> top > docs > PMC:1920263 > spans > 5091-10492 > annotations

PMC:1920263 / 5091-10492 JSONTXT

Annnotations TAB JSON ListView MergeView

test2

Id Subject Object Predicate Lexical cue
T2605 27-35 Protein denotes APOBEC3G
T2606 442-445 Protein denotes Pwo
T2607 661-671 Protein denotes luciferase
T2608 835-838 Protein denotes A3G
T2609 939-947 Protein denotes APOBEC3G
T2610 1817-1820 Protein denotes Pfu
T2611 2945-2953 Protein denotes APOBEC3G
T2612 3190-3198 Protein denotes APOBEC3G
T2613 3634-3659 Protein denotes guanylate-binding protein
T2614 3661-3664 Protein denotes GBP
T2615 4053-4056 Protein denotes Vif
T2616 4214-4220 Protein denotes TatHIV
T2617 4277-4280 Protein denotes Tat
T2618 4391-4399 Protein denotes Tat1Plus
T2619 4448-4457 Protein denotes Tat1Minus
T2620 4505-4513 Protein denotes Tat2Plus
T2621 4570-4579 Protein denotes Tat2Minus
R2129 T2614 T2613 equivalentTo GBP,guanylate-binding protein

GO-CC

Id Subject Object Predicate Lexical cue
T3718 106-110 http://purl.obolibrary.org/obo/GO_0005623 denotes cell

GO-MF

Id Subject Object Predicate Lexical cue
T3715 3545-3548 http://purl.obolibrary.org/obo/GO_0034005 denotes GAS
T3716 3644-3651 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T3717 3644-3659 http://purl.obolibrary.org/obo/GO_0005515 denotes binding protein

GO-BP

Id Subject Object Predicate Lexical cue
T2669 230-243 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T2670 3375-3390 http://purl.obolibrary.org/obo/GO_0006351 denotes transcriptional
T2671 3545-3548 http://purl.obolibrary.org/obo/GO_0034005 denotes GAS

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T2715 0-8 NNP denotes Plasmids
T2716 9-12 IN denotes For
T2717 13-20 VBG denotes cloning
T2718 21-23 IN denotes of
T2719 24-26 DT denotes an
T2720 27-35 NNP denotes APOBEC3G
T2721 36-51 JJ denotes promoter-driven
T2722 52-60 NN denotes reporter
T2723 61-68 NN denotes plasmid
T2724 68-69 , denotes ,
T2725 70-77 JJ denotes genomic
T2726 78-81 NN denotes DNA
T2727 82-85 VBD denotes was
T2728 86-94 VBN denotes prepared
T2729 95-99 IN denotes from
T2730 100-103 DT denotes the
T2731 104-105 NNP denotes T
T2732 106-110 NN denotes cell
T2733 111-115 NN denotes line
T2734 116-119 CD denotes PM1
T2735 120-125 VBG denotes using
T2736 126-129 DT denotes the
T2737 130-136 NNP denotes DNeasy
T2738 137-140 NNP denotes Kit
T2739 141-142 -LRB- denotes (
T2740 142-148 NNP denotes Qiagen
T2741 148-149 -RRB- denotes )
T2742 149-150 . denotes .
T2743 151-154 DT denotes The
T2744 155-158 NNP denotes DNA
T2745 159-167 NN denotes sequence
T2746 168-175 VBG denotes ranging
T2747 176-180 IN denotes from
T2748 181-190 NNS denotes positions
T2749 191-192 VBP denotes −
T2750 192-195 CD denotes 959
T2751 196-198 TO denotes to
T2752 199-202 CD denotes +66
T2753 203-211 JJ denotes relative
T2754 212-214 TO denotes to
T2755 215-218 DT denotes the
T2756 219-229 VBN denotes identified
T2757 230-243 NN denotes transcription
T2758 244-249 NN denotes start
T2759 250-253 VBD denotes was
T2760 254-263 VBN denotes amplified
T2761 264-267 IN denotes via
T2762 268-271 NNP denotes PCR
T2763 272-277 VBG denotes using
T2764 278-281 DT denotes the
T2765 282-289 NNS denotes primers
T2766 290-300 NNS denotes 3Gprom1025
T2767 301-302 -LRB- denotes (
T2768 302-303 CD denotes 5
T2769 303-304 SYM denotes ′
T2770 304-305 : denotes -
T2771 305-344 NN denotes TGTGAACGCGTTGCTGCAGGCCATCTGGATGTATATG-3
T2772 344-345 NN denotes ′
T2773 345-346 -RRB- denotes )
T2774 347-350 CC denotes and
T2775 351-364 NNP denotes 3Gpromreverse
T2776 365-366 -LRB- denotes (
T2777 366-367 CD denotes 5
T2778 367-368 SYM denotes ′
T2779 368-369 : denotes -
T2780 369-404 NN denotes ACAGCAGATCTAGGGACCTCTGATAAAGACAGG-3
T2781 404-405 NN denotes ′
T2782 405-406 -RRB- denotes )
T2783 406-407 . denotes .
T2784 408-411 NNP denotes PCR
T2785 412-421 NNS denotes reactions
T2786 422-426 VBD denotes were
T2787 427-436 VBN denotes performed
T2788 437-441 IN denotes with
T2789 442-445 NNP denotes Pwo
T2790 446-449 NNP denotes DNA
T2791 450-460 NNP denotes Polymerase
T2792 461-462 -LRB- denotes (
T2793 462-467 NNP denotes Roche
T2794 467-468 -RRB- denotes )
T2795 469-474 VBG denotes using
T2796 475-478 DT denotes the
T2797 479-488 JJ denotes following
T2798 489-494 NN denotes cycle
T2799 495-505 NNS denotes conditions
T2800 505-506 : denotes :
T2801 507-510 CD denotes one
T2802 511-516 NN denotes cycle
T2803 517-519 CD denotes 94
T2804 519-520 NN denotes °
T2805 520-521 NNP denotes C
T2806 522-525 IN denotes for
T2807 526-527 CD denotes 2
T2808 528-531 NN denotes min
T2809 531-532 : denotes ;
T2810 533-535 CD denotes 30
T2811 536-542 NNS denotes cycles
T2812 543-545 CD denotes 94
T2813 545-546 NN denotes °
T2814 546-547 NNP denotes C
T2815 548-551 IN denotes for
T2816 552-554 CD denotes 30
T2817 555-556 PRP denotes s
T2818 556-557 , denotes ,
T2819 558-560 CD denotes 58
T2820 560-561 NN denotes °
T2821 561-562 NNP denotes C
T2822 563-566 IN denotes for
T2823 567-569 CD denotes 60
T2824 570-571 PRP denotes s
T2825 571-572 , denotes ,
T2826 573-575 CD denotes 72
T2827 575-576 NN denotes °
T2828 576-577 NNP denotes C
T2829 578-581 IN denotes for
T2830 582-584 CD denotes 60
T2831 585-586 PRP denotes s
T2832 586-587 : denotes ;
T2833 588-591 CD denotes one
T2834 592-597 NN denotes cycle
T2835 598-600 CD denotes 72
T2836 600-601 NN denotes °
T2837 601-602 NNP denotes C
T2838 603-606 IN denotes for
T2839 607-608 CD denotes 7
T2840 609-612 NN denotes min
T2841 612-613 . denotes .
T2842 614-617 DT denotes The
T2843 618-626 NN denotes amplicon
T2844 627-630 VBD denotes was
T2845 631-638 VBN denotes ligated
T2846 639-643 IN denotes into
T2847 644-647 DT denotes the
T2848 648-660 JJ denotes promoterless
T2849 661-671 NN denotes luciferase
T2850 672-680 NN denotes reporter
T2851 681-688 VBD denotes plasmid
T2852 689-699 JJ denotes pGL3-Basic
T2853 700-701 -LRB- denotes (
T2854 701-708 NNP denotes Promega
T2855 708-709 -RRB- denotes )
T2856 710-713 IN denotes via
T2857 714-718 NNP denotes MluI
T2858 719-722 CC denotes and
T2859 723-728 NNP denotes BglII
T2860 729-740 NN denotes restriction
T2861 741-746 NNS denotes sites
T2862 746-747 , denotes ,
T2863 748-753 WDT denotes which
T2864 754-758 VBD denotes were
T2865 759-769 VBN denotes introduced
T2866 770-772 IN denotes by
T2867 773-776 DT denotes the
T2868 777-784 NNS denotes primers
T2869 784-785 . denotes .
T2870 786-789 DT denotes The
T2871 790-799 VBG denotes resulting
T2872 800-809 VB denotes construct
T2873 810-819 VBN denotes contained
T2874 820-824 CD denotes 1025
T2875 825-827 NN denotes bp
T2876 828-830 IN denotes of
T2877 831-834 DT denotes the
T2878 835-838 NNP denotes A3G
T2879 839-847 NN denotes promoter
T2880 848-851 CC denotes and
T2881 852-855 VBD denotes was
T2882 856-866 VBN denotes designated
T2883 867-883 NN denotes pGL3-APOprom1025
T2884 883-884 . denotes .
T2885 885-893 NN denotes Reporter
T2886 894-902 NNS denotes plasmids
T2887 903-913 VBG denotes containing
T2888 914-921 JJR denotes shorter
T2889 922-931 NNS denotes fragments
T2890 932-934 IN denotes of
T2891 935-938 DT denotes the
T2892 939-947 NNP denotes APOBEC3G
T2893 948-956 NN denotes promoter
T2894 957-961 VBD denotes were
T2895 962-973 VBN denotes constructed
T2896 974-979 VBG denotes using
T2897 980-996 NN denotes pGL3-APOprom1025
T2898 997-999 IN denotes as
T2899 1000-1008 NN denotes template
T2900 1009-1012 CC denotes and
T2901 1013-1016 DT denotes the
T2902 1017-1026 VBG denotes following
T2903 1027-1034 RB denotes forward
T2904 1035-1042 NNS denotes primers
T2905 1042-1043 : denotes :
T2906 1044-1047 IN denotes for
T2907 1048-1055 JJ denotes plasmid
T2908 1056-1071 NN denotes pGL3-APOprom502
T2909 1072-1073 -LRB- denotes (
T2910 1073-1083 VBG denotes containing
T2911 1084-1092 NN denotes sequence
T2912 1093-1094 NN denotes −
T2913 1094-1097 CD denotes 436
T2914 1097-1098 NN denotes /
T2915 1098-1101 CD denotes +66
T2916 1101-1102 -RRB- denotes )
T2917 1102-1103 : denotes :
T2918 1104-1113 NNP denotes 3Gprom502
T2919 1114-1115 -LRB- denotes (
T2920 1115-1116 CD denotes 5
T2921 1116-1117 SYM denotes ′
T2922 1117-1118 : denotes -
T2923 1118-1151 NN denotes TGTGAACGCGTTCCATAACATGGGGACAAGA-3
T2924 1151-1152 NN denotes ′
T2925 1152-1153 -RRB- denotes )
T2926 1153-1154 : denotes ;
T2927 1155-1158 IN denotes for
T2928 1159-1166 JJ denotes plasmid
T2929 1167-1182 NN denotes pGL3-APOprom225
T2930 1183-1184 -LRB- denotes (
T2931 1184-1194 VBG denotes containing
T2932 1195-1203 NN denotes sequence
T2933 1204-1205 NN denotes −
T2934 1205-1208 CD denotes 159
T2935 1208-1209 NN denotes /
T2936 1209-1212 CD denotes +66
T2937 1212-1213 -RRB- denotes )
T2938 1213-1214 : denotes :
T2939 1215-1224 NNS denotes 3Gprom225
T2940 1225-1226 -LRB- denotes (
T2941 1226-1227 CD denotes 5
T2942 1227-1228 SYM denotes ′
T2943 1228-1229 : denotes -
T2944 1229-1262 NN denotes TGTGAACGCGTCGAGGGCAGGATCCGGGAGT-3
T2945 1262-1263 NN denotes ′
T2946 1263-1264 -RRB- denotes )
T2947 1264-1265 : denotes ;
T2948 1266-1269 IN denotes for
T2949 1270-1277 JJ denotes plasmid
T2950 1278-1293 NN denotes pGL3-APOprom180
T2951 1294-1295 -LRB- denotes (
T2952 1295-1305 VBG denotes containing
T2953 1306-1314 NN denotes sequence
T2954 1315-1316 CD denotes −
T2955 1316-1319 CD denotes 114
T2956 1319-1320 NN denotes /
T2957 1320-1323 CD denotes +66
T2958 1323-1324 -RRB- denotes )
T2959 1324-1325 : denotes :
T2960 1326-1335 NN denotes 3Gprom180
T2961 1336-1337 -LRB- denotes (
T2962 1337-1338 CD denotes 5
T2963 1338-1339 SYM denotes ′
T2964 1339-1340 : denotes -
T2965 1340-1373 NN denotes TGTGAACGCGTTCTTGATGGTGGAGAGGAGG-3
T2966 1373-1374 NN denotes ′
T2967 1374-1375 -RRB- denotes )
T2968 1375-1376 : denotes ;
T2969 1377-1380 IN denotes for
T2970 1381-1388 JJ denotes plasmid
T2971 1389-1404 NN denotes pGL3-APOprom150
T2972 1405-1406 -LRB- denotes (
T2973 1406-1416 VBG denotes containing
T2974 1417-1425 NN denotes sequence
T2975 1426-1427 CD denotes −
T2976 1427-1429 CD denotes 84
T2977 1429-1430 NN denotes /
T2978 1430-1433 CD denotes +66
T2979 1433-1434 -RRB- denotes )
T2980 1434-1435 : denotes :
T2981 1436-1445 NNP denotes 3Gprom150
T2982 1446-1447 -LRB- denotes (
T2983 1447-1448 CD denotes 5
T2984 1448-1449 SYM denotes ′
T2985 1449-1450 : denotes -
T2986 1450-1487 NN denotes TGTGAACGCGTGCGGGACCACCAGGGGAGGGGCTT-3
T2987 1487-1488 NN denotes ′
T2988 1488-1489 -RRB- denotes )
T2989 1489-1490 : denotes ;
T2990 1491-1494 IN denotes for
T2991 1495-1502 JJ denotes plasmid
T2992 1503-1518 NN denotes pGL3-APOprom120
T2993 1519-1520 -LRB- denotes (
T2994 1520-1530 VBG denotes containing
T2995 1531-1539 NN denotes sequence
T2996 1540-1541 NN denotes −
T2997 1541-1543 CD denotes 54
T2998 1543-1544 NN denotes /
T2999 1544-1547 CD denotes +66
T3000 1547-1548 -RRB- denotes )
T3001 1548-1549 : denotes :
T3002 1550-1559 NNS denotes 3Gprom120
T3003 1560-1561 -LRB- denotes (
T3004 1561-1562 CD denotes 5
T3005 1562-1563 SYM denotes ′
T3006 1563-1564 : denotes -
T3007 1564-1597 NN denotes TGTGAACGCGTTGCTGGCTCAGCCTGGTGTG-3
T3008 1597-1598 NN denotes ′
T3009 1598-1599 -RRB- denotes )
T3010 1599-1600 : denotes ;
T3011 1601-1604 IN denotes for
T3012 1605-1612 JJ denotes plasmid
T3013 1613-1627 NN denotes pGL3-APOprom60
T3014 1628-1629 -LRB- denotes (
T3015 1629-1639 VBG denotes containing
T3016 1640-1648 NN denotes sequence
T3017 1649-1651 CD denotes +7
T3018 1651-1652 NN denotes /
T3019 1652-1655 CD denotes +66
T3020 1655-1656 -RRB- denotes )
T3021 1656-1657 : denotes :
T3022 1658-1666 NNP denotes 3Gprom60
T3023 1667-1668 -LRB- denotes (
T3024 1668-1669 CD denotes 5
T3025 1669-1670 SYM denotes ′
T3026 1670-1671 : denotes -
T3027 1671-1702 NN denotes TGTGAACGCGTCCCTTTGCAATTGCCTTG-3
T3028 1702-1703 NN denotes ′
T3029 1703-1704 -RRB- denotes )
T3030 1704-1705 : denotes ;
T3031 1706-1710 DT denotes each
T3032 1711-1713 IN denotes in
T3033 1714-1725 NN denotes combination
T3034 1726-1730 IN denotes with
T3035 1731-1734 DT denotes the
T3036 1735-1742 NN denotes reverse
T3037 1743-1749 NN denotes primer
T3038 1750-1763 NNP denotes 3Gpromreverse
T3039 1764-1765 -LRB- denotes (
T3040 1765-1774 VBN denotes described
T3041 1775-1780 IN denotes above
T3042 1780-1781 -RRB- denotes )
T3043 1781-1782 . denotes .
T3044 1783-1786 NNP denotes PCR
T3045 1787-1796 NNS denotes reactions
T3046 1797-1801 VBD denotes were
T3047 1802-1811 VBN denotes performed
T3048 1812-1816 IN denotes with
T3049 1817-1820 NNP denotes Pfu
T3050 1821-1826 NNP denotes Ultra
T3051 1827-1835 NNP denotes Hotstart
T3052 1836-1837 -LRB- denotes (
T3053 1837-1847 NNP denotes Stratagene
T3054 1847-1848 -RRB- denotes )
T3055 1849-1854 VBG denotes using
T3056 1855-1858 DT denotes the
T3057 1859-1868 JJ denotes following
T3058 1869-1874 NN denotes cycle
T3059 1875-1885 NNS denotes conditions
T3060 1885-1886 : denotes :
T3061 1887-1890 CD denotes one
T3062 1891-1896 NN denotes cycle
T3063 1897-1899 CD denotes 94
T3064 1899-1900 NN denotes °
T3065 1900-1901 NNP denotes C
T3066 1902-1905 IN denotes for
T3067 1906-1907 CD denotes 2
T3068 1908-1911 NN denotes min
T3069 1911-1912 : denotes ;
T3070 1913-1915 CD denotes 30
T3071 1916-1922 NNS denotes cycles
T3072 1923-1925 CD denotes 94
T3073 1925-1926 NN denotes °
T3074 1926-1927 NNP denotes C
T3075 1928-1931 IN denotes for
T3076 1932-1934 CD denotes 45
T3077 1935-1936 PRP denotes s
T3078 1936-1937 , denotes ,
T3079 1938-1940 CD denotes 58
T3080 1940-1941 NN denotes °
T3081 1941-1942 NNP denotes C
T3082 1943-1946 IN denotes for
T3083 1947-1949 CD denotes 45
T3084 1950-1951 PRP denotes s
T3085 1951-1952 , denotes ,
T3086 1953-1955 CD denotes 72
T3087 1955-1956 NN denotes °
T3088 1956-1957 NNP denotes C
T3089 1958-1961 IN denotes for
T3090 1962-1964 CD denotes 60
T3091 1965-1966 PRP denotes s
T3092 1966-1967 : denotes ;
T3093 1968-1971 CD denotes one
T3094 1972-1977 NN denotes cycle
T3095 1978-1980 CD denotes 72
T3096 1980-1981 NN denotes °
T3097 1981-1982 NNP denotes C
T3098 1983-1986 IN denotes for
T3099 1987-1988 CD denotes 7
T3100 1989-1992 NN denotes min
T3101 1992-1993 . denotes .
T3102 1994-1996 IN denotes As
T3103 1997-2000 IN denotes for
T3104 2001-2017 NN denotes pGL3-APOprom1025
T3105 2017-2018 , denotes ,
T3106 2019-2023 NNP denotes MluI
T3107 2024-2027 CC denotes and
T3108 2028-2033 NNP denotes BglII
T3109 2034-2045 NN denotes restriction
T3110 2046-2051 NNS denotes sites
T3111 2052-2056 VBD denotes were
T3112 2057-2067 VBN denotes introduced
T3113 2068-2071 IN denotes via
T3114 2072-2075 DT denotes the
T3115 2076-2083 NNS denotes primers
T3116 2084-2087 CC denotes and
T3117 2088-2091 NNP denotes PCR
T3118 2092-2100 NNS denotes products
T3119 2101-2105 VBD denotes were
T3120 2106-2113 VBN denotes ligated
T3121 2114-2118 IN denotes into
T3122 2119-2129 JJ denotes pGL3-Basic
T3123 2130-2131 -LRB- denotes (
T3124 2131-2138 NNP denotes Promega
T3125 2138-2139 -RRB- denotes )
T3126 2140-2143 IN denotes via
T3127 2144-2149 DT denotes these
T3128 2150-2161 NN denotes restriction
T3129 2162-2167 NNS denotes sites
T3130 2167-2168 . denotes .
T3131 2169-2187 NN denotes pGL3-APOprom180mut
T3132 2188-2195 VBZ denotes carries
T3133 2196-2199 CD denotes two
T3134 2200-2205 NN denotes point
T3135 2206-2215 NNS denotes mutations
T3136 2216-2217 -LRB- denotes (
T3137 2217-2221 JJ denotes bold
T3138 2221-2222 -RRB- denotes )
T3139 2223-2226 CC denotes and
T3140 2227-2230 VBD denotes was
T3141 2231-2240 VBN denotes generated
T3142 2241-2246 VBG denotes using
T3143 2247-2250 DT denotes the
T3144 2251-2257 NN denotes primer
T3145 2258-2270 NNP denotes 3GProm180mut
T3146 2271-2272 -LRB- denotes (
T3147 2272-2273 CD denotes 5
T3148 2273-2274 SYM denotes ′
T3149 2274-2275 : denotes -
T3150 2275-2331 NN denotes TGTGAACGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGTTCGGGACCACCAG-3
T3151 2331-2332 NN denotes ′
T3152 2332-2333 -RRB- denotes )
T3153 2334-2336 IN denotes in
T3154 2337-2348 NN denotes combination
T3155 2349-2353 IN denotes with
T3156 2354-2360 NN denotes primer
T3157 2361-2374 NNP denotes 3Gpromreverse
T3158 2374-2375 . denotes .
T3159 2376-2380 DT denotes This
T3160 2381-2384 NNP denotes PCR
T3161 2385-2388 VBD denotes was
T3162 2389-2398 VBN denotes performed
T3163 2399-2403 IN denotes with
T3164 2404-2406 DT denotes an
T3165 2407-2416 NN denotes annealing
T3166 2417-2428 NN denotes temperature
T3167 2429-2431 IN denotes of
T3168 2432-2434 CD denotes 65
T3169 2434-2435 CD denotes °
T3170 2435-2437 NNP denotes C.
T3171 2438-2448 NNP denotes pGL3promE1
T3172 2449-2450 -LRB- denotes (
T3173 2450-2460 VBG denotes containing
T3174 2461-2472 NNS denotes nucleotides
T3175 2473-2474 VBP denotes −
T3176 2474-2477 CD denotes 114
T3177 2477-2478 CD denotes /
T3178 2478-2479 NN denotes −
T3179 2479-2481 CD denotes 85
T3180 2481-2482 -RRB- denotes )
T3181 2483-2486 CC denotes and
T3182 2487-2497 NNP denotes pGL3promE2
T3183 2498-2499 -LRB- denotes (
T3184 2499-2509 VBG denotes containing
T3185 2510-2521 NNS denotes nucleotides
T3186 2522-2523 VBP denotes −
T3187 2523-2525 CD denotes 92
T3188 2525-2526 CD denotes /
T3189 2526-2527 NN denotes −
T3190 2527-2529 CD denotes 63
T3191 2529-2530 -RRB- denotes )
T3192 2531-2535 VBD denotes were
T3193 2536-2547 VBN denotes constructed
T3194 2548-2550 IN denotes by
T3195 2551-2560 VBG denotes annealing
T3196 2561-2564 DT denotes the
T3197 2565-2574 VBG denotes following
T3198 2575-2590 JJ denotes single-stranded
T3199 2591-2607 NNS denotes oligonucleotides
T3200 2607-2608 : denotes :
T3201 2609-2619 NNS denotes 114_85Plus
T3202 2620-2621 -LRB- denotes (
T3203 2621-2622 CD denotes 5
T3204 2622-2623 SYM denotes ′
T3205 2623-2624 : denotes -
T3206 2625-2663 NN denotes CGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGGA-3
T3207 2663-2664 NN denotes ′
T3208 2664-2665 -RRB- denotes )
T3209 2666-2669 CC denotes and
T3210 2670-2681 NNP denotes 114_85Minus
T3211 2682-2683 -LRB- denotes (
T3212 2683-2684 CD denotes 5
T3213 2684-2685 SYM denotes ′
T3214 2685-2686 : denotes -
T3215 2687-2725 NN denotes GATCTCCAGCTGGAGCCTCCTCTCCACCATCAAGAA-3
T3216 2725-2726 NN denotes ′
T3217 2726-2727 -RRB- denotes )
T3218 2728-2730 CC denotes or
T3219 2731-2740 NN denotes 92-63Plus
T3220 2741-2742 -LRB- denotes (
T3221 2742-2743 CD denotes 5
T3222 2743-2744 SYM denotes ′
T3223 2744-2745 : denotes -
T3224 2745-2783 NN denotes CGCGTCCAGCTGGGCGGGACCACCAGGGGAGGGGCA-3
T3225 2783-2784 NN denotes ′
T3226 2784-2785 -RRB- denotes )
T3227 2786-2789 CC denotes and
T3228 2790-2800 NNP denotes 92_63Minus
T3229 2801-2802 -LRB- denotes (
T3230 2802-2803 CD denotes 5
T3231 2803-2804 SYM denotes ′
T3232 2804-2805 : denotes -
T3233 2805-2843 NN denotes GATCTGCCCCTCCCCTGGTGGTCCCGCCCAGCTGGA-3
T3234 2843-2844 NN denotes ′
T3235 2844-2845 -RRB- denotes )
T3236 2845-2846 . denotes .
T3237 2847-2852 IN denotes After
T3238 2853-2862 VBG denotes annealing
T3239 2862-2863 , denotes ,
T3240 2864-2867 DT denotes the
T3241 2868-2883 JJ denotes double-stranded
T3242 2884-2900 NNS denotes oligonucleotides
T3243 2901-2906 WDT denotes which
T3244 2907-2916 VBD denotes contained
T3245 2917-2920 DT denotes the
T3246 2921-2931 JJ denotes respective
T3247 2932-2934 CD denotes 30
T3248 2935-2937 NN denotes bp
T3249 2938-2940 IN denotes of
T3250 2941-2944 DT denotes the
T3251 2945-2953 NNP denotes APOBEC3G
T3252 2954-2962 NN denotes promoter
T3253 2963-2966 CC denotes and
T3254 2967-2973 JJ denotes sticky
T3255 2974-2978 NNS denotes ends
T3256 2979-2989 JJ denotes compatible
T3257 2990-2994 IN denotes with
T3258 2995-2999 NNP denotes MluI
T3259 3000-3003 CC denotes and
T3260 3004-3009 NNP denotes BglII
T3261 3010-3021 NN denotes restriction
T3262 3022-3027 NNS denotes sites
T3263 3028-3032 VBD denotes were
T3264 3033-3040 VBN denotes ligated
T3265 3041-3045 IN denotes into
T3266 3046-3049 DT denotes the
T3267 3050-3063 NN denotes pGL3-Promoter
T3268 3064-3065 -LRB- denotes (
T3269 3065-3072 NNP denotes Promega
T3270 3072-3073 -RRB- denotes )
T3271 3074-3080 NN denotes vector
T3272 3080-3081 . denotes .
T3273 3082-3085 DT denotes The
T3274 3086-3095 NNS denotes sequences
T3275 3096-3098 IN denotes of
T3276 3099-3102 DT denotes all
T3277 3103-3114 VBN denotes constructed
T3278 3115-3123 NNS denotes plasmids
T3279 3124-3128 VBD denotes were
T3280 3129-3137 VBN denotes verified
T3281 3138-3140 IN denotes by
T3282 3141-3149 NN denotes sequence
T3283 3150-3158 NN denotes analysis
T3284 3158-3159 . denotes .
T3285 3160-3170 NNP denotes Nucleotide
T3286 3171-3172 NNP denotes −
T3287 3172-3175 CD denotes 219
T3288 3176-3178 IN denotes of
T3289 3179-3182 DT denotes the
T3290 3183-3189 VBN denotes cloned
T3291 3190-3198 NNP denotes APOBEC3G
T3292 3199-3207 NN denotes promoter
T3293 3208-3215 VBZ denotes differs
T3294 3216-3220 IN denotes from
T3295 3221-3224 DT denotes the
T3296 3225-3233 NN denotes sequence
T3297 3234-3236 IN denotes in
T3298 3237-3240 DT denotes the
T3299 3241-3249 NN denotes database
T3300 3250-3251 -LRB- denotes (
T3301 3251-3258 NNP denotes GenBank
T3302 3258-3259 NNP denotes ™
T3303 3260-3269 NN denotes accession
T3304 3270-3276 NN denotes number
T3305 3277-3285 NNP denotes DQ147772
T3306 3285-3286 -RRB- denotes )
T3307 3286-3287 . denotes .
T3308 3288-3290 DT denotes An
T3309 3291-3297 JJ denotes A-to-C
T3310 3298-3310 NN denotes substitution
T3311 3311-3313 VBZ denotes is
T3312 3314-3321 JJ denotes present
T3313 3322-3324 IN denotes at
T3314 3325-3329 DT denotes this
T3315 3330-3338 NN denotes position
T3316 3338-3339 . denotes .
T3317 3340-3349 VBG denotes Numbering
T3318 3350-3352 VBZ denotes is
T3319 3353-3361 JJ denotes relative
T3320 3362-3364 TO denotes to
T3321 3365-3368 DT denotes the
T3322 3369-3374 JJ denotes major
T3323 3375-3390 JJ denotes transcriptional
T3324 3391-3396 NN denotes start
T3325 3397-3401 NN denotes site
T3326 3402-3404 PRP denotes we
T3327 3405-3415 VBD denotes identified
T3328 3415-3416 . denotes .
T3329 3417-3420 DT denotes The
T3330 3421-3429 NN denotes reporter
T3331 3430-3438 NNS denotes plasmids
T3332 3439-3451 JJ denotes pGL3-Control
T3333 3452-3455 CC denotes and
T3334 3456-3463 JJ denotes phRG-TK
T3335 3464-3468 VBD denotes were
T3336 3469-3478 VBN denotes purchased
T3337 3479-3483 IN denotes from
T3338 3484-3491 NNP denotes Promega
T3339 3491-3492 . denotes .
T3340 3493-3501 NN denotes pGL2-CVX
T3341 3502-3510 VBZ denotes contains
T3342 3511-3514 CD denotes two
T3343 3515-3522 NNS denotes repeats
T3344 3523-3525 IN denotes of
T3345 3526-3529 DT denotes the
T3346 3530-3544 JJ denotes IFN-responsive
T3347 3545-3548 NNP denotes GAS
T3348 3549-3550 -LRB- denotes (
T3349 3550-3555 NN denotes gamma
T3350 3556-3565 VBN denotes activated
T3351 3566-3574 NN denotes sequence
T3352 3574-3575 -RRB- denotes )
T3353 3576-3584 NNS denotes elements
T3354 3585-3586 -LRB- denotes (
T3355 3586-3625 NNP denotes GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG
T3356 3625-3626 -RRB- denotes )
T3357 3627-3629 IN denotes of
T3358 3630-3633 DT denotes the
T3359 3634-3651 JJ denotes guanylate-binding
T3360 3652-3659 NN denotes protein
T3361 3660-3661 -LRB- denotes (
T3362 3661-3664 NNP denotes GBP
T3363 3664-3665 -RRB- denotes )
T3364 3666-3670 NN denotes gene
T3365 3671-3673 IN denotes in
T3366 3674-3679 NN denotes front
T3367 3680-3682 IN denotes of
T3368 3683-3684 DT denotes a
T3369 3685-3688 NNP denotes CMV
T3370 3689-3696 JJ denotes minimal
T3371 3697-3705 NN denotes promoter
T3372 3706-3709 CC denotes and
T3373 3710-3713 VBD denotes was
T3374 3714-3720 RB denotes kindly
T3375 3721-3729 VBN denotes provided
T3376 3730-3732 IN denotes by
T3377 3733-3736 NNP denotes Ute
T3378 3737-3744 NNP denotes Pägelow
T3379 3745-3748 CC denotes and
T3380 3749-3754 NNP denotes Mario
T3381 3755-3761 NNP denotes Köster
T3382 3762-3766 IN denotes from
T3383 3767-3770 DT denotes the
T3384 3771-3788 NNP denotes Helmholtz-Zentrum
T3385 3789-3792 NN denotes für
T3386 3793-3812 NNP denotes Infektionsforschung
T3387 3812-3813 . denotes .
T3388 3814-3821 NNP denotes Plasmid
T3389 3822-3828 NNP denotes pNL4-3
T3390 3829-3830 -LRB- denotes (
T3391 3830-3835 NNP denotes NIBSC
T3392 3835-3836 , denotes ,
T3393 3837-3839 NNP denotes UK
T3394 3839-3840 -RRB- denotes )
T3395 3841-3849 VBZ denotes contains
T3396 3850-3853 DT denotes the
T3397 3854-3865 JJ denotes full-length
T3398 3866-3876 JJ denotes HIV-1NL4-3
T3399 3877-3883 NN denotes genome
T3400 3884-3887 CC denotes and
T3401 3888-3891 VBZ denotes has
T3402 3892-3896 VBN denotes been
T3403 3897-3906 VBN denotes described
T3404 3907-3917 RB denotes previously
T3405 3918-3919 -LRB- denotes (
T3406 3919-3921 CD denotes 34
T3407 3921-3922 -RRB- denotes )
T3408 3922-3923 . denotes .
T3409 3924-3930 JJ denotes pcDNA3
T3410 3930-3932 CD denotes .1
T3411 3932-3935 NNP denotes Vif
T3412 3936-3939 VBD denotes was
T3413 3940-3950 RB denotes generously
T3414 3951-3959 VBN denotes provided
T3415 3960-3962 IN denotes by
T3416 3963-3972 NNP denotes Nathaniel
T3417 3973-3975 NNP denotes R.
T3418 3976-3982 NNP denotes Landau
T3419 3983-3987 IN denotes from
T3420 3988-3991 DT denotes the
T3421 3992-3996 NNP denotes Salk
T3422 3997-4006 NNP denotes Institute
T3423 4006-4007 , denotes ,
T3424 4008-4010 NNP denotes La
T3425 4011-4016 NNP denotes Jolla
T3426 4016-4017 . denotes .
T3427 4018-4020 PRP denotes It
T3428 4021-4024 VBD denotes was
T3429 4025-4034 VBN denotes generated
T3430 4035-4037 IN denotes by
T3431 4038-4048 VBG denotes amplifying
T3432 4049-4052 DT denotes the
T3433 4053-4056 NNP denotes Vif
T3434 4057-4061 NN denotes gene
T3435 4062-4066 IN denotes from
T3436 4067-4073 JJ denotes pNL4-3
T3437 4074-4077 CC denotes and
T3438 4078-4086 VBG denotes ligating
T3439 4087-4089 PRP denotes it
T3440 4090-4094 IN denotes into
T3441 4095-4098 DT denotes the
T3442 4099-4105 NNP denotes pcDNA3
T3443 4105-4107 CD denotes .1
T3444 4108-4114 NN denotes vector
T3445 4115-4118 IN denotes via
T3446 4119-4124 NNP denotes BamHI
T3447 4125-4128 CC denotes and
T3448 4129-4133 NNP denotes XhoI
T3449 4134-4145 NN denotes restriction
T3450 4146-4151 NNS denotes sites
T3451 4151-4152 . denotes .
T3452 4153-4154 DT denotes A
T3453 4155-4156 CD denotes 3
T3454 4156-4157 SYM denotes ′
T3455 4157-4158 : denotes -
T3456 4158-4162 NNP denotes WPRE
T3457 4163-4170 NN denotes element
T3458 4171-4174 VBD denotes was
T3459 4175-4183 VBN denotes included
T3460 4184-4188 IN denotes into
T3461 4189-4192 DT denotes the
T3462 4193-4197 NNP denotes XhoI
T3463 4198-4202 NN denotes site
T3464 4202-4203 . denotes .
T3465 4204-4222 NN denotes pBS-kRSPA-TatHIV-1
T3466 4222-4223 -LRB- denotes (
T3467 4223-4228 NN denotes NL4-3
T3468 4228-4229 -RRB- denotes )
T3469 4230-4233 VBD denotes was
T3470 4234-4245 VBN denotes constructed
T3471 4246-4248 IN denotes by
T3472 4249-4259 VBG denotes amplifying
T3473 4260-4263 DT denotes the
T3474 4264-4267 CD denotes two
T3475 4268-4273 NNS denotes exons
T3476 4274-4276 IN denotes of
T3477 4277-4280 NNP denotes Tat
T3478 4281-4284 IN denotes via
T3479 4285-4288 NNP denotes PCR
T3480 4289-4297 NN denotes reaction
T3481 4298-4303 VBG denotes using
T3482 4304-4307 DT denotes the
T3483 4308-4317 JJ denotes molecular
T3484 4318-4323 NN denotes clone
T3485 4324-4330 NN denotes pNL4-3
T3486 4331-4333 IN denotes as
T3487 4334-4342 NN denotes template
T3488 4343-4346 CC denotes and
T3489 4347-4350 DT denotes the
T3490 4351-4360 VBG denotes following
T3491 4361-4367 NN denotes primer
T3492 4368-4372 NNS denotes sets
T3493 4372-4373 : denotes :
T3494 4374-4379 CD denotes exon1
T3495 4379-4380 , denotes ,
T3496 4381-4399 NN denotes 5ÜXho1HIV-Tat1Plus
T3497 4400-4401 -LRB- denotes (
T3498 4401-4402 CD denotes 5
T3499 4402-4403 SYM denotes ′
T3500 4403-4404 : denotes -
T3501 4404-4437 NN denotes GCATGCTCGAGATGGAGCCAGTAGATCCTAG-3
T3502 4437-4438 NN denotes ′
T3503 4438-4439 -RRB- denotes )
T3504 4440-4443 CC denotes and
T3505 4444-4457 NNP denotes HIV-Tat1Minus
T3506 4458-4459 -LRB- denotes (
T3507 4459-4460 CD denotes 5
T3508 4460-4461 SYM denotes ′
T3509 4461-4462 : denotes -
T3510 4462-4487 NN denotes TGCTTTGATAGAGAAGCTTGATG-3
T3511 4487-4488 NN denotes ′
T3512 4488-4489 -RRB- denotes )
T3513 4489-4490 : denotes ;
T3514 4491-4496 CD denotes exon2
T3515 4496-4497 , denotes ,
T3516 4498-4513 NN denotes 15FHIV-Tat2Plus
T3517 4514-4515 -LRB- denotes (
T3518 4515-4516 CD denotes 5
T3519 4516-4517 SYM denotes ′
T3520 4517-4518 : denotes -
T3521 4518-4553 NN denotes TTCTCTATCAAAGCAACCCACCTCCCAATCCCG-3
T3522 4553-4554 NN denotes ′
T3523 4554-4555 -RRB- denotes )
T3524 4556-4559 CC denotes and
T3525 4560-4579 NNP denotes 5ÜSpe1HIV-Tat2Minus
T3526 4580-4581 -LRB- denotes (
T3527 4581-4582 CD denotes 5
T3528 4582-4583 SYM denotes ′
T3529 4583-4584 : denotes -
T3530 4584-4616 NN denotes GACGTACTAGTCTATTCCTTCGGGCCTGTC-3
T3531 4616-4617 NN denotes ′
T3532 4617-4618 -RRB- denotes )
T3533 4618-4619 . denotes .
T3534 4620-4624 NNP denotes XhoI
T3535 4625-4628 CC denotes and
T3536 4629-4633 NNP denotes SpeI
T3537 4634-4645 NN denotes restriction
T3538 4646-4651 NNS denotes sites
T3539 4652-4656 VBD denotes were
T3540 4657-4667 VBN denotes introduced
T3541 4668-4671 IN denotes via
T3542 4672-4675 DT denotes the
T3543 4676-4683 NNS denotes primers
T3544 4683-4684 . denotes .
T3545 4685-4688 DT denotes The
T3546 4689-4701 NN denotes sense-primer
T3547 4702-4704 IN denotes of
T3548 4705-4710 CD denotes exon2
T3549 4711-4717 NNS denotes starts
T3550 4718-4722 IN denotes with
T3551 4723-4724 DT denotes a
T3552 4725-4731 JJ denotes 15-mer
T3553 4732-4737 WDT denotes which
T3554 4738-4740 VBZ denotes is
T3555 4741-4751 RB denotes homologous
T3556 4752-4754 TO denotes to
T3557 4755-4758 DT denotes the
T3558 4759-4760 CD denotes 3
T3559 4760-4761 NN denotes ′
T3560 4762-4765 NN denotes end
T3561 4766-4768 IN denotes of
T3562 4769-4774 CD denotes exon1
T3563 4775-4778 CC denotes and
T3564 4779-4788 JJ denotes necessary
T3565 4789-4792 IN denotes for
T3566 4793-4799 NN denotes fusion
T3567 4800-4802 IN denotes of
T3568 4803-4807 DT denotes both
T3569 4808-4813 NNS denotes exons
T3570 4813-4814 . denotes .
T3571 4815-4819 NNS denotes PCRs
T3572 4820-4824 VBD denotes were
T3573 4825-4834 VBN denotes performed
T3574 4835-4839 IN denotes with
T3575 4840-4846 NNP denotes Expand
T3576 4847-4851 NNP denotes High
T3577 4852-4860 NNP denotes Fidelity
T3578 4861-4864 NNP denotes PCR
T3579 4865-4871 NNP denotes System
T3580 4872-4873 -LRB- denotes (
T3581 4873-4878 NNP denotes Roche
T3582 4878-4879 -RRB- denotes )
T3583 4880-4885 VBG denotes using
T3584 4886-4889 DT denotes the
T3585 4890-4899 JJ denotes following
T3586 4900-4910 NNS denotes conditions
T3587 4910-4911 : denotes :
T3588 4912-4915 CD denotes one
T3589 4916-4921 NN denotes cycle
T3590 4922-4924 CD denotes 94
T3591 4924-4925 NN denotes °
T3592 4925-4926 NNP denotes C
T3593 4927-4930 IN denotes for
T3594 4931-4932 CD denotes 3
T3595 4933-4936 NN denotes min
T3596 4936-4937 : denotes ;
T3597 4938-4940 CD denotes 35
T3598 4941-4947 NNS denotes cycles
T3599 4948-4950 CD denotes 94
T3600 4950-4951 NN denotes °
T3601 4951-4952 NNP denotes C
T3602 4953-4956 IN denotes for
T3603 4957-4959 CD denotes 45
T3604 4960-4961 PRP denotes s
T3605 4961-4962 , denotes ,
T3606 4963-4965 CD denotes 55
T3607 4965-4966 NN denotes °
T3608 4966-4967 NNP denotes C
T3609 4968-4971 IN denotes for
T3610 4972-4974 CD denotes 45
T3611 4975-4976 PRP denotes s
T3612 4976-4977 , denotes ,
T3613 4978-4980 CD denotes 68
T3614 4980-4981 NN denotes °
T3615 4981-4982 NNP denotes C
T3616 4983-4986 IN denotes for
T3617 4987-4989 CD denotes 45
T3618 4990-4991 PRP denotes s
T3619 4991-4992 : denotes ;
T3620 4993-4996 CD denotes one
T3621 4997-5002 NN denotes cycle
T3622 5003-5005 CD denotes 68
T3623 5005-5006 NN denotes °
T3624 5006-5007 NNP denotes C
T3625 5008-5011 IN denotes for
T3626 5012-5013 CD denotes 7
T3627 5014-5017 NN denotes min
T3628 5017-5018 . denotes .
T3629 5019-5022 IN denotes For
T3630 5023-5029 NN denotes fusion
T3631 5030-5032 IN denotes of
T3632 5033-5037 DT denotes both
T3633 5038-5043 NNS denotes exons
T3634 5043-5044 , denotes ,
T3635 5045-5048 DT denotes the
T3636 5049-5058 VBG denotes following
T3637 5059-5062 NNP denotes PCR
T3638 5063-5073 NNS denotes conditions
T3639 5074-5078 VBD denotes were
T3640 5079-5086 VBN denotes applied
T3641 5086-5087 : denotes :
T3642 5088-5091 CD denotes one
T3643 5092-5097 NN denotes cycle
T3644 5098-5100 CD denotes 94
T3645 5100-5101 NN denotes °
T3646 5101-5102 NNP denotes C
T3647 5103-5106 IN denotes for
T3648 5107-5108 CD denotes 3
T3649 5109-5112 NN denotes min
T3650 5112-5113 : denotes ;
T3651 5114-5116 CD denotes 35
T3652 5117-5123 NNS denotes cycles
T3653 5124-5126 CD denotes 94
T3654 5126-5127 NN denotes °
T3655 5127-5128 NNP denotes C
T3656 5129-5132 IN denotes for
T3657 5133-5135 CD denotes 45
T3658 5136-5137 PRP denotes s
T3659 5137-5138 , denotes ,
T3660 5139-5141 CD denotes 58
T3661 5141-5142 NN denotes °
T3662 5142-5143 NNP denotes C
T3663 5144-5147 IN denotes for
T3664 5148-5150 CD denotes 45
T3665 5151-5152 PRP denotes s
T3666 5152-5153 , denotes ,
T3667 5154-5156 CD denotes 68
T3668 5156-5157 NN denotes °
T3669 5157-5158 NNP denotes C
T3670 5159-5162 IN denotes for
T3671 5163-5165 CD denotes 60
T3672 5166-5167 PRP denotes s
T3673 5167-5168 . denotes .
T3674 5169-5174 IN denotes After
T3675 5175-5177 CD denotes 10
T3676 5178-5184 NNS denotes cycles
T3677 5185-5192 IN denotes without
T3678 5193-5200 NNS denotes primers
T3679 5200-5201 , denotes ,
T3680 5202-5205 DT denotes the
T3681 5206-5218 NN denotes sense-primer
T3682 5219-5221 IN denotes of
T3683 5222-5227 CD denotes exon1
T3684 5228-5231 CC denotes and
T3685 5232-5235 DT denotes the
T3686 5236-5252 NN denotes antisense-primer
T3687 5253-5255 IN denotes of
T3688 5256-5261 CD denotes exon2
T3689 5262-5266 VBD denotes were
T3690 5267-5272 VBN denotes added
T3691 5273-5276 IN denotes for
T3692 5277-5280 DT denotes the
T3693 5281-5290 VBG denotes remaining
T3694 5291-5297 NNS denotes cycles
T3695 5297-5298 . denotes .
T3696 5299-5302 DT denotes The
T3697 5303-5312 VBG denotes resulting
T3698 5313-5321 NN denotes amplicon
T3699 5322-5325 VBD denotes was
T3700 5326-5333 VBN denotes ligated
T3701 5334-5338 IN denotes into
T3702 5339-5342 DT denotes the
T3703 5343-5352 JJ denotes pBS-kRSPA
T3704 5353-5359 NN denotes vector
T3705 5360-5361 -LRB- denotes (
T3706 5361-5363 CD denotes 35
T3707 5363-5364 -RRB- denotes )
T3708 5365-5368 IN denotes via
T3709 5369-5373 NNP denotes XhoI
T3710 5374-5377 CC denotes and
T3711 5378-5382 NNP denotes SpeI
T3712 5383-5394 NN denotes restriction
T3713 5395-5400 NNS denotes sites
T3714 5400-5401 . denotes .
R2131 T2715 T2728 nsubjpass Plasmids,prepared
R2132 T2716 T2728 prep For,prepared
R2133 T2717 T2716 pobj cloning,For
R2134 T2718 T2717 prep of,cloning
R2135 T2719 T2723 det an,plasmid
R2136 T2720 T2722 nmod APOBEC3G,reporter
R2137 T2721 T2722 compound promoter-driven,reporter
R2138 T2722 T2723 compound reporter,plasmid
R2139 T2723 T2718 pobj plasmid,of
R2140 T2724 T2728 punct ",",prepared
R2141 T2725 T2726 amod genomic,DNA
R2142 T2726 T2728 nsubjpass DNA,prepared
R2143 T2727 T2728 auxpass was,prepared
R2144 T2728 T2728 ROOT prepared,prepared
R2145 T2729 T2728 prep from,prepared
R2146 T2730 T2733 det the,line
R2147 T2731 T2732 compound T,cell
R2148 T2732 T2733 compound cell,line
R2150 T2734 T2733 nummod PM1,line
R2151 T2735 T2728 advcl using,prepared
R2152 T2736 T2738 det the,Kit
R2153 T2737 T2738 compound DNeasy,Kit
R2154 T2738 T2735 dobj Kit,using
R2155 T2739 T2740 punct (,Qiagen
R2156 T2740 T2738 appos Qiagen,Kit
R2157 T2741 T2738 punct ),Kit
R2158 T2742 T2728 punct .,prepared
R2159 T2743 T2745 det The,sequence
R2160 T2744 T2745 compound DNA,sequence
R2161 T2745 T2749 nsubj sequence,−
R2162 T2746 T2745 acl ranging,sequence
R2163 T2747 T2746 prep from,ranging
R2164 T2748 T2747 pobj positions,from
R2165 T2749 T2749 ROOT −,−
R2166 T2750 T2760 nsubjpass 959,amplified
R2167 T2751 T2750 prep to,959
R2168 T2752 T2751 pobj +66,to
R2169 T2753 T2751 amod relative,to
R2170 T2754 T2753 prep to,relative
R2171 T2755 T2758 det the,start
R2172 T2756 T2758 amod identified,start
R2173 T2757 T2758 compound transcription,start
R2174 T2758 T2754 pobj start,to
R2175 T2759 T2760 auxpass was,amplified
R2176 T2760 T2749 ccomp amplified,−
R2177 T2761 T2760 prep via,amplified
R2178 T2762 T2761 pobj PCR,via
R2179 T2763 T2760 advcl using,amplified
R2180 T2764 T2765 det the,primers
R2181 T2765 T2763 dobj primers,using
R2182 T2766 T2765 appos 3Gprom1025,primers
R2183 T2767 T2768 punct (,5
R2184 T2768 T2772 nummod 5,′
R2185 T2769 T2771 punct ′,TGTGAACGCGTTGCTGCAGGCCATCTGGATGTATATG-3
R2186 T2770 T2771 punct -,TGTGAACGCGTTGCTGCAGGCCATCTGGATGTATATG-3
R2187 T2771 T2772 compound TGTGAACGCGTTGCTGCAGGCCATCTGGATGTATATG-3,′
R2188 T2772 T2766 appos ′,3Gprom1025
R2189 T2773 T2766 punct ),3Gprom1025
R2190 T2774 T2765 cc and,primers
R2191 T2775 T2765 conj 3Gpromreverse,primers
R2192 T2776 T2777 punct (,5
R2193 T2777 T2781 nummod 5,′
R2194 T2778 T2777 punct ′,5
R2195 T2779 T2780 punct -,ACAGCAGATCTAGGGACCTCTGATAAAGACAGG-3
R2196 T2780 T2781 compound ACAGCAGATCTAGGGACCTCTGATAAAGACAGG-3,′
R2197 T2781 T2775 appos ′,3Gpromreverse
R2198 T2782 T2781 punct ),′
R2199 T2783 T2749 punct .,−
R2200 T2784 T2785 compound PCR,reactions
R2201 T2785 T2787 nsubjpass reactions,performed
R2202 T2786 T2787 auxpass were,performed
R2203 T2787 T2837 ccomp performed,C
R2204 T2788 T2787 prep with,performed
R2205 T2789 T2791 compound Pwo,Polymerase
R2206 T2790 T2791 compound DNA,Polymerase
R2207 T2791 T2788 pobj Polymerase,with
R2208 T2792 T2791 punct (,Polymerase
R2209 T2793 T2791 appos Roche,Polymerase
R2210 T2794 T2791 punct ),Polymerase
R2211 T2795 T2787 advcl using,performed
R2212 T2796 T2799 det the,conditions
R2213 T2797 T2799 amod following,conditions
R2214 T2798 T2799 compound cycle,conditions
R2215 T2799 T2795 dobj conditions,using
R2216 T2800 T2799 punct :,conditions
R2217 T2801 T2802 nummod one,cycle
R2218 T2802 T2799 appos cycle,conditions
R2219 T2803 T2804 nummod 94,°
R2220 T2804 T2805 compound °,C
R2221 T2805 T2802 appos C,cycle
R2222 T2806 T2805 prep for,C
R2223 T2807 T2808 nummod 2,min
R2224 T2808 T2806 pobj min,for
R2225 T2809 T2805 punct ;,C
R2226 T2810 T2811 nummod 30,cycles
R2227 T2811 T2805 appos cycles,C
R2228 T2812 T2813 nummod 94,°
R2229 T2813 T2814 compound °,C
R2230 T2814 T2805 appos C,C
R2231 T2815 T2799 prep for,conditions
R2232 T2816 T2815 pobj 30,for
R2233 T2817 T2795 npadvmod s,using
R2234 T2818 T2821 punct ",",C
R2235 T2819 T2820 nummod 58,°
R2236 T2820 T2821 compound °,C
R2237 T2821 T2787 npadvmod C,performed
R2238 T2822 T2787 prep for,performed
R2239 T2823 T2824 nummod 60,s
R2240 T2824 T2822 pobj s,for
R2241 T2825 T2824 punct ",",s
R2242 T2826 T2828 nummod 72,C
R2243 T2827 T2828 compound °,C
R2244 T2828 T2824 appos C,s
R2245 T2829 T2787 prep for,performed
R2246 T2830 T2831 nummod 60,s
R2247 T2831 T2829 pobj s,for
R2248 T2832 T2837 punct ;,C
R2249 T2833 T2834 nummod one,cycle
R2250 T2834 T2837 compound cycle,C
R2251 T2835 T2836 nummod 72,°
R2252 T2836 T2837 compound °,C
R2253 T2837 T2837 ROOT C,C
R2254 T2838 T2837 prep for,C
R2255 T2839 T2840 nummod 7,min
R2256 T2840 T2838 pobj min,for
R2257 T2841 T2837 punct .,C
R2258 T2842 T2843 det The,amplicon
R2259 T2843 T2845 nsubjpass amplicon,ligated
R2260 T2844 T2845 auxpass was,ligated
R2261 T2845 T2845 ROOT ligated,ligated
R2262 T2846 T2845 prep into,ligated
R2263 T2847 T2850 det the,reporter
R2264 T2848 T2850 amod promoterless,reporter
R2265 T2849 T2850 compound luciferase,reporter
R2266 T2850 T2846 pobj reporter,into
R2267 T2851 T2852 compound plasmid,pGL3-Basic
R2268 T2852 T2852 ROOT pGL3-Basic,pGL3-Basic
R2269 T2853 T2852 punct (,pGL3-Basic
R2270 T2854 T2852 appos Promega,pGL3-Basic
R2271 T2855 T2852 punct ),pGL3-Basic
R2272 T2856 T2845 prep via,ligated
R2273 T2857 T2861 nmod MluI,sites
R2274 T2858 T2857 cc and,MluI
R2275 T2859 T2857 conj BglII,MluI
R2276 T2860 T2861 compound restriction,sites
R2277 T2861 T2856 pobj sites,via
R2278 T2862 T2861 punct ",",sites
R2279 T2863 T2865 nsubjpass which,introduced
R2280 T2864 T2865 auxpass were,introduced
R2281 T2865 T2861 relcl introduced,sites
R2282 T2866 T2865 agent by,introduced
R2283 T2867 T2868 det the,primers
R2284 T2868 T2866 pobj primers,by
R2285 T2869 T2845 punct .,ligated
R2286 T2870 T2872 det The,construct
R2287 T2871 T2872 amod resulting,construct
R2288 T2872 T2873 nsubj construct,contained
R2289 T2873 T2873 ROOT contained,contained
R2290 T2874 T2875 nummod 1025,bp
R2291 T2875 T2873 dobj bp,contained
R2292 T2876 T2875 prep of,bp
R2293 T2877 T2879 det the,promoter
R2294 T2878 T2879 compound A3G,promoter
R2295 T2879 T2876 pobj promoter,of
R2296 T2880 T2873 cc and,contained
R2297 T2881 T2882 auxpass was,designated
R2298 T2882 T2873 conj designated,contained
R2299 T2883 T2882 oprd pGL3-APOprom1025,designated
R2300 T2884 T2873 punct .,contained
R2301 T2885 T2886 compound Reporter,plasmids
R2302 T2886 T2895 nsubjpass plasmids,constructed
R2303 T2887 T2886 acl containing,plasmids
R2304 T2888 T2889 amod shorter,fragments
R2306 T2890 T2889 prep of,fragments
R2308 T2892 T2893 compound APOBEC3G,promoter
R2309 T2893 T2890 pobj promoter,of
R2310 T2894 T2895 auxpass were,constructed
R2311 T2895 T3016 ccomp constructed,sequence
R2312 T2896 T2895 advcl using,constructed
R2313 T2897 T2896 dobj pGL3-APOprom1025,using
R2314 T2898 T2896 prep as,using
R2315 T2899 T2898 pobj template,as
R2316 T2900 T2899 cc and,template
R2317 T2901 T2902 det the,following
R2318 T2902 T2899 conj following,template
R2319 T2903 T2904 amod forward,primers
R2320 T2904 T2902 pobj primers,following
R2321 T2905 T2902 punct :,following
R2322 T2906 T2902 prep for,following
R2323 T2907 T2908 amod plasmid,pGL3-APOprom502
R2324 T2908 T2906 pobj pGL3-APOprom502,for
R2325 T2909 T2916 punct (,)
R2326 T2910 T2916 amod containing,)
R2327 T2911 T2912 compound sequence,−
R2328 T2912 T2914 dep −,/
R2329 T2913 T2914 nummod 436,/
R2330 T2914 T2916 dep /,)
R2331 T2915 T2914 nummod +66,/
R2332 T2916 T2902 acl ),following
R2333 T2917 T2924 punct :,′
R2334 T2918 T2924 compound 3Gprom502,′
R2335 T2919 T2920 punct (,5
R2336 T2920 T2923 meta 5,TGTGAACGCGTTCCATAACATGGGGACAAGA-3
R2337 T2921 T2920 punct ′,5
R2338 T2922 T2923 punct -,TGTGAACGCGTTCCATAACATGGGGACAAGA-3
R2339 T2923 T2924 compound TGTGAACGCGTTCCATAACATGGGGACAAGA-3,′
R2340 T2924 T3016 nmod ′,sequence
R2341 T2925 T2924 punct ),′
R2342 T2926 T3016 punct ;,sequence
R2343 T2927 T3016 prep for,sequence
R2344 T2928 T2927 pobj plasmid,for
R2345 T2929 T3016 ccomp pGL3-APOprom225,sequence
R2346 T2930 T2931 punct (,containing
R2347 T2931 T2929 acl containing,pGL3-APOprom225
R2348 T2932 T2933 compound sequence,−
R2349 T2933 T2931 dobj −,containing
R2350 T2934 T2935 nummod 159,/
R2351 T2935 T2931 npadvmod /,containing
R2352 T2936 T2935 appos +66,/
R2353 T2937 T2935 punct ),/
R2354 T2938 T2939 punct :,3Gprom225
R2355 T2939 T2935 appos 3Gprom225,/
R2356 T2940 T2941 punct (,5
R2357 T2941 T2945 nummod 5,′
R2358 T2942 T2944 punct ′,TGTGAACGCGTCGAGGGCAGGATCCGGGAGT-3
R2359 T2943 T2944 punct -,TGTGAACGCGTCGAGGGCAGGATCCGGGAGT-3
R2360 T2944 T2945 compound TGTGAACGCGTCGAGGGCAGGATCCGGGAGT-3,′
R2361 T2945 T2939 appos ′,3Gprom225
R2362 T2946 T2939 punct ),3Gprom225
R2363 T2947 T3016 punct ;,sequence
R2364 T2948 T3016 prep for,sequence
R2365 T2949 T2948 pobj plasmid,for
R2366 T2950 T3016 nmod pGL3-APOprom180,sequence
R2367 T2951 T2953 punct (,sequence
R2368 T2952 T2953 amod containing,sequence
R2369 T2953 T3016 nmod sequence,sequence
R2370 T2954 T3016 nummod −,sequence
R2371 T2955 T2956 nummod 114,/
R2372 T2956 T3016 nmod /,sequence
R2373 T2957 T2956 appos +66,/
R2374 T2958 T2956 punct ),/
R2375 T2959 T2956 punct :,/
R2376 T2960 T2956 appos 3Gprom180,/
R2377 T2961 T2962 punct (,5
R2378 T2962 T2960 nummod 5,3Gprom180
R2379 T2963 T2962 punct ′,5
R2380 T2964 T2965 punct -,TGTGAACGCGTTCTTGATGGTGGAGAGGAGG-3
R2381 T2965 T2956 appos TGTGAACGCGTTCTTGATGGTGGAGAGGAGG-3,/
R2382 T2966 T2965 appos ′,TGTGAACGCGTTCTTGATGGTGGAGAGGAGG-3
R2383 T2967 T2965 punct ),TGTGAACGCGTTCTTGATGGTGGAGAGGAGG-3
R2384 T2968 T3016 punct ;,sequence
R2388 T2972 T2974 punct (,sequence
R2389 T2973 T2974 amod containing,sequence
R2390 T2974 T3016 nmod sequence,sequence
R2391 T2975 T2978 nummod −,+66
R2392 T2976 T2977 nummod 84,/
R2393 T2977 T2978 compound /,+66
R2394 T2978 T2974 appos +66,sequence
R2395 T2979 T2974 punct ),sequence
R2396 T2980 T2974 punct :,sequence
R2397 T2981 T2987 compound 3Gprom150,′
R2398 T2982 T2983 punct (,5
R2399 T2983 T2986 nummod 5,TGTGAACGCGTGCGGGACCACCAGGGGAGGGGCTT-3
R2400 T2984 T2986 punct ′,TGTGAACGCGTGCGGGACCACCAGGGGAGGGGCTT-3
R2401 T2985 T2986 punct -,TGTGAACGCGTGCGGGACCACCAGGGGAGGGGCTT-3
R2402 T2986 T2987 compound TGTGAACGCGTGCGGGACCACCAGGGGAGGGGCTT-3,′
R2403 T2987 T2974 appos ′,sequence
R2404 T2988 T2974 punct ),sequence
R2405 T2989 T3016 punct ;,sequence
R2406 T2990 T3016 prep for,sequence
R2407 T2991 T2990 pobj plasmid,for
R2408 T2992 T3016 nmod pGL3-APOprom120,sequence
R2409 T2993 T3016 punct (,sequence
R2410 T2994 T3016 amod containing,sequence
R2411 T2995 T2996 compound sequence,−
R2412 T2996 T2994 dobj −,containing
R2413 T2997 T2998 nummod 54,/
R2414 T2998 T3000 dep /,)
R2415 T2999 T2998 nummod +66,/
R2416 T3000 T2994 punct ),containing
R2417 T3001 T3002 punct :,3Gprom120
R2418 T3002 T3016 meta 3Gprom120,sequence
R2419 T3003 T3002 punct (,3Gprom120
R2420 T3004 T3007 nummod 5,TGTGAACGCGTTGCTGGCTCAGCCTGGTGTG-3
R2421 T3005 T3007 punct ′,TGTGAACGCGTTGCTGGCTCAGCCTGGTGTG-3
R2422 T3006 T3007 punct -,TGTGAACGCGTTGCTGGCTCAGCCTGGTGTG-3
R2423 T3007 T3008 compound TGTGAACGCGTTGCTGGCTCAGCCTGGTGTG-3,′
R2424 T3008 T3002 appos ′,3Gprom120
R2425 T3009 T3002 punct ),3Gprom120
R2426 T3010 T3016 punct ;,sequence
R2427 T3011 T3016 prep for,sequence
R2428 T3012 T3011 pobj plasmid,for
R2429 T3013 T3016 nmod pGL3-APOprom60,sequence
R2430 T3014 T3016 punct (,sequence
R2431 T3015 T3016 amod containing,sequence
R2432 T3016 T3032 ccomp sequence,in
R2433 T3017 T3016 nummod +7,sequence
R2434 T3018 T3016 appos /,sequence
R2435 T3019 T3018 nummod +66,/
R2436 T3020 T3016 punct ),sequence
R2437 T3021 T3016 punct :,sequence
R2438 T3022 T3028 compound 3Gprom60,′
R2439 T3023 T3024 punct (,5
R2440 T3024 T3027 nummod 5,TGTGAACGCGTCCCTTTGCAATTGCCTTG-3
R2441 T3025 T3027 punct ′,TGTGAACGCGTCCCTTTGCAATTGCCTTG-3
R2442 T3026 T3027 punct -,TGTGAACGCGTCCCTTTGCAATTGCCTTG-3
R2443 T3027 T3028 compound TGTGAACGCGTCCCTTTGCAATTGCCTTG-3,′
R2444 T3028 T3016 appos ′,sequence
R2445 T3029 T3016 punct ),sequence
R2446 T3030 T3032 punct ;,in
R2447 T3031 T3032 nsubj each,in
R2448 T3032 T3040 prep in,described
R2449 T3033 T3032 pobj combination,in
R2450 T3034 T3040 prep with,described
R2451 T3035 T3037 det the,primer
R2452 T3036 T3037 amod reverse,primer
R2453 T3037 T3034 pobj primer,with
R2454 T3038 T3040 nsubj 3Gpromreverse,described
R2455 T3039 T3040 punct (,described
R2456 T3040 T3040 ROOT described,described
R2457 T3041 T3040 advmod above,described
R2458 T3042 T3040 punct ),described
R2459 T3043 T3040 punct .,described
R2460 T3044 T3045 compound PCR,reactions
R2461 T3045 T3047 nsubjpass reactions,performed
R2462 T3046 T3047 auxpass were,performed
R2463 T3047 T3097 ccomp performed,C
R2464 T3048 T3047 prep with,performed
R2465 T3049 T3051 compound Pfu,Hotstart
R2466 T3050 T3051 compound Ultra,Hotstart
R2467 T3051 T3048 pobj Hotstart,with
R2468 T3052 T3051 punct (,Hotstart
R2469 T3053 T3051 appos Stratagene,Hotstart
R2470 T3054 T3051 punct ),Hotstart
R2471 T3055 T3047 advcl using,performed
R2472 T3056 T3059 det the,conditions
R2473 T3057 T3059 amod following,conditions
R2474 T3058 T3059 compound cycle,conditions
R2475 T3059 T3055 dobj conditions,using
R2476 T3060 T3059 punct :,conditions
R2477 T3061 T3062 nummod one,cycle
R2478 T3062 T3059 appos cycle,conditions
R2479 T3063 T3064 nummod 94,°
R2480 T3064 T3065 compound °,C
R2481 T3065 T3062 appos C,cycle
R2482 T3066 T3065 prep for,C
R2483 T3067 T3068 nummod 2,min
R2484 T3068 T3066 pobj min,for
R2485 T3069 T3062 punct ;,cycle
R2486 T3070 T3071 nummod 30,cycles
R2487 T3071 T3062 appos cycles,cycle
R2488 T3072 T3073 nummod 94,°
R2489 T3073 T3074 compound °,C
R2490 T3074 T3062 appos C,cycle
R2491 T3075 T3074 prep for,C
R2492 T3076 T3075 pobj 45,for
R2493 T3077 T3074 appos s,C
R2494 T3078 T3074 punct ",",C
R2495 T3079 T3080 nummod 58,°
R2496 T3080 T3081 compound °,C
R2497 T3081 T3074 appos C,C
R2498 T3082 T3081 prep for,C
R2499 T3083 T3084 nummod 45,s
R2500 T3084 T3082 pobj s,for
R2501 T3085 T3084 punct ",",s
R2502 T3086 T3088 nummod 72,C
R2503 T3087 T3088 compound °,C
R2504 T3088 T3084 appos C,s
R2505 T3089 T3055 prep for,using
R2506 T3090 T3091 nummod 60,s
R2507 T3091 T3089 pobj s,for
R2508 T3092 T3097 punct ;,C
R2509 T3093 T3094 nummod one,cycle
R2510 T3094 T3097 compound cycle,C
R2511 T3095 T3096 nummod 72,°
R2512 T3096 T3097 compound °,C
R2513 T3097 T3097 ROOT C,C
R2514 T3098 T3097 prep for,C
R2515 T3099 T3100 nummod 7,min
R2516 T3100 T3098 pobj min,for
R2517 T3101 T3097 punct .,C
R2518 T3102 T3112 prep As,introduced
R2519 T3103 T3102 prep for,As
R2520 T3104 T3103 pobj pGL3-APOprom1025,for
R2521 T3105 T3104 punct ",",pGL3-APOprom1025
R2522 T3106 T3110 nmod MluI,sites
R2523 T3107 T3106 cc and,MluI
R2524 T3108 T3106 conj BglII,MluI
R2525 T3109 T3110 compound restriction,sites
R2526 T3110 T3112 nsubjpass sites,introduced
R2527 T3111 T3112 auxpass were,introduced
R2528 T3112 T3112 ROOT introduced,introduced
R2529 T3113 T3112 prep via,introduced
R2530 T3114 T3115 det the,primers
R2531 T3115 T3113 pobj primers,via
R2532 T3116 T3115 cc and,primers
R2533 T3117 T3118 compound PCR,products
R2534 T3118 T3115 conj products,primers
R2535 T3119 T3120 auxpass were,ligated
R2536 T3120 T3112 conj ligated,introduced
R2537 T3121 T3120 prep into,ligated
R2538 T3122 T3121 pobj pGL3-Basic,into
R2539 T3123 T3122 punct (,pGL3-Basic
R2540 T3124 T3122 appos Promega,pGL3-Basic
R2541 T3125 T3122 punct ),pGL3-Basic
R2542 T3126 T3120 prep via,ligated
R2543 T3127 T3129 det these,sites
R2544 T3128 T3129 compound restriction,sites
R2545 T3129 T3126 pobj sites,via
R2546 T3130 T3112 punct .,introduced
R2547 T3131 T3132 nsubj pGL3-APOprom180mut,carries
R2548 T3132 T3132 ROOT carries,carries
R2549 T3133 T3135 nummod two,mutations
R2550 T3134 T3135 compound point,mutations
R2551 T3135 T3132 dobj mutations,carries
R2552 T3136 T3135 punct (,mutations
R2553 T3137 T3135 appos bold,mutations
R2554 T3138 T3135 punct ),mutations
R2555 T3139 T3132 cc and,carries
R2556 T3140 T3141 auxpass was,generated
R2557 T3141 T3132 conj generated,carries
R2558 T3142 T3141 advcl using,generated
R2559 T3143 T3151 det the,′
R2560 T3144 T3151 nmod primer,′
R2561 T3145 T3144 appos 3GProm180mut,primer
R2562 T3146 T3147 punct (,5
R2563 T3147 T3150 nummod 5,TGTGAACGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGTTCGGGACCACCAG-3
R2564 T3148 T3150 punct ′,TGTGAACGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGTTCGGGACCACCAG-3
R2565 T3149 T3150 punct -,TGTGAACGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGTTCGGGACCACCAG-3
R2566 T3150 T3151 compound TGTGAACGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGTTCGGGACCACCAG-3,′
R2567 T3151 T3142 dobj ′,using
R2568 T3152 T3151 punct ),′
R2569 T3153 T3142 prep in,using
R2570 T3154 T3153 pobj combination,in
R2571 T3155 T3154 prep with,combination
R2572 T3156 T3157 compound primer,3Gpromreverse
R2573 T3157 T3155 pobj 3Gpromreverse,with
R2574 T3158 T3132 punct .,carries
R2575 T3159 T3160 det This,PCR
R2576 T3160 T3162 nsubjpass PCR,performed
R2577 T3161 T3162 auxpass was,performed
R2578 T3162 T3162 ROOT performed,performed
R2579 T3163 T3162 prep with,performed
R2580 T3164 T3166 det an,temperature
R2581 T3165 T3166 compound annealing,temperature
R2582 T3166 T3163 pobj temperature,with
R2583 T3167 T3166 prep of,temperature
R2584 T3168 T3171 nummod 65,pGL3promE1
R2585 T3169 T3171 nummod °,pGL3promE1
R2586 T3170 T3171 compound C.,pGL3promE1
R2587 T3171 T3167 pobj pGL3promE1,of
R2588 T3172 T3173 punct (,containing
R2589 T3173 T3171 acl containing,pGL3promE1
R2590 T3174 T3173 dobj nucleotides,containing
R2591 T3175 T3178 nmod −,−
R2592 T3176 T3177 compound 114,/
R2593 T3177 T3178 punct /,−
R2594 T3178 T3193 nsubjpass −,constructed
R2595 T3179 T3178 nummod 85,−
R2596 T3180 T3178 punct ),−
R2597 T3181 T3178 cc and,−
R2598 T3182 T3178 conj pGL3promE2,−
R2599 T3183 T3184 punct (,containing
R2600 T3184 T3193 nsubjpass containing,constructed
R2601 T3185 T3184 dobj nucleotides,containing
R2602 T3186 T3184 prep −,containing
R2603 T3187 T3189 nummod 92,−
R2604 T3188 T3189 punct /,−
R2605 T3189 T3186 appos −,−
R2606 T3190 T3189 nummod 63,−
R2607 T3191 T3189 punct ),−
R2608 T3192 T3193 auxpass were,constructed
R2609 T3193 T3162 conj constructed,performed
R2610 T3194 T3193 agent by,constructed
R2611 T3195 T3194 pcomp annealing,by
R2612 T3196 T3199 det the,oligonucleotides
R2613 T3197 T3199 amod following,oligonucleotides
R2614 T3198 T3199 amod single-stranded,oligonucleotides
R2615 T3199 T3195 dobj oligonucleotides,annealing
R2616 T3200 T3199 punct :,oligonucleotides
R2617 T3201 T3199 appos 114_85Plus,oligonucleotides
R2618 T3202 T3203 punct (,5
R2619 T3203 T3207 nummod 5,′
R2620 T3204 T3206 punct ′,CGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGGA-3
R2621 T3205 T3206 punct -,CGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGGA-3
R2622 T3206 T3207 compound CGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGGA-3,′
R2623 T3207 T3201 appos ′,114_85Plus
R2624 T3208 T3201 punct ),114_85Plus
R2625 T3209 T3199 cc and,oligonucleotides
R2626 T3210 T3199 conj 114_85Minus,oligonucleotides
R2627 T3211 T3212 punct (,5
R2628 T3212 T3215 nummod 5,GATCTCCAGCTGGAGCCTCCTCTCCACCATCAAGAA-3
R2629 T3213 T3215 punct ′,GATCTCCAGCTGGAGCCTCCTCTCCACCATCAAGAA-3
R2630 T3214 T3215 punct -,GATCTCCAGCTGGAGCCTCCTCTCCACCATCAAGAA-3
R2631 T3215 T3216 compound GATCTCCAGCTGGAGCCTCCTCTCCACCATCAAGAA-3,′
R2632 T3216 T3210 appos ′,114_85Minus
R2633 T3217 T3216 punct ),′
R2634 T3218 T3210 cc or,114_85Minus
R2635 T3219 T3210 conj 92-63Plus,114_85Minus
R2636 T3220 T3221 punct (,5
R2637 T3221 T3225 nummod 5,′
R2638 T3222 T3224 punct ′,CGCGTCCAGCTGGGCGGGACCACCAGGGGAGGGGCA-3
R2639 T3223 T3224 punct -,CGCGTCCAGCTGGGCGGGACCACCAGGGGAGGGGCA-3
R2640 T3224 T3225 compound CGCGTCCAGCTGGGCGGGACCACCAGGGGAGGGGCA-3,′
R2641 T3225 T3219 appos ′,92-63Plus
R2642 T3226 T3225 punct ),′
R2643 T3227 T3219 cc and,92-63Plus
R2644 T3228 T3234 compound 92_63Minus,′
R2645 T3229 T3230 punct (,5
R2646 T3230 T3233 nummod 5,GATCTGCCCCTCCCCTGGTGGTCCCGCCCAGCTGGA-3
R2647 T3231 T3233 punct ′,GATCTGCCCCTCCCCTGGTGGTCCCGCCCAGCTGGA-3
R2648 T3232 T3233 punct -,GATCTGCCCCTCCCCTGGTGGTCCCGCCCAGCTGGA-3
R2649 T3233 T3234 compound GATCTGCCCCTCCCCTGGTGGTCCCGCCCAGCTGGA-3,′
R2650 T3234 T3219 conj ′,92-63Plus
R2651 T3235 T3234 punct ),′
R2652 T3236 T3193 punct .,constructed
R2653 T3237 T3264 prep After,ligated
R2654 T3238 T3237 pcomp annealing,After
R2655 T3239 T3264 punct ",",ligated
R2656 T3240 T3242 det the,oligonucleotides
R2657 T3241 T3242 amod double-stranded,oligonucleotides
R2658 T3242 T3264 dep oligonucleotides,ligated
R2659 T3243 T3244 nsubj which,contained
R2660 T3244 T3242 relcl contained,oligonucleotides
R2661 T3245 T3248 det the,bp
R2662 T3246 T3248 amod respective,bp
R2663 T3247 T3248 nummod 30,bp
R2664 T3248 T3244 dobj bp,contained
R2665 T3249 T3248 prep of,bp
R2666 T3250 T3252 det the,promoter
R2667 T3251 T3252 compound APOBEC3G,promoter
R2668 T3252 T3249 pobj promoter,of
R2669 T3253 T3252 cc and,promoter
R2670 T3254 T3255 amod sticky,ends
R2671 T3255 T3264 nsubjpass ends,ligated
R2672 T3256 T3255 acl compatible,ends
R2673 T3257 T3256 prep with,compatible
R2674 T3258 T3262 nmod MluI,sites
R2675 T3259 T3258 cc and,MluI
R2676 T3260 T3258 conj BglII,MluI
R2677 T3261 T3262 compound restriction,sites
R2678 T3262 T3257 pobj sites,with
R2679 T3263 T3264 auxpass were,ligated
R2680 T3264 T3264 ROOT ligated,ligated
R2681 T3265 T3264 prep into,ligated
R2682 T3266 T3267 det the,pGL3-Promoter
R2683 T3267 T3265 pobj pGL3-Promoter,into
R2684 T3268 T3267 punct (,pGL3-Promoter
R2685 T3269 T3267 appos Promega,pGL3-Promoter
R2686 T3270 T3267 punct ),pGL3-Promoter
R2687 T3271 T3264 dobj vector,ligated
R2688 T3272 T3264 punct .,ligated
R2689 T3273 T3274 det The,sequences
R2690 T3274 T3280 nsubjpass sequences,verified
R2691 T3275 T3274 prep of,sequences
R2692 T3276 T3278 det all,plasmids
R2693 T3277 T3278 amod constructed,plasmids
R2694 T3278 T3275 pobj plasmids,of
R2695 T3279 T3280 auxpass were,verified
R2696 T3280 T3280 ROOT verified,verified
R2697 T3281 T3280 agent by,verified
R2698 T3282 T3283 compound sequence,analysis
R2699 T3283 T3281 pobj analysis,by
R2700 T3284 T3280 punct .,verified
R2701 T3285 T3286 compound Nucleotide,−
R2702 T3286 T3293 nsubj −,differs
R2703 T3287 T3286 nummod 219,−
R2704 T3288 T3286 prep of,−
R2705 T3289 T3292 det the,promoter
R2706 T3290 T3292 amod cloned,promoter
R2707 T3291 T3292 compound APOBEC3G,promoter
R2708 T3292 T3288 pobj promoter,of
R2709 T3293 T3293 ROOT differs,differs
R2710 T3294 T3293 prep from,differs
R2711 T3295 T3296 det the,sequence
R2712 T3296 T3294 pobj sequence,from
R2713 T3297 T3296 prep in,sequence
R2714 T3298 T3299 det the,database
R2715 T3299 T3297 pobj database,in
R2716 T3300 T3296 punct (,sequence
R2717 T3301 T3302 compound GenBank,™
R2718 T3302 T3304 compound ™,number
R2719 T3303 T3304 compound accession,number
R2720 T3304 T3296 appos number,sequence
R2721 T3305 T3304 nummod DQ147772,number
R2722 T3306 T3296 punct ),sequence
R2723 T3307 T3293 punct .,differs
R2724 T3308 T3310 det An,substitution
R2725 T3309 T3310 amod A-to-C,substitution
R2726 T3310 T3311 nsubj substitution,is
R2727 T3311 T3311 ROOT is,is
R2728 T3312 T3311 acomp present,is
R2729 T3313 T3312 prep at,present
R2730 T3314 T3315 det this,position
R2731 T3315 T3313 pobj position,at
R2732 T3316 T3311 punct .,is
R2733 T3317 T3318 nsubj Numbering,is
R2734 T3318 T3318 ROOT is,is
R2735 T3319 T3318 acomp relative,is
R2736 T3320 T3319 prep to,relative
R2737 T3321 T3325 det the,site
R2738 T3322 T3325 amod major,site
R2739 T3323 T3325 amod transcriptional,site
R2740 T3324 T3325 compound start,site
R2741 T3325 T3320 pobj site,to
R2742 T3326 T3327 nsubj we,identified
R2743 T3327 T3325 relcl identified,site
R2744 T3328 T3318 punct .,is
R2745 T3329 T3330 det The,reporter
R2746 T3330 T3331 nsubj reporter,plasmids
R2747 T3331 T3336 nsubjpass plasmids,purchased
R2748 T3332 T3331 amod pGL3-Control,plasmids
R2749 T3333 T3332 cc and,pGL3-Control
R2750 T3334 T3332 conj phRG-TK,pGL3-Control
R2751 T3335 T3336 auxpass were,purchased
R2752 T3336 T3336 ROOT purchased,purchased
R2753 T3337 T3336 prep from,purchased
R2754 T3338 T3337 pobj Promega,from
R2755 T3339 T3336 punct .,purchased
R2756 T3340 T3341 nsubj pGL2-CVX,contains
R2757 T3341 T3341 ROOT contains,contains
R2758 T3342 T3343 nummod two,repeats
R2759 T3343 T3341 dobj repeats,contains
R2760 T3344 T3343 prep of,repeats
R2761 T3345 T3347 det the,GAS
R2762 T3346 T3347 compound IFN-responsive,GAS
R2763 T3347 T3353 nmod GAS,elements
R2764 T3348 T3347 punct (,GAS
R2765 T3349 T3350 npadvmod gamma,activated
R2766 T3350 T3351 amod activated,sequence
R2767 T3351 T3347 appos sequence,GAS
R2768 T3352 T3347 punct ),GAS
R2769 T3353 T3344 pobj elements,of
R2770 T3354 T3355 punct (,GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG
R2771 T3355 T3353 appos GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG,elements
R2772 T3356 T3353 punct ),elements
R2773 T3357 T3353 prep of,elements
R2774 T3358 T3360 det the,protein
R2775 T3359 T3360 amod guanylate-binding,protein
R2776 T3360 T3357 pobj protein,of
R2777 T3361 T3360 punct (,protein
R2778 T3362 T3360 appos GBP,protein
R2779 T3363 T3360 punct ),protein
R2780 T3364 T3343 appos gene,repeats
R2781 T3365 T3364 prep in,gene
R2782 T3366 T3365 pobj front,in
R2783 T3367 T3366 prep of,front
R2784 T3368 T3371 det a,promoter
R2785 T3369 T3371 nmod CMV,promoter
R2786 T3370 T3371 amod minimal,promoter
R2787 T3371 T3367 pobj promoter,of
R2788 T3372 T3341 cc and,contains
R2789 T3373 T3375 auxpass was,provided
R2790 T3374 T3375 advmod kindly,provided
R2791 T3375 T3341 conj provided,contains
R2792 T3376 T3375 agent by,provided
R2793 T3377 T3378 compound Ute,Pägelow
R2794 T3378 T3376 pobj Pägelow,by
R2795 T3379 T3378 cc and,Pägelow
R2796 T3380 T3381 compound Mario,Köster
R2797 T3381 T3378 conj Köster,Pägelow
R2798 T3382 T3378 prep from,Pägelow
R2799 T3383 T3385 det the,für
R2800 T3384 T3385 compound Helmholtz-Zentrum,für
R2801 T3385 T3382 pobj für,from
R2802 T3386 T3385 appos Infektionsforschung,für
R2803 T3387 T3341 punct .,contains
R2804 T3388 T3389 compound Plasmid,pNL4-3
R2805 T3389 T3395 nsubj pNL4-3,contains
R2806 T3390 T3391 punct (,NIBSC
R2807 T3391 T3389 appos NIBSC,pNL4-3
R2808 T3392 T3391 punct ",",NIBSC
R2809 T3393 T3391 appos UK,NIBSC
R2810 T3394 T3391 punct ),NIBSC
R2811 T3395 T3395 ROOT contains,contains
R2812 T3396 T3399 det the,genome
R2813 T3397 T3399 amod full-length,genome
R2814 T3398 T3399 amod HIV-1NL4-3,genome
R2815 T3399 T3395 dobj genome,contains
R2816 T3400 T3395 cc and,contains
R2817 T3401 T3403 aux has,described
R2818 T3402 T3403 auxpass been,described
R2819 T3403 T3395 conj described,contains
R2820 T3404 T3403 advmod previously,described
R2821 T3405 T3403 punct (,described
R2822 T3406 T3403 npadvmod 34,described
R2823 T3407 T3403 punct ),described
R2824 T3408 T3395 punct .,contains
R2825 T3409 T3409 ROOT pcDNA3,pcDNA3
R2826 T3410 T3409 nummod .1,pcDNA3
R2827 T3411 T3414 nsubjpass Vif,provided
R2828 T3412 T3414 auxpass was,provided
R2829 T3413 T3414 advmod generously,provided
R2830 T3414 T3414 ROOT provided,provided
R2831 T3415 T3414 agent by,provided
R2832 T3416 T3418 compound Nathaniel,Landau
R2833 T3417 T3418 compound R.,Landau
R2834 T3418 T3415 pobj Landau,by
R2835 T3419 T3414 prep from,provided
R2836 T3420 T3422 det the,Institute
R2837 T3421 T3422 compound Salk,Institute
R2838 T3422 T3419 pobj Institute,from
R2839 T3423 T3422 punct ",",Institute
R2840 T3424 T3425 compound La,Jolla
R2841 T3425 T3422 appos Jolla,Institute
R2842 T3426 T3414 punct .,provided
R2843 T3427 T3429 nsubjpass It,generated
R2844 T3428 T3429 auxpass was,generated
R2845 T3429 T3429 ROOT generated,generated
R2846 T3430 T3429 prep by,generated
R2847 T3431 T3430 pcomp amplifying,by
R2848 T3432 T3434 det the,gene
R2849 T3433 T3434 compound Vif,gene
R2850 T3434 T3431 dobj gene,amplifying
R2851 T3435 T3431 prep from,amplifying
R2852 T3436 T3435 pobj pNL4-3,from
R2853 T3437 T3436 cc and,pNL4-3
R2854 T3438 T3436 conj ligating,pNL4-3
R2855 T3439 T3438 dobj it,ligating
R2856 T3440 T3438 prep into,ligating
R2857 T3441 T3444 det the,vector
R2858 T3442 T3444 nmod pcDNA3,vector
R2859 T3443 T3442 nummod .1,pcDNA3
R2860 T3444 T3440 pobj vector,into
R2861 T3445 T3431 prep via,amplifying
R2862 T3446 T3450 nmod BamHI,sites
R2863 T3447 T3446 cc and,BamHI
R2864 T3448 T3446 conj XhoI,BamHI
R2865 T3449 T3450 compound restriction,sites
R2866 T3450 T3445 pobj sites,via
R2867 T3451 T3429 punct .,generated
R2868 T3452 T3457 det A,element
R2869 T3453 T3457 nummod 3,element
R2870 T3454 T3453 punct ′,3
R2871 T3455 T3456 punct -,WPRE
R2872 T3456 T3457 compound WPRE,element
R2873 T3457 T3459 nsubjpass element,included
R2874 T3458 T3459 auxpass was,included
R2875 T3459 T3459 ROOT included,included
R2876 T3460 T3459 prep into,included
R2877 T3461 T3463 det the,site
R2878 T3462 T3463 compound XhoI,site
R2879 T3463 T3460 pobj site,into
R2880 T3464 T3459 punct .,included
R2881 T3465 T3470 nsubjpass pBS-kRSPA-TatHIV-1,constructed
R2882 T3466 T3467 punct (,NL4-3
R2883 T3467 T3465 appos NL4-3,pBS-kRSPA-TatHIV-1
R2884 T3468 T3467 punct ),NL4-3
R2885 T3469 T3470 auxpass was,constructed
R2886 T3470 T3516 ccomp constructed,15FHIV-Tat2Plus
R2887 T3471 T3470 agent by,constructed
R2888 T3472 T3471 pcomp amplifying,by
R2889 T3473 T3475 det the,exons
R2890 T3474 T3475 nummod two,exons
R2891 T3475 T3472 dobj exons,amplifying
R2892 T3476 T3475 prep of,exons
R2893 T3477 T3476 pobj Tat,of
R2894 T3478 T3472 prep via,amplifying
R2895 T3479 T3480 compound PCR,reaction
R2896 T3480 T3478 pobj reaction,via
R2897 T3481 T3472 advcl using,amplifying
R2898 T3482 T3485 det the,pNL4-3
R2899 T3483 T3484 amod molecular,clone
R2900 T3484 T3485 compound clone,pNL4-3
R2901 T3485 T3481 dobj pNL4-3,using
R2902 T3486 T3481 prep as,using
R2903 T3487 T3486 pobj template,as
R2904 T3488 T3487 cc and,template
R2905 T3489 T3492 det the,sets
R2906 T3490 T3492 amod following,sets
R2907 T3491 T3492 compound primer,sets
R2908 T3492 T3487 conj sets,template
R2909 T3493 T3492 punct :,sets
R2910 T3494 T3492 appos exon1,sets
R2911 T3495 T3492 punct ",",sets
R2912 T3496 T3492 conj 5ÜXho1HIV-Tat1Plus,sets
R2913 T3497 T3496 punct (,5ÜXho1HIV-Tat1Plus
R2914 T3498 T3502 nummod 5,′
R2915 T3499 T3501 punct ′,GCATGCTCGAGATGGAGCCAGTAGATCCTAG-3
R2916 T3500 T3501 punct -,GCATGCTCGAGATGGAGCCAGTAGATCCTAG-3
R2917 T3501 T3502 compound GCATGCTCGAGATGGAGCCAGTAGATCCTAG-3,′
R2918 T3502 T3496 appos ′,5ÜXho1HIV-Tat1Plus
R2919 T3503 T3502 punct ),′
R2920 T3504 T3496 cc and,5ÜXho1HIV-Tat1Plus
R2921 T3505 T3496 conj HIV-Tat1Minus,5ÜXho1HIV-Tat1Plus
R2922 T3506 T3507 punct (,5
R2923 T3507 T3510 acl 5,TGCTTTGATAGAGAAGCTTGATG-3
R2924 T3508 T3510 punct ′,TGCTTTGATAGAGAAGCTTGATG-3
R2925 T3509 T3510 punct -,TGCTTTGATAGAGAAGCTTGATG-3
R2926 T3510 T3511 compound TGCTTTGATAGAGAAGCTTGATG-3,′
R2927 T3511 T3492 conj ′,sets
R2928 T3512 T3470 punct ),constructed
R2929 T3513 T3516 punct ;,15FHIV-Tat2Plus
R2930 T3514 T3516 nummod exon2,15FHIV-Tat2Plus
R2931 T3515 T3516 punct ",",15FHIV-Tat2Plus
R2932 T3516 T3516 ROOT 15FHIV-Tat2Plus,15FHIV-Tat2Plus
R2933 T3517 T3516 punct (,15FHIV-Tat2Plus
R2934 T3518 T3522 nummod 5,′
R2935 T3519 T3521 punct ′,TTCTCTATCAAAGCAACCCACCTCCCAATCCCG-3
R2936 T3520 T3521 punct -,TTCTCTATCAAAGCAACCCACCTCCCAATCCCG-3
R2937 T3521 T3522 compound TTCTCTATCAAAGCAACCCACCTCCCAATCCCG-3,′
R2938 T3522 T3516 appos ′,15FHIV-Tat2Plus
R2939 T3523 T3522 punct ),′
R2940 T3524 T3516 cc and,15FHIV-Tat2Plus
R2941 T3525 T3516 conj 5ÜSpe1HIV-Tat2Minus,15FHIV-Tat2Plus
R2942 T3526 T3527 punct (,5
R2943 T3527 T3531 nummod 5,′
R2944 T3528 T3527 punct ′,5
R2945 T3529 T3530 punct -,GACGTACTAGTCTATTCCTTCGGGCCTGTC-3
R2946 T3530 T3531 compound GACGTACTAGTCTATTCCTTCGGGCCTGTC-3,′
R2947 T3531 T3516 appos ′,15FHIV-Tat2Plus
R2948 T3532 T3531 punct ),′
R2949 T3533 T3516 punct .,15FHIV-Tat2Plus
R2950 T3534 T3538 nmod XhoI,sites
R2951 T3535 T3534 cc and,XhoI
R2952 T3536 T3534 conj SpeI,XhoI
R2953 T3537 T3538 compound restriction,sites
R2954 T3538 T3540 nsubjpass sites,introduced
R2955 T3539 T3540 auxpass were,introduced
R2956 T3540 T3540 ROOT introduced,introduced
R2957 T3541 T3540 prep via,introduced
R2958 T3542 T3543 det the,primers
R2959 T3543 T3541 pobj primers,via
R2960 T3544 T3540 punct .,introduced
R2961 T3545 T3546 det The,sense-primer
R2962 T3546 T3549 nsubj sense-primer,starts
R2963 T3547 T3546 prep of,sense-primer
R2964 T3548 T3549 nummod exon2,starts
R2965 T3549 T3549 ROOT starts,starts
R2966 T3550 T3549 prep with,starts
R2967 T3551 T3552 det a,15-mer
R2968 T3552 T3550 pobj 15-mer,with
R2969 T3553 T3554 nsubj which,is
R2970 T3554 T3552 relcl is,15-mer
R2971 T3555 T3554 acomp homologous,is
R2972 T3556 T3555 prep to,homologous
R2973 T3557 T3560 det the,end
R2974 T3558 T3559 nummod 3,′
R2975 T3559 T3560 compound ′,end
R2976 T3560 T3556 pobj end,to
R2977 T3561 T3560 prep of,end
R2978 T3562 T3561 pobj exon1,of
R2979 T3563 T3560 cc and,end
R2980 T3564 T3556 amod necessary,to
R2981 T3565 T3554 prep for,is
R2982 T3566 T3565 pobj fusion,for
R2983 T3567 T3566 prep of,fusion
R2984 T3568 T3569 det both,exons
R2985 T3569 T3567 pobj exons,of
R2986 T3570 T3549 punct .,starts
R2987 T3571 T3573 nsubjpass PCRs,performed
R2988 T3572 T3573 auxpass were,performed
R2989 T3573 T3573 ROOT performed,performed
R2990 T3574 T3573 prep with,performed
R2991 T3575 T3579 compound Expand,System
R2992 T3576 T3577 compound High,Fidelity
R2993 T3577 T3579 compound Fidelity,System
R2994 T3578 T3579 compound PCR,System
R2995 T3579 T3574 pobj System,with
R2996 T3580 T3579 punct (,System
R2997 T3581 T3579 appos Roche,System
R2998 T3582 T3573 punct ),performed
R2999 T3583 T3573 advcl using,performed
R3000 T3584 T3586 det the,conditions
R3001 T3585 T3586 amod following,conditions
R3002 T3586 T3583 dobj conditions,using
R3003 T3587 T3586 punct :,conditions
R3004 T3588 T3589 nummod one,cycle
R3005 T3589 T3592 compound cycle,C
R3006 T3590 T3591 nummod 94,°
R3007 T3591 T3592 compound °,C
R3008 T3592 T3586 appos C,conditions
R3009 T3593 T3592 prep for,C
R3010 T3594 T3595 nummod 3,min
R3011 T3595 T3593 pobj min,for
R3012 T3596 T3592 punct ;,C
R3013 T3597 T3598 nummod 35,cycles
R3014 T3598 T3586 appos cycles,conditions
R3015 T3599 T3600 nummod 94,°
R3016 T3600 T3601 compound °,C
R3017 T3601 T3586 appos C,conditions
R3018 T3602 T3601 prep for,C
R3019 T3603 T3602 pobj 45,for
R3020 T3604 T3601 conj s,C
R3021 T3605 T3601 punct ",",C
R3022 T3606 T3607 nummod 55,°
R3023 T3607 T3608 compound °,C
R3024 T3608 T3601 appos C,C
R3025 T3609 T3601 prep for,C
R3026 T3610 T3611 nummod 45,s
R3027 T3611 T3609 pobj s,for
R3028 T3612 T3611 punct ",",s
R3029 T3613 T3614 nummod 68,°
R3030 T3614 T3615 compound °,C
R3031 T3615 T3611 appos C,s
R3032 T3616 T3601 prep for,C
R3033 T3617 T3618 nummod 45,s
R3034 T3618 T3616 pobj s,for
R3035 T3619 T3601 punct ;,C
R3036 T3620 T3621 nummod one,cycle
R3037 T3621 T3624 compound cycle,C
R3038 T3622 T3623 nummod 68,°
R3039 T3623 T3624 compound °,C
R3040 T3624 T3601 conj C,C
R3041 T3625 T3624 prep for,C
R3042 T3626 T3627 nummod 7,min
R3043 T3627 T3625 pobj min,for
R3044 T3628 T3573 punct .,performed
R3045 T3629 T3640 prep For,applied
R3046 T3630 T3629 pobj fusion,For
R3047 T3631 T3630 prep of,fusion
R3048 T3632 T3633 det both,exons
R3049 T3633 T3631 pobj exons,of
R3050 T3634 T3640 punct ",",applied
R3051 T3635 T3638 det the,conditions
R3052 T3636 T3638 amod following,conditions
R3053 T3637 T3638 compound PCR,conditions
R3054 T3638 T3640 nsubjpass conditions,applied
R3055 T3639 T3640 auxpass were,applied
R3056 T3640 T3652 ccomp applied,cycles
R3057 T3641 T3646 punct :,C
R3058 T3642 T3643 nummod one,cycle
R3059 T3643 T3646 compound cycle,C
R3060 T3644 T3645 nummod 94,°
R3061 T3645 T3646 compound °,C
R3062 T3646 T3640 dobj C,applied
R3063 T3647 T3640 prep for,applied
R3064 T3648 T3649 nummod 3,min
R3065 T3649 T3647 pobj min,for
R3066 T3650 T3652 punct ;,cycles
R3067 T3651 T3652 nummod 35,cycles
R3068 T3652 T3652 ROOT cycles,cycles
R3069 T3653 T3654 nummod 94,°
R3070 T3654 T3655 compound °,C
R3071 T3655 T3652 appos C,cycles
R3072 T3656 T3655 prep for,C
R3073 T3657 T3658 nummod 45,s
R3074 T3658 T3656 pobj s,for
R3075 T3659 T3658 punct ",",s
R3076 T3660 T3661 nummod 58,°
R3077 T3661 T3662 compound °,C
R3078 T3662 T3658 appos C,s
R3079 T3663 T3655 prep for,C
R3080 T3664 T3663 pobj 45,for
R3081 T3665 T3655 conj s,C
R3082 T3666 T3655 punct ",",C
R3083 T3667 T3668 nummod 68,°
R3084 T3668 T3669 compound °,C
R3085 T3669 T3655 appos C,C
R3086 T3670 T3655 prep for,C
R3087 T3671 T3672 nummod 60,s
R3088 T3672 T3670 pobj s,for
R3089 T3673 T3652 punct .,cycles
R3090 T3674 T3690 prep After,added
R3091 T3675 T3676 nummod 10,cycles
R3092 T3676 T3674 pobj cycles,After
R3093 T3677 T3676 prep without,cycles
R3094 T3678 T3677 pobj primers,without
R3095 T3679 T3690 punct ",",added
R3096 T3680 T3681 det the,sense-primer
R3097 T3681 T3690 nsubjpass sense-primer,added
R3098 T3682 T3681 prep of,sense-primer
R3099 T3683 T3682 pobj exon1,of
R3100 T3684 T3681 cc and,sense-primer
R3101 T3685 T3686 det the,antisense-primer
R3102 T3686 T3681 conj antisense-primer,sense-primer
R3103 T3687 T3686 prep of,antisense-primer
R3104 T3688 T3687 pobj exon2,of
R3105 T3689 T3690 auxpass were,added
R3106 T3690 T3690 ROOT added,added
R3107 T3691 T3690 prep for,added
R3108 T3692 T3694 det the,cycles
R3109 T3693 T3694 amod remaining,cycles
R3110 T3694 T3691 pobj cycles,for
R3111 T3695 T3690 punct .,added
R3112 T3696 T3698 det The,amplicon
R3113 T3697 T3698 amod resulting,amplicon
R3114 T3698 T3700 nsubjpass amplicon,ligated
R3115 T3699 T3700 auxpass was,ligated
R3116 T3700 T3700 ROOT ligated,ligated
R3117 T3701 T3700 prep into,ligated
R3118 T3702 T3704 det the,vector
R3119 T3703 T3704 amod pBS-kRSPA,vector
R3120 T3704 T3701 pobj vector,into
R3121 T3705 T3704 punct (,vector
R3122 T3706 T3704 appos 35,vector
R3123 T3707 T3704 punct ),vector
R3124 T3708 T3700 prep via,ligated
R3125 T3709 T3713 nmod XhoI,sites
R3126 T3710 T3709 cc and,XhoI
R3127 T3711 T3709 conj SpeI,XhoI
R3128 T3712 T3713 compound restriction,sites
R3129 T3713 T3708 pobj sites,via
R3130 T3714 T3700 punct .,ligated
R2149 T2733 T2729 pobj line,from
R2305 T2889 T2887 dobj fragments,containing
R2307 T2891 T2893 det the,promoter
R2385 T2969 T3016 prep for,sequence
R2386 T2970 T2969 pobj plasmid,for
R2387 T2971 T3016 nmod pGL3-APOprom150,sequence

sentences

Id Subject Object Predicate Lexical cue
T2639 0-8 Sentence denotes Plasmids
T2640 9-150 Sentence denotes For cloning of an APOBEC3G promoter-driven reporter plasmid, genomic DNA was prepared from the T cell line PM1 using the DNeasy Kit (Qiagen).
T2641 151-407 Sentence denotes The DNA sequence ranging from positions −959 to +66 relative to the identified transcription start was amplified via PCR using the primers 3Gprom1025 (5′-TGTGAACGCGTTGCTGCAGGCCATCTGGATGTATATG-3′) and 3Gpromreverse (5′-ACAGCAGATCTAGGGACCTCTGATAAAGACAGG-3′).
T2642 408-613 Sentence denotes PCR reactions were performed with Pwo DNA Polymerase (Roche) using the following cycle conditions: one cycle 94°C for 2 min; 30 cycles 94°C for 30 s, 58°C for 60 s, 72°C for 60 s; one cycle 72°C for 7 min.
T2643 614-785 Sentence denotes The amplicon was ligated into the promoterless luciferase reporter plasmid pGL3-Basic (Promega) via MluI and BglII restriction sites, which were introduced by the primers.
T2644 786-884 Sentence denotes The resulting construct contained 1025 bp of the A3G promoter and was designated pGL3-APOprom1025.
T2645 885-1103 Sentence denotes Reporter plasmids containing shorter fragments of the APOBEC3G promoter were constructed using pGL3-APOprom1025 as template and the following forward primers: for plasmid pGL3-APOprom502 (containing sequence −436/+66):
T2646 1104-1214 Sentence denotes 3Gprom502 (5′-TGTGAACGCGTTCCATAACATGGGGACAAGA-3′); for plasmid pGL3-APOprom225 (containing sequence −159/+66):
T2647 1215-1325 Sentence denotes 3Gprom225 (5′-TGTGAACGCGTCGAGGGCAGGATCCGGGAGT-3′); for plasmid pGL3-APOprom180 (containing sequence −114/+66):
T2648 1326-1435 Sentence denotes 3Gprom180 (5′-TGTGAACGCGTTCTTGATGGTGGAGAGGAGG-3′); for plasmid pGL3-APOprom150 (containing sequence −84/+66):
T2649 1436-1549 Sentence denotes 3Gprom150 (5′-TGTGAACGCGTGCGGGACCACCAGGGGAGGGGCTT-3′); for plasmid pGL3-APOprom120 (containing sequence −54/+66):
T2650 1550-1657 Sentence denotes 3Gprom120 (5′-TGTGAACGCGTTGCTGGCTCAGCCTGGTGTG-3′); for plasmid pGL3-APOprom60 (containing sequence +7/+66):
T2651 1658-1782 Sentence denotes 3Gprom60 (5′-TGTGAACGCGTCCCTTTGCAATTGCCTTG-3′); each in combination with the reverse primer 3Gpromreverse (described above).
T2652 1783-1993 Sentence denotes PCR reactions were performed with Pfu Ultra Hotstart (Stratagene) using the following cycle conditions: one cycle 94°C for 2 min; 30 cycles 94°C for 45 s, 58°C for 45 s, 72°C for 60 s; one cycle 72°C for 7 min.
T2653 1994-2375 Sentence denotes As for pGL3-APOprom1025, MluI and BglII restriction sites were introduced via the primers and PCR products were ligated into pGL3-Basic (Promega) via these restriction sites. pGL3-APOprom180mut carries two point mutations (bold) and was generated using the primer 3GProm180mut (5′-TGTGAACGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGTTCGGGACCACCAG-3′) in combination with primer 3Gpromreverse.
T2654 2376-2608 Sentence denotes This PCR was performed with an annealing temperature of 65°C. pGL3promE1 (containing nucleotides −114/−85) and pGL3promE2 (containing nucleotides −92/−63) were constructed by annealing the following single-stranded oligonucleotides:
T2655 2609-2846 Sentence denotes 114_85Plus (5′- CGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGGA-3′) and 114_85Minus (5′- GATCTCCAGCTGGAGCCTCCTCTCCACCATCAAGAA-3′) or 92-63Plus (5′-CGCGTCCAGCTGGGCGGGACCACCAGGGGAGGGGCA-3′) and 92_63Minus (5′-GATCTGCCCCTCCCCTGGTGGTCCCGCCCAGCTGGA-3′).
T2656 2847-3081 Sentence denotes After annealing, the double-stranded oligonucleotides which contained the respective 30 bp of the APOBEC3G promoter and sticky ends compatible with MluI and BglII restriction sites were ligated into the pGL3-Promoter (Promega) vector.
T2657 3082-3159 Sentence denotes The sequences of all constructed plasmids were verified by sequence analysis.
T2658 3160-3287 Sentence denotes Nucleotide −219 of the cloned APOBEC3G promoter differs from the sequence in the database (GenBank™ accession number DQ147772).
T2659 3288-3339 Sentence denotes An A-to-C substitution is present at this position.
T2660 3340-3416 Sentence denotes Numbering is relative to the major transcriptional start site we identified.
T2661 3417-4152 Sentence denotes The reporter plasmids pGL3-Control and phRG-TK were purchased from Promega. pGL2-CVX contains two repeats of the IFN-responsive GAS (gamma activated sequence) elements (GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG) of the guanylate-binding protein (GBP) gene in front of a CMV minimal promoter and was kindly provided by Ute Pägelow and Mario Köster from the Helmholtz-Zentrum für Infektionsforschung. Plasmid pNL4-3 (NIBSC, UK) contains the full-length HIV-1NL4-3 genome and has been described previously (34). pcDNA3.1Vif was generously provided by Nathaniel R. Landau from the Salk Institute, La Jolla. It was generated by amplifying the Vif gene from pNL4-3 and ligating it into the pcDNA3.1 vector via BamHI and XhoI restriction sites.
T2662 4153-4619 Sentence denotes A 3′-WPRE element was included into the XhoI site. pBS-kRSPA-TatHIV-1(NL4-3) was constructed by amplifying the two exons of Tat via PCR reaction using the molecular clone pNL4-3 as template and the following primer sets: exon1, 5ÜXho1HIV-Tat1Plus (5′-GCATGCTCGAGATGGAGCCAGTAGATCCTAG-3′) and HIV-Tat1Minus (5′-TGCTTTGATAGAGAAGCTTGATG-3′); exon2, 15FHIV-Tat2Plus (5′-TTCTCTATCAAAGCAACCCACCTCCCAATCCCG-3′) and 5ÜSpe1HIV-Tat2Minus (5′-GACGTACTAGTCTATTCCTTCGGGCCTGTC-3′).
T2663 4620-4684 Sentence denotes XhoI and SpeI restriction sites were introduced via the primers.
T2664 4685-4814 Sentence denotes The sense-primer of exon2 starts with a 15-mer which is homologous to the 3′ end of exon1 and necessary for fusion of both exons.
T2665 4815-5018 Sentence denotes PCRs were performed with Expand High Fidelity PCR System (Roche) using the following conditions: one cycle 94°C for 3 min; 35 cycles 94°C for 45 s, 55°C for 45 s, 68°C for 45 s; one cycle 68°C for 7 min.
T2666 5019-5168 Sentence denotes For fusion of both exons, the following PCR conditions were applied: one cycle 94°C for 3 min; 35 cycles 94°C for 45 s, 58°C for 45 s, 68°C for 60 s.
T2667 5169-5298 Sentence denotes After 10 cycles without primers, the sense-primer of exon1 and the antisense-primer of exon2 were added for the remaining cycles.
T2668 5299-5401 Sentence denotes The resulting amplicon was ligated into the pBS-kRSPA vector (35) via XhoI and SpeI restriction sites.
T35 0-8 Sentence denotes Plasmids
T36 9-150 Sentence denotes For cloning of an APOBEC3G promoter-driven reporter plasmid, genomic DNA was prepared from the T cell line PM1 using the DNeasy Kit (Qiagen).
T37 151-407 Sentence denotes The DNA sequence ranging from positions −959 to +66 relative to the identified transcription start was amplified via PCR using the primers 3Gprom1025 (5′-TGTGAACGCGTTGCTGCAGGCCATCTGGATGTATATG-3′) and 3Gpromreverse (5′-ACAGCAGATCTAGGGACCTCTGATAAAGACAGG-3′).
T38 408-613 Sentence denotes PCR reactions were performed with Pwo DNA Polymerase (Roche) using the following cycle conditions: one cycle 94°C for 2 min; 30 cycles 94°C for 30 s, 58°C for 60 s, 72°C for 60 s; one cycle 72°C for 7 min.
T39 614-785 Sentence denotes The amplicon was ligated into the promoterless luciferase reporter plasmid pGL3-Basic (Promega) via MluI and BglII restriction sites, which were introduced by the primers.
T40 786-884 Sentence denotes The resulting construct contained 1025 bp of the A3G promoter and was designated pGL3-APOprom1025.
T41 885-1103 Sentence denotes Reporter plasmids containing shorter fragments of the APOBEC3G promoter were constructed using pGL3-APOprom1025 as template and the following forward primers: for plasmid pGL3-APOprom502 (containing sequence −436/+66):
T42 1104-1214 Sentence denotes 3Gprom502 (5′-TGTGAACGCGTTCCATAACATGGGGACAAGA-3′); for plasmid pGL3-APOprom225 (containing sequence −159/+66):
T43 1215-1325 Sentence denotes 3Gprom225 (5′-TGTGAACGCGTCGAGGGCAGGATCCGGGAGT-3′); for plasmid pGL3-APOprom180 (containing sequence −114/+66):
T44 1326-1435 Sentence denotes 3Gprom180 (5′-TGTGAACGCGTTCTTGATGGTGGAGAGGAGG-3′); for plasmid pGL3-APOprom150 (containing sequence −84/+66):
T45 1436-1549 Sentence denotes 3Gprom150 (5′-TGTGAACGCGTGCGGGACCACCAGGGGAGGGGCTT-3′); for plasmid pGL3-APOprom120 (containing sequence −54/+66):
T46 1550-1657 Sentence denotes 3Gprom120 (5′-TGTGAACGCGTTGCTGGCTCAGCCTGGTGTG-3′); for plasmid pGL3-APOprom60 (containing sequence +7/+66):
T47 1658-1782 Sentence denotes 3Gprom60 (5′-TGTGAACGCGTCCCTTTGCAATTGCCTTG-3′); each in combination with the reverse primer 3Gpromreverse (described above).
T48 1783-1993 Sentence denotes PCR reactions were performed with Pfu Ultra Hotstart (Stratagene) using the following cycle conditions: one cycle 94°C for 2 min; 30 cycles 94°C for 45 s, 58°C for 45 s, 72°C for 60 s; one cycle 72°C for 7 min.
T49 1994-2375 Sentence denotes As for pGL3-APOprom1025, MluI and BglII restriction sites were introduced via the primers and PCR products were ligated into pGL3-Basic (Promega) via these restriction sites. pGL3-APOprom180mut carries two point mutations (bold) and was generated using the primer 3GProm180mut (5′-TGTGAACGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGTTCGGGACCACCAG-3′) in combination with primer 3Gpromreverse.
T50 2376-2608 Sentence denotes This PCR was performed with an annealing temperature of 65°C. pGL3promE1 (containing nucleotides −114/−85) and pGL3promE2 (containing nucleotides −92/−63) were constructed by annealing the following single-stranded oligonucleotides:
T51 2609-2846 Sentence denotes 114_85Plus (5′- CGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGGA-3′) and 114_85Minus (5′- GATCTCCAGCTGGAGCCTCCTCTCCACCATCAAGAA-3′) or 92-63Plus (5′-CGCGTCCAGCTGGGCGGGACCACCAGGGGAGGGGCA-3′) and 92_63Minus (5′-GATCTGCCCCTCCCCTGGTGGTCCCGCCCAGCTGGA-3′).
T52 2847-3081 Sentence denotes After annealing, the double-stranded oligonucleotides which contained the respective 30 bp of the APOBEC3G promoter and sticky ends compatible with MluI and BglII restriction sites were ligated into the pGL3-Promoter (Promega) vector.
T53 3082-3159 Sentence denotes The sequences of all constructed plasmids were verified by sequence analysis.
T54 3160-3287 Sentence denotes Nucleotide −219 of the cloned APOBEC3G promoter differs from the sequence in the database (GenBank™ accession number DQ147772).
T55 3288-3339 Sentence denotes An A-to-C substitution is present at this position.
T56 3340-3416 Sentence denotes Numbering is relative to the major transcriptional start site we identified.
T57 3417-3813 Sentence denotes The reporter plasmids pGL3-Control and phRG-TK were purchased from Promega. pGL2-CVX contains two repeats of the IFN-responsive GAS (gamma activated sequence) elements (GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG) of the guanylate-binding protein (GBP) gene in front of a CMV minimal promoter and was kindly provided by Ute Pägelow and Mario Köster from the Helmholtz-Zentrum für Infektionsforschung.
T58 3814-3975 Sentence denotes Plasmid pNL4-3 (NIBSC, UK) contains the full-length HIV-1NL4-3 genome and has been described previously (34). pcDNA3.1Vif was generously provided by Nathaniel R.
T59 3976-4017 Sentence denotes Landau from the Salk Institute, La Jolla.
T60 4018-4152 Sentence denotes It was generated by amplifying the Vif gene from pNL4-3 and ligating it into the pcDNA3.1 vector via BamHI and XhoI restriction sites.
T61 4153-4619 Sentence denotes A 3′-WPRE element was included into the XhoI site. pBS-kRSPA-TatHIV-1(NL4-3) was constructed by amplifying the two exons of Tat via PCR reaction using the molecular clone pNL4-3 as template and the following primer sets: exon1, 5ÜXho1HIV-Tat1Plus (5′-GCATGCTCGAGATGGAGCCAGTAGATCCTAG-3′) and HIV-Tat1Minus (5′-TGCTTTGATAGAGAAGCTTGATG-3′); exon2, 15FHIV-Tat2Plus (5′-TTCTCTATCAAAGCAACCCACCTCCCAATCCCG-3′) and 5ÜSpe1HIV-Tat2Minus (5′-GACGTACTAGTCTATTCCTTCGGGCCTGTC-3′).
T62 4620-4684 Sentence denotes XhoI and SpeI restriction sites were introduced via the primers.
T63 4685-4814 Sentence denotes The sense-primer of exon2 starts with a 15-mer which is homologous to the 3′ end of exon1 and necessary for fusion of both exons.
T64 4815-5018 Sentence denotes PCRs were performed with Expand High Fidelity PCR System (Roche) using the following conditions: one cycle 94°C for 3 min; 35 cycles 94°C for 45 s, 55°C for 45 s, 68°C for 45 s; one cycle 68°C for 7 min.
T65 5019-5168 Sentence denotes For fusion of both exons, the following PCR conditions were applied: one cycle 94°C for 3 min; 35 cycles 94°C for 45 s, 58°C for 45 s, 68°C for 60 s.
T66 5169-5298 Sentence denotes After 10 cycles without primers, the sense-primer of exon1 and the antisense-primer of exon2 were added for the remaining cycles.
T67 5299-5401 Sentence denotes The resulting amplicon was ligated into the pBS-kRSPA vector (35) via XhoI and SpeI restriction sites.

2_test

Id Subject Object Predicate Lexical cue
17517765-3016298-77155599 3919-3921 3016298 denotes 34
17517765-9933633-77155600 5361-5363 9933633 denotes 35

events-check-again

Id Subject Object Predicate Lexical cue
T3805 442-445 Protein denotes Pwo
T3806 661-671 Protein denotes luciferase
T3807 835-838 Protein denotes A3G
T3808 939-947 Protein denotes APOBEC3G
T3809 1817-1820 Protein denotes Pfu
T3810 2945-2953 Protein denotes APOBEC3G
T3811 3190-3198 Protein denotes APOBEC3G
T3812 3634-3659 Protein denotes guanylate-binding protein
T3813 3661-3664 Protein denotes GBP
T3814 4053-4056 Protein denotes Vif
T3815 4214-4217 Protein denotes Tat
T3816 4277-4280 Protein denotes Tat
T3817 4391-4394 Protein denotes Tat
T3818 4448-4451 Protein denotes Tat
T3819 4505-4508 Protein denotes Tat
T3820 4570-4573 Protein denotes Tat
T3804 27-35 Protein denotes APOBEC3G
R3135 T3813 T3812 equivalentTo GBP,guanylate-binding protein

bionlp-st-ge-2016-reference-tees

Id Subject Object Predicate Lexical cue
T3821 27-35 Protein denotes APOBEC3G
T3822 442-460 Protein denotes Pwo DNA Polymerase
T3823 661-671 Protein denotes luciferase
T3824 714-718 Protein denotes MluI
T3825 723-728 Protein denotes BglII
T3826 759-769 Gene_expression denotes introduced
T3827 759-769 Gene_expression denotes introduced
T3828 835-847 Protein denotes A3G promoter
T3829 867-883 Protein denotes pGL3-APOprom1025
T3830 939-956 Protein denotes APOBEC3G promoter
T3831 980-996 Protein denotes pGL3-APOprom1025
T3832 1048-1071 Protein denotes plasmid pGL3-APOprom502
T3833 1381-1404 Protein denotes plasmid pGL3-APOprom150
T3834 922-931 Positive_regulation denotes fragments
T3835 2001-2017 Protein denotes pGL3-APOprom1025
T3836 2019-2023 Protein denotes MluI
T3837 2028-2033 Protein denotes BglII
T3838 2057-2067 Gene_expression denotes introduced
T3839 2057-2067 Gene_expression denotes introduced
T3840 2057-2067 Gene_expression denotes introduced
T3841 2169-2187 Protein denotes pGL3-APOprom180mut
T3842 2945-2962 Protein denotes APOBEC3G promoter
T3843 2995-2999 Protein denotes MluI
T3844 3004-3009 Protein denotes BglII
T3845 3190-3207 Protein denotes APOBEC3G promoter
T3846 3530-3533 Protein denotes IFN
T3847 3634-3659 Protein denotes guanylate-binding protein
T3848 3661-3664 Protein denotes GBP
T3849 4119-4124 Protein denotes BamHI
T3850 4129-4151 Protein denotes XhoI restriction sites
T3851 4193-4202 Protein denotes XhoI site
T3852 4277-4280 Protein denotes Tat
T3853 4620-4624 Protein denotes XhoI
T3854 4629-4651 Protein denotes SpeI restriction sites
T3855 4657-4667 Gene_expression denotes introduced
T3856 4657-4667 Gene_expression denotes introduced
T3857 4769-4774 Protein denotes exon1
T3858 5369-5373 Protein denotes XhoI
T3859 5378-5400 Protein denotes SpeI restriction sites
R3144 T3854 T3856 themeOf SpeI restriction sites,introduced
R3136 T3824 T3826 themeOf MluI,introduced
R3138 T3825 T3827 themeOf BglII,introduced
R3139 T3830 T3834 themeOf APOBEC3G promoter,fragments
R3140 T3835 T3838 themeOf pGL3-APOprom1025,introduced
R3141 T3836 T3839 themeOf MluI,introduced
R3142 T3837 T3840 themeOf BglII,introduced
R3143 T3853 T3855 themeOf XhoI,introduced

bionlp-st-ge-2016-reference

Id Subject Object Predicate Lexical cue
T2622 27-35 Protein denotes APOBEC3G
T2623 442-445 Protein denotes Pwo
T2624 661-671 Protein denotes luciferase
T2625 835-838 Protein denotes A3G
T2626 939-947 Protein denotes APOBEC3G
T2627 1817-1820 Protein denotes Pfu
T2628 2945-2953 Protein denotes APOBEC3G
T2629 3190-3198 Protein denotes APOBEC3G
T2630 3634-3659 Protein denotes guanylate-binding protein
T2631 3661-3664 Protein denotes GBP
T2632 4053-4056 Protein denotes Vif
T2633 4214-4217 Protein denotes Tat
T2634 4277-4280 Protein denotes Tat
T2635 4391-4394 Protein denotes Tat
T2636 4448-4451 Protein denotes Tat
T2637 4505-4508 Protein denotes Tat
T2638 4570-4573 Protein denotes Tat
R2130 T2631 T2630 equivalentTo GBP,guanylate-binding protein

bionlp-st-ge-2016-uniprot

Id Subject Object Predicate Lexical cue
T2672 27-35 Q9HC16 denotes APOBEC3G
T2673 203-211 Q04864 denotes relative
T2674 661-671 P08659 denotes luciferase
T2675 835-838 Q9HC16 denotes A3G
T2676 939-947 Q9HC16 denotes APOBEC3G
T2677 2945-2953 Q9HC16 denotes APOBEC3G
T2678 3190-3198 Q9HC16 denotes APOBEC3G
T2679 3353-3361 Q04864 denotes relative
T2680 4053-4056 P12504 denotes Vif
T2681 4277-4280 P04605 denotes Tat
T2682 4277-4280 P04608 denotes Tat
T2683 4277-4280 P04610 denotes Tat
T2684 4277-4280 Q8UMQ1 denotes Tat