,were |
R3570 | T4120 | T4121 | arg1Of | purchased,from |
R3571 | T4122 | T4121 | arg2Of | Sigma,from |
R3572 | T4122 | T4123 | arg1Of | Sigma,( |
R3573 | T4124 | T4123 | arg2Of | Poole,( |
R3574 | T4124 | T4125 | arg1Of | Poole,"," |
R3575 | T4126 | T4125 | arg2Of | UK,"," |
R3576 | T4127 | T4123 | arg3Of | ),( |
R3731 | T4355 | T4354 | arg1Of | Culture,Cell |
R3732 | T4355 | T4356 | arg1Of | Culture,and |
R3733 | T4358 | T4356 | arg2Of | Isolation,and |
R3734 | T4358 | T4357 | arg1Of | Isolation,PBMC |
R3735 | T4363 | T4359 | arg1Of | line,A |
R3736 | T4363 | T4360 | arg1Of | line,human |
R3737 | T4363 | T4361 | arg1Of | line,T |
R3738 | T4363 | T4362 | arg1Of | line,cell |
R3739 | T4363 | T4364 | arg1Of | line,( |
R3740 | T4363 | T4367 | arg1Of | line,was |
R3741 | T4363 | T4368 | arg2Of | line,purchased |
R3742 | T4365 | T4364 | arg2Of | HuT-78,( |
R3743 | T4366 | T4364 | arg3Of | ),( |
R3744 | T4368 | T4367 | arg2Of | purchased,was |
R3745 | T4368 | T4369 | arg1Of | purchased,from |
R3746 | T4372 | T4370 | arg1Of | Collection,ECACC |
R3747 | T4372 | T4371 | arg1Of | Collection,European |
R3748 | T4372 | T4373 | arg1Of | Collection,of |
R3749 | T4372 | T4376 | arg1Of | Collection,( |
R3750 | T4372 | T4381 | arg1Of | Collection,were |
R3751 | T4372 | T4382 | arg2Of | Collection,cultured |
R3752 | T4375 | T4373 | arg2Of | Culture,of |
R3753 | T4375 | T4374 | arg1Of | Culture,Cell |
R3754 | T4377 | T4376 | arg2Of | Wiltshire,( |
R3755 | T4377 | T4378 | arg1Of | Wiltshire,"," |
R3756 | T4377 | T4379 | arg1Of | Wiltshire,UK |
R3757 | T4380 | T4376 | arg3Of | ),( |
R3758 | T4382 | T4367 | modOf | cultured,was |
R3759 | T4382 | T4381 | arg2Of | cultured,were |
R3760 | T4382 | T4383 | arg1Of | cultured,as |
R3761 | T4385 | T4384 | arg1Of | described,previously |
R3762 | T4387 | T4383 | arg2Of | 12,as |
R3763 | T4387 | T4385 | arg1Of | 12,described |
R3764 | T4387 | T4386 | arg2Of | 12,[ |
R3765 | T4388 | T4386 | arg3Of | ],[ |
R3766 | T4389 | T4390 | arg1Of | PBMCs,were |
R3767 | T4389 | T4391 | arg2Of | PBMCs,isolated |
R3768 | T4391 | T4390 | arg2Of | isolated,were |
R3769 | T4391 | T4392 | arg1Of | isolated,by |
R3770 | T4391 | T4395 | arg1Of | isolated,over |
R3771 | T4394 | T4392 | arg2Of | centrifugation,by |
R3772 | T4394 | T4393 | arg1Of | centrifugation,density |
R3773 | T4396 | T4395 | arg2Of | Ficoll-Hypaque,over |
R3774 | T4396 | T4397 | arg1Of | Ficoll-Hypaque,( |
R3775 | T4396 | T4410 | arg1Of | Ficoll-Hypaque,as |
R3776 | T4398 | T4399 | arg1Of | density,"," |
R3777 | T4398 | T4402 | arg1Of | density,; |
R3778 | T4401 | T4399 | arg2Of | g/ml,"," |
R3779 | T4401 | T4400 | arg1Of | g/ml,1.077 |
R3780 | T4402 | T4397 | arg2Of | ;,( |
R3781 | T4402 | T4407 | arg1Of | ;,"," |
R3782 | T4402 | T4408 | arg1Of | ;,UK |
R3783 | T4404 | T4402 | arg2Of | Biosciences,; |
R3784 | T4404 | T4403 | arg1Of | Biosciences,Amersham |
R3785 | T4404 | T4405 | arg1Of | Biosciences,"," |
R3786 | T4406 | T4405 | arg2Of | Amersham,"," |
R3787 | T4409 | T4397 | arg3Of | ),( |
R3788 | T4412 | T4411 | arg1Of | described,previously |
R3789 | T4414 | T4410 | arg2Of | 34,as |
R3790 | T4414 | T4412 | arg1Of | 34,described |
R3791 | T4414 | T4413 | arg2Of | 34,[ |
R3792 | T4415 | T4413 | arg3Of | ],[ |
R3793 | T4416 | T4417 | arg1Of | Cells,were |
R3794 | T4416 | T4418 | arg2Of | Cells,stimulated |
R3795 | T4418 | T4417 | arg2Of | stimulated,were |
R3796 | T4418 | T4419 | arg1Of | stimulated,with |
R3797 | T4418 | T4426 | arg1Of | stimulated,for |
R3798 | T4420 | T4419 | arg2Of | anti-CD3/CD28,with |
R3799 | T4420 | T4421 | arg1Of | anti-CD3/CD28,( |
R3800 | T4423 | T4421 | arg2Of | µg/ml,( |
R3801 | T4423 | T4422 | arg1Of | µg/ml,1 |
R3802 | T4423 | T4424 | arg1Of | µg/ml,each |
R3803 | T4425 | T4421 | arg3Of | ),( |
R3804 | T4428 | T4426 | arg2Of | h,for |
R3805 | T4428 | T4427 | arg1Of | h,1 |
R3806 | T4428 | T4429 | arg1Of | h,at |
R3807 | T4428 | T4431 | modOf | h,to |
R3808 | T4428 | T4443 | arg1Of | h,( |
R3809 | T4430 | T4429 | arg2Of | 37°C,at |
R3810 | T4432 | T4431 | arg1Of | stimulate,to |
R3811 | T4435 | T4432 | arg2Of | release,stimulate |
R3812 | T4435 | T4433 | arg1Of | release,Th2 |
R3813 | T4435 | T4434 | arg1Of | release,cytokine |
R3814 | T4435 | T4436 | arg1Of | release,in |
R3815 | T4435 | T4441 | arg1Of | release,of |
R3816 | T4438 | T4439 | arg1Of | presence,or |
R3817 | T4439 | T4436 | arg2Of | or,in |
R3818 | T4439 | T4437 | arg1Of | or,the |
R3819 | T4440 | T4439 | arg2Of | absence,or |
R3820 | T4442 | T4441 | arg2Of | FP,of |
R3821 | T4444 | T4443 | arg2Of | 10−12,( |
R3822 | T4444 | T4445 | arg1Of | 10−12,to |
R3823 | T4446 | T4445 | arg2Of | 10−8M,to |
R3824 | T4447 | T4443 | arg3Of | ),( |
R3825 | T4448 | T4449 | arg1Of | Cytospins,were |
R3826 | T4448 | T4450 | arg2Of | Cytospins,prepared |
R3827 | T4450 | T4449 | arg2Of | prepared,were |
R3828 | T4450 | T4451 | arg1Of | prepared,and |
R3829 | T4453 | T4452 | arg1Of | localization,GATA-3 |
R3830 | T4453 | T4454 | arg1Of | localization,determined |
R3831 | T4454 | T4451 | arg2Of | determined,and |
R3832 | T4457 | T4454 | arg2Of | microscopy,determined |
R3833 | T4457 | T4455 | arg2Of | microscopy,by |
R3834 | T4457 | T4456 | arg1Of | microscopy,confocal |
R3835 | T4457 | T4458 | arg1Of | microscopy,as |
R3836 | T4460 | T4459 | arg1Of | described,previously |
R3837 | T4462 | T4458 | arg2Of | 12,as |
R3838 | T4462 | T4460 | arg1Of | 12,described |
R3839 | T4462 | T4461 | arg2Of | 12,[ |
R3840 | T4463 | T4461 | arg3Of | ],[ |
R3969 | T4624 | T4622 | arg1Of | PCR,Reverse |
R3970 | T4624 | T4623 | arg1Of | PCR,Transcription |
R3971 | T4626 | T4625 | arg1Of | RNA,Total |
R3972 | T4626 | T4627 | arg1Of | RNA,was |
R3973 | T4626 | T4628 | arg2Of | RNA,extracted |
R3975 | T4628 | T4627 | arg2Of | extracted,was |
R3979 | T4634 | T4632 | arg2Of | kit,( |
R3980 | T4634 | T4633 | arg1Of | kit,RNeasy |
R3981 | T4634 | T4635 | arg1Of | kit,; |
R3982 | T4636 | T4635 | arg2Of | Qiagen,; |
R3983 | T4636 | T4637 | arg1Of | Qiagen,"," |
R3984 | T4638 | T4637 | arg2Of | Crawley,"," |
R3985 | T4638 | T4639 | arg1Of | Crawley,"," |
R3986 | T4640 | T4639 | arg2Of | UK,"," |
R3987 | T4641 | T4632 | arg3Of | ),( |
R3988 | T4644 | T4642 | arg2Of | purification,During |
R3989 | T4644 | T4643 | arg1Of | purification,RNA |
R3990 | T4647 | T4646 | arg1Of | DNA,genomic |
R3991 | T4647 | T4648 | arg1Of | DNA,was |
R3992 | T4647 | T4649 | arg2Of | DNA,digested |
R3993 | T4649 | T4642 | arg1Of | digested,During |
R3994 | T4649 | T4645 | arg1Of | digested,"," |
R3995 | T4649 | T4648 | arg2Of | digested,was |
R3996 | T4649 | T4650 | arg1Of | digested,with |
R3997 | T4652 | T4650 | arg2Of | DNase,with |
R3998 | T4652 | T4651 | arg1Of | DNase,RNase-free |
R3999 | T4652 | T4653 | arg1Of | DNase,( |
R4000 | T4655 | T4653 | arg2Of | Biosciences,( |
R4001 | T4655 | T4654 | arg1Of | Biosciences,Amersham |
R4002 | T4656 | T4653 | arg3Of | ),( |
R4003 | T4660 | T4659 | arg1Of | µg,0.5 |
R4004 | T4660 | T4661 | arg1Of | µg,of |
R4005 | T4660 | T4664 | arg1Of | µg,was |
R4006 | T4660 | T4665 | arg2Of | µg,reversed |
R4007 | T4663 | T4661 | arg2Of | RNA,of |
R4008 | T4663 | T4662 | arg1Of | RNA,total |
R4009 | T4665 | T4657 | arg1Of | reversed,Next |
R4010 | T4665 | T4658 | arg1Of | reversed,"," |
R4011 | T4665 | T4664 | arg2Of | reversed,was |
R4012 | T4665 | T4666 | modOf | reversed,transcribed |
R4013 | T4665 | T4667 | modOf | reversed,using |
R4014 | T4665 | T4673 | arg1Of | reversed,( |
R4015 | T4672 | T4667 | arg2Of | RT,using |
R4016 | T4672 | T4668 | arg1Of | RT,the |
R4017 | T4672 | T4669 | arg1Of | RT,avian |
R4018 | T4672 | T4670 | arg1Of | RT,myeloblastosis |
R4019 | T4672 | T4671 | arg1Of | RT,virus |
R4020 | T4674 | T4675 | arg1Of | Promega,"," |
R4021 | T4675 | T4673 | arg2Of | ",",( |
R4022 | T4675 | T4677 | arg1Of | ",","," |
R4023 | T4676 | T4675 | arg2Of | Southampton,"," |
R4024 | T4678 | T4677 | arg2Of | UK,"," |
R4025 | T4679 | T4673 | arg3Of | ),( |
R4026 | T4682 | T4680 | arg2Of | quantification,For |
R4027 | T4682 | T4681 | arg1Of | quantification,relative |
R4028 | T4684 | T4685 | arg1Of | RT-PCR,was |
R4029 | T4684 | T4686 | arg2Of | RT-PCR,carried |
R4030 | T4686 | T4680 | arg1Of | carried,For |
R4031 | T4686 | T4683 | arg1Of | carried,"," |
R4032 | T4686 | T4685 | arg2Of | carried,was |
R4033 | T4686 | T4687 | arg1Of | carried,out |
R4034 | T4686 | T4688 | modOf | carried,using |
R4035 | T4690 | T4688 | arg2Of | probes,using |
R4036 | T4690 | T4689 | arg1Of | probes,cDNA |
R4037 | T4691 | T4692 | arg1Of | Primers,for |
R4038 | T4691 | T4694 | arg1Of | Primers,were |
R4039 | T4691 | T4695 | arg1Of | Primers,from |
R4040 | T4693 | T4692 | arg2Of | IL-4,for |
R4041 | T4694 | T4697 | arg1Of | were,( |
R4042 | T4695 | T4694 | arg2Of | from,were |
R4043 | T4696 | T4695 | arg2Of | Sigma-Genosys,from |
R4044 | T4698 | T4697 | arg2Of | Cambridge,( |
R4045 | T4698 | T4699 | arg1Of | Cambridge,"," |
R4046 | T4698 | T4700 | arg1Of | Cambridge,UK |
R4047 | T4701 | T4697 | arg3Of | ),( |
R4048 | T4702 | T4703 | arg1Of | Sequences,of |
R4049 | T4702 | T4706 | arg1Of | Sequences,are |
R4050 | T4702 | T4708 | arg1Of | Sequences,follows |
R4051 | T4704 | T4703 | arg2Of | GADPH,of |
R4052 | T4704 | T4705 | arg2Of | GADPH,used |
R4053 | T4706 | T4707 | arg1Of | are,as |
R4054 | T4708 | T4707 | arg2Of | follows,as |
R4055 | T4708 | T4709 | arg1Of | follows,: |
R4056 | T4711 | T4708 | arg2Of | 5′-CCACCCATGGCAAATTCCATGGC,follows |
R4057 | T4711 | T4710 | arg1Of | 5′-CCACCCATGGCAAATTCCATGGC,forward |
R4058 | T4711 | T4712 | arg1Of | 5′-CCACCCATGGCAAATTCCATGGC,"," |
R4059 | T4714 | T4712 | arg2Of | 3′-TCTAGACGGCAGGTCAGGTCCAC,"," |
R4060 | T4714 | T4713 | arg1Of | 3′-TCTAGACGGCAGGTCAGGTCCAC,reverse |
R4166 | T4854 | T4853 | arg1Of | Fractionation,Cell |
R4167 | T4854 | T4855 | arg1Of | Fractionation,"," |
R4168 | T4855 | T4858 | arg1Of | ",",and |
R4169 | T4856 | T4855 | arg2Of | Immunoprecipitation,"," |
R4170 | T4858 | T4857 | arg1Of | and,"," |
R4171 | T4860 | T4859 | arg1Of | Blot,Western |
R4172 | T4861 | T4858 | arg2Of | Analysis,and |
R4173 | T4861 | T4860 | arg1Of | Analysis,Blot |
R4174 | T4862 | T4863 | arg1Of | Nuclear,and |
R4175 | T4864 | T4863 | arg2Of | cytoplasmic,and |
R4176 | T4865 | T4862 | arg1Of | fractions,Nuclear |
R4177 | T4865 | T4864 | arg1Of | fractions,cytoplasmic |
R4178 | T4865 | T4866 | arg1Of | fractions,were |
R4179 | T4865 | T4867 | arg2Of | fractions,prepared |
R4180 | T4867 | T4866 | arg2Of | prepared,were |
R4181 | T4867 | T4868 | arg1Of | prepared,as |
R4182 | T4870 | T4869 | arg1Of | described,previously |
R4183 | T4872 | T4868 | arg2Of | 35,as |
R4184 | T4872 | T4870 | arg1Of | 35,described |
R4185 | T4872 | T4871 | arg2Of | 35,[ |
R4186 | T4873 | T4871 | arg3Of | ],[ |
R4187 | T4876 | T4874 | arg1Of | lysates,Whole |
R4188 | T4876 | T4875 | arg1Of | lysates,cell |
R4189 | T4876 | T4877 | arg1Of | lysates,were |
R4190 | T4876 | T4878 | arg2Of | lysates,prepared |
R4191 | T4878 | T4877 | arg2Of | prepared,were |
R4192 | T4878 | T4879 | arg1Of | prepared,in |
R4193 | T4882 | T4879 | arg2Of | buffer,in |
R4194 | T4882 | T4880 | arg1Of | buffer,NP-40 |
R4195 | T4882 | T4881 | arg1Of | buffer,lysis |
R4196 | T4882 | T4883 | arg1Of | buffer,( |
R4197 | T4882 | T4901 | arg1Of | buffer,in |
R4198 | T4884 | T4885 | arg1Of | 0.5,% |
R4199 | T4887 | T4884 | arg1Of | P-40,0.5 |
R4200 | T4887 | T4886 | arg1Of | P-40,Nonidet |
R4201 | T4887 | T4888 | arg1Of | P-40,"," |
R4202 | T4888 | T4896 | arg1Of | ",","," |
R4203 | T4889 | T4890 | arg1Of | 20,mM |
R4204 | T4891 | T4888 | arg2Of | Tris-HCl,"," |
R4205 | T4891 | T4889 | arg1Of | Tris-HCl,20 |
R4206 | T4891 | T4892 | arg1Of | Tris-HCl,[ |
R4207 | T4893 | T4892 | arg2Of | pH,[ |
R4208 | T4893 | T4894 | arg1Of | pH,7.5 |
R4209 | T4895 | T4892 | arg3Of | ],[ |
R4210 | T4896 | T4883 | arg2Of | ",",( |
R4211 | T4897 | T4898 | arg1Of | 150,mM |
R4212 | T4899 | T4896 | arg2Of | NaCl,"," |
R4213 | T4899 | T4897 | arg1Of | NaCl,150 |
R4214 | T4900 | T4883 | arg3Of | ),( |
R4215 | T4903 | T4901 | arg2Of | presence,in |
R4216 | T4903 | T4902 | arg1Of | presence,the |
R4217 | T4903 | T4904 | arg1Of | presence,of |
R4218 | T4908 | T4904 | arg2Of | inhibitor,of |
R4219 | T4908 | T4905 | arg1Of | inhibitor,complete |
R4220 | T4908 | T4906 | arg1Of | inhibitor,protease |
R4221 | T4908 | T4907 | arg1Of | inhibitor,cocktail |
R4222 | T4909 | T4910 | arg1Of | Lysates,were |
R4223 | T4909 | T4911 | arg2Of | Lysates,centrifuged |
R4224 | T4909 | T4925 | arg1Of | Lysates,remove |
R4225 | T4911 | T4910 | arg2Of | centrifuged,were |
R4226 | T4911 | T4912 | arg1Of | centrifuged,at |
R4227 | T4911 | T4914 | arg1Of | centrifuged,for |
R4228 | T4911 | T4917 | arg1Of | centrifuged,at |
R4229 | T4911 | T4920 | arg1Of | centrifuged,in |
R4230 | T4911 | T4924 | modOf | centrifuged,to |
R4231 | T4913 | T4912 | arg2Of | 4°C,at |
R4232 | T4916 | T4914 | arg2Of | min,for |
R4233 | T4916 | T4915 | arg1Of | min,10 |
R4234 | T4919 | T4917 | arg2Of | rpm,at |
R4235 | T4919 | T4918 | arg1Of | rpm,"12,000" |
R4236 | T4923 | T4920 | arg2Of | microcentrifuge,in |
R4237 | T4923 | T4921 | arg1Of | microcentrifuge,an |
R4238 | T4923 | T4922 | arg1Of | microcentrifuge,Eppendorf |
R4239 | T4925 | T4924 | arg1Of | remove,to |
R4240 | T4927 | T4925 | arg2Of | debris,remove |
R4241 | T4927 | T4926 | arg1Of | debris,cellular |
R4242 | T4928 | T4929 | arg1Of | Samples,were |
R4243 | T4928 | T4931 | arg2Of | Samples,immunoprecipitated |
R4244 | T4931 | T4929 | arg2Of | immunoprecipitated,were |
R4245 | T4931 | T4930 | arg1Of | immunoprecipitated,then |
R4246 | T4931 | T4932 | arg1Of | immunoprecipitated,with |
R4247 | T4935 | T4932 | arg2Of | µl,with |
R4248 | T4935 | T4933 | arg1Of | µl,either |
R4249 | T4935 | T4934 | arg1Of | µl,10 |
R4250 | T4935 | T4936 | arg1Of | µl,of |
R4251 | T4935 | T4942 | arg1Of | µl,using |
R4252 | T4935 | T4952 | arg1Of | µl,using |
R4253 | T4935 | T4958 | arg1Of | µl,( |
R4254 | T4937 | T4936 | arg2Of | antibody,of |
R4255 | T4937 | T4938 | arg1Of | antibody,against |
R4256 | T4939 | T4940 | arg1Of | GATA-3,or |
R4257 | T4940 | T4938 | arg2Of | or,against |
R4258 | T4941 | T4940 | arg2Of | importin-α,or |
R4259 | T4942 | T4946 | arg1Of | using,in |
R4260 | T4942 | T4952 | modOf | using,using |
R4261 | T4945 | T4942 | arg2Of | slurry,using |
R4262 | T4945 | T4943 | arg1Of | slurry,A/G |
R4263 | T4945 | T4944 | arg2Of | slurry,agarose |
R4264 | T4948 | T4946 | arg2Of | presence,in |
R4265 | T4948 | T4947 | arg1Of | presence,the |
R4266 | T4948 | T4949 | arg1Of | presence,of |
R4267 | T4951 | T4949 | arg2Of | inhibitor,of |
R4268 | T4951 | T4950 | arg1Of | inhibitor,protease |
R4269 | T4954 | T4955 | arg1Of | Catch,and |
R4270 | T4956 | T4955 | arg2Of | Release,and |
R4271 | T4957 | T4952 | arg2Of | methodology,using |
R4272 | T4957 | T4953 | arg1Of | methodology,the |
R4273 | T4957 | T4954 | arg1Of | methodology,Catch |
R4274 | T4957 | T4956 | arg1Of | methodology,Release |
R4275 | T4960 | T4959 | arg1Of | Biotechnology,Upstate |
R4276 | T4960 | T4961 | arg1Of | Biotechnology,"," |
R4277 | T4961 | T4964 | arg1Of | ",","," |
R4278 | T4963 | T4961 | arg2Of | Placid,"," |
R4279 | T4963 | T4962 | arg1Of | Placid,Lake |
R4280 | T4964 | T4958 | arg2Of | ",",( |
R4281 | T4964 | T4967 | arg1Of | ",","," |
R4282 | T4964 | T4968 | arg1Of | ",",USA |
R4283 | T4966 | T4964 | arg2Of | York,"," |
R4284 | T4966 | T4965 | arg1Of | York,New |
R4285 | T4969 | T4958 | arg3Of | ),( |
R4286 | T4972 | T4970 | arg1Of | analysis,Western |
R4287 | T4972 | T4971 | arg1Of | analysis,blot |
R4288 | T4972 | T4973 | arg1Of | analysis,was |
R4289 | T4972 | T4974 | arg2Of | analysis,performed |
R4290 | T4974 | T4973 | arg2Of | performed,was |
R4291 | T4975 | T4974 | arg3Of | using,performed |
R4292 | T4976 | T4975 | arg2Of | anti-GATA-3,using |
R4293 | T4976 | T4977 | arg1Of | anti-GATA-3,"," |
R4294 | T4978 | T4979 | arg1Of | anti-importin-α,"," |
R4295 | T4979 | T4981 | arg1Of | ",","," |
R4296 | T4980 | T4979 | arg2Of | anti-GR,"," |
R4297 | T4982 | T4981 | arg2Of | anti-p-p38,"," |
R4298 | T4984 | T4978 | arg1Of | kinase,anti-importin-α |
R4299 | T4984 | T4980 | arg1Of | kinase,anti-GR |
R4300 | T4984 | T4982 | arg1Of | kinase,anti-p-p38 |
R4301 | T4984 | T4983 | arg1Of | kinase,MAP |
R4302 | T4984 | T4985 | arg1Of | kinase,"," |
R4303 | T4985 | T4988 | arg1Of | ",",and |
R4304 | T4986 | T4985 | arg2Of | anti-p-ATF-2,"," |
R4305 | T4988 | T4977 | arg2Of | and,"," |
R4306 | T4988 | T4987 | arg1Of | and,"," |
R4307 | T4989 | T4988 | arg2Of | anti-p-serine,and |
R4308 | T4991 | T4990 | arg1Of | proteins,Immunoreactive |
R4309 | T4991 | T4992 | arg1Of | proteins,were |
R4310 | T4991 | T4993 | arg2Of | proteins,detected |
R4311 | T4993 | T4992 | arg2Of | detected,were |
R4312 | T4994 | T4993 | arg3Of | using,detected |
R4313 | T4999 | T4994 | arg2Of | kit,using |
R4314 | T4999 | T4995 | arg1Of | kit,an |
R4315 | T4999 | T4996 | arg2Of | kit,enhanced |
R4316 | T4999 | T4997 | arg1Of | kit,chemiluminescence |
R4317 | T4999 | T4998 | arg1Of | kit,ECL |
R4318 | T4999 | T5000 | arg1Of | kit,( |
R4319 | T5002 | T5000 | arg2Of | Biosciences,( |
R4320 | T5002 | T5001 | arg1Of | Biosciences,Amersham |
R4321 | T5003 | T5000 | arg3Of | ),( |
R4483 | T5207 | T5206 | arg1Of | Immunoprecipitation,Chromatin |
R4484 | T5209 | T5208 | arg1Of | immunoprecipitation,Chromatin |
R4485 | T5209 | T5210 | arg1Of | immunoprecipitation,( |
R4486 | T5209 | T5213 | arg1Of | immunoprecipitation,was |
R4487 | T5209 | T5214 | arg2Of | immunoprecipitation,performed |
R4488 | T5211 | T5210 | arg2Of | IP,( |
R4489 | T5212 | T5210 | arg3Of | ),( |
R4490 | T5214 | T5213 | arg2Of | performed,was |
R4491 | T5214 | T5215 | arg1Of | performed,as |
R4492 | T5214 | T5239 | arg1Of | performed,as |
R4493 | T5214 | T5248 | arg1Of | performed,overnight |
R4494 | T5217 | T5216 | arg1Of | described,previously |
R4495 | T5219 | T5215 | arg2Of | 12,as |
R4496 | T5219 | T5217 | arg1Of | 12,described |
R4497 | T5219 | T5218 | arg2Of | 12,[ |
R4498 | T5219 | T5221 | arg1Of | 12,in |
R4499 | T5219 | T5224 | arg1Of | 12,with |
R4500 | T5220 | T5218 | arg3Of | ],[ |
R4501 | T5223 | T5221 | arg2Of | T-cells,in |
R4502 | T5223 | T5222 | arg1Of | T-cells,HuT-78 |
R4503 | T5226 | T5224 | arg2Of | µg,with |
R4504 | T5226 | T5225 | arg1Of | µg,2 |
R4505 | T5226 | T5227 | arg1Of | µg,of |
R4506 | T5228 | T5229 | arg1Of | anti-GATA-3,( |
R4507 | T5228 | T5235 | arg1Of | anti-GATA-3,or |
R4508 | T5232 | T5229 | arg2Of | Biotechnology,( |
R4509 | T5232 | T5230 | arg1Of | Biotechnology,Santa |
R4510 | T5232 | T5231 | arg1Of | Biotechnology,Cruz |
R4511 | T5233 | T5229 | arg3Of | ),( |
R4512 | T5235 | T5227 | arg2Of | or,of |
R4513 | T5235 | T5234 | arg1Of | or,"," |
R4514 | T5238 | T5235 | arg2Of | G,or |
R4515 | T5238 | T5236 | arg1Of | G,isotypic |
R4516 | T5238 | T5237 | arg1Of | G,immunoglobulin |
R4517 | T5242 | T5239 | arg2Of | control,as |
R4518 | T5242 | T5240 | arg1Of | control,a |
R4519 | T5242 | T5241 | arg1Of | control,non-specific |
R4520 | T5242 | T5243 | arg1Of | control,( |
R4521 | T5246 | T5243 | arg2Of | Biotechnology,( |
R4522 | T5246 | T5244 | arg1Of | Biotechnology,Santa |
R4523 | T5246 | T5245 | arg1Of | Biotechnology,Cruz |
R4524 | T5247 | T5243 | arg3Of | ),( |
R4525 | T5251 | T5250 | arg1Of | Promoter,4°C. |
R4526 | T5252 | T5251 | arg1Of | sequences,Promoter |
R4527 | T5252 | T5253 | arg1Of | sequences,were |
R4528 | T5252 | T5254 | arg2Of | sequences,detected |
R4529 | T5252 | T5271 | arg1Of | sequences,reverse |
R4530 | T5254 | T5253 | arg2Of | detected,were |
R4531 | T5254 | T5255 | arg1Of | detected,with |
R4532 | T5254 | T5270 | arg1Of | detected,and |
R4533 | T5257 | T5255 | arg2Of | primers,with |
R4534 | T5257 | T5256 | arg1Of | primers,PCR |
R4535 | T5257 | T5258 | arg1Of | primers,for |
R4536 | T5261 | T5259 | arg1Of | promoter,the |
R4537 | T5261 | T5260 | arg1Of | promoter,IL-5 |
R4538 | T5261 | T5262 | arg1Of | promoter,( |
R4539 | T5261 | T5267 | arg1Of | promoter,: |
R4540 | T5265 | T5262 | arg2Of | +4,( |
R4541 | T5265 | T5263 | arg1Of | +4,−445 |
R4542 | T5265 | T5264 | arg1Of | +4,to |
R4543 | T5266 | T5262 | arg3Of | ),( |
R4544 | T5269 | T5258 | arg2Of | 5′-TTAATCTAGCCACAGTCATAG-3′,for |
R4545 | T5269 | T5261 | arg1Of | 5′-TTAATCTAGCCACAGTCATAG-3′,promoter |
R4546 | T5269 | T5268 | arg1Of | 5′-TTAATCTAGCCACAGTCATAG-3′,forward |
R4547 | T5270 | T5213 | modOf | and,was |
R4548 | T5270 | T5249 | arg1Of | and,at |
R4549 | T5270 | T5272 | arg1Of | and,: |
R4550 | T5271 | T5270 | arg2Of | reverse,and |
R4551 | T5274 | T5275 | arg1Of | PCR,was |
R4552 | T5274 | T5276 | arg2Of | PCR,performed |
R4553 | T5276 | T5275 | arg2Of | performed,was |
R4554 | T5277 | T5276 | arg3Of | using,performed |
R4555 | T5280 | T5279 | arg1Of | Omnigene,Hybaid |
R4556 | T5282 | T5277 | arg2Of | cycler,using |
R4557 | T5282 | T5278 | arg1Of | cycler,a |
R4558 | T5282 | T5280 | arg1Of | cycler,Omnigene |
R4559 | T5282 | T5281 | arg1Of | cycler,thermal |
R4560 | T5282 | T5283 | arg1Of | cycler,( |
R4561 | T5282 | T5290 | arg1Of | cycler,with |
R4562 | T5284 | T5285 | arg1Of | Hybaid,"," |
R4563 | T5285 | T5283 | arg2Of | ",",( |
R4564 | T5285 | T5287 | arg1Of | ",","," |
R4565 | T5286 | T5285 | arg2Of | Ashford,"," |
R4566 | T5288 | T5287 | arg2Of | UK,"," |
R4567 | T5289 | T5283 | arg3Of | ),( |
R4568 | T5292 | T5290 | arg2Of | parameters,with |
R4569 | T5292 | T5291 | arg1Of | parameters,cycling |
R4570 | T5292 | T5293 | arg1Of | parameters,of |
R4571 | T5292 | T5301 | arg1Of | parameters,at |
R4572 | T5294 | T5295 | arg1Of | 72°C,for |
R4573 | T5294 | T5298 | arg1Of | 72°C,"," |
R4574 | T5297 | T5295 | arg2Of | min,for |
R4575 | T5297 | T5296 | arg1Of | min,10 |
R4576 | T5298 | T5293 | arg2Of | ",",of |
R4577 | T5300 | T5298 | arg2Of | cycles,"," |
R4578 | T5300 | T5299 | arg1Of | cycles,35 |
R4579 | T5302 | T5301 | arg2Of | 94°C,at |
R4580 | T5302 | T5303 | arg1Of | 94°C,for |
R4581 | T5305 | T5304 | arg1Of | s,45 |
R4582 | T5305 | T5306 | arg1Of | s,"," |
R4583 | T5306 | T5311 | arg1Of | ",","," |
R4584 | T5307 | T5306 | arg2Of | 52°C,"," |
R4585 | T5307 | T5308 | arg1Of | 52°C,for |
R4586 | T5310 | T5308 | arg2Of | s,for |
R4587 | T5310 | T5309 | arg1Of | s,45 |
R4588 | T5311 | T5303 | arg2Of | ",",for |
R4589 | T5311 | T5313 | arg1Of | ",",for |
R4590 | T5312 | T5311 | arg2Of | 72°C,"," |
R4591 | T5315 | T5313 | arg2Of | s,for |
R4592 | T5315 | T5314 | arg1Of | s,45 |
R4724 | T5499 | T5500 | arg1Of | GR-GATA-3,In |
R4725 | T5499 | T5504 | arg1Of | GR-GATA-3,for |
R4726 | T5503 | T5500 | arg2Of | Assay,In |
R4727 | T5503 | T5501 | arg1Of | Assay,Vitro |
R4728 | T5503 | T5502 | arg1Of | Assay,Competition |
R4729 | T5505 | T5504 | arg2Of | Importin-α,for |
R4730 | T5505 | T5506 | arg1Of | Importin-α,( |
R4731 | T5508 | T5506 | arg2Of | ELISA,( |
R4732 | T5508 | T5507 | arg1Of | ELISA,Far-Western |
R4733 | T5509 | T5506 | arg3Of | ),( |
R4734 | T5513 | T5510 | arg2Of | anti-importin-α,Immunoprecipitated |
R4735 | T5513 | T5511 | arg1Of | anti-importin-α,importin-α |
R4736 | T5513 | T5512 | arg2Of | anti-importin-α,( |
R4737 | T5513 | T5514 | arg1Of | anti-importin-α,"," |
R4738 | T5513 | T5519 | arg1Of | anti-importin-α,from |
R4739 | T5513 | T5522 | arg1Of | anti-importin-α,was |
R4740 | T5513 | T5523 | arg2Of | anti-importin-α,separated |
R4741 | T5513 | T5527 | arg2Of | anti-importin-α,purified |
R4742 | T5517 | T5514 | arg2Of | Biotechnology,"," |
R4743 | T5517 | T5515 | arg1Of | Biotechnology,Santa |
R4744 | T5517 | T5516 | arg1Of | Biotechnology,Cruz |
R4745 | T5518 | T5512 | arg3Of | ),( |
R4746 | T5521 | T5519 | arg2Of | cells,from |
R4747 | T5521 | T5520 | arg1Of | cells,HuT-78 |
R4748 | T5523 | T5526 | arg1Of | separated,and |
R4749 | T5525 | T5523 | arg1Of | SDS-PAGE,separated |
R4750 | T5525 | T5524 | arg2Of | SDS-PAGE,by |
R4751 | T5526 | T5522 | arg2Of | and,was |
R4752 | T5527 | T5526 | arg2Of | purified,and |
R4753 | T5527 | T5528 | arg1Of | purified,from |
R4754 | T5527 | T5534 | arg1Of | purified,[ |
R4755 | T5531 | T5528 | arg2Of | gel,from |
R4756 | T5531 | T5529 | arg1Of | gel,the |
R4757 | T5531 | T5530 | arg2Of | gel,excised |
R4758 | T5533 | T5527 | arg1Of | electroelution,purified |
R4759 | T5533 | T5532 | arg2Of | electroelution,by |
R4760 | T5535 | T5534 | arg2Of | 36,[ |
R4761 | T5536 | T5534 | arg3Of | ],[ |
R4762 | T5539 | T5540 | arg1Of | GATA-3,was |
R4763 | T5539 | T5541 | arg2Of | GATA-3,isolated |
R4764 | T5541 | T5537 | arg1Of | isolated,Similarly |
R4765 | T5541 | T5538 | arg1Of | isolated,"," |
R4766 | T5541 | T5540 | arg2Of | isolated,was |
R4767 | T5541 | T5542 | arg1Of | isolated,from |
R4768 | T5541 | T5554 | arg1Of | isolated,and |
R4769 | T5545 | T5543 | arg1Of | cells,nonstimulated |
R4770 | T5545 | T5544 | arg1Of | cells,HuT-78 |
R4771 | T5545 | T5546 | arg1Of | cells,or |
R4772 | T5546 | T5542 | arg2Of | or,from |
R4773 | T5547 | T5546 | arg2Of | cells,or |
R4774 | T5547 | T5548 | arg2Of | cells,stimulated |
R4775 | T5548 | T5549 | arg1Of | stimulated,for |
R4776 | T5551 | T5549 | arg2Of | min,for |
R4777 | T5551 | T5550 | arg1Of | min,30 |
R4778 | T5551 | T5552 | arg1Of | min,with |
R4779 | T5553 | T5552 | arg2Of | anti-CD3/CD28,with |
R4780 | T5555 | T5556 | arg1Of | GR,was |
R4781 | T5555 | T5557 | arg2Of | GR,isolated |
R4782 | T5557 | T5554 | arg2Of | isolated,and |
R4783 | T5557 | T5556 | arg2Of | isolated,was |
R4784 | T5557 | T5558 | arg1Of | isolated,from |
R4785 | T5559 | T5560 | arg1Of | FP,( |
R4786 | T5562 | T5560 | arg2Of | M,( |
R4787 | T5562 | T5561 | arg1Of | M,10−8 |
R4788 | T5562 | T5563 | arg1Of | M,"," |
R4789 | T5565 | T5563 | arg2Of | min,"," |
R4790 | T5565 | T5564 | arg1Of | min,30 |
R4791 | T5566 | T5560 | arg3Of | ),( |
R4792 | T5569 | T5558 | arg2Of | cells,from |
R4793 | T5569 | T5559 | arg1Of | cells,FP |
R4794 | T5569 | T5567 | arg1Of | cells,stimulated |
R4795 | T5569 | T5568 | arg1Of | cells,HuT-78 |
R4796 | T5571 | T5570 | arg1Of | proteins,These |
R4797 | T5571 | T5572 | arg1Of | proteins,were |
R4798 | T5571 | T5574 | arg2Of | proteins,refolded |
R4799 | T5574 | T5572 | arg2Of | refolded,were |
R4800 | T5574 | T5573 | arg1Of | refolded,subsequently |
R4801 | T5574 | T5575 | arg1Of | refolded,in |
R4802 | T5577 | T5575 | arg2Of | solution,in |
R4803 | T5577 | T5576 | arg1Of | solution,glycine |
R4804 | T5579 | T5578 | arg1Of | µl,100 |
R4805 | T5579 | T5580 | arg1Of | µl,of |
R4806 | T5579 | T5583 | arg1Of | µl,( |
R4807 | T5579 | T5589 | arg1Of | µl,was |
R4808 | T5579 | T5590 | arg2Of | µl,added |
R4809 | T5582 | T5580 | arg2Of | solution,of |
R4810 | T5582 | T5581 | arg1Of | solution,importin-α |
R4811 | T5585 | T5583 | arg2Of | ng/ml,( |
R4812 | T5585 | T5584 | arg1Of | ng/ml,100 |
R4813 | T5585 | T5586 | arg1Of | ng/ml,in |
R4814 | T5587 | T5586 | arg2Of | TBS,in |
R4815 | T5588 | T5583 | arg3Of | ),( |
R4816 | T5590 | T5589 | arg2Of | added,was |
R4817 | T5590 | T5591 | arg1Of | added,to |
R4818 | T5593 | T5591 | arg2Of | plates,to |
R4819 | T5593 | T5592 | arg1Of | plates,96-well |
R4820 | T5593 | T5594 | arg2Of | plates,coated |
R4821 | T5594 | T5595 | arg1Of | coated,with |
R4822 | T5598 | T5595 | arg2Of | antibody,with |
R4823 | T5598 | T5596 | arg1Of | antibody,goat |
R4824 | T5598 | T5597 | arg1Of | antibody,anti-importin-α |
R4825 | T5602 | T5599 | arg2Of | incubation,After |
R4826 | T5602 | T5600 | arg1Of | incubation,1 |
R4827 | T5602 | T5601 | arg1Of | incubation,h |
R4828 | T5604 | T5605 | arg1Of | GATA-3,( |
R4829 | T5604 | T5611 | arg1Of | GATA-3,from |
R4830 | T5604 | T5616 | arg1Of | GATA-3,were |
R4831 | T5604 | T5617 | arg2Of | GATA-3,added |
R4832 | T5607 | T5605 | arg2Of | ng/ml,( |
R4833 | T5607 | T5606 | arg1Of | ng/ml,100 |
R4834 | T5607 | T5608 | arg1Of | ng/ml,in |
R4835 | T5609 | T5608 | arg2Of | TBS,in |
R4836 | T5610 | T5605 | arg3Of | ),( |
R4837 | T5615 | T5611 | arg2Of | cells,from |
R4838 | T5615 | T5612 | arg2Of | cells,stimulated |
R4839 | T5615 | T5613 | arg1Of | cells,or |
R4840 | T5615 | T5614 | arg1Of | cells,unstimulated |
R4841 | T5617 | T5599 | arg1Of | added,After |
R4842 | T5617 | T5603 | arg1Of | added,"," |
R4843 | T5617 | T5616 | arg2Of | added,were |
R4844 | T5617 | T5618 | arg1Of | added,to |
R4845 | T5621 | T5618 | arg2Of | wells,to |
R4846 | T5621 | T5619 | arg1Of | wells,the |
R4847 | T5621 | T5620 | arg1Of | wells,importin-α-coated |
R4848 | T5622 | T5623 | arg1Of | GR,( |
R4849 | T5622 | T5631 | arg1Of | GR,from |
R4850 | T5622 | T5636 | arg1Of | GR,were |
R4851 | T5622 | T5637 | arg2Of | GR,added |
R4852 | T5624 | T5625 | arg1Of | 10,or |
R4853 | T5626 | T5625 | arg2Of | 100,or |
R4854 | T5627 | T5623 | arg2Of | ng/ml,( |
R4855 | T5627 | T5624 | arg1Of | ng/ml,10 |
R4856 | T5627 | T5626 | arg1Of | ng/ml,100 |
R4857 | T5627 | T5628 | arg1Of | ng/ml,in |
R4858 | T5629 | T5628 | arg2Of | TBS,in |
R4859 | T5630 | T5623 | arg3Of | ),( |
R4860 | T5635 | T5631 | arg2Of | cells,from |
R4861 | T5635 | T5632 | arg2Of | cells,stimulated |
R4862 | T5635 | T5633 | arg1Of | cells,or |
R4863 | T5635 | T5634 | arg1Of | cells,unstimulated |
R4864 | T5637 | T5636 | arg2Of | added,were |
R4865 | T5637 | T5638 | arg1Of | added,to |
R4866 | T5640 | T5638 | arg2Of | wells,to |
R4867 | T5640 | T5639 | arg1Of | wells,some |
R4868 | T5644 | T5645 | arg1Of | 1,h |
R4869 | T5646 | T5641 | arg2Of | incubation,After |
R4870 | T5646 | T5642 | arg1Of | incubation,a |
R4871 | T5646 | T5643 | arg1Of | incubation,further |
R4872 | T5646 | T5644 | arg1Of | incubation,1 |
R4873 | T5649 | T5648 | arg1Of | plate,the |
R4874 | T5649 | T5650 | arg1Of | plate,was |
R4875 | T5649 | T5651 | arg2Of | plate,washed |
R4876 | T5649 | T5653 | arg2Of | plate,incubated |
R4877 | T5649 | T5677 | arg2Of | plate,incubated |
R4878 | T5651 | T5652 | arg1Of | washed,and |
R4879 | T5652 | T5654 | arg1Of | and,with |
R4880 | T5652 | T5675 | arg1Of | and,and |
R4881 | T5653 | T5652 | arg2Of | incubated,and |
R4882 | T5656 | T5654 | arg2Of | antibodies,with |
R4883 | T5656 | T5655 | arg1Of | antibodies,primary |
R4884 | T5656 | T5657 | arg1Of | antibodies,( |
R4885 | T5656 | T5671 | arg1Of | antibodies,for |
R4886 | T5659 | T5657 | arg2Of | mixture,( |
R4887 | T5659 | T5658 | arg1Of | mixture,a |
R4888 | T5659 | T5660 | arg1Of | mixture,of |
R4889 | T5662 | T5661 | arg1Of | anti-GATA-3,rabbit |
R4890 | T5662 | T5663 | arg1Of | anti-GATA-3,and |
R4891 | T5663 | T5660 | arg2Of | and,of |
R4892 | T5663 | T5666 | arg1Of | and,"," |
R4893 | T5665 | T5663 | arg2Of | anti-GR,and |
R4894 | T5665 | T5664 | arg1Of | anti-GR,mouse |
R4895 | T5669 | T5666 | arg2Of | Biotechnology,"," |
R4896 | T5669 | T5667 | arg1Of | Biotechnology,Santa |
R4897 | T5669 | T5668 | arg1Of | Biotechnology,Cruz |
R4898 | T5670 | T5657 | arg3Of | ),( |
R4899 | T5673 | T5671 | arg2Of | h,for |
R4900 | T5673 | T5672 | arg1Of | h,1.5 |
R4901 | T5675 | T5641 | arg1Of | and,After |
R4902 | T5675 | T5647 | arg1Of | and,"," |
R4903 | T5675 | T5650 | arg2Of | and,was |
R4904 | T5675 | T5674 | arg1Of | and,"," |
R4905 | T5677 | T5675 | arg2Of | incubated,and |
R4906 | T5677 | T5676 | arg1Of | incubated,then |
R4907 | T5677 | T5678 | arg1Of | incubated,with |
R4908 | T5680 | T5678 | arg2Of | antibodies,with |
R4909 | T5680 | T5679 | arg1Of | antibodies,secondary |
R4910 | T5684 | T5681 | arg1Of | IgG,FITC |
R4911 | T5684 | T5682 | arg1Of | IgG,swine |
R4912 | T5684 | T5683 | arg1Of | IgG,anti-rabbit |
R4913 | T5684 | T5685 | arg1Of | IgG,( |
R4914 | T5684 | T5692 | arg1Of | IgG,was |
R4915 | T5684 | T5693 | arg2Of | IgG,used |
R4916 | T5686 | T5685 | arg2Of | Dako,( |
R4917 | T5686 | T5687 | arg1Of | Dako,"," |
R4918 | T5688 | T5687 | arg2Of | Cambridge,"," |
R4919 | T5688 | T5689 | arg1Of | Cambridge,"," |
R4920 | T5690 | T5689 | arg2Of | UK,"," |
R4921 | T5691 | T5685 | arg3Of | ),( |
R4922 | T5693 | T5692 | arg2Of | used,was |
R4923 | T5693 | T5694 | arg1Of | used,for |
R4924 | T5693 | T5700 | arg1Of | used,and |
R4925 | T5696 | T5694 | arg2Of | detection,for |
R4926 | T5696 | T5695 | arg1Of | detection,the |
R4927 | T5696 | T5697 | arg1Of | detection,of |
R4928 | T5698 | T5697 | arg2Of | GATA-3,of |
R4929 | T5700 | T5699 | arg1Of | and,"," |
R4930 | T5704 | T5701 | arg1Of | IgG,rhodamine |
R4931 | T5704 | T5702 | arg1Of | IgG,donkey |
R4932 | T5704 | T5703 | arg1Of | IgG,anti-mouse |
R4933 | T5704 | T5705 | arg1Of | IgG,( |
R4934 | T5704 | T5714 | arg1Of | IgG,was |
R4935 | T5704 | T5715 | arg2Of | IgG,used |
R4936 | T5706 | T5707 | arg1Of | Novus,"," |
R4937 | T5707 | T5709 | arg1Of | ",","," |
R4938 | T5708 | T5707 | arg2Of | Littleton,"," |
R4939 | T5709 | T5705 | arg2Of | ",",( |
R4940 | T5709 | T5711 | arg1Of | ",","," |
R4941 | T5709 | T5712 | arg1Of | ",",USA |
R4942 | T5710 | T5709 | arg2Of | Colorado,"," |
R4943 | T5713 | T5705 | arg3Of | ),( |
R4944 | T5715 | T5700 | arg2Of | used,and |
R4945 | T5715 | T5714 | arg2Of | used,was |
R4946 | T5715 | T5716 | arg1Of | used,for |
R4947 | T5718 | T5716 | arg2Of | detection,for |
R4948 | T5718 | T5717 | arg1Of | detection,the |
R4949 | T5718 | T5719 | arg1Of | detection,of |
R4950 | T5720 | T5719 | arg2Of | GR,of |
R4951 | T5721 | T5722 | arg1Of | FITC,and |
R4952 | T5723 | T5722 | arg2Of | rhodamine,and |
R4953 | T5724 | T5721 | arg1Of | levels,FITC |
R4954 | T5724 | T5723 | arg1Of | levels,rhodamine |
R4955 | T5724 | T5725 | arg1Of | levels,were |
R4956 | T5724 | T5726 | arg2Of | levels,measured |
R4957 | T5726 | T5725 | arg2Of | measured,were |
R4958 | T5726 | T5727 | arg1Of | measured,with |
R4959 | T5726 | T5732 | arg1Of | measured,( |
R4960 | T5731 | T5727 | arg2Of | reader,with |
R4961 | T5731 | T5728 | arg1Of | reader,a |
R4962 | T5731 | T5729 | arg1Of | reader,fluorescent |
R4963 | T5731 | T5730 | arg1Of | reader,micro-plate |
R4964 | T5733 | T5732 | arg2Of | Bioline,( |
R4965 | T5733 | T5734 | arg1Of | Bioline,"," |
R4966 | T5735 | T5734 | arg2Of | London,"," |
R4967 | T5735 | T5736 | arg1Of | London,"," |
R4968 | T5737 | T5736 | arg2Of | UK,"," |
R4969 | T5738 | T5732 | arg3Of | ),( |
R5227 | T6081 | T6080 | arg1Of | Activation,NF-κB |
R5228 | T6084 | T6082 | arg1Of | activity,NF-κB |
R5229 | T6084 | T6083 | arg1Of | activity,binding |
R5230 | T6084 | T6085 | arg1Of | activity,in |
R5231 | T6084 | T6088 | arg1Of | activity,was |
R5232 | T6084 | T6089 | arg2Of | activity,determined |
R5233 | T6087 | T6085 | arg2Of | extracts,in |
R5234 | T6087 | T6086 | arg1Of | extracts,nuclear |
R5235 | T6089 | T6088 | arg2Of | determined,was |
R5236 | T6090 | T6089 | arg3Of | using,determined |
R5237 | T6093 | T6090 | arg2Of | kit,using |
R5238 | T6093 | T6091 | arg1Of | kit,an |
R5239 | T6093 | T6092 | arg1Of | kit,ELISA-based |
R5240 | T6093 | T6094 | arg1Of | kit,( |
R5241 | T6096 | T6095 | arg1Of | p65,Trans-AM |
R5242 | T6096 | T6097 | arg1Of | p65,"," |
R5243 | T6096 | T6100 | arg1Of | p65,"," |
R5244 | T6099 | T6097 | arg2Of | Motif,"," |
R5245 | T6099 | T6098 | arg1Of | Motif,Active |
R5246 | T6100 | T6094 | arg2Of | ",",( |
R5247 | T6101 | T6100 | arg2Of | Rixensart,"," |
R5248 | T6101 | T6102 | arg1Of | Rixensart,"," |
R5249 | T6103 | T6102 | arg2Of | Belgium,"," |
R5250 | T6104 | T6094 | arg3Of | ),( |
R5251 | T6106 | T6105 | arg2Of | brief,In |
R5252 | T6109 | T6108 | arg1Of | µg,5 |
R5253 | T6109 | T6110 | arg1Of | µg,of |
R5254 | T6109 | T6113 | arg1Of | µg,were |
R5255 | T6109 | T6114 | arg2Of | µg,incubated |
R5256 | T6112 | T6110 | arg2Of | extracts,of |
R5257 | T6112 | T6111 | arg1Of | extracts,nuclear |
R5258 | T6114 | T6105 | arg1Of | incubated,In |
R5259 | T6114 | T6107 | arg1Of | incubated,"," |
R5260 | T6114 | T6113 | arg2Of | incubated,were |
R5261 | T6114 | T6115 | arg1Of | incubated,with |
R5262 | T6117 | T6115 | arg2Of | plate,with |
R5263 | T6117 | T6116 | arg1Of | plate,a |
R5264 | T6117 | T6118 | arg2Of | plate,coated |
R5265 | T6118 | T6119 | arg1Of | coated,with |
R5266 | T6123 | T6119 | arg2Of | oligonucleotide,with |
R5267 | T6123 | T6120 | arg1Of | oligonucleotide,an |
R5268 | T6123 | T6121 | arg1Of | oligonucleotide,NF-κB |
R5269 | T6123 | T6122 | arg1Of | oligonucleotide,consensus |
R5270 | T6124 | T6125 | arg1Of | Plates,were |
R5271 | T6124 | T6126 | arg2Of | Plates,washed |
R5272 | T6126 | T6125 | arg2Of | washed,were |
R5273 | T6126 | T6127 | arg1Of | washed,before |
R5274 | T6128 | T6127 | arg2Of | addition,before |
R5275 | T6128 | T6129 | arg1Of | addition,of |
R5276 | T6132 | T6129 | arg2Of | antibody,of |
R5277 | T6132 | T6130 | arg1Of | antibody,an |
R5278 | T6132 | T6131 | arg1Of | antibody,anti-p65 |
R5279 | T6134 | T6133 | arg1Of | binding,Antibody |
R5280 | T6134 | T6135 | arg1Of | binding,was |
R5281 | T6134 | T6136 | arg2Of | binding,detected |
R5282 | T6134 | T6143 | arg2Of | binding,developed |
R5283 | T6136 | T6137 | arg1Of | detected,with |
R5284 | T6136 | T6142 | arg1Of | detected,and |
R5285 | T6141 | T6137 | arg2Of | antibody,with |
R5286 | T6141 | T6138 | arg1Of | antibody,a |
R5287 | T6141 | T6139 | arg1Of | antibody,secondary |
R5288 | T6141 | T6140 | arg1Of | antibody,HRP-conjugated |
R5289 | T6142 | T6135 | arg2Of | and,was |
R5290 | T6143 | T6142 | arg2Of | developed,and |
R5291 | T6143 | T6144 | arg1Of | developed,with |
R5292 | T6146 | T6144 | arg2Of | substrate,with |
R5293 | T6146 | T6145 | arg1Of | substrate,TMB |
R5294 | T6148 | T6147 | arg1Of | intensity,The |
R5295 | T6148 | T6149 | arg1Of | intensity,of |
R5296 | T6148 | T6152 | arg1Of | intensity,was |
R5297 | T6148 | T6153 | arg2Of | intensity,measured |
R5298 | T6151 | T6149 | arg2Of | reaction,of |
R5299 | T6151 | T6150 | arg1Of | reaction,the |
R5300 | T6153 | T6152 | arg2Of | measured,was |
R5301 | T6153 | T6154 | arg1Of | measured,at |
R5302 | T6156 | T6154 | arg2Of | nm,at |
R5303 | T6156 | T6155 | arg1Of | nm,450 |
R5389 | T6284 | T6283 | arg1Of | Staining,Immunofluorescence |
R5390 | T6286 | T6285 | arg1Of | staining,Immunofluorescence |
R5391 | T6286 | T6287 | arg1Of | staining,was |
R5392 | T6286 | T6288 | arg2Of | staining,performed |
R5393 | T6288 | T6287 | arg2Of | performed,was |
R5394 | T6288 | T6289 | arg1Of | performed,as |
R5395 | T6291 | T6290 | arg1Of | described,previously |
R5396 | T6293 | T6289 | arg2Of | 34,as |
R5397 | T6293 | T6291 | arg1Of | 34,described |
R5398 | T6293 | T6292 | arg2Of | 34,[ |
R5399 | T6294 | T6292 | arg3Of | ],[ |
R5400 | T6296 | T6295 | arg1Of | staining,All |
R5401 | T6296 | T6297 | arg1Of | staining,was |
R5402 | T6296 | T6298 | arg2Of | staining,performed |
R5403 | T6298 | T6297 | arg2Of | performed,was |
R5404 | T6298 | T6299 | arg1Of | performed,at |
R5405 | T6298 | T6303 | arg1Of | performed,under |
R5406 | T6299 | T6302 | arg1Of | at,and |
R5407 | T6301 | T6299 | arg2Of | temperature,at |
R5408 | T6301 | T6300 | arg1Of | temperature,room |
R5409 | T6303 | T6302 | arg2Of | under,and |
R5410 | T6304 | T6303 | arg2Of | humidification,under |
R5411 | T6305 | T6306 | arg1Of | Cells,were |
R5412 | T6305 | T6307 | arg2Of | Cells,collected |
R5413 | T6307 | T6306 | arg2Of | collected,were |
R5414 | T6307 | T6308 | arg1Of | collected,and |
R5415 | T6308 | T6314 | arg1Of | and,( |
R5416 | T6309 | T6310 | arg2Of | cytospins,prepared |
R5417 | T6310 | T6308 | arg2Of | prepared,and |
R5418 | T6310 | T6311 | arg1Of | prepared,in |
R5419 | T6313 | T6311 | arg2Of | cytocentrifuge,in |
R5420 | T6313 | T6312 | arg1Of | cytocentrifuge,a |
R5421 | T6316 | T6315 | arg1Of | II,Shandon |
R5422 | T6316 | T6317 | arg1Of | II,"," |
R5423 | T6317 | T6319 | arg1Of | ",","," |
R5424 | T6318 | T6317 | arg2Of | Shandon,"," |
R5425 | T6319 | T6314 | arg2Of | ",",( |
R5426 | T6319 | T6321 | arg1Of | ",","," |
R5427 | T6320 | T6319 | arg2Of | Runcorn,"," |
R5428 | T6322 | T6321 | arg2Of | UK,"," |
R5429 | T6323 | T6314 | arg3Of | ),( |
R5430 | T6324 | T6325 | arg1Of | Cells,were |
R5431 | T6324 | T6326 | arg2Of | Cells,permeabilized |
R5432 | T6324 | T6328 | arg2Of | Cells,blocked |
R5433 | T6324 | T6332 | arg2Of | Cells,incubated |
R5434 | T6326 | T6327 | arg1Of | permeabilized,"," |
R5435 | T6327 | T6330 | arg1Of | ",",and |
R5436 | T6328 | T6327 | arg2Of | blocked,"," |
R5437 | T6330 | T6325 | arg2Of | and,were |
R5438 | T6330 | T6329 | arg1Of | and,"," |
R5439 | T6332 | T6330 | arg2Of | incubated,and |
R5440 | T6332 | T6331 | arg1Of | incubated,then |
R5441 | T6332 | T6333 | arg1Of | incubated,with |
R5442 | T6334 | T6335 | arg1Of | GR,( |
R5443 | T6334 | T6342 | arg1Of | GR,or |
R5444 | T6340 | T6335 | arg2Of | Biotechnology,( |
R5445 | T6340 | T6336 | arg1Of | Biotechnology,1∶50 |
R5446 | T6340 | T6337 | arg1Of | Biotechnology,E-20 |
R5447 | T6340 | T6338 | arg1Of | Biotechnology,Santa |
R5448 | T6340 | T6339 | arg1Of | Biotechnology,Cruz |
R5449 | T6341 | T6335 | arg3Of | ),( |
R5450 | T6342 | T6333 | arg2Of | or,with |
R5451 | T6343 | T6344 | arg1Of | anti-GATA-3,( |
R5452 | T6345 | T6344 | arg2Of | H-48,( |
R5453 | T6345 | T6346 | arg1Of | H-48,; |
R5454 | T6349 | T6346 | arg2Of | Biotechnology,; |
R5455 | T6349 | T6347 | arg1Of | Biotechnology,Santa |
R5456 | T6349 | T6348 | arg1Of | Biotechnology,Cruz |
R5457 | T6350 | T6344 | arg3Of | ),( |
R5458 | T6351 | T6342 | arg2Of | antibody,or |
R5459 | T6351 | T6343 | arg1Of | antibody,anti-GATA-3 |
R5460 | T6351 | T6352 | arg1Of | antibody,for |
R5461 | T6354 | T6352 | arg2Of | h,for |
R5462 | T6354 | T6353 | arg1Of | h,1 |
R5463 | T6354 | T6355 | arg1Of | h,at |
R5464 | T6357 | T6355 | arg2Of | temperature,at |
R5465 | T6357 | T6356 | arg1Of | temperature,room |
R5466 | T6360 | T6358 | arg2Of | washes,After |
R5467 | T6360 | T6359 | arg1Of | washes,three |
R5468 | T6360 | T6361 | arg1Of | washes,in |
R5469 | T6363 | T6361 | arg2Of | saline,in |
R5470 | T6363 | T6362 | arg1Of | saline,phosphate-buffered |
R5471 | T6363 | T6364 | arg1Of | saline,( |
R5472 | T6365 | T6364 | arg2Of | PBS,( |
R5473 | T6366 | T6364 | arg3Of | ),( |
R5474 | T6368 | T6369 | arg1Of | cells,were |
R5475 | T6368 | T6370 | arg2Of | cells,incubated |
R5476 | T6370 | T6358 | arg1Of | incubated,After |
R5477 | T6370 | T6367 | arg1Of | incubated,"," |
R5478 | T6370 | T6369 | arg2Of | incubated,were |
R5479 | T6370 | T6371 | arg1Of | incubated,with |
R5480 | T6372 | T6371 | arg2Of | tetrarhodamine,with |
R5481 | T6372 | T6373 | arg2Of | tetrarhodamine,isothiocyanate–conjugated |
R5482 | T6376 | T6373 | arg3Of | antibody,isothiocyanate–conjugated |
R5483 | T6376 | T6374 | arg1Of | antibody,goat |
R5484 | T6376 | T6375 | arg1Of | antibody,anti-rabbit |
R5485 | T6376 | T6377 | arg1Of | antibody,( |
R5486 | T6378 | T6377 | arg2Of | Dako,( |
R5487 | T6379 | T6377 | arg3Of | ),( |
R5488 | T6380 | T6381 | arg1Of | Cytospins,were |
R5489 | T6380 | T6382 | arg2Of | Cytospins,counterstained |
R5490 | T6380 | T6401 | arg1Of | Cytospins,mounted |
R5491 | T6382 | T6381 | arg2Of | counterstained,were |
R5492 | T6382 | T6383 | arg1Of | counterstained,with |
R5493 | T6382 | T6400 | arg1Of | counterstained,and |
R5494 | T6384 | T6383 | arg2Of | 4′,with |
R5495 | T6384 | T6385 | arg1Of | 4′,"," |
R5496 | T6384 | T6391 | arg1Of | 4′,"," |
R5497 | T6387 | T6385 | arg2Of | dihydrochloride,"," |
R5498 | T6387 | T6386 | arg1Of | dihydrochloride,6-diamidino-2-phenylindole |
R5499 | T6387 | T6388 | arg1Of | dihydrochloride,( |
R5500 | T6389 | T6388 | arg2Of | DAPI,( |
R5501 | T6390 | T6388 | arg3Of | ),( |
R5502 | T6398 | T6391 | arg2Of | stain,"," |
R5503 | T6398 | T6392 | arg1Of | stain,a |
R5504 | T6398 | T6393 | arg1Of | stain,fluorescent |
R5505 | T6398 | T6394 | arg1Of | stain,blue |
R5506 | T6398 | T6395 | arg1Of | stain,nuclear |
R5507 | T6398 | T6396 | arg1Of | stain,indole |
R5508 | T6398 | T6397 | arg1Of | stain,chromatin |
R5509 | T6400 | T6399 | arg1Of | and,"," |
R5510 | T6401 | T6400 | arg2Of | mounted,and |
R5511 | T6401 | T6402 | arg1Of | mounted,in |
R5512 | T6401 | T6404 | arg1Of | mounted,: |
R5513 | T6403 | T6402 | arg2Of | PBS,in |
R5514 | T6405 | T6401 | arg2Of | glycerol,mounted |
R5515 | T6405 | T6406 | arg1Of | glycerol,( |
R5516 | T6407 | T6406 | arg2Of | 50∶50,( |
R5517 | T6408 | T6406 | arg3Of | ),( |
R5518 | T6411 | T6409 | arg1Of | signal,The |
R5519 | T6411 | T6410 | arg1Of | signal,immunopositive |
R5520 | T6411 | T6412 | arg1Of | signal,was |
R5521 | T6411 | T6413 | arg2Of | signal,characterised |
R5522 | T6411 | T6414 | arg1Of | signal,using |
R5523 | T6413 | T6412 | arg2Of | characterised,was |
R5524 | T6414 | T6413 | arg3Of | using,characterised |
R5525 | T6414 | T6419 | arg1Of | using,on |
R5526 | T6418 | T6414 | arg2Of | microscopy,using |
R5527 | T6418 | T6415 | arg1Of | microscopy,laser |
R5528 | T6418 | T6416 | arg1Of | microscopy,scanning |
R5529 | T6418 | T6417 | arg1Of | microscopy,confocal |
R5530 | T6423 | T6421 | arg1Of | NT/SP,Leica |
R5531 | T6423 | T6422 | arg1Of | NT/SP,TCS |
R5532 | T6426 | T6419 | arg2Of | cytometer,on |
R5533 | T6426 | T6420 | arg1Of | cytometer,a |
R5534 | T6426 | T6423 | arg1Of | cytometer,NT/SP |
R5535 | T6426 | T6424 | arg1Of | cytometer,interactive |
R5536 | T6426 | T6425 | arg1Of | cytometer,laser |
R5537 | T6426 | T6427 | arg2Of | cytometer,equipped |
R5538 | T6427 | T6428 | arg1Of | equipped,with |
R5539 | T6430 | T6428 | arg2Of | optics,with |
R5540 | T6430 | T6429 | arg1Of | optics,confocal |
R5541 | T6430 | T6431 | arg1Of | optics,( |
R5542 | T6433 | T6431 | arg2Of | Microsystems,( |
R5543 | T6433 | T6432 | arg1Of | Microsystems,Leica |
R5544 | T6433 | T6434 | arg1Of | Microsystems,"," |
R5545 | T6435 | T6434 | arg2Of | Wetzlar,"," |
R5546 | T6435 | T6436 | arg1Of | Wetzlar,"," |
R5547 | T6437 | T6436 | arg2Of | Germany,"," |
R5548 | T6438 | T6431 | arg3Of | ),( |
R5549 | T6440 | T6439 | arg1Of | determine,To |
R5550 | T6442 | T6440 | arg2Of | specificity,determine |
R5551 | T6442 | T6441 | arg1Of | specificity,the |
R5552 | T6442 | T6443 | arg1Of | specificity,of |
R5553 | T6445 | T6443 | arg2Of | antibodies,of |
R5554 | T6445 | T6444 | arg1Of | antibodies,the |
R5555 | T6449 | T6447 | arg1Of | immunoglobulin,rabbit |
R5556 | T6449 | T6448 | arg1Of | immunoglobulin,serum |
R5557 | T6449 | T6450 | arg1Of | immunoglobulin,( |
R5558 | T6449 | T6453 | arg1Of | immunoglobulin,and |
R5559 | T6451 | T6450 | arg2Of | Dako,( |
R5560 | T6452 | T6450 | arg3Of | ),( |
R5561 | T6453 | T6456 | arg1Of | and,without |
R5562 | T6453 | T6459 | arg1Of | and,were |
R5563 | T6453 | T6460 | arg2Of | and,used |
R5564 | T6455 | T6453 | arg2Of | antibodies,and |
R5565 | T6455 | T6454 | arg1Of | antibodies,secondary |
R5566 | T6458 | T6456 | arg2Of | primary,without |
R5567 | T6458 | T6457 | arg1Of | primary,the |
R5568 | T6460 | T6439 | modOf | used,To |
R5569 | T6460 | T6446 | arg1Of | used,"," |
R5570 | T6460 | T6459 | arg2Of | used,were |
R5571 | T6460 | T6461 | arg1Of | used,as |
R5572 | T6462 | T6461 | arg2Of | controls,as |
R5573 | T6464 | T6463 | arg1Of | stained,Positively |
R5574 | T6465 | T6464 | arg1Of | nuclei,stained |
R5575 | T6465 | T6466 | arg1Of | nuclei,and |
R5576 | T6466 | T6469 | arg1Of | and,were |
R5577 | T6466 | T6470 | arg2Of | and,counted |
R5578 | T6468 | T6466 | arg2Of | cells,and |
R5579 | T6468 | T6467 | arg1Of | cells,total |
R5580 | T6470 | T6469 | arg2Of | counted,were |
R5581 | T6470 | T6471 | arg1Of | counted,( |
R5582 | T6470 | T6474 | arg1Of | counted,on |
R5583 | T6472 | T6471 | arg2Of | 500,( |
R5584 | T6473 | T6471 | arg3Of | ),( |
R5585 | T6476 | T6474 | arg2Of | slide,on |
R5586 | T6476 | T6475 | arg1Of | slide,each |
R5587 | T6476 | T6477 | arg1Of | slide,with |
R5588 | T6479 | T6477 | arg2Of | observer,with |
R5589 | T6479 | T6478 | arg1Of | observer,the |
R5590 | T6479 | T6480 | arg2Of | observer,blinded |
R5591 | T6480 | T6481 | arg1Of | blinded,to |
R5592 | T6483 | T6481 | arg2Of | treatment,to |
R5593 | T6483 | T6482 | arg1Of | treatment,the |
R5815 | T6780 | T6779 | arg1Of | Construct,GATA-3-GFP |
R5816 | T6785 | T6784 | arg2Of | BC003070,( |
R5817 | T6786 | T6784 | arg3Of | ),( |
R5818 | T6788 | T6781 | arg1Of | cDNA,The |
R5819 | T6788 | T6782 | arg1Of | cDNA,GATA-3 |
R5820 | T6788 | T6783 | arg1Of | cDNA,clone |
R5821 | T6788 | T6784 | arg1Of | cDNA,( |
R5822 | T6788 | T6787 | arg1Of | cDNA,complete |
R5823 | T6788 | T6789 | arg1Of | cDNA,was |
R5824 | T6788 | T6790 | arg2Of | cDNA,obtained |
R5825 | T6790 | T6789 | arg2Of | obtained,was |
R5826 | T6790 | T6791 | arg1Of | obtained,from |
R5827 | T6790 | T6795 | arg1Of | obtained,as |
R5828 | T6794 | T6791 | arg2Of | Technologies,from |
R5829 | T6794 | T6792 | arg1Of | Technologies,Invitrogen |
R5830 | T6794 | T6793 | arg1Of | Technologies,Life |
R5831 | T6799 | T6795 | arg2Of | insert,as |
R5832 | T6799 | T6796 | arg1Of | insert,a |
R5833 | T6799 | T6797 | arg1Of | insert,5′- |
R5834 | T6799 | T6798 | arg1Of | insert,EcoRI/3′-XhoI |
R5835 | T6799 | T6800 | arg1Of | insert,of |
R5836 | T6799 | T6802 | arg1Of | insert,in |
R5837 | T6801 | T6800 | arg2Of | GATA-3,of |
R5838 | T6805 | T6802 | arg2Of | vector,in |
R5839 | T6805 | T6803 | arg1Of | vector,the |
R5840 | T6805 | T6804 | arg1Of | vector,pOTB7 |
R5841 | T6806 | T6807 | arg1Of | GATA-3,was |
R5842 | T6806 | T6808 | arg2Of | GATA-3,excised |
R5843 | T6808 | T6807 | arg2Of | excised,was |
R5844 | T6808 | T6809 | arg1Of | excised,from |
R5845 | T6810 | T6809 | arg2Of | pOTB7,from |
R5846 | T6813 | T6811 | arg1Of | digestion,using |
R5847 | T6813 | T6812 | arg1Of | digestion,XhoI |
R5848 | T6813 | T6814 | arg1Of | digestion,and |
R5849 | T6814 | T6823 | arg1Of | and,was |
R5850 | T6814 | T6824 | arg2Of | and,digested |
R5851 | T6815 | T6814 | arg2Of | pEGFP-C2,and |
R5852 | T6815 | T6816 | arg1Of | pEGFP-C2,( |
R5853 | T6817 | T6818 | arg1Of | Clontech,"," |
R5854 | T6818 | T6820 | arg1Of | ",","," |
R5855 | T6819 | T6818 | arg2Of | Saint-Germain-en-Laye,"," |
R5856 | T6820 | T6816 | arg2Of | ",",( |
R5857 | T6821 | T6820 | arg2Of | France,"," |
R5858 | T6822 | T6816 | arg3Of | ),( |
R5859 | T6824 | T6807 | modOf | digested,was |
R5860 | T6824 | T6823 | arg2Of | digested,was |
R5861 | T6824 | T6825 | arg1Of | digested,with |
R5862 | T6826 | T6825 | arg2Of | BamHI,with |
R5863 | T6827 | T6828 | arg1Of | DNA,was |
R5864 | T6827 | T6829 | arg2Of | DNA,recovered |
R5865 | T6829 | T6828 | arg2Of | recovered,was |
R5866 | T6832 | T6831 | arg1Of | extraction,phenol |
R5867 | T6832 | T6833 | arg1Of | extraction,and |
R5868 | T6833 | T6829 | arg1Of | and,recovered |
R5869 | T6833 | T6830 | arg2Of | and,by |
R5870 | T6835 | T6833 | arg2Of | precipitation,and |
R5871 | T6835 | T6834 | arg1Of | precipitation,ethanol |
R5872 | T6837 | T6836 | arg1Of | and,"," |
R5873 | T6841 | T6839 | arg1Of | fragment,the |
R5874 | T6841 | T6840 | arg1Of | fragment,GATA-3 |
R5875 | T6841 | T6842 | arg1Of | fragment,and |
R5876 | T6842 | T6838 | arg1Of | and,both |
R5877 | T6845 | T6842 | arg2Of | vector,and |
R5878 | T6845 | T6843 | arg1Of | vector,the |
R5879 | T6845 | T6844 | arg1Of | vector,pEGFP-C2 |
R5880 | T6845 | T6846 | arg1Of | vector,blunt-ended |
R5881 | T6848 | T6847 | arg2Of | incubation,by |
R5882 | T6850 | T6849 | arg2Of | Klenow,with |
R5883 | T6852 | T6851 | arg2Of | Bioline,( |
R5884 | T6852 | T6853 | arg1Of | Bioline,Bio-27029 |
R5885 | T6854 | T6851 | arg3Of | ),( |
R5886 | T6857 | T6855 | arg2Of | min,for |
R5887 | T6857 | T6856 | arg1Of | min,30 |
R5888 | T6860 | T6859 | arg1Of | Klenow,37°C. |
R5889 | T6860 | T6861 | arg1Of | Klenow,was |
R5890 | T6860 | T6862 | arg2Of | Klenow,inactivated |
R5891 | T6862 | T6861 | arg2Of | inactivated,was |
R5892 | T6862 | T6863 | arg1Of | inactivated,by |
R5893 | T6864 | T6863 | arg2Of | incubation,by |
R5894 | T6864 | T6865 | arg1Of | incubation,for |
R5895 | T6867 | T6865 | arg2Of | min,for |
R5896 | T6867 | T6866 | arg1Of | min,10 |
R5897 | T6867 | T6868 | arg1Of | min,at |
R5898 | T6870 | T6868 | arg2Of | DNA,at |
R5899 | T6870 | T6869 | arg1Of | DNA,75°C. |
R5900 | T6872 | T6871 | arg2Of | recovered,was |
R5901 | T6875 | T6874 | arg1Of | extraction,phenol |
R5902 | T6875 | T6876 | arg1Of | extraction,and |
R5903 | T6876 | T6872 | arg1Of | and,recovered |
R5904 | T6876 | T6873 | arg2Of | and,by |
R5905 | T6878 | T6876 | arg2Of | precipitation,and |
R5906 | T6878 | T6877 | arg1Of | precipitation,ethanol |
R5907 | T6880 | T6879 | arg1Of | and,"," |
R5908 | T6885 | T6882 | arg1Of | fragment,the |
R5909 | T6885 | T6883 | arg1Of | fragment,blunt-ended |
R5910 | T6885 | T6884 | arg1Of | fragment,GATA-3 |
R5911 | T6885 | T6886 | arg1Of | fragment,and |
R5912 | T6886 | T6881 | arg1Of | and,both |
R5913 | T6886 | T6890 | arg1Of | and,were |
R5914 | T6886 | T6892 | arg2Of | and,digested |
R5915 | T6889 | T6886 | arg2Of | vector,and |
R5916 | T6889 | T6887 | arg1Of | vector,the |
R5917 | T6889 | T6888 | arg1Of | vector,GFP |
R5918 | T6892 | T6880 | arg2Of | digested,and |
R5919 | T6892 | T6890 | arg2Of | digested,were |
R5920 | T6892 | T6891 | arg1Of | digested,subsequently |
R5921 | T6892 | T6893 | arg1Of | digested,with |
R5922 | T6892 | T6895 | arg1Of | digested,before |
R5923 | T6894 | T6893 | arg2Of | EcoRI,with |
R5924 | T6900 | T6896 | arg1Of | fragment,the |
R5925 | T6900 | T6897 | arg1Of | fragment,5′-EcoRI/3′–blunt |
R5926 | T6900 | T6898 | arg1Of | fragment,end |
R5927 | T6900 | T6899 | arg1Of | fragment,GATA-3 |
R5928 | T6900 | T6901 | arg1Of | fragment,was |
R5929 | T6900 | T6902 | arg2Of | fragment,inserted |
R5930 | T6902 | T6895 | arg2Of | inserted,before |
R5931 | T6902 | T6901 | arg2Of | inserted,was |
R5932 | T6902 | T6903 | arg1Of | inserted,into |
R5933 | T6906 | T6905 | arg1Of | ended,5′-EcoRI/3′–blunt |
R5934 | T6908 | T6903 | arg2Of | vector,into |
R5935 | T6908 | T6904 | arg1Of | vector,the |
R5936 | T6908 | T6906 | arg1Of | vector,ended |
R5937 | T6908 | T6907 | arg1Of | vector,GFP |
R5938 | T6910 | T6909 | arg1Of | clones,Positive |
R5939 | T6910 | T6911 | arg1Of | clones,were |
R5940 | T6910 | T6912 | arg2Of | clones,confirmed |
R5941 | T6912 | T6911 | arg2Of | confirmed,were |
R5942 | T6912 | T6918 | arg1Of | confirmed,by |
R5943 | T6912 | T6925 | arg1Of | confirmed,by |
R5944 | T6914 | T6915 | arg1Of | digestion,and |
R5945 | T6916 | T6915 | arg2Of | size,and |
R5946 | T6917 | T6912 | arg1Of | analysis,confirmed |
R5947 | T6917 | T6913 | arg2Of | analysis,by |
R5948 | T6917 | T6914 | arg1Of | analysis,digestion |
R5949 | T6917 | T6916 | arg1Of | analysis,size |
R5950 | T6918 | T6924 | arg1Of | by,and |
R5951 | T6919 | T6920 | arg1Of | 1,% |
R5952 | T6923 | T6918 | arg2Of | electrophoresis,by |
R5953 | T6923 | T6919 | arg1Of | electrophoresis,1 |
R5954 | T6923 | T6921 | arg1Of | electrophoresis,agarose |
R5955 | T6923 | T6922 | arg1Of | electrophoresis,gel |
R5956 | T6925 | T6924 | arg2Of | by,and |
R5957 | T6926 | T6925 | arg2Of | sequencing,by |
R6131 | T7174 | T7173 | arg1Of | cells,HuT-78 |
R6132 | T7174 | T7175 | arg1Of | cells,were |
R6133 | T7174 | T7176 | arg2Of | cells,transfected |
R6134 | T7176 | T7175 | arg2Of | transfected,were |
R6135 | T7176 | T7177 | arg1Of | transfected,with |
R6136 | T7179 | T7180 | arg1Of | EP8,or |
R6137 | T7180 | T7177 | arg2Of | or,with |
R6138 | T7180 | T7178 | arg1Of | or,either |
R6139 | T7182 | T7180 | arg2Of | vector,or |
R6140 | T7182 | T7181 | arg1Of | vector,GFP |
R6141 | T7184 | T7183 | arg1Of | DNA,only |
R6142 | T7184 | T7185 | arg1Of | DNA,using |
R6143 | T7184 | T7197 | arg1Of | DNA,µg |
R6144 | T7187 | T7185 | arg2Of | R,using |
R6145 | T7187 | T7186 | arg1Of | R,solution |
R6146 | T7187 | T7188 | arg1Of | R,"," |
R6147 | T7190 | T7188 | arg2Of | V-001,"," |
R6148 | T7190 | T7189 | arg1Of | V-001,programme |
R6149 | T7190 | T7191 | arg1Of | V-001,at |
R6150 | T7193 | T7191 | arg2Of | ratio,at |
R6151 | T7193 | T7192 | arg1Of | ratio,a |
R6152 | T7193 | T7194 | arg1Of | ratio,of |
R6153 | T7196 | T7194 | arg2Of | cells/4,of |
R6154 | T7196 | T7195 | arg1Of | cells/4,3×106 |
R6155 | T7197 | T7175 | modOf | µg,were |
R6156 | T7197 | T7199 | arg1Of | µg,for |
R6157 | T7197 | T7202 | arg1Of | µg,in |
R6158 | T7197 | T7214 | arg1Of | µg,according |
R6159 | T7198 | T7197 | arg2Of | DNA,µg |
R6160 | T7201 | T7199 | arg2Of | h,for |
R6161 | T7201 | T7200 | arg1Of | h,7–8 |
R6162 | T7204 | T7202 | arg2Of | medium,in |
R6163 | T7204 | T7203 | arg1Of | medium,complete |
R6164 | T7204 | T7205 | arg1Of | medium,( |
R6165 | T7206 | T7207 | arg1Of | 10,% |
R6166 | T7209 | T7205 | arg2Of | serum,( |
R6167 | T7209 | T7206 | arg1Of | serum,10 |
R6168 | T7209 | T7208 | arg1Of | serum,bovine |
R6169 | T7209 | T7210 | arg1Of | serum,in |
R6170 | T7212 | T7210 | arg2Of | L-glutamine,in |
R6171 | T7212 | T7211 | arg1Of | L-glutamine,RPMI1640+15 |
R6172 | T7213 | T7205 | arg3Of | ),( |
R6173 | T7215 | T7214 | arg2Of | to,according |
R6174 | T7219 | T7215 | arg2Of | protocol,to |
R6175 | T7219 | T7216 | arg1Of | protocol,the |
R6176 | T7219 | T7217 | arg1Of | protocol,general |
R6177 | T7219 | T7218 | arg1Of | protocol,Amaxa |
R6178 | T7219 | T7220 | arg1Of | protocol,for |
R6179 | T7221 | T7220 | arg2Of | nucleofection,for |
R6180 | T7223 | T7222 | arg1Of | medium,The |
R6181 | T7223 | T7224 | arg1Of | medium,was |
R6182 | T7223 | T7226 | arg2Of | medium,changed |
R6183 | T7226 | T7224 | arg2Of | changed,was |
R6184 | T7226 | T7225 | arg1Of | changed,subsequently |
R6185 | T7226 | T7227 | arg1Of | changed,to |
R6186 | T7226 | T7231 | arg1Of | changed,for |
R6187 | T7228 | T7229 | arg1Of | 1,% |
R6188 | T7230 | T7227 | arg2Of | RPMI,to |
R6189 | T7230 | T7228 | arg1Of | RPMI,1 |
R6190 | T7233 | T7232 | arg1Of | h,24 |
R6191 | T7233 | T7234 | arg1Of | h,before |
R6192 | T7233 | T7243 | arg1Of | h,and |
R6193 | T7236 | T7235 | arg2Of | cells,transfected |
R6194 | T7236 | T7237 | arg1Of | cells,were |
R6195 | T7236 | T7238 | arg2Of | cells,added |
R6196 | T7238 | T7234 | arg2Of | added,before |
R6197 | T7238 | T7237 | arg2Of | added,were |
R6198 | T7238 | T7239 | arg1Of | added,to |
R6199 | T7242 | T7239 | arg2Of | wells,to |
R6200 | T7242 | T7240 | arg1Of | wells,anti-CD3/CD28 |
R6201 | T7242 | T7241 | arg2Of | wells,treated |
R6202 | T7243 | T7231 | arg2Of | and,for |
R6203 | T7246 | T7243 | arg2Of | videomicroscopy,and |
R6204 | T7246 | T7244 | arg1Of | videomicroscopy,live |
R6205 | T7246 | T7245 | arg1Of | videomicroscopy,cell |
R6206 | T7246 | T7247 | arg2Of | videomicroscopy,performed |
R6294 | T7358 | T7357 | arg1Of | Microscopy,Time-Lapse |
R6295 | T7360 | T7359 | arg1Of | cells,HuT-78 |
R6296 | T7360 | T7361 | arg1Of | cells,expressing |
R6297 | T7360 | T7363 | arg1Of | cells,were |
R6298 | T7360 | T7364 | arg2Of | cells,maintained |
R6299 | T7362 | T7361 | arg2Of | GATA-3-GFP,expressing |
R6300 | T7364 | T7363 | arg2Of | maintained,were |
R6301 | T7364 | T7365 | arg1Of | maintained,at |
R6302 | T7364 | T7367 | arg1Of | maintained,in |
R6303 | T7366 | T7365 | arg2Of | 37°C,at |
R6304 | T7369 | T7367 | arg2Of | medium,in |
R6305 | T7369 | T7368 | arg1Of | medium,growth |
R6306 | T7369 | T7370 | arg1Of | medium,in |
R6307 | T7369 | T7376 | arg1Of | medium,( |
R6308 | T7369 | T7385 | arg2Of | medium,combined |
R6309 | T7375 | T7370 | arg2Of | chamber,in |
R6310 | T7375 | T7371 | arg1Of | chamber,a |
R6311 | T7375 | T7372 | arg1Of | chamber,closed |
R6312 | T7375 | T7373 | arg1Of | chamber,FCS2 |
R6313 | T7375 | T7374 | arg1Of | chamber,perfusion |
R6314 | T7377 | T7378 | arg1Of | Bioptechs,"," |
R6315 | T7378 | T7380 | arg1Of | ",","," |
R6316 | T7379 | T7378 | arg2Of | Butler,"," |
R6317 | T7380 | T7376 | arg2Of | ",",( |
R6318 | T7380 | T7382 | arg1Of | ",","," |
R6319 | T7380 | T7383 | arg1Of | ",",USA |
R6320 | T7381 | T7380 | arg2Of | Pennsylvania,"," |
R6321 | T7384 | T7376 | arg3Of | ),( |
R6322 | T7385 | T7386 | arg1Of | combined,with |
R6323 | T7385 | T7393 | arg1Of | combined,on |
R6324 | T7385 | T7401 | arg1Of | combined,( |
R6325 | T7389 | T7386 | arg2Of | heater,with |
R6326 | T7389 | T7387 | arg1Of | heater,an |
R6327 | T7389 | T7388 | arg1Of | heater,objective |
R6328 | T7389 | T7390 | arg1Of | heater,( |
R6329 | T7391 | T7390 | arg2Of | Bioptechs,( |
R6330 | T7392 | T7390 | arg3Of | ),( |
R6331 | T7395 | T7393 | arg2Of | stage,on |
R6332 | T7395 | T7394 | arg1Of | stage,the |
R6333 | T7398 | T7397 | arg1Of | Axiovert,Zeiss |
R6334 | T7398 | T7399 | arg1Of | Axiovert,200 |
R6335 | T7400 | T7393 | arg3Of | microscope,on |
R6336 | T7400 | T7396 | arg1Of | microscope,a |
R6337 | T7400 | T7398 | arg1Of | microscope,Axiovert |
R6338 | T7402 | T7401 | arg2Of | Thornwood,( |
R6339 | T7402 | T7403 | arg1Of | Thornwood,"," |
R6340 | T7405 | T7403 | arg2Of | York,"," |
R6341 | T7405 | T7404 | arg1Of | York,New |
R6342 | T7405 | T7406 | arg1Of | York,"," |
R6343 | T7407 | T7406 | arg2Of | USA,"," |
R6344 | T7408 | T7401 | arg3Of | ),( |
R6345 | T7409 | T7410 | arg1Of | Observations,were |
R6346 | T7409 | T7411 | arg2Of | Observations,made |
R6347 | T7411 | T7410 | arg2Of | made,were |
R6348 | T7411 | T7419 | arg1Of | made,and |
R6349 | T7417 | T7411 | arg1Of | lens,made |
R6350 | T7417 | T7412 | arg2Of | lens,by |
R6351 | T7417 | T7413 | arg1Of | lens,40×1.0 |
R6352 | T7417 | T7414 | arg1Of | lens,NA |
R6353 | T7417 | T7415 | arg1Of | lens,oil-immersion |
R6354 | T7417 | T7416 | arg1Of | lens,objective |
R6355 | T7419 | T7418 | arg1Of | and,"," |
R6356 | T7420 | T7421 | arg1Of | fluorescence,and |
R6357 | T7422 | T7421 | arg2Of | phase,and |
R6358 | T7424 | T7420 | arg1Of | images,fluorescence |
R6359 | T7424 | T7422 | arg1Of | images,phase |
R6360 | T7424 | T7423 | arg1Of | images,contrast |
R6361 | T7424 | T7425 | arg1Of | images,were |
R6362 | T7424 | T7426 | arg2Of | images,gathered |
R6363 | T7426 | T7419 | arg2Of | gathered,and |
R6364 | T7426 | T7425 | arg2Of | gathered,were |
R6365 | T7426 | T7427 | modOf | gathered,using |
R6366 | T7427 | T7431 | arg2Of | using,charged |
R6367 | T7430 | T7428 | arg1Of | ORCA-ER,a |
R6368 | T7430 | T7429 | arg1Of | ORCA-ER,Hamamatsu |
R6369 | T7430 | T7431 | arg1Of | ORCA-ER,charged |
R6370 | T7434 | T7427 | arg2Of | camera,using |
R6371 | T7434 | T7432 | arg2Of | camera,coupled |
R6372 | T7434 | T7433 | arg1Of | camera,device |
R6373 | T7434 | T7435 | arg1Of | camera,( |
R6374 | T7434 | T7443 | arg2Of | camera,driven |
R6375 | T7436 | T7435 | arg2Of | Bridgewater,( |
R6376 | T7436 | T7437 | arg1Of | Bridgewater,"," |
R6377 | T7439 | T7437 | arg2Of | Jersey,"," |
R6378 | T7439 | T7438 | arg1Of | Jersey,New |
R6379 | T7439 | T7440 | arg1Of | Jersey,"," |
R6380 | T7441 | T7440 | arg2Of | USA,"," |
R6381 | T7442 | T7435 | arg3Of | ),( |
R6382 | T7443 | T7447 | arg1Of | driven,( |
R6383 | T7446 | T7443 | arg1Of | software,driven |
R6384 | T7446 | T7444 | arg2Of | software,by |
R6385 | T7446 | T7445 | arg1Of | software,Openlab |
R6386 | T7448 | T7449 | arg1Of | Improvision,"," |
R6387 | T7449 | T7447 | arg2Of | ",",( |
R6388 | T7449 | T7451 | arg1Of | ",","," |
R6389 | T7450 | T7449 | arg2Of | Coventry,"," |
R6390 | T7452 | T7451 | arg2Of | UK,"," |
R6391 | T7453 | T7447 | arg3Of | ),( |
R6392 | T7454 | T7455 | arg1Of | Photographs,were |
R6393 | T7454 | T7456 | arg2Of | Photographs,taken |
R6394 | T7456 | T7455 | arg2Of | taken,were |
R6395 | T7456 | T7457 | arg1Of | taken,at |
R6396 | T7458 | T7459 | arg1Of | 0,"," |
R6397 | T7459 | T7461 | arg1Of | ",","," |
R6398 | T7460 | T7459 | arg2Of | 30,"," |
R6399 | T7461 | T7463 | arg1Of | ",","," |
R6400 | T7462 | T7461 | arg2Of | 60,"," |
R6401 | T7463 | T7466 | arg1Of | ",",and |
R6402 | T7464 | T7463 | arg2Of | 120,"," |
R6403 | T7466 | T7465 | arg1Of | and,"," |
R6404 | T7467 | T7466 | arg2Of | 240,and |
R6405 | T7468 | T7457 | arg2Of | min,at |
R6406 | T7468 | T7458 | arg1Of | min,0 |
R6407 | T7468 | T7460 | arg1Of | min,30 |
R6408 | T7468 | T7462 | arg1Of | min,60 |
R6409 | T7468 | T7464 | arg1Of | min,120 |
R6410 | T7468 | T7467 | arg1Of | min,240 |
R6533 | T7612 | T7611 | arg1Of | Analysis,Densitometric |
R6534 | T7613 | T7614 | arg1Of | Densitometry,of |
R6535 | T7613 | T7617 | arg1Of | Densitometry,was |
R6536 | T7613 | T7618 | arg2Of | Densitometry,performed |
R6537 | T7616 | T7614 | arg2Of | immunoblots,of |
R6538 | T7616 | T7615 | arg1Of | immunoblots,ECL |
R6539 | T7618 | T7617 | arg2Of | performed,was |
R6540 | T7619 | T7618 | arg3Of | using,performed |
R6541 | T7621 | T7620 | arg1Of | ID,Gelworks |
R6542 | T7623 | T7619 | arg2Of | software,using |
R6543 | T7623 | T7621 | arg1Of | software,ID |
R6544 | T7623 | T7622 | arg1Of | software,intermediate |
R6545 | T7623 | T7624 | arg1Of | software,( |
R6546 | T7626 | T7624 | arg2Of | Products,( |
R6547 | T7626 | T7625 | arg1Of | Products,Ultraviolet |
R6548 | T7626 | T7627 | arg1Of | Products,"," |
R6549 | T7628 | T7627 | arg2Of | Cambridgeshire,"," |
R6550 | T7628 | T7629 | arg1Of | Cambridgeshire,"," |
R6551 | T7630 | T7629 | arg2Of | UK,"," |
R6552 | T7631 | T7624 | arg3Of | ),( |
R6553 | T7634 | T7635 | arg1Of | immunoblots,were |
R6554 | T7634 | T7636 | arg2Of | immunoblots,scanned |
R6555 | T7636 | T7635 | arg2Of | scanned,were |
R6556 | T7636 | T7637 | arg1Of | scanned,and |
R6557 | T7637 | T7632 | arg1Of | and,Briefly |
R6558 | T7637 | T7633 | arg1Of | and,"," |
R6559 | T7638 | T7639 | arg1Of | gates,were |
R6560 | T7638 | T7640 | arg2Of | gates,drawn |
R6561 | T7640 | T7637 | arg2Of | drawn,and |
R6562 | T7640 | T7639 | arg2Of | drawn,were |
R6563 | T7640 | T7641 | arg1Of | drawn,tightly |
R6564 | T7640 | T7642 | arg1Of | drawn,around |
R6565 | T7644 | T7642 | arg2Of | band,around |
R6566 | T7644 | T7643 | arg1Of | band,each |
R6567 | T7646 | T7645 | arg1Of | values,Background |
R6568 | T7646 | T7647 | arg1Of | values,from |
R6572 | T7649 | T7647 | arg2Of | lane,from |
R6604 | T7679 | T7686 | arg2Of | films,selected |
R6605 | T7682 | T7680 | arg2Of | levels,generating |
R6606 | T7682 | T7681 | arg1Of | levels,subsaturating |
R6607 | T7682 | T7683 | arg1Of | levels,of |
R6608 | T7684 | T7683 | arg2Of | intensity,of |
R6609 | T7686 | T7677 | arg2Of | selected,and |
R6610 | T7686 | T7685 | arg2Of | selected,were |
R6611 | T7686 | T7687 | arg1Of | selected,for |
R6612 | T7689 | T7687 | arg2Of | evaluation,for |
R6613 | T7689 | T7688 | arg1Of | evaluation,densitometric |
R6698 | T7788 | T7787 | arg1Of | Analysis,Statistical |
R6699 | T7789 | T7790 | arg1Of | Data,from |
R6700 | T7789 | T7796 | arg1Of | Data,are |
R6701 | T7789 | T7797 | arg2Of | Data,presented |
R6702 | T7789 | T7813 | arg1Of | Data,were |
R6703 | T7789 | T7814 | arg2Of | Data,compared |
R6704 | T7789 | T7815 | arg1Of | Data,using |
R6705 | T7791 | T7792 | arg1Of | three,or |
R6706 | T7791 | T7793 | arg1Of | three,more |
R6707 | T7795 | T7790 | arg2Of | experiments,from |
R6708 | T7795 | T7791 | arg1Of | experiments,three |
R6709 | T7795 | T7794 | arg1Of | experiments,independent |
R6710 | T7797 | T7796 | arg2Of | presented,are |
R6711 | T7797 | T7798 | arg1Of | presented,as |
R6712 | T7797 | T7812 | arg1Of | presented,and |
R6713 | T7801 | T7798 | arg2Of | error,as |
R6714 | T7801 | T7799 | arg1Of | error,the |
R6715 | T7801 | T7800 | arg1Of | error,mean±standard |
R6716 | T7801 | T7802 | arg1Of | error,of |
R6717 | T7801 | T7808 | arg1Of | error,"," |
R6718 | T7801 | T7809 | arg1Of | error,except |
R6719 | T7801 | T7811 | arg2Of | error,stated |
R6720 | T7804 | T7802 | arg2Of | mean,of |
R6721 | T7804 | T7803 | arg1Of | mean,the |
R6722 | T7804 | T7805 | arg1Of | mean,( |
R6723 | T7806 | T7805 | arg2Of | SEM,( |
R6724 | T7807 | T7805 | arg3Of | ),( |
R6725 | T7811 | T7810 | arg1Of | stated,where |
R6726 | T7814 | T7812 | arg2Of | compared,and |
R6727 | T7814 | T7813 | arg2Of | compared,were |
R6728 | T7815 | T7814 | arg3Of | using,compared |
R6729 | T7815 | T7821 | arg1Of | using,Software |
R6730 | T7815 | T7825 | arg1Of | using,//www.graphpad.com |
R6731 | T7817 | T7815 | arg2Of | Prism,using |
R6732 | T7817 | T7816 | arg1Of | Prism,GraphPad |
R6733 | T7817 | T7818 | arg1Of | Prism,4 |
R6734 | T7821 | T7820 | arg1Of | Software,GraphPad |
R6735 | T7821 | T7822 | arg1Of | Software,"," |
R6736 | T7822 | T7819 | arg1Of | ",",( |
R6737 | T7822 | T7826 | arg1Of | ",",) |
R6738 | T7823 | T7824 | arg1Of | http,: |
R6739 | T7825 | T7822 | arg2Of | //www.graphpad.com,"," |
R6740 | T7825 | T7823 | arg1Of | //www.graphpad.com,http |
R6741 | T7827 | T7828 | arg1Of | Results,were |
R6742 | T7827 | T7829 | arg2Of | Results,analysed |
R6743 | T7829 | T7828 | arg2Of | analysed,were |
R6744 | T7829 | T7830 | modOf | analysed,using |
R6745 | T7830 | T7833 | arg1Of | using,with |
R6746 | T7832 | T7830 | arg2Of | ANOVA,using |
R6747 | T7832 | T7831 | arg1Of | ANOVA,one-way |
R6748 | T7834 | T7833 | arg2Of | Newman-Keuls,with |
R6749 | T7836 | T7835 | arg1Of | test,post |
R6750 | T7836 | T7837 | arg1Of | test,except |
R6751 | T7836 | T7859 | arg2Of | test,matched |
R6752 | T7836 | T7861 | arg2Of | test,signed |
R6753 | T7837 | T7838 | arg1Of | except,for |
R6754 | T7840 | T7839 | arg1Of | data,the |
R6755 | T7840 | T7841 | arg1Of | data,from |
R6756 | T7840 | T7859 | arg1Of | data,matched |
R6757 | T7844 | T7843 | arg1Of | vivo,in |
R6758 | T7845 | T7844 | arg1Of | inhaled,vivo |
R6759 | T7847 | T7841 | arg2Of | study,from |
R6760 | T7847 | T7842 | arg1Of | study,the |
R6761 | T7847 | T7845 | arg1Of | study,inhaled |
R6762 | T7847 | T7846 | arg1Of | study,FP |
R6763 | T7847 | T7848 | arg1Of | study,"," |
R6764 | T7847 | T7849 | arg1Of | study,which |
R6765 | T7847 | T7850 | arg1Of | study,was |
R6766 | T7847 | T7851 | arg2Of | study,analysed |
R6767 | T7851 | T7850 | arg2Of | analysed,was |
R6768 | T7853 | T7854 | arg2Of | Friedman,'s |
R6769 | T7855 | T7851 | arg1Of | test,analysed |
R6770 | T7855 | T7852 | arg2Of | test,by |
R6771 | T7855 | T7854 | arg1Of | test,'s |
R6772 | T7855 | T7856 | arg1Of | test,with |
R6773 | T7858 | T7856 | arg2Of | Wilcoxson,with |
R6774 | T7858 | T7857 | arg1Of | Wilcoxson,subsequent |
R6775 | T7860 | T7861 | arg1Of | pair,signed |
R6776 | T7861 | T7828 | modOf | signed,were |
R6777 | T7864 | T7861 | arg3Of | test,signed |
R6778 | T7864 | T7862 | arg1Of | test,rank |
R6779 | T7864 | T7863 | arg1Of | test,sum |
R6780 | T7865 | T7866 | arg1Of | Data,from |
R6781 | T7865 | T7869 | arg1Of | Data,are |
R6782 | T7865 | T7870 | arg2Of | Data,presented |
R6783 | T7868 | T7866 | arg2Of | analysis,from |
R6784 | T7868 | T7867 | arg1Of | analysis,this |
R6785 | T7870 | T7869 | arg2Of | presented,are |
R6786 | T7870 | T7871 | arg1Of | presented,as |
R6787 | T7874 | T7871 | arg2Of | plot,as |
R6788 | T7874 | T7872 | arg1Of | plot,a |
R6789 | T7874 | T7873 | arg1Of | plot,box-and-whiskers |
R6790 | T7875 | T7876 | arg2Of | Friedman,'s |
R6791 | T7877 | T7876 | arg1Of | test,'s |
R6792 | T7877 | T7878 | arg1Of | test,was |
R6793 | T7877 | T7879 | arg2Of | test,used |
R6794 | T7879 | T7878 | arg2Of | used,was |
R6795 | T7879 | T7880 | arg1Of | used,as |
R6796 | T7883 | T7881 | arg1Of | measures,three |
R6797 | T7883 | T7882 | arg1Of | measures,matched |
R6798 | T7883 | T7884 | arg1Of | measures,were |
R6799 | T7883 | T7885 | arg2Of | measures,obtained |
R6800 | T7883 | T7886 | arg1Of | measures,using |
R6801 | T7885 | T7880 | arg2Of | obtained,as |
R6802 | T7885 | T7884 | arg2Of | obtained,were |
R6803 | T7886 | T7885 | arg3Of | using,obtained |
R6804 | T7887 | T7888 | arg1Of | placebo,"," |
R6805 | T7888 | T7892 | arg1Of | ",",and |
R6806 | T7890 | T7888 | arg2Of | µg,"," |
R6807 | T7890 | T7889 | arg1Of | µg,100 |
R6808 | T7892 | T7886 | arg2Of | and,using |
R6809 | T7892 | T7891 | arg1Of | and,"," |
R6810 | T7894 | T7892 | arg2Of | µg,and |
R6811 | T7894 | T7893 | arg1Of | µg,500 |
R6812 | T7894 | T7895 | arg1Of | µg,of |
R6813 | T7894 | T7898 | arg1Of | µg,"," |
R6814 | T7894 | T7899 | arg1Of | µg,which |
R6815 | T7894 | T7900 | arg1Of | µg,had |
R6816 | T7897 | T7895 | arg2Of | FP,of |
R6817 | T7897 | T7896 | arg2Of | FP,inhaled |
R6818 | T7903 | T7900 | arg2Of | levels,had |
R6819 | T7903 | T7901 | arg1Of | levels,variable |
R6820 | T7903 | T7902 | arg1Of | levels,baseline |
R6821 | T7904 | T7905 | arg1Of | We,did |
R6822 | T7904 | T7907 | arg1Of | We,assume |
R6823 | T7907 | T7905 | arg2Of | assume,did |
R6824 | T7907 | T7906 | arg1Of | assume,not |
R6825 | T7910 | T7907 | arg2Of | distribution,assume |
R6826 | T7910 | T7908 | arg1Of | distribution,a |
R6827 | T7910 | T7909 | arg1Of | distribution,Gaussian |
R6828 | T7910 | T7911 | arg1Of | distribution,of |
R6829 | T7910 | T7922 | arg1Of | distribution,( |
R6830 | T7913 | T7911 | arg2Of | data,of |
R6831 | T7913 | T7912 | arg1Of | data,the |
R6832 | T7913 | T7914 | arg1Of | data,due |
R6833 | T7914 | T7915 | arg1Of | due,to |
R6834 | T7918 | T7915 | arg2Of | numbers,to |
R6835 | T7918 | T7916 | arg1Of | numbers,the |
R6836 | T7918 | T7917 | arg1Of | numbers,limited |
R6837 | T7918 | T7919 | arg1Of | numbers,of |
R6838 | T7920 | T7919 | arg2Of | participants,of |
R6839 | T7920 | T7921 | arg2Of | participants,analysed |
R6840 | T7923 | T7922 | arg2Of | seven,( |
R6841 | T7924 | T7922 | arg3Of | ),( |
R6842 | T7927 | T7925 | arg1Of | hypothesis,.The |
R6843 | T7927 | T7926 | arg1Of | hypothesis,null |
R6844 | T7927 | T7928 | arg1Of | hypothesis,was |
R6845 | T7927 | T7929 | arg2Of | hypothesis,rejected |
R6846 | T7929 | T7907 | arg3Of | rejected,assume |
R6847 | T7929 | T7928 | arg2Of | rejected,was |
R6848 | T7929 | T7930 | arg1Of | rejected,at |
R6849 | T7933 | T7930 | arg2Of | 0.05,at |
R6850 | T7933 | T7931 | arg1Of | 0.05,p |
R6851 | T7933 | T7932 | arg1Of | 0.05,< |
R7117 | T8246 | T8245 | arg1Of | Effect,The |
R7118 | T8246 | T8247 | arg1Of | Effect,of |
R7119 | T8246 | T8249 | arg1Of | Effect,on |
R7120 | T8248 | T8247 | arg2Of | Corticosteroids,of |
R7121 | T8252 | T8250 | arg1Of | Translocation,GATA-3 |
R7122 | T8252 | T8251 | arg1Of | Translocation,Nuclear |
R7123 | T8252 | T8253 | arg1Of | Translocation,and |
R7124 | T8253 | T8249 | arg2Of | and,on |
R7125 | T8255 | T8253 | arg2Of | mRNA,and |
R7126 | T8255 | T8254 | arg1Of | mRNA,IL-4 |
R7127 | T8256 | T8257 | arg1Of | Corticosteroids,are |
R7128 | T8256 | T8258 | arg1Of | Corticosteroids,effective |
R7129 | T8258 | T8257 | arg2Of | effective,are |
R7130 | T8258 | T8259 | arg1Of | effective,in |
R7131 | T8260 | T8259 | arg2Of | inhibiting,in |
R7132 | T8260 | T8270 | arg1Of | inhibiting,[ |
R7133 | T8264 | T8260 | arg2Of | expression,inhibiting |
R7134 | T8264 | T8261 | arg1Of | expression,GATA-3-regulated |
R7135 | T8264 | T8262 | arg1Of | expression,IL-4 |
R7136 | T8264 | T8263 | arg1Of | expression,gene |
R7137 | T8264 | T8266 | arg1Of | expression,vitro |
R7138 | T8264 | T8269 | arg1Of | expression,vivo |
R7139 | T8266 | T8265 | arg1Of | vitro,in |
R7140 | T8266 | T8267 | arg1Of | vitro,and |
R7141 | T8269 | T8267 | arg2Of | vivo,and |
R7142 | T8269 | T8268 | arg1Of | vivo,in |
R7143 | T8271 | T8270 | arg2Of | 32,[ |
R7144 | T8272 | T8270 | arg3Of | ],[ |
R7145 | T8273 | T8275 | arg1Of | We,investigated |
R7146 | T8275 | T8274 | arg1Of | investigated,therefore |
R7147 | T8277 | T8278 | arg1Of | corticosteroids,affect |
R7148 | T8278 | T8275 | arg2Of | affect,investigated |
R7149 | T8278 | T8276 | arg1Of | affect,whether |
R7150 | T8281 | T8278 | arg2Of | import,affect |
R7151 | T8281 | T8279 | arg1Of | import,anti-CD3/CD28–stimulated |
R7152 | T8281 | T8280 | arg1Of | import,nuclear |
R7153 | T8281 | T8282 | arg1Of | import,of |
R7154 | T8283 | T8282 | arg2Of | GATA-3,of |
R7155 | T8284 | T8285 | arg1Of | Stimulation,of |
R7156 | T8284 | T8287 | arg1Of | Stimulation,with |
R7157 | T8284 | T8289 | arg1Of | Stimulation,resulted |
R7158 | T8286 | T8285 | arg2Of | cells,of |
R7159 | T8288 | T8287 | arg2Of | anti-CD3/CD28,with |
R7160 | T8289 | T8290 | arg1Of | resulted,in |
R7161 | T8289 | T8300 | arg1Of | resulted,"," |
R7162 | T8289 | T8301 | modOf | resulted,confirming |
R7163 | T8289 | T8305 | arg1Of | resulted,[ |
R7164 | T8295 | T8290 | arg2Of | translocation,in |
R7165 | T8295 | T8291 | arg1Of | translocation,a |
R7166 | T8295 | T8292 | arg1Of | translocation,rapid |
R7167 | T8295 | T8293 | arg1Of | translocation,cytoplasmic/nuclear |
R7168 | T8295 | T8294 | arg1Of | translocation,GATA-3 |
R7169 | T8295 | T8296 | arg1Of | translocation,( |
R7170 | T8298 | T8296 | arg2Of | 1A,( |
R7171 | T8298 | T8297 | arg1Of | 1A,Figure |
R7172 | T8299 | T8296 | arg3Of | ),( |
R7173 | T8304 | T8301 | arg2Of | results,confirming |
R7174 | T8304 | T8302 | arg1Of | results,our |
R7175 | T8304 | T8303 | arg1Of | results,previous |
R7176 | T8306 | T8305 | arg2Of | 12,[ |
R7177 | T8307 | T8305 | arg3Of | ],[ |
R7178 | T8308 | T8310 | arg1Of | We,confirmed |
R7179 | T8310 | T8309 | arg1Of | confirmed,also |
R7180 | T8310 | T8319 | arg1Of | confirmed,as |
R7181 | T8313 | T8310 | arg2Of | separation,confirmed |
R7182 | T8313 | T8311 | arg1Of | separation,a |
R7183 | T8313 | T8312 | arg1Of | separation,clear |
R7184 | T8313 | T8314 | arg1Of | separation,of |
R7185 | T8315 | T8316 | arg1Of | nuclear,and |
R7186 | T8317 | T8316 | arg2Of | cytosolic,and |
R7187 | T8318 | T8314 | arg2Of | fractions,of |
R7188 | T8318 | T8315 | arg1Of | fractions,nuclear |
R7189 | T8318 | T8317 | arg1Of | fractions,cytosolic |
R7190 | T8320 | T8319 | arg2Of | indicated,as |
R7191 | T8323 | T8322 | arg1Of | H1,histone |
R7192 | T8323 | T8324 | arg1Of | H1,and |
R7193 | T8324 | T8320 | arg1Of | and,indicated |
R7194 | T8324 | T8321 | arg2Of | and,by |
R7195 | T8326 | T8324 | arg2Of | markers,and |
R7196 | T8326 | T8325 | arg1Of | markers,MEK-1 |
R7197 | T8326 | T8327 | arg1Of | markers,( |
R7198 | T8329 | T8327 | arg2Of | 1B,( |
R7199 | T8329 | T8328 | arg1Of | 1B,Figure |
R7200 | T8330 | T8327 | arg3Of | ),( |
R7201 | T8335 | T8331 | arg1Of | FP,The |
R7202 | T8335 | T8332 | arg1Of | FP,potent |
R7203 | T8335 | T8333 | arg1Of | FP,topical |
R7204 | T8335 | T8334 | arg1Of | FP,corticosteroid |
R7205 | T8335 | T8336 | arg1Of | FP,caused |
R7206 | T8338 | T8336 | arg2Of | loss,caused |
R7207 | T8338 | T8337 | arg1Of | loss,sustained |
R7208 | T8338 | T8339 | arg1Of | loss,of |
R7209 | T8342 | T8340 | arg1Of | expression,nuclear |
R7210 | T8342 | T8341 | arg1Of | expression,GATA-3 |
R7211 | T8342 | T8343 | arg1Of | expression,and |
R7212 | T8343 | T8339 | arg2Of | and,of |
R7213 | T8343 | T8348 | arg1Of | and,at |
R7214 | T8345 | T8343 | arg2Of | retention,and |
R7215 | T8345 | T8344 | arg1Of | retention,cytoplasmic |
R7216 | T8345 | T8346 | arg1Of | retention,of |
R7217 | T8347 | T8346 | arg2Of | GATA-3,of |
R7218 | T8349 | T8348 | arg2Of | concentrations,at |
R7219 | T8349 | T8350 | arg1Of | concentrations,ranging |
R7220 | T8350 | T8351 | arg1Of | ranging,from |
R7221 | T8352 | T8353 | arg1Of | 10−12,to |
R7222 | T8354 | T8353 | arg2Of | 10−8,to |
R7223 | T8355 | T8351 | arg2Of | M,from |
R7224 | T8355 | T8352 | arg1Of | M,10−12 |
R7225 | T8355 | T8356 | arg1Of | M,"," |
R7226 | T8355 | T8357 | arg1Of | M,which |
R7227 | T8355 | T8358 | arg1Of | M,cover |
R7228 | T8361 | T8358 | arg2Of | range,cover |
R7229 | T8361 | T8359 | arg1Of | range,the |
R7230 | T8361 | T8360 | arg1Of | range,therapeutic |
R7231 | T8361 | T8362 | arg1Of | range,[ |
R7232 | T8363 | T8362 | arg2Of | 37,[ |
R7233 | T8364 | T8362 | arg3Of | ],[ |
R7234 | T8366 | T8365 | arg1Of | effect,This |
R7235 | T8366 | T8367 | arg1Of | effect,was |
R7236 | T8366 | T8368 | arg1Of | effect,concentration- |
R7237 | T8366 | T8370 | arg1Of | effect,time-dependent |
R7238 | T8366 | T8392 | arg1Of | effect,was |
R7239 | T8366 | T8393 | arg2Of | effect,associated |
R7240 | T8367 | T8371 | arg1Of | was,"," |
R7241 | T8367 | T8372 | arg1Of | was,with |
R7242 | T8367 | T8391 | arg1Of | was,and |
R7243 | T8368 | T8369 | arg1Of | concentration-,and |
R7244 | T8369 | T8367 | arg2Of | and,was |
R7245 | T8370 | T8369 | arg2Of | time-dependent,and |
R7246 | T8375 | T8372 | arg2Of | effect,with |
R7247 | T8375 | T8373 | arg1Of | effect,a |
R7248 | T8375 | T8374 | arg1Of | effect,peak |
R7249 | T8375 | T8376 | arg1Of | effect,of |
R7250 | T8375 | T8381 | arg1Of | effect,at |
R7251 | T8379 | T8377 | arg1Of | 30,11.6-fold |
R7252 | T8379 | T8378 | arg1Of | 30,at |
R7253 | T8380 | T8376 | arg2Of | min,of |
R7254 | T8380 | T8379 | arg1Of | min,30 |
R7255 | T8383 | T8381 | arg2Of | concentration,at |
R7256 | T8383 | T8382 | arg1Of | concentration,a |
R7257 | T8383 | T8384 | arg1Of | concentration,of |
R7258 | T8386 | T8384 | arg2Of | M,of |
R7259 | T8386 | T8385 | arg1Of | M,10−8 |
R7260 | T8386 | T8387 | arg1Of | M,( |
R7261 | T8389 | T8387 | arg2Of | 1C,( |
R7262 | T8389 | T8388 | arg1Of | 1C,Figure |
R7263 | T8390 | T8387 | arg3Of | ),( |
R7264 | T8393 | T8391 | arg2Of | associated,and |
R7265 | T8393 | T8392 | arg2Of | associated,was |
R7266 | T8393 | T8394 | arg1Of | associated,with |
R7267 | T8396 | T8394 | arg2Of | reductions,with |
R7268 | T8396 | T8395 | arg1Of | reductions,marked |
R7269 | T8396 | T8397 | arg1Of | reductions,in |
R7270 | T8399 | T8400 | arg1Of | IL-4,and |
R7271 | T8401 | T8400 | arg2Of | IL-5,and |
R7272 | T8403 | T8398 | arg1Of | expression,anti-CD3/CD28–stimulated |
R7273 | T8403 | T8399 | arg1Of | expression,IL-4 |
R7274 | T8403 | T8401 | arg1Of | expression,IL-5 |
R7275 | T8403 | T8402 | arg1Of | expression,mRNA |
R7276 | T8403 | T8404 | arg1Of | expression,( |
R7277 | T8403 | T8408 | arg1Of | expression,and |
R7278 | T8406 | T8404 | arg2Of | 1D,( |
R7279 | T8406 | T8405 | arg1Of | 1D,Figure |
R7280 | T8407 | T8404 | arg3Of | ),( |
R7281 | T8408 | T8397 | arg2Of | and,in |
R7282 | T8410 | T8408 | arg2Of | loss,and |
R7283 | T8410 | T8409 | arg1Of | loss,a |
R7284 | T8410 | T8411 | arg1Of | loss,of |
R7285 | T8410 | T8414 | arg1Of | loss,to |
R7286 | T8413 | T8411 | arg2Of | binding,of |
R7287 | T8413 | T8412 | arg1Of | binding,GATA-3 |
R7288 | T8418 | T8414 | arg2Of | promoter,to |
R7289 | T8418 | T8415 | arg1Of | promoter,the |
R7290 | T8418 | T8416 | arg1Of | promoter,native |
R7291 | T8418 | T8417 | arg1Of | promoter,IL-5 |
R7292 | T8418 | T8419 | arg1Of | promoter,( |
R7293 | T8421 | T8419 | arg2Of | 1E,( |
R7294 | T8421 | T8420 | arg1Of | 1E,Figure |
R7295 | T8422 | T8419 | arg3Of | ),( |
R7701 | T8947 | T8946 | arg1Of | GR,Ligand-Activated |
R7702 | T8947 | T8948 | arg1Of | GR,Competes |
R7703 | T8948 | T8949 | arg1Of | Competes,with |
R7704 | T8950 | T8949 | arg2Of | GATA-3,with |
R7705 | T8950 | T8951 | arg1Of | GATA-3,for |
R7706 | T8952 | T8951 | arg2Of | Importin-α,for |
R7707 | T8953 | T8954 | arg1Of | We,confirmed |
R7708 | T8953 | T8956 | arg1Of | We,extended |
R7709 | T8954 | T8955 | arg1Of | confirmed,and |
R7710 | T8956 | T8955 | arg2Of | extended,and |
R7711 | T8958 | T8954 | arg2Of | data,confirmed |
R7712 | T8958 | T8956 | arg2Of | data,extended |
R7713 | T8958 | T8957 | arg1Of | data,previous |
R7714 | T8958 | T8959 | arg1Of | data,[ |
R7715 | T8958 | T8962 | modOf | data,to |
R7716 | T8958 | T8963 | arg1Of | data,show |
R7717 | T8958 | T8972 | arg1Of | data,importin-α |
R7718 | T8958 | T8977 | arg1Of | data,( |
R7719 | T8960 | T8959 | arg2Of | 20,[ |
R7720 | T8961 | T8959 | arg3Of | ],[ |
R7721 | T8963 | T8962 | arg1Of | show,to |
R7722 | T8966 | T8965 | arg1Of | GR,ligand-activated |
R7723 | T8966 | T8969 | arg1Of | GR,as |
R7724 | T8969 | T8967 | arg1Of | as,as |
R7725 | T8969 | T8968 | arg1Of | as,well |
R7726 | T8969 | T8971 | arg1Of | as,uses |
R7727 | T8970 | T8969 | arg2Of | GATA-3,as |
R7728 | T8971 | T8963 | arg2Of | uses,show |
R7729 | T8971 | T8964 | arg1Of | uses,that |
R7730 | T8972 | T8973 | arg1Of | importin-α,for |
R7731 | T8976 | T8973 | arg2Of | import,for |
R7732 | T8976 | T8974 | arg1Of | import,its |
R7733 | T8976 | T8975 | arg1Of | import,nuclear |
R7734 | T8979 | T8978 | arg1Of | 2A,Figure |
R7735 | T8979 | T8980 | arg1Of | 2A,and |
R7736 | T8980 | T8977 | arg2Of | and,( |
R7737 | T8981 | T8980 | arg2Of | 2B,and |
R7738 | T8982 | T8977 | arg3Of | ),( |
R7739 | T8984 | T8983 | arg1Of | interaction,This |
R7740 | T8984 | T8985 | arg1Of | interaction,between |
R7741 | T8984 | T8989 | arg1Of | interaction,was |
R7742 | T8984 | T8990 | arg1Of | interaction,significant |
R7743 | T8984 | T8999 | arg1Of | interaction,was |
R7744 | T8984 | T9000 | arg1Of | interaction,maximal |
R7745 | T8986 | T8987 | arg1Of | GR,and |
R7746 | T8987 | T8985 | arg2Of | and,between |
R7747 | T8988 | T8987 | arg2Of | importin-α,and |
R7748 | T8989 | T8991 | arg1Of | was,at |
R7749 | T8989 | T8998 | arg1Of | was,and |
R7750 | T8990 | T8989 | arg2Of | significant,was |
R7751 | T8992 | T8991 | arg2Of | concentrations,at |
R7752 | T8992 | T8994 | arg1Of | concentrations,low |
R7753 | T8994 | T8993 | arg1Of | low,as |
R7754 | T8994 | T8995 | arg1Of | low,as |
R7755 | T8997 | T8995 | arg2Of | M,as |
R7756 | T8997 | T8996 | arg1Of | M,10−12 |
R7757 | T8999 | T8998 | arg2Of | was,and |
R7758 | T9000 | T8999 | arg2Of | maximal,was |
R7759 | T9000 | T9001 | arg1Of | maximal,with |
R7760 | T9002 | T9003 | arg1Of | 10−8,M |
R7761 | T9004 | T9001 | arg2Of | FP,with |
R7762 | T9004 | T9002 | arg1Of | FP,10−8 |
R7763 | T9008 | T9005 | arg1Of | translocation,Subsequent |
R7764 | T9008 | T9006 | arg1Of | translocation,GR |
R7765 | T9008 | T9007 | arg1Of | translocation,nuclear |
R7766 | T9008 | T9009 | arg1Of | translocation,was |
R7767 | T9008 | T9010 | arg1Of | translocation,rapid |
R7768 | T9008 | T9012 | arg1Of | translocation,sustained |
R7769 | T9009 | T9013 | arg1Of | was,at |
R7770 | T9009 | T9016 | arg1Of | was,for |
R7771 | T9010 | T9011 | arg1Of | rapid,and |
R7772 | T9011 | T9009 | arg2Of | and,was |
R7773 | T9012 | T9011 | arg2Of | sustained,and |
R7774 | T9015 | T9013 | arg2Of | levels,at |
R7775 | T9015 | T9014 | arg1Of | levels,significant |
R7776 | T9019 | T9017 | arg1Of | 14,at |
R7777 | T9019 | T9018 | arg1Of | 14,least |
R7778 | T9020 | T9016 | arg2Of | h,for |
R7779 | T9020 | T9019 | arg1Of | h,14 |
R7780 | T9020 | T9021 | arg1Of | h,( |
R7781 | T9023 | T9021 | arg2Of | 2B,( |
R7782 | T9023 | T9022 | arg1Of | 2B,Figure |
R7783 | T9024 | T9021 | arg3Of | ),( |
R7784 | T9027 | T9025 | arg2Of | blotting,Using |
R7785 | T9027 | T9026 | arg1Of | blotting,IP-Western |
R7786 | T9028 | T9025 | arg1Of | we,Using |
R7787 | T9028 | T9029 | arg1Of | we,showed |
R7788 | T9029 | T9025 | modOf | showed,Using |
R7789 | T9031 | T9032 | arg1Of | FP,at |
R7790 | T9031 | T9035 | arg1Of | FP,decreased |
R7791 | T9034 | T9032 | arg2Of | M,at |
R7792 | T9034 | T9033 | arg1Of | M,10−12–10−8 |
R7793 | T9035 | T9029 | arg2Of | decreased,showed |
R7794 | T9035 | T9030 | arg1Of | decreased,that |
R7795 | T9037 | T9035 | arg2Of | association,decreased |
R7796 | T9037 | T9036 | arg1Of | association,the |
R7797 | T9037 | T9038 | arg1Of | association,between |
R7798 | T9039 | T9040 | arg1Of | GATA-3,and |
R7799 | T9040 | T9038 | arg2Of | and,between |
R7800 | T9040 | T9042 | arg2Of | and,induced |
R7801 | T9041 | T9040 | arg2Of | importin-α,and |
R7802 | T9045 | T9042 | arg1Of | stimulation,induced |
R7803 | T9045 | T9043 | arg2Of | stimulation,by |
R7804 | T9045 | T9044 | arg1Of | stimulation,anti-CD3/CD28 |
R7805 | T9045 | T9046 | arg1Of | stimulation,in |
R7806 | T9049 | T9046 | arg2Of | manner,in |
R7807 | T9049 | T9047 | arg1Of | manner,a |
R7808 | T9049 | T9048 | arg1Of | manner,concentration-dependent |
R7809 | T9049 | T9050 | arg1Of | manner,( |
R7810 | T9052 | T9050 | arg2Of | 2C,( |
R7811 | T9052 | T9051 | arg1Of | 2C,Figure |
R7812 | T9053 | T9050 | arg3Of | ),( |
R7813 | T9055 | T9054 | arg2Of | addition,In |
R7814 | T9059 | T9058 | arg1Of | GATA-3,GFP-labelled |
R7815 | T9059 | T9060 | arg1Of | GATA-3,and |
R7816 | T9060 | T9057 | arg2Of | and,using |
R7817 | T9062 | T9060 | arg2Of | microscopy,and |
R7818 | T9062 | T9061 | arg1Of | microscopy,confocal |
R7819 | T9063 | T9064 | arg1Of | we,demonstrated |
R7820 | T9064 | T9054 | arg1Of | demonstrated,In |
R7821 | T9064 | T9056 | arg1Of | demonstrated,"," |
R7822 | T9064 | T9057 | modOf | demonstrated,using |
R7823 | T9068 | T9066 | arg1Of | import,GATA-3 |
R7824 | T9068 | T9067 | arg1Of | import,nuclear |
R7825 | T9068 | T9069 | arg1Of | import,following |
R7826 | T9068 | T9075 | arg1Of | import,was |
R7827 | T9068 | T9076 | arg2Of | import,attenuated |
R7828 | T9071 | T9069 | arg2Of | stimulation,following |
R7829 | T9071 | T9070 | arg1Of | stimulation,anti-CD3/CD28 |
R7830 | T9071 | T9072 | arg1Of | stimulation,for |
R7831 | T9074 | T9072 | arg2Of | min,for |
R7832 | T9074 | T9073 | arg1Of | min,30 |
R7833 | T9076 | T9064 | arg2Of | attenuated,demonstrated |
R7834 | T9076 | T9065 | arg1Of | attenuated,that |
R7835 | T9076 | T9075 | arg2Of | attenuated,was |
R7836 | T9078 | T9076 | arg1Of | pretreatment,attenuated |
R7837 | T9078 | T9077 | arg2Of | pretreatment,by |
R7838 | T9078 | T9079 | arg1Of | pretreatment,with |
R7839 | T9080 | T9079 | arg2Of | FP,with |
R7840 | T9080 | T9081 | arg1Of | FP,( |
R7841 | T9080 | T9085 | arg1Of | FP,( |
R7842 | T9083 | T9081 | arg2Of | M,( |
R7843 | T9083 | T9082 | arg1Of | M,10−8 |
R7844 | T9084 | T9081 | arg3Of | ),( |
R7845 | T9087 | T9085 | arg2Of | 2D,( |
R7846 | T9087 | T9086 | arg1Of | 2D,Figure |
R7847 | T9088 | T9085 | arg3Of | ),( |
R8309 | T9702 | T9703 | arg1Of | Effect,on |
R8310 | T9704 | T9703 | arg2Of | MKP-1,on |
R8311 | T9705 | T9706 | arg1Of | Dexamethasone,inhibits |
R8312 | T9706 | T9710 | arg1Of | inhibits,in |
R8313 | T9706 | T9715 | arg1Of | inhibits,through |
R8314 | T9706 | T9730 | arg1Of | inhibits,and |
R8315 | T9709 | T9706 | arg2Of | function,inhibits |
R8316 | T9709 | T9707 | arg1Of | function,p38 |
R8317 | T9709 | T9708 | arg1Of | function,MAPK |
R8318 | T9714 | T9710 | arg2Of | manner,in |
R8319 | T9714 | T9711 | arg1Of | manner,a |
R8320 | T9714 | T9712 | arg1Of | manner,cell |
R8321 | T9714 | T9713 | arg1Of | manner,type–specific |
R8322 | T9718 | T9715 | arg2Of | induction,through |
R8323 | T9718 | T9716 | arg1Of | induction,the |
R8324 | T9718 | T9717 | arg1Of | induction,rapid |
R8325 | T9718 | T9719 | arg1Of | induction,of |
R8326 | T9724 | T9719 | arg2Of | MKP-1,of |
R8327 | T9724 | T9720 | arg1Of | MKP-1,the |
R8328 | T9724 | T9721 | arg1Of | MKP-1,dual |
R8329 | T9724 | T9722 | arg1Of | MKP-1,kinase |
R8330 | T9724 | T9723 | arg1Of | MKP-1,phosphatase |
R8331 | T9724 | T9725 | arg1Of | MKP-1,( |
R8332 | T9727 | T9725 | arg2Of | phosphatase-1,( |
R8333 | T9727 | T9726 | arg1Of | phosphatase-1,MAPK |
R8334 | T9728 | T9725 | arg3Of | ),( |
R8335 | T9730 | T9729 | arg1Of | and,"," |
R8336 | T9732 | T9731 | arg1Of | effect,this |
R8337 | T9732 | T9733 | arg1Of | effect,lasts |
R8338 | T9733 | T9730 | arg2Of | lasts,and |
R8339 | T9733 | T9734 | arg1Of | lasts,for |
R8340 | T9733 | T9739 | arg1Of | lasts,[ |
R8341 | T9737 | T9735 | arg1Of | 24,up |
R8342 | T9737 | T9736 | arg1Of | 24,to |
R8343 | T9738 | T9734 | arg2Of | h,for |
R8344 | T9738 | T9737 | arg1Of | h,24 |
R8345 | T9740 | T9739 | arg2Of | 28,[ |
R8346 | T9741 | T9739 | arg3Of | ],[ |
R8347 | T9742 | T9743 | arg1Of | FP,( |
R8348 | T9745 | T9743 | arg2Of | M,( |
R8349 | T9745 | T9744 | arg1Of | M,10−8 |
R8350 | T9746 | T9743 | arg3Of | ),( |
R8351 | T9747 | T9742 | arg1Of | treatment,FP |
R8352 | T9747 | T9748 | arg1Of | treatment,of |
R8353 | T9747 | T9757 | arg1Of | treatment,decreased |
R8354 | T9750 | T9748 | arg2Of | cells,of |
R8355 | T9750 | T9749 | arg1Of | cells,HuT-78 |
R8356 | T9750 | T9751 | arg2Of | cells,activated |
R8357 | T9751 | T9755 | arg1Of | activated,vitro |
R8358 | T9753 | T9751 | arg1Of | anti-CD3/CD28,activated |
R8359 | T9753 | T9752 | arg2Of | anti-CD3/CD28,by |
R8360 | T9755 | T9754 | arg1Of | vitro,in |
R8361 | T9757 | T9756 | arg1Of | decreased,significantly |
R8362 | T9760 | T9758 | arg1Of | phosphorylation,p38 |
R8363 | T9760 | T9759 | arg1Of | phosphorylation,MAPK |
R8364 | T9760 | T9761 | arg1Of | phosphorylation,( |
R8365 | T9760 | T9765 | arg1Of | phosphorylation,and |
R8366 | T9763 | T9761 | arg2Of | 3A,( |
R8367 | T9763 | T9762 | arg1Of | 3A,Figure |
R8368 | T9764 | T9761 | arg3Of | ),( |
R8369 | T9765 | T9757 | arg2Of | and,decreased |
R8370 | T9766 | T9765 | arg2Of | activity,and |
R8371 | T9766 | T9767 | arg2Of | activity,measured |
R8372 | T9769 | T9767 | arg1Of | phosphorylation,measured |
R8373 | T9769 | T9768 | arg2Of | phosphorylation,by |
R8374 | T9769 | T9770 | arg1Of | phosphorylation,of |
R8375 | T9774 | T9770 | arg2Of | ATF-2,of |
R8376 | T9774 | T9771 | arg1Of | ATF-2,the |
R8377 | T9774 | T9772 | arg1Of | ATF-2,downstream |
R8378 | T9774 | T9773 | arg1Of | ATF-2,target |
R8379 | T9774 | T9775 | arg1Of | ATF-2,( |
R8380 | T9777 | T9775 | arg2Of | 3B,( |
R8381 | T9777 | T9776 | arg1Of | 3B,Figure |
R8382 | T9778 | T9775 | arg3Of | ),( |
R8383 | T9780 | T9779 | arg1Of | effect,This |
R8384 | T9780 | T9781 | arg1Of | effect,was |
R8385 | T9780 | T9782 | arg2Of | effect,detected |
R8386 | T9780 | T9787 | arg2Of | effect,lasted |
R8387 | T9782 | T9783 | arg1Of | detected,at |
R8388 | T9782 | T9786 | arg1Of | detected,and |
R8389 | T9785 | T9783 | arg2Of | min,at |
R8390 | T9785 | T9784 | arg1Of | min,30 |
R8391 | T9786 | T9781 | arg2Of | and,was |
R8392 | T9787 | T9786 | arg2Of | lasted,and |
R8393 | T9787 | T9788 | arg1Of | lasted,for |
R8394 | T9791 | T9789 | arg1Of | 14,at |
R8395 | T9791 | T9790 | arg1Of | 14,least |
R8396 | T9792 | T9788 | arg2Of | h,for |
R8397 | T9792 | T9791 | arg1Of | h,14 |
R8398 | T9792 | T9793 | arg1Of | h,( |
R8399 | T9795 | T9793 | arg2Of | 3B,( |
R8400 | T9795 | T9794 | arg1Of | 3B,Figure |
R8401 | T9796 | T9793 | arg3Of | ),( |
R8402 | T9797 | T9798 | arg1Of | FP,( |
R8403 | T9797 | T9804 | arg1Of | FP,reduced |
R8404 | T9800 | T9798 | arg2Of | M,( |
R8405 | T9800 | T9799 | arg1Of | M,10−8 |
R8406 | T9801 | T9798 | arg3Of | ),( |
R8407 | T9804 | T9802 | arg1Of | reduced,also |
R8408 | T9804 | T9803 | arg1Of | reduced,significantly |
R8409 | T9807 | T9804 | arg2Of | phosphorylation,reduced |
R8410 | T9807 | T9805 | arg1Of | phosphorylation,GATA-3 |
R8411 | T9807 | T9806 | arg1Of | phosphorylation,serine |
R8412 | T9807 | T9808 | arg2Of | phosphorylation,induced |
R8413 | T9811 | T9808 | arg1Of | stimulation,induced |
R8414 | T9811 | T9809 | arg2Of | stimulation,by |
R8415 | T9811 | T9810 | arg1Of | stimulation,anti-CD3/CD28 |
R8416 | T9811 | T9812 | arg1Of | stimulation,in |
R8417 | T9815 | T9816 | arg1Of | time-,and |
R8418 | T9817 | T9816 | arg2Of | concentration-dependent,and |
R8419 | T9818 | T9812 | arg2Of | manner,in |
R8420 | T9818 | T9813 | arg1Of | manner,both |
R8421 | T9818 | T9814 | arg1Of | manner,a |
R8422 | T9818 | T9815 | arg1Of | manner,time- |
R8423 | T9818 | T9817 | arg1Of | manner,concentration-dependent |
R8424 | T9818 | T9819 | arg1Of | manner,( |
R8425 | T9821 | T9819 | arg2Of | 3C,( |
R8426 | T9821 | T9820 | arg1Of | 3C,Figure |
R8427 | T9822 | T9819 | arg3Of | ),( |
R8428 | T9824 | T9823 | arg1Of | reduction,This |
R8429 | T9824 | T9825 | arg1Of | reduction,in |
R8430 | T9824 | T9828 | arg1Of | reduction,was |
R8431 | T9824 | T9830 | arg2Of | reduction,seen |
R8432 | T9827 | T9825 | arg2Of | phosphorylation,in |
R8433 | T9827 | T9826 | arg1Of | phosphorylation,GATA-3 |
R8434 | T9830 | T9828 | arg2Of | seen,was |
R8435 | T9830 | T9829 | arg1Of | seen,also |
R8436 | T9830 | T9831 | arg1Of | seen,with |
R8437 | T9833 | T9831 | arg2Of | concentrations,with |
R8438 | T9833 | T9832 | arg1Of | concentrations,lower |
R8439 | T9833 | T9834 | arg1Of | concentrations,of |
R8440 | T9835 | T9834 | arg2Of | FP,of |
R8441 | T9836 | T9837 | arg1Of | We,found |
R8442 | T9839 | T9841 | arg1Of | FP,induced |
R8443 | T9841 | T9837 | arg2Of | induced,found |
R8444 | T9841 | T9838 | arg1Of | induced,that |
R8445 | T9841 | T9840 | arg1Of | induced,significantly |
R8446 | T9841 | T9844 | arg1Of | induced,in |
R8447 | T9841 | T9851 | arg1Of | induced,"," |
R8448 | T9843 | T9841 | arg2Of | mRNA,induced |
R8449 | T9843 | T9842 | arg1Of | mRNA,MKP-1 |
R8450 | T9847 | T9848 | arg1Of | time-,and |
R8451 | T9849 | T9848 | arg2Of | concentration-dependent,and |
R8452 | T9850 | T9844 | arg2Of | manner,in |
R8453 | T9850 | T9845 | arg1Of | manner,both |
R8454 | T9850 | T9846 | arg1Of | manner,a |
R8455 | T9850 | T9847 | arg1Of | manner,time- |
R8456 | T9850 | T9849 | arg1Of | manner,concentration-dependent |
R8457 | T9852 | T9841 | arg3Of | reaching,induced |
R8458 | T9852 | T9855 | arg1Of | reaching,at |
R8459 | T9852 | T9858 | arg1Of | reaching,after |
R8460 | T9854 | T9852 | arg2Of | plateau,reaching |
R8461 | T9854 | T9853 | arg1Of | plateau,a |
R8462 | T9857 | T9855 | arg2Of | M,at |
R8463 | T9857 | T9856 | arg1Of | M,10−8 |
R8464 | T9860 | T9858 | arg2Of | min,after |
R8465 | T9860 | T9859 | arg1Of | min,10 |
R8466 | T9860 | T9861 | arg1Of | min,( |
R8467 | T9863 | T9862 | arg1Of | 3D,Figure |
R8468 | T9863 | T9864 | arg1Of | 3D,and |
R8469 | T9864 | T9861 | arg2Of | and,( |
R8470 | T9865 | T9864 | arg2Of | 3E,and |
R8471 | T9866 | T9861 | arg3Of | ),( |
R8472 | T9870 | T9869 | arg1Of | effects,the |
R8473 | T9870 | T9871 | arg1Of | effects,of |
R8474 | T9870 | T9873 | arg1Of | effects,on |
R8475 | T9870 | T9884 | arg1Of | effects,are |
R8476 | T9870 | T9885 | arg2Of | effects,seen |
R8477 | T9872 | T9871 | arg2Of | FP,of |
R8478 | T9876 | T9874 | arg1Of | import,GATA-3 |
R8479 | T9876 | T9875 | arg1Of | import,nuclear |
R8480 | T9876 | T9877 | arg1Of | import,"," |
R8481 | T9877 | T9880 | arg1Of | ",",and |
R8482 | T9879 | T9877 | arg2Of | association,"," |
R8483 | T9879 | T9878 | arg1Of | association,importin-α |
R8484 | T9880 | T9873 | arg2Of | and,on |
R8485 | T9883 | T9880 | arg2Of | expression,and |
R8486 | T9883 | T9881 | arg1Of | expression,IL-4 |
R8487 | T9883 | T9882 | arg1Of | expression,mRNA |
R8488 | T9885 | T9867 | arg1Of | seen,However |
R8489 | T9885 | T9868 | arg1Of | seen,"," |
R8490 | T9885 | T9884 | arg2Of | seen,are |
R8491 | T9885 | T9886 | arg1Of | seen,at |
R8492 | T9888 | T9887 | arg1Of | lower,"10,000-fold" |
R8493 | T9889 | T9886 | arg2Of | concentrations,at |
R8494 | T9889 | T9888 | arg1Of | concentrations,lower |
R8495 | T9889 | T9890 | arg1Of | concentrations,( |
R8496 | T9892 | T9891 | arg1Of | M,10−12 |
R8497 | T9892 | T9894 | arg1Of | M,see |
R8498 | T9894 | T9890 | arg2Of | see,( |
R8499 | T9894 | T9893 | arg1Of | see,"," |
R8500 | T9895 | T9894 | arg2Of | Figure,see |
R8501 | T9895 | T9896 | arg1Of | Figure,2 |
R8502 | T9897 | T9890 | arg3Of | ),( |
R8503 | T9898 | T9908 | modOf | Using,utilizing |
R8504 | T9901 | T9900 | arg1Of | vitro,in |
R8505 | T9903 | T9898 | arg2Of | assay,Using |
R8506 | T9903 | T9899 | arg1Of | assay,an |
R8507 | T9903 | T9901 | arg1Of | assay,vitro |
R8508 | T9903 | T9902 | arg1Of | assay,competition |
R8509 | T9903 | T9904 | arg1Of | assay,( |
R8510 | T9906 | T9904 | arg2Of | 4A,( |
R8511 | T9906 | T9905 | arg1Of | 4A,Figure |
R8512 | T9907 | T9904 | arg3Of | ),( |
R8513 | T9911 | T9909 | arg2Of | GATA-3,purified |
R8514 | T9911 | T9910 | arg2Of | GATA-3,activated |
R8515 | T9911 | T9912 | arg1Of | GATA-3,"," |
R8516 | T9912 | T9915 | arg1Of | ",",and |
R8517 | T9913 | T9912 | arg2Of | importin-α,"," |
R8518 | T9915 | T9908 | arg2Of | and,utilizing |
R8519 | T9915 | T9914 | arg1Of | and,"," |
R8520 | T9917 | T9915 | arg2Of | GR,and |
R8521 | T9917 | T9916 | arg2Of | GR,activated |
R8522 | T9919 | T9920 | arg1Of | we,demonstrated |
R8523 | T9920 | T9898 | modOf | demonstrated,Using |
R8524 | T9920 | T9918 | arg1Of | demonstrated,"," |
R8525 | T9923 | T9922 | arg2Of | GR,activated |
R8526 | T9923 | T9925 | arg1Of | GR,increased |
R8527 | T9925 | T9920 | arg2Of | increased,demonstrated |
R8528 | T9925 | T9921 | arg1Of | increased,that |
R8529 | T9925 | T9924 | arg1Of | increased,significantly |
R8530 | T9925 | T9928 | arg1Of | increased,in |
R8531 | T9927 | T9925 | arg2Of | association,increased |
R8532 | T9927 | T9926 | arg1Of | association,GR-importin-α |
R8533 | T9930 | T9931 | arg1Of | presence,and |
R8534 | T9931 | T9928 | arg2Of | and,in |
R8535 | T9931 | T9929 | arg1Of | and,the |
R8536 | T9932 | T9931 | arg2Of | absence,and |
R8537 | T9935 | T9925 | arg3Of | GATA-3,increased |
R8538 | T9935 | T9933 | arg1Of | GATA-3,of |
R8539 | T9935 | T9934 | arg2Of | GATA-3,activated |
R8540 | T9935 | T9936 | arg1Of | GATA-3,( |
R8541 | T9938 | T9936 | arg2Of | 4B,( |
R8542 | T9938 | T9937 | arg1Of | 4B,Figure |
R8543 | T9939 | T9936 | arg3Of | ),( |
R8544 | T9941 | T9940 | arg1Of | effect,This |
R8545 | T9941 | T9942 | arg1Of | effect,is |
R8546 | T9942 | T9943 | arg1Of | is,not |
R8547 | T9944 | T9945 | arg1Of | mutual,"," |
R8548 | T9944 | T9946 | arg1Of | mutual,since |
R8549 | T9947 | T9946 | arg2Of | activated,since |
R8550 | T9948 | T9944 | arg1Of | GATA-3,mutual |
R8551 | T9948 | T9949 | arg1Of | GATA-3,did |
R8552 | T9948 | T9951 | arg1Of | GATA-3,block |
R8553 | T9951 | T9942 | arg2Of | block,is |
R8554 | T9951 | T9949 | arg2Of | block,did |
R8555 | T9951 | T9950 | arg1Of | block,not |
R8556 | T9953 | T9951 | arg2Of | association,block |
R8557 | T9953 | T9952 | arg1Of | association,GR–importin-α |
R8558 | T9953 | T9954 | arg1Of | association,( |
R8559 | T9956 | T9954 | arg2Of | 4C,( |
R8560 | T9956 | T9955 | arg1Of | 4C,Figure |
R8561 | T9957 | T9954 | arg3Of | ),( |
R8562 | T9959 | T9958 | arg1Of | data,These |
R8563 | T9959 | T9961 | arg1Of | data,suggest |
R8564 | T9961 | T9960 | arg1Of | suggest,also |
R8565 | T9965 | T9966 | arg1Of | GR,and |
R8566 | T9966 | T9963 | arg1Of | and,both |
R8567 | T9966 | T9964 | arg2Of | and,activated |
R8568 | T9966 | T9968 | arg1Of | and,can |
R8569 | T9966 | T9970 | arg1Of | and,associate |
R8570 | T9967 | T9966 | arg2Of | phospho-GATA-3,and |
R8571 | T9970 | T9962 | arg1Of | associate,that |
R8572 | T9970 | T9968 | arg2Of | associate,can |
R8573 | T9970 | T9969 | arg1Of | associate,directly |
R8574 | T9970 | T9971 | arg1Of | associate,with |
R8575 | T9970 | T9977 | arg1Of | associate,and |
R8576 | T9972 | T9971 | arg2Of | importin-α,with |
R8577 | T9972 | T9973 | arg1Of | importin-α,( |
R8578 | T9975 | T9973 | arg2Of | 4D,( |
R8579 | T9975 | T9974 | arg1Of | 4D,Figure |
R8580 | T9976 | T9973 | arg3Of | ),( |
R8581 | T9977 | T9961 | arg2Of | and,suggest |
R8582 | T9978 | T9977 | arg2Of | that,and |
R8583 | T9980 | T9979 | arg2Of | GR,activated |
R8584 | T9980 | T9981 | arg1Of | GR,attenuates |
R8585 | T9981 | T9978 | arg2Of | attenuates,that |
R8586 | T9981 | T9985 | arg1Of | attenuates,in |
R8587 | T9984 | T9981 | arg2Of | interaction,attenuates |
R8588 | T9984 | T9982 | arg1Of | interaction,the |
R8589 | T9984 | T9983 | arg1Of | interaction,phospho-GATA-3/importin-α |
R8590 | T9988 | T9985 | arg2Of | manner,in |
R8591 | T9988 | T9986 | arg1Of | manner,a |
R8592 | T9988 | T9987 | arg1Of | manner,concentration-dependent |
R8593 | T9988 | T9989 | arg1Of | manner,( |
R8594 | T9991 | T9989 | arg2Of | 4E,( |
R8595 | T9991 | T9990 | arg1Of | 4E,Figure |
R8596 | T9992 | T9989 | arg3Of | ),( |
R8597 | T9995 | T9996 | arg1Of | this,suggests |
R8598 | T9996 | T9993 | arg1Of | suggests,Together |
R8599 | T9996 | T9994 | arg1Of | suggests,"," |
R8600 | T9999 | T9998 | arg1Of | GR,ligand-activated |
R8601 | T9999 | T10000 | arg1Of | GR,may |
R8602 | T9999 | T10001 | arg1Of | GR,compete |
R8603 | T9999 | T10008 | arg1Of | GR,limit |
R8604 | T10001 | T10000 | arg2Of | compete,may |
R8605 | T10001 | T10002 | arg1Of | compete,with |
R8606 | T10001 | T10004 | arg1Of | compete,for |
R8607 | T10001 | T10006 | arg1Of | compete,and |
R8608 | T10003 | T10002 | arg2Of | phospho-GATA-3,with |
R8609 | T10005 | T10004 | arg2Of | importin-α,for |
R8610 | T10006 | T9996 | arg2Of | and,suggests |
R8611 | T10006 | T9997 | arg1Of | and,that |
R8612 | T10008 | T10006 | arg2Of | limit,and |
R8613 | T10008 | T10007 | arg1Of | limit,thereby |
R8614 | T10011 | T10008 | arg2Of | import,limit |
R8615 | T10011 | T10009 | arg1Of | import,GATA-3 |
R8616 | T10011 | T10010 | arg1Of | import,nuclear |
R8617 | T10014 | T10012 | arg1Of | interpretations,Other |
R8618 | T10014 | T10013 | arg1Of | interpretations,possible |
R8619 | T10014 | T10015 | arg1Of | interpretations,of |
R8620 | T10014 | T10018 | arg1Of | interpretations,could |
R8621 | T10014 | T10019 | arg1Of | interpretations,include |
R8622 | T10017 | T10015 | arg2Of | results,of |
R8623 | T10017 | T10016 | arg1Of | results,our |
R8624 | T10019 | T10018 | arg2Of | include,could |
R8625 | T10021 | T10019 | arg2Of | effect,include |
R8626 | T10021 | T10020 | arg1Of | effect,an |
R8627 | T10021 | T10022 | arg1Of | effect,of |
R8628 | T10021 | T10024 | arg1Of | effect,on |
R8629 | T10023 | T10022 | arg2Of | FP,of |
R8630 | T10027 | T10025 | arg1Of | export,GATA-3 |
R8631 | T10027 | T10026 | arg1Of | export,nuclear |
R8632 | T10027 | T10028 | arg1Of | export,and/or |
R8633 | T10028 | T10024 | arg2Of | and/or,on |
R8634 | T10029 | T10028 | arg2Of | degradation,and/or |
R8635 | T10031 | T10030 | arg1Of | B,Leptomycin |
R8636 | T10031 | T10032 | arg1Of | B,"," |
R8637 | T10031 | T10033 | arg1Of | B,which |
R8638 | T10031 | T10034 | arg1Of | B,inhibits |
R8639 | T10031 | T10038 | arg1Of | B,did |
R8640 | T10031 | T10040 | arg1Of | B,affect |
R8641 | T10036 | T10034 | arg2Of | export,inhibits |
R8642 | T10036 | T10035 | arg1Of | export,nuclear |
R8643 | T10040 | T10037 | arg1Of | affect,"," |
R8644 | T10040 | T10038 | arg2Of | affect,did |
R8645 | T10040 | T10039 | arg1Of | affect,not |
R8646 | T10042 | T10040 | arg2Of | ability,affect |
R8647 | T10042 | T10041 | arg1Of | ability,the |
R8648 | T10042 | T10043 | arg1Of | ability,of |
R8649 | T10042 | T10045 | modOf | ability,to |
R8650 | T10044 | T10043 | arg2Of | FP,of |
R8651 | T10046 | T10045 | arg1Of | block,to |
R8652 | T10049 | T10046 | arg2Of | localization,block |
R8653 | T10049 | T10047 | arg1Of | localization,GATA-3 |
R8654 | T10049 | T10048 | arg1Of | localization,nuclear |
R8655 | T10049 | T10050 | arg1Of | localization,( |
R8656 | T10052 | T10050 | arg2Of | 5A,( |
R8657 | T10052 | T10051 | arg1Of | 5A,Figure |
R8658 | T10053 | T10050 | arg3Of | ),( |
R8659 | T10056 | T10057 | arg1Of | FP,had |
R8660 | T10057 | T10054 | arg1Of | had,Additionally |
R8661 | T10057 | T10055 | arg1Of | had,"," |
R8662 | T10057 | T10060 | arg1Of | had,on |
R8663 | T10057 | T10065 | arg1Of | had,during |
R8664 | T10059 | T10057 | arg2Of | effect,had |
R8665 | T10059 | T10058 | arg1Of | effect,no |
R8666 | T10064 | T10060 | arg2Of | expression,on |
R8667 | T10064 | T10061 | arg1Of | expression,whole |
R8668 | T10064 | T10062 | arg1Of | expression,cell |
R8669 | T10064 | T10063 | arg1Of | expression,GATA-3 |
R8670 | T10068 | T10065 | arg2Of | course,during |
R8671 | T10068 | T10066 | arg1Of | course,the |
R8672 | T10068 | T10067 | arg1Of | course,time |
R8673 | T10068 | T10069 | arg1Of | course,of |
R8674 | T10068 | T10072 | arg1Of | course,( |
R8675 | T10071 | T10069 | arg2Of | experiments,of |
R8676 | T10071 | T10070 | arg1Of | experiments,these |
R8677 | T10074 | T10072 | arg2Of | 5B,( |
R8678 | T10074 | T10073 | arg1Of | 5B,Figure |
R8679 | T10075 | T10072 | arg3Of | ),( |
R8680 | T10077 | T10076 | arg1Of | did,Nor |
R8681 | T10077 | T10094 | arg1Of | did,"," |
R8682 | T10077 | T10095 | modOf | did,suggesting |
R8683 | T10078 | T10077 | arg1Of | addition,did |
R8684 | T10078 | T10079 | arg1Of | addition,of |
R8685 | T10078 | T10081 | arg1Of | addition,subsequent |
R8686 | T10078 | T10086 | arg2Of | addition,affect |
R8687 | T10080 | T10079 | arg2Of | FP,of |
R8688 | T10081 | T10082 | arg1Of | subsequent,to |
R8689 | T10085 | T10082 | arg2Of | translocation,to |
R8690 | T10085 | T10083 | arg1Of | translocation,anti-CD3/CD28 |
R8691 | T10085 | T10084 | arg1Of | translocation,nuclear |
R8692 | T10089 | T10086 | arg1Of | residency,affect |
R8693 | T10089 | T10087 | arg1Of | residency,GATA-3 |
R8694 | T10089 | T10088 | arg1Of | residency,nuclear |
R8695 | T10089 | T10090 | arg1Of | residency,( |
R8696 | T10092 | T10090 | arg2Of | 5C,( |
R8697 | T10092 | T10091 | arg1Of | 5C,Figure |
R8698 | T10093 | T10090 | arg3Of | ),( |
R8699 | T10098 | T10097 | arg2Of | GR,activated |
R8700 | T10098 | T10099 | arg1Of | GR,does |
R8701 | T10098 | T10101 | arg1Of | GR,enhance |
R8702 | T10101 | T10095 | arg2Of | enhance,suggesting |
R8703 | T10101 | T10096 | arg1Of | enhance,that |
R8704 | T10101 | T10099 | arg2Of | enhance,does |
R8705 | T10101 | T10100 | arg1Of | enhance,not |
R8706 | T10104 | T10101 | arg2Of | export,enhance |
R8707 | T10104 | T10102 | arg1Of | export,GATA-3 |
R8708 | T10104 | T10103 | arg1Of | export,nuclear |
R8709 | T10108 | T10107 | arg1Of | effect,the |
R8710 | T10108 | T10109 | arg1Of | effect,of |
R8711 | T10108 | T10111 | arg1Of | effect,on |
R8712 | T10108 | T10115 | arg1Of | effect,was |
R8713 | T10108 | T10117 | arg1Of | effect,nonspecific |
R8714 | T10110 | T10109 | arg2Of | FP,of |
R8715 | T10114 | T10111 | arg2Of | import,on |
R8716 | T10114 | T10112 | arg1Of | import,GATA-3 |
R8717 | T10114 | T10113 | arg1Of | import,nuclear |
R8718 | T10115 | T10105 | arg1Of | was,Finally |
R8719 | T10115 | T10106 | arg1Of | was,"," |
R8720 | T10115 | T10116 | arg1Of | was,not |
R8721 | T10115 | T10118 | arg1Of | was,"," |
R8722 | T10117 | T10115 | arg2Of | nonspecific,was |
R8723 | T10119 | T10115 | arg3Of | since,was |
R8724 | T10120 | T10121 | arg1Of | FP,( |
R8725 | T10120 | T10125 | arg1Of | FP,had |
R8726 | T10123 | T10121 | arg2Of | M,( |
R8727 | T10123 | T10122 | arg1Of | M,10−8 |
R8728 | T10124 | T10121 | arg3Of | ),( |
R8729 | T10125 | T10119 | arg2Of | had,since |
R8730 | T10125 | T10128 | arg1Of | had,on |
R8731 | T10127 | T10125 | arg2Of | effect,had |
R8732 | T10127 | T10126 | arg1Of | effect,no |
R8733 | T10131 | T10128 | arg2Of | translocation,on |
R8734 | T10131 | T10129 | arg1Of | translocation,p65 |
R8735 | T10131 | T10130 | arg1Of | translocation,nuclear |
R8736 | T10131 | T10132 | arg2Of | translocation,measured |
R8737 | T10132 | T10133 | arg1Of | measured,at |
R8738 | T10135 | T10133 | arg2Of | min,at |
R8739 | T10135 | T10134 | arg1Of | min,60 |
R8740 | T10135 | T10136 | arg1Of | min,( |
R8741 | T10138 | T10136 | arg2Of | 5D,( |
R8742 | T10138 | T10137 | arg1Of | 5D,Figure |
R8743 | T10139 | T10136 | arg3Of | ),( |
R9645 | T11311 | T11309 | arg1Of | Effect,The |
R9646 | T11311 | T11310 | arg1Of | Effect,Inhibitory |
R9647 | T11311 | T11312 | arg1Of | Effect,of |
R9648 | T11311 | T11314 | arg1Of | Effect,on |
R9649 | T11313 | T11312 | arg2Of | Corticosteroids,of |
R9650 | T11317 | T11314 | arg2Of | Localization,on |
R9651 | T11317 | T11315 | arg1Of | Localization,GATA-3 |
R9652 | T11317 | T11316 | arg1Of | Localization,Nuclear |
R9653 | T11317 | T11318 | arg1Of | Localization,in |
R9654 | T11317 | T11325 | arg1Of | Localization,In |
R9655 | T11317 | T11326 | arg1Of | Localization,Vivo |
R9656 | T11323 | T11318 | arg2Of | Vivo,in |
R9657 | T11323 | T11319 | arg1Of | Vivo,Primary |
R9658 | T11323 | T11320 | arg1Of | Vivo,T |
R9659 | T11323 | T11321 | arg1Of | Vivo,Lymphocytes |
R9660 | T11323 | T11322 | arg1Of | Vivo,Ex |
R9661 | T11323 | T11324 | arg1Of | Vivo,and |
R9662 | T11327 | T11328 | arg1Of | Treatment,with |
R9663 | T11327 | T11332 | arg1Of | Treatment,demonstrated |
R9664 | T11329 | T11328 | arg2Of | FP,with |
R9665 | T11329 | T11331 | arg1Of | FP,vivo |
R9666 | T11331 | T11330 | arg1Of | vivo,ex |
R9667 | T11335 | T11332 | arg2Of | decrease,demonstrated |
R9668 | T11335 | T11333 | arg1Of | decrease,a |
R9669 | T11335 | T11334 | arg1Of | decrease,concentration-dependent |
R9670 | T11335 | T11336 | arg1Of | decrease,in |
R9671 | T11339 | T11336 | arg2Of | interaction,in |
R9672 | T11339 | T11337 | arg1Of | interaction,the |
R9673 | T11339 | T11338 | arg1Of | interaction,direct |
R9674 | T11339 | T11340 | arg1Of | interaction,between |
R9675 | T11341 | T11342 | arg1Of | phospho-GATA-3,and |
R9676 | T11342 | T11340 | arg2Of | and,between |
R9677 | T11342 | T11344 | arg1Of | and,in |
R9678 | T11342 | T11356 | arg1Of | and,"," |
R9679 | T11342 | T11357 | arg1Of | and,which |
R9680 | T11342 | T11358 | arg1Of | and,was |
R9681 | T11342 | T11360 | arg2Of | and,inhibited |
R9682 | T11342 | T11377 | arg2Of | and,attenuated |
R9683 | T11343 | T11342 | arg2Of | importin-α,and |
R9684 | T11345 | T11344 | arg2Of | PBMCs,in |
R9685 | T11345 | T11346 | arg1Of | PBMCs,from |
R9686 | T11347 | T11346 | arg2Of | patients,from |
R9687 | T11347 | T11348 | arg1Of | patients,with |
R9688 | T11347 | T11350 | arg1Of | patients,( |
R9689 | T11349 | T11348 | arg2Of | asthma,with |
R9690 | T11352 | T11351 | arg1Of | 6A,Figure |
R9691 | T11352 | T11353 | arg1Of | 6A,and |
R9692 | T11353 | T11350 | arg2Of | and,( |
R9693 | T11354 | T11353 | arg2Of | 6B,and |
R9694 | T11355 | T11350 | arg3Of | ),( |
R9695 | T11360 | T11361 | arg1Of | inhibited,at |
R9696 | T11360 | T11375 | arg1Of | inhibited,and |
R9697 | T11362 | T11363 | arg1Of | 10−12,M |
R9698 | T11364 | T11361 | arg2Of | FP,at |
R9699 | T11364 | T11362 | arg1Of | FP,10−12 |
R9700 | T11364 | T11365 | arg1Of | FP,( |
R9701 | T11366 | T11365 | arg2Of | p,( |
R9702 | T11366 | T11367 | arg1Of | p,< |
R9703 | T11366 | T11369 | arg1Of | p,"," |
R9704 | T11367 | T11368 | arg1Of | <,0.001 |
R9705 | T11370 | T11371 | arg1Of | ANOVA,and |
R9706 | T11371 | T11369 | arg2Of | and,"," |
R9707 | T11373 | T11371 | arg2Of | test,and |
R9708 | T11373 | T11372 | arg1Of | test,Newman-Keuls |
R9709 | T11374 | T11365 | arg3Of | ),( |
R9710 | T11375 | T11358 | arg2Of | and,was |
R9711 | T11375 | T11359 | arg1Of | and,significantly |
R9712 | T11377 | T11375 | arg2Of | attenuated,and |
R9713 | T11377 | T11376 | arg1Of | attenuated,completely |
R9714 | T11379 | T11380 | arg1Of | 10−8,M |
R9715 | T11381 | T11377 | arg1Of | FP,attenuated |
R9716 | T11381 | T11378 | arg2Of | FP,by |
R9717 | T11381 | T11379 | arg1Of | FP,10−8 |
R9718 | T11381 | T11382 | arg1Of | FP,( |
R9719 | T11383 | T11382 | arg2Of | p,( |
R9720 | T11383 | T11384 | arg1Of | p,< |
R9721 | T11383 | T11386 | arg1Of | p,"," |
R9722 | T11384 | T11385 | arg1Of | <,0.001 |
R9723 | T11387 | T11388 | arg1Of | ANOVA,and |
R9724 | T11388 | T11386 | arg2Of | and,"," |
R9725 | T11390 | T11388 | arg2Of | test,and |
R9726 | T11390 | T11389 | arg1Of | test,Newman-Keuls |
R9727 | T11391 | T11382 | arg3Of | ),( |
R9728 | T11397 | T11392 | arg1Of | studies,Our |
R9729 | T11397 | T11393 | arg1Of | studies,previous |
R9730 | T11397 | T11394 | arg1Of | studies,T |
R9731 | T11397 | T11395 | arg1Of | studies,cell |
R9732 | T11397 | T11396 | arg1Of | studies,line |
R9733 | T11397 | T11398 | arg1Of | studies,indicated |
R9734 | T11400 | T11401 | arg1Of | 10−12,M |
R9735 | T11402 | T11400 | arg1Of | FP,10−12 |
R9736 | T11402 | T11403 | arg1Of | FP,suppresses |
R9737 | T11402 | T11410 | arg1Of | FP,attenuated |
R9738 | T11403 | T11409 | arg1Of | suppresses,and |
R9739 | T11404 | T11405 | arg1Of | IL-4,and |
R9740 | T11406 | T11405 | arg2Of | -5,and |
R9741 | T11408 | T11403 | arg2Of | expression,suppresses |
R9742 | T11408 | T11404 | arg1Of | expression,IL-4 |
R9743 | T11408 | T11406 | arg1Of | expression,-5 |
R9744 | T11408 | T11407 | arg1Of | expression,gene |
R9745 | T11409 | T11398 | arg2Of | and,indicated |
R9746 | T11409 | T11399 | arg1Of | and,that |
R9747 | T11410 | T11409 | arg2Of | attenuated,and |
R9748 | T11410 | T11417 | arg1Of | attenuated,( |
R9749 | T11412 | T11410 | arg2Of | interaction,attenuated |
R9750 | T11412 | T11411 | arg1Of | interaction,the |
R9751 | T11412 | T11413 | arg1Of | interaction,of |
R9752 | T11412 | T11415 | arg1Of | interaction,with |
R9753 | T11414 | T11413 | arg2Of | GATA-3,of |
R9754 | T11416 | T11415 | arg2Of | importin-α,with |
R9755 | T11418 | T11417 | arg2Of | see,( |
R9756 | T11420 | T11421 | arg1Of | 1D,and |
R9757 | T11421 | T11418 | arg2Of | and,see |
R9758 | T11421 | T11419 | arg1Of | and,Figures |
R9759 | T11422 | T11421 | arg2Of | 2,and |
R9760 | T11423 | T11417 | arg3Of | ),( |
R9761 | T11425 | T11424 | arg1Of | concentration,This |
R9762 | T11425 | T11426 | arg1Of | concentration,is |
R9763 | T11425 | T11427 | arg1Of | concentration,close |
R9764 | T11427 | T11426 | arg2Of | close,is |
R9765 | T11427 | T11428 | arg1Of | close,to |
R9766 | T11431 | T11428 | arg2Of | levels,to |
R9767 | T11431 | T11429 | arg1Of | levels,peak |
R9768 | T11431 | T11430 | arg1Of | levels,plasma |
R9769 | T11431 | T11432 | arg2Of | levels,obtained |
R9770 | T11432 | T11433 | arg1Of | obtained,from |
R9771 | T11435 | T11433 | arg2Of | patients,from |
R9772 | T11435 | T11434 | arg1Of | patients,asthmatic |
R9773 | T11435 | T11436 | arg2Of | patients,treated |
R9774 | T11436 | T11437 | arg1Of | treated,with |
R9775 | T11436 | T11444 | arg1Of | treated,[ |
R9776 | T11439 | T11437 | arg2Of | FP,with |
R9777 | T11439 | T11438 | arg2Of | FP,inhaled |
R9778 | T11439 | T11440 | arg1Of | FP,( |
R9779 | T11442 | T11440 | arg2Of | µg,( |
R9780 | T11442 | T11441 | arg1Of | µg,500 |
R9781 | T11443 | T11440 | arg3Of | ),( |
R9782 | T11445 | T11444 | arg2Of | 27,[ |
R9783 | T11446 | T11444 | arg3Of | ],[ |
R9784 | T11448 | T11447 | arg2Of | FP,Inhaled |
R9785 | T11448 | T11449 | arg1Of | FP,( |
R9786 | T11451 | T11449 | arg2Of | µg,( |
R9787 | T11451 | T11450 | arg1Of | µg,500 |
R9788 | T11452 | T11449 | arg3Of | ),( |
R9789 | T11453 | T11448 | arg1Of | treatment,FP |
R9790 | T11453 | T11454 | arg1Of | treatment,of |
R9791 | T11453 | T11460 | arg1Of | treatment,reduced |
R9792 | T11458 | T11454 | arg2Of | patients,of |
R9793 | T11458 | T11455 | arg1Of | patients,seven |
R9794 | T11458 | T11456 | arg1Of | patients,steroid-naive |
R9795 | T11458 | T11457 | arg1Of | patients,asthma |
R9796 | T11460 | T11459 | arg1Of | reduced,significantly |
R9797 | T11460 | T11464 | arg1Of | reduced,vivo |
R9798 | T11460 | T11465 | arg1Of | reduced,in |
R9799 | T11462 | T11460 | arg2Of | interaction,reduced |
R9800 | T11462 | T11461 | arg1Of | interaction,GATA-3–importin-α |
R9801 | T11464 | T11463 | arg1Of | vivo,in |
R9802 | T11468 | T11465 | arg2Of | manner,in |
R9803 | T11468 | T11466 | arg1Of | manner,a |
R9804 | T11468 | T11467 | arg1Of | manner,time-dependent |
R9805 | T11469 | T11470 | arg1Of | This,produced |
R9806 | T11473 | T11472 | arg1Of | 90,> |
R9807 | T11473 | T11474 | arg1Of | 90,% |
R9808 | T11475 | T11470 | arg2Of | decrease,produced |
R9809 | T11475 | T11471 | arg1Of | decrease,a |
R9810 | T11475 | T11473 | arg1Of | decrease,90 |
R9811 | T11475 | T11476 | arg1Of | decrease,in |
R9812 | T11475 | T11479 | arg1Of | decrease,at |
R9813 | T11475 | T11482 | arg1Of | decrease,( |
R9814 | T11478 | T11476 | arg2Of | association,in |
R9815 | T11478 | T11477 | arg1Of | association,GATA-3–importin-α |
R9816 | T11481 | T11479 | arg2Of | h,at |
R9817 | T11481 | T11480 | arg1Of | h,2 |
R9818 | T11483 | T11484 | arg1Of | median,[ |
R9819 | T11483 | T11489 | arg1Of | median,"," |
R9820 | T11485 | T11486 | arg1Of | 95,% |
R9821 | T11487 | T11484 | arg2Of | CI,[ |
R9822 | T11487 | T11485 | arg1Of | CI,95 |
R9823 | T11488 | T11484 | arg3Of | ],[ |
R9824 | T11489 | T11482 | arg2Of | ",",( |
R9825 | T11489 | T11494 | arg1Of | ",",versus |
R9826 | T11490 | T11489 | arg2Of | "13,494","," |
R9827 | T11490 | T11491 | arg1Of | "13,494",[ |
R9828 | T11492 | T11491 | arg2Of | "6,828–17,829",[ |
R9829 | T11493 | T11491 | arg3Of | ],[ |
R9830 | T11495 | T11496 | arg1Of | 879,[ |
R9831 | T11495 | T11499 | arg1Of | 879,; |
R9832 | T11495 | T11504 | arg2Of | 879,'s |
R9833 | T11497 | T11496 | arg2Of | "597–1,165",[ |
R9834 | T11498 | T11496 | arg3Of | ],[ |
R9835 | T11500 | T11499 | arg2Of | p,; |
R9836 | T11500 | T11503 | arg1Of | p,Friedman |
R9837 | T11503 | T11501 | arg1Of | Friedman,< |
R9838 | T11503 | T11502 | arg1Of | Friedman,0.05 |
R9839 | T11505 | T11494 | arg2Of | analysis,versus |
R9840 | T11505 | T11504 | arg1Of | analysis,'s |
R9841 | T11506 | T11482 | arg3Of | ),( |
R9842 | T11509 | T11510 | arg1Of | this,did |
R9843 | T11509 | T11512 | arg1Of | this,reach |
R9844 | T11509 | T11514 | arg1Of | this,using |
R9845 | T11512 | T11507 | arg1Of | reach,However |
R9846 | T11512 | T11508 | arg1Of | reach,"," |
R9847 | T11512 | T11510 | arg2Of | reach,did |
R9848 | T11512 | T11511 | arg1Of | reach,not |
R9849 | T11512 | T11514 | modOf | reach,using |
R9850 | T11512 | T11522 | arg1Of | reach,probably |
R9851 | T11512 | T11524 | arg1Of | reach,to |
R9852 | T11513 | T11512 | arg2Of | significance,reach |
R9853 | T11515 | T11516 | arg2Of | Wilcoxon,'s |
R9854 | T11518 | T11514 | arg2Of | analysis,using |
R9855 | T11518 | T11516 | arg1Of | analysis,'s |
R9856 | T11518 | T11517 | arg1Of | analysis,post-test |
R9857 | T11518 | T11519 | arg1Of | analysis,( |
R9858 | T11520 | T11519 | arg2Of | W = 6.00,( |
R9859 | T11521 | T11519 | arg3Of | ),( |
R9860 | T11524 | T11523 | arg1Of | to,due |
R9861 | T11526 | T11524 | arg2Of | numbers,to |
R9862 | T11526 | T11525 | arg1Of | numbers,low |
R9863 | T11526 | T11527 | arg1Of | numbers,of |
R9864 | T11528 | T11527 | arg2Of | participants,of |
R9865 | T11530 | T11529 | arg1Of | results,Similar |
R9866 | T11530 | T11531 | arg1Of | results,were |
R9867 | T11530 | T11532 | arg2Of | results,observed |
R9868 | T11532 | T11531 | arg2Of | observed,were |
R9869 | T11532 | T11533 | arg1Of | observed,when |
R9870 | T11535 | T11534 | arg1Of | association,GATA-3–importin-α |
R9871 | T11535 | T11536 | arg1Of | association,was |
R9872 | T11535 | T11537 | arg2Of | association,measured |
R9873 | T11537 | T11533 | arg2Of | measured,when |
R9874 | T11537 | T11536 | arg2Of | measured,was |
R9875 | T11537 | T11538 | arg1Of | measured,( |
R9876 | T11540 | T11539 | arg1Of | 6C,Figure |
R9877 | T11540 | T11541 | arg1Of | 6C,and |
R9878 | T11541 | T11538 | arg2Of | and,( |
R9879 | T11542 | T11541 | arg2Of | 6D,and |
R9880 | T11543 | T11538 | arg3Of | ),( |
R9881 | T11546 | T11544 | arg1Of | dose,The |
R9882 | T11546 | T11545 | arg1Of | dose,lower |
R9883 | T11546 | T11547 | arg1Of | dose,of |
R9884 | T11546 | T11553 | arg1Of | dose,was |
R9885 | T11546 | T11555 | arg1Of | dose,effective |
R9886 | T11548 | T11547 | arg2Of | FP,of |
R9887 | T11548 | T11549 | arg1Of | FP,( |
R9888 | T11551 | T11549 | arg2Of | µg,( |
R9889 | T11551 | T11550 | arg1Of | µg,100 |
R9890 | T11552 | T11549 | arg3Of | ),( |
R9891 | T11553 | T11554 | arg1Of | was,not |
R9892 | T11555 | T11553 | arg2Of | effective,was |
R9893 | T11558 | T11556 | arg1Of | interaction,The |
R9894 | T11558 | T11557 | arg1Of | interaction,attenuated |
R9895 | T11558 | T11559 | arg1Of | interaction,of |
R9896 | T11558 | T11561 | arg1Of | interaction,did |
R9897 | T11558 | T11563 | arg1Of | interaction,result |
R9898 | T11560 | T11559 | arg2Of | GATA-3,of |
R9899 | T11563 | T11561 | arg2Of | result,did |
R9900 | T11563 | T11562 | arg1Of | result,not |
R9901 | T11563 | T11564 | arg1Of | result,from |
R9902 | T11563 | T11570 | arg1Of | result,"," |
R9903 | T11563 | T11571 | arg1Of | result,as |
R9904 | T11567 | T11564 | arg2Of | recycling,from |
R9905 | T11567 | T11565 | arg1Of | recycling,the |
R9906 | T11567 | T11566 | arg1Of | recycling,defective |
R9907 | T11567 | T11568 | arg1Of | recycling,of |
R9908 | T11569 | T11568 | arg2Of | importin-α,of |
R9909 | T11574 | T11572 | arg1Of | decrease,a |
R9910 | T11574 | T11573 | arg1Of | decrease,significant |
R9911 | T11574 | T11575 | arg1Of | decrease,in |
R9912 | T11574 | T11584 | arg1Of | decrease,was |
R9913 | T11574 | T11586 | arg2Of | decrease,detected |
R9914 | T11577 | T11575 | arg2Of | abundance,in |
R9915 | T11577 | T11576 | arg1Of | abundance,the |
R9916 | T11577 | T11578 | arg1Of | abundance,of |
R9917 | T11577 | T11580 | arg1Of | abundance,in |
R9918 | T11579 | T11578 | arg2Of | importin-α,of |
R9919 | T11583 | T11580 | arg2Of | pool,in |
R9920 | T11583 | T11581 | arg1Of | pool,the |
R9921 | T11583 | T11582 | arg1Of | pool,cytoplasmic |
R9922 | T11586 | T11571 | arg2Of | detected,as |
R9923 | T11586 | T11584 | arg2Of | detected,was |
R9924 | T11586 | T11585 | arg1Of | detected,not |
R9925 | T11586 | T11587 | arg1Of | detected,( |
R9926 | T11589 | T11587 | arg2Of | 6E,( |
R9927 | T11589 | T11588 | arg1Of | 6E,Figure |
R9928 | T11590 | T11587 | arg3Of | ),( |
R9929 | T11591 | T11593 | arg1Of | We,examined |
R9930 | T11593 | T11592 | arg1Of | examined,further |
R9931 | T11596 | T11595 | arg2Of | FP,inhaled |
R9932 | T11596 | T11597 | arg1Of | FP,could |
R9933 | T11596 | T11598 | arg1Of | FP,affect |
R9934 | T11598 | T11593 | arg2Of | affect,examined |
R9935 | T11598 | T11594 | arg1Of | affect,whether |
R9936 | T11598 | T11597 | arg2Of | affect,could |
R9937 | T11600 | T11598 | arg2Of | localization,affect |
R9938 | T11600 | T11599 | arg1Of | localization,cellular |
R9939 | T11600 | T11601 | arg1Of | localization,of |
R9940 | T11600 | T11603 | arg1Of | localization,in |
R9941 | T11602 | T11601 | arg2Of | GATA-3,of |
R9942 | T11607 | T11603 | arg2Of | cells,in |
R9943 | T11607 | T11604 | arg1Of | cells,peripheral |
R9944 | T11607 | T11605 | arg1Of | cells,blood |
R9945 | T11607 | T11606 | arg1Of | cells,T |
R9946 | T11608 | T11609 | arg1Of | Treatment,with |
R9947 | T11608 | T11616 | arg1Of | Treatment,for |
R9948 | T11608 | T11620 | arg1Of | Treatment,increased |
R9949 | T11608 | T11630 | arg1Of | Treatment,decreased |
R9950 | T11611 | T11609 | arg2Of | FP,with |
R9951 | T11611 | T11610 | arg2Of | FP,inhaled |
R9952 | T11611 | T11612 | arg1Of | FP,( |
R9953 | T11614 | T11612 | arg2Of | µg,( |
R9954 | T11614 | T11613 | arg1Of | µg,500 |
R9955 | T11615 | T11612 | arg3Of | ),( |
R9956 | T11618 | T11616 | arg2Of | h,for |
R9957 | T11618 | T11617 | arg1Of | h,2 |
R9958 | T11620 | T11628 | arg1Of | increased,and |
R9959 | T11623 | T11620 | arg2Of | translocation,increased |
R9960 | T11623 | T11621 | arg1Of | translocation,GR |
R9961 | T11623 | T11622 | arg1Of | translocation,nuclear |
R9962 | T11623 | T11624 | arg1Of | translocation,( |
R9963 | T11626 | T11624 | arg2Of | 7A,( |
R9964 | T11626 | T11625 | arg1Of | 7A,Figure |
R9965 | T11627 | T11624 | arg3Of | ),( |
R9966 | T11628 | T11619 | arg1Of | and,significantly |
R9967 | T11630 | T11628 | arg2Of | decreased,and |
R9968 | T11630 | T11629 | arg1Of | decreased,concomitantly |
R9969 | T11630 | T11661 | arg1Of | decreased,compared |
R9970 | T11632 | T11630 | arg2Of | number,decreased |
R9971 | T11632 | T11631 | arg1Of | number,the |
R9972 | T11632 | T11633 | arg1Of | number,of |
R9973 | T11640 | T11633 | arg2Of | cells,of |
R9974 | T11640 | T11634 | arg1Of | cells,nuclear |
R9975 | T11640 | T11635 | arg1Of | cells,GATA-3 |
R9976 | T11640 | T11636 | arg1Of | cells,immunoreactive |
R9977 | T11640 | T11637 | arg1Of | cells,peripheral |
R9978 | T11640 | T11638 | arg1Of | cells,blood |
R9979 | T11640 | T11639 | arg1Of | cells,T |
R9980 | T11640 | T11641 | arg1Of | cells,( |
R9981 | T11645 | T11641 | arg2Of | %,( |
R9982 | T11645 | T11642 | arg1Of | %,37 |
R9983 | T11645 | T11643 | arg1Of | %,% |
R9984 | T11645 | T11644 | arg1Of | %,±4.2 |
R9985 | T11645 | T11646 | arg1Of | %,versus |
R9986 | T11645 | T11651 | arg1Of | %,"," |
R9987 | T11650 | T11646 | arg2Of | %,versus |
R9988 | T11650 | T11647 | arg1Of | %,58.2 |
R9989 | T11650 | T11648 | arg1Of | %,% |
R9990 | T11650 | T11649 | arg1Of | %,±4.95 |
R9991 | T11652 | T11651 | arg2Of | p = 0.016,"," |
R9992 | T11652 | T11653 | arg1Of | p = 0.016,"," |
R9993 | T11652 | T11655 | arg1Of | p = 0.016,"," |
R9994 | T11654 | T11653 | arg2Of | W = 28.0,"," |
R9995 | T11656 | T11657 | arg2Of | Wilcoxon,'s |
R9996 | T11659 | T11655 | arg2Of | test,"," |
R9997 | T11659 | T11657 | arg1Of | test,'s |
R9998 | T11659 | T11658 | arg1Of | test,rank |
R9999 | T11660 | T11641 | arg3Of | ),( |
R10000 | T11662 | T11661 | arg2Of | with,compared |
R10001 | T11663 | T11662 | arg2Of | placebo,with |
R10002 | T11663 | T11664 | arg1Of | placebo,as |
R10003 | T11665 | T11664 | arg2Of | measured,as |
R10004 | T11665 | T11666 | arg1Of | measured,by |
R10005 | T11667 | T11666 | arg2Of | immunocytochemistry,by |
R10006 | T11667 | T11668 | arg1Of | immunocytochemistry,( |
R10007 | T11670 | T11669 | arg1Of | 7A,Figure |
R10008 | T11670 | T11671 | arg1Of | 7A,and |
R10009 | T11671 | T11668 | arg2Of | and,( |
R10010 | T11672 | T11671 | arg2Of | 7B,and |
R10011 | T11673 | T11668 | arg3Of | ),( |
R10012 | T11674 | T11675 | arg1Of | This,was |
R10013 | T11674 | T11676 | arg2Of | This,confirmed |
R10014 | T11676 | T11675 | arg2Of | confirmed,was |
R10015 | T11679 | T11676 | arg1Of | blotting,confirmed |
R10016 | T11679 | T11677 | arg2Of | blotting,by |
R10017 | T11679 | T11678 | arg1Of | blotting,Western |
R10018 | T11679 | T11680 | arg1Of | blotting,"," |
R10019 | T11679 | T11681 | arg1Of | blotting,which |
R10020 | T11679 | T11683 | arg1Of | blotting,indicated |
R10021 | T11683 | T11682 | arg1Of | indicated,also |
R10022 | T11686 | T11685 | arg1Of | effect,this |
R10023 | T11686 | T11687 | arg1Of | effect,was |
R10024 | T11687 | T11683 | arg2Of | was,indicated |
R10025 | T11687 | T11684 | arg1Of | was,that |
R10026 | T11689 | T11690 | arg1Of | time-,and |
R10027 | T11690 | T11688 | arg1Of | and,both |
R10028 | T11691 | T11690 | arg2Of | dose-dependent,and |
R10029 | T11694 | T11693 | arg1Of | 7C,Figure |
R10030 | T11694 | T11695 | arg1Of | 7C,and |
R10031 | T11695 | T11687 | arg2Of | and,was |
R10032 | T11695 | T11689 | arg1Of | and,time- |
R10033 | T11695 | T11691 | arg1Of | and,dose-dependent |
R10034 | T11695 | T11692 | arg2Of | and,( |
R10035 | T11696 | T11695 | arg2Of | 7D,and |
R10036 | T11697 | T11692 | arg3Of | ),( |
R10037 | T11701 | T11700 | arg2Of | FP,inhaled |
R10038 | T11701 | T11702 | arg1Of | FP,( |
R10039 | T11701 | T11706 | arg1Of | FP,induced |
R10040 | T11704 | T11702 | arg2Of | µg,( |
R10041 | T11704 | T11703 | arg1Of | µg,500 |
R10042 | T11705 | T11702 | arg3Of | ),( |
R10043 | T11706 | T11748 | arg1Of | induced,and |
R10044 | T11708 | T11706 | arg2Of | loss,induced |
R10045 | T11708 | T11707 | arg1Of | loss,significant |
R10046 | T11708 | T11709 | arg1Of | loss,in |
R10047 | T11708 | T11712 | arg1Of | loss,at |
R10048 | T11708 | T11715 | arg1Of | loss,( |
R10049 | T11708 | T11744 | arg1Of | loss,( |
R10050 | T11711 | T11709 | arg2Of | GATA-3,in |
R10051 | T11711 | T11710 | arg1Of | GATA-3,nuclear |
R10052 | T11714 | T11712 | arg2Of | h,at |
R10053 | T11714 | T11713 | arg1Of | h,2 |
R10054 | T11716 | T11715 | arg2Of | median,( |
R10055 | T11716 | T11717 | arg1Of | median,[ |
R10056 | T11716 | T11722 | arg1Of | median,"," |
R10057 | T11716 | T11732 | arg1Of | median,"," |
R10058 | T11718 | T11719 | arg1Of | 95,% |
R10059 | T11720 | T11717 | arg2Of | CI,[ |
R10060 | T11720 | T11718 | arg1Of | CI,95 |
R10061 | T11721 | T11717 | arg3Of | ],[ |
R10062 | T11723 | T11722 | arg2Of | 0.40,"," |
R10063 | T11723 | T11724 | arg1Of | 0.40,[ |
R10064 | T11723 | T11727 | arg1Of | 0.40,versus |
R10065 | T11725 | T11724 | arg2Of | 0.27–0.53,[ |
R10066 | T11726 | T11724 | arg3Of | ],[ |
R10067 | T11728 | T11727 | arg2Of | 0.14,versus |
R10068 | T11728 | T11729 | arg1Of | 0.14,[ |
R10069 | T11730 | T11729 | arg2Of | 0.11–0.19,[ |
R10070 | T11731 | T11729 | arg3Of | ],[ |
R10071 | T11733 | T11732 | arg2Of | p,"," |
R10072 | T11733 | T11734 | arg1Of | p,< |
R10073 | T11733 | T11735 | arg1Of | p,0.05 |
R10074 | T11733 | T11736 | arg1Of | p,"," |
R10075 | T11733 | T11738 | arg1Of | p,"," |
R10076 | T11737 | T11736 | arg2Of | W = 21.00,"," |
R10077 | T11739 | T11740 | arg2Of | Wilcoxon,'s |
R10078 | T11742 | T11738 | arg2Of | test,"," |
R10079 | T11742 | T11740 | arg1Of | test,'s |
R10080 | T11742 | T11741 | arg1Of | test,rank |
R10081 | T11743 | T11715 | arg3Of | ),( |
R10082 | T11746 | T11744 | arg2Of | 7C,( |
R10083 | T11746 | T11745 | arg1Of | 7C,Figure |
R10084 | T11747 | T11744 | arg3Of | ),( |
R10085 | T11748 | T11698 | arg1Of | and,Thus |
R10086 | T11748 | T11699 | arg1Of | and,"," |
R10087 | T11751 | T11749 | arg1Of | levels,cytoplasmic |
R10088 | T11751 | T11750 | arg1Of | levels,GATA-3 |
R10089 | T11751 | T11752 | arg1Of | levels,were |
R10090 | T11751 | T11753 | arg2Of | levels,enhanced |
R10091 | T11753 | T11748 | arg2Of | enhanced,and |
R10092 | T11753 | T11752 | arg2Of | enhanced,were |
R10093 | T11753 | T11757 | arg1Of | enhanced,in |
R10094 | T11756 | T11753 | arg1Of | FP,enhanced |
R10095 | T11756 | T11754 | arg2Of | FP,by |
R10096 | T11756 | T11755 | arg2Of | FP,inhaled |
R10097 | T11760 | T11757 | arg2Of | manner,in |
R10098 | T11760 | T11758 | arg1Of | manner,a |
R10099 | T11760 | T11759 | arg1Of | manner,dose-dependent |
R10100 | T11760 | T11761 | arg1Of | manner,( |
R10101 | T11760 | T11790 | arg1Of | manner,( |
R10102 | T11762 | T11761 | arg2Of | median,( |
R10103 | T11762 | T11763 | arg1Of | median,[ |
R10104 | T11762 | T11768 | arg1Of | median,"," |
R10105 | T11762 | T11778 | arg1Of | median,"," |
R10106 | T11764 | T11765 | arg1Of | 95,% |
R10107 | T11766 | T11763 | arg2Of | CI,[ |
R10108 | T11766 | T11764 | arg1Of | CI,95 |
R10109 | T11767 | T11763 | arg3Of | ],[ |
R10110 | T11769 | T11768 | arg2Of | 0.0032,"," |
R10111 | T11769 | T11770 | arg1Of | 0.0032,[ |
R10112 | T11769 | T11773 | arg1Of | 0.0032,versus |
R10113 | T11771 | T11770 | arg2Of | 0.0026–0.0039,[ |
R10114 | T11772 | T11770 | arg3Of | ],[ |
R10115 | T11774 | T11773 | arg2Of | 0.658,versus |
R10116 | T11774 | T11775 | arg1Of | 0.658,[ |
R10117 | T11776 | T11775 | arg2Of | 0.592–0.720,[ |
R10118 | T11777 | T11775 | arg3Of | ],[ |
R10119 | T11779 | T11778 | arg2Of | p,"," |
R10120 | T11779 | T11780 | arg1Of | p,< |
R10121 | T11779 | T11781 | arg1Of | p,0.05 |
R10122 | T11779 | T11782 | arg1Of | p,"," |
R10123 | T11779 | T11784 | arg1Of | p,"," |
R10124 | T11783 | T11782 | arg2Of | W = −21.00,"," |
R10125 | T11785 | T11786 | arg2Of | Wilcoxon,'s |
R10126 | T11788 | T11784 | arg2Of | test,"," |
R10127 | T11788 | T11786 | arg1Of | test,'s |
R10128 | T11788 | T11787 | arg1Of | test,rank |
R10129 | T11789 | T11761 | arg3Of | ),( |
R10130 | T11792 | T11790 | arg2Of | 7D,( |
R10131 | T11792 | T11791 | arg1Of | 7D,Figure |
R10132 | T11793 | T11790 | arg3Of | ),( |
R10133 | T11795 | T11794 | arg2Of | addition,In |
R10134 | T11797 | T11798 | arg1Of | FP,( |
R10135 | T11797 | T11802 | arg1Of | FP,inhibited |
R10136 | T11800 | T11798 | arg2Of | µg,( |
R10137 | T11800 | T11799 | arg1Of | µg,500 |
R10138 | T11801 | T11798 | arg3Of | ),( |
R10139 | T11802 | T11794 | arg1Of | inhibited,In |
R10140 | T11802 | T11796 | arg1Of | inhibited,"," |
R10141 | T11802 | T11806 | arg1Of | inhibited,in |
R10142 | T11802 | T11811 | arg1Of | inhibited,vivo |
R10143 | T11802 | T11812 | arg1Of | inhibited,at |
R10144 | T11802 | T11815 | arg1Of | inhibited,in |
R10145 | T11805 | T11802 | arg2Of | phosphorylation,inhibited |
R10146 | T11805 | T11803 | arg1Of | phosphorylation,p38 |
R10147 | T11805 | T11804 | arg1Of | phosphorylation,MAPK |
R10148 | T11809 | T11806 | arg2Of | cells,in |
R10149 | T11809 | T11807 | arg1Of | cells,primary |
R10150 | T11809 | T11808 | arg1Of | cells,T |
R10151 | T11811 | T11810 | arg1Of | vivo,in |
R10152 | T11814 | T11812 | arg2Of | h,at |
R10153 | T11814 | T11813 | arg1Of | h,2 |
R10154 | T11816 | T11815 | arg2Of | samples,in |
R10155 | T11816 | T11817 | arg1Of | samples,from |
R10156 | T11819 | T11817 | arg2Of | patients,from |
R10157 | T11819 | T11818 | arg1Of | patients,two |
R10158 | T11819 | T11820 | arg1Of | patients,( |
R10159 | T11822 | T11820 | arg2Of | 7E,( |
R10160 | T11822 | T11821 | arg1Of | 7E,Figure |
R10161 | T11823 | T11820 | arg3Of | ),( |
R10162 | T11824 | T11825 | arg1Of | Taken,together |
R10163 | T11828 | T11827 | arg1Of | data,our |
R10164 | T11828 | T11829 | arg1Of | data,suggest |
R10165 | T11829 | T11824 | modOf | suggest,Taken |
R10166 | T11829 | T11826 | arg1Of | suggest,"," |
R10167 | T11832 | T11831 | arg2Of | FP,inhaled |
R10168 | T11832 | T11833 | arg1Of | FP,reduces |
R10169 | T11833 | T11829 | arg2Of | reduces,suggest |
R10170 | T11833 | T11830 | arg1Of | reduces,that |
R10171 | T11833 | T11839 | arg1Of | reduces,vivo |
R10172 | T11833 | T11840 | arg1Of | reduces,by |
R10173 | T11835 | T11833 | arg2Of | localization,reduces |
R10174 | T11835 | T11834 | arg1Of | localization,nuclear |
R10175 | T11835 | T11836 | arg1Of | localization,of |
R10176 | T11837 | T11836 | arg2Of | GATA-3,of |
R10177 | T11839 | T11838 | arg1Of | vivo,in |
R10178 | T11842 | T11840 | arg2Of | inhibiting,by |
R10179 | T11842 | T11841 | arg1Of | inhibiting,acutely |
R10180 | T11844 | T11842 | arg2Of | association,inhibiting |
R10181 | T11844 | T11843 | arg1Of | association,phospho-GATA-3–importin |
R10182 | T11846 | T11845 | arg1Of | effect,This |
R10183 | T11846 | T11847 | arg1Of | effect,may |
R10184 | T11846 | T11848 | arg1Of | effect,be |
R10185 | T11846 | T11849 | arg1Of | effect,direct |
R10186 | T11846 | T11860 | arg1Of | effect,secondary |
R10187 | T11848 | T11847 | arg2Of | be,may |
R10188 | T11849 | T11850 | arg1Of | direct,"," |
R10189 | T11849 | T11851 | arg1Of | direct,through |
R10190 | T11849 | T11859 | arg1Of | direct,or |
R10191 | T11852 | T11851 | arg2Of | competition,through |
R10192 | T11852 | T11853 | arg1Of | competition,for |
R10193 | T11854 | T11855 | arg1Of | importin-α,or |
R10194 | T11855 | T11853 | arg2Of | or,for |
R10195 | T11857 | T11855 | arg2Of | molecules,or |
R10196 | T11857 | T11856 | arg2Of | molecules,associated |
R10197 | T11859 | T11848 | arg2Of | or,be |
R10198 | T11859 | T11858 | arg1Of | or,"," |
R10199 | T11860 | T11859 | arg2Of | secondary,or |
R10200 | T11860 | T11861 | arg1Of | secondary,to |
R10201 | T11863 | T11861 | arg2Of | effect,to |
R10202 | T11863 | T11862 | arg1Of | effect,an |
R10203 | T11863 | T11864 | arg1Of | effect,on |
R10204 | T11863 | T11869 | arg1Of | effect,via |
R10205 | T11868 | T11864 | arg2Of | phosphorylation,on |
R10206 | T11868 | T11865 | arg1Of | phosphorylation,p38 |
R10207 | T11868 | T11866 | arg1Of | phosphorylation,MAPK-mediated |
R10208 | T11868 | T11867 | arg1Of | phosphorylation,GATA-3 |
R10209 | T11871 | T11869 | arg2Of | induction,via |
R10210 | T11871 | T11870 | arg1Of | induction,rapid |
R10211 | T11871 | T11872 | arg1Of | induction,of |
R10212 | T11873 | T11872 | arg2Of | MKP-1,of |
R10213 | T11875 | T11874 | arg1Of | combination,The |
R10214 | T11875 | T11876 | arg1Of | combination,of |
R10215 | T11875 | T11881 | arg1Of | combination,can |
R10216 | T11875 | T11882 | arg1Of | combination,result |
R10217 | T11880 | T11876 | arg2Of | effects,of |
R10218 | T11880 | T11877 | arg1Of | effects,these |
R10219 | T11880 | T11878 | arg1Of | effects,two |
R10220 | T11880 | T11879 | arg1Of | effects,interacting |
R10221 | T11882 | T11881 | arg2Of | result,can |
R10222 | T11882 | T11883 | arg1Of | result,in |
R10223 | T11885 | T11884 | arg1Of | suppression,complete |
R10224 | T11885 | T11886 | arg1Of | suppression,of |
R10225 | T11885 | T11890 | arg1Of | suppression,and |
R10226 | T11889 | T11886 | arg2Of | import,of |
R10227 | T11889 | T11887 | arg1Of | import,GATA-3 |
R10228 | T11889 | T11888 | arg1Of | import,nuclear |
R10229 | T11890 | T11883 | arg2Of | and,in |
R10230 | T11895 | T11890 | arg2Of | expression,and |
R10231 | T11895 | T11891 | arg1Of | expression,thus |
R10232 | T11895 | T11892 | arg1Of | expression,Th2 |
R10233 | T11895 | T11893 | arg1Of | expression,cytokine |
R10234 | T11895 | T11894 | arg1Of | expression,gene |
R11419 | T13352 | T13353 | arg1Of | we,have |
R11420 | T13352 | T13354 | arg1Of | we,demonstrated |
R11421 | T13354 | T13351 | arg1Of | demonstrated,Here |
R11422 | T13354 | T13353 | arg2Of | demonstrated,have |
R11423 | T13354 | T13355 | arg1Of | demonstrated,"," |
R11424 | T13354 | T13356 | arg1Of | demonstrated,to |
R11425 | T13354 | T13363 | arg1Of | demonstrated,"," |
R11426 | T13358 | T13356 | arg2Of | knowledge,to |
R11427 | T13358 | T13357 | arg1Of | knowledge,our |
R11428 | T13358 | T13359 | arg1Of | knowledge,for |
R11429 | T13362 | T13359 | arg2Of | time,for |
R11430 | T13362 | T13360 | arg1Of | time,the |
R11431 | T13362 | T13361 | arg1Of | time,first |
R11432 | T13365 | T13366 | arg1Of | corticosteroids,may |
R11433 | T13365 | T13367 | arg1Of | corticosteroids,inhibit |
R11434 | T13367 | T13354 | arg2Of | inhibit,demonstrated |
R11435 | T13367 | T13364 | arg1Of | inhibit,that |
R11436 | T13367 | T13366 | arg2Of | inhibit,may |
R11437 | T13369 | T13368 | arg1Of | function,GATA-3 |
R11438 | T13369 | T13370 | arg1Of | function,and |
R11439 | T13370 | T13367 | arg2Of | and,inhibit |
R11440 | T13373 | T13370 | arg2Of | transcription,and |
R11441 | T13373 | T13371 | arg1Of | transcription,therefore |
R11442 | T13373 | T13372 | arg1Of | transcription,the |
R11443 | T13373 | T13374 | arg1Of | transcription,of |
R11444 | T13373 | T13377 | arg1Of | transcription,via |
R11445 | T13376 | T13374 | arg2Of | genes,of |
R11446 | T13376 | T13375 | arg1Of | genes,Th2 |
R11447 | T13379 | T13380 | arg1Of | distinct,but |
R11448 | T13381 | T13380 | arg2Of | interacting,but |
R11449 | T13383 | T13377 | arg2Of | mechanisms,via |
R11450 | T13383 | T13378 | arg1Of | mechanisms,two |
R11451 | T13383 | T13379 | arg1Of | mechanisms,distinct |
R11452 | T13383 | T13381 | arg1Of | mechanisms,interacting |
R11453 | T13383 | T13382 | arg1Of | mechanisms,molecular |
R11454 | T13387 | T13386 | arg1Of | GR,corticosteroid-activated |
R11455 | T13387 | T13388 | arg1Of | GR,appears |
R11456 | T13387 | T13390 | arg1Of | GR,compete |
R11457 | T13388 | T13384 | arg1Of | appears,Firstly |
R11458 | T13388 | T13385 | arg1Of | appears,"," |
R11459 | T13390 | T13388 | arg2Of | compete,appears |
R11460 | T13390 | T13389 | arg1Of | compete,to |
R11461 | T13390 | T13391 | arg1Of | compete,with |
R11462 | T13390 | T13397 | arg1Of | compete,via |
R11463 | T13393 | T13391 | arg2Of | GATA-3,with |
R11464 | T13393 | T13392 | arg2Of | GATA-3,activated |
R11465 | T13393 | T13394 | arg1Of | GATA-3,for |
R11466 | T13396 | T13394 | arg2Of | import,for |
R11467 | T13396 | T13395 | arg1Of | import,nuclear |
R11468 | T13398 | T13397 | arg2Of | importin-α,via |
R11469 | T13398 | T13399 | arg1Of | importin-α,"," |
R11470 | T13398 | T13400 | arg1Of | importin-α,which |
R11471 | T13398 | T13401 | arg1Of | importin-α,is |
R11472 | T13398 | T13402 | arg2Of | importin-α,required |
R11473 | T13402 | T13401 | arg2Of | required,is |
R11474 | T13402 | T13403 | arg1Of | required,for |
R11475 | T13406 | T13403 | arg2Of | transport,for |
R11476 | T13406 | T13404 | arg1Of | transport,the |
R11477 | T13406 | T13405 | arg1Of | transport,nuclear |
R11478 | T13406 | T13407 | arg1Of | transport,of |
R11479 | T13409 | T13410 | arg1Of | GATA-3,and |
R11480 | T13410 | T13407 | arg2Of | and,of |
R11481 | T13410 | T13408 | arg1Of | and,both |
R11482 | T13411 | T13410 | arg2Of | GR,and |
R11483 | T13414 | T13415 | arg1Of | corticosteroids,at |
R11484 | T13414 | T13418 | arg1Of | corticosteroids,increase |
R11485 | T13414 | T13433 | arg1Of | corticosteroids,prevent |
R11486 | T13417 | T13415 | arg2Of | concentrations,at |
R11487 | T13417 | T13416 | arg1Of | concentrations,higher |
R11488 | T13418 | T13431 | arg1Of | increase,and |
R11489 | T13420 | T13418 | arg2Of | expression,increase |
R11490 | T13420 | T13419 | arg1Of | expression,the |
R11491 | T13420 | T13421 | arg1Of | expression,of |
R11492 | T13422 | T13421 | arg2Of | MKP-1,of |
R11493 | T13422 | T13423 | arg1Of | MKP-1,"," |
R11494 | T13426 | T13423 | arg2Of | inhibitor,"," |
R11495 | T13426 | T13424 | arg1Of | inhibitor,a |
R11496 | T13426 | T13425 | arg1Of | inhibitor,potent |
R11497 | T13426 | T13427 | arg1Of | inhibitor,of |
R11498 | T13430 | T13427 | arg2Of | activity,of |
R11499 | T13430 | T13428 | arg1Of | activity,p38 |
R11500 | T13430 | T13429 | arg1Of | activity,MAPK |
R11501 | T13431 | T13412 | arg1Of | and,Secondly |
R11502 | T13431 | T13413 | arg1Of | and,"," |
R11503 | T13433 | T13431 | arg2Of | prevent,and |
R11504 | T13433 | T13432 | arg1Of | prevent,thereby |
R11505 | T13437 | T13433 | arg2Of | activation,prevent |
R11506 | T13437 | T13434 | arg1Of | activation,T |
R11507 | T13437 | T13435 | arg1Of | activation,cell |
R11508 | T13437 | T13436 | arg1Of | activation,receptor/co-receptor |
R11509 | T13437 | T13438 | arg1Of | activation,of |
R11510 | T13437 | T13441 | modOf | activation,to |
R11511 | T13440 | T13438 | arg2Of | MAPK,of |
R11512 | T13440 | T13439 | arg1Of | MAPK,p38 |
R11513 | T13442 | T13441 | arg1Of | prevent,to |
R11514 | T13444 | T13442 | arg2Of | phosphorylation,prevent |
R11515 | T13444 | T13443 | arg1Of | phosphorylation,the |
R11516 | T13444 | T13445 | arg1Of | phosphorylation,of |
R11517 | T13444 | T13447 | arg1Of | phosphorylation,that |
R11518 | T13444 | T13448 | arg1Of | phosphorylation,is |
R11519 | T13444 | T13449 | arg1Of | phosphorylation,necessary |
R11520 | T13446 | T13445 | arg2Of | GATA-3,of |
R11521 | T13449 | T13448 | arg2Of | necessary,is |
R11522 | T13449 | T13450 | arg1Of | necessary,for |
R11523 | T13451 | T13450 | arg2Of | interaction,for |
R11524 | T13451 | T13452 | arg1Of | interaction,with |
R11525 | T13453 | T13454 | arg1Of | importin-α,and |
R11526 | T13455 | T13454 | arg2Of | subsequent,and |
R11527 | T13457 | T13452 | arg2Of | import,with |
R11528 | T13457 | T13453 | arg1Of | import,importin-α |
R11529 | T13457 | T13455 | arg1Of | import,subsequent |
R11530 | T13457 | T13456 | arg1Of | import,nuclear |
R11531 | T13458 | T13459 | arg1Of | We,have |
R11532 | T13458 | T13461 | arg1Of | We,shown |
R11533 | T13461 | T13459 | arg2Of | shown,have |
R11534 | T13461 | T13460 | arg1Of | shown,previously |
R11535 | T13463 | T13464 | arg1Of | translocation,of |
R11536 | T13463 | T13469 | arg1Of | translocation,to |
R11537 | T13463 | T13472 | arg1Of | translocation,involves |
R11538 | T13465 | T13464 | arg2Of | GATA-3,of |
R11539 | T13465 | T13466 | arg1Of | GATA-3,from |
R11540 | T13468 | T13466 | arg2Of | cytoplasm,from |
R11541 | T13468 | T13467 | arg1Of | cytoplasm,the |
R11542 | T13471 | T13469 | arg2Of | nucleus,to |
R11543 | T13471 | T13470 | arg1Of | nucleus,the |
R11544 | T13472 | T13461 | arg2Of | involves,shown |
R11545 | T13472 | T13462 | arg1Of | involves,that |
R11546 | T13477 | T13472 | arg2Of | importin-α,involves |
R11547 | T13477 | T13473 | arg1Of | importin-α,the |
R11548 | T13477 | T13474 | arg1Of | importin-α,nuclear |
R11549 | T13477 | T13475 | arg1Of | importin-α,transporter |
R11550 | T13477 | T13476 | arg1Of | importin-α,protein |
R11551 | T13477 | T13478 | arg1Of | importin-α,"," |
R11552 | T13477 | T13479 | arg1Of | importin-α,which |
R11553 | T13477 | T13480 | arg1Of | importin-α,interacts |
R11554 | T13480 | T13481 | arg1Of | interacts,with |
R11555 | T13480 | T13484 | arg1Of | interacts,[ |
R11556 | T13483 | T13481 | arg2Of | GATA-3,with |
R11557 | T13483 | T13482 | arg2Of | GATA-3,phosphorylated |
R11558 | T13485 | T13484 | arg2Of | 12,[ |
R11559 | T13486 | T13484 | arg3Of | ],[ |
R11560 | T13487 | T13488 | arg1Of | We,have |
R11561 | T13487 | T13491 | arg1Of | We,reported |
R11562 | T13491 | T13488 | arg2Of | reported,have |
R11563 | T13491 | T13489 | arg1Of | reported,also |
R11564 | T13491 | T13490 | arg1Of | reported,previously |
R11565 | T13494 | T13493 | arg1Of | knockdown,GATA-3 |
R11566 | T13494 | T13495 | arg1Of | knockdown,using |
R11567 | T13494 | T13497 | arg1Of | knockdown,results |
R11568 | T13496 | T13495 | arg2Of | siRNA,using |
R11569 | T13497 | T13491 | arg2Of | results,reported |
R11570 | T13497 | T13492 | arg1Of | results,that |
R11571 | T13497 | T13498 | arg1Of | results,in |
R11572 | T13497 | T13505 | arg1Of | results,"," |
R11573 | T13497 | T13507 | modOf | results,implicating |
R11574 | T13499 | T13498 | arg2Of | suppression,in |
R11575 | T13499 | T13500 | arg1Of | suppression,of |
R11576 | T13504 | T13500 | arg2Of | induction,of |
R11577 | T13504 | T13501 | arg1Of | induction,anti-CD3/CD28–stimulated |
R11578 | T13504 | T13502 | arg1Of | induction,IL-4/IL-5 |
R11579 | T13504 | T13503 | arg1Of | induction,mRNA |
R11580 | T13507 | T13506 | arg1Of | implicating,thus |
R11581 | T13507 | T13519 | arg1Of | implicating,[ |
R11582 | T13510 | T13507 | arg2Of | role,implicating |
R11583 | T13510 | T13508 | arg1Of | role,an |
R11584 | T13510 | T13509 | arg1Of | role,essential |
R11585 | T13510 | T13511 | arg1Of | role,for |
R11586 | T13510 | T13513 | arg1Of | role,in |
R11587 | T13512 | T13511 | arg2Of | GATA-3,for |
R11588 | T13515 | T13513 | arg2Of | transcription,in |
R11589 | T13515 | T13514 | arg1Of | transcription,the |
R11590 | T13515 | T13516 | arg1Of | transcription,of |
R11591 | T13518 | T13516 | arg2Of | genes,of |
R11592 | T13518 | T13517 | arg1Of | genes,these |
R11593 | T13520 | T13519 | arg2Of | 12,[ |
R11594 | T13521 | T13519 | arg3Of | ],[ |
R11595 | T13522 | T13524 | arg1Of | We,confirm |
R11596 | T13524 | T13523 | arg1Of | confirm,now |
R11597 | T13524 | T13525 | arg1Of | confirm,"," |
R11598 | T13524 | T13526 | arg1Of | confirm,in |
R11599 | T13524 | T13530 | arg1Of | confirm,"," |
R11600 | T13529 | T13526 | arg2Of | cells,in |
R11601 | T13529 | T13527 | arg1Of | cells,human |
R11602 | T13529 | T13528 | arg1Of | cells,T |
R11603 | T13532 | T13534 | arg1Of | GR,uses |
R11604 | T13534 | T13524 | arg2Of | uses,confirm |
R11605 | T13534 | T13531 | arg1Of | uses,that |
R11606 | T13534 | T13533 | arg1Of | uses,also |
R11607 | T13534 | T13540 | arg1Of | uses,as |
R11608 | T13534 | T13542 | arg1Of | uses,[ |
R11609 | T13539 | T13534 | arg2Of | mechanism,uses |
R11610 | T13539 | T13535 | arg1Of | mechanism,the |
R11611 | T13539 | T13536 | arg1Of | mechanism,same |
R11612 | T13539 | T13537 | arg1Of | mechanism,nuclear |
R11613 | T13539 | T13538 | arg1Of | mechanism,import |
R11614 | T13541 | T13540 | arg2Of | GATA-3,as |
R11615 | T13543 | T13542 | arg2Of | 22,[ |
R11616 | T13544 | T13542 | arg3Of | ],[ |
R11617 | T13545 | T13547 | arg1Of | We,propose |
R11618 | T13547 | T13546 | arg1Of | propose,therefore |
R11619 | T13549 | T13550 | arg1Of | there,is |
R11620 | T13550 | T13547 | arg2Of | is,propose |
R11621 | T13550 | T13548 | arg1Of | is,that |
R11622 | T13551 | T13550 | arg2Of | competition,is |
R11623 | T13551 | T13552 | arg1Of | competition,between |
R11624 | T13551 | T13557 | arg1Of | competition,for |
R11625 | T13554 | T13555 | arg1Of | GR,and |
R11626 | T13555 | T13552 | arg2Of | and,between |
R11627 | T13555 | T13553 | arg1Of | and,ligand-activated |
R11628 | T13556 | T13555 | arg2Of | phospho-GATA-3,and |
R11629 | T13559 | T13557 | arg2Of | import,for |
R11630 | T13559 | T13558 | arg1Of | import,nuclear |
R11631 | T13562 | T13563 | arg1Of | we,have |
R11632 | T13562 | T13564 | arg1Of | we,shown |
R11633 | T13564 | T13560 | arg1Of | shown,Furthermore |
R11634 | T13564 | T13561 | arg1Of | shown,"," |
R11635 | T13564 | T13563 | arg2Of | shown,have |
R11636 | T13566 | T13567 | arg1Of | there,is |
R11637 | T13567 | T13564 | arg2Of | is,shown |
R11638 | T13567 | T13565 | arg1Of | is,that |
R11639 | T13567 | T13577 | arg1Of | is,"," |
R11640 | T13567 | T13578 | arg1Of | is,so |
R11641 | T13569 | T13567 | arg2Of | binding,is |
R11642 | T13569 | T13568 | arg1Of | binding,preferential |
R11643 | T13569 | T13570 | arg1Of | binding,of |
R11644 | T13569 | T13572 | arg1Of | binding,to |
R11645 | T13569 | T13575 | arg1Of | binding,over |
R11646 | T13571 | T13570 | arg2Of | importin-α,of |
R11647 | T13574 | T13572 | arg2Of | GR,to |
R11648 | T13574 | T13573 | arg2Of | GR,activated |
R11649 | T13576 | T13575 | arg2Of | phospho-GATA-3,over |
R11650 | T13578 | T13579 | arg1Of | so,that |
R11651 | T13580 | T13581 | arg1Of | corticosteroids,would |
R11652 | T13580 | T13583 | arg1Of | corticosteroids,reduce |
R11653 | T13580 | T13589 | arg1Of | corticosteroids,switch |
R11654 | T13583 | T13586 | arg1Of | reduce,and |
R11655 | T13585 | T13583 | arg2Of | entry,reduce |
R11656 | T13585 | T13584 | arg1Of | entry,GATA-3 |
R11657 | T13586 | T13578 | arg2Of | and,so |
R11658 | T13586 | T13581 | arg2Of | and,would |
R11659 | T13586 | T13582 | arg1Of | and,preferentially |
R11660 | T13589 | T13586 | arg2Of | switch,and |
R11661 | T13589 | T13587 | arg1Of | switch,thus |
R11662 | T13589 | T13588 | arg1Of | switch,rapidly |
R11663 | T13589 | T13590 | arg1Of | switch,off |
R11664 | T13589 | T13594 | arg1Of | switch,without |
R11665 | T13593 | T13589 | arg2Of | transcription,switch |
R11666 | T13593 | T13591 | arg1Of | transcription,Th2 |
R11667 | T13593 | T13592 | arg1Of | transcription,gene |
R11668 | T13596 | T13594 | arg2Of | need,without |
R11669 | T13596 | T13595 | arg1Of | need,any |
R11670 | T13596 | T13597 | arg1Of | need,for |
R11671 | T13600 | T13597 | arg2Of | steps,for |
R11672 | T13600 | T13598 | arg1Of | steps,any |
R11673 | T13600 | T13599 | arg1Of | steps,intermediate |
R11674 | T13603 | T13604 | arg1Of | there,was |
R11675 | T13604 | T13601 | arg1Of | was,Furthermore |
R11676 | T13604 | T13602 | arg1Of | was,"," |
R11677 | T13604 | T13611 | arg1Of | was,"," |
R11678 | T13604 | T13612 | arg1Of | was,as |
R11679 | T13606 | T13604 | arg2Of | degree,was |
R11680 | T13606 | T13605 | arg1Of | degree,some |
R11681 | T13606 | T13607 | arg1Of | degree,of |
R11682 | T13606 | T13609 | arg1Of | degree,for |
R11683 | T13608 | T13607 | arg2Of | specificity,of |
R11684 | T13610 | T13609 | arg2Of | GATA-3,for |
R11685 | T13614 | T13613 | arg1Of | translocation,nuclear |
R11686 | T13614 | T13615 | arg1Of | translocation,of |
R11687 | T13614 | T13621 | arg1Of | translocation,was |
R11688 | T13614 | T13623 | arg2Of | translocation,affected |
R11689 | T13618 | T13615 | arg2Of | subunit,of |
R11690 | T13618 | T13616 | arg1Of | subunit,the |
R11691 | T13618 | T13617 | arg1Of | subunit,p65 |
R11692 | T13618 | T13619 | arg1Of | subunit,of |
R11693 | T13620 | T13619 | arg2Of | NF-κB,of |
R11694 | T13623 | T13612 | arg2Of | affected,as |
R11695 | T13623 | T13621 | arg2Of | affected,was |
R11696 | T13623 | T13622 | arg1Of | affected,not |
R11697 | T13626 | T13623 | arg1Of | exposure,affected |
R11698 | T13626 | T13624 | arg2Of | exposure,by |
R11699 | T13626 | T13625 | arg1Of | exposure,corticosteroid |
R11700 | T13627 | T13628 | arg1Of | We,tested |
R11701 | T13627 | T13642 | arg1Of | We,failed |
R11702 | T13627 | T13644 | arg1Of | We,show |
R11703 | T13628 | T13641 | arg1Of | tested,and |
R11704 | T13631 | T13628 | arg2Of | explanations,tested |
R11705 | T13631 | T13629 | arg1Of | explanations,some |
R11706 | T13631 | T13630 | arg1Of | explanations,alternative |
R11707 | T13631 | T13632 | arg1Of | explanations,for |
R11708 | T13634 | T13632 | arg2Of | effect,for |
R11709 | T13634 | T13633 | arg1Of | effect,this |
R11710 | T13634 | T13635 | arg1Of | effect,of |
R11711 | T13634 | T13637 | arg1Of | effect,on |
R11712 | T13636 | T13635 | arg2Of | FP,of |
R11713 | T13640 | T13637 | arg2Of | exclusion,on |
R11714 | T13640 | T13638 | arg1Of | exclusion,GATA-3 |
R11715 | T13640 | T13639 | arg1Of | exclusion,nuclear |
R11716 | T13642 | T13641 | arg2Of | failed,and |
R11717 | T13644 | T13642 | arg2Of | show,failed |
R11718 | T13644 | T13643 | arg1Of | show,to |
R11719 | T13646 | T13648 | arg1Of | FP,enhances |
R11720 | T13646 | T13654 | arg1Of | FP,induces |
R11721 | T13648 | T13647 | arg1Of | enhances,either |
R11722 | T13648 | T13652 | arg1Of | enhances,directly |
R11723 | T13648 | T13653 | arg1Of | enhances,or |
R11724 | T13651 | T13648 | arg2Of | export,enhances |
R11725 | T13651 | T13649 | arg1Of | export,GATA-3 |
R11726 | T13651 | T13650 | arg1Of | export,nuclear |
R11727 | T13653 | T13644 | arg2Of | or,show |
R11728 | T13653 | T13645 | arg1Of | or,that |
R11729 | T13654 | T13653 | arg2Of | induces,or |
R11730 | T13656 | T13654 | arg2Of | degradation,induces |
R11731 | T13656 | T13655 | arg1Of | degradation,GATA-3 |
R11732 | T13658 | T13657 | arg1Of | evidence,The |
R11733 | T13658 | T13659 | arg1Of | evidence,from |
R11734 | T13658 | T13665 | arg1Of | evidence,does |
R11735 | T13658 | T13669 | arg1Of | evidence,suggest |
R11736 | T13662 | T13661 | arg1Of | vitro,in |
R11737 | T13664 | T13659 | arg2Of | assays,from |
R11738 | T13664 | T13660 | arg1Of | assays,the |
R11739 | T13664 | T13662 | arg1Of | assays,vitro |
R11740 | T13664 | T13663 | arg1Of | assays,competition |
R11741 | T13669 | T13665 | arg2Of | suggest,does |
R11742 | T13669 | T13666 | arg1Of | suggest,"," |
R11743 | T13669 | T13667 | arg1Of | suggest,however |
R11744 | T13669 | T13668 | arg1Of | suggest,"," |
R11745 | T13673 | T13671 | arg2Of | GR,purified |
R11746 | T13673 | T13672 | arg2Of | GR,activated |
R11747 | T13673 | T13674 | arg1Of | GR,can |
R11748 | T13673 | T13676 | arg1Of | GR,attenuate |
R11749 | T13676 | T13670 | arg1Of | attenuate,that |
R11750 | T13676 | T13674 | arg2Of | attenuate,can |
R11751 | T13676 | T13675 | arg1Of | attenuate,clearly |
R11752 | T13676 | T13680 | arg1Of | attenuate,and |
R11753 | T13679 | T13676 | arg2Of | association,attenuate |
R11754 | T13679 | T13677 | arg2Of | association,purified |
R11755 | T13679 | T13678 | arg1Of | association,phospho-GATA-3–importin-α |
R11756 | T13680 | T13669 | arg2Of | and,suggest |
R11757 | T13681 | T13680 | arg2Of | that,and |
R11758 | T13683 | T13682 | arg1Of | converse,the |
R11759 | T13683 | T13684 | arg1Of | converse,does |
R11760 | T13683 | T13686 | arg1Of | converse,occur |
R11761 | T13686 | T13681 | arg2Of | occur,that |
R11762 | T13686 | T13684 | arg2Of | occur,does |
R11763 | T13686 | T13685 | arg1Of | occur,not |
R11764 | T13689 | T13690 | arg1Of | we,have |
R11765 | T13689 | T13691 | arg1Of | we,shown |
R11766 | T13691 | T13687 | arg1Of | shown,Furthermore |
R11767 | T13691 | T13688 | arg1Of | shown,"," |
R11768 | T13691 | T13690 | arg2Of | shown,have |
R11769 | T13694 | T13693 | arg1Of | phospho-GATA-3,only |
R11770 | T13694 | T13695 | arg1Of | phospho-GATA-3,can |
R11771 | T13694 | T13696 | arg1Of | phospho-GATA-3,associate |
R11772 | T13696 | T13691 | arg2Of | associate,shown |
R11773 | T13696 | T13692 | arg1Of | associate,that |
R11774 | T13696 | T13695 | arg2Of | associate,can |
R11775 | T13696 | T13697 | arg1Of | associate,with |
R11776 | T13698 | T13697 | arg2Of | importin-α,with |
R11777 | T13700 | T13699 | arg1Of | mechanism,This |
R11778 | T13700 | T13701 | arg1Of | mechanism,is |
R11779 | T13700 | T13702 | arg1Of | mechanism,sensitive |
R11780 | T13700 | T13710 | arg1Of | mechanism,would |
R11781 | T13700 | T13711 | arg1Of | mechanism,be |
R11782 | T13700 | T13712 | arg1Of | mechanism,rapid |
R11783 | T13701 | T13709 | arg1Of | is,and |
R11784 | T13702 | T13701 | arg2Of | sensitive,is |
R11785 | T13702 | T13703 | arg1Of | sensitive,to |
R11786 | T13705 | T13704 | arg1Of | low,very |
R11787 | T13706 | T13703 | arg2Of | concentrations,to |
R11788 | T13706 | T13705 | arg1Of | concentrations,low |
R11789 | T13706 | T13707 | arg1Of | concentrations,of |
R11790 | T13708 | T13707 | arg2Of | corticosteroid,of |
R11791 | T13711 | T13709 | arg2Of | be,and |
R11792 | T13711 | T13710 | arg2Of | be,would |
R11793 | T13711 | T13713 | arg1Of | be,in |
R11794 | T13711 | T13715 | arg1Of | be,as |
R11795 | T13712 | T13711 | arg2Of | rapid,be |
R11796 | T13714 | T13713 | arg2Of | onset,in |
R11797 | T13717 | T13716 | arg1Of | changes,no |
R11798 | T13717 | T13718 | arg1Of | changes,in |
R11799 | T13717 | T13721 | arg1Of | changes,are |
R11800 | T13717 | T13722 | arg2Of | changes,required |
R11801 | T13720 | T13718 | arg2Of | synthesis,in |
R11802 | T13720 | T13719 | arg1Of | synthesis,protein |
R11803 | T13722 | T13715 | arg2Of | required,as |
R11804 | T13722 | T13721 | arg2Of | required,are |
R11805 | T13725 | T13723 | arg1Of | mechanism,This |
R11806 | T13725 | T13724 | arg1Of | mechanism,acute |
R11807 | T13725 | T13726 | arg1Of | mechanism,may |
R11808 | T13725 | T13728 | arg1Of | mechanism,contribute |
R11809 | T13725 | T13737 | arg1Of | mechanism,may |
R11810 | T13725 | T13738 | arg1Of | mechanism,play |
R11811 | T13728 | T13726 | arg2Of | contribute,may |
R11812 | T13728 | T13727 | arg1Of | contribute,also |
R11813 | T13728 | T13729 | arg1Of | contribute,to |
R11814 | T13728 | T13736 | arg1Of | contribute,and |
R11815 | T13731 | T13729 | arg2Of | reduction,to |
R11816 | T13731 | T13730 | arg1Of | reduction,the |
R11817 | T13731 | T13732 | arg1Of | reduction,in |
R11818 | T13735 | T13732 | arg2Of | import,in |
R11819 | T13735 | T13733 | arg1Of | import,GATA-3 |
R11820 | T13735 | T13734 | arg1Of | import,nuclear |
R11821 | T13738 | T13736 | arg2Of | play,and |
R11822 | T13738 | T13737 | arg2Of | play,may |
R11823 | T13738 | T13742 | arg1Of | play,at |
R11824 | T13738 | T13747 | arg1Of | play,at |
R11825 | T13741 | T13738 | arg2Of | role,play |
R11826 | T13741 | T13739 | arg1Of | role,a |
R11827 | T13741 | T13740 | arg1Of | role,major |
R11828 | T13742 | T13746 | arg1Of | at,and/or |
R11829 | T13745 | T13742 | arg2Of | concentrations,at |
R11830 | T13745 | T13743 | arg1Of | concentrations,low |
R11831 | T13745 | T13744 | arg1Of | concentrations,corticosteroid |
R11832 | T13747 | T13746 | arg2Of | at,and/or |
R11833 | T13750 | T13747 | arg2Of | points,at |
R11834 | T13750 | T13748 | arg1Of | points,early |
R11835 | T13750 | T13749 | arg1Of | points,time |
R11836 | T13750 | T13751 | arg1Of | points,prior |
R11837 | T13751 | T13752 | arg1Of | prior,to |
R11838 | T13754 | T13752 | arg2Of | induction,to |
R11839 | T13754 | T13753 | arg1Of | induction,MKP-1 |
R11840 | T13755 | T13756 | arg1Of | Corticosteroids,can |
R11841 | T13755 | T13757 | arg1Of | Corticosteroids,modulate |
R11842 | T13757 | T13756 | arg2Of | modulate,can |
R11843 | T13757 | T13761 | arg1Of | modulate,through |
R11844 | T13757 | T13777 | arg1Of | modulate,"," |
R11845 | T13757 | T13778 | arg1Of | modulate,[ |
R11846 | T13760 | T13757 | arg2Of | activity,modulate |
R11847 | T13760 | T13758 | arg1Of | activity,p38 |
R11848 | T13760 | T13759 | arg1Of | activity,MAPK |
R11849 | T13763 | T13761 | arg2Of | induction,through |
R11850 | T13763 | T13762 | arg1Of | induction,the |
R11851 | T13763 | T13764 | arg1Of | induction,of |
R11852 | T13763 | T13766 | arg1Of | induction,"," |
R11853 | T13765 | T13764 | arg2Of | MKP-1,of |
R11854 | T13770 | T13766 | arg2Of | inhibitor,"," |
R11855 | T13770 | T13767 | arg1Of | inhibitor,a |
R11856 | T13770 | T13768 | arg1Of | inhibitor,potent |
R11857 | T13770 | T13769 | arg1Of | inhibitor,endogenous |
R11858 | T13770 | T13771 | arg1Of | inhibitor,of |
R11859 | T13773 | T13771 | arg2Of | function,of |
R11860 | T13773 | T13772 | arg1Of | function,MAPK |
R11861 | T13773 | T13774 | arg1Of | function,[ |
R11862 | T13775 | T13774 | arg2Of | 38,[ |
R11863 | T13776 | T13774 | arg3Of | ],[ |
R11864 | T13779 | T13778 | arg2Of | 39,[ |
R11865 | T13780 | T13778 | arg3Of | ],[ |
R11866 | T13781 | T13782 | arg1Of | We,report |
R11867 | T13782 | T13783 | arg1Of | report,here |
R11868 | T13786 | T13782 | arg2Of | induction,report |
R11869 | T13786 | T13784 | arg1Of | induction,a |
R11870 | T13786 | T13785 | arg1Of | induction,rapid |
R11871 | T13786 | T13787 | arg1Of | induction,of |
R11872 | T13786 | T13790 | arg1Of | induction,following |
R11873 | T13789 | T13787 | arg2Of | mRNA,of |
R11874 | T13789 | T13788 | arg1Of | mRNA,MKP-1 |
R11875 | T13791 | T13790 | arg2Of | stimulation,following |
R11876 | T13791 | T13792 | arg1Of | stimulation,of |
R11877 | T13791 | T13794 | arg1Of | stimulation,with |
R11878 | T13793 | T13792 | arg2Of | cells,of |
R11879 | T13796 | T13795 | arg1Of | high,relatively |
R11880 | T13797 | T13794 | arg2Of | concentrations,with |
R11881 | T13797 | T13796 | arg1Of | concentrations,high |
R11882 | T13797 | T13798 | arg1Of | concentrations,of |
R11883 | T13799 | T13798 | arg2Of | FP,of |
R11884 | T13800 | T13801 | arg1Of | We,hypothesize |
R11885 | T13805 | T13803 | arg1Of | induction,this |
R11886 | T13805 | T13804 | arg1Of | induction,rapid |
R11887 | T13805 | T13806 | arg1Of | induction,of |
R11888 | T13805 | T13808 | arg1Of | induction,can |
R11889 | T13805 | T13809 | arg1Of | induction,reduce |
R11890 | T13805 | T13814 | arg1Of | induction,attenuating |
R11891 | T13805 | T13824 | arg1Of | induction,preventing |
R11892 | T13807 | T13806 | arg2Of | MKP-1,of |
R11893 | T13809 | T13801 | arg2Of | reduce,hypothesize |
R11894 | T13809 | T13802 | arg1Of | reduce,that |
R11895 | T13809 | T13808 | arg2Of | reduce,can |
R11896 | T13809 | T13813 | arg1Of | reduce,by |
R11897 | T13812 | T13809 | arg2Of | import,reduce |
R11898 | T13812 | T13810 | arg1Of | import,GATA-3 |
R11899 | T13812 | T13811 | arg1Of | import,nuclear |
R11900 | T13814 | T13822 | arg1Of | attenuating,"," |
R11901 | T13817 | T13815 | arg1Of | activity,p38 |
R11902 | T13817 | T13816 | arg1Of | activity,MAPK |
R11903 | T13817 | T13818 | arg1Of | activity,and |
R11904 | T13818 | T13814 | arg2Of | and,attenuating |
R11905 | T13821 | T13818 | arg2Of | phosphorylation,and |
R11906 | T13821 | T13819 | arg1Of | phosphorylation,subsequent |
R11907 | T13821 | T13820 | arg1Of | phosphorylation,GATA-3 |
R11908 | T13822 | T13813 | arg2Of | ",",by |
R11909 | T13824 | T13822 | arg2Of | preventing,"," |
R11910 | T13824 | T13823 | arg1Of | preventing,thus |
R11911 | T13826 | T13824 | arg2Of | translocation,preventing |
R11912 | T13826 | T13825 | arg1Of | translocation,nuclear |
R11913 | T13828 | T13827 | arg1Of | location,The |
R11914 | T13828 | T13829 | arg1Of | location,of |
R11915 | T13828 | T13838 | arg1Of | location,that |
R11916 | T13828 | T13839 | arg1Of | location,are |
R11917 | T13828 | T13840 | arg2Of | location,phosphorylated |
R11918 | T13828 | T13844 | arg1Of | location,are |
R11919 | T13828 | T13846 | arg1Of | location,unknown |
R11920 | T13832 | T13829 | arg2Of | residue,of |
R11921 | T13832 | T13830 | arg1Of | residue,the |
R11922 | T13832 | T13831 | arg1Of | residue,serine |
R11923 | T13832 | T13833 | arg1Of | residue,( |
R11924 | T13832 | T13836 | arg1Of | residue,of |
R11925 | T13834 | T13833 | arg2Of | s,( |
R11926 | T13835 | T13833 | arg3Of | ),( |
R11927 | T13837 | T13836 | arg2Of | GATA-3,of |
R11928 | T13840 | T13839 | arg2Of | phosphorylated,are |
R11929 | T13843 | T13840 | arg1Of | MAPK,phosphorylated |
R11930 | T13843 | T13841 | arg2Of | MAPK,by |
R11931 | T13843 | T13842 | arg1Of | MAPK,p38 |
R11932 | T13844 | T13845 | arg1Of | are,currently |
R11933 | T13844 | T13848 | arg1Of | are,but |
R11934 | T13846 | T13844 | arg2Of | unknown,are |
R11935 | T13848 | T13847 | arg1Of | but,"," |
R11936 | T13854 | T13849 | arg1Of | Scanner,a |
R11937 | T13854 | T13850 | arg1Of | Scanner,bioinformatics |
R11938 | T13854 | T13851 | arg1Of | Scanner,search |
R11939 | T13854 | T13852 | arg1Of | Scanner,( |
R11940 | T13854 | T13853 | arg1Of | Scanner,Motif |
R11941 | T13854 | T13855 | arg1Of | Scanner,"," |
R11942 | T13854 | T13860 | arg1Of | Scanner,indicates |
R11943 | T13856 | T13855 | arg2Of | http,"," |
R11944 | T13856 | T13857 | arg1Of | http,: |
R11945 | T13858 | T13859 | arg1Of | //scansite.mit.edu/motifscan_seq.phtml,) |
R11946 | T13860 | T13848 | arg2Of | indicates,but |
R11947 | T13860 | T13858 | arg1Of | indicates,//scansite.mit.edu/motifscan_seq.phtml |
R11948 | T13863 | T13861 | arg1Of | three,at |
R11949 | T13863 | T13862 | arg1Of | three,least |
R11950 | T13868 | T13860 | arg2Of | residues,indicates |
R11951 | T13868 | T13863 | arg1Of | residues,three |
R11952 | T13868 | T13864 | arg1Of | residues,potential |
R11953 | T13868 | T13865 | arg1Of | residues,p38 |
R11954 | T13868 | T13866 | arg1Of | residues,MAPK-sensitive |
R11955 | T13868 | T13867 | arg1Of | residues,serine |
R11956 | T13870 | T13869 | arg2Of | predicted,As |
R11957 | T13870 | T13871 | arg1Of | predicted,from |
R11958 | T13874 | T13873 | arg1Of | vitro,in |
R11959 | T13875 | T13871 | arg2Of | data,from |
R11960 | T13875 | T13872 | arg1Of | data,these |
R11961 | T13875 | T13874 | arg1Of | data,vitro |
R11962 | T13877 | T13878 | arg1Of | impairment,of |
R11963 | T13877 | T13882 | arg1Of | impairment,by |
R11964 | T13877 | T13884 | arg1Of | impairment,may |
R11965 | T13877 | T13891 | arg1Of | impairment,underlie |
R11966 | T13881 | T13878 | arg2Of | import,of |
R11967 | T13881 | T13879 | arg1Of | import,GATA-3 |
R11968 | T13881 | T13880 | arg1Of | import,nuclear |
R11969 | T13883 | T13882 | arg2Of | FP,by |
R11970 | T13887 | T13886 | arg1Of | least,at |
R11971 | T13888 | T13887 | arg1Of | in,least |
R11972 | T13889 | T13888 | arg2Of | part,in |
R11973 | T13890 | T13869 | arg1Of | ",",As |
R11974 | T13890 | T13876 | arg1Of | ",","," |
R11975 | T13891 | T13890 | arg2Of | underlie,"," |
R11976 | T13893 | T13891 | arg2Of | efficacy,underlie |
R11977 | T13893 | T13892 | arg1Of | efficacy,the |
R11978 | T13893 | T13894 | arg1Of | efficacy,of |
R11979 | T13893 | T13896 | arg1Of | efficacy,in |
R11980 | T13895 | T13894 | arg2Of | corticosteroids,of |
R11981 | T13897 | T13896 | arg2Of | suppressing,in |
R11982 | T13899 | T13897 | arg2Of | inflammation,suppressing |
R11983 | T13899 | T13898 | arg1Of | inflammation,allergic |
R11984 | T13901 | T13902 | arg1Of | we,did |
R11985 | T13901 | T13904 | arg1Of | we,assess |
R11986 | T13904 | T13900 | arg2Of | assess,Although |
R11987 | T13904 | T13902 | arg2Of | assess,did |
R11988 | T13904 | T13903 | arg1Of | assess,not |
R11989 | T13904 | T13918 | arg1Of | assess,vivo |
R11990 | T13907 | T13906 | arg1Of | inhibitory,acute |
R11991 | T13908 | T13904 | arg2Of | effect,assess |
R11992 | T13908 | T13905 | arg1Of | effect,the |
R11993 | T13908 | T13907 | arg1Of | effect,inhibitory |
R11994 | T13908 | T13909 | arg1Of | effect,of |
R11995 | T13908 | T13911 | arg1Of | effect,on |
R11996 | T13910 | T13909 | arg2Of | FP,of |
R11997 | T13913 | T13911 | arg2Of | expression,on |
R11998 | T13913 | T13912 | arg1Of | expression,the |
R11999 | T13913 | T13914 | arg1Of | expression,of |
R12000 | T13916 | T13914 | arg2Of | mRNA,of |
R12001 | T13916 | T13915 | arg1Of | mRNA,IL-4 |
R12002 | T13918 | T13917 | arg1Of | vivo,in |
R12003 | T13922 | T13920 | arg1Of | inhalation,a |
R12004 | T13922 | T13921 | arg1Of | inhalation,single |
R12005 | T13922 | T13923 | arg1Of | inhalation,of |
R12006 | T13922 | T13929 | arg1Of | inhalation,may |
R12007 | T13922 | T13930 | arg1Of | inhalation,have |
R12008 | T13924 | T13923 | arg2Of | FP,of |
R12009 | T13924 | T13925 | arg1Of | FP,( |
R12010 | T13927 | T13925 | arg2Of | µg,( |
R12011 | T13927 | T13926 | arg1Of | µg,500 |
R12012 | T13928 | T13925 | arg3Of | ),( |
R12013 | T13930 | T13900 | arg1Of | have,Although |
R12014 | T13930 | T13919 | arg1Of | have,"," |
R12015 | T13930 | T13929 | arg2Of | have,may |
R12016 | T13930 | T13933 | arg1Of | have,"," |
R12017 | T13930 | T13934 | arg1Of | have,as |
R12018 | T13932 | T13930 | arg2Of | effects,have |
R12019 | T13932 | T13931 | arg1Of | effects,comparable |
R12020 | T13935 | T13936 | arg1Of | it,provides |
R12021 | T13936 | T13934 | arg2Of | provides,as |
R12022 | T13936 | T13939 | arg1Of | provides,within |
R12023 | T13938 | T13936 | arg2Of | levels,provides |
R12024 | T13938 | T13937 | arg1Of | levels,plasma |
R12025 | T13942 | T13939 | arg2Of | range,within |
R12026 | T13942 | T13940 | arg1Of | range,a |
R12027 | T13942 | T13941 | arg1Of | range,relevant |
R12028 | T13942 | T13943 | arg1Of | range,of |
R12029 | T13944 | T13943 | arg2Of | concentrations,of |
R12030 | T13944 | T13945 | arg2Of | concentrations,used |
R12031 | T13947 | T13945 | arg3Of | suppress,used |
R12032 | T13947 | T13946 | arg1Of | suppress,to |
R12033 | T13947 | T13950 | arg1Of | suppress,in |
R12034 | T13949 | T13947 | arg2Of | transcription,suppress |
R12035 | T13949 | T13948 | arg1Of | transcription,IL-4 |
R12036 | T13953 | T13952 | arg1Of | vitro,in |
R12037 | T13954 | T13950 | arg2Of | system,in |
R12038 | T13954 | T13951 | arg1Of | system,our |
R12039 | T13954 | T13953 | arg1Of | system,vitro |
R12040 | T13954 | T13955 | arg1Of | system,[ |
R12041 | T13956 | T13955 | arg2Of | 37,[ |
R12042 | T13957 | T13955 | arg3Of | ],[ |
R12043 | T13960 | T13958 | arg1Of | dose,A |
R12044 | T13960 | T13959 | arg1Of | dose,lower |
R12045 | T13960 | T13961 | arg1Of | dose,of |
R12046 | T13960 | T13968 | arg1Of | dose,was |
R12047 | T13960 | T13970 | arg1Of | dose,effective |
R12048 | T13963 | T13961 | arg2Of | FP,of |
R12049 | T13963 | T13962 | arg2Of | FP,inhaled |
R12050 | T13963 | T13964 | arg1Of | FP,( |
R12051 | T13966 | T13964 | arg2Of | µg,( |
R12052 | T13966 | T13965 | arg1Of | µg,100 |
R12053 | T13967 | T13964 | arg3Of | ),( |
R12054 | T13968 | T13969 | arg1Of | was,not |
R12055 | T13968 | T13972 | arg1Of | was,but |
R12056 | T13970 | T13968 | arg2Of | effective,was |
R12057 | T13972 | T13971 | arg1Of | but,"," |
R12058 | T13974 | T13973 | arg1Of | concentrations,plasma |
R12059 | T13974 | T13975 | arg1Of | concentrations,may |
R12060 | T13974 | T13976 | arg1Of | concentrations,be |
R12061 | T13974 | T13977 | arg1Of | concentrations,below |
R12062 | T13976 | T13972 | arg2Of | be,but |
R12063 | T13976 | T13975 | arg2Of | be,may |
R12064 | T13977 | T13976 | arg2Of | below,be |
R12065 | T13978 | T13977 | arg2Of | those,below |
R12066 | T13978 | T13979 | arg2Of | those,required |
R12067 | T13979 | T13980 | arg1Of | required,for |
R12068 | T13982 | T13980 | arg2Of | inhibition,for |
R12069 | T13982 | T13981 | arg1Of | inhibition,GATA-3 |
R12070 | T13985 | T13986 | arg1Of | it,is |
R12071 | T13985 | T13987 | arg1Of | it,likely |
R12072 | T13986 | T13983 | arg1Of | is,However |
R12073 | T13986 | T13984 | arg1Of | is,"," |
R12074 | T13987 | T13986 | arg2Of | likely,is |
R12075 | T13991 | T13989 | arg1Of | concentrations,the |
R12076 | T13991 | T13990 | arg1Of | concentrations,higher |
R12077 | T13991 | T13992 | arg1Of | concentrations,of |
R12078 | T13991 | T13994 | arg1Of | concentrations,in |
R12079 | T13991 | T14000 | arg1Of | concentrations,would |
R12080 | T13991 | T14001 | arg1Of | concentrations,be |
R12081 | T13991 | T14002 | arg1Of | concentrations,effective |
R12082 | T13993 | T13992 | arg2Of | FP,of |
R12083 | T13996 | T13994 | arg2Of | airways,in |
R12084 | T13996 | T13995 | arg1Of | airways,the |
R12085 | T13996 | T13997 | arg1Of | airways,after |
R12086 | T13999 | T13997 | arg2Of | administration,after |
R12087 | T13999 | T13998 | arg2Of | administration,inhaled |
R12088 | T14001 | T13987 | arg2Of | be,likely |
R12089 | T14001 | T13988 | arg1Of | be,that |
R12090 | T14001 | T14000 | arg2Of | be,would |
R12091 | T14002 | T14001 | arg2Of | effective,be |
R12092 | T14002 | T14003 | arg1Of | effective,in |
R12093 | T14004 | T14003 | arg2Of | inhibiting,in |
R12094 | T14004 | T14006 | arg1Of | inhibiting,in |
R12095 | T14005 | T14004 | arg2Of | GATA-3,inhibiting |
R12096 | T14009 | T14006 | arg2Of | cells,in |
R12097 | T14009 | T14007 | arg1Of | cells,airway |
R12098 | T14009 | T14008 | arg1Of | cells,T |
R12099 | T14009 | T14010 | arg1Of | cells,of |
R12100 | T14012 | T14010 | arg2Of | patients,of |
R12101 | T14012 | T14011 | arg1Of | patients,asthma |
R12102 | T14014 | T14013 | arg1Of | study,The |
R12103 | T14014 | T14015 | arg1Of | study,of |
R12104 | T14014 | T14026 | arg1Of | study,demonstrates |
R12105 | T14016 | T14015 | arg2Of | PBMCs,of |
R12106 | T14016 | T14017 | arg1Of | PBMCs,from |
R12107 | T14019 | T14017 | arg2Of | patients,from |
R12108 | T14019 | T14018 | arg1Of | patients,asthma |
R12109 | T14019 | T14020 | arg2Of | patients,treated |
R12110 | T14020 | T14021 | arg1Of | treated,with |
R12111 | T14024 | T14021 | arg2Of | therapy,with |
R12112 | T14024 | T14022 | arg2Of | therapy,inhaled |
R12113 | T14024 | T14023 | arg1Of | therapy,corticosteroid |
R12114 | T14026 | T14025 | arg1Of | demonstrates,clearly |
R12115 | T14030 | T14028 | arg1Of | mechanisms,these |
R12116 | T14030 | T14029 | arg1Of | mechanisms,molecular |
R12117 | T14030 | T14031 | arg1Of | mechanisms,are |
R12118 | T14030 | T14032 | arg1Of | mechanisms,likely |
R12119 | T14030 | T14035 | arg1Of | mechanisms,occur |
R12120 | T14031 | T14026 | arg2Of | are,demonstrates |
R12121 | T14031 | T14027 | arg1Of | are,that |
R12122 | T14032 | T14031 | arg2Of | likely,are |
R12123 | T14035 | T14032 | arg2Of | occur,likely |
R12124 | T14035 | T14033 | arg1Of | occur,to |
R12125 | T14035 | T14034 | arg1Of | occur,also |
R12126 | T14035 | T14036 | arg1Of | occur,in |
R12127 | T14037 | T14036 | arg2Of | patients,in |
R12128 | T14037 | T14038 | arg1Of | patients,at |
R12129 | T14040 | T14038 | arg2Of | doses,at |
R12130 | T14040 | T14039 | arg1Of | doses,therapeutic |
R12131 | T14040 | T14041 | arg1Of | doses,of |
R12132 | T14043 | T14041 | arg2Of | corticosteroids,of |
R12133 | T14043 | T14042 | arg2Of | corticosteroids,inhaled |
R12134 | T14045 | T14044 | arg2Of | addition,In |
R12135 | T14048 | T14047 | arg1Of | studies,previous |
R12136 | T14048 | T14049 | arg1Of | studies,have |
R12137 | T14048 | T14050 | arg1Of | studies,shown |
R12138 | T14050 | T14044 | arg1Of | shown,In |
R12139 | T14050 | T14046 | arg1Of | shown,"," |
R12140 | T14050 | T14049 | arg2Of | shown,have |
R12141 | T14052 | T14053 | arg1Of | corticosteroids,can |
R12142 | T14052 | T14054 | arg1Of | corticosteroids,suppress |
R12143 | T14054 | T14050 | arg2Of | suppress,shown |
R12144 | T14054 | T14051 | arg1Of | suppress,that |
R12145 | T14054 | T14053 | arg2Of | suppress,can |
R12146 | T14055 | T14056 | arg1Of | IL-4,and |
R12147 | T14057 | T14056 | arg2Of | IL-5,and |
R12148 | T14058 | T14055 | arg1Of | release,IL-4 |
R12149 | T14058 | T14057 | arg1Of | release,IL-5 |
R12150 | T14058 | T14059 | arg1Of | release,from |
R12151 | T14058 | T14067 | arg1Of | release,vitro |
R12152 | T14058 | T14068 | arg1Of | release,and |
R12153 | T14062 | T14059 | arg2Of | cells,from |
R12154 | T14062 | T14060 | arg1Of | cells,peripheral |
R12155 | T14062 | T14061 | arg1Of | cells,blood |
R12156 | T14062 | T14063 | arg1Of | cells,of |
R12157 | T14065 | T14063 | arg2Of | patients,of |
R12158 | T14065 | T14064 | arg1Of | patients,asthma |
R12159 | T14067 | T14066 | arg1Of | vitro,in |
R12160 | T14068 | T14054 | arg2Of | and,suppress |
R12161 | T14070 | T14069 | arg1Of | vivo,in |
R12162 | T14072 | T14071 | arg2Of | 40,[ |
R12163 | T14073 | T14071 | arg3Of | ],[ |
R12164 | T14074 | T14068 | arg2Of | –,and |
R12165 | T14074 | T14070 | arg1Of | –,vivo |
R12166 | T14074 | T14071 | arg1Of | –,[ |
R12167 | T14074 | T14075 | arg1Of | –,[ |
R12168 | T14076 | T14075 | arg2Of | 42,[ |
R12169 | T14077 | T14075 | arg3Of | ],[ |
R12170 | T14079 | T14078 | arg2Of | summary,In |
R12171 | T14082 | T14081 | arg1Of | data,our |
R12172 | T14082 | T14083 | arg1Of | data,provide |
R12173 | T14083 | T14078 | arg1Of | provide,In |
R12174 | T14083 | T14080 | arg1Of | provide,"," |
R12175 | T14083 | T14096 | arg1Of | provide,through |
R12176 | T14083 | T14116 | arg1Of | provide,by |
R12177 | T14084 | T14083 | arg2Of | evidence,provide |
R12178 | T14084 | T14085 | arg1Of | evidence,for |
R12179 | T14088 | T14089 | arg1Of | action,of |
R12180 | T14090 | T14089 | arg2Of | corticosteroids,of |
R12181 | T14090 | T14091 | arg1Of | corticosteroids,: |
R12182 | T14092 | T14085 | arg2Of | suppression,for |
R12183 | T14092 | T14086 | arg1Of | suppression,a |
R12184 | T14092 | T14087 | arg1Of | suppression,novel |
R12185 | T14092 | T14088 | arg1Of | suppression,action |
R12186 | T14092 | T14093 | arg1Of | suppression,of |
R12187 | T14095 | T14093 | arg2Of | inflammation,of |
R12188 | T14095 | T14094 | arg1Of | inflammation,allergic |
R12189 | T14096 | T14115 | arg1Of | through,and |
R12190 | T14100 | T14096 | arg2Of | effect,through |
R12191 | T14100 | T14097 | arg1Of | effect,a |
R12192 | T14100 | T14098 | arg1Of | effect,rapid |
R12193 | T14100 | T14099 | arg1Of | effect,inhibitory |
R12194 | T14100 | T14101 | arg1Of | effect,on |
R12195 | T14100 | T14105 | arg1Of | effect,by |
R12196 | T14104 | T14101 | arg2Of | translocation,on |
R12197 | T14104 | T14102 | arg1Of | translocation,GATA-3 |
R12198 | T14104 | T14103 | arg1Of | translocation,nuclear |
R12199 | T14107 | T14105 | arg2Of | binding,by |
R12200 | T14107 | T14106 | arg1Of | binding,preferential |
R12201 | T14107 | T14108 | arg1Of | binding,to |
R12202 | T14114 | T14108 | arg2Of | importin-α,to |
R12203 | T14114 | T14109 | arg1Of | importin-α,the |
R12204 | T14114 | T14110 | arg1Of | importin-α,shared |
R12205 | T14114 | T14111 | arg1Of | importin-α,nuclear |
R12206 | T14114 | T14112 | arg1Of | importin-α,import |
R12207 | T14114 | T14113 | arg1Of | importin-α,protein |
R12208 | T14116 | T14115 | arg2Of | by,and |
R12209 | T14119 | T14116 | arg2Of | mechanism,by |
R12210 | T14119 | T14117 | arg1Of | mechanism,a |
R12211 | T14119 | T14118 | arg1Of | mechanism,second |
R12212 | T14119 | T14120 | arg1Of | mechanism,involving |
R12213 | T14122 | T14120 | arg2Of | synthesis,involving |
R12214 | T14122 | T14121 | arg2Of | synthesis,increased |
R12215 | T14122 | T14123 | arg1Of | synthesis,of |
R12216 | T14122 | T14125 | arg1Of | synthesis,"," |
R12217 | T14122 | T14126 | arg1Of | synthesis,which |
R12218 | T14122 | T14127 | arg1Of | synthesis,inhibits |
R12219 | T14124 | T14123 | arg2Of | MKP-1,of |
R12220 | T14127 | T14130 | arg1Of | inhibits,"," |
R12221 | T14127 | T14132 | modOf | inhibits,preventing |
R12222 | T14129 | T14127 | arg2Of | MAPK,inhibits |
R12223 | T14129 | T14128 | arg1Of | MAPK,p38 |
R12224 | T14132 | T14131 | arg1Of | preventing,thus |
R12225 | T14134 | T14132 | arg2Of | phosphorylation,preventing |
R12226 | T14134 | T14133 | arg1Of | phosphorylation,the |
R12227 | T14134 | T14135 | arg1Of | phosphorylation,of |
R12228 | T14134 | T14137 | arg1Of | phosphorylation,that |
R12229 | T14134 | T14138 | arg1Of | phosphorylation,is |
R12230 | T14134 | T14139 | arg1Of | phosphorylation,necessary |
R12231 | T14136 | T14135 | arg2Of | GATA-3,of |
R12232 | T14139 | T14138 | arg2Of | necessary,is |
R12233 | T14139 | T14140 | arg1Of | necessary,for |
R12234 | T14142 | T14140 | arg2Of | translocation,for |
R12235 | T14142 | T14141 | arg1Of | translocation,nuclear |
R12236 | T14142 | T14143 | arg1Of | translocation,of |
R12237 | T14144 | T14143 | arg2Of | GATA-3,of |
R12238 | T14147 | T14145 | arg1Of | mechanisms,These |
R12239 | T14147 | T14146 | arg1Of | mechanisms,two |
R12240 | T14147 | T14148 | arg1Of | mechanisms,are |
R12241 | T14147 | T14149 | arg1Of | mechanisms,likely |
R12242 | T14147 | T14151 | arg1Of | mechanisms,be |
R12243 | T14147 | T14152 | arg1Of | mechanisms,synergistic |
R12244 | T14147 | T14154 | arg1Of | mechanisms,accounting |
R12245 | T14148 | T14153 | arg1Of | are,"," |
R12246 | T14148 | T14154 | modOf | are,accounting |
R12247 | T14149 | T14148 | arg2Of | likely,are |
R12248 | T14151 | T14149 | arg2Of | be,likely |
R12249 | T14151 | T14150 | arg1Of | be,to |
R12250 | T14152 | T14151 | arg2Of | synergistic,be |
R12251 | T14154 | T14155 | arg1Of | accounting,for |
R12252 | T14157 | T14158 | arg1Of | rapid,and |
R12253 | T14159 | T14158 | arg2Of | potent,and |
R12254 | T14160 | T14155 | arg2Of | effect,for |
R12255 | T14160 | T14156 | arg1Of | effect,the |
R12256 | T14160 | T14157 | arg1Of | effect,rapid |
R12257 | T14160 | T14159 | arg1Of | effect,potent |
R12258 | T14160 | T14161 | arg1Of | effect,of |
R12259 | T14160 | T14163 | arg1Of | effect,on |
R12260 | T14162 | T14161 | arg2Of | corticosteroids,of |
R12261 | T14165 | T14163 | arg2Of | inflammation,on |
R12262 | T14165 | T14164 | arg1Of | inflammation,allergic |
R12263 | T14166 | T14167 | arg1Of | This,is |
R12264 | T14166 | T14168 | arg2Of | This,exemplified |
R12265 | T14168 | T14167 | arg2Of | exemplified,is |
R12266 | T14173 | T14168 | arg1Of | effect,exemplified |
R12267 | T14173 | T14169 | arg2Of | effect,by |
R12268 | T14173 | T14170 | arg1Of | effect,the |
R12269 | T14173 | T14171 | arg1Of | effect,rapid |
R12270 | T14173 | T14172 | arg1Of | effect,inhibitory |
R12271 | T14173 | T14174 | arg1Of | effect,of |
R12272 | T14173 | T14177 | arg1Of | effect,on |
R12273 | T14173 | T14182 | arg1Of | effect,after |
R12274 | T14176 | T14174 | arg2Of | corticosteroids,of |
R12275 | T14176 | T14175 | arg1Of | corticosteroids,topical |
R12276 | T14181 | T14177 | arg2Of | release,on |
R12277 | T14181 | T14178 | arg1Of | release,nasal |
R12278 | T14181 | T14179 | arg1Of | release,Th2 |
R12279 | T14181 | T14180 | arg1Of | release,cytokine |
R12280 | T14184 | T14182 | arg2Of | provocation,after |
R12281 | T14184 | T14183 | arg1Of | provocation,allergen |
R12282 | T14184 | T14185 | arg1Of | provocation,in |
R12283 | T14186 | T14185 | arg2Of | individuals,in |
R12284 | T14186 | T14187 | arg1Of | individuals,with |
R12285 | T14190 | T14187 | arg2Of | rhinitis,with |
R12286 | T14190 | T14188 | arg1Of | rhinitis,seasonal |
R12287 | T14190 | T14189 | arg1Of | rhinitis,allergic |
R12288 | T14190 | T14191 | arg1Of | rhinitis,( |
R12289 | T14190 | T14195 | arg1Of | rhinitis,[ |
R12290 | T14193 | T14191 | arg2Of | fever,( |
R12291 | T14193 | T14192 | arg1Of | fever,hay |
R12292 | T14194 | T14191 | arg3Of | ),( |
R12293 | T14196 | T14195 | arg2Of | 43,[ |
R12294 | T14197 | T14195 | arg3Of | ],[ |
R12295 | T14198 | T14199 | arg1Of | Prevention,of |
R12296 | T14198 | T14204 | arg1Of | Prevention,may |
R12297 | T14198 | T14205 | arg1Of | Prevention,provide |
R12298 | T14201 | T14199 | arg2Of | interaction,of |
R12299 | T14201 | T14200 | arg1Of | interaction,phospho-GATA-3 |
R12300 | T14201 | T14202 | arg1Of | interaction,with |
R12301 | T14203 | T14202 | arg2Of | importin-α,with |
R12302 | T14205 | T14204 | arg2Of | provide,may |
R12303 | T14208 | T14205 | arg2Of | approach,provide |
R12304 | T14208 | T14206 | arg1Of | approach,a |
R12305 | T14208 | T14207 | arg1Of | approach,new |
R12306 | T14208 | T14209 | arg1Of | approach,for |
R12307 | T14211 | T14209 | arg2Of | development,for |
R12308 | T14211 | T14210 | arg1Of | development,the |
R12309 | T14211 | T14212 | arg1Of | development,of |
R12310 | T14211 | T14215 | arg1Of | development,for |
R12311 | T14214 | T14212 | arg2Of | therapies,of |
R12312 | T14214 | T14213 | arg1Of | therapies,novel |
R12313 | T14217 | T14215 | arg2Of | treatment,for |
R12314 | T14217 | T14216 | arg1Of | treatment,the |
R12315 | T14217 | T14218 | arg1Of | treatment,of |
R12316 | T14220 | T14218 | arg2Of | diseases,of |
R12317 | T14220 | T14219 | arg1Of | diseases,allergic |
R13756 | T16039 | T16038 | arg1Of | propionate,Fluticasone |
R13757 | T16039 | T16040 | arg1Of | propionate,down-regulates |
R13758 | T16039 | T16046 | arg1Of | propionate,inhibits |
R13759 | T16040 | T16045 | arg1Of | down-regulates,and |
R13760 | T16044 | T16040 | arg2Of | expression,down-regulates |
R13761 | T16044 | T16041 | arg1Of | expression,Th2 |
R13762 | T16044 | T16042 | arg1Of | expression,cytokine |
R13763 | T16044 | T16043 | arg1Of | expression,gene |
R13764 | T16046 | T16045 | arg2Of | inhibits,and |
R13765 | T16049 | T16046 | arg2Of | import,inhibits |
R13766 | T16049 | T16047 | arg1Of | import,GATA-3 |
R13767 | T16049 | T16048 | arg1Of | import,nuclear |
R13768 | T16051 | T16050 | arg2Of | A,( |
R13769 | T16052 | T16050 | arg3Of | ),( |
R13770 | T16054 | T16050 | arg1Of | treatment,( |
R13771 | T16054 | T16053 | arg1Of | treatment,Anti-CD3/CD28 |
R13772 | T16054 | T16055 | arg1Of | treatment,of |
R13773 | T16054 | T16058 | arg1Of | treatment,results |
R13774 | T16057 | T16055 | arg2Of | cells,of |
R13775 | T16057 | T16056 | arg1Of | cells,HuT-78 |
R13776 | T16058 | T16059 | arg1Of | results,in |
R13777 | T16058 | T16066 | arg1Of | results,to |
R13778 | T16058 | T16069 | arg1Of | results,within |
R13779 | T16058 | T16077 | arg1Of | results,and |
R13780 | T16060 | T16059 | arg2Of | translocation,in |
R13781 | T16060 | T16061 | arg1Of | translocation,of |
R13782 | T16062 | T16061 | arg2Of | GATA-3,of |
R13783 | T16062 | T16063 | arg1Of | GATA-3,from |
R13784 | T16065 | T16063 | arg2Of | cytoplasm,from |
R13785 | T16065 | T16064 | arg1Of | cytoplasm,the |
R13786 | T16068 | T16066 | arg2Of | nucleus,to |
R13787 | T16068 | T16067 | arg1Of | nucleus,the |
R13788 | T16071 | T16070 | arg1Of | min.,30 |
R13789 | T16071 | T16072 | arg1Of | min.,( |
R13790 | T16073 | T16072 | arg2Of | B,( |
R13791 | T16074 | T16072 | arg3Of | ),( |
R13792 | T16076 | T16069 | arg2Of | H1,within |
R13793 | T16076 | T16071 | arg1Of | H1,min. |
R13794 | T16076 | T16075 | arg1Of | H1,Histone |
R13795 | T16078 | T16079 | arg1Of | MEK-1,were |
R13796 | T16078 | T16080 | arg2Of | MEK-1,used |
R13797 | T16080 | T16077 | arg2Of | used,and |
R13798 | T16080 | T16079 | arg2Of | used,were |
R13799 | T16082 | T16080 | arg3Of | confirm,used |
R13800 | T16082 | T16081 | arg1Of | confirm,to |
R13801 | T16084 | T16082 | arg2Of | separation,confirm |
R13802 | T16084 | T16083 | arg1Of | separation,distinct |
R13803 | T16084 | T16085 | arg1Of | separation,of |
R13804 | T16084 | T16090 | arg1Of | separation,in |
R13805 | T16084 | T16104 | modOf | separation,demonstrated |
R13806 | T16086 | T16087 | arg1Of | cytoplasmic,and |
R13807 | T16088 | T16087 | arg2Of | nuclear,and |
R13808 | T16089 | T16085 | arg2Of | extracts,of |
R13809 | T16089 | T16086 | arg1Of | extracts,cytoplasmic |
R13810 | T16089 | T16088 | arg1Of | extracts,nuclear |
R13811 | T16093 | T16090 | arg2Of | experiments.,in |
R13812 | T16093 | T16091 | arg1Of | experiments.,three |
R13813 | T16093 | T16092 | arg1Of | experiments.,separate |
R13814 | T16093 | T16094 | arg1Of | experiments.,( |
R13815 | T16095 | T16094 | arg2Of | C,( |
R13816 | T16096 | T16094 | arg3Of | ),( |
R13817 | T16099 | T16097 | arg1Of | analysis,Western |
R13818 | T16099 | T16098 | arg1Of | analysis,blot |
R13819 | T16099 | T16100 | arg1Of | analysis,of |
R13820 | T16099 | T16104 | arg1Of | analysis,demonstrated |
R13821 | T16103 | T16100 | arg2Of | cells,of |
R13822 | T16103 | T16101 | arg1Of | cells,FP-treated |
R13823 | T16103 | T16102 | arg1Of | cells,HuT-78 |
R13824 | T16106 | T16105 | arg1Of | nuclear,impaired |
R13825 | T16107 | T16104 | arg2Of | localization,demonstrated |
R13826 | T16107 | T16106 | arg1Of | localization,nuclear |
R13827 | T16107 | T16108 | arg1Of | localization,of |
R13828 | T16109 | T16108 | arg2Of | GATA-3,of |
R13829 | T16109 | T16110 | arg2Of | GATA-3,induced |
R13830 | T16113 | T16112 | arg1Of | co-stimulation,anti-CD3/CD28 |
R13831 | T16113 | T16114 | arg1Of | co-stimulation,in |
R13832 | T16113 | T16123 | arg1Of | co-stimulation,and |
R13833 | T16116 | T16114 | arg2Of | time-,in |
R13834 | T16116 | T16115 | arg1Of | time-,a |
R13835 | T16116 | T16117 | arg1Of | time-,( |
R13836 | T16118 | T16117 | arg2Of | at,( |
R13837 | T16119 | T16120 | arg1Of | 10−8,M |
R13838 | T16121 | T16118 | arg2Of | FP,at |
R13839 | T16121 | T16119 | arg1Of | FP,10−8 |
R13840 | T16122 | T16117 | arg3Of | ),( |
R13841 | T16123 | T16110 | arg1Of | and,induced |
R13842 | T16123 | T16111 | arg2Of | and,by |
R13843 | T16124 | T16125 | arg1Of | concentration-,( |
R13844 | T16126 | T16125 | arg2Of | at,( |
R13845 | T16128 | T16126 | arg2Of | min,at |
R13846 | T16128 | T16127 | arg1Of | min,60 |
R13847 | T16128 | T16129 | arg1Of | min,after |
R13848 | T16130 | T16129 | arg2Of | stimulation,after |
R13849 | T16131 | T16125 | arg3Of | ),( |
R13850 | T16133 | T16123 | arg2Of | manner,and |
R13851 | T16133 | T16124 | arg1Of | manner,concentration- |
R13852 | T16133 | T16132 | arg1Of | manner,dependent |
R13853 | T16134 | T16135 | arg1Of | Cells,were |
R13854 | T16134 | T16136 | arg2Of | Cells,pretreated |
R13855 | T16136 | T16135 | arg2Of | pretreated,were |
R13856 | T16136 | T16137 | arg1Of | pretreated,with |
R13857 | T16138 | T16137 | arg2Of | FP,with |
R13858 | T16138 | T16139 | arg1Of | FP,for |
R13859 | T16141 | T16139 | arg2Of | min,for |
R13860 | T16141 | T16140 | arg1Of | min,30 |
R13861 | T16141 | T16142 | arg1Of | min,prior |
R13862 | T16142 | T16143 | arg1Of | prior,to |
R13863 | T16144 | T16143 | arg2Of | stimulation,to |
R13864 | T16145 | T16146 | arg1Of | MEK1,and |
R13865 | T16146 | T16149 | arg1Of | and,were |
R13866 | T16146 | T16150 | arg2Of | and,used |
R13867 | T16148 | T16146 | arg2Of | H1,and |
R13868 | T16148 | T16147 | arg1Of | H1,histone |
R13869 | T16150 | T16149 | arg2Of | used,were |
R13870 | T16152 | T16150 | arg3Of | demonstrate,used |
R13871 | T16152 | T16151 | arg1Of | demonstrate,to |
R13872 | T16152 | T16158 | arg1Of | demonstrate,respectively |
R13873 | T16154 | T16155 | arg1Of | cytoplasmic,and |
R13874 | T16156 | T16155 | arg2Of | nuclear,and |
R13875 | T16157 | T16152 | arg2Of | loading,demonstrate |
R13876 | T16157 | T16153 | arg1Of | loading,equal |
R13877 | T16157 | T16154 | arg1Of | loading,cytoplasmic |
R13878 | T16157 | T16156 | arg1Of | loading,nuclear |
R13879 | T16159 | T16160 | arg1Of | Results,are |
R13880 | T16159 | T16161 | arg2Of | Results,presented |
R13881 | T16161 | T16160 | arg2Of | presented,are |
R13882 | T16161 | T16163 | arg1Of | presented,below |
R13883 | T16161 | T16164 | arg1Of | presented,as |
R13884 | T16161 | T16176 | arg1Of | presented,compared |
R13885 | T16163 | T16162 | arg1Of | below,graphically |
R13886 | T16165 | T16164 | arg2Of | mean±SEM,as |
R13887 | T16165 | T16166 | arg1Of | mean±SEM,of |
R13888 | T16169 | T16167 | arg1Of | three,at |
R13889 | T16169 | T16168 | arg1Of | three,least |
R13890 | T16171 | T16166 | arg2Of | experiments.,of |
R13891 | T16171 | T16169 | arg1Of | experiments.,three |
R13892 | T16171 | T16170 | arg1Of | experiments.,independent |
R13893 | T16173 | T16164 | arg3Of | p,as |
R13894 | T16173 | T16172 | arg1Of | p,*** |
R13895 | T16173 | T16174 | arg1Of | p,< |
R13896 | T16175 | T16161 | arg3Of | 0.001,presented |
R13897 | T16177 | T16176 | arg2Of | to,compared |
R13898 | T16180 | T16179 | arg2Of | D,( |
R13899 | T16181 | T16179 | arg3Of | ),( |
R13900 | T16182 | T16177 | arg2Of | RT-PCR,to |
R13901 | T16182 | T16178 | arg1Of | RT-PCR,t = 0. |
R13902 | T16182 | T16179 | arg1Of | RT-PCR,( |
R13903 | T16182 | T16183 | arg1Of | RT-PCR,showing |
R13904 | T16185 | T16186 | arg1Of | FP,inhibits |
R13905 | T16186 | T16183 | arg2Of | inhibits,showing |
R13906 | T16186 | T16184 | arg1Of | inhibits,that |
R13907 | T16187 | T16188 | arg1Of | IL-4,and |
R13908 | T16189 | T16188 | arg2Of | IL-5,and |
R13909 | T16191 | T16186 | arg2Of | expression,inhibits |
R13910 | T16191 | T16187 | arg1Of | expression,IL-4 |
R13911 | T16191 | T16189 | arg1Of | expression,IL-5 |
R13912 | T16191 | T16190 | arg1Of | expression,mRNA |
R13913 | T16191 | T16192 | arg1Of | expression,in |
R13914 | T16194 | T16192 | arg2Of | cells,in |
R13915 | T16194 | T16193 | arg1Of | cells,CD3/CD28-costimulated |
R13916 | T16195 | T16196 | arg1Of | GAPDH,was |
R13917 | T16195 | T16197 | arg2Of | GAPDH,used |
R13918 | T16197 | T16196 | arg2Of | used,was |
R13919 | T16197 | T16198 | arg1Of | used,as |
R13920 | T16201 | T16198 | arg2Of | control,as |
R13921 | T16201 | T16199 | arg1Of | control,a |
R13922 | T16201 | T16200 | arg1Of | control,loading |
R13923 | T16203 | T16202 | arg1Of | panels,Lower |
R13924 | T16203 | T16204 | arg1Of | panels,show |
R13925 | T16203 | T16228 | arg1Of | panels,***p |
R13926 | T16204 | T16227 | arg1Of | show,"," |
R13927 | T16204 | T16228 | modOf | show,***p |
R13928 | T16206 | T16204 | arg2Of | analysis,show |
R13929 | T16206 | T16205 | arg1Of | analysis,graphical |
R13930 | T16206 | T16207 | arg1Of | analysis,of |
R13931 | T16208 | T16207 | arg2Of | results,of |
R13932 | T16208 | T16209 | arg2Of | results,presented |
R13933 | T16209 | T16210 | arg1Of | presented,as |
R13934 | T16211 | T16210 | arg2Of | mean±SEM,as |
R13935 | T16211 | T16212 | arg1Of | mean±SEM,of |
R13936 | T16215 | T16213 | arg1Of | three,at |
R13937 | T16215 | T16214 | arg1Of | three,least |
R13938 | T16217 | T16215 | arg1Of | experiments.,three |
R13939 | T16217 | T16216 | arg1Of | experiments.,independent |
R13940 | T16221 | T16217 | arg1Of | p,experiments. |
R13941 | T16221 | T16218 | arg1Of | p,# |
R13942 | T16221 | T16219 | arg1Of | p,# |
R13943 | T16221 | T16220 | arg1Of | p,# |
R13944 | T16221 | T16222 | arg1Of | p,< |
R13945 | T16223 | T16212 | arg2Of | 0.001,of |
R13946 | T16223 | T16221 | arg1Of | 0.001,p |
R13947 | T16223 | T16224 | arg1Of | 0.001,compared |
R13948 | T16225 | T16224 | arg2Of | to,compared |
R13949 | T16226 | T16225 | arg2Of | control,to |
R13950 | T16230 | T16231 | arg1Of | 0.001,compared |
R13951 | T16232 | T16231 | arg2Of | to,compared |
R13952 | T16233 | T16232 | arg2Of | anti-CD3/CD28–stimulated.,to |
R13953 | T16233 | T16234 | arg1Of | anti-CD3/CD28–stimulated.,( |
R13954 | T16235 | T16234 | arg2Of | E,( |
R13955 | T16236 | T16234 | arg3Of | ),( |
R13956 | T16237 | T16229 | arg1Of | FP,< |
R13957 | T16237 | T16230 | arg1Of | FP,0.001 |
R13958 | T16237 | T16238 | arg1Of | FP,( |
R13959 | T16237 | T16242 | arg1Of | FP,reduces |
R13960 | T16240 | T16238 | arg2Of | nM,( |
R13961 | T16240 | T16239 | arg1Of | nM,10 |
R13962 | T16241 | T16238 | arg3Of | ),( |
R13963 | T16242 | T16228 | arg2Of | reduces,***p |
R13964 | T16244 | T16242 | arg2Of | ability,reduces |
R13965 | T16244 | T16243 | arg1Of | ability,the |
R13966 | T16244 | T16245 | arg1Of | ability,of |
R13967 | T16244 | T16248 | modOf | ability,to |
R13968 | T16247 | T16245 | arg2Of | GATA-3,of |
R13969 | T16247 | T16246 | arg1Of | GATA-3,anti-CD3/CD28-stimulated |
R13970 | T16249 | T16248 | arg1Of | associate,to |
R13971 | T16249 | T16250 | arg1Of | associate,with |
R13972 | T16256 | T16250 | arg2Of | min,with |
R13973 | T16256 | T16251 | arg1Of | min,the |
R13974 | T16256 | T16252 | arg1Of | min,native |
R13975 | T16256 | T16253 | arg1Of | min,IL-5 |
R13976 | T16256 | T16254 | arg1Of | min,promoter |
R13977 | T16256 | T16255 | arg1Of | min,60 |
R13978 | T16256 | T16257 | arg1Of | min,after |
R13979 | T16258 | T16257 | arg2Of | stimulation,after |
R13980 | T16259 | T16260 | arg1Of | Data,are |
R13981 | T16259 | T16262 | arg2Of | Data,shown |
R13982 | T16262 | T16260 | arg2Of | shown,are |
R13983 | T16262 | T16261 | arg1Of | shown,also |
R13984 | T16262 | T16263 | arg1Of | shown,graphically |
R13985 | T16262 | T16264 | arg1Of | shown,as |
R13986 | T16265 | T16264 | arg2Of | mean±SEM,as |
R13987 | T16265 | T16266 | arg1Of | mean±SEM,of |
R13988 | T16269 | T16266 | arg2Of | experiments,of |
R13989 | T16269 | T16267 | arg1Of | experiments,three |
R13990 | T16269 | T16268 | arg1Of | experiments,independent |
R13991 | T16271 | T16270 | arg1Of | data,All |
R13992 | T16271 | T16272 | arg1Of | data,were |
R13993 | T16271 | T16273 | arg2Of | data,analysed |
R13994 | T16273 | T16272 | arg2Of | analysed,were |
R13995 | T16275 | T16273 | arg1Of | ANOVA,analysed |
R13996 | T16275 | T16274 | arg2Of | ANOVA,by |
R13997 | T16275 | T16276 | arg2Of | ANOVA,followed |
R13998 | T16278 | T16276 | arg1Of | Newman-Keuls,followed |
R13999 | T16278 | T16277 | arg2Of | Newman-Keuls,by |
R14000 | T16278 | T16279 | arg1Of | Newman-Keuls,post-test |
R14410 | T16827 | T16826 | arg1Of | propionate,Fluticasone |
R14411 | T16827 | T16828 | arg1Of | propionate,reduces |
R14412 | T16830 | T16828 | arg2Of | association,reduces |
R14413 | T16830 | T16829 | arg1Of | association,GATA-3 |
R14414 | T16830 | T16831 | arg1Of | association,with |
R14415 | T16832 | T16833 | arg1Of | importin-α,and |
R14416 | T16833 | T16831 | arg2Of | and,with |
R14417 | T16836 | T16833 | arg2Of | import,and |
R14418 | T16836 | T16834 | arg1Of | import,GATA-3 |
R14419 | T16836 | T16835 | arg1Of | import,nuclear |
R14420 | T16838 | T16837 | arg2Of | A,( |
R14421 | T16839 | T16837 | arg3Of | ),( |
R14422 | T16842 | T16837 | arg1Of | analysis,( |
R14423 | T16842 | T16840 | arg1Of | analysis,Western |
R14424 | T16842 | T16841 | arg1Of | analysis,blot |
R14425 | T16842 | T16843 | arg1Of | analysis,demonstrates |
R14426 | T16845 | T16844 | arg1Of | time-,a |
R14427 | T16845 | T16846 | arg1Of | time-,( |
R14428 | T16845 | T16852 | arg1Of | time-,and |
R14429 | T16847 | T16846 | arg2Of | at,( |
R14430 | T16848 | T16849 | arg1Of | 10−8,M |
R14431 | T16850 | T16847 | arg2Of | FP,at |
R14432 | T16850 | T16848 | arg1Of | FP,10−8 |
R14433 | T16851 | T16846 | arg3Of | ),( |
R14434 | T16852 | T16843 | arg2Of | and,demonstrates |
R14435 | T16853 | T16854 | arg1Of | concentration-,( |
R14436 | T16855 | T16854 | arg2Of | at,( |
R14437 | T16857 | T16855 | arg2Of | min,at |
R14438 | T16857 | T16856 | arg1Of | min,60 |
R14439 | T16857 | T16858 | arg1Of | min,after |
R14440 | T16859 | T16858 | arg2Of | stimulation,after |
R14441 | T16860 | T16854 | arg3Of | ),( |
R14442 | T16862 | T16852 | arg2Of | induction,and |
R14443 | T16862 | T16853 | arg1Of | induction,concentration- |
R14444 | T16862 | T16861 | arg1Of | induction,dependent |
R14445 | T16862 | T16863 | arg1Of | induction,of |
R14446 | T16866 | T16863 | arg2Of | interaction,of |
R14447 | T16866 | T16864 | arg1Of | interaction,FP-activated |
R14448 | T16866 | T16865 | arg1Of | interaction,GR |
R14449 | T16866 | T16867 | arg1Of | interaction,with |
R14450 | T16868 | T16867 | arg2Of | importin-α,with |
R14451 | T16868 | T16869 | arg1Of | importin-α,( |
R14452 | T16870 | T16869 | arg2Of | Imp-α,( |
R14453 | T16871 | T16869 | arg3Of | ),( |
R14454 | T16874 | T16872 | arg1Of | control,A |
R14455 | T16874 | T16873 | arg1Of | control,positive |
R14456 | T16874 | T16875 | arg1Of | control,for |
R14457 | T16874 | T16880 | arg1Of | control,is |
R14458 | T16874 | T16881 | arg2Of | control,shown |
R14459 | T16877 | T16875 | arg2Of | association,for |
R14460 | T16877 | T16876 | arg1Of | association,GR |
R14461 | T16877 | T16878 | arg1Of | association,with |
R14462 | T16879 | T16878 | arg2Of | importin,with |
R14463 | T16881 | T16880 | arg2Of | shown,is |
R14464 | T16882 | T16883 | arg1Of | Quantification,of |
R14465 | T16882 | T16887 | arg1Of | Quantification,is |
R14466 | T16882 | T16888 | arg2Of | Quantification,shown |
R14467 | T16886 | T16883 | arg2Of | data,of |
R14468 | T16886 | T16884 | arg1Of | data,the |
R14469 | T16886 | T16885 | arg1Of | data,densitometry |
R14470 | T16888 | T16887 | arg2Of | shown,is |
R14471 | T16888 | T16889 | arg1Of | shown,below |
R14472 | T16891 | T16890 | arg1Of | bar,Each |
R14473 | T16891 | T16892 | arg1Of | bar,represents |
R14474 | T16893 | T16892 | arg2Of | mean±SEM,represents |
R14475 | T16893 | T16894 | arg1Of | mean±SEM,of |
R14476 | T16897 | T16895 | arg1Of | three,at |
R14477 | T16897 | T16896 | arg1Of | three,least |
R14478 | T16899 | T16894 | arg2Of | experiments.,of |
R14479 | T16899 | T16897 | arg1Of | experiments.,three |
R14480 | T16899 | T16898 | arg1Of | experiments.,independent |
R14481 | T16902 | T16900 | arg1Of | <,*** |
R14482 | T16902 | T16901 | arg1Of | <,p |
R14483 | T16903 | T16892 | arg3Of | 0.001,represents |
R14484 | T16903 | T16902 | arg1Of | 0.001,< |
R14485 | T16903 | T16904 | arg1Of | 0.001,compared |
R14486 | T16903 | T16945 | arg2Of | 0.001,measured |
R14487 | T16905 | T16904 | arg2Of | to,compared |
R14488 | T16906 | T16905 | arg2Of | control,to |
R14489 | T16906 | T16907 | arg1Of | control,"," |
R14490 | T16906 | T16912 | arg1Of | control,< |
R14491 | T16911 | T16907 | arg2Of | p,"," |
R14492 | T16911 | T16908 | arg1Of | p,# |
R14493 | T16911 | T16909 | arg1Of | p,# |
R14494 | T16911 | T16910 | arg1Of | p,# |
R14495 | T16915 | T16914 | arg2Of | B,( |
R14496 | T16916 | T16914 | arg3Of | ),( |
R14497 | T16919 | T16913 | arg1Of | analysis,0.001. |
R14498 | T16919 | T16914 | arg1Of | analysis,( |
R14499 | T16919 | T16917 | arg1Of | analysis,Western |
R14500 | T16919 | T16918 | arg1Of | analysis,blot |
R14501 | T16919 | T16920 | arg1Of | analysis,demonstrated |
R14502 | T16922 | T16921 | arg1Of | time-,a |
R14503 | T16922 | T16923 | arg1Of | time-,( |
R14504 | T16922 | T16929 | arg1Of | time-,and |
R14505 | T16924 | T16923 | arg2Of | at,( |
R14506 | T16925 | T16926 | arg1Of | 10−8,M |
R14507 | T16927 | T16924 | arg2Of | FP,at |
R14508 | T16927 | T16925 | arg1Of | FP,10−8 |
R14509 | T16928 | T16923 | arg3Of | ),( |
R14510 | T16929 | T16920 | arg2Of | and,demonstrated |
R14511 | T16930 | T16931 | arg1Of | concentration-,( |
R14512 | T16932 | T16931 | arg2Of | at,( |
R14513 | T16934 | T16932 | arg2Of | min,at |
R14514 | T16934 | T16933 | arg1Of | min,60 |
R14515 | T16934 | T16935 | arg1Of | min,after |
R14516 | T16936 | T16935 | arg2Of | stimulation,after |
R14517 | T16937 | T16931 | arg3Of | ),( |
R14518 | T16939 | T16929 | arg2Of | induction,and |
R14519 | T16939 | T16930 | arg1Of | induction,concentration- |
R14520 | T16939 | T16938 | arg1Of | induction,dependent |
R14521 | T16939 | T16940 | arg1Of | induction,of |
R14522 | T16944 | T16940 | arg2Of | translocation,of |
R14523 | T16944 | T16941 | arg1Of | translocation,FP-activated |
R14524 | T16944 | T16942 | arg1Of | translocation,GR |
R14525 | T16944 | T16943 | arg1Of | translocation,nuclear |
R14526 | T16945 | T16920 | arg3Of | measured,demonstrated |
R14527 | T16947 | T16945 | arg1Of | IP,measured |
R14528 | T16947 | T16946 | arg2Of | IP,by |
R14529 | T16948 | T16949 | arg1Of | Quantification,of |
R14530 | T16948 | T16953 | arg1Of | Quantification,is |
R14531 | T16948 | T16954 | arg2Of | Quantification,shown |
R14532 | T16952 | T16949 | arg2Of | data,of |
R14533 | T16952 | T16950 | arg1Of | data,the |
R14534 | T16952 | T16951 | arg1Of | data,densitometry |
R14535 | T16954 | T16953 | arg2Of | shown,is |
R14536 | T16954 | T16955 | arg1Of | shown,below |
R14537 | T16957 | T16956 | arg1Of | bar,Each |
R14538 | T16957 | T16958 | arg1Of | bar,represents |
R14539 | T16958 | T16984 | arg1Of | represents,and |
R14540 | T16959 | T16958 | arg2Of | mean±SEM,represents |
R14541 | T16959 | T16960 | arg1Of | mean±SEM,of |
R14542 | T16963 | T16961 | arg1Of | three,at |
R14543 | T16963 | T16962 | arg1Of | three,least |
R14544 | T16965 | T16963 | arg1Of | experiments.,three |
R14545 | T16965 | T16964 | arg1Of | experiments.,independent |
R14546 | T16965 | T16966 | arg1Of | experiments.,***p |
R14547 | T16966 | T16969 | arg1Of | ***p,compared |
R14548 | T16968 | T16966 | arg2Of | 0.001,***p |
R14549 | T16968 | T16967 | arg1Of | 0.001,< |
R14550 | T16970 | T16969 | arg2Of | to,compared |
R14551 | T16971 | T16970 | arg2Of | control.,to |
R14552 | T16971 | T16972 | arg1Of | control.,( |
R14553 | T16973 | T16972 | arg2Of | C,( |
R14554 | T16974 | T16972 | arg3Of | ),( |
R14555 | T16977 | T16960 | arg2Of | analysis,of |
R14556 | T16977 | T16965 | arg1Of | analysis,experiments. |
R14557 | T16977 | T16975 | arg1Of | analysis,Western |
R14558 | T16977 | T16976 | arg1Of | analysis,blot |
R14559 | T16977 | T16978 | arg1Of | analysis,of |
R14560 | T16980 | T16978 | arg2Of | cells,of |
R14561 | T16980 | T16979 | arg1Of | cells,HuT-78 |
R14562 | T16980 | T16981 | arg2Of | cells,treated |
R14563 | T16981 | T16982 | arg1Of | treated,with |
R14564 | T16983 | T16982 | arg2Of | FP,with |
R14565 | T16986 | T16985 | arg1Of | co-stimulation,anti-CD3/CD28 |
R14566 | T16986 | T16987 | arg1Of | co-stimulation,demonstrated |
R14567 | T16987 | T16984 | arg2Of | demonstrated,and |
R14568 | T16987 | T16994 | arg1Of | demonstrated,at |
R14569 | T16990 | T16987 | arg2Of | decrease,demonstrated |
R14570 | T16990 | T16988 | arg1Of | decrease,a |
R14571 | T16990 | T16989 | arg1Of | decrease,concentration-dependent |
R14572 | T16990 | T16991 | arg1Of | decrease,in |
R14573 | T16993 | T16991 | arg2Of | association,in |
R14574 | T16993 | T16992 | arg1Of | association,GATA-3–importin-α |
R14575 | T16996 | T16994 | arg2Of | min,at |
R14576 | T16996 | T16995 | arg1Of | min,20 |
R14577 | T16997 | T16998 | arg1Of | Quantification,of |
R14578 | T16997 | T17002 | arg1Of | Quantification,is |
R14579 | T16997 | T17003 | arg2Of | Quantification,shown |
R14580 | T17001 | T16998 | arg2Of | data,of |
R14581 | T17001 | T16999 | arg1Of | data,the |
R14582 | T17001 | T17000 | arg1Of | data,densitometry |
R14583 | T17003 | T17002 | arg2Of | shown,is |
R14584 | T17003 | T17004 | arg1Of | shown,below |
R14585 | T17006 | T17005 | arg1Of | bar,Each |
R14586 | T17006 | T17007 | arg1Of | bar,represents |
R14587 | T17006 | T17025 | arg1Of | bar,***p |
R14588 | T17007 | T17020 | arg1Of | represents,0.001 |
R14589 | T17007 | T17021 | arg1Of | represents,compared |
R14590 | T17007 | T17024 | arg1Of | represents,"," |
R14591 | T17007 | T17025 | modOf | represents,***p |
R14592 | T17008 | T17007 | arg2Of | mean±SEM,represents |
R14593 | T17008 | T17009 | arg1Of | mean±SEM,of |
R14594 | T17012 | T17010 | arg1Of | three,at |
R14595 | T17012 | T17011 | arg1Of | three,least |
R14596 | T17014 | T17009 | arg2Of | experiments.,of |
R14597 | T17014 | T17012 | arg1Of | experiments.,three |
R14598 | T17014 | T17013 | arg1Of | experiments.,independent |
R14599 | T17018 | T17015 | arg1Of | p,# |
R14600 | T17018 | T17016 | arg1Of | p,# |
R14601 | T17018 | T17017 | arg1Of | p,# |
R14602 | T17018 | T17019 | arg1Of | p,< |
R14603 | T17020 | T17018 | arg1Of | 0.001,p |
R14604 | T17022 | T17021 | arg2Of | to,compared |
R14605 | T17023 | T17022 | arg2Of | control,to |
R14606 | T17027 | T17028 | arg1Of | 0.001,compared |
R14607 | T17029 | T17028 | arg2Of | to,compared |
R14608 | T17031 | T17029 | arg2Of | cells.,to |
R14609 | T17031 | T17030 | arg1Of | cells.,αCD3/CD28-stimulated |
R14610 | T17031 | T17032 | arg1Of | cells.,( |
R14611 | T17033 | T17032 | arg2Of | D,( |
R14612 | T17034 | T17032 | arg3Of | ),( |
R14613 | T17036 | T17026 | arg1Of | GATA-3,< |
R14614 | T17036 | T17027 | arg1Of | GATA-3,0.001 |
R14615 | T17036 | T17035 | arg1Of | GATA-3,GFP-tagged |
R14616 | T17036 | T17037 | arg1Of | GATA-3,was |
R14617 | T17036 | T17038 | arg2Of | GATA-3,overexpressed |
R14618 | T17038 | T17025 | arg2Of | overexpressed,***p |
R14619 | T17038 | T17037 | arg2Of | overexpressed,was |
R14620 | T17040 | T17039 | arg1Of | cells,and |
R14621 | T17040 | T17041 | arg2Of | cells,stimulated |
R14622 | T17040 | T17042 | arg1Of | cells,( |
R14623 | T17040 | T17047 | arg1Of | cells,or |
R14624 | T17043 | T17042 | arg2Of | b,( |
R14625 | T17043 | T17044 | arg1Of | b,"," |
R14626 | T17045 | T17044 | arg2Of | c,"," |
R14627 | T17046 | T17042 | arg3Of | ),( |
R14628 | T17047 | T17007 | arg3Of | or,represents |
R14629 | T17047 | T17048 | arg1Of | or,not |
R14630 | T17050 | T17051 | arg1Of | a,) |
R14631 | T17050 | T17052 | arg1Of | a,for |
R14632 | T17054 | T17052 | arg2Of | min,for |
R14633 | T17054 | T17053 | arg1Of | min,30 |
R14634 | T17056 | T17047 | arg2Of | anti-CD3/CD28,or |
R14635 | T17056 | T17049 | arg1Of | anti-CD3/CD28,( |
R14636 | T17056 | T17050 | arg1Of | anti-CD3/CD28,a |
R14637 | T17056 | T17055 | arg1Of | anti-CD3/CD28,with |
R14638 | T17058 | T17057 | arg1Of | effect,The |
R14639 | T17058 | T17059 | arg1Of | effect,of |
R14640 | T17058 | T17073 | arg1Of | effect,is |
R14641 | T17058 | T17075 | arg2Of | effect,shown |
R14642 | T17062 | T17059 | arg2Of | pretreatment,of |
R14643 | T17062 | T17060 | arg1Of | pretreatment,30 |
R14644 | T17062 | T17061 | arg1Of | pretreatment,min |
R14645 | T17062 | T17063 | arg1Of | pretreatment,of |
R14646 | T17062 | T17065 | arg1Of | pretreatment,with |
R14647 | T17064 | T17063 | arg2Of | cells,of |
R14648 | T17066 | T17065 | arg2Of | FP,with |
R14649 | T17066 | T17067 | arg1Of | FP,( |
R14650 | T17069 | T17067 | arg2Of | M,( |
R14651 | T17069 | T17068 | arg1Of | M,10−8 |
R14652 | T17069 | T17070 | arg1Of | M,"," |
R14653 | T17071 | T17070 | arg2Of | c,"," |
R14654 | T17072 | T17067 | arg3Of | ),( |
R14655 | T17075 | T17073 | arg2Of | shown,is |
R14656 | T17075 | T17074 | arg1Of | shown,also |
R14657 | T17077 | T17076 | arg1Of | data,All |
R14658 | T17077 | T17078 | arg1Of | data,were |
R14659 | T17077 | T17079 | arg2Of | data,analysed |
R14660 | T17079 | T17078 | arg2Of | analysed,were |
R14661 | T17081 | T17079 | arg1Of | ANOVA,analysed |
R14662 | T17081 | T17080 | arg2Of | ANOVA,by |
R14663 | T17081 | T17082 | arg2Of | ANOVA,followed |
R14664 | T17084 | T17082 | arg1Of | Newman-Keuls,followed |
R14665 | T17084 | T17083 | arg2Of | Newman-Keuls,by |
R14666 | T17084 | T17085 | arg1Of | Newman-Keuls,post-test |
R15109 | T17625 | T17624 | arg1Of | down-regulation,marked |
R15094 | T17610 | T17611 | arg1Of | Fluticasone,propionate–mediated |
R15095 | T17611 | T17618 | arg1Of | propionate–mediated,and |
R15096 | T17612 | T17611 | arg2Of | inhibition,propionate–mediated |
R15097 | T17612 | T17613 | arg1Of | inhibition,of |
R15098 | T17617 | T17613 | arg2Of | phosphorylation,of |
R15099 | T17617 | T17614 | arg1Of | phosphorylation,p38 |
R15100 | T17617 | T17615 | arg1Of | phosphorylation,MAP |
R15101 | T17617 | T17616 | arg1Of | phosphorylation,kinase |
R15102 | T17619 | T17620 | arg1Of | activation,is |
R15103 | T17619 | T17621 | arg2Of | activation,associated |
R15104 | T17621 | T17618 | arg2Of | associated,and |
R15105 | T17621 | T17620 | arg2Of | associated,is |
R15106 | T17621 | T17622 | arg1Of | associated,with |
R15107 | T17625 | T17622 | arg2Of | down-regulation,with |
R15108 | T17625 | T17623 | arg1Of | down-regulation,a |
R15110 | T17625 | T17626 | arg1Of | down-regulation,of |
R15111 | T17629 | T17626 | arg2Of | phosphorylation,of |
R15112 | T17629 | T17627 | arg1Of | phosphorylation,GATA-3 |
R15113 | T17629 | T17628 | arg1Of | phosphorylation,serine |
R15114 | T17631 | T17630 | arg2Of | A,( |
R15115 | T17632 | T17630 | arg3Of | ),( |
R15116 | T17635 | T17630 | arg1Of | analysis,( |
R15117 | T17635 | T17633 | arg1Of | analysis,Western |
R15118 | T17635 | T17634 | arg1Of | analysis,blot |
R15119 | T17635 | T17636 | arg1Of | analysis,shows |
R15120 | T17638 | T17639 | arg1Of | FP,( |
R15121 | T17641 | T17639 | arg2Of | M,( |
R15122 | T17641 | T17640 | arg1Of | M,10−8 |
R15123 | T17641 | T17642 | arg1Of | M,"," |
R15124 | T17644 | T17642 | arg2Of | min,"," |
R15125 | T17644 | T17643 | arg1Of | min,30 |
R15126 | T17645 | T17639 | arg3Of | ),( |
R15127 | T17646 | T17638 | arg1Of | treatment,FP |
R15128 | T17646 | T17647 | arg1Of | treatment,reduced |
R15129 | T17647 | T17636 | arg2Of | reduced,shows |
R15130 | T17647 | T17637 | arg1Of | reduced,that |
R15131 | T17649 | T17647 | arg2Of | phosphorylation,reduced |
R15132 | T17649 | T17648 | arg1Of | phosphorylation,dual |
R15133 | T17649 | T17650 | arg1Of | phosphorylation,( |
R15134 | T17651 | T17652 | arg1Of | threonine-180,and |
R15135 | T17652 | T17650 | arg2Of | and,( |
R15136 | T17653 | T17652 | arg2Of | tyrosine-182,and |
R15137 | T17654 | T17650 | arg3Of | ),( |
R15138 | T17657 | T17655 | arg2Of | MAPK,of |
R15139 | T17657 | T17656 | arg1Of | MAPK,p38 |
R15140 | T17661 | T17658 | arg2Of | cells.,in |
R15141 | T17661 | T17659 | arg1Of | cells.,anti-CD3/CD28–co-stimulated |
R15142 | T17661 | T17660 | arg1Of | cells.,HuT-78 |
R15143 | T17661 | T17662 | arg1Of | cells.,( |
R15144 | T17663 | T17662 | arg2Of | B,( |
R15145 | T17664 | T17662 | arg3Of | ),( |
R15146 | T17666 | T17665 | arg1Of | course,Time |
R15147 | T17666 | T17667 | arg1Of | course,of |
R15148 | T17666 | T17702 | arg1Of | course,is |
R15149 | T17666 | T17703 | arg2Of | course,associated |
R15150 | T17669 | T17667 | arg2Of | effect,of |
R15151 | T17669 | T17668 | arg1Of | effect,the |
R15152 | T17669 | T17670 | arg1Of | effect,of |
R15153 | T17669 | T17676 | arg1Of | effect,on |
R15154 | T17669 | T17678 | arg1Of | effect,of |
R15155 | T17671 | T17670 | arg2Of | FP,of |
R15156 | T17671 | T17672 | arg1Of | FP,( |
R15157 | T17674 | T17672 | arg2Of | M,( |
R15158 | T17674 | T17673 | arg1Of | M,10−8 |
R15159 | T17675 | T17672 | arg3Of | ),( |
R15160 | T17677 | T17676 | arg2Of | phosphorylation,on |
R15161 | T17681 | T17678 | arg2Of | factor,of |
R15162 | T17681 | T17679 | arg2Of | factor,activated |
R15163 | T17681 | T17680 | arg1Of | factor,transcription |
R15164 | T17681 | T17682 | arg1Of | factor,2 |
R15165 | T17681 | T17683 | arg1Of | factor,( |
R15166 | T17681 | T17686 | arg1Of | factor,"," |
R15167 | T17684 | T17683 | arg2Of | ATF-2,( |
R15168 | T17685 | T17683 | arg3Of | ),( |
R15169 | T17688 | T17686 | arg2Of | measure,"," |
R15170 | T17688 | T17687 | arg1Of | measure,a |
R15171 | T17688 | T17689 | arg1Of | measure,of |
R15172 | T17694 | T17693 | arg2Of | C,( |
R15173 | T17695 | T17693 | arg3Of | ),( |
R15174 | T17697 | T17689 | arg2Of | inhibition,of |
R15175 | T17697 | T17690 | arg1Of | inhibition,p38 |
R15176 | T17697 | T17691 | arg1Of | inhibition,MAPK |
R15177 | T17697 | T17692 | arg1Of | inhibition,activity. |
R15178 | T17697 | T17693 | arg1Of | inhibition,( |
R15179 | T17697 | T17696 | arg1Of | inhibition,FP-induced |
R15180 | T17697 | T17698 | arg1Of | inhibition,of |
R15181 | T17701 | T17698 | arg2Of | activity,of |
R15182 | T17701 | T17699 | arg1Of | activity,p38 |
R15183 | T17701 | T17700 | arg1Of | activity,MAPK |
R15184 | T17703 | T17702 | arg2Of | associated,is |
R15185 | T17703 | T17704 | arg1Of | associated,with |
R15186 | T17706 | T17704 | arg2Of | decrease,with |
R15187 | T17706 | T17705 | arg1Of | decrease,the |
R15188 | T17706 | T17707 | arg1Of | decrease,of |
R15189 | T17711 | T17707 | arg2Of | phosphorylation,of |
R15190 | T17711 | T17708 | arg1Of | phosphorylation,anti-CD3/CD28 |
R15191 | T17711 | T17709 | arg1Of | phosphorylation,co-stimulation–induced |
R15192 | T17711 | T17710 | arg1Of | phosphorylation,serine |
R15193 | T17711 | T17712 | arg1Of | phosphorylation,( |
R15194 | T17711 | T17715 | arg1Of | phosphorylation,of |
R15195 | T17713 | T17712 | arg2Of | P-Ser,( |
R15196 | T17714 | T17712 | arg3Of | ),( |
R15197 | T17716 | T17715 | arg2Of | GATA-3,of |
R15198 | T17719 | T17717 | arg2Of | A–C,For |
R15199 | T17719 | T17718 | arg2Of | A–C,( |
R15200 | T17720 | T17718 | arg3Of | ),( |
R15201 | T17722 | T17723 | arg1Of | quantification,of |
R15202 | T17722 | T17727 | arg1Of | quantification,is |
R15203 | T17722 | T17729 | arg2Of | quantification,shown |
R15204 | T17726 | T17723 | arg2Of | data,of |
R15205 | T17726 | T17724 | arg1Of | data,the |
R15206 | T17726 | T17725 | arg1Of | data,densitometry |
R15207 | T17729 | T17717 | arg1Of | shown,For |
R15208 | T17729 | T17721 | arg1Of | shown,"," |
R15209 | T17729 | T17727 | arg2Of | shown,is |
R15210 | T17729 | T17728 | arg1Of | shown,also |
R15211 | T17731 | T17730 | arg1Of | bar,Each |
R15212 | T17731 | T17732 | arg1Of | bar,represents |
R15213 | T17731 | T17750 | arg1Of | bar,***p |
R15214 | T17732 | T17750 | modOf | represents,***p |
R15215 | T17733 | T17732 | arg2Of | mean±SEM,represents |
R15216 | T17733 | T17734 | arg1Of | mean±SEM,of |
R15217 | T17737 | T17735 | arg1Of | three,at |
R15218 | T17737 | T17736 | arg1Of | three,least |
R15219 | T17739 | T17737 | arg1Of | experiments.,three |
R15220 | T17739 | T17738 | arg1Of | experiments.,independent |
R15221 | T17743 | T17734 | arg2Of | p,of |
R15222 | T17743 | T17739 | arg1Of | p,experiments. |
R15223 | T17743 | T17740 | arg1Of | p,# |
R15224 | T17743 | T17741 | arg1Of | p,# |
R15225 | T17743 | T17742 | arg1Of | p,# |
R15226 | T17745 | T17732 | arg3Of | 0.001,represents |
R15227 | T17745 | T17744 | arg1Of | 0.001,< |
R15228 | T17745 | T17746 | arg1Of | 0.001,compared |
R15229 | T17747 | T17746 | arg2Of | to,compared |
R15230 | T17748 | T17747 | arg2Of | control,to |
R15231 | T17750 | T17749 | arg1Of | ***p,"," |
R15232 | T17752 | T17753 | arg1Of | 0.001,compared |
R15233 | T17754 | T17753 | arg2Of | to,compared |
R15234 | T17756 | T17754 | arg2Of | cells.,to |
R15235 | T17756 | T17755 | arg1Of | cells.,αCD3/CD28-stimulated |
R15236 | T17756 | T17757 | arg1Of | cells.,( |
R15237 | T17758 | T17757 | arg2Of | D,( |
R15238 | T17759 | T17757 | arg3Of | ),( |
R15239 | T17760 | T17751 | arg1Of | FP,< |
R15240 | T17760 | T17752 | arg1Of | FP,0.001 |
R15241 | T17760 | T17761 | arg1Of | FP,induced |
R15242 | T17761 | T17750 | arg2Of | induced,***p |
R15243 | T17761 | T17764 | arg1Of | induced,in |
R15244 | T17763 | T17761 | arg2Of | mRNA,induced |
R15245 | T17763 | T17762 | arg1Of | mRNA,MKP-1 |
R15246 | T17767 | T17764 | arg2Of | manner,in |
R15247 | T17767 | T17765 | arg1Of | manner,a |
R15248 | T17767 | T17766 | arg1Of | manner,concentration-dependent |
R15249 | T17769 | T17768 | arg1Of | results,All |
R15250 | T17769 | T17770 | arg1Of | results,are |
R15251 | T17769 | T17771 | arg1Of | results,representative |
R15252 | T17771 | T17770 | arg2Of | representative,are |
R15253 | T17771 | T17772 | arg1Of | representative,of |
R15254 | T17775 | T17773 | arg1Of | three,at |
R15255 | T17775 | T17774 | arg1Of | three,least |
R15256 | T17777 | T17775 | arg1Of | experiments,three |
R15257 | T17777 | T17776 | arg1Of | experiments,independent |
R15258 | T17777 | T17778 | arg1Of | experiments,and |
R15259 | T17778 | T17772 | arg2Of | and,of |
R15260 | T17779 | T17778 | arg2Of | where,and |
R15261 | T17781 | T17782 | arg1Of | expressed,as |
R15262 | T17783 | T17782 | arg2Of | means±SEM,as |
R15263 | T17783 | T17784 | arg1Of | means±SEM,"," |
R15264 | T17785 | T17784 | arg2Of | *p,"," |
R15265 | T17785 | T17786 | arg1Of | *p,< |
R15266 | T17789 | T17788 | arg2Of | E,( |
R15267 | T17790 | T17788 | arg3Of | ),( |
R15268 | T17791 | T17780 | arg1Of | FP,appropriate |
R15269 | T17791 | T17781 | arg2Of | FP,expressed |
R15270 | T17791 | T17787 | arg1Of | FP,0.05. |
R15271 | T17791 | T17788 | arg1Of | FP,( |
R15272 | T17791 | T17792 | arg1Of | FP,induces |
R15273 | T17792 | T17779 | arg1Of | induces,where |
R15274 | T17792 | T17795 | arg1Of | induces,in |
R15275 | T17794 | T17792 | arg2Of | mRNA,induces |
R15276 | T17794 | T17793 | arg1Of | mRNA,MKP-1 |
R15277 | T17798 | T17795 | arg2Of | manner,in |
R15278 | T17798 | T17796 | arg1Of | manner,a |
R15279 | T17798 | T17797 | arg1Of | manner,time-dependent |
R15280 | T17799 | T17800 | arg1Of | Results,are |
R15281 | T17799 | T17801 | arg1Of | Results,representative |
R15282 | T17801 | T17800 | arg2Of | representative,are |
R15283 | T17801 | T17802 | arg1Of | representative,of |
R15284 | T17805 | T17802 | arg2Of | experiments,of |
R15285 | T17805 | T17803 | arg1Of | experiments,two |
R15286 | T17805 | T17804 | arg1Of | experiments,independent |
R15287 | T17807 | T17806 | arg1Of | data,All |
R15288 | T17807 | T17808 | arg1Of | data,except |
R15289 | T17807 | T17809 | arg1Of | data,( |
R15290 | T17807 | T17812 | arg1Of | data,were |
R15291 | T17807 | T17813 | arg2Of | data,analysed |
R15292 | T17810 | T17809 | arg2Of | E,( |
R15293 | T17811 | T17809 | arg3Of | ),( |
R15294 | T17813 | T17812 | arg2Of | analysed,were |
R15295 | T17815 | T17813 | arg1Of | ANOVA,analysed |
R15296 | T17815 | T17814 | arg2Of | ANOVA,by |
R15297 | T17815 | T17816 | arg2Of | ANOVA,followed |
R15298 | T17818 | T17816 | arg1Of | Newman-Keuls,followed |
R15299 | T17818 | T17817 | arg2Of | Newman-Keuls,by |
R15300 | T17818 | T17819 | arg1Of | Newman-Keuls,post-test |
R15975 | T18719 | T18718 | arg1Of | propionate,Fluticasone |
R15976 | T18719 | T18720 | arg1Of | propionate,does |
R15977 | T18719 | T18722 | arg1Of | propionate,affect |
R15978 | T18722 | T18720 | arg2Of | affect,does |
R15979 | T18722 | T18721 | arg1Of | affect,not |
R15980 | T18725 | T18722 | arg2Of | export,affect |
R15981 | T18725 | T18723 | arg1Of | export,GATA-3 |
R15982 | T18725 | T18724 | arg1Of | export,nuclear |
R15983 | T18727 | T18726 | arg2Of | A,( |
R15984 | T18728 | T18726 | arg3Of | ),( |
R15985 | T18731 | T18726 | arg1Of | analysis,( |
R15986 | T18731 | T18729 | arg1Of | analysis,Western |
R15987 | T18731 | T18730 | arg1Of | analysis,blot |
R15988 | T18731 | T18732 | arg1Of | analysis,showing |
R15989 | T18731 | T18815 | arg1Of | analysis,( |
R15990 | T18731 | T18818 | arg1Of | analysis,or |
R15991 | T18739 | T18734 | arg1Of | B,the |
R15992 | T18739 | T18735 | arg1Of | B,nuclear |
R15993 | T18739 | T18736 | arg1Of | B,export |
R15994 | T18739 | T18737 | arg1Of | B,inhibitor |
R15995 | T18739 | T18738 | arg1Of | B,leptomycin |
R15996 | T18739 | T18740 | arg1Of | B,( |
R15997 | T18739 | T18744 | arg1Of | B,does |
R15998 | T18739 | T18746 | arg1Of | B,affect |
R15999 | T18742 | T18740 | arg2Of | nM,( |
R16000 | T18742 | T18741 | arg1Of | nM,2 |
R16001 | T18743 | T18740 | arg3Of | ),( |
R16002 | T18746 | T18744 | arg2Of | affect,does |
R16003 | T18746 | T18745 | arg1Of | affect,not |
R16004 | T18746 | T18772 | arg1Of | affect,"," |
R16005 | T18748 | T18746 | arg2Of | ability,affect |
R16006 | T18748 | T18747 | arg1Of | ability,the |
R16007 | T18748 | T18749 | arg1Of | ability,of |
R16008 | T18748 | T18755 | modOf | ability,to |
R16009 | T18748 | T18756 | arg1Of | ability,prevent |
R16010 | T18750 | T18749 | arg2Of | FP,of |
R16011 | T18750 | T18751 | arg1Of | FP,( |
R16012 | T18753 | T18751 | arg2Of | M,( |
R16013 | T18753 | T18752 | arg1Of | M,10−8 |
R16014 | T18754 | T18751 | arg3Of | ),( |
R16015 | T18756 | T18755 | arg1Of | prevent,to |
R16016 | T18760 | T18756 | arg2Of | localization,prevent |
R16017 | T18760 | T18757 | arg1Of | localization,anti-CD3/CD28–stimulated |
R16018 | T18760 | T18758 | arg1Of | localization,GATA-3 |
R16019 | T18760 | T18759 | arg1Of | localization,nuclear |
R16020 | T18760 | T18761 | arg2Of | localization,measured |
R16021 | T18760 | T18768 | arg1Of | localization,compared |
R16022 | T18761 | T18762 | arg1Of | measured,at |
R16023 | T18765 | T18766 | arg1Of | ***p,< |
R16024 | T18767 | T18762 | arg2Of | 0.001,at |
R16025 | T18767 | T18763 | arg1Of | 0.001,60 |
R16026 | T18767 | T18764 | arg1Of | 0.001,min. |
R16027 | T18767 | T18765 | arg1Of | 0.001,***p |
R16028 | T18769 | T18768 | arg2Of | to,compared |
R16029 | T18771 | T18769 | arg2Of | cells,to |
R16030 | T18771 | T18770 | arg1Of | cells,unstimulated |
R16031 | T18772 | T18732 | arg2Of | ",",showing |
R16032 | T18772 | T18733 | arg1Of | ",",that |
R16033 | T18777 | T18778 | arg1Of | <,0.001 |
R16034 | T18777 | T18779 | arg1Of | <,compared |
R16035 | T18780 | T18779 | arg2Of | to,compared |
R16036 | T18782 | T18780 | arg2Of | cells.,to |
R16037 | T18782 | T18781 | arg1Of | cells.,anti-CD3/CD28–stimulated |
R16038 | T18782 | T18783 | arg1Of | cells.,( |
R16039 | T18784 | T18783 | arg2Of | B,( |
R16040 | T18785 | T18783 | arg3Of | ),( |
R16041 | T18788 | T18773 | arg1Of | analysis,# |
R16042 | T18788 | T18774 | arg1Of | analysis,# |
R16043 | T18788 | T18775 | arg1Of | analysis,# |
R16044 | T18788 | T18776 | arg1Of | analysis,p |
R16045 | T18788 | T18777 | arg1Of | analysis,< |
R16046 | T18788 | T18786 | arg1Of | analysis,Western |
R16047 | T18788 | T18787 | arg1Of | analysis,blot |
R16048 | T18788 | T18789 | arg1Of | analysis,showing |
R16049 | T18788 | T18810 | arg1Of | analysis,is |
R16050 | T18788 | T18811 | arg2Of | analysis,overexpressed |
R16051 | T18791 | T18792 | arg1Of | FP,( |
R16052 | T18791 | T18796 | arg1Of | FP,does |
R16053 | T18791 | T18798 | arg1Of | FP,affect |
R16054 | T18794 | T18792 | arg2Of | M,( |
R16055 | T18794 | T18793 | arg1Of | M,10−8 |
R16056 | T18795 | T18792 | arg3Of | ),( |
R16057 | T18798 | T18789 | arg2Of | affect,showing |
R16058 | T18798 | T18790 | arg1Of | affect,that |
R16059 | T18798 | T18796 | arg2Of | affect,does |
R16060 | T18798 | T18797 | arg1Of | affect,not |
R16061 | T18798 | T18802 | arg1Of | affect,over |
R16062 | T18801 | T18798 | arg2Of | degradation,affect |
R16063 | T18801 | T18799 | arg1Of | degradation,whole-cell |
R16064 | T18801 | T18800 | arg1Of | degradation,GATA-3 |
R16065 | T18806 | T18805 | arg2Of | C,( |
R16066 | T18807 | T18805 | arg3Of | ),( |
R16067 | T18808 | T18804 | arg1Of | GFP-tagged,h. |
R16068 | T18808 | T18805 | arg1Of | GFP-tagged,( |
R16069 | T18809 | T18802 | arg2Of | GATA-3,over |
R16070 | T18809 | T18803 | arg1Of | GATA-3,17 |
R16071 | T18809 | T18808 | arg1Of | GATA-3,GFP-tagged |
R16072 | T18811 | T18810 | arg2Of | overexpressed,is |
R16073 | T18811 | T18812 | arg1Of | overexpressed,and |
R16074 | T18812 | T18772 | arg2Of | and,"," |
R16075 | T18813 | T18814 | arg1Of | cells,stimulated |
R16076 | T18814 | T18812 | arg2Of | stimulated,and |
R16077 | T18816 | T18815 | arg2Of | b–j,( |
R16078 | T18817 | T18815 | arg3Of | ),( |
R16079 | T18818 | T18819 | arg1Of | or,not |
R16080 | T18824 | T18818 | arg2Of | anti-CD3/CD28,or |
R16081 | T18824 | T18820 | arg1Of | anti-CD3/CD28,( |
R16082 | T18824 | T18821 | arg1Of | anti-CD3/CD28,a |
R16083 | T18824 | T18822 | arg1Of | anti-CD3/CD28,) |
R16084 | T18824 | T18823 | arg1Of | anti-CD3/CD28,with |
R16085 | T18826 | T18825 | arg1Of | effect,The |
R16086 | T18826 | T18827 | arg1Of | effect,of |
R16087 | T18826 | T18855 | arg1Of | effect,does |
R16088 | T18826 | T18857 | arg1Of | effect,prevent |
R16089 | T18828 | T18827 | arg2Of | treating,of |
R16090 | T18828 | T18830 | arg1Of | treating,with |
R16091 | T18828 | T18838 | arg1Of | treating,after |
R16092 | T18829 | T18828 | arg2Of | cells,treating |
R16093 | T18831 | T18830 | arg2Of | FP,with |
R16094 | T18831 | T18832 | arg1Of | FP,( |
R16095 | T18834 | T18832 | arg2Of | M,( |
R16096 | T18834 | T18833 | arg1Of | M,10−8 |
R16097 | T18834 | T18835 | arg1Of | M,"," |
R16098 | T18836 | T18835 | arg2Of | f–j,"," |
R16099 | T18837 | T18832 | arg3Of | ),( |
R16100 | T18841 | T18839 | arg1Of | stimulation,30 |
R16101 | T18841 | T18840 | arg1Of | stimulation,min |
R16102 | T18841 | T18842 | arg1Of | stimulation,with |
R16103 | T18841 | T18844 | arg1Of | stimulation,is |
R16104 | T18843 | T18842 | arg2Of | anti-CD3/CD28,with |
R16105 | T18844 | T18838 | arg2Of | is,after |
R16106 | T18844 | T18845 | arg1Of | is,also |
R16107 | T18844 | T18850 | arg1Of | is,FP |
R16108 | T18846 | T18844 | arg2Of | shown.,is |
R16109 | T18846 | T18847 | arg1Of | shown.,( |
R16110 | T18848 | T18847 | arg2Of | D,( |
R16111 | T18849 | T18847 | arg3Of | ),( |
R16112 | T18850 | T18851 | arg1Of | FP,( |
R16113 | T18853 | T18851 | arg2Of | M,( |
R16114 | T18853 | T18852 | arg1Of | M,10−8 |
R16115 | T18854 | T18851 | arg3Of | ),( |
R16116 | T18857 | T18855 | arg2Of | prevent,does |
R16117 | T18857 | T18856 | arg1Of | prevent,not |
R16118 | T18857 | T18862 | arg1Of | prevent,at |
R16119 | T18857 | T18865 | arg1Of | prevent,after |
R16120 | T18857 | T18870 | arg1Of | prevent,compared |
R16121 | T18861 | T18857 | arg2Of | translocation,prevent |
R16122 | T18861 | T18858 | arg1Of | translocation,anti-CD3/CD28–stimulated |
R16123 | T18861 | T18859 | arg1Of | translocation,p65 |
R16124 | T18861 | T18860 | arg1Of | translocation,nuclear |
R16125 | T18864 | T18862 | arg2Of | min,at |
R16126 | T18864 | T18863 | arg1Of | min,60 |
R16127 | T18867 | T18868 | arg1Of | **p,< |
R16128 | T18869 | T18865 | arg2Of | 0.01,after |
R16129 | T18869 | T18866 | arg1Of | 0.01,stimulation. |
R16130 | T18869 | T18867 | arg1Of | 0.01,**p |
R16131 | T18871 | T18870 | arg2Of | to,compared |
R16132 | T18873 | T18871 | arg2Of | cells,to |
R16133 | T18873 | T18872 | arg1Of | cells,unstimulated |
R16134 | T18875 | T18874 | arg1Of | results,All |
R16135 | T18875 | T18876 | arg1Of | results,are |
R16136 | T18875 | T18877 | arg1Of | results,representative |
R16137 | T18875 | T18885 | arg1Of | results,are |
R16138 | T18875 | T18886 | arg2Of | results,shown |
R16139 | T18876 | T18884 | arg1Of | are,and |
R16140 | T18877 | T18876 | arg2Of | representative,are |
R16141 | T18877 | T18878 | arg1Of | representative,of |
R16142 | T18881 | T18879 | arg1Of | four,at |
R16143 | T18881 | T18880 | arg1Of | four,least |
R16144 | T18883 | T18878 | arg2Of | experiments,of |
R16145 | T18883 | T18881 | arg1Of | experiments,four |
R16146 | T18883 | T18882 | arg1Of | experiments,independent |
R16147 | T18886 | T18884 | arg2Of | shown,and |
R16148 | T18886 | T18885 | arg2Of | shown,are |
R16149 | T18886 | T18887 | arg1Of | shown,as |
R16150 | T18888 | T18887 | arg2Of | mean±SEM,as |
R16151 | T18889 | T18890 | arg1Of | Results,were |
R16152 | T18889 | T18891 | arg2Of | Results,analysed |
R16153 | T18891 | T18890 | arg2Of | analysed,were |
R16154 | T18893 | T18891 | arg1Of | ANOVA,analysed |
R16155 | T18893 | T18892 | arg2Of | ANOVA,by |
R16156 | T18893 | T18894 | arg2Of | ANOVA,followed |
R16157 | T18897 | T18894 | arg1Of | test,followed |
R16158 | T18897 | T18895 | arg2Of | test,by |
R16159 | T18897 | T18896 | arg1Of | test,Newman-Keuls |
R16458 | T19292 | T19291 | arg1Of | propionate,Fluticasone |
R16459 | T19292 | T19293 | arg1Of | propionate,impairs |
R16460 | T19293 | T19303 | arg1Of | impairs,vivo |
R16461 | T19293 | T19306 | arg1Of | impairs,vivo |
R16462 | T19295 | T19293 | arg2Of | interaction,impairs |
R16463 | T19295 | T19294 | arg1Of | interaction,GATA-3 |
R16464 | T19295 | T19296 | arg1Of | interaction,with |
R16465 | T19297 | T19298 | arg1Of | importin-α,and |
R16466 | T19298 | T19296 | arg2Of | and,with |
R16467 | T19301 | T19298 | arg2Of | localization,and |
R16468 | T19301 | T19299 | arg1Of | localization,GATA-3 |
R16469 | T19301 | T19300 | arg1Of | localization,nuclear |
R16470 | T19303 | T19302 | arg1Of | vivo,in |
R16471 | T19303 | T19304 | arg1Of | vivo,and |
R16472 | T19306 | T19304 | arg2Of | vivo,and |
R16473 | T19306 | T19305 | arg1Of | vivo,ex |
R16474 | T19308 | T19309 | arg1Of | A,and |
R16475 | T19309 | T19307 | arg2Of | and,( |
R16476 | T19309 | T19325 | modOf | and,demonstrated |
R16477 | T19310 | T19309 | arg2Of | B,and |
R16478 | T19311 | T19307 | arg3Of | ),( |
R16479 | T19313 | T19312 | arg1Of | analysis,Co-immunoprecipitation |
R16480 | T19313 | T19314 | arg1Of | analysis,of |
R16481 | T19313 | T19325 | arg1Of | analysis,demonstrated |
R16482 | T19315 | T19314 | arg2Of | PBMCs,of |
R16483 | T19315 | T19316 | arg1Of | PBMCs,from |
R16484 | T19319 | T19316 | arg2Of | patients,from |
R16485 | T19319 | T19317 | arg1Of | patients,steroid-naïve |
R16486 | T19319 | T19318 | arg1Of | patients,asthma |
R16487 | T19319 | T19320 | arg2Of | patients,treated |
R16488 | T19319 | T19324 | arg1Of | patients,vitro |
R16489 | T19320 | T19321 | arg1Of | treated,with |
R16490 | T19322 | T19321 | arg2Of | FP,with |
R16491 | T19324 | T19323 | arg1Of | vitro,in |
R16492 | T19327 | T19325 | arg2Of | interaction,demonstrated |
R16493 | T19327 | T19326 | arg1Of | interaction,impaired |
R16494 | T19327 | T19328 | arg1Of | interaction,between |
R16495 | T19329 | T19330 | arg1Of | GATA-3,and |
R16496 | T19330 | T19328 | arg2Of | and,between |
R16497 | T19330 | T19332 | arg2Of | and,measured |
R16498 | T19331 | T19330 | arg2Of | importin-α,and |
R16499 | T19332 | T19333 | arg1Of | measured,at |
R16500 | T19335 | T19333 | arg2Of | min,at |
R16501 | T19335 | T19334 | arg1Of | min,60 |
R16502 | T19337 | T19336 | arg1Of | bar,Each |
R16503 | T19337 | T19338 | arg1Of | bar,represents |
R16504 | T19338 | T19347 | arg1Of | represents,; |
R16505 | T19340 | T19338 | arg2Of | mean±SEM,represents |
R16506 | T19340 | T19339 | arg1Of | mean±SEM,the |
R16507 | T19340 | T19341 | arg1Of | mean±SEM,of |
R16508 | T19344 | T19342 | arg1Of | three,at |
R16509 | T19344 | T19343 | arg1Of | three,least |
R16510 | T19346 | T19341 | arg2Of | experiments,of |
R16511 | T19346 | T19344 | arg1Of | experiments,three |
R16512 | T19346 | T19345 | arg1Of | experiments,independent |
R16513 | T19349 | T19348 | arg1Of | p,*** |
R16514 | T19349 | T19351 | arg1Of | p,0.001 |
R16515 | T19349 | T19352 | arg1Of | p,compared |
R16516 | T19351 | T19350 | arg1Of | 0.001,< |
R16517 | T19352 | T19347 | arg2Of | compared,; |
R16518 | T19352 | T19353 | arg1Of | compared,with |
R16519 | T19352 | T19355 | arg1Of | compared,as |
R16520 | T19354 | T19353 | arg2Of | control,with |
R16521 | T19356 | T19355 | arg2Of | determined,as |
R16522 | T19356 | T19357 | arg1Of | determined,by |
R16523 | T19359 | T19357 | arg2Of | analysis.,by |
R16524 | T19359 | T19358 | arg1Of | analysis.,ANOVA/Newman-Keuls |
R16525 | T19359 | T19360 | arg1Of | analysis.,( |
R16526 | T19361 | T19362 | arg1Of | C,and |
R16527 | T19362 | T19360 | arg2Of | and,( |
R16528 | T19363 | T19362 | arg2Of | D,and |
R16529 | T19364 | T19360 | arg3Of | ),( |
R16530 | T19366 | T19365 | arg1Of | analyses,Co-immunoprecipitation |
R16531 | T19366 | T19367 | arg1Of | analyses,of |
R16532 | T19366 | T19386 | arg1Of | analyses,demonstrated |
R16533 | T19368 | T19367 | arg2Of | PBMCs,of |
R16534 | T19368 | T19369 | arg1Of | PBMCs,from |
R16535 | T19372 | T19369 | arg2Of | patients,from |
R16536 | T19372 | T19370 | arg1Of | patients,steroid-naïve |
R16537 | T19372 | T19371 | arg1Of | patients,asthma |
R16538 | T19372 | T19373 | arg2Of | patients,treated |
R16539 | T19373 | T19374 | arg1Of | treated,with |
R16540 | T19376 | T19374 | arg2Of | FP,with |
R16541 | T19376 | T19375 | arg2Of | FP,inhaled |
R16542 | T19376 | T19377 | arg1Of | FP,( |
R16543 | T19376 | T19385 | arg1Of | FP,vivo |
R16544 | T19379 | T19377 | arg2Of | µg,( |
R16545 | T19379 | T19378 | arg1Of | µg,500 |
R16546 | T19379 | T19380 | arg1Of | µg,via |
R16547 | T19382 | T19380 | arg2Of | spacer,via |
R16548 | T19382 | T19381 | arg1Of | spacer,a |
R16549 | T19383 | T19377 | arg3Of | ),( |
R16550 | T19385 | T19384 | arg1Of | vivo,in |
R16551 | T19386 | T19347 | arg3Of | demonstrated,; |
R16552 | T19388 | T19386 | arg2Of | association,demonstrated |
R16553 | T19388 | T19387 | arg2Of | association,decreased |
R16554 | T19388 | T19389 | arg1Of | association,between |
R16555 | T19390 | T19391 | arg1Of | GATA-3,and |
R16556 | T19391 | T19389 | arg2Of | and,between |
R16557 | T19392 | T19391 | arg2Of | importin-α,and |
R16558 | T19395 | T19393 | arg1Of | values,The |
R16559 | T19395 | T19394 | arg1Of | values,individual |
R16560 | T19395 | T19396 | arg1Of | values,for |
R16561 | T19395 | T19399 | arg1Of | values,are |
R16562 | T19395 | T19400 | arg2Of | values,presented |
R16563 | T19398 | T19396 | arg2Of | treatment,for |
R16564 | T19398 | T19397 | arg1Of | treatment,each |
R16565 | T19400 | T19399 | arg2Of | presented,are |
R16566 | T19403 | T19402 | arg2Of | E,( |
R16567 | T19404 | T19402 | arg3Of | ),( |
R16568 | T19407 | T19400 | arg3Of | blot,presented |
R16569 | T19407 | T19401 | arg1Of | blot,graphically. |
R16570 | T19407 | T19402 | arg1Of | blot,( |
R16571 | T19407 | T19405 | arg1Of | blot,Representative |
R16572 | T19407 | T19406 | arg1Of | blot,Western |
R16573 | T19407 | T19408 | arg1Of | blot,showing |
R16574 | T19411 | T19410 | arg1Of | expression,importin-α |
R16575 | T19411 | T19412 | arg1Of | expression,was |
R16576 | T19411 | T19413 | arg2Of | expression,unaffected |
R16577 | T19413 | T19408 | arg2Of | unaffected,showing |
R16578 | T19413 | T19409 | arg1Of | unaffected,that |
R16579 | T19413 | T19412 | arg2Of | unaffected,was |
R16580 | T19415 | T19413 | arg1Of | inhalation,unaffected |
R16581 | T19415 | T19414 | arg2Of | inhalation,by |
R16582 | T19415 | T19416 | arg1Of | inhalation,of |
R16583 | T19417 | T19416 | arg2Of | FP,of |
R16584 | T19418 | T19419 | arg1Of | Blot,is |
R16585 | T19418 | T19420 | arg1Of | Blot,representative |
R16586 | T19420 | T19419 | arg2Of | representative,is |
R16587 | T19420 | T19421 | arg1Of | representative,of |
R16588 | T19422 | T19421 | arg2Of | gels,of |
R16589 | T19422 | T19423 | arg1Of | gels,from |
R16590 | T19425 | T19423 | arg2Of | participants,from |
R16591 | T19425 | T19424 | arg1Of | participants,three |
R16836 | T19734 | T19732 | arg2Of | propionate,Inhaled |
R16837 | T19734 | T19733 | arg1Of | propionate,fluticasone |
R16838 | T19734 | T19735 | arg1Of | propionate,impairs |
R16839 | T19738 | T19735 | arg2Of | localization,impairs |
R16840 | T19738 | T19736 | arg1Of | localization,GATA-3 |
R16841 | T19738 | T19737 | arg1Of | localization,nuclear |
R16842 | T19738 | T19739 | arg1Of | localization,in |
R16843 | T19740 | T19739 | arg2Of | PBMCs,in |
R16844 | T19742 | T19741 | arg2Of | A,( |
R16845 | T19743 | T19741 | arg3Of | ),( |
R16846 | T19745 | T19741 | arg1Of | immunocytochemistry,( |
R16847 | T19745 | T19744 | arg1Of | immunocytochemistry,Representative |
R16848 | T19745 | T19746 | arg1Of | immunocytochemistry,of |
R16849 | T19747 | T19746 | arg2Of | showing,of |
R16850 | T19747 | T19778 | arg1Of | showing,following |
R16851 | T19749 | T19747 | arg2Of | effect,showing |
R16852 | T19749 | T19748 | arg1Of | effect,the |
R16853 | T19749 | T19750 | arg1Of | effect,of |
R16854 | T19749 | T19757 | arg1Of | effect,on |
R16855 | T19752 | T19750 | arg2Of | FP,of |
R16856 | T19752 | T19751 | arg2Of | FP,inhaled |
R16857 | T19752 | T19753 | arg1Of | FP,( |
R16858 | T19755 | T19753 | arg2Of | µg,( |
R16859 | T19755 | T19754 | arg1Of | µg,500 |
R16860 | T19756 | T19753 | arg3Of | ),( |
R16861 | T19758 | T19759 | arg1Of | GR,and |
R16862 | T19760 | T19759 | arg2Of | GATA-3,and |
R16863 | T19764 | T19763 | arg2Of | B,( |
R16864 | T19765 | T19763 | arg3Of | ),( |
R16865 | T19768 | T19757 | arg2Of | immunoreactivity,on |
R16866 | T19768 | T19758 | arg1Of | immunoreactivity,GR |
R16867 | T19768 | T19760 | arg1Of | immunoreactivity,GATA-3 |
R16868 | T19768 | T19761 | arg1Of | immunoreactivity,nuclear |
R16869 | T19768 | T19762 | arg1Of | immunoreactivity,localisation. |
R16870 | T19768 | T19763 | arg1Of | immunoreactivity,( |
R16871 | T19768 | T19766 | arg1Of | immunoreactivity,Nuclear |
R16872 | T19768 | T19767 | arg1Of | immunoreactivity,GATA-3 |
R16873 | T19768 | T19769 | arg1Of | immunoreactivity,in |
R16874 | T19768 | T19771 | arg1Of | immunoreactivity,from |
R16875 | T19770 | T19769 | arg2Of | PBMCs,in |
R16876 | T19775 | T19771 | arg2Of | patients,from |
R16877 | T19775 | T19772 | arg1Of | patients,seven |
R16878 | T19775 | T19773 | arg1Of | patients,steroid-naïve |
R16879 | T19775 | T19774 | arg1Of | patients,asthma |
R16880 | T19777 | T19776 | arg1Of | h,2 |
R16881 | T19778 | T19777 | arg1Of | following,h |
R16882 | T19781 | T19778 | arg2Of | treatment,following |
R16883 | T19781 | T19779 | arg2Of | treatment,inhaled |
R16884 | T19781 | T19780 | arg1Of | treatment,FP |
R16885 | T19781 | T19782 | arg1Of | treatment,( |
R16886 | T19783 | T19784 | arg1Of | 100,or |
R16887 | T19785 | T19784 | arg2Of | 500,or |
R16888 | T19786 | T19782 | arg2Of | µg,( |
R16889 | T19786 | T19783 | arg1Of | µg,100 |
R16890 | T19786 | T19785 | arg1Of | µg,500 |
R16891 | T19786 | T19787 | arg1Of | µg,via |
R16892 | T19788 | T19787 | arg2Of | spacer,via |
R16893 | T19789 | T19782 | arg3Of | ),( |
R16894 | T19791 | T19792 | arg1Of | median,and |
R16895 | T19793 | T19792 | arg2Of | interquartile,and |
R16896 | T19794 | T19790 | arg1Of | ranges,The |
R16897 | T19794 | T19791 | arg1Of | ranges,median |
R16898 | T19794 | T19793 | arg1Of | ranges,interquartile |
R16899 | T19794 | T19795 | arg1Of | ranges,for |
R16900 | T19794 | T19798 | arg1Of | ranges,are |
R16901 | T19794 | T19799 | arg2Of | ranges,presented |
R16902 | T19797 | T19795 | arg2Of | treatment,for |
R16903 | T19797 | T19796 | arg1Of | treatment,each |
R16904 | T19799 | T19798 | arg2Of | presented,are |
R16905 | T19799 | T19800 | arg1Of | presented,as |
R16906 | T19799 | T19807 | arg1Of | presented,; |
R16907 | T19803 | T19800 | arg2Of | plot,as |
R16908 | T19803 | T19801 | arg1Of | plot,a |
R16909 | T19803 | T19802 | arg1Of | plot,box-and-whiskers |
R16910 | T19803 | T19804 | arg1Of | plot,( |
R16911 | T19805 | T19804 | arg2Of | n = 7,( |
R16912 | T19806 | T19804 | arg3Of | ),( |
R16913 | T19811 | T19810 | arg1Of | 0.05,< |
R16914 | T19812 | T19808 | arg1Of | Wilcoxon,* |
R16915 | T19812 | T19809 | arg1Of | Wilcoxon,p |
R16916 | T19812 | T19811 | arg1Of | Wilcoxon,0.05 |
R16917 | T19812 | T19813 | arg2Of | Wilcoxon,'s |
R16918 | T19815 | T19813 | arg1Of | test,'s |
R16919 | T19815 | T19814 | arg1Of | test,rank |
R16920 | T19815 | T19816 | arg1Of | test,compared |
R16921 | T19815 | T19826 | arg1Of | test,demonstrated |
R16922 | T19817 | T19816 | arg2Of | with,compared |
R16923 | T19820 | T19819 | arg2Of | C,( |
R16924 | T19821 | T19819 | arg3Of | ),( |
R16925 | T19823 | T19817 | arg2Of | analyses,with |
R16926 | T19823 | T19818 | arg1Of | analyses,placebo. |
R16927 | T19823 | T19819 | arg1Of | analyses,( |
R16928 | T19823 | T19822 | arg1Of | analyses,Immunoblotting |
R16929 | T19823 | T19824 | arg1Of | analyses,of |
R16930 | T19825 | T19824 | arg2Of | PBMCs,of |
R16931 | T19826 | T19836 | arg1Of | demonstrated,and |
R16932 | T19829 | T19826 | arg2Of | decrease,demonstrated |
R16933 | T19829 | T19827 | arg1Of | decrease,a |
R16934 | T19829 | T19828 | arg1Of | decrease,time-dependent |
R16935 | T19829 | T19830 | arg1Of | decrease,in |
R16936 | T19832 | T19830 | arg2Of | expression,in |
R16937 | T19832 | T19831 | arg1Of | expression,nuclear |
R16938 | T19832 | T19833 | arg1Of | expression,of |
R16939 | T19834 | T19833 | arg2Of | GATA-3,of |
R16940 | T19836 | T19807 | arg2Of | and,; |
R16941 | T19836 | T19835 | arg1Of | and,"," |
R16942 | T19840 | T19837 | arg2Of | expression,increased |
R16943 | T19840 | T19838 | arg1Of | expression,cytoplasmic |
R16944 | T19840 | T19839 | arg1Of | expression,GATA-3 |
R16945 | T19840 | T19841 | arg1Of | expression,after |
R16946 | T19840 | T19852 | arg1Of | expression,demonstrated |
R16947 | T19840 | T19863 | arg1Of | expression,increased |
R16948 | T19842 | T19841 | arg2Of | inhalation,after |
R16949 | T19842 | T19843 | arg1Of | inhalation,of |
R16950 | T19846 | T19845 | arg2Of | D,( |
R16951 | T19847 | T19845 | arg3Of | ),( |
R16952 | T19849 | T19843 | arg2Of | analyses,of |
R16953 | T19849 | T19844 | arg1Of | analyses,FP. |
R16954 | T19849 | T19845 | arg1Of | analyses,( |
R16955 | T19849 | T19848 | arg1Of | analyses,Immunoblotting |
R16956 | T19849 | T19850 | arg1Of | analyses,of |
R16957 | T19851 | T19850 | arg2Of | PBMCs,of |
R16958 | T19852 | T19862 | arg1Of | demonstrated,and |
R16959 | T19855 | T19852 | arg2Of | decrease,demonstrated |
R16960 | T19855 | T19853 | arg1Of | decrease,a |
R16961 | T19855 | T19854 | arg1Of | decrease,dose-dependent |
R16962 | T19855 | T19856 | arg1Of | decrease,in |
R16963 | T19858 | T19856 | arg2Of | expression,in |
R16964 | T19858 | T19857 | arg1Of | expression,nuclear |
R16965 | T19858 | T19859 | arg1Of | expression,of |
R16966 | T19860 | T19859 | arg2Of | GATA-3,of |
R16967 | T19862 | T19836 | arg2Of | and,and |
R16968 | T19862 | T19861 | arg1Of | and,"," |
R16969 | T19863 | T19862 | arg2Of | increased,and |
R16970 | T19863 | T19869 | arg1Of | increased,after |
R16971 | T19866 | T19863 | arg2Of | expression,increased |
R16972 | T19866 | T19864 | arg1Of | expression,cytoplasmic |
R16973 | T19866 | T19865 | arg1Of | expression,GATA-3 |
R16974 | T19868 | T19867 | arg1Of | h,2 |
R16975 | T19869 | T19868 | arg1Of | after,h |
R16976 | T19870 | T19869 | arg2Of | inhalation,after |
R16977 | T19870 | T19871 | arg1Of | inhalation,of |
R16978 | T19872 | T19871 | arg2Of | FP,of |
R16979 | T19874 | T19873 | arg1Of | H1,Histone |
R16980 | T19874 | T19875 | arg1Of | H1,and |
R16981 | T19875 | T19878 | arg1Of | and,confirmed |
R16982 | T19877 | T19875 | arg2Of | immunoblotting,and |
R16983 | T19877 | T19876 | arg1Of | immunoblotting,MEK-1 |
R16984 | T19881 | T19878 | arg2Of | protein,confirmed |
R16985 | T19881 | T19879 | arg1Of | protein,equivalent |
R16986 | T19881 | T19880 | arg1Of | protein,total |
R16987 | T19881 | T19882 | arg1Of | protein,loading |
R16988 | T19882 | T19883 | arg1Of | loading,for |
R16989 | T19882 | T19889 | arg1Of | loading,respectively |
R16990 | T19885 | T19886 | arg1Of | nuclear,and |
R16991 | T19887 | T19886 | arg2Of | cytoplasmic,and |
R16992 | T19888 | T19883 | arg2Of | fractions,for |
R16993 | T19888 | T19884 | arg1Of | fractions,the |
R16994 | T19888 | T19885 | arg1Of | fractions,nuclear |
R16995 | T19888 | T19887 | arg1Of | fractions,cytoplasmic |
R16996 | T19890 | T19891 | arg1Of | Quantification,of |
R16997 | T19890 | T19903 | arg1Of | Quantification,is |
R16998 | T19890 | T19904 | arg2Of | Quantification,shown |
R16999 | T19894 | T19891 | arg2Of | data,of |
R17000 | T19894 | T19892 | arg1Of | data,the |
R17001 | T19894 | T19893 | arg1Of | data,densitometry |
R17002 | T19894 | T19895 | arg1Of | data,in |
R17003 | T19897 | T19896 | arg2Of | C,( |
R17004 | T19897 | T19899 | arg1Of | C,and |
R17005 | T19898 | T19896 | arg3Of | ),( |
R17006 | T19899 | T19895 | arg2Of | and,in |
R17007 | T19901 | T19899 | arg2Of | D,and |
R17008 | T19901 | T19900 | arg2Of | D,( |
R17009 | T19902 | T19900 | arg3Of | ),( |
R17010 | T19904 | T19903 | arg2Of | shown,is |
R17011 | T19904 | T19905 | arg1Of | shown,as |
R17012 | T19908 | T19905 | arg2Of | plot,as |
R17013 | T19908 | T19906 | arg1Of | plot,a |
R17014 | T19908 | T19907 | arg1Of | plot,box-and-whiskers |
R17015 | T19908 | T19909 | arg1Of | plot,of |
R17016 | T19910 | T19909 | arg2Of | results,of |
R17017 | T19910 | T19911 | arg1Of | results,from |
R17018 | T19910 | T19914 | arg2Of | results,for |
R17019 | T19910 | T19915 | arg1Of | results,which |
R17020 | T19913 | T19911 | arg2Of | participants,from |
R17021 | T19913 | T19912 | arg1Of | participants,n = 6 |
R17022 | T19916 | T19917 | arg1Of | data,were |
R17023 | T19917 | T19914 | arg1Of | were,for |
R17024 | T19919 | T19920 | arg1Of | *p,< |
R17025 | T19921 | T19917 | arg2Of | 0.05,were |
R17026 | T19921 | T19918 | arg1Of | 0.05,available. |
R17027 | T19921 | T19919 | arg1Of | 0.05,*p |
R17028 | T19921 | T19922 | arg2Of | 0.05,compared |
R17029 | T19921 | T19933 | modOf | 0.05,demonstrated |
R17030 | T19921 | T19945 | arg1Of | 0.05,of |
R17031 | T19924 | T19922 | arg3Of | control.,compared |
R17032 | T19924 | T19923 | arg1Of | control.,to |
R17033 | T19924 | T19925 | arg1Of | control.,( |
R17034 | T19926 | T19925 | arg2Of | E,( |
R17035 | T19927 | T19925 | arg3Of | ),( |
R17036 | T19930 | T19928 | arg1Of | analyses,Western |
R17037 | T19930 | T19929 | arg1Of | analyses,blot |
R17038 | T19930 | T19931 | arg1Of | analyses,of |
R17039 | T19930 | T19933 | arg1Of | analyses,demonstrated |
R17040 | T19932 | T19931 | arg2Of | PBMCs,of |
R17041 | T19936 | T19933 | arg2Of | decrease,demonstrated |
R17042 | T19936 | T19934 | arg1Of | decrease,a |
R17043 | T19936 | T19935 | arg1Of | decrease,time-dependent |
R17044 | T19936 | T19937 | arg1Of | decrease,in |
R17045 | T19939 | T19937 | arg2Of | phosphorylation,in |
R17046 | T19939 | T19938 | arg1Of | phosphorylation,dual |
R17047 | T19939 | T19940 | arg1Of | phosphorylation,( |
R17048 | T19941 | T19942 | arg1Of | threonine-180,and |
R17049 | T19942 | T19940 | arg2Of | and,( |
R17050 | T19943 | T19942 | arg2Of | tyrosine-182,and |
R17051 | T19944 | T19940 | arg3Of | ),( |
R17052 | T19947 | T19945 | arg2Of | MAPK,of |
R17053 | T19947 | T19946 | arg1Of | MAPK,p38 |
R17054 | T19947 | T19948 | arg1Of | MAPK,after |
R17055 | T19949 | T19948 | arg2Of | inhalation,after |
R17056 | T19949 | T19950 | arg1Of | inhalation,of |
R17057 | T19951 | T19950 | arg2Of | FP,of |
R17058 | T19951 | T19952 | arg1Of | FP,( |
R17059 | T19954 | T19952 | arg2Of | µg,( |
R17060 | T19954 | T19953 | arg1Of | µg,500 |
R17061 | T19955 | T19952 | arg3Of | ),( |
R17062 | T19957 | T19956 | arg1Of | results,The |
R17063 | T19957 | T19958 | arg2Of | results,shown |
R17064 | T19957 | T19963 | arg1Of | results,are |
R17065 | T19957 | T19964 | arg1Of | results,representative |
R17066 | T19958 | T19959 | arg1Of | shown,in |
R17067 | T19961 | T19959 | arg2Of | E,in |
R17068 | T19961 | T19960 | arg2Of | E,( |
R17069 | T19962 | T19960 | arg3Of | ),( |
R17070 | T19964 | T19963 | arg2Of | representative,are |
R17071 | T19964 | T19965 | arg1Of | representative,of |
R17072 | T19966 | T19965 | arg2Of | samples,of |
R17073 | T19966 | T19967 | arg1Of | samples,from |
R17074 | T19969 | T19967 | arg2Of | participants,from |
R17075 | T19969 | T19968 | arg1Of | participants,two |
R3974 | T4628 | T4629 | modOf | extracted,using |
R3976 | T4631 | T4629 | arg2Of | buffer,using |
R3977 | T4631 | T4630 | arg1Of | buffer,lysis |
R3978 | T4631 | T4632 | arg1Of | buffer,( |
R6569 | T7646 | T7650 | arg1Of | values,were |
R6570 | T7646 | T7651 | arg2Of | values,subtracted |
R6571 | T7646 | T7653 | arg1Of | values,normalize |
R6573 | T7649 | T7648 | arg1Of | lane,each |
R6574 | T7651 | T7650 | arg2Of | subtracted,were |
R6575 | T7653 | T7651 | arg3Of | normalize,subtracted |
R6576 | T7653 | T7652 | arg1Of | normalize,to |
R6577 | T7655 | T7653 | arg2Of | measurement,normalize |
R6578 | T7655 | T7654 | arg1Of | measurement,each |
R6579 | T7657 | T7656 | arg1Of | bands,The |
R6580 | T7657 | T7658 | arg1Of | bands,were |
R6581 | T7657 | T7659 | arg2Of | bands,quantified |
R6582 | T7659 | T7658 | arg2Of | quantified,were |
R6583 | T7660 | T7659 | arg3Of | using,quantified |
R6584 | T7663 | T7660 | arg2Of | software,using |
R6585 | T7663 | T7661 | arg1Of | software,the |
R6586 | T7663 | T7662 | arg1Of | software,Gelworks |
R6587 | T7666 | T7664 | arg1Of | blots,All |
R6588 | T7666 | T7665 | arg1Of | blots,Western |
R6589 | T7666 | T7667 | arg1Of | blots,were |
R6590 | T7666 | T7668 | arg2Of | blots,exposed |
R6591 | T7668 | T7667 | arg2Of | exposed,were |
R6592 | T7668 | T7669 | modOf | exposed,to |
R6593 | T7668 | T7677 | arg1Of | exposed,and |
R6594 | T7670 | T7669 | arg1Of | film,to |
R6595 | T7670 | T7671 | arg1Of | film,for |
R6596 | T7673 | T7671 | arg2Of | lengths,for |
R6597 | T7673 | T7672 | arg1Of | lengths,varying |
R6598 | T7673 | T7674 | arg1Of | lengths,of |
R6599 | T7675 | T7674 | arg2Of | time,of |
R6600 | T7677 | T7676 | arg1Of | and,"," |
R6601 | T7679 | T7678 | arg1Of | films,only |
R6602 | T7679 | T7680 | arg1Of | films,generating |
R6603 | T7679 | T7685 | arg1Of | films,were |
bionlp-st-ge-2016-coref
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T14221 | 40550-40554 | Anaphor | denotes | that |
T14222 | 40524-40539 | Antecedent | denotes | phosphorylation |
T14223 | 41035-41046 | Anaphor | denotes | these genes |
T14224 | 40939-40943 | Antecedent | denotes | IL-4 |
T14225 | 40944-40948 | Antecedent | denotes | IL-5 |
T426 | 527-540 | Anaphor | denotes | the cytokines |
T427 | 541-559 | Antecedent | denotes | interleukin (IL)-4 |
T428 | 561-565 | Antecedent | denotes | IL-5 |
T429 | 571-576 | Antecedent | denotes | IL-13 |
T2213 | 7643-7648 | Anaphor | denotes | which |
T2214 | 7635-7641 | Antecedent | denotes | GATA-3 |
T2215 | 8499-8501 | Anaphor | denotes | it |
T2216 | 8463-8469 | Antecedent | denotes | GATA-3 |
T2217 | 8565-8568 | Anaphor | denotes | its |
T2218 | 9346-9349 | Anaphor | denotes | its |
T2219 | 9328-9334 | Antecedent | denotes | GATA-3 |
T2220 | 9695-9700 | Anaphor | denotes | which |
T2221 | 9663-9687 | Antecedent | denotes | glucocorticoid receptors |
T2222 | 9739-9743 | Anaphor | denotes | they |
T2223 | 9695-9700 | Antecedent | denotes | which |
R12318 | T14221 | T14222 | boundBy | that,phosphorylation |
R12319 | T14223 | T14224 | boundBy | these genes,IL-4 |
R12320 | T14223 | T14225 | boundBy | these genes,IL-5 |
R768 | T426 | T427 | boundBy | the cytokines,interleukin (IL)-4 |
R777 | T426 | T428 | boundBy | the cytokines,IL-5 |
R778 | T426 | T429 | boundBy | the cytokines,IL-13 |
R1958 | T2213 | T2214 | boundBy | which,GATA-3 |
R1960 | T2215 | T2216 | boundBy | it,GATA-3 |
R1961 | T2217 | T2216 | boundBy | its,GATA-3 |
R1963 | T2218 | T2219 | boundBy | its,GATA-3 |
R1965 | T2220 | T2221 | boundBy | which,glucocorticoid receptors |
R1966 | T2222 | T2220 | boundBy | they,which |
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T477 | 495-497 | IN | denotes | in |
T478 | 498-508 | VBG | denotes | regulating |
T479 | 509-512 | DT | denotes | the |
T480 | 513-523 | NN | denotes | expression |
T481 | 524-526 | IN | denotes | of |
T482 | 527-530 | DT | denotes | the |
T483 | 531-540 | NNS | denotes | cytokines |
T484 | 541-552 | VBP | denotes | interleukin |
T485 | 553-554 | -LRB- | denotes | ( |
T486 | 554-556 | NNP | denotes | IL |
T487 | 556-557 | -RRB- | denotes | ) |
T488 | 557-559 | CD | denotes | -4 |
T489 | 559-560 | , | denotes | , |
T490 | 561-565 | NN | denotes | IL-5 |
T491 | 565-566 | , | denotes | , |
T492 | 567-570 | CC | denotes | and |
T493 | 571-576 | NN | denotes | IL-13 |
T494 | 577-581 | IN | denotes | from |
T495 | 582-583 | NNP | denotes | T |
T496 | 584-592 | JJ | denotes | helper-2 |
T497 | 593-594 | -LRB- | denotes | ( |
T498 | 594-597 | JJ | denotes | Th2 |
T499 | 597-598 | -RRB- | denotes | ) |
T500 | 599-604 | NNS | denotes | cells |
T501 | 605-608 | CC | denotes | and |
T502 | 609-618 | RB | denotes | therefore |
T503 | 619-621 | VBZ | denotes | is |
T504 | 622-623 | DT | denotes | a |
T505 | 624-627 | JJ | denotes | key |
T506 | 628-636 | NN | denotes | mediator |
T507 | 637-639 | IN | denotes | of |
T508 | 640-648 | JJ | denotes | allergic |
T509 | 649-657 | NNS | denotes | diseases |
T510 | 657-658 | . | denotes | . |
T511 | 659-674 | NNS | denotes | Corticosteroids |
T512 | 675-678 | VBP | denotes | are |
T513 | 679-685 | RB | denotes | highly |
T514 | 686-695 | JJ | denotes | effective |
T515 | 696-698 | IN | denotes | in |
T516 | 699-710 | VBG | denotes | suppressing |
T517 | 711-719 | JJ | denotes | allergic |
T518 | 720-732 | NN | denotes | inflammation |
T519 | 732-733 | , | denotes | , |
T520 | 734-737 | CC | denotes | but |
T521 | 738-743 | PRP$ | denotes | their |
T522 | 744-751 | NNS | denotes | effects |
T523 | 752-754 | IN | denotes | on |
T524 | 755-761 | NN | denotes | GATA-3 |
T525 | 762-765 | VBP | denotes | are |
T526 | 766-773 | JJ | denotes | unknown |
T527 | 773-774 | . | denotes | . |
T528 | 775-777 | PRP | denotes | We |
T529 | 778-790 | VBD | denotes | investigated |
T530 | 791-794 | DT | denotes | the |
T531 | 795-801 | NN | denotes | effect |
T532 | 802-804 | IN | denotes | of |
T533 | 805-808 | DT | denotes | the |
T534 | 809-823 | JJ | denotes | corticosteroid |
T535 | 824-835 | NN | denotes | fluticasone |
T536 | 836-846 | NN | denotes | propionate |
T537 | 847-849 | IN | denotes | on |
T538 | 850-856 | JJ | denotes | GATA-3 |
T539 | 857-867 | NN | denotes | regulation |
T540 | 868-870 | IN | denotes | in |
T541 | 871-876 | JJ | denotes | human |
T542 | 877-890 | NNS | denotes | T-lymphocytes |
T543 | 891-893 | IN | denotes | in |
T544 | 894-899 | NN | denotes | vitro |
T545 | 900-903 | CC | denotes | and |
T546 | 904-906 | IN | denotes | in |
T547 | 907-911 | NN | denotes | vivo |
T548 | 911-912 | . | denotes | . |
T549 | 914-921 | NNS | denotes | Methods |
T550 | 922-925 | CC | denotes | and |
T551 | 926-934 | NNS | denotes | Findings |
T552 | 935-937 | IN | denotes | In |
T553 | 938-939 | DT | denotes | a |
T554 | 940-941 | NNP | denotes | T |
T555 | 942-952 | NN | denotes | lymphocyte |
T556 | 953-957 | NN | denotes | cell |
T557 | 958-962 | NN | denotes | line |
T558 | 963-964 | -LRB- | denotes | ( |
T559 | 964-970 | JJ | denotes | HuT-78 |
T560 | 970-971 | -RRB- | denotes | ) |
T561 | 972-975 | CC | denotes | and |
T562 | 976-986 | JJ | denotes | peripheral |
T563 | 987-992 | NN | denotes | blood |
T564 | 993-1004 | NN | denotes | mononuclear |
T565 | 1005-1010 | NNS | denotes | cells |
T566 | 1011-1021 | VBN | denotes | stimulated |
T567 | 1022-1024 | IN | denotes | by |
T568 | 1025-1033 | JJ | denotes | anti-CD3 |
T569 | 1034-1037 | CC | denotes | and |
T570 | 1038-1047 | JJ | denotes | anti-CD28 |
T571 | 1048-1050 | IN | denotes | in |
T572 | 1051-1056 | NN | denotes | vitro |
T573 | 1057-1059 | PRP | denotes | we |
T574 | 1060-1072 | VBD | denotes | demonstrated |
T575 | 1073-1077 | IN | denotes | that |
T576 | 1078-1089 | NN | denotes | fluticasone |
T577 | 1090-1098 | NNS | denotes | inhibits |
T578 | 1099-1106 | JJ | denotes | nuclear |
T579 | 1107-1120 | NN | denotes | translocation |
T580 | 1121-1123 | IN | denotes | of |
T581 | 1124-1130 | NNP | denotes | GATA-3 |
T582 | 1131-1134 | CC | denotes | and |
T583 | 1135-1145 | NN | denotes | expression |
T584 | 1146-1148 | IN | denotes | of |
T585 | 1149-1152 | JJ | denotes | Th2 |
T586 | 1153-1162 | NNS | denotes | cytokines |
T587 | 1163-1166 | IN | denotes | via |
T588 | 1167-1168 | DT | denotes | a |
T589 | 1169-1178 | NN | denotes | mechanism |
T590 | 1179-1190 | JJ | denotes | independent |
T591 | 1191-1193 | IN | denotes | of |
T592 | 1194-1201 | JJ | denotes | nuclear |
T593 | 1202-1211 | NN | denotes | factor-κB |
T594 | 1212-1215 | CC | denotes | and |
T595 | 1216-1218 | VBZ | denotes | is |
T596 | 1219-1222 | JJ | denotes | due |
T597 | 1222-1223 | , | denotes | , |
T598 | 1224-1226 | IN | denotes | in |
T599 | 1227-1231 | NN | denotes | part |
T600 | 1231-1232 | , | denotes | , |
T601 | 1233-1235 | TO | denotes | to |
T602 | 1236-1247 | NN | denotes | competition |
T603 | 1248-1255 | IN | denotes | between |
T604 | 1256-1262 | NNP | denotes | GATA-3 |
T605 | 1263-1266 | CC | denotes | and |
T606 | 1267-1270 | DT | denotes | the |
T607 | 1271-1287 | JJ | denotes | ligand-activated |
T608 | 1288-1302 | NN | denotes | glucocorticoid |
T609 | 1303-1311 | NN | denotes | receptor |
T610 | 1312-1315 | IN | denotes | for |
T611 | 1316-1323 | JJ | denotes | nuclear |
T612 | 1324-1333 | NN | denotes | transport |
T613 | 1334-1341 | IN | denotes | through |
T614 | 1342-1345 | DT | denotes | the |
T615 | 1346-1353 | JJ | denotes | nuclear |
T616 | 1354-1362 | NN | denotes | importer |
T617 | 1363-1373 | NN | denotes | importin-α |
T618 | 1373-1374 | . | denotes | . |
T619 | 1375-1377 | IN | denotes | In |
T620 | 1378-1386 | NN | denotes | addition |
T621 | 1386-1387 | , | denotes | , |
T622 | 1388-1399 | NN | denotes | fluticasone |
T623 | 1400-1407 | VBZ | denotes | induces |
T624 | 1408-1411 | DT | denotes | the |
T625 | 1412-1422 | NN | denotes | expression |
T626 | 1423-1425 | IN | denotes | of |
T627 | 1426-1443 | JJ | denotes | mitogen-activated |
T628 | 1444-1451 | NN | denotes | protein |
T629 | 1452-1458 | NN | denotes | kinase |
T630 | 1459-1460 | -LRB- | denotes | ( |
T631 | 1460-1464 | NNP | denotes | MAPK |
T632 | 1464-1465 | -RRB- | denotes | ) |
T633 | 1466-1479 | JJ | denotes | phosphatase-1 |
T634 | 1480-1481 | -LRB- | denotes | ( |
T635 | 1481-1486 | NNP | denotes | MKP-1 |
T636 | 1486-1487 | -RRB- | denotes | ) |
T637 | 1487-1488 | , | denotes | , |
T638 | 1489-1492 | DT | denotes | the |
T639 | 1493-1503 | JJ | denotes | endogenous |
T640 | 1504-1513 | NN | denotes | inhibitor |
T641 | 1514-1516 | IN | denotes | of |
T642 | 1517-1520 | CD | denotes | p38 |
T643 | 1521-1525 | NNP | denotes | MAPK |
T644 | 1525-1526 | , | denotes | , |
T645 | 1527-1532 | WDT | denotes | which |
T646 | 1533-1535 | VBZ | denotes | is |
T647 | 1536-1545 | JJ | denotes | necessary |
T648 | 1546-1549 | IN | denotes | for |
T649 | 1550-1556 | JJ | denotes | GATA-3 |
T650 | 1557-1564 | JJ | denotes | nuclear |
T651 | 1565-1578 | NN | denotes | translocation |
T652 | 1578-1579 | . | denotes | . |
T653 | 1580-1585 | DT | denotes | These |
T654 | 1586-1596 | JJ | denotes | inhibitory |
T655 | 1597-1604 | NNS | denotes | effects |
T656 | 1605-1607 | IN | denotes | of |
T657 | 1608-1619 | NN | denotes | fluticasone |
T658 | 1620-1623 | VBP | denotes | are |
T659 | 1624-1629 | JJ | denotes | rapid |
T660 | 1629-1630 | , | denotes | , |
T661 | 1631-1637 | JJ | denotes | potent |
T662 | 1637-1638 | , | denotes | , |
T663 | 1639-1642 | CC | denotes | and |
T664 | 1643-1652 | VBN | denotes | prolonged |
T665 | 1652-1653 | . | denotes | . |
T666 | 1654-1656 | PRP | denotes | We |
T667 | 1657-1661 | RB | denotes | also |
T668 | 1662-1674 | VBD | denotes | demonstrated |
T669 | 1675-1679 | IN | denotes | that |
T670 | 1680-1687 | JJ | denotes | inhaled |
T671 | 1688-1699 | NN | denotes | fluticasone |
T672 | 1700-1708 | VBZ | denotes | inhibits |
T673 | 1709-1715 | JJ | denotes | GATA-3 |
T674 | 1716-1723 | JJ | denotes | nuclear |
T675 | 1724-1737 | NN | denotes | translocation |
T676 | 1738-1740 | IN | denotes | in |
T677 | 1741-1751 | JJ | denotes | peripheral |
T678 | 1752-1757 | NN | denotes | blood |
T679 | 1758-1769 | NNS | denotes | lymphocytes |
T680 | 1770-1772 | IN | denotes | of |
T681 | 1773-1781 | NNS | denotes | patients |
T682 | 1782-1786 | IN | denotes | with |
T683 | 1787-1793 | NN | denotes | asthma |
T684 | 1794-1796 | IN | denotes | in |
T685 | 1797-1801 | NN | denotes | vivo |
T686 | 1801-1802 | . | denotes | . |
T687 | 1804-1815 | NNS | denotes | Conclusions |
T688 | 1816-1831 | NNS | denotes | Corticosteroids |
T689 | 1832-1836 | VBP | denotes | have |
T690 | 1837-1838 | DT | denotes | a |
T691 | 1839-1845 | JJ | denotes | potent |
T692 | 1846-1856 | JJ | denotes | inhibitory |
T693 | 1857-1863 | NN | denotes | effect |
T694 | 1864-1866 | IN | denotes | on |
T695 | 1867-1873 | JJ | denotes | GATA-3 |
T696 | 1874-1877 | IN | denotes | via |
T697 | 1878-1881 | CD | denotes | two |
T698 | 1882-1893 | VBG | denotes | interacting |
T699 | 1894-1904 | NNS | denotes | mechanisms |
T700 | 1905-1909 | WDT | denotes | that |
T701 | 1910-1918 | RB | denotes | potently |
T702 | 1919-1927 | VBP | denotes | suppress |
T703 | 1928-1931 | JJ | denotes | Th2 |
T704 | 1932-1940 | NN | denotes | cytokine |
T705 | 1941-1951 | NN | denotes | expression |
T706 | 1951-1952 | . | denotes | . |
T707 | 1953-1957 | DT | denotes | This |
T708 | 1958-1963 | NN | denotes | novel |
T709 | 1964-1973 | NN | denotes | mechanism |
T710 | 1974-1976 | IN | denotes | of |
T711 | 1977-1983 | NN | denotes | action |
T712 | 1984-1986 | IN | denotes | of |
T713 | 1987-2002 | NNS | denotes | corticosteroids |
T714 | 2003-2006 | MD | denotes | may |
T715 | 2007-2014 | VB | denotes | account |
T716 | 2015-2018 | IN | denotes | for |
T717 | 2019-2022 | DT | denotes | the |
T718 | 2023-2031 | JJ | denotes | striking |
T719 | 2032-2040 | JJ | denotes | clinical |
T720 | 2041-2049 | NN | denotes | efficacy |
T721 | 2050-2052 | IN | denotes | of |
T722 | 2053-2068 | NNS | denotes | corticosteroids |
T723 | 2069-2071 | IN | denotes | in |
T724 | 2072-2075 | DT | denotes | the |
T725 | 2076-2085 | NN | denotes | treatment |
T726 | 2086-2088 | IN | denotes | of |
T727 | 2089-2097 | JJ | denotes | allergic |
T728 | 2098-2106 | NNS | denotes | diseases |
T729 | 2106-2107 | . | denotes | . |
T730 | 2109-2115 | VB | denotes | Please |
T731 | 2116-2119 | VB | denotes | see |
T732 | 2120-2125 | RB | denotes | later |
T733 | 2126-2128 | IN | denotes | in |
T734 | 2129-2132 | DT | denotes | the |
T735 | 2133-2140 | NN | denotes | article |
T736 | 2141-2144 | IN | denotes | for |
T737 | 2145-2152 | NNS | denotes | Editors |
T738 | 2152-2153 | POS | denotes | ' |
T739 | 2154-2161 | NN | denotes | Summary |
T2279 | 7246-7258 | NNP | denotes | Inflammation |
T2280 | 7259-7261 | IN | denotes | in |
T2281 | 7262-7270 | JJ | denotes | allergic |
T2282 | 7271-7279 | NNS | denotes | diseases |
T2283 | 7280-7284 | JJ | denotes | such |
T2284 | 7285-7287 | IN | denotes | as |
T2285 | 7288-7294 | NN | denotes | asthma |
T2286 | 7294-7295 | , | denotes | , |
T2287 | 7296-7304 | NN | denotes | rhinitis |
T2288 | 7304-7305 | , | denotes | , |
T2289 | 7306-7309 | CC | denotes | and |
T2290 | 7310-7316 | JJ | denotes | atopic |
T2291 | 7317-7327 | NN | denotes | dermatitis |
T2292 | 7328-7330 | VBZ | denotes | is |
T2293 | 7331-7339 | VBN | denotes | mediated |
T2294 | 7340-7343 | IN | denotes | via |
T2295 | 7344-7354 | NN | denotes | expression |
T2296 | 7355-7357 | IN | denotes | of |
T2297 | 7358-7361 | DT | denotes | the |
T2298 | 7362-7371 | NNS | denotes | cytokines |
T2299 | 7372-7383 | VBP | denotes | interleukin |
T2300 | 7384-7385 | -LRB- | denotes | ( |
T2301 | 7385-7387 | NNP | denotes | IL |
T2302 | 7387-7388 | -RRB- | denotes | ) |
T2303 | 7388-7390 | CD | denotes | -4 |
T2304 | 7390-7391 | , | denotes | , |
T2305 | 7392-7396 | NN | denotes | IL-5 |
T2306 | 7396-7397 | , | denotes | , |
T2307 | 7398-7401 | CC | denotes | and |
T2308 | 7402-7407 | NN | denotes | IL-13 |
T2309 | 7408-7412 | IN | denotes | from |
T2310 | 7413-7414 | NNP | denotes | T |
T2311 | 7415-7423 | JJ | denotes | helper-2 |
T2312 | 7424-7425 | -LRB- | denotes | ( |
T2313 | 7425-7428 | JJ | denotes | Th2 |
T2314 | 7428-7429 | -RRB- | denotes | ) |
T2315 | 7430-7435 | NNS | denotes | cells |
T2316 | 7435-7436 | . | denotes | . |
T2317 | 7437-7441 | NN | denotes | IL-4 |
T2318 | 7442-7445 | CC | denotes | and |
T2319 | 7446-7451 | JJ | denotes | IL-13 |
T2320 | 7452-7460 | VB | denotes | regulate |
T2321 | 7461-7464 | DT | denotes | the |
T2322 | 7465-7475 | NN | denotes | expression |
T2323 | 7476-7478 | IN | denotes | of |
T2324 | 7479-7482 | NNP | denotes | IgE |
T2325 | 7483-7487 | IN | denotes | from |
T2326 | 7488-7489 | NNP | denotes | B |
T2327 | 7490-7501 | NNS | denotes | lymphocytes |
T2328 | 7501-7502 | , | denotes | , |
T2329 | 7503-7510 | IN | denotes | whereas |
T2330 | 7511-7515 | NNP | denotes | IL-5 |
T2331 | 7516-7521 | VBZ | denotes | plays |
T2332 | 7522-7523 | DT | denotes | a |
T2333 | 7524-7527 | JJ | denotes | key |
T2334 | 7528-7532 | NN | denotes | role |
T2335 | 7533-7535 | IN | denotes | in |
T2336 | 7536-7548 | JJ | denotes | eosinophilic |
T2337 | 7549-7561 | NN | denotes | inflammation |
T2338 | 7562-7563 | NNP | denotes | [ |
T2339 | 7563-7564 | CD | denotes | 1 |
T2340 | 7564-7565 | NNP | denotes | ] |
T2341 | 7565-7566 | . | denotes | . |
T2342 | 7567-7570 | CD | denotes | Th2 |
T2343 | 7571-7580 | NNS | denotes | cytokines |
T2344 | 7581-7584 | VBP | denotes | are |
T2345 | 7585-7594 | VBN | denotes | regulated |
T2346 | 7595-7597 | IN | denotes | by |
T2347 | 7598-7601 | DT | denotes | the |
T2348 | 7602-7606 | NN | denotes | zinc |
T2349 | 7607-7613 | NN | denotes | finger |
T2350 | 7614-7627 | NN | denotes | transcription |
T2351 | 7628-7634 | NN | denotes | factor |
T2352 | 7635-7641 | NNP | denotes | GATA-3 |
T2353 | 7641-7642 | , | denotes | , |
T2354 | 7643-7648 | WDT | denotes | which |
T2355 | 7649-7651 | VBZ | denotes | is |
T2356 | 7652-7665 | RB | denotes | predominantly |
T2357 | 7666-7675 | VBN | denotes | expressed |
T2358 | 7676-7678 | IN | denotes | in |
T2359 | 7679-7682 | JJ | denotes | Th2 |
T2360 | 7683-7688 | NNS | denotes | cells |
T2361 | 7689-7690 | VBP | denotes | [ |
T2362 | 7690-7691 | CD | denotes | 2 |
T2363 | 7691-7692 | NNP | denotes | ] |
T2364 | 7692-7693 | , | denotes | , |
T2365 | 7693-7694 | NNP | denotes | [ |
T2366 | 7694-7695 | CD | denotes | 3 |
T2367 | 7695-7696 | NNP | denotes | ] |
T2368 | 7696-7697 | . | denotes | . |
T2369 | 7698-7704 | JJ | denotes | GATA-3 |
T2370 | 7705-7715 | VBZ | denotes | determines |
T2371 | 7716-7719 | NNP | denotes | Th2 |
T2372 | 7720-7724 | NN | denotes | cell |
T2373 | 7725-7740 | NN | denotes | differentiation |
T2374 | 7741-7744 | CC | denotes | and |
T2375 | 7745-7756 | RB | denotes | selectively |
T2376 | 7757-7766 | VBZ | denotes | activates |
T2377 | 7767-7770 | DT | denotes | the |
T2378 | 7771-7780 | NNS | denotes | promoters |
T2379 | 7781-7783 | IN | denotes | of |
T2380 | 7784-7788 | NN | denotes | IL-4 |
T2381 | 7788-7789 | , | denotes | , |
T2382 | 7790-7794 | NN | denotes | IL-5 |
T2383 | 7794-7795 | , | denotes | , |
T2384 | 7796-7799 | CC | denotes | and |
T2385 | 7800-7805 | NN | denotes | IL-13 |
T2386 | 7806-7813 | IN | denotes | through |
T2387 | 7814-7823 | NN | denotes | chromatin |
T2388 | 7824-7835 | VBG | denotes | remodelling |
T2389 | 7836-7837 | NNP | denotes | [ |
T2390 | 7837-7838 | CD | denotes | 4 |
T2391 | 7838-7839 | NNP | denotes | ] |
T2392 | 7840-7841 | NN | denotes | [ |
T2393 | 7841-7842 | CD | denotes | 7 |
T2394 | 7842-7843 | NNP | denotes | ] |
T2395 | 7843-7844 | . | denotes | . |
T2396 | 7845-7848 | DT | denotes | The |
T2397 | 7849-7852 | JJ | denotes | key |
T2398 | 7853-7857 | NN | denotes | role |
T2399 | 7858-7860 | IN | denotes | of |
T2400 | 7861-7867 | NN | denotes | GATA-3 |
T2401 | 7868-7870 | IN | denotes | in |
T2402 | 7871-7879 | JJ | denotes | allergic |
T2403 | 7880-7886 | NN | denotes | airway |
T2404 | 7887-7899 | NN | denotes | inflammation |
T2405 | 7900-7903 | VBZ | denotes | has |
T2406 | 7904-7908 | VBN | denotes | been |
T2407 | 7909-7921 | VBN | denotes | demonstrated |
T2408 | 7922-7924 | IN | denotes | in |
T2409 | 7925-7929 | NNS | denotes | mice |
T2410 | 7930-7932 | IN | denotes | by |
T2411 | 7933-7936 | DT | denotes | the |
T2412 | 7937-7944 | VBN | denotes | reduced |
T2413 | 7945-7952 | NN | denotes | release |
T2414 | 7953-7955 | IN | denotes | of |
T2415 | 7956-7959 | JJ | denotes | Th2 |
T2416 | 7960-7969 | NNS | denotes | cytokines |
T2417 | 7970-7972 | IN | denotes | in |
T2418 | 7973-7980 | NNS | denotes | animals |
T2419 | 7981-7988 | VBN | denotes | treated |
T2420 | 7989-7993 | IN | denotes | with |
T2421 | 7994-8011 | JJ | denotes | dominant-negative |
T2422 | 8012-8019 | NNS | denotes | mutants |
T2423 | 8020-8022 | IN | denotes | of |
T2424 | 8023-8029 | NN | denotes | GATA-3 |
T2425 | 8030-8033 | CC | denotes | and |
T2426 | 8034-8036 | IN | denotes | by |
T2427 | 8037-8042 | JJ | denotes | local |
T2428 | 8043-8054 | NN | denotes | application |
T2429 | 8055-8057 | IN | denotes | of |
T2430 | 8058-8067 | JJ | denotes | antisense |
T2431 | 8068-8084 | NNS | denotes | oligonucleotides |
T2432 | 8085-8087 | TO | denotes | to |
T2433 | 8088-8094 | NNP | denotes | GATA-3 |
T2434 | 8095-8096 | NNP | denotes | [ |
T2435 | 8096-8097 | CD | denotes | 8 |
T2436 | 8097-8098 | NNP | denotes | ] |
T2437 | 8098-8099 | , | denotes | , |
T2438 | 8099-8100 | NNP | denotes | [ |
T2439 | 8100-8101 | CD | denotes | 9 |
T2440 | 8101-8102 | NNP | denotes | ] |
T2441 | 8102-8103 | . | denotes | . |
T2442 | 8104-8115 | RB | denotes | Furthermore |
T2443 | 8115-8116 | , | denotes | , |
T2444 | 8117-8128 | JJ | denotes | conditional |
T2445 | 8129-8138 | NN | denotes | knock-out |
T2446 | 8139-8141 | IN | denotes | of |
T2447 | 8142-8145 | DT | denotes | the |
T2448 | 8146-8151 | NNP | denotes | Gata3 |
T2449 | 8152-8156 | NN | denotes | gene |
T2450 | 8157-8159 | IN | denotes | in |
T2451 | 8160-8164 | NNS | denotes | mice |
T2452 | 8165-8172 | VBZ | denotes | reduces |
T2453 | 8173-8183 | NN | denotes | expression |
T2454 | 8184-8186 | IN | denotes | of |
T2455 | 8187-8190 | JJ | denotes | Th2 |
T2456 | 8191-8200 | NNS | denotes | cytokines |
T2457 | 8201-8203 | IN | denotes | in |
T2458 | 8204-8209 | NN | denotes | vitro |
T2459 | 8210-8213 | CC | denotes | and |
T2460 | 8214-8216 | IN | denotes | in |
T2461 | 8217-8221 | NN | denotes | vivo |
T2462 | 8222-8223 | NNP | denotes | [ |
T2463 | 8223-8225 | CD | denotes | 10 |
T2464 | 8225-8226 | NNP | denotes | ] |
T2465 | 8226-8227 | , | denotes | , |
T2466 | 8228-8231 | CC | denotes | and |
T2467 | 8232-8239 | JJ | denotes | similar |
T2468 | 8240-8247 | NNS | denotes | results |
T2469 | 8248-8252 | VBP | denotes | have |
T2470 | 8253-8257 | VBN | denotes | been |
T2471 | 8258-8266 | VBN | denotes | reported |
T2472 | 8267-8269 | IN | denotes | in |
T2473 | 8270-8278 | JJ | denotes | isolated |
T2474 | 8279-8285 | NN | denotes | murine |
T2475 | 8286-8289 | NNP | denotes | CD4 |
T2476 | 8289-8290 | NNP | denotes | + |
T2477 | 8291-8302 | VBZ | denotes | lymphocytes |
T2478 | 8303-8304 | NNP | denotes | [ |
T2479 | 8304-8306 | CD | denotes | 11 |
T2480 | 8306-8307 | NNP | denotes | ] |
T2481 | 8307-8308 | . | denotes | . |
T2482 | 8309-8316 | RB | denotes | Finally |
T2483 | 8316-8317 | , | denotes | , |
T2484 | 8318-8327 | NN | denotes | knockdown |
T2485 | 8328-8330 | IN | denotes | of |
T2486 | 8331-8337 | JJ | denotes | GATA-3 |
T2487 | 8338-8348 | NN | denotes | expression |
T2488 | 8349-8354 | VBG | denotes | using |
T2489 | 8355-8360 | NNP | denotes | siRNA |
T2490 | 8361-8363 | IN | denotes | in |
T2491 | 8364-8369 | JJ | denotes | human |
T2492 | 8370-8371 | NNP | denotes | T |
T2493 | 8372-8377 | NNS | denotes | cells |
T2494 | 8378-8385 | NNS | denotes | results |
T2495 | 8386-8388 | IN | denotes | in |
T2496 | 8389-8393 | NN | denotes | loss |
T2497 | 8394-8396 | IN | denotes | of |
T2498 | 8397-8405 | JJ | denotes | anti-CD3 |
T2499 | 8405-8406 | NN | denotes | / |
T2500 | 8406-8419 | JJ | denotes | CD28-mediated |
T2501 | 8420-8423 | JJ | denotes | Th2 |
T2502 | 8424-8432 | NN | denotes | cytokine |
T2503 | 8433-8443 | NN | denotes | expression |
T2504 | 8444-8445 | NNP | denotes | [ |
T2505 | 8445-8447 | CD | denotes | 12 |
T2506 | 8447-8448 | NNP | denotes | ] |
T2507 | 8448-8449 | . | denotes | . |
T2508 | 8450-8452 | IN | denotes | In |
T2509 | 8453-8458 | NN | denotes | order |
T2510 | 8459-8462 | IN | denotes | for |
T2511 | 8463-8469 | NN | denotes | GATA-3 |
T2512 | 8470-8472 | TO | denotes | to |
T2513 | 8473-8481 | VB | denotes | regulate |
T2514 | 8482-8486 | NN | denotes | gene |
T2515 | 8487-8497 | NN | denotes | expression |
T2516 | 8497-8498 | , | denotes | , |
T2517 | 8499-8501 | PRP | denotes | it |
T2518 | 8502-8506 | MD | denotes | must |
T2519 | 8507-8518 | VB | denotes | translocate |
T2520 | 8519-8523 | IN | denotes | from |
T2521 | 8524-8527 | DT | denotes | the |
T2522 | 8528-8537 | NN | denotes | cytoplasm |
T2523 | 8538-8542 | IN | denotes | into |
T2524 | 8543-8546 | DT | denotes | the |
T2525 | 8547-8554 | NN | denotes | nucleus |
T2526 | 8555-8557 | TO | denotes | to |
T2527 | 8558-8564 | VB | denotes | access |
T2528 | 8565-8568 | PRP$ | denotes | its |
T2529 | 8569-8575 | NN | denotes | target |
T2530 | 8576-8581 | NNS | denotes | genes |
T2531 | 8581-8582 | . | denotes | . |
T2532 | 8583-8591 | JJ | denotes | Enhanced |
T2533 | 8592-8599 | JJ | denotes | nuclear |
T2534 | 8600-8610 | NN | denotes | expression |
T2535 | 8611-8613 | IN | denotes | of |
T2536 | 8614-8620 | NN | denotes | GATA-3 |
T2537 | 8621-8630 | VBG | denotes | following |
T2538 | 8631-8632 | NNP | denotes | T |
T2539 | 8633-8637 | NN | denotes | cell |
T2540 | 8638-8646 | NN | denotes | receptor |
T2541 | 8647-8657 | NN | denotes | activation |
T2542 | 8658-8661 | VBD | denotes | was |
T2543 | 8662-8667 | JJ | denotes | first |
T2544 | 8668-8680 | VBN | denotes | demonstrated |
T2545 | 8681-8683 | IN | denotes | in |
T2546 | 8684-8690 | NN | denotes | murine |
T2547 | 8691-8692 | NNP | denotes | T |
T2548 | 8693-8698 | NNS | denotes | cells |
T2549 | 8699-8700 | NNP | denotes | [ |
T2550 | 8700-8702 | CD | denotes | 13 |
T2551 | 8702-8703 | NNP | denotes | ] |
T2552 | 8704-8707 | CC | denotes | and |
T2553 | 8708-8711 | VBD | denotes | was |
T2554 | 8712-8720 | RB | denotes | recently |
T2555 | 8721-8730 | VBN | denotes | confirmed |
T2556 | 8731-8733 | IN | denotes | in |
T2557 | 8734-8739 | JJ | denotes | human |
T2558 | 8740-8741 | NNP | denotes | T |
T2559 | 8742-8747 | NNS | denotes | cells |
T2560 | 8748-8757 | VBG | denotes | following |
T2561 | 8758-8759 | NNP | denotes | T |
T2562 | 8760-8764 | NN | denotes | cell |
T2563 | 8765-8773 | NN | denotes | receptor |
T2564 | 8774-8777 | CC | denotes | and |
T2565 | 8778-8789 | NN | denotes | co-receptor |
T2566 | 8790-8801 | NN | denotes | stimulation |
T2567 | 8802-8803 | NNP | denotes | [ |
T2568 | 8803-8805 | CD | denotes | 12 |
T2569 | 8805-8806 | NNP | denotes | ] |
T2570 | 8806-8807 | . | denotes | . |
T2571 | 8808-8814 | JJ | denotes | GATA-3 |
T2572 | 8815-8823 | VBZ | denotes | contains |
T2573 | 8824-8825 | DT | denotes | a |
T2574 | 8826-8835 | JJ | denotes | classical |
T2575 | 8836-8843 | JJ | denotes | nuclear |
T2576 | 8844-8850 | NN | denotes | import |
T2577 | 8851-8857 | NN | denotes | signal |
T2578 | 8858-8859 | NNP | denotes | [ |
T2579 | 8859-8861 | CD | denotes | 14 |
T2580 | 8861-8862 | NNP | denotes | ] |
T2581 | 8863-8866 | CC | denotes | and |
T2582 | 8867-8869 | VBZ | denotes | is |
T2583 | 8870-8881 | VBN | denotes | transported |
T2584 | 8882-8886 | IN | denotes | into |
T2585 | 8887-8890 | DT | denotes | the |
T2586 | 8891-8898 | NN | denotes | nucleus |
T2587 | 8899-8901 | IN | denotes | by |
T2588 | 8902-8905 | DT | denotes | the |
T2589 | 8906-8913 | JJ | denotes | nuclear |
T2590 | 8914-8920 | NN | denotes | import |
T2591 | 8921-8928 | NN | denotes | protein |
T2592 | 8929-8939 | NN | denotes | importin-α |
T2593 | 8940-8941 | -LRB- | denotes | ( |
T2594 | 8941-8945 | RB | denotes | also |
T2595 | 8946-8951 | VBN | denotes | known |
T2596 | 8952-8954 | IN | denotes | as |
T2597 | 8955-8968 | NN | denotes | karyopherin-α |
T2598 | 8968-8969 | -RRB- | denotes | ) |
T2599 | 8970-8971 | NNP | denotes | [ |
T2600 | 8971-8973 | CD | denotes | 12 |
T2601 | 8973-8974 | NNP | denotes | ] |
T2602 | 8974-8975 | . | denotes | . |
T2603 | 8976-8984 | NN | denotes | Deletion |
T2604 | 8985-8987 | IN | denotes | of |
T2605 | 8988-8989 | DT | denotes | a |
T2606 | 8990-8996 | NN | denotes | region |
T2607 | 8997-9009 | VBG | denotes | encompassing |
T2608 | 9010-9013 | DT | denotes | the |
T2609 | 9014-9020 | JJ | denotes | GATA-3 |
T2610 | 9021-9028 | JJ | denotes | nuclear |
T2611 | 9029-9041 | NN | denotes | localisation |
T2612 | 9042-9050 | NN | denotes | sequence |
T2613 | 9051-9052 | -LRB- | denotes | ( |
T2614 | 9052-9055 | NNP | denotes | NLS |
T2615 | 9055-9056 | -RRB- | denotes | ) |
T2616 | 9057-9063 | NN | denotes | region |
T2617 | 9064-9066 | IN | denotes | in |
T2618 | 9067-9073 | NN | denotes | murine |
T2619 | 9074-9077 | CC | denotes | and |
T2620 | 9078-9083 | JJ | denotes | human |
T2621 | 9084-9089 | NNS | denotes | cells |
T2622 | 9090-9098 | VBZ | denotes | prevents |
T2623 | 9099-9102 | PRP$ | denotes | its |
T2624 | 9103-9110 | JJ | denotes | nuclear |
T2625 | 9111-9123 | NN | denotes | localisation |
T2626 | 9124-9125 | NNP | denotes | [ |
T2627 | 9125-9127 | CD | denotes | 12 |
T2628 | 9127-9128 | NNP | denotes | ] |
T2629 | 9128-9129 | , | denotes | , |
T2630 | 9129-9130 | NNP | denotes | [ |
T2631 | 9130-9132 | CD | denotes | 14 |
T2632 | 9132-9133 | NNP | denotes | ] |
T2633 | 9133-9134 | . | denotes | . |
T2634 | 9135-9138 | DT | denotes | The |
T2635 | 9139-9147 | NN | denotes | affinity |
T2636 | 9148-9150 | IN | denotes | of |
T2637 | 9151-9154 | DT | denotes | the |
T2638 | 9155-9165 | JJ | denotes | importin-α |
T2639 | 9166-9169 | NNP | denotes | NLS |
T2640 | 9170-9181 | NN | denotes | interaction |
T2641 | 9182-9184 | VBZ | denotes | is |
T2642 | 9185-9194 | VBN | denotes | regulated |
T2643 | 9195-9197 | IN | denotes | by |
T2644 | 9198-9213 | NN | denotes | phosphorylation |
T2645 | 9214-9215 | NNP | denotes | [ |
T2646 | 9215-9217 | CD | denotes | 15 |
T2647 | 9217-9218 | NNP | denotes | ] |
T2648 | 9218-9219 | , | denotes | , |
T2649 | 9220-9223 | CC | denotes | and |
T2650 | 9224-9226 | PRP | denotes | we |
T2651 | 9227-9231 | VBP | denotes | have |
T2652 | 9232-9237 | VBN | denotes | shown |
T2653 | 9238-9242 | IN | denotes | that |
T2654 | 9243-9246 | CD | denotes | p38 |
T2655 | 9247-9264 | JJ | denotes | mitogen-activated |
T2656 | 9265-9272 | NN | denotes | protein |
T2657 | 9273-9279 | NN | denotes | kinase |
T2658 | 9280-9281 | -LRB- | denotes | ( |
T2659 | 9281-9285 | NNP | denotes | MAPK |
T2660 | 9285-9286 | -RRB- | denotes | ) |
T2661 | 9287-9292 | VBZ | denotes | plays |
T2662 | 9293-9294 | DT | denotes | a |
T2663 | 9295-9303 | JJ | denotes | critical |
T2664 | 9304-9308 | NN | denotes | role |
T2665 | 9309-9311 | IN | denotes | in |
T2666 | 9312-9327 | VBG | denotes | phosphorylating |
T2667 | 9328-9334 | NN | denotes | GATA-3 |
T2668 | 9335-9337 | TO | denotes | to |
T2669 | 9338-9345 | VB | denotes | enhance |
T2670 | 9346-9349 | PRP$ | denotes | its |
T2671 | 9350-9361 | NN | denotes | interaction |
T2672 | 9362-9366 | IN | denotes | with |
T2673 | 9367-9377 | JJ | denotes | importin-α |
T2674 | 9378-9381 | CC | denotes | and |
T2675 | 9382-9392 | JJ | denotes | subsequent |
T2676 | 9393-9402 | NN | denotes | transport |
T2677 | 9403-9407 | IN | denotes | into |
T2678 | 9408-9411 | DT | denotes | the |
T2679 | 9412-9419 | NN | denotes | nucleus |
T2680 | 9420-9421 | NNP | denotes | [ |
T2681 | 9421-9423 | CD | denotes | 12 |
T2682 | 9423-9424 | NNP | denotes | ] |
T2683 | 9424-9425 | . | denotes | . |
T2684 | 9426-9441 | NNS | denotes | Corticosteroids |
T2685 | 9442-9445 | VBP | denotes | are |
T2686 | 9446-9452 | RB | denotes | highly |
T2687 | 9453-9462 | JJ | denotes | effective |
T2688 | 9463-9465 | IN | denotes | in |
T2689 | 9466-9469 | DT | denotes | the |
T2690 | 9470-9479 | NN | denotes | treatment |
T2691 | 9480-9482 | IN | denotes | of |
T2692 | 9483-9491 | JJ | denotes | allergic |
T2693 | 9492-9504 | NN | denotes | inflammation |
T2694 | 9504-9505 | , | denotes | , |
T2695 | 9506-9510 | IN | denotes | with |
T2696 | 9511-9517 | JJ | denotes | marked |
T2697 | 9518-9529 | NN | denotes | suppression |
T2698 | 9530-9532 | IN | denotes | of |
T2699 | 9533-9536 | JJ | denotes | Th2 |
T2700 | 9537-9546 | NNS | denotes | cytokines |
T2701 | 9547-9549 | IN | denotes | in |
T2702 | 9550-9557 | NNS | denotes | airways |
T2703 | 9558-9560 | IN | denotes | of |
T2704 | 9561-9569 | NNS | denotes | patients |
T2705 | 9570-9574 | IN | denotes | with |
T2706 | 9575-9581 | NN | denotes | asthma |
T2707 | 9582-9583 | NNP | denotes | [ |
T2708 | 9583-9585 | CD | denotes | 16 |
T2709 | 9585-9586 | NNP | denotes | ] |
T2710 | 9586-9587 | . | denotes | . |
T2711 | 9588-9603 | NNS | denotes | Corticosteroids |
T2712 | 9604-9611 | VBP | denotes | mediate |
T2713 | 9612-9617 | PRP$ | denotes | their |
T2714 | 9618-9635 | JJ | denotes | anti-inflammatory |
T2715 | 9636-9643 | NNS | denotes | effects |
T2716 | 9644-9651 | IN | denotes | through |
T2717 | 9652-9659 | JJ | denotes | binding |
T2718 | 9660-9662 | TO | denotes | to |
T2719 | 9663-9677 | JJ | denotes | glucocorticoid |
T2720 | 9678-9687 | NNS | denotes | receptors |
T2721 | 9688-9689 | -LRB- | denotes | ( |
T2722 | 9689-9692 | NNS | denotes | GRs |
T2723 | 9692-9693 | -RRB- | denotes | ) |
T2724 | 9693-9694 | , | denotes | , |
T2725 | 9695-9700 | WDT | denotes | which |
T2726 | 9701-9705 | RB | denotes | then |
T2727 | 9706-9717 | VBP | denotes | translocate |
T2728 | 9718-9720 | TO | denotes | to |
T2729 | 9721-9724 | DT | denotes | the |
T2730 | 9725-9732 | NN | denotes | nucleus |
T2731 | 9733-9738 | WRB | denotes | where |
T2732 | 9739-9743 | PRP | denotes | they |
T2733 | 9744-9752 | VBP | denotes | interact |
T2734 | 9753-9757 | IN | denotes | with |
T2735 | 9758-9772 | JJ | denotes | glucocorticoid |
T2736 | 9773-9781 | NN | denotes | response |
T2737 | 9782-9790 | NNS | denotes | elements |
T2738 | 9791-9792 | -LRB- | denotes | ( |
T2739 | 9792-9796 | NNS | denotes | GREs |
T2740 | 9796-9797 | -RRB- | denotes | ) |
T2741 | 9798-9800 | IN | denotes | in |
T2742 | 9801-9804 | DT | denotes | the |
T2743 | 9805-9813 | NN | denotes | promoter |
T2744 | 9814-9821 | NNS | denotes | regions |
T2745 | 9822-9824 | IN | denotes | of |
T2746 | 9825-9842 | JJ | denotes | steroid-sensitive |
T2747 | 9843-9848 | NNS | denotes | genes |
T2748 | 9848-9849 | . | denotes | . |
T2749 | 9850-9863 | RB | denotes | Alternatively |
T2750 | 9863-9864 | , | denotes | , |
T2751 | 9865-9874 | VBN | denotes | activated |
T2752 | 9875-9877 | NNP | denotes | GR |
T2753 | 9878-9887 | NNS | denotes | interacts |
T2754 | 9888-9892 | IN | denotes | with |
T2755 | 9893-9904 | NN | denotes | coactivator |
T2756 | 9905-9914 | NNS | denotes | molecules |
T2757 | 9915-9917 | TO | denotes | to |
T2758 | 9918-9926 | VB | denotes | suppress |
T2759 | 9927-9930 | DT | denotes | the |
T2760 | 9931-9941 | NN | denotes | expression |
T2761 | 9942-9944 | IN | denotes | of |
T2762 | 9945-9957 | JJ | denotes | inflammatory |
T2763 | 9958-9963 | NNS | denotes | genes |
T2764 | 9964-9966 | IN | denotes | by |
T2765 | 9967-9977 | VBG | denotes | inhibiting |
T2766 | 9978-9981 | DT | denotes | the |
T2767 | 9982-9988 | NN | denotes | action |
T2768 | 9989-9991 | IN | denotes | of |
T2769 | 9992-10007 | JJ | denotes | proinflammatory |
T2770 | 10008-10021 | NN | denotes | transcription |
T2771 | 10022-10029 | NNS | denotes | factors |
T2772 | 10030-10034 | JJ | denotes | such |
T2773 | 10035-10037 | IN | denotes | as |
T2774 | 10038-10045 | JJ | denotes | nuclear |
T2775 | 10046-10055 | NNP | denotes | factor-κB |
T2776 | 10056-10057 | -LRB- | denotes | ( |
T2777 | 10057-10062 | NNP | denotes | NF-κB |
T2778 | 10062-10063 | -RRB- | denotes | ) |
T2779 | 10064-10071 | IN | denotes | through |
T2780 | 10072-10075 | DT | denotes | the |
T2781 | 10076-10087 | NN | denotes | recruitment |
T2782 | 10088-10090 | IN | denotes | of |
T2783 | 10091-10103 | NN | denotes | co-repressor |
T2784 | 10104-10113 | NNS | denotes | molecules |
T2785 | 10114-10118 | JJ | denotes | such |
T2786 | 10119-10121 | IN | denotes | as |
T2787 | 10122-10129 | NN | denotes | histone |
T2788 | 10130-10143 | JJ | denotes | deacetylase-2 |
T2789 | 10144-10145 | NNP | denotes | [ |
T2790 | 10145-10147 | CD | denotes | 17 |
T2791 | 10147-10148 | NNP | denotes | ] |
T2792 | 10148-10149 | , | denotes | , |
T2793 | 10149-10150 | NNP | denotes | [ |
T2794 | 10150-10152 | CD | denotes | 18 |
T2795 | 10152-10153 | NNP | denotes | ] |
T2796 | 10153-10154 | . | denotes | . |
T2797 | 10155-10162 | NNP | denotes | Nuclear |
T2798 | 10163-10175 | NN | denotes | localisation |
T2799 | 10176-10179 | CC | denotes | and |
T2800 | 10180-10189 | NN | denotes | retention |
T2801 | 10190-10192 | IN | denotes | of |
T2802 | 10193-10195 | NNP | denotes | GR |
T2803 | 10196-10198 | VBZ | denotes | is |
T2804 | 10199-10207 | VBN | denotes | mediated |
T2805 | 10208-10215 | IN | denotes | through |
T2806 | 10216-10219 | DT | denotes | the |
T2807 | 10220-10227 | JJ | denotes | nuclear |
T2808 | 10228-10240 | NN | denotes | localisation |
T2809 | 10241-10250 | NNS | denotes | sequences |
T2810 | 10251-10254 | NNP | denotes | NL1 |
T2811 | 10255-10258 | CC | denotes | and |
T2812 | 10259-10262 | NNP | denotes | NL2 |
T2813 | 10263-10264 | NNP | denotes | [ |
T2814 | 10264-10266 | CD | denotes | 19 |
T2815 | 10266-10267 | NNP | denotes | ] |
T2816 | 10267-10268 | , | denotes | , |
T2817 | 10269-10271 | IN | denotes | by |
T2818 | 10272-10279 | JJ | denotes | nuclear |
T2819 | 10280-10289 | NN | denotes | retention |
T2820 | 10290-10297 | VBZ | denotes | signals |
T2821 | 10298-10299 | NNP | denotes | [ |
T2822 | 10299-10301 | CD | denotes | 20 |
T2823 | 10301-10302 | NNP | denotes | ] |
T2824 | 10302-10303 | , | denotes | , |
T2825 | 10304-10307 | CC | denotes | and |
T2826 | 10308-10310 | IN | denotes | by |
T2827 | 10311-10318 | NN | denotes | control |
T2828 | 10319-10321 | IN | denotes | of |
T2829 | 10322-10329 | JJ | denotes | nuclear |
T2830 | 10330-10336 | NN | denotes | export |
T2831 | 10337-10340 | IN | denotes | via |
T2832 | 10341-10342 | DT | denotes | a |
T2833 | 10343-10354 | JJ | denotes | chromosomal |
T2834 | 10355-10361 | NN | denotes | region |
T2835 | 10362-10373 | NN | denotes | maintenance |
T2836 | 10374-10375 | CD | denotes | 1 |
T2837 | 10376-10377 | -LRB- | denotes | ( |
T2838 | 10377-10382 | NN | denotes | CRM-1 |
T2839 | 10382-10383 | -RRB- | denotes | ) |
T2840 | 10384-10393 | JJ | denotes | dependent |
T2841 | 10394-10401 | NN | denotes | pathway |
T2842 | 10402-10403 | NNP | denotes | [ |
T2843 | 10403-10405 | CD | denotes | 21 |
T2844 | 10405-10406 | NNP | denotes | ] |
T2845 | 10406-10407 | . | denotes | . |
T2846 | 10408-10411 | CD | denotes | NL1 |
T2847 | 10411-10412 | , | denotes | , |
T2848 | 10413-10418 | WDT | denotes | which |
T2849 | 10419-10421 | VBZ | denotes | is |
T2850 | 10422-10429 | JJ | denotes | similar |
T2851 | 10430-10432 | TO | denotes | to |
T2852 | 10433-10436 | DT | denotes | the |
T2853 | 10437-10441 | NNP | denotes | SV40 |
T2854 | 10442-10445 | NNP | denotes | NLS |
T2855 | 10445-10446 | , | denotes | , |
T2856 | 10447-10452 | VBZ | denotes | binds |
T2857 | 10453-10455 | TO | denotes | to |
T2858 | 10456-10466 | VB | denotes | importin-α |
T2859 | 10467-10468 | NNP | denotes | [ |
T2860 | 10468-10470 | CD | denotes | 22 |
T2861 | 10470-10471 | NNP | denotes | ] |
T2862 | 10471-10472 | . | denotes | . |
T2863 | 10473-10476 | CD | denotes | NL1 |
T2864 | 10477-10479 | VBZ | denotes | is |
T2865 | 10480-10489 | VBN | denotes | activated |
T2866 | 10490-10494 | DT | denotes | both |
T2867 | 10495-10497 | IN | denotes | by |
T2868 | 10498-10512 | JJ | denotes | glucocorticoid |
T2869 | 10513-10521 | NNS | denotes | agonists |
T2870 | 10522-10526 | JJ | denotes | such |
T2871 | 10527-10529 | IN | denotes | as |
T2872 | 10530-10543 | NN | denotes | dexamethasone |
T2873 | 10544-10547 | CC | denotes | and |
T2874 | 10548-10559 | NN | denotes | fluticasone |
T2875 | 10560-10570 | NN | denotes | propionate |
T2876 | 10571-10572 | -LRB- | denotes | ( |
T2877 | 10572-10574 | NNP | denotes | FP |
T2878 | 10574-10575 | -RRB- | denotes | ) |
T2879 | 10576-10579 | CC | denotes | and |
T2880 | 10580-10582 | IN | denotes | by |
T2881 | 10583-10597 | JJ | denotes | glucocorticoid |
T2882 | 10598-10609 | NNS | denotes | antagonists |
T2883 | 10610-10614 | JJ | denotes | such |
T2884 | 10615-10617 | IN | denotes | as |
T2885 | 10618-10630 | NN | denotes | mifepristone |
T2886 | 10631-10632 | -LRB- | denotes | ( |
T2887 | 10632-10637 | NNP | denotes | RU486 |
T2888 | 10637-10638 | -RRB- | denotes | ) |
T2889 | 10639-10640 | NNP | denotes | [ |
T2890 | 10640-10642 | CD | denotes | 23 |
T2891 | 10642-10643 | NNP | denotes | ] |
T2892 | 10643-10644 | . | denotes | . |
T2893 | 10645-10648 | CD | denotes | NL1 |
T2894 | 10649-10652 | MD | denotes | can |
T2895 | 10653-10655 | VB | denotes | be |
T2896 | 10656-10663 | VBN | denotes | mutated |
T2897 | 10663-10664 | , | denotes | , |
T2898 | 10665-10668 | CC | denotes | and |
T2899 | 10669-10672 | DT | denotes | the |
T2900 | 10673-10682 | VBG | denotes | resulting |
T2901 | 10683-10685 | NNP | denotes | GR |
T2902 | 10686-10691 | RB | denotes | still |
T2903 | 10692-10704 | VBZ | denotes | translocates |
T2904 | 10705-10707 | TO | denotes | to |
T2905 | 10708-10711 | DT | denotes | the |
T2906 | 10712-10719 | NN | denotes | nucleus |
T2907 | 10720-10722 | IN | denotes | in |
T2908 | 10723-10731 | NN | denotes | response |
T2909 | 10732-10734 | TO | denotes | to |
T2910 | 10735-10742 | NNS | denotes | ligands |
T2911 | 10742-10743 | , | denotes | , |
T2912 | 10744-10747 | CC | denotes | but |
T2913 | 10748-10751 | IN | denotes | via |
T2914 | 10752-10763 | NN | denotes | interaction |
T2915 | 10764-10768 | IN | denotes | with |
T2916 | 10769-10777 | NN | denotes | importin |
T2917 | 10778-10779 | CD | denotes | 7 |
T2918 | 10779-10780 | , | denotes | , |
T2919 | 10781-10783 | DT | denotes | an |
T2920 | 10784-10789 | NN | denotes | event |
T2921 | 10790-10794 | WDT | denotes | that |
T2922 | 10795-10803 | VBZ | denotes | requires |
T2923 | 10804-10806 | DT | denotes | an |
T2924 | 10807-10813 | RB | denotes | as-yet |
T2925 | 10814-10821 | JJ | denotes | unknown |
T2926 | 10822-10831 | NN | denotes | component |
T2927 | 10832-10833 | NNP | denotes | [ |
T2928 | 10833-10835 | CD | denotes | 23 |
T2929 | 10835-10836 | NNP | denotes | ] |
T2930 | 10836-10837 | . | denotes | . |
T2931 | 10838-10841 | CD | denotes | NL2 |
T2932 | 10842-10844 | VBZ | denotes | is |
T2933 | 10845-10851 | RB | denotes | poorly |
T2934 | 10852-10859 | VBN | denotes | defined |
T2935 | 10859-10860 | , | denotes | , |
T2936 | 10861-10869 | VBG | denotes | residing |
T2937 | 10870-10872 | IN | denotes | in |
T2938 | 10873-10876 | DT | denotes | the |
T2939 | 10877-10891 | JJ | denotes | ligand-binding |
T2940 | 10892-10898 | NN | denotes | domain |
T2941 | 10898-10899 | , | denotes | , |
T2942 | 10900-10903 | CC | denotes | and |
T2943 | 10904-10908 | RB | denotes | much |
T2944 | 10909-10913 | JJR | denotes | less |
T2945 | 10914-10916 | VBZ | denotes | is |
T2946 | 10917-10922 | VBN | denotes | known |
T2947 | 10923-10928 | IN | denotes | about |
T2948 | 10929-10932 | PRP$ | denotes | its |
T2949 | 10933-10942 | NN | denotes | mechanism |
T2950 | 10943-10945 | IN | denotes | of |
T2951 | 10946-10948 | NNP | denotes | GR |
T2952 | 10949-10955 | NN | denotes | import |
T2953 | 10956-10957 | NNP | denotes | [ |
T2954 | 10957-10959 | CD | denotes | 24 |
T2955 | 10959-10960 | NNP | denotes | ] |
T2956 | 10960-10961 | . | denotes | . |
T2957 | 10962-10963 | DT | denotes | A |
T2958 | 10964-10971 | NN | denotes | variety |
T2959 | 10972-10974 | IN | denotes | of |
T2960 | 10975-10980 | JJ | denotes | other |
T2961 | 10981-10988 | NNS | denotes | factors |
T2962 | 10989-10992 | VBP | denotes | are |
T2963 | 10993-10997 | RB | denotes | also |
T2964 | 10998-11007 | JJ | denotes | important |
T2965 | 11008-11011 | IN | denotes | for |
T2966 | 11012-11015 | DT | denotes | the |
T2967 | 11016-11026 | NN | denotes | regulation |
T2968 | 11027-11029 | IN | denotes | of |
T2969 | 11030-11032 | NNP | denotes | GR |
T2970 | 11033-11043 | NN | denotes | activation |
T2971 | 11044-11047 | CC | denotes | and |
T2972 | 11048-11055 | JJ | denotes | nuclear |
T2973 | 11056-11062 | NN | denotes | import |
T2974 | 11063-11072 | VBG | denotes | including |
T2975 | 11073-11083 | NNS | denotes | chaperones |
T2976 | 11084-11088 | JJ | denotes | such |
T2977 | 11089-11091 | IN | denotes | as |
T2978 | 11092-11097 | NNP | denotes | Hsp90 |
T2979 | 11098-11101 | CC | denotes | and |
T2980 | 11102-11107 | JJ | denotes | other |
T2981 | 11108-11121 | NNS | denotes | immunophilins |
T2982 | 11122-11123 | NNP | denotes | [ |
T2983 | 11123-11125 | CD | denotes | 24 |
T2984 | 11125-11126 | NNP | denotes | ] |
T2985 | 11127-11128 | NNP | denotes | [ |
T2986 | 11128-11130 | CD | denotes | 26 |
T2987 | 11130-11131 | NNP | denotes | ] |
T2988 | 11132-11135 | CC | denotes | and |
T2989 | 11136-11149 | JJ | denotes | FK506-binding |
T2990 | 11150-11158 | NNS | denotes | proteins |
T2991 | 11159-11163 | WDT | denotes | that |
T2992 | 11164-11167 | MD | denotes | may |
T2993 | 11168-11170 | VB | denotes | be |
T2994 | 11171-11177 | VBN | denotes | linked |
T2995 | 11178-11180 | TO | denotes | to |
T2996 | 11181-11187 | VB | denotes | dynein |
T2997 | 11188-11194 | CC | denotes | and/or |
T2998 | 11195-11209 | VB | denotes | peptidylprolyl |
T2999 | 11210-11219 | JJ | denotes | isomerase |
T3000 | 11220-11221 | NNP | denotes | [ |
T3001 | 11221-11223 | CD | denotes | 27 |
T3002 | 11223-11224 | NNP | denotes | ] |
T3003 | 11224-11225 | , | denotes | , |
T3004 | 11225-11226 | NNP | denotes | [ |
T3005 | 11226-11228 | CD | denotes | 28 |
T3006 | 11228-11229 | NNP | denotes | ] |
T3007 | 11229-11230 | . | denotes | . |
T3008 | 11231-11238 | RB | denotes | However |
T3009 | 11238-11239 | , | denotes | , |
T3010 | 11240-11243 | DT | denotes | the |
T3011 | 11244-11253 | JJ | denotes | molecular |
T3012 | 11254-11259 | NN | denotes | basis |
T3013 | 11260-11263 | IN | denotes | for |
T3014 | 11264-11267 | DT | denotes | the |
T3015 | 11268-11278 | NN | denotes | inhibition |
T3016 | 11279-11281 | IN | denotes | of |
T3017 | 11282-11285 | JJ | denotes | Th2 |
T3018 | 11286-11295 | NNS | denotes | cytokines |
T3019 | 11296-11298 | IN | denotes | by |
T3020 | 11299-11314 | NNS | denotes | corticosteroids |
T3021 | 11315-11317 | VBZ | denotes | is |
T3022 | 11318-11321 | RB | denotes | not |
T3023 | 11322-11326 | RB | denotes | well |
T3024 | 11327-11337 | VBN | denotes | understood |
T3025 | 11337-11338 | , | denotes | , |
T3026 | 11339-11346 | IN | denotes | because |
T3027 | 11347-11350 | DT | denotes | the |
T3028 | 11351-11356 | NNS | denotes | genes |
T3029 | 11357-11365 | VBG | denotes | encoding |
T3030 | 11366-11370 | NN | denotes | IL-4 |
T3031 | 11370-11371 | , | denotes | , |
T3032 | 11372-11376 | NN | denotes | IL-5 |
T3033 | 11376-11377 | , | denotes | , |
T3034 | 11378-11381 | CC | denotes | and |
T3035 | 11382-11387 | NNP | denotes | IL-13 |
T3036 | 11388-11390 | VBP | denotes | do |
T3037 | 11391-11394 | RB | denotes | not |
T3038 | 11395-11399 | VB | denotes | have |
T3039 | 11400-11403 | DT | denotes | any |
T3040 | 11404-11416 | JJ | denotes | recognisable |
T3041 | 11417-11420 | NNP | denotes | GRE |
T3042 | 11421-11429 | NN | denotes | sequence |
T3043 | 11430-11431 | NNP | denotes | [ |
T3044 | 11431-11433 | CD | denotes | 29 |
T3045 | 11433-11434 | NNP | denotes | ] |
T3046 | 11435-11438 | CC | denotes | and |
T3047 | 11439-11442 | VBP | denotes | are |
T3048 | 11443-11447 | RB | denotes | only |
T3049 | 11448-11454 | RB | denotes | partly |
T3050 | 11455-11464 | VBN | denotes | regulated |
T3051 | 11465-11467 | IN | denotes | by |
T3052 | 11468-11473 | NNP | denotes | NF-κB |
T3053 | 11474-11476 | IN | denotes | in |
T3054 | 11477-11482 | JJ | denotes | human |
T3055 | 11483-11488 | NNS | denotes | cells |
T3056 | 11489-11490 | NNP | denotes | [ |
T3057 | 11490-11492 | CD | denotes | 30 |
T3058 | 11492-11493 | NNP | denotes | ] |
T3059 | 11494-11495 | NNP | denotes | [ |
T3060 | 11495-11497 | CD | denotes | 32 |
T3061 | 11497-11498 | NNP | denotes | ] |
T3062 | 11498-11499 | . | denotes | . |
T3063 | 11500-11505 | VBG | denotes | Using |
T3064 | 11506-11520 | NN | denotes | overexpression |
T3065 | 11521-11524 | CC | denotes | and |
T3066 | 11525-11537 | JJ | denotes | CAT-reporter |
T3067 | 11538-11543 | NNS | denotes | genes |
T3068 | 11543-11544 | , | denotes | , |
T3069 | 11545-11553 | NNP | denotes | Lavender |
T3070 | 11554-11557 | CC | denotes | and |
T3071 | 11558-11568 | NNS | denotes | colleagues |
T3072 | 11569-11570 | NNP | denotes | [ |
T3073 | 11570-11572 | CD | denotes | 33 |
T3074 | 11572-11573 | NNP | denotes | ] |
T3075 | 11574-11578 | VBP | denotes | have |
T3076 | 11579-11584 | VBN | denotes | shown |
T3077 | 11585-11589 | IN | denotes | that |
T3078 | 11590-11592 | NNP | denotes | GR |
T3079 | 11593-11600 | VBD | denotes | reduced |
T3080 | 11601-11616 | JJ | denotes | GATA-3-mediated |
T3081 | 11617-11621 | NN | denotes | IL-5 |
T3082 | 11622-11625 | CC | denotes | and |
T3083 | 11626-11629 | CD | denotes | -13 |
T3084 | 11630-11638 | NN | denotes | promoter |
T3085 | 11639-11647 | NN | denotes | activity |
T3086 | 11648-11650 | IN | denotes | in |
T3087 | 11651-11656 | JJ | denotes | human |
T3088 | 11657-11660 | NNP | denotes | CD4 |
T3089 | 11660-11661 | CD | denotes | + |
T3090 | 11662-11663 | NNP | denotes | T |
T3091 | 11664-11669 | NNS | denotes | cells |
T3092 | 11669-11670 | . | denotes | . |
T3093 | 11671-11674 | DT | denotes | The |
T3094 | 11675-11682 | NNS | denotes | authors |
T3095 | 11683-11693 | VBD | denotes | postulated |
T3096 | 11694-11698 | IN | denotes | that |
T3097 | 11699-11704 | JJ | denotes | local |
T3098 | 11705-11716 | NN | denotes | recruitment |
T3099 | 11717-11719 | IN | denotes | of |
T3100 | 11720-11722 | NNP | denotes | GR |
T3101 | 11723-11726 | MD | denotes | may |
T3102 | 11727-11732 | VB | denotes | alter |
T3103 | 11733-11736 | DT | denotes | the |
T3104 | 11737-11744 | NN | denotes | ability |
T3105 | 11745-11747 | IN | denotes | of |
T3106 | 11748-11754 | JJ | denotes | GATA-3 |
T3107 | 11755-11761 | CC | denotes | either |
T3108 | 11762-11764 | TO | denotes | to |
T3109 | 11765-11769 | NN | denotes | bind |
T3110 | 11770-11772 | TO | denotes | to |
T3111 | 11773-11776 | PRP$ | denotes | its |
T3112 | 11777-11783 | NN | denotes | target |
T3113 | 11784-11788 | NN | denotes | site |
T3114 | 11788-11789 | , | denotes | , |
T3115 | 11790-11792 | TO | denotes | to |
T3116 | 11793-11798 | VB | denotes | cause |
T3117 | 11799-11814 | JJ | denotes | transcriptional |
T3118 | 11815-11828 | NN | denotes | up-regulation |
T3119 | 11828-11829 | , | denotes | , |
T3120 | 11830-11832 | CC | denotes | or |
T3121 | 11833-11835 | TO | denotes | to |
T3122 | 11836-11844 | VB | denotes | maintain |
T3123 | 11845-11847 | DT | denotes | an |
T3124 | 11848-11859 | NN | denotes | environment |
T3125 | 11860-11864 | WDT | denotes | that |
T3126 | 11865-11867 | VBZ | denotes | is |
T3127 | 11868-11878 | JJ | denotes | permissive |
T3128 | 11879-11882 | IN | denotes | for |
T3129 | 11883-11896 | NN | denotes | transcription |
T3130 | 11896-11897 | . | denotes | . |
T3131 | 11898-11900 | PRP | denotes | We |
T3132 | 11901-11910 | RB | denotes | therefore |
T3133 | 11911-11923 | VBD | denotes | investigated |
T3134 | 11924-11927 | DT | denotes | the |
T3135 | 11928-11935 | NNS | denotes | effects |
T3136 | 11936-11938 | IN | denotes | of |
T3137 | 11939-11940 | DT | denotes | a |
T3138 | 11941-11950 | JJ | denotes | synthetic |
T3139 | 11951-11965 | NN | denotes | corticosteroid |
T3140 | 11965-11966 | , | denotes | , |
T3141 | 11967-11969 | NNP | denotes | FP |
T3142 | 11969-11970 | , | denotes | , |
T3143 | 11971-11973 | IN | denotes | on |
T3144 | 11974-11980 | JJ | denotes | GATA-3 |
T3145 | 11981-11996 | NN | denotes | phosphorylation |
T3146 | 11997-12000 | CC | denotes | and |
T3147 | 12001-12008 | JJ | denotes | nuclear |
T3148 | 12009-12022 | NN | denotes | translocation |
T3149 | 12023-12025 | IN | denotes | in |
T3150 | 12026-12027 | DT | denotes | a |
T3151 | 12028-12029 | NNP | denotes | T |
T3152 | 12030-12040 | NN | denotes | lymphocyte |
T3153 | 12041-12045 | NN | denotes | cell |
T3154 | 12046-12050 | NN | denotes | line |
T3155 | 12051-12052 | -LRB- | denotes | ( |
T3156 | 12052-12058 | JJ | denotes | HuT-78 |
T3157 | 12058-12059 | -RRB- | denotes | ) |
T3158 | 12060-12063 | CC | denotes | and |
T3159 | 12064-12066 | IN | denotes | in |
T3160 | 12067-12077 | JJ | denotes | peripheral |
T3161 | 12078-12083 | NN | denotes | blood |
T3162 | 12084-12095 | NN | denotes | mononuclear |
T3163 | 12096-12101 | NNS | denotes | cells |
T3164 | 12102-12111 | VBN | denotes | activated |
T3165 | 12112-12114 | IN | denotes | by |
T3166 | 12115-12123 | JJ | denotes | anti-CD3 |
T3167 | 12124-12127 | CC | denotes | and |
T3168 | 12128-12137 | JJ | denotes | anti-CD28 |
T3169 | 12138-12148 | NNS | denotes | antibodies |
T3170 | 12149-12151 | IN | denotes | in |
T3171 | 12152-12157 | NN | denotes | vitro |
T3172 | 12157-12158 | . | denotes | . |
T3173 | 12159-12161 | PRP | denotes | We |
T3174 | 12162-12166 | RB | denotes | also |
T3175 | 12167-12174 | VBD | denotes | studied |
T3176 | 12175-12178 | DT | denotes | the |
T3177 | 12179-12186 | NNS | denotes | effects |
T3178 | 12187-12189 | IN | denotes | of |
T3179 | 12190-12197 | JJ | denotes | inhaled |
T3180 | 12198-12209 | NN | denotes | fluticasone |
T3181 | 12210-12217 | NN | denotes | therapy |
T3182 | 12218-12220 | IN | denotes | on |
T3183 | 12221-12227 | JJ | denotes | GATA-3 |
T3184 | 12228-12239 | JJ | denotes | subcellular |
T3185 | 12240-12252 | NN | denotes | localization |
T3186 | 12253-12255 | IN | denotes | in |
T3187 | 12256-12266 | JJ | denotes | peripheral |
T3188 | 12267-12272 | NN | denotes | blood |
T3189 | 12273-12284 | NN | denotes | mononuclear |
T3190 | 12285-12290 | NNS | denotes | cells |
T3191 | 12291-12292 | -LRB- | denotes | ( |
T3192 | 12292-12297 | NNS | denotes | PBMCs |
T3193 | 12297-12298 | -RRB- | denotes | ) |
T3194 | 12299-12303 | IN | denotes | from |
T3195 | 12304-12312 | NNS | denotes | patients |
T3196 | 12313-12317 | IN | denotes | with |
T3197 | 12318-12324 | NN | denotes | asthma |
T3198 | 12324-12325 | . | denotes | . |
T3810 | 12350-12362 | NNS | denotes | Participants |
T3811 | 12363-12366 | CC | denotes | and |
T3812 | 12367-12372 | NNP | denotes | Study |
T3813 | 12373-12379 | NNP | denotes | Design |
T3814 | 12380-12382 | PRP | denotes | We |
T3815 | 12383-12390 | VBD | denotes | studied |
T3816 | 12391-12399 | NNS | denotes | patients |
T3817 | 12400-12404 | IN | denotes | with |
T3818 | 12405-12409 | JJ | denotes | mild |
T3819 | 12410-12416 | NN | denotes | asthma |
T3820 | 12417-12420 | WP | denotes | who |
T3821 | 12421-12425 | VBD | denotes | were |
T3822 | 12426-12429 | RB | denotes | not |
T3823 | 12430-12437 | VBN | denotes | treated |
T3824 | 12438-12442 | IN | denotes | with |
T3825 | 12443-12450 | JJ | denotes | inhaled |
T3826 | 12451-12466 | NNS | denotes | corticosteroids |
T3827 | 12467-12470 | WP | denotes | who |
T3828 | 12471-12474 | VBD | denotes | had |
T3829 | 12475-12479 | VBN | denotes | been |
T3830 | 12480-12488 | VBN | denotes | included |
T3831 | 12489-12491 | IN | denotes | in |
T3832 | 12492-12493 | DT | denotes | a |
T3833 | 12494-12504 | RB | denotes | previously |
T3834 | 12505-12513 | VBN | denotes | reported |
T3835 | 12514-12526 | NN | denotes | double-blind |
T3836 | 12526-12527 | , | denotes | , |
T3837 | 12528-12546 | JJ | denotes | placebo-controlled |
T3838 | 12546-12547 | , | denotes | , |
T3839 | 12548-12557 | JJ | denotes | crossover |
T3840 | 12558-12563 | NN | denotes | study |
T3841 | 12564-12568 | IN | denotes | with |
T3842 | 12569-12571 | NNP | denotes | FP |
T3843 | 12572-12573 | NNP | denotes | [ |
T3844 | 12573-12575 | CD | denotes | 34 |
T3845 | 12575-12576 | NNP | denotes | ] |
T3846 | 12576-12577 | . | denotes | . |
T3847 | 12578-12583 | CD | denotes | Seven |
T3848 | 12584-12592 | NNS | denotes | patients |
T3849 | 12593-12597 | IN | denotes | with |
T3850 | 12598-12602 | JJ | denotes | mild |
T3851 | 12603-12609 | NN | denotes | asthma |
T3852 | 12610-12617 | VBD | denotes | entered |
T3853 | 12618-12621 | DT | denotes | the |
T3854 | 12622-12627 | NN | denotes | study |
T3855 | 12628-12631 | CC | denotes | and |
T3856 | 12632-12636 | VBD | denotes | were |
T3857 | 12637-12647 | VBN | denotes | randomized |
T3858 | 12648-12650 | TO | denotes | to |
T3859 | 12651-12658 | VB | denotes | receive |
T3860 | 12659-12660 | DT | denotes | a |
T3861 | 12661-12667 | JJ | denotes | single |
T3862 | 12668-12678 | NN | denotes | inhalation |
T3863 | 12679-12681 | IN | denotes | of |
T3864 | 12682-12684 | NNP | denotes | FP |
T3865 | 12685-12686 | -LRB- | denotes | ( |
T3866 | 12686-12689 | CD | denotes | 100 |
T3867 | 12690-12693 | CC | denotes | and |
T3868 | 12694-12697 | CD | denotes | 500 |
T3869 | 12698-12700 | NN | denotes | µg |
T3870 | 12700-12701 | -RRB- | denotes | ) |
T3871 | 12702-12704 | CC | denotes | or |
T3872 | 12705-12706 | DT | denotes | a |
T3873 | 12707-12714 | VBN | denotes | matched |
T3874 | 12715-12722 | NN | denotes | placebo |
T3875 | 12723-12730 | NN | denotes | control |
T3876 | 12731-12734 | IN | denotes | via |
T3877 | 12735-12736 | DT | denotes | a |
T3878 | 12737-12743 | NN | denotes | spacer |
T3879 | 12744-12751 | NN | denotes | chamber |
T3880 | 12751-12752 | , | denotes | , |
T3881 | 12753-12756 | CC | denotes | and |
T3882 | 12757-12760 | DT | denotes | the |
T3883 | 12761-12766 | JJ | denotes | other |
T3884 | 12767-12776 | NN | denotes | treatment |
T3885 | 12777-12780 | VBD | denotes | was |
T3886 | 12781-12786 | VBN | denotes | given |
T3887 | 12787-12792 | IN | denotes | after |
T3888 | 12793-12794 | DT | denotes | a |
T3889 | 12795-12803 | JJ | denotes | wash-out |
T3890 | 12804-12810 | NN | denotes | period |
T3891 | 12811-12813 | IN | denotes | of |
T3892 | 12814-12816 | IN | denotes | at |
T3893 | 12817-12822 | JJS | denotes | least |
T3894 | 12823-12824 | CD | denotes | 6 |
T3895 | 12825-12827 | NN | denotes | d. |
T3896 | 12828-12833 | NNP | denotes | Blood |
T3897 | 12834-12837 | VBD | denotes | was |
T3898 | 12838-12843 | VBN | denotes | taken |
T3899 | 12844-12847 | IN | denotes | for |
T3900 | 12848-12859 | NN | denotes | preparation |
T3901 | 12860-12862 | IN | denotes | of |
T3902 | 12863-12868 | NNS | denotes | PBMCs |
T3903 | 12869-12871 | IN | denotes | at |
T3904 | 12872-12873 | CD | denotes | 1 |
T3905 | 12874-12877 | CC | denotes | and |
T3906 | 12878-12879 | CD | denotes | 2 |
T3907 | 12880-12881 | NN | denotes | h |
T3908 | 12882-12887 | IN | denotes | after |
T3909 | 12888-12892 | NN | denotes | drug |
T3910 | 12893-12907 | NN | denotes | administration |
T3911 | 12907-12908 | . | denotes | . |
T3912 | 12909-12912 | DT | denotes | All |
T3913 | 12913-12921 | NNS | denotes | patients |
T3914 | 12922-12926 | VBD | denotes | gave |
T3915 | 12927-12935 | VBN | denotes | informed |
T3916 | 12936-12943 | NN | denotes | consent |
T3917 | 12944-12947 | CC | denotes | and |
T3918 | 12948-12951 | DT | denotes | the |
T3919 | 12952-12957 | NN | denotes | study |
T3920 | 12958-12961 | VBD | denotes | was |
T3921 | 12962-12970 | VBN | denotes | approved |
T3922 | 12971-12973 | IN | denotes | by |
T3923 | 12974-12977 | DT | denotes | the |
T3924 | 12978-12984 | NNPS | denotes | Ethics |
T3925 | 12985-12994 | NNP | denotes | Committee |
T3926 | 12995-12997 | IN | denotes | of |
T3927 | 12998-13001 | DT | denotes | the |
T3928 | 13002-13007 | NNP | denotes | Royal |
T3929 | 13008-13016 | NNP | denotes | Brompton |
T3930 | 13017-13020 | CC | denotes | and |
T3931 | 13021-13030 | NNP | denotes | Harefield |
T3932 | 13031-13040 | NNPS | denotes | Hospitals |
T3933 | 13041-13044 | NNP | denotes | NHS |
T3934 | 13045-13050 | NNP | denotes | Trust |
T3935 | 13050-13051 | . | denotes | . |
T3936 | 13052-13055 | DT | denotes | The |
T3937 | 13056-13064 | JJ | denotes | clinical |
T3938 | 13065-13070 | NN | denotes | study |
T3939 | 13071-13074 | VBD | denotes | was |
T3940 | 13075-13084 | VBN | denotes | conducted |
T3941 | 13085-13091 | IN | denotes | before |
T3942 | 13092-13095 | DT | denotes | the |
T3943 | 13096-13107 | NN | denotes | requirement |
T3944 | 13108-13111 | IN | denotes | for |
T3945 | 13112-13120 | NNP | denotes | Clinical |
T3946 | 13121-13126 | NNP | denotes | Trial |
T3947 | 13127-13139 | NNP | denotes | Registration |
T3948 | 13139-13140 | . | denotes | . |
T4142 | 13142-13152 | NNS | denotes | Antibodies |
T4143 | 13153-13156 | CC | denotes | and |
T4144 | 13157-13165 | NNS | denotes | Reagents |
T4145 | 13166-13169 | DT | denotes | The |
T4146 | 13170-13180 | JJ | denotes | monoclonal |
T4147 | 13181-13191 | NNS | denotes | antibodies |
T4148 | 13192-13199 | IN | denotes | against |
T4149 | 13200-13205 | JJ | denotes | human |
T4150 | 13206-13209 | NNP | denotes | CD3 |
T4151 | 13209-13210 | , | denotes | , |
T4152 | 13211-13215 | NNP | denotes | CD28 |
T4153 | 13215-13216 | , | denotes | , |
T4154 | 13217-13219 | NNP | denotes | GR |
T4155 | 13219-13220 | , | denotes | , |
T4156 | 13221-13224 | CC | denotes | and |
T4157 | 13225-13235 | JJ | denotes | importin-α |
T4158 | 13236-13240 | VBD | denotes | were |
T4159 | 13241-13250 | VBN | denotes | purchased |
T4160 | 13251-13255 | IN | denotes | from |
T4161 | 13256-13258 | NNP | denotes | BD |
T4162 | 13259-13270 | NNP | denotes | Biosciences |
T4163 | 13271-13272 | -LRB- | denotes | ( |
T4164 | 13272-13278 | NNP | denotes | Oxford |
T4165 | 13278-13279 | , | denotes | , |
T4166 | 13280-13286 | NNP | denotes | United |
T4167 | 13287-13294 | NNP | denotes | Kingdom |
T4168 | 13294-13295 | -RRB- | denotes | ) |
T4169 | 13295-13296 | . | denotes | . |
T4170 | 13297-13303 | NN | denotes | Rabbit |
T4171 | 13304-13314 | NNS | denotes | antibodies |
T4172 | 13315-13322 | IN | denotes | against |
T4173 | 13323-13328 | JJ | denotes | human |
T4174 | 13329-13335 | NNP | denotes | GATA-3 |
T4175 | 13336-13337 | -LRB- | denotes | ( |
T4176 | 13337-13341 | NNP | denotes | H-48 |
T4177 | 13341-13342 | -RRB- | denotes | ) |
T4178 | 13343-13346 | CC | denotes | and |
T4179 | 13347-13349 | NNP | denotes | GR |
T4180 | 13350-13351 | -LRB- | denotes | ( |
T4181 | 13351-13355 | NNP | denotes | E-20 |
T4182 | 13355-13356 | , | denotes | , |
T4183 | 13357-13364 | JJ | denotes | sc-1003 |
T4184 | 13364-13365 | -RRB- | denotes | ) |
T4185 | 13366-13370 | VBD | denotes | were |
T4186 | 13371-13379 | VBN | denotes | obtained |
T4187 | 13380-13384 | IN | denotes | from |
T4188 | 13385-13390 | NNP | denotes | Santa |
T4189 | 13391-13395 | NNP | denotes | Cruz |
T4190 | 13396-13409 | NNP | denotes | Biotechnology |
T4191 | 13410-13411 | -LRB- | denotes | ( |
T4192 | 13411-13416 | NNP | denotes | Santa |
T4193 | 13417-13421 | NNP | denotes | Cruz |
T4194 | 13421-13422 | , | denotes | , |
T4195 | 13423-13433 | NNP | denotes | California |
T4196 | 13433-13434 | , | denotes | , |
T4197 | 13435-13441 | NNP | denotes | United |
T4198 | 13442-13448 | NNPS | denotes | States |
T4199 | 13448-13449 | -RRB- | denotes | ) |
T4200 | 13449-13450 | , | denotes | , |
T4201 | 13451-13461 | JJ | denotes | polyclonal |
T4202 | 13462-13468 | NN | denotes | rabbit |
T4203 | 13469-13479 | NNS | denotes | antibodies |
T4204 | 13480-13487 | IN | denotes | against |
T4205 | 13488-13499 | JJ | denotes | phospho-p38 |
T4206 | 13500-13503 | NNP | denotes | MAP |
T4207 | 13504-13510 | NN | denotes | kinase |
T4208 | 13511-13514 | CC | denotes | and |
T4209 | 13515-13528 | NN | denotes | phospho-ATF-2 |
T4210 | 13529-13533 | IN | denotes | from |
T4211 | 13534-13538 | NNP | denotes | Cell |
T4212 | 13539-13548 | NNP | denotes | Signaling |
T4213 | 13549-13559 | NNP | denotes | Technology |
T4214 | 13560-13561 | -LRB- | denotes | ( |
T4215 | 13561-13564 | NNP | denotes | New |
T4216 | 13565-13572 | NNP | denotes | England |
T4217 | 13573-13580 | NNPS | denotes | Biolabs |
T4218 | 13580-13581 | , | denotes | , |
T4219 | 13582-13590 | NNP | denotes | Hertford |
T4220 | 13590-13591 | , | denotes | , |
T4221 | 13592-13594 | NNP | denotes | UK |
T4222 | 13594-13595 | -RRB- | denotes | ) |
T4223 | 13595-13596 | , | denotes | , |
T4224 | 13597-13607 | JJ | denotes | monoclonal |
T4225 | 13608-13616 | NN | denotes | antibody |
T4226 | 13617-13624 | IN | denotes | against |
T4227 | 13625-13638 | NN | denotes | phosphoserine |
T4228 | 13639-13640 | -LRB- | denotes | ( |
T4229 | 13640-13645 | JJ | denotes | clone |
T4230 | 13646-13649 | NNP | denotes | 4H4 |
T4231 | 13649-13650 | -RRB- | denotes | ) |
T4232 | 13651-13655 | IN | denotes | from |
T4233 | 13656-13664 | NNP | denotes | Affiniti |
T4234 | 13665-13673 | NNP | denotes | Research |
T4235 | 13674-13682 | NNP | denotes | Products |
T4236 | 13683-13684 | -LRB- | denotes | ( |
T4237 | 13684-13690 | NNP | denotes | Exeter |
T4238 | 13690-13691 | , | denotes | , |
T4239 | 13692-13694 | NNP | denotes | UK |
T4240 | 13694-13695 | -RRB- | denotes | ) |
T4241 | 13695-13696 | , | denotes | , |
T4242 | 13697-13700 | CC | denotes | and |
T4243 | 13701-13711 | NNS | denotes | antibodies |
T4244 | 13712-13719 | IN | denotes | against |
T4245 | 13720-13726 | NN | denotes | rabbit |
T4246 | 13727-13741 | NNP | denotes | IgG-conjugated |
T4247 | 13742-13747 | NNP | denotes | TRITC |
T4248 | 13748-13752 | IN | denotes | from |
T4249 | 13753-13757 | NNP | denotes | Dako |
T4250 | 13758-13768 | NNP | denotes | Cytomation |
T4251 | 13769-13770 | -LRB- | denotes | ( |
T4252 | 13770-13779 | NNP | denotes | Cambridge |
T4253 | 13779-13780 | , | denotes | , |
T4254 | 13781-13783 | NNP | denotes | UK |
T4255 | 13783-13784 | -RRB- | denotes | ) |
T4256 | 13784-13785 | . | denotes | . |
T4257 | 13786-13789 | DT | denotes | The |
T4258 | 13790-13797 | JJ | denotes | anti-GR |
T4259 | 13798-13806 | NN | denotes | antibody |
T4260 | 13807-13808 | -LRB- | denotes | ( |
T4261 | 13808-13813 | NNP | denotes | Clone |
T4262 | 13814-13816 | CD | denotes | 41 |
T4263 | 13816-13817 | -RRB- | denotes | ) |
T4264 | 13818-13822 | IN | denotes | from |
T4265 | 13823-13825 | NNP | denotes | BD |
T4266 | 13826-13838 | NNP | denotes | Transduction |
T4267 | 13839-13851 | NNP | denotes | Laboratories |
T4268 | 13852-13853 | -LRB- | denotes | ( |
T4269 | 13853-13859 | NNP | denotes | Oxford |
T4270 | 13859-13860 | , | denotes | , |
T4271 | 13861-13863 | NNP | denotes | UK |
T4272 | 13863-13864 | -RRB- | denotes | ) |
T4273 | 13865-13868 | VBD | denotes | was |
T4274 | 13869-13873 | VBN | denotes | used |
T4275 | 13874-13877 | IN | denotes | for |
T4276 | 13878-13885 | JJ | denotes | Western |
T4277 | 13886-13890 | NN | denotes | blot |
T4278 | 13891-13899 | NN | denotes | analysis |
T4279 | 13899-13900 | . | denotes | . |
T4280 | 13901-13904 | DT | denotes | All |
T4281 | 13905-13910 | JJ | denotes | other |
T4282 | 13911-13919 | NNS | denotes | reagents |
T4283 | 13920-13924 | VBD | denotes | were |
T4284 | 13925-13934 | VBN | denotes | purchased |
T4285 | 13935-13939 | IN | denotes | from |
T4286 | 13940-13945 | NNP | denotes | Sigma |
T4287 | 13946-13947 | -LRB- | denotes | ( |
T4288 | 13947-13952 | NNP | denotes | Poole |
T4289 | 13952-13953 | , | denotes | , |
T4290 | 13954-13956 | NNP | denotes | UK |
T4291 | 13956-13957 | -RRB- | denotes | ) |
T4292 | 13957-13958 | . | denotes | . |
T4470 | 13960-13964 | NNP | denotes | Cell |
T4471 | 13965-13972 | NNP | denotes | Culture |
T4472 | 13973-13976 | CC | denotes | and |
T4473 | 13977-13981 | NNP | denotes | PBMC |
T4474 | 13982-13991 | NNP | denotes | Isolation |
T4475 | 13992-13993 | NNP | denotes | A |
T4476 | 13994-13999 | JJ | denotes | human |
T4477 | 14000-14001 | NNP | denotes | T |
T4478 | 14002-14006 | NN | denotes | cell |
T4479 | 14007-14011 | NN | denotes | line |
T4480 | 14012-14013 | -LRB- | denotes | ( |
T4481 | 14013-14019 | JJ | denotes | HuT-78 |
T4482 | 14019-14020 | -RRB- | denotes | ) |
T4483 | 14021-14024 | VBD | denotes | was |
T4484 | 14025-14034 | VBN | denotes | purchased |
T4485 | 14035-14039 | IN | denotes | from |
T4486 | 14040-14045 | NNP | denotes | ECACC |
T4487 | 14046-14054 | NNP | denotes | European |
T4488 | 14055-14065 | NNP | denotes | Collection |
T4489 | 14066-14068 | IN | denotes | of |
T4490 | 14069-14073 | NNP | denotes | Cell |
T4491 | 14074-14081 | NNP | denotes | Culture |
T4492 | 14082-14083 | -LRB- | denotes | ( |
T4493 | 14083-14092 | NNP | denotes | Wiltshire |
T4494 | 14092-14093 | , | denotes | , |
T4495 | 14094-14096 | NNP | denotes | UK |
T4496 | 14096-14097 | -RRB- | denotes | ) |
T4497 | 14098-14102 | VBD | denotes | were |
T4498 | 14103-14111 | VBN | denotes | cultured |
T4499 | 14112-14114 | IN | denotes | as |
T4500 | 14115-14125 | RB | denotes | previously |
T4501 | 14126-14135 | VBN | denotes | described |
T4502 | 14136-14137 | NNP | denotes | [ |
T4503 | 14137-14139 | CD | denotes | 12 |
T4504 | 14139-14140 | NNP | denotes | ] |
T4505 | 14140-14141 | . | denotes | . |
T4506 | 14142-14147 | NNS | denotes | PBMCs |
T4507 | 14148-14152 | VBD | denotes | were |
T4508 | 14153-14161 | VBN | denotes | isolated |
T4509 | 14162-14164 | IN | denotes | by |
T4510 | 14165-14172 | NN | denotes | density |
T4511 | 14173-14187 | NN | denotes | centrifugation |
T4512 | 14188-14192 | IN | denotes | over |
T4513 | 14193-14207 | NNP | denotes | Ficoll-Hypaque |
T4514 | 14208-14209 | -LRB- | denotes | ( |
T4515 | 14209-14216 | NN | denotes | density |
T4516 | 14216-14217 | , | denotes | , |
T4517 | 14218-14223 | CD | denotes | 1.077 |
T4518 | 14224-14228 | NN | denotes | g/ml |
T4519 | 14228-14229 | : | denotes | ; |
T4520 | 14230-14238 | NNP | denotes | Amersham |
T4521 | 14239-14250 | NNP | denotes | Biosciences |
T4522 | 14250-14251 | , | denotes | , |
T4523 | 14252-14260 | NNP | denotes | Amersham |
T4524 | 14260-14261 | , | denotes | , |
T4525 | 14262-14264 | NNP | denotes | UK |
T4526 | 14264-14265 | -RRB- | denotes | ) |
T4527 | 14266-14268 | IN | denotes | as |
T4528 | 14269-14279 | RB | denotes | previously |
T4529 | 14280-14289 | VBN | denotes | described |
T4530 | 14290-14291 | NNP | denotes | [ |
T4531 | 14291-14293 | CD | denotes | 34 |
T4532 | 14293-14294 | NNP | denotes | ] |
T4533 | 14294-14295 | . | denotes | . |
T4534 | 14296-14301 | NNS | denotes | Cells |
T4535 | 14302-14306 | VBD | denotes | were |
T4536 | 14307-14317 | VBN | denotes | stimulated |
T4537 | 14318-14322 | IN | denotes | with |
T4538 | 14323-14331 | JJ | denotes | anti-CD3 |
T4539 | 14331-14332 | NN | denotes | / |
T4540 | 14332-14336 | NNP | denotes | CD28 |
T4541 | 14337-14338 | -LRB- | denotes | ( |
T4542 | 14338-14339 | CD | denotes | 1 |
T4543 | 14340-14342 | NN | denotes | µg |
T4544 | 14342-14343 | NN | denotes | / |
T4545 | 14343-14345 | NN | denotes | ml |
T4546 | 14346-14350 | DT | denotes | each |
T4547 | 14350-14351 | -RRB- | denotes | ) |
T4548 | 14352-14355 | IN | denotes | for |
T4549 | 14356-14357 | CD | denotes | 1 |
T4550 | 14358-14359 | NN | denotes | h |
T4551 | 14360-14362 | IN | denotes | at |
T4552 | 14363-14365 | CD | denotes | 37 |
T4553 | 14365-14366 | CD | denotes | ° |
T4554 | 14366-14367 | NNP | denotes | C |
T4555 | 14368-14370 | TO | denotes | to |
T4556 | 14371-14380 | VB | denotes | stimulate |
T4557 | 14381-14384 | JJ | denotes | Th2 |
T4558 | 14385-14393 | NN | denotes | cytokine |
T4559 | 14394-14401 | NN | denotes | release |
T4560 | 14402-14404 | IN | denotes | in |
T4561 | 14405-14408 | DT | denotes | the |
T4562 | 14409-14417 | NN | denotes | presence |
T4563 | 14418-14420 | CC | denotes | or |
T4564 | 14421-14428 | NN | denotes | absence |
T4565 | 14429-14431 | IN | denotes | of |
T4566 | 14432-14434 | NNP | denotes | FP |
T4567 | 14435-14436 | -LRB- | denotes | ( |
T4568 | 14436-14438 | CD | denotes | 10 |
T4569 | 14438-14439 | NN | denotes | − |
T4570 | 14439-14441 | CD | denotes | 12 |
T4571 | 14442-14444 | TO | denotes | to |
T4572 | 14445-14447 | CD | denotes | 10 |
T4573 | 14447-14448 | CD | denotes | − |
T4574 | 14448-14450 | NNP | denotes | 8M |
T4575 | 14450-14451 | -RRB- | denotes | ) |
T4576 | 14451-14452 | . | denotes | . |
T4577 | 14453-14462 | NNS | denotes | Cytospins |
T4578 | 14463-14467 | VBD | denotes | were |
T4579 | 14468-14476 | JJ | denotes | prepared |
T4580 | 14477-14480 | CC | denotes | and |
T4581 | 14481-14487 | JJ | denotes | GATA-3 |
T4582 | 14488-14500 | NN | denotes | localization |
T4583 | 14501-14511 | VBN | denotes | determined |
T4584 | 14512-14514 | IN | denotes | by |
T4585 | 14515-14523 | JJ | denotes | confocal |
T4586 | 14524-14534 | NN | denotes | microscopy |
T4587 | 14535-14537 | IN | denotes | as |
T4588 | 14538-14548 | RB | denotes | previously |
T4589 | 14549-14558 | VBN | denotes | described |
T4590 | 14559-14560 | NNP | denotes | [ |
T4591 | 14560-14562 | CD | denotes | 12 |
T4592 | 14562-14563 | NNP | denotes | ] |
T4593 | 14563-14564 | . | denotes | . |
T4717 | 14566-14573 | VB | denotes | Reverse |
T4718 | 14574-14587 | NNP | denotes | Transcription |
T4719 | 14588-14591 | NNP | denotes | PCR |
T4720 | 14592-14597 | NNP | denotes | Total |
T4721 | 14598-14601 | NNP | denotes | RNA |
T4722 | 14602-14605 | VBD | denotes | was |
T4723 | 14606-14615 | VBN | denotes | extracted |
T4724 | 14616-14621 | VBG | denotes | using |
T4725 | 14622-14627 | NN | denotes | lysis |
T4726 | 14628-14634 | NN | denotes | buffer |
T4727 | 14635-14636 | -LRB- | denotes | ( |
T4728 | 14636-14642 | NNP | denotes | RNeasy |
T4729 | 14643-14646 | NN | denotes | kit |
T4730 | 14646-14647 | : | denotes | ; |
T4731 | 14648-14654 | NNP | denotes | Qiagen |
T4732 | 14654-14655 | , | denotes | , |
T4733 | 14656-14663 | NNP | denotes | Crawley |
T4734 | 14663-14664 | , | denotes | , |
T4735 | 14665-14667 | NNP | denotes | UK |
T4736 | 14667-14668 | -RRB- | denotes | ) |
T4737 | 14668-14669 | . | denotes | . |
T4738 | 14670-14676 | IN | denotes | During |
T4739 | 14677-14680 | NNP | denotes | RNA |
T4740 | 14681-14693 | NN | denotes | purification |
T4741 | 14693-14694 | , | denotes | , |
T4742 | 14695-14702 | JJ | denotes | genomic |
T4743 | 14703-14706 | NN | denotes | DNA |
T4744 | 14707-14710 | VBD | denotes | was |
T4745 | 14711-14719 | VBN | denotes | digested |
T4746 | 14720-14724 | IN | denotes | with |
T4747 | 14725-14735 | JJ | denotes | RNase-free |
T4748 | 14736-14741 | NNP | denotes | DNase |
T4749 | 14742-14743 | -LRB- | denotes | ( |
T4750 | 14743-14751 | NNP | denotes | Amersham |
T4751 | 14752-14763 | NNPS | denotes | Biosciences |
T4752 | 14763-14764 | -RRB- | denotes | ) |
T4753 | 14764-14765 | . | denotes | . |
T4754 | 14766-14770 | JJ | denotes | Next |
T4755 | 14770-14771 | , | denotes | , |
T4756 | 14772-14775 | CD | denotes | 0.5 |
T4757 | 14776-14778 | NN | denotes | µg |
T4758 | 14779-14781 | IN | denotes | of |
T4759 | 14782-14787 | JJ | denotes | total |
T4760 | 14788-14791 | NNP | denotes | RNA |
T4761 | 14792-14795 | VBD | denotes | was |
T4762 | 14796-14804 | JJ | denotes | reversed |
T4763 | 14805-14816 | VBN | denotes | transcribed |
T4764 | 14817-14822 | VBG | denotes | using |
T4765 | 14823-14826 | DT | denotes | the |
T4766 | 14827-14832 | JJ | denotes | avian |
T4767 | 14833-14847 | NN | denotes | myeloblastosis |
T4768 | 14848-14853 | NN | denotes | virus |
T4769 | 14854-14856 | NNP | denotes | RT |
T4770 | 14857-14858 | -LRB- | denotes | ( |
T4771 | 14858-14865 | NNP | denotes | Promega |
T4772 | 14865-14866 | , | denotes | , |
T4773 | 14867-14878 | NNP | denotes | Southampton |
T4774 | 14878-14879 | , | denotes | , |
T4775 | 14880-14882 | NNP | denotes | UK |
T4776 | 14882-14883 | -RRB- | denotes | ) |
T4777 | 14883-14884 | . | denotes | . |
T4778 | 14885-14888 | IN | denotes | For |
T4779 | 14889-14897 | JJ | denotes | relative |
T4780 | 14898-14912 | NN | denotes | quantification |
T4781 | 14912-14913 | , | denotes | , |
T4782 | 14914-14920 | NN | denotes | RT-PCR |
T4783 | 14921-14924 | VBD | denotes | was |
T4784 | 14925-14932 | VBN | denotes | carried |
T4785 | 14933-14936 | IN | denotes | out |
T4786 | 14937-14942 | VBG | denotes | using |
T4787 | 14943-14947 | NNP | denotes | cDNA |
T4788 | 14948-14954 | NNS | denotes | probes |
T4789 | 14954-14955 | . | denotes | . |
T4790 | 14956-14963 | NNS | denotes | Primers |
T4791 | 14964-14967 | IN | denotes | for |
T4792 | 14968-14972 | NN | denotes | IL-4 |
T4793 | 14973-14977 | VBD | denotes | were |
T4794 | 14978-14982 | IN | denotes | from |
T4795 | 14983-14996 | NNP | denotes | Sigma-Genosys |
T4796 | 14997-14998 | -LRB- | denotes | ( |
T4797 | 14998-15007 | NNP | denotes | Cambridge |
T4798 | 15007-15008 | , | denotes | , |
T4799 | 15009-15011 | NNP | denotes | UK |
T4800 | 15011-15012 | -RRB- | denotes | ) |
T4801 | 15012-15013 | . | denotes | . |
T4802 | 15014-15023 | NNS | denotes | Sequences |
T4803 | 15024-15026 | IN | denotes | of |
T4804 | 15027-15032 | NNP | denotes | GADPH |
T4805 | 15033-15037 | VBD | denotes | used |
T4806 | 15038-15041 | VBP | denotes | are |
T4807 | 15042-15044 | IN | denotes | as |
T4808 | 15045-15052 | VBZ | denotes | follows |
T4809 | 15052-15053 | : | denotes | : |
T4810 | 15054-15061 | RB | denotes | forward |
T4811 | 15062-15063 | CD | denotes | 5 |
T4812 | 15063-15064 | SYM | denotes | ′ |
T4813 | 15064-15065 | : | denotes | - |
T4814 | 15065-15088 | NNP | denotes | CCACCCATGGCAAATTCCATGGC |
T4815 | 15088-15089 | , | denotes | , |
T4816 | 15090-15097 | VB | denotes | reverse |
T4817 | 15098-15099 | CD | denotes | 3 |
T4818 | 15099-15100 | SYM | denotes | ′ |
T4819 | 15100-15101 | : | denotes | - |
T4820 | 15101-15124 | NNP | denotes | TCTAGACGGCAGGTCAGGTCCAC |
T4821 | 15124-15125 | . | denotes | . |
T5013 | 15127-15131 | NNP | denotes | Cell |
T5014 | 15132-15145 | NNP | denotes | Fractionation |
T5015 | 15145-15146 | , | denotes | , |
T5016 | 15147-15166 | NNP | denotes | Immunoprecipitation |
T5017 | 15166-15167 | , | denotes | , |
T5018 | 15168-15171 | CC | denotes | and |
T5019 | 15172-15179 | JJ | denotes | Western |
T5020 | 15180-15184 | NNP | denotes | Blot |
T5021 | 15185-15193 | NNP | denotes | Analysis |
T5022 | 15194-15201 | NNP | denotes | Nuclear |
T5023 | 15202-15205 | CC | denotes | and |
T5024 | 15206-15217 | JJ | denotes | cytoplasmic |
T5025 | 15218-15227 | NNS | denotes | fractions |
T5026 | 15228-15232 | VBD | denotes | were |
T5027 | 15233-15241 | VBN | denotes | prepared |
T5028 | 15242-15244 | IN | denotes | as |
T5029 | 15245-15255 | RB | denotes | previously |
T5030 | 15256-15265 | VBN | denotes | described |
T5031 | 15266-15267 | NNP | denotes | [ |
T5032 | 15267-15269 | CD | denotes | 35 |
T5033 | 15269-15270 | NNP | denotes | ] |
T5034 | 15270-15271 | . | denotes | . |
T5035 | 15272-15277 | JJ | denotes | Whole |
T5036 | 15278-15282 | NN | denotes | cell |
T5037 | 15283-15290 | NNS | denotes | lysates |
T5038 | 15291-15295 | VBD | denotes | were |
T5039 | 15296-15304 | VBN | denotes | prepared |
T5040 | 15305-15307 | IN | denotes | in |
T5041 | 15308-15313 | NN | denotes | NP-40 |
T5042 | 15314-15319 | NN | denotes | lysis |
T5043 | 15320-15326 | NN | denotes | buffer |
T5044 | 15327-15328 | -LRB- | denotes | ( |
T5045 | 15328-15331 | CD | denotes | 0.5 |
T5046 | 15331-15332 | NN | denotes | % |
T5047 | 15333-15340 | NNP | denotes | Nonidet |
T5048 | 15341-15345 | NNP | denotes | P-40 |
T5049 | 15345-15346 | , | denotes | , |
T5050 | 15347-15349 | CD | denotes | 20 |
T5051 | 15350-15352 | NNP | denotes | mM |
T5052 | 15353-15361 | NNP | denotes | Tris-HCl |
T5053 | 15362-15363 | NNP | denotes | [ |
T5054 | 15363-15365 | NNP | denotes | pH |
T5055 | 15366-15369 | CD | denotes | 7.5 |
T5056 | 15369-15370 | NNP | denotes | ] |
T5057 | 15370-15371 | , | denotes | , |
T5058 | 15372-15375 | CD | denotes | 150 |
T5059 | 15376-15378 | NNP | denotes | mM |
T5060 | 15379-15383 | NNP | denotes | NaCl |
T5061 | 15383-15384 | -RRB- | denotes | ) |
T5062 | 15385-15387 | IN | denotes | in |
T5063 | 15388-15391 | DT | denotes | the |
T5064 | 15392-15400 | NN | denotes | presence |
T5065 | 15401-15403 | IN | denotes | of |
T5066 | 15404-15412 | JJ | denotes | complete |
T5067 | 15413-15421 | NN | denotes | protease |
T5068 | 15422-15430 | NN | denotes | cocktail |
T5069 | 15431-15440 | NN | denotes | inhibitor |
T5070 | 15440-15441 | . | denotes | . |
T5071 | 15442-15449 | NNS | denotes | Lysates |
T5072 | 15450-15454 | VBD | denotes | were |
T5073 | 15455-15466 | VBN | denotes | centrifuged |
T5074 | 15467-15469 | IN | denotes | at |
T5075 | 15470-15471 | CD | denotes | 4 |
T5076 | 15471-15472 | CD | denotes | ° |
T5077 | 15472-15473 | NNP | denotes | C |
T5078 | 15474-15477 | IN | denotes | for |
T5079 | 15478-15480 | CD | denotes | 10 |
T5080 | 15481-15484 | NN | denotes | min |
T5081 | 15485-15487 | IN | denotes | at |
T5082 | 15488-15494 | CD | denotes | 12,000 |
T5083 | 15495-15498 | NN | denotes | rpm |
T5084 | 15499-15501 | IN | denotes | in |
T5085 | 15502-15504 | DT | denotes | an |
T5086 | 15505-15514 | NNP | denotes | Eppendorf |
T5087 | 15515-15530 | NN | denotes | microcentrifuge |
T5088 | 15531-15533 | TO | denotes | to |
T5089 | 15534-15540 | VB | denotes | remove |
T5090 | 15541-15549 | JJ | denotes | cellular |
T5091 | 15550-15556 | NN | denotes | debris |
T5092 | 15556-15557 | . | denotes | . |
T5093 | 15558-15565 | NNS | denotes | Samples |
T5094 | 15566-15570 | VBD | denotes | were |
T5095 | 15571-15575 | RB | denotes | then |
T5096 | 15576-15594 | VBN | denotes | immunoprecipitated |
T5097 | 15595-15599 | IN | denotes | with |
T5098 | 15600-15606 | DT | denotes | either |
T5099 | 15607-15609 | CD | denotes | 10 |
T5100 | 15610-15612 | NN | denotes | µl |
T5101 | 15613-15615 | IN | denotes | of |
T5102 | 15616-15624 | NN | denotes | antibody |
T5103 | 15625-15632 | IN | denotes | against |
T5104 | 15633-15639 | NNP | denotes | GATA-3 |
T5105 | 15640-15642 | CC | denotes | or |
T5106 | 15643-15653 | JJ | denotes | importin-α |
T5107 | 15654-15659 | VBG | denotes | using |
T5108 | 15660-15663 | NNP | denotes | A/G |
T5109 | 15664-15671 | JJ | denotes | agarose |
T5110 | 15672-15678 | NN | denotes | slurry |
T5111 | 15679-15681 | IN | denotes | in |
T5112 | 15682-15685 | DT | denotes | the |
T5113 | 15686-15694 | NN | denotes | presence |
T5114 | 15695-15697 | IN | denotes | of |
T5115 | 15698-15706 | NN | denotes | protease |
T5116 | 15707-15716 | NN | denotes | inhibitor |
T5117 | 15717-15722 | VBG | denotes | using |
T5118 | 15723-15726 | DT | denotes | the |
T5119 | 15727-15732 | NNP | denotes | Catch |
T5120 | 15733-15736 | CC | denotes | and |
T5121 | 15737-15744 | NNP | denotes | Release |
T5122 | 15745-15756 | NN | denotes | methodology |
T5123 | 15757-15758 | -LRB- | denotes | ( |
T5124 | 15758-15765 | NNP | denotes | Upstate |
T5125 | 15766-15779 | NNP | denotes | Biotechnology |
T5126 | 15779-15780 | , | denotes | , |
T5127 | 15781-15785 | NNP | denotes | Lake |
T5128 | 15786-15792 | NNP | denotes | Placid |
T5129 | 15792-15793 | , | denotes | , |
T5130 | 15794-15797 | NNP | denotes | New |
T5131 | 15798-15802 | NNP | denotes | York |
T5132 | 15802-15803 | , | denotes | , |
T5133 | 15804-15807 | NNP | denotes | USA |
T5134 | 15807-15808 | -RRB- | denotes | ) |
T5135 | 15808-15809 | . | denotes | . |
T5136 | 15810-15817 | JJ | denotes | Western |
T5137 | 15818-15822 | NN | denotes | blot |
T5138 | 15823-15831 | NN | denotes | analysis |
T5139 | 15832-15835 | VBD | denotes | was |
T5140 | 15836-15845 | VBN | denotes | performed |
T5141 | 15846-15851 | VBG | denotes | using |
T5142 | 15852-15863 | JJ | denotes | anti-GATA-3 |
T5143 | 15863-15864 | , | denotes | , |
T5144 | 15865-15880 | JJ | denotes | anti-importin-α |
T5145 | 15880-15881 | , | denotes | , |
T5146 | 15882-15889 | JJ | denotes | anti-GR |
T5147 | 15889-15890 | , | denotes | , |
T5148 | 15891-15901 | JJ | denotes | anti-p-p38 |
T5149 | 15902-15905 | NNP | denotes | MAP |
T5150 | 15906-15912 | NN | denotes | kinase |
T5151 | 15912-15913 | , | denotes | , |
T5152 | 15914-15926 | JJ | denotes | anti-p-ATF-2 |
T5153 | 15926-15927 | , | denotes | , |
T5154 | 15928-15931 | CC | denotes | and |
T5155 | 15932-15945 | JJ | denotes | anti-p-serine |
T5156 | 15945-15946 | . | denotes | . |
T5157 | 15947-15961 | JJ | denotes | Immunoreactive |
T5158 | 15962-15970 | NNS | denotes | proteins |
T5159 | 15971-15975 | VBD | denotes | were |
T5160 | 15976-15984 | VBN | denotes | detected |
T5161 | 15985-15990 | VBG | denotes | using |
T5162 | 15991-15993 | DT | denotes | an |
T5163 | 15994-16002 | JJ | denotes | enhanced |
T5164 | 16003-16020 | NN | denotes | chemiluminescence |
T5165 | 16021-16024 | NNP | denotes | ECL |
T5166 | 16025-16028 | NN | denotes | kit |
T5167 | 16029-16030 | -LRB- | denotes | ( |
T5168 | 16030-16038 | NNP | denotes | Amersham |
T5169 | 16039-16050 | NNPS | denotes | Biosciences |
T5170 | 16050-16051 | -RRB- | denotes | ) |
T5171 | 16051-16052 | . | denotes | . |
T5318 | 16054-16063 | NNP | denotes | Chromatin |
T5319 | 16064-16083 | NNP | denotes | Immunoprecipitation |
T5320 | 16084-16093 | NNP | denotes | Chromatin |
T5321 | 16094-16113 | NN | denotes | immunoprecipitation |
T5322 | 16114-16115 | -LRB- | denotes | ( |
T5323 | 16115-16117 | NNP | denotes | IP |
T5324 | 16117-16118 | -RRB- | denotes | ) |
T5325 | 16119-16122 | VBD | denotes | was |
T5326 | 16123-16132 | VBN | denotes | performed |
T5327 | 16133-16135 | IN | denotes | as |
T5328 | 16136-16146 | RB | denotes | previously |
T5329 | 16147-16156 | VBN | denotes | described |
T5330 | 16157-16158 | NNP | denotes | [ |
T5331 | 16158-16160 | CD | denotes | 12 |
T5332 | 16160-16161 | NNP | denotes | ] |
T5333 | 16162-16164 | IN | denotes | in |
T5334 | 16165-16171 | NNP | denotes | HuT-78 |
T5335 | 16172-16179 | NNS | denotes | T-cells |
T5336 | 16180-16184 | IN | denotes | with |
T5337 | 16185-16186 | CD | denotes | 2 |
T5338 | 16187-16189 | NN | denotes | µg |
T5339 | 16190-16192 | IN | denotes | of |
T5340 | 16193-16204 | JJ | denotes | anti-GATA-3 |
T5341 | 16205-16206 | -LRB- | denotes | ( |
T5342 | 16206-16211 | NNP | denotes | Santa |
T5343 | 16212-16216 | NNP | denotes | Cruz |
T5344 | 16217-16230 | NNP | denotes | Biotechnology |
T5345 | 16230-16231 | -RRB- | denotes | ) |
T5346 | 16231-16232 | , | denotes | , |
T5347 | 16233-16235 | CC | denotes | or |
T5348 | 16236-16244 | JJ | denotes | isotypic |
T5349 | 16245-16259 | NN | denotes | immunoglobulin |
T5350 | 16260-16261 | NNP | denotes | G |
T5351 | 16262-16264 | IN | denotes | as |
T5352 | 16265-16266 | DT | denotes | a |
T5353 | 16267-16279 | JJ | denotes | non-specific |
T5354 | 16280-16287 | NN | denotes | control |
T5355 | 16288-16289 | -LRB- | denotes | ( |
T5356 | 16289-16294 | NNP | denotes | Santa |
T5357 | 16295-16299 | NNP | denotes | Cruz |
T5358 | 16300-16313 | NNP | denotes | Biotechnology |
T5359 | 16313-16314 | -RRB- | denotes | ) |
T5360 | 16315-16324 | RB | denotes | overnight |
T5361 | 16325-16327 | IN | denotes | at |
T5362 | 16328-16329 | CD | denotes | 4 |
T5363 | 16329-16330 | CD | denotes | ° |
T5364 | 16330-16332 | NNP | denotes | C. |
T5365 | 16333-16341 | NNP | denotes | Promoter |
T5366 | 16342-16351 | NNS | denotes | sequences |
T5367 | 16352-16356 | VBD | denotes | were |
T5368 | 16357-16365 | VBN | denotes | detected |
T5369 | 16366-16370 | IN | denotes | with |
T5370 | 16371-16374 | NNP | denotes | PCR |
T5371 | 16375-16382 | NNS | denotes | primers |
T5372 | 16383-16386 | IN | denotes | for |
T5373 | 16387-16390 | DT | denotes | the |
T5374 | 16391-16395 | NN | denotes | IL-5 |
T5375 | 16396-16404 | NN | denotes | promoter |
T5376 | 16405-16406 | -LRB- | denotes | ( |
T5377 | 16406-16407 | FW | denotes | − |
T5378 | 16407-16410 | CD | denotes | 445 |
T5379 | 16411-16413 | TO | denotes | to |
T5380 | 16414-16416 | CD | denotes | +4 |
T5381 | 16416-16417 | -RRB- | denotes | ) |
T5382 | 16417-16418 | : | denotes | : |
T5383 | 16419-16426 | RB | denotes | forward |
T5384 | 16427-16428 | CD | denotes | 5 |
T5385 | 16428-16429 | SYM | denotes | ′ |
T5386 | 16429-16430 | : | denotes | - |
T5387 | 16430-16453 | NN | denotes | TTAATCTAGCCACAGTCATAG-3 |
T5388 | 16453-16454 | NN | denotes | ′ |
T5389 | 16455-16458 | CC | denotes | and |
T5390 | 16459-16466 | NN | denotes | reverse |
T5391 | 16466-16467 | : | denotes | : |
T5392 | 16468-16469 | CD | denotes | 5 |
T5393 | 16469-16470 | SYM | denotes | ′ |
T5394 | 16470-16471 | : | denotes | - |
T5395 | 16471-16494 | NN | denotes | TCATGGCTCTGAAACGTTCTG-3 |
T5396 | 16494-16495 | NN | denotes | ′ |
T5397 | 16495-16496 | . | denotes | . |
T5398 | 16497-16500 | NNP | denotes | PCR |
T5399 | 16501-16504 | VBD | denotes | was |
T5400 | 16505-16514 | VBN | denotes | performed |
T5401 | 16515-16520 | VBG | denotes | using |
T5402 | 16521-16522 | DT | denotes | a |
T5403 | 16523-16529 | NNP | denotes | Hybaid |
T5404 | 16530-16538 | NNP | denotes | Omnigene |
T5405 | 16539-16546 | JJ | denotes | thermal |
T5406 | 16547-16553 | NN | denotes | cycler |
T5407 | 16554-16555 | -LRB- | denotes | ( |
T5408 | 16555-16561 | NNP | denotes | Hybaid |
T5409 | 16561-16562 | , | denotes | , |
T5410 | 16563-16570 | NNP | denotes | Ashford |
T5411 | 16570-16571 | , | denotes | , |
T5412 | 16572-16574 | NNP | denotes | UK |
T5413 | 16574-16575 | -RRB- | denotes | ) |
T5414 | 16576-16580 | IN | denotes | with |
T5415 | 16581-16588 | NN | denotes | cycling |
T5416 | 16589-16599 | NNS | denotes | parameters |
T5417 | 16600-16602 | IN | denotes | of |
T5418 | 16603-16605 | CD | denotes | 72 |
T5419 | 16605-16606 | CD | denotes | ° |
T5420 | 16606-16607 | NNP | denotes | C |
T5421 | 16608-16611 | IN | denotes | for |
T5422 | 16612-16614 | CD | denotes | 10 |
T5423 | 16615-16618 | NN | denotes | min |
T5424 | 16618-16619 | , | denotes | , |
T5425 | 16620-16622 | CD | denotes | 35 |
T5426 | 16623-16629 | NNS | denotes | cycles |
T5427 | 16630-16632 | IN | denotes | at |
T5428 | 16633-16635 | CD | denotes | 94 |
T5429 | 16635-16636 | CD | denotes | ° |
T5430 | 16636-16637 | NNP | denotes | C |
T5431 | 16638-16641 | IN | denotes | for |
T5432 | 16642-16644 | CD | denotes | 45 |
T5433 | 16645-16646 | PRP | denotes | s |
T5434 | 16646-16647 | , | denotes | , |
T5435 | 16648-16650 | CD | denotes | 52 |
T5436 | 16650-16651 | NN | denotes | ° |
T5437 | 16651-16652 | NNP | denotes | C |
T5438 | 16653-16656 | IN | denotes | for |
T5439 | 16657-16659 | CD | denotes | 45 |
T5440 | 16660-16661 | PRP | denotes | s |
T5441 | 16661-16662 | , | denotes | , |
T5442 | 16663-16665 | CD | denotes | 72 |
T5443 | 16665-16666 | NN | denotes | ° |
T5444 | 16666-16667 | NNP | denotes | C |
T5445 | 16668-16671 | IN | denotes | for |
T5446 | 16672-16674 | CD | denotes | 45 |
T5447 | 16675-16677 | NN | denotes | s. |
T5754 | 16679-16688 | CD | denotes | GR-GATA-3 |
T5755 | 16689-16691 | IN | denotes | In |
T5756 | 16692-16697 | NNP | denotes | Vitro |
T5757 | 16698-16709 | NNP | denotes | Competition |
T5758 | 16710-16715 | NNP | denotes | Assay |
T5759 | 16716-16719 | IN | denotes | for |
T5760 | 16720-16730 | NNP | denotes | Importin-α |
T5761 | 16731-16732 | -LRB- | denotes | ( |
T5762 | 16732-16743 | NNP | denotes | Far-Western |
T5763 | 16744-16749 | NNP | denotes | ELISA |
T5764 | 16749-16750 | -RRB- | denotes | ) |
T5765 | 16751-16769 | NNP | denotes | Immunoprecipitated |
T5766 | 16770-16780 | NN | denotes | importin-α |
T5767 | 16781-16782 | -LRB- | denotes | ( |
T5768 | 16782-16797 | JJ | denotes | anti-importin-α |
T5769 | 16797-16798 | , | denotes | , |
T5770 | 16799-16804 | NNP | denotes | Santa |
T5771 | 16805-16809 | NNP | denotes | Cruz |
T5772 | 16810-16823 | NNP | denotes | Biotechnology |
T5773 | 16823-16824 | -RRB- | denotes | ) |
T5774 | 16825-16829 | IN | denotes | from |
T5775 | 16830-16836 | JJ | denotes | HuT-78 |
T5776 | 16837-16842 | NNS | denotes | cells |
T5777 | 16843-16846 | VBD | denotes | was |
T5778 | 16847-16856 | VBN | denotes | separated |
T5779 | 16857-16859 | IN | denotes | by |
T5780 | 16860-16868 | NNP | denotes | SDS-PAGE |
T5781 | 16869-16872 | CC | denotes | and |
T5782 | 16873-16881 | VBN | denotes | purified |
T5783 | 16882-16886 | IN | denotes | from |
T5784 | 16887-16890 | DT | denotes | the |
T5785 | 16891-16898 | VBN | denotes | excised |
T5786 | 16899-16902 | NN | denotes | gel |
T5787 | 16903-16905 | IN | denotes | by |
T5788 | 16906-16920 | NN | denotes | electroelution |
T5789 | 16921-16922 | NNP | denotes | [ |
T5790 | 16922-16924 | CD | denotes | 36 |
T5791 | 16924-16925 | NNP | denotes | ] |
T5792 | 16925-16926 | . | denotes | . |
T5793 | 16927-16936 | RB | denotes | Similarly |
T5794 | 16936-16937 | , | denotes | , |
T5795 | 16938-16944 | NN | denotes | GATA-3 |
T5796 | 16945-16948 | VBD | denotes | was |
T5797 | 16949-16957 | VBN | denotes | isolated |
T5798 | 16958-16962 | IN | denotes | from |
T5799 | 16963-16976 | JJ | denotes | nonstimulated |
T5800 | 16977-16983 | JJ | denotes | HuT-78 |
T5801 | 16984-16989 | NNS | denotes | cells |
T5802 | 16990-16992 | CC | denotes | or |
T5803 | 16993-16998 | NNS | denotes | cells |
T5804 | 16999-17009 | VBD | denotes | stimulated |
T5805 | 17010-17013 | IN | denotes | for |
T5806 | 17014-17016 | CD | denotes | 30 |
T5807 | 17017-17020 | NN | denotes | min |
T5808 | 17021-17025 | IN | denotes | with |
T5809 | 17026-17034 | JJ | denotes | anti-CD3 |
T5810 | 17034-17035 | NN | denotes | / |
T5811 | 17035-17039 | CD | denotes | CD28 |
T5812 | 17040-17043 | CC | denotes | and |
T5813 | 17044-17046 | NNP | denotes | GR |
T5814 | 17047-17050 | VBD | denotes | was |
T5815 | 17051-17059 | VBN | denotes | isolated |
T5816 | 17060-17064 | IN | denotes | from |
T5817 | 17065-17067 | NNP | denotes | FP |
T5818 | 17068-17069 | -LRB- | denotes | ( |
T5819 | 17069-17071 | CD | denotes | 10 |
T5820 | 17071-17072 | NN | denotes | − |
T5821 | 17072-17073 | CD | denotes | 8 |
T5822 | 17074-17075 | NNP | denotes | M |
T5823 | 17075-17076 | , | denotes | , |
T5824 | 17077-17079 | CD | denotes | 30 |
T5825 | 17080-17083 | NN | denotes | min |
T5826 | 17083-17084 | -RRB- | denotes | ) |
T5827 | 17085-17095 | VBD | denotes | stimulated |
T5828 | 17096-17102 | JJ | denotes | HuT-78 |
T5829 | 17103-17108 | NNS | denotes | cells |
T5830 | 17108-17109 | . | denotes | . |
T5831 | 17110-17115 | DT | denotes | These |
T5832 | 17116-17124 | NNS | denotes | proteins |
T5833 | 17125-17129 | VBD | denotes | were |
T5834 | 17130-17142 | RB | denotes | subsequently |
T5835 | 17143-17151 | VBN | denotes | refolded |
T5836 | 17152-17154 | IN | denotes | in |
T5837 | 17155-17162 | NN | denotes | glycine |
T5838 | 17163-17171 | NN | denotes | solution |
T5839 | 17171-17172 | . | denotes | . |
T5840 | 17173-17176 | CD | denotes | 100 |
T5841 | 17177-17179 | NN | denotes | µl |
T5842 | 17180-17182 | IN | denotes | of |
T5843 | 17183-17193 | JJ | denotes | importin-α |
T5844 | 17194-17202 | NN | denotes | solution |
T5845 | 17203-17204 | -LRB- | denotes | ( |
T5846 | 17204-17207 | CD | denotes | 100 |
T5847 | 17208-17213 | NN | denotes | ng/ml |
T5848 | 17214-17216 | IN | denotes | in |
T5849 | 17217-17220 | NNP | denotes | TBS |
T5850 | 17220-17221 | -RRB- | denotes | ) |
T5851 | 17222-17225 | VBD | denotes | was |
T5852 | 17226-17231 | VBN | denotes | added |
T5853 | 17232-17234 | TO | denotes | to |
T5854 | 17235-17242 | JJ | denotes | 96-well |
T5855 | 17243-17249 | NNS | denotes | plates |
T5856 | 17250-17256 | VBN | denotes | coated |
T5857 | 17257-17261 | IN | denotes | with |
T5858 | 17262-17266 | NN | denotes | goat |
T5859 | 17267-17282 | JJ | denotes | anti-importin-α |
T5860 | 17283-17291 | NN | denotes | antibody |
T5861 | 17291-17292 | . | denotes | . |
T5862 | 17293-17298 | IN | denotes | After |
T5863 | 17299-17300 | CD | denotes | 1 |
T5864 | 17301-17302 | NN | denotes | h |
T5865 | 17303-17313 | NN | denotes | incubation |
T5866 | 17313-17314 | , | denotes | , |
T5867 | 17315-17321 | NNP | denotes | GATA-3 |
T5868 | 17322-17323 | -LRB- | denotes | ( |
T5869 | 17323-17326 | CD | denotes | 100 |
T5870 | 17327-17332 | NN | denotes | ng/ml |
T5871 | 17333-17335 | IN | denotes | in |
T5872 | 17336-17339 | NNP | denotes | TBS |
T5873 | 17339-17340 | -RRB- | denotes | ) |
T5874 | 17341-17345 | IN | denotes | from |
T5875 | 17346-17356 | VBN | denotes | stimulated |
T5876 | 17357-17359 | CC | denotes | or |
T5877 | 17360-17372 | JJ | denotes | unstimulated |
T5878 | 17373-17378 | NNS | denotes | cells |
T5879 | 17379-17383 | VBD | denotes | were |
T5880 | 17384-17389 | VBN | denotes | added |
T5881 | 17390-17392 | TO | denotes | to |
T5882 | 17393-17396 | DT | denotes | the |
T5883 | 17397-17414 | JJ | denotes | importin-α-coated |
T5884 | 17415-17420 | NNS | denotes | wells |
T5885 | 17420-17421 | . | denotes | . |
T5886 | 17422-17424 | NNP | denotes | GR |
T5887 | 17425-17426 | -LRB- | denotes | ( |
T5888 | 17426-17428 | CD | denotes | 10 |
T5889 | 17429-17431 | CC | denotes | or |
T5890 | 17432-17435 | CD | denotes | 100 |
T5891 | 17436-17441 | NN | denotes | ng/ml |
T5892 | 17442-17444 | IN | denotes | in |
T5893 | 17445-17448 | NNP | denotes | TBS |
T5894 | 17448-17449 | -RRB- | denotes | ) |
T5895 | 17450-17454 | IN | denotes | from |
T5896 | 17455-17465 | VBN | denotes | stimulated |
T5897 | 17466-17468 | CC | denotes | or |
T5898 | 17469-17481 | JJ | denotes | unstimulated |
T5899 | 17482-17487 | NNS | denotes | cells |
T5900 | 17488-17492 | VBD | denotes | were |
T5901 | 17493-17498 | VBN | denotes | added |
T5902 | 17499-17501 | TO | denotes | to |
T5903 | 17502-17506 | DT | denotes | some |
T5904 | 17507-17512 | NNS | denotes | wells |
T5905 | 17512-17513 | . | denotes | . |
T5906 | 17514-17519 | IN | denotes | After |
T5907 | 17520-17521 | DT | denotes | a |
T5908 | 17522-17529 | JJ | denotes | further |
T5909 | 17530-17531 | CD | denotes | 1 |
T5910 | 17532-17533 | NN | denotes | h |
T5911 | 17534-17544 | NN | denotes | incubation |
T5912 | 17544-17545 | , | denotes | , |
T5913 | 17546-17549 | DT | denotes | the |
T5914 | 17550-17555 | NN | denotes | plate |
T5915 | 17556-17559 | VBD | denotes | was |
T5916 | 17560-17566 | VBN | denotes | washed |
T5917 | 17567-17570 | CC | denotes | and |
T5918 | 17571-17580 | VBN | denotes | incubated |
T5919 | 17581-17585 | IN | denotes | with |
T5920 | 17586-17593 | JJ | denotes | primary |
T5921 | 17594-17604 | NNS | denotes | antibodies |
T5922 | 17605-17606 | -LRB- | denotes | ( |
T5923 | 17606-17607 | DT | denotes | a |
T5924 | 17608-17615 | NN | denotes | mixture |
T5925 | 17616-17618 | IN | denotes | of |
T5926 | 17619-17625 | NN | denotes | rabbit |
T5927 | 17626-17637 | JJ | denotes | anti-GATA-3 |
T5928 | 17638-17641 | CC | denotes | and |
T5929 | 17642-17647 | NN | denotes | mouse |
T5930 | 17648-17655 | JJ | denotes | anti-GR |
T5931 | 17655-17656 | , | denotes | , |
T5932 | 17657-17662 | NNP | denotes | Santa |
T5933 | 17663-17667 | NNP | denotes | Cruz |
T5934 | 17668-17681 | NNP | denotes | Biotechnology |
T5935 | 17681-17682 | -RRB- | denotes | ) |
T5936 | 17683-17686 | IN | denotes | for |
T5937 | 17687-17690 | CD | denotes | 1.5 |
T5938 | 17691-17692 | NN | denotes | h |
T5939 | 17692-17693 | , | denotes | , |
T5940 | 17694-17697 | CC | denotes | and |
T5941 | 17698-17702 | RB | denotes | then |
T5942 | 17703-17712 | VBN | denotes | incubated |
T5943 | 17713-17717 | IN | denotes | with |
T5944 | 17718-17727 | JJ | denotes | secondary |
T5945 | 17728-17738 | NNS | denotes | antibodies |
T5946 | 17738-17739 | . | denotes | . |
T5947 | 17740-17744 | CD | denotes | FITC |
T5948 | 17745-17750 | NNS | denotes | swine |
T5949 | 17751-17762 | JJ | denotes | anti-rabbit |
T5950 | 17763-17766 | NNP | denotes | IgG |
T5951 | 17767-17768 | -LRB- | denotes | ( |
T5952 | 17768-17772 | NNP | denotes | Dako |
T5953 | 17772-17773 | , | denotes | , |
T5954 | 17774-17783 | NNP | denotes | Cambridge |
T5955 | 17783-17784 | , | denotes | , |
T5956 | 17785-17787 | NNP | denotes | UK |
T5957 | 17787-17788 | -RRB- | denotes | ) |
T5958 | 17789-17792 | VBD | denotes | was |
T5959 | 17793-17797 | VBN | denotes | used |
T5960 | 17798-17801 | IN | denotes | for |
T5961 | 17802-17805 | DT | denotes | the |
T5962 | 17806-17815 | NN | denotes | detection |
T5963 | 17816-17818 | IN | denotes | of |
T5964 | 17819-17825 | NNP | denotes | GATA-3 |
T5965 | 17825-17826 | , | denotes | , |
T5966 | 17827-17830 | CC | denotes | and |
T5967 | 17831-17840 | JJ | denotes | rhodamine |
T5968 | 17841-17847 | NN | denotes | donkey |
T5969 | 17848-17858 | JJ | denotes | anti-mouse |
T5970 | 17859-17862 | NNP | denotes | IgG |
T5971 | 17863-17864 | -LRB- | denotes | ( |
T5972 | 17864-17869 | NNP | denotes | Novus |
T5973 | 17869-17870 | , | denotes | , |
T5974 | 17871-17880 | NNP | denotes | Littleton |
T5975 | 17880-17881 | , | denotes | , |
T5976 | 17882-17890 | NNP | denotes | Colorado |
T5977 | 17890-17891 | , | denotes | , |
T5978 | 17892-17895 | NNP | denotes | USA |
T5979 | 17895-17896 | -RRB- | denotes | ) |
T5980 | 17897-17900 | VBD | denotes | was |
T5981 | 17901-17905 | VBN | denotes | used |
T5982 | 17906-17909 | IN | denotes | for |
T5983 | 17910-17913 | DT | denotes | the |
T5984 | 17914-17923 | NN | denotes | detection |
T5985 | 17924-17926 | IN | denotes | of |
T5986 | 17927-17929 | NNP | denotes | GR |
T5987 | 17929-17930 | . | denotes | . |
T5988 | 17931-17935 | NNP | denotes | FITC |
T5989 | 17936-17939 | CC | denotes | and |
T5990 | 17940-17949 | JJ | denotes | rhodamine |
T5991 | 17950-17956 | NNS | denotes | levels |
T5992 | 17957-17961 | VBD | denotes | were |
T5993 | 17962-17970 | VBN | denotes | measured |
T5994 | 17971-17975 | IN | denotes | with |
T5995 | 17976-17977 | DT | denotes | a |
T5996 | 17978-17989 | JJ | denotes | fluorescent |
T5997 | 17990-18001 | JJ | denotes | micro-plate |
T5998 | 18002-18008 | NN | denotes | reader |
T5999 | 18009-18010 | -LRB- | denotes | ( |
T6000 | 18010-18017 | NNP | denotes | Bioline |
T6001 | 18017-18018 | , | denotes | , |
T6002 | 18019-18025 | NNP | denotes | London |
T6003 | 18025-18026 | , | denotes | , |
T6004 | 18027-18029 | NNP | denotes | UK |
T6005 | 18029-18030 | -RRB- | denotes | ) |
T6006 | 18030-18031 | . | denotes | . |
T6161 | 18033-18038 | NNP | denotes | NF-κB |
T6162 | 18039-18049 | NNP | denotes | Activation |
T6163 | 18050-18055 | NNP | denotes | NF-κB |
T6164 | 18056-18063 | JJ | denotes | binding |
T6165 | 18064-18072 | NN | denotes | activity |
T6166 | 18073-18075 | IN | denotes | in |
T6167 | 18076-18083 | JJ | denotes | nuclear |
T6168 | 18084-18092 | NNS | denotes | extracts |
T6169 | 18093-18096 | VBD | denotes | was |
T6170 | 18097-18107 | VBN | denotes | determined |
T6171 | 18108-18113 | VBG | denotes | using |
T6172 | 18114-18116 | DT | denotes | an |
T6173 | 18117-18128 | JJ | denotes | ELISA-based |
T6174 | 18129-18132 | NN | denotes | kit |
T6175 | 18133-18134 | -LRB- | denotes | ( |
T6176 | 18134-18142 | JJ | denotes | Trans-AM |
T6177 | 18143-18146 | NNS | denotes | p65 |
T6178 | 18146-18147 | , | denotes | , |
T6179 | 18148-18154 | NNP | denotes | Active |
T6180 | 18155-18160 | NNP | denotes | Motif |
T6181 | 18160-18161 | , | denotes | , |
T6182 | 18162-18171 | NNP | denotes | Rixensart |
T6183 | 18171-18172 | , | denotes | , |
T6184 | 18173-18180 | NNP | denotes | Belgium |
T6185 | 18180-18181 | -RRB- | denotes | ) |
T6186 | 18181-18182 | . | denotes | . |
T6187 | 18183-18185 | IN | denotes | In |
T6188 | 18186-18191 | NN | denotes | brief |
T6189 | 18191-18192 | , | denotes | , |
T6190 | 18193-18194 | CD | denotes | 5 |
T6191 | 18195-18197 | NN | denotes | µg |
T6192 | 18198-18200 | IN | denotes | of |
T6193 | 18201-18208 | JJ | denotes | nuclear |
T6194 | 18209-18217 | NNS | denotes | extracts |
T6195 | 18218-18222 | VBD | denotes | were |
T6196 | 18223-18232 | VBN | denotes | incubated |
T6197 | 18233-18237 | IN | denotes | with |
T6198 | 18238-18239 | DT | denotes | a |
T6199 | 18240-18245 | NN | denotes | plate |
T6200 | 18246-18252 | VBN | denotes | coated |
T6201 | 18253-18257 | IN | denotes | with |
T6202 | 18258-18260 | DT | denotes | an |
T6203 | 18261-18266 | JJ | denotes | NF-κB |
T6204 | 18267-18276 | NN | denotes | consensus |
T6205 | 18277-18292 | NN | denotes | oligonucleotide |
T6206 | 18292-18293 | . | denotes | . |
T6207 | 18294-18300 | NNS | denotes | Plates |
T6208 | 18301-18305 | VBD | denotes | were |
T6209 | 18306-18312 | VBN | denotes | washed |
T6210 | 18313-18319 | IN | denotes | before |
T6211 | 18320-18328 | NN | denotes | addition |
T6212 | 18329-18331 | IN | denotes | of |
T6213 | 18332-18334 | DT | denotes | an |
T6214 | 18335-18343 | JJ | denotes | anti-p65 |
T6215 | 18344-18352 | NN | denotes | antibody |
T6216 | 18352-18353 | . | denotes | . |
T6217 | 18354-18362 | NN | denotes | Antibody |
T6218 | 18363-18370 | JJ | denotes | binding |
T6219 | 18371-18374 | VBD | denotes | was |
T6220 | 18375-18383 | VBN | denotes | detected |
T6221 | 18384-18388 | IN | denotes | with |
T6222 | 18389-18390 | DT | denotes | a |
T6223 | 18391-18400 | JJ | denotes | secondary |
T6224 | 18401-18415 | JJ | denotes | HRP-conjugated |
T6225 | 18416-18424 | NN | denotes | antibody |
T6226 | 18425-18428 | CC | denotes | and |
T6227 | 18429-18438 | VBN | denotes | developed |
T6228 | 18439-18443 | IN | denotes | with |
T6229 | 18444-18447 | NNP | denotes | TMB |
T6230 | 18448-18457 | NN | denotes | substrate |
T6231 | 18457-18458 | . | denotes | . |
T6232 | 18459-18462 | DT | denotes | The |
T6233 | 18463-18472 | NN | denotes | intensity |
T6234 | 18473-18475 | IN | denotes | of |
T6235 | 18476-18479 | DT | denotes | the |
T6236 | 18480-18488 | NN | denotes | reaction |
T6237 | 18489-18492 | VBD | denotes | was |
T6238 | 18493-18501 | VBN | denotes | measured |
T6239 | 18502-18504 | IN | denotes | at |
T6240 | 18505-18508 | CD | denotes | 450 |
T6241 | 18509-18511 | NN | denotes | nm |
T6242 | 18511-18512 | . | denotes | . |
T6486 | 18514-18532 | NNP | denotes | Immunofluorescence |
T6487 | 18533-18541 | NNP | denotes | Staining |
T6488 | 18542-18560 | NNP | denotes | Immunofluorescence |
T6489 | 18561-18569 | VBG | denotes | staining |
T6490 | 18570-18573 | VBD | denotes | was |
T6491 | 18574-18583 | VBN | denotes | performed |
T6492 | 18584-18586 | IN | denotes | as |
T6493 | 18587-18597 | RB | denotes | previously |
T6494 | 18598-18607 | VBN | denotes | described |
T6495 | 18608-18609 | NNP | denotes | [ |
T6496 | 18609-18611 | CD | denotes | 34 |
T6497 | 18611-18612 | NNP | denotes | ] |
T6498 | 18612-18613 | . | denotes | . |
T6499 | 18614-18617 | DT | denotes | All |
T6500 | 18618-18626 | VBG | denotes | staining |
T6501 | 18627-18630 | VBD | denotes | was |
T6502 | 18631-18640 | VBN | denotes | performed |
T6503 | 18641-18643 | IN | denotes | at |
T6504 | 18644-18648 | NN | denotes | room |
T6505 | 18649-18660 | NN | denotes | temperature |
T6506 | 18661-18664 | CC | denotes | and |
T6507 | 18665-18670 | IN | denotes | under |
T6508 | 18671-18685 | NN | denotes | humidification |
T6509 | 18685-18686 | . | denotes | . |
T6510 | 18687-18692 | NNS | denotes | Cells |
T6511 | 18693-18697 | VBD | denotes | were |
T6512 | 18698-18707 | VBN | denotes | collected |
T6513 | 18708-18711 | CC | denotes | and |
T6514 | 18712-18721 | NNS | denotes | cytospins |
T6515 | 18722-18730 | VBN | denotes | prepared |
T6516 | 18731-18733 | IN | denotes | in |
T6517 | 18734-18735 | DT | denotes | a |
T6518 | 18736-18750 | NN | denotes | cytocentrifuge |
T6519 | 18751-18752 | -LRB- | denotes | ( |
T6520 | 18752-18759 | NNP | denotes | Shandon |
T6521 | 18760-18762 | NNP | denotes | II |
T6522 | 18762-18763 | , | denotes | , |
T6523 | 18764-18771 | NNP | denotes | Shandon |
T6524 | 18771-18772 | , | denotes | , |
T6525 | 18773-18780 | NNP | denotes | Runcorn |
T6526 | 18780-18781 | , | denotes | , |
T6527 | 18782-18784 | NNP | denotes | UK |
T6528 | 18784-18785 | -RRB- | denotes | ) |
T6529 | 18785-18786 | . | denotes | . |
T6530 | 18787-18792 | NNS | denotes | Cells |
T6531 | 18793-18797 | VBD | denotes | were |
T6532 | 18798-18811 | VBN | denotes | permeabilized |
T6533 | 18811-18812 | , | denotes | , |
T6534 | 18813-18820 | VBN | denotes | blocked |
T6535 | 18820-18821 | , | denotes | , |
T6536 | 18822-18825 | CC | denotes | and |
T6537 | 18826-18830 | RB | denotes | then |
T6538 | 18831-18840 | VBN | denotes | incubated |
T6539 | 18841-18845 | IN | denotes | with |
T6540 | 18846-18848 | NNP | denotes | GR |
T6541 | 18849-18850 | -LRB- | denotes | ( |
T6542 | 18850-18851 | CD | denotes | 1 |
T6543 | 18851-18852 | CD | denotes | ∶ |
T6544 | 18852-18854 | CD | denotes | 50 |
T6545 | 18855-18859 | NN | denotes | E-20 |
T6546 | 18860-18865 | NNP | denotes | Santa |
T6547 | 18866-18870 | NNP | denotes | Cruz |
T6548 | 18871-18884 | NNP | denotes | Biotechnology |
T6549 | 18884-18885 | -RRB- | denotes | ) |
T6550 | 18886-18888 | CC | denotes | or |
T6551 | 18889-18900 | JJ | denotes | anti-GATA-3 |
T6552 | 18901-18902 | -LRB- | denotes | ( |
T6553 | 18902-18906 | JJ | denotes | H-48 |
T6554 | 18906-18907 | : | denotes | ; |
T6555 | 18908-18913 | NNP | denotes | Santa |
T6556 | 18914-18918 | NNP | denotes | Cruz |
T6557 | 18919-18932 | NNP | denotes | Biotechnology |
T6558 | 18932-18933 | -RRB- | denotes | ) |
T6559 | 18934-18942 | NN | denotes | antibody |
T6560 | 18943-18946 | IN | denotes | for |
T6561 | 18947-18948 | CD | denotes | 1 |
T6562 | 18949-18950 | NN | denotes | h |
T6563 | 18951-18953 | IN | denotes | at |
T6564 | 18954-18958 | NN | denotes | room |
T6565 | 18959-18970 | NN | denotes | temperature |
T6566 | 18970-18971 | . | denotes | . |
T6567 | 18972-18977 | IN | denotes | After |
T6568 | 18978-18983 | CD | denotes | three |
T6569 | 18984-18990 | NNS | denotes | washes |
T6570 | 18991-18993 | IN | denotes | in |
T6571 | 18994-19012 | JJ | denotes | phosphate-buffered |
T6572 | 19013-19019 | NN | denotes | saline |
T6573 | 19020-19021 | -LRB- | denotes | ( |
T6574 | 19021-19024 | NNP | denotes | PBS |
T6575 | 19024-19025 | -RRB- | denotes | ) |
T6576 | 19025-19026 | , | denotes | , |
T6577 | 19027-19032 | NNS | denotes | cells |
T6578 | 19033-19037 | VBD | denotes | were |
T6579 | 19038-19047 | VBN | denotes | incubated |
T6580 | 19048-19052 | IN | denotes | with |
T6581 | 19053-19067 | JJ | denotes | tetrarhodamine |
T6582 | 19068-19082 | NN | denotes | isothiocyanate |
T6583 | 19083-19093 | VBN | denotes | conjugated |
T6584 | 19094-19098 | NN | denotes | goat |
T6585 | 19099-19110 | JJ | denotes | anti-rabbit |
T6586 | 19111-19119 | NN | denotes | antibody |
T6587 | 19120-19121 | -LRB- | denotes | ( |
T6588 | 19121-19125 | NNP | denotes | Dako |
T6589 | 19125-19126 | -RRB- | denotes | ) |
T6590 | 19126-19127 | . | denotes | . |
T6591 | 19128-19137 | NNS | denotes | Cytospins |
T6592 | 19138-19142 | VBD | denotes | were |
T6593 | 19143-19157 | VBN | denotes | counterstained |
T6594 | 19158-19162 | IN | denotes | with |
T6595 | 19163-19164 | CD | denotes | 4 |
T6596 | 19164-19165 | CD | denotes | ′ |
T6597 | 19165-19167 | SYM | denotes | ,6 |
T6598 | 19167-19168 | : | denotes | - |
T6599 | 19168-19192 | JJ | denotes | diamidino-2-phenylindole |
T6600 | 19193-19208 | NN | denotes | dihydrochloride |
T6601 | 19209-19210 | -LRB- | denotes | ( |
T6602 | 19210-19214 | NNP | denotes | DAPI |
T6603 | 19214-19215 | -RRB- | denotes | ) |
T6604 | 19215-19216 | , | denotes | , |
T6605 | 19217-19218 | DT | denotes | a |
T6606 | 19219-19230 | JJ | denotes | fluorescent |
T6607 | 19231-19235 | JJ | denotes | blue |
T6608 | 19236-19243 | JJ | denotes | nuclear |
T6609 | 19244-19250 | NN | denotes | indole |
T6610 | 19251-19260 | NN | denotes | chromatin |
T6611 | 19261-19266 | VBP | denotes | stain |
T6612 | 19266-19267 | , | denotes | , |
T6613 | 19268-19271 | CC | denotes | and |
T6614 | 19272-19279 | VBD | denotes | mounted |
T6615 | 19280-19282 | IN | denotes | in |
T6616 | 19283-19286 | NNP | denotes | PBS |
T6617 | 19286-19287 | : | denotes | : |
T6618 | 19287-19295 | NN | denotes | glycerol |
T6619 | 19296-19297 | -LRB- | denotes | ( |
T6620 | 19297-19299 | CD | denotes | 50 |
T6621 | 19299-19300 | NN | denotes | ∶ |
T6622 | 19300-19302 | CD | denotes | 50 |
T6623 | 19302-19303 | -RRB- | denotes | ) |
T6624 | 19303-19304 | . | denotes | . |
T6625 | 19305-19308 | DT | denotes | The |
T6626 | 19309-19323 | JJ | denotes | immunopositive |
T6627 | 19324-19330 | NN | denotes | signal |
T6628 | 19331-19334 | VBD | denotes | was |
T6629 | 19335-19348 | VBN | denotes | characterised |
T6630 | 19349-19354 | VBG | denotes | using |
T6631 | 19355-19360 | NN | denotes | laser |
T6632 | 19361-19369 | VBG | denotes | scanning |
T6633 | 19370-19378 | JJ | denotes | confocal |
T6634 | 19379-19389 | NN | denotes | microscopy |
T6635 | 19390-19392 | IN | denotes | on |
T6636 | 19393-19394 | DT | denotes | a |
T6637 | 19395-19400 | NNP | denotes | Leica |
T6638 | 19401-19404 | NNP | denotes | TCS |
T6639 | 19405-19410 | NNP | denotes | NT/SP |
T6640 | 19411-19422 | JJ | denotes | interactive |
T6641 | 19423-19428 | NN | denotes | laser |
T6642 | 19429-19438 | NN | denotes | cytometer |
T6643 | 19439-19447 | VBN | denotes | equipped |
T6644 | 19448-19452 | IN | denotes | with |
T6645 | 19453-19461 | JJ | denotes | confocal |
T6646 | 19462-19468 | NNS | denotes | optics |
T6647 | 19469-19470 | -LRB- | denotes | ( |
T6648 | 19470-19475 | NNP | denotes | Leica |
T6649 | 19476-19488 | NNP | denotes | Microsystems |
T6650 | 19488-19489 | , | denotes | , |
T6651 | 19490-19497 | NNP | denotes | Wetzlar |
T6652 | 19497-19498 | , | denotes | , |
T6653 | 19499-19506 | NNP | denotes | Germany |
T6654 | 19506-19507 | -RRB- | denotes | ) |
T6655 | 19507-19508 | . | denotes | . |
T6656 | 19509-19511 | TO | denotes | To |
T6657 | 19512-19521 | VB | denotes | determine |
T6658 | 19522-19525 | DT | denotes | the |
T6659 | 19526-19537 | NN | denotes | specificity |
T6660 | 19538-19540 | IN | denotes | of |
T6661 | 19541-19544 | DT | denotes | the |
T6662 | 19545-19555 | NNS | denotes | antibodies |
T6663 | 19555-19556 | , | denotes | , |
T6664 | 19557-19563 | NN | denotes | rabbit |
T6665 | 19564-19569 | NN | denotes | serum |
T6666 | 19570-19584 | NN | denotes | immunoglobulin |
T6667 | 19585-19586 | -LRB- | denotes | ( |
T6668 | 19586-19590 | NNP | denotes | Dako |
T6669 | 19590-19591 | -RRB- | denotes | ) |
T6670 | 19592-19595 | CC | denotes | and |
T6671 | 19596-19605 | JJ | denotes | secondary |
T6672 | 19606-19616 | NNS | denotes | antibodies |
T6673 | 19617-19624 | IN | denotes | without |
T6674 | 19625-19628 | DT | denotes | the |
T6675 | 19629-19636 | JJ | denotes | primary |
T6676 | 19637-19641 | VBD | denotes | were |
T6677 | 19642-19646 | VBN | denotes | used |
T6678 | 19647-19649 | IN | denotes | as |
T6679 | 19650-19658 | NNS | denotes | controls |
T6680 | 19658-19659 | . | denotes | . |
T6681 | 19660-19670 | RB | denotes | Positively |
T6682 | 19671-19678 | VBN | denotes | stained |
T6683 | 19679-19685 | NNS | denotes | nuclei |
T6684 | 19686-19689 | CC | denotes | and |
T6685 | 19690-19695 | JJ | denotes | total |
T6686 | 19696-19701 | NNS | denotes | cells |
T6687 | 19702-19706 | VBD | denotes | were |
T6688 | 19707-19714 | VBN | denotes | counted |
T6689 | 19715-19716 | -LRB- | denotes | ( |
T6690 | 19716-19719 | CD | denotes | 500 |
T6691 | 19719-19720 | -RRB- | denotes | ) |
T6692 | 19721-19723 | IN | denotes | on |
T6693 | 19724-19728 | DT | denotes | each |
T6694 | 19729-19734 | NN | denotes | slide |
T6695 | 19735-19739 | IN | denotes | with |
T6696 | 19740-19743 | DT | denotes | the |
T6697 | 19744-19752 | NN | denotes | observer |
T6698 | 19753-19760 | VBD | denotes | blinded |
T6699 | 19761-19763 | TO | denotes | to |
T6700 | 19764-19767 | DT | denotes | the |
T6701 | 19768-19777 | NN | denotes | treatment |
T6702 | 19777-19778 | . | denotes | . |
T6937 | 19780-19790 | NNP | denotes | GATA-3-GFP |
T6938 | 19791-19800 | NNP | denotes | Construct |
T6939 | 19801-19804 | NNP | denotes | The |
T6940 | 19805-19811 | NNP | denotes | GATA-3 |
T6941 | 19812-19817 | NN | denotes | clone |
T6942 | 19818-19819 | -LRB- | denotes | ( |
T6943 | 19819-19827 | NNP | denotes | BC003070 |
T6944 | 19827-19828 | -RRB- | denotes | ) |
T6945 | 19829-19837 | JJ | denotes | complete |
T6946 | 19838-19842 | NNP | denotes | cDNA |
T6947 | 19843-19846 | VBD | denotes | was |
T6948 | 19847-19855 | VBN | denotes | obtained |
T6949 | 19856-19860 | IN | denotes | from |
T6950 | 19861-19871 | NNP | denotes | Invitrogen |
T6951 | 19872-19876 | NNP | denotes | Life |
T6952 | 19877-19889 | NNPS | denotes | Technologies |
T6953 | 19890-19892 | IN | denotes | as |
T6954 | 19893-19894 | DT | denotes | a |
T6955 | 19895-19896 | CD | denotes | 5 |
T6956 | 19896-19897 | SYM | denotes | ′ |
T6957 | 19897-19898 | : | denotes | - |
T6958 | 19899-19906 | JJ | denotes | EcoRI/3 |
T6959 | 19906-19907 | SYM | denotes | ′ |
T6960 | 19907-19908 | : | denotes | - |
T6961 | 19908-19912 | NNP | denotes | XhoI |
T6962 | 19913-19919 | NN | denotes | insert |
T6963 | 19920-19922 | IN | denotes | of |
T6964 | 19923-19929 | NN | denotes | GATA-3 |
T6965 | 19930-19932 | IN | denotes | in |
T6966 | 19933-19936 | DT | denotes | the |
T6967 | 19937-19942 | NNP | denotes | pOTB7 |
T6968 | 19943-19949 | NN | denotes | vector |
T6969 | 19949-19950 | . | denotes | . |
T6970 | 19951-19957 | NN | denotes | GATA-3 |
T6971 | 19958-19961 | VBD | denotes | was |
T6972 | 19962-19969 | VBN | denotes | excised |
T6973 | 19970-19974 | IN | denotes | from |
T6974 | 19975-19980 | NNP | denotes | pOTB7 |
T6975 | 19981-19986 | VBG | denotes | using |
T6976 | 19987-19991 | NNP | denotes | XhoI |
T6977 | 19992-20001 | NN | denotes | digestion |
T6978 | 20002-20005 | CC | denotes | and |
T6979 | 20006-20014 | NN | denotes | pEGFP-C2 |
T6980 | 20015-20016 | -LRB- | denotes | ( |
T6981 | 20016-20024 | NNP | denotes | Clontech |
T6982 | 20024-20025 | , | denotes | , |
T6983 | 20026-20047 | NNP | denotes | Saint-Germain-en-Laye |
T6984 | 20047-20048 | , | denotes | , |
T6985 | 20049-20055 | NNP | denotes | France |
T6986 | 20055-20056 | -RRB- | denotes | ) |
T6987 | 20057-20060 | VBD | denotes | was |
T6988 | 20061-20069 | VBN | denotes | digested |
T6989 | 20070-20074 | IN | denotes | with |
T6990 | 20075-20080 | NNP | denotes | BamHI |
T6991 | 20080-20081 | . | denotes | . |
T6992 | 20082-20085 | NNP | denotes | DNA |
T6993 | 20086-20089 | VBD | denotes | was |
T6994 | 20090-20099 | VBN | denotes | recovered |
T6995 | 20100-20102 | IN | denotes | by |
T6996 | 20103-20109 | NN | denotes | phenol |
T6997 | 20110-20120 | NN | denotes | extraction |
T6998 | 20121-20124 | CC | denotes | and |
T6999 | 20125-20132 | NN | denotes | ethanol |
T7000 | 20133-20146 | NN | denotes | precipitation |
T7001 | 20146-20147 | , | denotes | , |
T7002 | 20148-20151 | CC | denotes | and |
T7003 | 20152-20156 | DT | denotes | both |
T7004 | 20157-20160 | DT | denotes | the |
T7005 | 20161-20167 | NNP | denotes | GATA-3 |
T7006 | 20168-20176 | NN | denotes | fragment |
T7007 | 20177-20180 | CC | denotes | and |
T7008 | 20181-20184 | DT | denotes | the |
T7009 | 20185-20193 | NN | denotes | pEGFP-C2 |
T7010 | 20194-20200 | NN | denotes | vector |
T7011 | 20201-20212 | JJ | denotes | blunt-ended |
T7012 | 20213-20215 | IN | denotes | by |
T7013 | 20216-20226 | NN | denotes | incubation |
T7014 | 20227-20231 | IN | denotes | with |
T7015 | 20232-20238 | NNP | denotes | Klenow |
T7016 | 20239-20240 | -LRB- | denotes | ( |
T7017 | 20240-20247 | NNP | denotes | Bioline |
T7018 | 20248-20257 | NNP | denotes | Bio-27029 |
T7019 | 20257-20258 | -RRB- | denotes | ) |
T7020 | 20259-20262 | IN | denotes | for |
T7021 | 20263-20265 | CD | denotes | 30 |
T7022 | 20266-20269 | NN | denotes | min |
T7023 | 20270-20272 | IN | denotes | at |
T7024 | 20273-20275 | CD | denotes | 37 |
T7025 | 20275-20276 | CD | denotes | ° |
T7026 | 20276-20278 | NNP | denotes | C. |
T7027 | 20279-20285 | NNP | denotes | Klenow |
T7028 | 20286-20289 | VBD | denotes | was |
T7029 | 20290-20301 | VBN | denotes | inactivated |
T7030 | 20302-20304 | IN | denotes | by |
T7031 | 20305-20315 | NN | denotes | incubation |
T7032 | 20316-20319 | IN | denotes | for |
T7033 | 20320-20322 | CD | denotes | 10 |
T7034 | 20323-20326 | NN | denotes | min |
T7035 | 20327-20329 | IN | denotes | at |
T7036 | 20330-20332 | CD | denotes | 75 |
T7037 | 20332-20333 | CD | denotes | ° |
T7038 | 20333-20335 | NNP | denotes | C. |
T7039 | 20336-20339 | NNP | denotes | DNA |
T7040 | 20340-20343 | VBD | denotes | was |
T7041 | 20344-20353 | VBN | denotes | recovered |
T7042 | 20354-20356 | IN | denotes | by |
T7043 | 20357-20363 | NN | denotes | phenol |
T7044 | 20364-20374 | NN | denotes | extraction |
T7045 | 20375-20378 | CC | denotes | and |
T7046 | 20379-20386 | NN | denotes | ethanol |
T7047 | 20387-20400 | NN | denotes | precipitation |
T7048 | 20400-20401 | , | denotes | , |
T7049 | 20402-20405 | CC | denotes | and |
T7050 | 20406-20410 | DT | denotes | both |
T7051 | 20411-20414 | DT | denotes | the |
T7052 | 20415-20426 | JJ | denotes | blunt-ended |
T7053 | 20427-20433 | JJ | denotes | GATA-3 |
T7054 | 20434-20442 | NN | denotes | fragment |
T7055 | 20443-20446 | CC | denotes | and |
T7056 | 20447-20450 | DT | denotes | the |
T7057 | 20451-20454 | NNP | denotes | GFP |
T7058 | 20455-20461 | NN | denotes | vector |
T7059 | 20462-20466 | VBD | denotes | were |
T7060 | 20467-20479 | RB | denotes | subsequently |
T7061 | 20480-20488 | VBN | denotes | digested |
T7062 | 20489-20493 | IN | denotes | with |
T7063 | 20494-20499 | NNP | denotes | EcoRI |
T7064 | 20500-20506 | IN | denotes | before |
T7065 | 20507-20510 | DT | denotes | the |
T7066 | 20511-20512 | CD | denotes | 5 |
T7067 | 20512-20513 | SYM | denotes | ′ |
T7068 | 20513-20514 | : | denotes | - |
T7069 | 20514-20521 | JJ | denotes | EcoRI/3 |
T7070 | 20521-20522 | NN | denotes | ′ |
T7071 | 20523-20528 | JJ | denotes | blunt |
T7072 | 20529-20532 | NN | denotes | end |
T7073 | 20533-20539 | NN | denotes | GATA-3 |
T7074 | 20540-20548 | NN | denotes | fragment |
T7075 | 20549-20552 | VBD | denotes | was |
T7076 | 20553-20561 | VBN | denotes | inserted |
T7077 | 20562-20566 | IN | denotes | into |
T7078 | 20567-20570 | DT | denotes | the |
T7079 | 20571-20572 | CD | denotes | 5 |
T7080 | 20572-20573 | SYM | denotes | ′ |
T7081 | 20573-20574 | : | denotes | - |
T7082 | 20574-20581 | JJ | denotes | EcoRI/3 |
T7083 | 20581-20582 | NN | denotes | ′ |
T7084 | 20583-20588 | JJ | denotes | blunt |
T7085 | 20589-20594 | VBN | denotes | ended |
T7086 | 20595-20598 | NNP | denotes | GFP |
T7087 | 20599-20605 | NN | denotes | vector |
T7088 | 20605-20606 | . | denotes | . |
T7089 | 20607-20615 | JJ | denotes | Positive |
T7090 | 20616-20622 | NNS | denotes | clones |
T7091 | 20623-20627 | VBD | denotes | were |
T7092 | 20628-20637 | VBN | denotes | confirmed |
T7093 | 20638-20640 | IN | denotes | by |
T7094 | 20641-20650 | NN | denotes | digestion |
T7095 | 20651-20654 | CC | denotes | and |
T7096 | 20655-20659 | NN | denotes | size |
T7097 | 20660-20668 | NN | denotes | analysis |
T7098 | 20669-20671 | IN | denotes | by |
T7099 | 20672-20673 | CD | denotes | 1 |
T7100 | 20673-20674 | NN | denotes | % |
T7101 | 20675-20682 | JJ | denotes | agarose |
T7102 | 20683-20686 | NN | denotes | gel |
T7103 | 20687-20702 | NN | denotes | electrophoresis |
T7104 | 20703-20706 | CC | denotes | and |
T7105 | 20707-20709 | IN | denotes | by |
T7106 | 20710-20720 | VBG | denotes | sequencing |
T7107 | 20720-20721 | . | denotes | . |
T7254 | 20723-20735 | NNP | denotes | Transfection |
T7255 | 20736-20742 | NNP | denotes | HuT-78 |
T7256 | 20743-20748 | NNS | denotes | cells |
T7257 | 20749-20753 | VBD | denotes | were |
T7258 | 20754-20765 | VBN | denotes | transfected |
T7259 | 20766-20770 | IN | denotes | with |
T7260 | 20771-20777 | DT | denotes | either |
T7261 | 20778-20781 | CD | denotes | EP8 |
T7262 | 20782-20784 | CC | denotes | or |
T7263 | 20785-20788 | NNP | denotes | GFP |
T7264 | 20789-20795 | NN | denotes | vector |
T7265 | 20796-20800 | RB | denotes | only |
T7266 | 20801-20804 | NNP | denotes | DNA |
T7267 | 20805-20810 | VBG | denotes | using |
T7268 | 20811-20819 | NN | denotes | solution |
T7269 | 20820-20821 | NN | denotes | R |
T7270 | 20821-20822 | , | denotes | , |
T7271 | 20823-20832 | NN | denotes | programme |
T7272 | 20833-20838 | NN | denotes | V-001 |
T7273 | 20839-20841 | IN | denotes | at |
T7274 | 20842-20843 | DT | denotes | a |
T7275 | 20844-20849 | NN | denotes | ratio |
T7276 | 20850-20852 | IN | denotes | of |
T7277 | 20853-20854 | CD | denotes | 3 |
T7278 | 20854-20855 | CD | denotes | × |
T7279 | 20855-20858 | CD | denotes | 106 |
T7280 | 20859-20866 | CD | denotes | cells/4 |
T7281 | 20867-20869 | NN | denotes | µg |
T7282 | 20870-20873 | NN | denotes | DNA |
T7283 | 20874-20877 | IN | denotes | for |
T7284 | 20878-20879 | CD | denotes | 7 |
T7285 | 20880-20881 | CD | denotes | 8 |
T7286 | 20882-20883 | NN | denotes | h |
T7287 | 20884-20886 | IN | denotes | in |
T7288 | 20887-20895 | JJ | denotes | complete |
T7289 | 20896-20902 | NN | denotes | medium |
T7290 | 20903-20904 | -LRB- | denotes | ( |
T7291 | 20904-20906 | CD | denotes | 10 |
T7292 | 20906-20907 | NN | denotes | % |
T7293 | 20908-20914 | JJ | denotes | bovine |
T7294 | 20915-20920 | NN | denotes | serum |
T7295 | 20921-20923 | IN | denotes | in |
T7296 | 20924-20932 | NNP | denotes | RPMI1640 |
T7297 | 20932-20935 | CD | denotes | +15 |
T7298 | 20936-20947 | NN | denotes | L-glutamine |
T7299 | 20947-20948 | -RRB- | denotes | ) |
T7300 | 20949-20958 | VBG | denotes | according |
T7301 | 20959-20961 | TO | denotes | to |
T7302 | 20962-20965 | DT | denotes | the |
T7303 | 20966-20973 | JJ | denotes | general |
T7304 | 20974-20979 | NNP | denotes | Amaxa |
T7305 | 20980-20988 | NN | denotes | protocol |
T7306 | 20989-20992 | IN | denotes | for |
T7307 | 20993-21006 | NN | denotes | nucleofection |
T7308 | 21006-21007 | . | denotes | . |
T7309 | 21008-21011 | DT | denotes | The |
T7310 | 21012-21018 | NN | denotes | medium |
T7311 | 21019-21022 | VBD | denotes | was |
T7312 | 21023-21035 | RB | denotes | subsequently |
T7313 | 21036-21043 | VBN | denotes | changed |
T7314 | 21044-21046 | TO | denotes | to |
T7315 | 21047-21048 | CD | denotes | 1 |
T7316 | 21048-21049 | NN | denotes | % |
T7317 | 21050-21054 | NNP | denotes | RPMI |
T7318 | 21055-21058 | IN | denotes | for |
T7319 | 21059-21061 | CD | denotes | 24 |
T7320 | 21062-21063 | NN | denotes | h |
T7321 | 21064-21070 | IN | denotes | before |
T7322 | 21071-21082 | VBN | denotes | transfected |
T7323 | 21083-21088 | NNS | denotes | cells |
T7324 | 21089-21093 | VBD | denotes | were |
T7325 | 21094-21099 | VBN | denotes | added |
T7326 | 21100-21102 | TO | denotes | to |
T7327 | 21103-21111 | JJ | denotes | anti-CD3 |
T7328 | 21111-21112 | NN | denotes | / |
T7329 | 21112-21116 | CD | denotes | CD28 |
T7330 | 21117-21124 | VBN | denotes | treated |
T7331 | 21125-21130 | NNS | denotes | wells |
T7332 | 21131-21134 | CC | denotes | and |
T7333 | 21135-21139 | VBP | denotes | live |
T7334 | 21140-21144 | NN | denotes | cell |
T7335 | 21145-21160 | JJ | denotes | videomicroscopy |
T7336 | 21161-21170 | VBN | denotes | performed |
T7337 | 21170-21171 | . | denotes | . |
T7473 | 21173-21183 | NNP | denotes | Time-Lapse |
T7474 | 21184-21194 | NNP | denotes | Microscopy |
T7475 | 21195-21201 | NNP | denotes | HuT-78 |
T7476 | 21202-21207 | NNS | denotes | cells |
T7477 | 21208-21218 | VBG | denotes | expressing |
T7478 | 21219-21229 | NNP | denotes | GATA-3-GFP |
T7479 | 21230-21234 | VBD | denotes | were |
T7480 | 21235-21245 | VBN | denotes | maintained |
T7481 | 21246-21248 | IN | denotes | at |
T7482 | 21249-21251 | CD | denotes | 37 |
T7483 | 21251-21252 | CD | denotes | ° |
T7484 | 21252-21253 | NNP | denotes | C |
T7485 | 21254-21256 | IN | denotes | in |
T7486 | 21257-21263 | NN | denotes | growth |
T7487 | 21264-21270 | NN | denotes | medium |
T7488 | 21271-21273 | IN | denotes | in |
T7489 | 21274-21275 | DT | denotes | a |
T7490 | 21276-21282 | JJ | denotes | closed |
T7491 | 21283-21287 | CD | denotes | FCS2 |
T7492 | 21288-21297 | NN | denotes | perfusion |
T7493 | 21298-21305 | NN | denotes | chamber |
T7494 | 21306-21307 | -LRB- | denotes | ( |
T7495 | 21307-21316 | NNPS | denotes | Bioptechs |
T7496 | 21316-21317 | , | denotes | , |
T7497 | 21318-21324 | NNP | denotes | Butler |
T7498 | 21324-21325 | , | denotes | , |
T7499 | 21326-21338 | NNP | denotes | Pennsylvania |
T7500 | 21338-21339 | , | denotes | , |
T7501 | 21340-21343 | NNP | denotes | USA |
T7502 | 21343-21344 | -RRB- | denotes | ) |
T7503 | 21345-21353 | VBN | denotes | combined |
T7504 | 21354-21358 | IN | denotes | with |
T7505 | 21359-21361 | DT | denotes | an |
T7506 | 21362-21371 | JJ | denotes | objective |
T7507 | 21372-21378 | NN | denotes | heater |
T7508 | 21379-21380 | -LRB- | denotes | ( |
T7509 | 21380-21389 | NNPS | denotes | Bioptechs |
T7510 | 21389-21390 | -RRB- | denotes | ) |
T7511 | 21391-21393 | IN | denotes | on |
T7512 | 21394-21397 | DT | denotes | the |
T7513 | 21398-21403 | NN | denotes | stage |
T7514 | 21404-21405 | DT | denotes | a |
T7515 | 21406-21411 | NNP | denotes | Zeiss |
T7516 | 21412-21420 | NNP | denotes | Axiovert |
T7517 | 21421-21424 | CD | denotes | 200 |
T7518 | 21425-21435 | NN | denotes | microscope |
T7519 | 21436-21437 | -LRB- | denotes | ( |
T7520 | 21437-21446 | NNP | denotes | Thornwood |
T7521 | 21446-21447 | , | denotes | , |
T7522 | 21448-21451 | NNP | denotes | New |
T7523 | 21452-21456 | NNP | denotes | York |
T7524 | 21456-21457 | , | denotes | , |
T7525 | 21458-21461 | NNP | denotes | USA |
T7526 | 21461-21462 | -RRB- | denotes | ) |
T7527 | 21462-21463 | . | denotes | . |
T7528 | 21464-21476 | NNS | denotes | Observations |
T7529 | 21477-21481 | VBD | denotes | were |
T7530 | 21482-21486 | VBN | denotes | made |
T7531 | 21487-21489 | IN | denotes | by |
T7532 | 21490-21492 | CD | denotes | 40 |
T7533 | 21492-21493 | CD | denotes | × |
T7534 | 21493-21496 | CD | denotes | 1.0 |
T7535 | 21497-21499 | NNP | denotes | NA |
T7536 | 21500-21513 | NN | denotes | oil-immersion |
T7537 | 21514-21523 | NN | denotes | objective |
T7538 | 21524-21528 | NN | denotes | lens |
T7539 | 21528-21529 | , | denotes | , |
T7540 | 21530-21533 | CC | denotes | and |
T7541 | 21534-21546 | NN | denotes | fluorescence |
T7542 | 21547-21550 | CC | denotes | and |
T7543 | 21551-21556 | NN | denotes | phase |
T7544 | 21557-21565 | NN | denotes | contrast |
T7545 | 21566-21572 | NNS | denotes | images |
T7546 | 21573-21577 | VBD | denotes | were |
T7547 | 21578-21586 | VBN | denotes | gathered |
T7548 | 21587-21592 | VBG | denotes | using |
T7549 | 21593-21594 | DT | denotes | a |
T7550 | 21595-21604 | NNP | denotes | Hamamatsu |
T7551 | 21605-21612 | NNP | denotes | ORCA-ER |
T7552 | 21613-21620 | VBD | denotes | charged |
T7553 | 21621-21628 | VBN | denotes | coupled |
T7554 | 21629-21635 | NN | denotes | device |
T7555 | 21636-21642 | NN | denotes | camera |
T7556 | 21643-21644 | -LRB- | denotes | ( |
T7557 | 21644-21655 | NNP | denotes | Bridgewater |
T7558 | 21655-21656 | , | denotes | , |
T7559 | 21657-21660 | NNP | denotes | New |
T7560 | 21661-21667 | NNP | denotes | Jersey |
T7561 | 21667-21668 | , | denotes | , |
T7562 | 21669-21672 | NNP | denotes | USA |
T7563 | 21672-21673 | -RRB- | denotes | ) |
T7564 | 21674-21680 | VBN | denotes | driven |
T7565 | 21681-21683 | IN | denotes | by |
T7566 | 21684-21691 | NNP | denotes | Openlab |
T7567 | 21692-21700 | NN | denotes | software |
T7568 | 21701-21702 | -LRB- | denotes | ( |
T7569 | 21702-21713 | NNP | denotes | Improvision |
T7570 | 21713-21714 | , | denotes | , |
T7571 | 21715-21723 | NNP | denotes | Coventry |
T7572 | 21723-21724 | , | denotes | , |
T7573 | 21725-21727 | NNP | denotes | UK |
T7574 | 21727-21728 | -RRB- | denotes | ) |
T7575 | 21728-21729 | . | denotes | . |
T7576 | 21730-21741 | NNS | denotes | Photographs |
T7577 | 21742-21746 | VBD | denotes | were |
T7578 | 21747-21752 | VBN | denotes | taken |
T7579 | 21753-21755 | IN | denotes | at |
T7580 | 21756-21757 | CD | denotes | 0 |
T7581 | 21757-21758 | , | denotes | , |
T7582 | 21759-21761 | CD | denotes | 30 |
T7583 | 21761-21762 | , | denotes | , |
T7584 | 21763-21765 | CD | denotes | 60 |
T7585 | 21765-21766 | , | denotes | , |
T7586 | 21767-21770 | CD | denotes | 120 |
T7587 | 21770-21771 | , | denotes | , |
T7588 | 21772-21775 | CC | denotes | and |
T7589 | 21776-21779 | CD | denotes | 240 |
T7590 | 21780-21783 | NN | denotes | min |
T7591 | 21783-21784 | . | denotes | . |
T7691 | 21786-21799 | NNP | denotes | Densitometric |
T7692 | 21800-21808 | NNP | denotes | Analysis |
T7693 | 21809-21821 | NNP | denotes | Densitometry |
T7694 | 21822-21824 | IN | denotes | of |
T7695 | 21825-21828 | NNP | denotes | ECL |
T7696 | 21829-21840 | NNS | denotes | immunoblots |
T7697 | 21841-21844 | VBD | denotes | was |
T7698 | 21845-21854 | VBN | denotes | performed |
T7699 | 21855-21860 | VBG | denotes | using |
T7700 | 21861-21869 | NNP | denotes | Gelworks |
T7701 | 21870-21872 | NNP | denotes | ID |
T7702 | 21873-21885 | JJ | denotes | intermediate |
T7703 | 21886-21894 | NN | denotes | software |
T7704 | 21895-21896 | -LRB- | denotes | ( |
T7705 | 21896-21907 | NNP | denotes | Ultraviolet |
T7706 | 21908-21916 | NNPS | denotes | Products |
T7707 | 21916-21917 | , | denotes | , |
T7708 | 21918-21932 | NNP | denotes | Cambridgeshire |
T7709 | 21932-21933 | , | denotes | , |
T7710 | 21934-21936 | NNP | denotes | UK |
T7711 | 21936-21937 | -RRB- | denotes | ) |
T7712 | 21937-21938 | . | denotes | . |
T7713 | 21939-21946 | RB | denotes | Briefly |
T7714 | 21946-21947 | , | denotes | , |
T7715 | 21948-21959 | NNS | denotes | immunoblots |
T7716 | 21960-21964 | VBD | denotes | were |
T7717 | 21965-21972 | VBN | denotes | scanned |
T7718 | 21973-21976 | CC | denotes | and |
T7719 | 21977-21982 | NNS | denotes | gates |
T7720 | 21983-21987 | VBD | denotes | were |
T7721 | 21988-21993 | VBN | denotes | drawn |
T7722 | 21994-22001 | RB | denotes | tightly |
T7723 | 22002-22008 | IN | denotes | around |
T7724 | 22009-22013 | DT | denotes | each |
T7725 | 22014-22018 | NN | denotes | band |
T7726 | 22018-22019 | . | denotes | . |
T7727 | 22020-22030 | NN | denotes | Background |
T7728 | 22031-22037 | NNS | denotes | values |
T7729 | 22038-22042 | IN | denotes | from |
T7730 | 22043-22047 | DT | denotes | each |
T7731 | 22048-22052 | NN | denotes | lane |
T7732 | 22053-22057 | VBD | denotes | were |
T7733 | 22058-22068 | VBN | denotes | subtracted |
T7734 | 22069-22071 | TO | denotes | to |
T7735 | 22072-22081 | VB | denotes | normalize |
T7736 | 22082-22086 | DT | denotes | each |
T7737 | 22087-22098 | NN | denotes | measurement |
T7738 | 22098-22099 | . | denotes | . |
T7739 | 22100-22103 | DT | denotes | The |
T7740 | 22104-22109 | NNS | denotes | bands |
T7741 | 22110-22114 | VBD | denotes | were |
T7742 | 22115-22125 | VBN | denotes | quantified |
T7743 | 22126-22131 | VBG | denotes | using |
T7744 | 22132-22135 | DT | denotes | the |
T7745 | 22136-22144 | NNPS | denotes | Gelworks |
T7746 | 22145-22153 | NN | denotes | software |
T7747 | 22153-22154 | . | denotes | . |
T7748 | 22155-22158 | DT | denotes | All |
T7749 | 22159-22166 | JJ | denotes | Western |
T7750 | 22167-22172 | NNS | denotes | blots |
T7751 | 22173-22177 | VBD | denotes | were |
T7752 | 22178-22185 | VBN | denotes | exposed |
T7753 | 22186-22188 | TO | denotes | to |
T7754 | 22189-22193 | NN | denotes | film |
T7755 | 22194-22197 | IN | denotes | for |
T7756 | 22198-22205 | VBG | denotes | varying |
T7757 | 22206-22213 | NNS | denotes | lengths |
T7758 | 22214-22216 | IN | denotes | of |
T7759 | 22217-22221 | NN | denotes | time |
T7760 | 22221-22222 | , | denotes | , |
T7761 | 22223-22226 | CC | denotes | and |
T7762 | 22227-22231 | RB | denotes | only |
T7763 | 22232-22237 | NNS | denotes | films |
T7764 | 22238-22248 | VBG | denotes | generating |
T7765 | 22249-22262 | JJ | denotes | subsaturating |
T7766 | 22263-22269 | NNS | denotes | levels |
T7767 | 22270-22272 | IN | denotes | of |
T7768 | 22273-22282 | NN | denotes | intensity |
T7769 | 22283-22287 | VBD | denotes | were |
T7770 | 22288-22296 | VBN | denotes | selected |
T7771 | 22297-22300 | IN | denotes | for |
T7772 | 22301-22314 | JJ | denotes | densitometric |
T7773 | 22315-22325 | NN | denotes | evaluation |
T7774 | 22325-22326 | . | denotes | . |
T7934 | 22328-22339 | NNP | denotes | Statistical |
T7935 | 22340-22348 | NNP | denotes | Analysis |
T7936 | 22349-22353 | NNP | denotes | Data |
T7937 | 22354-22358 | IN | denotes | from |
T7938 | 22359-22364 | CD | denotes | three |
T7939 | 22365-22367 | CC | denotes | or |
T7940 | 22368-22372 | JJR | denotes | more |
T7941 | 22373-22384 | JJ | denotes | independent |
T7942 | 22385-22396 | NNS | denotes | experiments |
T7943 | 22397-22400 | VBP | denotes | are |
T7944 | 22401-22410 | VBN | denotes | presented |
T7945 | 22411-22413 | IN | denotes | as |
T7946 | 22414-22417 | DT | denotes | the |
T7947 | 22418-22422 | JJ | denotes | mean |
T7948 | 22422-22423 | NN | denotes | ± |
T7949 | 22423-22431 | NN | denotes | standard |
T7950 | 22432-22437 | NN | denotes | error |
T7951 | 22438-22440 | IN | denotes | of |
T7952 | 22441-22444 | DT | denotes | the |
T7953 | 22445-22449 | NN | denotes | mean |
T7954 | 22450-22451 | -LRB- | denotes | ( |
T7955 | 22451-22454 | NNP | denotes | SEM |
T7956 | 22454-22455 | -RRB- | denotes | ) |
T7957 | 22455-22456 | , | denotes | , |
T7958 | 22457-22463 | IN | denotes | except |
T7959 | 22464-22469 | WRB | denotes | where |
T7960 | 22470-22476 | VBN | denotes | stated |
T7961 | 22477-22480 | CC | denotes | and |
T7962 | 22481-22485 | VBD | denotes | were |
T7963 | 22486-22494 | VBN | denotes | compared |
T7964 | 22495-22500 | VBG | denotes | using |
T7965 | 22501-22509 | NNP | denotes | GraphPad |
T7966 | 22510-22515 | NNP | denotes | Prism |
T7967 | 22516-22517 | CD | denotes | 4 |
T7968 | 22518-22519 | -LRB- | denotes | ( |
T7969 | 22519-22527 | NNP | denotes | GraphPad |
T7970 | 22528-22536 | NNP | denotes | Software |
T7971 | 22536-22537 | , | denotes | , |
T7972 | 22538-22561 | NN | denotes | http://www.graphpad.com |
T7973 | 22561-22562 | -RRB- | denotes | ) |
T7974 | 22562-22563 | . | denotes | . |
T7975 | 22564-22571 | NNS | denotes | Results |
T7976 | 22572-22576 | VBD | denotes | were |
T7977 | 22577-22585 | JJ | denotes | analysed |
T7978 | 22586-22591 | VBG | denotes | using |
T7979 | 22592-22599 | JJ | denotes | one-way |
T7980 | 22600-22605 | NNP | denotes | ANOVA |
T7981 | 22606-22610 | IN | denotes | with |
T7982 | 22611-22623 | NNP | denotes | Newman-Keuls |
T7983 | 22624-22628 | NN | denotes | post |
T7984 | 22629-22633 | NN | denotes | test |
T7985 | 22634-22640 | IN | denotes | except |
T7986 | 22641-22644 | IN | denotes | for |
T7987 | 22645-22648 | DT | denotes | the |
T7988 | 22649-22653 | NNS | denotes | data |
T7989 | 22654-22658 | IN | denotes | from |
T7990 | 22659-22662 | DT | denotes | the |
T7991 | 22663-22665 | IN | denotes | in |
T7992 | 22666-22670 | NN | denotes | vivo |
T7993 | 22671-22678 | VBD | denotes | inhaled |
T7994 | 22679-22681 | NNP | denotes | FP |
T7995 | 22682-22687 | NN | denotes | study |
T7996 | 22687-22688 | , | denotes | , |
T7997 | 22689-22694 | WDT | denotes | which |
T7998 | 22695-22698 | VBD | denotes | was |
T7999 | 22699-22707 | VBN | denotes | analysed |
T8000 | 22708-22710 | IN | denotes | by |
T8001 | 22711-22719 | NNP | denotes | Friedman |
T8002 | 22719-22721 | POS | denotes | 's |
T8003 | 22722-22726 | NN | denotes | test |
T8004 | 22727-22731 | IN | denotes | with |
T8005 | 22732-22742 | JJ | denotes | subsequent |
T8006 | 22743-22752 | NNP | denotes | Wilcoxson |
T8007 | 22753-22760 | VBD | denotes | matched |
T8008 | 22761-22765 | NN | denotes | pair |
T8009 | 22766-22772 | VBD | denotes | signed |
T8010 | 22773-22777 | NN | denotes | rank |
T8011 | 22778-22781 | NN | denotes | sum |
T8012 | 22782-22786 | NN | denotes | test |
T8013 | 22786-22787 | . | denotes | . |
T8014 | 22788-22792 | NNP | denotes | Data |
T8015 | 22793-22797 | IN | denotes | from |
T8016 | 22798-22802 | DT | denotes | this |
T8017 | 22803-22811 | NN | denotes | analysis |
T8018 | 22812-22815 | VBP | denotes | are |
T8019 | 22816-22825 | VBN | denotes | presented |
T8020 | 22826-22828 | IN | denotes | as |
T8021 | 22829-22830 | DT | denotes | a |
T8022 | 22831-22847 | NNS | denotes | box-and-whiskers |
T8023 | 22848-22852 | NN | denotes | plot |
T8024 | 22852-22853 | . | denotes | . |
T8025 | 22854-22862 | NNP | denotes | Friedman |
T8026 | 22862-22864 | POS | denotes | 's |
T8027 | 22865-22869 | NN | denotes | test |
T8028 | 22870-22873 | VBD | denotes | was |
T8029 | 22874-22878 | VBN | denotes | used |
T8030 | 22879-22881 | IN | denotes | as |
T8031 | 22882-22887 | CD | denotes | three |
T8032 | 22888-22895 | VBN | denotes | matched |
T8033 | 22896-22904 | NNS | denotes | measures |
T8034 | 22905-22909 | VBD | denotes | were |
T8035 | 22910-22918 | VBN | denotes | obtained |
T8036 | 22919-22924 | VBG | denotes | using |
T8037 | 22925-22932 | NN | denotes | placebo |
T8038 | 22932-22933 | , | denotes | , |
T8039 | 22934-22937 | CD | denotes | 100 |
T8040 | 22938-22940 | NN | denotes | µg |
T8041 | 22940-22941 | , | denotes | , |
T8042 | 22942-22945 | CC | denotes | and |
T8043 | 22946-22949 | CD | denotes | 500 |
T8044 | 22950-22952 | NN | denotes | µg |
T8045 | 22953-22955 | IN | denotes | of |
T8046 | 22956-22963 | JJ | denotes | inhaled |
T8047 | 22964-22966 | NNP | denotes | FP |
T8048 | 22966-22967 | , | denotes | , |
T8049 | 22968-22973 | WDT | denotes | which |
T8050 | 22974-22977 | VBD | denotes | had |
T8051 | 22978-22986 | JJ | denotes | variable |
T8052 | 22987-22995 | NN | denotes | baseline |
T8053 | 22996-23002 | NNS | denotes | levels |
T8054 | 23002-23003 | . | denotes | . |
T8055 | 23004-23006 | PRP | denotes | We |
T8056 | 23007-23010 | VBD | denotes | did |
T8057 | 23011-23014 | RB | denotes | not |
T8058 | 23015-23021 | VB | denotes | assume |
T8059 | 23022-23023 | DT | denotes | a |
T8060 | 23024-23032 | JJ | denotes | Gaussian |
T8061 | 23033-23045 | NN | denotes | distribution |
T8062 | 23046-23048 | IN | denotes | of |
T8063 | 23049-23052 | DT | denotes | the |
T8064 | 23053-23057 | NNS | denotes | data |
T8065 | 23058-23061 | JJ | denotes | due |
T8066 | 23062-23064 | TO | denotes | to |
T8067 | 23065-23068 | DT | denotes | the |
T8068 | 23069-23076 | JJ | denotes | limited |
T8069 | 23077-23084 | NNS | denotes | numbers |
T8070 | 23085-23087 | IN | denotes | of |
T8071 | 23088-23100 | NNS | denotes | participants |
T8072 | 23101-23109 | VBN | denotes | analysed |
T8073 | 23110-23111 | -LRB- | denotes | ( |
T8074 | 23111-23116 | CD | denotes | seven |
T8075 | 23116-23117 | -RRB- | denotes | ) |
T8076 | 23117-23118 | . | denotes | . |
T8077 | 23118-23121 | DT | denotes | The |
T8078 | 23122-23126 | NN | denotes | null |
T8079 | 23127-23137 | NN | denotes | hypothesis |
T8080 | 23138-23141 | VBD | denotes | was |
T8081 | 23142-23150 | VBN | denotes | rejected |
T8082 | 23151-23153 | IN | denotes | at |
T8083 | 23154-23155 | NN | denotes | p |
T8084 | 23155-23156 | NN | denotes | < |
T8085 | 23156-23160 | CD | denotes | 0.05 |
T8086 | 23160-23161 | . | denotes | . |
T8451 | 23172-23175 | DT | denotes | The |
T8452 | 23176-23182 | NN | denotes | Effect |
T8453 | 23183-23185 | IN | denotes | of |
T8454 | 23186-23201 | NNS | denotes | Corticosteroids |
T8455 | 23202-23204 | IN | denotes | on |
T8456 | 23205-23211 | NNP | denotes | GATA-3 |
T8457 | 23212-23219 | NNP | denotes | Nuclear |
T8458 | 23220-23233 | NNP | denotes | Translocation |
T8459 | 23234-23237 | CC | denotes | and |
T8460 | 23238-23242 | NN | denotes | IL-4 |
T8461 | 23243-23247 | NNP | denotes | mRNA |
T8462 | 23248-23263 | NNP | denotes | Corticosteroids |
T8463 | 23264-23267 | VBP | denotes | are |
T8464 | 23268-23277 | JJ | denotes | effective |
T8465 | 23278-23280 | IN | denotes | in |
T8466 | 23281-23291 | VBG | denotes | inhibiting |
T8467 | 23292-23308 | JJ | denotes | GATA-3-regulated |
T8468 | 23309-23313 | NN | denotes | IL-4 |
T8469 | 23314-23318 | NN | denotes | gene |
T8470 | 23319-23329 | NN | denotes | expression |
T8471 | 23330-23332 | IN | denotes | in |
T8472 | 23333-23338 | NN | denotes | vitro |
T8473 | 23339-23342 | CC | denotes | and |
T8474 | 23343-23345 | IN | denotes | in |
T8475 | 23346-23350 | NN | denotes | vivo |
T8476 | 23351-23352 | NNP | denotes | [ |
T8477 | 23352-23354 | CD | denotes | 32 |
T8478 | 23354-23355 | NNP | denotes | ] |
T8479 | 23355-23356 | . | denotes | . |
T8480 | 23357-23359 | PRP | denotes | We |
T8481 | 23360-23369 | RB | denotes | therefore |
T8482 | 23370-23382 | VBD | denotes | investigated |
T8483 | 23383-23390 | IN | denotes | whether |
T8484 | 23391-23406 | NNS | denotes | corticosteroids |
T8485 | 23407-23413 | VBP | denotes | affect |
T8486 | 23414-23422 | JJ | denotes | anti-CD3 |
T8487 | 23422-23423 | NN | denotes | / |
T8488 | 23423-23427 | CD | denotes | CD28 |
T8489 | 23428-23438 | VBD | denotes | stimulated |
T8490 | 23439-23446 | JJ | denotes | nuclear |
T8491 | 23447-23453 | NN | denotes | import |
T8492 | 23454-23456 | IN | denotes | of |
T8493 | 23457-23463 | NN | denotes | GATA-3 |
T8494 | 23463-23464 | . | denotes | . |
T8495 | 23465-23476 | NN | denotes | Stimulation |
T8496 | 23477-23479 | IN | denotes | of |
T8497 | 23480-23485 | NNS | denotes | cells |
T8498 | 23486-23490 | IN | denotes | with |
T8499 | 23491-23499 | JJ | denotes | anti-CD3 |
T8500 | 23499-23500 | NN | denotes | / |
T8501 | 23500-23504 | CD | denotes | CD28 |
T8502 | 23505-23513 | VBD | denotes | resulted |
T8503 | 23514-23516 | IN | denotes | in |
T8504 | 23517-23518 | DT | denotes | a |
T8505 | 23519-23524 | JJ | denotes | rapid |
T8506 | 23525-23544 | NN | denotes | cytoplasmic/nuclear |
T8507 | 23545-23551 | NN | denotes | GATA-3 |
T8508 | 23552-23565 | NN | denotes | translocation |
T8509 | 23566-23567 | -LRB- | denotes | ( |
T8510 | 23567-23573 | NN | denotes | Figure |
T8511 | 23574-23576 | CD | denotes | 1A |
T8512 | 23576-23577 | -RRB- | denotes | ) |
T8513 | 23577-23578 | , | denotes | , |
T8514 | 23579-23589 | VBG | denotes | confirming |
T8515 | 23590-23593 | PRP$ | denotes | our |
T8516 | 23594-23602 | JJ | denotes | previous |
T8517 | 23603-23610 | NNS | denotes | results |
T8518 | 23611-23612 | NNP | denotes | [ |
T8519 | 23612-23614 | CD | denotes | 12 |
T8520 | 23614-23615 | NNP | denotes | ] |
T8521 | 23615-23616 | . | denotes | . |
T8522 | 23617-23619 | PRP | denotes | We |
T8523 | 23620-23624 | RB | denotes | also |
T8524 | 23625-23634 | VBD | denotes | confirmed |
T8525 | 23635-23636 | DT | denotes | a |
T8526 | 23637-23642 | JJ | denotes | clear |
T8527 | 23643-23653 | NN | denotes | separation |
T8528 | 23654-23656 | IN | denotes | of |
T8529 | 23657-23664 | JJ | denotes | nuclear |
T8530 | 23665-23668 | CC | denotes | and |
T8531 | 23669-23678 | JJ | denotes | cytosolic |
T8532 | 23679-23688 | NNS | denotes | fractions |
T8533 | 23689-23691 | IN | denotes | as |
T8534 | 23692-23701 | VBN | denotes | indicated |
T8535 | 23702-23704 | IN | denotes | by |
T8536 | 23705-23712 | NN | denotes | histone |
T8537 | 23713-23715 | CD | denotes | H1 |
T8538 | 23716-23719 | CC | denotes | and |
T8539 | 23720-23725 | CD | denotes | MEK-1 |
T8540 | 23726-23733 | NNS | denotes | markers |
T8541 | 23734-23735 | -LRB- | denotes | ( |
T8542 | 23735-23741 | NN | denotes | Figure |
T8543 | 23742-23744 | NN | denotes | 1B |
T8544 | 23744-23745 | -RRB- | denotes | ) |
T8545 | 23745-23746 | . | denotes | . |
T8546 | 23747-23750 | DT | denotes | The |
T8547 | 23751-23757 | JJ | denotes | potent |
T8548 | 23758-23765 | JJ | denotes | topical |
T8549 | 23766-23780 | JJ | denotes | corticosteroid |
T8550 | 23781-23783 | NN | denotes | FP |
T8551 | 23784-23790 | VBD | denotes | caused |
T8552 | 23791-23800 | JJ | denotes | sustained |
T8553 | 23801-23805 | NN | denotes | loss |
T8554 | 23806-23808 | IN | denotes | of |
T8555 | 23809-23816 | JJ | denotes | nuclear |
T8556 | 23817-23823 | JJ | denotes | GATA-3 |
T8557 | 23824-23834 | NN | denotes | expression |
T8558 | 23835-23838 | CC | denotes | and |
T8559 | 23839-23850 | JJ | denotes | cytoplasmic |
T8560 | 23851-23860 | NN | denotes | retention |
T8561 | 23861-23863 | IN | denotes | of |
T8562 | 23864-23870 | NN | denotes | GATA-3 |
T8563 | 23871-23873 | IN | denotes | at |
T8564 | 23874-23888 | NNS | denotes | concentrations |
T8565 | 23889-23896 | VBG | denotes | ranging |
T8566 | 23897-23901 | IN | denotes | from |
T8567 | 23902-23904 | CD | denotes | 10 |
T8568 | 23904-23905 | CD | denotes | − |
T8569 | 23905-23907 | CD | denotes | 12 |
T8570 | 23908-23910 | TO | denotes | to |
T8571 | 23911-23913 | CD | denotes | 10 |
T8572 | 23913-23914 | CD | denotes | − |
T8573 | 23914-23915 | CD | denotes | 8 |
T8574 | 23916-23917 | NNP | denotes | M |
T8575 | 23917-23918 | , | denotes | , |
T8576 | 23919-23924 | WDT | denotes | which |
T8577 | 23925-23930 | VBP | denotes | cover |
T8578 | 23931-23934 | DT | denotes | the |
T8579 | 23935-23946 | JJ | denotes | therapeutic |
T8580 | 23947-23952 | NN | denotes | range |
T8581 | 23953-23954 | NNP | denotes | [ |
T8582 | 23954-23956 | CD | denotes | 37 |
T8583 | 23956-23957 | NNP | denotes | ] |
T8584 | 23957-23958 | . | denotes | . |
T8585 | 23959-23963 | DT | denotes | This |
T8586 | 23964-23970 | NN | denotes | effect |
T8587 | 23971-23974 | VBD | denotes | was |
T8588 | 23975-23988 | NN | denotes | concentration |
T8589 | 23988-23989 | : | denotes | - |
T8590 | 23990-23993 | CC | denotes | and |
T8591 | 23994-24008 | JJ | denotes | time-dependent |
T8592 | 24008-24009 | , | denotes | , |
T8593 | 24010-24014 | IN | denotes | with |
T8594 | 24015-24016 | DT | denotes | a |
T8595 | 24017-24021 | JJ | denotes | peak |
T8596 | 24022-24028 | NN | denotes | effect |
T8597 | 24029-24031 | IN | denotes | of |
T8598 | 24032-24041 | JJ | denotes | 11.6-fold |
T8599 | 24042-24044 | IN | denotes | at |
T8600 | 24045-24047 | CD | denotes | 30 |
T8601 | 24048-24051 | NN | denotes | min |
T8602 | 24052-24054 | IN | denotes | at |
T8603 | 24055-24056 | DT | denotes | a |
T8604 | 24057-24070 | NN | denotes | concentration |
T8605 | 24071-24073 | IN | denotes | of |
T8606 | 24074-24076 | CD | denotes | 10 |
T8607 | 24076-24077 | NN | denotes | − |
T8608 | 24077-24078 | CD | denotes | 8 |
T8609 | 24079-24080 | NNP | denotes | M |
T8610 | 24081-24082 | -LRB- | denotes | ( |
T8611 | 24082-24088 | NNP | denotes | Figure |
T8612 | 24089-24091 | NNP | denotes | 1C |
T8613 | 24091-24092 | -RRB- | denotes | ) |
T8614 | 24093-24096 | CC | denotes | and |
T8615 | 24097-24100 | VBD | denotes | was |
T8616 | 24101-24111 | VBN | denotes | associated |
T8617 | 24112-24116 | IN | denotes | with |
T8618 | 24117-24123 | JJ | denotes | marked |
T8619 | 24124-24134 | NNS | denotes | reductions |
T8620 | 24135-24137 | IN | denotes | in |
T8621 | 24138-24146 | JJ | denotes | anti-CD3 |
T8622 | 24146-24147 | NN | denotes | / |
T8623 | 24147-24151 | CD | denotes | CD28 |
T8624 | 24152-24162 | VBD | denotes | stimulated |
T8625 | 24163-24167 | NN | denotes | IL-4 |
T8626 | 24168-24171 | CC | denotes | and |
T8627 | 24172-24176 | NN | denotes | IL-5 |
T8628 | 24177-24181 | NNP | denotes | mRNA |
T8629 | 24182-24192 | NN | denotes | expression |
T8630 | 24193-24194 | -LRB- | denotes | ( |
T8631 | 24194-24200 | NN | denotes | Figure |
T8632 | 24201-24203 | CD | denotes | 1D |
T8633 | 24203-24204 | -RRB- | denotes | ) |
T8634 | 24205-24208 | CC | denotes | and |
T8635 | 24209-24210 | DT | denotes | a |
T8636 | 24211-24215 | NN | denotes | loss |
T8637 | 24216-24218 | IN | denotes | of |
T8638 | 24219-24225 | JJ | denotes | GATA-3 |
T8639 | 24226-24233 | JJ | denotes | binding |
T8640 | 24234-24236 | TO | denotes | to |
T8641 | 24237-24240 | DT | denotes | the |
T8642 | 24241-24247 | JJ | denotes | native |
T8643 | 24248-24252 | NN | denotes | IL-5 |
T8644 | 24253-24261 | NN | denotes | promoter |
T8645 | 24262-24263 | -LRB- | denotes | ( |
T8646 | 24263-24269 | NN | denotes | Figure |
T8647 | 24270-24272 | CD | denotes | 1E |
T8648 | 24272-24273 | -RRB- | denotes | ) |
T8649 | 24273-24274 | . | denotes | . |
T9109 | 25824-25840 | NNP | denotes | Ligand-Activated |
T9110 | 25841-25843 | NNP | denotes | GR |
T9111 | 25844-25852 | VBZ | denotes | Competes |
T9112 | 25853-25857 | IN | denotes | with |
T9113 | 25858-25864 | NNP | denotes | GATA-3 |
T9114 | 25865-25868 | IN | denotes | for |
T9115 | 25869-25879 | NNP | denotes | Importin-α |
T9116 | 25880-25882 | PRP | denotes | We |
T9117 | 25883-25892 | VBD | denotes | confirmed |
T9118 | 25893-25896 | CC | denotes | and |
T9119 | 25897-25905 | VBD | denotes | extended |
T9120 | 25906-25914 | JJ | denotes | previous |
T9121 | 25915-25919 | NNS | denotes | data |
T9122 | 25920-25921 | NNP | denotes | [ |
T9123 | 25921-25923 | CD | denotes | 20 |
T9124 | 25923-25924 | NNP | denotes | ] |
T9125 | 25925-25927 | TO | denotes | to |
T9126 | 25928-25932 | VB | denotes | show |
T9127 | 25933-25937 | IN | denotes | that |
T9128 | 25938-25954 | JJ | denotes | ligand-activated |
T9129 | 25955-25957 | NNP | denotes | GR |
T9130 | 25958-25960 | RB | denotes | as |
T9131 | 25961-25965 | RB | denotes | well |
T9132 | 25966-25968 | IN | denotes | as |
T9133 | 25969-25975 | JJ | denotes | GATA-3 |
T9134 | 25976-25980 | NNS | denotes | uses |
T9135 | 25981-25991 | JJ | denotes | importin-α |
T9136 | 25992-25995 | IN | denotes | for |
T9137 | 25996-25999 | PRP$ | denotes | its |
T9138 | 26000-26007 | JJ | denotes | nuclear |
T9139 | 26008-26014 | NN | denotes | import |
T9140 | 26015-26016 | -LRB- | denotes | ( |
T9141 | 26016-26022 | NN | denotes | Figure |
T9142 | 26023-26025 | CD | denotes | 2A |
T9143 | 26026-26029 | CC | denotes | and |
T9144 | 26030-26032 | CD | denotes | 2B |
T9145 | 26032-26033 | -RRB- | denotes | ) |
T9146 | 26033-26034 | . | denotes | . |
T9147 | 26035-26039 | DT | denotes | This |
T9148 | 26040-26051 | NN | denotes | interaction |
T9149 | 26052-26059 | IN | denotes | between |
T9150 | 26060-26062 | NNP | denotes | GR |
T9151 | 26063-26066 | CC | denotes | and |
T9152 | 26067-26077 | NNP | denotes | importin-α |
T9153 | 26078-26081 | VBD | denotes | was |
T9154 | 26082-26093 | JJ | denotes | significant |
T9155 | 26094-26096 | IN | denotes | at |
T9156 | 26097-26111 | NNS | denotes | concentrations |
T9157 | 26112-26114 | RB | denotes | as |
T9158 | 26115-26118 | JJ | denotes | low |
T9159 | 26119-26121 | IN | denotes | as |
T9160 | 26122-26124 | CD | denotes | 10 |
T9161 | 26124-26125 | CD | denotes | − |
T9162 | 26125-26127 | CD | denotes | 12 |
T9163 | 26128-26129 | NNP | denotes | M |
T9164 | 26130-26133 | CC | denotes | and |
T9165 | 26134-26137 | VBD | denotes | was |
T9166 | 26138-26145 | JJ | denotes | maximal |
T9167 | 26146-26150 | IN | denotes | with |
T9168 | 26151-26153 | CD | denotes | 10 |
T9169 | 26153-26154 | NN | denotes | − |
T9170 | 26154-26155 | CD | denotes | 8 |
T9171 | 26156-26157 | NNP | denotes | M |
T9172 | 26158-26160 | NNP | denotes | FP |
T9173 | 26160-26161 | . | denotes | . |
T9174 | 26162-26172 | JJ | denotes | Subsequent |
T9175 | 26173-26175 | NNP | denotes | GR |
T9176 | 26176-26183 | JJ | denotes | nuclear |
T9177 | 26184-26197 | NN | denotes | translocation |
T9178 | 26198-26201 | VBD | denotes | was |
T9179 | 26202-26207 | JJ | denotes | rapid |
T9180 | 26208-26211 | CC | denotes | and |
T9181 | 26212-26221 | VBD | denotes | sustained |
T9182 | 26222-26224 | IN | denotes | at |
T9183 | 26225-26236 | JJ | denotes | significant |
T9184 | 26237-26243 | NNS | denotes | levels |
T9185 | 26244-26247 | IN | denotes | for |
T9186 | 26248-26250 | IN | denotes | at |
T9187 | 26251-26256 | JJS | denotes | least |
T9188 | 26257-26259 | CD | denotes | 14 |
T9189 | 26260-26261 | NN | denotes | h |
T9190 | 26262-26263 | -LRB- | denotes | ( |
T9191 | 26263-26269 | NN | denotes | Figure |
T9192 | 26270-26272 | NN | denotes | 2B |
T9193 | 26272-26273 | -RRB- | denotes | ) |
T9194 | 26273-26274 | . | denotes | . |
T9195 | 26275-26280 | VBG | denotes | Using |
T9196 | 26281-26291 | JJ | denotes | IP-Western |
T9197 | 26292-26300 | VBG | denotes | blotting |
T9198 | 26301-26303 | PRP | denotes | we |
T9199 | 26304-26310 | VBD | denotes | showed |
T9200 | 26311-26315 | IN | denotes | that |
T9201 | 26316-26318 | NNP | denotes | FP |
T9202 | 26319-26321 | IN | denotes | at |
T9203 | 26322-26324 | CD | denotes | 10 |
T9204 | 26324-26325 | CD | denotes | − |
T9205 | 26325-26327 | CD | denotes | 12 |
T9206 | 26328-26330 | CD | denotes | 10 |
T9207 | 26330-26331 | NN | denotes | − |
T9208 | 26331-26332 | CD | denotes | 8 |
T9209 | 26333-26334 | NNP | denotes | M |
T9210 | 26335-26344 | VBD | denotes | decreased |
T9211 | 26345-26348 | DT | denotes | the |
T9212 | 26349-26360 | NN | denotes | association |
T9213 | 26361-26368 | IN | denotes | between |
T9214 | 26369-26375 | NNP | denotes | GATA-3 |
T9215 | 26376-26379 | CC | denotes | and |
T9216 | 26380-26390 | JJ | denotes | importin-α |
T9217 | 26391-26398 | VBN | denotes | induced |
T9218 | 26399-26401 | IN | denotes | by |
T9219 | 26402-26410 | JJ | denotes | anti-CD3 |
T9220 | 26410-26411 | NN | denotes | / |
T9221 | 26411-26415 | CD | denotes | CD28 |
T9222 | 26416-26427 | NN | denotes | stimulation |
T9223 | 26428-26430 | IN | denotes | in |
T9224 | 26431-26432 | DT | denotes | a |
T9225 | 26433-26456 | JJ | denotes | concentration-dependent |
T9226 | 26457-26463 | NN | denotes | manner |
T9227 | 26464-26465 | -LRB- | denotes | ( |
T9228 | 26465-26471 | NN | denotes | Figure |
T9229 | 26472-26474 | CD | denotes | 2C |
T9230 | 26474-26475 | -RRB- | denotes | ) |
T9231 | 26475-26476 | . | denotes | . |
T9232 | 26477-26479 | IN | denotes | In |
T9233 | 26480-26488 | NN | denotes | addition |
T9234 | 26488-26489 | , | denotes | , |
T9235 | 26490-26495 | VBG | denotes | using |
T9236 | 26496-26508 | JJ | denotes | GFP-labelled |
T9237 | 26509-26515 | NN | denotes | GATA-3 |
T9238 | 26516-26519 | CC | denotes | and |
T9239 | 26520-26528 | JJ | denotes | confocal |
T9240 | 26529-26539 | NN | denotes | microscopy |
T9241 | 26540-26542 | PRP | denotes | we |
T9242 | 26543-26555 | VBD | denotes | demonstrated |
T9243 | 26556-26560 | IN | denotes | that |
T9244 | 26561-26567 | JJ | denotes | GATA-3 |
T9245 | 26568-26575 | JJ | denotes | nuclear |
T9246 | 26576-26582 | NN | denotes | import |
T9247 | 26583-26592 | VBG | denotes | following |
T9248 | 26593-26601 | JJ | denotes | anti-CD3 |
T9249 | 26601-26602 | NN | denotes | / |
T9250 | 26602-26606 | CD | denotes | CD28 |
T9251 | 26607-26618 | NN | denotes | stimulation |
T9252 | 26619-26622 | IN | denotes | for |
T9253 | 26623-26625 | CD | denotes | 30 |
T9254 | 26626-26629 | NN | denotes | min |
T9255 | 26630-26633 | VBD | denotes | was |
T9256 | 26634-26644 | VBN | denotes | attenuated |
T9257 | 26645-26647 | IN | denotes | by |
T9258 | 26648-26660 | NN | denotes | pretreatment |
T9259 | 26661-26665 | IN | denotes | with |
T9260 | 26666-26668 | NNP | denotes | FP |
T9261 | 26669-26670 | -LRB- | denotes | ( |
T9262 | 26670-26672 | CD | denotes | 10 |
T9263 | 26672-26673 | NN | denotes | − |
T9264 | 26673-26674 | CD | denotes | 8 |
T9265 | 26675-26676 | NNP | denotes | M |
T9266 | 26676-26677 | -RRB- | denotes | ) |
T9267 | 26678-26679 | -LRB- | denotes | ( |
T9268 | 26679-26685 | NN | denotes | Figure |
T9269 | 26686-26688 | CD | denotes | 2D |
T9270 | 26688-26689 | -RRB- | denotes | ) |
T9271 | 26689-26690 | . | denotes | . |
T10194 | 28251-28257 | NN | denotes | Effect |
T10195 | 28258-28260 | IN | denotes | on |
T10196 | 28261-28266 | NNP | denotes | MKP-1 |
T10197 | 28267-28280 | NNP | denotes | Dexamethasone |
T10198 | 28281-28289 | VBZ | denotes | inhibits |
T10199 | 28290-28293 | CD | denotes | p38 |
T10200 | 28294-28298 | NNP | denotes | MAPK |
T10201 | 28299-28307 | NN | denotes | function |
T10202 | 28308-28310 | IN | denotes | in |
T10203 | 28311-28312 | DT | denotes | a |
T10204 | 28313-28317 | NN | denotes | cell |
T10205 | 28318-28322 | NN | denotes | type |
T10206 | 28323-28331 | JJ | denotes | specific |
T10207 | 28332-28338 | NN | denotes | manner |
T10208 | 28339-28346 | IN | denotes | through |
T10209 | 28347-28350 | DT | denotes | the |
T10210 | 28351-28356 | JJ | denotes | rapid |
T10211 | 28357-28366 | NN | denotes | induction |
T10212 | 28367-28369 | IN | denotes | of |
T10213 | 28370-28373 | DT | denotes | the |
T10214 | 28374-28378 | JJ | denotes | dual |
T10215 | 28379-28385 | NN | denotes | kinase |
T10216 | 28386-28397 | NN | denotes | phosphatase |
T10217 | 28398-28403 | NNP | denotes | MKP-1 |
T10218 | 28404-28405 | -LRB- | denotes | ( |
T10219 | 28405-28409 | NNP | denotes | MAPK |
T10220 | 28410-28423 | JJ | denotes | phosphatase-1 |
T10221 | 28423-28424 | -RRB- | denotes | ) |
T10222 | 28424-28425 | , | denotes | , |
T10223 | 28426-28429 | CC | denotes | and |
T10224 | 28430-28434 | DT | denotes | this |
T10225 | 28435-28441 | NN | denotes | effect |
T10226 | 28442-28447 | VBZ | denotes | lasts |
T10227 | 28448-28451 | IN | denotes | for |
T10228 | 28452-28454 | RB | denotes | up |
T10229 | 28455-28457 | TO | denotes | to |
T10230 | 28458-28460 | CD | denotes | 24 |
T10231 | 28461-28462 | NN | denotes | h |
T10232 | 28463-28464 | NNP | denotes | [ |
T10233 | 28464-28466 | CD | denotes | 28 |
T10234 | 28466-28467 | NNP | denotes | ] |
T10235 | 28467-28468 | . | denotes | . |
T10236 | 28469-28471 | NNP | denotes | FP |
T10237 | 28472-28473 | -LRB- | denotes | ( |
T10238 | 28473-28475 | CD | denotes | 10 |
T10239 | 28475-28476 | NN | denotes | − |
T10240 | 28476-28477 | CD | denotes | 8 |
T10241 | 28478-28479 | NNP | denotes | M |
T10242 | 28479-28480 | -RRB- | denotes | ) |
T10243 | 28481-28490 | NN | denotes | treatment |
T10244 | 28491-28493 | IN | denotes | of |
T10245 | 28494-28500 | JJ | denotes | HuT-78 |
T10246 | 28501-28506 | NNS | denotes | cells |
T10247 | 28507-28516 | VBN | denotes | activated |
T10248 | 28517-28519 | IN | denotes | by |
T10249 | 28520-28528 | JJ | denotes | anti-CD3 |
T10250 | 28528-28529 | NN | denotes | / |
T10251 | 28529-28533 | CD | denotes | CD28 |
T10252 | 28534-28536 | IN | denotes | in |
T10253 | 28537-28542 | NN | denotes | vitro |
T10254 | 28543-28556 | RB | denotes | significantly |
T10255 | 28557-28566 | VBD | denotes | decreased |
T10256 | 28567-28570 | CD | denotes | p38 |
T10257 | 28571-28575 | NNP | denotes | MAPK |
T10258 | 28576-28591 | NN | denotes | phosphorylation |
T10259 | 28592-28593 | -LRB- | denotes | ( |
T10260 | 28593-28599 | NN | denotes | Figure |
T10261 | 28600-28602 | NN | denotes | 3A |
T10262 | 28602-28603 | -RRB- | denotes | ) |
T10263 | 28604-28607 | CC | denotes | and |
T10264 | 28608-28616 | NN | denotes | activity |
T10265 | 28617-28625 | VBN | denotes | measured |
T10266 | 28626-28628 | IN | denotes | by |
T10267 | 28629-28644 | NN | denotes | phosphorylation |
T10268 | 28645-28647 | IN | denotes | of |
T10269 | 28648-28651 | DT | denotes | the |
T10270 | 28652-28662 | JJ | denotes | downstream |
T10271 | 28663-28669 | NN | denotes | target |
T10272 | 28670-28675 | NNP | denotes | ATF-2 |
T10273 | 28676-28677 | -LRB- | denotes | ( |
T10274 | 28677-28683 | NNP | denotes | Figure |
T10275 | 28684-28686 | NNP | denotes | 3B |
T10276 | 28686-28687 | -RRB- | denotes | ) |
T10277 | 28687-28688 | . | denotes | . |
T10278 | 28689-28693 | DT | denotes | This |
T10279 | 28694-28700 | NN | denotes | effect |
T10280 | 28701-28704 | VBD | denotes | was |
T10281 | 28705-28713 | VBN | denotes | detected |
T10282 | 28714-28716 | IN | denotes | at |
T10283 | 28717-28719 | CD | denotes | 30 |
T10284 | 28720-28723 | NN | denotes | min |
T10285 | 28724-28727 | CC | denotes | and |
T10286 | 28728-28734 | VBD | denotes | lasted |
T10287 | 28735-28738 | IN | denotes | for |
T10288 | 28739-28741 | IN | denotes | at |
T10289 | 28742-28747 | JJS | denotes | least |
T10290 | 28748-28750 | CD | denotes | 14 |
T10291 | 28751-28752 | NN | denotes | h |
T10292 | 28753-28754 | -LRB- | denotes | ( |
T10293 | 28754-28760 | NN | denotes | Figure |
T10294 | 28761-28763 | NN | denotes | 3B |
T10295 | 28763-28764 | -RRB- | denotes | ) |
T10296 | 28764-28765 | . | denotes | . |
T10297 | 28766-28768 | NNP | denotes | FP |
T10298 | 28769-28770 | -LRB- | denotes | ( |
T10299 | 28770-28772 | CD | denotes | 10 |
T10300 | 28772-28773 | NN | denotes | − |
T10301 | 28773-28774 | CD | denotes | 8 |
T10302 | 28775-28776 | NNP | denotes | M |
T10303 | 28776-28777 | -RRB- | denotes | ) |
T10304 | 28778-28782 | RB | denotes | also |
T10305 | 28783-28796 | RB | denotes | significantly |
T10306 | 28797-28804 | VBN | denotes | reduced |
T10307 | 28805-28811 | JJ | denotes | GATA-3 |
T10308 | 28812-28818 | NN | denotes | serine |
T10309 | 28819-28834 | NN | denotes | phosphorylation |
T10310 | 28835-28842 | VBN | denotes | induced |
T10311 | 28843-28845 | IN | denotes | by |
T10312 | 28846-28854 | JJ | denotes | anti-CD3 |
T10313 | 28854-28855 | NN | denotes | / |
T10314 | 28855-28859 | CD | denotes | CD28 |
T10315 | 28860-28871 | NN | denotes | stimulation |
T10316 | 28872-28874 | IN | denotes | in |
T10317 | 28875-28879 | DT | denotes | both |
T10318 | 28880-28881 | DT | denotes | a |
T10319 | 28882-28886 | NN | denotes | time |
T10320 | 28886-28887 | : | denotes | - |
T10321 | 28888-28891 | CC | denotes | and |
T10322 | 28892-28915 | JJ | denotes | concentration-dependent |
T10323 | 28916-28922 | NN | denotes | manner |
T10324 | 28923-28924 | -LRB- | denotes | ( |
T10325 | 28924-28930 | NN | denotes | Figure |
T10326 | 28931-28933 | NN | denotes | 3C |
T10327 | 28933-28934 | -RRB- | denotes | ) |
T10328 | 28934-28935 | . | denotes | . |
T10329 | 28936-28940 | DT | denotes | This |
T10330 | 28941-28950 | NN | denotes | reduction |
T10331 | 28951-28953 | IN | denotes | in |
T10332 | 28954-28960 | JJ | denotes | GATA-3 |
T10333 | 28961-28976 | NN | denotes | phosphorylation |
T10334 | 28977-28980 | VBD | denotes | was |
T10335 | 28981-28985 | RB | denotes | also |
T10336 | 28986-28990 | VBN | denotes | seen |
T10337 | 28991-28995 | IN | denotes | with |
T10338 | 28996-29001 | JJR | denotes | lower |
T10339 | 29002-29016 | NNS | denotes | concentrations |
T10340 | 29017-29019 | IN | denotes | of |
T10341 | 29020-29022 | NNP | denotes | FP |
T10342 | 29022-29023 | . | denotes | . |
T10343 | 29024-29026 | PRP | denotes | We |
T10344 | 29027-29032 | VBD | denotes | found |
T10345 | 29033-29037 | IN | denotes | that |
T10346 | 29038-29040 | NNP | denotes | FP |
T10347 | 29041-29054 | RB | denotes | significantly |
T10348 | 29055-29062 | VBD | denotes | induced |
T10349 | 29063-29068 | NNP | denotes | MKP-1 |
T10350 | 29069-29073 | NNP | denotes | mRNA |
T10351 | 29074-29076 | IN | denotes | in |
T10352 | 29077-29081 | DT | denotes | both |
T10353 | 29082-29083 | DT | denotes | a |
T10354 | 29084-29088 | NN | denotes | time |
T10355 | 29088-29089 | : | denotes | - |
T10356 | 29090-29093 | CC | denotes | and |
T10357 | 29094-29117 | JJ | denotes | concentration-dependent |
T10358 | 29118-29124 | NN | denotes | manner |
T10359 | 29124-29125 | , | denotes | , |
T10360 | 29126-29134 | VBG | denotes | reaching |
T10361 | 29135-29136 | DT | denotes | a |
T10362 | 29137-29144 | NN | denotes | plateau |
T10363 | 29145-29147 | IN | denotes | at |
T10364 | 29148-29150 | CD | denotes | 10 |
T10365 | 29150-29151 | NN | denotes | − |
T10366 | 29151-29152 | CD | denotes | 8 |
T10367 | 29153-29154 | NNP | denotes | M |
T10368 | 29155-29160 | IN | denotes | after |
T10369 | 29161-29163 | CD | denotes | 10 |
T10370 | 29164-29167 | NN | denotes | min |
T10371 | 29168-29169 | -LRB- | denotes | ( |
T10372 | 29169-29175 | NN | denotes | Figure |
T10373 | 29176-29178 | CD | denotes | 3D |
T10374 | 29179-29182 | CC | denotes | and |
T10375 | 29183-29185 | CD | denotes | 3E |
T10376 | 29185-29186 | -RRB- | denotes | ) |
T10377 | 29186-29187 | . | denotes | . |
T10378 | 29188-29195 | RB | denotes | However |
T10379 | 29195-29196 | , | denotes | , |
T10380 | 29197-29200 | DT | denotes | the |
T10381 | 29201-29208 | NNS | denotes | effects |
T10382 | 29209-29211 | IN | denotes | of |
T10383 | 29212-29214 | NNP | denotes | FP |
T10384 | 29215-29217 | IN | denotes | on |
T10385 | 29218-29224 | NNP | denotes | GATA-3 |
T10386 | 29225-29232 | JJ | denotes | nuclear |
T10387 | 29233-29239 | NN | denotes | import |
T10388 | 29239-29240 | , | denotes | , |
T10389 | 29241-29251 | JJ | denotes | importin-α |
T10390 | 29252-29263 | NN | denotes | association |
T10391 | 29264-29267 | CC | denotes | and |
T10392 | 29268-29272 | NN | denotes | IL-4 |
T10393 | 29273-29277 | NNP | denotes | mRNA |
T10394 | 29278-29288 | NN | denotes | expression |
T10395 | 29289-29292 | VBP | denotes | are |
T10396 | 29293-29297 | VBN | denotes | seen |
T10397 | 29298-29300 | IN | denotes | at |
T10398 | 29301-29312 | CD | denotes | 10,000-fold |
T10399 | 29313-29318 | JJR | denotes | lower |
T10400 | 29319-29333 | NNS | denotes | concentrations |
T10401 | 29334-29335 | -LRB- | denotes | ( |
T10402 | 29335-29337 | CD | denotes | 10 |
T10403 | 29337-29338 | NN | denotes | − |
T10404 | 29338-29340 | CD | denotes | 12 |
T10405 | 29341-29342 | NNP | denotes | M |
T10406 | 29342-29343 | , | denotes | , |
T10407 | 29344-29347 | VBP | denotes | see |
T10408 | 29348-29354 | NN | denotes | Figure |
T10409 | 29355-29356 | CD | denotes | 2 |
T10410 | 29356-29357 | -RRB- | denotes | ) |
T10411 | 29357-29358 | . | denotes | . |
T10412 | 30668-30673 | VBG | denotes | Using |
T10413 | 30674-30676 | DT | denotes | an |
T10414 | 30677-30679 | IN | denotes | in |
T10415 | 30680-30685 | NN | denotes | vitro |
T10416 | 30686-30697 | NN | denotes | competition |
T10417 | 30698-30703 | NN | denotes | assay |
T10418 | 30704-30705 | -LRB- | denotes | ( |
T10419 | 30705-30711 | NN | denotes | Figure |
T10420 | 30712-30714 | NN | denotes | 4A |
T10421 | 30714-30715 | -RRB- | denotes | ) |
T10422 | 30716-30725 | VBG | denotes | utilizing |
T10423 | 30726-30734 | JJ | denotes | purified |
T10424 | 30735-30744 | VBN | denotes | activated |
T10425 | 30745-30751 | NN | denotes | GATA-3 |
T10426 | 30751-30752 | , | denotes | , |
T10427 | 30753-30763 | NN | denotes | importin-α |
T10428 | 30763-30764 | , | denotes | , |
T10429 | 30765-30768 | CC | denotes | and |
T10430 | 30769-30778 | VBD | denotes | activated |
T10431 | 30779-30781 | NNP | denotes | GR |
T10432 | 30781-30782 | , | denotes | , |
T10433 | 30783-30785 | PRP | denotes | we |
T10434 | 30786-30798 | VBD | denotes | demonstrated |
T10435 | 30799-30803 | IN | denotes | that |
T10436 | 30804-30813 | VBN | denotes | activated |
T10437 | 30814-30816 | NNP | denotes | GR |
T10438 | 30817-30830 | RB | denotes | significantly |
T10439 | 30831-30840 | VBD | denotes | increased |
T10440 | 30841-30854 | JJ | denotes | GR-importin-α |
T10441 | 30855-30866 | NN | denotes | association |
T10442 | 30867-30869 | IN | denotes | in |
T10443 | 30870-30873 | DT | denotes | the |
T10444 | 30874-30882 | NN | denotes | presence |
T10445 | 30883-30886 | CC | denotes | and |
T10446 | 30887-30894 | NN | denotes | absence |
T10447 | 30895-30897 | IN | denotes | of |
T10448 | 30898-30907 | VBN | denotes | activated |
T10449 | 30908-30914 | NNP | denotes | GATA-3 |
T10450 | 30915-30916 | -LRB- | denotes | ( |
T10451 | 30916-30922 | NNP | denotes | Figure |
T10452 | 30923-30925 | NNP | denotes | 4B |
T10453 | 30925-30926 | -RRB- | denotes | ) |
T10454 | 30926-30927 | . | denotes | . |
T10455 | 30928-30932 | DT | denotes | This |
T10456 | 30933-30939 | NN | denotes | effect |
T10457 | 30940-30942 | VBZ | denotes | is |
T10458 | 30943-30946 | RB | denotes | not |
T10459 | 30947-30953 | JJ | denotes | mutual |
T10460 | 30953-30954 | , | denotes | , |
T10461 | 30955-30960 | IN | denotes | since |
T10462 | 30961-30970 | VBN | denotes | activated |
T10463 | 30971-30977 | NNP | denotes | GATA-3 |
T10464 | 30978-30981 | VBD | denotes | did |
T10465 | 30982-30985 | RB | denotes | not |
T10466 | 30986-30991 | VB | denotes | block |
T10467 | 30992-30994 | NNP | denotes | GR |
T10468 | 30995-31005 | JJ | denotes | importin-α |
T10469 | 31006-31017 | NN | denotes | association |
T10470 | 31018-31019 | -LRB- | denotes | ( |
T10471 | 31019-31025 | NN | denotes | Figure |
T10472 | 31026-31028 | NN | denotes | 4C |
T10473 | 31028-31029 | -RRB- | denotes | ) |
T10474 | 31029-31030 | . | denotes | . |
T10475 | 31031-31036 | DT | denotes | These |
T10476 | 31037-31041 | NNS | denotes | data |
T10477 | 31042-31046 | RB | denotes | also |
T10478 | 31047-31054 | VBP | denotes | suggest |
T10479 | 31055-31059 | IN | denotes | that |
T10480 | 31060-31064 | DT | denotes | both |
T10481 | 31065-31074 | VBN | denotes | activated |
T10482 | 31075-31077 | NNP | denotes | GR |
T10483 | 31078-31081 | CC | denotes | and |
T10484 | 31082-31096 | NNP | denotes | phospho-GATA-3 |
T10485 | 31097-31100 | MD | denotes | can |
T10486 | 31101-31109 | RB | denotes | directly |
T10487 | 31110-31119 | VB | denotes | associate |
T10488 | 31120-31124 | IN | denotes | with |
T10489 | 31125-31135 | JJ | denotes | importin-α |
T10490 | 31136-31137 | -LRB- | denotes | ( |
T10491 | 31137-31143 | NNP | denotes | Figure |
T10492 | 31144-31146 | NNP | denotes | 4D |
T10493 | 31146-31147 | -RRB- | denotes | ) |
T10494 | 31148-31151 | CC | denotes | and |
T10495 | 31152-31156 | IN | denotes | that |
T10496 | 31157-31166 | VBN | denotes | activated |
T10497 | 31167-31169 | NNP | denotes | GR |
T10498 | 31170-31180 | VBZ | denotes | attenuates |
T10499 | 31181-31184 | DT | denotes | the |
T10500 | 31185-31199 | JJ | denotes | phospho-GATA-3 |
T10501 | 31199-31200 | NN | denotes | / |
T10502 | 31200-31210 | JJ | denotes | importin-α |
T10503 | 31211-31222 | NN | denotes | interaction |
T10504 | 31223-31225 | IN | denotes | in |
T10505 | 31226-31227 | DT | denotes | a |
T10506 | 31228-31251 | JJ | denotes | concentration-dependent |
T10507 | 31252-31258 | NN | denotes | manner |
T10508 | 31259-31260 | -LRB- | denotes | ( |
T10509 | 31260-31266 | NN | denotes | Figure |
T10510 | 31267-31269 | CD | denotes | 4E |
T10511 | 31269-31270 | -RRB- | denotes | ) |
T10512 | 31270-31271 | . | denotes | . |
T10513 | 31272-31280 | RB | denotes | Together |
T10514 | 31280-31281 | , | denotes | , |
T10515 | 31282-31286 | DT | denotes | this |
T10516 | 31287-31295 | VBZ | denotes | suggests |
T10517 | 31296-31300 | IN | denotes | that |
T10518 | 31301-31317 | JJ | denotes | ligand-activated |
T10519 | 31318-31320 | NNP | denotes | GR |
T10520 | 31321-31324 | MD | denotes | may |
T10521 | 31325-31332 | VB | denotes | compete |
T10522 | 31333-31337 | IN | denotes | with |
T10523 | 31338-31352 | JJ | denotes | phospho-GATA-3 |
T10524 | 31353-31356 | IN | denotes | for |
T10525 | 31357-31367 | JJ | denotes | importin-α |
T10526 | 31368-31371 | CC | denotes | and |
T10527 | 31372-31379 | RB | denotes | thereby |
T10528 | 31380-31385 | NN | denotes | limit |
T10529 | 31386-31392 | JJ | denotes | GATA-3 |
T10530 | 31393-31400 | JJ | denotes | nuclear |
T10531 | 31401-31407 | NN | denotes | import |
T10532 | 31407-31408 | . | denotes | . |
T10533 | 32497-32502 | JJ | denotes | Other |
T10534 | 32503-32511 | JJ | denotes | possible |
T10535 | 32512-32527 | NNS | denotes | interpretations |
T10536 | 32528-32530 | IN | denotes | of |
T10537 | 32531-32534 | PRP$ | denotes | our |
T10538 | 32535-32542 | NNS | denotes | results |
T10539 | 32543-32548 | MD | denotes | could |
T10540 | 32549-32556 | VB | denotes | include |
T10541 | 32557-32559 | DT | denotes | an |
T10542 | 32560-32566 | NN | denotes | effect |
T10543 | 32567-32569 | IN | denotes | of |
T10544 | 32570-32572 | NNP | denotes | FP |
T10545 | 32573-32575 | IN | denotes | on |
T10546 | 32576-32582 | NNP | denotes | GATA-3 |
T10547 | 32583-32590 | JJ | denotes | nuclear |
T10548 | 32591-32597 | NN | denotes | export |
T10549 | 32598-32604 | CC | denotes | and/or |
T10550 | 32605-32616 | NN | denotes | degradation |
T10551 | 32616-32617 | . | denotes | . |
T10552 | 32618-32628 | NNP | denotes | Leptomycin |
T10553 | 32629-32630 | NNP | denotes | B |
T10554 | 32630-32631 | , | denotes | , |
T10555 | 32632-32637 | WDT | denotes | which |
T10556 | 32638-32646 | VBZ | denotes | inhibits |
T10557 | 32647-32654 | JJ | denotes | nuclear |
T10558 | 32655-32661 | NN | denotes | export |
T10559 | 32661-32662 | , | denotes | , |
T10560 | 32663-32666 | VBD | denotes | did |
T10561 | 32667-32670 | RB | denotes | not |
T10562 | 32671-32677 | VB | denotes | affect |
T10563 | 32678-32681 | DT | denotes | the |
T10564 | 32682-32689 | NN | denotes | ability |
T10565 | 32690-32692 | IN | denotes | of |
T10566 | 32693-32695 | NNP | denotes | FP |
T10567 | 32696-32698 | TO | denotes | to |
T10568 | 32699-32704 | VB | denotes | block |
T10569 | 32705-32711 | JJ | denotes | GATA-3 |
T10570 | 32712-32719 | JJ | denotes | nuclear |
T10571 | 32720-32732 | NN | denotes | localization |
T10572 | 32733-32734 | -LRB- | denotes | ( |
T10573 | 32734-32740 | NN | denotes | Figure |
T10574 | 32741-32743 | NN | denotes | 5A |
T10575 | 32743-32744 | -RRB- | denotes | ) |
T10576 | 32744-32745 | . | denotes | . |
T10577 | 32746-32758 | RB | denotes | Additionally |
T10578 | 32758-32759 | , | denotes | , |
T10579 | 32760-32762 | NNP | denotes | FP |
T10580 | 32763-32766 | VBD | denotes | had |
T10581 | 32767-32769 | DT | denotes | no |
T10582 | 32770-32776 | NN | denotes | effect |
T10583 | 32777-32779 | IN | denotes | on |
T10584 | 32780-32785 | JJ | denotes | whole |
T10585 | 32786-32790 | NN | denotes | cell |
T10586 | 32791-32797 | NN | denotes | GATA-3 |
T10587 | 32798-32808 | NN | denotes | expression |
T10588 | 32809-32815 | IN | denotes | during |
T10589 | 32816-32819 | DT | denotes | the |
T10590 | 32820-32824 | NN | denotes | time |
T10591 | 32825-32831 | NN | denotes | course |
T10592 | 32832-32834 | IN | denotes | of |
T10593 | 32835-32840 | DT | denotes | these |
T10594 | 32841-32852 | NNS | denotes | experiments |
T10595 | 32853-32854 | -LRB- | denotes | ( |
T10596 | 32854-32860 | NN | denotes | Figure |
T10597 | 32861-32863 | NN | denotes | 5B |
T10598 | 32863-32864 | -RRB- | denotes | ) |
T10599 | 32864-32865 | . | denotes | . |
T10600 | 32866-32869 | CC | denotes | Nor |
T10601 | 32870-32873 | VBD | denotes | did |
T10602 | 32874-32882 | NN | denotes | addition |
T10603 | 32883-32885 | IN | denotes | of |
T10604 | 32886-32888 | NNP | denotes | FP |
T10605 | 32889-32899 | JJ | denotes | subsequent |
T10606 | 32900-32902 | TO | denotes | to |
T10607 | 32903-32911 | JJ | denotes | anti-CD3 |
T10608 | 32911-32912 | NN | denotes | / |
T10609 | 32912-32916 | CD | denotes | CD28 |
T10610 | 32917-32924 | JJ | denotes | nuclear |
T10611 | 32925-32938 | NN | denotes | translocation |
T10612 | 32939-32945 | VB | denotes | affect |
T10613 | 32946-32952 | JJ | denotes | GATA-3 |
T10614 | 32953-32960 | JJ | denotes | nuclear |
T10615 | 32961-32970 | NN | denotes | residency |
T10616 | 32971-32972 | -LRB- | denotes | ( |
T10617 | 32972-32978 | NN | denotes | Figure |
T10618 | 32979-32981 | NN | denotes | 5C |
T10619 | 32981-32982 | -RRB- | denotes | ) |
T10620 | 32982-32983 | , | denotes | , |
T10621 | 32984-32994 | VBG | denotes | suggesting |
T10622 | 32995-32999 | IN | denotes | that |
T10623 | 33000-33009 | VBN | denotes | activated |
T10624 | 33010-33012 | NNP | denotes | GR |
T10625 | 33013-33017 | VBZ | denotes | does |
T10626 | 33018-33021 | RB | denotes | not |
T10627 | 33022-33029 | VB | denotes | enhance |
T10628 | 33030-33036 | JJ | denotes | GATA-3 |
T10629 | 33037-33044 | JJ | denotes | nuclear |
T10630 | 33045-33051 | NN | denotes | export |
T10631 | 33051-33052 | . | denotes | . |
T10632 | 33053-33060 | RB | denotes | Finally |
T10633 | 33060-33061 | , | denotes | , |
T10634 | 33062-33065 | DT | denotes | the |
T10635 | 33066-33072 | NN | denotes | effect |
T10636 | 33073-33075 | IN | denotes | of |
T10637 | 33076-33078 | NNP | denotes | FP |
T10638 | 33079-33081 | IN | denotes | on |
T10639 | 33082-33088 | NNP | denotes | GATA-3 |
T10640 | 33089-33096 | JJ | denotes | nuclear |
T10641 | 33097-33103 | NN | denotes | import |
T10642 | 33104-33107 | VBD | denotes | was |
T10643 | 33108-33111 | RB | denotes | not |
T10644 | 33112-33123 | JJ | denotes | nonspecific |
T10645 | 33123-33124 | , | denotes | , |
T10646 | 33125-33130 | IN | denotes | since |
T10647 | 33131-33133 | NNP | denotes | FP |
T10648 | 33134-33135 | -LRB- | denotes | ( |
T10649 | 33135-33137 | CD | denotes | 10 |
T10650 | 33137-33138 | NN | denotes | − |
T10651 | 33138-33139 | CD | denotes | 8 |
T10652 | 33140-33141 | NNP | denotes | M |
T10653 | 33141-33142 | -RRB- | denotes | ) |
T10654 | 33143-33146 | VBD | denotes | had |
T10655 | 33147-33149 | DT | denotes | no |
T10656 | 33150-33156 | NN | denotes | effect |
T10657 | 33157-33159 | IN | denotes | on |
T10658 | 33160-33163 | CD | denotes | p65 |
T10659 | 33164-33171 | JJ | denotes | nuclear |
T10660 | 33172-33185 | NN | denotes | translocation |
T10661 | 33186-33194 | VBN | denotes | measured |
T10662 | 33195-33197 | IN | denotes | at |
T10663 | 33198-33200 | CD | denotes | 60 |
T10664 | 33201-33204 | NN | denotes | min |
T10665 | 33205-33206 | -LRB- | denotes | ( |
T10666 | 33206-33212 | NN | denotes | Figure |
T10667 | 33213-33215 | CD | denotes | 5D |
T10668 | 33215-33216 | -RRB- | denotes | ) |
T10669 | 33216-33217 | . | denotes | . |
T11922 | 34269-34272 | DT | denotes | The |
T11923 | 34273-34283 | NNP | denotes | Inhibitory |
T11924 | 34284-34290 | NN | denotes | Effect |
T11925 | 34291-34293 | IN | denotes | of |
T11926 | 34294-34309 | NNS | denotes | Corticosteroids |
T11927 | 34310-34312 | IN | denotes | on |
T11928 | 34313-34319 | NNP | denotes | GATA-3 |
T11929 | 34320-34327 | NNP | denotes | Nuclear |
T11930 | 34328-34340 | NNP | denotes | Localization |
T11931 | 34341-34343 | IN | denotes | in |
T11932 | 34344-34351 | JJ | denotes | Primary |
T11933 | 34352-34353 | NNP | denotes | T |
T11934 | 34354-34365 | NNP | denotes | Lymphocytes |
T11935 | 34366-34368 | NNP | denotes | Ex |
T11936 | 34369-34373 | NNP | denotes | Vivo |
T11937 | 34374-34377 | CC | denotes | and |
T11938 | 34378-34380 | IN | denotes | In |
T11939 | 34381-34385 | NNP | denotes | Vivo |
T11940 | 34386-34395 | NNP | denotes | Treatment |
T11941 | 34396-34400 | IN | denotes | with |
T11942 | 34401-34403 | NNP | denotes | FP |
T11943 | 34404-34406 | FW | denotes | ex |
T11944 | 34407-34411 | FW | denotes | vivo |
T11945 | 34412-34424 | VBD | denotes | demonstrated |
T11946 | 34425-34426 | DT | denotes | a |
T11947 | 34427-34450 | JJ | denotes | concentration-dependent |
T11948 | 34451-34459 | NN | denotes | decrease |
T11949 | 34460-34462 | IN | denotes | in |
T11950 | 34463-34466 | DT | denotes | the |
T11951 | 34467-34473 | JJ | denotes | direct |
T11952 | 34474-34485 | NN | denotes | interaction |
T11953 | 34486-34493 | IN | denotes | between |
T11954 | 34494-34508 | JJ | denotes | phospho-GATA-3 |
T11955 | 34509-34512 | CC | denotes | and |
T11956 | 34513-34523 | JJ | denotes | importin-α |
T11957 | 34524-34526 | IN | denotes | in |
T11958 | 34527-34532 | NNS | denotes | PBMCs |
T11959 | 34533-34537 | IN | denotes | from |
T11960 | 34538-34546 | NNS | denotes | patients |
T11961 | 34547-34551 | IN | denotes | with |
T11962 | 34552-34558 | NN | denotes | asthma |
T11963 | 34559-34560 | -LRB- | denotes | ( |
T11964 | 34560-34566 | NN | denotes | Figure |
T11965 | 34567-34569 | NN | denotes | 6A |
T11966 | 34570-34573 | CC | denotes | and |
T11967 | 34574-34576 | NN | denotes | 6B |
T11968 | 34576-34577 | -RRB- | denotes | ) |
T11969 | 34577-34578 | , | denotes | , |
T11970 | 34579-34584 | WDT | denotes | which |
T11971 | 34585-34588 | VBD | denotes | was |
T11972 | 34589-34602 | RB | denotes | significantly |
T11973 | 34603-34612 | VBN | denotes | inhibited |
T11974 | 34613-34615 | IN | denotes | at |
T11975 | 34616-34618 | CD | denotes | 10 |
T11976 | 34618-34619 | CD | denotes | − |
T11977 | 34619-34621 | CD | denotes | 12 |
T11978 | 34622-34623 | NNP | denotes | M |
T11979 | 34624-34626 | NNP | denotes | FP |
T11980 | 34627-34628 | -LRB- | denotes | ( |
T11981 | 34628-34629 | FW | denotes | p |
T11982 | 34629-34630 | FW | denotes | < |
T11983 | 34630-34635 | CD | denotes | 0.001 |
T11984 | 34635-34636 | , | denotes | , |
T11985 | 34637-34642 | NNP | denotes | ANOVA |
T11986 | 34643-34646 | CC | denotes | and |
T11987 | 34647-34659 | NNP | denotes | Newman-Keuls |
T11988 | 34660-34664 | NN | denotes | test |
T11989 | 34664-34665 | -RRB- | denotes | ) |
T11990 | 34666-34669 | CC | denotes | and |
T11991 | 34670-34680 | RB | denotes | completely |
T11992 | 34681-34691 | VBN | denotes | attenuated |
T11993 | 34692-34694 | IN | denotes | by |
T11994 | 34695-34697 | CD | denotes | 10 |
T11995 | 34697-34698 | NN | denotes | − |
T11996 | 34698-34699 | CD | denotes | 8 |
T11997 | 34700-34701 | NNP | denotes | M |
T11998 | 34702-34704 | NNP | denotes | FP |
T11999 | 34705-34706 | -LRB- | denotes | ( |
T12000 | 34706-34707 | FW | denotes | p |
T12001 | 34707-34708 | FW | denotes | < |
T12002 | 34708-34713 | CD | denotes | 0.001 |
T12003 | 34713-34714 | , | denotes | , |
T12004 | 34715-34720 | NNP | denotes | ANOVA |
T12005 | 34721-34724 | CC | denotes | and |
T12006 | 34725-34737 | NNP | denotes | Newman-Keuls |
T12007 | 34738-34742 | NN | denotes | test |
T12008 | 34742-34743 | -RRB- | denotes | ) |
T12009 | 34743-34744 | . | denotes | . |
T12010 | 35694-35697 | PRP$ | denotes | Our |
T12011 | 35698-35706 | JJ | denotes | previous |
T12012 | 35707-35708 | NNP | denotes | T |
T12013 | 35709-35713 | NN | denotes | cell |
T12014 | 35714-35718 | NN | denotes | line |
T12015 | 35719-35726 | NNS | denotes | studies |
T12016 | 35727-35736 | VBD | denotes | indicated |
T12017 | 35737-35741 | IN | denotes | that |
T12018 | 35742-35744 | CD | denotes | 10 |
T12019 | 35744-35745 | CD | denotes | − |
T12020 | 35745-35747 | CD | denotes | 12 |
T12021 | 35748-35749 | NNP | denotes | M |
T12022 | 35750-35752 | NNP | denotes | FP |
T12023 | 35753-35763 | VBZ | denotes | suppresses |
T12024 | 35764-35768 | NN | denotes | IL-4 |
T12025 | 35769-35772 | CC | denotes | and |
T12026 | 35773-35775 | CD | denotes | -5 |
T12027 | 35776-35780 | NN | denotes | gene |
T12028 | 35781-35791 | NN | denotes | expression |
T12029 | 35792-35795 | CC | denotes | and |
T12030 | 35796-35806 | VBD | denotes | attenuated |
T12031 | 35807-35810 | DT | denotes | the |
T12032 | 35811-35822 | NN | denotes | interaction |
T12033 | 35823-35825 | IN | denotes | of |
T12034 | 35826-35832 | NN | denotes | GATA-3 |
T12035 | 35833-35837 | IN | denotes | with |
T12036 | 35838-35848 | JJ | denotes | importin-α |
T12037 | 35849-35850 | -LRB- | denotes | ( |
T12038 | 35850-35853 | VB | denotes | see |
T12039 | 35854-35861 | NNS | denotes | Figures |
T12040 | 35862-35864 | CD | denotes | 1D |
T12041 | 35865-35868 | CC | denotes | and |
T12042 | 35869-35870 | CD | denotes | 2 |
T12043 | 35870-35871 | -RRB- | denotes | ) |
T12044 | 35871-35872 | . | denotes | . |
T12045 | 35873-35877 | DT | denotes | This |
T12046 | 35878-35891 | NN | denotes | concentration |
T12047 | 35892-35894 | VBZ | denotes | is |
T12048 | 35895-35900 | JJ | denotes | close |
T12049 | 35901-35903 | TO | denotes | to |
T12050 | 35904-35908 | VB | denotes | peak |
T12051 | 35909-35915 | NN | denotes | plasma |
T12052 | 35916-35922 | NNS | denotes | levels |
T12053 | 35923-35931 | VBN | denotes | obtained |
T12054 | 35932-35936 | IN | denotes | from |
T12055 | 35937-35946 | JJ | denotes | asthmatic |
T12056 | 35947-35955 | NNS | denotes | patients |
T12057 | 35956-35963 | VBN | denotes | treated |
T12058 | 35964-35968 | IN | denotes | with |
T12059 | 35969-35976 | JJ | denotes | inhaled |
T12060 | 35977-35979 | NNP | denotes | FP |
T12061 | 35980-35981 | -LRB- | denotes | ( |
T12062 | 35981-35984 | CD | denotes | 500 |
T12063 | 35985-35987 | NN | denotes | µg |
T12064 | 35987-35988 | -RRB- | denotes | ) |
T12065 | 35989-35990 | NNP | denotes | [ |
T12066 | 35990-35992 | CD | denotes | 27 |
T12067 | 35992-35993 | NNP | denotes | ] |
T12068 | 35993-35994 | . | denotes | . |
T12069 | 35995-36002 | VBN | denotes | Inhaled |
T12070 | 36003-36005 | NNP | denotes | FP |
T12071 | 36006-36007 | -LRB- | denotes | ( |
T12072 | 36007-36010 | CD | denotes | 500 |
T12073 | 36011-36013 | NN | denotes | µg |
T12074 | 36013-36014 | -RRB- | denotes | ) |
T12075 | 36015-36024 | NN | denotes | treatment |
T12076 | 36025-36027 | IN | denotes | of |
T12077 | 36028-36033 | CD | denotes | seven |
T12078 | 36034-36047 | JJ | denotes | steroid-naive |
T12079 | 36048-36054 | NN | denotes | asthma |
T12080 | 36055-36063 | NNS | denotes | patients |
T12081 | 36064-36077 | RB | denotes | significantly |
T12082 | 36078-36085 | VBD | denotes | reduced |
T12083 | 36086-36092 | NNP | denotes | GATA-3 |
T12084 | 36093-36103 | JJ | denotes | importin-α |
T12085 | 36104-36115 | NN | denotes | interaction |
T12086 | 36116-36118 | IN | denotes | in |
T12087 | 36119-36123 | NN | denotes | vivo |
T12088 | 36124-36126 | IN | denotes | in |
T12089 | 36127-36128 | DT | denotes | a |
T12090 | 36129-36143 | JJ | denotes | time-dependent |
T12091 | 36144-36150 | NN | denotes | manner |
T12092 | 36150-36151 | . | denotes | . |
T12093 | 36152-36156 | DT | denotes | This |
T12094 | 36157-36165 | VBD | denotes | produced |
T12095 | 36166-36167 | DT | denotes | a |
T12096 | 36168-36169 | NN | denotes | > |
T12097 | 36169-36171 | CD | denotes | 90 |
T12098 | 36171-36172 | NN | denotes | % |
T12099 | 36173-36181 | NN | denotes | decrease |
T12100 | 36182-36184 | IN | denotes | in |
T12101 | 36185-36191 | NNP | denotes | GATA-3 |
T12102 | 36192-36202 | JJ | denotes | importin-α |
T12103 | 36203-36214 | NN | denotes | association |
T12104 | 36215-36217 | IN | denotes | at |
T12105 | 36218-36219 | CD | denotes | 2 |
T12106 | 36220-36221 | NN | denotes | h |
T12107 | 36222-36223 | -LRB- | denotes | ( |
T12108 | 36223-36229 | JJ | denotes | median |
T12109 | 36230-36231 | NNP | denotes | [ |
T12110 | 36231-36233 | CD | denotes | 95 |
T12111 | 36233-36234 | NN | denotes | % |
T12112 | 36235-36237 | NNP | denotes | CI |
T12113 | 36237-36238 | NNP | denotes | ] |
T12114 | 36238-36239 | , | denotes | , |
T12115 | 36240-36246 | CD | denotes | 13,494 |
T12116 | 36247-36248 | NNP | denotes | [ |
T12117 | 36248-36253 | CD | denotes | 6,828 |
T12118 | 36254-36260 | CD | denotes | 17,829 |
T12119 | 36260-36261 | NNP | denotes | ] |
T12120 | 36262-36268 | CC | denotes | versus |
T12121 | 36269-36272 | CD | denotes | 879 |
T12122 | 36273-36274 | JJ | denotes | [ |
T12123 | 36274-36277 | CD | denotes | 597 |
T12124 | 36278-36283 | CD | denotes | 1,165 |
T12125 | 36283-36284 | NNP | denotes | ] |
T12126 | 36284-36285 | : | denotes | ; |
T12127 | 36286-36287 | VB | denotes | p |
T12128 | 36287-36288 | RB | denotes | < |
T12129 | 36288-36292 | CD | denotes | 0.05 |
T12130 | 36293-36301 | NNP | denotes | Friedman |
T12131 | 36301-36303 | POS | denotes | 's |
T12132 | 36304-36312 | NN | denotes | analysis |
T12133 | 36312-36313 | -RRB- | denotes | ) |
T12134 | 36313-36314 | . | denotes | . |
T12135 | 36315-36322 | RB | denotes | However |
T12136 | 36322-36323 | , | denotes | , |
T12137 | 36324-36328 | DT | denotes | this |
T12138 | 36329-36332 | VBD | denotes | did |
T12139 | 36333-36336 | RB | denotes | not |
T12140 | 36337-36342 | VB | denotes | reach |
T12141 | 36343-36355 | NN | denotes | significance |
T12142 | 36356-36361 | VBG | denotes | using |
T12143 | 36362-36370 | NNP | denotes | Wilcoxon |
T12144 | 36370-36372 | POS | denotes | 's |
T12145 | 36373-36382 | JJ | denotes | post-test |
T12146 | 36383-36391 | NN | denotes | analysis |
T12147 | 36392-36393 | -LRB- | denotes | ( |
T12148 | 36393-36394 | NNP | denotes | W |
T12149 | 36395-36396 | SYM | denotes | = |
T12150 | 36397-36401 | CD | denotes | 6.00 |
T12151 | 36401-36402 | -RRB- | denotes | ) |
T12152 | 36403-36411 | RB | denotes | probably |
T12153 | 36412-36415 | JJ | denotes | due |
T12154 | 36416-36418 | TO | denotes | to |
T12155 | 36419-36422 | JJ | denotes | low |
T12156 | 36423-36430 | NNS | denotes | numbers |
T12157 | 36431-36433 | IN | denotes | of |
T12158 | 36434-36446 | NNS | denotes | participants |
T12159 | 36446-36447 | . | denotes | . |
T12160 | 36448-36455 | JJ | denotes | Similar |
T12161 | 36456-36463 | NNS | denotes | results |
T12162 | 36464-36468 | VBD | denotes | were |
T12163 | 36469-36477 | VBN | denotes | observed |
T12164 | 36478-36482 | WRB | denotes | when |
T12165 | 36483-36489 | NNP | denotes | GATA-3 |
T12166 | 36490-36500 | JJ | denotes | importin-α |
T12167 | 36501-36512 | NN | denotes | association |
T12168 | 36513-36516 | VBD | denotes | was |
T12169 | 36517-36525 | VBN | denotes | measured |
T12170 | 36526-36527 | -LRB- | denotes | ( |
T12171 | 36527-36533 | NNP | denotes | Figure |
T12172 | 36534-36536 | NNP | denotes | 6C |
T12173 | 36537-36540 | CC | denotes | and |
T12174 | 36541-36543 | NNP | denotes | 6D |
T12175 | 36543-36544 | -RRB- | denotes | ) |
T12176 | 36544-36545 | . | denotes | . |
T12177 | 36546-36549 | DT | denotes | The |
T12178 | 36550-36555 | JJR | denotes | lower |
T12179 | 36556-36560 | NN | denotes | dose |
T12180 | 36561-36563 | IN | denotes | of |
T12181 | 36564-36566 | NNP | denotes | FP |
T12182 | 36567-36568 | -LRB- | denotes | ( |
T12183 | 36568-36571 | CD | denotes | 100 |
T12184 | 36572-36574 | NN | denotes | µg |
T12185 | 36574-36575 | -RRB- | denotes | ) |
T12186 | 36576-36579 | VBD | denotes | was |
T12187 | 36580-36583 | RB | denotes | not |
T12188 | 36584-36593 | JJ | denotes | effective |
T12189 | 36593-36594 | . | denotes | . |
T12190 | 36595-36598 | DT | denotes | The |
T12191 | 36599-36609 | JJ | denotes | attenuated |
T12192 | 36610-36621 | NN | denotes | interaction |
T12193 | 36622-36624 | IN | denotes | of |
T12194 | 36625-36631 | NN | denotes | GATA-3 |
T12195 | 36632-36635 | VBD | denotes | did |
T12196 | 36636-36639 | RB | denotes | not |
T12197 | 36640-36646 | VB | denotes | result |
T12198 | 36647-36651 | IN | denotes | from |
T12199 | 36652-36655 | DT | denotes | the |
T12200 | 36656-36665 | JJ | denotes | defective |
T12201 | 36666-36675 | NN | denotes | recycling |
T12202 | 36676-36678 | IN | denotes | of |
T12203 | 36679-36689 | NN | denotes | importin-α |
T12204 | 36689-36690 | , | denotes | , |
T12205 | 36691-36693 | IN | denotes | as |
T12206 | 36694-36695 | DT | denotes | a |
T12207 | 36696-36707 | JJ | denotes | significant |
T12208 | 36708-36716 | NN | denotes | decrease |
T12209 | 36717-36719 | IN | denotes | in |
T12210 | 36720-36723 | DT | denotes | the |
T12211 | 36724-36733 | NN | denotes | abundance |
T12212 | 36734-36736 | IN | denotes | of |
T12213 | 36737-36747 | NN | denotes | importin-α |
T12214 | 36748-36750 | IN | denotes | in |
T12215 | 36751-36754 | DT | denotes | the |
T12216 | 36755-36766 | JJ | denotes | cytoplasmic |
T12217 | 36767-36771 | NN | denotes | pool |
T12218 | 36772-36775 | VBD | denotes | was |
T12219 | 36776-36779 | RB | denotes | not |
T12220 | 36780-36788 | VBN | denotes | detected |
T12221 | 36789-36790 | -LRB- | denotes | ( |
T12222 | 36790-36796 | NN | denotes | Figure |
T12223 | 36797-36799 | CD | denotes | 6E |
T12224 | 36799-36800 | -RRB- | denotes | ) |
T12225 | 36800-36801 | . | denotes | . |
T12226 | 36802-36804 | PRP | denotes | We |
T12227 | 36805-36812 | RB | denotes | further |
T12228 | 36813-36821 | VBD | denotes | examined |
T12229 | 36822-36829 | IN | denotes | whether |
T12230 | 36830-36837 | JJ | denotes | inhaled |
T12231 | 36838-36840 | NNP | denotes | FP |
T12232 | 36841-36846 | MD | denotes | could |
T12233 | 36847-36853 | VB | denotes | affect |
T12234 | 36854-36862 | JJ | denotes | cellular |
T12235 | 36863-36875 | NN | denotes | localization |
T12236 | 36876-36878 | IN | denotes | of |
T12237 | 36879-36885 | NN | denotes | GATA-3 |
T12238 | 36886-36888 | IN | denotes | in |
T12239 | 36889-36899 | JJ | denotes | peripheral |
T12240 | 36900-36905 | NN | denotes | blood |
T12241 | 36906-36907 | NNP | denotes | T |
T12242 | 36908-36913 | NNS | denotes | cells |
T12243 | 36913-36914 | . | denotes | . |
T12244 | 36915-36924 | NNP | denotes | Treatment |
T12245 | 36925-36929 | IN | denotes | with |
T12246 | 36930-36937 | JJ | denotes | inhaled |
T12247 | 36938-36940 | NNP | denotes | FP |
T12248 | 36941-36942 | -LRB- | denotes | ( |
T12249 | 36942-36945 | CD | denotes | 500 |
T12250 | 36946-36948 | NN | denotes | µg |
T12251 | 36948-36949 | -RRB- | denotes | ) |
T12252 | 36950-36953 | IN | denotes | for |
T12253 | 36954-36955 | CD | denotes | 2 |
T12254 | 36956-36957 | NN | denotes | h |
T12255 | 36958-36971 | RB | denotes | significantly |
T12256 | 36972-36981 | VBD | denotes | increased |
T12257 | 36982-36984 | NNP | denotes | GR |
T12258 | 36985-36992 | JJ | denotes | nuclear |
T12259 | 36993-37006 | NN | denotes | translocation |
T12260 | 37007-37008 | -LRB- | denotes | ( |
T12261 | 37008-37014 | NN | denotes | Figure |
T12262 | 37015-37017 | NN | denotes | 7A |
T12263 | 37017-37018 | -RRB- | denotes | ) |
T12264 | 37019-37022 | CC | denotes | and |
T12265 | 37023-37036 | RB | denotes | concomitantly |
T12266 | 37037-37046 | VBD | denotes | decreased |
T12267 | 37047-37050 | DT | denotes | the |
T12268 | 37051-37057 | NN | denotes | number |
T12269 | 37058-37060 | IN | denotes | of |
T12270 | 37061-37068 | JJ | denotes | nuclear |
T12271 | 37069-37075 | JJ | denotes | GATA-3 |
T12272 | 37076-37090 | JJ | denotes | immunoreactive |
T12273 | 37091-37101 | JJ | denotes | peripheral |
T12274 | 37102-37107 | NN | denotes | blood |
T12275 | 37108-37109 | NNP | denotes | T |
T12276 | 37110-37115 | NNS | denotes | cells |
T12277 | 37116-37117 | -LRB- | denotes | ( |
T12278 | 37117-37119 | CD | denotes | 37 |
T12279 | 37119-37120 | NN | denotes | % |
T12280 | 37120-37121 | CD | denotes | ± |
T12281 | 37121-37124 | CD | denotes | 4.2 |
T12282 | 37124-37125 | NN | denotes | % |
T12283 | 37126-37132 | CC | denotes | versus |
T12284 | 37133-37137 | CD | denotes | 58.2 |
T12285 | 37137-37138 | NN | denotes | % |
T12286 | 37138-37139 | CD | denotes | ± |
T12287 | 37139-37143 | CD | denotes | 4.95 |
T12288 | 37143-37144 | NN | denotes | % |
T12289 | 37144-37145 | , | denotes | , |
T12290 | 37146-37147 | VBP | denotes | p |
T12291 | 37148-37149 | SYM | denotes | = |
T12292 | 37150-37155 | CD | denotes | 0.016 |
T12293 | 37155-37156 | , | denotes | , |
T12294 | 37157-37158 | NNP | denotes | W |
T12295 | 37159-37160 | SYM | denotes | = |
T12296 | 37161-37165 | CD | denotes | 28.0 |
T12297 | 37165-37166 | , | denotes | , |
T12298 | 37167-37175 | NNP | denotes | Wilcoxon |
T12299 | 37175-37177 | POS | denotes | 's |
T12300 | 37178-37182 | NN | denotes | rank |
T12301 | 37183-37187 | NN | denotes | test |
T12302 | 37187-37188 | -RRB- | denotes | ) |
T12303 | 37189-37197 | VBN | denotes | compared |
T12304 | 37198-37202 | IN | denotes | with |
T12305 | 37203-37210 | NN | denotes | placebo |
T12306 | 37211-37213 | IN | denotes | as |
T12307 | 37214-37222 | VBN | denotes | measured |
T12308 | 37223-37225 | IN | denotes | by |
T12309 | 37226-37245 | NN | denotes | immunocytochemistry |
T12310 | 37246-37247 | -LRB- | denotes | ( |
T12311 | 37247-37253 | NN | denotes | Figure |
T12312 | 37254-37256 | NN | denotes | 7A |
T12313 | 37257-37260 | CC | denotes | and |
T12314 | 37261-37263 | NN | denotes | 7B |
T12315 | 37263-37264 | -RRB- | denotes | ) |
T12316 | 37264-37265 | . | denotes | . |
T12317 | 37266-37270 | DT | denotes | This |
T12318 | 37271-37274 | VBD | denotes | was |
T12319 | 37275-37284 | VBN | denotes | confirmed |
T12320 | 37285-37287 | IN | denotes | by |
T12321 | 37288-37295 | JJ | denotes | Western |
T12322 | 37296-37304 | VBG | denotes | blotting |
T12323 | 37304-37305 | , | denotes | , |
T12324 | 37306-37311 | WDT | denotes | which |
T12325 | 37312-37316 | RB | denotes | also |
T12326 | 37317-37326 | VBD | denotes | indicated |
T12327 | 37327-37331 | IN | denotes | that |
T12328 | 37332-37336 | DT | denotes | this |
T12329 | 37337-37343 | NN | denotes | effect |
T12330 | 37344-37347 | VBD | denotes | was |
T12331 | 37348-37352 | DT | denotes | both |
T12332 | 37353-37357 | NN | denotes | time |
T12333 | 37357-37358 | : | denotes | - |
T12334 | 37359-37362 | CC | denotes | and |
T12335 | 37363-37377 | JJ | denotes | dose-dependent |
T12336 | 37378-37379 | -LRB- | denotes | ( |
T12337 | 37379-37385 | NNP | denotes | Figure |
T12338 | 37386-37388 | NNP | denotes | 7C |
T12339 | 37389-37392 | CC | denotes | and |
T12340 | 37393-37395 | NNP | denotes | 7D |
T12341 | 37395-37396 | -RRB- | denotes | ) |
T12342 | 37396-37397 | . | denotes | . |
T12343 | 37398-37402 | RB | denotes | Thus |
T12344 | 37402-37403 | , | denotes | , |
T12345 | 37404-37411 | VBD | denotes | inhaled |
T12346 | 37412-37414 | NNP | denotes | FP |
T12347 | 37415-37416 | -LRB- | denotes | ( |
T12348 | 37416-37419 | CD | denotes | 500 |
T12349 | 37420-37422 | NN | denotes | µg |
T12350 | 37422-37423 | -RRB- | denotes | ) |
T12351 | 37424-37431 | VBD | denotes | induced |
T12352 | 37432-37443 | JJ | denotes | significant |
T12353 | 37444-37448 | NN | denotes | loss |
T12354 | 37449-37451 | IN | denotes | in |
T12355 | 37452-37459 | JJ | denotes | nuclear |
T12356 | 37460-37466 | NN | denotes | GATA-3 |
T12357 | 37467-37469 | IN | denotes | at |
T12358 | 37470-37471 | CD | denotes | 2 |
T12359 | 37472-37473 | NN | denotes | h |
T12360 | 37474-37475 | -LRB- | denotes | ( |
T12361 | 37475-37481 | JJ | denotes | median |
T12362 | 37482-37483 | NNP | denotes | [ |
T12363 | 37483-37485 | CD | denotes | 95 |
T12364 | 37485-37486 | NN | denotes | % |
T12365 | 37487-37489 | NNP | denotes | CI |
T12366 | 37489-37490 | NNP | denotes | ] |
T12367 | 37490-37491 | , | denotes | , |
T12368 | 37492-37496 | CD | denotes | 0.40 |
T12369 | 37497-37498 | NNP | denotes | [ |
T12370 | 37498-37502 | CD | denotes | 0.27 |
T12371 | 37503-37507 | CD | denotes | 0.53 |
T12372 | 37507-37508 | NNP | denotes | ] |
T12373 | 37509-37515 | CC | denotes | versus |
T12374 | 37516-37520 | CD | denotes | 0.14 |
T12375 | 37521-37522 | NNP | denotes | [ |
T12376 | 37522-37526 | CD | denotes | 0.11 |
T12377 | 37527-37531 | CD | denotes | 0.19 |
T12378 | 37531-37532 | NNP | denotes | ] |
T12379 | 37532-37533 | , | denotes | , |
T12380 | 37534-37535 | NN | denotes | p |
T12381 | 37535-37536 | NN | denotes | < |
T12382 | 37536-37540 | CD | denotes | 0.05 |
T12383 | 37540-37541 | , | denotes | , |
T12384 | 37542-37543 | NNP | denotes | W |
T12385 | 37544-37545 | SYM | denotes | = |
T12386 | 37546-37551 | CD | denotes | 21.00 |
T12387 | 37551-37552 | , | denotes | , |
T12388 | 37553-37561 | NNP | denotes | Wilcoxon |
T12389 | 37561-37563 | POS | denotes | 's |
T12390 | 37564-37568 | NN | denotes | rank |
T12391 | 37569-37573 | NN | denotes | test |
T12392 | 37573-37574 | -RRB- | denotes | ) |
T12393 | 37575-37576 | -LRB- | denotes | ( |
T12394 | 37576-37582 | NN | denotes | Figure |
T12395 | 37583-37585 | NN | denotes | 7C |
T12396 | 37585-37586 | -RRB- | denotes | ) |
T12397 | 37587-37590 | CC | denotes | and |
T12398 | 37591-37602 | JJ | denotes | cytoplasmic |
T12399 | 37603-37609 | NN | denotes | GATA-3 |
T12400 | 37610-37616 | NNS | denotes | levels |
T12401 | 37617-37621 | VBD | denotes | were |
T12402 | 37622-37630 | VBN | denotes | enhanced |
T12403 | 37631-37633 | IN | denotes | by |
T12404 | 37634-37641 | JJ | denotes | inhaled |
T12405 | 37642-37644 | NNP | denotes | FP |
T12406 | 37645-37647 | IN | denotes | in |
T12407 | 37648-37649 | DT | denotes | a |
T12408 | 37650-37664 | JJ | denotes | dose-dependent |
T12409 | 37665-37671 | NN | denotes | manner |
T12410 | 37672-37673 | -LRB- | denotes | ( |
T12411 | 37673-37679 | JJ | denotes | median |
T12412 | 37680-37681 | NNP | denotes | [ |
T12413 | 37681-37683 | CD | denotes | 95 |
T12414 | 37683-37684 | NN | denotes | % |
T12415 | 37685-37687 | NNP | denotes | CI |
T12416 | 37687-37688 | NNP | denotes | ] |
T12417 | 37688-37689 | , | denotes | , |
T12418 | 37690-37696 | CD | denotes | 0.0032 |
T12419 | 37697-37698 | NNP | denotes | [ |
T12420 | 37698-37704 | CD | denotes | 0.0026 |
T12421 | 37705-37711 | CD | denotes | 0.0039 |
T12422 | 37711-37712 | NNP | denotes | ] |
T12423 | 37713-37719 | CC | denotes | versus |
T12424 | 37720-37725 | CD | denotes | 0.658 |
T12425 | 37726-37727 | NNP | denotes | [ |
T12426 | 37727-37732 | CD | denotes | 0.592 |
T12427 | 37733-37738 | CD | denotes | 0.720 |
T12428 | 37738-37739 | NNP | denotes | ] |
T12429 | 37739-37740 | , | denotes | , |
T12430 | 37741-37742 | NN | denotes | p |
T12431 | 37742-37743 | NN | denotes | < |
T12432 | 37743-37747 | CD | denotes | 0.05 |
T12433 | 37747-37748 | , | denotes | , |
T12434 | 37749-37750 | NNP | denotes | W |
T12435 | 37751-37752 | SYM | denotes | = |
T12436 | 37753-37754 | FW | denotes | − |
T12437 | 37754-37759 | CD | denotes | 21.00 |
T12438 | 37759-37760 | , | denotes | , |
T12439 | 37761-37769 | NNP | denotes | Wilcoxon |
T12440 | 37769-37771 | POS | denotes | 's |
T12441 | 37772-37776 | NN | denotes | rank |
T12442 | 37777-37781 | NN | denotes | test |
T12443 | 37781-37782 | -RRB- | denotes | ) |
T12444 | 37783-37784 | -LRB- | denotes | ( |
T12445 | 37784-37790 | NNP | denotes | Figure |
T12446 | 37791-37793 | NNP | denotes | 7D |
T12447 | 37793-37794 | -RRB- | denotes | ) |
T12448 | 37794-37795 | . | denotes | . |
T12449 | 37796-37798 | IN | denotes | In |
T12450 | 37799-37807 | NN | denotes | addition |
T12451 | 37807-37808 | , | denotes | , |
T12452 | 37809-37811 | NNP | denotes | FP |
T12453 | 37812-37813 | -LRB- | denotes | ( |
T12454 | 37813-37816 | CD | denotes | 500 |
T12455 | 37817-37819 | NN | denotes | µg |
T12456 | 37819-37820 | -RRB- | denotes | ) |
T12457 | 37821-37830 | VBD | denotes | inhibited |
T12458 | 37831-37834 | CD | denotes | p38 |
T12459 | 37835-37839 | NNP | denotes | MAPK |
T12460 | 37840-37855 | NN | denotes | phosphorylation |
T12461 | 37856-37858 | IN | denotes | in |
T12462 | 37859-37866 | JJ | denotes | primary |
T12463 | 37867-37868 | NNP | denotes | T |
T12464 | 37869-37874 | NNS | denotes | cells |
T12465 | 37875-37877 | IN | denotes | in |
T12466 | 37878-37882 | NN | denotes | vivo |
T12467 | 37883-37885 | IN | denotes | at |
T12468 | 37886-37887 | CD | denotes | 2 |
T12469 | 37888-37889 | NN | denotes | h |
T12470 | 37890-37892 | IN | denotes | in |
T12471 | 37893-37900 | NNS | denotes | samples |
T12472 | 37901-37905 | IN | denotes | from |
T12473 | 37906-37909 | CD | denotes | two |
T12474 | 37910-37918 | NNS | denotes | patients |
T12475 | 37919-37920 | -LRB- | denotes | ( |
T12476 | 37920-37926 | NN | denotes | Figure |
T12477 | 37927-37929 | CD | denotes | 7E |
T12478 | 37929-37930 | -RRB- | denotes | ) |
T12479 | 37930-37931 | . | denotes | . |
T12480 | 39418-39423 | VBN | denotes | Taken |
T12481 | 39424-39432 | RB | denotes | together |
T12482 | 39432-39433 | , | denotes | , |
T12483 | 39434-39437 | PRP$ | denotes | our |
T12484 | 39438-39442 | NNS | denotes | data |
T12485 | 39443-39450 | VBP | denotes | suggest |
T12486 | 39451-39455 | IN | denotes | that |
T12487 | 39456-39463 | VBD | denotes | inhaled |
T12488 | 39464-39466 | NNP | denotes | FP |
T12489 | 39467-39474 | VBZ | denotes | reduces |
T12490 | 39475-39482 | JJ | denotes | nuclear |
T12491 | 39483-39495 | NN | denotes | localization |
T12492 | 39496-39498 | IN | denotes | of |
T12493 | 39499-39505 | NN | denotes | GATA-3 |
T12494 | 39506-39508 | IN | denotes | in |
T12495 | 39509-39513 | NN | denotes | vivo |
T12496 | 39514-39516 | IN | denotes | by |
T12497 | 39517-39524 | RB | denotes | acutely |
T12498 | 39525-39535 | VBG | denotes | inhibiting |
T12499 | 39536-39550 | JJ | denotes | phospho-GATA-3 |
T12500 | 39551-39559 | NN | denotes | importin |
T12501 | 39560-39571 | NN | denotes | association |
T12502 | 39571-39572 | . | denotes | . |
T12503 | 39573-39577 | DT | denotes | This |
T12504 | 39578-39584 | NN | denotes | effect |
T12505 | 39585-39588 | MD | denotes | may |
T12506 | 39589-39591 | VB | denotes | be |
T12507 | 39592-39598 | JJ | denotes | direct |
T12508 | 39598-39599 | , | denotes | , |
T12509 | 39600-39607 | IN | denotes | through |
T12510 | 39608-39619 | NN | denotes | competition |
T12511 | 39620-39623 | IN | denotes | for |
T12512 | 39624-39634 | JJ | denotes | importin-α |
T12513 | 39635-39637 | CC | denotes | or |
T12514 | 39638-39648 | VBN | denotes | associated |
T12515 | 39649-39658 | NNS | denotes | molecules |
T12516 | 39658-39659 | , | denotes | , |
T12517 | 39660-39662 | CC | denotes | or |
T12518 | 39663-39672 | JJ | denotes | secondary |
T12519 | 39673-39675 | TO | denotes | to |
T12520 | 39676-39678 | DT | denotes | an |
T12521 | 39679-39685 | NN | denotes | effect |
T12522 | 39686-39688 | IN | denotes | on |
T12523 | 39689-39692 | CD | denotes | p38 |
T12524 | 39693-39706 | JJ | denotes | MAPK-mediated |
T12525 | 39707-39713 | JJ | denotes | GATA-3 |
T12526 | 39714-39729 | NN | denotes | phosphorylation |
T12527 | 39730-39733 | IN | denotes | via |
T12528 | 39734-39739 | JJ | denotes | rapid |
T12529 | 39740-39749 | NN | denotes | induction |
T12530 | 39750-39752 | IN | denotes | of |
T12531 | 39753-39758 | NN | denotes | MKP-1 |
T12532 | 39758-39759 | . | denotes | . |
T12533 | 39760-39763 | DT | denotes | The |
T12534 | 39764-39775 | NN | denotes | combination |
T12535 | 39776-39778 | IN | denotes | of |
T12536 | 39779-39784 | DT | denotes | these |
T12537 | 39785-39788 | CD | denotes | two |
T12538 | 39789-39800 | VBG | denotes | interacting |
T12539 | 39801-39808 | NNS | denotes | effects |
T12540 | 39809-39812 | MD | denotes | can |
T12541 | 39813-39819 | VB | denotes | result |
T12542 | 39820-39822 | IN | denotes | in |
T12543 | 39823-39831 | JJ | denotes | complete |
T12544 | 39832-39843 | NN | denotes | suppression |
T12545 | 39844-39846 | IN | denotes | of |
T12546 | 39847-39853 | JJ | denotes | GATA-3 |
T12547 | 39854-39861 | JJ | denotes | nuclear |
T12548 | 39862-39868 | NN | denotes | import |
T12549 | 39869-39872 | CC | denotes | and |
T12550 | 39873-39877 | RB | denotes | thus |
T12551 | 39878-39881 | JJ | denotes | Th2 |
T12552 | 39882-39890 | NN | denotes | cytokine |
T12553 | 39891-39895 | NN | denotes | gene |
T12554 | 39896-39906 | NN | denotes | expression |
T12555 | 39906-39907 | . | denotes | . |
T14309 | 39920-39924 | RB | denotes | Here |
T14310 | 39925-39927 | PRP | denotes | we |
T14311 | 39928-39932 | VBP | denotes | have |
T14312 | 39933-39945 | VBN | denotes | demonstrated |
T14313 | 39945-39946 | , | denotes | , |
T14314 | 39947-39949 | TO | denotes | to |
T14315 | 39950-39953 | PRP$ | denotes | our |
T14316 | 39954-39963 | NN | denotes | knowledge |
T14317 | 39964-39967 | IN | denotes | for |
T14318 | 39968-39971 | DT | denotes | the |
T14319 | 39972-39977 | JJ | denotes | first |
T14320 | 39978-39982 | NN | denotes | time |
T14321 | 39982-39983 | , | denotes | , |
T14322 | 39984-39988 | IN | denotes | that |
T14323 | 39989-40004 | NNS | denotes | corticosteroids |
T14324 | 40005-40008 | MD | denotes | may |
T14325 | 40009-40016 | VB | denotes | inhibit |
T14326 | 40017-40023 | JJ | denotes | GATA-3 |
T14327 | 40024-40032 | NN | denotes | function |
T14328 | 40033-40036 | CC | denotes | and |
T14329 | 40037-40046 | RB | denotes | therefore |
T14330 | 40047-40050 | DT | denotes | the |
T14331 | 40051-40064 | NN | denotes | transcription |
T14332 | 40065-40067 | IN | denotes | of |
T14333 | 40068-40071 | JJ | denotes | Th2 |
T14334 | 40072-40077 | NNS | denotes | genes |
T14335 | 40078-40081 | IN | denotes | via |
T14336 | 40082-40085 | CD | denotes | two |
T14337 | 40086-40094 | JJ | denotes | distinct |
T14338 | 40095-40098 | CC | denotes | but |
T14339 | 40099-40110 | VBG | denotes | interacting |
T14340 | 40111-40120 | JJ | denotes | molecular |
T14341 | 40121-40131 | NNS | denotes | mechanisms |
T14342 | 40131-40132 | . | denotes | . |
T14343 | 40133-40140 | RB | denotes | Firstly |
T14344 | 40140-40141 | , | denotes | , |
T14345 | 40142-40166 | JJ | denotes | corticosteroid-activated |
T14346 | 40167-40169 | NNP | denotes | GR |
T14347 | 40170-40177 | VBZ | denotes | appears |
T14348 | 40178-40180 | TO | denotes | to |
T14349 | 40181-40188 | VB | denotes | compete |
T14350 | 40189-40193 | IN | denotes | with |
T14351 | 40194-40203 | VBN | denotes | activated |
T14352 | 40204-40210 | NNP | denotes | GATA-3 |
T14353 | 40211-40214 | IN | denotes | for |
T14354 | 40215-40222 | JJ | denotes | nuclear |
T14355 | 40223-40229 | NN | denotes | import |
T14356 | 40230-40233 | IN | denotes | via |
T14357 | 40234-40244 | JJ | denotes | importin-α |
T14358 | 40244-40245 | , | denotes | , |
T14359 | 40246-40251 | WDT | denotes | which |
T14360 | 40252-40254 | VBZ | denotes | is |
T14361 | 40255-40263 | VBN | denotes | required |
T14362 | 40264-40267 | IN | denotes | for |
T14363 | 40268-40271 | DT | denotes | the |
T14364 | 40272-40279 | JJ | denotes | nuclear |
T14365 | 40280-40289 | NN | denotes | transport |
T14366 | 40290-40292 | IN | denotes | of |
T14367 | 40293-40297 | DT | denotes | both |
T14368 | 40298-40304 | NNP | denotes | GATA-3 |
T14369 | 40305-40308 | CC | denotes | and |
T14370 | 40309-40311 | NNP | denotes | GR |
T14371 | 40311-40312 | . | denotes | . |
T14372 | 40313-40321 | RB | denotes | Secondly |
T14373 | 40321-40322 | , | denotes | , |
T14374 | 40323-40338 | NNS | denotes | corticosteroids |
T14375 | 40339-40341 | IN | denotes | at |
T14376 | 40342-40348 | JJR | denotes | higher |
T14377 | 40349-40363 | NNS | denotes | concentrations |
T14378 | 40364-40372 | VB | denotes | increase |
T14379 | 40373-40376 | DT | denotes | the |
T14380 | 40377-40387 | NN | denotes | expression |
T14381 | 40388-40390 | IN | denotes | of |
T14382 | 40391-40396 | NNP | denotes | MKP-1 |
T14383 | 40396-40397 | , | denotes | , |
T14384 | 40398-40399 | DT | denotes | a |
T14385 | 40400-40406 | JJ | denotes | potent |
T14386 | 40407-40416 | NN | denotes | inhibitor |
T14387 | 40417-40419 | IN | denotes | of |
T14388 | 40420-40423 | CD | denotes | p38 |
T14389 | 40424-40428 | NNP | denotes | MAPK |
T14390 | 40429-40437 | NN | denotes | activity |
T14391 | 40438-40441 | CC | denotes | and |
T14392 | 40442-40449 | RB | denotes | thereby |
T14393 | 40450-40457 | VB | denotes | prevent |
T14394 | 40458-40459 | NNP | denotes | T |
T14395 | 40460-40464 | NN | denotes | cell |
T14396 | 40465-40485 | NN | denotes | receptor/co-receptor |
T14397 | 40486-40496 | NN | denotes | activation |
T14398 | 40497-40499 | IN | denotes | of |
T14399 | 40500-40503 | CD | denotes | p38 |
T14400 | 40504-40508 | NNP | denotes | MAPK |
T14401 | 40509-40511 | TO | denotes | to |
T14402 | 40512-40519 | VB | denotes | prevent |
T14403 | 40520-40523 | DT | denotes | the |
T14404 | 40524-40539 | NN | denotes | phosphorylation |
T14405 | 40540-40542 | IN | denotes | of |
T14406 | 40543-40549 | NN | denotes | GATA-3 |
T14407 | 40550-40554 | WDT | denotes | that |
T14408 | 40555-40557 | VBZ | denotes | is |
T14409 | 40558-40567 | JJ | denotes | necessary |
T14410 | 40568-40571 | IN | denotes | for |
T14411 | 40572-40583 | NN | denotes | interaction |
T14412 | 40584-40588 | IN | denotes | with |
T14413 | 40589-40599 | JJ | denotes | importin-α |
T14414 | 40600-40603 | CC | denotes | and |
T14415 | 40604-40614 | JJ | denotes | subsequent |
T14416 | 40615-40622 | JJ | denotes | nuclear |
T14417 | 40623-40629 | NN | denotes | import |
T14418 | 40629-40630 | . | denotes | . |
T14419 | 40631-40633 | PRP | denotes | We |
T14420 | 40634-40638 | VBP | denotes | have |
T14421 | 40639-40649 | RB | denotes | previously |
T14422 | 40650-40655 | VBN | denotes | shown |
T14423 | 40656-40660 | IN | denotes | that |
T14424 | 40661-40674 | NN | denotes | translocation |
T14425 | 40675-40677 | IN | denotes | of |
T14426 | 40678-40684 | NN | denotes | GATA-3 |
T14427 | 40685-40689 | IN | denotes | from |
T14428 | 40690-40693 | DT | denotes | the |
T14429 | 40694-40703 | NN | denotes | cytoplasm |
T14430 | 40704-40706 | TO | denotes | to |
T14431 | 40707-40710 | DT | denotes | the |
T14432 | 40711-40718 | NN | denotes | nucleus |
T14433 | 40719-40727 | VBZ | denotes | involves |
T14434 | 40728-40731 | DT | denotes | the |
T14435 | 40732-40739 | JJ | denotes | nuclear |
T14436 | 40740-40751 | NN | denotes | transporter |
T14437 | 40752-40759 | NN | denotes | protein |
T14438 | 40760-40770 | NN | denotes | importin-α |
T14439 | 40770-40771 | , | denotes | , |
T14440 | 40772-40777 | WDT | denotes | which |
T14441 | 40778-40787 | VBZ | denotes | interacts |
T14442 | 40788-40792 | IN | denotes | with |
T14443 | 40793-40807 | VBN | denotes | phosphorylated |
T14444 | 40808-40814 | NNP | denotes | GATA-3 |
T14445 | 40815-40816 | NNP | denotes | [ |
T14446 | 40816-40818 | CD | denotes | 12 |
T14447 | 40818-40819 | NNP | denotes | ] |
T14448 | 40819-40820 | . | denotes | . |
T14449 | 40821-40823 | PRP | denotes | We |
T14450 | 40824-40828 | VBP | denotes | have |
T14451 | 40829-40833 | RB | denotes | also |
T14452 | 40834-40844 | RB | denotes | previously |
T14453 | 40845-40853 | VBN | denotes | reported |
T14454 | 40854-40858 | IN | denotes | that |
T14455 | 40859-40865 | JJ | denotes | GATA-3 |
T14456 | 40866-40875 | NN | denotes | knockdown |
T14457 | 40876-40881 | VBG | denotes | using |
T14458 | 40882-40887 | NNP | denotes | siRNA |
T14459 | 40888-40895 | NNS | denotes | results |
T14460 | 40896-40898 | IN | denotes | in |
T14461 | 40899-40910 | NN | denotes | suppression |
T14462 | 40911-40913 | IN | denotes | of |
T14463 | 40914-40922 | JJ | denotes | anti-CD3 |
T14464 | 40922-40923 | NN | denotes | / |
T14465 | 40923-40927 | CD | denotes | CD28 |
T14466 | 40928-40938 | VBD | denotes | stimulated |
T14467 | 40939-40943 | NN | denotes | IL-4 |
T14468 | 40943-40944 | NN | denotes | / |
T14469 | 40944-40948 | NN | denotes | IL-5 |
T14470 | 40949-40953 | NNP | denotes | mRNA |
T14471 | 40954-40963 | NN | denotes | induction |
T14472 | 40963-40964 | , | denotes | , |
T14473 | 40965-40969 | RB | denotes | thus |
T14474 | 40970-40981 | VBG | denotes | implicating |
T14475 | 40982-40984 | DT | denotes | an |
T14476 | 40985-40994 | JJ | denotes | essential |
T14477 | 40995-40999 | NN | denotes | role |
T14478 | 41000-41003 | IN | denotes | for |
T14479 | 41004-41010 | NNP | denotes | GATA-3 |
T14480 | 41011-41013 | IN | denotes | in |
T14481 | 41014-41017 | DT | denotes | the |
T14482 | 41018-41031 | NN | denotes | transcription |
T14483 | 41032-41034 | IN | denotes | of |
T14484 | 41035-41040 | DT | denotes | these |
T14485 | 41041-41046 | NNS | denotes | genes |
T14486 | 41047-41048 | NNP | denotes | [ |
T14487 | 41048-41050 | CD | denotes | 12 |
T14488 | 41050-41051 | NNP | denotes | ] |
T14489 | 41051-41052 | . | denotes | . |
T14490 | 41053-41055 | PRP | denotes | We |
T14491 | 41056-41059 | RB | denotes | now |
T14492 | 41060-41067 | VBP | denotes | confirm |
T14493 | 41067-41068 | , | denotes | , |
T14494 | 41069-41071 | IN | denotes | in |
T14495 | 41072-41077 | JJ | denotes | human |
T14496 | 41078-41079 | NNP | denotes | T |
T14497 | 41080-41085 | NNS | denotes | cells |
T14498 | 41085-41086 | , | denotes | , |
T14499 | 41087-41091 | IN | denotes | that |
T14500 | 41092-41094 | NNP | denotes | GR |
T14501 | 41095-41099 | RB | denotes | also |
T14502 | 41100-41104 | VBZ | denotes | uses |
T14503 | 41105-41108 | DT | denotes | the |
T14504 | 41109-41113 | JJ | denotes | same |
T14505 | 41114-41121 | JJ | denotes | nuclear |
T14506 | 41122-41128 | NN | denotes | import |
T14507 | 41129-41138 | NN | denotes | mechanism |
T14508 | 41139-41141 | IN | denotes | as |
T14509 | 41142-41148 | JJ | denotes | GATA-3 |
T14510 | 41149-41150 | NNP | denotes | [ |
T14511 | 41150-41152 | CD | denotes | 22 |
T14512 | 41152-41153 | NNP | denotes | ] |
T14513 | 41153-41154 | . | denotes | . |
T14514 | 41155-41157 | PRP | denotes | We |
T14515 | 41158-41167 | RB | denotes | therefore |
T14516 | 41168-41175 | VBP | denotes | propose |
T14517 | 41176-41180 | IN | denotes | that |
T14518 | 41181-41186 | EX | denotes | there |
T14519 | 41187-41189 | VBZ | denotes | is |
T14520 | 41190-41201 | NN | denotes | competition |
T14521 | 41202-41209 | IN | denotes | between |
T14522 | 41210-41226 | JJ | denotes | ligand-activated |
T14523 | 41227-41229 | NNP | denotes | GR |
T14524 | 41230-41233 | CC | denotes | and |
T14525 | 41234-41248 | NNP | denotes | phospho-GATA-3 |
T14526 | 41249-41252 | IN | denotes | for |
T14527 | 41253-41260 | JJ | denotes | nuclear |
T14528 | 41261-41267 | NN | denotes | import |
T14529 | 41267-41268 | . | denotes | . |
T14530 | 41269-41280 | RB | denotes | Furthermore |
T14531 | 41280-41281 | , | denotes | , |
T14532 | 41282-41284 | PRP | denotes | we |
T14533 | 41285-41289 | VBP | denotes | have |
T14534 | 41290-41295 | VBN | denotes | shown |
T14535 | 41296-41300 | IN | denotes | that |
T14536 | 41301-41306 | EX | denotes | there |
T14537 | 41307-41309 | VBZ | denotes | is |
T14538 | 41310-41322 | JJ | denotes | preferential |
T14539 | 41323-41330 | JJ | denotes | binding |
T14540 | 41331-41333 | IN | denotes | of |
T14541 | 41334-41344 | JJ | denotes | importin-α |
T14542 | 41345-41347 | TO | denotes | to |
T14543 | 41348-41357 | VBN | denotes | activated |
T14544 | 41358-41360 | NNP | denotes | GR |
T14545 | 41361-41365 | IN | denotes | over |
T14546 | 41366-41380 | NNP | denotes | phospho-GATA-3 |
T14547 | 41380-41381 | , | denotes | , |
T14548 | 41382-41384 | RB | denotes | so |
T14549 | 41385-41389 | IN | denotes | that |
T14550 | 41390-41405 | NNS | denotes | corticosteroids |
T14551 | 41406-41411 | MD | denotes | would |
T14552 | 41412-41426 | RB | denotes | preferentially |
T14553 | 41427-41433 | VB | denotes | reduce |
T14554 | 41434-41440 | JJ | denotes | GATA-3 |
T14555 | 41441-41446 | NN | denotes | entry |
T14556 | 41447-41450 | CC | denotes | and |
T14557 | 41451-41455 | RB | denotes | thus |
T14558 | 41456-41463 | RB | denotes | rapidly |
T14559 | 41464-41470 | VB | denotes | switch |
T14560 | 41471-41474 | RP | denotes | off |
T14561 | 41475-41478 | CD | denotes | Th2 |
T14562 | 41479-41483 | NN | denotes | gene |
T14563 | 41484-41497 | NN | denotes | transcription |
T14564 | 41498-41505 | IN | denotes | without |
T14565 | 41506-41509 | DT | denotes | any |
T14566 | 41510-41514 | NN | denotes | need |
T14567 | 41515-41518 | IN | denotes | for |
T14568 | 41519-41522 | DT | denotes | any |
T14569 | 41523-41535 | JJ | denotes | intermediate |
T14570 | 41536-41541 | NNS | denotes | steps |
T14571 | 41541-41542 | . | denotes | . |
T14572 | 41543-41554 | RB | denotes | Furthermore |
T14573 | 41554-41555 | , | denotes | , |
T14574 | 41556-41561 | EX | denotes | there |
T14575 | 41562-41565 | VBD | denotes | was |
T14576 | 41566-41570 | DT | denotes | some |
T14577 | 41571-41577 | NN | denotes | degree |
T14578 | 41578-41580 | IN | denotes | of |
T14579 | 41581-41592 | NN | denotes | specificity |
T14580 | 41593-41596 | IN | denotes | for |
T14581 | 41597-41603 | NNP | denotes | GATA-3 |
T14582 | 41603-41604 | , | denotes | , |
T14583 | 41605-41607 | IN | denotes | as |
T14584 | 41608-41615 | JJ | denotes | nuclear |
T14585 | 41616-41629 | NN | denotes | translocation |
T14586 | 41630-41632 | IN | denotes | of |
T14587 | 41633-41636 | DT | denotes | the |
T14588 | 41637-41640 | CD | denotes | p65 |
T14589 | 41641-41648 | NN | denotes | subunit |
T14590 | 41649-41651 | IN | denotes | of |
T14591 | 41652-41657 | NN | denotes | NF-κB |
T14592 | 41658-41661 | VBD | denotes | was |
T14593 | 41662-41665 | RB | denotes | not |
T14594 | 41666-41674 | VBN | denotes | affected |
T14595 | 41675-41677 | IN | denotes | by |
T14596 | 41678-41692 | JJ | denotes | corticosteroid |
T14597 | 41693-41701 | NN | denotes | exposure |
T14598 | 41701-41702 | . | denotes | . |
T14599 | 41703-41705 | PRP | denotes | We |
T14600 | 41706-41712 | VBD | denotes | tested |
T14601 | 41713-41717 | DT | denotes | some |
T14602 | 41718-41729 | JJ | denotes | alternative |
T14603 | 41730-41742 | NNS | denotes | explanations |
T14604 | 41743-41746 | IN | denotes | for |
T14605 | 41747-41751 | DT | denotes | this |
T14606 | 41752-41758 | NN | denotes | effect |
T14607 | 41759-41761 | IN | denotes | of |
T14608 | 41762-41764 | NNP | denotes | FP |
T14609 | 41765-41767 | IN | denotes | on |
T14610 | 41768-41774 | NNP | denotes | GATA-3 |
T14611 | 41775-41782 | JJ | denotes | nuclear |
T14612 | 41783-41792 | NN | denotes | exclusion |
T14613 | 41793-41796 | CC | denotes | and |
T14614 | 41797-41803 | VBD | denotes | failed |
T14615 | 41804-41806 | TO | denotes | to |
T14616 | 41807-41811 | VB | denotes | show |
T14617 | 41812-41816 | IN | denotes | that |
T14618 | 41817-41819 | NNP | denotes | FP |
T14619 | 41820-41826 | CC | denotes | either |
T14620 | 41827-41835 | VBZ | denotes | enhances |
T14621 | 41836-41842 | JJ | denotes | GATA-3 |
T14622 | 41843-41850 | JJ | denotes | nuclear |
T14623 | 41851-41857 | NN | denotes | export |
T14624 | 41858-41866 | RB | denotes | directly |
T14625 | 41867-41869 | CC | denotes | or |
T14626 | 41870-41877 | VBZ | denotes | induces |
T14627 | 41878-41884 | JJ | denotes | GATA-3 |
T14628 | 41885-41896 | NN | denotes | degradation |
T14629 | 41896-41897 | . | denotes | . |
T14630 | 41898-41901 | DT | denotes | The |
T14631 | 41902-41910 | NN | denotes | evidence |
T14632 | 41911-41915 | IN | denotes | from |
T14633 | 41916-41919 | DT | denotes | the |
T14634 | 41920-41922 | IN | denotes | in |
T14635 | 41923-41928 | NN | denotes | vitro |
T14636 | 41929-41940 | NN | denotes | competition |
T14637 | 41941-41947 | VBZ | denotes | assays |
T14638 | 41948-41952 | VBZ | denotes | does |
T14639 | 41952-41953 | , | denotes | , |
T14640 | 41954-41961 | RB | denotes | however |
T14641 | 41961-41962 | , | denotes | , |
T14642 | 41963-41970 | VBP | denotes | suggest |
T14643 | 41971-41975 | IN | denotes | that |
T14644 | 41976-41984 | JJ | denotes | purified |
T14645 | 41985-41994 | VBN | denotes | activated |
T14646 | 41995-41997 | NNP | denotes | GR |
T14647 | 41998-42001 | MD | denotes | can |
T14648 | 42002-42009 | RB | denotes | clearly |
T14649 | 42010-42019 | VB | denotes | attenuate |
T14650 | 42020-42028 | VBN | denotes | purified |
T14651 | 42029-42043 | JJ | denotes | phospho-GATA-3 |
T14652 | 42044-42054 | JJ | denotes | importin-α |
T14653 | 42055-42066 | NN | denotes | association |
T14654 | 42067-42070 | CC | denotes | and |
T14655 | 42071-42075 | IN | denotes | that |
T14656 | 42076-42079 | DT | denotes | the |
T14657 | 42080-42088 | NN | denotes | converse |
T14658 | 42089-42093 | VBZ | denotes | does |
T14659 | 42094-42097 | RB | denotes | not |
T14660 | 42098-42103 | VB | denotes | occur |
T14661 | 42103-42104 | . | denotes | . |
T14662 | 42105-42116 | RB | denotes | Furthermore |
T14663 | 42116-42117 | , | denotes | , |
T14664 | 42118-42120 | PRP | denotes | we |
T14665 | 42121-42125 | VBP | denotes | have |
T14666 | 42126-42131 | VBN | denotes | shown |
T14667 | 42132-42136 | IN | denotes | that |
T14668 | 42137-42141 | RB | denotes | only |
T14669 | 42142-42156 | JJ | denotes | phospho-GATA-3 |
T14670 | 42157-42160 | MD | denotes | can |
T14671 | 42161-42170 | VB | denotes | associate |
T14672 | 42171-42175 | IN | denotes | with |
T14673 | 42176-42186 | JJ | denotes | importin-α |
T14674 | 42186-42187 | . | denotes | . |
T14675 | 42188-42192 | DT | denotes | This |
T14676 | 42193-42202 | NN | denotes | mechanism |
T14677 | 42203-42205 | VBZ | denotes | is |
T14678 | 42206-42215 | JJ | denotes | sensitive |
T14679 | 42216-42218 | TO | denotes | to |
T14680 | 42219-42223 | RB | denotes | very |
T14681 | 42224-42227 | JJ | denotes | low |
T14682 | 42228-42242 | NNS | denotes | concentrations |
T14683 | 42243-42245 | IN | denotes | of |
T14684 | 42246-42260 | JJ | denotes | corticosteroid |
T14685 | 42261-42264 | CC | denotes | and |
T14686 | 42265-42270 | MD | denotes | would |
T14687 | 42271-42273 | VB | denotes | be |
T14688 | 42274-42279 | JJ | denotes | rapid |
T14689 | 42280-42282 | IN | denotes | in |
T14690 | 42283-42288 | NN | denotes | onset |
T14691 | 42289-42291 | IN | denotes | as |
T14692 | 42292-42294 | DT | denotes | no |
T14693 | 42295-42302 | NNS | denotes | changes |
T14694 | 42303-42305 | IN | denotes | in |
T14695 | 42306-42313 | NN | denotes | protein |
T14696 | 42314-42323 | NN | denotes | synthesis |
T14697 | 42324-42327 | VBP | denotes | are |
T14698 | 42328-42336 | VBN | denotes | required |
T14699 | 42336-42337 | . | denotes | . |
T14700 | 42338-42342 | DT | denotes | This |
T14701 | 42343-42348 | JJ | denotes | acute |
T14702 | 42349-42358 | NN | denotes | mechanism |
T14703 | 42359-42362 | MD | denotes | may |
T14704 | 42363-42367 | RB | denotes | also |
T14705 | 42368-42378 | VB | denotes | contribute |
T14706 | 42379-42381 | TO | denotes | to |
T14707 | 42382-42385 | DT | denotes | the |
T14708 | 42386-42395 | NN | denotes | reduction |
T14709 | 42396-42398 | IN | denotes | in |
T14710 | 42399-42405 | JJ | denotes | GATA-3 |
T14711 | 42406-42413 | JJ | denotes | nuclear |
T14712 | 42414-42420 | NN | denotes | import |
T14713 | 42421-42424 | CC | denotes | and |
T14714 | 42425-42428 | MD | denotes | may |
T14715 | 42429-42433 | VB | denotes | play |
T14716 | 42434-42435 | DT | denotes | a |
T14717 | 42436-42441 | JJ | denotes | major |
T14718 | 42442-42446 | NN | denotes | role |
T14719 | 42447-42449 | IN | denotes | at |
T14720 | 42450-42453 | JJ | denotes | low |
T14721 | 42454-42468 | JJ | denotes | corticosteroid |
T14722 | 42469-42483 | NNS | denotes | concentrations |
T14723 | 42484-42490 | CC | denotes | and/or |
T14724 | 42491-42493 | IN | denotes | at |
T14725 | 42494-42499 | JJ | denotes | early |
T14726 | 42500-42504 | NN | denotes | time |
T14727 | 42505-42511 | NNS | denotes | points |
T14728 | 42512-42517 | RB | denotes | prior |
T14729 | 42518-42520 | TO | denotes | to |
T14730 | 42521-42526 | NNP | denotes | MKP-1 |
T14731 | 42527-42536 | NN | denotes | induction |
T14732 | 42536-42537 | . | denotes | . |
T14733 | 42538-42553 | NNS | denotes | Corticosteroids |
T14734 | 42554-42557 | MD | denotes | can |
T14735 | 42558-42566 | VB | denotes | modulate |
T14736 | 42567-42570 | CD | denotes | p38 |
T14737 | 42571-42575 | NNP | denotes | MAPK |
T14738 | 42576-42584 | NN | denotes | activity |
T14739 | 42585-42592 | IN | denotes | through |
T14740 | 42593-42596 | DT | denotes | the |
T14741 | 42597-42606 | NN | denotes | induction |
T14742 | 42607-42609 | IN | denotes | of |
T14743 | 42610-42615 | NNP | denotes | MKP-1 |
T14744 | 42615-42616 | , | denotes | , |
T14745 | 42617-42618 | DT | denotes | a |
T14746 | 42619-42625 | JJ | denotes | potent |
T14747 | 42626-42636 | JJ | denotes | endogenous |
T14748 | 42637-42646 | NN | denotes | inhibitor |
T14749 | 42647-42649 | IN | denotes | of |
T14750 | 42650-42654 | NNP | denotes | MAPK |
T14751 | 42655-42663 | NN | denotes | function |
T14752 | 42664-42665 | NNP | denotes | [ |
T14753 | 42665-42667 | CD | denotes | 38 |
T14754 | 42667-42668 | NNP | denotes | ] |
T14755 | 42668-42669 | , | denotes | , |
T14756 | 42669-42670 | NNP | denotes | [ |
T14757 | 42670-42672 | CD | denotes | 39 |
T14758 | 42672-42673 | NNP | denotes | ] |
T14759 | 42673-42674 | . | denotes | . |
T14760 | 42675-42677 | PRP | denotes | We |
T14761 | 42678-42684 | VBP | denotes | report |
T14762 | 42685-42689 | RB | denotes | here |
T14763 | 42690-42691 | DT | denotes | a |
T14764 | 42692-42697 | JJ | denotes | rapid |
T14765 | 42698-42707 | NN | denotes | induction |
T14766 | 42708-42710 | IN | denotes | of |
T14767 | 42711-42716 | NNP | denotes | MKP-1 |
T14768 | 42717-42721 | NNP | denotes | mRNA |
T14769 | 42722-42731 | VBG | denotes | following |
T14770 | 42732-42743 | NN | denotes | stimulation |
T14771 | 42744-42746 | IN | denotes | of |
T14772 | 42747-42752 | NNS | denotes | cells |
T14773 | 42753-42757 | IN | denotes | with |
T14774 | 42758-42768 | RB | denotes | relatively |
T14775 | 42769-42773 | JJ | denotes | high |
T14776 | 42774-42788 | NNS | denotes | concentrations |
T14777 | 42789-42791 | IN | denotes | of |
T14778 | 42792-42794 | NNP | denotes | FP |
T14779 | 42794-42795 | . | denotes | . |
T14780 | 42796-42798 | PRP | denotes | We |
T14781 | 42799-42810 | VBP | denotes | hypothesize |
T14782 | 42811-42815 | IN | denotes | that |
T14783 | 42816-42820 | DT | denotes | this |
T14784 | 42821-42826 | JJ | denotes | rapid |
T14785 | 42827-42836 | NN | denotes | induction |
T14786 | 42837-42839 | IN | denotes | of |
T14787 | 42840-42845 | NN | denotes | MKP-1 |
T14788 | 42846-42849 | MD | denotes | can |
T14789 | 42850-42856 | VB | denotes | reduce |
T14790 | 42857-42863 | JJ | denotes | GATA-3 |
T14791 | 42864-42871 | JJ | denotes | nuclear |
T14792 | 42872-42878 | NN | denotes | import |
T14793 | 42879-42881 | IN | denotes | by |
T14794 | 42882-42893 | VBG | denotes | attenuating |
T14795 | 42894-42897 | CD | denotes | p38 |
T14796 | 42898-42902 | NNP | denotes | MAPK |
T14797 | 42903-42911 | NN | denotes | activity |
T14798 | 42912-42915 | CC | denotes | and |
T14799 | 42916-42926 | JJ | denotes | subsequent |
T14800 | 42927-42933 | NN | denotes | GATA-3 |
T14801 | 42934-42949 | NN | denotes | phosphorylation |
T14802 | 42949-42950 | , | denotes | , |
T14803 | 42951-42955 | RB | denotes | thus |
T14804 | 42956-42966 | VBG | denotes | preventing |
T14805 | 42967-42974 | JJ | denotes | nuclear |
T14806 | 42975-42988 | NN | denotes | translocation |
T14807 | 42988-42989 | . | denotes | . |
T14808 | 42990-42993 | DT | denotes | The |
T14809 | 42994-43002 | NN | denotes | location |
T14810 | 43003-43005 | IN | denotes | of |
T14811 | 43006-43009 | DT | denotes | the |
T14812 | 43010-43016 | NN | denotes | serine |
T14813 | 43017-43024 | NN | denotes | residue |
T14814 | 43024-43025 | -LRB- | denotes | ( |
T14815 | 43025-43026 | PRP | denotes | s |
T14816 | 43026-43027 | -RRB- | denotes | ) |
T14817 | 43028-43030 | IN | denotes | of |
T14818 | 43031-43037 | NN | denotes | GATA-3 |
T14819 | 43038-43042 | WDT | denotes | that |
T14820 | 43043-43046 | VBP | denotes | are |
T14821 | 43047-43061 | VBN | denotes | phosphorylated |
T14822 | 43062-43064 | IN | denotes | by |
T14823 | 43065-43068 | CD | denotes | p38 |
T14824 | 43069-43073 | NNP | denotes | MAPK |
T14825 | 43074-43077 | VBP | denotes | are |
T14826 | 43078-43087 | RB | denotes | currently |
T14827 | 43088-43095 | JJ | denotes | unknown |
T14828 | 43095-43096 | , | denotes | , |
T14829 | 43097-43100 | CC | denotes | but |
T14830 | 43101-43102 | DT | denotes | a |
T14831 | 43103-43117 | NNS | denotes | bioinformatics |
T14832 | 43118-43124 | NN | denotes | search |
T14833 | 43125-43126 | -LRB- | denotes | ( |
T14834 | 43126-43131 | NNP | denotes | Motif |
T14835 | 43132-43139 | NNP | denotes | Scanner |
T14836 | 43139-43140 | , | denotes | , |
T14837 | 43141-43184 | NNP | denotes | http://scansite.mit.edu/motifscan_seq.phtml |
T14838 | 43184-43185 | -RRB- | denotes | ) |
T14839 | 43186-43195 | VBZ | denotes | indicates |
T14840 | 43196-43198 | IN | denotes | at |
T14841 | 43199-43204 | JJS | denotes | least |
T14842 | 43205-43210 | CD | denotes | three |
T14843 | 43211-43220 | JJ | denotes | potential |
T14844 | 43221-43224 | CD | denotes | p38 |
T14845 | 43225-43239 | JJ | denotes | MAPK-sensitive |
T14846 | 43240-43246 | NN | denotes | serine |
T14847 | 43247-43255 | NNS | denotes | residues |
T14848 | 43255-43256 | . | denotes | . |
T14849 | 43257-43259 | IN | denotes | As |
T14850 | 43260-43269 | VBN | denotes | predicted |
T14851 | 43270-43274 | IN | denotes | from |
T14852 | 43275-43280 | DT | denotes | these |
T14853 | 43281-43283 | IN | denotes | in |
T14854 | 43284-43289 | NN | denotes | vitro |
T14855 | 43290-43294 | NNS | denotes | data |
T14856 | 43294-43295 | , | denotes | , |
T14857 | 43296-43306 | NN | denotes | impairment |
T14858 | 43307-43309 | IN | denotes | of |
T14859 | 43310-43316 | JJ | denotes | GATA-3 |
T14860 | 43317-43324 | JJ | denotes | nuclear |
T14861 | 43325-43331 | NN | denotes | import |
T14862 | 43332-43334 | IN | denotes | by |
T14863 | 43335-43337 | NNP | denotes | FP |
T14864 | 43338-43341 | MD | denotes | may |
T14865 | 43341-43342 | , | denotes | , |
T14866 | 43343-43345 | IN | denotes | at |
T14867 | 43346-43351 | JJS | denotes | least |
T14868 | 43352-43354 | IN | denotes | in |
T14869 | 43355-43359 | NN | denotes | part |
T14870 | 43359-43360 | , | denotes | , |
T14871 | 43361-43369 | VBP | denotes | underlie |
T14872 | 43370-43373 | DT | denotes | the |
T14873 | 43374-43382 | NN | denotes | efficacy |
T14874 | 43383-43385 | IN | denotes | of |
T14875 | 43386-43401 | NNS | denotes | corticosteroids |
T14876 | 43402-43404 | IN | denotes | in |
T14877 | 43405-43416 | VBG | denotes | suppressing |
T14878 | 43417-43425 | JJ | denotes | allergic |
T14879 | 43426-43438 | NN | denotes | inflammation |
T14880 | 43438-43439 | . | denotes | . |
T14881 | 43440-43448 | IN | denotes | Although |
T14882 | 43449-43451 | PRP | denotes | we |
T14883 | 43452-43455 | VBD | denotes | did |
T14884 | 43456-43459 | RB | denotes | not |
T14885 | 43460-43466 | VB | denotes | assess |
T14886 | 43467-43470 | DT | denotes | the |
T14887 | 43471-43476 | JJ | denotes | acute |
T14888 | 43477-43487 | JJ | denotes | inhibitory |
T14889 | 43488-43494 | NN | denotes | effect |
T14890 | 43495-43497 | IN | denotes | of |
T14891 | 43498-43500 | NNP | denotes | FP |
T14892 | 43501-43503 | IN | denotes | on |
T14893 | 43504-43507 | DT | denotes | the |
T14894 | 43508-43518 | NN | denotes | expression |
T14895 | 43519-43521 | IN | denotes | of |
T14896 | 43522-43526 | NN | denotes | IL-4 |
T14897 | 43527-43531 | NNP | denotes | mRNA |
T14898 | 43532-43534 | IN | denotes | in |
T14899 | 43535-43539 | NN | denotes | vivo |
T14900 | 43539-43540 | , | denotes | , |
T14901 | 43541-43542 | DT | denotes | a |
T14902 | 43543-43549 | JJ | denotes | single |
T14903 | 43550-43560 | NN | denotes | inhalation |
T14904 | 43561-43563 | IN | denotes | of |
T14905 | 43564-43566 | NNP | denotes | FP |
T14906 | 43567-43568 | -LRB- | denotes | ( |
T14907 | 43568-43571 | CD | denotes | 500 |
T14908 | 43572-43574 | NN | denotes | µg |
T14909 | 43574-43575 | -RRB- | denotes | ) |
T14910 | 43576-43579 | MD | denotes | may |
T14911 | 43580-43584 | VB | denotes | have |
T14912 | 43585-43595 | JJ | denotes | comparable |
T14913 | 43596-43603 | NNS | denotes | effects |
T14914 | 43603-43604 | , | denotes | , |
T14915 | 43605-43607 | IN | denotes | as |
T14916 | 43608-43610 | PRP | denotes | it |
T14917 | 43611-43619 | VBZ | denotes | provides |
T14918 | 43620-43626 | NN | denotes | plasma |
T14919 | 43627-43633 | NNS | denotes | levels |
T14920 | 43634-43640 | IN | denotes | within |
T14921 | 43641-43642 | DT | denotes | a |
T14922 | 43643-43651 | JJ | denotes | relevant |
T14923 | 43652-43657 | NN | denotes | range |
T14924 | 43658-43660 | IN | denotes | of |
T14925 | 43661-43675 | NNS | denotes | concentrations |
T14926 | 43676-43680 | VBN | denotes | used |
T14927 | 43681-43683 | TO | denotes | to |
T14928 | 43684-43692 | VB | denotes | suppress |
T14929 | 43693-43697 | NN | denotes | IL-4 |
T14930 | 43698-43711 | NN | denotes | transcription |
T14931 | 43712-43714 | IN | denotes | in |
T14932 | 43715-43718 | PRP$ | denotes | our |
T14933 | 43719-43721 | IN | denotes | in |
T14934 | 43722-43727 | NN | denotes | vitro |
T14935 | 43728-43734 | NN | denotes | system |
T14936 | 43735-43736 | NNP | denotes | [ |
T14937 | 43736-43738 | CD | denotes | 37 |
T14938 | 43738-43739 | NNP | denotes | ] |
T14939 | 43739-43740 | . | denotes | . |
T14940 | 43741-43742 | DT | denotes | A |
T14941 | 43743-43748 | JJR | denotes | lower |
T14942 | 43749-43753 | NN | denotes | dose |
T14943 | 43754-43756 | IN | denotes | of |
T14944 | 43757-43764 | JJ | denotes | inhaled |
T14945 | 43765-43767 | NNP | denotes | FP |
T14946 | 43768-43769 | -LRB- | denotes | ( |
T14947 | 43769-43772 | CD | denotes | 100 |
T14948 | 43773-43775 | NN | denotes | µg |
T14949 | 43775-43776 | -RRB- | denotes | ) |
T14950 | 43777-43780 | VBD | denotes | was |
T14951 | 43781-43784 | RB | denotes | not |
T14952 | 43785-43794 | JJ | denotes | effective |
T14953 | 43794-43795 | , | denotes | , |
T14954 | 43796-43799 | CC | denotes | but |
T14955 | 43800-43806 | NN | denotes | plasma |
T14956 | 43807-43821 | NNS | denotes | concentrations |
T14957 | 43822-43825 | MD | denotes | may |
T14958 | 43826-43828 | VB | denotes | be |
T14959 | 43829-43834 | IN | denotes | below |
T14960 | 43835-43840 | DT | denotes | those |
T14961 | 43841-43849 | VBN | denotes | required |
T14962 | 43850-43853 | IN | denotes | for |
T14963 | 43854-43860 | JJ | denotes | GATA-3 |
T14964 | 43861-43871 | NN | denotes | inhibition |
T14965 | 43871-43872 | . | denotes | . |
T14966 | 43873-43880 | RB | denotes | However |
T14967 | 43880-43881 | , | denotes | , |
T14968 | 43882-43884 | PRP | denotes | it |
T14969 | 43885-43887 | VBZ | denotes | is |
T14970 | 43888-43894 | JJ | denotes | likely |
T14971 | 43895-43899 | IN | denotes | that |
T14972 | 43900-43903 | DT | denotes | the |
T14973 | 43904-43910 | JJR | denotes | higher |
T14974 | 43911-43925 | NNS | denotes | concentrations |
T14975 | 43926-43928 | IN | denotes | of |
T14976 | 43929-43931 | NNP | denotes | FP |
T14977 | 43932-43934 | IN | denotes | in |
T14978 | 43935-43938 | DT | denotes | the |
T14979 | 43939-43946 | NNS | denotes | airways |
T14980 | 43947-43952 | IN | denotes | after |
T14981 | 43953-43960 | JJ | denotes | inhaled |
T14982 | 43961-43975 | NN | denotes | administration |
T14983 | 43976-43981 | MD | denotes | would |
T14984 | 43982-43984 | VB | denotes | be |
T14985 | 43985-43994 | JJ | denotes | effective |
T14986 | 43995-43997 | IN | denotes | in |
T14987 | 43998-44008 | VBG | denotes | inhibiting |
T14988 | 44009-44015 | NN | denotes | GATA-3 |
T14989 | 44016-44018 | IN | denotes | in |
T14990 | 44019-44025 | NN | denotes | airway |
T14991 | 44026-44027 | NNP | denotes | T |
T14992 | 44028-44033 | NNS | denotes | cells |
T14993 | 44034-44036 | IN | denotes | of |
T14994 | 44037-44043 | NN | denotes | asthma |
T14995 | 44044-44052 | NNS | denotes | patients |
T14996 | 44052-44053 | . | denotes | . |
T14997 | 44054-44057 | DT | denotes | The |
T14998 | 44058-44063 | NN | denotes | study |
T14999 | 44064-44066 | IN | denotes | of |
T15000 | 44067-44072 | NNS | denotes | PBMCs |
T15001 | 44073-44077 | IN | denotes | from |
T15002 | 44078-44084 | NN | denotes | asthma |
T15003 | 44085-44093 | NNS | denotes | patients |
T15004 | 44094-44101 | VBN | denotes | treated |
T15005 | 44102-44106 | IN | denotes | with |
T15006 | 44107-44114 | JJ | denotes | inhaled |
T15007 | 44115-44129 | JJ | denotes | corticosteroid |
T15008 | 44130-44137 | NN | denotes | therapy |
T15009 | 44138-44145 | RB | denotes | clearly |
T15010 | 44146-44158 | VBZ | denotes | demonstrates |
T15011 | 44159-44163 | IN | denotes | that |
T15012 | 44164-44169 | DT | denotes | these |
T15013 | 44170-44179 | JJ | denotes | molecular |
T15014 | 44180-44190 | NNS | denotes | mechanisms |
T15015 | 44191-44194 | VBP | denotes | are |
T15016 | 44195-44201 | JJ | denotes | likely |
T15017 | 44202-44204 | TO | denotes | to |
T15018 | 44205-44209 | RB | denotes | also |
T15019 | 44210-44215 | VB | denotes | occur |
T15020 | 44216-44218 | IN | denotes | in |
T15021 | 44219-44227 | NNS | denotes | patients |
T15022 | 44228-44230 | IN | denotes | at |
T15023 | 44231-44242 | JJ | denotes | therapeutic |
T15024 | 44243-44248 | NNS | denotes | doses |
T15025 | 44249-44251 | IN | denotes | of |
T15026 | 44252-44259 | JJ | denotes | inhaled |
T15027 | 44260-44275 | NNS | denotes | corticosteroids |
T15028 | 44275-44276 | . | denotes | . |
T15029 | 44277-44279 | IN | denotes | In |
T15030 | 44280-44288 | NN | denotes | addition |
T15031 | 44288-44289 | , | denotes | , |
T15032 | 44290-44298 | JJ | denotes | previous |
T15033 | 44299-44306 | NNS | denotes | studies |
T15034 | 44307-44311 | VBP | denotes | have |
T15035 | 44312-44317 | VBN | denotes | shown |
T15036 | 44318-44322 | IN | denotes | that |
T15037 | 44323-44338 | NNS | denotes | corticosteroids |
T15038 | 44339-44342 | MD | denotes | can |
T15039 | 44343-44351 | VB | denotes | suppress |
T15040 | 44352-44356 | NN | denotes | IL-4 |
T15041 | 44357-44360 | CC | denotes | and |
T15042 | 44361-44365 | NN | denotes | IL-5 |
T15043 | 44366-44373 | NN | denotes | release |
T15044 | 44374-44378 | IN | denotes | from |
T15045 | 44379-44389 | JJ | denotes | peripheral |
T15046 | 44390-44395 | NN | denotes | blood |
T15047 | 44396-44401 | NNS | denotes | cells |
T15048 | 44402-44404 | IN | denotes | of |
T15049 | 44405-44411 | NN | denotes | asthma |
T15050 | 44412-44420 | NNS | denotes | patients |
T15051 | 44421-44423 | IN | denotes | in |
T15052 | 44424-44429 | NN | denotes | vitro |
T15053 | 44430-44433 | CC | denotes | and |
T15054 | 44434-44436 | IN | denotes | in |
T15055 | 44437-44441 | NN | denotes | vivo |
T15056 | 44442-44443 | NNP | denotes | [ |
T15057 | 44443-44445 | CD | denotes | 40 |
T15058 | 44445-44446 | NNP | denotes | ] |
T15059 | 44447-44448 | NNP | denotes | [ |
T15060 | 44448-44450 | CD | denotes | 42 |
T15061 | 44450-44451 | NNP | denotes | ] |
T15062 | 44451-44452 | . | denotes | . |
T15063 | 44453-44455 | IN | denotes | In |
T15064 | 44456-44463 | NN | denotes | summary |
T15065 | 44463-44464 | , | denotes | , |
T15066 | 44465-44468 | PRP$ | denotes | our |
T15067 | 44469-44473 | NNS | denotes | data |
T15068 | 44474-44481 | VBP | denotes | provide |
T15069 | 44482-44490 | NN | denotes | evidence |
T15070 | 44491-44494 | IN | denotes | for |
T15071 | 44495-44496 | DT | denotes | a |
T15072 | 44497-44502 | NN | denotes | novel |
T15073 | 44503-44509 | NN | denotes | action |
T15074 | 44510-44512 | IN | denotes | of |
T15075 | 44513-44528 | NNS | denotes | corticosteroids |
T15076 | 44528-44529 | : | denotes | : |
T15077 | 44530-44541 | NN | denotes | suppression |
T15078 | 44542-44544 | IN | denotes | of |
T15079 | 44545-44553 | JJ | denotes | allergic |
T15080 | 44554-44566 | NN | denotes | inflammation |
T15081 | 44567-44574 | IN | denotes | through |
T15082 | 44575-44576 | DT | denotes | a |
T15083 | 44577-44582 | JJ | denotes | rapid |
T15084 | 44583-44593 | JJ | denotes | inhibitory |
T15085 | 44594-44600 | NN | denotes | effect |
T15086 | 44601-44603 | IN | denotes | on |
T15087 | 44604-44610 | JJ | denotes | GATA-3 |
T15088 | 44611-44618 | JJ | denotes | nuclear |
T15089 | 44619-44632 | NN | denotes | translocation |
T15090 | 44633-44635 | IN | denotes | by |
T15091 | 44636-44648 | JJ | denotes | preferential |
T15092 | 44649-44656 | JJ | denotes | binding |
T15093 | 44657-44659 | TO | denotes | to |
T15094 | 44660-44663 | DT | denotes | the |
T15095 | 44664-44670 | VBN | denotes | shared |
T15096 | 44671-44678 | JJ | denotes | nuclear |
T15097 | 44679-44685 | NN | denotes | import |
T15098 | 44686-44693 | NN | denotes | protein |
T15099 | 44694-44704 | NN | denotes | importin-α |
T15100 | 44705-44708 | CC | denotes | and |
T15101 | 44709-44711 | IN | denotes | by |
T15102 | 44712-44713 | DT | denotes | a |
T15103 | 44714-44720 | JJ | denotes | second |
T15104 | 44721-44730 | NN | denotes | mechanism |
T15105 | 44731-44740 | VBG | denotes | involving |
T15106 | 44741-44750 | VBN | denotes | increased |
T15107 | 44751-44760 | NN | denotes | synthesis |
T15108 | 44761-44763 | IN | denotes | of |
T15109 | 44764-44769 | NNP | denotes | MKP-1 |
T15110 | 44769-44770 | , | denotes | , |
T15111 | 44771-44776 | WDT | denotes | which |
T15112 | 44777-44785 | VBZ | denotes | inhibits |
T15113 | 44786-44789 | CD | denotes | p38 |
T15114 | 44790-44794 | NNP | denotes | MAPK |
T15115 | 44794-44795 | , | denotes | , |
T15116 | 44796-44800 | RB | denotes | thus |
T15117 | 44801-44811 | VBG | denotes | preventing |
T15118 | 44812-44815 | DT | denotes | the |
T15119 | 44816-44831 | NN | denotes | phosphorylation |
T15120 | 44832-44834 | IN | denotes | of |
T15121 | 44835-44841 | NN | denotes | GATA-3 |
T15122 | 44842-44846 | WDT | denotes | that |
T15123 | 44847-44849 | VBZ | denotes | is |
T15124 | 44850-44859 | JJ | denotes | necessary |
T15125 | 44860-44863 | IN | denotes | for |
T15126 | 44864-44871 | JJ | denotes | nuclear |
T15127 | 44872-44885 | NN | denotes | translocation |
T15128 | 44886-44888 | IN | denotes | of |
T15129 | 44889-44895 | NN | denotes | GATA-3 |
T15130 | 44895-44896 | . | denotes | . |
T15131 | 44897-44902 | DT | denotes | These |
T15132 | 44903-44906 | CD | denotes | two |
T15133 | 44907-44917 | NNS | denotes | mechanisms |
T15134 | 44918-44921 | VBP | denotes | are |
T15135 | 44922-44928 | JJ | denotes | likely |
T15136 | 44929-44931 | TO | denotes | to |
T15137 | 44932-44934 | VB | denotes | be |
T15138 | 44935-44946 | JJ | denotes | synergistic |
T15139 | 44946-44947 | , | denotes | , |
T15140 | 44948-44958 | VBG | denotes | accounting |
T15141 | 44959-44962 | IN | denotes | for |
T15142 | 44963-44966 | DT | denotes | the |
T15143 | 44967-44972 | JJ | denotes | rapid |
T15144 | 44973-44976 | CC | denotes | and |
T15145 | 44977-44983 | JJ | denotes | potent |
T15146 | 44984-44990 | NN | denotes | effect |
T15147 | 44991-44993 | IN | denotes | of |
T15148 | 44994-45009 | NNS | denotes | corticosteroids |
T15149 | 45010-45012 | IN | denotes | on |
T15150 | 45013-45021 | JJ | denotes | allergic |
T15151 | 45022-45034 | NN | denotes | inflammation |
T15152 | 45034-45035 | . | denotes | . |
T15153 | 45036-45040 | DT | denotes | This |
T15154 | 45041-45043 | VBZ | denotes | is |
T15155 | 45044-45055 | VBN | denotes | exemplified |
T15156 | 45056-45058 | IN | denotes | by |
T15157 | 45059-45062 | DT | denotes | the |
T15158 | 45063-45068 | JJ | denotes | rapid |
T15159 | 45069-45079 | JJ | denotes | inhibitory |
T15160 | 45080-45086 | NN | denotes | effect |
T15161 | 45087-45089 | IN | denotes | of |
T15162 | 45090-45097 | JJ | denotes | topical |
T15163 | 45098-45113 | NNS | denotes | corticosteroids |
T15164 | 45114-45116 | IN | denotes | on |
T15165 | 45117-45122 | JJ | denotes | nasal |
T15166 | 45123-45126 | JJ | denotes | Th2 |
T15167 | 45127-45135 | NN | denotes | cytokine |
T15168 | 45136-45143 | NN | denotes | release |
T15169 | 45144-45149 | IN | denotes | after |
T15170 | 45150-45158 | NN | denotes | allergen |
T15171 | 45159-45170 | NN | denotes | provocation |
T15172 | 45171-45173 | IN | denotes | in |
T15173 | 45174-45185 | NNS | denotes | individuals |
T15174 | 45186-45190 | IN | denotes | with |
T15175 | 45191-45199 | JJ | denotes | seasonal |
T15176 | 45200-45208 | JJ | denotes | allergic |
T15177 | 45209-45217 | NN | denotes | rhinitis |
T15178 | 45218-45219 | -LRB- | denotes | ( |
T15179 | 45219-45222 | NN | denotes | hay |
T15180 | 45223-45228 | NN | denotes | fever |
T15181 | 45228-45229 | -RRB- | denotes | ) |
T15182 | 45230-45231 | NNP | denotes | [ |
T15183 | 45231-45233 | CD | denotes | 43 |
T15184 | 45233-45234 | NNP | denotes | ] |
T15185 | 45234-45235 | . | denotes | . |
T15186 | 45236-45246 | NNP | denotes | Prevention |
T15187 | 45247-45249 | IN | denotes | of |
T15188 | 45250-45264 | JJ | denotes | phospho-GATA-3 |
T15189 | 45265-45276 | NN | denotes | interaction |
T15190 | 45277-45281 | IN | denotes | with |
T15191 | 45282-45292 | NN | denotes | importin-α |
T15192 | 45293-45296 | MD | denotes | may |
T15193 | 45297-45304 | VB | denotes | provide |
T15194 | 45305-45306 | DT | denotes | a |
T15195 | 45307-45310 | JJ | denotes | new |
T15196 | 45311-45319 | NN | denotes | approach |
T15197 | 45320-45323 | IN | denotes | for |
T15198 | 45324-45327 | DT | denotes | the |
T15199 | 45328-45339 | NN | denotes | development |
T15200 | 45340-45342 | IN | denotes | of |
T15201 | 45343-45348 | NN | denotes | novel |
T15202 | 45349-45358 | NNS | denotes | therapies |
T15203 | 45359-45362 | IN | denotes | for |
T15204 | 45363-45366 | DT | denotes | the |
T15205 | 45367-45376 | NN | denotes | treatment |
T15206 | 45377-45379 | IN | denotes | of |
T15207 | 45380-45388 | JJ | denotes | allergic |
T15208 | 45389-45397 | NNS | denotes | diseases |
T15209 | 45397-45398 | . | denotes | . |
T16315 | 24319-24330 | NNP | denotes | Fluticasone |
T16316 | 24331-24341 | JJ | denotes | propionate |
T16317 | 24342-24356 | NNS | denotes | down-regulates |
T16318 | 24357-24360 | JJ | denotes | Th2 |
T16319 | 24361-24369 | NN | denotes | cytokine |
T16320 | 24370-24374 | NN | denotes | gene |
T16321 | 24375-24385 | NN | denotes | expression |
T16322 | 24386-24389 | CC | denotes | and |
T16323 | 24390-24398 | NNS | denotes | inhibits |
T16324 | 24399-24405 | JJ | denotes | GATA-3 |
T16325 | 24406-24413 | JJ | denotes | nuclear |
T16326 | 24414-24420 | NN | denotes | import |
T16327 | 24420-24421 | . | denotes | . |
T16328 | 24422-24423 | -LRB- | denotes | ( |
T16329 | 24423-24424 | NNP | denotes | A |
T16330 | 24424-24425 | -RRB- | denotes | ) |
T16331 | 24426-24434 | JJ | denotes | Anti-CD3 |
T16332 | 24434-24435 | NN | denotes | / |
T16333 | 24435-24439 | CD | denotes | CD28 |
T16334 | 24440-24449 | NN | denotes | treatment |
T16335 | 24450-24452 | IN | denotes | of |
T16336 | 24453-24459 | JJ | denotes | HuT-78 |
T16337 | 24460-24465 | NNS | denotes | cells |
T16338 | 24466-24473 | NNS | denotes | results |
T16339 | 24474-24476 | IN | denotes | in |
T16340 | 24477-24490 | NN | denotes | translocation |
T16341 | 24491-24493 | IN | denotes | of |
T16342 | 24494-24500 | NN | denotes | GATA-3 |
T16343 | 24501-24505 | IN | denotes | from |
T16344 | 24506-24509 | DT | denotes | the |
T16345 | 24510-24519 | NN | denotes | cytoplasm |
T16346 | 24520-24522 | TO | denotes | to |
T16347 | 24523-24526 | DT | denotes | the |
T16348 | 24527-24534 | NN | denotes | nucleus |
T16349 | 24535-24541 | IN | denotes | within |
T16350 | 24542-24544 | CD | denotes | 30 |
T16351 | 24545-24548 | NN | denotes | min |
T16352 | 24548-24549 | . | denotes | . |
T16353 | 24550-24551 | -LRB- | denotes | ( |
T16354 | 24551-24552 | NNP | denotes | B |
T16355 | 24552-24553 | -RRB- | denotes | ) |
T16356 | 24554-24561 | NNP | denotes | Histone |
T16357 | 24562-24564 | NNP | denotes | H1 |
T16358 | 24565-24568 | CC | denotes | and |
T16359 | 24569-24574 | NNP | denotes | MEK-1 |
T16360 | 24575-24579 | VBD | denotes | were |
T16361 | 24580-24584 | VBN | denotes | used |
T16362 | 24585-24587 | TO | denotes | to |
T16363 | 24588-24595 | VB | denotes | confirm |
T16364 | 24596-24604 | JJ | denotes | distinct |
T16365 | 24605-24615 | NN | denotes | separation |
T16366 | 24616-24618 | IN | denotes | of |
T16367 | 24619-24630 | JJ | denotes | cytoplasmic |
T16368 | 24631-24634 | CC | denotes | and |
T16369 | 24635-24642 | JJ | denotes | nuclear |
T16370 | 24643-24651 | NNS | denotes | extracts |
T16371 | 24652-24654 | IN | denotes | in |
T16372 | 24655-24660 | CD | denotes | three |
T16373 | 24661-24669 | JJ | denotes | separate |
T16374 | 24670-24681 | NNS | denotes | experiments |
T16375 | 24681-24682 | . | denotes | . |
T16376 | 24683-24684 | -LRB- | denotes | ( |
T16377 | 24684-24685 | $ | denotes | C |
T16378 | 24685-24686 | -RRB- | denotes | ) |
T16379 | 24687-24694 | JJ | denotes | Western |
T16380 | 24695-24699 | NN | denotes | blot |
T16381 | 24700-24708 | NN | denotes | analysis |
T16382 | 24709-24711 | IN | denotes | of |
T16383 | 24712-24722 | JJ | denotes | FP-treated |
T16384 | 24723-24729 | JJ | denotes | HuT-78 |
T16385 | 24730-24735 | NNS | denotes | cells |
T16386 | 24736-24748 | VBD | denotes | demonstrated |
T16387 | 24749-24757 | VBN | denotes | impaired |
T16388 | 24758-24765 | JJ | denotes | nuclear |
T16389 | 24766-24778 | NN | denotes | localization |
T16390 | 24779-24781 | IN | denotes | of |
T16391 | 24782-24788 | JJ | denotes | GATA-3 |
T16392 | 24789-24796 | VBN | denotes | induced |
T16393 | 24797-24799 | IN | denotes | by |
T16394 | 24800-24808 | JJ | denotes | anti-CD3 |
T16395 | 24808-24809 | NN | denotes | / |
T16396 | 24809-24813 | CD | denotes | CD28 |
T16397 | 24814-24828 | NN | denotes | co-stimulation |
T16398 | 24829-24831 | IN | denotes | in |
T16399 | 24832-24833 | DT | denotes | a |
T16400 | 24834-24838 | NN | denotes | time |
T16401 | 24838-24839 | : | denotes | - |
T16402 | 24840-24841 | -LRB- | denotes | ( |
T16403 | 24841-24843 | IN | denotes | at |
T16404 | 24844-24846 | CD | denotes | 10 |
T16405 | 24846-24847 | NN | denotes | − |
T16406 | 24847-24848 | CD | denotes | 8 |
T16407 | 24849-24850 | NNP | denotes | M |
T16408 | 24851-24853 | NNP | denotes | FP |
T16409 | 24853-24854 | -RRB- | denotes | ) |
T16410 | 24855-24858 | CC | denotes | and |
T16411 | 24859-24872 | NN | denotes | concentration |
T16412 | 24872-24873 | : | denotes | - |
T16413 | 24874-24875 | -LRB- | denotes | ( |
T16414 | 24875-24877 | IN | denotes | at |
T16415 | 24878-24880 | CD | denotes | 60 |
T16416 | 24881-24884 | NN | denotes | min |
T16417 | 24885-24890 | IN | denotes | after |
T16418 | 24891-24902 | NN | denotes | stimulation |
T16419 | 24902-24903 | -RRB- | denotes | ) |
T16420 | 24904-24913 | JJ | denotes | dependent |
T16421 | 24914-24920 | NN | denotes | manner |
T16422 | 24920-24921 | . | denotes | . |
T16423 | 24922-24927 | NNS | denotes | Cells |
T16424 | 24928-24932 | VBD | denotes | were |
T16425 | 24933-24943 | VBN | denotes | pretreated |
T16426 | 24944-24948 | IN | denotes | with |
T16427 | 24949-24951 | NNP | denotes | FP |
T16428 | 24952-24955 | IN | denotes | for |
T16429 | 24956-24958 | CD | denotes | 30 |
T16430 | 24959-24962 | NN | denotes | min |
T16431 | 24963-24968 | RB | denotes | prior |
T16432 | 24969-24971 | TO | denotes | to |
T16433 | 24972-24983 | NN | denotes | stimulation |
T16434 | 24983-24984 | . | denotes | . |
T16435 | 24985-24989 | CD | denotes | MEK1 |
T16436 | 24990-24993 | CC | denotes | and |
T16437 | 24994-25001 | VB | denotes | histone |
T16438 | 25002-25004 | CD | denotes | H1 |
T16439 | 25005-25009 | VBD | denotes | were |
T16440 | 25010-25014 | VBN | denotes | used |
T16441 | 25015-25017 | TO | denotes | to |
T16442 | 25018-25029 | VB | denotes | demonstrate |
T16443 | 25030-25035 | JJ | denotes | equal |
T16444 | 25036-25047 | JJ | denotes | cytoplasmic |
T16445 | 25048-25051 | CC | denotes | and |
T16446 | 25052-25059 | JJ | denotes | nuclear |
T16447 | 25060-25067 | VBG | denotes | loading |
T16448 | 25068-25080 | RB | denotes | respectively |
T16449 | 25080-25081 | . | denotes | . |
T16450 | 25082-25089 | NNS | denotes | Results |
T16451 | 25090-25093 | VBP | denotes | are |
T16452 | 25094-25103 | VBN | denotes | presented |
T16453 | 25104-25115 | RB | denotes | graphically |
T16454 | 25116-25121 | IN | denotes | below |
T16455 | 25122-25124 | IN | denotes | as |
T16456 | 25125-25129 | JJ | denotes | mean |
T16457 | 25129-25130 | NN | denotes | ± |
T16458 | 25130-25133 | NNP | denotes | SEM |
T16459 | 25134-25136 | IN | denotes | of |
T16460 | 25137-25139 | IN | denotes | at |
T16461 | 25140-25145 | JJS | denotes | least |
T16462 | 25146-25151 | CD | denotes | three |
T16463 | 25152-25163 | JJ | denotes | independent |
T16464 | 25164-25175 | NNS | denotes | experiments |
T16465 | 25175-25176 | . | denotes | . |
T16466 | 25177-25180 | FW | denotes | *** |
T16467 | 25181-25182 | FW | denotes | p |
T16468 | 25182-25183 | FW | denotes | < |
T16469 | 25183-25188 | CD | denotes | 0.001 |
T16470 | 25189-25197 | VBN | denotes | compared |
T16471 | 25198-25200 | TO | denotes | to |
T16472 | 25201-25202 | VB | denotes | t |
T16473 | 25203-25204 | SYM | denotes | = |
T16474 | 25205-25206 | CD | denotes | 0 |
T16475 | 25206-25207 | . | denotes | . |
T16476 | 25208-25209 | -LRB- | denotes | ( |
T16477 | 25209-25210 | NNP | denotes | D |
T16478 | 25210-25211 | -RRB- | denotes | ) |
T16479 | 25212-25218 | NNP | denotes | RT-PCR |
T16480 | 25219-25226 | VBG | denotes | showing |
T16481 | 25227-25231 | IN | denotes | that |
T16482 | 25232-25234 | NNP | denotes | FP |
T16483 | 25235-25243 | VBZ | denotes | inhibits |
T16484 | 25244-25248 | NN | denotes | IL-4 |
T16485 | 25249-25252 | CC | denotes | and |
T16486 | 25253-25257 | NN | denotes | IL-5 |
T16487 | 25258-25262 | NNP | denotes | mRNA |
T16488 | 25263-25273 | NN | denotes | expression |
T16489 | 25274-25276 | IN | denotes | in |
T16490 | 25277-25298 | JJ | denotes | CD3/CD28-costimulated |
T16491 | 25299-25304 | NNS | denotes | cells |
T16492 | 25304-25305 | . | denotes | . |
T16493 | 25306-25311 | NNP | denotes | GAPDH |
T16494 | 25312-25315 | VBD | denotes | was |
T16495 | 25316-25320 | VBN | denotes | used |
T16496 | 25321-25323 | IN | denotes | as |
T16497 | 25324-25325 | DT | denotes | a |
T16498 | 25326-25333 | VBG | denotes | loading |
T16499 | 25334-25341 | NN | denotes | control |
T16500 | 25341-25342 | . | denotes | . |
T16501 | 25343-25348 | JJR | denotes | Lower |
T16502 | 25349-25355 | NNS | denotes | panels |
T16503 | 25356-25360 | VBP | denotes | show |
T16504 | 25361-25370 | JJ | denotes | graphical |
T16505 | 25371-25379 | NN | denotes | analysis |
T16506 | 25380-25382 | IN | denotes | of |
T16507 | 25383-25390 | NNS | denotes | results |
T16508 | 25391-25400 | VBN | denotes | presented |
T16509 | 25401-25403 | IN | denotes | as |
T16510 | 25404-25408 | JJ | denotes | mean |
T16511 | 25408-25409 | NN | denotes | ± |
T16512 | 25409-25412 | NNP | denotes | SEM |
T16513 | 25413-25415 | IN | denotes | of |
T16514 | 25416-25418 | IN | denotes | at |
T16515 | 25419-25424 | JJS | denotes | least |
T16516 | 25425-25430 | CD | denotes | three |
T16517 | 25431-25442 | JJ | denotes | independent |
T16518 | 25443-25454 | NNS | denotes | experiments |
T16519 | 25454-25455 | . | denotes | . |
T16520 | 25456-25459 | FW | denotes | ### |
T16521 | 25181-25182 | FW | denotes | p |
T16522 | 25182-25183 | FW | denotes | < |
T16523 | 25183-25188 | CD | denotes | 0.001 |
T16524 | 25189-25197 | VBN | denotes | compared |
T16525 | 25198-25200 | TO | denotes | to |
T16526 | 25480-25487 | VB | denotes | control |
T16527 | 25487-25488 | , | denotes | , |
T16528 | 25489-25492 | FW | denotes | *** |
T16529 | 25492-25493 | FW | denotes | p |
T16530 | 25493-25494 | FW | denotes | < |
T16531 | 25494-25499 | CD | denotes | 0.001 |
T16532 | 25500-25508 | VBN | denotes | compared |
T16533 | 25509-25511 | TO | denotes | to |
T16534 | 25512-25520 | JJ | denotes | anti-CD3 |
T16535 | 25520-25521 | NN | denotes | / |
T16536 | 25521-25525 | CD | denotes | CD28 |
T16537 | 25526-25536 | VBN | denotes | stimulated |
T16538 | 25536-25537 | . | denotes | . |
T16539 | 25538-25539 | -LRB- | denotes | ( |
T16540 | 25539-25540 | NNP | denotes | E |
T16541 | 25540-25541 | -RRB- | denotes | ) |
T16542 | 25542-25544 | NNP | denotes | FP |
T16543 | 25545-25546 | -LRB- | denotes | ( |
T16544 | 25546-25548 | CD | denotes | 10 |
T16545 | 25549-25551 | NNP | denotes | nM |
T16546 | 25551-25552 | -RRB- | denotes | ) |
T16547 | 25553-25560 | VBZ | denotes | reduces |
T16548 | 25561-25564 | DT | denotes | the |
T16549 | 25565-25572 | NN | denotes | ability |
T16550 | 25573-25575 | IN | denotes | of |
T16551 | 25576-25584 | JJ | denotes | anti-CD3 |
T16552 | 25584-25585 | NN | denotes | / |
T16553 | 25585-25600 | JJ | denotes | CD28-stimulated |
T16554 | 25601-25607 | NN | denotes | GATA-3 |
T16555 | 25608-25610 | TO | denotes | to |
T16556 | 25611-25620 | VB | denotes | associate |
T16557 | 25621-25625 | IN | denotes | with |
T16558 | 25626-25629 | DT | denotes | the |
T16559 | 25630-25636 | JJ | denotes | native |
T16560 | 25637-25641 | NN | denotes | IL-5 |
T16561 | 25642-25650 | NN | denotes | promoter |
T16562 | 25651-25653 | CD | denotes | 60 |
T16563 | 25654-25657 | NN | denotes | min |
T16564 | 25658-25663 | IN | denotes | after |
T16565 | 25664-25675 | NN | denotes | stimulation |
T16566 | 25675-25676 | . | denotes | . |
T16567 | 25677-25681 | NNS | denotes | Data |
T16568 | 25682-25685 | VBP | denotes | are |
T16569 | 25686-25690 | RB | denotes | also |
T16570 | 25691-25696 | VBN | denotes | shown |
T16571 | 25697-25708 | RB | denotes | graphically |
T16572 | 25709-25711 | IN | denotes | as |
T16573 | 25712-25716 | JJ | denotes | mean |
T16574 | 25716-25717 | NN | denotes | ± |
T16575 | 25717-25720 | NNP | denotes | SEM |
T16576 | 25721-25723 | IN | denotes | of |
T16577 | 25724-25729 | CD | denotes | three |
T16578 | 25730-25741 | JJ | denotes | independent |
T16579 | 25742-25753 | NNS | denotes | experiments |
T16580 | 25753-25754 | . | denotes | . |
T16581 | 25755-25758 | DT | denotes | All |
T16582 | 25759-25763 | NNS | denotes | data |
T16583 | 25764-25768 | VBD | denotes | were |
T16584 | 25769-25777 | VBN | denotes | analysed |
T16585 | 25778-25780 | IN | denotes | by |
T16586 | 25781-25786 | NNP | denotes | ANOVA |
T16587 | 25787-25795 | VBD | denotes | followed |
T16588 | 25796-25798 | IN | denotes | by |
T16589 | 25799-25811 | NNP | denotes | Newman-Keuls |
T16590 | 25812-25821 | JJS | denotes | post-test |
T16591 | 25821-25822 | . | denotes | . |
T17105 | 26735-26746 | NNP | denotes | Fluticasone |
T17106 | 26747-26757 | NN | denotes | propionate |
T17107 | 26758-26765 | VBZ | denotes | reduces |
T17108 | 26766-26772 | JJ | denotes | GATA-3 |
T17109 | 26773-26784 | NN | denotes | association |
T17110 | 26785-26789 | IN | denotes | with |
T17111 | 26790-26800 | JJ | denotes | importin-α |
T17112 | 26801-26804 | CC | denotes | and |
T17113 | 26805-26811 | JJ | denotes | GATA-3 |
T17114 | 26812-26819 | JJ | denotes | nuclear |
T17115 | 26820-26826 | NN | denotes | import |
T17116 | 26826-26827 | . | denotes | . |
T17117 | 26828-26829 | -LRB- | denotes | ( |
T17118 | 26829-26830 | NN | denotes | A |
T17119 | 26830-26831 | -RRB- | denotes | ) |
T17120 | 26832-26839 | JJ | denotes | Western |
T17121 | 26840-26844 | NN | denotes | blot |
T17122 | 26845-26853 | NN | denotes | analysis |
T17123 | 26854-26866 | VBZ | denotes | demonstrates |
T17124 | 26867-26868 | DT | denotes | a |
T17125 | 26869-26873 | NN | denotes | time |
T17126 | 26873-26874 | : | denotes | - |
T17127 | 26875-26876 | -LRB- | denotes | ( |
T17128 | 26876-26878 | IN | denotes | at |
T17129 | 26879-26881 | CD | denotes | 10 |
T17130 | 26881-26882 | NN | denotes | − |
T17131 | 26882-26883 | CD | denotes | 8 |
T17132 | 26884-26885 | NNP | denotes | M |
T17133 | 26886-26888 | NNP | denotes | FP |
T17134 | 26888-26889 | -RRB- | denotes | ) |
T17135 | 26890-26893 | CC | denotes | and |
T17136 | 26894-26907 | NN | denotes | concentration |
T17137 | 26907-26908 | : | denotes | - |
T17138 | 26909-26910 | -LRB- | denotes | ( |
T17139 | 26910-26912 | IN | denotes | at |
T17140 | 26913-26915 | CD | denotes | 60 |
T17141 | 26916-26919 | NN | denotes | min |
T17142 | 26920-26925 | IN | denotes | after |
T17143 | 26926-26937 | NN | denotes | stimulation |
T17144 | 26937-26938 | -RRB- | denotes | ) |
T17145 | 26939-26948 | JJ | denotes | dependent |
T17146 | 26949-26958 | NN | denotes | induction |
T17147 | 26959-26961 | IN | denotes | of |
T17148 | 26962-26974 | JJ | denotes | FP-activated |
T17149 | 26975-26977 | NNP | denotes | GR |
T17150 | 26978-26989 | NN | denotes | interaction |
T17151 | 26990-26994 | IN | denotes | with |
T17152 | 26995-27005 | JJ | denotes | importin-α |
T17153 | 27006-27007 | -LRB- | denotes | ( |
T17154 | 27007-27012 | JJ | denotes | Imp-α |
T17155 | 27012-27013 | -RRB- | denotes | ) |
T17156 | 27013-27014 | . | denotes | . |
T17157 | 27015-27016 | DT | denotes | A |
T17158 | 27017-27025 | JJ | denotes | positive |
T17159 | 27026-27033 | NN | denotes | control |
T17160 | 27034-27037 | IN | denotes | for |
T17161 | 27038-27040 | NNP | denotes | GR |
T17162 | 27041-27052 | NN | denotes | association |
T17163 | 27053-27057 | IN | denotes | with |
T17164 | 27058-27066 | NN | denotes | importin |
T17165 | 27067-27069 | VBZ | denotes | is |
T17166 | 27070-27075 | VBN | denotes | shown |
T17167 | 27075-27076 | . | denotes | . |
T17168 | 27077-27091 | NN | denotes | Quantification |
T17169 | 27092-27094 | IN | denotes | of |
T17170 | 27095-27098 | DT | denotes | the |
T17171 | 27099-27111 | NN | denotes | densitometry |
T17172 | 27112-27116 | NN | denotes | data |
T17173 | 27117-27119 | VBZ | denotes | is |
T17174 | 27120-27125 | VBN | denotes | shown |
T17175 | 27126-27131 | IN | denotes | below |
T17176 | 27131-27132 | . | denotes | . |
T17177 | 27133-27137 | DT | denotes | Each |
T17178 | 27138-27141 | NN | denotes | bar |
T17179 | 27142-27152 | VBZ | denotes | represents |
T17180 | 27153-27157 | JJ | denotes | mean |
T17181 | 27157-27158 | NN | denotes | ± |
T17182 | 27158-27161 | NNP | denotes | SEM |
T17183 | 27162-27164 | IN | denotes | of |
T17184 | 27165-27167 | IN | denotes | at |
T17185 | 27168-27173 | JJS | denotes | least |
T17186 | 27174-27179 | CD | denotes | three |
T17187 | 27180-27191 | JJ | denotes | independent |
T17188 | 27192-27203 | NNS | denotes | experiments |
T17189 | 27203-27204 | . | denotes | . |
T17190 | 27205-27208 | FW | denotes | *** |
T17191 | 27209-27210 | FW | denotes | p |
T17192 | 27210-27211 | FW | denotes | < |
T17193 | 27211-27216 | CD | denotes | 0.001 |
T17194 | 27217-27225 | VBN | denotes | compared |
T17195 | 27226-27228 | TO | denotes | to |
T17196 | 27229-27236 | VB | denotes | control |
T17197 | 27236-27237 | , | denotes | , |
T17198 | 27238-27241 | FW | denotes | ### |
T17199 | 27242-27243 | FW | denotes | p |
T17200 | 27243-27244 | FW | denotes | < |
T17201 | 27244-27249 | CD | denotes | 0.001 |
T17202 | 27249-27250 | . | denotes | . |
T17203 | 27251-27252 | -LRB- | denotes | ( |
T17204 | 27252-27253 | NNP | denotes | B |
T17205 | 27253-27254 | -RRB- | denotes | ) |
T17206 | 27255-27262 | NNP | denotes | Western |
T17207 | 27263-27267 | NN | denotes | blot |
T17208 | 27268-27276 | NN | denotes | analysis |
T17209 | 27277-27289 | VBD | denotes | demonstrated |
T17210 | 27290-27291 | DT | denotes | a |
T17211 | 27292-27296 | NN | denotes | time |
T17212 | 27296-27297 | : | denotes | - |
T17213 | 27298-27299 | -LRB- | denotes | ( |
T17214 | 27299-27301 | IN | denotes | at |
T17215 | 27302-27304 | CD | denotes | 10 |
T17216 | 27304-27305 | NN | denotes | − |
T17217 | 27305-27306 | CD | denotes | 8 |
T17218 | 27307-27308 | NNP | denotes | M |
T17219 | 27309-27311 | NNP | denotes | FP |
T17220 | 27311-27312 | -RRB- | denotes | ) |
T17221 | 27313-27316 | CC | denotes | and |
T17222 | 27317-27330 | NN | denotes | concentration |
T17223 | 27330-27331 | : | denotes | - |
T17224 | 27332-27333 | -LRB- | denotes | ( |
T17225 | 27333-27335 | IN | denotes | at |
T17226 | 27336-27338 | CD | denotes | 60 |
T17227 | 27339-27342 | NN | denotes | min |
T17228 | 27343-27348 | IN | denotes | after |
T17229 | 27349-27360 | NN | denotes | stimulation |
T17230 | 27360-27361 | -RRB- | denotes | ) |
T17231 | 27362-27371 | JJ | denotes | dependent |
T17232 | 27372-27381 | NN | denotes | induction |
T17233 | 27382-27384 | IN | denotes | of |
T17234 | 27385-27397 | JJ | denotes | FP-activated |
T17235 | 27398-27400 | NNP | denotes | GR |
T17236 | 27401-27408 | JJ | denotes | nuclear |
T17237 | 27409-27422 | NN | denotes | translocation |
T17238 | 27423-27431 | VBN | denotes | measured |
T17239 | 27432-27434 | IN | denotes | by |
T17240 | 27435-27437 | NNP | denotes | IP |
T17241 | 27437-27438 | . | denotes | . |
T17242 | 27439-27453 | NN | denotes | Quantification |
T17243 | 27454-27456 | IN | denotes | of |
T17244 | 27457-27460 | DT | denotes | the |
T17245 | 27461-27473 | NN | denotes | densitometry |
T17246 | 27474-27478 | NN | denotes | data |
T17247 | 27479-27481 | VBZ | denotes | is |
T17248 | 27482-27487 | VBN | denotes | shown |
T17249 | 27488-27493 | IN | denotes | below |
T17250 | 27493-27494 | . | denotes | . |
T17251 | 27495-27499 | DT | denotes | Each |
T17252 | 27500-27503 | NN | denotes | bar |
T17253 | 27504-27514 | VBZ | denotes | represents |
T17254 | 27515-27519 | JJ | denotes | mean |
T17255 | 27519-27520 | NN | denotes | ± |
T17256 | 27520-27523 | NNP | denotes | SEM |
T17257 | 27524-27526 | IN | denotes | of |
T17258 | 27527-27529 | IN | denotes | at |
T17259 | 27530-27535 | JJS | denotes | least |
T17260 | 27536-27541 | CD | denotes | three |
T17261 | 27542-27553 | JJ | denotes | independent |
T17262 | 27554-27565 | NNS | denotes | experiments |
T17263 | 27565-27566 | . | denotes | . |
T17264 | 27567-27570 | FW | denotes | *** |
T17265 | 27570-27571 | FW | denotes | p |
T17266 | 27571-27572 | FW | denotes | < |
T17267 | 27572-27577 | CD | denotes | 0.001 |
T17268 | 27578-27586 | VBN | denotes | compared |
T17269 | 27587-27589 | TO | denotes | to |
T17270 | 27590-27597 | VB | denotes | control |
T17271 | 27597-27598 | . | denotes | . |
T17272 | 27599-27600 | -LRB- | denotes | ( |
T17273 | 27600-27601 | $ | denotes | C |
T17274 | 27601-27602 | -RRB- | denotes | ) |
T17275 | 27603-27610 | JJ | denotes | Western |
T17276 | 27611-27615 | NN | denotes | blot |
T17277 | 27616-27624 | NN | denotes | analysis |
T17278 | 27625-27627 | IN | denotes | of |
T17279 | 27628-27634 | JJ | denotes | HuT-78 |
T17280 | 27635-27640 | NNS | denotes | cells |
T17281 | 27641-27648 | VBN | denotes | treated |
T17282 | 27649-27653 | IN | denotes | with |
T17283 | 27654-27656 | NNP | denotes | FP |
T17284 | 27657-27660 | CC | denotes | and |
T17285 | 27661-27669 | JJ | denotes | anti-CD3 |
T17286 | 27669-27670 | NN | denotes | / |
T17287 | 27670-27674 | CD | denotes | CD28 |
T17288 | 27675-27689 | NN | denotes | co-stimulation |
T17289 | 27690-27702 | VBD | denotes | demonstrated |
T17290 | 27703-27704 | DT | denotes | a |
T17291 | 27705-27728 | JJ | denotes | concentration-dependent |
T17292 | 27729-27737 | NN | denotes | decrease |
T17293 | 27738-27740 | IN | denotes | in |
T17294 | 27741-27747 | NNP | denotes | GATA-3 |
T17295 | 27748-27758 | JJ | denotes | importin-α |
T17296 | 27759-27770 | NN | denotes | association |
T17297 | 27771-27773 | IN | denotes | at |
T17298 | 27774-27776 | CD | denotes | 20 |
T17299 | 27777-27780 | NN | denotes | min |
T17300 | 27780-27781 | . | denotes | . |
T17301 | 27782-27796 | NN | denotes | Quantification |
T17302 | 27797-27799 | IN | denotes | of |
T17303 | 27800-27803 | DT | denotes | the |
T17304 | 27804-27816 | NN | denotes | densitometry |
T17305 | 27817-27821 | NN | denotes | data |
T17306 | 27822-27824 | VBZ | denotes | is |
T17307 | 27825-27830 | VBN | denotes | shown |
T17308 | 27831-27836 | IN | denotes | below |
T17309 | 27836-27837 | . | denotes | . |
T17310 | 27838-27842 | DT | denotes | Each |
T17311 | 27843-27846 | NN | denotes | bar |
T17312 | 27847-27857 | VBZ | denotes | represents |
T17313 | 27858-27862 | JJ | denotes | mean |
T17314 | 27862-27863 | NN | denotes | ± |
T17315 | 27863-27866 | NNP | denotes | SEM |
T17316 | 27867-27869 | IN | denotes | of |
T17317 | 27870-27872 | IN | denotes | at |
T17318 | 27873-27878 | JJS | denotes | least |
T17319 | 27879-27884 | CD | denotes | three |
T17320 | 27885-27896 | JJ | denotes | independent |
T17321 | 27897-27908 | NNS | denotes | experiments |
T17322 | 27908-27909 | . | denotes | . |
T17323 | 27910-27913 | FW | denotes | ### |
T17324 | 25181-25182 | FW | denotes | p |
T17325 | 25182-25183 | FW | denotes | < |
T17326 | 25183-25188 | CD | denotes | 0.001 |
T17327 | 25189-25197 | VBN | denotes | compared |
T17328 | 25198-25200 | TO | denotes | to |
T17329 | 25480-25487 | VB | denotes | control |
T17330 | 25487-25488 | , | denotes | , |
T17331 | 25489-25492 | FW | denotes | *** |
T17332 | 25492-25493 | FW | denotes | p |
T17333 | 25493-25494 | FW | denotes | < |
T17334 | 25494-25499 | CD | denotes | 0.001 |
T17335 | 25500-25508 | VBN | denotes | compared |
T17336 | 25509-25511 | TO | denotes | to |
T17337 | 27966-27970 | JJ | denotes | αCD3 |
T17338 | 27970-27971 | NN | denotes | / |
T17339 | 27971-27986 | JJ | denotes | CD28-stimulated |
T17340 | 27987-27992 | NNS | denotes | cells |
T17341 | 27992-27993 | . | denotes | . |
T17342 | 27994-27995 | -LRB- | denotes | ( |
T17343 | 27995-27996 | NNP | denotes | D |
T17344 | 27996-27997 | -RRB- | denotes | ) |
T17345 | 27998-28008 | JJ | denotes | GFP-tagged |
T17346 | 28009-28015 | NN | denotes | GATA-3 |
T17347 | 28016-28019 | VBD | denotes | was |
T17348 | 28020-28033 | VBN | denotes | overexpressed |
T17349 | 28034-28037 | CC | denotes | and |
T17350 | 28038-28043 | NNS | denotes | cells |
T17351 | 28044-28054 | VBN | denotes | stimulated |
T17352 | 28055-28056 | -LRB- | denotes | ( |
T17353 | 28056-28057 | NN | denotes | b |
T17354 | 28057-28058 | , | denotes | , |
T17355 | 28059-28060 | NN | denotes | c |
T17356 | 28060-28061 | -RRB- | denotes | ) |
T17357 | 28062-28064 | CC | denotes | or |
T17358 | 28065-28068 | RB | denotes | not |
T17359 | 28069-28070 | -LRB- | denotes | ( |
T17360 | 28070-28071 | DT | denotes | a |
T17361 | 28071-28072 | -RRB- | denotes | ) |
T17362 | 28073-28076 | IN | denotes | for |
T17363 | 28077-28079 | CD | denotes | 30 |
T17364 | 28080-28083 | NN | denotes | min |
T17365 | 28084-28088 | IN | denotes | with |
T17366 | 28089-28097 | JJ | denotes | anti-CD3 |
T17367 | 28097-28098 | NN | denotes | / |
T17368 | 28098-28102 | NNP | denotes | CD28 |
T17369 | 28102-28103 | . | denotes | . |
T17370 | 28104-28107 | DT | denotes | The |
T17371 | 28108-28114 | NN | denotes | effect |
T17372 | 28115-28117 | IN | denotes | of |
T17373 | 28118-28120 | CD | denotes | 30 |
T17374 | 28121-28124 | NN | denotes | min |
T17375 | 28125-28137 | NN | denotes | pretreatment |
T17376 | 28138-28140 | IN | denotes | of |
T17377 | 28141-28146 | NNS | denotes | cells |
T17378 | 28147-28151 | IN | denotes | with |
T17379 | 28152-28154 | NNP | denotes | FP |
T17380 | 28155-28156 | -LRB- | denotes | ( |
T17381 | 28156-28158 | CD | denotes | 10 |
T17382 | 28158-28159 | NN | denotes | − |
T17383 | 28159-28160 | CD | denotes | 8 |
T17384 | 28161-28162 | NNP | denotes | M |
T17385 | 28162-28163 | , | denotes | , |
T17386 | 28164-28165 | NN | denotes | c |
T17387 | 28165-28166 | -RRB- | denotes | ) |
T17388 | 28167-28169 | VBZ | denotes | is |
T17389 | 28170-28174 | RB | denotes | also |
T17390 | 28175-28180 | VBN | denotes | shown |
T17391 | 28180-28181 | . | denotes | . |
T17392 | 28182-28185 | DT | denotes | All |
T17393 | 28186-28190 | NNS | denotes | data |
T17394 | 28191-28195 | VBD | denotes | were |
T17395 | 28196-28204 | VBN | denotes | analysed |
T17396 | 28205-28207 | IN | denotes | by |
T17397 | 28208-28213 | NNP | denotes | ANOVA |
T17398 | 28214-28222 | VBD | denotes | followed |
T17399 | 28223-28225 | IN | denotes | by |
T17400 | 28226-28238 | NNP | denotes | Newman-Keuls |
T17401 | 28239-28248 | JJS | denotes | post-test |
T17402 | 28248-28249 | . | denotes | . |
T17853 | 29403-29414 | NNP | denotes | Fluticasone |
T17854 | 29415-29425 | NN | denotes | propionate |
T17855 | 29426-29434 | VBN | denotes | mediated |
T17856 | 29435-29445 | NN | denotes | inhibition |
T17857 | 29446-29448 | IN | denotes | of |
T17858 | 29449-29452 | CD | denotes | p38 |
T17859 | 29453-29456 | NNP | denotes | MAP |
T17860 | 29457-29463 | NN | denotes | kinase |
T17861 | 29464-29479 | NN | denotes | phosphorylation |
T17862 | 29480-29483 | CC | denotes | and |
T17863 | 29484-29494 | NN | denotes | activation |
T17864 | 29495-29497 | VBZ | denotes | is |
T17865 | 29498-29508 | VBN | denotes | associated |
T17866 | 29509-29513 | IN | denotes | with |
T17867 | 29514-29515 | DT | denotes | a |
T17868 | 29516-29522 | JJ | denotes | marked |
T17869 | 29523-29538 | NN | denotes | down-regulation |
T17870 | 29539-29541 | IN | denotes | of |
T17871 | 29542-29548 | JJ | denotes | GATA-3 |
T17872 | 29549-29555 | NN | denotes | serine |
T17873 | 29556-29571 | NN | denotes | phosphorylation |
T17874 | 29571-29572 | . | denotes | . |
T17875 | 29573-29574 | -LRB- | denotes | ( |
T17876 | 29574-29575 | NN | denotes | A |
T17877 | 29575-29576 | -RRB- | denotes | ) |
T17878 | 29577-29584 | JJ | denotes | Western |
T17879 | 29585-29589 | NN | denotes | blot |
T17880 | 29590-29598 | NN | denotes | analysis |
T17881 | 29599-29604 | VBZ | denotes | shows |
T17882 | 29605-29609 | IN | denotes | that |
T17883 | 29610-29612 | NNP | denotes | FP |
T17884 | 29613-29614 | -LRB- | denotes | ( |
T17885 | 29614-29616 | CD | denotes | 10 |
T17886 | 29616-29617 | NN | denotes | − |
T17887 | 29617-29618 | CD | denotes | 8 |
T17888 | 29619-29620 | NNP | denotes | M |
T17889 | 29620-29621 | , | denotes | , |
T17890 | 29622-29624 | CD | denotes | 30 |
T17891 | 29625-29628 | NN | denotes | min |
T17892 | 29628-29629 | -RRB- | denotes | ) |
T17893 | 29630-29639 | NN | denotes | treatment |
T17894 | 29640-29647 | VBD | denotes | reduced |
T17895 | 29648-29652 | JJ | denotes | dual |
T17896 | 29653-29668 | NN | denotes | phosphorylation |
T17897 | 29669-29670 | -LRB- | denotes | ( |
T17898 | 29670-29683 | NN | denotes | threonine-180 |
T17899 | 29684-29687 | CC | denotes | and |
T17900 | 29688-29700 | NN | denotes | tyrosine-182 |
T17901 | 29700-29701 | -RRB- | denotes | ) |
T17902 | 29702-29704 | IN | denotes | of |
T17903 | 29705-29708 | CD | denotes | p38 |
T17904 | 29709-29713 | NNP | denotes | MAPK |
T17905 | 29714-29716 | IN | denotes | in |
T17906 | 29717-29725 | JJ | denotes | anti-CD3 |
T17907 | 29725-29726 | NN | denotes | / |
T17908 | 29726-29730 | CD | denotes | CD28 |
T17909 | 29731-29744 | JJ | denotes | co-stimulated |
T17910 | 29745-29751 | JJ | denotes | HuT-78 |
T17911 | 29752-29757 | NNS | denotes | cells |
T17912 | 29757-29758 | . | denotes | . |
T17913 | 29759-29760 | -LRB- | denotes | ( |
T17914 | 29760-29761 | NNP | denotes | B |
T17915 | 29761-29762 | -RRB- | denotes | ) |
T17916 | 29763-29767 | NNP | denotes | Time |
T17917 | 29768-29774 | NN | denotes | course |
T17918 | 29775-29777 | IN | denotes | of |
T17919 | 29778-29781 | DT | denotes | the |
T17920 | 29782-29788 | NN | denotes | effect |
T17921 | 29789-29791 | IN | denotes | of |
T17922 | 29792-29794 | NNP | denotes | FP |
T17923 | 29795-29796 | -LRB- | denotes | ( |
T17924 | 29796-29798 | CD | denotes | 10 |
T17925 | 29798-29799 | NN | denotes | − |
T17926 | 29799-29800 | CD | denotes | 8 |
T17927 | 29801-29802 | NNP | denotes | M |
T17928 | 29802-29803 | -RRB- | denotes | ) |
T17929 | 29804-29806 | IN | denotes | on |
T17930 | 29807-29822 | NN | denotes | phosphorylation |
T17931 | 29823-29825 | IN | denotes | of |
T17932 | 29826-29835 | VBN | denotes | activated |
T17933 | 29836-29849 | NN | denotes | transcription |
T17934 | 29850-29856 | NN | denotes | factor |
T17935 | 29857-29858 | CD | denotes | 2 |
T17936 | 29859-29860 | -LRB- | denotes | ( |
T17937 | 29860-29865 | NN | denotes | ATF-2 |
T17938 | 29865-29866 | -RRB- | denotes | ) |
T17939 | 29866-29867 | , | denotes | , |
T17940 | 29868-29869 | DT | denotes | a |
T17941 | 29870-29877 | NN | denotes | measure |
T17942 | 29878-29880 | IN | denotes | of |
T17943 | 29881-29884 | CD | denotes | p38 |
T17944 | 29885-29889 | NNP | denotes | MAPK |
T17945 | 29890-29898 | NN | denotes | activity |
T17946 | 29898-29899 | . | denotes | . |
T17947 | 29900-29901 | -LRB- | denotes | ( |
T17948 | 29901-29902 | $ | denotes | C |
T17949 | 29902-29903 | -RRB- | denotes | ) |
T17950 | 29904-29914 | JJ | denotes | FP-induced |
T17951 | 29915-29925 | NN | denotes | inhibition |
T17952 | 29926-29928 | IN | denotes | of |
T17953 | 29929-29932 | CD | denotes | p38 |
T17954 | 29933-29937 | NNP | denotes | MAPK |
T17955 | 29938-29946 | NN | denotes | activity |
T17956 | 29947-29949 | VBZ | denotes | is |
T17957 | 29950-29960 | VBN | denotes | associated |
T17958 | 29961-29965 | IN | denotes | with |
T17959 | 29966-29969 | DT | denotes | the |
T17960 | 29970-29978 | NN | denotes | decrease |
T17961 | 29979-29981 | IN | denotes | of |
T17962 | 29982-29990 | JJ | denotes | anti-CD3 |
T17963 | 29990-29991 | NN | denotes | / |
T17964 | 29991-29995 | CD | denotes | CD28 |
T17965 | 29996-30010 | NN | denotes | co-stimulation |
T17966 | 30011-30018 | VBD | denotes | induced |
T17967 | 30019-30025 | JJ | denotes | serine |
T17968 | 30026-30041 | NN | denotes | phosphorylation |
T17969 | 30042-30043 | -LRB- | denotes | ( |
T17970 | 30043-30048 | NN | denotes | P-Ser |
T17971 | 30048-30049 | -RRB- | denotes | ) |
T17972 | 30050-30052 | IN | denotes | of |
T17973 | 30053-30059 | NN | denotes | GATA-3 |
T17974 | 30059-30060 | . | denotes | . |
T17975 | 30061-30064 | IN | denotes | For |
T17976 | 30065-30066 | -LRB- | denotes | ( |
T17977 | 30066-30067 | DT | denotes | A |
T17978 | 30068-30069 | NNP | denotes | C |
T17979 | 30069-30070 | -RRB- | denotes | ) |
T17980 | 30070-30071 | , | denotes | , |
T17981 | 30072-30086 | NN | denotes | quantification |
T17982 | 30087-30089 | IN | denotes | of |
T17983 | 30090-30093 | DT | denotes | the |
T17984 | 30094-30106 | NN | denotes | densitometry |
T17985 | 30107-30111 | NN | denotes | data |
T17986 | 30112-30114 | VBZ | denotes | is |
T17987 | 30115-30119 | RB | denotes | also |
T17988 | 30120-30125 | VBN | denotes | shown |
T17989 | 30125-30126 | . | denotes | . |
T17990 | 30127-30131 | DT | denotes | Each |
T17991 | 30132-30135 | NN | denotes | bar |
T17992 | 30136-30146 | VBZ | denotes | represents |
T17993 | 30147-30151 | JJ | denotes | mean |
T17994 | 30151-30152 | NN | denotes | ± |
T17995 | 30152-30155 | NNP | denotes | SEM |
T17996 | 30156-30158 | IN | denotes | of |
T17997 | 30159-30161 | IN | denotes | at |
T17998 | 30162-30167 | JJS | denotes | least |
T17999 | 30168-30173 | CD | denotes | three |
T18000 | 30174-30185 | JJ | denotes | independent |
T18001 | 30186-30197 | NNS | denotes | experiments |
T18002 | 30197-30198 | . | denotes | . |
T18003 | 30199-30202 | FW | denotes | ### |
T18004 | 25181-25182 | FW | denotes | p |
T18005 | 25182-25183 | FW | denotes | < |
T18006 | 25183-25188 | CD | denotes | 0.001 |
T18007 | 25189-25197 | VBN | denotes | compared |
T18008 | 25198-25200 | TO | denotes | to |
T18009 | 25480-25487 | VB | denotes | control |
T18010 | 25487-25488 | , | denotes | , |
T18011 | 25489-25492 | FW | denotes | *** |
T18012 | 25492-25493 | FW | denotes | p |
T18013 | 25493-25494 | FW | denotes | < |
T18014 | 25494-25499 | CD | denotes | 0.001 |
T18015 | 25500-25508 | VBN | denotes | compared |
T18016 | 25509-25511 | TO | denotes | to |
T18017 | 27966-27970 | JJ | denotes | αCD3 |
T18018 | 27970-27971 | NN | denotes | / |
T18019 | 27971-27986 | JJ | denotes | CD28-stimulated |
T18020 | 27987-27992 | NNS | denotes | cells |
T18021 | 27992-27993 | . | denotes | . |
T18022 | 27994-27995 | -LRB- | denotes | ( |
T18023 | 27995-27996 | NNP | denotes | D |
T18024 | 27996-27997 | -RRB- | denotes | ) |
T18025 | 30287-30289 | NNP | denotes | FP |
T18026 | 30290-30297 | VBD | denotes | induced |
T18027 | 30298-30303 | NNP | denotes | MKP-1 |
T18028 | 30304-30308 | NNP | denotes | mRNA |
T18029 | 30309-30311 | IN | denotes | in |
T18030 | 30312-30313 | DT | denotes | a |
T18031 | 30314-30337 | JJ | denotes | concentration-dependent |
T18032 | 30338-30344 | NN | denotes | manner |
T18033 | 30344-30345 | . | denotes | . |
T18034 | 30346-30349 | DT | denotes | All |
T18035 | 30350-30357 | NNS | denotes | results |
T18036 | 30358-30361 | VBP | denotes | are |
T18037 | 30362-30376 | NN | denotes | representative |
T18038 | 30377-30379 | IN | denotes | of |
T18039 | 30380-30382 | IN | denotes | at |
T18040 | 30383-30388 | JJS | denotes | least |
T18041 | 30389-30394 | CD | denotes | three |
T18042 | 30395-30406 | JJ | denotes | independent |
T18043 | 30407-30418 | NNS | denotes | experiments |
T18044 | 30419-30422 | CC | denotes | and |
T18045 | 30423-30428 | WRB | denotes | where |
T18046 | 30429-30440 | JJ | denotes | appropriate |
T18047 | 30441-30450 | VBN | denotes | expressed |
T18048 | 30451-30453 | IN | denotes | as |
T18049 | 30454-30459 | NNS | denotes | means |
T18050 | 30459-30460 | VBP | denotes | ± |
T18051 | 30460-30463 | NNP | denotes | SEM |
T18052 | 30463-30464 | , | denotes | , |
T18053 | 30465-30466 | SYM | denotes | * |
T18054 | 30466-30467 | FW | denotes | p |
T18055 | 30467-30468 | FW | denotes | < |
T18056 | 30468-30472 | CD | denotes | 0.05 |
T18057 | 30472-30473 | . | denotes | . |
T18058 | 30474-30475 | -LRB- | denotes | ( |
T18059 | 30475-30476 | NNP | denotes | E |
T18060 | 30476-30477 | -RRB- | denotes | ) |
T18061 | 30478-30480 | NNP | denotes | FP |
T18062 | 30481-30488 | VBZ | denotes | induces |
T18063 | 30489-30494 | NNP | denotes | MKP-1 |
T18064 | 30495-30499 | NNP | denotes | mRNA |
T18065 | 30500-30502 | IN | denotes | in |
T18066 | 30503-30504 | DT | denotes | a |
T18067 | 30505-30519 | JJ | denotes | time-dependent |
T18068 | 30520-30526 | NN | denotes | manner |
T18069 | 30526-30527 | . | denotes | . |
T18070 | 30528-30535 | NNS | denotes | Results |
T18071 | 30536-30539 | VBP | denotes | are |
T18072 | 30540-30554 | NN | denotes | representative |
T18073 | 30555-30557 | IN | denotes | of |
T18074 | 30558-30561 | CD | denotes | two |
T18075 | 30562-30573 | JJ | denotes | independent |
T18076 | 30574-30585 | NNS | denotes | experiments |
T18077 | 30585-30586 | . | denotes | . |
T18078 | 30587-30590 | DT | denotes | All |
T18079 | 30591-30595 | NNS | denotes | data |
T18080 | 30596-30602 | IN | denotes | except |
T18081 | 30603-30604 | -LRB- | denotes | ( |
T18082 | 30604-30605 | NNP | denotes | E |
T18083 | 30605-30606 | -RRB- | denotes | ) |
T18084 | 30607-30611 | VBD | denotes | were |
T18085 | 30612-30620 | VBN | denotes | analysed |
T18086 | 30621-30623 | IN | denotes | by |
T18087 | 30624-30629 | NNP | denotes | ANOVA |
T18088 | 30630-30638 | VBD | denotes | followed |
T18089 | 30639-30641 | IN | denotes | by |
T18090 | 30642-30654 | NNP | denotes | Newman-Keuls |
T18091 | 30655-30664 | JJS | denotes | post-test |
T18092 | 30664-30665 | . | denotes | . |
T18334 | 31453-31464 | NNP | denotes | Fluticasone |
T18335 | 31465-31475 | NN | denotes | propionate |
T18336 | 31476-31484 | VBZ | denotes | competes |
T18337 | 31485-31489 | IN | denotes | with |
T18338 | 31490-31504 | NN | denotes | phospho-GATA-3 |
T18339 | 31505-31508 | IN | denotes | for |
T18340 | 31509-31519 | NN | denotes | importin-α |
T18341 | 31519-31520 | . | denotes | . |
T18342 | 31521-31522 | -LRB- | denotes | ( |
T18343 | 31522-31523 | NNP | denotes | A |
T18344 | 31523-31524 | -RRB- | denotes | ) |
T18345 | 31525-31534 | JJ | denotes | schematic |
T18346 | 31535-31549 | NN | denotes | representation |
T18347 | 31550-31552 | IN | denotes | of |
T18348 | 31553-31556 | DT | denotes | the |
T18349 | 31557-31559 | IN | denotes | in |
T18350 | 31560-31565 | NN | denotes | vitro |
T18351 | 31566-31573 | JJ | denotes | binding |
T18352 | 31574-31585 | NN | denotes | competition |
T18353 | 31586-31591 | NN | denotes | assay |
T18354 | 31591-31592 | . | denotes | . |
T18355 | 31593-31594 | -LRB- | denotes | ( |
T18356 | 31594-31595 | NNP | denotes | B |
T18357 | 31595-31596 | -RRB- | denotes | ) |
T18358 | 31597-31599 | NNP | denotes | GR |
T18359 | 31600-31608 | VBD | denotes | isolated |
T18360 | 31609-31613 | IN | denotes | from |
T18361 | 31614-31616 | NNP | denotes | FP |
T18362 | 31617-31618 | -LRB- | denotes | ( |
T18363 | 31618-31620 | CD | denotes | 10 |
T18364 | 31620-31621 | NN | denotes | − |
T18365 | 31621-31622 | CD | denotes | 8 |
T18366 | 31623-31624 | NNP | denotes | M |
T18367 | 31624-31625 | -RRB- | denotes | ) |
T18368 | 31626-31636 | VBD | denotes | stimulated |
T18369 | 31637-31642 | NNS | denotes | cells |
T18370 | 31643-31651 | VBZ | denotes | enhances |
T18371 | 31652-31654 | NNP | denotes | GR |
T18372 | 31655-31665 | JJ | denotes | importin-α |
T18373 | 31666-31673 | JJ | denotes | binding |
T18374 | 31674-31676 | IN | denotes | in |
T18375 | 31677-31680 | DT | denotes | the |
T18376 | 31681-31689 | NN | denotes | presence |
T18377 | 31690-31691 | -LRB- | denotes | ( |
T18378 | 31691-31692 | FW | denotes | • |
T18379 | 31692-31693 | -RRB- | denotes | ) |
T18380 | 31694-31697 | CC | denotes | and |
T18381 | 31698-31705 | NN | denotes | absence |
T18382 | 31706-31707 | -LRB- | denotes | ( |
T18383 | 31707-31708 | FW | denotes | ▪ |
T18384 | 31708-31709 | -RRB- | denotes | ) |
T18385 | 31710-31712 | IN | denotes | of |
T18386 | 31713-31722 | VBN | denotes | activated |
T18387 | 31723-31729 | NNP | denotes | GATA-3 |
T18388 | 31729-31730 | . | denotes | . |
T18389 | 31731-31732 | SYM | denotes | * |
T18390 | 31733-31734 | NN | denotes | p |
T18391 | 31734-31735 | NN | denotes | < |
T18392 | 31735-31739 | CD | denotes | 0.05 |
T18393 | 31740-31748 | VBN | denotes | compared |
T18394 | 31749-31751 | TO | denotes | to |
T18395 | 31752-31754 | DT | denotes | no |
T18396 | 31755-31764 | VBN | denotes | activated |
T18397 | 31765-31767 | NNP | denotes | GR |
T18398 | 31767-31768 | . | denotes | . |
T18399 | 31769-31770 | -LRB- | denotes | ( |
T18400 | 31770-31771 | $ | denotes | C |
T18401 | 31771-31772 | -RRB- | denotes | ) |
T18402 | 31773-31779 | JJ | denotes | GATA-3 |
T18403 | 31780-31788 | VBN | denotes | isolated |
T18404 | 31789-31793 | IN | denotes | from |
T18405 | 31794-31802 | JJ | denotes | anti-CD3 |
T18406 | 31802-31803 | NN | denotes | / |
T18407 | 31803-31807 | CD | denotes | CD28 |
T18408 | 31808-31818 | VBD | denotes | stimulated |
T18409 | 31819-31824 | NNS | denotes | cells |
T18410 | 31825-31829 | VBZ | denotes | does |
T18411 | 31830-31833 | RB | denotes | not |
T18412 | 31834-31843 | VB | denotes | attenuate |
T18413 | 31844-31846 | NNP | denotes | GR |
T18414 | 31847-31857 | JJ | denotes | importin-α |
T18415 | 31858-31869 | NN | denotes | association |
T18416 | 31869-31870 | . | denotes | . |
T18417 | 31871-31872 | SYM | denotes | * |
T18418 | 31872-31873 | NN | denotes | p |
T18419 | 31873-31874 | NN | denotes | < |
T18420 | 31874-31878 | CD | denotes | 0.05 |
T18421 | 31879-31887 | VBN | denotes | compared |
T18422 | 31888-31890 | TO | denotes | to |
T18423 | 31891-31898 | VB | denotes | control |
T18424 | 31898-31899 | . | denotes | . |
T18425 | 31900-31901 | -LRB- | denotes | ( |
T18426 | 31901-31902 | NNP | denotes | D |
T18427 | 31902-31903 | -RRB- | denotes | ) |
T18428 | 31904-31913 | NNP | denotes | Activated |
T18429 | 31914-31916 | NNP | denotes | GR |
T18430 | 31917-31923 | VBZ | denotes | blocks |
T18431 | 31924-31927 | DT | denotes | the |
T18432 | 31928-31935 | NN | denotes | ability |
T18433 | 31936-31938 | IN | denotes | of |
T18434 | 31939-31947 | JJ | denotes | purified |
T18435 | 31948-31962 | JJ | denotes | phospho-GATA-3 |
T18436 | 31963-31971 | VBN | denotes | isolated |
T18437 | 31972-31976 | IN | denotes | from |
T18438 | 31977-31985 | JJ | denotes | anti-CD3 |
T18439 | 31985-31986 | NN | denotes | / |
T18440 | 31986-31990 | CD | denotes | CD28 |
T18441 | 31991-32001 | VBD | denotes | stimulated |
T18442 | 32002-32007 | NNS | denotes | cells |
T18443 | 32008-32019 | VBG | denotes | interacting |
T18444 | 32020-32024 | IN | denotes | with |
T18445 | 32025-32036 | JJ | denotes | immobilised |
T18446 | 32037-32047 | NN | denotes | importin-α |
T18447 | 32048-32050 | IN | denotes | in |
T18448 | 32051-32053 | DT | denotes | an |
T18449 | 32054-32056 | IN | denotes | in |
T18450 | 32057-32062 | NN | denotes | vitro |
T18451 | 32063-32070 | JJ | denotes | binding |
T18452 | 32071-32076 | NN | denotes | assay |
T18453 | 32076-32077 | . | denotes | . |
T18454 | 32078-32079 | SYM | denotes | * |
T18455 | 32079-32080 | NN | denotes | p |
T18456 | 32080-32081 | NN | denotes | < |
T18457 | 32081-32085 | CD | denotes | 0.05 |
T18458 | 32086-32094 | VBN | denotes | compared |
T18459 | 32095-32097 | TO | denotes | to |
T18460 | 32098-32104 | JJ | denotes | GATA-3 |
T18461 | 32105-32113 | VBN | denotes | isolated |
T18462 | 32114-32118 | IN | denotes | from |
T18463 | 32119-32131 | JJ | denotes | unstimulated |
T18464 | 32132-32137 | NNS | denotes | cells |
T18465 | 32137-32138 | . | denotes | . |
T18466 | 32139-32142 | JJ | denotes | # p |
T18467 | 32142-32143 | NN | denotes | < |
T18468 | 32143-32147 | CD | denotes | 0.05 |
T18469 | 32148-32156 | VBN | denotes | compared |
T18470 | 32157-32159 | TO | denotes | to |
T18471 | 32160-32170 | VBN | denotes | stimulated |
T18472 | 32171-32186 | JJ | denotes | GATA-3-importin |
T18473 | 32187-32194 | JJ | denotes | binding |
T18474 | 32194-32195 | . | denotes | . |
T18475 | 32196-32197 | -LRB- | denotes | ( |
T18476 | 32197-32198 | NNP | denotes | E |
T18477 | 32198-32199 | -RRB- | denotes | ) |
T18478 | 32200-32203 | DT | denotes | The |
T18479 | 32204-32210 | NN | denotes | effect |
T18480 | 32211-32213 | IN | denotes | of |
T18481 | 32214-32223 | VBN | denotes | activated |
T18482 | 32224-32225 | -LRB- | denotes | ( |
T18483 | 32225-32226 | NN | denotes | • |
T18484 | 32226-32227 | -RRB- | denotes | ) |
T18485 | 32228-32234 | CC | denotes | versus |
T18486 | 32235-32247 | JJ | denotes | unstimulated |
T18487 | 32248-32249 | -LRB- | denotes | ( |
T18488 | 32249-32250 | NN | denotes | ○ |
T18489 | 32250-32251 | -RRB- | denotes | ) |
T18490 | 32252-32254 | NN | denotes | GR |
T18491 | 32255-32257 | IN | denotes | on |
T18492 | 32258-32269 | NN | denotes | attenuation |
T18493 | 32270-32272 | IN | denotes | of |
T18494 | 32273-32279 | NNP | denotes | GATA-3 |
T18495 | 32280-32290 | JJ | denotes | importin-α |
T18496 | 32291-32302 | NN | denotes | association |
T18497 | 32303-32306 | VBD | denotes | was |
T18498 | 32307-32330 | JJ | denotes | concentration-dependent |
T18499 | 32330-32331 | . | denotes | . |
T18500 | 32332-32333 | SYM | denotes | * |
T18501 | 32333-32334 | NN | denotes | p |
T18502 | 32334-32335 | NN | denotes | < |
T18503 | 32335-32339 | CD | denotes | 0.05 |
T18504 | 32339-32340 | , | denotes | , |
T18505 | 32341-32343 | SYM | denotes | ** |
T18506 | 32343-32344 | FW | denotes | p |
T18507 | 32344-32345 | FW | denotes | < |
T18508 | 32345-32349 | CD | denotes | 0.01 |
T18509 | 32350-32357 | IN | denotes | between |
T18510 | 32358-32364 | NNS | denotes | groups |
T18511 | 32364-32365 | . | denotes | . |
T18512 | 32366-32369 | DT | denotes | All |
T18513 | 32370-32377 | NNS | denotes | results |
T18514 | 32378-32381 | VBP | denotes | are |
T18515 | 32382-32391 | VBN | denotes | expressed |
T18516 | 32392-32394 | IN | denotes | as |
T18517 | 32395-32399 | JJ | denotes | mean |
T18518 | 32399-32400 | NN | denotes | ± |
T18519 | 32400-32403 | NNP | denotes | SEM |
T18520 | 32404-32406 | IN | denotes | of |
T18521 | 32407-32412 | CD | denotes | three |
T18522 | 32413-32424 | JJ | denotes | independent |
T18523 | 32425-32436 | NNS | denotes | experiments |
T18524 | 32437-32440 | CC | denotes | and |
T18525 | 32441-32449 | VBN | denotes | analysed |
T18526 | 32450-32452 | IN | denotes | by |
T18527 | 32453-32458 | NNP | denotes | ANOVA |
T18528 | 32459-32467 | VBD | denotes | followed |
T18529 | 32468-32470 | IN | denotes | by |
T18530 | 32471-32483 | NNP | denotes | Newman-Keuls |
T18531 | 32484-32493 | JJS | denotes | post-test |
T18532 | 32493-32494 | . | denotes | . |
T18930 | 33262-33273 | NNP | denotes | Fluticasone |
T18931 | 33274-33284 | NN | denotes | propionate |
T18932 | 33285-33289 | VBZ | denotes | does |
T18933 | 33290-33293 | RB | denotes | not |
T18934 | 33294-33300 | VB | denotes | affect |
T18935 | 33301-33307 | JJ | denotes | GATA-3 |
T18936 | 33308-33315 | JJ | denotes | nuclear |
T18937 | 33316-33322 | NN | denotes | export |
T18938 | 33322-33323 | . | denotes | . |
T18939 | 33324-33325 | -LRB- | denotes | ( |
T18940 | 33325-33326 | NN | denotes | A |
T18941 | 33326-33327 | -RRB- | denotes | ) |
T18942 | 33328-33335 | JJ | denotes | Western |
T18943 | 33336-33340 | NN | denotes | blot |
T18944 | 33341-33349 | NN | denotes | analysis |
T18945 | 33350-33357 | VBG | denotes | showing |
T18946 | 33358-33362 | IN | denotes | that |
T18947 | 33363-33366 | DT | denotes | the |
T18948 | 33367-33374 | JJ | denotes | nuclear |
T18949 | 33375-33381 | NN | denotes | export |
T18950 | 33382-33391 | NN | denotes | inhibitor |
T18951 | 33392-33402 | NN | denotes | leptomycin |
T18952 | 33403-33404 | NNP | denotes | B |
T18953 | 33405-33406 | -LRB- | denotes | ( |
T18954 | 33406-33407 | CD | denotes | 2 |
T18955 | 33408-33410 | NNP | denotes | nM |
T18956 | 33410-33411 | -RRB- | denotes | ) |
T18957 | 33412-33416 | VBZ | denotes | does |
T18958 | 33417-33420 | RB | denotes | not |
T18959 | 33421-33427 | VB | denotes | affect |
T18960 | 33428-33431 | DT | denotes | the |
T18961 | 33432-33439 | NN | denotes | ability |
T18962 | 33440-33442 | IN | denotes | of |
T18963 | 33443-33445 | NNP | denotes | FP |
T18964 | 33446-33447 | -LRB- | denotes | ( |
T18965 | 33447-33449 | CD | denotes | 10 |
T18966 | 33449-33450 | NN | denotes | − |
T18967 | 33450-33451 | CD | denotes | 8 |
T18968 | 33452-33453 | NNP | denotes | M |
T18969 | 33453-33454 | -RRB- | denotes | ) |
T18970 | 33455-33457 | TO | denotes | to |
T18971 | 33458-33465 | VB | denotes | prevent |
T18972 | 33466-33474 | JJ | denotes | anti-CD3 |
T18973 | 33474-33475 | NN | denotes | / |
T18974 | 33475-33479 | CD | denotes | CD28 |
T18975 | 33480-33490 | VBD | denotes | stimulated |
T18976 | 33491-33497 | JJ | denotes | GATA-3 |
T18977 | 33498-33505 | JJ | denotes | nuclear |
T18978 | 33506-33518 | NN | denotes | localization |
T18979 | 33519-33527 | VBN | denotes | measured |
T18980 | 33528-33530 | IN | denotes | at |
T18981 | 33531-33533 | CD | denotes | 60 |
T18982 | 33534-33537 | NN | denotes | min |
T18983 | 33537-33538 | . | denotes | . |
T18984 | 33539-33542 | FW | denotes | *** |
T18985 | 33542-33543 | FW | denotes | p |
T18986 | 33543-33544 | FW | denotes | < |
T18987 | 33544-33549 | CD | denotes | 0.001 |
T18988 | 33550-33558 | VBN | denotes | compared |
T18989 | 33559-33561 | TO | denotes | to |
T18990 | 33562-33574 | JJ | denotes | unstimulated |
T18991 | 33575-33580 | NNS | denotes | cells |
T18992 | 33580-33581 | , | denotes | , |
T18993 | 33582-33585 | FW | denotes | ### |
T18994 | 25492-25493 | FW | denotes | p |
T18995 | 25493-25494 | FW | denotes | < |
T18996 | 25494-25499 | CD | denotes | 0.001 |
T18997 | 25500-25508 | VBN | denotes | compared |
T18998 | 25509-25511 | TO | denotes | to |
T18999 | 25512-25520 | JJ | denotes | anti-CD3 |
T19000 | 25520-25521 | NN | denotes | / |
T19001 | 25521-25525 | CD | denotes | CD28 |
T19002 | 25526-25536 | VBD | denotes | stimulated |
T19003 | 33631-33636 | NNS | denotes | cells |
T19004 | 33636-33637 | . | denotes | . |
T19005 | 33638-33639 | -LRB- | denotes | ( |
T19006 | 33639-33640 | NNP | denotes | B |
T19007 | 33640-33641 | -RRB- | denotes | ) |
T19008 | 33642-33649 | NNP | denotes | Western |
T19009 | 33650-33654 | NN | denotes | blot |
T19010 | 33655-33663 | NN | denotes | analysis |
T19011 | 33664-33671 | VBG | denotes | showing |
T19012 | 33672-33676 | IN | denotes | that |
T19013 | 33677-33679 | NNP | denotes | FP |
T19014 | 33680-33681 | -LRB- | denotes | ( |
T19015 | 33681-33683 | CD | denotes | 10 |
T19016 | 33683-33684 | NN | denotes | − |
T19017 | 33684-33685 | CD | denotes | 8 |
T19018 | 33686-33687 | NNP | denotes | M |
T19019 | 33687-33688 | -RRB- | denotes | ) |
T19020 | 33689-33693 | VBZ | denotes | does |
T19021 | 33694-33697 | RB | denotes | not |
T19022 | 33698-33704 | VB | denotes | affect |
T19023 | 33705-33715 | JJ | denotes | whole-cell |
T19024 | 33716-33722 | JJ | denotes | GATA-3 |
T19025 | 33723-33734 | NN | denotes | degradation |
T19026 | 33735-33739 | IN | denotes | over |
T19027 | 33740-33742 | CD | denotes | 17 |
T19028 | 33743-33745 | NN | denotes | h. |
T19029 | 33746-33747 | -LRB- | denotes | ( |
T19030 | 33747-33748 | NNP | denotes | C |
T19031 | 33748-33749 | -RRB- | denotes | ) |
T19032 | 33750-33760 | JJ | denotes | GFP-tagged |
T19033 | 33761-33767 | NN | denotes | GATA-3 |
T19034 | 33768-33770 | VBZ | denotes | is |
T19035 | 33771-33784 | VBN | denotes | overexpressed |
T19036 | 33785-33788 | CC | denotes | and |
T19037 | 33789-33794 | NNS | denotes | cells |
T19038 | 33795-33805 | VBN | denotes | stimulated |
T19039 | 33806-33807 | -LRB- | denotes | ( |
T19040 | 33807-33808 | NN | denotes | b |
T19041 | 33809-33810 | NN | denotes | j |
T19042 | 33810-33811 | -RRB- | denotes | ) |
T19043 | 33812-33814 | CC | denotes | or |
T19044 | 33815-33818 | RB | denotes | not |
T19045 | 33819-33820 | -LRB- | denotes | ( |
T19046 | 33820-33821 | DT | denotes | a |
T19047 | 33821-33822 | -RRB- | denotes | ) |
T19048 | 33823-33827 | IN | denotes | with |
T19049 | 33828-33836 | JJ | denotes | anti-CD3 |
T19050 | 33836-33837 | NN | denotes | / |
T19051 | 33837-33841 | NNP | denotes | CD28 |
T19052 | 33841-33842 | . | denotes | . |
T19053 | 33843-33846 | DT | denotes | The |
T19054 | 33847-33853 | NN | denotes | effect |
T19055 | 33854-33856 | IN | denotes | of |
T19056 | 33857-33865 | VBG | denotes | treating |
T19057 | 33866-33871 | NNS | denotes | cells |
T19058 | 33872-33876 | IN | denotes | with |
T19059 | 33877-33879 | NNP | denotes | FP |
T19060 | 33880-33881 | -LRB- | denotes | ( |
T19061 | 33881-33883 | CD | denotes | 10 |
T19062 | 33883-33884 | NN | denotes | − |
T19063 | 33884-33885 | CD | denotes | 8 |
T19064 | 33886-33887 | NNP | denotes | M |
T19065 | 33887-33888 | , | denotes | , |
T19066 | 33889-33890 | SYM | denotes | f |
T19067 | 33891-33892 | NN | denotes | j |
T19068 | 33892-33893 | -RRB- | denotes | ) |
T19069 | 33894-33899 | IN | denotes | after |
T19070 | 33900-33902 | CD | denotes | 30 |
T19071 | 33903-33906 | NN | denotes | min |
T19072 | 33907-33918 | NN | denotes | stimulation |
T19073 | 33919-33923 | IN | denotes | with |
T19074 | 33924-33932 | JJ | denotes | anti-CD3 |
T19075 | 33932-33933 | NN | denotes | / |
T19076 | 33933-33937 | NNP | denotes | CD28 |
T19077 | 33938-33940 | VBZ | denotes | is |
T19078 | 33941-33945 | RB | denotes | also |
T19079 | 33946-33951 | VBN | denotes | shown |
T19080 | 33951-33952 | . | denotes | . |
T19081 | 33953-33954 | -LRB- | denotes | ( |
T19082 | 33954-33955 | NNP | denotes | D |
T19083 | 33955-33956 | -RRB- | denotes | ) |
T19084 | 33957-33959 | NNP | denotes | FP |
T19085 | 33960-33961 | -LRB- | denotes | ( |
T19086 | 33961-33963 | CD | denotes | 10 |
T19087 | 33963-33964 | NN | denotes | − |
T19088 | 33964-33965 | CD | denotes | 8 |
T19089 | 33966-33967 | NNP | denotes | M |
T19090 | 33967-33968 | -RRB- | denotes | ) |
T19091 | 33969-33973 | VBZ | denotes | does |
T19092 | 33974-33977 | RB | denotes | not |
T19093 | 33978-33985 | VB | denotes | prevent |
T19094 | 33986-33994 | JJ | denotes | anti-CD3 |
T19095 | 33994-33995 | NN | denotes | / |
T19096 | 33995-33999 | CD | denotes | CD28 |
T19097 | 34000-34010 | VBD | denotes | stimulated |
T19098 | 34011-34014 | CD | denotes | p65 |
T19099 | 34015-34022 | JJ | denotes | nuclear |
T19100 | 34023-34036 | NN | denotes | translocation |
T19101 | 34037-34039 | IN | denotes | at |
T19102 | 34040-34042 | CD | denotes | 60 |
T19103 | 34043-34046 | NN | denotes | min |
T19104 | 34047-34052 | IN | denotes | after |
T19105 | 34053-34064 | NN | denotes | stimulation |
T19106 | 34064-34065 | . | denotes | . |
T19107 | 34066-34068 | SYM | denotes | ** |
T19108 | 34068-34069 | FW | denotes | p |
T19109 | 34069-34070 | FW | denotes | < |
T19110 | 34070-34074 | CD | denotes | 0.01 |
T19111 | 34075-34083 | VBN | denotes | compared |
T19112 | 34084-34086 | TO | denotes | to |
T19113 | 34087-34099 | JJ | denotes | unstimulated |
T19114 | 34100-34105 | NNS | denotes | cells |
T19115 | 34105-34106 | . | denotes | . |
T19116 | 34107-34110 | DT | denotes | All |
T19117 | 34111-34118 | NNS | denotes | results |
T19118 | 34119-34122 | VBP | denotes | are |
T19119 | 34123-34137 | NN | denotes | representative |
T19120 | 34138-34140 | IN | denotes | of |
T19121 | 34141-34143 | IN | denotes | at |
T19122 | 34144-34149 | JJS | denotes | least |
T19123 | 34150-34154 | CD | denotes | four |
T19124 | 34155-34166 | JJ | denotes | independent |
T19125 | 34167-34178 | NNS | denotes | experiments |
T19126 | 34179-34182 | CC | denotes | and |
T19127 | 34183-34186 | VBP | denotes | are |
T19128 | 34187-34192 | VBN | denotes | shown |
T19129 | 34193-34195 | IN | denotes | as |
T19130 | 34196-34200 | JJ | denotes | mean |
T19131 | 34200-34201 | NN | denotes | ± |
T19132 | 34201-34204 | NNP | denotes | SEM |
T19133 | 34204-34205 | . | denotes | . |
T19134 | 34206-34213 | NNS | denotes | Results |
T19135 | 34214-34218 | VBD | denotes | were |
T19136 | 34219-34227 | VBN | denotes | analysed |
T19137 | 34228-34230 | IN | denotes | by |
T19138 | 34231-34236 | NNP | denotes | ANOVA |
T19139 | 34237-34245 | VBD | denotes | followed |
T19140 | 34246-34248 | IN | denotes | by |
T19141 | 34249-34261 | NNP | denotes | Newman-Keuls |
T19142 | 34262-34266 | NN | denotes | test |
T19143 | 34266-34267 | . | denotes | . |
T19430 | 34789-34800 | NNP | denotes | Fluticasone |
T19431 | 34801-34811 | NN | denotes | propionate |
T19432 | 34812-34819 | VBZ | denotes | impairs |
T19433 | 34820-34826 | JJ | denotes | GATA-3 |
T19434 | 34827-34838 | NN | denotes | interaction |
T19435 | 34839-34843 | IN | denotes | with |
T19436 | 34844-34854 | JJ | denotes | importin-α |
T19437 | 34855-34858 | CC | denotes | and |
T19438 | 34859-34865 | JJ | denotes | GATA-3 |
T19439 | 34866-34873 | JJ | denotes | nuclear |
T19440 | 34874-34886 | NN | denotes | localization |
T19441 | 34887-34889 | IN | denotes | in |
T19442 | 34890-34894 | NN | denotes | vivo |
T19443 | 34895-34898 | CC | denotes | and |
T19444 | 34899-34901 | FW | denotes | ex |
T19445 | 34902-34906 | FW | denotes | vivo |
T19446 | 34906-34907 | . | denotes | . |
T19447 | 34908-34909 | -LRB- | denotes | ( |
T19448 | 34909-34910 | DT | denotes | A |
T19449 | 34911-34914 | CC | denotes | and |
T19450 | 34915-34916 | NNP | denotes | B |
T19451 | 34916-34917 | -RRB- | denotes | ) |
T19452 | 34918-34940 | NN | denotes | Co-immunoprecipitation |
T19453 | 34941-34949 | NN | denotes | analysis |
T19454 | 34950-34952 | IN | denotes | of |
T19455 | 34953-34958 | NNS | denotes | PBMCs |
T19456 | 34959-34963 | IN | denotes | from |
T19457 | 34964-34977 | JJ | denotes | steroid-naïve |
T19458 | 34978-34984 | NN | denotes | asthma |
T19459 | 34985-34993 | NNS | denotes | patients |
T19460 | 34994-35001 | VBN | denotes | treated |
T19461 | 35002-35006 | IN | denotes | with |
T19462 | 35007-35009 | NNP | denotes | FP |
T19463 | 35010-35012 | IN | denotes | in |
T19464 | 35013-35018 | NN | denotes | vitro |
T19465 | 35019-35031 | VBD | denotes | demonstrated |
T19466 | 35032-35040 | VBN | denotes | impaired |
T19467 | 35041-35052 | NN | denotes | interaction |
T19468 | 35053-35060 | IN | denotes | between |
T19469 | 35061-35067 | NNP | denotes | GATA-3 |
T19470 | 35068-35071 | CC | denotes | and |
T19471 | 35072-35082 | JJ | denotes | importin-α |
T19472 | 35083-35091 | VBN | denotes | measured |
T19473 | 35092-35094 | IN | denotes | at |
T19474 | 35095-35097 | CD | denotes | 60 |
T19475 | 35098-35101 | NN | denotes | min |
T19476 | 35101-35102 | . | denotes | . |
T19477 | 35103-35107 | DT | denotes | Each |
T19478 | 35108-35111 | NN | denotes | bar |
T19479 | 35112-35122 | VBZ | denotes | represents |
T19480 | 35123-35126 | DT | denotes | the |
T19481 | 35127-35131 | JJ | denotes | mean |
T19482 | 35131-35132 | NN | denotes | ± |
T19483 | 35132-35135 | NNP | denotes | SEM |
T19484 | 35136-35138 | IN | denotes | of |
T19485 | 35139-35141 | IN | denotes | at |
T19486 | 35142-35147 | JJS | denotes | least |
T19487 | 35148-35153 | CD | denotes | three |
T19488 | 35154-35165 | JJ | denotes | independent |
T19489 | 35166-35177 | NNS | denotes | experiments |
T19490 | 35177-35178 | : | denotes | ; |
T19491 | 35179-35182 | FW | denotes | *** |
T19492 | 35183-35184 | FW | denotes | p |
T19493 | 35184-35185 | FW | denotes | < |
T19494 | 35185-35190 | CD | denotes | 0.001 |
T19495 | 35191-35199 | VBN | denotes | compared |
T19496 | 35200-35204 | IN | denotes | with |
T19497 | 35205-35212 | NN | denotes | control |
T19498 | 35213-35215 | IN | denotes | as |
T19499 | 35216-35226 | VBN | denotes | determined |
T19500 | 35227-35229 | IN | denotes | by |
T19501 | 35230-35248 | NNP | denotes | ANOVA/Newman-Keuls |
T19502 | 35249-35257 | NN | denotes | analysis |
T19503 | 35257-35258 | . | denotes | . |
T19504 | 35259-35260 | -LRB- | denotes | ( |
T19505 | 35260-35261 | NNP | denotes | C |
T19506 | 35262-35265 | CC | denotes | and |
T19507 | 35266-35267 | NNP | denotes | D |
T19508 | 35267-35268 | -RRB- | denotes | ) |
T19509 | 35269-35291 | NN | denotes | Co-immunoprecipitation |
T19510 | 35292-35300 | NNS | denotes | analyses |
T19511 | 35301-35303 | IN | denotes | of |
T19512 | 35304-35309 | NNS | denotes | PBMCs |
T19513 | 35310-35314 | IN | denotes | from |
T19514 | 35315-35328 | JJ | denotes | steroid-naïve |
T19515 | 35329-35335 | NN | denotes | asthma |
T19516 | 35336-35344 | NNS | denotes | patients |
T19517 | 35345-35352 | VBN | denotes | treated |
T19518 | 35353-35357 | IN | denotes | with |
T19519 | 35358-35365 | JJ | denotes | inhaled |
T19520 | 35366-35368 | NNP | denotes | FP |
T19521 | 35369-35370 | -LRB- | denotes | ( |
T19522 | 35370-35373 | CD | denotes | 500 |
T19523 | 35374-35376 | NN | denotes | µg |
T19524 | 35377-35380 | IN | denotes | via |
T19525 | 35381-35382 | DT | denotes | a |
T19526 | 35383-35389 | NN | denotes | spacer |
T19527 | 35389-35390 | -RRB- | denotes | ) |
T19528 | 35391-35393 | IN | denotes | in |
T19529 | 35394-35398 | NN | denotes | vivo |
T19530 | 35399-35411 | VBD | denotes | demonstrated |
T19531 | 35412-35421 | VBN | denotes | decreased |
T19532 | 35422-35433 | NN | denotes | association |
T19533 | 35434-35441 | IN | denotes | between |
T19534 | 35442-35448 | NNP | denotes | GATA-3 |
T19535 | 35449-35452 | CC | denotes | and |
T19536 | 35453-35463 | JJ | denotes | importin-α |
T19537 | 35463-35464 | . | denotes | . |
T19538 | 35465-35468 | DT | denotes | The |
T19539 | 35469-35479 | JJ | denotes | individual |
T19540 | 35480-35486 | NNS | denotes | values |
T19541 | 35487-35490 | IN | denotes | for |
T19542 | 35491-35495 | DT | denotes | each |
T19543 | 35496-35505 | NN | denotes | treatment |
T19544 | 35506-35509 | VBP | denotes | are |
T19545 | 35510-35519 | VBN | denotes | presented |
T19546 | 35520-35531 | RB | denotes | graphically |
T19547 | 35531-35532 | . | denotes | . |
T19548 | 35533-35534 | -LRB- | denotes | ( |
T19549 | 35534-35535 | NNP | denotes | E |
T19550 | 35535-35536 | -RRB- | denotes | ) |
T19551 | 35537-35551 | NNP | denotes | Representative |
T19552 | 35552-35559 | NNP | denotes | Western |
T19553 | 35560-35564 | NN | denotes | blot |
T19554 | 35565-35572 | VBG | denotes | showing |
T19555 | 35573-35577 | IN | denotes | that |
T19556 | 35578-35588 | JJ | denotes | importin-α |
T19557 | 35589-35599 | NN | denotes | expression |
T19558 | 35600-35603 | VBD | denotes | was |
T19559 | 35604-35614 | JJ | denotes | unaffected |
T19560 | 35615-35617 | IN | denotes | by |
T19561 | 35618-35628 | NN | denotes | inhalation |
T19562 | 35629-35631 | IN | denotes | of |
T19563 | 35632-35634 | NNP | denotes | FP |
T19564 | 35634-35635 | . | denotes | . |
T19565 | 35636-35640 | NNP | denotes | Blot |
T19566 | 35641-35643 | VBZ | denotes | is |
T19567 | 35644-35658 | NN | denotes | representative |
T19568 | 35659-35661 | IN | denotes | of |
T19569 | 35662-35666 | NNS | denotes | gels |
T19570 | 35667-35671 | IN | denotes | from |
T19571 | 35672-35677 | CD | denotes | three |
T19572 | 35678-35690 | NNS | denotes | participants |
T19573 | 35690-35691 | . | denotes | . |
T19983 | 37976-37983 | VBN | denotes | Inhaled |
T19984 | 37984-37995 | NN | denotes | fluticasone |
T19985 | 37996-38006 | NN | denotes | propionate |
T19986 | 38007-38014 | VBZ | denotes | impairs |
T19987 | 38015-38021 | JJ | denotes | GATA-3 |
T19988 | 38022-38029 | JJ | denotes | nuclear |
T19989 | 38030-38042 | NN | denotes | localization |
T19990 | 38043-38045 | IN | denotes | in |
T19991 | 38046-38051 | NNP | denotes | PBMCs |
T19992 | 38051-38052 | . | denotes | . |
T19993 | 38053-38054 | -LRB- | denotes | ( |
T19994 | 38054-38055 | NNP | denotes | A |
T19995 | 38055-38056 | -RRB- | denotes | ) |
T19996 | 38057-38071 | NNP | denotes | Representative |
T19997 | 38072-38091 | NN | denotes | immunocytochemistry |
T19998 | 38092-38094 | IN | denotes | of |
T19999 | 38095-38102 | VBG | denotes | showing |
T20000 | 38103-38106 | DT | denotes | the |
T20001 | 38107-38113 | NN | denotes | effect |
T20002 | 38114-38116 | IN | denotes | of |
T20003 | 38117-38124 | JJ | denotes | inhaled |
T20004 | 38125-38127 | NNP | denotes | FP |
T20005 | 38128-38129 | -LRB- | denotes | ( |
T20006 | 38129-38132 | CD | denotes | 500 |
T20007 | 38133-38135 | NN | denotes | µg |
T20008 | 38135-38136 | -RRB- | denotes | ) |
T20009 | 38137-38139 | IN | denotes | on |
T20010 | 38140-38142 | NNP | denotes | GR |
T20011 | 38143-38146 | CC | denotes | and |
T20012 | 38147-38153 | NNP | denotes | GATA-3 |
T20013 | 38154-38161 | JJ | denotes | nuclear |
T20014 | 38162-38174 | NN | denotes | localisation |
T20015 | 38174-38175 | . | denotes | . |
T20016 | 38176-38177 | -LRB- | denotes | ( |
T20017 | 38177-38178 | NNP | denotes | B |
T20018 | 38178-38179 | -RRB- | denotes | ) |
T20019 | 38180-38187 | NNP | denotes | Nuclear |
T20020 | 38188-38194 | NNP | denotes | GATA-3 |
T20021 | 38195-38211 | NN | denotes | immunoreactivity |
T20022 | 38212-38214 | IN | denotes | in |
T20023 | 38215-38220 | NNS | denotes | PBMCs |
T20024 | 38221-38225 | IN | denotes | from |
T20025 | 38226-38231 | CD | denotes | seven |
T20026 | 38232-38245 | JJ | denotes | steroid-naïve |
T20027 | 38246-38252 | NN | denotes | asthma |
T20028 | 38253-38261 | NNS | denotes | patients |
T20029 | 38262-38263 | CD | denotes | 2 |
T20030 | 38264-38265 | NN | denotes | h |
T20031 | 38266-38275 | VBG | denotes | following |
T20032 | 38276-38283 | JJ | denotes | inhaled |
T20033 | 38284-38286 | NNP | denotes | FP |
T20034 | 38287-38296 | NN | denotes | treatment |
T20035 | 38297-38298 | -LRB- | denotes | ( |
T20036 | 38298-38301 | CD | denotes | 100 |
T20037 | 38302-38304 | CC | denotes | or |
T20038 | 38305-38308 | CD | denotes | 500 |
T20039 | 38309-38311 | NN | denotes | µg |
T20040 | 38312-38315 | IN | denotes | via |
T20041 | 38316-38322 | NN | denotes | spacer |
T20042 | 38322-38323 | -RRB- | denotes | ) |
T20043 | 38323-38324 | . | denotes | . |
T20044 | 38325-38328 | DT | denotes | The |
T20045 | 38329-38335 | NN | denotes | median |
T20046 | 38336-38339 | CC | denotes | and |
T20047 | 38340-38353 | JJ | denotes | interquartile |
T20048 | 38354-38360 | NNS | denotes | ranges |
T20049 | 38361-38364 | IN | denotes | for |
T20050 | 38365-38369 | DT | denotes | each |
T20051 | 38370-38379 | NN | denotes | treatment |
T20052 | 38380-38383 | VBP | denotes | are |
T20053 | 38384-38393 | VBN | denotes | presented |
T20054 | 38394-38396 | IN | denotes | as |
T20055 | 38397-38398 | DT | denotes | a |
T20056 | 38399-38415 | NNS | denotes | box-and-whiskers |
T20057 | 38416-38420 | NN | denotes | plot |
T20058 | 38421-38422 | -LRB- | denotes | ( |
T20059 | 38422-38423 | FW | denotes | n |
T20060 | 38424-38425 | SYM | denotes | = |
T20061 | 38426-38427 | CD | denotes | 7 |
T20062 | 38427-38428 | -RRB- | denotes | ) |
T20063 | 38428-38429 | : | denotes | ; |
T20064 | 38430-38431 | SYM | denotes | * |
T20065 | 38432-38433 | NN | denotes | p |
T20066 | 38433-38434 | NN | denotes | < |
T20067 | 38434-38438 | CD | denotes | 0.05 |
T20068 | 38439-38447 | NNP | denotes | Wilcoxon |
T20069 | 38447-38449 | POS | denotes | 's |
T20070 | 38450-38454 | NN | denotes | rank |
T20071 | 38455-38459 | NN | denotes | test |
T20072 | 38460-38468 | VBN | denotes | compared |
T20073 | 38469-38473 | IN | denotes | with |
T20074 | 38474-38481 | NN | denotes | placebo |
T20075 | 38481-38482 | . | denotes | . |
T20076 | 38483-38484 | -LRB- | denotes | ( |
T20077 | 38484-38485 | NNP | denotes | C |
T20078 | 38485-38486 | -RRB- | denotes | ) |
T20079 | 38487-38501 | NNP | denotes | Immunoblotting |
T20080 | 38502-38510 | NNS | denotes | analyses |
T20081 | 38511-38513 | IN | denotes | of |
T20082 | 38514-38519 | NNP | denotes | PBMCs |
T20083 | 38520-38532 | VBD | denotes | demonstrated |
T20084 | 38533-38534 | DT | denotes | a |
T20085 | 38535-38549 | JJ | denotes | time-dependent |
T20086 | 38550-38558 | NN | denotes | decrease |
T20087 | 38559-38561 | IN | denotes | in |
T20088 | 38562-38569 | JJ | denotes | nuclear |
T20089 | 38570-38580 | NN | denotes | expression |
T20090 | 38581-38583 | IN | denotes | of |
T20091 | 38584-38590 | NNP | denotes | GATA-3 |
T20092 | 38590-38591 | , | denotes | , |
T20093 | 38592-38595 | CC | denotes | and |
T20094 | 38596-38605 | VBD | denotes | increased |
T20095 | 38606-38617 | JJ | denotes | cytoplasmic |
T20096 | 38618-38624 | JJ | denotes | GATA-3 |
T20097 | 38625-38635 | NN | denotes | expression |
T20098 | 38636-38641 | IN | denotes | after |
T20099 | 38642-38652 | NN | denotes | inhalation |
T20100 | 38653-38655 | IN | denotes | of |
T20101 | 38656-38658 | NNP | denotes | FP |
T20102 | 38658-38659 | . | denotes | . |
T20103 | 38660-38661 | -LRB- | denotes | ( |
T20104 | 38661-38662 | NNP | denotes | D |
T20105 | 38662-38663 | -RRB- | denotes | ) |
T20106 | 38664-38678 | NNP | denotes | Immunoblotting |
T20107 | 38679-38687 | NNS | denotes | analyses |
T20108 | 38688-38690 | IN | denotes | of |
T20109 | 38691-38696 | NNP | denotes | PBMCs |
T20110 | 38697-38709 | VBD | denotes | demonstrated |
T20111 | 38710-38711 | DT | denotes | a |
T20112 | 38712-38726 | JJ | denotes | dose-dependent |
T20113 | 38727-38735 | NN | denotes | decrease |
T20114 | 38736-38738 | IN | denotes | in |
T20115 | 38739-38746 | JJ | denotes | nuclear |
T20116 | 38747-38757 | NN | denotes | expression |
T20117 | 38758-38760 | IN | denotes | of |
T20118 | 38761-38767 | NNP | denotes | GATA-3 |
T20119 | 38767-38768 | , | denotes | , |
T20120 | 38769-38772 | CC | denotes | and |
T20121 | 38773-38782 | VBD | denotes | increased |
T20122 | 38783-38794 | JJ | denotes | cytoplasmic |
T20123 | 38795-38801 | JJ | denotes | GATA-3 |
T20124 | 38802-38812 | NN | denotes | expression |
T20125 | 38813-38814 | CD | denotes | 2 |
T20126 | 38815-38816 | NN | denotes | h |
T20127 | 38817-38822 | IN | denotes | after |
T20128 | 38823-38833 | NN | denotes | inhalation |
T20129 | 38834-38836 | IN | denotes | of |
T20130 | 38837-38839 | NNP | denotes | FP |
T20131 | 38839-38840 | . | denotes | . |
T20132 | 38841-38848 | NNP | denotes | Histone |
T20133 | 38849-38851 | NNP | denotes | H1 |
T20134 | 38852-38855 | CC | denotes | and |
T20135 | 38856-38861 | NNP | denotes | MEK-1 |
T20136 | 38862-38876 | VBG | denotes | immunoblotting |
T20137 | 38877-38886 | VBN | denotes | confirmed |
T20138 | 38887-38897 | JJ | denotes | equivalent |
T20139 | 38898-38903 | JJ | denotes | total |
T20140 | 38904-38911 | NN | denotes | protein |
T20141 | 38912-38919 | VBG | denotes | loading |
T20142 | 38920-38923 | IN | denotes | for |
T20143 | 38924-38927 | DT | denotes | the |
T20144 | 38928-38935 | JJ | denotes | nuclear |
T20145 | 38936-38939 | CC | denotes | and |
T20146 | 38940-38951 | JJ | denotes | cytoplasmic |
T20147 | 38952-38961 | NNS | denotes | fractions |
T20148 | 38962-38974 | RB | denotes | respectively |
T20149 | 38974-38975 | . | denotes | . |
T20150 | 38976-38990 | NN | denotes | Quantification |
T20151 | 38991-38993 | IN | denotes | of |
T20152 | 38994-38997 | DT | denotes | the |
T20153 | 38998-39010 | NN | denotes | densitometry |
T20154 | 39011-39015 | NNS | denotes | data |
T20155 | 39016-39018 | IN | denotes | in |
T20156 | 39019-39020 | -LRB- | denotes | ( |
T20157 | 39020-39021 | NNP | denotes | C |
T20158 | 39021-39022 | -RRB- | denotes | ) |
T20159 | 39023-39026 | CC | denotes | and |
T20160 | 39027-39028 | -LRB- | denotes | ( |
T20161 | 39028-39029 | NNP | denotes | D |
T20162 | 39029-39030 | -RRB- | denotes | ) |
T20163 | 39031-39033 | VBZ | denotes | is |
T20164 | 39034-39039 | VBN | denotes | shown |
T20165 | 39040-39042 | IN | denotes | as |
T20166 | 39043-39044 | DT | denotes | a |
T20167 | 39045-39061 | NNS | denotes | box-and-whiskers |
T20168 | 39062-39066 | NN | denotes | plot |
T20169 | 39067-39069 | IN | denotes | of |
T20170 | 39070-39077 | NNS | denotes | results |
T20171 | 39078-39082 | IN | denotes | from |
T20172 | 39083-39084 | JJ | denotes | n |
T20173 | 39085-39086 | SYM | denotes | = |
T20174 | 39087-39088 | CD | denotes | 6 |
T20175 | 39089-39101 | NNS | denotes | participants |
T20176 | 39102-39105 | IN | denotes | for |
T20177 | 39106-39111 | WDT | denotes | which |
T20178 | 39112-39116 | NNS | denotes | data |
T20179 | 39117-39121 | VBD | denotes | were |
T20180 | 39122-39131 | JJ | denotes | available |
T20181 | 39131-39132 | . | denotes | . |
T20182 | 39133-39134 | SYM | denotes | * |
T20183 | 39134-39135 | NN | denotes | p |
T20184 | 39135-39136 | NN | denotes | < |
T20185 | 39136-39140 | CD | denotes | 0.05 |
T20186 | 39141-39149 | VBN | denotes | compared |
T20187 | 39150-39152 | TO | denotes | to |
T20188 | 39153-39160 | VB | denotes | control |
T20189 | 39160-39161 | . | denotes | . |
T20190 | 39162-39163 | -LRB- | denotes | ( |
T20191 | 39163-39164 | NNP | denotes | E |
T20192 | 39164-39165 | -RRB- | denotes | ) |
T20193 | 39166-39173 | NNP | denotes | Western |
T20194 | 39174-39178 | NN | denotes | blot |
T20195 | 39179-39187 | NNS | denotes | analyses |
T20196 | 39188-39190 | IN | denotes | of |
T20197 | 39191-39196 | NNP | denotes | PBMCs |
T20198 | 39197-39209 | VBD | denotes | demonstrated |
T20199 | 39210-39211 | DT | denotes | a |
T20200 | 39212-39226 | JJ | denotes | time-dependent |
T20201 | 39227-39235 | NN | denotes | decrease |
T20202 | 39236-39238 | IN | denotes | in |
T20203 | 39239-39243 | JJ | denotes | dual |
T20204 | 39244-39259 | NN | denotes | phosphorylation |
T20205 | 39260-39261 | -LRB- | denotes | ( |
T20206 | 39261-39274 | NN | denotes | threonine-180 |
T20207 | 39275-39278 | CC | denotes | and |
T20208 | 39279-39291 | NN | denotes | tyrosine-182 |
T20209 | 39291-39292 | -RRB- | denotes | ) |
T20210 | 39293-39295 | IN | denotes | of |
T20211 | 39296-39299 | CD | denotes | p38 |
T20212 | 39300-39304 | NNP | denotes | MAPK |
T20213 | 39305-39310 | IN | denotes | after |
T20214 | 39311-39321 | NN | denotes | inhalation |
T20215 | 39322-39324 | IN | denotes | of |
T20216 | 39325-39327 | NNP | denotes | FP |
T454 | 0-11 | NN | denotes | Suppression |
T455 | 12-14 | IN | denotes | of |
T456 | 15-21 | NNP | denotes | GATA-3 |
T457 | 22-29 | NNP | denotes | Nuclear |
T458 | 30-36 | NN | denotes | Import |
T459 | 37-40 | CC | denotes | and |
T460 | 41-56 | NNP | denotes | Phosphorylation |
T461 | 56-57 | : | denotes | : |
T462 | 58-59 | NNP | denotes | A |
T463 | 60-65 | NNP | denotes | Novel |
T464 | 66-75 | NNP | denotes | Mechanism |
T465 | 76-78 | IN | denotes | of |
T466 | 79-93 | NNP | denotes | Corticosteroid |
T467 | 94-100 | NNP | denotes | Action |
T468 | 101-103 | IN | denotes | in |
T469 | 104-112 | NNP | denotes | Allergic |
T470 | 113-120 | NNP | denotes | Disease |
T471 | 455-465 | NNP | denotes | Background |
T472 | 466-472 | NNP | denotes | GATA-3 |
T473 | 473-478 | VBZ | denotes | plays |
T474 | 479-480 | DT | denotes | a |
T475 | 481-489 | JJ | denotes | critical |
T476 | 490-494 | NN | denotes | role |
T20217 | 39328-39329 | -LRB- | denotes | ( |
T20218 | 39329-39332 | CD | denotes | 500 |
T20219 | 39333-39335 | NN | denotes | µg |
T20220 | 39335-39336 | -RRB- | denotes | ) |
T20221 | 39336-39337 | . | denotes | . |
T20222 | 39338-39341 | DT | denotes | The |
T20223 | 39342-39349 | NNS | denotes | results |
T20224 | 39350-39355 | VBN | denotes | shown |
T20225 | 39356-39358 | IN | denotes | in |
T20226 | 39359-39360 | -LRB- | denotes | ( |
T20227 | 39360-39361 | NNP | denotes | E |
T20228 | 39361-39362 | -RRB- | denotes | ) |
T20229 | 39363-39366 | VBP | denotes | are |
T20230 | 39367-39381 | NN | denotes | representative |
T20231 | 39382-39384 | IN | denotes | of |
T20232 | 39385-39392 | NNS | denotes | samples |
T20233 | 39393-39397 | IN | denotes | from |
T20234 | 39398-39401 | CD | denotes | two |
T20235 | 39402-39414 | NNS | denotes | participants |
T20236 | 39414-39415 | . | denotes | . |
R374 | T484 | T488 | nmod | interleukin,-4 |
R375 | T477 | T476 | prep | in,role |
R376 | T478 | T477 | pcomp | regulating,in |
R377 | T479 | T480 | det | the,expression |
R378 | T480 | T478 | dobj | expression,regulating |
R379 | T485 | T484 | punct | (,interleukin |
R380 | T481 | T480 | prep | of,expression |
R381 | T482 | T483 | det | the,cytokines |
R382 | T483 | T481 | pobj | cytokines,of |
R383 | T486 | T484 | appos | IL,interleukin |
R384 | T487 | T484 | punct | ),interleukin |
R385 | T488 | T473 | npadvmod | -4,plays |
R386 | T489 | T488 | punct | ",",-4 |
R387 | T490 | T488 | conj | IL-5,-4 |
R398 | T590 | T589 | amod | independent,mechanism |
R400 | T591 | T590 | prep | of,independent |
R401 | T592 | T593 | amod | nuclear,factor-κB |
R403 | T593 | T591 | pobj | factor-κB,of |
R404 | T594 | T577 | cc | and,inhibits |
R405 | T595 | T577 | conj | is,inhibits |
R436 | T516 | T515 | pcomp | suppressing,in |
R444 | T517 | T518 | amod | allergic,inflammation |
R446 | T621 | T623 | punct | ",",induces |
R447 | T622 | T623 | nsubj | fluticasone,induces |
R448 | T518 | T516 | dobj | inflammation,suppressing |
R449 | T623 | T623 | ROOT | induces,induces |
R450 | T624 | T625 | det | the,expression |
R451 | T625 | T623 | dobj | expression,induces |
R452 | T519 | T512 | punct | ",",are |
R453 | T626 | T625 | prep | of,expression |
R454 | T627 | T629 | amod | mitogen-activated,kinase |
R455 | T628 | T629 | compound | protein,kinase |
R456 | T520 | T512 | cc | but,are |
R457 | T629 | T626 | pobj | kinase,of |
R458 | T630 | T631 | punct | (,MAPK |
R459 | T631 | T629 | appos | MAPK,kinase |
R460 | T632 | T629 | punct | ),kinase |
R461 | T633 | T625 | appos | phosphatase-1,expression |
R462 | T634 | T633 | punct | (,phosphatase-1 |
R463 | T521 | T522 | poss | their,effects |
R464 | T635 | T633 | appos | MKP-1,phosphatase-1 |
R465 | T636 | T633 | punct | ),phosphatase-1 |
R466 | T637 | T633 | punct | ",",phosphatase-1 |
R467 | T522 | T525 | nsubj | effects,are |
R468 | T638 | T640 | det | the,inhibitor |
R469 | T639 | T640 | amod | endogenous,inhibitor |
R470 | T640 | T633 | appos | inhibitor,phosphatase-1 |
R471 | T523 | T522 | prep | on,effects |
R472 | T641 | T640 | prep | of,inhibitor |
R473 | T642 | T643 | nummod | p38,MAPK |
R474 | T524 | T523 | pobj | GATA-3,on |
R475 | T643 | T641 | pobj | MAPK,of |
R476 | T644 | T643 | punct | ",",MAPK |
R477 | T645 | T646 | nsubj | which,is |
R478 | T646 | T643 | relcl | is,MAPK |
R479 | T525 | T512 | conj | are,are |
R480 | T647 | T646 | acomp | necessary,is |
R481 | T648 | T647 | prep | for,necessary |
R482 | T526 | T525 | acomp | unknown,are |
R483 | T527 | T525 | punct | .,are |
R484 | T528 | T529 | nsubj | We,investigated |
R485 | T529 | T529 | ROOT | investigated,investigated |
R486 | T649 | T651 | amod | GATA-3,translocation |
R487 | T530 | T531 | det | the,effect |
R488 | T531 | T529 | dobj | effect,investigated |
R489 | T532 | T531 | prep | of,effect |
R490 | T533 | T536 | det | the,propionate |
R491 | T534 | T536 | amod | corticosteroid,propionate |
R492 | T650 | T651 | amod | nuclear,translocation |
R493 | T535 | T536 | compound | fluticasone,propionate |
R494 | T536 | T532 | pobj | propionate,of |
R495 | T537 | T536 | prep | on,propionate |
R496 | T538 | T539 | amod | GATA-3,regulation |
R497 | T539 | T537 | pobj | regulation,on |
R498 | T540 | T539 | prep | in,regulation |
R499 | T651 | T648 | pobj | translocation,for |
R500 | T541 | T542 | amod | human,T-lymphocytes |
R501 | T542 | T540 | pobj | T-lymphocytes,in |
R502 | T543 | T539 | prep | in,regulation |
R503 | T544 | T543 | pobj | vitro,in |
R504 | T545 | T543 | cc | and,in |
R506 | T546 | T543 | conj | in,in |
R508 | T547 | T546 | pobj | vivo,in |
R511 | T548 | T529 | punct | .,investigated |
R512 | T549 | T549 | ROOT | Methods,Methods |
R514 | T550 | T549 | cc | and,Methods |
R518 | T551 | T549 | conj | Findings,Methods |
R522 | T552 | T574 | prep | In,demonstrated |
R526 | T553 | T557 | det | a,line |
R529 | T554 | T557 | compound | T,line |
R534 | T555 | T557 | compound | lymphocyte,line |
R537 | T556 | T557 | compound | cell,line |
R541 | T557 | T552 | pobj | line,In |
R545 | T558 | T559 | punct | (,HuT-78 |
R548 | T559 | T565 | amod | HuT-78,cells |
R550 | T560 | T559 | punct | ),HuT-78 |
R551 | T561 | T559 | cc | and,HuT-78 |
R552 | T562 | T565 | amod | peripheral,cells |
R553 | T563 | T564 | compound | blood,mononuclear |
R556 | T564 | T565 | compound | mononuclear,cells |
R562 | T565 | T574 | nsubj | cells,demonstrated |
R565 | T566 | T565 | acl | stimulated,cells |
R569 | T567 | T566 | agent | by,stimulated |
R572 | T568 | T574 | advcl | anti-CD3,demonstrated |
R573 | T569 | T568 | cc | and,anti-CD3 |
R574 | T570 | T568 | conj | anti-CD28,anti-CD3 |
R575 | T571 | T574 | prep | in,demonstrated |
R577 | T572 | T571 | pobj | vitro,in |
R581 | T573 | T574 | nsubj | we,demonstrated |
R584 | T574 | T574 | ROOT | demonstrated,demonstrated |
R588 | T575 | T577 | mark | that,inhibits |
R592 | T576 | T577 | nsubj | fluticasone,inhibits |
R596 | T577 | T574 | ccomp | inhibits,demonstrated |
R600 | T578 | T579 | amod | nuclear,translocation |
R603 | T579 | T577 | dobj | translocation,inhibits |
R604 | T717 | T720 | det | the,efficacy |
R605 | T580 | T579 | prep | of,translocation |
R606 | T581 | T580 | pobj | GATA-3,of |
R607 | T582 | T579 | cc | and,translocation |
R608 | T583 | T579 | conj | expression,translocation |
R609 | T584 | T583 | prep | of,expression |
R610 | T585 | T586 | amod | Th2,cytokines |
R611 | T586 | T584 | pobj | cytokines,of |
R612 | T718 | T720 | amod | striking,efficacy |
R613 | T587 | T577 | prep | via,inhibits |
R614 | T719 | T720 | amod | clinical,efficacy |
R615 | T720 | T716 | pobj | efficacy,for |
R616 | T588 | T589 | det | a,mechanism |
R617 | T721 | T720 | prep | of,efficacy |
R618 | T722 | T721 | pobj | corticosteroids,of |
R619 | T589 | T587 | pobj | mechanism,via |
R620 | T723 | T722 | prep | in,corticosteroids |
R621 | T724 | T725 | det | the,treatment |
R622 | T725 | T723 | pobj | treatment,in |
R624 | T726 | T725 | prep | of,treatment |
R625 | T727 | T728 | amod | allergic,diseases |
R784 | T459 | T458 | cc | and,Import |
R785 | T460 | T458 | conj | Phosphorylation,Import |
R786 | T461 | T454 | punct | :,Suppression |
R787 | T462 | T464 | compound | A,Mechanism |
R788 | T463 | T464 | compound | Novel,Mechanism |
R789 | T464 | T454 | appos | Mechanism,Suppression |
R790 | T465 | T464 | prep | of,Mechanism |
R791 | T466 | T467 | compound | Corticosteroid,Action |
R792 | T467 | T465 | pobj | Action,of |
R793 | T468 | T467 | prep | in,Action |
R794 | T469 | T468 | pobj | Allergic,in |
R795 | T470 | T472 | compound | Disease,GATA-3 |
R796 | T471 | T472 | compound | Background,GATA-3 |
R797 | T472 | T473 | nsubj | GATA-3,plays |
R798 | T473 | T473 | ROOT | plays,plays |
R799 | T474 | T476 | det | a,role |
R800 | T475 | T476 | amod | critical,role |
R801 | T476 | T473 | dobj | role,plays |
R3612 | T4177 | T4174 | punct | ),GATA-3 |
R3613 | T4178 | T4174 | cc | and,GATA-3 |
R3614 | T4179 | T4174 | conj | GR,GATA-3 |
R3615 | T4180 | T4181 | punct | (,E-20 |
R3616 | T4181 | T4174 | conj | E-20,GATA-3 |
R3617 | T4182 | T4181 | punct | ",",E-20 |
R3618 | T4183 | T4181 | amod | sc-1003,E-20 |
R3619 | T4184 | T4181 | punct | ),E-20 |
R3620 | T4185 | T4186 | auxpass | were,obtained |
R3621 | T4186 | T4186 | ROOT | obtained,obtained |
R3622 | T4187 | T4186 | prep | from,obtained |
R3623 | T4188 | T4190 | compound | Santa,Biotechnology |
R3624 | T4189 | T4190 | compound | Cruz,Biotechnology |
R3625 | T4190 | T4187 | pobj | Biotechnology,from |
R3626 | T4191 | T4190 | punct | (,Biotechnology |
R1977 | T2289 | T2287 | cc | and,rhinitis |
R1978 | T2290 | T2291 | amod | atopic,dermatitis |
R1979 | T2291 | T2287 | conj | dermatitis,rhinitis |
R1980 | T2292 | T2293 | auxpass | is,mediated |
R1981 | T2293 | T2293 | ROOT | mediated,mediated |
R1982 | T2294 | T2293 | prep | via,mediated |
R1983 | T2295 | T2294 | pobj | expression,via |
R1984 | T2296 | T2295 | prep | of,expression |
R1985 | T2297 | T2298 | det | the,cytokines |
R1986 | T2298 | T2296 | pobj | cytokines,of |
R1987 | T2299 | T2293 | conj | interleukin,mediated |
R1988 | T2300 | T2301 | punct | (,IL |
R1989 | T2301 | T2299 | appos | IL,interleukin |
R1990 | T2302 | T2301 | punct | ),IL |
R1991 | T2303 | T2301 | nummod | -4,IL |
R1992 | T2327 | T2325 | pobj | lymphocytes,from |
R1993 | T2304 | T2301 | punct | ",",IL |
R1994 | T2328 | T2320 | punct | ",",regulate |
R1995 | T2305 | T2301 | appos | IL-5,IL |
R1996 | T2306 | T2305 | punct | ",",IL-5 |
R1997 | T2329 | T2331 | mark | whereas,plays |
R1998 | T2307 | T2305 | cc | and,IL-5 |
R1999 | T2330 | T2331 | nsubj | IL-5,plays |
R2000 | T2331 | T2320 | advcl | plays,regulate |
R2001 | T2308 | T2305 | conj | IL-13,IL-5 |
R2002 | T2332 | T2334 | det | a,role |
R2003 | T2333 | T2334 | amod | key,role |
R2004 | T2334 | T2331 | dobj | role,plays |
R2005 | T2335 | T2334 | prep | in,role |
R2006 | T2309 | T2308 | prep | from,IL-13 |
R2007 | T2336 | T2337 | amod | eosinophilic,inflammation |
R2008 | T2337 | T2335 | pobj | inflammation,in |
R2009 | T2310 | T2311 | compound | T,helper-2 |
R2010 | T2338 | T2340 | quantmod | [,] |
R2011 | T2339 | T2340 | nummod | 1,] |
R2012 | T2340 | T2331 | npadvmod | ],plays |
R2013 | T2311 | T2309 | pobj | helper-2,from |
R2014 | T2341 | T2320 | punct | .,regulate |
R2015 | T2342 | T2343 | nummod | Th2,cytokines |
R2016 | T2343 | T2345 | nsubjpass | cytokines,regulated |
R2017 | T2312 | T2311 | punct | (,helper-2 |
R2018 | T2344 | T2345 | auxpass | are,regulated |
R2019 | T2313 | T2311 | appos | Th2,helper-2 |
R2020 | T2314 | T2311 | punct | ),helper-2 |
R2021 | T2315 | T2309 | pobj | cells,from |
R2022 | T2345 | T2345 | ROOT | regulated,regulated |
R2023 | T2346 | T2345 | agent | by,regulated |
R2024 | T2347 | T2351 | det | the,factor |
R2025 | T2348 | T2350 | compound | zinc,transcription |
R2026 | T2349 | T2350 | compound | finger,transcription |
R2027 | T2316 | T2293 | punct | .,mediated |
R2028 | T2350 | T2351 | compound | transcription,factor |
R2029 | T2351 | T2346 | pobj | factor,by |
R2030 | T2317 | T2320 | nsubj | IL-4,regulate |
R2031 | T2352 | T2351 | appos | GATA-3,factor |
R2032 | T2353 | T2351 | punct | ",",factor |
R2033 | T2354 | T2357 | nsubjpass | which,expressed |
R2034 | T2318 | T2317 | cc | and,IL-4 |
R2035 | T2355 | T2357 | auxpass | is,expressed |
R2036 | T2356 | T2357 | advmod | predominantly,expressed |
R2037 | T2357 | T2351 | relcl | expressed,factor |
R2038 | T2319 | T2317 | conj | IL-13,IL-4 |
R2039 | T2358 | T2357 | prep | in,expressed |
R2040 | T2320 | T2320 | ROOT | regulate,regulate |
R2041 | T2321 | T2322 | det | the,expression |
R2042 | T2359 | T2360 | amod | Th2,cells |
R2043 | T2322 | T2320 | dobj | expression,regulate |
R2044 | T2360 | T2358 | pobj | cells,in |
R2045 | T2361 | T2363 | nmod | [,] |
R2046 | T2362 | T2363 | nummod | 2,] |
R2047 | T2363 | T2367 | nmod | ],] |
R2048 | T2323 | T2322 | prep | of,expression |
R2049 | T2364 | T2363 | punct | ",",] |
R2050 | T2324 | T2323 | pobj | IgE,of |
R2051 | T2325 | T2320 | prep | from,regulate |
R2052 | T2365 | T2363 | conj | [,] |
R2053 | T2326 | T2327 | compound | B,lymphocytes |
R2054 | T2366 | T2367 | nummod | 3,] |
R2055 | T2367 | T2345 | npadvmod | ],regulated |
R2056 | T2368 | T2345 | punct | .,regulated |
R2057 | T2456 | T2454 | pobj | cytokines,of |
R2058 | T2369 | T2370 | nsubj | GATA-3,determines |
R2059 | T2370 | T2370 | ROOT | determines,determines |
R2060 | T2371 | T2373 | compound | Th2,differentiation |
R2061 | T2372 | T2373 | compound | cell,differentiation |
R2062 | T2457 | T2452 | prep | in,reduces |
R2063 | T2373 | T2370 | dobj | differentiation,determines |
R2064 | T2374 | T2370 | cc | and,determines |
R2065 | T2375 | T2376 | advmod | selectively,activates |
R2066 | T2458 | T2457 | pobj | vitro,in |
R2067 | T2376 | T2370 | conj | activates,determines |
R2068 | T2377 | T2378 | det | the,promoters |
R2069 | T2378 | T2376 | dobj | promoters,activates |
R2070 | T2459 | T2457 | cc | and,in |
R2071 | T2379 | T2378 | prep | of,promoters |
R2072 | T2380 | T2379 | pobj | IL-4,of |
R2073 | T2381 | T2380 | punct | ",",IL-4 |
R2074 | T2382 | T2380 | conj | IL-5,IL-4 |
R2075 | T2383 | T2382 | punct | ",",IL-5 |
R2076 | T2384 | T2382 | cc | and,IL-5 |
R2077 | T2385 | T2382 | conj | IL-13,IL-5 |
R2078 | T2460 | T2457 | conj | in,in |
R2079 | T2386 | T2376 | prep | through,activates |
R2080 | T2387 | T2388 | compound | chromatin,remodelling |
R2081 | T2388 | T2389 | compound | remodelling,[ |
R2082 | T2389 | T2391 | nmod | [,] |
R2083 | T2461 | T2460 | pobj | vivo,in |
R2084 | T2390 | T2391 | nummod | 4,] |
R2085 | T2391 | T2386 | pobj | ],through |
R2086 | T2392 | T2394 | nmod | [,] |
R2087 | T2462 | T2464 | nmod | [,] |
R2088 | T2393 | T2392 | nummod | 7,[ |
R2089 | T2394 | T2391 | appos | ],] |
R2090 | T2463 | T2464 | nummod | 10,] |
R2091 | T2395 | T2370 | punct | .,determines |
R2092 | T2396 | T2398 | det | The,role |
R2093 | T2397 | T2398 | amod | key,role |
R2094 | T2464 | T2452 | dobj | ],reduces |
R2095 | T2398 | T2407 | nsubjpass | role,demonstrated |
R2096 | T2399 | T2398 | prep | of,role |
R2097 | T2400 | T2399 | pobj | GATA-3,of |
R2098 | T2465 | T2464 | punct | ",",] |
R2099 | T2401 | T2400 | prep | in,GATA-3 |
R2100 | T2402 | T2404 | amod | allergic,inflammation |
R2101 | T2403 | T2404 | compound | airway,inflammation |
R2102 | T2466 | T2464 | cc | and,] |
R2103 | T2404 | T2401 | pobj | inflammation,in |
R2104 | T2405 | T2407 | aux | has,demonstrated |
R2105 | T2406 | T2407 | auxpass | been,demonstrated |
R2106 | T2407 | T2407 | ROOT | demonstrated,demonstrated |
R2107 | T2467 | T2468 | amod | similar,results |
R2108 | T2408 | T2407 | prep | in,demonstrated |
R2109 | T2409 | T2408 | pobj | mice,in |
R2110 | T2468 | T2464 | conj | results,] |
R2111 | T2410 | T2407 | agent | by,demonstrated |
R2112 | T2469 | T2471 | aux | have,reported |
R2113 | T2411 | T2413 | det | the,release |
R2114 | T2470 | T2471 | auxpass | been,reported |
R2115 | T2412 | T2413 | amod | reduced,release |
R2116 | T2471 | T2452 | conj | reported,reduces |
R2117 | T2413 | T2410 | pobj | release,by |
R2118 | T2414 | T2413 | prep | of,release |
R2119 | T2415 | T2416 | amod | Th2,cytokines |
R2120 | T2472 | T2471 | prep | in,reported |
R2121 | T2416 | T2414 | pobj | cytokines,of |
R2122 | T2417 | T2416 | prep | in,cytokines |
R2123 | T2418 | T2417 | pobj | animals,in |
R2124 | T2473 | T2474 | amod | isolated,murine |
R2125 | T2419 | T2418 | acl | treated,animals |
R2126 | T2420 | T2419 | prep | with,treated |
R2127 | T2421 | T2422 | amod | dominant-negative,mutants |
R2128 | T2474 | T2472 | pobj | murine,in |
R2129 | T2422 | T2420 | pobj | mutants,with |
R2130 | T2423 | T2422 | prep | of,mutants |
R2131 | T2475 | T2476 | compound | CD4,+ |
R2132 | T2476 | T2477 | nsubj | +,lymphocytes |
R2133 | T2424 | T2423 | pobj | GATA-3,of |
R2134 | T2425 | T2420 | cc | and,with |
R2135 | T2426 | T2419 | agent | by,treated |
R2136 | T2477 | T2471 | parataxis | lymphocytes,reported |
R2137 | T2427 | T2428 | amod | local,application |
R2138 | T2428 | T2426 | pobj | application,by |
R2139 | T2429 | T2428 | prep | of,application |
R2140 | T2478 | T2480 | nmod | [,] |
R2141 | T2430 | T2431 | amod | antisense,oligonucleotides |
R2142 | T2431 | T2429 | pobj | oligonucleotides,of |
R2143 | T2479 | T2480 | nummod | 11,] |
R2144 | T2432 | T2419 | prep | to,treated |
R2145 | T2433 | T2436 | nmod | GATA-3,] |
R2146 | T2434 | T2436 | nmod | [,] |
R2147 | T2480 | T2477 | dobj | ],lymphocytes |
R2148 | T2435 | T2436 | nummod | 8,] |
R2149 | T2436 | T2432 | pobj | ],to |
R2150 | T2437 | T2436 | punct | ",",] |
R2151 | T2438 | T2440 | nmod | [,] |
R2152 | T2481 | T2477 | punct | .,lymphocytes |
R2153 | T2439 | T2440 | nummod | 9,] |
R2154 | T2440 | T2436 | appos | ],] |
R2155 | T2482 | T2488 | advmod | Finally,using |
R2156 | T2441 | T2407 | punct | .,demonstrated |
R2157 | T2442 | T2452 | advmod | Furthermore,reduces |
R2158 | T2443 | T2445 | punct | ",",knock-out |
R2159 | T2483 | T2488 | punct | ",",using |
R2160 | T2444 | T2445 | amod | conditional,knock-out |
R2161 | T2445 | T2452 | nsubj | knock-out,reduces |
R2162 | T2446 | T2445 | prep | of,knock-out |
R3627 | T4192 | T4193 | compound | Santa,Cruz |
R3628 | T4193 | T4190 | appos | Cruz,Biotechnology |
R3629 | T4194 | T4193 | punct | ",",Cruz |
R3630 | T4195 | T4193 | conj | California,Cruz |
R3631 | T4196 | T4195 | punct | ",",California |
R3632 | T4197 | T4198 | compound | United,States |
R3633 | T4198 | T4195 | appos | States,California |
R3634 | T4199 | T4195 | punct | ),California |
R3635 | T4200 | T4190 | punct | ",",Biotechnology |
R3636 | T4201 | T4203 | amod | polyclonal,antibodies |
R3637 | T4202 | T4203 | compound | rabbit,antibodies |
R3638 | T4203 | T4186 | dobj | antibodies,obtained |
R3639 | T4204 | T4186 | prep | against,obtained |
R3640 | T4205 | T4207 | amod | phospho-p38,kinase |
R3641 | T4206 | T4207 | compound | MAP,kinase |
R3642 | T4207 | T4204 | pobj | kinase,against |
R3643 | T4208 | T4207 | cc | and,kinase |
R3644 | T4209 | T4207 | conj | phospho-ATF-2,kinase |
R3645 | T4210 | T4207 | prep | from,kinase |
R3646 | T4211 | T4212 | compound | Cell,Signaling |
R3647 | T4212 | T4210 | pobj | Signaling,from |
R3648 | T4213 | T4225 | nmod | Technology,antibody |
R3649 | T4214 | T4217 | punct | (,Biolabs |
R3650 | T4215 | T4217 | compound | New,Biolabs |
R3651 | T4216 | T4217 | compound | England,Biolabs |
R3652 | T4217 | T4213 | appos | Biolabs,Technology |
R3653 | T4218 | T4217 | punct | ",",Biolabs |
R3654 | T4219 | T4217 | conj | Hertford,Biolabs |
R3655 | T4220 | T4219 | punct | ",",Hertford |
R3656 | T4221 | T4219 | conj | UK,Hertford |
R3657 | T4222 | T4217 | punct | ),Biolabs |
R3658 | T4223 | T4217 | punct | ",",Biolabs |
R3659 | T4224 | T4225 | amod | monoclonal,antibody |
R3660 | T4225 | T4243 | nsubj | antibody,antibodies |
R3661 | T4226 | T4225 | prep | against,antibody |
R3662 | T4227 | T4226 | pobj | phosphoserine,against |
R3663 | T4228 | T4230 | punct | (,4H4 |
R3664 | T4229 | T4230 | compound | clone,4H4 |
R3665 | T4230 | T4227 | appos | 4H4,phosphoserine |
R3666 | T4231 | T4230 | punct | ),4H4 |
R3667 | T4232 | T4230 | prep | from,4H4 |
R3668 | T4233 | T4235 | compound | Affiniti,Products |
R3669 | T4234 | T4235 | compound | Research,Products |
R3670 | T4235 | T4232 | pobj | Products,from |
R3671 | T4236 | T4235 | punct | (,Products |
R3672 | T4237 | T4235 | npadvmod | Exeter,Products |
R3673 | T4238 | T4237 | punct | ",",Exeter |
R3674 | T4239 | T4237 | appos | UK,Exeter |
R3675 | T4240 | T4237 | punct | ),Exeter |
R3676 | T4241 | T4235 | punct | ",",Products |
R3677 | T4242 | T4227 | cc | and,phosphoserine |
R3678 | T4243 | T4212 | dobj | antibodies,Signaling |
R3679 | T4244 | T4243 | prep | against,antibodies |
R3680 | T4245 | T4247 | compound | rabbit,TRITC |
R3681 | T4246 | T4247 | compound | IgG-conjugated,TRITC |
R3682 | T4247 | T4244 | pobj | TRITC,against |
R3683 | T4248 | T4247 | prep | from,TRITC |
R3684 | T4249 | T4250 | compound | Dako,Cytomation |
R3685 | T4250 | T4248 | pobj | Cytomation,from |
R3686 | T4251 | T4250 | punct | (,Cytomation |
R3687 | T4252 | T4250 | appos | Cambridge,Cytomation |
R3688 | T4253 | T4252 | punct | ",",Cambridge |
R3689 | T4254 | T4252 | appos | UK,Cambridge |
R3690 | T4255 | T4252 | punct | ),Cambridge |
R3691 | T4256 | T4186 | punct | .,obtained |
R3692 | T4257 | T4259 | det | The,antibody |
R3693 | T4258 | T4259 | amod | anti-GR,antibody |
R3694 | T4259 | T4274 | nsubjpass | antibody,used |
R3695 | T4260 | T4259 | punct | (,antibody |
R3696 | T4261 | T4259 | appos | Clone,antibody |
R3697 | T4262 | T4261 | nummod | 41,Clone |
R3698 | T4263 | T4261 | punct | ),Clone |
R3699 | T4264 | T4259 | prep | from,antibody |
R3700 | T4265 | T4267 | compound | BD,Laboratories |
R3701 | T4266 | T4267 | compound | Transduction,Laboratories |
R2163 | T2484 | T2488 | nsubj | knockdown,using |
R2164 | T2447 | T2449 | det | the,gene |
R2165 | T2448 | T2449 | compound | Gata3,gene |
R2166 | T2449 | T2446 | pobj | gene,of |
R2167 | T2450 | T2445 | prep | in,knock-out |
R2168 | T2485 | T2484 | prep | of,knockdown |
R2169 | T2451 | T2450 | pobj | mice,in |
R2170 | T2452 | T2452 | ROOT | reduces,reduces |
R2171 | T2486 | T2487 | amod | GATA-3,expression |
R2172 | T2453 | T2452 | dobj | expression,reduces |
R2173 | T2454 | T2453 | prep | of,expression |
R2174 | T2455 | T2456 | compound | Th2,cytokines |
R2175 | T2487 | T2485 | pobj | expression,of |
R2176 | T2488 | T2488 | ROOT | using,using |
R2177 | T2489 | T2488 | dobj | siRNA,using |
R2178 | T2490 | T2488 | prep | in,using |
R2179 | T2491 | T2493 | amod | human,cells |
R2180 | T2553 | T2555 | auxpass | was,confirmed |
R2181 | T2554 | T2555 | advmod | recently,confirmed |
R2182 | T2492 | T2493 | compound | T,cells |
R2183 | T2555 | T2544 | conj | confirmed,demonstrated |
R2184 | T2556 | T2555 | prep | in,confirmed |
R2185 | T2557 | T2559 | amod | human,cells |
R2186 | T2493 | T2494 | compound | cells,results |
R2187 | T2558 | T2559 | compound | T,cells |
R2188 | T2559 | T2556 | pobj | cells,in |
R2189 | T2560 | T2555 | prep | following,confirmed |
R2190 | T2494 | T2490 | pobj | results,in |
R2191 | T2561 | T2563 | compound | T,receptor |
R2192 | T2562 | T2563 | compound | cell,receptor |
R2193 | T2563 | T2560 | pobj | receptor,following |
R2194 | T2495 | T2494 | prep | in,results |
R2195 | T2564 | T2563 | cc | and,receptor |
R2196 | T2565 | T2566 | compound | co-receptor,stimulation |
R2197 | T2496 | T2495 | pobj | loss,in |
R2198 | T2566 | T2563 | conj | stimulation,receptor |
R2199 | T2567 | T2569 | nmod | [,] |
R2200 | T2568 | T2569 | nummod | 12,] |
R2201 | T2497 | T2496 | prep | of,loss |
R2202 | T2569 | T2566 | nmod | ],stimulation |
R2203 | T2570 | T2544 | punct | .,demonstrated |
R2204 | T2571 | T2572 | nsubj | GATA-3,contains |
R2205 | T2498 | T2503 | amod | anti-CD3,expression |
R2206 | T2499 | T2503 | nmod | /,expression |
R2207 | T2572 | T2572 | ROOT | contains,contains |
R2208 | T2500 | T2503 | nmod | CD28-mediated,expression |
R2209 | T2573 | T2577 | det | a,signal |
R2210 | T2574 | T2577 | amod | classical,signal |
R2211 | T2501 | T2503 | amod | Th2,expression |
R2212 | T2575 | T2576 | amod | nuclear,import |
R2213 | T2576 | T2577 | compound | import,signal |
R2214 | T2577 | T2572 | dobj | signal,contains |
R2215 | T2502 | T2503 | compound | cytokine,expression |
R2216 | T2578 | T2580 | nmod | [,] |
R2217 | T2579 | T2580 | nummod | 14,] |
R2218 | T2580 | T2577 | appos | ],signal |
R2219 | T2503 | T2497 | pobj | expression,of |
R2220 | T2581 | T2572 | cc | and,contains |
R2221 | T2504 | T2506 | nmod | [,] |
R2222 | T2582 | T2583 | auxpass | is,transported |
R2223 | T2505 | T2506 | nummod | 12,] |
R2224 | T2583 | T2572 | conj | transported,contains |
R2225 | T2584 | T2583 | prep | into,transported |
R2226 | T2585 | T2586 | det | the,nucleus |
R2227 | T2586 | T2584 | pobj | nucleus,into |
R2228 | T2587 | T2583 | agent | by,transported |
R2229 | T2506 | T2503 | appos | ],expression |
R2230 | T2588 | T2591 | det | the,protein |
R2231 | T2589 | T2591 | amod | nuclear,protein |
R2232 | T2590 | T2591 | compound | import,protein |
R2233 | T2507 | T2488 | punct | .,using |
R2234 | T2591 | T2587 | pobj | protein,by |
R2235 | T2592 | T2583 | conj | importin-α,transported |
R2236 | T2593 | T2595 | punct | (,known |
R2237 | T2508 | T2519 | prep | In,translocate |
R2238 | T2594 | T2595 | advmod | also,known |
R2239 | T2595 | T2592 | acl | known,importin-α |
R2240 | T2596 | T2595 | prep | as,known |
R2241 | T2509 | T2508 | pobj | order,In |
R2242 | T2597 | T2596 | pobj | karyopherin-α,as |
R2243 | T2598 | T2592 | punct | ),importin-α |
R2244 | T2599 | T2601 | nmod | [,] |
R2245 | T2510 | T2513 | mark | for,regulate |
R2246 | T2600 | T2601 | nummod | 12,] |
R2247 | T2601 | T2572 | dep | ],contains |
R2248 | T2602 | T2572 | punct | .,contains |
R2249 | T2511 | T2513 | nsubj | GATA-3,regulate |
R2250 | T2603 | T2622 | nsubj | Deletion,prevents |
R2251 | T2604 | T2603 | prep | of,Deletion |
R2252 | T2605 | T2606 | det | a,region |
R2253 | T2512 | T2513 | aux | to,regulate |
R2254 | T2606 | T2604 | pobj | region,of |
R2255 | T2607 | T2606 | acl | encompassing,region |
R2256 | T2608 | T2612 | det | the,sequence |
R2257 | T2513 | T2509 | advcl | regulate,order |
R2258 | T2609 | T2612 | amod | GATA-3,sequence |
R2259 | T2610 | T2611 | amod | nuclear,localisation |
R2260 | T2514 | T2515 | compound | gene,expression |
R2261 | T2611 | T2612 | compound | localisation,sequence |
R2262 | T2515 | T2513 | dobj | expression,regulate |
R2263 | T2612 | T2607 | dobj | sequence,encompassing |
R2264 | T2613 | T2612 | punct | (,sequence |
R2265 | T2614 | T2612 | appos | NLS,sequence |
R2266 | T2516 | T2519 | punct | ",",translocate |
R2267 | T2615 | T2612 | punct | ),sequence |
R2268 | T2616 | T2606 | conj | region,region |
R2269 | T2617 | T2603 | prep | in,Deletion |
R2270 | T2517 | T2519 | nsubj | it,translocate |
R2271 | T2618 | T2617 | pobj | murine,in |
R2272 | T2619 | T2618 | cc | and,murine |
R2273 | T2620 | T2621 | amod | human,cells |
R2274 | T2518 | T2519 | aux | must,translocate |
R2275 | T2621 | T2618 | conj | cells,murine |
R2276 | T2622 | T2622 | ROOT | prevents,prevents |
R2277 | T2623 | T2625 | poss | its,localisation |
R2278 | T2624 | T2625 | amod | nuclear,localisation |
R2279 | T2625 | T2622 | dobj | localisation,prevents |
R2280 | T2519 | T2519 | ROOT | translocate,translocate |
R2281 | T2626 | T2628 | nmod | [,] |
R2282 | T2520 | T2519 | prep | from,translocate |
R2283 | T2627 | T2628 | nummod | 12,] |
R2284 | T2628 | T2622 | dobj | ],prevents |
R2285 | T2629 | T2628 | punct | ",",] |
R2286 | T2521 | T2522 | det | the,cytoplasm |
R2287 | T2630 | T2628 | conj | [,] |
R2288 | T2631 | T2632 | nummod | 14,] |
R2289 | T2632 | T2628 | conj | ],] |
R2290 | T2522 | T2520 | pobj | cytoplasm,from |
R2291 | T2633 | T2622 | punct | .,prevents |
R2292 | T2634 | T2635 | det | The,affinity |
R2293 | T2635 | T2642 | nsubjpass | affinity,regulated |
R2294 | T2523 | T2519 | prep | into,translocate |
R2295 | T2636 | T2635 | prep | of,affinity |
R2296 | T2637 | T2638 | det | the,importin-α |
R2297 | T2638 | T2636 | pobj | importin-α,of |
R2298 | T2524 | T2525 | det | the,nucleus |
R2299 | T2639 | T2640 | compound | NLS,interaction |
R2300 | T2640 | T2642 | nsubjpass | interaction,regulated |
R2301 | T2641 | T2642 | auxpass | is,regulated |
R2302 | T2525 | T2523 | pobj | nucleus,into |
R2303 | T2642 | T2642 | ROOT | regulated,regulated |
R2304 | T2643 | T2642 | agent | by,regulated |
R2305 | T2644 | T2645 | compound | phosphorylation,[ |
R2306 | T2526 | T2527 | aux | to,access |
R2307 | T2645 | T2647 | nmod | [,] |
R2308 | T2646 | T2647 | nummod | 15,] |
R2309 | T2647 | T2643 | pobj | ],by |
R2310 | T2527 | T2519 | advcl | access,translocate |
R2311 | T2648 | T2642 | punct | ",",regulated |
R2312 | T2649 | T2642 | cc | and,regulated |
R2313 | T2528 | T2530 | poss | its,genes |
R2314 | T2529 | T2530 | compound | target,genes |
R2315 | T2650 | T2652 | nsubj | we,shown |
R2316 | T2530 | T2527 | dobj | genes,access |
R2317 | T2651 | T2652 | aux | have,shown |
R2318 | T2652 | T2642 | conj | shown,regulated |
R2319 | T2653 | T2661 | mark | that,plays |
R2320 | T2531 | T2519 | punct | .,translocate |
R2321 | T2654 | T2657 | nummod | p38,kinase |
R2322 | T2655 | T2657 | amod | mitogen-activated,kinase |
R2323 | T2656 | T2657 | compound | protein,kinase |
R2324 | T2532 | T2534 | amod | Enhanced,expression |
R2325 | T2657 | T2661 | nsubj | kinase,plays |
R2326 | T2658 | T2659 | punct | (,MAPK |
R2327 | T2533 | T2534 | amod | nuclear,expression |
R2328 | T2659 | T2657 | appos | MAPK,kinase |
R2329 | T2660 | T2657 | punct | ),kinase |
R2330 | T2534 | T2544 | nsubjpass | expression,demonstrated |
R2331 | T2661 | T2652 | ccomp | plays,shown |
R2332 | T2662 | T2664 | det | a,role |
R2333 | T2663 | T2664 | amod | critical,role |
R2334 | T2535 | T2534 | prep | of,expression |
R2335 | T2664 | T2661 | dobj | role,plays |
R2336 | T2665 | T2664 | prep | in,role |
R2337 | T2536 | T2535 | pobj | GATA-3,of |
R2338 | T2537 | T2534 | acl | following,expression |
R2341 | T2538 | T2541 | compound | T,activation |
R2345 | T2539 | T2540 | compound | cell,receptor |
R2350 | T2540 | T2541 | compound | receptor,activation |
R2353 | T2541 | T2537 | pobj | activation,following |
R2357 | T2542 | T2544 | auxpass | was,demonstrated |
R2358 | T2680 | T2682 | nmod | [,] |
R2359 | T2681 | T2682 | nummod | 12,] |
R2360 | T2682 | T2679 | appos | ],nucleus |
R2361 | T2543 | T2544 | advmod | first,demonstrated |
R2362 | T2683 | T2652 | punct | .,shown |
R2363 | T2684 | T2685 | nsubj | Corticosteroids,are |
R2364 | T2685 | T2685 | ROOT | are,are |
R2365 | T2686 | T2687 | advmod | highly,effective |
R2366 | T2544 | T2544 | ROOT | demonstrated,demonstrated |
R2367 | T2687 | T2685 | acomp | effective,are |
R2368 | T2688 | T2687 | prep | in,effective |
R2369 | T2689 | T2690 | det | the,treatment |
R2370 | T2545 | T2544 | prep | in,demonstrated |
R2371 | T2690 | T2688 | pobj | treatment,in |
R2372 | T2691 | T2690 | prep | of,treatment |
R2373 | T2546 | T2547 | compound | murine,T |
R2374 | T2692 | T2693 | amod | allergic,inflammation |
R2375 | T2693 | T2691 | pobj | inflammation,of |
R2376 | T2694 | T2685 | punct | ",",are |
R2377 | T2695 | T2685 | prep | with,are |
R2378 | T2696 | T2697 | amod | marked,suppression |
R2379 | T2697 | T2695 | pobj | suppression,with |
R2380 | T2547 | T2548 | compound | T,cells |
R2381 | T2698 | T2697 | prep | of,suppression |
R2382 | T2699 | T2700 | amod | Th2,cytokines |
R2383 | T2700 | T2698 | pobj | cytokines,of |
R2384 | T2701 | T2697 | prep | in,suppression |
R2385 | T2548 | T2545 | pobj | cells,in |
R2386 | T2702 | T2701 | pobj | airways,in |
R2387 | T2703 | T2702 | prep | of,airways |
R2388 | T2704 | T2703 | pobj | patients,of |
R2389 | T2549 | T2551 | nmod | [,] |
R2390 | T2705 | T2704 | prep | with,patients |
R2391 | T2706 | T2705 | pobj | asthma,with |
R2392 | T2707 | T2709 | quantmod | [,] |
R2393 | T2550 | T2551 | nummod | 13,] |
R2394 | T2708 | T2709 | nummod | 16,] |
R2395 | T2709 | T2685 | npadvmod | ],are |
R2396 | T2710 | T2685 | punct | .,are |
R2397 | T2711 | T2712 | nsubj | Corticosteroids,mediate |
R2398 | T2551 | T2548 | appos | ],cells |
R2399 | T2712 | T2712 | ROOT | mediate,mediate |
R2400 | T2713 | T2715 | poss | their,effects |
R2401 | T2552 | T2544 | cc | and,demonstrated |
R2402 | T2714 | T2715 | amod | anti-inflammatory,effects |
R2403 | T2747 | T2745 | pobj | genes,of |
R2404 | T2715 | T2712 | dobj | effects,mediate |
R2405 | T2716 | T2712 | prep | through,mediate |
R2406 | T2748 | T2712 | punct | .,mediate |
R2407 | T2717 | T2716 | amod | binding,through |
R2408 | T2749 | T2751 | advmod | Alternatively,activated |
R2409 | T2718 | T2717 | prep | to,binding |
R2410 | T2750 | T2751 | punct | ",",activated |
R2411 | T2719 | T2720 | amod | glucocorticoid,receptors |
R2412 | T2751 | T2751 | ROOT | activated,activated |
R2413 | T2752 | T2753 | compound | GR,interacts |
R2414 | T2720 | T2718 | pobj | receptors,to |
R2415 | T2721 | T2720 | punct | (,receptors |
R2416 | T2722 | T2720 | appos | GRs,receptors |
R2417 | T2753 | T2751 | dobj | interacts,activated |
R2418 | T2723 | T2720 | punct | ),receptors |
R2419 | T2724 | T2720 | punct | ",",receptors |
R2420 | T2725 | T2727 | nsubj | which,translocate |
R2421 | T2754 | T2753 | prep | with,interacts |
R2422 | T2726 | T2727 | advmod | then,translocate |
R2423 | T2727 | T2720 | relcl | translocate,receptors |
R2424 | T2755 | T2756 | compound | coactivator,molecules |
R2425 | T2728 | T2727 | prep | to,translocate |
R2426 | T2729 | T2730 | det | the,nucleus |
R2427 | T2730 | T2728 | pobj | nucleus,to |
R2428 | T2756 | T2754 | pobj | molecules,with |
R2429 | T2731 | T2733 | advmod | where,interact |
R2430 | T2757 | T2758 | aux | to,suppress |
R2431 | T2732 | T2733 | nsubj | they,interact |
R2432 | T2733 | T2730 | relcl | interact,nucleus |
R2433 | T2734 | T2733 | prep | with,interact |
R2434 | T2758 | T2751 | advcl | suppress,activated |
R2435 | T2735 | T2737 | amod | glucocorticoid,elements |
R2436 | T2736 | T2737 | compound | response,elements |
R2437 | T2737 | T2734 | pobj | elements,with |
R2438 | T2759 | T2760 | det | the,expression |
R2439 | T2738 | T2739 | punct | (,GREs |
R2440 | T2760 | T2758 | dobj | expression,suppress |
R2441 | T2739 | T2737 | appos | GREs,elements |
R2442 | T2740 | T2737 | punct | ),elements |
R2443 | T2761 | T2760 | prep | of,expression |
R2444 | T2741 | T2733 | prep | in,interact |
R2445 | T2742 | T2744 | det | the,regions |
R2446 | T2743 | T2744 | compound | promoter,regions |
R2447 | T2762 | T2763 | amod | inflammatory,genes |
R2448 | T2744 | T2741 | pobj | regions,in |
R2449 | T2745 | T2744 | prep | of,regions |
R2450 | T2746 | T2747 | amod | steroid-sensitive,genes |
R2451 | T2763 | T2761 | pobj | genes,of |
R2452 | T2764 | T2758 | prep | by,suppress |
R2453 | T2765 | T2764 | pcomp | inhibiting,by |
R2454 | T2766 | T2767 | det | the,action |
R2455 | T2844 | T2841 | appos | ],pathway |
R2456 | T2767 | T2765 | dobj | action,inhibiting |
R2457 | T2845 | T2820 | punct | .,signals |
R2458 | T2846 | T2856 | nsubj | NL1,binds |
R2459 | T2768 | T2767 | prep | of,action |
R2460 | T2847 | T2846 | punct | ",",NL1 |
R2461 | T2848 | T2849 | nsubj | which,is |
R2462 | T2849 | T2846 | relcl | is,NL1 |
R2463 | T2769 | T2771 | amod | proinflammatory,factors |
R2464 | T2850 | T2849 | acomp | similar,is |
R2465 | T2851 | T2850 | prep | to,similar |
R2466 | T2852 | T2854 | det | the,NLS |
R2467 | T2770 | T2771 | compound | transcription,factors |
R2468 | T2853 | T2854 | compound | SV40,NLS |
R2469 | T2854 | T2851 | pobj | NLS,to |
R2470 | T2855 | T2849 | punct | ",",is |
R2471 | T2771 | T2768 | pobj | factors,of |
R2472 | T2856 | T2856 | ROOT | binds,binds |
R2473 | T2857 | T2858 | aux | to,importin-α |
R2474 | T2858 | T2856 | xcomp | importin-α,binds |
R2475 | T2772 | T2773 | amod | such,as |
R2476 | T2859 | T2858 | dobj | [,importin-α |
R2477 | T2860 | T2861 | nummod | 22,] |
R2478 | T2861 | T2856 | npadvmod | ],binds |
R2479 | T2862 | T2856 | punct | .,binds |
R2480 | T2863 | T2865 | nsubjpass | NL1,activated |
R2481 | T2864 | T2865 | auxpass | is,activated |
R2482 | T2773 | T2771 | prep | as,factors |
R2483 | T2865 | T2865 | ROOT | activated,activated |
R2484 | T2866 | T2867 | advmod | both,by |
R2485 | T2867 | T2865 | agent | by,activated |
R2486 | T2868 | T2869 | amod | glucocorticoid,agonists |
R2487 | T2774 | T2775 | amod | nuclear,factor-κB |
R2488 | T2869 | T2867 | pobj | agonists,by |
R2489 | T2775 | T2773 | pobj | factor-κB,as |
R2490 | T2870 | T2871 | amod | such,as |
R2491 | T2871 | T2869 | prep | as,agonists |
R2492 | T2872 | T2871 | pobj | dexamethasone,as |
R2493 | T2873 | T2872 | cc | and,dexamethasone |
R2494 | T2776 | T2775 | punct | (,factor-κB |
R2495 | T2874 | T2875 | compound | fluticasone,propionate |
R2496 | T2875 | T2872 | conj | propionate,dexamethasone |
R2497 | T2876 | T2877 | punct | (,FP |
R2498 | T2877 | T2875 | appos | FP,propionate |
R2499 | T2777 | T2775 | appos | NF-κB,factor-κB |
R2500 | T2878 | T2877 | punct | ),FP |
R2501 | T2879 | T2867 | cc | and,by |
R2502 | T2880 | T2867 | conj | by,by |
R2503 | T2778 | T2775 | punct | ),factor-κB |
R2504 | T2779 | T2765 | prep | through,inhibiting |
R2505 | T2881 | T2882 | amod | glucocorticoid,antagonists |
R2506 | T2780 | T2781 | det | the,recruitment |
R2507 | T2781 | T2779 | pobj | recruitment,through |
R2508 | T2882 | T2880 | pobj | antagonists,by |
R2509 | T2782 | T2781 | prep | of,recruitment |
R2510 | T2883 | T2884 | amod | such,as |
R2511 | T2783 | T2784 | compound | co-repressor,molecules |
R2512 | T2784 | T2782 | pobj | molecules,of |
R2513 | T2884 | T2882 | prep | as,antagonists |
R2514 | T2885 | T2884 | pobj | mifepristone,as |
R2515 | T2785 | T2786 | amod | such,as |
R2516 | T2886 | T2885 | punct | (,mifepristone |
R2517 | T2887 | T2889 | nmod | RU486,[ |
R2518 | T2888 | T2889 | punct | ),[ |
R2519 | T2786 | T2784 | prep | as,molecules |
R2520 | T2889 | T2865 | npadvmod | [,activated |
R2521 | T2890 | T2891 | nummod | 23,] |
R2522 | T2891 | T2889 | appos | ],[ |
R2523 | T2787 | T2789 | compound | histone,[ |
R2524 | T2892 | T2865 | punct | .,activated |
R2525 | T2893 | T2896 | nsubjpass | NL1,mutated |
R2526 | T2788 | T2789 | compound | deacetylase-2,[ |
R2527 | T2894 | T2896 | aux | can,mutated |
R2528 | T2789 | T2786 | pobj | [,as |
R2529 | T2895 | T2896 | auxpass | be,mutated |
R2530 | T2896 | T2896 | ROOT | mutated,mutated |
R2531 | T2790 | T2791 | nummod | 17,] |
R2532 | T2897 | T2896 | punct | ",",mutated |
R2533 | T2898 | T2896 | cc | and,mutated |
R2534 | T2899 | T2901 | det | the,GR |
R2535 | T2791 | T2789 | conj | ],[ |
R2536 | T2900 | T2901 | amod | resulting,GR |
R2537 | T2901 | T2903 | nsubj | GR,translocates |
R2538 | T2902 | T2903 | advmod | still,translocates |
R2539 | T2792 | T2791 | punct | ",",] |
R2540 | T2903 | T2896 | conj | translocates,mutated |
R2541 | T2904 | T2903 | prep | to,translocates |
R2542 | T2905 | T2906 | det | the,nucleus |
R2543 | T2793 | T2791 | conj | [,] |
R2544 | T2906 | T2904 | pobj | nucleus,to |
R2545 | T2907 | T2903 | prep | in,translocates |
R2546 | T2908 | T2907 | pobj | response,in |
R2547 | T2794 | T2795 | nummod | 18,] |
R2548 | T2909 | T2908 | prep | to,response |
R2549 | T2910 | T2909 | pobj | ligands,to |
R2550 | T2911 | T2903 | punct | ",",translocates |
R2551 | T2795 | T2791 | conj | ],] |
R2552 | T2912 | T2903 | cc | but,translocates |
R2553 | T2913 | T2903 | conj | via,translocates |
R2554 | T2914 | T2913 | pobj | interaction,via |
R2555 | T2796 | T2751 | punct | .,activated |
R2556 | T2915 | T2914 | prep | with,interaction |
R2557 | T2916 | T2915 | pobj | importin,with |
R2558 | T2917 | T2916 | nummod | 7,importin |
R2559 | T2797 | T2798 | compound | Nuclear,localisation |
R2560 | T2918 | T2916 | punct | ",",importin |
R2561 | T2919 | T2920 | det | an,event |
R2562 | T2920 | T2916 | appos | event,importin |
R2563 | T2798 | T2804 | nsubjpass | localisation,mediated |
R2564 | T2921 | T2922 | nsubj | that,requires |
R2565 | T2922 | T2920 | relcl | requires,event |
R2566 | T2923 | T2926 | det | an,component |
R2567 | T2799 | T2798 | cc | and,localisation |
R2568 | T2924 | T2925 | advmod | as-yet,unknown |
R2569 | T2925 | T2926 | amod | unknown,component |
R2570 | T2926 | T2922 | dobj | component,requires |
R2571 | T2800 | T2798 | conj | retention,localisation |
R2572 | T2927 | T2926 | appos | [,component |
R2573 | T2801 | T2800 | prep | of,retention |
R2574 | T2928 | T2929 | nummod | 23,] |
R2575 | T2929 | T2922 | dobj | ],requires |
R2576 | T2802 | T2801 | pobj | GR,of |
R2577 | T2930 | T2903 | punct | .,translocates |
R2578 | T2931 | T2934 | nsubjpass | NL2,defined |
R2579 | T2932 | T2934 | auxpass | is,defined |
R2580 | T2933 | T2934 | advmod | poorly,defined |
R2581 | T2934 | T2934 | ROOT | defined,defined |
R2582 | T2935 | T2934 | punct | ",",defined |
R2583 | T2803 | T2804 | auxpass | is,mediated |
R2584 | T2936 | T2934 | advcl | residing,defined |
R2585 | T2937 | T2936 | prep | in,residing |
R2586 | T2938 | T2940 | det | the,domain |
R2587 | T2804 | T2820 | ccomp | mediated,signals |
R2588 | T2939 | T2940 | amod | ligand-binding,domain |
R2589 | T2940 | T2937 | pobj | domain,in |
R2590 | T2805 | T2804 | prep | through,mediated |
R2591 | T2806 | T2809 | det | the,sequences |
R2592 | T2807 | T2808 | amod | nuclear,localisation |
R2593 | T2941 | T2934 | punct | ",",defined |
R2594 | T2808 | T2809 | compound | localisation,sequences |
R2595 | T2942 | T2934 | cc | and,defined |
R2596 | T2943 | T2944 | advmod | much,less |
R2597 | T2944 | T2946 | advmod | less,known |
R2598 | T2809 | T2805 | pobj | sequences,through |
R2599 | T2945 | T2946 | auxpass | is,known |
R2600 | T2946 | T2934 | conj | known,defined |
R2601 | T2947 | T2946 | prep | about,known |
R2602 | T2810 | T2809 | appos | NL1,sequences |
R2603 | T2948 | T2949 | poss | its,mechanism |
R2604 | T2949 | T2947 | pobj | mechanism,about |
R2605 | T2950 | T2949 | prep | of,mechanism |
R2606 | T2811 | T2810 | cc | and,NL1 |
R2607 | T2951 | T2953 | compound | GR,[ |
R2608 | T2952 | T2953 | compound | import,[ |
R2609 | T2953 | T2950 | pobj | [,of |
R2610 | T2812 | T2813 | compound | NL2,[ |
R2611 | T2954 | T2955 | nummod | 24,] |
R2612 | T2955 | T2949 | appos | ],mechanism |
R2613 | T2956 | T2934 | punct | .,defined |
R2614 | T2813 | T2810 | conj | [,NL1 |
R2615 | T2957 | T2958 | det | A,variety |
R2616 | T2958 | T2962 | nsubj | variety,are |
R2617 | T2959 | T2958 | prep | of,variety |
R2618 | T2814 | T2815 | nummod | 19,] |
R2619 | T2960 | T2961 | amod | other,factors |
R2620 | T2961 | T2959 | pobj | factors,of |
R2621 | T2962 | T2962 | ROOT | are,are |
R2622 | T2815 | T2810 | conj | ],NL1 |
R2623 | T2963 | T2962 | advmod | also,are |
R2624 | T2964 | T2962 | acomp | important,are |
R2625 | T2965 | T2964 | prep | for,important |
R2626 | T2816 | T2804 | punct | ",",mediated |
R2627 | T2966 | T2967 | det | the,regulation |
R2628 | T2967 | T2965 | pobj | regulation,for |
R2629 | T2968 | T2967 | prep | of,regulation |
R2630 | T2969 | T2970 | compound | GR,activation |
R2631 | T2970 | T2968 | pobj | activation,of |
R2632 | T2817 | T2804 | agent | by,mediated |
R2633 | T2971 | T2970 | cc | and,activation |
R2634 | T2818 | T2819 | amod | nuclear,retention |
R2635 | T2972 | T2973 | amod | nuclear,import |
R2636 | T2819 | T2817 | pobj | retention,by |
R2637 | T2973 | T2970 | conj | import,activation |
R2638 | T2974 | T2967 | prep | including,regulation |
R2639 | T2975 | T2974 | pobj | chaperones,including |
R2640 | T2820 | T2820 | ROOT | signals,signals |
R2641 | T2976 | T2977 | amod | such,as |
R2642 | T2821 | T2823 | nmod | [,] |
R2643 | T2822 | T2823 | nummod | 20,] |
R2644 | T2977 | T2975 | prep | as,chaperones |
R2645 | T2823 | T2820 | dobj | ],signals |
R2646 | T2824 | T2820 | punct | ",",signals |
R2647 | T2978 | T2990 | nmod | Hsp90,proteins |
R2648 | T2825 | T2820 | cc | and,signals |
R2649 | T2979 | T2978 | cc | and,Hsp90 |
R2650 | T2826 | T2820 | conj | by,signals |
R2651 | T2827 | T2826 | pobj | control,by |
R2652 | T2980 | T2981 | amod | other,immunophilins |
R2653 | T2828 | T2827 | prep | of,control |
R2654 | T2981 | T2978 | conj | immunophilins,Hsp90 |
R2655 | T2829 | T2830 | amod | nuclear,export |
R2656 | T2982 | T2978 | conj | [,Hsp90 |
R2657 | T2830 | T2828 | pobj | export,of |
R2658 | T2983 | T2984 | nummod | 24,] |
R2659 | T2984 | T2978 | conj | ],Hsp90 |
R2660 | T2831 | T2820 | prep | via,signals |
R2661 | T2985 | T2978 | conj | [,Hsp90 |
R2662 | T2986 | T2987 | nummod | 26,] |
R2663 | T2832 | T2841 | det | a,pathway |
R2664 | T2987 | T2990 | nmod | ],proteins |
R2665 | T2988 | T2987 | cc | and,] |
R2666 | T2989 | T2990 | amod | FK506-binding,proteins |
R2667 | T2833 | T2834 | amod | chromosomal,region |
R2668 | T2990 | T2977 | pobj | proteins,as |
R2669 | T2991 | T2994 | nsubjpass | that,linked |
R2670 | T2992 | T2994 | aux | may,linked |
R2671 | T2834 | T2835 | compound | region,maintenance |
R2672 | T2993 | T2994 | auxpass | be,linked |
R2673 | T2994 | T2990 | relcl | linked,proteins |
R2674 | T2995 | T2996 | aux | to,dynein |
R2675 | T2996 | T2994 | xcomp | dynein,linked |
R2676 | T2835 | T2841 | nmod | maintenance,pathway |
R2677 | T2997 | T2996 | cc | and/or,dynein |
R2678 | T2998 | T2996 | conj | peptidylprolyl,dynein |
R2679 | T2999 | T3000 | compound | isomerase,[ |
R2680 | T3000 | T2998 | dobj | [,peptidylprolyl |
R2681 | T3001 | T3002 | nummod | 27,] |
R2682 | T3002 | T2998 | npadvmod | ],peptidylprolyl |
R2683 | T2836 | T2835 | nummod | 1,maintenance |
R2684 | T3003 | T3002 | punct | ",",] |
R2685 | T3004 | T3002 | appos | [,] |
R2686 | T3005 | T3006 | nummod | 28,] |
R2687 | T2837 | T2835 | punct | (,maintenance |
R2688 | T3006 | T3002 | appos | ],] |
R2689 | T3007 | T2962 | punct | .,are |
R2690 | T3008 | T3021 | advmod | However,is |
R2691 | T2838 | T2835 | appos | CRM-1,maintenance |
R2692 | T3009 | T3021 | punct | ",",is |
R2693 | T3010 | T3012 | det | the,basis |
R2694 | T3011 | T3012 | amod | molecular,basis |
R2695 | T2839 | T2835 | punct | ),maintenance |
R2696 | T3012 | T3021 | nsubj | basis,is |
R2697 | T3013 | T3012 | prep | for,basis |
R2698 | T2840 | T2841 | amod | dependent,pathway |
R2699 | T3014 | T3015 | det | the,inhibition |
R2700 | T3015 | T3013 | pobj | inhibition,for |
R2701 | T2841 | T2831 | pobj | pathway,via |
R2702 | T2842 | T2844 | nmod | [,] |
R2704 | T2843 | T2844 | nummod | 21,] |
R2780 | T3167 | T3166 | cc | and,anti-CD3 |
R2781 | T3168 | T3166 | conj | anti-CD28,anti-CD3 |
R2782 | T3169 | T3165 | pobj | antibodies,by |
R2784 | T3170 | T3164 | prep | in,activated |
R2785 | T3171 | T3170 | pobj | vitro,in |
R2786 | T3172 | T3133 | punct | .,investigated |
R2788 | T3173 | T3175 | nsubj | We,studied |
R2789 | T3174 | T3175 | advmod | also,studied |
R2790 | T3175 | T3175 | ROOT | studied,studied |
R2793 | T3176 | T3177 | det | the,effects |
R2795 | T3177 | T3175 | dobj | effects,studied |
R2796 | T3178 | T3177 | prep | of,effects |
R2798 | T3179 | T3181 | amod | inhaled,therapy |
R2799 | T3180 | T3181 | compound | fluticasone,therapy |
R2800 | T3181 | T3178 | pobj | therapy,of |
R2802 | T3182 | T3181 | prep | on,therapy |
R2803 | T3183 | T3185 | amod | GATA-3,localization |
R2804 | T3184 | T3185 | amod | subcellular,localization |
R2806 | T3185 | T3182 | pobj | localization,on |
R2807 | T3186 | T3185 | prep | in,localization |
R2808 | T3187 | T3190 | amod | peripheral,cells |
R2810 | T3188 | T3189 | compound | blood,mononuclear |
R2811 | T3189 | T3190 | compound | mononuclear,cells |
R2812 | T3190 | T3186 | pobj | cells,in |
R2814 | T3191 | T3192 | punct | (,PBMCs |
R2815 | T3192 | T3190 | appos | PBMCs,cells |
R2816 | T3193 | T3192 | punct | ),PBMCs |
R2818 | T3194 | T3192 | prep | from,PBMCs |
R2819 | T3195 | T3194 | pobj | patients,from |
R2820 | T3196 | T3192 | prep | with,PBMCs |
R2822 | T3197 | T3196 | pobj | asthma,with |
R2823 | T3198 | T3175 | punct | .,studied |
R2835 | T3083 | T3085 | nummod | -13,activity |
R2836 | T3084 | T3085 | compound | promoter,activity |
R2837 | T3085 | T3079 | conj | activity,reduced |
R2838 | T3086 | T3085 | prep | in,activity |
R2839 | T3087 | T3091 | amod | human,cells |
R2840 | T3088 | T3091 | compound | CD4,cells |
R2841 | T3089 | T3091 | nummod | +,cells |
R2842 | T3090 | T3091 | compound | T,cells |
R2843 | T3091 | T3086 | pobj | cells,in |
R2844 | T3092 | T3076 | punct | .,shown |
R2845 | T3093 | T3094 | det | The,authors |
R2846 | T3094 | T3095 | nsubj | authors,postulated |
R2847 | T3095 | T3095 | ROOT | postulated,postulated |
R2848 | T3096 | T3102 | mark | that,alter |
R2881 | T3129 | T3128 | pobj | transcription,for |
R2882 | T3130 | T3095 | punct | .,postulated |
R2883 | T3131 | T3133 | nsubj | We,investigated |
R2884 | T3132 | T3133 | advmod | therefore,investigated |
R2885 | T3133 | T3133 | ROOT | investigated,investigated |
R2886 | T3134 | T3135 | det | the,effects |
R3292 | T3810 | T3815 | npadvmod | Participants,studied |
R3293 | T3811 | T3810 | cc | and,Participants |
R3294 | T3812 | T3813 | compound | Study,Design |
R3295 | T3813 | T3810 | conj | Design,Participants |
R3296 | T3814 | T3815 | nsubj | We,studied |
R3297 | T3815 | T3815 | ROOT | studied,studied |
R3298 | T3816 | T3815 | dobj | patients,studied |
R3299 | T3817 | T3816 | prep | with,patients |
R3300 | T3818 | T3819 | amod | mild,asthma |
R3301 | T3819 | T3817 | pobj | asthma,with |
R3302 | T3820 | T3823 | nsubjpass | who,treated |
R3303 | T3821 | T3823 | auxpass | were,treated |
R3304 | T3822 | T3823 | neg | not,treated |
R3305 | T3823 | T3816 | relcl | treated,patients |
R3306 | T3824 | T3823 | prep | with,treated |
R3307 | T3825 | T3826 | amod | inhaled,corticosteroids |
R3308 | T3826 | T3824 | pobj | corticosteroids,with |
R3309 | T3827 | T3830 | nsubjpass | who,included |
R3310 | T3828 | T3830 | aux | had,included |
R3311 | T3829 | T3830 | auxpass | been,included |
R3312 | T3830 | T3826 | relcl | included,corticosteroids |
R3313 | T3831 | T3830 | prep | in,included |
R3314 | T3832 | T3840 | det | a,study |
R3315 | T3833 | T3834 | advmod | previously,reported |
R3316 | T3834 | T3835 | amod | reported,double-blind |
R3317 | T3835 | T3840 | amod | double-blind,study |
R3318 | T3836 | T3840 | punct | ",",study |
R3319 | T3837 | T3840 | amod | placebo-controlled,study |
R3320 | T3838 | T3840 | punct | ",",study |
R3321 | T3839 | T3840 | amod | crossover,study |
R3322 | T3840 | T3831 | pobj | study,in |
R3323 | T3841 | T3840 | prep | with,study |
R3324 | T3842 | T3843 | compound | FP,[ |
R3325 | T3843 | T3841 | pobj | [,with |
R3326 | T3844 | T3845 | nummod | 34,] |
R3327 | T3845 | T3843 | appos | ],[ |
R3328 | T3846 | T3815 | punct | .,studied |
R3329 | T3847 | T3848 | nummod | Seven,patients |
R3330 | T3848 | T3852 | nsubj | patients,entered |
R3331 | T3849 | T3848 | prep | with,patients |
R3332 | T3850 | T3851 | amod | mild,asthma |
R3333 | T3851 | T3849 | pobj | asthma,with |
R3334 | T3852 | T3852 | ROOT | entered,entered |
R3335 | T3853 | T3854 | det | the,study |
R3336 | T3854 | T3852 | dobj | study,entered |
R3337 | T3855 | T3852 | cc | and,entered |
R3338 | T3856 | T3857 | auxpass | were,randomized |
R3339 | T3857 | T3852 | conj | randomized,entered |
R3340 | T3858 | T3859 | aux | to,receive |
R3341 | T3859 | T3857 | xcomp | receive,randomized |
R3342 | T3860 | T3862 | det | a,inhalation |
R3343 | T3861 | T3862 | amod | single,inhalation |
R3344 | T3862 | T3859 | dobj | inhalation,receive |
R3345 | T3863 | T3862 | prep | of,inhalation |
R3346 | T3864 | T3863 | pobj | FP,of |
R3347 | T3865 | T3864 | punct | (,FP |
R3348 | T3866 | T3864 | nummod | 100,FP |
R3349 | T3867 | T3864 | cc | and,FP |
R3350 | T3868 | T3869 | nummod | 500,µg |
R3351 | T3869 | T3864 | conj | µg,FP |
R3352 | T3870 | T3869 | punct | ),µg |
R3353 | T3871 | T3869 | cc | or,µg |
R3354 | T3872 | T3875 | det | a,control |
R3355 | T3873 | T3875 | amod | matched,control |
R3356 | T3874 | T3875 | compound | placebo,control |
R3357 | T3875 | T3869 | conj | control,µg |
R3358 | T3876 | T3859 | prep | via,receive |
R3359 | T3877 | T3879 | det | a,chamber |
R3360 | T3878 | T3879 | compound | spacer,chamber |
R3361 | T3879 | T3876 | pobj | chamber,via |
R3362 | T3880 | T3857 | punct | ",",randomized |
R3363 | T3881 | T3857 | cc | and,randomized |
R3364 | T3882 | T3884 | det | the,treatment |
R3365 | T3883 | T3884 | amod | other,treatment |
R3366 | T3884 | T3886 | nsubjpass | treatment,given |
R3367 | T3885 | T3886 | auxpass | was,given |
R3368 | T3886 | T3857 | conj | given,randomized |
R3369 | T3887 | T3898 | mark | after,taken |
R3370 | T3888 | T3890 | det | a,period |
R3371 | T3889 | T3890 | amod | wash-out,period |
R3372 | T3890 | T3898 | nsubjpass | period,taken |
R3373 | T3891 | T3890 | prep | of,period |
R3374 | T3892 | T3893 | advmod | at,least |
R3375 | T3893 | T3894 | advmod | least,6 |
R3376 | T3894 | T3895 | nummod | 6,d. |
R3377 | T3895 | T3896 | compound | d.,Blood |
R3378 | T3896 | T3891 | pobj | Blood,of |
R3389 | T3907 | T3898 | conj | h,taken |
R3390 | T3908 | T3907 | prep | after,h |
R3391 | T3909 | T3910 | compound | drug,administration |
R3392 | T3910 | T3908 | pobj | administration,after |
R3393 | T3911 | T3852 | punct | .,entered |
R3394 | T3912 | T3913 | det | All,patients |
R3395 | T3913 | T3914 | nsubj | patients,gave |
R3396 | T3914 | T3914 | ROOT | gave,gave |
R3397 | T3915 | T3916 | amod | informed,consent |
R3398 | T3916 | T3914 | dobj | consent,gave |
R3399 | T3917 | T3916 | cc | and,consent |
R3400 | T3918 | T3919 | det | the,study |
R3401 | T3919 | T3921 | nsubjpass | study,approved |
R3402 | T3920 | T3921 | auxpass | was,approved |
R3403 | T3921 | T3914 | conj | approved,gave |
R3404 | T3922 | T3921 | agent | by,approved |
R3405 | T3923 | T3925 | det | the,Committee |
R3406 | T3924 | T3925 | compound | Ethics,Committee |
R3407 | T3925 | T3922 | pobj | Committee,by |
R3408 | T3926 | T3925 | prep | of,Committee |
R3409 | T3927 | T3929 | det | the,Brompton |
R3410 | T3928 | T3929 | compound | Royal,Brompton |
R3411 | T3929 | T3926 | pobj | Brompton,of |
R3412 | T3930 | T3929 | cc | and,Brompton |
R3413 | T3931 | T3934 | compound | Harefield,Trust |
R3414 | T3932 | T3934 | compound | Hospitals,Trust |
R3415 | T3933 | T3934 | compound | NHS,Trust |
R3416 | T3934 | T3929 | conj | Trust,Brompton |
R3417 | T3935 | T3921 | punct | .,approved |
R3418 | T3936 | T3938 | det | The,study |
R3419 | T3937 | T3938 | amod | clinical,study |
R3420 | T3938 | T3940 | nsubjpass | study,conducted |
R3421 | T3939 | T3940 | auxpass | was,conducted |
R3422 | T3940 | T3940 | ROOT | conducted,conducted |
R3423 | T3941 | T3940 | prep | before,conducted |
R3424 | T3942 | T3943 | det | the,requirement |
R3425 | T3943 | T3941 | pobj | requirement,before |
R3426 | T3944 | T3943 | prep | for,requirement |
R3427 | T3945 | T3947 | compound | Clinical,Registration |
R3428 | T3946 | T3947 | compound | Trial,Registration |
R3429 | T3947 | T3944 | pobj | Registration,for |
R3430 | T3948 | T3940 | punct | .,conducted |
R3577 | T4142 | T4142 | ROOT | Antibodies,Antibodies |
R3578 | T4143 | T4142 | cc | and,Antibodies |
R3579 | T4144 | T4142 | conj | Reagents,Antibodies |
R3580 | T4145 | T4147 | det | The,antibodies |
R3581 | T4146 | T4147 | amod | monoclonal,antibodies |
R3582 | T4147 | T4159 | nsubjpass | antibodies,purchased |
R3583 | T4148 | T4147 | prep | against,antibodies |
R3584 | T4149 | T4150 | compound | human,CD3 |
R3585 | T4150 | T4148 | pobj | CD3,against |
R3586 | T4151 | T4150 | punct | ",",CD3 |
R3587 | T4152 | T4150 | conj | CD28,CD3 |
R3588 | T4153 | T4152 | punct | ",",CD28 |
R3589 | T4154 | T4152 | conj | GR,CD28 |
R3590 | T4155 | T4154 | punct | ",",GR |
R3591 | T4156 | T4154 | cc | and,GR |
R3592 | T4157 | T4154 | conj | importin-α,GR |
R3593 | T4158 | T4159 | auxpass | were,purchased |
R3594 | T4159 | T4159 | ROOT | purchased,purchased |
R3595 | T4160 | T4159 | prep | from,purchased |
R3596 | T4161 | T4162 | compound | BD,Biosciences |
R3597 | T4162 | T4160 | pobj | Biosciences,from |
R3598 | T4163 | T4162 | punct | (,Biosciences |
R3599 | T4164 | T4162 | npadvmod | Oxford,Biosciences |
R3600 | T4165 | T4164 | punct | ",",Oxford |
R3601 | T4166 | T4167 | compound | United,Kingdom |
R3602 | T4167 | T4164 | appos | Kingdom,Oxford |
R3604 | T4169 | T4159 | punct | .,purchased |
R3605 | T4170 | T4171 | compound | Rabbit,antibodies |
R3606 | T4171 | T4186 | nsubjpass | antibodies,obtained |
R3607 | T4172 | T4171 | prep | against,antibodies |
R3608 | T4173 | T4174 | compound | human,GATA-3 |
R3609 | T4174 | T4172 | pobj | GATA-3,against |
R3610 | T4175 | T4174 | punct | (,GATA-3 |
R3611 | T4176 | T4174 | appos | H-48,GATA-3 |
R3702 | T4267 | T4264 | pobj | Laboratories,from |
R3703 | T4268 | T4267 | punct | (,Laboratories |
R3704 | T4269 | T4267 | npadvmod | Oxford,Laboratories |
R3705 | T4270 | T4269 | punct | ",",Oxford |
R3706 | T4271 | T4269 | appos | UK,Oxford |
R3707 | T4272 | T4269 | punct | ),Oxford |
R3708 | T4273 | T4274 | auxpass | was,used |
R3709 | T4274 | T4274 | ROOT | used,used |
R3710 | T4275 | T4274 | prep | for,used |
R3711 | T4276 | T4278 | amod | Western,analysis |
R3712 | T4277 | T4278 | compound | blot,analysis |
R3713 | T4278 | T4275 | pobj | analysis,for |
R3714 | T4279 | T4274 | punct | .,used |
R3715 | T4280 | T4282 | det | All,reagents |
R3716 | T4281 | T4282 | amod | other,reagents |
R3727 | T4292 | T4284 | punct | .,purchased |
R3841 | T4470 | T4471 | compound | Cell,Culture |
R3842 | T4471 | T4474 | nsubj | Culture,Isolation |
R3843 | T4472 | T4471 | cc | and,Culture |
R3844 | T4473 | T4471 | conj | PBMC,Culture |
R3845 | T4474 | T4498 | nsubjpass | Isolation,cultured |
R3846 | T4475 | T4479 | det | A,line |
R3847 | T4476 | T4478 | amod | human,cell |
R3848 | T4477 | T4478 | compound | T,cell |
R3849 | T4478 | T4479 | compound | cell,line |
R3850 | T4479 | T4474 | dobj | line,Isolation |
R3851 | T4480 | T4484 | punct | (,purchased |
R3852 | T4481 | T4484 | nsubjpass | HuT-78,purchased |
R3853 | T4482 | T4481 | punct | ),HuT-78 |
R3854 | T4483 | T4484 | auxpass | was,purchased |
R3855 | T4484 | T4474 | relcl | purchased,Isolation |
R3856 | T4485 | T4484 | prep | from,purchased |
R3857 | T4486 | T4488 | compound | ECACC,Collection |
R3858 | T4487 | T4488 | compound | European,Collection |
R3859 | T4488 | T4485 | pobj | Collection,from |
R3860 | T4489 | T4488 | prep | of,Collection |
R3861 | T4490 | T4491 | compound | Cell,Culture |
R3862 | T4491 | T4489 | pobj | Culture,of |
R3863 | T4492 | T4488 | punct | (,Collection |
R3864 | T4493 | T4488 | appos | Wiltshire,Collection |
R3865 | T4494 | T4493 | punct | ",",Wiltshire |
R3866 | T4495 | T4493 | appos | UK,Wiltshire |
R3867 | T4496 | T4493 | punct | ),Wiltshire |
R3868 | T4497 | T4498 | auxpass | were,cultured |
R3869 | T4498 | T4498 | ROOT | cultured,cultured |
R3870 | T4499 | T4501 | mark | as,described |
R3871 | T4500 | T4501 | advmod | previously,described |
R3872 | T4501 | T4498 | advcl | described,cultured |
R3873 | T4502 | T4504 | nmod | [,] |
R3874 | T4503 | T4504 | nummod | 12,] |
R3875 | T4504 | T4501 | dobj | ],described |
R3876 | T4505 | T4498 | punct | .,cultured |
R3877 | T4506 | T4508 | nsubjpass | PBMCs,isolated |
R3878 | T4507 | T4508 | auxpass | were,isolated |
R3879 | T4508 | T4529 | ccomp | isolated,described |
R3880 | T4509 | T4508 | agent | by,isolated |
R3881 | T4510 | T4511 | compound | density,centrifugation |
R3882 | T4511 | T4509 | pobj | centrifugation,by |
R3883 | T4512 | T4511 | prep | over,centrifugation |
R3884 | T4513 | T4512 | pobj | Ficoll-Hypaque,over |
R3885 | T4514 | T4515 | punct | (,density |
R3886 | T4515 | T4513 | appos | density,Ficoll-Hypaque |
R3887 | T4516 | T4515 | punct | ",",density |
R3888 | T4517 | T4518 | nummod | 1.077,g/ml |
R3889 | T4518 | T4515 | appos | g/ml,density |
R3890 | T4519 | T4529 | punct | ;,described |
R3891 | T4520 | T4521 | compound | Amersham,Biosciences |
R3892 | T4521 | T4529 | nsubj | Biosciences,described |
R3893 | T4522 | T4521 | punct | ",",Biosciences |
R3894 | T4523 | T4521 | conj | Amersham,Biosciences |
R3895 | T4524 | T4523 | punct | ",",Amersham |
R3896 | T4525 | T4523 | conj | UK,Amersham |
R3897 | T4526 | T4521 | punct | ),Biosciences |
R3898 | T4527 | T4529 | mark | as,described |
R3899 | T4528 | T4529 | advmod | previously,described |
R3900 | T4529 | T4529 | ROOT | described,described |
R3901 | T4530 | T4532 | nmod | [,] |
R3902 | T4531 | T4532 | nummod | 34,] |
R3903 | T4532 | T4529 | dobj | ],described |
R3904 | T4533 | T4529 | punct | .,described |
R3905 | T4534 | T4536 | nsubjpass | Cells,stimulated |
R3906 | T4535 | T4536 | auxpass | were,stimulated |
R3907 | T4536 | T4536 | ROOT | stimulated,stimulated |
R3908 | T4537 | T4536 | prep | with,stimulated |
R3909 | T4538 | T4540 | amod | anti-CD3,CD28 |
R3910 | T4539 | T4540 | compound | /,CD28 |
R3911 | T4540 | T4537 | pobj | CD28,with |
R3912 | T4541 | T4540 | punct | (,CD28 |
R3913 | T4542 | T4543 | nummod | 1,µg |
R3914 | T4543 | T4545 | nmod | µg,ml |
R3915 | T4544 | T4545 | compound | /,ml |
R3916 | T4545 | T4540 | appos | ml,CD28 |
R3917 | T4546 | T4545 | npadvmod | each,ml |
R3918 | T4547 | T4540 | punct | ),CD28 |
R3919 | T4548 | T4536 | prep | for,stimulated |
R3920 | T4549 | T4550 | nummod | 1,h |
R3921 | T4550 | T4548 | pobj | h,for |
R3922 | T4551 | T4550 | prep | at,h |
R3923 | T4552 | T4553 | nummod | 37,° |
R3924 | T4553 | T4551 | pobj | °,at |
R3925 | T4554 | T4550 | npadvmod | C,h |
R3926 | T4555 | T4556 | aux | to,stimulate |
R3927 | T4556 | T4536 | advcl | stimulate,stimulated |
R3928 | T4557 | T4559 | amod | Th2,release |
R3929 | T4558 | T4559 | compound | cytokine,release |
R3930 | T4559 | T4556 | dobj | release,stimulate |
R3931 | T4560 | T4559 | prep | in,release |
R3932 | T4561 | T4562 | det | the,presence |
R3933 | T4562 | T4560 | pobj | presence,in |
R3934 | T4563 | T4562 | cc | or,presence |
R3935 | T4564 | T4562 | conj | absence,presence |
R3936 | T4565 | T4562 | prep | of,presence |
R3937 | T4566 | T4565 | pobj | FP,of |
R3938 | T4567 | T4569 | punct | (,− |
R3939 | T4568 | T4569 | nummod | 10,− |
R3940 | T4569 | T4566 | appos | −,FP |
R3941 | T4570 | T4572 | quantmod | 12,10 |
R3942 | T4571 | T4572 | quantmod | to,10 |
R3943 | T4572 | T4574 | nummod | 10,8M |
R3944 | T4573 | T4574 | nummod | −,8M |
R3945 | T4574 | T4569 | npadvmod | 8M,− |
R3946 | T4575 | T4569 | punct | ),− |
R3947 | T4576 | T4536 | punct | .,stimulated |
R3948 | T4577 | T4579 | nsubjpass | Cytospins,prepared |
R3949 | T4578 | T4579 | auxpass | were,prepared |
R3950 | T4579 | T4582 | amod | prepared,localization |
R3951 | T4580 | T4579 | cc | and,prepared |
R3952 | T4581 | T4579 | conj | GATA-3,prepared |
R3953 | T4582 | T4582 | ROOT | localization,localization |
R3954 | T4583 | T4582 | acl | determined,localization |
R3955 | T4584 | T4583 | agent | by,determined |
R3956 | T4585 | T4586 | amod | confocal,microscopy |
R3957 | T4586 | T4584 | pobj | microscopy,by |
R3958 | T4587 | T4589 | mark | as,described |
R3959 | T4588 | T4589 | advmod | previously,described |
R3960 | T4589 | T4582 | advcl | described,localization |
R3961 | T4590 | T4592 | nmod | [,] |
R3962 | T4591 | T4592 | nummod | 12,] |
R3963 | T4592 | T4589 | dobj | ],described |
R3964 | T4593 | T4582 | punct | .,localization |
R4061 | T4717 | T4721 | amod | Reverse,RNA |
R4062 | T4718 | T4721 | compound | Transcription,RNA |
R4063 | T4719 | T4721 | compound | PCR,RNA |
R4064 | T4720 | T4721 | compound | Total,RNA |
R4065 | T4721 | T4723 | nsubjpass | RNA,extracted |
R4066 | T4722 | T4723 | auxpass | was,extracted |
R4067 | T4723 | T4723 | ROOT | extracted,extracted |
R4068 | T4724 | T4723 | advcl | using,extracted |
R4069 | T4725 | T4726 | compound | lysis,buffer |
R4070 | T4726 | T4724 | dobj | buffer,using |
R4071 | T4727 | T4726 | punct | (,buffer |
R4072 | T4728 | T4729 | compound | RNeasy,kit |
R4073 | T4729 | T4726 | appos | kit,buffer |
R4074 | T4730 | T4726 | punct | ;,buffer |
R4075 | T4731 | T4726 | conj | Qiagen,buffer |
R4076 | T4732 | T4731 | punct | ",",Qiagen |
R4077 | T4733 | T4731 | conj | Crawley,Qiagen |
R4078 | T4734 | T4733 | punct | ",",Crawley |
R4079 | T4735 | T4733 | conj | UK,Crawley |
R4080 | T4736 | T4731 | punct | ),Qiagen |
R4081 | T4737 | T4723 | punct | .,extracted |
R4082 | T4738 | T4745 | prep | During,digested |
R4083 | T4739 | T4740 | compound | RNA,purification |
R4084 | T4740 | T4738 | pobj | purification,During |
R4085 | T4741 | T4745 | punct | ",",digested |
R4086 | T4742 | T4743 | amod | genomic,DNA |
R4087 | T4743 | T4745 | nsubjpass | DNA,digested |
R4088 | T4744 | T4745 | auxpass | was,digested |
R4089 | T4745 | T4745 | ROOT | digested,digested |
R4090 | T4746 | T4745 | prep | with,digested |
R4091 | T4747 | T4748 | compound | RNase-free,DNase |
R4092 | T4748 | T4746 | pobj | DNase,with |
R4093 | T4749 | T4751 | punct | (,Biosciences |
R4094 | T4750 | T4751 | compound | Amersham,Biosciences |
R4095 | T4751 | T4748 | appos | Biosciences,DNase |
R4096 | T4752 | T4751 | punct | ),Biosciences |
R4097 | T4753 | T4745 | punct | .,digested |
R4098 | T4754 | T4757 | advmod | Next,µg |
R4099 | T4755 | T4757 | punct | ",",µg |
R4100 | T4756 | T4757 | nummod | 0.5,µg |
R4101 | T4757 | T4763 | nsubjpass | µg,transcribed |
R4102 | T4758 | T4757 | prep | of,µg |
R4103 | T4759 | T4760 | amod | total,RNA |
R4104 | T4760 | T4758 | pobj | RNA,of |
R4105 | T4761 | T4763 | auxpass | was,transcribed |
R4106 | T4762 | T4763 | advmod | reversed,transcribed |
R4107 | T4763 | T4763 | ROOT | transcribed,transcribed |
R4108 | T4764 | T4763 | advcl | using,transcribed |
R4109 | T4765 | T4768 | det | the,virus |
R4110 | T4766 | T4767 | amod | avian,myeloblastosis |
R4111 | T4767 | T4768 | compound | myeloblastosis,virus |
R4134 | T4790 | T4793 | nsubj | Primers,were |
R4135 | T4791 | T4790 | prep | for,Primers |
R4136 | T4792 | T4791 | pobj | IL-4,for |
R4137 | T4793 | T4793 | ROOT | were,were |
R4138 | T4794 | T4793 | prep | from,were |
R4139 | T4795 | T4794 | pobj | Sigma-Genosys,from |
R4140 | T4796 | T4795 | punct | (,Sigma-Genosys |
R4141 | T4797 | T4795 | appos | Cambridge,Sigma-Genosys |
R4142 | T4798 | T4797 | punct | ",",Cambridge |
R4143 | T4799 | T4797 | appos | UK,Cambridge |
R4144 | T4800 | T4797 | punct | ),Cambridge |
R4145 | T4801 | T4793 | punct | .,were |
R4146 | T4802 | T4806 | nsubj | Sequences,are |
R4147 | T4803 | T4802 | prep | of,Sequences |
R4148 | T4804 | T4803 | pobj | GADPH,of |
R4149 | T4805 | T4802 | acl | used,Sequences |
R4150 | T4806 | T4806 | ROOT | are,are |
R4151 | T4807 | T4808 | mark | as,follows |
R4152 | T4808 | T4806 | advcl | follows,are |
R4153 | T4809 | T4806 | punct | :,are |
R4154 | T4810 | T4816 | advmod | forward,reverse |
R4155 | T4811 | T4814 | nummod | 5,CCACCCATGGCAAATTCCATGGC |
R4156 | T4812 | T4814 | punct | ′,CCACCCATGGCAAATTCCATGGC |
R4157 | T4813 | T4814 | punct | -,CCACCCATGGCAAATTCCATGGC |
R4158 | T4814 | T4816 | npadvmod | CCACCCATGGCAAATTCCATGGC,reverse |
R4159 | T4815 | T4816 | punct | ",",reverse |
R4160 | T4816 | T4820 | dep | reverse,TCTAGACGGCAGGTCAGGTCCAC |
R4161 | T4817 | T4816 | dobj | 3,reverse |
R4162 | T4818 | T4820 | punct | ′,TCTAGACGGCAGGTCAGGTCCAC |
R4163 | T4819 | T4820 | punct | -,TCTAGACGGCAGGTCAGGTCCAC |
R4164 | T4820 | T4820 | ROOT | TCTAGACGGCAGGTCAGGTCCAC,TCTAGACGGCAGGTCAGGTCCAC |
R4165 | T4821 | T4820 | punct | .,TCTAGACGGCAGGTCAGGTCCAC |
R4322 | T5013 | T5014 | compound | Cell,Fractionation |
R4323 | T5014 | T5027 | nsubjpass | Fractionation,prepared |
R4324 | T5015 | T5014 | punct | ",",Fractionation |
R4325 | T5016 | T5014 | conj | Immunoprecipitation,Fractionation |
R4326 | T5017 | T5016 | punct | ",",Immunoprecipitation |
R4327 | T5018 | T5016 | cc | and,Immunoprecipitation |
R4328 | T5019 | T5022 | amod | Western,Nuclear |
R4329 | T5020 | T5022 | compound | Blot,Nuclear |
R4330 | T5021 | T5022 | compound | Analysis,Nuclear |
R4331 | T5022 | T5016 | conj | Nuclear,Immunoprecipitation |
R4332 | T5023 | T5022 | cc | and,Nuclear |
R4333 | T5024 | T5022 | conj | cytoplasmic,Nuclear |
R4334 | T5025 | T5014 | appos | fractions,Fractionation |
R4335 | T5026 | T5027 | auxpass | were,prepared |
R4336 | T5027 | T5027 | ROOT | prepared,prepared |
R4337 | T5028 | T5030 | mark | as,described |
R4338 | T5029 | T5030 | advmod | previously,described |
R4339 | T5030 | T5027 | advcl | described,prepared |
R4340 | T5031 | T5033 | nmod | [,] |
R4341 | T5032 | T5033 | nummod | 35,] |
R4342 | T5033 | T5030 | dobj | ],described |
R4343 | T5034 | T5027 | punct | .,prepared |
R4344 | T5035 | T5037 | amod | Whole,lysates |
R4345 | T5036 | T5037 | compound | cell,lysates |
R4346 | T5037 | T5039 | nsubjpass | lysates,prepared |
R4347 | T5038 | T5039 | auxpass | were,prepared |
R4348 | T5039 | T5039 | ROOT | prepared,prepared |
R4349 | T5040 | T5039 | prep | in,prepared |
R4350 | T5041 | T5043 | compound | NP-40,buffer |
R4351 | T5042 | T5043 | compound | lysis,buffer |
R4352 | T5043 | T5040 | pobj | buffer,in |
R4353 | T5044 | T5048 | punct | (,P-40 |
R4354 | T5045 | T5046 | nummod | 0.5,% |
R4355 | T5046 | T5048 | compound | %,P-40 |
R4356 | T5047 | T5048 | compound | Nonidet,P-40 |
R4357 | T5048 | T5043 | appos | P-40,buffer |
R4358 | T5049 | T5048 | punct | ",",P-40 |
R4359 | T5050 | T5054 | nummod | 20,pH |
R4360 | T5051 | T5054 | compound | mM,pH |
R4361 | T5052 | T5054 | compound | Tris-HCl,pH |
R4415 | T5106 | T5104 | conj | importin-α,GATA-3 |
R4438 | T5129 | T5128 | punct | ",",Placid |
R4439 | T5130 | T5131 | compound | New,York |
R4440 | T5131 | T5128 | conj | York,Placid |
R4441 | T5132 | T5131 | punct | ",",York |
R4442 | T5133 | T5131 | conj | USA,York |
R4443 | T5134 | T5125 | punct | ),Biotechnology |
R4444 | T5135 | T5096 | punct | .,immunoprecipitated |
R4445 | T5136 | T5138 | amod | Western,analysis |
R4446 | T5137 | T5138 | compound | blot,analysis |
R4447 | T5138 | T5140 | nsubjpass | analysis,performed |
R4448 | T5139 | T5140 | auxpass | was,performed |
R4449 | T5140 | T5140 | ROOT | performed,performed |
R4450 | T5141 | T5140 | advcl | using,performed |
R4451 | T5142 | T5141 | dobj | anti-GATA-3,using |
R4452 | T5143 | T5142 | punct | ",",anti-GATA-3 |
R4453 | T5144 | T5142 | conj | anti-importin-α,anti-GATA-3 |
R4454 | T5145 | T5144 | punct | ",",anti-importin-α |
R4455 | T5146 | T5144 | conj | anti-GR,anti-importin-α |
R4456 | T5147 | T5146 | punct | ",",anti-GR |
R4457 | T5148 | T5150 | amod | anti-p-p38,kinase |
R4458 | T5149 | T5150 | compound | MAP,kinase |
R4459 | T5150 | T5146 | conj | kinase,anti-GR |
R4460 | T5151 | T5150 | punct | ",",kinase |
R4461 | T5152 | T5150 | conj | anti-p-ATF-2,kinase |
R4462 | T5153 | T5152 | punct | ",",anti-p-ATF-2 |
R4463 | T5154 | T5152 | cc | and,anti-p-ATF-2 |
R4464 | T5155 | T5152 | conj | anti-p-serine,anti-p-ATF-2 |
R4465 | T5156 | T5140 | punct | .,performed |
R4466 | T5157 | T5158 | amod | Immunoreactive,proteins |
R4467 | T5158 | T5160 | nsubjpass | proteins,detected |
R4468 | T5159 | T5160 | auxpass | were,detected |
R4469 | T5160 | T5160 | ROOT | detected,detected |
R4470 | T5161 | T5160 | advcl | using,detected |
R4471 | T5162 | T5166 | det | an,kit |
R4472 | T5163 | T5166 | amod | enhanced,kit |
R4473 | T5164 | T5165 | compound | chemiluminescence,ECL |
R4474 | T5165 | T5166 | compound | ECL,kit |
R4475 | T5166 | T5161 | dobj | kit,using |
R4476 | T5167 | T5166 | punct | (,kit |
R4477 | T5168 | T5169 | compound | Amersham,Biosciences |
R4478 | T5169 | T5166 | appos | Biosciences,kit |
R4479 | T5170 | T5166 | punct | ),kit |
R4480 | T5171 | T5160 | punct | .,detected |
R4593 | T5318 | T5321 | compound | Chromatin,immunoprecipitation |
R4594 | T5319 | T5321 | compound | Immunoprecipitation,immunoprecipitation |
R4595 | T5320 | T5321 | compound | Chromatin,immunoprecipitation |
R4596 | T5321 | T5326 | nsubjpass | immunoprecipitation,performed |
R4597 | T5322 | T5323 | punct | (,IP |
R4598 | T5323 | T5321 | appos | IP,immunoprecipitation |
R4599 | T5324 | T5321 | punct | ),immunoprecipitation |
R4600 | T5325 | T5326 | auxpass | was,performed |
R4601 | T5326 | T5326 | ROOT | performed,performed |
R4602 | T5327 | T5329 | mark | as,described |
R4603 | T5328 | T5329 | advmod | previously,described |
R4604 | T5329 | T5326 | advcl | described,performed |
R4605 | T5330 | T5332 | nmod | [,] |
R4606 | T5331 | T5332 | nummod | 12,] |
R4607 | T5332 | T5329 | dobj | ],described |
R4608 | T5333 | T5329 | prep | in,described |
R4609 | T5334 | T5335 | compound | HuT-78,T-cells |
R4610 | T5335 | T5333 | pobj | T-cells,in |
R4611 | T5336 | T5335 | prep | with,T-cells |
R4612 | T5337 | T5338 | nummod | 2,µg |
R4613 | T5338 | T5336 | pobj | µg,with |
R4614 | T5339 | T5338 | prep | of,µg |
R4615 | T5340 | T5339 | pobj | anti-GATA-3,of |
R4616 | T5341 | T5344 | punct | (,Biotechnology |
R4617 | T5342 | T5344 | compound | Santa,Biotechnology |
R4618 | T5343 | T5344 | compound | Cruz,Biotechnology |
R4619 | T5344 | T5340 | appos | Biotechnology,anti-GATA-3 |
R4620 | T5345 | T5344 | punct | ),Biotechnology |
R4621 | T5346 | T5344 | punct | ",",Biotechnology |
R4622 | T5347 | T5344 | cc | or,Biotechnology |
R4623 | T5348 | T5350 | amod | isotypic,G |
R4624 | T5349 | T5350 | compound | immunoglobulin,G |
R4625 | T5350 | T5344 | conj | G,Biotechnology |
R4626 | T5351 | T5338 | prep | as,µg |
R4627 | T5352 | T5354 | det | a,control |
R4628 | T5353 | T5354 | amod | non-specific,control |
R4629 | T5354 | T5351 | pobj | control,as |
R4630 | T5355 | T5358 | punct | (,Biotechnology |
R4631 | T5356 | T5357 | compound | Santa,Cruz |
R4632 | T5357 | T5358 | compound | Cruz,Biotechnology |
R4633 | T5358 | T5354 | appos | Biotechnology,control |
R4634 | T5359 | T5354 | punct | ),control |
R4635 | T5360 | T5329 | advmod | overnight,described |
R4636 | T5361 | T5329 | prep | at,described |
R4637 | T5362 | T5363 | nummod | 4,° |
R4638 | T5363 | T5366 | nummod | °,sequences |
R4639 | T5364 | T5365 | compound | C.,Promoter |
R4640 | T5365 | T5366 | compound | Promoter,sequences |
R4641 | T5366 | T5368 | nsubjpass | sequences,detected |
R4642 | T5367 | T5368 | auxpass | were,detected |
R4643 | T5368 | T5326 | conj | detected,performed |
R4644 | T5369 | T5368 | prep | with,detected |
R4645 | T5370 | T5371 | compound | PCR,primers |
R4646 | T5371 | T5369 | pobj | primers,with |
R4647 | T5372 | T5371 | prep | for,primers |
R4648 | T5373 | T5375 | det | the,promoter |
R4649 | T5374 | T5375 | compound | IL-5,promoter |
R4650 | T5375 | T5372 | pobj | promoter,for |
R4651 | T5376 | T5375 | punct | (,promoter |
R4652 | T5377 | T5388 | advmod | −,′ |
R4653 | T5378 | T5388 | meta | 445,′ |
R4654 | T5379 | T5378 | prep | to,445 |
R4655 | T5380 | T5379 | pobj | +4,to |
R4656 | T5381 | T5378 | punct | ),445 |
R4657 | T5382 | T5388 | punct | :,′ |
R4658 | T5383 | T5388 | advmod | forward,′ |
R4659 | T5384 | T5388 | nummod | 5,′ |
R4660 | T5385 | T5387 | punct | ′,TTAATCTAGCCACAGTCATAG-3 |
R4661 | T5386 | T5387 | punct | -,TTAATCTAGCCACAGTCATAG-3 |
R4662 | T5387 | T5388 | compound | TTAATCTAGCCACAGTCATAG-3,′ |
R4663 | T5388 | T5375 | appos | ′,promoter |
R4664 | T5389 | T5388 | cc | and,′ |
R4665 | T5390 | T5388 | conj | reverse,′ |
R4666 | T5391 | T5388 | punct | :,′ |
R4667 | T5392 | T5395 | nummod | 5,TCATGGCTCTGAAACGTTCTG-3 |
R4687 | T5412 | T5410 | appos | UK,Ashford |
R4688 | T5413 | T5408 | punct | ),Hybaid |
R4689 | T5414 | T5408 | prep | with,Hybaid |
R4690 | T5415 | T5416 | compound | cycling,parameters |
R4691 | T5416 | T5414 | pobj | parameters,with |
R4692 | T5417 | T5416 | prep | of,parameters |
R4693 | T5418 | T5420 | nummod | 72,C |
R4694 | T5419 | T5420 | compound | °,C |
R4695 | T5420 | T5417 | pobj | C,of |
R4696 | T5421 | T5401 | prep | for,using |
R4697 | T5422 | T5423 | nummod | 10,min |
R4698 | T5423 | T5421 | pobj | min,for |
R4699 | T5424 | T5423 | punct | ",",min |
R4700 | T5425 | T5426 | nummod | 35,cycles |
R4701 | T5426 | T5423 | appos | cycles,min |
R4702 | T5427 | T5401 | prep | at,using |
R4703 | T5428 | T5429 | nummod | 94,° |
R4704 | T5429 | T5427 | pobj | °,at |
R4705 | T5430 | T5401 | dobj | C,using |
R4706 | T5431 | T5401 | prep | for,using |
R4707 | T5432 | T5433 | nummod | 45,s |
R4708 | T5433 | T5431 | pobj | s,for |
R4709 | T5434 | T5433 | punct | ",",s |
R4710 | T5435 | T5437 | nummod | 52,C |
R4711 | T5436 | T5437 | compound | °,C |
R4712 | T5437 | T5433 | appos | C,s |
R4713 | T5438 | T5401 | prep | for,using |
R4714 | T5439 | T5438 | pobj | 45,for |
R4715 | T5440 | T5401 | dobj | s,using |
R4716 | T5441 | T5440 | punct | ",",s |
R4717 | T5442 | T5444 | nummod | 72,C |
R4718 | T5443 | T5444 | compound | °,C |
R4719 | T5444 | T5440 | appos | C,s |
R4720 | T5445 | T5401 | prep | for,using |
R4721 | T5446 | T5447 | nummod | 45,s. |
R4722 | T5447 | T5445 | pobj | s.,for |
R4970 | T5754 | T5754 | ROOT | GR-GATA-3,GR-GATA-3 |
R4971 | T5755 | T5778 | prep | In,separated |
R4972 | T5756 | T5758 | compound | Vitro,Assay |
R4973 | T5757 | T5758 | compound | Competition,Assay |
R4976 | T5760 | T5759 | pobj | Importin-α,for |
R4977 | T5761 | T5760 | punct | (,Importin-α |
R4978 | T5762 | T5763 | compound | Far-Western,ELISA |
R4979 | T5763 | T5760 | appos | ELISA,Importin-α |
R4980 | T5764 | T5760 | punct | ),Importin-α |
R4981 | T5765 | T5766 | compound | Immunoprecipitated,importin-α |
R4982 | T5766 | T5778 | nsubjpass | importin-α,separated |
R4983 | T5767 | T5772 | punct | (,Biotechnology |
R4984 | T5768 | T5772 | npadvmod | anti-importin-α,Biotechnology |
R4985 | T5769 | T5772 | punct | ",",Biotechnology |
R4986 | T5770 | T5771 | compound | Santa,Cruz |
R4987 | T5771 | T5772 | compound | Cruz,Biotechnology |
R4988 | T5772 | T5766 | appos | Biotechnology,importin-α |
R4989 | T5773 | T5772 | punct | ),Biotechnology |
R4990 | T5774 | T5772 | prep | from,Biotechnology |
R4991 | T5775 | T5776 | amod | HuT-78,cells |
R4992 | T5776 | T5774 | pobj | cells,from |
R4993 | T5777 | T5778 | auxpass | was,separated |
R4994 | T5778 | T5778 | ROOT | separated,separated |
R4995 | T5779 | T5778 | agent | by,separated |
R4996 | T5780 | T5779 | pobj | SDS-PAGE,by |
R4997 | T5781 | T5778 | cc | and,separated |
R4998 | T5782 | T5778 | conj | purified,separated |
R4999 | T5783 | T5782 | prep | from,purified |
R5000 | T5784 | T5786 | det | the,gel |
R5001 | T5785 | T5786 | amod | excised,gel |
R5002 | T5786 | T5783 | pobj | gel,from |
R5003 | T5787 | T5786 | prep | by,gel |
R5004 | T5788 | T5789 | compound | electroelution,[ |
R5005 | T5789 | T5787 | pobj | [,by |
R5006 | T5790 | T5791 | nummod | 36,] |
R5007 | T5791 | T5789 | appos | ],[ |
R5008 | T5792 | T5778 | punct | .,separated |
R5009 | T5793 | T5796 | advmod | Similarly,was |
R5010 | T5794 | T5796 | punct | ",",was |
R5011 | T5795 | T5796 | nsubj | GATA-3,was |
R5012 | T5796 | T5796 | ROOT | was,was |
R5013 | T5797 | T5796 | acomp | isolated,was |
R5014 | T5798 | T5797 | prep | from,isolated |
R5015 | T5799 | T5801 | amod | nonstimulated,cells |
R5016 | T5800 | T5801 | amod | HuT-78,cells |
R5017 | T5801 | T5798 | pobj | cells,from |
R5018 | T5802 | T5801 | cc | or,cells |
R5019 | T5803 | T5801 | conj | cells,cells |
R5020 | T5804 | T5796 | conj | stimulated,was |
R5021 | T5805 | T5804 | prep | for,stimulated |
R5022 | T5806 | T5807 | nummod | 30,min |
R5023 | T5807 | T5805 | pobj | min,for |
R5024 | T5808 | T5807 | prep | with,min |
R5025 | T5809 | T5810 | compound | anti-CD3,/ |
R5026 | T5810 | T5808 | pobj | /,with |
R5027 | T5811 | T5810 | nummod | CD28,/ |
R5028 | T5812 | T5810 | cc | and,/ |
R5029 | T5813 | T5814 | nsubj | GR,was |
R5030 | T5814 | T5796 | conj | was,was |
R5031 | T5815 | T5814 | acomp | isolated,was |
R5032 | T5816 | T5815 | prep | from,isolated |
R5033 | T5817 | T5816 | pobj | FP,from |
R5034 | T5818 | T5817 | punct | (,FP |
R5035 | T5819 | T5820 | nummod | 10,− |
R5036 | T5820 | T5817 | appos | −,FP |
R5037 | T5821 | T5822 | nummod | 8,M |
R5038 | T5822 | T5817 | conj | M,FP |
R5039 | T5823 | T5822 | punct | ",",M |
R5040 | T5824 | T5825 | nummod | 30,min |
R5041 | T5825 | T5822 | appos | min,M |
R5042 | T5826 | T5822 | punct | ),M |
R5043 | T5827 | T5814 | conj | stimulated,was |
R5044 | T5828 | T5829 | amod | HuT-78,cells |
R5045 | T5829 | T5827 | dobj | cells,stimulated |
R5046 | T5830 | T5814 | punct | .,was |
R5047 | T5831 | T5832 | det | These,proteins |
R5048 | T5832 | T5835 | nsubjpass | proteins,refolded |
R5049 | T5833 | T5835 | auxpass | were,refolded |
R5050 | T5834 | T5835 | advmod | subsequently,refolded |
R5051 | T5835 | T5835 | ROOT | refolded,refolded |
R5052 | T5836 | T5835 | prep | in,refolded |
R5053 | T5837 | T5838 | amod | glycine,solution |
R5054 | T5838 | T5836 | pobj | solution,in |
R5055 | T5839 | T5835 | punct | .,refolded |
R5056 | T5840 | T5841 | nummod | 100,µl |
R5057 | T5841 | T5852 | nsubjpass | µl,added |
R5058 | T5842 | T5841 | prep | of,µl |
R5059 | T5843 | T5844 | amod | importin-α,solution |
R5060 | T5844 | T5842 | pobj | solution,of |
R5061 | T5845 | T5844 | punct | (,solution |
R5062 | T5846 | T5847 | nummod | 100,ng/ml |
R5063 | T5847 | T5844 | appos | ng/ml,solution |
R5064 | T5848 | T5847 | prep | in,ng/ml |
R5065 | T5849 | T5848 | pobj | TBS,in |
R5066 | T5850 | T5844 | punct | ),solution |
R5067 | T5851 | T5852 | auxpass | was,added |
R5068 | T5852 | T5852 | ROOT | added,added |
R5069 | T5853 | T5852 | prep | to,added |
R5071 | T5855 | T5854 | dobj | plates,96-well |
R5072 | T5856 | T5855 | acl | coated,plates |
R5073 | T5857 | T5856 | prep | with,coated |
R5074 | T5858 | T5860 | amod | goat,antibody |
R5075 | T5859 | T5860 | amod | anti-importin-α,antibody |
R5085 | T5869 | T5870 | nummod | 100,ng/ml |
R5086 | T5870 | T5867 | appos | ng/ml,GATA-3 |
R5087 | T5871 | T5870 | prep | in,ng/ml |
R5088 | T5872 | T5871 | pobj | TBS,in |
R5089 | T5873 | T5870 | punct | ),ng/ml |
R5090 | T5874 | T5870 | prep | from,ng/ml |
R5091 | T5875 | T5878 | amod | stimulated,cells |
R5092 | T5876 | T5875 | cc | or,stimulated |
R5093 | T5877 | T5875 | conj | unstimulated,stimulated |
R5094 | T5878 | T5874 | pobj | cells,from |
R5095 | T5879 | T5880 | auxpass | were,added |
R5096 | T5880 | T5880 | ROOT | added,added |
R5097 | T5881 | T5880 | prep | to,added |
R5098 | T5882 | T5884 | det | the,wells |
R5099 | T5883 | T5884 | amod | importin-α-coated,wells |
R5100 | T5884 | T5881 | pobj | wells,to |
R5101 | T5885 | T5880 | punct | .,added |
R5102 | T5886 | T5901 | nsubjpass | GR,added |
R5103 | T5887 | T5886 | punct | (,GR |
R5104 | T5888 | T5891 | nummod | 10,ng/ml |
R5105 | T5889 | T5888 | cc | or,10 |
R5106 | T5890 | T5888 | conj | 100,10 |
R5107 | T5891 | T5886 | appos | ng/ml,GR |
R5108 | T5892 | T5891 | prep | in,ng/ml |
R5109 | T5893 | T5892 | pobj | TBS,in |
R5110 | T5894 | T5891 | punct | ),ng/ml |
R5111 | T5895 | T5891 | prep | from,ng/ml |
R5112 | T5896 | T5899 | amod | stimulated,cells |
R5113 | T5897 | T5896 | cc | or,stimulated |
R5114 | T5898 | T5896 | conj | unstimulated,stimulated |
R5115 | T5899 | T5895 | pobj | cells,from |
R5116 | T5900 | T5901 | auxpass | were,added |
R5117 | T5901 | T5901 | ROOT | added,added |
R5118 | T5902 | T5901 | prep | to,added |
R5119 | T5903 | T5904 | det | some,wells |
R5120 | T5904 | T5902 | pobj | wells,to |
R5121 | T5905 | T5901 | punct | .,added |
R5122 | T5906 | T5916 | prep | After,washed |
R5123 | T5907 | T5911 | det | a,incubation |
R5124 | T5908 | T5911 | amod | further,incubation |
R5125 | T5909 | T5910 | nummod | 1,h |
R5126 | T5910 | T5911 | compound | h,incubation |
R5127 | T5911 | T5906 | pobj | incubation,After |
R5128 | T5912 | T5916 | punct | ",",washed |
R5129 | T5913 | T5914 | det | the,plate |
R5130 | T5914 | T5916 | nsubjpass | plate,washed |
R5131 | T5915 | T5916 | auxpass | was,washed |
R5132 | T5916 | T5916 | ROOT | washed,washed |
R5133 | T5917 | T5916 | cc | and,washed |
R5134 | T5918 | T5916 | conj | incubated,washed |
R5135 | T5919 | T5918 | prep | with,incubated |
R5136 | T5920 | T5921 | amod | primary,antibodies |
R5137 | T5921 | T5919 | pobj | antibodies,with |
R5138 | T5922 | T5921 | punct | (,antibodies |
R5139 | T5923 | T5924 | det | a,mixture |
R5140 | T5924 | T5921 | appos | mixture,antibodies |
R5141 | T5925 | T5924 | prep | of,mixture |
R5142 | T5926 | T5927 | compound | rabbit,anti-GATA-3 |
R5143 | T5927 | T5925 | pobj | anti-GATA-3,of |
R5144 | T5928 | T5927 | cc | and,anti-GATA-3 |
R5145 | T5929 | T5927 | conj | mouse,anti-GATA-3 |
R5146 | T5930 | T5927 | conj | anti-GR,anti-GATA-3 |
R5147 | T5931 | T5930 | punct | ",",anti-GR |
R5148 | T5932 | T5934 | compound | Santa,Biotechnology |
R5149 | T5933 | T5934 | compound | Cruz,Biotechnology |
R5150 | T5934 | T5927 | appos | Biotechnology,anti-GATA-3 |
R5151 | T5935 | T5921 | punct | ),antibodies |
R5152 | T5936 | T5918 | prep | for,incubated |
R5153 | T5937 | T5938 | nummod | 1.5,h |
R5154 | T5938 | T5936 | pobj | h,for |
R5155 | T5939 | T5918 | punct | ",",incubated |
R5156 | T5940 | T5918 | cc | and,incubated |
R5157 | T5941 | T5942 | advmod | then,incubated |
R5158 | T5942 | T5918 | conj | incubated,incubated |
R5159 | T5943 | T5942 | prep | with,incubated |
R5160 | T5944 | T5945 | amod | secondary,antibodies |
R5161 | T5945 | T5943 | pobj | antibodies,with |
R5162 | T5946 | T5916 | punct | .,washed |
R5163 | T5947 | T5948 | nummod | FITC,swine |
R5164 | T5948 | T5949 | nsubj | swine,anti-rabbit |
R5165 | T5949 | T5959 | nsubjpass | anti-rabbit,used |
R5166 | T5950 | T5949 | dobj | IgG,anti-rabbit |
R5167 | T5951 | T5952 | punct | (,Dako |
R5168 | T5952 | T5950 | appos | Dako,IgG |
R5169 | T5953 | T5952 | punct | ",",Dako |
R5170 | T5954 | T5952 | npadvmod | Cambridge,Dako |
R5171 | T5955 | T5954 | punct | ",",Cambridge |
R5172 | T5956 | T5954 | appos | UK,Cambridge |
R5173 | T5957 | T5954 | punct | ),Cambridge |
R5174 | T5958 | T5959 | auxpass | was,used |
R5175 | T5959 | T5959 | ROOT | used,used |
R5176 | T5960 | T5959 | prep | for,used |
R5177 | T5961 | T5962 | det | the,detection |
R5178 | T5962 | T5960 | pobj | detection,for |
R5179 | T5963 | T5962 | prep | of,detection |
R5207 | T5991 | T5993 | nsubjpass | levels,measured |
R5208 | T5992 | T5993 | auxpass | were,measured |
R5209 | T5993 | T5993 | ROOT | measured,measured |
R5210 | T5994 | T5993 | prep | with,measured |
R5211 | T5995 | T5998 | det | a,reader |
R5212 | T5996 | T5998 | amod | fluorescent,reader |
R5213 | T5997 | T5998 | amod | micro-plate,reader |
R5214 | T5998 | T5994 | pobj | reader,with |
R5215 | T5999 | T5998 | punct | (,reader |
R5216 | T6000 | T5998 | appos | Bioline,reader |
R5217 | T6001 | T6000 | punct | ",",Bioline |
R5218 | T6002 | T6000 | conj | London,Bioline |
R5219 | T6003 | T6002 | punct | ",",London |
R5220 | T6004 | T6002 | conj | UK,London |
R5221 | T6005 | T5998 | punct | ),reader |
R5222 | T6006 | T5993 | punct | .,measured |
R5304 | T6161 | T6163 | compound | NF-κB,NF-κB |
R5305 | T6162 | T6163 | compound | Activation,NF-κB |
R5306 | T6163 | T6170 | nsubjpass | NF-κB,determined |
R5307 | T6164 | T6165 | amod | binding,activity |
R5308 | T6165 | T6163 | dobj | activity,NF-κB |
R5309 | T6166 | T6165 | prep | in,activity |
R5310 | T6167 | T6168 | amod | nuclear,extracts |
R5311 | T6168 | T6166 | pobj | extracts,in |
R5312 | T6169 | T6170 | auxpass | was,determined |
R5313 | T6170 | T6170 | ROOT | determined,determined |
R5342 | T6199 | T6197 | pobj | plate,with |
R5343 | T6200 | T6199 | acl | coated,plate |
R5344 | T6201 | T6200 | prep | with,coated |
R5345 | T6202 | T6204 | det | an,consensus |
R5346 | T6203 | T6204 | amod | NF-κB,consensus |
R5347 | T6204 | T6205 | compound | consensus,oligonucleotide |
R5348 | T6205 | T6201 | pobj | oligonucleotide,with |
R5349 | T6206 | T6196 | punct | .,incubated |
R5350 | T6207 | T6209 | nsubjpass | Plates,washed |
R5351 | T6208 | T6209 | auxpass | were,washed |
R5352 | T6209 | T6209 | ROOT | washed,washed |
R5353 | T6210 | T6209 | prep | before,washed |
R5354 | T6211 | T6210 | pobj | addition,before |
R5355 | T6212 | T6211 | prep | of,addition |
R5356 | T6213 | T6215 | det | an,antibody |
R5357 | T6214 | T6215 | amod | anti-p65,antibody |
R5358 | T6215 | T6212 | pobj | antibody,of |
R5359 | T6216 | T6209 | punct | .,washed |
R5360 | T6217 | T6218 | compound | Antibody,binding |
R5361 | T6218 | T6220 | nsubjpass | binding,detected |
R5362 | T6219 | T6220 | auxpass | was,detected |
R5363 | T6220 | T6220 | ROOT | detected,detected |
R5364 | T6221 | T6220 | prep | with,detected |
R5365 | T6222 | T6225 | det | a,antibody |
R5366 | T6223 | T6225 | amod | secondary,antibody |
R5367 | T6224 | T6225 | amod | HRP-conjugated,antibody |
R5368 | T6225 | T6221 | pobj | antibody,with |
R5369 | T6226 | T6220 | cc | and,detected |
R5370 | T6227 | T6220 | conj | developed,detected |
R5371 | T6228 | T6227 | prep | with,developed |
R5372 | T6229 | T6230 | compound | TMB,substrate |
R5373 | T6230 | T6228 | pobj | substrate,with |
R5374 | T6231 | T6220 | punct | .,detected |
R5375 | T6232 | T6233 | det | The,intensity |
R5376 | T6233 | T6238 | nsubjpass | intensity,measured |
R5377 | T6234 | T6233 | prep | of,intensity |
R5378 | T6235 | T6236 | det | the,reaction |
R5379 | T6236 | T6234 | pobj | reaction,of |
R5380 | T6237 | T6238 | auxpass | was,measured |
R5381 | T6238 | T6238 | ROOT | measured,measured |
R5382 | T6239 | T6238 | prep | at,measured |
R5383 | T6240 | T6241 | nummod | 450,nm |
R5384 | T6241 | T6239 | pobj | nm,at |
R5385 | T6242 | T6238 | punct | .,measured |
R5594 | T6486 | T6488 | compound | Immunofluorescence,Immunofluorescence |
R5595 | T6487 | T6488 | compound | Staining,Immunofluorescence |
R5596 | T6488 | T6491 | nsubjpass | Immunofluorescence,performed |
R5597 | T6489 | T6488 | acl | staining,Immunofluorescence |
R5598 | T6490 | T6491 | auxpass | was,performed |
R5599 | T6491 | T6491 | ROOT | performed,performed |
R5600 | T6492 | T6494 | mark | as,described |
R5601 | T6493 | T6494 | advmod | previously,described |
R5602 | T6494 | T6491 | advcl | described,performed |
R5603 | T6495 | T6497 | nmod | [,] |
R5604 | T6496 | T6497 | nummod | 34,] |
R5605 | T6497 | T6494 | dobj | ],described |
R5606 | T6498 | T6491 | punct | .,performed |
R5607 | T6499 | T6500 | det | All,staining |
R5608 | T6500 | T6502 | nsubjpass | staining,performed |
R5609 | T6501 | T6502 | auxpass | was,performed |
R5610 | T6502 | T6502 | ROOT | performed,performed |
R5611 | T6503 | T6502 | prep | at,performed |
R5612 | T6504 | T6505 | compound | room,temperature |
R5613 | T6505 | T6503 | pobj | temperature,at |
R5614 | T6506 | T6503 | cc | and,at |
R5615 | T6507 | T6503 | conj | under,at |
R5616 | T6508 | T6507 | pobj | humidification,under |
R5617 | T6509 | T6502 | punct | .,performed |
R5618 | T6510 | T6512 | nsubjpass | Cells,collected |
R5619 | T6511 | T6512 | auxpass | were,collected |
R5620 | T6512 | T6512 | ROOT | collected,collected |
R5621 | T6513 | T6512 | cc | and,collected |
R5622 | T6514 | T6512 | conj | cytospins,collected |
R5623 | T6515 | T6514 | acl | prepared,cytospins |
R5624 | T6516 | T6515 | prep | in,prepared |
R5625 | T6517 | T6518 | det | a,cytocentrifuge |
R5626 | T6518 | T6516 | pobj | cytocentrifuge,in |
R5627 | T6519 | T6521 | punct | (,II |
R5628 | T6520 | T6521 | compound | Shandon,II |
R5629 | T6521 | T6518 | appos | II,cytocentrifuge |
R5630 | T6522 | T6521 | punct | ",",II |
R5631 | T6523 | T6521 | conj | Shandon,II |
R5632 | T6524 | T6523 | punct | ",",Shandon |
R5633 | T6525 | T6523 | conj | Runcorn,Shandon |
R5634 | T6526 | T6525 | punct | ",",Runcorn |
R5635 | T6527 | T6525 | conj | UK,Runcorn |
R5636 | T6528 | T6521 | punct | ),II |
R5637 | T6529 | T6512 | punct | .,collected |
R5638 | T6530 | T6532 | nsubjpass | Cells,permeabilized |
R5639 | T6531 | T6532 | auxpass | were,permeabilized |
R5640 | T6532 | T6532 | ROOT | permeabilized,permeabilized |
R5641 | T6533 | T6532 | punct | ",",permeabilized |
R5642 | T6534 | T6532 | conj | blocked,permeabilized |
R5643 | T6535 | T6534 | punct | ",",blocked |
R5644 | T6536 | T6532 | cc | and,permeabilized |
R5645 | T6537 | T6538 | advmod | then,incubated |
R5646 | T6538 | T6532 | conj | incubated,permeabilized |
R5647 | T6539 | T6538 | prep | with,incubated |
R5648 | T6540 | T6539 | pobj | GR,with |
R5649 | T6541 | T6542 | punct | (,1 |
R5650 | T6542 | T6548 | nummod | 1,Biotechnology |
R5651 | T6543 | T6548 | nummod | ∶,Biotechnology |
R5652 | T6544 | T6545 | nummod | 50,E-20 |
R5653 | T6545 | T6548 | compound | E-20,Biotechnology |
R5654 | T6546 | T6547 | compound | Santa,Cruz |
R5655 | T6547 | T6548 | compound | Cruz,Biotechnology |
R5656 | T6548 | T6540 | appos | Biotechnology,GR |
R5657 | T6549 | T6538 | punct | ),incubated |
R5658 | T6550 | T6538 | cc | or,incubated |
R5659 | T6551 | T6538 | conj | anti-GATA-3,incubated |
R5660 | T6552 | T6559 | punct | (,antibody |
R5661 | T6553 | T6559 | amod | H-48,antibody |
R5662 | T6554 | T6559 | punct | ;,antibody |
R5663 | T6555 | T6556 | compound | Santa,Cruz |
R5664 | T6556 | T6557 | compound | Cruz,Biotechnology |
R5665 | T6557 | T6559 | compound | Biotechnology,antibody |
R5666 | T6558 | T6557 | punct | ),Biotechnology |
R5667 | T6559 | T6559 | ROOT | antibody,antibody |
R5668 | T6560 | T6559 | prep | for,antibody |
R5669 | T6561 | T6562 | nummod | 1,h |
R5670 | T6562 | T6560 | pobj | h,for |
R5671 | T6563 | T6562 | prep | at,h |
R5672 | T6564 | T6565 | compound | room,temperature |
R5673 | T6565 | T6563 | pobj | temperature,at |
R5674 | T6566 | T6532 | punct | .,permeabilized |
R5675 | T6567 | T6579 | prep | After,incubated |
R5676 | T6568 | T6569 | nummod | three,washes |
R5677 | T6569 | T6567 | pobj | washes,After |
R5678 | T6570 | T6569 | prep | in,washes |
R5679 | T6571 | T6572 | amod | phosphate-buffered,saline |
R5680 | T6572 | T6570 | pobj | saline,in |
R5681 | T6573 | T6574 | punct | (,PBS |
R5682 | T6574 | T6569 | appos | PBS,washes |
R5683 | T6575 | T6569 | punct | ),washes |
R5684 | T6576 | T6579 | punct | ",",incubated |
R5685 | T6577 | T6579 | nsubjpass | cells,incubated |
R5686 | T6578 | T6579 | auxpass | were,incubated |
R5687 | T6579 | T6579 | ROOT | incubated,incubated |
R5688 | T6580 | T6579 | prep | with,incubated |
R5689 | T6581 | T6582 | amod | tetrarhodamine,isothiocyanate |
R5690 | T6582 | T6580 | pobj | isothiocyanate,with |
R5691 | T6583 | T6586 | amod | conjugated,antibody |
R5692 | T6584 | T6586 | nmod | goat,antibody |
R5693 | T6585 | T6586 | amod | anti-rabbit,antibody |
R5694 | T6586 | T6586 | ROOT | antibody,antibody |
R5695 | T6587 | T6588 | punct | (,Dako |
R5696 | T6588 | T6586 | appos | Dako,antibody |
R5697 | T6589 | T6588 | punct | ),Dako |
R5698 | T6590 | T6586 | punct | .,antibody |
R5699 | T6591 | T6593 | nsubjpass | Cytospins,counterstained |
R5700 | T6592 | T6593 | auxpass | were,counterstained |
R5701 | T6593 | T6593 | ROOT | counterstained,counterstained |
R5702 | T6594 | T6593 | prep | with,counterstained |
R5703 | T6595 | T6596 | nummod | 4,′ |
R5704 | T6596 | T6600 | nummod | ′,dihydrochloride |
R5705 | T6597 | T6599 | punct | ",6",diamidino-2-phenylindole |
R5706 | T6598 | T6599 | punct | -,diamidino-2-phenylindole |
R5707 | T6599 | T6600 | compound | diamidino-2-phenylindole,dihydrochloride |
R5708 | T6600 | T6594 | pobj | dihydrochloride,with |
R5709 | T6601 | T6600 | punct | (,dihydrochloride |
R5710 | T6602 | T6600 | appos | DAPI,dihydrochloride |
R5711 | T6603 | T6600 | punct | ),dihydrochloride |
R5712 | T6604 | T6600 | punct | ",",dihydrochloride |
R5713 | T6605 | T6611 | det | a,stain |
R5714 | T6606 | T6611 | amod | fluorescent,stain |
R5715 | T6607 | T6609 | amod | blue,indole |
R5716 | T6608 | T6609 | amod | nuclear,indole |
R5717 | T6609 | T6611 | compound | indole,stain |
R5718 | T6610 | T6611 | compound | chromatin,stain |
R5719 | T6611 | T6600 | appos | stain,dihydrochloride |
R5720 | T6612 | T6593 | punct | ",",counterstained |
R5721 | T6613 | T6593 | cc | and,counterstained |
R5722 | T6614 | T6593 | conj | mounted,counterstained |
R5723 | T6615 | T6614 | prep | in,mounted |
R5724 | T6616 | T6615 | pobj | PBS,in |
R5725 | T6617 | T6614 | punct | :,mounted |
R5726 | T6618 | T6614 | conj | glycerol,mounted |
R5727 | T6619 | T6618 | punct | (,glycerol |
R5728 | T6620 | T6621 | nummod | 50,∶ |
R5729 | T6621 | T6618 | appos | ∶,glycerol |
R5730 | T6622 | T6621 | nummod | 50,∶ |
R5731 | T6623 | T6618 | punct | ),glycerol |
R5732 | T6624 | T6593 | punct | .,counterstained |
R5733 | T6625 | T6627 | det | The,signal |
R5734 | T6626 | T6627 | amod | immunopositive,signal |
R5735 | T6627 | T6629 | nsubjpass | signal,characterised |
R5736 | T6628 | T6629 | auxpass | was,characterised |
R5737 | T6629 | T6629 | ROOT | characterised,characterised |
R5738 | T6630 | T6629 | advcl | using,characterised |
R5739 | T6631 | T6632 | nmod | laser,scanning |
R5740 | T6632 | T6630 | dobj | scanning,using |
R5741 | T6633 | T6634 | amod | confocal,microscopy |
R5742 | T6634 | T6632 | dobj | microscopy,scanning |
R5743 | T6635 | T6632 | prep | on,scanning |
R5744 | T6636 | T6642 | det | a,cytometer |
R5745 | T6637 | T6639 | nmod | Leica,NT/SP |
R5746 | T6638 | T6639 | compound | TCS,NT/SP |
R5747 | T6639 | T6642 | nmod | NT/SP,cytometer |
R5748 | T6640 | T6642 | amod | interactive,cytometer |
R5749 | T6641 | T6642 | compound | laser,cytometer |
R5750 | T6642 | T6635 | pobj | cytometer,on |
R5751 | T6643 | T6642 | acl | equipped,cytometer |
R5752 | T6644 | T6643 | prep | with,equipped |
R5753 | T6645 | T6646 | compound | confocal,optics |
R5754 | T6646 | T6644 | pobj | optics,with |
R5782 | T6674 | T6675 | det | the,primary |
R5783 | T6675 | T6673 | pobj | primary,without |
R5784 | T6676 | T6677 | auxpass | were,used |
R5785 | T6677 | T6677 | ROOT | used,used |
R5786 | T6678 | T6677 | prep | as,used |
R5787 | T6679 | T6678 | pobj | controls,as |
R5788 | T6680 | T6677 | punct | .,used |
R5789 | T6681 | T6682 | advmod | Positively,stained |
R5790 | T6682 | T6683 | amod | stained,nuclei |
R5791 | T6683 | T6688 | nsubjpass | nuclei,counted |
R5792 | T6684 | T6683 | cc | and,nuclei |
R5793 | T6685 | T6686 | amod | total,cells |
R5794 | T6686 | T6683 | conj | cells,nuclei |
R5795 | T6687 | T6688 | auxpass | were,counted |
R5796 | T6688 | T6688 | ROOT | counted,counted |
R5797 | T6689 | T6688 | punct | (,counted |
R5798 | T6690 | T6688 | npadvmod | 500,counted |
R5799 | T6691 | T6688 | punct | ),counted |
R5800 | T6692 | T6688 | prep | on,counted |
R5801 | T6693 | T6694 | det | each,slide |
R5802 | T6694 | T6692 | pobj | slide,on |
R5803 | T6695 | T6694 | prep | with,slide |
R5804 | T6696 | T6697 | det | the,observer |
R5805 | T6697 | T6695 | pobj | observer,with |
R5806 | T6698 | T6688 | conj | blinded,counted |
R5807 | T6699 | T6698 | prep | to,blinded |
R5808 | T6700 | T6701 | det | the,treatment |
R5809 | T6701 | T6699 | pobj | treatment,to |
R5810 | T6702 | T6688 | punct | .,counted |
R5958 | T6937 | T6938 | compound | GATA-3-GFP,Construct |
R5959 | T6938 | T6948 | nsubjpass | Construct,obtained |
R5960 | T6939 | T6941 | det | The,clone |
R5961 | T6940 | T6941 | compound | GATA-3,clone |
R5962 | T6941 | T6938 | appos | clone,Construct |
R5963 | T6942 | T6943 | punct | (,BC003070 |
R5964 | T6943 | T6941 | appos | BC003070,clone |
R5965 | T6944 | T6941 | punct | ),clone |
R5966 | T6945 | T6946 | amod | complete,cDNA |
R5967 | T6946 | T6948 | nsubjpass | cDNA,obtained |
R5968 | T6947 | T6948 | auxpass | was,obtained |
R5969 | T6948 | T6948 | ROOT | obtained,obtained |
R5970 | T6949 | T6948 | prep | from,obtained |
R5971 | T6950 | T6952 | compound | Invitrogen,Technologies |
R5972 | T6951 | T6952 | compound | Life,Technologies |
R5973 | T6952 | T6949 | pobj | Technologies,from |
R5974 | T6953 | T6948 | prep | as,obtained |
R5975 | T6954 | T6962 | det | a,insert |
R5976 | T6955 | T6958 | nummod | 5,EcoRI/3 |
R5977 | T6956 | T6958 | punct | ′,EcoRI/3 |
R5978 | T6957 | T6958 | punct | -,EcoRI/3 |
R5979 | T6958 | T6962 | compound | EcoRI/3,insert |
R5980 | T6959 | T6961 | punct | ′,XhoI |
R5981 | T6960 | T6961 | punct | -,XhoI |
R5982 | T6961 | T6962 | compound | XhoI,insert |
R5983 | T6962 | T6953 | pobj | insert,as |
R5984 | T6963 | T6962 | prep | of,insert |
R5985 | T6964 | T6963 | pobj | GATA-3,of |
R5986 | T6965 | T6962 | prep | in,insert |
R5987 | T6966 | T6968 | det | the,vector |
R5988 | T6967 | T6968 | compound | pOTB7,vector |
R5989 | T6968 | T6965 | pobj | vector,in |
R5990 | T6969 | T6948 | punct | .,obtained |
R5991 | T6970 | T6972 | nsubjpass | GATA-3,excised |
R5992 | T6971 | T6972 | auxpass | was,excised |
R5993 | T6972 | T6972 | ROOT | excised,excised |
R5994 | T6973 | T6972 | prep | from,excised |
R5995 | T6974 | T6973 | pobj | pOTB7,from |
R5996 | T6975 | T6972 | advcl | using,excised |
R5997 | T6976 | T6977 | compound | XhoI,digestion |
R5998 | T6977 | T6975 | dobj | digestion,using |
R5999 | T6978 | T6977 | cc | and,digestion |
R6000 | T6979 | T6977 | conj | pEGFP-C2,digestion |
R6001 | T6980 | T6981 | punct | (,Clontech |
R6002 | T6981 | T6977 | appos | Clontech,digestion |
R6003 | T6982 | T6981 | punct | ",",Clontech |
R6004 | T6983 | T6981 | conj | Saint-Germain-en-Laye,Clontech |
R6005 | T6984 | T6983 | punct | ",",Saint-Germain-en-Laye |
R6006 | T6985 | T6983 | conj | France,Saint-Germain-en-Laye |
R6007 | T6986 | T6981 | punct | ),Clontech |
R6008 | T6987 | T6988 | auxpass | was,digested |
R6009 | T6988 | T6972 | advcl | digested,excised |
R6010 | T6989 | T6988 | prep | with,digested |
R6011 | T6990 | T6989 | pobj | BamHI,with |
R6012 | T6991 | T6972 | punct | .,excised |
R6013 | T6992 | T6994 | nsubjpass | DNA,recovered |
R6014 | T6993 | T6994 | auxpass | was,recovered |
R6015 | T6994 | T6994 | ROOT | recovered,recovered |
R6016 | T6995 | T6994 | agent | by,recovered |
R6017 | T6996 | T6997 | compound | phenol,extraction |
R6018 | T6997 | T6995 | pobj | extraction,by |
R6019 | T6998 | T6997 | cc | and,extraction |
R6020 | T6999 | T7000 | compound | ethanol,precipitation |
R6021 | T7000 | T6997 | conj | precipitation,extraction |
R6022 | T7001 | T6994 | punct | ",",recovered |
R6023 | T7002 | T6994 | cc | and,recovered |
R6024 | T7003 | T7006 | preconj | both,fragment |
R6025 | T7004 | T7006 | det | the,fragment |
R6026 | T7005 | T7006 | compound | GATA-3,fragment |
R6027 | T7006 | T7029 | nsubjpass | fragment,inactivated |
R6028 | T7007 | T7006 | cc | and,fragment |
R6029 | T7008 | T7010 | det | the,vector |
R6030 | T7009 | T7010 | compound | pEGFP-C2,vector |
R6031 | T7010 | T7006 | conj | vector,fragment |
R6032 | T7011 | T7006 | acl | blunt-ended,fragment |
R6033 | T7012 | T7011 | agent | by,blunt-ended |
R6034 | T7013 | T7012 | pobj | incubation,by |
R6035 | T7014 | T7011 | prep | with,blunt-ended |
R6036 | T7015 | T7014 | pobj | Klenow,with |
R6037 | T7016 | T7015 | punct | (,Klenow |
R6038 | T7017 | T7018 | compound | Bioline,Bio-27029 |
R6039 | T7018 | T7015 | appos | Bio-27029,Klenow |
R6040 | T7019 | T7015 | punct | ),Klenow |
R6041 | T7020 | T7011 | prep | for,blunt-ended |
R6042 | T7021 | T7022 | nummod | 30,min |
R6043 | T7022 | T7020 | pobj | min,for |
R6044 | T7023 | T7022 | prep | at,min |
R6045 | T7024 | T7025 | nummod | 37,° |
R6046 | T7025 | T7027 | nummod | °,Klenow |
R6047 | T7026 | T7027 | compound | C.,Klenow |
R6048 | T7027 | T7023 | pobj | Klenow,at |
R6049 | T7028 | T7029 | auxpass | was,inactivated |
R6050 | T7029 | T6994 | conj | inactivated,recovered |
R6051 | T7030 | T7029 | agent | by,inactivated |
R6052 | T7031 | T7030 | pobj | incubation,by |
R6053 | T7032 | T7029 | prep | for,inactivated |
R6054 | T7033 | T7034 | nummod | 10,min |
R6055 | T7034 | T7032 | pobj | min,for |
R6056 | T7035 | T7034 | prep | at,min |
R6057 | T7036 | T7037 | nummod | 75,° |
R6058 | T7037 | T7039 | nummod | °,DNA |
R6059 | T7038 | T7039 | compound | C.,DNA |
R6060 | T7039 | T7035 | pobj | DNA,at |
R6061 | T7040 | T7041 | auxpass | was,recovered |
R6062 | T7041 | T6994 | conj | recovered,recovered |
R6063 | T7042 | T7041 | agent | by,recovered |
R6064 | T7043 | T7044 | compound | phenol,extraction |
R6065 | T7044 | T7042 | pobj | extraction,by |
R6066 | T7045 | T7044 | cc | and,extraction |
R6067 | T7046 | T7047 | compound | ethanol,precipitation |
R6068 | T7047 | T7044 | conj | precipitation,extraction |
R6069 | T7048 | T7041 | punct | ",",recovered |
R6070 | T7049 | T6994 | cc | and,recovered |
R6071 | T7050 | T7054 | preconj | both,fragment |
R6072 | T7051 | T7054 | det | the,fragment |
R6073 | T7052 | T7054 | amod | blunt-ended,fragment |
R6074 | T7053 | T7054 | compound | GATA-3,fragment |
R6075 | T7054 | T7061 | nsubjpass | fragment,digested |
R6076 | T7055 | T7054 | cc | and,fragment |
R6077 | T7056 | T7058 | det | the,vector |
R6078 | T7057 | T7058 | compound | GFP,vector |
R6079 | T7058 | T7054 | conj | vector,fragment |
R6080 | T7059 | T7061 | auxpass | were,digested |
R6081 | T7060 | T7061 | advmod | subsequently,digested |
R6082 | T7061 | T6994 | conj | digested,recovered |
R6083 | T7062 | T7061 | prep | with,digested |
R6084 | T7063 | T7062 | pobj | EcoRI,with |
R6085 | T7064 | T7061 | prep | before,digested |
R6086 | T7065 | T7070 | det | the,′ |
R6087 | T7066 | T7070 | nummod | 5,′ |
R6088 | T7067 | T7069 | punct | ′,EcoRI/3 |
R6089 | T7068 | T7069 | punct | -,EcoRI/3 |
R6090 | T7069 | T7070 | compound | EcoRI/3,′ |
R6091 | T7070 | T7064 | pobj | ′,before |
R6092 | T7071 | T7074 | amod | blunt,fragment |
R6093 | T7072 | T7074 | compound | end,fragment |
R6094 | T7073 | T7074 | compound | GATA-3,fragment |
R6095 | T7074 | T7076 | nsubjpass | fragment,inserted |
R6096 | T7075 | T7076 | auxpass | was,inserted |
R6097 | T7076 | T6994 | conj | inserted,recovered |
R6098 | T7077 | T7076 | prep | into,inserted |
R6099 | T7078 | T7083 | det | the,′ |
R6100 | T7079 | T7082 | nummod | 5,EcoRI/3 |
R6101 | T7080 | T7082 | punct | ′,EcoRI/3 |
R6247 | T7294 | T7286 | appos | serum,h |
R6248 | T7295 | T7294 | prep | in,serum |
R6249 | T7296 | T7295 | pobj | RPMI1640,in |
R6250 | T7297 | T7298 | nummod | +15,L-glutamine |
R6251 | T7298 | T7294 | appos | L-glutamine,serum |
R6252 | T7299 | T7286 | punct | ),h |
R6253 | T7300 | T7258 | prep | according,transfected |
R6254 | T7301 | T7300 | prep | to,according |
R6255 | T7302 | T7305 | det | the,protocol |
R6256 | T7303 | T7305 | amod | general,protocol |
R6257 | T7304 | T7305 | compound | Amaxa,protocol |
R6258 | T7305 | T7301 | pobj | protocol,to |
R6412 | T7474 | T7475 | compound | Microscopy,HuT-78 |
R6413 | T7475 | T7476 | compound | HuT-78,cells |
R6414 | T7476 | T7480 | nsubjpass | cells,maintained |
R6415 | T7477 | T7476 | acl | expressing,cells |
R6416 | T7478 | T7477 | dobj | GATA-3-GFP,expressing |
R6417 | T7479 | T7480 | auxpass | were,maintained |
R6418 | T7480 | T7480 | ROOT | maintained,maintained |
R6419 | T7481 | T7480 | prep | at,maintained |
R6420 | T7482 | T7483 | nummod | 37,° |
R6421 | T7483 | T7484 | nummod | °,C |
R6422 | T7484 | T7481 | pobj | C,at |
R6423 | T7485 | T7484 | prep | in,C |
R6424 | T7486 | T7487 | compound | growth,medium |
R6425 | T7487 | T7485 | pobj | medium,in |
R6426 | T7488 | T7480 | prep | in,maintained |
R6427 | T7489 | T7493 | det | a,chamber |
R6428 | T7490 | T7493 | amod | closed,chamber |
R6429 | T7491 | T7493 | nummod | FCS2,chamber |
R6430 | T7492 | T7493 | compound | perfusion,chamber |
R6431 | T7493 | T7488 | pobj | chamber,in |
R6432 | T7494 | T7495 | punct | (,Bioptechs |
R6433 | T7495 | T7493 | appos | Bioptechs,chamber |
R6434 | T7496 | T7495 | punct | ",",Bioptechs |
R6435 | T7497 | T7495 | conj | Butler,Bioptechs |
R6436 | T7498 | T7497 | punct | ",",Butler |
R6437 | T7499 | T7497 | conj | Pennsylvania,Butler |
R6438 | T7500 | T7499 | punct | ",",Pennsylvania |
R6439 | T7501 | T7499 | conj | USA,Pennsylvania |
R6440 | T7502 | T7480 | punct | ),maintained |
R6441 | T7503 | T7480 | conj | combined,maintained |
R6442 | T7504 | T7503 | prep | with,combined |
R6443 | T7505 | T7507 | det | an,heater |
R6444 | T7506 | T7507 | amod | objective,heater |
R6445 | T7507 | T7504 | pobj | heater,with |
R6446 | T7508 | T7507 | punct | (,heater |
R6447 | T7509 | T7507 | appos | Bioptechs,heater |
R6448 | T7510 | T7507 | punct | ),heater |
R6449 | T7511 | T7503 | prep | on,combined |
R6450 | T7512 | T7513 | det | the,stage |
R6451 | T7513 | T7511 | pobj | stage,on |
R6452 | T7514 | T7518 | det | a,microscope |
R6453 | T7515 | T7516 | compound | Zeiss,Axiovert |
R6454 | T7516 | T7518 | nmod | Axiovert,microscope |
R6455 | T7517 | T7518 | nummod | 200,microscope |
R6456 | T7518 | T7503 | npadvmod | microscope,combined |
R6457 | T7519 | T7520 | punct | (,Thornwood |
R6458 | T7520 | T7518 | appos | Thornwood,microscope |
R6459 | T7521 | T7520 | punct | ",",Thornwood |
R6460 | T7522 | T7523 | compound | New,York |
R6461 | T7523 | T7520 | npadvmod | York,Thornwood |
R6462 | T7524 | T7523 | punct | ",",York |
R6463 | T7525 | T7520 | appos | USA,Thornwood |
R6464 | T7526 | T7520 | punct | ),Thornwood |
R6465 | T7527 | T7480 | punct | .,maintained |
R6466 | T7528 | T7530 | nsubjpass | Observations,made |
R6467 | T7529 | T7530 | auxpass | were,made |
R6468 | T7530 | T7530 | ROOT | made,made |
R6469 | T7531 | T7530 | agent | by,made |
R6470 | T7532 | T7534 | nummod | 40,1.0 |
R6471 | T7533 | T7534 | nummod | ×,1.0 |
R6472 | T7534 | T7531 | pobj | 1.0,by |
R6473 | T7535 | T7538 | nmod | NA,lens |
R6474 | T7536 | T7538 | amod | oil-immersion,lens |
R6475 | T7537 | T7538 | amod | objective,lens |
R6476 | T7538 | T7545 | nmod | lens,images |
R6477 | T7539 | T7538 | punct | ",",lens |
R6478 | T7540 | T7538 | cc | and,lens |
R6479 | T7541 | T7538 | conj | fluorescence,lens |
R6480 | T7542 | T7541 | cc | and,fluorescence |
R6481 | T7543 | T7541 | conj | phase,fluorescence |
R6482 | T7544 | T7545 | compound | contrast,images |
R6483 | T7545 | T7547 | nsubjpass | images,gathered |
R6484 | T7546 | T7547 | auxpass | were,gathered |
R6485 | T7547 | T7530 | conj | gathered,made |
R6486 | T7548 | T7547 | advcl | using,gathered |
R6487 | T7549 | T7551 | det | a,ORCA-ER |
R6488 | T7550 | T7551 | compound | Hamamatsu,ORCA-ER |
R6489 | T7551 | T7548 | dobj | ORCA-ER,using |
R6490 | T7552 | T7547 | conj | charged,gathered |
R6491 | T7553 | T7555 | amod | coupled,camera |
R6492 | T7554 | T7555 | compound | device,camera |
R6493 | T7555 | T7552 | dobj | camera,charged |
R6494 | T7556 | T7564 | punct | (,driven |
R6495 | T7557 | T7564 | dep | Bridgewater,driven |
R6496 | T7558 | T7557 | punct | ",",Bridgewater |
R6497 | T7559 | T7560 | compound | New,Jersey |
R6498 | T7560 | T7557 | conj | Jersey,Bridgewater |
R6499 | T7561 | T7560 | punct | ",",Jersey |
R6500 | T7562 | T7560 | conj | USA,Jersey |
R6501 | T7563 | T7564 | punct | ),driven |
R6502 | T7564 | T7552 | advcl | driven,charged |
R6503 | T7565 | T7564 | agent | by,driven |
R6504 | T7566 | T7567 | compound | Openlab,software |
R6505 | T7567 | T7565 | pobj | software,by |
R6506 | T7568 | T7569 | punct | (,Improvision |
R6507 | T7569 | T7567 | appos | Improvision,software |
R6508 | T7570 | T7569 | punct | ",",Improvision |
R6509 | T7571 | T7569 | npadvmod | Coventry,Improvision |
R6510 | T7572 | T7571 | punct | ",",Coventry |
R6511 | T7573 | T7571 | appos | UK,Coventry |
R6512 | T7574 | T7571 | punct | ),Coventry |
R6513 | T7575 | T7547 | punct | .,gathered |
R6514 | T7576 | T7578 | nsubjpass | Photographs,taken |
R6515 | T7577 | T7578 | auxpass | were,taken |
R6516 | T7578 | T7578 | ROOT | taken,taken |
R6517 | T7579 | T7578 | prep | at,taken |
R6518 | T7580 | T7579 | pobj | 0,at |
R6519 | T7581 | T7580 | punct | ",",0 |
R6520 | T7582 | T7580 | appos | 30,0 |
R6521 | T7583 | T7580 | punct | ",",0 |
R6522 | T7584 | T7580 | appos | 60,0 |
R6523 | T7585 | T7584 | punct | ",",60 |
R6524 | T7586 | T7584 | conj | 120,60 |
R6525 | T7587 | T7578 | punct | ",",taken |
R6526 | T7588 | T7578 | cc | and,taken |
R6527 | T7589 | T7590 | nummod | 240,min |
R6528 | T7590 | T7578 | conj | min,taken |
R6529 | T7591 | T7578 | punct | .,taken |
R6614 | T7691 | T7693 | compound | Densitometric,Densitometry |
R6615 | T7692 | T7693 | compound | Analysis,Densitometry |
R6616 | T7693 | T7698 | nsubjpass | Densitometry,performed |
R6617 | T7694 | T7693 | prep | of,Densitometry |
R6618 | T7695 | T7696 | compound | ECL,immunoblots |
R6619 | T7696 | T7694 | pobj | immunoblots,of |
R6620 | T7697 | T7698 | auxpass | was,performed |
R6621 | T7698 | T7698 | ROOT | performed,performed |
R6622 | T7699 | T7698 | advcl | using,performed |
R6623 | T7700 | T7703 | nmod | Gelworks,software |
R6624 | T7701 | T7703 | nmod | ID,software |
R6625 | T7702 | T7703 | amod | intermediate,software |
R6626 | T7703 | T7699 | dobj | software,using |
R6627 | T7704 | T7706 | punct | (,Products |
R6628 | T7705 | T7706 | compound | Ultraviolet,Products |
R6629 | T7706 | T7703 | appos | Products,software |
R6630 | T7707 | T7706 | punct | ",",Products |
R6631 | T7708 | T7706 | conj | Cambridgeshire,Products |
R6632 | T7709 | T7708 | punct | ",",Cambridgeshire |
R6633 | T7710 | T7708 | appos | UK,Cambridgeshire |
R6634 | T7711 | T7708 | punct | ),Cambridgeshire |
R6635 | T7712 | T7698 | punct | .,performed |
R6636 | T7713 | T7717 | advmod | Briefly,scanned |
R6637 | T7714 | T7717 | punct | ",",scanned |
R6638 | T7715 | T7717 | nsubjpass | immunoblots,scanned |
R6639 | T7716 | T7717 | auxpass | were,scanned |
R6640 | T7717 | T7717 | ROOT | scanned,scanned |
R6641 | T7718 | T7717 | cc | and,scanned |
R6642 | T7719 | T7721 | nsubjpass | gates,drawn |
R6643 | T7720 | T7721 | auxpass | were,drawn |
R6644 | T7721 | T7717 | conj | drawn,scanned |
R6645 | T7722 | T7721 | advmod | tightly,drawn |
R6646 | T7723 | T7721 | prep | around,drawn |
R6647 | T7724 | T7725 | det | each,band |
R6648 | T7725 | T7723 | pobj | band,around |
R6649 | T7726 | T7721 | punct | .,drawn |
R6650 | T7727 | T7728 | compound | Background,values |
R6651 | T7728 | T7733 | nsubjpass | values,subtracted |
R6652 | T7729 | T7728 | prep | from,values |
R6653 | T7730 | T7731 | det | each,lane |
R6654 | T7731 | T7729 | pobj | lane,from |
R6655 | T7732 | T7733 | auxpass | were,subtracted |
R6656 | T7733 | T7733 | ROOT | subtracted,subtracted |
R6657 | T7734 | T7735 | aux | to,normalize |
R6658 | T7735 | T7733 | xcomp | normalize,subtracted |
R6659 | T7736 | T7737 | det | each,measurement |
R6660 | T7737 | T7735 | dobj | measurement,normalize |
R6661 | T7738 | T7733 | punct | .,subtracted |
R6662 | T7739 | T7740 | det | The,bands |
R6663 | T7740 | T7742 | nsubjpass | bands,quantified |
R6664 | T7741 | T7742 | auxpass | were,quantified |
R6665 | T7742 | T7742 | ROOT | quantified,quantified |
R6666 | T7743 | T7742 | advcl | using,quantified |
R6667 | T7744 | T7746 | det | the,software |
R6668 | T7745 | T7746 | compound | Gelworks,software |
R6669 | T7746 | T7743 | dobj | software,using |
R6670 | T7747 | T7742 | punct | .,quantified |
R6671 | T7748 | T7750 | det | All,blots |
R6672 | T7749 | T7750 | amod | Western,blots |
R6673 | T7750 | T7752 | nsubjpass | blots,exposed |
R6674 | T7751 | T7752 | auxpass | were,exposed |
R6675 | T7752 | T7752 | ROOT | exposed,exposed |
R6676 | T7753 | T7752 | prep | to,exposed |
R6677 | T7754 | T7753 | pobj | film,to |
R6678 | T7755 | T7754 | prep | for,film |
R6679 | T7756 | T7757 | amod | varying,lengths |
R6680 | T7757 | T7755 | pobj | lengths,for |
R6681 | T7758 | T7757 | prep | of,lengths |
R6682 | T7759 | T7758 | pobj | time,of |
R6683 | T7760 | T7752 | punct | ",",exposed |
R6684 | T7761 | T7752 | cc | and,exposed |
R6685 | T7762 | T7763 | advmod | only,films |
R6686 | T7763 | T7770 | nsubjpass | films,selected |
R6687 | T7764 | T7763 | acl | generating,films |
R6688 | T7765 | T7766 | amod | subsaturating,levels |
R6689 | T7766 | T7764 | dobj | levels,generating |
R6690 | T7767 | T7766 | prep | of,levels |
R6691 | T7768 | T7767 | pobj | intensity,of |
R6692 | T7769 | T7770 | auxpass | were,selected |
R6693 | T7770 | T7752 | conj | selected,exposed |
R6694 | T7771 | T7770 | prep | for,selected |
R6695 | T7772 | T7773 | amod | densitometric,evaluation |
R6696 | T7773 | T7771 | pobj | evaluation,for |
R6697 | T7774 | T7770 | punct | .,selected |
R6852 | T7934 | T7935 | compound | Statistical,Analysis |
R6853 | T7935 | T7936 | compound | Analysis,Data |
R6854 | T7936 | T7944 | nsubjpass | Data,presented |
R6855 | T7937 | T7936 | prep | from,Data |
R6856 | T7938 | T7942 | nummod | three,experiments |
R6857 | T7939 | T7938 | cc | or,three |
R6858 | T7940 | T7938 | conj | more,three |
R6859 | T7941 | T7942 | amod | independent,experiments |
R6860 | T7942 | T7937 | pobj | experiments,from |
R6861 | T7943 | T7944 | auxpass | are,presented |
R6862 | T7944 | T7944 | ROOT | presented,presented |
R6863 | T7945 | T7944 | prep | as,presented |
R6864 | T7946 | T7950 | det | the,error |
R6865 | T7947 | T7950 | amod | mean,error |
R6866 | T7948 | T7950 | compound | ±,error |
R6867 | T7949 | T7950 | compound | standard,error |
R6868 | T7950 | T7945 | pobj | error,as |
R6869 | T7951 | T7950 | prep | of,error |
R6870 | T7952 | T7953 | det | the,mean |
R6871 | T7953 | T7951 | pobj | mean,of |
R6872 | T7954 | T7955 | punct | (,SEM |
R6873 | T7955 | T7953 | appos | SEM,mean |
R6874 | T7956 | T7955 | punct | ),SEM |
R6875 | T7957 | T7950 | punct | ",",error |
R6876 | T7958 | T7950 | prep | except,error |
R6877 | T7959 | T7960 | advmod | where,stated |
R6878 | T7960 | T7958 | pcomp | stated,except |
R6879 | T7961 | T7944 | cc | and,presented |
R6880 | T7962 | T7963 | auxpass | were,compared |
R6881 | T7963 | T7944 | conj | compared,presented |
R6882 | T7964 | T7963 | advcl | using,compared |
R6930 | T8012 | T8009 | dobj | test,signed |
R6931 | T8013 | T8009 | punct | .,signed |
R6932 | T8014 | T8019 | nsubjpass | Data,presented |
R6933 | T8015 | T8014 | prep | from,Data |
R6934 | T8016 | T8017 | det | this,analysis |
R6935 | T8017 | T8015 | pobj | analysis,from |
R6936 | T8018 | T8019 | auxpass | are,presented |
R6937 | T8019 | T8019 | ROOT | presented,presented |
R6938 | T8020 | T8019 | prep | as,presented |
R6939 | T8021 | T8023 | det | a,plot |
R6940 | T8022 | T8023 | compound | box-and-whiskers,plot |
R6941 | T8023 | T8020 | pobj | plot,as |
R6942 | T8024 | T8019 | punct | .,presented |
R6943 | T8025 | T8027 | poss | Friedman,test |
R6944 | T8026 | T8025 | case | 's,Friedman |
R6945 | T8027 | T8029 | nsubjpass | test,used |
R6946 | T8028 | T8029 | auxpass | was,used |
R6947 | T8029 | T8029 | ROOT | used,used |
R6948 | T8030 | T8035 | mark | as,obtained |
R6949 | T8031 | T8033 | nummod | three,measures |
R6950 | T8032 | T8033 | amod | matched,measures |
R6951 | T8033 | T8035 | nsubjpass | measures,obtained |
R6952 | T8034 | T8035 | auxpass | were,obtained |
R6953 | T8035 | T8029 | advcl | obtained,used |
R6954 | T8036 | T8035 | advcl | using,obtained |
R6955 | T8037 | T8036 | dobj | placebo,using |
R6956 | T8038 | T8037 | punct | ",",placebo |
R6957 | T8039 | T8040 | nummod | 100,µg |
R6958 | T8040 | T8037 | conj | µg,placebo |
R6959 | T8041 | T8040 | punct | ",",µg |
R6960 | T8042 | T8040 | cc | and,µg |
R6986 | T8068 | T8069 | amod | limited,numbers |
R6987 | T8069 | T8065 | pobj | numbers,due |
R6988 | T8070 | T8069 | prep | of,numbers |
R6989 | T8071 | T8070 | pobj | participants,of |
R6990 | T8072 | T8071 | acl | analysed,participants |
R6991 | T8073 | T8061 | punct | (,distribution |
R6992 | T8074 | T8061 | appos | seven,distribution |
R6993 | T8075 | T8061 | punct | ),distribution |
R6994 | T8076 | T8058 | punct | .,assume |
R6995 | T8077 | T8079 | det | The,hypothesis |
R6996 | T8078 | T8079 | amod | null,hypothesis |
R6997 | T8079 | T8081 | nsubjpass | hypothesis,rejected |
R6998 | T8080 | T8081 | auxpass | was,rejected |
R6999 | T8081 | T8081 | ROOT | rejected,rejected |
R7000 | T8082 | T8081 | prep | at,rejected |
R7001 | T8083 | T8084 | compound | p,< |
R7002 | T8084 | T8085 | compound | <,0.05 |
R7003 | T8085 | T8082 | pobj | 0.05,at |
R7004 | T8086 | T8081 | punct | .,rejected |
R7296 | T8451 | T8452 | det | The,Effect |
R7297 | T8452 | T8463 | nsubj | Effect,are |
R7298 | T8453 | T8452 | prep | of,Effect |
R7299 | T8454 | T8453 | pobj | Corticosteroids,of |
R7300 | T8455 | T8452 | prep | on,Effect |
R7301 | T8456 | T8458 | compound | GATA-3,Translocation |
R7302 | T8457 | T8458 | compound | Nuclear,Translocation |
R7303 | T8458 | T8455 | pobj | Translocation,on |
R7304 | T8459 | T8458 | cc | and,Translocation |
R7305 | T8460 | T8462 | compound | IL-4,Corticosteroids |
R7306 | T8461 | T8462 | compound | mRNA,Corticosteroids |
R7307 | T8462 | T8458 | conj | Corticosteroids,Translocation |
R7308 | T8463 | T8463 | ROOT | are,are |
R7309 | T8464 | T8463 | acomp | effective,are |
R7310 | T8465 | T8464 | prep | in,effective |
R7311 | T8466 | T8465 | pcomp | inhibiting,in |
R7312 | T8467 | T8470 | amod | GATA-3-regulated,expression |
R7313 | T8468 | T8469 | compound | IL-4,gene |
R7314 | T8469 | T8470 | compound | gene,expression |
R7315 | T8470 | T8466 | dobj | expression,inhibiting |
R7316 | T8471 | T8466 | prep | in,inhibiting |
R7317 | T8472 | T8471 | pobj | vitro,in |
R7318 | T8473 | T8471 | cc | and,in |
R7319 | T8474 | T8471 | conj | in,in |
R7320 | T8475 | T8474 | pobj | vivo,in |
R7321 | T8476 | T8478 | nmod | [,] |
R7322 | T8477 | T8478 | nummod | 32,] |
R7323 | T8478 | T8463 | attr | ],are |
R7324 | T8479 | T8463 | punct | .,are |
R7325 | T8480 | T8482 | nsubj | We,investigated |
R7326 | T8481 | T8482 | advmod | therefore,investigated |
R7327 | T8482 | T8482 | ROOT | investigated,investigated |
R7328 | T8483 | T8485 | mark | whether,affect |
R7329 | T8484 | T8485 | nsubj | corticosteroids,affect |
R7347 | T8502 | T8502 | ROOT | resulted,resulted |
R7348 | T8503 | T8502 | prep | in,resulted |
R7349 | T8504 | T8508 | det | a,translocation |
R7350 | T8505 | T8508 | amod | rapid,translocation |
R7351 | T8506 | T8508 | nmod | cytoplasmic/nuclear,translocation |
R7352 | T8507 | T8508 | compound | GATA-3,translocation |
R7353 | T8508 | T8503 | pobj | translocation,in |
R7354 | T8509 | T8510 | punct | (,Figure |
R7355 | T8510 | T8511 | nmod | Figure,1A |
R7356 | T8511 | T8508 | appos | 1A,translocation |
R7357 | T8512 | T8508 | punct | ),translocation |
R7358 | T8513 | T8502 | punct | ",",resulted |
R7359 | T8514 | T8502 | advcl | confirming,resulted |
R7360 | T8515 | T8517 | poss | our,results |
R7361 | T8516 | T8517 | amod | previous,results |
R7362 | T8517 | T8514 | dobj | results,confirming |
R7363 | T8518 | T8520 | nmod | [,] |
R7364 | T8519 | T8520 | nummod | 12,] |
R7365 | T8520 | T8517 | appos | ],results |
R7366 | T8521 | T8502 | punct | .,resulted |
R7367 | T8522 | T8524 | nsubj | We,confirmed |
R7368 | T8523 | T8524 | advmod | also,confirmed |
R7369 | T8524 | T8524 | ROOT | confirmed,confirmed |
R7370 | T8525 | T8527 | det | a,separation |
R7371 | T8526 | T8527 | amod | clear,separation |
R7372 | T8527 | T8524 | dobj | separation,confirmed |
R7373 | T8528 | T8527 | prep | of,separation |
R7374 | T8529 | T8532 | amod | nuclear,fractions |
R7375 | T8530 | T8529 | cc | and,nuclear |
R7376 | T8531 | T8529 | conj | cytosolic,nuclear |
R7377 | T8532 | T8528 | pobj | fractions,of |
R7378 | T8533 | T8534 | mark | as,indicated |
R7379 | T8534 | T8527 | advcl | indicated,separation |
R7380 | T8535 | T8534 | agent | by,indicated |
R7381 | T8536 | T8535 | pobj | histone,by |
R7382 | T8537 | T8536 | nummod | H1,histone |
R7383 | T8538 | T8536 | cc | and,histone |
R7384 | T8539 | T8540 | nummod | MEK-1,markers |
R7385 | T8540 | T8536 | conj | markers,histone |
R7386 | T8541 | T8543 | punct | (,1B |
R7387 | T8542 | T8543 | compound | Figure,1B |
R7388 | T8543 | T8540 | appos | 1B,markers |
R7389 | T8544 | T8543 | punct | ),1B |
R7390 | T8545 | T8524 | punct | .,confirmed |
R7391 | T8546 | T8550 | det | The,FP |
R7392 | T8547 | T8550 | amod | potent,FP |
R7393 | T8548 | T8550 | amod | topical,FP |
R7394 | T8549 | T8550 | amod | corticosteroid,FP |
R7395 | T8550 | T8551 | nsubj | FP,caused |
R7396 | T8551 | T8551 | ROOT | caused,caused |
R7397 | T8552 | T8553 | amod | sustained,loss |
R7398 | T8553 | T8551 | dobj | loss,caused |
R7399 | T8554 | T8553 | prep | of,loss |
R7400 | T8555 | T8557 | amod | nuclear,expression |
R7401 | T8556 | T8557 | amod | GATA-3,expression |
R7402 | T8557 | T8554 | pobj | expression,of |
R7403 | T8558 | T8557 | cc | and,expression |
R7404 | T8559 | T8560 | amod | cytoplasmic,retention |
R7405 | T8560 | T8557 | conj | retention,expression |
R7406 | T8561 | T8557 | prep | of,expression |
R7407 | T8562 | T8561 | pobj | GATA-3,of |
R7408 | T8563 | T8553 | prep | at,loss |
R7409 | T8564 | T8563 | pobj | concentrations,at |
R7410 | T8565 | T8564 | acl | ranging,concentrations |
R7411 | T8566 | T8565 | prep | from,ranging |
R7412 | T8567 | T8568 | nummod | 10,− |
R7413 | T8568 | T8566 | pobj | −,from |
R7414 | T8569 | T8571 | quantmod | 12,10 |
R7415 | T8570 | T8571 | quantmod | to,10 |
R7416 | T8571 | T8572 | nummod | 10,− |
R7417 | T8572 | T8574 | nummod | −,M |
R7418 | T8573 | T8574 | nummod | 8,M |
R7419 | T8574 | T8566 | pobj | M,from |
R7420 | T8575 | T8574 | punct | ",",M |
R7421 | T8576 | T8577 | nsubj | which,cover |
R7422 | T8577 | T8574 | relcl | cover,M |
R7423 | T8578 | T8580 | det | the,range |
R7424 | T8579 | T8580 | amod | therapeutic,range |
R7425 | T8580 | T8577 | dobj | range,cover |
R7426 | T8581 | T8583 | nmod | [,] |
R7427 | T8582 | T8583 | nummod | 37,] |
R7428 | T8583 | T8580 | appos | ],range |
R7429 | T8584 | T8551 | punct | .,caused |
R7430 | T8585 | T8586 | det | This,effect |
R7431 | T8586 | T8587 | nsubj | effect,was |
R7432 | T8587 | T8587 | ROOT | was,was |
R7433 | T8588 | T8587 | attr | concentration,was |
R7434 | T8589 | T8588 | punct | -,concentration |
R7435 | T8590 | T8588 | cc | and,concentration |
R7436 | T8591 | T8588 | conj | time-dependent,concentration |
R7437 | T8592 | T8587 | punct | ",",was |
R7438 | T8593 | T8587 | prep | with,was |
R7439 | T8594 | T8596 | det | a,effect |
R7440 | T8595 | T8596 | amod | peak,effect |
R7441 | T8596 | T8593 | pobj | effect,with |
R7442 | T8597 | T8596 | prep | of,effect |
R7443 | T8598 | T8597 | pobj | 11.6-fold,of |
R7444 | T8599 | T8596 | prep | at,effect |
R7445 | T8600 | T8601 | nummod | 30,min |
R7446 | T8601 | T8599 | pobj | min,at |
R7447 | T8602 | T8601 | prep | at,min |
R7448 | T8603 | T8604 | det | a,concentration |
R7449 | T8604 | T8602 | pobj | concentration,at |
R7450 | T8605 | T8604 | prep | of,concentration |
R7451 | T8606 | T8608 | quantmod | 10,8 |
R7452 | T8607 | T8608 | quantmod | −,8 |
R7453 | T8608 | T8605 | pobj | 8,of |
R7454 | T8609 | T8608 | quantmod | M,8 |
R7455 | T8610 | T8612 | punct | (,1C |
R7456 | T8611 | T8612 | compound | Figure,1C |
R7457 | T8612 | T8609 | appos | 1C,M |
R7458 | T8613 | T8612 | punct | ),1C |
R7459 | T8614 | T8587 | cc | and,was |
R7460 | T8615 | T8616 | auxpass | was,associated |
R7461 | T8616 | T8624 | parataxis | associated,stimulated |
R7462 | T8617 | T8616 | prep | with,associated |
R7463 | T8618 | T8619 | amod | marked,reductions |
R7464 | T8619 | T8617 | pobj | reductions,with |
R7465 | T8620 | T8619 | prep | in,reductions |
R7466 | T8621 | T8622 | amod | anti-CD3,/ |
R7467 | T8622 | T8620 | pobj | /,in |
R7468 | T8623 | T8622 | nummod | CD28,/ |
R7469 | T8624 | T8587 | conj | stimulated,was |
R7470 | T8625 | T8624 | dobj | IL-4,stimulated |
R7471 | T8626 | T8625 | cc | and,IL-4 |
R7472 | T8627 | T8625 | conj | IL-5,IL-4 |
R7473 | T8628 | T8629 | compound | mRNA,expression |
R7474 | T8629 | T8625 | conj | expression,IL-4 |
R7475 | T8630 | T8631 | punct | (,Figure |
R7476 | T8631 | T8629 | appos | Figure,expression |
R7477 | T8632 | T8631 | nummod | 1D,Figure |
R7478 | T8633 | T8631 | punct | ),Figure |
R7479 | T8634 | T8631 | cc | and,Figure |
R7480 | T8635 | T8636 | det | a,loss |
R7481 | T8636 | T8625 | appos | loss,IL-4 |
R7487 | T8642 | T8644 | amod | native,promoter |
R7849 | T9110 | T9111 | nsubj | GR,Competes |
R7850 | T9111 | T9111 | ROOT | Competes,Competes |
R7851 | T9112 | T9111 | prep | with,Competes |
R7852 | T9113 | T9112 | pobj | GATA-3,with |
R7853 | T9114 | T9113 | prep | for,GATA-3 |
R7854 | T9115 | T9114 | pobj | Importin-α,for |
R7855 | T9116 | T9117 | nsubj | We,confirmed |
R7856 | T9117 | T9111 | ccomp | confirmed,Competes |
R7857 | T9118 | T9117 | cc | and,confirmed |
R7858 | T9119 | T9117 | conj | extended,confirmed |
R7859 | T9120 | T9121 | amod | previous,data |
R7860 | T9121 | T9119 | dobj | data,extended |
R7861 | T9122 | T9124 | nmod | [,] |
R7862 | T9123 | T9124 | nummod | 20,] |
R7863 | T9124 | T9126 | nsubj | ],show |
R7864 | T9125 | T9126 | aux | to,show |
R7865 | T9126 | T9119 | advcl | show,extended |
R7866 | T9127 | T9126 | dobj | that,show |
R7867 | T9128 | T9129 | compound | ligand-activated,GR |
R7868 | T9129 | T9127 | nsubj | GR,that |
R7869 | T9130 | T9132 | advmod | as,as |
R7870 | T9131 | T9132 | advmod | well,as |
R7871 | T9132 | T9129 | cc | as,GR |
R7872 | T9133 | T9134 | amod | GATA-3,uses |
R7873 | T9134 | T9129 | conj | uses,GR |
R7874 | T9135 | T9129 | conj | importin-α,GR |
R7875 | T9136 | T9135 | prep | for,importin-α |
R7876 | T9137 | T9145 | poss | its,) |
R7877 | T9138 | T9139 | amod | nuclear,import |
R7878 | T9139 | T9145 | nmod | import,) |
R7879 | T9140 | T9141 | punct | (,Figure |
R7880 | T9141 | T9145 | nmod | Figure,) |
R7881 | T9142 | T9141 | nummod | 2A,Figure |
R7882 | T9143 | T9141 | cc | and,Figure |
R7883 | T9144 | T9141 | conj | 2B,Figure |
R7884 | T9145 | T9135 | punct | ),importin-α |
R7885 | T9146 | T9111 | punct | .,Competes |
R7886 | T9147 | T9148 | det | This,interaction |
R7887 | T9148 | T9153 | nsubj | interaction,was |
R7888 | T9149 | T9148 | prep | between,interaction |
R7889 | T9150 | T9149 | pobj | GR,between |
R7890 | T9151 | T9150 | cc | and,GR |
R7891 | T9152 | T9150 | conj | importin-α,GR |
R7892 | T9153 | T9153 | ROOT | was,was |
R7893 | T9154 | T9153 | acomp | significant,was |
R7894 | T9155 | T9153 | prep | at,was |
R7895 | T9156 | T9155 | pobj | concentrations,at |
R7896 | T9157 | T9158 | advmod | as,low |
R7897 | T9158 | T9156 | amod | low,concentrations |
R7898 | T9159 | T9158 | prep | as,low |
R7899 | T9160 | T9161 | nummod | 10,− |
R7900 | T9161 | T9159 | pobj | −,as |
R7901 | T9162 | T9163 | nummod | 12,M |
R7902 | T9163 | T9158 | npadvmod | M,low |
R7903 | T9164 | T9153 | cc | and,was |
R7904 | T9165 | T9166 | auxpass | was,maximal |
R7905 | T9166 | T9153 | conj | maximal,was |
R7906 | T9167 | T9166 | prep | with,maximal |
R7907 | T9168 | T9170 | quantmod | 10,8 |
R7908 | T9169 | T9170 | quantmod | −,8 |
R7909 | T9170 | T9167 | pobj | 8,with |
R7910 | T9171 | T9172 | compound | M,FP |
R7911 | T9172 | T9170 | quantmod | FP,8 |
R7912 | T9173 | T9166 | punct | .,maximal |
R7913 | T9174 | T9177 | amod | Subsequent,translocation |
R7914 | T9175 | T9177 | nmod | GR,translocation |
R7915 | T9176 | T9177 | amod | nuclear,translocation |
R7916 | T9177 | T9178 | nsubj | translocation,was |
R7917 | T9178 | T9178 | ROOT | was,was |
R7918 | T9179 | T9178 | acomp | rapid,was |
R7919 | T9180 | T9178 | cc | and,was |
R7920 | T9181 | T9178 | conj | sustained,was |
R7921 | T9182 | T9181 | prep | at,sustained |
R7922 | T9183 | T9184 | amod | significant,levels |
R7923 | T9184 | T9182 | pobj | levels,at |
R7924 | T9185 | T9181 | prep | for,sustained |
R7925 | T9186 | T9187 | advmod | at,least |
R7926 | T9187 | T9188 | advmod | least,14 |
R7927 | T9188 | T9189 | nummod | 14,h |
R7928 | T9189 | T9185 | pobj | h,for |
R7929 | T9190 | T9192 | punct | (,2B |
R7930 | T9191 | T9192 | compound | Figure,2B |
R7931 | T9192 | T9189 | appos | 2B,h |
R7932 | T9193 | T9192 | punct | ),2B |
R7933 | T9194 | T9178 | punct | .,was |
R7934 | T9195 | T9199 | advcl | Using,showed |
R7935 | T9196 | T9197 | amod | IP-Western,blotting |
R7936 | T9197 | T9195 | dobj | blotting,Using |
R7937 | T9198 | T9199 | nsubj | we,showed |
R7938 | T9199 | T9199 | ROOT | showed,showed |
R7939 | T9200 | T9210 | mark | that,decreased |
R7940 | T9201 | T9210 | nsubj | FP,decreased |
R7941 | T9202 | T9201 | prep | at,FP |
R7942 | T9203 | T9205 | nummod | 10,12 |
R7943 | T9204 | T9205 | nummod | −,12 |
R7944 | T9205 | T9202 | pobj | 12,at |
R7945 | T9206 | T9209 | nummod | 10,M |
R7946 | T9207 | T9209 | nmod | −,M |
R7947 | T9208 | T9207 | nummod | 8,− |
R7948 | T9209 | T9201 | conj | M,FP |
R7949 | T9210 | T9199 | ccomp | decreased,showed |
R7950 | T9211 | T9212 | det | the,association |
R7951 | T9212 | T9210 | dobj | association,decreased |
R7952 | T9213 | T9212 | prep | between,association |
R7953 | T9214 | T9213 | pobj | GATA-3,between |
R7954 | T9215 | T9214 | cc | and,GATA-3 |
R7955 | T9216 | T9214 | conj | importin-α,GATA-3 |
R7956 | T9217 | T9212 | acl | induced,association |
R7957 | T9218 | T9217 | agent | by,induced |
R7958 | T9219 | T9222 | amod | anti-CD3,stimulation |
R7959 | T9220 | T9222 | nmod | /,stimulation |
R7960 | T9221 | T9222 | nummod | CD28,stimulation |
R7961 | T9222 | T9218 | pobj | stimulation,by |
R7962 | T9223 | T9217 | prep | in,induced |
R7963 | T9224 | T9226 | det | a,manner |
R7964 | T9225 | T9226 | amod | concentration-dependent,manner |
R7965 | T9226 | T9223 | pobj | manner,in |
R7966 | T9227 | T9228 | punct | (,Figure |
R7967 | T9228 | T9226 | appos | Figure,manner |
R7968 | T9229 | T9228 | npadvmod | 2C,Figure |
R7969 | T9230 | T9228 | punct | ),Figure |
R7970 | T9231 | T9199 | punct | .,showed |
R7971 | T9232 | T9242 | prep | In,demonstrated |
R7972 | T9233 | T9232 | pobj | addition,In |
R7973 | T9234 | T9242 | punct | ",",demonstrated |
R7974 | T9235 | T9242 | advcl | using,demonstrated |
R7975 | T9236 | T9237 | amod | GFP-labelled,GATA-3 |
R7976 | T9237 | T9235 | dobj | GATA-3,using |
R7977 | T9238 | T9237 | cc | and,GATA-3 |
R7978 | T9239 | T9240 | amod | confocal,microscopy |
R7979 | T9240 | T9237 | conj | microscopy,GATA-3 |
R7980 | T9241 | T9242 | nsubj | we,demonstrated |
R7981 | T9242 | T9242 | ROOT | demonstrated,demonstrated |
R7982 | T9243 | T9256 | mark | that,attenuated |
R7983 | T9244 | T9246 | amod | GATA-3,import |
R7984 | T9245 | T9246 | amod | nuclear,import |
R7985 | T9246 | T9256 | nsubjpass | import,attenuated |
R7986 | T9247 | T9246 | prep | following,import |
R7987 | T9248 | T9249 | compound | anti-CD3,/ |
R7988 | T9249 | T9247 | dobj | /,following |
R7989 | T9250 | T9251 | nummod | CD28,stimulation |
R7990 | T9251 | T9246 | appos | stimulation,import |
R7991 | T9252 | T9251 | prep | for,stimulation |
R7992 | T9253 | T9254 | nummod | 30,min |
R7993 | T9254 | T9252 | pobj | min,for |
R7994 | T9255 | T9256 | auxpass | was,attenuated |
R7995 | T9256 | T9242 | ccomp | attenuated,demonstrated |
R7996 | T9257 | T9256 | agent | by,attenuated |
R7997 | T9258 | T9257 | pobj | pretreatment,by |
R7998 | T9259 | T9256 | prep | with,attenuated |
R7999 | T9260 | T9259 | pobj | FP,with |
R8000 | T9261 | T9260 | punct | (,FP |
R8001 | T9262 | T9263 | nummod | 10,− |
R8002 | T9263 | T9265 | npadvmod | −,M |
R8003 | T9264 | T9265 | nummod | 8,M |
R8004 | T9265 | T9260 | appos | M,FP |
R8005 | T9266 | T9260 | punct | ),FP |
R8006 | T9267 | T9268 | punct | (,Figure |
R8007 | T9268 | T9260 | appos | Figure,FP |
R8008 | T9269 | T9268 | nummod | 2D,Figure |
R8009 | T9270 | T9242 | punct | ),demonstrated |
R8010 | T9271 | T9242 | punct | .,demonstrated |
R8744 | T10194 | T10198 | nsubj | Effect,inhibits |
R8745 | T10195 | T10194 | prep | on,Effect |
R8746 | T10196 | T10197 | compound | MKP-1,Dexamethasone |
R8747 | T10197 | T10195 | pobj | Dexamethasone,on |
R8748 | T10198 | T10198 | ROOT | inhibits,inhibits |
R8749 | T10199 | T10201 | nummod | p38,function |
R8750 | T10200 | T10201 | compound | MAPK,function |
R8751 | T10201 | T10198 | dobj | function,inhibits |
R8752 | T10202 | T10201 | prep | in,function |
R8753 | T10203 | T10205 | det | a,type |
R8754 | T10204 | T10205 | compound | cell,type |
R8755 | T10205 | T10202 | pobj | type,in |
R8756 | T10206 | T10207 | amod | specific,manner |
R8757 | T10207 | T10201 | conj | manner,function |
R8758 | T10208 | T10198 | prep | through,inhibits |
R8759 | T10209 | T10211 | det | the,induction |
R8760 | T10210 | T10211 | amod | rapid,induction |
R8761 | T10211 | T10208 | pobj | induction,through |
R8762 | T10212 | T10211 | prep | of,induction |
R8763 | T10213 | T10215 | det | the,kinase |
R8764 | T10214 | T10215 | amod | dual,kinase |
R8765 | T10215 | T10212 | pobj | kinase,of |
R8766 | T10216 | T10217 | compound | phosphatase,MKP-1 |
R8767 | T10217 | T10215 | appos | MKP-1,kinase |
R8768 | T10218 | T10220 | punct | (,phosphatase-1 |
R8769 | T10219 | T10220 | compound | MAPK,phosphatase-1 |
R8770 | T10220 | T10217 | appos | phosphatase-1,MKP-1 |
R8771 | T10221 | T10220 | punct | ),phosphatase-1 |
R8772 | T10222 | T10217 | punct | ",",MKP-1 |
R8773 | T10223 | T10217 | cc | and,MKP-1 |
R8774 | T10224 | T10225 | det | this,effect |
R8775 | T10225 | T10226 | nsubj | effect,lasts |
R8776 | T10226 | T10215 | relcl | lasts,kinase |
R8777 | T10227 | T10226 | prep | for,lasts |
R8778 | T10228 | T10230 | quantmod | up,24 |
R8779 | T10229 | T10230 | quantmod | to,24 |
R8780 | T10230 | T10234 | nummod | 24,] |
R8781 | T10231 | T10232 | compound | h,[ |
R8782 | T10232 | T10234 | nmod | [,] |
R8783 | T10233 | T10232 | nummod | 28,[ |
R8784 | T10234 | T10227 | pobj | ],for |
R8785 | T10235 | T10198 | punct | .,inhibits |
R8786 | T10236 | T10243 | nmod | FP,treatment |
R8787 | T10237 | T10239 | punct | (,− |
R8788 | T10238 | T10239 | nummod | 10,− |
R8789 | T10239 | T10243 | nmod | −,treatment |
R8790 | T10240 | T10239 | nummod | 8,− |
R8791 | T10241 | T10239 | appos | M,− |
R8792 | T10242 | T10239 | punct | ),− |
R8793 | T10243 | T10255 | nsubj | treatment,decreased |
R8794 | T10244 | T10243 | prep | of,treatment |
R8795 | T10245 | T10246 | amod | HuT-78,cells |
R8796 | T10246 | T10244 | pobj | cells,of |
R8797 | T10247 | T10246 | acl | activated,cells |
R8798 | T10248 | T10247 | agent | by,activated |
R8799 | T10249 | T10250 | compound | anti-CD3,/ |
R8800 | T10250 | T10248 | pobj | /,by |
R8801 | T10251 | T10250 | nummod | CD28,/ |
R8802 | T10252 | T10247 | prep | in,activated |
R8803 | T10253 | T10252 | pobj | vitro,in |
R8804 | T10254 | T10255 | advmod | significantly,decreased |
R8805 | T10255 | T10255 | ROOT | decreased,decreased |
R8806 | T10256 | T10258 | nummod | p38,phosphorylation |
R8807 | T10257 | T10258 | compound | MAPK,phosphorylation |
R8808 | T10258 | T10255 | dobj | phosphorylation,decreased |
R8809 | T10259 | T10261 | punct | (,3A |
R8810 | T10260 | T10261 | compound | Figure,3A |
R8811 | T10261 | T10258 | appos | 3A,phosphorylation |
R8812 | T10262 | T10258 | punct | ),phosphorylation |
R8813 | T10263 | T10258 | cc | and,phosphorylation |
R8814 | T10264 | T10258 | conj | activity,phosphorylation |
R8815 | T10265 | T10255 | conj | measured,decreased |
R8816 | T10266 | T10265 | agent | by,measured |
R8817 | T10267 | T10266 | pobj | phosphorylation,by |
R8818 | T10268 | T10267 | prep | of,phosphorylation |
R8819 | T10269 | T10271 | det | the,target |
R8820 | T10270 | T10271 | amod | downstream,target |
R8821 | T10271 | T10268 | pobj | target,of |
R8822 | T10272 | T10271 | appos | ATF-2,target |
R8823 | T10273 | T10275 | punct | (,3B |
R8824 | T10274 | T10275 | compound | Figure,3B |
R8825 | T10275 | T10272 | appos | 3B,ATF-2 |
R8826 | T10276 | T10272 | punct | ),ATF-2 |
R8827 | T10277 | T10255 | punct | .,decreased |
R8828 | T10278 | T10279 | det | This,effect |
R8829 | T10279 | T10281 | nsubjpass | effect,detected |
R8830 | T10280 | T10281 | auxpass | was,detected |
R8831 | T10281 | T10281 | ROOT | detected,detected |
R8832 | T10282 | T10281 | prep | at,detected |
R8833 | T10283 | T10284 | nummod | 30,min |
R8834 | T10284 | T10282 | pobj | min,at |
R8835 | T10285 | T10281 | cc | and,detected |
R8836 | T10286 | T10281 | conj | lasted,detected |
R8837 | T10287 | T10286 | prep | for,lasted |
R8838 | T10288 | T10289 | advmod | at,least |
R8839 | T10289 | T10290 | advmod | least,14 |
R8840 | T10290 | T10291 | nummod | 14,h |
R8841 | T10291 | T10287 | pobj | h,for |
R8842 | T10292 | T10294 | punct | (,3B |
R8843 | T10293 | T10294 | compound | Figure,3B |
R8844 | T10294 | T10291 | appos | 3B,h |
R8845 | T10295 | T10291 | punct | ),h |
R8846 | T10296 | T10281 | punct | .,detected |
R8847 | T10297 | T10306 | nsubj | FP,reduced |
R8848 | T10298 | T10300 | punct | (,− |
R8849 | T10299 | T10300 | nummod | 10,− |
R8850 | T10300 | T10306 | nsubj | −,reduced |
R8851 | T10301 | T10300 | nummod | 8,− |
R8852 | T10302 | T10300 | appos | M,− |
R8853 | T10303 | T10300 | punct | ),− |
R8854 | T10304 | T10306 | advmod | also,reduced |
R8855 | T10305 | T10306 | advmod | significantly,reduced |
R8856 | T10306 | T10306 | ROOT | reduced,reduced |
R8857 | T10307 | T10309 | nmod | GATA-3,phosphorylation |
R8858 | T10308 | T10309 | compound | serine,phosphorylation |
R8859 | T10309 | T10306 | dobj | phosphorylation,reduced |
R8860 | T10310 | T10309 | acl | induced,phosphorylation |
R8861 | T10311 | T10310 | agent | by,induced |
R8862 | T10312 | T10315 | amod | anti-CD3,stimulation |
R8863 | T10313 | T10315 | nmod | /,stimulation |
R8864 | T10314 | T10315 | nummod | CD28,stimulation |
R8865 | T10315 | T10311 | pobj | stimulation,by |
R8866 | T10316 | T10315 | prep | in,stimulation |
R8867 | T10317 | T10319 | preconj | both,time |
R8868 | T10318 | T10319 | det | a,time |
R8869 | T10319 | T10316 | pobj | time,in |
R8870 | T10320 | T10319 | punct | -,time |
R8871 | T10321 | T10319 | cc | and,time |
R8872 | T10322 | T10323 | amod | concentration-dependent,manner |
R8873 | T10323 | T10319 | conj | manner,time |
R8874 | T10324 | T10326 | punct | (,3C |
R8875 | T10325 | T10326 | compound | Figure,3C |
R8876 | T10326 | T10323 | appos | 3C,manner |
R8877 | T10327 | T10326 | punct | ),3C |
R8878 | T10328 | T10306 | punct | .,reduced |
R8879 | T10329 | T10330 | det | This,reduction |
R8880 | T10330 | T10336 | nsubjpass | reduction,seen |
R8881 | T10331 | T10330 | prep | in,reduction |
R8882 | T10332 | T10333 | amod | GATA-3,phosphorylation |
R8883 | T10333 | T10331 | pobj | phosphorylation,in |
R8884 | T10334 | T10336 | auxpass | was,seen |
R8885 | T10335 | T10336 | advmod | also,seen |
R8886 | T10336 | T10336 | ROOT | seen,seen |
R8887 | T10337 | T10336 | prep | with,seen |
R8888 | T10338 | T10339 | amod | lower,concentrations |
R8889 | T10339 | T10337 | pobj | concentrations,with |
R8890 | T10340 | T10339 | prep | of,concentrations |
R8891 | T10341 | T10340 | pobj | FP,of |
R8892 | T10342 | T10336 | punct | .,seen |
R8893 | T10343 | T10344 | nsubj | We,found |
R8894 | T10344 | T10344 | ROOT | found,found |
R8895 | T10345 | T10348 | mark | that,induced |
R8896 | T10346 | T10348 | nsubj | FP,induced |
R8897 | T10347 | T10348 | advmod | significantly,induced |
R8898 | T10348 | T10344 | ccomp | induced,found |
R8899 | T10349 | T10350 | compound | MKP-1,mRNA |
R8900 | T10350 | T10348 | dobj | mRNA,induced |
R8901 | T10351 | T10348 | prep | in,induced |
R8902 | T10352 | T10354 | predet | both,time |
R8903 | T10353 | T10354 | det | a,time |
R8904 | T10354 | T10351 | pobj | time,in |
R8905 | T10355 | T10348 | punct | -,induced |
R8906 | T10356 | T10348 | cc | and,induced |
R8907 | T10357 | T10358 | amod | concentration-dependent,manner |
R8908 | T10358 | T10348 | conj | manner,induced |
R8909 | T10359 | T10358 | punct | ",",manner |
R8910 | T10360 | T10358 | acl | reaching,manner |
R8911 | T10361 | T10362 | det | a,plateau |
R8912 | T10362 | T10360 | dobj | plateau,reaching |
R8913 | T10363 | T10360 | prep | at,reaching |
R8914 | T10364 | T10365 | nummod | 10,− |
R8915 | T10365 | T10367 | compound | −,M |
R8916 | T10366 | T10367 | compound | 8,M |
R8917 | T10367 | T10363 | pobj | M,at |
R8918 | T10368 | T10360 | prep | after,reaching |
R8919 | T10369 | T10370 | nummod | 10,min |
R8920 | T10370 | T10368 | pobj | min,after |
R8921 | T10371 | T10372 | punct | (,Figure |
R8922 | T10372 | T10376 | nmod | Figure,) |
R8923 | T10373 | T10372 | nummod | 3D,Figure |
R8924 | T10374 | T10372 | cc | and,Figure |
R8925 | T10375 | T10372 | conj | 3E,Figure |
R8926 | T10376 | T10358 | punct | ),manner |
R8927 | T10377 | T10344 | punct | .,found |
R8928 | T10378 | T10396 | advmod | However,seen |
R8929 | T10379 | T10396 | punct | ",",seen |
R8930 | T10380 | T10381 | det | the,effects |
R8931 | T10381 | T10396 | nsubjpass | effects,seen |
R8932 | T10382 | T10381 | prep | of,effects |
R8933 | T10383 | T10382 | pobj | FP,of |
R8934 | T10384 | T10381 | prep | on,effects |
R8935 | T10385 | T10387 | nmod | GATA-3,import |
R8936 | T10386 | T10387 | amod | nuclear,import |
R8937 | T10387 | T10384 | pobj | import,on |
R8938 | T10388 | T10387 | punct | ",",import |
R8939 | T10389 | T10390 | amod | importin-α,association |
R8940 | T10390 | T10387 | conj | association,import |
R8941 | T10391 | T10390 | cc | and,association |
R8942 | T10392 | T10390 | conj | IL-4,association |
R8943 | T10393 | T10394 | compound | mRNA,expression |
R8944 | T10394 | T10390 | conj | expression,association |
R8945 | T10395 | T10396 | auxpass | are,seen |
R8946 | T10396 | T10396 | ROOT | seen,seen |
R8947 | T10397 | T10396 | prep | at,seen |
R8948 | T10398 | T10400 | nummod | "10,000-fold",concentrations |
R8949 | T10399 | T10400 | amod | lower,concentrations |
R8950 | T10400 | T10397 | pobj | concentrations,at |
R8951 | T10401 | T10400 | punct | (,concentrations |
R8952 | T10402 | T10403 | nummod | 10,− |
R8953 | T10403 | T10400 | appos | −,concentrations |
R8954 | T10404 | T10405 | nummod | 12,M |
R8955 | T10405 | T10403 | appos | M,− |
R8956 | T10406 | T10403 | punct | ",",− |
R8957 | T10407 | T10408 | compound | see,Figure |
R8958 | T10408 | T10400 | appos | Figure,concentrations |
R8959 | T10409 | T10408 | nummod | 2,Figure |
R8960 | T10410 | T10408 | punct | ),Figure |
R8961 | T10411 | T10396 | punct | .,seen |
R8962 | T10412 | T10434 | advcl | Using,demonstrated |
R8963 | T10413 | T10417 | det | an,assay |
R8964 | T10414 | T10417 | nmod | in,assay |
R8965 | T10415 | T10416 | amod | vitro,competition |
R8966 | T10416 | T10417 | compound | competition,assay |
R8967 | T10417 | T10412 | dobj | assay,Using |
R8968 | T10418 | T10420 | punct | (,4A |
R8969 | T10419 | T10420 | compound | Figure,4A |
R8970 | T10420 | T10417 | appos | 4A,assay |
R8971 | T10421 | T10420 | punct | ),4A |
R8989 | T10439 | T10434 | conj | increased,demonstrated |
R8990 | T10440 | T10441 | amod | GR-importin-α,association |
R8991 | T10441 | T10439 | dobj | association,increased |
R8992 | T10442 | T10439 | prep | in,increased |
R8993 | T10443 | T10444 | det | the,presence |
R8994 | T10444 | T10442 | pobj | presence,in |
R8995 | T10445 | T10444 | cc | and,presence |
R8996 | T10446 | T10444 | conj | absence,presence |
R8997 | T10447 | T10446 | prep | of,absence |
R8998 | T10448 | T10449 | amod | activated,GATA-3 |
R8999 | T10449 | T10447 | pobj | GATA-3,of |
R9000 | T10450 | T10452 | punct | (,4B |
R9001 | T10451 | T10452 | compound | Figure,4B |
R9002 | T10452 | T10449 | appos | 4B,GATA-3 |
R9003 | T10453 | T10449 | punct | ),GATA-3 |
R9004 | T10454 | T10439 | punct | .,increased |
R9005 | T10455 | T10456 | det | This,effect |
R9006 | T10456 | T10457 | nsubj | effect,is |
R9007 | T10457 | T10457 | ROOT | is,is |
R9008 | T10458 | T10457 | neg | not,is |
R9009 | T10459 | T10457 | acomp | mutual,is |
R9010 | T10460 | T10457 | punct | ",",is |
R9011 | T10461 | T10462 | mark | since,activated |
R9012 | T10462 | T10466 | advcl | activated,block |
R9013 | T10463 | T10466 | nsubj | GATA-3,block |
R9014 | T10464 | T10466 | aux | did,block |
R9015 | T10465 | T10466 | neg | not,block |
R9016 | T10466 | T10457 | advcl | block,is |
R9017 | T10467 | T10466 | dobj | GR,block |
R9018 | T10468 | T10469 | amod | importin-α,association |
R9019 | T10469 | T10466 | dep | association,block |
R9020 | T10470 | T10471 | punct | (,Figure |
R9021 | T10471 | T10472 | nmod | Figure,4C |
R9022 | T10472 | T10469 | appos | 4C,association |
R9023 | T10473 | T10469 | punct | ),association |
R9024 | T10474 | T10457 | punct | .,is |
R9025 | T10475 | T10476 | det | These,data |
R9026 | T10476 | T10478 | nsubj | data,suggest |
R9027 | T10477 | T10478 | advmod | also,suggest |
R9028 | T10478 | T10478 | ROOT | suggest,suggest |
R9029 | T10479 | T10481 | mark | that,activated |
R9030 | T10480 | T10481 | nsubj | both,activated |
R9031 | T10481 | T10478 | ccomp | activated,suggest |
R9032 | T10482 | T10481 | dobj | GR,activated |
R9033 | T10483 | T10482 | cc | and,GR |
R9034 | T10484 | T10482 | conj | phospho-GATA-3,GR |
R9035 | T10485 | T10487 | aux | can,associate |
R9036 | T10486 | T10487 | advmod | directly,associate |
R9037 | T10487 | T10478 | ccomp | associate,suggest |
R9038 | T10488 | T10487 | prep | with,associate |
R9039 | T10489 | T10488 | pobj | importin-α,with |
R9040 | T10490 | T10492 | punct | (,4D |
R9041 | T10491 | T10492 | compound | Figure,4D |
R9042 | T10492 | T10489 | appos | 4D,importin-α |
R9043 | T10493 | T10492 | punct | ),4D |
R9044 | T10494 | T10487 | cc | and,associate |
R9045 | T10495 | T10496 | nsubj | that,activated |
R9046 | T10496 | T10487 | conj | activated,associate |
R9047 | T10497 | T10498 | compound | GR,attenuates |
R9048 | T10498 | T10498 | ROOT | attenuates,attenuates |
R9049 | T10499 | T10503 | det | the,interaction |
R9050 | T10500 | T10503 | amod | phospho-GATA-3,interaction |
R9051 | T10501 | T10503 | nmod | /,interaction |
R9052 | T10502 | T10503 | amod | importin-α,interaction |
R9053 | T10503 | T10498 | dobj | interaction,attenuates |
R9054 | T10504 | T10498 | prep | in,attenuates |
R9055 | T10505 | T10507 | det | a,manner |
R9056 | T10506 | T10507 | amod | concentration-dependent,manner |
R9057 | T10507 | T10504 | pobj | manner,in |
R9058 | T10508 | T10509 | punct | (,Figure |
R9059 | T10509 | T10498 | appos | Figure,attenuates |
R9060 | T10510 | T10509 | nummod | 4E,Figure |
R9061 | T10511 | T10509 | punct | ),Figure |
R9062 | T10512 | T10478 | punct | .,suggest |
R9063 | T10513 | T10516 | advmod | Together,suggests |
R9064 | T10514 | T10516 | punct | ",",suggests |
R9065 | T10515 | T10516 | nsubj | this,suggests |
R9066 | T10516 | T10516 | ROOT | suggests,suggests |
R9067 | T10517 | T10521 | mark | that,compete |
R9068 | T10518 | T10519 | compound | ligand-activated,GR |
R9069 | T10519 | T10521 | nsubj | GR,compete |
R9070 | T10520 | T10521 | aux | may,compete |
R9071 | T10521 | T10516 | ccomp | compete,suggests |
R9072 | T10522 | T10521 | prep | with,compete |
R9073 | T10523 | T10522 | pobj | phospho-GATA-3,with |
R9074 | T10524 | T10523 | prep | for,phospho-GATA-3 |
R9075 | T10525 | T10524 | pobj | importin-α,for |
R9076 | T10526 | T10525 | cc | and,importin-α |
R9077 | T10527 | T10528 | advmod | thereby,limit |
R9078 | T10528 | T10525 | conj | limit,importin-α |
R9079 | T10529 | T10531 | amod | GATA-3,import |
R9080 | T10530 | T10531 | amod | nuclear,import |
R9081 | T10531 | T10528 | dobj | import,limit |
R9082 | T10532 | T10516 | punct | .,suggests |
R9083 | T10533 | T10535 | amod | Other,interpretations |
R9084 | T10534 | T10535 | amod | possible,interpretations |
R9085 | T10535 | T10540 | nsubj | interpretations,include |
R9086 | T10536 | T10535 | prep | of,interpretations |
R9087 | T10537 | T10538 | poss | our,results |
R9088 | T10538 | T10536 | pobj | results,of |
R9089 | T10539 | T10540 | aux | could,include |
R9090 | T10540 | T10540 | ROOT | include,include |
R9091 | T10541 | T10542 | det | an,effect |
R9092 | T10542 | T10540 | dobj | effect,include |
R9093 | T10543 | T10542 | prep | of,effect |
R9094 | T10544 | T10543 | pobj | FP,of |
R9095 | T10545 | T10542 | prep | on,effect |
R9096 | T10546 | T10548 | nmod | GATA-3,export |
R9097 | T10547 | T10548 | amod | nuclear,export |
R9098 | T10548 | T10545 | pobj | export,on |
R9099 | T10549 | T10548 | cc | and/or,export |
R9100 | T10550 | T10548 | conj | degradation,export |
R9101 | T10551 | T10540 | punct | .,include |
R9102 | T10552 | T10553 | compound | Leptomycin,B |
R9103 | T10553 | T10562 | nsubj | B,affect |
R9104 | T10554 | T10553 | punct | ",",B |
R9105 | T10555 | T10556 | nsubj | which,inhibits |
R9106 | T10556 | T10553 | relcl | inhibits,B |
R9107 | T10557 | T10558 | amod | nuclear,export |
R9108 | T10558 | T10556 | dobj | export,inhibits |
R9109 | T10559 | T10562 | punct | ",",affect |
R9110 | T10560 | T10562 | aux | did,affect |
R9111 | T10561 | T10562 | neg | not,affect |
R9112 | T10562 | T10562 | ROOT | affect,affect |
R9113 | T10563 | T10564 | det | the,ability |
R9114 | T10564 | T10562 | dobj | ability,affect |
R9115 | T10565 | T10564 | prep | of,ability |
R9116 | T10566 | T10565 | pobj | FP,of |
R9117 | T10567 | T10568 | aux | to,block |
R9118 | T10568 | T10564 | acl | block,ability |
R9119 | T10569 | T10571 | amod | GATA-3,localization |
R9120 | T10570 | T10571 | amod | nuclear,localization |
R9121 | T10571 | T10568 | dobj | localization,block |
R9122 | T10572 | T10574 | punct | (,5A |
R9123 | T10573 | T10574 | compound | Figure,5A |
R9124 | T10574 | T10571 | appos | 5A,localization |
R9125 | T10575 | T10574 | punct | ),5A |
R9126 | T10576 | T10562 | punct | .,affect |
R9127 | T10577 | T10580 | advmod | Additionally,had |
R9128 | T10578 | T10580 | punct | ",",had |
R9129 | T10579 | T10580 | nsubj | FP,had |
R9130 | T10580 | T10580 | ROOT | had,had |
R9131 | T10581 | T10582 | det | no,effect |
R9132 | T10582 | T10580 | dobj | effect,had |
R9133 | T10583 | T10582 | prep | on,effect |
R9134 | T10584 | T10587 | amod | whole,expression |
R9135 | T10585 | T10586 | compound | cell,GATA-3 |
R9136 | T10586 | T10587 | compound | GATA-3,expression |
R9137 | T10587 | T10583 | pobj | expression,on |
R9138 | T10588 | T10580 | prep | during,had |
R9139 | T10589 | T10591 | det | the,course |
R9140 | T10590 | T10591 | compound | time,course |
R9141 | T10591 | T10588 | pobj | course,during |
R9142 | T10592 | T10591 | prep | of,course |
R9143 | T10593 | T10594 | det | these,experiments |
R9144 | T10594 | T10592 | pobj | experiments,of |
R9145 | T10595 | T10597 | punct | (,5B |
R9146 | T10596 | T10597 | compound | Figure,5B |
R9147 | T10597 | T10594 | appos | 5B,experiments |
R9148 | T10598 | T10597 | punct | ),5B |
R9149 | T10599 | T10580 | punct | .,had |
R9150 | T10600 | T10602 | cc | Nor,addition |
R9151 | T10601 | T10602 | aux | did,addition |
R9152 | T10602 | T10602 | ROOT | addition,addition |
R9153 | T10603 | T10602 | prep | of,addition |
R9154 | T10604 | T10603 | pobj | FP,of |
R9155 | T10605 | T10602 | advmod | subsequent,addition |
R9156 | T10606 | T10607 | aux | to,anti-CD3 |
R9157 | T10607 | T10605 | xcomp | anti-CD3,subsequent |
R9158 | T10608 | T10611 | nmod | /,translocation |
R9159 | T10609 | T10608 | nummod | CD28,/ |
R9160 | T10610 | T10611 | amod | nuclear,translocation |
R9161 | T10611 | T10612 | nsubj | translocation,affect |
R9162 | T10612 | T10607 | conj | affect,anti-CD3 |
R9163 | T10613 | T10615 | nmod | GATA-3,residency |
R9164 | T10614 | T10615 | amod | nuclear,residency |
R9165 | T10615 | T10612 | dobj | residency,affect |
R9166 | T10616 | T10618 | punct | (,5C |
R9167 | T10617 | T10618 | compound | Figure,5C |
R9168 | T10618 | T10615 | appos | 5C,residency |
R9169 | T10619 | T10615 | punct | ),residency |
R9170 | T10620 | T10605 | punct | ",",subsequent |
R9171 | T10621 | T10605 | advcl | suggesting,subsequent |
R9172 | T10622 | T10627 | mark | that,enhance |
R9173 | T10623 | T10624 | amod | activated,GR |
R9174 | T10624 | T10627 | nsubj | GR,enhance |
R9175 | T10625 | T10627 | aux | does,enhance |
R9176 | T10626 | T10627 | neg | not,enhance |
R9177 | T10627 | T10621 | ccomp | enhance,suggesting |
R9178 | T10628 | T10630 | amod | GATA-3,export |
R9179 | T10629 | T10630 | amod | nuclear,export |
R9180 | T10630 | T10627 | dobj | export,enhance |
R9181 | T10631 | T10605 | punct | .,subsequent |
R9182 | T10632 | T10642 | advmod | Finally,was |
R9183 | T10633 | T10642 | punct | ",",was |
R9184 | T10634 | T10635 | det | the,effect |
R9185 | T10635 | T10642 | nsubj | effect,was |
R9186 | T10636 | T10635 | prep | of,effect |
R9187 | T10637 | T10636 | pobj | FP,of |
R9188 | T10638 | T10635 | prep | on,effect |
R9189 | T10639 | T10641 | nmod | GATA-3,import |
R9190 | T10640 | T10641 | amod | nuclear,import |
R9191 | T10641 | T10638 | pobj | import,on |
R9192 | T10642 | T10642 | ROOT | was,was |
R9193 | T10643 | T10642 | neg | not,was |
R9194 | T10644 | T10642 | acomp | nonspecific,was |
R9195 | T10645 | T10642 | punct | ",",was |
R9196 | T10646 | T10654 | mark | since,had |
R9197 | T10647 | T10652 | nmod | FP,M |
R9198 | T10648 | T10650 | punct | (,− |
R9199 | T10649 | T10650 | nummod | 10,− |
R9200 | T10650 | T10652 | nmod | −,M |
R9201 | T10651 | T10650 | nummod | 8,− |
R9202 | T10652 | T10646 | pobj | M,since |
R9203 | T10653 | T10654 | punct | ),had |
R9204 | T10654 | T10642 | advcl | had,was |
R9205 | T10655 | T10656 | det | no,effect |
R9206 | T10656 | T10654 | dobj | effect,had |
R9207 | T10657 | T10656 | prep | on,effect |
R10256 | T11943 | T11944 | nmod | ex,vivo |
R10257 | T11944 | T11945 | nsubj | vivo,demonstrated |
R10258 | T11945 | T11945 | ROOT | demonstrated,demonstrated |
R10259 | T11946 | T11948 | det | a,decrease |
R10260 | T11947 | T11948 | amod | concentration-dependent,decrease |
R10261 | T11948 | T11945 | dobj | decrease,demonstrated |
R10262 | T11949 | T11948 | prep | in,decrease |
R10263 | T11950 | T11952 | det | the,interaction |
R10264 | T11951 | T11952 | amod | direct,interaction |
R10265 | T11952 | T11949 | pobj | interaction,in |
R10266 | T11953 | T11952 | prep | between,interaction |
R10267 | T11954 | T11953 | pobj | phospho-GATA-3,between |
R10268 | T11955 | T11954 | cc | and,phospho-GATA-3 |
R10269 | T11956 | T11954 | conj | importin-α,phospho-GATA-3 |
R10270 | T11957 | T11956 | prep | in,importin-α |
R10271 | T11958 | T11957 | pobj | PBMCs,in |
R10272 | T11959 | T11954 | prep | from,phospho-GATA-3 |
R10273 | T11960 | T11959 | pobj | patients,from |
R10274 | T11961 | T11960 | prep | with,patients |
R10275 | T11962 | T11965 | compound | asthma,6A |
R10276 | T11963 | T11964 | punct | (,Figure |
R10277 | T11964 | T11965 | compound | Figure,6A |
R10278 | T11965 | T11961 | pobj | 6A,with |
R10279 | T11966 | T11965 | cc | and,6A |
R10280 | T11967 | T11965 | conj | 6B,6A |
R10281 | T11968 | T11967 | punct | ),6B |
R10282 | T11969 | T11965 | punct | ",",6A |
R10283 | T11970 | T11973 | nsubjpass | which,inhibited |
R10284 | T11971 | T11973 | auxpass | was,inhibited |
R10285 | T11972 | T11973 | advmod | significantly,inhibited |
R10286 | T11973 | T11960 | relcl | inhibited,patients |
R10287 | T11974 | T11973 | prep | at,inhibited |
R10288 | T11975 | T11979 | nummod | 10,FP |
R10289 | T11976 | T11979 | nummod | −,FP |
R10290 | T11977 | T11979 | nummod | 12,FP |
R10291 | T11978 | T11979 | compound | M,FP |
R10292 | T11979 | T11974 | pobj | FP,at |
R10293 | T11980 | T11979 | punct | (,FP |
R10294 | T11981 | T11982 | nmod | p,< |
R10295 | T11982 | T11983 | nmod | <,0.001 |
R10296 | T11983 | T11979 | appos | 0.001,FP |
R10297 | T11984 | T11983 | punct | ",",0.001 |
R10298 | T11985 | T11983 | conj | ANOVA,0.001 |
R10299 | T11986 | T11985 | cc | and,ANOVA |
R10300 | T11987 | T11988 | compound | Newman-Keuls,test |
R10301 | T11988 | T11985 | conj | test,ANOVA |
R10302 | T11989 | T11988 | punct | ),test |
R10303 | T11990 | T11973 | cc | and,inhibited |
R10304 | T11991 | T11992 | advmod | completely,attenuated |
R10305 | T11992 | T11973 | conj | attenuated,inhibited |
R10306 | T11993 | T11992 | prep | by,attenuated |
R10307 | T11994 | T11998 | nummod | 10,FP |
R10308 | T11995 | T11996 | quantmod | −,8 |
R10309 | T11996 | T11998 | nummod | 8,FP |
R10310 | T11997 | T11998 | compound | M,FP |
R10311 | T11998 | T12001 | nmod | FP,< |
R10312 | T11999 | T12001 | punct | (,< |
R10313 | T12000 | T12001 | nmod | p,< |
R10314 | T12001 | T11993 | pobj | <,by |
R10315 | T12002 | T12001 | appos | 0.001,< |
R10316 | T12003 | T12001 | punct | ",",< |
R10317 | T12004 | T12001 | conj | ANOVA,< |
R10318 | T12005 | T12004 | cc | and,ANOVA |
R10319 | T12006 | T12007 | compound | Newman-Keuls,test |
R10320 | T12007 | T12004 | conj | test,ANOVA |
R10321 | T12008 | T12001 | punct | ),< |
R10322 | T12009 | T11945 | punct | .,demonstrated |
R10323 | T12010 | T12015 | poss | Our,studies |
R10324 | T12011 | T12015 | amod | previous,studies |
R10325 | T12012 | T12015 | compound | T,studies |
R10326 | T12013 | T12014 | compound | cell,line |
R10327 | T12014 | T12015 | compound | line,studies |
R10328 | T12015 | T12016 | nsubj | studies,indicated |
R10329 | T12016 | T12016 | ROOT | indicated,indicated |
R10330 | T12017 | T12023 | mark | that,suppresses |
R10331 | T12018 | T12023 | nsubj | 10,suppresses |
R10332 | T12019 | T12023 | dep | −,suppresses |
R10333 | T12020 | T12023 | dep | 12,suppresses |
R10334 | T12021 | T12022 | compound | M,FP |
R10350 | T12037 | T12038 | punct | (,see |
R10351 | T12038 | T12016 | parataxis | see,indicated |
R10352 | T12039 | T12038 | npadvmod | Figures,see |
R10353 | T12040 | T12043 | nmod | 1D,) |
R10354 | T12041 | T12040 | cc | and,1D |
R10355 | T12042 | T12040 | conj | 2,1D |
R10356 | T12043 | T12038 | punct | ),see |
R10357 | T12044 | T12016 | punct | .,indicated |
R10358 | T12045 | T12046 | det | This,concentration |
R10359 | T12046 | T12047 | nsubj | concentration,is |
R10360 | T12047 | T12047 | ROOT | is,is |
R10361 | T12048 | T12047 | acomp | close,is |
R10362 | T12049 | T12050 | aux | to,peak |
R10363 | T12050 | T12047 | xcomp | peak,is |
R10364 | T12051 | T12052 | compound | plasma,levels |
R10365 | T12052 | T12050 | dobj | levels,peak |
R10366 | T12053 | T12052 | acl | obtained,levels |
R10367 | T12054 | T12053 | prep | from,obtained |
R10368 | T12055 | T12056 | amod | asthmatic,patients |
R10369 | T12056 | T12054 | pobj | patients,from |
R10370 | T12057 | T12056 | acl | treated,patients |
R10371 | T12058 | T12057 | prep | with,treated |
R10372 | T12059 | T12060 | amod | inhaled,FP |
R10373 | T12060 | T12065 | nmod | FP,[ |
R10374 | T12061 | T12060 | punct | (,FP |
R10375 | T12062 | T12063 | nummod | 500,µg |
R10376 | T12063 | T12060 | appos | µg,FP |
R10377 | T12064 | T12065 | punct | ),[ |
R10378 | T12065 | T12067 | nmod | [,] |
R10379 | T12066 | T12067 | nummod | 27,] |
R10380 | T12067 | T12058 | pobj | ],with |
R10381 | T12068 | T12047 | punct | .,is |
R10382 | T12069 | T12070 | compound | Inhaled,FP |
R10383 | T12070 | T12082 | nsubj | FP,reduced |
R10384 | T12071 | T12073 | punct | (,µg |
R10385 | T12072 | T12073 | nummod | 500,µg |
R10386 | T12073 | T12070 | appos | µg,FP |
R10387 | T12074 | T12073 | punct | ),µg |
R10388 | T12075 | T12070 | appos | treatment,FP |
R10389 | T12076 | T12075 | prep | of,treatment |
R10390 | T12077 | T12080 | nummod | seven,patients |
R10391 | T12078 | T12080 | amod | steroid-naive,patients |
R10392 | T12079 | T12080 | compound | asthma,patients |
R10393 | T12080 | T12076 | pobj | patients,of |
R10394 | T12081 | T12082 | advmod | significantly,reduced |
R10395 | T12082 | T12082 | ROOT | reduced,reduced |
R10396 | T12083 | T12082 | dobj | GATA-3,reduced |
R10397 | T12084 | T12085 | amod | importin-α,interaction |
R10398 | T12085 | T12083 | appos | interaction,GATA-3 |
R10399 | T12086 | T12085 | prep | in,interaction |
R10400 | T12087 | T12086 | pobj | vivo,in |
R10401 | T12088 | T12082 | prep | in,reduced |
R10402 | T12089 | T12091 | det | a,manner |
R10403 | T12090 | T12091 | amod | time-dependent,manner |
R10404 | T12091 | T12088 | pobj | manner,in |
R10405 | T12092 | T12082 | punct | .,reduced |
R10406 | T12093 | T12094 | nsubj | This,produced |
R10407 | T12094 | T12094 | ROOT | produced,produced |
R10408 | T12095 | T12096 | det | a,> |
R10409 | T12096 | T12099 | compound | >,decrease |
R10410 | T12097 | T12098 | nummod | 90,% |
R10411 | T12098 | T12099 | compound | %,decrease |
R10412 | T12099 | T12094 | dobj | decrease,produced |
R10413 | T12100 | T12099 | prep | in,decrease |
R10414 | T12101 | T12100 | pobj | GATA-3,in |
R10415 | T12102 | T12103 | compound | importin-α,association |
R10416 | T12103 | T12099 | appos | association,decrease |
R10417 | T12104 | T12099 | prep | at,decrease |
R10418 | T12105 | T12106 | nummod | 2,h |
R10419 | T12106 | T12104 | pobj | h,at |
R10420 | T12107 | T12113 | punct | (,] |
R10421 | T12108 | T12113 | amod | median,] |
R10422 | T12109 | T12113 | compound | [,] |
R10423 | T12110 | T12111 | nummod | 95,% |
R10424 | T12111 | T12113 | compound | %,] |
R10425 | T12112 | T12113 | compound | CI,] |
R10426 | T12113 | T12099 | appos | ],decrease |
R10427 | T12114 | T12113 | punct | ",",] |
R10428 | T12115 | T12117 | nummod | "13,494","6,828" |
R10429 | T12116 | T12117 | compound | [,"6,828" |
R10430 | T12117 | T12113 | appos | "6,828",] |
R10431 | T12118 | T12119 | compound | "17,829",] |
R10432 | T12119 | T12113 | conj | ],] |
R10433 | T12120 | T12119 | cc | versus,] |
R10434 | T12121 | T12127 | dep | 879,p |
R10435 | T12122 | T12127 | ccomp | [,p |
R10436 | T12123 | T12122 | nummod | 597,[ |
R10437 | T12124 | T12122 | nummod | "1,165",[ |
R10438 | T12125 | T12125 | ROOT | ],] |
R10439 | T12126 | T12127 | punct | ;,p |
R10440 | T12127 | T12113 | parataxis | p,] |
R10441 | T12128 | T12127 | advmod | <,p |
R10442 | T12129 | T12132 | nummod | 0.05,analysis |
R10443 | T12130 | T12132 | poss | Friedman,analysis |
R10444 | T12131 | T12130 | case | 's,Friedman |
R10445 | T12132 | T12128 | appos | analysis,< |
R10446 | T12133 | T12128 | punct | ),< |
R10447 | T12134 | T12127 | punct | .,p |
R10448 | T12135 | T12140 | advmod | However,reach |
R10449 | T12136 | T12140 | punct | ",",reach |
R10475 | T12162 | T12163 | auxpass | were,observed |
R10476 | T12163 | T12163 | ROOT | observed,observed |
R10477 | T12164 | T12169 | advmod | when,measured |
R10478 | T12165 | T12169 | nsubjpass | GATA-3,measured |
R10479 | T12166 | T12167 | amod | importin-α,association |
R10480 | T12167 | T12165 | appos | association,GATA-3 |
R10481 | T12168 | T12169 | auxpass | was,measured |
R10482 | T12169 | T12163 | advcl | measured,observed |
R10483 | T12170 | T12172 | punct | (,6C |
R10484 | T12171 | T12172 | compound | Figure,6C |
R10485 | T12172 | T12169 | dobj | 6C,measured |
R10486 | T12173 | T12172 | cc | and,6C |
R10487 | T12174 | T12172 | conj | 6D,6C |
R10488 | T12175 | T12172 | punct | ),6C |
R10489 | T12176 | T12163 | punct | .,observed |
R10490 | T12177 | T12179 | det | The,dose |
R10491 | T12178 | T12179 | amod | lower,dose |
R10492 | T12179 | T12186 | nsubj | dose,was |
R10493 | T12180 | T12179 | prep | of,dose |
R10494 | T12181 | T12180 | pobj | FP,of |
R10495 | T12182 | T12181 | punct | (,FP |
R10496 | T12183 | T12184 | nummod | 100,µg |
R10497 | T12184 | T12181 | appos | µg,FP |
R10498 | T12185 | T12184 | punct | ),µg |
R10499 | T12186 | T12186 | ROOT | was,was |
R10500 | T12187 | T12186 | neg | not,was |
R10501 | T12188 | T12186 | acomp | effective,was |
R10502 | T12189 | T12186 | punct | .,was |
R10503 | T12190 | T12192 | det | The,interaction |
R10504 | T12191 | T12192 | amod | attenuated,interaction |
R10554 | T12241 | T12242 | compound | T,cells |
R10555 | T12242 | T12238 | pobj | cells,in |
R10556 | T12243 | T12228 | punct | .,examined |
R10557 | T12244 | T12256 | nsubj | Treatment,increased |
R10558 | T12245 | T12244 | prep | with,Treatment |
R10559 | T12246 | T12247 | amod | inhaled,FP |
R10560 | T12247 | T12245 | pobj | FP,with |
R10561 | T12248 | T12247 | punct | (,FP |
R10562 | T12249 | T12250 | nummod | 500,µg |
R10563 | T12250 | T12247 | appos | µg,FP |
R10564 | T12251 | T12244 | punct | ),Treatment |
R10565 | T12252 | T12244 | prep | for,Treatment |
R10566 | T12253 | T12254 | nummod | 2,h |
R10567 | T12254 | T12252 | pobj | h,for |
R10568 | T12255 | T12256 | advmod | significantly,increased |
R10569 | T12256 | T12256 | ROOT | increased,increased |
R10570 | T12257 | T12259 | nmod | GR,translocation |
R10571 | T12258 | T12259 | amod | nuclear,translocation |
R10572 | T12259 | T12256 | dobj | translocation,increased |
R10573 | T12260 | T12262 | punct | (,7A |
R10574 | T12261 | T12262 | compound | Figure,7A |
R10575 | T12262 | T12259 | appos | 7A,translocation |
R10576 | T12263 | T12262 | punct | ),7A |
R10577 | T12264 | T12256 | cc | and,increased |
R10578 | T12265 | T12266 | advmod | concomitantly,decreased |
R10579 | T12266 | T12256 | conj | decreased,increased |
R10580 | T12267 | T12268 | det | the,number |
R10581 | T12268 | T12266 | dobj | number,decreased |
R10582 | T12269 | T12268 | prep | of,number |
R10583 | T12270 | T12276 | amod | nuclear,cells |
R10585 | T12272 | T12276 | amod | immunoreactive,cells |
R10586 | T12273 | T12276 | amod | peripheral,cells |
R10587 | T12274 | T12276 | compound | blood,cells |
R10588 | T12275 | T12276 | compound | T,cells |
R10589 | T12276 | T12269 | pobj | cells,of |
R10590 | T12277 | T12276 | punct | (,cells |
R10591 | T12278 | T12279 | nummod | 37,% |
R10592 | T12279 | T12276 | appos | %,cells |
R10593 | T12280 | T12290 | nummod | ±,p |
R10594 | T12281 | T12282 | nummod | 4.2,% |
R10595 | T12282 | T12280 | quantmod | %,± |
R10596 | T12283 | T12280 | cc | versus,± |
R10597 | T12284 | T12285 | nummod | 58.2,% |
R10598 | T12285 | T12290 | dep | %,p |
R10599 | T12286 | T12288 | nummod | ±,% |
R10600 | T12287 | T12288 | nummod | 4.95,% |
R10601 | T12288 | T12285 | appos | %,% |
R10602 | T12289 | T12290 | punct | ",",p |
R10603 | T12290 | T12276 | parataxis | p,cells |
R10604 | T12291 | T12292 | punct | =,0.016 |
R10605 | T12292 | T12290 | prep | 0.016,p |
R10606 | T12293 | T12303 | punct | ",",compared |
R10607 | T12294 | T12303 | nsubj | W,compared |
R10608 | T12295 | T12294 | punct | =,W |
R10609 | T12296 | T12294 | appos | 28.0,W |
R10610 | T12297 | T12294 | punct | ",",W |
R10611 | T12298 | T12301 | poss | Wilcoxon,test |
R10612 | T12299 | T12298 | case | 's,Wilcoxon |
R10613 | T12300 | T12301 | compound | rank,test |
R10614 | T12301 | T12294 | appos | test,W |
R10615 | T12302 | T12294 | punct | ),W |
R10616 | T12303 | T12256 | prep | compared,increased |
R10617 | T12304 | T12303 | prep | with,compared |
R10618 | T12305 | T12304 | pobj | placebo,with |
R10619 | T12306 | T12307 | mark | as,measured |
R10620 | T12307 | T12303 | advcl | measured,compared |
R10621 | T12308 | T12307 | agent | by,measured |
R10622 | T12309 | T12308 | pobj | immunocytochemistry,by |
R10623 | T12310 | T12312 | punct | (,7A |
R10624 | T12311 | T12312 | compound | Figure,7A |
R10625 | T12312 | T12309 | appos | 7A,immunocytochemistry |
R10626 | T12313 | T12312 | cc | and,7A |
R10627 | T12314 | T12312 | conj | 7B,7A |
R10628 | T12315 | T12312 | punct | ),7A |
R10629 | T12316 | T12303 | punct | .,compared |
R10630 | T12317 | T12319 | nsubjpass | This,confirmed |
R10631 | T12318 | T12319 | auxpass | was,confirmed |
R10632 | T12319 | T12319 | ROOT | confirmed,confirmed |
R10633 | T12320 | T12319 | agent | by,confirmed |
R10634 | T12321 | T12322 | amod | Western,blotting |
R10635 | T12322 | T12320 | pobj | blotting,by |
R10636 | T12323 | T12322 | punct | ",",blotting |
R10637 | T12324 | T12326 | nsubj | which,indicated |
R10638 | T12325 | T12326 | advmod | also,indicated |
R10639 | T12326 | T12319 | ccomp | indicated,confirmed |
R10640 | T12327 | T12330 | mark | that,was |
R10641 | T12328 | T12329 | det | this,effect |
R10642 | T12329 | T12330 | nsubj | effect,was |
R10643 | T12330 | T12326 | ccomp | was,indicated |
R10644 | T12331 | T12332 | preconj | both,time |
R10645 | T12332 | T12330 | attr | time,was |
R10646 | T12333 | T12332 | punct | -,time |
R10647 | T12334 | T12332 | cc | and,time |
R10648 | T12335 | T12332 | conj | dose-dependent,time |
R10649 | T12336 | T12338 | punct | (,7C |
R10650 | T12337 | T12338 | compound | Figure,7C |
R10651 | T12338 | T12335 | appos | 7C,dose-dependent |
R10652 | T12339 | T12338 | cc | and,7C |
R10653 | T12340 | T12338 | conj | 7D,7C |
R10654 | T12341 | T12338 | punct | ),7C |
R10655 | T12342 | T12319 | punct | .,confirmed |
R10656 | T12343 | T12345 | advmod | Thus,inhaled |
R10657 | T12344 | T12345 | punct | ",",inhaled |
R10658 | T12345 | T12345 | ROOT | inhaled,inhaled |
R10659 | T12346 | T12345 | dobj | FP,inhaled |
R10660 | T12347 | T12346 | punct | (,FP |
R10666 | T12353 | T12351 | dobj | loss,induced |
R10667 | T12354 | T12351 | prep | in,induced |
R10668 | T12355 | T12356 | amod | nuclear,GATA-3 |
R10669 | T12356 | T12354 | pobj | GATA-3,in |
R10670 | T12357 | T12351 | prep | at,induced |
R10671 | T12358 | T12359 | nummod | 2,h |
R10672 | T12359 | T12357 | pobj | h,at |
R10673 | T12360 | T12366 | punct | (,] |
R10674 | T12361 | T12366 | amod | median,] |
R10675 | T12362 | T12366 | compound | [,] |
R10676 | T12363 | T12364 | nummod | 95,% |
R10677 | T12364 | T12366 | compound | %,] |
R10678 | T12365 | T12366 | compound | CI,] |
R10679 | T12366 | T12381 | meta | ],< |
R10680 | T12367 | T12366 | punct | ",",] |
R10681 | T12368 | T12370 | compound | 0.40,0.27 |
R10682 | T12369 | T12370 | compound | [,0.27 |
R10683 | T12370 | T12366 | appos | 0.27,] |
R10684 | T12371 | T12372 | nummod | 0.53,] |
R10685 | T12372 | T12366 | conj | ],] |
R10686 | T12373 | T12372 | cc | versus,] |
R10687 | T12374 | T12376 | compound | 0.14,0.11 |
R10688 | T12375 | T12376 | compound | [,0.11 |
R10689 | T12376 | T12366 | appos | 0.11,] |
R10690 | T12377 | T12378 | nummod | 0.19,] |
R10691 | T12378 | T12366 | appos | ],] |
R10692 | T12379 | T12378 | punct | ",",] |
R10693 | T12380 | T12381 | compound | p,< |
R10694 | T12381 | T12351 | npadvmod | <,induced |
R10695 | T12382 | T12381 | nummod | 0.05,< |
R10696 | T12383 | T12381 | punct | ",",< |
R10697 | T12384 | T12400 | nmod | W,levels |
R10698 | T12385 | T12384 | punct | =,W |
R10699 | T12386 | T12384 | appos | 21.00,W |
R10700 | T12387 | T12384 | punct | ",",W |
R10701 | T12388 | T12391 | poss | Wilcoxon,test |
R10702 | T12389 | T12388 | case | 's,Wilcoxon |
R10703 | T12390 | T12391 | compound | rank,test |
R10704 | T12391 | T12384 | appos | test,W |
R10705 | T12392 | T12384 | punct | ),W |
R10706 | T12393 | T12395 | punct | (,7C |
R10707 | T12394 | T12395 | compound | Figure,7C |
R10708 | T12395 | T12384 | appos | 7C,W |
R10709 | T12396 | T12395 | punct | ),7C |
R10710 | T12397 | T12384 | cc | and,W |
R10711 | T12398 | T12400 | amod | cytoplasmic,levels |
R10712 | T12399 | T12400 | compound | GATA-3,levels |
R10713 | T12400 | T12402 | nsubjpass | levels,enhanced |
R10714 | T12401 | T12402 | auxpass | were,enhanced |
R10715 | T12402 | T12351 | conj | enhanced,induced |
R10716 | T12403 | T12402 | agent | by,enhanced |
R10717 | T12404 | T12405 | amod | inhaled,FP |
R10718 | T12405 | T12403 | pobj | FP,by |
R10719 | T12406 | T12402 | prep | in,enhanced |
R10720 | T12407 | T12409 | det | a,manner |
R10721 | T12408 | T12409 | amod | dose-dependent,manner |
R10722 | T12409 | T12406 | pobj | manner,in |
R10723 | T12410 | T12416 | punct | (,] |
R10724 | T12411 | T12416 | amod | median,] |
R10725 | T12412 | T12416 | compound | [,] |
R10726 | T12413 | T12414 | nummod | 95,% |
R10727 | T12414 | T12416 | compound | %,] |
R10728 | T12415 | T12416 | compound | CI,] |
R10729 | T12416 | T12409 | appos | ],manner |
R10730 | T12417 | T12416 | punct | ",",] |
R10731 | T12418 | T12420 | nummod | 0.0032,0.0026 |
R10732 | T12419 | T12420 | compound | [,0.0026 |
R10733 | T12420 | T12416 | appos | 0.0026,] |
R10734 | T12421 | T12422 | nummod | 0.0039,] |
R10735 | T12422 | T12416 | conj | ],] |
R10736 | T12423 | T12422 | cc | versus,] |
R10737 | T12424 | T12426 | compound | 0.658,0.592 |
R10738 | T12425 | T12426 | compound | [,0.592 |
R10739 | T12426 | T12416 | appos | 0.592,] |
R10740 | T12427 | T12428 | nummod | 0.720,] |
R10741 | T12428 | T12416 | appos | ],] |
R10742 | T12429 | T12428 | punct | ",",] |
R10743 | T12430 | T12431 | compound | p,< |
R10744 | T12431 | T12432 | compound | <,0.05 |
R10745 | T12432 | T12428 | appos | 0.05,] |
R10746 | T12433 | T12428 | punct | ",",] |
R10747 | T12434 | T12428 | amod | W,] |
R10748 | T12435 | T12416 | punct | =,] |
R10749 | T12436 | T12416 | punct | −,] |
R10750 | T12437 | T12416 | appos | 21.00,] |
R10751 | T12438 | T12416 | punct | ",",] |
R10752 | T12439 | T12442 | poss | Wilcoxon,test |
R10753 | T12440 | T12439 | case | 's,Wilcoxon |
R10754 | T12441 | T12442 | compound | rank,test |
R10755 | T12442 | T12416 | appos | test,] |
R10756 | T12443 | T12416 | punct | ),] |
R10757 | T12444 | T12446 | punct | (,7D |
R10758 | T12445 | T12446 | compound | Figure,7D |
R10759 | T12446 | T12416 | appos | 7D,] |
R10760 | T12447 | T12416 | punct | ),] |
R10761 | T12448 | T12345 | punct | .,inhaled |
R10762 | T12449 | T12457 | prep | In,inhibited |
R10763 | T12450 | T12449 | pobj | addition,In |
R10764 | T12451 | T12457 | punct | ",",inhibited |
R10765 | T12452 | T12457 | nsubj | FP,inhibited |
R10766 | T12453 | T12455 | punct | (,µg |
R10767 | T12454 | T12455 | nummod | 500,µg |
R10768 | T12455 | T12452 | appos | µg,FP |
R10769 | T12456 | T12455 | punct | ),µg |
R10770 | T12457 | T12457 | ROOT | inhibited,inhibited |
R10771 | T12458 | T12460 | nummod | p38,phosphorylation |
R10772 | T12459 | T12460 | compound | MAPK,phosphorylation |
R10773 | T12460 | T12457 | dobj | phosphorylation,inhibited |
R10774 | T12461 | T12460 | prep | in,phosphorylation |
R10775 | T12462 | T12464 | amod | primary,cells |
R10812 | T12499 | T12498 | dobj | phospho-GATA-3,inhibiting |
R10813 | T12500 | T12501 | compound | importin,association |
R10814 | T12501 | T12498 | npadvmod | association,inhibiting |
R10815 | T12502 | T12485 | punct | .,suggest |
R10816 | T12503 | T12504 | det | This,effect |
R10817 | T12504 | T12506 | nsubj | effect,be |
R10818 | T12505 | T12506 | aux | may,be |
R10819 | T12506 | T12506 | ROOT | be,be |
R10820 | T12507 | T12506 | acomp | direct,be |
R10821 | T12508 | T12507 | punct | ",",direct |
R10822 | T12509 | T12506 | prep | through,be |
R10823 | T12510 | T12509 | pobj | competition,through |
R10824 | T12511 | T12510 | prep | for,competition |
R10825 | T12512 | T12515 | amod | importin-α,molecules |
R10826 | T12513 | T12512 | cc | or,importin-α |
R10827 | T12514 | T12512 | conj | associated,importin-α |
R10828 | T12515 | T12511 | pobj | molecules,for |
R10829 | T12516 | T12515 | punct | ",",molecules |
R10830 | T12517 | T12510 | cc | or,competition |
R10831 | T12518 | T12510 | conj | secondary,competition |
R10832 | T12519 | T12518 | prep | to,secondary |
R10833 | T12520 | T12521 | det | an,effect |
R10834 | T12521 | T12519 | pobj | effect,to |
R10835 | T12522 | T12521 | prep | on,effect |
R10836 | T12523 | T12526 | nummod | p38,phosphorylation |
R10837 | T12524 | T12526 | nmod | MAPK-mediated,phosphorylation |
R10838 | T12525 | T12526 | amod | GATA-3,phosphorylation |
R10839 | T12526 | T12522 | pobj | phosphorylation,on |
R10840 | T12527 | T12506 | prep | via,be |
R10841 | T12528 | T12529 | amod | rapid,induction |
R10842 | T12529 | T12527 | pobj | induction,via |
R10843 | T12530 | T12529 | prep | of,induction |
R10844 | T12531 | T12530 | pobj | MKP-1,of |
R10845 | T12532 | T12506 | punct | .,be |
R10846 | T12533 | T12534 | det | The,combination |
R10847 | T12534 | T12541 | nsubj | combination,result |
R10848 | T12535 | T12534 | prep | of,combination |
R10849 | T12536 | T12539 | det | these,effects |
R10850 | T12537 | T12539 | nummod | two,effects |
R10851 | T12538 | T12539 | amod | interacting,effects |
R10852 | T12539 | T12535 | pobj | effects,of |
R10853 | T12540 | T12541 | aux | can,result |
R10854 | T12541 | T12541 | ROOT | result,result |
R10855 | T12542 | T12541 | prep | in,result |
R10856 | T12543 | T12544 | amod | complete,suppression |
R10857 | T12544 | T12542 | pobj | suppression,in |
R10858 | T12545 | T12544 | prep | of,suppression |
R10859 | T12546 | T12554 | amod | GATA-3,expression |
R10860 | T12547 | T12548 | amod | nuclear,import |
R10861 | T12548 | T12554 | nmod | import,expression |
R10862 | T12549 | T12548 | cc | and,import |
R10863 | T12550 | T12554 | advmod | thus,expression |
R10864 | T12551 | T12554 | amod | Th2,expression |
R10865 | T12552 | T12554 | amod | cytokine,expression |
R10866 | T12553 | T12554 | compound | gene,expression |
R10867 | T12554 | T12545 | pobj | expression,of |
R10868 | T12555 | T12541 | punct | .,result |
R12321 | T14309 | T14312 | advmod | Here,demonstrated |
R12322 | T14310 | T14312 | nsubj | we,demonstrated |
R12323 | T14311 | T14312 | aux | have,demonstrated |
R12324 | T14312 | T14312 | ROOT | demonstrated,demonstrated |
R12325 | T14313 | T14312 | punct | ",",demonstrated |
R12326 | T14314 | T14312 | prep | to,demonstrated |
R12327 | T14315 | T14316 | poss | our,knowledge |
R12328 | T14316 | T14314 | pobj | knowledge,to |
R12329 | T14317 | T14316 | prep | for,knowledge |
R12330 | T14318 | T14320 | det | the,time |
R12331 | T14319 | T14320 | amod | first,time |
R12332 | T14320 | T14317 | pobj | time,for |
R12333 | T14321 | T14312 | punct | ",",demonstrated |
R12334 | T14322 | T14325 | mark | that,inhibit |
R12335 | T14323 | T14325 | nsubj | corticosteroids,inhibit |
R12336 | T14324 | T14325 | aux | may,inhibit |
R12337 | T14325 | T14312 | ccomp | inhibit,demonstrated |
R12338 | T14326 | T14327 | compound | GATA-3,function |
R12339 | T14327 | T14325 | dobj | function,inhibit |
R12340 | T14328 | T14325 | cc | and,inhibit |
R12341 | T14329 | T14331 | advmod | therefore,transcription |
R12342 | T14330 | T14331 | det | the,transcription |
R12343 | T14331 | T14325 | conj | transcription,inhibit |
R12344 | T14332 | T14331 | prep | of,transcription |
R12345 | T14333 | T14334 | amod | Th2,genes |
R12346 | T14334 | T14332 | pobj | genes,of |
R12347 | T14335 | T14331 | prep | via,transcription |
R12348 | T14336 | T14341 | nummod | two,mechanisms |
R12349 | T14337 | T14341 | amod | distinct,mechanisms |
R12350 | T14338 | T14337 | cc | but,distinct |
R12390 | T14378 | T14378 | ROOT | increase,increase |
R12391 | T14379 | T14380 | det | the,expression |
R12392 | T14380 | T14378 | dobj | expression,increase |
R12393 | T14381 | T14380 | prep | of,expression |
R12394 | T14382 | T14381 | pobj | MKP-1,of |
R12395 | T14383 | T14382 | punct | ",",MKP-1 |
R12396 | T14384 | T14386 | det | a,inhibitor |
R12397 | T14385 | T14386 | amod | potent,inhibitor |
R12398 | T14386 | T14382 | appos | inhibitor,MKP-1 |
R12399 | T14387 | T14386 | prep | of,inhibitor |
R12400 | T14388 | T14390 | nummod | p38,activity |
R12401 | T14389 | T14390 | compound | MAPK,activity |
R12402 | T14390 | T14387 | pobj | activity,of |
R12403 | T14391 | T14378 | cc | and,increase |
R12404 | T14392 | T14393 | advmod | thereby,prevent |
R12405 | T14393 | T14378 | conj | prevent,increase |
R12406 | T14394 | T14397 | compound | T,activation |
R12407 | T14395 | T14396 | compound | cell,receptor/co-receptor |
R12408 | T14396 | T14397 | compound | receptor/co-receptor,activation |
R12409 | T14397 | T14393 | dobj | activation,prevent |
R12410 | T14398 | T14397 | prep | of,activation |
R12411 | T14399 | T14400 | nummod | p38,MAPK |
R12412 | T14400 | T14398 | pobj | MAPK,of |
R12413 | T14401 | T14402 | aux | to,prevent |
R12414 | T14402 | T14393 | advcl | prevent,prevent |
R12415 | T14403 | T14404 | det | the,phosphorylation |
R12416 | T14404 | T14402 | dobj | phosphorylation,prevent |
R12417 | T14405 | T14404 | prep | of,phosphorylation |
R12418 | T14406 | T14405 | pobj | GATA-3,of |
R12419 | T14407 | T14408 | nsubj | that,is |
R12420 | T14408 | T14406 | relcl | is,GATA-3 |
R12421 | T14409 | T14408 | acomp | necessary,is |
R12422 | T14410 | T14409 | prep | for,necessary |
R12423 | T14411 | T14410 | pobj | interaction,for |
R12424 | T14412 | T14411 | prep | with,interaction |
R12425 | T14413 | T14412 | pobj | importin-α,with |
R12426 | T14414 | T14413 | cc | and,importin-α |
R12427 | T14415 | T14417 | amod | subsequent,import |
R12428 | T14416 | T14417 | amod | nuclear,import |
R12429 | T14417 | T14413 | conj | import,importin-α |
R12458 | T14446 | T14447 | nummod | 12,] |
R12459 | T14447 | T14445 | appos | ],[ |
R12460 | T14448 | T14422 | punct | .,shown |
R12461 | T14449 | T14453 | nsubj | We,reported |
R12462 | T14450 | T14453 | aux | have,reported |
R12463 | T14451 | T14453 | advmod | also,reported |
R12464 | T14452 | T14453 | advmod | previously,reported |
R12465 | T14453 | T14453 | ROOT | reported,reported |
R12466 | T14454 | T14466 | mark | that,stimulated |
R12467 | T14455 | T14456 | amod | GATA-3,knockdown |
R12468 | T14456 | T14466 | nsubj | knockdown,stimulated |
R12469 | T14457 | T14456 | acl | using,knockdown |
R12470 | T14458 | T14459 | compound | siRNA,results |
R12471 | T14459 | T14457 | dobj | results,using |
R12472 | T14460 | T14459 | prep | in,results |
R12473 | T14461 | T14460 | pobj | suppression,in |
R12474 | T14462 | T14461 | prep | of,suppression |
R12475 | T14463 | T14464 | compound | anti-CD3,/ |
R12476 | T14464 | T14465 | compound | /,CD28 |
R12477 | T14465 | T14462 | pobj | CD28,of |
R12478 | T14466 | T14453 | ccomp | stimulated,reported |
R12479 | T14467 | T14469 | compound | IL-4,IL-5 |
R12480 | T14468 | T14469 | compound | /,IL-5 |
R12481 | T14469 | T14470 | compound | IL-5,mRNA |
R12482 | T14470 | T14471 | compound | mRNA,induction |
R12483 | T14471 | T14466 | dobj | induction,stimulated |
R12484 | T14472 | T14466 | punct | ",",stimulated |
R12485 | T14473 | T14474 | advmod | thus,implicating |
R12486 | T14474 | T14466 | prep | implicating,stimulated |
R12487 | T14475 | T14477 | det | an,role |
R12488 | T14476 | T14477 | amod | essential,role |
R12489 | T14477 | T14474 | dobj | role,implicating |
R12490 | T14478 | T14477 | prep | for,role |
R12491 | T14479 | T14478 | pobj | GATA-3,for |
R12492 | T14480 | T14477 | prep | in,role |
R12493 | T14481 | T14482 | det | the,transcription |
R12494 | T14482 | T14480 | pobj | transcription,in |
R12495 | T14483 | T14482 | prep | of,transcription |
R12496 | T14484 | T14485 | det | these,genes |
R12497 | T14485 | T14483 | pobj | genes,of |
R12498 | T14486 | T14488 | nmod | [,] |
R12499 | T14487 | T14488 | nummod | 12,] |
R12500 | T14488 | T14482 | appos | ],transcription |
R12501 | T14489 | T14453 | punct | .,reported |
R12502 | T14490 | T14492 | nsubj | We,confirm |
R12503 | T14491 | T14492 | advmod | now,confirm |
R12504 | T14492 | T14492 | ROOT | confirm,confirm |
R12505 | T14493 | T14492 | punct | ",",confirm |
R12506 | T14494 | T14492 | prep | in,confirm |
R12507 | T14495 | T14497 | amod | human,cells |
R12508 | T14496 | T14497 | compound | T,cells |
R12509 | T14497 | T14494 | pobj | cells,in |
R12510 | T14498 | T14492 | punct | ",",confirm |
R12511 | T14499 | T14502 | mark | that,uses |
R12512 | T14500 | T14502 | nsubj | GR,uses |
R12513 | T14501 | T14502 | advmod | also,uses |
R12514 | T14502 | T14492 | ccomp | uses,confirm |
R12515 | T14503 | T14507 | det | the,mechanism |
R12516 | T14504 | T14507 | amod | same,mechanism |
R12517 | T14505 | T14507 | amod | nuclear,mechanism |
R12518 | T14506 | T14507 | compound | import,mechanism |
R12519 | T14507 | T14502 | dobj | mechanism,uses |
R12520 | T14508 | T14502 | prep | as,uses |
R12521 | T14509 | T14510 | compound | GATA-3,[ |
R12522 | T14510 | T14508 | pobj | [,as |
R12523 | T14511 | T14512 | nummod | 22,] |
R12524 | T14512 | T14510 | appos | ],[ |
R12525 | T14513 | T14492 | punct | .,confirm |
R12526 | T14514 | T14516 | nsubj | We,propose |
R12527 | T14515 | T14516 | advmod | therefore,propose |
R12528 | T14516 | T14516 | ROOT | propose,propose |
R12529 | T14517 | T14519 | mark | that,is |
R12530 | T14518 | T14519 | expl | there,is |
R12531 | T14519 | T14516 | ccomp | is,propose |
R12532 | T14520 | T14519 | attr | competition,is |
R12533 | T14521 | T14520 | prep | between,competition |
R12534 | T14522 | T14523 | compound | ligand-activated,GR |
R12535 | T14523 | T14521 | pobj | GR,between |
R12536 | T14524 | T14523 | cc | and,GR |
R12537 | T14525 | T14523 | conj | phospho-GATA-3,GR |
R12538 | T14526 | T14520 | prep | for,competition |
R12539 | T14527 | T14528 | amod | nuclear,import |
R12540 | T14528 | T14526 | pobj | import,for |
R12541 | T14529 | T14516 | punct | .,propose |
R12542 | T14530 | T14534 | advmod | Furthermore,shown |
R12543 | T14531 | T14534 | punct | ",",shown |
R12544 | T14532 | T14534 | nsubj | we,shown |
R12545 | T14533 | T14534 | aux | have,shown |
R12546 | T14534 | T14534 | ROOT | shown,shown |
R12547 | T14535 | T14537 | mark | that,is |
R12548 | T14536 | T14537 | expl | there,is |
R12549 | T14537 | T14534 | ccomp | is,shown |
R12550 | T14538 | T14539 | amod | preferential,binding |
R12551 | T14539 | T14537 | attr | binding,is |
R12552 | T14540 | T14539 | prep | of,binding |
R12553 | T14541 | T14540 | pobj | importin-α,of |
R12554 | T14542 | T14543 | aux | to,activated |
R12555 | T14543 | T14534 | xcomp | activated,shown |
R12556 | T14544 | T14543 | dobj | GR,activated |
R12557 | T14545 | T14543 | prep | over,activated |
R12558 | T14546 | T14545 | pobj | phospho-GATA-3,over |
R12559 | T14547 | T14534 | punct | ",",shown |
R12560 | T14548 | T14553 | mark | so,reduce |
R12561 | T14549 | T14553 | mark | that,reduce |
R12562 | T14550 | T14553 | nsubj | corticosteroids,reduce |
R12563 | T14551 | T14553 | aux | would,reduce |
R12564 | T14552 | T14553 | advmod | preferentially,reduce |
R12565 | T14553 | T14534 | advcl | reduce,shown |
R12566 | T14554 | T14555 | compound | GATA-3,entry |
R12567 | T14555 | T14553 | dobj | entry,reduce |
R12568 | T14556 | T14553 | cc | and,reduce |
R12569 | T14557 | T14559 | advmod | thus,switch |
R12570 | T14558 | T14559 | advmod | rapidly,switch |
R12571 | T14559 | T14553 | conj | switch,reduce |
R12572 | T14560 | T14559 | prt | off,switch |
R12573 | T14561 | T14563 | nummod | Th2,transcription |
R12574 | T14562 | T14563 | compound | gene,transcription |
R12575 | T14563 | T14559 | dobj | transcription,switch |
R12576 | T14564 | T14559 | prep | without,switch |
R12577 | T14565 | T14566 | det | any,need |
R12578 | T14566 | T14564 | pobj | need,without |
R12579 | T14567 | T14566 | prep | for,need |
R12580 | T14568 | T14570 | det | any,steps |
R12581 | T14569 | T14570 | amod | intermediate,steps |
R12582 | T14570 | T14567 | pobj | steps,for |
R12583 | T14571 | T14534 | punct | .,shown |
R12584 | T14572 | T14575 | advmod | Furthermore,was |
R12585 | T14573 | T14575 | punct | ",",was |
R12586 | T14574 | T14575 | expl | there,was |
R12587 | T14575 | T14575 | ROOT | was,was |
R12588 | T14576 | T14577 | det | some,degree |
R12589 | T14577 | T14575 | attr | degree,was |
R12590 | T14578 | T14577 | prep | of,degree |
R12591 | T14579 | T14578 | pobj | specificity,of |
R12592 | T14580 | T14577 | prep | for,degree |
R12593 | T14581 | T14580 | pobj | GATA-3,for |
R12594 | T14582 | T14577 | punct | ",",degree |
R12595 | T14583 | T14594 | mark | as,affected |
R12596 | T14584 | T14585 | amod | nuclear,translocation |
R12597 | T14585 | T14583 | pobj | translocation,as |
R12598 | T14586 | T14585 | prep | of,translocation |
R12599 | T14587 | T14589 | det | the,subunit |
R12600 | T14588 | T14589 | nummod | p65,subunit |
R12601 | T14589 | T14586 | pobj | subunit,of |
R12602 | T14590 | T14589 | prep | of,subunit |
R12603 | T14591 | T14590 | pobj | NF-κB,of |
R12604 | T14592 | T14594 | auxpass | was,affected |
R12605 | T14593 | T14594 | neg | not,affected |
R12606 | T14594 | T14575 | advcl | affected,was |
R12607 | T14595 | T14594 | agent | by,affected |
R12608 | T14596 | T14597 | amod | corticosteroid,exposure |
R12609 | T14597 | T14595 | pobj | exposure,by |
R12610 | T14598 | T14575 | punct | .,was |
R12611 | T14599 | T14600 | nsubj | We,tested |
R12612 | T14600 | T14600 | ROOT | tested,tested |
R12613 | T14601 | T14603 | det | some,explanations |
R12614 | T14602 | T14603 | amod | alternative,explanations |
R12615 | T14603 | T14600 | dobj | explanations,tested |
R12616 | T14604 | T14603 | prep | for,explanations |
R12617 | T14605 | T14606 | det | this,effect |
R12618 | T14606 | T14604 | pobj | effect,for |
R12619 | T14607 | T14606 | prep | of,effect |
R12620 | T14608 | T14607 | pobj | FP,of |
R12621 | T14609 | T14606 | prep | on,effect |
R12622 | T14610 | T14612 | nmod | GATA-3,exclusion |
R12623 | T14611 | T14612 | amod | nuclear,exclusion |
R12624 | T14612 | T14609 | pobj | exclusion,on |
R12625 | T14613 | T14600 | cc | and,tested |
R12626 | T14614 | T14600 | conj | failed,tested |
R12627 | T14615 | T14616 | aux | to,show |
R12628 | T14616 | T14614 | xcomp | show,failed |
R12629 | T14617 | T14620 | mark | that,enhances |
R12630 | T14618 | T14620 | nsubj | FP,enhances |
R12631 | T14619 | T14620 | preconj | either,enhances |
R12632 | T14620 | T14616 | ccomp | enhances,show |
R12633 | T14621 | T14623 | amod | GATA-3,export |
R12634 | T14622 | T14623 | amod | nuclear,export |
R12635 | T14623 | T14620 | dobj | export,enhances |
R12636 | T14624 | T14620 | advmod | directly,enhances |
R12637 | T14625 | T14620 | cc | or,enhances |
R12638 | T14626 | T14620 | conj | induces,enhances |
R12639 | T14627 | T14628 | amod | GATA-3,degradation |
R12640 | T14628 | T14626 | dobj | degradation,induces |
R12641 | T14629 | T14600 | punct | .,tested |
R12642 | T14630 | T14631 | det | The,evidence |
R12643 | T14631 | T14638 | nsubj | evidence,does |
R12644 | T14632 | T14631 | prep | from,evidence |
R12645 | T14633 | T14638 | det | the,does |
R12646 | T14634 | T14638 | prep | in,does |
R12647 | T14635 | T14636 | amod | vitro,competition |
R12648 | T14636 | T14637 | compound | competition,assays |
R12649 | T14637 | T14634 | pobj | assays,in |
R12650 | T14638 | T14642 | aux | does,suggest |
R12651 | T14639 | T14642 | punct | ",",suggest |
R12652 | T14640 | T14642 | advmod | however,suggest |
R12653 | T14641 | T14642 | punct | ",",suggest |
R12654 | T14642 | T14642 | ROOT | suggest,suggest |
R12655 | T14643 | T14649 | mark | that,attenuate |
R12656 | T14644 | T14646 | amod | purified,GR |
R12657 | T14645 | T14646 | amod | activated,GR |
R12658 | T14646 | T14649 | nsubj | GR,attenuate |
R12659 | T14647 | T14649 | aux | can,attenuate |
R12660 | T14648 | T14649 | advmod | clearly,attenuate |
R12661 | T14649 | T14642 | ccomp | attenuate,suggest |
R12662 | T14650 | T14651 | amod | purified,phospho-GATA-3 |
R12663 | T14651 | T14649 | dobj | phospho-GATA-3,attenuate |
R12664 | T14652 | T14653 | amod | importin-α,association |
R12665 | T14653 | T14651 | appos | association,phospho-GATA-3 |
R12666 | T14654 | T14649 | cc | and,attenuate |
R12667 | T14655 | T14660 | mark | that,occur |
R12668 | T14656 | T14657 | det | the,converse |
R12669 | T14657 | T14660 | nsubj | converse,occur |
R12670 | T14658 | T14660 | aux | does,occur |
R12671 | T14659 | T14660 | neg | not,occur |
R12672 | T14660 | T14649 | conj | occur,attenuate |
R12673 | T14661 | T14642 | punct | .,suggest |
R12674 | T14662 | T14666 | advmod | Furthermore,shown |
R12675 | T14663 | T14666 | punct | ",",shown |
R12676 | T14664 | T14666 | nsubj | we,shown |
R12677 | T14665 | T14666 | aux | have,shown |
R12678 | T14666 | T14666 | ROOT | shown,shown |
R12679 | T14667 | T14671 | mark | that,associate |
R12680 | T14668 | T14669 | advmod | only,phospho-GATA-3 |
R12681 | T14669 | T14671 | nsubj | phospho-GATA-3,associate |
R12682 | T14670 | T14671 | aux | can,associate |
R12683 | T14671 | T14666 | ccomp | associate,shown |
R12684 | T14672 | T14671 | prep | with,associate |
R12685 | T14673 | T14672 | pobj | importin-α,with |
R12686 | T14674 | T14666 | punct | .,shown |
R12687 | T14675 | T14676 | det | This,mechanism |
R12688 | T14676 | T14677 | nsubj | mechanism,is |
R12689 | T14677 | T14677 | ROOT | is,is |
R12690 | T14678 | T14677 | acomp | sensitive,is |
R12691 | T14679 | T14678 | prep | to,sensitive |
R12692 | T14680 | T14681 | advmod | very,low |
R12693 | T14681 | T14682 | amod | low,concentrations |
R12694 | T14682 | T14679 | pobj | concentrations,to |
R12695 | T14683 | T14682 | prep | of,concentrations |
R12696 | T14684 | T14683 | pobj | corticosteroid,of |
R12697 | T14685 | T14677 | cc | and,is |
R12698 | T14686 | T14687 | aux | would,be |
R12699 | T14687 | T14677 | conj | be,is |
R12700 | T14688 | T14687 | acomp | rapid,be |
R12701 | T14689 | T14688 | prep | in,rapid |
R12702 | T14690 | T14689 | pobj | onset,in |
R12703 | T14691 | T14698 | mark | as,required |
R12704 | T14692 | T14693 | det | no,changes |
R12705 | T14693 | T14698 | nsubjpass | changes,required |
R12706 | T14694 | T14693 | prep | in,changes |
R12707 | T14695 | T14696 | compound | protein,synthesis |
R12741 | T14729 | T14728 | prep | to,prior |
R12742 | T14730 | T14731 | compound | MKP-1,induction |
R12743 | T14731 | T14729 | pobj | induction,to |
R12744 | T14732 | T14705 | punct | .,contribute |
R12745 | T14733 | T14735 | nsubj | Corticosteroids,modulate |
R12746 | T14734 | T14735 | aux | can,modulate |
R12747 | T14735 | T14735 | ROOT | modulate,modulate |
R12748 | T14736 | T14738 | nummod | p38,activity |
R12749 | T14737 | T14738 | compound | MAPK,activity |
R12750 | T14738 | T14735 | dobj | activity,modulate |
R12751 | T14739 | T14735 | prep | through,modulate |
R12752 | T14740 | T14741 | det | the,induction |
R12753 | T14741 | T14739 | pobj | induction,through |
R12754 | T14742 | T14741 | prep | of,induction |
R12755 | T14743 | T14742 | pobj | MKP-1,of |
R12756 | T14744 | T14743 | punct | ",",MKP-1 |
R12757 | T14745 | T14748 | det | a,inhibitor |
R12758 | T14746 | T14748 | amod | potent,inhibitor |
R12759 | T14747 | T14748 | amod | endogenous,inhibitor |
R12760 | T14748 | T14743 | appos | inhibitor,MKP-1 |
R12761 | T14749 | T14748 | prep | of,inhibitor |
R12762 | T14750 | T14751 | compound | MAPK,function |
R12763 | T14751 | T14749 | pobj | function,of |
R12764 | T14752 | T14754 | nmod | [,] |
R12765 | T14753 | T14754 | nummod | 38,] |
R12766 | T14754 | T14748 | appos | ],inhibitor |
R12767 | T14755 | T14754 | punct | ",",] |
R12768 | T14756 | T14758 | nmod | [,] |
R12769 | T14757 | T14758 | nummod | 39,] |
R12770 | T14758 | T14754 | appos | ],] |
R12771 | T14759 | T14735 | punct | .,modulate |
R12772 | T14760 | T14761 | nsubj | We,report |
R12773 | T14761 | T14761 | ROOT | report,report |
R12774 | T14762 | T14761 | advmod | here,report |
R12775 | T14763 | T14765 | det | a,induction |
R12776 | T14764 | T14765 | amod | rapid,induction |
R12777 | T14765 | T14761 | dobj | induction,report |
R12778 | T14766 | T14765 | prep | of,induction |
R12779 | T14767 | T14768 | compound | MKP-1,mRNA |
R12780 | T14768 | T14766 | pobj | mRNA,of |
R12781 | T14769 | T14765 | prep | following,induction |
R12782 | T14770 | T14769 | pobj | stimulation,following |
R12783 | T14771 | T14770 | prep | of,stimulation |
R12784 | T14772 | T14771 | pobj | cells,of |
R12785 | T14773 | T14772 | prep | with,cells |
R12786 | T14774 | T14775 | advmod | relatively,high |
R12787 | T14775 | T14776 | amod | high,concentrations |
R12788 | T14776 | T14773 | pobj | concentrations,with |
R12789 | T14777 | T14776 | prep | of,concentrations |
R12790 | T14778 | T14777 | pobj | FP,of |
R12791 | T14779 | T14761 | punct | .,report |
R12792 | T14780 | T14781 | nsubj | We,hypothesize |
R12793 | T14781 | T14781 | ROOT | hypothesize,hypothesize |
R12794 | T14782 | T14789 | mark | that,reduce |
R12795 | T14783 | T14785 | det | this,induction |
R12796 | T14784 | T14785 | amod | rapid,induction |
R12797 | T14785 | T14789 | nsubj | induction,reduce |
R12798 | T14786 | T14785 | prep | of,induction |
R12799 | T14787 | T14786 | pobj | MKP-1,of |
R12800 | T14788 | T14789 | aux | can,reduce |
R12801 | T14789 | T14781 | ccomp | reduce,hypothesize |
R12802 | T14790 | T14792 | amod | GATA-3,import |
R12803 | T14791 | T14792 | amod | nuclear,import |
R12804 | T14792 | T14789 | dobj | import,reduce |
R12805 | T14793 | T14789 | prep | by,reduce |
R12806 | T14794 | T14793 | pcomp | attenuating,by |
R12807 | T14795 | T14797 | nummod | p38,activity |
R12808 | T14796 | T14797 | compound | MAPK,activity |
R12809 | T14797 | T14794 | dobj | activity,attenuating |
R12810 | T14798 | T14797 | cc | and,activity |
R12811 | T14799 | T14801 | amod | subsequent,phosphorylation |
R12812 | T14800 | T14801 | compound | GATA-3,phosphorylation |
R12813 | T14801 | T14797 | conj | phosphorylation,activity |
R12814 | T14802 | T14789 | punct | ",",reduce |
R12815 | T14803 | T14804 | advmod | thus,preventing |
R12816 | T14804 | T14789 | advcl | preventing,reduce |
R12817 | T14805 | T14806 | amod | nuclear,translocation |
R12818 | T14806 | T14804 | dobj | translocation,preventing |
R12819 | T14807 | T14781 | punct | .,hypothesize |
R12820 | T14808 | T14809 | det | The,location |
R12821 | T14809 | T14825 | nsubj | location,are |
R12822 | T14810 | T14809 | prep | of,location |
R12823 | T14811 | T14813 | det | the,residue |
R12824 | T14812 | T14813 | compound | serine,residue |
R12825 | T14813 | T14810 | pobj | residue,of |
R12826 | T14814 | T14813 | punct | (,residue |
R12827 | T14815 | T14813 | appos | s,residue |
R12828 | T14816 | T14813 | punct | ),residue |
R12829 | T14817 | T14813 | prep | of,residue |
R12830 | T14818 | T14817 | pobj | GATA-3,of |
R12831 | T14819 | T14821 | nsubjpass | that,phosphorylated |
R12832 | T14820 | T14821 | auxpass | are,phosphorylated |
R12833 | T14821 | T14813 | relcl | phosphorylated,residue |
R12834 | T14822 | T14821 | agent | by,phosphorylated |
R12835 | T14823 | T14824 | nummod | p38,MAPK |
R12836 | T14824 | T14822 | pobj | MAPK,by |
R12837 | T14825 | T14825 | ROOT | are,are |
R12838 | T14826 | T14825 | advmod | currently,are |
R12839 | T14827 | T14825 | acomp | unknown,are |
R12840 | T14828 | T14825 | punct | ",",are |
R12841 | T14829 | T14825 | cc | but,are |
R12842 | T14830 | T14832 | det | a,search |
R12843 | T14831 | T14832 | compound | bioinformatics,search |
R12844 | T14832 | T14839 | nsubj | search,indicates |
R12845 | T14833 | T14832 | punct | (,search |
R12846 | T14834 | T14835 | compound | Motif,Scanner |
R12847 | T14835 | T14832 | appos | Scanner,search |
R12848 | T14836 | T14835 | punct | ",",Scanner |
R12849 | T14837 | T14835 | appos | http://scansite.mit.edu/motifscan_seq.phtml,Scanner |
R12850 | T14838 | T14835 | punct | ),Scanner |
R12851 | T14839 | T14825 | conj | indicates,are |
R12852 | T14840 | T14841 | advmod | at,least |
R12853 | T14841 | T14842 | advmod | least,three |
R12854 | T14842 | T14847 | nummod | three,residues |
R12855 | T14843 | T14847 | amod | potential,residues |
R12856 | T14844 | T14847 | nummod | p38,residues |
R12857 | T14845 | T14847 | amod | MAPK-sensitive,residues |
R12858 | T14846 | T14847 | compound | serine,residues |
R12859 | T14847 | T14839 | dobj | residues,indicates |
R12860 | T14848 | T14839 | punct | .,indicates |
R12861 | T14849 | T14850 | mark | As,predicted |
R12862 | T14850 | T14871 | advcl | predicted,underlie |
R12863 | T14851 | T14850 | prep | from,predicted |
R12864 | T14852 | T14851 | pobj | these,from |
R12865 | T14853 | T14850 | prep | in,predicted |
R12866 | T14854 | T14855 | compound | vitro,data |
R12867 | T14855 | T14853 | pobj | data,in |
R12868 | T14856 | T14855 | punct | ",",data |
R12869 | T14857 | T14871 | nsubj | impairment,underlie |
R12870 | T14858 | T14857 | prep | of,impairment |
R12871 | T14859 | T14861 | amod | GATA-3,import |
R12872 | T14860 | T14861 | amod | nuclear,import |
R12873 | T14861 | T14858 | pobj | import,of |
R12874 | T14862 | T14857 | prep | by,impairment |
R12875 | T14863 | T14862 | pobj | FP,by |
R12876 | T14864 | T14871 | aux | may,underlie |
R12877 | T14865 | T14871 | punct | ",",underlie |
R12878 | T14866 | T14867 | advmod | at,least |
R12879 | T14867 | T14868 | advmod | least,in |
R12880 | T14868 | T14871 | prep | in,underlie |
R12881 | T14869 | T14868 | pobj | part,in |
R12882 | T14870 | T14871 | punct | ",",underlie |
R12883 | T14871 | T14871 | ROOT | underlie,underlie |
R12884 | T14872 | T14873 | det | the,efficacy |
R12885 | T14873 | T14871 | dobj | efficacy,underlie |
R12886 | T14874 | T14873 | prep | of,efficacy |
R12887 | T14875 | T14874 | pobj | corticosteroids,of |
R12888 | T14876 | T14871 | prep | in,underlie |
R12889 | T14877 | T14876 | pcomp | suppressing,in |
R12890 | T14878 | T14879 | amod | allergic,inflammation |
R12891 | T14879 | T14877 | dobj | inflammation,suppressing |
R12892 | T14880 | T14871 | punct | .,underlie |
R12893 | T14881 | T14885 | mark | Although,assess |
R12894 | T14882 | T14885 | nsubj | we,assess |
R12895 | T14883 | T14885 | aux | did,assess |
R12896 | T14884 | T14885 | neg | not,assess |
R12897 | T14885 | T14911 | advcl | assess,have |
R12898 | T14886 | T14889 | det | the,effect |
R12899 | T14887 | T14889 | amod | acute,effect |
R12900 | T14888 | T14889 | amod | inhibitory,effect |
R12901 | T14889 | T14885 | dobj | effect,assess |
R12902 | T14890 | T14889 | prep | of,effect |
R12903 | T14891 | T14890 | pobj | FP,of |
R12904 | T14892 | T14889 | prep | on,effect |
R12905 | T14893 | T14894 | det | the,expression |
R12906 | T14894 | T14892 | pobj | expression,on |
R12907 | T14895 | T14894 | prep | of,expression |
R12908 | T14896 | T14897 | compound | IL-4,mRNA |
R12909 | T14897 | T14895 | pobj | mRNA,of |
R12910 | T14898 | T14889 | prep | in,effect |
R12911 | T14899 | T14898 | pobj | vivo,in |
R12912 | T14900 | T14899 | punct | ",",vivo |
R12913 | T14901 | T14903 | det | a,inhalation |
R12914 | T14902 | T14903 | amod | single,inhalation |
R12915 | T14903 | T14911 | nsubj | inhalation,have |
R12916 | T14904 | T14903 | prep | of,inhalation |
R12917 | T14905 | T14904 | pobj | FP,of |
R12918 | T14906 | T14905 | punct | (,FP |
R12919 | T14907 | T14908 | nummod | 500,µg |
R12920 | T14908 | T14905 | appos | µg,FP |
R12921 | T14909 | T14905 | punct | ),FP |
R12922 | T14910 | T14911 | aux | may,have |
R12923 | T14911 | T14911 | ROOT | have,have |
R12924 | T14912 | T14913 | amod | comparable,effects |
R12925 | T14913 | T14911 | dobj | effects,have |
R12926 | T14914 | T14911 | punct | ",",have |
R12927 | T14915 | T14917 | mark | as,provides |
R12928 | T14916 | T14917 | nsubj | it,provides |
R12929 | T14917 | T14911 | advcl | provides,have |
R12930 | T14918 | T14919 | compound | plasma,levels |
R12931 | T14919 | T14917 | dobj | levels,provides |
R12932 | T14920 | T14917 | prep | within,provides |
R12933 | T14921 | T14923 | det | a,range |
R12934 | T14922 | T14923 | amod | relevant,range |
R12935 | T14923 | T14920 | pobj | range,within |
R12936 | T14924 | T14923 | prep | of,range |
R12937 | T14925 | T14924 | pobj | concentrations,of |
R12938 | T14926 | T14911 | advcl | used,have |
R12939 | T14927 | T14928 | aux | to,suppress |
R12940 | T14928 | T14926 | xcomp | suppress,used |
R12941 | T14929 | T14930 | compound | IL-4,transcription |
R12942 | T14930 | T14928 | dobj | transcription,suppress |
R12943 | T14931 | T14928 | prep | in,suppress |
R12944 | T14932 | T14931 | pobj | our,in |
R12945 | T14933 | T14928 | prep | in,suppress |
R12946 | T14934 | T14935 | amod | vitro,system |
R12947 | T14935 | T14933 | pobj | system,in |
R12948 | T14936 | T14938 | nmod | [,] |
R12949 | T14937 | T14938 | nummod | 37,] |
R12950 | T14938 | T14928 | conj | ],suppress |
R12951 | T14939 | T14911 | punct | .,have |
R12952 | T14940 | T14942 | det | A,dose |
R12953 | T14941 | T14942 | amod | lower,dose |
R12954 | T14942 | T14950 | nsubj | dose,was |
R12955 | T14943 | T14942 | prep | of,dose |
R12956 | T14944 | T14945 | amod | inhaled,FP |
R12957 | T14945 | T14943 | pobj | FP,of |
R12958 | T14946 | T14945 | punct | (,FP |
R12959 | T14947 | T14948 | nummod | 100,µg |
R12960 | T14948 | T14945 | appos | µg,FP |
R12961 | T14949 | T14948 | punct | ),µg |
R12962 | T14950 | T14950 | ROOT | was,was |
R12963 | T14951 | T14950 | neg | not,was |
R12964 | T14952 | T14950 | acomp | effective,was |
R12965 | T14953 | T14950 | punct | ",",was |
R12966 | T14954 | T14950 | cc | but,was |
R12967 | T14955 | T14956 | compound | plasma,concentrations |
R12968 | T14956 | T14958 | nsubj | concentrations,be |
R12969 | T14957 | T14958 | aux | may,be |
R12970 | T14958 | T14950 | conj | be,was |
R12971 | T14959 | T14958 | prep | below,be |
R12972 | T14960 | T14959 | pobj | those,below |
R12973 | T14961 | T14960 | acl | required,those |
R12974 | T14962 | T14961 | prep | for,required |
R12975 | T14963 | T14964 | amod | GATA-3,inhibition |
R12976 | T14964 | T14962 | pobj | inhibition,for |
R12977 | T14965 | T14958 | punct | .,be |
R12978 | T14966 | T14969 | advmod | However,is |
R12979 | T14967 | T14969 | punct | ",",is |
R12980 | T14968 | T14969 | nsubj | it,is |
R12981 | T14969 | T14969 | ROOT | is,is |
R12982 | T14970 | T14969 | acomp | likely,is |
R12983 | T14971 | T14984 | mark | that,be |
R12984 | T14972 | T14974 | det | the,concentrations |
R12985 | T14973 | T14974 | amod | higher,concentrations |
R12986 | T14974 | T14984 | nsubj | concentrations,be |
R12987 | T14975 | T14974 | prep | of,concentrations |
R12988 | T14976 | T14975 | pobj | FP,of |
R12989 | T14977 | T14974 | prep | in,concentrations |
R12990 | T14978 | T14979 | det | the,airways |
R12991 | T14979 | T14977 | pobj | airways,in |
R12992 | T14980 | T14974 | prep | after,concentrations |
R12993 | T14981 | T14982 | amod | inhaled,administration |
R12994 | T14982 | T14980 | pobj | administration,after |
R12995 | T14983 | T14984 | aux | would,be |
R12996 | T14984 | T14970 | ccomp | be,likely |
R12997 | T14985 | T14984 | acomp | effective,be |
R12998 | T14986 | T14985 | prep | in,effective |
R12999 | T14987 | T14986 | pcomp | inhibiting,in |
R13000 | T14988 | T14987 | dobj | GATA-3,inhibiting |
R13001 | T14989 | T14987 | prep | in,inhibiting |
R13002 | T14990 | T14991 | compound | airway,T |
R13003 | T14991 | T14992 | compound | T,cells |
R13004 | T14992 | T14989 | pobj | cells,in |
R13005 | T14993 | T14992 | prep | of,cells |
R13006 | T14994 | T14995 | compound | asthma,patients |
R13007 | T14995 | T14993 | pobj | patients,of |
R13008 | T14996 | T14969 | punct | .,is |
R13009 | T14997 | T14998 | det | The,study |
R13010 | T14998 | T15010 | nsubj | study,demonstrates |
R13011 | T14999 | T14998 | prep | of,study |
R13012 | T15000 | T14999 | pobj | PBMCs,of |
R13013 | T15001 | T14998 | prep | from,study |
R13014 | T15002 | T15003 | compound | asthma,patients |
R13015 | T15003 | T15001 | pobj | patients,from |
R13016 | T15004 | T14998 | acl | treated,study |
R13017 | T15005 | T15004 | prep | with,treated |
R13018 | T15006 | T15008 | amod | inhaled,therapy |
R13019 | T15007 | T15008 | amod | corticosteroid,therapy |
R13020 | T15008 | T15005 | pobj | therapy,with |
R13021 | T15009 | T15010 | advmod | clearly,demonstrates |
R13022 | T15010 | T15010 | ROOT | demonstrates,demonstrates |
R13023 | T15011 | T15015 | mark | that,are |
R13024 | T15012 | T15014 | det | these,mechanisms |
R13025 | T15013 | T15014 | amod | molecular,mechanisms |
R13026 | T15014 | T15015 | nsubj | mechanisms,are |
R13027 | T15015 | T15010 | ccomp | are,demonstrates |
R13028 | T15016 | T15015 | acomp | likely,are |
R13029 | T15017 | T15019 | aux | to,occur |
R13030 | T15018 | T15019 | advmod | also,occur |
R13031 | T15019 | T15016 | xcomp | occur,likely |
R13032 | T15020 | T15019 | prep | in,occur |
R13033 | T15021 | T15020 | pobj | patients,in |
R13034 | T15022 | T15021 | prep | at,patients |
R13035 | T15023 | T15024 | amod | therapeutic,doses |
R13036 | T15024 | T15022 | pobj | doses,at |
R13037 | T15025 | T15024 | prep | of,doses |
R13038 | T15026 | T15027 | amod | inhaled,corticosteroids |
R13039 | T15027 | T15025 | pobj | corticosteroids,of |
R13040 | T15028 | T15010 | punct | .,demonstrates |
R13041 | T15029 | T15035 | prep | In,shown |
R13042 | T15030 | T15029 | pobj | addition,In |
R13043 | T15031 | T15035 | punct | ",",shown |
R13044 | T15032 | T15033 | amod | previous,studies |
R13045 | T15033 | T15035 | nsubj | studies,shown |
R13046 | T15034 | T15035 | aux | have,shown |
R13047 | T15035 | T15035 | ROOT | shown,shown |
R13048 | T15036 | T15039 | mark | that,suppress |
R13049 | T15037 | T15039 | nsubj | corticosteroids,suppress |
R13050 | T15038 | T15039 | aux | can,suppress |
R13051 | T15039 | T15035 | ccomp | suppress,shown |
R13052 | T15040 | T15043 | nmod | IL-4,release |
R13053 | T15041 | T15040 | cc | and,IL-4 |
R13054 | T15042 | T15043 | compound | IL-5,release |
R13055 | T15043 | T15039 | dobj | release,suppress |
R13056 | T15044 | T15043 | prep | from,release |
R13057 | T15045 | T15047 | amod | peripheral,cells |
R13058 | T15046 | T15047 | compound | blood,cells |
R13059 | T15047 | T15044 | pobj | cells,from |
R13060 | T15048 | T15047 | prep | of,cells |
R13061 | T15049 | T15050 | compound | asthma,patients |
R13062 | T15050 | T15048 | pobj | patients,of |
R13063 | T15051 | T15043 | prep | in,release |
R13064 | T15052 | T15051 | pobj | vitro,in |
R13065 | T15053 | T15051 | cc | and,in |
R13066 | T15054 | T15051 | conj | in,in |
R13067 | T15055 | T15056 | compound | vivo,[ |
R13068 | T15056 | T15054 | pobj | [,in |
R13069 | T15057 | T15058 | nummod | 40,] |
R13070 | T15058 | T15056 | appos | ],[ |
R13071 | T15059 | T15056 | appos | [,[ |
R13072 | T15060 | T15061 | nummod | 42,] |
R13073 | T15061 | T15056 | appos | ],[ |
R13074 | T15062 | T15035 | punct | .,shown |
R13075 | T15063 | T15068 | prep | In,provide |
R13076 | T15064 | T15063 | pobj | summary,In |
R13077 | T15065 | T15068 | punct | ",",provide |
R13078 | T15066 | T15067 | poss | our,data |
R13079 | T15067 | T15068 | nsubj | data,provide |
R13080 | T15068 | T15068 | ROOT | provide,provide |
R13081 | T15069 | T15068 | dobj | evidence,provide |
R13082 | T15070 | T15069 | prep | for,evidence |
R13083 | T15071 | T15073 | det | a,action |
R13084 | T15072 | T15073 | compound | novel,action |
R13085 | T15073 | T15070 | pobj | action,for |
R13086 | T15074 | T15073 | prep | of,action |
R13087 | T15075 | T15074 | pobj | corticosteroids,of |
R13088 | T15076 | T15069 | punct | :,evidence |
R13089 | T15077 | T15069 | conj | suppression,evidence |
R13090 | T15078 | T15077 | prep | of,suppression |
R13091 | T15079 | T15080 | amod | allergic,inflammation |
R13092 | T15080 | T15078 | pobj | inflammation,of |
R13093 | T15081 | T15068 | prep | through,provide |
R13094 | T15082 | T15085 | det | a,effect |
R13095 | T15083 | T15085 | amod | rapid,effect |
R13096 | T15084 | T15085 | amod | inhibitory,effect |
R13097 | T15085 | T15081 | pobj | effect,through |
R13098 | T15086 | T15085 | prep | on,effect |
R13099 | T15087 | T15089 | amod | GATA-3,translocation |
R13100 | T15088 | T15089 | amod | nuclear,translocation |
R13101 | T15089 | T15086 | pobj | translocation,on |
R13102 | T15090 | T15085 | prep | by,effect |
R13103 | T15091 | T15092 | amod | preferential,binding |
R13104 | T15092 | T15085 | amod | binding,effect |
R13105 | T15093 | T15092 | prep | to,binding |
R13106 | T15094 | T15098 | det | the,protein |
R13107 | T15095 | T15098 | amod | shared,protein |
R13108 | T15096 | T15097 | amod | nuclear,import |
R13109 | T15097 | T15098 | compound | import,protein |
R13110 | T15098 | T15099 | compound | protein,importin-α |
R13111 | T15099 | T15093 | pobj | importin-α,to |
R13112 | T15100 | T15081 | cc | and,through |
R13113 | T15101 | T15081 | conj | by,through |
R13114 | T15102 | T15104 | det | a,mechanism |
R13115 | T15103 | T15104 | amod | second,mechanism |
R13116 | T15104 | T15101 | pobj | mechanism,by |
R13117 | T15105 | T15104 | acl | involving,mechanism |
R13118 | T15106 | T15107 | amod | increased,synthesis |
R13119 | T15107 | T15068 | dobj | synthesis,provide |
R13120 | T15108 | T15107 | prep | of,synthesis |
R13121 | T15109 | T15108 | pobj | MKP-1,of |
R13122 | T15110 | T15109 | punct | ",",MKP-1 |
R13123 | T15111 | T15112 | nsubj | which,inhibits |
R13124 | T15112 | T15109 | relcl | inhibits,MKP-1 |
R13125 | T15113 | T15114 | nummod | p38,MAPK |
R13126 | T15114 | T15112 | dobj | MAPK,inhibits |
R13127 | T15115 | T15068 | punct | ",",provide |
R13128 | T15116 | T15117 | advmod | thus,preventing |
R13129 | T15117 | T15068 | advcl | preventing,provide |
R13130 | T15118 | T15119 | det | the,phosphorylation |
R13131 | T15119 | T15117 | dobj | phosphorylation,preventing |
R13132 | T15120 | T15119 | prep | of,phosphorylation |
R13133 | T15121 | T15120 | pobj | GATA-3,of |
R13134 | T15122 | T15123 | nsubj | that,is |
R13135 | T15123 | T15121 | relcl | is,GATA-3 |
R13136 | T15124 | T15123 | acomp | necessary,is |
R13137 | T15125 | T15124 | prep | for,necessary |
R13138 | T15126 | T15127 | amod | nuclear,translocation |
R13139 | T15127 | T15125 | pobj | translocation,for |
R13140 | T15128 | T15127 | prep | of,translocation |
R13141 | T15129 | T15128 | pobj | GATA-3,of |
R13142 | T15130 | T15068 | punct | .,provide |
R13143 | T15131 | T15133 | det | These,mechanisms |
R13144 | T15132 | T15133 | nummod | two,mechanisms |
R13145 | T15133 | T15134 | nsubj | mechanisms,are |
R13146 | T15134 | T15134 | ROOT | are,are |
R13147 | T15135 | T15134 | acomp | likely,are |
R13148 | T15136 | T15137 | aux | to,be |
R13149 | T15137 | T15135 | xcomp | be,likely |
R13150 | T15138 | T15137 | acomp | synergistic,be |
R13151 | T15139 | T15137 | punct | ",",be |
R13152 | T15140 | T15137 | advcl | accounting,be |
R13153 | T15141 | T15140 | prep | for,accounting |
R13154 | T15142 | T15146 | det | the,effect |
R13155 | T15143 | T15146 | amod | rapid,effect |
R13156 | T15144 | T15143 | cc | and,rapid |
R13157 | T15145 | T15143 | conj | potent,rapid |
R13158 | T15146 | T15141 | pobj | effect,for |
R13159 | T15147 | T15146 | prep | of,effect |
R13160 | T15148 | T15147 | pobj | corticosteroids,of |
R13161 | T15149 | T15148 | prep | on,corticosteroids |
R13162 | T15150 | T15151 | amod | allergic,inflammation |
R13163 | T15151 | T15149 | pobj | inflammation,on |
R13164 | T15152 | T15134 | punct | .,are |
R13165 | T15153 | T15155 | nsubjpass | This,exemplified |
R13166 | T15154 | T15155 | auxpass | is,exemplified |
R13167 | T15155 | T15155 | ROOT | exemplified,exemplified |
R13168 | T15156 | T15155 | agent | by,exemplified |
R13169 | T15157 | T15160 | det | the,effect |
R13170 | T15158 | T15160 | amod | rapid,effect |
R13171 | T15159 | T15160 | amod | inhibitory,effect |
R13172 | T15160 | T15156 | pobj | effect,by |
R13173 | T15161 | T15160 | prep | of,effect |
R13174 | T15162 | T15163 | amod | topical,corticosteroids |
R13175 | T15163 | T15161 | pobj | corticosteroids,of |
R13176 | T15164 | T15163 | prep | on,corticosteroids |
R13177 | T15165 | T15168 | amod | nasal,release |
R13178 | T15166 | T15168 | amod | Th2,release |
R13179 | T15167 | T15168 | compound | cytokine,release |
R13180 | T15168 | T15164 | pobj | release,on |
R13181 | T15169 | T15155 | prep | after,exemplified |
R13182 | T15170 | T15171 | compound | allergen,provocation |
R13183 | T15171 | T15169 | pobj | provocation,after |
R13184 | T15172 | T15171 | prep | in,provocation |
R13185 | T15173 | T15172 | pobj | individuals,in |
R13186 | T15174 | T15173 | prep | with,individuals |
R13187 | T15175 | T15177 | amod | seasonal,rhinitis |
R13188 | T15176 | T15177 | amod | allergic,rhinitis |
R13189 | T15177 | T15174 | pobj | rhinitis,with |
R13190 | T15178 | T15177 | punct | (,rhinitis |
R13191 | T15179 | T15180 | compound | hay,fever |
R13192 | T15180 | T15177 | appos | fever,rhinitis |
R13193 | T15181 | T15177 | punct | ),rhinitis |
R13194 | T15182 | T15184 | quantmod | [,] |
R13195 | T15183 | T15184 | nummod | 43,] |
R13196 | T15184 | T15173 | appos | ],individuals |
R13197 | T15185 | T15155 | punct | .,exemplified |
R13198 | T15186 | T15193 | nsubj | Prevention,provide |
R13199 | T15187 | T15186 | prep | of,Prevention |
R13200 | T15188 | T15189 | amod | phospho-GATA-3,interaction |
R13201 | T15189 | T15187 | pobj | interaction,of |
R13202 | T15190 | T15189 | prep | with,interaction |
R13203 | T15191 | T15190 | pobj | importin-α,with |
R13204 | T15192 | T15193 | aux | may,provide |
R13205 | T15193 | T15193 | ROOT | provide,provide |
R13206 | T15194 | T15196 | det | a,approach |
R13207 | T15195 | T15196 | amod | new,approach |
R13208 | T15196 | T15193 | dobj | approach,provide |
R13209 | T15197 | T15196 | prep | for,approach |
R13210 | T15198 | T15199 | det | the,development |
R13211 | T15199 | T15197 | pobj | development,for |
R13212 | T15200 | T15199 | prep | of,development |
R13213 | T15201 | T15202 | compound | novel,therapies |
R13214 | T15202 | T15200 | pobj | therapies,of |
R13215 | T15203 | T15202 | prep | for,therapies |
R13216 | T15204 | T15205 | det | the,treatment |
R13217 | T15205 | T15203 | pobj | treatment,for |
R13218 | T15206 | T15205 | prep | of,treatment |
R13219 | T15207 | T15208 | amod | allergic,diseases |
R13220 | T15208 | T15206 | pobj | diseases,of |
R13221 | T15209 | T15193 | punct | .,provide |
R14001 | T16315 | T16317 | nmod | Fluticasone,down-regulates |
R14002 | T16316 | T16317 | amod | propionate,down-regulates |
R14003 | T16317 | T16317 | ROOT | down-regulates,down-regulates |
R14004 | T16318 | T16321 | nmod | Th2,expression |
R14005 | T16319 | T16321 | compound | cytokine,expression |
R14006 | T16320 | T16321 | compound | gene,expression |
R14007 | T16321 | T16317 | dobj | expression,down-regulates |
R14008 | T16322 | T16321 | cc | and,expression |
R14009 | T16323 | T16317 | conj | inhibits,down-regulates |
R14010 | T16324 | T16326 | nmod | GATA-3,import |
R14011 | T16325 | T16326 | amod | nuclear,import |
R14012 | T16326 | T16323 | dobj | import,inhibits |
R14013 | T16327 | T16323 | punct | .,inhibits |
R14014 | T16328 | T16329 | punct | (,A |
R14015 | T16329 | T16329 | ROOT | A,A |
R14016 | T16330 | T16329 | punct | ),A |
R14017 | T16331 | T16334 | amod | Anti-CD3,treatment |
R14018 | T16332 | T16334 | nmod | /,treatment |
R14019 | T16333 | T16334 | nummod | CD28,treatment |
R14020 | T16334 | T16334 | ROOT | treatment,treatment |
R14021 | T16335 | T16334 | prep | of,treatment |
R14022 | T16336 | T16337 | amod | HuT-78,cells |
R14023 | T16337 | T16338 | compound | cells,results |
R14024 | T16338 | T16335 | pobj | results,of |
R14025 | T16339 | T16338 | prep | in,results |
R14026 | T16340 | T16339 | pobj | translocation,in |
R14027 | T16341 | T16340 | prep | of,translocation |
R14028 | T16342 | T16341 | pobj | GATA-3,of |
R14029 | T16343 | T16334 | prep | from,treatment |
R14030 | T16344 | T16345 | det | the,cytoplasm |
R14031 | T16345 | T16343 | pobj | cytoplasm,from |
R14032 | T16346 | T16334 | prep | to,treatment |
R14033 | T16347 | T16348 | det | the,nucleus |
R14034 | T16348 | T16346 | pobj | nucleus,to |
R14035 | T16349 | T16334 | prep | within,treatment |
R14036 | T16350 | T16351 | nummod | 30,min |
R14037 | T16351 | T16349 | pobj | min,within |
R14038 | T16352 | T16334 | punct | .,treatment |
R14039 | T16353 | T16361 | punct | (,used |
R14040 | T16354 | T16361 | nsubjpass | B,used |
R14041 | T16355 | T16354 | punct | ),B |
R14042 | T16356 | T16357 | compound | Histone,H1 |
R14043 | T16357 | T16354 | appos | H1,B |
R14044 | T16358 | T16357 | cc | and,H1 |
R14045 | T16359 | T16357 | conj | MEK-1,H1 |
R14046 | T16360 | T16361 | auxpass | were,used |
R14047 | T16361 | T16361 | ROOT | used,used |
R14048 | T16362 | T16363 | aux | to,confirm |
R14049 | T16363 | T16361 | xcomp | confirm,used |
R14050 | T16364 | T16365 | amod | distinct,separation |
R14051 | T16365 | T16363 | dobj | separation,confirm |
R14052 | T16366 | T16365 | prep | of,separation |
R14053 | T16367 | T16370 | amod | cytoplasmic,extracts |
R14054 | T16368 | T16367 | cc | and,cytoplasmic |
R14055 | T16369 | T16367 | conj | nuclear,cytoplasmic |
R14056 | T16370 | T16366 | pobj | extracts,of |
R14057 | T16371 | T16363 | prep | in,confirm |
R14058 | T16372 | T16374 | nummod | three,experiments |
R14059 | T16373 | T16374 | amod | separate,experiments |
R14060 | T16374 | T16371 | pobj | experiments,in |
R14061 | T16375 | T16361 | punct | .,used |
R14062 | T16376 | T16377 | punct | (,C |
R14063 | T16377 | T16381 | nmod | C,analysis |
R14064 | T16378 | T16377 | punct | ),C |
R14065 | T16379 | T16381 | amod | Western,analysis |
R14066 | T16380 | T16381 | compound | blot,analysis |
R14067 | T16381 | T16386 | nsubj | analysis,demonstrated |
R14068 | T16382 | T16381 | prep | of,analysis |
R14069 | T16383 | T16385 | amod | FP-treated,cells |
R14070 | T16384 | T16385 | amod | HuT-78,cells |
R14071 | T16385 | T16382 | pobj | cells,of |
R14072 | T16386 | T16386 | ROOT | demonstrated,demonstrated |
R14073 | T16387 | T16389 | amod | impaired,localization |
R14074 | T16388 | T16389 | amod | nuclear,localization |
R14075 | T16389 | T16386 | dobj | localization,demonstrated |
R14076 | T16390 | T16389 | prep | of,localization |
R14077 | T16391 | T16390 | pobj | GATA-3,of |
R14078 | T16392 | T16389 | acl | induced,localization |
R14079 | T16393 | T16392 | agent | by,induced |
R14080 | T16394 | T16397 | amod | anti-CD3,co-stimulation |
R14081 | T16395 | T16397 | nmod | /,co-stimulation |
R14082 | T16396 | T16397 | nummod | CD28,co-stimulation |
R14083 | T16397 | T16393 | pobj | co-stimulation,by |
R14084 | T16398 | T16392 | prep | in,induced |
R14085 | T16399 | T16400 | det | a,time |
R14086 | T16400 | T16398 | pobj | time,in |
R14087 | T16401 | T16389 | punct | -,localization |
R14088 | T16402 | T16389 | punct | (,localization |
R14089 | T16403 | T16389 | prep | at,localization |
R14090 | T16404 | T16405 | nummod | 10,− |
R14091 | T16405 | T16408 | nmod | −,FP |
R14092 | T16406 | T16408 | nummod | 8,FP |
R14093 | T16407 | T16408 | compound | M,FP |
R14094 | T16408 | T16403 | pobj | FP,at |
R14095 | T16409 | T16389 | punct | ),localization |
R14096 | T16410 | T16389 | cc | and,localization |
R14097 | T16411 | T16389 | conj | concentration,localization |
R14098 | T16412 | T16389 | punct | -,localization |
R14099 | T16413 | T16389 | punct | (,localization |
R14100 | T16414 | T16386 | prep | at,demonstrated |
R14101 | T16415 | T16416 | nummod | 60,min |
R14102 | T16416 | T16414 | pobj | min,at |
R14103 | T16417 | T16416 | prep | after,min |
R14104 | T16418 | T16417 | pobj | stimulation,after |
R14105 | T16419 | T16386 | punct | ),demonstrated |
R14106 | T16420 | T16421 | amod | dependent,manner |
R14107 | T16421 | T16421 | ROOT | manner,manner |
R14108 | T16422 | T16421 | punct | .,manner |
R14109 | T16423 | T16425 | nsubjpass | Cells,pretreated |
R14110 | T16424 | T16425 | auxpass | were,pretreated |
R14111 | T16425 | T16425 | ROOT | pretreated,pretreated |
R14112 | T16426 | T16425 | prep | with,pretreated |
R14113 | T16427 | T16426 | pobj | FP,with |
R14114 | T16428 | T16425 | prep | for,pretreated |
R14115 | T16429 | T16430 | nummod | 30,min |
R14116 | T16430 | T16428 | pobj | min,for |
R14117 | T16431 | T16425 | advmod | prior,pretreated |
R14118 | T16432 | T16431 | prep | to,prior |
R14119 | T16433 | T16432 | pobj | stimulation,to |
R14120 | T16434 | T16425 | punct | .,pretreated |
R14121 | T16435 | T16440 | nsubjpass | MEK1,used |
R14122 | T16436 | T16435 | cc | and,MEK1 |
R14123 | T16437 | T16438 | compound | histone,H1 |
R14124 | T16438 | T16435 | conj | H1,MEK1 |
R14125 | T16439 | T16440 | auxpass | were,used |
R14126 | T16440 | T16440 | ROOT | used,used |
R14127 | T16441 | T16442 | aux | to,demonstrate |
R14128 | T16442 | T16440 | xcomp | demonstrate,used |
R14129 | T16443 | T16444 | amod | equal,cytoplasmic |
R14130 | T16444 | T16442 | dobj | cytoplasmic,demonstrate |
R14131 | T16445 | T16444 | cc | and,cytoplasmic |
R14132 | T16446 | T16444 | conj | nuclear,cytoplasmic |
R14133 | T16447 | T16442 | advcl | loading,demonstrate |
R14134 | T16448 | T16447 | advmod | respectively,loading |
R14135 | T16449 | T16440 | punct | .,used |
R14136 | T16450 | T16452 | nsubjpass | Results,presented |
R14137 | T16451 | T16452 | auxpass | are,presented |
R14138 | T16452 | T16452 | ROOT | presented,presented |
R14139 | T16453 | T16454 | advmod | graphically,below |
R14140 | T16454 | T16452 | prep | below,presented |
R14141 | T16455 | T16452 | prep | as,presented |
R14142 | T16456 | T16458 | amod | mean,SEM |
R14143 | T16457 | T16458 | compound | ±,SEM |
R14144 | T16458 | T16455 | pobj | SEM,as |
R14145 | T16459 | T16458 | prep | of,SEM |
R14146 | T16460 | T16461 | advmod | at,least |
R14147 | T16461 | T16462 | advmod | least,three |
R14148 | T16462 | T16464 | nummod | three,experiments |
R14149 | T16463 | T16464 | amod | independent,experiments |
R14150 | T16464 | T16459 | pobj | experiments,of |
R14151 | T16465 | T16452 | punct | .,presented |
R14152 | T16466 | T16468 | compound | ***,< |
R14153 | T16467 | T16468 | compound | p,< |
R14154 | T16468 | T16470 | nsubj | <,compared |
R14155 | T16469 | T16468 | nummod | 0.001,< |
R14156 | T16470 | T16470 | ROOT | compared,compared |
R14157 | T16471 | T16470 | prep | to,compared |
R14158 | T16472 | T16471 | pobj | t,to |
R14159 | T16473 | T16474 | punct | =,0 |
R14160 | T16474 | T16472 | prep | 0,t |
R14161 | T16475 | T16470 | punct | .,compared |
R14162 | T16476 | T16479 | punct | (,RT-PCR |
R14163 | T16477 | T16479 | nmod | D,RT-PCR |
R14164 | T16478 | T16479 | punct | ),RT-PCR |
R14165 | T16479 | T16479 | ROOT | RT-PCR,RT-PCR |
R14166 | T16480 | T16479 | acl | showing,RT-PCR |
R14167 | T16481 | T16483 | mark | that,inhibits |
R14168 | T16482 | T16483 | nsubj | FP,inhibits |
R14169 | T16483 | T16480 | ccomp | inhibits,showing |
R14170 | T16484 | T16488 | nmod | IL-4,expression |
R14171 | T16485 | T16484 | cc | and,IL-4 |
R14172 | T16486 | T16484 | conj | IL-5,IL-4 |
R14173 | T16487 | T16488 | compound | mRNA,expression |
R14174 | T16488 | T16483 | dobj | expression,inhibits |
R14175 | T16489 | T16488 | prep | in,expression |
R14176 | T16490 | T16491 | amod | CD3/CD28-costimulated,cells |
R14177 | T16491 | T16489 | pobj | cells,in |
R14178 | T16492 | T16479 | punct | .,RT-PCR |
R14179 | T16493 | T16495 | nsubjpass | GAPDH,used |
R14180 | T16494 | T16495 | auxpass | was,used |
R14181 | T16495 | T16495 | ROOT | used,used |
R14182 | T16496 | T16495 | prep | as,used |
R14183 | T16497 | T16499 | det | a,control |
R14184 | T16498 | T16499 | compound | loading,control |
R14185 | T16499 | T16496 | pobj | control,as |
R14186 | T16500 | T16495 | punct | .,used |
R14187 | T16501 | T16502 | amod | Lower,panels |
R14188 | T16502 | T16503 | nsubj | panels,show |
R14189 | T16503 | T16503 | ROOT | show,show |
R14190 | T16504 | T16505 | amod | graphical,analysis |
R14191 | T16505 | T16503 | dobj | analysis,show |
R14192 | T16506 | T16505 | prep | of,analysis |
R14193 | T16507 | T16506 | pobj | results,of |
R14194 | T16508 | T16507 | acl | presented,results |
R14196 | T16510 | T16512 | amod | mean,SEM |
R14197 | T16511 | T16512 | compound | ±,SEM |
R14198 | T16512 | T16509 | pobj | SEM,as |
R14199 | T16513 | T16512 | prep | of,SEM |
R14200 | T16514 | T16515 | advmod | at,least |
R14201 | T16515 | T16516 | advmod | least,three |
R14202 | T16516 | T16518 | nummod | three,experiments |
R14203 | T16517 | T16518 | amod | independent,experiments |
R14204 | T16518 | T16513 | pobj | experiments,of |
R14205 | T16519 | T16503 | punct | .,show |
R14206 | T16520 | T16522 | dep | ###,< |
R14207 | T16521 | T16522 | nmod | p,< |
R14208 | T16522 | T16522 | ROOT | <,< |
R14209 | T16523 | T16532 | nsubj | 0.001,compared |
R14210 | T16524 | T16532 | prep | compared,compared |
R14211 | T16525 | T16526 | aux | to,control |
R14212 | T16526 | T16524 | xcomp | control,compared |
R14213 | T16527 | T16532 | punct | ",",compared |
R14214 | T16528 | T16531 | nmod | ***,0.001 |
R14215 | T16529 | T16531 | nmod | p,0.001 |
R14216 | T16530 | T16531 | nmod | <,0.001 |
R14217 | T16531 | T16532 | nsubj | 0.001,compared |
R14218 | T16532 | T16532 | ROOT | compared,compared |
R14219 | T16533 | T16532 | prep | to,compared |
R14220 | T16534 | T16535 | compound | anti-CD3,/ |
R14221 | T16535 | T16536 | compound | /,CD28 |
R14222 | T16536 | T16533 | pobj | CD28,to |
R14223 | T16537 | T16536 | acl | stimulated,CD28 |
R14224 | T16538 | T16532 | punct | .,compared |
R14225 | T16539 | T16542 | punct | (,FP |
R14226 | T16540 | T16542 | nmod | E,FP |
R14227 | T16541 | T16542 | punct | ),FP |
R14228 | T16542 | T16547 | nsubj | FP,reduces |
R14229 | T16543 | T16545 | punct | (,nM |
R14230 | T16544 | T16545 | nummod | 10,nM |
R14231 | T16545 | T16542 | appos | nM,FP |
R14232 | T16546 | T16542 | punct | ),FP |
R14233 | T16547 | T16547 | ROOT | reduces,reduces |
R14234 | T16548 | T16549 | det | the,ability |
R14235 | T16549 | T16547 | dobj | ability,reduces |
R14236 | T16550 | T16549 | prep | of,ability |
R14237 | T16551 | T16554 | amod | anti-CD3,GATA-3 |
R14238 | T16552 | T16554 | nmod | /,GATA-3 |
R14239 | T16553 | T16554 | amod | CD28-stimulated,GATA-3 |
R14240 | T16554 | T16550 | pobj | GATA-3,of |
R14241 | T16555 | T16556 | aux | to,associate |
R14242 | T16556 | T16549 | acl | associate,ability |
R14243 | T16557 | T16556 | prep | with,associate |
R14244 | T16558 | T16561 | det | the,promoter |
R14245 | T16559 | T16561 | amod | native,promoter |
R14246 | T16560 | T16561 | compound | IL-5,promoter |
R14247 | T16561 | T16557 | pobj | promoter,with |
R14248 | T16562 | T16563 | nummod | 60,min |
R14249 | T16563 | T16561 | appos | min,promoter |
R14250 | T16564 | T16563 | prep | after,min |
R14251 | T16565 | T16564 | pobj | stimulation,after |
R14252 | T16566 | T16547 | punct | .,reduces |
R14253 | T16567 | T16570 | nsubjpass | Data,shown |
R14254 | T16568 | T16570 | auxpass | are,shown |
R14255 | T16569 | T16570 | advmod | also,shown |
R14256 | T16570 | T16570 | ROOT | shown,shown |
R14257 | T16571 | T16570 | advmod | graphically,shown |
R14258 | T16572 | T16570 | prep | as,shown |
R14259 | T16573 | T16575 | amod | mean,SEM |
R14260 | T16574 | T16575 | compound | ±,SEM |
R14261 | T16575 | T16572 | pobj | SEM,as |
R14262 | T16576 | T16575 | prep | of,SEM |
R14263 | T16577 | T16579 | nummod | three,experiments |
R14264 | T16578 | T16579 | amod | independent,experiments |
R14265 | T16579 | T16576 | pobj | experiments,of |
R14266 | T16580 | T16570 | punct | .,shown |
R14267 | T16581 | T16582 | det | All,data |
R14268 | T16582 | T16584 | nsubjpass | data,analysed |
R14269 | T16583 | T16584 | auxpass | were,analysed |
R14270 | T16584 | T16584 | ROOT | analysed,analysed |
R14271 | T16585 | T16584 | agent | by,analysed |
R14272 | T16586 | T16585 | pobj | ANOVA,by |
R14273 | T16587 | T16584 | acl | followed,analysed |
R14274 | T16588 | T16587 | agent | by,followed |
R14275 | T16589 | T16588 | pobj | Newman-Keuls,by |
R14276 | T16590 | T16590 | ROOT | post-test,post-test |
R14277 | T16591 | T16584 | punct | .,analysed |
R14667 | T17105 | T17106 | compound | Fluticasone,propionate |
R14668 | T17106 | T17107 | nsubj | propionate,reduces |
R14669 | T17107 | T17107 | ROOT | reduces,reduces |
R14670 | T17108 | T17109 | amod | GATA-3,association |
R14671 | T17109 | T17107 | dobj | association,reduces |
R14672 | T17110 | T17109 | prep | with,association |
R14673 | T17111 | T17115 | amod | importin-α,import |
R14674 | T17112 | T17111 | cc | and,importin-α |
R14675 | T17113 | T17111 | conj | GATA-3,importin-α |
R14676 | T17114 | T17115 | amod | nuclear,import |
R14677 | T17115 | T17110 | pobj | import,with |
R14678 | T17116 | T17107 | punct | .,reduces |
R14679 | T17117 | T17118 | punct | (,A |
R14680 | T17118 | T17122 | nmod | A,analysis |
R14681 | T17119 | T17118 | punct | ),A |
R14682 | T17120 | T17122 | amod | Western,analysis |
R14683 | T17121 | T17122 | compound | blot,analysis |
R14684 | T17122 | T17123 | nsubj | analysis,demonstrates |
R14685 | T17123 | T17123 | ROOT | demonstrates,demonstrates |
R14686 | T17124 | T17133 | det | a,FP |
R14687 | T17125 | T17133 | nmod | time,FP |
R14688 | T17126 | T17133 | punct | -,FP |
R14689 | T17127 | T17133 | punct | (,FP |
R14690 | T17128 | T17133 | prep | at,FP |
R14691 | T17129 | T17131 | quantmod | 10,8 |
R14692 | T17130 | T17131 | quantmod | −,8 |
R14718 | T17156 | T17123 | punct | .,demonstrates |
R14719 | T17157 | T17159 | det | A,control |
R14720 | T17158 | T17159 | amod | positive,control |
R14721 | T17159 | T17166 | nsubjpass | control,shown |
R14722 | T17160 | T17159 | prep | for,control |
R14723 | T17161 | T17162 | compound | GR,association |
R14724 | T17162 | T17160 | pobj | association,for |
R14725 | T17163 | T17162 | prep | with,association |
R14726 | T17164 | T17163 | pobj | importin,with |
R14727 | T17165 | T17166 | auxpass | is,shown |
R14728 | T17166 | T17166 | ROOT | shown,shown |
R14729 | T17167 | T17166 | punct | .,shown |
R14730 | T17168 | T17174 | nsubjpass | Quantification,shown |
R14731 | T17169 | T17168 | prep | of,Quantification |
R14732 | T17170 | T17172 | det | the,data |
R14733 | T17171 | T17172 | compound | densitometry,data |
R14734 | T17172 | T17169 | pobj | data,of |
R14735 | T17173 | T17174 | auxpass | is,shown |
R14736 | T17174 | T17174 | ROOT | shown,shown |
R14737 | T17175 | T17174 | prep | below,shown |
R14738 | T17176 | T17174 | punct | .,shown |
R14739 | T17177 | T17178 | det | Each,bar |
R14740 | T17178 | T17179 | nsubj | bar,represents |
R14741 | T17179 | T17179 | ROOT | represents,represents |
R14742 | T17180 | T17182 | amod | mean,SEM |
R14743 | T17181 | T17182 | compound | ±,SEM |
R14744 | T17182 | T17179 | dobj | SEM,represents |
R14745 | T17183 | T17182 | prep | of,SEM |
R14796 | T17234 | T17237 | amod | FP-activated,translocation |
R14797 | T17235 | T17237 | nmod | GR,translocation |
R14798 | T17236 | T17237 | amod | nuclear,translocation |
R14799 | T17237 | T17238 | npadvmod | translocation,measured |
R14800 | T17238 | T17232 | acl | measured,induction |
R14801 | T17239 | T17238 | agent | by,measured |
R14802 | T17240 | T17239 | pobj | IP,by |
R14803 | T17241 | T17209 | punct | .,demonstrated |
R14804 | T17242 | T17248 | nsubjpass | Quantification,shown |
R14805 | T17243 | T17242 | prep | of,Quantification |
R14806 | T17244 | T17246 | det | the,data |
R14807 | T17245 | T17246 | compound | densitometry,data |
R14808 | T17246 | T17243 | pobj | data,of |
R14809 | T17247 | T17248 | auxpass | is,shown |
R14810 | T17248 | T17248 | ROOT | shown,shown |
R14811 | T17249 | T17248 | prep | below,shown |
R14812 | T17250 | T17248 | punct | .,shown |
R14813 | T17251 | T17252 | det | Each,bar |
R14814 | T17252 | T17253 | nsubj | bar,represents |
R14815 | T17253 | T17253 | ROOT | represents,represents |
R14816 | T17254 | T17256 | amod | mean,SEM |
R14817 | T17255 | T17256 | compound | ±,SEM |
R14818 | T17256 | T17253 | dobj | SEM,represents |
R14819 | T17257 | T17256 | prep | of,SEM |
R14820 | T17258 | T17259 | advmod | at,least |
R14821 | T17259 | T17260 | advmod | least,three |
R14822 | T17260 | T17262 | nummod | three,experiments |
R14823 | T17261 | T17262 | amod | independent,experiments |
R14849 | T17287 | T17288 | nummod | CD28,co-stimulation |
R14850 | T17288 | T17289 | nsubj | co-stimulation,demonstrated |
R14851 | T17289 | T17289 | ROOT | demonstrated,demonstrated |
R14852 | T17290 | T17292 | det | a,decrease |
R14853 | T17291 | T17292 | amod | concentration-dependent,decrease |
R14854 | T17292 | T17289 | dobj | decrease,demonstrated |
R14855 | T17293 | T17292 | prep | in,decrease |
R14856 | T17294 | T17293 | pobj | GATA-3,in |
R14857 | T17295 | T17296 | compound | importin-α,association |
R14858 | T17296 | T17292 | appos | association,decrease |
R14859 | T17297 | T17292 | prep | at,decrease |
R14860 | T17298 | T17299 | nummod | 20,min |
R14861 | T17299 | T17297 | pobj | min,at |
R14862 | T17300 | T17289 | punct | .,demonstrated |
R14863 | T17301 | T17307 | nsubjpass | Quantification,shown |
R14864 | T17302 | T17301 | prep | of,Quantification |
R14865 | T17303 | T17305 | det | the,data |
R14866 | T17304 | T17305 | compound | densitometry,data |
R14867 | T17305 | T17302 | pobj | data,of |
R14868 | T17306 | T17307 | auxpass | is,shown |
R14869 | T17307 | T17307 | ROOT | shown,shown |
R14870 | T17308 | T17307 | prep | below,shown |
R14871 | T17309 | T17307 | punct | .,shown |
R14872 | T17310 | T17311 | det | Each,bar |
R14873 | T17311 | T17312 | nsubj | bar,represents |
R14874 | T17312 | T17312 | ROOT | represents,represents |
R14875 | T17313 | T17315 | amod | mean,SEM |
R14876 | T17314 | T17315 | compound | ±,SEM |
R14877 | T17315 | T17312 | dobj | SEM,represents |
R14878 | T17316 | T17315 | prep | of,SEM |
R14879 | T17317 | T17318 | advmod | at,least |
R14880 | T17318 | T17319 | advmod | least,three |
R14881 | T17319 | T17321 | nummod | three,experiments |
R14882 | T17320 | T17321 | amod | independent,experiments |
R14883 | T17321 | T17316 | pobj | experiments,of |
R14884 | T17322 | T17312 | punct | .,represents |
R14885 | T17323 | T17325 | dep | ###,< |
R14886 | T17324 | T17325 | compound | p,< |
R14887 | T17325 | T17325 | ROOT | <,< |
R14888 | T17326 | T17326 | ROOT | 0.001,0.001 |
R14889 | T17327 | T17335 | prep | compared,compared |
R14890 | T17328 | T17329 | aux | to,control |
R14891 | T17329 | T17327 | xcomp | control,compared |
R14892 | T17330 | T17333 | punct | ",",< |
R14893 | T17331 | T17333 | nmod | ***,< |
R14894 | T17332 | T17333 | nmod | p,< |
R14895 | T17333 | T17334 | nmod | <,0.001 |
R14896 | T17334 | T17335 | npadvmod | 0.001,compared |
R14897 | T17335 | T17326 | prep | compared,0.001 |
R14898 | T17336 | T17335 | prep | to,compared |
R14899 | T17337 | T17336 | pobj | αCD3,to |
R14900 | T17338 | T17340 | amod | /,cells |
R14901 | T17339 | T17340 | amod | CD28-stimulated,cells |
R14902 | T17340 | T17337 | dobj | cells,αCD3 |
R14903 | T17341 | T17326 | punct | .,0.001 |
R14904 | T17342 | T17343 | punct | (,D |
R14905 | T17343 | T17343 | ROOT | D,D |
R14906 | T17344 | T17343 | punct | ),D |
R14907 | T17345 | T17346 | amod | GFP-tagged,GATA-3 |
R14908 | T17346 | T17348 | nsubjpass | GATA-3,overexpressed |
R14909 | T17347 | T17348 | auxpass | was,overexpressed |
R14910 | T17348 | T17348 | ROOT | overexpressed,overexpressed |
R14911 | T17349 | T17348 | cc | and,overexpressed |
R14912 | T17350 | T17348 | conj | cells,overexpressed |
R14913 | T17351 | T17350 | acl | stimulated,cells |
R14914 | T17352 | T17355 | punct | (,c |
R14915 | T17353 | T17355 | nmod | b,c |
R14916 | T17354 | T17355 | punct | ",",c |
R14917 | T17355 | T17351 | appos | c,stimulated |
R14918 | T17356 | T17355 | punct | ),c |
R14919 | T17357 | T17355 | cc | or,c |
R14920 | T17358 | T17359 | neg | not,( |
R14921 | T17359 | T17360 | punct | (,a |
R14922 | T17360 | T17362 | meta | a,for |
R14923 | T17361 | T17360 | punct | ),a |
R14924 | T17362 | T17355 | conj | for,c |
R14925 | T17363 | T17364 | nummod | 30,min |
R14926 | T17364 | T17362 | pobj | min,for |
R14927 | T17365 | T17364 | prep | with,min |
R14928 | T17366 | T17367 | compound | anti-CD3,/ |
R14929 | T17367 | T17368 | compound | /,CD28 |
R14930 | T17368 | T17365 | pobj | CD28,with |
R14931 | T17369 | T17348 | punct | .,overexpressed |
R14932 | T17370 | T17371 | det | The,effect |
R14933 | T17371 | T17390 | nsubjpass | effect,shown |
R14934 | T17372 | T17371 | prep | of,effect |
R14935 | T17373 | T17375 | nummod | 30,pretreatment |
R14936 | T17374 | T17375 | compound | min,pretreatment |
R14937 | T17375 | T17372 | pobj | pretreatment,of |
R14938 | T17376 | T17375 | prep | of,pretreatment |
R14939 | T17377 | T17376 | pobj | cells,of |
R14940 | T17378 | T17371 | prep | with,effect |
R14941 | T17379 | T17378 | pobj | FP,with |
R14942 | T17380 | T17379 | punct | (,FP |
R14943 | T17381 | T17382 | nummod | 10,− |
R14944 | T17382 | T17379 | appos | −,FP |
R14945 | T17383 | T17384 | nummod | 8,M |
R14946 | T17384 | T17390 | nsubjpass | M,shown |
R14947 | T17385 | T17384 | punct | ",",M |
R14948 | T17386 | T17384 | appos | c,M |
R14949 | T17387 | T17384 | punct | ),M |
R14950 | T17388 | T17390 | auxpass | is,shown |
R14951 | T17389 | T17390 | advmod | also,shown |
R14952 | T17390 | T17390 | ROOT | shown,shown |
R14953 | T17391 | T17390 | punct | .,shown |
R14954 | T17392 | T17393 | det | All,data |
R14955 | T17393 | T17395 | nsubjpass | data,analysed |
R14956 | T17394 | T17395 | auxpass | were,analysed |
R14957 | T17395 | T17395 | ROOT | analysed,analysed |
R14958 | T17396 | T17395 | agent | by,analysed |
R14959 | T17397 | T17396 | pobj | ANOVA,by |
R14960 | T17398 | T17395 | prep | followed,analysed |
R14961 | T17399 | T17398 | agent | by,followed |
R14962 | T17400 | T17399 | pobj | Newman-Keuls,by |
R14963 | T17401 | T17395 | conj | post-test,analysed |
R14964 | T17402 | T17395 | punct | .,analysed |
R15301 | T17853 | T17854 | compound | Fluticasone,propionate |
R15302 | T17854 | T17854 | ROOT | propionate,propionate |
R15303 | T17855 | T17865 | nsubjpass | mediated,associated |
R15304 | T17856 | T17855 | dobj | inhibition,mediated |
R15305 | T17857 | T17856 | prep | of,inhibition |
R15306 | T17858 | T17861 | nummod | p38,phosphorylation |
R15307 | T17859 | T17861 | nmod | MAP,phosphorylation |
R15308 | T17860 | T17861 | compound | kinase,phosphorylation |
R15309 | T17861 | T17857 | pobj | phosphorylation,of |
R15310 | T17862 | T17861 | cc | and,phosphorylation |
R15311 | T17863 | T17861 | conj | activation,phosphorylation |
R15312 | T17864 | T17865 | auxpass | is,associated |
R15313 | T17865 | T17865 | ROOT | associated,associated |
R15314 | T17866 | T17865 | prep | with,associated |
R15315 | T17867 | T17869 | det | a,down-regulation |
R15316 | T17868 | T17869 | amod | marked,down-regulation |
R15317 | T17869 | T17866 | pobj | down-regulation,with |
R15318 | T17870 | T17869 | prep | of,down-regulation |
R15319 | T17871 | T17873 | amod | GATA-3,phosphorylation |
R15320 | T17872 | T17873 | compound | serine,phosphorylation |
R15321 | T17873 | T17870 | pobj | phosphorylation,of |
R15322 | T17874 | T17865 | punct | .,associated |
R15323 | T17875 | T17876 | punct | (,A |
R15324 | T17876 | T17880 | nmod | A,analysis |
R15325 | T17877 | T17876 | punct | ),A |
R15326 | T17878 | T17880 | amod | Western,analysis |
R15327 | T17879 | T17880 | compound | blot,analysis |
R15328 | T17880 | T17881 | nsubj | analysis,shows |
R15329 | T17881 | T17881 | ROOT | shows,shows |
R15330 | T17882 | T17894 | mark | that,reduced |
R15331 | T17883 | T17888 | nmod | FP,M |
R15332 | T17884 | T17886 | punct | (,− |
R15333 | T17885 | T17886 | nummod | 10,− |
R15334 | T17886 | T17883 | appos | −,FP |
R15335 | T17887 | T17888 | nummod | 8,M |
R15336 | T17888 | T17894 | nsubj | M,reduced |
R15337 | T17889 | T17888 | punct | ",",M |
R15338 | T17890 | T17891 | nummod | 30,min |
R15339 | T17891 | T17888 | appos | min,M |
R15340 | T17892 | T17891 | punct | ),min |
R15341 | T17893 | T17894 | nsubj | treatment,reduced |
R15342 | T17894 | T17881 | ccomp | reduced,shows |
R15343 | T17895 | T17896 | amod | dual,phosphorylation |
R15344 | T17896 | T17894 | dobj | phosphorylation,reduced |
R15345 | T17897 | T17898 | punct | (,threonine-180 |
R15346 | T17898 | T17896 | appos | threonine-180,phosphorylation |
R15347 | T17899 | T17898 | cc | and,threonine-180 |
R15348 | T17900 | T17898 | conj | tyrosine-182,threonine-180 |
R15349 | T17901 | T17898 | punct | ),threonine-180 |
R15350 | T17902 | T17896 | prep | of,phosphorylation |
R15351 | T17903 | T17904 | nummod | p38,MAPK |
R15352 | T17904 | T17902 | pobj | MAPK,of |
R15353 | T17905 | T17904 | prep | in,MAPK |
R15354 | T17906 | T17907 | compound | anti-CD3,/ |
R15355 | T17907 | T17905 | pobj | /,in |
R15356 | T17908 | T17907 | nummod | CD28,/ |
R15357 | T17909 | T17911 | amod | co-stimulated,cells |
R15358 | T17910 | T17911 | amod | HuT-78,cells |
R15359 | T17911 | T17896 | appos | cells,phosphorylation |
R15360 | T17912 | T17881 | punct | .,shows |
R15361 | T17913 | T17917 | punct | (,course |
R15362 | T17914 | T17917 | compound | B,course |
R15363 | T17915 | T17916 | punct | ),Time |
R15364 | T17916 | T17917 | compound | Time,course |
R15365 | T17917 | T17917 | ROOT | course,course |
R15366 | T17918 | T17917 | prep | of,course |
R15367 | T17919 | T17920 | det | the,effect |
R15368 | T17920 | T17918 | pobj | effect,of |
R15369 | T17921 | T17920 | prep | of,effect |
R15370 | T17922 | T17921 | pobj | FP,of |
R15371 | T17923 | T17922 | punct | (,FP |
R15372 | T17924 | T17926 | quantmod | 10,8 |
R15373 | T17925 | T17926 | quantmod | −,8 |
R15374 | T17926 | T17927 | npadvmod | 8,M |
R15375 | T17927 | T17922 | appos | M,FP |
R15376 | T17928 | T17922 | punct | ),FP |
R15377 | T17929 | T17920 | prep | on,effect |
R15378 | T17930 | T17929 | pobj | phosphorylation,on |
R15379 | T17931 | T17930 | prep | of,phosphorylation |
R15380 | T17932 | T17934 | amod | activated,factor |
R15381 | T17933 | T17934 | compound | transcription,factor |
R15382 | T17934 | T17931 | pobj | factor,of |
R15383 | T17935 | T17934 | nummod | 2,factor |
R15384 | T17936 | T17937 | punct | (,ATF-2 |
R15385 | T17937 | T17934 | appos | ATF-2,factor |
R15386 | T17938 | T17937 | punct | ),ATF-2 |
R15387 | T17939 | T17937 | punct | ",",ATF-2 |
R15388 | T17940 | T17941 | det | a,measure |
R15389 | T17941 | T17937 | appos | measure,ATF-2 |
R15390 | T17942 | T17941 | prep | of,measure |
R15391 | T17943 | T17945 | nummod | p38,activity |
R15392 | T17944 | T17945 | compound | MAPK,activity |
R15393 | T17945 | T17942 | pobj | activity,of |
R15394 | T17946 | T17917 | punct | .,course |
R15395 | T17947 | T17948 | punct | (,C |
R15396 | T17948 | T17951 | nmod | C,inhibition |
R15397 | T17949 | T17948 | punct | ),C |
R15398 | T17950 | T17951 | amod | FP-induced,inhibition |
R15399 | T17951 | T17957 | nsubjpass | inhibition,associated |
R15400 | T17952 | T17951 | prep | of,inhibition |
R15401 | T17953 | T17955 | nummod | p38,activity |
R15402 | T17954 | T17955 | compound | MAPK,activity |
R15403 | T17955 | T17952 | pobj | activity,of |
R15404 | T17956 | T17957 | auxpass | is,associated |
R15405 | T17957 | T17957 | ROOT | associated,associated |
R15406 | T17958 | T17957 | prep | with,associated |
R15407 | T17959 | T17960 | det | the,decrease |
R15408 | T17960 | T17958 | pobj | decrease,with |
R15409 | T17961 | T17960 | prep | of,decrease |
R15410 | T17962 | T17966 | dep | anti-CD3,induced |
R15411 | T17963 | T17966 | dep | /,induced |
R15412 | T17964 | T17965 | nummod | CD28,co-stimulation |
R15413 | T17965 | T17963 | appos | co-stimulation,/ |
R15414 | T17966 | T17957 | advcl | induced,associated |
R15415 | T17967 | T17968 | amod | serine,phosphorylation |
R15416 | T17968 | T17966 | dobj | phosphorylation,induced |
R15417 | T17969 | T17970 | punct | (,P-Ser |
R15418 | T17970 | T17968 | appos | P-Ser,phosphorylation |
R15419 | T17971 | T17970 | punct | ),P-Ser |
R15420 | T17972 | T17968 | prep | of,phosphorylation |
R15421 | T17973 | T17972 | pobj | GATA-3,of |
R15422 | T17974 | T17966 | punct | .,induced |
R15423 | T17975 | T17988 | prep | For,shown |
R15424 | T17976 | T17977 | punct | (,A |
R15425 | T17977 | T17978 | det | A,C |
R15426 | T17978 | T17975 | pobj | C,For |
R15427 | T17979 | T17978 | punct | ),C |
R15428 | T17980 | T17988 | punct | ",",shown |
R15429 | T17981 | T17988 | nsubjpass | quantification,shown |
R15430 | T17982 | T17981 | prep | of,quantification |
R15431 | T17983 | T17985 | det | the,data |
R15432 | T17984 | T17985 | compound | densitometry,data |
R15433 | T17985 | T17982 | pobj | data,of |
R15434 | T17986 | T17988 | auxpass | is,shown |
R15435 | T17987 | T17988 | advmod | also,shown |
R15436 | T17988 | T17988 | ROOT | shown,shown |
R15437 | T17989 | T17988 | punct | .,shown |
R15438 | T17990 | T17991 | det | Each,bar |
R15439 | T17991 | T17992 | nsubj | bar,represents |
R15440 | T17992 | T17992 | ROOT | represents,represents |
R15441 | T17993 | T17995 | amod | mean,SEM |
R15442 | T17994 | T17995 | compound | ±,SEM |
R15443 | T17995 | T17992 | dobj | SEM,represents |
R15444 | T17996 | T17995 | prep | of,SEM |
R15445 | T17997 | T17998 | advmod | at,least |
R15446 | T17998 | T17999 | advmod | least,three |
R15447 | T17999 | T18001 | nummod | three,experiments |
R15448 | T18000 | T18001 | amod | independent,experiments |
R15449 | T18001 | T17996 | pobj | experiments,of |
R15450 | T18002 | T17992 | punct | .,represents |
R15451 | T18003 | T18005 | dep | ###,< |
R15452 | T18004 | T18005 | compound | p,< |
R15453 | T18005 | T18005 | ROOT | <,< |
R15454 | T18006 | T18015 | nsubj | 0.001,compared |
R15455 | T18007 | T18015 | prep | compared,compared |
R15456 | T18008 | T18009 | aux | to,control |
R15457 | T18009 | T18007 | xcomp | control,compared |
R15458 | T18010 | T18015 | punct | ",",compared |
R15459 | T18011 | T18013 | nmod | ***,< |
R15460 | T18012 | T18013 | nmod | p,< |
R15461 | T18013 | T18014 | nmod | <,0.001 |
R15462 | T18014 | T18015 | nsubj | 0.001,compared |
R15463 | T18015 | T18015 | ROOT | compared,compared |
R15464 | T18016 | T18015 | prep | to,compared |
R15465 | T18017 | T18016 | pobj | αCD3,to |
R15466 | T18018 | T18020 | amod | /,cells |
R15467 | T18019 | T18020 | amod | CD28-stimulated,cells |
R15468 | T18020 | T18017 | dobj | cells,αCD3 |
R15469 | T18021 | T18015 | punct | .,compared |
R15470 | T18022 | T18026 | punct | (,induced |
R15471 | T18023 | T18025 | nmod | D,FP |
R15472 | T18024 | T18025 | punct | ),FP |
R15473 | T18025 | T18026 | nsubj | FP,induced |
R15474 | T18026 | T18026 | ROOT | induced,induced |
R15475 | T18027 | T18028 | compound | MKP-1,mRNA |
R15476 | T18028 | T18026 | dobj | mRNA,induced |
R15477 | T18029 | T18026 | prep | in,induced |
R15478 | T18030 | T18032 | det | a,manner |
R15479 | T18031 | T18032 | amod | concentration-dependent,manner |
R15480 | T18032 | T18029 | pobj | manner,in |
R15481 | T18033 | T18026 | punct | .,induced |
R15482 | T18034 | T18035 | det | All,results |
R15483 | T18035 | T18036 | nsubj | results,are |
R15484 | T18036 | T18036 | ROOT | are,are |
R15485 | T18037 | T18036 | attr | representative,are |
R15486 | T18038 | T18037 | prep | of,representative |
R15487 | T18039 | T18040 | advmod | at,least |
R15488 | T18040 | T18041 | advmod | least,three |
R15489 | T18041 | T18043 | nummod | three,experiments |
R15490 | T18042 | T18043 | amod | independent,experiments |
R15491 | T18043 | T18038 | pobj | experiments,of |
R15492 | T18044 | T18043 | cc | and,experiments |
R15493 | T18045 | T18047 | advmod | where,expressed |
R15494 | T18046 | T18047 | amod | appropriate,expressed |
R15495 | T18047 | T18037 | relcl | expressed,representative |
R15496 | T18048 | T18047 | prep | as,expressed |
R15521 | T18073 | T18072 | prep | of,representative |
R15522 | T18074 | T18076 | nummod | two,experiments |
R15523 | T18075 | T18076 | amod | independent,experiments |
R15524 | T18076 | T18073 | pobj | experiments,of |
R15525 | T18077 | T18071 | punct | .,are |
R15526 | T18078 | T18079 | det | All,data |
R15527 | T18079 | T18085 | nsubjpass | data,analysed |
R15528 | T18080 | T18079 | prep | except,data |
R15529 | T18081 | T18082 | punct | (,E |
R15530 | T18082 | T18080 | pobj | E,except |
R15531 | T18083 | T18079 | punct | ),data |
R15532 | T18084 | T18085 | auxpass | were,analysed |
R15533 | T18085 | T18085 | ROOT | analysed,analysed |
R15534 | T18086 | T18085 | agent | by,analysed |
R15535 | T18087 | T18086 | pobj | ANOVA,by |
R15536 | T18088 | T18085 | prep | followed,analysed |
R15537 | T18089 | T18088 | agent | by,followed |
R15538 | T18090 | T18089 | pobj | Newman-Keuls,by |
R15539 | T18091 | T18088 | advmod | post-test,followed |
R15540 | T18092 | T18085 | punct | .,analysed |
R15666 | T18334 | T18335 | compound | Fluticasone,propionate |
R15667 | T18335 | T18336 | nsubj | propionate,competes |
R15668 | T18336 | T18336 | ROOT | competes,competes |
R15669 | T18337 | T18336 | prep | with,competes |
R15670 | T18338 | T18337 | pobj | phospho-GATA-3,with |
R15671 | T18339 | T18338 | prep | for,phospho-GATA-3 |
R15672 | T18340 | T18339 | pobj | importin-α,for |
R15673 | T18341 | T18336 | punct | .,competes |
R15674 | T18342 | T18346 | punct | (,representation |
R15675 | T18343 | T18346 | det | A,representation |
R15676 | T18344 | T18346 | punct | ),representation |
R15677 | T18345 | T18346 | amod | schematic,representation |
R15678 | T18346 | T18346 | ROOT | representation,representation |
R15679 | T18347 | T18346 | prep | of,representation |
R15680 | T18348 | T18353 | det | the,assay |
R15681 | T18349 | T18353 | nmod | in,assay |
R15682 | T18350 | T18353 | amod | vitro,assay |
R15683 | T18351 | T18352 | amod | binding,competition |
R15684 | T18352 | T18353 | compound | competition,assay |
R15685 | T18353 | T18347 | pobj | assay,of |
R15686 | T18354 | T18346 | punct | .,representation |
R15687 | T18355 | T18358 | punct | (,GR |
R15688 | T18356 | T18358 | nmod | B,GR |
R15689 | T18357 | T18358 | punct | ),GR |
R15690 | T18358 | T18359 | nsubj | GR,isolated |
R15691 | T18359 | T18359 | ROOT | isolated,isolated |
R15692 | T18360 | T18359 | prep | from,isolated |
R15693 | T18361 | T18360 | pobj | FP,from |
R15694 | T18362 | T18361 | punct | (,FP |
R15695 | T18363 | T18364 | nummod | 10,− |
R15696 | T18364 | T18361 | appos | −,FP |
R15697 | T18365 | T18366 | nummod | 8,M |
R15698 | T18366 | T18364 | appos | M,− |
R15699 | T18367 | T18364 | punct | ),− |
R15700 | T18368 | T18369 | amod | stimulated,cells |
R15701 | T18369 | T18370 | nsubj | cells,enhances |
R15702 | T18370 | T18370 | ROOT | enhances,enhances |
R15703 | T18371 | T18370 | dobj | GR,enhances |
R15704 | T18372 | T18373 | nsubj | importin-α,binding |
R15705 | T18373 | T18370 | oprd | binding,enhances |
R15706 | T18374 | T18373 | prep | in,binding |
R15707 | T18375 | T18376 | det | the,presence |
R15708 | T18376 | T18374 | pobj | presence,in |
R15709 | T18377 | T18378 | punct | (,• |
R15710 | T18378 | T18376 | appos | •,presence |
R15711 | T18379 | T18378 | punct | ),• |
R15712 | T18380 | T18378 | cc | and,• |
R15713 | T18381 | T18378 | conj | absence,• |
R15714 | T18382 | T18383 | punct | (,▪ |
R15715 | T18383 | T18381 | appos | ▪,absence |
R15716 | T18384 | T18376 | punct | ),presence |
R15717 | T18385 | T18376 | prep | of,presence |
R15718 | T18386 | T18387 | amod | activated,GATA-3 |
R15719 | T18387 | T18385 | pobj | GATA-3,of |
R15720 | T18388 | T18370 | punct | .,enhances |
R15721 | T18389 | T18393 | punct | *,compared |
R15722 | T18390 | T18391 | compound | p,< |
R15723 | T18391 | T18392 | compound | <,0.05 |
R15724 | T18392 | T18393 | nsubj | 0.05,compared |
R15725 | T18393 | T18393 | ROOT | compared,compared |
R15726 | T18394 | T18393 | prep | to,compared |
R15727 | T18395 | T18397 | det | no,GR |
R15728 | T18396 | T18397 | amod | activated,GR |
R15729 | T18397 | T18394 | pobj | GR,to |
R15730 | T18398 | T18393 | punct | .,compared |
R15731 | T18399 | T18400 | punct | (,C |
R15732 | T18400 | T18400 | ROOT | C,C |
R15733 | T18401 | T18400 | punct | ),C |
R15734 | T18402 | T18403 | nsubj | GATA-3,isolated |
R15735 | T18403 | T18412 | csubj | isolated,attenuate |
R15736 | T18404 | T18403 | prep | from,isolated |
R15737 | T18405 | T18406 | compound | anti-CD3,/ |
R15738 | T18406 | T18408 | npadvmod | /,stimulated |
R15739 | T18407 | T18406 | nummod | CD28,/ |
R15740 | T18408 | T18409 | amod | stimulated,cells |
R15741 | T18409 | T18404 | pobj | cells,from |
R15742 | T18410 | T18412 | aux | does,attenuate |
R15743 | T18411 | T18412 | neg | not,attenuate |
R15744 | T18412 | T18412 | ROOT | attenuate,attenuate |
R15745 | T18413 | T18412 | dobj | GR,attenuate |
R15746 | T18414 | T18415 | amod | importin-α,association |
R15747 | T18415 | T18413 | appos | association,GR |
R15748 | T18416 | T18412 | punct | .,attenuate |
R15749 | T18417 | T18417 | ROOT | *,* |
R15750 | T18418 | T18419 | compound | p,< |
R15751 | T18419 | T18420 | compound | <,0.05 |
R15752 | T18420 | T18421 | nsubj | 0.05,compared |
R15753 | T18421 | T18421 | ROOT | compared,compared |
R15754 | T18422 | T18423 | aux | to,control |
R15755 | T18423 | T18421 | xcomp | control,compared |
R15756 | T18424 | T18421 | punct | .,compared |
R15757 | T18425 | T18430 | punct | (,blocks |
R15758 | T18426 | T18429 | compound | D,GR |
R15759 | T18427 | T18428 | punct | ),Activated |
R15760 | T18428 | T18429 | compound | Activated,GR |
R15761 | T18429 | T18430 | nsubj | GR,blocks |
R15762 | T18430 | T18430 | ROOT | blocks,blocks |
R15763 | T18431 | T18432 | det | the,ability |
R15764 | T18432 | T18430 | dobj | ability,blocks |
R15765 | T18433 | T18432 | prep | of,ability |
R15766 | T18434 | T18435 | amod | purified,phospho-GATA-3 |
R15767 | T18435 | T18436 | amod | phospho-GATA-3,isolated |
R15768 | T18436 | T18433 | pobj | isolated,of |
R15769 | T18437 | T18436 | prep | from,isolated |
R15770 | T18438 | T18439 | compound | anti-CD3,/ |
R15771 | T18439 | T18440 | compound | /,CD28 |
R15772 | T18440 | T18437 | pobj | CD28,from |
R15773 | T18441 | T18442 | amod | stimulated,cells |
R15774 | T18442 | T18430 | dobj | cells,blocks |
R15775 | T18443 | T18442 | acl | interacting,cells |
R15776 | T18444 | T18443 | prep | with,interacting |
R15777 | T18445 | T18446 | amod | immobilised,importin-α |
R15779 | T18447 | T18443 | prep | in,interacting |
R15780 | T18448 | T18452 | det | an,assay |
R15781 | T18449 | T18452 | nmod | in,assay |
R15782 | T18450 | T18452 | amod | vitro,assay |
R15783 | T18451 | T18452 | amod | binding,assay |
R15784 | T18452 | T18447 | pobj | assay,in |
R15785 | T18453 | T18430 | punct | .,blocks |
R15786 | T18454 | T18461 | punct | *,isolated |
R15787 | T18455 | T18456 | compound | p,< |
R15788 | T18456 | T18457 | compound | <,0.05 |
R15789 | T18457 | T18461 | nsubjpass | 0.05,isolated |
R15790 | T18458 | T18461 | prep | compared,isolated |
R15791 | T18459 | T18461 | aux | to,isolated |
R15792 | T18460 | T18461 | nsubj | GATA-3,isolated |
R15793 | T18461 | T18461 | ROOT | isolated,isolated |
R15794 | T18462 | T18461 | prep | from,isolated |
R15795 | T18463 | T18464 | amod | unstimulated,cells |
R15796 | T18464 | T18462 | pobj | cells,from |
R15797 | T18465 | T18461 | punct | .,isolated |
R15798 | T18466 | T18468 | amod | # p,0.05 |
R15799 | T18467 | T18468 | compound | <,0.05 |
R15800 | T18468 | T18469 | nsubj | 0.05,compared |
R15801 | T18469 | T18469 | ROOT | compared,compared |
R15802 | T18470 | T18471 | aux | to,stimulated |
R15803 | T18471 | T18469 | xcomp | stimulated,compared |
R15804 | T18472 | T18473 | advmod | GATA-3-importin,binding |
R15805 | T18473 | T18471 | oprd | binding,stimulated |
R15806 | T18474 | T18469 | punct | .,compared |
R15807 | T18475 | T18476 | punct | (,E |
R15808 | T18476 | T18476 | ROOT | E,E |
R15809 | T18477 | T18476 | punct | ),E |
R15810 | T18478 | T18479 | det | The,effect |
R15811 | T18479 | T18497 | nsubj | effect,was |
R15812 | T18480 | T18479 | prep | of,effect |
R15813 | T18481 | T18483 | amod | activated,• |
R15814 | T18482 | T18483 | punct | (,• |
R15815 | T18483 | T18480 | pobj | •,of |
R15816 | T18484 | T18483 | punct | ),• |
R15817 | T18485 | T18483 | cc | versus,• |
R15818 | T18486 | T18483 | conj | unstimulated,• |
R15819 | T18487 | T18488 | punct | (,○ |
R15820 | T18488 | T18486 | appos | ○,unstimulated |
R15821 | T18489 | T18483 | punct | ),• |
R15822 | T18490 | T18479 | conj | GR,effect |
R15823 | T18491 | T18490 | prep | on,GR |
R15824 | T18492 | T18491 | pobj | attenuation,on |
R15825 | T18493 | T18492 | prep | of,attenuation |
R15826 | T18494 | T18493 | pobj | GATA-3,of |
R15827 | T18495 | T18496 | amod | importin-α,association |
R15828 | T18496 | T18497 | nsubj | association,was |
R15829 | T18497 | T18497 | ROOT | was,was |
R15830 | T18498 | T18497 | acomp | concentration-dependent,was |
R16175 | T18945 | T18944 | acl | showing,analysis |
R16176 | T18946 | T18959 | mark | that,affect |
R16177 | T18947 | T18959 | det | the,affect |
R16178 | T18948 | T18950 | amod | nuclear,inhibitor |
R16179 | T18949 | T18950 | compound | export,inhibitor |
R16180 | T18950 | T18959 | nsubj | inhibitor,affect |
R16181 | T18951 | T18952 | compound | leptomycin,B |
R16182 | T18952 | T18950 | appos | B,inhibitor |
R16183 | T18953 | T18954 | punct | (,2 |
R16184 | T18954 | T18955 | nummod | 2,nM |
R16185 | T18955 | T18952 | appos | nM,B |
R16186 | T18956 | T18952 | punct | ),B |
R16187 | T18957 | T18959 | aux | does,affect |
R16188 | T18958 | T18959 | neg | not,affect |
R16189 | T18959 | T18945 | ccomp | affect,showing |
R16190 | T18960 | T18961 | det | the,ability |
R16191 | T18961 | T18959 | dobj | ability,affect |
R16192 | T18962 | T18961 | prep | of,ability |
R16193 | T18963 | T18962 | pobj | FP,of |
R16194 | T18964 | T18963 | punct | (,FP |
R16195 | T18965 | T18966 | nummod | 10,− |
R16196 | T18966 | T18963 | appos | −,FP |
R16197 | T18967 | T18968 | nummod | 8,M |
R16198 | T18968 | T18966 | appos | M,− |
R16199 | T18969 | T18966 | punct | ),− |
R16200 | T18970 | T18971 | aux | to,prevent |
R16201 | T18971 | T18961 | acl | prevent,ability |
R16202 | T18972 | T18973 | compound | anti-CD3,/ |
R16203 | T18973 | T18971 | dobj | /,prevent |
R16204 | T18974 | T18973 | nummod | CD28,/ |
R16206 | T18976 | T18978 | amod | GATA-3,localization |
R16207 | T18977 | T18978 | amod | nuclear,localization |
R16208 | T18978 | T18975 | dobj | localization,stimulated |
R16209 | T18979 | T18978 | acl | measured,localization |
R16210 | T18980 | T18979 | prep | at,measured |
R16211 | T18981 | T18982 | nummod | 60,min |
R16212 | T18982 | T18980 | pobj | min,at |
R16213 | T18983 | T18975 | punct | .,stimulated |
R16214 | T18984 | T18986 | compound | ***,< |
R16215 | T18985 | T18986 | compound | p,< |
R16216 | T18986 | T18988 | nsubj | <,compared |
R16217 | T18987 | T18986 | nummod | 0.001,< |
R16218 | T18988 | T18997 | prep | compared,compared |
R16219 | T18989 | T18988 | prep | to,compared |
R16220 | T18990 | T18991 | amod | unstimulated,cells |
R16221 | T18991 | T18989 | pobj | cells,to |
R16222 | T18992 | T18997 | punct | ",",compared |
R16223 | T18993 | T18995 | nmod | ###,< |
R16224 | T18994 | T18995 | nmod | p,< |
R16225 | T18995 | T18996 | nmod | <,0.001 |
R16226 | T18996 | T18997 | nsubj | 0.001,compared |
R16227 | T18997 | T18997 | ROOT | compared,compared |
R16228 | T18998 | T18997 | prep | to,compared |
R16252 | T19022 | T19011 | ccomp | affect,showing |
R16253 | T19023 | T19025 | amod | whole-cell,degradation |
R16254 | T19024 | T19025 | amod | GATA-3,degradation |
R16255 | T19025 | T19022 | dobj | degradation,affect |
R16256 | T19026 | T19025 | prep | over,degradation |
R16257 | T19027 | T19028 | nummod | 17,h. |
R16258 | T19028 | T19026 | pobj | h.,over |
R16259 | T19029 | T19030 | punct | (,C |
R16260 | T19030 | T19028 | appos | C,h. |
R16261 | T19031 | T19030 | punct | ),C |
R16262 | T19032 | T19033 | amod | GFP-tagged,GATA-3 |
R16263 | T19033 | T19034 | nsubj | GATA-3,is |
R16264 | T19034 | T19034 | ROOT | is,is |
R16265 | T19035 | T19034 | acomp | overexpressed,is |
R16266 | T19036 | T19035 | cc | and,overexpressed |
R16267 | T19037 | T19035 | conj | cells,overexpressed |
R16268 | T19038 | T19037 | acl | stimulated,cells |
R16269 | T19039 | T19041 | punct | (,j |
R16270 | T19040 | T19041 | nmod | b,j |
R16271 | T19041 | T19038 | dobj | j,stimulated |
R16272 | T19042 | T19041 | punct | ),j |
R16273 | T19043 | T19038 | cc | or,stimulated |
R16274 | T19044 | T19045 | neg | not,( |
R16275 | T19045 | T19046 | punct | (,a |
R16276 | T19046 | T19037 | appos | a,cells |
R16277 | T19047 | T19046 | punct | ),a |
R16278 | T19048 | T19046 | prep | with,a |
R16279 | T19049 | T19050 | amod | anti-CD3,/ |
R16280 | T19050 | T19051 | compound | /,CD28 |
R16281 | T19051 | T19048 | pobj | CD28,with |
R16282 | T19052 | T19034 | punct | .,is |
R16283 | T19053 | T19054 | det | The,effect |
R16284 | T19054 | T19079 | nsubjpass | effect,shown |
R16285 | T19055 | T19054 | prep | of,effect |
R16286 | T19056 | T19055 | pcomp | treating,of |
R16287 | T19057 | T19056 | dobj | cells,treating |
R16288 | T19058 | T19056 | prep | with,treating |
R16289 | T19059 | T19058 | pobj | FP,with |
R16290 | T19060 | T19062 | punct | (,− |
R16291 | T19061 | T19062 | nummod | 10,− |
R16292 | T19062 | T19079 | npadvmod | −,shown |
R16293 | T19063 | T19062 | nummod | 8,− |
R16294 | T19064 | T19079 | npadvmod | M,shown |
R16295 | T19065 | T19079 | punct | ",",shown |
R16296 | T19066 | T19079 | nsubjpass | f,shown |
R16297 | T19067 | T19066 | appos | j,f |
R16298 | T19068 | T19066 | punct | ),f |
R16299 | T19069 | T19066 | prep | after,f |
R16300 | T19070 | T19072 | nummod | 30,stimulation |
R16301 | T19071 | T19072 | compound | min,stimulation |
R16302 | T19072 | T19069 | pobj | stimulation,after |
R16303 | T19073 | T19072 | prep | with,stimulation |
R16304 | T19074 | T19075 | amod | anti-CD3,/ |
R16305 | T19075 | T19076 | compound | /,CD28 |
R16306 | T19076 | T19073 | pobj | CD28,with |
R16307 | T19077 | T19079 | auxpass | is,shown |
R16308 | T19078 | T19079 | advmod | also,shown |
R16309 | T19079 | T19079 | ROOT | shown,shown |
R16310 | T19080 | T19079 | punct | .,shown |
R16311 | T19081 | T19084 | punct | (,FP |
R16312 | T19082 | T19084 | nmod | D,FP |
R16313 | T19083 | T19084 | punct | ),FP |
R16314 | T19084 | T19093 | nsubj | FP,prevent |
R16315 | T19085 | T19087 | punct | (,− |
R16316 | T19086 | T19087 | nummod | 10,− |
R16317 | T19087 | T19093 | nsubj | −,prevent |
R16318 | T19088 | T19087 | nummod | 8,− |
R16319 | T19089 | T19087 | appos | M,− |
R16320 | T19090 | T19087 | punct | ),− |
R16321 | T19091 | T19093 | aux | does,prevent |
R16322 | T19092 | T19093 | neg | not,prevent |
R16323 | T19093 | T19097 | ccomp | prevent,stimulated |
R16324 | T19094 | T19095 | compound | anti-CD3,/ |
R16325 | T19095 | T19093 | dobj | /,prevent |
R16326 | T19096 | T19095 | nummod | CD28,/ |
R16327 | T19097 | T19097 | ROOT | stimulated,stimulated |
R16328 | T19098 | T19100 | nummod | p65,translocation |
R16329 | T19099 | T19100 | amod | nuclear,translocation |
R16330 | T19100 | T19097 | dobj | translocation,stimulated |
R16331 | T19101 | T19097 | prep | at,stimulated |
R16332 | T19102 | T19103 | nummod | 60,min |
R16333 | T19103 | T19101 | pobj | min,at |
R16334 | T19104 | T19103 | prep | after,min |
R16335 | T19105 | T19104 | pobj | stimulation,after |
R16336 | T19106 | T19097 | punct | .,stimulated |
R16337 | T19107 | T19111 | dep | **,compared |
R16338 | T19108 | T19111 | nsubj | p,compared |
R16339 | T19109 | T19110 | nmod | <,0.01 |
R16340 | T19110 | T19108 | npadvmod | 0.01,p |
R16341 | T19111 | T19111 | ROOT | compared,compared |
R16342 | T19112 | T19111 | prep | to,compared |
R16343 | T19113 | T19114 | amod | unstimulated,cells |
R16344 | T19114 | T19112 | pobj | cells,to |
R16345 | T19115 | T19111 | punct | .,compared |
R16346 | T19116 | T19117 | det | All,results |
R16347 | T19117 | T19118 | nsubj | results,are |
R16348 | T19118 | T19118 | ROOT | are,are |
R16349 | T19119 | T19118 | attr | representative,are |
R16350 | T19120 | T19119 | prep | of,representative |
R16351 | T19121 | T19122 | advmod | at,least |
R16352 | T19122 | T19123 | advmod | least,four |
R16353 | T19123 | T19125 | nummod | four,experiments |
R16354 | T19124 | T19125 | amod | independent,experiments |
R16355 | T19125 | T19120 | pobj | experiments,of |
R16356 | T19126 | T19118 | cc | and,are |
R16357 | T19127 | T19128 | auxpass | are,shown |
R16358 | T19128 | T19118 | conj | shown,are |
R16359 | T19129 | T19128 | prep | as,shown |
R16360 | T19130 | T19132 | amod | mean,SEM |
R16361 | T19131 | T19132 | compound | ±,SEM |
R16362 | T19132 | T19129 | pobj | SEM,as |
R16363 | T19133 | T19118 | punct | .,are |
R16364 | T19134 | T19136 | nsubjpass | Results,analysed |
R16365 | T19135 | T19136 | auxpass | were,analysed |
R16366 | T19136 | T19136 | ROOT | analysed,analysed |
R16367 | T19137 | T19136 | agent | by,analysed |
R16368 | T19138 | T19137 | pobj | ANOVA,by |
R16369 | T19139 | T19136 | acl | followed,analysed |
R16370 | T19140 | T19139 | agent | by,followed |
R16371 | T19141 | T19142 | compound | Newman-Keuls,test |
R16372 | T19142 | T19140 | pobj | test,by |
R16373 | T19143 | T19136 | punct | .,analysed |
R16592 | T19430 | T19431 | compound | Fluticasone,propionate |
R16593 | T19431 | T19432 | nsubj | propionate,impairs |
R16594 | T19432 | T19432 | ROOT | impairs,impairs |
R16595 | T19433 | T19434 | amod | GATA-3,interaction |
R16596 | T19434 | T19432 | dobj | interaction,impairs |
R16597 | T19435 | T19434 | prep | with,interaction |
R16598 | T19436 | T19440 | amod | importin-α,localization |
R16599 | T19437 | T19436 | cc | and,importin-α |
R16600 | T19438 | T19436 | conj | GATA-3,importin-α |
R16601 | T19439 | T19440 | amod | nuclear,localization |
R16602 | T19440 | T19435 | pobj | localization,with |
R16603 | T19441 | T19440 | prep | in,localization |
R16604 | T19442 | T19441 | pobj | vivo,in |
R16605 | T19443 | T19442 | cc | and,vivo |
R16606 | T19444 | T19445 | dep | ex,vivo |
R16607 | T19445 | T19442 | conj | vivo,vivo |
R16608 | T19446 | T19432 | punct | .,impairs |
R16609 | T19447 | T19448 | punct | (,A |
R16610 | T19448 | T19448 | ROOT | A,A |
R16611 | T19449 | T19448 | cc | and,A |
R16612 | T19450 | T19453 | nmod | B,analysis |
R16613 | T19451 | T19450 | punct | ),B |
R16614 | T19452 | T19453 | compound | Co-immunoprecipitation,analysis |
R16615 | T19453 | T19465 | nsubj | analysis,demonstrated |
R16616 | T19454 | T19453 | prep | of,analysis |
R16617 | T19455 | T19454 | pobj | PBMCs,of |
R16618 | T19456 | T19455 | prep | from,PBMCs |
R16619 | T19457 | T19459 | amod | steroid-naïve,patients |
R16620 | T19458 | T19459 | compound | asthma,patients |
R16621 | T19459 | T19456 | pobj | patients,from |
R16622 | T19460 | T19459 | acl | treated,patients |
R16623 | T19461 | T19460 | prep | with,treated |
R16624 | T19462 | T19461 | pobj | FP,with |
R16625 | T19463 | T19460 | prep | in,treated |
R16626 | T19464 | T19463 | pobj | vitro,in |
R16627 | T19465 | T19448 | conj | demonstrated,A |
R16628 | T19466 | T19467 | amod | impaired,interaction |
R16629 | T19467 | T19465 | dobj | interaction,demonstrated |
R16630 | T19468 | T19467 | prep | between,interaction |
R16631 | T19469 | T19468 | pobj | GATA-3,between |
R16632 | T19470 | T19469 | cc | and,GATA-3 |
R16633 | T19471 | T19469 | conj | importin-α,GATA-3 |
R16634 | T19472 | T19465 | conj | measured,demonstrated |
R16635 | T19473 | T19472 | prep | at,measured |
R16636 | T19474 | T19475 | nummod | 60,min |
R16637 | T19475 | T19473 | pobj | min,at |
R16638 | T19476 | T19465 | punct | .,demonstrated |
R16639 | T19477 | T19478 | det | Each,bar |
R16640 | T19478 | T19479 | nsubj | bar,represents |
R16641 | T19479 | T19479 | ROOT | represents,represents |
R16642 | T19480 | T19483 | det | the,SEM |
R16643 | T19481 | T19483 | amod | mean,SEM |
R16644 | T19482 | T19483 | compound | ±,SEM |
R16645 | T19483 | T19479 | dobj | SEM,represents |
R16646 | T19484 | T19483 | prep | of,SEM |
R16647 | T19485 | T19486 | advmod | at,least |
R16648 | T19486 | T19487 | advmod | least,three |
R16649 | T19487 | T19489 | nummod | three,experiments |
R16650 | T19488 | T19489 | amod | independent,experiments |
R16651 | T19489 | T19484 | pobj | experiments,of |
R16652 | T19490 | T19483 | punct | ;,SEM |
R16653 | T19491 | T19493 | nmod | ***,< |
R16654 | T19492 | T19493 | nmod | p,< |
R16655 | T19493 | T19494 | nmod | <,0.001 |
R16656 | T19494 | T19483 | appos | 0.001,SEM |
R16657 | T19495 | T19494 | prep | compared,0.001 |
R16658 | T19496 | T19495 | prep | with,compared |
R16659 | T19497 | T19496 | pobj | control,with |
R16660 | T19498 | T19499 | mark | as,determined |
R16661 | T19499 | T19494 | advcl | determined,0.001 |
R16662 | T19500 | T19499 | agent | by,determined |
R16663 | T19501 | T19502 | compound | ANOVA/Newman-Keuls,analysis |
R16664 | T19502 | T19500 | pobj | analysis,by |
R16665 | T19503 | T19479 | punct | .,represents |
R16666 | T19504 | T19505 | punct | (,C |
R16667 | T19505 | T19505 | ROOT | C,C |
R16668 | T19506 | T19505 | cc | and,C |
R16669 | T19507 | T19505 | conj | D,C |
R16670 | T19508 | T19505 | punct | ),C |
R16671 | T19509 | T19510 | compound | Co-immunoprecipitation,analyses |
R16672 | T19510 | T19530 | nsubj | analyses,demonstrated |
R16673 | T19511 | T19510 | prep | of,analyses |
R16674 | T19512 | T19511 | pobj | PBMCs,of |
R16675 | T19513 | T19512 | prep | from,PBMCs |
R16676 | T19514 | T19516 | amod | steroid-naïve,patients |
R16677 | T19515 | T19516 | compound | asthma,patients |
R16678 | T19516 | T19513 | pobj | patients,from |
R16679 | T19517 | T19516 | acl | treated,patients |
R16680 | T19518 | T19517 | prep | with,treated |
R16681 | T19519 | T19520 | amod | inhaled,FP |
R16682 | T19520 | T19518 | pobj | FP,with |
R16683 | T19521 | T19520 | punct | (,FP |
R16684 | T19522 | T19523 | nummod | 500,µg |
R16685 | T19523 | T19520 | appos | µg,FP |
R16686 | T19524 | T19517 | prep | via,treated |
R16687 | T19525 | T19526 | det | a,spacer |
R16688 | T19526 | T19524 | pobj | spacer,via |
R16689 | T19527 | T19517 | punct | ),treated |
R16690 | T19528 | T19517 | prep | in,treated |
R16691 | T19529 | T19528 | pobj | vivo,in |
R16692 | T19530 | T19530 | ROOT | demonstrated,demonstrated |
R16693 | T19531 | T19532 | amod | decreased,association |
R16694 | T19532 | T19530 | dobj | association,demonstrated |
R16695 | T19533 | T19532 | prep | between,association |
R16696 | T19534 | T19533 | pobj | GATA-3,between |
R16697 | T19535 | T19534 | cc | and,GATA-3 |
R16698 | T19536 | T19534 | conj | importin-α,GATA-3 |
R16699 | T19537 | T19530 | punct | .,demonstrated |
R16700 | T19538 | T19540 | det | The,values |
R16701 | T19539 | T19540 | amod | individual,values |
R16702 | T19540 | T19545 | nsubjpass | values,presented |
R16703 | T19541 | T19540 | prep | for,values |
R16704 | T19542 | T19543 | det | each,treatment |
R16705 | T19543 | T19541 | pobj | treatment,for |
R16706 | T19544 | T19545 | auxpass | are,presented |
R16707 | T19545 | T19545 | ROOT | presented,presented |
R16708 | T19546 | T19545 | advmod | graphically,presented |
R16709 | T19547 | T19545 | punct | .,presented |
R16710 | T19548 | T19554 | punct | (,showing |
R16711 | T19549 | T19553 | nmod | E,blot |
R16712 | T19550 | T19549 | punct | ),E |
R16713 | T19551 | T19553 | compound | Representative,blot |
R16714 | T19552 | T19553 | compound | Western,blot |
R16715 | T19553 | T19554 | nsubj | blot,showing |
R16716 | T19554 | T19554 | ROOT | showing,showing |
R16717 | T19555 | T19559 | mark | that,unaffected |
R16718 | T19556 | T19557 | amod | importin-α,expression |
R16719 | T19557 | T19559 | nsubjpass | expression,unaffected |
R16720 | T19558 | T19559 | auxpass | was,unaffected |
R16721 | T19559 | T19554 | ccomp | unaffected,showing |
R16722 | T19560 | T19559 | prep | by,unaffected |
R16723 | T19561 | T19560 | pobj | inhalation,by |
R16724 | T19562 | T19561 | prep | of,inhalation |
R16725 | T19563 | T19562 | pobj | FP,of |
R16726 | T19564 | T19554 | punct | .,showing |
R16727 | T19565 | T19566 | nsubj | Blot,is |
R16728 | T19566 | T19566 | ROOT | is,is |
R16729 | T19567 | T19566 | attr | representative,is |
R16730 | T19568 | T19567 | prep | of,representative |
R16731 | T19569 | T19568 | pobj | gels,of |
R16732 | T19570 | T19567 | prep | from,representative |
R16733 | T19571 | T19572 | nummod | three,participants |
R16734 | T19572 | T19570 | pobj | participants,from |
R16735 | T19573 | T19566 | punct | .,is |
R17076 | T19983 | T19985 | amod | Inhaled,propionate |
R17077 | T19984 | T19985 | compound | fluticasone,propionate |
R17078 | T19985 | T19986 | nsubj | propionate,impairs |
R17079 | T19986 | T19986 | ROOT | impairs,impairs |
R17080 | T19987 | T19989 | amod | GATA-3,localization |
R17081 | T19988 | T19989 | amod | nuclear,localization |
R17082 | T19989 | T19986 | dobj | localization,impairs |
R17083 | T19990 | T19989 | prep | in,localization |
R17084 | T19991 | T19990 | pobj | PBMCs,in |
R17085 | T19992 | T19986 | punct | .,impairs |
R17086 | T19993 | T19993 | ROOT | (,( |
R17087 | T19994 | T19993 | dep | A,( |
R17088 | T19995 | T19994 | punct | ),A |
R17089 | T19996 | T19997 | compound | Representative,immunocytochemistry |
R17090 | T19997 | T19997 | ROOT | immunocytochemistry,immunocytochemistry |
R17091 | T19998 | T19997 | prep | of,immunocytochemistry |
R17092 | T19999 | T19998 | pcomp | showing,of |
R17093 | T20000 | T20001 | det | the,effect |
R17094 | T20001 | T19999 | dobj | effect,showing |
R17095 | T20002 | T20001 | prep | of,effect |
R17096 | T20003 | T20004 | amod | inhaled,FP |
R17097 | T20004 | T20002 | pobj | FP,of |
R17098 | T20005 | T20007 | punct | (,µg |
R17099 | T20006 | T20007 | nummod | 500,µg |
R17100 | T20007 | T20004 | appos | µg,FP |
R17122 | T20029 | T20030 | nummod | 2,h |
R17123 | T20030 | T20031 | amod | h,following |
R17124 | T20031 | T20021 | prep | following,immunoreactivity |
R17125 | T20032 | T20034 | amod | inhaled,treatment |
R17126 | T20033 | T20034 | compound | FP,treatment |
R17127 | T20034 | T20031 | dobj | treatment,following |
R17128 | T20035 | T20034 | punct | (,treatment |
R17129 | T20036 | T20039 | nummod | 100,µg |
R17130 | T20037 | T20036 | cc | or,100 |
R17131 | T20038 | T20036 | conj | 500,100 |
R17132 | T20039 | T20034 | appos | µg,treatment |
R17133 | T20040 | T20039 | prep | via,µg |
R17134 | T20041 | T20040 | pobj | spacer,via |
R17135 | T20042 | T20034 | punct | ),treatment |
R17136 | T20043 | T20021 | punct | .,immunoreactivity |
R17137 | T20044 | T20048 | det | The,ranges |
R17138 | T20045 | T20048 | amod | median,ranges |
R17139 | T20046 | T20045 | cc | and,median |
R17140 | T20047 | T20045 | conj | interquartile,median |
R17141 | T20048 | T20053 | nsubjpass | ranges,presented |
R17142 | T20049 | T20048 | prep | for,ranges |
R17143 | T20050 | T20051 | det | each,treatment |
R17144 | T20051 | T20049 | pobj | treatment,for |
R17145 | T20052 | T20053 | auxpass | are,presented |
R17146 | T20053 | T20053 | ROOT | presented,presented |
R17147 | T20054 | T20053 | prep | as,presented |
R17148 | T20055 | T20057 | det | a,plot |
R17149 | T20056 | T20057 | compound | box-and-whiskers,plot |
R17150 | T20057 | T20054 | pobj | plot,as |
R17151 | T20058 | T20061 | punct | (,7 |
R17152 | T20059 | T20061 | advmod | n,7 |
R17153 | T20060 | T20061 | punct | =,7 |
R17154 | T20061 | T20057 | appos | 7,plot |
R17155 | T20062 | T20061 | punct | ),7 |
R17156 | T20063 | T20053 | punct | ;,presented |
R17200 | T20107 | T20110 | nsubj | analyses,demonstrated |
R17201 | T20108 | T20107 | prep | of,analyses |
R17202 | T20109 | T20108 | pobj | PBMCs,of |
R17203 | T20110 | T20110 | ROOT | demonstrated,demonstrated |
R17204 | T20111 | T20113 | det | a,decrease |
R17205 | T20112 | T20113 | amod | dose-dependent,decrease |
R17206 | T20113 | T20110 | dobj | decrease,demonstrated |
R17207 | T20114 | T20113 | prep | in,decrease |
R17208 | T20115 | T20116 | amod | nuclear,expression |
R17209 | T20116 | T20114 | pobj | expression,in |
R17210 | T20117 | T20116 | prep | of,expression |
R17211 | T20118 | T20117 | pobj | GATA-3,of |
R17212 | T20119 | T20110 | punct | ",",demonstrated |
R17213 | T20120 | T20110 | cc | and,demonstrated |
R17214 | T20121 | T20110 | conj | increased,demonstrated |
R17215 | T20122 | T20124 | amod | cytoplasmic,expression |
R17216 | T20123 | T20124 | amod | GATA-3,expression |
R17217 | T20124 | T20121 | dobj | expression,increased |
R17218 | T20125 | T20126 | nummod | 2,h |
R17219 | T20126 | T20124 | appos | h,expression |
R17220 | T20127 | T20126 | prep | after,h |
R17221 | T20128 | T20127 | pobj | inhalation,after |
R17222 | T20129 | T20128 | prep | of,inhalation |
R17223 | T20130 | T20129 | pobj | FP,of |
R17224 | T20131 | T20110 | punct | .,demonstrated |
R17225 | T20132 | T20133 | compound | Histone,H1 |
R17226 | T20133 | T20137 | nsubj | H1,confirmed |
R17227 | T20134 | T20133 | cc | and,H1 |
R17228 | T20135 | T20133 | conj | MEK-1,H1 |
R17229 | T20136 | T20137 | nsubj | immunoblotting,confirmed |
R17230 | T20137 | T20137 | ROOT | confirmed,confirmed |
R17231 | T20138 | T20141 | amod | equivalent,loading |
R17232 | T20139 | T20140 | amod | total,protein |
R17233 | T20140 | T20141 | compound | protein,loading |
R17234 | T20141 | T20137 | dobj | loading,confirmed |
R17235 | T20142 | T20141 | prep | for,loading |
R17236 | T20143 | T20147 | det | the,fractions |
R17279 | T20186 | T20186 | ROOT | compared,compared |
R17280 | T20187 | T20188 | aux | to,control |
R17281 | T20188 | T20186 | xcomp | control,compared |
R17282 | T20189 | T20164 | punct | .,shown |
R17283 | T20190 | T20198 | punct | (,demonstrated |
R17284 | T20191 | T20195 | nmod | E,analyses |
R17285 | T20192 | T20191 | punct | ),E |
R17286 | T20193 | T20195 | amod | Western,analyses |
R17287 | T20194 | T20195 | compound | blot,analyses |
R17288 | T20195 | T20198 | nsubj | analyses,demonstrated |
R17289 | T20196 | T20195 | prep | of,analyses |
R17290 | T20197 | T20196 | pobj | PBMCs,of |
R17291 | T20198 | T20198 | ROOT | demonstrated,demonstrated |
R17292 | T20199 | T20201 | det | a,decrease |
R17293 | T20200 | T20201 | amod | time-dependent,decrease |
R17294 | T20201 | T20198 | dobj | decrease,demonstrated |
R17295 | T20202 | T20201 | prep | in,decrease |
R17296 | T20203 | T20204 | amod | dual,phosphorylation |
R17297 | T20204 | T20202 | pobj | phosphorylation,in |
R17298 | T20205 | T20206 | punct | (,threonine-180 |
R17299 | T20206 | T20204 | appos | threonine-180,phosphorylation |
R17300 | T20207 | T20206 | cc | and,threonine-180 |
R17301 | T20208 | T20206 | conj | tyrosine-182,threonine-180 |
R17302 | T20209 | T20206 | punct | ),threonine-180 |
R17303 | T20210 | T20206 | prep | of,threonine-180 |
R17304 | T20211 | T20212 | nummod | p38,MAPK |
R17305 | T20212 | T20210 | pobj | MAPK,of |
R17306 | T20213 | T20198 | prep | after,demonstrated |
R17307 | T20214 | T20213 | pobj | inhalation,after |
R17308 | T20215 | T20214 | prep | of,inhalation |
R17309 | T20216 | T20215 | pobj | FP,of |
R17310 | T20217 | T20219 | punct | (,µg |
R17311 | T20218 | T20219 | nummod | 500,µg |
R17312 | T20219 | T20216 | appos | µg,FP |
R17313 | T20220 | T20219 | punct | ),µg |
R17314 | T20221 | T20198 | punct | .,demonstrated |
R17321 | T20228 | T20223 | punct | ),results |
R17322 | T20229 | T20229 | ROOT | are,are |
R17323 | T20230 | T20229 | attr | representative,are |
R17324 | T20231 | T20230 | prep | of,representative |
R17325 | T20232 | T20231 | pobj | samples,of |
R17326 | T20233 | T20232 | prep | from,samples |
R17327 | T20234 | T20235 | nummod | two,participants |
R17328 | T20235 | T20233 | pobj | participants,from |
R17329 | T20236 | T20229 | punct | .,are |
R434 | T611 | T612 | amod | nuclear,transport |
R435 | T612 | T610 | pobj | transport,for |
R437 | T613 | T610 | prep | through,for |
R438 | T614 | T616 | det | the,importer |
R439 | T615 | T616 | amod | nuclear,importer |
R440 | T616 | T613 | pobj | importer,through |
R441 | T617 | T609 | conj | importin-α,receptor |
R442 | T618 | T574 | punct | .,demonstrated |
R443 | T619 | T623 | prep | In,induces |
R445 | T620 | T619 | pobj | addition,In |
R505 | T652 | T623 | punct | .,induces |
R507 | T653 | T655 | det | These,effects |
R509 | T654 | T655 | amod | inhibitory,effects |
R510 | T655 | T658 | nsubj | effects,are |
R513 | T656 | T655 | prep | of,effects |
R515 | T657 | T656 | pobj | fluticasone,of |
R516 | T658 | T658 | ROOT | are,are |
R517 | T659 | T658 | acomp | rapid,are |
R519 | T660 | T659 | punct | ",",rapid |
R520 | T661 | T659 | conj | potent,rapid |
R521 | T662 | T658 | punct | ",",are |
R523 | T663 | T658 | cc | and,are |
R524 | T664 | T658 | conj | prolonged,are |
R525 | T665 | T658 | punct | .,are |
R527 | T666 | T668 | nsubj | We,demonstrated |
R528 | T667 | T668 | advmod | also,demonstrated |
R530 | T668 | T668 | ROOT | demonstrated,demonstrated |
R531 | T669 | T672 | mark | that,inhibits |
R532 | T670 | T671 | amod | inhaled,fluticasone |
R533 | T671 | T672 | nsubj | fluticasone,inhibits |
R535 | T672 | T668 | ccomp | inhibits,demonstrated |
R536 | T673 | T675 | amod | GATA-3,translocation |
R538 | T674 | T675 | amod | nuclear,translocation |
R539 | T675 | T672 | dobj | translocation,inhibits |
R540 | T676 | T675 | prep | in,translocation |
R542 | T677 | T679 | amod | peripheral,lymphocytes |
R543 | T678 | T679 | compound | blood,lymphocytes |
R544 | T679 | T676 | pobj | lymphocytes,in |
R546 | T680 | T679 | prep | of,lymphocytes |
R547 | T681 | T680 | pobj | patients,of |
R549 | T682 | T672 | prep | with,inhibits |
R554 | T683 | T682 | pobj | asthma,with |
R555 | T684 | T683 | prep | in,asthma |
R557 | T685 | T684 | pobj | vivo,in |
R558 | T686 | T668 | punct | .,demonstrated |
R559 | T687 | T688 | compound | Conclusions,Corticosteroids |
R560 | T688 | T689 | nsubj | Corticosteroids,have |
R561 | T689 | T689 | ROOT | have,have |
R563 | T690 | T693 | det | a,effect |
R564 | T691 | T693 | amod | potent,effect |
R566 | T692 | T693 | amod | inhibitory,effect |
R567 | T693 | T689 | dobj | effect,have |
R568 | T694 | T693 | prep | on,effect |
R570 | T695 | T694 | pobj | GATA-3,on |
R571 | T696 | T689 | prep | via,have |
R576 | T697 | T699 | nummod | two,mechanisms |
R578 | T698 | T699 | amod | interacting,mechanisms |
R579 | T699 | T696 | pobj | mechanisms,via |
R580 | T700 | T702 | nsubj | that,suppress |
R582 | T701 | T702 | advmod | potently,suppress |
R583 | T702 | T699 | relcl | suppress,mechanisms |
R585 | T703 | T705 | amod | Th2,expression |
R586 | T704 | T705 | amod | cytokine,expression |
R587 | T705 | T702 | dobj | expression,suppress |
R589 | T706 | T689 | punct | .,have |
R590 | T707 | T709 | det | This,mechanism |
R591 | T708 | T709 | amod | novel,mechanism |
R593 | T709 | T715 | nsubj | mechanism,account |
R594 | T710 | T709 | prep | of,mechanism |
R595 | T711 | T710 | pobj | action,of |
R597 | T712 | T711 | prep | of,action |
R598 | T713 | T712 | pobj | corticosteroids,of |
R599 | T714 | T715 | aux | may,account |
R601 | T715 | T715 | ROOT | account,account |
R602 | T716 | T715 | prep | for,account |
R2703 | T3016 | T3015 | prep | of,inhibition |
R2705 | T3017 | T3018 | amod | Th2,cytokines |
R2706 | T3018 | T3016 | pobj | cytokines,of |
R2707 | T3038 | T3021 | advcl | have,is |
R2708 | T3019 | T3015 | prep | by,inhibition |
R2709 | T3020 | T3019 | pobj | corticosteroids,by |
R2710 | T3021 | T3021 | ROOT | is,is |
R2711 | T3022 | T3021 | neg | not,is |
R2712 | T3039 | T3042 | det | any,sequence |
R2713 | T3023 | T3024 | advmod | well,understood |
R2714 | T3024 | T3021 | acomp | understood,is |
R2715 | T3040 | T3042 | amod | recognisable,sequence |
R2716 | T3025 | T3021 | punct | ",",is |
R2717 | T3026 | T3038 | mark | because,have |
R2718 | T3027 | T3028 | det | the,genes |
R2719 | T3041 | T3042 | compound | GRE,sequence |
R2720 | T3028 | T3038 | nsubj | genes,have |
R2721 | T3029 | T3028 | acl | encoding,genes |
R2722 | T3030 | T3029 | dobj | IL-4,encoding |
R2723 | T3042 | T3038 | dobj | sequence,have |
R2724 | T3031 | T3030 | punct | ",",IL-4 |
R2725 | T3032 | T3030 | conj | IL-5,IL-4 |
R2726 | T3033 | T3032 | punct | ",",IL-5 |
R2727 | T3043 | T3045 | nmod | [,] |
R2728 | T3034 | T3029 | cc | and,encoding |
R2729 | T3035 | T3038 | nsubj | IL-13,have |
R2730 | T3036 | T3038 | aux | do,have |
R2731 | T3037 | T3038 | neg | not,have |
R2732 | T3044 | T3045 | nummod | 29,] |
R2733 | T3045 | T3042 | appos | ],sequence |
R2734 | T3046 | T3038 | cc | and,have |
R2735 | T3047 | T3050 | auxpass | are,regulated |
R2736 | T3048 | T3050 | advmod | only,regulated |
R2738 | T3049 | T3050 | advmod | partly,regulated |
R2741 | T3050 | T3038 | conj | regulated,have |
R2745 | T3051 | T3050 | agent | by,regulated |
R2750 | T3052 | T3051 | pobj | NF-κB,by |
R2753 | T3053 | T3050 | prep | in,regulated |
R2758 | T3054 | T3055 | amod | human,cells |
R2762 | T3055 | T3053 | pobj | cells,in |
R2765 | T3056 | T3058 | nmod | [,] |
R2769 | T3057 | T3058 | nummod | 30,] |
R2773 | T3058 | T3055 | appos | ],cells |
R2776 | T3059 | T3055 | appos | [,cells |
R2783 | T3060 | T3061 | nummod | 32,] |
R2787 | T3061 | T3059 | appos | ],[ |
R2791 | T3062 | T3021 | punct | .,is |
R2792 | T3063 | T3076 | advcl | Using,shown |
R2794 | T3064 | T3063 | dobj | overexpression,Using |
R2797 | T3065 | T3064 | cc | and,overexpression |
R2801 | T3066 | T3067 | amod | CAT-reporter,genes |
R2805 | T3067 | T3064 | conj | genes,overexpression |
R2809 | T3068 | T3067 | punct | ",",genes |
R2813 | T3069 | T3076 | nsubj | Lavender,shown |
R2817 | T3070 | T3069 | cc | and,Lavender |
R2821 | T3071 | T3069 | conj | colleagues,Lavender |
R2824 | T3072 | T3074 | nmod | [,] |
R2825 | T3073 | T3074 | nummod | 33,] |
R2826 | T3074 | T3071 | appos | ],colleagues |
R2827 | T3075 | T3076 | aux | have,shown |
R2828 | T3076 | T3076 | ROOT | shown,shown |
R2829 | T3077 | T3079 | mark | that,reduced |
R2830 | T3078 | T3079 | nsubj | GR,reduced |
R2831 | T3079 | T3076 | ccomp | reduced,shown |
R2832 | T3080 | T3081 | amod | GATA-3-mediated,IL-5 |
R2833 | T3081 | T3079 | dobj | IL-5,reduced |
R2834 | T3082 | T3079 | cc | and,reduced |
R2849 | T3097 | T3098 | amod | local,recruitment |
R2850 | T3098 | T3102 | nsubj | recruitment,alter |
R2851 | T3099 | T3098 | prep | of,recruitment |
R2852 | T3100 | T3099 | pobj | GR,of |
R2853 | T3101 | T3102 | aux | may,alter |
R2854 | T3102 | T3095 | ccomp | alter,postulated |
R2855 | T3103 | T3104 | det | the,ability |
R2856 | T3104 | T3102 | dobj | ability,alter |
R2857 | T3105 | T3104 | prep | of,ability |
R2858 | T3106 | T3105 | pobj | GATA-3,of |
R2859 | T3107 | T3109 | preconj | either,bind |
R2860 | T3108 | T3109 | aux | to,bind |
R2861 | T3109 | T3104 | conj | bind,ability |
R2862 | T3110 | T3102 | prep | to,alter |
R2863 | T3111 | T3113 | poss | its,site |
R2864 | T3112 | T3113 | compound | target,site |
R2865 | T3113 | T3110 | pobj | site,to |
R2866 | T3114 | T3102 | punct | ",",alter |
R2867 | T3115 | T3116 | aux | to,cause |
R2868 | T3116 | T3102 | advcl | cause,alter |
R2869 | T3117 | T3118 | amod | transcriptional,up-regulation |
R2870 | T3118 | T3116 | dobj | up-regulation,cause |
R2871 | T3119 | T3118 | punct | ",",up-regulation |
R2872 | T3120 | T3116 | cc | or,cause |
R2873 | T3121 | T3122 | aux | to,maintain |
R2874 | T3122 | T3116 | conj | maintain,cause |
R2875 | T3123 | T3124 | det | an,environment |
R2876 | T3124 | T3122 | dobj | environment,maintain |
R2877 | T3125 | T3126 | nsubj | that,is |
R2878 | T3126 | T3124 | relcl | is,environment |
R2879 | T3127 | T3126 | acomp | permissive,is |
R2880 | T3128 | T3127 | prep | for,permissive |
R2737 | T3135 | T3133 | dobj | effects,investigated |
R2739 | T3136 | T3135 | prep | of,effects |
R2740 | T3137 | T3139 | det | a,corticosteroid |
R2742 | T3138 | T3139 | amod | synthetic,corticosteroid |
R2743 | T3139 | T3136 | pobj | corticosteroid,of |
R2744 | T3140 | T3139 | punct | ",",corticosteroid |
R2746 | T3141 | T3139 | appos | FP,corticosteroid |
R2747 | T3142 | T3139 | punct | ",",corticosteroid |
R2748 | T3143 | T3135 | prep | on,effects |
R2749 | T3144 | T3145 | amod | GATA-3,phosphorylation |
R2751 | T3145 | T3143 | pobj | phosphorylation,on |
R2752 | T3146 | T3145 | cc | and,phosphorylation |
R2754 | T3147 | T3148 | amod | nuclear,translocation |
R2755 | T3148 | T3145 | conj | translocation,phosphorylation |
R2756 | T3149 | T3135 | prep | in,effects |
R2757 | T3150 | T3154 | det | a,line |
R2759 | T3151 | T3154 | compound | T,line |
R2760 | T3152 | T3154 | compound | lymphocyte,line |
R2761 | T3153 | T3154 | compound | cell,line |
R2763 | T3154 | T3149 | pobj | line,in |
R2764 | T3155 | T3156 | punct | (,HuT-78 |
R2766 | T3156 | T3154 | appos | HuT-78,line |
R2767 | T3157 | T3156 | punct | ),HuT-78 |
R2768 | T3158 | T3149 | cc | and,in |
R2770 | T3159 | T3149 | conj | in,in |
R2771 | T3160 | T3163 | amod | peripheral,cells |
R2772 | T3161 | T3162 | compound | blood,mononuclear |
R2774 | T3162 | T3163 | compound | mononuclear,cells |
R2775 | T3163 | T3159 | pobj | cells,in |
R2777 | T3164 | T3163 | acl | activated,cells |
R2778 | T3165 | T3164 | agent | by,activated |
R2779 | T3166 | T3169 | amod | anti-CD3,antibodies |
R779 | T454 | T473 | npadvmod | Suppression,plays |
R780 | T455 | T454 | prep | of,Suppression |
R781 | T456 | T458 | compound | GATA-3,Import |
R782 | T457 | T458 | compound | Nuclear,Import |
R783 | T458 | T455 | pobj | Import,of |
R388 | T491 | T490 | punct | ",",IL-5 |
R389 | T492 | T490 | cc | and,IL-5 |
R390 | T493 | T490 | conj | IL-13,IL-5 |
R391 | T494 | T490 | prep | from,IL-5 |
R392 | T495 | T496 | compound | T,helper-2 |
R393 | T496 | T494 | pobj | helper-2,from |
R394 | T497 | T496 | punct | (,helper-2 |
R395 | T498 | T496 | appos | Th2,helper-2 |
R396 | T499 | T496 | punct | ),helper-2 |
R397 | T500 | T494 | pobj | cells,from |
R399 | T501 | T473 | cc | and,plays |
R402 | T502 | T503 | advmod | therefore,is |
R406 | T503 | T473 | conj | is,plays |
R407 | T504 | T506 | det | a,mediator |
R408 | T505 | T506 | amod | key,mediator |
R409 | T506 | T503 | attr | mediator,is |
R410 | T507 | T506 | prep | of,mediator |
R411 | T508 | T509 | amod | allergic,diseases |
R412 | T509 | T507 | pobj | diseases,of |
R413 | T510 | T473 | punct | .,plays |
R417 | T511 | T512 | nsubj | Corticosteroids,are |
R420 | T512 | T512 | ROOT | are,are |
R424 | T513 | T514 | advmod | highly,effective |
R427 | T514 | T512 | acomp | effective,are |
R431 | T515 | T514 | prep | in,effective |
R414 | T596 | T595 | acomp | due,is |
R415 | T597 | T595 | punct | ",",is |
R416 | T598 | T595 | prep | in,is |
R418 | T599 | T598 | pobj | part,in |
R419 | T600 | T595 | punct | ",",is |
R421 | T601 | T577 | prep | to,inhibits |
R422 | T602 | T601 | pobj | competition,to |
R423 | T603 | T602 | prep | between,competition |
R425 | T604 | T603 | pobj | GATA-3,between |
R426 | T605 | T604 | cc | and,GATA-3 |
R428 | T606 | T609 | det | the,receptor |
R429 | T607 | T609 | amod | ligand-activated,receptor |
R430 | T608 | T609 | compound | glucocorticoid,receptor |
R432 | T609 | T604 | conj | receptor,GATA-3 |
R433 | T610 | T609 | prep | for,receptor |
R626 | T728 | T726 | pobj | diseases,of |
R627 | T729 | T715 | punct | .,account |
R628 | T730 | T731 | intj | Please,see |
R629 | T731 | T731 | ROOT | see,see |
R630 | T732 | T731 | advmod | later,see |
R631 | T733 | T732 | prep | in,later |
R633 | T734 | T735 | det | the,article |
R634 | T735 | T733 | pobj | article,in |
R635 | T736 | T735 | prep | for,article |
R636 | T737 | T739 | poss | Editors,Summary |
R638 | T738 | T737 | case | ',Editors |
R639 | T739 | T736 | pobj | Summary,for |
R1967 | T2279 | T2293 | nsubjpass | Inflammation,mediated |
R1968 | T2280 | T2279 | prep | in,Inflammation |
R1969 | T2281 | T2282 | amod | allergic,diseases |
R1970 | T2282 | T2280 | pobj | diseases,in |
R1971 | T2283 | T2284 | amod | such,as |
R1972 | T2284 | T2282 | prep | as,diseases |
R1973 | T2285 | T2284 | pobj | asthma,as |
R1974 | T2286 | T2285 | punct | ",",asthma |
R1975 | T2287 | T2285 | conj | rhinitis,asthma |
R1976 | T2288 | T2287 | punct | ",",rhinitis |
R2339 | T2666 | T2665 | pcomp | phosphorylating,in |
R2340 | T2667 | T2666 | dobj | GATA-3,phosphorylating |
R2342 | T2668 | T2669 | aux | to,enhance |
R2343 | T2669 | T2661 | advcl | enhance,plays |
R2344 | T2670 | T2671 | poss | its,interaction |
R2346 | T2671 | T2669 | dobj | interaction,enhance |
R2347 | T2672 | T2671 | prep | with,interaction |
R2348 | T2673 | T2676 | amod | importin-α,transport |
R2349 | T2674 | T2673 | cc | and,importin-α |
R2351 | T2675 | T2673 | conj | subsequent,importin-α |
R2352 | T2676 | T2672 | pobj | transport,with |
R2354 | T2677 | T2669 | prep | into,enhance |
R2355 | T2678 | T2679 | det | the,nucleus |
R2356 | T2679 | T2677 | pobj | nucleus,into |
R3379 | T3897 | T3898 | auxpass | was,taken |
R3380 | T3898 | T3886 | advcl | taken,given |
R3381 | T3899 | T3898 | prep | for,taken |
R3382 | T3900 | T3899 | pobj | preparation,for |
R3383 | T3901 | T3900 | prep | of,preparation |
R3384 | T3902 | T3901 | pobj | PBMCs,of |
R3385 | T3903 | T3898 | prep | at,taken |
R3386 | T3904 | T3903 | pobj | 1,at |
R3387 | T3905 | T3898 | cc | and,taken |
R3388 | T3906 | T3907 | nummod | 2,h |
R3603 | T4168 | T4164 | punct | ),Oxford |
R3717 | T4282 | T4284 | nsubjpass | reagents,purchased |
R3718 | T4283 | T4284 | auxpass | were,purchased |
R3719 | T4284 | T4284 | ROOT | purchased,purchased |
R3720 | T4285 | T4284 | prep | from,purchased |
R3721 | T4286 | T4285 | pobj | Sigma,from |
R3722 | T4287 | T4288 | punct | (,Poole |
R3723 | T4288 | T4284 | npadvmod | Poole,purchased |
R3724 | T4289 | T4288 | punct | ",",Poole |
R3725 | T4290 | T4288 | appos | UK,Poole |
R3726 | T4291 | T4288 | punct | ),Poole |
R4112 | T4768 | T4764 | dobj | virus,using |
R4113 | T4769 | T4771 | nmod | RT,Promega |
R4114 | T4770 | T4771 | punct | (,Promega |
R4115 | T4771 | T4768 | appos | Promega,virus |
R4116 | T4772 | T4771 | punct | ",",Promega |
R4117 | T4773 | T4771 | conj | Southampton,Promega |
R4118 | T4774 | T4773 | punct | ",",Southampton |
R4119 | T4775 | T4773 | conj | UK,Southampton |
R4120 | T4776 | T4771 | punct | ),Promega |
R4121 | T4777 | T4763 | punct | .,transcribed |
R4122 | T4778 | T4784 | prep | For,carried |
R4123 | T4779 | T4780 | amod | relative,quantification |
R4124 | T4780 | T4778 | pobj | quantification,For |
R4125 | T4781 | T4784 | punct | ",",carried |
R4126 | T4782 | T4784 | nsubjpass | RT-PCR,carried |
R4127 | T4783 | T4784 | auxpass | was,carried |
R4128 | T4784 | T4784 | ROOT | carried,carried |
R4129 | T4785 | T4784 | prt | out,carried |
R4130 | T4786 | T4784 | advcl | using,carried |
R4131 | T4787 | T4788 | compound | cDNA,probes |
R4132 | T4788 | T4786 | dobj | probes,using |
R4133 | T4789 | T4784 | punct | .,carried |
R4362 | T5053 | T5054 | compound | [,pH |
R4363 | T5054 | T5048 | appos | pH,P-40 |
R4364 | T5055 | T5056 | nummod | 7.5,] |
R4365 | T5056 | T5056 | ROOT | ],] |
R4366 | T5057 | T5056 | punct | ",",] |
R4367 | T5058 | T5060 | nummod | 150,NaCl |
R4368 | T5059 | T5060 | compound | mM,NaCl |
R4369 | T5060 | T5056 | appos | NaCl,] |
R4370 | T5061 | T5056 | punct | ),] |
R4371 | T5062 | T5056 | prep | in,] |
R4372 | T5063 | T5064 | det | the,presence |
R4373 | T5064 | T5062 | pobj | presence,in |
R4374 | T5065 | T5064 | prep | of,presence |
R4375 | T5066 | T5069 | amod | complete,inhibitor |
R4376 | T5067 | T5069 | compound | protease,inhibitor |
R4377 | T5068 | T5069 | compound | cocktail,inhibitor |
R4378 | T5069 | T5065 | pobj | inhibitor,of |
R4379 | T5070 | T5039 | punct | .,prepared |
R4380 | T5071 | T5073 | nsubjpass | Lysates,centrifuged |
R4381 | T5072 | T5073 | auxpass | were,centrifuged |
R4382 | T5073 | T5073 | ROOT | centrifuged,centrifuged |
R4383 | T5074 | T5073 | prep | at,centrifuged |
R4384 | T5075 | T5076 | nummod | 4,° |
R4385 | T5076 | T5074 | pobj | °,at |
R4386 | T5077 | T5073 | conj | C,centrifuged |
R4387 | T5078 | T5077 | prep | for,C |
R4388 | T5079 | T5080 | nummod | 10,min |
R4389 | T5080 | T5078 | pobj | min,for |
R4390 | T5081 | T5080 | prep | at,min |
R4391 | T5082 | T5083 | nummod | "12,000",rpm |
R4392 | T5083 | T5081 | pobj | rpm,at |
R4393 | T5084 | T5073 | prep | in,centrifuged |
R4394 | T5085 | T5087 | det | an,microcentrifuge |
R4395 | T5086 | T5087 | compound | Eppendorf,microcentrifuge |
R4396 | T5087 | T5084 | pobj | microcentrifuge,in |
R4397 | T5088 | T5089 | aux | to,remove |
R4398 | T5089 | T5073 | advcl | remove,centrifuged |
R4399 | T5090 | T5091 | amod | cellular,debris |
R4400 | T5091 | T5089 | dobj | debris,remove |
R4401 | T5092 | T5073 | punct | .,centrifuged |
R4402 | T5093 | T5096 | nsubjpass | Samples,immunoprecipitated |
R4403 | T5094 | T5096 | auxpass | were,immunoprecipitated |
R4404 | T5095 | T5096 | advmod | then,immunoprecipitated |
R4405 | T5096 | T5096 | ROOT | immunoprecipitated,immunoprecipitated |
R4406 | T5097 | T5096 | prep | with,immunoprecipitated |
R4407 | T5098 | T5100 | preconj | either,µl |
R4408 | T5099 | T5100 | nummod | 10,µl |
R4409 | T5100 | T5107 | nsubj | µl,using |
R4410 | T5101 | T5100 | prep | of,µl |
R4411 | T5102 | T5101 | pobj | antibody,of |
R4412 | T5103 | T5102 | prep | against,antibody |
R4413 | T5104 | T5103 | pobj | GATA-3,against |
R4414 | T5105 | T5104 | cc | or,GATA-3 |
R4416 | T5107 | T5097 | pcomp | using,with |
R4417 | T5108 | T5110 | nmod | A/G,slurry |
R4418 | T5109 | T5110 | amod | agarose,slurry |
R4419 | T5110 | T5107 | dobj | slurry,using |
R4420 | T5111 | T5107 | prep | in,using |
R4421 | T5112 | T5113 | det | the,presence |
R4422 | T5113 | T5111 | pobj | presence,in |
R4423 | T5114 | T5113 | prep | of,presence |
R4424 | T5115 | T5116 | amod | protease,inhibitor |
R4425 | T5116 | T5114 | pobj | inhibitor,of |
R4426 | T5117 | T5107 | advcl | using,using |
R4427 | T5118 | T5119 | det | the,Catch |
R4428 | T5119 | T5117 | dobj | Catch,using |
R4429 | T5120 | T5119 | cc | and,Catch |
R4430 | T5121 | T5119 | conj | Release,Catch |
R4431 | T5122 | T5119 | conj | methodology,Catch |
R4432 | T5123 | T5125 | punct | (,Biotechnology |
R4433 | T5124 | T5125 | compound | Upstate,Biotechnology |
R4434 | T5125 | T5119 | conj | Biotechnology,Catch |
R4435 | T5126 | T5125 | punct | ",",Biotechnology |
R4436 | T5127 | T5128 | compound | Lake,Placid |
R4437 | T5128 | T5125 | conj | Placid,Biotechnology |
R4974 | T5758 | T5755 | pobj | Assay,In |
R4975 | T5759 | T5758 | prep | for,Assay |
R4668 | T5393 | T5395 | punct | ′,TCATGGCTCTGAAACGTTCTG-3 |
R4669 | T5394 | T5395 | punct | -,TCATGGCTCTGAAACGTTCTG-3 |
R4670 | T5395 | T5396 | compound | TCATGGCTCTGAAACGTTCTG-3,′ |
R4671 | T5396 | T5388 | appos | ′,′ |
R4672 | T5397 | T5368 | punct | .,detected |
R4673 | T5398 | T5400 | nsubjpass | PCR,performed |
R4674 | T5399 | T5400 | auxpass | was,performed |
R4675 | T5400 | T5400 | ROOT | performed,performed |
R4676 | T5401 | T5400 | advcl | using,performed |
R4677 | T5402 | T5406 | det | a,cycler |
R4678 | T5403 | T5404 | nmod | Hybaid,Omnigene |
R4679 | T5404 | T5406 | nmod | Omnigene,cycler |
R4680 | T5405 | T5406 | amod | thermal,cycler |
R4681 | T5406 | T5401 | dobj | cycler,using |
R4682 | T5407 | T5408 | punct | (,Hybaid |
R4683 | T5408 | T5406 | appos | Hybaid,cycler |
R4684 | T5409 | T5408 | punct | ",",Hybaid |
R4685 | T5410 | T5408 | npadvmod | Ashford,Hybaid |
R4686 | T5411 | T5410 | punct | ",",Ashford |
R5070 | T5854 | T5853 | pobj | 96-well,to |
R5076 | T5860 | T5857 | pobj | antibody,with |
R5077 | T5861 | T5852 | punct | .,added |
R5078 | T5862 | T5880 | prep | After,added |
R5079 | T5863 | T5865 | nummod | 1,incubation |
R5080 | T5864 | T5865 | compound | h,incubation |
R5081 | T5865 | T5862 | pobj | incubation,After |
R5082 | T5866 | T5880 | punct | ",",added |
R5083 | T5867 | T5880 | nsubjpass | GATA-3,added |
R5084 | T5868 | T5870 | punct | (,ng/ml |
R5180 | T5964 | T5963 | pobj | GATA-3,of |
R5181 | T5965 | T5959 | punct | ",",used |
R5182 | T5966 | T5959 | cc | and,used |
R5183 | T5967 | T5968 | compound | rhodamine,donkey |
R5184 | T5968 | T5981 | nsubjpass | donkey,used |
R5185 | T5969 | T5970 | compound | anti-mouse,IgG |
R5186 | T5970 | T5981 | nsubjpass | IgG,used |
R5187 | T5971 | T5972 | punct | (,Novus |
R5188 | T5972 | T5970 | appos | Novus,IgG |
R5189 | T5973 | T5972 | punct | ",",Novus |
R5190 | T5974 | T5972 | npadvmod | Littleton,Novus |
R5191 | T5975 | T5974 | punct | ",",Littleton |
R5192 | T5976 | T5974 | conj | Colorado,Littleton |
R5193 | T5977 | T5976 | punct | ",",Colorado |
R5194 | T5978 | T5976 | conj | USA,Colorado |
R5195 | T5979 | T5976 | punct | ),Colorado |
R5196 | T5980 | T5981 | auxpass | was,used |
R5197 | T5981 | T5959 | conj | used,used |
R5198 | T5982 | T5981 | prep | for,used |
R5199 | T5983 | T5984 | det | the,detection |
R5200 | T5984 | T5982 | pobj | detection,for |
R5201 | T5985 | T5984 | prep | of,detection |
R5202 | T5986 | T5985 | pobj | GR,of |
R5203 | T5987 | T5981 | punct | .,used |
R5204 | T5988 | T5991 | nmod | FITC,levels |
R5205 | T5989 | T5988 | cc | and,FITC |
R5206 | T5990 | T5988 | conj | rhodamine,FITC |
R5314 | T6171 | T6170 | advcl | using,determined |
R5315 | T6172 | T6174 | det | an,kit |
R5316 | T6173 | T6174 | amod | ELISA-based,kit |
R5317 | T6174 | T6171 | dobj | kit,using |
R5318 | T6175 | T6174 | punct | (,kit |
R5319 | T6176 | T6177 | amod | Trans-AM,p65 |
R5320 | T6177 | T6174 | appos | p65,kit |
R5321 | T6178 | T6177 | punct | ",",p65 |
R5322 | T6179 | T6180 | compound | Active,Motif |
R5323 | T6180 | T6177 | appos | Motif,p65 |
R5324 | T6181 | T6180 | punct | ",",Motif |
R5325 | T6182 | T6180 | conj | Rixensart,Motif |
R5326 | T6183 | T6182 | punct | ",",Rixensart |
R5327 | T6184 | T6182 | conj | Belgium,Rixensart |
R5328 | T6185 | T6174 | punct | ),kit |
R5329 | T6186 | T6170 | punct | .,determined |
R5330 | T6187 | T6196 | prep | In,incubated |
R5331 | T6188 | T6187 | pobj | brief,In |
R5332 | T6189 | T6196 | punct | ",",incubated |
R5333 | T6190 | T6191 | nummod | 5,µg |
R5334 | T6191 | T6196 | nsubjpass | µg,incubated |
R5335 | T6192 | T6191 | prep | of,µg |
R5336 | T6193 | T6194 | amod | nuclear,extracts |
R5337 | T6194 | T6192 | pobj | extracts,of |
R5338 | T6195 | T6196 | auxpass | were,incubated |
R5339 | T6196 | T6196 | ROOT | incubated,incubated |
R5340 | T6197 | T6196 | prep | with,incubated |
R5341 | T6198 | T6199 | det | a,plate |
R5755 | T6647 | T6646 | punct | (,optics |
R5756 | T6648 | T6649 | compound | Leica,Microsystems |
R5757 | T6649 | T6646 | appos | Microsystems,optics |
R5758 | T6650 | T6649 | punct | ",",Microsystems |
R5759 | T6651 | T6649 | conj | Wetzlar,Microsystems |
R5760 | T6652 | T6651 | punct | ",",Wetzlar |
R5761 | T6653 | T6651 | conj | Germany,Wetzlar |
R5762 | T6654 | T6646 | punct | ),optics |
R5763 | T6655 | T6629 | punct | .,characterised |
R5764 | T6656 | T6657 | aux | To,determine |
R5765 | T6657 | T6677 | advcl | determine,used |
R5766 | T6658 | T6659 | det | the,specificity |
R5767 | T6659 | T6657 | dobj | specificity,determine |
R5768 | T6660 | T6659 | prep | of,specificity |
R5769 | T6661 | T6662 | det | the,antibodies |
R5770 | T6662 | T6660 | pobj | antibodies,of |
R5771 | T6663 | T6662 | punct | ",",antibodies |
R5772 | T6664 | T6665 | compound | rabbit,serum |
R5773 | T6665 | T6666 | compound | serum,immunoglobulin |
R5774 | T6666 | T6659 | conj | immunoglobulin,specificity |
R5775 | T6667 | T6666 | punct | (,immunoglobulin |
R5776 | T6668 | T6666 | appos | Dako,immunoglobulin |
R5777 | T6669 | T6666 | punct | ),immunoglobulin |
R5778 | T6670 | T6666 | cc | and,immunoglobulin |
R5779 | T6671 | T6672 | amod | secondary,antibodies |
R5780 | T6672 | T6666 | conj | antibodies,immunoglobulin |
R5781 | T6673 | T6657 | prep | without,determine |
R6102 | T7081 | T7082 | punct | -,EcoRI/3 |
R6103 | T7082 | T7083 | compound | EcoRI/3,′ |
R6104 | T7083 | T7077 | pobj | ′,into |
R6105 | T7084 | T7085 | nsubj | blunt,ended |
R6106 | T7085 | T7076 | advcl | ended,inserted |
R6107 | T7086 | T7087 | compound | GFP,vector |
R6108 | T7087 | T7085 | dobj | vector,ended |
R6109 | T7088 | T7085 | punct | .,ended |
R6110 | T7089 | T7090 | amod | Positive,clones |
R6111 | T7090 | T7092 | nsubjpass | clones,confirmed |
R6112 | T7091 | T7092 | auxpass | were,confirmed |
R6113 | T7092 | T7092 | ROOT | confirmed,confirmed |
R6114 | T7093 | T7092 | agent | by,confirmed |
R6115 | T7094 | T7093 | pobj | digestion,by |
R6116 | T7095 | T7094 | cc | and,digestion |
R6117 | T7096 | T7094 | conj | size,digestion |
R6118 | T7097 | T7094 | conj | analysis,digestion |
R6119 | T7098 | T7092 | prep | by,confirmed |
R6120 | T7099 | T7100 | nummod | 1,% |
R6121 | T7100 | T7103 | compound | %,electrophoresis |
R6122 | T7101 | T7102 | amod | agarose,gel |
R6123 | T7102 | T7103 | compound | gel,electrophoresis |
R6124 | T7103 | T7098 | pobj | electrophoresis,by |
R6125 | T7104 | T7098 | cc | and,by |
R6126 | T7105 | T7098 | conj | by,by |
R6127 | T7106 | T7105 | pcomp | sequencing,by |
R6128 | T7107 | T7092 | punct | .,confirmed |
R6207 | T7254 | T7255 | compound | Transfection,HuT-78 |
R6208 | T7255 | T7256 | compound | HuT-78,cells |
R6209 | T7256 | T7258 | nsubjpass | cells,transfected |
R6210 | T7257 | T7258 | auxpass | were,transfected |
R6211 | T7258 | T7258 | ROOT | transfected,transfected |
R6212 | T7259 | T7258 | prep | with,transfected |
R6213 | T7260 | T7261 | det | either,EP8 |
R6214 | T7261 | T7259 | pobj | EP8,with |
R6215 | T7262 | T7261 | cc | or,EP8 |
R6216 | T7263 | T7264 | compound | GFP,vector |
R6217 | T7264 | T7261 | conj | vector,EP8 |
R6218 | T7265 | T7266 | advmod | only,DNA |
R6219 | T7266 | T7267 | nsubj | DNA,using |
R6220 | T7267 | T7258 | advcl | using,transfected |
R6221 | T7268 | T7269 | compound | solution,R |
R6222 | T7269 | T7267 | dobj | R,using |
R6223 | T7270 | T7269 | punct | ",",R |
R6224 | T7271 | T7272 | compound | programme,V-001 |
R6225 | T7272 | T7269 | appos | V-001,R |
R6226 | T7273 | T7267 | prep | at,using |
R6227 | T7274 | T7275 | det | a,ratio |
R6228 | T7275 | T7282 | nmod | ratio,DNA |
R6229 | T7276 | T7275 | prep | of,ratio |
R6230 | T7277 | T7280 | nummod | 3,cells/4 |
R6231 | T7278 | T7280 | nummod | ×,cells/4 |
R6232 | T7279 | T7280 | nummod | 106,cells/4 |
R6233 | T7280 | T7276 | pobj | cells/4,of |
R6234 | T7281 | T7282 | compound | µg,DNA |
R6235 | T7282 | T7273 | pobj | DNA,at |
R6236 | T7283 | T7267 | prep | for,using |
R6237 | T7284 | T7283 | pobj | 7,for |
R6238 | T7285 | T7286 | nummod | 8,h |
R6239 | T7286 | T7284 | appos | h,7 |
R6240 | T7287 | T7286 | prep | in,h |
R6241 | T7288 | T7289 | amod | complete,medium |
R6242 | T7289 | T7287 | pobj | medium,in |
R6243 | T7290 | T7286 | punct | (,h |
R6244 | T7291 | T7292 | nummod | 10,% |
R6245 | T7292 | T7294 | nmod | %,serum |
R6246 | T7293 | T7294 | amod | bovine,serum |
R6259 | T7306 | T7305 | prep | for,protocol |
R6260 | T7307 | T7306 | pobj | nucleofection,for |
R6261 | T7308 | T7258 | punct | .,transfected |
R6262 | T7309 | T7310 | det | The,medium |
R6263 | T7310 | T7313 | nsubjpass | medium,changed |
R6264 | T7311 | T7313 | auxpass | was,changed |
R6265 | T7312 | T7313 | advmod | subsequently,changed |
R6266 | T7313 | T7313 | ROOT | changed,changed |
R6267 | T7314 | T7313 | prep | to,changed |
R6268 | T7315 | T7317 | nummod | 1,RPMI |
R6269 | T7316 | T7315 | quantmod | %,1 |
R6270 | T7317 | T7314 | pobj | RPMI,to |
R6271 | T7318 | T7313 | prep | for,changed |
R6272 | T7319 | T7320 | nummod | 24,h |
R6273 | T7320 | T7318 | pobj | h,for |
R6274 | T7321 | T7325 | mark | before,added |
R6275 | T7322 | T7323 | amod | transfected,cells |
R6276 | T7323 | T7325 | nsubjpass | cells,added |
R6277 | T7324 | T7325 | auxpass | were,added |
R6278 | T7325 | T7313 | advcl | added,changed |
R6279 | T7326 | T7325 | prep | to,added |
R6280 | T7327 | T7336 | amod | anti-CD3,performed |
R6281 | T7328 | T7331 | nummod | /,wells |
R6282 | T7329 | T7331 | nummod | CD28,wells |
R6283 | T7330 | T7331 | amod | treated,wells |
R6284 | T7331 | T7327 | dobj | wells,anti-CD3 |
R6285 | T7332 | T7327 | cc | and,anti-CD3 |
R6286 | T7333 | T7335 | amod | live,videomicroscopy |
R6287 | T7334 | T7335 | compound | cell,videomicroscopy |
R6288 | T7335 | T7327 | conj | videomicroscopy,anti-CD3 |
R6289 | T7336 | T7326 | pobj | performed,to |
R6290 | T7337 | T7313 | punct | .,changed |
R6411 | T7473 | T7476 | compound | Time-Lapse,cells |
R6883 | T7965 | T7966 | compound | GraphPad,Prism |
R6884 | T7966 | T7964 | dobj | Prism,using |
R6885 | T7967 | T7966 | nummod | 4,Prism |
R6886 | T7968 | T7970 | punct | (,Software |
R6887 | T7969 | T7970 | compound | GraphPad,Software |
R6888 | T7970 | T7966 | conj | Software,Prism |
R6889 | T7971 | T7970 | punct | ",",Software |
R6890 | T7972 | T7970 | appos | http://www.graphpad.com,Software |
R6891 | T7973 | T7970 | punct | ),Software |
R6892 | T7974 | T7944 | punct | .,presented |
R6893 | T7975 | T7976 | nsubj | Results,were |
R6894 | T7976 | T7976 | ROOT | were,were |
R6895 | T7977 | T7976 | acomp | analysed,were |
R6896 | T7978 | T7976 | advcl | using,were |
R6897 | T7979 | T7980 | amod | one-way,ANOVA |
R6898 | T7980 | T7978 | dobj | ANOVA,using |
R6899 | T7981 | T7978 | prep | with,using |
R6900 | T7982 | T7984 | compound | Newman-Keuls,test |
R6901 | T7983 | T7984 | compound | post,test |
R6902 | T7984 | T7981 | pobj | test,with |
R6903 | T7985 | T7978 | prep | except,using |
R6904 | T7986 | T7985 | prep | for,except |
R6905 | T7987 | T7988 | det | the,data |
R6906 | T7988 | T7986 | pobj | data,for |
R6907 | T7989 | T7988 | prep | from,data |
R6908 | T7990 | T7995 | det | the,study |
R6909 | T7991 | T7993 | prep | in,inhaled |
R6910 | T7992 | T7991 | pobj | vivo,in |
R6911 | T7993 | T7995 | amod | inhaled,study |
R6912 | T7994 | T7995 | compound | FP,study |
R6913 | T7995 | T7989 | pobj | study,from |
R6914 | T7996 | T7995 | punct | ",",study |
R6915 | T7997 | T7999 | nsubjpass | which,analysed |
R6916 | T7998 | T7999 | auxpass | was,analysed |
R6917 | T7999 | T7995 | relcl | analysed,study |
R6918 | T8000 | T7999 | agent | by,analysed |
R6919 | T8001 | T8003 | poss | Friedman,test |
R6920 | T8002 | T8001 | case | 's,Friedman |
R6921 | T8003 | T8000 | pobj | test,by |
R6922 | T8004 | T8003 | prep | with,test |
R6923 | T8005 | T8006 | amod | subsequent,Wilcoxson |
R6924 | T8006 | T8004 | pobj | Wilcoxson,with |
R6925 | T8007 | T8008 | amod | matched,pair |
R6926 | T8008 | T8009 | nsubj | pair,signed |
R6927 | T8009 | T7976 | conj | signed,were |
R6928 | T8010 | T8012 | compound | rank,test |
R6929 | T8011 | T8012 | compound | sum,test |
R6961 | T8043 | T8044 | nummod | 500,µg |
R6962 | T8044 | T8040 | conj | µg,µg |
R6963 | T8045 | T8044 | prep | of,µg |
R6964 | T8046 | T8047 | amod | inhaled,FP |
R6965 | T8047 | T8045 | pobj | FP,of |
R6966 | T8048 | T8047 | punct | ",",FP |
R6967 | T8049 | T8050 | nsubj | which,had |
R6968 | T8050 | T8047 | relcl | had,FP |
R6969 | T8051 | T8053 | amod | variable,levels |
R6970 | T8052 | T8053 | compound | baseline,levels |
R6971 | T8053 | T8050 | dobj | levels,had |
R6972 | T8054 | T8029 | punct | .,used |
R6973 | T8055 | T8058 | nsubj | We,assume |
R6974 | T8056 | T8058 | aux | did,assume |
R6975 | T8057 | T8058 | neg | not,assume |
R6976 | T8058 | T8058 | ROOT | assume,assume |
R6977 | T8059 | T8061 | det | a,distribution |
R6978 | T8060 | T8061 | amod | Gaussian,distribution |
R6979 | T8061 | T8058 | dobj | distribution,assume |
R6980 | T8062 | T8061 | prep | of,distribution |
R6981 | T8063 | T8064 | det | the,data |
R6982 | T8064 | T8062 | pobj | data,of |
R6983 | T8065 | T8061 | amod | due,distribution |
R6984 | T8066 | T8065 | pcomp | to,due |
R6985 | T8067 | T8069 | det | the,numbers |
R7330 | T8485 | T8482 | ccomp | affect,investigated |
R7331 | T8486 | T8487 | compound | anti-CD3,/ |
R7332 | T8487 | T8485 | dobj | /,affect |
R7333 | T8488 | T8487 | nummod | CD28,/ |
R7334 | T8489 | T8482 | dep | stimulated,investigated |
R7335 | T8490 | T8491 | amod | nuclear,import |
R7336 | T8491 | T8489 | dobj | import,stimulated |
R7337 | T8492 | T8491 | prep | of,import |
R7338 | T8493 | T8492 | pobj | GATA-3,of |
R7339 | T8494 | T8482 | punct | .,investigated |
R7340 | T8495 | T8502 | nsubj | Stimulation,resulted |
R7341 | T8496 | T8495 | prep | of,Stimulation |
R7342 | T8497 | T8496 | pobj | cells,of |
R7343 | T8498 | T8497 | prep | with,cells |
R7344 | T8499 | T8500 | compound | anti-CD3,/ |
R7345 | T8500 | T8498 | pobj | /,with |
R7346 | T8501 | T8500 | nummod | CD28,/ |
R7482 | T8637 | T8636 | prep | of,loss |
R7483 | T8638 | T8639 | amod | GATA-3,binding |
R7484 | T8639 | T8636 | amod | binding,loss |
R7485 | T8640 | T8639 | prep | to,binding |
R7486 | T8641 | T8644 | det | the,promoter |
R7488 | T8643 | T8644 | compound | IL-5,promoter |
R7489 | T8644 | T8640 | pobj | promoter,to |
R7490 | T8645 | T8646 | punct | (,Figure |
R7491 | T8646 | T8644 | appos | Figure,promoter |
R7492 | T8647 | T8646 | nummod | 1E,Figure |
R7493 | T8648 | T8646 | punct | ),Figure |
R7494 | T8649 | T8587 | punct | .,was |
R7848 | T9109 | T9110 | compound | Ligand-Activated,GR |
R8972 | T10422 | T10417 | acl | utilizing,assay |
R8973 | T10423 | T10425 | amod | purified,GATA-3 |
R8974 | T10424 | T10425 | amod | activated,GATA-3 |
R8975 | T10425 | T10422 | dobj | GATA-3,utilizing |
R8976 | T10426 | T10425 | punct | ",",GATA-3 |
R8977 | T10427 | T10425 | conj | importin-α,GATA-3 |
R8978 | T10428 | T10412 | punct | ",",Using |
R8979 | T10429 | T10412 | cc | and,Using |
R8980 | T10430 | T10434 | advcl | activated,demonstrated |
R8981 | T10431 | T10430 | dobj | GR,activated |
R8982 | T10432 | T10434 | punct | ",",demonstrated |
R8983 | T10433 | T10434 | nsubj | we,demonstrated |
R8984 | T10434 | T10434 | ROOT | demonstrated,demonstrated |
R8985 | T10435 | T10436 | mark | that,activated |
R8986 | T10436 | T10434 | ccomp | activated,demonstrated |
R8987 | T10437 | T10439 | nsubj | GR,increased |
R8988 | T10438 | T10439 | advmod | significantly,increased |
R9208 | T10658 | T10660 | nummod | p65,translocation |
R9209 | T10659 | T10660 | amod | nuclear,translocation |
R9210 | T10660 | T10657 | pobj | translocation,on |
R9211 | T10661 | T10654 | conj | measured,had |
R9212 | T10662 | T10661 | prep | at,measured |
R9213 | T10663 | T10664 | nummod | 60,min |
R9214 | T10664 | T10662 | pobj | min,at |
R9215 | T10665 | T10666 | punct | (,Figure |
R9216 | T10666 | T10664 | appos | Figure,min |
R9217 | T10667 | T10666 | nummod | 5D,Figure |
R9218 | T10668 | T10666 | punct | ),Figure |
R9219 | T10669 | T10642 | punct | .,was |
R10235 | T11922 | T11924 | det | The,Effect |
R10236 | T11923 | T11924 | compound | Inhibitory,Effect |
R10237 | T11924 | T11945 | nsubj | Effect,demonstrated |
R10238 | T11925 | T11924 | prep | of,Effect |
R10239 | T11926 | T11925 | pobj | Corticosteroids,of |
R10240 | T11927 | T11924 | prep | on,Effect |
R10241 | T11928 | T11930 | compound | GATA-3,Localization |
R10242 | T11929 | T11930 | compound | Nuclear,Localization |
R10243 | T11930 | T11927 | pobj | Localization,on |
R10244 | T11931 | T11930 | prep | in,Localization |
R10245 | T11932 | T11933 | compound | Primary,T |
R10246 | T11933 | T11934 | compound | T,Lymphocytes |
R10247 | T11934 | T11936 | compound | Lymphocytes,Vivo |
R10248 | T11935 | T11936 | compound | Ex,Vivo |
R10249 | T11936 | T11931 | pobj | Vivo,in |
R10250 | T11937 | T11924 | cc | and,Effect |
R10251 | T11938 | T11945 | prep | In,demonstrated |
R10252 | T11939 | T11940 | compound | Vivo,Treatment |
R10253 | T11940 | T11938 | pobj | Treatment,In |
R10254 | T11941 | T11940 | prep | with,Treatment |
R10255 | T11942 | T11944 | compound | FP,vivo |
R10335 | T12022 | T12023 | nsubj | FP,suppresses |
R10336 | T12023 | T12016 | ccomp | suppresses,indicated |
R10337 | T12024 | T12023 | dobj | IL-4,suppresses |
R10338 | T12025 | T12024 | cc | and,IL-4 |
R10339 | T12026 | T12028 | nummod | -5,expression |
R10340 | T12027 | T12028 | compound | gene,expression |
R10341 | T12028 | T12024 | conj | expression,IL-4 |
R10342 | T12029 | T12028 | cc | and,expression |
R10343 | T12030 | T12016 | conj | attenuated,indicated |
R10344 | T12031 | T12032 | det | the,interaction |
R10345 | T12032 | T12030 | dobj | interaction,attenuated |
R10346 | T12033 | T12032 | prep | of,interaction |
R10347 | T12034 | T12033 | pobj | GATA-3,of |
R10348 | T12035 | T12032 | prep | with,interaction |
R10349 | T12036 | T12035 | pobj | importin-α,with |
R10450 | T12137 | T12140 | nsubj | this,reach |
R10451 | T12138 | T12140 | aux | did,reach |
R10452 | T12139 | T12140 | neg | not,reach |
R10453 | T12140 | T12140 | ROOT | reach,reach |
R10454 | T12141 | T12140 | dobj | significance,reach |
R10455 | T12142 | T12140 | advcl | using,reach |
R10456 | T12143 | T12146 | poss | Wilcoxon,analysis |
R10457 | T12144 | T12143 | case | 's,Wilcoxon |
R10458 | T12145 | T12146 | amod | post-test,analysis |
R10459 | T12146 | T12142 | dobj | analysis,using |
R10460 | T12147 | T12153 | punct | (,due |
R10461 | T12148 | T12153 | nsubj | W,due |
R10462 | T12149 | T12150 | punct | =,6.00 |
R10463 | T12150 | T12148 | nummod | 6.00,W |
R10464 | T12151 | T12148 | punct | ),W |
R10465 | T12152 | T12153 | advmod | probably,due |
R10466 | T12153 | T12140 | advcl | due,reach |
R10467 | T12154 | T12153 | pcomp | to,due |
R10468 | T12155 | T12156 | amod | low,numbers |
R10469 | T12156 | T12154 | pobj | numbers,to |
R10470 | T12157 | T12156 | prep | of,numbers |
R10471 | T12158 | T12157 | pobj | participants,of |
R10472 | T12159 | T12140 | punct | .,reach |
R10473 | T12160 | T12161 | amod | Similar,results |
R10474 | T12161 | T12163 | nsubjpass | results,observed |
R10505 | T12192 | T12197 | nsubj | interaction,result |
R10506 | T12193 | T12192 | prep | of,interaction |
R10507 | T12194 | T12193 | pobj | GATA-3,of |
R10508 | T12195 | T12197 | aux | did,result |
R10509 | T12196 | T12197 | neg | not,result |
R10510 | T12197 | T12197 | ROOT | result,result |
R10511 | T12198 | T12197 | prep | from,result |
R10512 | T12199 | T12201 | det | the,recycling |
R10513 | T12200 | T12201 | amod | defective,recycling |
R10514 | T12201 | T12198 | pobj | recycling,from |
R10515 | T12202 | T12201 | prep | of,recycling |
R10516 | T12203 | T12202 | pobj | importin-α,of |
R10517 | T12204 | T12197 | punct | ",",result |
R10518 | T12205 | T12197 | prep | as,result |
R10519 | T12206 | T12208 | det | a,decrease |
R10520 | T12207 | T12208 | amod | significant,decrease |
R10521 | T12208 | T12205 | pobj | decrease,as |
R10522 | T12209 | T12208 | prep | in,decrease |
R10523 | T12210 | T12211 | det | the,abundance |
R10524 | T12211 | T12209 | pobj | abundance,in |
R10525 | T12212 | T12211 | prep | of,abundance |
R10526 | T12213 | T12212 | pobj | importin-α,of |
R10527 | T12214 | T12208 | prep | in,decrease |
R10528 | T12215 | T12217 | det | the,pool |
R10529 | T12216 | T12217 | amod | cytoplasmic,pool |
R10530 | T12217 | T12214 | pobj | pool,in |
R10531 | T12218 | T12220 | auxpass | was,detected |
R10532 | T12219 | T12220 | neg | not,detected |
R10533 | T12220 | T12197 | conj | detected,result |
R10534 | T12221 | T12222 | punct | (,Figure |
R10535 | T12222 | T12220 | advmod | Figure,detected |
R10536 | T12223 | T12222 | nummod | 6E,Figure |
R10537 | T12224 | T12222 | punct | ),Figure |
R10538 | T12225 | T12197 | punct | .,result |
R10539 | T12226 | T12228 | nsubj | We,examined |
R10540 | T12227 | T12228 | advmod | further,examined |
R10541 | T12228 | T12228 | ROOT | examined,examined |
R10542 | T12229 | T12233 | mark | whether,affect |
R10543 | T12230 | T12231 | amod | inhaled,FP |
R10544 | T12231 | T12233 | nsubj | FP,affect |
R10545 | T12232 | T12233 | aux | could,affect |
R10546 | T12233 | T12228 | ccomp | affect,examined |
R10547 | T12234 | T12235 | amod | cellular,localization |
R10548 | T12235 | T12233 | dobj | localization,affect |
R10549 | T12236 | T12235 | prep | of,localization |
R10550 | T12237 | T12236 | pobj | GATA-3,of |
R10551 | T12238 | T12235 | prep | in,localization |
R10552 | T12239 | T12242 | amod | peripheral,cells |
R10553 | T12240 | T12242 | compound | blood,cells |
R10584 | T12271 | T12276 | amod | GATA-3,cells |
R10661 | T12348 | T12349 | nummod | 500,µg |
R10662 | T12349 | T12346 | appos | µg,FP |
R10663 | T12350 | T12346 | punct | ),FP |
R10664 | T12351 | T12345 | conj | induced,inhaled |
R10665 | T12352 | T12353 | amod | significant,loss |
R10776 | T12463 | T12464 | compound | T,cells |
R10777 | T12464 | T12461 | pobj | cells,in |
R10778 | T12465 | T12457 | prep | in,inhibited |
R10779 | T12466 | T12465 | pobj | vivo,in |
R10780 | T12467 | T12457 | prep | at,inhibited |
R10781 | T12468 | T12469 | nummod | 2,h |
R10782 | T12469 | T12467 | pobj | h,at |
R10783 | T12470 | T12469 | prep | in,h |
R10784 | T12471 | T12470 | pobj | samples,in |
R10785 | T12472 | T12471 | prep | from,samples |
R10786 | T12473 | T12474 | nummod | two,patients |
R10787 | T12474 | T12472 | pobj | patients,from |
R10788 | T12475 | T12474 | punct | (,patients |
R10789 | T12476 | T12474 | appos | Figure,patients |
R10790 | T12477 | T12476 | nummod | 7E,Figure |
R10791 | T12478 | T12474 | punct | ),patients |
R10792 | T12479 | T12457 | punct | .,inhibited |
R10793 | T12480 | T12485 | advcl | Taken,suggest |
R10794 | T12481 | T12480 | advmod | together,Taken |
R10795 | T12482 | T12485 | punct | ",",suggest |
R10796 | T12483 | T12484 | poss | our,data |
R10797 | T12484 | T12485 | nsubj | data,suggest |
R10798 | T12485 | T12485 | ROOT | suggest,suggest |
R10799 | T12486 | T12487 | mark | that,inhaled |
R10800 | T12487 | T12485 | ccomp | inhaled,suggest |
R10801 | T12488 | T12489 | nsubj | FP,reduces |
R10802 | T12489 | T12487 | pcomp | reduces,inhaled |
R10803 | T12490 | T12491 | amod | nuclear,localization |
R10804 | T12491 | T12489 | dobj | localization,reduces |
R10805 | T12492 | T12491 | prep | of,localization |
R10806 | T12493 | T12492 | pobj | GATA-3,of |
R10807 | T12494 | T12491 | prep | in,localization |
R10808 | T12495 | T12494 | pobj | vivo,in |
R10809 | T12496 | T12489 | prep | by,reduces |
R10810 | T12497 | T12498 | advmod | acutely,inhibiting |
R10811 | T12498 | T12496 | pcomp | inhibiting,by |
R12351 | T14339 | T14337 | conj | interacting,distinct |
R12352 | T14340 | T14341 | amod | molecular,mechanisms |
R12353 | T14341 | T14335 | pobj | mechanisms,via |
R12354 | T14342 | T14312 | punct | .,demonstrated |
R12355 | T14343 | T14347 | advmod | Firstly,appears |
R12356 | T14344 | T14347 | punct | ",",appears |
R12357 | T14345 | T14346 | compound | corticosteroid-activated,GR |
R12358 | T14346 | T14347 | nsubj | GR,appears |
R12359 | T14347 | T14347 | ROOT | appears,appears |
R12360 | T14348 | T14349 | aux | to,compete |
R12361 | T14349 | T14347 | xcomp | compete,appears |
R12362 | T14350 | T14349 | prep | with,compete |
R12363 | T14351 | T14352 | amod | activated,GATA-3 |
R12364 | T14352 | T14350 | pobj | GATA-3,with |
R12365 | T14353 | T14349 | prep | for,compete |
R12366 | T14354 | T14355 | amod | nuclear,import |
R12367 | T14355 | T14353 | pobj | import,for |
R12368 | T14356 | T14349 | prep | via,compete |
R12369 | T14357 | T14356 | pobj | importin-α,via |
R12370 | T14358 | T14357 | punct | ",",importin-α |
R12371 | T14359 | T14361 | nsubjpass | which,required |
R12372 | T14360 | T14361 | auxpass | is,required |
R12373 | T14361 | T14349 | advcl | required,compete |
R12374 | T14362 | T14361 | prep | for,required |
R12375 | T14363 | T14365 | det | the,transport |
R12376 | T14364 | T14365 | amod | nuclear,transport |
R12377 | T14365 | T14362 | pobj | transport,for |
R12378 | T14366 | T14365 | prep | of,transport |
R12379 | T14367 | T14368 | preconj | both,GATA-3 |
R12380 | T14368 | T14366 | pobj | GATA-3,of |
R12381 | T14369 | T14368 | cc | and,GATA-3 |
R12382 | T14370 | T14368 | conj | GR,GATA-3 |
R12383 | T14371 | T14347 | punct | .,appears |
R12384 | T14372 | T14378 | advmod | Secondly,increase |
R12385 | T14373 | T14378 | punct | ",",increase |
R12386 | T14374 | T14378 | nsubj | corticosteroids,increase |
R12387 | T14375 | T14374 | prep | at,corticosteroids |
R12388 | T14376 | T14377 | amod | higher,concentrations |
R12389 | T14377 | T14375 | pobj | concentrations,at |
R12430 | T14418 | T14378 | punct | .,increase |
R12431 | T14419 | T14422 | nsubj | We,shown |
R12432 | T14420 | T14422 | aux | have,shown |
R12433 | T14421 | T14422 | advmod | previously,shown |
R12434 | T14422 | T14422 | ROOT | shown,shown |
R12435 | T14423 | T14433 | mark | that,involves |
R12436 | T14424 | T14433 | nsubj | translocation,involves |
R12437 | T14425 | T14424 | prep | of,translocation |
R12438 | T14426 | T14425 | pobj | GATA-3,of |
R12439 | T14427 | T14424 | prep | from,translocation |
R12440 | T14428 | T14429 | det | the,cytoplasm |
R12441 | T14429 | T14427 | pobj | cytoplasm,from |
R12442 | T14430 | T14424 | prep | to,translocation |
R12443 | T14431 | T14432 | det | the,nucleus |
R12444 | T14432 | T14430 | pobj | nucleus,to |
R12445 | T14433 | T14422 | ccomp | involves,shown |
R12446 | T14434 | T14437 | det | the,protein |
R12447 | T14435 | T14436 | amod | nuclear,transporter |
R12448 | T14436 | T14437 | compound | transporter,protein |
R12449 | T14437 | T14438 | compound | protein,importin-α |
R12450 | T14438 | T14433 | dobj | importin-α,involves |
R12451 | T14439 | T14438 | punct | ",",importin-α |
R12452 | T14440 | T14441 | nsubj | which,interacts |
R12453 | T14441 | T14438 | relcl | interacts,importin-α |
R12454 | T14442 | T14441 | prep | with,interacts |
R12455 | T14443 | T14445 | amod | phosphorylated,[ |
R12456 | T14444 | T14445 | compound | GATA-3,[ |
R12457 | T14445 | T14442 | pobj | [,with |
R12708 | T14696 | T14694 | pobj | synthesis,in |
R12709 | T14697 | T14698 | auxpass | are,required |
R12710 | T14698 | T14687 | advcl | required,be |
R12711 | T14699 | T14677 | punct | .,is |
R12712 | T14700 | T14702 | det | This,mechanism |
R12713 | T14701 | T14702 | amod | acute,mechanism |
R12714 | T14702 | T14705 | nsubj | mechanism,contribute |
R12715 | T14703 | T14705 | aux | may,contribute |
R12716 | T14704 | T14705 | advmod | also,contribute |
R12717 | T14705 | T14705 | ROOT | contribute,contribute |
R12718 | T14706 | T14705 | prep | to,contribute |
R12719 | T14707 | T14708 | det | the,reduction |
R12720 | T14708 | T14706 | pobj | reduction,to |
R12721 | T14709 | T14708 | prep | in,reduction |
R12722 | T14710 | T14712 | amod | GATA-3,import |
R12723 | T14711 | T14712 | amod | nuclear,import |
R12724 | T14712 | T14709 | pobj | import,in |
R12725 | T14713 | T14705 | cc | and,contribute |
R12726 | T14714 | T14715 | aux | may,play |
R12727 | T14715 | T14705 | conj | play,contribute |
R12728 | T14716 | T14718 | det | a,role |
R12729 | T14717 | T14718 | amod | major,role |
R12730 | T14718 | T14715 | dobj | role,play |
R12731 | T14719 | T14715 | prep | at,play |
R12732 | T14720 | T14722 | amod | low,concentrations |
R12733 | T14721 | T14722 | amod | corticosteroid,concentrations |
R12734 | T14722 | T14719 | pobj | concentrations,at |
R12735 | T14723 | T14719 | cc | and/or,at |
R12736 | T14724 | T14719 | conj | at,at |
R12737 | T14725 | T14726 | amod | early,time |
R12738 | T14726 | T14724 | pobj | time,at |
R12739 | T14727 | T14728 | compound | points,prior |
R12740 | T14728 | T14715 | advmod | prior,play |
R14195 | T16509 | T16508 | prep | as,presented |
R14693 | T17131 | T17128 | pobj | 8,at |
R14694 | T17132 | T17133 | compound | M,FP |
R14695 | T17133 | T17123 | dobj | FP,demonstrates |
R14696 | T17134 | T17123 | punct | ),demonstrates |
R14697 | T17135 | T17123 | cc | and,demonstrates |
R14698 | T17136 | T17123 | conj | concentration,demonstrates |
R14699 | T17137 | T17136 | punct | -,concentration |
R14700 | T17138 | T17141 | punct | (,min |
R14701 | T17139 | T17141 | prep | at,min |
R14702 | T17140 | T17141 | nummod | 60,min |
R14703 | T17141 | T17136 | appos | min,concentration |
R14704 | T17142 | T17141 | prep | after,min |
R14705 | T17143 | T17142 | pobj | stimulation,after |
R14706 | T17144 | T17141 | punct | ),min |
R14707 | T17145 | T17146 | amod | dependent,induction |
R14708 | T17146 | T17136 | conj | induction,concentration |
R14709 | T17147 | T17146 | prep | of,induction |
R14710 | T17148 | T17150 | amod | FP-activated,interaction |
R14711 | T17149 | T17150 | compound | GR,interaction |
R14712 | T17150 | T17147 | pobj | interaction,of |
R14713 | T17151 | T17150 | prep | with,interaction |
R14714 | T17152 | T17151 | pobj | importin-α,with |
R14715 | T17153 | T17154 | punct | (,Imp-α |
R14716 | T17154 | T17152 | appos | Imp-α,importin-α |
R14717 | T17155 | T17154 | punct | ),Imp-α |
R14746 | T17184 | T17185 | advmod | at,least |
R14747 | T17185 | T17186 | advmod | least,three |
R14748 | T17186 | T17188 | nummod | three,experiments |
R14749 | T17187 | T17188 | amod | independent,experiments |
R14750 | T17188 | T17183 | pobj | experiments,of |
R14751 | T17189 | T17179 | punct | .,represents |
R14752 | T17190 | T17192 | nmod | ***,< |
R14753 | T17191 | T17192 | nmod | p,< |
R14754 | T17192 | T17193 | nmod | <,0.001 |
R14755 | T17193 | T17194 | nsubj | 0.001,compared |
R14756 | T17194 | T17194 | ROOT | compared,compared |
R14757 | T17195 | T17196 | aux | to,control |
R14758 | T17196 | T17194 | xcomp | control,compared |
R14759 | T17197 | T17200 | punct | ",",< |
R14760 | T17198 | T17200 | dep | ###,< |
R14761 | T17199 | T17200 | dep | p,< |
R14762 | T17200 | T17201 | nmod | <,0.001 |
R14763 | T17201 | T17194 | dobj | 0.001,compared |
R14764 | T17202 | T17194 | punct | .,compared |
R14765 | T17203 | T17209 | punct | (,demonstrated |
R14766 | T17204 | T17208 | nmod | B,analysis |
R14767 | T17205 | T17204 | punct | ),B |
R14768 | T17206 | T17208 | compound | Western,analysis |
R14769 | T17207 | T17208 | compound | blot,analysis |
R14770 | T17208 | T17209 | nsubj | analysis,demonstrated |
R14771 | T17209 | T17209 | ROOT | demonstrated,demonstrated |
R14772 | T17210 | T17232 | det | a,induction |
R14773 | T17211 | T17232 | npadvmod | time,induction |
R14774 | T17212 | T17232 | punct | -,induction |
R14775 | T17213 | T17232 | punct | (,induction |
R14776 | T17214 | T17232 | nmod | at,induction |
R14777 | T17215 | T17219 | nummod | 10,FP |
R14778 | T17216 | T17217 | quantmod | −,8 |
R14779 | T17217 | T17219 | nummod | 8,FP |
R14780 | T17218 | T17219 | compound | M,FP |
R14781 | T17219 | T17214 | pobj | FP,at |
R14782 | T17220 | T17214 | punct | ),at |
R14783 | T17221 | T17214 | cc | and,at |
R14784 | T17222 | T17214 | conj | concentration,at |
R14785 | T17223 | T17222 | punct | -,concentration |
R14786 | T17224 | T17222 | punct | (,concentration |
R14787 | T17225 | T17222 | prep | at,concentration |
R14788 | T17226 | T17227 | nummod | 60,min |
R14789 | T17227 | T17225 | pobj | min,at |
R14790 | T17228 | T17227 | prep | after,min |
R14791 | T17229 | T17228 | pobj | stimulation,after |
R14792 | T17230 | T17222 | punct | ),concentration |
R14793 | T17231 | T17232 | amod | dependent,induction |
R14794 | T17232 | T17209 | dobj | induction,demonstrated |
R14795 | T17233 | T17232 | prep | of,induction |
R14824 | T17262 | T17257 | pobj | experiments,of |
R14825 | T17263 | T17253 | punct | .,represents |
R14826 | T17264 | T17266 | compound | ***,< |
R14827 | T17265 | T17266 | compound | p,< |
R14828 | T17266 | T17268 | nsubj | <,compared |
R14829 | T17267 | T17266 | nummod | 0.001,< |
R14830 | T17268 | T17268 | ROOT | compared,compared |
R14831 | T17269 | T17270 | aux | to,control |
R14832 | T17270 | T17268 | xcomp | control,compared |
R14833 | T17271 | T17268 | punct | .,compared |
R14834 | T17272 | T17273 | punct | (,C |
R14835 | T17273 | T17277 | nmod | C,analysis |
R14836 | T17274 | T17273 | punct | ),C |
R14837 | T17275 | T17277 | amod | Western,analysis |
R14838 | T17276 | T17277 | compound | blot,analysis |
R14839 | T17277 | T17289 | nsubj | analysis,demonstrated |
R14840 | T17278 | T17277 | prep | of,analysis |
R14841 | T17279 | T17280 | amod | HuT-78,cells |
R14842 | T17280 | T17278 | pobj | cells,of |
R14843 | T17281 | T17280 | acl | treated,cells |
R14844 | T17282 | T17281 | prep | with,treated |
R14845 | T17283 | T17282 | pobj | FP,with |
R14846 | T17284 | T17283 | cc | and,FP |
R14847 | T17285 | T17286 | compound | anti-CD3,/ |
R14848 | T17286 | T17283 | conj | /,FP |
R15497 | T18049 | T18048 | pobj | means,as |
R15498 | T18050 | T18051 | compound | ±,SEM |
R15499 | T18051 | T18054 | dep | SEM,p |
R15500 | T18052 | T18051 | punct | ",",SEM |
R15501 | T18053 | T18051 | punct | *,SEM |
R15502 | T18054 | T18036 | dep | p,are |
R15503 | T18055 | T18056 | nmod | <,0.05 |
R15504 | T18056 | T18054 | npadvmod | 0.05,p |
R15505 | T18057 | T18036 | punct | .,are |
R15506 | T18058 | T18062 | punct | (,induces |
R15507 | T18059 | T18061 | nmod | E,FP |
R15508 | T18060 | T18061 | punct | ),FP |
R15509 | T18061 | T18062 | nsubj | FP,induces |
R15510 | T18062 | T18062 | ROOT | induces,induces |
R15511 | T18063 | T18064 | compound | MKP-1,mRNA |
R15512 | T18064 | T18062 | dobj | mRNA,induces |
R15513 | T18065 | T18062 | prep | in,induces |
R15514 | T18066 | T18068 | det | a,manner |
R15515 | T18067 | T18068 | amod | time-dependent,manner |
R15516 | T18068 | T18065 | pobj | manner,in |
R15517 | T18069 | T18062 | punct | .,induces |
R15518 | T18070 | T18071 | nsubj | Results,are |
R15519 | T18071 | T18071 | ROOT | are,are |
R15520 | T18072 | T18071 | attr | representative,are |
R15778 | T18446 | T18444 | pobj | importin-α,with |
R15831 | T18499 | T18497 | punct | .,was |
R15832 | T18500 | T18503 | punct | *,0.05 |
R15833 | T18501 | T18502 | compound | p,< |
R15834 | T18502 | T18503 | compound | <,0.05 |
R15835 | T18503 | T18503 | ROOT | 0.05,0.05 |
R15836 | T18504 | T18508 | punct | ",",0.01 |
R15837 | T18505 | T18508 | amod | **,0.01 |
R15838 | T18506 | T18508 | compound | p,0.01 |
R15839 | T18507 | T18508 | compound | <,0.01 |
R15840 | T18508 | T18503 | appos | 0.01,0.05 |
R15841 | T18509 | T18508 | prep | between,0.01 |
R15842 | T18510 | T18509 | pobj | groups,between |
R15843 | T18511 | T18503 | punct | .,0.05 |
R15844 | T18512 | T18513 | det | All,results |
R15845 | T18513 | T18515 | nsubjpass | results,expressed |
R15846 | T18514 | T18515 | auxpass | are,expressed |
R15847 | T18515 | T18515 | ROOT | expressed,expressed |
R15848 | T18516 | T18515 | prep | as,expressed |
R15849 | T18517 | T18519 | amod | mean,SEM |
R15850 | T18518 | T18519 | compound | ±,SEM |
R15851 | T18519 | T18516 | pobj | SEM,as |
R15852 | T18520 | T18519 | prep | of,SEM |
R15853 | T18521 | T18523 | nummod | three,experiments |
R15854 | T18522 | T18523 | amod | independent,experiments |
R15855 | T18523 | T18520 | pobj | experiments,of |
R16205 | T18975 | T18975 | ROOT | stimulated,stimulated |
R15856 | T18524 | T18523 | cc | and,experiments |
R15857 | T18525 | T18515 | advcl | analysed,expressed |
R15858 | T18526 | T18525 | agent | by,analysed |
R15859 | T18527 | T18526 | pobj | ANOVA,by |
R15860 | T18528 | T18525 | acl | followed,analysed |
R15861 | T18529 | T18528 | agent | by,followed |
R15862 | T18530 | T18529 | pobj | Newman-Keuls,by |
R15863 | T18531 | T18515 | conj | post-test,expressed |
R15864 | T18532 | T18515 | punct | .,expressed |
R16160 | T18930 | T18931 | compound | Fluticasone,propionate |
R16161 | T18931 | T18934 | nsubj | propionate,affect |
R16162 | T18932 | T18934 | aux | does,affect |
R16163 | T18933 | T18934 | neg | not,affect |
R16164 | T18934 | T18934 | ROOT | affect,affect |
R16165 | T18935 | T18937 | amod | GATA-3,export |
R16166 | T18936 | T18937 | amod | nuclear,export |
R16167 | T18937 | T18934 | dobj | export,affect |
R16168 | T18938 | T18934 | punct | .,affect |
R16169 | T18939 | T18940 | punct | (,A |
R16170 | T18940 | T18944 | nmod | A,analysis |
R16171 | T18941 | T18940 | punct | ),A |
R16172 | T18942 | T18944 | amod | Western,analysis |
R16173 | T18943 | T18944 | compound | blot,analysis |
R16174 | T18944 | T18975 | nsubj | analysis,stimulated |
R16229 | T18999 | T19002 | dep | anti-CD3,stimulated |
R16230 | T19000 | T18999 | dobj | /,anti-CD3 |
R16231 | T19001 | T19000 | nummod | CD28,/ |
R16232 | T19002 | T18998 | pcomp | stimulated,to |
R16233 | T19003 | T19002 | dobj | cells,stimulated |
R16234 | T19004 | T19002 | punct | .,stimulated |
R16235 | T19005 | T19010 | punct | (,analysis |
R16236 | T19006 | T19010 | nmod | B,analysis |
R16237 | T19007 | T19010 | punct | ),analysis |
R16238 | T19008 | T19010 | amod | Western,analysis |
R16239 | T19009 | T19010 | compound | blot,analysis |
R16240 | T19010 | T19010 | ROOT | analysis,analysis |
R16241 | T19011 | T19010 | acl | showing,analysis |
R16242 | T19012 | T19022 | mark | that,affect |
R16243 | T19013 | T19022 | nsubj | FP,affect |
R16244 | T19014 | T19016 | punct | (,− |
R16245 | T19015 | T19016 | nummod | 10,− |
R16246 | T19016 | T19022 | nsubj | −,affect |
R16247 | T19017 | T19016 | nummod | 8,− |
R16248 | T19018 | T19016 | appos | M,− |
R16249 | T19019 | T19016 | punct | ),− |
R16250 | T19020 | T19022 | aux | does,affect |
R16251 | T19021 | T19022 | neg | not,affect |
R17101 | T20008 | T20004 | punct | ),FP |
R17102 | T20009 | T20001 | prep | on,effect |
R17103 | T20010 | T20014 | nmod | GR,localisation |
R17104 | T20011 | T20010 | cc | and,GR |
R17105 | T20012 | T20010 | conj | GATA-3,GR |
R17106 | T20013 | T20014 | amod | nuclear,localisation |
R17107 | T20014 | T20009 | pobj | localisation,on |
R17108 | T20015 | T19997 | punct | .,immunocytochemistry |
R17109 | T20016 | T20021 | punct | (,immunoreactivity |
R17110 | T20017 | T20021 | nmod | B,immunoreactivity |
R17111 | T20018 | T20017 | punct | ),B |
R17112 | T20019 | T20020 | compound | Nuclear,GATA-3 |
R17113 | T20020 | T20021 | compound | GATA-3,immunoreactivity |
R17114 | T20021 | T20021 | ROOT | immunoreactivity,immunoreactivity |
R17115 | T20022 | T20021 | prep | in,immunoreactivity |
R17116 | T20023 | T20022 | pobj | PBMCs,in |
R17117 | T20024 | T20021 | prep | from,immunoreactivity |
R17118 | T20025 | T20028 | nummod | seven,patients |
R17119 | T20026 | T20028 | amod | steroid-naïve,patients |
R17120 | T20027 | T20028 | compound | asthma,patients |
R17121 | T20028 | T20024 | pobj | patients,from |
R17157 | T20064 | T20066 | punct | *,< |
R17158 | T20065 | T20066 | compound | p,< |
R17159 | T20066 | T20053 | conj | <,presented |
R17160 | T20067 | T20071 | nummod | 0.05,test |
R17161 | T20068 | T20071 | poss | Wilcoxon,test |
R17162 | T20069 | T20068 | case | 's,Wilcoxon |
R17163 | T20070 | T20071 | compound | rank,test |
R17164 | T20071 | T20066 | appos | test,< |
R17165 | T20072 | T20071 | prep | compared,test |
R17166 | T20073 | T20072 | prep | with,compared |
R17167 | T20074 | T20073 | pobj | placebo,with |
R17168 | T20075 | T20053 | punct | .,presented |
R17169 | T20076 | T20080 | punct | (,analyses |
R17170 | T20077 | T20080 | compound | C,analyses |
R17171 | T20078 | T20079 | punct | ),Immunoblotting |
R17172 | T20079 | T20080 | compound | Immunoblotting,analyses |
R17173 | T20080 | T20083 | nsubj | analyses,demonstrated |
R17174 | T20081 | T20080 | prep | of,analyses |
R17175 | T20082 | T20081 | pobj | PBMCs,of |
R17176 | T20083 | T20083 | ROOT | demonstrated,demonstrated |
R17177 | T20084 | T20086 | det | a,decrease |
R17178 | T20085 | T20086 | amod | time-dependent,decrease |
R17179 | T20086 | T20083 | dobj | decrease,demonstrated |
R17180 | T20087 | T20086 | prep | in,decrease |
R17181 | T20088 | T20089 | amod | nuclear,expression |
R17182 | T20089 | T20087 | pobj | expression,in |
R17183 | T20090 | T20089 | prep | of,expression |
R17184 | T20091 | T20090 | pobj | GATA-3,of |
R17185 | T20092 | T20083 | punct | ",",demonstrated |
R17186 | T20093 | T20083 | cc | and,demonstrated |
R17187 | T20094 | T20097 | amod | increased,expression |
R17188 | T20095 | T20097 | amod | cytoplasmic,expression |
R17189 | T20096 | T20097 | amod | GATA-3,expression |
R17190 | T20097 | T20083 | conj | expression,demonstrated |
R17191 | T20098 | T20097 | prep | after,expression |
R17192 | T20099 | T20098 | pobj | inhalation,after |
R17193 | T20100 | T20099 | prep | of,inhalation |
R17194 | T20101 | T20100 | pobj | FP,of |
R17195 | T20102 | T20083 | punct | .,demonstrated |
R17196 | T20103 | T20110 | punct | (,demonstrated |
R17197 | T20104 | T20107 | compound | D,analyses |
R17198 | T20105 | T20106 | punct | ),Immunoblotting |
R17199 | T20106 | T20107 | compound | Immunoblotting,analyses |
R17237 | T20144 | T20147 | amod | nuclear,fractions |
R17238 | T20145 | T20144 | cc | and,nuclear |
R17239 | T20146 | T20144 | conj | cytoplasmic,nuclear |
R17240 | T20147 | T20142 | pobj | fractions,for |
R17241 | T20148 | T20137 | advmod | respectively,confirmed |
R17242 | T20149 | T20137 | punct | .,confirmed |
R17243 | T20150 | T20164 | nsubjpass | Quantification,shown |
R17244 | T20151 | T20150 | prep | of,Quantification |
R17245 | T20152 | T20154 | det | the,data |
R17246 | T20153 | T20154 | compound | densitometry,data |
R17247 | T20154 | T20151 | pobj | data,of |
R17248 | T20155 | T20154 | prep | in,data |
R17249 | T20156 | T20157 | punct | (,C |
R17250 | T20157 | T20155 | pobj | C,in |
R17251 | T20158 | T20150 | punct | ),Quantification |
R17252 | T20159 | T20150 | cc | and,Quantification |
R17253 | T20160 | T20161 | punct | (,D |
R17254 | T20161 | T20150 | conj | D,Quantification |
R17255 | T20162 | T20161 | punct | ),D |
R17256 | T20163 | T20164 | auxpass | is,shown |
R17257 | T20164 | T20164 | ROOT | shown,shown |
R17258 | T20165 | T20164 | prep | as,shown |
R17259 | T20166 | T20168 | det | a,plot |
R17260 | T20167 | T20168 | compound | box-and-whiskers,plot |
R17261 | T20168 | T20165 | pobj | plot,as |
R17262 | T20169 | T20168 | prep | of,plot |
R17263 | T20170 | T20169 | pobj | results,of |
R17264 | T20171 | T20170 | prep | from,results |
R17265 | T20172 | T20175 | amod | n,participants |
R17266 | T20173 | T20174 | punct | =,6 |
R17267 | T20174 | T20175 | nummod | 6,participants |
R17268 | T20175 | T20171 | pobj | participants,from |
R17269 | T20176 | T20179 | prep | for,were |
R17270 | T20177 | T20176 | pobj | which,for |
R17271 | T20178 | T20179 | nsubj | data,were |
R17272 | T20179 | T20175 | relcl | were,participants |
R17273 | T20180 | T20179 | acomp | available,were |
R17274 | T20181 | T20164 | punct | .,shown |
R17275 | T20182 | T20186 | advmod | *,compared |
R17276 | T20183 | T20184 | compound | p,< |
R17277 | T20184 | T20185 | compound | <,0.05 |
R17278 | T20185 | T20186 | advmod | 0.05,compared |
R17315 | T20222 | T20223 | det | The,results |
R17316 | T20223 | T20229 | nsubj | results,are |
R17317 | T20224 | T20223 | acl | shown,results |
R17318 | T20225 | T20224 | prep | in,shown |
R17319 | T20226 | T20227 | punct | (,E |
R17320 | T20227 | T20225 | pobj | E,in |
UBERON-AE
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T87 | 987-992 | http://purl.obolibrary.org/obo/UBERON_0000178 | denotes | blood |
T88 | 1752-1757 | http://purl.obolibrary.org/obo/UBERON_0000178 | denotes | blood |
T1179 | 12078-12083 | http://purl.obolibrary.org/obo/UBERON_0000178 | denotes | blood |
T1180 | 12267-12272 | http://purl.obolibrary.org/obo/UBERON_0000178 | denotes | blood |
T6271 | 19564-19569 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
T7168 | 20915-20920 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
T11222 | 36900-36905 | http://purl.obolibrary.org/obo/UBERON_0000178 | denotes | blood |
T11223 | 37102-37107 | http://purl.obolibrary.org/obo/UBERON_0000178 | denotes | blood |
T13159 | 44390-44395 | http://purl.obolibrary.org/obo/UBERON_0000178 | denotes | blood |
GO-BP
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T757 | 720-732 | http://purl.obolibrary.org/obo/GO_0006954 | denotes | inflammation |
T758 | 857-867 | http://purl.obolibrary.org/obo/GO_0065007 | denotes | regulation |
T759 | 1288-1323 | http://purl.obolibrary.org/obo/GO_0002147 | denotes | glucocorticoid receptor for nuclear |
T760 | 1316-1333 | http://purl.obolibrary.org/obo/GO_0051169 | denotes | nuclear transport |
T761 | 1324-1333 | http://purl.obolibrary.org/obo/GO_0006810 | denotes | transport |
T762 | 1434-1458 | http://purl.obolibrary.org/obo/GO_0034199 | denotes | activated protein kinase |
T763 | 1434-1458 | http://purl.obolibrary.org/obo/GO_0032147 | denotes | activated protein kinase |
T764 | 1434-1458 | http://purl.obolibrary.org/obo/GO_0030295 | denotes | activated protein kinase |
T765 | 1434-1458 | http://purl.obolibrary.org/obo/GO_0032111 | denotes | activated protein kinase |
T766 | 1460-1464 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T767 | 1517-1520 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T768 | 1466-1477 | http://purl.obolibrary.org/obo/GO_0016791 | denotes | phosphatase |
T3229 | 7614-7627 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
T3230 | 10008-10021 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
T3231 | 11883-11896 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
T3232 | 7720-7740 | http://purl.obolibrary.org/obo/GO_0030154 | denotes | cell differentiation |
T3233 | 7814-7835 | http://purl.obolibrary.org/obo/GO_0006338 | denotes | chromatin remodelling |
T3234 | 8482-8497 | http://purl.obolibrary.org/obo/GO_0010467 | denotes | gene expression |
T3235 | 8836-8850 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T3236 | 8906-8920 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T3237 | 11048-11062 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T3238 | 8851-8857 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signal |
T3239 | 10290-10297 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signals |
T3240 | 8870-8881 | http://purl.obolibrary.org/obo/GO_0006810 | denotes | transported |
T3241 | 9393-9402 | http://purl.obolibrary.org/obo/GO_0006810 | denotes | transport |
T3242 | 8870-8898 | http://purl.obolibrary.org/obo/GO_0051169 | denotes | transported into the nucleus |
T3243 | 9393-9419 | http://purl.obolibrary.org/obo/GO_0051169 | denotes | transport into the nucleus |
T3244 | 8891-8928 | http://purl.obolibrary.org/obo/GO_0006606 | denotes | nucleus by the nuclear import protein |
T3245 | 8914-8928 | http://purl.obolibrary.org/obo/GO_0017038 | denotes | import protein |
T3246 | 9029-9041 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localisation |
T3247 | 9111-9123 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localisation |
T3248 | 10163-10175 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localisation |
T3249 | 10228-10240 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localisation |
T3250 | 12240-12252 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
T3251 | 9198-9213 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T3252 | 11981-11996 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T3253 | 9243-9246 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T3254 | 9281-9285 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T3255 | 9255-9279 | http://purl.obolibrary.org/obo/GO_0034199 | denotes | activated protein kinase |
T3256 | 9255-9279 | http://purl.obolibrary.org/obo/GO_0032147 | denotes | activated protein kinase |
T3257 | 9255-9279 | http://purl.obolibrary.org/obo/GO_0030295 | denotes | activated protein kinase |
T3258 | 9255-9279 | http://purl.obolibrary.org/obo/GO_0032111 | denotes | activated protein kinase |
T3259 | 9758-9781 | http://purl.obolibrary.org/obo/GO_0051384 | denotes | glucocorticoid response |
T3260 | 10180-10189 | http://purl.obolibrary.org/obo/GO_0051235 | denotes | retention |
T3261 | 10280-10289 | http://purl.obolibrary.org/obo/GO_0051235 | denotes | retention |
T3262 | 10322-10336 | http://purl.obolibrary.org/obo/GO_0051168 | denotes | nuclear export |
T3263 | 11016-11026 | http://purl.obolibrary.org/obo/GO_0065007 | denotes | regulation |
T3264 | 11818-11828 | http://purl.obolibrary.org/obo/GO_0065007 | denotes | regulation |
T3265 | 11108-11121 | http://purl.obolibrary.org/obo/GO_0003755 | denotes | immunophilins |
T3266 | 11181-11187 | http://purl.obolibrary.org/obo/GO_0003777 | denotes | dynein |
T3267 | 11525-11528 | http://purl.obolibrary.org/obo/GO_0004096 | denotes | CAT |
T3268 | 12096-12111 | http://purl.obolibrary.org/obo/GO_0001775 | denotes | cells activated |
T4298 | 13496-13499 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T4299 | 13826-13838 | http://purl.obolibrary.org/obo/GO_0009293 | denotes | Transduction |
T4599 | 14488-14500 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
T4829 | 14566-14587 | http://purl.obolibrary.org/obo/GO_0001171 | denotes | Reverse Transcription |
T4830 | 14574-14587 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | Transcription |
T4831 | 14622-14627 | http://purl.obolibrary.org/obo/GO_0019835 | denotes | lysis |
T4832 | 14854-14856 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T4833 | 14914-14916 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T5179 | 15314-15319 | http://purl.obolibrary.org/obo/GO_0019835 | denotes | lysis |
T5180 | 15541-15549 | http://purl.obolibrary.org/obo/GO_0007349 | denotes | cellular |
T6713 | 19324-19330 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signal |
T7113 | 19992-20001 | http://purl.obolibrary.org/obo/GO_0007586 | denotes | digestion |
T7114 | 20641-20650 | http://purl.obolibrary.org/obo/GO_0007586 | denotes | digestion |
T7596 | 21257-21263 | http://purl.obolibrary.org/obo/GO_0040007 | denotes | growth |
T8657 | 23314-23329 | http://purl.obolibrary.org/obo/GO_0010467 | denotes | gene expression |
T8658 | 23439-23453 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T8659 | 23851-23860 | http://purl.obolibrary.org/obo/GO_0051235 | denotes | retention |
T9278 | 26000-26014 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T9279 | 26568-26582 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T10687 | 28290-28293 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T10688 | 28294-28298 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T10689 | 28405-28409 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T10690 | 28571-28575 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T10691 | 28386-28397 | http://purl.obolibrary.org/obo/GO_0016791 | denotes | phosphatase |
T10692 | 28410-28421 | http://purl.obolibrary.org/obo/GO_0016791 | denotes | phosphatase |
T10693 | 28501-28516 | http://purl.obolibrary.org/obo/GO_0001775 | denotes | cells activated |
T10694 | 28576-28591 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T10695 | 28629-28644 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T10696 | 28819-28834 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T10697 | 28961-28976 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T10698 | 29225-29239 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T10699 | 31393-31407 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T10700 | 33089-33103 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T10701 | 30947-30953 | http://purl.obolibrary.org/obo/GO_0085030 | denotes | mutual |
T10702 | 32583-32597 | http://purl.obolibrary.org/obo/GO_0051168 | denotes | nuclear export |
T10703 | 32647-32661 | http://purl.obolibrary.org/obo/GO_0051168 | denotes | nuclear export |
T10704 | 33037-33051 | http://purl.obolibrary.org/obo/GO_0051168 | denotes | nuclear export |
T10705 | 32605-32616 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
T10706 | 32720-32732 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
T12574 | 35776-35791 | http://purl.obolibrary.org/obo/GO_0010467 | denotes | gene expression |
T12575 | 39891-39906 | http://purl.obolibrary.org/obo/GO_0010467 | denotes | gene expression |
T12576 | 36854-36862 | http://purl.obolibrary.org/obo/GO_0007349 | denotes | cellular |
T12577 | 36863-36875 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
T12578 | 39483-39495 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
T12579 | 37831-37834 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T12580 | 37835-37839 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T12581 | 39693-39697 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T12582 | 37840-37855 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T12583 | 39714-39729 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T12584 | 39854-39868 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T15238 | 40051-40064 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
T15239 | 41018-41031 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
T15240 | 41484-41497 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
T15241 | 43698-43711 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
T15242 | 40215-40229 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T15243 | 40615-40629 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T15244 | 41114-41128 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T15245 | 41253-41267 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T15246 | 42406-42420 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T15247 | 42864-42878 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T15248 | 43317-43331 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T15249 | 44671-44685 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T15250 | 40272-40289 | http://purl.obolibrary.org/obo/GO_0051169 | denotes | nuclear transport |
T15251 | 40280-40289 | http://purl.obolibrary.org/obo/GO_0006810 | denotes | transport |
T15252 | 40420-40423 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15253 | 40500-40503 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15254 | 42567-42570 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15255 | 42894-42897 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15256 | 43065-43068 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15257 | 43221-43224 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15258 | 40424-40428 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15259 | 40504-40508 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15260 | 42571-42575 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15261 | 42650-42654 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15262 | 42898-42902 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15263 | 43069-43073 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15264 | 43225-43229 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15265 | 44790-44794 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15266 | 40486-40508 | http://purl.obolibrary.org/obo/GO_1900745 | denotes | activation of p38 MAPK |
T15267 | 40524-40539 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T15268 | 42934-42949 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T15269 | 44816-44831 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T15270 | 41323-41344 | http://purl.obolibrary.org/obo/GO_0005049 | denotes | binding of importin-α |
T15271 | 41843-41857 | http://purl.obolibrary.org/obo/GO_0051168 | denotes | nuclear export |
T15272 | 41885-41896 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
T15273 | 42306-42323 | http://purl.obolibrary.org/obo/GO_0006412 | denotes | protein synthesis |
T15274 | 42314-42323 | http://purl.obolibrary.org/obo/GO_0009058 | denotes | synthesis |
T15275 | 44751-44760 | http://purl.obolibrary.org/obo/GO_0009058 | denotes | synthesis |
T15276 | 43426-43438 | http://purl.obolibrary.org/obo/GO_0006954 | denotes | inflammation |
T15277 | 44554-44566 | http://purl.obolibrary.org/obo/GO_0006954 | denotes | inflammation |
T15278 | 45022-45034 | http://purl.obolibrary.org/obo/GO_0006954 | denotes | inflammation |
T15279 | 44679-44693 | http://purl.obolibrary.org/obo/GO_0017038 | denotes | import protein |
T15280 | 45328-45339 | http://purl.obolibrary.org/obo/GO_0032502 | denotes | development |
T16601 | 24370-24385 | http://purl.obolibrary.org/obo/GO_0010467 | denotes | gene expression |
T16602 | 24406-24420 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T16603 | 24766-24778 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
T16604 | 24985-24989 | http://purl.obolibrary.org/obo/GO_0004708 | denotes | MEK1 |
T16605 | 25212-25214 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T17414 | 26812-26826 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear import |
T17415 | 28038-28057 | http://purl.obolibrary.org/obo/GO_0002672 | denotes | cells stimulated (b |
T17416 | 28038-28057 | http://purl.obolibrary.org/obo/GO_0045579 | denotes | cells stimulated (b |
T17417 | 28038-28057 | http://purl.obolibrary.org/obo/GO_0002869 | denotes | cells stimulated (b |
T17418 | 28038-28057 | http://purl.obolibrary.org/obo/GO_0002904 | denotes | cells stimulated (b |
T17419 | 28038-28057 | http://purl.obolibrary.org/obo/GO_0050871 | denotes | cells stimulated (b |
T17420 | 28038-28057 | http://purl.obolibrary.org/obo/GO_0031296 | denotes | cells stimulated (b |
T17421 | 28038-28057 | http://purl.obolibrary.org/obo/GO_0030890 | denotes | cells stimulated (b |
T18100 | 29449-29452 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T18101 | 29705-29708 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T18102 | 29881-29884 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T18103 | 29709-29713 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T18104 | 29885-29889 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T18105 | 29933-29937 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T18106 | 29464-29479 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T18107 | 29556-29571 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T18108 | 29653-29668 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T18109 | 29807-29822 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T18110 | 30026-30041 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T18111 | 29464-29494 | http://purl.obolibrary.org/obo/GO_0042327 | denotes | phosphorylation and activation |
T18112 | 29807-29835 | http://purl.obolibrary.org/obo/GO_0042327 | denotes | phosphorylation of activated |
T18113 | 29528-29538 | http://purl.obolibrary.org/obo/GO_0065007 | denotes | regulation |
T18114 | 29826-29856 | http://purl.obolibrary.org/obo/GO_0051091 | denotes | activated transcription factor |
T18115 | 29826-29856 | http://purl.obolibrary.org/obo/GO_0032793 | denotes | activated transcription factor |
T18116 | 29826-29856 | http://purl.obolibrary.org/obo/GO_1901485 | denotes | activated transcription factor |
T18117 | 29836-29849 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
T18118 | 29915-29937 | http://purl.obolibrary.org/obo/GO_1903753 | denotes | inhibition of p38 MAPK |
T18536 | 31655-31673 | http://purl.obolibrary.org/obo/GO_0005049 | denotes | importin-α binding |
T19149 | 33308-33322 | http://purl.obolibrary.org/obo/GO_0051168 | denotes | nuclear export |
T19150 | 33367-33381 | http://purl.obolibrary.org/obo/GO_0051168 | denotes | nuclear export |
T19151 | 33506-33518 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
T19152 | 25526-33640 | http://purl.obolibrary.org/obo/GO_0031296 | denotes | stimulated. (E) FP (10 nM) reduces the ability of anti-CD3/CD28-stimulated GATA-3 to associate with the native IL-5 promoter 60 min after stimulation. Data are also shown graphically as mean±SEM of three independent experiments. All data were analysed by ANOVA followed by Newman-Keuls post-test. Ligand-Activated GR Competes with GATA-3 for Importin-α We confirmed and extended previous data [20] to show that ligand-activated GR as well as GATA-3 uses importin-α for its nuclear import (Figure 2A and 2B). This interaction between GR and importin-α was significant at concentrations as low as 10−12 M and was maximal with 10−8 M FP. Subsequent GR nuclear translocation was rapid and sustained at significant levels for at least 14 h (Figure 2B). Using IP-Western blotting we showed that FP at 10−12–10−8 M decreased the association between GATA-3 and importin-α induced by anti-CD3/CD28 stimulation in a concentration-dependent manner (Figure 2C). In addition, using GFP-labelled GATA-3 and confocal microscopy we demonstrated that GATA-3 nuclear import following anti-CD3/CD28 stimulation for 30 min was attenuated by pretreatment with FP (10−8 M) (Figure 2D). 10.1371/journal.pmed.1000076.g002 Figure 2 Fluticasone propionate reduces GATA-3 association with importin-α and GATA-3 nuclear import. (A) Western blot analysis demonstrates a time- (at 10−8 M FP) and concentration- (at 60 min after stimulation) dependent induction of FP-activated GR interaction with importin-α (Imp-α). A positive control for GR association with importin is shown. Quantification of the densitometry data is shown below. Each bar represents mean±SEM of at least three independent experiments. *** p<0.001 compared to control, ### p<0.001. (B) Western blot analysis demonstrated a time- (at 10−8 M FP) and concentration- (at 60 min after stimulation) dependent induction of FP-activated GR nuclear translocation measured by IP. Quantification of the densitometry data is shown below. Each bar represents mean±SEM of at least three independent experiments. ***p<0.001 compared to control. (C) Western blot analysis of HuT-78 cells treated with FP and anti-CD3/CD28 co-stimulation demonstrated a concentration-dependent decrease in GATA-3–importin-α association at 20 min. Quantification of the densitometry data is shown below. Each bar represents mean±SEM of at least three independent experiments. ### p<0.001 compared to control, ***p<0.001 compared to αCD3/CD28-stimulated cells. (D) GFP-tagged GATA-3 was overexpressed and cells stimulated (b, c) or not (a) for 30 min with anti-CD3/CD28. The effect of 30 min pretreatment of cells with FP (10−8 M, c) is also shown. All data were analysed by ANOVA followed by Newman-Keuls post-test. Effect on MKP-1 Dexamethasone inhibits p38 MAPK function in a cell type–specific manner through the rapid induction of the dual kinase phosphatase MKP-1 (MAPK phosphatase-1), and this effect lasts for up to 24 h [28]. FP (10−8 M) treatment of HuT-78 cells activated by anti-CD3/CD28 in vitro significantly decreased p38 MAPK phosphorylation (Figure 3A) and activity measured by phosphorylation of the downstream target ATF-2 (Figure 3B). This effect was detected at 30 min and lasted for at least 14 h (Figure 3B). FP (10−8 M) also significantly reduced GATA-3 serine phosphorylation induced by anti-CD3/CD28 stimulation in both a time- and concentration-dependent manner (Figure 3C). This reduction in GATA-3 phosphorylation was also seen with lower concentrations of FP. We found that FP significantly induced MKP-1 mRNA in both a time- and concentration-dependent manner, reaching a plateau at 10−8 M after 10 min (Figure 3D and 3E). However, the effects of FP on GATA-3 nuclear import, importin-α association and IL-4 mRNA expression are seen at 10,000-fold lower concentrations (10−12 M, see Figure 2). 10.1371/journal.pmed.1000076.g003 Figure 3 Fluticasone propionate–mediated inhibition of p38 MAP kinase phosphorylation and activation is associated with a marked down-regulation of GATA-3 serine phosphorylation. (A) Western blot analysis shows that FP (10−8 M, 30 min) treatment reduced dual phosphorylation (threonine-180 and tyrosine-182) of p38 MAPK in anti-CD3/CD28–co-stimulated HuT-78 cells. (B) Time course of the effect of FP (10−8 M) on phosphorylation of activated transcription factor 2 (ATF-2), a measure of p38 MAPK activity. (C) FP-induced inhibition of p38 MAPK activity is associated with the decrease of anti-CD3/CD28 co-stimulation–induced serine phosphorylation (P-Ser) of GATA-3. For (A–C), quantification of the densitometry data is also shown. Each bar represents mean±SEM of at least three independent experiments. ### p<0.001 compared to control, ***p<0.001 compared to αCD3/CD28-stimulated cells. (D) FP induced MKP-1 mRNA in a concentration-dependent manner. All results are representative of at least three independent experiments and where appropriate expressed as means±SEM, *p<0.05. (E) FP induces MKP-1 mRNA in a time-dependent manner. Results are representative of two independent experiments. All data except (E) were analysed by ANOVA followed by Newman-Keuls post-test. Using an in vitro competition assay (Figure 4A) utilizing purified activated GATA-3, importin-α, and activated GR, we demonstrated that activated GR significantly increased GR-importin-α association in the presence and absence of activated GATA-3 (Figure 4B). This effect is not mutual, since activated GATA-3 did not block GR–importin-α association (Figure 4C). These data also suggest that both activated GR and phospho-GATA-3 can directly associate with importin-α (Figure 4D) and that activated GR attenuates the phospho-GATA-3/importin-α interaction in a concentration-dependent manner (Figure 4E). Together, this suggests that ligand-activated GR may compete with phospho-GATA-3 for importin-α and thereby limit GATA-3 nuclear import. 10.1371/journal.pmed.1000076.g004 Figure 4 Fluticasone propionate competes with phospho-GATA-3 for importin-α. (A) schematic representation of the in vitro binding competition assay. (B) GR isolated from FP (10−8 M) stimulated cells enhances GR–importin-α binding in the presence (•) and absence (▪) of activated GATA-3. * p<0.05 compared to no activated GR. (C) GATA-3 isolated from anti-CD3/CD28–stimulated cells does not attenuate GR–importin-α association. *p<0.05 compared to control. (D) Activated GR blocks the ability of purified phospho-GATA-3 isolated from anti-CD3/CD28–stimulated cells interacting with immobilised importin-α in an in vitro binding assay. *p<0.05 compared to GATA-3 isolated from unstimulated cells. # p<0.05 compared to stimulated GATA-3-importin binding. (E) The effect of activated (•) versus unstimulated (○) GR on attenuation of GATA-3–importin-α association was concentration-dependent. *p<0.05, **p<0.01 between groups. All results are expressed as mean±SEM of three independent experiments and analysed by ANOVA followed by Newman-Keuls post-test. Other possible interpretations of our results could include an effect of FP on GATA-3 nuclear export and/or degradation. Leptomycin B, which inhibits nuclear export, did not affect the ability of FP to block GATA-3 nuclear localization (Figure 5A). Additionally, FP had no effect on whole cell GATA-3 expression during the time course of these experiments (Figure 5B). Nor did addition of FP subsequent to anti-CD3/CD28 nuclear translocation affect GATA-3 nuclear residency (Figure 5C), suggesting that activated GR does not enhance GATA-3 nuclear export. Finally, the effect of FP on GATA-3 nuclear import was not nonspecific, since FP (10−8 M) had no effect on p65 nuclear translocation measured at 60 min (Figure 5D). 10.1371/journal.pmed.1000076.g005 Figure 5 Fluticasone propionate does not affect GATA-3 nuclear export. (A) Western blot analysis showing that the nuclear export inhibitor leptomycin B (2 nM) does not affect the ability of FP (10−8 M) to prevent anti-CD3/CD28–stimulated GATA-3 nuclear localization measured at 60 min. ***p<0.001 compared to unstimulated cells, ### p<0.001 compared to anti-CD3/CD28–stimulated cells. (B |
T19153 | 33789-33808 | http://purl.obolibrary.org/obo/GO_0031296 | denotes | cells stimulated (b |
T19154 | 33723-33734 | http://purl.obolibrary.org/obo/GO_0009056 | denotes | degradation |
T19155 | 33789-33808 | http://purl.obolibrary.org/obo/GO_0002672 | denotes | cells stimulated (b |
T19156 | 33789-33808 | http://purl.obolibrary.org/obo/GO_0045579 | denotes | cells stimulated (b |
T19157 | 33789-33808 | http://purl.obolibrary.org/obo/GO_0002869 | denotes | cells stimulated (b |
T19158 | 33789-33808 | http://purl.obolibrary.org/obo/GO_0002904 | denotes | cells stimulated (b |
T19159 | 33789-33808 | http://purl.obolibrary.org/obo/GO_0050871 | denotes | cells stimulated (b |
T19160 | 33789-33808 | http://purl.obolibrary.org/obo/GO_0030890 | denotes | cells stimulated (b |
T19579 | 34874-34886 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
T20243 | 38030-38042 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localization |
T20244 | 38162-38174 | http://purl.obolibrary.org/obo/GO_0051179 | denotes | localisation |
T20245 | 39244-39259 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | phosphorylation |
T20246 | 39296-39299 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T20247 | 39300-39304 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T754 | 22-36 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | Nuclear Import |
T755 | 1346-1362 | http://purl.obolibrary.org/obo/GO_0051170 | denotes | nuclear importer |
T756 | 41-56 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | Phosphorylation |
T3225 | 7246-7258 | http://purl.obolibrary.org/obo/GO_0006954 | denotes | Inflammation |
T3226 | 7549-7561 | http://purl.obolibrary.org/obo/GO_0006954 | denotes | inflammation |
T3227 | 7887-7899 | http://purl.obolibrary.org/obo/GO_0006954 | denotes | inflammation |
T3228 | 9492-9504 | http://purl.obolibrary.org/obo/GO_0006954 | denotes | inflammation |
GO-MF
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T770 | 554-559 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL)-4 |
T771 | 561-565 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T772 | 571-576 | http://purl.obolibrary.org/obo/GO_0005144 | denotes | IL-13 |
T773 | 1271-1277 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | ligand |
T774 | 1434-1458 | http://purl.obolibrary.org/obo/GO_0030295 | denotes | activated protein kinase |
T775 | 1460-1464 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T776 | 1517-1520 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T777 | 1466-1477 | http://purl.obolibrary.org/obo/GO_0016791 | denotes | phosphatase |
T3290 | 10877-10898 | http://purl.obolibrary.org/obo/GO_0050693 | denotes | ligand-binding domain |
T3291 | 11108-11121 | http://purl.obolibrary.org/obo/GO_0003755 | denotes | immunophilins |
T3292 | 11136-11149 | http://purl.obolibrary.org/obo/GO_0005528 | denotes | FK506-binding |
T3293 | 11142-11158 | http://purl.obolibrary.org/obo/GO_0005515 | denotes | binding proteins |
T3294 | 11181-11187 | http://purl.obolibrary.org/obo/GO_0003777 | denotes | dynein |
T3295 | 11525-11528 | http://purl.obolibrary.org/obo/GO_0004096 | denotes | CAT |
T3296 | 12138-12148 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T4300 | 13181-13191 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T4301 | 13304-13314 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T4302 | 13469-13479 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T4303 | 13701-13711 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T4304 | 13798-13806 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T4305 | 13496-13499 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T4834 | 14854-14856 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T4835 | 14914-14916 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T4836 | 14968-14972 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T5181 | 15616-15624 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T5452 | 16245-16259 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | immunoglobulin |
T5453 | 16391-16395 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T6017 | 17283-17291 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T6018 | 17594-17604 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T6019 | 17728-17738 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T6249 | 18050-18063 | http://purl.obolibrary.org/obo/GO_0051059 | denotes | NF-κB binding |
T6250 | 18056-18063 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T6251 | 18363-18370 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T6252 | 18344-18352 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T6253 | 18416-18424 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T6714 | 18934-18942 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T6715 | 19111-19119 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T6716 | 19545-19555 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T6717 | 19570-19584 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | immunoglobulin |
T8660 | 23238-23242 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T8661 | 23309-23313 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T8662 | 24163-24167 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T8663 | 24172-24176 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T8664 | 24248-24252 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T8665 | 24226-24233 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T9280 | 25824-25830 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | Ligand |
T9281 | 25938-25944 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | ligand |
T10707 | 28290-28293 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T10708 | 28294-28298 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T10709 | 28405-28409 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T10710 | 28571-28575 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T10711 | 28386-28397 | http://purl.obolibrary.org/obo/GO_0016791 | denotes | phosphatase |
T10712 | 28410-28421 | http://purl.obolibrary.org/obo/GO_0016791 | denotes | phosphatase |
T10713 | 29268-29272 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T10714 | 31301-31307 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | ligand |
T12589 | 35764-35768 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T12590 | 37831-37834 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T12591 | 37835-37839 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T12592 | 39693-39697 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15296 | 40504-40508 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15297 | 42571-42575 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15298 | 42650-42654 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15299 | 42898-42902 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15300 | 43069-43073 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15301 | 43225-43229 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15302 | 44790-44794 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15303 | 40939-40943 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T15304 | 43522-43526 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T15305 | 43693-43697 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T15306 | 44352-44356 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T15307 | 40944-40948 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T15308 | 44361-44365 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T15309 | 41210-41216 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | ligand |
T15310 | 41323-41330 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T15311 | 44649-44656 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T15312 | 41323-41344 | http://purl.obolibrary.org/obo/GO_0005049 | denotes | binding of importin-α |
T16606 | 24985-24989 | http://purl.obolibrary.org/obo/GO_0004708 | denotes | MEK1 |
T16607 | 25212-25214 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T16608 | 25244-25248 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
T16609 | 25253-25257 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T16610 | 25637-25641 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T18119 | 29449-29452 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T18120 | 29705-29708 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T18121 | 29881-29884 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T18122 | 29709-29713 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T18123 | 29885-29889 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T18124 | 29933-29937 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T18125 | 29826-29856 | http://purl.obolibrary.org/obo/GO_0033613 | denotes | activated transcription factor |
T18537 | 31566-31573 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T18538 | 31666-31673 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T18539 | 32063-32070 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T18540 | 32187-32194 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T18541 | 31655-31673 | http://purl.obolibrary.org/obo/GO_0005049 | denotes | importin-α binding |
T20250 | 39296-39299 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T20251 | 39300-39304 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T15289 | 40420-40423 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15290 | 40500-40503 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15291 | 42567-42570 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15292 | 42894-42897 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15293 | 43065-43068 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15294 | 43221-43224 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T15295 | 40424-40428 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T3269 | 7385-7390 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL)-4 |
T3270 | 7787-7792 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | 4, IL |
T3271 | 11369-11374 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | 4, IL |
T3272 | 7392-7396 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T3273 | 7511-7515 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T3274 | 7790-7794 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T3275 | 11372-11376 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T3276 | 11617-11621 | http://purl.obolibrary.org/obo/GO_0005137 | denotes | IL-5 |
T3277 | 7402-7407 | http://purl.obolibrary.org/obo/GO_0005144 | denotes | IL-13 |
T3278 | 7446-7451 | http://purl.obolibrary.org/obo/GO_0005144 | denotes | IL-13 |
T3279 | 7800-7805 | http://purl.obolibrary.org/obo/GO_0005144 | denotes | IL-13 |
T3280 | 11382-11387 | http://purl.obolibrary.org/obo/GO_0005144 | denotes | IL-13 |
T3281 | 9243-9246 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | p38 |
T3282 | 9281-9285 | http://purl.obolibrary.org/obo/GO_0004707 | denotes | MAPK |
T3283 | 9255-9279 | http://purl.obolibrary.org/obo/GO_0030295 | denotes | activated protein kinase |
T3284 | 9652-9659 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T3285 | 10884-10891 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T3286 | 10735-10742 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | ligands |
T3287 | 10877-10883 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | ligand |
T3288 | 9652-9687 | http://purl.obolibrary.org/obo/GO_0035259 | denotes | binding to glucocorticoid receptors |
T3289 | 10220-10250 | http://purl.obolibrary.org/obo/GO_0008139 | denotes | nuclear localisation sequences |
GO-CC
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T778 | 599-604 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T779 | 1005-1010 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3311 | 9084-9089 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3312 | 11483-11488 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T4306 | 13181-13191 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T4307 | 13304-13314 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T4308 | 13469-13479 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T4309 | 13701-13711 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T4310 | 13798-13806 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T4311 | 13181-13191 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T4312 | 13304-13314 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T4313 | 13469-13479 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T4314 | 13701-13711 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T4315 | 13798-13806 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T4316 | 13534-13538 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T5182 | 15127-15131 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T5183 | 15278-15282 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
T5184 | 15616-15624 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T5185 | 15616-15624 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T5454 | 16054-16063 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | Chromatin |
T5455 | 16084-16093 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | Chromatin |
T5456 | 16174-16179 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6020 | 16837-16842 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6021 | 16984-16989 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6022 | 16993-16998 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6023 | 17103-17108 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6024 | 17373-17378 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6025 | 17482-17487 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6026 | 17283-17291 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T6027 | 17594-17604 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T6028 | 17728-17738 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T6029 | 17283-17291 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T6030 | 17594-17604 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T6031 | 17728-17738 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T6254 | 18344-18352 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T6255 | 18416-18424 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T6256 | 18344-18352 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T6257 | 18416-18424 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T6718 | 18934-18942 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T6719 | 19111-19119 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T6720 | 19545-19555 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T6721 | 19606-19616 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T6722 | 18934-18942 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T6723 | 19111-19119 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T6724 | 19545-19555 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T6725 | 19606-19616 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T6726 | 19027-19032 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6727 | 19696-19701 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T6728 | 19251-19260 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | chromatin |
T7341 | 20743-20748 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T7342 | 20859-20864 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T7343 | 21083-21088 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T7344 | 21140-21144 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
T7597 | 21202-21207 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T7598 | 21610-21612 | http://purl.obolibrary.org/obo/GO_0005783 | denotes | ER |
T8666 | 23480-23485 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T12593 | 35709-35713 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
T12594 | 36908-36913 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T12595 | 37110-37115 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T12596 | 37869-37874 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T16614 | 24510-24519 | http://purl.obolibrary.org/obo/GO_0005737 | denotes | cytoplasm |
T16615 | 24527-24534 | http://purl.obolibrary.org/obo/GO_0005634 | denotes | nucleus |
T18542 | 31637-31642 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T18543 | 31819-31824 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T18544 | 32002-32007 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T18545 | 32132-32137 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T15313 | 40460-40464 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
T15314 | 41080-41085 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T15315 | 42747-42752 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T15316 | 44028-44033 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T15317 | 44396-44401 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T15318 | 40694-40703 | http://purl.obolibrary.org/obo/GO_0005737 | denotes | cytoplasm |
T15319 | 40711-40718 | http://purl.obolibrary.org/obo/GO_0005634 | denotes | nucleus |
T17422 | 27635-27640 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T17423 | 27987-27992 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T17424 | 28038-28043 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T10715 | 28313-28317 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
T10716 | 32786-32790 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
T16611 | 24460-24465 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T16612 | 24730-24735 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T16613 | 25299-25304 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T17425 | 28141-28146 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T18126 | 29752-29757 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T18127 | 27987-27992 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T19161 | 33575-33580 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T19162 | 33631-33636 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T19163 | 33789-33794 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T19164 | 33866-33871 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T19165 | 34100-34105 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3306 | 7430-7435 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3307 | 7683-7688 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3308 | 8372-8377 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3309 | 8693-8698 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3310 | 8742-8747 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3313 | 11664-11669 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3314 | 12096-12101 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3315 | 12285-12290 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T3316 | 7814-7823 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | chromatin |
T3317 | 8528-8537 | http://purl.obolibrary.org/obo/GO_0005737 | denotes | cytoplasm |
T3318 | 8547-8554 | http://purl.obolibrary.org/obo/GO_0005634 | denotes | nucleus |
T3319 | 8891-8898 | http://purl.obolibrary.org/obo/GO_0005634 | denotes | nucleus |
T3320 | 9412-9419 | http://purl.obolibrary.org/obo/GO_0005634 | denotes | nucleus |
T3321 | 9725-9732 | http://purl.obolibrary.org/obo/GO_0005634 | denotes | nucleus |
T3322 | 10712-10719 | http://purl.obolibrary.org/obo/GO_0005634 | denotes | nucleus |
T3323 | 10008-10045 | http://purl.obolibrary.org/obo/GO_0044798 | denotes | transcription factors such as nuclear |
T3324 | 10343-10354 | http://purl.obolibrary.org/obo/GO_0005694 | denotes | chromosomal |
T3325 | 10343-10361 | http://purl.obolibrary.org/obo/GO_0098687 | denotes | chromosomal region |
T3326 | 12138-12148 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T3327 | 12138-12148 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T4600 | 13960-13964 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T4601 | 14069-14073 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
sentences
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T1295 | 7246-7436 | Sentence | denotes | Inflammation in allergic diseases such as asthma, rhinitis, and atopic dermatitis is mediated via expression of the cytokines interleukin (IL)-4, IL-5, and IL-13 from T helper-2 (Th2) cells. |
T1296 | 7437-7566 | Sentence | denotes | IL-4 and IL-13 regulate the expression of IgE from B lymphocytes, whereas IL-5 plays a key role in eosinophilic inflammation [1]. |
T1297 | 7567-7697 | Sentence | denotes | Th2 cytokines are regulated by the zinc finger transcription factor GATA-3, which is predominantly expressed in Th2 cells [2],[3]. |
T1298 | 7698-7844 | Sentence | denotes | GATA-3 determines Th2 cell differentiation and selectively activates the promoters of IL-4, IL-5, and IL-13 through chromatin remodelling [4]–[7]. |
T1299 | 7845-8103 | Sentence | denotes | The key role of GATA-3 in allergic airway inflammation has been demonstrated in mice by the reduced release of Th2 cytokines in animals treated with dominant-negative mutants of GATA-3 and by local application of antisense oligonucleotides to GATA-3 [8],[9]. |
T1300 | 8104-8308 | Sentence | denotes | Furthermore, conditional knock-out of the Gata3 gene in mice reduces expression of Th2 cytokines in vitro and in vivo [10], and similar results have been reported in isolated murine CD4+ lymphocytes [11]. |
T1301 | 8309-8449 | Sentence | denotes | Finally, knockdown of GATA-3 expression using siRNA in human T cells results in loss of anti-CD3/CD28-mediated Th2 cytokine expression [12]. |
T3670 | 12350-12379 | Sentence | denotes | Participants and Study Design |
T3671 | 12380-12577 | Sentence | denotes | We studied patients with mild asthma who were not treated with inhaled corticosteroids who had been included in a previously reported double-blind, placebo-controlled, crossover study with FP [34]. |
T3672 | 12578-12827 | Sentence | denotes | Seven patients with mild asthma entered the study and were randomized to receive a single inhalation of FP (100 and 500 µg) or a matched placebo control via a spacer chamber, and the other treatment was given after a wash-out period of at least 6 d. |
T3673 | 12828-12908 | Sentence | denotes | Blood was taken for preparation of PBMCs at 1 and 2 h after drug administration. |
T3674 | 12909-13140 | Sentence | denotes | All patients gave informed consent and the study was approved by the Ethics Committee of the Royal Brompton and Harefield Hospitals NHS Trust. The clinical study was conducted before the requirement for Clinical Trial Registration. |
T3976 | 13142-13165 | Sentence | denotes | Antibodies and Reagents |
T3977 | 13166-13296 | Sentence | denotes | The monoclonal antibodies against human CD3, CD28, GR, and importin-α were purchased from BD Biosciences (Oxford, United Kingdom). |
T3978 | 13297-13785 | Sentence | denotes | Rabbit antibodies against human GATA-3 (H-48) and GR (E-20, sc-1003) were obtained from Santa Cruz Biotechnology (Santa Cruz, California, United States), polyclonal rabbit antibodies against phospho-p38 MAP kinase and phospho-ATF-2 from Cell Signaling Technology (New England Biolabs, Hertford, UK), monoclonal antibody against phosphoserine (clone 4H4) from Affiniti Research Products (Exeter, UK), and antibodies against rabbit IgG-conjugated TRITC from Dako Cytomation (Cambridge, UK). |
T3979 | 13786-13900 | Sentence | denotes | The anti-GR antibody (Clone 41) from BD Transduction Laboratories (Oxford, UK) was used for Western blot analysis. |
T3980 | 13901-13958 | Sentence | denotes | All other reagents were purchased from Sigma (Poole, UK). |
T4615 | 14566-14591 | Sentence | denotes | Reverse Transcription PCR |
T4616 | 14592-14669 | Sentence | denotes | Total RNA was extracted using lysis buffer (RNeasy kit; Qiagen, Crawley, UK). |
T4617 | 14670-14765 | Sentence | denotes | During RNA purification, genomic DNA was digested with RNase-free DNase (Amersham Biosciences). |
T4618 | 14766-14884 | Sentence | denotes | Next, 0.5 µg of total RNA was reversed transcribed using the avian myeloblastosis virus RT (Promega, Southampton, UK). |
T4619 | 14885-14955 | Sentence | denotes | For relative quantification, RT-PCR was carried out using cDNA probes. |
T4620 | 14956-15013 | Sentence | denotes | Primers for IL-4 were from Sigma-Genosys (Cambridge, UK). |
T4621 | 15014-15125 | Sentence | denotes | Sequences of GADPH used are as follows: forward 5′-CCACCCATGGCAAATTCCATGGC, reverse 3′-TCTAGACGGCAGGTCAGGTCCAC. |
T4846 | 15127-15193 | Sentence | denotes | Cell Fractionation, Immunoprecipitation, and Western Blot Analysis |
T4847 | 15194-15271 | Sentence | denotes | Nuclear and cytoplasmic fractions were prepared as previously described [35]. |
T4848 | 15272-15441 | Sentence | denotes | Whole cell lysates were prepared in NP-40 lysis buffer (0.5% Nonidet P-40, 20 mM Tris-HCl [pH 7.5], 150 mM NaCl) in the presence of complete protease cocktail inhibitor. |
T4849 | 15442-15557 | Sentence | denotes | Lysates were centrifuged at 4°C for 10 min at 12,000 rpm in an Eppendorf microcentrifuge to remove cellular debris. |
T4850 | 15558-15809 | Sentence | denotes | Samples were then immunoprecipitated with either 10 µl of antibody against GATA-3 or importin-α using A/G agarose slurry in the presence of protease inhibitor using the Catch and Release methodology (Upstate Biotechnology, Lake Placid, New York, USA). |
T4851 | 15810-15946 | Sentence | denotes | Western blot analysis was performed using anti-GATA-3, anti-importin-α, anti-GR, anti-p-p38 MAP kinase, anti-p-ATF-2, and anti-p-serine. |
T4852 | 15947-16052 | Sentence | denotes | Immunoreactive proteins were detected using an enhanced chemiluminescence ECL kit (Amersham Biosciences). |
T5202 | 16054-16083 | Sentence | denotes | Chromatin Immunoprecipitation |
T5203 | 16084-16467 | Sentence | denotes | Chromatin immunoprecipitation (IP) was performed as previously described [12] in HuT-78 T-cells with 2 µg of anti-GATA-3 (Santa Cruz Biotechnology), or isotypic immunoglobulin G as a non-specific control (Santa Cruz Biotechnology) overnight at 4°C. Promoter sequences were detected with PCR primers for the IL-5 promoter (−445 to +4): forward 5′-TTAATCTAGCCACAGTCATAG-3′ and reverse: |
T5204 | 16468-16496 | Sentence | denotes | 5′-TCATGGCTCTGAAACGTTCTG-3′. |
T5205 | 16497-16677 | Sentence | denotes | PCR was performed using a Hybaid Omnigene thermal cycler (Hybaid, Ashford, UK) with cycling parameters of 72°C for 10 min, 35 cycles at 94°C for 45 s, 52°C for 45 s, 72°C for 45 s. |
T5489 | 16679-16750 | Sentence | denotes | GR-GATA-3 In Vitro Competition Assay for Importin-α (Far-Western ELISA) |
T5490 | 16751-16926 | Sentence | denotes | Immunoprecipitated importin-α (anti-importin-α, Santa Cruz Biotechnology) from HuT-78 cells was separated by SDS-PAGE and purified from the excised gel by electroelution [36]. |
T5491 | 16927-17109 | Sentence | denotes | Similarly, GATA-3 was isolated from nonstimulated HuT-78 cells or cells stimulated for 30 min with anti-CD3/CD28 and GR was isolated from FP (10−8 M, 30 min) stimulated HuT-78 cells. |
T5492 | 17110-17172 | Sentence | denotes | These proteins were subsequently refolded in glycine solution. |
T5493 | 17173-17292 | Sentence | denotes | 100 µl of importin-α solution (100 ng/ml in TBS) was added to 96-well plates coated with goat anti-importin-α antibody. |
T5494 | 17293-17421 | Sentence | denotes | After 1 h incubation, GATA-3 (100 ng/ml in TBS) from stimulated or unstimulated cells were added to the importin-α-coated wells. |
T5495 | 17422-17513 | Sentence | denotes | GR (10 or 100 ng/ml in TBS) from stimulated or unstimulated cells were added to some wells. |
T5496 | 17514-17739 | Sentence | denotes | After a further 1 h incubation, the plate was washed and incubated with primary antibodies (a mixture of rabbit anti-GATA-3 and mouse anti-GR, Santa Cruz Biotechnology) for 1.5 h, and then incubated with secondary antibodies. |
T5497 | 17740-17930 | Sentence | denotes | FITC swine anti-rabbit IgG (Dako, Cambridge, UK) was used for the detection of GATA-3, and rhodamine donkey anti-mouse IgG (Novus, Littleton, Colorado, USA) was used for the detection of GR. |
T5498 | 17931-18031 | Sentence | denotes | FITC and rhodamine levels were measured with a fluorescent micro-plate reader (Bioline, London, UK). |
T6074 | 18033-18049 | Sentence | denotes | NF-κB Activation |
T6075 | 18050-18182 | Sentence | denotes | NF-κB binding activity in nuclear extracts was determined using an ELISA-based kit (Trans-AM p65, Active Motif, Rixensart, Belgium). |
T6076 | 18183-18293 | Sentence | denotes | In brief, 5 µg of nuclear extracts were incubated with a plate coated with an NF-κB consensus oligonucleotide. |
T6077 | 18294-18353 | Sentence | denotes | Plates were washed before addition of an anti-p65 antibody. |
T6078 | 18354-18458 | Sentence | denotes | Antibody binding was detected with a secondary HRP-conjugated antibody and developed with TMB substrate. |
T6079 | 18459-18512 | Sentence | denotes | The intensity of the reaction was measured at 450 nm. |
T6273 | 18514-18541 | Sentence | denotes | Immunofluorescence Staining |
T6274 | 18542-18613 | Sentence | denotes | Immunofluorescence staining was performed as previously described [34]. |
T6275 | 18614-18686 | Sentence | denotes | All staining was performed at room temperature and under humidification. |
T6276 | 18687-18786 | Sentence | denotes | Cells were collected and cytospins prepared in a cytocentrifuge (Shandon II, Shandon, Runcorn, UK). |
T6277 | 18787-18971 | Sentence | denotes | Cells were permeabilized, blocked, and then incubated with GR (1∶50 E-20 Santa Cruz Biotechnology) or anti-GATA-3 (H-48; Santa Cruz Biotechnology) antibody for 1 h at room temperature. |
T6278 | 18972-19127 | Sentence | denotes | After three washes in phosphate-buffered saline (PBS), cells were incubated with tetrarhodamine isothiocyanate–conjugated goat anti-rabbit antibody (Dako). |
T6279 | 19128-19304 | Sentence | denotes | Cytospins were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI), a fluorescent blue nuclear indole chromatin stain, and mounted in PBS:glycerol (50∶50). |
T6280 | 19305-19508 | Sentence | denotes | The immunopositive signal was characterised using laser scanning confocal microscopy on a Leica TCS NT/SP interactive laser cytometer equipped with confocal optics (Leica Microsystems, Wetzlar, Germany). |
T6281 | 19509-19659 | Sentence | denotes | To determine the specificity of the antibodies, rabbit serum immunoglobulin (Dako) and secondary antibodies without the primary were used as controls. |
T6282 | 19660-19778 | Sentence | denotes | Positively stained nuclei and total cells were counted (500) on each slide with the observer blinded to the treatment. |
T7169 | 20723-20735 | Sentence | denotes | Transfection |
T7170 | 20736-21007 | Sentence | denotes | HuT-78 cells were transfected with either EP8 or GFP vector only DNA using solution R, programme V-001 at a ratio of 3×106 cells/4 µg DNA for 7–8 h in complete medium (10% bovine serum in RPMI1640+15 L-glutamine) according to the general Amaxa protocol for nucleofection. |
T7171 | 21008-21171 | Sentence | denotes | The medium was subsequently changed to 1% RPMI for 24 h before transfected cells were added to anti-CD3/CD28 treated wells and live cell videomicroscopy performed. |
T7353 | 21173-21194 | Sentence | denotes | Time-Lapse Microscopy |
T7354 | 21195-21463 | Sentence | denotes | HuT-78 cells expressing GATA-3-GFP were maintained at 37°C in growth medium in a closed FCS2 perfusion chamber (Bioptechs, Butler, Pennsylvania, USA) combined with an objective heater (Bioptechs) on the stage a Zeiss Axiovert 200 microscope (Thornwood, New York, USA). |
T7355 | 21464-21729 | Sentence | denotes | Observations were made by 40×1.0 NA oil-immersion objective lens, and fluorescence and phase contrast images were gathered using a Hamamatsu ORCA-ER charged coupled device camera (Bridgewater, New Jersey, USA) driven by Openlab software (Improvision, Coventry, UK). |
T7356 | 21730-21784 | Sentence | denotes | Photographs were taken at 0, 30, 60, 120, and 240 min. |
T7605 | 21786-21808 | Sentence | denotes | Densitometric Analysis |
T7606 | 21809-21938 | Sentence | denotes | Densitometry of ECL immunoblots was performed using Gelworks ID intermediate software (Ultraviolet Products, Cambridgeshire, UK). |
T7607 | 21939-22019 | Sentence | denotes | Briefly, immunoblots were scanned and gates were drawn tightly around each band. |
T7608 | 22020-22099 | Sentence | denotes | Background values from each lane were subtracted to normalize each measurement. |
T7609 | 22100-22154 | Sentence | denotes | The bands were quantified using the Gelworks software. |
T7610 | 22155-22326 | Sentence | denotes | All Western blots were exposed to film for varying lengths of time, and only films generating subsaturating levels of intensity were selected for densitometric evaluation. |
T7781 | 22328-22348 | Sentence | denotes | Statistical Analysis |
T7782 | 22349-22563 | Sentence | denotes | Data from three or more independent experiments are presented as the mean±standard error of the mean (SEM), except where stated and were compared using GraphPad Prism 4 (GraphPad Software, http://www.graphpad.com). |
T7783 | 22564-22787 | Sentence | denotes | Results were analysed using one-way ANOVA with Newman-Keuls post test except for the data from the in vivo inhaled FP study, which was analysed by Friedman's test with subsequent Wilcoxson matched pair signed rank sum test. |
T7784 | 22788-22853 | Sentence | denotes | Data from this analysis are presented as a box-and-whiskers plot. |
T7785 | 22854-23003 | Sentence | denotes | Friedman's test was used as three matched measures were obtained using placebo, 100 µg, and 500 µg of inhaled FP, which had variable baseline levels. |
T7786 | 23004-23161 | Sentence | denotes | We did not assume a Gaussian distribution of the data due to the limited numbers of participants analysed (seven).The null hypothesis was rejected at p<0.05. |
T8238 | 23172-23247 | Sentence | denotes | The Effect of Corticosteroids on GATA-3 Nuclear Translocation and IL-4 mRNA |
T8239 | 23248-23356 | Sentence | denotes | Corticosteroids are effective in inhibiting GATA-3-regulated IL-4 gene expression in vitro and in vivo [32]. |
T8240 | 23357-23464 | Sentence | denotes | We therefore investigated whether corticosteroids affect anti-CD3/CD28–stimulated nuclear import of GATA-3. |
T8241 | 23465-23616 | Sentence | denotes | Stimulation of cells with anti-CD3/CD28 resulted in a rapid cytoplasmic/nuclear GATA-3 translocation (Figure 1A), confirming our previous results [12]. |
T8242 | 23617-23746 | Sentence | denotes | We also confirmed a clear separation of nuclear and cytosolic fractions as indicated by histone H1 and MEK-1 markers (Figure 1B). |
T8243 | 23747-23958 | Sentence | denotes | The potent topical corticosteroid FP caused sustained loss of nuclear GATA-3 expression and cytoplasmic retention of GATA-3 at concentrations ranging from 10−12 to 10−8 M, which cover the therapeutic range [37]. |
T8244 | 23959-24274 | Sentence | denotes | This effect was concentration- and time-dependent, with a peak effect of 11.6-fold at 30 min at a concentration of 10−8 M (Figure 1C) and was associated with marked reductions in anti-CD3/CD28–stimulated IL-4 and IL-5 mRNA expression (Figure 1D) and a loss of GATA-3 binding to the native IL-5 promoter (Figure 1E). |
T8940 | 25824-25879 | Sentence | denotes | Ligand-Activated GR Competes with GATA-3 for Importin-α |
T8941 | 25880-26034 | Sentence | denotes | We confirmed and extended previous data [20] to show that ligand-activated GR as well as GATA-3 uses importin-α for its nuclear import (Figure 2A and 2B). |
T8942 | 26035-26161 | Sentence | denotes | This interaction between GR and importin-α was significant at concentrations as low as 10−12 M and was maximal with 10−8 M FP. |
T8943 | 26162-26274 | Sentence | denotes | Subsequent GR nuclear translocation was rapid and sustained at significant levels for at least 14 h (Figure 2B). |
T8944 | 26275-26476 | Sentence | denotes | Using IP-Western blotting we showed that FP at 10−12–10−8 M decreased the association between GATA-3 and importin-α induced by anti-CD3/CD28 stimulation in a concentration-dependent manner (Figure 2C). |
T8945 | 26477-26690 | Sentence | denotes | In addition, using GFP-labelled GATA-3 and confocal microscopy we demonstrated that GATA-3 nuclear import following anti-CD3/CD28 stimulation for 30 min was attenuated by pretreatment with FP (10−8 M) (Figure 2D). |
T9693 | 30668-30927 | Sentence | denotes | Using an in vitro competition assay (Figure 4A) utilizing purified activated GATA-3, importin-α, and activated GR, we demonstrated that activated GR significantly increased GR-importin-α association in the presence and absence of activated GATA-3 (Figure 4B). |
T9694 | 30928-31030 | Sentence | denotes | This effect is not mutual, since activated GATA-3 did not block GR–importin-α association (Figure 4C). |
T9695 | 31031-31271 | Sentence | denotes | These data also suggest that both activated GR and phospho-GATA-3 can directly associate with importin-α (Figure 4D) and that activated GR attenuates the phospho-GATA-3/importin-α interaction in a concentration-dependent manner (Figure 4E). |
T9696 | 31272-31408 | Sentence | denotes | Together, this suggests that ligand-activated GR may compete with phospho-GATA-3 for importin-α and thereby limit GATA-3 nuclear import. |
T9697 | 32497-32617 | Sentence | denotes | Other possible interpretations of our results could include an effect of FP on GATA-3 nuclear export and/or degradation. |
T9698 | 32618-32745 | Sentence | denotes | Leptomycin B, which inhibits nuclear export, did not affect the ability of FP to block GATA-3 nuclear localization (Figure 5A). |
T9699 | 32746-32865 | Sentence | denotes | Additionally, FP had no effect on whole cell GATA-3 expression during the time course of these experiments (Figure 5B). |
T9700 | 32866-33052 | Sentence | denotes | Nor did addition of FP subsequent to anti-CD3/CD28 nuclear translocation affect GATA-3 nuclear residency (Figure 5C), suggesting that activated GR does not enhance GATA-3 nuclear export. |
T9701 | 33053-33217 | Sentence | denotes | Finally, the effect of FP on GATA-3 nuclear import was not nonspecific, since FP (10−8 M) had no effect on p65 nuclear translocation measured at 60 min (Figure 5D). |
T11291 | 34269-34385 | Sentence | denotes | The Inhibitory Effect of Corticosteroids on GATA-3 Nuclear Localization in Primary T Lymphocytes Ex Vivo and In Vivo |
T11292 | 34386-34744 | Sentence | denotes | Treatment with FP ex vivo demonstrated a concentration-dependent decrease in the direct interaction between phospho-GATA-3 and importin-α in PBMCs from patients with asthma (Figure 6A and 6B), which was significantly inhibited at 10−12 M FP (p<0.001, ANOVA and Newman-Keuls test) and completely attenuated by 10−8 M FP (p<0.001, ANOVA and Newman-Keuls test). |
T11293 | 35694-35872 | Sentence | denotes | Our previous T cell line studies indicated that 10−12 M FP suppresses IL-4 and -5 gene expression and attenuated the interaction of GATA-3 with importin-α (see Figures 1D and 2). |
T11294 | 35873-35994 | Sentence | denotes | This concentration is close to peak plasma levels obtained from asthmatic patients treated with inhaled FP (500 µg) [27]. |
T11295 | 35995-36151 | Sentence | denotes | Inhaled FP (500 µg) treatment of seven steroid-naive asthma patients significantly reduced GATA-3–importin-α interaction in vivo in a time-dependent manner. |
T11296 | 36152-36314 | Sentence | denotes | This produced a >90% decrease in GATA-3–importin-α association at 2 h (median [95% CI], 13,494 [6,828–17,829] versus 879 [597–1,165]; p<0.05 Friedman's analysis). |
T11297 | 36315-36447 | Sentence | denotes | However, this did not reach significance using Wilcoxon's post-test analysis (W = 6.00) probably due to low numbers of participants. |
T11298 | 36448-36545 | Sentence | denotes | Similar results were observed when GATA-3–importin-α association was measured (Figure 6C and 6D). |
T11299 | 36546-36594 | Sentence | denotes | The lower dose of FP (100 µg) was not effective. |
T11300 | 36595-36801 | Sentence | denotes | The attenuated interaction of GATA-3 did not result from the defective recycling of importin-α, as a significant decrease in the abundance of importin-α in the cytoplasmic pool was not detected (Figure 6E). |
T11301 | 36802-36914 | Sentence | denotes | We further examined whether inhaled FP could affect cellular localization of GATA-3 in peripheral blood T cells. |
T11302 | 36915-37265 | Sentence | denotes | Treatment with inhaled FP (500 µg) for 2 h significantly increased GR nuclear translocation (Figure 7A) and concomitantly decreased the number of nuclear GATA-3 immunoreactive peripheral blood T cells (37%±4.2% versus 58.2%±4.95%, p = 0.016, W = 28.0, Wilcoxon's rank test) compared with placebo as measured by immunocytochemistry (Figure 7A and 7B). |
T11303 | 37266-37397 | Sentence | denotes | This was confirmed by Western blotting, which also indicated that this effect was both time- and dose-dependent (Figure 7C and 7D). |
T11304 | 37398-37795 | Sentence | denotes | Thus, inhaled FP (500 µg) induced significant loss in nuclear GATA-3 at 2 h (median [95% CI], 0.40 [0.27–0.53] versus 0.14 [0.11–0.19], p<0.05, W = 21.00, Wilcoxon's rank test) (Figure 7C) and cytoplasmic GATA-3 levels were enhanced by inhaled FP in a dose-dependent manner (median [95% CI], 0.0032 [0.0026–0.0039] versus 0.658 [0.592–0.720], p<0.05, W = −21.00, Wilcoxon's rank test) (Figure 7D). |
T11305 | 37796-37931 | Sentence | denotes | In addition, FP (500 µg) inhibited p38 MAPK phosphorylation in primary T cells in vivo at 2 h in samples from two patients (Figure 7E). |
T11306 | 39418-39572 | Sentence | denotes | Taken together, our data suggest that inhaled FP reduces nuclear localization of GATA-3 in vivo by acutely inhibiting phospho-GATA-3–importin association. |
T11307 | 39573-39759 | Sentence | denotes | This effect may be direct, through competition for importin-α or associated molecules, or secondary to an effect on p38 MAPK-mediated GATA-3 phosphorylation via rapid induction of MKP-1. |
T11308 | 39760-39907 | Sentence | denotes | The combination of these two interacting effects can result in complete suppression of GATA-3 nuclear import and thus Th2 cytokine gene expression. |
T13323 | 39920-40132 | Sentence | denotes | Here we have demonstrated, to our knowledge for the first time, that corticosteroids may inhibit GATA-3 function and therefore the transcription of Th2 genes via two distinct but interacting molecular mechanisms. |
T13324 | 40133-40312 | Sentence | denotes | Firstly, corticosteroid-activated GR appears to compete with activated GATA-3 for nuclear import via importin-α, which is required for the nuclear transport of both GATA-3 and GR. |
T13325 | 40313-40630 | Sentence | denotes | Secondly, corticosteroids at higher concentrations increase the expression of MKP-1, a potent inhibitor of p38 MAPK activity and thereby prevent T cell receptor/co-receptor activation of p38 MAPK to prevent the phosphorylation of GATA-3 that is necessary for interaction with importin-α and subsequent nuclear import. |
T13326 | 40631-40820 | Sentence | denotes | We have previously shown that translocation of GATA-3 from the cytoplasm to the nucleus involves the nuclear transporter protein importin-α, which interacts with phosphorylated GATA-3 [12]. |
T13327 | 40821-41052 | Sentence | denotes | We have also previously reported that GATA-3 knockdown using siRNA results in suppression of anti-CD3/CD28–stimulated IL-4/IL-5 mRNA induction, thus implicating an essential role for GATA-3 in the transcription of these genes [12]. |
T13328 | 41053-41154 | Sentence | denotes | We now confirm, in human T cells, that GR also uses the same nuclear import mechanism as GATA-3 [22]. |
T13329 | 41155-41268 | Sentence | denotes | We therefore propose that there is competition between ligand-activated GR and phospho-GATA-3 for nuclear import. |
T13330 | 41269-41542 | Sentence | denotes | Furthermore, we have shown that there is preferential binding of importin-α to activated GR over phospho-GATA-3, so that corticosteroids would preferentially reduce GATA-3 entry and thus rapidly switch off Th2 gene transcription without any need for any intermediate steps. |
T13331 | 41543-41702 | Sentence | denotes | Furthermore, there was some degree of specificity for GATA-3, as nuclear translocation of the p65 subunit of NF-κB was not affected by corticosteroid exposure. |
T13332 | 41703-41897 | Sentence | denotes | We tested some alternative explanations for this effect of FP on GATA-3 nuclear exclusion and failed to show that FP either enhances GATA-3 nuclear export directly or induces GATA-3 degradation. |
T13333 | 41898-42104 | Sentence | denotes | The evidence from the in vitro competition assays does, however, suggest that purified activated GR can clearly attenuate purified phospho-GATA-3–importin-α association and that the converse does not occur. |
T13334 | 42105-42187 | Sentence | denotes | Furthermore, we have shown that only phospho-GATA-3 can associate with importin-α. |
T13335 | 42188-42337 | Sentence | denotes | This mechanism is sensitive to very low concentrations of corticosteroid and would be rapid in onset as no changes in protein synthesis are required. |
T13336 | 42338-42537 | Sentence | denotes | This acute mechanism may also contribute to the reduction in GATA-3 nuclear import and may play a major role at low corticosteroid concentrations and/or at early time points prior to MKP-1 induction. |
T13337 | 42538-42674 | Sentence | denotes | Corticosteroids can modulate p38 MAPK activity through the induction of MKP-1, a potent endogenous inhibitor of MAPK function [38],[39]. |
T13338 | 42675-42795 | Sentence | denotes | We report here a rapid induction of MKP-1 mRNA following stimulation of cells with relatively high concentrations of FP. |
T13339 | 42796-42989 | Sentence | denotes | We hypothesize that this rapid induction of MKP-1 can reduce GATA-3 nuclear import by attenuating p38 MAPK activity and subsequent GATA-3 phosphorylation, thus preventing nuclear translocation. |
T13340 | 42990-43256 | Sentence | denotes | The location of the serine residue(s) of GATA-3 that are phosphorylated by p38 MAPK are currently unknown, but a bioinformatics search (Motif Scanner, http://scansite.mit.edu/motifscan_seq.phtml) indicates at least three potential p38 MAPK-sensitive serine residues. |
T13341 | 43257-43439 | Sentence | denotes | As predicted from these in vitro data, impairment of GATA-3 nuclear import by FP may, at least in part, underlie the efficacy of corticosteroids in suppressing allergic inflammation. |
T13342 | 43440-43740 | Sentence | denotes | Although we did not assess the acute inhibitory effect of FP on the expression of IL-4 mRNA in vivo, a single inhalation of FP (500 µg) may have comparable effects, as it provides plasma levels within a relevant range of concentrations used to suppress IL-4 transcription in our in vitro system [37]. |
T13343 | 43741-43872 | Sentence | denotes | A lower dose of inhaled FP (100 µg) was not effective, but plasma concentrations may be below those required for GATA-3 inhibition. |
T13344 | 43873-44053 | Sentence | denotes | However, it is likely that the higher concentrations of FP in the airways after inhaled administration would be effective in inhibiting GATA-3 in airway T cells of asthma patients. |
T13345 | 44054-44276 | Sentence | denotes | The study of PBMCs from asthma patients treated with inhaled corticosteroid therapy clearly demonstrates that these molecular mechanisms are likely to also occur in patients at therapeutic doses of inhaled corticosteroids. |
T13346 | 44277-44452 | Sentence | denotes | In addition, previous studies have shown that corticosteroids can suppress IL-4 and IL-5 release from peripheral blood cells of asthma patients in vitro and in vivo [40]–[42]. |
T13347 | 44453-44896 | Sentence | denotes | In summary, our data provide evidence for a novel action of corticosteroids: suppression of allergic inflammation through a rapid inhibitory effect on GATA-3 nuclear translocation by preferential binding to the shared nuclear import protein importin-α and by a second mechanism involving increased synthesis of MKP-1, which inhibits p38 MAPK, thus preventing the phosphorylation of GATA-3 that is necessary for nuclear translocation of GATA-3. |
T13348 | 44897-45035 | Sentence | denotes | These two mechanisms are likely to be synergistic, accounting for the rapid and potent effect of corticosteroids on allergic inflammation. |
T13349 | 45036-45235 | Sentence | denotes | This is exemplified by the rapid inhibitory effect of topical corticosteroids on nasal Th2 cytokine release after allergen provocation in individuals with seasonal allergic rhinitis (hay fever) [43]. |
T13350 | 45236-45398 | Sentence | denotes | Prevention of phospho-GATA-3 interaction with importin-α may provide a new approach for the development of novel therapies for the treatment of allergic diseases. |
T16029 | 24319-24421 | Sentence | denotes | Fluticasone propionate down-regulates Th2 cytokine gene expression and inhibits GATA-3 nuclear import. |
T16030 | 24422-24921 | Sentence | denotes | (A) Anti-CD3/CD28 treatment of HuT-78 cells results in translocation of GATA-3 from the cytoplasm to the nucleus within 30 min. (B) Histone H1 and MEK-1 were used to confirm distinct separation of cytoplasmic and nuclear extracts in three separate experiments. (C) Western blot analysis of FP-treated HuT-78 cells demonstrated impaired nuclear localization of GATA-3 induced by anti-CD3/CD28 co-stimulation in a time- (at 10−8 M FP) and concentration- (at 60 min after stimulation) dependent manner. |
T16031 | 24922-24984 | Sentence | denotes | Cells were pretreated with FP for 30 min prior to stimulation. |
T16032 | 24985-25081 | Sentence | denotes | MEK1 and histone H1 were used to demonstrate equal cytoplasmic and nuclear loading respectively. |
T16033 | 25082-25305 | Sentence | denotes | Results are presented graphically below as mean±SEM of at least three independent experiments. *** p<0.001 compared to t = 0. (D) RT-PCR showing that FP inhibits IL-4 and IL-5 mRNA expression in CD3/CD28-costimulated cells. |
T16034 | 25306-25342 | Sentence | denotes | GAPDH was used as a loading control. |
T16035 | 25343-25676 | Sentence | denotes | Lower panels show graphical analysis of results presented as mean±SEM of at least three independent experiments. ### p<0.001 compared to control, ***p<0.001 compared to anti-CD3/CD28–stimulated. (E) FP (10 nM) reduces the ability of anti-CD3/CD28-stimulated GATA-3 to associate with the native IL-5 promoter 60 min after stimulation. |
T16036 | 25677-25754 | Sentence | denotes | Data are also shown graphically as mean±SEM of three independent experiments. |
T16037 | 25755-25822 | Sentence | denotes | All data were analysed by ANOVA followed by Newman-Keuls post-test. |
T18308 | 31453-31520 | Sentence | denotes | Fluticasone propionate competes with phospho-GATA-3 for importin-α. |
T18309 | 31521-32365 | Sentence | denotes | (A) schematic representation of the in vitro binding competition assay. (B) GR isolated from FP (10−8 M) stimulated cells enhances GR–importin-α binding in the presence (•) and absence (▪) of activated GATA-3. * p<0.05 compared to no activated GR. (C) GATA-3 isolated from anti-CD3/CD28–stimulated cells does not attenuate GR–importin-α association. *p<0.05 compared to control. (D) Activated GR blocks the ability of purified phospho-GATA-3 isolated from anti-CD3/CD28–stimulated cells interacting with immobilised importin-α in an in vitro binding assay. *p<0.05 compared to GATA-3 isolated from unstimulated cells. # p<0.05 compared to stimulated GATA-3-importin binding. (E) The effect of activated (•) versus unstimulated (○) GR on attenuation of GATA-3–importin-α association was concentration-dependent. *p<0.05, **p<0.01 between groups. |
T18310 | 32366-32494 | Sentence | denotes | All results are expressed as mean±SEM of three independent experiments and analysed by ANOVA followed by Newman-Keuls post-test. |
T18713 | 33262-33323 | Sentence | denotes | Fluticasone propionate does not affect GATA-3 nuclear export. |
T18714 | 33324-33842 | Sentence | denotes | (A) Western blot analysis showing that the nuclear export inhibitor leptomycin B (2 nM) does not affect the ability of FP (10−8 M) to prevent anti-CD3/CD28–stimulated GATA-3 nuclear localization measured at 60 min. ***p<0.001 compared to unstimulated cells, ### p<0.001 compared to anti-CD3/CD28–stimulated cells. (B) Western blot analysis showing that FP (10−8 M) does not affect whole-cell GATA-3 degradation over 17 h. (C) GFP-tagged GATA-3 is overexpressed and cells stimulated (b–j) or not (a) with anti-CD3/CD28. |
T18715 | 33843-34106 | Sentence | denotes | The effect of treating cells with FP (10−8 M, f–j) after 30 min stimulation with anti-CD3/CD28 is also shown. (D) FP (10−8 M) does not prevent anti-CD3/CD28–stimulated p65 nuclear translocation at 60 min after stimulation. **p<0.01 compared to unstimulated cells. |
T18716 | 34107-34205 | Sentence | denotes | All results are representative of at least four independent experiments and are shown as mean±SEM. |
T18717 | 34206-34267 | Sentence | denotes | Results were analysed by ANOVA followed by Newman-Keuls test. |
T19286 | 34789-34907 | Sentence | denotes | Fluticasone propionate impairs GATA-3 interaction with importin-α and GATA-3 nuclear localization in vivo and ex vivo. |
T19287 | 34908-35102 | Sentence | denotes | (A and B) Co-immunoprecipitation analysis of PBMCs from steroid-naïve asthma patients treated with FP in vitro demonstrated impaired interaction between GATA-3 and importin-α measured at 60 min. |
T19288 | 35103-35464 | Sentence | denotes | Each bar represents the mean±SEM of at least three independent experiments; *** p<0.001 compared with control as determined by ANOVA/Newman-Keuls analysis. (C and D) Co-immunoprecipitation analyses of PBMCs from steroid-naïve asthma patients treated with inhaled FP (500 µg via a spacer) in vivo demonstrated decreased association between GATA-3 and importin-α. |
T19289 | 35465-35635 | Sentence | denotes | The individual values for each treatment are presented graphically. (E) Representative Western blot showing that importin-α expression was unaffected by inhalation of FP. |
T19290 | 35636-35691 | Sentence | denotes | Blot is representative of gels from three participants. |
T19726 | 37976-38052 | Sentence | denotes | Inhaled fluticasone propionate impairs GATA-3 nuclear localization in PBMCs. |
T19727 | 38053-38324 | Sentence | denotes | (A) Representative immunocytochemistry of showing the effect of inhaled FP (500 µg) on GR and GATA-3 nuclear localisation. (B) Nuclear GATA-3 immunoreactivity in PBMCs from seven steroid-naïve asthma patients 2 h following inhaled FP treatment (100 or 500 µg via spacer). |
T19728 | 38325-38840 | Sentence | denotes | The median and interquartile ranges for each treatment are presented as a box-and-whiskers plot (n = 7); * p<0.05 Wilcoxon's rank test compared with placebo. (C) Immunoblotting analyses of PBMCs demonstrated a time-dependent decrease in nuclear expression of GATA-3, and increased cytoplasmic GATA-3 expression after inhalation of FP. (D) Immunoblotting analyses of PBMCs demonstrated a dose-dependent decrease in nuclear expression of GATA-3, and increased cytoplasmic GATA-3 expression 2 h after inhalation of FP. |
T19729 | 38841-38975 | Sentence | denotes | Histone H1 and MEK-1 immunoblotting confirmed equivalent total protein loading for the nuclear and cytoplasmic fractions respectively. |
T19730 | 38976-39337 | Sentence | denotes | Quantification of the densitometry data in (C) and (D) is shown as a box-and-whiskers plot of results from n = 6 participants for which data were available. *p<0.05 compared to control. (E) Western blot analyses of PBMCs demonstrated a time-dependent decrease in dual phosphorylation (threonine-180 and tyrosine-182) of p38 MAPK after inhalation of FP (500 µg). |
T19731 | 39338-39415 | Sentence | denotes | The results shown in (E) are representative of samples from two participants. |
T9685 | 28251-28266 | Sentence | denotes | Effect on MKP-1 |
T9686 | 28267-28468 | Sentence | denotes | Dexamethasone inhibits p38 MAPK function in a cell type–specific manner through the rapid induction of the dual kinase phosphatase MKP-1 (MAPK phosphatase-1), and this effect lasts for up to 24 h [28]. |
T9687 | 28469-28688 | Sentence | denotes | FP (10−8 M) treatment of HuT-78 cells activated by anti-CD3/CD28 in vitro significantly decreased p38 MAPK phosphorylation (Figure 3A) and activity measured by phosphorylation of the downstream target ATF-2 (Figure 3B). |
T9688 | 28689-28765 | Sentence | denotes | This effect was detected at 30 min and lasted for at least 14 h (Figure 3B). |
T9689 | 28766-28935 | Sentence | denotes | FP (10−8 M) also significantly reduced GATA-3 serine phosphorylation induced by anti-CD3/CD28 stimulation in both a time- and concentration-dependent manner (Figure 3C). |
T9690 | 28936-29023 | Sentence | denotes | This reduction in GATA-3 phosphorylation was also seen with lower concentrations of FP. |
T9691 | 29024-29187 | Sentence | denotes | We found that FP significantly induced MKP-1 mRNA in both a time- and concentration-dependent manner, reaching a plateau at 10−8 M after 10 min (Figure 3D and 3E). |
T9692 | 29188-29358 | Sentence | denotes | However, the effects of FP on GATA-3 nuclear import, importin-α association and IL-4 mRNA expression are seen at 10,000-fold lower concentrations (10−12 M, see Figure 2). |
T16815 | 26735-26827 | Sentence | denotes | Fluticasone propionate reduces GATA-3 association with importin-α and GATA-3 nuclear import. |
T16816 | 26828-27014 | Sentence | denotes | (A) Western blot analysis demonstrates a time- (at 10−8 M FP) and concentration- (at 60 min after stimulation) dependent induction of FP-activated GR interaction with importin-α (Imp-α). |
T16817 | 27015-27076 | Sentence | denotes | A positive control for GR association with importin is shown. |
T16818 | 27077-27132 | Sentence | denotes | Quantification of the densitometry data is shown below. |
T16819 | 27133-27438 | Sentence | denotes | Each bar represents mean±SEM of at least three independent experiments. *** p<0.001 compared to control, ### p<0.001. (B) Western blot analysis demonstrated a time- (at 10−8 M FP) and concentration- (at 60 min after stimulation) dependent induction of FP-activated GR nuclear translocation measured by IP. |
T16820 | 27439-27494 | Sentence | denotes | Quantification of the densitometry data is shown below. |
T16821 | 27495-27781 | Sentence | denotes | Each bar represents mean±SEM of at least three independent experiments. ***p<0.001 compared to control. (C) Western blot analysis of HuT-78 cells treated with FP and anti-CD3/CD28 co-stimulation demonstrated a concentration-dependent decrease in GATA-3–importin-α association at 20 min. |
T16822 | 27782-27837 | Sentence | denotes | Quantification of the densitometry data is shown below. |
T16823 | 27838-28103 | Sentence | denotes | Each bar represents mean±SEM of at least three independent experiments. ### p<0.001 compared to control, ***p<0.001 compared to αCD3/CD28-stimulated cells. (D) GFP-tagged GATA-3 was overexpressed and cells stimulated (b, c) or not (a) for 30 min with anti-CD3/CD28. |
T16824 | 28104-28181 | Sentence | denotes | The effect of 30 min pretreatment of cells with FP (10−8 M, c) is also shown. |
T16825 | 28182-28249 | Sentence | denotes | All data were analysed by ANOVA followed by Newman-Keuls post-test. |
T17603 | 29403-29572 | Sentence | denotes | Fluticasone propionate–mediated inhibition of p38 MAP kinase phosphorylation and activation is associated with a marked down-regulation of GATA-3 serine phosphorylation. |
T17604 | 29573-30060 | Sentence | denotes | (A) Western blot analysis shows that FP (10−8 M, 30 min) treatment reduced dual phosphorylation (threonine-180 and tyrosine-182) of p38 MAPK in anti-CD3/CD28–co-stimulated HuT-78 cells. (B) Time course of the effect of FP (10−8 M) on phosphorylation of activated transcription factor 2 (ATF-2), a measure of p38 MAPK activity. (C) FP-induced inhibition of p38 MAPK activity is associated with the decrease of anti-CD3/CD28 co-stimulation–induced serine phosphorylation (P-Ser) of GATA-3. |
T17605 | 30061-30126 | Sentence | denotes | For (A–C), quantification of the densitometry data is also shown. |
T17606 | 30127-30345 | Sentence | denotes | Each bar represents mean±SEM of at least three independent experiments. ### p<0.001 compared to control, ***p<0.001 compared to αCD3/CD28-stimulated cells. (D) FP induced MKP-1 mRNA in a concentration-dependent manner. |
T17607 | 30346-30527 | Sentence | denotes | All results are representative of at least three independent experiments and where appropriate expressed as means±SEM, *p<0.05. (E) FP induces MKP-1 mRNA in a time-dependent manner. |
T17608 | 30528-30586 | Sentence | denotes | Results are representative of two independent experiments. |
T17609 | 30587-30665 | Sentence | denotes | All data except (E) were analysed by ANOVA followed by Newman-Keuls post-test. |
T135 | 0-120 | Sentence | denotes | Suppression of GATA-3 Nuclear Import and Phosphorylation: A Novel Mechanism of Corticosteroid Action in Allergic Disease |
T136 | 455-465 | Sentence | denotes | Background |
T137 | 466-658 | Sentence | denotes | GATA-3 plays a critical role in regulating the expression of the cytokines interleukin (IL)-4, IL-5, and IL-13 from T helper-2 (Th2) cells and therefore is a key mediator of allergic diseases. |
T138 | 659-774 | Sentence | denotes | Corticosteroids are highly effective in suppressing allergic inflammation, but their effects on GATA-3 are unknown. |
T139 | 775-912 | Sentence | denotes | We investigated the effect of the corticosteroid fluticasone propionate on GATA-3 regulation in human T-lymphocytes in vitro and in vivo. |
T140 | 914-934 | Sentence | denotes | Methods and Findings |
T141 | 935-1374 | Sentence | denotes | In a T lymphocyte cell line (HuT-78) and peripheral blood mononuclear cells stimulated by anti-CD3 and anti-CD28 in vitro we demonstrated that fluticasone inhibits nuclear translocation of GATA-3 and expression of Th2 cytokines via a mechanism independent of nuclear factor-κB and is due, in part, to competition between GATA-3 and the ligand-activated glucocorticoid receptor for nuclear transport through the nuclear importer importin-α. |
T142 | 1375-1579 | Sentence | denotes | In addition, fluticasone induces the expression of mitogen-activated protein kinase (MAPK) phosphatase-1 (MKP-1), the endogenous inhibitor of p38 MAPK, which is necessary for GATA-3 nuclear translocation. |
T143 | 1580-1653 | Sentence | denotes | These inhibitory effects of fluticasone are rapid, potent, and prolonged. |
T144 | 1654-1802 | Sentence | denotes | We also demonstrated that inhaled fluticasone inhibits GATA-3 nuclear translocation in peripheral blood lymphocytes of patients with asthma in vivo. |
T145 | 1804-1815 | Sentence | denotes | Conclusions |
T146 | 1816-1952 | Sentence | denotes | Corticosteroids have a potent inhibitory effect on GATA-3 via two interacting mechanisms that potently suppress Th2 cytokine expression. |
T147 | 1953-2107 | Sentence | denotes | This novel mechanism of action of corticosteroids may account for the striking clinical efficacy of corticosteroids in the treatment of allergic diseases. |
T148 | 2109-2161 | Sentence | denotes | Please see later in the article for Editors' Summary |
T1302 | 8450-8582 | Sentence | denotes | In order for GATA-3 to regulate gene expression, it must translocate from the cytoplasm into the nucleus to access its target genes. |
T1303 | 8583-8807 | Sentence | denotes | Enhanced nuclear expression of GATA-3 following T cell receptor activation was first demonstrated in murine T cells [13] and was recently confirmed in human T cells following T cell receptor and co-receptor stimulation [12]. |
T1304 | 8808-8975 | Sentence | denotes | GATA-3 contains a classical nuclear import signal [14] and is transported into the nucleus by the nuclear import protein importin-α (also known as karyopherin-α) [12]. |
T1305 | 8976-9134 | Sentence | denotes | Deletion of a region encompassing the GATA-3 nuclear localisation sequence (NLS) region in murine and human cells prevents its nuclear localisation [12],[14]. |
T1306 | 9135-9425 | Sentence | denotes | The affinity of the importin-α–NLS interaction is regulated by phosphorylation [15], and we have shown that p38 mitogen-activated protein kinase (MAPK) plays a critical role in phosphorylating GATA-3 to enhance its interaction with importin-α and subsequent transport into the nucleus [12]. |
T1307 | 9426-9587 | Sentence | denotes | Corticosteroids are highly effective in the treatment of allergic inflammation, with marked suppression of Th2 cytokines in airways of patients with asthma [16]. |
T1308 | 9588-9849 | Sentence | denotes | Corticosteroids mediate their anti-inflammatory effects through binding to glucocorticoid receptors (GRs), which then translocate to the nucleus where they interact with glucocorticoid response elements (GREs) in the promoter regions of steroid-sensitive genes. |
T1309 | 9850-10154 | Sentence | denotes | Alternatively, activated GR interacts with coactivator molecules to suppress the expression of inflammatory genes by inhibiting the action of proinflammatory transcription factors such as nuclear factor-κB (NF-κB) through the recruitment of co-repressor molecules such as histone deacetylase-2 [17],[18]. |
T1310 | 10155-10407 | Sentence | denotes | Nuclear localisation and retention of GR is mediated through the nuclear localisation sequences NL1 and NL2 [19], by nuclear retention signals [20], and by control of nuclear export via a chromosomal region maintenance 1 (CRM-1) dependent pathway [21]. |
T1311 | 10408-10472 | Sentence | denotes | NL1, which is similar to the SV40 NLS, binds to importin-α [22]. |
T1312 | 10473-10644 | Sentence | denotes | NL1 is activated both by glucocorticoid agonists such as dexamethasone and fluticasone propionate (FP) and by glucocorticoid antagonists such as mifepristone (RU486) [23]. |
T1313 | 10645-10837 | Sentence | denotes | NL1 can be mutated, and the resulting GR still translocates to the nucleus in response to ligands, but via interaction with importin 7, an event that requires an as-yet unknown component [23]. |
T1314 | 10838-10961 | Sentence | denotes | NL2 is poorly defined, residing in the ligand-binding domain, and much less is known about its mechanism of GR import [24]. |
T1315 | 10962-11230 | Sentence | denotes | A variety of other factors are also important for the regulation of GR activation and nuclear import including chaperones such as Hsp90 and other immunophilins [24]–[26] and FK506-binding proteins that may be linked to dynein and/or peptidylprolyl isomerase [27],[28]. |
T1316 | 11231-11499 | Sentence | denotes | However, the molecular basis for the inhibition of Th2 cytokines by corticosteroids is not well understood, because the genes encoding IL-4, IL-5, and IL-13 do not have any recognisable GRE sequence [29] and are only partly regulated by NF-κB in human cells [30]–[32]. |
T1317 | 11500-11670 | Sentence | denotes | Using overexpression and CAT-reporter genes, Lavender and colleagues [33] have shown that GR reduced GATA-3-mediated IL-5 and -13 promoter activity in human CD4+ T cells. |
T1318 | 11671-11897 | Sentence | denotes | The authors postulated that local recruitment of GR may alter the ability of GATA-3 either to bind to its target site, to cause transcriptional up-regulation, or to maintain an environment that is permissive for transcription. |
T1319 | 11898-12158 | Sentence | denotes | We therefore investigated the effects of a synthetic corticosteroid, FP, on GATA-3 phosphorylation and nuclear translocation in a T lymphocyte cell line (HuT-78) and in peripheral blood mononuclear cells activated by anti-CD3 and anti-CD28 antibodies in vitro. |
T1320 | 12159-12325 | Sentence | denotes | We also studied the effects of inhaled fluticasone therapy on GATA-3 subcellular localization in peripheral blood mononuclear cells (PBMCs) from patients with asthma. |
T4349 | 13960-13991 | Sentence | denotes | Cell Culture and PBMC Isolation |
T4350 | 13992-14141 | Sentence | denotes | A human T cell line (HuT-78) was purchased from ECACC European Collection of Cell Culture (Wiltshire, UK) were cultured as previously described [12]. |
T4351 | 14142-14295 | Sentence | denotes | PBMCs were isolated by density centrifugation over Ficoll-Hypaque (density, 1.077 g/ml; Amersham Biosciences, Amersham, UK) as previously described [34]. |
T4352 | 14296-14452 | Sentence | denotes | Cells were stimulated with anti-CD3/CD28 (1 µg/ml each) for 1 h at 37°C to stimulate Th2 cytokine release in the presence or absence of FP (10−12 to 10−8M). |
T4353 | 14453-14564 | Sentence | denotes | Cytospins were prepared and GATA-3 localization determined by confocal microscopy as previously described [12]. |
T6774 | 19780-19800 | Sentence | denotes | GATA-3-GFP Construct |
T6775 | 19801-19950 | Sentence | denotes | The GATA-3 clone (BC003070) complete cDNA was obtained from Invitrogen Life Technologies as a 5′- EcoRI/3′-XhoI insert of GATA-3 in the pOTB7 vector. |
T6776 | 19951-20081 | Sentence | denotes | GATA-3 was excised from pOTB7 using XhoI digestion and pEGFP-C2 (Clontech, Saint-Germain-en-Laye, France) was digested with BamHI. |
T6777 | 20082-20606 | Sentence | denotes | DNA was recovered by phenol extraction and ethanol precipitation, and both the GATA-3 fragment and the pEGFP-C2 vector blunt-ended by incubation with Klenow (Bioline Bio-27029) for 30 min at 37°C. Klenow was inactivated by incubation for 10 min at 75°C. DNA was recovered by phenol extraction and ethanol precipitation, and both the blunt-ended GATA-3 fragment and the GFP vector were subsequently digested with EcoRI before the 5′-EcoRI/3′–blunt end GATA-3 fragment was inserted into the 5′-EcoRI/3′–blunt ended GFP vector. |
T6778 | 20607-20721 | Sentence | denotes | Positive clones were confirmed by digestion and size analysis by 1% agarose gel electrophoresis and by sequencing. |
T1 | 0-57 | Sentence | denotes | Suppression of GATA-3 Nuclear Import and Phosphorylation: |
T2 | 58-159 | Sentence | denotes | A Novel Mechanism of Corticosteroid Action in Allergic Disease Steroid Suppression of GATA-3 Function |
T3 | 162-327 | Sentence | denotes | Peter Barnes and colleagues show that corticosteroids have a potent inhibitory effect on GATA-3 via two interacting mechanisms that suppress Th2 cytokine expression. |
T4 | 328-444 | Sentence | denotes | This novel mechanism of corticosteroid action may help explain the efficacy of corticosteroids in allergic diseases. |
T5 | 446-454 | Sentence | denotes | Abstract |
T6 | 455-465 | Sentence | denotes | Background |
T7 | 466-658 | Sentence | denotes | GATA-3 plays a critical role in regulating the expression of the cytokines interleukin (IL)-4, IL-5, and IL-13 from T helper-2 (Th2) cells and therefore is a key mediator of allergic diseases. |
T8 | 659-774 | Sentence | denotes | Corticosteroids are highly effective in suppressing allergic inflammation, but their effects on GATA-3 are unknown. |
T9 | 775-912 | Sentence | denotes | We investigated the effect of the corticosteroid fluticasone propionate on GATA-3 regulation in human T-lymphocytes in vitro and in vivo. |
T10 | 914-934 | Sentence | denotes | Methods and Findings |
T11 | 935-1374 | Sentence | denotes | In a T lymphocyte cell line (HuT-78) and peripheral blood mononuclear cells stimulated by anti-CD3 and anti-CD28 in vitro we demonstrated that fluticasone inhibits nuclear translocation of GATA-3 and expression of Th2 cytokines via a mechanism independent of nuclear factor-κB and is due, in part, to competition between GATA-3 and the ligand-activated glucocorticoid receptor for nuclear transport through the nuclear importer importin-α. |
T12 | 1375-1579 | Sentence | denotes | In addition, fluticasone induces the expression of mitogen-activated protein kinase (MAPK) phosphatase-1 (MKP-1), the endogenous inhibitor of p38 MAPK, which is necessary for GATA-3 nuclear translocation. |
T13 | 1580-1653 | Sentence | denotes | These inhibitory effects of fluticasone are rapid, potent, and prolonged. |
T14 | 1654-1802 | Sentence | denotes | We also demonstrated that inhaled fluticasone inhibits GATA-3 nuclear translocation in peripheral blood lymphocytes of patients with asthma in vivo. |
T15 | 1804-1815 | Sentence | denotes | Conclusions |
T16 | 1816-1952 | Sentence | denotes | Corticosteroids have a potent inhibitory effect on GATA-3 via two interacting mechanisms that potently suppress Th2 cytokine expression. |
T17 | 1953-2107 | Sentence | denotes | This novel mechanism of action of corticosteroids may account for the striking clinical efficacy of corticosteroids in the treatment of allergic diseases. |
T18 | 2109-2161 | Sentence | denotes | Please see later in the article for Editors' Summary |
T19 | 2163-2179 | Sentence | denotes | Editors' Summary |
T20 | 2181-2191 | Sentence | denotes | Background |
T21 | 2192-2279 | Sentence | denotes | The immune system protects the human body from viruses, bacteria, parasites, and fungi. |
T22 | 2280-2555 | Sentence | denotes | When one of these foreign invaders enters the body, immune system cells called T lymphocytes recognize specific molecules on the invader's surface and release chemical messengers (cytokines) that recruit and activate other types of immune cell, which then attack the invader. |
T23 | 2556-2787 | Sentence | denotes | Sometimes, however, the immune system responds to a normally harmless material (for example, house-dust mites or grass pollen; scientists call these materials allergens) and triggers an allergic disease such as asthma or hay fever. |
T24 | 2788-2974 | Sentence | denotes | Contact with an allergen activates a type of T lymphocyte called a T helper-2 (Th2) cell that subsequently makes (expresses) three cytokines called interleukin-4 (IL-4), IL-5, and IL-13. |
T25 | 2975-3080 | Sentence | denotes | These cytokines ultimately cause inflammation (swelling) of the part of the body exposed to the allergen. |
T26 | 3081-3213 | Sentence | denotes | Corticosteroids, which suppress the expression of cytokines by Th2 cells, are often used to treat inflammation in allergic diseases. |
T27 | 3214-3455 | Sentence | denotes | Other treatments for these common conditions—about 50 million people in the US have an allergic disease—include minimizing exposure to allergens and diminishing the response of the immune system to allergens by using various immunotherapies. |
T28 | 3457-3481 | Sentence | denotes | Why Was This Study Done? |
T29 | 3482-3626 | Sentence | denotes | Scientists know that corticosteroids reduce allergic inflammation by binding to proteins in immune system cells called glucocorticoid receptors. |
T30 | 3627-3828 | Sentence | denotes | After binding to a corticosteroid, these receptors move into the nucleus of the cell (the part of the cell that contains its genes), where they suppress the expression of certain proinflammatory genes. |
T31 | 3829-3920 | Sentence | denotes | However, it is still not known how corticosteroids inhibit the expression of Th2 cytokines. |
T32 | 3921-4043 | Sentence | denotes | A key regulator of the expression of these cytokines and of allergic inflammation is a transcription factor called GATA-3. |
T33 | 4044-4188 | Sentence | denotes | Transcription factors are proteins that control the expression of other proteins by binding to specific sequences in the genes that encode them. |
T34 | 4189-4413 | Sentence | denotes | In this study, the researchers try to discover more about how corticosteroids reduce allergic inflammation by investigating the effects of the corticosteroid fluticasone on the regulation of GATA-3 activity in T lymphocytes. |
T35 | 4415-4452 | Sentence | denotes | What Did the Researchers Do and Find? |
T36 | 4453-4692 | Sentence | denotes | Transcription factors have to move into the nucleus of cells (so-called nuclear translocation) to control the expression of their target genes, so the researchers first asked whether fluticasone affects the cellular localization of GATA-3. |
T37 | 4693-4856 | Sentence | denotes | Fluticasone treatment of activated T lymphocytes growing in dishes, they report, inhibited the nuclear translocation of GATA-3 and reduced Th2 cytokine expression. |
T38 | 4857-5108 | Sentence | denotes | Other experiments showed that the inhibition of GATA-3 nuclear translocation was partly caused by competition between the glucocorticoid receptor bound to fluticasone and GATA-3 for binding to importin-α, a protein that is required for nuclear import. |
T39 | 5109-5197 | Sentence | denotes | However, fluticasone also prevented the nuclear translocation of GATA-3 in a second way. |
T40 | 5198-5298 | Sentence | denotes | Before GATA-3 can bind to importin-α, phosphate groups have to be added to specific sites in GATA-3. |
T41 | 5299-5522 | Sentence | denotes | This “phosphorylation” requires an enzyme called p38 MAP kinase, and the researchers found that fluticasone treatment of activated T lymphocytes induced the expression of MAP kinase phophatase-1, a p38 MAP kinase inhibitor. |
T42 | 5523-5745 | Sentence | denotes | Finally, when the researchers treated seven patients with mild asthma with inhaled fluticasone, they found that fluticasone also inhibited GATA-3 nuclear translocation in the lymphocytes circulating in the patients' blood. |
T43 | 5747-5775 | Sentence | denotes | What Do These Findings Mean? |
T44 | 5776-5983 | Sentence | denotes | These findings, obtained both in the laboratory and in patients, suggest that corticosteroids inhibit the expression of Th2 cytokines and thus reduce allergic inflammation through two interacting mechanisms. |
T45 | 5984-6263 | Sentence | denotes | They suggest that corticosteroids prevent the nuclear translocation of GATA-3, a key regulator of Th2 cytokine expression, by competing with GATA-3 for binding to importin-α and by preventing the phosphorylation of GATA-3, a modification that allows GATA-3 to bind to importin-α. |
T46 | 6264-6584 | Sentence | denotes | This dual mechanism of corticosteroid action may help to explain why these drugs are so effective in the treatment of allergic diseases, although further experiments are needed to show that the lymphocytes resident at sites of allergic inflammation respond to corticosteroids in the same way as lymphocytes in the blood. |
T47 | 6585-6752 | Sentence | denotes | Finally, these findings suggest that the interaction between phosphorylated GATA-3 and importin-α might be a potential target for new treatments for allergic diseases. |
T48 | 6754-6776 | Sentence | denotes | Additional Information |
T49 | 6777-6896 | Sentence | denotes | Please access these Web sites via the online version of this summary at http://dx.doi.org/10.1371/journal.pmed.1000076. |
T50 | 6897-7228 | Sentence | denotes | The US National Institute of Allergy and Infectious Diseases provides information on allergic diseases and a simple description of the immune system The UK National Health Service Choices service provides information about allergies Links to other information about allergies are available from MedlinePlus (in English and Spanish) |
T51 | 7233-7245 | Sentence | denotes | Introduction |
T52 | 7246-7436 | Sentence | denotes | Inflammation in allergic diseases such as asthma, rhinitis, and atopic dermatitis is mediated via expression of the cytokines interleukin (IL)-4, IL-5, and IL-13 from T helper-2 (Th2) cells. |
T53 | 7437-7566 | Sentence | denotes | IL-4 and IL-13 regulate the expression of IgE from B lymphocytes, whereas IL-5 plays a key role in eosinophilic inflammation [1]. |
T54 | 7567-7697 | Sentence | denotes | Th2 cytokines are regulated by the zinc finger transcription factor GATA-3, which is predominantly expressed in Th2 cells [2],[3]. |
T55 | 7698-7844 | Sentence | denotes | GATA-3 determines Th2 cell differentiation and selectively activates the promoters of IL-4, IL-5, and IL-13 through chromatin remodelling [4]–[7]. |
T56 | 7845-8103 | Sentence | denotes | The key role of GATA-3 in allergic airway inflammation has been demonstrated in mice by the reduced release of Th2 cytokines in animals treated with dominant-negative mutants of GATA-3 and by local application of antisense oligonucleotides to GATA-3 [8],[9]. |
T57 | 8104-8308 | Sentence | denotes | Furthermore, conditional knock-out of the Gata3 gene in mice reduces expression of Th2 cytokines in vitro and in vivo [10], and similar results have been reported in isolated murine CD4+ lymphocytes [11]. |
T58 | 8309-8449 | Sentence | denotes | Finally, knockdown of GATA-3 expression using siRNA in human T cells results in loss of anti-CD3/CD28-mediated Th2 cytokine expression [12]. |
T59 | 8450-8582 | Sentence | denotes | In order for GATA-3 to regulate gene expression, it must translocate from the cytoplasm into the nucleus to access its target genes. |
T60 | 8583-8807 | Sentence | denotes | Enhanced nuclear expression of GATA-3 following T cell receptor activation was first demonstrated in murine T cells [13] and was recently confirmed in human T cells following T cell receptor and co-receptor stimulation [12]. |
T61 | 8808-8975 | Sentence | denotes | GATA-3 contains a classical nuclear import signal [14] and is transported into the nucleus by the nuclear import protein importin-α (also known as karyopherin-α) [12]. |
T62 | 8976-9134 | Sentence | denotes | Deletion of a region encompassing the GATA-3 nuclear localisation sequence (NLS) region in murine and human cells prevents its nuclear localisation [12],[14]. |
T63 | 9135-9425 | Sentence | denotes | The affinity of the importin-α–NLS interaction is regulated by phosphorylation [15], and we have shown that p38 mitogen-activated protein kinase (MAPK) plays a critical role in phosphorylating GATA-3 to enhance its interaction with importin-α and subsequent transport into the nucleus [12]. |
T64 | 9426-9587 | Sentence | denotes | Corticosteroids are highly effective in the treatment of allergic inflammation, with marked suppression of Th2 cytokines in airways of patients with asthma [16]. |
T65 | 9588-9849 | Sentence | denotes | Corticosteroids mediate their anti-inflammatory effects through binding to glucocorticoid receptors (GRs), which then translocate to the nucleus where they interact with glucocorticoid response elements (GREs) in the promoter regions of steroid-sensitive genes. |
T66 | 9850-10154 | Sentence | denotes | Alternatively, activated GR interacts with coactivator molecules to suppress the expression of inflammatory genes by inhibiting the action of proinflammatory transcription factors such as nuclear factor-κB (NF-κB) through the recruitment of co-repressor molecules such as histone deacetylase-2 [17],[18]. |
T67 | 10155-10407 | Sentence | denotes | Nuclear localisation and retention of GR is mediated through the nuclear localisation sequences NL1 and NL2 [19], by nuclear retention signals [20], and by control of nuclear export via a chromosomal region maintenance 1 (CRM-1) dependent pathway [21]. |
T68 | 10408-10472 | Sentence | denotes | NL1, which is similar to the SV40 NLS, binds to importin-α [22]. |
T69 | 10473-10644 | Sentence | denotes | NL1 is activated both by glucocorticoid agonists such as dexamethasone and fluticasone propionate (FP) and by glucocorticoid antagonists such as mifepristone (RU486) [23]. |
T70 | 10645-10837 | Sentence | denotes | NL1 can be mutated, and the resulting GR still translocates to the nucleus in response to ligands, but via interaction with importin 7, an event that requires an as-yet unknown component [23]. |
T71 | 10838-10961 | Sentence | denotes | NL2 is poorly defined, residing in the ligand-binding domain, and much less is known about its mechanism of GR import [24]. |
T72 | 10962-11230 | Sentence | denotes | A variety of other factors are also important for the regulation of GR activation and nuclear import including chaperones such as Hsp90 and other immunophilins [24]–[26] and FK506-binding proteins that may be linked to dynein and/or peptidylprolyl isomerase [27],[28]. |
T73 | 11231-11499 | Sentence | denotes | However, the molecular basis for the inhibition of Th2 cytokines by corticosteroids is not well understood, because the genes encoding IL-4, IL-5, and IL-13 do not have any recognisable GRE sequence [29] and are only partly regulated by NF-κB in human cells [30]–[32]. |
T74 | 11500-11670 | Sentence | denotes | Using overexpression and CAT-reporter genes, Lavender and colleagues [33] have shown that GR reduced GATA-3-mediated IL-5 and -13 promoter activity in human CD4+ T cells. |
T75 | 11671-11897 | Sentence | denotes | The authors postulated that local recruitment of GR may alter the ability of GATA-3 either to bind to its target site, to cause transcriptional up-regulation, or to maintain an environment that is permissive for transcription. |
T76 | 11898-12158 | Sentence | denotes | We therefore investigated the effects of a synthetic corticosteroid, FP, on GATA-3 phosphorylation and nuclear translocation in a T lymphocyte cell line (HuT-78) and in peripheral blood mononuclear cells activated by anti-CD3 and anti-CD28 antibodies in vitro. |
T77 | 12159-12325 | Sentence | denotes | We also studied the effects of inhaled fluticasone therapy on GATA-3 subcellular localization in peripheral blood mononuclear cells (PBMCs) from patients with asthma. |
T78 | 12327-12348 | Sentence | denotes | Materials and Methods |
T79 | 12350-12379 | Sentence | denotes | Participants and Study Design |
T80 | 12380-12577 | Sentence | denotes | We studied patients with mild asthma who were not treated with inhaled corticosteroids who had been included in a previously reported double-blind, placebo-controlled, crossover study with FP [34]. |
T81 | 12578-12827 | Sentence | denotes | Seven patients with mild asthma entered the study and were randomized to receive a single inhalation of FP (100 and 500 µg) or a matched placebo control via a spacer chamber, and the other treatment was given after a wash-out period of at least 6 d. |
T82 | 12828-12908 | Sentence | denotes | Blood was taken for preparation of PBMCs at 1 and 2 h after drug administration. |
T83 | 12909-13051 | Sentence | denotes | All patients gave informed consent and the study was approved by the Ethics Committee of the Royal Brompton and Harefield Hospitals NHS Trust. |
T84 | 13052-13140 | Sentence | denotes | The clinical study was conducted before the requirement for Clinical Trial Registration. |
T85 | 13142-13165 | Sentence | denotes | Antibodies and Reagents |
T86 | 13166-13296 | Sentence | denotes | The monoclonal antibodies against human CD3, CD28, GR, and importin-α were purchased from BD Biosciences (Oxford, United Kingdom). |
T87 | 13297-13785 | Sentence | denotes | Rabbit antibodies against human GATA-3 (H-48) and GR (E-20, sc-1003) were obtained from Santa Cruz Biotechnology (Santa Cruz, California, United States), polyclonal rabbit antibodies against phospho-p38 MAP kinase and phospho-ATF-2 from Cell Signaling Technology (New England Biolabs, Hertford, UK), monoclonal antibody against phosphoserine (clone 4H4) from Affiniti Research Products (Exeter, UK), and antibodies against rabbit IgG-conjugated TRITC from Dako Cytomation (Cambridge, UK). |
T88 | 13786-13900 | Sentence | denotes | The anti-GR antibody (Clone 41) from BD Transduction Laboratories (Oxford, UK) was used for Western blot analysis. |
T89 | 13901-13958 | Sentence | denotes | All other reagents were purchased from Sigma (Poole, UK). |
T90 | 13960-13991 | Sentence | denotes | Cell Culture and PBMC Isolation |
T91 | 13992-14141 | Sentence | denotes | A human T cell line (HuT-78) was purchased from ECACC European Collection of Cell Culture (Wiltshire, UK) were cultured as previously described [12]. |
T92 | 14142-14295 | Sentence | denotes | PBMCs were isolated by density centrifugation over Ficoll-Hypaque (density, 1.077 g/ml; Amersham Biosciences, Amersham, UK) as previously described [34]. |
T93 | 14296-14452 | Sentence | denotes | Cells were stimulated with anti-CD3/CD28 (1 µg/ml each) for 1 h at 37°C to stimulate Th2 cytokine release in the presence or absence of FP (10−12 to 10−8M). |
T94 | 14453-14564 | Sentence | denotes | Cytospins were prepared and GATA-3 localization determined by confocal microscopy as previously described [12]. |
T95 | 14566-14591 | Sentence | denotes | Reverse Transcription PCR |
T96 | 14592-14669 | Sentence | denotes | Total RNA was extracted using lysis buffer (RNeasy kit; Qiagen, Crawley, UK). |
T97 | 14670-14765 | Sentence | denotes | During RNA purification, genomic DNA was digested with RNase-free DNase (Amersham Biosciences). |
T98 | 14766-14884 | Sentence | denotes | Next, 0.5 µg of total RNA was reversed transcribed using the avian myeloblastosis virus RT (Promega, Southampton, UK). |
T99 | 14885-14955 | Sentence | denotes | For relative quantification, RT-PCR was carried out using cDNA probes. |
T100 | 14956-15013 | Sentence | denotes | Primers for IL-4 were from Sigma-Genosys (Cambridge, UK). |
T101 | 15014-15125 | Sentence | denotes | Sequences of GADPH used are as follows: forward 5′-CCACCCATGGCAAATTCCATGGC, reverse 3′-TCTAGACGGCAGGTCAGGTCCAC. |
T102 | 15127-15193 | Sentence | denotes | Cell Fractionation, Immunoprecipitation, and Western Blot Analysis |
T103 | 15194-15271 | Sentence | denotes | Nuclear and cytoplasmic fractions were prepared as previously described [35]. |
T104 | 15272-15441 | Sentence | denotes | Whole cell lysates were prepared in NP-40 lysis buffer (0.5% Nonidet P-40, 20 mM Tris-HCl [pH 7.5], 150 mM NaCl) in the presence of complete protease cocktail inhibitor. |
T105 | 15442-15557 | Sentence | denotes | Lysates were centrifuged at 4°C for 10 min at 12,000 rpm in an Eppendorf microcentrifuge to remove cellular debris. |
T106 | 15558-15809 | Sentence | denotes | Samples were then immunoprecipitated with either 10 µl of antibody against GATA-3 or importin-α using A/G agarose slurry in the presence of protease inhibitor using the Catch and Release methodology (Upstate Biotechnology, Lake Placid, New York, USA). |
T107 | 15810-15946 | Sentence | denotes | Western blot analysis was performed using anti-GATA-3, anti-importin-α, anti-GR, anti-p-p38 MAP kinase, anti-p-ATF-2, and anti-p-serine. |
T108 | 15947-16052 | Sentence | denotes | Immunoreactive proteins were detected using an enhanced chemiluminescence ECL kit (Amersham Biosciences). |
T109 | 16054-16083 | Sentence | denotes | Chromatin Immunoprecipitation |
T110 | 16084-16332 | Sentence | denotes | Chromatin immunoprecipitation (IP) was performed as previously described [12] in HuT-78 T-cells with 2 µg of anti-GATA-3 (Santa Cruz Biotechnology), or isotypic immunoglobulin G as a non-specific control (Santa Cruz Biotechnology) overnight at 4°C. |
T111 | 16333-16467 | Sentence | denotes | Promoter sequences were detected with PCR primers for the IL-5 promoter (−445 to +4): forward 5′-TTAATCTAGCCACAGTCATAG-3′ and reverse: |
T112 | 16468-16496 | Sentence | denotes | 5′-TCATGGCTCTGAAACGTTCTG-3′. |
T113 | 16497-16677 | Sentence | denotes | PCR was performed using a Hybaid Omnigene thermal cycler (Hybaid, Ashford, UK) with cycling parameters of 72°C for 10 min, 35 cycles at 94°C for 45 s, 52°C for 45 s, 72°C for 45 s. |
T114 | 16679-16750 | Sentence | denotes | GR-GATA-3 In Vitro Competition Assay for Importin-α (Far-Western ELISA) |
T115 | 16751-16926 | Sentence | denotes | Immunoprecipitated importin-α (anti-importin-α, Santa Cruz Biotechnology) from HuT-78 cells was separated by SDS-PAGE and purified from the excised gel by electroelution [36]. |
T116 | 16927-17109 | Sentence | denotes | Similarly, GATA-3 was isolated from nonstimulated HuT-78 cells or cells stimulated for 30 min with anti-CD3/CD28 and GR was isolated from FP (10−8 M, 30 min) stimulated HuT-78 cells. |
T117 | 17110-17172 | Sentence | denotes | These proteins were subsequently refolded in glycine solution. |
T118 | 17173-17292 | Sentence | denotes | 100 µl of importin-α solution (100 ng/ml in TBS) was added to 96-well plates coated with goat anti-importin-α antibody. |
T119 | 17293-17421 | Sentence | denotes | After 1 h incubation, GATA-3 (100 ng/ml in TBS) from stimulated or unstimulated cells were added to the importin-α-coated wells. |
T120 | 17422-17513 | Sentence | denotes | GR (10 or 100 ng/ml in TBS) from stimulated or unstimulated cells were added to some wells. |
T121 | 17514-17739 | Sentence | denotes | After a further 1 h incubation, the plate was washed and incubated with primary antibodies (a mixture of rabbit anti-GATA-3 and mouse anti-GR, Santa Cruz Biotechnology) for 1.5 h, and then incubated with secondary antibodies. |
T122 | 17740-17930 | Sentence | denotes | FITC swine anti-rabbit IgG (Dako, Cambridge, UK) was used for the detection of GATA-3, and rhodamine donkey anti-mouse IgG (Novus, Littleton, Colorado, USA) was used for the detection of GR. |
T123 | 17931-18031 | Sentence | denotes | FITC and rhodamine levels were measured with a fluorescent micro-plate reader (Bioline, London, UK). |
T124 | 18033-18049 | Sentence | denotes | NF-κB Activation |
T125 | 18050-18182 | Sentence | denotes | NF-κB binding activity in nuclear extracts was determined using an ELISA-based kit (Trans-AM p65, Active Motif, Rixensart, Belgium). |
T126 | 18183-18293 | Sentence | denotes | In brief, 5 µg of nuclear extracts were incubated with a plate coated with an NF-κB consensus oligonucleotide. |
T127 | 18294-18353 | Sentence | denotes | Plates were washed before addition of an anti-p65 antibody. |
T128 | 18354-18458 | Sentence | denotes | Antibody binding was detected with a secondary HRP-conjugated antibody and developed with TMB substrate. |
T129 | 18459-18512 | Sentence | denotes | The intensity of the reaction was measured at 450 nm. |
T130 | 18514-18541 | Sentence | denotes | Immunofluorescence Staining |
T131 | 18542-18613 | Sentence | denotes | Immunofluorescence staining was performed as previously described [34]. |
T132 | 18614-18686 | Sentence | denotes | All staining was performed at room temperature and under humidification. |
T133 | 18687-18786 | Sentence | denotes | Cells were collected and cytospins prepared in a cytocentrifuge (Shandon II, Shandon, Runcorn, UK). |
T134 | 18787-18971 | Sentence | denotes | Cells were permeabilized, blocked, and then incubated with GR (1∶50 E-20 Santa Cruz Biotechnology) or anti-GATA-3 (H-48; Santa Cruz Biotechnology) antibody for 1 h at room temperature. |
T135 | 18972-19127 | Sentence | denotes | After three washes in phosphate-buffered saline (PBS), cells were incubated with tetrarhodamine isothiocyanate–conjugated goat anti-rabbit antibody (Dako). |
T136 | 19128-19304 | Sentence | denotes | Cytospins were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI), a fluorescent blue nuclear indole chromatin stain, and mounted in PBS:glycerol (50∶50). |
T137 | 19305-19508 | Sentence | denotes | The immunopositive signal was characterised using laser scanning confocal microscopy on a Leica TCS NT/SP interactive laser cytometer equipped with confocal optics (Leica Microsystems, Wetzlar, Germany). |
T138 | 19509-19659 | Sentence | denotes | To determine the specificity of the antibodies, rabbit serum immunoglobulin (Dako) and secondary antibodies without the primary were used as controls. |
T139 | 19660-19778 | Sentence | denotes | Positively stained nuclei and total cells were counted (500) on each slide with the observer blinded to the treatment. |
T140 | 19780-19800 | Sentence | denotes | GATA-3-GFP Construct |
T141 | 19801-19950 | Sentence | denotes | The GATA-3 clone (BC003070) complete cDNA was obtained from Invitrogen Life Technologies as a 5′- EcoRI/3′-XhoI insert of GATA-3 in the pOTB7 vector. |
T142 | 19951-20081 | Sentence | denotes | GATA-3 was excised from pOTB7 using XhoI digestion and pEGFP-C2 (Clontech, Saint-Germain-en-Laye, France) was digested with BamHI. |
T143 | 20082-20278 | Sentence | denotes | DNA was recovered by phenol extraction and ethanol precipitation, and both the GATA-3 fragment and the pEGFP-C2 vector blunt-ended by incubation with Klenow (Bioline Bio-27029) for 30 min at 37°C. |
T144 | 20279-20335 | Sentence | denotes | Klenow was inactivated by incubation for 10 min at 75°C. |
T145 | 20336-20606 | Sentence | denotes | DNA was recovered by phenol extraction and ethanol precipitation, and both the blunt-ended GATA-3 fragment and the GFP vector were subsequently digested with EcoRI before the 5′-EcoRI/3′–blunt end GATA-3 fragment was inserted into the 5′-EcoRI/3′–blunt ended GFP vector. |
T146 | 20607-20721 | Sentence | denotes | Positive clones were confirmed by digestion and size analysis by 1% agarose gel electrophoresis and by sequencing. |
T147 | 20723-20735 | Sentence | denotes | Transfection |
T148 | 20736-21007 | Sentence | denotes | HuT-78 cells were transfected with either EP8 or GFP vector only DNA using solution R, programme V-001 at a ratio of 3×106 cells/4 µg DNA for 7–8 h in complete medium (10% bovine serum in RPMI1640+15 L-glutamine) according to the general Amaxa protocol for nucleofection. |
T149 | 21008-21171 | Sentence | denotes | The medium was subsequently changed to 1% RPMI for 24 h before transfected cells were added to anti-CD3/CD28 treated wells and live cell videomicroscopy performed. |
T150 | 21173-21194 | Sentence | denotes | Time-Lapse Microscopy |
T151 | 21195-21463 | Sentence | denotes | HuT-78 cells expressing GATA-3-GFP were maintained at 37°C in growth medium in a closed FCS2 perfusion chamber (Bioptechs, Butler, Pennsylvania, USA) combined with an objective heater (Bioptechs) on the stage a Zeiss Axiovert 200 microscope (Thornwood, New York, USA). |
T152 | 21464-21729 | Sentence | denotes | Observations were made by 40×1.0 NA oil-immersion objective lens, and fluorescence and phase contrast images were gathered using a Hamamatsu ORCA-ER charged coupled device camera (Bridgewater, New Jersey, USA) driven by Openlab software (Improvision, Coventry, UK). |
T153 | 21730-21784 | Sentence | denotes | Photographs were taken at 0, 30, 60, 120, and 240 min. |
T154 | 21786-21808 | Sentence | denotes | Densitometric Analysis |
T155 | 21809-21938 | Sentence | denotes | Densitometry of ECL immunoblots was performed using Gelworks ID intermediate software (Ultraviolet Products, Cambridgeshire, UK). |
T156 | 21939-22019 | Sentence | denotes | Briefly, immunoblots were scanned and gates were drawn tightly around each band. |
T157 | 22020-22099 | Sentence | denotes | Background values from each lane were subtracted to normalize each measurement. |
T158 | 22100-22154 | Sentence | denotes | The bands were quantified using the Gelworks software. |
T159 | 22155-22326 | Sentence | denotes | All Western blots were exposed to film for varying lengths of time, and only films generating subsaturating levels of intensity were selected for densitometric evaluation. |
T160 | 22328-22348 | Sentence | denotes | Statistical Analysis |
T161 | 22349-22563 | Sentence | denotes | Data from three or more independent experiments are presented as the mean±standard error of the mean (SEM), except where stated and were compared using GraphPad Prism 4 (GraphPad Software, http://www.graphpad.com). |
T162 | 22564-22787 | Sentence | denotes | Results were analysed using one-way ANOVA with Newman-Keuls post test except for the data from the in vivo inhaled FP study, which was analysed by Friedman's test with subsequent Wilcoxson matched pair signed rank sum test. |
T163 | 22788-22853 | Sentence | denotes | Data from this analysis are presented as a box-and-whiskers plot. |
T164 | 22854-23003 | Sentence | denotes | Friedman's test was used as three matched measures were obtained using placebo, 100 µg, and 500 µg of inhaled FP, which had variable baseline levels. |
T165 | 23004-23161 | Sentence | denotes | We did not assume a Gaussian distribution of the data due to the limited numbers of participants analysed (seven).The null hypothesis was rejected at p<0.05. |
T166 | 23163-23170 | Sentence | denotes | Results |
T167 | 23172-23247 | Sentence | denotes | The Effect of Corticosteroids on GATA-3 Nuclear Translocation and IL-4 mRNA |
T168 | 23248-23356 | Sentence | denotes | Corticosteroids are effective in inhibiting GATA-3-regulated IL-4 gene expression in vitro and in vivo [32]. |
T169 | 23357-23464 | Sentence | denotes | We therefore investigated whether corticosteroids affect anti-CD3/CD28–stimulated nuclear import of GATA-3. |
T170 | 23465-23616 | Sentence | denotes | Stimulation of cells with anti-CD3/CD28 resulted in a rapid cytoplasmic/nuclear GATA-3 translocation (Figure 1A), confirming our previous results [12]. |
T171 | 23617-23746 | Sentence | denotes | We also confirmed a clear separation of nuclear and cytosolic fractions as indicated by histone H1 and MEK-1 markers (Figure 1B). |
T172 | 23747-23958 | Sentence | denotes | The potent topical corticosteroid FP caused sustained loss of nuclear GATA-3 expression and cytoplasmic retention of GATA-3 at concentrations ranging from 10−12 to 10−8 M, which cover the therapeutic range [37]. |
T173 | 23959-24274 | Sentence | denotes | This effect was concentration- and time-dependent, with a peak effect of 11.6-fold at 30 min at a concentration of 10−8 M (Figure 1C) and was associated with marked reductions in anti-CD3/CD28–stimulated IL-4 and IL-5 mRNA expression (Figure 1D) and a loss of GATA-3 binding to the native IL-5 promoter (Figure 1E). |
T174 | 24275-24421 | Sentence | denotes | 10.1371/journal.pmed.1000076.g001 Figure 1 Fluticasone propionate down-regulates Th2 cytokine gene expression and inhibits GATA-3 nuclear import. |
T175 | 24422-24921 | Sentence | denotes | (A) Anti-CD3/CD28 treatment of HuT-78 cells results in translocation of GATA-3 from the cytoplasm to the nucleus within 30 min. (B) Histone H1 and MEK-1 were used to confirm distinct separation of cytoplasmic and nuclear extracts in three separate experiments. (C) Western blot analysis of FP-treated HuT-78 cells demonstrated impaired nuclear localization of GATA-3 induced by anti-CD3/CD28 co-stimulation in a time- (at 10−8 M FP) and concentration- (at 60 min after stimulation) dependent manner. |
T176 | 24922-24984 | Sentence | denotes | Cells were pretreated with FP for 30 min prior to stimulation. |
T177 | 24985-25081 | Sentence | denotes | MEK1 and histone H1 were used to demonstrate equal cytoplasmic and nuclear loading respectively. |
T178 | 25082-25305 | Sentence | denotes | Results are presented graphically below as mean±SEM of at least three independent experiments. *** p<0.001 compared to t = 0. (D) RT-PCR showing that FP inhibits IL-4 and IL-5 mRNA expression in CD3/CD28-costimulated cells. |
T179 | 25306-25342 | Sentence | denotes | GAPDH was used as a loading control. |
T180 | 25343-25676 | Sentence | denotes | Lower panels show graphical analysis of results presented as mean±SEM of at least three independent experiments. ### p<0.001 compared to control, ***p<0.001 compared to anti-CD3/CD28–stimulated. (E) FP (10 nM) reduces the ability of anti-CD3/CD28-stimulated GATA-3 to associate with the native IL-5 promoter 60 min after stimulation. |
T181 | 25677-25754 | Sentence | denotes | Data are also shown graphically as mean±SEM of three independent experiments. |
T182 | 25755-25822 | Sentence | denotes | All data were analysed by ANOVA followed by Newman-Keuls post-test. |
T183 | 25824-25879 | Sentence | denotes | Ligand-Activated GR Competes with GATA-3 for Importin-α |
T184 | 25880-26034 | Sentence | denotes | We confirmed and extended previous data [20] to show that ligand-activated GR as well as GATA-3 uses importin-α for its nuclear import (Figure 2A and 2B). |
T185 | 26035-26161 | Sentence | denotes | This interaction between GR and importin-α was significant at concentrations as low as 10−12 M and was maximal with 10−8 M FP. |
T186 | 26162-26274 | Sentence | denotes | Subsequent GR nuclear translocation was rapid and sustained at significant levels for at least 14 h (Figure 2B). |
T187 | 26275-26476 | Sentence | denotes | Using IP-Western blotting we showed that FP at 10−12–10−8 M decreased the association between GATA-3 and importin-α induced by anti-CD3/CD28 stimulation in a concentration-dependent manner (Figure 2C). |
T188 | 26477-26690 | Sentence | denotes | In addition, using GFP-labelled GATA-3 and confocal microscopy we demonstrated that GATA-3 nuclear import following anti-CD3/CD28 stimulation for 30 min was attenuated by pretreatment with FP (10−8 M) (Figure 2D). |
T189 | 26691-26827 | Sentence | denotes | 10.1371/journal.pmed.1000076.g002 Figure 2 Fluticasone propionate reduces GATA-3 association with importin-α and GATA-3 nuclear import. |
T190 | 26828-27014 | Sentence | denotes | (A) Western blot analysis demonstrates a time- (at 10−8 M FP) and concentration- (at 60 min after stimulation) dependent induction of FP-activated GR interaction with importin-α (Imp-α). |
T191 | 27015-27076 | Sentence | denotes | A positive control for GR association with importin is shown. |
T192 | 27077-27132 | Sentence | denotes | Quantification of the densitometry data is shown below. |
T193 | 27133-27438 | Sentence | denotes | Each bar represents mean±SEM of at least three independent experiments. *** p<0.001 compared to control, ### p<0.001. (B) Western blot analysis demonstrated a time- (at 10−8 M FP) and concentration- (at 60 min after stimulation) dependent induction of FP-activated GR nuclear translocation measured by IP. |
T194 | 27439-27494 | Sentence | denotes | Quantification of the densitometry data is shown below. |
T195 | 27495-27781 | Sentence | denotes | Each bar represents mean±SEM of at least three independent experiments. ***p<0.001 compared to control. (C) Western blot analysis of HuT-78 cells treated with FP and anti-CD3/CD28 co-stimulation demonstrated a concentration-dependent decrease in GATA-3–importin-α association at 20 min. |
T196 | 27782-27837 | Sentence | denotes | Quantification of the densitometry data is shown below. |
T197 | 27838-28103 | Sentence | denotes | Each bar represents mean±SEM of at least three independent experiments. ### p<0.001 compared to control, ***p<0.001 compared to αCD3/CD28-stimulated cells. (D) GFP-tagged GATA-3 was overexpressed and cells stimulated (b, c) or not (a) for 30 min with anti-CD3/CD28. |
T198 | 28104-28181 | Sentence | denotes | The effect of 30 min pretreatment of cells with FP (10−8 M, c) is also shown. |
T199 | 28182-28249 | Sentence | denotes | All data were analysed by ANOVA followed by Newman-Keuls post-test. |
T200 | 28251-28266 | Sentence | denotes | Effect on MKP-1 |
T201 | 28267-28468 | Sentence | denotes | Dexamethasone inhibits p38 MAPK function in a cell type–specific manner through the rapid induction of the dual kinase phosphatase MKP-1 (MAPK phosphatase-1), and this effect lasts for up to 24 h [28]. |
T202 | 28469-28688 | Sentence | denotes | FP (10−8 M) treatment of HuT-78 cells activated by anti-CD3/CD28 in vitro significantly decreased p38 MAPK phosphorylation (Figure 3A) and activity measured by phosphorylation of the downstream target ATF-2 (Figure 3B). |
T203 | 28689-28765 | Sentence | denotes | This effect was detected at 30 min and lasted for at least 14 h (Figure 3B). |
T204 | 28766-28935 | Sentence | denotes | FP (10−8 M) also significantly reduced GATA-3 serine phosphorylation induced by anti-CD3/CD28 stimulation in both a time- and concentration-dependent manner (Figure 3C). |
T205 | 28936-29023 | Sentence | denotes | This reduction in GATA-3 phosphorylation was also seen with lower concentrations of FP. |
T206 | 29024-29187 | Sentence | denotes | We found that FP significantly induced MKP-1 mRNA in both a time- and concentration-dependent manner, reaching a plateau at 10−8 M after 10 min (Figure 3D and 3E). |
T207 | 29188-29358 | Sentence | denotes | However, the effects of FP on GATA-3 nuclear import, importin-α association and IL-4 mRNA expression are seen at 10,000-fold lower concentrations (10−12 M, see Figure 2). |
T208 | 29359-29572 | Sentence | denotes | 10.1371/journal.pmed.1000076.g003 Figure 3 Fluticasone propionate–mediated inhibition of p38 MAP kinase phosphorylation and activation is associated with a marked down-regulation of GATA-3 serine phosphorylation. |
T209 | 29573-30060 | Sentence | denotes | (A) Western blot analysis shows that FP (10−8 M, 30 min) treatment reduced dual phosphorylation (threonine-180 and tyrosine-182) of p38 MAPK in anti-CD3/CD28–co-stimulated HuT-78 cells. (B) Time course of the effect of FP (10−8 M) on phosphorylation of activated transcription factor 2 (ATF-2), a measure of p38 MAPK activity. (C) FP-induced inhibition of p38 MAPK activity is associated with the decrease of anti-CD3/CD28 co-stimulation–induced serine phosphorylation (P-Ser) of GATA-3. |
T210 | 30061-30126 | Sentence | denotes | For (A–C), quantification of the densitometry data is also shown. |
T211 | 30127-30345 | Sentence | denotes | Each bar represents mean±SEM of at least three independent experiments. ### p<0.001 compared to control, ***p<0.001 compared to αCD3/CD28-stimulated cells. (D) FP induced MKP-1 mRNA in a concentration-dependent manner. |
T212 | 30346-30527 | Sentence | denotes | All results are representative of at least three independent experiments and where appropriate expressed as means±SEM, *p<0.05. (E) FP induces MKP-1 mRNA in a time-dependent manner. |
T213 | 30528-30586 | Sentence | denotes | Results are representative of two independent experiments. |
T214 | 30587-30665 | Sentence | denotes | All data except (E) were analysed by ANOVA followed by Newman-Keuls post-test. |
T215 | 30668-30927 | Sentence | denotes | Using an in vitro competition assay (Figure 4A) utilizing purified activated GATA-3, importin-α, and activated GR, we demonstrated that activated GR significantly increased GR-importin-α association in the presence and absence of activated GATA-3 (Figure 4B). |
T216 | 30928-31030 | Sentence | denotes | This effect is not mutual, since activated GATA-3 did not block GR–importin-α association (Figure 4C). |
T217 | 31031-31271 | Sentence | denotes | These data also suggest that both activated GR and phospho-GATA-3 can directly associate with importin-α (Figure 4D) and that activated GR attenuates the phospho-GATA-3/importin-α interaction in a concentration-dependent manner (Figure 4E). |
T218 | 31272-31408 | Sentence | denotes | Together, this suggests that ligand-activated GR may compete with phospho-GATA-3 for importin-α and thereby limit GATA-3 nuclear import. |
T219 | 31409-31520 | Sentence | denotes | 10.1371/journal.pmed.1000076.g004 Figure 4 Fluticasone propionate competes with phospho-GATA-3 for importin-α. |
T220 | 31521-32365 | Sentence | denotes | (A) schematic representation of the in vitro binding competition assay. (B) GR isolated from FP (10−8 M) stimulated cells enhances GR–importin-α binding in the presence (•) and absence (▪) of activated GATA-3. * p<0.05 compared to no activated GR. (C) GATA-3 isolated from anti-CD3/CD28–stimulated cells does not attenuate GR–importin-α association. *p<0.05 compared to control. (D) Activated GR blocks the ability of purified phospho-GATA-3 isolated from anti-CD3/CD28–stimulated cells interacting with immobilised importin-α in an in vitro binding assay. *p<0.05 compared to GATA-3 isolated from unstimulated cells. # p<0.05 compared to stimulated GATA-3-importin binding. (E) The effect of activated (•) versus unstimulated (○) GR on attenuation of GATA-3–importin-α association was concentration-dependent. *p<0.05, **p<0.01 between groups. |
T221 | 32366-32494 | Sentence | denotes | All results are expressed as mean±SEM of three independent experiments and analysed by ANOVA followed by Newman-Keuls post-test. |
T222 | 32497-32617 | Sentence | denotes | Other possible interpretations of our results could include an effect of FP on GATA-3 nuclear export and/or degradation. |
T223 | 32618-32745 | Sentence | denotes | Leptomycin B, which inhibits nuclear export, did not affect the ability of FP to block GATA-3 nuclear localization (Figure 5A). |
T224 | 32746-32865 | Sentence | denotes | Additionally, FP had no effect on whole cell GATA-3 expression during the time course of these experiments (Figure 5B). |
T225 | 32866-33052 | Sentence | denotes | Nor did addition of FP subsequent to anti-CD3/CD28 nuclear translocation affect GATA-3 nuclear residency (Figure 5C), suggesting that activated GR does not enhance GATA-3 nuclear export. |
T226 | 33053-33217 | Sentence | denotes | Finally, the effect of FP on GATA-3 nuclear import was not nonspecific, since FP (10−8 M) had no effect on p65 nuclear translocation measured at 60 min (Figure 5D). |
T227 | 33218-33323 | Sentence | denotes | 10.1371/journal.pmed.1000076.g005 Figure 5 Fluticasone propionate does not affect GATA-3 nuclear export. |
T228 | 33324-33842 | Sentence | denotes | (A) Western blot analysis showing that the nuclear export inhibitor leptomycin B (2 nM) does not affect the ability of FP (10−8 M) to prevent anti-CD3/CD28–stimulated GATA-3 nuclear localization measured at 60 min. ***p<0.001 compared to unstimulated cells, ### p<0.001 compared to anti-CD3/CD28–stimulated cells. (B) Western blot analysis showing that FP (10−8 M) does not affect whole-cell GATA-3 degradation over 17 h. (C) GFP-tagged GATA-3 is overexpressed and cells stimulated (b–j) or not (a) with anti-CD3/CD28. |
T229 | 33843-34106 | Sentence | denotes | The effect of treating cells with FP (10−8 M, f–j) after 30 min stimulation with anti-CD3/CD28 is also shown. (D) FP (10−8 M) does not prevent anti-CD3/CD28–stimulated p65 nuclear translocation at 60 min after stimulation. **p<0.01 compared to unstimulated cells. |
T230 | 34107-34205 | Sentence | denotes | All results are representative of at least four independent experiments and are shown as mean±SEM. |
T231 | 34206-34267 | Sentence | denotes | Results were analysed by ANOVA followed by Newman-Keuls test. |
T232 | 34269-34385 | Sentence | denotes | The Inhibitory Effect of Corticosteroids on GATA-3 Nuclear Localization in Primary T Lymphocytes Ex Vivo and In Vivo |
T233 | 34386-34744 | Sentence | denotes | Treatment with FP ex vivo demonstrated a concentration-dependent decrease in the direct interaction between phospho-GATA-3 and importin-α in PBMCs from patients with asthma (Figure 6A and 6B), which was significantly inhibited at 10−12 M FP (p<0.001, ANOVA and Newman-Keuls test) and completely attenuated by 10−8 M FP (p<0.001, ANOVA and Newman-Keuls test). |
T234 | 34745-34907 | Sentence | denotes | 10.1371/journal.pmed.1000076.g006 Figure 6 Fluticasone propionate impairs GATA-3 interaction with importin-α and GATA-3 nuclear localization in vivo and ex vivo. |
T235 | 34908-35102 | Sentence | denotes | (A and B) Co-immunoprecipitation analysis of PBMCs from steroid-naïve asthma patients treated with FP in vitro demonstrated impaired interaction between GATA-3 and importin-α measured at 60 min. |
T236 | 35103-35464 | Sentence | denotes | Each bar represents the mean±SEM of at least three independent experiments; *** p<0.001 compared with control as determined by ANOVA/Newman-Keuls analysis. (C and D) Co-immunoprecipitation analyses of PBMCs from steroid-naïve asthma patients treated with inhaled FP (500 µg via a spacer) in vivo demonstrated decreased association between GATA-3 and importin-α. |
T237 | 35465-35635 | Sentence | denotes | The individual values for each treatment are presented graphically. (E) Representative Western blot showing that importin-α expression was unaffected by inhalation of FP. |
T238 | 35636-35691 | Sentence | denotes | Blot is representative of gels from three participants. |
T239 | 35694-35872 | Sentence | denotes | Our previous T cell line studies indicated that 10−12 M FP suppresses IL-4 and -5 gene expression and attenuated the interaction of GATA-3 with importin-α (see Figures 1D and 2). |
T240 | 35873-35994 | Sentence | denotes | This concentration is close to peak plasma levels obtained from asthmatic patients treated with inhaled FP (500 µg) [27]. |
T241 | 35995-36151 | Sentence | denotes | Inhaled FP (500 µg) treatment of seven steroid-naive asthma patients significantly reduced GATA-3–importin-α interaction in vivo in a time-dependent manner. |
T242 | 36152-36314 | Sentence | denotes | This produced a >90% decrease in GATA-3–importin-α association at 2 h (median [95% CI], 13,494 [6,828–17,829] versus 879 [597–1,165]; p<0.05 Friedman's analysis). |
T243 | 36315-36447 | Sentence | denotes | However, this did not reach significance using Wilcoxon's post-test analysis (W = 6.00) probably due to low numbers of participants. |
T244 | 36448-36545 | Sentence | denotes | Similar results were observed when GATA-3–importin-α association was measured (Figure 6C and 6D). |
T245 | 36546-36594 | Sentence | denotes | The lower dose of FP (100 µg) was not effective. |
T246 | 36595-36801 | Sentence | denotes | The attenuated interaction of GATA-3 did not result from the defective recycling of importin-α, as a significant decrease in the abundance of importin-α in the cytoplasmic pool was not detected (Figure 6E). |
T247 | 36802-36914 | Sentence | denotes | We further examined whether inhaled FP could affect cellular localization of GATA-3 in peripheral blood T cells. |
T248 | 36915-37265 | Sentence | denotes | Treatment with inhaled FP (500 µg) for 2 h significantly increased GR nuclear translocation (Figure 7A) and concomitantly decreased the number of nuclear GATA-3 immunoreactive peripheral blood T cells (37%±4.2% versus 58.2%±4.95%, p = 0.016, W = 28.0, Wilcoxon's rank test) compared with placebo as measured by immunocytochemistry (Figure 7A and 7B). |
T249 | 37266-37397 | Sentence | denotes | This was confirmed by Western blotting, which also indicated that this effect was both time- and dose-dependent (Figure 7C and 7D). |
T250 | 37398-37795 | Sentence | denotes | Thus, inhaled FP (500 µg) induced significant loss in nuclear GATA-3 at 2 h (median [95% CI], 0.40 [0.27–0.53] versus 0.14 [0.11–0.19], p<0.05, W = 21.00, Wilcoxon's rank test) (Figure 7C) and cytoplasmic GATA-3 levels were enhanced by inhaled FP in a dose-dependent manner (median [95% CI], 0.0032 [0.0026–0.0039] versus 0.658 [0.592–0.720], p<0.05, W = −21.00, Wilcoxon's rank test) (Figure 7D). |
T251 | 37796-37931 | Sentence | denotes | In addition, FP (500 µg) inhibited p38 MAPK phosphorylation in primary T cells in vivo at 2 h in samples from two patients (Figure 7E). |
T252 | 37932-38052 | Sentence | denotes | 10.1371/journal.pmed.1000076.g007 Figure 7 Inhaled fluticasone propionate impairs GATA-3 nuclear localization in PBMCs. |
T253 | 38053-38324 | Sentence | denotes | (A) Representative immunocytochemistry of showing the effect of inhaled FP (500 µg) on GR and GATA-3 nuclear localisation. (B) Nuclear GATA-3 immunoreactivity in PBMCs from seven steroid-naïve asthma patients 2 h following inhaled FP treatment (100 or 500 µg via spacer). |
T254 | 38325-38840 | Sentence | denotes | The median and interquartile ranges for each treatment are presented as a box-and-whiskers plot (n = 7); * p<0.05 Wilcoxon's rank test compared with placebo. (C) Immunoblotting analyses of PBMCs demonstrated a time-dependent decrease in nuclear expression of GATA-3, and increased cytoplasmic GATA-3 expression after inhalation of FP. (D) Immunoblotting analyses of PBMCs demonstrated a dose-dependent decrease in nuclear expression of GATA-3, and increased cytoplasmic GATA-3 expression 2 h after inhalation of FP. |
T255 | 38841-38975 | Sentence | denotes | Histone H1 and MEK-1 immunoblotting confirmed equivalent total protein loading for the nuclear and cytoplasmic fractions respectively. |
T256 | 38976-39337 | Sentence | denotes | Quantification of the densitometry data in (C) and (D) is shown as a box-and-whiskers plot of results from n = 6 participants for which data were available. *p<0.05 compared to control. (E) Western blot analyses of PBMCs demonstrated a time-dependent decrease in dual phosphorylation (threonine-180 and tyrosine-182) of p38 MAPK after inhalation of FP (500 µg). |
T257 | 39338-39415 | Sentence | denotes | The results shown in (E) are representative of samples from two participants. |
T258 | 39418-39572 | Sentence | denotes | Taken together, our data suggest that inhaled FP reduces nuclear localization of GATA-3 in vivo by acutely inhibiting phospho-GATA-3–importin association. |
T259 | 39573-39759 | Sentence | denotes | This effect may be direct, through competition for importin-α or associated molecules, or secondary to an effect on p38 MAPK-mediated GATA-3 phosphorylation via rapid induction of MKP-1. |
T260 | 39760-39907 | Sentence | denotes | The combination of these two interacting effects can result in complete suppression of GATA-3 nuclear import and thus Th2 cytokine gene expression. |
T261 | 39909-39919 | Sentence | denotes | Discussion |
T262 | 39920-40132 | Sentence | denotes | Here we have demonstrated, to our knowledge for the first time, that corticosteroids may inhibit GATA-3 function and therefore the transcription of Th2 genes via two distinct but interacting molecular mechanisms. |
T263 | 40133-40312 | Sentence | denotes | Firstly, corticosteroid-activated GR appears to compete with activated GATA-3 for nuclear import via importin-α, which is required for the nuclear transport of both GATA-3 and GR. |
T264 | 40313-40630 | Sentence | denotes | Secondly, corticosteroids at higher concentrations increase the expression of MKP-1, a potent inhibitor of p38 MAPK activity and thereby prevent T cell receptor/co-receptor activation of p38 MAPK to prevent the phosphorylation of GATA-3 that is necessary for interaction with importin-α and subsequent nuclear import. |
T265 | 40631-40820 | Sentence | denotes | We have previously shown that translocation of GATA-3 from the cytoplasm to the nucleus involves the nuclear transporter protein importin-α, which interacts with phosphorylated GATA-3 [12]. |
T266 | 40821-41052 | Sentence | denotes | We have also previously reported that GATA-3 knockdown using siRNA results in suppression of anti-CD3/CD28–stimulated IL-4/IL-5 mRNA induction, thus implicating an essential role for GATA-3 in the transcription of these genes [12]. |
T267 | 41053-41154 | Sentence | denotes | We now confirm, in human T cells, that GR also uses the same nuclear import mechanism as GATA-3 [22]. |
T268 | 41155-41268 | Sentence | denotes | We therefore propose that there is competition between ligand-activated GR and phospho-GATA-3 for nuclear import. |
T269 | 41269-41542 | Sentence | denotes | Furthermore, we have shown that there is preferential binding of importin-α to activated GR over phospho-GATA-3, so that corticosteroids would preferentially reduce GATA-3 entry and thus rapidly switch off Th2 gene transcription without any need for any intermediate steps. |
T270 | 41543-41702 | Sentence | denotes | Furthermore, there was some degree of specificity for GATA-3, as nuclear translocation of the p65 subunit of NF-κB was not affected by corticosteroid exposure. |
T271 | 41703-41897 | Sentence | denotes | We tested some alternative explanations for this effect of FP on GATA-3 nuclear exclusion and failed to show that FP either enhances GATA-3 nuclear export directly or induces GATA-3 degradation. |
T272 | 41898-42104 | Sentence | denotes | The evidence from the in vitro competition assays does, however, suggest that purified activated GR can clearly attenuate purified phospho-GATA-3–importin-α association and that the converse does not occur. |
T273 | 42105-42187 | Sentence | denotes | Furthermore, we have shown that only phospho-GATA-3 can associate with importin-α. |
T274 | 42188-42337 | Sentence | denotes | This mechanism is sensitive to very low concentrations of corticosteroid and would be rapid in onset as no changes in protein synthesis are required. |
T275 | 42338-42537 | Sentence | denotes | This acute mechanism may also contribute to the reduction in GATA-3 nuclear import and may play a major role at low corticosteroid concentrations and/or at early time points prior to MKP-1 induction. |
T276 | 42538-42674 | Sentence | denotes | Corticosteroids can modulate p38 MAPK activity through the induction of MKP-1, a potent endogenous inhibitor of MAPK function [38],[39]. |
T277 | 42675-42795 | Sentence | denotes | We report here a rapid induction of MKP-1 mRNA following stimulation of cells with relatively high concentrations of FP. |
T278 | 42796-42989 | Sentence | denotes | We hypothesize that this rapid induction of MKP-1 can reduce GATA-3 nuclear import by attenuating p38 MAPK activity and subsequent GATA-3 phosphorylation, thus preventing nuclear translocation. |
T279 | 42990-43256 | Sentence | denotes | The location of the serine residue(s) of GATA-3 that are phosphorylated by p38 MAPK are currently unknown, but a bioinformatics search (Motif Scanner, http://scansite.mit.edu/motifscan_seq.phtml) indicates at least three potential p38 MAPK-sensitive serine residues. |
T280 | 43257-43439 | Sentence | denotes | As predicted from these in vitro data, impairment of GATA-3 nuclear import by FP may, at least in part, underlie the efficacy of corticosteroids in suppressing allergic inflammation. |
T281 | 43440-43740 | Sentence | denotes | Although we did not assess the acute inhibitory effect of FP on the expression of IL-4 mRNA in vivo, a single inhalation of FP (500 µg) may have comparable effects, as it provides plasma levels within a relevant range of concentrations used to suppress IL-4 transcription in our in vitro system [37]. |
T282 | 43741-43872 | Sentence | denotes | A lower dose of inhaled FP (100 µg) was not effective, but plasma concentrations may be below those required for GATA-3 inhibition. |
T283 | 43873-44053 | Sentence | denotes | However, it is likely that the higher concentrations of FP in the airways after inhaled administration would be effective in inhibiting GATA-3 in airway T cells of asthma patients. |
T284 | 44054-44276 | Sentence | denotes | The study of PBMCs from asthma patients treated with inhaled corticosteroid therapy clearly demonstrates that these molecular mechanisms are likely to also occur in patients at therapeutic doses of inhaled corticosteroids. |
T285 | 44277-44452 | Sentence | denotes | In addition, previous studies have shown that corticosteroids can suppress IL-4 and IL-5 release from peripheral blood cells of asthma patients in vitro and in vivo [40]–[42]. |
T286 | 44453-44896 | Sentence | denotes | In summary, our data provide evidence for a novel action of corticosteroids: suppression of allergic inflammation through a rapid inhibitory effect on GATA-3 nuclear translocation by preferential binding to the shared nuclear import protein importin-α and by a second mechanism involving increased synthesis of MKP-1, which inhibits p38 MAPK, thus preventing the phosphorylation of GATA-3 that is necessary for nuclear translocation of GATA-3. |
T287 | 44897-45035 | Sentence | denotes | These two mechanisms are likely to be synergistic, accounting for the rapid and potent effect of corticosteroids on allergic inflammation. |
T288 | 45036-45235 | Sentence | denotes | This is exemplified by the rapid inhibitory effect of topical corticosteroids on nasal Th2 cytokine release after allergen provocation in individuals with seasonal allergic rhinitis (hay fever) [43]. |
T289 | 45236-45398 | Sentence | denotes | Prevention of phospho-GATA-3 interaction with importin-α may provide a new approach for the development of novel therapies for the treatment of allergic diseases. |
ICD10
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T780 | 1787-1793 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T3297 | 7288-7294 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T3298 | 9575-9581 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T3299 | 12318-12324 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T3300 | 7288-7294 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T3954 | 12410-12416 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T3955 | 12603-12609 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T3956 | 12410-12416 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T3957 | 12603-12609 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T19580 | 34978-34984 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T19581 | 35329-35335 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T19582 | 34978-34984 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T19583 | 35329-35335 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T769 | 1787-1793 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T12585 | 34552-34558 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T12586 | 36048-36054 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T12587 | 34552-34558 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T12588 | 36048-36054 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T15281 | 44037-44043 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T15282 | 44078-44084 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T15283 | 44405-44411 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T15284 | 44037-44043 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T15285 | 44078-44084 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T15286 | 44405-44411 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T15287 | 45200-45217 | http://purl.bioontology.org/ontology/ICD10/J30.4 | denotes | allergic rhinitis |
T15288 | 45223-45228 | http://purl.bioontology.org/ontology/ICD10/R50.9 | denotes | fever |
T20248 | 38246-38252 | http://purl.bioontology.org/ontology/ICD10/J45.9 | denotes | asthma |
T20249 | 38246-38252 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T3301 | 9575-9581 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T3302 | 12318-12324 | http://purl.bioontology.org/ontology/ICD10/J45 | denotes | asthma |
T3303 | 7310-7327 | http://purl.bioontology.org/ontology/ICD10/L20 | denotes | atopic dermatitis |
T3304 | 7310-7327 | http://purl.bioontology.org/ontology/ICD10/L20.9 | denotes | atopic dermatitis |
T3305 | 7317-7327 | http://purl.bioontology.org/ontology/ICD10/L30.9 | denotes | dermatitis |
events-check-again
Id | Subject | Object | Predicate | Lexical cue | Negation | Speculation |
---|---|---|---|---|---|---|
T873 | 0-11 | Negative_regulation | denotes | Suppression | ||
T874 | 0-11 | Negative_regulation | denotes | Suppression | ||
T875 | 15-21 | Protein | denotes | GATA-3 | ||
T876 | 22-29 | Entity | denotes | Nuclear | ||
T877 | 30-36 | Localization | denotes | Import | ||
T878 | 41-56 | Phosphorylation | denotes | Phosphorylation | ||
T879 | 466-472 | Protein | denotes | GATA-3 | ||
T880 | 498-508 | Regulation | denotes | regulating | ||
T881 | 498-508 | Regulation | denotes | regulating | ||
T882 | 498-508 | Regulation | denotes | regulating | ||
T883 | 513-523 | Gene_expression | denotes | expression | ||
T884 | 513-523 | Gene_expression | denotes | expression | ||
T885 | 513-523 | Gene_expression | denotes | expression | ||
T886 | 541-559 | Protein | denotes | interleukin (IL)-4 | ||
T887 | 561-565 | Protein | denotes | IL-5 | ||
T888 | 571-576 | Protein | denotes | IL-13 | ||
T889 | 755-761 | Protein | denotes | GATA-3 | ||
T890 | 795-801 | Regulation | denotes | effect | ||
T891 | 850-856 | Protein | denotes | GATA-3 | ||
T892 | 857-867 | Regulation | denotes | regulation | ||
T893 | 1090-1098 | Negative_regulation | denotes | inhibits | ||
T894 | 1099-1106 | Entity | denotes | nuclear | ||
T895 | 1107-1120 | Localization | denotes | translocation | ||
T896 | 1124-1130 | Protein | denotes | GATA-3 | ||
T897 | 1236-1247 | Negative_regulation | denotes | competition | ||
T898 | 1236-1247 | Negative_regulation | denotes | competition | ||
T899 | 1256-1262 | Protein | denotes | GATA-3 | ||
T900 | 1278-1287 | Positive_regulation | denotes | activated | ||
T901 | 1288-1311 | Protein | denotes | glucocorticoid receptor | ||
T902 | 1316-1323 | Entity | denotes | nuclear | ||
T903 | 1324-1333 | Localization | denotes | transport | ||
T904 | 1324-1333 | Localization | denotes | transport | ||
T905 | 1400-1407 | Positive_regulation | denotes | induces | ||
T906 | 1412-1422 | Gene_expression | denotes | expression | ||
T907 | 1426-1479 | Protein | denotes | mitogen-activated protein kinase (MAPK) phosphatase-1 | ||
T908 | 1481-1486 | Protein | denotes | MKP-1 | ||
T909 | 1536-1545 | Positive_regulation | denotes | necessary | ||
T910 | 1550-1556 | Protein | denotes | GATA-3 | ||
T911 | 1557-1564 | Entity | denotes | nuclear | ||
T912 | 1565-1578 | Localization | denotes | translocation | ||
T913 | 1700-1708 | Negative_regulation | denotes | inhibits | ||
T914 | 1709-1715 | Protein | denotes | GATA-3 | ||
T915 | 1716-1723 | Entity | denotes | nuclear | ||
T916 | 1724-1737 | Localization | denotes | translocation | ||
T917 | 1846-1863 | Negative_regulation | denotes | inhibitory effect | ||
T918 | 1867-1873 | Protein | denotes | GATA-3 | ||
T3556 | 7372-7390 | Protein | denotes | interleukin (IL)-4 | ||
T3557 | 7392-7396 | Protein | denotes | IL-5 | ||
T3558 | 7402-7407 | Protein | denotes | IL-13 | ||
T3559 | 7437-7441 | Protein | denotes | IL-4 | ||
T3560 | 7446-7451 | Protein | denotes | IL-13 | ||
T3561 | 7511-7515 | Protein | denotes | IL-5 | ||
T3562 | 7635-7641 | Protein | denotes | GATA-3 | ||
T3563 | 7666-7675 | Gene_expression | denotes | expressed | ||
T3564 | 7698-7704 | Protein | denotes | GATA-3 | ||
T3565 | 7757-7766 | Positive_regulation | denotes | activates | ||
T3566 | 7757-7766 | Positive_regulation | denotes | activates | ||
T3567 | 7757-7766 | Positive_regulation | denotes | activates | ||
T3568 | 7771-7780 | Entity | denotes | promoters | ||
T3569 | 7784-7788 | Protein | denotes | IL-4 | ||
T3570 | 7790-7794 | Protein | denotes | IL-5 | ||
T3571 | 7800-7805 | Protein | denotes | IL-13 | ||
T3572 | 7861-7867 | Protein | denotes | GATA-3 | ||
T3573 | 8023-8029 | Protein | denotes | GATA-3 | ||
T3574 | 8088-8094 | Protein | denotes | GATA-3 | ||
T3575 | 8146-8151 | Protein | denotes | Gata3 | ||
T3576 | 8286-8289 | Protein | denotes | CD4 | ||
T3577 | 8318-8327 | Negative_regulation | denotes | knockdown | ||
T3578 | 8331-8337 | Protein | denotes | GATA-3 | ||
T3579 | 8338-8348 | Gene_expression | denotes | expression | ||
T3580 | 8463-8469 | Protein | denotes | GATA-3 | ||
T3581 | 8507-8518 | Localization | denotes | translocate | ||
T3582 | 8547-8554 | Entity | denotes | nucleus | ||
T3583 | 8558-8564 | Binding | denotes | access | ||
T3584 | 8569-8575 | Binding | denotes | target | ||
T3585 | 8592-8599 | Entity | denotes | nuclear | ||
T3586 | 8600-8610 | Localization | denotes | expression | ||
T3587 | 8614-8620 | Protein | denotes | GATA-3 | ||
T3588 | 8621-8630 | Positive_regulation | denotes | following | ||
T3589 | 8748-8757 | Positive_regulation | denotes | following | ||
T3590 | 8808-8814 | Protein | denotes | GATA-3 | ||
T3591 | 8870-8881 | Localization | denotes | transported | ||
T3592 | 8891-8898 | Entity | denotes | nucleus | ||
T3593 | 9014-9020 | Protein | denotes | GATA-3 | ||
T3594 | 9304-9308 | Regulation | denotes | role | ||
T3595 | 9312-9327 | Phosphorylation | denotes | phosphorylating | ||
T3596 | 9328-9334 | Protein | denotes | GATA-3 | ||
T3597 | 9338-9345 | Positive_regulation | denotes | enhance | ||
T3598 | 9350-9361 | Binding | denotes | interaction | ||
T3599 | 9652-9659 | Binding | denotes | binding | ||
T3600 | 9663-9687 | Protein | denotes | glucocorticoid receptors | ||
T3601 | 9689-9692 | Protein | denotes | GRs | ||
T3602 | 9706-9717 | Localization | denotes | translocate | ||
T3603 | 9725-9732 | Entity | denotes | nucleus | ||
T3604 | 9744-9752 | Binding | denotes | interact | ||
T3605 | 9865-9874 | Positive_regulation | denotes | activated | ||
T3606 | 9875-9877 | Protein | denotes | GR | ||
T3607 | 9878-9887 | Binding | denotes | interacts | ||
T3608 | 10076-10087 | Binding | denotes | recruitment | ||
T3609 | 10122-10143 | Protein | denotes | histone deacetylase-2 | ||
T3610 | 10155-10162 | Entity | denotes | Nuclear | ||
T3611 | 10163-10175 | Localization | denotes | localisation | ||
T3612 | 10180-10189 | Localization | denotes | retention | ||
T3613 | 10193-10195 | Protein | denotes | GR | ||
T3614 | 10199-10207 | Positive_regulation | denotes | mediated | ||
T3615 | 10199-10207 | Positive_regulation | denotes | mediated | ||
T3616 | 10311-10318 | Regulation | denotes | control | ||
T3617 | 10322-10329 | Entity | denotes | nuclear | ||
T3618 | 10330-10336 | Localization | denotes | export | ||
T3619 | 10343-10375 | Protein | denotes | chromosomal region maintenance 1 | ||
T3620 | 10377-10382 | Protein | denotes | CRM-1 | ||
T3621 | 10384-10393 | Regulation | denotes | dependent | ||
T3622 | 10408-10411 | Entity | denotes | NL1 | ||
T3623 | 10447-10452 | Binding | denotes | binds | ||
T3624 | 10673-10682 | Regulation | denotes | resulting | ||
T3625 | 10683-10685 | Protein | denotes | GR | ||
T3626 | 10692-10704 | Localization | denotes | translocates | ||
T3627 | 10712-10719 | Entity | denotes | nucleus | ||
T3628 | 10720-10734 | Positive_regulation | denotes | in response to | ||
T3629 | 10752-10763 | Binding | denotes | interaction | ||
T3630 | 10769-10779 | Protein | denotes | importin 7 | ||
T3631 | 10795-10803 | Positive_regulation | denotes | requires | ||
T3632 | 10946-10948 | Protein | denotes | GR | ||
T3633 | 10949-10955 | Localization | denotes | import | ||
T3634 | 10998-11007 | Regulation | denotes | important | ||
T3635 | 11016-11026 | Regulation | denotes | regulation | ||
T3636 | 11030-11032 | Protein | denotes | GR | ||
T3637 | 11033-11043 | Positive_regulation | denotes | activation | ||
T3638 | 11366-11370 | Protein | denotes | IL-4 | ||
T3639 | 11372-11376 | Protein | denotes | IL-5 | ||
T3640 | 11382-11387 | Protein | denotes | IL-13 | ||
T3641 | 11455-11464 | Regulation | denotes | regulated | ||
T3642 | 11455-11464 | Regulation | denotes | regulated | ||
T3643 | 11455-11464 | Regulation | denotes | regulated | ||
T3644 | 11525-11528 | Protein | denotes | CAT | ||
T3645 | 11590-11592 | Protein | denotes | GR | ||
T3646 | 11593-11600 | Negative_regulation | denotes | reduced | ||
T3647 | 11593-11600 | Negative_regulation | denotes | reduced | ||
T3648 | 11601-11607 | Protein | denotes | GATA-3 | ||
T3649 | 11608-11616 | Positive_regulation | denotes | mediated | ||
T3650 | 11608-11616 | Positive_regulation | denotes | mediated | ||
T3651 | 11617-11621 | Protein | denotes | IL-5 | ||
T3652 | 11626-11629 | Protein | denotes | -13 | ||
T3653 | 11639-11647 | Gene_expression | denotes | activity | ||
T3654 | 11639-11647 | Gene_expression | denotes | activity | ||
T3655 | 11657-11660 | Protein | denotes | CD4 | ||
T3656 | 11705-11716 | Localization | denotes | recruitment | ||
T3657 | 11720-11722 | Protein | denotes | GR | ||
T3658 | 11727-11732 | Regulation | denotes | alter | true | |
T3659 | 11748-11754 | Protein | denotes | GATA-3 | ||
T3660 | 11765-11769 | Binding | denotes | bind | ||
T3661 | 11928-11935 | Regulation | denotes | effects | true | |
T3662 | 11928-11935 | Regulation | denotes | effects | true | |
T3663 | 11974-11980 | Protein | denotes | GATA-3 | ||
T3664 | 11981-11996 | Phosphorylation | denotes | phosphorylation | ||
T3665 | 12001-12008 | Entity | denotes | nuclear | ||
T3666 | 12009-12022 | Localization | denotes | translocation | ||
T3667 | 12179-12186 | Regulation | denotes | effects | ||
T3668 | 12221-12227 | Protein | denotes | GATA-3 | ||
T3669 | 12240-12252 | Localization | denotes | localization | ||
T6048 | 16679-16681 | Protein | denotes | GR | ||
T6049 | 16682-16688 | Protein | denotes | GATA-3 | ||
T6050 | 16938-16944 | Protein | denotes | GATA-3 | ||
T6051 | 17044-17046 | Protein | denotes | GR | ||
T6052 | 17315-17321 | Protein | denotes | GATA-3 | ||
T6053 | 17422-17424 | Protein | denotes | GR | ||
T6054 | 17819-17825 | Protein | denotes | GATA-3 | ||
T6055 | 17927-17929 | Protein | denotes | GR | ||
T6731 | 18846-18848 | Protein | denotes | GR | ||
T8795 | 23176-23182 | Regulation | denotes | Effect | ||
T8796 | 23176-23182 | Regulation | denotes | Effect | ||
T8797 | 23205-23211 | Protein | denotes | GATA-3 | ||
T8798 | 23212-23219 | Entity | denotes | Nuclear | ||
T8799 | 23220-23233 | Localization | denotes | Translocation | ||
T8800 | 23238-23242 | Protein | denotes | IL-4 | ||
T8801 | 23268-23277 | Regulation | denotes | effective | ||
T8802 | 23281-23291 | Negative_regulation | denotes | inhibiting | ||
T8803 | 23292-23298 | Protein | denotes | GATA-3 | ||
T8804 | 23299-23308 | Regulation | denotes | regulated | ||
T8805 | 23309-23313 | Protein | denotes | IL-4 | ||
T8806 | 23319-23329 | Gene_expression | denotes | expression | ||
T8807 | 23407-23413 | Regulation | denotes | affect | true | |
T8808 | 23428-23438 | Positive_regulation | denotes | stimulated | ||
T8809 | 23439-23446 | Entity | denotes | nuclear | ||
T8810 | 23447-23453 | Localization | denotes | import | ||
T8811 | 23457-23463 | Protein | denotes | GATA-3 | ||
T8812 | 23505-23513 | Positive_regulation | denotes | resulted | ||
T8813 | 23537-23544 | Entity | denotes | nuclear | ||
T8814 | 23545-23551 | Protein | denotes | GATA-3 | ||
T8815 | 23552-23565 | Localization | denotes | translocation | ||
T8816 | 23720-23725 | Protein | denotes | MEK-1 | ||
T8817 | 23784-23790 | Positive_regulation | denotes | caused | ||
T8818 | 23784-23790 | Positive_regulation | denotes | caused | ||
T8819 | 23801-23805 | Negative_regulation | denotes | loss | ||
T8820 | 23809-23816 | Entity | denotes | nuclear | ||
T8821 | 23817-23823 | Protein | denotes | GATA-3 | ||
T8822 | 23824-23834 | Localization | denotes | expression | ||
T8823 | 23839-23850 | Entity | denotes | cytoplasmic | ||
T8824 | 23851-23860 | Localization | denotes | retention | ||
T8825 | 23864-23870 | Protein | denotes | GATA-3 | ||
T8826 | 23959-23970 | Regulation | denotes | This effect | ||
T8827 | 23959-23970 | Regulation | denotes | This effect | ||
T8828 | 23959-23970 | Regulation | denotes | This effect | ||
T8829 | 23999-24008 | Regulation | denotes | dependent | ||
T8830 | 23999-24008 | Regulation | denotes | dependent | ||
T8831 | 23999-24008 | Regulation | denotes | dependent | ||
T8832 | 24101-24111 | Regulation | denotes | associated | ||
T8833 | 24101-24111 | Regulation | denotes | associated | ||
T8834 | 24101-24111 | Regulation | denotes | associated | ||
T8835 | 24124-24134 | Negative_regulation | denotes | reductions | ||
T8836 | 24124-24134 | Negative_regulation | denotes | reductions | ||
T8837 | 24152-24162 | Positive_regulation | denotes | stimulated | ||
T8838 | 24152-24162 | Positive_regulation | denotes | stimulated | ||
T8839 | 24163-24167 | Protein | denotes | IL-4 | ||
T8840 | 24172-24176 | Protein | denotes | IL-5 | ||
T8841 | 24177-24192 | Transcription | denotes | mRNA expression | ||
T8842 | 24177-24192 | Transcription | denotes | mRNA expression | ||
T8843 | 24211-24215 | Negative_regulation | denotes | loss | ||
T8844 | 24219-24225 | Protein | denotes | GATA-3 | ||
T8845 | 24226-24233 | Binding | denotes | binding | ||
T8846 | 24248-24252 | Protein | denotes | IL-5 | ||
T8847 | 24253-24261 | Entity | denotes | promoter | ||
T9360 | 25841-25843 | Protein | denotes | GR | ||
T9361 | 25858-25864 | Protein | denotes | GATA-3 | ||
T9362 | 25865-25868 | Binding | denotes | for | ||
T9363 | 25945-25954 | Positive_regulation | denotes | activated | ||
T9364 | 25955-25957 | Protein | denotes | GR | ||
T9365 | 25969-25975 | Protein | denotes | GATA-3 | ||
T9366 | 25976-25980 | Positive_regulation | denotes | uses | ||
T9367 | 25976-25980 | Positive_regulation | denotes | uses | ||
T9368 | 26000-26007 | Entity | denotes | nuclear | ||
T9369 | 26008-26014 | Localization | denotes | import | ||
T9370 | 26008-26014 | Localization | denotes | import | ||
T9371 | 26060-26062 | Protein | denotes | GR | ||
T9372 | 26173-26175 | Protein | denotes | GR | ||
T9373 | 26176-26183 | Entity | denotes | nuclear | ||
T9374 | 26184-26197 | Localization | denotes | translocation | ||
T9375 | 26335-26344 | Negative_regulation | denotes | decreased | ||
T9376 | 26349-26360 | Binding | denotes | association | ||
T9377 | 26369-26375 | Protein | denotes | GATA-3 | ||
T9378 | 26391-26398 | Positive_regulation | denotes | induced | ||
T9379 | 26447-26456 | Regulation | denotes | dependent | ||
T9380 | 26496-26515 | Protein | denotes | GFP-labelled GATA-3 | ||
T9381 | 26561-26567 | Protein | denotes | GATA-3 | ||
T9382 | 26568-26575 | Entity | denotes | nuclear | ||
T9383 | 26576-26582 | Localization | denotes | import | ||
T9384 | 26583-26592 | Positive_regulation | denotes | following | ||
T9385 | 26634-26644 | Negative_regulation | denotes | attenuated | ||
T10991 | 28261-28266 | Protein | denotes | MKP-1 | ||
T10992 | 28357-28366 | Gene_expression | denotes | induction | ||
T10993 | 28398-28403 | Protein | denotes | MKP-1 | ||
T10994 | 28405-28423 | Protein | denotes | MAPK phosphatase-1 | ||
T10995 | 28557-28566 | Negative_regulation | denotes | decreased | ||
T10996 | 28629-28644 | Phosphorylation | denotes | phosphorylation | ||
T10997 | 28663-28669 | Binding | denotes | target | ||
T10998 | 28670-28675 | Protein | denotes | ATF-2 | ||
T10999 | 28797-28804 | Negative_regulation | denotes | reduced | ||
T11000 | 28805-28811 | Protein | denotes | GATA-3 | ||
T11001 | 28812-28818 | Entity | denotes | serine | ||
T11002 | 28819-28834 | Phosphorylation | denotes | phosphorylation | ||
T11003 | 28835-28842 | Positive_regulation | denotes | induced | ||
T11004 | 28906-28915 | Regulation | denotes | dependent | ||
T11005 | 28936-28950 | Negative_regulation | denotes | This reduction | ||
T11006 | 28954-28960 | Protein | denotes | GATA-3 | ||
T11007 | 28961-28976 | Phosphorylation | denotes | phosphorylation | ||
T11008 | 29055-29062 | Positive_regulation | denotes | induced | ||
T11009 | 29063-29068 | Protein | denotes | MKP-1 | ||
T11010 | 29069-29073 | Transcription | denotes | mRNA | ||
T11011 | 29108-29117 | Regulation | denotes | dependent | ||
T11012 | 29201-29208 | Regulation | denotes | effects | ||
T11013 | 29201-29208 | Regulation | denotes | effects | ||
T11014 | 29201-29208 | Regulation | denotes | effects | ||
T11015 | 29218-29224 | Protein | denotes | GATA-3 | ||
T11016 | 29225-29232 | Entity | denotes | nuclear | ||
T11017 | 29233-29239 | Localization | denotes | import | ||
T11018 | 29252-29263 | Binding | denotes | association | ||
T11019 | 29268-29272 | Protein | denotes | IL-4 | ||
T11020 | 29273-29288 | Transcription | denotes | mRNA expression | ||
T11021 | 30686-30697 | Negative_regulation | denotes | competition | ||
T11022 | 30686-30697 | Negative_regulation | denotes | competition | ||
T11023 | 30735-30744 | Positive_regulation | denotes | activated | ||
T11024 | 30745-30751 | Protein | denotes | GATA-3 | ||
T11025 | 30769-30778 | Positive_regulation | denotes | activated | ||
T11026 | 30779-30781 | Protein | denotes | GR | ||
T11027 | 30804-30813 | Positive_regulation | denotes | activated | ||
T11028 | 30814-30816 | Protein | denotes | GR | ||
T11029 | 30831-30840 | Positive_regulation | denotes | increased | ||
T11030 | 30841-30843 | Protein | denotes | GR | ||
T11031 | 30855-30866 | Binding | denotes | association | ||
T11032 | 30867-30897 | Regulation | denotes | in the presence and absence of | true | |
T11033 | 30898-30907 | Positive_regulation | denotes | activated | ||
T11034 | 30908-30914 | Protein | denotes | GATA-3 | ||
T11035 | 30961-30970 | Positive_regulation | denotes | activated | ||
T11036 | 30971-30977 | Protein | denotes | GATA-3 | ||
T11037 | 30986-30991 | Negative_regulation | denotes | block | true | |
T11038 | 30992-30994 | Protein | denotes | GR | ||
T11039 | 31006-31017 | Binding | denotes | association | ||
T11040 | 31065-31074 | Positive_regulation | denotes | activated | ||
T11041 | 31075-31077 | Protein | denotes | GR | ||
T11042 | 31090-31096 | Protein | denotes | GATA-3 | ||
T11043 | 31110-31119 | Binding | denotes | associate | ||
T11044 | 31110-31119 | Binding | denotes | associate | ||
T11045 | 31157-31166 | Positive_regulation | denotes | activated | ||
T11046 | 31167-31169 | Protein | denotes | GR | ||
T11047 | 31170-31180 | Negative_regulation | denotes | attenuates | ||
T11048 | 31185-31192 | Phosphorylation | denotes | phospho | ||
T11049 | 31193-31199 | Protein | denotes | GATA-3 | ||
T11050 | 31211-31222 | Binding | denotes | interaction | ||
T11051 | 31242-31251 | Regulation | denotes | dependent | ||
T11052 | 31308-31317 | Positive_regulation | denotes | activated | ||
T11053 | 31318-31320 | Protein | denotes | GR | ||
T11054 | 31325-31332 | Negative_regulation | denotes | compete | true | |
T11055 | 31346-31352 | Protein | denotes | GATA-3 | ||
T11056 | 31353-31356 | Binding | denotes | for | ||
T11057 | 31380-31385 | Negative_regulation | denotes | limit | ||
T11058 | 31386-31392 | Protein | denotes | GATA-3 | ||
T11059 | 31393-31400 | Entity | denotes | nuclear | ||
T11060 | 31401-31407 | Localization | denotes | import | ||
T11061 | 32560-32566 | Regulation | denotes | effect | ||
T11062 | 32560-32566 | Regulation | denotes | effect | ||
T11063 | 32576-32582 | Protein | denotes | GATA-3 | ||
T11064 | 32583-32590 | Entity | denotes | nuclear | ||
T11065 | 32591-32597 | Localization | denotes | export | ||
T11066 | 32605-32616 | Protein_catabolism | denotes | degradation | ||
T11067 | 32671-32677 | Regulation | denotes | affect | true | |
T11068 | 32699-32704 | Negative_regulation | denotes | block | ||
T11069 | 32705-32711 | Protein | denotes | GATA-3 | ||
T11070 | 32712-32719 | Entity | denotes | nuclear | ||
T11071 | 32720-32732 | Localization | denotes | localization | ||
T11072 | 32770-32776 | Regulation | denotes | effect | true | |
T11073 | 32791-32797 | Protein | denotes | GATA-3 | ||
T11074 | 32798-32808 | Gene_expression | denotes | expression | ||
T11075 | 32939-32945 | Regulation | denotes | affect | true | |
T11076 | 32946-32952 | Protein | denotes | GATA-3 | ||
T11077 | 32953-32960 | Entity | denotes | nuclear | ||
T11078 | 32961-32970 | Localization | denotes | residency | ||
T11079 | 33000-33009 | Positive_regulation | denotes | activated | ||
T11080 | 33010-33012 | Protein | denotes | GR | ||
T11081 | 33022-33029 | Positive_regulation | denotes | enhance | true | |
T11082 | 33030-33036 | Protein | denotes | GATA-3 | ||
T11083 | 33037-33044 | Entity | denotes | nuclear | ||
T11084 | 33045-33051 | Localization | denotes | export | ||
T11085 | 33066-33072 | Regulation | denotes | effect | ||
T11086 | 33082-33088 | Protein | denotes | GATA-3 | ||
T11087 | 33089-33096 | Entity | denotes | nuclear | ||
T11088 | 33097-33103 | Localization | denotes | import | ||
T11089 | 33150-33156 | Regulation | denotes | effect | true | |
T11090 | 33160-33163 | Protein | denotes | p65 | ||
T11091 | 33164-33171 | Entity | denotes | nuclear | ||
T11092 | 33172-33185 | Localization | denotes | translocation | ||
T12731 | 34273-34283 | Negative_regulation | denotes | Inhibitory | ||
T12732 | 34313-34319 | Protein | denotes | GATA-3 | ||
T12733 | 34320-34327 | Entity | denotes | Nuclear | ||
T12734 | 34328-34340 | Localization | denotes | Localization | ||
T12735 | 34441-34450 | Regulation | denotes | dependent | ||
T12736 | 34451-34459 | Negative_regulation | denotes | decrease | ||
T12737 | 34474-34485 | Binding | denotes | interaction | ||
T12738 | 34494-34501 | Phosphorylation | denotes | phospho | ||
T12739 | 34502-34508 | Protein | denotes | GATA-3 | ||
T12740 | 34603-34612 | Negative_regulation | denotes | inhibited | ||
T12741 | 34681-34691 | Negative_regulation | denotes | attenuated | ||
T12742 | 35753-35763 | Negative_regulation | denotes | suppresses | ||
T12743 | 35753-35763 | Negative_regulation | denotes | suppresses | ||
T12744 | 35764-35768 | Protein | denotes | IL-4 | ||
T12745 | 35773-35775 | Protein | denotes | -5 | ||
T12746 | 35781-35791 | Gene_expression | denotes | expression | ||
T12747 | 35781-35791 | Gene_expression | denotes | expression | ||
T12748 | 35796-35806 | Negative_regulation | denotes | attenuated | ||
T12749 | 35811-35822 | Binding | denotes | interaction | ||
T12750 | 35826-35832 | Protein | denotes | GATA-3 | ||
T12751 | 36078-36085 | Negative_regulation | denotes | reduced | ||
T12752 | 36086-36092 | Protein | denotes | GATA-3 | ||
T12753 | 36104-36115 | Binding | denotes | interaction | ||
T12754 | 36134-36143 | Regulation | denotes | dependent | ||
T12755 | 36157-36165 | Regulation | denotes | produced | ||
T12756 | 36173-36181 | Negative_regulation | denotes | decrease | ||
T12757 | 36185-36191 | Protein | denotes | GATA-3 | ||
T12758 | 36203-36214 | Binding | denotes | association | ||
T12759 | 36483-36489 | Protein | denotes | GATA-3 | ||
T12760 | 36501-36512 | Binding | denotes | association | ||
T12761 | 36599-36609 | Negative_regulation | denotes | attenuated | ||
T12762 | 36610-36621 | Binding | denotes | interaction | ||
T12763 | 36625-36631 | Protein | denotes | GATA-3 | ||
T12764 | 36847-36853 | Regulation | denotes | affect | true | |
T12765 | 36863-36875 | Localization | denotes | localization | ||
T12766 | 36879-36885 | Protein | denotes | GATA-3 | ||
T12767 | 36972-36981 | Positive_regulation | denotes | increased | ||
T12768 | 36982-36984 | Protein | denotes | GR | ||
T12769 | 36985-36992 | Entity | denotes | nuclear | ||
T12770 | 36993-37006 | Localization | denotes | translocation | ||
T12771 | 37069-37075 | Protein | denotes | GATA-3 | ||
T12772 | 37424-37431 | Positive_regulation | denotes | induced | ||
T12773 | 37444-37448 | Localization | denotes | loss | true | |
T12774 | 37452-37459 | Entity | denotes | nuclear | ||
T12775 | 37460-37466 | Protein | denotes | GATA-3 | ||
T12776 | 37591-37602 | Entity | denotes | cytoplasmic | ||
T12777 | 37603-37609 | Protein | denotes | GATA-3 | ||
T12778 | 37610-37616 | Localization | denotes | levels | ||
T12779 | 37622-37630 | Positive_regulation | denotes | enhanced | ||
T12780 | 37655-37664 | Regulation | denotes | dependent | ||
T12781 | 39467-39474 | Negative_regulation | denotes | reduces | ||
T12782 | 39475-39482 | Entity | denotes | nuclear | ||
T12783 | 39483-39495 | Localization | denotes | localization | ||
T12784 | 39499-39505 | Protein | denotes | GATA-3 | ||
T12785 | 39525-39535 | Negative_regulation | denotes | inhibiting | ||
T12786 | 39544-39550 | Protein | denotes | GATA-3 | ||
T12787 | 39560-39571 | Binding | denotes | association | ||
T12788 | 39698-39706 | Positive_regulation | denotes | mediated | ||
T12789 | 39707-39713 | Protein | denotes | GATA-3 | ||
T12790 | 39714-39729 | Phosphorylation | denotes | phosphorylation | ||
T12791 | 39740-39749 | Gene_expression | denotes | induction | ||
T12792 | 39753-39758 | Protein | denotes | MKP-1 | ||
T12793 | 39801-39808 | Regulation | denotes | effects | ||
T12794 | 39832-39843 | Negative_regulation | denotes | suppression | ||
T12795 | 39847-39853 | Protein | denotes | GATA-3 | ||
T12796 | 39854-39861 | Entity | denotes | nuclear | ||
T12797 | 39862-39868 | Localization | denotes | import | ||
T15783 | 40017-40023 | Protein | denotes | GATA-3 | ||
T15784 | 40157-40166 | Positive_regulation | denotes | activated | ||
T15785 | 40167-40169 | Protein | denotes | GR | ||
T15786 | 40181-40188 | Negative_regulation | denotes | compete | ||
T15787 | 40194-40203 | Positive_regulation | denotes | activated | ||
T15788 | 40204-40210 | Protein | denotes | GATA-3 | ||
T15789 | 40215-40222 | Entity | denotes | nuclear | ||
T15790 | 40223-40229 | Localization | denotes | import | ||
T15791 | 40230-40233 | Regulation | denotes | via | ||
T15792 | 40255-40263 | Regulation | denotes | required | ||
T15793 | 40255-40263 | Regulation | denotes | required | ||
T15794 | 40272-40279 | Entity | denotes | nuclear | ||
T15795 | 40280-40289 | Localization | denotes | transport | ||
T15796 | 40280-40289 | Localization | denotes | transport | ||
T15797 | 40298-40304 | Protein | denotes | GATA-3 | ||
T15798 | 40309-40311 | Protein | denotes | GR | ||
T15799 | 40364-40372 | Positive_regulation | denotes | increase | ||
T15800 | 40377-40387 | Gene_expression | denotes | expression | ||
T15801 | 40391-40396 | Protein | denotes | MKP-1 | ||
T15802 | 40512-40519 | Negative_regulation | denotes | prevent | ||
T15803 | 40524-40539 | Phosphorylation | denotes | phosphorylation | ||
T15804 | 40543-40549 | Protein | denotes | GATA-3 | ||
T15805 | 40558-40567 | Positive_regulation | denotes | necessary | ||
T15806 | 40558-40567 | Positive_regulation | denotes | necessary | ||
T15807 | 40572-40583 | Binding | denotes | interaction | ||
T15808 | 40604-40614 | Positive_regulation | denotes | subsequent | ||
T15809 | 40615-40622 | Entity | denotes | nuclear | ||
T15810 | 40623-40629 | Localization | denotes | import | ||
T15811 | 40661-40674 | Localization | denotes | translocation | ||
T15812 | 40678-40684 | Protein | denotes | GATA-3 | ||
T15813 | 40711-40718 | Entity | denotes | nucleus | ||
T15814 | 40719-40727 | Regulation | denotes | involves | ||
T15815 | 40778-40787 | Binding | denotes | interacts | ||
T15816 | 40793-40807 | Phosphorylation | denotes | phosphorylated | ||
T15817 | 40808-40814 | Protein | denotes | GATA-3 | ||
T15818 | 40859-40865 | Protein | denotes | GATA-3 | ||
T15819 | 40866-40875 | Gene_expression | denotes | knockdown | true | |
T15820 | 40899-40910 | Negative_regulation | denotes | suppression | ||
T15821 | 40899-40910 | Negative_regulation | denotes | suppression | ||
T15822 | 40928-40938 | Positive_regulation | denotes | stimulated | ||
T15823 | 40928-40938 | Positive_regulation | denotes | stimulated | ||
T15824 | 40939-40943 | Protein | denotes | IL-4 | ||
T15825 | 40944-40948 | Protein | denotes | IL-5 | ||
T15826 | 40954-40963 | Transcription | denotes | induction | ||
T15827 | 40954-40963 | Transcription | denotes | induction | ||
T15828 | 40995-40999 | Regulation | denotes | role | ||
T15829 | 40995-40999 | Regulation | denotes | role | ||
T15830 | 41004-41010 | Protein | denotes | GATA-3 | ||
T15831 | 41018-41031 | Transcription | denotes | transcription | ||
T15832 | 41018-41031 | Transcription | denotes | transcription | ||
T15833 | 41092-41094 | Protein | denotes | GR | ||
T15834 | 41114-41121 | Entity | denotes | nuclear | ||
T15835 | 41122-41128 | Localization | denotes | import | ||
T15836 | 41142-41148 | Protein | denotes | GATA-3 | ||
T15837 | 41190-41201 | Negative_regulation | denotes | competition | true | |
T15838 | 41227-41229 | Protein | denotes | GR | ||
T15839 | 41234-41241 | Phosphorylation | denotes | phospho | ||
T15840 | 41242-41248 | Protein | denotes | GATA-3 | ||
T15841 | 41253-41260 | Entity | denotes | nuclear | ||
T15842 | 41261-41267 | Localization | denotes | import | ||
T15843 | 41323-41330 | Binding | denotes | binding | ||
T15844 | 41323-41330 | Binding | denotes | binding | ||
T15845 | 41348-41357 | Positive_regulation | denotes | activated | ||
T15846 | 41358-41360 | Protein | denotes | GR | ||
T15847 | 41366-41373 | Phosphorylation | denotes | phospho | ||
T15848 | 41374-41380 | Protein | denotes | GATA-3 | ||
T15849 | 41427-41433 | Negative_regulation | denotes | reduce | true | |
T15850 | 41434-41440 | Protein | denotes | GATA-3 | ||
T15851 | 41441-41446 | Localization | denotes | entry | ||
T15852 | 41597-41603 | Protein | denotes | GATA-3 | ||
T15853 | 41608-41615 | Entity | denotes | nuclear | ||
T15854 | 41616-41629 | Localization | denotes | translocation | ||
T15855 | 41637-41640 | Protein | denotes | p65 | ||
T15856 | 41666-41674 | Regulation | denotes | affected | true | |
T15857 | 41747-41758 | Negative_regulation | denotes | this effect | ||
T15858 | 41768-41774 | Protein | denotes | GATA-3 | ||
T15859 | 41775-41782 | Entity | denotes | nuclear | ||
T15860 | 41783-41792 | Localization | denotes | exclusion | ||
T15861 | 41827-41835 | Positive_regulation | denotes | enhances | true | |
T15862 | 41836-41842 | Protein | denotes | GATA-3 | ||
T15863 | 41843-41850 | Entity | denotes | nuclear | ||
T15864 | 41851-41857 | Localization | denotes | export | ||
T15865 | 41870-41877 | Positive_regulation | denotes | induces | true | |
T15866 | 41878-41884 | Protein | denotes | GATA-3 | ||
T15867 | 41885-41896 | Protein_catabolism | denotes | degradation | ||
T15868 | 41985-41994 | Positive_regulation | denotes | activated | ||
T15869 | 41995-41997 | Protein | denotes | GR | ||
T15870 | 42010-42019 | Negative_regulation | denotes | attenuate | ||
T15871 | 42029-42036 | Phosphorylation | denotes | phospho | ||
T15872 | 42037-42043 | Protein | denotes | GATA-3 | ||
T15873 | 42055-42066 | Binding | denotes | association | ||
T15874 | 42142-42149 | Phosphorylation | denotes | phospho | ||
T15875 | 42150-42156 | Protein | denotes | GATA-3 | ||
T15876 | 42161-42170 | Binding | denotes | associate | ||
T15877 | 42368-42378 | Positive_regulation | denotes | contribute | true | |
T15878 | 42386-42395 | Negative_regulation | denotes | reduction | ||
T15879 | 42399-42405 | Protein | denotes | GATA-3 | ||
T15880 | 42406-42413 | Entity | denotes | nuclear | ||
T15881 | 42414-42420 | Localization | denotes | import | ||
T15882 | 42442-42446 | Regulation | denotes | role | true | |
T15883 | 42521-42526 | Protein | denotes | MKP-1 | ||
T15884 | 42527-42536 | Gene_expression | denotes | induction | ||
T15885 | 42597-42606 | Positive_regulation | denotes | induction | ||
T15886 | 42610-42615 | Protein | denotes | MKP-1 | ||
T15887 | 42698-42707 | Gene_expression | denotes | induction | ||
T15888 | 42711-42716 | Protein | denotes | MKP-1 | ||
T15889 | 42722-42731 | Positive_regulation | denotes | following | ||
T15890 | 42827-42836 | Gene_expression | denotes | induction | ||
T15891 | 42840-42845 | Protein | denotes | MKP-1 | ||
T15892 | 42850-42856 | Negative_regulation | denotes | reduce | ||
T15893 | 42857-42863 | Protein | denotes | GATA-3 | ||
T15894 | 42864-42871 | Entity | denotes | nuclear | ||
T15895 | 42872-42878 | Localization | denotes | import | ||
T15896 | 42882-42893 | Negative_regulation | denotes | attenuating | ||
T15897 | 42916-42926 | Regulation | denotes | subsequent | ||
T15898 | 42927-42933 | Protein | denotes | GATA-3 | ||
T15899 | 42934-42949 | Phosphorylation | denotes | phosphorylation | ||
T15900 | 42956-42966 | Negative_regulation | denotes | preventing | true | |
T15901 | 42967-42974 | Entity | denotes | nuclear | ||
T15902 | 42975-42988 | Localization | denotes | translocation | ||
T15903 | 43010-43024 | Entity | denotes | serine residue | ||
T15904 | 43031-43037 | Protein | denotes | GATA-3 | ||
T15905 | 43047-43061 | Phosphorylation | denotes | phosphorylated | ||
T15906 | 43296-43306 | Negative_regulation | denotes | impairment | ||
T15907 | 43310-43316 | Protein | denotes | GATA-3 | ||
T15908 | 43317-43324 | Entity | denotes | nuclear | ||
T15909 | 43325-43331 | Localization | denotes | import | ||
T15910 | 43477-43494 | Negative_regulation | denotes | inhibitory effect | true | true |
T15911 | 43508-43518 | Transcription | denotes | expression | ||
T15912 | 43522-43526 | Protein | denotes | IL-4 | ||
T15913 | 43684-43692 | Negative_regulation | denotes | suppress | ||
T15914 | 43693-43697 | Protein | denotes | IL-4 | ||
T15915 | 43698-43711 | Transcription | denotes | transcription | ||
T15916 | 43854-43860 | Protein | denotes | GATA-3 | ||
T15917 | 43861-43871 | Negative_regulation | denotes | inhibition | ||
T15918 | 43998-44008 | Negative_regulation | denotes | inhibiting | ||
T15919 | 44009-44015 | Protein | denotes | GATA-3 | ||
T15920 | 44343-44351 | Negative_regulation | denotes | suppress | ||
T15921 | 44343-44351 | Negative_regulation | denotes | suppress | ||
T15922 | 44352-44356 | Protein | denotes | IL-4 | ||
T15923 | 44361-44365 | Protein | denotes | IL-5 | ||
T15924 | 44366-44373 | Localization | denotes | release | ||
T15925 | 44366-44373 | Localization | denotes | release | ||
T15926 | 44583-44600 | Negative_regulation | denotes | inhibitory effect | ||
T15927 | 44583-44600 | Negative_regulation | denotes | inhibitory effect | ||
T15928 | 44604-44610 | Protein | denotes | GATA-3 | ||
T15929 | 44611-44618 | Entity | denotes | nuclear | ||
T15930 | 44619-44632 | Localization | denotes | translocation | ||
T15931 | 44649-44656 | Binding | denotes | binding | ||
T15932 | 44741-44750 | Positive_regulation | denotes | increased | ||
T15933 | 44751-44760 | Gene_expression | denotes | synthesis | ||
T15934 | 44764-44769 | Protein | denotes | MKP-1 | ||
T15935 | 44801-44811 | Negative_regulation | denotes | preventing | ||
T15936 | 44816-44831 | Phosphorylation | denotes | phosphorylation | ||
T15937 | 44835-44841 | Protein | denotes | GATA-3 | ||
T15938 | 44850-44859 | Positive_regulation | denotes | necessary | ||
T15939 | 44864-44871 | Entity | denotes | nuclear | ||
T15940 | 44872-44885 | Localization | denotes | translocation | ||
T15941 | 44889-44895 | Protein | denotes | GATA-3 | ||
T15942 | 45236-45246 | Negative_regulation | denotes | Prevention | ||
T15943 | 45250-45257 | Phosphorylation | denotes | phospho | ||
T15944 | 45258-45264 | Protein | denotes | GATA-3 | ||
T15945 | 45265-45276 | Binding | denotes | interaction | ||
T16674 | 24390-24398 | Negative_regulation | denotes | inhibits | ||
T16675 | 24399-24405 | Protein | denotes | GATA-3 | ||
T16676 | 24406-24413 | Entity | denotes | nuclear | ||
T16677 | 24414-24420 | Localization | denotes | import | ||
T16678 | 24477-24490 | Localization | denotes | translocation | ||
T16679 | 24494-24500 | Protein | denotes | GATA-3 | ||
T16680 | 24527-24534 | Entity | denotes | nucleus | ||
T16681 | 24569-24574 | Protein | denotes | MEK-1 | ||
T16682 | 24758-24765 | Entity | denotes | nuclear | ||
T16683 | 24766-24778 | Localization | denotes | localization | ||
T16684 | 24782-24788 | Protein | denotes | GATA-3 | ||
T16685 | 24789-24796 | Positive_regulation | denotes | induced | ||
T16686 | 24985-24989 | Protein | denotes | MEK1 | ||
T16687 | 25235-25243 | Negative_regulation | denotes | inhibits | ||
T16688 | 25235-25243 | Negative_regulation | denotes | inhibits | ||
T16689 | 25244-25248 | Protein | denotes | IL-4 | ||
T16690 | 25253-25257 | Protein | denotes | IL-5 | ||
T16691 | 25258-25273 | Transcription | denotes | mRNA expression | ||
T16692 | 25258-25273 | Transcription | denotes | mRNA expression | ||
T16693 | 25277-25280 | Protein | denotes | CD3 | ||
T16694 | 25281-25285 | Protein | denotes | CD28 | ||
T16695 | 25286-25298 | Regulation | denotes | costimulated | ||
T16696 | 25286-25298 | Regulation | denotes | costimulated | ||
T16697 | 25553-25560 | Negative_regulation | denotes | reduces | ||
T16698 | 25590-25600 | Positive_regulation | denotes | stimulated | ||
T16699 | 25601-25607 | Protein | denotes | GATA-3 | ||
T16700 | 25611-25620 | Binding | denotes | associate | ||
T16701 | 25637-25641 | Protein | denotes | IL-5 | ||
T16702 | 25642-25650 | Entity | denotes | promoter | ||
T17478 | 26758-26765 | Negative_regulation | denotes | reduces | ||
T17479 | 26758-26765 | Negative_regulation | denotes | reduces | ||
T17480 | 26766-26772 | Protein | denotes | GATA-3 | ||
T17481 | 26773-26784 | Binding | denotes | association | ||
T17482 | 26805-26811 | Protein | denotes | GATA-3 | ||
T17483 | 26812-26819 | Entity | denotes | nuclear | ||
T17484 | 26820-26826 | Localization | denotes | import | ||
T17485 | 26939-26948 | Regulation | denotes | dependent | ||
T17486 | 26949-26958 | Positive_regulation | denotes | induction | ||
T17487 | 26965-26974 | Positive_regulation | denotes | activated | ||
T17488 | 26975-26977 | Protein | denotes | GR | ||
T17489 | 26978-26989 | Binding | denotes | interaction | ||
T17490 | 27038-27040 | Protein | denotes | GR | ||
T17491 | 27041-27052 | Binding | denotes | association | ||
T17492 | 27362-27371 | Regulation | denotes | dependent | ||
T17493 | 27372-27381 | Positive_regulation | denotes | induction | ||
T17494 | 27388-27397 | Positive_regulation | denotes | activated | ||
T17495 | 27398-27400 | Protein | denotes | GR | ||
T17496 | 27401-27408 | Entity | denotes | nuclear | ||
T17497 | 27409-27422 | Localization | denotes | translocation | ||
T17498 | 27719-27728 | Regulation | denotes | dependent | ||
T17499 | 27729-27737 | Negative_regulation | denotes | decrease | ||
T17500 | 27741-27747 | Protein | denotes | GATA-3 | ||
T17501 | 27759-27770 | Binding | denotes | association | ||
T17502 | 28009-28015 | Protein | denotes | GATA-3 | ||
T17503 | 28020-28033 | Gene_expression | denotes | overexpressed | ||
T18198 | 29498-29508 | Regulation | denotes | associated | ||
T18199 | 29523-29538 | Negative_regulation | denotes | down-regulation | ||
T18200 | 29542-29548 | Protein | denotes | GATA-3 | ||
T18201 | 29549-29555 | Entity | denotes | serine | ||
T18202 | 29556-29571 | Phosphorylation | denotes | phosphorylation | ||
T18203 | 29782-29788 | Regulation | denotes | effect | ||
T18204 | 29807-29822 | Phosphorylation | denotes | phosphorylation | ||
T18205 | 29826-29858 | Protein | denotes | activated transcription factor 2 | ||
T18206 | 29860-29865 | Protein | denotes | ATF-2 | ||
T18207 | 29970-29978 | Negative_regulation | denotes | decrease | ||
T18208 | 30011-30018 | Positive_regulation | denotes | induced | ||
T18209 | 30019-30025 | Entity | denotes | serine | ||
T18210 | 30026-30041 | Phosphorylation | denotes | phosphorylation | ||
T18211 | 30053-30059 | Protein | denotes | GATA-3 | ||
T18212 | 30290-30297 | Positive_regulation | denotes | induced | ||
T18213 | 30298-30303 | Protein | denotes | MKP-1 | ||
T18214 | 30328-30337 | Regulation | denotes | dependent | ||
T18215 | 30481-30488 | Positive_regulation | denotes | induces | ||
T18216 | 30489-30494 | Protein | denotes | MKP-1 | ||
T18217 | 30510-30519 | Regulation | denotes | dependent | ||
T18606 | 31490-31497 | Phosphorylation | denotes | phospho | ||
T18607 | 31498-31504 | Protein | denotes | GATA-3 | ||
T18608 | 31597-31599 | Protein | denotes | GR | ||
T18609 | 31643-31651 | Positive_regulation | denotes | enhances | ||
T18610 | 31652-31654 | Protein | denotes | GR | ||
T18611 | 31666-31673 | Binding | denotes | binding | ||
T18612 | 31723-31729 | Protein | denotes | GATA-3 | ||
T18613 | 31755-31764 | Positive_regulation | denotes | activated | ||
T18614 | 31765-31767 | Protein | denotes | GR | ||
T18615 | 31773-31779 | Protein | denotes | GATA-3 | ||
T18616 | 31834-31843 | Negative_regulation | denotes | attenuate | true | |
T18617 | 31844-31846 | Protein | denotes | GR | ||
T18618 | 31858-31869 | Binding | denotes | association | ||
T18619 | 31904-31913 | Positive_regulation | denotes | Activated | ||
T18620 | 31914-31916 | Protein | denotes | GR | ||
T18621 | 31917-31923 | Negative_regulation | denotes | blocks | ||
T18622 | 31948-31955 | Phosphorylation | denotes | phospho | ||
T18623 | 31956-31962 | Protein | denotes | GATA-3 | ||
T18624 | 32008-32019 | Binding | denotes | interacting | ||
T18625 | 32098-32104 | Protein | denotes | GATA-3 | ||
T18626 | 32160-32170 | Positive_regulation | denotes | stimulated | ||
T18627 | 32171-32177 | Protein | denotes | GATA-3 | ||
T18628 | 32187-32194 | Binding | denotes | binding | ||
T18629 | 32214-32223 | Positive_regulation | denotes | activated | ||
T18630 | 32235-32247 | Positive_regulation | denotes | unstimulated | true | |
T18631 | 32252-32254 | Protein | denotes | GR | ||
T18632 | 32258-32269 | Negative_regulation | denotes | attenuation | ||
T18633 | 32273-32279 | Protein | denotes | GATA-3 | ||
T18634 | 32291-32302 | Binding | denotes | association | ||
T18635 | 32321-32330 | Regulation | denotes | dependent | ||
T19230 | 33294-33300 | Regulation | denotes | affect | true | |
T19231 | 33301-33307 | Protein | denotes | GATA-3 | ||
T19232 | 33316-33322 | Localization | denotes | export | ||
T19233 | 33421-33427 | Regulation | denotes | affect | true | |
T19234 | 33458-33465 | Negative_regulation | denotes | prevent | ||
T19235 | 33480-33490 | Positive_regulation | denotes | stimulated | ||
T19236 | 33491-33497 | Protein | denotes | GATA-3 | ||
T19237 | 33498-33505 | Entity | denotes | nuclear | ||
T19238 | 33506-33518 | Localization | denotes | localization | ||
T20332 | 38007-38014 | Negative_regulation | denotes | impairs | ||
T20333 | 38015-38021 | Protein | denotes | GATA-3 | ||
T20334 | 38022-38029 | Entity | denotes | nuclear | ||
T20335 | 38030-38042 | Localization | denotes | localization | ||
T20336 | 38140-38142 | Protein | denotes | GR | ||
T20337 | 38147-38153 | Protein | denotes | GATA-3 | ||
T20338 | 38154-38161 | Entity | denotes | nuclear | ||
T20339 | 38162-38174 | Localization | denotes | localisation | ||
T20340 | 38162-38174 | Localization | denotes | localisation | ||
T20341 | 38188-38194 | Protein | denotes | GATA-3 | ||
T20342 | 38540-38549 | Regulation | denotes | dependent | ||
T20343 | 38540-38549 | Regulation | denotes | dependent | ||
T20344 | 38550-38558 | Negative_regulation | denotes | decrease | ||
T20345 | 38562-38569 | Entity | denotes | nuclear | ||
T20346 | 38570-38580 | Localization | denotes | expression | ||
T20347 | 38584-38590 | Protein | denotes | GATA-3 | ||
T20348 | 38596-38605 | Positive_regulation | denotes | increased | ||
T20349 | 38606-38617 | Entity | denotes | cytoplasmic | ||
T20350 | 38618-38624 | Protein | denotes | GATA-3 | ||
T20351 | 38625-38635 | Localization | denotes | expression | ||
T20352 | 38727-38735 | Negative_regulation | denotes | decrease | ||
T20353 | 38739-38746 | Entity | denotes | nuclear | ||
T20354 | 38747-38757 | Localization | denotes | expression | ||
T20355 | 38761-38767 | Protein | denotes | GATA-3 | ||
T20356 | 38783-38794 | Entity | denotes | cytoplasmic | ||
T20357 | 38795-38801 | Protein | denotes | GATA-3 | ||
T20358 | 38802-38812 | Localization | denotes | expression | ||
T20359 | 38856-38861 | Protein | denotes | MEK-1 | ||
T4329 | 13206-13209 | Protein | denotes | CD3 | ||
T4330 | 13211-13215 | Protein | denotes | CD28 | ||
T4331 | 13217-13219 | Protein | denotes | GR | ||
T4332 | 13329-13335 | Protein | denotes | GATA-3 | ||
T4333 | 13347-13349 | Protein | denotes | GR | ||
T4334 | 13523-13528 | Protein | denotes | ATF-2 | ||
T4606 | 14481-14487 | Protein | denotes | GATA-3 | ||
T4607 | 14488-14500 | Localization | denotes | localization | ||
T4842 | 14968-14972 | Protein | denotes | IL-4 | ||
T5188 | 15633-15639 | Protein | denotes | GATA-3 | ||
T5459 | 16391-16395 | Protein | denotes | IL-5 | ||
T6260 | 18143-18146 | Protein | denotes | p65 | ||
T7155 | 19780-19786 | Protein | denotes | GATA-3 | ||
T7156 | 19787-19790 | Protein | denotes | GFP | ||
T7157 | 19805-19811 | Protein | denotes | GATA-3 | ||
T7158 | 19923-19929 | Protein | denotes | GATA-3 | ||
T7159 | 19951-19957 | Protein | denotes | GATA-3 | ||
T7160 | 19987-19991 | Protein | denotes | XhoI | ||
T7161 | 20075-20080 | Protein | denotes | BamHI | ||
T7162 | 20161-20167 | Protein | denotes | GATA-3 | ||
T7163 | 20427-20433 | Protein | denotes | GATA-3 | ||
T7164 | 20451-20454 | Protein | denotes | GFP | ||
T7165 | 20494-20499 | Protein | denotes | EcoRI | ||
T7166 | 20533-20539 | Protein | denotes | GATA-3 | ||
T7167 | 20595-20598 | Protein | denotes | GFP | ||
T7603 | 21208-21218 | Gene_expression | denotes | expressing | ||
T7604 | 21219-21229 | Protein | denotes | GATA-3-GFP | ||
T19239 | 33698-33704 | Regulation | denotes | affect | true | |
T19240 | 33716-33722 | Protein | denotes | GATA-3 | ||
T19241 | 33723-33734 | Protein_catabolism | denotes | degradation | ||
T19242 | 33761-33767 | Protein | denotes | GATA-3 | ||
T19243 | 33978-33985 | Negative_regulation | denotes | prevent | true | |
T19244 | 34000-34010 | Positive_regulation | denotes | stimulated | ||
T19245 | 34011-34014 | Protein | denotes | p65 | ||
T19246 | 34015-34022 | Entity | denotes | nuclear | ||
T19247 | 34023-34036 | Localization | denotes | translocation | ||
T19629 | 34812-34819 | Negative_regulation | denotes | impairs | ||
T19630 | 34812-34819 | Negative_regulation | denotes | impairs | ||
T19631 | 34820-34826 | Protein | denotes | GATA-3 | ||
T19632 | 34827-34838 | Binding | denotes | interaction | ||
T19633 | 34859-34865 | Protein | denotes | GATA-3 | ||
T19634 | 34866-34873 | Entity | denotes | nuclear | ||
T19635 | 34874-34886 | Localization | denotes | localization | ||
T19636 | 35032-35040 | Negative_regulation | denotes | impaired | ||
T19637 | 35041-35052 | Binding | denotes | interaction | ||
T19638 | 35061-35067 | Protein | denotes | GATA-3 | ||
T19639 | 35412-35421 | Negative_regulation | denotes | decreased | ||
T19640 | 35422-35433 | Binding | denotes | association | ||
T19641 | 35442-35448 | Protein | denotes | GATA-3 | ||
R684 | T884 | T882 | themeOf | expression,regulating | ||
R686 | T885 | T881 | themeOf | expression,regulating | ||
R688 | T886 | T884 | themeOf | interleukin (IL)-4,expression | ||
R689 | T887 | T883 | themeOf | IL-5,expression | ||
R690 | T888 | T885 | themeOf | IL-13,expression | ||
R692 | T891 | T892 | themeOf | GATA-3,regulation | ||
R694 | T892 | T890 | themeOf | regulation,effect | ||
R695 | T894 | T895 | locationOf | nuclear,translocation | ||
R696 | T895 | T893 | themeOf | translocation,inhibits | ||
R697 | T896 | T895 | themeOf | GATA-3,translocation | ||
R704 | T899 | T904 | themeOf | GATA-3,transport | ||
R707 | T901 | T903 | themeOf | glucocorticoid receptor,transport | ||
R708 | T901 | T900 | themeOf | glucocorticoid receptor,activated | ||
R709 | T902 | T904 | locationOf | nuclear,transport | ||
R710 | T902 | T903 | locationOf | nuclear,transport | ||
R712 | T903 | T897 | themeOf | transport,competition | ||
R714 | T904 | T898 | themeOf | transport,competition | ||
R715 | T906 | T905 | themeOf | expression,induces | ||
R716 | T907 | T906 | themeOf | mitogen-activated protein kinase (MAPK) phosphatase-1,expression | ||
R717 | T908 | T907 | equivalentTo | MKP-1,mitogen-activated protein kinase (MAPK) phosphatase-1 | ||
R718 | T910 | T912 | themeOf | GATA-3,translocation | ||
R720 | T911 | T912 | locationOf | nuclear,translocation | ||
R722 | T912 | T909 | themeOf | translocation,necessary | ||
R723 | T914 | T916 | themeOf | GATA-3,translocation | ||
R724 | T915 | T916 | locationOf | nuclear,translocation | ||
R725 | T916 | T913 | themeOf | translocation,inhibits | ||
R727 | T918 | T917 | themeOf | GATA-3,inhibitory effect | ||
R741 | T875 | T878 | themeOf | GATA-3,Phosphorylation | ||
R749 | T875 | T877 | themeOf | GATA-3,Import | ||
R751 | T876 | T877 | locationOf | Nuclear,Import | ||
R753 | T877 | T873 | themeOf | Import,Suppression | ||
R757 | T878 | T874 | themeOf | Phosphorylation,Suppression | ||
R760 | T879 | T882 | causeOf | GATA-3,regulating | ||
R762 | T879 | T880 | causeOf | GATA-3,regulating | ||
R763 | T879 | T881 | causeOf | GATA-3,regulating | ||
R766 | T883 | T880 | themeOf | expression,regulating | ||
R3043 | T3562 | T3563 | themeOf | GATA-3,expressed | ||
R3044 | T3564 | T3566 | causeOf | GATA-3,activates | ||
R3045 | T3564 | T3567 | causeOf | GATA-3,activates | ||
R3046 | T3564 | T3565 | causeOf | GATA-3,activates | ||
R3049 | T3568 | T3566 | themeOf | promoters,activates | ||
R3050 | T3568 | T3570 | partOf | promoters,IL-5 | ||
R3051 | T3568 | T3567 | themeOf | promoters,activates | ||
R3052 | T3568 | T3569 | partOf | promoters,IL-4 | ||
R3053 | T3568 | T3565 | themeOf | promoters,activates | ||
R3054 | T3568 | T3571 | partOf | promoters,IL-13 | ||
R3059 | T3578 | T3579 | themeOf | GATA-3,expression | ||
R3060 | T3579 | T3577 | themeOf | expression,knockdown | ||
R3062 | T3580 | T3581 | themeOf | GATA-3,translocate | ||
R3063 | T3580 | T3583 | themeOf | GATA-3,access | ||
R3064 | T3580 | T3584 | themeOf | GATA-3,target | ||
R3065 | T3582 | T3581 | locationOf | nucleus,translocate | ||
R3069 | T3585 | T3586 | locationOf | nuclear,expression | ||
R3070 | T3586 | T3588 | themeOf | expression,following | ||
R3071 | T3586 | T3589 | themeOf | expression,following | ||
R3073 | T3587 | T3586 | themeOf | GATA-3,expression | ||
R3075 | T3590 | T3591 | themeOf | GATA-3,transported | ||
R3076 | T3592 | T3591 | locationOf | nucleus,transported | ||
R3079 | T3595 | T3594 | themeOf | phosphorylating,role | ||
R3080 | T3595 | T3597 | causeOf | phosphorylating,enhance | ||
R3081 | T3596 | T3595 | themeOf | GATA-3,phosphorylating | ||
R3082 | T3596 | T3598 | themeOf | GATA-3,interaction | ||
R3084 | T3598 | T3597 | themeOf | interaction,enhance | ||
R3085 | T3600 | T3599 | themeOf | glucocorticoid receptors,binding | ||
R3086 | T3600 | T3602 | themeOf | glucocorticoid receptors,translocate | ||
R3087 | T3600 | T3604 | themeOf | glucocorticoid receptors,interact | ||
R3089 | T3601 | T3600 | equivalentTo | GRs,glucocorticoid receptors | ||
R3091 | T3603 | T3602 | locationOf | nucleus,translocate | ||
R3092 | T3606 | T3605 | themeOf | GR,activated | ||
R3093 | T3606 | T3607 | themeOf | GR,interacts | ||
R3094 | T3606 | T3608 | themeOf | GR,recruitment | ||
R3096 | T3609 | T3608 | themeOf | histone deacetylase-2,recruitment | ||
R3097 | T3610 | T3611 | locationOf | Nuclear,localisation | ||
R3098 | T3611 | T3615 | themeOf | localisation,mediated | ||
R3099 | T3612 | T3614 | themeOf | retention,mediated | ||
R3100 | T3613 | T3611 | themeOf | GR,localisation | ||
R3101 | T3613 | T3612 | themeOf | GR,retention | ||
R3102 | T3613 | T3618 | themeOf | GR,export | ||
R3103 | T3616 | T3615 | causeOf | control,mediated | ||
R3104 | T3616 | T3614 | causeOf | control,mediated | ||
R3105 | T3616 | T3621 | themeOf | control,dependent | ||
R3106 | T3617 | T3618 | locationOf | nuclear,export | ||
R3107 | T3618 | T3616 | themeOf | export,control | ||
R3108 | T3619 | T3621 | causeOf | chromosomal region maintenance 1,dependent | ||
R3109 | T3620 | T3619 | equivalentTo | CRM-1,chromosomal region maintenance 1 | ||
R3110 | T3622 | T3623 | themeOf | NL1,binds | ||
R3111 | T3622 | T3613 | partOf | NL1,GR | ||
R3112 | T3625 | T3626 | themeOf | GR,translocates | ||
R3113 | T3625 | T3629 | themeOf | GR,interaction | ||
R3114 | T3626 | T3624 | themeOf | translocates,resulting | ||
R3115 | T3626 | T3628 | themeOf | translocates,in response to | ||
R3116 | T3627 | T3626 | locationOf | nucleus,translocates | ||
R3117 | T3629 | T3628 | causeOf | interaction,in response to | ||
R3118 | T3629 | T3631 | themeOf | interaction,requires | ||
R3119 | T3630 | T3629 | themeOf | importin 7,interaction | ||
R3120 | T3632 | T3633 | themeOf | GR,import | ||
R3121 | T3635 | T3634 | themeOf | regulation,important | ||
R3122 | T3636 | T3637 | themeOf | GR,activation | ||
R3123 | T3637 | T3635 | themeOf | activation,regulation | ||
R3124 | T3638 | T3641 | themeOf | IL-4,regulated | ||
R3125 | T3639 | T3643 | themeOf | IL-5,regulated | ||
R3126 | T3640 | T3642 | themeOf | IL-13,regulated | ||
R3127 | T3645 | T3646 | causeOf | GR,reduced | ||
R3128 | T3645 | T3647 | causeOf | GR,reduced | ||
R3129 | T3648 | T3649 | causeOf | GATA-3,mediated | ||
R3130 | T3648 | T3650 | causeOf | GATA-3,mediated | ||
R3131 | T3649 | T3646 | themeOf | mediated,reduced | ||
R3132 | T3650 | T3647 | themeOf | mediated,reduced | ||
R3133 | T3651 | T3653 | themeOf | IL-5,activity | ||
R3134 | T3652 | T3654 | themeOf | -13,activity | ||
R3135 | T3653 | T3649 | themeOf | activity,mediated | ||
R3136 | T3654 | T3650 | themeOf | activity,mediated | ||
R3137 | T3656 | T3658 | causeOf | recruitment,alter | ||
R3138 | T3657 | T3656 | themeOf | GR,recruitment | ||
R3139 | T3659 | T3660 | themeOf | GATA-3,bind | ||
R3140 | T3660 | T3658 | themeOf | bind,alter | ||
R3141 | T3663 | T3664 | themeOf | GATA-3,phosphorylation | ||
R3142 | T3663 | T3666 | themeOf | GATA-3,translocation | ||
R3143 | T3664 | T3662 | themeOf | phosphorylation,effects | ||
R3144 | T3665 | T3666 | locationOf | nuclear,translocation | ||
R3145 | T3666 | T3661 | themeOf | translocation,effects | ||
R3146 | T3668 | T3669 | themeOf | GATA-3,localization | ||
R3147 | T3669 | T3667 | themeOf | localization,effects | ||
R7591 | T8797 | T8799 | themeOf | GATA-3,Translocation | ||
R7592 | T8798 | T8799 | locationOf | Nuclear,Translocation | ||
R7593 | T8799 | T8795 | themeOf | Translocation,Effect | ||
R7594 | T8800 | T8796 | themeOf | IL-4,Effect | ||
R7595 | T8802 | T8801 | themeOf | inhibiting,effective | ||
R7596 | T8803 | T8804 | causeOf | GATA-3,regulated | ||
R7597 | T8804 | T8802 | themeOf | regulated,inhibiting | ||
R7598 | T8805 | T8806 | themeOf | IL-4,expression | ||
R7599 | T8806 | T8804 | themeOf | expression,regulated | ||
R7600 | T8808 | T8807 | themeOf | stimulated,affect | ||
R7601 | T8809 | T8810 | locationOf | nuclear,import | ||
R7602 | T8810 | T8808 | themeOf | import,stimulated | ||
R7603 | T8811 | T8810 | themeOf | GATA-3,import | ||
R7604 | T8813 | T8815 | locationOf | nuclear,translocation | ||
R7605 | T8814 | T8815 | themeOf | GATA-3,translocation | ||
R7606 | T8815 | T8812 | themeOf | translocation,resulted | ||
R7607 | T8819 | T8818 | themeOf | loss,caused | ||
R7608 | T8820 | T8822 | locationOf | nuclear,expression | ||
R7609 | T8821 | T8822 | themeOf | GATA-3,expression | ||
R7610 | T8822 | T8819 | themeOf | expression,loss | ||
R7611 | T8823 | T8824 | locationOf | cytoplasmic,retention | ||
R7612 | T8824 | T8817 | themeOf | retention,caused | ||
R7613 | T8825 | T8824 | themeOf | GATA-3,retention | ||
R7614 | T8826 | T8831 | themeOf | This effect,dependent | ||
R7615 | T8827 | T8830 | themeOf | This effect,dependent | ||
R7616 | T8828 | T8829 | themeOf | This effect,dependent | ||
R7617 | T8832 | T8827 | themeOf | associated,This effect | ||
R7618 | T8833 | T8828 | themeOf | associated,This effect | ||
R7619 | T8834 | T8826 | themeOf | associated,This effect | ||
R7620 | T8835 | T8834 | themeOf | reductions,associated | ||
R7621 | T8836 | T8832 | themeOf | reductions,associated | ||
R7622 | T8837 | T8835 | themeOf | stimulated,reductions | ||
R7623 | T8838 | T8836 | themeOf | stimulated,reductions | ||
R7624 | T8839 | T8842 | themeOf | IL-4,mRNA expression | ||
R7625 | T8840 | T8841 | themeOf | IL-5,mRNA expression | ||
R7626 | T8841 | T8838 | themeOf | mRNA expression,stimulated | ||
R7627 | T8842 | T8837 | themeOf | mRNA expression,stimulated | ||
R7628 | T8843 | T8833 | themeOf | loss,associated | ||
R7629 | T8844 | T8845 | themeOf | GATA-3,binding | ||
R7630 | T8845 | T8843 | themeOf | binding,loss | ||
R7631 | T8847 | T8845 | themeOf | promoter,binding | ||
R7632 | T8847 | T8846 | partOf | promoter,IL-5 | ||
R8068 | T9373 | T9374 | locationOf | nuclear,translocation | ||
R8069 | T9375 | T9379 | themeOf | decreased,dependent | ||
R8070 | T9376 | T9375 | themeOf | association,decreased | ||
R8071 | T9376 | T9378 | themeOf | association,induced | ||
R8072 | T9377 | T9376 | themeOf | GATA-3,association | ||
R8073 | T9381 | T9383 | themeOf | GATA-3,import | ||
R8074 | T9382 | T9383 | locationOf | nuclear,import | ||
R8075 | T9383 | T9384 | themeOf | import,following | ||
R8076 | T9383 | T9385 | themeOf | import,attenuated | ||
R9420 | T10993 | T10992 | themeOf | MKP-1,induction | ||
R9421 | T10994 | T10993 | equivalentTo | MAPK phosphatase-1,MKP-1 | ||
R9422 | T10996 | T10995 | themeOf | phosphorylation,decreased | ||
R9423 | T10998 | T10996 | themeOf | ATF-2,phosphorylation | ||
R9424 | T10998 | T10997 | themeOf | ATF-2,target | ||
R9425 | T10999 | T11004 | themeOf | reduced,dependent | ||
R9426 | T11001 | T11002 | themeOf | serine,phosphorylation | ||
R9427 | T11001 | T11000 | partOf | serine,GATA-3 | ||
R9428 | T11002 | T10999 | themeOf | phosphorylation,reduced | ||
R9429 | T11002 | T11003 | themeOf | phosphorylation,induced | ||
R9430 | T11006 | T11007 | themeOf | GATA-3,phosphorylation | ||
R9431 | T11007 | T11005 | themeOf | phosphorylation,This reduction | ||
R9432 | T11008 | T11011 | themeOf | induced,dependent | ||
R9433 | T11009 | T11010 | themeOf | MKP-1,mRNA | ||
R9434 | T11010 | T11008 | themeOf | mRNA,induced | ||
R9435 | T11015 | T11017 | themeOf | GATA-3,import | ||
R9436 | T11015 | T11018 | themeOf | GATA-3,association | ||
R9437 | T11016 | T11017 | locationOf | nuclear,import | ||
R9438 | T11017 | T11014 | themeOf | import,effects | ||
R9439 | T11018 | T11012 | themeOf | association,effects | ||
R9440 | T11019 | T11020 | themeOf | IL-4,mRNA expression | ||
R9441 | T11020 | T11013 | themeOf | mRNA expression,effects | ||
R9442 | T11024 | T11021 | themeOf | GATA-3,competition | ||
R9443 | T11024 | T11023 | themeOf | GATA-3,activated | ||
R9444 | T11026 | T11022 | themeOf | GR,competition | ||
R9445 | T11026 | T11025 | themeOf | GR,activated | ||
R9446 | T11028 | T11027 | themeOf | GR,activated | ||
R9447 | T11028 | T11029 | causeOf | GR,increased | ||
R9448 | T11029 | T11032 | themeOf | increased,in the presence and absence of | ||
R9449 | T11030 | T11031 | themeOf | GR,association | ||
R9450 | T11031 | T11029 | themeOf | association,increased | ||
R9451 | T11033 | T11032 | causeOf | activated,in the presence and absence of | ||
R9452 | T11034 | T11033 | themeOf | GATA-3,activated | ||
R9453 | T11036 | T11035 | themeOf | GATA-3,activated | ||
R9454 | T11036 | T11037 | causeOf | GATA-3,block | ||
R9455 | T11038 | T11039 | themeOf | GR,association | ||
R9456 | T11039 | T11037 | themeOf | association,block | ||
R9457 | T11041 | T11040 | themeOf | GR,activated | ||
R9458 | T11041 | T11043 | themeOf | GR,associate | ||
R9459 | T11042 | T11044 | themeOf | GATA-3,associate | ||
R9460 | T11046 | T11045 | themeOf | GR,activated | ||
R9461 | T11046 | T11047 | causeOf | GR,attenuates | ||
R9462 | T11047 | T11051 | themeOf | attenuates,dependent | ||
R9463 | T11049 | T11050 | themeOf | GATA-3,interaction | ||
R9464 | T11049 | T11048 | themeOf | GATA-3,phospho | ||
R9465 | T11050 | T11047 | themeOf | interaction,attenuates | ||
R9466 | T11053 | T11052 | themeOf | GR,activated | ||
R9467 | T11053 | T11054 | causeOf | GR,compete | ||
R9468 | T11054 | T11057 | causeOf | compete,limit | ||
R9469 | T11055 | T11056 | themeOf | GATA-3,for | ||
R9470 | T11056 | T11054 | themeOf | for,compete | ||
R9471 | T11058 | T11060 | themeOf | GATA-3,import | ||
R9472 | T11059 | T11060 | locationOf | nuclear,import | ||
R9473 | T11060 | T11057 | themeOf | import,limit | ||
R9474 | T11063 | T11065 | themeOf | GATA-3,export | ||
R9475 | T11063 | T11066 | themeOf | GATA-3,degradation | ||
R9476 | T11064 | T11065 | locationOf | nuclear,export | ||
R9477 | T11065 | T11061 | themeOf | export,effect | ||
R9478 | T11066 | T11062 | themeOf | degradation,effect | ||
R9479 | T11068 | T11067 | themeOf | block,affect | ||
R9480 | T11069 | T11071 | themeOf | GATA-3,localization | ||
R9481 | T11070 | T11071 | locationOf | nuclear,localization | ||
R9482 | T11071 | T11068 | themeOf | localization,block | ||
R9483 | T11073 | T11074 | themeOf | GATA-3,expression | ||
R9484 | T11074 | T11072 | themeOf | expression,effect | ||
R9485 | T11076 | T11078 | themeOf | GATA-3,residency | ||
R9486 | T11077 | T11078 | locationOf | nuclear,residency | ||
R9487 | T11078 | T11075 | themeOf | residency,affect | ||
R9488 | T11080 | T11079 | themeOf | GR,activated | ||
R9489 | T11080 | T11081 | causeOf | GR,enhance | ||
R9490 | T11082 | T11084 | themeOf | GATA-3,export | ||
R9491 | T11083 | T11084 | locationOf | nuclear,export | ||
R9492 | T11084 | T11081 | themeOf | export,enhance | ||
R9493 | T11086 | T11088 | themeOf | GATA-3,import | ||
R9494 | T11087 | T11088 | locationOf | nuclear,import | ||
R9495 | T11088 | T11085 | themeOf | import,effect | ||
R9496 | T11090 | T11092 | themeOf | p65,translocation | ||
R9497 | T11091 | T11092 | locationOf | nuclear,translocation | ||
R9498 | T11092 | T11089 | themeOf | translocation,effect | ||
R10967 | T12732 | T12734 | themeOf | GATA-3,Localization | ||
R10968 | T12733 | T12734 | locationOf | Nuclear,Localization | ||
R10969 | T12734 | T12731 | themeOf | Localization,Inhibitory | ||
R10970 | T12736 | T12735 | themeOf | decrease,dependent | ||
R10971 | T12737 | T12736 | themeOf | interaction,decrease | ||
R10972 | T12737 | T12740 | themeOf | interaction,inhibited | ||
R10973 | T12737 | T12741 | themeOf | interaction,attenuated | ||
R10974 | T12739 | T12737 | themeOf | GATA-3,interaction | ||
R10975 | T12739 | T12738 | themeOf | GATA-3,phospho | ||
R10976 | T12744 | T12747 | themeOf | IL-4,expression | ||
R10977 | T12745 | T12746 | themeOf | -5,expression | ||
R10978 | T12746 | T12742 | themeOf | expression,suppresses | ||
R10979 | T12747 | T12743 | themeOf | expression,suppresses | ||
R10980 | T12749 | T12748 | themeOf | interaction,attenuated | ||
R10981 | T12750 | T12749 | themeOf | GATA-3,interaction | ||
R10982 | T12751 | T12754 | themeOf | reduced,dependent | ||
R10983 | T12752 | T12753 | themeOf | GATA-3,interaction | ||
R10984 | T12753 | T12751 | themeOf | interaction,reduced | ||
R10985 | T12756 | T12755 | themeOf | decrease,produced | ||
R10986 | T12757 | T12758 | themeOf | GATA-3,association | ||
R10987 | T12758 | T12756 | themeOf | association,decrease | ||
R10988 | T12759 | T12760 | themeOf | GATA-3,association | ||
R10989 | T12762 | T12761 | themeOf | interaction,attenuated | ||
R10990 | T12763 | T12762 | themeOf | GATA-3,interaction | ||
R10991 | T12765 | T12764 | themeOf | localization,affect | ||
R10992 | T12766 | T12765 | themeOf | GATA-3,localization | ||
R10993 | T12768 | T12770 | themeOf | GR,translocation | ||
R10994 | T12769 | T12770 | locationOf | nuclear,translocation | ||
R10995 | T12770 | T12767 | themeOf | translocation,increased | ||
R10996 | T12773 | T12772 | themeOf | loss,induced | ||
R10997 | T12774 | T12773 | locationOf | nuclear,loss | ||
R10998 | T12775 | T12773 | themeOf | GATA-3,loss | ||
R10999 | T12776 | T12778 | locationOf | cytoplasmic,levels | ||
R11000 | T12777 | T12778 | themeOf | GATA-3,levels | ||
R11001 | T12778 | T12779 | themeOf | levels,enhanced | ||
R11002 | T12779 | T12780 | themeOf | enhanced,dependent | ||
R11003 | T12782 | T12783 | locationOf | nuclear,localization | ||
R11004 | T12783 | T12781 | themeOf | localization,reduces | ||
R11005 | T12784 | T12783 | themeOf | GATA-3,localization | ||
R11006 | T12785 | T12781 | causeOf | inhibiting,reduces | ||
R11007 | T12786 | T12787 | themeOf | GATA-3,association | ||
R11008 | T12787 | T12785 | themeOf | association,inhibiting | ||
R11009 | T12789 | T12790 | themeOf | GATA-3,phosphorylation | ||
R11010 | T12790 | T12788 | themeOf | phosphorylation,mediated | ||
R11011 | T12792 | T12791 | themeOf | MKP-1,induction | ||
R11012 | T12794 | T12793 | themeOf | suppression,effects | ||
R11013 | T12795 | T12797 | themeOf | GATA-3,import | ||
R11014 | T12796 | T12797 | locationOf | nuclear,import | ||
R11015 | T12797 | T12794 | themeOf | import,suppression | ||
R13552 | T15785 | T15784 | themeOf | GR,activated | ||
R13553 | T15785 | T15786 | causeOf | GR,compete | ||
R13555 | T15788 | T15786 | themeOf | GATA-3,compete | ||
R13558 | T15788 | T15787 | themeOf | GATA-3,activated | ||
R13559 | T15788 | T15790 | themeOf | GATA-3,import | ||
R13560 | T15789 | T15790 | locationOf | nuclear,import | ||
R13562 | T15790 | T15791 | themeOf | import,via | ||
R13564 | T15794 | T15796 | locationOf | nuclear,transport | ||
R13565 | T15794 | T15795 | locationOf | nuclear,transport | ||
R13566 | T15795 | T15792 | themeOf | transport,required | ||
R13568 | T15796 | T15793 | themeOf | transport,required | ||
R13569 | T15797 | T15796 | themeOf | GATA-3,transport | ||
R13570 | T15798 | T15795 | themeOf | GR,transport | ||
R13572 | T15800 | T15799 | themeOf | expression,increase | ||
R13573 | T15801 | T15800 | themeOf | MKP-1,expression | ||
R13576 | T15803 | T15802 | themeOf | phosphorylation,prevent | ||
R13577 | T15803 | T15805 | causeOf | phosphorylation,necessary | ||
R13578 | T15803 | T15806 | causeOf | phosphorylation,necessary | ||
R13579 | T15804 | T15803 | themeOf | GATA-3,phosphorylation | ||
R13580 | T15804 | T15807 | themeOf | GATA-3,interaction | ||
R13581 | T15804 | T15810 | themeOf | GATA-3,import | ||
R13583 | T15807 | T15805 | themeOf | interaction,necessary | ||
R13584 | T15807 | T15808 | causeOf | interaction,subsequent | ||
R13585 | T15809 | T15810 | locationOf | nuclear,import | ||
R13587 | T15810 | T15806 | themeOf | import,necessary | ||
R13588 | T15810 | T15808 | themeOf | import,subsequent | ||
R13589 | T15811 | T15814 | themeOf | translocation,involves | ||
R13590 | T15812 | T15811 | themeOf | GATA-3,translocation | ||
R13591 | T15813 | T15811 | locationOf | nucleus,translocation | ||
R13592 | T15817 | T15815 | themeOf | GATA-3,interacts | ||
R13593 | T15817 | T15816 | themeOf | GATA-3,phosphorylated | ||
R13594 | T15818 | T15819 | themeOf | GATA-3,knockdown | ||
R13596 | T15819 | T15820 | causeOf | knockdown,suppression | ||
R13597 | T15819 | T15821 | causeOf | knockdown,suppression | ||
R13598 | T15822 | T15821 | themeOf | stimulated,suppression | ||
R13600 | T15823 | T15820 | themeOf | stimulated,suppression | ||
R13601 | T15824 | T15826 | themeOf | IL-4,induction | ||
R13602 | T15824 | T15832 | themeOf | IL-4,transcription | ||
R13603 | T15825 | T15827 | themeOf | IL-5,induction | ||
R13604 | T15825 | T15831 | themeOf | IL-5,transcription | ||
R13606 | T15826 | T15823 | themeOf | induction,stimulated | ||
R13607 | T15827 | T15822 | themeOf | induction,stimulated | ||
R13609 | T15830 | T15829 | causeOf | GATA-3,role | ||
R13610 | T15830 | T15828 | causeOf | GATA-3,role | ||
R13611 | T15831 | T15828 | themeOf | transcription,role | ||
R13612 | T15832 | T15829 | themeOf | transcription,role | ||
R13613 | T15833 | T15835 | themeOf | GR,import | ||
R13614 | T15834 | T15835 | locationOf | nuclear,import | ||
R13616 | T15838 | T15837 | causeOf | GR,competition | ||
R13618 | T15840 | T15842 | themeOf | GATA-3,import | ||
R13619 | T15840 | T15839 | themeOf | GATA-3,phospho | ||
R13620 | T15841 | T15842 | locationOf | nuclear,import | ||
R13621 | T15842 | T15837 | themeOf | import,competition | ||
R13622 | T15883 | T15884 | themeOf | MKP-1,induction | ||
R13623 | T15846 | T15843 | themeOf | GR,binding | ||
R13624 | T15846 | T15845 | themeOf | GR,activated | ||
R13625 | T15848 | T15844 | themeOf | GATA-3,binding | ||
R13626 | T15848 | T15847 | themeOf | GATA-3,phospho | ||
R13627 | T15850 | T15851 | themeOf | GATA-3,entry | ||
R13628 | T15884 | T15882 | themeOf | induction,role | ||
R13629 | T15851 | T15849 | themeOf | entry,reduce | ||
R13630 | T15853 | T15854 | locationOf | nuclear,translocation | ||
R13631 | T15886 | T15885 | themeOf | MKP-1,induction | ||
R13632 | T15854 | T15856 | themeOf | translocation,affected | ||
R13633 | T15855 | T15854 | themeOf | p65,translocation | ||
R13634 | T15858 | T15860 | themeOf | GATA-3,exclusion | ||
R13635 | T15887 | T15889 | themeOf | induction,following | ||
R13636 | T15859 | T15860 | locationOf | nuclear,exclusion | ||
R13637 | T15860 | T15857 | themeOf | exclusion,this effect | ||
R13638 | T15888 | T15887 | themeOf | MKP-1,induction | ||
R13639 | T15862 | T15864 | themeOf | GATA-3,export | ||
R13640 | T15863 | T15864 | locationOf | nuclear,export | ||
R13641 | T15864 | T15861 | themeOf | export,enhances | ||
R13642 | T15866 | T15867 | themeOf | GATA-3,degradation | ||
R13643 | T15890 | T15896 | causeOf | induction,attenuating | ||
R13644 | T15867 | T15865 | themeOf | degradation,induces | ||
R13645 | T15869 | T15868 | themeOf | GR,activated | ||
R13646 | T15869 | T15870 | causeOf | GR,attenuate | ||
R13647 | T15891 | T15890 | themeOf | MKP-1,induction | ||
R13648 | T15872 | T15873 | themeOf | GATA-3,association | ||
R13649 | T15872 | T15871 | themeOf | GATA-3,phospho | ||
R13650 | T15873 | T15870 | themeOf | association,attenuate | ||
R13651 | T15893 | T15902 | themeOf | GATA-3,translocation | ||
R13652 | T15875 | T15874 | themeOf | GATA-3,phospho | ||
R13653 | T15875 | T15876 | themeOf | GATA-3,associate | ||
R13654 | T15878 | T15877 | themeOf | reduction,contribute | ||
R13655 | T15879 | T15881 | themeOf | GATA-3,import | ||
R13656 | T15880 | T15881 | locationOf | nuclear,import | ||
R13657 | T15893 | T15895 | themeOf | GATA-3,import | ||
R13658 | T15881 | T15878 | themeOf | import,reduction | ||
R13659 | T15894 | T15895 | locationOf | nuclear,import | ||
R13660 | T15895 | T15892 | themeOf | import,reduce | ||
R13661 | T15896 | T15900 | causeOf | attenuating,preventing | ||
R13662 | T15896 | T15892 | causeOf | attenuating,reduce | ||
R13663 | T15897 | T15896 | themeOf | subsequent,attenuating | ||
R13664 | T15898 | T15899 | themeOf | GATA-3,phosphorylation | ||
R13665 | T15899 | T15897 | themeOf | phosphorylation,subsequent | ||
R13666 | T15901 | T15902 | locationOf | nuclear,translocation | ||
R13667 | T15902 | T15900 | themeOf | translocation,preventing | ||
R13668 | T15903 | T15905 | themeOf | serine residue,phosphorylated | ||
R13669 | T15903 | T15904 | partOf | serine residue,GATA-3 | ||
R13670 | T15907 | T15909 | themeOf | GATA-3,import | ||
R13671 | T15908 | T15909 | locationOf | nuclear,import | ||
R13672 | T15909 | T15906 | themeOf | import,impairment | ||
R13673 | T15911 | T15910 | themeOf | expression,inhibitory effect | ||
R13674 | T15912 | T15911 | themeOf | IL-4,expression | ||
R13675 | T15914 | T15915 | themeOf | IL-4,transcription | ||
R13676 | T15915 | T15913 | themeOf | transcription,suppress | ||
R13677 | T15916 | T15917 | themeOf | GATA-3,inhibition | ||
R13678 | T15919 | T15918 | themeOf | GATA-3,inhibiting | ||
R13679 | T15922 | T15924 | themeOf | IL-4,release | ||
R13680 | T15923 | T15925 | themeOf | IL-5,release | ||
R13681 | T15924 | T15921 | themeOf | release,suppress | ||
R13682 | T15925 | T15920 | themeOf | release,suppress | ||
R13683 | T15928 | T15930 | themeOf | GATA-3,translocation | ||
R13684 | T15928 | T15931 | themeOf | GATA-3,binding | ||
R13685 | T15929 | T15930 | locationOf | nuclear,translocation | ||
R13686 | T15930 | T15927 | themeOf | translocation,inhibitory effect | ||
R13687 | T15930 | T15926 | themeOf | translocation,inhibitory effect | ||
R13688 | T15931 | T15927 | causeOf | binding,inhibitory effect | ||
R13689 | T15932 | T15926 | causeOf | increased,inhibitory effect | ||
R13690 | T15932 | T15935 | causeOf | increased,preventing | ||
R13691 | T15933 | T15932 | themeOf | synthesis,increased | ||
R13692 | T15934 | T15933 | themeOf | MKP-1,synthesis | ||
R13693 | T15936 | T15935 | themeOf | phosphorylation,preventing | ||
R13694 | T15937 | T15936 | themeOf | GATA-3,phosphorylation | ||
R13695 | T15939 | T15940 | locationOf | nuclear,translocation | ||
R13696 | T15940 | T15938 | themeOf | translocation,necessary | ||
R13697 | T15941 | T15940 | themeOf | GATA-3,translocation | ||
R13698 | T15944 | T15945 | themeOf | GATA-3,interaction | ||
R13699 | T15944 | T15943 | themeOf | GATA-3,phospho | ||
R13700 | T15945 | T15942 | themeOf | interaction,Prevention | ||
R14316 | T16675 | T16677 | themeOf | GATA-3,import | ||
R14317 | T16676 | T16677 | locationOf | nuclear,import | ||
R14318 | T16677 | T16674 | themeOf | import,inhibits | ||
R14319 | T16679 | T16678 | themeOf | GATA-3,translocation | ||
R14320 | T16680 | T16678 | locationOf | nucleus,translocation | ||
R14321 | T16682 | T16683 | locationOf | nuclear,localization | ||
R14322 | T16683 | T16685 | themeOf | localization,induced | ||
R14323 | T16684 | T16683 | themeOf | GATA-3,localization | ||
R14324 | T16689 | T16691 | themeOf | IL-4,mRNA expression | ||
R14325 | T16690 | T16692 | themeOf | IL-5,mRNA expression | ||
R14326 | T16691 | T16688 | themeOf | mRNA expression,inhibits | ||
R14327 | T16692 | T16687 | themeOf | mRNA expression,inhibits | ||
R14328 | T16693 | T16696 | themeOf | CD3,costimulated | ||
R14329 | T16694 | T16695 | themeOf | CD28,costimulated | ||
R14330 | T16699 | T16700 | themeOf | GATA-3,associate | ||
R14331 | T16699 | T16698 | themeOf | GATA-3,stimulated | ||
R14332 | T16700 | T16697 | themeOf | associate,reduces | ||
R14333 | T16702 | T16700 | themeOf | promoter,associate | ||
R14334 | T16702 | T16701 | partOf | promoter,IL-5 | ||
R15003 | T17480 | T17481 | themeOf | GATA-3,association | ||
R15004 | T17481 | T17478 | themeOf | association,reduces | ||
R15005 | T17482 | T17484 | themeOf | GATA-3,import | ||
R15006 | T17483 | T17484 | locationOf | nuclear,import | ||
R15007 | T17484 | T17479 | themeOf | import,reduces | ||
R15008 | T17486 | T17485 | themeOf | induction,dependent | ||
R15009 | T17488 | T17489 | themeOf | GR,interaction | ||
R15010 | T17488 | T17487 | themeOf | GR,activated | ||
R15011 | T17489 | T17486 | themeOf | interaction,induction | ||
R15012 | T17490 | T17491 | themeOf | GR,association | ||
R15013 | T17493 | T17492 | themeOf | induction,dependent | ||
R15014 | T17495 | T17497 | themeOf | GR,translocation | ||
R15015 | T17495 | T17494 | themeOf | GR,activated | ||
R15016 | T17496 | T17497 | locationOf | nuclear,translocation | ||
R15017 | T17497 | T17493 | themeOf | translocation,induction | ||
R15018 | T17499 | T17498 | themeOf | decrease,dependent | ||
R15019 | T17500 | T17501 | themeOf | GATA-3,association | ||
R15020 | T17501 | T17499 | themeOf | association,decrease | ||
R15021 | T17502 | T17503 | themeOf | GATA-3,overexpressed | ||
R15590 | T18199 | T18198 | themeOf | down-regulation,associated | ||
R15591 | T18201 | T18202 | themeOf | serine,phosphorylation | ||
R15592 | T18201 | T18200 | partOf | serine,GATA-3 | ||
R15593 | T18202 | T18199 | themeOf | phosphorylation,down-regulation | ||
R15594 | T18204 | T18203 | themeOf | phosphorylation,effect | ||
R15595 | T18205 | T18204 | themeOf | activated transcription factor 2,phosphorylation | ||
R15596 | T18206 | T18205 | equivalentTo | ATF-2,activated transcription factor 2 | ||
R15597 | T18209 | T18211 | partOf | serine,GATA-3 | ||
R15598 | T18209 | T18210 | themeOf | serine,phosphorylation | ||
R15599 | T18210 | T18208 | themeOf | phosphorylation,induced | ||
R15600 | T18210 | T18207 | themeOf | phosphorylation,decrease | ||
R15601 | T18212 | T18214 | themeOf | induced,dependent | ||
R15602 | T18213 | T18212 | themeOf | MKP-1,induced | ||
R15603 | T18215 | T18217 | themeOf | induces,dependent | ||
R15604 | T18216 | T18215 | themeOf | MKP-1,induces | ||
R15907 | T18607 | T18606 | themeOf | GATA-3,phospho | ||
R15908 | T18608 | T18609 | causeOf | GR,enhances | ||
R15909 | T18610 | T18611 | themeOf | GR,binding | ||
R15910 | T18611 | T18609 | themeOf | binding,enhances | ||
R15911 | T18614 | T18613 | themeOf | GR,activated | ||
R15912 | T18615 | T18616 | causeOf | GATA-3,attenuate | ||
R15913 | T18617 | T18618 | themeOf | GR,association | ||
R15914 | T18618 | T18616 | themeOf | association,attenuate | ||
R15915 | T18620 | T18621 | causeOf | GR,blocks | ||
R15916 | T18620 | T18619 | themeOf | GR,Activated | ||
R15917 | T18623 | T18624 | themeOf | GATA-3,interacting | ||
R15918 | T18623 | T18622 | themeOf | GATA-3,phospho | ||
R15919 | T18624 | T18621 | themeOf | interacting,blocks | ||
R15920 | T18627 | T18628 | themeOf | GATA-3,binding | ||
R15921 | T18628 | T18626 | themeOf | binding,stimulated | ||
R15922 | T18631 | T18629 | themeOf | GR,activated | ||
R15923 | T18631 | T18630 | themeOf | GR,unstimulated | ||
R15924 | T18631 | T18632 | causeOf | GR,attenuation | ||
R15925 | T18632 | T18635 | themeOf | attenuation,dependent | ||
R15926 | T18633 | T18634 | themeOf | GATA-3,association | ||
R15927 | T18634 | T18632 | themeOf | association,attenuation | ||
R16418 | T19231 | T19232 | themeOf | GATA-3,export | ||
R16419 | T19232 | T19230 | themeOf | export,affect | ||
R16420 | T19234 | T19233 | themeOf | prevent,affect | ||
R16421 | T19236 | T19238 | themeOf | GATA-3,localization | ||
R16422 | T19237 | T19238 | locationOf | nuclear,localization | ||
R16423 | T19238 | T19234 | themeOf | localization,prevent | ||
R16424 | T19238 | T19235 | themeOf | localization,stimulated | ||
R16425 | T19240 | T19241 | themeOf | GATA-3,degradation | ||
R16426 | T19241 | T19239 | themeOf | degradation,affect | ||
R16427 | T19245 | T19247 | themeOf | p65,translocation | ||
R16428 | T19246 | T19247 | locationOf | nuclear,translocation | ||
R16429 | T19247 | T19243 | themeOf | translocation,prevent | ||
R16430 | T19247 | T19244 | themeOf | translocation,stimulated | ||
R16769 | T19631 | T19632 | themeOf | GATA-3,interaction | ||
R16770 | T19632 | T19629 | themeOf | interaction,impairs | ||
R16771 | T19633 | T19635 | themeOf | GATA-3,localization | ||
R16772 | T19634 | T19635 | locationOf | nuclear,localization | ||
R16773 | T19635 | T19630 | themeOf | localization,impairs | ||
R16774 | T19637 | T19636 | themeOf | interaction,impaired | ||
R16775 | T19638 | T19637 | themeOf | GATA-3,interaction | ||
R16776 | T19640 | T19639 | themeOf | association,decreased | ||
R16777 | T19641 | T19640 | themeOf | GATA-3,association | ||
R17384 | T20333 | T20335 | themeOf | GATA-3,localization | ||
R17385 | T20334 | T20335 | locationOf | nuclear,localization | ||
R17386 | T20335 | T20332 | themeOf | localization,impairs | ||
R17387 | T20336 | T20339 | themeOf | GR,localisation | ||
R17388 | T20337 | T20340 | themeOf | GATA-3,localisation | ||
R17389 | T20338 | T20339 | locationOf | nuclear,localisation | ||
R17390 | T20338 | T20340 | locationOf | nuclear,localisation | ||
R17391 | T20344 | T20342 | themeOf | decrease,dependent | ||
R17392 | T20345 | T20346 | locationOf | nuclear,expression | ||
R17393 | T20346 | T20344 | themeOf | expression,decrease | ||
R17394 | T20347 | T20346 | themeOf | GATA-3,expression | ||
R17395 | T20348 | T20343 | themeOf | increased,dependent | ||
R17396 | T20349 | T20351 | locationOf | cytoplasmic,expression | ||
R17397 | T20350 | T20351 | themeOf | GATA-3,expression | ||
R17398 | T20351 | T20348 | themeOf | expression,increased | ||
R17399 | T20353 | T20354 | locationOf | nuclear,expression | ||
R17400 | T20354 | T20352 | themeOf | expression,decrease | ||
R17401 | T20355 | T20354 | themeOf | GATA-3,expression | ||
R17402 | T20356 | T20358 | locationOf | cytoplasmic,expression | ||
R17403 | T20357 | T20358 | themeOf | GATA-3,expression | ||
R3967 | T4606 | T4607 | themeOf | GATA-3,localization | ||
R6532 | T7604 | T7603 | themeOf | GATA-3-GFP,expressing | ||
R8059 | T9361 | T9362 | themeOf | GATA-3,for | ||
R8060 | T9364 | T9363 | themeOf | GR,activated | ||
R8061 | T9364 | T9370 | themeOf | GR,import | ||
R8062 | T9365 | T9369 | themeOf | GATA-3,import | ||
R8063 | T9368 | T9370 | locationOf | nuclear,import | ||
R8064 | T9368 | T9369 | locationOf | nuclear,import | ||
R8065 | T9369 | T9366 | themeOf | import,uses | ||
R8066 | T9370 | T9367 | themeOf | import,uses | ||
R8067 | T9372 | T9374 | themeOf | GR,translocation |
bionlp-st-ge-2016-reference-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T919 | 15-36 | Protein | denotes | GATA-3 Nuclear Import |
T920 | 0-11 | Negative_regulation | denotes | Suppression |
T921 | 41-56 | Phosphorylation | denotes | Phosphorylation |
T922 | 0-11 | Negative_regulation | denotes | Suppression |
T923 | 466-472 | Protein | denotes | GATA-3 |
T924 | 541-565 | Protein | denotes | interleukin (IL)-4, IL-5 |
T925 | 513-523 | Gene_expression | denotes | expression |
T926 | 498-508 | Regulation | denotes | regulating |
T927 | 755-761 | Protein | denotes | GATA-3 |
T928 | 744-751 | Regulation | denotes | effects |
T929 | 850-856 | Protein | denotes | GATA-3 |
T930 | 857-867 | Regulation | denotes | regulation |
T931 | 795-801 | Regulation | denotes | effect |
T932 | 1025-1033 | Protein | denotes | anti-CD3 |
T933 | 1038-1047 | Protein | denotes | anti-CD28 |
T934 | 1124-1130 | Protein | denotes | GATA-3 |
T935 | 1194-1211 | Protein | denotes | nuclear factor-κB |
T936 | 1256-1262 | Protein | denotes | GATA-3 |
T937 | 1288-1311 | Protein | denotes | glucocorticoid receptor |
T938 | 1099-1106 | Entity | denotes | nuclear |
T939 | 1107-1120 | Localization | denotes | translocation |
T940 | 1271-1287 | Positive_regulation | denotes | ligand-activated |
T941 | 1090-1098 | Negative_regulation | denotes | inhibits |
T942 | 1426-1458 | Protein | denotes | mitogen-activated protein kinase |
T943 | 1460-1464 | Protein | denotes | MAPK |
T944 | 1517-1525 | Protein | denotes | p38 MAPK |
T945 | 1412-1422 | Gene_expression | denotes | expression |
T946 | 1412-1422 | Gene_expression | denotes | expression |
T947 | 1504-1513 | Negative_regulation | denotes | inhibitor |
T948 | 1565-1578 | Localization | denotes | translocation |
T949 | 1400-1407 | Positive_regulation | denotes | induces |
T950 | 1400-1407 | Positive_regulation | denotes | induces |
T951 | 1536-1545 | Positive_regulation | denotes | necessary |
T952 | 1867-1873 | Protein | denotes | GATA-3 |
T953 | 1928-1931 | Protein | denotes | Th2 |
T954 | 1857-1863 | Negative_regulation | denotes | effect |
T955 | 1941-1951 | Gene_expression | denotes | expression |
T956 | 1919-1927 | Negative_regulation | denotes | suppress |
T4335 | 13200-13209 | Protein | denotes | human CD3 |
T4336 | 13211-13215 | Protein | denotes | CD28 |
T4337 | 13217-13219 | Protein | denotes | GR |
T4338 | 13225-13235 | Protein | denotes | importin-α |
T4339 | 13347-13349 | Protein | denotes | GR |
T4839 | 14725-14730 | Protein | denotes | RNase |
T4840 | 14968-14972 | Protein | denotes | IL-4 |
T4841 | 15027-15032 | Protein | denotes | GADPH |
T6056 | 16720-16730 | Protein | denotes | Importin-α |
T6057 | 16770-16780 | Protein | denotes | importin-α |
T6058 | 16938-16944 | Protein | denotes | GATA-3 |
T6059 | 17031-17034 | Protein | denotes | CD3 |
T6060 | 17035-17039 | Protein | denotes | CD28 |
T6061 | 17044-17046 | Protein | denotes | GR |
T6062 | 17262-17291 | Protein | denotes | goat anti-importin-α antibody |
T6063 | 17397-17407 | Protein | denotes | importin-α |
T6064 | 17740-17766 | Protein | denotes | FITC swine anti-rabbit IgG |
T6065 | 17819-17825 | Protein | denotes | GATA-3 |
T6066 | 17859-17862 | Protein | denotes | IgG |
T6067 | 17927-17929 | Protein | denotes | GR |
T6068 | 17806-17815 | Gene_expression | denotes | detection |
T6069 | 17914-17923 | Gene_expression | denotes | detection |
T6070 | 17793-17797 | Positive_regulation | denotes | used |
T6732 | 19564-19584 | Protein | denotes | serum immunoglobulin |
T6733 | 19586-19590 | Protein | denotes | Dako |
T7141 | 19908-19912 | Protein | denotes | XhoI |
T7142 | 19923-19929 | Protein | denotes | GATA-3 |
T7143 | 19937-19949 | Protein | denotes | pOTB7 vector |
T7144 | 19951-19957 | Protein | denotes | GATA-3 |
T7145 | 19975-19991 | Protein | denotes | pOTB7 using XhoI |
T7146 | 20006-20014 | Protein | denotes | pEGFP-C2 |
T7147 | 20075-20080 | Protein | denotes | BamHI |
T7148 | 19962-19969 | Negative_regulation | denotes | excised |
T7149 | 19962-19969 | Negative_regulation | denotes | excised |
T7150 | 20161-20176 | Protein | denotes | GATA-3 fragment |
T7151 | 20185-20190 | Protein | denotes | pEGFP |
T7152 | 20191-20193 | Protein | denotes | C2 |
T7153 | 20494-20499 | Protein | denotes | EcoRI |
T7154 | 20533-20548 | Protein | denotes | GATA-3 fragment |
T8093 | 22964-22966 | Protein | denotes | FP |
T8773 | 23205-23233 | Protein | denotes | GATA-3 Nuclear Translocation |
T8774 | 23238-23247 | Protein | denotes | IL-4 mRNA |
T8775 | 23176-23182 | Regulation | denotes | Effect |
T8776 | 23176-23182 | Regulation | denotes | Effect |
T8777 | 23292-23318 | Protein | denotes | GATA-3-regulated IL-4 gene |
T8778 | 23319-23329 | Gene_expression | denotes | expression |
T8779 | 23281-23291 | Negative_regulation | denotes | inhibiting |
T8780 | 23414-23422 | Protein | denotes | anti-CD3 |
T8781 | 23423-23427 | Protein | denotes | CD28 |
T8782 | 23457-23463 | Protein | denotes | GATA-3 |
T8783 | 23439-23446 | Entity | denotes | nuclear |
T8784 | 23447-23453 | Localization | denotes | import |
T8785 | 23447-23453 | Localization | denotes | import |
T8786 | 23407-23413 | Regulation | denotes | affect |
T8787 | 23407-23413 | Regulation | denotes | affect |
T8788 | 23496-23499 | Protein | denotes | CD3 |
T8789 | 23500-23504 | Protein | denotes | CD28 |
T8790 | 23705-23715 | Protein | denotes | histone H1 |
T8791 | 23720-23725 | Protein | denotes | MEK-1 |
T8792 | 23864-23870 | Protein | denotes | GATA-3 |
T8793 | 23851-23860 | Localization | denotes | retention |
T8794 | 23801-23805 | Negative_regulation | denotes | loss |
T8848 | 24143-24146 | Protein | denotes | CD3 |
T8849 | 24147-24151 | Protein | denotes | CD28 |
T8850 | 24163-24167 | Protein | denotes | IL-4 |
T8851 | 24172-24181 | Protein | denotes | IL-5 mRNA |
T8852 | 24219-24225 | Protein | denotes | GATA-3 |
T8853 | 24248-24261 | Protein | denotes | IL-5 promoter |
T8854 | 24182-24192 | Gene_expression | denotes | expression |
T8855 | 24182-24192 | Gene_expression | denotes | expression |
T8856 | 24211-24215 | Negative_regulation | denotes | loss |
T8857 | 24226-24233 | Binding | denotes | binding |
T8858 | 24226-24233 | Binding | denotes | binding |
T8859 | 24124-24134 | Negative_regulation | denotes | reductions |
T8860 | 24124-24134 | Negative_regulation | denotes | reductions |
T8861 | 24152-24162 | Positive_regulation | denotes | stimulated |
T8862 | 24152-24162 | Positive_regulation | denotes | stimulated |
T8863 | 24211-24215 | Negative_regulation | denotes | loss |
T8864 | 24211-24215 | Negative_regulation | denotes | loss |
T9334 | 25841-25843 | Protein | denotes | GR |
T9335 | 25858-25864 | Protein | denotes | GATA-3 |
T9336 | 25869-25879 | Protein | denotes | Importin-α |
T9337 | 25824-25840 | Positive_regulation | denotes | Ligand-Activated |
T9338 | 25955-25957 | Protein | denotes | GR |
T9339 | 25969-25975 | Protein | denotes | GATA-3 |
T9340 | 25981-25991 | Protein | denotes | importin-α |
T9341 | 25938-25954 | Positive_regulation | denotes | ligand-activated |
T9342 | 25938-25954 | Positive_regulation | denotes | ligand-activated |
T9343 | 26000-26007 | Entity | denotes | nuclear |
T9344 | 26008-26014 | Localization | denotes | import |
T9345 | 26060-26062 | Protein | denotes | GR |
T9346 | 26067-26077 | Protein | denotes | importin-α |
T9347 | 26040-26051 | Binding | denotes | interaction |
T9348 | 26173-26175 | Protein | denotes | GR |
T9349 | 26176-26183 | Entity | denotes | nuclear |
T9350 | 26184-26197 | Localization | denotes | translocation |
T9351 | 26369-26375 | Protein | denotes | GATA-3 |
T9352 | 26380-26390 | Protein | denotes | importin-α |
T9353 | 26407-26410 | Protein | denotes | CD3 |
T9354 | 26411-26415 | Protein | denotes | CD28 |
T9355 | 26349-26360 | Binding | denotes | association |
T9356 | 26335-26344 | Negative_regulation | denotes | decreased |
T9357 | 26509-26515 | Protein | denotes | GATA-3 |
T9358 | 26598-26601 | Protein | denotes | CD3 |
T9359 | 26602-26606 | Protein | denotes | CD28 |
T10943 | 29020-29022 | Protein | denotes | FP |
T10944 | 28961-28976 | Phosphorylation | denotes | phosphorylation |
T10945 | 28941-28950 | Negative_regulation | denotes | reduction |
T10946 | 29038-29040 | Protein | denotes | FP |
T10947 | 29063-29073 | Protein | denotes | MKP-1 mRNA |
T10948 | 29055-29062 | Positive_regulation | denotes | induced |
T10949 | 29268-29277 | Protein | denotes | IL-4 mRNA |
T10950 | 29278-29288 | Gene_expression | denotes | expression |
T10951 | 29201-29208 | Regulation | denotes | effects |
T10952 | 30745-30751 | Protein | denotes | GATA-3 |
T10953 | 30753-30763 | Protein | denotes | importin-α |
T10954 | 30779-30781 | Protein | denotes | GR |
T10955 | 30814-30816 | Protein | denotes | GR |
T10956 | 30841-30843 | Protein | denotes | GR |
T10957 | 30735-30744 | Positive_regulation | denotes | activated |
T10958 | 30735-30744 | Positive_regulation | denotes | activated |
T10959 | 30769-30778 | Positive_regulation | denotes | activated |
T10960 | 30804-30813 | Positive_regulation | denotes | activated |
T10961 | 30971-30977 | Protein | denotes | GATA-3 |
T10962 | 30992-30994 | Protein | denotes | GR |
T10963 | 30961-30970 | Positive_regulation | denotes | activated |
T10964 | 31075-31077 | Protein | denotes | GR |
T10965 | 31167-31169 | Protein | denotes | GR |
T10966 | 31065-31074 | Positive_regulation | denotes | activated |
T10967 | 31110-31119 | Binding | denotes | associate |
T10968 | 31157-31166 | Positive_regulation | denotes | activated |
T10969 | 31318-31320 | Protein | denotes | GR |
T10970 | 31301-31317 | Positive_regulation | denotes | ligand-activated |
T10971 | 32693-32695 | Protein | denotes | FP |
T10972 | 32671-32677 | Regulation | denotes | affect |
T10973 | 32712-32719 | Entity | denotes | nuclear |
T10974 | 32760-32762 | Protein | denotes | FP |
T10975 | 32798-32808 | Gene_expression | denotes | expression |
T10976 | 32770-32776 | Regulation | denotes | effect |
T10977 | 32886-32888 | Protein | denotes | FP |
T10978 | 32908-32911 | Protein | denotes | CD3 |
T10979 | 32912-32916 | Protein | denotes | CD28 |
T10980 | 33010-33012 | Protein | denotes | GR |
T10981 | 32917-32924 | Entity | denotes | nuclear |
T10982 | 32925-32938 | Localization | denotes | translocation |
T10983 | 32925-32938 | Localization | denotes | translocation |
T10984 | 32925-32938 | Localization | denotes | translocation |
T10985 | 33000-33009 | Positive_regulation | denotes | activated |
T10986 | 33160-33163 | Protein | denotes | p65 |
T10987 | 33089-33096 | Entity | denotes | nuclear |
T10988 | 33164-33171 | Entity | denotes | nuclear |
T10989 | 33172-33185 | Localization | denotes | translocation |
T10990 | 33150-33156 | Regulation | denotes | effect |
T12798 | 34494-34508 | Protein | denotes | phospho-GATA-3 |
T12799 | 34513-34523 | Protein | denotes | importin-α |
T12800 | 34474-34485 | Binding | denotes | interaction |
T12801 | 34451-34459 | Negative_regulation | denotes | decrease |
T12802 | 35748-35752 | Protein | denotes | M FP |
T12803 | 35764-35768 | Protein | denotes | IL-4 |
T12804 | 35826-35832 | Protein | denotes | GATA-3 |
T12805 | 35838-35848 | Protein | denotes | importin-α |
T12806 | 35781-35791 | Gene_expression | denotes | expression |
T12807 | 35811-35822 | Binding | denotes | interaction |
T12808 | 35753-35763 | Negative_regulation | denotes | suppresses |
T12809 | 35796-35806 | Negative_regulation | denotes | attenuated |
T12810 | 36086-36101 | Protein | denotes | GATA-3–importin |
T12811 | 36102-36103 | Protein | denotes | α |
T12812 | 36104-36115 | Binding | denotes | interaction |
T12813 | 36078-36085 | Negative_regulation | denotes | reduced |
T12814 | 36185-36200 | Protein | denotes | GATA-3–importin |
T12815 | 36625-36631 | Protein | denotes | GATA-3 |
T12816 | 36679-36689 | Protein | denotes | importin-α |
T12817 | 36737-36747 | Protein | denotes | importin-α |
T12818 | 36610-36621 | Binding | denotes | interaction |
T12819 | 36724-36733 | Localization | denotes | abundance |
T12820 | 36708-36716 | Negative_regulation | denotes | decrease |
T12821 | 36879-36885 | Protein | denotes | GATA-3 |
T12822 | 36854-36862 | Entity | denotes | cellular |
T12823 | 36863-36875 | Localization | denotes | localization |
T12824 | 36982-36984 | Protein | denotes | GR |
T12825 | 36985-36992 | Entity | denotes | nuclear |
T12826 | 36993-37006 | Localization | denotes | translocation |
T12827 | 36972-36981 | Positive_regulation | denotes | increased |
T12828 | 37591-37609 | Protein | denotes | cytoplasmic GATA-3 |
T12829 | 37642-37644 | Protein | denotes | FP |
T12830 | 37452-37459 | Entity | denotes | nuclear |
T12831 | 37622-37630 | Positive_regulation | denotes | enhanced |
T12832 | 37831-37839 | Protein | denotes | p38 MAPK |
T12833 | 37840-37855 | Phosphorylation | denotes | phosphorylation |
T12834 | 37821-37830 | Negative_regulation | denotes | inhibited |
T12835 | 39499-39505 | Protein | denotes | GATA-3 |
T12836 | 39475-39482 | Entity | denotes | nuclear |
T12837 | 39483-39495 | Localization | denotes | localization |
T12838 | 39467-39474 | Negative_regulation | denotes | reduces |
T12839 | 39624-39634 | Protein | denotes | importin-α |
T12840 | 39689-39692 | Protein | denotes | p38 |
T12841 | 39753-39758 | Protein | denotes | MKP-1 |
T12842 | 39608-39619 | Binding | denotes | competition |
T12843 | 39714-39729 | Phosphorylation | denotes | phosphorylation |
T12844 | 39740-39749 | Positive_regulation | denotes | induction |
T15646 | 40017-40023 | Protein | denotes | GATA-3 |
T15647 | 40068-40077 | Protein | denotes | Th2 genes |
T15648 | 40051-40064 | Transcription | denotes | transcription |
T15649 | 40167-40169 | Protein | denotes | GR |
T15650 | 40204-40210 | Protein | denotes | GATA-3 |
T15651 | 40298-40304 | Protein | denotes | GATA-3 |
T15652 | 40309-40311 | Protein | denotes | GR |
T15653 | 40181-40188 | Binding | denotes | compete |
T15654 | 40194-40203 | Positive_regulation | denotes | activated |
T15655 | 40215-40222 | Entity | denotes | nuclear |
T15656 | 40272-40279 | Entity | denotes | nuclear |
T15657 | 40280-40289 | Localization | denotes | transport |
T15658 | 40280-40289 | Localization | denotes | transport |
T15659 | 40255-40263 | Positive_regulation | denotes | required |
T15660 | 40255-40263 | Positive_regulation | denotes | required |
T15661 | 40391-40396 | Protein | denotes | MKP-1 |
T15662 | 40420-40428 | Protein | denotes | p38 MAPK |
T15663 | 40458-40485 | Protein | denotes | T cell receptor/co-receptor |
T15664 | 40500-40508 | Protein | denotes | p38 MAPK |
T15665 | 40543-40549 | Protein | denotes | GATA-3 |
T15666 | 40589-40599 | Protein | denotes | importin-α |
T15667 | 40377-40387 | Gene_expression | denotes | expression |
T15668 | 40407-40416 | Negative_regulation | denotes | inhibitor |
T15669 | 40486-40496 | Positive_regulation | denotes | activation |
T15670 | 40524-40539 | Phosphorylation | denotes | phosphorylation |
T15671 | 40572-40583 | Binding | denotes | interaction |
T15672 | 40615-40622 | Entity | denotes | nuclear |
T15673 | 40623-40629 | Localization | denotes | import |
T15674 | 40364-40372 | Positive_regulation | denotes | increase |
T15675 | 40450-40457 | Negative_regulation | denotes | prevent |
T15676 | 40512-40519 | Negative_regulation | denotes | prevent |
T15677 | 40558-40567 | Positive_regulation | denotes | necessary |
T15678 | 40678-40684 | Protein | denotes | GATA-3 |
T15679 | 40732-40770 | Protein | denotes | nuclear transporter protein importin-α |
T15680 | 40711-40718 | Entity | denotes | nucleus |
T15681 | 40778-40787 | Binding | denotes | interacts |
T15682 | 40661-40674 | Localization | denotes | translocation |
T15683 | 40859-40865 | Protein | denotes | GATA-3 |
T15684 | 40919-40922 | Protein | denotes | CD3 |
T15685 | 40923-40927 | Protein | denotes | CD28 |
T15686 | 40939-40953 | Protein | denotes | IL-4/IL-5 mRNA |
T15687 | 41004-41010 | Protein | denotes | GATA-3 |
T15688 | 40866-40875 | Negative_regulation | denotes | knockdown |
T15689 | 41018-41031 | Transcription | denotes | transcription |
T15690 | 41092-41094 | Protein | denotes | GR |
T15691 | 41227-41229 | Protein | denotes | GR |
T15692 | 41334-41344 | Protein | denotes | importin-α |
T15693 | 41358-41360 | Protein | denotes | GR |
T15694 | 41475-41483 | Protein | denotes | Th2 gene |
T15695 | 41323-41330 | Binding | denotes | binding |
T15696 | 41323-41330 | Binding | denotes | binding |
T15697 | 41348-41357 | Positive_regulation | denotes | activated |
T15698 | 41348-41357 | Positive_regulation | denotes | activated |
T15699 | 41348-41357 | Positive_regulation | denotes | activated |
T15700 | 41484-41497 | Transcription | denotes | transcription |
T15701 | 41464-41470 | Negative_regulation | denotes | switch |
T15702 | 41464-41470 | Positive_regulation | denotes | switch |
T15703 | 41597-41603 | Protein | denotes | GATA-3 |
T15704 | 41637-41648 | Protein | denotes | p65 subunit |
T15705 | 41652-41657 | Protein | denotes | NF-κB |
T15706 | 41608-41615 | Entity | denotes | nuclear |
T15707 | 41616-41629 | Localization | denotes | translocation |
T15708 | 41616-41629 | Localization | denotes | translocation |
T15709 | 41666-41674 | Regulation | denotes | affected |
T15710 | 41666-41674 | Regulation | denotes | affected |
T15711 | 41762-41764 | Protein | denotes | FP |
T15712 | 41768-41774 | Protein | denotes | GATA-3 |
T15713 | 41878-41884 | Protein | denotes | GATA-3 |
T15714 | 41775-41782 | Entity | denotes | nuclear |
T15715 | 41783-41792 | Localization | denotes | exclusion |
T15716 | 41885-41896 | Protein_catabolism | denotes | degradation |
T15717 | 41870-41877 | Positive_regulation | denotes | induces |
T15718 | 41995-41997 | Protein | denotes | GR |
T15719 | 41985-41994 | Positive_regulation | denotes | activated |
T15720 | 42176-42186 | Protein | denotes | importin-α |
T15721 | 42161-42170 | Binding | denotes | associate |
T15722 | 42521-42526 | Protein | denotes | MKP-1 |
T15723 | 42527-42536 | Positive_regulation | denotes | induction |
T15724 | 42567-42575 | Protein | denotes | p38 MAPK |
T15725 | 42610-42615 | Protein | denotes | MKP-1 |
T15726 | 42650-42654 | Protein | denotes | MAPK |
T15727 | 42597-42606 | Positive_regulation | denotes | induction |
T15728 | 42637-42646 | Negative_regulation | denotes | inhibitor |
T15729 | 42558-42566 | Regulation | denotes | modulate |
T15730 | 42597-42606 | Positive_regulation | denotes | induction |
T15731 | 42711-42721 | Protein | denotes | MKP-1 mRNA |
T15732 | 42792-42794 | Protein | denotes | FP |
T15733 | 42698-42707 | Positive_regulation | denotes | induction |
T15734 | 42840-42845 | Protein | denotes | MKP-1 |
T15735 | 42894-42902 | Protein | denotes | p38 MAPK |
T15736 | 42827-42836 | Positive_regulation | denotes | induction |
T15737 | 42864-42871 | Entity | denotes | nuclear |
T15738 | 42882-42893 | Positive_regulation | denotes | attenuating |
T15739 | 42934-42949 | Phosphorylation | denotes | phosphorylation |
T15740 | 42967-42974 | Entity | denotes | nuclear |
T15741 | 42882-42893 | Positive_regulation | denotes | attenuating |
T15742 | 43031-43037 | Protein | denotes | GATA-3 |
T15743 | 43065-43073 | Protein | denotes | p38 MAPK |
T15744 | 43221-43224 | Protein | denotes | p38 |
T15745 | 43047-43061 | Phosphorylation | denotes | phosphorylated |
T15746 | 43335-43337 | Protein | denotes | FP |
T15747 | 43522-43531 | Protein | denotes | IL-4 mRNA |
T15748 | 43693-43697 | Protein | denotes | IL-4 |
T15749 | 43508-43518 | Gene_expression | denotes | expression |
T15750 | 43698-43711 | Transcription | denotes | transcription |
T15751 | 43488-43494 | Regulation | denotes | effect |
T15752 | 43684-43692 | Negative_regulation | denotes | suppress |
T15753 | 43854-43860 | Protein | denotes | GATA-3 |
T15754 | 43861-43871 | Negative_regulation | denotes | inhibition |
T15755 | 43929-43931 | Protein | denotes | FP |
T15756 | 44009-44015 | Protein | denotes | GATA-3 |
T15757 | 43998-44008 | Negative_regulation | denotes | inhibiting |
T15758 | 44352-44356 | Protein | denotes | IL-4 |
T15759 | 44361-44365 | Protein | denotes | IL-5 |
T15760 | 44366-44373 | Localization | denotes | release |
T15761 | 44366-44373 | Localization | denotes | release |
T15762 | 44343-44351 | Negative_regulation | denotes | suppress |
T15763 | 44343-44351 | Negative_regulation | denotes | suppress |
T15764 | 44694-44704 | Protein | denotes | importin-α |
T15765 | 44764-44769 | Protein | denotes | MKP-1 |
T15766 | 44786-44794 | Protein | denotes | p38 MAPK |
T15767 | 44835-44841 | Protein | denotes | GATA-3 |
T15768 | 44889-44895 | Protein | denotes | GATA-3 |
T15769 | 44611-44618 | Entity | denotes | nuclear |
T15770 | 44649-44656 | Binding | denotes | binding |
T15771 | 44751-44760 | Gene_expression | denotes | synthesis |
T15772 | 44777-44785 | Negative_regulation | denotes | inhibits |
T15773 | 44816-44831 | Phosphorylation | denotes | phosphorylation |
T15774 | 44864-44871 | Entity | denotes | nuclear |
T15775 | 44872-44885 | Localization | denotes | translocation |
T15776 | 44741-44750 | Positive_regulation | denotes | increased |
T15777 | 44801-44811 | Negative_regulation | denotes | preventing |
T15778 | 44850-44859 | Positive_regulation | denotes | necessary |
T15779 | 45117-45143 | Protein | denotes | nasal Th2 cytokine release |
T15780 | 45282-45292 | Protein | denotes | importin-α |
T15781 | 45265-45276 | Binding | denotes | interaction |
T15782 | 45236-45246 | Negative_regulation | denotes | Prevention |
T16703 | 24431-24434 | Protein | denotes | CD3 |
T16704 | 24435-24439 | Protein | denotes | CD28 |
T16705 | 24494-24500 | Protein | denotes | GATA-3 |
T16706 | 24527-24534 | Entity | denotes | nucleus |
T16707 | 24477-24490 | Localization | denotes | translocation |
T16708 | 24554-24564 | Protein | denotes | Histone H1 |
T16709 | 24569-24574 | Protein | denotes | MEK-1 |
T16710 | 24782-24788 | Protein | denotes | GATA-3 |
T16711 | 24800-24808 | Protein | denotes | anti-CD3 |
T16712 | 24809-24813 | Protein | denotes | CD28 |
T16713 | 24758-24765 | Entity | denotes | nuclear |
T16714 | 24766-24778 | Localization | denotes | localization |
T16715 | 24789-24796 | Positive_regulation | denotes | induced |
T16716 | 24749-24757 | Negative_regulation | denotes | impaired |
T16717 | 24985-24989 | Protein | denotes | MEK1 |
T16718 | 24994-25004 | Protein | denotes | histone H1 |
T16719 | 25232-25234 | Protein | denotes | FP |
T16720 | 25244-25248 | Protein | denotes | IL-4 |
T16721 | 25253-25262 | Protein | denotes | IL-5 mRNA |
T16722 | 25277-25280 | Protein | denotes | CD3 |
T16723 | 25281-25285 | Protein | denotes | CD28 |
T16724 | 25263-25273 | Gene_expression | denotes | expression |
T16725 | 25263-25273 | Gene_expression | denotes | expression |
T16726 | 25235-25243 | Negative_regulation | denotes | inhibits |
T16727 | 25235-25243 | Negative_regulation | denotes | inhibits |
T16728 | 25306-25311 | Protein | denotes | GAPDH |
T16729 | 25517-25520 | Protein | denotes | CD3 |
T16730 | 25521-25525 | Protein | denotes | CD28 |
T16731 | 25581-25584 | Protein | denotes | CD3 |
T16732 | 25585-25589 | Protein | denotes | CD28 |
T16733 | 25601-25607 | Protein | denotes | GATA-3 |
T16734 | 25637-25657 | Protein | denotes | IL-5 promoter 60 min |
T16735 | 25590-25600 | Positive_regulation | denotes | stimulated |
T16736 | 25611-25620 | Binding | denotes | associate |
T16737 | 25553-25560 | Negative_regulation | denotes | reduces |
T16738 | 25781-25786 | Protein | denotes | ANOVA |
T17504 | 26766-26772 | Protein | denotes | GATA-3 |
T17505 | 26790-26800 | Protein | denotes | importin-α |
T17506 | 26805-26811 | Protein | denotes | GATA-3 |
T17507 | 26773-26784 | Binding | denotes | association |
T17508 | 26812-26819 | Entity | denotes | nuclear |
T17509 | 26820-26826 | Localization | denotes | import |
T17510 | 26820-26826 | Localization | denotes | import |
T17511 | 26758-26765 | Negative_regulation | denotes | reduces |
T17512 | 26962-26964 | Protein | denotes | FP |
T17513 | 26975-26977 | Protein | denotes | GR |
T17514 | 26995-27005 | Protein | denotes | importin-α |
T17515 | 27007-27012 | Protein | denotes | Imp-α |
T17516 | 26978-26989 | Binding | denotes | interaction |
T17517 | 26978-26989 | Binding | denotes | interaction |
T17518 | 26978-26989 | Binding | denotes | interaction |
T17519 | 26965-26974 | Positive_regulation | denotes | activated |
T17520 | 26965-26974 | Positive_regulation | denotes | activated |
T17521 | 26965-26974 | Positive_regulation | denotes | activated |
T17522 | 26949-26958 | Positive_regulation | denotes | induction |
T17523 | 26949-26958 | Positive_regulation | denotes | induction |
T17524 | 26949-26958 | Positive_regulation | denotes | induction |
T17525 | 27038-27040 | Protein | denotes | GR |
T17526 | 27058-27066 | Protein | denotes | importin |
T17527 | 27041-27052 | Binding | denotes | association |
T17528 | 27026-27033 | Regulation | denotes | control |
T17529 | 27385-27387 | Protein | denotes | FP |
T17530 | 27398-27400 | Protein | denotes | GR |
T17531 | 27401-27408 | Entity | denotes | nuclear |
T17532 | 27409-27422 | Localization | denotes | translocation |
T17533 | 27388-27397 | Positive_regulation | denotes | activated |
T17534 | 27372-27381 | Positive_regulation | denotes | induction |
T17535 | 27654-27656 | Protein | denotes | FP |
T17536 | 27661-27669 | Protein | denotes | anti-CD3 |
T17537 | 27670-27674 | Protein | denotes | CD28 |
T17538 | 27741-27756 | Protein | denotes | GATA-3–importin |
T17539 | 27966-27970 | Protein | denotes | αCD3 |
T17540 | 27971-27975 | Protein | denotes | CD28 |
T17541 | 28009-28015 | Protein | denotes | GATA-3 |
T17542 | 28094-28097 | Protein | denotes | CD3 |
T17543 | 28098-28102 | Protein | denotes | CD28 |
T17544 | 28020-28033 | Gene_expression | denotes | overexpressed |
T17545 | 28020-28033 | Positive_regulation | denotes | overexpressed |
T17546 | 28208-28213 | Protein | denotes | ANOVA |
T18168 | 29449-29463 | Protein | denotes | p38 MAP kinase |
T18169 | 29542-29548 | Protein | denotes | GATA-3 |
T18170 | 29435-29445 | Negative_regulation | denotes | inhibition |
T18171 | 29464-29479 | Phosphorylation | denotes | phosphorylation |
T18172 | 29549-29555 | Entity | denotes | serine |
T18173 | 29556-29571 | Phosphorylation | denotes | phosphorylation |
T18174 | 29435-29445 | Negative_regulation | denotes | inhibition |
T18175 | 29523-29538 | Negative_regulation | denotes | down-regulation |
T18176 | 29705-29713 | Protein | denotes | p38 MAPK |
T18177 | 29717-29725 | Protein | denotes | anti-CD3 |
T18178 | 29726-29730 | Protein | denotes | CD28 |
T18179 | 29688-29700 | Entity | denotes | tyrosine-182 |
T18180 | 29653-29668 | Phosphorylation | denotes | phosphorylation |
T18181 | 29640-29647 | Negative_regulation | denotes | reduced |
T18182 | 29881-29889 | Protein | denotes | p38 MAPK |
T18183 | 29807-29822 | Phosphorylation | denotes | phosphorylation |
T18184 | 29929-29937 | Protein | denotes | p38 MAPK |
T18185 | 29982-29990 | Protein | denotes | anti-CD3 |
T18186 | 29991-29995 | Protein | denotes | CD28 |
T18187 | 30053-30059 | Protein | denotes | GATA-3 |
T18188 | 29915-29925 | Negative_regulation | denotes | inhibition |
T18189 | 30019-30025 | Entity | denotes | serine |
T18190 | 30043-30048 | Entity | denotes | P-Ser |
T18191 | 27966-27970 | Protein | denotes | αCD3 |
T18192 | 27971-27975 | Protein | denotes | CD28 |
T18636 | 31490-31497 | Protein | denotes | phospho |
T18637 | 31498-31504 | Protein | denotes | GATA-3 |
T18638 | 31509-31519 | Protein | denotes | importin-α |
T18639 | 31652-31654 | Protein | denotes | GR |
T18640 | 31723-31729 | Protein | denotes | GATA-3 |
T18641 | 31666-31673 | Binding | denotes | binding |
T18642 | 31713-31722 | Positive_regulation | denotes | activated |
T18643 | 31765-31767 | Protein | denotes | GR |
T18644 | 31755-31764 | Positive_regulation | denotes | activated |
T18645 | 31799-31802 | Protein | denotes | CD3 |
T18646 | 31803-31807 | Protein | denotes | CD28 |
T18647 | 31844-31846 | Protein | denotes | GR |
T18648 | 31914-31916 | Protein | denotes | GR |
T18649 | 31982-31985 | Protein | denotes | CD3 |
T18650 | 31986-31990 | Protein | denotes | CD28 |
T18651 | 31904-31913 | Positive_regulation | denotes | Activated |
T18652 | 32171-32186 | Protein | denotes | GATA-3-importin |
T18653 | 32187-32194 | Binding | denotes | binding |
T18654 | 32252-32254 | Protein | denotes | GR |
T18655 | 32273-32288 | Protein | denotes | GATA-3–importin |
T18656 | 32214-32223 | Positive_regulation | denotes | activated |
T18657 | 32453-32458 | Protein | denotes | ANOVA |
T19202 | 33471-33474 | Protein | denotes | CD3 |
T19203 | 33475-33479 | Protein | denotes | CD28 |
T19204 | 33498-33505 | Entity | denotes | nuclear |
T19205 | 33506-33518 | Localization | denotes | localization |
T19206 | 33506-33518 | Localization | denotes | localization |
T19207 | 33458-33465 | Negative_regulation | denotes | prevent |
T19208 | 33458-33465 | Negative_regulation | denotes | prevent |
T19209 | 33421-33427 | Regulation | denotes | affect |
T19210 | 33421-33427 | Regulation | denotes | affect |
T19211 | 25517-25520 | Protein | denotes | CD3 |
T19212 | 25521-25525 | Protein | denotes | CD28 |
T19213 | 33761-33767 | Protein | denotes | GATA-3 |
T19214 | 33828-33836 | Protein | denotes | anti-CD3 |
T19215 | 33837-33841 | Protein | denotes | CD28 |
T19216 | 33771-33784 | Gene_expression | denotes | overexpressed |
T19217 | 33924-33932 | Protein | denotes | anti-CD3 |
T19218 | 33933-33937 | Protein | denotes | CD28 |
T19219 | 33991-33994 | Protein | denotes | CD3 |
T19220 | 33995-33999 | Protein | denotes | CD28 |
T19221 | 34011-34014 | Protein | denotes | p65 |
T19222 | 34015-34022 | Entity | denotes | nuclear |
T19223 | 34023-34036 | Localization | denotes | translocation |
T19224 | 34023-34036 | Localization | denotes | translocation |
T19225 | 34023-34036 | Localization | denotes | translocation |
T19226 | 33978-33985 | Negative_regulation | denotes | prevent |
T19227 | 33978-33985 | Negative_regulation | denotes | prevent |
T19228 | 33978-33985 | Negative_regulation | denotes | prevent |
T19229 | 34231-34236 | Protein | denotes | ANOVA |
T19610 | 34844-34854 | Protein | denotes | importin-α |
T19611 | 34859-34865 | Protein | denotes | GATA-3 |
T19612 | 34827-34838 | Binding | denotes | interaction |
T19613 | 34827-34838 | Binding | denotes | interaction |
T19614 | 34866-34873 | Entity | denotes | nuclear |
T19615 | 34874-34886 | Localization | denotes | localization |
T19616 | 34874-34886 | Localization | denotes | localization |
T19617 | 35007-35009 | Protein | denotes | FP |
T19618 | 35061-35067 | Protein | denotes | GATA-3 |
T19619 | 35072-35082 | Protein | denotes | importin-α |
T19620 | 35041-35052 | Binding | denotes | interaction |
T19621 | 35442-35448 | Protein | denotes | GATA-3 |
T19622 | 35453-35463 | Protein | denotes | importin-α |
T19623 | 35422-35433 | Binding | denotes | association |
T19624 | 35412-35421 | Negative_regulation | denotes | decreased |
T19625 | 35578-35588 | Protein | denotes | importin-α |
T19626 | 35632-35634 | Protein | denotes | FP |
T19627 | 35589-35599 | Gene_expression | denotes | expression |
T19628 | 35604-35614 | Regulation | denotes | unaffected |
T20308 | 38140-38142 | Protein | denotes | GR |
T20309 | 38147-38174 | Protein | denotes | GATA-3 nuclear localisation |
T20310 | 38180-38194 | Protein | denotes | Nuclear GATA-3 |
T20311 | 38584-38590 | Protein | denotes | GATA-3 |
T20312 | 38606-38624 | Protein | denotes | cytoplasmic GATA-3 |
T20313 | 38656-38658 | Protein | denotes | FP |
T20314 | 38562-38569 | Entity | denotes | nuclear |
T20315 | 38570-38580 | Gene_expression | denotes | expression |
T20316 | 38625-38635 | Gene_expression | denotes | expression |
T20317 | 38642-38652 | Negative_regulation | denotes | inhalation |
T20318 | 38550-38558 | Negative_regulation | denotes | decrease |
T20319 | 38550-38558 | Negative_regulation | denotes | decrease |
T20320 | 38596-38605 | Positive_regulation | denotes | increased |
T20321 | 38761-38767 | Protein | denotes | GATA-3 |
T20322 | 38837-38839 | Protein | denotes | FP |
T20323 | 38739-38746 | Entity | denotes | nuclear |
T20324 | 38747-38757 | Gene_expression | denotes | expression |
T20325 | 38727-38735 | Negative_regulation | denotes | decrease |
T20326 | 38841-38851 | Protein | denotes | Histone H1 |
T20327 | 38856-38861 | Protein | denotes | MEK-1 |
T20328 | 39296-39299 | Protein | denotes | p38 |
T20329 | 39279-39291 | Entity | denotes | tyrosine-182 |
T20330 | 39244-39259 | Phosphorylation | denotes | phosphorylation |
T20331 | 39227-39235 | Negative_regulation | denotes | decrease |
T10934 | 28557-28566 | Negative_regulation | denotes | decreased |
T10921 | 28290-28298 | Protein | denotes | p38 MAPK |
T10922 | 28374-28397 | Protein | denotes | dual kinase phosphatase |
T10923 | 28398-28403 | Protein | denotes | MKP-1 |
T10924 | 28405-28409 | Protein | denotes | MAPK |
T10925 | 28357-28366 | Positive_regulation | denotes | induction |
T10926 | 28357-28366 | Positive_regulation | denotes | induction |
T10927 | 28281-28289 | Negative_regulation | denotes | inhibits |
T10928 | 28281-28289 | Negative_regulation | denotes | inhibits |
T10929 | 28525-28528 | Protein | denotes | CD3 |
T10930 | 28529-28533 | Protein | denotes | CD28 |
T10931 | 28567-28570 | Protein | denotes | p38 |
T10932 | 28571-28575 | Entity | denotes | MAPK |
T10933 | 28576-28591 | Phosphorylation | denotes | phosphorylation |
T10935 | 28805-28811 | Protein | denotes | GATA-3 |
T10936 | 28851-28854 | Protein | denotes | CD3 |
T10937 | 28855-28859 | Protein | denotes | CD28 |
T10938 | 28812-28818 | Entity | denotes | serine |
T10939 | 28819-28834 | Phosphorylation | denotes | phosphorylation |
T10940 | 28835-28842 | Positive_regulation | denotes | induced |
T10941 | 28797-28804 | Negative_regulation | denotes | reduced |
T10942 | 28954-28960 | Protein | denotes | GATA-3 |
T18193 | 30298-30308 | Protein | denotes | MKP-1 mRNA |
T18194 | 30290-30297 | Positive_regulation | denotes | induced |
T18195 | 30489-30499 | Protein | denotes | MKP-1 mRNA |
T18196 | 30481-30488 | Positive_regulation | denotes | induces |
T18197 | 30624-30629 | Protein | denotes | ANOVA |
T4610 | 14381-14401 | Protein | denotes | Th2 cytokine release |
T4340 | 13500-13510 | Protein | denotes | MAP kinase |
T4341 | 13515-13528 | Protein | denotes | phospho-ATF-2 |
T4342 | 13727-13730 | Protein | denotes | IgG |
T4608 | 14323-14331 | Protein | denotes | anti-CD3 |
T4609 | 14332-14336 | Protein | denotes | CD28 |
T4611 | 14371-14380 | Positive_regulation | denotes | stimulate |
T5189 | 15404-15421 | Protein | denotes | complete protease |
T5190 | 15431-15440 | Negative_regulation | denotes | inhibitor |
T5191 | 15633-15639 | Protein | denotes | GATA-3 |
T5192 | 15643-15653 | Protein | denotes | importin-α |
T5193 | 15852-15863 | Protein | denotes | anti-GATA-3 |
T5194 | 15865-15880 | Protein | denotes | anti-importin-α |
T5195 | 15882-15889 | Protein | denotes | anti-GR |
T5196 | 15891-15901 | Protein | denotes | anti-p-p38 |
T5197 | 15902-15912 | Protein | denotes | MAP kinase |
T5198 | 15846-15851 | Positive_regulation | denotes | using |
T5460 | 16054-16063 | Protein | denotes | Chromatin |
T5461 | 16064-16083 | Localization | denotes | Immunoprecipitation |
T5462 | 16084-16093 | Protein | denotes | Chromatin |
T5463 | 16245-16261 | Protein | denotes | immunoglobulin G |
T5464 | 16391-16404 | Protein | denotes | IL-5 promoter |
T6261 | 18033-18038 | Protein | denotes | NF-κB |
T6262 | 18039-18049 | Positive_regulation | denotes | Activation |
T6263 | 18050-18055 | Protein | denotes | NF-κB |
T6264 | 18056-18063 | Binding | denotes | binding |
T6265 | 18261-18292 | Protein | denotes | NF-κB consensus oligonucleotide |
T6266 | 18335-18352 | Protein | denotes | anti-p65 antibody |
T6267 | 18401-18424 | Protein | denotes | HRP-conjugated antibody |
T6268 | 18363-18370 | Binding | denotes | binding |
T7345 | 21103-21111 | Protein | denotes | anti-CD3 |
T7346 | 21112-21116 | Protein | denotes | CD28 |
R752 | T942 | T945 | themeOf | mitogen-activated protein kinase,expression |
R754 | T943 | T946 | themeOf | MAPK,expression |
R755 | T943 | T948 | themeOf | MAPK,translocation |
R756 | T944 | T947 | themeOf | p38 MAPK,inhibitor |
R758 | T945 | T949 | themeOf | expression,induces |
R759 | T946 | T950 | themeOf | expression,induces |
R761 | T948 | T951 | themeOf | translocation,necessary |
R764 | T952 | T954 | themeOf | GATA-3,effect |
R765 | T953 | T955 | themeOf | Th2,expression |
R767 | T955 | T956 | themeOf | expression,suppress |
R3968 | T4610 | T4611 | themeOf | Th2 cytokine release,stimulate |
R4481 | T5189 | T5190 | themeOf | complete protease,inhibitor |
R4482 | T5196 | T5198 | themeOf | anti-p-p38,using |
R4723 | T5460 | T5461 | themeOf | Chromatin,Immunoprecipitation |
R5223 | T6064 | T6070 | causeOf | FITC swine anti-rabbit IgG,used |
R5224 | T6065 | T6068 | themeOf | GATA-3,detection |
R5225 | T6067 | T6069 | themeOf | GR,detection |
R5226 | T6068 | T6070 | themeOf | detection,used |
R5386 | T6261 | T6262 | themeOf | NF-κB,Activation |
R5387 | T6263 | T6264 | themeOf | NF-κB,binding |
R5388 | T6267 | T6268 | themeOf | HRP-conjugated antibody,binding |
R6129 | T7144 | T7148 | themeOf | GATA-3,excised |
R6130 | T7145 | T7149 | themeOf | pOTB7 using XhoI,excised |
R7579 | T8773 | T8775 | themeOf | GATA-3 Nuclear Translocation,Effect |
R7580 | T8774 | T8776 | themeOf | IL-4 mRNA,Effect |
R7581 | T8777 | T8778 | themeOf | GATA-3-regulated IL-4 gene,expression |
R7582 | T8778 | T8779 | themeOf | expression,inhibiting |
R7583 | T8780 | T8784 | themeOf | anti-CD3,import |
R7584 | T8782 | T8785 | themeOf | GATA-3,import |
R7585 | T8783 | T8784 | locationOf | nuclear,import |
R7586 | T8783 | T8785 | locationOf | nuclear,import |
R7587 | T8784 | T8786 | themeOf | import,affect |
R7588 | T8785 | T8787 | themeOf | import,affect |
R7589 | T8792 | T8793 | themeOf | GATA-3,retention |
R7590 | T8793 | T8794 | themeOf | retention,loss |
R7633 | T8849 | T8861 | causeOf | CD28,stimulated |
R7634 | T8849 | T8862 | causeOf | CD28,stimulated |
R7635 | T8850 | T8854 | themeOf | IL-4,expression |
R7636 | T8851 | T8855 | themeOf | IL-5 mRNA,expression |
R7637 | T8852 | T8856 | themeOf | GATA-3,loss |
R7638 | T8852 | T8857 | themeOf | GATA-3,binding |
R7639 | T8852 | T8858 | themeOf | GATA-3,binding |
R7640 | T8853 | T8858 | themeOf | IL-5 promoter,binding |
R7641 | T8854 | T8859 | themeOf | expression,reductions |
R7642 | T8854 | T8861 | themeOf | expression,stimulated |
R7643 | T8855 | T8860 | themeOf | expression,reductions |
R7644 | T8855 | T8862 | themeOf | expression,stimulated |
R7645 | T8857 | T8863 | themeOf | binding,loss |
R7646 | T8858 | T8864 | themeOf | binding,loss |
R8047 | T9334 | T9337 | themeOf | GR,Ligand-Activated |
R8048 | T9338 | T9341 | themeOf | GR,ligand-activated |
R8049 | T9339 | T9342 | themeOf | GATA-3,ligand-activated |
R8050 | T9340 | T9344 | themeOf | importin-α,import |
R8051 | T9343 | T9344 | locationOf | nuclear,import |
R8052 | T9345 | T9347 | themeOf | GR,interaction |
R8053 | T9346 | T9347 | themeOf | importin-α,interaction |
R8054 | T9348 | T9350 | themeOf | GR,translocation |
R8055 | T9349 | T9350 | locationOf | nuclear,translocation |
R8056 | T9351 | T9355 | themeOf | GATA-3,association |
R8057 | T9352 | T9355 | themeOf | importin-α,association |
R8058 | T9355 | T9356 | themeOf | association,decreased |
R9378 | T10922 | T10925 | themeOf | dual kinase phosphatase,induction |
R9379 | T10923 | T10926 | themeOf | MKP-1,induction |
R9380 | T10925 | T10927 | themeOf | induction,inhibits |
R9381 | T10926 | T10928 | themeOf | induction,inhibits |
R9382 | T10931 | T10933 | themeOf | p38,phosphorylation |
R9383 | T10931 | T10932 | partOf | p38,MAPK |
R9384 | T10932 | T10933 | Site | MAPK,phosphorylation |
R9385 | T10933 | T10934 | themeOf | phosphorylation,decreased |
R9386 | T10935 | T10939 | themeOf | GATA-3,phosphorylation |
R9387 | T10935 | T10938 | partOf | GATA-3,serine |
R9388 | T10938 | T10939 | Site | serine,phosphorylation |
R9389 | T10939 | T10940 | themeOf | phosphorylation,induced |
R9390 | T10939 | T10941 | themeOf | phosphorylation,reduced |
R9391 | T10942 | T10944 | themeOf | GATA-3,phosphorylation |
R9392 | T10944 | T10945 | themeOf | phosphorylation,reduction |
R9393 | T10946 | T10948 | causeOf | FP,induced |
R9394 | T10947 | T10948 | themeOf | MKP-1 mRNA,induced |
R9395 | T10949 | T10950 | themeOf | IL-4 mRNA,expression |
R9396 | T10950 | T10951 | themeOf | expression,effects |
R9397 | T10952 | T10957 | themeOf | GATA-3,activated |
R9398 | T10953 | T10958 | themeOf | importin-α,activated |
R9399 | T10954 | T10959 | themeOf | GR,activated |
R9400 | T10955 | T10960 | themeOf | GR,activated |
R9401 | T10961 | T10963 | themeOf | GATA-3,activated |
R9402 | T10964 | T10966 | themeOf | GR,activated |
R9403 | T10964 | T10967 | themeOf | GR,associate |
R9404 | T10965 | T10968 | themeOf | GR,activated |
R9405 | T10969 | T10970 | themeOf | GR,ligand-activated |
R9406 | T10971 | T10972 | themeOf | FP,affect |
R9407 | T10974 | T10975 | themeOf | FP,expression |
R9408 | T10974 | T10976 | causeOf | FP,effect |
R9409 | T10975 | T10976 | themeOf | expression,effect |
R9410 | T10977 | T10982 | themeOf | FP,translocation |
R9411 | T10978 | T10983 | themeOf | CD3,translocation |
R9412 | T10979 | T10984 | themeOf | CD28,translocation |
R9413 | T10980 | T10985 | themeOf | GR,activated |
R9414 | T10981 | T10982 | locationOf | nuclear,translocation |
R9415 | T10981 | T10983 | locationOf | nuclear,translocation |
R9416 | T10981 | T10984 | locationOf | nuclear,translocation |
R9417 | T10986 | T10989 | themeOf | p65,translocation |
R9418 | T10988 | T10989 | locationOf | nuclear,translocation |
R9419 | T10989 | T10990 | themeOf | translocation,effect |
R11016 | T12798 | T12800 | themeOf | phospho-GATA-3,interaction |
R11017 | T12799 | T12800 | themeOf | importin-α,interaction |
R11018 | T12800 | T12801 | themeOf | interaction,decrease |
R11019 | T12802 | T12808 | causeOf | M FP,suppresses |
R11020 | T12803 | T12806 | themeOf | IL-4,expression |
R11021 | T12804 | T12807 | themeOf | GATA-3,interaction |
R11022 | T12805 | T12807 | themeOf | importin-α,interaction |
R11023 | T12806 | T12808 | themeOf | expression,suppresses |
R11024 | T12807 | T12809 | themeOf | interaction,attenuated |
R11025 | T12810 | T12812 | themeOf | GATA-3–importin,interaction |
R11026 | T12811 | T12812 | themeOf | α,interaction |
R11027 | T12812 | T12813 | themeOf | interaction,reduced |
R11028 | T12815 | T12818 | themeOf | GATA-3,interaction |
R11029 | T12817 | T12819 | themeOf | importin-α,abundance |
R11030 | T12819 | T12820 | themeOf | abundance,decrease |
R11031 | T12821 | T12823 | themeOf | GATA-3,localization |
R11032 | T12822 | T12823 | locationOf | cellular,localization |
R11033 | T12824 | T12826 | themeOf | GR,translocation |
R11034 | T12825 | T12826 | locationOf | nuclear,translocation |
R11035 | T12826 | T12827 | themeOf | translocation,increased |
R11036 | T12828 | T12831 | themeOf | cytoplasmic GATA-3,enhanced |
R11037 | T12829 | T12831 | causeOf | FP,enhanced |
R11038 | T12832 | T12833 | themeOf | p38 MAPK,phosphorylation |
R11039 | T12833 | T12834 | themeOf | phosphorylation,inhibited |
R11040 | T12835 | T12837 | themeOf | GATA-3,localization |
R11041 | T12836 | T12837 | locationOf | nuclear,localization |
R11042 | T12837 | T12838 | themeOf | localization,reduces |
R11043 | T12839 | T12842 | themeOf | importin-α,competition |
R11044 | T12840 | T12843 | themeOf | p38,phosphorylation |
R11045 | T12841 | T12844 | themeOf | MKP-1,induction |
R13478 | T15647 | T15648 | themeOf | Th2 genes,transcription |
R13483 | T15649 | T15653 | themeOf | GR,compete |
R13488 | T15650 | T15653 | themeOf | GATA-3,compete |
R13489 | T15650 | T15654 | themeOf | GATA-3,activated |
R13490 | T15651 | T15657 | themeOf | GATA-3,transport |
R13491 | T15652 | T15658 | themeOf | GR,transport |
R13492 | T15656 | T15657 | locationOf | nuclear,transport |
R13493 | T15656 | T15658 | locationOf | nuclear,transport |
R13494 | T15725 | T15727 | themeOf | MKP-1,induction |
R13495 | T15726 | T15728 | themeOf | MAPK,inhibitor |
R13496 | T15657 | T15659 | themeOf | transport,required |
R13497 | T15727 | T15729 | themeOf | induction,modulate |
R13498 | T15728 | T15730 | themeOf | inhibitor,induction |
R13499 | T15658 | T15660 | themeOf | transport,required |
R13500 | T15731 | T15733 | themeOf | MKP-1 mRNA,induction |
R13501 | T15661 | T15667 | themeOf | MKP-1,expression |
R13502 | T15734 | T15736 | themeOf | MKP-1,induction |
R13503 | T15662 | T15668 | themeOf | p38 MAPK,inhibitor |
R13504 | T15735 | T15738 | themeOf | p38 MAPK,attenuating |
R13505 | T15735 | T15739 | themeOf | p38 MAPK,phosphorylation |
R13506 | T15736 | T15738 | causeOf | induction,attenuating |
R13507 | T15736 | T15741 | causeOf | induction,attenuating |
R13508 | T15664 | T15669 | themeOf | p38 MAPK,activation |
R13509 | T15739 | T15741 | themeOf | phosphorylation,attenuating |
R13510 | T15665 | T15670 | themeOf | GATA-3,phosphorylation |
R13511 | T15742 | T15745 | themeOf | GATA-3,phosphorylated |
R13512 | T15665 | T15677 | causeOf | GATA-3,necessary |
R13513 | T15666 | T15671 | themeOf | importin-α,interaction |
R13514 | T15747 | T15749 | themeOf | IL-4 mRNA,expression |
R13515 | T15748 | T15750 | themeOf | IL-4,transcription |
R13516 | T15666 | T15673 | themeOf | importin-α,import |
R13517 | T15749 | T15751 | themeOf | expression,effect |
R13518 | T15667 | T15674 | themeOf | expression,increase |
R13519 | T15750 | T15752 | themeOf | transcription,suppress |
R13520 | T15669 | T15675 | themeOf | activation,prevent |
R13521 | T15753 | T15754 | themeOf | GATA-3,inhibition |
R13522 | T15756 | T15757 | themeOf | GATA-3,inhibiting |
R13523 | T15670 | T15676 | themeOf | phosphorylation,prevent |
R13524 | T15758 | T15760 | themeOf | IL-4,release |
R13525 | T15759 | T15761 | themeOf | IL-5,release |
R13526 | T15671 | T15677 | themeOf | interaction,necessary |
R13527 | T15760 | T15762 | themeOf | release,suppress |
R13528 | T15761 | T15763 | themeOf | release,suppress |
R13529 | T15672 | T15673 | locationOf | nuclear,import |
R13530 | T15764 | T15770 | themeOf | importin-α,binding |
R13531 | T15765 | T15771 | themeOf | MKP-1,synthesis |
R13532 | T15678 | T15682 | themeOf | GATA-3,translocation |
R13533 | T15766 | T15772 | themeOf | p38 MAPK,inhibits |
R13534 | T15767 | T15773 | themeOf | GATA-3,phosphorylation |
R13535 | T15767 | T15778 | causeOf | GATA-3,necessary |
R13536 | T15768 | T15775 | themeOf | GATA-3,translocation |
R13537 | T15771 | T15776 | themeOf | synthesis,increased |
R13538 | T15773 | T15777 | themeOf | phosphorylation,preventing |
R13539 | T15774 | T15775 | locationOf | nuclear,translocation |
R13540 | T15775 | T15778 | themeOf | translocation,necessary |
R13541 | T15679 | T15681 | themeOf | nuclear transporter protein importin-α,interacts |
R13542 | T15780 | T15781 | themeOf | importin-α,interaction |
R13543 | T15781 | T15782 | themeOf | interaction,Prevention |
R13544 | T15680 | T15682 | locationOf | nucleus,translocation |
R13545 | T15683 | T15688 | themeOf | GATA-3,knockdown |
R13546 | T15687 | T15689 | themeOf | GATA-3,transcription |
R13547 | T15692 | T15695 | themeOf | importin-α,binding |
R13548 | T15692 | T15696 | themeOf | importin-α,binding |
R13549 | T15693 | T15696 | themeOf | GR,binding |
R13550 | T15693 | T15697 | themeOf | GR,activated |
R13551 | T15694 | T15700 | themeOf | Th2 gene,transcription |
R13554 | T15695 | T15698 | themeOf | binding,activated |
R13556 | T15696 | T15699 | themeOf | binding,activated |
R13557 | T15700 | T15701 | themeOf | transcription,switch |
R13561 | T15700 | T15702 | themeOf | transcription,switch |
R13563 | T15704 | T15707 | themeOf | p65 subunit,translocation |
R13567 | T15705 | T15708 | themeOf | NF-κB,translocation |
R13571 | T15706 | T15707 | locationOf | nuclear,translocation |
R13574 | T15706 | T15708 | locationOf | nuclear,translocation |
R13575 | T15707 | T15709 | themeOf | translocation,affected |
R13582 | T15708 | T15710 | themeOf | translocation,affected |
R13586 | T15712 | T15715 | themeOf | GATA-3,exclusion |
R13595 | T15713 | T15716 | themeOf | GATA-3,degradation |
R13599 | T15714 | T15715 | locationOf | nuclear,exclusion |
R13605 | T15716 | T15717 | themeOf | degradation,induces |
R13608 | T15718 | T15719 | themeOf | GR,activated |
R13615 | T15720 | T15721 | themeOf | importin-α,associate |
R13617 | T15722 | T15723 | themeOf | MKP-1,induction |
R14335 | T16705 | T16707 | themeOf | GATA-3,translocation |
R14336 | T16706 | T16707 | locationOf | nucleus,translocation |
R14337 | T16710 | T16714 | themeOf | GATA-3,localization |
R14338 | T16713 | T16714 | locationOf | nuclear,localization |
R14339 | T16714 | T16715 | themeOf | localization,induced |
R14340 | T16714 | T16716 | themeOf | localization,impaired |
R14341 | T16719 | T16726 | causeOf | FP,inhibits |
R14342 | T16719 | T16727 | causeOf | FP,inhibits |
R14343 | T16720 | T16724 | themeOf | IL-4,expression |
R14344 | T16721 | T16725 | themeOf | IL-5 mRNA,expression |
R14345 | T16724 | T16726 | themeOf | expression,inhibits |
R14346 | T16725 | T16727 | themeOf | expression,inhibits |
R14347 | T16732 | T16735 | causeOf | CD28,stimulated |
R14348 | T16733 | T16735 | themeOf | GATA-3,stimulated |
R14349 | T16733 | T16736 | themeOf | GATA-3,associate |
R14350 | T16734 | T16736 | themeOf | IL-5 promoter 60 min,associate |
R14351 | T16735 | T16737 | themeOf | stimulated,reduces |
R15022 | T17504 | T17507 | themeOf | GATA-3,association |
R15023 | T17505 | T17507 | themeOf | importin-α,association |
R15024 | T17505 | T17509 | themeOf | importin-α,import |
R15025 | T17506 | T17510 | themeOf | GATA-3,import |
R15026 | T17507 | T17511 | themeOf | association,reduces |
R15027 | T17508 | T17509 | locationOf | nuclear,import |
R15028 | T17508 | T17510 | locationOf | nuclear,import |
R15029 | T17512 | T17519 | causeOf | FP,activated |
R15030 | T17512 | T17520 | causeOf | FP,activated |
R15031 | T17512 | T17521 | causeOf | FP,activated |
R15032 | T17513 | T17516 | themeOf | GR,interaction |
R15033 | T17513 | T17517 | themeOf | GR,interaction |
R15034 | T17513 | T17518 | themeOf | GR,interaction |
R15035 | T17514 | T17517 | themeOf | importin-α,interaction |
R15036 | T17515 | T17518 | themeOf | Imp-α,interaction |
R15037 | T17516 | T17519 | themeOf | interaction,activated |
R15038 | T17517 | T17520 | themeOf | interaction,activated |
R15039 | T17518 | T17521 | themeOf | interaction,activated |
R15040 | T17519 | T17522 | themeOf | activated,induction |
R15041 | T17520 | T17523 | themeOf | activated,induction |
R15042 | T17521 | T17524 | themeOf | activated,induction |
R15043 | T17525 | T17527 | themeOf | GR,association |
R15044 | T17526 | T17527 | themeOf | importin,association |
R15045 | T17527 | T17528 | themeOf | association,control |
R15046 | T17529 | T17533 | causeOf | FP,activated |
R15047 | T17530 | T17532 | themeOf | GR,translocation |
R15048 | T17531 | T17532 | locationOf | nuclear,translocation |
R15049 | T17532 | T17533 | themeOf | translocation,activated |
R15050 | T17533 | T17534 | themeOf | activated,induction |
R15051 | T17541 | T17544 | themeOf | GATA-3,overexpressed |
R15052 | T17544 | T17545 | themeOf | overexpressed,overexpressed |
R15571 | T18168 | T18170 | themeOf | p38 MAP kinase,inhibition |
R15572 | T18168 | T18171 | themeOf | p38 MAP kinase,phosphorylation |
R15573 | T18169 | T18173 | themeOf | GATA-3,phosphorylation |
R15574 | T18169 | T18172 | partOf | GATA-3,serine |
R15575 | T18171 | T18174 | themeOf | phosphorylation,inhibition |
R15576 | T18172 | T18173 | Site | serine,phosphorylation |
R15577 | T18173 | T18175 | themeOf | phosphorylation,down-regulation |
R15578 | T18176 | T18180 | themeOf | p38 MAPK,phosphorylation |
R15579 | T18176 | T18179 | partOf | p38 MAPK,tyrosine-182 |
R15580 | T18179 | T18180 | Site | tyrosine-182,phosphorylation |
R15581 | T18180 | T18181 | themeOf | phosphorylation,reduced |
R15582 | T18182 | T18183 | themeOf | p38 MAPK,phosphorylation |
R15583 | T18184 | T18188 | themeOf | p38 MAPK,inhibition |
R15584 | T18185 | T18189 | partOf | anti-CD3,serine |
R15585 | T18186 | T18189 | partOf | CD28,serine |
R15586 | T18187 | T18189 | partOf | GATA-3,serine |
R15587 | T18187 | T18190 | partOf | GATA-3,P-Ser |
R15588 | T18193 | T18194 | themeOf | MKP-1 mRNA,induced |
R15589 | T18195 | T18196 | themeOf | MKP-1 mRNA,induces |
R15928 | T18639 | T18641 | themeOf | GR,binding |
R15929 | T18640 | T18642 | themeOf | GATA-3,activated |
R15930 | T18643 | T18644 | themeOf | GR,activated |
R15931 | T18648 | T18651 | themeOf | GR,Activated |
R15932 | T18652 | T18653 | themeOf | GATA-3-importin,binding |
R15933 | T18654 | T18656 | themeOf | GR,activated |
R16400 | T19202 | T19205 | themeOf | CD3,localization |
R16401 | T19203 | T19206 | themeOf | CD28,localization |
R16402 | T19204 | T19205 | locationOf | nuclear,localization |
R16403 | T19204 | T19206 | locationOf | nuclear,localization |
R16404 | T19205 | T19207 | themeOf | localization,prevent |
R16405 | T19206 | T19208 | themeOf | localization,prevent |
R16406 | T19207 | T19209 | themeOf | prevent,affect |
R16407 | T19208 | T19210 | themeOf | prevent,affect |
R16408 | T19213 | T19216 | themeOf | GATA-3,overexpressed |
R16409 | T19219 | T19223 | themeOf | CD3,translocation |
R16410 | T19220 | T19224 | themeOf | CD28,translocation |
R16411 | T19221 | T19225 | themeOf | p65,translocation |
R16412 | T19222 | T19223 | locationOf | nuclear,translocation |
R16413 | T19222 | T19224 | locationOf | nuclear,translocation |
R16414 | T19222 | T19225 | locationOf | nuclear,translocation |
R16415 | T19223 | T19226 | themeOf | translocation,prevent |
R16416 | T19224 | T19227 | themeOf | translocation,prevent |
R16417 | T19225 | T19228 | themeOf | translocation,prevent |
R16754 | T19610 | T19612 | themeOf | importin-α,interaction |
R16755 | T19610 | T19613 | themeOf | importin-α,interaction |
R16756 | T19610 | T19615 | themeOf | importin-α,localization |
R16757 | T19611 | T19613 | themeOf | GATA-3,interaction |
R16758 | T19611 | T19616 | themeOf | GATA-3,localization |
R16759 | T19614 | T19615 | locationOf | nuclear,localization |
R16760 | T19614 | T19616 | locationOf | nuclear,localization |
R16761 | T19618 | T19620 | themeOf | GATA-3,interaction |
R16762 | T19619 | T19620 | themeOf | importin-α,interaction |
R16763 | T19621 | T19623 | themeOf | GATA-3,association |
R16764 | T19622 | T19623 | themeOf | importin-α,association |
R16765 | T19623 | T19624 | themeOf | association,decreased |
R16766 | T19625 | T19627 | themeOf | importin-α,expression |
R16767 | T19626 | T19628 | causeOf | FP,unaffected |
R16768 | T19627 | T19628 | themeOf | expression,unaffected |
R17370 | T20311 | T20315 | themeOf | GATA-3,expression |
R17371 | T20312 | T20316 | themeOf | cytoplasmic GATA-3,expression |
R17372 | T20313 | T20317 | themeOf | FP,inhalation |
R17373 | T20315 | T20318 | themeOf | expression,decrease |
R17374 | T20316 | T20319 | themeOf | expression,decrease |
R17375 | T20316 | T20320 | themeOf | expression,increased |
R17376 | T20317 | T20318 | causeOf | inhalation,decrease |
R17377 | T20317 | T20319 | causeOf | inhalation,decrease |
R17378 | T20321 | T20324 | themeOf | GATA-3,expression |
R17379 | T20324 | T20325 | themeOf | expression,decrease |
R17380 | T20328 | T20330 | themeOf | p38,phosphorylation |
R17381 | T20328 | T20329 | partOf | p38,tyrosine-182 |
R17382 | T20329 | T20330 | Site | tyrosine-182,phosphorylation |
R17383 | T20330 | T20331 | themeOf | phosphorylation,decrease |
R734 | T919 | T920 | themeOf | GATA-3 Nuclear Import,Suppression |
R735 | T919 | T921 | themeOf | GATA-3 Nuclear Import,Phosphorylation |
R737 | T921 | T922 | themeOf | Phosphorylation,Suppression |
R739 | T923 | T926 | causeOf | GATA-3,regulating |
R740 | T924 | T925 | themeOf | "interleukin (IL)-4, IL-5",expression |
R742 | T925 | T926 | themeOf | expression,regulating |
R743 | T927 | T928 | themeOf | GATA-3,effects |
R744 | T929 | T930 | themeOf | GATA-3,regulation |
R745 | T930 | T931 | themeOf | regulation,effect |
R746 | T934 | T939 | themeOf | GATA-3,translocation |
R747 | T937 | T940 | themeOf | glucocorticoid receptor,ligand-activated |
R748 | T938 | T939 | locationOf | nuclear,translocation |
R750 | T939 | T941 | themeOf | translocation,inhibits |
bionlp-st-ge-2016-reference
Id | Subject | Object | Predicate | Lexical cue | Negation | Speculation |
---|---|---|---|---|---|---|
T96 | 498-508 | Regulation | denotes | regulating | ||
T97 | 498-508 | Regulation | denotes | regulating | ||
T98 | 498-508 | Regulation | denotes | regulating | ||
T99 | 513-523 | Gene_expression | denotes | expression | ||
T100 | 513-523 | Gene_expression | denotes | expression | ||
T101 | 513-523 | Gene_expression | denotes | expression | ||
T102 | 541-559 | Protein | denotes | interleukin (IL)-4 | ||
T103 | 561-565 | Protein | denotes | IL-5 | ||
T104 | 571-576 | Protein | denotes | IL-13 | ||
T105 | 755-761 | Protein | denotes | GATA-3 | ||
T106 | 795-801 | Regulation | denotes | effect | ||
T107 | 850-856 | Protein | denotes | GATA-3 | ||
T108 | 857-867 | Regulation | denotes | regulation | ||
T109 | 1090-1098 | Negative_regulation | denotes | inhibits | ||
T110 | 1099-1106 | Entity | denotes | nuclear | ||
T111 | 1107-1120 | Localization | denotes | translocation | ||
T112 | 1124-1130 | Protein | denotes | GATA-3 | ||
T113 | 1236-1247 | Negative_regulation | denotes | competition | ||
T114 | 1236-1247 | Negative_regulation | denotes | competition | ||
T115 | 1256-1262 | Protein | denotes | GATA-3 | ||
T116 | 1278-1287 | Positive_regulation | denotes | activated | ||
T117 | 1288-1311 | Protein | denotes | glucocorticoid receptor | ||
T118 | 1316-1323 | Entity | denotes | nuclear | ||
T119 | 1324-1333 | Localization | denotes | transport | ||
T120 | 1324-1333 | Localization | denotes | transport | ||
T121 | 1400-1407 | Positive_regulation | denotes | induces | ||
T122 | 1412-1422 | Gene_expression | denotes | expression | ||
T123 | 1426-1479 | Protein | denotes | mitogen-activated protein kinase (MAPK) phosphatase-1 | ||
T124 | 1481-1486 | Protein | denotes | MKP-1 | ||
T125 | 1536-1545 | Positive_regulation | denotes | necessary | ||
T126 | 1550-1556 | Protein | denotes | GATA-3 | ||
T127 | 1557-1564 | Entity | denotes | nuclear | ||
T128 | 1565-1578 | Localization | denotes | translocation | ||
T129 | 1700-1708 | Negative_regulation | denotes | inhibits | ||
T130 | 1709-1715 | Protein | denotes | GATA-3 | ||
T131 | 1716-1723 | Entity | denotes | nuclear | ||
T132 | 1724-1737 | Localization | denotes | translocation | ||
T133 | 1846-1863 | Negative_regulation | denotes | inhibitory effect | ||
T134 | 1867-1873 | Protein | denotes | GATA-3 | ||
T1201 | 8286-8289 | Protein | denotes | CD4 | ||
T1202 | 8318-8327 | Negative_regulation | denotes | knockdown | ||
T1203 | 8331-8337 | Protein | denotes | GATA-3 | ||
T1204 | 8338-8348 | Gene_expression | denotes | expression | ||
T1205 | 8463-8469 | Protein | denotes | GATA-3 | ||
T1206 | 8507-8518 | Localization | denotes | translocate | ||
T1207 | 8547-8554 | Entity | denotes | nucleus | ||
T1208 | 8558-8564 | Binding | denotes | access | ||
T1209 | 8569-8575 | Binding | denotes | target | ||
T1210 | 8592-8599 | Entity | denotes | nuclear | ||
T1211 | 8600-8610 | Localization | denotes | expression | ||
T1212 | 8614-8620 | Protein | denotes | GATA-3 | ||
T1213 | 8621-8630 | Positive_regulation | denotes | following | ||
T1214 | 8748-8757 | Positive_regulation | denotes | following | ||
T1215 | 8808-8814 | Protein | denotes | GATA-3 | ||
T1216 | 8870-8881 | Localization | denotes | transported | ||
T1217 | 8891-8898 | Entity | denotes | nucleus | ||
T1218 | 9014-9020 | Protein | denotes | GATA-3 | ||
T1219 | 9304-9308 | Regulation | denotes | role | ||
T1220 | 9312-9327 | Phosphorylation | denotes | phosphorylating | ||
T1221 | 9328-9334 | Protein | denotes | GATA-3 | ||
T1222 | 9338-9345 | Positive_regulation | denotes | enhance | ||
T1223 | 9350-9361 | Binding | denotes | interaction | ||
T1224 | 9652-9659 | Binding | denotes | binding | ||
T1225 | 9663-9687 | Protein | denotes | glucocorticoid receptors | ||
T1226 | 9689-9692 | Protein | denotes | GRs | ||
T1227 | 9706-9717 | Localization | denotes | translocate | ||
T1228 | 9725-9732 | Entity | denotes | nucleus | ||
T1229 | 9744-9752 | Binding | denotes | interact | ||
T1256 | 10795-10803 | Positive_regulation | denotes | requires | ||
T1257 | 10946-10948 | Protein | denotes | GR | ||
T1258 | 10949-10955 | Localization | denotes | import | ||
T1259 | 10998-11007 | Regulation | denotes | important | ||
T1260 | 11016-11026 | Regulation | denotes | regulation | ||
T1261 | 11030-11032 | Protein | denotes | GR | ||
T1262 | 11033-11043 | Positive_regulation | denotes | activation | ||
T1263 | 11366-11370 | Protein | denotes | IL-4 | ||
T1264 | 11372-11376 | Protein | denotes | IL-5 | ||
T1265 | 11382-11387 | Protein | denotes | IL-13 | ||
T1266 | 11455-11464 | Regulation | denotes | regulated | ||
T1267 | 11455-11464 | Regulation | denotes | regulated | ||
T1268 | 11455-11464 | Regulation | denotes | regulated | ||
T1269 | 11525-11528 | Protein | denotes | CAT | ||
T1270 | 11590-11592 | Protein | denotes | GR | ||
T1271 | 11593-11600 | Negative_regulation | denotes | reduced | ||
T1272 | 11593-11600 | Negative_regulation | denotes | reduced | ||
T1273 | 11601-11607 | Protein | denotes | GATA-3 | ||
T1274 | 11608-11616 | Positive_regulation | denotes | mediated | ||
T1275 | 11608-11616 | Positive_regulation | denotes | mediated | ||
T1276 | 11617-11621 | Protein | denotes | IL-5 | ||
T1277 | 11626-11629 | Protein | denotes | -13 | ||
T1278 | 11639-11647 | Gene_expression | denotes | activity | ||
T1279 | 11639-11647 | Gene_expression | denotes | activity | ||
T1280 | 11657-11660 | Protein | denotes | CD4 | ||
T1281 | 11705-11716 | Localization | denotes | recruitment | ||
T1282 | 11720-11722 | Protein | denotes | GR | ||
T1283 | 11727-11732 | Regulation | denotes | alter | true | |
T1284 | 11748-11754 | Protein | denotes | GATA-3 | ||
T1285 | 11765-11769 | Binding | denotes | bind | ||
T1286 | 11928-11935 | Regulation | denotes | effects | true | |
T1287 | 11928-11935 | Regulation | denotes | effects | true | |
T1288 | 11974-11980 | Protein | denotes | GATA-3 | ||
T1289 | 11981-11996 | Phosphorylation | denotes | phosphorylation | ||
T1290 | 12001-12008 | Entity | denotes | nuclear | ||
T1291 | 12009-12022 | Localization | denotes | translocation | ||
T1292 | 12179-12186 | Regulation | denotes | effects | ||
T1293 | 12221-12227 | Protein | denotes | GATA-3 | ||
T1294 | 12240-12252 | Localization | denotes | localization | ||
T3970 | 13206-13209 | Protein | denotes | CD3 | ||
T3971 | 13211-13215 | Protein | denotes | CD28 | ||
T3972 | 13217-13219 | Protein | denotes | GR | ||
T3973 | 13329-13335 | Protein | denotes | GATA-3 | ||
T3974 | 13347-13349 | Protein | denotes | GR | ||
T3975 | 13523-13528 | Protein | denotes | ATF-2 | ||
T8186 | 23176-23182 | Regulation | denotes | Effect | ||
T8187 | 23205-23211 | Protein | denotes | GATA-3 | ||
T8188 | 23212-23219 | Entity | denotes | Nuclear | ||
T8189 | 23220-23233 | Localization | denotes | Translocation | ||
T8190 | 23238-23242 | Protein | denotes | IL-4 | ||
T8191 | 23268-23277 | Regulation | denotes | effective | ||
T8192 | 23281-23291 | Negative_regulation | denotes | inhibiting | ||
T8193 | 23292-23298 | Protein | denotes | GATA-3 | ||
T8194 | 23299-23308 | Regulation | denotes | regulated | ||
T8195 | 23309-23313 | Protein | denotes | IL-4 | ||
T8196 | 23319-23329 | Gene_expression | denotes | expression | ||
T8197 | 23407-23413 | Regulation | denotes | affect | true | |
T8198 | 23428-23438 | Positive_regulation | denotes | stimulated | ||
T8199 | 23439-23446 | Entity | denotes | nuclear | ||
T8200 | 23447-23453 | Localization | denotes | import | ||
T8201 | 23457-23463 | Protein | denotes | GATA-3 | ||
T8202 | 23505-23513 | Positive_regulation | denotes | resulted | ||
T8203 | 23537-23544 | Entity | denotes | nuclear | ||
T8204 | 23545-23551 | Protein | denotes | GATA-3 | ||
T8205 | 23552-23565 | Localization | denotes | translocation | ||
T8206 | 23720-23725 | Protein | denotes | MEK-1 | ||
T8207 | 23784-23790 | Positive_regulation | denotes | caused | ||
T8208 | 23784-23790 | Positive_regulation | denotes | caused | ||
T8209 | 23801-23805 | Negative_regulation | denotes | loss | ||
T8210 | 23809-23816 | Entity | denotes | nuclear | ||
T8211 | 23817-23823 | Protein | denotes | GATA-3 | ||
T8212 | 23824-23834 | Localization | denotes | expression | ||
T8213 | 23839-23850 | Entity | denotes | cytoplasmic | ||
T8214 | 23851-23860 | Localization | denotes | retention | ||
T8215 | 23864-23870 | Protein | denotes | GATA-3 | ||
T8216 | 23959-23970 | Regulation | denotes | This effect | ||
T8217 | 23959-23970 | Regulation | denotes | This effect | ||
T8218 | 23959-23970 | Regulation | denotes | This effect | ||
T8219 | 23999-24008 | Regulation | denotes | dependent | ||
T8220 | 23999-24008 | Regulation | denotes | dependent | ||
T8221 | 23999-24008 | Regulation | denotes | dependent | ||
T8222 | 24101-24111 | Regulation | denotes | associated | ||
T8223 | 24101-24111 | Regulation | denotes | associated | ||
T8224 | 24101-24111 | Regulation | denotes | associated | ||
T8225 | 24124-24134 | Negative_regulation | denotes | reductions | ||
T8226 | 24124-24134 | Negative_regulation | denotes | reductions | ||
T8227 | 24152-24162 | Positive_regulation | denotes | stimulated | ||
T8228 | 24152-24162 | Positive_regulation | denotes | stimulated | ||
T8229 | 24163-24167 | Protein | denotes | IL-4 | ||
T8230 | 24172-24176 | Protein | denotes | IL-5 | ||
T8231 | 24177-24192 | Transcription | denotes | mRNA expression | ||
T8232 | 24177-24192 | Transcription | denotes | mRNA expression | ||
T8233 | 24211-24215 | Negative_regulation | denotes | loss | ||
T8234 | 24219-24225 | Protein | denotes | GATA-3 | ||
T8235 | 24226-24233 | Binding | denotes | binding | ||
T8236 | 24248-24252 | Protein | denotes | IL-5 | ||
T8237 | 24253-24261 | Entity | denotes | promoter | ||
T8929 | 26335-26344 | Negative_regulation | denotes | decreased | ||
T8930 | 26349-26360 | Binding | denotes | association | ||
T8931 | 26369-26375 | Protein | denotes | GATA-3 | ||
T8932 | 26391-26398 | Positive_regulation | denotes | induced | ||
T8933 | 26447-26456 | Regulation | denotes | dependent | ||
T8934 | 26496-26515 | Protein | denotes | GFP-labelled GATA-3 | ||
T8935 | 26561-26567 | Protein | denotes | GATA-3 | ||
T8936 | 26568-26575 | Entity | denotes | nuclear | ||
T8937 | 26576-26582 | Localization | denotes | import | ||
T8938 | 26583-26592 | Positive_regulation | denotes | following | ||
T8939 | 26634-26644 | Negative_regulation | denotes | attenuated | ||
T9602 | 29069-29073 | Transcription | denotes | mRNA | ||
T9603 | 29108-29117 | Regulation | denotes | dependent | ||
T9604 | 29201-29208 | Regulation | denotes | effects | ||
T9605 | 29201-29208 | Regulation | denotes | effects | ||
T9606 | 29201-29208 | Regulation | denotes | effects | ||
T9607 | 29218-29224 | Protein | denotes | GATA-3 | ||
T9608 | 29225-29232 | Entity | denotes | nuclear | ||
T9609 | 29233-29239 | Localization | denotes | import | ||
T9610 | 29252-29263 | Binding | denotes | association | ||
T9611 | 29268-29272 | Protein | denotes | IL-4 | ||
T9612 | 29273-29288 | Transcription | denotes | mRNA expression | ||
T9613 | 30686-30697 | Negative_regulation | denotes | competition | ||
T9614 | 30686-30697 | Negative_regulation | denotes | competition | ||
T9615 | 30735-30744 | Positive_regulation | denotes | activated | ||
T9616 | 30745-30751 | Protein | denotes | GATA-3 | ||
T9617 | 30769-30778 | Positive_regulation | denotes | activated | ||
T9618 | 30779-30781 | Protein | denotes | GR | ||
T9619 | 30804-30813 | Positive_regulation | denotes | activated | ||
T9633 | 31075-31077 | Protein | denotes | GR | ||
T9634 | 31090-31096 | Protein | denotes | GATA-3 | ||
T9635 | 31110-31119 | Binding | denotes | associate | ||
T9636 | 31110-31119 | Binding | denotes | associate | ||
T9637 | 31157-31166 | Positive_regulation | denotes | activated | ||
T9638 | 31167-31169 | Protein | denotes | GR | ||
T9639 | 31170-31180 | Negative_regulation | denotes | attenuates | ||
T9640 | 31185-31192 | Phosphorylation | denotes | phospho | ||
T9641 | 31193-31199 | Protein | denotes | GATA-3 | ||
T9642 | 31211-31222 | Binding | denotes | interaction | ||
T9643 | 31242-31251 | Regulation | denotes | dependent | ||
T9644 | 31308-31317 | Positive_regulation | denotes | activated | ||
T9645 | 31318-31320 | Protein | denotes | GR | ||
T9646 | 31325-31332 | Negative_regulation | denotes | compete | true | |
T9647 | 31346-31352 | Protein | denotes | GATA-3 | ||
T9648 | 31353-31356 | Binding | denotes | for | ||
T9649 | 31380-31385 | Negative_regulation | denotes | limit | ||
T9650 | 31386-31392 | Protein | denotes | GATA-3 | ||
T9651 | 31393-31400 | Entity | denotes | nuclear | ||
T9652 | 31401-31407 | Localization | denotes | import | ||
T9653 | 32560-32566 | Regulation | denotes | effect | ||
T9654 | 32560-32566 | Regulation | denotes | effect | ||
T9655 | 32576-32582 | Protein | denotes | GATA-3 | ||
T9656 | 32583-32590 | Entity | denotes | nuclear | ||
T9657 | 32591-32597 | Localization | denotes | export | ||
T9658 | 32605-32616 | Protein_catabolism | denotes | degradation | ||
T9659 | 32671-32677 | Regulation | denotes | affect | true | |
T9660 | 32699-32704 | Negative_regulation | denotes | block | ||
T9661 | 32705-32711 | Protein | denotes | GATA-3 | ||
T9662 | 32712-32719 | Entity | denotes | nuclear | ||
T9663 | 32720-32732 | Localization | denotes | localization | ||
T9664 | 32770-32776 | Regulation | denotes | effect | true | |
T9665 | 32791-32797 | Protein | denotes | GATA-3 | ||
T9666 | 32798-32808 | Gene_expression | denotes | expression | ||
T9667 | 32939-32945 | Regulation | denotes | affect | true | |
T9668 | 32946-32952 | Protein | denotes | GATA-3 | ||
T9669 | 32953-32960 | Entity | denotes | nuclear | ||
T9670 | 32961-32970 | Localization | denotes | residency | ||
T9671 | 33000-33009 | Positive_regulation | denotes | activated | ||
T9672 | 33010-33012 | Protein | denotes | GR | ||
T9673 | 33022-33029 | Positive_regulation | denotes | enhance | true | |
T9674 | 33030-33036 | Protein | denotes | GATA-3 | ||
T9675 | 33037-33044 | Entity | denotes | nuclear | ||
T9676 | 33045-33051 | Localization | denotes | export | ||
T9677 | 33066-33072 | Regulation | denotes | effect | ||
T9678 | 33082-33088 | Protein | denotes | GATA-3 | ||
T9679 | 33089-33096 | Entity | denotes | nuclear | ||
T9680 | 33097-33103 | Localization | denotes | import | ||
T9681 | 33150-33156 | Regulation | denotes | effect | true | |
T9682 | 33160-33163 | Protein | denotes | p65 | ||
T9683 | 33164-33171 | Entity | denotes | nuclear | ||
T9684 | 33172-33185 | Localization | denotes | translocation | ||
T11235 | 35753-35763 | Negative_regulation | denotes | suppresses | ||
T11236 | 35753-35763 | Negative_regulation | denotes | suppresses | ||
T11237 | 35764-35768 | Protein | denotes | IL-4 | ||
T11238 | 35773-35775 | Protein | denotes | -5 | ||
T11239 | 35781-35791 | Gene_expression | denotes | expression | ||
T11240 | 35781-35791 | Gene_expression | denotes | expression | ||
T11241 | 35796-35806 | Negative_regulation | denotes | attenuated | ||
T11242 | 35811-35822 | Binding | denotes | interaction | ||
T11243 | 35826-35832 | Protein | denotes | GATA-3 | ||
T11244 | 36078-36085 | Negative_regulation | denotes | reduced | ||
T11245 | 36086-36092 | Protein | denotes | GATA-3 | ||
T11246 | 36104-36115 | Binding | denotes | interaction | ||
T11247 | 36134-36143 | Regulation | denotes | dependent | ||
T11248 | 36157-36165 | Regulation | denotes | produced | ||
T11249 | 36173-36181 | Negative_regulation | denotes | decrease | ||
T11250 | 36185-36191 | Protein | denotes | GATA-3 | ||
T11251 | 36203-36214 | Binding | denotes | association | ||
T11252 | 36483-36489 | Protein | denotes | GATA-3 | ||
T11253 | 36501-36512 | Binding | denotes | association | ||
T11254 | 36599-36609 | Negative_regulation | denotes | attenuated | ||
T11255 | 36610-36621 | Binding | denotes | interaction | ||
T11256 | 36625-36631 | Protein | denotes | GATA-3 | ||
T11257 | 36847-36853 | Regulation | denotes | affect | true | |
T11258 | 36863-36875 | Localization | denotes | localization | ||
T11259 | 36879-36885 | Protein | denotes | GATA-3 | ||
T11260 | 36972-36981 | Positive_regulation | denotes | increased | ||
T11261 | 36982-36984 | Protein | denotes | GR | ||
T11262 | 36985-36992 | Entity | denotes | nuclear | ||
T11263 | 36993-37006 | Localization | denotes | translocation | ||
T11264 | 37069-37075 | Protein | denotes | GATA-3 | ||
T11265 | 37424-37431 | Positive_regulation | denotes | induced | ||
T11266 | 37444-37448 | Localization | denotes | loss | true | |
T11267 | 37452-37459 | Entity | denotes | nuclear | ||
T11268 | 37460-37466 | Protein | denotes | GATA-3 | ||
T11269 | 37591-37602 | Entity | denotes | cytoplasmic | ||
T11270 | 37603-37609 | Protein | denotes | GATA-3 | ||
T11271 | 37610-37616 | Localization | denotes | levels | ||
T11272 | 37622-37630 | Positive_regulation | denotes | enhanced | ||
T13173 | 40280-40289 | Localization | denotes | transport | ||
T13174 | 40298-40304 | Protein | denotes | GATA-3 | ||
T13175 | 40309-40311 | Protein | denotes | GR | ||
T13176 | 40364-40372 | Positive_regulation | denotes | increase | ||
T13177 | 40377-40387 | Gene_expression | denotes | expression | ||
T13178 | 40391-40396 | Protein | denotes | MKP-1 | ||
T13179 | 40512-40519 | Negative_regulation | denotes | prevent | ||
T13180 | 40524-40539 | Phosphorylation | denotes | phosphorylation | ||
T13181 | 40543-40549 | Protein | denotes | GATA-3 | ||
T13182 | 40558-40567 | Positive_regulation | denotes | necessary | ||
T13183 | 40558-40567 | Positive_regulation | denotes | necessary | ||
T13184 | 40572-40583 | Binding | denotes | interaction | ||
T13185 | 40604-40614 | Positive_regulation | denotes | subsequent | ||
T13186 | 40615-40622 | Entity | denotes | nuclear | ||
T13187 | 40623-40629 | Localization | denotes | import | ||
T13188 | 40661-40674 | Localization | denotes | translocation | ||
T13189 | 40678-40684 | Protein | denotes | GATA-3 | ||
T13190 | 40711-40718 | Entity | denotes | nucleus | ||
T13191 | 40719-40727 | Regulation | denotes | involves | ||
T13192 | 40778-40787 | Binding | denotes | interacts | ||
T13193 | 40793-40807 | Phosphorylation | denotes | phosphorylated | ||
T13194 | 40808-40814 | Protein | denotes | GATA-3 | ||
T13195 | 40859-40865 | Protein | denotes | GATA-3 | ||
T13196 | 40866-40875 | Gene_expression | denotes | knockdown | true | |
T13197 | 40899-40910 | Negative_regulation | denotes | suppression | ||
T13198 | 40899-40910 | Negative_regulation | denotes | suppression | ||
T13199 | 40928-40938 | Positive_regulation | denotes | stimulated | ||
T13200 | 40928-40938 | Positive_regulation | denotes | stimulated | ||
T13201 | 40939-40943 | Protein | denotes | IL-4 | ||
T13202 | 40944-40948 | Protein | denotes | IL-5 | ||
T13203 | 40954-40963 | Transcription | denotes | induction | ||
T13204 | 40954-40963 | Transcription | denotes | induction | ||
T13205 | 40995-40999 | Regulation | denotes | role | ||
T13206 | 40995-40999 | Regulation | denotes | role | ||
T13207 | 41004-41010 | Protein | denotes | GATA-3 | ||
T13208 | 41018-41031 | Transcription | denotes | transcription | ||
T13209 | 41018-41031 | Transcription | denotes | transcription | ||
T13210 | 41092-41094 | Protein | denotes | GR | ||
T13211 | 41114-41121 | Entity | denotes | nuclear | ||
T13212 | 41122-41128 | Localization | denotes | import | ||
T13213 | 41142-41148 | Protein | denotes | GATA-3 | ||
T13214 | 41190-41201 | Negative_regulation | denotes | competition | true | |
T13215 | 41227-41229 | Protein | denotes | GR | ||
T13216 | 41234-41241 | Phosphorylation | denotes | phospho | ||
T13217 | 41242-41248 | Protein | denotes | GATA-3 | ||
T13218 | 41253-41260 | Entity | denotes | nuclear | ||
T13219 | 41261-41267 | Localization | denotes | import | ||
T13220 | 41323-41330 | Binding | denotes | binding | ||
T13221 | 41323-41330 | Binding | denotes | binding | ||
T13222 | 41348-41357 | Positive_regulation | denotes | activated | ||
T13223 | 41358-41360 | Protein | denotes | GR | ||
T13224 | 41366-41373 | Phosphorylation | denotes | phospho | ||
T13225 | 41374-41380 | Protein | denotes | GATA-3 | ||
T13226 | 41427-41433 | Negative_regulation | denotes | reduce | true | |
T13227 | 41434-41440 | Protein | denotes | GATA-3 | ||
T13228 | 41441-41446 | Localization | denotes | entry | ||
T13229 | 41597-41603 | Protein | denotes | GATA-3 | ||
T13230 | 41608-41615 | Entity | denotes | nuclear | ||
T13231 | 41616-41629 | Localization | denotes | translocation | ||
T13232 | 41637-41640 | Protein | denotes | p65 | ||
T13233 | 41666-41674 | Regulation | denotes | affected | true | |
T13234 | 41747-41758 | Negative_regulation | denotes | this effect | ||
T13235 | 41768-41774 | Protein | denotes | GATA-3 | ||
T13236 | 41775-41782 | Entity | denotes | nuclear | ||
T13237 | 41783-41792 | Localization | denotes | exclusion | ||
T13238 | 41827-41835 | Positive_regulation | denotes | enhances | true | |
T13239 | 41836-41842 | Protein | denotes | GATA-3 | ||
T13240 | 41843-41850 | Entity | denotes | nuclear | ||
T13241 | 41851-41857 | Localization | denotes | export | ||
T13242 | 41870-41877 | Positive_regulation | denotes | induces | true | |
T13243 | 41878-41884 | Protein | denotes | GATA-3 | ||
T13244 | 41885-41896 | Protein_catabolism | denotes | degradation | ||
T13245 | 41985-41994 | Positive_regulation | denotes | activated | ||
T13246 | 41995-41997 | Protein | denotes | GR | ||
T13247 | 42010-42019 | Negative_regulation | denotes | attenuate | ||
T13248 | 42029-42036 | Phosphorylation | denotes | phospho | ||
T13249 | 42037-42043 | Protein | denotes | GATA-3 | ||
T13250 | 42055-42066 | Binding | denotes | association | ||
T13251 | 42142-42149 | Phosphorylation | denotes | phospho | ||
T13252 | 42150-42156 | Protein | denotes | GATA-3 | ||
T13253 | 42161-42170 | Binding | denotes | associate | ||
T13254 | 42368-42378 | Positive_regulation | denotes | contribute | true | |
T13255 | 42386-42395 | Negative_regulation | denotes | reduction | ||
T13256 | 42399-42405 | Protein | denotes | GATA-3 | ||
T13257 | 42406-42413 | Entity | denotes | nuclear | ||
T13258 | 42414-42420 | Localization | denotes | import | ||
T13259 | 42442-42446 | Regulation | denotes | role | true | |
T13260 | 42521-42526 | Protein | denotes | MKP-1 | ||
T13261 | 42527-42536 | Gene_expression | denotes | induction | ||
T13262 | 42597-42606 | Positive_regulation | denotes | induction | ||
T13263 | 42610-42615 | Protein | denotes | MKP-1 | ||
T13264 | 42698-42707 | Gene_expression | denotes | induction | ||
T13265 | 42711-42716 | Protein | denotes | MKP-1 | ||
T13266 | 42722-42731 | Positive_regulation | denotes | following | ||
T13267 | 42827-42836 | Gene_expression | denotes | induction | ||
T13268 | 42840-42845 | Protein | denotes | MKP-1 | ||
T13269 | 42850-42856 | Negative_regulation | denotes | reduce | ||
T13270 | 42857-42863 | Protein | denotes | GATA-3 | ||
T13271 | 42864-42871 | Entity | denotes | nuclear | ||
T13272 | 42872-42878 | Localization | denotes | import | ||
T13273 | 42882-42893 | Negative_regulation | denotes | attenuating | ||
T13274 | 42916-42926 | Regulation | denotes | subsequent | ||
T13275 | 42927-42933 | Protein | denotes | GATA-3 | ||
T13276 | 42934-42949 | Phosphorylation | denotes | phosphorylation | ||
T13277 | 42956-42966 | Negative_regulation | denotes | preventing | true | |
T13278 | 42967-42974 | Entity | denotes | nuclear | ||
T13279 | 42975-42988 | Localization | denotes | translocation | ||
T13280 | 43010-43024 | Entity | denotes | serine residue | ||
T13281 | 43031-43037 | Protein | denotes | GATA-3 | ||
T13282 | 43047-43061 | Phosphorylation | denotes | phosphorylated | ||
T13283 | 43296-43306 | Negative_regulation | denotes | impairment | ||
T13284 | 43310-43316 | Protein | denotes | GATA-3 | ||
T13285 | 43317-43324 | Entity | denotes | nuclear | ||
T13286 | 43325-43331 | Localization | denotes | import | ||
T13287 | 43477-43494 | Negative_regulation | denotes | inhibitory effect | true | true |
T13288 | 43508-43518 | Transcription | denotes | expression | ||
T13289 | 43522-43526 | Protein | denotes | IL-4 | ||
T13290 | 43684-43692 | Negative_regulation | denotes | suppress | ||
T13291 | 43693-43697 | Protein | denotes | IL-4 | ||
T13292 | 43698-43711 | Transcription | denotes | transcription | ||
T13293 | 43854-43860 | Protein | denotes | GATA-3 | ||
T13294 | 43861-43871 | Negative_regulation | denotes | inhibition | ||
T13295 | 43998-44008 | Negative_regulation | denotes | inhibiting | ||
T13296 | 44009-44015 | Protein | denotes | GATA-3 | ||
T13297 | 44343-44351 | Negative_regulation | denotes | suppress | ||
T13298 | 44343-44351 | Negative_regulation | denotes | suppress | ||
T13299 | 44352-44356 | Protein | denotes | IL-4 | ||
T13300 | 44361-44365 | Protein | denotes | IL-5 | ||
T13301 | 44366-44373 | Localization | denotes | release | ||
T13302 | 44366-44373 | Localization | denotes | release | ||
T13303 | 44583-44600 | Negative_regulation | denotes | inhibitory effect | ||
T13304 | 44583-44600 | Negative_regulation | denotes | inhibitory effect | ||
T13305 | 44604-44610 | Protein | denotes | GATA-3 | ||
T13306 | 44611-44618 | Entity | denotes | nuclear | ||
T13307 | 44619-44632 | Localization | denotes | translocation | ||
T13308 | 44649-44656 | Binding | denotes | binding | ||
T13309 | 44741-44750 | Positive_regulation | denotes | increased | ||
T13310 | 44751-44760 | Gene_expression | denotes | synthesis | ||
T13311 | 44764-44769 | Protein | denotes | MKP-1 | ||
T13312 | 44801-44811 | Negative_regulation | denotes | preventing | ||
T13313 | 44816-44831 | Phosphorylation | denotes | phosphorylation | ||
T13314 | 44835-44841 | Protein | denotes | GATA-3 | ||
T13315 | 44850-44859 | Positive_regulation | denotes | necessary | ||
T13316 | 44864-44871 | Entity | denotes | nuclear | ||
T13317 | 44872-44885 | Localization | denotes | translocation | ||
T13318 | 44889-44895 | Protein | denotes | GATA-3 | ||
T13319 | 45236-45246 | Negative_regulation | denotes | Prevention | ||
T13320 | 45250-45257 | Phosphorylation | denotes | phospho | ||
T13321 | 45258-45264 | Protein | denotes | GATA-3 | ||
T16000 | 24390-24398 | Negative_regulation | denotes | inhibits | ||
T16001 | 24399-24405 | Protein | denotes | GATA-3 | ||
T16002 | 24406-24413 | Entity | denotes | nuclear | ||
T16003 | 24414-24420 | Localization | denotes | import | ||
T16004 | 24477-24490 | Localization | denotes | translocation | ||
T16005 | 24494-24500 | Protein | denotes | GATA-3 | ||
T16006 | 24527-24534 | Entity | denotes | nucleus | ||
T16007 | 24569-24574 | Protein | denotes | MEK-1 | ||
T16008 | 24758-24765 | Entity | denotes | nuclear | ||
T16009 | 24766-24778 | Localization | denotes | localization | ||
T16010 | 24782-24788 | Protein | denotes | GATA-3 | ||
T16011 | 24789-24796 | Positive_regulation | denotes | induced | ||
T16012 | 24985-24989 | Protein | denotes | MEK1 | ||
T16013 | 25235-25243 | Negative_regulation | denotes | inhibits | ||
T16014 | 25235-25243 | Negative_regulation | denotes | inhibits | ||
T16015 | 25244-25248 | Protein | denotes | IL-4 | ||
T16016 | 25253-25257 | Protein | denotes | IL-5 | ||
T16017 | 25258-25273 | Transcription | denotes | mRNA expression | ||
T16018 | 25258-25273 | Transcription | denotes | mRNA expression | ||
T16019 | 25277-25280 | Protein | denotes | CD3 | ||
T16020 | 25281-25285 | Protein | denotes | CD28 | ||
T16021 | 25286-25298 | Regulation | denotes | costimulated | ||
T16022 | 25286-25298 | Regulation | denotes | costimulated | ||
T16023 | 25553-25560 | Negative_regulation | denotes | reduces | ||
T16024 | 25590-25600 | Positive_regulation | denotes | stimulated | ||
T16025 | 25601-25607 | Protein | denotes | GATA-3 | ||
T16026 | 25611-25620 | Binding | denotes | associate | ||
T16027 | 25637-25641 | Protein | denotes | IL-5 | ||
T16028 | 25642-25650 | Entity | denotes | promoter | ||
T17583 | 29498-29508 | Regulation | denotes | associated | ||
T17584 | 29523-29538 | Negative_regulation | denotes | down-regulation | ||
T17585 | 29542-29548 | Protein | denotes | GATA-3 | ||
T17586 | 29549-29555 | Entity | denotes | serine | ||
T17587 | 29556-29571 | Phosphorylation | denotes | phosphorylation | ||
T17588 | 29782-29788 | Regulation | denotes | effect | ||
T17589 | 29807-29822 | Phosphorylation | denotes | phosphorylation | ||
T17590 | 29826-29858 | Protein | denotes | activated transcription factor 2 | ||
T17591 | 29860-29865 | Protein | denotes | ATF-2 | ||
T17592 | 29970-29978 | Negative_regulation | denotes | decrease | ||
T17593 | 30011-30018 | Positive_regulation | denotes | induced | ||
T17594 | 30019-30025 | Entity | denotes | serine | ||
T17595 | 30026-30041 | Phosphorylation | denotes | phosphorylation | ||
T17596 | 30053-30059 | Protein | denotes | GATA-3 | ||
T17597 | 30290-30297 | Positive_regulation | denotes | induced | ||
T17598 | 30298-30303 | Protein | denotes | MKP-1 | ||
T17599 | 30328-30337 | Regulation | denotes | dependent | ||
T17600 | 30481-30488 | Positive_regulation | denotes | induces | ||
T17601 | 30489-30494 | Protein | denotes | MKP-1 | ||
T17602 | 30510-30519 | Regulation | denotes | dependent | ||
T18278 | 31490-31497 | Phosphorylation | denotes | phospho | ||
T18279 | 31498-31504 | Protein | denotes | GATA-3 | ||
T18280 | 31597-31599 | Protein | denotes | GR | ||
T18281 | 31643-31651 | Positive_regulation | denotes | enhances | ||
T18282 | 31652-31654 | Protein | denotes | GR | ||
T18283 | 31666-31673 | Binding | denotes | binding | ||
T18284 | 31723-31729 | Protein | denotes | GATA-3 | ||
T18285 | 31755-31764 | Positive_regulation | denotes | activated | ||
T18286 | 31765-31767 | Protein | denotes | GR | ||
T18287 | 31773-31779 | Protein | denotes | GATA-3 | ||
T18288 | 31834-31843 | Negative_regulation | denotes | attenuate | true | |
T18289 | 31844-31846 | Protein | denotes | GR | ||
T18290 | 31858-31869 | Binding | denotes | association | ||
T18291 | 31904-31913 | Positive_regulation | denotes | Activated | ||
T18292 | 31914-31916 | Protein | denotes | GR | ||
T18293 | 31917-31923 | Negative_regulation | denotes | blocks | ||
T18294 | 31948-31955 | Phosphorylation | denotes | phospho | ||
T18295 | 31956-31962 | Protein | denotes | GATA-3 | ||
T18296 | 32008-32019 | Binding | denotes | interacting | ||
T18297 | 32098-32104 | Protein | denotes | GATA-3 | ||
T18298 | 32160-32170 | Positive_regulation | denotes | stimulated | ||
T18299 | 32171-32177 | Protein | denotes | GATA-3 | ||
T18300 | 32187-32194 | Binding | denotes | binding | ||
T18301 | 32214-32223 | Positive_regulation | denotes | activated | ||
T18302 | 32235-32247 | Positive_regulation | denotes | unstimulated | true | |
T18303 | 32252-32254 | Protein | denotes | GR | ||
T18304 | 32258-32269 | Negative_regulation | denotes | attenuation | ||
T18305 | 32273-32279 | Protein | denotes | GATA-3 | ||
T18306 | 32291-32302 | Binding | denotes | association | ||
T18307 | 32321-32330 | Regulation | denotes | dependent | ||
T18706 | 33723-33734 | Protein_catabolism | denotes | degradation | ||
T18707 | 33761-33767 | Protein | denotes | GATA-3 | ||
T18708 | 33978-33985 | Negative_regulation | denotes | prevent | true | |
T18709 | 34000-34010 | Positive_regulation | denotes | stimulated | ||
T18710 | 34011-34014 | Protein | denotes | p65 | ||
T18711 | 34015-34022 | Entity | denotes | nuclear | ||
T18712 | 34023-34036 | Localization | denotes | translocation | ||
T19698 | 38007-38014 | Negative_regulation | denotes | impairs | ||
T19699 | 38015-38021 | Protein | denotes | GATA-3 | ||
T19700 | 38022-38029 | Entity | denotes | nuclear | ||
T19701 | 38030-38042 | Localization | denotes | localization | ||
T19702 | 38140-38142 | Protein | denotes | GR | ||
T19703 | 38147-38153 | Protein | denotes | GATA-3 | ||
T19704 | 38154-38161 | Entity | denotes | nuclear | ||
T19705 | 38162-38174 | Localization | denotes | localisation | ||
T19706 | 38162-38174 | Localization | denotes | localisation | ||
T19707 | 38188-38194 | Protein | denotes | GATA-3 | ||
T19708 | 38540-38549 | Regulation | denotes | dependent | ||
T19709 | 38540-38549 | Regulation | denotes | dependent | ||
T19710 | 38550-38558 | Negative_regulation | denotes | decrease | ||
T19711 | 38562-38569 | Entity | denotes | nuclear | ||
T19712 | 38570-38580 | Localization | denotes | expression | ||
T19713 | 38584-38590 | Protein | denotes | GATA-3 | ||
T19714 | 38596-38605 | Positive_regulation | denotes | increased | ||
T19715 | 38606-38617 | Entity | denotes | cytoplasmic | ||
T19716 | 38618-38624 | Protein | denotes | GATA-3 | ||
T19717 | 38625-38635 | Localization | denotes | expression | ||
T19718 | 38727-38735 | Negative_regulation | denotes | decrease | ||
T19719 | 38739-38746 | Entity | denotes | nuclear | ||
T19720 | 38747-38757 | Localization | denotes | expression | ||
T19721 | 38761-38767 | Protein | denotes | GATA-3 | ||
T19722 | 38783-38794 | Entity | denotes | cytoplasmic | ||
T19723 | 38795-38801 | Protein | denotes | GATA-3 | ||
T19724 | 38802-38812 | Localization | denotes | expression | ||
T19725 | 38856-38861 | Protein | denotes | MEK-1 | ||
T13160 | 40017-40023 | Protein | denotes | GATA-3 | ||
T13161 | 40157-40166 | Positive_regulation | denotes | activated | ||
T13162 | 40167-40169 | Protein | denotes | GR | ||
T13163 | 40181-40188 | Negative_regulation | denotes | compete | ||
T13164 | 40194-40203 | Positive_regulation | denotes | activated | ||
T13165 | 40204-40210 | Protein | denotes | GATA-3 | ||
T13166 | 40215-40222 | Entity | denotes | nuclear | ||
T13167 | 40223-40229 | Localization | denotes | import | ||
T13168 | 40230-40233 | Regulation | denotes | via | ||
T13169 | 40255-40263 | Regulation | denotes | required | ||
T13170 | 40255-40263 | Regulation | denotes | required | ||
T13171 | 40272-40279 | Entity | denotes | nuclear | ||
T13172 | 40280-40289 | Localization | denotes | transport | ||
T13322 | 45265-45276 | Binding | denotes | interaction | ||
T5481 | 16679-16681 | Protein | denotes | GR | ||
T5482 | 16682-16688 | Protein | denotes | GATA-3 | ||
T5483 | 16938-16944 | Protein | denotes | GATA-3 | ||
T5484 | 17044-17046 | Protein | denotes | GR | ||
T5485 | 17315-17321 | Protein | denotes | GATA-3 | ||
T5486 | 17422-17424 | Protein | denotes | GR | ||
T5487 | 17819-17825 | Protein | denotes | GATA-3 | ||
T5488 | 17927-17929 | Protein | denotes | GR | ||
T7351 | 21208-21218 | Gene_expression | denotes | expressing | ||
T7352 | 21219-21229 | Protein | denotes | GATA-3-GFP | ||
T4614 | 14968-14972 | Protein | denotes | IL-4 | ||
T8185 | 23176-23182 | Regulation | denotes | Effect | ||
T6272 | 18846-18848 | Protein | denotes | GR | ||
T18695 | 33294-33300 | Regulation | denotes | affect | true | |
T18696 | 33301-33307 | Protein | denotes | GATA-3 | ||
T18697 | 33316-33322 | Localization | denotes | export | ||
T18698 | 33421-33427 | Regulation | denotes | affect | true | |
T18699 | 33458-33465 | Negative_regulation | denotes | prevent | ||
T18700 | 33480-33490 | Positive_regulation | denotes | stimulated | ||
T18701 | 33491-33497 | Protein | denotes | GATA-3 | ||
T18702 | 33498-33505 | Entity | denotes | nuclear | ||
T18703 | 33506-33518 | Localization | denotes | localization | ||
T18704 | 33698-33704 | Regulation | denotes | affect | true | |
T18705 | 33716-33722 | Protein | denotes | GATA-3 | ||
T11224 | 34273-34283 | Negative_regulation | denotes | Inhibitory | ||
T11225 | 34313-34319 | Protein | denotes | GATA-3 | ||
T11226 | 34320-34327 | Entity | denotes | Nuclear | ||
T11227 | 34328-34340 | Localization | denotes | Localization | ||
T11228 | 34441-34450 | Regulation | denotes | dependent | ||
T11229 | 34451-34459 | Negative_regulation | denotes | decrease | ||
T11230 | 34474-34485 | Binding | denotes | interaction | ||
T11231 | 34494-34501 | Phosphorylation | denotes | phospho | ||
T11232 | 34502-34508 | Protein | denotes | GATA-3 | ||
T11233 | 34603-34612 | Negative_regulation | denotes | inhibited | ||
T11234 | 34681-34691 | Negative_regulation | denotes | attenuated | ||
T11273 | 37655-37664 | Regulation | denotes | dependent | ||
T11274 | 39467-39474 | Negative_regulation | denotes | reduces | ||
T11275 | 39475-39482 | Entity | denotes | nuclear | ||
T11276 | 39483-39495 | Localization | denotes | localization | ||
T11277 | 39499-39505 | Protein | denotes | GATA-3 | ||
T11278 | 39525-39535 | Negative_regulation | denotes | inhibiting | ||
T11279 | 39544-39550 | Protein | denotes | GATA-3 | ||
T11280 | 39560-39571 | Binding | denotes | association | ||
T11281 | 39698-39706 | Positive_regulation | denotes | mediated | ||
T11282 | 39707-39713 | Protein | denotes | GATA-3 | ||
T11283 | 39714-39729 | Phosphorylation | denotes | phosphorylation | ||
T11284 | 39740-39749 | Gene_expression | denotes | induction | ||
T11285 | 39753-39758 | Protein | denotes | MKP-1 | ||
T11286 | 39801-39808 | Regulation | denotes | effects | ||
T11287 | 39832-39843 | Negative_regulation | denotes | suppression | ||
T11288 | 39847-39853 | Protein | denotes | GATA-3 | ||
T11289 | 39854-39861 | Entity | denotes | nuclear | ||
T11290 | 39862-39868 | Localization | denotes | import | ||
T6761 | 19780-19786 | Protein | denotes | GATA-3 | ||
T6762 | 19787-19790 | Protein | denotes | GFP | ||
T6763 | 19805-19811 | Protein | denotes | GATA-3 | ||
T6764 | 19923-19929 | Protein | denotes | GATA-3 | ||
T6765 | 19951-19957 | Protein | denotes | GATA-3 | ||
T6766 | 19987-19991 | Protein | denotes | XhoI | ||
T6767 | 20075-20080 | Protein | denotes | BamHI | ||
T6768 | 20161-20167 | Protein | denotes | GATA-3 | ||
T6769 | 20427-20433 | Protein | denotes | GATA-3 | ||
T6770 | 20451-20454 | Protein | denotes | GFP | ||
T6771 | 20494-20499 | Protein | denotes | EcoRI | ||
T6772 | 20533-20539 | Protein | denotes | GATA-3 | ||
T6773 | 20595-20598 | Protein | denotes | GFP | ||
T89 | 0-11 | Negative_regulation | denotes | Suppression | ||
T90 | 0-11 | Negative_regulation | denotes | Suppression | ||
T91 | 15-21 | Protein | denotes | GATA-3 | ||
T92 | 22-29 | Entity | denotes | Nuclear | ||
T93 | 30-36 | Localization | denotes | Import | ||
T94 | 41-56 | Phosphorylation | denotes | Phosphorylation | ||
T95 | 466-472 | Protein | denotes | GATA-3 | ||
T6073 | 18143-18146 | Protein | denotes | p65 | ||
T4347 | 14481-14487 | Protein | denotes | GATA-3 | ||
T4348 | 14488-14500 | Localization | denotes | localization | ||
T5201 | 16391-16395 | Protein | denotes | IL-5 | ||
T8914 | 25841-25843 | Protein | denotes | GR | ||
T8915 | 25858-25864 | Protein | denotes | GATA-3 | ||
T8916 | 25865-25868 | Binding | denotes | for | ||
T8917 | 25945-25954 | Positive_regulation | denotes | activated | ||
T8918 | 25955-25957 | Protein | denotes | GR | ||
T8919 | 25969-25975 | Protein | denotes | GATA-3 | ||
T8920 | 25976-25980 | Positive_regulation | denotes | uses | ||
T8921 | 25976-25980 | Positive_regulation | denotes | uses | ||
T8922 | 26000-26007 | Entity | denotes | nuclear | ||
T8923 | 26008-26014 | Localization | denotes | import | ||
T8924 | 26008-26014 | Localization | denotes | import | ||
T8925 | 26060-26062 | Protein | denotes | GR | ||
T8926 | 26173-26175 | Protein | denotes | GR | ||
T8927 | 26176-26183 | Entity | denotes | nuclear | ||
T8928 | 26184-26197 | Localization | denotes | translocation | ||
T1181 | 7372-7390 | Protein | denotes | interleukin (IL)-4 | ||
T1182 | 7392-7396 | Protein | denotes | IL-5 | ||
T1183 | 7402-7407 | Protein | denotes | IL-13 | ||
T1184 | 7437-7441 | Protein | denotes | IL-4 | ||
T1185 | 7446-7451 | Protein | denotes | IL-13 | ||
T1186 | 7511-7515 | Protein | denotes | IL-5 | ||
T1187 | 7635-7641 | Protein | denotes | GATA-3 | ||
T1188 | 7666-7675 | Gene_expression | denotes | expressed | ||
T1189 | 7698-7704 | Protein | denotes | GATA-3 | ||
T1190 | 7757-7766 | Positive_regulation | denotes | activates | ||
T1191 | 7757-7766 | Positive_regulation | denotes | activates | ||
T1192 | 7757-7766 | Positive_regulation | denotes | activates | ||
T1193 | 7771-7780 | Entity | denotes | promoters | ||
T1194 | 7784-7788 | Protein | denotes | IL-4 | ||
T1195 | 7790-7794 | Protein | denotes | IL-5 | ||
T1196 | 7800-7805 | Protein | denotes | IL-13 | ||
T1197 | 7861-7867 | Protein | denotes | GATA-3 | ||
T1198 | 8023-8029 | Protein | denotes | GATA-3 | ||
T1199 | 8088-8094 | Protein | denotes | GATA-3 | ||
T1200 | 8146-8151 | Protein | denotes | Gata3 | ||
T1230 | 9865-9874 | Positive_regulation | denotes | activated | ||
T1231 | 9875-9877 | Protein | denotes | GR | ||
T1232 | 9878-9887 | Binding | denotes | interacts | ||
T1233 | 10076-10087 | Binding | denotes | recruitment | ||
T1234 | 10122-10143 | Protein | denotes | histone deacetylase-2 | ||
T1235 | 10155-10162 | Entity | denotes | Nuclear | ||
T1236 | 10163-10175 | Localization | denotes | localisation | ||
T1237 | 10180-10189 | Localization | denotes | retention | ||
T1238 | 10193-10195 | Protein | denotes | GR | ||
T1239 | 10199-10207 | Positive_regulation | denotes | mediated | ||
T1240 | 10199-10207 | Positive_regulation | denotes | mediated | ||
T1241 | 10311-10318 | Regulation | denotes | control | ||
T1242 | 10322-10329 | Entity | denotes | nuclear | ||
T1243 | 10330-10336 | Localization | denotes | export | ||
T1244 | 10343-10375 | Protein | denotes | chromosomal region maintenance 1 | ||
T1245 | 10377-10382 | Protein | denotes | CRM-1 | ||
T1246 | 10384-10393 | Regulation | denotes | dependent | ||
T1247 | 10408-10411 | Entity | denotes | NL1 | ||
T1248 | 10447-10452 | Binding | denotes | binds | ||
T1249 | 10673-10682 | Regulation | denotes | resulting | ||
T1250 | 10683-10685 | Protein | denotes | GR | ||
T1251 | 10692-10704 | Localization | denotes | translocates | ||
T1252 | 10712-10719 | Entity | denotes | nucleus | ||
T1253 | 10720-10734 | Positive_regulation | denotes | in response to | ||
T1254 | 10752-10763 | Binding | denotes | interaction | ||
T1255 | 10769-10779 | Protein | denotes | importin 7 | ||
T9583 | 28261-28266 | Protein | denotes | MKP-1 | ||
T9584 | 28357-28366 | Gene_expression | denotes | induction | ||
T9585 | 28398-28403 | Protein | denotes | MKP-1 | ||
T9586 | 28405-28423 | Protein | denotes | MAPK phosphatase-1 | ||
T9587 | 28557-28566 | Negative_regulation | denotes | decreased | ||
T9588 | 28629-28644 | Phosphorylation | denotes | phosphorylation | ||
T9589 | 28663-28669 | Binding | denotes | target | ||
T9590 | 28670-28675 | Protein | denotes | ATF-2 | ||
T9591 | 28797-28804 | Negative_regulation | denotes | reduced | ||
T9592 | 28805-28811 | Protein | denotes | GATA-3 | ||
T9593 | 28812-28818 | Entity | denotes | serine | ||
T9594 | 28819-28834 | Phosphorylation | denotes | phosphorylation | ||
T9595 | 28835-28842 | Positive_regulation | denotes | induced | ||
T9596 | 28906-28915 | Regulation | denotes | dependent | ||
T9597 | 28936-28950 | Negative_regulation | denotes | This reduction | ||
T9598 | 28954-28960 | Protein | denotes | GATA-3 | ||
T9599 | 28961-28976 | Phosphorylation | denotes | phosphorylation | ||
T9600 | 29055-29062 | Positive_regulation | denotes | induced | ||
T9601 | 29063-29068 | Protein | denotes | MKP-1 | ||
T9620 | 30814-30816 | Protein | denotes | GR | ||
T9621 | 30831-30840 | Positive_regulation | denotes | increased | ||
T9622 | 30841-30843 | Protein | denotes | GR | ||
T9623 | 30855-30866 | Binding | denotes | association | ||
T9624 | 30867-30897 | Regulation | denotes | in the presence and absence of | true | |
T9625 | 30898-30907 | Positive_regulation | denotes | activated | ||
T9626 | 30908-30914 | Protein | denotes | GATA-3 | ||
T9627 | 30961-30970 | Positive_regulation | denotes | activated | ||
T9628 | 30971-30977 | Protein | denotes | GATA-3 | ||
T9629 | 30986-30991 | Negative_regulation | denotes | block | true | |
T9630 | 30992-30994 | Protein | denotes | GR | ||
T9631 | 31006-31017 | Binding | denotes | association | ||
T9632 | 31065-31074 | Positive_regulation | denotes | activated | ||
T4845 | 15633-15639 | Protein | denotes | GATA-3 | ||
T16789 | 26758-26765 | Negative_regulation | denotes | reduces | ||
T16790 | 26758-26765 | Negative_regulation | denotes | reduces | ||
T16791 | 26766-26772 | Protein | denotes | GATA-3 | ||
T16792 | 26773-26784 | Binding | denotes | association | ||
T16793 | 26805-26811 | Protein | denotes | GATA-3 | ||
T16794 | 26812-26819 | Entity | denotes | nuclear | ||
T16795 | 26820-26826 | Localization | denotes | import | ||
T16796 | 26939-26948 | Regulation | denotes | dependent | ||
T16797 | 26949-26958 | Positive_regulation | denotes | induction | ||
T16798 | 26965-26974 | Positive_regulation | denotes | activated | ||
T16799 | 26975-26977 | Protein | denotes | GR | ||
T16800 | 26978-26989 | Binding | denotes | interaction | ||
T16801 | 27038-27040 | Protein | denotes | GR | ||
T16802 | 27041-27052 | Binding | denotes | association | ||
T16803 | 27362-27371 | Regulation | denotes | dependent | ||
T16804 | 27372-27381 | Positive_regulation | denotes | induction | ||
T16805 | 27388-27397 | Positive_regulation | denotes | activated | ||
T16806 | 27398-27400 | Protein | denotes | GR | ||
T16807 | 27401-27408 | Entity | denotes | nuclear | ||
T16808 | 27409-27422 | Localization | denotes | translocation | ||
T16809 | 27719-27728 | Regulation | denotes | dependent | ||
T16810 | 27729-27737 | Negative_regulation | denotes | decrease | ||
T16811 | 27741-27747 | Protein | denotes | GATA-3 | ||
T16812 | 27759-27770 | Binding | denotes | association | ||
T16813 | 28009-28015 | Protein | denotes | GATA-3 | ||
T16814 | 28020-28033 | Gene_expression | denotes | overexpressed | ||
T19273 | 34812-34819 | Negative_regulation | denotes | impairs | ||
T19274 | 34812-34819 | Negative_regulation | denotes | impairs | ||
T19275 | 34820-34826 | Protein | denotes | GATA-3 | ||
T19276 | 34827-34838 | Binding | denotes | interaction | ||
T19277 | 34859-34865 | Protein | denotes | GATA-3 | ||
T19278 | 34866-34873 | Entity | denotes | nuclear | ||
T19279 | 34874-34886 | Localization | denotes | localization | ||
T19280 | 35032-35040 | Negative_regulation | denotes | impaired | ||
T19281 | 35041-35052 | Binding | denotes | interaction | ||
T19282 | 35061-35067 | Protein | denotes | GATA-3 | ||
T19283 | 35412-35421 | Negative_regulation | denotes | decreased | ||
T19284 | 35422-35433 | Binding | denotes | association | ||
T19285 | 35442-35448 | Protein | denotes | GATA-3 | ||
R970 | T1204 | T1202 | themeOf | expression,knockdown | ||
R971 | T1205 | T1206 | themeOf | GATA-3,translocate | ||
R972 | T1205 | T1208 | themeOf | GATA-3,access | ||
R973 | T1205 | T1209 | themeOf | GATA-3,target | ||
R974 | T1207 | T1206 | locationOf | nucleus,translocate | ||
R975 | T1210 | T1211 | locationOf | nuclear,expression | ||
R976 | T1211 | T1213 | themeOf | expression,following | ||
R977 | T1211 | T1214 | themeOf | expression,following | ||
R978 | T1212 | T1211 | themeOf | GATA-3,expression | ||
R979 | T1215 | T1216 | themeOf | GATA-3,transported | ||
R980 | T1217 | T1216 | locationOf | nucleus,transported | ||
R981 | T1220 | T1219 | themeOf | phosphorylating,role | ||
R982 | T1220 | T1222 | causeOf | phosphorylating,enhance | ||
R983 | T1221 | T1220 | themeOf | GATA-3,phosphorylating | ||
R984 | T1221 | T1223 | themeOf | GATA-3,interaction | ||
R985 | T1223 | T1222 | themeOf | interaction,enhance | ||
R986 | T1225 | T1224 | themeOf | glucocorticoid receptors,binding | ||
R987 | T1225 | T1227 | themeOf | glucocorticoid receptors,translocate | ||
R988 | T1225 | T1229 | themeOf | glucocorticoid receptors,interact | ||
R989 | T1226 | T1225 | equivalentTo | GRs,glucocorticoid receptors | ||
R990 | T1228 | T1227 | locationOf | nucleus,translocate | ||
R991 | T1231 | T1230 | themeOf | GR,activated | ||
R992 | T1231 | T1232 | themeOf | GR,interacts | ||
R993 | T1231 | T1233 | themeOf | GR,recruitment | ||
R994 | T1234 | T1233 | themeOf | histone deacetylase-2,recruitment | ||
R995 | T1235 | T1236 | locationOf | Nuclear,localisation | ||
R996 | T1236 | T1240 | themeOf | localisation,mediated | ||
R997 | T1237 | T1239 | themeOf | retention,mediated | ||
R998 | T1238 | T1236 | themeOf | GR,localisation | ||
R999 | T1238 | T1237 | themeOf | GR,retention | ||
R1000 | T1238 | T1243 | themeOf | GR,export | ||
R1001 | T1241 | T1240 | causeOf | control,mediated | ||
R1002 | T1241 | T1239 | causeOf | control,mediated | ||
R1003 | T1241 | T1246 | themeOf | control,dependent | ||
R1004 | T1242 | T1243 | locationOf | nuclear,export | ||
R1005 | T1243 | T1241 | themeOf | export,control | ||
R1006 | T1244 | T1246 | causeOf | chromosomal region maintenance 1,dependent | ||
R1007 | T1245 | T1244 | equivalentTo | CRM-1,chromosomal region maintenance 1 | ||
R1008 | T1247 | T1248 | themeOf | NL1,binds | ||
R1009 | T1247 | T1238 | partOf | NL1,GR | ||
R1010 | T1250 | T1251 | themeOf | GR,translocates | ||
R1011 | T1250 | T1254 | themeOf | GR,interaction | ||
R1012 | T1251 | T1249 | themeOf | translocates,resulting | ||
R1013 | T1251 | T1253 | themeOf | translocates,in response to | ||
R1014 | T1252 | T1251 | locationOf | nucleus,translocates | ||
R1015 | T1254 | T1253 | causeOf | interaction,in response to | ||
R1016 | T1254 | T1256 | themeOf | interaction,requires | ||
R1017 | T1255 | T1254 | themeOf | importin 7,interaction | ||
R1018 | T1257 | T1258 | themeOf | GR,import | ||
R1019 | T1260 | T1259 | themeOf | regulation,important | ||
R1020 | T1261 | T1262 | themeOf | GR,activation | ||
R1021 | T1262 | T1260 | themeOf | activation,regulation | ||
R1022 | T1263 | T1266 | themeOf | IL-4,regulated | ||
R1023 | T1264 | T1268 | themeOf | IL-5,regulated | ||
R1024 | T1265 | T1267 | themeOf | IL-13,regulated | ||
R1025 | T1270 | T1271 | causeOf | GR,reduced | ||
R1026 | T1270 | T1272 | causeOf | GR,reduced | ||
R1027 | T1273 | T1274 | causeOf | GATA-3,mediated | ||
R1028 | T1273 | T1275 | causeOf | GATA-3,mediated | ||
R1029 | T1274 | T1271 | themeOf | mediated,reduced | ||
R1030 | T1275 | T1272 | themeOf | mediated,reduced | ||
R1031 | T1276 | T1278 | themeOf | IL-5,activity | ||
R1032 | T1277 | T1279 | themeOf | -13,activity | ||
R1033 | T1278 | T1274 | themeOf | activity,mediated | ||
R1034 | T1279 | T1275 | themeOf | activity,mediated | ||
R1035 | T1281 | T1283 | causeOf | recruitment,alter | ||
R1036 | T1282 | T1281 | themeOf | GR,recruitment | ||
R1037 | T1284 | T1285 | themeOf | GATA-3,bind | ||
R1038 | T1285 | T1283 | themeOf | bind,alter | ||
R1039 | T1288 | T1289 | themeOf | GATA-3,phosphorylation | ||
R1040 | T1288 | T1291 | themeOf | GATA-3,translocation | ||
R1041 | T1289 | T1287 | themeOf | phosphorylation,effects | ||
R1042 | T1290 | T1291 | locationOf | nuclear,translocation | ||
R1043 | T1291 | T1286 | themeOf | translocation,effects | ||
R1044 | T1293 | T1294 | themeOf | GATA-3,localization | ||
R1045 | T1294 | T1292 | themeOf | localization,effects | ||
R7090 | T8205 | T8202 | themeOf | translocation,resulted | ||
R7091 | T8209 | T8208 | themeOf | loss,caused | ||
R7092 | T8210 | T8212 | locationOf | nuclear,expression | ||
R7093 | T8211 | T8212 | themeOf | GATA-3,expression | ||
R7094 | T8212 | T8209 | themeOf | expression,loss | ||
R7095 | T8213 | T8214 | locationOf | cytoplasmic,retention | ||
R7096 | T8214 | T8207 | themeOf | retention,caused | ||
R7097 | T8215 | T8214 | themeOf | GATA-3,retention | ||
R7098 | T8216 | T8221 | themeOf | This effect,dependent | ||
R7099 | T8217 | T8220 | themeOf | This effect,dependent | ||
R7100 | T8218 | T8219 | themeOf | This effect,dependent | ||
R7101 | T8222 | T8217 | themeOf | associated,This effect | ||
R7102 | T8223 | T8218 | themeOf | associated,This effect | ||
R7103 | T8224 | T8216 | themeOf | associated,This effect | ||
R7104 | T8225 | T8224 | themeOf | reductions,associated | ||
R7105 | T8226 | T8222 | themeOf | reductions,associated | ||
R7106 | T8227 | T8225 | themeOf | stimulated,reductions | ||
R7107 | T8228 | T8226 | themeOf | stimulated,reductions | ||
R7108 | T8229 | T8232 | themeOf | IL-4,mRNA expression | ||
R7109 | T8230 | T8231 | themeOf | IL-5,mRNA expression | ||
R7110 | T8231 | T8228 | themeOf | mRNA expression,stimulated | ||
R7111 | T8232 | T8227 | themeOf | mRNA expression,stimulated | ||
R7112 | T8233 | T8223 | themeOf | loss,associated | ||
R7113 | T8234 | T8235 | themeOf | GATA-3,binding | ||
R7114 | T8235 | T8233 | themeOf | binding,loss | ||
R7115 | T8237 | T8235 | themeOf | promoter,binding | ||
R7116 | T8237 | T8236 | partOf | promoter,IL-5 | ||
R7695 | T8930 | T8932 | themeOf | association,induced | ||
R7696 | T8931 | T8930 | themeOf | GATA-3,association | ||
R7697 | T8935 | T8937 | themeOf | GATA-3,import | ||
R7698 | T8936 | T8937 | locationOf | nuclear,import | ||
R7699 | T8937 | T8938 | themeOf | import,following | ||
R7700 | T8937 | T8939 | themeOf | import,attenuated | ||
R8282 | T9651 | T9652 | locationOf | nuclear,import | ||
R8283 | T9652 | T9649 | themeOf | import,limit | ||
R8284 | T9655 | T9657 | themeOf | GATA-3,export | ||
R8285 | T9655 | T9658 | themeOf | GATA-3,degradation | ||
R8286 | T9656 | T9657 | locationOf | nuclear,export | ||
R8287 | T9657 | T9653 | themeOf | export,effect | ||
R8288 | T9658 | T9654 | themeOf | degradation,effect | ||
R8289 | T9660 | T9659 | themeOf | block,affect | ||
R8290 | T9661 | T9663 | themeOf | GATA-3,localization | ||
R8291 | T9662 | T9663 | locationOf | nuclear,localization | ||
R8292 | T9663 | T9660 | themeOf | localization,block | ||
R8293 | T9665 | T9666 | themeOf | GATA-3,expression | ||
R8294 | T9666 | T9664 | themeOf | expression,effect | ||
R8295 | T9668 | T9670 | themeOf | GATA-3,residency | ||
R8296 | T9669 | T9670 | locationOf | nuclear,residency | ||
R8297 | T9670 | T9667 | themeOf | residency,affect | ||
R8298 | T9672 | T9671 | themeOf | GR,activated | ||
R8299 | T9672 | T9673 | causeOf | GR,enhance | ||
R8300 | T9674 | T9676 | themeOf | GATA-3,export | ||
R8301 | T9675 | T9676 | locationOf | nuclear,export | ||
R8302 | T9676 | T9673 | themeOf | export,enhance | ||
R8303 | T9678 | T9680 | themeOf | GATA-3,import | ||
R8304 | T9679 | T9680 | locationOf | nuclear,import | ||
R8305 | T9680 | T9677 | themeOf | import,effect | ||
R8306 | T9682 | T9684 | themeOf | p65,translocation | ||
R8307 | T9683 | T9684 | locationOf | nuclear,translocation | ||
R8308 | T9684 | T9681 | themeOf | translocation,effect | ||
R9623 | T11262 | T11263 | locationOf | nuclear,translocation | ||
R9624 | T11263 | T11260 | themeOf | translocation,increased | ||
R9625 | T11266 | T11265 | themeOf | loss,induced | ||
R9626 | T11267 | T11266 | locationOf | nuclear,loss | ||
R9627 | T11268 | T11266 | themeOf | GATA-3,loss | ||
R9628 | T11269 | T11271 | locationOf | cytoplasmic,levels | ||
R9629 | T11270 | T11271 | themeOf | GATA-3,levels | ||
R9630 | T11271 | T11272 | themeOf | levels,enhanced | ||
R9631 | T11272 | T11273 | themeOf | enhanced,dependent | ||
R9632 | T11275 | T11276 | locationOf | nuclear,localization | ||
R9633 | T11276 | T11274 | themeOf | localization,reduces | ||
R9634 | T11277 | T11276 | themeOf | GATA-3,localization | ||
R9635 | T11278 | T11274 | causeOf | inhibiting,reduces | ||
R9636 | T11279 | T11280 | themeOf | GATA-3,association | ||
R9637 | T11280 | T11278 | themeOf | association,inhibiting | ||
R9638 | T11282 | T11283 | themeOf | GATA-3,phosphorylation | ||
R9639 | T11283 | T11281 | themeOf | phosphorylation,mediated | ||
R9640 | T11285 | T11284 | themeOf | MKP-1,induction | ||
R9641 | T11287 | T11286 | themeOf | suppression,effects | ||
R9642 | T11288 | T11290 | themeOf | GATA-3,import | ||
R9643 | T11289 | T11290 | locationOf | nuclear,import | ||
R9644 | T11290 | T11287 | themeOf | import,suppression | ||
R11287 | T13162 | T13161 | themeOf | GR,activated | ||
R11288 | T13162 | T13163 | causeOf | GR,compete | ||
R11289 | T13165 | T13163 | themeOf | GATA-3,compete | ||
R11294 | T13171 | T13173 | locationOf | nuclear,transport | ||
R11295 | T13171 | T13172 | locationOf | nuclear,transport | ||
R11296 | T13172 | T13169 | themeOf | transport,required | ||
R11297 | T13173 | T13170 | themeOf | transport,required | ||
R11298 | T13174 | T13173 | themeOf | GATA-3,transport | ||
R11299 | T13175 | T13172 | themeOf | GR,transport | ||
R11300 | T13177 | T13176 | themeOf | expression,increase | ||
R11301 | T13178 | T13177 | themeOf | MKP-1,expression | ||
R11302 | T13180 | T13179 | themeOf | phosphorylation,prevent | ||
R11303 | T13180 | T13182 | causeOf | phosphorylation,necessary | ||
R11304 | T13180 | T13183 | causeOf | phosphorylation,necessary | ||
R11305 | T13181 | T13180 | themeOf | GATA-3,phosphorylation | ||
R11306 | T13181 | T13184 | themeOf | GATA-3,interaction | ||
R11307 | T13181 | T13187 | themeOf | GATA-3,import | ||
R11308 | T13184 | T13182 | themeOf | interaction,necessary | ||
R11309 | T13184 | T13185 | causeOf | interaction,subsequent | ||
R11310 | T13186 | T13187 | locationOf | nuclear,import | ||
R11311 | T13187 | T13183 | themeOf | import,necessary | ||
R11312 | T13187 | T13185 | themeOf | import,subsequent | ||
R11313 | T13188 | T13191 | themeOf | translocation,involves | ||
R11314 | T13189 | T13188 | themeOf | GATA-3,translocation | ||
R11315 | T13190 | T13188 | locationOf | nucleus,translocation | ||
R11316 | T13194 | T13192 | themeOf | GATA-3,interacts | ||
R11317 | T13194 | T13193 | themeOf | GATA-3,phosphorylated | ||
R11318 | T13195 | T13196 | themeOf | GATA-3,knockdown | ||
R11319 | T13196 | T13197 | causeOf | knockdown,suppression | ||
R11320 | T13196 | T13198 | causeOf | knockdown,suppression | ||
R11321 | T13199 | T13198 | themeOf | stimulated,suppression | ||
R11322 | T13200 | T13197 | themeOf | stimulated,suppression | ||
R11323 | T13201 | T13203 | themeOf | IL-4,induction | ||
R11324 | T13201 | T13209 | themeOf | IL-4,transcription | ||
R11325 | T13202 | T13204 | themeOf | IL-5,induction | ||
R11326 | T13202 | T13208 | themeOf | IL-5,transcription | ||
R11327 | T13203 | T13200 | themeOf | induction,stimulated | ||
R11328 | T13204 | T13199 | themeOf | induction,stimulated | ||
R11329 | T13207 | T13206 | causeOf | GATA-3,role | ||
R11330 | T13207 | T13205 | causeOf | GATA-3,role | ||
R11331 | T13208 | T13205 | themeOf | transcription,role | ||
R11332 | T13209 | T13206 | themeOf | transcription,role | ||
R11333 | T13210 | T13212 | themeOf | GR,import | ||
R11334 | T13211 | T13212 | locationOf | nuclear,import | ||
R11335 | T13215 | T13214 | causeOf | GR,competition | ||
R11336 | T13217 | T13219 | themeOf | GATA-3,import | ||
R11337 | T13217 | T13216 | themeOf | GATA-3,phospho | ||
R11338 | T13218 | T13219 | locationOf | nuclear,import | ||
R11339 | T13219 | T13214 | themeOf | import,competition | ||
R11340 | T13223 | T13220 | themeOf | GR,binding | ||
R11341 | T13223 | T13222 | themeOf | GR,activated | ||
R11342 | T13225 | T13221 | themeOf | GATA-3,binding | ||
R11343 | T13225 | T13224 | themeOf | GATA-3,phospho | ||
R11344 | T13227 | T13228 | themeOf | GATA-3,entry | ||
R11345 | T13228 | T13226 | themeOf | entry,reduce | ||
R11346 | T13230 | T13231 | locationOf | nuclear,translocation | ||
R11347 | T13231 | T13233 | themeOf | translocation,affected | ||
R11348 | T13232 | T13231 | themeOf | p65,translocation | ||
R11349 | T13235 | T13237 | themeOf | GATA-3,exclusion | ||
R11350 | T13236 | T13237 | locationOf | nuclear,exclusion | ||
R11351 | T13237 | T13234 | themeOf | exclusion,this effect | ||
R11352 | T13239 | T13241 | themeOf | GATA-3,export | ||
R11354 | T13241 | T13238 | themeOf | export,enhances | ||
R11367 | T13258 | T13255 | themeOf | import,reduction | ||
R11368 | T13260 | T13261 | themeOf | MKP-1,induction | ||
R11369 | T13261 | T13259 | themeOf | induction,role | ||
R11370 | T13263 | T13262 | themeOf | MKP-1,induction | ||
R11371 | T13264 | T13266 | themeOf | induction,following | ||
R11372 | T13265 | T13264 | themeOf | MKP-1,induction | ||
R11373 | T13267 | T13273 | causeOf | induction,attenuating | ||
R11374 | T13268 | T13267 | themeOf | MKP-1,induction | ||
R11376 | T13270 | T13272 | themeOf | GATA-3,import | ||
R11377 | T13271 | T13272 | locationOf | nuclear,import | ||
R11378 | T13272 | T13269 | themeOf | import,reduce | ||
R11380 | T13273 | T13269 | causeOf | attenuating,reduce | ||
R11381 | T13274 | T13273 | themeOf | subsequent,attenuating | ||
R11382 | T13275 | T13276 | themeOf | GATA-3,phosphorylation | ||
R11383 | T13276 | T13274 | themeOf | phosphorylation,subsequent | ||
R11401 | T13305 | T13307 | themeOf | GATA-3,translocation | ||
R11402 | T13305 | T13308 | themeOf | GATA-3,binding | ||
R11403 | T13306 | T13307 | locationOf | nuclear,translocation | ||
R11404 | T13307 | T13304 | themeOf | translocation,inhibitory effect | ||
R11405 | T13307 | T13303 | themeOf | translocation,inhibitory effect | ||
R11406 | T13308 | T13304 | causeOf | binding,inhibitory effect | ||
R11407 | T13309 | T13303 | causeOf | increased,inhibitory effect | ||
R11408 | T13309 | T13312 | causeOf | increased,preventing | ||
R11409 | T13310 | T13309 | themeOf | synthesis,increased | ||
R11410 | T13311 | T13310 | themeOf | MKP-1,synthesis | ||
R11411 | T13313 | T13312 | themeOf | phosphorylation,preventing | ||
R11412 | T13314 | T13313 | themeOf | GATA-3,phosphorylation | ||
R11413 | T13316 | T13317 | locationOf | nuclear,translocation | ||
R11414 | T13317 | T13315 | themeOf | translocation,necessary | ||
R11415 | T13318 | T13317 | themeOf | GATA-3,translocation | ||
R11416 | T13321 | T13322 | themeOf | GATA-3,interaction | ||
R11417 | T13321 | T13320 | themeOf | GATA-3,phospho | ||
R11418 | T13322 | T13319 | themeOf | interaction,Prevention | ||
R15079 | T17584 | T17583 | themeOf | down-regulation,associated | ||
R15080 | T17586 | T17587 | themeOf | serine,phosphorylation | ||
R15081 | T17586 | T17585 | partOf | serine,GATA-3 | ||
R15082 | T17587 | T17584 | themeOf | phosphorylation,down-regulation | ||
R15083 | T17589 | T17588 | themeOf | phosphorylation,effect | ||
R15084 | T17590 | T17589 | themeOf | activated transcription factor 2,phosphorylation | ||
R15085 | T17591 | T17590 | equivalentTo | ATF-2,activated transcription factor 2 | ||
R15086 | T17594 | T17596 | partOf | serine,GATA-3 | ||
R15087 | T17594 | T17595 | themeOf | serine,phosphorylation | ||
R15088 | T17595 | T17593 | themeOf | phosphorylation,induced | ||
R15089 | T17595 | T17592 | themeOf | phosphorylation,decrease | ||
R15090 | T17597 | T17599 | themeOf | induced,dependent | ||
R15091 | T17598 | T17597 | themeOf | MKP-1,induced | ||
R15092 | T17600 | T17602 | themeOf | induces,dependent | ||
R15093 | T17601 | T17600 | themeOf | MKP-1,induces | ||
R15645 | T18279 | T18278 | themeOf | GATA-3,phospho | ||
R15646 | T18280 | T18281 | causeOf | GR,enhances | ||
R15647 | T18282 | T18283 | themeOf | GR,binding | ||
R15648 | T18283 | T18281 | themeOf | binding,enhances | ||
R15649 | T18286 | T18285 | themeOf | GR,activated | ||
R15650 | T18287 | T18288 | causeOf | GATA-3,attenuate | ||
R15651 | T18289 | T18290 | themeOf | GR,association | ||
R15652 | T18290 | T18288 | themeOf | association,attenuate | ||
R15653 | T18292 | T18293 | causeOf | GR,blocks | ||
R15654 | T18292 | T18291 | themeOf | GR,Activated | ||
R15655 | T18295 | T18296 | themeOf | GATA-3,interacting | ||
R15656 | T18295 | T18294 | themeOf | GATA-3,phospho | ||
R15657 | T18296 | T18293 | themeOf | interacting,blocks | ||
R15658 | T18299 | T18300 | themeOf | GATA-3,binding | ||
R15659 | T18300 | T18298 | themeOf | binding,stimulated | ||
R15660 | T18303 | T18301 | themeOf | GR,activated | ||
R15661 | T18303 | T18302 | themeOf | GR,unstimulated | ||
R15662 | T18303 | T18304 | causeOf | GR,attenuation | ||
R15663 | T18304 | T18307 | themeOf | attenuation,dependent | ||
R15664 | T18305 | T18306 | themeOf | GATA-3,association | ||
R15665 | T18306 | T18304 | themeOf | association,attenuation | ||
R15967 | T18703 | T18699 | themeOf | localization,prevent | ||
R15968 | T18703 | T18700 | themeOf | localization,stimulated | ||
R15969 | T18705 | T18706 | themeOf | GATA-3,degradation | ||
R15970 | T18706 | T18704 | themeOf | degradation,affect | ||
R15971 | T18710 | T18712 | themeOf | p65,translocation | ||
R15972 | T18711 | T18712 | locationOf | nuclear,translocation | ||
R15973 | T18712 | T18708 | themeOf | translocation,prevent | ||
R15974 | T18712 | T18709 | themeOf | translocation,stimulated | ||
R16816 | T19699 | T19701 | themeOf | GATA-3,localization | ||
R16817 | T19700 | T19701 | locationOf | nuclear,localization | ||
R16818 | T19701 | T19698 | themeOf | localization,impairs | ||
R16819 | T19702 | T19705 | themeOf | GR,localisation | ||
R16820 | T19703 | T19706 | themeOf | GATA-3,localisation | ||
R16821 | T19704 | T19705 | locationOf | nuclear,localisation | ||
R16822 | T19704 | T19706 | locationOf | nuclear,localisation | ||
R16823 | T19710 | T19708 | themeOf | decrease,dependent | ||
R16824 | T19711 | T19712 | locationOf | nuclear,expression | ||
R16825 | T19712 | T19710 | themeOf | expression,decrease | ||
R16826 | T19713 | T19712 | themeOf | GATA-3,expression | ||
R16827 | T19714 | T19709 | themeOf | increased,dependent | ||
R16828 | T19715 | T19717 | locationOf | cytoplasmic,expression | ||
R16829 | T19716 | T19717 | themeOf | GATA-3,expression | ||
R16830 | T19717 | T19714 | themeOf | expression,increased | ||
R16831 | T19719 | T19720 | locationOf | nuclear,expression | ||
R16832 | T19720 | T19718 | themeOf | expression,decrease | ||
R16833 | T19721 | T19720 | themeOf | GATA-3,expression | ||
R16834 | T19722 | T19724 | locationOf | cytoplasmic,expression | ||
R16835 | T19723 | T19724 | themeOf | GATA-3,expression | ||
R11398 | T13300 | T13302 | themeOf | IL-5,release | ||
R11292 | T13166 | T13167 | locationOf | nuclear,import | ||
R11293 | T13167 | T13168 | themeOf | import,via | ||
R11375 | T13270 | T13279 | themeOf | GATA-3,translocation | ||
R11379 | T13273 | T13277 | causeOf | attenuating,preventing | ||
R11384 | T13278 | T13279 | locationOf | nuclear,translocation | ||
R11385 | T13279 | T13277 | themeOf | translocation,preventing | ||
R11386 | T13280 | T13282 | themeOf | serine residue,phosphorylated | ||
R11387 | T13280 | T13281 | partOf | serine residue,GATA-3 | ||
R11388 | T13284 | T13286 | themeOf | GATA-3,import | ||
R11389 | T13285 | T13286 | locationOf | nuclear,import | ||
R11390 | T13286 | T13283 | themeOf | import,impairment | ||
R11391 | T13288 | T13287 | themeOf | expression,inhibitory effect | ||
R11392 | T13289 | T13288 | themeOf | IL-4,expression | ||
R11393 | T13291 | T13292 | themeOf | IL-4,transcription | ||
R11394 | T13292 | T13290 | themeOf | transcription,suppress | ||
R11395 | T13293 | T13294 | themeOf | GATA-3,inhibition | ||
R11396 | T13296 | T13295 | themeOf | GATA-3,inhibiting | ||
R11397 | T13299 | T13301 | themeOf | IL-4,release | ||
R11399 | T13301 | T13298 | themeOf | release,suppress | ||
R11400 | T13302 | T13297 | themeOf | release,suppress | ||
R11290 | T13165 | T13164 | themeOf | GATA-3,activated | ||
R11291 | T13165 | T13167 | themeOf | GATA-3,import | ||
R11353 | T13240 | T13241 | locationOf | nuclear,export | ||
R11355 | T13243 | T13244 | themeOf | GATA-3,degradation | ||
R11356 | T13244 | T13242 | themeOf | degradation,induces | ||
R11357 | T13246 | T13245 | themeOf | GR,activated | ||
R11358 | T13246 | T13247 | causeOf | GR,attenuate | ||
R11359 | T13249 | T13250 | themeOf | GATA-3,association | ||
R11360 | T13249 | T13248 | themeOf | GATA-3,phospho | ||
R11361 | T13250 | T13247 | themeOf | association,attenuate | ||
R11362 | T13252 | T13251 | themeOf | GATA-3,phospho | ||
R11363 | T13252 | T13253 | themeOf | GATA-3,associate | ||
R11364 | T13255 | T13254 | themeOf | reduction,contribute | ||
R11365 | T13256 | T13258 | themeOf | GATA-3,import | ||
R11366 | T13257 | T13258 | locationOf | nuclear,import | ||
R13739 | T16003 | T16000 | themeOf | import,inhibits | ||
R13737 | T16001 | T16003 | themeOf | GATA-3,import | ||
R13738 | T16002 | T16003 | locationOf | nuclear,import | ||
R13740 | T16005 | T16004 | themeOf | GATA-3,translocation | ||
R13741 | T16006 | T16004 | locationOf | nucleus,translocation | ||
R13742 | T16008 | T16009 | locationOf | nuclear,localization | ||
R13743 | T16009 | T16011 | themeOf | localization,induced | ||
R13744 | T16010 | T16009 | themeOf | GATA-3,localization | ||
R13745 | T16015 | T16017 | themeOf | IL-4,mRNA expression | ||
R13746 | T16016 | T16018 | themeOf | IL-5,mRNA expression | ||
R13747 | T16017 | T16014 | themeOf | mRNA expression,inhibits | ||
R13748 | T16018 | T16013 | themeOf | mRNA expression,inhibits | ||
R13749 | T16019 | T16022 | themeOf | CD3,costimulated | ||
R13750 | T16020 | T16021 | themeOf | CD28,costimulated | ||
R13751 | T16025 | T16026 | themeOf | GATA-3,associate | ||
R13752 | T16025 | T16024 | themeOf | GATA-3,stimulated | ||
R13753 | T16026 | T16023 | themeOf | associate,reduces | ||
R13754 | T16028 | T16026 | themeOf | promoter,associate | ||
R13755 | T16028 | T16027 | partOf | promoter,IL-5 | ||
R6293 | T7352 | T7351 | themeOf | GATA-3-GFP,expressing | ||
R7075 | T8187 | T8189 | themeOf | GATA-3,Translocation | ||
R7076 | T8188 | T8189 | locationOf | Nuclear,Translocation | ||
R7077 | T8189 | T8185 | themeOf | Translocation,Effect | ||
R7078 | T8190 | T8186 | themeOf | IL-4,Effect | ||
R7079 | T8192 | T8191 | themeOf | inhibiting,effective | ||
R7080 | T8193 | T8194 | causeOf | GATA-3,regulated | ||
R7081 | T8194 | T8192 | themeOf | regulated,inhibiting | ||
R7082 | T8195 | T8196 | themeOf | IL-4,expression | ||
R7083 | T8196 | T8194 | themeOf | expression,regulated | ||
R7084 | T8198 | T8197 | themeOf | stimulated,affect | ||
R7085 | T8199 | T8200 | locationOf | nuclear,import | ||
R7086 | T8200 | T8198 | themeOf | import,stimulated | ||
R7087 | T8201 | T8200 | themeOf | GATA-3,import | ||
R7088 | T8203 | T8205 | locationOf | nuclear,translocation | ||
R7089 | T8204 | T8205 | themeOf | GATA-3,translocation | ||
R15962 | T18696 | T18697 | themeOf | GATA-3,export | ||
R15963 | T18697 | T18695 | themeOf | export,affect | ||
R15964 | T18699 | T18698 | themeOf | prevent,affect | ||
R15965 | T18701 | T18703 | themeOf | GATA-3,localization | ||
R15966 | T18702 | T18703 | locationOf | nuclear,localization | ||
R9596 | T11225 | T11227 | themeOf | GATA-3,Localization | ||
R9597 | T11226 | T11227 | locationOf | Nuclear,Localization | ||
R9598 | T11227 | T11224 | themeOf | Localization,Inhibitory | ||
R9599 | T11229 | T11228 | themeOf | decrease,dependent | ||
R9600 | T11230 | T11229 | themeOf | interaction,decrease | ||
R9601 | T11230 | T11233 | themeOf | interaction,inhibited | ||
R9602 | T11230 | T11234 | themeOf | interaction,attenuated | ||
R9603 | T11232 | T11230 | themeOf | GATA-3,interaction | ||
R9604 | T11232 | T11231 | themeOf | GATA-3,phospho | ||
R9605 | T11237 | T11240 | themeOf | IL-4,expression | ||
R9606 | T11238 | T11239 | themeOf | -5,expression | ||
R9607 | T11239 | T11235 | themeOf | expression,suppresses | ||
R9608 | T11240 | T11236 | themeOf | expression,suppresses | ||
R9609 | T11242 | T11241 | themeOf | interaction,attenuated | ||
R9610 | T11243 | T11242 | themeOf | GATA-3,interaction | ||
R9611 | T11244 | T11247 | themeOf | reduced,dependent | ||
R9612 | T11245 | T11246 | themeOf | GATA-3,interaction | ||
R9613 | T11246 | T11244 | themeOf | interaction,reduced | ||
R9614 | T11249 | T11248 | themeOf | decrease,produced | ||
R9615 | T11250 | T11251 | themeOf | GATA-3,association | ||
R9616 | T11251 | T11249 | themeOf | association,decrease | ||
R9617 | T11252 | T11253 | themeOf | GATA-3,association | ||
R9618 | T11255 | T11254 | themeOf | interaction,attenuated | ||
R9619 | T11256 | T11255 | themeOf | GATA-3,interaction | ||
R9620 | T11258 | T11257 | themeOf | localization,affect | ||
R9621 | T11259 | T11258 | themeOf | GATA-3,localization | ||
R9622 | T11261 | T11263 | themeOf | GR,translocation | ||
R71 | T99 | T96 | themeOf | expression,regulating | ||
R72 | T100 | T98 | themeOf | expression,regulating | ||
R74 | T102 | T100 | themeOf | interleukin (IL)-4,expression | ||
R769 | T91 | T94 | themeOf | GATA-3,Phosphorylation | ||
R774 | T95 | T98 | causeOf | GATA-3,regulating | ||
R775 | T95 | T96 | causeOf | GATA-3,regulating | ||
R73 | T101 | T97 | themeOf | expression,regulating | ||
R75 | T103 | T99 | themeOf | IL-5,expression | ||
R76 | T104 | T101 | themeOf | IL-13,expression | ||
R77 | T107 | T108 | themeOf | GATA-3,regulation | ||
R78 | T108 | T106 | themeOf | regulation,effect | ||
R79 | T110 | T111 | locationOf | nuclear,translocation | ||
R80 | T111 | T109 | themeOf | translocation,inhibits | ||
R81 | T112 | T111 | themeOf | GATA-3,translocation | ||
R82 | T115 | T120 | themeOf | GATA-3,transport | ||
R83 | T117 | T119 | themeOf | glucocorticoid receptor,transport | ||
R84 | T117 | T116 | themeOf | glucocorticoid receptor,activated | ||
R85 | T118 | T120 | locationOf | nuclear,transport | ||
R86 | T118 | T119 | locationOf | nuclear,transport | ||
R87 | T119 | T113 | themeOf | transport,competition | ||
R88 | T120 | T114 | themeOf | transport,competition | ||
R89 | T122 | T121 | themeOf | expression,induces | ||
R90 | T123 | T122 | themeOf | mitogen-activated protein kinase (MAPK) phosphatase-1,expression | ||
R91 | T124 | T123 | equivalentTo | MKP-1,mitogen-activated protein kinase (MAPK) phosphatase-1 | ||
R92 | T126 | T128 | themeOf | GATA-3,translocation | ||
R93 | T127 | T128 | locationOf | nuclear,translocation | ||
R94 | T128 | T125 | themeOf | translocation,necessary | ||
R95 | T130 | T132 | themeOf | GATA-3,translocation | ||
R96 | T131 | T132 | locationOf | nuclear,translocation | ||
R97 | T132 | T129 | themeOf | translocation,inhibits | ||
R98 | T134 | T133 | themeOf | GATA-3,inhibitory effect | ||
R770 | T91 | T93 | themeOf | GATA-3,Import | ||
R771 | T92 | T93 | locationOf | Nuclear,Import | ||
R772 | T93 | T89 | themeOf | Import,Suppression | ||
R773 | T94 | T90 | themeOf | Phosphorylation,Suppression | ||
R776 | T95 | T97 | causeOf | GATA-3,regulating | ||
R3730 | T4347 | T4348 | themeOf | GATA-3,localization | ||
R7683 | T8915 | T8916 | themeOf | GATA-3,for | ||
R7684 | T8918 | T8917 | themeOf | GR,activated | ||
R7685 | T8918 | T8924 | themeOf | GR,import | ||
R7686 | T8919 | T8923 | themeOf | GATA-3,import | ||
R7687 | T8922 | T8924 | locationOf | nuclear,import | ||
R7688 | T8922 | T8923 | locationOf | nuclear,import | ||
R7689 | T8923 | T8920 | themeOf | import,uses | ||
R7690 | T8924 | T8921 | themeOf | import,uses | ||
R7691 | T8926 | T8928 | themeOf | GR,translocation | ||
R7692 | T8927 | T8928 | locationOf | nuclear,translocation | ||
R7693 | T8929 | T8933 | themeOf | decreased,dependent | ||
R7694 | T8930 | T8929 | themeOf | association,decreased | ||
R959 | T1187 | T1188 | themeOf | GATA-3,expressed | ||
R960 | T1189 | T1191 | causeOf | GATA-3,activates | ||
R961 | T1189 | T1192 | causeOf | GATA-3,activates | ||
R962 | T1189 | T1190 | causeOf | GATA-3,activates | ||
R963 | T1193 | T1191 | themeOf | promoters,activates | ||
R964 | T1193 | T1195 | partOf | promoters,IL-5 | ||
R965 | T1193 | T1192 | themeOf | promoters,activates | ||
R966 | T1193 | T1194 | partOf | promoters,IL-4 | ||
R967 | T1193 | T1190 | themeOf | promoters,activates | ||
R968 | T1193 | T1196 | partOf | promoters,IL-13 | ||
R969 | T1203 | T1204 | themeOf | GATA-3,expression | ||
R8230 | T9585 | T9584 | themeOf | MKP-1,induction | ||
R8231 | T9586 | T9585 | equivalentTo | MAPK phosphatase-1,MKP-1 | ||
R8232 | T9588 | T9587 | themeOf | phosphorylation,decreased | ||
R8235 | T9591 | T9596 | themeOf | reduced,dependent | ||
R8240 | T9598 | T9599 | themeOf | GATA-3,phosphorylation | ||
R8241 | T9599 | T9597 | themeOf | phosphorylation,This reduction | ||
R8242 | T9600 | T9603 | themeOf | induced,dependent | ||
R8243 | T9601 | T9602 | themeOf | MKP-1,mRNA | ||
R8244 | T9602 | T9600 | themeOf | mRNA,induced | ||
R8245 | T9607 | T9609 | themeOf | GATA-3,import | ||
R8246 | T9607 | T9610 | themeOf | GATA-3,association | ||
R8247 | T9608 | T9609 | locationOf | nuclear,import | ||
R8248 | T9609 | T9606 | themeOf | import,effects | ||
R8249 | T9610 | T9604 | themeOf | association,effects | ||
R8250 | T9611 | T9612 | themeOf | IL-4,mRNA expression | ||
R8251 | T9612 | T9605 | themeOf | mRNA expression,effects | ||
R8252 | T9616 | T9613 | themeOf | GATA-3,competition | ||
R8253 | T9616 | T9615 | themeOf | GATA-3,activated | ||
R8254 | T9618 | T9614 | themeOf | GR,competition | ||
R8255 | T9618 | T9617 | themeOf | GR,activated | ||
R8256 | T9620 | T9619 | themeOf | GR,activated | ||
R8257 | T9620 | T9621 | causeOf | GR,increased | ||
R8258 | T9621 | T9624 | themeOf | increased,in the presence and absence of | ||
R8259 | T9622 | T9623 | themeOf | GR,association | ||
R8260 | T9623 | T9621 | themeOf | association,increased | ||
R8261 | T9625 | T9624 | causeOf | activated,in the presence and absence of | ||
R8262 | T9626 | T9625 | themeOf | GATA-3,activated | ||
R8263 | T9628 | T9627 | themeOf | GATA-3,activated | ||
R8264 | T9628 | T9629 | causeOf | GATA-3,block | ||
R8265 | T9630 | T9631 | themeOf | GR,association | ||
R8266 | T9631 | T9629 | themeOf | association,block | ||
R8267 | T9633 | T9632 | themeOf | GR,activated | ||
R8268 | T9633 | T9635 | themeOf | GR,associate | ||
R8233 | T9590 | T9588 | themeOf | ATF-2,phosphorylation | ||
R8234 | T9590 | T9589 | themeOf | ATF-2,target | ||
R8236 | T9593 | T9594 | themeOf | serine,phosphorylation | ||
R8237 | T9593 | T9592 | partOf | serine,GATA-3 | ||
R8238 | T9594 | T9591 | themeOf | phosphorylation,reduced | ||
R8239 | T9594 | T9595 | themeOf | phosphorylation,induced | ||
R8269 | T9634 | T9636 | themeOf | GATA-3,associate | ||
R8270 | T9638 | T9637 | themeOf | GR,activated | ||
R8271 | T9638 | T9639 | causeOf | GR,attenuates | ||
R8272 | T9639 | T9643 | themeOf | attenuates,dependent | ||
R8273 | T9641 | T9642 | themeOf | GATA-3,interaction | ||
R8274 | T9641 | T9640 | themeOf | GATA-3,phospho | ||
R8275 | T9642 | T9639 | themeOf | interaction,attenuates | ||
R8276 | T9645 | T9644 | themeOf | GR,activated | ||
R8277 | T9645 | T9646 | causeOf | GR,compete | ||
R8278 | T9646 | T9649 | causeOf | compete,limit | ||
R8279 | T9647 | T9648 | themeOf | GATA-3,for | ||
R8280 | T9648 | T9646 | themeOf | for,compete | ||
R8281 | T9650 | T9652 | themeOf | GATA-3,import | ||
R14391 | T16791 | T16792 | themeOf | GATA-3,association | ||
R14392 | T16792 | T16789 | themeOf | association,reduces | ||
R14393 | T16793 | T16795 | themeOf | GATA-3,import | ||
R14394 | T16794 | T16795 | locationOf | nuclear,import | ||
R14395 | T16795 | T16790 | themeOf | import,reduces | ||
R14396 | T16797 | T16796 | themeOf | induction,dependent | ||
R14397 | T16799 | T16800 | themeOf | GR,interaction | ||
R14398 | T16799 | T16798 | themeOf | GR,activated | ||
R14399 | T16800 | T16797 | themeOf | interaction,induction | ||
R14400 | T16801 | T16802 | themeOf | GR,association | ||
R14401 | T16804 | T16803 | themeOf | induction,dependent | ||
R14402 | T16806 | T16808 | themeOf | GR,translocation | ||
R14403 | T16806 | T16805 | themeOf | GR,activated | ||
R14404 | T16807 | T16808 | locationOf | nuclear,translocation | ||
R14405 | T16808 | T16804 | themeOf | translocation,induction | ||
R14406 | T16810 | T16809 | themeOf | decrease,dependent | ||
R14407 | T16811 | T16812 | themeOf | GATA-3,association | ||
R14408 | T16812 | T16810 | themeOf | association,decrease | ||
R14409 | T16813 | T16814 | themeOf | GATA-3,overexpressed | ||
R16449 | T19275 | T19276 | themeOf | GATA-3,interaction | ||
R16450 | T19276 | T19273 | themeOf | interaction,impairs | ||
R16451 | T19277 | T19279 | themeOf | GATA-3,localization | ||
R16452 | T19278 | T19279 | locationOf | nuclear,localization | ||
R16453 | T19279 | T19274 | themeOf | localization,impairs | ||
R16454 | T19281 | T19280 | themeOf | interaction,impaired | ||
R16455 | T19282 | T19281 | themeOf | GATA-3,interaction | ||
R16456 | T19284 | T19283 | themeOf | association,decreased | ||
R16457 | T19285 | T19284 | themeOf | GATA-3,association |
bionlp-st-ge-2016-uniprot
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T430 | 15-21 | P23771 | denotes | GATA-3 |
T431 | 466-472 | P23771 | denotes | GATA-3 |
T432 | 561-565 | P05113 | denotes | IL-5 |
T433 | 571-576 | P35225 | denotes | IL-13 |
T434 | 755-761 | P23771 | denotes | GATA-3 |
T435 | 850-856 | P23771 | denotes | GATA-3 |
T436 | 1030-1033 | P04234 | denotes | CD3 |
T437 | 1030-1033 | P20963 | denotes | CD3 |
T438 | 1030-1033 | P09693 | denotes | CD3 |
T439 | 1030-1033 | P07766 | denotes | CD3 |
T440 | 1043-1047 | P10747 | denotes | CD28 |
T441 | 1124-1130 | P23771 | denotes | GATA-3 |
T442 | 1256-1262 | P23771 | denotes | GATA-3 |
T443 | 1288-1311 | P04150 | denotes | glucocorticoid receptor |
T444 | 1426-1458 | P27361 | denotes | mitogen-activated protein kinase |
T445 | 1426-1458 | P28482 | denotes | mitogen-activated protein kinase |
T446 | 1481-1486 | P28562 | denotes | MKP-1 |
T447 | 1517-1520 | P53778 | denotes | p38 |
T448 | 1517-1520 | Q16539 | denotes | p38 |
T449 | 1517-1520 | Q15759 | denotes | p38 |
T450 | 1517-1520 | O15264 | denotes | p38 |
T451 | 1550-1556 | P23771 | denotes | GATA-3 |
T452 | 1709-1715 | P23771 | denotes | GATA-3 |
T453 | 1867-1873 | P23771 | denotes | GATA-3 |
T2224 | 7392-7396 | P05113 | denotes | IL-5 |
T2225 | 7402-7407 | P35225 | denotes | IL-13 |
T2226 | 7437-7441 | P05112 | denotes | IL-4 |
T2227 | 7446-7451 | P35225 | denotes | IL-13 |
T2228 | 7511-7515 | P05113 | denotes | IL-5 |
T2229 | 7635-7641 | P23771 | denotes | GATA-3 |
T2230 | 7698-7704 | P23771 | denotes | GATA-3 |
T2231 | 7784-7788 | P05112 | denotes | IL-4 |
T2232 | 7790-7794 | P05113 | denotes | IL-5 |
T2233 | 7800-7805 | P35225 | denotes | IL-13 |
T2234 | 7861-7867 | P23771 | denotes | GATA-3 |
T2235 | 8023-8029 | P23771 | denotes | GATA-3 |
T2236 | 8088-8094 | P23771 | denotes | GATA-3 |
T2237 | 8146-8151 | P23771 | denotes | Gata3 |
T2238 | 8286-8289 | P01730 | denotes | CD4 |
T2239 | 8331-8337 | P23771 | denotes | GATA-3 |
T2240 | 8402-8405 | P09693 | denotes | CD3 |
T2241 | 8402-8405 | P20963 | denotes | CD3 |
T2242 | 8402-8405 | P04234 | denotes | CD3 |
T2243 | 8402-8405 | P07766 | denotes | CD3 |
T2244 | 8406-8410 | P10747 | denotes | CD28 |
T2245 | 8463-8469 | P23771 | denotes | GATA-3 |
T2246 | 8614-8620 | P23771 | denotes | GATA-3 |
T2247 | 8808-8814 | P23771 | denotes | GATA-3 |
T2248 | 9014-9020 | P23771 | denotes | GATA-3 |
T2249 | 9243-9246 | Q16539 | denotes | p38 |
T2250 | 9243-9246 | P53778 | denotes | p38 |
T2251 | 9243-9246 | Q15759 | denotes | p38 |
T2252 | 9243-9246 | O15264 | denotes | p38 |
T2253 | 9247-9279 | P28482 | denotes | mitogen-activated protein kinase |
T2254 | 9247-9279 | P27361 | denotes | mitogen-activated protein kinase |
T2255 | 9328-9334 | P23771 | denotes | GATA-3 |
T2256 | 9663-9687 | P04150 | denotes | glucocorticoid receptors |
T2257 | 9689-9692 | P04150 | denotes | GRs |
T2258 | 9875-9877 | P04150 | denotes | GR |
T2259 | 10193-10195 | P04150 | denotes | GR |
T2260 | 10683-10685 | P04150 | denotes | GR |
T2261 | 10946-10948 | P04150 | denotes | GR |
T2262 | 11030-11032 | P04150 | denotes | GR |
T2263 | 11366-11370 | P05112 | denotes | IL-4 |
T2264 | 11372-11376 | P05113 | denotes | IL-5 |
T2265 | 11382-11387 | P35225 | denotes | IL-13 |
T2266 | 11590-11592 | P04150 | denotes | GR |
T2267 | 11601-11607 | P23771 | denotes | GATA-3 |
T2268 | 11617-11621 | P05113 | denotes | IL-5 |
T2269 | 11657-11660 | P01730 | denotes | CD4 |
T2270 | 11720-11722 | P04150 | denotes | GR |
T2271 | 11748-11754 | P23771 | denotes | GATA-3 |
T2272 | 11974-11980 | P23771 | denotes | GATA-3 |
T2273 | 12120-12123 | P07766 | denotes | CD3 |
T2274 | 12120-12123 | P09693 | denotes | CD3 |
T2275 | 12120-12123 | P04234 | denotes | CD3 |
T2276 | 12120-12123 | P20963 | denotes | CD3 |
T2277 | 12133-12137 | P10747 | denotes | CD28 |
T2278 | 12221-12227 | P23771 | denotes | GATA-3 |
T4128 | 13206-13209 | P09693 | denotes | CD3 |
T4129 | 13206-13209 | P07766 | denotes | CD3 |
T4130 | 13206-13209 | P04234 | denotes | CD3 |
T4131 | 13206-13209 | P20963 | denotes | CD3 |
T4132 | 13211-13215 | P10747 | denotes | CD28 |
T4133 | 13217-13219 | P04150 | denotes | GR |
T4134 | 13329-13335 | P23771 | denotes | GATA-3 |
T4135 | 13347-13349 | P04150 | denotes | GR |
T4136 | 13496-13499 | Q16539 | denotes | p38 |
T4137 | 13496-13499 | P53778 | denotes | p38 |
T4138 | 13496-13499 | Q15759 | denotes | p38 |
T4139 | 13496-13499 | O15264 | denotes | p38 |
T4140 | 13523-13528 | P15336 | denotes | ATF-2 |
T4141 | 13795-13797 | P04150 | denotes | GR |
T5739 | 16679-16681 | P04150 | denotes | GR |
T5740 | 16682-16688 | P23771 | denotes | GATA-3 |
T5741 | 16938-16944 | P23771 | denotes | GATA-3 |
T5742 | 17031-17034 | P04234 | denotes | CD3 |
T5743 | 17031-17034 | P09693 | denotes | CD3 |
T5744 | 17031-17034 | P20963 | denotes | CD3 |
T5745 | 17031-17034 | P07766 | denotes | CD3 |
T5746 | 17035-17039 | P10747 | denotes | CD28 |
T5747 | 17044-17046 | P04150 | denotes | GR |
T5748 | 17315-17321 | P23771 | denotes | GATA-3 |
T5749 | 17422-17424 | P04150 | denotes | GR |
T5750 | 17631-17637 | P23771 | denotes | GATA-3 |
T5751 | 17653-17655 | P04150 | denotes | GR |
T5752 | 17819-17825 | P23771 | denotes | GATA-3 |
T5753 | 17927-17929 | P04150 | denotes | GR |
T6927 | 19780-19786 | P23771 | denotes | GATA-3 |
T6928 | 19787-19790 | Q9U6Y4 | denotes | GFP |
T6929 | 19805-19811 | P23771 | denotes | GATA-3 |
T6930 | 19923-19929 | P23771 | denotes | GATA-3 |
T6931 | 19951-19957 | P23771 | denotes | GATA-3 |
T6932 | 20161-20167 | P23771 | denotes | GATA-3 |
T6933 | 20427-20433 | P23771 | denotes | GATA-3 |
T6934 | 20451-20454 | Q9U6Y4 | denotes | GFP |
T6935 | 20533-20539 | P23771 | denotes | GATA-3 |
T6936 | 20595-20598 | Q9U6Y4 | denotes | GFP |
T8423 | 23205-23211 | P23771 | denotes | GATA-3 |
T8424 | 23238-23242 | P05112 | denotes | IL-4 |
T8425 | 23292-23298 | P23771 | denotes | GATA-3 |
T8426 | 23309-23313 | P05112 | denotes | IL-4 |
T8427 | 23419-23422 | P04234 | denotes | CD3 |
T8428 | 23419-23422 | P20963 | denotes | CD3 |
T8429 | 23419-23422 | P07766 | denotes | CD3 |
T8430 | 23419-23422 | P09693 | denotes | CD3 |
T8431 | 23423-23427 | P10747 | denotes | CD28 |
T8432 | 23457-23463 | P23771 | denotes | GATA-3 |
T8433 | 23496-23499 | P04234 | denotes | CD3 |
T8434 | 23496-23499 | P20963 | denotes | CD3 |
T8435 | 23496-23499 | P07766 | denotes | CD3 |
T8436 | 23496-23499 | P09693 | denotes | CD3 |
T8437 | 23500-23504 | P10747 | denotes | CD28 |
T8438 | 23545-23551 | P23771 | denotes | GATA-3 |
T8439 | 23720-23725 | Q02750 | denotes | MEK-1 |
T8440 | 23817-23823 | P23771 | denotes | GATA-3 |
T8441 | 23864-23870 | P23771 | denotes | GATA-3 |
T8442 | 24143-24146 | P20963 | denotes | CD3 |
T8443 | 24143-24146 | P09693 | denotes | CD3 |
T8444 | 24143-24146 | P07766 | denotes | CD3 |
T8445 | 24143-24146 | P04234 | denotes | CD3 |
T8446 | 24147-24151 | P10747 | denotes | CD28 |
T8447 | 24163-24167 | P05112 | denotes | IL-4 |
T8448 | 24172-24176 | P05113 | denotes | IL-5 |
T8449 | 24219-24225 | P23771 | denotes | GATA-3 |
T8450 | 24248-24252 | P05113 | denotes | IL-5 |
T9089 | 25841-25843 | P04150 | denotes | GR |
T9090 | 25858-25864 | P23771 | denotes | GATA-3 |
T9091 | 25955-25957 | P04150 | denotes | GR |
T9092 | 25969-25975 | P23771 | denotes | GATA-3 |
T9093 | 26060-26062 | P04150 | denotes | GR |
T9094 | 26173-26175 | P04150 | denotes | GR |
T9095 | 26369-26375 | P23771 | denotes | GATA-3 |
T9096 | 26407-26410 | P09693 | denotes | CD3 |
T9097 | 26407-26410 | P20963 | denotes | CD3 |
T9098 | 26407-26410 | P07766 | denotes | CD3 |
T9099 | 26407-26410 | P04234 | denotes | CD3 |
T9100 | 26411-26415 | P10747 | denotes | CD28 |
T9101 | 26496-26499 | Q9U6Y4 | denotes | GFP |
T9102 | 26509-26515 | P23771 | denotes | GATA-3 |
T9103 | 26561-26567 | P23771 | denotes | GATA-3 |
T9104 | 26598-26601 | P09693 | denotes | CD3 |
T9105 | 26598-26601 | P07766 | denotes | CD3 |
T9106 | 26598-26601 | P04234 | denotes | CD3 |
T9107 | 26598-26601 | P20963 | denotes | CD3 |
T9108 | 26602-26606 | P10747 | denotes | CD28 |
T10140 | 28261-28266 | P28562 | denotes | MKP-1 |
T10141 | 28290-28293 | Q15759 | denotes | p38 |
T10142 | 28290-28293 | P53778 | denotes | p38 |
T10143 | 28290-28293 | O15264 | denotes | p38 |
T10144 | 28290-28293 | Q16539 | denotes | p38 |
T10145 | 28398-28403 | P28562 | denotes | MKP-1 |
T10146 | 28525-28528 | P09693 | denotes | CD3 |
T10147 | 28525-28528 | P07766 | denotes | CD3 |
T10148 | 28525-28528 | P20963 | denotes | CD3 |
T10149 | 28525-28528 | P04234 | denotes | CD3 |
T10150 | 28529-28533 | P10747 | denotes | CD28 |
T10151 | 28567-28570 | O15264 | denotes | p38 |
T10152 | 28567-28570 | Q16539 | denotes | p38 |
T10153 | 28567-28570 | Q15759 | denotes | p38 |
T10154 | 28567-28570 | P53778 | denotes | p38 |
T10155 | 28670-28675 | P15336 | denotes | ATF-2 |
T10156 | 28805-28811 | P23771 | denotes | GATA-3 |
T10157 | 28851-28854 | P09693 | denotes | CD3 |
T10158 | 28851-28854 | P04234 | denotes | CD3 |
T10159 | 28851-28854 | P07766 | denotes | CD3 |
T10160 | 28851-28854 | P20963 | denotes | CD3 |
T10161 | 28855-28859 | P10747 | denotes | CD28 |
T10162 | 28954-28960 | P23771 | denotes | GATA-3 |
T10163 | 29063-29068 | P28562 | denotes | MKP-1 |
T10164 | 29218-29224 | P23771 | denotes | GATA-3 |
T10165 | 29268-29272 | P05112 | denotes | IL-4 |
T10166 | 30745-30751 | P23771 | denotes | GATA-3 |
T10167 | 30779-30781 | P04150 | denotes | GR |
T10168 | 30814-30816 | P04150 | denotes | GR |
T10169 | 30841-30843 | P04150 | denotes | GR |
T10170 | 30908-30914 | P23771 | denotes | GATA-3 |
T10171 | 30971-30977 | P23771 | denotes | GATA-3 |
T10172 | 30992-30994 | P04150 | denotes | GR |
T10173 | 31075-31077 | P04150 | denotes | GR |
T10174 | 31090-31096 | P23771 | denotes | GATA-3 |
T10175 | 31167-31169 | P04150 | denotes | GR |
T10176 | 31193-31199 | P23771 | denotes | GATA-3 |
T10177 | 31318-31320 | P04150 | denotes | GR |
T10178 | 31346-31352 | P23771 | denotes | GATA-3 |
T10179 | 31386-31392 | P23771 | denotes | GATA-3 |
T10180 | 32576-32582 | P23771 | denotes | GATA-3 |
T10181 | 32705-32711 | P23771 | denotes | GATA-3 |
T10182 | 32791-32797 | P23771 | denotes | GATA-3 |
T10183 | 32908-32911 | P20963 | denotes | CD3 |
T10184 | 32908-32911 | P09693 | denotes | CD3 |
T10185 | 32908-32911 | P07766 | denotes | CD3 |
T10186 | 32908-32911 | P04234 | denotes | CD3 |
T10187 | 32912-32916 | P10747 | denotes | CD28 |
T10188 | 32946-32952 | P23771 | denotes | GATA-3 |
T10189 | 33010-33012 | P04150 | denotes | GR |
T10190 | 33030-33036 | P23771 | denotes | GATA-3 |
T10191 | 33082-33088 | P23771 | denotes | GATA-3 |
T10192 | 33160-33163 | Q04206 | denotes | p65 |
T10193 | 33160-33163 | P21579 | denotes | p65 |
T11896 | 34313-34319 | P23771 | denotes | GATA-3 |
T11897 | 34502-34508 | P23771 | denotes | GATA-3 |
T11898 | 35764-35768 | P05112 | denotes | IL-4 |
T11899 | 35826-35832 | P23771 | denotes | GATA-3 |
T11900 | 36086-36092 | P23771 | denotes | GATA-3 |
T11901 | 36185-36191 | P23771 | denotes | GATA-3 |
T11902 | 36483-36489 | P23771 | denotes | GATA-3 |
T11903 | 36625-36631 | P23771 | denotes | GATA-3 |
T11904 | 36879-36885 | P23771 | denotes | GATA-3 |
T11905 | 36982-36984 | P04150 | denotes | GR |
T11906 | 37069-37075 | P23771 | denotes | GATA-3 |
T11907 | 37460-37466 | P23771 | denotes | GATA-3 |
T11908 | 37603-37609 | P23771 | denotes | GATA-3 |
T11909 | 37831-37834 | O15264 | denotes | p38 |
T11910 | 37831-37834 | Q16539 | denotes | p38 |
T11911 | 37831-37834 | Q15759 | denotes | p38 |
T11912 | 37831-37834 | P53778 | denotes | p38 |
T11913 | 39499-39505 | P23771 | denotes | GATA-3 |
T11914 | 39544-39550 | P23771 | denotes | GATA-3 |
T11915 | 39689-39692 | Q16539 | denotes | p38 |
T11916 | 39689-39692 | P53778 | denotes | p38 |
T11917 | 39689-39692 | Q15759 | denotes | p38 |
T11918 | 39689-39692 | O15264 | denotes | p38 |
T11919 | 39707-39713 | P23771 | denotes | GATA-3 |
T11920 | 39753-39758 | P28562 | denotes | MKP-1 |
T11921 | 39847-39853 | P23771 | denotes | GATA-3 |
T14226 | 40017-40023 | P23771 | denotes | GATA-3 |
T14227 | 40167-40169 | P04150 | denotes | GR |
T14228 | 40204-40210 | P23771 | denotes | GATA-3 |
T14229 | 40298-40304 | P23771 | denotes | GATA-3 |
T14230 | 40309-40311 | P04150 | denotes | GR |
T14231 | 40391-40396 | P28562 | denotes | MKP-1 |
T14232 | 40420-40423 | Q16539 | denotes | p38 |
T14233 | 40420-40423 | Q15759 | denotes | p38 |
T14234 | 40420-40423 | P53778 | denotes | p38 |
T14235 | 40420-40423 | O15264 | denotes | p38 |
T14236 | 40500-40503 | P53778 | denotes | p38 |
T14237 | 40500-40503 | Q15759 | denotes | p38 |
T14238 | 40500-40503 | Q16539 | denotes | p38 |
T14239 | 40500-40503 | O15264 | denotes | p38 |
T14240 | 40543-40549 | P23771 | denotes | GATA-3 |
T14241 | 40678-40684 | P23771 | denotes | GATA-3 |
T14242 | 40808-40814 | P23771 | denotes | GATA-3 |
T14243 | 40859-40865 | P23771 | denotes | GATA-3 |
T14244 | 40919-40922 | P04234 | denotes | CD3 |
T14245 | 40919-40922 | P09693 | denotes | CD3 |
T14246 | 40919-40922 | P20963 | denotes | CD3 |
T14247 | 40919-40922 | P07766 | denotes | CD3 |
T14248 | 40923-40927 | P10747 | denotes | CD28 |
T14249 | 40939-40943 | P05112 | denotes | IL-4 |
T14250 | 40944-40948 | P05113 | denotes | IL-5 |
T14251 | 41004-41010 | P23771 | denotes | GATA-3 |
T14252 | 41092-41094 | P04150 | denotes | GR |
T14253 | 41142-41148 | P23771 | denotes | GATA-3 |
T14254 | 41227-41229 | P04150 | denotes | GR |
T14255 | 41242-41248 | P23771 | denotes | GATA-3 |
T14256 | 41358-41360 | P04150 | denotes | GR |
T14257 | 41374-41380 | P23771 | denotes | GATA-3 |
T14258 | 41434-41440 | P23771 | denotes | GATA-3 |
T14259 | 41597-41603 | P23771 | denotes | GATA-3 |
T14260 | 41637-41640 | Q04206 | denotes | p65 |
T14261 | 41637-41640 | P21579 | denotes | p65 |
T14262 | 41768-41774 | P23771 | denotes | GATA-3 |
T14263 | 41836-41842 | P23771 | denotes | GATA-3 |
T14264 | 41878-41884 | P23771 | denotes | GATA-3 |
T14265 | 41995-41997 | P04150 | denotes | GR |
T14266 | 42037-42043 | P23771 | denotes | GATA-3 |
T14267 | 42150-42156 | P23771 | denotes | GATA-3 |
T14268 | 42399-42405 | P23771 | denotes | GATA-3 |
T14269 | 42521-42526 | P28562 | denotes | MKP-1 |
T14270 | 42567-42570 | P53778 | denotes | p38 |
T14271 | 42567-42570 | O15264 | denotes | p38 |
T14272 | 42567-42570 | Q16539 | denotes | p38 |
T14273 | 42567-42570 | Q15759 | denotes | p38 |
T14274 | 42610-42615 | P28562 | denotes | MKP-1 |
T14275 | 42711-42716 | P28562 | denotes | MKP-1 |
T14276 | 42758-42768 | Q04864 | denotes | relatively |
T14277 | 42840-42845 | P28562 | denotes | MKP-1 |
T14278 | 42857-42863 | P23771 | denotes | GATA-3 |
T14279 | 42894-42897 | Q16539 | denotes | p38 |
T14280 | 42894-42897 | P53778 | denotes | p38 |
T14281 | 42894-42897 | Q15759 | denotes | p38 |
T14282 | 42894-42897 | O15264 | denotes | p38 |
T14283 | 42927-42933 | P23771 | denotes | GATA-3 |
T14284 | 43031-43037 | P23771 | denotes | GATA-3 |
T14285 | 43065-43068 | P53778 | denotes | p38 |
T14286 | 43065-43068 | O15264 | denotes | p38 |
T14287 | 43065-43068 | Q15759 | denotes | p38 |
T14288 | 43065-43068 | Q16539 | denotes | p38 |
T14294 | 43522-43526 | P05112 | denotes | IL-4 |
T14295 | 43693-43697 | P05112 | denotes | IL-4 |
T14296 | 43854-43860 | P23771 | denotes | GATA-3 |
T14297 | 44009-44015 | P23771 | denotes | GATA-3 |
T14298 | 44352-44356 | P05112 | denotes | IL-4 |
T14299 | 44361-44365 | P05113 | denotes | IL-5 |
T14300 | 44604-44610 | P23771 | denotes | GATA-3 |
T14301 | 44764-44769 | P28562 | denotes | MKP-1 |
T14302 | 44786-44789 | Q16539 | denotes | p38 |
T14303 | 44786-44789 | Q15759 | denotes | p38 |
T14304 | 44786-44789 | P53778 | denotes | p38 |
T14305 | 44786-44789 | O15264 | denotes | p38 |
T14306 | 44835-44841 | P23771 | denotes | GATA-3 |
T14307 | 44889-44895 | P23771 | denotes | GATA-3 |
T14308 | 45258-45264 | P23771 | denotes | GATA-3 |
T16280 | 24399-24405 | P23771 | denotes | GATA-3 |
T16281 | 24431-24434 | P09693 | denotes | CD3 |
T16282 | 24431-24434 | P20963 | denotes | CD3 |
T16283 | 24431-24434 | P04234 | denotes | CD3 |
T16284 | 24431-24434 | P07766 | denotes | CD3 |
T16285 | 24435-24439 | P10747 | denotes | CD28 |
T16286 | 24494-24500 | P23771 | denotes | GATA-3 |
T16287 | 24569-24574 | Q02750 | denotes | MEK-1 |
T16288 | 24782-24788 | P23771 | denotes | GATA-3 |
T16289 | 24805-24808 | P04234 | denotes | CD3 |
T16290 | 24805-24808 | P20963 | denotes | CD3 |
T16291 | 24805-24808 | P07766 | denotes | CD3 |
T16292 | 24805-24808 | P09693 | denotes | CD3 |
T16293 | 24809-24813 | P10747 | denotes | CD28 |
T16294 | 24985-24989 | Q02750 | denotes | MEK1 |
T16295 | 25244-25248 | P05112 | denotes | IL-4 |
T16296 | 25253-25257 | P05113 | denotes | IL-5 |
T16297 | 25277-25280 | P09693 | denotes | CD3 |
T16298 | 25277-25280 | P04234 | denotes | CD3 |
T16299 | 25277-25280 | P07766 | denotes | CD3 |
T16300 | 25277-25280 | P20963 | denotes | CD3 |
T16301 | 25281-25285 | P10747 | denotes | CD28 |
T16302 | 25306-25311 | P04406 | denotes | GAPDH |
T16303 | 25517-25520 | P04234 | denotes | CD3 |
T16304 | 25517-25520 | P20963 | denotes | CD3 |
T16305 | 25517-25520 | P07766 | denotes | CD3 |
T16306 | 25517-25520 | P09693 | denotes | CD3 |
T16307 | 25521-25525 | P10747 | denotes | CD28 |
T16308 | 25581-25584 | P09693 | denotes | CD3 |
T16309 | 25581-25584 | P20963 | denotes | CD3 |
T16310 | 25581-25584 | P04234 | denotes | CD3 |
T16311 | 25581-25584 | P07766 | denotes | CD3 |
T16312 | 25585-25589 | P10747 | denotes | CD28 |
T16313 | 25601-25607 | P23771 | denotes | GATA-3 |
T16314 | 25637-25641 | P05113 | denotes | IL-5 |
T17086 | 26766-26772 | P23771 | denotes | GATA-3 |
T17087 | 26805-26811 | P23771 | denotes | GATA-3 |
T17088 | 26975-26977 | P04150 | denotes | GR |
T17089 | 27038-27040 | P04150 | denotes | GR |
T17090 | 27398-27400 | P04150 | denotes | GR |
T17091 | 27666-27669 | P04234 | denotes | CD3 |
T17092 | 27666-27669 | P07766 | denotes | CD3 |
T17093 | 27666-27669 | P20963 | denotes | CD3 |
T17094 | 27666-27669 | P09693 | denotes | CD3 |
T17095 | 27670-27674 | P10747 | denotes | CD28 |
T17096 | 27741-27747 | P23771 | denotes | GATA-3 |
T17097 | 27971-27975 | P10747 | denotes | CD28 |
T17098 | 27998-28001 | Q9U6Y4 | denotes | GFP |
T17099 | 28009-28015 | P23771 | denotes | GATA-3 |
T17100 | 28094-28097 | P07766 | denotes | CD3 |
T17101 | 28094-28097 | P20963 | denotes | CD3 |
T17102 | 28094-28097 | P04234 | denotes | CD3 |
T17103 | 28094-28097 | P09693 | denotes | CD3 |
T17104 | 28098-28102 | P10747 | denotes | CD28 |
T17820 | 29449-29452 | Q15759 | denotes | p38 |
T17821 | 29449-29452 | Q16539 | denotes | p38 |
T17822 | 29449-29452 | O15264 | denotes | p38 |
T17823 | 29449-29452 | P53778 | denotes | p38 |
T17824 | 29542-29548 | P23771 | denotes | GATA-3 |
T17825 | 29705-29708 | Q16539 | denotes | p38 |
T17826 | 29705-29708 | Q15759 | denotes | p38 |
T17827 | 29705-29708 | P53778 | denotes | p38 |
T17828 | 29705-29708 | O15264 | denotes | p38 |
T17829 | 29722-29725 | P04234 | denotes | CD3 |
T17830 | 29722-29725 | P09693 | denotes | CD3 |
T17831 | 29722-29725 | P07766 | denotes | CD3 |
T17832 | 29722-29725 | P20963 | denotes | CD3 |
T17833 | 29726-29730 | P10747 | denotes | CD28 |
T17834 | 29826-29858 | P15336 | denotes | activated transcription factor 2 |
T17835 | 29860-29865 | P15336 | denotes | ATF-2 |
T17836 | 29881-29884 | Q16539 | denotes | p38 |
T17837 | 29881-29884 | Q15759 | denotes | p38 |
T17838 | 29881-29884 | O15264 | denotes | p38 |
T17839 | 29881-29884 | P53778 | denotes | p38 |
T17840 | 29929-29932 | P53778 | denotes | p38 |
T17841 | 29929-29932 | Q16539 | denotes | p38 |
T17842 | 29929-29932 | Q15759 | denotes | p38 |
T17843 | 29929-29932 | O15264 | denotes | p38 |
T17844 | 29987-29990 | P09693 | denotes | CD3 |
T17845 | 29987-29990 | P20963 | denotes | CD3 |
T17846 | 29987-29990 | P04234 | denotes | CD3 |
T17847 | 29987-29990 | P07766 | denotes | CD3 |
T17848 | 29991-29995 | P10747 | denotes | CD28 |
T17849 | 30053-30059 | P23771 | denotes | GATA-3 |
T17850 | 27971-27975 | P10747 | denotes | CD28 |
T17851 | 30298-30303 | P28562 | denotes | MKP-1 |
T17852 | 30489-30494 | P28562 | denotes | MKP-1 |
T18311 | 31498-31504 | P23771 | denotes | GATA-3 |
T18312 | 31597-31599 | P04150 | denotes | GR |
T18313 | 31652-31654 | P04150 | denotes | GR |
T18314 | 31723-31729 | P23771 | denotes | GATA-3 |
T18315 | 31765-31767 | P04150 | denotes | GR |
T18316 | 31773-31779 | P23771 | denotes | GATA-3 |
T18317 | 31799-31802 | P07766 | denotes | CD3 |
T18318 | 31799-31802 | P20963 | denotes | CD3 |
T18319 | 31799-31802 | P09693 | denotes | CD3 |
T18320 | 31799-31802 | P04234 | denotes | CD3 |
T18321 | 31803-31807 | P10747 | denotes | CD28 |
T18322 | 31844-31846 | P04150 | denotes | GR |
T18323 | 31914-31916 | P04150 | denotes | GR |
T18324 | 31956-31962 | P23771 | denotes | GATA-3 |
T18325 | 31982-31985 | P07766 | denotes | CD3 |
T18326 | 31982-31985 | P04234 | denotes | CD3 |
T18327 | 31982-31985 | P20963 | denotes | CD3 |
T18328 | 31982-31985 | P09693 | denotes | CD3 |
T18329 | 31986-31990 | P10747 | denotes | CD28 |
T18330 | 32098-32104 | P23771 | denotes | GATA-3 |
T18331 | 32171-32177 | P23771 | denotes | GATA-3 |
T18332 | 32252-32254 | P04150 | denotes | GR |
T18333 | 32273-32279 | P23771 | denotes | GATA-3 |
T18898 | 33301-33307 | P23771 | denotes | GATA-3 |
T18899 | 33471-33474 | P09693 | denotes | CD3 |
T18900 | 33471-33474 | P20963 | denotes | CD3 |
T18901 | 33471-33474 | P07766 | denotes | CD3 |
T18902 | 33471-33474 | P04234 | denotes | CD3 |
T18903 | 33475-33479 | P10747 | denotes | CD28 |
T18904 | 33491-33497 | P23771 | denotes | GATA-3 |
T18905 | 25517-25520 | P20963 | denotes | CD3 |
T18906 | 25517-25520 | P09693 | denotes | CD3 |
T18907 | 25517-25520 | P07766 | denotes | CD3 |
T18908 | 25517-25520 | P04234 | denotes | CD3 |
T18909 | 25521-25525 | P10747 | denotes | CD28 |
T18910 | 33716-33722 | P23771 | denotes | GATA-3 |
T18911 | 33750-33753 | Q9U6Y4 | denotes | GFP |
T18912 | 33761-33767 | P23771 | denotes | GATA-3 |
T18913 | 33833-33836 | P20963 | denotes | CD3 |
T18914 | 33833-33836 | P07766 | denotes | CD3 |
T18915 | 33833-33836 | P09693 | denotes | CD3 |
T18916 | 33833-33836 | P04234 | denotes | CD3 |
T18917 | 33837-33841 | P10747 | denotes | CD28 |
T18918 | 33929-33932 | P07766 | denotes | CD3 |
T18919 | 33929-33932 | P04234 | denotes | CD3 |
T18920 | 33929-33932 | P20963 | denotes | CD3 |
T18921 | 33929-33932 | P09693 | denotes | CD3 |
T18922 | 33933-33937 | P10747 | denotes | CD28 |
T18923 | 33991-33994 | P04234 | denotes | CD3 |
T18924 | 33991-33994 | P09693 | denotes | CD3 |
T18925 | 33991-33994 | P07766 | denotes | CD3 |
T18926 | 33991-33994 | P20963 | denotes | CD3 |
T18927 | 33995-33999 | P10747 | denotes | CD28 |
T18928 | 34011-34014 | Q04206 | denotes | p65 |
T18929 | 34011-34014 | P21579 | denotes | p65 |
T19426 | 34820-34826 | P23771 | denotes | GATA-3 |
T19427 | 34859-34865 | P23771 | denotes | GATA-3 |
T19428 | 35061-35067 | P23771 | denotes | GATA-3 |
T19429 | 35442-35448 | P23771 | denotes | GATA-3 |
T19970 | 38015-38021 | P23771 | denotes | GATA-3 |
T19971 | 38140-38142 | P04150 | denotes | GR |
T19972 | 38147-38153 | P23771 | denotes | GATA-3 |
T19973 | 38188-38194 | P23771 | denotes | GATA-3 |
T19974 | 38584-38590 | P23771 | denotes | GATA-3 |
T19975 | 38618-38624 | P23771 | denotes | GATA-3 |
T19976 | 38761-38767 | P23771 | denotes | GATA-3 |
T19977 | 38795-38801 | P23771 | denotes | GATA-3 |
T19978 | 38856-38861 | Q02750 | denotes | MEK-1 |
T19979 | 39296-39299 | Q16539 | denotes | p38 |
T19980 | 39296-39299 | Q15759 | denotes | p38 |
T19981 | 39296-39299 | P53778 | denotes | p38 |
T19982 | 39296-39299 | O15264 | denotes | p38 |
T4464 | 14328-14331 | P04234 | denotes | CD3 |
T4465 | 14328-14331 | P20963 | denotes | CD3 |
T4466 | 14328-14331 | P09693 | denotes | CD3 |
T4467 | 14328-14331 | P07766 | denotes | CD3 |
T4468 | 14332-14336 | P10747 | denotes | CD28 |
T4469 | 14481-14487 | P23771 | denotes | GATA-3 |
T4715 | 14889-14897 | Q04864 | denotes | relative |
T4716 | 14968-14972 | P05112 | denotes | IL-4 |
T5004 | 15363-15365 | P0A7Z4 | denotes | pH |
T5005 | 15633-15639 | P23771 | denotes | GATA-3 |
T5006 | 15857-15863 | P23771 | denotes | GATA-3 |
T5007 | 15887-15889 | P04150 | denotes | GR |
T5008 | 15898-15901 | Q16539 | denotes | p38 |
T5009 | 15898-15901 | Q15759 | denotes | p38 |
T5010 | 15898-15901 | P53778 | denotes | p38 |
T5011 | 15898-15901 | O15264 | denotes | p38 |
T5012 | 15921-15926 | P15336 | denotes | ATF-2 |
T5316 | 16198-16204 | P23771 | denotes | GATA-3 |
T5317 | 16391-16395 | P05113 | denotes | IL-5 |
T6157 | 18143-18146 | Q04206 | denotes | p65 |
T6158 | 18143-18146 | P21579 | denotes | p65 |
T6159 | 18340-18343 | Q04206 | denotes | p65 |
T6160 | 18340-18343 | P21579 | denotes | p65 |
T6484 | 18846-18848 | P04150 | denotes | GR |
T6485 | 18894-18900 | P23771 | denotes | GATA-3 |
T7248 | 20785-20788 | Q9U6Y4 | denotes | GFP |
T7249 | 21108-21111 | P20963 | denotes | CD3 |
T7250 | 21108-21111 | P09693 | denotes | CD3 |
T7251 | 21108-21111 | P07766 | denotes | CD3 |
T7252 | 21108-21111 | P04234 | denotes | CD3 |
T7253 | 21112-21116 | P10747 | denotes | CD28 |
T7469 | 21219-21225 | P23771 | denotes | GATA-3 |
T7470 | 21226-21229 | Q9U6Y4 | denotes | GFP |
T7471 | 21605-21609 | Q13501 | denotes | ORCA |
T7472 | 21610-21612 | P03372 | denotes | ER |
T7690 | 21870-21872 | P41134 | denotes | ID |
T14289 | 43221-43224 | Q16539 | denotes | p38 |
T14290 | 43221-43224 | Q15759 | denotes | p38 |
T14291 | 43221-43224 | O15264 | denotes | p38 |
T14292 | 43221-43224 | P53778 | denotes | p38 |
T14293 | 43310-43316 | P23771 | denotes | GATA-3 |
test2
Id | Subject | Object | Predicate | Lexical cue | Negation | Speculation |
---|---|---|---|---|---|---|
T47 | 0-11 | Negative_regulation | denotes | Suppression | ||
T48 | 15-21 | Protein | denotes | GATA-3 | ||
T49 | 22-29 | Entity | denotes | Nuclear | ||
T50 | 30-36 | Localization | denotes | Import | ||
T51 | 41-56 | Phosphorylation | denotes | Phosphorylation | ||
T52 | 466-472 | Protein | denotes | GATA-3 | ||
T53 | 490-494 | Regulation | denotes | role | ||
T54 | 498-508 | Regulation | denotes | regulating | ||
T55 | 513-523 | Gene_expression | denotes | expression | ||
T56 | 541-559 | Protein | denotes | interleukin (IL)-4 | ||
T57 | 561-565 | Protein | denotes | IL-5 | ||
T58 | 571-576 | Protein | denotes | IL-13 | ||
T59 | 744-751 | Regulation | denotes | effects | ||
T60 | 755-761 | Protein | denotes | GATA-3 | ||
T61 | 850-856 | Protein | denotes | GATA-3 | ||
T62 | 857-867 | Regulation | denotes | regulation | ||
T63 | 1090-1098 | Negative_regulation | denotes | inhibits | ||
T64 | 1099-1106 | Entity | denotes | nuclear | ||
T65 | 1107-1120 | Localization | denotes | translocation | ||
T66 | 1124-1130 | Protein | denotes | GATA-3 | ||
T67 | 1135-1145 | Gene_expression | denotes | expression | ||
T68 | 1179-1190 | Regulation | denotes | independent | ||
T69 | 1236-1247 | Negative_regulation | denotes | competition | ||
T70 | 1256-1262 | Protein | denotes | GATA-3 | ||
T71 | 1278-1287 | Positive_regulation | denotes | activated | ||
T72 | 1288-1311 | Protein | denotes | glucocorticoid receptor | ||
T73 | 1400-1407 | Positive_regulation | denotes | induces | ||
T74 | 1412-1422 | Gene_expression | denotes | expression | ||
T75 | 1426-1479 | Protein | denotes | mitogen-activated protein kinase (MAPK) phosphatase-1 | ||
T76 | 1481-1486 | Protein | denotes | MKP-1 | ||
T77 | 1536-1545 | Positive_regulation | denotes | necessary | ||
T78 | 1550-1556 | Protein | denotes | GATA-3 | ||
T79 | 1557-1564 | Entity | denotes | nuclear | ||
T80 | 1565-1578 | Localization | denotes | translocation | ||
T81 | 1700-1708 | Negative_regulation | denotes | inhibits | ||
T82 | 1709-1715 | Protein | denotes | GATA-3 | ||
T83 | 1716-1723 | Entity | denotes | nuclear | ||
T84 | 1724-1737 | Localization | denotes | translocation | ||
T85 | 1846-1863 | Negative_regulation | denotes | inhibitory effect | ||
T86 | 1867-1873 | Protein | denotes | GATA-3 | ||
T1071 | 7344-7354 | Gene_expression | denotes | expression | ||
T1072 | 7372-7390 | Protein | denotes | interleukin (IL)-4 | ||
T1073 | 7392-7396 | Protein | denotes | IL-5 | ||
T1074 | 7402-7407 | Protein | denotes | IL-13 | ||
T1075 | 7437-7441 | Protein | denotes | IL-4 | ||
T1076 | 7446-7451 | Protein | denotes | IL-13 | ||
T1077 | 7452-7460 | Regulation | denotes | regulate | ||
T1078 | 7465-7475 | Gene_expression | denotes | expression | ||
T1079 | 7511-7515 | Protein | denotes | IL-5 | ||
T1080 | 7585-7594 | Regulation | denotes | regulated | ||
T1081 | 7635-7641 | Protein | denotes | GATA-3 | ||
T1082 | 7666-7675 | Gene_expression | denotes | expressed | ||
T1083 | 7698-7704 | Protein | denotes | GATA-3 | ||
T1084 | 7757-7766 | Positive_regulation | denotes | activates | ||
T1085 | 7771-7780 | Entity | denotes | promoters | ||
T1086 | 7784-7788 | Protein | denotes | IL-4 | ||
T1087 | 7790-7794 | Protein | denotes | IL-5 | ||
T1088 | 7800-7805 | Protein | denotes | IL-13 | ||
T1089 | 7861-7867 | Protein | denotes | GATA-3 | ||
T1090 | 7994-8003 | Negative_regulation | denotes | dominant- | ||
T1091 | 8023-8029 | Protein | denotes | GATA-3 | ||
T1092 | 8088-8094 | Protein | denotes | GATA-3 | ||
T1093 | 8146-8151 | Protein | denotes | Gata3 | ||
T1094 | 8286-8289 | Protein | denotes | CD4 | ||
T1095 | 8318-8327 | Negative_regulation | denotes | knockdown | ||
T1096 | 8331-8337 | Protein | denotes | GATA-3 | ||
T1097 | 8338-8348 | Gene_expression | denotes | expression | ||
T1098 | 8463-8469 | Protein | denotes | GATA-3 | ||
T1099 | 8507-8518 | Localization | denotes | translocate | ||
T1100 | 8547-8554 | Entity | denotes | nucleus | ||
T1101 | 8583-8591 | Positive_regulation | denotes | Enhanced | ||
T1102 | 8592-8599 | Entity | denotes | nuclear | ||
T1103 | 8600-8610 | Localization | denotes | expression | ||
T1104 | 8614-8620 | Protein | denotes | GATA-3 | ||
T1105 | 8621-8630 | Positive_regulation | denotes | following | ||
T1106 | 8647-8657 | Positive_regulation | denotes | activation | ||
T1107 | 8808-8814 | Protein | denotes | GATA-3 | ||
T1108 | 8844-8850 | Localization | denotes | import | ||
T1109 | 8891-8898 | Entity | denotes | nucleus | ||
T1110 | 8914-8920 | Localization | denotes | import | ||
T1111 | 9014-9020 | Protein | denotes | GATA-3 | ||
T1112 | 9185-9194 | Regulation | denotes | regulated | ||
T1113 | 9198-9213 | Phosphorylation | denotes | phosphorylation | ||
T1114 | 9304-9308 | Regulation | denotes | role | ||
T1115 | 9312-9327 | Phosphorylation | denotes | phosphorylating | ||
T1116 | 9328-9334 | Protein | denotes | GATA-3 | ||
T1117 | 9338-9345 | Positive_regulation | denotes | enhance | ||
T1118 | 9350-9361 | Binding | denotes | interaction | ||
T1119 | 9652-9659 | Binding | denotes | binding | ||
T1120 | 9663-9687 | Protein | denotes | glucocorticoid receptors | ||
T1121 | 9689-9692 | Protein | denotes | GRs | true | |
T1122 | 9706-9717 | Localization | denotes | translocate | ||
T1123 | 9725-9732 | Entity | denotes | nucleus | true | |
T1124 | 9744-9752 | Binding | denotes | interact | ||
T1125 | 9865-9874 | Positive_regulation | denotes | activated | true | |
T1126 | 9875-9877 | Protein | denotes | GR | ||
T1127 | 9878-9887 | Binding | denotes | interacts | ||
T1128 | 10076-10087 | Binding | denotes | recruitment | ||
T1129 | 10122-10143 | Protein | denotes | histone deacetylase-2 | ||
T1130 | 10155-10162 | Entity | denotes | Nuclear | ||
T1131 | 10163-10175 | Localization | denotes | localisation | ||
T1132 | 10180-10189 | Localization | denotes | retention | ||
T1133 | 10193-10195 | Protein | denotes | GR | ||
T1134 | 10199-10207 | Positive_regulation | denotes | mediated | ||
T1135 | 10280-10289 | Localization | denotes | retention | ||
T1136 | 10322-10329 | Entity | denotes | nuclear | ||
T1137 | 10330-10336 | Localization | denotes | export | ||
T1138 | 10343-10375 | Protein | denotes | chromosomal region maintenance 1 | ||
T1139 | 10377-10382 | Protein | denotes | CRM-1 | ||
T1140 | 10447-10452 | Binding | denotes | binds | ||
T1141 | 10673-10682 | Positive_regulation | denotes | resulting | ||
T1142 | 10683-10685 | Protein | denotes | GR | ||
T1143 | 10692-10704 | Localization | denotes | translocates | ||
T1144 | 10712-10719 | Entity | denotes | nucleus | ||
T1145 | 10720-10734 | Positive_regulation | denotes | in response to | ||
T1146 | 10752-10763 | Binding | denotes | interaction | ||
T1147 | 10769-10779 | Protein | denotes | importin 7 | ||
T1148 | 10946-10948 | Protein | denotes | GR | ||
T1149 | 10949-10955 | Localization | denotes | import | ||
T1150 | 11016-11026 | Regulation | denotes | regulation | ||
T1151 | 11030-11032 | Protein | denotes | GR | ||
T1152 | 11033-11043 | Positive_regulation | denotes | activation | ||
T1153 | 11048-11055 | Entity | denotes | nuclear | ||
T1154 | 11056-11062 | Localization | denotes | import | ||
T1155 | 11142-11149 | Binding | denotes | binding | ||
T1156 | 11366-11370 | Protein | denotes | IL-4 | ||
T1157 | 11372-11376 | Protein | denotes | IL-5 | ||
T1158 | 11382-11387 | Protein | denotes | IL-13 | ||
T1159 | 11525-11528 | Protein | denotes | CAT | ||
T1160 | 11590-11592 | Protein | denotes | GR | ||
T1161 | 11593-11600 | Negative_regulation | denotes | reduced | ||
T1162 | 11601-11607 | Protein | denotes | GATA-3 | ||
T1163 | 11608-11616 | Positive_regulation | denotes | mediated | ||
T1164 | 11617-11621 | Protein | denotes | IL-5 | ||
T1165 | 11626-11629 | Protein | denotes | -13 | ||
T1166 | 11657-11660 | Protein | denotes | CD4 | ||
T1167 | 11705-11716 | Binding | denotes | recruitment | ||
T1168 | 11720-11722 | Protein | denotes | GR | ||
T1169 | 11727-11732 | Regulation | denotes | alter | ||
T1170 | 11748-11754 | Protein | denotes | GATA-3 | ||
T1171 | 11765-11769 | Binding | denotes | bind | ||
T1172 | 11815-11828 | Positive_regulation | denotes | up-regulation | ||
T1173 | 11974-11980 | Protein | denotes | GATA-3 | ||
T1174 | 11981-11996 | Phosphorylation | denotes | phosphorylation | ||
T1175 | 12001-12008 | Entity | denotes | nuclear | ||
T1176 | 12009-12022 | Localization | denotes | translocation | ||
T1177 | 12221-12227 | Protein | denotes | GATA-3 | ||
T1178 | 12240-12252 | Localization | denotes | localization | ||
T3964 | 13206-13209 | Protein | denotes | CD3 | ||
T3965 | 13211-13215 | Protein | denotes | CD28 | ||
T3966 | 13217-13219 | Protein | denotes | GR | ||
T3967 | 13329-13335 | Protein | denotes | GATA-3 | ||
T3968 | 13347-13349 | Protein | denotes | GR | ||
T3969 | 13523-13528 | Protein | denotes | ATF-2 | ||
T4345 | 14481-14487 | Protein | denotes | GATA-3 | ||
T4346 | 14488-14500 | Localization | denotes | localization | ||
T4613 | 14968-14972 | Protein | denotes | IL-4 | ||
T4844 | 15633-15639 | Protein | denotes | GATA-3 | ||
T5200 | 16391-16395 | Protein | denotes | IL-5 | ||
T5473 | 16679-16681 | Protein | denotes | GR | ||
T5474 | 16682-16688 | Protein | denotes | GATA-3 | ||
T5475 | 16938-16944 | Protein | denotes | GATA-3 | ||
T5476 | 17044-17046 | Protein | denotes | GR | ||
T5477 | 17315-17321 | Protein | denotes | GATA-3 | ||
T5478 | 17422-17424 | Protein | denotes | GR | ||
T5479 | 17819-17825 | Protein | denotes | GATA-3 | ||
T5480 | 17927-17929 | Protein | denotes | GR | ||
T6072 | 18143-18146 | Protein | denotes | p65 | ||
T6270 | 18846-18848 | Protein | denotes | GR | ||
T6747 | 19780-19786 | Protein | denotes | GATA-3 | ||
T6748 | 19787-19790 | Protein | denotes | GFP | ||
T6749 | 19805-19811 | Protein | denotes | GATA-3 | ||
T6750 | 19923-19929 | Protein | denotes | GATA-3 | ||
T6751 | 19951-19957 | Protein | denotes | GATA-3 | ||
T6752 | 19962-19969 | Negative_regulation | denotes | excised | ||
T6753 | 19987-19991 | Protein | denotes | XhoI | ||
T6754 | 20075-20080 | Protein | denotes | BamHI | ||
T6755 | 20161-20167 | Protein | denotes | GATA-3 | ||
T6756 | 20427-20433 | Protein | denotes | GATA-3 | ||
T6757 | 20451-20454 | Protein | denotes | GFP | ||
T6758 | 20494-20499 | Protein | denotes | EcoRI | ||
T6759 | 20533-20539 | Protein | denotes | GATA-3 | ||
T6760 | 20595-20598 | Protein | denotes | GFP | ||
T7349 | 21208-21218 | Gene_expression | denotes | expressing | ||
T7350 | 21219-21229 | Protein | denotes | GATA-3-GFP | ||
T8147 | 23176-23182 | Regulation | denotes | Effect | ||
T8148 | 23205-23211 | Protein | denotes | GATA-3 | ||
T8149 | 23212-23219 | Entity | denotes | Nuclear | ||
T8150 | 23220-23233 | Localization | denotes | Translocation | ||
T8151 | 23238-23242 | Protein | denotes | IL-4 | ||
T8152 | 23281-23291 | Negative_regulation | denotes | inhibiting | ||
T8153 | 23292-23298 | Protein | denotes | GATA-3 | ||
T8154 | 23299-23308 | Regulation | denotes | regulated | true | |
T8155 | 23309-23313 | Protein | denotes | IL-4 | ||
T8156 | 23319-23329 | Gene_expression | denotes | expression | ||
T8157 | 23407-23413 | Regulation | denotes | affect | ||
T8158 | 23428-23438 | Positive_regulation | denotes | stimulated | ||
T8159 | 23439-23446 | Entity | denotes | nuclear | ||
T8160 | 23447-23453 | Localization | denotes | import | ||
T8161 | 23457-23463 | Protein | denotes | GATA-3 | ||
T8162 | 23505-23513 | Positive_regulation | denotes | resulted | ||
T8163 | 23537-23544 | Entity | denotes | nuclear | ||
T8164 | 23545-23551 | Protein | denotes | GATA-3 | ||
T8165 | 23552-23565 | Localization | denotes | translocation | ||
T8166 | 23720-23725 | Protein | denotes | MEK-1 | ||
T8167 | 23791-23800 | Positive_regulation | denotes | sustained | ||
T8168 | 23801-23805 | Negative_regulation | denotes | loss | ||
T8169 | 23809-23816 | Entity | denotes | nuclear | ||
T8170 | 23817-23823 | Protein | denotes | GATA-3 | ||
T8171 | 23824-23834 | Gene_expression | denotes | expression | ||
T8172 | 23839-23850 | Entity | denotes | cytoplasmic | ||
T8173 | 23851-23860 | Localization | denotes | retention | ||
T8174 | 23864-23870 | Protein | denotes | GATA-3 | ||
T8175 | 24124-24134 | Negative_regulation | denotes | reductions | ||
T8176 | 24152-24162 | Positive_regulation | denotes | stimulated | ||
T8177 | 24163-24167 | Protein | denotes | IL-4 | ||
T8178 | 24172-24176 | Protein | denotes | IL-5 | ||
T8179 | 24177-24192 | Transcription | denotes | mRNA expression | ||
T8180 | 24211-24215 | Negative_regulation | denotes | loss | ||
T8181 | 24219-24225 | Protein | denotes | GATA-3 | ||
T8182 | 24226-24233 | Binding | denotes | binding | ||
T8183 | 24248-24252 | Protein | denotes | IL-5 | ||
T8184 | 24253-24261 | Entity | denotes | promoter | ||
T8891 | 25831-25840 | Positive_regulation | denotes | Activated | ||
T8892 | 25841-25843 | Protein | denotes | GR | ||
T8893 | 25858-25864 | Protein | denotes | GATA-3 | ||
T8894 | 25945-25954 | Positive_regulation | denotes | activated | ||
T8895 | 25955-25957 | Protein | denotes | GR | ||
T8896 | 25969-25975 | Protein | denotes | GATA-3 | ||
T8897 | 26000-26007 | Entity | denotes | nuclear | ||
T8898 | 26008-26014 | Localization | denotes | import | ||
T8899 | 26040-26051 | Binding | denotes | interaction | ||
T8900 | 26060-26062 | Protein | denotes | GR | ||
T8901 | 26173-26175 | Protein | denotes | GR | ||
T8902 | 26176-26183 | Entity | denotes | nuclear | ||
T8903 | 26184-26197 | Localization | denotes | translocation | ||
T8904 | 26335-26344 | Negative_regulation | denotes | decreased | ||
T8905 | 26349-26360 | Binding | denotes | association | ||
T8906 | 26369-26375 | Protein | denotes | GATA-3 | ||
T8907 | 26391-26398 | Positive_regulation | denotes | induced | ||
T8908 | 26496-26515 | Protein | denotes | GFP-labelled GATA-3 | ||
T8909 | 26561-26567 | Protein | denotes | GATA-3 | ||
T8910 | 26568-26575 | Entity | denotes | nuclear | ||
T8911 | 26576-26582 | Localization | denotes | import | ||
T8912 | 26583-26592 | Positive_regulation | denotes | following | ||
T8913 | 26634-26644 | Negative_regulation | denotes | attenuated | ||
T9488 | 28251-28257 | Regulation | denotes | Effect | ||
T9489 | 28398-28403 | Protein | denotes | MKP-1 | ||
T9490 | 28405-28423 | Protein | denotes | MAPK phosphatase-1 | ||
T9491 | 28629-28644 | Phosphorylation | denotes | phosphorylation | ||
T9492 | 28670-28675 | Protein | denotes | ATF-2 | ||
T9493 | 28797-28804 | Negative_regulation | denotes | reduced | ||
T9494 | 28805-28811 | Protein | denotes | GATA-3 | ||
T9495 | 28812-28818 | Entity | denotes | serine | ||
T9496 | 28819-28834 | Phosphorylation | denotes | phosphorylation | ||
T9497 | 28835-28842 | Positive_regulation | denotes | induced | ||
T9498 | 28941-28950 | Negative_regulation | denotes | reduction | ||
T9499 | 28954-28960 | Protein | denotes | GATA-3 | ||
T9500 | 28961-28976 | Phosphorylation | denotes | phosphorylation | ||
T9501 | 29055-29062 | Positive_regulation | denotes | induced | ||
T9502 | 29063-29068 | Protein | denotes | MKP-1 | ||
T9503 | 29201-29208 | Regulation | denotes | effects | ||
T9504 | 29218-29224 | Protein | denotes | GATA-3 | ||
T9505 | 29225-29232 | Entity | denotes | nuclear | ||
T9506 | 29233-29239 | Localization | denotes | import | ||
T9507 | 29252-29263 | Binding | denotes | association | ||
T9508 | 29268-29272 | Protein | denotes | IL-4 | ||
T9509 | 29273-29288 | Transcription | denotes | mRNA expression | ||
T9510 | 30735-30744 | Positive_regulation | denotes | activated | ||
T9511 | 30745-30751 | Protein | denotes | GATA-3 | ||
T9512 | 30769-30778 | Positive_regulation | denotes | activated | ||
T9513 | 30779-30781 | Protein | denotes | GR | ||
T9514 | 30804-30813 | Positive_regulation | denotes | activated | true | |
T9515 | 30814-30816 | Protein | denotes | GR | ||
T9516 | 30831-30840 | Positive_regulation | denotes | increased | ||
T9517 | 30841-30843 | Protein | denotes | GR | true | |
T9518 | 30855-30866 | Binding | denotes | association | ||
T9519 | 30887-30894 | Negative_regulation | denotes | absence | ||
T9520 | 30898-30907 | Positive_regulation | denotes | activated | ||
T9521 | 30908-30914 | Protein | denotes | GATA-3 | ||
T9522 | 30961-30970 | Positive_regulation | denotes | activated | ||
T9523 | 30971-30977 | Protein | denotes | GATA-3 | ||
T9524 | 30986-30991 | Negative_regulation | denotes | block | ||
T9525 | 30992-30994 | Protein | denotes | GR | ||
T9526 | 31006-31017 | Binding | denotes | association | ||
T9527 | 31065-31074 | Positive_regulation | denotes | activated | ||
T9528 | 31075-31077 | Protein | denotes | GR | true | |
T9529 | 31082-31089 | Phosphorylation | denotes | phospho | ||
T9530 | 31090-31096 | Protein | denotes | GATA-3 | ||
T9531 | 31110-31119 | Binding | denotes | associate | ||
T9532 | 31157-31166 | Positive_regulation | denotes | activated | ||
T9533 | 31167-31169 | Protein | denotes | GR | ||
T9534 | 31170-31180 | Negative_regulation | denotes | attenuates | ||
T9535 | 31185-31192 | Phosphorylation | denotes | phospho | ||
T9536 | 31193-31199 | Protein | denotes | GATA-3 | true | |
T9537 | 31211-31222 | Binding | denotes | interaction | ||
T9538 | 31242-31251 | Regulation | denotes | dependent | ||
T9539 | 31308-31317 | Positive_regulation | denotes | activated | true | |
T9540 | 31318-31320 | Protein | denotes | GR | ||
T9541 | 31325-31332 | Negative_regulation | denotes | compete | true | |
T9542 | 31338-31345 | Phosphorylation | denotes | phospho | ||
T9543 | 31346-31352 | Protein | denotes | GATA-3 | ||
T9544 | 31380-31385 | Negative_regulation | denotes | limit | true | |
T9545 | 31386-31392 | Protein | denotes | GATA-3 | ||
T9546 | 31393-31400 | Entity | denotes | nuclear | ||
T9547 | 31401-31407 | Localization | denotes | import | ||
T9548 | 32560-32566 | Regulation | denotes | effect | true | |
T9549 | 32576-32582 | Protein | denotes | GATA-3 | ||
T9550 | 32583-32590 | Entity | denotes | nuclear | ||
T9551 | 32591-32597 | Localization | denotes | export | ||
T9552 | 32605-32616 | Protein_catabolism | denotes | degradation | ||
T9553 | 32638-32646 | Negative_regulation | denotes | inhibits | ||
T9554 | 32655-32661 | Localization | denotes | export | ||
T9555 | 32671-32677 | Regulation | denotes | affect | ||
T9556 | 32699-32704 | Negative_regulation | denotes | block | ||
T9557 | 32705-32711 | Protein | denotes | GATA-3 | ||
T9558 | 32712-32719 | Entity | denotes | nuclear | ||
T9559 | 32720-32732 | Localization | denotes | localization | ||
T9560 | 32770-32776 | Regulation | denotes | effect | ||
T9561 | 32791-32797 | Protein | denotes | GATA-3 | ||
T9562 | 32798-32808 | Gene_expression | denotes | expression | ||
T9563 | 32917-32924 | Entity | denotes | nuclear | ||
T9564 | 32925-32938 | Localization | denotes | translocation | ||
T9565 | 32939-32945 | Regulation | denotes | affect | ||
T9566 | 32946-32952 | Protein | denotes | GATA-3 | ||
T9567 | 32953-32960 | Entity | denotes | nuclear | ||
T9568 | 32961-32970 | Localization | denotes | residency | ||
T9569 | 33000-33009 | Positive_regulation | denotes | activated | ||
T9570 | 33010-33012 | Protein | denotes | GR | ||
T9571 | 33022-33029 | Positive_regulation | denotes | enhance | ||
T9572 | 33030-33036 | Protein | denotes | GATA-3 | ||
T9573 | 33037-33044 | Entity | denotes | nuclear | ||
T9574 | 33045-33051 | Localization | denotes | export | ||
T9575 | 33066-33072 | Regulation | denotes | effect | ||
T9576 | 33082-33088 | Protein | denotes | GATA-3 | ||
T9577 | 33089-33096 | Entity | denotes | nuclear | ||
T9578 | 33097-33103 | Localization | denotes | import | ||
T9579 | 33150-33156 | Regulation | denotes | effect | ||
T9580 | 33160-33163 | Protein | denotes | p65 | ||
T9581 | 33164-33171 | Entity | denotes | nuclear | ||
T9582 | 33172-33185 | Localization | denotes | translocation | ||
T11160 | 34284-34290 | Regulation | denotes | Effect | ||
T11161 | 34313-34319 | Protein | denotes | GATA-3 | ||
T11162 | 34320-34327 | Entity | denotes | Nuclear | ||
T11163 | 34328-34340 | Localization | denotes | Localization | ||
T11164 | 34441-34450 | Regulation | denotes | dependent | ||
T11165 | 34451-34459 | Negative_regulation | denotes | decrease | ||
T11166 | 34474-34485 | Binding | denotes | interaction | ||
T11167 | 34494-34501 | Phosphorylation | denotes | phospho | ||
T11168 | 34502-34508 | Protein | denotes | GATA-3 | ||
T11169 | 34603-34612 | Negative_regulation | denotes | inhibited | ||
T11170 | 34681-34691 | Negative_regulation | denotes | attenuated | ||
T11171 | 35753-35763 | Negative_regulation | denotes | suppresses | ||
T11172 | 35764-35768 | Protein | denotes | IL-4 | ||
T11173 | 35773-35775 | Protein | denotes | -5 | ||
T11174 | 35781-35791 | Gene_expression | denotes | expression | ||
T11175 | 35796-35806 | Negative_regulation | denotes | attenuated | ||
T11176 | 35811-35822 | Binding | denotes | interaction | ||
T11177 | 35826-35832 | Protein | denotes | GATA-3 | ||
T11178 | 36078-36085 | Negative_regulation | denotes | reduced | ||
T11179 | 36086-36092 | Protein | denotes | GATA-3 | ||
T11180 | 36104-36115 | Binding | denotes | interaction | ||
T11181 | 36134-36143 | Regulation | denotes | dependent | ||
T11182 | 36173-36181 | Negative_regulation | denotes | decrease | ||
T11183 | 36185-36191 | Protein | denotes | GATA-3 | true | |
T11184 | 36203-36214 | Binding | denotes | association | ||
T11185 | 36483-36489 | Protein | denotes | GATA-3 | ||
T11186 | 36501-36512 | Binding | denotes | association | ||
T11187 | 36599-36609 | Negative_regulation | denotes | attenuated | ||
T11188 | 36610-36621 | Binding | denotes | interaction | true | |
T11189 | 36625-36631 | Protein | denotes | GATA-3 | ||
T11190 | 36708-36716 | Negative_regulation | denotes | decrease | ||
T11191 | 36847-36853 | Regulation | denotes | affect | ||
T11192 | 36863-36875 | Localization | denotes | localization | ||
T11193 | 36879-36885 | Protein | denotes | GATA-3 | ||
T11194 | 36972-36981 | Positive_regulation | denotes | increased | ||
T11195 | 36982-36984 | Protein | denotes | GR | ||
T11196 | 36985-36992 | Entity | denotes | nuclear | ||
T11197 | 36993-37006 | Localization | denotes | translocation | ||
T11198 | 37069-37075 | Protein | denotes | GATA-3 | ||
T11199 | 37424-37431 | Positive_regulation | denotes | induced | ||
T11200 | 37444-37448 | Negative_regulation | denotes | loss | ||
T11201 | 37460-37466 | Protein | denotes | GATA-3 | ||
T11202 | 37603-37609 | Protein | denotes | GATA-3 | ||
T11203 | 37622-37630 | Positive_regulation | denotes | enhanced | ||
T11204 | 39467-39474 | Negative_regulation | denotes | reduces | ||
T11205 | 39475-39482 | Entity | denotes | nuclear | ||
T11206 | 39483-39495 | Localization | denotes | localization | ||
T11207 | 39499-39505 | Protein | denotes | GATA-3 | ||
T11208 | 39525-39535 | Negative_regulation | denotes | inhibiting | ||
T11209 | 39536-39543 | Phosphorylation | denotes | phospho | ||
T11210 | 39544-39550 | Protein | denotes | GATA-3 | ||
T11211 | 39560-39571 | Binding | denotes | association | ||
T11212 | 39679-39685 | Regulation | denotes | effect | ||
T11213 | 39698-39706 | Positive_regulation | denotes | mediated | ||
T11214 | 39707-39713 | Protein | denotes | GATA-3 | ||
T11215 | 39714-39729 | Phosphorylation | denotes | phosphorylation | ||
T11216 | 39740-39749 | Positive_regulation | denotes | induction | ||
T11217 | 39753-39758 | Protein | denotes | MKP-1 | ||
T11218 | 39832-39843 | Negative_regulation | denotes | suppression | ||
T11219 | 39847-39853 | Protein | denotes | GATA-3 | ||
T11220 | 39854-39861 | Entity | denotes | nuclear | ||
T11221 | 39862-39868 | Localization | denotes | import | ||
T13008 | 40009-40016 | Negative_regulation | denotes | inhibit | ||
T13009 | 40017-40023 | Protein | denotes | GATA-3 | ||
T13010 | 40157-40166 | Positive_regulation | denotes | activated | ||
T13011 | 40167-40169 | Protein | denotes | GR | ||
T13012 | 40194-40203 | Positive_regulation | denotes | activated | ||
T13013 | 40204-40210 | Protein | denotes | GATA-3 | ||
T13014 | 40215-40222 | Entity | denotes | nuclear | ||
T13015 | 40223-40229 | Localization | denotes | import | ||
T13016 | 40230-40233 | Positive_regulation | denotes | via | ||
T13017 | 40255-40263 | Positive_regulation | denotes | required | ||
T13018 | 40272-40279 | Entity | denotes | nuclear | ||
T13019 | 40280-40289 | Localization | denotes | transport | ||
T13020 | 40298-40304 | Protein | denotes | GATA-3 | ||
T13021 | 40309-40311 | Protein | denotes | GR | ||
T13022 | 40364-40372 | Positive_regulation | denotes | increase | ||
T13023 | 40377-40387 | Gene_expression | denotes | expression | ||
T13024 | 40391-40396 | Protein | denotes | MKP-1 | ||
T13025 | 40512-40519 | Negative_regulation | denotes | prevent | ||
T13026 | 40524-40539 | Phosphorylation | denotes | phosphorylation | ||
T13027 | 40543-40549 | Protein | denotes | GATA-3 | ||
T13028 | 40558-40567 | Positive_regulation | denotes | necessary | ||
T13029 | 40572-40583 | Binding | denotes | interaction | ||
T13030 | 40615-40622 | Entity | denotes | nuclear | true | |
T13031 | 40623-40629 | Localization | denotes | import | ||
T13032 | 40661-40674 | Localization | denotes | translocation | ||
T13033 | 40678-40684 | Protein | denotes | GATA-3 | ||
T13034 | 40711-40718 | Entity | denotes | nucleus | ||
T13035 | 40719-40727 | Positive_regulation | denotes | involves | ||
T13036 | 40778-40787 | Binding | denotes | interacts | ||
T13037 | 40793-40807 | Phosphorylation | denotes | phosphorylated | ||
T13038 | 40808-40814 | Protein | denotes | GATA-3 | ||
T13039 | 40859-40865 | Protein | denotes | GATA-3 | ||
T13040 | 40866-40875 | Negative_regulation | denotes | knockdown | ||
T13041 | 40899-40910 | Negative_regulation | denotes | suppression | ||
T13042 | 40928-40938 | Positive_regulation | denotes | stimulated | true | |
T13043 | 40939-40943 | Protein | denotes | IL-4 | ||
T13044 | 40944-40948 | Protein | denotes | IL-5 | ||
T13045 | 40949-40953 | Transcription | denotes | mRNA | ||
T13046 | 40954-40963 | Positive_regulation | denotes | induction | ||
T13047 | 40995-40999 | Regulation | denotes | role | ||
T13048 | 41004-41010 | Protein | denotes | GATA-3 | ||
T13049 | 41092-41094 | Protein | denotes | GR | true | |
T13050 | 41114-41121 | Entity | denotes | nuclear | ||
T13051 | 41122-41128 | Localization | denotes | import | ||
T13052 | 41142-41148 | Protein | denotes | GATA-3 | true | |
T13053 | 41217-41226 | Positive_regulation | denotes | activated | ||
T13054 | 41227-41229 | Protein | denotes | GR | ||
T13055 | 41234-41241 | Phosphorylation | denotes | phospho | true | |
T13056 | 41242-41248 | Protein | denotes | GATA-3 | ||
T13057 | 41253-41260 | Entity | denotes | nuclear | true | |
T13058 | 41261-41267 | Localization | denotes | import | ||
T13059 | 41323-41330 | Binding | denotes | binding | ||
T13060 | 41348-41357 | Positive_regulation | denotes | activated | ||
T13061 | 41358-41360 | Protein | denotes | GR | ||
T13062 | 41366-41373 | Phosphorylation | denotes | phospho | ||
T13063 | 41374-41380 | Protein | denotes | GATA-3 | ||
T13064 | 41427-41433 | Negative_regulation | denotes | reduce | ||
T13065 | 41434-41440 | Protein | denotes | GATA-3 | true | |
T13066 | 41441-41446 | Binding | denotes | entry | ||
T13067 | 41597-41603 | Protein | denotes | GATA-3 | ||
T13068 | 41608-41615 | Entity | denotes | nuclear | true | |
T13069 | 41616-41629 | Localization | denotes | translocation | ||
T13070 | 41637-41640 | Protein | denotes | p65 | ||
T13071 | 41666-41674 | Regulation | denotes | affected | ||
T13072 | 41752-41758 | Regulation | denotes | effect | ||
T13073 | 41768-41774 | Protein | denotes | GATA-3 | ||
T13074 | 41775-41782 | Entity | denotes | nuclear | ||
T13075 | 41783-41792 | Localization | denotes | exclusion | ||
T13076 | 41827-41835 | Positive_regulation | denotes | enhances | ||
T13077 | 41836-41842 | Protein | denotes | GATA-3 | ||
T13078 | 41843-41850 | Entity | denotes | nuclear | ||
T13079 | 41851-41857 | Localization | denotes | export | true | |
T13080 | 41870-41877 | Positive_regulation | denotes | induces | ||
T13081 | 41878-41884 | Protein | denotes | GATA-3 | ||
T13082 | 41885-41896 | Protein_catabolism | denotes | degradation | ||
T13083 | 41985-41994 | Positive_regulation | denotes | activated | ||
T13084 | 41995-41997 | Protein | denotes | GR | true | true |
T13085 | 42010-42019 | Negative_regulation | denotes | attenuate | ||
T13086 | 42029-42036 | Phosphorylation | denotes | phospho | ||
T13087 | 42037-42043 | Protein | denotes | GATA-3 | ||
T13088 | 42055-42066 | Binding | denotes | association | ||
T13089 | 42142-42149 | Phosphorylation | denotes | phospho | ||
T13090 | 42150-42156 | Protein | denotes | GATA-3 | ||
T13091 | 42161-42170 | Binding | denotes | associate | ||
T13092 | 42368-42378 | Positive_regulation | denotes | contribute | ||
T13093 | 42386-42395 | Negative_regulation | denotes | reduction | ||
T13094 | 42399-42405 | Protein | denotes | GATA-3 | ||
T13095 | 42406-42413 | Entity | denotes | nuclear | ||
T13096 | 42414-42420 | Localization | denotes | import | ||
T13097 | 42521-42526 | Protein | denotes | MKP-1 | ||
T13098 | 42527-42536 | Positive_regulation | denotes | induction | ||
T13099 | 42597-42606 | Positive_regulation | denotes | induction | ||
T13100 | 42610-42615 | Protein | denotes | MKP-1 | ||
T13101 | 42698-42707 | Positive_regulation | denotes | induction | ||
T13102 | 42711-42716 | Protein | denotes | MKP-1 | ||
T13103 | 42722-42731 | Positive_regulation | denotes | following | ||
T13104 | 42827-42836 | Positive_regulation | denotes | induction | ||
T13105 | 42840-42845 | Protein | denotes | MKP-1 | ||
T13106 | 42850-42856 | Negative_regulation | denotes | reduce | ||
T13107 | 42857-42863 | Protein | denotes | GATA-3 | ||
T13108 | 42864-42871 | Entity | denotes | nuclear | ||
T13109 | 42872-42878 | Localization | denotes | import | ||
T13110 | 42916-42926 | Positive_regulation | denotes | subsequent | ||
T13111 | 42927-42933 | Protein | denotes | GATA-3 | ||
T13112 | 42934-42949 | Phosphorylation | denotes | phosphorylation | ||
T13113 | 42956-42966 | Negative_regulation | denotes | preventing | ||
T13114 | 42967-42974 | Entity | denotes | nuclear | ||
T13115 | 42975-42988 | Localization | denotes | translocation | ||
T13116 | 43010-43024 | Entity | denotes | serine residue | ||
T13117 | 43031-43037 | Protein | denotes | GATA-3 | ||
T13118 | 43047-43061 | Phosphorylation | denotes | phosphorylated | ||
T13119 | 43310-43316 | Protein | denotes | GATA-3 | ||
T13120 | 43317-43324 | Entity | denotes | nuclear | ||
T13121 | 43325-43331 | Localization | denotes | import | ||
T13122 | 43477-43487 | Negative_regulation | denotes | inhibitory | ||
T13123 | 43488-43494 | Regulation | denotes | effect | ||
T13124 | 43508-43518 | Gene_expression | denotes | expression | ||
T13125 | 43522-43526 | Protein | denotes | IL-4 | ||
T13126 | 43684-43692 | Negative_regulation | denotes | suppress | ||
T13127 | 43693-43697 | Protein | denotes | IL-4 | ||
T13128 | 43698-43711 | Transcription | denotes | transcription | ||
T13129 | 43841-43849 | Positive_regulation | denotes | required | ||
T13130 | 43854-43860 | Protein | denotes | GATA-3 | ||
T13131 | 43861-43871 | Negative_regulation | denotes | inhibition | ||
T13132 | 43998-44008 | Negative_regulation | denotes | inhibiting | ||
T13133 | 44009-44015 | Protein | denotes | GATA-3 | ||
T13134 | 44343-44351 | Negative_regulation | denotes | suppress | ||
T13135 | 44352-44356 | Protein | denotes | IL-4 | ||
T13136 | 44361-44365 | Protein | denotes | IL-5 | ||
T13137 | 44366-44373 | Localization | denotes | release | ||
T13138 | 44594-44600 | Regulation | denotes | effect | ||
T13139 | 44604-44610 | Protein | denotes | GATA-3 | ||
T13140 | 44611-44618 | Entity | denotes | nuclear | ||
T13141 | 44619-44632 | Localization | denotes | translocation | ||
T13142 | 44649-44656 | Binding | denotes | binding | ||
T13143 | 44671-44678 | Entity | denotes | nuclear | ||
T13144 | 44679-44685 | Localization | denotes | import | ||
T13145 | 44741-44750 | Positive_regulation | denotes | increased | ||
T13146 | 44751-44760 | Gene_expression | denotes | synthesis | ||
T13147 | 44764-44769 | Protein | denotes | MKP-1 | ||
T13148 | 44801-44811 | Negative_regulation | denotes | preventing | ||
T13149 | 44816-44831 | Phosphorylation | denotes | phosphorylation | ||
T13150 | 44835-44841 | Protein | denotes | GATA-3 | ||
T13151 | 44850-44859 | Positive_regulation | denotes | necessary | ||
T13152 | 44864-44871 | Entity | denotes | nuclear | ||
T13153 | 44872-44885 | Localization | denotes | translocation | ||
T13154 | 44889-44895 | Protein | denotes | GATA-3 | ||
T13155 | 45236-45246 | Negative_regulation | denotes | Prevention | ||
T13156 | 45250-45257 | Phosphorylation | denotes | phospho | ||
T13157 | 45258-45264 | Protein | denotes | GATA-3 | ||
T13158 | 45265-45276 | Binding | denotes | interaction | ||
T15975 | 24390-24398 | Negative_regulation | denotes | inhibits | ||
T15976 | 24399-24405 | Protein | denotes | GATA-3 | ||
T15977 | 24406-24413 | Entity | denotes | nuclear | ||
T15978 | 24414-24420 | Localization | denotes | import | ||
T15979 | 24477-24490 | Localization | denotes | translocation | ||
T15980 | 24494-24500 | Protein | denotes | GATA-3 | ||
T15981 | 24527-24534 | Entity | denotes | nucleus | ||
T15982 | 24569-24574 | Protein | denotes | MEK-1 | ||
T15983 | 24749-24757 | Negative_regulation | denotes | impaired | ||
T15984 | 24758-24765 | Entity | denotes | nuclear | ||
T15985 | 24766-24778 | Localization | denotes | localization | ||
T15986 | 24782-24788 | Protein | denotes | GATA-3 | ||
T15987 | 24789-24796 | Positive_regulation | denotes | induced | ||
T15988 | 24985-24989 | Protein | denotes | MEK1 | ||
T15989 | 25235-25243 | Negative_regulation | denotes | inhibits | ||
T15990 | 25244-25248 | Protein | denotes | IL-4 | ||
T15991 | 25253-25257 | Protein | denotes | IL-5 | ||
T15992 | 25258-25273 | Transcription | denotes | mRNA expression | ||
T15993 | 25277-25280 | Protein | denotes | CD3 | ||
T15994 | 25281-25285 | Protein | denotes | CD28 | ||
T15995 | 25553-25560 | Negative_regulation | denotes | reduces | ||
T15996 | 25590-25600 | Positive_regulation | denotes | stimulated | ||
T15997 | 25601-25607 | Protein | denotes | GATA-3 | ||
T15998 | 25611-25620 | Binding | denotes | associate | ||
T15999 | 25637-25641 | Protein | denotes | IL-5 | ||
T16765 | 26758-26765 | Negative_regulation | denotes | reduces | ||
T16766 | 26766-26772 | Protein | denotes | GATA-3 | ||
T16767 | 26773-26784 | Binding | denotes | association | ||
T16768 | 26805-26811 | Protein | denotes | GATA-3 | ||
T16769 | 26812-26819 | Entity | denotes | nuclear | ||
T16770 | 26820-26826 | Localization | denotes | import | ||
T16771 | 26939-26948 | Regulation | denotes | dependent | ||
T16772 | 26949-26958 | Positive_regulation | denotes | induction | ||
T16773 | 26965-26974 | Positive_regulation | denotes | activated | ||
T16774 | 26975-26977 | Protein | denotes | GR | ||
T16775 | 26978-26989 | Binding | denotes | interaction | ||
T16776 | 27038-27040 | Protein | denotes | GR | ||
T16777 | 27041-27052 | Binding | denotes | association | ||
T16778 | 27362-27371 | Regulation | denotes | dependent | ||
T16779 | 27372-27381 | Positive_regulation | denotes | induction | ||
T16780 | 27388-27397 | Positive_regulation | denotes | activated | ||
T16781 | 27398-27400 | Protein | denotes | GR | ||
T16782 | 27401-27408 | Entity | denotes | nuclear | ||
T16783 | 27409-27422 | Localization | denotes | translocation | ||
T16784 | 27719-27728 | Regulation | denotes | dependent | ||
T16785 | 27729-27737 | Negative_regulation | denotes | decrease | ||
T16786 | 27741-27747 | Protein | denotes | GATA-3 | ||
T16787 | 27759-27770 | Binding | denotes | association | ||
T16788 | 28009-28015 | Protein | denotes | GATA-3 | ||
T17567 | 29523-29538 | Negative_regulation | denotes | down-regulation | ||
T17568 | 29542-29548 | Protein | denotes | GATA-3 | ||
T17569 | 29549-29555 | Entity | denotes | serine | ||
T17570 | 29556-29571 | Phosphorylation | denotes | phosphorylation | ||
T17571 | 29782-29788 | Regulation | denotes | effect | ||
T17572 | 29807-29822 | Phosphorylation | denotes | phosphorylation | ||
T17573 | 29826-29858 | Protein | denotes | activated transcription factor 2 | ||
T17574 | 29860-29865 | Protein | denotes | ATF-2 | ||
T17575 | 30011-30018 | Positive_regulation | denotes | induced | ||
T17576 | 30019-30025 | Entity | denotes | serine | ||
T17577 | 30026-30041 | Phosphorylation | denotes | phosphorylation | ||
T17578 | 30053-30059 | Protein | denotes | GATA-3 | ||
T17579 | 30290-30297 | Positive_regulation | denotes | induced | ||
T17580 | 30298-30303 | Protein | denotes | MKP-1 | ||
T17581 | 30481-30488 | Positive_regulation | denotes | induces | ||
T17582 | 30489-30494 | Protein | denotes | MKP-1 | ||
T18248 | 31490-31497 | Phosphorylation | denotes | phospho | ||
T18249 | 31498-31504 | Protein | denotes | GATA-3 | ||
T18250 | 31597-31599 | Protein | denotes | GR | ||
T18251 | 31643-31651 | Positive_regulation | denotes | enhances | ||
T18252 | 31652-31654 | Protein | denotes | GR | true | |
T18253 | 31666-31673 | Binding | denotes | binding | ||
T18254 | 31698-31705 | Negative_regulation | denotes | absence | ||
T18255 | 31713-31722 | Positive_regulation | denotes | activated | ||
T18256 | 31723-31729 | Protein | denotes | GATA-3 | ||
T18257 | 31755-31764 | Positive_regulation | denotes | activated | ||
T18258 | 31765-31767 | Protein | denotes | GR | ||
T18259 | 31773-31779 | Protein | denotes | GATA-3 | ||
T18260 | 31834-31843 | Negative_regulation | denotes | attenuate | ||
T18261 | 31844-31846 | Protein | denotes | GR | true | |
T18262 | 31858-31869 | Binding | denotes | association | ||
T18263 | 31904-31913 | Positive_regulation | denotes | Activated | ||
T18264 | 31914-31916 | Protein | denotes | GR | ||
T18265 | 31956-31962 | Protein | denotes | GATA-3 | ||
T18266 | 32008-32019 | Binding | denotes | interacting | ||
T18267 | 32098-32104 | Protein | denotes | GATA-3 | ||
T18268 | 32160-32170 | Positive_regulation | denotes | stimulated | ||
T18269 | 32171-32177 | Protein | denotes | GATA-3 | ||
T18270 | 32187-32194 | Binding | denotes | binding | ||
T18271 | 32204-32210 | Regulation | denotes | effect | ||
T18272 | 32214-32223 | Positive_regulation | denotes | activated | ||
T18273 | 32252-32254 | Protein | denotes | GR | ||
T18274 | 32258-32269 | Negative_regulation | denotes | attenuation | ||
T18275 | 32273-32279 | Protein | denotes | GATA-3 | ||
T18276 | 32291-32302 | Binding | denotes | association | ||
T18277 | 32321-32330 | Regulation | denotes | dependent | ||
T18676 | 33294-33300 | Regulation | denotes | affect | true | |
T18677 | 33301-33307 | Protein | denotes | GATA-3 | ||
T18678 | 33308-33315 | Entity | denotes | nuclear | true | |
T18679 | 33316-33322 | Localization | denotes | export | ||
T18680 | 33421-33427 | Regulation | denotes | affect | ||
T18681 | 33458-33465 | Negative_regulation | denotes | prevent | ||
T18682 | 33480-33490 | Positive_regulation | denotes | stimulated | true | |
T18683 | 33491-33497 | Protein | denotes | GATA-3 | ||
T18684 | 33498-33505 | Entity | denotes | nuclear | true | |
T18685 | 33506-33518 | Localization | denotes | localization | ||
T18686 | 33698-33704 | Regulation | denotes | affect | ||
T18687 | 33716-33722 | Protein | denotes | GATA-3 | ||
T18688 | 33723-33734 | Protein_catabolism | denotes | degradation | ||
T18689 | 33761-33767 | Protein | denotes | GATA-3 | ||
T18690 | 33978-33985 | Negative_regulation | denotes | prevent | ||
T18691 | 34000-34010 | Positive_regulation | denotes | stimulated | ||
T18692 | 34011-34014 | Protein | denotes | p65 | ||
T18693 | 34015-34022 | Entity | denotes | nuclear | ||
T18694 | 34023-34036 | Localization | denotes | translocation | ||
T19261 | 34812-34819 | Negative_regulation | denotes | impairs | ||
T19262 | 34820-34826 | Protein | denotes | GATA-3 | ||
T19263 | 34827-34838 | Binding | denotes | interaction | ||
T19264 | 34859-34865 | Protein | denotes | GATA-3 | ||
T19265 | 34866-34873 | Entity | denotes | nuclear | ||
T19266 | 34874-34886 | Localization | denotes | localization | ||
T19267 | 35032-35040 | Negative_regulation | denotes | impaired | ||
T19268 | 35041-35052 | Binding | denotes | interaction | ||
T19269 | 35061-35067 | Protein | denotes | GATA-3 | ||
T19270 | 35412-35421 | Negative_regulation | denotes | decreased | ||
T19271 | 35422-35433 | Binding | denotes | association | ||
T19272 | 35442-35448 | Protein | denotes | GATA-3 | ||
T19670 | 38007-38014 | Negative_regulation | denotes | impairs | ||
T19671 | 38015-38021 | Protein | denotes | GATA-3 | ||
T19672 | 38022-38029 | Entity | denotes | nuclear | ||
T19673 | 38030-38042 | Localization | denotes | localization | ||
T19674 | 38140-38142 | Protein | denotes | GR | ||
T19675 | 38147-38153 | Protein | denotes | GATA-3 | ||
T19676 | 38154-38161 | Entity | denotes | nuclear | ||
T19677 | 38162-38174 | Localization | denotes | localisation | ||
T19678 | 38188-38194 | Protein | denotes | GATA-3 | ||
T19679 | 38540-38549 | Regulation | denotes | dependent | ||
T19680 | 38550-38558 | Negative_regulation | denotes | decrease | ||
T19681 | 38562-38569 | Entity | denotes | nuclear | ||
T19682 | 38570-38580 | Gene_expression | denotes | expression | ||
T19683 | 38584-38590 | Protein | denotes | GATA-3 | ||
T19684 | 38596-38605 | Positive_regulation | denotes | increased | ||
T19685 | 38606-38617 | Entity | denotes | cytoplasmic | ||
T19686 | 38618-38624 | Protein | denotes | GATA-3 | ||
T19687 | 38625-38635 | Gene_expression | denotes | expression | ||
T19688 | 38717-38726 | Regulation | denotes | dependent | ||
T19689 | 38727-38735 | Negative_regulation | denotes | decrease | ||
T19690 | 38739-38746 | Entity | denotes | nuclear | ||
T19691 | 38747-38757 | Gene_expression | denotes | expression | ||
T19692 | 38761-38767 | Protein | denotes | GATA-3 | ||
T19693 | 38773-38782 | Positive_regulation | denotes | increased | ||
T19694 | 38783-38794 | Entity | denotes | cytoplasmic | ||
T19695 | 38795-38801 | Protein | denotes | GATA-3 | ||
T19696 | 38802-38812 | Gene_expression | denotes | expression | ||
T19697 | 38856-38861 | Protein | denotes | MEK-1 | ||
R59 | T72 | T71 | themeOf | glucocorticoid receptor,activated | ||
R60 | T74 | T73 | themeOf | expression,induces | ||
R61 | T74 | T77 | causeOf | expression,necessary | ||
R62 | T75 | T74 | themeOf | mitogen-activated protein kinase (MAPK) phosphatase-1,expression | ||
R63 | T76 | T75 | equivalentTo | MKP-1,mitogen-activated protein kinase (MAPK) phosphatase-1 | ||
R64 | T78 | T80 | themeOf | GATA-3,translocation | ||
R65 | T79 | T80 | locationOf | nuclear,translocation | ||
R66 | T80 | T77 | themeOf | translocation,necessary | ||
R67 | T82 | T84 | themeOf | GATA-3,translocation | ||
R68 | T83 | T84 | locationOf | nuclear,translocation | ||
R69 | T84 | T81 | themeOf | translocation,inhibits | ||
R70 | T86 | T85 | themeOf | GATA-3,inhibitory effect | ||
R38 | T48 | T51 | themeOf | GATA-3,Phosphorylation | ||
R39 | T49 | T50 | locationOf | Nuclear,Import | ||
R40 | T50 | T47 | themeOf | Import,Suppression | ||
R41 | T51 | T47 | themeOf | Phosphorylation,Suppression | ||
R42 | T52 | T54 | causeOf | GATA-3,regulating | ||
R43 | T52 | T53 | causeOf | GATA-3,role | ||
R44 | T55 | T54 | themeOf | expression,regulating | ||
R45 | T56 | T55 | themeOf | interleukin (IL)-4,expression | ||
R46 | T57 | T55 | themeOf | IL-5,expression | ||
R47 | T58 | T55 | themeOf | IL-13,expression | ||
R48 | T60 | T59 | themeOf | GATA-3,effects | ||
R49 | T61 | T62 | themeOf | GATA-3,regulation | ||
R50 | T63 | T68 | themeOf | inhibits,independent | ||
R51 | T64 | T65 | locationOf | nuclear,translocation | ||
R52 | T65 | T68 | themeOf | translocation,independent | ||
R53 | T65 | T63 | themeOf | translocation,inhibits | ||
R54 | T66 | T67 | themeOf | GATA-3,expression | ||
R55 | T67 | T63 | themeOf | expression,inhibits | ||
R56 | T67 | T68 | themeOf | expression,independent | ||
R57 | T70 | T71 | themeOf | GATA-3,activated | ||
R58 | T70 | T69 | themeOf | GATA-3,competition | ||
R889 | T1072 | T1071 | themeOf | interleukin (IL)-4,expression | ||
R890 | T1073 | T1071 | themeOf | IL-5,expression | ||
R891 | T1074 | T1071 | themeOf | IL-13,expression | ||
R892 | T1078 | T1077 | themeOf | expression,regulate | ||
R893 | T1081 | T1082 | themeOf | GATA-3,expressed | ||
R894 | T1083 | T1084 | causeOf | GATA-3,activates | ||
R895 | T1085 | T1084 | themeOf | promoters,activates | ||
R896 | T1085 | T1087 | partOf | promoters,IL-5 | ||
R897 | T1085 | T1088 | partOf | promoters,IL-13 | ||
R898 | T1085 | T1086 | partOf | promoters,IL-4 | ||
R899 | T1096 | T1097 | themeOf | GATA-3,expression | ||
R900 | T1097 | T1095 | themeOf | expression,knockdown | ||
R901 | T1098 | T1099 | themeOf | GATA-3,translocate | ||
R902 | T1100 | T1099 | locationOf | nucleus,translocate | ||
R903 | T1102 | T1103 | locationOf | nuclear,expression | ||
R904 | T1103 | T1101 | themeOf | expression,Enhanced | ||
R905 | T1103 | T1105 | themeOf | expression,following | ||
R906 | T1104 | T1103 | themeOf | GATA-3,expression | ||
R907 | T1107 | T1108 | themeOf | GATA-3,import | ||
R908 | T1107 | T1110 | themeOf | GATA-3,import | ||
R909 | T1109 | T1108 | locationOf | nucleus,import | ||
R910 | T1115 | T1114 | themeOf | phosphorylating,role | ||
R911 | T1116 | T1115 | themeOf | GATA-3,phosphorylating | ||
R912 | T1116 | T1117 | causeOf | GATA-3,enhance | ||
R913 | T1116 | T1118 | themeOf | GATA-3,interaction | ||
R914 | T1118 | T1117 | themeOf | interaction,enhance | ||
R915 | T1120 | T1119 | themeOf | glucocorticoid receptors,binding | ||
R916 | T1120 | T1124 | themeOf | glucocorticoid receptors,interact | ||
R917 | T1120 | T1122 | themeOf | glucocorticoid receptors,translocate | ||
R918 | T1121 | T1120 | equivalentTo | GRs,glucocorticoid receptors | ||
R919 | T1123 | T1122 | locationOf | nucleus,translocate | ||
R920 | T1126 | T1127 | themeOf | GR,interacts | ||
R921 | T1126 | T1128 | themeOf | GR,recruitment | ||
R922 | T1126 | T1125 | themeOf | GR,activated | ||
R923 | T1129 | T1128 | themeOf | histone deacetylase-2,recruitment | ||
R924 | T1130 | T1131 | locationOf | Nuclear,localisation | ||
R925 | T1131 | T1134 | themeOf | localisation,mediated | ||
R926 | T1132 | T1134 | themeOf | retention,mediated | ||
R927 | T1133 | T1131 | themeOf | GR,localisation | ||
R928 | T1133 | T1137 | themeOf | GR,export | ||
R929 | T1133 | T1132 | themeOf | GR,retention | ||
R930 | T1133 | T1135 | themeOf | GR,retention | ||
R931 | T1136 | T1137 | locationOf | nuclear,export | ||
R932 | T1139 | T1138 | equivalentTo | CRM-1,chromosomal region maintenance 1 | ||
R933 | T1142 | T1146 | themeOf | GR,interaction | ||
R934 | T1142 | T1143 | themeOf | GR,translocates | ||
R935 | T1143 | T1145 | themeOf | translocates,in response to | ||
R936 | T1143 | T1141 | themeOf | translocates,resulting | ||
R937 | T1144 | T1143 | locationOf | nucleus,translocates | ||
R938 | T1146 | T1145 | causeOf | interaction,in response to | ||
R939 | T1147 | T1146 | themeOf | importin 7,interaction | ||
R940 | T1148 | T1149 | themeOf | GR,import | ||
R941 | T1151 | T1154 | themeOf | GR,import | ||
R942 | T1151 | T1155 | themeOf | GR,binding | ||
R943 | T1151 | T1152 | themeOf | GR,activation | ||
R944 | T1152 | T1150 | themeOf | activation,regulation | ||
R945 | T1153 | T1154 | locationOf | nuclear,import | ||
R946 | T1154 | T1150 | themeOf | import,regulation | ||
R947 | T1155 | T1150 | themeOf | binding,regulation | ||
R948 | T1160 | T1161 | causeOf | GR,reduced | ||
R949 | T1162 | T1163 | causeOf | GATA-3,mediated | ||
R950 | T1163 | T1161 | themeOf | mediated,reduced | ||
R951 | T1167 | T1169 | causeOf | recruitment,alter | ||
R952 | T1168 | T1167 | themeOf | GR,recruitment | ||
R953 | T1170 | T1172 | themeOf | GATA-3,up-regulation | ||
R954 | T1170 | T1171 | themeOf | GATA-3,bind | ||
R955 | T1173 | T1174 | themeOf | GATA-3,phosphorylation | ||
R956 | T1173 | T1176 | themeOf | GATA-3,translocation | ||
R957 | T1175 | T1176 | locationOf | nuclear,translocation | ||
R958 | T1177 | T1178 | themeOf | GATA-3,localization | ||
R5811 | T6751 | T6752 | themeOf | GATA-3,excised | ||
R5812 | T6756 | T6758 | themeOf | GATA-3,EcoRI | ||
R5813 | T6757 | T6758 | themeOf | GFP,EcoRI | ||
R5814 | T6759 | T6758 | themeOf | GATA-3,EcoRI | ||
R6292 | T7350 | T7349 | themeOf | GATA-3-GFP,expressing | ||
R7047 | T8148 | T8150 | themeOf | GATA-3,Translocation | ||
R7048 | T8149 | T8150 | locationOf | Nuclear,Translocation | ||
R7049 | T8150 | T8147 | themeOf | Translocation,Effect | ||
R7050 | T8151 | T8147 | themeOf | IL-4,Effect | ||
R7051 | T8153 | T8154 | causeOf | GATA-3,regulated | ||
R7052 | T8154 | T8152 | themeOf | regulated,inhibiting | ||
R7053 | T8155 | T8156 | themeOf | IL-4,expression | ||
R7054 | T8156 | T8154 | themeOf | expression,regulated | ||
R7055 | T8159 | T8160 | locationOf | nuclear,import | ||
R7056 | T8160 | T8158 | themeOf | import,stimulated | ||
R7057 | T8161 | T8160 | themeOf | GATA-3,import | ||
R7058 | T8163 | T8165 | locationOf | nuclear,translocation | ||
R7059 | T8164 | T8165 | themeOf | GATA-3,translocation | ||
R7060 | T8165 | T8162 | themeOf | translocation,resulted | ||
R7061 | T8168 | T8167 | themeOf | loss,sustained | ||
R7062 | T8169 | T8171 | locationOf | nuclear,expression | ||
R7063 | T8170 | T8171 | themeOf | GATA-3,expression | ||
R7064 | T8171 | T8168 | themeOf | expression,loss | ||
R7065 | T8172 | T8173 | locationOf | cytoplasmic,retention | ||
R7066 | T8173 | T8168 | themeOf | retention,loss | ||
R7067 | T8174 | T8173 | themeOf | GATA-3,retention | ||
R7068 | T8177 | T8179 | themeOf | IL-4,mRNA expression | ||
R7069 | T8178 | T8179 | themeOf | IL-5,mRNA expression | ||
R7070 | T8179 | T8176 | themeOf | mRNA expression,stimulated | ||
R7071 | T8181 | T8182 | themeOf | GATA-3,binding | ||
R7072 | T8182 | T8180 | themeOf | binding,loss | ||
R7073 | T8184 | T8182 | themeOf | promoter,binding | ||
R7074 | T8184 | T8183 | partOf | promoter,IL-5 | ||
R7665 | T8892 | T8891 | themeOf | GR,Activated | ||
R7666 | T8895 | T8894 | themeOf | GR,activated | ||
R7667 | T8895 | T8898 | themeOf | GR,import | ||
R7668 | T8896 | T8898 | themeOf | GATA-3,import | ||
R7669 | T8897 | T8898 | locationOf | nuclear,import | ||
R7670 | T8900 | T8899 | themeOf | GR,interaction | ||
R7671 | T8901 | T8903 | themeOf | GR,translocation | ||
R7672 | T8902 | T8903 | locationOf | nuclear,translocation | ||
R7673 | T8905 | T8904 | themeOf | association,decreased | ||
R7674 | T8905 | T8907 | themeOf | association,induced | ||
R7675 | T8906 | T8907 | themeOf | GATA-3,induced | ||
R7676 | T8906 | T8905 | themeOf | GATA-3,association | ||
R7677 | T8907 | T8904 | themeOf | induced,decreased | ||
R7678 | T8909 | T8911 | themeOf | GATA-3,import | ||
R7679 | T8910 | T8911 | locationOf | nuclear,import | ||
R7680 | T8911 | T8912 | themeOf | import,following | ||
R7681 | T8911 | T8913 | themeOf | import,attenuated | ||
R7682 | T8912 | T8913 | themeOf | following,attenuated | ||
R8156 | T9490 | T9489 | equivalentTo | MAPK phosphatase-1,MKP-1 | ||
R8157 | T9492 | T9491 | themeOf | ATF-2,phosphorylation | ||
R8158 | T9495 | T9496 | themeOf | serine,phosphorylation | ||
R8159 | T9495 | T9494 | partOf | serine,GATA-3 | ||
R8160 | T9496 | T9497 | themeOf | phosphorylation,induced | ||
R8161 | T9496 | T9493 | themeOf | phosphorylation,reduced | ||
R8162 | T9499 | T9500 | themeOf | GATA-3,phosphorylation | ||
R8163 | T9500 | T9498 | themeOf | phosphorylation,reduction | ||
R8164 | T9502 | T9501 | themeOf | MKP-1,induced | ||
R8165 | T9504 | T9509 | themeOf | GATA-3,mRNA expression | ||
R8166 | T9504 | T9507 | themeOf | GATA-3,association | ||
R8167 | T9504 | T9506 | themeOf | GATA-3,import | ||
R8168 | T9505 | T9506 | locationOf | nuclear,import | ||
R8169 | T9505 | T9509 | locationOf | nuclear,mRNA expression | ||
R8170 | T9506 | T9503 | themeOf | import,effects | ||
R8171 | T9507 | T9503 | themeOf | association,effects | ||
R8172 | T9508 | T9509 | themeOf | IL-4,mRNA expression | ||
R8173 | T9509 | T9503 | themeOf | mRNA expression,effects | ||
R8174 | T9511 | T9510 | themeOf | GATA-3,activated | ||
R8175 | T9513 | T9512 | themeOf | GR,activated | ||
R8176 | T9515 | T9514 | themeOf | GR,activated | ||
R8177 | T9515 | T9516 | causeOf | GR,increased | ||
R8178 | T9517 | T9518 | themeOf | GR,association | ||
R8179 | T9518 | T9516 | themeOf | association,increased | ||
R8180 | T9521 | T9520 | themeOf | GATA-3,activated | ||
R8181 | T9523 | T9524 | causeOf | GATA-3,block | ||
R8182 | T9523 | T9522 | themeOf | GATA-3,activated | ||
R8183 | T9525 | T9526 | themeOf | GR,association | ||
R8184 | T9526 | T9524 | themeOf | association,block | ||
R8185 | T9528 | T9531 | themeOf | GR,associate | ||
R8186 | T9528 | T9527 | themeOf | GR,activated | ||
R8187 | T9530 | T9529 | themeOf | GATA-3,phospho | ||
R8188 | T9530 | T9531 | themeOf | GATA-3,associate | ||
R8189 | T9533 | T9532 | themeOf | GR,activated | ||
R8190 | T9533 | T9534 | causeOf | GR,attenuates | ||
R8191 | T9534 | T9538 | themeOf | attenuates,dependent | ||
R8192 | T9535 | T9534 | themeOf | phospho,attenuates | ||
R8193 | T9536 | T9537 | themeOf | GATA-3,interaction | ||
R8194 | T9536 | T9535 | themeOf | GATA-3,phospho | ||
R8195 | T9537 | T9534 | themeOf | interaction,attenuates | ||
R8196 | T9540 | T9544 | causeOf | GR,limit | ||
R8197 | T9540 | T9539 | themeOf | GR,activated | ||
R8198 | T9540 | T9541 | causeOf | GR,compete | ||
R8199 | T9542 | T9541 | themeOf | phospho,compete | ||
R8200 | T9543 | T9542 | themeOf | GATA-3,phospho | ||
R8201 | T9545 | T9547 | themeOf | GATA-3,import | ||
R8202 | T9546 | T9547 | locationOf | nuclear,import | ||
R8203 | T9547 | T9544 | themeOf | import,limit | ||
R8204 | T9549 | T9552 | themeOf | GATA-3,degradation | ||
R8205 | T9549 | T9551 | themeOf | GATA-3,export | ||
R8206 | T9550 | T9551 | locationOf | nuclear,export | ||
R8207 | T9551 | T9548 | themeOf | export,effect | ||
R8208 | T9552 | T9548 | themeOf | degradation,effect | ||
R8209 | T9554 | T9553 | themeOf | export,inhibits | ||
R8210 | T9557 | T9559 | themeOf | GATA-3,localization | ||
R8211 | T9558 | T9559 | locationOf | nuclear,localization | ||
R8212 | T9559 | T9556 | themeOf | localization,block | ||
R8213 | T9561 | T9562 | themeOf | GATA-3,expression | ||
R8214 | T9562 | T9560 | themeOf | expression,effect | ||
R8215 | T9563 | T9564 | locationOf | nuclear,translocation | ||
R8216 | T9566 | T9568 | themeOf | GATA-3,residency | ||
R8217 | T9567 | T9568 | locationOf | nuclear,residency | ||
R8218 | T9568 | T9565 | themeOf | residency,affect | ||
R8219 | T9570 | T9571 | causeOf | GR,enhance | ||
R8220 | T9570 | T9569 | themeOf | GR,activated | ||
R8221 | T9572 | T9574 | themeOf | GATA-3,export | ||
R8222 | T9573 | T9574 | locationOf | nuclear,export | ||
R8223 | T9574 | T9571 | themeOf | export,enhance | ||
R8224 | T9576 | T9578 | themeOf | GATA-3,import | ||
R8225 | T9577 | T9578 | locationOf | nuclear,import | ||
R8226 | T9578 | T9575 | themeOf | import,effect | ||
R8227 | T9580 | T9582 | themeOf | p65,translocation | ||
R8228 | T9581 | T9582 | locationOf | nuclear,translocation | ||
R8229 | T9582 | T9579 | themeOf | translocation,effect | ||
R9548 | T11161 | T11163 | themeOf | GATA-3,Localization | ||
R9549 | T11162 | T11163 | locationOf | Nuclear,Localization | ||
R9550 | T11163 | T11160 | themeOf | Localization,Effect | ||
R9551 | T11166 | T11165 | themeOf | interaction,decrease | ||
R9552 | T11166 | T11170 | themeOf | interaction,attenuated | ||
R9553 | T11166 | T11169 | themeOf | interaction,inhibited | ||
R9554 | T11167 | T11170 | themeOf | phospho,attenuated | ||
R9555 | T11167 | T11169 | themeOf | phospho,inhibited | ||
R9556 | T11168 | T11166 | themeOf | GATA-3,interaction | ||
R9557 | T11168 | T11167 | themeOf | GATA-3,phospho | ||
R9558 | T11172 | T11174 | themeOf | IL-4,expression | ||
R9559 | T11173 | T11174 | themeOf | -5,expression | ||
R9560 | T11174 | T11171 | themeOf | expression,suppresses | ||
R9561 | T11176 | T11175 | themeOf | interaction,attenuated | ||
R9562 | T11177 | T11176 | themeOf | GATA-3,interaction | ||
R9563 | T11178 | T11181 | themeOf | reduced,dependent | ||
R9564 | T11179 | T11180 | themeOf | GATA-3,interaction | ||
R9565 | T11180 | T11178 | themeOf | interaction,reduced | ||
R9566 | T11183 | T11184 | themeOf | GATA-3,association | ||
R9567 | T11184 | T11182 | themeOf | association,decrease | ||
R9568 | T11185 | T11186 | themeOf | GATA-3,association | ||
R9569 | T11187 | T11190 | themeOf | attenuated,decrease | ||
R9570 | T11188 | T11187 | themeOf | interaction,attenuated | ||
R9571 | T11188 | T11190 | themeOf | interaction,decrease | ||
R9572 | T11189 | T11188 | themeOf | GATA-3,interaction | ||
R9573 | T11192 | T11191 | themeOf | localization,affect | ||
R9574 | T11193 | T11192 | themeOf | GATA-3,localization | ||
R9575 | T11195 | T11197 | themeOf | GR,translocation | ||
R9576 | T11196 | T11197 | locationOf | nuclear,translocation | ||
R9577 | T11197 | T11194 | themeOf | translocation,increased | ||
R9578 | T11200 | T11199 | themeOf | loss,induced | ||
R9579 | T11200 | T11203 | themeOf | loss,enhanced | ||
R9580 | T11201 | T11200 | themeOf | GATA-3,loss | ||
R9581 | T11202 | T11203 | themeOf | GATA-3,enhanced | ||
R9582 | T11202 | T11200 | themeOf | GATA-3,loss | ||
R9583 | T11205 | T11206 | locationOf | nuclear,localization | ||
R9584 | T11206 | T11204 | themeOf | localization,reduces | ||
R9585 | T11207 | T11206 | themeOf | GATA-3,localization | ||
R9586 | T11208 | T11204 | causeOf | inhibiting,reduces | ||
R9587 | T11209 | T11208 | themeOf | phospho,inhibiting | ||
R9588 | T11210 | T11211 | themeOf | GATA-3,association | ||
R9589 | T11211 | T11208 | themeOf | association,inhibiting | ||
R9590 | T11214 | T11215 | themeOf | GATA-3,phosphorylation | ||
R9591 | T11215 | T11213 | themeOf | phosphorylation,mediated | ||
R9592 | T11217 | T11216 | themeOf | MKP-1,induction | ||
R9593 | T11219 | T11221 | themeOf | GATA-3,import | ||
R9594 | T11220 | T11221 | locationOf | nuclear,import | ||
R9595 | T11221 | T11218 | themeOf | import,suppression | ||
R11178 | T13009 | T13008 | themeOf | GATA-3,inhibit | ||
R11179 | T13011 | T13010 | themeOf | GR,activated | ||
R11180 | T13013 | T13015 | themeOf | GATA-3,import | ||
R11181 | T13014 | T13015 | locationOf | nuclear,import | ||
R11182 | T13015 | T13016 | themeOf | import,via | ||
R11183 | T13018 | T13019 | locationOf | nuclear,transport | ||
R11184 | T13019 | T13017 | themeOf | transport,required | ||
R11185 | T13020 | T13019 | themeOf | GATA-3,transport | ||
R11186 | T13021 | T13019 | themeOf | GR,transport | ||
R11187 | T13023 | T13022 | themeOf | expression,increase | ||
R11188 | T13024 | T13023 | themeOf | MKP-1,expression | ||
R11189 | T13026 | T13028 | causeOf | phosphorylation,necessary | ||
R11190 | T13026 | T13025 | themeOf | phosphorylation,prevent | ||
R11191 | T13027 | T13029 | themeOf | GATA-3,interaction | ||
R11192 | T13027 | T13031 | themeOf | GATA-3,import | ||
R11193 | T13027 | T13026 | themeOf | GATA-3,phosphorylation | ||
R11194 | T13029 | T13028 | themeOf | interaction,necessary | ||
R11195 | T13030 | T13031 | locationOf | nuclear,import | ||
R11196 | T13031 | T13028 | themeOf | import,necessary | ||
R11197 | T13032 | T13035 | themeOf | translocation,involves | ||
R11198 | T13033 | T13032 | themeOf | GATA-3,translocation | ||
R11199 | T13034 | T13032 | locationOf | nucleus,translocation | ||
R11200 | T13038 | T13037 | themeOf | GATA-3,phosphorylated | ||
R11201 | T13038 | T13036 | themeOf | GATA-3,interacts | ||
R11202 | T13039 | T13040 | themeOf | GATA-3,knockdown | ||
R11203 | T13040 | T13041 | causeOf | knockdown,suppression | ||
R11204 | T13043 | T13046 | themeOf | IL-4,induction | ||
R11205 | T13046 | T13042 | themeOf | induction,stimulated | ||
R11206 | T13048 | T13047 | causeOf | GATA-3,role | ||
R11207 | T13049 | T13051 | themeOf | GR,import | ||
R11208 | T13050 | T13051 | locationOf | nuclear,import | ||
R11209 | T13054 | T13058 | themeOf | GR,import | ||
R11210 | T13054 | T13053 | themeOf | GR,activated | ||
R11211 | T13056 | T13058 | themeOf | GATA-3,import | ||
R11212 | T13056 | T13055 | themeOf | GATA-3,phospho | ||
R11213 | T13057 | T13058 | locationOf | nuclear,import | ||
R11214 | T13061 | T13060 | themeOf | GR,activated | ||
R11215 | T13063 | T13062 | themeOf | GATA-3,phospho | ||
R11216 | T13065 | T13066 | themeOf | GATA-3,entry | ||
R11217 | T13065 | T13064 | themeOf | GATA-3,reduce | ||
R11218 | T13066 | T13064 | themeOf | entry,reduce | ||
R11219 | T13068 | T13069 | locationOf | nuclear,translocation | ||
R11220 | T13069 | T13071 | themeOf | translocation,affected | ||
R11221 | T13070 | T13069 | themeOf | p65,translocation | ||
R11222 | T13073 | T13075 | themeOf | GATA-3,exclusion | ||
R11223 | T13074 | T13075 | locationOf | nuclear,exclusion | ||
R11224 | T13075 | T13072 | themeOf | exclusion,effect | ||
R11225 | T13077 | T13079 | themeOf | GATA-3,export | ||
R11226 | T13078 | T13079 | locationOf | nuclear,export | ||
R11227 | T13079 | T13076 | themeOf | export,enhances | ||
R11228 | T13081 | T13082 | themeOf | GATA-3,degradation | ||
R11229 | T13082 | T13080 | themeOf | degradation,induces | ||
R11230 | T13084 | T13085 | causeOf | GR,attenuate | ||
R11231 | T13084 | T13083 | themeOf | GR,activated | ||
R11232 | T13086 | T13085 | themeOf | phospho,attenuate | ||
R11233 | T13087 | T13088 | themeOf | GATA-3,association | ||
R11234 | T13088 | T13085 | themeOf | association,attenuate | ||
R11235 | T13090 | T13089 | themeOf | GATA-3,phospho | ||
R11236 | T13090 | T13091 | themeOf | GATA-3,associate | ||
R11237 | T13093 | T13092 | themeOf | reduction,contribute | ||
R11238 | T13094 | T13096 | themeOf | GATA-3,import | ||
R11239 | T13095 | T13096 | locationOf | nuclear,import | ||
R11240 | T13096 | T13093 | themeOf | import,reduction | ||
R11241 | T13097 | T13098 | themeOf | MKP-1,induction | ||
R11242 | T13098 | T13093 | themeOf | induction,reduction | ||
R11243 | T13100 | T13099 | themeOf | MKP-1,induction | ||
R11244 | T13101 | T13103 | themeOf | induction,following | ||
R11245 | T13102 | T13101 | themeOf | MKP-1,induction | ||
R11246 | T13105 | T13104 | themeOf | MKP-1,induction | ||
R11247 | T13107 | T13115 | themeOf | GATA-3,translocation | ||
R11248 | T13107 | T13109 | themeOf | GATA-3,import | ||
R11249 | T13108 | T13109 | locationOf | nuclear,import | ||
R11250 | T13109 | T13106 | themeOf | import,reduce | ||
R11251 | T13111 | T13115 | themeOf | GATA-3,translocation | ||
R11252 | T13111 | T13112 | themeOf | GATA-3,phosphorylation | ||
R11253 | T13112 | T13113 | causeOf | phosphorylation,preventing | ||
R11254 | T13112 | T13110 | themeOf | phosphorylation,subsequent | ||
R11255 | T13114 | T13115 | locationOf | nuclear,translocation | ||
R11256 | T13115 | T13113 | themeOf | translocation,preventing | ||
R11257 | T13116 | T13118 | themeOf | serine residue,phosphorylated | ||
R11258 | T13116 | T13117 | partOf | serine residue,GATA-3 | ||
R11259 | T13119 | T13121 | themeOf | GATA-3,import | ||
R11260 | T13120 | T13121 | locationOf | nuclear,import | ||
R11261 | T13125 | T13124 | themeOf | IL-4,expression | ||
R11262 | T13127 | T13128 | themeOf | IL-4,transcription | ||
R11263 | T13128 | T13126 | themeOf | transcription,suppress | ||
R11264 | T13130 | T13131 | themeOf | GATA-3,inhibition | ||
R11265 | T13131 | T13129 | themeOf | inhibition,required | ||
R11266 | T13133 | T13132 | themeOf | GATA-3,inhibiting | ||
R11267 | T13135 | T13137 | themeOf | IL-4,release | ||
R11268 | T13136 | T13137 | themeOf | IL-5,release | ||
R11269 | T13137 | T13134 | themeOf | release,suppress | ||
R11270 | T13139 | T13144 | themeOf | GATA-3,import | ||
R11271 | T13139 | T13141 | themeOf | GATA-3,translocation | ||
R11272 | T13140 | T13141 | locationOf | nuclear,translocation | ||
R11273 | T13141 | T13138 | themeOf | translocation,effect | ||
R11274 | T13143 | T13144 | locationOf | nuclear,import | ||
R11275 | T13146 | T13145 | themeOf | synthesis,increased | ||
R11276 | T13147 | T13146 | themeOf | MKP-1,synthesis | ||
R11277 | T13149 | T13151 | causeOf | phosphorylation,necessary | ||
R11278 | T13149 | T13148 | themeOf | phosphorylation,preventing | ||
R11279 | T13150 | T13149 | themeOf | GATA-3,phosphorylation | ||
R11280 | T13152 | T13153 | locationOf | nuclear,translocation | ||
R11281 | T13153 | T13151 | themeOf | translocation,necessary | ||
R11282 | T13154 | T13153 | themeOf | GATA-3,translocation | ||
R11283 | T13156 | T13155 | themeOf | phospho,Prevention | ||
R11284 | T13157 | T13156 | themeOf | GATA-3,phospho | ||
R11285 | T13157 | T13158 | themeOf | GATA-3,interaction | ||
R11286 | T13158 | T13155 | themeOf | interaction,Prevention | ||
R13720 | T15976 | T15978 | themeOf | GATA-3,import | ||
R13721 | T15977 | T15978 | locationOf | nuclear,import | ||
R13722 | T15978 | T15975 | themeOf | import,inhibits | ||
R13723 | T15980 | T15979 | themeOf | GATA-3,translocation | ||
R13724 | T15981 | T15979 | locationOf | nucleus,translocation | ||
R13725 | T15984 | T15985 | locationOf | nuclear,localization | ||
R13726 | T15985 | T15983 | themeOf | localization,impaired | ||
R13727 | T15985 | T15987 | themeOf | localization,induced | ||
R13728 | T15986 | T15985 | themeOf | GATA-3,localization | ||
R13729 | T15987 | T15983 | themeOf | induced,impaired | ||
R13730 | T15990 | T15992 | themeOf | IL-4,mRNA expression | ||
R13731 | T15991 | T15992 | themeOf | IL-5,mRNA expression | ||
R13732 | T15992 | T15989 | themeOf | mRNA expression,inhibits | ||
R13733 | T15996 | T15995 | themeOf | stimulated,reduces | ||
R13734 | T15997 | T15998 | themeOf | GATA-3,associate | ||
R13735 | T15997 | T15996 | themeOf | GATA-3,stimulated | ||
R13736 | T15998 | T15995 | themeOf | associate,reduces | ||
R14371 | T16766 | T16767 | themeOf | GATA-3,association | ||
R14372 | T16767 | T16765 | themeOf | association,reduces | ||
R14373 | T16768 | T16770 | themeOf | GATA-3,import | ||
R14374 | T16769 | T16770 | locationOf | nuclear,import | ||
R14375 | T16770 | T16765 | themeOf | import,reduces | ||
R14376 | T16772 | T16771 | themeOf | induction,dependent | ||
R14377 | T16773 | T16772 | themeOf | activated,induction | ||
R14378 | T16774 | T16773 | themeOf | GR,activated | ||
R14379 | T16774 | T16775 | themeOf | GR,interaction | ||
R14380 | T16775 | T16772 | themeOf | interaction,induction | ||
R14381 | T16776 | T16777 | themeOf | GR,association | ||
R14382 | T16779 | T16778 | themeOf | induction,dependent | ||
R14383 | T16780 | T16779 | themeOf | activated,induction | ||
R14384 | T16781 | T16780 | themeOf | GR,activated | ||
R14385 | T16781 | T16783 | themeOf | GR,translocation | ||
R14386 | T16782 | T16783 | locationOf | nuclear,translocation | ||
R14387 | T16783 | T16779 | themeOf | translocation,induction | ||
R14388 | T16785 | T16784 | themeOf | decrease,dependent | ||
R14389 | T16786 | T16787 | themeOf | GATA-3,association | ||
R14390 | T16787 | T16785 | themeOf | association,decrease | ||
R15068 | T17569 | T17568 | partOf | serine,GATA-3 | ||
R15069 | T17569 | T17567 | themeOf | serine,down-regulation | ||
R15070 | T17569 | T17570 | themeOf | serine,phosphorylation | ||
R15071 | T17570 | T17567 | themeOf | phosphorylation,down-regulation | ||
R15072 | T17573 | T17572 | themeOf | activated transcription factor 2,phosphorylation | ||
R15073 | T17574 | T17573 | equivalentTo | ATF-2,activated transcription factor 2 | ||
R15074 | T17576 | T17577 | themeOf | serine,phosphorylation | ||
R15075 | T17576 | T17578 | partOf | serine,GATA-3 | ||
R15076 | T17577 | T17575 | themeOf | phosphorylation,induced | ||
R15077 | T17580 | T17579 | themeOf | MKP-1,induced | ||
R15078 | T17582 | T17581 | themeOf | MKP-1,induces | ||
R15626 | T18249 | T18248 | themeOf | GATA-3,phospho | ||
R15627 | T18250 | T18251 | causeOf | GR,enhances | ||
R15628 | T18252 | T18253 | themeOf | GR,binding | ||
R15629 | T18253 | T18251 | themeOf | binding,enhances | ||
R15630 | T18256 | T18255 | themeOf | GATA-3,activated | ||
R15631 | T18258 | T18257 | themeOf | GR,activated | ||
R15632 | T18259 | T18260 | causeOf | GATA-3,attenuate | ||
R15633 | T18261 | T18262 | themeOf | GR,association | ||
R15634 | T18262 | T18260 | themeOf | association,attenuate | ||
R15635 | T18264 | T18263 | themeOf | GR,Activated | ||
R15636 | T18264 | T18266 | themeOf | GR,interacting | ||
R15637 | T18265 | T18266 | themeOf | GATA-3,interacting | ||
R15638 | T18269 | T18270 | themeOf | GATA-3,binding | ||
R15639 | T18270 | T18268 | themeOf | binding,stimulated | ||
R15640 | T18273 | T18272 | themeOf | GR,activated | ||
R15641 | T18273 | T18274 | causeOf | GR,attenuation | ||
R15642 | T18274 | T18277 | themeOf | attenuation,dependent | ||
R15643 | T18275 | T18276 | themeOf | GATA-3,association | ||
R15644 | T18276 | T18274 | themeOf | association,attenuation | ||
R15947 | T18677 | T18679 | themeOf | GATA-3,export | ||
R15948 | T18678 | T18679 | locationOf | nuclear,export | ||
R15949 | T18679 | T18676 | themeOf | export,affect | ||
R15950 | T18682 | T18681 | themeOf | stimulated,prevent | ||
R15951 | T18683 | T18685 | themeOf | GATA-3,localization | ||
R15952 | T18684 | T18685 | locationOf | nuclear,localization | ||
R15953 | T18685 | T18681 | themeOf | localization,prevent | ||
R15954 | T18685 | T18682 | themeOf | localization,stimulated | ||
R15955 | T18687 | T18688 | themeOf | GATA-3,degradation | ||
R15956 | T18688 | T18686 | themeOf | degradation,affect | ||
R15957 | T18691 | T18690 | themeOf | stimulated,prevent | ||
R15958 | T18692 | T18694 | themeOf | p65,translocation | ||
R15959 | T18693 | T18694 | locationOf | nuclear,translocation | ||
R15960 | T18694 | T18691 | themeOf | translocation,stimulated | ||
R15961 | T18694 | T18690 | themeOf | translocation,prevent | ||
R16440 | T19262 | T19263 | themeOf | GATA-3,interaction | ||
R16441 | T19263 | T19261 | themeOf | interaction,impairs | ||
R16442 | T19264 | T19266 | themeOf | GATA-3,localization | ||
R16443 | T19265 | T19266 | locationOf | nuclear,localization | ||
R16444 | T19266 | T19261 | themeOf | localization,impairs | ||
R16445 | T19268 | T19267 | themeOf | interaction,impaired | ||
R16446 | T19269 | T19268 | themeOf | GATA-3,interaction | ||
R16447 | T19271 | T19270 | themeOf | association,decreased | ||
R16448 | T19272 | T19271 | themeOf | GATA-3,association | ||
R16798 | T19671 | T19673 | themeOf | GATA-3,localization | ||
R16799 | T19672 | T19673 | locationOf | nuclear,localization | ||
R16800 | T19673 | T19670 | themeOf | localization,impairs | ||
R16801 | T19674 | T19677 | themeOf | GR,localisation | ||
R16802 | T19675 | T19677 | themeOf | GATA-3,localisation | ||
R16803 | T19676 | T19677 | locationOf | nuclear,localisation | ||
R16804 | T19681 | T19682 | locationOf | nuclear,expression | ||
R16809 | T19687 | T19684 | themeOf | expression,increased | ||
R37 | T48 | T50 | themeOf | GATA-3,Import | ||
R3729 | T4345 | T4346 | themeOf | GATA-3,localization | ||
R16805 | T19682 | T19680 | themeOf | expression,decrease | ||
R16806 | T19683 | T19682 | themeOf | GATA-3,expression | ||
R16807 | T19685 | T19687 | locationOf | cytoplasmic,expression | ||
R16808 | T19686 | T19687 | themeOf | GATA-3,expression | ||
R16810 | T19690 | T19691 | locationOf | nuclear,expression | ||
R16811 | T19691 | T19689 | themeOf | expression,decrease | ||
R16812 | T19692 | T19691 | themeOf | GATA-3,expression | ||
R16813 | T19694 | T19696 | locationOf | cytoplasmic,expression | ||
R16814 | T19695 | T19696 | themeOf | GATA-3,expression | ||
R16815 | T19696 | T19693 | themeOf | expression,increased |