Id |
Subject |
Object |
Predicate |
Lexical cue |
T20216 |
0-8 |
JJ |
denotes |
Distinct |
T20217 |
9-21 |
NN |
denotes |
Localization |
T20218 |
22-24 |
IN |
denotes |
of |
T20219 |
25-29 |
NN |
denotes |
E2f3 |
T20220 |
30-38 |
NNS |
denotes |
Isoforms |
T20221 |
38-136 |
sentence |
denotes |
As noted above, E2f3 and Rb staining in SACs was both nuclear and cytoplasmic (Figure 5A and 5B). |
T20222 |
39-41 |
IN |
denotes |
As |
T20223 |
42-47 |
VBN |
denotes |
noted |
T20224 |
84-87 |
VBD |
denotes |
was |
T20225 |
48-53 |
RB |
denotes |
above |
T20226 |
53-55 |
, |
denotes |
, |
T20227 |
55-59 |
NN |
denotes |
E2f3 |
T20228 |
67-75 |
NN |
denotes |
staining |
T20229 |
60-63 |
CC |
denotes |
and |
T20230 |
64-66 |
NN |
denotes |
Rb |
T20231 |
76-78 |
IN |
denotes |
in |
T20232 |
79-83 |
NNS |
denotes |
SACs |
T20233 |
88-92 |
CC |
denotes |
both |
T20234 |
93-100 |
JJ |
denotes |
nuclear |
T20235 |
101-104 |
CC |
denotes |
and |
T20236 |
105-116 |
JJ |
denotes |
cytoplasmic |
T20237 |
117-118 |
-LRB- |
denotes |
( |
T20238 |
125-127 |
NN |
denotes |
5A |
T20239 |
118-124 |
NN |
denotes |
Figure |
T20240 |
128-131 |
CC |
denotes |
and |
T20241 |
132-134 |
NN |
denotes |
5B |
T20242 |
134-135 |
-RRB- |
denotes |
) |
T20243 |
135-136 |
. |
denotes |
. |
T20244 |
136-255 |
sentence |
denotes |
The antibody that worked in immunostaining recognizes a C-terminal region and thus, does not distinguish a/b isoforms. |
T20245 |
137-140 |
DT |
denotes |
The |
T20246 |
141-149 |
NN |
denotes |
antibody |
T20247 |
180-190 |
VBZ |
denotes |
recognizes |
T20248 |
150-154 |
WDT |
denotes |
that |
T20249 |
155-161 |
VBD |
denotes |
worked |
T20250 |
162-164 |
IN |
denotes |
in |
T20251 |
165-179 |
NN |
denotes |
immunostaining |
T20252 |
191-192 |
DT |
denotes |
a |
T20253 |
204-210 |
NN |
denotes |
region |
T20254 |
193-194 |
NN |
denotes |
C |
T20255 |
195-203 |
JJ |
denotes |
terminal |
T20256 |
194-195 |
HYPH |
denotes |
- |
T20257 |
211-214 |
CC |
denotes |
and |
T20258 |
215-219 |
RB |
denotes |
thus |
T20259 |
230-241 |
VB |
denotes |
distinguish |
T20260 |
219-221 |
, |
denotes |
, |
T20261 |
221-225 |
VBZ |
denotes |
does |
T20262 |
226-229 |
RB |
denotes |
not |
T20263 |
242-243 |
NN |
denotes |
a |
T20264 |
244-245 |
NN |
denotes |
b |
T20265 |
243-244 |
HYPH |
denotes |
/ |
T20266 |
246-254 |
NNS |
denotes |
isoforms |
T20267 |
254-255 |
. |
denotes |
. |
T20268 |
255-357 |
sentence |
denotes |
To our knowledge, the subcellular location of E2f3 isoforms has not been determined in any cell type. |
T20269 |
256-258 |
IN |
denotes |
To |
T20270 |
329-339 |
VBN |
denotes |
determined |
T20271 |
259-262 |
PRP$ |
denotes |
our |
T20272 |
263-272 |
NN |
denotes |
knowledge |
T20273 |
272-274 |
, |
denotes |
, |
T20274 |
274-277 |
DT |
denotes |
the |
T20275 |
290-298 |
NN |
denotes |
location |
T20276 |
278-289 |
JJ |
denotes |
subcellular |
T20277 |
299-301 |
IN |
denotes |
of |
T20278 |
302-306 |
NN |
denotes |
E2f3 |
T20279 |
307-315 |
NNS |
denotes |
isoforms |
T20280 |
316-319 |
VBZ |
denotes |
has |
T20281 |
320-323 |
RB |
denotes |
not |
T20282 |
324-328 |
VBN |
denotes |
been |
T20283 |
340-342 |
IN |
denotes |
in |
T20284 |
343-346 |
DT |
denotes |
any |
T20285 |
352-356 |
NN |
denotes |
type |
T20286 |
347-351 |
NN |
denotes |
cell |
T20287 |
356-357 |
. |
denotes |
. |
T20288 |
357-551 |
sentence |
denotes |
To verify the dual locations of E2f3 and to determine which isoforms were present in retina, we analyzed nuclear and cytoplasmic fractions by Western blot at different times during development. |
T20289 |
358-360 |
TO |
denotes |
To |
T20290 |
361-367 |
VB |
denotes |
verify |
T20291 |
454-462 |
VBD |
denotes |
analyzed |
T20292 |
368-371 |
DT |
denotes |
the |
T20293 |
377-386 |
NNS |
denotes |
locations |
T20294 |
372-376 |
JJ |
denotes |
dual |
T20295 |
387-389 |
IN |
denotes |
of |
T20296 |
390-394 |
NN |
denotes |
E2f3 |
T20297 |
395-398 |
CC |
denotes |
and |
T20298 |
399-401 |
TO |
denotes |
to |
T20299 |
402-411 |
VB |
denotes |
determine |
T20300 |
412-417 |
WDT |
denotes |
which |
T20301 |
418-426 |
NNS |
denotes |
isoforms |
T20302 |
427-431 |
VBD |
denotes |
were |
T20303 |
432-439 |
JJ |
denotes |
present |
T20304 |
440-442 |
IN |
denotes |
in |
T20305 |
443-449 |
NN |
denotes |
retina |
T20306 |
449-451 |
, |
denotes |
, |
T20307 |
451-453 |
PRP |
denotes |
we |
T20308 |
463-470 |
JJ |
denotes |
nuclear |
T20309 |
487-496 |
NNS |
denotes |
fractions |
T20310 |
471-474 |
CC |
denotes |
and |
T20311 |
475-486 |
JJ |
denotes |
cytoplasmic |
T20312 |
497-499 |
IN |
denotes |
by |
T20313 |
500-507 |
NNP |
denotes |
Western |
T20314 |
508-512 |
NN |
denotes |
blot |
T20315 |
513-515 |
IN |
denotes |
at |
T20316 |
516-525 |
JJ |
denotes |
different |
T20317 |
526-531 |
NNS |
denotes |
times |
T20318 |
532-538 |
IN |
denotes |
during |
T20319 |
539-550 |
NN |
denotes |
development |
T20320 |
550-551 |
. |
denotes |
. |
T20321 |
551-695 |
sentence |
denotes |
Analysis with the pan-E2f3 antibody (sc-878, Santa Cruz Biotechnology) detected a 55-kD E2f3a species and a 40-kD E2f3b polypeptide (Figure 6). |
T20322 |
552-560 |
NN |
denotes |
Analysis |
T20323 |
623-631 |
VBD |
denotes |
detected |
T20324 |
561-565 |
IN |
denotes |
with |
T20325 |
566-569 |
DT |
denotes |
the |
T20326 |
579-587 |
NN |
denotes |
antibody |
T20327 |
570-578 |
JJ |
denotes |
pan-E2f3 |
T20328 |
588-589 |
-LRB- |
denotes |
( |
T20329 |
589-591 |
NN |
denotes |
sc |
T20330 |
591-592 |
HYPH |
denotes |
- |
T20331 |
592-595 |
CD |
denotes |
878 |
T20332 |
595-597 |
, |
denotes |
, |
T20333 |
608-621 |
NNP |
denotes |
Biotechnology |
T20334 |
597-602 |
NNP |
denotes |
Santa |
T20335 |
603-607 |
NNP |
denotes |
Cruz |
T20336 |
621-622 |
-RRB- |
denotes |
) |
T20337 |
632-633 |
DT |
denotes |
a |
T20338 |
646-653 |
NNS |
denotes |
species |
T20339 |
634-636 |
CD |
denotes |
55 |
T20340 |
637-639 |
NN |
denotes |
kD |
T20341 |
636-637 |
HYPH |
denotes |
- |
T20342 |
640-645 |
NN |
denotes |
E2f3a |
T20343 |
654-657 |
CC |
denotes |
and |
T20344 |
658-659 |
DT |
denotes |
a |
T20345 |
672-683 |
NN |
denotes |
polypeptide |
T20346 |
660-662 |
CD |
denotes |
40 |
T20347 |
663-665 |
NN |
denotes |
kD |
T20348 |
662-663 |
HYPH |
denotes |
- |
T20349 |
666-671 |
NN |
denotes |
E2f3b |
T20350 |
684-685 |
-LRB- |
denotes |
( |
T20351 |
685-691 |
NN |
denotes |
Figure |
T20352 |
692-693 |
CD |
denotes |
6 |
T20353 |
693-694 |
-RRB- |
denotes |
) |
T20354 |
694-695 |
. |
denotes |
. |
T20355 |
695-882 |
sentence |
denotes |
To confirm that the upper species in our retinal lysates was E2f3a, we exploited novel mice that lack E2f3 exon 1a and thus express E2f3b exclusively (R. O. and G. L., unpublished data). |
T20356 |
696-698 |
TO |
denotes |
To |
T20357 |
699-706 |
VB |
denotes |
confirm |
T20358 |
767-776 |
VBD |
denotes |
exploited |
T20359 |
707-711 |
IN |
denotes |
that |
T20360 |
753-756 |
VBD |
denotes |
was |
T20361 |
712-715 |
DT |
denotes |
the |
T20362 |
722-729 |
NNS |
denotes |
species |
T20363 |
716-721 |
JJ |
denotes |
upper |
T20364 |
730-732 |
IN |
denotes |
in |
T20365 |
733-736 |
PRP$ |
denotes |
our |
T20366 |
745-752 |
NNS |
denotes |
lysates |
T20367 |
737-744 |
JJ |
denotes |
retinal |
T20368 |
757-762 |
NN |
denotes |
E2f3a |
T20369 |
762-764 |
, |
denotes |
, |
T20370 |
764-766 |
PRP |
denotes |
we |
T20371 |
777-782 |
JJ |
denotes |
novel |
T20372 |
783-787 |
NNS |
denotes |
mice |
T20373 |
788-792 |
WDT |
denotes |
that |
T20374 |
793-797 |
VBP |
denotes |
lack |
T20375 |
798-802 |
NN |
denotes |
E2f3 |
T20376 |
808-810 |
NN |
denotes |
1a |
T20377 |
803-807 |
NN |
denotes |
exon |
T20378 |
811-814 |
CC |
denotes |
and |
T20379 |
815-819 |
RB |
denotes |
thus |
T20380 |
820-827 |
VBP |
denotes |
express |
T20381 |
828-833 |
NN |
denotes |
E2f3b |
T20382 |
834-845 |
RB |
denotes |
exclusively |
T20383 |
846-847 |
-LRB- |
denotes |
( |
T20384 |
847-849 |
NNP |
denotes |
R. |
T20385 |
850-852 |
NNP |
denotes |
O. |
T20386 |
853-856 |
CC |
denotes |
and |
T20387 |
857-859 |
NNP |
denotes |
G. |
T20388 |
860-862 |
NNP |
denotes |
L. |
T20389 |
862-864 |
, |
denotes |
, |
T20390 |
864-875 |
JJ |
denotes |
unpublished |
T20391 |
876-880 |
NNS |
denotes |
data |
T20392 |
880-881 |
-RRB- |
denotes |
) |
T20393 |
881-882 |
. |
denotes |
. |
T20394 |
882-965 |
sentence |
denotes |
The genotyping strategy is discussed in detail later and is outlined in Figure 7A. |
T20395 |
883-886 |
DT |
denotes |
The |
T20396 |
898-906 |
NN |
denotes |
strategy |
T20397 |
887-897 |
NN |
denotes |
genotyping |
T20398 |
910-919 |
VBN |
denotes |
discussed |
T20399 |
907-909 |
VBZ |
denotes |
is |
T20400 |
920-922 |
IN |
denotes |
in |
T20401 |
923-929 |
NN |
denotes |
detail |
T20402 |
930-935 |
RB |
denotes |
later |
T20403 |
936-939 |
CC |
denotes |
and |
T20404 |
940-942 |
VBZ |
denotes |
is |
T20405 |
943-951 |
VBN |
denotes |
outlined |
T20406 |
952-954 |
IN |
denotes |
in |
T20407 |
955-961 |
NN |
denotes |
Figure |
T20408 |
962-964 |
NN |
denotes |
7A |
T20410 |
965-1060 |
sentence |
denotes |
Western analysis confirmed that the upper band was absent in E2f3a−/− mice (Figures 6 and S8). |
T20411 |
966-973 |
NNP |
denotes |
Western |
T20412 |
974-982 |
NN |
denotes |
analysis |
T20413 |
983-992 |
VBD |
denotes |
confirmed |
T20414 |
993-997 |
IN |
denotes |
that |
T20415 |
1013-1016 |
VBD |
denotes |
was |
T20416 |
998-1001 |
DT |
denotes |
the |
T20417 |
1008-1012 |
NN |
denotes |
band |
T20418 |
1002-1007 |
JJ |
denotes |
upper |
T20419 |
1017-1023 |
JJ |
denotes |
absent |
T20420 |
1024-1026 |
IN |
denotes |
in |
T20421 |
1027-1032 |
NN |
denotes |
E2f3a |
T20422 |
1036-1040 |
NNS |
denotes |
mice |
T20423 |
1032-1033 |
SYM |
denotes |
− |
T20424 |
1033-1034 |
HYPH |
denotes |
/ |
T20425 |
1034-1035 |
SYM |
denotes |
− |
T20426 |
1041-1042 |
-LRB- |
denotes |
( |
T20427 |
1056-1058 |
NN |
denotes |
S8 |
T20428 |
1042-1049 |
NNS |
denotes |
Figures |
T20429 |
1050-1051 |
CD |
denotes |
6 |
T20430 |
1052-1055 |
CC |
denotes |
and |
T20431 |
1058-1059 |
-RRB- |
denotes |
) |
T20432 |
1059-1060 |
. |
denotes |
. |
T20433 |
1060-1221 |
sentence |
denotes |
Consistent with the drop in E2f3-expressing cells during WT retinal maturation (Figure 5A), the total amount of E2f3a was less at P18 compared to P0 (Figure 6). |
T20434 |
1061-1071 |
JJ |
denotes |
Consistent |
T20435 |
1179-1182 |
VBD |
denotes |
was |
T20436 |
1072-1076 |
IN |
denotes |
with |
T20437 |
1077-1080 |
DT |
denotes |
the |
T20438 |
1081-1085 |
NN |
denotes |
drop |
T20439 |
1086-1088 |
IN |
denotes |
in |
T20440 |
1089-1093 |
NN |
denotes |
E2f3 |
T20441 |
1094-1104 |
VBG |
denotes |
expressing |
T20442 |
1093-1094 |
HYPH |
denotes |
- |
T20443 |
1105-1110 |
NNS |
denotes |
cells |
T20444 |
1111-1117 |
IN |
denotes |
during |
T20445 |
1118-1120 |
NN |
denotes |
WT |
T20446 |
1129-1139 |
NN |
denotes |
maturation |
T20447 |
1121-1128 |
JJ |
denotes |
retinal |
T20448 |
1140-1141 |
-LRB- |
denotes |
( |
T20449 |
1148-1150 |
NN |
denotes |
5A |
T20450 |
1141-1147 |
NN |
denotes |
Figure |
T20451 |
1150-1151 |
-RRB- |
denotes |
) |
T20452 |
1151-1153 |
, |
denotes |
, |
T20453 |
1153-1156 |
DT |
denotes |
the |
T20454 |
1163-1169 |
NN |
denotes |
amount |
T20455 |
1157-1162 |
JJ |
denotes |
total |
T20456 |
1170-1172 |
IN |
denotes |
of |
T20457 |
1173-1178 |
NN |
denotes |
E2f3a |
T20458 |
1183-1187 |
JJR |
denotes |
less |
T20459 |
1188-1190 |
IN |
denotes |
at |
T20460 |
1191-1194 |
NN |
denotes |
P18 |
T20461 |
1195-1203 |
VBN |
denotes |
compared |
T20462 |
1204-1206 |
IN |
denotes |
to |
T20463 |
1207-1209 |
NN |
denotes |
P0 |
T20464 |
1210-1211 |
-LRB- |
denotes |
( |
T20465 |
1211-1217 |
NN |
denotes |
Figure |
T20466 |
1218-1219 |
CD |
denotes |
6 |
T20467 |
1219-1220 |
-RRB- |
denotes |
) |
T20468 |
1220-1221 |
. |
denotes |
. |
T20469 |
1221-1279 |
sentence |
denotes |
E2f3b was present in similar amounts at both time points. |
T20470 |
1222-1227 |
NN |
denotes |
E2f3b |
T20471 |
1228-1231 |
VBD |
denotes |
was |
T20472 |
1232-1239 |
JJ |
denotes |
present |
T20473 |
1240-1242 |
IN |
denotes |
in |
T20474 |
1243-1250 |
JJ |
denotes |
similar |
T20475 |
1251-1258 |
NNS |
denotes |
amounts |
T20476 |
1259-1261 |
IN |
denotes |
at |
T20477 |
1262-1266 |
DT |
denotes |
both |
T20478 |
1272-1278 |
NNS |
denotes |
points |
T20479 |
1267-1271 |
NN |
denotes |
time |
T20480 |
1278-1279 |
. |
denotes |
. |
T20481 |
1279-1435 |
sentence |
denotes |
At P0 and P18, E2f3a was present in both nuclear and cytoplasmic fractions, but in marked contrast, E2f3b was exclusively nuclear at both times (Figure 6). |
T20482 |
1280-1282 |
IN |
denotes |
At |
T20483 |
1301-1304 |
VBD |
denotes |
was |
T20484 |
1283-1285 |
NN |
denotes |
P0 |
T20485 |
1286-1289 |
CC |
denotes |
and |
T20486 |
1290-1293 |
NN |
denotes |
P18 |
T20487 |
1293-1295 |
, |
denotes |
, |
T20488 |
1295-1300 |
NN |
denotes |
E2f3a |
T20489 |
1305-1312 |
JJ |
denotes |
present |
T20490 |
1313-1315 |
IN |
denotes |
in |
T20491 |
1316-1320 |
CC |
denotes |
both |
T20492 |
1321-1328 |
JJ |
denotes |
nuclear |
T20493 |
1345-1354 |
NNS |
denotes |
fractions |
T20494 |
1329-1332 |
CC |
denotes |
and |
T20495 |
1333-1344 |
JJ |
denotes |
cytoplasmic |
T20496 |
1354-1356 |
, |
denotes |
, |
T20497 |
1356-1359 |
CC |
denotes |
but |
T20498 |
1360-1362 |
IN |
denotes |
in |
T20499 |
1386-1389 |
VBD |
denotes |
was |
T20500 |
1363-1369 |
JJ |
denotes |
marked |
T20501 |
1370-1378 |
NN |
denotes |
contrast |
T20502 |
1378-1380 |
, |
denotes |
, |
T20503 |
1380-1385 |
NN |
denotes |
E2f3b |
T20504 |
1390-1401 |
RB |
denotes |
exclusively |
T20505 |
1402-1409 |
JJ |
denotes |
nuclear |
T20506 |
1410-1412 |
IN |
denotes |
at |
T20507 |
1413-1417 |
DT |
denotes |
both |
T20508 |
1418-1423 |
NNS |
denotes |
times |
T20509 |
1424-1425 |
-LRB- |
denotes |
( |
T20510 |
1425-1431 |
NN |
denotes |
Figure |
T20511 |
1432-1433 |
CD |
denotes |
6 |
T20512 |
1433-1434 |
-RRB- |
denotes |
) |
T20513 |
1434-1435 |
. |
denotes |
. |
T20514 |
1435-1636 |
sentence |
denotes |
Two closely migrating E2f3a bands were detected, more clearly evident at P18, of which the faster migrating species was dominant in nuclear and the slower species was dominant in cytoplasm (Figure 6). |
T20515 |
1436-1439 |
CD |
denotes |
Two |
T20516 |
1464-1469 |
NNS |
denotes |
bands |
T20517 |
1440-1447 |
RB |
denotes |
closely |
T20518 |
1448-1457 |
VBG |
denotes |
migrating |
T20519 |
1458-1463 |
NN |
denotes |
E2f3a |
T20520 |
1475-1483 |
VBN |
denotes |
detected |
T20521 |
1470-1474 |
VBD |
denotes |
were |
T20522 |
1483-1485 |
, |
denotes |
, |
T20523 |
1485-1489 |
RBR |
denotes |
more |
T20524 |
1490-1497 |
RB |
denotes |
clearly |
T20525 |
1498-1505 |
JJ |
denotes |
evident |
T20526 |
1506-1508 |
IN |
denotes |
at |
T20527 |
1509-1512 |
NN |
denotes |
P18 |
T20528 |
1512-1514 |
, |
denotes |
, |
T20529 |
1514-1516 |
IN |
denotes |
of |
T20530 |
1552-1555 |
VBD |
denotes |
was |
T20531 |
1517-1522 |
WDT |
denotes |
which |
T20532 |
1523-1526 |
DT |
denotes |
the |
T20533 |
1544-1551 |
NN |
denotes |
species |
T20534 |
1527-1533 |
RBR |
denotes |
faster |
T20535 |
1534-1543 |
VBG |
denotes |
migrating |
T20536 |
1556-1564 |
JJ |
denotes |
dominant |
T20537 |
1565-1567 |
IN |
denotes |
in |
T20538 |
1568-1575 |
JJ |
denotes |
nuclear |
T20539 |
1576-1579 |
CC |
denotes |
and |
T20540 |
1580-1583 |
DT |
denotes |
the |
T20541 |
1591-1598 |
NN |
denotes |
species |
T20542 |
1584-1590 |
JJR |
denotes |
slower |
T20543 |
1599-1602 |
VBD |
denotes |
was |
T20544 |
1603-1611 |
JJ |
denotes |
dominant |
T20545 |
1612-1614 |
IN |
denotes |
in |
T20546 |
1615-1624 |
NN |
denotes |
cytoplasm |
T20547 |
1625-1626 |
-LRB- |
denotes |
( |
T20548 |
1626-1632 |
NN |
denotes |
Figure |
T20549 |
1633-1634 |
CD |
denotes |
6 |
T20550 |
1634-1635 |
-RRB- |
denotes |
) |
T20551 |
1635-1636 |
. |
denotes |
. |
T20552 |
1636-1745 |
sentence |
denotes |
The identity of both as E2f3a species was confirmed by their absence in the P18 E2f3a KO retina (Figure S8). |
T20553 |
1637-1640 |
DT |
denotes |
The |
T20554 |
1641-1649 |
NN |
denotes |
identity |
T20555 |
1679-1688 |
VBN |
denotes |
confirmed |
T20556 |
1650-1652 |
IN |
denotes |
of |
T20557 |
1653-1657 |
DT |
denotes |
both |
T20558 |
1658-1660 |
IN |
denotes |
as |
T20559 |
1661-1666 |
NN |
denotes |
E2f3a |
T20560 |
1667-1674 |
NNS |
denotes |
species |
T20561 |
1675-1678 |
VBD |
denotes |
was |
T20562 |
1689-1691 |
IN |
denotes |
by |
T20563 |
1692-1697 |
PRP$ |
denotes |
their |
T20564 |
1698-1705 |
NN |
denotes |
absence |
T20565 |
1706-1708 |
IN |
denotes |
in |
T20566 |
1709-1712 |
DT |
denotes |
the |
T20567 |
1726-1732 |
NN |
denotes |
retina |
T20568 |
1713-1716 |
NN |
denotes |
P18 |
T20569 |
1717-1722 |
NN |
denotes |
E2f3a |
T20570 |
1723-1725 |
NN |
denotes |
KO |
T20571 |
1733-1734 |
-LRB- |
denotes |
( |
T20572 |
1741-1743 |
NN |
denotes |
S8 |
T20573 |
1734-1740 |
NN |
denotes |
Figure |
T20574 |
1743-1744 |
-RRB- |
denotes |
) |
T20575 |
1744-1745 |
. |
denotes |
. |
T20576 |
1745-2013 |
sentence |
denotes |
Analysis of Pou4f2, a nuclear transcription factor expressed in ganglion cells, showed that nuclear proteins had not contaminated the cytoplasmic fraction, and analysis of Slc18a3, a cytoplasmic SAC marker, confirmed that the reverse had also not occurred (Figure 6). |
T20577 |
1746-1754 |
NN |
denotes |
Analysis |
T20578 |
1826-1832 |
VBD |
denotes |
showed |
T20579 |
1755-1757 |
IN |
denotes |
of |
T20580 |
1758-1764 |
NN |
denotes |
Pou4f2 |
T20581 |
1764-1766 |
, |
denotes |
, |
T20582 |
1766-1767 |
DT |
denotes |
a |
T20583 |
1790-1796 |
NN |
denotes |
factor |
T20584 |
1768-1775 |
JJ |
denotes |
nuclear |
T20585 |
1776-1789 |
NN |
denotes |
transcription |
T20586 |
1797-1806 |
VBN |
denotes |
expressed |
T20587 |
1807-1809 |
IN |
denotes |
in |
T20588 |
1810-1818 |
NN |
denotes |
ganglion |
T20589 |
1819-1824 |
NNS |
denotes |
cells |
T20590 |
1824-1826 |
, |
denotes |
, |
T20591 |
1833-1837 |
IN |
denotes |
that |
T20592 |
1863-1875 |
VBN |
denotes |
contaminated |
T20593 |
1838-1845 |
JJ |
denotes |
nuclear |
T20594 |
1846-1854 |
NN |
denotes |
proteins |
T20595 |
1855-1858 |
VBD |
denotes |
had |
T20596 |
1859-1862 |
RB |
denotes |
not |
T20597 |
1876-1879 |
DT |
denotes |
the |
T20598 |
1892-1900 |
NN |
denotes |
fraction |
T20599 |
1880-1891 |
JJ |
denotes |
cytoplasmic |
T20600 |
1900-1902 |
, |
denotes |
, |
T20601 |
1902-1905 |
CC |
denotes |
and |
T20602 |
1906-1914 |
NN |
denotes |
analysis |
T20603 |
1953-1962 |
VBD |
denotes |
confirmed |
T20604 |
1915-1917 |
IN |
denotes |
of |
T20605 |
1918-1925 |
NN |
denotes |
Slc18a3 |
T20606 |
1925-1927 |
, |
denotes |
, |
T20607 |
1927-1928 |
DT |
denotes |
a |
T20608 |
1945-1951 |
NN |
denotes |
marker |
T20609 |
1929-1940 |
JJ |
denotes |
cytoplasmic |
T20610 |
1941-1944 |
NN |
denotes |
SAC |
T20611 |
1951-1953 |
, |
denotes |
, |
T20612 |
1963-1967 |
IN |
denotes |
that |
T20613 |
1993-2001 |
VBN |
denotes |
occurred |
T20614 |
1968-1971 |
DT |
denotes |
the |
T20615 |
1972-1979 |
NN |
denotes |
reverse |
T20616 |
1980-1983 |
VBD |
denotes |
had |
T20617 |
1984-1988 |
RB |
denotes |
also |
T20618 |
1989-1992 |
RB |
denotes |
not |
T20619 |
2002-2003 |
-LRB- |
denotes |
( |
T20716 |
4361-4362 |
-RRB- |
denotes |
) |
T20717 |
4362-4363 |
. |
denotes |
. |
T20718 |
4363-4548 |
sentence |
denotes |
A very faint cytoplasmic Rb signal was evident at P18, which is consistent with Rb staining of SAC processes (Figure 5B), and with the very small proportion of SACs in the retina [38]. |
T20719 |
4364-4365 |
DT |
denotes |
A |
T20720 |
4392-4398 |
NN |
denotes |
signal |
T20721 |
4366-4370 |
RB |
denotes |
very |
T20722 |
4371-4376 |
JJ |
denotes |
faint |
T20723 |
4377-4388 |
JJ |
denotes |
cytoplasmic |
T20724 |
4389-4391 |
NN |
denotes |
Rb |
T20725 |
4399-4402 |
VBD |
denotes |
was |
T20726 |
4403-4410 |
JJ |
denotes |
evident |
T20727 |
4411-4413 |
IN |
denotes |
at |
T20728 |
4414-4417 |
NN |
denotes |
P18 |
T20729 |
4417-4419 |
, |
denotes |
, |
T20730 |
4419-4424 |
WDT |
denotes |
which |
T20731 |
4425-4427 |
VBZ |
denotes |
is |
T20732 |
4428-4438 |
JJ |
denotes |
consistent |
T20733 |
4439-4443 |
IN |
denotes |
with |
T20734 |
4444-4446 |
NN |
denotes |
Rb |
T20735 |
4447-4455 |
NN |
denotes |
staining |
T20736 |
4456-4458 |
IN |
denotes |
of |
T20737 |
4459-4462 |
NN |
denotes |
SAC |
T20738 |
4463-4472 |
NNS |
denotes |
processes |
T20739 |
4473-4474 |
-LRB- |
denotes |
( |
T20740 |
4481-4483 |
NN |
denotes |
5B |
T20741 |
4474-4480 |
NN |
denotes |
Figure |
T20742 |
4483-4484 |
-RRB- |
denotes |
) |
T20743 |
4484-4486 |
, |
denotes |
, |
T20744 |
4486-4489 |
CC |
denotes |
and |
T20745 |
4490-4494 |
IN |
denotes |
with |
T20746 |
4495-4498 |
DT |
denotes |
the |
T20747 |
4510-4520 |
NN |
denotes |
proportion |
T20748 |
4499-4503 |
RB |
denotes |
very |
T20749 |
4504-4509 |
JJ |
denotes |
small |
T20750 |
4521-4523 |
IN |
denotes |
of |
T20751 |
4524-4528 |
NNS |
denotes |
SACs |
T20752 |
4529-4531 |
IN |
denotes |
in |
T20753 |
4532-4535 |
DT |
denotes |
the |
T20754 |
4536-4542 |
NN |
denotes |
retina |
T20755 |
4543-4544 |
-LRB- |
denotes |
[ |
T20756 |
4544-4546 |
CD |
denotes |
38 |
T20757 |
4546-4547 |
-RRB- |
denotes |
] |
T20758 |
4547-4548 |
. |
denotes |
. |
T20759 |
4548-4696 |
sentence |
denotes |
E2f1 was also detected in both nuclear and cytoplasmic fractions, although unlike E2f3a it was predominantly nuclear both at P0 and P18 (Figure 6). |
T20760 |
4549-4553 |
NN |
denotes |
E2f1 |
T20761 |
4563-4571 |
VBN |
denotes |
detected |
T20762 |
4554-4557 |
VBD |
denotes |
was |
T20763 |
4558-4562 |
RB |
denotes |
also |
T20764 |
4572-4574 |
IN |
denotes |
in |
T20765 |
4575-4579 |
CC |
denotes |
both |
T20766 |
4580-4587 |
JJ |
denotes |
nuclear |
T20767 |
4604-4613 |
NNS |
denotes |
fractions |
T20768 |
4588-4591 |
CC |
denotes |
and |
T20769 |
4592-4603 |
JJ |
denotes |
cytoplasmic |
T20770 |
4613-4615 |
, |
denotes |
, |
T20771 |
4615-4623 |
IN |
denotes |
although |
T20772 |
4640-4643 |
VBD |
denotes |
was |
T20773 |
4624-4630 |
IN |
denotes |
unlike |
T20774 |
4631-4636 |
NN |
denotes |
E2f3a |
T20775 |
4637-4639 |
PRP |
denotes |
it |
T20776 |
4644-4657 |
RB |
denotes |
predominantly |
T20777 |
4658-4665 |
JJ |
denotes |
nuclear |
T20778 |
4666-4670 |
CC |
denotes |
both |
T20779 |
4671-4673 |
IN |
denotes |
at |
T20780 |
4674-4676 |
NN |
denotes |
P0 |
T20781 |
4677-4680 |
CC |
denotes |
and |
T20782 |
4681-4684 |
NN |
denotes |
P18 |
T20783 |
4685-4686 |
-LRB- |
denotes |
( |
T20784 |
4686-4692 |
NN |
denotes |
Figure |
T20785 |
4693-4694 |
CD |
denotes |
6 |
T20786 |
4694-4695 |
-RRB- |
denotes |
) |
T20787 |
4695-4696 |
. |
denotes |
. |
T20788 |
4696-4921 |
sentence |
denotes |
The E2f dimerization partner, Tfdp1, which lacks a nuclear localization signal [54], was primarily cytoplasmic at both P0 and P18, and the Cdk inhibitors Cdkn1a and Cdkn1b showed a similar pattern of distribution (Figure 6). |
T20789 |
4697-4700 |
DT |
denotes |
The |
T20790 |
4718-4725 |
NN |
denotes |
partner |
T20791 |
4701-4704 |
NN |
denotes |
E2f |
T20792 |
4705-4717 |
NN |
denotes |
dimerization |
T20793 |
4782-4785 |
VBD |
denotes |
was |
T20794 |
4725-4727 |
, |
denotes |
, |
T20795 |
4727-4732 |
NN |
denotes |
Tfdp1 |
T20796 |
4732-4734 |
, |
denotes |
, |
T20797 |
4734-4739 |
WDT |
denotes |
which |
T20798 |
4740-4745 |
VBZ |
denotes |
lacks |
T20799 |
4746-4747 |
DT |
denotes |
a |
T20800 |
4769-4775 |
NN |
denotes |
signal |
T20801 |
4748-4755 |
JJ |
denotes |
nuclear |
T20802 |
4756-4768 |
NN |
denotes |
localization |
T20803 |
4776-4777 |
-LRB- |
denotes |
[ |
T20804 |
4777-4779 |
CD |
denotes |
54 |
T20805 |
4779-4780 |
-RRB- |
denotes |
] |
T20806 |
4780-4782 |
, |
denotes |
, |
T20807 |
4786-4795 |
RB |
denotes |
primarily |
T20808 |
4796-4807 |
JJ |
denotes |
cytoplasmic |
T20809 |
4808-4810 |
IN |
denotes |
at |
T20810 |
4811-4815 |
CC |
denotes |
both |
T20811 |
4816-4818 |
NN |
denotes |
P0 |
T20812 |
4819-4822 |
CC |
denotes |
and |
T20813 |
4823-4826 |
NN |
denotes |
P18 |
T20814 |
4826-4828 |
, |
denotes |
, |
T20815 |
4828-4831 |
CC |
denotes |
and |
T20816 |
4832-4835 |
DT |
denotes |
the |
T20817 |
4840-4850 |
NNS |
denotes |
inhibitors |
T20818 |
4836-4839 |
NN |
denotes |
Cdk |
T20819 |
4869-4875 |
VBD |
denotes |
showed |
T20820 |
4851-4857 |
NN |
denotes |
Cdkn1a |
T20821 |
4858-4861 |
CC |
denotes |
and |
T20822 |
4862-4868 |
NN |
denotes |
Cdkn1b |
T20823 |
4876-4877 |
DT |
denotes |
a |
T20824 |
4886-4893 |
NN |
denotes |
pattern |
T20825 |
4878-4885 |
JJ |
denotes |
similar |
T20826 |
4894-4896 |
IN |
denotes |
of |
T20827 |
4897-4909 |
NN |
denotes |
distribution |
T20828 |
4910-4911 |
-LRB- |
denotes |
( |
T20829 |
4911-4917 |
NN |
denotes |
Figure |
T20830 |
4918-4919 |
CD |
denotes |
6 |
T20831 |
4919-4920 |
-RRB- |
denotes |
) |
T20832 |
4920-4921 |
. |
denotes |
. |
T20833 |
4921-5073 |
sentence |
denotes |
Thus, among the cell cycle regulators we examined, most showed bivalent distribution, and E2f3b was unusual in its solely nuclear compartmentalization. |
T20834 |
4922-4926 |
RB |
denotes |
Thus |
T20835 |
4978-4984 |
VBD |
denotes |
showed |
T20836 |
4926-4928 |
, |
denotes |
, |
T20837 |
4928-4933 |
IN |
denotes |
among |
T20838 |
4934-4937 |
DT |
denotes |
the |
T20839 |
4949-4959 |
NNS |
denotes |
regulators |
T20840 |
4938-4942 |
NN |
denotes |
cell |
T20841 |
4943-4948 |
NN |
denotes |
cycle |
T20842 |
4960-4962 |
PRP |
denotes |
we |
T20843 |
4963-4971 |
VBD |
denotes |
examined |
T20844 |
4971-4973 |
, |
denotes |
, |
T20845 |
4973-4977 |
JJS |
denotes |
most |
T20846 |
4985-4993 |
JJ |
denotes |
bivalent |
T20847 |
4994-5006 |
NN |
denotes |
distribution |
T20848 |
5006-5008 |
, |
denotes |
, |
T20849 |
5008-5011 |
CC |
denotes |
and |
T20850 |
5012-5017 |
NN |
denotes |
E2f3b |
T20851 |
5018-5021 |
VBD |
denotes |
was |
T20852 |
5022-5029 |
JJ |
denotes |
unusual |
T20853 |
5030-5032 |
IN |
denotes |
in |
T20854 |
5033-5036 |
PRP$ |
denotes |
its |
T20855 |
5052-5072 |
NN |
denotes |
compartmentalization |
T20856 |
5037-5043 |
RB |
denotes |
solely |
T20857 |
5044-5051 |
JJ |
denotes |
nuclear |
T20858 |
5072-5073 |
. |
denotes |
. |
T37145 |
2273-2284 |
JJ |
denotes |
Subcellular |
T37146 |
2285-2297 |
NN |
denotes |
Distribution |
T37147 |
2298-2300 |
IN |
denotes |
of |
T37148 |
2301-2305 |
NN |
denotes |
E2f3 |
T37149 |
2306-2314 |
NNS |
denotes |
Isoforms |
T37150 |
2315-2318 |
CC |
denotes |
and |
T37151 |
2319-2324 |
JJ |
denotes |
Other |
T37152 |
2336-2344 |
NNS |
denotes |
Proteins |
T37153 |
2325-2329 |
NN |
denotes |
Cell |
T37154 |
2330-2335 |
NN |
denotes |
Cycle |
T37155 |
2345-2347 |
IN |
denotes |
in |
T37156 |
2348-2351 |
DT |
denotes |
the |
T37157 |
2363-2369 |
NN |
denotes |
Retina |
T37158 |
2352-2362 |
VBG |
denotes |
Developing |
T37159 |
2369-2559 |
sentence |
denotes |
Nuclear and cytoplasmic extracts from an equivalent number of retinal cells from mice of the indicated genotypes and ages were analyzed by Western blotting to detect the indicated proteins. |
T37160 |
2370-2377 |
JJ |
denotes |
Nuclear |
T37161 |
2394-2402 |
NNS |
denotes |
extracts |
T37162 |
2378-2381 |
CC |
denotes |
and |
T37163 |
2382-2393 |
JJ |
denotes |
cytoplasmic |
T37164 |
2497-2505 |
VBN |
denotes |
analyzed |
T37165 |
2403-2407 |
IN |
denotes |
from |
T37166 |
2408-2410 |
DT |
denotes |
an |
T37167 |
2422-2428 |
NN |
denotes |
number |
T37168 |
2411-2421 |
JJ |
denotes |
equivalent |
T37169 |
2429-2431 |
IN |
denotes |
of |
T37170 |
2432-2439 |
JJ |
denotes |
retinal |
T37171 |
2440-2445 |
NNS |
denotes |
cells |
T37172 |
2446-2450 |
IN |
denotes |
from |
T37173 |
2451-2455 |
NNS |
denotes |
mice |
T37174 |
2456-2458 |
IN |
denotes |
of |
T37175 |
2459-2462 |
DT |
denotes |
the |
T37176 |
2473-2482 |
NNS |
denotes |
genotypes |
T37177 |
2463-2472 |
VBN |
denotes |
indicated |
T37178 |
2483-2486 |
CC |
denotes |
and |
T37179 |
2487-2491 |
NNS |
denotes |
ages |
T37180 |
2492-2496 |
VBD |
denotes |
were |
T37181 |
2506-2508 |
IN |
denotes |
by |
T37182 |
2509-2516 |
NNP |
denotes |
Western |
T37183 |
2517-2525 |
NN |
denotes |
blotting |
T37184 |
2526-2528 |
TO |
denotes |
to |
T37185 |
2529-2535 |
VB |
denotes |
detect |
T37186 |
2536-2539 |
DT |
denotes |
the |
T37187 |
2550-2558 |
NN |
denotes |
proteins |
T37188 |
2540-2549 |
VBN |
denotes |
indicated |
T37189 |
2558-2559 |
. |
denotes |
. |
T37190 |
2559-2649 |
sentence |
denotes |
Lysate from E2f3a−/− mice was used as a control to confirm the location of E2f3a protein. |
T37191 |
2560-2566 |
NN |
denotes |
Lysate |
T37192 |
2590-2594 |
VBN |
denotes |
used |
T37193 |
2567-2571 |
IN |
denotes |
from |
T37194 |
2572-2577 |
NN |
denotes |
E2f3a |
T37195 |
2581-2585 |
NNS |
denotes |
mice |
T37196 |
2577-2578 |
SYM |
denotes |
− |
T37197 |
2578-2579 |
HYPH |
denotes |
/ |
T37198 |
2579-2580 |
SYM |
denotes |
− |
T37199 |
2586-2589 |
VBD |
denotes |
was |
T37200 |
2595-2597 |
IN |
denotes |
as |
T37201 |
2598-2599 |
DT |
denotes |
a |
T37202 |
2600-2607 |
NN |
denotes |
control |
T37203 |
2608-2610 |
TO |
denotes |
to |
T37204 |
2611-2618 |
VB |
denotes |
confirm |
T37205 |
2619-2622 |
DT |
denotes |
the |
T37206 |
2623-2631 |
NN |
denotes |
location |
T37207 |
2632-2634 |
IN |
denotes |
of |
T37208 |
2635-2640 |
NN |
denotes |
E2f3a |
T37209 |
2641-2648 |
NN |
denotes |
protein |
T37210 |
2648-2649 |
. |
denotes |
. |
T37211 |
2649-2695 |
sentence |
denotes |
C, cytoplasmic extracts; N, nuclear extracts. |
T37212 |
2650-2651 |
NN |
denotes |
C |
T37213 |
2651-2653 |
, |
denotes |
, |
T37214 |
2653-2664 |
JJ |
denotes |
cytoplasmic |
T37215 |
2665-2673 |
NNS |
denotes |
extracts |
T37216 |
2673-2674 |
: |
denotes |
; |
T37217 |
2675-2676 |
NN |
denotes |
N |
T37218 |
2676-2678 |
, |
denotes |
, |
T37219 |
2678-2685 |
JJ |
denotes |
nuclear |
T37220 |
2686-2694 |
NNS |
denotes |
extracts |
T37221 |
2694-2695 |
. |
denotes |
. |
T37919 |
2731-2734 |
DT |
denotes |
the |
T37920 |
2751-2757 |
NN |
denotes |
Defect |
T37921 |
2735-2750 |
NN |
denotes |
Differentiation |
T37922 |
2758-2760 |
IN |
denotes |
in |
T37923 |
2761-2763 |
NN |
denotes |
Rb |
T37915 |
2706-2709 |
DT |
denotes |
The |
T37916 |
2716-2723 |
NN |
denotes |
Isoform |
T37917 |
2710-2715 |
NN |
denotes |
E2f3a |
T37918 |
2724-2730 |
VBZ |
denotes |
Drives |
T37924 |
2764-2766 |
NN |
denotes |
KO |
T37925 |
2767-2771 |
NNS |
denotes |
SACs |
T37926 |
2771-2905 |
sentence |
denotes |
(A) Schematic diagrams of the mouse WT, E2f3a−/−, and the Cre-recombined floxed E2f3 loci (indicated here as E2f3−/− for simplicity). |
T37927 |
2772-2773 |
-LRB- |
denotes |
( |
T37928 |
2773-2774 |
LS |
denotes |
A |
T37929 |
2786-2794 |
NNS |
denotes |
diagrams |
T37930 |
2774-2775 |
-RRB- |
denotes |
) |
T37931 |
2776-2785 |
JJ |
denotes |
Schematic |
T37932 |
2795-2797 |
IN |
denotes |
of |
T37933 |
2798-2801 |
DT |
denotes |
the |
T37934 |
2808-2810 |
NN |
denotes |
WT |
T37935 |
2802-2807 |
NN |
denotes |
mouse |
T37936 |
2810-2812 |
, |
denotes |
, |
T37937 |
2812-2817 |
NN |
denotes |
E2f3a |
T37938 |
2817-2818 |
SYM |
denotes |
− |
T37939 |
2818-2819 |
HYPH |
denotes |
/ |
T37940 |
2819-2820 |
SYM |
denotes |
− |
T37941 |
2820-2822 |
, |
denotes |
, |
T37942 |
2822-2825 |
CC |
denotes |
and |
T37943 |
2826-2829 |
DT |
denotes |
the |
T37944 |
2857-2861 |
NNS |
denotes |
loci |
T37945 |
2830-2833 |
NN |
denotes |
Cre |
T37946 |
2833-2834 |
HYPH |
denotes |
- |
T37947 |
2834-2844 |
VBN |
denotes |
recombined |
T37948 |
2845-2851 |
VBN |
denotes |
floxed |
T37949 |
2852-2856 |
NN |
denotes |
E2f3 |
T37950 |
2862-2863 |
-LRB- |
denotes |
( |
T37951 |
2863-2872 |
VBN |
denotes |
indicated |
T37952 |
2873-2877 |
RB |
denotes |
here |
T37953 |
2878-2880 |
IN |
denotes |
as |
T37954 |
2881-2885 |
NN |
denotes |
E2f3 |
T37955 |
2885-2886 |
SYM |
denotes |
− |
T37956 |
2886-2887 |
HYPH |
denotes |
/ |
T37957 |
2887-2888 |
SYM |
denotes |
− |
T37958 |
2889-2892 |
IN |
denotes |
for |
T37959 |
2893-2903 |
NN |
denotes |
simplicity |
T37960 |
2903-2904 |
-RRB- |
denotes |
) |
T37961 |
2904-2905 |
. |
denotes |
. |
T37962 |
2905-2985 |
sentence |
denotes |
E2f3a−/− mice lack most of E2f3 exon 1a and part of intron 1a (red dotted box). |
T37963 |
2906-2911 |
NN |
denotes |
E2f3a |
T37964 |
2915-2919 |
NNS |
denotes |
mice |
T37965 |
2911-2912 |
SYM |
denotes |
− |
T37966 |
2912-2913 |
HYPH |
denotes |
/ |
T37967 |
2913-2914 |
SYM |
denotes |
− |
T37968 |
2920-2924 |
VBP |
denotes |
lack |
T37969 |
2925-2929 |
JJS |
denotes |
most |
T37970 |
2930-2932 |
IN |
denotes |
of |
T37971 |
2933-2937 |
NN |
denotes |
E2f3 |
T37972 |
2943-2945 |
NN |
denotes |
1a |
T37973 |
2938-2942 |
NN |
denotes |
exon |
T37974 |
2946-2949 |
CC |
denotes |
and |
T37975 |
2950-2954 |
NN |
denotes |
part |
T37976 |
2955-2957 |
IN |
denotes |
of |
T37977 |
2958-2964 |
NN |
denotes |
intron |
T37978 |
2965-2967 |
NN |
denotes |
1a |
T37979 |
2968-2969 |
-LRB- |
denotes |
( |
T37980 |
2980-2983 |
NN |
denotes |
box |
T37981 |
2969-2972 |
JJ |
denotes |
red |
T37982 |
2973-2979 |
VBN |
denotes |
dotted |
T37983 |
2983-2984 |
-RRB- |
denotes |
) |
T37984 |
2984-2985 |
. |
denotes |
. |
T37985 |
2985-3014 |
sentence |
denotes |
Arrows indicate PCR primers. |
T37986 |
2986-2992 |
NNS |
denotes |
Arrows |
T37987 |
2993-3001 |
VBP |
denotes |
indicate |
T37988 |
3002-3005 |
NN |
denotes |
PCR |
T37989 |
3006-3013 |
NNS |
denotes |
primers |
T37990 |
3013-3014 |
. |
denotes |
. |
T37991 |
3014-3069 |
sentence |
denotes |
Genotyping of an E2f3a+/− mouse is shown on the right. |
T37992 |
3015-3025 |
NN |
denotes |
Genotyping |
T37993 |
3050-3055 |
VBN |
denotes |
shown |
T37994 |
3026-3028 |
IN |
denotes |
of |
T37995 |
3029-3031 |
DT |
denotes |
an |
T37996 |
3041-3046 |
NN |
denotes |
mouse |
T37997 |
3032-3037 |
NN |
denotes |
E2f3a |
T37998 |
3037-3038 |
SYM |
denotes |
+ |
T37999 |
3038-3039 |
HYPH |
denotes |
/ |
T38000 |
3039-3040 |
SYM |
denotes |
− |
T38001 |
3047-3049 |
VBZ |
denotes |
is |
T38002 |
3056-3058 |
IN |
denotes |
on |
T38003 |
3059-3062 |
DT |
denotes |
the |
T38004 |
3063-3068 |
NN |
denotes |
right |
T38005 |
3068-3069 |
. |
denotes |
. |
T38006 |
3069-3129 |
sentence |
denotes |
(B) RT-PCR detection of E2f3a and E2f3b mRNA in the retina. |
T38007 |
3070-3071 |
-LRB- |
denotes |
( |
T38008 |
3071-3072 |
LS |
denotes |
B |
T38009 |
3081-3090 |
NN |
denotes |
detection |
T38010 |
3072-3073 |
-RRB- |
denotes |
) |
T38011 |
3074-3076 |
NN |
denotes |
RT |
T38012 |
3077-3080 |
NN |
denotes |
PCR |
T38013 |
3076-3077 |
HYPH |
denotes |
- |
T38014 |
3091-3093 |
IN |
denotes |
of |
T38015 |
3094-3099 |
NN |
denotes |
E2f3a |
T38016 |
3110-3114 |
NN |
denotes |
mRNA |
T38017 |
3100-3103 |
CC |
denotes |
and |
T38018 |
3104-3109 |
NN |
denotes |
E2f3b |
T38019 |
3115-3117 |
IN |
denotes |
in |
T38020 |
3118-3121 |
DT |
denotes |
the |
T38021 |
3122-3128 |
NN |
denotes |
retina |
T38022 |
3128-3129 |
. |
denotes |
. |
T38023 |
3129-3263 |
sentence |
denotes |
The sequences of primers are 1aF (5′-GCCTCTACACCACGCCACAAG-3′), 1bF (5′-CGGAAATGCCCTTACAGC-3′), and 4R (5′-CTCAGTCACTTCTTTGGACAG-3′). |
T38024 |
3130-3133 |
DT |
denotes |
The |
T38025 |
3134-3143 |
NNS |
denotes |
sequences |
T38026 |
3155-3158 |
VBP |
denotes |
are |
T38027 |
3144-3146 |
IN |
denotes |
of |
T38028 |
3147-3154 |
NNS |
denotes |
primers |
T38029 |
3159-3162 |
NN |
denotes |
1aF |
T38030 |
3163-3164 |
-LRB- |
denotes |
( |
T38031 |
3164-3165 |
CD |
denotes |
5 |
T38032 |
3167-3188 |
NN |
denotes |
GCCTCTACACCACGCCACAAG |
T38033 |
3165-3166 |
SYM |
denotes |
′ |
T38034 |
3166-3167 |
HYPH |
denotes |
- |
T38035 |
3188-3189 |
HYPH |
denotes |
- |
T38036 |
3189-3190 |
CD |
denotes |
3 |
T38037 |
3190-3191 |
SYM |
denotes |
′ |
T38038 |
3191-3192 |
-RRB- |
denotes |
) |
T38039 |
3192-3194 |
, |
denotes |
, |
T38040 |
3194-3197 |
NN |
denotes |
1bF |
T38041 |
3198-3199 |
-LRB- |
denotes |
( |
T38042 |
3199-3200 |
CD |
denotes |
5 |
T38043 |
3202-3220 |
NN |
denotes |
CGGAAATGCCCTTACAGC |
T38044 |
3200-3201 |
SYM |
denotes |
′ |
T38045 |
3201-3202 |
HYPH |
denotes |
- |
T38046 |
3220-3221 |
HYPH |
denotes |
- |
T38047 |
3221-3222 |
CD |
denotes |
3 |
T38048 |
3222-3223 |
SYM |
denotes |
′ |
T38049 |
3223-3224 |
-RRB- |
denotes |
) |
T38050 |
3224-3226 |
, |
denotes |
, |
T38051 |
3226-3229 |
CC |
denotes |
and |
T38052 |
3230-3232 |
NN |
denotes |
4R |
T38053 |
3233-3234 |
-LRB- |
denotes |
( |
T38054 |
3234-3235 |
CD |
denotes |
5 |
T38055 |
3237-3258 |
NN |
denotes |
CTCAGTCACTTCTTTGGACAG |
T38056 |
3235-3236 |
SYM |
denotes |
′ |
T38057 |
3236-3237 |
HYPH |
denotes |
- |
T38058 |
3258-3259 |
HYPH |
denotes |
- |
T38059 |
3259-3260 |
CD |
denotes |
3 |
T38060 |
3260-3261 |
SYM |
denotes |
′ |
T38061 |
3261-3262 |
-RRB- |
denotes |
) |
T38062 |
3262-3263 |
. |
denotes |
. |
T38063 |
3263-3310 |
sentence |
denotes |
WT retina expresses both E2f3a and E2f3b mRNA. |
T38064 |
3264-3266 |
NN |
denotes |
WT |
T38065 |
3267-3273 |
NN |
denotes |
retina |
T38066 |
3274-3283 |
VBZ |
denotes |
expresses |
T38067 |
3284-3288 |
CC |
denotes |
both |
T38068 |
3289-3294 |
NN |
denotes |
E2f3a |
T38069 |
3305-3309 |
NN |
denotes |
mRNA |
T38070 |
3295-3298 |
CC |
denotes |
and |
T38071 |
3299-3304 |
NN |
denotes |
E2f3b |
T38072 |
3309-3310 |
. |
denotes |
. |
T38073 |
3310-3388 |
sentence |
denotes |
As expected, E2f3a−/− retina lacks E2f3a mRNA and still expresses E2f3b mRNA. |
T38074 |
3311-3313 |
IN |
denotes |
As |
T38075 |
3314-3322 |
VBN |
denotes |
expected |
T38076 |
3340-3345 |
VBZ |
denotes |
lacks |
T38077 |
3322-3324 |
, |
denotes |
, |
T38078 |
3324-3329 |
NN |
denotes |
E2f3a |
T38079 |
3333-3339 |
NN |
denotes |
retina |
T38080 |
3329-3330 |
SYM |
denotes |
− |
T38081 |
3330-3331 |
HYPH |
denotes |
/ |
T38082 |
3331-3332 |
SYM |
denotes |
− |
T38083 |
3346-3351 |
NN |
denotes |
E2f3a |
T38084 |
3352-3356 |
NN |
denotes |
mRNA |
T38085 |
3357-3360 |
CC |
denotes |
and |
T38086 |
3361-3366 |
RB |
denotes |
still |
T38087 |
3367-3376 |
VBZ |
denotes |
expresses |
T38088 |
3377-3382 |
NN |
denotes |
E2f3b |
T38089 |
3383-3387 |
NN |
denotes |
mRNA |
T38090 |
3387-3388 |
. |
denotes |
. |
T38091 |
3388-3499 |
sentence |
denotes |
E2f3−/− retina lacks full-length E2f3a and E2f3b mRNAs, and instead expresses a truncated mRNA lacking exon 3. |
T38092 |
3389-3393 |
NN |
denotes |
E2f3 |
T38093 |
3397-3403 |
NN |
denotes |
retina |
T38094 |
3393-3394 |
SYM |
denotes |
− |
T38095 |
3394-3395 |
HYPH |
denotes |
/ |
T38096 |
3395-3396 |
SYM |
denotes |
− |
T38097 |
3404-3409 |
VBZ |
denotes |
lacks |
T38098 |
3410-3414 |
JJ |
denotes |
full |
T38099 |
3415-3421 |
NN |
denotes |
length |
T38100 |
3414-3415 |
HYPH |
denotes |
- |
T38101 |
3438-3443 |
NNS |
denotes |
mRNAs |
T38102 |
3422-3427 |
NN |
denotes |
E2f3a |
T38103 |
3428-3431 |
CC |
denotes |
and |
T38104 |
3432-3437 |
NN |
denotes |
E2f3b |
T38105 |
3443-3445 |
, |
denotes |
, |
T38106 |
3445-3448 |
CC |
denotes |
and |
T38107 |
3449-3456 |
RB |
denotes |
instead |
T38108 |
3457-3466 |
VBZ |
denotes |
expresses |
T38109 |
3467-3468 |
DT |
denotes |
a |
T38110 |
3479-3483 |
NN |
denotes |
mRNA |
T38111 |
3469-3478 |
VBN |
denotes |
truncated |
T38112 |
3484-3491 |
VBG |
denotes |
lacking |
T38113 |
3492-3496 |
NN |
denotes |
exon |
T38114 |
3497-3498 |
CD |
denotes |
3 |
T38115 |
3498-3499 |
. |
denotes |
. |
T38116 |
3499-3584 |
sentence |
denotes |
(C) Real-time RT-PCR analysis of E2f genes in P8 retinas of the indicated genotypes. |
T38117 |
3500-3501 |
-LRB- |
denotes |
( |
T38118 |
3501-3502 |
LS |
denotes |
C |
T38119 |
3521-3529 |
NN |
denotes |
analysis |
T38120 |
3502-3503 |
-RRB- |
denotes |
) |
T38121 |
3504-3508 |
JJ |
denotes |
Real |
T38122 |
3509-3513 |
NN |
denotes |
time |
T38123 |
3508-3509 |
HYPH |
denotes |
- |
T38124 |
3514-3516 |
NN |
denotes |
RT |
T38125 |
3517-3520 |
NN |
denotes |
PCR |
T38126 |
3516-3517 |
HYPH |
denotes |
- |
T38127 |
3530-3532 |
IN |
denotes |
of |
T38128 |
3533-3536 |
NN |
denotes |
E2f |
T38129 |
3537-3542 |
NNS |
denotes |
genes |
T38130 |
3543-3545 |
IN |
denotes |
in |
T38131 |
3546-3548 |
NN |
denotes |
P8 |
T38132 |
3549-3556 |
NNS |
denotes |
retinas |
T38133 |
3557-3559 |
IN |
denotes |
of |
T38134 |
3560-3563 |
DT |
denotes |
the |
T38135 |
3574-3583 |
NNS |
denotes |
genotypes |
T38136 |
3564-3573 |
VBN |
denotes |
indicated |
T38137 |
3583-3584 |
. |
denotes |
. |
T38138 |
3584-3784 |
sentence |
denotes |
Error bars represent SD of measurements from three animals, and asterisks indicate a significant difference between WT and the indicated genotypes (*, p <0.05; **; p <0.01; ANOVA and Tukey HSD test). |
T38139 |
3585-3590 |
NN |
denotes |
Error |
T38140 |
3591-3595 |
NNS |
denotes |
bars |
T38141 |
3596-3605 |
VBP |
denotes |
represent |
T38142 |
3606-3608 |
NN |
denotes |
SD |
T38143 |
3609-3611 |
IN |
denotes |
of |
T38144 |
3612-3624 |
NNS |
denotes |
measurements |
T38145 |
3625-3629 |
IN |
denotes |
from |
T38146 |
3630-3635 |
CD |
denotes |
three |
T38147 |
3636-3643 |
NNS |
denotes |
animals |
T38148 |
3643-3645 |
, |
denotes |
, |
T38149 |
3645-3648 |
CC |
denotes |
and |
T38150 |
3649-3658 |
NNS |
denotes |
asterisks |
T38151 |
3659-3667 |
VBP |
denotes |
indicate |
T38152 |
3668-3669 |
DT |
denotes |
a |
T38153 |
3682-3692 |
NN |
denotes |
difference |
T38154 |
3670-3681 |
JJ |
denotes |
significant |
T38155 |
3693-3700 |
IN |
denotes |
between |
T38156 |
3701-3703 |
NN |
denotes |
WT |
T38157 |
3704-3707 |
CC |
denotes |
and |
T38158 |
3708-3711 |
DT |
denotes |
the |
T38159 |
3712-3721 |
VBN |
denotes |
indicated |
T38160 |
3722-3731 |
NNS |
denotes |
genotypes |
T38161 |
3732-3733 |
-LRB- |
denotes |
( |
T38162 |
3778-3782 |
NN |
denotes |
test |
T38163 |
3733-3734 |
SYM |
denotes |
* |
T38164 |
3739-3743 |
CD |
denotes |
0.05 |
T38165 |
3734-3736 |
, |
denotes |
, |
T38166 |
3736-3737 |
NN |
denotes |
p |
T38167 |
3738-3739 |
SYM |
denotes |
< |
T38168 |
3743-3744 |
: |
denotes |
; |
T38169 |
3745-3747 |
SYM |
denotes |
** |
T38170 |
3752-3756 |
CD |
denotes |
0.01 |
T38171 |
3747-3748 |
: |
denotes |
; |
T38172 |
3749-3750 |
NN |
denotes |
p |
T38173 |
3751-3752 |
SYM |
denotes |
< |
T38174 |
3756-3757 |
: |
denotes |
; |
T38175 |
3758-3763 |
NN |
denotes |
ANOVA |
T38176 |
3764-3767 |
CC |
denotes |
and |
T38177 |
3768-3773 |
NNP |
denotes |
Tukey |
T38178 |
3774-3777 |
NN |
denotes |
HSD |
T38179 |
3782-3783 |
-RRB- |
denotes |
) |
T38180 |
3783-3784 |
. |
denotes |
. |
T38181 |
3784-3828 |
sentence |
denotes |
(D) Rescue of Rb KO SACs by E2f3a deletion. |
T38182 |
3785-3786 |
-LRB- |
denotes |
( |
T38183 |
3786-3787 |
LS |
denotes |
D |
T38184 |
3789-3795 |
NN |
denotes |
Rescue |
T38185 |
3787-3788 |
-RRB- |
denotes |
) |
T38186 |
3796-3798 |
IN |
denotes |
of |
T38187 |
3799-3801 |
NN |
denotes |
Rb |
T38188 |
3802-3804 |
NN |
denotes |
KO |
T38189 |
3805-3809 |
NNS |
denotes |
SACs |
T38190 |
3810-3812 |
IN |
denotes |
by |
T38191 |
3813-3818 |
NN |
denotes |
E2f3a |
T38192 |
3819-3827 |
NN |
denotes |
deletion |
T38193 |
3827-3828 |
. |
denotes |
. |
T38194 |
3828-3986 |
sentence |
denotes |
Horizontal retinal sections of the indicated genotypes and ages were stained for nuclei (DAPI, blue), M-phase (PH3, green), and the SAC marker Slc18a3 (red). |
T38195 |
3829-3839 |
JJ |
denotes |
Horizontal |
T38196 |
3848-3856 |
NNS |
denotes |
sections |
T38197 |
3840-3847 |
JJ |
denotes |
retinal |
T38198 |
3898-3905 |
VBN |
denotes |
stained |
T38199 |
3857-3859 |
IN |
denotes |
of |
T38200 |
3860-3863 |
DT |
denotes |
the |
T38201 |
3874-3883 |
NNS |
denotes |
genotypes |
T38202 |
3864-3873 |
VBN |
denotes |
indicated |
T38203 |
3884-3887 |
CC |
denotes |
and |
T38204 |
3888-3892 |
NNS |
denotes |
ages |
T38205 |
3893-3897 |
VBD |
denotes |
were |
T38206 |
3906-3909 |
IN |
denotes |
for |
T38207 |
3910-3916 |
NNS |
denotes |
nuclei |
T38208 |
3917-3918 |
-LRB- |
denotes |
( |
T38209 |
3924-3928 |
JJ |
denotes |
blue |
T38210 |
3918-3922 |
NN |
denotes |
DAPI |
T38211 |
3922-3924 |
, |
denotes |
, |
T38212 |
3928-3929 |
-RRB- |
denotes |
) |
T38213 |
3929-3931 |
, |
denotes |
, |
T38214 |
3931-3932 |
NN |
denotes |
M |
T38215 |
3933-3938 |
NN |
denotes |
phase |
T38216 |
3932-3933 |
HYPH |
denotes |
- |
T38217 |
3939-3940 |
-LRB- |
denotes |
( |
T38218 |
3945-3950 |
JJ |
denotes |
green |
T38219 |
3940-3943 |
NN |
denotes |
PH3 |
T38220 |
3943-3945 |
, |
denotes |
, |
T38221 |
3950-3951 |
-RRB- |
denotes |
) |
T38222 |
3951-3953 |
, |
denotes |
, |
T38223 |
3953-3956 |
CC |
denotes |
and |
T38224 |
3957-3960 |
DT |
denotes |
the |
T38225 |
3965-3971 |
NN |
denotes |
marker |
T38226 |
3961-3964 |
NN |
denotes |
SAC |
T38227 |
3972-3979 |
NN |
denotes |
Slc18a3 |
T38228 |
3980-3981 |
-LRB- |
denotes |
( |
T38229 |
3981-3984 |
JJ |
denotes |
red |
T38230 |
3984-3985 |
-RRB- |
denotes |
) |
T38231 |
3985-3986 |
. |
denotes |
. |
T38232 |
3986-4065 |
sentence |
denotes |
E2f3a deletion does not suppress ectopic division, but rescues the SAC defect. |
T38233 |
3987-3992 |
NN |
denotes |
E2f3a |
T38234 |
3993-4001 |
NN |
denotes |
deletion |
T38235 |
4011-4019 |
VB |
denotes |
suppress |
T38236 |
4002-4006 |
VBZ |
denotes |
does |
T38237 |
4007-4010 |
RB |
denotes |
not |
T38238 |
4020-4027 |
JJ |
denotes |
ectopic |
T38239 |
4028-4036 |
NN |
denotes |
division |
T38240 |
4036-4038 |
, |
denotes |
, |
T38241 |
4038-4041 |
CC |
denotes |
but |
T38242 |
4042-4049 |
VBZ |
denotes |
rescues |
T38243 |
4050-4053 |
DT |
denotes |
the |
T38244 |
4058-4064 |
NN |
denotes |
defect |
T38245 |
4054-4057 |
NN |
denotes |
SAC |
T38246 |
4064-4065 |
. |
denotes |
. |
T38247 |
4065-4087 |
sentence |
denotes |
Scale bars are 50 μm. |
T38248 |
4066-4071 |
NN |
denotes |
Scale |
T38249 |
4072-4076 |
NNS |
denotes |
bars |
T38250 |
4077-4080 |
VBP |
denotes |
are |
T38251 |
4081-4083 |
CD |
denotes |
50 |
T38252 |
4084-4086 |
NN |
denotes |
μm |
T38253 |
4086-4087 |
. |
denotes |
. |
T38254 |
4087-4113 |
sentence |
denotes |
M, molecular size marker. |
T38255 |
4088-4089 |
NN |
denotes |
M |
T38256 |
4089-4091 |
, |
denotes |
, |
T38257 |
4091-4100 |
JJ |
denotes |
molecular |
T38258 |
4101-4105 |
NN |
denotes |
size |
T38259 |
4106-4112 |
NN |
denotes |
marker |
T38260 |
4112-4113 |
. |
denotes |
. |
T20626 |
2020-2024 |
NNS |
denotes |
data |
T20627 |
2025-2029 |
VBP |
denotes |
show |
T20628 |
2029-2031 |
, |
denotes |
, |
T20629 |
2031-2033 |
IN |
denotes |
to |
T20630 |
2048-2051 |
IN |
denotes |
for |
T20631 |
2034-2037 |
PRP$ |
denotes |
our |
T20632 |
2038-2047 |
NN |
denotes |
knowledge |
T20633 |
2052-2055 |
DT |
denotes |
the |
T20634 |
2062-2066 |
NN |
denotes |
time |
T20635 |
2056-2061 |
JJ |
denotes |
first |
T20636 |
2066-2068 |
, |
denotes |
, |
T20637 |
2068-2072 |
IN |
denotes |
that |
T20638 |
2089-2096 |
VBP |
denotes |
exhibit |
T20639 |
2073-2078 |
NN |
denotes |
E2f3a |
T20640 |
2079-2082 |
CC |
denotes |
and |
T20641 |
2083-2088 |
NN |
denotes |
E2f3b |
T20642 |
2097-2105 |
JJ |
denotes |
distinct |
T20643 |
2106-2114 |
NNS |
denotes |
patterns |
T20644 |
2115-2117 |
IN |
denotes |
of |
T20645 |
2118-2129 |
JJ |
denotes |
subcellular |
T20646 |
2130-2142 |
NN |
denotes |
distribution |
T20647 |
2142-2144 |
, |
denotes |
, |
T20648 |
2144-2147 |
CC |
denotes |
and |
T20649 |
2148-2153 |
VB |
denotes |
raise |
T20650 |
2154-2157 |
DT |
denotes |
the |
T20651 |
2158-2169 |
NN |
denotes |
possibility |
T20652 |
2170-2174 |
IN |
denotes |
that |
T20653 |
2201-2210 |
VBN |
denotes |
regulated |
T20654 |
2175-2180 |
NN |
denotes |
E2f3a |
T20655 |
2181-2193 |
NN |
denotes |
localization |
T20656 |
2194-2197 |
MD |
denotes |
may |
T20657 |
2198-2200 |
VB |
denotes |
be |
T20658 |
2211-2213 |
IN |
denotes |
by |
T20659 |
2214-2216 |
RB |
denotes |
as |
T20660 |
2217-2220 |
RB |
denotes |
yet |
T20661 |
2221-2228 |
JJ |
denotes |
unknown |
T20662 |
2248-2261 |
NNS |
denotes |
modifications |
T20663 |
2229-2247 |
JJ |
denotes |
post-translational |
T20664 |
2261-2262 |
. |
denotes |
. |
T20695 |
4274-4276 |
NN |
denotes |
P0 |
T20696 |
4276-4278 |
, |
denotes |
, |
T20697 |
4278-4281 |
CC |
denotes |
but |
T20698 |
4282-4284 |
IN |
denotes |
at |
T20699 |
4330-4333 |
VBD |
denotes |
was |
T20700 |
4285-4288 |
NN |
denotes |
P18 |
T20701 |
4288-4290 |
, |
denotes |
, |
T20702 |
4290-4294 |
WRB |
denotes |
when |
T20703 |
4316-4325 |
VBN |
denotes |
increased |
T20704 |
4295-4298 |
DT |
denotes |
the |
T20705 |
4299-4305 |
NNS |
denotes |
levels |
T20706 |
4306-4308 |
IN |
denotes |
of |
T20707 |
4309-4311 |
NN |
denotes |
Rb |
T20708 |
4312-4315 |
VBD |
denotes |
had |
T20709 |
4325-4327 |
, |
denotes |
, |
T20710 |
4327-4329 |
PRP |
denotes |
it |
T20711 |
4334-4343 |
RB |
denotes |
primarily |
T20712 |
4344-4351 |
JJ |
denotes |
nuclear |
T20713 |
4352-4353 |
-LRB- |
denotes |
( |
T20714 |
4353-4359 |
NN |
denotes |
Figure |
T20715 |
4360-4361 |
CD |
denotes |
6 |
T20409 |
964-965 |
. |
denotes |
. |
T20620 |
2003-2009 |
NN |
denotes |
Figure |
T20621 |
2010-2011 |
CD |
denotes |
6 |
T20622 |
2011-2012 |
-RRB- |
denotes |
) |
T20623 |
2012-2013 |
. |
denotes |
. |
T20624 |
2013-2262 |
sentence |
denotes |
These data show, to our knowledge for the first time, that E2f3a and E2f3b exhibit distinct patterns of subcellular distribution, and raise the possibility that E2f3a localization may be regulated by as yet unknown post-translational modifications. |
T20625 |
2014-2019 |
DT |
denotes |
These |
T20665 |
2262-4206 |
sentence |
denotes |
Figure 6 Subcellular Distribution of E2f3 Isoforms and Other Cell Cycle Proteins in the Developing Retina
Nuclear and cytoplasmic extracts from an equivalent number of retinal cells from mice of the indicated genotypes and ages were analyzed by Western blotting to detect the indicated proteins. Lysate from E2f3a−/− mice was used as a control to confirm the location of E2f3a protein. C, cytoplasmic extracts; N, nuclear extracts.
Figure 7 The E2f3a Isoform Drives the Differentiation Defect in Rb KO SACs
(A) Schematic diagrams of the mouse WT, E2f3a−/−, and the Cre-recombined floxed E2f3 loci (indicated here as E2f3−/− for simplicity). E2f3a−/− mice lack most of E2f3 exon 1a and part of intron 1a (red dotted box). Arrows indicate PCR primers. Genotyping of an E2f3a+/− mouse is shown on the right.
(B) RT-PCR detection of E2f3a and E2f3b mRNA in the retina. The sequences of primers are 1aF (5′-GCCTCTACACCACGCCACAAG-3′), 1bF (5′-CGGAAATGCCCTTACAGC-3′), and 4R (5′-CTCAGTCACTTCTTTGGACAG-3′). WT retina expresses both E2f3a and E2f3b mRNA. As expected, E2f3a−/− retina lacks E2f3a mRNA and still expresses E2f3b mRNA. E2f3−/− retina lacks full-length E2f3a and E2f3b mRNAs, and instead expresses a truncated mRNA lacking exon 3.
(C) Real-time RT-PCR analysis of E2f genes in P8 retinas of the indicated genotypes. Error bars represent SD of measurements from three animals, and asterisks indicate a significant difference between WT and the indicated genotypes (*, p <0.05; **; p <0.01; ANOVA and Tukey HSD test).
(D) Rescue of Rb KO SACs by E2f3a deletion. Horizontal retinal sections of the indicated genotypes and ages were stained for nuclei (DAPI, blue), M-phase (PH3, green), and the SAC marker Slc18a3 (red). E2f3a deletion does not suppress ectopic division, but rescues the SAC defect. Scale bars are 50 μm.
M, molecular size marker. We also examined the distribution of other cell cycle regulators during retinal development. |
T20666 |
4114-4116 |
PRP |
denotes |
We |
T20667 |
4122-4130 |
VBD |
denotes |
examined |
T20668 |
4117-4121 |
RB |
denotes |
also |
T20669 |
4131-4134 |
DT |
denotes |
the |
T20670 |
4135-4147 |
NN |
denotes |
distribution |
T20671 |
4148-4150 |
IN |
denotes |
of |
T20672 |
4151-4156 |
JJ |
denotes |
other |
T20673 |
4168-4178 |
NNS |
denotes |
regulators |
T20674 |
4157-4161 |
NN |
denotes |
cell |
T20675 |
4162-4167 |
NN |
denotes |
cycle |
T20676 |
4179-4185 |
IN |
denotes |
during |
T20677 |
4186-4193 |
JJ |
denotes |
retinal |
T20678 |
4194-4205 |
NN |
denotes |
development |
T20679 |
4205-4206 |
. |
denotes |
. |
T20680 |
4206-4363 |
sentence |
denotes |
Like E2f3a, Rb was present in both the WT cytoplasm and nucleus at P0, but at P18, when the levels of Rb had increased, it was primarily nuclear (Figure 6). |
T20681 |
4207-4211 |
IN |
denotes |
Like |
T20682 |
4222-4225 |
VBD |
denotes |
was |
T20683 |
4212-4217 |
NN |
denotes |
E2f3a |
T20684 |
4217-4219 |
, |
denotes |
, |
T20685 |
4219-4221 |
NN |
denotes |
Rb |
T20686 |
4226-4233 |
JJ |
denotes |
present |
T20687 |
4234-4236 |
IN |
denotes |
in |
T20688 |
4237-4241 |
CC |
denotes |
both |
T20689 |
4249-4258 |
NN |
denotes |
cytoplasm |
T20690 |
4242-4245 |
DT |
denotes |
the |
T20691 |
4246-4248 |
NN |
denotes |
WT |
T20692 |
4259-4262 |
CC |
denotes |
and |
T20693 |
4263-4270 |
NN |
denotes |
nucleus |
T20694 |
4271-4273 |
IN |
denotes |
at |
R5721 |
T20216 |
T20217 |
amod |
Distinct,Localization |
R5722 |
T20218 |
T20217 |
prep |
of,Localization |
R5723 |
T20219 |
T20220 |
compound |
E2f3,Isoforms |
R5724 |
T20220 |
T20218 |
pobj |
Isoforms,of |
R5725 |
T20222 |
T20223 |
mark |
As,noted |
R5726 |
T20223 |
T20224 |
advcl |
noted,was |
R5727 |
T20225 |
T20223 |
advmod |
above,noted |
R5728 |
T20226 |
T20224 |
punct |
", ",was |
R5729 |
T20227 |
T20228 |
nmod |
E2f3,staining |
R5730 |
T20228 |
T20224 |
nsubj |
staining,was |
R5731 |
T20229 |
T20227 |
cc |
and,E2f3 |
R5732 |
T20230 |
T20227 |
conj |
Rb,E2f3 |
R5733 |
T20231 |
T20228 |
prep |
in,staining |
R5734 |
T20232 |
T20231 |
pobj |
SACs,in |
R5735 |
T20233 |
T20234 |
preconj |
both,nuclear |
R5736 |
T20234 |
T20224 |
acomp |
nuclear,was |
R5737 |
T20235 |
T20234 |
cc |
and,nuclear |
R5738 |
T20236 |
T20234 |
conj |
cytoplasmic,nuclear |
R5739 |
T20237 |
T20238 |
punct |
(,5A |
R5740 |
T20238 |
T20224 |
parataxis |
5A,was |
R5741 |
T20239 |
T20238 |
compound |
Figure,5A |
R5742 |
T20240 |
T20238 |
cc |
and,5A |
R5743 |
T20241 |
T20238 |
conj |
5B,5A |
R5744 |
T20242 |
T20238 |
punct |
),5A |
R5745 |
T20243 |
T20224 |
punct |
.,was |
R5746 |
T20245 |
T20246 |
det |
The,antibody |
R5747 |
T20246 |
T20247 |
nsubj |
antibody,recognizes |
R5748 |
T20248 |
T20249 |
dep |
that,worked |
R5749 |
T20249 |
T20246 |
relcl |
worked,antibody |
R5750 |
T20250 |
T20249 |
prep |
in,worked |
R5751 |
T20251 |
T20250 |
pobj |
immunostaining,in |
R5752 |
T20252 |
T20253 |
det |
a,region |
R5753 |
T20253 |
T20247 |
dobj |
region,recognizes |
R5754 |
T20254 |
T20255 |
npadvmod |
C,terminal |
R5755 |
T20255 |
T20253 |
amod |
terminal,region |
R5756 |
T20256 |
T20255 |
punct |
-,terminal |
R5757 |
T20257 |
T20247 |
cc |
and,recognizes |
R5758 |
T20258 |
T20259 |
advmod |
thus,distinguish |
R5759 |
T20259 |
T20247 |
conj |
distinguish,recognizes |
R5760 |
T20260 |
T20259 |
punct |
", ",distinguish |
R5761 |
T20261 |
T20259 |
aux |
does,distinguish |
R5762 |
T20262 |
T20259 |
neg |
not,distinguish |
R5763 |
T20263 |
T20264 |
compound |
a,b |
R5764 |
T20264 |
T20266 |
compound |
b,isoforms |
R5765 |
T20265 |
T20264 |
punct |
/,b |
R5766 |
T20266 |
T20259 |
dobj |
isoforms,distinguish |
R5767 |
T20267 |
T20247 |
punct |
.,recognizes |
R5768 |
T20269 |
T20270 |
prep |
To,determined |
R5769 |
T20271 |
T20272 |
poss |
our,knowledge |
R5770 |
T20272 |
T20269 |
pobj |
knowledge,To |
R5771 |
T20273 |
T20270 |
punct |
", ",determined |
R5772 |
T20274 |
T20275 |
det |
the,location |
R5773 |
T20275 |
T20270 |
nsubjpass |
location,determined |
R5774 |
T20276 |
T20275 |
amod |
subcellular,location |
R5775 |
T20277 |
T20275 |
prep |
of,location |
R5776 |
T20278 |
T20279 |
compound |
E2f3,isoforms |
R5777 |
T20279 |
T20277 |
pobj |
isoforms,of |
R5778 |
T20280 |
T20270 |
aux |
has,determined |
R5779 |
T20281 |
T20270 |
neg |
not,determined |
R5780 |
T20282 |
T20270 |
auxpass |
been,determined |
R5781 |
T20283 |
T20270 |
prep |
in,determined |
R5782 |
T20284 |
T20285 |
det |
any,type |
R5783 |
T20285 |
T20283 |
pobj |
type,in |
R5784 |
T20286 |
T20285 |
compound |
cell,type |
R5785 |
T20287 |
T20270 |
punct |
.,determined |
R5786 |
T20289 |
T20290 |
aux |
To,verify |
R5787 |
T20290 |
T20291 |
advcl |
verify,analyzed |
R5788 |
T20292 |
T20293 |
det |
the,locations |
R5789 |
T20293 |
T20290 |
dobj |
locations,verify |
R5790 |
T20294 |
T20293 |
amod |
dual,locations |
R5791 |
T20295 |
T20293 |
prep |
of,locations |
R5792 |
T20296 |
T20295 |
pobj |
E2f3,of |
R5793 |
T20297 |
T20290 |
cc |
and,verify |
R5794 |
T20298 |
T20299 |
aux |
to,determine |
R5795 |
T20299 |
T20290 |
conj |
determine,verify |
R5796 |
T20300 |
T20301 |
det |
which,isoforms |
R5797 |
T20301 |
T20302 |
dep |
isoforms,were |
R5798 |
T20302 |
T20299 |
ccomp |
were,determine |
R5799 |
T20303 |
T20302 |
acomp |
present,were |
R5800 |
T20304 |
T20302 |
prep |
in,were |
R5801 |
T20305 |
T20304 |
pobj |
retina,in |
R5802 |
T20306 |
T20291 |
punct |
", ",analyzed |
R5803 |
T20307 |
T20291 |
nsubj |
we,analyzed |
R5804 |
T20308 |
T20309 |
amod |
nuclear,fractions |
R5805 |
T20309 |
T20291 |
dobj |
fractions,analyzed |
R5806 |
T20310 |
T20308 |
cc |
and,nuclear |
R5807 |
T20311 |
T20308 |
conj |
cytoplasmic,nuclear |
R5808 |
T20312 |
T20291 |
prep |
by,analyzed |
R5809 |
T20313 |
T20314 |
compound |
Western,blot |
R5810 |
T20314 |
T20312 |
pobj |
blot,by |
R5811 |
T20315 |
T20291 |
prep |
at,analyzed |
R5812 |
T20316 |
T20317 |
amod |
different,times |
R5813 |
T20317 |
T20315 |
pobj |
times,at |
R5814 |
T20318 |
T20317 |
prep |
during,times |
R5815 |
T20319 |
T20318 |
pobj |
development,during |
R5816 |
T20320 |
T20291 |
punct |
.,analyzed |
R5817 |
T20322 |
T20323 |
nsubj |
Analysis,detected |
R5818 |
T20324 |
T20322 |
prep |
with,Analysis |
R5819 |
T20325 |
T20326 |
det |
the,antibody |
R5820 |
T20326 |
T20324 |
pobj |
antibody,with |
R5821 |
T20327 |
T20326 |
amod |
pan-E2f3,antibody |
R5822 |
T20328 |
T20326 |
punct |
(,antibody |
R5823 |
T20329 |
T20326 |
appos |
sc,antibody |
R5824 |
T20330 |
T20329 |
punct |
-,sc |
R5825 |
T20331 |
T20329 |
nummod |
878,sc |
R5826 |
T20332 |
T20333 |
punct |
", ",Biotechnology |
R5827 |
T20333 |
T20326 |
parataxis |
Biotechnology,antibody |
R5828 |
T20334 |
T20335 |
compound |
Santa,Cruz |
R5829 |
T20335 |
T20333 |
compound |
Cruz,Biotechnology |
R5830 |
T20336 |
T20333 |
punct |
),Biotechnology |
R5831 |
T20337 |
T20338 |
det |
a,species |
R5832 |
T20338 |
T20323 |
dobj |
species,detected |
R5833 |
T20339 |
T20340 |
nummod |
55,kD |
R5834 |
T20340 |
T20338 |
compound |
kD,species |
R5835 |
T20341 |
T20340 |
punct |
-,kD |
R5836 |
T20342 |
T20338 |
compound |
E2f3a,species |
R5837 |
T20343 |
T20338 |
cc |
and,species |
R5838 |
T20344 |
T20345 |
det |
a,polypeptide |
R5839 |
T20345 |
T20338 |
conj |
polypeptide,species |
R5840 |
T20346 |
T20347 |
nummod |
40,kD |
R5841 |
T20347 |
T20345 |
compound |
kD,polypeptide |
R5842 |
T20348 |
T20347 |
punct |
-,kD |
R5843 |
T20349 |
T20345 |
compound |
E2f3b,polypeptide |
R5844 |
T20350 |
T20351 |
punct |
(,Figure |
R5845 |
T20351 |
T20323 |
parataxis |
Figure,detected |
R5846 |
T20352 |
T20351 |
nummod |
6,Figure |
R5847 |
T20353 |
T20351 |
punct |
),Figure |
R5848 |
T20354 |
T20323 |
punct |
.,detected |
R5849 |
T20356 |
T20357 |
aux |
To,confirm |
R5850 |
T20357 |
T20358 |
advcl |
confirm,exploited |
R5851 |
T20359 |
T20360 |
mark |
that,was |
R5852 |
T20360 |
T20357 |
ccomp |
was,confirm |
R5853 |
T20361 |
T20362 |
det |
the,species |
R5854 |
T20362 |
T20360 |
nsubj |
species,was |
R5855 |
T20363 |
T20362 |
amod |
upper,species |
R5856 |
T20364 |
T20362 |
prep |
in,species |
R5857 |
T20365 |
T20366 |
poss |
our,lysates |
R5858 |
T20366 |
T20364 |
pobj |
lysates,in |
R5859 |
T20367 |
T20366 |
amod |
retinal,lysates |
R5860 |
T20368 |
T20360 |
attr |
E2f3a,was |
R5861 |
T20369 |
T20358 |
punct |
", ",exploited |
R5862 |
T20370 |
T20358 |
nsubj |
we,exploited |
R5863 |
T20371 |
T20372 |
amod |
novel,mice |
R5864 |
T20372 |
T20358 |
dobj |
mice,exploited |
R5865 |
T20373 |
T20374 |
dep |
that,lack |
R5866 |
T20374 |
T20372 |
relcl |
lack,mice |
R5867 |
T20375 |
T20376 |
compound |
E2f3,1a |
R5868 |
T20376 |
T20374 |
dobj |
1a,lack |
R5869 |
T20377 |
T20376 |
compound |
exon,1a |
R5870 |
T20378 |
T20374 |
cc |
and,lack |
R5871 |
T20379 |
T20380 |
advmod |
thus,express |
R5872 |
T20380 |
T20374 |
conj |
express,lack |
R5873 |
T20381 |
T20380 |
dobj |
E2f3b,express |
R5874 |
T20382 |
T20380 |
advmod |
exclusively,express |
R5875 |
T20383 |
T20384 |
punct |
(,R. |
R5876 |
T20384 |
T20380 |
meta |
R.,express |
R5877 |
T20385 |
T20384 |
nmod |
O.,R. |
R5878 |
T20386 |
T20384 |
cc |
and,R. |
R5879 |
T20387 |
T20384 |
conj |
G.,R. |
R5880 |
T20388 |
T20387 |
nmod |
L.,G. |
R5881 |
T20389 |
T20387 |
punct |
", ",G. |
R5882 |
T20390 |
T20391 |
amod |
unpublished,data |
R5883 |
T20391 |
T20387 |
conj |
data,G. |
R5884 |
T20392 |
T20391 |
punct |
),data |
R5885 |
T20393 |
T20358 |
punct |
.,exploited |
R5886 |
T20395 |
T20396 |
det |
The,strategy |
R5887 |
T20396 |
T20398 |
nsubjpass |
strategy,discussed |
R5888 |
T20397 |
T20396 |
compound |
genotyping,strategy |
R5889 |
T20399 |
T20398 |
auxpass |
is,discussed |
R5890 |
T20400 |
T20398 |
prep |
in,discussed |
R5891 |
T20401 |
T20400 |
pobj |
detail,in |
R5892 |
T20402 |
T20398 |
advmod |
later,discussed |
R5893 |
T20403 |
T20398 |
cc |
and,discussed |
R5894 |
T20404 |
T20405 |
auxpass |
is,outlined |
R5895 |
T20405 |
T20398 |
conj |
outlined,discussed |
R5896 |
T20406 |
T20405 |
prep |
in,outlined |
R5897 |
T20407 |
T20408 |
compound |
Figure,7A |
R5898 |
T20408 |
T20406 |
pobj |
7A,in |
R5899 |
T20409 |
T20398 |
punct |
.,discussed |
R5900 |
T20411 |
T20412 |
compound |
Western,analysis |
R5901 |
T20412 |
T20413 |
nsubj |
analysis,confirmed |
R5902 |
T20414 |
T20415 |
mark |
that,was |
R5903 |
T20415 |
T20413 |
ccomp |
was,confirmed |
R5904 |
T20416 |
T20417 |
det |
the,band |
R5905 |
T20417 |
T20415 |
nsubj |
band,was |
R5906 |
T20418 |
T20417 |
amod |
upper,band |
R5907 |
T20419 |
T20415 |
acomp |
absent,was |
R5908 |
T20420 |
T20415 |
prep |
in,was |
R5909 |
T20421 |
T20422 |
nmod |
E2f3a,mice |
R5910 |
T20422 |
T20420 |
pobj |
mice,in |
R5911 |
T20423 |
T20421 |
punct |
−,E2f3a |
R5912 |
T20424 |
T20421 |
punct |
/,E2f3a |
R5913 |
T20425 |
T20421 |
punct |
−,E2f3a |
R5914 |
T20426 |
T20427 |
punct |
(,S8 |
R5915 |
T20427 |
T20413 |
parataxis |
S8,confirmed |
R5916 |
T20428 |
T20427 |
nmod |
Figures,S8 |
R5917 |
T20429 |
T20427 |
nummod |
6,S8 |
R5918 |
T20430 |
T20427 |
cc |
and,S8 |
R5919 |
T20431 |
T20427 |
punct |
),S8 |
R5920 |
T20432 |
T20413 |
punct |
.,confirmed |
R5921 |
T20434 |
T20435 |
advcl |
Consistent,was |
R5922 |
T20436 |
T20434 |
prep |
with,Consistent |
R5923 |
T20437 |
T20438 |
det |
the,drop |
R5924 |
T20438 |
T20436 |
pobj |
drop,with |
R5925 |
T20439 |
T20438 |
prep |
in,drop |
R5926 |
T20440 |
T20441 |
npadvmod |
E2f3,expressing |
R5927 |
T20441 |
T20443 |
amod |
expressing,cells |
R5928 |
T20442 |
T20441 |
punct |
-,expressing |
R5929 |
T20443 |
T20439 |
pobj |
cells,in |
R5930 |
T20444 |
T20438 |
prep |
during,drop |
R5931 |
T20445 |
T20446 |
nmod |
WT,maturation |
R5932 |
T20446 |
T20444 |
pobj |
maturation,during |
R5933 |
T20447 |
T20446 |
amod |
retinal,maturation |
R5934 |
T20448 |
T20449 |
punct |
(,5A |
R5935 |
T20449 |
T20438 |
parataxis |
5A,drop |
R5936 |
T20450 |
T20449 |
compound |
Figure,5A |
R5937 |
T20451 |
T20449 |
punct |
),5A |
R5938 |
T20452 |
T20435 |
punct |
", ",was |
R5939 |
T20453 |
T20454 |
det |
the,amount |
R5940 |
T20454 |
T20435 |
nsubj |
amount,was |
R5941 |
T20455 |
T20454 |
amod |
total,amount |
R5942 |
T20456 |
T20454 |
prep |
of,amount |
R5943 |
T20457 |
T20456 |
pobj |
E2f3a,of |
R5944 |
T20458 |
T20435 |
acomp |
less,was |
R5945 |
T20459 |
T20435 |
prep |
at,was |
R5946 |
T20460 |
T20459 |
pobj |
P18,at |
R5947 |
T20461 |
T20435 |
prep |
compared,was |
R5948 |
T20462 |
T20461 |
prep |
to,compared |
R5949 |
T20463 |
T20462 |
pobj |
P0,to |
R5950 |
T20464 |
T20465 |
punct |
(,Figure |
R5951 |
T20465 |
T20435 |
parataxis |
Figure,was |
R5952 |
T20466 |
T20465 |
nummod |
6,Figure |
R5953 |
T20467 |
T20465 |
punct |
),Figure |
R5954 |
T20468 |
T20435 |
punct |
.,was |
R5955 |
T20470 |
T20471 |
nsubj |
E2f3b,was |
R5956 |
T20472 |
T20471 |
acomp |
present,was |
R5957 |
T20473 |
T20471 |
prep |
in,was |
R5958 |
T20474 |
T20475 |
amod |
similar,amounts |
R5959 |
T20475 |
T20473 |
pobj |
amounts,in |
R5960 |
T20476 |
T20471 |
prep |
at,was |
R5961 |
T20477 |
T20478 |
det |
both,points |
R5962 |
T20478 |
T20476 |
pobj |
points,at |
R5963 |
T20479 |
T20478 |
compound |
time,points |
R5964 |
T20480 |
T20471 |
punct |
.,was |
R5965 |
T20482 |
T20483 |
prep |
At,was |
R5966 |
T20484 |
T20482 |
pobj |
P0,At |
R5967 |
T20485 |
T20484 |
cc |
and,P0 |
R5968 |
T20486 |
T20484 |
conj |
P18,P0 |
R5969 |
T20487 |
T20483 |
punct |
", ",was |
R5970 |
T20488 |
T20483 |
nsubj |
E2f3a,was |
R5971 |
T20489 |
T20483 |
acomp |
present,was |
R5972 |
T20490 |
T20483 |
prep |
in,was |
R5973 |
T20491 |
T20492 |
preconj |
both,nuclear |
R5974 |
T20492 |
T20493 |
amod |
nuclear,fractions |
R5975 |
T20493 |
T20490 |
pobj |
fractions,in |
R5976 |
T20494 |
T20492 |
cc |
and,nuclear |
R5977 |
T20495 |
T20492 |
conj |
cytoplasmic,nuclear |
R5978 |
T20496 |
T20483 |
punct |
", ",was |
R5979 |
T20497 |
T20483 |
cc |
but,was |
R5980 |
T20498 |
T20499 |
prep |
in,was |
R5981 |
T20499 |
T20483 |
conj |
was,was |
R5982 |
T20500 |
T20501 |
amod |
marked,contrast |
R5983 |
T20501 |
T20498 |
pobj |
contrast,in |
R5984 |
T20502 |
T20499 |
punct |
", ",was |
R5985 |
T20503 |
T20499 |
nsubj |
E2f3b,was |
R5986 |
T20504 |
T20505 |
advmod |
exclusively,nuclear |
R5987 |
T20505 |
T20499 |
acomp |
nuclear,was |
R5988 |
T20506 |
T20499 |
prep |
at,was |
R5989 |
T20507 |
T20508 |
det |
both,times |
R5990 |
T20508 |
T20506 |
pobj |
times,at |
R5991 |
T20509 |
T20510 |
punct |
(,Figure |
R5992 |
T20510 |
T20499 |
parataxis |
Figure,was |
R5993 |
T20511 |
T20510 |
nummod |
6,Figure |
R5994 |
T20512 |
T20510 |
punct |
),Figure |
R5995 |
T20513 |
T20499 |
punct |
.,was |
R5996 |
T20515 |
T20516 |
nummod |
Two,bands |
R5997 |
T20516 |
T20520 |
nsubjpass |
bands,detected |
R5998 |
T20517 |
T20518 |
advmod |
closely,migrating |
R5999 |
T20518 |
T20516 |
amod |
migrating,bands |
R6000 |
T20519 |
T20516 |
compound |
E2f3a,bands |
R6001 |
T20521 |
T20520 |
auxpass |
were,detected |
R6002 |
T20522 |
T20520 |
punct |
", ",detected |
R6003 |
T20523 |
T20524 |
advmod |
more,clearly |
R6004 |
T20524 |
T20525 |
advmod |
clearly,evident |
R6005 |
T20525 |
T20520 |
advcl |
evident,detected |
R6006 |
T20526 |
T20525 |
prep |
at,evident |
R6007 |
T20527 |
T20526 |
pobj |
P18,at |
R6008 |
T20528 |
T20520 |
punct |
", ",detected |
R6009 |
T20529 |
T20530 |
prep |
of,was |
R6010 |
T20530 |
T20520 |
ccomp |
was,detected |
R6011 |
T20531 |
T20529 |
pobj |
which,of |
R6012 |
T20532 |
T20533 |
det |
the,species |
R6013 |
T20533 |
T20530 |
nsubj |
species,was |
R6014 |
T20534 |
T20533 |
advmod |
faster,species |
R6015 |
T20535 |
T20533 |
amod |
migrating,species |
R6016 |
T20536 |
T20530 |
acomp |
dominant,was |
R6017 |
T20537 |
T20530 |
prep |
in,was |
R6018 |
T20538 |
T20537 |
amod |
nuclear,in |
R6019 |
T20539 |
T20530 |
cc |
and,was |
R6020 |
T20540 |
T20541 |
det |
the,species |
R6021 |
T20541 |
T20543 |
nsubj |
species,was |
R6022 |
T20542 |
T20541 |
amod |
slower,species |
R6023 |
T20543 |
T20530 |
conj |
was,was |
R6024 |
T20544 |
T20543 |
acomp |
dominant,was |
R6025 |
T20545 |
T20543 |
prep |
in,was |
R6026 |
T20546 |
T20545 |
pobj |
cytoplasm,in |
R6027 |
T20547 |
T20548 |
punct |
(,Figure |
R6028 |
T20548 |
T20543 |
parataxis |
Figure,was |
R6029 |
T20549 |
T20548 |
nummod |
6,Figure |
R6030 |
T20550 |
T20548 |
punct |
),Figure |
R6031 |
T20551 |
T20520 |
punct |
.,detected |
R6032 |
T20553 |
T20554 |
det |
The,identity |
R6033 |
T20554 |
T20555 |
nsubjpass |
identity,confirmed |
R6034 |
T20556 |
T20554 |
prep |
of,identity |
R6035 |
T20557 |
T20556 |
pobj |
both,of |
R6036 |
T20558 |
T20554 |
prep |
as,identity |
R6037 |
T20559 |
T20560 |
compound |
E2f3a,species |
R6038 |
T20560 |
T20558 |
pobj |
species,as |
R6039 |
T20561 |
T20555 |
auxpass |
was,confirmed |
R6040 |
T20562 |
T20555 |
agent |
by,confirmed |
R6041 |
T20563 |
T20564 |
poss |
their,absence |
R6042 |
T20564 |
T20562 |
pobj |
absence,by |
R6043 |
T20565 |
T20564 |
prep |
in,absence |
R6044 |
T20566 |
T20567 |
det |
the,retina |
R6045 |
T20567 |
T20565 |
pobj |
retina,in |
R6046 |
T20568 |
T20567 |
compound |
P18,retina |
R6047 |
T20569 |
T20570 |
compound |
E2f3a,KO |
R6048 |
T20570 |
T20567 |
compound |
KO,retina |
R6049 |
T20571 |
T20572 |
punct |
(,S8 |
R6050 |
T20572 |
T20555 |
parataxis |
S8,confirmed |
R6051 |
T20573 |
T20572 |
compound |
Figure,S8 |
R6052 |
T20574 |
T20572 |
punct |
),S8 |
R6053 |
T20575 |
T20555 |
punct |
.,confirmed |
R6054 |
T20577 |
T20578 |
nsubj |
Analysis,showed |
R6055 |
T20579 |
T20577 |
prep |
of,Analysis |
R6056 |
T20580 |
T20579 |
pobj |
Pou4f2,of |
R6057 |
T20581 |
T20580 |
punct |
", ",Pou4f2 |
R6058 |
T20582 |
T20583 |
det |
a,factor |
R6059 |
T20583 |
T20580 |
appos |
factor,Pou4f2 |
R6060 |
T20584 |
T20583 |
amod |
nuclear,factor |
R6061 |
T20585 |
T20583 |
compound |
transcription,factor |
R6062 |
T20586 |
T20583 |
acl |
expressed,factor |
R6063 |
T20587 |
T20586 |
prep |
in,expressed |
R6064 |
T20588 |
T20589 |
compound |
ganglion,cells |
R6065 |
T20589 |
T20587 |
pobj |
cells,in |
R6066 |
T20590 |
T20578 |
punct |
", ",showed |
R6067 |
T20591 |
T20592 |
mark |
that,contaminated |
R6068 |
T20592 |
T20578 |
ccomp |
contaminated,showed |
R6069 |
T20593 |
T20594 |
amod |
nuclear,proteins |
R6070 |
T20594 |
T20592 |
nsubj |
proteins,contaminated |
R6071 |
T20595 |
T20592 |
aux |
had,contaminated |
R6072 |
T20596 |
T20592 |
neg |
not,contaminated |
R6073 |
T20597 |
T20598 |
det |
the,fraction |
R6074 |
T20598 |
T20592 |
dobj |
fraction,contaminated |
R6075 |
T20599 |
T20598 |
amod |
cytoplasmic,fraction |
R6076 |
T20600 |
T20578 |
punct |
", ",showed |
R6077 |
T20601 |
T20578 |
cc |
and,showed |
R6078 |
T20602 |
T20603 |
nsubj |
analysis,confirmed |
R6079 |
T20603 |
T20578 |
conj |
confirmed,showed |
R6080 |
T20604 |
T20602 |
prep |
of,analysis |
R6081 |
T20605 |
T20604 |
pobj |
Slc18a3,of |
R6082 |
T20606 |
T20605 |
punct |
", ",Slc18a3 |
R6083 |
T20607 |
T20608 |
det |
a,marker |
R6084 |
T20608 |
T20605 |
appos |
marker,Slc18a3 |
R6085 |
T20609 |
T20608 |
amod |
cytoplasmic,marker |
R6086 |
T20610 |
T20608 |
compound |
SAC,marker |
R6087 |
T20611 |
T20603 |
punct |
", ",confirmed |
R6088 |
T20612 |
T20613 |
mark |
that,occurred |
R6089 |
T20613 |
T20603 |
ccomp |
occurred,confirmed |
R6090 |
T20614 |
T20615 |
det |
the,reverse |
R6091 |
T20615 |
T20613 |
nsubj |
reverse,occurred |
R6092 |
T20616 |
T20613 |
aux |
had,occurred |
R6093 |
T20617 |
T20613 |
advmod |
also,occurred |
R6094 |
T20618 |
T20613 |
neg |
not,occurred |
R6095 |
T20619 |
T20620 |
punct |
(,Figure |
R6096 |
T20620 |
T20613 |
parataxis |
Figure,occurred |
R6097 |
T20621 |
T20620 |
nummod |
6,Figure |
R6098 |
T20622 |
T20620 |
punct |
),Figure |
R6099 |
T20623 |
T20603 |
punct |
.,confirmed |
R6100 |
T20625 |
T20626 |
det |
These,data |
R6101 |
T20626 |
T20627 |
nsubj |
data,show |
R6102 |
T20628 |
T20627 |
punct |
", ",show |
R6103 |
T20629 |
T20630 |
prep |
to,for |
R6104 |
T20630 |
T20627 |
prep |
for,show |
R6105 |
T20631 |
T20632 |
poss |
our,knowledge |
R6106 |
T20632 |
T20629 |
pobj |
knowledge,to |
R6107 |
T20633 |
T20634 |
det |
the,time |
R6108 |
T20634 |
T20630 |
pobj |
time,for |
R6109 |
T20635 |
T20634 |
amod |
first,time |
R6110 |
T20636 |
T20627 |
punct |
", ",show |
R6111 |
T20637 |
T20638 |
mark |
that,exhibit |
R6112 |
T20638 |
T20627 |
ccomp |
exhibit,show |
R6113 |
T20639 |
T20638 |
nsubj |
E2f3a,exhibit |
R6114 |
T20640 |
T20639 |
cc |
and,E2f3a |
R6115 |
T20641 |
T20639 |
conj |
E2f3b,E2f3a |
R6116 |
T20642 |
T20643 |
amod |
distinct,patterns |
R6117 |
T20643 |
T20638 |
dobj |
patterns,exhibit |
R6118 |
T20644 |
T20643 |
prep |
of,patterns |
R6119 |
T20645 |
T20646 |
amod |
subcellular,distribution |
R6120 |
T20646 |
T20644 |
pobj |
distribution,of |
R6121 |
T20647 |
T20638 |
punct |
", ",exhibit |
R6122 |
T20648 |
T20638 |
cc |
and,exhibit |
R6123 |
T20649 |
T20638 |
conj |
raise,exhibit |
R6124 |
T20650 |
T20651 |
det |
the,possibility |
R6125 |
T20651 |
T20649 |
dobj |
possibility,raise |
R6126 |
T20652 |
T20653 |
mark |
that,regulated |
R6127 |
T20653 |
T20651 |
acl |
regulated,possibility |
R6128 |
T20654 |
T20655 |
compound |
E2f3a,localization |
R6129 |
T20655 |
T20653 |
nsubjpass |
localization,regulated |
R6130 |
T20656 |
T20653 |
aux |
may,regulated |
R6131 |
T20657 |
T20653 |
auxpass |
be,regulated |
R6132 |
T20658 |
T20653 |
agent |
by,regulated |
R6133 |
T20659 |
T20660 |
advmod |
as,yet |
R6134 |
T20660 |
T20661 |
advmod |
yet,unknown |
R6135 |
T20661 |
T20662 |
amod |
unknown,modifications |
R6156 |
T20686 |
T20682 |
acomp |
present,was |
R6157 |
T20687 |
T20682 |
prep |
in,was |
R6158 |
T20688 |
T20689 |
preconj |
both,cytoplasm |
R6159 |
T20689 |
T20687 |
pobj |
cytoplasm,in |
R6160 |
T20690 |
T20689 |
det |
the,cytoplasm |
R6161 |
T20691 |
T20689 |
compound |
WT,cytoplasm |
R6162 |
T20692 |
T20689 |
cc |
and,cytoplasm |
R6163 |
T20693 |
T20689 |
conj |
nucleus,cytoplasm |
R6164 |
T20694 |
T20682 |
prep |
at,was |
R6165 |
T20695 |
T20694 |
pobj |
P0,at |
R6166 |
T20696 |
T20682 |
punct |
", ",was |
R6167 |
T20697 |
T20682 |
cc |
but,was |
R6168 |
T20698 |
T20699 |
prep |
at,was |
R6169 |
T20699 |
T20682 |
conj |
was,was |
R6170 |
T20700 |
T20698 |
pobj |
P18,at |
R6171 |
T20701 |
T20699 |
punct |
", ",was |
R6172 |
T20702 |
T20703 |
advmod |
when,increased |
R6173 |
T20703 |
T20699 |
advcl |
increased,was |
R6174 |
T20704 |
T20705 |
det |
the,levels |
R6175 |
T20705 |
T20703 |
nsubj |
levels,increased |
R6176 |
T20706 |
T20705 |
prep |
of,levels |
R6177 |
T20707 |
T20706 |
pobj |
Rb,of |
R6178 |
T20708 |
T20703 |
aux |
had,increased |
R6179 |
T20709 |
T20699 |
punct |
", ",was |
R6180 |
T20710 |
T20699 |
nsubj |
it,was |
R6181 |
T20711 |
T20699 |
advmod |
primarily,was |
R6182 |
T20712 |
T20699 |
acomp |
nuclear,was |
R6183 |
T20713 |
T20714 |
punct |
(,Figure |
R6184 |
T20714 |
T20699 |
parataxis |
Figure,was |
R6185 |
T20715 |
T20714 |
nummod |
6,Figure |
R6186 |
T20716 |
T20714 |
punct |
),Figure |
R6187 |
T20717 |
T20699 |
punct |
.,was |
R6188 |
T20719 |
T20720 |
det |
A,signal |
R6189 |
T20720 |
T20725 |
nsubj |
signal,was |
R6190 |
T20721 |
T20722 |
advmod |
very,faint |
R6191 |
T20722 |
T20720 |
amod |
faint,signal |
R6192 |
T20723 |
T20720 |
amod |
cytoplasmic,signal |
R6193 |
T20724 |
T20720 |
compound |
Rb,signal |
R6194 |
T20726 |
T20725 |
acomp |
evident,was |
R6195 |
T20727 |
T20725 |
prep |
at,was |
R6196 |
T20728 |
T20727 |
pobj |
P18,at |
R6197 |
T20729 |
T20725 |
punct |
", ",was |
R6198 |
T20730 |
T20731 |
dep |
which,is |
R6199 |
T20731 |
T20725 |
advcl |
is,was |
R6200 |
T20732 |
T20731 |
acomp |
consistent,is |
R6201 |
T20733 |
T20732 |
prep |
with,consistent |
R6202 |
T20734 |
T20735 |
compound |
Rb,staining |
R6203 |
T20735 |
T20733 |
pobj |
staining,with |
R6204 |
T20736 |
T20735 |
prep |
of,staining |
R6205 |
T20737 |
T20738 |
compound |
SAC,processes |
R6206 |
T20738 |
T20736 |
pobj |
processes,of |
R6207 |
T20739 |
T20740 |
punct |
(,5B |
R6208 |
T20740 |
T20735 |
parataxis |
5B,staining |
R6209 |
T20741 |
T20740 |
compound |
Figure,5B |
R6210 |
T20742 |
T20740 |
punct |
),5B |
R6211 |
T20743 |
T20733 |
punct |
", ",with |
R6212 |
T20744 |
T20733 |
cc |
and,with |
R6213 |
T20745 |
T20733 |
conj |
with,with |
R6214 |
T20746 |
T20747 |
det |
the,proportion |
R6215 |
T20747 |
T20745 |
pobj |
proportion,with |
R6216 |
T20748 |
T20749 |
advmod |
very,small |
R6217 |
T20749 |
T20747 |
amod |
small,proportion |
R6218 |
T20750 |
T20747 |
prep |
of,proportion |
R6219 |
T20751 |
T20750 |
pobj |
SACs,of |
R6220 |
T20752 |
T20747 |
prep |
in,proportion |
R6221 |
T20753 |
T20754 |
det |
the,retina |
R6222 |
T20754 |
T20752 |
pobj |
retina,in |
R6223 |
T20755 |
T20756 |
punct |
[,38 |
R6224 |
T20756 |
T20731 |
parataxis |
38,is |
R6225 |
T20757 |
T20756 |
punct |
],38 |
R6226 |
T20758 |
T20725 |
punct |
.,was |
R6227 |
T20760 |
T20761 |
nsubjpass |
E2f1,detected |
R6228 |
T20762 |
T20761 |
auxpass |
was,detected |
R6229 |
T20763 |
T20761 |
advmod |
also,detected |
R6230 |
T20764 |
T20761 |
prep |
in,detected |
R6231 |
T20765 |
T20766 |
preconj |
both,nuclear |
R6232 |
T20766 |
T20767 |
amod |
nuclear,fractions |
R6233 |
T20767 |
T20764 |
pobj |
fractions,in |
R6234 |
T20768 |
T20766 |
cc |
and,nuclear |
R6235 |
T20769 |
T20766 |
conj |
cytoplasmic,nuclear |
R6236 |
T20770 |
T20761 |
punct |
", ",detected |
R6237 |
T20771 |
T20772 |
mark |
although,was |
R6238 |
T20772 |
T20761 |
advcl |
was,detected |
R6239 |
T20773 |
T20772 |
prep |
unlike,was |
R6240 |
T20774 |
T20773 |
pobj |
E2f3a,unlike |
R6241 |
T20775 |
T20772 |
nsubj |
it,was |
R6242 |
T20776 |
T20777 |
advmod |
predominantly,nuclear |
R6243 |
T20777 |
T20772 |
acomp |
nuclear,was |
R6244 |
T20778 |
T20779 |
preconj |
both,at |
R6245 |
T20779 |
T20772 |
prep |
at,was |
R6246 |
T20780 |
T20779 |
pobj |
P0,at |
R6247 |
T20781 |
T20780 |
cc |
and,P0 |
R6248 |
T20782 |
T20780 |
conj |
P18,P0 |
R6249 |
T20783 |
T20784 |
punct |
(,Figure |
R6250 |
T20784 |
T20772 |
parataxis |
Figure,was |
R6251 |
T20785 |
T20784 |
nummod |
6,Figure |
R6252 |
T20786 |
T20784 |
punct |
),Figure |
R6253 |
T20787 |
T20761 |
punct |
.,detected |
R6254 |
T20789 |
T20790 |
det |
The,partner |
R6255 |
T20790 |
T20793 |
nsubj |
partner,was |
R6256 |
T20791 |
T20790 |
compound |
E2f,partner |
R6257 |
T20792 |
T20790 |
compound |
dimerization,partner |
R6258 |
T20794 |
T20790 |
punct |
", ",partner |
R6259 |
T20795 |
T20790 |
appos |
Tfdp1,partner |
R6260 |
T20796 |
T20790 |
punct |
", ",partner |
R6261 |
T20797 |
T20798 |
dep |
which,lacks |
R6262 |
T20798 |
T20790 |
relcl |
lacks,partner |
R6263 |
T20799 |
T20800 |
det |
a,signal |
R6264 |
T20800 |
T20798 |
dobj |
signal,lacks |
R6265 |
T20801 |
T20802 |
amod |
nuclear,localization |
R6266 |
T20802 |
T20800 |
compound |
localization,signal |
R6267 |
T20803 |
T20804 |
punct |
[,54 |
R6268 |
T20804 |
T20798 |
parataxis |
54,lacks |
R6269 |
T20805 |
T20804 |
punct |
],54 |
R6270 |
T20806 |
T20793 |
punct |
", ",was |
R6271 |
T20807 |
T20808 |
advmod |
primarily,cytoplasmic |
R6272 |
T20808 |
T20793 |
acomp |
cytoplasmic,was |
R6273 |
T20809 |
T20793 |
prep |
at,was |
R6274 |
T20810 |
T20811 |
preconj |
both,P0 |
R6275 |
T20811 |
T20809 |
pobj |
P0,at |
R6276 |
T20812 |
T20811 |
cc |
and,P0 |
R6277 |
T20813 |
T20811 |
conj |
P18,P0 |
R6278 |
T20814 |
T20793 |
punct |
", ",was |
R6279 |
T20815 |
T20793 |
cc |
and,was |
R6280 |
T20816 |
T20817 |
det |
the,inhibitors |
R6281 |
T20817 |
T20819 |
nsubj |
inhibitors,showed |
R6282 |
T20818 |
T20817 |
compound |
Cdk,inhibitors |
R6283 |
T20819 |
T20793 |
conj |
showed,was |
R6284 |
T20820 |
T20817 |
appos |
Cdkn1a,inhibitors |
R6285 |
T20821 |
T20820 |
cc |
and,Cdkn1a |
R6286 |
T20822 |
T20820 |
conj |
Cdkn1b,Cdkn1a |
R6287 |
T20823 |
T20824 |
det |
a,pattern |
R6288 |
T20824 |
T20819 |
dobj |
pattern,showed |
R6289 |
T20825 |
T20824 |
amod |
similar,pattern |
R6290 |
T20826 |
T20824 |
prep |
of,pattern |
R6291 |
T20827 |
T20826 |
pobj |
distribution,of |
R6292 |
T20828 |
T20829 |
punct |
(,Figure |
R6293 |
T20829 |
T20819 |
parataxis |
Figure,showed |
R6294 |
T20830 |
T20829 |
nummod |
6,Figure |
R6295 |
T20831 |
T20829 |
punct |
),Figure |
R6296 |
T20832 |
T20819 |
punct |
.,showed |
R6297 |
T20834 |
T20835 |
advmod |
Thus,showed |
R6298 |
T20836 |
T20835 |
punct |
", ",showed |
R6299 |
T20837 |
T20835 |
prep |
among,showed |
R6300 |
T20838 |
T20839 |
det |
the,regulators |
R6301 |
T20839 |
T20837 |
pobj |
regulators,among |
R6302 |
T20840 |
T20841 |
compound |
cell,cycle |
R6303 |
T20841 |
T20839 |
compound |
cycle,regulators |
R6304 |
T20842 |
T20843 |
nsubj |
we,examined |
R6305 |
T20843 |
T20839 |
advcl |
examined,regulators |
R6306 |
T20844 |
T20835 |
punct |
", ",showed |
R6307 |
T20845 |
T20835 |
nsubj |
most,showed |
R6308 |
T20846 |
T20847 |
amod |
bivalent,distribution |
R6309 |
T20847 |
T20835 |
dobj |
distribution,showed |
R6310 |
T20848 |
T20835 |
punct |
", ",showed |
R6311 |
T20849 |
T20835 |
cc |
and,showed |
R6312 |
T20850 |
T20851 |
nsubj |
E2f3b,was |
R6313 |
T20851 |
T20835 |
conj |
was,showed |
R6314 |
T20852 |
T20851 |
acomp |
unusual,was |
R6315 |
T20853 |
T20851 |
prep |
in,was |
R6316 |
T20854 |
T20855 |
poss |
its,compartmentalization |
R6317 |
T20855 |
T20853 |
pobj |
compartmentalization,in |
R6318 |
T20856 |
T20857 |
advmod |
solely,nuclear |
R6319 |
T20857 |
T20855 |
amod |
nuclear,compartmentalization |
R6320 |
T20858 |
T20851 |
punct |
.,was |
R11271 |
T37145 |
T37146 |
amod |
Subcellular,Distribution |
R11272 |
T37147 |
T37146 |
prep |
of,Distribution |
R11273 |
T37148 |
T37149 |
compound |
E2f3,Isoforms |
R11274 |
T37149 |
T37147 |
pobj |
Isoforms,of |
R11275 |
T37150 |
T37149 |
cc |
and,Isoforms |
R11276 |
T37151 |
T37152 |
amod |
Other,Proteins |
R11277 |
T37152 |
T37149 |
conj |
Proteins,Isoforms |
R11278 |
T37153 |
T37154 |
compound |
Cell,Cycle |
R11279 |
T37154 |
T37152 |
compound |
Cycle,Proteins |
R11280 |
T37155 |
T37146 |
prep |
in,Distribution |
R11281 |
T37156 |
T37157 |
det |
the,Retina |
R11282 |
T37157 |
T37155 |
pobj |
Retina,in |
R11283 |
T37158 |
T37157 |
amod |
Developing,Retina |
R11284 |
T37160 |
T37161 |
amod |
Nuclear,extracts |
R11285 |
T37161 |
T37164 |
nsubjpass |
extracts,analyzed |
R11286 |
T37162 |
T37160 |
cc |
and,Nuclear |
R11287 |
T37163 |
T37160 |
conj |
cytoplasmic,Nuclear |
R11288 |
T37165 |
T37161 |
prep |
from,extracts |
R11289 |
T37166 |
T37167 |
det |
an,number |
R11290 |
T37167 |
T37165 |
pobj |
number,from |
R11291 |
T37168 |
T37167 |
amod |
equivalent,number |
R11292 |
T37169 |
T37167 |
prep |
of,number |
R11293 |
T37170 |
T37171 |
amod |
retinal,cells |
R11294 |
T37171 |
T37169 |
pobj |
cells,of |
R11295 |
T37172 |
T37171 |
prep |
from,cells |
R11296 |
T37173 |
T37172 |
pobj |
mice,from |
R11297 |
T37174 |
T37173 |
prep |
of,mice |
R11298 |
T37175 |
T37176 |
det |
the,genotypes |
R11299 |
T37176 |
T37174 |
pobj |
genotypes,of |
R11300 |
T37177 |
T37176 |
amod |
indicated,genotypes |
R11301 |
T37178 |
T37176 |
cc |
and,genotypes |
R11302 |
T37179 |
T37176 |
conj |
ages,genotypes |
R11303 |
T37180 |
T37164 |
auxpass |
were,analyzed |
R11304 |
T37181 |
T37164 |
prep |
by,analyzed |
R11305 |
T37182 |
T37183 |
compound |
Western,blotting |
R11306 |
T37183 |
T37181 |
pobj |
blotting,by |
R11307 |
T37184 |
T37185 |
aux |
to,detect |
R11308 |
T37185 |
T37164 |
advcl |
detect,analyzed |
R11309 |
T37186 |
T37187 |
det |
the,proteins |
R11310 |
T37187 |
T37185 |
dobj |
proteins,detect |
R11311 |
T37188 |
T37187 |
amod |
indicated,proteins |
R11312 |
T37189 |
T37164 |
punct |
.,analyzed |
R11313 |
T37191 |
T37192 |
nsubjpass |
Lysate,used |
R11314 |
T37193 |
T37191 |
prep |
from,Lysate |
R11315 |
T37194 |
T37195 |
nmod |
E2f3a,mice |
R11316 |
T37195 |
T37193 |
pobj |
mice,from |
R11317 |
T37196 |
T37194 |
punct |
−,E2f3a |
R11318 |
T37197 |
T37194 |
punct |
/,E2f3a |
R11319 |
T37198 |
T37194 |
punct |
−,E2f3a |
R11320 |
T37199 |
T37192 |
auxpass |
was,used |
R11321 |
T37200 |
T37192 |
prep |
as,used |
R11322 |
T37201 |
T37202 |
det |
a,control |
R11323 |
T37202 |
T37200 |
pobj |
control,as |
R11324 |
T37203 |
T37204 |
aux |
to,confirm |
R11325 |
T37204 |
T37192 |
advcl |
confirm,used |
R11326 |
T37205 |
T37206 |
det |
the,location |
R11327 |
T37206 |
T37204 |
dobj |
location,confirm |
R11328 |
T37207 |
T37206 |
prep |
of,location |
R11329 |
T37208 |
T37209 |
compound |
E2f3a,protein |
R11330 |
T37209 |
T37207 |
pobj |
protein,of |
R11331 |
T37210 |
T37192 |
punct |
.,used |
R11332 |
T37213 |
T37212 |
punct |
", ",C |
R11333 |
T37214 |
T37215 |
amod |
cytoplasmic,extracts |
R11334 |
T37215 |
T37212 |
appos |
extracts,C |
R11335 |
T37216 |
T37212 |
punct |
;,C |
R11336 |
T37217 |
T37212 |
appos |
N,C |
R11337 |
T37218 |
T37217 |
punct |
", ",N |
R11338 |
T37219 |
T37220 |
amod |
nuclear,extracts |
R11339 |
T37220 |
T37217 |
appos |
extracts,N |
R11340 |
T37221 |
T37212 |
punct |
.,C |
R11341 |
T37915 |
T37916 |
det |
The,Isoform |
R11342 |
T37916 |
T37918 |
nsubj |
Isoform,Drives |
R11343 |
T37917 |
T37916 |
compound |
E2f3a,Isoform |
R11344 |
T37919 |
T37920 |
det |
the,Defect |
R11345 |
T37920 |
T37918 |
dobj |
Defect,Drives |
R11346 |
T37921 |
T37920 |
compound |
Differentiation,Defect |
R11347 |
T37922 |
T37918 |
prep |
in,Drives |
R11348 |
T37923 |
T37924 |
compound |
Rb,KO |
R11349 |
T37924 |
T37925 |
compound |
KO,SACs |
R11350 |
T37925 |
T37922 |
pobj |
SACs,in |
R11351 |
T37927 |
T37928 |
punct |
(,A |
R11352 |
T37928 |
T37929 |
meta |
A,diagrams |
R11353 |
T37930 |
T37928 |
punct |
),A |
R11354 |
T37931 |
T37929 |
amod |
Schematic,diagrams |
R11355 |
T37932 |
T37929 |
prep |
of,diagrams |
R11356 |
T37933 |
T37934 |
det |
the,WT |
R11357 |
T37934 |
T37932 |
pobj |
WT,of |
R11358 |
T37935 |
T37934 |
compound |
mouse,WT |
R11359 |
T37936 |
T37934 |
punct |
", ",WT |
R11360 |
T37937 |
T37934 |
conj |
E2f3a,WT |
R11361 |
T37938 |
T37937 |
punct |
−,E2f3a |
R11362 |
T37939 |
T37937 |
punct |
/,E2f3a |
R11363 |
T37940 |
T37937 |
punct |
−,E2f3a |
R11364 |
T37941 |
T37937 |
punct |
", ",E2f3a |
R11365 |
T37942 |
T37937 |
cc |
and,E2f3a |
R11366 |
T37943 |
T37944 |
det |
the,loci |
R11367 |
T37944 |
T37937 |
conj |
loci,E2f3a |
R11368 |
T37945 |
T37944 |
nmod |
Cre,loci |
R11369 |
T37946 |
T37945 |
punct |
-,Cre |
R11370 |
T37947 |
T37945 |
amod |
recombined,Cre |
R11371 |
T37948 |
T37944 |
amod |
floxed,loci |
R11372 |
T37949 |
T37944 |
compound |
E2f3,loci |
R11373 |
T37950 |
T37944 |
punct |
(,loci |
R11374 |
T37951 |
T37944 |
acl |
indicated,loci |
R11375 |
T37952 |
T37951 |
advmod |
here,indicated |
R11376 |
T37953 |
T37951 |
prep |
as,indicated |
R11377 |
T37954 |
T37953 |
pobj |
E2f3,as |
R11378 |
T37955 |
T37954 |
punct |
−,E2f3 |
R11379 |
T37956 |
T37954 |
punct |
/,E2f3 |
R11380 |
T37957 |
T37954 |
punct |
−,E2f3 |
R11381 |
T37958 |
T37951 |
prep |
for,indicated |
R11382 |
T37959 |
T37958 |
pobj |
simplicity,for |
R11383 |
T37960 |
T37929 |
punct |
),diagrams |
R11384 |
T37961 |
T37929 |
punct |
.,diagrams |
R11385 |
T37963 |
T37964 |
nmod |
E2f3a,mice |
R11386 |
T37964 |
T37968 |
nsubj |
mice,lack |
R11387 |
T37965 |
T37963 |
punct |
−,E2f3a |
R11388 |
T37966 |
T37963 |
punct |
/,E2f3a |
R11389 |
T37967 |
T37963 |
punct |
−,E2f3a |
R11390 |
T37969 |
T37968 |
dobj |
most,lack |
R11391 |
T37970 |
T37969 |
prep |
of,most |
R11392 |
T37971 |
T37972 |
compound |
E2f3,1a |
R11393 |
T37972 |
T37970 |
pobj |
1a,of |
R11394 |
T37973 |
T37972 |
compound |
exon,1a |
R11395 |
T37974 |
T37969 |
cc |
and,most |
R11396 |
T37975 |
T37969 |
conj |
part,most |
R11397 |
T37976 |
T37975 |
prep |
of,part |
R11398 |
T37977 |
T37978 |
compound |
intron,1a |
R11399 |
T37978 |
T37976 |
pobj |
1a,of |
R11400 |
T37979 |
T37980 |
punct |
(,box |
R11401 |
T37980 |
T37968 |
parataxis |
box,lack |
R11402 |
T37981 |
T37980 |
amod |
red,box |
R11403 |
T37982 |
T37980 |
amod |
dotted,box |
R11404 |
T37983 |
T37980 |
punct |
),box |
R11405 |
T37984 |
T37968 |
punct |
.,lack |
R11406 |
T37986 |
T37987 |
nsubj |
Arrows,indicate |
R11407 |
T37988 |
T37989 |
compound |
PCR,primers |
R11408 |
T37989 |
T37987 |
dobj |
primers,indicate |
R11409 |
T37990 |
T37987 |
punct |
.,indicate |
R11410 |
T37992 |
T37993 |
nsubjpass |
Genotyping,shown |
R11411 |
T37994 |
T37992 |
prep |
of,Genotyping |
R11412 |
T37995 |
T37996 |
det |
an,mouse |
R11413 |
T37996 |
T37994 |
pobj |
mouse,of |
R11414 |
T37997 |
T37996 |
nmod |
E2f3a,mouse |
R11415 |
T37998 |
T37997 |
punct |
+,E2f3a |
R11416 |
T37999 |
T37997 |
punct |
/,E2f3a |
R11417 |
T38000 |
T37997 |
punct |
−,E2f3a |
R11418 |
T38001 |
T37993 |
auxpass |
is,shown |
R11419 |
T38002 |
T37993 |
prep |
on,shown |
R11420 |
T38003 |
T38004 |
det |
the,right |
R11421 |
T38004 |
T38002 |
pobj |
right,on |
R11422 |
T38005 |
T37993 |
punct |
.,shown |
R11423 |
T38007 |
T38008 |
punct |
(,B |
R11424 |
T38008 |
T38009 |
meta |
B,detection |
R11425 |
T38010 |
T38008 |
punct |
),B |
R11426 |
T38011 |
T38012 |
compound |
RT,PCR |
R11427 |
T38012 |
T38009 |
compound |
PCR,detection |
R11428 |
T38013 |
T38012 |
punct |
-,PCR |
R11429 |
T38014 |
T38009 |
prep |
of,detection |
R11430 |
T38015 |
T38016 |
nmod |
E2f3a,mRNA |
R11431 |
T38016 |
T38014 |
pobj |
mRNA,of |
R11432 |
T38017 |
T38015 |
cc |
and,E2f3a |
R11433 |
T38018 |
T38015 |
conj |
E2f3b,E2f3a |
R11434 |
T38019 |
T38009 |
prep |
in,detection |
R11435 |
T38020 |
T38021 |
det |
the,retina |
R11436 |
T38021 |
T38019 |
pobj |
retina,in |
R11437 |
T38022 |
T38009 |
punct |
.,detection |
R11438 |
T38024 |
T38025 |
det |
The,sequences |
R11439 |
T38025 |
T38026 |
nsubj |
sequences,are |
R11440 |
T38027 |
T38025 |
prep |
of,sequences |
R11441 |
T38028 |
T38027 |
pobj |
primers,of |
R11442 |
T38029 |
T38026 |
attr |
1aF,are |
R11443 |
T38030 |
T38029 |
punct |
(,1aF |
R11444 |
T38031 |
T38032 |
nummod |
5,GCCTCTACACCACGCCACAAG |
R11445 |
T38032 |
T38029 |
appos |
GCCTCTACACCACGCCACAAG,1aF |
R11446 |
T38033 |
T38031 |
punct |
′,5 |
R11447 |
T38034 |
T38032 |
punct |
-,GCCTCTACACCACGCCACAAG |
R11448 |
T38035 |
T38032 |
punct |
-,GCCTCTACACCACGCCACAAG |
R11449 |
T38036 |
T38032 |
nummod |
3,GCCTCTACACCACGCCACAAG |
R11450 |
T38037 |
T38032 |
punct |
′,GCCTCTACACCACGCCACAAG |
R11451 |
T38038 |
T38029 |
punct |
),1aF |
R11452 |
T38039 |
T38029 |
punct |
", ",1aF |
R11453 |
T38040 |
T38029 |
conj |
1bF,1aF |
R11454 |
T38041 |
T38040 |
punct |
(,1bF |
R11455 |
T38042 |
T38043 |
nummod |
5,CGGAAATGCCCTTACAGC |
R11456 |
T38043 |
T38040 |
appos |
CGGAAATGCCCTTACAGC,1bF |
R11457 |
T38044 |
T38042 |
punct |
′,5 |
R11458 |
T38045 |
T38043 |
punct |
-,CGGAAATGCCCTTACAGC |
R11459 |
T38046 |
T38043 |
punct |
-,CGGAAATGCCCTTACAGC |
R11460 |
T38047 |
T38043 |
nummod |
3,CGGAAATGCCCTTACAGC |
R11461 |
T38048 |
T38043 |
punct |
′,CGGAAATGCCCTTACAGC |
R11462 |
T38049 |
T38040 |
punct |
),1bF |
R11463 |
T38050 |
T38040 |
punct |
", ",1bF |
R11464 |
T38051 |
T38040 |
cc |
and,1bF |
R11465 |
T38052 |
T38040 |
conj |
4R,1bF |
R11466 |
T38053 |
T38052 |
punct |
(,4R |
R11467 |
T38054 |
T38055 |
nummod |
5,CTCAGTCACTTCTTTGGACAG |
R11468 |
T38055 |
T38052 |
appos |
CTCAGTCACTTCTTTGGACAG,4R |
R11469 |
T38056 |
T38054 |
punct |
′,5 |
R11470 |
T38057 |
T38055 |
punct |
-,CTCAGTCACTTCTTTGGACAG |
R11471 |
T38058 |
T38055 |
punct |
-,CTCAGTCACTTCTTTGGACAG |
R11472 |
T38059 |
T38055 |
nummod |
3,CTCAGTCACTTCTTTGGACAG |
R11473 |
T38060 |
T38055 |
punct |
′,CTCAGTCACTTCTTTGGACAG |
R11474 |
T38061 |
T38026 |
punct |
),are |
R11475 |
T38062 |
T38026 |
punct |
.,are |
R11476 |
T38064 |
T38065 |
compound |
WT,retina |
R11477 |
T38065 |
T38066 |
nsubj |
retina,expresses |
R11478 |
T38067 |
T38068 |
preconj |
both,E2f3a |
R11479 |
T38068 |
T38069 |
nmod |
E2f3a,mRNA |
R11480 |
T38069 |
T38066 |
dobj |
mRNA,expresses |
R11481 |
T38070 |
T38068 |
cc |
and,E2f3a |
R11482 |
T38071 |
T38068 |
conj |
E2f3b,E2f3a |
R11483 |
T38072 |
T38066 |
punct |
.,expresses |
R11484 |
T38074 |
T38075 |
mark |
As,expected |
R11485 |
T38075 |
T38076 |
advcl |
expected,lacks |
R11486 |
T38077 |
T38076 |
punct |
", ",lacks |
R11487 |
T38078 |
T38079 |
nmod |
E2f3a,retina |
R11488 |
T38079 |
T38076 |
nsubj |
retina,lacks |
R11489 |
T38080 |
T38078 |
punct |
−,E2f3a |
R11490 |
T38081 |
T38078 |
punct |
/,E2f3a |
R11491 |
T38082 |
T38078 |
punct |
−,E2f3a |
R11492 |
T38083 |
T38084 |
compound |
E2f3a,mRNA |
R11493 |
T38084 |
T38076 |
dobj |
mRNA,lacks |
R11494 |
T38085 |
T38076 |
cc |
and,lacks |
R11495 |
T38086 |
T38087 |
advmod |
still,expresses |
R11496 |
T38087 |
T38076 |
conj |
expresses,lacks |
R11497 |
T38088 |
T38089 |
compound |
E2f3b,mRNA |
R11498 |
T38089 |
T38087 |
dobj |
mRNA,expresses |
R11499 |
T38090 |
T38076 |
punct |
.,lacks |
R11500 |
T38092 |
T38093 |
nmod |
E2f3,retina |
R11501 |
T38093 |
T38097 |
nsubj |
retina,lacks |
R11502 |
T38094 |
T38092 |
punct |
−,E2f3 |
R11503 |
T38095 |
T38092 |
punct |
/,E2f3 |
R11504 |
T38096 |
T38092 |
punct |
−,E2f3 |
R11505 |
T38098 |
T38099 |
amod |
full,length |
R11506 |
T38099 |
T38101 |
nmod |
length,mRNAs |
R11507 |
T38100 |
T38099 |
punct |
-,length |
R11508 |
T38101 |
T38097 |
dobj |
mRNAs,lacks |
R11509 |
T38102 |
T38101 |
nmod |
E2f3a,mRNAs |
R11510 |
T38103 |
T38102 |
cc |
and,E2f3a |
R11511 |
T38104 |
T38102 |
conj |
E2f3b,E2f3a |
R11512 |
T38105 |
T38097 |
punct |
", ",lacks |
R11513 |
T38106 |
T38097 |
cc |
and,lacks |
R11514 |
T38107 |
T38108 |
advmod |
instead,expresses |
R11515 |
T38108 |
T38097 |
conj |
expresses,lacks |
R11516 |
T38109 |
T38110 |
det |
a,mRNA |
R11517 |
T38110 |
T38108 |
dobj |
mRNA,expresses |
R11518 |
T38111 |
T38110 |
amod |
truncated,mRNA |
R11519 |
T38112 |
T38110 |
acl |
lacking,mRNA |
R11520 |
T38113 |
T38112 |
dobj |
exon,lacking |
R11521 |
T38114 |
T38113 |
nummod |
3,exon |
R11522 |
T38115 |
T38097 |
punct |
.,lacks |
R11523 |
T38117 |
T38118 |
punct |
(,C |
R11524 |
T38118 |
T38119 |
meta |
C,analysis |
R11525 |
T38120 |
T38118 |
punct |
),C |
R11526 |
T38121 |
T38122 |
amod |
Real,time |
R11527 |
T38122 |
T38119 |
compound |
time,analysis |
R11528 |
T38123 |
T38122 |
punct |
-,time |
R11529 |
T38124 |
T38125 |
compound |
RT,PCR |
R11530 |
T38125 |
T38119 |
compound |
PCR,analysis |
R11531 |
T38126 |
T38125 |
punct |
-,PCR |
R11532 |
T38127 |
T38119 |
prep |
of,analysis |
R11533 |
T38128 |
T38129 |
compound |
E2f,genes |
R11534 |
T38129 |
T38127 |
pobj |
genes,of |
R11535 |
T38130 |
T38119 |
prep |
in,analysis |
R11536 |
T38131 |
T38132 |
compound |
P8,retinas |
R11537 |
T38132 |
T38130 |
pobj |
retinas,in |
R11538 |
T38133 |
T38132 |
prep |
of,retinas |
R11539 |
T38134 |
T38135 |
det |
the,genotypes |
R11540 |
T38135 |
T38133 |
pobj |
genotypes,of |
R11541 |
T38136 |
T38135 |
amod |
indicated,genotypes |
R11542 |
T38137 |
T38119 |
punct |
.,analysis |
R11543 |
T38139 |
T38140 |
compound |
Error,bars |
R11544 |
T38140 |
T38141 |
nsubj |
bars,represent |
R11545 |
T38142 |
T38141 |
dobj |
SD,represent |
R11546 |
T38143 |
T38142 |
prep |
of,SD |
R11547 |
T38144 |
T38143 |
pobj |
measurements,of |
R11548 |
T38145 |
T38144 |
prep |
from,measurements |
R11549 |
T38146 |
T38147 |
nummod |
three,animals |
R11550 |
T38147 |
T38145 |
pobj |
animals,from |
R11551 |
T38148 |
T38141 |
punct |
", ",represent |
R11552 |
T38149 |
T38141 |
cc |
and,represent |
R11553 |
T38150 |
T38151 |
nsubj |
asterisks,indicate |
R11554 |
T38151 |
T38141 |
conj |
indicate,represent |
R11555 |
T38152 |
T38153 |
det |
a,difference |
R11556 |
T38153 |
T38151 |
dobj |
difference,indicate |
R11557 |
T38154 |
T38153 |
amod |
significant,difference |
R11558 |
T38155 |
T38153 |
prep |
between,difference |
R11559 |
T38156 |
T38155 |
pobj |
WT,between |
R11560 |
T38157 |
T38156 |
cc |
and,WT |
R11561 |
T38158 |
T38159 |
det |
the,indicated |
R11562 |
T38159 |
T38160 |
nmod |
indicated,genotypes |
R11563 |
T38160 |
T38156 |
conj |
genotypes,WT |
R11564 |
T38161 |
T38162 |
punct |
(,test |
R11565 |
T38162 |
T38153 |
parataxis |
test,difference |
R11566 |
T38163 |
T38164 |
punct |
*,0.05 |
R11567 |
T38164 |
T38162 |
ccomp |
0.05,test |
R11568 |
T38165 |
T38164 |
punct |
", ",0.05 |
R11569 |
T38166 |
T38164 |
nsubj |
p,0.05 |
R11570 |
T38167 |
T38164 |
punct |
<,0.05 |
R11571 |
T38168 |
T38162 |
punct |
;,test |
R11572 |
T38169 |
T38170 |
punct |
**,0.01 |
R11573 |
T38170 |
T38162 |
ccomp |
0.01,test |
R11574 |
T38171 |
T38170 |
punct |
;,0.01 |
R11575 |
T38172 |
T38170 |
nsubj |
p,0.01 |
R11576 |
T38173 |
T38170 |
punct |
<,0.01 |
R11577 |
T38174 |
T38162 |
punct |
;,test |
R11578 |
T38175 |
T38162 |
nmod |
ANOVA,test |
R11579 |
T38176 |
T38175 |
cc |
and,ANOVA |
R11580 |
T38177 |
T38178 |
compound |
Tukey,HSD |
R11581 |
T38178 |
T38175 |
conj |
HSD,ANOVA |
R11582 |
T38179 |
T38162 |
punct |
),test |
R11583 |
T38180 |
T38151 |
punct |
.,indicate |
R11584 |
T38182 |
T38183 |
punct |
(,D |
R11585 |
T38183 |
T38184 |
meta |
D,Rescue |
R11586 |
T38185 |
T38183 |
punct |
),D |
R11587 |
T38186 |
T38184 |
prep |
of,Rescue |
R11588 |
T38187 |
T38188 |
compound |
Rb,KO |
R11589 |
T38188 |
T38189 |
compound |
KO,SACs |
R11590 |
T38189 |
T38186 |
pobj |
SACs,of |
R11591 |
T38190 |
T38184 |
prep |
by,Rescue |
R11592 |
T38191 |
T38192 |
compound |
E2f3a,deletion |
R11593 |
T38192 |
T38190 |
pobj |
deletion,by |
R11594 |
T38193 |
T38184 |
punct |
.,Rescue |
R11595 |
T38195 |
T38196 |
amod |
Horizontal,sections |
R11596 |
T38196 |
T38198 |
nsubjpass |
sections,stained |
R11597 |
T38197 |
T38196 |
amod |
retinal,sections |
R11598 |
T38199 |
T38196 |
prep |
of,sections |
R11599 |
T38200 |
T38201 |
det |
the,genotypes |
R11600 |
T38201 |
T38199 |
pobj |
genotypes,of |
R11601 |
T38202 |
T38201 |
amod |
indicated,genotypes |
R11602 |
T38203 |
T38201 |
cc |
and,genotypes |
R11603 |
T38204 |
T38201 |
conj |
ages,genotypes |
R11604 |
T38205 |
T38198 |
auxpass |
were,stained |
R11605 |
T38206 |
T38198 |
prep |
for,stained |
R11606 |
T38207 |
T38206 |
pobj |
nuclei,for |
R11607 |
T38208 |
T38209 |
punct |
(,blue |
R11608 |
T38209 |
T38207 |
parataxis |
blue,nuclei |
R11609 |
T38210 |
T38209 |
dep |
DAPI,blue |
R11610 |
T38211 |
T38209 |
punct |
", ",blue |
R11611 |
T38212 |
T38209 |
punct |
),blue |
R11612 |
T38213 |
T38207 |
punct |
", ",nuclei |
R11613 |
T38214 |
T38215 |
compound |
M,phase |
R11614 |
T38215 |
T38207 |
conj |
phase,nuclei |
R11615 |
T38216 |
T38215 |
punct |
-,phase |
R11616 |
T38217 |
T38218 |
punct |
(,green |
R11617 |
T38218 |
T38215 |
parataxis |
green,phase |
R11618 |
T38219 |
T38218 |
dep |
PH3,green |
R11619 |
T38220 |
T38218 |
punct |
", ",green |
R11620 |
T38221 |
T38218 |
punct |
),green |
R11621 |
T38222 |
T38215 |
punct |
", ",phase |
R11622 |
T38223 |
T38215 |
cc |
and,phase |
R11623 |
T38224 |
T38225 |
det |
the,marker |
R11624 |
T38225 |
T38215 |
conj |
marker,phase |
R11625 |
T38226 |
T38225 |
compound |
SAC,marker |
R11626 |
T38227 |
T38225 |
appos |
Slc18a3,marker |
R11627 |
T38228 |
T38229 |
punct |
(,red |
R11628 |
T38229 |
T38225 |
parataxis |
red,marker |
R11629 |
T38230 |
T38229 |
punct |
),red |
R11630 |
T38231 |
T38198 |
punct |
.,stained |
R11631 |
T38233 |
T38234 |
compound |
E2f3a,deletion |
R11632 |
T38234 |
T38235 |
nsubj |
deletion,suppress |
R11633 |
T38236 |
T38235 |
aux |
does,suppress |
R11634 |
T38237 |
T38235 |
neg |
not,suppress |
R11635 |
T38238 |
T38239 |
amod |
ectopic,division |
R11636 |
T38239 |
T38235 |
dobj |
division,suppress |
R11637 |
T38240 |
T38235 |
punct |
", ",suppress |
R11638 |
T38241 |
T38235 |
cc |
but,suppress |
R11639 |
T38242 |
T38235 |
conj |
rescues,suppress |
R11640 |
T38243 |
T38244 |
det |
the,defect |
R11641 |
T38244 |
T38242 |
dobj |
defect,rescues |
R11642 |
T38245 |
T38244 |
compound |
SAC,defect |
R11643 |
T38246 |
T38235 |
punct |
.,suppress |
R11644 |
T38248 |
T38249 |
compound |
Scale,bars |
R11645 |
T38249 |
T38250 |
nsubj |
bars,are |
R11646 |
T38251 |
T38252 |
nummod |
50,μm |
R11647 |
T38252 |
T38250 |
attr |
μm,are |
R11648 |
T38253 |
T38250 |
punct |
.,are |
R11649 |
T38256 |
T38255 |
punct |
", ",M |
R11650 |
T38257 |
T38258 |
amod |
molecular,size |
R11651 |
T38258 |
T38259 |
compound |
size,marker |
R11652 |
T38259 |
T38255 |
appos |
marker,M |
R11653 |
T38260 |
T38255 |
punct |
.,M |
R6136 |
T20662 |
T20658 |
pobj |
modifications,by |
R6137 |
T20663 |
T20662 |
amod |
post-translational,modifications |
R6138 |
T20664 |
T20627 |
punct |
.,show |
R6139 |
T20666 |
T20667 |
nsubj |
We,examined |
R6140 |
T20668 |
T20667 |
advmod |
also,examined |
R6141 |
T20669 |
T20670 |
det |
the,distribution |
R6142 |
T20670 |
T20667 |
dobj |
distribution,examined |
R6143 |
T20671 |
T20670 |
prep |
of,distribution |
R6144 |
T20672 |
T20673 |
amod |
other,regulators |
R6145 |
T20673 |
T20671 |
pobj |
regulators,of |
R6146 |
T20674 |
T20675 |
compound |
cell,cycle |
R6147 |
T20675 |
T20673 |
compound |
cycle,regulators |
R6148 |
T20676 |
T20667 |
prep |
during,examined |
R6149 |
T20677 |
T20678 |
amod |
retinal,development |
R6150 |
T20678 |
T20676 |
pobj |
development,during |
R6151 |
T20679 |
T20667 |
punct |
.,examined |
R6152 |
T20681 |
T20682 |
prep |
Like,was |
R6153 |
T20683 |
T20681 |
pobj |
E2f3a,Like |
R6154 |
T20684 |
T20682 |
punct |
", ",was |
R6155 |
T20685 |
T20682 |
nsubj |
Rb,was |