| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T6543 |
4171-4177 |
NN |
denotes |
genome |
| T871 |
0-8 |
NN |
denotes |
Deletion |
| T872 |
18-27 |
VBZ |
denotes |
Underlies |
| T873 |
0-82 |
sentence |
denotes |
Deletion at ITPR1 Underlies Ataxia in Mice and Spinocerebellar Ataxia 15 in Humans |
| T874 |
9-11 |
IN |
denotes |
at |
| T875 |
12-17 |
NNP |
denotes |
ITPR1 |
| T876 |
28-34 |
NN |
denotes |
Ataxia |
| T877 |
35-37 |
IN |
denotes |
in |
| T878 |
38-42 |
NNS |
denotes |
Mice |
| T879 |
43-46 |
CC |
denotes |
and |
| T880 |
47-62 |
JJ |
denotes |
Spinocerebellar |
| T881 |
63-69 |
NN |
denotes |
Ataxia |
| T882 |
70-72 |
CD |
denotes |
15 |
| T883 |
73-75 |
IN |
denotes |
in |
| T884 |
76-82 |
NNS |
denotes |
Humans |
| T887 |
82-216 |
sentence |
denotes |
ITPR1 Deletion Causes Ataxia
Abstract
We observed a severe autosomal recessive movement disorder in mice used within our laboratory. |
| T888 |
122-124 |
PRP |
denotes |
We |
| T889 |
125-133 |
VBD |
denotes |
observed |
| T890 |
134-135 |
DT |
denotes |
a |
| T891 |
172-180 |
NN |
denotes |
disorder |
| T892 |
136-142 |
JJ |
denotes |
severe |
| T893 |
143-152 |
JJ |
denotes |
autosomal |
| T894 |
153-162 |
JJ |
denotes |
recessive |
| T895 |
163-171 |
NN |
denotes |
movement |
| T896 |
181-183 |
IN |
denotes |
in |
| T897 |
184-188 |
NNS |
denotes |
mice |
| T898 |
189-193 |
VBN |
denotes |
used |
| T899 |
194-200 |
IN |
denotes |
within |
| T900 |
201-204 |
PRP$ |
denotes |
our |
| T901 |
205-215 |
NN |
denotes |
laboratory |
| T902 |
215-216 |
. |
denotes |
. |
| T903 |
216-382 |
sentence |
denotes |
We pursued a series of experiments to define the genetic lesion underlying this disorder and to identify a cognate disease in humans with mutation at the same locus. |
| T904 |
217-219 |
PRP |
denotes |
We |
| T905 |
220-227 |
VBD |
denotes |
pursued |
| T906 |
228-229 |
DT |
denotes |
a |
| T907 |
230-236 |
NN |
denotes |
series |
| T908 |
237-239 |
IN |
denotes |
of |
| T909 |
240-251 |
NNS |
denotes |
experiments |
| T910 |
252-254 |
TO |
denotes |
to |
| T911 |
255-261 |
VB |
denotes |
define |
| T912 |
262-265 |
DT |
denotes |
the |
| T913 |
274-280 |
NN |
denotes |
lesion |
| T914 |
266-273 |
JJ |
denotes |
genetic |
| T915 |
281-291 |
VBG |
denotes |
underlying |
| T916 |
292-296 |
DT |
denotes |
this |
| T917 |
297-305 |
NN |
denotes |
disorder |
| T918 |
306-309 |
CC |
denotes |
and |
| T919 |
310-312 |
TO |
denotes |
to |
| T920 |
313-321 |
VB |
denotes |
identify |
| T921 |
322-323 |
DT |
denotes |
a |
| T922 |
332-339 |
NN |
denotes |
disease |
| T923 |
324-331 |
JJ |
denotes |
cognate |
| T924 |
340-342 |
IN |
denotes |
in |
| T925 |
343-349 |
NNS |
denotes |
humans |
| T926 |
350-354 |
IN |
denotes |
with |
| T927 |
355-363 |
NN |
denotes |
mutation |
| T928 |
364-366 |
IN |
denotes |
at |
| T929 |
367-370 |
DT |
denotes |
the |
| T930 |
376-381 |
NN |
denotes |
locus |
| T931 |
371-375 |
JJ |
denotes |
same |
| T932 |
381-382 |
. |
denotes |
. |
| T933 |
382-576 |
sentence |
denotes |
Through linkage and sequence analysis we show here that this disorder is caused by a homozygous in-frame 18-bp deletion in Itpr1 (Itpr1Δ18/Δ18), encoding inositol 1,4,5-triphosphate receptor 1. |
| T934 |
383-390 |
IN |
denotes |
Through |
| T935 |
424-428 |
VBP |
denotes |
show |
| T936 |
391-398 |
NN |
denotes |
linkage |
| T937 |
412-420 |
NN |
denotes |
analysis |
| T938 |
399-402 |
CC |
denotes |
and |
| T939 |
403-411 |
NN |
denotes |
sequence |
| T940 |
421-423 |
PRP |
denotes |
we |
| T941 |
429-433 |
RB |
denotes |
here |
| T942 |
434-438 |
IN |
denotes |
that |
| T943 |
456-462 |
VBN |
denotes |
caused |
| T944 |
439-443 |
DT |
denotes |
this |
| T945 |
444-452 |
NN |
denotes |
disorder |
| T946 |
453-455 |
VBZ |
denotes |
is |
| T947 |
463-465 |
IN |
denotes |
by |
| T948 |
466-467 |
DT |
denotes |
a |
| T949 |
494-502 |
NN |
denotes |
deletion |
| T950 |
468-478 |
JJ |
denotes |
homozygous |
| T951 |
479-481 |
IN |
denotes |
in |
| T952 |
481-482 |
HYPH |
denotes |
- |
| T953 |
482-487 |
NN |
denotes |
frame |
| T954 |
488-490 |
CD |
denotes |
18 |
| T955 |
491-493 |
NN |
denotes |
bp |
| T956 |
490-491 |
HYPH |
denotes |
- |
| T957 |
503-505 |
IN |
denotes |
in |
| T958 |
506-511 |
NN |
denotes |
Itpr1 |
| T959 |
512-513 |
-LRB- |
denotes |
( |
| T960 |
522-525 |
NN |
denotes |
Δ18 |
| T961 |
513-518 |
NN |
denotes |
Itpr1 |
| T962 |
518-521 |
NN |
denotes |
Δ18 |
| T963 |
521-522 |
HYPH |
denotes |
/ |
| T964 |
525-526 |
-RRB- |
denotes |
) |
| T965 |
526-528 |
, |
denotes |
, |
| T966 |
528-536 |
VBG |
denotes |
encoding |
| T967 |
537-545 |
NN |
denotes |
inositol |
| T968 |
565-573 |
NN |
denotes |
receptor |
| T969 |
546-547 |
CD |
denotes |
1 |
| T970 |
550-551 |
CD |
denotes |
5 |
| T971 |
547-548 |
, |
denotes |
, |
| T972 |
548-549 |
CD |
denotes |
4 |
| T973 |
549-550 |
, |
denotes |
, |
| T974 |
552-564 |
NN |
denotes |
triphosphate |
| T975 |
551-552 |
HYPH |
denotes |
- |
| T976 |
574-575 |
CD |
denotes |
1 |
| T977 |
575-576 |
. |
denotes |
. |
| T978 |
576-685 |
sentence |
denotes |
A previously reported spontaneous Itpr1 mutation in mice causes a phenotype identical to that observed here. |
| T979 |
577-578 |
DT |
denotes |
A |
| T980 |
617-625 |
NN |
denotes |
mutation |
| T981 |
579-589 |
RB |
denotes |
previously |
| T982 |
590-598 |
VBN |
denotes |
reported |
| T983 |
599-610 |
JJ |
denotes |
spontaneous |
| T984 |
611-616 |
NN |
denotes |
Itpr1 |
| T985 |
634-640 |
VBZ |
denotes |
causes |
| T986 |
626-628 |
IN |
denotes |
in |
| T987 |
629-633 |
NNS |
denotes |
mice |
| T988 |
641-642 |
DT |
denotes |
a |
| T989 |
643-652 |
NN |
denotes |
phenotype |
| T990 |
653-662 |
JJ |
denotes |
identical |
| T991 |
663-665 |
IN |
denotes |
to |
| T992 |
666-670 |
DT |
denotes |
that |
| T993 |
671-679 |
VBN |
denotes |
observed |
| T994 |
680-684 |
RB |
denotes |
here |
| T995 |
684-685 |
. |
denotes |
. |
| T996 |
685-828 |
sentence |
denotes |
In both models in-frame deletion within Itpr1 leads to a decrease in the normally high level of Itpr1 expression in cerebellar Purkinje cells. |
| T997 |
686-688 |
IN |
denotes |
In |
| T998 |
732-737 |
VBZ |
denotes |
leads |
| T999 |
689-693 |
DT |
denotes |
both |
| T1000 |
694-700 |
NNS |
denotes |
models |
| T1001 |
701-703 |
IN |
denotes |
in |
| T1002 |
704-709 |
NN |
denotes |
frame |
| T1003 |
703-704 |
HYPH |
denotes |
- |
| T1004 |
710-718 |
NN |
denotes |
deletion |
| T1005 |
719-725 |
IN |
denotes |
within |
| T1006 |
726-731 |
NN |
denotes |
Itpr1 |
| T1007 |
738-740 |
IN |
denotes |
to |
| T1008 |
741-742 |
DT |
denotes |
a |
| T1009 |
743-751 |
NN |
denotes |
decrease |
| T1010 |
752-754 |
IN |
denotes |
in |
| T1011 |
755-758 |
DT |
denotes |
the |
| T1012 |
773-778 |
NN |
denotes |
level |
| T1013 |
759-767 |
RB |
denotes |
normally |
| T1014 |
768-772 |
JJ |
denotes |
high |
| T1015 |
779-781 |
IN |
denotes |
of |
| T1016 |
782-787 |
NN |
denotes |
Itpr1 |
| T1017 |
788-798 |
NN |
denotes |
expression |
| T1018 |
799-801 |
IN |
denotes |
in |
| T1019 |
802-812 |
JJ |
denotes |
cerebellar |
| T1020 |
822-827 |
NNS |
denotes |
cells |
| T1021 |
813-821 |
NNP |
denotes |
Purkinje |
| T1022 |
827-828 |
. |
denotes |
. |
| T1023 |
828-1003 |
sentence |
denotes |
Spinocerebellar ataxia 15 (SCA15), a human autosomal dominant disorder, maps to the genomic region containing ITPR1; however, to date no causal mutations had been identified. |
| T1024 |
829-844 |
JJ |
denotes |
Spinocerebellar |
| T1025 |
845-851 |
NN |
denotes |
ataxia |
| T1026 |
901-905 |
VBZ |
denotes |
maps |
| T1027 |
852-854 |
CD |
denotes |
15 |
| T1028 |
855-856 |
-LRB- |
denotes |
( |
| T1029 |
856-861 |
NN |
denotes |
SCA15 |
| T1030 |
861-862 |
-RRB- |
denotes |
) |
| T1031 |
862-864 |
, |
denotes |
, |
| T1032 |
864-865 |
DT |
denotes |
a |
| T1033 |
891-899 |
NN |
denotes |
disorder |
| T1034 |
866-871 |
JJ |
denotes |
human |
| T1035 |
872-881 |
JJ |
denotes |
autosomal |
| T1036 |
882-890 |
JJ |
denotes |
dominant |
| T1037 |
899-901 |
, |
denotes |
, |
| T1038 |
992-1002 |
VBN |
denotes |
identified |
| T1039 |
906-908 |
IN |
denotes |
to |
| T1040 |
909-912 |
DT |
denotes |
the |
| T1041 |
921-927 |
NN |
denotes |
region |
| T1042 |
913-920 |
JJ |
denotes |
genomic |
| T1043 |
928-938 |
VBG |
denotes |
containing |
| T1044 |
939-944 |
NN |
denotes |
ITPR1 |
| T1045 |
944-945 |
: |
denotes |
; |
| T1046 |
946-953 |
RB |
denotes |
however |
| T1047 |
953-955 |
, |
denotes |
, |
| T1048 |
955-957 |
IN |
denotes |
to |
| T1049 |
958-962 |
NN |
denotes |
date |
| T1050 |
963-965 |
DT |
denotes |
no |
| T1051 |
973-982 |
NNS |
denotes |
mutations |
| T1052 |
966-972 |
JJ |
denotes |
causal |
| T1053 |
983-986 |
VBD |
denotes |
had |
| T1054 |
987-991 |
VBN |
denotes |
been |
| T1055 |
1002-1003 |
. |
denotes |
. |
| T1056 |
1003-1173 |
sentence |
denotes |
Because ataxia is a prominent feature in Itpr1 mutant mice, we performed a series of experiments to test the hypothesis that mutation at ITPR1 may be the cause of SCA15. |
| T1057 |
1004-1011 |
IN |
denotes |
Because |
| T1058 |
1019-1021 |
VBZ |
denotes |
is |
| T1059 |
1012-1018 |
NN |
denotes |
ataxia |
| T1060 |
1067-1076 |
VBD |
denotes |
performed |
| T1061 |
1022-1023 |
DT |
denotes |
a |
| T1062 |
1034-1041 |
NN |
denotes |
feature |
| T1063 |
1024-1033 |
JJ |
denotes |
prominent |
| T1064 |
1042-1044 |
IN |
denotes |
in |
| T1065 |
1045-1050 |
NN |
denotes |
Itpr1 |
| T1066 |
1058-1062 |
NNS |
denotes |
mice |
| T1067 |
1051-1057 |
NN |
denotes |
mutant |
| T1068 |
1062-1064 |
, |
denotes |
, |
| T1069 |
1064-1066 |
PRP |
denotes |
we |
| T1070 |
1077-1078 |
DT |
denotes |
a |
| T1071 |
1079-1085 |
NN |
denotes |
series |
| T1072 |
1086-1088 |
IN |
denotes |
of |
| T1073 |
1089-1100 |
NNS |
denotes |
experiments |
| T1074 |
1101-1103 |
TO |
denotes |
to |
| T1075 |
1104-1108 |
VB |
denotes |
test |
| T1076 |
1109-1112 |
DT |
denotes |
the |
| T1077 |
1113-1123 |
NN |
denotes |
hypothesis |
| T1078 |
1124-1128 |
IN |
denotes |
that |
| T1079 |
1151-1153 |
VB |
denotes |
be |
| T1080 |
1129-1137 |
NN |
denotes |
mutation |
| T1081 |
1138-1140 |
IN |
denotes |
at |
| T1082 |
1141-1146 |
NN |
denotes |
ITPR1 |
| T1083 |
1147-1150 |
MD |
denotes |
may |
| T1084 |
1154-1157 |
DT |
denotes |
the |
| T1085 |
1158-1163 |
NN |
denotes |
cause |
| T1086 |
1164-1166 |
IN |
denotes |
of |
| T1087 |
1167-1172 |
NN |
denotes |
SCA15 |
| T1088 |
1172-1173 |
. |
denotes |
. |
| T1089 |
1173-1341 |
sentence |
denotes |
We show here that heterozygous deletion of the 5′ part of the ITPR1 gene, encompassing exons 1–10, 1–40, and 1–44 in three studied families, underlies SCA15 in humans. |
| T1090 |
1174-1176 |
PRP |
denotes |
We |
| T1091 |
1177-1181 |
VBP |
denotes |
show |
| T1092 |
1182-1186 |
RB |
denotes |
here |
| T1093 |
1187-1191 |
IN |
denotes |
that |
| T1094 |
1315-1324 |
VBZ |
denotes |
underlies |
| T1095 |
1192-1204 |
JJ |
denotes |
heterozygous |
| T1096 |
1205-1213 |
NN |
denotes |
deletion |
| T1097 |
1214-1216 |
IN |
denotes |
of |
| T1098 |
1217-1220 |
DT |
denotes |
the |
| T1099 |
1224-1228 |
NN |
denotes |
part |
| T1100 |
1221-1222 |
CD |
denotes |
5 |
| T1101 |
1222-1223 |
SYM |
denotes |
′ |
| T1102 |
1229-1231 |
IN |
denotes |
of |
| T1103 |
1232-1235 |
DT |
denotes |
the |
| T1104 |
1242-1246 |
NN |
denotes |
gene |
| T1105 |
1236-1241 |
NN |
denotes |
ITPR1 |
| T1106 |
1246-1248 |
, |
denotes |
, |
| T1107 |
1248-1260 |
VBG |
denotes |
encompassing |
| T1108 |
1261-1266 |
NNS |
denotes |
exons |
| T1109 |
1267-1268 |
CD |
denotes |
1 |
| T1110 |
1268-1269 |
SYM |
denotes |
– |
| T1111 |
1269-1271 |
CD |
denotes |
10 |
| T1112 |
1271-1273 |
, |
denotes |
, |
| T1113 |
1273-1274 |
CD |
denotes |
1 |
| T1114 |
1274-1275 |
SYM |
denotes |
– |
| T1115 |
1275-1277 |
CD |
denotes |
40 |
| T1116 |
1277-1279 |
, |
denotes |
, |
| T1117 |
1279-1282 |
CC |
denotes |
and |
| T1118 |
1283-1284 |
CD |
denotes |
1 |
| T1119 |
1284-1285 |
SYM |
denotes |
– |
| T1120 |
1285-1287 |
CD |
denotes |
44 |
| T1121 |
1288-1290 |
IN |
denotes |
in |
| T1122 |
1291-1296 |
CD |
denotes |
three |
| T1123 |
1305-1313 |
NNS |
denotes |
families |
| T1124 |
1297-1304 |
VBN |
denotes |
studied |
| T1125 |
1313-1315 |
, |
denotes |
, |
| T1126 |
1325-1330 |
NN |
denotes |
SCA15 |
| T1127 |
1331-1333 |
IN |
denotes |
in |
| T1128 |
1334-1340 |
NNS |
denotes |
humans |
| T1129 |
1340-1341 |
. |
denotes |
. |
| T1474 |
2135-2138 |
DT |
denotes |
The |
| T1475 |
2139-2142 |
NN |
denotes |
use |
| T1476 |
2217-2223 |
VBN |
denotes |
become |
| T1477 |
2143-2145 |
IN |
denotes |
of |
| T1478 |
2146-2153 |
JJ |
denotes |
forward |
| T1479 |
2154-2162 |
NN |
denotes |
genetics |
| T1480 |
2163-2165 |
TO |
denotes |
to |
| T1481 |
2166-2172 |
VB |
denotes |
define |
| T1482 |
2173-2178 |
JJ |
denotes |
novel |
| T1483 |
2179-2183 |
NNS |
denotes |
loci |
| T1484 |
2184-2186 |
IN |
denotes |
of |
| T1485 |
2187-2195 |
NN |
denotes |
interest |
| T1486 |
2196-2198 |
IN |
denotes |
in |
| T1487 |
2199-2204 |
JJ |
denotes |
human |
| T1488 |
2205-2212 |
NN |
denotes |
disease |
| T1489 |
2213-2216 |
VBZ |
denotes |
has |
| T1490 |
2224-2236 |
RB |
denotes |
increasingly |
| T1491 |
2237-2243 |
JJ |
denotes |
viable |
| T1492 |
2244-2248 |
IN |
denotes |
with |
| T1493 |
2249-2252 |
DT |
denotes |
the |
| T1494 |
2253-2267 |
NN |
denotes |
implementation |
| T1495 |
2268-2270 |
IN |
denotes |
of |
| T1496 |
2271-2276 |
JJ |
denotes |
large |
| T1497 |
2277-2282 |
NN |
denotes |
scale |
| T1498 |
2276-2277 |
HYPH |
denotes |
- |
| T1499 |
2295-2303 |
NNS |
denotes |
programs |
| T1500 |
2283-2294 |
NN |
denotes |
mutagenesis |
| T1501 |
2303-2304 |
. |
denotes |
. |
| T1502 |
2304-2460 |
sentence |
denotes |
Prior to these initiatives this work was carried out in part by the investigation of spontaneous mutations that cause disorders in mouse breeding colonies. |
| T1503 |
2305-2310 |
RB |
denotes |
Prior |
| T1504 |
2311-2313 |
IN |
denotes |
to |
| T1505 |
2346-2353 |
VBN |
denotes |
carried |
| T1506 |
2314-2319 |
DT |
denotes |
these |
| T1507 |
2320-2331 |
NNS |
denotes |
initiatives |
| T1508 |
2332-2336 |
DT |
denotes |
this |
| T1509 |
2337-2341 |
NN |
denotes |
work |
| T1510 |
2342-2345 |
VBD |
denotes |
was |
| T1511 |
2354-2357 |
RP |
denotes |
out |
| T1512 |
2358-2360 |
IN |
denotes |
in |
| T1513 |
2361-2365 |
JJ |
denotes |
part |
| T1514 |
2366-2368 |
IN |
denotes |
by |
| T1515 |
2369-2372 |
DT |
denotes |
the |
| T1516 |
2373-2386 |
NN |
denotes |
investigation |
| T1517 |
2387-2389 |
IN |
denotes |
of |
| T1518 |
2390-2401 |
JJ |
denotes |
spontaneous |
| T1519 |
2402-2411 |
NNS |
denotes |
mutations |
| T1520 |
2412-2416 |
WDT |
denotes |
that |
| T1521 |
2417-2422 |
VBP |
denotes |
cause |
| T1522 |
2423-2432 |
NNS |
denotes |
disorders |
| T1523 |
2433-2435 |
IN |
denotes |
in |
| T1524 |
2436-2441 |
NN |
denotes |
mouse |
| T1525 |
2451-2459 |
NNS |
denotes |
colonies |
| T1526 |
2442-2450 |
NN |
denotes |
breeding |
| T1527 |
2459-2460 |
. |
denotes |
. |
| T1528 |
2460-2585 |
sentence |
denotes |
Careful observation of these serendipitous events has led to the establishment and study of many in vivo disease models [3]. |
| T1529 |
2461-2468 |
JJ |
denotes |
Careful |
| T1530 |
2469-2480 |
NN |
denotes |
observation |
| T1531 |
2515-2518 |
VBN |
denotes |
led |
| T1532 |
2481-2483 |
IN |
denotes |
of |
| T1533 |
2484-2489 |
DT |
denotes |
these |
| T1534 |
2504-2510 |
NNS |
denotes |
events |
| T1535 |
2490-2503 |
JJ |
denotes |
serendipitous |
| T1536 |
2511-2514 |
VBZ |
denotes |
has |
| T1537 |
2519-2521 |
IN |
denotes |
to |
| T1538 |
2522-2525 |
DT |
denotes |
the |
| T1539 |
2526-2539 |
NN |
denotes |
establishment |
| T1540 |
2540-2543 |
CC |
denotes |
and |
| T1541 |
2544-2549 |
NN |
denotes |
study |
| T1542 |
2550-2552 |
IN |
denotes |
of |
| T1543 |
2553-2557 |
JJ |
denotes |
many |
| T1544 |
2574-2580 |
NNS |
denotes |
models |
| T1545 |
2558-2560 |
FW |
denotes |
in |
| T1546 |
2561-2565 |
FW |
denotes |
vivo |
| T1547 |
2566-2573 |
NN |
denotes |
disease |
| T1548 |
2581-2582 |
-LRB- |
denotes |
[ |
| T1549 |
2582-2583 |
CD |
denotes |
3 |
| T1550 |
2583-2584 |
-RRB- |
denotes |
] |
| T1551 |
2584-2585 |
. |
denotes |
. |
| T1552 |
2585-2737 |
sentence |
denotes |
During the generation of a knockout line of mice we noted an early movement disorder that was inherited independently of targeting vector transmission. |
| T1553 |
2586-2592 |
IN |
denotes |
During |
| T1554 |
2638-2643 |
VBD |
denotes |
noted |
| T1555 |
2593-2596 |
DT |
denotes |
the |
| T1556 |
2597-2607 |
NN |
denotes |
generation |
| T1557 |
2608-2610 |
IN |
denotes |
of |
| T1558 |
2611-2612 |
DT |
denotes |
a |
| T1559 |
2622-2626 |
NN |
denotes |
line |
| T1560 |
2613-2621 |
NN |
denotes |
knockout |
| T1561 |
2627-2629 |
IN |
denotes |
of |
| T1562 |
2630-2634 |
NNS |
denotes |
mice |
| T1563 |
2635-2637 |
PRP |
denotes |
we |
| T1564 |
2644-2646 |
DT |
denotes |
an |
| T1565 |
2662-2670 |
NN |
denotes |
disorder |
| T1566 |
2647-2652 |
JJ |
denotes |
early |
| T1567 |
2653-2661 |
NN |
denotes |
movement |
| T1568 |
2671-2675 |
WDT |
denotes |
that |
| T1569 |
2680-2689 |
VBN |
denotes |
inherited |
| T1570 |
2676-2679 |
VBD |
denotes |
was |
| T1571 |
2690-2703 |
RB |
denotes |
independently |
| T1572 |
2704-2706 |
IN |
denotes |
of |
| T1573 |
2707-2716 |
VBG |
denotes |
targeting |
| T1574 |
2717-2723 |
NN |
denotes |
vector |
| T1575 |
2724-2736 |
NN |
denotes |
transmission |
| T1576 |
2736-2737 |
. |
denotes |
. |
| T1577 |
2737-2913 |
sentence |
denotes |
We embarked on a series of experiments to identify the genetic lesion underlying this movement disorder and to identify a cognate disease and corresponding mutation in humans. |
| T1578 |
2738-2740 |
PRP |
denotes |
We |
| T1579 |
2741-2749 |
VBD |
denotes |
embarked |
| T1580 |
2750-2752 |
IN |
denotes |
on |
| T1581 |
2753-2754 |
DT |
denotes |
a |
| T1582 |
2755-2761 |
NN |
denotes |
series |
| T1583 |
2762-2764 |
IN |
denotes |
of |
| T1584 |
2765-2776 |
NNS |
denotes |
experiments |
| T1585 |
2777-2779 |
TO |
denotes |
to |
| T1586 |
2780-2788 |
VB |
denotes |
identify |
| T1587 |
2789-2792 |
DT |
denotes |
the |
| T1588 |
2801-2807 |
NN |
denotes |
lesion |
| T1589 |
2793-2800 |
JJ |
denotes |
genetic |
| T1590 |
2808-2818 |
VBG |
denotes |
underlying |
| T1591 |
2819-2823 |
DT |
denotes |
this |
| T1592 |
2833-2841 |
NN |
denotes |
disorder |
| T1593 |
2824-2832 |
NN |
denotes |
movement |
| T1594 |
2842-2845 |
CC |
denotes |
and |
| T1595 |
2846-2848 |
TO |
denotes |
to |
| T1596 |
2849-2857 |
VB |
denotes |
identify |
| T1597 |
2858-2859 |
DT |
denotes |
a |
| T1598 |
2868-2875 |
NN |
denotes |
disease |
| T1599 |
2860-2867 |
JJ |
denotes |
cognate |
| T1600 |
2876-2879 |
CC |
denotes |
and |
| T1601 |
2880-2893 |
VBG |
denotes |
corresponding |
| T1602 |
2894-2902 |
NN |
denotes |
mutation |
| T1603 |
2903-2905 |
IN |
denotes |
in |
| T1604 |
2906-2912 |
NNS |
denotes |
humans |
| T1605 |
2912-2913 |
. |
denotes |
. |
| T1606 |
2913-3079 |
sentence |
denotes |
Here we describe this effort and the discovery of deletion at the ITPR1 locus as a cause of this disorder in mice and of spinocerebellar ataxia 15 (SCA15) in humans. |
| T1607 |
2914-2918 |
RB |
denotes |
Here |
| T1608 |
2922-2930 |
VBP |
denotes |
describe |
| T1609 |
2919-2921 |
PRP |
denotes |
we |
| T1610 |
2931-2935 |
DT |
denotes |
this |
| T1611 |
2936-2942 |
NN |
denotes |
effort |
| T1612 |
2943-2946 |
CC |
denotes |
and |
| T1613 |
2947-2950 |
DT |
denotes |
the |
| T1614 |
2951-2960 |
NN |
denotes |
discovery |
| T1615 |
2961-2963 |
IN |
denotes |
of |
| T1616 |
2964-2972 |
NN |
denotes |
deletion |
| T1617 |
2973-2975 |
IN |
denotes |
at |
| T1618 |
2976-2979 |
DT |
denotes |
the |
| T1619 |
2986-2991 |
NN |
denotes |
locus |
| T1620 |
2980-2985 |
NN |
denotes |
ITPR1 |
| T1621 |
2992-2994 |
IN |
denotes |
as |
| T1622 |
2995-2996 |
DT |
denotes |
a |
| T1623 |
2997-3002 |
NN |
denotes |
cause |
| T1624 |
3003-3005 |
IN |
denotes |
of |
| T1625 |
3006-3010 |
DT |
denotes |
this |
| T1626 |
3011-3019 |
NN |
denotes |
disorder |
| T1627 |
3020-3022 |
IN |
denotes |
in |
| T1628 |
3023-3027 |
NNS |
denotes |
mice |
| T1629 |
3028-3031 |
CC |
denotes |
and |
| T1630 |
3032-3034 |
IN |
denotes |
of |
| T1631 |
3035-3050 |
JJ |
denotes |
spinocerebellar |
| T1632 |
3051-3057 |
NN |
denotes |
ataxia |
| T1633 |
3058-3060 |
CD |
denotes |
15 |
| T1634 |
3061-3062 |
-LRB- |
denotes |
( |
| T1635 |
3062-3067 |
NN |
denotes |
SCA15 |
| T1636 |
3067-3068 |
-RRB- |
denotes |
) |
| T1637 |
3069-3071 |
IN |
denotes |
in |
| T1638 |
3072-3078 |
NNS |
denotes |
humans |
| T1639 |
3078-3079 |
. |
denotes |
. |
| T6544 |
4165-4170 |
NN |
denotes |
mouse |
| T6436 |
3545-3546 |
DT |
denotes |
a |
| T6363 |
3100-3106 |
IN |
denotes |
During |
| T6364 |
3175-3180 |
VBD |
denotes |
noted |
| T6365 |
3107-3110 |
DT |
denotes |
the |
| T6366 |
3111-3121 |
NN |
denotes |
generation |
| T6367 |
3122-3124 |
IN |
denotes |
of |
| T6368 |
3125-3126 |
DT |
denotes |
a |
| T6369 |
3127-3131 |
NN |
denotes |
line |
| T6370 |
3132-3134 |
IN |
denotes |
of |
| T6371 |
3135-3139 |
NNS |
denotes |
mice |
| T6372 |
3140-3144 |
IN |
denotes |
with |
| T6373 |
3145-3153 |
NN |
denotes |
knockout |
| T6374 |
3154-3156 |
IN |
denotes |
of |
| T6375 |
3157-3160 |
DT |
denotes |
the |
| T6376 |
3161-3165 |
NN |
denotes |
gene |
| T6377 |
3166-3171 |
NN |
denotes |
Park7 |
| T6378 |
3172-3174 |
PRP |
denotes |
we |
| T6379 |
3181-3183 |
DT |
denotes |
an |
| T6380 |
3199-3207 |
NN |
denotes |
disorder |
| T6381 |
3184-3189 |
JJ |
denotes |
early |
| T6382 |
3190-3198 |
NN |
denotes |
movement |
| T6383 |
3208-3212 |
WDT |
denotes |
that |
| T6384 |
3217-3226 |
VBN |
denotes |
inherited |
| T6385 |
3213-3216 |
VBD |
denotes |
was |
| T6386 |
3227-3240 |
RB |
denotes |
independently |
| T6387 |
3241-3243 |
IN |
denotes |
of |
| T6388 |
3244-3253 |
NN |
denotes |
targeting |
| T6389 |
3254-3260 |
NN |
denotes |
vector |
| T6390 |
3261-3273 |
NN |
denotes |
transmission |
| T6391 |
3273-3274 |
. |
denotes |
. |
| T6392 |
3274-3409 |
sentence |
denotes |
Our initial observations suggested the affected mice suffered from an apparently paroxysmal movement disorder, often induced by touch. |
| T6393 |
3275-3278 |
PRP$ |
denotes |
Our |
| T6394 |
3287-3299 |
NNS |
denotes |
observations |
| T6395 |
3279-3286 |
JJ |
denotes |
initial |
| T6396 |
3300-3309 |
VBD |
denotes |
suggested |
| T6397 |
3310-3313 |
DT |
denotes |
the |
| T6398 |
3323-3327 |
NNS |
denotes |
mice |
| T6399 |
3314-3322 |
VBN |
denotes |
affected |
| T6400 |
3328-3336 |
VBD |
denotes |
suffered |
| T6401 |
3337-3341 |
IN |
denotes |
from |
| T6402 |
3342-3344 |
DT |
denotes |
an |
| T6403 |
3376-3384 |
NN |
denotes |
disorder |
| T6404 |
3345-3355 |
RB |
denotes |
apparently |
| T6405 |
3356-3366 |
JJ |
denotes |
paroxysmal |
| T6406 |
3367-3375 |
NN |
denotes |
movement |
| T6407 |
3384-3386 |
, |
denotes |
, |
| T6408 |
3386-3391 |
RB |
denotes |
often |
| T6409 |
3392-3399 |
VBN |
denotes |
induced |
| T6410 |
3400-3402 |
IN |
denotes |
by |
| T6411 |
3403-3408 |
NN |
denotes |
touch |
| T6412 |
3408-3409 |
. |
denotes |
. |
| T6413 |
3409-3520 |
sentence |
denotes |
The abnormal movements occurred predominantly below the cervical level, and the disorder appeared progressive. |
| T6414 |
3410-3413 |
DT |
denotes |
The |
| T6415 |
3423-3432 |
NNS |
denotes |
movements |
| T6416 |
3414-3422 |
JJ |
denotes |
abnormal |
| T6417 |
3433-3441 |
VBD |
denotes |
occurred |
| T6418 |
3442-3455 |
RB |
denotes |
predominantly |
| T6419 |
3456-3461 |
IN |
denotes |
below |
| T6420 |
3462-3465 |
DT |
denotes |
the |
| T6421 |
3475-3480 |
NN |
denotes |
level |
| T6422 |
3466-3474 |
JJ |
denotes |
cervical |
| T6423 |
3480-3482 |
, |
denotes |
, |
| T6424 |
3482-3485 |
CC |
denotes |
and |
| T6425 |
3486-3489 |
DT |
denotes |
the |
| T6426 |
3490-3498 |
NN |
denotes |
disorder |
| T6427 |
3499-3507 |
VBD |
denotes |
appeared |
| T6428 |
3508-3519 |
JJ |
denotes |
progressive |
| T6429 |
3519-3520 |
. |
denotes |
. |
| T6430 |
3520-3755 |
sentence |
denotes |
At initial examination, a human movement disorder specialist (K. G.-H.) likened the disorder to episodic intermittent ataxia or kinesiogenic paroxysmal dystonia and predicted the involvement of an ion channel mutation in the etiology. |
| T6431 |
3521-3523 |
IN |
denotes |
At |
| T6432 |
3593-3600 |
VBD |
denotes |
likened |
| T6433 |
3524-3531 |
JJ |
denotes |
initial |
| T6434 |
3532-3543 |
NN |
denotes |
examination |
| T6435 |
3543-3545 |
, |
denotes |
, |
| T6437 |
3571-3581 |
NN |
denotes |
specialist |
| T6438 |
3547-3552 |
JJ |
denotes |
human |
| T6439 |
3562-3570 |
NN |
denotes |
disorder |
| T6440 |
3553-3561 |
NN |
denotes |
movement |
| T6441 |
3582-3583 |
-LRB- |
denotes |
( |
| T6442 |
3589-3591 |
NNP |
denotes |
H. |
| T6443 |
3583-3585 |
NNP |
denotes |
K. |
| T6444 |
3586-3588 |
NNP |
denotes |
G. |
| T6445 |
3588-3589 |
HYPH |
denotes |
- |
| T6446 |
3591-3592 |
-RRB- |
denotes |
) |
| T6447 |
3601-3604 |
DT |
denotes |
the |
| T6448 |
3605-3613 |
NN |
denotes |
disorder |
| T6449 |
3614-3616 |
IN |
denotes |
to |
| T6450 |
3617-3625 |
JJ |
denotes |
episodic |
| T6451 |
3639-3645 |
NN |
denotes |
ataxia |
| T6452 |
3626-3638 |
JJ |
denotes |
intermittent |
| T6453 |
3646-3648 |
CC |
denotes |
or |
| T6454 |
3649-3661 |
JJ |
denotes |
kinesiogenic |
| T6455 |
3673-3681 |
NN |
denotes |
dystonia |
| T6456 |
3662-3672 |
JJ |
denotes |
paroxysmal |
| T6457 |
3682-3685 |
CC |
denotes |
and |
| T6458 |
3686-3695 |
VBD |
denotes |
predicted |
| T6459 |
3696-3699 |
DT |
denotes |
the |
| T6460 |
3700-3711 |
NN |
denotes |
involvement |
| T6461 |
3712-3714 |
IN |
denotes |
of |
| T6462 |
3715-3717 |
DT |
denotes |
an |
| T6463 |
3730-3738 |
NN |
denotes |
mutation |
| T6464 |
3718-3721 |
NN |
denotes |
ion |
| T6465 |
3722-3729 |
NN |
denotes |
channel |
| T6466 |
3739-3741 |
IN |
denotes |
in |
| T6467 |
3742-3745 |
DT |
denotes |
the |
| T6468 |
3746-3754 |
NN |
denotes |
etiology |
| T6469 |
3754-3755 |
. |
denotes |
. |
| T6470 |
3755-3881 |
sentence |
denotes |
Affected mice presented at approximately postnatal day 14, and survival time without weaning was on average 4 wk after onset. |
| T6471 |
3756-3764 |
VBN |
denotes |
Affected |
| T6472 |
3765-3769 |
NNS |
denotes |
mice |
| T6473 |
3770-3779 |
VBD |
denotes |
presented |
| T6474 |
3780-3782 |
IN |
denotes |
at |
| T6475 |
3783-3796 |
RB |
denotes |
approximately |
| T6476 |
3807-3810 |
NN |
denotes |
day |
| T6477 |
3797-3806 |
JJ |
denotes |
postnatal |
| T6478 |
3811-3813 |
CD |
denotes |
14 |
| T6479 |
3813-3815 |
, |
denotes |
, |
| T6480 |
3815-3818 |
CC |
denotes |
and |
| T6481 |
3819-3827 |
NN |
denotes |
survival |
| T6482 |
3828-3832 |
NN |
denotes |
time |
| T6483 |
3849-3852 |
VBD |
denotes |
was |
| T6484 |
3833-3840 |
IN |
denotes |
without |
| T6485 |
3841-3848 |
NN |
denotes |
weaning |
| T6486 |
3853-3855 |
IN |
denotes |
on |
| T6487 |
3856-3863 |
JJ |
denotes |
average |
| T6488 |
3864-3865 |
CD |
denotes |
4 |
| T6489 |
3866-3868 |
NN |
denotes |
wk |
| T6490 |
3869-3874 |
IN |
denotes |
after |
| T6491 |
3875-3880 |
NN |
denotes |
onset |
| T6492 |
3880-3881 |
. |
denotes |
. |
| T6493 |
3881-3987 |
sentence |
denotes |
Breeding experiments suggested that the observed disorder was inherited in an autosomal recessive manner. |
| T6494 |
3882-3890 |
NN |
denotes |
Breeding |
| T6495 |
3891-3902 |
NNS |
denotes |
experiments |
| T6496 |
3903-3912 |
VBD |
denotes |
suggested |
| T6497 |
3913-3917 |
IN |
denotes |
that |
| T6498 |
3944-3953 |
VBN |
denotes |
inherited |
| T6499 |
3918-3921 |
DT |
denotes |
the |
| T6500 |
3931-3939 |
NN |
denotes |
disorder |
| T6501 |
3922-3930 |
VBN |
denotes |
observed |
| T6502 |
3940-3943 |
VBD |
denotes |
was |
| T6503 |
3954-3956 |
IN |
denotes |
in |
| T6504 |
3957-3959 |
DT |
denotes |
an |
| T6505 |
3980-3986 |
NN |
denotes |
manner |
| T6506 |
3960-3969 |
JJ |
denotes |
autosomal |
| T6507 |
3970-3979 |
JJ |
denotes |
recessive |
| T6508 |
3986-3987 |
. |
denotes |
. |
| T6509 |
3987-4178 |
sentence |
denotes |
To map the location of the disease-causing lesion, we performed genome-wide linkage analysis using strain-specific single nucleotide polymorphisms (SNPs) at 120 loci across the mouse genome. |
| T6510 |
3988-3990 |
TO |
denotes |
To |
| T6511 |
3991-3994 |
VB |
denotes |
map |
| T6512 |
4042-4051 |
VBD |
denotes |
performed |
| T6513 |
3995-3998 |
DT |
denotes |
the |
| T6514 |
3999-4007 |
NN |
denotes |
location |
| T6515 |
4008-4010 |
IN |
denotes |
of |
| T6516 |
4011-4014 |
DT |
denotes |
the |
| T6517 |
4031-4037 |
NN |
denotes |
lesion |
| T6518 |
4015-4022 |
NN |
denotes |
disease |
| T6519 |
4023-4030 |
VBG |
denotes |
causing |
| T6520 |
4022-4023 |
HYPH |
denotes |
- |
| T6521 |
4037-4039 |
, |
denotes |
, |
| T6522 |
4039-4041 |
PRP |
denotes |
we |
| T6523 |
4052-4058 |
NN |
denotes |
genome |
| T6524 |
4059-4063 |
JJ |
denotes |
wide |
| T6525 |
4058-4059 |
HYPH |
denotes |
- |
| T6526 |
4072-4080 |
NN |
denotes |
analysis |
| T6527 |
4064-4071 |
NN |
denotes |
linkage |
| T6528 |
4081-4086 |
VBG |
denotes |
using |
| T6529 |
4087-4093 |
NN |
denotes |
strain |
| T6530 |
4094-4102 |
JJ |
denotes |
specific |
| T6531 |
4093-4094 |
HYPH |
denotes |
- |
| T6532 |
4121-4134 |
NNS |
denotes |
polymorphisms |
| T6533 |
4103-4109 |
JJ |
denotes |
single |
| T6534 |
4110-4120 |
NN |
denotes |
nucleotide |
| T6535 |
4135-4136 |
-LRB- |
denotes |
( |
| T6536 |
4136-4140 |
NNS |
denotes |
SNPs |
| T6537 |
4140-4141 |
-RRB- |
denotes |
) |
| T6538 |
4142-4144 |
IN |
denotes |
at |
| T6539 |
4145-4148 |
CD |
denotes |
120 |
| T6540 |
4149-4153 |
NNS |
denotes |
loci |
| T6541 |
4154-4160 |
IN |
denotes |
across |
| T6542 |
4161-4164 |
DT |
denotes |
the |
| T6545 |
4177-4178 |
. |
denotes |
. |
| T6546 |
4178-4354 |
sentence |
denotes |
Analysis of these data showed a single genomic region with significant linkage to disease, providing a two-point LOD score of 5.13 at marker 20.MMHAP85FLG2 on Chromosome 6qE1. |
| T6547 |
4179-4187 |
NN |
denotes |
Analysis |
| T6548 |
4202-4208 |
VBD |
denotes |
showed |
| T6549 |
4188-4190 |
IN |
denotes |
of |
| T6550 |
4191-4196 |
DT |
denotes |
these |
| T6551 |
4197-4201 |
NNS |
denotes |
data |
| T6552 |
4209-4210 |
DT |
denotes |
a |
| T6553 |
4226-4232 |
NN |
denotes |
region |
| T6554 |
4211-4217 |
JJ |
denotes |
single |
| T6555 |
4218-4225 |
JJ |
denotes |
genomic |
| T6556 |
4233-4237 |
IN |
denotes |
with |
| T6557 |
4238-4249 |
JJ |
denotes |
significant |
| T6558 |
4250-4257 |
NN |
denotes |
linkage |
| T6559 |
4258-4260 |
IN |
denotes |
to |
| T6560 |
4261-4268 |
NN |
denotes |
disease |
| T6561 |
4268-4270 |
, |
denotes |
, |
| T6562 |
4270-4279 |
VBG |
denotes |
providing |
| T6563 |
4280-4281 |
DT |
denotes |
a |
| T6564 |
4296-4301 |
NN |
denotes |
score |
| T6565 |
4282-4285 |
CD |
denotes |
two |
| T6566 |
4286-4291 |
NN |
denotes |
point |
| T6567 |
4285-4286 |
HYPH |
denotes |
- |
| T6568 |
4292-4295 |
NN |
denotes |
LOD |
| T6569 |
4302-4304 |
IN |
denotes |
of |
| T6570 |
4305-4309 |
CD |
denotes |
5.13 |
| T6571 |
4310-4312 |
IN |
denotes |
at |
| T6572 |
4313-4319 |
NN |
denotes |
marker |
| T6573 |
4320-4334 |
NN |
denotes |
20.MMHAP85FLG2 |
| T6574 |
4335-4337 |
IN |
denotes |
on |
| T6575 |
4338-4348 |
NN |
denotes |
Chromosome |
| T6576 |
4349-4353 |
NN |
denotes |
6qE1 |
| T6577 |
4353-4354 |
. |
denotes |
. |
| T6578 |
4354-4452 |
sentence |
denotes |
The linked haplotype suggested the mutation had occurred on the 129x1/SvJ background (Figure S1). |
| T6579 |
4355-4358 |
DT |
denotes |
The |
| T6580 |
4366-4375 |
NN |
denotes |
haplotype |
| T6581 |
4359-4365 |
VBN |
denotes |
linked |
| T6582 |
4376-4385 |
VBD |
denotes |
suggested |
| T6583 |
4386-4389 |
DT |
denotes |
the |
| T6584 |
4390-4398 |
NN |
denotes |
mutation |
| T6585 |
4403-4411 |
VBN |
denotes |
occurred |
| T6586 |
4399-4402 |
VBD |
denotes |
had |
| T6587 |
4412-4414 |
IN |
denotes |
on |
| T6588 |
4415-4418 |
DT |
denotes |
the |
| T6589 |
4429-4439 |
NN |
denotes |
background |
| T6590 |
4419-4424 |
NN |
denotes |
129x1 |
| T6591 |
4425-4428 |
NN |
denotes |
SvJ |
| T6592 |
4424-4425 |
HYPH |
denotes |
/ |
| T6593 |
4440-4441 |
-LRB- |
denotes |
( |
| T6594 |
4448-4450 |
NN |
denotes |
S1 |
| T6595 |
4441-4447 |
NN |
denotes |
Figure |
| T6596 |
4450-4451 |
-RRB- |
denotes |
) |
| T6597 |
4451-4452 |
. |
denotes |
. |
| T6598 |
4452-4626 |
sentence |
denotes |
Literature searches revealed that among disease lines mapped to 6qE1, the spontaneous mutant opt mouse displays a strikingly similar presentation to that described here [1]. |
| T6599 |
4453-4463 |
NN |
denotes |
Literature |
| T6600 |
4464-4472 |
NNS |
denotes |
searches |
| T6601 |
4473-4481 |
VBD |
denotes |
revealed |
| T6602 |
4482-4486 |
IN |
denotes |
that |
| T6603 |
4556-4564 |
VBZ |
denotes |
displays |
| T6604 |
4487-4492 |
IN |
denotes |
among |
| T6605 |
4493-4500 |
NN |
denotes |
disease |
| T6606 |
4501-4506 |
NNS |
denotes |
lines |
| T6607 |
4507-4513 |
VBN |
denotes |
mapped |
| T6608 |
4514-4516 |
IN |
denotes |
to |
| T6609 |
4517-4521 |
NN |
denotes |
6qE1 |
| T6610 |
4521-4523 |
, |
denotes |
, |
| T6611 |
4523-4526 |
DT |
denotes |
the |
| T6612 |
4539-4545 |
NN |
denotes |
mutant |
| T6613 |
4527-4538 |
JJ |
denotes |
spontaneous |
| T6614 |
4546-4549 |
NN |
denotes |
opt |
| T6615 |
4550-4555 |
NN |
denotes |
mouse |
| T6616 |
4565-4566 |
DT |
denotes |
a |
| T6617 |
4586-4598 |
NN |
denotes |
presentation |
| T6618 |
4567-4577 |
RB |
denotes |
strikingly |
| T6619 |
4578-4585 |
JJ |
denotes |
similar |
| T6620 |
4599-4601 |
IN |
denotes |
to |
| T6621 |
4602-4606 |
DT |
denotes |
that |
| T6622 |
4607-4616 |
VBN |
denotes |
described |
| T6623 |
4617-4621 |
RB |
denotes |
here |
| T6624 |
4622-4623 |
-LRB- |
denotes |
[ |
| T6625 |
4623-4624 |
CD |
denotes |
1 |
| T6626 |
4624-4625 |
-RRB- |
denotes |
] |
| T6627 |
4625-4626 |
. |
denotes |
. |
| T6628 |
4626-4827 |
sentence |
denotes |
The underlying genetic lesion causing the opt phenotype is a homozygous in-frame deletion of exons 43 and 44 of the gene Itpr1 (Itpr1opt /opt), encoding inositol 1,4,5-triphosphate receptor 1 (Itpr1). |
| T6629 |
4627-4630 |
DT |
denotes |
The |
| T6630 |
4650-4656 |
NN |
denotes |
lesion |
| T6631 |
4631-4641 |
VBG |
denotes |
underlying |
| T6632 |
4642-4649 |
JJ |
denotes |
genetic |
| T6633 |
4683-4685 |
VBZ |
denotes |
is |
| T6634 |
4657-4664 |
VBG |
denotes |
causing |
| T6635 |
4665-4668 |
DT |
denotes |
the |
| T6636 |
4673-4682 |
NN |
denotes |
phenotype |
| T6637 |
4669-4672 |
NN |
denotes |
opt |
| T6638 |
4686-4687 |
DT |
denotes |
a |
| T6639 |
4708-4716 |
NN |
denotes |
deletion |
| T6640 |
4688-4698 |
JJ |
denotes |
homozygous |
| T6641 |
4699-4701 |
IN |
denotes |
in |
| T6642 |
4702-4707 |
NN |
denotes |
frame |
| T6643 |
4701-4702 |
HYPH |
denotes |
- |
| T6644 |
4717-4719 |
IN |
denotes |
of |
| T6645 |
4720-4725 |
NNS |
denotes |
exons |
| T6646 |
4726-4728 |
CD |
denotes |
43 |
| T6647 |
4729-4732 |
CC |
denotes |
and |
| T6648 |
4733-4735 |
CD |
denotes |
44 |
| T6649 |
4736-4738 |
IN |
denotes |
of |
| T6650 |
4739-4742 |
DT |
denotes |
the |
| T6651 |
4748-4753 |
NN |
denotes |
Itpr1 |
| T6652 |
4743-4747 |
NN |
denotes |
gene |
| T6653 |
4754-4755 |
-LRB- |
denotes |
( |
| T6654 |
4765-4768 |
NN |
denotes |
opt |
| T6655 |
4755-4763 |
NN |
denotes |
Itpr1opt |
| T6656 |
4764-4765 |
HYPH |
denotes |
/ |
| T6657 |
4768-4769 |
-RRB- |
denotes |
) |
| T6658 |
4769-4771 |
, |
denotes |
, |
| T6659 |
4771-4779 |
VBG |
denotes |
encoding |
| T6660 |
4780-4788 |
NN |
denotes |
inositol |
| T6661 |
4808-4816 |
NN |
denotes |
receptor |
| T6662 |
4789-4790 |
CD |
denotes |
1 |
| T6663 |
4793-4794 |
CD |
denotes |
5 |
| T6664 |
4790-4791 |
, |
denotes |
, |
| T6665 |
4791-4792 |
CD |
denotes |
4 |
| T6666 |
4792-4793 |
, |
denotes |
, |
| T6667 |
4795-4807 |
NN |
denotes |
triphosphate |
| T6668 |
4794-4795 |
HYPH |
denotes |
- |
| T6669 |
4817-4818 |
CD |
denotes |
1 |
| T6670 |
4819-4820 |
-LRB- |
denotes |
( |
| T6671 |
4820-4825 |
NN |
denotes |
Itpr1 |
| T6672 |
4825-4826 |
-RRB- |
denotes |
) |
| T6673 |
4826-4827 |
. |
denotes |
. |
| T6674 |
4827-5034 |
sentence |
denotes |
Sequencing of all exons and intron–exon boundaries of Itpr1 in affected mice from the current study revealed a single mutation within Itpr1: a novel in-frame deletion of 18 bp within exon 36 (Itpr1Δ18/Δ18). |
| T6675 |
4828-4838 |
NN |
denotes |
Sequencing |
| T6676 |
4928-4936 |
VBD |
denotes |
revealed |
| T6677 |
4839-4841 |
IN |
denotes |
of |
| T6678 |
4842-4845 |
DT |
denotes |
all |
| T6679 |
4846-4851 |
NNS |
denotes |
exons |
| T6680 |
4852-4855 |
CC |
denotes |
and |
| T6681 |
4856-4862 |
NN |
denotes |
intron |
| T6682 |
4863-4867 |
NN |
denotes |
exon |
| T6683 |
4862-4863 |
HYPH |
denotes |
– |
| T6684 |
4868-4878 |
NNS |
denotes |
boundaries |
| T6685 |
4879-4881 |
IN |
denotes |
of |
| T6686 |
4882-4887 |
NN |
denotes |
Itpr1 |
| T6687 |
4888-4890 |
IN |
denotes |
in |
| T6688 |
4891-4899 |
VBN |
denotes |
affected |
| T6689 |
4900-4904 |
NNS |
denotes |
mice |
| T6690 |
4905-4909 |
IN |
denotes |
from |
| T6691 |
4910-4913 |
DT |
denotes |
the |
| T6692 |
4922-4927 |
NN |
denotes |
study |
| T6693 |
4914-4921 |
JJ |
denotes |
current |
| T6694 |
4937-4938 |
DT |
denotes |
a |
| T6695 |
4946-4954 |
NN |
denotes |
mutation |
| T6696 |
4939-4945 |
JJ |
denotes |
single |
| T6697 |
4955-4961 |
IN |
denotes |
within |
| T6698 |
4962-4967 |
NN |
denotes |
Itpr1 |
| T6699 |
4967-4969 |
: |
denotes |
: |
| T6700 |
4969-4970 |
DT |
denotes |
a |
| T6701 |
4986-4994 |
NN |
denotes |
deletion |
| T6702 |
4971-4976 |
JJ |
denotes |
novel |
| T6703 |
4977-4979 |
IN |
denotes |
in |
| T6704 |
4979-4980 |
HYPH |
denotes |
- |
| T6705 |
4980-4985 |
NN |
denotes |
frame |
| T6706 |
4995-4997 |
IN |
denotes |
of |
| T6707 |
4998-5000 |
CD |
denotes |
18 |
| T6708 |
5001-5003 |
NN |
denotes |
bp |
| T6709 |
5004-5010 |
IN |
denotes |
within |
| T6710 |
5011-5015 |
NN |
denotes |
exon |
| T6711 |
5016-5018 |
CD |
denotes |
36 |
| T6712 |
5019-5020 |
-LRB- |
denotes |
( |
| T6713 |
5029-5032 |
NN |
denotes |
Δ18 |
| T6714 |
5020-5028 |
NN |
denotes |
Itpr1Δ18 |
| T6715 |
5028-5029 |
HYPH |
denotes |
/ |
| T6716 |
5032-5033 |
-RRB- |
denotes |
) |
| T6717 |
5033-5034 |
. |
denotes |
. |
| T6718 |
5034-5205 |
sentence |
denotes |
To confirm the pathogenicity of this mutation we crossed heterozygous mice from the current study (Itpr1wt/Δ18) with mice heterozygous for the opt mutation (Itpr1wt/opt). |
| T6719 |
5035-5037 |
TO |
denotes |
To |
| T6720 |
5038-5045 |
VB |
denotes |
confirm |
| T6721 |
5084-5091 |
VBD |
denotes |
crossed |
| T6722 |
5046-5049 |
DT |
denotes |
the |
| T6723 |
5050-5063 |
NN |
denotes |
pathogenicity |
| T6724 |
5064-5066 |
IN |
denotes |
of |
| T6725 |
5067-5071 |
DT |
denotes |
this |
| T6726 |
5072-5080 |
NN |
denotes |
mutation |
| T6727 |
5081-5083 |
PRP |
denotes |
we |
| T6728 |
5092-5104 |
JJ |
denotes |
heterozygous |
| T6729 |
5105-5109 |
NNS |
denotes |
mice |
| T6730 |
5110-5114 |
IN |
denotes |
from |
| T6731 |
5115-5118 |
DT |
denotes |
the |
| T6732 |
5127-5132 |
NN |
denotes |
study |
| T6733 |
5119-5126 |
JJ |
denotes |
current |
| T6734 |
5133-5134 |
-LRB- |
denotes |
( |
| T6735 |
5142-5145 |
NN |
denotes |
Δ18 |
| T6736 |
5134-5141 |
NN |
denotes |
Itpr1wt |
| T6737 |
5141-5142 |
HYPH |
denotes |
/ |
| T6738 |
5145-5146 |
-RRB- |
denotes |
) |
| T6739 |
5147-5151 |
IN |
denotes |
with |
| T6740 |
5152-5156 |
NNS |
denotes |
mice |
| T6741 |
5157-5169 |
JJ |
denotes |
heterozygous |
| T6742 |
5170-5173 |
IN |
denotes |
for |
| T6743 |
5174-5177 |
DT |
denotes |
the |
| T6744 |
5182-5190 |
NN |
denotes |
mutation |
| T6745 |
5178-5181 |
NN |
denotes |
opt |
| T6746 |
5191-5192 |
-LRB- |
denotes |
( |
| T6747 |
5200-5203 |
NN |
denotes |
opt |
| T6748 |
5192-5199 |
NN |
denotes |
Itpr1wt |
| T6749 |
5199-5200 |
HYPH |
denotes |
/ |
| T6750 |
5203-5204 |
-RRB- |
denotes |
) |
| T6751 |
5204-5205 |
. |
denotes |
. |
| T6752 |
5205-5404 |
sentence |
denotes |
This resulted in two litters of mice with a total of four affected Itpr1opt/Δ18 pups (from a total of 15) with a phenotype indistinguishable from that of the Itpr1Δ18/Δ18 and Itpr1opt /opt mice [1]. |
| T6753 |
5206-5210 |
DT |
denotes |
This |
| T6754 |
5211-5219 |
VBD |
denotes |
resulted |
| T6755 |
5220-5222 |
IN |
denotes |
in |
| T6756 |
5223-5226 |
CD |
denotes |
two |
| T6757 |
5227-5234 |
NNS |
denotes |
litters |
| T6758 |
5235-5237 |
IN |
denotes |
of |
| T6759 |
5238-5242 |
NNS |
denotes |
mice |
| T6760 |
5243-5247 |
IN |
denotes |
with |
| T6761 |
5248-5249 |
DT |
denotes |
a |
| T6762 |
5250-5255 |
NN |
denotes |
total |
| T6763 |
5256-5258 |
IN |
denotes |
of |
| T6764 |
5259-5263 |
CD |
denotes |
four |
| T6765 |
5286-5290 |
NNS |
denotes |
pups |
| T6766 |
5264-5272 |
VBN |
denotes |
affected |
| T6767 |
5273-5281 |
NN |
denotes |
Itpr1opt |
| T6768 |
5282-5285 |
NN |
denotes |
Δ18 |
| T6769 |
5281-5282 |
HYPH |
denotes |
/ |
| T6770 |
5291-5292 |
-LRB- |
denotes |
( |
| T6771 |
5292-5296 |
IN |
denotes |
from |
| T6772 |
5297-5298 |
DT |
denotes |
a |
| T6773 |
5299-5304 |
NN |
denotes |
total |
| T6774 |
5305-5307 |
IN |
denotes |
of |
| T6775 |
5308-5310 |
CD |
denotes |
15 |
| T6776 |
5310-5311 |
-RRB- |
denotes |
) |
| T6777 |
5312-5316 |
IN |
denotes |
with |
| T6778 |
5317-5318 |
DT |
denotes |
a |
| T6779 |
5319-5328 |
NN |
denotes |
phenotype |
| T6780 |
5329-5346 |
JJ |
denotes |
indistinguishable |
| T6781 |
5347-5351 |
IN |
denotes |
from |
| T6782 |
5352-5356 |
DT |
denotes |
that |
| T6783 |
5357-5359 |
IN |
denotes |
of |
| T6784 |
5360-5363 |
DT |
denotes |
the |
| T6785 |
5395-5399 |
NNS |
denotes |
mice |
| T6786 |
5364-5372 |
NN |
denotes |
Itpr1Δ18 |
| T6787 |
5373-5376 |
NN |
denotes |
Δ18 |
| T6788 |
5372-5373 |
HYPH |
denotes |
/ |
| T6789 |
5377-5380 |
CC |
denotes |
and |
| T6790 |
5381-5389 |
NN |
denotes |
Itpr1opt |
| T6791 |
5391-5394 |
NN |
denotes |
opt |
| T6792 |
5390-5391 |
HYPH |
denotes |
/ |
| T6793 |
5400-5401 |
-LRB- |
denotes |
[ |
| T6794 |
5401-5402 |
CD |
denotes |
1 |
| T6795 |
5402-5403 |
-RRB- |
denotes |
] |
| T6796 |
5403-5404 |
. |
denotes |
. |
| T6797 |
5404-5589 |
sentence |
denotes |
Furthermore, this phenotype was similar, although less severe, to that described in a mouse line with targeted deletion of Itpr1, where ataxia was described as a prominent feature [4]. |
| T6798 |
5405-5416 |
RB |
denotes |
Furthermore |
| T6799 |
5433-5436 |
VBD |
denotes |
was |
| T6800 |
5416-5418 |
, |
denotes |
, |
| T6801 |
5418-5422 |
DT |
denotes |
this |
| T6802 |
5423-5432 |
NN |
denotes |
phenotype |
| T6803 |
5437-5444 |
JJ |
denotes |
similar |
| T6804 |
5444-5446 |
, |
denotes |
, |
| T6805 |
5446-5454 |
IN |
denotes |
although |
| T6806 |
5460-5466 |
JJ |
denotes |
severe |
| T6807 |
5455-5459 |
RBR |
denotes |
less |
| T6808 |
5466-5468 |
, |
denotes |
, |
| T6809 |
5468-5470 |
IN |
denotes |
to |
| T6810 |
5471-5475 |
DT |
denotes |
that |
| T6811 |
5476-5485 |
VBN |
denotes |
described |
| T6812 |
5486-5488 |
IN |
denotes |
in |
| T6813 |
5489-5490 |
DT |
denotes |
a |
| T6814 |
5497-5501 |
NN |
denotes |
line |
| T6815 |
5491-5496 |
NN |
denotes |
mouse |
| T6816 |
5502-5506 |
IN |
denotes |
with |
| T6817 |
5507-5515 |
VBN |
denotes |
targeted |
| T6818 |
5516-5524 |
NN |
denotes |
deletion |
| T6819 |
5525-5527 |
IN |
denotes |
of |
| T6820 |
5528-5533 |
NN |
denotes |
Itpr1 |
| T6821 |
5533-5535 |
, |
denotes |
, |
| T6822 |
5535-5540 |
WRB |
denotes |
where |
| T6823 |
5552-5561 |
VBN |
denotes |
described |
| T6824 |
5541-5547 |
NN |
denotes |
ataxia |
| T6825 |
5548-5551 |
VBD |
denotes |
was |
| T6826 |
5562-5564 |
IN |
denotes |
as |
| T6827 |
5565-5566 |
DT |
denotes |
a |
| T6828 |
5577-5584 |
NN |
denotes |
feature |
| T6829 |
5567-5576 |
JJ |
denotes |
prominent |
| T6830 |
5585-5586 |
-LRB- |
denotes |
[ |
| T6831 |
5586-5587 |
CD |
denotes |
4 |
| T6832 |
5587-5588 |
-RRB- |
denotes |
] |
| T6833 |
5588-5589 |
. |
denotes |
. |
| T6834 |
5589-5850 |
sentence |
denotes |
As with the Itpr1opt /opt mice, where the deletion of exons 43 and 44 is also predicted to leave the translational reading frame unaffected, the in-frame Itpr1Δ18/Δ18 deletion mutation results in markedly decreased levels of Itpr1 in cerebellar Purkinje cells. |
| T6835 |
5590-5592 |
IN |
denotes |
As |
| T6836 |
5775-5782 |
VBZ |
denotes |
results |
| T6837 |
5593-5597 |
IN |
denotes |
with |
| T6838 |
5598-5601 |
DT |
denotes |
the |
| T6839 |
5616-5620 |
NNS |
denotes |
mice |
| T6840 |
5602-5610 |
NN |
denotes |
Itpr1opt |
| T6841 |
5612-5615 |
NN |
denotes |
opt |
| T6842 |
5611-5612 |
HYPH |
denotes |
/ |
| T6843 |
5620-5622 |
, |
denotes |
, |
| T6844 |
5622-5627 |
WRB |
denotes |
where |
| T6845 |
5668-5677 |
VBN |
denotes |
predicted |
| T6846 |
5628-5631 |
DT |
denotes |
the |
| T6847 |
5632-5640 |
NN |
denotes |
deletion |
| T6848 |
5641-5643 |
IN |
denotes |
of |
| T6849 |
5644-5649 |
NNS |
denotes |
exons |
| T6850 |
5650-5652 |
CD |
denotes |
43 |
| T6851 |
5653-5656 |
CC |
denotes |
and |
| T6852 |
5657-5659 |
CD |
denotes |
44 |
| T6853 |
5660-5662 |
VBZ |
denotes |
is |
| T6854 |
5663-5667 |
RB |
denotes |
also |
| T6855 |
5678-5680 |
TO |
denotes |
to |
| T6856 |
5681-5686 |
VB |
denotes |
leave |
| T6857 |
5687-5690 |
DT |
denotes |
the |
| T6858 |
5713-5718 |
NN |
denotes |
frame |
| T6859 |
5691-5704 |
JJ |
denotes |
translational |
| T6860 |
5705-5712 |
NN |
denotes |
reading |
| T6861 |
5719-5729 |
JJ |
denotes |
unaffected |
| T6862 |
5729-5731 |
, |
denotes |
, |
| T6863 |
5731-5734 |
DT |
denotes |
the |
| T6864 |
5766-5774 |
NN |
denotes |
mutation |
| T6865 |
5735-5737 |
IN |
denotes |
in |
| T6866 |
5737-5738 |
HYPH |
denotes |
- |
| T6867 |
5738-5743 |
NN |
denotes |
frame |
| T6868 |
5744-5752 |
NN |
denotes |
Itpr1Δ18 |
| T6869 |
5753-5756 |
NN |
denotes |
Δ18 |
| T6870 |
5752-5753 |
HYPH |
denotes |
/ |
| T6871 |
5757-5765 |
NN |
denotes |
deletion |
| T6872 |
5783-5785 |
IN |
denotes |
in |
| T6873 |
5786-5794 |
RB |
denotes |
markedly |
| T6874 |
5795-5804 |
VBN |
denotes |
decreased |
| T6875 |
5805-5811 |
NNS |
denotes |
levels |
| T6876 |
5812-5814 |
IN |
denotes |
of |
| T6877 |
5815-5820 |
NN |
denotes |
Itpr1 |
| T6878 |
5821-5823 |
IN |
denotes |
in |
| T6879 |
5824-5834 |
JJ |
denotes |
cerebellar |
| T6880 |
5844-5849 |
NNS |
denotes |
cells |
| T6881 |
5835-5843 |
NNP |
denotes |
Purkinje |
| T6882 |
5849-5850 |
. |
denotes |
. |
| T6883 |
5850-6058 |
sentence |
denotes |
In these two spontaneous mutants [1] and in the Itpr1-deficient mouse [4] generated by gene targeting, decreased Itpr1 expression is associated with the same autosomal recessive movement disorder (Figure 1). |
| T6884 |
5851-5853 |
IN |
denotes |
In |
| T6885 |
5984-5994 |
VBN |
denotes |
associated |
| T6886 |
5854-5859 |
DT |
denotes |
these |
| T6887 |
5876-5883 |
NNS |
denotes |
mutants |
| T6888 |
5860-5863 |
CD |
denotes |
two |
| T6889 |
5864-5875 |
JJ |
denotes |
spontaneous |
| T6890 |
5884-5885 |
-LRB- |
denotes |
[ |
| T6891 |
5885-5886 |
CD |
denotes |
1 |
| T6892 |
5886-5887 |
-RRB- |
denotes |
] |
| T6893 |
5888-5891 |
CC |
denotes |
and |
| T6894 |
5892-5894 |
IN |
denotes |
in |
| T6895 |
5895-5898 |
DT |
denotes |
the |
| T6896 |
5915-5920 |
NN |
denotes |
mouse |
| T6897 |
5899-5904 |
NN |
denotes |
Itpr1 |
| T6898 |
5905-5914 |
JJ |
denotes |
deficient |
| T6899 |
5904-5905 |
HYPH |
denotes |
- |
| T6900 |
5921-5922 |
-LRB- |
denotes |
[ |
| T6901 |
5922-5923 |
CD |
denotes |
4 |
| T6902 |
5923-5924 |
-RRB- |
denotes |
] |
| T6903 |
5925-5934 |
VBN |
denotes |
generated |
| T6904 |
5935-5937 |
IN |
denotes |
by |
| T6905 |
5938-5942 |
NN |
denotes |
gene |
| T6906 |
5943-5952 |
NN |
denotes |
targeting |
| T6907 |
5952-5954 |
, |
denotes |
, |
| T6908 |
5954-5963 |
VBN |
denotes |
decreased |
| T6909 |
5970-5980 |
NN |
denotes |
expression |
| T6910 |
5964-5969 |
NN |
denotes |
Itpr1 |
| T6911 |
5981-5983 |
VBZ |
denotes |
is |
| T6912 |
5995-5999 |
IN |
denotes |
with |
| T6913 |
6000-6003 |
DT |
denotes |
the |
| T6914 |
6038-6046 |
NN |
denotes |
disorder |
| T6915 |
6004-6008 |
JJ |
denotes |
same |
| T6916 |
6009-6018 |
JJ |
denotes |
autosomal |
| T6917 |
6019-6028 |
JJ |
denotes |
recessive |
| T6918 |
6029-6037 |
NN |
denotes |
movement |
| T6919 |
6047-6048 |
-LRB- |
denotes |
( |
| T6920 |
6048-6054 |
NN |
denotes |
Figure |
| T6921 |
6055-6056 |
CD |
denotes |
1 |
| T6922 |
6056-6057 |
-RRB- |
denotes |
) |
| T6923 |
6057-6058 |
. |
denotes |
. |
| T6924 |
6058-7247 |
sentence |
denotes |
Figure 1 Immunohistochemistry and Western Blot Analysis of ITPR1 Protein Levels in Mouse Cerebellum
(A–F) Immunohistochemistry of cerebellum from a wild-type mouse (A and D), a mouse heterozygous for the Itpr1 18-bp deletion (B and E), and a mouse homozygous for the 18-bp Itpr1 deletion (C and F). (A–C) Immunohistochemistry using polyclonal Itpr1 anti-rabbit antibody (1:2,000; Alexa Fluor 555); (D–F) immunohistochemistry using monoclonal Calb1 anti-mouse antibody (1:6,000; Alexa Fluor 488). Scale bars denote 100 μm. As previously described, Iptr1 is highly expressed in the Purkinje cells. Notably, there appears to be decreased immunoreactivity to Itpr1 in the heterozygous and homozygous mutant mice.
(G) Western blot performed to examine Itpr1 levels in whole brain from wild-type, Itpr1wt/Δ18, and Itpr1Δ18/Δ18 mice; this clearly shows a reduction of Itpr1 in brain tissue from Itpr1wt/Δ18 mice and a greater reduction of Itpr1 in Itpr1Δ18/Δ18 mice. Given our interest in human neurological disease we sought to identify any cognate human disorders where linkage had been established to the syntenic region of the human genome, but where no causal mutation had been identified. |
| T6925 |
7020-7025 |
VBN |
denotes |
Given |
| T6926 |
7072-7078 |
VBD |
denotes |
sought |
| T6927 |
7026-7029 |
PRP$ |
denotes |
our |
| T6928 |
7030-7038 |
NN |
denotes |
interest |
| T6929 |
7039-7041 |
IN |
denotes |
in |
| T6930 |
7042-7047 |
JJ |
denotes |
human |
| T6931 |
7061-7068 |
NN |
denotes |
disease |
| T6932 |
7048-7060 |
JJ |
denotes |
neurological |
| T6933 |
7069-7071 |
PRP |
denotes |
we |
| T6934 |
7079-7081 |
TO |
denotes |
to |
| T6935 |
7082-7090 |
VB |
denotes |
identify |
| T6936 |
7091-7094 |
DT |
denotes |
any |
| T6937 |
7109-7118 |
NNS |
denotes |
disorders |
| T6938 |
7095-7102 |
JJ |
denotes |
cognate |
| T6939 |
7103-7108 |
JJ |
denotes |
human |
| T6940 |
7119-7124 |
WRB |
denotes |
where |
| T6941 |
7142-7153 |
VBN |
denotes |
established |
| T6942 |
7125-7132 |
NN |
denotes |
linkage |
| T6943 |
7133-7136 |
VBD |
denotes |
had |
| T6944 |
7137-7141 |
VBN |
denotes |
been |
| T6945 |
7154-7156 |
IN |
denotes |
to |
| T6946 |
7157-7160 |
DT |
denotes |
the |
| T6947 |
7170-7176 |
NN |
denotes |
region |
| T6948 |
7161-7169 |
JJ |
denotes |
syntenic |
| T6949 |
7177-7179 |
IN |
denotes |
of |
| T6950 |
7180-7183 |
DT |
denotes |
the |
| T6951 |
7190-7196 |
NN |
denotes |
genome |
| T6952 |
7184-7189 |
JJ |
denotes |
human |
| T6953 |
7196-7198 |
, |
denotes |
, |
| T6954 |
7198-7201 |
CC |
denotes |
but |
| T6955 |
7202-7207 |
WRB |
denotes |
where |
| T6956 |
7236-7246 |
VBN |
denotes |
identified |
| T6957 |
7208-7210 |
DT |
denotes |
no |
| T6958 |
7218-7226 |
NN |
denotes |
mutation |
| T6959 |
7211-7217 |
JJ |
denotes |
causal |
| T6960 |
7227-7230 |
VBD |
denotes |
had |
| T6961 |
7231-7235 |
VBN |
denotes |
been |
| T6962 |
7246-7247 |
. |
denotes |
. |
| T6963 |
7247-7336 |
sentence |
denotes |
SCA15, an adult-onset autosomal dominant progressive ataxia is linked to this locus [5]. |
| T6964 |
7248-7253 |
NN |
denotes |
SCA15 |
| T6965 |
7311-7317 |
VBN |
denotes |
linked |
| T6966 |
7253-7255 |
, |
denotes |
, |
| T6967 |
7255-7257 |
DT |
denotes |
an |
| T6968 |
7301-7307 |
NN |
denotes |
ataxia |
| T6969 |
7258-7263 |
JJ |
denotes |
adult |
| T6970 |
7264-7269 |
NN |
denotes |
onset |
| T6971 |
7263-7264 |
HYPH |
denotes |
- |
| T6972 |
7270-7279 |
JJ |
denotes |
autosomal |
| T6973 |
7280-7288 |
JJ |
denotes |
dominant |
| T6974 |
7289-7300 |
JJ |
denotes |
progressive |
| T6975 |
7308-7310 |
VBZ |
denotes |
is |
| T6976 |
7318-7320 |
IN |
denotes |
to |
| T6977 |
7321-7325 |
DT |
denotes |
this |
| T6978 |
7326-7331 |
NN |
denotes |
locus |
| T6979 |
7332-7333 |
-LRB- |
denotes |
[ |
| T6980 |
7333-7334 |
CD |
denotes |
5 |
| T6981 |
7334-7335 |
-RRB- |
denotes |
] |
| T6982 |
7335-7336 |
. |
denotes |
. |
| T6983 |
7336-7617 |
sentence |
denotes |
Although missense mutation of ITPR1 had previously been ruled out [2] and the mode of inheritance was inconsistent with that seen in the Itpr1Δ18 and Itpr1opt mice, the phenotypic presence of ataxia in the mice led us to reexamine this candidate gene as a possible cause of SCA15. |
| T6984 |
7337-7345 |
IN |
denotes |
Although |
| T6985 |
7393-7398 |
VBN |
denotes |
ruled |
| T6986 |
7346-7354 |
NN |
denotes |
missense |
| T6987 |
7355-7363 |
NN |
denotes |
mutation |
| T6988 |
7364-7366 |
IN |
denotes |
of |
| T6989 |
7367-7372 |
NN |
denotes |
ITPR1 |
| T6990 |
7373-7376 |
VBD |
denotes |
had |
| T6991 |
7377-7387 |
RB |
denotes |
previously |
| T6992 |
7388-7392 |
VBN |
denotes |
been |
| T6993 |
7548-7551 |
VBD |
denotes |
led |
| T6994 |
7399-7402 |
RP |
denotes |
out |
| T6995 |
7403-7404 |
-LRB- |
denotes |
[ |
| T6996 |
7404-7405 |
CD |
denotes |
2 |
| T6997 |
7405-7406 |
-RRB- |
denotes |
] |
| T6998 |
7407-7410 |
CC |
denotes |
and |
| T6999 |
7411-7414 |
DT |
denotes |
the |
| T7000 |
7415-7419 |
NN |
denotes |
mode |
| T7001 |
7435-7438 |
VBD |
denotes |
was |
| T7002 |
7420-7422 |
IN |
denotes |
of |
| T7003 |
7423-7434 |
NN |
denotes |
inheritance |
| T7004 |
7439-7451 |
JJ |
denotes |
inconsistent |
| T7005 |
7452-7456 |
IN |
denotes |
with |
| T7006 |
7457-7461 |
DT |
denotes |
that |
| T7007 |
7462-7466 |
VBN |
denotes |
seen |
| T7008 |
7467-7469 |
IN |
denotes |
in |
| T7009 |
7470-7473 |
DT |
denotes |
the |
| T7010 |
7496-7500 |
NNS |
denotes |
mice |
| T7011 |
7474-7482 |
NN |
denotes |
Itpr1Δ18 |
| T7012 |
7483-7486 |
CC |
denotes |
and |
| T7013 |
7487-7495 |
NN |
denotes |
Itpr1opt |
| T7014 |
7500-7502 |
, |
denotes |
, |
| T7015 |
7502-7505 |
DT |
denotes |
the |
| T7016 |
7517-7525 |
NN |
denotes |
presence |
| T7017 |
7506-7516 |
JJ |
denotes |
phenotypic |
| T7018 |
7526-7528 |
IN |
denotes |
of |
| T7019 |
7529-7535 |
NN |
denotes |
ataxia |
| T7020 |
7536-7538 |
IN |
denotes |
in |
| T7021 |
7539-7542 |
DT |
denotes |
the |
| T7022 |
7543-7547 |
NNS |
denotes |
mice |
| T7023 |
7552-7554 |
PRP |
denotes |
us |
| T7024 |
7555-7557 |
TO |
denotes |
to |
| T7025 |
7558-7567 |
VB |
denotes |
reexamine |
| T7026 |
7568-7572 |
DT |
denotes |
this |
| T7027 |
7583-7587 |
NN |
denotes |
gene |
| T7028 |
7573-7582 |
NN |
denotes |
candidate |
| T7029 |
7588-7590 |
IN |
denotes |
as |
| T7030 |
7591-7592 |
DT |
denotes |
a |
| T7031 |
7602-7607 |
NN |
denotes |
cause |
| T7032 |
7593-7601 |
JJ |
denotes |
possible |
| T7033 |
7608-7610 |
IN |
denotes |
of |
| T7034 |
7611-7616 |
NN |
denotes |
SCA15 |
| T7035 |
7616-7617 |
. |
denotes |
. |
| T7036 |
7617-7837 |
sentence |
denotes |
We obtained genomic DNA from three affected family members and one family member with unknown disease status from the kindred originally used to define and map SCA15 (family AUS1, of Australian Anglo-Celtic origin) [2]. |
| T7037 |
7618-7620 |
PRP |
denotes |
We |
| T7038 |
7621-7629 |
VBD |
denotes |
obtained |
| T7039 |
7630-7637 |
JJ |
denotes |
genomic |
| T7040 |
7638-7641 |
NN |
denotes |
DNA |
| T7041 |
7642-7646 |
IN |
denotes |
from |
| T7042 |
7647-7652 |
CD |
denotes |
three |
| T7043 |
7669-7676 |
NNS |
denotes |
members |
| T7044 |
7653-7661 |
VBN |
denotes |
affected |
| T7045 |
7662-7668 |
NN |
denotes |
family |
| T7046 |
7677-7680 |
CC |
denotes |
and |
| T7047 |
7681-7684 |
CD |
denotes |
one |
| T7048 |
7692-7698 |
NN |
denotes |
member |
| T7049 |
7685-7691 |
NN |
denotes |
family |
| T7050 |
7699-7703 |
IN |
denotes |
with |
| T7051 |
7704-7711 |
JJ |
denotes |
unknown |
| T7052 |
7720-7726 |
NN |
denotes |
status |
| T7053 |
7712-7719 |
NN |
denotes |
disease |
| T7054 |
7727-7731 |
IN |
denotes |
from |
| T7055 |
7732-7735 |
DT |
denotes |
the |
| T7056 |
7736-7743 |
NN |
denotes |
kindred |
| T7057 |
7744-7754 |
RB |
denotes |
originally |
| T7058 |
7755-7759 |
VBN |
denotes |
used |
| T7059 |
7760-7762 |
TO |
denotes |
to |
| T7060 |
7763-7769 |
VB |
denotes |
define |
| T7061 |
7770-7773 |
CC |
denotes |
and |
| T7062 |
7774-7777 |
VB |
denotes |
map |
| T7063 |
7778-7783 |
NN |
denotes |
SCA15 |
| T7064 |
7784-7785 |
-LRB- |
denotes |
( |
| T7065 |
7792-7796 |
NN |
denotes |
AUS1 |
| T7066 |
7785-7791 |
NN |
denotes |
family |
| T7067 |
7796-7798 |
, |
denotes |
, |
| T7068 |
7798-7800 |
IN |
denotes |
of |
| T7069 |
7801-7811 |
JJ |
denotes |
Australian |
| T7070 |
7825-7831 |
NN |
denotes |
origin |
| T7071 |
7812-7817 |
AFX |
denotes |
Anglo |
| T7072 |
7818-7824 |
JJ |
denotes |
Celtic |
| T7073 |
7817-7818 |
HYPH |
denotes |
- |
| T7074 |
7831-7832 |
-RRB- |
denotes |
) |
| T7075 |
7833-7834 |
-LRB- |
denotes |
[ |
| T7076 |
7834-7835 |
CD |
denotes |
2 |
| T7077 |
7835-7836 |
-RRB- |
denotes |
] |
| T7078 |
7836-7837 |
. |
denotes |
. |
| T7079 |
7837-8013 |
sentence |
denotes |
We performed two experiments concurrently in three affected members of this family: sequence analysis of the coding exons of ITPR1 and high-density genome-wide SNP genotyping. |
| T7080 |
7838-7840 |
PRP |
denotes |
We |
| T7081 |
7841-7850 |
VBD |
denotes |
performed |
| T7082 |
7851-7854 |
CD |
denotes |
two |
| T7083 |
7855-7866 |
NNS |
denotes |
experiments |
| T7084 |
7867-7879 |
RB |
denotes |
concurrently |
| T7085 |
7880-7882 |
IN |
denotes |
in |
| T7086 |
7883-7888 |
CD |
denotes |
three |
| T7087 |
7898-7905 |
NNS |
denotes |
members |
| T7088 |
7889-7897 |
VBN |
denotes |
affected |
| T7089 |
7906-7908 |
IN |
denotes |
of |
| T7090 |
7909-7913 |
DT |
denotes |
this |
| T7091 |
7914-7920 |
NN |
denotes |
family |
| T7092 |
7920-7922 |
: |
denotes |
: |
| T7093 |
7922-7930 |
NN |
denotes |
sequence |
| T7094 |
7931-7939 |
NN |
denotes |
analysis |
| T7095 |
7940-7942 |
IN |
denotes |
of |
| T7096 |
7943-7946 |
DT |
denotes |
the |
| T7097 |
7954-7959 |
NNS |
denotes |
exons |
| T7098 |
7947-7953 |
VBG |
denotes |
coding |
| T7099 |
7960-7962 |
IN |
denotes |
of |
| T7100 |
7963-7968 |
NN |
denotes |
ITPR1 |
| T7101 |
7969-7972 |
CC |
denotes |
and |
| T7102 |
7973-7977 |
JJ |
denotes |
high |
| T7103 |
7978-7985 |
NN |
denotes |
density |
| T7104 |
7977-7978 |
HYPH |
denotes |
- |
| T7105 |
8002-8012 |
NN |
denotes |
genotyping |
| T7106 |
7986-7992 |
NN |
denotes |
genome |
| T7107 |
7992-7993 |
HYPH |
denotes |
- |
| T7108 |
7993-7997 |
JJ |
denotes |
wide |
| T7109 |
7998-8001 |
NN |
denotes |
SNP |
| T7110 |
8012-8013 |
. |
denotes |
. |
| T7111 |
8013-8194 |
sentence |
denotes |
Sequence analysis failed to show any coding alterations segregating with disease or any alterations that were inconsistent with Mendelian patterns of inheritance within the family. |
| T7112 |
8014-8022 |
NN |
denotes |
Sequence |
| T7113 |
8023-8031 |
NN |
denotes |
analysis |
| T7114 |
8032-8038 |
VBD |
denotes |
failed |
| T7115 |
8039-8041 |
TO |
denotes |
to |
| T7116 |
8042-8046 |
VB |
denotes |
show |
| T7117 |
8047-8050 |
DT |
denotes |
any |
| T7118 |
8058-8069 |
NNS |
denotes |
alterations |
| T7119 |
8051-8057 |
NN |
denotes |
coding |
| T7120 |
8070-8081 |
VBG |
denotes |
segregating |
| T7121 |
8082-8086 |
IN |
denotes |
with |
| T7122 |
8087-8094 |
NN |
denotes |
disease |
| T7123 |
8095-8097 |
CC |
denotes |
or |
| T7124 |
8098-8101 |
DT |
denotes |
any |
| T7125 |
8102-8113 |
NNS |
denotes |
alterations |
| T7126 |
8114-8118 |
WDT |
denotes |
that |
| T7127 |
8119-8123 |
VBD |
denotes |
were |
| T7128 |
8124-8136 |
JJ |
denotes |
inconsistent |
| T7129 |
8137-8141 |
IN |
denotes |
with |
| T7130 |
8142-8151 |
JJ |
denotes |
Mendelian |
| T7131 |
8152-8160 |
NNS |
denotes |
patterns |
| T7132 |
8161-8163 |
IN |
denotes |
of |
| T7133 |
8164-8175 |
NN |
denotes |
inheritance |
| T7134 |
8176-8182 |
IN |
denotes |
within |
| T7135 |
8183-8186 |
DT |
denotes |
the |
| T7136 |
8187-8193 |
NN |
denotes |
family |
| T7137 |
8193-8194 |
. |
denotes |
. |
| T7138 |
8194-8482 |
sentence |
denotes |
However, visualization of log R ratio and B allele frequency metrics from the genome-wide SNP genotyping experiments clearly showed data consistent with a heterozygous genomic deletion across the first one-third of ITPR1 and across the first half of a neighboring gene, SUMF1 (Figure 2). |
| T7139 |
8195-8202 |
RB |
denotes |
However |
| T7140 |
8320-8326 |
VBD |
denotes |
showed |
| T7141 |
8202-8204 |
, |
denotes |
, |
| T7142 |
8204-8217 |
NN |
denotes |
visualization |
| T7143 |
8218-8220 |
IN |
denotes |
of |
| T7144 |
8221-8224 |
NN |
denotes |
log |
| T7145 |
8225-8226 |
NN |
denotes |
R |
| T7146 |
8227-8232 |
NN |
denotes |
ratio |
| T7147 |
8233-8236 |
CC |
denotes |
and |
| T7148 |
8237-8238 |
NN |
denotes |
B |
| T7149 |
8239-8245 |
NN |
denotes |
allele |
| T7150 |
8256-8263 |
NNS |
denotes |
metrics |
| T7151 |
8246-8255 |
NN |
denotes |
frequency |
| T7152 |
8264-8268 |
IN |
denotes |
from |
| T7153 |
8269-8272 |
DT |
denotes |
the |
| T7154 |
8300-8311 |
NNS |
denotes |
experiments |
| T7155 |
8273-8279 |
NN |
denotes |
genome |
| T7156 |
8280-8284 |
JJ |
denotes |
wide |
| T7157 |
8279-8280 |
HYPH |
denotes |
- |
| T7158 |
8285-8288 |
NN |
denotes |
SNP |
| T7159 |
8289-8299 |
NN |
denotes |
genotyping |
| T7160 |
8312-8319 |
RB |
denotes |
clearly |
| T7161 |
8327-8331 |
NNS |
denotes |
data |
| T7162 |
8332-8342 |
JJ |
denotes |
consistent |
| T7163 |
8343-8347 |
IN |
denotes |
with |
| T7164 |
8348-8349 |
DT |
denotes |
a |
| T7165 |
8371-8379 |
NN |
denotes |
deletion |
| T7166 |
8350-8362 |
JJ |
denotes |
heterozygous |
| T7167 |
8363-8370 |
JJ |
denotes |
genomic |
| T7168 |
8380-8386 |
IN |
denotes |
across |
| T7169 |
8387-8390 |
DT |
denotes |
the |
| T7170 |
8401-8406 |
NN |
denotes |
third |
| T7171 |
8391-8396 |
JJ |
denotes |
first |
| T7172 |
8397-8400 |
CD |
denotes |
one |
| T7173 |
8400-8401 |
HYPH |
denotes |
- |
| T7174 |
8407-8409 |
IN |
denotes |
of |
| T7175 |
8410-8415 |
NN |
denotes |
ITPR1 |
| T7176 |
8416-8419 |
CC |
denotes |
and |
| T7177 |
8420-8426 |
IN |
denotes |
across |
| T7178 |
8427-8430 |
DT |
denotes |
the |
| T7179 |
8437-8441 |
NN |
denotes |
half |
| T7180 |
8431-8436 |
JJ |
denotes |
first |
| T7181 |
8442-8444 |
IN |
denotes |
of |
| T7182 |
8445-8446 |
DT |
denotes |
a |
| T7183 |
8459-8463 |
NN |
denotes |
gene |
| T7184 |
8447-8458 |
JJ |
denotes |
neighboring |
| T7185 |
8463-8465 |
, |
denotes |
, |
| T7186 |
8465-8470 |
NN |
denotes |
SUMF1 |
| T7187 |
8471-8472 |
-LRB- |
denotes |
( |
| T7188 |
8472-8478 |
NN |
denotes |
Figure |
| T7189 |
8479-8480 |
CD |
denotes |
2 |
| T7190 |
8480-8481 |
-RRB- |
denotes |
) |
| T7191 |
8481-8482 |
. |
denotes |
. |
| T7192 |
8482-8630 |
sentence |
denotes |
This deletion was apparent in all three affected family members studied and absent from the family member with unknown affection status (Figure 3). |
| T7193 |
8483-8487 |
DT |
denotes |
This |
| T7194 |
8488-8496 |
NN |
denotes |
deletion |
| T7195 |
8497-8500 |
VBD |
denotes |
was |
| T7196 |
8501-8509 |
JJ |
denotes |
apparent |
| T7197 |
8510-8512 |
IN |
denotes |
in |
| T7198 |
8513-8516 |
DT |
denotes |
all |
| T7199 |
8539-8546 |
NNS |
denotes |
members |
| T7200 |
8517-8522 |
CD |
denotes |
three |
| T7201 |
8523-8531 |
VBN |
denotes |
affected |
| T7202 |
8532-8538 |
NN |
denotes |
family |
| T7203 |
8547-8554 |
VBN |
denotes |
studied |
| T7204 |
8555-8558 |
CC |
denotes |
and |
| T7205 |
8559-8565 |
JJ |
denotes |
absent |
| T7206 |
8566-8570 |
IN |
denotes |
from |
| T7207 |
8571-8574 |
DT |
denotes |
the |
| T7208 |
8582-8588 |
NN |
denotes |
member |
| T7209 |
8575-8581 |
NN |
denotes |
family |
| T7210 |
8589-8593 |
IN |
denotes |
with |
| T7211 |
8594-8601 |
JJ |
denotes |
unknown |
| T7212 |
8612-8618 |
NN |
denotes |
status |
| T7213 |
8602-8611 |
NN |
denotes |
affection |
| T7214 |
8619-8620 |
-LRB- |
denotes |
( |
| T7215 |
8620-8626 |
NN |
denotes |
Figure |
| T7216 |
8627-8628 |
CD |
denotes |
3 |
| T7217 |
8628-8629 |
-RRB- |
denotes |
) |
| T7218 |
8629-8630 |
. |
denotes |
. |
| T7219 |
8630-8989 |
sentence |
denotes |
The SNP data showed a deletion of between 188 kb and 210 kb in size; examination of SNPs at the flanking unknown regions of this deletion allowed us to delimit the borders of the deletion to 7.5 kb on the telomeric side of the deletion (between rs12634249 and rs793396) and ~14.4 kb on the centromeric side of the deletion (between rs4073665 and rs17709863). |
| T7220 |
8631-8634 |
DT |
denotes |
The |
| T7221 |
8639-8643 |
NNS |
denotes |
data |
| T7222 |
8635-8638 |
NN |
denotes |
SNP |
| T7223 |
8644-8650 |
VBD |
denotes |
showed |
| T7224 |
8769-8776 |
VBD |
denotes |
allowed |
| T7225 |
8651-8652 |
DT |
denotes |
a |
| T7226 |
8653-8661 |
NN |
denotes |
deletion |
| T7227 |
8662-8664 |
IN |
denotes |
of |
| T7228 |
8665-8672 |
IN |
denotes |
between |
| T7229 |
8673-8676 |
CD |
denotes |
188 |
| T7230 |
8677-8679 |
NN |
denotes |
kb |
| T7231 |
8680-8683 |
CC |
denotes |
and |
| T7232 |
8684-8687 |
CD |
denotes |
210 |
| T7233 |
8688-8690 |
NN |
denotes |
kb |
| T7234 |
8691-8693 |
IN |
denotes |
in |
| T7235 |
8694-8698 |
NN |
denotes |
size |
| T7236 |
8698-8699 |
: |
denotes |
; |
| T7237 |
8700-8711 |
NN |
denotes |
examination |
| T7238 |
8712-8714 |
IN |
denotes |
of |
| T7239 |
8715-8719 |
NNS |
denotes |
SNPs |
| T7240 |
8720-8722 |
IN |
denotes |
at |
| T7241 |
8723-8726 |
DT |
denotes |
the |
| T7242 |
8744-8751 |
NNS |
denotes |
regions |
| T7243 |
8727-8735 |
VBG |
denotes |
flanking |
| T7244 |
8736-8743 |
JJ |
denotes |
unknown |
| T7245 |
8752-8754 |
IN |
denotes |
of |
| T7246 |
8755-8759 |
DT |
denotes |
this |
| T7247 |
8760-8768 |
NN |
denotes |
deletion |
| T7248 |
8777-8779 |
PRP |
denotes |
us |
| T7249 |
8783-8790 |
VB |
denotes |
delimit |
| T7250 |
8780-8782 |
TO |
denotes |
to |
| T7251 |
8791-8794 |
DT |
denotes |
the |
| T7252 |
8795-8802 |
NNS |
denotes |
borders |
| T7253 |
8803-8805 |
IN |
denotes |
of |
| T7254 |
8806-8809 |
DT |
denotes |
the |
| T7255 |
8810-8818 |
NN |
denotes |
deletion |
| T7256 |
8819-8821 |
IN |
denotes |
to |
| T7257 |
8822-8825 |
CD |
denotes |
7.5 |
| T7258 |
8826-8828 |
NN |
denotes |
kb |
| T7259 |
8829-8831 |
IN |
denotes |
on |
| T7260 |
8832-8835 |
DT |
denotes |
the |
| T7261 |
8846-8850 |
NN |
denotes |
side |
| T7262 |
8836-8845 |
JJ |
denotes |
telomeric |
| T7263 |
8851-8853 |
IN |
denotes |
of |
| T7264 |
8854-8857 |
DT |
denotes |
the |
| T7265 |
8858-8866 |
NN |
denotes |
deletion |
| T7266 |
8867-8868 |
-LRB- |
denotes |
( |
| T7267 |
8868-8875 |
IN |
denotes |
between |
| T7268 |
8876-8886 |
NN |
denotes |
rs12634249 |
| T7269 |
8887-8890 |
CC |
denotes |
and |
| T7270 |
8891-8899 |
NN |
denotes |
rs793396 |
| T7271 |
8899-8900 |
-RRB- |
denotes |
) |
| T7272 |
8901-8904 |
CC |
denotes |
and |
| T7273 |
8905-8906 |
SYM |
denotes |
~ |
| T7274 |
8906-8910 |
CD |
denotes |
14.4 |
| T7275 |
8911-8913 |
NN |
denotes |
kb |
| T7276 |
8914-8916 |
IN |
denotes |
on |
| T7277 |
8917-8920 |
DT |
denotes |
the |
| T7278 |
8933-8937 |
NN |
denotes |
side |
| T7279 |
8921-8932 |
JJ |
denotes |
centromeric |
| T7280 |
8938-8940 |
IN |
denotes |
of |
| T7281 |
8941-8944 |
DT |
denotes |
the |
| T7282 |
8945-8953 |
NN |
denotes |
deletion |
| T7283 |
8954-8955 |
-LRB- |
denotes |
( |
| T7284 |
8955-8962 |
IN |
denotes |
between |
| T7285 |
8963-8972 |
NN |
denotes |
rs4073665 |
| T7286 |
8973-8976 |
CC |
denotes |
and |
| T7287 |
8977-8987 |
NN |
denotes |
rs17709863 |
| T7288 |
8987-8988 |
-RRB- |
denotes |
) |
| T7289 |
8988-8989 |
. |
denotes |
. |
| T7290 |
8989-9273 |
sentence |
denotes |
In an attempt to define whether this variation was a benign polymorphism we analyzed genome-wide SNP data at this locus, produced using the same genotyping chip, from 577 individuals of European descent who were either controls or individuals with an unrelated neurological disorder. |
| T7291 |
8990-8992 |
IN |
denotes |
In |
| T7292 |
9066-9074 |
VBD |
denotes |
analyzed |
| T7293 |
8993-8995 |
DT |
denotes |
an |
| T7294 |
8996-9003 |
NN |
denotes |
attempt |
| T7295 |
9004-9006 |
TO |
denotes |
to |
| T7296 |
9007-9013 |
VB |
denotes |
define |
| T7297 |
9014-9021 |
IN |
denotes |
whether |
| T7298 |
9037-9040 |
VBD |
denotes |
was |
| T7299 |
9022-9026 |
DT |
denotes |
this |
| T7300 |
9027-9036 |
NN |
denotes |
variation |
| T7301 |
9041-9042 |
DT |
denotes |
a |
| T7302 |
9050-9062 |
NN |
denotes |
polymorphism |
| T7303 |
9043-9049 |
JJ |
denotes |
benign |
| T7304 |
9063-9065 |
PRP |
denotes |
we |
| T7305 |
9075-9081 |
NN |
denotes |
genome |
| T7306 |
9082-9086 |
JJ |
denotes |
wide |
| T7307 |
9081-9082 |
HYPH |
denotes |
- |
| T7308 |
9091-9095 |
NNS |
denotes |
data |
| T7309 |
9087-9090 |
NN |
denotes |
SNP |
| T7310 |
9096-9098 |
IN |
denotes |
at |
| T7311 |
9099-9103 |
DT |
denotes |
this |
| T7312 |
9104-9109 |
NN |
denotes |
locus |
| T7313 |
9109-9111 |
, |
denotes |
, |
| T7314 |
9111-9119 |
VBN |
denotes |
produced |
| T7315 |
9120-9125 |
VBG |
denotes |
using |
| T7316 |
9126-9129 |
DT |
denotes |
the |
| T7317 |
9146-9150 |
NN |
denotes |
chip |
| T7318 |
9130-9134 |
JJ |
denotes |
same |
| T7319 |
9135-9145 |
NN |
denotes |
genotyping |
| T7320 |
9150-9152 |
, |
denotes |
, |
| T7321 |
9152-9156 |
IN |
denotes |
from |
| T7322 |
9157-9160 |
CD |
denotes |
577 |
| T7323 |
9161-9172 |
NNS |
denotes |
individuals |
| T7324 |
9173-9175 |
IN |
denotes |
of |
| T7325 |
9176-9184 |
JJ |
denotes |
European |
| T7326 |
9185-9192 |
NN |
denotes |
descent |
| T7327 |
9193-9196 |
WP |
denotes |
who |
| T7328 |
9197-9201 |
VBD |
denotes |
were |
| T7329 |
9202-9208 |
CC |
denotes |
either |
| T7330 |
9209-9217 |
NNS |
denotes |
controls |
| T7331 |
9218-9220 |
CC |
denotes |
or |
| T7332 |
9221-9232 |
NNS |
denotes |
individuals |
| T7333 |
9233-9237 |
IN |
denotes |
with |
| T7334 |
9238-9240 |
DT |
denotes |
an |
| T7335 |
9264-9272 |
NN |
denotes |
disorder |
| T7336 |
9241-9250 |
JJ |
denotes |
unrelated |
| T7337 |
9251-9263 |
JJ |
denotes |
neurological |
| T7338 |
9272-9273 |
. |
denotes |
. |
| T7339 |
9273-9541 |
sentence |
denotes |
We failed to find any deletions affecting the coding sequence of either gene, ITPR1 or SUMF1; we did, however, identify a single individual with a possible heterozygous deletion approximately 6 kb in size within intron 40–41 of ITPR1, at least 5 kb away from exon 40. |
| T7340 |
9274-9276 |
PRP |
denotes |
We |
| T7341 |
9277-9283 |
VBD |
denotes |
failed |
| T7342 |
9385-9393 |
VB |
denotes |
identify |
| T7343 |
9284-9286 |
TO |
denotes |
to |
| T7344 |
9287-9291 |
VB |
denotes |
find |
| T7345 |
9292-9295 |
DT |
denotes |
any |
| T7346 |
9296-9305 |
NNS |
denotes |
deletions |
| T7347 |
9306-9315 |
VBG |
denotes |
affecting |
| T7348 |
9316-9319 |
DT |
denotes |
the |
| T7349 |
9327-9335 |
NN |
denotes |
sequence |
| T7350 |
9320-9326 |
NN |
denotes |
coding |
| T7351 |
9336-9338 |
IN |
denotes |
of |
| T7352 |
9339-9345 |
DT |
denotes |
either |
| T7353 |
9346-9350 |
NN |
denotes |
gene |
| T7354 |
9350-9352 |
, |
denotes |
, |
| T7355 |
9352-9357 |
NN |
denotes |
ITPR1 |
| T7356 |
9358-9360 |
CC |
denotes |
or |
| T7357 |
9361-9366 |
NN |
denotes |
SUMF1 |
| T7358 |
9366-9367 |
: |
denotes |
; |
| T7359 |
9368-9370 |
PRP |
denotes |
we |
| T7360 |
9371-9374 |
VBD |
denotes |
did |
| T7361 |
9374-9376 |
, |
denotes |
, |
| T7362 |
9376-9383 |
RB |
denotes |
however |
| T7363 |
9383-9385 |
, |
denotes |
, |
| T7364 |
9394-9395 |
DT |
denotes |
a |
| T7365 |
9403-9413 |
NN |
denotes |
individual |
| T7366 |
9396-9402 |
JJ |
denotes |
single |
| T7367 |
9414-9418 |
IN |
denotes |
with |
| T7368 |
9419-9420 |
DT |
denotes |
a |
| T7369 |
9443-9451 |
NN |
denotes |
deletion |
| T7370 |
9421-9429 |
JJ |
denotes |
possible |
| T7371 |
9430-9442 |
JJ |
denotes |
heterozygous |
| T7372 |
9452-9465 |
RB |
denotes |
approximately |
| T7373 |
9466-9467 |
CD |
denotes |
6 |
| T7374 |
9468-9470 |
NN |
denotes |
kb |
| T7375 |
9471-9473 |
IN |
denotes |
in |
| T7376 |
9474-9478 |
NN |
denotes |
size |
| T7377 |
9479-9485 |
IN |
denotes |
within |
| T7378 |
9486-9492 |
NN |
denotes |
intron |
| T7379 |
9493-9495 |
CD |
denotes |
40 |
| T7380 |
9495-9496 |
SYM |
denotes |
– |
| T7381 |
9496-9498 |
CD |
denotes |
41 |
| T7382 |
9499-9501 |
IN |
denotes |
of |
| T7383 |
9502-9507 |
NN |
denotes |
ITPR1 |
| T7384 |
9507-9509 |
, |
denotes |
, |
| T7385 |
9509-9511 |
RB |
denotes |
at |
| T7386 |
9518-9519 |
CD |
denotes |
5 |
| T7387 |
9512-9517 |
RBS |
denotes |
least |
| T7388 |
9520-9522 |
NN |
denotes |
kb |
| T7389 |
9523-9527 |
RB |
denotes |
away |
| T7390 |
9528-9532 |
IN |
denotes |
from |
| T7391 |
9533-9537 |
NN |
denotes |
exon |
| T7392 |
9538-9540 |
CD |
denotes |
40 |
| T7393 |
9540-9541 |
. |
denotes |
. |
| T7394 |
9541-9641 |
sentence |
denotes |
Given the location of this alteration it is unlikely to effect the expression or splicing of ITPR1. |
| T7395 |
9542-9547 |
VBN |
denotes |
Given |
| T7396 |
9583-9585 |
VBZ |
denotes |
is |
| T7397 |
9548-9551 |
DT |
denotes |
the |
| T7398 |
9552-9560 |
NN |
denotes |
location |
| T7399 |
9561-9563 |
IN |
denotes |
of |
| T7400 |
9564-9568 |
DT |
denotes |
this |
| T7401 |
9569-9579 |
NN |
denotes |
alteration |
| T7402 |
9580-9582 |
PRP |
denotes |
it |
| T7403 |
9586-9594 |
JJ |
denotes |
unlikely |
| T7404 |
9595-9597 |
TO |
denotes |
to |
| T7405 |
9598-9604 |
VB |
denotes |
effect |
| T7406 |
9605-9608 |
DT |
denotes |
the |
| T7407 |
9609-9619 |
NN |
denotes |
expression |
| T7408 |
9620-9622 |
CC |
denotes |
or |
| T7409 |
9623-9631 |
NN |
denotes |
splicing |
| T7410 |
9632-9634 |
IN |
denotes |
of |
| T7411 |
9635-9640 |
NN |
denotes |
ITPR1 |
| T7412 |
9640-9641 |
. |
denotes |
. |
| T7413 |
9641-12242 |
sentence |
denotes |
Figure 2 Metrics Derived from Analysis of DNA from Affected Family Member 7 Using Illumina Infinium HumanHap550 Genotyping Chips
The upper and lower plots are log R ratio and B allele frequency, respectively, at an ~800-kb segment on the p arm of Chromosome 3. Log R ratio is the ratio of normalized, observed R to expected R for each SNP (each SNP is a blue dot) and thus serves as a surrogate of copy number at each locus. B allele frequency is a measure of the number of times the A or B alleles are detected at each locus (each SNP is denoted by a blue dot). Thus, SNPs with a B allele frequency of one are apparent B/B homozygotes, SNPs with a B allele frequency of 0.5 are apparent A/B heterozygotes, and those with a B allele frequency of zero are apparent A/A homozygotes. Clearly, these plots show a contiguous region ~200 kb long with decreased copy number and apparent homozygosity (bounded by a red box). As we have demonstrated previously, this is indicative of a heterozygous genomic deletion [15]. Below these plots is a schematic of the two known genes affected by this deletion, ITPR1 and SUMF1.
Figure 3 Mutation Analysis in the Australian SCA15 Family
(Top) Pedigree of kindred. Filled symbols denote affected individuals; open symbols, unaffected individuals; grey symbol denotes unknown disease status; bulls-eye symbol denotes obligate carrier. w/w, wild-type at ITPR1; w/m, heterozygous carrier of the ITPR1 deletion.
(Middle) Schematic of primer pairs used to narrow the unknown regions between known deleted sequence and known diploid sequence at the SCA15 locus. Nine primer pairs (T1–T9) were used to amplify across the unknown region telomeric to the known deleted region; 19 primer pairs (C1–C19) were used to amplify across the unknown region centromeric to the known deleted region. All PCRs were carried out in the three affected family members. Analysis of these data narrowed the unknown region, and ultimately we were able to use primer T3f and C11r to amplify across the deletion breakpoint in the three affected family members, producing a fragment of 953 bp in affected individuals.
(Bottom) Gel showing amplification product using primer pair T3f and C11r from affected pedigree members 6, 7, and 19; in pedigree member 23, with unknown disease affection status; in a neurologically normal control (C); and in a no template control (NC). In an attempt to fine-map the breakpoints of the disease-causing deletion we performed a series of experiments designed to refine the unknown intervals at the edges between definite deleted and definite diploid sequences. |
| T7414 |
12021-12023 |
IN |
denotes |
In |
| T7415 |
12098-12107 |
VBD |
denotes |
performed |
| T7416 |
12024-12026 |
DT |
denotes |
an |
| T7417 |
12027-12034 |
NN |
denotes |
attempt |
| T7418 |
12035-12037 |
TO |
denotes |
to |
| T7419 |
12043-12046 |
VB |
denotes |
map |
| T7420 |
12038-12042 |
RB |
denotes |
fine |
| T7421 |
12042-12043 |
HYPH |
denotes |
- |
| T7422 |
12047-12050 |
DT |
denotes |
the |
| T7423 |
12051-12062 |
NNS |
denotes |
breakpoints |
| T7424 |
12063-12065 |
IN |
denotes |
of |
| T7425 |
12066-12069 |
DT |
denotes |
the |
| T7426 |
12086-12094 |
NN |
denotes |
deletion |
| T7427 |
12070-12077 |
NN |
denotes |
disease |
| T7428 |
12078-12085 |
VBG |
denotes |
causing |
| T7429 |
12077-12078 |
HYPH |
denotes |
- |
| T7430 |
12095-12097 |
PRP |
denotes |
we |
| T7431 |
12108-12109 |
DT |
denotes |
a |
| T7432 |
12110-12116 |
NN |
denotes |
series |
| T7433 |
12117-12119 |
IN |
denotes |
of |
| T7434 |
12120-12131 |
NNS |
denotes |
experiments |
| T7435 |
12132-12140 |
VBN |
denotes |
designed |
| T7436 |
12141-12143 |
TO |
denotes |
to |
| T7437 |
12144-12150 |
VB |
denotes |
refine |
| T7438 |
12151-12154 |
DT |
denotes |
the |
| T7439 |
12163-12172 |
NNS |
denotes |
intervals |
| T7440 |
12155-12162 |
JJ |
denotes |
unknown |
| T7441 |
12173-12175 |
IN |
denotes |
at |
| T7442 |
12176-12179 |
DT |
denotes |
the |
| T7443 |
12180-12185 |
NNS |
denotes |
edges |
| T7444 |
12186-12193 |
IN |
denotes |
between |
| T7445 |
12194-12202 |
JJ |
denotes |
definite |
| T7446 |
12203-12210 |
VBN |
denotes |
deleted |
| T7447 |
12232-12241 |
NNS |
denotes |
sequences |
| T7448 |
12211-12214 |
CC |
denotes |
and |
| T7449 |
12215-12223 |
JJ |
denotes |
definite |
| T7450 |
12224-12231 |
JJ |
denotes |
diploid |
| T7451 |
12241-12242 |
. |
denotes |
. |
| T7452 |
12242-12348 |
sentence |
denotes |
These data narrowed the unknown borders to ~4 kb on the telomeric side and ~7 kb on the centromeric side. |
| T7453 |
12243-12248 |
DT |
denotes |
These |
| T7454 |
12249-12253 |
NNS |
denotes |
data |
| T7455 |
12254-12262 |
VBD |
denotes |
narrowed |
| T7456 |
12263-12266 |
DT |
denotes |
the |
| T7457 |
12275-12282 |
NNS |
denotes |
borders |
| T7458 |
12267-12274 |
JJ |
denotes |
unknown |
| T7459 |
12283-12285 |
IN |
denotes |
to |
| T7460 |
12286-12287 |
SYM |
denotes |
~ |
| T7461 |
12287-12288 |
CD |
denotes |
4 |
| T7462 |
12289-12291 |
NN |
denotes |
kb |
| T7463 |
12292-12294 |
IN |
denotes |
on |
| T7464 |
12295-12298 |
DT |
denotes |
the |
| T7465 |
12309-12313 |
NN |
denotes |
side |
| T7466 |
12299-12308 |
JJ |
denotes |
telomeric |
| T7467 |
12314-12317 |
CC |
denotes |
and |
| T7468 |
12318-12319 |
SYM |
denotes |
~ |
| T7469 |
12319-12320 |
CD |
denotes |
7 |
| T7470 |
12321-12323 |
NN |
denotes |
kb |
| T7471 |
12324-12326 |
IN |
denotes |
on |
| T7472 |
12327-12330 |
DT |
denotes |
the |
| T7473 |
12343-12347 |
NN |
denotes |
side |
| T7474 |
12331-12342 |
JJ |
denotes |
centromeric |
| T7475 |
12347-12348 |
. |
denotes |
. |
| T7476 |
12348-12643 |
sentence |
denotes |
We used all possible combinations of forward orientation primers designed within the newly defined telomeric boundary and of reverse orientation primers designed within the newly defined centromeric boundary in PCR assays in an attempt to amplify across the deletion in affected family members. |
| T7477 |
12349-12351 |
PRP |
denotes |
We |
| T7478 |
12352-12356 |
VBD |
denotes |
used |
| T7479 |
12357-12360 |
DT |
denotes |
all |
| T7480 |
12370-12382 |
NNS |
denotes |
combinations |
| T7481 |
12361-12369 |
JJ |
denotes |
possible |
| T7482 |
12383-12385 |
IN |
denotes |
of |
| T7483 |
12386-12393 |
JJ |
denotes |
forward |
| T7484 |
12394-12405 |
NN |
denotes |
orientation |
| T7485 |
12406-12413 |
NNS |
denotes |
primers |
| T7486 |
12414-12422 |
VBN |
denotes |
designed |
| T7487 |
12423-12429 |
IN |
denotes |
within |
| T7488 |
12430-12433 |
DT |
denotes |
the |
| T7489 |
12458-12466 |
NN |
denotes |
boundary |
| T7490 |
12434-12439 |
RB |
denotes |
newly |
| T7491 |
12440-12447 |
VBN |
denotes |
defined |
| T7492 |
12448-12457 |
JJ |
denotes |
telomeric |
| T7493 |
12467-12470 |
CC |
denotes |
and |
| T7494 |
12471-12473 |
IN |
denotes |
of |
| T7495 |
12474-12481 |
JJ |
denotes |
reverse |
| T7496 |
12482-12493 |
NN |
denotes |
orientation |
| T7497 |
12494-12501 |
NNS |
denotes |
primers |
| T7498 |
12502-12510 |
VBN |
denotes |
designed |
| T7499 |
12511-12517 |
IN |
denotes |
within |
| T7500 |
12518-12521 |
DT |
denotes |
the |
| T7501 |
12548-12556 |
NN |
denotes |
boundary |
| T7502 |
12522-12527 |
RB |
denotes |
newly |
| T7503 |
12528-12535 |
VBN |
denotes |
defined |
| T7504 |
12536-12547 |
JJ |
denotes |
centromeric |
| T7505 |
12557-12559 |
IN |
denotes |
in |
| T7506 |
12560-12563 |
NN |
denotes |
PCR |
| T7507 |
12564-12570 |
NNS |
denotes |
assays |
| T7508 |
12571-12573 |
IN |
denotes |
in |
| T7509 |
12574-12576 |
DT |
denotes |
an |
| T7510 |
12577-12584 |
NN |
denotes |
attempt |
| T7511 |
12585-12587 |
TO |
denotes |
to |
| T7512 |
12588-12595 |
VB |
denotes |
amplify |
| T7513 |
12596-12602 |
IN |
denotes |
across |
| T7514 |
12603-12606 |
DT |
denotes |
the |
| T7515 |
12607-12615 |
NN |
denotes |
deletion |
| T7516 |
12616-12618 |
IN |
denotes |
in |
| T7517 |
12619-12627 |
VBN |
denotes |
affected |
| T7518 |
12635-12642 |
NNS |
denotes |
members |
| T7519 |
12628-12634 |
NN |
denotes |
family |
| T7520 |
12642-12643 |
. |
denotes |
. |
| T7521 |
12643-12835 |
sentence |
denotes |
Using PCR primers T3F and C11R, which should be more than 200 kb apart, we were able to amplify a fragment 953 bp in size using DNA from each of the three affected family members as template. |
| T7522 |
12644-12649 |
VBG |
denotes |
Using |
| T7523 |
12719-12723 |
VBD |
denotes |
were |
| T7524 |
12650-12653 |
NN |
denotes |
PCR |
| T7525 |
12654-12661 |
NNS |
denotes |
primers |
| T7526 |
12662-12665 |
NN |
denotes |
T3F |
| T7527 |
12666-12669 |
CC |
denotes |
and |
| T7528 |
12670-12674 |
NN |
denotes |
C11R |
| T7529 |
12674-12676 |
, |
denotes |
, |
| T7530 |
12676-12681 |
WDT |
denotes |
which |
| T7531 |
12689-12691 |
VB |
denotes |
be |
| T7532 |
12682-12688 |
MD |
denotes |
should |
| T7533 |
12692-12696 |
JJR |
denotes |
more |
| T7534 |
12702-12705 |
CD |
denotes |
200 |
| T7535 |
12697-12701 |
IN |
denotes |
than |
| T7536 |
12706-12708 |
NN |
denotes |
kb |
| T7537 |
12709-12714 |
RB |
denotes |
apart |
| T7538 |
12714-12716 |
, |
denotes |
, |
| T7539 |
12716-12718 |
PRP |
denotes |
we |
| T7540 |
12724-12728 |
JJ |
denotes |
able |
| T7541 |
12729-12731 |
TO |
denotes |
to |
| T7542 |
12732-12739 |
VB |
denotes |
amplify |
| T7543 |
12740-12741 |
DT |
denotes |
a |
| T7544 |
12742-12750 |
NN |
denotes |
fragment |
| T7545 |
12751-12754 |
CD |
denotes |
953 |
| T7546 |
12755-12757 |
NN |
denotes |
bp |
| T7547 |
12758-12760 |
IN |
denotes |
in |
| T7548 |
12761-12765 |
NN |
denotes |
size |
| T7549 |
12766-12771 |
VBG |
denotes |
using |
| T7550 |
12772-12775 |
NN |
denotes |
DNA |
| T7551 |
12776-12780 |
IN |
denotes |
from |
| T7552 |
12781-12785 |
DT |
denotes |
each |
| T7553 |
12786-12788 |
IN |
denotes |
of |
| T7554 |
12789-12792 |
DT |
denotes |
the |
| T7555 |
12815-12822 |
NNS |
denotes |
members |
| T7556 |
12793-12798 |
CD |
denotes |
three |
| T7557 |
12799-12807 |
VBN |
denotes |
affected |
| T7558 |
12808-12814 |
NN |
denotes |
family |
| T7559 |
12823-12825 |
IN |
denotes |
as |
| T7560 |
12826-12834 |
NN |
denotes |
template |
| T7561 |
12834-12835 |
. |
denotes |
. |
| T7562 |
12835-13006 |
sentence |
denotes |
Sequencing of this fragment revealed a deletion of 201,509 bp (Figure S3), removing the first three of the nine exons of SUMF1 and the first ten of the 58 exons of ITPR1. |
| T7563 |
12836-12846 |
NN |
denotes |
Sequencing |
| T7564 |
12864-12872 |
VBD |
denotes |
revealed |
| T7565 |
12847-12849 |
IN |
denotes |
of |
| T7566 |
12850-12854 |
DT |
denotes |
this |
| T7567 |
12855-12863 |
NN |
denotes |
fragment |
| T7568 |
12873-12874 |
DT |
denotes |
a |
| T7569 |
12875-12883 |
NN |
denotes |
deletion |
| T7570 |
12884-12886 |
IN |
denotes |
of |
| T7571 |
12887-12894 |
CD |
denotes |
201,509 |
| T7572 |
12895-12897 |
NN |
denotes |
bp |
| T7573 |
12898-12899 |
-LRB- |
denotes |
( |
| T7574 |
12906-12908 |
NN |
denotes |
S3 |
| T7575 |
12899-12905 |
NN |
denotes |
Figure |
| T7576 |
12908-12909 |
-RRB- |
denotes |
) |
| T7577 |
12909-12911 |
, |
denotes |
, |
| T7578 |
12911-12919 |
VBG |
denotes |
removing |
| T7579 |
12920-12923 |
DT |
denotes |
the |
| T7580 |
12930-12935 |
CD |
denotes |
three |
| T7581 |
12924-12929 |
JJ |
denotes |
first |
| T7582 |
12936-12938 |
IN |
denotes |
of |
| T7583 |
12939-12942 |
DT |
denotes |
the |
| T7584 |
12948-12953 |
NNS |
denotes |
exons |
| T7585 |
12943-12947 |
CD |
denotes |
nine |
| T7586 |
12954-12956 |
IN |
denotes |
of |
| T7587 |
12957-12962 |
NN |
denotes |
SUMF1 |
| T7588 |
12963-12966 |
CC |
denotes |
and |
| T7589 |
12967-12970 |
DT |
denotes |
the |
| T7590 |
12977-12980 |
CD |
denotes |
ten |
| T7591 |
12971-12976 |
JJ |
denotes |
first |
| T7592 |
12981-12983 |
IN |
denotes |
of |
| T7593 |
12984-12987 |
DT |
denotes |
the |
| T7594 |
12991-12996 |
NNS |
denotes |
exons |
| T7595 |
12988-12990 |
CD |
denotes |
58 |
| T7596 |
12997-12999 |
IN |
denotes |
of |
| T7597 |
13000-13005 |
NN |
denotes |
ITPR1 |
| T7598 |
13005-13006 |
. |
denotes |
. |
| T7599 |
13006-13155 |
sentence |
denotes |
We were unable to amplify the deletion-specific fragment in the family member of unknown affection status, or in 275 neurologically normal controls. |
| T7600 |
13007-13009 |
PRP |
denotes |
We |
| T7601 |
13010-13014 |
VBD |
denotes |
were |
| T7602 |
13015-13021 |
JJ |
denotes |
unable |
| T7603 |
13022-13024 |
TO |
denotes |
to |
| T7604 |
13025-13032 |
VB |
denotes |
amplify |
| T7605 |
13033-13036 |
DT |
denotes |
the |
| T7606 |
13055-13063 |
NN |
denotes |
fragment |
| T7607 |
13037-13045 |
NN |
denotes |
deletion |
| T7608 |
13046-13054 |
JJ |
denotes |
specific |
| T7609 |
13045-13046 |
HYPH |
denotes |
- |
| T7610 |
13064-13066 |
IN |
denotes |
in |
| T7611 |
13067-13070 |
DT |
denotes |
the |
| T7612 |
13078-13084 |
NN |
denotes |
member |
| T7613 |
13071-13077 |
NN |
denotes |
family |
| T7614 |
13085-13087 |
IN |
denotes |
of |
| T7615 |
13088-13095 |
JJ |
denotes |
unknown |
| T7616 |
13106-13112 |
NN |
denotes |
status |
| T7617 |
13096-13105 |
NN |
denotes |
affection |
| T7618 |
13112-13114 |
, |
denotes |
, |
| T7619 |
13114-13116 |
CC |
denotes |
or |
| T7620 |
13117-13119 |
IN |
denotes |
in |
| T7621 |
13120-13123 |
CD |
denotes |
275 |
| T7622 |
13146-13154 |
NNS |
denotes |
controls |
| T7623 |
13124-13138 |
RB |
denotes |
neurologically |
| T7624 |
13139-13145 |
JJ |
denotes |
normal |
| T7625 |
13154-13155 |
. |
denotes |
. |
| T7626 |
13155-13407 |
sentence |
denotes |
To further establish genetic deletion at ITPR1 as the cause of SCA15 we analyzed two additional families with an inherited cerebellar ataxia similar to that described in the AUS1 family, ascertained through neurology clinics in London, United Kingdom. |
| T7627 |
13156-13158 |
TO |
denotes |
To |
| T7628 |
13167-13176 |
VB |
denotes |
establish |
| T7629 |
13159-13166 |
RB |
denotes |
further |
| T7630 |
13228-13236 |
VBD |
denotes |
analyzed |
| T7631 |
13177-13184 |
JJ |
denotes |
genetic |
| T7632 |
13185-13193 |
NN |
denotes |
deletion |
| T7633 |
13194-13196 |
IN |
denotes |
at |
| T7634 |
13197-13202 |
NN |
denotes |
ITPR1 |
| T7635 |
13203-13205 |
IN |
denotes |
as |
| T7636 |
13206-13209 |
DT |
denotes |
the |
| T7637 |
13210-13215 |
NN |
denotes |
cause |
| T7638 |
13216-13218 |
IN |
denotes |
of |
| T7639 |
13219-13224 |
NN |
denotes |
SCA15 |
| T7640 |
13225-13227 |
PRP |
denotes |
we |
| T7641 |
13237-13240 |
CD |
denotes |
two |
| T7642 |
13252-13260 |
NNS |
denotes |
families |
| T7643 |
13241-13251 |
JJ |
denotes |
additional |
| T7644 |
13261-13265 |
IN |
denotes |
with |
| T7645 |
13266-13268 |
DT |
denotes |
an |
| T7646 |
13290-13296 |
NN |
denotes |
ataxia |
| T7647 |
13269-13278 |
VBN |
denotes |
inherited |
| T7648 |
13279-13289 |
JJ |
denotes |
cerebellar |
| T7649 |
13297-13304 |
JJ |
denotes |
similar |
| T7650 |
13305-13307 |
IN |
denotes |
to |
| T7651 |
13308-13312 |
DT |
denotes |
that |
| T7652 |
13313-13322 |
VBN |
denotes |
described |
| T7653 |
13323-13325 |
IN |
denotes |
in |
| T7654 |
13326-13329 |
DT |
denotes |
the |
| T7655 |
13335-13341 |
NN |
denotes |
family |
| T7656 |
13330-13334 |
NN |
denotes |
AUS1 |
| T7657 |
13341-13343 |
, |
denotes |
, |
| T7658 |
13343-13354 |
VBN |
denotes |
ascertained |
| T7659 |
13355-13362 |
IN |
denotes |
through |
| T7660 |
13363-13372 |
NN |
denotes |
neurology |
| T7661 |
13373-13380 |
NNS |
denotes |
clinics |
| T7662 |
13381-13383 |
IN |
denotes |
in |
| T7663 |
13384-13390 |
NNP |
denotes |
London |
| T7664 |
13390-13392 |
, |
denotes |
, |
| T7665 |
13392-13398 |
NNP |
denotes |
United |
| T7666 |
13399-13406 |
NNP |
denotes |
Kingdom |
| T7667 |
13406-13407 |
. |
denotes |
. |
| T7668 |
13407-13560 |
sentence |
denotes |
DNA extracted from probands from these two families (family H33 and family H27) were also analyzed using Illumina Infinium HumanHap550 genotyping chips. |
| T7669 |
13408-13411 |
NN |
denotes |
DNA |
| T7670 |
13498-13506 |
VBN |
denotes |
analyzed |
| T7671 |
13412-13421 |
VBN |
denotes |
extracted |
| T7672 |
13422-13426 |
IN |
denotes |
from |
| T7673 |
13427-13435 |
NNS |
denotes |
probands |
| T7674 |
13436-13440 |
IN |
denotes |
from |
| T7675 |
13441-13446 |
DT |
denotes |
these |
| T7676 |
13451-13459 |
NNS |
denotes |
families |
| T7677 |
13447-13450 |
CD |
denotes |
two |
| T7678 |
13460-13461 |
-LRB- |
denotes |
( |
| T7679 |
13468-13471 |
NN |
denotes |
H33 |
| T7680 |
13461-13467 |
NN |
denotes |
family |
| T7681 |
13472-13475 |
CC |
denotes |
and |
| T7682 |
13476-13482 |
NN |
denotes |
family |
| T7683 |
13483-13486 |
NN |
denotes |
H27 |
| T7684 |
13486-13487 |
-RRB- |
denotes |
) |
| T7685 |
13488-13492 |
VBD |
denotes |
were |
| T7686 |
13493-13497 |
RB |
denotes |
also |
| T7687 |
13507-13512 |
VBG |
denotes |
using |
| T7688 |
13513-13521 |
NNP |
denotes |
Illumina |
| T7689 |
13531-13542 |
NNP |
denotes |
HumanHap550 |
| T7690 |
13522-13530 |
NNP |
denotes |
Infinium |
| T7691 |
13554-13559 |
NNS |
denotes |
chips |
| T7692 |
13543-13553 |
NN |
denotes |
genotyping |
| T7693 |
13559-13560 |
. |
denotes |
. |
| T7694 |
13560-13672 |
sentence |
denotes |
These experiments showed deletion at the SCA15 locus in all affected members assayed, from SUMF1 through ITPR1. |
| T7695 |
13561-13566 |
DT |
denotes |
These |
| T7696 |
13567-13578 |
NNS |
denotes |
experiments |
| T7697 |
13579-13585 |
VBD |
denotes |
showed |
| T7698 |
13586-13594 |
NN |
denotes |
deletion |
| T7699 |
13595-13597 |
IN |
denotes |
at |
| T7700 |
13598-13601 |
DT |
denotes |
the |
| T7701 |
13608-13613 |
NN |
denotes |
locus |
| T7702 |
13602-13607 |
NN |
denotes |
SCA15 |
| T7703 |
13614-13616 |
IN |
denotes |
in |
| T7704 |
13617-13620 |
DT |
denotes |
all |
| T7705 |
13630-13637 |
NNS |
denotes |
members |
| T7706 |
13621-13629 |
VBN |
denotes |
affected |
| T7707 |
13638-13645 |
VBN |
denotes |
assayed |
| T7708 |
13645-13647 |
, |
denotes |
, |
| T7709 |
13647-13651 |
IN |
denotes |
from |
| T7710 |
13652-13657 |
NN |
denotes |
SUMF1 |
| T7711 |
13658-13665 |
IN |
denotes |
through |
| T7712 |
13666-13671 |
NN |
denotes |
ITPR1 |
| T7713 |
13671-13672 |
. |
denotes |
. |
| T7714 |
13672-13747 |
sentence |
denotes |
These mutations segregated with disease in these two families (Figure S3). |
| T7715 |
13673-13678 |
DT |
denotes |
These |
| T7716 |
13679-13688 |
NNS |
denotes |
mutations |
| T7717 |
13689-13699 |
VBD |
denotes |
segregated |
| T7718 |
13700-13704 |
IN |
denotes |
with |
| T7719 |
13705-13712 |
NN |
denotes |
disease |
| T7720 |
13713-13715 |
IN |
denotes |
in |
| T7721 |
13716-13721 |
DT |
denotes |
these |
| T7722 |
13726-13734 |
NNS |
denotes |
families |
| T7723 |
13722-13725 |
CD |
denotes |
two |
| T7724 |
13735-13736 |
-LRB- |
denotes |
( |
| T7725 |
13743-13745 |
NN |
denotes |
S3 |
| T7726 |
13736-13742 |
NN |
denotes |
Figure |
| T7727 |
13745-13746 |
-RRB- |
denotes |
) |
| T7728 |
13746-13747 |
. |
denotes |
. |
| T7729 |
13747-13869 |
sentence |
denotes |
A strategy similar to the one outlined above enabled us to sequence over the breakpoint in family H27 but not family H33. |
| T7730 |
13748-13749 |
DT |
denotes |
A |
| T7731 |
13750-13758 |
NN |
denotes |
strategy |
| T7732 |
13793-13800 |
VBD |
denotes |
enabled |
| T7733 |
13759-13766 |
JJ |
denotes |
similar |
| T7734 |
13767-13769 |
IN |
denotes |
to |
| T7735 |
13770-13773 |
DT |
denotes |
the |
| T7736 |
13774-13777 |
CD |
denotes |
one |
| T7737 |
13778-13786 |
VBN |
denotes |
outlined |
| T7738 |
13787-13792 |
RB |
denotes |
above |
| T7739 |
13801-13803 |
PRP |
denotes |
us |
| T7740 |
13804-13806 |
TO |
denotes |
to |
| T7741 |
13807-13815 |
VB |
denotes |
sequence |
| T7742 |
13816-13820 |
IN |
denotes |
over |
| T7743 |
13821-13824 |
DT |
denotes |
the |
| T7744 |
13825-13835 |
NN |
denotes |
breakpoint |
| T7745 |
13836-13838 |
IN |
denotes |
in |
| T7746 |
13839-13845 |
NN |
denotes |
family |
| T7747 |
13846-13849 |
NN |
denotes |
H27 |
| T7748 |
13850-13853 |
CC |
denotes |
but |
| T7749 |
13854-13857 |
RB |
denotes |
not |
| T7750 |
13858-13864 |
NN |
denotes |
family |
| T7751 |
13865-13868 |
NN |
denotes |
H33 |
| T7752 |
13868-13869 |
. |
denotes |
. |
| T7753 |
13869-14091 |
sentence |
denotes |
In the former, the deletion spans 344,408 bp, removing exons 1–3 of SUMF1 and 1–44 of ITPR1; in the latter, we estimate that the deletion is 310 kb in length and that it removes exons 1–3 of SUMF1 and exons 1–40 of ITPR1. |
| T7754 |
13870-13872 |
IN |
denotes |
In |
| T7755 |
13898-13903 |
VBZ |
denotes |
spans |
| T7756 |
13873-13876 |
DT |
denotes |
the |
| T7757 |
13877-13883 |
JJ |
denotes |
former |
| T7758 |
13883-13885 |
, |
denotes |
, |
| T7759 |
13885-13888 |
DT |
denotes |
the |
| T7760 |
13889-13897 |
NN |
denotes |
deletion |
| T7761 |
13981-13989 |
VBP |
denotes |
estimate |
| T7762 |
13904-13911 |
CD |
denotes |
344,408 |
| T7763 |
13912-13914 |
NN |
denotes |
bp |
| T7764 |
13914-13916 |
, |
denotes |
, |
| T7765 |
13916-13924 |
VBG |
denotes |
removing |
| T7766 |
13925-13930 |
NNS |
denotes |
exons |
| T7767 |
13931-13932 |
CD |
denotes |
1 |
| T7768 |
13932-13933 |
SYM |
denotes |
– |
| T7769 |
13933-13934 |
CD |
denotes |
3 |
| T7770 |
13935-13937 |
IN |
denotes |
of |
| T7771 |
13938-13943 |
NN |
denotes |
SUMF1 |
| T7772 |
13944-13947 |
CC |
denotes |
and |
| T7773 |
13948-13949 |
CD |
denotes |
1 |
| T7774 |
13949-13950 |
SYM |
denotes |
– |
| T7775 |
13950-13952 |
CD |
denotes |
44 |
| T7776 |
13953-13955 |
IN |
denotes |
of |
| T7777 |
13956-13961 |
NN |
denotes |
ITPR1 |
| T7778 |
13961-13962 |
: |
denotes |
; |
| T7779 |
13963-13965 |
IN |
denotes |
in |
| T7780 |
13966-13969 |
DT |
denotes |
the |
| T7781 |
13970-13976 |
JJ |
denotes |
latter |
| T7782 |
13976-13978 |
, |
denotes |
, |
| T7783 |
13978-13980 |
PRP |
denotes |
we |
| T7784 |
13990-13994 |
IN |
denotes |
that |
| T7785 |
14008-14010 |
VBZ |
denotes |
is |
| T7786 |
13995-13998 |
DT |
denotes |
the |
| T7787 |
13999-14007 |
NN |
denotes |
deletion |
| T7788 |
14011-14014 |
CD |
denotes |
310 |
| T7789 |
14015-14017 |
NN |
denotes |
kb |
| T7790 |
14018-14020 |
IN |
denotes |
in |
| T7791 |
14021-14027 |
NN |
denotes |
length |
| T7792 |
14028-14031 |
CC |
denotes |
and |
| T7793 |
14032-14036 |
IN |
denotes |
that |
| T7794 |
14040-14047 |
VBZ |
denotes |
removes |
| T7795 |
14037-14039 |
PRP |
denotes |
it |
| T7796 |
14048-14053 |
NNS |
denotes |
exons |
| T7797 |
14054-14055 |
CD |
denotes |
1 |
| T7798 |
14055-14056 |
SYM |
denotes |
– |
| T7799 |
14056-14057 |
CD |
denotes |
3 |
| T7800 |
14058-14060 |
IN |
denotes |
of |
| T7801 |
14061-14066 |
NN |
denotes |
SUMF1 |
| T7802 |
14067-14070 |
CC |
denotes |
and |
| T7803 |
14071-14076 |
NNS |
denotes |
exons |
| T7804 |
14077-14078 |
CD |
denotes |
1 |
| T7805 |
14078-14079 |
SYM |
denotes |
– |
| T7806 |
14079-14081 |
CD |
denotes |
40 |
| T7807 |
14082-14084 |
IN |
denotes |
of |
| T7808 |
14085-14090 |
NN |
denotes |
ITPR1 |
| T7809 |
14090-14091 |
. |
denotes |
. |
| T7810 |
14091-14357 |
sentence |
denotes |
The site of mutation is of interest, particularly the fact that in each of the three families the telomeric end of the deletion is anchored between exons 3 and 4 of SUMF1; sequence searches failed to identify any repeat sequences that might explain this phenomenon. |
| T7811 |
14092-14095 |
DT |
denotes |
The |
| T7812 |
14096-14100 |
NN |
denotes |
site |
| T7813 |
14113-14115 |
VBZ |
denotes |
is |
| T7814 |
14101-14103 |
IN |
denotes |
of |
| T7815 |
14104-14112 |
NN |
denotes |
mutation |
| T7816 |
14282-14288 |
VBD |
denotes |
failed |
| T7817 |
14116-14118 |
IN |
denotes |
of |
| T7818 |
14119-14127 |
NN |
denotes |
interest |
| T7819 |
14127-14129 |
, |
denotes |
, |
| T7820 |
14129-14141 |
RB |
denotes |
particularly |
| T7821 |
14146-14150 |
NN |
denotes |
fact |
| T7822 |
14142-14145 |
DT |
denotes |
the |
| T7823 |
14151-14155 |
IN |
denotes |
that |
| T7824 |
14223-14231 |
VBN |
denotes |
anchored |
| T7825 |
14156-14158 |
IN |
denotes |
in |
| T7826 |
14159-14163 |
DT |
denotes |
each |
| T7827 |
14164-14166 |
IN |
denotes |
of |
| T7828 |
14167-14170 |
DT |
denotes |
the |
| T7829 |
14177-14185 |
NNS |
denotes |
families |
| T7830 |
14171-14176 |
CD |
denotes |
three |
| T7831 |
14186-14189 |
DT |
denotes |
the |
| T7832 |
14200-14203 |
NN |
denotes |
end |
| T7833 |
14190-14199 |
JJ |
denotes |
telomeric |
| T7834 |
14204-14206 |
IN |
denotes |
of |
| T7835 |
14207-14210 |
DT |
denotes |
the |
| T7836 |
14211-14219 |
NN |
denotes |
deletion |
| T7837 |
14220-14222 |
VBZ |
denotes |
is |
| T7838 |
14232-14239 |
IN |
denotes |
between |
| T7839 |
14240-14245 |
NNS |
denotes |
exons |
| T7840 |
14246-14247 |
CD |
denotes |
3 |
| T7841 |
14248-14251 |
CC |
denotes |
and |
| T7842 |
14252-14253 |
CD |
denotes |
4 |
| T7843 |
14254-14256 |
IN |
denotes |
of |
| T7844 |
14257-14262 |
NN |
denotes |
SUMF1 |
| T7845 |
14262-14263 |
: |
denotes |
; |
| T7846 |
14264-14272 |
NN |
denotes |
sequence |
| T7847 |
14273-14281 |
NNS |
denotes |
searches |
| T7848 |
14289-14291 |
TO |
denotes |
to |
| T7849 |
14292-14300 |
VB |
denotes |
identify |
| T7850 |
14301-14304 |
DT |
denotes |
any |
| T7851 |
14312-14321 |
NNS |
denotes |
sequences |
| T7852 |
14305-14311 |
NN |
denotes |
repeat |
| T7853 |
14322-14326 |
WDT |
denotes |
that |
| T7854 |
14333-14340 |
VB |
denotes |
explain |
| T7855 |
14327-14332 |
MD |
denotes |
might |
| T7856 |
14341-14345 |
DT |
denotes |
this |
| T7857 |
14346-14356 |
NN |
denotes |
phenomenon |
| T7858 |
14356-14357 |
. |
denotes |
. |
| T7859 |
14357-14708 |
sentence |
denotes |
With three cerebellar ataxia families segregating a SUMF1–ITPR1 deletion, and this deletion not observed in a control population, we may reasonably conclude that the association is causal, and that the deletion is indeed the genetic basis of the disease, with SCA15 the diagnosis in the two British families as well as the original Australian family. |
| T7860 |
14358-14362 |
IN |
denotes |
With |
| T7861 |
14506-14514 |
VB |
denotes |
conclude |
| T7862 |
14363-14368 |
CD |
denotes |
three |
| T7863 |
14387-14395 |
NNS |
denotes |
families |
| T7864 |
14369-14379 |
JJ |
denotes |
cerebellar |
| T7865 |
14380-14386 |
NN |
denotes |
ataxia |
| T7866 |
14396-14407 |
VBG |
denotes |
segregating |
| T7867 |
14408-14409 |
DT |
denotes |
a |
| T7868 |
14422-14430 |
NN |
denotes |
deletion |
| T7869 |
14410-14415 |
NN |
denotes |
SUMF1 |
| T7870 |
14416-14421 |
NN |
denotes |
ITPR1 |
| T7871 |
14415-14416 |
HYPH |
denotes |
– |
| T7872 |
14430-14432 |
, |
denotes |
, |
| T7873 |
14432-14435 |
CC |
denotes |
and |
| T7874 |
14436-14440 |
DT |
denotes |
this |
| T7875 |
14441-14449 |
NN |
denotes |
deletion |
| T7876 |
14450-14453 |
RB |
denotes |
not |
| T7877 |
14454-14462 |
VBN |
denotes |
observed |
| T7878 |
14463-14465 |
IN |
denotes |
in |
| T7879 |
14466-14467 |
DT |
denotes |
a |
| T7880 |
14476-14486 |
NN |
denotes |
population |
| T7881 |
14468-14475 |
NN |
denotes |
control |
| T7882 |
14486-14488 |
, |
denotes |
, |
| T7883 |
14488-14490 |
PRP |
denotes |
we |
| T7884 |
14491-14494 |
MD |
denotes |
may |
| T7885 |
14495-14505 |
RB |
denotes |
reasonably |
| T7886 |
14515-14519 |
IN |
denotes |
that |
| T7887 |
14536-14538 |
VBZ |
denotes |
is |
| T7888 |
14520-14523 |
DT |
denotes |
the |
| T7889 |
14524-14535 |
NN |
denotes |
association |
| T7890 |
14539-14545 |
JJ |
denotes |
causal |
| T7891 |
14545-14547 |
, |
denotes |
, |
| T7892 |
14547-14550 |
CC |
denotes |
and |
| T7893 |
14551-14555 |
IN |
denotes |
that |
| T7894 |
14569-14571 |
VBZ |
denotes |
is |
| T7895 |
14556-14559 |
DT |
denotes |
the |
| T7896 |
14560-14568 |
NN |
denotes |
deletion |
| T7897 |
14572-14578 |
RB |
denotes |
indeed |
| T7898 |
14579-14582 |
DT |
denotes |
the |
| T7899 |
14591-14596 |
NN |
denotes |
basis |
| T7900 |
14583-14590 |
JJ |
denotes |
genetic |
| T7901 |
14597-14599 |
IN |
denotes |
of |
| T7902 |
14600-14603 |
DT |
denotes |
the |
| T7903 |
14604-14611 |
NN |
denotes |
disease |
| T7904 |
14611-14613 |
, |
denotes |
, |
| T7905 |
14613-14617 |
IN |
denotes |
with |
| T7906 |
14628-14637 |
NN |
denotes |
diagnosis |
| T7907 |
14618-14623 |
NN |
denotes |
SCA15 |
| T7908 |
14624-14627 |
DT |
denotes |
the |
| T7909 |
14638-14640 |
IN |
denotes |
in |
| T7910 |
14641-14644 |
DT |
denotes |
the |
| T7911 |
14657-14665 |
NNS |
denotes |
families |
| T7912 |
14645-14648 |
CD |
denotes |
two |
| T7913 |
14649-14656 |
JJ |
denotes |
British |
| T7914 |
14666-14668 |
RB |
denotes |
as |
| T7915 |
14674-14676 |
IN |
denotes |
as |
| T7916 |
14669-14673 |
RB |
denotes |
well |
| T7917 |
14677-14680 |
DT |
denotes |
the |
| T7918 |
14701-14707 |
NN |
denotes |
family |
| T7919 |
14681-14689 |
JJ |
denotes |
original |
| T7920 |
14690-14700 |
JJ |
denotes |
Australian |
| T7921 |
14707-14708 |
. |
denotes |
. |
| T7922 |
14708-14853 |
sentence |
denotes |
It is improbable that heterozygosity for the deletion of SUMF1, encoding sulfatase modifying factor 1, of itself causes or contributes to SCA15. |
| T7923 |
14709-14711 |
PRP |
denotes |
It |
| T7924 |
14712-14714 |
VBZ |
denotes |
is |
| T7925 |
14715-14725 |
JJ |
denotes |
improbable |
| T7926 |
14726-14730 |
IN |
denotes |
that |
| T7927 |
14822-14828 |
VBZ |
denotes |
causes |
| T7928 |
14731-14745 |
NN |
denotes |
heterozygosity |
| T7929 |
14746-14749 |
IN |
denotes |
for |
| T7930 |
14750-14753 |
DT |
denotes |
the |
| T7931 |
14754-14762 |
NN |
denotes |
deletion |
| T7932 |
14763-14765 |
IN |
denotes |
of |
| T7933 |
14766-14771 |
NN |
denotes |
SUMF1 |
| T7934 |
14771-14773 |
, |
denotes |
, |
| T7935 |
14773-14781 |
VBG |
denotes |
encoding |
| T7936 |
14782-14791 |
NN |
denotes |
sulfatase |
| T7937 |
14802-14808 |
NN |
denotes |
factor |
| T7938 |
14792-14801 |
VBG |
denotes |
modifying |
| T7939 |
14809-14810 |
CD |
denotes |
1 |
| T7940 |
14810-14812 |
, |
denotes |
, |
| T7941 |
14812-14814 |
IN |
denotes |
of |
| T7942 |
14815-14821 |
PRP |
denotes |
itself |
| T7943 |
14829-14831 |
CC |
denotes |
or |
| T7944 |
14832-14843 |
VBZ |
denotes |
contributes |
| T7945 |
14844-14846 |
IN |
denotes |
to |
| T7946 |
14847-14852 |
NN |
denotes |
SCA15 |
| T7947 |
14852-14853 |
. |
denotes |
. |
| T7948 |
14853-15043 |
sentence |
denotes |
Homozygous mutation of SUMF1 results in autosomal recessive multiple sulfatase deficiency, a metabolic disorder characterized by hepatosplenomegaly, deafness, and developmental delay [6,7]. |
| T7949 |
14854-14864 |
JJ |
denotes |
Homozygous |
| T7950 |
14865-14873 |
NN |
denotes |
mutation |
| T7951 |
14883-14890 |
VBZ |
denotes |
results |
| T7952 |
14874-14876 |
IN |
denotes |
of |
| T7953 |
14877-14882 |
NN |
denotes |
SUMF1 |
| T7954 |
14891-14893 |
IN |
denotes |
in |
| T7955 |
14894-14903 |
JJ |
denotes |
autosomal |
| T7956 |
14933-14943 |
NN |
denotes |
deficiency |
| T7957 |
14904-14913 |
JJ |
denotes |
recessive |
| T7958 |
14914-14922 |
JJ |
denotes |
multiple |
| T7959 |
14923-14932 |
NN |
denotes |
sulfatase |
| T7960 |
14943-14945 |
, |
denotes |
, |
| T7961 |
14945-14946 |
DT |
denotes |
a |
| T7962 |
14957-14965 |
NN |
denotes |
disorder |
| T7963 |
14947-14956 |
JJ |
denotes |
metabolic |
| T7964 |
14966-14979 |
VBN |
denotes |
characterized |
| T7965 |
14980-14982 |
IN |
denotes |
by |
| T7966 |
14983-15001 |
NN |
denotes |
hepatosplenomegaly |
| T7967 |
15001-15003 |
, |
denotes |
, |
| T7968 |
15003-15011 |
NN |
denotes |
deafness |
| T7969 |
15011-15013 |
, |
denotes |
, |
| T7970 |
15013-15016 |
CC |
denotes |
and |
| T7971 |
15017-15030 |
JJ |
denotes |
developmental |
| T7972 |
15031-15036 |
NN |
denotes |
delay |
| T7973 |
15037-15038 |
-LRB- |
denotes |
[ |
| T7974 |
15040-15041 |
CD |
denotes |
7 |
| T7975 |
15038-15039 |
CD |
denotes |
6 |
| T7976 |
15039-15040 |
, |
denotes |
, |
| T7977 |
15041-15042 |
-RRB- |
denotes |
] |
| T7978 |
15042-15043 |
. |
denotes |
. |
| T7979 |
15043-15163 |
sentence |
denotes |
No co-occurrence of ataxia has been described in (heterozygous) parents of patients with multiple sulfatase deficiency. |
| T7980 |
15044-15046 |
DT |
denotes |
No |
| T7981 |
15047-15060 |
NN |
denotes |
co-occurrence |
| T7982 |
15080-15089 |
VBN |
denotes |
described |
| T7983 |
15061-15063 |
IN |
denotes |
of |
| T7984 |
15064-15070 |
NN |
denotes |
ataxia |
| T7985 |
15071-15074 |
VBZ |
denotes |
has |
| T7986 |
15075-15079 |
VBN |
denotes |
been |
| T7987 |
15090-15092 |
IN |
denotes |
in |
| T7988 |
15093-15094 |
-LRB- |
denotes |
( |
| T7989 |
15108-15115 |
NNS |
denotes |
parents |
| T7990 |
15094-15106 |
JJ |
denotes |
heterozygous |
| T7991 |
15106-15107 |
-RRB- |
denotes |
) |
| T7992 |
15116-15118 |
IN |
denotes |
of |
| T7993 |
15119-15127 |
NNS |
denotes |
patients |
| T7994 |
15128-15132 |
IN |
denotes |
with |
| T7995 |
15133-15141 |
JJ |
denotes |
multiple |
| T7996 |
15152-15162 |
NN |
denotes |
deficiency |
| T7997 |
15142-15151 |
NN |
denotes |
sulfatase |
| T7998 |
15162-15163 |
. |
denotes |
. |
| T7999 |
15163-15504 |
sentence |
denotes |
Conversely, mutation of ITPR1 is biologically plausible as a cause of ataxia: the protein is highly expressed in Purkinje cells; as we have shown here, mice with mutation at this locus present with ataxia; and perturbed Ca2+ signaling has previously been implicated in the etiology of ataxia, notably in episodic ataxia type 2 and SCA6 [8]. |
| T8000 |
15164-15174 |
RB |
denotes |
Conversely |
| T8001 |
15349-15356 |
VBP |
denotes |
present |
| T8002 |
15174-15176 |
, |
denotes |
, |
| T8003 |
15176-15184 |
NN |
denotes |
mutation |
| T8004 |
15194-15196 |
VBZ |
denotes |
is |
| T8005 |
15185-15187 |
IN |
denotes |
of |
| T8006 |
15188-15193 |
NN |
denotes |
ITPR1 |
| T8007 |
15197-15209 |
RB |
denotes |
biologically |
| T8008 |
15210-15219 |
JJ |
denotes |
plausible |
| T8009 |
15220-15222 |
IN |
denotes |
as |
| T8010 |
15223-15224 |
DT |
denotes |
a |
| T8011 |
15225-15230 |
NN |
denotes |
cause |
| T8012 |
15231-15233 |
IN |
denotes |
of |
| T8013 |
15234-15240 |
NN |
denotes |
ataxia |
| T8014 |
15240-15242 |
: |
denotes |
: |
| T8015 |
15242-15245 |
DT |
denotes |
the |
| T8016 |
15246-15253 |
NN |
denotes |
protein |
| T8017 |
15264-15273 |
VBN |
denotes |
expressed |
| T8018 |
15254-15256 |
VBZ |
denotes |
is |
| T8019 |
15257-15263 |
RB |
denotes |
highly |
| T8020 |
15274-15276 |
IN |
denotes |
in |
| T8021 |
15277-15285 |
NNP |
denotes |
Purkinje |
| T8022 |
15286-15291 |
NNS |
denotes |
cells |
| T8023 |
15291-15292 |
: |
denotes |
; |
| T8024 |
15293-15295 |
IN |
denotes |
as |
| T8025 |
15304-15309 |
VBN |
denotes |
shown |
| T8026 |
15296-15298 |
PRP |
denotes |
we |
| T8027 |
15299-15303 |
VBP |
denotes |
have |
| T8028 |
15310-15314 |
RB |
denotes |
here |
| T8029 |
15314-15316 |
, |
denotes |
, |
| T8030 |
15316-15320 |
NNS |
denotes |
mice |
| T8031 |
15321-15325 |
IN |
denotes |
with |
| T8032 |
15326-15334 |
NN |
denotes |
mutation |
| T8033 |
15335-15337 |
IN |
denotes |
at |
| T8034 |
15338-15342 |
DT |
denotes |
this |
| T8035 |
15343-15348 |
NN |
denotes |
locus |
| T8036 |
15357-15361 |
IN |
denotes |
with |
| T8037 |
15362-15368 |
NN |
denotes |
ataxia |
| T8038 |
15368-15369 |
: |
denotes |
; |
| T8039 |
15370-15373 |
CC |
denotes |
and |
| T8040 |
15374-15383 |
VBN |
denotes |
perturbed |
| T8041 |
15389-15398 |
NN |
denotes |
signaling |
| T8042 |
15384-15388 |
NN |
denotes |
Ca2+ |
| T8043 |
15419-15429 |
VBN |
denotes |
implicated |
| T8044 |
15399-15402 |
VBZ |
denotes |
has |
| T8045 |
15403-15413 |
RB |
denotes |
previously |
| T8046 |
15414-15418 |
VBN |
denotes |
been |
| T8047 |
15430-15432 |
IN |
denotes |
in |
| T8048 |
15433-15436 |
DT |
denotes |
the |
| T8049 |
15437-15445 |
NN |
denotes |
etiology |
| T8050 |
15446-15448 |
IN |
denotes |
of |
| T8051 |
15449-15455 |
NN |
denotes |
ataxia |
| T8052 |
15455-15457 |
, |
denotes |
, |
| T8053 |
15457-15464 |
RB |
denotes |
notably |
| T8054 |
15465-15467 |
IN |
denotes |
in |
| T8055 |
15468-15476 |
JJ |
denotes |
episodic |
| T8056 |
15484-15488 |
NN |
denotes |
type |
| T8057 |
15477-15483 |
NN |
denotes |
ataxia |
| T8058 |
15489-15490 |
CD |
denotes |
2 |
| T8059 |
15491-15494 |
CC |
denotes |
and |
| T8060 |
15495-15499 |
NN |
denotes |
SCA6 |
| T8061 |
15500-15501 |
-LRB- |
denotes |
[ |
| T8062 |
15501-15502 |
CD |
denotes |
8 |
| T8063 |
15502-15503 |
-RRB- |
denotes |
] |
| T8064 |
15503-15504 |
. |
denotes |
. |
| T8065 |
15504-15829 |
sentence |
denotes |
In further support of this conclusion, analysis of protein levels of ITPR1 in Epstein-Barr virus (EBV) immortalized lymphocytes from affected and unaffected AUS1 family members revealed that all affected members showed a dramatic decrease in ITPR1 levels when compared with the family member without the deletion (Figure 4). |
| T8066 |
15505-15507 |
IN |
denotes |
In |
| T8067 |
15682-15690 |
VBD |
denotes |
revealed |
| T8068 |
15508-15515 |
JJ |
denotes |
further |
| T8069 |
15516-15523 |
NN |
denotes |
support |
| T8070 |
15524-15526 |
IN |
denotes |
of |
| T8071 |
15527-15531 |
DT |
denotes |
this |
| T8072 |
15532-15542 |
NN |
denotes |
conclusion |
| T8073 |
15542-15544 |
, |
denotes |
, |
| T8074 |
15544-15552 |
NN |
denotes |
analysis |
| T8075 |
15553-15555 |
IN |
denotes |
of |
| T8076 |
15556-15563 |
NN |
denotes |
protein |
| T8077 |
15564-15570 |
NNS |
denotes |
levels |
| T8078 |
15571-15573 |
IN |
denotes |
of |
| T8079 |
15574-15579 |
NN |
denotes |
ITPR1 |
| T8080 |
15580-15582 |
IN |
denotes |
in |
| T8081 |
15583-15590 |
NN |
denotes |
Epstein |
| T8082 |
15591-15595 |
NN |
denotes |
Barr |
| T8083 |
15590-15591 |
HYPH |
denotes |
- |
| T8084 |
15596-15601 |
NN |
denotes |
virus |
| T8085 |
15621-15632 |
NNS |
denotes |
lymphocytes |
| T8086 |
15602-15603 |
-LRB- |
denotes |
( |
| T8087 |
15603-15606 |
NN |
denotes |
EBV |
| T8088 |
15606-15607 |
-RRB- |
denotes |
) |
| T8089 |
15608-15620 |
VBN |
denotes |
immortalized |
| T8090 |
15633-15637 |
IN |
denotes |
from |
| T8091 |
15638-15646 |
VBN |
denotes |
affected |
| T8092 |
15674-15681 |
NNS |
denotes |
members |
| T8093 |
15647-15650 |
CC |
denotes |
and |
| T8094 |
15651-15661 |
JJ |
denotes |
unaffected |
| T8095 |
15662-15666 |
NN |
denotes |
AUS1 |
| T8096 |
15667-15673 |
NN |
denotes |
family |
| T8097 |
15691-15695 |
IN |
denotes |
that |
| T8098 |
15717-15723 |
VBD |
denotes |
showed |
| T8099 |
15696-15699 |
DT |
denotes |
all |
| T8100 |
15709-15716 |
NNS |
denotes |
members |
| T8101 |
15700-15708 |
VBN |
denotes |
affected |
| T8102 |
15724-15725 |
DT |
denotes |
a |
| T8103 |
15735-15743 |
NN |
denotes |
decrease |
| T8104 |
15726-15734 |
JJ |
denotes |
dramatic |
| T8105 |
15744-15746 |
IN |
denotes |
in |
| T8106 |
15747-15752 |
NN |
denotes |
ITPR1 |
| T8107 |
15753-15759 |
NNS |
denotes |
levels |
| T8108 |
15760-15764 |
WRB |
denotes |
when |
| T8109 |
15765-15773 |
VBN |
denotes |
compared |
| T8110 |
15774-15778 |
IN |
denotes |
with |
| T8111 |
15779-15782 |
DT |
denotes |
the |
| T8112 |
15790-15796 |
NN |
denotes |
member |
| T8113 |
15783-15789 |
NN |
denotes |
family |
| T8114 |
15797-15804 |
IN |
denotes |
without |
| T8115 |
15805-15808 |
DT |
denotes |
the |
| T8116 |
15809-15817 |
NN |
denotes |
deletion |
| T8117 |
15818-15819 |
-LRB- |
denotes |
( |
| T8118 |
15819-15825 |
NN |
denotes |
Figure |
| T8119 |
15826-15827 |
CD |
denotes |
4 |
| T8120 |
15827-15828 |
-RRB- |
denotes |
) |
| T8121 |
15828-15829 |
. |
denotes |
. |
| T8122 |
15829-16631 |
sentence |
denotes |
Figure 4 Western Blot Analysis of ITPR1 Protein Levels in EBV Immortalized Lymphoblasts from AUS1 Family Members
Western blot performed to examine ITPR1 levels in EBV immortalized lymphocytes from AUS1 affected family members carrying the ITPR1 deletion and from an AUS1 family member of unknown disease status who does not carry the deletion. Notably the samples from patients with ITPR1 deletion show a dramatic decrease in ITPR1 levels. To demonstrate equal loading, these samples were diluted one in five, and the Western blot was repeated using an antibody against ACTB. Itpr1 contains three domains, an N-terminal inositol triphosphate binding domain, a coupling domain, and a C-terminal transmembrane domain; it also contains two protein kinase A phosphorylation sites and an ATP-binding site. |
| T8123 |
16407-16412 |
NN |
denotes |
Itpr1 |
| T8124 |
16413-16421 |
VBZ |
denotes |
contains |
| T8125 |
16555-16563 |
VBZ |
denotes |
contains |
| T8126 |
16422-16427 |
CD |
denotes |
three |
| T8127 |
16428-16435 |
NNS |
denotes |
domains |
| T8128 |
16435-16437 |
, |
denotes |
, |
| T8129 |
16437-16439 |
DT |
denotes |
an |
| T8130 |
16481-16487 |
NN |
denotes |
domain |
| T8131 |
16440-16441 |
NN |
denotes |
N |
| T8132 |
16442-16450 |
JJ |
denotes |
terminal |
| T8133 |
16441-16442 |
HYPH |
denotes |
- |
| T8134 |
16451-16459 |
NN |
denotes |
inositol |
| T8135 |
16460-16472 |
NN |
denotes |
triphosphate |
| T8136 |
16473-16480 |
NN |
denotes |
binding |
| T8137 |
16487-16489 |
, |
denotes |
, |
| T8138 |
16489-16490 |
DT |
denotes |
a |
| T8139 |
16500-16506 |
NN |
denotes |
domain |
| T8140 |
16491-16499 |
VBG |
denotes |
coupling |
| T8141 |
16506-16508 |
, |
denotes |
, |
| T8142 |
16508-16511 |
CC |
denotes |
and |
| T8143 |
16512-16513 |
DT |
denotes |
a |
| T8144 |
16539-16545 |
NN |
denotes |
domain |
| T8145 |
16514-16515 |
NN |
denotes |
C |
| T8146 |
16516-16524 |
JJ |
denotes |
terminal |
| T8147 |
16515-16516 |
HYPH |
denotes |
- |
| T8148 |
16525-16538 |
NN |
denotes |
transmembrane |
| T8149 |
16545-16546 |
: |
denotes |
; |
| T8150 |
16547-16549 |
PRP |
denotes |
it |
| T8151 |
16550-16554 |
RB |
denotes |
also |
| T8152 |
16564-16567 |
CD |
denotes |
two |
| T8153 |
16601-16606 |
NNS |
denotes |
sites |
| T8154 |
16568-16575 |
NN |
denotes |
protein |
| T8155 |
16583-16584 |
NN |
denotes |
A |
| T8156 |
16576-16582 |
NN |
denotes |
kinase |
| T8157 |
16585-16600 |
NN |
denotes |
phosphorylation |
| T8158 |
16607-16610 |
CC |
denotes |
and |
| T8159 |
16611-16613 |
DT |
denotes |
an |
| T8160 |
16626-16630 |
NN |
denotes |
site |
| T8161 |
16614-16617 |
NN |
denotes |
ATP |
| T8162 |
16618-16625 |
VBG |
denotes |
binding |
| T8163 |
16617-16618 |
HYPH |
denotes |
- |
| T8164 |
16630-16631 |
. |
denotes |
. |
| T8165 |
16631-16810 |
sentence |
denotes |
Itpr1 is coupled to Ca2+ channels and facilitates Ca2+ release from the endoplasmic reticulum after binding by the intracellular second messenger inositol 1,4,5-triphosphate [9]. |
| T8166 |
16632-16637 |
NN |
denotes |
Itpr1 |
| T8167 |
16641-16648 |
VBN |
denotes |
coupled |
| T8168 |
16638-16640 |
VBZ |
denotes |
is |
| T8169 |
16649-16651 |
IN |
denotes |
to |
| T8170 |
16652-16656 |
NN |
denotes |
Ca2+ |
| T8171 |
16657-16665 |
NNS |
denotes |
channels |
| T8172 |
16666-16669 |
CC |
denotes |
and |
| T8173 |
16670-16681 |
VBZ |
denotes |
facilitates |
| T8174 |
16682-16686 |
NN |
denotes |
Ca2+ |
| T8175 |
16687-16694 |
NN |
denotes |
release |
| T8176 |
16695-16699 |
IN |
denotes |
from |
| T8177 |
16700-16703 |
DT |
denotes |
the |
| T8178 |
16716-16725 |
NN |
denotes |
reticulum |
| T8179 |
16704-16715 |
JJ |
denotes |
endoplasmic |
| T8180 |
16726-16731 |
IN |
denotes |
after |
| T8181 |
16732-16739 |
NN |
denotes |
binding |
| T8182 |
16740-16742 |
IN |
denotes |
by |
| T8183 |
16743-16746 |
DT |
denotes |
the |
| T8184 |
16768-16777 |
NN |
denotes |
messenger |
| T8185 |
16747-16760 |
JJ |
denotes |
intracellular |
| T8186 |
16761-16767 |
JJ |
denotes |
second |
| T8187 |
16778-16786 |
NN |
denotes |
inositol |
| T8188 |
16793-16805 |
NN |
denotes |
triphosphate |
| T8189 |
16787-16788 |
CD |
denotes |
1 |
| T8190 |
16791-16792 |
CD |
denotes |
5 |
| T8191 |
16788-16789 |
, |
denotes |
, |
| T8192 |
16789-16790 |
CD |
denotes |
4 |
| T8193 |
16790-16791 |
, |
denotes |
, |
| T8194 |
16792-16793 |
HYPH |
denotes |
- |
| T8195 |
16806-16807 |
-LRB- |
denotes |
[ |
| T8196 |
16807-16808 |
CD |
denotes |
9 |
| T8197 |
16808-16809 |
-RRB- |
denotes |
] |
| T8198 |
16809-16810 |
. |
denotes |
. |
| T8199 |
16810-16873 |
sentence |
denotes |
Itpr1 is enriched in the Purkinje cells of the cerebellum [4]. |
| T8200 |
16811-16816 |
NN |
denotes |
Itpr1 |
| T8201 |
16820-16828 |
VBN |
denotes |
enriched |
| T8202 |
16817-16819 |
VBZ |
denotes |
is |
| T8203 |
16829-16831 |
IN |
denotes |
in |
| T8204 |
16832-16835 |
DT |
denotes |
the |
| T8205 |
16845-16850 |
NNS |
denotes |
cells |
| T8206 |
16836-16844 |
NNP |
denotes |
Purkinje |
| T8207 |
16851-16853 |
IN |
denotes |
of |
| T8208 |
16854-16857 |
DT |
denotes |
the |
| T8209 |
16858-16868 |
NN |
denotes |
cerebellum |
| T8210 |
16869-16870 |
-LRB- |
denotes |
[ |
| T8211 |
16870-16871 |
CD |
denotes |
4 |
| T8212 |
16871-16872 |
-RRB- |
denotes |
] |
| T8213 |
16872-16873 |
. |
denotes |
. |
| T8214 |
16873-16940 |
sentence |
denotes |
ITPR1 mutations have more than one potential pathogenic mechanism. |
| T8215 |
16874-16879 |
NN |
denotes |
ITPR1 |
| T8216 |
16880-16889 |
NNS |
denotes |
mutations |
| T8217 |
16890-16894 |
VBP |
denotes |
have |
| T8218 |
16895-16899 |
JJR |
denotes |
more |
| T8219 |
16905-16908 |
CD |
denotes |
one |
| T8220 |
16900-16904 |
IN |
denotes |
than |
| T8221 |
16930-16939 |
NN |
denotes |
mechanism |
| T8222 |
16909-16918 |
JJ |
denotes |
potential |
| T8223 |
16919-16929 |
JJ |
denotes |
pathogenic |
| T8224 |
16939-16940 |
. |
denotes |
. |
| T8225 |
16940-17264 |
sentence |
denotes |
First, the disease may be a result of haploinsufficiency at ITPR1; this concept is consistent with the observation that heterozygous deletion leads to a later onset disorder in humans, whereas homozygous deletion in mice leads to an early onset disorder, able to be expressed within the much shorter life span of the mouse. |
| T8226 |
16941-16946 |
RB |
denotes |
First |
| T8227 |
17021-17023 |
VBZ |
denotes |
is |
| T8228 |
16946-16948 |
, |
denotes |
, |
| T8229 |
16948-16951 |
DT |
denotes |
the |
| T8230 |
16952-16959 |
NN |
denotes |
disease |
| T8231 |
16964-16966 |
VB |
denotes |
be |
| T8232 |
16960-16963 |
MD |
denotes |
may |
| T8233 |
16967-16968 |
DT |
denotes |
a |
| T8234 |
16969-16975 |
NN |
denotes |
result |
| T8235 |
16976-16978 |
IN |
denotes |
of |
| T8236 |
16979-16997 |
NN |
denotes |
haploinsufficiency |
| T8237 |
16998-17000 |
IN |
denotes |
at |
| T8238 |
17001-17006 |
NN |
denotes |
ITPR1 |
| T8239 |
17006-17007 |
: |
denotes |
; |
| T8240 |
17008-17012 |
DT |
denotes |
this |
| T8241 |
17013-17020 |
NN |
denotes |
concept |
| T8242 |
17024-17034 |
JJ |
denotes |
consistent |
| T8243 |
17035-17039 |
IN |
denotes |
with |
| T8244 |
17040-17043 |
DT |
denotes |
the |
| T8245 |
17044-17055 |
NN |
denotes |
observation |
| T8246 |
17056-17060 |
IN |
denotes |
that |
| T8247 |
17083-17088 |
VBZ |
denotes |
leads |
| T8248 |
17061-17073 |
JJ |
denotes |
heterozygous |
| T8249 |
17074-17082 |
NN |
denotes |
deletion |
| T8250 |
17089-17091 |
IN |
denotes |
to |
| T8251 |
17092-17093 |
DT |
denotes |
a |
| T8252 |
17106-17114 |
NN |
denotes |
disorder |
| T8253 |
17094-17099 |
JJ |
denotes |
later |
| T8254 |
17100-17105 |
NN |
denotes |
onset |
| T8255 |
17115-17117 |
IN |
denotes |
in |
| T8256 |
17118-17124 |
NNS |
denotes |
humans |
| T8257 |
17124-17126 |
, |
denotes |
, |
| T8258 |
17126-17133 |
IN |
denotes |
whereas |
| T8259 |
17162-17167 |
VBZ |
denotes |
leads |
| T8260 |
17134-17144 |
JJ |
denotes |
homozygous |
| T8261 |
17145-17153 |
NN |
denotes |
deletion |
| T8262 |
17154-17156 |
IN |
denotes |
in |
| T8263 |
17157-17161 |
NNS |
denotes |
mice |
| T8264 |
17168-17170 |
IN |
denotes |
to |
| T8265 |
17171-17173 |
DT |
denotes |
an |
| T8266 |
17186-17194 |
NN |
denotes |
disorder |
| T8267 |
17174-17179 |
JJ |
denotes |
early |
| T8268 |
17180-17185 |
NN |
denotes |
onset |
| T8269 |
17194-17196 |
, |
denotes |
, |
| T8270 |
17196-17200 |
JJ |
denotes |
able |
| T8271 |
17201-17203 |
TO |
denotes |
to |
| T8272 |
17207-17216 |
VBN |
denotes |
expressed |
| T8273 |
17204-17206 |
VB |
denotes |
be |
| T8274 |
17217-17223 |
IN |
denotes |
within |
| T8275 |
17224-17227 |
DT |
denotes |
the |
| T8276 |
17246-17250 |
NN |
denotes |
span |
| T8277 |
17228-17232 |
RB |
denotes |
much |
| T8278 |
17233-17240 |
JJR |
denotes |
shorter |
| T8279 |
17241-17245 |
NN |
denotes |
life |
| T8280 |
17251-17253 |
IN |
denotes |
of |
| T8281 |
17254-17257 |
DT |
denotes |
the |
| T8282 |
17258-17263 |
NN |
denotes |
mouse |
| T8283 |
17263-17264 |
. |
denotes |
. |
| T8284 |
17264-17667 |
sentence |
denotes |
Second, we cannot rule out the existence of an alternate start site for ITPR1 that may result in a product that confers a pathogenic gain of function to the protein; however, Western blot analysis of cells derived from affected AUS1 family members, which was performed using an antibody raised against the C-terminal portion of ITPR1, failed to identify any disease-specific truncated protein products. |
| T8285 |
17265-17271 |
RB |
denotes |
Second |
| T8286 |
17600-17606 |
VBD |
denotes |
failed |
| T8287 |
17271-17273 |
, |
denotes |
, |
| T8288 |
17273-17275 |
PRP |
denotes |
we |
| T8289 |
17283-17287 |
VB |
denotes |
rule |
| T8290 |
17276-17279 |
MD |
denotes |
can |
| T8291 |
17279-17282 |
RB |
denotes |
not |
| T8292 |
17288-17291 |
RP |
denotes |
out |
| T8293 |
17292-17295 |
DT |
denotes |
the |
| T8294 |
17296-17305 |
NN |
denotes |
existence |
| T8295 |
17306-17308 |
IN |
denotes |
of |
| T8296 |
17309-17311 |
DT |
denotes |
an |
| T8297 |
17328-17332 |
NN |
denotes |
site |
| T8298 |
17312-17321 |
JJ |
denotes |
alternate |
| T8299 |
17322-17327 |
NN |
denotes |
start |
| T8300 |
17333-17336 |
IN |
denotes |
for |
| T8301 |
17337-17342 |
NN |
denotes |
ITPR1 |
| T8302 |
17343-17347 |
WDT |
denotes |
that |
| T8303 |
17352-17358 |
VB |
denotes |
result |
| T8304 |
17348-17351 |
MD |
denotes |
may |
| T8305 |
17359-17361 |
IN |
denotes |
in |
| T8306 |
17362-17363 |
DT |
denotes |
a |
| T8307 |
17364-17371 |
NN |
denotes |
product |
| T8308 |
17372-17376 |
WDT |
denotes |
that |
| T8309 |
17377-17384 |
VBZ |
denotes |
confers |
| T8310 |
17385-17386 |
DT |
denotes |
a |
| T8311 |
17398-17402 |
NN |
denotes |
gain |
| T8312 |
17387-17397 |
JJ |
denotes |
pathogenic |
| T8313 |
17403-17405 |
IN |
denotes |
of |
| T8314 |
17406-17414 |
NN |
denotes |
function |
| T8315 |
17415-17417 |
IN |
denotes |
to |
| T8316 |
17418-17421 |
DT |
denotes |
the |
| T8317 |
17422-17429 |
NN |
denotes |
protein |
| T8318 |
17429-17430 |
: |
denotes |
; |
| T8319 |
17431-17438 |
RB |
denotes |
however |
| T8320 |
17438-17440 |
, |
denotes |
, |
| T8321 |
17440-17447 |
NNP |
denotes |
Western |
| T8322 |
17448-17452 |
NN |
denotes |
blot |
| T8323 |
17453-17461 |
NN |
denotes |
analysis |
| T8324 |
17462-17464 |
IN |
denotes |
of |
| T8325 |
17465-17470 |
NNS |
denotes |
cells |
| T8326 |
17471-17478 |
VBN |
denotes |
derived |
| T8327 |
17479-17483 |
IN |
denotes |
from |
| T8328 |
17484-17492 |
VBN |
denotes |
affected |
| T8329 |
17505-17512 |
NNS |
denotes |
members |
| T8330 |
17493-17497 |
NN |
denotes |
AUS1 |
| T8331 |
17498-17504 |
NN |
denotes |
family |
| T8332 |
17512-17514 |
, |
denotes |
, |
| T8333 |
17514-17519 |
WDT |
denotes |
which |
| T8334 |
17524-17533 |
VBN |
denotes |
performed |
| T8335 |
17520-17523 |
VBD |
denotes |
was |
| T8336 |
17534-17539 |
VBG |
denotes |
using |
| T8337 |
17540-17542 |
DT |
denotes |
an |
| T8338 |
17543-17551 |
NN |
denotes |
antibody |
| T8339 |
17552-17558 |
VBN |
denotes |
raised |
| T8340 |
17559-17566 |
IN |
denotes |
against |
| T8341 |
17567-17570 |
DT |
denotes |
the |
| T8342 |
17582-17589 |
NN |
denotes |
portion |
| T8343 |
17571-17572 |
NN |
denotes |
C |
| T8344 |
17573-17581 |
JJ |
denotes |
terminal |
| T8345 |
17572-17573 |
HYPH |
denotes |
- |
| T8346 |
17590-17592 |
IN |
denotes |
of |
| T8347 |
17593-17598 |
NN |
denotes |
ITPR1 |
| T8348 |
17598-17600 |
, |
denotes |
, |
| T8349 |
17607-17609 |
TO |
denotes |
to |
| T8350 |
17610-17618 |
VB |
denotes |
identify |
| T8351 |
17619-17622 |
DT |
denotes |
any |
| T8352 |
17658-17666 |
NNS |
denotes |
products |
| T8353 |
17623-17630 |
NN |
denotes |
disease |
| T8354 |
17631-17639 |
JJ |
denotes |
specific |
| T8355 |
17630-17631 |
HYPH |
denotes |
- |
| T8356 |
17640-17649 |
VBN |
denotes |
truncated |
| T8357 |
17650-17657 |
NN |
denotes |
protein |
| T8358 |
17666-17667 |
. |
denotes |
. |
| T8359 |
17667-17803 |
sentence |
denotes |
Clearly, the identification of distinct ITPR1 mutations underlying SCA15 will help elucidate the pathogenic mechanism of this disorder. |
| T8360 |
17668-17675 |
RB |
denotes |
Clearly |
| T8361 |
17746-17750 |
VB |
denotes |
help |
| T8362 |
17675-17677 |
, |
denotes |
, |
| T8363 |
17677-17680 |
DT |
denotes |
the |
| T8364 |
17681-17695 |
NN |
denotes |
identification |
| T8365 |
17696-17698 |
IN |
denotes |
of |
| T8366 |
17699-17707 |
JJ |
denotes |
distinct |
| T8367 |
17714-17723 |
NNS |
denotes |
mutations |
| T8368 |
17708-17713 |
NN |
denotes |
ITPR1 |
| T8369 |
17724-17734 |
VBG |
denotes |
underlying |
| T8370 |
17735-17740 |
NN |
denotes |
SCA15 |
| T8371 |
17741-17745 |
MD |
denotes |
will |
| T8372 |
17751-17760 |
VB |
denotes |
elucidate |
| T8373 |
17761-17764 |
DT |
denotes |
the |
| T8374 |
17776-17785 |
NN |
denotes |
mechanism |
| T8375 |
17765-17775 |
JJ |
denotes |
pathogenic |
| T8376 |
17786-17788 |
IN |
denotes |
of |
| T8377 |
17789-17793 |
DT |
denotes |
this |
| T8378 |
17794-17802 |
NN |
denotes |
disorder |
| T8379 |
17802-17803 |
. |
denotes |
. |
| T8380 |
17803-17905 |
sentence |
denotes |
We show here the utility of investigating spontaneous mouse mutations in understanding human disease. |
| T8381 |
17804-17806 |
PRP |
denotes |
We |
| T8382 |
17807-17811 |
VBP |
denotes |
show |
| T8383 |
17812-17816 |
RB |
denotes |
here |
| T8384 |
17817-17820 |
DT |
denotes |
the |
| T8385 |
17821-17828 |
NN |
denotes |
utility |
| T8386 |
17829-17831 |
IN |
denotes |
of |
| T8387 |
17832-17845 |
VBG |
denotes |
investigating |
| T8388 |
17846-17857 |
JJ |
denotes |
spontaneous |
| T8389 |
17864-17873 |
NNS |
denotes |
mutations |
| T8390 |
17858-17863 |
NN |
denotes |
mouse |
| T8391 |
17874-17876 |
IN |
denotes |
in |
| T8392 |
17877-17890 |
VBG |
denotes |
understanding |
| T8393 |
17891-17896 |
JJ |
denotes |
human |
| T8394 |
17897-17904 |
NN |
denotes |
disease |
| T8395 |
17904-17905 |
. |
denotes |
. |
| T8396 |
17905-18152 |
sentence |
denotes |
Currently, the small number of aged Itpr1wt/Δ18 animals precludes us from examining these mice for subtle signs and symptoms similar to those seen in SCA15 patients; however, these mice are clearly of interest to us as a potential model of SCA15. |
| T8397 |
17906-17915 |
RB |
denotes |
Currently |
| T8398 |
17962-17971 |
VBZ |
denotes |
precludes |
| T8399 |
17915-17917 |
, |
denotes |
, |
| T8400 |
17917-17920 |
DT |
denotes |
the |
| T8401 |
17927-17933 |
NN |
denotes |
number |
| T8402 |
17921-17926 |
JJ |
denotes |
small |
| T8403 |
17934-17936 |
IN |
denotes |
of |
| T8404 |
17937-17941 |
VBN |
denotes |
aged |
| T8405 |
17954-17961 |
NNS |
denotes |
animals |
| T8406 |
17942-17949 |
NN |
denotes |
Itpr1wt |
| T8407 |
17950-17953 |
NN |
denotes |
Δ18 |
| T8408 |
17949-17950 |
HYPH |
denotes |
/ |
| T8409 |
18092-18095 |
VBP |
denotes |
are |
| T8410 |
17972-17974 |
PRP |
denotes |
us |
| T8411 |
17975-17979 |
IN |
denotes |
from |
| T8412 |
17980-17989 |
VBG |
denotes |
examining |
| T8413 |
17990-17995 |
DT |
denotes |
these |
| T8414 |
17996-18000 |
NNS |
denotes |
mice |
| T8415 |
18001-18004 |
IN |
denotes |
for |
| T8416 |
18005-18011 |
JJ |
denotes |
subtle |
| T8417 |
18012-18017 |
NNS |
denotes |
signs |
| T8418 |
18018-18021 |
CC |
denotes |
and |
| T8419 |
18022-18030 |
NNS |
denotes |
symptoms |
| T8420 |
18031-18038 |
JJ |
denotes |
similar |
| T8421 |
18039-18041 |
IN |
denotes |
to |
| T8422 |
18042-18047 |
DT |
denotes |
those |
| T8423 |
18048-18052 |
VBN |
denotes |
seen |
| T8424 |
18053-18055 |
IN |
denotes |
in |
| T8425 |
18056-18061 |
NN |
denotes |
SCA15 |
| T8426 |
18062-18070 |
NNS |
denotes |
patients |
| T8427 |
18070-18071 |
: |
denotes |
; |
| T8428 |
18072-18079 |
RB |
denotes |
however |
| T8429 |
18079-18081 |
, |
denotes |
, |
| T8430 |
18081-18086 |
DT |
denotes |
these |
| T8431 |
18087-18091 |
NNS |
denotes |
mice |
| T8432 |
18096-18103 |
RB |
denotes |
clearly |
| T8433 |
18104-18106 |
IN |
denotes |
of |
| T8434 |
18107-18115 |
NN |
denotes |
interest |
| T8435 |
18116-18118 |
IN |
denotes |
to |
| T8436 |
18119-18121 |
PRP |
denotes |
us |
| T8437 |
18122-18124 |
IN |
denotes |
as |
| T8438 |
18125-18126 |
DT |
denotes |
a |
| T8439 |
18137-18142 |
NN |
denotes |
model |
| T8440 |
18127-18136 |
JJ |
denotes |
potential |
| T8441 |
18143-18145 |
IN |
denotes |
of |
| T8442 |
18146-18151 |
NN |
denotes |
SCA15 |
| T8443 |
18151-18152 |
. |
denotes |
. |
| T8444 |
18152-18297 |
sentence |
denotes |
These data also demonstrate that genome-wide SNP assay can facilitate rapid detection of structural genomic mutations that may underlie disease. |
| T8445 |
18153-18158 |
DT |
denotes |
These |
| T8446 |
18159-18163 |
NNS |
denotes |
data |
| T8447 |
18169-18180 |
VBP |
denotes |
demonstrate |
| T8448 |
18164-18168 |
RB |
denotes |
also |
| T8449 |
18181-18185 |
IN |
denotes |
that |
| T8450 |
18212-18222 |
VB |
denotes |
facilitate |
| T8451 |
18186-18192 |
NN |
denotes |
genome |
| T8452 |
18193-18197 |
JJ |
denotes |
wide |
| T8453 |
18192-18193 |
HYPH |
denotes |
- |
| T8454 |
18202-18207 |
NN |
denotes |
assay |
| T8455 |
18198-18201 |
NN |
denotes |
SNP |
| T8456 |
18208-18211 |
MD |
denotes |
can |
| T8457 |
18223-18228 |
JJ |
denotes |
rapid |
| T8458 |
18229-18238 |
NN |
denotes |
detection |
| T8459 |
18239-18241 |
IN |
denotes |
of |
| T8460 |
18242-18252 |
JJ |
denotes |
structural |
| T8461 |
18261-18270 |
NNS |
denotes |
mutations |
| T8462 |
18253-18260 |
JJ |
denotes |
genomic |
| T8463 |
18271-18275 |
WDT |
denotes |
that |
| T8464 |
18280-18288 |
VB |
denotes |
underlie |
| T8465 |
18276-18279 |
MD |
denotes |
may |
| T8466 |
18289-18296 |
NN |
denotes |
disease |
| T8467 |
18296-18297 |
. |
denotes |
. |
| T8468 |
18297-18413 |
sentence |
denotes |
The data provided by these approaches provide compelling evidence that heterozygous deletion of ITPR1 causes SCA15. |
| T8469 |
18298-18301 |
DT |
denotes |
The |
| T8470 |
18302-18306 |
NNS |
denotes |
data |
| T8471 |
18336-18343 |
VBP |
denotes |
provide |
| T8472 |
18307-18315 |
VBN |
denotes |
provided |
| T8473 |
18316-18318 |
IN |
denotes |
by |
| T8474 |
18319-18324 |
DT |
denotes |
these |
| T8475 |
18325-18335 |
NNS |
denotes |
approaches |
| T8476 |
18344-18354 |
JJ |
denotes |
compelling |
| T8477 |
18355-18363 |
NN |
denotes |
evidence |
| T8478 |
18364-18368 |
IN |
denotes |
that |
| T8479 |
18400-18406 |
VBZ |
denotes |
causes |
| T8480 |
18369-18381 |
JJ |
denotes |
heterozygous |
| T8481 |
18382-18390 |
NN |
denotes |
deletion |
| T8482 |
18391-18393 |
IN |
denotes |
of |
| T8483 |
18394-18399 |
NN |
denotes |
ITPR1 |
| T8484 |
18407-18412 |
NN |
denotes |
SCA15 |
| T8485 |
18412-18413 |
. |
denotes |
. |
| T8486 |
18413-18805 |
sentence |
denotes |
Clearly, sequence analysis of ITPR1 in potential SCA15 cases may provide additional insight into the disease, particularly if a stop mutation were to be identified; however, the mutational mechanism noted here means that standard sequencing approaches alone are insufficient to confidently rule out ITPR1 mutation as a cause of disease: a comprehensive gene dosage approach is also required. |
| T8487 |
18414-18421 |
RB |
denotes |
Clearly |
| T8488 |
18479-18486 |
VB |
denotes |
provide |
| T8489 |
18421-18423 |
, |
denotes |
, |
| T8490 |
18423-18431 |
NN |
denotes |
sequence |
| T8491 |
18432-18440 |
NN |
denotes |
analysis |
| T8492 |
18441-18443 |
IN |
denotes |
of |
| T8493 |
18444-18449 |
NN |
denotes |
ITPR1 |
| T8494 |
18450-18452 |
IN |
denotes |
in |
| T8495 |
18453-18462 |
JJ |
denotes |
potential |
| T8496 |
18469-18474 |
NNS |
denotes |
cases |
| T8497 |
18463-18468 |
NN |
denotes |
SCA15 |
| T8498 |
18475-18478 |
MD |
denotes |
may |
| T8499 |
18624-18629 |
VBZ |
denotes |
means |
| T8500 |
18487-18497 |
JJ |
denotes |
additional |
| T8501 |
18498-18505 |
NN |
denotes |
insight |
| T8502 |
18506-18510 |
IN |
denotes |
into |
| T8503 |
18511-18514 |
DT |
denotes |
the |
| T8504 |
18515-18522 |
NN |
denotes |
disease |
| T8505 |
18522-18524 |
, |
denotes |
, |
| T8506 |
18524-18536 |
RB |
denotes |
particularly |
| T8507 |
18556-18560 |
VBD |
denotes |
were |
| T8508 |
18537-18539 |
IN |
denotes |
if |
| T8509 |
18540-18541 |
DT |
denotes |
a |
| T8510 |
18547-18555 |
NN |
denotes |
mutation |
| T8511 |
18542-18546 |
NN |
denotes |
stop |
| T8512 |
18561-18563 |
TO |
denotes |
to |
| T8513 |
18567-18577 |
VBN |
denotes |
identified |
| T8514 |
18564-18566 |
VB |
denotes |
be |
| T8515 |
18577-18578 |
: |
denotes |
; |
| T8516 |
18579-18586 |
RB |
denotes |
however |
| T8517 |
18586-18588 |
, |
denotes |
, |
| T8518 |
18588-18591 |
DT |
denotes |
the |
| T8519 |
18603-18612 |
NN |
denotes |
mechanism |
| T8520 |
18592-18602 |
JJ |
denotes |
mutational |
| T8521 |
18613-18618 |
VBN |
denotes |
noted |
| T8522 |
18619-18623 |
RB |
denotes |
here |
| T8523 |
18630-18634 |
IN |
denotes |
that |
| T8524 |
18796-18804 |
VBN |
denotes |
required |
| T8525 |
18635-18643 |
JJ |
denotes |
standard |
| T8526 |
18655-18665 |
NNS |
denotes |
approaches |
| T8527 |
18644-18654 |
NN |
denotes |
sequencing |
| T8528 |
18672-18675 |
VBP |
denotes |
are |
| T8529 |
18666-18671 |
RB |
denotes |
alone |
| T8530 |
18676-18688 |
JJ |
denotes |
insufficient |
| T8531 |
18689-18691 |
TO |
denotes |
to |
| T8532 |
18704-18708 |
VB |
denotes |
rule |
| T8533 |
18692-18703 |
RB |
denotes |
confidently |
| T8534 |
18709-18712 |
RP |
denotes |
out |
| T8535 |
18713-18718 |
NN |
denotes |
ITPR1 |
| T8536 |
18719-18727 |
NN |
denotes |
mutation |
| T8537 |
18728-18730 |
IN |
denotes |
as |
| T8538 |
18731-18732 |
DT |
denotes |
a |
| T8539 |
18733-18738 |
NN |
denotes |
cause |
| T8540 |
18739-18741 |
IN |
denotes |
of |
| T8541 |
18742-18749 |
NN |
denotes |
disease |
| T8542 |
18749-18751 |
: |
denotes |
: |
| T8543 |
18751-18752 |
DT |
denotes |
a |
| T8544 |
18779-18787 |
NN |
denotes |
approach |
| T8545 |
18753-18766 |
JJ |
denotes |
comprehensive |
| T8546 |
18767-18771 |
NN |
denotes |
gene |
| T8547 |
18772-18778 |
NN |
denotes |
dosage |
| T8548 |
18788-18790 |
VBZ |
denotes |
is |
| T8549 |
18791-18795 |
RB |
denotes |
also |
| T8550 |
18804-18805 |
. |
denotes |
. |
| T8551 |
18805-19025 |
sentence |
denotes |
Given that SCA16 and autosomal dominant congenital nonprogressive ataxia have both recently been mapped to regions overlapping with the SCA15 locus [10,11], ITPR1 is a gene of importance for screening in these families. |
| T8552 |
18806-18811 |
VBN |
denotes |
Given |
| T8553 |
18969-18971 |
VBZ |
denotes |
is |
| T8554 |
18812-18816 |
IN |
denotes |
that |
| T8555 |
18903-18909 |
VBN |
denotes |
mapped |
| T8556 |
18817-18822 |
NN |
denotes |
SCA16 |
| T8557 |
18823-18826 |
CC |
denotes |
and |
| T8558 |
18827-18836 |
JJ |
denotes |
autosomal |
| T8559 |
18872-18878 |
NN |
denotes |
ataxia |
| T8560 |
18837-18845 |
JJ |
denotes |
dominant |
| T8561 |
18846-18856 |
JJ |
denotes |
congenital |
| T8562 |
18857-18871 |
JJ |
denotes |
nonprogressive |
| T8563 |
18879-18883 |
VBP |
denotes |
have |
| T8564 |
18884-18888 |
DT |
denotes |
both |
| T8565 |
18889-18897 |
RB |
denotes |
recently |
| T8566 |
18898-18902 |
VBN |
denotes |
been |
| T8567 |
18910-18912 |
IN |
denotes |
to |
| T8568 |
18913-18920 |
NNS |
denotes |
regions |
| T8569 |
18921-18932 |
VBG |
denotes |
overlapping |
| T8570 |
18933-18937 |
IN |
denotes |
with |
| T8571 |
18938-18941 |
DT |
denotes |
the |
| T8572 |
18948-18953 |
NN |
denotes |
locus |
| T8573 |
18942-18947 |
NN |
denotes |
SCA15 |
| T8574 |
18954-18955 |
-LRB- |
denotes |
[ |
| T8575 |
18958-18960 |
CD |
denotes |
11 |
| T8576 |
18955-18957 |
CD |
denotes |
10 |
| T8577 |
18957-18958 |
, |
denotes |
, |
| T8578 |
18960-18961 |
-RRB- |
denotes |
] |
| T8579 |
18961-18963 |
, |
denotes |
, |
| T8580 |
18963-18968 |
NN |
denotes |
ITPR1 |
| T8581 |
18972-18973 |
DT |
denotes |
a |
| T8582 |
18974-18978 |
NN |
denotes |
gene |
| T8583 |
18979-18981 |
IN |
denotes |
of |
| T8584 |
18982-18992 |
NN |
denotes |
importance |
| T8585 |
18993-18996 |
IN |
denotes |
for |
| T8586 |
18997-19006 |
NN |
denotes |
screening |
| T8587 |
19007-19009 |
IN |
denotes |
in |
| T8588 |
19010-19015 |
DT |
denotes |
these |
| T8589 |
19016-19024 |
NNS |
denotes |
families |
| T8590 |
19024-19025 |
. |
denotes |
. |
| T8591 |
19025-19164 |
sentence |
denotes |
These data add weight to a role for aberrant intracellular Ca2+ signaling in Purkinje cells in the pathogenesis of spinocerebellar ataxia. |
| T8592 |
19026-19031 |
DT |
denotes |
These |
| T8593 |
19032-19036 |
NNS |
denotes |
data |
| T8594 |
19037-19040 |
VBP |
denotes |
add |
| T8595 |
19041-19047 |
NN |
denotes |
weight |
| T8596 |
19048-19050 |
IN |
denotes |
to |
| T8597 |
19051-19052 |
DT |
denotes |
a |
| T8598 |
19053-19057 |
NN |
denotes |
role |
| T8599 |
19058-19061 |
IN |
denotes |
for |
| T8600 |
19062-19070 |
JJ |
denotes |
aberrant |
| T8601 |
19090-19099 |
NN |
denotes |
signaling |
| T8602 |
19071-19084 |
JJ |
denotes |
intracellular |
| T8603 |
19085-19089 |
NN |
denotes |
Ca2+ |
| T8604 |
19100-19102 |
IN |
denotes |
in |
| T8605 |
19103-19111 |
NNP |
denotes |
Purkinje |
| T8606 |
19112-19117 |
NNS |
denotes |
cells |
| T8607 |
19118-19120 |
IN |
denotes |
in |
| T8608 |
19121-19124 |
DT |
denotes |
the |
| T8609 |
19125-19137 |
NN |
denotes |
pathogenesis |
| T8610 |
19138-19140 |
IN |
denotes |
of |
| T8611 |
19141-19156 |
JJ |
denotes |
spinocerebellar |
| T8612 |
19157-19163 |
NN |
denotes |
ataxia |
| T8613 |
19163-19164 |
. |
denotes |
. |
| T8971 |
19189-19195 |
NN |
denotes |
Genome |
| T8972 |
19196-19200 |
JJ |
denotes |
wide |
| T8973 |
19195-19196 |
HYPH |
denotes |
- |
| T8974 |
19201-19208 |
NN |
denotes |
linkage |
| T8975 |
19209-19211 |
IN |
denotes |
in |
| T8976 |
19212-19216 |
NNS |
denotes |
mice |
| T8977 |
19216-19217 |
. |
denotes |
. |
| T8978 |
19217-19423 |
sentence |
denotes |
One hundred and twenty DNA fragments were amplified across the genome, each selected to contain one or more strain-specific SNPs that would differentiate between C57BL/6J and 129x1/SvJ inbred strains [12]. |
| T8979 |
19218-19221 |
CD |
denotes |
One |
| T8980 |
19222-19229 |
CD |
denotes |
hundred |
| T8981 |
19245-19254 |
NNS |
denotes |
fragments |
| T8982 |
19230-19233 |
CC |
denotes |
and |
| T8983 |
19234-19240 |
CD |
denotes |
twenty |
| T8984 |
19241-19244 |
NN |
denotes |
DNA |
| T8985 |
19260-19269 |
VBN |
denotes |
amplified |
| T8986 |
19255-19259 |
VBD |
denotes |
were |
| T8987 |
19270-19276 |
IN |
denotes |
across |
| T8988 |
19277-19280 |
DT |
denotes |
the |
| T8989 |
19281-19287 |
NN |
denotes |
genome |
| T8990 |
19287-19289 |
, |
denotes |
, |
| T8991 |
19289-19293 |
DT |
denotes |
each |
| T8992 |
19294-19302 |
VBN |
denotes |
selected |
| T8993 |
19303-19305 |
TO |
denotes |
to |
| T8994 |
19306-19313 |
VB |
denotes |
contain |
| T8995 |
19314-19317 |
CD |
denotes |
one |
| T8996 |
19342-19346 |
NNS |
denotes |
SNPs |
| T8997 |
19318-19320 |
CC |
denotes |
or |
| T8998 |
19321-19325 |
JJR |
denotes |
more |
| T8999 |
19326-19332 |
NN |
denotes |
strain |
| T9000 |
19333-19341 |
JJ |
denotes |
specific |
| T9001 |
19332-19333 |
HYPH |
denotes |
- |
| T9002 |
19347-19351 |
WDT |
denotes |
that |
| T9003 |
19358-19371 |
VB |
denotes |
differentiate |
| T9004 |
19352-19357 |
MD |
denotes |
would |
| T9005 |
19372-19379 |
IN |
denotes |
between |
| T9006 |
19380-19385 |
NN |
denotes |
C57BL |
| T9007 |
19386-19388 |
NN |
denotes |
6J |
| T9008 |
19385-19386 |
HYPH |
denotes |
/ |
| T9009 |
19410-19417 |
NNS |
denotes |
strains |
| T9010 |
19389-19392 |
CC |
denotes |
and |
| T9011 |
19393-19398 |
NN |
denotes |
129x1 |
| T9012 |
19399-19402 |
NN |
denotes |
SvJ |
| T9013 |
19398-19399 |
HYPH |
denotes |
/ |
| T9014 |
19403-19409 |
JJ |
denotes |
inbred |
| T9015 |
19418-19419 |
-LRB- |
denotes |
[ |
| T9016 |
19419-19421 |
CD |
denotes |
12 |
| T9017 |
19421-19422 |
-RRB- |
denotes |
] |
| T9018 |
19422-19423 |
. |
denotes |
. |
| T9019 |
19423-19587 |
sentence |
denotes |
Each fragment was initially amplified in 11 affected mice and nine unaffected mice; genotype calling was performed by dye-terminator sequencing of these fragments. |
| T9020 |
19424-19428 |
DT |
denotes |
Each |
| T9021 |
19429-19437 |
NN |
denotes |
fragment |
| T9022 |
19452-19461 |
VBN |
denotes |
amplified |
| T9023 |
19438-19441 |
VBD |
denotes |
was |
| T9024 |
19442-19451 |
RB |
denotes |
initially |
| T9025 |
19529-19538 |
VBN |
denotes |
performed |
| T9026 |
19462-19464 |
IN |
denotes |
in |
| T9027 |
19465-19467 |
CD |
denotes |
11 |
| T9028 |
19477-19481 |
NNS |
denotes |
mice |
| T9029 |
19468-19476 |
VBN |
denotes |
affected |
| T9030 |
19482-19485 |
CC |
denotes |
and |
| T9031 |
19486-19490 |
CD |
denotes |
nine |
| T9032 |
19502-19506 |
NNS |
denotes |
mice |
| T9033 |
19491-19501 |
JJ |
denotes |
unaffected |
| T9034 |
19506-19507 |
: |
denotes |
; |
| T9035 |
19508-19516 |
NN |
denotes |
genotype |
| T9036 |
19517-19524 |
NN |
denotes |
calling |
| T9037 |
19525-19528 |
VBD |
denotes |
was |
| T9038 |
19539-19541 |
IN |
denotes |
by |
| T9039 |
19542-19545 |
NN |
denotes |
dye |
| T9040 |
19546-19556 |
NN |
denotes |
terminator |
| T9041 |
19545-19546 |
HYPH |
denotes |
- |
| T9042 |
19557-19567 |
NN |
denotes |
sequencing |
| T9043 |
19568-19570 |
IN |
denotes |
of |
| T9044 |
19571-19576 |
DT |
denotes |
these |
| T9045 |
19577-19586 |
NNS |
denotes |
fragments |
| T9046 |
19586-19587 |
. |
denotes |
. |
| T9047 |
19587-19788 |
sentence |
denotes |
Linkage analysis using these data was performed using mlink [13], which revealed a positive linkage at Chromosome 6qE1, on the 129x1/SvJ background (two-point LOD score 5.13 at marker 20.MMHAP85FLG2). |
| T9048 |
19588-19595 |
NN |
denotes |
Linkage |
| T9049 |
19596-19604 |
NN |
denotes |
analysis |
| T9050 |
19626-19635 |
VBN |
denotes |
performed |
| T9051 |
19605-19610 |
VBG |
denotes |
using |
| T9052 |
19611-19616 |
DT |
denotes |
these |
| T9053 |
19617-19621 |
NNS |
denotes |
data |
| T9054 |
19622-19625 |
VBD |
denotes |
was |
| T9055 |
19636-19641 |
VBG |
denotes |
using |
| T9056 |
19642-19647 |
NN |
denotes |
mlink |
| T9057 |
19648-19649 |
-LRB- |
denotes |
[ |
| T9058 |
19649-19651 |
CD |
denotes |
13 |
| T9059 |
19651-19652 |
-RRB- |
denotes |
] |
| T9060 |
19652-19654 |
, |
denotes |
, |
| T9061 |
19654-19659 |
WDT |
denotes |
which |
| T9062 |
19660-19668 |
VBD |
denotes |
revealed |
| T9063 |
19669-19670 |
DT |
denotes |
a |
| T9064 |
19680-19687 |
NN |
denotes |
linkage |
| T9065 |
19671-19679 |
JJ |
denotes |
positive |
| T9066 |
19688-19690 |
IN |
denotes |
at |
| T9067 |
19691-19701 |
NN |
denotes |
Chromosome |
| T9068 |
19702-19706 |
NN |
denotes |
6qE1 |
| T9069 |
19706-19708 |
, |
denotes |
, |
| T9070 |
19708-19710 |
IN |
denotes |
on |
| T9071 |
19711-19714 |
DT |
denotes |
the |
| T9072 |
19725-19735 |
NN |
denotes |
background |
| T9073 |
19715-19720 |
NN |
denotes |
129x1 |
| T9074 |
19721-19724 |
NN |
denotes |
SvJ |
| T9075 |
19720-19721 |
HYPH |
denotes |
/ |
| T9076 |
19736-19737 |
-LRB- |
denotes |
( |
| T9077 |
19751-19756 |
NN |
denotes |
score |
| T9078 |
19737-19740 |
CD |
denotes |
two |
| T9079 |
19741-19746 |
NN |
denotes |
point |
| T9080 |
19740-19741 |
HYPH |
denotes |
- |
| T9081 |
19747-19750 |
NN |
denotes |
LOD |
| T9082 |
19757-19761 |
CD |
denotes |
5.13 |
| T9083 |
19762-19764 |
IN |
denotes |
at |
| T9084 |
19765-19771 |
NN |
denotes |
marker |
| T9085 |
19772-19786 |
NN |
denotes |
20.MMHAP85FLG2 |
| T9086 |
19786-19787 |
-RRB- |
denotes |
) |
| T9087 |
19787-19788 |
. |
denotes |
. |
| T9088 |
19788-19935 |
sentence |
denotes |
In an attempt to narrow the disease interval we performed backcross experiments that resulted in the generation of three additional affected mice. |
| T9089 |
19789-19791 |
IN |
denotes |
In |
| T9090 |
19837-19846 |
VBD |
denotes |
performed |
| T9091 |
19792-19794 |
DT |
denotes |
an |
| T9092 |
19795-19802 |
NN |
denotes |
attempt |
| T9093 |
19803-19805 |
TO |
denotes |
to |
| T9094 |
19806-19812 |
VB |
denotes |
narrow |
| T9095 |
19813-19816 |
DT |
denotes |
the |
| T9096 |
19825-19833 |
NN |
denotes |
interval |
| T9097 |
19817-19824 |
NN |
denotes |
disease |
| T9098 |
19834-19836 |
PRP |
denotes |
we |
| T9099 |
19847-19856 |
NN |
denotes |
backcross |
| T9100 |
19857-19868 |
NNS |
denotes |
experiments |
| T9101 |
19869-19873 |
WDT |
denotes |
that |
| T9102 |
19874-19882 |
VBD |
denotes |
resulted |
| T9103 |
19883-19885 |
IN |
denotes |
in |
| T9104 |
19886-19889 |
DT |
denotes |
the |
| T9105 |
19890-19900 |
NN |
denotes |
generation |
| T9106 |
19901-19903 |
IN |
denotes |
of |
| T9107 |
19904-19909 |
CD |
denotes |
three |
| T9108 |
19930-19934 |
NNS |
denotes |
mice |
| T9109 |
19910-19920 |
JJ |
denotes |
additional |
| T9110 |
19921-19929 |
VBN |
denotes |
affected |
| T9111 |
19934-19935 |
. |
denotes |
. |
| T9112 |
19935-20127 |
sentence |
denotes |
Genotyping of all affected mice across the disease-segregating interval revealed flanking recombinants and a candidate region of ~5 Mb, between markers D6Mit37 and 44.MMHAP85FLG5 (Figure S1). |
| T9113 |
19936-19946 |
NN |
denotes |
Genotyping |
| T9114 |
20008-20016 |
VBD |
denotes |
revealed |
| T9115 |
19947-19949 |
IN |
denotes |
of |
| T9116 |
19950-19953 |
DT |
denotes |
all |
| T9117 |
19963-19967 |
NNS |
denotes |
mice |
| T9118 |
19954-19962 |
VBN |
denotes |
affected |
| T9119 |
19968-19974 |
IN |
denotes |
across |
| T9120 |
19975-19978 |
DT |
denotes |
the |
| T9121 |
19999-20007 |
NN |
denotes |
interval |
| T9122 |
19979-19986 |
NN |
denotes |
disease |
| T9123 |
19987-19998 |
VBG |
denotes |
segregating |
| T9124 |
19986-19987 |
HYPH |
denotes |
- |
| T9125 |
20017-20025 |
VBG |
denotes |
flanking |
| T9126 |
20026-20038 |
NNS |
denotes |
recombinants |
| T9127 |
20039-20042 |
CC |
denotes |
and |
| T9128 |
20043-20044 |
DT |
denotes |
a |
| T9129 |
20055-20061 |
NN |
denotes |
region |
| T9130 |
20045-20054 |
NN |
denotes |
candidate |
| T9131 |
20062-20064 |
IN |
denotes |
of |
| T9132 |
20065-20066 |
SYM |
denotes |
~ |
| T9133 |
20066-20067 |
CD |
denotes |
5 |
| T9134 |
20068-20070 |
NN |
denotes |
Mb |
| T9135 |
20070-20072 |
, |
denotes |
, |
| T9136 |
20072-20079 |
IN |
denotes |
between |
| T9137 |
20080-20087 |
NNS |
denotes |
markers |
| T9138 |
20088-20095 |
NN |
denotes |
D6Mit37 |
| T9139 |
20096-20099 |
CC |
denotes |
and |
| T9140 |
20100-20114 |
NN |
denotes |
44.MMHAP85FLG5 |
| T9141 |
20115-20116 |
-LRB- |
denotes |
( |
| T9142 |
20123-20125 |
NN |
denotes |
S1 |
| T9143 |
20116-20122 |
NN |
denotes |
Figure |
| T9144 |
20125-20126 |
-RRB- |
denotes |
) |
| T9145 |
20126-20127 |
. |
denotes |
. |
| T9146 |
20127-20184 |
sentence |
denotes |
This region contains 16 genes and predicted transcripts. |
| T9147 |
20128-20132 |
DT |
denotes |
This |
| T9148 |
20133-20139 |
NN |
denotes |
region |
| T9149 |
20140-20148 |
VBZ |
denotes |
contains |
| T9150 |
20149-20151 |
CD |
denotes |
16 |
| T9151 |
20152-20157 |
NNS |
denotes |
genes |
| T9152 |
20158-20161 |
CC |
denotes |
and |
| T9153 |
20162-20171 |
VBN |
denotes |
predicted |
| T9154 |
20172-20183 |
NNS |
denotes |
transcripts |
| T9155 |
20183-20184 |
. |
denotes |
. |
| T9602 |
20186-20200 |
NN |
denotes |
Identification |
| T9603 |
20201-20203 |
IN |
denotes |
of |
| T9604 |
20204-20207 |
DT |
denotes |
the |
| T9605 |
20227-20233 |
NN |
denotes |
lesion |
| T9606 |
20208-20218 |
VBG |
denotes |
underlying |
| T9607 |
20219-20226 |
JJ |
denotes |
genetic |
| T9608 |
20234-20236 |
IN |
denotes |
in |
| T9609 |
20237-20241 |
NNS |
denotes |
mice |
| T9610 |
20241-20242 |
. |
denotes |
. |
| T9611 |
20242-20353 |
sentence |
denotes |
Identification of similar phenotypes in mice linked to the 6qE1 interval was performed by literature searches. |
| T9612 |
20243-20257 |
NN |
denotes |
Identification |
| T9613 |
20320-20329 |
VBN |
denotes |
performed |
| T9614 |
20258-20260 |
IN |
denotes |
of |
| T9615 |
20261-20268 |
JJ |
denotes |
similar |
| T9616 |
20269-20279 |
NNS |
denotes |
phenotypes |
| T9617 |
20280-20282 |
IN |
denotes |
in |
| T9618 |
20283-20287 |
NNS |
denotes |
mice |
| T9619 |
20288-20294 |
VBN |
denotes |
linked |
| T9620 |
20295-20297 |
IN |
denotes |
to |
| T9621 |
20298-20301 |
DT |
denotes |
the |
| T9622 |
20307-20315 |
NN |
denotes |
interval |
| T9623 |
20302-20306 |
NN |
denotes |
6qE1 |
| T9624 |
20316-20319 |
VBD |
denotes |
was |
| T9625 |
20330-20332 |
IN |
denotes |
by |
| T9626 |
20333-20343 |
NN |
denotes |
literature |
| T9627 |
20344-20352 |
NNS |
denotes |
searches |
| T9628 |
20352-20353 |
. |
denotes |
. |
| T9629 |
20353-20479 |
sentence |
denotes |
This revealed the Itpr1opt/opt mouse, in which disease is caused by homozygous deletion mutation of exons 43 and 44 of Itpr1. |
| T9630 |
20354-20358 |
DT |
denotes |
This |
| T9631 |
20359-20367 |
VBD |
denotes |
revealed |
| T9632 |
20368-20371 |
DT |
denotes |
the |
| T9633 |
20385-20390 |
NN |
denotes |
mouse |
| T9634 |
20372-20380 |
NN |
denotes |
Itpr1opt |
| T9635 |
20381-20384 |
NN |
denotes |
opt |
| T9636 |
20380-20381 |
HYPH |
denotes |
/ |
| T9637 |
20390-20392 |
, |
denotes |
, |
| T9638 |
20392-20394 |
IN |
denotes |
in |
| T9639 |
20412-20418 |
VBN |
denotes |
caused |
| T9640 |
20395-20400 |
WDT |
denotes |
which |
| T9641 |
20401-20408 |
NN |
denotes |
disease |
| T9642 |
20409-20411 |
VBZ |
denotes |
is |
| T9643 |
20419-20421 |
IN |
denotes |
by |
| T9644 |
20422-20432 |
JJ |
denotes |
homozygous |
| T9645 |
20442-20450 |
NN |
denotes |
mutation |
| T9646 |
20433-20441 |
NN |
denotes |
deletion |
| T9647 |
20451-20453 |
IN |
denotes |
of |
| T9648 |
20454-20459 |
NNS |
denotes |
exons |
| T9649 |
20460-20462 |
CD |
denotes |
43 |
| T9650 |
20463-20466 |
CC |
denotes |
and |
| T9651 |
20467-20469 |
CD |
denotes |
44 |
| T9652 |
20470-20472 |
IN |
denotes |
of |
| T9653 |
20473-20478 |
NN |
denotes |
Itpr1 |
| T9654 |
20478-20479 |
. |
denotes |
. |
| T9655 |
20479-20607 |
sentence |
denotes |
Primer pairs were designed to sequence each of the coding exons and at least 50 bp of each flanking intronic sequence of Itpr1. |
| T9656 |
20480-20486 |
NN |
denotes |
Primer |
| T9657 |
20487-20492 |
NNS |
denotes |
pairs |
| T9658 |
20498-20506 |
VBN |
denotes |
designed |
| T9659 |
20493-20497 |
VBD |
denotes |
were |
| T9660 |
20507-20509 |
TO |
denotes |
to |
| T9661 |
20510-20518 |
VB |
denotes |
sequence |
| T9662 |
20519-20523 |
DT |
denotes |
each |
| T9663 |
20524-20526 |
IN |
denotes |
of |
| T9664 |
20527-20530 |
DT |
denotes |
the |
| T9665 |
20538-20543 |
NNS |
denotes |
exons |
| T9666 |
20531-20537 |
NN |
denotes |
coding |
| T9667 |
20544-20547 |
CC |
denotes |
and |
| T9668 |
20548-20550 |
RB |
denotes |
at |
| T9669 |
20557-20559 |
CD |
denotes |
50 |
| T9670 |
20551-20556 |
RBS |
denotes |
least |
| T9671 |
20560-20562 |
NN |
denotes |
bp |
| T9672 |
20563-20565 |
IN |
denotes |
of |
| T9673 |
20566-20570 |
DT |
denotes |
each |
| T9674 |
20589-20597 |
NN |
denotes |
sequence |
| T9675 |
20571-20579 |
VBG |
denotes |
flanking |
| T9676 |
20580-20588 |
JJ |
denotes |
intronic |
| T9677 |
20598-20600 |
IN |
denotes |
of |
| T9678 |
20601-20606 |
NN |
denotes |
Itpr1 |
| T9679 |
20606-20607 |
. |
denotes |
. |
| T9680 |
20607-20699 |
sentence |
denotes |
PCR amplification of each exon was performed using DNA from two affected mice as templates. |
| T9681 |
20608-20611 |
NN |
denotes |
PCR |
| T9682 |
20612-20625 |
NN |
denotes |
amplification |
| T9683 |
20643-20652 |
VBN |
denotes |
performed |
| T9684 |
20626-20628 |
IN |
denotes |
of |
| T9685 |
20629-20633 |
DT |
denotes |
each |
| T9686 |
20634-20638 |
NN |
denotes |
exon |
| T9687 |
20639-20642 |
VBD |
denotes |
was |
| T9688 |
20653-20658 |
VBG |
denotes |
using |
| T9689 |
20659-20662 |
NN |
denotes |
DNA |
| T9690 |
20663-20667 |
IN |
denotes |
from |
| T9691 |
20668-20671 |
CD |
denotes |
two |
| T9692 |
20681-20685 |
NNS |
denotes |
mice |
| T9693 |
20672-20680 |
VBN |
denotes |
affected |
| T9694 |
20686-20688 |
IN |
denotes |
as |
| T9695 |
20689-20698 |
NNS |
denotes |
templates |
| T9696 |
20698-20699 |
. |
denotes |
. |
| T9697 |
20699-20787 |
sentence |
denotes |
The Itpr1Δ18/Δ18 mutation was confirmed by sequencing in all affected mice (Figure S2). |
| T9698 |
20700-20703 |
DT |
denotes |
The |
| T9699 |
20717-20725 |
NN |
denotes |
mutation |
| T9700 |
20704-20712 |
NN |
denotes |
Itpr1Δ18 |
| T9701 |
20713-20716 |
NN |
denotes |
Δ18 |
| T9702 |
20712-20713 |
HYPH |
denotes |
/ |
| T9703 |
20730-20739 |
VBN |
denotes |
confirmed |
| T9704 |
20726-20729 |
VBD |
denotes |
was |
| T9705 |
20740-20742 |
IN |
denotes |
by |
| T9706 |
20743-20753 |
NN |
denotes |
sequencing |
| T9707 |
20754-20756 |
IN |
denotes |
in |
| T9708 |
20757-20760 |
DT |
denotes |
all |
| T9709 |
20770-20774 |
NNS |
denotes |
mice |
| T9710 |
20761-20769 |
VBN |
denotes |
affected |
| T9711 |
20775-20776 |
-LRB- |
denotes |
( |
| T9712 |
20783-20785 |
NN |
denotes |
S2 |
| T9713 |
20776-20782 |
NN |
denotes |
Figure |
| T9714 |
20785-20786 |
-RRB- |
denotes |
) |
| T9715 |
20786-20787 |
. |
denotes |
. |
| T9716 |
20787-20970 |
sentence |
denotes |
Breeding experiments were performed between two female mice heterozygous for the current mutation (Itpr1wt/Δ18) and a male mouse heterozygous for the Itpr1opt mutation (Itpr1wt/opt). |
| T9717 |
20788-20796 |
VBG |
denotes |
Breeding |
| T9718 |
20797-20808 |
NNS |
denotes |
experiments |
| T9719 |
20814-20823 |
VBN |
denotes |
performed |
| T9720 |
20809-20813 |
VBD |
denotes |
were |
| T9721 |
20824-20831 |
IN |
denotes |
between |
| T9722 |
20832-20835 |
CD |
denotes |
two |
| T9723 |
20843-20847 |
NNS |
denotes |
mice |
| T9724 |
20836-20842 |
JJ |
denotes |
female |
| T9725 |
20848-20860 |
JJ |
denotes |
heterozygous |
| T9726 |
20861-20864 |
IN |
denotes |
for |
| T9727 |
20865-20868 |
DT |
denotes |
the |
| T9728 |
20877-20885 |
NN |
denotes |
mutation |
| T9729 |
20869-20876 |
JJ |
denotes |
current |
| T9730 |
20886-20887 |
-LRB- |
denotes |
( |
| T9731 |
20895-20898 |
NN |
denotes |
Δ18 |
| T9732 |
20887-20894 |
NN |
denotes |
Itpr1wt |
| T9733 |
20894-20895 |
HYPH |
denotes |
/ |
| T9734 |
20898-20899 |
-RRB- |
denotes |
) |
| T9735 |
20900-20903 |
CC |
denotes |
and |
| T9736 |
20904-20905 |
DT |
denotes |
a |
| T9737 |
20911-20916 |
NN |
denotes |
mouse |
| T9738 |
20906-20910 |
JJ |
denotes |
male |
| T9739 |
20917-20929 |
JJ |
denotes |
heterozygous |
| T9740 |
20930-20933 |
IN |
denotes |
for |
| T9741 |
20934-20937 |
DT |
denotes |
the |
| T9742 |
20947-20955 |
NN |
denotes |
mutation |
| T9743 |
20938-20946 |
NN |
denotes |
Itpr1opt |
| T9744 |
20956-20957 |
-LRB- |
denotes |
( |
| T9745 |
20965-20968 |
NN |
denotes |
opt |
| T9746 |
20957-20964 |
NN |
denotes |
Itpr1wt |
| T9747 |
20964-20965 |
HYPH |
denotes |
/ |
| T9748 |
20968-20969 |
-RRB- |
denotes |
) |
| T9749 |
20969-20970 |
. |
denotes |
. |
| T9750 |
20970-21234 |
sentence |
denotes |
This resulted in two litters of mice with a total of four affected Itpr1opt/Δ18 pups (from a total of 15; two of seven from first mating; two of eight from the second mating) with a phenotype indistinguishable from that of the Itpr1Δ18/Δ18 and Itpr1opt /opt mice. |
| T9751 |
20971-20975 |
DT |
denotes |
This |
| T9752 |
20976-20984 |
VBD |
denotes |
resulted |
| T9753 |
20985-20987 |
IN |
denotes |
in |
| T9754 |
20988-20991 |
CD |
denotes |
two |
| T9755 |
20992-20999 |
NNS |
denotes |
litters |
| T9756 |
21000-21002 |
IN |
denotes |
of |
| T9757 |
21003-21007 |
NNS |
denotes |
mice |
| T9758 |
21008-21012 |
IN |
denotes |
with |
| T9759 |
21013-21014 |
DT |
denotes |
a |
| T9760 |
21015-21020 |
NN |
denotes |
total |
| T9761 |
21021-21023 |
IN |
denotes |
of |
| T9762 |
21024-21028 |
CD |
denotes |
four |
| T9763 |
21051-21055 |
NNS |
denotes |
pups |
| T9764 |
21029-21037 |
VBN |
denotes |
affected |
| T9765 |
21038-21046 |
NN |
denotes |
Itpr1opt |
| T9766 |
21047-21050 |
NN |
denotes |
Δ18 |
| T9767 |
21046-21047 |
HYPH |
denotes |
/ |
| T9768 |
21056-21057 |
-LRB- |
denotes |
( |
| T9769 |
21116-21121 |
CD |
denotes |
eight |
| T9770 |
21057-21061 |
IN |
denotes |
from |
| T9771 |
21062-21063 |
DT |
denotes |
a |
| T9772 |
21064-21069 |
NN |
denotes |
total |
| T9773 |
21070-21072 |
IN |
denotes |
of |
| T9774 |
21073-21075 |
CD |
denotes |
15 |
| T9775 |
21075-21076 |
: |
denotes |
; |
| T9776 |
21077-21080 |
CD |
denotes |
two |
| T9777 |
21084-21089 |
CD |
denotes |
seven |
| T9778 |
21081-21083 |
IN |
denotes |
of |
| T9779 |
21090-21094 |
IN |
denotes |
from |
| T9780 |
21095-21100 |
JJ |
denotes |
first |
| T9781 |
21101-21107 |
NN |
denotes |
mating |
| T9782 |
21107-21108 |
: |
denotes |
; |
| T9783 |
21109-21112 |
CD |
denotes |
two |
| T9784 |
21113-21115 |
IN |
denotes |
of |
| T9785 |
21122-21126 |
IN |
denotes |
from |
| T9786 |
21127-21130 |
DT |
denotes |
the |
| T9787 |
21138-21144 |
NN |
denotes |
mating |
| T9788 |
21131-21137 |
JJ |
denotes |
second |
| T9789 |
21144-21145 |
-RRB- |
denotes |
) |
| T9790 |
21146-21150 |
IN |
denotes |
with |
| T9791 |
21151-21152 |
DT |
denotes |
a |
| T9792 |
21153-21162 |
NN |
denotes |
phenotype |
| T9793 |
21163-21180 |
JJ |
denotes |
indistinguishable |
| T9794 |
21181-21185 |
IN |
denotes |
from |
| T9795 |
21186-21190 |
DT |
denotes |
that |
| T9796 |
21191-21193 |
IN |
denotes |
of |
| T9797 |
21194-21197 |
DT |
denotes |
the |
| T9798 |
21229-21233 |
NNS |
denotes |
mice |
| T9799 |
21198-21206 |
NN |
denotes |
Itpr1Δ18 |
| T9800 |
21207-21210 |
NN |
denotes |
Δ18 |
| T9801 |
21206-21207 |
HYPH |
denotes |
/ |
| T9802 |
21211-21214 |
CC |
denotes |
and |
| T9803 |
21215-21223 |
NN |
denotes |
Itpr1opt |
| T9804 |
21225-21228 |
NN |
denotes |
opt |
| T9805 |
21224-21225 |
HYPH |
denotes |
/ |
| T9806 |
21233-21234 |
. |
denotes |
. |
| T10116 |
21236-21244 |
NN |
denotes |
Analysis |
| T10117 |
21245-21247 |
IN |
denotes |
of |
| T10118 |
21248-21253 |
NN |
denotes |
Itpr1 |
| T10119 |
21254-21261 |
NN |
denotes |
protein |
| T10120 |
21262-21264 |
IN |
denotes |
in |
| T10121 |
21265-21269 |
NNS |
denotes |
mice |
| T10122 |
21269-21270 |
. |
denotes |
. |
| T10123 |
21270-21392 |
sentence |
denotes |
We performed Western blot analyses using standard techniques with ECL detection kits (Amersham, http://www.amersham.com). |
| T10124 |
21271-21273 |
PRP |
denotes |
We |
| T10125 |
21274-21283 |
VBD |
denotes |
performed |
| T10126 |
21284-21291 |
NNP |
denotes |
Western |
| T10127 |
21292-21296 |
NN |
denotes |
blot |
| T10128 |
21297-21305 |
NNS |
denotes |
analyses |
| T10129 |
21306-21311 |
VBG |
denotes |
using |
| T10130 |
21312-21320 |
JJ |
denotes |
standard |
| T10131 |
21321-21331 |
NNS |
denotes |
techniques |
| T10132 |
21332-21336 |
IN |
denotes |
with |
| T10133 |
21337-21340 |
NN |
denotes |
ECL |
| T10134 |
21351-21355 |
NNS |
denotes |
kits |
| T10135 |
21341-21350 |
NN |
denotes |
detection |
| T10136 |
21356-21357 |
-LRB- |
denotes |
( |
| T10137 |
21357-21365 |
NNP |
denotes |
Amersham |
| T10138 |
21365-21367 |
, |
denotes |
, |
| T10139 |
21367-21390 |
NN |
denotes |
http://www.amersham.com |
| T10140 |
21390-21391 |
-RRB- |
denotes |
) |
| T10141 |
21391-21392 |
. |
denotes |
. |
| T10142 |
21392-21658 |
sentence |
denotes |
Briefly, dissected whole brains from postnatal day 21 littermates were homogenized in a buffer containing 50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, and a cocktail of protease inhibitors (Roche, http://www.roche.com). |
| T10143 |
21393-21400 |
RB |
denotes |
Briefly |
| T10144 |
21464-21475 |
VBN |
denotes |
homogenized |
| T10145 |
21400-21402 |
, |
denotes |
, |
| T10146 |
21402-21411 |
VBN |
denotes |
dissected |
| T10147 |
21418-21424 |
NNS |
denotes |
brains |
| T10148 |
21412-21417 |
JJ |
denotes |
whole |
| T10149 |
21425-21429 |
IN |
denotes |
from |
| T10150 |
21430-21439 |
JJ |
denotes |
postnatal |
| T10151 |
21440-21443 |
NN |
denotes |
day |
| T10152 |
21447-21458 |
NNS |
denotes |
littermates |
| T10153 |
21444-21446 |
CD |
denotes |
21 |
| T10154 |
21459-21463 |
VBD |
denotes |
were |
| T10155 |
21476-21478 |
IN |
denotes |
in |
| T10156 |
21479-21480 |
DT |
denotes |
a |
| T10157 |
21481-21487 |
NN |
denotes |
buffer |
| T10158 |
21488-21498 |
VBG |
denotes |
containing |
| T10159 |
21499-21501 |
CD |
denotes |
50 |
| T10160 |
21502-21504 |
NN |
denotes |
mM |
| T10161 |
21510-21513 |
NN |
denotes |
HCl |
| T10162 |
21505-21509 |
NN |
denotes |
Tris |
| T10163 |
21509-21510 |
HYPH |
denotes |
- |
| T10164 |
21513-21515 |
, |
denotes |
, |
| T10165 |
21515-21518 |
CD |
denotes |
150 |
| T10166 |
21519-21521 |
NN |
denotes |
mM |
| T10167 |
21522-21526 |
NN |
denotes |
NaCl |
| T10168 |
21526-21528 |
, |
denotes |
, |
| T10169 |
21528-21529 |
CD |
denotes |
1 |
| T10170 |
21530-21532 |
NN |
denotes |
mM |
| T10171 |
21533-21537 |
NN |
denotes |
EDTA |
| T10172 |
21537-21539 |
, |
denotes |
, |
| T10173 |
21539-21540 |
CD |
denotes |
1 |
| T10174 |
21540-21541 |
NN |
denotes |
% |
| T10175 |
21549-21550 |
NN |
denotes |
X |
| T10176 |
21542-21548 |
NN |
denotes |
Triton |
| T10177 |
21550-21551 |
HYPH |
denotes |
- |
| T10178 |
21551-21554 |
CD |
denotes |
100 |
| T10179 |
21554-21556 |
, |
denotes |
, |
| T10180 |
21556-21557 |
CD |
denotes |
1 |
| T10181 |
21557-21558 |
NN |
denotes |
% |
| T10182 |
21566-21578 |
NN |
denotes |
deoxycholate |
| T10183 |
21559-21565 |
NN |
denotes |
sodium |
| T10184 |
21578-21580 |
, |
denotes |
, |
| T10185 |
21580-21583 |
CD |
denotes |
0.1 |
| T10186 |
21583-21584 |
NN |
denotes |
% |
| T10187 |
21585-21588 |
NN |
denotes |
SDS |
| T10188 |
21588-21590 |
, |
denotes |
, |
| T10189 |
21590-21593 |
CC |
denotes |
and |
| T10190 |
21594-21595 |
DT |
denotes |
a |
| T10191 |
21596-21604 |
NN |
denotes |
cocktail |
| T10192 |
21605-21607 |
IN |
denotes |
of |
| T10193 |
21608-21616 |
NN |
denotes |
protease |
| T10194 |
21617-21627 |
NNS |
denotes |
inhibitors |
| T10195 |
21628-21629 |
-LRB- |
denotes |
( |
| T10196 |
21629-21634 |
NNP |
denotes |
Roche |
| T10197 |
21634-21636 |
, |
denotes |
, |
| T10198 |
21636-21656 |
NN |
denotes |
http://www.roche.com |
| T10199 |
21656-21657 |
-RRB- |
denotes |
) |
| T10200 |
21657-21658 |
. |
denotes |
. |
| T10201 |
21658-21849 |
sentence |
denotes |
Homogenates were diluted appropriately, mixed with 4× reducing sample buffer, and loaded onto 4%–12% precast gradient gels (Novex, http://www.invitrogen.com) for SDS-PAGE and immunoblotting. |
| T10202 |
21659-21670 |
NNS |
denotes |
Homogenates |
| T10203 |
21676-21683 |
VBN |
denotes |
diluted |
| T10204 |
21671-21675 |
VBD |
denotes |
were |
| T10205 |
21684-21697 |
RB |
denotes |
appropriately |
| T10206 |
21697-21699 |
, |
denotes |
, |
| T10207 |
21699-21704 |
VBN |
denotes |
mixed |
| T10208 |
21705-21709 |
IN |
denotes |
with |
| T10209 |
21710-21711 |
CD |
denotes |
4 |
| T10210 |
21729-21735 |
NN |
denotes |
buffer |
| T10211 |
21711-21712 |
SYM |
denotes |
× |
| T10212 |
21713-21721 |
VBG |
denotes |
reducing |
| T10213 |
21722-21728 |
NN |
denotes |
sample |
| T10214 |
21735-21737 |
, |
denotes |
, |
| T10215 |
21737-21740 |
CC |
denotes |
and |
| T10216 |
21741-21747 |
VBN |
denotes |
loaded |
| T10217 |
21748-21752 |
IN |
denotes |
onto |
| T10218 |
21753-21754 |
CD |
denotes |
4 |
| T10219 |
21754-21755 |
NN |
denotes |
% |
| T10220 |
21777-21781 |
NNS |
denotes |
gels |
| T10221 |
21755-21756 |
SYM |
denotes |
– |
| T10222 |
21758-21759 |
NN |
denotes |
% |
| T10223 |
21756-21758 |
CD |
denotes |
12 |
| T10224 |
21760-21767 |
NN |
denotes |
precast |
| T10225 |
21768-21776 |
NN |
denotes |
gradient |
| T10226 |
21782-21783 |
-LRB- |
denotes |
( |
| T10227 |
21783-21788 |
NNP |
denotes |
Novex |
| T10228 |
21788-21790 |
, |
denotes |
, |
| T10229 |
21790-21815 |
NN |
denotes |
http://www.invitrogen.com |
| T10230 |
21815-21816 |
-RRB- |
denotes |
) |
| T10231 |
21817-21820 |
IN |
denotes |
for |
| T10232 |
21821-21824 |
NN |
denotes |
SDS |
| T10233 |
21825-21829 |
NN |
denotes |
PAGE |
| T10234 |
21824-21825 |
HYPH |
denotes |
- |
| T10235 |
21830-21833 |
CC |
denotes |
and |
| T10236 |
21834-21848 |
NN |
denotes |
immunoblotting |
| T10237 |
21848-21849 |
. |
denotes |
. |
| T10238 |
21849-21945 |
sentence |
denotes |
The antibodies to Itpr1 (1:2,000) and Actb (1:5,000) were used as recommended by manufacturers. |
| T10239 |
21850-21853 |
DT |
denotes |
The |
| T10240 |
21854-21864 |
NNS |
denotes |
antibodies |
| T10241 |
21908-21912 |
VBN |
denotes |
used |
| T10242 |
21865-21867 |
IN |
denotes |
to |
| T10243 |
21868-21873 |
NN |
denotes |
Itpr1 |
| T10244 |
21874-21875 |
-LRB- |
denotes |
( |
| T10245 |
21875-21876 |
CD |
denotes |
1 |
| T10246 |
21876-21877 |
SYM |
denotes |
: |
| T10247 |
21877-21882 |
CD |
denotes |
2,000 |
| T10248 |
21882-21883 |
-RRB- |
denotes |
) |
| T10249 |
21884-21887 |
CC |
denotes |
and |
| T10250 |
21888-21892 |
NN |
denotes |
Actb |
| T10251 |
21893-21894 |
-LRB- |
denotes |
( |
| T10252 |
21894-21895 |
CD |
denotes |
1 |
| T10253 |
21895-21896 |
SYM |
denotes |
: |
| T10254 |
21896-21901 |
CD |
denotes |
5,000 |
| T10255 |
21901-21902 |
-RRB- |
denotes |
) |
| T10256 |
21903-21907 |
VBD |
denotes |
were |
| T10257 |
21913-21915 |
IN |
denotes |
as |
| T10258 |
21916-21927 |
VBN |
denotes |
recommended |
| T10259 |
21928-21930 |
IN |
denotes |
by |
| T10260 |
21931-21944 |
NNS |
denotes |
manufacturers |
| T10261 |
21944-21945 |
. |
denotes |
. |
| T10935 |
21947-21967 |
NN |
denotes |
Immunohistochemistry |
| T10936 |
21967-21968 |
. |
denotes |
. |
| T10937 |
21968-22098 |
sentence |
denotes |
Brains were isolated from 21-d-old mice, perfused with 4% paraformaldehyde in PBS, and post-fixed overnight in the same fixative. |
| T10938 |
21969-21975 |
NNS |
denotes |
Brains |
| T10939 |
21981-21989 |
VBN |
denotes |
isolated |
| T10940 |
21976-21980 |
VBD |
denotes |
were |
| T10941 |
21990-21994 |
IN |
denotes |
from |
| T10942 |
21995-21997 |
CD |
denotes |
21 |
| T10943 |
21998-21999 |
NN |
denotes |
d |
| T10944 |
21997-21998 |
HYPH |
denotes |
- |
| T10945 |
22000-22003 |
JJ |
denotes |
old |
| T10946 |
21999-22000 |
HYPH |
denotes |
- |
| T10947 |
22004-22008 |
NNS |
denotes |
mice |
| T10948 |
22008-22010 |
, |
denotes |
, |
| T10949 |
22010-22018 |
VBN |
denotes |
perfused |
| T10950 |
22019-22023 |
IN |
denotes |
with |
| T10951 |
22024-22025 |
CD |
denotes |
4 |
| T10952 |
22025-22026 |
NN |
denotes |
% |
| T10953 |
22027-22043 |
NN |
denotes |
paraformaldehyde |
| T10954 |
22044-22046 |
IN |
denotes |
in |
| T10955 |
22047-22050 |
NN |
denotes |
PBS |
| T10956 |
22050-22052 |
, |
denotes |
, |
| T10957 |
22052-22055 |
CC |
denotes |
and |
| T10958 |
22056-22066 |
VBN |
denotes |
post-fixed |
| T10959 |
22067-22076 |
RB |
denotes |
overnight |
| T10960 |
22077-22079 |
IN |
denotes |
in |
| T10961 |
22080-22083 |
DT |
denotes |
the |
| T10962 |
22089-22097 |
NN |
denotes |
fixative |
| T10963 |
22084-22088 |
JJ |
denotes |
same |
| T10964 |
22097-22098 |
. |
denotes |
. |
| T10965 |
22098-22260 |
sentence |
denotes |
Brains were embedded in gelatin, and 35-μm sagittal sections were cut using a sliding microtome (NeuroScience Associates, http://www.neuroscienceassociates.com). |
| T10966 |
22099-22105 |
NNS |
denotes |
Brains |
| T10967 |
22111-22119 |
VBN |
denotes |
embedded |
| T10968 |
22106-22110 |
VBD |
denotes |
were |
| T10969 |
22120-22122 |
IN |
denotes |
in |
| T10970 |
22123-22130 |
NN |
denotes |
gelatin |
| T10971 |
22130-22132 |
, |
denotes |
, |
| T10972 |
22132-22135 |
CC |
denotes |
and |
| T10973 |
22136-22138 |
CD |
denotes |
35 |
| T10974 |
22139-22141 |
NN |
denotes |
μm |
| T10975 |
22138-22139 |
HYPH |
denotes |
- |
| T10976 |
22151-22159 |
NNS |
denotes |
sections |
| T10977 |
22142-22150 |
JJ |
denotes |
sagittal |
| T10978 |
22165-22168 |
VBN |
denotes |
cut |
| T10979 |
22160-22164 |
VBD |
denotes |
were |
| T10980 |
22169-22174 |
VBG |
denotes |
using |
| T10981 |
22175-22176 |
DT |
denotes |
a |
| T10982 |
22185-22194 |
NN |
denotes |
microtome |
| T10983 |
22177-22184 |
VBG |
denotes |
sliding |
| T10984 |
22195-22196 |
-LRB- |
denotes |
( |
| T10985 |
22209-22219 |
NNP |
denotes |
Associates |
| T10986 |
22196-22208 |
NNP |
denotes |
NeuroScience |
| T10987 |
22219-22221 |
, |
denotes |
, |
| T10988 |
22221-22258 |
NN |
denotes |
http://www.neuroscienceassociates.com |
| T10989 |
22258-22259 |
-RRB- |
denotes |
) |
| T10990 |
22259-22260 |
. |
denotes |
. |
| T10991 |
22260-22361 |
sentence |
denotes |
Sections from wild-type, heterozygote, and homozygous brains were placed in the MultiBrain template. |
| T10992 |
22261-22269 |
NNS |
denotes |
Sections |
| T10993 |
22327-22333 |
VBN |
denotes |
placed |
| T10994 |
22270-22274 |
IN |
denotes |
from |
| T10995 |
22275-22279 |
JJ |
denotes |
wild |
| T10996 |
22280-22284 |
NN |
denotes |
type |
| T10997 |
22279-22280 |
HYPH |
denotes |
- |
| T10998 |
22315-22321 |
NNS |
denotes |
brains |
| T10999 |
22284-22286 |
, |
denotes |
, |
| T11000 |
22286-22298 |
NN |
denotes |
heterozygote |
| T11001 |
22298-22300 |
, |
denotes |
, |
| T11002 |
22300-22303 |
CC |
denotes |
and |
| T11003 |
22304-22314 |
JJ |
denotes |
homozygous |
| T11004 |
22322-22326 |
VBD |
denotes |
were |
| T11005 |
22334-22336 |
IN |
denotes |
in |
| T11006 |
22337-22340 |
DT |
denotes |
the |
| T11007 |
22352-22360 |
NN |
denotes |
template |
| T11008 |
22341-22351 |
NN |
denotes |
MultiBrain |
| T11009 |
22360-22361 |
. |
denotes |
. |
| T11010 |
22361-22514 |
sentence |
denotes |
Sections were washed in 1× PBS prior to 1 h of incubation in block solution containing 1× PBS with 20% normal goat serum and 0.3% Triton X-100 (pH 7.4). |
| T11011 |
22362-22370 |
NNS |
denotes |
Sections |
| T11012 |
22376-22382 |
VBN |
denotes |
washed |
| T11013 |
22371-22375 |
VBD |
denotes |
were |
| T11014 |
22383-22385 |
IN |
denotes |
in |
| T11015 |
22386-22387 |
CD |
denotes |
1 |
| T11016 |
22389-22392 |
NN |
denotes |
PBS |
| T11017 |
22387-22388 |
SYM |
denotes |
× |
| T11018 |
22393-22398 |
RB |
denotes |
prior |
| T11019 |
22399-22401 |
IN |
denotes |
to |
| T11020 |
22402-22403 |
CD |
denotes |
1 |
| T11021 |
22404-22405 |
NN |
denotes |
h |
| T11022 |
22406-22408 |
IN |
denotes |
of |
| T11023 |
22409-22419 |
NN |
denotes |
incubation |
| T11024 |
22420-22422 |
IN |
denotes |
in |
| T11025 |
22423-22428 |
NN |
denotes |
block |
| T11026 |
22429-22437 |
NN |
denotes |
solution |
| T11027 |
22438-22448 |
VBG |
denotes |
containing |
| T11028 |
22449-22450 |
CD |
denotes |
1 |
| T11029 |
22452-22455 |
NN |
denotes |
PBS |
| T11030 |
22450-22451 |
SYM |
denotes |
× |
| T11031 |
22456-22460 |
IN |
denotes |
with |
| T11032 |
22461-22463 |
CD |
denotes |
20 |
| T11033 |
22463-22464 |
NN |
denotes |
% |
| T11034 |
22477-22482 |
NN |
denotes |
serum |
| T11035 |
22465-22471 |
JJ |
denotes |
normal |
| T11036 |
22472-22476 |
NN |
denotes |
goat |
| T11037 |
22483-22486 |
CC |
denotes |
and |
| T11038 |
22487-22490 |
CD |
denotes |
0.3 |
| T11039 |
22490-22491 |
NN |
denotes |
% |
| T11040 |
22499-22500 |
NN |
denotes |
X |
| T11041 |
22492-22498 |
NN |
denotes |
Triton |
| T11042 |
22500-22501 |
HYPH |
denotes |
- |
| T11043 |
22501-22504 |
CD |
denotes |
100 |
| T11044 |
22505-22506 |
-LRB- |
denotes |
( |
| T11045 |
22506-22508 |
NN |
denotes |
pH |
| T11046 |
22509-22512 |
CD |
denotes |
7.4 |
| T11047 |
22512-22513 |
-RRB- |
denotes |
) |
| T11048 |
22513-22514 |
. |
denotes |
. |
| T11049 |
22514-22800 |
sentence |
denotes |
Sections were incubated overnight at 4 °C in primary antibodies: affinity purified polyclonal Itpr1 antibody (1:2,000, Chemicon International, http://www.chemicon.com) and monoclonal anti-Calb1 antibody (1:6,000, Sigma-Aldrich, http://www.sigmaaldrich.com) diluted in carrier solution. |
| T11050 |
22515-22523 |
NNS |
denotes |
Sections |
| T11051 |
22529-22538 |
VBN |
denotes |
incubated |
| T11052 |
22524-22528 |
VBD |
denotes |
were |
| T11053 |
22539-22548 |
RB |
denotes |
overnight |
| T11054 |
22549-22551 |
IN |
denotes |
at |
| T11055 |
22552-22553 |
CD |
denotes |
4 |
| T11056 |
22554-22556 |
NN |
denotes |
°C |
| T11057 |
22557-22559 |
IN |
denotes |
in |
| T11058 |
22560-22567 |
JJ |
denotes |
primary |
| T11059 |
22568-22578 |
NNS |
denotes |
antibodies |
| T11060 |
22578-22580 |
: |
denotes |
: |
| T11061 |
22580-22588 |
NN |
denotes |
affinity |
| T11062 |
22615-22623 |
NN |
denotes |
antibody |
| T11063 |
22589-22597 |
VBN |
denotes |
purified |
| T11064 |
22598-22608 |
JJ |
denotes |
polyclonal |
| T11065 |
22609-22614 |
NN |
denotes |
Itpr1 |
| T11066 |
22624-22625 |
-LRB- |
denotes |
( |
| T11067 |
22643-22656 |
NNP |
denotes |
International |
| T11068 |
22625-22626 |
CD |
denotes |
1 |
| T11069 |
22626-22627 |
SYM |
denotes |
: |
| T11070 |
22627-22632 |
CD |
denotes |
2,000 |
| T11071 |
22632-22634 |
, |
denotes |
, |
| T11072 |
22634-22642 |
NNP |
denotes |
Chemicon |
| T11073 |
22656-22658 |
, |
denotes |
, |
| T11074 |
22658-22681 |
NN |
denotes |
http://www.chemicon.com |
| T11075 |
22681-22682 |
-RRB- |
denotes |
) |
| T11076 |
22683-22686 |
CC |
denotes |
and |
| T11077 |
22687-22697 |
JJ |
denotes |
monoclonal |
| T11078 |
22709-22717 |
NN |
denotes |
antibody |
| T11079 |
22698-22708 |
JJ |
denotes |
anti-Calb1 |
| T11080 |
22718-22719 |
-LRB- |
denotes |
( |
| T11081 |
22734-22741 |
NNP |
denotes |
Aldrich |
| T11082 |
22719-22720 |
CD |
denotes |
1 |
| T11083 |
22720-22721 |
SYM |
denotes |
: |
| T11084 |
22721-22726 |
CD |
denotes |
6,000 |
| T11085 |
22726-22728 |
, |
denotes |
, |
| T11086 |
22728-22733 |
NNP |
denotes |
Sigma |
| T11087 |
22733-22734 |
HYPH |
denotes |
- |
| T11088 |
22741-22743 |
, |
denotes |
, |
| T11089 |
22743-22770 |
NN |
denotes |
http://www.sigmaaldrich.com |
| T11090 |
22770-22771 |
-RRB- |
denotes |
) |
| T11091 |
22772-22779 |
VBN |
denotes |
diluted |
| T11092 |
22780-22782 |
IN |
denotes |
in |
| T11093 |
22783-22790 |
NN |
denotes |
carrier |
| T11094 |
22791-22799 |
NN |
denotes |
solution |
| T11095 |
22799-22800 |
. |
denotes |
. |
| T11096 |
22800-23070 |
sentence |
denotes |
Following extensive washes (in 6.0 ml of PBS, three times), sections were incubated with appropriate secondary antibodies (Alexa Fluor 555 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG [Invitrogen, http://www.invitrogen.com]) for 1 h at room temperature. |
| T11097 |
22801-22810 |
VBG |
denotes |
Following |
| T11098 |
22875-22884 |
VBN |
denotes |
incubated |
| T11099 |
22811-22820 |
JJ |
denotes |
extensive |
| T11100 |
22821-22827 |
NNS |
denotes |
washes |
| T11101 |
22828-22829 |
-LRB- |
denotes |
( |
| T11102 |
22829-22831 |
IN |
denotes |
in |
| T11103 |
22832-22835 |
CD |
denotes |
6.0 |
| T11104 |
22836-22838 |
NN |
denotes |
ml |
| T11105 |
22839-22841 |
IN |
denotes |
of |
| T11106 |
22842-22845 |
NN |
denotes |
PBS |
| T11107 |
22845-22847 |
, |
denotes |
, |
| T11108 |
22853-22858 |
NNS |
denotes |
times |
| T11109 |
22847-22852 |
CD |
denotes |
three |
| T11110 |
22858-22859 |
-RRB- |
denotes |
) |
| T11111 |
22859-22861 |
, |
denotes |
, |
| T11112 |
22861-22869 |
NNS |
denotes |
sections |
| T11113 |
22870-22874 |
VBD |
denotes |
were |
| T11114 |
22885-22889 |
IN |
denotes |
with |
| T11115 |
22890-22901 |
JJ |
denotes |
appropriate |
| T11116 |
22912-22922 |
NNS |
denotes |
antibodies |
| T11117 |
22902-22911 |
JJ |
denotes |
secondary |
| T11118 |
22923-22924 |
-LRB- |
denotes |
( |
| T11119 |
22957-22960 |
NN |
denotes |
IgG |
| T11120 |
22924-22929 |
NNP |
denotes |
Alexa |
| T11121 |
22930-22935 |
NNP |
denotes |
Fluor |
| T11122 |
22936-22939 |
CD |
denotes |
555 |
| T11123 |
22940-22944 |
NN |
denotes |
goat |
| T11124 |
22945-22956 |
JJ |
denotes |
anti-rabbit |
| T11125 |
22961-22964 |
CC |
denotes |
and |
| T11126 |
22965-22970 |
NNP |
denotes |
Alexa |
| T11127 |
22971-22976 |
NNP |
denotes |
Fluor |
| T11128 |
22997-23000 |
NN |
denotes |
IgG |
| T11129 |
22977-22980 |
CD |
denotes |
488 |
| T11130 |
22981-22985 |
NN |
denotes |
goat |
| T11131 |
22986-22996 |
JJ |
denotes |
anti-mouse |
| T11132 |
23001-23002 |
-LRB- |
denotes |
[ |
| T11133 |
23002-23012 |
NNP |
denotes |
Invitrogen |
| T11134 |
23012-23014 |
, |
denotes |
, |
| T11135 |
23014-23039 |
NN |
denotes |
http://www.invitrogen.com |
| T11136 |
23039-23040 |
-RRB- |
denotes |
] |
| T11137 |
23040-23041 |
-RRB- |
denotes |
) |
| T11138 |
23042-23045 |
IN |
denotes |
for |
| T11139 |
23046-23047 |
CD |
denotes |
1 |
| T11140 |
23048-23049 |
NN |
denotes |
h |
| T11141 |
23050-23052 |
IN |
denotes |
at |
| T11142 |
23053-23057 |
NN |
denotes |
room |
| T11143 |
23058-23069 |
NN |
denotes |
temperature |
| T11144 |
23069-23070 |
. |
denotes |
. |
| T11145 |
23070-23229 |
sentence |
denotes |
Sections were washed and mounted on glass slides in a buffered medium containing Mowiol (Calbiochem, http://www.emdbiosciences.com) as described earlier [14]. |
| T11146 |
23071-23079 |
NNS |
denotes |
Sections |
| T11147 |
23085-23091 |
VBN |
denotes |
washed |
| T11148 |
23080-23084 |
VBD |
denotes |
were |
| T11149 |
23092-23095 |
CC |
denotes |
and |
| T11150 |
23096-23103 |
VBN |
denotes |
mounted |
| T11151 |
23104-23106 |
IN |
denotes |
on |
| T11152 |
23107-23112 |
NN |
denotes |
glass |
| T11153 |
23113-23119 |
NNS |
denotes |
slides |
| T11154 |
23120-23122 |
IN |
denotes |
in |
| T11155 |
23123-23124 |
DT |
denotes |
a |
| T11156 |
23134-23140 |
NN |
denotes |
medium |
| T11157 |
23125-23133 |
VBN |
denotes |
buffered |
| T11158 |
23141-23151 |
VBG |
denotes |
containing |
| T11159 |
23152-23158 |
NN |
denotes |
Mowiol |
| T11160 |
23159-23160 |
-LRB- |
denotes |
( |
| T11161 |
23160-23170 |
NNP |
denotes |
Calbiochem |
| T11162 |
23170-23172 |
, |
denotes |
, |
| T11163 |
23172-23201 |
NN |
denotes |
http://www.emdbiosciences.com |
| T11164 |
23201-23202 |
-RRB- |
denotes |
) |
| T11165 |
23203-23205 |
IN |
denotes |
as |
| T11166 |
23206-23215 |
VBN |
denotes |
described |
| T11167 |
23216-23223 |
RBR |
denotes |
earlier |
| T11168 |
23224-23225 |
-LRB- |
denotes |
[ |
| T11169 |
23225-23227 |
CD |
denotes |
14 |
| T11170 |
23227-23228 |
-RRB- |
denotes |
] |
| T11171 |
23228-23229 |
. |
denotes |
. |
| T11172 |
23229-23333 |
sentence |
denotes |
Sections were imaged using a laser scanning confocal microscope (LSM 510; Zeiss, http://www.zeiss.com). |
| T11173 |
23230-23238 |
NNS |
denotes |
Sections |
| T11174 |
23244-23250 |
VBN |
denotes |
imaged |
| T11175 |
23239-23243 |
VBD |
denotes |
were |
| T11176 |
23251-23256 |
VBG |
denotes |
using |
| T11177 |
23257-23258 |
DT |
denotes |
a |
| T11178 |
23283-23293 |
NN |
denotes |
microscope |
| T11179 |
23259-23264 |
NN |
denotes |
laser |
| T11180 |
23265-23273 |
VBG |
denotes |
scanning |
| T11181 |
23274-23282 |
JJ |
denotes |
confocal |
| T11182 |
23294-23295 |
-LRB- |
denotes |
( |
| T11183 |
23304-23309 |
NNP |
denotes |
Zeiss |
| T11184 |
23295-23298 |
NN |
denotes |
LSM |
| T11185 |
23299-23302 |
CD |
denotes |
510 |
| T11186 |
23302-23303 |
: |
denotes |
; |
| T11187 |
23309-23311 |
, |
denotes |
, |
| T11188 |
23311-23331 |
NN |
denotes |
http://www.zeiss.com |
| T11189 |
23331-23332 |
-RRB- |
denotes |
) |
| T11190 |
23332-23333 |
. |
denotes |
. |
| T11191 |
23333-23492 |
sentence |
denotes |
Imaging parameters (pinhole, detector gain, laser power) were optimized, and were kept constant for the wild-type, heterozygous, and homozygous mutant brains. |
| T11192 |
23334-23341 |
NN |
denotes |
Imaging |
| T11193 |
23342-23352 |
NNS |
denotes |
parameters |
| T11194 |
23396-23405 |
VBN |
denotes |
optimized |
| T11195 |
23353-23354 |
-LRB- |
denotes |
( |
| T11196 |
23354-23361 |
NN |
denotes |
pinhole |
| T11197 |
23361-23363 |
, |
denotes |
, |
| T11198 |
23363-23371 |
NN |
denotes |
detector |
| T11199 |
23372-23376 |
NN |
denotes |
gain |
| T11200 |
23376-23378 |
, |
denotes |
, |
| T11201 |
23378-23383 |
NN |
denotes |
laser |
| T11202 |
23384-23389 |
NN |
denotes |
power |
| T11203 |
23389-23390 |
-RRB- |
denotes |
) |
| T11204 |
23391-23395 |
VBD |
denotes |
were |
| T11205 |
23405-23407 |
, |
denotes |
, |
| T11206 |
23407-23410 |
CC |
denotes |
and |
| T11207 |
23411-23415 |
VBD |
denotes |
were |
| T11208 |
23416-23420 |
VBN |
denotes |
kept |
| T11209 |
23421-23429 |
JJ |
denotes |
constant |
| T11210 |
23430-23433 |
IN |
denotes |
for |
| T11211 |
23434-23437 |
DT |
denotes |
the |
| T11212 |
23485-23491 |
NNS |
denotes |
brains |
| T11213 |
23438-23442 |
JJ |
denotes |
wild |
| T11214 |
23443-23447 |
NN |
denotes |
type |
| T11215 |
23442-23443 |
HYPH |
denotes |
- |
| T11216 |
23447-23449 |
, |
denotes |
, |
| T11217 |
23449-23461 |
JJ |
denotes |
heterozygous |
| T11218 |
23461-23463 |
, |
denotes |
, |
| T11219 |
23463-23466 |
CC |
denotes |
and |
| T11220 |
23467-23477 |
JJ |
denotes |
homozygous |
| T11221 |
23478-23484 |
NN |
denotes |
mutant |
| T11222 |
23491-23492 |
. |
denotes |
. |
| T11223 |
23492-23579 |
sentence |
denotes |
Specificity of the Itpr1 antibodies was verified by preabsorption control experiments. |
| T11224 |
23493-23504 |
NN |
denotes |
Specificity |
| T11225 |
23533-23541 |
VBN |
denotes |
verified |
| T11226 |
23505-23507 |
IN |
denotes |
of |
| T11227 |
23508-23511 |
DT |
denotes |
the |
| T11228 |
23518-23528 |
NNS |
denotes |
antibodies |
| T11229 |
23512-23517 |
NN |
denotes |
Itpr1 |
| T11230 |
23529-23532 |
VBD |
denotes |
was |
| T11231 |
23542-23544 |
IN |
denotes |
by |
| T11232 |
23545-23558 |
NN |
denotes |
preabsorption |
| T11233 |
23567-23578 |
NNS |
denotes |
experiments |
| T11234 |
23559-23566 |
NN |
denotes |
control |
| T11235 |
23578-23579 |
. |
denotes |
. |
| T11236 |
23579-23659 |
sentence |
denotes |
Antibody dilutions were incubated for 24 h at 4 °C with the immunizing peptide. |
| T11237 |
23580-23588 |
NN |
denotes |
Antibody |
| T11238 |
23589-23598 |
NNS |
denotes |
dilutions |
| T11239 |
23604-23613 |
VBN |
denotes |
incubated |
| T11240 |
23599-23603 |
VBD |
denotes |
were |
| T11241 |
23614-23617 |
IN |
denotes |
for |
| T11242 |
23618-23620 |
CD |
denotes |
24 |
| T11243 |
23621-23622 |
NN |
denotes |
h |
| T11244 |
23623-23625 |
IN |
denotes |
at |
| T11245 |
23626-23627 |
CD |
denotes |
4 |
| T11246 |
23628-23630 |
NN |
denotes |
°C |
| T11247 |
23631-23635 |
IN |
denotes |
with |
| T11248 |
23636-23639 |
DT |
denotes |
the |
| T11249 |
23651-23658 |
NN |
denotes |
peptide |
| T11250 |
23640-23650 |
VBG |
denotes |
immunizing |
| T11251 |
23658-23659 |
. |
denotes |
. |
| T11252 |
23659-23756 |
sentence |
denotes |
Tissue sections were incubated with the preabsorbed antibodies and processed as described above. |
| T11253 |
23660-23666 |
NN |
denotes |
Tissue |
| T11254 |
23667-23675 |
NNS |
denotes |
sections |
| T11255 |
23681-23690 |
VBN |
denotes |
incubated |
| T11256 |
23676-23680 |
VBD |
denotes |
were |
| T11257 |
23691-23695 |
IN |
denotes |
with |
| T11258 |
23696-23699 |
DT |
denotes |
the |
| T11259 |
23712-23722 |
NNS |
denotes |
antibodies |
| T11260 |
23700-23711 |
VBN |
denotes |
preabsorbed |
| T11261 |
23723-23726 |
CC |
denotes |
and |
| T11262 |
23727-23736 |
VBN |
denotes |
processed |
| T11263 |
23737-23739 |
IN |
denotes |
as |
| T11264 |
23740-23749 |
VBN |
denotes |
described |
| T11265 |
23750-23755 |
RB |
denotes |
above |
| T11266 |
23755-23756 |
. |
denotes |
. |
| T11267 |
23756-23829 |
sentence |
denotes |
Under these conditions, no staining above autofluorescence was detected. |
| T11268 |
23757-23762 |
IN |
denotes |
Under |
| T11269 |
23820-23828 |
VBN |
denotes |
detected |
| T11270 |
23763-23768 |
DT |
denotes |
these |
| T11271 |
23769-23779 |
NNS |
denotes |
conditions |
| T11272 |
23779-23781 |
, |
denotes |
, |
| T11273 |
23781-23783 |
DT |
denotes |
no |
| T11274 |
23784-23792 |
NN |
denotes |
staining |
| T11275 |
23793-23798 |
IN |
denotes |
above |
| T11276 |
23799-23815 |
NN |
denotes |
autofluorescence |
| T11277 |
23816-23819 |
VBD |
denotes |
was |
| T11278 |
23828-23829 |
. |
denotes |
. |
| T16337 |
16384-16392 |
NN |
denotes |
antibody |
| T12755 |
23831-23839 |
NN |
denotes |
Analysis |
| T12756 |
23840-23842 |
IN |
denotes |
of |
| T12757 |
23843-23848 |
NN |
denotes |
ITPR1 |
| T12758 |
23849-23851 |
IN |
denotes |
in |
| T12759 |
23852-23857 |
NN |
denotes |
SCA15 |
| T12760 |
23858-23866 |
NNS |
denotes |
patients |
| T12761 |
23866-23867 |
. |
denotes |
. |
| T12762 |
23867-23949 |
sentence |
denotes |
DNA was extracted from EBV immortalized lymphocytes, derived from family members. |
| T12763 |
23868-23871 |
NN |
denotes |
DNA |
| T12764 |
23876-23885 |
VBN |
denotes |
extracted |
| T12765 |
23872-23875 |
VBD |
denotes |
was |
| T12766 |
23886-23890 |
IN |
denotes |
from |
| T12767 |
23891-23894 |
NN |
denotes |
EBV |
| T12768 |
23908-23919 |
NNS |
denotes |
lymphocytes |
| T12769 |
23895-23907 |
VBN |
denotes |
immortalized |
| T12770 |
23919-23921 |
, |
denotes |
, |
| T12771 |
23921-23928 |
VBN |
denotes |
derived |
| T12772 |
23929-23933 |
IN |
denotes |
from |
| T12773 |
23934-23940 |
NN |
denotes |
family |
| T12774 |
23941-23948 |
NNS |
denotes |
members |
| T12775 |
23948-23949 |
. |
denotes |
. |
| T12776 |
23949-24155 |
sentence |
denotes |
The coding exons and at least 50 bp of flanking introns of ITPR1 were PCR amplified and sequenced using dye-terminator sequencing (BigDye version 3.1; Applied Biosystems, http://www.appliedbiosystems.com). |
| T12777 |
23950-23953 |
DT |
denotes |
The |
| T12778 |
23961-23966 |
NNS |
denotes |
exons |
| T12779 |
23954-23960 |
VBG |
denotes |
coding |
| T12780 |
24024-24033 |
VBN |
denotes |
amplified |
| T12781 |
23967-23970 |
CC |
denotes |
and |
| T12782 |
23971-23973 |
RB |
denotes |
at |
| T12783 |
23980-23982 |
CD |
denotes |
50 |
| T12784 |
23974-23979 |
RBS |
denotes |
least |
| T12785 |
23983-23985 |
NN |
denotes |
bp |
| T12786 |
23986-23988 |
IN |
denotes |
of |
| T12787 |
23989-23997 |
VBG |
denotes |
flanking |
| T12788 |
23998-24005 |
NNS |
denotes |
introns |
| T12789 |
24006-24008 |
IN |
denotes |
of |
| T12790 |
24009-24014 |
NN |
denotes |
ITPR1 |
| T12791 |
24015-24019 |
VBD |
denotes |
were |
| T12792 |
24020-24023 |
NN |
denotes |
PCR |
| T12793 |
24034-24037 |
CC |
denotes |
and |
| T12794 |
24038-24047 |
VBN |
denotes |
sequenced |
| T12795 |
24048-24053 |
VBG |
denotes |
using |
| T12796 |
24054-24057 |
NN |
denotes |
dye |
| T12797 |
24058-24068 |
NN |
denotes |
terminator |
| T12798 |
24057-24058 |
HYPH |
denotes |
- |
| T12799 |
24069-24079 |
NN |
denotes |
sequencing |
| T12800 |
24080-24081 |
-LRB- |
denotes |
( |
| T12801 |
24109-24119 |
NNP |
denotes |
Biosystems |
| T12802 |
24081-24087 |
NNP |
denotes |
BigDye |
| T12803 |
24088-24095 |
NN |
denotes |
version |
| T12804 |
24096-24099 |
CD |
denotes |
3.1 |
| T12805 |
24099-24100 |
: |
denotes |
; |
| T12806 |
24101-24108 |
NNP |
denotes |
Applied |
| T12807 |
24119-24121 |
, |
denotes |
, |
| T12808 |
24121-24153 |
NN |
denotes |
http://www.appliedbiosystems.com |
| T12809 |
24153-24154 |
-RRB- |
denotes |
) |
| T12810 |
24154-24155 |
. |
denotes |
. |
| T12811 |
24155-24280 |
sentence |
denotes |
Sequence reactions were run on an ABI3730XP automated sequencer as per the manufacturer's instructions (Applied Biosystems). |
| T12812 |
24156-24164 |
NN |
denotes |
Sequence |
| T12813 |
24165-24174 |
NNS |
denotes |
reactions |
| T12814 |
24180-24183 |
VBN |
denotes |
run |
| T12815 |
24175-24179 |
VBD |
denotes |
were |
| T12816 |
24184-24186 |
IN |
denotes |
on |
| T12817 |
24187-24189 |
DT |
denotes |
an |
| T12818 |
24210-24219 |
NN |
denotes |
sequencer |
| T12819 |
24190-24199 |
NN |
denotes |
ABI3730XP |
| T12820 |
24200-24209 |
VBN |
denotes |
automated |
| T12821 |
24220-24222 |
IN |
denotes |
as |
| T12822 |
24223-24226 |
IN |
denotes |
per |
| T12823 |
24227-24230 |
DT |
denotes |
the |
| T12824 |
24231-24243 |
NN |
denotes |
manufacturer |
| T12825 |
24246-24258 |
NNS |
denotes |
instructions |
| T12826 |
24243-24245 |
POS |
denotes |
's |
| T12827 |
24259-24260 |
-LRB- |
denotes |
( |
| T12828 |
24268-24278 |
NNP |
denotes |
Biosystems |
| T12829 |
24260-24267 |
NNP |
denotes |
Applied |
| T12830 |
24278-24279 |
-RRB- |
denotes |
) |
| T12831 |
24279-24280 |
. |
denotes |
. |
| T12832 |
24280-24404 |
sentence |
denotes |
This analysis was performed in all three affected family members for whom genomic DNA was available (members 6, 7, and 19). |
| T12833 |
24281-24285 |
DT |
denotes |
This |
| T12834 |
24286-24294 |
NN |
denotes |
analysis |
| T12835 |
24299-24308 |
VBN |
denotes |
performed |
| T12836 |
24295-24298 |
VBD |
denotes |
was |
| T12837 |
24309-24311 |
IN |
denotes |
in |
| T12838 |
24312-24315 |
DT |
denotes |
all |
| T12839 |
24338-24345 |
NNS |
denotes |
members |
| T12840 |
24316-24321 |
CD |
denotes |
three |
| T12841 |
24322-24330 |
VBN |
denotes |
affected |
| T12842 |
24331-24337 |
NN |
denotes |
family |
| T12843 |
24346-24349 |
IN |
denotes |
for |
| T12844 |
24367-24370 |
VBD |
denotes |
was |
| T12845 |
24350-24354 |
WP |
denotes |
whom |
| T12846 |
24355-24362 |
JJ |
denotes |
genomic |
| T12847 |
24363-24366 |
NN |
denotes |
DNA |
| T12848 |
24371-24380 |
JJ |
denotes |
available |
| T12849 |
24381-24382 |
-LRB- |
denotes |
( |
| T12850 |
24390-24391 |
CD |
denotes |
6 |
| T12851 |
24382-24389 |
NNS |
denotes |
members |
| T12852 |
24391-24393 |
, |
denotes |
, |
| T12853 |
24393-24394 |
CD |
denotes |
7 |
| T12854 |
24394-24396 |
, |
denotes |
, |
| T12855 |
24396-24399 |
CC |
denotes |
and |
| T12856 |
24400-24402 |
CD |
denotes |
19 |
| T12857 |
24402-24403 |
-RRB- |
denotes |
) |
| T12858 |
24403-24404 |
. |
denotes |
. |
| T12859 |
24404-24464 |
sentence |
denotes |
Primer sequences and conditions are available upon request. |
| T12860 |
24405-24411 |
NN |
denotes |
Primer |
| T12861 |
24412-24421 |
NNS |
denotes |
sequences |
| T12862 |
24437-24440 |
VBP |
denotes |
are |
| T12863 |
24422-24425 |
CC |
denotes |
and |
| T12864 |
24426-24436 |
NNS |
denotes |
conditions |
| T12865 |
24441-24450 |
JJ |
denotes |
available |
| T12866 |
24451-24455 |
IN |
denotes |
upon |
| T12867 |
24456-24463 |
NN |
denotes |
request |
| T12868 |
24463-24464 |
. |
denotes |
. |
| T12869 |
24464-24561 |
sentence |
denotes |
Sequence data were analyzed using Sequencher (Gene Codes Corporation, http://www.genecodes.com). |
| T12870 |
24465-24473 |
NN |
denotes |
Sequence |
| T12871 |
24474-24478 |
NNS |
denotes |
data |
| T12872 |
24484-24492 |
VBN |
denotes |
analyzed |
| T12873 |
24479-24483 |
VBD |
denotes |
were |
| T12874 |
24493-24498 |
VBG |
denotes |
using |
| T12875 |
24499-24509 |
NNP |
denotes |
Sequencher |
| T12876 |
24510-24511 |
-LRB- |
denotes |
( |
| T12877 |
24522-24533 |
NNP |
denotes |
Corporation |
| T12878 |
24511-24515 |
NNP |
denotes |
Gene |
| T12879 |
24516-24521 |
NNPS |
denotes |
Codes |
| T12880 |
24533-24535 |
, |
denotes |
, |
| T12881 |
24535-24559 |
NN |
denotes |
http://www.genecodes.com |
| T12882 |
24559-24560 |
-RRB- |
denotes |
) |
| T12883 |
24560-24561 |
. |
denotes |
. |
| T12884 |
24561-24722 |
sentence |
denotes |
Genome-wide SNP genotyping was performed using Infinium HumanHap550 SNP genotyping chips as per the manufacturer's protocol (Illumina, http://www.illumina.com). |
| T12885 |
24562-24568 |
NN |
denotes |
Genome |
| T12886 |
24569-24573 |
JJ |
denotes |
wide |
| T12887 |
24568-24569 |
HYPH |
denotes |
- |
| T12888 |
24578-24588 |
NN |
denotes |
genotyping |
| T12889 |
24574-24577 |
NN |
denotes |
SNP |
| T12890 |
24593-24602 |
VBN |
denotes |
performed |
| T12891 |
24589-24592 |
VBD |
denotes |
was |
| T12892 |
24603-24608 |
VBG |
denotes |
using |
| T12893 |
24609-24617 |
NNP |
denotes |
Infinium |
| T12894 |
24630-24633 |
NN |
denotes |
SNP |
| T12895 |
24618-24629 |
NN |
denotes |
HumanHap550 |
| T12896 |
24645-24650 |
NNS |
denotes |
chips |
| T12897 |
24634-24644 |
NN |
denotes |
genotyping |
| T12898 |
24651-24653 |
IN |
denotes |
as |
| T12899 |
24654-24657 |
IN |
denotes |
per |
| T12900 |
24658-24661 |
DT |
denotes |
the |
| T12901 |
24662-24674 |
NN |
denotes |
manufacturer |
| T12902 |
24677-24685 |
NN |
denotes |
protocol |
| T12903 |
24674-24676 |
POS |
denotes |
's |
| T12904 |
24686-24687 |
-LRB- |
denotes |
( |
| T12905 |
24687-24695 |
NNP |
denotes |
Illumina |
| T12906 |
24695-24697 |
, |
denotes |
, |
| T12907 |
24697-24720 |
NN |
denotes |
http://www.illumina.com |
| T12908 |
24720-24721 |
-RRB- |
denotes |
) |
| T12909 |
24721-24722 |
. |
denotes |
. |
| T12910 |
24722-24763 |
sentence |
denotes |
This product assays 555,352 unique SNPs. |
| T12911 |
24723-24727 |
DT |
denotes |
This |
| T12912 |
24728-24735 |
NN |
denotes |
product |
| T12913 |
24736-24742 |
VBZ |
denotes |
assays |
| T12914 |
24743-24750 |
CD |
denotes |
555,352 |
| T12915 |
24758-24762 |
NNS |
denotes |
SNPs |
| T12916 |
24751-24757 |
JJ |
denotes |
unique |
| T12917 |
24762-24763 |
. |
denotes |
. |
| T12918 |
24763-24852 |
sentence |
denotes |
Data were collected using the Illumina BeadStation scanner and data collection software. |
| T12919 |
24764-24768 |
NNS |
denotes |
Data |
| T12920 |
24774-24783 |
VBN |
denotes |
collected |
| T12921 |
24769-24773 |
VBD |
denotes |
were |
| T12922 |
24784-24789 |
VBG |
denotes |
using |
| T12923 |
24790-24793 |
DT |
denotes |
the |
| T12924 |
24815-24822 |
NN |
denotes |
scanner |
| T12925 |
24794-24802 |
NNP |
denotes |
Illumina |
| T12926 |
24803-24814 |
NNP |
denotes |
BeadStation |
| T12927 |
24823-24826 |
CC |
denotes |
and |
| T12928 |
24827-24831 |
NNS |
denotes |
data |
| T12929 |
24832-24842 |
NN |
denotes |
collection |
| T12930 |
24843-24851 |
NN |
denotes |
software |
| T12931 |
24851-24852 |
. |
denotes |
. |
| T12932 |
24852-25051 |
sentence |
denotes |
Genotypes were produced using the genotyping module of BeadStudio (version 2.3.25; Illumina), and log R ratio and B allele frequency were visualized using the genome viewer tool within this package. |
| T12933 |
24853-24862 |
NNS |
denotes |
Genotypes |
| T12934 |
24868-24876 |
VBN |
denotes |
produced |
| T12935 |
24863-24867 |
VBD |
denotes |
were |
| T12936 |
24877-24882 |
VBG |
denotes |
using |
| T12937 |
24883-24886 |
DT |
denotes |
the |
| T12938 |
24898-24904 |
NN |
denotes |
module |
| T12939 |
24887-24897 |
NN |
denotes |
genotyping |
| T12940 |
24905-24907 |
IN |
denotes |
of |
| T12941 |
24908-24918 |
NNP |
denotes |
BeadStudio |
| T12942 |
24919-24920 |
-LRB- |
denotes |
( |
| T12943 |
24920-24927 |
NN |
denotes |
version |
| T12944 |
24928-24934 |
CD |
denotes |
2.3.25 |
| T12945 |
24934-24935 |
: |
denotes |
; |
| T12946 |
24936-24944 |
NNP |
denotes |
Illumina |
| T12947 |
24944-24945 |
-RRB- |
denotes |
) |
| T12948 |
24945-24947 |
, |
denotes |
, |
| T12949 |
24947-24950 |
CC |
denotes |
and |
| T12950 |
24951-24954 |
NN |
denotes |
log |
| T12951 |
24955-24956 |
NN |
denotes |
R |
| T12952 |
24957-24962 |
NN |
denotes |
ratio |
| T12953 |
24991-25001 |
VBN |
denotes |
visualized |
| T12954 |
24963-24966 |
CC |
denotes |
and |
| T12955 |
24967-24968 |
NN |
denotes |
B |
| T12956 |
24969-24975 |
NN |
denotes |
allele |
| T12957 |
24976-24985 |
NN |
denotes |
frequency |
| T12958 |
24986-24990 |
VBD |
denotes |
were |
| T12959 |
25002-25007 |
VBG |
denotes |
using |
| T12960 |
25008-25011 |
DT |
denotes |
the |
| T12961 |
25026-25030 |
NN |
denotes |
tool |
| T12962 |
25012-25018 |
NN |
denotes |
genome |
| T12963 |
25019-25025 |
JJR |
denotes |
viewer |
| T12964 |
25031-25037 |
IN |
denotes |
within |
| T12965 |
25038-25042 |
DT |
denotes |
this |
| T12966 |
25043-25050 |
NN |
denotes |
package |
| T12967 |
25050-25051 |
. |
denotes |
. |
| T12968 |
25051-25388 |
sentence |
denotes |
In order to rule out the possibility that the observed deletion within ITPR1 was a benign copy number variant we examined log R ratio and B allele frequency metrics of HumanHap550 genotyping data at this locus from 577 individuals of Northern European descent from North America and Europe, produced by us as a part of an ongoing study. |
| T12969 |
25052-25054 |
IN |
denotes |
In |
| T12970 |
25165-25173 |
VBD |
denotes |
examined |
| T12971 |
25055-25060 |
NN |
denotes |
order |
| T12972 |
25061-25063 |
TO |
denotes |
to |
| T12973 |
25064-25068 |
VB |
denotes |
rule |
| T12974 |
25069-25072 |
RP |
denotes |
out |
| T12975 |
25073-25076 |
DT |
denotes |
the |
| T12976 |
25077-25088 |
NN |
denotes |
possibility |
| T12977 |
25089-25093 |
IN |
denotes |
that |
| T12978 |
25129-25132 |
VBD |
denotes |
was |
| T12979 |
25094-25097 |
DT |
denotes |
the |
| T12980 |
25107-25115 |
NN |
denotes |
deletion |
| T12981 |
25098-25106 |
VBN |
denotes |
observed |
| T12982 |
25116-25122 |
IN |
denotes |
within |
| T12983 |
25123-25128 |
NN |
denotes |
ITPR1 |
| T12984 |
25133-25134 |
DT |
denotes |
a |
| T12985 |
25154-25161 |
NN |
denotes |
variant |
| T12986 |
25135-25141 |
JJ |
denotes |
benign |
| T12987 |
25142-25146 |
NN |
denotes |
copy |
| T12988 |
25147-25153 |
NN |
denotes |
number |
| T12989 |
25162-25164 |
PRP |
denotes |
we |
| T12990 |
25174-25177 |
NN |
denotes |
log |
| T12991 |
25178-25179 |
NN |
denotes |
R |
| T12992 |
25180-25185 |
NN |
denotes |
ratio |
| T12993 |
25209-25216 |
NNS |
denotes |
metrics |
| T12994 |
25186-25189 |
CC |
denotes |
and |
| T12995 |
25190-25191 |
NN |
denotes |
B |
| T12996 |
25192-25198 |
NN |
denotes |
allele |
| T12997 |
25199-25208 |
NN |
denotes |
frequency |
| T12998 |
25217-25219 |
IN |
denotes |
of |
| T12999 |
25220-25231 |
NN |
denotes |
HumanHap550 |
| T13000 |
25243-25247 |
NNS |
denotes |
data |
| T13001 |
25232-25242 |
NN |
denotes |
genotyping |
| T13002 |
25248-25250 |
IN |
denotes |
at |
| T13003 |
25251-25255 |
DT |
denotes |
this |
| T13004 |
25256-25261 |
NN |
denotes |
locus |
| T13005 |
25262-25266 |
IN |
denotes |
from |
| T13006 |
25267-25270 |
CD |
denotes |
577 |
| T13007 |
25271-25282 |
NNS |
denotes |
individuals |
| T13008 |
25283-25285 |
IN |
denotes |
of |
| T13009 |
25286-25294 |
JJ |
denotes |
Northern |
| T13010 |
25295-25303 |
JJ |
denotes |
European |
| T13011 |
25304-25311 |
NN |
denotes |
descent |
| T13012 |
25312-25316 |
IN |
denotes |
from |
| T13013 |
25317-25322 |
NNP |
denotes |
North |
| T13014 |
25323-25330 |
NNP |
denotes |
America |
| T13015 |
25331-25334 |
CC |
denotes |
and |
| T13016 |
25335-25341 |
NNP |
denotes |
Europe |
| T13017 |
25341-25343 |
, |
denotes |
, |
| T13018 |
25343-25351 |
VBN |
denotes |
produced |
| T13019 |
25352-25354 |
IN |
denotes |
by |
| T13020 |
25355-25357 |
PRP |
denotes |
us |
| T13021 |
25358-25360 |
IN |
denotes |
as |
| T13022 |
25361-25362 |
DT |
denotes |
a |
| T13023 |
25363-25367 |
NN |
denotes |
part |
| T13024 |
25368-25370 |
IN |
denotes |
of |
| T13025 |
25371-25373 |
DT |
denotes |
an |
| T13026 |
25382-25387 |
NN |
denotes |
study |
| T13027 |
25374-25381 |
JJ |
denotes |
ongoing |
| T13028 |
25387-25388 |
. |
denotes |
. |
| T13029 |
25388-25659 |
sentence |
denotes |
In an attempt to narrow the unknown intervals flanking the deletion observed in family AUS1, we designed primers for 30 PCR amplifications that would generate overlapping fragments across the two bordering regions (primer sequence and conditions available upon request). |
| T13030 |
25389-25391 |
IN |
denotes |
In |
| T13031 |
25485-25493 |
VBD |
denotes |
designed |
| T13032 |
25392-25394 |
DT |
denotes |
an |
| T13033 |
25395-25402 |
NN |
denotes |
attempt |
| T13034 |
25403-25405 |
TO |
denotes |
to |
| T13035 |
25406-25412 |
VB |
denotes |
narrow |
| T13036 |
25413-25416 |
DT |
denotes |
the |
| T13037 |
25425-25434 |
NNS |
denotes |
intervals |
| T13038 |
25417-25424 |
JJ |
denotes |
unknown |
| T13039 |
25435-25443 |
VBG |
denotes |
flanking |
| T13040 |
25444-25447 |
DT |
denotes |
the |
| T13041 |
25448-25456 |
NN |
denotes |
deletion |
| T13042 |
25457-25465 |
VBN |
denotes |
observed |
| T13043 |
25466-25468 |
IN |
denotes |
in |
| T13044 |
25469-25475 |
NN |
denotes |
family |
| T13045 |
25476-25480 |
NN |
denotes |
AUS1 |
| T13046 |
25480-25482 |
, |
denotes |
, |
| T13047 |
25482-25484 |
PRP |
denotes |
we |
| T13048 |
25494-25501 |
NNS |
denotes |
primers |
| T13049 |
25502-25505 |
IN |
denotes |
for |
| T13050 |
25506-25508 |
CD |
denotes |
30 |
| T13051 |
25513-25527 |
NNS |
denotes |
amplifications |
| T13052 |
25509-25512 |
NN |
denotes |
PCR |
| T13053 |
25528-25532 |
WDT |
denotes |
that |
| T13054 |
25539-25547 |
VB |
denotes |
generate |
| T13055 |
25533-25538 |
MD |
denotes |
would |
| T13056 |
25548-25559 |
VBG |
denotes |
overlapping |
| T13057 |
25560-25569 |
NNS |
denotes |
fragments |
| T13058 |
25570-25576 |
IN |
denotes |
across |
| T13059 |
25577-25580 |
DT |
denotes |
the |
| T13060 |
25595-25602 |
NNS |
denotes |
regions |
| T13061 |
25581-25584 |
CD |
denotes |
two |
| T13062 |
25585-25594 |
NN |
denotes |
bordering |
| T13063 |
25603-25604 |
-LRB- |
denotes |
( |
| T13064 |
25611-25619 |
NN |
denotes |
sequence |
| T13065 |
25604-25610 |
NN |
denotes |
primer |
| T13066 |
25620-25623 |
CC |
denotes |
and |
| T13067 |
25624-25634 |
NNS |
denotes |
conditions |
| T13068 |
25635-25644 |
JJ |
denotes |
available |
| T13069 |
25645-25649 |
IN |
denotes |
upon |
| T13070 |
25650-25657 |
NN |
denotes |
request |
| T13071 |
25657-25658 |
-RRB- |
denotes |
) |
| T13072 |
25658-25659 |
. |
denotes |
. |
| T13073 |
25659-25781 |
sentence |
denotes |
There were ten primer pairs in the telomeric flanking region and 20 pairs in the centromeric flanking region (Figure S3). |
| T13074 |
25660-25665 |
EX |
denotes |
There |
| T13075 |
25666-25670 |
VBD |
denotes |
were |
| T13076 |
25671-25674 |
CD |
denotes |
ten |
| T13077 |
25682-25687 |
NNS |
denotes |
pairs |
| T13078 |
25675-25681 |
NN |
denotes |
primer |
| T13079 |
25688-25690 |
IN |
denotes |
in |
| T13080 |
25691-25694 |
DT |
denotes |
the |
| T13081 |
25714-25720 |
NN |
denotes |
region |
| T13082 |
25695-25704 |
JJ |
denotes |
telomeric |
| T13083 |
25705-25713 |
NN |
denotes |
flanking |
| T13084 |
25721-25724 |
CC |
denotes |
and |
| T13085 |
25725-25727 |
CD |
denotes |
20 |
| T13086 |
25728-25733 |
NNS |
denotes |
pairs |
| T13087 |
25734-25736 |
IN |
denotes |
in |
| T13088 |
25737-25740 |
DT |
denotes |
the |
| T13089 |
25762-25768 |
NN |
denotes |
region |
| T13090 |
25741-25752 |
JJ |
denotes |
centromeric |
| T13091 |
25753-25761 |
NN |
denotes |
flanking |
| T13092 |
25769-25770 |
-LRB- |
denotes |
( |
| T13093 |
25777-25779 |
NN |
denotes |
S3 |
| T13094 |
25770-25776 |
NN |
denotes |
Figure |
| T13095 |
25779-25780 |
-RRB- |
denotes |
) |
| T13096 |
25780-25781 |
. |
denotes |
. |
| T13097 |
25781-25953 |
sentence |
denotes |
On average each product was ~750 bp in size, and amplifications were performed using genomic DNA from each of the three affected individuals (family members 6, 7, and 19). |
| T13098 |
25782-25784 |
IN |
denotes |
On |
| T13099 |
25806-25809 |
VBD |
denotes |
was |
| T13100 |
25785-25792 |
JJ |
denotes |
average |
| T13101 |
25793-25797 |
DT |
denotes |
each |
| T13102 |
25798-25805 |
NN |
denotes |
product |
| T13103 |
25810-25811 |
SYM |
denotes |
~ |
| T13104 |
25811-25814 |
CD |
denotes |
750 |
| T13105 |
25815-25817 |
NN |
denotes |
bp |
| T13106 |
25818-25820 |
IN |
denotes |
in |
| T13107 |
25821-25825 |
NN |
denotes |
size |
| T13108 |
25825-25827 |
, |
denotes |
, |
| T13109 |
25827-25830 |
CC |
denotes |
and |
| T13110 |
25831-25845 |
NNS |
denotes |
amplifications |
| T13111 |
25851-25860 |
VBN |
denotes |
performed |
| T13112 |
25846-25850 |
VBD |
denotes |
were |
| T13113 |
25861-25866 |
VBG |
denotes |
using |
| T13114 |
25867-25874 |
JJ |
denotes |
genomic |
| T13115 |
25875-25878 |
NN |
denotes |
DNA |
| T13116 |
25879-25883 |
IN |
denotes |
from |
| T13117 |
25884-25888 |
DT |
denotes |
each |
| T13118 |
25889-25891 |
IN |
denotes |
of |
| T13119 |
25892-25895 |
DT |
denotes |
the |
| T13120 |
25911-25922 |
NNS |
denotes |
individuals |
| T13121 |
25896-25901 |
CD |
denotes |
three |
| T13122 |
25902-25910 |
VBN |
denotes |
affected |
| T13123 |
25923-25924 |
-LRB- |
denotes |
( |
| T13124 |
25939-25940 |
CD |
denotes |
6 |
| T13125 |
25924-25930 |
NN |
denotes |
family |
| T13126 |
25931-25938 |
NNS |
denotes |
members |
| T13127 |
25940-25942 |
, |
denotes |
, |
| T13128 |
25942-25943 |
CD |
denotes |
7 |
| T13129 |
25943-25945 |
, |
denotes |
, |
| T13130 |
25945-25948 |
CC |
denotes |
and |
| T13131 |
25949-25951 |
CD |
denotes |
19 |
| T13132 |
25951-25952 |
-RRB- |
denotes |
) |
| T13133 |
25952-25953 |
. |
denotes |
. |
| T13134 |
25953-26147 |
sentence |
denotes |
Dye-terminator sequencing of each product was performed using the forward and reverse primers designed for amplification; running and analysis of each fragment was performed as described above. |
| T13135 |
25954-25957 |
NN |
denotes |
Dye |
| T13136 |
25958-25968 |
NN |
denotes |
terminator |
| T13137 |
25957-25958 |
HYPH |
denotes |
- |
| T13138 |
25969-25979 |
NN |
denotes |
sequencing |
| T13139 |
26000-26009 |
VBN |
denotes |
performed |
| T13140 |
25980-25982 |
IN |
denotes |
of |
| T13141 |
25983-25987 |
DT |
denotes |
each |
| T13142 |
25988-25995 |
NN |
denotes |
product |
| T13143 |
25996-25999 |
VBD |
denotes |
was |
| T13144 |
26118-26127 |
VBN |
denotes |
performed |
| T13145 |
26010-26015 |
VBG |
denotes |
using |
| T13146 |
26016-26019 |
DT |
denotes |
the |
| T13147 |
26040-26047 |
NNS |
denotes |
primers |
| T13148 |
26020-26027 |
JJ |
denotes |
forward |
| T13149 |
26028-26031 |
CC |
denotes |
and |
| T13150 |
26032-26039 |
JJ |
denotes |
reverse |
| T13151 |
26048-26056 |
VBN |
denotes |
designed |
| T13152 |
26057-26060 |
IN |
denotes |
for |
| T13153 |
26061-26074 |
NN |
denotes |
amplification |
| T13154 |
26074-26075 |
: |
denotes |
; |
| T13155 |
26076-26083 |
VBG |
denotes |
running |
| T13156 |
26088-26096 |
NN |
denotes |
analysis |
| T13157 |
26084-26087 |
CC |
denotes |
and |
| T13158 |
26097-26099 |
IN |
denotes |
of |
| T13159 |
26100-26104 |
DT |
denotes |
each |
| T13160 |
26105-26113 |
NN |
denotes |
fragment |
| T13161 |
26114-26117 |
VBD |
denotes |
was |
| T13162 |
26128-26130 |
IN |
denotes |
as |
| T13163 |
26131-26140 |
VBN |
denotes |
described |
| T13164 |
26141-26146 |
RB |
denotes |
above |
| T13165 |
26146-26147 |
. |
denotes |
. |
| T13166 |
26147-26600 |
sentence |
denotes |
Amplification of a fragment from a normal diploid genome was denoted by the presence of a heterozygous polymorphism; amplification of a fragment from a region of the genome harboring a heterozygous genomic deletion was inferred when homozygosity for the major allele and the minor allele were noted among the three affected family members (i.e., this is inconsistent with Mendelian inheritance in related individuals known to share a common haplotype). |
| T13167 |
26148-26161 |
NN |
denotes |
Amplification |
| T13168 |
26209-26216 |
VBN |
denotes |
denoted |
| T13169 |
26162-26164 |
IN |
denotes |
of |
| T13170 |
26165-26166 |
DT |
denotes |
a |
| T13171 |
26167-26175 |
NN |
denotes |
fragment |
| T13172 |
26176-26180 |
IN |
denotes |
from |
| T13173 |
26181-26182 |
DT |
denotes |
a |
| T13174 |
26198-26204 |
NN |
denotes |
genome |
| T13175 |
26183-26189 |
JJ |
denotes |
normal |
| T13176 |
26190-26197 |
JJ |
denotes |
diploid |
| T13177 |
26205-26208 |
VBD |
denotes |
was |
| T13178 |
26367-26375 |
VBN |
denotes |
inferred |
| T13179 |
26217-26219 |
IN |
denotes |
by |
| T13180 |
26220-26223 |
DT |
denotes |
the |
| T13181 |
26224-26232 |
NN |
denotes |
presence |
| T13182 |
26233-26235 |
IN |
denotes |
of |
| T13183 |
26236-26237 |
DT |
denotes |
a |
| T13184 |
26251-26263 |
NN |
denotes |
polymorphism |
| T13185 |
26238-26250 |
JJ |
denotes |
heterozygous |
| T13186 |
26263-26264 |
: |
denotes |
; |
| T13187 |
26265-26278 |
NN |
denotes |
amplification |
| T13188 |
26279-26281 |
IN |
denotes |
of |
| T13189 |
26282-26283 |
DT |
denotes |
a |
| T13190 |
26284-26292 |
NN |
denotes |
fragment |
| T13191 |
26293-26297 |
IN |
denotes |
from |
| T13192 |
26298-26299 |
DT |
denotes |
a |
| T13193 |
26300-26306 |
NN |
denotes |
region |
| T13194 |
26307-26309 |
IN |
denotes |
of |
| T13195 |
26310-26313 |
DT |
denotes |
the |
| T13196 |
26314-26320 |
NN |
denotes |
genome |
| T13197 |
26321-26330 |
VBG |
denotes |
harboring |
| T13198 |
26331-26332 |
DT |
denotes |
a |
| T13199 |
26354-26362 |
NN |
denotes |
deletion |
| T13200 |
26333-26345 |
JJ |
denotes |
heterozygous |
| T13201 |
26346-26353 |
JJ |
denotes |
genomic |
| T13202 |
26363-26366 |
VBD |
denotes |
was |
| T13203 |
26376-26380 |
WRB |
denotes |
when |
| T13204 |
26441-26446 |
VBN |
denotes |
noted |
| T13205 |
26381-26393 |
NN |
denotes |
homozygosity |
| T13206 |
26394-26397 |
IN |
denotes |
for |
| T13207 |
26398-26401 |
DT |
denotes |
the |
| T13208 |
26408-26414 |
NN |
denotes |
allele |
| T13209 |
26402-26407 |
JJ |
denotes |
major |
| T13210 |
26415-26418 |
CC |
denotes |
and |
| T13211 |
26419-26422 |
DT |
denotes |
the |
| T13212 |
26429-26435 |
NN |
denotes |
allele |
| T13213 |
26423-26428 |
JJ |
denotes |
minor |
| T13214 |
26436-26440 |
VBD |
denotes |
were |
| T13215 |
26447-26452 |
IN |
denotes |
among |
| T13216 |
26453-26456 |
DT |
denotes |
the |
| T13217 |
26479-26486 |
NNS |
denotes |
members |
| T13218 |
26457-26462 |
CD |
denotes |
three |
| T13219 |
26463-26471 |
VBN |
denotes |
affected |
| T13220 |
26472-26478 |
NN |
denotes |
family |
| T13221 |
26487-26488 |
-LRB- |
denotes |
( |
| T13222 |
26499-26501 |
VBZ |
denotes |
is |
| T13223 |
26488-26492 |
FW |
denotes |
i.e. |
| T13224 |
26492-26494 |
, |
denotes |
, |
| T13225 |
26494-26498 |
DT |
denotes |
this |
| T13226 |
26502-26514 |
JJ |
denotes |
inconsistent |
| T13227 |
26515-26519 |
IN |
denotes |
with |
| T13228 |
26520-26529 |
JJ |
denotes |
Mendelian |
| T13229 |
26530-26541 |
NN |
denotes |
inheritance |
| T13230 |
26542-26544 |
IN |
denotes |
in |
| T13231 |
26545-26552 |
JJ |
denotes |
related |
| T13232 |
26553-26564 |
NNS |
denotes |
individuals |
| T13233 |
26565-26570 |
VBN |
denotes |
known |
| T13234 |
26571-26573 |
TO |
denotes |
to |
| T13235 |
26574-26579 |
VB |
denotes |
share |
| T13236 |
26580-26581 |
DT |
denotes |
a |
| T13237 |
26589-26598 |
NN |
denotes |
haplotype |
| T13238 |
26582-26588 |
JJ |
denotes |
common |
| T13239 |
26598-26599 |
-RRB- |
denotes |
) |
| T13240 |
26599-26600 |
. |
denotes |
. |
| T13241 |
26600-26789 |
sentence |
denotes |
Using the data from the experiments described above we were able to limit the size of unknown regions flanking the deletion to ~4 kb on the telomeric side and 7 kb on the centromeric side. |
| T13242 |
26601-26606 |
VBG |
denotes |
Using |
| T13243 |
26656-26660 |
VBD |
denotes |
were |
| T13244 |
26607-26610 |
DT |
denotes |
the |
| T13245 |
26611-26615 |
NNS |
denotes |
data |
| T13246 |
26616-26620 |
IN |
denotes |
from |
| T13247 |
26621-26624 |
DT |
denotes |
the |
| T13248 |
26625-26636 |
NNS |
denotes |
experiments |
| T13249 |
26637-26646 |
VBN |
denotes |
described |
| T13250 |
26647-26652 |
RB |
denotes |
above |
| T13251 |
26653-26655 |
PRP |
denotes |
we |
| T13252 |
26661-26665 |
JJ |
denotes |
able |
| T13253 |
26666-26668 |
TO |
denotes |
to |
| T13254 |
26669-26674 |
VB |
denotes |
limit |
| T13255 |
26675-26678 |
DT |
denotes |
the |
| T13256 |
26679-26683 |
NN |
denotes |
size |
| T13257 |
26684-26686 |
IN |
denotes |
of |
| T13258 |
26687-26694 |
JJ |
denotes |
unknown |
| T13259 |
26695-26702 |
NNS |
denotes |
regions |
| T13260 |
26703-26711 |
VBG |
denotes |
flanking |
| T13261 |
26712-26715 |
DT |
denotes |
the |
| T13262 |
26716-26724 |
NN |
denotes |
deletion |
| T13263 |
26725-26727 |
IN |
denotes |
to |
| T13264 |
26728-26729 |
SYM |
denotes |
~ |
| T13265 |
26729-26730 |
CD |
denotes |
4 |
| T13266 |
26731-26733 |
NN |
denotes |
kb |
| T13267 |
26734-26736 |
IN |
denotes |
on |
| T13268 |
26737-26740 |
DT |
denotes |
the |
| T13269 |
26751-26755 |
NN |
denotes |
side |
| T13270 |
26741-26750 |
JJ |
denotes |
telomeric |
| T13271 |
26756-26759 |
CC |
denotes |
and |
| T13272 |
26760-26761 |
CD |
denotes |
7 |
| T13273 |
26762-26764 |
NN |
denotes |
kb |
| T13274 |
26765-26767 |
IN |
denotes |
on |
| T13275 |
26768-26771 |
DT |
denotes |
the |
| T13276 |
26784-26788 |
NN |
denotes |
side |
| T13277 |
26772-26783 |
JJ |
denotes |
centromeric |
| T13278 |
26788-26789 |
. |
denotes |
. |
| T13279 |
26789-27133 |
sentence |
denotes |
All combinations of forward primers from the newly defined region flanking the deletion on the telomeric side with reverse primers from the newly defined region flanking the deletion on the centromeric side were used in PCR amplification reactions performed with DNA from the three affected family members and single unaffected family members. |
| T13280 |
26790-26793 |
DT |
denotes |
All |
| T13281 |
26794-26806 |
NNS |
denotes |
combinations |
| T13282 |
27002-27006 |
VBN |
denotes |
used |
| T13283 |
26807-26809 |
IN |
denotes |
of |
| T13284 |
26810-26817 |
JJ |
denotes |
forward |
| T13285 |
26818-26825 |
NNS |
denotes |
primers |
| T13286 |
26826-26830 |
IN |
denotes |
from |
| T13287 |
26831-26834 |
DT |
denotes |
the |
| T13288 |
26849-26855 |
NN |
denotes |
region |
| T13289 |
26835-26840 |
RB |
denotes |
newly |
| T13290 |
26841-26848 |
VBN |
denotes |
defined |
| T13291 |
26856-26864 |
VBG |
denotes |
flanking |
| T13292 |
26865-26868 |
DT |
denotes |
the |
| T13293 |
26869-26877 |
NN |
denotes |
deletion |
| T13294 |
26878-26880 |
IN |
denotes |
on |
| T13295 |
26881-26884 |
DT |
denotes |
the |
| T13296 |
26895-26899 |
NN |
denotes |
side |
| T13297 |
26885-26894 |
JJ |
denotes |
telomeric |
| T13298 |
26900-26904 |
IN |
denotes |
with |
| T13299 |
26905-26912 |
JJ |
denotes |
reverse |
| T13300 |
26913-26920 |
NNS |
denotes |
primers |
| T13301 |
26921-26925 |
IN |
denotes |
from |
| T13302 |
26926-26929 |
DT |
denotes |
the |
| T13303 |
26944-26950 |
NN |
denotes |
region |
| T13304 |
26930-26935 |
RB |
denotes |
newly |
| T13305 |
26936-26943 |
VBN |
denotes |
defined |
| T13306 |
26951-26959 |
VBG |
denotes |
flanking |
| T13307 |
26960-26963 |
DT |
denotes |
the |
| T13308 |
26964-26972 |
NN |
denotes |
deletion |
| T13309 |
26973-26975 |
IN |
denotes |
on |
| T13310 |
26976-26979 |
DT |
denotes |
the |
| T13311 |
26992-26996 |
NN |
denotes |
side |
| T13312 |
26980-26991 |
JJ |
denotes |
centromeric |
| T13313 |
26997-27001 |
VBD |
denotes |
were |
| T13314 |
27007-27009 |
IN |
denotes |
in |
| T13315 |
27010-27013 |
NN |
denotes |
PCR |
| T13316 |
27014-27027 |
NN |
denotes |
amplification |
| T13317 |
27028-27037 |
NNS |
denotes |
reactions |
| T13318 |
27038-27047 |
VBN |
denotes |
performed |
| T13319 |
27048-27052 |
IN |
denotes |
with |
| T13320 |
27053-27056 |
NN |
denotes |
DNA |
| T13321 |
27057-27061 |
IN |
denotes |
from |
| T13322 |
27062-27065 |
DT |
denotes |
the |
| T13323 |
27088-27095 |
NNS |
denotes |
members |
| T13324 |
27066-27071 |
CD |
denotes |
three |
| T13325 |
27072-27080 |
VBN |
denotes |
affected |
| T13326 |
27081-27087 |
NN |
denotes |
family |
| T13327 |
27096-27099 |
CC |
denotes |
and |
| T13328 |
27100-27106 |
JJ |
denotes |
single |
| T13329 |
27125-27132 |
NNS |
denotes |
members |
| T13330 |
27107-27117 |
JJ |
denotes |
unaffected |
| T13331 |
27118-27124 |
NN |
denotes |
family |
| T13332 |
27132-27133 |
. |
denotes |
. |
| T13333 |
27133-27249 |
sentence |
denotes |
This experiment was performed in an attempt to amplify across the deleted fragment and define the exact breakpoint. |
| T13334 |
27134-27138 |
DT |
denotes |
This |
| T13335 |
27139-27149 |
NN |
denotes |
experiment |
| T13336 |
27154-27163 |
VBN |
denotes |
performed |
| T13337 |
27150-27153 |
VBD |
denotes |
was |
| T13338 |
27164-27166 |
IN |
denotes |
in |
| T13339 |
27167-27169 |
DT |
denotes |
an |
| T13340 |
27170-27177 |
NN |
denotes |
attempt |
| T13341 |
27178-27180 |
TO |
denotes |
to |
| T13342 |
27181-27188 |
VB |
denotes |
amplify |
| T13343 |
27189-27195 |
IN |
denotes |
across |
| T13344 |
27196-27199 |
DT |
denotes |
the |
| T13345 |
27208-27216 |
NN |
denotes |
fragment |
| T13346 |
27200-27207 |
VBN |
denotes |
deleted |
| T13347 |
27217-27220 |
CC |
denotes |
and |
| T13348 |
27221-27227 |
VB |
denotes |
define |
| T13349 |
27228-27231 |
DT |
denotes |
the |
| T13350 |
27238-27248 |
NN |
denotes |
breakpoint |
| T13351 |
27232-27237 |
JJ |
denotes |
exact |
| T13352 |
27248-27249 |
. |
denotes |
. |
| T13353 |
27249-27457 |
sentence |
denotes |
A single fragment was obtained from the third forward primer from the telomeric side (T3f 5′-TGAATGCTCAATTTTCCAGC-3′) with the 11th reverse primer from the centromeric side (C11r 5′-GGGAAAATGGATAGAGGGTG-3′). |
| T13354 |
27250-27251 |
DT |
denotes |
A |
| T13355 |
27259-27267 |
NN |
denotes |
fragment |
| T13356 |
27252-27258 |
JJ |
denotes |
single |
| T13357 |
27272-27280 |
VBN |
denotes |
obtained |
| T13358 |
27268-27271 |
VBD |
denotes |
was |
| T13359 |
27281-27285 |
IN |
denotes |
from |
| T13360 |
27286-27289 |
DT |
denotes |
the |
| T13361 |
27304-27310 |
NN |
denotes |
primer |
| T13362 |
27290-27295 |
JJ |
denotes |
third |
| T13363 |
27296-27303 |
JJ |
denotes |
forward |
| T13364 |
27311-27315 |
IN |
denotes |
from |
| T13365 |
27316-27319 |
DT |
denotes |
the |
| T13366 |
27330-27334 |
NN |
denotes |
side |
| T13367 |
27320-27329 |
JJ |
denotes |
telomeric |
| T13368 |
27335-27336 |
-LRB- |
denotes |
( |
| T13369 |
27343-27363 |
NN |
denotes |
TGAATGCTCAATTTTCCAGC |
| T13370 |
27336-27339 |
NN |
denotes |
T3f |
| T13371 |
27340-27341 |
CD |
denotes |
5 |
| T13372 |
27341-27342 |
SYM |
denotes |
′ |
| T13373 |
27342-27343 |
HYPH |
denotes |
- |
| T13374 |
27363-27364 |
HYPH |
denotes |
- |
| T13375 |
27364-27365 |
CD |
denotes |
3 |
| T13376 |
27365-27366 |
SYM |
denotes |
′ |
| T13377 |
27366-27367 |
-RRB- |
denotes |
) |
| T13378 |
27368-27372 |
IN |
denotes |
with |
| T13379 |
27373-27376 |
DT |
denotes |
the |
| T13380 |
27390-27396 |
NN |
denotes |
primer |
| T13381 |
27377-27381 |
JJ |
denotes |
11th |
| T13382 |
27382-27389 |
JJ |
denotes |
reverse |
| T13383 |
27397-27401 |
IN |
denotes |
from |
| T13384 |
27402-27405 |
DT |
denotes |
the |
| T13385 |
27418-27422 |
NN |
denotes |
side |
| T13386 |
27406-27417 |
JJ |
denotes |
centromeric |
| T13387 |
27423-27424 |
-LRB- |
denotes |
( |
| T13388 |
27432-27452 |
NN |
denotes |
GGGAAAATGGATAGAGGGTG |
| T13389 |
27424-27428 |
NN |
denotes |
C11r |
| T13390 |
27429-27430 |
CD |
denotes |
5 |
| T13391 |
27430-27431 |
SYM |
denotes |
′ |
| T13392 |
27431-27432 |
HYPH |
denotes |
- |
| T13393 |
27452-27453 |
HYPH |
denotes |
- |
| T13394 |
27453-27454 |
CD |
denotes |
3 |
| T13395 |
27454-27455 |
SYM |
denotes |
′ |
| T13396 |
27455-27456 |
-RRB- |
denotes |
) |
| T13397 |
27456-27457 |
. |
denotes |
. |
| T13398 |
27457-27584 |
sentence |
denotes |
The fragment, which is 953 bp in size, was sequenced as described above and compared to the current build of the human genome. |
| T13399 |
27458-27461 |
DT |
denotes |
The |
| T13400 |
27462-27470 |
NN |
denotes |
fragment |
| T13401 |
27501-27510 |
VBN |
denotes |
sequenced |
| T13402 |
27470-27472 |
, |
denotes |
, |
| T13403 |
27472-27477 |
WDT |
denotes |
which |
| T13404 |
27478-27480 |
VBZ |
denotes |
is |
| T13405 |
27481-27484 |
CD |
denotes |
953 |
| T13406 |
27485-27487 |
NN |
denotes |
bp |
| T13407 |
27488-27490 |
IN |
denotes |
in |
| T13408 |
27491-27495 |
NN |
denotes |
size |
| T13409 |
27495-27497 |
, |
denotes |
, |
| T13410 |
27497-27500 |
VBD |
denotes |
was |
| T13411 |
27511-27513 |
IN |
denotes |
as |
| T13412 |
27514-27523 |
VBN |
denotes |
described |
| T13413 |
27524-27529 |
RB |
denotes |
above |
| T13414 |
27530-27533 |
CC |
denotes |
and |
| T13415 |
27534-27542 |
VBN |
denotes |
compared |
| T13416 |
27543-27545 |
IN |
denotes |
to |
| T13417 |
27546-27549 |
DT |
denotes |
the |
| T13418 |
27558-27563 |
NN |
denotes |
build |
| T13419 |
27550-27557 |
JJ |
denotes |
current |
| T13420 |
27564-27566 |
IN |
denotes |
of |
| T13421 |
27567-27570 |
DT |
denotes |
the |
| T13422 |
27577-27583 |
NN |
denotes |
genome |
| T13423 |
27571-27576 |
JJ |
denotes |
human |
| T13424 |
27583-27584 |
. |
denotes |
. |
| T13425 |
27584-27979 |
sentence |
denotes |
A similar series of experiments was performed to identify the deletion breakpoints in families H27 and H33; we were able to amplify a 369-bp PCR product across the breakpoint found in affected members of family H27 using primer pair H27-11F 5′-GACCTCAAGAAGGCATGAATAC-3′ and H27-3R 5′-ATGGTGGCCAGGTACACAAG-3′ (Figure S4), but to date we have been unable to identify the breakpoint in family H33. |
| T13426 |
27585-27586 |
DT |
denotes |
A |
| T13427 |
27595-27601 |
NN |
denotes |
series |
| T13428 |
27587-27594 |
JJ |
denotes |
similar |
| T13429 |
27621-27630 |
VBN |
denotes |
performed |
| T13430 |
27602-27604 |
IN |
denotes |
of |
| T13431 |
27605-27616 |
NNS |
denotes |
experiments |
| T13432 |
27617-27620 |
VBD |
denotes |
was |
| T13433 |
27696-27700 |
VBD |
denotes |
were |
| T13434 |
27631-27633 |
TO |
denotes |
to |
| T13435 |
27634-27642 |
VB |
denotes |
identify |
| T13436 |
27643-27646 |
DT |
denotes |
the |
| T13437 |
27656-27667 |
NNS |
denotes |
breakpoints |
| T13438 |
27647-27655 |
NN |
denotes |
deletion |
| T13439 |
27668-27670 |
IN |
denotes |
in |
| T13440 |
27671-27679 |
NNS |
denotes |
families |
| T13441 |
27680-27683 |
NN |
denotes |
H27 |
| T13442 |
27684-27687 |
CC |
denotes |
and |
| T13443 |
27688-27691 |
NN |
denotes |
H33 |
| T13444 |
27691-27692 |
: |
denotes |
; |
| T13445 |
27693-27695 |
PRP |
denotes |
we |
| T13446 |
27701-27705 |
JJ |
denotes |
able |
| T13447 |
27706-27708 |
TO |
denotes |
to |
| T13448 |
27709-27716 |
VB |
denotes |
amplify |
| T13449 |
27717-27718 |
DT |
denotes |
a |
| T13450 |
27730-27737 |
NN |
denotes |
product |
| T13451 |
27719-27722 |
CD |
denotes |
369 |
| T13452 |
27723-27725 |
NN |
denotes |
bp |
| T13453 |
27722-27723 |
HYPH |
denotes |
- |
| T13454 |
27726-27729 |
NN |
denotes |
PCR |
| T13455 |
27738-27744 |
IN |
denotes |
across |
| T13456 |
27745-27748 |
DT |
denotes |
the |
| T13457 |
27749-27759 |
NN |
denotes |
breakpoint |
| T13458 |
27760-27765 |
VBN |
denotes |
found |
| T13459 |
27766-27768 |
IN |
denotes |
in |
| T13460 |
27769-27777 |
VBN |
denotes |
affected |
| T13461 |
27778-27785 |
NNS |
denotes |
members |
| T13462 |
27786-27788 |
IN |
denotes |
of |
| T13463 |
27789-27795 |
NN |
denotes |
family |
| T13464 |
27796-27799 |
NN |
denotes |
H27 |
| T13465 |
27800-27805 |
VBG |
denotes |
using |
| T13466 |
27806-27812 |
NN |
denotes |
primer |
| T13467 |
27813-27817 |
NN |
denotes |
pair |
| T13468 |
27818-27821 |
NN |
denotes |
H27 |
| T13469 |
27822-27825 |
NN |
denotes |
11F |
| T13470 |
27821-27822 |
HYPH |
denotes |
- |
| T13471 |
27829-27851 |
NN |
denotes |
GACCTCAAGAAGGCATGAATAC |
| T13472 |
27826-27827 |
CD |
denotes |
5 |
| T13473 |
27827-27828 |
SYM |
denotes |
′ |
| T13474 |
27828-27829 |
HYPH |
denotes |
- |
| T13475 |
27851-27852 |
HYPH |
denotes |
- |
| T13476 |
27852-27853 |
CD |
denotes |
3 |
| T13477 |
27853-27854 |
SYM |
denotes |
′ |
| T13478 |
27855-27858 |
CC |
denotes |
and |
| T13479 |
27859-27862 |
NN |
denotes |
H27 |
| T13480 |
27863-27865 |
NN |
denotes |
3R |
| T13481 |
27862-27863 |
HYPH |
denotes |
- |
| T13482 |
27869-27889 |
NN |
denotes |
ATGGTGGCCAGGTACACAAG |
| T13483 |
27866-27867 |
CD |
denotes |
5 |
| T13484 |
27867-27868 |
SYM |
denotes |
′ |
| T13485 |
27868-27869 |
HYPH |
denotes |
- |
| T13486 |
27889-27890 |
HYPH |
denotes |
- |
| T13487 |
27890-27891 |
CD |
denotes |
3 |
| T13488 |
27891-27892 |
SYM |
denotes |
′ |
| T13489 |
27893-27894 |
-LRB- |
denotes |
( |
| T13490 |
27901-27903 |
NN |
denotes |
S4 |
| T13491 |
27894-27900 |
NN |
denotes |
Figure |
| T13492 |
27903-27904 |
-RRB- |
denotes |
) |
| T13493 |
27904-27906 |
, |
denotes |
, |
| T13494 |
27906-27909 |
CC |
denotes |
but |
| T13495 |
27910-27912 |
IN |
denotes |
to |
| T13496 |
27926-27930 |
VBN |
denotes |
been |
| T13497 |
27913-27917 |
NN |
denotes |
date |
| T13498 |
27918-27920 |
PRP |
denotes |
we |
| T13499 |
27921-27925 |
VBP |
denotes |
have |
| T13500 |
27931-27937 |
JJ |
denotes |
unable |
| T13501 |
27938-27940 |
TO |
denotes |
to |
| T13502 |
27941-27949 |
VB |
denotes |
identify |
| T13503 |
27950-27953 |
DT |
denotes |
the |
| T13504 |
27954-27964 |
NN |
denotes |
breakpoint |
| T13505 |
27965-27967 |
IN |
denotes |
in |
| T13506 |
27968-27974 |
NN |
denotes |
family |
| T13507 |
27975-27978 |
NN |
denotes |
H33 |
| T13508 |
27978-27979 |
. |
denotes |
. |
| T13807 |
27981-27988 |
NNP |
denotes |
Western |
| T13808 |
27989-27993 |
NN |
denotes |
blot |
| T13809 |
27994-28002 |
NN |
denotes |
analysis |
| T13810 |
28003-28005 |
IN |
denotes |
in |
| T13811 |
28006-28011 |
NN |
denotes |
SCA15 |
| T13812 |
28012-28020 |
NNS |
denotes |
patients |
| T13813 |
28020-28021 |
. |
denotes |
. |
| T13814 |
28021-28251 |
sentence |
denotes |
EBV immortalized lymphoblasts from three affected family members who carry the deletion and one family member without the mutation were used as a readily accessible source of protein; all samples came from members of family AUS1. |
| T13815 |
28022-28025 |
NN |
denotes |
EBV |
| T13816 |
28039-28051 |
NNS |
denotes |
lymphoblasts |
| T13817 |
28026-28038 |
VBN |
denotes |
immortalized |
| T13818 |
28158-28162 |
VBN |
denotes |
used |
| T13819 |
28052-28056 |
IN |
denotes |
from |
| T13820 |
28057-28062 |
CD |
denotes |
three |
| T13821 |
28079-28086 |
NNS |
denotes |
members |
| T13822 |
28063-28071 |
VBN |
denotes |
affected |
| T13823 |
28072-28078 |
NN |
denotes |
family |
| T13824 |
28087-28090 |
WP |
denotes |
who |
| T13825 |
28091-28096 |
VBP |
denotes |
carry |
| T13826 |
28097-28100 |
DT |
denotes |
the |
| T13827 |
28101-28109 |
NN |
denotes |
deletion |
| T13828 |
28110-28113 |
CC |
denotes |
and |
| T13829 |
28114-28117 |
CD |
denotes |
one |
| T13830 |
28125-28131 |
NN |
denotes |
member |
| T13831 |
28118-28124 |
NN |
denotes |
family |
| T13832 |
28132-28139 |
IN |
denotes |
without |
| T13833 |
28140-28143 |
DT |
denotes |
the |
| T13834 |
28144-28152 |
NN |
denotes |
mutation |
| T13835 |
28153-28157 |
VBD |
denotes |
were |
| T13836 |
28218-28222 |
VBD |
denotes |
came |
| T13837 |
28163-28165 |
IN |
denotes |
as |
| T13838 |
28166-28167 |
DT |
denotes |
a |
| T13839 |
28187-28193 |
NN |
denotes |
source |
| T13840 |
28168-28175 |
RB |
denotes |
readily |
| T13841 |
28176-28186 |
JJ |
denotes |
accessible |
| T13842 |
28194-28196 |
IN |
denotes |
of |
| T13843 |
28197-28204 |
NN |
denotes |
protein |
| T13844 |
28204-28205 |
: |
denotes |
; |
| T13845 |
28206-28209 |
DT |
denotes |
all |
| T13846 |
28210-28217 |
NNS |
denotes |
samples |
| T13847 |
28223-28227 |
IN |
denotes |
from |
| T13848 |
28228-28235 |
NNS |
denotes |
members |
| T13849 |
28236-28238 |
IN |
denotes |
of |
| T13850 |
28239-28245 |
NN |
denotes |
family |
| T13851 |
28246-28250 |
NN |
denotes |
AUS1 |
| T13852 |
28250-28251 |
. |
denotes |
. |
| T13853 |
28251-28417 |
sentence |
denotes |
Protein extraction was performed using lysis buffer containing 1× TBS, 1% Triton X-100, and a cocktail of protease inhibitors (Roche) with overnight lysis at −80 °C. |
| T13854 |
28252-28259 |
NN |
denotes |
Protein |
| T13855 |
28260-28270 |
NN |
denotes |
extraction |
| T13856 |
28275-28284 |
VBN |
denotes |
performed |
| T13857 |
28271-28274 |
VBD |
denotes |
was |
| T13858 |
28285-28290 |
VBG |
denotes |
using |
| T13859 |
28291-28296 |
NN |
denotes |
lysis |
| T13860 |
28297-28303 |
NN |
denotes |
buffer |
| T13861 |
28304-28314 |
VBG |
denotes |
containing |
| T13862 |
28315-28316 |
CD |
denotes |
1 |
| T13863 |
28318-28321 |
NN |
denotes |
TBS |
| T13864 |
28316-28317 |
SYM |
denotes |
× |
| T13865 |
28321-28323 |
, |
denotes |
, |
| T13866 |
28323-28324 |
CD |
denotes |
1 |
| T13867 |
28324-28325 |
NN |
denotes |
% |
| T13868 |
28333-28334 |
NN |
denotes |
X |
| T13869 |
28326-28332 |
NN |
denotes |
Triton |
| T13870 |
28334-28335 |
HYPH |
denotes |
- |
| T13871 |
28335-28338 |
CD |
denotes |
100 |
| T13872 |
28338-28340 |
, |
denotes |
, |
| T13873 |
28340-28343 |
CC |
denotes |
and |
| T13874 |
28344-28345 |
DT |
denotes |
a |
| T13875 |
28346-28354 |
NN |
denotes |
cocktail |
| T13876 |
28355-28357 |
IN |
denotes |
of |
| T13877 |
28358-28366 |
NN |
denotes |
protease |
| T13878 |
28367-28377 |
NNS |
denotes |
inhibitors |
| T13879 |
28378-28379 |
-LRB- |
denotes |
( |
| T13880 |
28379-28384 |
NNP |
denotes |
Roche |
| T13881 |
28384-28385 |
-RRB- |
denotes |
) |
| T13882 |
28386-28390 |
IN |
denotes |
with |
| T13883 |
28391-28400 |
JJ |
denotes |
overnight |
| T13884 |
28401-28406 |
NN |
denotes |
lysis |
| T13885 |
28407-28409 |
IN |
denotes |
at |
| T13886 |
28410-28411 |
SYM |
denotes |
− |
| T13887 |
28411-28413 |
CD |
denotes |
80 |
| T13888 |
28414-28416 |
NN |
denotes |
°C |
| T13889 |
28416-28417 |
. |
denotes |
. |
| T13890 |
28417-28594 |
sentence |
denotes |
Homogenates were diluted appropriately, mixed with 4× reducing sample buffer, and loaded onto 4%–12% precast gradient gels (NuPAGE, Invitrogen) for SDS-PAGE and immunoblotting. |
| T13891 |
28418-28429 |
NNS |
denotes |
Homogenates |
| T13892 |
28435-28442 |
VBN |
denotes |
diluted |
| T13893 |
28430-28434 |
VBD |
denotes |
were |
| T13894 |
28443-28456 |
RB |
denotes |
appropriately |
| T13895 |
28456-28458 |
, |
denotes |
, |
| T13896 |
28458-28463 |
VBN |
denotes |
mixed |
| T13897 |
28464-28468 |
IN |
denotes |
with |
| T13898 |
28469-28470 |
CD |
denotes |
4 |
| T13899 |
28488-28494 |
NN |
denotes |
buffer |
| T13900 |
28470-28471 |
SYM |
denotes |
× |
| T13901 |
28472-28480 |
VBG |
denotes |
reducing |
| T13902 |
28481-28487 |
NN |
denotes |
sample |
| T13903 |
28494-28496 |
, |
denotes |
, |
| T13904 |
28496-28499 |
CC |
denotes |
and |
| T13905 |
28500-28506 |
VBN |
denotes |
loaded |
| T13906 |
28507-28511 |
IN |
denotes |
onto |
| T13907 |
28512-28513 |
CD |
denotes |
4 |
| T13908 |
28513-28514 |
NN |
denotes |
% |
| T13909 |
28536-28540 |
NNS |
denotes |
gels |
| T13910 |
28514-28515 |
SYM |
denotes |
– |
| T13911 |
28517-28518 |
NN |
denotes |
% |
| T13912 |
28515-28517 |
CD |
denotes |
12 |
| T13913 |
28519-28526 |
JJ |
denotes |
precast |
| T13914 |
28527-28535 |
NN |
denotes |
gradient |
| T13915 |
28541-28542 |
-LRB- |
denotes |
( |
| T13916 |
28542-28548 |
NN |
denotes |
NuPAGE |
| T13917 |
28548-28550 |
, |
denotes |
, |
| T13918 |
28550-28560 |
NNP |
denotes |
Invitrogen |
| T13919 |
28560-28561 |
-RRB- |
denotes |
) |
| T13920 |
28562-28565 |
IN |
denotes |
for |
| T13921 |
28566-28569 |
NN |
denotes |
SDS |
| T13922 |
28570-28574 |
NN |
denotes |
PAGE |
| T13923 |
28569-28570 |
HYPH |
denotes |
- |
| T13924 |
28575-28578 |
CC |
denotes |
and |
| T13925 |
28579-28593 |
NN |
denotes |
immunoblotting |
| T13926 |
28593-28594 |
. |
denotes |
. |
| T13927 |
28594-28690 |
sentence |
denotes |
The antibodies to ITPR1 (1:1,000) and ACTB (1:5,000) were used as recommended by manufacturers. |
| T13928 |
28595-28598 |
DT |
denotes |
The |
| T13929 |
28599-28609 |
NNS |
denotes |
antibodies |
| T13930 |
28653-28657 |
VBN |
denotes |
used |
| T13931 |
28610-28612 |
IN |
denotes |
to |
| T13932 |
28613-28618 |
NN |
denotes |
ITPR1 |
| T13933 |
28619-28620 |
-LRB- |
denotes |
( |
| T13934 |
28620-28621 |
CD |
denotes |
1 |
| T13935 |
28621-28622 |
SYM |
denotes |
: |
| T13936 |
28622-28627 |
CD |
denotes |
1,000 |
| T13937 |
28627-28628 |
-RRB- |
denotes |
) |
| T13938 |
28629-28632 |
CC |
denotes |
and |
| T13939 |
28633-28637 |
NN |
denotes |
ACTB |
| T13940 |
28638-28639 |
-LRB- |
denotes |
( |
| T13941 |
28639-28640 |
CD |
denotes |
1 |
| T13942 |
28640-28641 |
SYM |
denotes |
: |
| T13943 |
28641-28646 |
CD |
denotes |
5,000 |
| T13944 |
28646-28647 |
-RRB- |
denotes |
) |
| T13945 |
28648-28652 |
VBD |
denotes |
were |
| T13946 |
28658-28660 |
IN |
denotes |
as |
| T13947 |
28661-28672 |
VBN |
denotes |
recommended |
| T13948 |
28673-28675 |
IN |
denotes |
by |
| T13949 |
28676-28689 |
NNS |
denotes |
manufacturers |
| T13950 |
28689-28690 |
. |
denotes |
. |
| T14399 |
6069-6089 |
NN |
denotes |
Immunohistochemistry |
| T14400 |
6090-6093 |
CC |
denotes |
and |
| T14401 |
6094-6101 |
NNP |
denotes |
Western |
| T14402 |
6102-6106 |
NN |
denotes |
Blot |
| T14403 |
6107-6115 |
NN |
denotes |
Analysis |
| T14404 |
6116-6118 |
IN |
denotes |
of |
| T14405 |
6119-6124 |
NN |
denotes |
ITPR1 |
| T14406 |
6133-6139 |
NNS |
denotes |
Levels |
| T14407 |
6125-6132 |
NN |
denotes |
Protein |
| T14408 |
6140-6142 |
IN |
denotes |
in |
| T14409 |
6143-6148 |
NN |
denotes |
Mouse |
| T14410 |
6149-6159 |
NN |
denotes |
Cerebellum |
| T14411 |
6159-6358 |
sentence |
denotes |
(A–F) Immunohistochemistry of cerebellum from a wild-type mouse (A and D), a mouse heterozygous for the Itpr1 18-bp deletion (B and E), and a mouse homozygous for the 18-bp Itpr1 deletion (C and F). |
| T14412 |
6160-6161 |
-LRB- |
denotes |
( |
| T14413 |
6161-6162 |
LS |
denotes |
A |
| T14414 |
6166-6186 |
NN |
denotes |
Immunohistochemistry |
| T14415 |
6162-6163 |
SYM |
denotes |
– |
| T14416 |
6163-6164 |
LS |
denotes |
F |
| T14417 |
6164-6165 |
-RRB- |
denotes |
) |
| T14418 |
6187-6189 |
IN |
denotes |
of |
| T14419 |
6190-6200 |
NN |
denotes |
cerebellum |
| T14420 |
6201-6205 |
IN |
denotes |
from |
| T14421 |
6206-6207 |
DT |
denotes |
a |
| T14422 |
6218-6223 |
NN |
denotes |
mouse |
| T14423 |
6208-6212 |
JJ |
denotes |
wild |
| T14424 |
6213-6217 |
NN |
denotes |
type |
| T14425 |
6212-6213 |
HYPH |
denotes |
- |
| T14426 |
6224-6225 |
-LRB- |
denotes |
( |
| T14427 |
6225-6226 |
NN |
denotes |
A |
| T14428 |
6227-6230 |
CC |
denotes |
and |
| T14429 |
6231-6232 |
NN |
denotes |
D |
| T14430 |
6232-6233 |
-RRB- |
denotes |
) |
| T14431 |
6233-6235 |
, |
denotes |
, |
| T14432 |
6235-6236 |
DT |
denotes |
a |
| T14433 |
6237-6242 |
NN |
denotes |
mouse |
| T14434 |
6243-6255 |
JJ |
denotes |
heterozygous |
| T14435 |
6256-6259 |
IN |
denotes |
for |
| T14436 |
6260-6263 |
DT |
denotes |
the |
| T14437 |
6276-6284 |
NN |
denotes |
deletion |
| T14438 |
6264-6269 |
NN |
denotes |
Itpr1 |
| T14439 |
6270-6272 |
CD |
denotes |
18 |
| T14440 |
6273-6275 |
NN |
denotes |
bp |
| T14441 |
6272-6273 |
HYPH |
denotes |
- |
| T14442 |
6285-6286 |
-LRB- |
denotes |
( |
| T14443 |
6286-6287 |
NN |
denotes |
B |
| T14444 |
6288-6291 |
CC |
denotes |
and |
| T14445 |
6292-6293 |
NN |
denotes |
E |
| T14446 |
6293-6294 |
-RRB- |
denotes |
) |
| T14447 |
6294-6296 |
, |
denotes |
, |
| T14448 |
6296-6299 |
CC |
denotes |
and |
| T14449 |
6300-6301 |
DT |
denotes |
a |
| T14450 |
6302-6307 |
NN |
denotes |
mouse |
| T14451 |
6308-6318 |
JJ |
denotes |
homozygous |
| T14452 |
6319-6322 |
IN |
denotes |
for |
| T14453 |
6323-6326 |
DT |
denotes |
the |
| T14454 |
6339-6347 |
NN |
denotes |
deletion |
| T14455 |
6327-6329 |
CD |
denotes |
18 |
| T14456 |
6330-6332 |
NN |
denotes |
bp |
| T14457 |
6329-6330 |
HYPH |
denotes |
- |
| T14458 |
6333-6338 |
NN |
denotes |
Itpr1 |
| T14459 |
6348-6349 |
-LRB- |
denotes |
( |
| T14460 |
6349-6350 |
NN |
denotes |
C |
| T14461 |
6351-6354 |
CC |
denotes |
and |
| T14462 |
6355-6356 |
NN |
denotes |
F |
| T14463 |
6356-6357 |
-RRB- |
denotes |
) |
| T14464 |
6357-6358 |
. |
denotes |
. |
| T14465 |
6358-6555 |
sentence |
denotes |
(A–C) Immunohistochemistry using polyclonal Itpr1 anti-rabbit antibody (1:2,000; Alexa Fluor 555); (D–F) immunohistochemistry using monoclonal Calb1 anti-mouse antibody (1:6,000; Alexa Fluor 488). |
| T14466 |
6359-6360 |
-LRB- |
denotes |
( |
| T14467 |
6360-6361 |
LS |
denotes |
A |
| T14468 |
6365-6385 |
NN |
denotes |
Immunohistochemistry |
| T14469 |
6361-6362 |
SYM |
denotes |
– |
| T14470 |
6362-6363 |
LS |
denotes |
C |
| T14471 |
6363-6364 |
-RRB- |
denotes |
) |
| T14472 |
6386-6391 |
VBG |
denotes |
using |
| T14473 |
6392-6402 |
JJ |
denotes |
polyclonal |
| T14474 |
6421-6429 |
NN |
denotes |
antibody |
| T14475 |
6403-6408 |
NN |
denotes |
Itpr1 |
| T14476 |
6409-6420 |
JJ |
denotes |
anti-rabbit |
| T14477 |
6430-6431 |
-LRB- |
denotes |
( |
| T14478 |
6446-6451 |
NNP |
denotes |
Fluor |
| T14479 |
6431-6432 |
CD |
denotes |
1 |
| T14480 |
6432-6433 |
SYM |
denotes |
: |
| T14481 |
6433-6438 |
CD |
denotes |
2,000 |
| T14482 |
6438-6439 |
: |
denotes |
; |
| T14483 |
6440-6445 |
NNP |
denotes |
Alexa |
| T14484 |
6452-6455 |
CD |
denotes |
555 |
| T14485 |
6455-6456 |
-RRB- |
denotes |
) |
| T14486 |
6456-6457 |
: |
denotes |
; |
| T14487 |
6458-6459 |
-LRB- |
denotes |
( |
| T14488 |
6459-6460 |
LS |
denotes |
D |
| T14489 |
6464-6484 |
NN |
denotes |
immunohistochemistry |
| T14490 |
6460-6461 |
SYM |
denotes |
– |
| T14491 |
6461-6462 |
LS |
denotes |
F |
| T14492 |
6462-6463 |
-RRB- |
denotes |
) |
| T14493 |
6485-6490 |
VBG |
denotes |
using |
| T14494 |
6491-6501 |
JJ |
denotes |
monoclonal |
| T14495 |
6519-6527 |
NN |
denotes |
antibody |
| T14496 |
6502-6507 |
NN |
denotes |
Calb1 |
| T14497 |
6508-6518 |
JJ |
denotes |
anti-mouse |
| T14498 |
6528-6529 |
-LRB- |
denotes |
( |
| T14499 |
6544-6549 |
NNP |
denotes |
Fluor |
| T14500 |
6529-6530 |
CD |
denotes |
1 |
| T14501 |
6530-6531 |
SYM |
denotes |
: |
| T14502 |
6531-6536 |
CD |
denotes |
6,000 |
| T14503 |
6536-6537 |
: |
denotes |
; |
| T14504 |
6538-6543 |
NNP |
denotes |
Alexa |
| T14505 |
6550-6553 |
CD |
denotes |
488 |
| T14506 |
6553-6554 |
-RRB- |
denotes |
) |
| T14507 |
6554-6555 |
. |
denotes |
. |
| T14508 |
6555-6581 |
sentence |
denotes |
Scale bars denote 100 μm. |
| T14509 |
6556-6561 |
NN |
denotes |
Scale |
| T14510 |
6562-6566 |
NNS |
denotes |
bars |
| T14511 |
6567-6573 |
VBP |
denotes |
denote |
| T14512 |
6574-6577 |
CD |
denotes |
100 |
| T14513 |
6578-6580 |
NN |
denotes |
μm |
| T14514 |
6580-6581 |
. |
denotes |
. |
| T14515 |
6581-6655 |
sentence |
denotes |
As previously described, Iptr1 is highly expressed in the Purkinje cells. |
| T14516 |
6582-6584 |
IN |
denotes |
As |
| T14517 |
6596-6605 |
VBN |
denotes |
described |
| T14518 |
6585-6595 |
RB |
denotes |
previously |
| T14519 |
6623-6632 |
VBN |
denotes |
expressed |
| T14520 |
6605-6607 |
, |
denotes |
, |
| T14521 |
6607-6612 |
NN |
denotes |
Iptr1 |
| T14522 |
6613-6615 |
VBZ |
denotes |
is |
| T14523 |
6616-6622 |
RB |
denotes |
highly |
| T14524 |
6633-6635 |
IN |
denotes |
in |
| T14525 |
6636-6639 |
DT |
denotes |
the |
| T14526 |
6649-6654 |
NNS |
denotes |
cells |
| T14527 |
6640-6648 |
NNP |
denotes |
Purkinje |
| T14528 |
6654-6655 |
. |
denotes |
. |
| T14529 |
6655-6768 |
sentence |
denotes |
Notably, there appears to be decreased immunoreactivity to Itpr1 in the heterozygous and homozygous mutant mice. |
| T14530 |
6656-6663 |
RB |
denotes |
Notably |
| T14531 |
6671-6678 |
VBZ |
denotes |
appears |
| T14532 |
6663-6665 |
, |
denotes |
, |
| T14533 |
6665-6670 |
EX |
denotes |
there |
| T14534 |
6679-6681 |
TO |
denotes |
to |
| T14535 |
6682-6684 |
VB |
denotes |
be |
| T14536 |
6685-6694 |
VBN |
denotes |
decreased |
| T14537 |
6695-6711 |
NN |
denotes |
immunoreactivity |
| T14538 |
6712-6714 |
IN |
denotes |
to |
| T14539 |
6715-6720 |
NN |
denotes |
Itpr1 |
| T14540 |
6721-6723 |
IN |
denotes |
in |
| T14541 |
6724-6727 |
DT |
denotes |
the |
| T14542 |
6763-6767 |
NNS |
denotes |
mice |
| T14543 |
6728-6740 |
JJ |
denotes |
heterozygous |
| T14544 |
6741-6744 |
CC |
denotes |
and |
| T14545 |
6745-6755 |
JJ |
denotes |
homozygous |
| T14546 |
6756-6762 |
NN |
denotes |
mutant |
| T14547 |
6767-6768 |
. |
denotes |
. |
| T14548 |
6768-7019 |
sentence |
denotes |
(G) Western blot performed to examine Itpr1 levels in whole brain from wild-type, Itpr1wt/Δ18, and Itpr1Δ18/Δ18 mice; this clearly shows a reduction of Itpr1 in brain tissue from Itpr1wt/Δ18 mice and a greater reduction of Itpr1 in Itpr1Δ18/Δ18 mice. |
| T14549 |
6769-6770 |
-LRB- |
denotes |
( |
| T14550 |
6770-6771 |
LS |
denotes |
G |
| T14551 |
6900-6905 |
VBZ |
denotes |
shows |
| T14552 |
6771-6772 |
-RRB- |
denotes |
) |
| T14553 |
6773-6780 |
NNP |
denotes |
Western |
| T14554 |
6781-6785 |
NN |
denotes |
blot |
| T14555 |
6786-6795 |
VBN |
denotes |
performed |
| T14556 |
6796-6798 |
TO |
denotes |
to |
| T14557 |
6799-6806 |
VB |
denotes |
examine |
| T14558 |
6807-6812 |
NN |
denotes |
Itpr1 |
| T14559 |
6813-6819 |
NNS |
denotes |
levels |
| T14560 |
6820-6822 |
IN |
denotes |
in |
| T14561 |
6823-6828 |
JJ |
denotes |
whole |
| T14562 |
6829-6834 |
NN |
denotes |
brain |
| T14563 |
6835-6839 |
IN |
denotes |
from |
| T14564 |
6840-6844 |
JJ |
denotes |
wild |
| T14565 |
6845-6849 |
NN |
denotes |
type |
| T14566 |
6844-6845 |
HYPH |
denotes |
- |
| T14567 |
6881-6885 |
NNS |
denotes |
mice |
| T14568 |
6849-6851 |
, |
denotes |
, |
| T14569 |
6851-6858 |
NN |
denotes |
Itpr1wt |
| T14570 |
6859-6862 |
NN |
denotes |
Δ18 |
| T14571 |
6858-6859 |
HYPH |
denotes |
/ |
| T14572 |
6862-6864 |
, |
denotes |
, |
| T14573 |
6864-6867 |
CC |
denotes |
and |
| T14574 |
6868-6876 |
NN |
denotes |
Itpr1Δ18 |
| T14575 |
6877-6880 |
NN |
denotes |
Δ18 |
| T14576 |
6876-6877 |
HYPH |
denotes |
/ |
| T14577 |
6885-6886 |
: |
denotes |
; |
| T14578 |
6887-6891 |
DT |
denotes |
this |
| T14579 |
6892-6899 |
RB |
denotes |
clearly |
| T14580 |
6906-6907 |
DT |
denotes |
a |
| T14581 |
6908-6917 |
NN |
denotes |
reduction |
| T14582 |
6918-6920 |
IN |
denotes |
of |
| T14583 |
6921-6926 |
NN |
denotes |
Itpr1 |
| T14584 |
6927-6929 |
IN |
denotes |
in |
| T14585 |
6930-6935 |
NN |
denotes |
brain |
| T14586 |
6936-6942 |
NN |
denotes |
tissue |
| T14587 |
6943-6947 |
IN |
denotes |
from |
| T14588 |
6948-6955 |
NN |
denotes |
Itpr1wt |
| T14589 |
6956-6959 |
NN |
denotes |
Δ18 |
| T14590 |
6955-6956 |
HYPH |
denotes |
/ |
| T14591 |
6960-6964 |
NNS |
denotes |
mice |
| T14592 |
6965-6968 |
CC |
denotes |
and |
| T14593 |
6969-6970 |
DT |
denotes |
a |
| T14594 |
6979-6988 |
NN |
denotes |
reduction |
| T14595 |
6971-6978 |
JJR |
denotes |
greater |
| T14596 |
6989-6991 |
IN |
denotes |
of |
| T14597 |
6992-6997 |
NN |
denotes |
Itpr1 |
| T14598 |
6998-7000 |
IN |
denotes |
in |
| T14599 |
7001-7009 |
NN |
denotes |
Itpr1Δ18 |
| T14600 |
7010-7013 |
NN |
denotes |
Δ18 |
| T14601 |
7009-7010 |
HYPH |
denotes |
/ |
| T14602 |
7014-7018 |
NNS |
denotes |
mice |
| T14603 |
7018-7019 |
. |
denotes |
. |
| T15069 |
9652-9659 |
NNS |
denotes |
Metrics |
| T15070 |
9660-9667 |
VBN |
denotes |
Derived |
| T15071 |
9668-9672 |
IN |
denotes |
from |
| T15072 |
9673-9681 |
NN |
denotes |
Analysis |
| T15073 |
9682-9684 |
IN |
denotes |
of |
| T15074 |
9685-9688 |
NN |
denotes |
DNA |
| T15075 |
9689-9693 |
IN |
denotes |
from |
| T15076 |
9694-9702 |
VBN |
denotes |
Affected |
| T15077 |
9710-9716 |
NN |
denotes |
Member |
| T15078 |
9703-9709 |
NN |
denotes |
Family |
| T15079 |
9717-9718 |
CD |
denotes |
7 |
| T15080 |
9719-9724 |
VBG |
denotes |
Using |
| T15081 |
9725-9733 |
NNP |
denotes |
Illumina |
| T15082 |
9743-9754 |
NNP |
denotes |
HumanHap550 |
| T15083 |
9734-9742 |
NNP |
denotes |
Infinium |
| T15084 |
9766-9771 |
NNS |
denotes |
Chips |
| T15085 |
9755-9765 |
NN |
denotes |
Genotyping |
| T15086 |
9771-9903 |
sentence |
denotes |
The upper and lower plots are log R ratio and B allele frequency, respectively, at an ~800-kb segment on the p arm of Chromosome 3. |
| T15087 |
9772-9775 |
DT |
denotes |
The |
| T15088 |
9792-9797 |
NNS |
denotes |
plots |
| T15089 |
9776-9781 |
JJ |
denotes |
upper |
| T15090 |
9782-9785 |
CC |
denotes |
and |
| T15091 |
9786-9791 |
JJ |
denotes |
lower |
| T15092 |
9798-9801 |
VBP |
denotes |
are |
| T15093 |
9802-9805 |
NN |
denotes |
log |
| T15094 |
9806-9807 |
NN |
denotes |
R |
| T15095 |
9808-9813 |
NN |
denotes |
ratio |
| T15096 |
9814-9817 |
CC |
denotes |
and |
| T15097 |
9818-9819 |
NN |
denotes |
B |
| T15098 |
9820-9826 |
NN |
denotes |
allele |
| T15099 |
9827-9836 |
NN |
denotes |
frequency |
| T15100 |
9836-9838 |
, |
denotes |
, |
| T15101 |
9838-9850 |
RB |
denotes |
respectively |
| T15102 |
9850-9852 |
, |
denotes |
, |
| T15103 |
9852-9854 |
IN |
denotes |
at |
| T15104 |
9855-9857 |
DT |
denotes |
an |
| T15105 |
9866-9873 |
NN |
denotes |
segment |
| T15106 |
9858-9859 |
SYM |
denotes |
~ |
| T15107 |
9859-9862 |
CD |
denotes |
800 |
| T15108 |
9863-9865 |
NN |
denotes |
kb |
| T15109 |
9862-9863 |
HYPH |
denotes |
- |
| T15110 |
9874-9876 |
IN |
denotes |
on |
| T15111 |
9877-9880 |
DT |
denotes |
the |
| T15112 |
9883-9886 |
NN |
denotes |
arm |
| T15113 |
9881-9882 |
NN |
denotes |
p |
| T15114 |
9887-9889 |
IN |
denotes |
of |
| T15115 |
9890-9900 |
NN |
denotes |
Chromosome |
| T15116 |
9901-9902 |
CD |
denotes |
3 |
| T15117 |
9902-9903 |
. |
denotes |
. |
| T15118 |
9903-10067 |
sentence |
denotes |
Log R ratio is the ratio of normalized, observed R to expected R for each SNP (each SNP is a blue dot) and thus serves as a surrogate of copy number at each locus. |
| T15119 |
9904-9907 |
NN |
denotes |
Log |
| T15120 |
9908-9909 |
NN |
denotes |
R |
| T15121 |
9910-9915 |
NN |
denotes |
ratio |
| T15122 |
9916-9918 |
VBZ |
denotes |
is |
| T15123 |
9919-9922 |
DT |
denotes |
the |
| T15124 |
9923-9928 |
NN |
denotes |
ratio |
| T15125 |
9929-9931 |
IN |
denotes |
of |
| T15126 |
9932-9942 |
VBN |
denotes |
normalized |
| T15127 |
9953-9954 |
NN |
denotes |
R |
| T15128 |
9942-9944 |
, |
denotes |
, |
| T15129 |
9944-9952 |
VBN |
denotes |
observed |
| T15130 |
9955-9957 |
IN |
denotes |
to |
| T15131 |
9958-9966 |
VBN |
denotes |
expected |
| T15132 |
9967-9968 |
NN |
denotes |
R |
| T15133 |
9969-9972 |
IN |
denotes |
for |
| T15134 |
9973-9977 |
DT |
denotes |
each |
| T15135 |
9978-9981 |
NN |
denotes |
SNP |
| T15136 |
9982-9983 |
-LRB- |
denotes |
( |
| T15137 |
9992-9994 |
VBZ |
denotes |
is |
| T15138 |
9983-9987 |
DT |
denotes |
each |
| T15139 |
9988-9991 |
NN |
denotes |
SNP |
| T15140 |
9995-9996 |
DT |
denotes |
a |
| T15141 |
10002-10005 |
NN |
denotes |
dot |
| T15142 |
9997-10001 |
JJ |
denotes |
blue |
| T15143 |
10005-10006 |
-RRB- |
denotes |
) |
| T15144 |
10007-10010 |
CC |
denotes |
and |
| T15145 |
10011-10015 |
RB |
denotes |
thus |
| T15146 |
10016-10022 |
VBZ |
denotes |
serves |
| T15147 |
10023-10025 |
IN |
denotes |
as |
| T15148 |
10026-10027 |
DT |
denotes |
a |
| T15149 |
10028-10037 |
NN |
denotes |
surrogate |
| T15150 |
10038-10040 |
IN |
denotes |
of |
| T15151 |
10041-10045 |
NN |
denotes |
copy |
| T15152 |
10046-10052 |
NN |
denotes |
number |
| T15153 |
10053-10055 |
IN |
denotes |
at |
| T15154 |
10056-10060 |
DT |
denotes |
each |
| T15155 |
10061-10066 |
NN |
denotes |
locus |
| T15156 |
10066-10067 |
. |
denotes |
. |
| T15157 |
10067-10205 |
sentence |
denotes |
B allele frequency is a measure of the number of times the A or B alleles are detected at each locus (each SNP is denoted by a blue dot). |
| T15158 |
10068-10069 |
NN |
denotes |
B |
| T15159 |
10070-10076 |
NN |
denotes |
allele |
| T15160 |
10077-10086 |
NN |
denotes |
frequency |
| T15161 |
10087-10089 |
VBZ |
denotes |
is |
| T15162 |
10090-10091 |
DT |
denotes |
a |
| T15163 |
10092-10099 |
NN |
denotes |
measure |
| T15164 |
10100-10102 |
IN |
denotes |
of |
| T15165 |
10103-10106 |
DT |
denotes |
the |
| T15166 |
10107-10113 |
NN |
denotes |
number |
| T15167 |
10114-10116 |
IN |
denotes |
of |
| T15168 |
10117-10122 |
NNS |
denotes |
times |
| T15169 |
10123-10126 |
DT |
denotes |
the |
| T15170 |
10134-10141 |
NNS |
denotes |
alleles |
| T15171 |
10127-10128 |
NN |
denotes |
A |
| T15172 |
10129-10131 |
CC |
denotes |
or |
| T15173 |
10132-10133 |
NN |
denotes |
B |
| T15174 |
10146-10154 |
VBN |
denotes |
detected |
| T15175 |
10142-10145 |
VBP |
denotes |
are |
| T15176 |
10155-10157 |
IN |
denotes |
at |
| T15177 |
10158-10162 |
DT |
denotes |
each |
| T15178 |
10163-10168 |
NN |
denotes |
locus |
| T15179 |
10169-10170 |
-LRB- |
denotes |
( |
| T15180 |
10182-10189 |
VBN |
denotes |
denoted |
| T15181 |
10170-10174 |
DT |
denotes |
each |
| T15182 |
10175-10178 |
NN |
denotes |
SNP |
| T15183 |
10179-10181 |
VBZ |
denotes |
is |
| T15184 |
10190-10192 |
IN |
denotes |
by |
| T15185 |
10193-10194 |
DT |
denotes |
a |
| T15186 |
10200-10203 |
NN |
denotes |
dot |
| T15187 |
10195-10199 |
JJ |
denotes |
blue |
| T15188 |
10203-10204 |
-RRB- |
denotes |
) |
| T15189 |
10204-10205 |
. |
denotes |
. |
| T15190 |
10205-10423 |
sentence |
denotes |
Thus, SNPs with a B allele frequency of one are apparent B/B homozygotes, SNPs with a B allele frequency of 0.5 are apparent A/B heterozygotes, and those with a B allele frequency of zero are apparent A/A homozygotes. |
| T15191 |
10206-10210 |
RB |
denotes |
Thus |
| T15192 |
10318-10321 |
VBP |
denotes |
are |
| T15193 |
10210-10212 |
, |
denotes |
, |
| T15194 |
10212-10216 |
NNS |
denotes |
SNPs |
| T15195 |
10250-10253 |
VBP |
denotes |
are |
| T15196 |
10217-10221 |
IN |
denotes |
with |
| T15197 |
10222-10223 |
DT |
denotes |
a |
| T15198 |
10233-10242 |
NN |
denotes |
frequency |
| T15199 |
10224-10225 |
NN |
denotes |
B |
| T15200 |
10226-10232 |
NN |
denotes |
allele |
| T15201 |
10243-10245 |
IN |
denotes |
of |
| T15202 |
10246-10249 |
CD |
denotes |
one |
| T15203 |
10254-10262 |
JJ |
denotes |
apparent |
| T15204 |
10267-10278 |
NNS |
denotes |
homozygotes |
| T15205 |
10263-10264 |
NN |
denotes |
B |
| T15206 |
10265-10266 |
NN |
denotes |
B |
| T15207 |
10264-10265 |
HYPH |
denotes |
/ |
| T15208 |
10278-10280 |
, |
denotes |
, |
| T15209 |
10280-10284 |
NNS |
denotes |
SNPs |
| T15210 |
10285-10289 |
IN |
denotes |
with |
| T15211 |
10290-10291 |
DT |
denotes |
a |
| T15212 |
10301-10310 |
NN |
denotes |
frequency |
| T15213 |
10292-10293 |
NN |
denotes |
B |
| T15214 |
10294-10300 |
NN |
denotes |
allele |
| T15215 |
10311-10313 |
IN |
denotes |
of |
| T15216 |
10314-10317 |
CD |
denotes |
0.5 |
| T15217 |
10322-10330 |
JJ |
denotes |
apparent |
| T15218 |
10335-10348 |
NNS |
denotes |
heterozygotes |
| T15219 |
10331-10332 |
NN |
denotes |
A |
| T15220 |
10333-10334 |
NN |
denotes |
B |
| T15221 |
10332-10333 |
HYPH |
denotes |
/ |
| T15222 |
10348-10350 |
, |
denotes |
, |
| T15223 |
10350-10353 |
CC |
denotes |
and |
| T15224 |
10354-10359 |
DT |
denotes |
those |
| T15225 |
10394-10397 |
VBP |
denotes |
are |
| T15226 |
10360-10364 |
IN |
denotes |
with |
| T15227 |
10365-10366 |
DT |
denotes |
a |
| T15228 |
10376-10385 |
NN |
denotes |
frequency |
| T15229 |
10367-10368 |
NN |
denotes |
B |
| T15230 |
10369-10375 |
NN |
denotes |
allele |
| T15231 |
10386-10388 |
IN |
denotes |
of |
| T15232 |
10389-10393 |
CD |
denotes |
zero |
| T15233 |
10398-10406 |
JJ |
denotes |
apparent |
| T15234 |
10411-10422 |
NNS |
denotes |
homozygotes |
| T15235 |
10407-10408 |
NN |
denotes |
A |
| T15236 |
10409-10410 |
NN |
denotes |
A |
| T15237 |
10408-10409 |
HYPH |
denotes |
/ |
| T15238 |
10422-10423 |
. |
denotes |
. |
| T15239 |
10423-10559 |
sentence |
denotes |
Clearly, these plots show a contiguous region ~200 kb long with decreased copy number and apparent homozygosity (bounded by a red box). |
| T15240 |
10424-10431 |
RB |
denotes |
Clearly |
| T15241 |
10445-10449 |
VBP |
denotes |
show |
| T15242 |
10431-10433 |
, |
denotes |
, |
| T15243 |
10433-10438 |
DT |
denotes |
these |
| T15244 |
10439-10444 |
NNS |
denotes |
plots |
| T15245 |
10450-10451 |
DT |
denotes |
a |
| T15246 |
10463-10469 |
NN |
denotes |
region |
| T15247 |
10452-10462 |
JJ |
denotes |
contiguous |
| T15248 |
10470-10471 |
SYM |
denotes |
~ |
| T15249 |
10471-10474 |
CD |
denotes |
200 |
| T15250 |
10475-10477 |
NN |
denotes |
kb |
| T15251 |
10478-10482 |
JJ |
denotes |
long |
| T15252 |
10483-10487 |
IN |
denotes |
with |
| T15253 |
10488-10497 |
VBN |
denotes |
decreased |
| T15254 |
10503-10509 |
NN |
denotes |
number |
| T15255 |
10498-10502 |
NN |
denotes |
copy |
| T15256 |
10510-10513 |
CC |
denotes |
and |
| T15257 |
10514-10522 |
JJ |
denotes |
apparent |
| T15258 |
10523-10535 |
NN |
denotes |
homozygosity |
| T15259 |
10536-10537 |
-LRB- |
denotes |
( |
| T15260 |
10537-10544 |
VBN |
denotes |
bounded |
| T15261 |
10545-10547 |
IN |
denotes |
by |
| T15262 |
10548-10549 |
DT |
denotes |
a |
| T15263 |
10554-10557 |
NN |
denotes |
box |
| T15264 |
10550-10553 |
JJ |
denotes |
red |
| T15265 |
10557-10558 |
-RRB- |
denotes |
) |
| T15266 |
10558-10559 |
. |
denotes |
. |
| T15267 |
10559-10655 |
sentence |
denotes |
As we have demonstrated previously, this is indicative of a heterozygous genomic deletion [15]. |
| T15268 |
10560-10562 |
IN |
denotes |
As |
| T15269 |
10571-10583 |
VBN |
denotes |
demonstrated |
| T15270 |
10563-10565 |
PRP |
denotes |
we |
| T15271 |
10566-10570 |
VBP |
denotes |
have |
| T15272 |
10601-10603 |
VBZ |
denotes |
is |
| T15273 |
10584-10594 |
RB |
denotes |
previously |
| T15274 |
10594-10596 |
, |
denotes |
, |
| T15275 |
10596-10600 |
DT |
denotes |
this |
| T15276 |
10604-10614 |
JJ |
denotes |
indicative |
| T15277 |
10615-10617 |
IN |
denotes |
of |
| T15278 |
10618-10619 |
DT |
denotes |
a |
| T15279 |
10641-10649 |
NN |
denotes |
deletion |
| T15280 |
10620-10632 |
JJ |
denotes |
heterozygous |
| T15281 |
10633-10640 |
JJ |
denotes |
genomic |
| T15282 |
10650-10651 |
-LRB- |
denotes |
[ |
| T15283 |
10651-10653 |
CD |
denotes |
15 |
| T15284 |
10653-10654 |
-RRB- |
denotes |
] |
| T15285 |
10654-10655 |
. |
denotes |
. |
| T15286 |
10655-10755 |
sentence |
denotes |
Below these plots is a schematic of the two known genes affected by this deletion, ITPR1 and SUMF1. |
| T15287 |
10656-10661 |
IN |
denotes |
Below |
| T15288 |
10674-10676 |
VBZ |
denotes |
is |
| T15289 |
10662-10667 |
DT |
denotes |
these |
| T15290 |
10668-10673 |
NNS |
denotes |
plots |
| T15291 |
10677-10678 |
DT |
denotes |
a |
| T15292 |
10679-10688 |
NN |
denotes |
schematic |
| T15293 |
10689-10691 |
IN |
denotes |
of |
| T15294 |
10692-10695 |
DT |
denotes |
the |
| T15295 |
10706-10711 |
NNS |
denotes |
genes |
| T15296 |
10696-10699 |
CD |
denotes |
two |
| T15297 |
10700-10705 |
VBN |
denotes |
known |
| T15298 |
10712-10720 |
VBN |
denotes |
affected |
| T15299 |
10721-10723 |
IN |
denotes |
by |
| T15300 |
10724-10728 |
DT |
denotes |
this |
| T15301 |
10729-10737 |
NN |
denotes |
deletion |
| T15302 |
10737-10739 |
, |
denotes |
, |
| T15303 |
10739-10744 |
NN |
denotes |
ITPR1 |
| T15304 |
10745-10748 |
CC |
denotes |
and |
| T15305 |
10749-10754 |
NN |
denotes |
SUMF1 |
| T15306 |
10754-10755 |
. |
denotes |
. |
| T16338 |
16393-16400 |
IN |
denotes |
against |
| T15781 |
10766-10774 |
NN |
denotes |
Mutation |
| T15782 |
10775-10783 |
NN |
denotes |
Analysis |
| T15783 |
10784-10786 |
IN |
denotes |
in |
| T15784 |
10787-10790 |
DT |
denotes |
the |
| T15785 |
10808-10814 |
NN |
denotes |
Family |
| T15786 |
10791-10801 |
JJ |
denotes |
Australian |
| T15787 |
10802-10807 |
NN |
denotes |
SCA15 |
| T15788 |
10814-10841 |
sentence |
denotes |
(Top) Pedigree of kindred. |
| T15789 |
10815-10816 |
-LRB- |
denotes |
( |
| T15790 |
10816-10819 |
NN |
denotes |
Top |
| T15791 |
10821-10829 |
NN |
denotes |
Pedigree |
| T15792 |
10819-10820 |
-RRB- |
denotes |
) |
| T15793 |
10830-10832 |
IN |
denotes |
of |
| T15794 |
10833-10840 |
NN |
denotes |
kindred |
| T15795 |
10840-10841 |
. |
denotes |
. |
| T15796 |
10841-11010 |
sentence |
denotes |
Filled symbols denote affected individuals; open symbols, unaffected individuals; grey symbol denotes unknown disease status; bulls-eye symbol denotes obligate carrier. |
| T15797 |
10842-10848 |
VBN |
denotes |
Filled |
| T15798 |
10849-10856 |
NNS |
denotes |
symbols |
| T15799 |
10857-10863 |
VBP |
denotes |
denote |
| T15800 |
10985-10992 |
VBZ |
denotes |
denotes |
| T15801 |
10864-10872 |
VBN |
denotes |
affected |
| T15802 |
10873-10884 |
NNS |
denotes |
individuals |
| T15803 |
10884-10885 |
: |
denotes |
; |
| T15804 |
10886-10890 |
JJ |
denotes |
open |
| T15805 |
10891-10898 |
NNS |
denotes |
symbols |
| T15806 |
10911-10922 |
NNS |
denotes |
individuals |
| T15807 |
10898-10900 |
, |
denotes |
, |
| T15808 |
10900-10910 |
JJ |
denotes |
unaffected |
| T15809 |
10922-10923 |
: |
denotes |
; |
| T15810 |
10924-10928 |
JJ |
denotes |
grey |
| T15811 |
10929-10935 |
NN |
denotes |
symbol |
| T15812 |
10936-10943 |
VBZ |
denotes |
denotes |
| T15813 |
10944-10951 |
JJ |
denotes |
unknown |
| T15814 |
10960-10966 |
NN |
denotes |
status |
| T15815 |
10952-10959 |
NN |
denotes |
disease |
| T15816 |
10966-10967 |
: |
denotes |
; |
| T15817 |
10968-10973 |
NN |
denotes |
bulls |
| T15818 |
10974-10977 |
NN |
denotes |
eye |
| T15819 |
10973-10974 |
HYPH |
denotes |
- |
| T15820 |
10978-10984 |
NN |
denotes |
symbol |
| T15821 |
10993-11001 |
JJ |
denotes |
obligate |
| T15822 |
11002-11009 |
NN |
denotes |
carrier |
| T15823 |
11009-11010 |
. |
denotes |
. |
| T15824 |
11010-11084 |
sentence |
denotes |
w/w, wild-type at ITPR1; w/m, heterozygous carrier of the ITPR1 deletion. |
| T15825 |
11011-11012 |
NN |
denotes |
w |
| T15826 |
11013-11014 |
NN |
denotes |
w |
| T15827 |
11012-11013 |
HYPH |
denotes |
/ |
| T15828 |
11014-11016 |
, |
denotes |
, |
| T15829 |
11016-11020 |
JJ |
denotes |
wild |
| T15830 |
11021-11025 |
NN |
denotes |
type |
| T15831 |
11020-11021 |
HYPH |
denotes |
- |
| T15832 |
11026-11028 |
IN |
denotes |
at |
| T15833 |
11029-11034 |
NN |
denotes |
ITPR1 |
| T15834 |
11034-11035 |
: |
denotes |
; |
| T15835 |
11036-11037 |
NN |
denotes |
w |
| T15836 |
11038-11039 |
NN |
denotes |
m |
| T15837 |
11037-11038 |
HYPH |
denotes |
/ |
| T15838 |
11039-11041 |
, |
denotes |
, |
| T15839 |
11041-11053 |
JJ |
denotes |
heterozygous |
| T15840 |
11054-11061 |
NN |
denotes |
carrier |
| T15841 |
11062-11064 |
IN |
denotes |
of |
| T15842 |
11065-11068 |
DT |
denotes |
the |
| T15843 |
11075-11083 |
NN |
denotes |
deletion |
| T15844 |
11069-11074 |
NN |
denotes |
ITPR1 |
| T15845 |
11083-11084 |
. |
denotes |
. |
| T15846 |
11084-11232 |
sentence |
denotes |
(Middle) Schematic of primer pairs used to narrow the unknown regions between known deleted sequence and known diploid sequence at the SCA15 locus. |
| T15847 |
11085-11086 |
-LRB- |
denotes |
( |
| T15848 |
11086-11092 |
NN |
denotes |
Middle |
| T15849 |
11094-11103 |
JJ |
denotes |
Schematic |
| T15850 |
11092-11093 |
-RRB- |
denotes |
) |
| T15851 |
11104-11106 |
IN |
denotes |
of |
| T15852 |
11107-11113 |
NN |
denotes |
primer |
| T15853 |
11114-11119 |
NNS |
denotes |
pairs |
| T15854 |
11120-11124 |
VBN |
denotes |
used |
| T15855 |
11125-11127 |
TO |
denotes |
to |
| T15856 |
11128-11134 |
VB |
denotes |
narrow |
| T15857 |
11135-11138 |
DT |
denotes |
the |
| T15858 |
11147-11154 |
NNS |
denotes |
regions |
| T15859 |
11139-11146 |
JJ |
denotes |
unknown |
| T15860 |
11155-11162 |
IN |
denotes |
between |
| T15861 |
11163-11168 |
VBN |
denotes |
known |
| T15862 |
11177-11185 |
NN |
denotes |
sequence |
| T15863 |
11169-11176 |
VBN |
denotes |
deleted |
| T15864 |
11186-11189 |
CC |
denotes |
and |
| T15865 |
11190-11195 |
VBN |
denotes |
known |
| T15866 |
11204-11212 |
NN |
denotes |
sequence |
| T15867 |
11196-11203 |
JJ |
denotes |
diploid |
| T15868 |
11213-11215 |
IN |
denotes |
at |
| T15869 |
11216-11219 |
DT |
denotes |
the |
| T15870 |
11226-11231 |
NN |
denotes |
locus |
| T15871 |
11220-11225 |
NN |
denotes |
SCA15 |
| T15872 |
11231-11232 |
. |
denotes |
. |
| T15873 |
11232-11457 |
sentence |
denotes |
Nine primer pairs (T1–T9) were used to amplify across the unknown region telomeric to the known deleted region; 19 primer pairs (C1–C19) were used to amplify across the unknown region centromeric to the known deleted region. |
| T15874 |
11233-11237 |
CD |
denotes |
Nine |
| T15875 |
11245-11250 |
NNS |
denotes |
pairs |
| T15876 |
11238-11244 |
NN |
denotes |
primer |
| T15877 |
11264-11268 |
VBN |
denotes |
used |
| T15878 |
11251-11252 |
-LRB- |
denotes |
( |
| T15879 |
11252-11254 |
NN |
denotes |
T1 |
| T15880 |
11254-11255 |
SYM |
denotes |
– |
| T15881 |
11255-11257 |
NN |
denotes |
T9 |
| T15882 |
11257-11258 |
-RRB- |
denotes |
) |
| T15883 |
11259-11263 |
VBD |
denotes |
were |
| T15884 |
11375-11379 |
VBN |
denotes |
used |
| T15885 |
11269-11271 |
TO |
denotes |
to |
| T15886 |
11272-11279 |
VB |
denotes |
amplify |
| T15887 |
11280-11286 |
IN |
denotes |
across |
| T15888 |
11287-11290 |
DT |
denotes |
the |
| T15889 |
11299-11305 |
NN |
denotes |
region |
| T15890 |
11291-11298 |
JJ |
denotes |
unknown |
| T15891 |
11306-11315 |
JJ |
denotes |
telomeric |
| T15892 |
11316-11318 |
IN |
denotes |
to |
| T15893 |
11319-11322 |
DT |
denotes |
the |
| T15894 |
11337-11343 |
NN |
denotes |
region |
| T15895 |
11323-11328 |
VBN |
denotes |
known |
| T15896 |
11329-11336 |
VBN |
denotes |
deleted |
| T15897 |
11343-11344 |
: |
denotes |
; |
| T15898 |
11345-11347 |
CD |
denotes |
19 |
| T15899 |
11355-11360 |
NNS |
denotes |
pairs |
| T15900 |
11348-11354 |
NN |
denotes |
primer |
| T15901 |
11361-11362 |
-LRB- |
denotes |
( |
| T15902 |
11362-11364 |
NN |
denotes |
C1 |
| T15903 |
11364-11365 |
SYM |
denotes |
– |
| T15904 |
11365-11368 |
NN |
denotes |
C19 |
| T15905 |
11368-11369 |
-RRB- |
denotes |
) |
| T15906 |
11370-11374 |
VBD |
denotes |
were |
| T15907 |
11380-11382 |
TO |
denotes |
to |
| T15908 |
11383-11390 |
VB |
denotes |
amplify |
| T15909 |
11391-11397 |
IN |
denotes |
across |
| T15910 |
11398-11401 |
DT |
denotes |
the |
| T15911 |
11410-11416 |
NN |
denotes |
region |
| T15912 |
11402-11409 |
JJ |
denotes |
unknown |
| T15913 |
11417-11428 |
JJ |
denotes |
centromeric |
| T15914 |
11429-11431 |
IN |
denotes |
to |
| T15915 |
11432-11435 |
DT |
denotes |
the |
| T15916 |
11450-11456 |
NN |
denotes |
region |
| T15917 |
11436-11441 |
VBN |
denotes |
known |
| T15918 |
11442-11449 |
VBN |
denotes |
deleted |
| T15919 |
11456-11457 |
. |
denotes |
. |
| T15920 |
11457-11521 |
sentence |
denotes |
All PCRs were carried out in the three affected family members. |
| T15921 |
11458-11461 |
DT |
denotes |
All |
| T15922 |
11462-11466 |
NNS |
denotes |
PCRs |
| T15923 |
11472-11479 |
VBN |
denotes |
carried |
| T15924 |
11467-11471 |
VBD |
denotes |
were |
| T15925 |
11480-11483 |
RP |
denotes |
out |
| T15926 |
11484-11486 |
IN |
denotes |
in |
| T15927 |
11487-11490 |
DT |
denotes |
the |
| T15928 |
11513-11520 |
NNS |
denotes |
members |
| T15929 |
11491-11496 |
CD |
denotes |
three |
| T15930 |
11497-11505 |
VBN |
denotes |
affected |
| T15931 |
11506-11512 |
NN |
denotes |
family |
| T15932 |
11520-11521 |
. |
denotes |
. |
| T15933 |
11521-11764 |
sentence |
denotes |
Analysis of these data narrowed the unknown region, and ultimately we were able to use primer T3f and C11r to amplify across the deletion breakpoint in the three affected family members, producing a fragment of 953 bp in affected individuals. |
| T15934 |
11522-11530 |
NN |
denotes |
Analysis |
| T15935 |
11545-11553 |
VBD |
denotes |
narrowed |
| T15936 |
11531-11533 |
IN |
denotes |
of |
| T15937 |
11534-11539 |
DT |
denotes |
these |
| T15938 |
11540-11544 |
NNS |
denotes |
data |
| T15939 |
11554-11557 |
DT |
denotes |
the |
| T15940 |
11566-11572 |
NN |
denotes |
region |
| T15941 |
11558-11565 |
JJ |
denotes |
unknown |
| T15942 |
11572-11574 |
, |
denotes |
, |
| T15943 |
11574-11577 |
CC |
denotes |
and |
| T15944 |
11578-11588 |
RB |
denotes |
ultimately |
| T15945 |
11592-11596 |
VBD |
denotes |
were |
| T15946 |
11589-11591 |
PRP |
denotes |
we |
| T15947 |
11597-11601 |
JJ |
denotes |
able |
| T15948 |
11602-11604 |
TO |
denotes |
to |
| T15949 |
11605-11608 |
VB |
denotes |
use |
| T15950 |
11609-11615 |
NN |
denotes |
primer |
| T15951 |
11616-11619 |
NN |
denotes |
T3f |
| T15952 |
11620-11623 |
CC |
denotes |
and |
| T15953 |
11624-11628 |
NN |
denotes |
C11r |
| T15954 |
11629-11631 |
TO |
denotes |
to |
| T15955 |
11632-11639 |
VB |
denotes |
amplify |
| T15956 |
11640-11646 |
IN |
denotes |
across |
| T15957 |
11647-11650 |
DT |
denotes |
the |
| T15958 |
11660-11670 |
NN |
denotes |
breakpoint |
| T15959 |
11651-11659 |
NN |
denotes |
deletion |
| T15960 |
11671-11673 |
IN |
denotes |
in |
| T15961 |
11674-11677 |
DT |
denotes |
the |
| T15962 |
11700-11707 |
NNS |
denotes |
members |
| T15963 |
11678-11683 |
CD |
denotes |
three |
| T15964 |
11684-11692 |
VBN |
denotes |
affected |
| T15965 |
11693-11699 |
NN |
denotes |
family |
| T15966 |
11707-11709 |
, |
denotes |
, |
| T15967 |
11709-11718 |
VBG |
denotes |
producing |
| T15968 |
11719-11720 |
DT |
denotes |
a |
| T15969 |
11721-11729 |
NN |
denotes |
fragment |
| T15970 |
11730-11732 |
IN |
denotes |
of |
| T15971 |
11733-11736 |
CD |
denotes |
953 |
| T15972 |
11737-11739 |
NN |
denotes |
bp |
| T15973 |
11740-11742 |
IN |
denotes |
in |
| T15974 |
11743-11751 |
VBN |
denotes |
affected |
| T15975 |
11752-11763 |
NNS |
denotes |
individuals |
| T15976 |
11763-11764 |
. |
denotes |
. |
| T15977 |
11764-12020 |
sentence |
denotes |
(Bottom) Gel showing amplification product using primer pair T3f and C11r from affected pedigree members 6, 7, and 19; in pedigree member 23, with unknown disease affection status; in a neurologically normal control (C); and in a no template control (NC). |
| T15978 |
11765-11766 |
-LRB- |
denotes |
( |
| T15979 |
11766-11772 |
NN |
denotes |
Bottom |
| T15980 |
11774-11777 |
NN |
denotes |
Gel |
| T15981 |
11772-11773 |
-RRB- |
denotes |
) |
| T15982 |
11778-11785 |
VBG |
denotes |
showing |
| T15983 |
11786-11799 |
NN |
denotes |
amplification |
| T15984 |
11800-11807 |
NN |
denotes |
product |
| T15985 |
11808-11813 |
VBG |
denotes |
using |
| T15986 |
11814-11820 |
NN |
denotes |
primer |
| T15987 |
11821-11825 |
NN |
denotes |
pair |
| T15988 |
11826-11829 |
NN |
denotes |
T3f |
| T15989 |
11830-11833 |
CC |
denotes |
and |
| T15990 |
11834-11838 |
NN |
denotes |
C11r |
| T15991 |
11839-11843 |
IN |
denotes |
from |
| T15992 |
11844-11852 |
VBN |
denotes |
affected |
| T15993 |
11870-11871 |
CD |
denotes |
6 |
| T15994 |
11853-11861 |
NN |
denotes |
pedigree |
| T15995 |
11862-11869 |
NNS |
denotes |
members |
| T15996 |
11871-11873 |
, |
denotes |
, |
| T15997 |
11873-11874 |
CD |
denotes |
7 |
| T15998 |
11874-11876 |
, |
denotes |
, |
| T15999 |
11876-11879 |
CC |
denotes |
and |
| T16000 |
11880-11882 |
CD |
denotes |
19 |
| T16001 |
11882-11883 |
: |
denotes |
; |
| T16002 |
11884-11886 |
IN |
denotes |
in |
| T16003 |
11887-11895 |
NN |
denotes |
pedigree |
| T16004 |
11896-11902 |
NN |
denotes |
member |
| T16005 |
11903-11905 |
CD |
denotes |
23 |
| T16006 |
11905-11907 |
, |
denotes |
, |
| T16007 |
11907-11911 |
IN |
denotes |
with |
| T16008 |
11912-11919 |
JJ |
denotes |
unknown |
| T16009 |
11938-11944 |
NN |
denotes |
status |
| T16010 |
11920-11927 |
NN |
denotes |
disease |
| T16011 |
11928-11937 |
NN |
denotes |
affection |
| T16012 |
11944-11945 |
: |
denotes |
; |
| T16013 |
11946-11948 |
IN |
denotes |
in |
| T16014 |
11949-11950 |
DT |
denotes |
a |
| T16015 |
11973-11980 |
NN |
denotes |
control |
| T16016 |
11951-11965 |
RB |
denotes |
neurologically |
| T16017 |
11966-11972 |
JJ |
denotes |
normal |
| T16018 |
11981-11982 |
-LRB- |
denotes |
( |
| T16019 |
11982-11983 |
NN |
denotes |
C |
| T16020 |
11983-11984 |
-RRB- |
denotes |
) |
| T16021 |
11984-11985 |
: |
denotes |
; |
| T16022 |
11986-11989 |
CC |
denotes |
and |
| T16023 |
11990-11992 |
IN |
denotes |
in |
| T16024 |
11993-11994 |
DT |
denotes |
a |
| T16025 |
12007-12014 |
NN |
denotes |
control |
| T16026 |
11995-11997 |
DT |
denotes |
no |
| T16027 |
11998-12006 |
NN |
denotes |
template |
| T16028 |
12015-12016 |
-LRB- |
denotes |
( |
| T16029 |
12016-12018 |
NN |
denotes |
NC |
| T16030 |
12018-12019 |
-RRB- |
denotes |
) |
| T16031 |
12019-12020 |
. |
denotes |
. |
| T16245 |
15840-15847 |
NNP |
denotes |
Western |
| T16246 |
15848-15852 |
NN |
denotes |
Blot |
| T16247 |
15853-15861 |
NN |
denotes |
Analysis |
| T16248 |
15862-15864 |
IN |
denotes |
of |
| T16249 |
15865-15870 |
NN |
denotes |
ITPR1 |
| T16250 |
15879-15885 |
NNS |
denotes |
Levels |
| T16251 |
15871-15878 |
NN |
denotes |
Protein |
| T16252 |
15886-15888 |
IN |
denotes |
in |
| T16253 |
15889-15892 |
NN |
denotes |
EBV |
| T16254 |
15906-15918 |
NNS |
denotes |
Lymphoblasts |
| T16255 |
15893-15905 |
VBN |
denotes |
Immortalized |
| T16256 |
15919-15923 |
IN |
denotes |
from |
| T16257 |
15924-15928 |
NN |
denotes |
AUS1 |
| T16258 |
15936-15943 |
NNS |
denotes |
Members |
| T16259 |
15929-15935 |
NN |
denotes |
Family |
| T16260 |
15943-16174 |
sentence |
denotes |
Western blot performed to examine ITPR1 levels in EBV immortalized lymphocytes from AUS1 affected family members carrying the ITPR1 deletion and from an AUS1 family member of unknown disease status who does not carry the deletion. |
| T16261 |
15944-15951 |
NNP |
denotes |
Western |
| T16262 |
15952-15956 |
NN |
denotes |
blot |
| T16263 |
15957-15966 |
VBN |
denotes |
performed |
| T16264 |
15967-15969 |
TO |
denotes |
to |
| T16265 |
15970-15977 |
VB |
denotes |
examine |
| T16266 |
15978-15983 |
NN |
denotes |
ITPR1 |
| T16267 |
15984-15990 |
NNS |
denotes |
levels |
| T16268 |
15991-15993 |
IN |
denotes |
in |
| T16269 |
15994-15997 |
NN |
denotes |
EBV |
| T16270 |
16011-16022 |
NNS |
denotes |
lymphocytes |
| T16271 |
15998-16010 |
VBN |
denotes |
immortalized |
| T16272 |
16023-16027 |
IN |
denotes |
from |
| T16273 |
16028-16032 |
NN |
denotes |
AUS1 |
| T16274 |
16033-16041 |
VBN |
denotes |
affected |
| T16275 |
16049-16056 |
NNS |
denotes |
members |
| T16276 |
16042-16048 |
NN |
denotes |
family |
| T16277 |
16057-16065 |
VBG |
denotes |
carrying |
| T16278 |
16066-16069 |
DT |
denotes |
the |
| T16279 |
16076-16084 |
NN |
denotes |
deletion |
| T16280 |
16070-16075 |
NN |
denotes |
ITPR1 |
| T16281 |
16085-16088 |
CC |
denotes |
and |
| T16282 |
16089-16093 |
IN |
denotes |
from |
| T16283 |
16094-16096 |
DT |
denotes |
an |
| T16284 |
16109-16115 |
NN |
denotes |
member |
| T16285 |
16097-16101 |
NN |
denotes |
AUS1 |
| T16286 |
16102-16108 |
NN |
denotes |
family |
| T16287 |
16116-16118 |
IN |
denotes |
of |
| T16288 |
16119-16126 |
JJ |
denotes |
unknown |
| T16289 |
16135-16141 |
NN |
denotes |
status |
| T16290 |
16127-16134 |
NN |
denotes |
disease |
| T16291 |
16142-16145 |
WP |
denotes |
who |
| T16292 |
16155-16160 |
VB |
denotes |
carry |
| T16293 |
16146-16150 |
VBZ |
denotes |
does |
| T16294 |
16151-16154 |
RB |
denotes |
not |
| T16295 |
16161-16164 |
DT |
denotes |
the |
| T16296 |
16165-16173 |
NN |
denotes |
deletion |
| T16297 |
16173-16174 |
. |
denotes |
. |
| T16298 |
16174-16270 |
sentence |
denotes |
Notably the samples from patients with ITPR1 deletion show a dramatic decrease in ITPR1 levels. |
| T16299 |
16175-16182 |
RB |
denotes |
Notably |
| T16300 |
16229-16233 |
VBP |
denotes |
show |
| T16301 |
16183-16186 |
DT |
denotes |
the |
| T16302 |
16187-16194 |
NNS |
denotes |
samples |
| T16303 |
16195-16199 |
IN |
denotes |
from |
| T16304 |
16200-16208 |
NNS |
denotes |
patients |
| T16305 |
16209-16213 |
IN |
denotes |
with |
| T16306 |
16214-16219 |
NN |
denotes |
ITPR1 |
| T16307 |
16220-16228 |
NN |
denotes |
deletion |
| T16308 |
16234-16235 |
DT |
denotes |
a |
| T16309 |
16245-16253 |
NN |
denotes |
decrease |
| T16310 |
16236-16244 |
JJ |
denotes |
dramatic |
| T16311 |
16254-16256 |
IN |
denotes |
in |
| T16312 |
16257-16262 |
NN |
denotes |
ITPR1 |
| T16313 |
16263-16269 |
NNS |
denotes |
levels |
| T16314 |
16269-16270 |
. |
denotes |
. |
| T16315 |
16270-16406 |
sentence |
denotes |
To demonstrate equal loading, these samples were diluted one in five, and the Western blot was repeated using an antibody against ACTB. |
| T16316 |
16271-16273 |
TO |
denotes |
To |
| T16317 |
16274-16285 |
VB |
denotes |
demonstrate |
| T16318 |
16320-16327 |
VBN |
denotes |
diluted |
| T16319 |
16286-16291 |
JJ |
denotes |
equal |
| T16320 |
16292-16299 |
NN |
denotes |
loading |
| T16321 |
16299-16301 |
, |
denotes |
, |
| T16322 |
16301-16306 |
DT |
denotes |
these |
| T16323 |
16307-16314 |
NNS |
denotes |
samples |
| T16324 |
16315-16319 |
VBD |
denotes |
were |
| T16325 |
16328-16331 |
CD |
denotes |
one |
| T16326 |
16332-16334 |
IN |
denotes |
in |
| T16327 |
16335-16339 |
CD |
denotes |
five |
| T16328 |
16339-16341 |
, |
denotes |
, |
| T16329 |
16341-16344 |
CC |
denotes |
and |
| T16330 |
16345-16348 |
DT |
denotes |
the |
| T16331 |
16357-16361 |
NN |
denotes |
blot |
| T16332 |
16349-16356 |
NNP |
denotes |
Western |
| T16333 |
16366-16374 |
VBN |
denotes |
repeated |
| T16334 |
16362-16365 |
VBD |
denotes |
was |
| T16335 |
16375-16380 |
VBG |
denotes |
using |
| T16336 |
16381-16383 |
DT |
denotes |
an |
| T16339 |
16401-16405 |
NN |
denotes |
ACTB |
| T16340 |
16405-16406 |
. |
denotes |
. |
| R66 |
T944 |
T945 |
det |
this,disorder |
| R3 |
T871 |
T872 |
nsubj |
Deletion,Underlies |
| R4 |
T874 |
T871 |
prep |
at,Deletion |
| R5 |
T875 |
T874 |
pobj |
ITPR1,at |
| R6 |
T876 |
T872 |
dobj |
Ataxia,Underlies |
| R7 |
T877 |
T876 |
prep |
in,Ataxia |
| R8 |
T878 |
T877 |
pobj |
Mice,in |
| R9 |
T879 |
T876 |
cc |
and,Ataxia |
| R10 |
T880 |
T881 |
amod |
Spinocerebellar,Ataxia |
| R11 |
T881 |
T876 |
conj |
Ataxia,Ataxia |
| R12 |
T882 |
T881 |
nummod |
15,Ataxia |
| R13 |
T883 |
T881 |
prep |
in,Ataxia |
| R14 |
T884 |
T883 |
pobj |
Humans,in |
| R15 |
T888 |
T889 |
nsubj |
We,observed |
| R16 |
T890 |
T891 |
det |
a,disorder |
| R17 |
T891 |
T889 |
dobj |
disorder,observed |
| R18 |
T892 |
T891 |
amod |
severe,disorder |
| R19 |
T893 |
T891 |
amod |
autosomal,disorder |
| R20 |
T894 |
T891 |
amod |
recessive,disorder |
| R21 |
T895 |
T891 |
compound |
movement,disorder |
| R22 |
T896 |
T889 |
prep |
in,observed |
| R23 |
T897 |
T896 |
pobj |
mice,in |
| R24 |
T898 |
T897 |
acl |
used,mice |
| R25 |
T899 |
T898 |
prep |
within,used |
| R26 |
T900 |
T901 |
poss |
our,laboratory |
| R27 |
T901 |
T899 |
pobj |
laboratory,within |
| R28 |
T902 |
T889 |
punct |
.,observed |
| R29 |
T904 |
T905 |
nsubj |
We,pursued |
| R30 |
T906 |
T907 |
det |
a,series |
| R31 |
T907 |
T905 |
dobj |
series,pursued |
| R32 |
T908 |
T907 |
prep |
of,series |
| R33 |
T909 |
T908 |
pobj |
experiments,of |
| R34 |
T910 |
T911 |
aux |
to,define |
| R35 |
T911 |
T905 |
advcl |
define,pursued |
| R36 |
T912 |
T913 |
det |
the,lesion |
| R37 |
T913 |
T911 |
dobj |
lesion,define |
| R38 |
T914 |
T913 |
amod |
genetic,lesion |
| R39 |
T915 |
T913 |
acl |
underlying,lesion |
| R40 |
T916 |
T917 |
det |
this,disorder |
| R41 |
T917 |
T915 |
dobj |
disorder,underlying |
| R42 |
T918 |
T911 |
cc |
and,define |
| R43 |
T919 |
T920 |
aux |
to,identify |
| R44 |
T920 |
T911 |
conj |
identify,define |
| R45 |
T921 |
T922 |
det |
a,disease |
| R46 |
T922 |
T920 |
dobj |
disease,identify |
| R47 |
T923 |
T922 |
amod |
cognate,disease |
| R48 |
T924 |
T920 |
prep |
in,identify |
| R49 |
T925 |
T924 |
pobj |
humans,in |
| R50 |
T926 |
T925 |
prep |
with,humans |
| R51 |
T927 |
T926 |
pobj |
mutation,with |
| R52 |
T928 |
T927 |
prep |
at,mutation |
| R53 |
T929 |
T930 |
det |
the,locus |
| R54 |
T930 |
T928 |
pobj |
locus,at |
| R55 |
T931 |
T930 |
amod |
same,locus |
| R56 |
T932 |
T905 |
punct |
.,pursued |
| R57 |
T934 |
T935 |
prep |
Through,show |
| R58 |
T936 |
T937 |
nmod |
linkage,analysis |
| R60 |
T938 |
T936 |
cc |
and,linkage |
| R61 |
T939 |
T936 |
conj |
sequence,linkage |
| R62 |
T940 |
T935 |
nsubj |
we,show |
| R63 |
T941 |
T935 |
advmod |
here,show |
| R64 |
T942 |
T943 |
mark |
that,caused |
| R65 |
T943 |
T935 |
ccomp |
caused,show |
| R67 |
T945 |
T943 |
nsubjpass |
disorder,caused |
| R68 |
T946 |
T943 |
auxpass |
is,caused |
| R69 |
T947 |
T943 |
agent |
by,caused |
| R70 |
T948 |
T949 |
det |
a,deletion |
| R71 |
T949 |
T947 |
pobj |
deletion,by |
| R72 |
T950 |
T949 |
amod |
homozygous,deletion |
| R73 |
T951 |
T949 |
nmod |
in,deletion |
| R74 |
T952 |
T951 |
punct |
-,in |
| R75 |
T953 |
T951 |
pobj |
frame,in |
| R76 |
T954 |
T955 |
nummod |
18,bp |
| R77 |
T955 |
T949 |
compound |
bp,deletion |
| R78 |
T956 |
T955 |
punct |
-,bp |
| R79 |
T957 |
T949 |
prep |
in,deletion |
| R80 |
T958 |
T957 |
pobj |
Itpr1,in |
| R81 |
T959 |
T960 |
punct |
(,Δ18 |
| R82 |
T960 |
T958 |
parataxis |
Δ18,Itpr1 |
| R83 |
T961 |
T960 |
compound |
Itpr1,Δ18 |
| R84 |
T962 |
T960 |
compound |
Δ18,Δ18 |
| R85 |
T963 |
T960 |
punct |
/,Δ18 |
| R86 |
T964 |
T960 |
punct |
),Δ18 |
| R87 |
T965 |
T949 |
punct |
", ",deletion |
| R88 |
T966 |
T949 |
acl |
encoding,deletion |
| R89 |
T967 |
T968 |
nmod |
inositol,receptor |
| R90 |
T968 |
T966 |
dobj |
receptor,encoding |
| R91 |
T969 |
T970 |
nummod |
1,5 |
| R93 |
T971 |
T970 |
punct |
",",5 |
| R94 |
T972 |
T970 |
nummod |
4,5 |
| R95 |
T973 |
T970 |
punct |
",",5 |
| R96 |
T974 |
T968 |
compound |
triphosphate,receptor |
| R97 |
T975 |
T974 |
punct |
-,triphosphate |
| R98 |
T976 |
T968 |
nummod |
1,receptor |
| R99 |
T977 |
T935 |
punct |
.,show |
| R100 |
T979 |
T980 |
det |
A,mutation |
| R101 |
T980 |
T985 |
nsubj |
mutation,causes |
| R102 |
T981 |
T982 |
advmod |
previously,reported |
| R103 |
T982 |
T980 |
amod |
reported,mutation |
| R104 |
T983 |
T980 |
amod |
spontaneous,mutation |
| R105 |
T984 |
T980 |
compound |
Itpr1,mutation |
| R106 |
T986 |
T980 |
prep |
in,mutation |
| R107 |
T987 |
T986 |
pobj |
mice,in |
| R108 |
T988 |
T989 |
det |
a,phenotype |
| R109 |
T989 |
T985 |
dobj |
phenotype,causes |
| R110 |
T990 |
T989 |
amod |
identical,phenotype |
| R111 |
T991 |
T990 |
prep |
to,identical |
| R112 |
T992 |
T991 |
pobj |
that,to |
| R113 |
T993 |
T992 |
acl |
observed,that |
| R114 |
T994 |
T993 |
advmod |
here,observed |
| R115 |
T995 |
T985 |
punct |
.,causes |
| R116 |
T997 |
T998 |
prep |
In,leads |
| R117 |
T999 |
T1000 |
det |
both,models |
| R118 |
T1000 |
T997 |
pobj |
models,In |
| R119 |
T1001 |
T1002 |
nmod |
in,frame |
| R120 |
T1002 |
T1004 |
compound |
frame,deletion |
| R121 |
T1003 |
T1002 |
punct |
-,frame |
| R122 |
T1004 |
T998 |
nsubj |
deletion,leads |
| R123 |
T1005 |
T1004 |
prep |
within,deletion |
| R124 |
T1006 |
T1005 |
pobj |
Itpr1,within |
| R125 |
T1007 |
T998 |
prep |
to,leads |
| R126 |
T1008 |
T1009 |
det |
a,decrease |
| R127 |
T1009 |
T1007 |
pobj |
decrease,to |
| R128 |
T1010 |
T1009 |
prep |
in,decrease |
| R129 |
T1011 |
T1012 |
det |
the,level |
| R131 |
T1013 |
T1014 |
advmod |
normally,high |
| R132 |
T1014 |
T1012 |
amod |
high,level |
| R133 |
T1015 |
T1012 |
prep |
of,level |
| R134 |
T1016 |
T1017 |
compound |
Itpr1,expression |
| R135 |
T1017 |
T1015 |
pobj |
expression,of |
| R136 |
T1018 |
T1017 |
prep |
in,expression |
| R137 |
T1019 |
T1020 |
amod |
cerebellar,cells |
| R138 |
T1020 |
T1018 |
pobj |
cells,in |
| R139 |
T1021 |
T1020 |
compound |
Purkinje,cells |
| R140 |
T1022 |
T998 |
punct |
.,leads |
| R141 |
T1024 |
T1025 |
amod |
Spinocerebellar,ataxia |
| R142 |
T1025 |
T1026 |
nsubj |
ataxia,maps |
| R143 |
T1026 |
T1038 |
ccomp |
maps,identified |
| R144 |
T1027 |
T1025 |
nummod |
15,ataxia |
| R145 |
T1028 |
T1025 |
punct |
(,ataxia |
| R146 |
T1029 |
T1025 |
appos |
SCA15,ataxia |
| R147 |
T1030 |
T1025 |
punct |
),ataxia |
| R148 |
T1031 |
T1025 |
punct |
", ",ataxia |
| R149 |
T1032 |
T1033 |
det |
a,disorder |
| R151 |
T1034 |
T1033 |
amod |
human,disorder |
| R152 |
T1035 |
T1033 |
amod |
autosomal,disorder |
| R153 |
T1036 |
T1033 |
amod |
dominant,disorder |
| R154 |
T1037 |
T1026 |
punct |
", ",maps |
| R155 |
T1039 |
T1026 |
prep |
to,maps |
| R156 |
T1040 |
T1041 |
det |
the,region |
| R157 |
T1041 |
T1039 |
pobj |
region,to |
| R158 |
T1042 |
T1041 |
amod |
genomic,region |
| R159 |
T1043 |
T1041 |
acl |
containing,region |
| R160 |
T1044 |
T1043 |
dobj |
ITPR1,containing |
| R161 |
T1045 |
T1038 |
punct |
;,identified |
| R162 |
T1046 |
T1038 |
advmod |
however,identified |
| R163 |
T1047 |
T1038 |
punct |
", ",identified |
| R164 |
T1048 |
T1038 |
prep |
to,identified |
| R165 |
T1049 |
T1048 |
pobj |
date,to |
| R166 |
T1050 |
T1051 |
det |
no,mutations |
| R167 |
T1051 |
T1038 |
nsubjpass |
mutations,identified |
| R168 |
T1052 |
T1051 |
amod |
causal,mutations |
| R169 |
T1053 |
T1038 |
aux |
had,identified |
| R170 |
T1054 |
T1038 |
auxpass |
been,identified |
| R171 |
T1055 |
T1038 |
punct |
.,identified |
| R172 |
T1057 |
T1058 |
mark |
Because,is |
| R173 |
T1058 |
T1060 |
advcl |
is,performed |
| R174 |
T1059 |
T1058 |
nsubj |
ataxia,is |
| R175 |
T1061 |
T1062 |
det |
a,feature |
| R176 |
T1062 |
T1058 |
attr |
feature,is |
| R177 |
T1063 |
T1062 |
amod |
prominent,feature |
| R178 |
T1064 |
T1062 |
prep |
in,feature |
| R179 |
T1065 |
T1066 |
compound |
Itpr1,mice |
| R180 |
T1066 |
T1064 |
pobj |
mice,in |
| R181 |
T1067 |
T1066 |
compound |
mutant,mice |
| R182 |
T1068 |
T1060 |
punct |
", ",performed |
| R183 |
T1069 |
T1060 |
nsubj |
we,performed |
| R184 |
T1070 |
T1071 |
det |
a,series |
| R185 |
T1071 |
T1060 |
dobj |
series,performed |
| R186 |
T1072 |
T1071 |
prep |
of,series |
| R187 |
T1073 |
T1072 |
pobj |
experiments,of |
| R188 |
T1074 |
T1075 |
aux |
to,test |
| R189 |
T1075 |
T1060 |
advcl |
test,performed |
| R190 |
T1076 |
T1077 |
det |
the,hypothesis |
| R191 |
T1077 |
T1075 |
dobj |
hypothesis,test |
| R192 |
T1078 |
T1079 |
mark |
that,be |
| R193 |
T1079 |
T1077 |
acl |
be,hypothesis |
| R194 |
T1080 |
T1079 |
nsubj |
mutation,be |
| R195 |
T1081 |
T1080 |
prep |
at,mutation |
| R196 |
T1082 |
T1081 |
pobj |
ITPR1,at |
| R197 |
T1083 |
T1079 |
aux |
may,be |
| R198 |
T1084 |
T1085 |
det |
the,cause |
| R199 |
T1085 |
T1079 |
attr |
cause,be |
| R200 |
T1086 |
T1085 |
prep |
of,cause |
| R201 |
T1087 |
T1086 |
pobj |
SCA15,of |
| R202 |
T1088 |
T1060 |
punct |
.,performed |
| R203 |
T1090 |
T1091 |
nsubj |
We,show |
| R204 |
T1092 |
T1091 |
advmod |
here,show |
| R205 |
T1093 |
T1094 |
mark |
that,underlies |
| R206 |
T1094 |
T1091 |
ccomp |
underlies,show |
| R207 |
T1095 |
T1096 |
amod |
heterozygous,deletion |
| R208 |
T1096 |
T1094 |
nsubj |
deletion,underlies |
| R209 |
T1097 |
T1096 |
prep |
of,deletion |
| R210 |
T1098 |
T1099 |
det |
the,part |
| R211 |
T1099 |
T1097 |
pobj |
part,of |
| R212 |
T1100 |
T1099 |
nummod |
5,part |
| R213 |
T1101 |
T1100 |
punct |
′,5 |
| R214 |
T1102 |
T1099 |
prep |
of,part |
| R215 |
T1103 |
T1104 |
det |
the,gene |
| R216 |
T1104 |
T1102 |
pobj |
gene,of |
| R217 |
T1105 |
T1104 |
compound |
ITPR1,gene |
| R218 |
T1106 |
T1099 |
punct |
", ",part |
| R219 |
T1107 |
T1099 |
acl |
encompassing,part |
| R220 |
T1108 |
T1109 |
nmod |
exons,1 |
| R221 |
T1109 |
T1107 |
dobj |
1,encompassing |
| R222 |
T1110 |
T1111 |
punct |
–,10 |
| R223 |
T1111 |
T1109 |
prep |
10,1 |
| R224 |
T1112 |
T1109 |
punct |
", ",1 |
| R225 |
T1113 |
T1109 |
conj |
1,1 |
| R226 |
T1114 |
T1115 |
punct |
–,40 |
| R227 |
T1115 |
T1113 |
prep |
40,1 |
| R228 |
T1116 |
T1113 |
punct |
", ",1 |
| R229 |
T1117 |
T1113 |
cc |
and,1 |
| R230 |
T1118 |
T1113 |
conj |
1,1 |
| R231 |
T1119 |
T1120 |
punct |
–,44 |
| R232 |
T1120 |
T1118 |
prep |
44,1 |
| R233 |
T1121 |
T1107 |
prep |
in,encompassing |
| R234 |
T1122 |
T1123 |
nummod |
three,families |
| R235 |
T1123 |
T1121 |
pobj |
families,in |
| R236 |
T1124 |
T1123 |
amod |
studied,families |
| R237 |
T1125 |
T1094 |
punct |
", ",underlies |
| R238 |
T1126 |
T1094 |
dobj |
SCA15,underlies |
| R239 |
T1127 |
T1094 |
prep |
in,underlies |
| R240 |
T1128 |
T1127 |
pobj |
humans,in |
| R241 |
T1129 |
T1091 |
punct |
.,show |
| R242 |
T1474 |
T1475 |
det |
The,use |
| R243 |
T1475 |
T1476 |
nsubj |
use,become |
| R244 |
T1477 |
T1475 |
prep |
of,use |
| R245 |
T1478 |
T1479 |
amod |
forward,genetics |
| R246 |
T1479 |
T1477 |
pobj |
genetics,of |
| R247 |
T1480 |
T1481 |
aux |
to,define |
| R248 |
T1481 |
T1475 |
acl |
define,use |
| R249 |
T1482 |
T1483 |
amod |
novel,loci |
| R250 |
T1483 |
T1481 |
dobj |
loci,define |
| R251 |
T1484 |
T1483 |
prep |
of,loci |
| R252 |
T1485 |
T1484 |
pobj |
interest,of |
| R253 |
T1486 |
T1483 |
prep |
in,loci |
| R254 |
T1487 |
T1488 |
amod |
human,disease |
| R255 |
T1488 |
T1486 |
pobj |
disease,in |
| R256 |
T1489 |
T1476 |
aux |
has,become |
| R257 |
T1490 |
T1491 |
advmod |
increasingly,viable |
| R258 |
T1491 |
T1476 |
acomp |
viable,become |
| R259 |
T1492 |
T1476 |
prep |
with,become |
| R260 |
T1493 |
T1494 |
det |
the,implementation |
| R261 |
T1494 |
T1492 |
pobj |
implementation,with |
| R262 |
T1495 |
T1494 |
prep |
of,implementation |
| R263 |
T1496 |
T1497 |
amod |
large,scale |
| R264 |
T1497 |
T1499 |
compound |
scale,programs |
| R265 |
T1498 |
T1497 |
punct |
-,scale |
| R266 |
T1499 |
T1495 |
pobj |
programs,of |
| R267 |
T1500 |
T1499 |
compound |
mutagenesis,programs |
| R268 |
T1501 |
T1476 |
punct |
.,become |
| R269 |
T1503 |
T1504 |
advmod |
Prior,to |
| R270 |
T1504 |
T1505 |
prep |
to,carried |
| R271 |
T1506 |
T1507 |
det |
these,initiatives |
| R272 |
T1507 |
T1504 |
pobj |
initiatives,to |
| R273 |
T1508 |
T1509 |
det |
this,work |
| R274 |
T1509 |
T1505 |
nsubjpass |
work,carried |
| R275 |
T1510 |
T1505 |
auxpass |
was,carried |
| R276 |
T1511 |
T1505 |
prt |
out,carried |
| R277 |
T1512 |
T1505 |
prep |
in,carried |
| R278 |
T1513 |
T1512 |
amod |
part,in |
| R279 |
T1514 |
T1505 |
prep |
by,carried |
| R280 |
T1515 |
T1516 |
det |
the,investigation |
| R281 |
T1516 |
T1514 |
pobj |
investigation,by |
| R282 |
T1517 |
T1516 |
prep |
of,investigation |
| R283 |
T1518 |
T1519 |
amod |
spontaneous,mutations |
| R284 |
T1519 |
T1517 |
pobj |
mutations,of |
| R285 |
T1520 |
T1521 |
dep |
that,cause |
| R286 |
T1521 |
T1519 |
relcl |
cause,mutations |
| R287 |
T1522 |
T1521 |
dobj |
disorders,cause |
| R288 |
T1523 |
T1521 |
prep |
in,cause |
| R289 |
T1524 |
T1525 |
compound |
mouse,colonies |
| R290 |
T1525 |
T1523 |
pobj |
colonies,in |
| R291 |
T1526 |
T1525 |
compound |
breeding,colonies |
| R292 |
T1527 |
T1505 |
punct |
.,carried |
| R293 |
T1529 |
T1530 |
amod |
Careful,observation |
| R294 |
T1530 |
T1531 |
nsubj |
observation,led |
| R295 |
T1532 |
T1530 |
prep |
of,observation |
| R296 |
T1533 |
T1534 |
det |
these,events |
| R297 |
T1534 |
T1532 |
pobj |
events,of |
| R298 |
T1535 |
T1534 |
amod |
serendipitous,events |
| R299 |
T1536 |
T1531 |
aux |
has,led |
| R300 |
T1537 |
T1531 |
prep |
to,led |
| R301 |
T1538 |
T1539 |
det |
the,establishment |
| R302 |
T1539 |
T1537 |
pobj |
establishment,to |
| R303 |
T1540 |
T1539 |
cc |
and,establishment |
| R304 |
T1541 |
T1539 |
conj |
study,establishment |
| R305 |
T1542 |
T1539 |
prep |
of,establishment |
| R306 |
T1543 |
T1544 |
amod |
many,models |
| R307 |
T1544 |
T1542 |
pobj |
models,of |
| R308 |
T1545 |
T1546 |
advmod |
in,vivo |
| R309 |
T1546 |
T1544 |
amod |
vivo,models |
| R310 |
T1547 |
T1544 |
compound |
disease,models |
| R311 |
T1548 |
T1549 |
punct |
[,3 |
| R312 |
T1549 |
T1531 |
parataxis |
3,led |
| R313 |
T1550 |
T1549 |
punct |
],3 |
| R314 |
T1551 |
T1531 |
punct |
.,led |
| R315 |
T1553 |
T1554 |
prep |
During,noted |
| R316 |
T1555 |
T1556 |
det |
the,generation |
| R317 |
T1556 |
T1553 |
pobj |
generation,During |
| R318 |
T1557 |
T1556 |
prep |
of,generation |
| R319 |
T1558 |
T1559 |
det |
a,line |
| R320 |
T1559 |
T1557 |
pobj |
line,of |
| R321 |
T1560 |
T1559 |
compound |
knockout,line |
| R322 |
T1561 |
T1559 |
prep |
of,line |
| R323 |
T1562 |
T1561 |
pobj |
mice,of |
| R324 |
T1563 |
T1554 |
nsubj |
we,noted |
| R325 |
T1564 |
T1565 |
det |
an,disorder |
| R326 |
T1565 |
T1554 |
dobj |
disorder,noted |
| R327 |
T1566 |
T1565 |
amod |
early,disorder |
| R328 |
T1567 |
T1565 |
compound |
movement,disorder |
| R329 |
T1568 |
T1569 |
dep |
that,inherited |
| R330 |
T1569 |
T1565 |
relcl |
inherited,disorder |
| R331 |
T1570 |
T1569 |
auxpass |
was,inherited |
| R332 |
T1571 |
T1569 |
advmod |
independently,inherited |
| R333 |
T1572 |
T1571 |
prep |
of,independently |
| R334 |
T1573 |
T1574 |
amod |
targeting,vector |
| R335 |
T1574 |
T1575 |
compound |
vector,transmission |
| R336 |
T1575 |
T1572 |
pobj |
transmission,of |
| R337 |
T1576 |
T1554 |
punct |
.,noted |
| R338 |
T1578 |
T1579 |
nsubj |
We,embarked |
| R339 |
T1580 |
T1579 |
prep |
on,embarked |
| R340 |
T1581 |
T1582 |
det |
a,series |
| R341 |
T1582 |
T1580 |
pobj |
series,on |
| R342 |
T1583 |
T1582 |
prep |
of,series |
| R343 |
T1584 |
T1583 |
pobj |
experiments,of |
| R344 |
T1585 |
T1586 |
aux |
to,identify |
| R345 |
T1586 |
T1579 |
advcl |
identify,embarked |
| R346 |
T1587 |
T1588 |
det |
the,lesion |
| R347 |
T1588 |
T1586 |
dobj |
lesion,identify |
| R348 |
T1589 |
T1588 |
amod |
genetic,lesion |
| R349 |
T1590 |
T1588 |
acl |
underlying,lesion |
| R350 |
T1591 |
T1592 |
det |
this,disorder |
| R351 |
T1592 |
T1590 |
dobj |
disorder,underlying |
| R352 |
T1593 |
T1592 |
compound |
movement,disorder |
| R353 |
T1594 |
T1586 |
cc |
and,identify |
| R354 |
T1595 |
T1596 |
aux |
to,identify |
| R355 |
T1596 |
T1586 |
conj |
identify,identify |
| R356 |
T1597 |
T1598 |
det |
a,disease |
| R357 |
T1598 |
T1596 |
dobj |
disease,identify |
| R358 |
T1599 |
T1598 |
amod |
cognate,disease |
| R359 |
T1600 |
T1598 |
cc |
and,disease |
| R360 |
T1601 |
T1602 |
amod |
corresponding,mutation |
| R361 |
T1602 |
T1598 |
conj |
mutation,disease |
| R362 |
T1603 |
T1596 |
prep |
in,identify |
| R363 |
T1604 |
T1603 |
pobj |
humans,in |
| R364 |
T1605 |
T1579 |
punct |
.,embarked |
| R365 |
T1607 |
T1608 |
advmod |
Here,describe |
| R366 |
T1609 |
T1608 |
nsubj |
we,describe |
| R367 |
T1610 |
T1611 |
det |
this,effort |
| R368 |
T1611 |
T1608 |
dobj |
effort,describe |
| R369 |
T1612 |
T1611 |
cc |
and,effort |
| R370 |
T1613 |
T1614 |
det |
the,discovery |
| R371 |
T1614 |
T1611 |
conj |
discovery,effort |
| R372 |
T1615 |
T1614 |
prep |
of,discovery |
| R373 |
T1616 |
T1615 |
pobj |
deletion,of |
| R374 |
T1617 |
T1616 |
prep |
at,deletion |
| R375 |
T1618 |
T1619 |
det |
the,locus |
| R376 |
T1619 |
T1617 |
pobj |
locus,at |
| R377 |
T1620 |
T1619 |
compound |
ITPR1,locus |
| R378 |
T1621 |
T1608 |
prep |
as,describe |
| R379 |
T1622 |
T1623 |
det |
a,cause |
| R380 |
T1623 |
T1621 |
pobj |
cause,as |
| R381 |
T1624 |
T1623 |
prep |
of,cause |
| R382 |
T1625 |
T1626 |
det |
this,disorder |
| R383 |
T1626 |
T1624 |
pobj |
disorder,of |
| R384 |
T1627 |
T1626 |
prep |
in,disorder |
| R385 |
T1628 |
T1627 |
pobj |
mice,in |
| R386 |
T1629 |
T1624 |
cc |
and,of |
| R387 |
T1630 |
T1624 |
conj |
of,of |
| R388 |
T1631 |
T1632 |
amod |
spinocerebellar,ataxia |
| R389 |
T1632 |
T1630 |
pobj |
ataxia,of |
| R390 |
T1633 |
T1632 |
nummod |
15,ataxia |
| R391 |
T1634 |
T1632 |
punct |
(,ataxia |
| R392 |
T1635 |
T1632 |
appos |
SCA15,ataxia |
| R393 |
T1636 |
T1632 |
punct |
),ataxia |
| R394 |
T1637 |
T1632 |
prep |
in,ataxia |
| R395 |
T1638 |
T1637 |
pobj |
humans,in |
| R396 |
T1639 |
T1608 |
punct |
.,describe |
| R406 |
T6363 |
T6364 |
prep |
During,noted |
| R408 |
T6365 |
T6366 |
det |
the,generation |
| R409 |
T6366 |
T6363 |
pobj |
generation,During |
| R410 |
T6474 |
T6473 |
prep |
at,presented |
| R411 |
T6475 |
T6476 |
advmod |
approximately,day |
| R412 |
T6476 |
T6474 |
pobj |
day,at |
| R413 |
T6477 |
T6476 |
amod |
postnatal,day |
| R414 |
T6367 |
T6366 |
prep |
of,generation |
| R415 |
T6368 |
T6369 |
det |
a,line |
| R416 |
T6478 |
T6476 |
nummod |
14,day |
| R417 |
T6369 |
T6367 |
pobj |
line,of |
| R418 |
T6370 |
T6369 |
prep |
of,line |
| R419 |
T6371 |
T6370 |
pobj |
mice,of |
| R420 |
T6479 |
T6473 |
punct |
", ",presented |
| R421 |
T6372 |
T6371 |
prep |
with,mice |
| R422 |
T6373 |
T6372 |
pobj |
knockout,with |
| R423 |
T6374 |
T6373 |
prep |
of,knockout |
| R424 |
T6480 |
T6473 |
cc |
and,presented |
| R425 |
T6375 |
T6376 |
det |
the,gene |
| R426 |
T6376 |
T6374 |
pobj |
gene,of |
| R427 |
T6481 |
T6482 |
compound |
survival,time |
| R428 |
T6377 |
T6376 |
appos |
Park7,gene |
| R429 |
T6378 |
T6364 |
nsubj |
we,noted |
| R430 |
T6379 |
T6380 |
det |
an,disorder |
| R431 |
T6380 |
T6364 |
dobj |
disorder,noted |
| R432 |
T6482 |
T6483 |
nsubj |
time,was |
| R433 |
T6381 |
T6380 |
amod |
early,disorder |
| R434 |
T6382 |
T6380 |
compound |
movement,disorder |
| R435 |
T6383 |
T6384 |
dep |
that,inherited |
| R436 |
T6483 |
T6473 |
conj |
was,presented |
| R437 |
T6384 |
T6380 |
relcl |
inherited,disorder |
| R438 |
T6385 |
T6384 |
auxpass |
was,inherited |
| R439 |
T6386 |
T6384 |
advmod |
independently,inherited |
| R440 |
T6484 |
T6482 |
prep |
without,time |
| R441 |
T6387 |
T6386 |
prep |
of,independently |
| R442 |
T6388 |
T6389 |
compound |
targeting,vector |
| R443 |
T6389 |
T6390 |
compound |
vector,transmission |
| R444 |
T6485 |
T6484 |
pobj |
weaning,without |
| R445 |
T6390 |
T6387 |
pobj |
transmission,of |
| R446 |
T6391 |
T6364 |
punct |
.,noted |
| R447 |
T6393 |
T6394 |
poss |
Our,observations |
| R448 |
T6394 |
T6396 |
nsubj |
observations,suggested |
| R449 |
T6395 |
T6394 |
amod |
initial,observations |
| R450 |
T6397 |
T6398 |
det |
the,mice |
| R451 |
T6398 |
T6400 |
nsubj |
mice,suffered |
| R452 |
T6486 |
T6483 |
prep |
on,was |
| R453 |
T6399 |
T6398 |
amod |
affected,mice |
| R454 |
T6400 |
T6396 |
advcl |
suffered,suggested |
| R455 |
T6401 |
T6400 |
prep |
from,suffered |
| R456 |
T6402 |
T6403 |
det |
an,disorder |
| R457 |
T6487 |
T6486 |
amod |
average,on |
| R458 |
T6403 |
T6401 |
pobj |
disorder,from |
| R459 |
T6404 |
T6405 |
advmod |
apparently,paroxysmal |
| R460 |
T6405 |
T6403 |
amod |
paroxysmal,disorder |
| R461 |
T6488 |
T6489 |
nummod |
4,wk |
| R462 |
T6406 |
T6403 |
compound |
movement,disorder |
| R463 |
T6407 |
T6403 |
punct |
", ",disorder |
| R464 |
T6408 |
T6409 |
advmod |
often,induced |
| R465 |
T6489 |
T6490 |
npadvmod |
wk,after |
| R466 |
T6409 |
T6403 |
acl |
induced,disorder |
| R467 |
T6410 |
T6409 |
prep |
by,induced |
| R468 |
T6411 |
T6410 |
pobj |
touch,by |
| R469 |
T6490 |
T6483 |
prep |
after,was |
| R470 |
T6412 |
T6396 |
punct |
.,suggested |
| R471 |
T6491 |
T6490 |
pobj |
onset,after |
| R472 |
T6414 |
T6415 |
det |
The,movements |
| R473 |
T6492 |
T6483 |
punct |
.,was |
| R474 |
T6415 |
T6417 |
nsubj |
movements,occurred |
| R475 |
T6416 |
T6415 |
amod |
abnormal,movements |
| R476 |
T6494 |
T6495 |
compound |
Breeding,experiments |
| R477 |
T6418 |
T6417 |
advmod |
predominantly,occurred |
| R478 |
T6419 |
T6417 |
prep |
below,occurred |
| R479 |
T6420 |
T6421 |
det |
the,level |
| R480 |
T6495 |
T6496 |
nsubj |
experiments,suggested |
| R481 |
T6421 |
T6419 |
pobj |
level,below |
| R482 |
T6422 |
T6421 |
amod |
cervical,level |
| R483 |
T6423 |
T6417 |
punct |
", ",occurred |
| R484 |
T6497 |
T6498 |
mark |
that,inherited |
| R485 |
T6424 |
T6417 |
cc |
and,occurred |
| R486 |
T6425 |
T6426 |
det |
the,disorder |
| R487 |
T6426 |
T6427 |
nsubj |
disorder,appeared |
| R488 |
T6498 |
T6496 |
ccomp |
inherited,suggested |
| R489 |
T6427 |
T6417 |
conj |
appeared,occurred |
| R490 |
T6428 |
T6427 |
oprd |
progressive,appeared |
| R491 |
T6429 |
T6427 |
punct |
.,appeared |
| R492 |
T6499 |
T6500 |
det |
the,disorder |
| R493 |
T6431 |
T6432 |
prep |
At,likened |
| R494 |
T6500 |
T6498 |
nsubjpass |
disorder,inherited |
| R495 |
T6433 |
T6434 |
amod |
initial,examination |
| R496 |
T6434 |
T6431 |
pobj |
examination,At |
| R497 |
T6435 |
T6432 |
punct |
", ",likened |
| R498 |
T6501 |
T6500 |
amod |
observed,disorder |
| R499 |
T6436 |
T6437 |
det |
a,specialist |
| R500 |
T6437 |
T6432 |
nsubj |
specialist,likened |
| R501 |
T6438 |
T6439 |
amod |
human,disorder |
| R502 |
T6439 |
T6437 |
compound |
disorder,specialist |
| R503 |
T6440 |
T6439 |
compound |
movement,disorder |
| R504 |
T6502 |
T6498 |
auxpass |
was,inherited |
| R505 |
T6441 |
T6442 |
punct |
(,H. |
| R506 |
T6442 |
T6437 |
parataxis |
H.,specialist |
| R507 |
T6443 |
T6442 |
compound |
K.,H. |
| R508 |
T6444 |
T6442 |
compound |
G.,H. |
| R509 |
T6503 |
T6498 |
prep |
in,inherited |
| R510 |
T6445 |
T6442 |
punct |
-,H. |
| R511 |
T6446 |
T6442 |
punct |
),H. |
| R512 |
T6447 |
T6448 |
det |
the,disorder |
| R513 |
T6504 |
T6505 |
det |
an,manner |
| R514 |
T6448 |
T6432 |
dobj |
disorder,likened |
| R515 |
T6449 |
T6432 |
prep |
to,likened |
| R516 |
T6450 |
T6451 |
amod |
episodic,ataxia |
| R517 |
T6505 |
T6503 |
pobj |
manner,in |
| R518 |
T6451 |
T6449 |
pobj |
ataxia,to |
| R519 |
T6452 |
T6451 |
amod |
intermittent,ataxia |
| R520 |
T6453 |
T6451 |
cc |
or,ataxia |
| R521 |
T6506 |
T6505 |
amod |
autosomal,manner |
| R522 |
T6454 |
T6455 |
amod |
kinesiogenic,dystonia |
| R523 |
T6455 |
T6451 |
conj |
dystonia,ataxia |
| R524 |
T6456 |
T6455 |
amod |
paroxysmal,dystonia |
| R525 |
T6507 |
T6505 |
amod |
recessive,manner |
| R526 |
T6457 |
T6432 |
cc |
and,likened |
| R527 |
T6458 |
T6432 |
conj |
predicted,likened |
| R528 |
T6459 |
T6460 |
det |
the,involvement |
| R529 |
T6508 |
T6496 |
punct |
.,suggested |
| R530 |
T6460 |
T6458 |
dobj |
involvement,predicted |
| R531 |
T6461 |
T6460 |
prep |
of,involvement |
| R532 |
T6510 |
T6511 |
aux |
To,map |
| R533 |
T6462 |
T6463 |
det |
an,mutation |
| R534 |
T6463 |
T6461 |
pobj |
mutation,of |
| R535 |
T6464 |
T6463 |
compound |
ion,mutation |
| R536 |
T6465 |
T6463 |
compound |
channel,mutation |
| R537 |
T6466 |
T6460 |
prep |
in,involvement |
| R538 |
T6511 |
T6512 |
advcl |
map,performed |
| R539 |
T6467 |
T6468 |
det |
the,etiology |
| R540 |
T6468 |
T6466 |
pobj |
etiology,in |
| R541 |
T6513 |
T6514 |
det |
the,location |
| R542 |
T6469 |
T6432 |
punct |
.,likened |
| R543 |
T6471 |
T6472 |
amod |
Affected,mice |
| R544 |
T6472 |
T6473 |
nsubj |
mice,presented |
| R545 |
T6514 |
T6511 |
dobj |
location,map |
| R546 |
T6515 |
T6514 |
prep |
of,location |
| R547 |
T6516 |
T6517 |
det |
the,lesion |
| R548 |
T6517 |
T6515 |
pobj |
lesion,of |
| R549 |
T6518 |
T6519 |
npadvmod |
disease,causing |
| R550 |
T6579 |
T6580 |
det |
The,haplotype |
| R551 |
T6519 |
T6517 |
amod |
causing,lesion |
| R552 |
T6580 |
T6582 |
nsubj |
haplotype,suggested |
| R553 |
T6581 |
T6580 |
amod |
linked,haplotype |
| R554 |
T6583 |
T6584 |
det |
the,mutation |
| R555 |
T6584 |
T6585 |
nsubj |
mutation,occurred |
| R556 |
T6520 |
T6519 |
punct |
-,causing |
| R557 |
T6585 |
T6582 |
advcl |
occurred,suggested |
| R558 |
T6586 |
T6585 |
aux |
had,occurred |
| R559 |
T6521 |
T6512 |
punct |
", ",performed |
| R560 |
T6587 |
T6585 |
prep |
on,occurred |
| R561 |
T6588 |
T6589 |
det |
the,background |
| R562 |
T6522 |
T6512 |
nsubj |
we,performed |
| R563 |
T6589 |
T6587 |
pobj |
background,on |
| R564 |
T6523 |
T6524 |
npadvmod |
genome,wide |
| R565 |
T6590 |
T6591 |
compound |
129x1,SvJ |
| R566 |
T6591 |
T6589 |
compound |
SvJ,background |
| R567 |
T6524 |
T6526 |
amod |
wide,analysis |
| R568 |
T6592 |
T6591 |
punct |
/,SvJ |
| R569 |
T6593 |
T6594 |
punct |
(,S1 |
| R570 |
T6594 |
T6582 |
parataxis |
S1,suggested |
| R571 |
T6525 |
T6524 |
punct |
-,wide |
| R572 |
T6595 |
T6594 |
compound |
Figure,S1 |
| R573 |
T6596 |
T6594 |
punct |
),S1 |
| R574 |
T6597 |
T6582 |
punct |
.,suggested |
| R575 |
T6526 |
T6512 |
dobj |
analysis,performed |
| R576 |
T6599 |
T6600 |
compound |
Literature,searches |
| R577 |
T6600 |
T6601 |
nsubj |
searches,revealed |
| R578 |
T6527 |
T6526 |
compound |
linkage,analysis |
| R579 |
T6602 |
T6603 |
mark |
that,displays |
| R580 |
T6528 |
T6512 |
advcl |
using,performed |
| R581 |
T6603 |
T6601 |
ccomp |
displays,revealed |
| R582 |
T6604 |
T6603 |
prep |
among,displays |
| R583 |
T6605 |
T6606 |
compound |
disease,lines |
| R584 |
T6529 |
T6530 |
npadvmod |
strain,specific |
| R585 |
T6606 |
T6604 |
pobj |
lines,among |
| R586 |
T6607 |
T6606 |
acl |
mapped,lines |
| R587 |
T6608 |
T6607 |
prep |
to,mapped |
| R588 |
T6530 |
T6532 |
amod |
specific,polymorphisms |
| R589 |
T6609 |
T6608 |
pobj |
6qE1,to |
| R590 |
T6610 |
T6603 |
punct |
", ",displays |
| R591 |
T6531 |
T6530 |
punct |
-,specific |
| R592 |
T6611 |
T6612 |
det |
the,mutant |
| R593 |
T6612 |
T6603 |
nsubj |
mutant,displays |
| R594 |
T6613 |
T6612 |
amod |
spontaneous,mutant |
| R595 |
T6532 |
T6528 |
dobj |
polymorphisms,using |
| R596 |
T6614 |
T6615 |
compound |
opt,mouse |
| R597 |
T6615 |
T6612 |
appos |
mouse,mutant |
| R598 |
T6616 |
T6617 |
det |
a,presentation |
| R599 |
T6617 |
T6603 |
dobj |
presentation,displays |
| R600 |
T6533 |
T6534 |
amod |
single,nucleotide |
| R601 |
T6618 |
T6619 |
advmod |
strikingly,similar |
| R602 |
T6619 |
T6617 |
amod |
similar,presentation |
| R603 |
T6534 |
T6532 |
compound |
nucleotide,polymorphisms |
| R604 |
T6620 |
T6617 |
prep |
to,presentation |
| R605 |
T6621 |
T6620 |
pobj |
that,to |
| R606 |
T6622 |
T6621 |
acl |
described,that |
| R607 |
T6623 |
T6622 |
advmod |
here,described |
| R608 |
T6535 |
T6532 |
punct |
(,polymorphisms |
| R609 |
T6624 |
T6625 |
punct |
[,1 |
| R610 |
T6625 |
T6601 |
parataxis |
1,revealed |
| R611 |
T6626 |
T6625 |
punct |
],1 |
| R612 |
T6627 |
T6601 |
punct |
.,revealed |
| R613 |
T6536 |
T6532 |
appos |
SNPs,polymorphisms |
| R614 |
T6537 |
T6528 |
punct |
),using |
| R615 |
T6629 |
T6630 |
det |
The,lesion |
| R616 |
T6630 |
T6633 |
nsubj |
lesion,is |
| R617 |
T6631 |
T6630 |
amod |
underlying,lesion |
| R618 |
T6632 |
T6630 |
amod |
genetic,lesion |
| R619 |
T6538 |
T6528 |
prep |
at,using |
| R620 |
T6634 |
T6630 |
acl |
causing,lesion |
| R621 |
T6539 |
T6540 |
nummod |
120,loci |
| R622 |
T6635 |
T6636 |
det |
the,phenotype |
| R623 |
T6636 |
T6634 |
dobj |
phenotype,causing |
| R624 |
T6637 |
T6636 |
compound |
opt,phenotype |
| R625 |
T6540 |
T6538 |
pobj |
loci,at |
| R626 |
T6638 |
T6639 |
det |
a,deletion |
| R627 |
T6639 |
T6633 |
attr |
deletion,is |
| R628 |
T6640 |
T6639 |
amod |
homozygous,deletion |
| R629 |
T6641 |
T6642 |
nmod |
in,frame |
| R630 |
T6541 |
T6528 |
prep |
across,using |
| R631 |
T6642 |
T6639 |
compound |
frame,deletion |
| R632 |
T6643 |
T6642 |
punct |
-,frame |
| R633 |
T6542 |
T6543 |
det |
the,genome |
| R634 |
T6644 |
T6639 |
prep |
of,deletion |
| R635 |
T6645 |
T6646 |
nmod |
exons,43 |
| R636 |
T6646 |
T6644 |
pobj |
43,of |
| R637 |
T6543 |
T6541 |
pobj |
genome,across |
| R638 |
T6647 |
T6646 |
cc |
and,43 |
| R639 |
T6648 |
T6646 |
conj |
44,43 |
| R640 |
T6649 |
T6646 |
prep |
of,43 |
| R641 |
T6544 |
T6543 |
compound |
mouse,genome |
| R642 |
T6650 |
T6651 |
det |
the,Itpr1 |
| R643 |
T6651 |
T6649 |
pobj |
Itpr1,of |
| R644 |
T6652 |
T6651 |
compound |
gene,Itpr1 |
| R645 |
T6545 |
T6512 |
punct |
.,performed |
| R646 |
T6653 |
T6654 |
punct |
(,opt |
| R647 |
T6654 |
T6651 |
parataxis |
opt,Itpr1 |
| R648 |
T6655 |
T6654 |
compound |
Itpr1opt,opt |
| R649 |
T6547 |
T6548 |
nsubj |
Analysis,showed |
| R650 |
T6656 |
T6654 |
punct |
/,opt |
| R651 |
T6657 |
T6654 |
punct |
),opt |
| R652 |
T6658 |
T6646 |
punct |
", ",43 |
| R653 |
T6659 |
T6646 |
acl |
encoding,43 |
| R654 |
T6549 |
T6547 |
prep |
of,Analysis |
| R655 |
T6660 |
T6661 |
nmod |
inositol,receptor |
| R656 |
T6661 |
T6659 |
dobj |
receptor,encoding |
| R657 |
T6662 |
T6663 |
nummod |
1,5 |
| R658 |
T6663 |
T6667 |
nummod |
5,triphosphate |
| R659 |
T6664 |
T6663 |
punct |
",",5 |
| R660 |
T6665 |
T6663 |
nummod |
4,5 |
| R661 |
T6666 |
T6663 |
punct |
",",5 |
| R662 |
T6667 |
T6661 |
compound |
triphosphate,receptor |
| R663 |
T6668 |
T6667 |
punct |
-,triphosphate |
| R664 |
T6550 |
T6551 |
det |
these,data |
| R665 |
T6669 |
T6661 |
nummod |
1,receptor |
| R666 |
T6670 |
T6671 |
punct |
(,Itpr1 |
| R667 |
T6671 |
T6661 |
parataxis |
Itpr1,receptor |
| R668 |
T6551 |
T6549 |
pobj |
data,of |
| R669 |
T6672 |
T6671 |
punct |
),Itpr1 |
| R670 |
T6673 |
T6633 |
punct |
.,is |
| R671 |
T6552 |
T6553 |
det |
a,region |
| R672 |
T6675 |
T6676 |
nsubj |
Sequencing,revealed |
| R673 |
T6553 |
T6548 |
dobj |
region,showed |
| R674 |
T6677 |
T6675 |
prep |
of,Sequencing |
| R675 |
T6554 |
T6553 |
amod |
single,region |
| R676 |
T6678 |
T6679 |
det |
all,exons |
| R677 |
T6679 |
T6677 |
pobj |
exons,of |
| R678 |
T6555 |
T6553 |
amod |
genomic,region |
| R679 |
T6680 |
T6679 |
cc |
and,exons |
| R680 |
T6681 |
T6682 |
compound |
intron,exon |
| R681 |
T6682 |
T6684 |
compound |
exon,boundaries |
| R682 |
T6556 |
T6553 |
prep |
with,region |
| R683 |
T6683 |
T6682 |
punct |
–,exon |
| R684 |
T6557 |
T6558 |
amod |
significant,linkage |
| R685 |
T6558 |
T6556 |
pobj |
linkage,with |
| R686 |
T6684 |
T6679 |
conj |
boundaries,exons |
| R687 |
T6559 |
T6558 |
prep |
to,linkage |
| R688 |
T6685 |
T6684 |
prep |
of,boundaries |
| R689 |
T6686 |
T6685 |
pobj |
Itpr1,of |
| R690 |
T6560 |
T6559 |
pobj |
disease,to |
| R691 |
T6687 |
T6679 |
prep |
in,exons |
| R692 |
T6688 |
T6689 |
amod |
affected,mice |
| R693 |
T6561 |
T6548 |
punct |
", ",showed |
| R694 |
T6689 |
T6687 |
pobj |
mice,in |
| R695 |
T6690 |
T6689 |
prep |
from,mice |
| R696 |
T6562 |
T6548 |
advcl |
providing,showed |
| R697 |
T6691 |
T6692 |
det |
the,study |
| R698 |
T6692 |
T6690 |
pobj |
study,from |
| R699 |
T6693 |
T6692 |
amod |
current,study |
| R700 |
T6563 |
T6564 |
det |
a,score |
| R701 |
T6694 |
T6695 |
det |
a,mutation |
| R702 |
T6695 |
T6676 |
dobj |
mutation,revealed |
| R703 |
T6696 |
T6695 |
amod |
single,mutation |
| R704 |
T6564 |
T6562 |
dobj |
score,providing |
| R705 |
T6697 |
T6695 |
prep |
within,mutation |
| R706 |
T6698 |
T6697 |
pobj |
Itpr1,within |
| R707 |
T6699 |
T6695 |
punct |
: ,mutation |
| R708 |
T6565 |
T6566 |
nummod |
two,point |
| R709 |
T6700 |
T6701 |
det |
a,deletion |
| R710 |
T6701 |
T6695 |
appos |
deletion,mutation |
| R711 |
T6702 |
T6701 |
amod |
novel,deletion |
| R712 |
T6703 |
T6701 |
nmod |
in,deletion |
| R713 |
T6704 |
T6703 |
punct |
-,in |
| R714 |
T6705 |
T6703 |
pobj |
frame,in |
| R715 |
T6566 |
T6564 |
compound |
point,score |
| R716 |
T6706 |
T6701 |
prep |
of,deletion |
| R717 |
T6707 |
T6708 |
nummod |
18,bp |
| R718 |
T6708 |
T6706 |
pobj |
bp,of |
| R719 |
T6567 |
T6566 |
punct |
-,point |
| R720 |
T6709 |
T6701 |
prep |
within,deletion |
| R721 |
T6568 |
T6564 |
compound |
LOD,score |
| R722 |
T6710 |
T6709 |
pobj |
exon,within |
| R723 |
T6711 |
T6710 |
nummod |
36,exon |
| R724 |
T6712 |
T6713 |
punct |
(,Δ18 |
| R725 |
T6713 |
T6701 |
parataxis |
Δ18,deletion |
| R726 |
T6569 |
T6564 |
prep |
of,score |
| R727 |
T6714 |
T6713 |
compound |
Itpr1Δ18,Δ18 |
| R728 |
T6715 |
T6713 |
punct |
/,Δ18 |
| R729 |
T6716 |
T6713 |
punct |
),Δ18 |
| R730 |
T6570 |
T6569 |
pobj |
5.13,of |
| R731 |
T6717 |
T6676 |
punct |
.,revealed |
| R732 |
T6719 |
T6720 |
aux |
To,confirm |
| R733 |
T6571 |
T6564 |
prep |
at,score |
| R734 |
T6720 |
T6721 |
advcl |
confirm,crossed |
| R735 |
T6722 |
T6723 |
det |
the,pathogenicity |
| R736 |
T6572 |
T6573 |
compound |
marker,20.MMHAP85FLG2 |
| R737 |
T6723 |
T6720 |
dobj |
pathogenicity,confirm |
| R738 |
T6724 |
T6723 |
prep |
of,pathogenicity |
| R739 |
T6725 |
T6726 |
det |
this,mutation |
| R740 |
T6573 |
T6571 |
pobj |
20.MMHAP85FLG2,at |
| R741 |
T6726 |
T6724 |
pobj |
mutation,of |
| R742 |
T6727 |
T6721 |
nsubj |
we,crossed |
| R743 |
T6574 |
T6573 |
prep |
on,20.MMHAP85FLG2 |
| R744 |
T6728 |
T6729 |
amod |
heterozygous,mice |
| R745 |
T6729 |
T6721 |
dobj |
mice,crossed |
| R746 |
T6730 |
T6729 |
prep |
from,mice |
| R747 |
T6731 |
T6732 |
det |
the,study |
| R748 |
T6575 |
T6576 |
compound |
Chromosome,6qE1 |
| R749 |
T6732 |
T6730 |
pobj |
study,from |
| R750 |
T6733 |
T6732 |
amod |
current,study |
| R751 |
T6576 |
T6574 |
pobj |
6qE1,on |
| R752 |
T6734 |
T6735 |
punct |
(,Δ18 |
| R753 |
T6735 |
T6730 |
parataxis |
Δ18,from |
| R754 |
T6736 |
T6735 |
compound |
Itpr1wt,Δ18 |
| R755 |
T6737 |
T6735 |
punct |
/,Δ18 |
| R756 |
T6577 |
T6548 |
punct |
.,showed |
| R757 |
T6738 |
T6735 |
punct |
),Δ18 |
| R758 |
T6739 |
T6721 |
prep |
with,crossed |
| R759 |
T6789 |
T6787 |
cc |
and,Δ18 |
| R760 |
T6740 |
T6739 |
pobj |
mice,with |
| R761 |
T6741 |
T6740 |
amod |
heterozygous,mice |
| R762 |
T6742 |
T6741 |
prep |
for,heterozygous |
| R763 |
T6743 |
T6744 |
det |
the,mutation |
| R764 |
T6744 |
T6742 |
pobj |
mutation,for |
| R765 |
T6745 |
T6744 |
compound |
opt,mutation |
| R766 |
T6746 |
T6747 |
punct |
(,opt |
| R767 |
T6747 |
T6740 |
parataxis |
opt,mice |
| R768 |
T6748 |
T6747 |
compound |
Itpr1wt,opt |
| R769 |
T6749 |
T6747 |
punct |
/,opt |
| R770 |
T6790 |
T6791 |
compound |
Itpr1opt,opt |
| R771 |
T6750 |
T6747 |
punct |
),opt |
| R772 |
T6751 |
T6721 |
punct |
.,crossed |
| R773 |
T6791 |
T6787 |
conj |
opt,Δ18 |
| R774 |
T6753 |
T6754 |
nsubj |
This,resulted |
| R775 |
T6755 |
T6754 |
prep |
in,resulted |
| R776 |
T6792 |
T6791 |
punct |
/,opt |
| R777 |
T6756 |
T6757 |
nummod |
two,litters |
| R778 |
T6757 |
T6755 |
pobj |
litters,in |
| R779 |
T6758 |
T6757 |
prep |
of,litters |
| R780 |
T6793 |
T6794 |
punct |
[,1 |
| R781 |
T6759 |
T6758 |
pobj |
mice,of |
| R782 |
T6760 |
T6757 |
prep |
with,litters |
| R783 |
T6761 |
T6762 |
det |
a,total |
| R784 |
T6794 |
T6754 |
parataxis |
1,resulted |
| R785 |
T6762 |
T6760 |
pobj |
total,with |
| R786 |
T6795 |
T6794 |
punct |
],1 |
| R787 |
T6763 |
T6762 |
prep |
of,total |
| R788 |
T6796 |
T6754 |
punct |
.,resulted |
| R789 |
T6764 |
T6765 |
nummod |
four,pups |
| R790 |
T6765 |
T6763 |
pobj |
pups,of |
| R791 |
T6766 |
T6765 |
amod |
affected,pups |
| R792 |
T6798 |
T6799 |
advmod |
Furthermore,was |
| R793 |
T6767 |
T6768 |
compound |
Itpr1opt,Δ18 |
| R794 |
T6768 |
T6765 |
compound |
Δ18,pups |
| R795 |
T6769 |
T6768 |
punct |
/,Δ18 |
| R796 |
T6770 |
T6762 |
punct |
(,total |
| R797 |
T6800 |
T6799 |
punct |
", ",was |
| R798 |
T6771 |
T6762 |
prep |
from,total |
| R799 |
T6772 |
T6773 |
det |
a,total |
| R800 |
T6773 |
T6771 |
pobj |
total,from |
| R801 |
T6801 |
T6802 |
det |
this,phenotype |
| R802 |
T6774 |
T6773 |
prep |
of,total |
| R803 |
T6775 |
T6774 |
pobj |
15,of |
| R804 |
T6776 |
T6762 |
punct |
),total |
| R805 |
T6802 |
T6799 |
nsubj |
phenotype,was |
| R806 |
T6777 |
T6762 |
prep |
with,total |
| R807 |
T6778 |
T6779 |
det |
a,phenotype |
| R808 |
T6779 |
T6777 |
pobj |
phenotype,with |
| R809 |
T6803 |
T6799 |
acomp |
similar,was |
| R810 |
T6780 |
T6779 |
amod |
indistinguishable,phenotype |
| R811 |
T6781 |
T6780 |
prep |
from,indistinguishable |
| R812 |
T6782 |
T6781 |
pobj |
that,from |
| R813 |
T6783 |
T6782 |
prep |
of,that |
| R814 |
T6784 |
T6785 |
det |
the,mice |
| R815 |
T6785 |
T6783 |
pobj |
mice,of |
| R816 |
T6804 |
T6799 |
punct |
", ",was |
| R817 |
T6786 |
T6787 |
nmod |
Itpr1Δ18,Δ18 |
| R818 |
T6787 |
T6785 |
nmod |
Δ18,mice |
| R819 |
T6788 |
T6787 |
punct |
/,Δ18 |
| R820 |
T6805 |
T6806 |
mark |
although,severe |
| R821 |
T6806 |
T6799 |
advcl |
severe,was |
| R822 |
T6807 |
T6806 |
advmod |
less,severe |
| R823 |
T6895 |
T6896 |
det |
the,mouse |
| R824 |
T6808 |
T6799 |
punct |
", ",was |
| R825 |
T6896 |
T6894 |
pobj |
mouse,in |
| R826 |
T6897 |
T6898 |
npadvmod |
Itpr1,deficient |
| R827 |
T6898 |
T6896 |
amod |
deficient,mouse |
| R828 |
T6809 |
T6799 |
prep |
to,was |
| R829 |
T6899 |
T6898 |
punct |
-,deficient |
| R830 |
T6810 |
T6809 |
pobj |
that,to |
| R831 |
T6900 |
T6901 |
punct |
[,4 |
| R832 |
T6901 |
T6896 |
parataxis |
4,mouse |
| R833 |
T6902 |
T6901 |
punct |
],4 |
| R834 |
T6811 |
T6810 |
acl |
described,that |
| R835 |
T6903 |
T6896 |
acl |
generated,mouse |
| R836 |
T6904 |
T6903 |
prep |
by,generated |
| R837 |
T6905 |
T6906 |
compound |
gene,targeting |
| R838 |
T6906 |
T6904 |
pobj |
targeting,by |
| R839 |
T6812 |
T6811 |
prep |
in,described |
| R840 |
T6907 |
T6885 |
punct |
", ",associated |
| R841 |
T6908 |
T6909 |
amod |
decreased,expression |
| R842 |
T6813 |
T6814 |
det |
a,line |
| R843 |
T6909 |
T6885 |
nsubjpass |
expression,associated |
| R844 |
T6910 |
T6909 |
compound |
Itpr1,expression |
| R845 |
T6911 |
T6885 |
auxpass |
is,associated |
| R846 |
T6814 |
T6812 |
pobj |
line,in |
| R847 |
T6912 |
T6885 |
prep |
with,associated |
| R848 |
T6913 |
T6914 |
det |
the,disorder |
| R849 |
T6914 |
T6912 |
pobj |
disorder,with |
| R850 |
T6915 |
T6914 |
amod |
same,disorder |
| R851 |
T6815 |
T6814 |
compound |
mouse,line |
| R852 |
T6916 |
T6914 |
amod |
autosomal,disorder |
| R853 |
T6917 |
T6914 |
amod |
recessive,disorder |
| R854 |
T6816 |
T6814 |
prep |
with,line |
| R855 |
T6918 |
T6914 |
compound |
movement,disorder |
| R856 |
T6919 |
T6920 |
punct |
(,Figure |
| R857 |
T6920 |
T6885 |
parataxis |
Figure,associated |
| R858 |
T6921 |
T6920 |
nummod |
1,Figure |
| R859 |
T6817 |
T6818 |
amod |
targeted,deletion |
| R860 |
T6922 |
T6920 |
punct |
),Figure |
| R861 |
T6923 |
T6885 |
punct |
.,associated |
| R862 |
T6818 |
T6816 |
pobj |
deletion,with |
| R863 |
T6925 |
T6926 |
prep |
Given,sought |
| R864 |
T6927 |
T6928 |
poss |
our,interest |
| R865 |
T6928 |
T6925 |
pobj |
interest,Given |
| R866 |
T6929 |
T6928 |
prep |
in,interest |
| R867 |
T6930 |
T6931 |
amod |
human,disease |
| R868 |
T6819 |
T6818 |
prep |
of,deletion |
| R869 |
T6931 |
T6929 |
pobj |
disease,in |
| R870 |
T6932 |
T6931 |
amod |
neurological,disease |
| R871 |
T6820 |
T6819 |
pobj |
Itpr1,of |
| R872 |
T6821 |
T6820 |
punct |
", ",Itpr1 |
| R873 |
T6933 |
T6926 |
nsubj |
we,sought |
| R874 |
T6934 |
T6935 |
aux |
to,identify |
| R875 |
T6822 |
T6823 |
advmod |
where,described |
| R876 |
T6823 |
T6820 |
relcl |
described,Itpr1 |
| R877 |
T6935 |
T6926 |
xcomp |
identify,sought |
| R878 |
T6824 |
T6823 |
nsubjpass |
ataxia,described |
| R879 |
T6936 |
T6937 |
det |
any,disorders |
| R880 |
T6937 |
T6935 |
dobj |
disorders,identify |
| R881 |
T6825 |
T6823 |
auxpass |
was,described |
| R882 |
T6938 |
T6937 |
amod |
cognate,disorders |
| R883 |
T6939 |
T6937 |
amod |
human,disorders |
| R884 |
T6826 |
T6823 |
prep |
as,described |
| R885 |
T6940 |
T6941 |
advmod |
where,established |
| R886 |
T6827 |
T6828 |
det |
a,feature |
| R887 |
T6941 |
T6937 |
advcl |
established,disorders |
| R888 |
T6942 |
T6941 |
nsubjpass |
linkage,established |
| R889 |
T6943 |
T6941 |
aux |
had,established |
| R890 |
T6828 |
T6826 |
pobj |
feature,as |
| R891 |
T6944 |
T6941 |
auxpass |
been,established |
| R892 |
T6945 |
T6941 |
prep |
to,established |
| R893 |
T6829 |
T6828 |
amod |
prominent,feature |
| R894 |
T6946 |
T6947 |
det |
the,region |
| R895 |
T6947 |
T6945 |
pobj |
region,to |
| R896 |
T6948 |
T6947 |
amod |
syntenic,region |
| R897 |
T6830 |
T6831 |
punct |
[,4 |
| R898 |
T6949 |
T6947 |
prep |
of,region |
| R899 |
T6950 |
T6951 |
det |
the,genome |
| R900 |
T6951 |
T6949 |
pobj |
genome,of |
| R901 |
T6831 |
T6799 |
parataxis |
4,was |
| R902 |
T6952 |
T6951 |
amod |
human,genome |
| R903 |
T6953 |
T6941 |
punct |
", ",established |
| R904 |
T6954 |
T6941 |
cc |
but,established |
| R905 |
T6832 |
T6831 |
punct |
],4 |
| R906 |
T6955 |
T6956 |
advmod |
where,identified |
| R907 |
T6956 |
T6941 |
conj |
identified,established |
| R908 |
T6833 |
T6799 |
punct |
.,was |
| R909 |
T6957 |
T6958 |
det |
no,mutation |
| R910 |
T6958 |
T6956 |
nsubjpass |
mutation,identified |
| R911 |
T6959 |
T6958 |
amod |
causal,mutation |
| R912 |
T6835 |
T6836 |
prep |
As,results |
| R913 |
T6960 |
T6956 |
aux |
had,identified |
| R914 |
T6961 |
T6956 |
auxpass |
been,identified |
| R915 |
T6962 |
T6926 |
punct |
.,sought |
| R916 |
T6837 |
T6835 |
prep |
with,As |
| R917 |
T6964 |
T6965 |
nsubjpass |
SCA15,linked |
| R918 |
T6966 |
T6964 |
punct |
", ",SCA15 |
| R919 |
T6967 |
T6968 |
det |
an,ataxia |
| R920 |
T6968 |
T6964 |
appos |
ataxia,SCA15 |
| R921 |
T6969 |
T6970 |
amod |
adult,onset |
| R922 |
T6970 |
T6968 |
nmod |
onset,ataxia |
| R923 |
T6838 |
T6839 |
det |
the,mice |
| R924 |
T6971 |
T6970 |
punct |
-,onset |
| R925 |
T6972 |
T6973 |
amod |
autosomal,dominant |
| R926 |
T6973 |
T6968 |
amod |
dominant,ataxia |
| R927 |
T6839 |
T6837 |
pobj |
mice,with |
| R928 |
T6974 |
T6968 |
amod |
progressive,ataxia |
| R929 |
T6975 |
T6965 |
auxpass |
is,linked |
| R930 |
T6976 |
T6965 |
prep |
to,linked |
| R931 |
T6840 |
T6841 |
compound |
Itpr1opt,opt |
| R932 |
T6977 |
T6978 |
det |
this,locus |
| R933 |
T6978 |
T6976 |
pobj |
locus,to |
| R934 |
T6841 |
T6839 |
compound |
opt,mice |
| R935 |
T6979 |
T6980 |
punct |
[,5 |
| R936 |
T6980 |
T6965 |
parataxis |
5,linked |
| R937 |
T6842 |
T6841 |
punct |
/,opt |
| R938 |
T6981 |
T6980 |
punct |
],5 |
| R939 |
T6982 |
T6965 |
punct |
.,linked |
| R940 |
T6843 |
T6839 |
punct |
", ",mice |
| R941 |
T6984 |
T6985 |
mark |
Although,ruled |
| R942 |
T6985 |
T6993 |
advcl |
ruled,led |
| R943 |
T6986 |
T6987 |
compound |
missense,mutation |
| R944 |
T6844 |
T6845 |
advmod |
where,predicted |
| R945 |
T6987 |
T6985 |
nsubjpass |
mutation,ruled |
| R946 |
T6988 |
T6987 |
prep |
of,mutation |
| R947 |
T6989 |
T6988 |
pobj |
ITPR1,of |
| R948 |
T6845 |
T6839 |
relcl |
predicted,mice |
| R949 |
T6990 |
T6985 |
aux |
had,ruled |
| R950 |
T6991 |
T6985 |
advmod |
previously,ruled |
| R951 |
T6992 |
T6985 |
auxpass |
been,ruled |
| R952 |
T6846 |
T6847 |
det |
the,deletion |
| R953 |
T6994 |
T6985 |
prt |
out,ruled |
| R954 |
T6995 |
T6996 |
punct |
[,2 |
| R955 |
T6847 |
T6845 |
nsubjpass |
deletion,predicted |
| R956 |
T6996 |
T6985 |
parataxis |
2,ruled |
| R957 |
T6997 |
T6996 |
punct |
],2 |
| R958 |
T6998 |
T6985 |
cc |
and,ruled |
| R959 |
T6848 |
T6847 |
prep |
of,deletion |
| R960 |
T6999 |
T7000 |
det |
the,mode |
| R961 |
T7000 |
T7001 |
nsubj |
mode,was |
| R962 |
T6849 |
T6850 |
nmod |
exons,43 |
| R963 |
T6850 |
T6848 |
pobj |
43,of |
| R964 |
T7001 |
T6985 |
conj |
was,ruled |
| R965 |
T6851 |
T6850 |
cc |
and,43 |
| R966 |
T7002 |
T7000 |
prep |
of,mode |
| R967 |
T7003 |
T7002 |
pobj |
inheritance,of |
| R968 |
T7004 |
T7001 |
acomp |
inconsistent,was |
| R969 |
T7005 |
T7004 |
prep |
with,inconsistent |
| R970 |
T7006 |
T7005 |
pobj |
that,with |
| R971 |
T7007 |
T7006 |
acl |
seen,that |
| R972 |
T6852 |
T6850 |
conj |
44,43 |
| R973 |
T7008 |
T7007 |
prep |
in,seen |
| R974 |
T7009 |
T7010 |
det |
the,mice |
| R975 |
T7010 |
T7008 |
pobj |
mice,in |
| R976 |
T6853 |
T6845 |
auxpass |
is,predicted |
| R977 |
T7011 |
T7010 |
nmod |
Itpr1Δ18,mice |
| R978 |
T7012 |
T7011 |
cc |
and,Itpr1Δ18 |
| R979 |
T7013 |
T7011 |
conj |
Itpr1opt,Itpr1Δ18 |
| R980 |
T6854 |
T6845 |
advmod |
also,predicted |
| R981 |
T7014 |
T6993 |
punct |
", ",led |
| R982 |
T7015 |
T7016 |
det |
the,presence |
| R983 |
T7016 |
T6993 |
nsubj |
presence,led |
| R984 |
T6855 |
T6856 |
aux |
to,leave |
| R985 |
T7017 |
T7016 |
amod |
phenotypic,presence |
| R986 |
T6856 |
T6845 |
xcomp |
leave,predicted |
| R987 |
T6857 |
T6858 |
det |
the,frame |
| R988 |
T7018 |
T7016 |
prep |
of,presence |
| R989 |
T7019 |
T7018 |
pobj |
ataxia,of |
| R990 |
T6858 |
T6856 |
dobj |
frame,leave |
| R991 |
T7020 |
T7016 |
prep |
in,presence |
| R992 |
T7021 |
T7022 |
det |
the,mice |
| R993 |
T6859 |
T6858 |
amod |
translational,frame |
| R994 |
T7022 |
T7020 |
pobj |
mice,in |
| R995 |
T7023 |
T6993 |
dobj |
us,led |
| R996 |
T6860 |
T6858 |
compound |
reading,frame |
| R997 |
T7024 |
T7025 |
aux |
to,reexamine |
| R998 |
T7025 |
T6993 |
xcomp |
reexamine,led |
| R999 |
T7026 |
T7027 |
det |
this,gene |
| R1000 |
T6861 |
T6856 |
oprd |
unaffected,leave |
| R1001 |
T7027 |
T7025 |
dobj |
gene,reexamine |
| R1002 |
T7028 |
T7027 |
compound |
candidate,gene |
| R1003 |
T6862 |
T6836 |
punct |
", ",results |
| R1004 |
T7029 |
T7025 |
prep |
as,reexamine |
| R1005 |
T7030 |
T7031 |
det |
a,cause |
| R1006 |
T7031 |
T7029 |
pobj |
cause,as |
| R1007 |
T6863 |
T6864 |
det |
the,mutation |
| R1008 |
T7032 |
T7031 |
amod |
possible,cause |
| R1009 |
T7033 |
T7031 |
prep |
of,cause |
| R1010 |
T6864 |
T6836 |
nsubj |
mutation,results |
| R1011 |
T7034 |
T7033 |
pobj |
SCA15,of |
| R1012 |
T7035 |
T6993 |
punct |
.,led |
| R1013 |
T6865 |
T6864 |
nmod |
in,mutation |
| R1014 |
T7037 |
T7038 |
nsubj |
We,obtained |
| R1015 |
T7039 |
T7040 |
amod |
genomic,DNA |
| R1016 |
T6866 |
T6865 |
punct |
-,in |
| R1017 |
T7040 |
T7038 |
dobj |
DNA,obtained |
| R1018 |
T7041 |
T7038 |
prep |
from,obtained |
| R1019 |
T7042 |
T7043 |
nummod |
three,members |
| R1020 |
T6867 |
T6865 |
pobj |
frame,in |
| R1021 |
T7043 |
T7041 |
pobj |
members,from |
| R1022 |
T7044 |
T7043 |
amod |
affected,members |
| R1023 |
T7045 |
T7043 |
compound |
family,members |
| R1024 |
T7046 |
T7043 |
cc |
and,members |
| R1025 |
T7047 |
T7048 |
nummod |
one,member |
| R1026 |
T7048 |
T7043 |
conj |
member,members |
| R1027 |
T6868 |
T6869 |
compound |
Itpr1Δ18,Δ18 |
| R1028 |
T7049 |
T7048 |
compound |
family,member |
| R1029 |
T7050 |
T7048 |
prep |
with,member |
| R1030 |
T7051 |
T7052 |
amod |
unknown,status |
| R1031 |
T6869 |
T6864 |
compound |
Δ18,mutation |
| R1032 |
T7052 |
T7050 |
pobj |
status,with |
| R1033 |
T7053 |
T7052 |
compound |
disease,status |
| R1034 |
T7054 |
T7043 |
prep |
from,members |
| R1035 |
T6870 |
T6869 |
punct |
/,Δ18 |
| R1036 |
T7055 |
T7056 |
det |
the,kindred |
| R1037 |
T7056 |
T7054 |
pobj |
kindred,from |
| R1038 |
T6871 |
T6864 |
compound |
deletion,mutation |
| R1039 |
T7057 |
T7058 |
advmod |
originally,used |
| R1040 |
T7058 |
T7056 |
acl |
used,kindred |
| R1041 |
T7059 |
T7060 |
aux |
to,define |
| R1042 |
T6872 |
T6836 |
prep |
in,results |
| R1043 |
T7060 |
T7058 |
advcl |
define,used |
| R1044 |
T7061 |
T7060 |
cc |
and,define |
| R1045 |
T7062 |
T7060 |
conj |
map,define |
| R1046 |
T6873 |
T6874 |
advmod |
markedly,decreased |
| R1047 |
T7063 |
T7062 |
dobj |
SCA15,map |
| R1048 |
T7064 |
T7065 |
punct |
(,AUS1 |
| R1049 |
T7065 |
T7063 |
parataxis |
AUS1,SCA15 |
| R1050 |
T6874 |
T6875 |
amod |
decreased,levels |
| R1051 |
T7066 |
T7065 |
compound |
family,AUS1 |
| R1052 |
T7067 |
T7065 |
punct |
", ",AUS1 |
| R1053 |
T7068 |
T7065 |
prep |
of,AUS1 |
| R1054 |
T6875 |
T6872 |
pobj |
levels,in |
| R1055 |
T7069 |
T7070 |
amod |
Australian,origin |
| R1056 |
T7070 |
T7068 |
pobj |
origin,of |
| R1057 |
T7071 |
T7072 |
advmod |
Anglo,Celtic |
| R1058 |
T6876 |
T6875 |
prep |
of,levels |
| R1059 |
T7072 |
T7070 |
amod |
Celtic,origin |
| R1060 |
T7073 |
T7072 |
punct |
-,Celtic |
| R1061 |
T7074 |
T7065 |
punct |
),AUS1 |
| R1062 |
T6877 |
T6876 |
pobj |
Itpr1,of |
| R1063 |
T7075 |
T7076 |
punct |
[,2 |
| R1064 |
T7076 |
T7038 |
parataxis |
2,obtained |
| R1065 |
T7077 |
T7076 |
punct |
],2 |
| R1066 |
T6878 |
T6836 |
prep |
in,results |
| R1067 |
T7078 |
T7038 |
punct |
.,obtained |
| R1068 |
T6879 |
T6880 |
amod |
cerebellar,cells |
| R1069 |
T7080 |
T7081 |
nsubj |
We,performed |
| R1070 |
T7082 |
T7083 |
nummod |
two,experiments |
| R1071 |
T6880 |
T6878 |
pobj |
cells,in |
| R1072 |
T7083 |
T7081 |
dative |
experiments,performed |
| R1073 |
T7084 |
T7081 |
advmod |
concurrently,performed |
| R1074 |
T7085 |
T7081 |
prep |
in,performed |
| R1075 |
T7086 |
T7087 |
nummod |
three,members |
| R1076 |
T7087 |
T7085 |
pobj |
members,in |
| R1077 |
T7088 |
T7087 |
amod |
affected,members |
| R1078 |
T6881 |
T6880 |
compound |
Purkinje,cells |
| R1079 |
T7089 |
T7087 |
prep |
of,members |
| R1080 |
T7090 |
T7091 |
det |
this,family |
| R1081 |
T7091 |
T7089 |
pobj |
family,of |
| R1082 |
T6882 |
T6836 |
punct |
.,results |
| R1083 |
T7092 |
T7081 |
punct |
: ,performed |
| R1084 |
T7093 |
T7094 |
compound |
sequence,analysis |
| R1085 |
T7094 |
T7081 |
dobj |
analysis,performed |
| R1086 |
T6884 |
T6885 |
prep |
In,associated |
| R1087 |
T7095 |
T7094 |
prep |
of,analysis |
| R1088 |
T7096 |
T7097 |
det |
the,exons |
| R1089 |
T7097 |
T7095 |
pobj |
exons,of |
| R1090 |
T7098 |
T7097 |
amod |
coding,exons |
| R1091 |
T6886 |
T6887 |
det |
these,mutants |
| R1092 |
T7099 |
T7097 |
prep |
of,exons |
| R1093 |
T7100 |
T7099 |
pobj |
ITPR1,of |
| R1094 |
T7101 |
T7094 |
cc |
and,analysis |
| R1095 |
T7102 |
T7103 |
amod |
high,density |
| R1096 |
T6887 |
T6884 |
pobj |
mutants,In |
| R1097 |
T6888 |
T6887 |
nummod |
two,mutants |
| R1098 |
T7103 |
T7105 |
nmod |
density,genotyping |
| R1099 |
T7104 |
T7103 |
punct |
-,density |
| R1100 |
T6889 |
T6887 |
amod |
spontaneous,mutants |
| R1101 |
T7105 |
T7094 |
conj |
genotyping,analysis |
| R1102 |
T7106 |
T7105 |
nmod |
genome,genotyping |
| R1103 |
T6890 |
T6891 |
punct |
[,1 |
| R1104 |
T6891 |
T6887 |
parataxis |
1,mutants |
| R1105 |
T6892 |
T6891 |
punct |
],1 |
| R1106 |
T7107 |
T7106 |
punct |
-,genome |
| R1107 |
T7108 |
T7106 |
amod |
wide,genome |
| R1108 |
T7109 |
T7105 |
compound |
SNP,genotyping |
| R1109 |
T6893 |
T6884 |
cc |
and,In |
| R1110 |
T7110 |
T7081 |
punct |
.,performed |
| R1111 |
T6894 |
T6884 |
conj |
in,In |
| R1112 |
T7112 |
T7113 |
compound |
Sequence,analysis |
| R1113 |
T7113 |
T7114 |
nsubj |
analysis,failed |
| R1114 |
T7213 |
T7212 |
compound |
affection,status |
| R1115 |
T7115 |
T7116 |
aux |
to,show |
| R1116 |
T7116 |
T7114 |
xcomp |
show,failed |
| R1117 |
T7117 |
T7118 |
det |
any,alterations |
| R1118 |
T7118 |
T7116 |
dobj |
alterations,show |
| R1119 |
T7214 |
T7215 |
punct |
(,Figure |
| R1120 |
T7119 |
T7118 |
compound |
coding,alterations |
| R1121 |
T7120 |
T7118 |
acl |
segregating,alterations |
| R1122 |
T7121 |
T7120 |
prep |
with,segregating |
| R1123 |
T7215 |
T7195 |
parataxis |
Figure,was |
| R1124 |
T7122 |
T7121 |
pobj |
disease,with |
| R1125 |
T7123 |
T7122 |
cc |
or,disease |
| R1126 |
T7124 |
T7125 |
det |
any,alterations |
| R1127 |
T7125 |
T7122 |
conj |
alterations,disease |
| R1128 |
T7126 |
T7127 |
dep |
that,were |
| R1129 |
T7216 |
T7215 |
nummod |
3,Figure |
| R1130 |
T7127 |
T7125 |
relcl |
were,alterations |
| R1131 |
T7128 |
T7127 |
acomp |
inconsistent,were |
| R1132 |
T7129 |
T7128 |
prep |
with,inconsistent |
| R1133 |
T7217 |
T7215 |
punct |
),Figure |
| R1134 |
T7130 |
T7131 |
amod |
Mendelian,patterns |
| R1135 |
T7131 |
T7129 |
pobj |
patterns,with |
| R1136 |
T7132 |
T7131 |
prep |
of,patterns |
| R1137 |
T7218 |
T7195 |
punct |
.,was |
| R1138 |
T7133 |
T7132 |
pobj |
inheritance,of |
| R1139 |
T7134 |
T7131 |
prep |
within,patterns |
| R1140 |
T7135 |
T7136 |
det |
the,family |
| R1141 |
T7220 |
T7221 |
det |
The,data |
| R1142 |
T7136 |
T7134 |
pobj |
family,within |
| R1143 |
T7137 |
T7114 |
punct |
.,failed |
| R1144 |
T7139 |
T7140 |
advmod |
However,showed |
| R1145 |
T7221 |
T7223 |
nsubj |
data,showed |
| R1146 |
T7141 |
T7140 |
punct |
", ",showed |
| R1147 |
T7222 |
T7221 |
compound |
SNP,data |
| R1148 |
T7142 |
T7140 |
nsubj |
visualization,showed |
| R1149 |
T7143 |
T7142 |
prep |
of,visualization |
| R1150 |
T7144 |
T7145 |
compound |
log,R |
| R1151 |
T7223 |
T7224 |
ccomp |
showed,allowed |
| R1152 |
T7145 |
T7146 |
compound |
R,ratio |
| R1153 |
T7146 |
T7143 |
pobj |
ratio,of |
| R1154 |
T7147 |
T7146 |
cc |
and,ratio |
| R1155 |
T7225 |
T7226 |
det |
a,deletion |
| R1156 |
T7148 |
T7149 |
compound |
B,allele |
| R1157 |
T7149 |
T7150 |
compound |
allele,metrics |
| R1158 |
T7150 |
T7146 |
conj |
metrics,ratio |
| R1159 |
T7226 |
T7223 |
dobj |
deletion,showed |
| R1160 |
T7151 |
T7150 |
compound |
frequency,metrics |
| R1161 |
T7152 |
T7150 |
prep |
from,metrics |
| R1162 |
T7153 |
T7154 |
det |
the,experiments |
| R1163 |
T7227 |
T7226 |
prep |
of,deletion |
| R1164 |
T7154 |
T7152 |
pobj |
experiments,from |
| R1165 |
T7155 |
T7156 |
npadvmod |
genome,wide |
| R1166 |
T7156 |
T7154 |
amod |
wide,experiments |
| R1167 |
T7228 |
T7227 |
prep |
between,of |
| R1168 |
T7157 |
T7156 |
punct |
-,wide |
| R1169 |
T7158 |
T7154 |
compound |
SNP,experiments |
| R1170 |
T7159 |
T7154 |
compound |
genotyping,experiments |
| R1171 |
T7229 |
T7230 |
nummod |
188,kb |
| R1172 |
T7160 |
T7140 |
advmod |
clearly,showed |
| R1173 |
T7161 |
T7140 |
dobj |
data,showed |
| R1174 |
T7230 |
T7228 |
pobj |
kb,between |
| R1175 |
T7162 |
T7161 |
amod |
consistent,data |
| R1176 |
T7163 |
T7162 |
prep |
with,consistent |
| R1177 |
T7164 |
T7165 |
det |
a,deletion |
| R1178 |
T7165 |
T7163 |
pobj |
deletion,with |
| R1179 |
T7166 |
T7165 |
amod |
heterozygous,deletion |
| R1180 |
T7167 |
T7165 |
amod |
genomic,deletion |
| R1181 |
T7231 |
T7230 |
cc |
and,kb |
| R1182 |
T7168 |
T7165 |
prep |
across,deletion |
| R1183 |
T7169 |
T7170 |
det |
the,third |
| R1184 |
T7170 |
T7168 |
pobj |
third,across |
| R1185 |
T7171 |
T7170 |
amod |
first,third |
| R1186 |
T7232 |
T7233 |
nummod |
210,kb |
| R1187 |
T7172 |
T7170 |
nummod |
one,third |
| R1188 |
T7173 |
T7170 |
punct |
-,third |
| R1189 |
T7174 |
T7170 |
prep |
of,third |
| R1190 |
T7233 |
T7230 |
conj |
kb,kb |
| R1191 |
T7175 |
T7174 |
pobj |
ITPR1,of |
| R1192 |
T7176 |
T7168 |
cc |
and,across |
| R1193 |
T7177 |
T7168 |
conj |
across,across |
| R1194 |
T7234 |
T7230 |
prep |
in,kb |
| R1195 |
T7178 |
T7179 |
det |
the,half |
| R1196 |
T7179 |
T7177 |
pobj |
half,across |
| R1197 |
T7180 |
T7179 |
amod |
first,half |
| R1198 |
T7235 |
T7234 |
pobj |
size,in |
| R1199 |
T7181 |
T7179 |
prep |
of,half |
| R1200 |
T7182 |
T7183 |
det |
a,gene |
| R1201 |
T7183 |
T7181 |
pobj |
gene,of |
| R1202 |
T7236 |
T7224 |
punct |
;,allowed |
| R1203 |
T7184 |
T7183 |
amod |
neighboring,gene |
| R1204 |
T7185 |
T7183 |
punct |
", ",gene |
| R1205 |
T7186 |
T7183 |
appos |
SUMF1,gene |
| R1206 |
T7237 |
T7224 |
nsubj |
examination,allowed |
| R1207 |
T7187 |
T7188 |
punct |
(,Figure |
| R1208 |
T7238 |
T7237 |
prep |
of,examination |
| R1209 |
T7239 |
T7238 |
pobj |
SNPs,of |
| R1210 |
T7188 |
T7140 |
parataxis |
Figure,showed |
| R1211 |
T7240 |
T7239 |
prep |
at,SNPs |
| R1212 |
T7189 |
T7188 |
nummod |
2,Figure |
| R1213 |
T7190 |
T7188 |
punct |
),Figure |
| R1214 |
T7191 |
T7140 |
punct |
.,showed |
| R1215 |
T7241 |
T7242 |
det |
the,regions |
| R1216 |
T7193 |
T7194 |
det |
This,deletion |
| R1217 |
T7242 |
T7240 |
pobj |
regions,at |
| R1218 |
T7194 |
T7195 |
nsubj |
deletion,was |
| R1219 |
T7243 |
T7242 |
amod |
flanking,regions |
| R1220 |
T7196 |
T7195 |
acomp |
apparent,was |
| R1221 |
T7197 |
T7196 |
prep |
in,apparent |
| R1222 |
T7244 |
T7242 |
amod |
unknown,regions |
| R1223 |
T7198 |
T7199 |
det |
all,members |
| R1224 |
T7245 |
T7242 |
prep |
of,regions |
| R1225 |
T7199 |
T7197 |
pobj |
members,in |
| R1226 |
T7200 |
T7199 |
nummod |
three,members |
| R1227 |
T7201 |
T7199 |
amod |
affected,members |
| R1228 |
T7246 |
T7247 |
det |
this,deletion |
| R1229 |
T7202 |
T7199 |
compound |
family,members |
| R1230 |
T7203 |
T7199 |
acl |
studied,members |
| R1231 |
T7204 |
T7196 |
cc |
and,apparent |
| R1232 |
T7205 |
T7196 |
conj |
absent,apparent |
| R1233 |
T7206 |
T7205 |
prep |
from,absent |
| R1234 |
T7207 |
T7208 |
det |
the,member |
| R1235 |
T7247 |
T7245 |
pobj |
deletion,of |
| R1236 |
T7208 |
T7206 |
pobj |
member,from |
| R1237 |
T7209 |
T7208 |
compound |
family,member |
| R1238 |
T7248 |
T7249 |
nsubj |
us,delimit |
| R1239 |
T7210 |
T7208 |
prep |
with,member |
| R1240 |
T7211 |
T7212 |
amod |
unknown,status |
| R1241 |
T7212 |
T7210 |
pobj |
status,with |
| R1242 |
T7249 |
T7224 |
ccomp |
delimit,allowed |
| R1243 |
T7250 |
T7249 |
aux |
to,delimit |
| R1244 |
T7251 |
T7252 |
det |
the,borders |
| R1245 |
T7252 |
T7249 |
dobj |
borders,delimit |
| R1246 |
T7253 |
T7252 |
prep |
of,borders |
| R1247 |
T7319 |
T7317 |
compound |
genotyping,chip |
| R1248 |
T7254 |
T7255 |
det |
the,deletion |
| R1249 |
T7320 |
T7317 |
punct |
", ",chip |
| R1250 |
T7321 |
T7317 |
prep |
from,chip |
| R1251 |
T7255 |
T7253 |
pobj |
deletion,of |
| R1252 |
T7322 |
T7323 |
nummod |
577,individuals |
| R1253 |
T7323 |
T7321 |
pobj |
individuals,from |
| R1254 |
T7256 |
T7249 |
prep |
to,delimit |
| R1255 |
T7324 |
T7323 |
prep |
of,individuals |
| R1256 |
T7325 |
T7326 |
amod |
European,descent |
| R1257 |
T7326 |
T7324 |
pobj |
descent,of |
| R1258 |
T7257 |
T7258 |
nummod |
7.5,kb |
| R1259 |
T7327 |
T7328 |
dep |
who,were |
| R1260 |
T7328 |
T7323 |
relcl |
were,individuals |
| R1261 |
T7329 |
T7330 |
preconj |
either,controls |
| R1262 |
T7258 |
T7256 |
pobj |
kb,to |
| R1263 |
T7330 |
T7328 |
attr |
controls,were |
| R1264 |
T7331 |
T7330 |
cc |
or,controls |
| R1265 |
T7332 |
T7330 |
conj |
individuals,controls |
| R1266 |
T7259 |
T7258 |
prep |
on,kb |
| R1267 |
T7333 |
T7332 |
prep |
with,individuals |
| R1268 |
T7334 |
T7335 |
det |
an,disorder |
| R1269 |
T7260 |
T7261 |
det |
the,side |
| R1270 |
T7335 |
T7333 |
pobj |
disorder,with |
| R1271 |
T7336 |
T7335 |
amod |
unrelated,disorder |
| R1272 |
T7337 |
T7335 |
amod |
neurological,disorder |
| R1273 |
T7261 |
T7259 |
pobj |
side,on |
| R1274 |
T7338 |
T7292 |
punct |
.,analyzed |
| R1275 |
T7262 |
T7261 |
amod |
telomeric,side |
| R1276 |
T7340 |
T7341 |
nsubj |
We,failed |
| R1277 |
T7341 |
T7342 |
ccomp |
failed,identify |
| R1278 |
T7263 |
T7261 |
prep |
of,side |
| R1279 |
T7343 |
T7344 |
aux |
to,find |
| R1280 |
T7344 |
T7341 |
xcomp |
find,failed |
| R1281 |
T7345 |
T7346 |
det |
any,deletions |
| R1282 |
T7346 |
T7344 |
dobj |
deletions,find |
| R1283 |
T7347 |
T7346 |
acl |
affecting,deletions |
| R1284 |
T7264 |
T7265 |
det |
the,deletion |
| R1285 |
T7348 |
T7349 |
det |
the,sequence |
| R1286 |
T7349 |
T7347 |
dobj |
sequence,affecting |
| R1287 |
T7350 |
T7349 |
compound |
coding,sequence |
| R1288 |
T7265 |
T7263 |
pobj |
deletion,of |
| R1289 |
T7351 |
T7349 |
prep |
of,sequence |
| R1290 |
T7352 |
T7353 |
det |
either,gene |
| R1291 |
T7353 |
T7351 |
pobj |
gene,of |
| R1292 |
T7266 |
T7261 |
punct |
(,side |
| R1293 |
T7354 |
T7353 |
punct |
", ",gene |
| R1294 |
T7355 |
T7353 |
appos |
ITPR1,gene |
| R1295 |
T7356 |
T7355 |
cc |
or,ITPR1 |
| R1296 |
T7267 |
T7261 |
prep |
between,side |
| R1297 |
T7357 |
T7355 |
conj |
SUMF1,ITPR1 |
| R1298 |
T7268 |
T7267 |
pobj |
rs12634249,between |
| R1299 |
T7358 |
T7342 |
punct |
;,identify |
| R1300 |
T7269 |
T7268 |
cc |
and,rs12634249 |
| R1301 |
T7359 |
T7342 |
nsubj |
we,identify |
| R1302 |
T7360 |
T7342 |
aux |
did,identify |
| R1303 |
T7361 |
T7342 |
punct |
", ",identify |
| R1304 |
T7270 |
T7268 |
conj |
rs793396,rs12634249 |
| R1305 |
T7362 |
T7342 |
advmod |
however,identify |
| R1306 |
T7363 |
T7342 |
punct |
", ",identify |
| R1307 |
T7364 |
T7365 |
det |
a,individual |
| R1308 |
T7271 |
T7261 |
punct |
),side |
| R1309 |
T7365 |
T7342 |
dobj |
individual,identify |
| R1310 |
T7366 |
T7365 |
amod |
single,individual |
| R1311 |
T7272 |
T7258 |
cc |
and,kb |
| R1312 |
T7367 |
T7365 |
prep |
with,individual |
| R1313 |
T7368 |
T7369 |
det |
a,deletion |
| R1314 |
T7273 |
T7274 |
punct |
~,14.4 |
| R1315 |
T7369 |
T7367 |
pobj |
deletion,with |
| R1316 |
T7370 |
T7369 |
amod |
possible,deletion |
| R1317 |
T7371 |
T7369 |
amod |
heterozygous,deletion |
| R1318 |
T7274 |
T7275 |
nummod |
14.4,kb |
| R1319 |
T7372 |
T7373 |
advmod |
approximately,6 |
| R1320 |
T7373 |
T7374 |
nummod |
6,kb |
| R1321 |
T7374 |
T7369 |
npadvmod |
kb,deletion |
| R1322 |
T7275 |
T7258 |
conj |
kb,kb |
| R1323 |
T7375 |
T7374 |
prep |
in,kb |
| R1324 |
T7376 |
T7375 |
pobj |
size,in |
| R1325 |
T7377 |
T7369 |
prep |
within,deletion |
| R1326 |
T7276 |
T7275 |
prep |
on,kb |
| R1327 |
T7378 |
T7379 |
nmod |
intron,40 |
| R1328 |
T7379 |
T7377 |
pobj |
40,within |
| R1329 |
T7277 |
T7278 |
det |
the,side |
| R1330 |
T7380 |
T7381 |
punct |
–,41 |
| R1331 |
T7381 |
T7379 |
prep |
41,40 |
| R1332 |
T7382 |
T7379 |
prep |
of,40 |
| R1333 |
T7383 |
T7382 |
pobj |
ITPR1,of |
| R1334 |
T7384 |
T7379 |
punct |
", ",40 |
| R1335 |
T7385 |
T7386 |
advmod |
at,5 |
| R1336 |
T7278 |
T7276 |
pobj |
side,on |
| R1337 |
T7386 |
T7388 |
nummod |
5,kb |
| R1338 |
T7387 |
T7386 |
advmod |
least,5 |
| R1339 |
T7388 |
T7389 |
npadvmod |
kb,away |
| R1340 |
T7279 |
T7278 |
amod |
centromeric,side |
| R1341 |
T7389 |
T7379 |
advmod |
away,40 |
| R1342 |
T7390 |
T7389 |
prep |
from,away |
| R1343 |
T7391 |
T7390 |
pobj |
exon,from |
| R1344 |
T7280 |
T7278 |
prep |
of,side |
| R1345 |
T7392 |
T7391 |
nummod |
40,exon |
| R1346 |
T7393 |
T7342 |
punct |
.,identify |
| R1347 |
T7281 |
T7282 |
det |
the,deletion |
| R1348 |
T7395 |
T7396 |
prep |
Given,is |
| R1349 |
T7282 |
T7280 |
pobj |
deletion,of |
| R1350 |
T7397 |
T7398 |
det |
the,location |
| R1351 |
T7398 |
T7395 |
pobj |
location,Given |
| R1352 |
T7283 |
T7278 |
punct |
(,side |
| R1353 |
T7399 |
T7398 |
prep |
of,location |
| R1354 |
T7400 |
T7401 |
det |
this,alteration |
| R1355 |
T7401 |
T7399 |
pobj |
alteration,of |
| R1356 |
T7284 |
T7278 |
prep |
between,side |
| R1357 |
T7402 |
T7396 |
nsubj |
it,is |
| R1358 |
T7403 |
T7396 |
acomp |
unlikely,is |
| R1359 |
T7404 |
T7405 |
aux |
to,effect |
| R1360 |
T7285 |
T7284 |
pobj |
rs4073665,between |
| R1361 |
T7405 |
T7403 |
xcomp |
effect,unlikely |
| R1362 |
T7406 |
T7407 |
det |
the,expression |
| R1363 |
T7407 |
T7405 |
dobj |
expression,effect |
| R1364 |
T7286 |
T7285 |
cc |
and,rs4073665 |
| R1365 |
T7408 |
T7407 |
cc |
or,expression |
| R1366 |
T7409 |
T7407 |
conj |
splicing,expression |
| R1367 |
T7410 |
T7407 |
prep |
of,expression |
| R1368 |
T7287 |
T7285 |
conj |
rs17709863,rs4073665 |
| R1369 |
T7411 |
T7410 |
pobj |
ITPR1,of |
| R1370 |
T7412 |
T7396 |
punct |
.,is |
| R1371 |
T7288 |
T7278 |
punct |
),side |
| R1372 |
T7414 |
T7415 |
prep |
In,performed |
| R1373 |
T7289 |
T7224 |
punct |
.,allowed |
| R1374 |
T7416 |
T7417 |
det |
an,attempt |
| R1375 |
T7417 |
T7414 |
pobj |
attempt,In |
| R1376 |
T7291 |
T7292 |
prep |
In,analyzed |
| R1377 |
T7418 |
T7419 |
aux |
to,map |
| R1378 |
T7419 |
T7417 |
acl |
map,attempt |
| R1379 |
T7420 |
T7419 |
advmod |
fine,map |
| R1380 |
T7421 |
T7419 |
punct |
-,map |
| R1381 |
T7293 |
T7294 |
det |
an,attempt |
| R1382 |
T7422 |
T7423 |
det |
the,breakpoints |
| R1383 |
T7423 |
T7419 |
dobj |
breakpoints,map |
| R1384 |
T7424 |
T7423 |
prep |
of,breakpoints |
| R1385 |
T7425 |
T7426 |
det |
the,deletion |
| R1386 |
T7294 |
T7291 |
pobj |
attempt,In |
| R1387 |
T7295 |
T7296 |
aux |
to,define |
| R1388 |
T7426 |
T7424 |
pobj |
deletion,of |
| R1389 |
T7296 |
T7294 |
acl |
define,attempt |
| R1390 |
T7427 |
T7428 |
npadvmod |
disease,causing |
| R1391 |
T7428 |
T7426 |
amod |
causing,deletion |
| R1392 |
T7297 |
T7298 |
mark |
whether,was |
| R1393 |
T7429 |
T7428 |
punct |
-,causing |
| R1394 |
T7430 |
T7415 |
nsubj |
we,performed |
| R1395 |
T7431 |
T7432 |
det |
a,series |
| R1396 |
T7298 |
T7296 |
ccomp |
was,define |
| R1397 |
T7432 |
T7415 |
dobj |
series,performed |
| R1398 |
T7433 |
T7432 |
prep |
of,series |
| R1399 |
T7299 |
T7300 |
det |
this,variation |
| R1400 |
T7434 |
T7433 |
pobj |
experiments,of |
| R1401 |
T7435 |
T7434 |
acl |
designed,experiments |
| R1402 |
T7436 |
T7437 |
aux |
to,refine |
| R1403 |
T7437 |
T7435 |
advcl |
refine,designed |
| R1404 |
T7300 |
T7298 |
nsubj |
variation,was |
| R1405 |
T7438 |
T7439 |
det |
the,intervals |
| R1406 |
T7439 |
T7437 |
dobj |
intervals,refine |
| R1407 |
T7301 |
T7302 |
det |
a,polymorphism |
| R1408 |
T7440 |
T7439 |
amod |
unknown,intervals |
| R1409 |
T7441 |
T7437 |
prep |
at,refine |
| R1410 |
T7442 |
T7443 |
det |
the,edges |
| R1411 |
T7302 |
T7298 |
attr |
polymorphism,was |
| R1412 |
T7303 |
T7302 |
amod |
benign,polymorphism |
| R1413 |
T7443 |
T7441 |
pobj |
edges,at |
| R1414 |
T7444 |
T7443 |
prep |
between,edges |
| R1415 |
T7304 |
T7292 |
nsubj |
we,analyzed |
| R1416 |
T7445 |
T7446 |
amod |
definite,deleted |
| R1417 |
T7446 |
T7447 |
amod |
deleted,sequences |
| R1418 |
T7305 |
T7306 |
npadvmod |
genome,wide |
| R1419 |
T7447 |
T7444 |
pobj |
sequences,between |
| R1420 |
T7448 |
T7446 |
cc |
and,deleted |
| R1421 |
T7449 |
T7450 |
amod |
definite,diploid |
| R1422 |
T7306 |
T7308 |
amod |
wide,data |
| R1423 |
T7450 |
T7446 |
conj |
diploid,deleted |
| R1424 |
T7451 |
T7415 |
punct |
.,performed |
| R1425 |
T7307 |
T7306 |
punct |
-,wide |
| R1426 |
T7453 |
T7454 |
det |
These,data |
| R1427 |
T7308 |
T7292 |
dobj |
data,analyzed |
| R1428 |
T7454 |
T7455 |
nsubj |
data,narrowed |
| R1429 |
T7309 |
T7308 |
compound |
SNP,data |
| R1430 |
T7456 |
T7457 |
det |
the,borders |
| R1431 |
T7457 |
T7455 |
dobj |
borders,narrowed |
| R1432 |
T7458 |
T7457 |
amod |
unknown,borders |
| R1433 |
T7310 |
T7308 |
prep |
at,data |
| R1434 |
T7459 |
T7455 |
prep |
to,narrowed |
| R1435 |
T7460 |
T7461 |
punct |
~,4 |
| R1436 |
T7311 |
T7312 |
det |
this,locus |
| R1437 |
T7461 |
T7462 |
nummod |
4,kb |
| R1438 |
T7462 |
T7459 |
pobj |
kb,to |
| R1439 |
T7463 |
T7462 |
prep |
on,kb |
| R1440 |
T7464 |
T7465 |
det |
the,side |
| R1441 |
T7465 |
T7463 |
pobj |
side,on |
| R1442 |
T7466 |
T7465 |
amod |
telomeric,side |
| R1443 |
T7312 |
T7310 |
pobj |
locus,at |
| R1444 |
T7467 |
T7462 |
cc |
and,kb |
| R1445 |
T7468 |
T7469 |
punct |
~,7 |
| R1446 |
T7469 |
T7470 |
nummod |
7,kb |
| R1447 |
T7313 |
T7308 |
punct |
", ",data |
| R1448 |
T7470 |
T7462 |
conj |
kb,kb |
| R1449 |
T7471 |
T7470 |
prep |
on,kb |
| R1450 |
T7472 |
T7473 |
det |
the,side |
| R1451 |
T7314 |
T7308 |
acl |
produced,data |
| R1452 |
T7473 |
T7471 |
pobj |
side,on |
| R1453 |
T7474 |
T7473 |
amod |
centromeric,side |
| R1454 |
T7315 |
T7314 |
advcl |
using,produced |
| R1455 |
T7475 |
T7455 |
punct |
.,narrowed |
| R1456 |
T7477 |
T7478 |
nsubj |
We,used |
| R1457 |
T7316 |
T7317 |
det |
the,chip |
| R1458 |
T7479 |
T7480 |
det |
all,combinations |
| R1459 |
T7317 |
T7315 |
dobj |
chip,using |
| R1460 |
T7480 |
T7478 |
dobj |
combinations,used |
| R1461 |
T7481 |
T7480 |
amod |
possible,combinations |
| R1462 |
T7482 |
T7480 |
prep |
of,combinations |
| R1463 |
T7318 |
T7317 |
amod |
same,chip |
| R1464 |
T7483 |
T7484 |
amod |
forward,orientation |
| R1465 |
T7484 |
T7485 |
compound |
orientation,primers |
| R1466 |
T7485 |
T7482 |
pobj |
primers,of |
| R1467 |
T7533 |
T7534 |
amod |
more,200 |
| R1468 |
T7486 |
T7485 |
acl |
designed,primers |
| R1469 |
T7487 |
T7486 |
prep |
within,designed |
| R1470 |
T7488 |
T7489 |
det |
the,boundary |
| R1471 |
T7489 |
T7487 |
pobj |
boundary,within |
| R1472 |
T7534 |
T7536 |
nummod |
200,kb |
| R1473 |
T7490 |
T7491 |
advmod |
newly,defined |
| R1474 |
T7491 |
T7489 |
amod |
defined,boundary |
| R1475 |
T7492 |
T7489 |
amod |
telomeric,boundary |
| R1476 |
T7493 |
T7482 |
cc |
and,of |
| R1477 |
T7535 |
T7534 |
quantmod |
than,200 |
| R1478 |
T7494 |
T7482 |
conj |
of,of |
| R1479 |
T7495 |
T7496 |
amod |
reverse,orientation |
| R1480 |
T7496 |
T7497 |
compound |
orientation,primers |
| R1481 |
T7536 |
T7537 |
npadvmod |
kb,apart |
| R1482 |
T7497 |
T7494 |
pobj |
primers,of |
| R1483 |
T7498 |
T7497 |
acl |
designed,primers |
| R1484 |
T7537 |
T7531 |
advmod |
apart,be |
| R1485 |
T7499 |
T7498 |
prep |
within,designed |
| R1486 |
T7500 |
T7501 |
det |
the,boundary |
| R1487 |
T7501 |
T7499 |
pobj |
boundary,within |
| R1488 |
T7538 |
T7523 |
punct |
", ",were |
| R1489 |
T7502 |
T7503 |
advmod |
newly,defined |
| R1490 |
T7503 |
T7501 |
amod |
defined,boundary |
| R1491 |
T7504 |
T7501 |
amod |
centromeric,boundary |
| R1492 |
T7505 |
T7478 |
prep |
in,used |
| R1493 |
T7506 |
T7507 |
compound |
PCR,assays |
| R1494 |
T7507 |
T7505 |
pobj |
assays,in |
| R1495 |
T7539 |
T7523 |
nsubj |
we,were |
| R1496 |
T7508 |
T7478 |
prep |
in,used |
| R1497 |
T7509 |
T7510 |
det |
an,attempt |
| R1498 |
T7510 |
T7508 |
pobj |
attempt,in |
| R1499 |
T7511 |
T7512 |
aux |
to,amplify |
| R1500 |
T7512 |
T7510 |
acl |
amplify,attempt |
| R1501 |
T7540 |
T7523 |
acomp |
able,were |
| R1502 |
T7513 |
T7512 |
prep |
across,amplify |
| R1503 |
T7514 |
T7515 |
det |
the,deletion |
| R1504 |
T7515 |
T7513 |
pobj |
deletion,across |
| R1505 |
T7541 |
T7542 |
aux |
to,amplify |
| R1506 |
T7516 |
T7515 |
prep |
in,deletion |
| R1507 |
T7517 |
T7518 |
amod |
affected,members |
| R1508 |
T7518 |
T7516 |
pobj |
members,in |
| R1509 |
T7542 |
T7540 |
xcomp |
amplify,able |
| R1510 |
T7519 |
T7518 |
compound |
family,members |
| R1511 |
T7520 |
T7478 |
punct |
.,used |
| R1512 |
T7543 |
T7544 |
det |
a,fragment |
| R1513 |
T7522 |
T7523 |
advcl |
Using,were |
| R1514 |
T7544 |
T7542 |
dobj |
fragment,amplify |
| R1515 |
T7524 |
T7525 |
compound |
PCR,primers |
| R1516 |
T7525 |
T7522 |
dobj |
primers,Using |
| R1517 |
T7526 |
T7525 |
appos |
T3F,primers |
| R1518 |
T7545 |
T7546 |
nummod |
953,bp |
| R1519 |
T7527 |
T7526 |
cc |
and,T3F |
| R1520 |
T7528 |
T7526 |
conj |
C11R,T3F |
| R1521 |
T7546 |
T7544 |
npadvmod |
bp,fragment |
| R1522 |
T7529 |
T7525 |
punct |
", ",primers |
| R1523 |
T7547 |
T7546 |
prep |
in,bp |
| R1524 |
T7530 |
T7531 |
dep |
which,be |
| R1525 |
T7531 |
T7525 |
relcl |
be,primers |
| R1526 |
T7548 |
T7547 |
pobj |
size,in |
| R1527 |
T7532 |
T7531 |
aux |
should,be |
| R1528 |
T7549 |
T7542 |
advcl |
using,amplify |
| R1529 |
T7550 |
T7549 |
dobj |
DNA,using |
| R1530 |
T7551 |
T7550 |
prep |
from,DNA |
| R1531 |
T7552 |
T7551 |
pobj |
each,from |
| R1532 |
T7639 |
T7638 |
pobj |
SCA15,of |
| R1533 |
T7640 |
T7630 |
nsubj |
we,analyzed |
| R1534 |
T7641 |
T7642 |
nummod |
two,families |
| R1535 |
T7553 |
T7552 |
prep |
of,each |
| R1536 |
T7642 |
T7630 |
dobj |
families,analyzed |
| R1537 |
T7643 |
T7642 |
amod |
additional,families |
| R1538 |
T7644 |
T7642 |
prep |
with,families |
| R1539 |
T7554 |
T7555 |
det |
the,members |
| R1540 |
T7645 |
T7646 |
det |
an,ataxia |
| R1541 |
T7646 |
T7644 |
pobj |
ataxia,with |
| R1542 |
T7647 |
T7646 |
amod |
inherited,ataxia |
| R1543 |
T7648 |
T7646 |
amod |
cerebellar,ataxia |
| R1544 |
T7649 |
T7646 |
amod |
similar,ataxia |
| R1545 |
T7555 |
T7553 |
pobj |
members,of |
| R1546 |
T7650 |
T7649 |
prep |
to,similar |
| R1547 |
T7651 |
T7650 |
pobj |
that,to |
| R1548 |
T7652 |
T7651 |
acl |
described,that |
| R1549 |
T7556 |
T7555 |
nummod |
three,members |
| R1550 |
T7653 |
T7652 |
prep |
in,described |
| R1551 |
T7654 |
T7655 |
det |
the,family |
| R1552 |
T7655 |
T7653 |
pobj |
family,in |
| R1553 |
T7557 |
T7555 |
amod |
affected,members |
| R1554 |
T7656 |
T7655 |
compound |
AUS1,family |
| R1555 |
T7657 |
T7652 |
punct |
", ",described |
| R1556 |
T7658 |
T7652 |
dep |
ascertained,described |
| R1557 |
T7558 |
T7555 |
compound |
family,members |
| R1558 |
T7659 |
T7658 |
prep |
through,ascertained |
| R1559 |
T7660 |
T7661 |
compound |
neurology,clinics |
| R1560 |
T7559 |
T7549 |
prep |
as,using |
| R1561 |
T7661 |
T7659 |
pobj |
clinics,through |
| R1562 |
T7662 |
T7661 |
prep |
in,clinics |
| R1563 |
T7663 |
T7662 |
pobj |
London,in |
| R1564 |
T7560 |
T7559 |
pobj |
template,as |
| R1565 |
T7664 |
T7663 |
punct |
", ",London |
| R1566 |
T7665 |
T7666 |
compound |
United,Kingdom |
| R1567 |
T7561 |
T7523 |
punct |
.,were |
| R1568 |
T7666 |
T7663 |
npadvmod |
Kingdom,London |
| R1569 |
T7667 |
T7630 |
punct |
.,analyzed |
| R1570 |
T7563 |
T7564 |
nsubj |
Sequencing,revealed |
| R1571 |
T7669 |
T7670 |
nsubjpass |
DNA,analyzed |
| R1572 |
T7671 |
T7669 |
acl |
extracted,DNA |
| R1573 |
T7672 |
T7671 |
prep |
from,extracted |
| R1574 |
T7565 |
T7563 |
prep |
of,Sequencing |
| R1575 |
T7673 |
T7672 |
pobj |
probands,from |
| R1576 |
T7674 |
T7673 |
prep |
from,probands |
| R1577 |
T7675 |
T7676 |
det |
these,families |
| R1578 |
T7676 |
T7674 |
pobj |
families,from |
| R1579 |
T7566 |
T7567 |
det |
this,fragment |
| R1580 |
T7677 |
T7676 |
nummod |
two,families |
| R1581 |
T7678 |
T7679 |
punct |
(,H33 |
| R1582 |
T7567 |
T7565 |
pobj |
fragment,of |
| R1583 |
T7679 |
T7676 |
parataxis |
H33,families |
| R1584 |
T7680 |
T7679 |
compound |
family,H33 |
| R1585 |
T7681 |
T7679 |
cc |
and,H33 |
| R1586 |
T7568 |
T7569 |
det |
a,deletion |
| R1587 |
T7682 |
T7683 |
compound |
family,H27 |
| R1588 |
T7683 |
T7679 |
conj |
H27,H33 |
| R1589 |
T7684 |
T7679 |
punct |
),H33 |
| R1590 |
T7569 |
T7564 |
dobj |
deletion,revealed |
| R1591 |
T7685 |
T7670 |
auxpass |
were,analyzed |
| R1592 |
T7686 |
T7670 |
advmod |
also,analyzed |
| R1593 |
T7687 |
T7670 |
advcl |
using,analyzed |
| R1594 |
T7688 |
T7689 |
compound |
Illumina,HumanHap550 |
| R1595 |
T7689 |
T7691 |
compound |
HumanHap550,chips |
| R1596 |
T7690 |
T7689 |
compound |
Infinium,HumanHap550 |
| R1597 |
T7691 |
T7687 |
dobj |
chips,using |
| R1598 |
T7570 |
T7569 |
prep |
of,deletion |
| R1599 |
T7692 |
T7691 |
compound |
genotyping,chips |
| R1600 |
T7693 |
T7670 |
punct |
.,analyzed |
| R1601 |
T7571 |
T7572 |
nummod |
"201,509",bp |
| R1602 |
T7695 |
T7696 |
det |
These,experiments |
| R1603 |
T7696 |
T7697 |
nsubj |
experiments,showed |
| R1604 |
T7572 |
T7570 |
pobj |
bp,of |
| R1605 |
T7698 |
T7697 |
dobj |
deletion,showed |
| R1606 |
T7699 |
T7697 |
prep |
at,showed |
| R1607 |
T7573 |
T7574 |
punct |
(,S3 |
| R1608 |
T7700 |
T7701 |
det |
the,locus |
| R1609 |
T7574 |
T7564 |
parataxis |
S3,revealed |
| R1610 |
T7701 |
T7699 |
pobj |
locus,at |
| R1611 |
T7575 |
T7574 |
compound |
Figure,S3 |
| R1612 |
T7702 |
T7701 |
compound |
SCA15,locus |
| R1613 |
T7703 |
T7697 |
prep |
in,showed |
| R1614 |
T7704 |
T7705 |
det |
all,members |
| R1615 |
T7576 |
T7574 |
punct |
),S3 |
| R1616 |
T7705 |
T7703 |
pobj |
members,in |
| R1617 |
T7706 |
T7705 |
amod |
affected,members |
| R1618 |
T7577 |
T7564 |
punct |
", ",revealed |
| R1619 |
T7578 |
T7564 |
advcl |
removing,revealed |
| R1620 |
T7707 |
T7705 |
acl |
assayed,members |
| R1621 |
T7708 |
T7705 |
punct |
", ",members |
| R1622 |
T7579 |
T7580 |
det |
the,three |
| R1623 |
T7709 |
T7705 |
prep |
from,members |
| R1624 |
T7710 |
T7709 |
pobj |
SUMF1,from |
| R1625 |
T7580 |
T7578 |
dobj |
three,removing |
| R1626 |
T7711 |
T7709 |
prep |
through,from |
| R1627 |
T7712 |
T7711 |
pobj |
ITPR1,through |
| R1628 |
T7581 |
T7580 |
amod |
first,three |
| R1629 |
T7713 |
T7697 |
punct |
.,showed |
| R1630 |
T7582 |
T7580 |
prep |
of,three |
| R1631 |
T7715 |
T7716 |
det |
These,mutations |
| R1632 |
T7716 |
T7717 |
nsubj |
mutations,segregated |
| R1633 |
T7583 |
T7584 |
det |
the,exons |
| R1634 |
T7718 |
T7717 |
prep |
with,segregated |
| R1635 |
T7719 |
T7718 |
pobj |
disease,with |
| R1636 |
T7720 |
T7719 |
prep |
in,disease |
| R1637 |
T7584 |
T7582 |
pobj |
exons,of |
| R1638 |
T7721 |
T7722 |
det |
these,families |
| R1639 |
T7722 |
T7720 |
pobj |
families,in |
| R1640 |
T7585 |
T7584 |
nummod |
nine,exons |
| R1641 |
T7723 |
T7722 |
nummod |
two,families |
| R1642 |
T7724 |
T7725 |
punct |
(,S3 |
| R1643 |
T7725 |
T7717 |
parataxis |
S3,segregated |
| R1644 |
T7586 |
T7584 |
prep |
of,exons |
| R1645 |
T7726 |
T7725 |
compound |
Figure,S3 |
| R1646 |
T7727 |
T7725 |
punct |
),S3 |
| R1647 |
T7728 |
T7717 |
punct |
.,segregated |
| R1648 |
T7730 |
T7731 |
det |
A,strategy |
| R1649 |
T7731 |
T7732 |
nsubj |
strategy,enabled |
| R1650 |
T7587 |
T7586 |
pobj |
SUMF1,of |
| R1651 |
T7733 |
T7731 |
amod |
similar,strategy |
| R1652 |
T7734 |
T7733 |
prep |
to,similar |
| R1653 |
T7588 |
T7580 |
cc |
and,three |
| R1654 |
T7735 |
T7736 |
det |
the,one |
| R1655 |
T7736 |
T7734 |
pobj |
one,to |
| R1656 |
T7737 |
T7736 |
acl |
outlined,one |
| R1657 |
T7589 |
T7590 |
det |
the,ten |
| R1658 |
T7738 |
T7737 |
advmod |
above,outlined |
| R1659 |
T7739 |
T7732 |
dobj |
us,enabled |
| R1660 |
T7740 |
T7741 |
aux |
to,sequence |
| R1661 |
T7590 |
T7580 |
conj |
ten,three |
| R1662 |
T7741 |
T7732 |
xcomp |
sequence,enabled |
| R1663 |
T7742 |
T7741 |
prep |
over,sequence |
| R1664 |
T7743 |
T7744 |
det |
the,breakpoint |
| R1665 |
T7591 |
T7590 |
amod |
first,ten |
| R1666 |
T7744 |
T7742 |
pobj |
breakpoint,over |
| R1667 |
T7592 |
T7590 |
prep |
of,ten |
| R1668 |
T7593 |
T7594 |
det |
the,exons |
| R1669 |
T7745 |
T7741 |
prep |
in,sequence |
| R1670 |
T7594 |
T7592 |
pobj |
exons,of |
| R1671 |
T7746 |
T7747 |
compound |
family,H27 |
| R1672 |
T7747 |
T7745 |
pobj |
H27,in |
| R1673 |
T7748 |
T7747 |
cc |
but,H27 |
| R1674 |
T7595 |
T7594 |
nummod |
58,exons |
| R1675 |
T7749 |
T7748 |
neg |
not,but |
| R1676 |
T7750 |
T7751 |
compound |
family,H33 |
| R1677 |
T7596 |
T7594 |
prep |
of,exons |
| R1678 |
T7751 |
T7747 |
conj |
H33,H27 |
| R1679 |
T7752 |
T7732 |
punct |
.,enabled |
| R1680 |
T7597 |
T7596 |
pobj |
ITPR1,of |
| R1681 |
T7754 |
T7755 |
prep |
In,spans |
| R1682 |
T7755 |
T7761 |
ccomp |
spans,estimate |
| R1683 |
T7756 |
T7757 |
det |
the,former |
| R1684 |
T7598 |
T7564 |
punct |
.,revealed |
| R1685 |
T7757 |
T7754 |
pobj |
former,In |
| R1686 |
T7758 |
T7755 |
punct |
", ",spans |
| R1687 |
T7759 |
T7760 |
det |
the,deletion |
| R1688 |
T7600 |
T7601 |
nsubj |
We,were |
| R1689 |
T7760 |
T7755 |
nsubj |
deletion,spans |
| R1690 |
T7762 |
T7763 |
nummod |
"344,408",bp |
| R1691 |
T7763 |
T7755 |
dobj |
bp,spans |
| R1692 |
T7602 |
T7601 |
acomp |
unable,were |
| R1693 |
T7764 |
T7755 |
punct |
", ",spans |
| R1694 |
T7765 |
T7755 |
advcl |
removing,spans |
| R1695 |
T7766 |
T7767 |
nmod |
exons,1 |
| R1696 |
T7767 |
T7765 |
dobj |
1,removing |
| R1697 |
T7603 |
T7604 |
aux |
to,amplify |
| R1698 |
T7768 |
T7769 |
punct |
–,3 |
| R1699 |
T7769 |
T7767 |
prep |
3,1 |
| R1700 |
T7770 |
T7767 |
prep |
of,1 |
| R1701 |
T7771 |
T7770 |
pobj |
SUMF1,of |
| R1702 |
T7772 |
T7767 |
cc |
and,1 |
| R1703 |
T7773 |
T7767 |
conj |
1,1 |
| R1704 |
T7604 |
T7602 |
xcomp |
amplify,unable |
| R1705 |
T7774 |
T7775 |
punct |
–,44 |
| R1706 |
T7775 |
T7773 |
prep |
44,1 |
| R1707 |
T7776 |
T7773 |
prep |
of,1 |
| R1708 |
T7605 |
T7606 |
det |
the,fragment |
| R1709 |
T7777 |
T7776 |
pobj |
ITPR1,of |
| R1710 |
T7778 |
T7761 |
punct |
;,estimate |
| R1711 |
T7779 |
T7761 |
prep |
in,estimate |
| R1712 |
T7606 |
T7604 |
dobj |
fragment,amplify |
| R1713 |
T7780 |
T7781 |
det |
the,latter |
| R1714 |
T7781 |
T7779 |
pobj |
latter,in |
| R1715 |
T7782 |
T7761 |
punct |
", ",estimate |
| R1716 |
T7607 |
T7608 |
npadvmod |
deletion,specific |
| R1717 |
T7783 |
T7761 |
nsubj |
we,estimate |
| R1718 |
T7784 |
T7785 |
mark |
that,is |
| R1719 |
T7785 |
T7761 |
advcl |
is,estimate |
| R1720 |
T7608 |
T7606 |
amod |
specific,fragment |
| R1721 |
T7786 |
T7787 |
det |
the,deletion |
| R1722 |
T7787 |
T7785 |
nsubj |
deletion,is |
| R1723 |
T7609 |
T7608 |
punct |
-,specific |
| R1724 |
T7788 |
T7789 |
nummod |
310,kb |
| R1725 |
T7610 |
T7606 |
prep |
in,fragment |
| R1726 |
T7789 |
T7785 |
attr |
kb,is |
| R1727 |
T7790 |
T7789 |
prep |
in,kb |
| R1728 |
T7611 |
T7612 |
det |
the,member |
| R1729 |
T7791 |
T7790 |
pobj |
length,in |
| R1730 |
T7792 |
T7785 |
cc |
and,is |
| R1731 |
T7793 |
T7794 |
mark |
that,removes |
| R1732 |
T7612 |
T7610 |
pobj |
member,in |
| R1733 |
T7794 |
T7785 |
conj |
removes,is |
| R1734 |
T7795 |
T7794 |
nsubj |
it,removes |
| R1735 |
T7796 |
T7797 |
nmod |
exons,1 |
| R1736 |
T7613 |
T7612 |
compound |
family,member |
| R1737 |
T7797 |
T7794 |
dobj |
1,removes |
| R1738 |
T7798 |
T7799 |
punct |
–,3 |
| R1739 |
T7614 |
T7612 |
prep |
of,member |
| R1740 |
T7799 |
T7797 |
prep |
3,1 |
| R1741 |
T7800 |
T7797 |
prep |
of,1 |
| R1742 |
T7801 |
T7800 |
pobj |
SUMF1,of |
| R1743 |
T7802 |
T7797 |
cc |
and,1 |
| R1744 |
T7615 |
T7616 |
amod |
unknown,status |
| R1745 |
T7803 |
T7804 |
nmod |
exons,1 |
| R1746 |
T7804 |
T7797 |
conj |
1,1 |
| R1747 |
T7616 |
T7614 |
pobj |
status,of |
| R1748 |
T7805 |
T7806 |
punct |
–,40 |
| R1749 |
T7806 |
T7804 |
prep |
40,1 |
| R1750 |
T7807 |
T7804 |
prep |
of,1 |
| R1751 |
T7808 |
T7807 |
pobj |
ITPR1,of |
| R1752 |
T7809 |
T7761 |
punct |
.,estimate |
| R1753 |
T7617 |
T7616 |
compound |
affection,status |
| R1754 |
T7811 |
T7812 |
det |
The,site |
| R1755 |
T7812 |
T7813 |
nsubj |
site,is |
| R1756 |
T7813 |
T7816 |
ccomp |
is,failed |
| R1757 |
T7618 |
T7610 |
punct |
", ",in |
| R1758 |
T7814 |
T7812 |
prep |
of,site |
| R1759 |
T7815 |
T7814 |
pobj |
mutation,of |
| R1760 |
T7619 |
T7610 |
cc |
or,in |
| R1761 |
T7817 |
T7813 |
prep |
of,is |
| R1762 |
T7818 |
T7817 |
pobj |
interest,of |
| R1763 |
T7819 |
T7813 |
punct |
", ",is |
| R1764 |
T7620 |
T7610 |
conj |
in,in |
| R1765 |
T7820 |
T7821 |
advmod |
particularly,fact |
| R1766 |
T7821 |
T7813 |
npadvmod |
fact,is |
| R1767 |
T7822 |
T7821 |
det |
the,fact |
| R1768 |
T7621 |
T7622 |
nummod |
275,controls |
| R1769 |
T7823 |
T7824 |
mark |
that,anchored |
| R1770 |
T7824 |
T7821 |
acl |
anchored,fact |
| R1771 |
T7825 |
T7824 |
prep |
in,anchored |
| R1772 |
T7622 |
T7620 |
pobj |
controls,in |
| R1773 |
T7826 |
T7825 |
pobj |
each,in |
| R1774 |
T7827 |
T7826 |
prep |
of,each |
| R1775 |
T7828 |
T7829 |
det |
the,families |
| R1776 |
T7623 |
T7624 |
advmod |
neurologically,normal |
| R1777 |
T7829 |
T7827 |
pobj |
families,of |
| R1778 |
T7830 |
T7829 |
nummod |
three,families |
| R1779 |
T7624 |
T7622 |
amod |
normal,controls |
| R1780 |
T7831 |
T7832 |
det |
the,end |
| R1781 |
T7832 |
T7824 |
nsubjpass |
end,anchored |
| R1782 |
T7833 |
T7832 |
amod |
telomeric,end |
| R1783 |
T7625 |
T7601 |
punct |
.,were |
| R1784 |
T7834 |
T7832 |
prep |
of,end |
| R1785 |
T7835 |
T7836 |
det |
the,deletion |
| R1786 |
T7836 |
T7834 |
pobj |
deletion,of |
| R1787 |
T7627 |
T7628 |
aux |
To,establish |
| R1788 |
T7837 |
T7824 |
auxpass |
is,anchored |
| R1789 |
T7838 |
T7824 |
prep |
between,anchored |
| R1790 |
T7839 |
T7840 |
nmod |
exons,3 |
| R1791 |
T7840 |
T7838 |
pobj |
3,between |
| R1792 |
T7628 |
T7630 |
advcl |
establish,analyzed |
| R1793 |
T7841 |
T7840 |
cc |
and,3 |
| R1794 |
T7842 |
T7840 |
conj |
4,3 |
| R1795 |
T7629 |
T7628 |
advmod |
further,establish |
| R1796 |
T7843 |
T7840 |
prep |
of,3 |
| R1797 |
T7844 |
T7843 |
pobj |
SUMF1,of |
| R1798 |
T7845 |
T7816 |
punct |
;,failed |
| R1799 |
T7631 |
T7632 |
amod |
genetic,deletion |
| R1800 |
T7846 |
T7847 |
compound |
sequence,searches |
| R1801 |
T7847 |
T7816 |
nsubj |
searches,failed |
| R1802 |
T7848 |
T7849 |
aux |
to,identify |
| R1803 |
T7849 |
T7816 |
xcomp |
identify,failed |
| R1804 |
T7850 |
T7851 |
det |
any,sequences |
| R1805 |
T7851 |
T7849 |
dobj |
sequences,identify |
| R1806 |
T7632 |
T7628 |
dobj |
deletion,establish |
| R1807 |
T7633 |
T7632 |
prep |
at,deletion |
| R1808 |
T7634 |
T7633 |
pobj |
ITPR1,at |
| R1809 |
T7635 |
T7628 |
prep |
as,establish |
| R1810 |
T7852 |
T7851 |
compound |
repeat,sequences |
| R1811 |
T7853 |
T7854 |
dep |
that,explain |
| R1812 |
T7636 |
T7637 |
det |
the,cause |
| R1813 |
T7854 |
T7851 |
relcl |
explain,sequences |
| R1814 |
T7855 |
T7854 |
aux |
might,explain |
| R1815 |
T7637 |
T7635 |
pobj |
cause,as |
| R1816 |
T7856 |
T7857 |
det |
this,phenomenon |
| R1817 |
T7857 |
T7854 |
dobj |
phenomenon,explain |
| R1818 |
T7858 |
T7816 |
punct |
.,failed |
| R1819 |
T7638 |
T7637 |
prep |
of,cause |
| R1820 |
T7860 |
T7861 |
prep |
With,conclude |
| R1821 |
T7959 |
T7956 |
compound |
sulfatase,deficiency |
| R1822 |
T7862 |
T7863 |
nummod |
three,families |
| R1823 |
T7863 |
T7860 |
pobj |
families,With |
| R1824 |
T7864 |
T7863 |
amod |
cerebellar,families |
| R1825 |
T7865 |
T7863 |
compound |
ataxia,families |
| R1826 |
T7866 |
T7863 |
acl |
segregating,families |
| R1827 |
T7960 |
T7956 |
punct |
", ",deficiency |
| R1828 |
T7867 |
T7868 |
det |
a,deletion |
| R1829 |
T7868 |
T7866 |
dobj |
deletion,segregating |
| R1830 |
T7869 |
T7870 |
compound |
SUMF1,ITPR1 |
| R1831 |
T7961 |
T7962 |
det |
a,disorder |
| R1832 |
T7870 |
T7868 |
compound |
ITPR1,deletion |
| R1833 |
T7962 |
T7956 |
appos |
disorder,deficiency |
| R1834 |
T7871 |
T7870 |
punct |
–,ITPR1 |
| R1835 |
T7872 |
T7863 |
punct |
", ",families |
| R1836 |
T7873 |
T7863 |
cc |
and,families |
| R1837 |
T7963 |
T7962 |
amod |
metabolic,disorder |
| R1838 |
T7964 |
T7962 |
acl |
characterized,disorder |
| R1839 |
T7874 |
T7875 |
det |
this,deletion |
| R1840 |
T7965 |
T7964 |
agent |
by,characterized |
| R1841 |
T7875 |
T7863 |
conj |
deletion,families |
| R1842 |
T7876 |
T7877 |
neg |
not,observed |
| R1843 |
T7966 |
T7965 |
pobj |
hepatosplenomegaly,by |
| R1844 |
T7877 |
T7875 |
acl |
observed,deletion |
| R1845 |
T7878 |
T7877 |
prep |
in,observed |
| R1846 |
T7967 |
T7966 |
punct |
", ",hepatosplenomegaly |
| R1847 |
T7879 |
T7880 |
det |
a,population |
| R1848 |
T7880 |
T7878 |
pobj |
population,in |
| R1849 |
T7881 |
T7880 |
compound |
control,population |
| R1850 |
T7968 |
T7966 |
conj |
deafness,hepatosplenomegaly |
| R1851 |
T7882 |
T7861 |
punct |
", ",conclude |
| R1852 |
T7883 |
T7861 |
nsubj |
we,conclude |
| R1853 |
T7884 |
T7861 |
aux |
may,conclude |
| R1854 |
T7885 |
T7861 |
advmod |
reasonably,conclude |
| R1855 |
T7886 |
T7887 |
mark |
that,is |
| R1856 |
T7887 |
T7861 |
advcl |
is,conclude |
| R1857 |
T7969 |
T7968 |
punct |
", ",deafness |
| R1858 |
T7888 |
T7889 |
det |
the,association |
| R1859 |
T7889 |
T7887 |
nsubj |
association,is |
| R1860 |
T7890 |
T7887 |
acomp |
causal,is |
| R1861 |
T7970 |
T7968 |
cc |
and,deafness |
| R1862 |
T7891 |
T7887 |
punct |
", ",is |
| R1863 |
T7892 |
T7887 |
cc |
and,is |
| R1864 |
T7893 |
T7894 |
mark |
that,is |
| R1865 |
T7971 |
T7972 |
amod |
developmental,delay |
| R1866 |
T7894 |
T7887 |
conj |
is,is |
| R1867 |
T7895 |
T7896 |
det |
the,deletion |
| R1868 |
T7896 |
T7894 |
nsubj |
deletion,is |
| R1869 |
T7972 |
T7968 |
conj |
delay,deafness |
| R1870 |
T7897 |
T7894 |
advmod |
indeed,is |
| R1871 |
T7898 |
T7899 |
det |
the,basis |
| R1872 |
T7973 |
T7974 |
punct |
[,7 |
| R1873 |
T7899 |
T7894 |
attr |
basis,is |
| R1874 |
T7900 |
T7899 |
amod |
genetic,basis |
| R1875 |
T7901 |
T7899 |
prep |
of,basis |
| R1876 |
T7974 |
T7951 |
parataxis |
7,results |
| R1877 |
T7902 |
T7903 |
det |
the,disease |
| R1878 |
T7903 |
T7901 |
pobj |
disease,of |
| R1879 |
T7904 |
T7894 |
punct |
", ",is |
| R1880 |
T7975 |
T7974 |
nummod |
6,7 |
| R1881 |
T7905 |
T7906 |
mark |
with,diagnosis |
| R1882 |
T7906 |
T7894 |
advcl |
diagnosis,is |
| R1883 |
T7976 |
T7974 |
punct |
",",7 |
| R1884 |
T7907 |
T7906 |
nsubj |
SCA15,diagnosis |
| R1885 |
T7908 |
T7906 |
det |
the,diagnosis |
| R1886 |
T7909 |
T7906 |
prep |
in,diagnosis |
| R1887 |
T7977 |
T7974 |
punct |
],7 |
| R1888 |
T7910 |
T7911 |
det |
the,families |
| R1889 |
T7911 |
T7909 |
pobj |
families,in |
| R1890 |
T7912 |
T7911 |
nummod |
two,families |
| R1891 |
T7978 |
T7951 |
punct |
.,results |
| R1892 |
T7913 |
T7911 |
amod |
British,families |
| R1893 |
T7914 |
T7915 |
advmod |
as,as |
| R1894 |
T7915 |
T7911 |
cc |
as,families |
| R1895 |
T7980 |
T7981 |
det |
No,co-occurrence |
| R1896 |
T7916 |
T7915 |
advmod |
well,as |
| R1897 |
T7917 |
T7918 |
det |
the,family |
| R1898 |
T7918 |
T7911 |
conj |
family,families |
| R1899 |
T7919 |
T7918 |
amod |
original,family |
| R1900 |
T7981 |
T7982 |
nsubjpass |
co-occurrence,described |
| R1901 |
T7920 |
T7918 |
amod |
Australian,family |
| R1902 |
T7921 |
T7861 |
punct |
.,conclude |
| R1903 |
T7983 |
T7981 |
prep |
of,co-occurrence |
| R1904 |
T7923 |
T7924 |
nsubj |
It,is |
| R1905 |
T7925 |
T7924 |
acomp |
improbable,is |
| R1906 |
T7926 |
T7927 |
mark |
that,causes |
| R1907 |
T7927 |
T7924 |
ccomp |
causes,is |
| R1908 |
T7928 |
T7927 |
nsubj |
heterozygosity,causes |
| R1909 |
T7984 |
T7983 |
pobj |
ataxia,of |
| R1910 |
T7929 |
T7928 |
prep |
for,heterozygosity |
| R1911 |
T7930 |
T7931 |
det |
the,deletion |
| R1912 |
T7985 |
T7982 |
aux |
has,described |
| R1913 |
T7931 |
T7929 |
pobj |
deletion,for |
| R1914 |
T7932 |
T7931 |
prep |
of,deletion |
| R1915 |
T7933 |
T7932 |
pobj |
SUMF1,of |
| R1916 |
T7934 |
T7928 |
punct |
", ",heterozygosity |
| R1917 |
T7986 |
T7982 |
auxpass |
been,described |
| R1918 |
T7935 |
T7928 |
acl |
encoding,heterozygosity |
| R1919 |
T7936 |
T7937 |
nmod |
sulfatase,factor |
| R1920 |
T7987 |
T7982 |
prep |
in,described |
| R1921 |
T7937 |
T7935 |
dobj |
factor,encoding |
| R1922 |
T7938 |
T7937 |
amod |
modifying,factor |
| R1923 |
T7939 |
T7937 |
nummod |
1,factor |
| R1924 |
T7988 |
T7989 |
punct |
(,parents |
| R1925 |
T7940 |
T7928 |
punct |
", ",heterozygosity |
| R1926 |
T7941 |
T7928 |
prep |
of,heterozygosity |
| R1927 |
T7942 |
T7941 |
pobj |
itself,of |
| R1928 |
T7989 |
T7987 |
pobj |
parents,in |
| R1929 |
T7943 |
T7927 |
cc |
or,causes |
| R1930 |
T7944 |
T7927 |
conj |
contributes,causes |
| R1931 |
T7990 |
T7989 |
amod |
heterozygous,parents |
| R1932 |
T7945 |
T7944 |
prep |
to,contributes |
| R1933 |
T7946 |
T7944 |
dobj |
SCA15,contributes |
| R1934 |
T7947 |
T7924 |
punct |
.,is |
| R1935 |
T7991 |
T7989 |
punct |
),parents |
| R1936 |
T7949 |
T7950 |
amod |
Homozygous,mutation |
| R1937 |
T7950 |
T7951 |
nsubj |
mutation,results |
| R1938 |
T7992 |
T7989 |
prep |
of,parents |
| R1939 |
T7952 |
T7950 |
prep |
of,mutation |
| R1940 |
T7993 |
T7992 |
pobj |
patients,of |
| R1941 |
T7953 |
T7952 |
pobj |
SUMF1,of |
| R1942 |
T7954 |
T7951 |
prep |
in,results |
| R1943 |
T7955 |
T7956 |
amod |
autosomal,deficiency |
| R1944 |
T7994 |
T7993 |
prep |
with,patients |
| R1945 |
T7995 |
T7996 |
amod |
multiple,deficiency |
| R1946 |
T7956 |
T7954 |
pobj |
deficiency,in |
| R1947 |
T7957 |
T7956 |
amod |
recessive,deficiency |
| R1948 |
T7996 |
T7994 |
pobj |
deficiency,with |
| R1949 |
T7958 |
T7956 |
amod |
multiple,deficiency |
| R1950 |
T7997 |
T7996 |
compound |
sulfatase,deficiency |
| R1951 |
T7998 |
T7982 |
punct |
.,described |
| R1952 |
T8000 |
T8001 |
advmod |
Conversely,present |
| R1953 |
T8066 |
T8067 |
prep |
In,revealed |
| R1954 |
T8002 |
T8001 |
punct |
", ",present |
| R1955 |
T8068 |
T8069 |
amod |
further,support |
| R1956 |
T8069 |
T8066 |
pobj |
support,In |
| R1957 |
T8003 |
T8004 |
nsubj |
mutation,is |
| R1958 |
T8070 |
T8069 |
prep |
of,support |
| R1959 |
T8071 |
T8072 |
det |
this,conclusion |
| R1960 |
T8072 |
T8070 |
pobj |
conclusion,of |
| R1961 |
T8073 |
T8067 |
punct |
", ",revealed |
| R1962 |
T8074 |
T8067 |
nsubj |
analysis,revealed |
| R1963 |
T8004 |
T8001 |
ccomp |
is,present |
| R1964 |
T8075 |
T8074 |
prep |
of,analysis |
| R1965 |
T8076 |
T8077 |
compound |
protein,levels |
| R1966 |
T8077 |
T8075 |
pobj |
levels,of |
| R1967 |
T8005 |
T8003 |
prep |
of,mutation |
| R1968 |
T8078 |
T8077 |
prep |
of,levels |
| R1969 |
T8079 |
T8078 |
pobj |
ITPR1,of |
| R1970 |
T8080 |
T8079 |
prep |
in,ITPR1 |
| R1971 |
T8006 |
T8005 |
pobj |
ITPR1,of |
| R1972 |
T8081 |
T8082 |
nmod |
Epstein,Barr |
| R1973 |
T8082 |
T8084 |
nmod |
Barr,virus |
| R1974 |
T8007 |
T8008 |
advmod |
biologically,plausible |
| R1975 |
T8083 |
T8082 |
punct |
-,Barr |
| R1976 |
T8084 |
T8085 |
nmod |
virus,lymphocytes |
| R1977 |
T8085 |
T8080 |
pobj |
lymphocytes,in |
| R1978 |
T8008 |
T8004 |
acomp |
plausible,is |
| R1979 |
T8086 |
T8084 |
punct |
(,virus |
| R1980 |
T8087 |
T8084 |
appos |
EBV,virus |
| R1981 |
T8088 |
T8085 |
punct |
),lymphocytes |
| R1982 |
T8009 |
T8004 |
prep |
as,is |
| R1983 |
T8089 |
T8085 |
amod |
immortalized,lymphocytes |
| R1984 |
T8090 |
T8085 |
prep |
from,lymphocytes |
| R1985 |
T8091 |
T8092 |
amod |
affected,members |
| R1986 |
T8010 |
T8011 |
det |
a,cause |
| R1987 |
T8092 |
T8090 |
pobj |
members,from |
| R1988 |
T8011 |
T8009 |
pobj |
cause,as |
| R1989 |
T8012 |
T8011 |
prep |
of,cause |
| R1990 |
T8093 |
T8091 |
cc |
and,affected |
| R1991 |
T8013 |
T8012 |
pobj |
ataxia,of |
| R1992 |
T8094 |
T8091 |
conj |
unaffected,affected |
| R1993 |
T8095 |
T8092 |
compound |
AUS1,members |
| R1994 |
T8096 |
T8092 |
compound |
family,members |
| R1995 |
T8014 |
T8001 |
punct |
: ,present |
| R1996 |
T8097 |
T8098 |
mark |
that,showed |
| R1997 |
T8098 |
T8067 |
ccomp |
showed,revealed |
| R1998 |
T8099 |
T8100 |
det |
all,members |
| R1999 |
T8015 |
T8016 |
det |
the,protein |
| R2000 |
T8100 |
T8098 |
nsubj |
members,showed |
| R2001 |
T8101 |
T8100 |
amod |
affected,members |
| R2002 |
T8102 |
T8103 |
det |
a,decrease |
| R2003 |
T8016 |
T8017 |
nsubjpass |
protein,expressed |
| R2004 |
T8103 |
T8098 |
dobj |
decrease,showed |
| R2005 |
T8104 |
T8103 |
amod |
dramatic,decrease |
| R2006 |
T8105 |
T8103 |
prep |
in,decrease |
| R2007 |
T8017 |
T8001 |
ccomp |
expressed,present |
| R2008 |
T8106 |
T8107 |
compound |
ITPR1,levels |
| R2009 |
T8107 |
T8105 |
pobj |
levels,in |
| R2010 |
T8108 |
T8109 |
advmod |
when,compared |
| R2011 |
T8109 |
T8098 |
advcl |
compared,showed |
| R2012 |
T8110 |
T8109 |
prep |
with,compared |
| R2013 |
T8018 |
T8017 |
auxpass |
is,expressed |
| R2014 |
T8111 |
T8112 |
det |
the,member |
| R2015 |
T8112 |
T8110 |
pobj |
member,with |
| R2016 |
T8113 |
T8112 |
compound |
family,member |
| R2017 |
T8114 |
T8112 |
prep |
without,member |
| R2018 |
T8019 |
T8017 |
advmod |
highly,expressed |
| R2019 |
T8115 |
T8116 |
det |
the,deletion |
| R2020 |
T8116 |
T8114 |
pobj |
deletion,without |
| R2021 |
T8020 |
T8017 |
prep |
in,expressed |
| R2022 |
T8117 |
T8118 |
punct |
(,Figure |
| R2023 |
T8118 |
T8067 |
parataxis |
Figure,revealed |
| R2024 |
T8119 |
T8118 |
nummod |
4,Figure |
| R2025 |
T8021 |
T8022 |
compound |
Purkinje,cells |
| R2026 |
T8120 |
T8118 |
punct |
),Figure |
| R2027 |
T8121 |
T8067 |
punct |
.,revealed |
| R2028 |
T8022 |
T8020 |
pobj |
cells,in |
| R2029 |
T8123 |
T8124 |
nsubj |
Itpr1,contains |
| R2030 |
T8124 |
T8125 |
ccomp |
contains,contains |
| R2031 |
T8023 |
T8001 |
punct |
;,present |
| R2032 |
T8126 |
T8127 |
nummod |
three,domains |
| R2033 |
T8127 |
T8124 |
dobj |
domains,contains |
| R2034 |
T8024 |
T8025 |
mark |
as,shown |
| R2035 |
T8128 |
T8127 |
punct |
", ",domains |
| R2036 |
T8025 |
T8001 |
advcl |
shown,present |
| R2037 |
T8129 |
T8130 |
det |
an,domain |
| R2038 |
T8026 |
T8025 |
nsubj |
we,shown |
| R2039 |
T8130 |
T8127 |
appos |
domain,domains |
| R2040 |
T8131 |
T8132 |
npadvmod |
N,terminal |
| R2041 |
T8132 |
T8130 |
amod |
terminal,domain |
| R2042 |
T8027 |
T8025 |
aux |
have,shown |
| R2043 |
T8133 |
T8132 |
punct |
-,terminal |
| R2044 |
T8134 |
T8130 |
compound |
inositol,domain |
| R2045 |
T8135 |
T8130 |
compound |
triphosphate,domain |
| R2046 |
T8028 |
T8025 |
advmod |
here,shown |
| R2047 |
T8136 |
T8130 |
compound |
binding,domain |
| R2048 |
T8137 |
T8130 |
punct |
", ",domain |
| R2049 |
T8029 |
T8001 |
punct |
", ",present |
| R2050 |
T8138 |
T8139 |
det |
a,domain |
| R2051 |
T8139 |
T8130 |
conj |
domain,domain |
| R2052 |
T8140 |
T8139 |
amod |
coupling,domain |
| R2053 |
T8030 |
T8001 |
nsubj |
mice,present |
| R2054 |
T8141 |
T8139 |
punct |
", ",domain |
| R2055 |
T8142 |
T8139 |
cc |
and,domain |
| R2056 |
T8031 |
T8030 |
prep |
with,mice |
| R2057 |
T8143 |
T8144 |
det |
a,domain |
| R2058 |
T8144 |
T8139 |
conj |
domain,domain |
| R2059 |
T8145 |
T8146 |
npadvmod |
C,terminal |
| R2060 |
T8032 |
T8031 |
pobj |
mutation,with |
| R2061 |
T8146 |
T8144 |
amod |
terminal,domain |
| R2062 |
T8147 |
T8146 |
punct |
-,terminal |
| R2063 |
T8148 |
T8144 |
compound |
transmembrane,domain |
| R2064 |
T8149 |
T8125 |
punct |
;,contains |
| R2065 |
T8150 |
T8125 |
nsubj |
it,contains |
| R2066 |
T8033 |
T8032 |
prep |
at,mutation |
| R2067 |
T8151 |
T8125 |
advmod |
also,contains |
| R2068 |
T8152 |
T8153 |
nummod |
two,sites |
| R2069 |
T8153 |
T8125 |
dobj |
sites,contains |
| R2070 |
T8034 |
T8035 |
det |
this,locus |
| R2071 |
T8154 |
T8155 |
compound |
protein,A |
| R2072 |
T8155 |
T8153 |
compound |
A,sites |
| R2073 |
T8156 |
T8155 |
compound |
kinase,A |
| R2074 |
T8035 |
T8033 |
pobj |
locus,at |
| R2075 |
T8157 |
T8153 |
compound |
phosphorylation,sites |
| R2076 |
T8158 |
T8153 |
cc |
and,sites |
| R2077 |
T8159 |
T8160 |
det |
an,site |
| R2078 |
T8036 |
T8001 |
prep |
with,present |
| R2079 |
T8160 |
T8153 |
conj |
site,sites |
| R2080 |
T8161 |
T8162 |
npadvmod |
ATP,binding |
| R2081 |
T8162 |
T8160 |
amod |
binding,site |
| R2082 |
T8037 |
T8036 |
pobj |
ataxia,with |
| R2083 |
T8163 |
T8162 |
punct |
-,binding |
| R2084 |
T8164 |
T8125 |
punct |
.,contains |
| R2085 |
T8038 |
T8001 |
punct |
;,present |
| R2086 |
T8166 |
T8167 |
nsubjpass |
Itpr1,coupled |
| R2087 |
T8039 |
T8001 |
cc |
and,present |
| R2088 |
T8168 |
T8167 |
auxpass |
is,coupled |
| R2089 |
T8169 |
T8167 |
prep |
to,coupled |
| R2090 |
T8040 |
T8041 |
amod |
perturbed,signaling |
| R2091 |
T8170 |
T8171 |
compound |
Ca2+,channels |
| R2092 |
T8041 |
T8043 |
nsubjpass |
signaling,implicated |
| R2093 |
T8042 |
T8041 |
compound |
Ca2+,signaling |
| R2094 |
T8171 |
T8169 |
pobj |
channels,to |
| R2095 |
T8172 |
T8167 |
cc |
and,coupled |
| R2096 |
T8043 |
T8001 |
conj |
implicated,present |
| R2097 |
T8173 |
T8167 |
conj |
facilitates,coupled |
| R2098 |
T8174 |
T8175 |
compound |
Ca2+,release |
| R2099 |
T8175 |
T8173 |
dobj |
release,facilitates |
| R2100 |
T8176 |
T8175 |
prep |
from,release |
| R2101 |
T8044 |
T8043 |
aux |
has,implicated |
| R2102 |
T8177 |
T8178 |
det |
the,reticulum |
| R2103 |
T8178 |
T8176 |
pobj |
reticulum,from |
| R2104 |
T8045 |
T8043 |
advmod |
previously,implicated |
| R2105 |
T8179 |
T8178 |
amod |
endoplasmic,reticulum |
| R2106 |
T8180 |
T8175 |
prep |
after,release |
| R2107 |
T8181 |
T8180 |
pobj |
binding,after |
| R2108 |
T8046 |
T8043 |
auxpass |
been,implicated |
| R2109 |
T8182 |
T8181 |
prep |
by,binding |
| R2110 |
T8183 |
T8184 |
det |
the,messenger |
| R2111 |
T8184 |
T8182 |
pobj |
messenger,by |
| R2112 |
T8047 |
T8043 |
prep |
in,implicated |
| R2113 |
T8185 |
T8184 |
amod |
intracellular,messenger |
| R2114 |
T8186 |
T8184 |
amod |
second,messenger |
| R2115 |
T8187 |
T8188 |
nmod |
inositol,triphosphate |
| R2116 |
T8188 |
T8184 |
appos |
triphosphate,messenger |
| R2117 |
T8189 |
T8190 |
nummod |
1,5 |
| R2118 |
T8190 |
T8188 |
nummod |
5,triphosphate |
| R2119 |
T8048 |
T8049 |
det |
the,etiology |
| R2120 |
T8191 |
T8190 |
punct |
",",5 |
| R2121 |
T8192 |
T8190 |
nummod |
4,5 |
| R2122 |
T8193 |
T8190 |
punct |
",",5 |
| R2123 |
T8049 |
T8047 |
pobj |
etiology,in |
| R2124 |
T8194 |
T8188 |
punct |
-,triphosphate |
| R2125 |
T8195 |
T8196 |
punct |
[,9 |
| R2126 |
T8196 |
T8173 |
parataxis |
9,facilitates |
| R2127 |
T8050 |
T8049 |
prep |
of,etiology |
| R2128 |
T8197 |
T8196 |
punct |
],9 |
| R2129 |
T8198 |
T8167 |
punct |
.,coupled |
| R2130 |
T8051 |
T8050 |
pobj |
ataxia,of |
| R2131 |
T8200 |
T8201 |
nsubjpass |
Itpr1,enriched |
| R2132 |
T8052 |
T8043 |
punct |
", ",implicated |
| R2133 |
T8202 |
T8201 |
auxpass |
is,enriched |
| R2134 |
T8203 |
T8201 |
prep |
in,enriched |
| R2135 |
T8204 |
T8205 |
det |
the,cells |
| R2136 |
T8053 |
T8054 |
advmod |
notably,in |
| R2137 |
T8205 |
T8203 |
pobj |
cells,in |
| R2138 |
T8206 |
T8205 |
compound |
Purkinje,cells |
| R2139 |
T8207 |
T8205 |
prep |
of,cells |
| R2140 |
T8054 |
T8043 |
prep |
in,implicated |
| R2141 |
T8208 |
T8209 |
det |
the,cerebellum |
| R2142 |
T8209 |
T8207 |
pobj |
cerebellum,of |
| R2143 |
T8210 |
T8211 |
punct |
[,4 |
| R2144 |
T8055 |
T8056 |
amod |
episodic,type |
| R2145 |
T8211 |
T8201 |
parataxis |
4,enriched |
| R2146 |
T8212 |
T8211 |
punct |
],4 |
| R2147 |
T8213 |
T8201 |
punct |
.,enriched |
| R2148 |
T8056 |
T8054 |
pobj |
type,in |
| R2149 |
T8057 |
T8056 |
compound |
ataxia,type |
| R2150 |
T8215 |
T8216 |
compound |
ITPR1,mutations |
| R2151 |
T8058 |
T8056 |
nummod |
2,type |
| R2152 |
T8216 |
T8217 |
nsubj |
mutations,have |
| R2153 |
T8059 |
T8056 |
cc |
and,type |
| R2154 |
T8218 |
T8219 |
amod |
more,one |
| R2155 |
T8219 |
T8221 |
nummod |
one,mechanism |
| R2156 |
T8220 |
T8219 |
quantmod |
than,one |
| R2157 |
T8221 |
T8217 |
dobj |
mechanism,have |
| R2158 |
T8060 |
T8056 |
conj |
SCA6,type |
| R2159 |
T8222 |
T8221 |
amod |
potential,mechanism |
| R2160 |
T8223 |
T8221 |
amod |
pathogenic,mechanism |
| R2161 |
T8224 |
T8217 |
punct |
.,have |
| R2162 |
T8061 |
T8062 |
punct |
[,8 |
| R2163 |
T8226 |
T8227 |
advmod |
First,is |
| R2164 |
T8062 |
T8043 |
parataxis |
8,implicated |
| R2165 |
T8228 |
T8227 |
punct |
", ",is |
| R2166 |
T8229 |
T8230 |
det |
the,disease |
| R2167 |
T8230 |
T8231 |
nsubj |
disease,be |
| R2168 |
T8231 |
T8227 |
ccomp |
be,is |
| R2169 |
T8063 |
T8062 |
punct |
],8 |
| R2170 |
T8232 |
T8231 |
aux |
may,be |
| R2171 |
T8233 |
T8234 |
det |
a,result |
| R2172 |
T8234 |
T8231 |
attr |
result,be |
| R2173 |
T8235 |
T8234 |
prep |
of,result |
| R2174 |
T8064 |
T8001 |
punct |
.,present |
| R2175 |
T8236 |
T8235 |
pobj |
haploinsufficiency,of |
| R2176 |
T8237 |
T8236 |
prep |
at,haploinsufficiency |
| R2177 |
T8277 |
T8278 |
advmod |
much,shorter |
| R2178 |
T8238 |
T8237 |
pobj |
ITPR1,at |
| R2179 |
T8239 |
T8227 |
punct |
;,is |
| R2180 |
T8240 |
T8241 |
det |
this,concept |
| R2181 |
T8241 |
T8227 |
nsubj |
concept,is |
| R2182 |
T8278 |
T8276 |
amod |
shorter,span |
| R2183 |
T8242 |
T8227 |
acomp |
consistent,is |
| R2184 |
T8243 |
T8242 |
prep |
with,consistent |
| R2185 |
T8244 |
T8245 |
det |
the,observation |
| R2186 |
T8279 |
T8276 |
compound |
life,span |
| R2187 |
T8245 |
T8243 |
pobj |
observation,with |
| R2188 |
T8246 |
T8247 |
mark |
that,leads |
| R2189 |
T8247 |
T8245 |
acl |
leads,observation |
| R2190 |
T8280 |
T8276 |
prep |
of,span |
| R2191 |
T8248 |
T8249 |
amod |
heterozygous,deletion |
| R2192 |
T8249 |
T8247 |
nsubj |
deletion,leads |
| R2193 |
T8250 |
T8247 |
prep |
to,leads |
| R2194 |
T8281 |
T8282 |
det |
the,mouse |
| R2195 |
T8251 |
T8252 |
det |
a,disorder |
| R2196 |
T8252 |
T8250 |
pobj |
disorder,to |
| R2197 |
T8282 |
T8280 |
pobj |
mouse,of |
| R2198 |
T8253 |
T8254 |
amod |
later,onset |
| R2199 |
T8254 |
T8252 |
compound |
onset,disorder |
| R2200 |
T8255 |
T8247 |
prep |
in,leads |
| R2201 |
T8283 |
T8227 |
punct |
.,is |
| R2202 |
T8256 |
T8255 |
pobj |
humans,in |
| R2203 |
T8257 |
T8247 |
punct |
", ",leads |
| R2204 |
T8285 |
T8286 |
advmod |
Second,failed |
| R2205 |
T8258 |
T8259 |
mark |
whereas,leads |
| R2206 |
T8259 |
T8247 |
advcl |
leads,leads |
| R2207 |
T8260 |
T8261 |
amod |
homozygous,deletion |
| R2208 |
T8261 |
T8259 |
nsubj |
deletion,leads |
| R2209 |
T8262 |
T8261 |
prep |
in,deletion |
| R2210 |
T8263 |
T8262 |
pobj |
mice,in |
| R2211 |
T8287 |
T8286 |
punct |
", ",failed |
| R2212 |
T8264 |
T8259 |
prep |
to,leads |
| R2213 |
T8265 |
T8266 |
det |
an,disorder |
| R2214 |
T8266 |
T8264 |
pobj |
disorder,to |
| R2215 |
T8288 |
T8289 |
nsubj |
we,rule |
| R2216 |
T8267 |
T8268 |
amod |
early,onset |
| R2217 |
T8268 |
T8266 |
compound |
onset,disorder |
| R2218 |
T8269 |
T8266 |
punct |
", ",disorder |
| R2219 |
T8270 |
T8266 |
amod |
able,disorder |
| R2220 |
T8271 |
T8272 |
aux |
to,expressed |
| R2221 |
T8272 |
T8270 |
xcomp |
expressed,able |
| R2222 |
T8289 |
T8286 |
ccomp |
rule,failed |
| R2223 |
T8273 |
T8272 |
auxpass |
be,expressed |
| R2224 |
T8274 |
T8272 |
prep |
within,expressed |
| R2225 |
T8275 |
T8276 |
det |
the,span |
| R2226 |
T8290 |
T8289 |
aux |
can,rule |
| R2227 |
T8276 |
T8274 |
pobj |
span,within |
| R2228 |
T8291 |
T8289 |
neg |
not,rule |
| R2229 |
T8292 |
T8289 |
prt |
out,rule |
| R2230 |
T8383 |
T8382 |
advmod |
here,show |
| R2231 |
T8293 |
T8294 |
det |
the,existence |
| R2232 |
T8384 |
T8385 |
det |
the,utility |
| R2233 |
T8385 |
T8382 |
dobj |
utility,show |
| R2234 |
T8294 |
T8289 |
dobj |
existence,rule |
| R2235 |
T8295 |
T8294 |
prep |
of,existence |
| R2236 |
T8386 |
T8385 |
prep |
of,utility |
| R2237 |
T8296 |
T8297 |
det |
an,site |
| R2238 |
T8387 |
T8386 |
pcomp |
investigating,of |
| R2239 |
T8388 |
T8389 |
amod |
spontaneous,mutations |
| R2240 |
T8389 |
T8387 |
dobj |
mutations,investigating |
| R2241 |
T8297 |
T8295 |
pobj |
site,of |
| R2242 |
T8390 |
T8389 |
compound |
mouse,mutations |
| R2243 |
T8391 |
T8387 |
prep |
in,investigating |
| R2244 |
T8392 |
T8391 |
pcomp |
understanding,in |
| R2245 |
T8298 |
T8297 |
amod |
alternate,site |
| R2246 |
T8393 |
T8394 |
amod |
human,disease |
| R2247 |
T8394 |
T8392 |
dobj |
disease,understanding |
| R2248 |
T8299 |
T8297 |
compound |
start,site |
| R2249 |
T8395 |
T8382 |
punct |
.,show |
| R2250 |
T8300 |
T8297 |
prep |
for,site |
| R2251 |
T8397 |
T8398 |
advmod |
Currently,precludes |
| R2252 |
T8398 |
T8409 |
ccomp |
precludes,are |
| R2253 |
T8399 |
T8398 |
punct |
", ",precludes |
| R2254 |
T8301 |
T8300 |
pobj |
ITPR1,for |
| R2255 |
T8400 |
T8401 |
det |
the,number |
| R2256 |
T8401 |
T8398 |
nsubj |
number,precludes |
| R2257 |
T8302 |
T8303 |
dep |
that,result |
| R2258 |
T8402 |
T8401 |
amod |
small,number |
| R2259 |
T8403 |
T8401 |
prep |
of,number |
| R2260 |
T8404 |
T8405 |
amod |
aged,animals |
| R2261 |
T8303 |
T8297 |
relcl |
result,site |
| R2262 |
T8405 |
T8403 |
pobj |
animals,of |
| R2263 |
T8406 |
T8407 |
compound |
Itpr1wt,Δ18 |
| R2264 |
T8407 |
T8405 |
compound |
Δ18,animals |
| R2265 |
T8304 |
T8303 |
aux |
may,result |
| R2266 |
T8408 |
T8407 |
punct |
/,Δ18 |
| R2267 |
T8410 |
T8398 |
dobj |
us,precludes |
| R2268 |
T8305 |
T8303 |
prep |
in,result |
| R2269 |
T8411 |
T8398 |
prep |
from,precludes |
| R2270 |
T8412 |
T8411 |
pcomp |
examining,from |
| R2271 |
T8413 |
T8414 |
det |
these,mice |
| R2272 |
T8414 |
T8412 |
dobj |
mice,examining |
| R2273 |
T8415 |
T8412 |
prep |
for,examining |
| R2274 |
T8306 |
T8307 |
det |
a,product |
| R2275 |
T8416 |
T8417 |
amod |
subtle,signs |
| R2276 |
T8417 |
T8415 |
pobj |
signs,for |
| R2277 |
T8418 |
T8417 |
cc |
and,signs |
| R2278 |
T8307 |
T8305 |
pobj |
product,in |
| R2279 |
T8419 |
T8417 |
conj |
symptoms,signs |
| R2280 |
T8420 |
T8417 |
amod |
similar,signs |
| R2281 |
T8421 |
T8420 |
prep |
to,similar |
| R2282 |
T8308 |
T8309 |
dep |
that,confers |
| R2283 |
T8422 |
T8421 |
pobj |
those,to |
| R2284 |
T8423 |
T8422 |
acl |
seen,those |
| R2285 |
T8309 |
T8307 |
relcl |
confers,product |
| R2286 |
T8424 |
T8423 |
prep |
in,seen |
| R2287 |
T8425 |
T8426 |
compound |
SCA15,patients |
| R2288 |
T8426 |
T8424 |
pobj |
patients,in |
| R2289 |
T8310 |
T8311 |
det |
a,gain |
| R2290 |
T8427 |
T8409 |
punct |
;,are |
| R2291 |
T8428 |
T8409 |
advmod |
however,are |
| R2292 |
T8429 |
T8409 |
punct |
", ",are |
| R2293 |
T8311 |
T8309 |
dobj |
gain,confers |
| R2294 |
T8430 |
T8431 |
det |
these,mice |
| R2295 |
T8431 |
T8409 |
nsubj |
mice,are |
| R2296 |
T8432 |
T8409 |
advmod |
clearly,are |
| R2297 |
T8433 |
T8409 |
prep |
of,are |
| R2298 |
T8312 |
T8311 |
amod |
pathogenic,gain |
| R2299 |
T8434 |
T8433 |
pobj |
interest,of |
| R2300 |
T8435 |
T8434 |
prep |
to,interest |
| R2301 |
T8313 |
T8311 |
prep |
of,gain |
| R2302 |
T8436 |
T8435 |
pobj |
us,to |
| R2303 |
T8437 |
T8409 |
prep |
as,are |
| R2304 |
T8438 |
T8439 |
det |
a,model |
| R2305 |
T8314 |
T8313 |
pobj |
function,of |
| R2306 |
T8439 |
T8437 |
pobj |
model,as |
| R2307 |
T8440 |
T8439 |
amod |
potential,model |
| R2308 |
T8441 |
T8439 |
prep |
of,model |
| R2309 |
T8315 |
T8309 |
prep |
to,confers |
| R2310 |
T8442 |
T8441 |
pobj |
SCA15,of |
| R2311 |
T8443 |
T8409 |
punct |
.,are |
| R2312 |
T8316 |
T8317 |
det |
the,protein |
| R2313 |
T8445 |
T8446 |
det |
These,data |
| R2314 |
T8446 |
T8447 |
nsubj |
data,demonstrate |
| R2315 |
T8317 |
T8315 |
pobj |
protein,to |
| R2316 |
T8448 |
T8447 |
advmod |
also,demonstrate |
| R2317 |
T8318 |
T8286 |
punct |
;,failed |
| R2318 |
T8449 |
T8450 |
mark |
that,facilitate |
| R2319 |
T8450 |
T8447 |
ccomp |
facilitate,demonstrate |
| R2320 |
T8451 |
T8452 |
npadvmod |
genome,wide |
| R2321 |
T8452 |
T8454 |
amod |
wide,assay |
| R2322 |
T8453 |
T8452 |
punct |
-,wide |
| R2323 |
T8454 |
T8450 |
nsubj |
assay,facilitate |
| R2324 |
T8319 |
T8286 |
advmod |
however,failed |
| R2325 |
T8455 |
T8454 |
compound |
SNP,assay |
| R2326 |
T8456 |
T8450 |
aux |
can,facilitate |
| R2327 |
T8457 |
T8458 |
amod |
rapid,detection |
| R2328 |
T8458 |
T8450 |
dobj |
detection,facilitate |
| R2329 |
T8320 |
T8286 |
punct |
", ",failed |
| R2330 |
T8459 |
T8458 |
prep |
of,detection |
| R2331 |
T8460 |
T8461 |
amod |
structural,mutations |
| R2332 |
T8461 |
T8459 |
pobj |
mutations,of |
| R2333 |
T8321 |
T8322 |
compound |
Western,blot |
| R2334 |
T8462 |
T8461 |
amod |
genomic,mutations |
| R2335 |
T8463 |
T8464 |
dep |
that,underlie |
| R2336 |
T8322 |
T8323 |
compound |
blot,analysis |
| R2337 |
T8464 |
T8461 |
relcl |
underlie,mutations |
| R2338 |
T8465 |
T8464 |
aux |
may,underlie |
| R2339 |
T8466 |
T8464 |
dobj |
disease,underlie |
| R2340 |
T8323 |
T8286 |
nsubj |
analysis,failed |
| R2341 |
T8467 |
T8447 |
punct |
.,demonstrate |
| R2342 |
T8324 |
T8323 |
prep |
of,analysis |
| R2343 |
T8469 |
T8470 |
det |
The,data |
| R2344 |
T8470 |
T8471 |
nsubj |
data,provide |
| R2345 |
T8325 |
T8324 |
pobj |
cells,of |
| R2346 |
T8472 |
T8470 |
acl |
provided,data |
| R2347 |
T8326 |
T8325 |
acl |
derived,cells |
| R2348 |
T8327 |
T8326 |
prep |
from,derived |
| R2349 |
T8473 |
T8472 |
agent |
by,provided |
| R2350 |
T8474 |
T8475 |
det |
these,approaches |
| R2351 |
T8328 |
T8329 |
amod |
affected,members |
| R2352 |
T8475 |
T8473 |
pobj |
approaches,by |
| R2353 |
T8476 |
T8477 |
amod |
compelling,evidence |
| R2354 |
T8329 |
T8327 |
pobj |
members,from |
| R2355 |
T8477 |
T8471 |
dobj |
evidence,provide |
| R2356 |
T8478 |
T8479 |
mark |
that,causes |
| R2357 |
T8479 |
T8477 |
acl |
causes,evidence |
| R2358 |
T8330 |
T8331 |
compound |
AUS1,family |
| R2359 |
T8480 |
T8481 |
amod |
heterozygous,deletion |
| R2360 |
T8331 |
T8329 |
compound |
family,members |
| R2361 |
T8332 |
T8323 |
punct |
", ",analysis |
| R2362 |
T8481 |
T8479 |
nsubj |
deletion,causes |
| R2363 |
T8333 |
T8334 |
dep |
which,performed |
| R2364 |
T8482 |
T8481 |
prep |
of,deletion |
| R2365 |
T8483 |
T8482 |
pobj |
ITPR1,of |
| R2366 |
T8484 |
T8479 |
dobj |
SCA15,causes |
| R2367 |
T8334 |
T8323 |
relcl |
performed,analysis |
| R2368 |
T8485 |
T8471 |
punct |
.,provide |
| R2369 |
T8335 |
T8334 |
auxpass |
was,performed |
| R2370 |
T8487 |
T8488 |
advmod |
Clearly,provide |
| R2371 |
T8488 |
T8499 |
ccomp |
provide,means |
| R2372 |
T8336 |
T8334 |
advcl |
using,performed |
| R2373 |
T8337 |
T8338 |
det |
an,antibody |
| R2374 |
T8338 |
T8336 |
dobj |
antibody,using |
| R2375 |
T8489 |
T8488 |
punct |
", ",provide |
| R2376 |
T8339 |
T8338 |
acl |
raised,antibody |
| R2377 |
T8490 |
T8491 |
compound |
sequence,analysis |
| R2378 |
T8491 |
T8488 |
nsubj |
analysis,provide |
| R2379 |
T8340 |
T8339 |
prep |
against,raised |
| R2380 |
T8492 |
T8491 |
prep |
of,analysis |
| R2381 |
T8493 |
T8492 |
pobj |
ITPR1,of |
| R2382 |
T8494 |
T8493 |
prep |
in,ITPR1 |
| R2383 |
T8341 |
T8342 |
det |
the,portion |
| R2384 |
T8495 |
T8496 |
amod |
potential,cases |
| R2385 |
T8496 |
T8494 |
pobj |
cases,in |
| R2386 |
T8342 |
T8340 |
pobj |
portion,against |
| R2387 |
T8497 |
T8496 |
compound |
SCA15,cases |
| R2388 |
T8498 |
T8488 |
aux |
may,provide |
| R2389 |
T8343 |
T8344 |
npadvmod |
C,terminal |
| R2390 |
T8500 |
T8501 |
amod |
additional,insight |
| R2391 |
T8501 |
T8488 |
dobj |
insight,provide |
| R2392 |
T8344 |
T8342 |
amod |
terminal,portion |
| R2393 |
T8502 |
T8501 |
prep |
into,insight |
| R2394 |
T8503 |
T8504 |
det |
the,disease |
| R2395 |
T8504 |
T8502 |
pobj |
disease,into |
| R2396 |
T8345 |
T8344 |
punct |
-,terminal |
| R2397 |
T8505 |
T8488 |
punct |
", ",provide |
| R2398 |
T8506 |
T8507 |
advmod |
particularly,were |
| R2399 |
T8507 |
T8488 |
advcl |
were,provide |
| R2400 |
T8346 |
T8342 |
prep |
of,portion |
| R2401 |
T8508 |
T8507 |
mark |
if,were |
| R2402 |
T8509 |
T8510 |
det |
a,mutation |
| R2403 |
T8347 |
T8346 |
pobj |
ITPR1,of |
| R2404 |
T8510 |
T8507 |
nsubj |
mutation,were |
| R2405 |
T8511 |
T8510 |
compound |
stop,mutation |
| R2406 |
T8512 |
T8513 |
aux |
to,identified |
| R2407 |
T8348 |
T8286 |
punct |
", ",failed |
| R2408 |
T8513 |
T8507 |
xcomp |
identified,were |
| R2409 |
T8514 |
T8513 |
auxpass |
be,identified |
| R2410 |
T8515 |
T8499 |
punct |
;,means |
| R2411 |
T8349 |
T8350 |
aux |
to,identify |
| R2412 |
T8516 |
T8499 |
advmod |
however,means |
| R2413 |
T8517 |
T8499 |
punct |
", ",means |
| R2414 |
T8350 |
T8286 |
xcomp |
identify,failed |
| R2415 |
T8518 |
T8519 |
det |
the,mechanism |
| R2416 |
T8519 |
T8499 |
nsubj |
mechanism,means |
| R2417 |
T8520 |
T8519 |
amod |
mutational,mechanism |
| R2418 |
T8351 |
T8352 |
det |
any,products |
| R2419 |
T8521 |
T8519 |
acl |
noted,mechanism |
| R2420 |
T8522 |
T8521 |
advmod |
here,noted |
| R2421 |
T8352 |
T8350 |
dobj |
products,identify |
| R2422 |
T8523 |
T8524 |
mark |
that,required |
| R2423 |
T8524 |
T8499 |
ccomp |
required,means |
| R2424 |
T8525 |
T8526 |
amod |
standard,approaches |
| R2425 |
T8526 |
T8528 |
nsubj |
approaches,are |
| R2426 |
T8527 |
T8526 |
compound |
sequencing,approaches |
| R2427 |
T8528 |
T8524 |
ccomp |
are,required |
| R2428 |
T8353 |
T8354 |
npadvmod |
disease,specific |
| R2429 |
T8529 |
T8526 |
advmod |
alone,approaches |
| R2430 |
T8530 |
T8528 |
acomp |
insufficient,are |
| R2431 |
T8354 |
T8352 |
amod |
specific,products |
| R2432 |
T8531 |
T8532 |
aux |
to,rule |
| R2433 |
T8532 |
T8530 |
xcomp |
rule,insufficient |
| R2434 |
T8533 |
T8532 |
advmod |
confidently,rule |
| R2435 |
T8355 |
T8354 |
punct |
-,specific |
| R2436 |
T8534 |
T8532 |
prt |
out,rule |
| R2437 |
T8535 |
T8536 |
compound |
ITPR1,mutation |
| R2438 |
T8536 |
T8532 |
dobj |
mutation,rule |
| R2439 |
T8356 |
T8357 |
amod |
truncated,protein |
| R2440 |
T8537 |
T8532 |
prep |
as,rule |
| R2441 |
T8538 |
T8539 |
det |
a,cause |
| R2442 |
T8357 |
T8352 |
compound |
protein,products |
| R2443 |
T8539 |
T8537 |
pobj |
cause,as |
| R2444 |
T8540 |
T8539 |
prep |
of,cause |
| R2445 |
T8358 |
T8286 |
punct |
.,failed |
| R2446 |
T8541 |
T8540 |
pobj |
disease,of |
| R2447 |
T8542 |
T8524 |
punct |
: ,required |
| R2448 |
T8360 |
T8361 |
advmod |
Clearly,help |
| R2449 |
T8543 |
T8544 |
det |
a,approach |
| R2450 |
T8544 |
T8524 |
nsubjpass |
approach,required |
| R2451 |
T8545 |
T8544 |
amod |
comprehensive,approach |
| R2452 |
T8546 |
T8547 |
compound |
gene,dosage |
| R2453 |
T8362 |
T8361 |
punct |
", ",help |
| R2454 |
T8547 |
T8544 |
compound |
dosage,approach |
| R2455 |
T8548 |
T8524 |
auxpass |
is,required |
| R2456 |
T8549 |
T8524 |
advmod |
also,required |
| R2457 |
T8550 |
T8499 |
punct |
.,means |
| R2458 |
T8363 |
T8364 |
det |
the,identification |
| R2459 |
T8552 |
T8553 |
prep |
Given,is |
| R2460 |
T8364 |
T8361 |
nsubj |
identification,help |
| R2461 |
T8554 |
T8555 |
mark |
that,mapped |
| R2462 |
T8365 |
T8364 |
prep |
of,identification |
| R2463 |
T8366 |
T8367 |
amod |
distinct,mutations |
| R2464 |
T8555 |
T8552 |
pcomp |
mapped,Given |
| R2465 |
T8556 |
T8555 |
nsubjpass |
SCA16,mapped |
| R2466 |
T8557 |
T8556 |
cc |
and,SCA16 |
| R2467 |
T8367 |
T8365 |
pobj |
mutations,of |
| R2468 |
T8558 |
T8559 |
amod |
autosomal,ataxia |
| R2469 |
T8559 |
T8556 |
conj |
ataxia,SCA16 |
| R2470 |
T8368 |
T8367 |
compound |
ITPR1,mutations |
| R2471 |
T8560 |
T8559 |
amod |
dominant,ataxia |
| R2472 |
T8561 |
T8559 |
amod |
congenital,ataxia |
| R2473 |
T8369 |
T8367 |
acl |
underlying,mutations |
| R2474 |
T8562 |
T8559 |
amod |
nonprogressive,ataxia |
| R2475 |
T8563 |
T8555 |
aux |
have,mapped |
| R2476 |
T8564 |
T8555 |
dep |
both,mapped |
| R2477 |
T8565 |
T8555 |
advmod |
recently,mapped |
| R2478 |
T8566 |
T8555 |
auxpass |
been,mapped |
| R2479 |
T8370 |
T8369 |
dobj |
SCA15,underlying |
| R2480 |
T8567 |
T8555 |
prep |
to,mapped |
| R2481 |
T8568 |
T8567 |
pobj |
regions,to |
| R2482 |
T8569 |
T8568 |
acl |
overlapping,regions |
| R2483 |
T8371 |
T8361 |
aux |
will,help |
| R2484 |
T8570 |
T8569 |
prep |
with,overlapping |
| R2485 |
T8571 |
T8572 |
det |
the,locus |
| R2486 |
T8572 |
T8570 |
pobj |
locus,with |
| R2487 |
T8372 |
T8361 |
xcomp |
elucidate,help |
| R2488 |
T8573 |
T8572 |
compound |
SCA15,locus |
| R2489 |
T8574 |
T8575 |
punct |
[,11 |
| R2490 |
T8373 |
T8374 |
det |
the,mechanism |
| R2491 |
T8575 |
T8555 |
parataxis |
11,mapped |
| R2492 |
T8576 |
T8575 |
nummod |
10,11 |
| R2493 |
T8577 |
T8575 |
punct |
",",11 |
| R2494 |
T8374 |
T8372 |
dobj |
mechanism,elucidate |
| R2495 |
T8578 |
T8575 |
punct |
],11 |
| R2496 |
T8579 |
T8553 |
punct |
", ",is |
| R2497 |
T8580 |
T8553 |
nsubj |
ITPR1,is |
| R2498 |
T8375 |
T8374 |
amod |
pathogenic,mechanism |
| R2499 |
T8581 |
T8582 |
det |
a,gene |
| R2500 |
T8582 |
T8553 |
attr |
gene,is |
| R2501 |
T8376 |
T8374 |
prep |
of,mechanism |
| R2502 |
T8583 |
T8582 |
prep |
of,gene |
| R2503 |
T8584 |
T8583 |
pobj |
importance,of |
| R2504 |
T8585 |
T8584 |
prep |
for,importance |
| R2505 |
T8586 |
T8585 |
pobj |
screening,for |
| R2506 |
T8377 |
T8378 |
det |
this,disorder |
| R2507 |
T8587 |
T8553 |
prep |
in,is |
| R2508 |
T8588 |
T8589 |
det |
these,families |
| R2509 |
T8589 |
T8587 |
pobj |
families,in |
| R2510 |
T8378 |
T8376 |
pobj |
disorder,of |
| R2511 |
T8590 |
T8553 |
punct |
.,is |
| R2512 |
T8379 |
T8361 |
punct |
.,help |
| R2513 |
T8592 |
T8593 |
det |
These,data |
| R2514 |
T8593 |
T8594 |
nsubj |
data,add |
| R2515 |
T8381 |
T8382 |
nsubj |
We,show |
| R2516 |
T8595 |
T8594 |
dobj |
weight,add |
| R2517 |
T8596 |
T8594 |
prep |
to,add |
| R2518 |
T8597 |
T8598 |
det |
a,role |
| R2519 |
T8598 |
T8596 |
pobj |
role,to |
| R2520 |
T8599 |
T8598 |
prep |
for,role |
| R2521 |
T8600 |
T8601 |
amod |
aberrant,signaling |
| R2522 |
T8601 |
T8599 |
pobj |
signaling,for |
| R2523 |
T8602 |
T8601 |
amod |
intracellular,signaling |
| R2524 |
T8603 |
T8601 |
compound |
Ca2+,signaling |
| R2525 |
T8604 |
T8601 |
prep |
in,signaling |
| R2526 |
T8605 |
T8606 |
compound |
Purkinje,cells |
| R2527 |
T8606 |
T8604 |
pobj |
cells,in |
| R2528 |
T8607 |
T8598 |
prep |
in,role |
| R2529 |
T8608 |
T8609 |
det |
the,pathogenesis |
| R2530 |
T8609 |
T8607 |
pobj |
pathogenesis,in |
| R2531 |
T8610 |
T8609 |
prep |
of,pathogenesis |
| R2532 |
T8611 |
T8612 |
amod |
spinocerebellar,ataxia |
| R2533 |
T8612 |
T8610 |
pobj |
ataxia,of |
| R2534 |
T8613 |
T8594 |
punct |
.,add |
| R2535 |
T8971 |
T8972 |
npadvmod |
Genome,wide |
| R2536 |
T8972 |
T8974 |
amod |
wide,linkage |
| R2537 |
T8973 |
T8972 |
punct |
-,wide |
| R2538 |
T8975 |
T8974 |
prep |
in,linkage |
| R2539 |
T8976 |
T8975 |
pobj |
mice,in |
| R2540 |
T8977 |
T8974 |
punct |
.,linkage |
| R2541 |
T8979 |
T8980 |
compound |
One,hundred |
| R2542 |
T8980 |
T8981 |
nummod |
hundred,fragments |
| R2543 |
T8981 |
T8985 |
nsubjpass |
fragments,amplified |
| R2544 |
T8982 |
T8980 |
cc |
and,hundred |
| R2545 |
T8983 |
T8980 |
conj |
twenty,hundred |
| R2546 |
T8984 |
T8981 |
compound |
DNA,fragments |
| R2547 |
T8986 |
T8985 |
auxpass |
were,amplified |
| R2548 |
T8987 |
T8985 |
prep |
across,amplified |
| R2549 |
T8988 |
T8989 |
det |
the,genome |
| R2550 |
T8989 |
T8987 |
pobj |
genome,across |
| R2551 |
T8990 |
T8985 |
punct |
", ",amplified |
| R2552 |
T8991 |
T8985 |
npadvmod |
each,amplified |
| R2553 |
T8992 |
T8991 |
acl |
selected,each |
| R2554 |
T8993 |
T8994 |
aux |
to,contain |
| R2555 |
T8994 |
T8992 |
advcl |
contain,selected |
| R2556 |
T8995 |
T8996 |
nummod |
one,SNPs |
| R2557 |
T8996 |
T8994 |
dobj |
SNPs,contain |
| R2558 |
T8997 |
T8995 |
cc |
or,one |
| R2559 |
T8998 |
T8995 |
conj |
more,one |
| R2560 |
T8999 |
T9000 |
npadvmod |
strain,specific |
| R2561 |
T9000 |
T8996 |
amod |
specific,SNPs |
| R2562 |
T9001 |
T9000 |
punct |
-,specific |
| R2563 |
T9002 |
T9003 |
dep |
that,differentiate |
| R2564 |
T9003 |
T8996 |
relcl |
differentiate,SNPs |
| R2565 |
T9004 |
T9003 |
aux |
would,differentiate |
| R2566 |
T9005 |
T9003 |
prep |
between,differentiate |
| R2567 |
T9006 |
T9007 |
nmod |
C57BL,6J |
| R2568 |
T9007 |
T9009 |
nmod |
6J,strains |
| R2569 |
T9008 |
T9007 |
punct |
/,6J |
| R2570 |
T9009 |
T9005 |
pobj |
strains,between |
| R2571 |
T9010 |
T9007 |
cc |
and,6J |
| R2572 |
T9011 |
T9012 |
compound |
129x1,SvJ |
| R2573 |
T9012 |
T9007 |
conj |
SvJ,6J |
| R2574 |
T9013 |
T9012 |
punct |
/,SvJ |
| R2575 |
T9014 |
T9009 |
amod |
inbred,strains |
| R2576 |
T9015 |
T9016 |
punct |
[,12 |
| R2577 |
T9016 |
T8985 |
parataxis |
12,amplified |
| R2578 |
T9017 |
T9016 |
punct |
],12 |
| R2579 |
T9018 |
T8985 |
punct |
.,amplified |
| R2580 |
T9020 |
T9021 |
det |
Each,fragment |
| R2581 |
T9021 |
T9022 |
nsubjpass |
fragment,amplified |
| R2582 |
T9022 |
T9025 |
ccomp |
amplified,performed |
| R2583 |
T9023 |
T9022 |
auxpass |
was,amplified |
| R2584 |
T9024 |
T9022 |
advmod |
initially,amplified |
| R2585 |
T9026 |
T9022 |
prep |
in,amplified |
| R2586 |
T9027 |
T9028 |
nummod |
11,mice |
| R2587 |
T9028 |
T9026 |
pobj |
mice,in |
| R2588 |
T9029 |
T9028 |
amod |
affected,mice |
| R2589 |
T9030 |
T9028 |
cc |
and,mice |
| R2590 |
T9031 |
T9032 |
nummod |
nine,mice |
| R2591 |
T9032 |
T9028 |
conj |
mice,mice |
| R2592 |
T9033 |
T9032 |
amod |
unaffected,mice |
| R2593 |
T9034 |
T9025 |
punct |
;,performed |
| R2594 |
T9035 |
T9036 |
compound |
genotype,calling |
| R2595 |
T9036 |
T9025 |
nsubjpass |
calling,performed |
| R2596 |
T9037 |
T9025 |
auxpass |
was,performed |
| R2597 |
T9038 |
T9025 |
prep |
by,performed |
| R2598 |
T9039 |
T9040 |
compound |
dye,terminator |
| R2599 |
T9040 |
T9042 |
compound |
terminator,sequencing |
| R2600 |
T9041 |
T9040 |
punct |
-,terminator |
| R2601 |
T9042 |
T9038 |
pobj |
sequencing,by |
| R2602 |
T9043 |
T9042 |
prep |
of,sequencing |
| R2603 |
T9044 |
T9045 |
det |
these,fragments |
| R2604 |
T9045 |
T9043 |
pobj |
fragments,of |
| R2605 |
T9046 |
T9025 |
punct |
.,performed |
| R2606 |
T9048 |
T9049 |
compound |
Linkage,analysis |
| R2607 |
T9049 |
T9050 |
nsubjpass |
analysis,performed |
| R2608 |
T9051 |
T9049 |
acl |
using,analysis |
| R2609 |
T9052 |
T9053 |
det |
these,data |
| R2610 |
T9053 |
T9051 |
dobj |
data,using |
| R2611 |
T9054 |
T9050 |
auxpass |
was,performed |
| R2612 |
T9055 |
T9050 |
advcl |
using,performed |
| R2613 |
T9056 |
T9055 |
dobj |
mlink,using |
| R2614 |
T9057 |
T9058 |
punct |
[,13 |
| R2615 |
T9058 |
T9055 |
parataxis |
13,using |
| R2616 |
T9059 |
T9058 |
punct |
],13 |
| R2617 |
T9060 |
T9050 |
punct |
", ",performed |
| R2618 |
T9061 |
T9062 |
dep |
which,revealed |
| R2619 |
T9062 |
T9050 |
advcl |
revealed,performed |
| R2620 |
T9063 |
T9064 |
det |
a,linkage |
| R2621 |
T9064 |
T9062 |
dobj |
linkage,revealed |
| R2622 |
T9065 |
T9064 |
amod |
positive,linkage |
| R2623 |
T9066 |
T9062 |
prep |
at,revealed |
| R2624 |
T9067 |
T9068 |
compound |
Chromosome,6qE1 |
| R2625 |
T9068 |
T9066 |
pobj |
6qE1,at |
| R2626 |
T9069 |
T9062 |
punct |
", ",revealed |
| R2627 |
T9070 |
T9062 |
prep |
on,revealed |
| R2628 |
T9071 |
T9072 |
det |
the,background |
| R2629 |
T9072 |
T9070 |
pobj |
background,on |
| R2630 |
T9073 |
T9074 |
compound |
129x1,SvJ |
| R2631 |
T9074 |
T9072 |
compound |
SvJ,background |
| R2632 |
T9075 |
T9074 |
punct |
/,SvJ |
| R2633 |
T9076 |
T9077 |
punct |
(,score |
| R2634 |
T9077 |
T9072 |
parataxis |
score,background |
| R2635 |
T9078 |
T9079 |
nummod |
two,point |
| R2636 |
T9079 |
T9077 |
compound |
point,score |
| R2637 |
T9080 |
T9079 |
punct |
-,point |
| R2638 |
T9081 |
T9077 |
compound |
LOD,score |
| R2639 |
T9082 |
T9077 |
nummod |
5.13,score |
| R2640 |
T9083 |
T9077 |
prep |
at,score |
| R2641 |
T9084 |
T9085 |
compound |
marker,20.MMHAP85FLG2 |
| R2642 |
T9085 |
T9083 |
pobj |
20.MMHAP85FLG2,at |
| R2643 |
T9086 |
T9077 |
punct |
),score |
| R2644 |
T9087 |
T9050 |
punct |
.,performed |
| R2645 |
T9089 |
T9090 |
prep |
In,performed |
| R2646 |
T9091 |
T9092 |
det |
an,attempt |
| R2647 |
T9092 |
T9089 |
pobj |
attempt,In |
| R2648 |
T9093 |
T9094 |
aux |
to,narrow |
| R2649 |
T9094 |
T9092 |
acl |
narrow,attempt |
| R2650 |
T9095 |
T9096 |
det |
the,interval |
| R2651 |
T9096 |
T9094 |
dobj |
interval,narrow |
| R2652 |
T9097 |
T9096 |
compound |
disease,interval |
| R2653 |
T9098 |
T9090 |
nsubj |
we,performed |
| R2654 |
T9099 |
T9100 |
compound |
backcross,experiments |
| R2655 |
T9100 |
T9090 |
dobj |
experiments,performed |
| R2656 |
T9101 |
T9102 |
dep |
that,resulted |
| R2657 |
T9102 |
T9100 |
relcl |
resulted,experiments |
| R2658 |
T9103 |
T9102 |
prep |
in,resulted |
| R2659 |
T9104 |
T9105 |
det |
the,generation |
| R2660 |
T9105 |
T9103 |
pobj |
generation,in |
| R2661 |
T9106 |
T9105 |
prep |
of,generation |
| R2662 |
T9107 |
T9108 |
nummod |
three,mice |
| R2663 |
T9108 |
T9106 |
pobj |
mice,of |
| R2664 |
T9109 |
T9108 |
amod |
additional,mice |
| R2665 |
T9110 |
T9108 |
amod |
affected,mice |
| R2666 |
T9111 |
T9090 |
punct |
.,performed |
| R2667 |
T9113 |
T9114 |
nsubj |
Genotyping,revealed |
| R2668 |
T9115 |
T9113 |
prep |
of,Genotyping |
| R2669 |
T9116 |
T9117 |
det |
all,mice |
| R2670 |
T9117 |
T9115 |
pobj |
mice,of |
| R2671 |
T9118 |
T9117 |
amod |
affected,mice |
| R2672 |
T9119 |
T9113 |
prep |
across,Genotyping |
| R2673 |
T9120 |
T9121 |
det |
the,interval |
| R2674 |
T9121 |
T9119 |
pobj |
interval,across |
| R2675 |
T9122 |
T9123 |
npadvmod |
disease,segregating |
| R2676 |
T9123 |
T9121 |
amod |
segregating,interval |
| R2677 |
T9124 |
T9123 |
punct |
-,segregating |
| R2678 |
T9125 |
T9126 |
amod |
flanking,recombinants |
| R2679 |
T9126 |
T9114 |
dobj |
recombinants,revealed |
| R2680 |
T9127 |
T9126 |
cc |
and,recombinants |
| R2681 |
T9128 |
T9129 |
det |
a,region |
| R2682 |
T9129 |
T9126 |
conj |
region,recombinants |
| R2683 |
T9130 |
T9129 |
compound |
candidate,region |
| R2684 |
T9131 |
T9129 |
prep |
of,region |
| R2685 |
T9132 |
T9133 |
punct |
~,5 |
| R2686 |
T9133 |
T9134 |
nummod |
5,Mb |
| R2687 |
T9134 |
T9131 |
pobj |
Mb,of |
| R2688 |
T9135 |
T9114 |
punct |
", ",revealed |
| R2689 |
T9136 |
T9114 |
prep |
between,revealed |
| R2690 |
T9137 |
T9138 |
compound |
markers,D6Mit37 |
| R2691 |
T9138 |
T9136 |
pobj |
D6Mit37,between |
| R2692 |
T9139 |
T9138 |
cc |
and,D6Mit37 |
| R2693 |
T9140 |
T9138 |
conj |
44.MMHAP85FLG5,D6Mit37 |
| R2694 |
T9141 |
T9142 |
punct |
(,S1 |
| R2695 |
T9142 |
T9114 |
parataxis |
S1,revealed |
| R2696 |
T9143 |
T9142 |
compound |
Figure,S1 |
| R2697 |
T9144 |
T9142 |
punct |
),S1 |
| R2698 |
T9145 |
T9114 |
punct |
.,revealed |
| R2699 |
T9147 |
T9148 |
det |
This,region |
| R2700 |
T9148 |
T9149 |
nsubj |
region,contains |
| R2701 |
T9150 |
T9151 |
nummod |
16,genes |
| R2702 |
T9151 |
T9149 |
dobj |
genes,contains |
| R2703 |
T9152 |
T9151 |
cc |
and,genes |
| R2704 |
T9153 |
T9154 |
amod |
predicted,transcripts |
| R2705 |
T9154 |
T9151 |
conj |
transcripts,genes |
| R2706 |
T9155 |
T9149 |
punct |
.,contains |
| R2709 |
T9603 |
T9602 |
prep |
of,Identification |
| R2710 |
T9604 |
T9605 |
det |
the,lesion |
| R2711 |
T9605 |
T9603 |
pobj |
lesion,of |
| R2712 |
T9606 |
T9605 |
amod |
underlying,lesion |
| R2713 |
T9607 |
T9605 |
amod |
genetic,lesion |
| R2714 |
T9608 |
T9602 |
prep |
in,Identification |
| R2715 |
T9609 |
T9608 |
pobj |
mice,in |
| R2716 |
T9610 |
T9602 |
punct |
.,Identification |
| R2717 |
T9612 |
T9613 |
nsubjpass |
Identification,performed |
| R2718 |
T9614 |
T9612 |
prep |
of,Identification |
| R2719 |
T9615 |
T9616 |
amod |
similar,phenotypes |
| R2720 |
T9616 |
T9614 |
pobj |
phenotypes,of |
| R2721 |
T9617 |
T9616 |
prep |
in,phenotypes |
| R2722 |
T9618 |
T9617 |
pobj |
mice,in |
| R2723 |
T9619 |
T9618 |
acl |
linked,mice |
| R2724 |
T9620 |
T9619 |
prep |
to,linked |
| R2725 |
T9621 |
T9622 |
det |
the,interval |
| R2726 |
T9622 |
T9620 |
pobj |
interval,to |
| R2727 |
T9623 |
T9622 |
compound |
6qE1,interval |
| R2728 |
T9624 |
T9613 |
auxpass |
was,performed |
| R2729 |
T9625 |
T9613 |
prep |
by,performed |
| R2730 |
T9626 |
T9627 |
compound |
literature,searches |
| R2731 |
T9627 |
T9625 |
pobj |
searches,by |
| R2732 |
T9628 |
T9613 |
punct |
.,performed |
| R2733 |
T9630 |
T9631 |
nsubj |
This,revealed |
| R2734 |
T9632 |
T9633 |
det |
the,mouse |
| R2735 |
T9633 |
T9631 |
dobj |
mouse,revealed |
| R2736 |
T9634 |
T9635 |
compound |
Itpr1opt,opt |
| R2737 |
T9635 |
T9633 |
compound |
opt,mouse |
| R2738 |
T9636 |
T9635 |
punct |
/,opt |
| R2739 |
T9637 |
T9633 |
punct |
", ",mouse |
| R2740 |
T9638 |
T9639 |
prep |
in,caused |
| R2741 |
T9639 |
T9633 |
relcl |
caused,mouse |
| R2742 |
T9640 |
T9638 |
pobj |
which,in |
| R2743 |
T9641 |
T9639 |
nsubjpass |
disease,caused |
| R2744 |
T9642 |
T9639 |
auxpass |
is,caused |
| R2745 |
T9643 |
T9639 |
agent |
by,caused |
| R2746 |
T9644 |
T9645 |
amod |
homozygous,mutation |
| R2747 |
T9645 |
T9643 |
pobj |
mutation,by |
| R2748 |
T9646 |
T9645 |
compound |
deletion,mutation |
| R2749 |
T9647 |
T9645 |
prep |
of,mutation |
| R2750 |
T9648 |
T9649 |
nmod |
exons,43 |
| R2751 |
T9649 |
T9647 |
pobj |
43,of |
| R2752 |
T9650 |
T9649 |
cc |
and,43 |
| R2753 |
T9651 |
T9649 |
conj |
44,43 |
| R2754 |
T9652 |
T9649 |
prep |
of,43 |
| R2755 |
T9653 |
T9652 |
pobj |
Itpr1,of |
| R2756 |
T9654 |
T9631 |
punct |
.,revealed |
| R2757 |
T9656 |
T9657 |
compound |
Primer,pairs |
| R2758 |
T9657 |
T9658 |
nsubjpass |
pairs,designed |
| R2759 |
T9659 |
T9658 |
auxpass |
were,designed |
| R2760 |
T9660 |
T9661 |
aux |
to,sequence |
| R2761 |
T9661 |
T9658 |
advcl |
sequence,designed |
| R2762 |
T9662 |
T9661 |
dobj |
each,sequence |
| R2763 |
T9663 |
T9662 |
prep |
of,each |
| R2764 |
T9664 |
T9665 |
det |
the,exons |
| R2765 |
T9665 |
T9663 |
pobj |
exons,of |
| R2766 |
T9666 |
T9665 |
compound |
coding,exons |
| R2767 |
T9667 |
T9662 |
cc |
and,each |
| R2768 |
T9668 |
T9669 |
advmod |
at,50 |
| R2769 |
T9669 |
T9671 |
nummod |
50,bp |
| R2770 |
T9670 |
T9669 |
advmod |
least,50 |
| R2771 |
T9671 |
T9662 |
conj |
bp,each |
| R2772 |
T9672 |
T9671 |
prep |
of,bp |
| R2773 |
T9673 |
T9674 |
det |
each,sequence |
| R2774 |
T9674 |
T9672 |
pobj |
sequence,of |
| R2775 |
T9675 |
T9674 |
amod |
flanking,sequence |
| R2776 |
T9676 |
T9674 |
amod |
intronic,sequence |
| R2777 |
T9677 |
T9662 |
prep |
of,each |
| R2778 |
T9678 |
T9677 |
pobj |
Itpr1,of |
| R2779 |
T9679 |
T9658 |
punct |
.,designed |
| R2780 |
T9681 |
T9682 |
compound |
PCR,amplification |
| R2781 |
T9682 |
T9683 |
nsubjpass |
amplification,performed |
| R2782 |
T9684 |
T9682 |
prep |
of,amplification |
| R2783 |
T9685 |
T9686 |
det |
each,exon |
| R2784 |
T9686 |
T9684 |
pobj |
exon,of |
| R2785 |
T9687 |
T9683 |
auxpass |
was,performed |
| R2786 |
T9688 |
T9683 |
advcl |
using,performed |
| R2787 |
T9689 |
T9688 |
dobj |
DNA,using |
| R2788 |
T9690 |
T9689 |
prep |
from,DNA |
| R2789 |
T9691 |
T9692 |
nummod |
two,mice |
| R2790 |
T9692 |
T9690 |
pobj |
mice,from |
| R2791 |
T9693 |
T9692 |
amod |
affected,mice |
| R2792 |
T9694 |
T9688 |
prep |
as,using |
| R2793 |
T9695 |
T9694 |
pobj |
templates,as |
| R2794 |
T9696 |
T9683 |
punct |
.,performed |
| R2795 |
T9698 |
T9699 |
det |
The,mutation |
| R2796 |
T9699 |
T9703 |
nsubjpass |
mutation,confirmed |
| R2797 |
T9700 |
T9701 |
compound |
Itpr1Δ18,Δ18 |
| R2798 |
T9701 |
T9699 |
compound |
Δ18,mutation |
| R2799 |
T9702 |
T9701 |
punct |
/,Δ18 |
| R2800 |
T9704 |
T9703 |
auxpass |
was,confirmed |
| R2801 |
T9705 |
T9703 |
prep |
by,confirmed |
| R2802 |
T9706 |
T9705 |
pobj |
sequencing,by |
| R2803 |
T9707 |
T9703 |
prep |
in,confirmed |
| R2804 |
T9708 |
T9709 |
det |
all,mice |
| R2805 |
T9709 |
T9707 |
pobj |
mice,in |
| R2806 |
T9710 |
T9709 |
amod |
affected,mice |
| R2807 |
T9711 |
T9712 |
punct |
(,S2 |
| R2808 |
T9712 |
T9703 |
parataxis |
S2,confirmed |
| R2809 |
T9713 |
T9712 |
compound |
Figure,S2 |
| R2810 |
T9714 |
T9712 |
punct |
),S2 |
| R2811 |
T9715 |
T9703 |
punct |
.,confirmed |
| R2812 |
T9717 |
T9718 |
amod |
Breeding,experiments |
| R2813 |
T9718 |
T9719 |
nsubjpass |
experiments,performed |
| R2814 |
T9720 |
T9719 |
auxpass |
were,performed |
| R2815 |
T9721 |
T9719 |
prep |
between,performed |
| R2816 |
T9722 |
T9723 |
nummod |
two,mice |
| R2817 |
T9723 |
T9721 |
pobj |
mice,between |
| R2818 |
T9724 |
T9723 |
amod |
female,mice |
| R2819 |
T9725 |
T9723 |
amod |
heterozygous,mice |
| R2820 |
T9726 |
T9725 |
prep |
for,heterozygous |
| R2821 |
T9727 |
T9728 |
det |
the,mutation |
| R2822 |
T9728 |
T9726 |
pobj |
mutation,for |
| R2823 |
T9729 |
T9728 |
amod |
current,mutation |
| R2824 |
T9730 |
T9731 |
punct |
(,Δ18 |
| R2825 |
T9731 |
T9728 |
parataxis |
Δ18,mutation |
| R2826 |
T9732 |
T9731 |
compound |
Itpr1wt,Δ18 |
| R2827 |
T9733 |
T9731 |
punct |
/,Δ18 |
| R2828 |
T9734 |
T9731 |
punct |
),Δ18 |
| R2829 |
T9735 |
T9723 |
cc |
and,mice |
| R2830 |
T9736 |
T9737 |
det |
a,mouse |
| R2831 |
T9737 |
T9723 |
conj |
mouse,mice |
| R2832 |
T9738 |
T9737 |
amod |
male,mouse |
| R2833 |
T9739 |
T9737 |
amod |
heterozygous,mouse |
| R2834 |
T9740 |
T9739 |
prep |
for,heterozygous |
| R2835 |
T9741 |
T9742 |
det |
the,mutation |
| R2836 |
T9742 |
T9740 |
pobj |
mutation,for |
| R2837 |
T9743 |
T9742 |
compound |
Itpr1opt,mutation |
| R2838 |
T9744 |
T9745 |
punct |
(,opt |
| R2839 |
T9745 |
T9742 |
parataxis |
opt,mutation |
| R2840 |
T9746 |
T9745 |
compound |
Itpr1wt,opt |
| R2841 |
T9747 |
T9745 |
punct |
/,opt |
| R2842 |
T9748 |
T9745 |
punct |
),opt |
| R2843 |
T9749 |
T9719 |
punct |
.,performed |
| R2844 |
T9751 |
T9752 |
nsubj |
This,resulted |
| R2845 |
T9753 |
T9752 |
prep |
in,resulted |
| R2846 |
T9754 |
T9755 |
nummod |
two,litters |
| R2847 |
T9755 |
T9753 |
pobj |
litters,in |
| R2848 |
T9756 |
T9755 |
prep |
of,litters |
| R2849 |
T9757 |
T9756 |
pobj |
mice,of |
| R2850 |
T9758 |
T9755 |
prep |
with,litters |
| R2851 |
T9759 |
T9760 |
det |
a,total |
| R2852 |
T9760 |
T9758 |
pobj |
total,with |
| R2853 |
T9761 |
T9760 |
prep |
of,total |
| R2854 |
T9762 |
T9763 |
nummod |
four,pups |
| R2855 |
T9763 |
T9761 |
pobj |
pups,of |
| R2856 |
T9764 |
T9763 |
amod |
affected,pups |
| R2857 |
T9765 |
T9766 |
compound |
Itpr1opt,Δ18 |
| R2858 |
T9766 |
T9763 |
compound |
Δ18,pups |
| R2859 |
T9767 |
T9766 |
punct |
/,Δ18 |
| R2860 |
T9768 |
T9769 |
punct |
(,eight |
| R2861 |
T9769 |
T9763 |
parataxis |
eight,pups |
| R2862 |
T9770 |
T9769 |
prep |
from,eight |
| R2863 |
T9771 |
T9772 |
det |
a,total |
| R2864 |
T9772 |
T9770 |
pobj |
total,from |
| R2865 |
T9773 |
T9772 |
prep |
of,total |
| R2866 |
T9774 |
T9773 |
pobj |
15,of |
| R2867 |
T9775 |
T9769 |
punct |
;,eight |
| R2868 |
T9776 |
T9777 |
quantmod |
two,seven |
| R2869 |
T9777 |
T9769 |
dep |
seven,eight |
| R2870 |
T9778 |
T9777 |
quantmod |
of,seven |
| R2871 |
T9779 |
T9777 |
prep |
from,seven |
| R2872 |
T9780 |
T9781 |
amod |
first,mating |
| R2873 |
T9781 |
T9779 |
pobj |
mating,from |
| R2874 |
T9782 |
T9769 |
punct |
;,eight |
| R2875 |
T9783 |
T9769 |
quantmod |
two,eight |
| R2876 |
T9784 |
T9769 |
quantmod |
of,eight |
| R2877 |
T9785 |
T9769 |
prep |
from,eight |
| R2878 |
T9786 |
T9787 |
det |
the,mating |
| R2879 |
T9787 |
T9785 |
pobj |
mating,from |
| R2880 |
T9788 |
T9787 |
amod |
second,mating |
| R2881 |
T9789 |
T9769 |
punct |
),eight |
| R2882 |
T9790 |
T9763 |
prep |
with,pups |
| R2883 |
T9791 |
T9792 |
det |
a,phenotype |
| R2884 |
T9792 |
T9790 |
pobj |
phenotype,with |
| R2885 |
T9793 |
T9792 |
amod |
indistinguishable,phenotype |
| R2886 |
T9794 |
T9793 |
prep |
from,indistinguishable |
| R2887 |
T9795 |
T9794 |
pobj |
that,from |
| R2888 |
T9796 |
T9795 |
prep |
of,that |
| R2889 |
T9797 |
T9798 |
det |
the,mice |
| R2890 |
T9798 |
T9796 |
pobj |
mice,of |
| R2891 |
T9799 |
T9800 |
nmod |
Itpr1Δ18,Δ18 |
| R2892 |
T9800 |
T9798 |
nmod |
Δ18,mice |
| R2893 |
T9801 |
T9800 |
punct |
/,Δ18 |
| R2894 |
T9802 |
T9800 |
cc |
and,Δ18 |
| R2895 |
T9803 |
T9804 |
compound |
Itpr1opt,opt |
| R2896 |
T9804 |
T9800 |
conj |
opt,Δ18 |
| R2897 |
T9805 |
T9804 |
punct |
/,opt |
| R2898 |
T9806 |
T9752 |
punct |
.,resulted |
| R2899 |
T10117 |
T10116 |
prep |
of,Analysis |
| R2900 |
T10118 |
T10119 |
compound |
Itpr1,protein |
| R2901 |
T10119 |
T10117 |
pobj |
protein,of |
| R2902 |
T10120 |
T10119 |
prep |
in,protein |
| R2903 |
T10121 |
T10120 |
pobj |
mice,in |
| R2904 |
T10122 |
T10116 |
punct |
.,Analysis |
| R2905 |
T10124 |
T10125 |
nsubj |
We,performed |
| R2906 |
T10126 |
T10127 |
compound |
Western,blot |
| R2907 |
T10127 |
T10128 |
compound |
blot,analyses |
| R2908 |
T10128 |
T10125 |
dobj |
analyses,performed |
| R2909 |
T10129 |
T10125 |
advcl |
using,performed |
| R2910 |
T10130 |
T10131 |
amod |
standard,techniques |
| R2911 |
T10131 |
T10129 |
dobj |
techniques,using |
| R2912 |
T10132 |
T10125 |
prep |
with,performed |
| R2913 |
T10133 |
T10134 |
compound |
ECL,kits |
| R2914 |
T10134 |
T10132 |
pobj |
kits,with |
| R2915 |
T10135 |
T10134 |
compound |
detection,kits |
| R2916 |
T10136 |
T10137 |
punct |
(,Amersham |
| R2917 |
T10137 |
T10134 |
parataxis |
Amersham,kits |
| R2918 |
T10138 |
T10137 |
punct |
", ",Amersham |
| R2919 |
T10139 |
T10137 |
npadvmod |
http://www.amersham.com,Amersham |
| R2920 |
T10140 |
T10137 |
punct |
),Amersham |
| R2921 |
T10141 |
T10125 |
punct |
.,performed |
| R2922 |
T10143 |
T10144 |
advmod |
Briefly,homogenized |
| R2923 |
T10145 |
T10144 |
punct |
", ",homogenized |
| R2924 |
T10146 |
T10147 |
amod |
dissected,brains |
| R2925 |
T10147 |
T10144 |
nsubjpass |
brains,homogenized |
| R2926 |
T10148 |
T10147 |
amod |
whole,brains |
| R2927 |
T10149 |
T10147 |
prep |
from,brains |
| R2928 |
T10150 |
T10151 |
amod |
postnatal,day |
| R2929 |
T10151 |
T10152 |
nmod |
day,littermates |
| R2930 |
T10152 |
T10149 |
pobj |
littermates,from |
| R2931 |
T10153 |
T10151 |
nummod |
21,day |
| R2932 |
T10154 |
T10144 |
auxpass |
were,homogenized |
| R2933 |
T10155 |
T10144 |
prep |
in,homogenized |
| R2934 |
T10156 |
T10157 |
det |
a,buffer |
| R2935 |
T10157 |
T10155 |
pobj |
buffer,in |
| R2936 |
T10158 |
T10157 |
acl |
containing,buffer |
| R2937 |
T10159 |
T10160 |
nummod |
50,mM |
| R2938 |
T10160 |
T10161 |
compound |
mM,HCl |
| R2939 |
T10161 |
T10158 |
dobj |
HCl,containing |
| R2940 |
T10162 |
T10161 |
compound |
Tris,HCl |
| R2941 |
T10163 |
T10161 |
punct |
-,HCl |
| R2942 |
T10164 |
T10161 |
punct |
", ",HCl |
| R2943 |
T10165 |
T10166 |
nummod |
150,mM |
| R2944 |
T10166 |
T10167 |
compound |
mM,NaCl |
| R2945 |
T10167 |
T10161 |
conj |
NaCl,HCl |
| R2946 |
T10168 |
T10167 |
punct |
", ",NaCl |
| R2947 |
T10169 |
T10170 |
nummod |
1,mM |
| R2948 |
T10170 |
T10171 |
compound |
mM,EDTA |
| R2949 |
T10171 |
T10167 |
conj |
EDTA,NaCl |
| R2950 |
T10172 |
T10171 |
punct |
", ",EDTA |
| R2951 |
T10173 |
T10174 |
nummod |
1,% |
| R2952 |
T10174 |
T10175 |
compound |
%,X |
| R2953 |
T10175 |
T10171 |
conj |
X,EDTA |
| R2954 |
T10176 |
T10175 |
compound |
Triton,X |
| R2955 |
T10177 |
T10175 |
punct |
-,X |
| R2956 |
T10178 |
T10175 |
nummod |
100,X |
| R2957 |
T10179 |
T10175 |
punct |
", ",X |
| R2958 |
T10180 |
T10181 |
nummod |
1,% |
| R2959 |
T10181 |
T10182 |
compound |
%,deoxycholate |
| R2960 |
T10182 |
T10175 |
conj |
deoxycholate,X |
| R2961 |
T10183 |
T10182 |
compound |
sodium,deoxycholate |
| R2962 |
T10184 |
T10182 |
punct |
", ",deoxycholate |
| R2963 |
T10185 |
T10186 |
nummod |
0.1,% |
| R2964 |
T10186 |
T10187 |
compound |
%,SDS |
| R2965 |
T10187 |
T10182 |
conj |
SDS,deoxycholate |
| R2966 |
T10188 |
T10187 |
punct |
", ",SDS |
| R2967 |
T10189 |
T10187 |
cc |
and,SDS |
| R2968 |
T10190 |
T10191 |
det |
a,cocktail |
| R2969 |
T10191 |
T10187 |
conj |
cocktail,SDS |
| R2970 |
T10192 |
T10191 |
prep |
of,cocktail |
| R2971 |
T10193 |
T10194 |
compound |
protease,inhibitors |
| R2972 |
T10194 |
T10192 |
pobj |
inhibitors,of |
| R2973 |
T10195 |
T10196 |
punct |
(,Roche |
| R2974 |
T10196 |
T10191 |
parataxis |
Roche,cocktail |
| R2975 |
T10197 |
T10196 |
punct |
", ",Roche |
| R2976 |
T10198 |
T10196 |
npadvmod |
http://www.roche.com,Roche |
| R2977 |
T10199 |
T10196 |
punct |
),Roche |
| R2978 |
T10200 |
T10144 |
punct |
.,homogenized |
| R2979 |
T10202 |
T10203 |
nsubjpass |
Homogenates,diluted |
| R2980 |
T10204 |
T10203 |
auxpass |
were,diluted |
| R2981 |
T10205 |
T10203 |
advmod |
appropriately,diluted |
| R2982 |
T10206 |
T10203 |
punct |
", ",diluted |
| R2983 |
T10207 |
T10203 |
conj |
mixed,diluted |
| R2984 |
T10208 |
T10207 |
prep |
with,mixed |
| R2985 |
T10209 |
T10210 |
nummod |
4,buffer |
| R2986 |
T10210 |
T10208 |
pobj |
buffer,with |
| R2987 |
T10211 |
T10209 |
punct |
×,4 |
| R2988 |
T10212 |
T10210 |
amod |
reducing,buffer |
| R2989 |
T10213 |
T10210 |
compound |
sample,buffer |
| R2990 |
T10214 |
T10207 |
punct |
", ",mixed |
| R2991 |
T10215 |
T10207 |
cc |
and,mixed |
| R2992 |
T10216 |
T10207 |
conj |
loaded,mixed |
| R2993 |
T10217 |
T10216 |
prep |
onto,loaded |
| R2994 |
T10218 |
T10219 |
nummod |
4,% |
| R2995 |
T10219 |
T10220 |
nmod |
%,gels |
| R2996 |
T10220 |
T10217 |
pobj |
gels,onto |
| R2997 |
T10221 |
T10222 |
punct |
–,% |
| R2998 |
T10222 |
T10219 |
prep |
%,% |
| R2999 |
T10223 |
T10222 |
nummod |
12,% |
| R3000 |
T10224 |
T10220 |
compound |
precast,gels |
| R3001 |
T10225 |
T10220 |
compound |
gradient,gels |
| R3002 |
T10226 |
T10227 |
punct |
(,Novex |
| R3003 |
T10227 |
T10220 |
parataxis |
Novex,gels |
| R3004 |
T10228 |
T10227 |
punct |
", ",Novex |
| R3005 |
T10229 |
T10227 |
npadvmod |
http://www.invitrogen.com,Novex |
| R3006 |
T10230 |
T10227 |
punct |
),Novex |
| R3007 |
T10231 |
T10216 |
prep |
for,loaded |
| R3008 |
T10232 |
T10233 |
compound |
SDS,PAGE |
| R3009 |
T10233 |
T10231 |
pobj |
PAGE,for |
| R3010 |
T10234 |
T10233 |
punct |
-,PAGE |
| R3011 |
T10235 |
T10233 |
cc |
and,PAGE |
| R3012 |
T10236 |
T10233 |
conj |
immunoblotting,PAGE |
| R3013 |
T10237 |
T10203 |
punct |
.,diluted |
| R3014 |
T10239 |
T10240 |
det |
The,antibodies |
| R3015 |
T10240 |
T10241 |
nsubjpass |
antibodies,used |
| R3016 |
T10242 |
T10240 |
prep |
to,antibodies |
| R3017 |
T10243 |
T10242 |
pobj |
Itpr1,to |
| R3018 |
T10244 |
T10245 |
punct |
(,1 |
| R3019 |
T10245 |
T10243 |
parataxis |
1,Itpr1 |
| R3020 |
T10246 |
T10247 |
punct |
:,"2,000" |
| R3021 |
T10247 |
T10245 |
prep |
"2,000",1 |
| R3022 |
T10248 |
T10245 |
punct |
),1 |
| R3023 |
T10249 |
T10243 |
cc |
and,Itpr1 |
| R3024 |
T10250 |
T10243 |
conj |
Actb,Itpr1 |
| R3025 |
T10251 |
T10252 |
punct |
(,1 |
| R3026 |
T10252 |
T10250 |
parataxis |
1,Actb |
| R3027 |
T10253 |
T10254 |
punct |
:,"5,000" |
| R3028 |
T10254 |
T10252 |
prep |
"5,000",1 |
| R3029 |
T10255 |
T10252 |
punct |
),1 |
| R3030 |
T10256 |
T10241 |
auxpass |
were,used |
| R3031 |
T10257 |
T10258 |
mark |
as,recommended |
| R3032 |
T10258 |
T10241 |
advcl |
recommended,used |
| R3033 |
T10259 |
T10258 |
agent |
by,recommended |
| R3034 |
T10260 |
T10259 |
pobj |
manufacturers,by |
| R3035 |
T10261 |
T10241 |
punct |
.,used |
| R3036 |
T10936 |
T10935 |
punct |
.,Immunohistochemistry |
| R3037 |
T10938 |
T10939 |
nsubjpass |
Brains,isolated |
| R3038 |
T10940 |
T10939 |
auxpass |
were,isolated |
| R3039 |
T10941 |
T10939 |
prep |
from,isolated |
| R3040 |
T10942 |
T10943 |
nummod |
21,d |
| R3041 |
T10943 |
T10945 |
npadvmod |
d,old |
| R3042 |
T10944 |
T10943 |
punct |
-,d |
| R3043 |
T10945 |
T10947 |
amod |
old,mice |
| R3044 |
T10946 |
T10945 |
punct |
-,old |
| R3045 |
T10947 |
T10941 |
pobj |
mice,from |
| R3046 |
T10948 |
T10939 |
punct |
", ",isolated |
| R3047 |
T10949 |
T10939 |
conj |
perfused,isolated |
| R3048 |
T10950 |
T10949 |
prep |
with,perfused |
| R3049 |
T10951 |
T10952 |
nummod |
4,% |
| R3050 |
T10952 |
T10953 |
compound |
%,paraformaldehyde |
| R3051 |
T10953 |
T10950 |
pobj |
paraformaldehyde,with |
| R3052 |
T10954 |
T10953 |
prep |
in,paraformaldehyde |
| R3053 |
T10955 |
T10954 |
pobj |
PBS,in |
| R3054 |
T10956 |
T10949 |
punct |
", ",perfused |
| R3055 |
T10957 |
T10949 |
cc |
and,perfused |
| R3056 |
T10958 |
T10949 |
conj |
post-fixed,perfused |
| R3057 |
T10959 |
T10958 |
advmod |
overnight,post-fixed |
| R3058 |
T10960 |
T10958 |
prep |
in,post-fixed |
| R3059 |
T10961 |
T10962 |
det |
the,fixative |
| R3060 |
T10962 |
T10960 |
pobj |
fixative,in |
| R3061 |
T10963 |
T10962 |
amod |
same,fixative |
| R3062 |
T10964 |
T10939 |
punct |
.,isolated |
| R3063 |
T10966 |
T10967 |
nsubjpass |
Brains,embedded |
| R3064 |
T10968 |
T10967 |
auxpass |
were,embedded |
| R3065 |
T10969 |
T10967 |
prep |
in,embedded |
| R3066 |
T10970 |
T10969 |
pobj |
gelatin,in |
| R3067 |
T10971 |
T10967 |
punct |
", ",embedded |
| R3068 |
T10972 |
T10967 |
cc |
and,embedded |
| R3069 |
T10973 |
T10974 |
nummod |
35,μm |
| R3070 |
T10974 |
T10976 |
nmod |
μm,sections |
| R3071 |
T10975 |
T10974 |
punct |
-,μm |
| R3072 |
T10976 |
T10978 |
nsubjpass |
sections,cut |
| R3073 |
T10977 |
T10976 |
amod |
sagittal,sections |
| R3074 |
T10978 |
T10967 |
conj |
cut,embedded |
| R3075 |
T10979 |
T10978 |
auxpass |
were,cut |
| R3076 |
T10980 |
T10978 |
advcl |
using,cut |
| R3077 |
T10981 |
T10982 |
det |
a,microtome |
| R3078 |
T10982 |
T10980 |
dobj |
microtome,using |
| R3079 |
T10983 |
T10982 |
amod |
sliding,microtome |
| R3080 |
T10984 |
T10985 |
punct |
(,Associates |
| R3081 |
T10985 |
T10982 |
parataxis |
Associates,microtome |
| R3082 |
T10986 |
T10985 |
compound |
NeuroScience,Associates |
| R3083 |
T10987 |
T10985 |
punct |
", ",Associates |
| R3084 |
T10988 |
T10985 |
npadvmod |
http://www.neuroscienceassociates.com,Associates |
| R3085 |
T10989 |
T10985 |
punct |
),Associates |
| R3086 |
T10990 |
T10978 |
punct |
.,cut |
| R3087 |
T10992 |
T10993 |
nsubjpass |
Sections,placed |
| R3088 |
T10994 |
T10992 |
prep |
from,Sections |
| R3089 |
T10995 |
T10996 |
amod |
wild,type |
| R3090 |
T10996 |
T10998 |
nmod |
type,brains |
| R3091 |
T10997 |
T10996 |
punct |
-,type |
| R3092 |
T10998 |
T10994 |
pobj |
brains,from |
| R3093 |
T10999 |
T10996 |
punct |
", ",type |
| R3094 |
T11000 |
T10996 |
conj |
heterozygote,type |
| R3095 |
T11001 |
T11000 |
punct |
", ",heterozygote |
| R3096 |
T11002 |
T11000 |
cc |
and,heterozygote |
| R3097 |
T11003 |
T11000 |
conj |
homozygous,heterozygote |
| R3098 |
T11004 |
T10993 |
auxpass |
were,placed |
| R3099 |
T11005 |
T10993 |
prep |
in,placed |
| R3100 |
T11006 |
T11007 |
det |
the,template |
| R3101 |
T11007 |
T11005 |
pobj |
template,in |
| R3102 |
T11008 |
T11007 |
compound |
MultiBrain,template |
| R3103 |
T11009 |
T10993 |
punct |
.,placed |
| R3104 |
T11011 |
T11012 |
nsubjpass |
Sections,washed |
| R3105 |
T11013 |
T11012 |
auxpass |
were,washed |
| R3106 |
T11014 |
T11012 |
prep |
in,washed |
| R3107 |
T11015 |
T11016 |
nummod |
1,PBS |
| R3108 |
T11016 |
T11014 |
pobj |
PBS,in |
| R3109 |
T11017 |
T11015 |
punct |
×,1 |
| R3110 |
T11018 |
T11019 |
advmod |
prior,to |
| R3111 |
T11019 |
T11012 |
prep |
to,washed |
| R3112 |
T11020 |
T11021 |
nummod |
1,h |
| R3113 |
T11021 |
T11019 |
pobj |
h,to |
| R3114 |
T11022 |
T11021 |
prep |
of,h |
| R3115 |
T11023 |
T11022 |
pobj |
incubation,of |
| R3116 |
T11024 |
T11023 |
prep |
in,incubation |
| R3117 |
T11025 |
T11026 |
compound |
block,solution |
| R3118 |
T11026 |
T11024 |
pobj |
solution,in |
| R3119 |
T11027 |
T11026 |
acl |
containing,solution |
| R3120 |
T11028 |
T11029 |
nummod |
1,PBS |
| R3121 |
T11029 |
T11027 |
dobj |
PBS,containing |
| R3122 |
T11030 |
T11028 |
punct |
×,1 |
| R3123 |
T11031 |
T11029 |
prep |
with,PBS |
| R3124 |
T11032 |
T11033 |
nummod |
20,% |
| R3125 |
T11033 |
T11034 |
nmod |
%,serum |
| R3126 |
T11034 |
T11031 |
pobj |
serum,with |
| R3127 |
T11035 |
T11034 |
amod |
normal,serum |
| R3128 |
T11036 |
T11034 |
compound |
goat,serum |
| R3129 |
T11037 |
T11034 |
cc |
and,serum |
| R3130 |
T11038 |
T11039 |
nummod |
0.3,% |
| R3131 |
T11039 |
T11040 |
compound |
%,X |
| R3132 |
T11040 |
T11034 |
conj |
X,serum |
| R3133 |
T11041 |
T11040 |
compound |
Triton,X |
| R3134 |
T11042 |
T11040 |
punct |
-,X |
| R3135 |
T11043 |
T11040 |
nummod |
100,X |
| R3136 |
T11044 |
T11045 |
punct |
(,pH |
| R3137 |
T11045 |
T11040 |
parataxis |
pH,X |
| R3138 |
T11046 |
T11045 |
nummod |
7.4,pH |
| R3139 |
T11047 |
T11045 |
punct |
),pH |
| R3140 |
T11048 |
T11012 |
punct |
.,washed |
| R3141 |
T11050 |
T11051 |
nsubjpass |
Sections,incubated |
| R3142 |
T11052 |
T11051 |
auxpass |
were,incubated |
| R3143 |
T11053 |
T11051 |
advmod |
overnight,incubated |
| R3144 |
T11054 |
T11051 |
prep |
at,incubated |
| R3145 |
T11055 |
T11056 |
nummod |
4,°C |
| R3146 |
T11056 |
T11054 |
pobj |
°C,at |
| R3147 |
T11057 |
T11051 |
prep |
in,incubated |
| R3148 |
T11058 |
T11059 |
amod |
primary,antibodies |
| R3149 |
T11059 |
T11057 |
pobj |
antibodies,in |
| R3150 |
T11060 |
T11059 |
punct |
: ,antibodies |
| R3151 |
T11061 |
T11062 |
nmod |
affinity,antibody |
| R3152 |
T11062 |
T11059 |
appos |
antibody,antibodies |
| R3153 |
T11063 |
T11062 |
amod |
purified,antibody |
| R3154 |
T11064 |
T11062 |
amod |
polyclonal,antibody |
| R3155 |
T11065 |
T11062 |
compound |
Itpr1,antibody |
| R3156 |
T11066 |
T11067 |
punct |
(,International |
| R3157 |
T11067 |
T11062 |
parataxis |
International,antibody |
| R3158 |
T11068 |
T11067 |
dep |
1,International |
| R3159 |
T11069 |
T11070 |
punct |
:,"2,000" |
| R3160 |
T11070 |
T11068 |
prep |
"2,000",1 |
| R3161 |
T11071 |
T11067 |
punct |
", ",International |
| R3162 |
T11072 |
T11067 |
compound |
Chemicon,International |
| R3163 |
T11073 |
T11067 |
punct |
", ",International |
| R3164 |
T11074 |
T11067 |
npadvmod |
http://www.chemicon.com,International |
| R3165 |
T11075 |
T11067 |
punct |
),International |
| R3166 |
T11076 |
T11062 |
cc |
and,antibody |
| R3167 |
T11077 |
T11078 |
amod |
monoclonal,antibody |
| R3168 |
T11078 |
T11062 |
conj |
antibody,antibody |
| R3169 |
T11079 |
T11078 |
amod |
anti-Calb1,antibody |
| R3170 |
T11080 |
T11081 |
punct |
(,Aldrich |
| R3171 |
T11081 |
T11078 |
parataxis |
Aldrich,antibody |
| R3172 |
T11082 |
T11081 |
dep |
1,Aldrich |
| R3173 |
T11083 |
T11084 |
punct |
:,"6,000" |
| R3174 |
T11084 |
T11082 |
prep |
"6,000",1 |
| R3175 |
T11085 |
T11081 |
punct |
", ",Aldrich |
| R3176 |
T11086 |
T11081 |
compound |
Sigma,Aldrich |
| R3177 |
T11087 |
T11081 |
punct |
-,Aldrich |
| R3178 |
T11088 |
T11081 |
punct |
", ",Aldrich |
| R3179 |
T11089 |
T11081 |
npadvmod |
http://www.sigmaaldrich.com,Aldrich |
| R3180 |
T11090 |
T11081 |
punct |
),Aldrich |
| R3181 |
T11091 |
T11062 |
acl |
diluted,antibody |
| R3182 |
T11092 |
T11091 |
prep |
in,diluted |
| R3183 |
T11093 |
T11094 |
compound |
carrier,solution |
| R3184 |
T11094 |
T11092 |
pobj |
solution,in |
| R3185 |
T11095 |
T11051 |
punct |
.,incubated |
| R3186 |
T11097 |
T11098 |
prep |
Following,incubated |
| R3187 |
T11099 |
T11100 |
amod |
extensive,washes |
| R3188 |
T11100 |
T11097 |
pobj |
washes,Following |
| R3189 |
T11101 |
T11100 |
punct |
(,washes |
| R3190 |
T11102 |
T11100 |
prep |
in,washes |
| R3191 |
T11103 |
T11104 |
nummod |
6.0,ml |
| R3192 |
T11104 |
T11102 |
pobj |
ml,in |
| R3193 |
T11105 |
T11104 |
prep |
of,ml |
| R3194 |
T11106 |
T11105 |
pobj |
PBS,of |
| R3195 |
T11107 |
T11108 |
punct |
", ",times |
| R3196 |
T11108 |
T11100 |
parataxis |
times,washes |
| R3197 |
T11109 |
T11108 |
nummod |
three,times |
| R3198 |
T11110 |
T11108 |
punct |
),times |
| R3199 |
T11111 |
T11098 |
punct |
", ",incubated |
| R3200 |
T11112 |
T11098 |
nsubjpass |
sections,incubated |
| R3201 |
T11113 |
T11098 |
auxpass |
were,incubated |
| R3202 |
T11114 |
T11098 |
prep |
with,incubated |
| R3203 |
T11115 |
T11116 |
amod |
appropriate,antibodies |
| R3204 |
T11116 |
T11114 |
pobj |
antibodies,with |
| R3205 |
T11117 |
T11116 |
amod |
secondary,antibodies |
| R3206 |
T11118 |
T11119 |
punct |
(,IgG |
| R3207 |
T11119 |
T11116 |
parataxis |
IgG,antibodies |
| R3208 |
T11120 |
T11121 |
nmod |
Alexa,Fluor |
| R3209 |
T11121 |
T11119 |
nmod |
Fluor,IgG |
| R3210 |
T11122 |
T11121 |
nummod |
555,Fluor |
| R3211 |
T11123 |
T11119 |
nmod |
goat,IgG |
| R3212 |
T11124 |
T11119 |
amod |
anti-rabbit,IgG |
| R3213 |
T11125 |
T11119 |
cc |
and,IgG |
| R3214 |
T11126 |
T11127 |
nmod |
Alexa,Fluor |
| R3215 |
T11127 |
T11128 |
nmod |
Fluor,IgG |
| R3216 |
T11128 |
T11119 |
conj |
IgG,IgG |
| R3217 |
T11129 |
T11127 |
nummod |
488,Fluor |
| R3218 |
T11130 |
T11128 |
nmod |
goat,IgG |
| R3219 |
T11131 |
T11128 |
amod |
anti-mouse,IgG |
| R3220 |
T11132 |
T11133 |
punct |
[,Invitrogen |
| R3221 |
T11133 |
T11128 |
parataxis |
Invitrogen,IgG |
| R3222 |
T11134 |
T11133 |
punct |
", ",Invitrogen |
| R3223 |
T11135 |
T11133 |
npadvmod |
http://www.invitrogen.com,Invitrogen |
| R3224 |
T11136 |
T11133 |
punct |
],Invitrogen |
| R3225 |
T11137 |
T11119 |
punct |
),IgG |
| R3226 |
T11138 |
T11098 |
prep |
for,incubated |
| R3227 |
T11139 |
T11140 |
nummod |
1,h |
| R3228 |
T11140 |
T11138 |
pobj |
h,for |
| R3229 |
T11141 |
T11098 |
prep |
at,incubated |
| R3230 |
T11142 |
T11143 |
compound |
room,temperature |
| R3231 |
T11143 |
T11141 |
pobj |
temperature,at |
| R3232 |
T11144 |
T11098 |
punct |
.,incubated |
| R3233 |
T11146 |
T11147 |
nsubjpass |
Sections,washed |
| R3234 |
T11148 |
T11147 |
auxpass |
were,washed |
| R3235 |
T11149 |
T11147 |
cc |
and,washed |
| R3236 |
T11150 |
T11147 |
conj |
mounted,washed |
| R3237 |
T11151 |
T11150 |
prep |
on,mounted |
| R3238 |
T11152 |
T11153 |
compound |
glass,slides |
| R3239 |
T11153 |
T11151 |
pobj |
slides,on |
| R3240 |
T11154 |
T11150 |
prep |
in,mounted |
| R3241 |
T11155 |
T11156 |
det |
a,medium |
| R3242 |
T11156 |
T11154 |
pobj |
medium,in |
| R3243 |
T11157 |
T11156 |
amod |
buffered,medium |
| R3244 |
T11158 |
T11156 |
acl |
containing,medium |
| R3245 |
T11159 |
T11158 |
dobj |
Mowiol,containing |
| R3246 |
T11160 |
T11161 |
punct |
(,Calbiochem |
| R3247 |
T11161 |
T11159 |
parataxis |
Calbiochem,Mowiol |
| R3248 |
T11162 |
T11161 |
punct |
", ",Calbiochem |
| R3249 |
T11163 |
T11161 |
npadvmod |
http://www.emdbiosciences.com,Calbiochem |
| R3250 |
T11164 |
T11161 |
punct |
),Calbiochem |
| R3251 |
T11165 |
T11166 |
mark |
as,described |
| R3252 |
T11166 |
T11150 |
advcl |
described,mounted |
| R3253 |
T11167 |
T11166 |
advmod |
earlier,described |
| R3254 |
T11168 |
T11169 |
punct |
[,14 |
| R3255 |
T11169 |
T11150 |
parataxis |
14,mounted |
| R3256 |
T11170 |
T11169 |
punct |
],14 |
| R3257 |
T11171 |
T11147 |
punct |
.,washed |
| R3258 |
T11173 |
T11174 |
nsubjpass |
Sections,imaged |
| R3259 |
T11175 |
T11174 |
auxpass |
were,imaged |
| R3260 |
T11176 |
T11174 |
advcl |
using,imaged |
| R3261 |
T11177 |
T11178 |
det |
a,microscope |
| R3262 |
T11178 |
T11176 |
dobj |
microscope,using |
| R3263 |
T11179 |
T11178 |
nmod |
laser,microscope |
| R3264 |
T11180 |
T11178 |
amod |
scanning,microscope |
| R3265 |
T11181 |
T11178 |
amod |
confocal,microscope |
| R3266 |
T11182 |
T11183 |
punct |
(,Zeiss |
| R3267 |
T11183 |
T11178 |
parataxis |
Zeiss,microscope |
| R3268 |
T11184 |
T11183 |
dep |
LSM,Zeiss |
| R3269 |
T11185 |
T11184 |
nummod |
510,LSM |
| R3270 |
T11186 |
T11183 |
punct |
;,Zeiss |
| R3271 |
T11187 |
T11183 |
punct |
", ",Zeiss |
| R3272 |
T11188 |
T11183 |
npadvmod |
http://www.zeiss.com,Zeiss |
| R3273 |
T11189 |
T11183 |
punct |
),Zeiss |
| R3274 |
T11190 |
T11174 |
punct |
.,imaged |
| R3275 |
T11192 |
T11193 |
compound |
Imaging,parameters |
| R3276 |
T11193 |
T11194 |
nsubjpass |
parameters,optimized |
| R3277 |
T11195 |
T11196 |
punct |
(,pinhole |
| R3278 |
T11196 |
T11193 |
parataxis |
pinhole,parameters |
| R3279 |
T11197 |
T11196 |
punct |
", ",pinhole |
| R3280 |
T11198 |
T11199 |
compound |
detector,gain |
| R3281 |
T11199 |
T11196 |
appos |
gain,pinhole |
| R3282 |
T11200 |
T11196 |
punct |
", ",pinhole |
| R3283 |
T11201 |
T11202 |
compound |
laser,power |
| R3284 |
T11202 |
T11196 |
appos |
power,pinhole |
| R3285 |
T11203 |
T11196 |
punct |
),pinhole |
| R3286 |
T11204 |
T11194 |
auxpass |
were,optimized |
| R3287 |
T11205 |
T11194 |
punct |
", ",optimized |
| R3288 |
T11206 |
T11194 |
cc |
and,optimized |
| R3289 |
T11207 |
T11208 |
auxpass |
were,kept |
| R3290 |
T11208 |
T11194 |
conj |
kept,optimized |
| R3291 |
T11209 |
T11208 |
oprd |
constant,kept |
| R3292 |
T11210 |
T11208 |
prep |
for,kept |
| R3293 |
T11211 |
T11212 |
det |
the,brains |
| R3294 |
T11212 |
T11210 |
pobj |
brains,for |
| R3295 |
T11213 |
T11214 |
amod |
wild,type |
| R3296 |
T11214 |
T11212 |
nmod |
type,brains |
| R3297 |
T11215 |
T11214 |
punct |
-,type |
| R3298 |
T11216 |
T11214 |
punct |
", ",type |
| R3299 |
T11217 |
T11214 |
conj |
heterozygous,type |
| R3300 |
T11218 |
T11217 |
punct |
", ",heterozygous |
| R3301 |
T11219 |
T11217 |
cc |
and,heterozygous |
| R3302 |
T11220 |
T11217 |
conj |
homozygous,heterozygous |
| R3303 |
T11221 |
T11212 |
compound |
mutant,brains |
| R3304 |
T11222 |
T11194 |
punct |
.,optimized |
| R3305 |
T11224 |
T11225 |
nsubjpass |
Specificity,verified |
| R3306 |
T11226 |
T11224 |
prep |
of,Specificity |
| R3307 |
T11227 |
T11228 |
det |
the,antibodies |
| R3308 |
T11228 |
T11226 |
pobj |
antibodies,of |
| R3309 |
T11229 |
T11228 |
compound |
Itpr1,antibodies |
| R3310 |
T11230 |
T11225 |
auxpass |
was,verified |
| R3311 |
T11231 |
T11225 |
prep |
by,verified |
| R3312 |
T11232 |
T11233 |
compound |
preabsorption,experiments |
| R3313 |
T11233 |
T11231 |
pobj |
experiments,by |
| R3314 |
T11234 |
T11233 |
compound |
control,experiments |
| R3315 |
T11235 |
T11225 |
punct |
.,verified |
| R3316 |
T11237 |
T11238 |
compound |
Antibody,dilutions |
| R3317 |
T11238 |
T11239 |
nsubjpass |
dilutions,incubated |
| R3318 |
T11240 |
T11239 |
auxpass |
were,incubated |
| R3319 |
T11241 |
T11239 |
prep |
for,incubated |
| R3320 |
T11242 |
T11243 |
nummod |
24,h |
| R3321 |
T11243 |
T11241 |
pobj |
h,for |
| R3322 |
T11244 |
T11239 |
prep |
at,incubated |
| R3323 |
T11245 |
T11246 |
nummod |
4,°C |
| R3324 |
T11246 |
T11244 |
pobj |
°C,at |
| R3325 |
T11247 |
T11239 |
prep |
with,incubated |
| R3326 |
T11248 |
T11249 |
det |
the,peptide |
| R3327 |
T11249 |
T11247 |
pobj |
peptide,with |
| R3328 |
T11250 |
T11249 |
amod |
immunizing,peptide |
| R3329 |
T11251 |
T11239 |
punct |
.,incubated |
| R3330 |
T11253 |
T11254 |
compound |
Tissue,sections |
| R3331 |
T11254 |
T11255 |
nsubjpass |
sections,incubated |
| R3332 |
T11256 |
T11255 |
auxpass |
were,incubated |
| R3333 |
T11257 |
T11255 |
prep |
with,incubated |
| R3334 |
T11258 |
T11259 |
det |
the,antibodies |
| R3335 |
T11259 |
T11257 |
pobj |
antibodies,with |
| R3336 |
T11260 |
T11259 |
amod |
preabsorbed,antibodies |
| R3337 |
T11261 |
T11255 |
cc |
and,incubated |
| R3338 |
T11262 |
T11255 |
conj |
processed,incubated |
| R3339 |
T11263 |
T11264 |
mark |
as,described |
| R3340 |
T11264 |
T11262 |
advcl |
described,processed |
| R3341 |
T11265 |
T11264 |
advmod |
above,described |
| R3342 |
T11266 |
T11255 |
punct |
.,incubated |
| R3343 |
T11268 |
T11269 |
prep |
Under,detected |
| R3344 |
T11270 |
T11271 |
det |
these,conditions |
| R3345 |
T11271 |
T11268 |
pobj |
conditions,Under |
| R3346 |
T11272 |
T11269 |
punct |
", ",detected |
| R3347 |
T11273 |
T11274 |
det |
no,staining |
| R3348 |
T11274 |
T11269 |
nsubjpass |
staining,detected |
| R3349 |
T11275 |
T11274 |
prep |
above,staining |
| R3350 |
T11276 |
T11275 |
pobj |
autofluorescence,above |
| R3351 |
T11277 |
T11269 |
auxpass |
was,detected |
| R3352 |
T11278 |
T11269 |
punct |
.,detected |
| R3355 |
T12756 |
T12755 |
prep |
of,Analysis |
| R3356 |
T12757 |
T12756 |
pobj |
ITPR1,of |
| R3357 |
T12758 |
T12757 |
prep |
in,ITPR1 |
| R3358 |
T12759 |
T12760 |
compound |
SCA15,patients |
| R3359 |
T12760 |
T12758 |
pobj |
patients,in |
| R3360 |
T12761 |
T12755 |
punct |
.,Analysis |
| R3361 |
T12763 |
T12764 |
nsubjpass |
DNA,extracted |
| R3362 |
T12765 |
T12764 |
auxpass |
was,extracted |
| R3363 |
T12766 |
T12764 |
prep |
from,extracted |
| R3364 |
T12767 |
T12768 |
nmod |
EBV,lymphocytes |
| R3365 |
T12768 |
T12766 |
pobj |
lymphocytes,from |
| R3366 |
T12769 |
T12768 |
amod |
immortalized,lymphocytes |
| R3367 |
T12770 |
T12768 |
punct |
", ",lymphocytes |
| R3368 |
T12771 |
T12768 |
acl |
derived,lymphocytes |
| R3369 |
T12772 |
T12771 |
prep |
from,derived |
| R3370 |
T12773 |
T12774 |
compound |
family,members |
| R3371 |
T12774 |
T12772 |
pobj |
members,from |
| R3372 |
T12775 |
T12764 |
punct |
.,extracted |
| R3373 |
T12777 |
T12778 |
det |
The,exons |
| R3374 |
T12778 |
T12780 |
nsubjpass |
exons,amplified |
| R3375 |
T12779 |
T12778 |
amod |
coding,exons |
| R3376 |
T12781 |
T12778 |
cc |
and,exons |
| R3377 |
T12782 |
T12783 |
advmod |
at,50 |
| R3378 |
T12783 |
T12785 |
nummod |
50,bp |
| R3379 |
T12784 |
T12783 |
advmod |
least,50 |
| R3380 |
T12785 |
T12778 |
conj |
bp,exons |
| R3381 |
T12786 |
T12785 |
prep |
of,bp |
| R3382 |
T12787 |
T12788 |
amod |
flanking,introns |
| R3383 |
T12788 |
T12786 |
pobj |
introns,of |
| R3384 |
T12789 |
T12788 |
prep |
of,introns |
| R3385 |
T12790 |
T12789 |
pobj |
ITPR1,of |
| R3386 |
T12791 |
T12780 |
auxpass |
were,amplified |
| R3387 |
T12792 |
T12780 |
dep |
PCR,amplified |
| R3388 |
T12793 |
T12780 |
cc |
and,amplified |
| R3389 |
T12794 |
T12780 |
conj |
sequenced,amplified |
| R3390 |
T12795 |
T12794 |
advcl |
using,sequenced |
| R3391 |
T12796 |
T12797 |
compound |
dye,terminator |
| R3392 |
T12797 |
T12799 |
compound |
terminator,sequencing |
| R3393 |
T12798 |
T12797 |
punct |
-,terminator |
| R3394 |
T12799 |
T12795 |
dobj |
sequencing,using |
| R3395 |
T12800 |
T12801 |
punct |
(,Biosystems |
| R3396 |
T12801 |
T12799 |
parataxis |
Biosystems,sequencing |
| R3397 |
T12802 |
T12803 |
compound |
BigDye,version |
| R3398 |
T12803 |
T12801 |
dep |
version,Biosystems |
| R3399 |
T12804 |
T12803 |
nummod |
3.1,version |
| R3400 |
T12805 |
T12801 |
punct |
;,Biosystems |
| R3401 |
T12806 |
T12801 |
compound |
Applied,Biosystems |
| R3402 |
T12807 |
T12801 |
punct |
", ",Biosystems |
| R3403 |
T12808 |
T12801 |
npadvmod |
http://www.appliedbiosystems.com,Biosystems |
| R3404 |
T12809 |
T12801 |
punct |
),Biosystems |
| R3405 |
T12810 |
T12780 |
punct |
.,amplified |
| R3406 |
T12812 |
T12813 |
compound |
Sequence,reactions |
| R3407 |
T12813 |
T12814 |
nsubjpass |
reactions,run |
| R3408 |
T12815 |
T12814 |
auxpass |
were,run |
| R3409 |
T12816 |
T12814 |
prep |
on,run |
| R3410 |
T12817 |
T12818 |
det |
an,sequencer |
| R3411 |
T12818 |
T12816 |
pobj |
sequencer,on |
| R3412 |
T12819 |
T12818 |
nmod |
ABI3730XP,sequencer |
| R3413 |
T12820 |
T12818 |
amod |
automated,sequencer |
| R3414 |
T12821 |
T12814 |
prep |
as,run |
| R3415 |
T12822 |
T12821 |
prep |
per,as |
| R3416 |
T12823 |
T12824 |
det |
the,manufacturer |
| R3417 |
T12824 |
T12825 |
poss |
manufacturer,instructions |
| R3418 |
T12825 |
T12822 |
pobj |
instructions,per |
| R3419 |
T12826 |
T12824 |
case |
's,manufacturer |
| R3420 |
T12827 |
T12828 |
punct |
(,Biosystems |
| R3421 |
T12828 |
T12825 |
parataxis |
Biosystems,instructions |
| R3422 |
T12829 |
T12828 |
compound |
Applied,Biosystems |
| R3423 |
T12830 |
T12828 |
punct |
),Biosystems |
| R3424 |
T12831 |
T12814 |
punct |
.,run |
| R3425 |
T12833 |
T12834 |
det |
This,analysis |
| R3426 |
T12834 |
T12835 |
nsubjpass |
analysis,performed |
| R3427 |
T12836 |
T12835 |
auxpass |
was,performed |
| R3428 |
T12837 |
T12835 |
prep |
in,performed |
| R3429 |
T12838 |
T12839 |
det |
all,members |
| R3430 |
T12839 |
T12837 |
pobj |
members,in |
| R3431 |
T12840 |
T12839 |
nummod |
three,members |
| R3432 |
T12841 |
T12839 |
amod |
affected,members |
| R3433 |
T12842 |
T12839 |
compound |
family,members |
| R3434 |
T12843 |
T12844 |
prep |
for,was |
| R3435 |
T12844 |
T12839 |
relcl |
was,members |
| R3436 |
T12845 |
T12843 |
pobj |
whom,for |
| R3437 |
T12846 |
T12847 |
amod |
genomic,DNA |
| R3438 |
T12847 |
T12844 |
nsubj |
DNA,was |
| R3439 |
T12848 |
T12844 |
acomp |
available,was |
| R3440 |
T12849 |
T12850 |
punct |
(,6 |
| R3441 |
T12850 |
T12839 |
parataxis |
6,members |
| R3442 |
T12851 |
T12850 |
nmod |
members,6 |
| R3443 |
T12852 |
T12850 |
punct |
", ",6 |
| R3444 |
T12853 |
T12850 |
conj |
7,6 |
| R3445 |
T12854 |
T12853 |
punct |
", ",7 |
| R3446 |
T12855 |
T12853 |
cc |
and,7 |
| R3447 |
T12856 |
T12853 |
conj |
19,7 |
| R3448 |
T12857 |
T12850 |
punct |
),6 |
| R3449 |
T12858 |
T12835 |
punct |
.,performed |
| R3450 |
T12860 |
T12861 |
compound |
Primer,sequences |
| R3451 |
T12861 |
T12862 |
nsubj |
sequences,are |
| R3452 |
T12863 |
T12861 |
cc |
and,sequences |
| R3453 |
T12864 |
T12861 |
conj |
conditions,sequences |
| R3454 |
T12865 |
T12862 |
acomp |
available,are |
| R3455 |
T12866 |
T12862 |
prep |
upon,are |
| R3456 |
T12867 |
T12866 |
pobj |
request,upon |
| R3457 |
T12868 |
T12862 |
punct |
.,are |
| R3458 |
T12870 |
T12871 |
compound |
Sequence,data |
| R3459 |
T12871 |
T12872 |
nsubjpass |
data,analyzed |
| R3460 |
T12873 |
T12872 |
auxpass |
were,analyzed |
| R3461 |
T12874 |
T12872 |
advcl |
using,analyzed |
| R3462 |
T12875 |
T12874 |
dobj |
Sequencher,using |
| R3463 |
T12876 |
T12877 |
punct |
(,Corporation |
| R3464 |
T12877 |
T12875 |
parataxis |
Corporation,Sequencher |
| R3465 |
T12878 |
T12879 |
compound |
Gene,Codes |
| R3466 |
T12879 |
T12877 |
compound |
Codes,Corporation |
| R3467 |
T12880 |
T12877 |
punct |
", ",Corporation |
| R3468 |
T12881 |
T12877 |
npadvmod |
http://www.genecodes.com,Corporation |
| R3469 |
T12882 |
T12877 |
punct |
),Corporation |
| R3470 |
T12883 |
T12872 |
punct |
.,analyzed |
| R3471 |
T12885 |
T12886 |
npadvmod |
Genome,wide |
| R3472 |
T12886 |
T12888 |
amod |
wide,genotyping |
| R3473 |
T12887 |
T12886 |
punct |
-,wide |
| R3474 |
T12888 |
T12890 |
nsubjpass |
genotyping,performed |
| R3475 |
T12889 |
T12888 |
compound |
SNP,genotyping |
| R3476 |
T12891 |
T12890 |
auxpass |
was,performed |
| R3477 |
T12892 |
T12890 |
advcl |
using,performed |
| R3478 |
T12893 |
T12894 |
compound |
Infinium,SNP |
| R3479 |
T12894 |
T12896 |
compound |
SNP,chips |
| R3480 |
T12895 |
T12894 |
compound |
HumanHap550,SNP |
| R3481 |
T12896 |
T12892 |
dobj |
chips,using |
| R3482 |
T12897 |
T12896 |
compound |
genotyping,chips |
| R3483 |
T12898 |
T12892 |
prep |
as,using |
| R3484 |
T12899 |
T12898 |
prep |
per,as |
| R3485 |
T12900 |
T12901 |
det |
the,manufacturer |
| R3486 |
T12901 |
T12902 |
poss |
manufacturer,protocol |
| R3487 |
T12902 |
T12899 |
pobj |
protocol,per |
| R3488 |
T12903 |
T12901 |
case |
's,manufacturer |
| R3489 |
T12904 |
T12905 |
punct |
(,Illumina |
| R3490 |
T12905 |
T12902 |
parataxis |
Illumina,protocol |
| R3491 |
T12906 |
T12905 |
punct |
", ",Illumina |
| R3492 |
T12907 |
T12905 |
npadvmod |
http://www.illumina.com,Illumina |
| R3493 |
T12908 |
T12905 |
punct |
),Illumina |
| R3494 |
T12909 |
T12890 |
punct |
.,performed |
| R3495 |
T12911 |
T12912 |
det |
This,product |
| R3496 |
T12912 |
T12913 |
nsubj |
product,assays |
| R3497 |
T12914 |
T12915 |
nummod |
"555,352",SNPs |
| R3498 |
T12915 |
T12913 |
dobj |
SNPs,assays |
| R3499 |
T12916 |
T12915 |
amod |
unique,SNPs |
| R3500 |
T12917 |
T12913 |
punct |
.,assays |
| R3501 |
T12919 |
T12920 |
nsubjpass |
Data,collected |
| R3502 |
T12921 |
T12920 |
auxpass |
were,collected |
| R3503 |
T12922 |
T12920 |
advcl |
using,collected |
| R3504 |
T12923 |
T12924 |
det |
the,scanner |
| R3505 |
T12924 |
T12922 |
dobj |
scanner,using |
| R3506 |
T12925 |
T12926 |
compound |
Illumina,BeadStation |
| R3507 |
T12926 |
T12924 |
compound |
BeadStation,scanner |
| R3508 |
T12927 |
T12924 |
cc |
and,scanner |
| R3509 |
T12928 |
T12929 |
compound |
data,collection |
| R3510 |
T12929 |
T12930 |
compound |
collection,software |
| R3511 |
T12930 |
T12924 |
conj |
software,scanner |
| R3512 |
T12931 |
T12920 |
punct |
.,collected |
| R3513 |
T12933 |
T12934 |
nsubjpass |
Genotypes,produced |
| R3514 |
T12935 |
T12934 |
auxpass |
were,produced |
| R3515 |
T12936 |
T12934 |
advcl |
using,produced |
| R3516 |
T12937 |
T12938 |
det |
the,module |
| R3517 |
T12938 |
T12936 |
dobj |
module,using |
| R3518 |
T12939 |
T12938 |
compound |
genotyping,module |
| R3519 |
T12940 |
T12938 |
prep |
of,module |
| R3520 |
T12941 |
T12940 |
pobj |
BeadStudio,of |
| R3521 |
T12942 |
T12943 |
punct |
(,version |
| R3522 |
T12943 |
T12941 |
parataxis |
version,BeadStudio |
| R3523 |
T12944 |
T12943 |
nummod |
2.3.25,version |
| R3524 |
T12945 |
T12943 |
punct |
;,version |
| R3525 |
T12946 |
T12943 |
appos |
Illumina,version |
| R3526 |
T12947 |
T12943 |
punct |
),version |
| R3527 |
T12948 |
T12934 |
punct |
", ",produced |
| R3528 |
T12949 |
T12934 |
cc |
and,produced |
| R3529 |
T12950 |
T12951 |
compound |
log,R |
| R3530 |
T12951 |
T12952 |
compound |
R,ratio |
| R3531 |
T12952 |
T12953 |
nsubjpass |
ratio,visualized |
| R3532 |
T12953 |
T12934 |
conj |
visualized,produced |
| R3533 |
T12954 |
T12952 |
cc |
and,ratio |
| R3534 |
T12955 |
T12956 |
compound |
B,allele |
| R3535 |
T12956 |
T12957 |
compound |
allele,frequency |
| R3536 |
T12957 |
T12952 |
conj |
frequency,ratio |
| R3537 |
T12958 |
T12953 |
auxpass |
were,visualized |
| R3538 |
T12959 |
T12953 |
advcl |
using,visualized |
| R3539 |
T12960 |
T12961 |
det |
the,tool |
| R3540 |
T12961 |
T12959 |
dobj |
tool,using |
| R3541 |
T12962 |
T12961 |
nmod |
genome,tool |
| R3542 |
T12963 |
T12962 |
amod |
viewer,genome |
| R3543 |
T12964 |
T12961 |
prep |
within,tool |
| R3544 |
T12965 |
T12966 |
det |
this,package |
| R3545 |
T12966 |
T12964 |
pobj |
package,within |
| R3546 |
T12967 |
T12953 |
punct |
.,visualized |
| R3547 |
T12969 |
T12970 |
prep |
In,examined |
| R3548 |
T12971 |
T12969 |
pobj |
order,In |
| R3549 |
T12972 |
T12973 |
aux |
to,rule |
| R3550 |
T12973 |
T12971 |
acl |
rule,order |
| R3551 |
T12974 |
T12973 |
prt |
out,rule |
| R3552 |
T12975 |
T12976 |
det |
the,possibility |
| R3553 |
T12976 |
T12973 |
dobj |
possibility,rule |
| R3554 |
T12977 |
T12978 |
mark |
that,was |
| R3555 |
T12978 |
T12976 |
acl |
was,possibility |
| R3556 |
T12979 |
T12980 |
det |
the,deletion |
| R3557 |
T12980 |
T12978 |
nsubj |
deletion,was |
| R3558 |
T12981 |
T12980 |
amod |
observed,deletion |
| R3559 |
T12982 |
T12980 |
prep |
within,deletion |
| R3560 |
T12983 |
T12982 |
pobj |
ITPR1,within |
| R3561 |
T12984 |
T12985 |
det |
a,variant |
| R3562 |
T12985 |
T12978 |
attr |
variant,was |
| R3563 |
T12986 |
T12985 |
amod |
benign,variant |
| R3564 |
T12987 |
T12985 |
compound |
copy,variant |
| R3565 |
T12988 |
T12985 |
compound |
number,variant |
| R3566 |
T12989 |
T12970 |
nsubj |
we,examined |
| R3567 |
T12990 |
T12991 |
nmod |
log,R |
| R3568 |
T12991 |
T12992 |
nmod |
R,ratio |
| R3569 |
T12992 |
T12993 |
nmod |
ratio,metrics |
| R3570 |
T12993 |
T12970 |
dobj |
metrics,examined |
| R3571 |
T12994 |
T12992 |
cc |
and,ratio |
| R3572 |
T12995 |
T12996 |
compound |
B,allele |
| R3573 |
T12996 |
T12997 |
compound |
allele,frequency |
| R3574 |
T12997 |
T12992 |
conj |
frequency,ratio |
| R3575 |
T12998 |
T12993 |
prep |
of,metrics |
| R3576 |
T12999 |
T13000 |
compound |
HumanHap550,data |
| R3577 |
T13000 |
T12998 |
pobj |
data,of |
| R3578 |
T13001 |
T13000 |
compound |
genotyping,data |
| R3579 |
T13002 |
T13000 |
prep |
at,data |
| R3580 |
T13003 |
T13004 |
det |
this,locus |
| R3581 |
T13004 |
T13002 |
pobj |
locus,at |
| R3582 |
T13005 |
T13000 |
prep |
from,data |
| R3583 |
T13006 |
T13007 |
nummod |
577,individuals |
| R3584 |
T13007 |
T13005 |
pobj |
individuals,from |
| R3585 |
T13008 |
T13007 |
prep |
of,individuals |
| R3586 |
T13009 |
T13010 |
amod |
Northern,European |
| R3587 |
T13010 |
T13011 |
amod |
European,descent |
| R3588 |
T13011 |
T13008 |
pobj |
descent,of |
| R3589 |
T13012 |
T13007 |
prep |
from,individuals |
| R3590 |
T13013 |
T13014 |
compound |
North,America |
| R3591 |
T13014 |
T13012 |
pobj |
America,from |
| R3592 |
T13015 |
T13014 |
cc |
and,America |
| R3593 |
T13016 |
T13014 |
conj |
Europe,America |
| R3594 |
T13017 |
T13000 |
punct |
", ",data |
| R3595 |
T13018 |
T13000 |
acl |
produced,data |
| R3596 |
T13019 |
T13018 |
agent |
by,produced |
| R3597 |
T13020 |
T13019 |
pobj |
us,by |
| R3598 |
T13021 |
T13018 |
prep |
as,produced |
| R3599 |
T13022 |
T13023 |
det |
a,part |
| R3600 |
T13023 |
T13021 |
pobj |
part,as |
| R3601 |
T13024 |
T13023 |
prep |
of,part |
| R3602 |
T13025 |
T13026 |
det |
an,study |
| R3603 |
T13026 |
T13024 |
pobj |
study,of |
| R3604 |
T13027 |
T13026 |
amod |
ongoing,study |
| R3605 |
T13028 |
T12970 |
punct |
.,examined |
| R3606 |
T13030 |
T13031 |
prep |
In,designed |
| R3607 |
T13032 |
T13033 |
det |
an,attempt |
| R3608 |
T13033 |
T13030 |
pobj |
attempt,In |
| R3609 |
T13034 |
T13035 |
aux |
to,narrow |
| R3610 |
T13035 |
T13033 |
acl |
narrow,attempt |
| R3611 |
T13036 |
T13037 |
det |
the,intervals |
| R3612 |
T13037 |
T13035 |
dobj |
intervals,narrow |
| R3613 |
T13038 |
T13037 |
amod |
unknown,intervals |
| R3614 |
T13039 |
T13037 |
acl |
flanking,intervals |
| R3615 |
T13040 |
T13041 |
det |
the,deletion |
| R3616 |
T13041 |
T13039 |
dobj |
deletion,flanking |
| R3617 |
T13042 |
T13041 |
acl |
observed,deletion |
| R3618 |
T13043 |
T13042 |
prep |
in,observed |
| R3619 |
T13044 |
T13045 |
compound |
family,AUS1 |
| R3620 |
T13045 |
T13043 |
pobj |
AUS1,in |
| R3621 |
T13046 |
T13031 |
punct |
", ",designed |
| R3622 |
T13047 |
T13031 |
nsubj |
we,designed |
| R3623 |
T13048 |
T13031 |
dobj |
primers,designed |
| R3624 |
T13049 |
T13048 |
prep |
for,primers |
| R3625 |
T13050 |
T13051 |
nummod |
30,amplifications |
| R3626 |
T13051 |
T13049 |
pobj |
amplifications,for |
| R3627 |
T13052 |
T13051 |
compound |
PCR,amplifications |
| R3628 |
T13053 |
T13054 |
dep |
that,generate |
| R3629 |
T13054 |
T13051 |
relcl |
generate,amplifications |
| R3630 |
T13055 |
T13054 |
aux |
would,generate |
| R3631 |
T13056 |
T13057 |
amod |
overlapping,fragments |
| R3632 |
T13057 |
T13054 |
dobj |
fragments,generate |
| R3633 |
T13058 |
T13054 |
prep |
across,generate |
| R3634 |
T13059 |
T13060 |
det |
the,regions |
| R3635 |
T13060 |
T13058 |
pobj |
regions,across |
| R3636 |
T13061 |
T13060 |
nummod |
two,regions |
| R3637 |
T13062 |
T13060 |
compound |
bordering,regions |
| R3638 |
T13063 |
T13064 |
punct |
(,sequence |
| R3639 |
T13064 |
T13060 |
parataxis |
sequence,regions |
| R3640 |
T13065 |
T13064 |
compound |
primer,sequence |
| R3641 |
T13066 |
T13064 |
cc |
and,sequence |
| R3642 |
T13067 |
T13064 |
conj |
conditions,sequence |
| R3643 |
T13068 |
T13064 |
amod |
available,sequence |
| R3644 |
T13069 |
T13068 |
prep |
upon,available |
| R3645 |
T13070 |
T13069 |
pobj |
request,upon |
| R3646 |
T13071 |
T13064 |
punct |
),sequence |
| R3647 |
T13072 |
T13031 |
punct |
.,designed |
| R3648 |
T13074 |
T13075 |
expl |
There,were |
| R3649 |
T13076 |
T13077 |
nummod |
ten,pairs |
| R3650 |
T13077 |
T13075 |
attr |
pairs,were |
| R3651 |
T13078 |
T13077 |
compound |
primer,pairs |
| R3652 |
T13079 |
T13077 |
prep |
in,pairs |
| R3653 |
T13080 |
T13081 |
det |
the,region |
| R3654 |
T13081 |
T13079 |
pobj |
region,in |
| R3655 |
T13082 |
T13081 |
amod |
telomeric,region |
| R3656 |
T13083 |
T13081 |
compound |
flanking,region |
| R3657 |
T13084 |
T13077 |
cc |
and,pairs |
| R3658 |
T13085 |
T13086 |
nummod |
20,pairs |
| R3659 |
T13086 |
T13077 |
conj |
pairs,pairs |
| R3660 |
T13087 |
T13086 |
prep |
in,pairs |
| R3661 |
T13088 |
T13089 |
det |
the,region |
| R3662 |
T13089 |
T13087 |
pobj |
region,in |
| R3663 |
T13090 |
T13089 |
amod |
centromeric,region |
| R3664 |
T13091 |
T13089 |
compound |
flanking,region |
| R3665 |
T13092 |
T13093 |
punct |
(,S3 |
| R3666 |
T13093 |
T13075 |
parataxis |
S3,were |
| R3667 |
T13094 |
T13093 |
compound |
Figure,S3 |
| R3668 |
T13095 |
T13093 |
punct |
),S3 |
| R3669 |
T13096 |
T13075 |
punct |
.,were |
| R3670 |
T13098 |
T13099 |
prep |
On,was |
| R3671 |
T13100 |
T13098 |
amod |
average,On |
| R3672 |
T13101 |
T13102 |
det |
each,product |
| R3673 |
T13102 |
T13099 |
nsubj |
product,was |
| R3674 |
T13103 |
T13104 |
punct |
~,750 |
| R3675 |
T13104 |
T13105 |
nummod |
750,bp |
| R3676 |
T13105 |
T13099 |
attr |
bp,was |
| R3677 |
T13106 |
T13105 |
prep |
in,bp |
| R3678 |
T13107 |
T13106 |
pobj |
size,in |
| R3679 |
T13108 |
T13099 |
punct |
", ",was |
| R3680 |
T13109 |
T13099 |
cc |
and,was |
| R3681 |
T13110 |
T13111 |
nsubjpass |
amplifications,performed |
| R3682 |
T13111 |
T13099 |
conj |
performed,was |
| R3683 |
T13112 |
T13111 |
auxpass |
were,performed |
| R3684 |
T13113 |
T13111 |
advcl |
using,performed |
| R3685 |
T13114 |
T13115 |
amod |
genomic,DNA |
| R3686 |
T13115 |
T13113 |
dobj |
DNA,using |
| R3687 |
T13116 |
T13113 |
prep |
from,using |
| R3688 |
T13117 |
T13116 |
pobj |
each,from |
| R3689 |
T13118 |
T13117 |
prep |
of,each |
| R3690 |
T13119 |
T13120 |
det |
the,individuals |
| R3691 |
T13120 |
T13118 |
pobj |
individuals,of |
| R3692 |
T13121 |
T13120 |
nummod |
three,individuals |
| R3693 |
T13122 |
T13120 |
amod |
affected,individuals |
| R3694 |
T13123 |
T13124 |
punct |
(,6 |
| R3695 |
T13124 |
T13120 |
parataxis |
6,individuals |
| R3696 |
T13125 |
T13124 |
nmod |
family,6 |
| R3697 |
T13126 |
T13124 |
nmod |
members,6 |
| R3698 |
T13127 |
T13124 |
punct |
", ",6 |
| R3699 |
T13128 |
T13124 |
conj |
7,6 |
| R3700 |
T13129 |
T13128 |
punct |
", ",7 |
| R3701 |
T13130 |
T13128 |
cc |
and,7 |
| R3702 |
T13131 |
T13128 |
conj |
19,7 |
| R3703 |
T13132 |
T13124 |
punct |
),6 |
| R3704 |
T13133 |
T13111 |
punct |
.,performed |
| R3705 |
T13135 |
T13136 |
compound |
Dye,terminator |
| R3706 |
T13136 |
T13138 |
compound |
terminator,sequencing |
| R3707 |
T13137 |
T13136 |
punct |
-,terminator |
| R3708 |
T13138 |
T13139 |
nsubjpass |
sequencing,performed |
| R3709 |
T13139 |
T13144 |
ccomp |
performed,performed |
| R3710 |
T13140 |
T13138 |
prep |
of,sequencing |
| R3711 |
T13141 |
T13142 |
det |
each,product |
| R3712 |
T13142 |
T13140 |
pobj |
product,of |
| R3713 |
T13143 |
T13139 |
auxpass |
was,performed |
| R3714 |
T13145 |
T13139 |
advcl |
using,performed |
| R3715 |
T13146 |
T13147 |
det |
the,primers |
| R3716 |
T13147 |
T13145 |
dobj |
primers,using |
| R3717 |
T13148 |
T13147 |
amod |
forward,primers |
| R3718 |
T13149 |
T13148 |
cc |
and,forward |
| R3719 |
T13150 |
T13148 |
conj |
reverse,forward |
| R3720 |
T13151 |
T13147 |
acl |
designed,primers |
| R3721 |
T13152 |
T13151 |
prep |
for,designed |
| R3722 |
T13153 |
T13152 |
pobj |
amplification,for |
| R3723 |
T13154 |
T13144 |
punct |
;,performed |
| R3724 |
T13155 |
T13156 |
amod |
running,analysis |
| R3725 |
T13156 |
T13144 |
nsubjpass |
analysis,performed |
| R3726 |
T13157 |
T13156 |
cc |
and,analysis |
| R3727 |
T13158 |
T13156 |
prep |
of,analysis |
| R3728 |
T13159 |
T13160 |
det |
each,fragment |
| R3729 |
T13160 |
T13158 |
pobj |
fragment,of |
| R3730 |
T13161 |
T13144 |
auxpass |
was,performed |
| R3731 |
T13162 |
T13163 |
mark |
as,described |
| R3732 |
T13163 |
T13144 |
advcl |
described,performed |
| R3733 |
T13164 |
T13163 |
advmod |
above,described |
| R3734 |
T13165 |
T13144 |
punct |
.,performed |
| R3735 |
T13167 |
T13168 |
nsubjpass |
Amplification,denoted |
| R3736 |
T13168 |
T13178 |
ccomp |
denoted,inferred |
| R3737 |
T13169 |
T13167 |
prep |
of,Amplification |
| R3738 |
T13170 |
T13171 |
det |
a,fragment |
| R3739 |
T13171 |
T13169 |
pobj |
fragment,of |
| R3740 |
T13172 |
T13171 |
prep |
from,fragment |
| R3741 |
T13173 |
T13174 |
det |
a,genome |
| R3742 |
T13174 |
T13172 |
pobj |
genome,from |
| R3743 |
T13175 |
T13174 |
amod |
normal,genome |
| R3744 |
T13176 |
T13174 |
amod |
diploid,genome |
| R3745 |
T13177 |
T13168 |
auxpass |
was,denoted |
| R3746 |
T13179 |
T13168 |
agent |
by,denoted |
| R3747 |
T13180 |
T13181 |
det |
the,presence |
| R3748 |
T13181 |
T13179 |
pobj |
presence,by |
| R3749 |
T13182 |
T13181 |
prep |
of,presence |
| R3750 |
T13183 |
T13184 |
det |
a,polymorphism |
| R3751 |
T13184 |
T13182 |
pobj |
polymorphism,of |
| R3752 |
T13185 |
T13184 |
amod |
heterozygous,polymorphism |
| R3753 |
T13186 |
T13178 |
punct |
;,inferred |
| R3754 |
T13187 |
T13178 |
nsubjpass |
amplification,inferred |
| R3755 |
T13188 |
T13187 |
prep |
of,amplification |
| R3756 |
T13189 |
T13190 |
det |
a,fragment |
| R3757 |
T13190 |
T13188 |
pobj |
fragment,of |
| R3758 |
T13191 |
T13190 |
prep |
from,fragment |
| R3759 |
T13192 |
T13193 |
det |
a,region |
| R3760 |
T13193 |
T13191 |
pobj |
region,from |
| R3761 |
T13194 |
T13193 |
prep |
of,region |
| R3762 |
T13195 |
T13196 |
det |
the,genome |
| R3763 |
T13196 |
T13194 |
pobj |
genome,of |
| R3764 |
T13197 |
T13196 |
acl |
harboring,genome |
| R3765 |
T13198 |
T13199 |
det |
a,deletion |
| R3766 |
T13199 |
T13197 |
dobj |
deletion,harboring |
| R3767 |
T13200 |
T13199 |
amod |
heterozygous,deletion |
| R3768 |
T13201 |
T13199 |
amod |
genomic,deletion |
| R3769 |
T13202 |
T13178 |
auxpass |
was,inferred |
| R3770 |
T13203 |
T13204 |
advmod |
when,noted |
| R3771 |
T13204 |
T13178 |
advcl |
noted,inferred |
| R3772 |
T13205 |
T13204 |
nsubjpass |
homozygosity,noted |
| R3773 |
T13206 |
T13205 |
prep |
for,homozygosity |
| R3774 |
T13207 |
T13208 |
det |
the,allele |
| R3775 |
T13208 |
T13206 |
pobj |
allele,for |
| R3776 |
T13209 |
T13208 |
amod |
major,allele |
| R3777 |
T13210 |
T13208 |
cc |
and,allele |
| R3778 |
T13211 |
T13212 |
det |
the,allele |
| R3779 |
T13212 |
T13208 |
conj |
allele,allele |
| R3780 |
T13213 |
T13212 |
amod |
minor,allele |
| R3781 |
T13214 |
T13204 |
auxpass |
were,noted |
| R3782 |
T13215 |
T13204 |
prep |
among,noted |
| R3783 |
T13216 |
T13217 |
det |
the,members |
| R3784 |
T13217 |
T13215 |
pobj |
members,among |
| R3785 |
T13218 |
T13217 |
nummod |
three,members |
| R3786 |
T13219 |
T13217 |
amod |
affected,members |
| R3787 |
T13220 |
T13217 |
compound |
family,members |
| R3788 |
T13221 |
T13222 |
punct |
(,is |
| R3789 |
T13222 |
T13204 |
parataxis |
is,noted |
| R3790 |
T13223 |
T13222 |
advmod |
i.e.,is |
| R3791 |
T13224 |
T13222 |
punct |
", ",is |
| R3792 |
T13225 |
T13222 |
nsubj |
this,is |
| R3793 |
T13226 |
T13222 |
acomp |
inconsistent,is |
| R3794 |
T13227 |
T13226 |
prep |
with,inconsistent |
| R3795 |
T13228 |
T13229 |
amod |
Mendelian,inheritance |
| R3796 |
T13229 |
T13227 |
pobj |
inheritance,with |
| R3797 |
T13230 |
T13229 |
prep |
in,inheritance |
| R3798 |
T13231 |
T13232 |
amod |
related,individuals |
| R3799 |
T13232 |
T13230 |
pobj |
individuals,in |
| R3800 |
T13233 |
T13232 |
acl |
known,individuals |
| R3801 |
T13234 |
T13235 |
aux |
to,share |
| R3802 |
T13235 |
T13233 |
xcomp |
share,known |
| R3803 |
T13236 |
T13237 |
det |
a,haplotype |
| R3804 |
T13237 |
T13235 |
dobj |
haplotype,share |
| R3805 |
T13238 |
T13237 |
amod |
common,haplotype |
| R3806 |
T13239 |
T13222 |
punct |
),is |
| R3807 |
T13240 |
T13178 |
punct |
.,inferred |
| R3808 |
T13242 |
T13243 |
advcl |
Using,were |
| R3809 |
T13244 |
T13245 |
det |
the,data |
| R3810 |
T13245 |
T13242 |
dobj |
data,Using |
| R3811 |
T13246 |
T13242 |
prep |
from,Using |
| R3812 |
T13247 |
T13248 |
det |
the,experiments |
| R3813 |
T13248 |
T13246 |
pobj |
experiments,from |
| R3814 |
T13249 |
T13248 |
acl |
described,experiments |
| R3815 |
T13250 |
T13249 |
advmod |
above,described |
| R3816 |
T13251 |
T13243 |
nsubj |
we,were |
| R3817 |
T13252 |
T13243 |
acomp |
able,were |
| R3818 |
T13253 |
T13254 |
aux |
to,limit |
| R3819 |
T13254 |
T13252 |
xcomp |
limit,able |
| R3820 |
T13255 |
T13256 |
det |
the,size |
| R3821 |
T13256 |
T13254 |
dobj |
size,limit |
| R3822 |
T13257 |
T13256 |
prep |
of,size |
| R3823 |
T13258 |
T13259 |
amod |
unknown,regions |
| R3824 |
T13259 |
T13257 |
pobj |
regions,of |
| R3825 |
T13260 |
T13259 |
acl |
flanking,regions |
| R3826 |
T13261 |
T13262 |
det |
the,deletion |
| R3827 |
T13262 |
T13260 |
dobj |
deletion,flanking |
| R3828 |
T13263 |
T13254 |
prep |
to,limit |
| R3829 |
T13264 |
T13265 |
punct |
~,4 |
| R3830 |
T13265 |
T13266 |
nummod |
4,kb |
| R3831 |
T13266 |
T13263 |
pobj |
kb,to |
| R3832 |
T13267 |
T13266 |
prep |
on,kb |
| R3833 |
T13268 |
T13269 |
det |
the,side |
| R3834 |
T13269 |
T13267 |
pobj |
side,on |
| R3835 |
T13270 |
T13269 |
amod |
telomeric,side |
| R3836 |
T13271 |
T13266 |
cc |
and,kb |
| R3837 |
T13272 |
T13273 |
nummod |
7,kb |
| R3838 |
T13273 |
T13266 |
conj |
kb,kb |
| R3839 |
T13274 |
T13273 |
prep |
on,kb |
| R3840 |
T13275 |
T13276 |
det |
the,side |
| R3841 |
T13276 |
T13274 |
pobj |
side,on |
| R3842 |
T13277 |
T13276 |
amod |
centromeric,side |
| R3843 |
T13278 |
T13243 |
punct |
.,were |
| R3844 |
T13280 |
T13281 |
det |
All,combinations |
| R3845 |
T13281 |
T13282 |
nsubjpass |
combinations,used |
| R3846 |
T13283 |
T13281 |
prep |
of,combinations |
| R3847 |
T13284 |
T13285 |
amod |
forward,primers |
| R3848 |
T13285 |
T13283 |
pobj |
primers,of |
| R3849 |
T13286 |
T13285 |
prep |
from,primers |
| R3850 |
T13287 |
T13288 |
det |
the,region |
| R3851 |
T13288 |
T13286 |
pobj |
region,from |
| R3852 |
T13289 |
T13290 |
advmod |
newly,defined |
| R3853 |
T13290 |
T13288 |
amod |
defined,region |
| R3854 |
T13291 |
T13281 |
acl |
flanking,combinations |
| R3855 |
T13292 |
T13293 |
det |
the,deletion |
| R3856 |
T13293 |
T13291 |
dobj |
deletion,flanking |
| R3857 |
T13294 |
T13291 |
prep |
on,flanking |
| R3858 |
T13295 |
T13296 |
det |
the,side |
| R3859 |
T13296 |
T13294 |
pobj |
side,on |
| R3860 |
T13297 |
T13296 |
amod |
telomeric,side |
| R3861 |
T13298 |
T13291 |
prep |
with,flanking |
| R3862 |
T13299 |
T13300 |
amod |
reverse,primers |
| R3863 |
T13300 |
T13298 |
pobj |
primers,with |
| R3864 |
T13301 |
T13300 |
prep |
from,primers |
| R3865 |
T13302 |
T13303 |
det |
the,region |
| R3866 |
T13303 |
T13301 |
pobj |
region,from |
| R3867 |
T13304 |
T13305 |
advmod |
newly,defined |
| R3868 |
T13305 |
T13303 |
amod |
defined,region |
| R3869 |
T13306 |
T13300 |
acl |
flanking,primers |
| R3870 |
T13307 |
T13308 |
det |
the,deletion |
| R3871 |
T13308 |
T13306 |
dobj |
deletion,flanking |
| R3872 |
T13309 |
T13306 |
prep |
on,flanking |
| R3873 |
T13310 |
T13311 |
det |
the,side |
| R3874 |
T13311 |
T13309 |
pobj |
side,on |
| R3875 |
T13312 |
T13311 |
amod |
centromeric,side |
| R3876 |
T13313 |
T13282 |
auxpass |
were,used |
| R3877 |
T13314 |
T13282 |
prep |
in,used |
| R3878 |
T13315 |
T13316 |
compound |
PCR,amplification |
| R3879 |
T13316 |
T13317 |
compound |
amplification,reactions |
| R3880 |
T13317 |
T13314 |
pobj |
reactions,in |
| R3881 |
T13318 |
T13317 |
acl |
performed,reactions |
| R3882 |
T13319 |
T13318 |
prep |
with,performed |
| R3883 |
T13320 |
T13319 |
pobj |
DNA,with |
| R3884 |
T13321 |
T13320 |
prep |
from,DNA |
| R3885 |
T13322 |
T13323 |
det |
the,members |
| R3886 |
T13323 |
T13321 |
pobj |
members,from |
| R3887 |
T13324 |
T13323 |
nummod |
three,members |
| R3888 |
T13325 |
T13323 |
amod |
affected,members |
| R3889 |
T13326 |
T13323 |
compound |
family,members |
| R3890 |
T13327 |
T13323 |
cc |
and,members |
| R3891 |
T13328 |
T13329 |
amod |
single,members |
| R3892 |
T13329 |
T13323 |
conj |
members,members |
| R3893 |
T13330 |
T13329 |
amod |
unaffected,members |
| R3894 |
T13331 |
T13329 |
compound |
family,members |
| R3895 |
T13332 |
T13282 |
punct |
.,used |
| R3896 |
T13334 |
T13335 |
det |
This,experiment |
| R3897 |
T13335 |
T13336 |
nsubjpass |
experiment,performed |
| R3898 |
T13337 |
T13336 |
auxpass |
was,performed |
| R3899 |
T13338 |
T13336 |
prep |
in,performed |
| R3900 |
T13339 |
T13340 |
det |
an,attempt |
| R3901 |
T13340 |
T13338 |
pobj |
attempt,in |
| R3902 |
T13341 |
T13342 |
aux |
to,amplify |
| R3903 |
T13342 |
T13340 |
acl |
amplify,attempt |
| R3904 |
T13343 |
T13342 |
prep |
across,amplify |
| R3905 |
T13344 |
T13345 |
det |
the,fragment |
| R3906 |
T13345 |
T13343 |
pobj |
fragment,across |
| R3907 |
T13346 |
T13345 |
amod |
deleted,fragment |
| R3908 |
T13347 |
T13342 |
cc |
and,amplify |
| R3909 |
T13348 |
T13342 |
conj |
define,amplify |
| R3910 |
T13349 |
T13350 |
det |
the,breakpoint |
| R3911 |
T13350 |
T13348 |
dobj |
breakpoint,define |
| R3912 |
T13351 |
T13350 |
amod |
exact,breakpoint |
| R3913 |
T13352 |
T13336 |
punct |
.,performed |
| R3914 |
T13354 |
T13355 |
det |
A,fragment |
| R3915 |
T13355 |
T13357 |
nsubjpass |
fragment,obtained |
| R3916 |
T13356 |
T13355 |
amod |
single,fragment |
| R3917 |
T13358 |
T13357 |
auxpass |
was,obtained |
| R3918 |
T13359 |
T13357 |
prep |
from,obtained |
| R3919 |
T13360 |
T13361 |
det |
the,primer |
| R3920 |
T13361 |
T13359 |
pobj |
primer,from |
| R3921 |
T13362 |
T13361 |
amod |
third,primer |
| R3922 |
T13363 |
T13361 |
amod |
forward,primer |
| R3923 |
T13364 |
T13361 |
prep |
from,primer |
| R3924 |
T13365 |
T13366 |
det |
the,side |
| R3925 |
T13366 |
T13364 |
pobj |
side,from |
| R3926 |
T13367 |
T13366 |
amod |
telomeric,side |
| R3927 |
T13368 |
T13369 |
punct |
(,TGAATGCTCAATTTTCCAGC |
| R3928 |
T13369 |
T13361 |
parataxis |
TGAATGCTCAATTTTCCAGC,primer |
| R3929 |
T13370 |
T13369 |
nmod |
T3f,TGAATGCTCAATTTTCCAGC |
| R3930 |
T13371 |
T13369 |
nummod |
5,TGAATGCTCAATTTTCCAGC |
| R3931 |
T13372 |
T13371 |
punct |
′,5 |
| R3932 |
T13373 |
T13369 |
punct |
-,TGAATGCTCAATTTTCCAGC |
| R3933 |
T13374 |
T13369 |
punct |
-,TGAATGCTCAATTTTCCAGC |
| R3934 |
T13375 |
T13369 |
nummod |
3,TGAATGCTCAATTTTCCAGC |
| R3935 |
T13376 |
T13369 |
punct |
′,TGAATGCTCAATTTTCCAGC |
| R3936 |
T13377 |
T13369 |
punct |
),TGAATGCTCAATTTTCCAGC |
| R3937 |
T13378 |
T13357 |
prep |
with,obtained |
| R3938 |
T13379 |
T13380 |
det |
the,primer |
| R3939 |
T13380 |
T13378 |
pobj |
primer,with |
| R3940 |
T13381 |
T13380 |
amod |
11th,primer |
| R3941 |
T13382 |
T13380 |
amod |
reverse,primer |
| R3942 |
T13383 |
T13380 |
prep |
from,primer |
| R3943 |
T13384 |
T13385 |
det |
the,side |
| R3944 |
T13385 |
T13383 |
pobj |
side,from |
| R3945 |
T13386 |
T13385 |
amod |
centromeric,side |
| R3946 |
T13387 |
T13388 |
punct |
(,GGGAAAATGGATAGAGGGTG |
| R3947 |
T13388 |
T13380 |
parataxis |
GGGAAAATGGATAGAGGGTG,primer |
| R3948 |
T13389 |
T13388 |
nmod |
C11r,GGGAAAATGGATAGAGGGTG |
| R3949 |
T13390 |
T13388 |
nummod |
5,GGGAAAATGGATAGAGGGTG |
| R3950 |
T13391 |
T13390 |
punct |
′,5 |
| R3951 |
T13392 |
T13388 |
punct |
-,GGGAAAATGGATAGAGGGTG |
| R3952 |
T13393 |
T13388 |
punct |
-,GGGAAAATGGATAGAGGGTG |
| R3953 |
T13394 |
T13388 |
nummod |
3,GGGAAAATGGATAGAGGGTG |
| R3954 |
T13395 |
T13388 |
punct |
′,GGGAAAATGGATAGAGGGTG |
| R3955 |
T13396 |
T13388 |
punct |
),GGGAAAATGGATAGAGGGTG |
| R3956 |
T13397 |
T13357 |
punct |
.,obtained |
| R3957 |
T13399 |
T13400 |
det |
The,fragment |
| R3958 |
T13400 |
T13401 |
nsubjpass |
fragment,sequenced |
| R3959 |
T13402 |
T13400 |
punct |
", ",fragment |
| R3960 |
T13403 |
T13404 |
dep |
which,is |
| R3961 |
T13404 |
T13400 |
relcl |
is,fragment |
| R3962 |
T13405 |
T13406 |
nummod |
953,bp |
| R3963 |
T13406 |
T13404 |
attr |
bp,is |
| R3964 |
T13407 |
T13406 |
prep |
in,bp |
| R3965 |
T13408 |
T13407 |
pobj |
size,in |
| R3966 |
T13409 |
T13401 |
punct |
", ",sequenced |
| R3967 |
T13410 |
T13401 |
auxpass |
was,sequenced |
| R3968 |
T13411 |
T13412 |
mark |
as,described |
| R3969 |
T13412 |
T13401 |
advcl |
described,sequenced |
| R3970 |
T13413 |
T13412 |
advmod |
above,described |
| R3971 |
T13414 |
T13412 |
cc |
and,described |
| R3972 |
T13415 |
T13412 |
conj |
compared,described |
| R3973 |
T13416 |
T13415 |
prep |
to,compared |
| R3974 |
T13417 |
T13418 |
det |
the,build |
| R3975 |
T13418 |
T13416 |
pobj |
build,to |
| R3976 |
T13419 |
T13418 |
amod |
current,build |
| R3977 |
T13420 |
T13418 |
prep |
of,build |
| R3978 |
T13421 |
T13422 |
det |
the,genome |
| R3979 |
T13422 |
T13420 |
pobj |
genome,of |
| R3980 |
T13423 |
T13422 |
amod |
human,genome |
| R3981 |
T13424 |
T13401 |
punct |
.,sequenced |
| R3982 |
T13426 |
T13427 |
det |
A,series |
| R3983 |
T13427 |
T13429 |
nsubjpass |
series,performed |
| R3984 |
T13428 |
T13427 |
amod |
similar,series |
| R3985 |
T13429 |
T13433 |
ccomp |
performed,were |
| R3986 |
T13430 |
T13427 |
prep |
of,series |
| R3987 |
T13431 |
T13430 |
pobj |
experiments,of |
| R3988 |
T13432 |
T13429 |
auxpass |
was,performed |
| R3989 |
T13434 |
T13435 |
aux |
to,identify |
| R3990 |
T13435 |
T13429 |
advcl |
identify,performed |
| R3991 |
T13436 |
T13437 |
det |
the,breakpoints |
| R3992 |
T13437 |
T13435 |
dobj |
breakpoints,identify |
| R3993 |
T13438 |
T13437 |
compound |
deletion,breakpoints |
| R3994 |
T13439 |
T13437 |
prep |
in,breakpoints |
| R3995 |
T13440 |
T13441 |
compound |
families,H27 |
| R3996 |
T13441 |
T13439 |
pobj |
H27,in |
| R3997 |
T13442 |
T13441 |
cc |
and,H27 |
| R3998 |
T13443 |
T13441 |
conj |
H33,H27 |
| R3999 |
T13444 |
T13433 |
punct |
;,were |
| R4000 |
T13445 |
T13433 |
nsubj |
we,were |
| R4001 |
T13446 |
T13433 |
acomp |
able,were |
| R4002 |
T13447 |
T13448 |
aux |
to,amplify |
| R4003 |
T13448 |
T13446 |
xcomp |
amplify,able |
| R4004 |
T13449 |
T13450 |
det |
a,product |
| R4005 |
T13450 |
T13448 |
dobj |
product,amplify |
| R4006 |
T13451 |
T13452 |
nummod |
369,bp |
| R4007 |
T13452 |
T13450 |
compound |
bp,product |
| R4008 |
T13453 |
T13452 |
punct |
-,bp |
| R4009 |
T13454 |
T13450 |
compound |
PCR,product |
| R4010 |
T13455 |
T13448 |
prep |
across,amplify |
| R4011 |
T13456 |
T13457 |
det |
the,breakpoint |
| R4012 |
T13457 |
T13455 |
pobj |
breakpoint,across |
| R4013 |
T13458 |
T13457 |
acl |
found,breakpoint |
| R4014 |
T13459 |
T13458 |
prep |
in,found |
| R4015 |
T13460 |
T13461 |
amod |
affected,members |
| R4016 |
T13461 |
T13459 |
pobj |
members,in |
| R4017 |
T13462 |
T13461 |
prep |
of,members |
| R4018 |
T13463 |
T13464 |
compound |
family,H27 |
| R4019 |
T13464 |
T13462 |
pobj |
H27,of |
| R4020 |
T13465 |
T13448 |
advcl |
using,amplify |
| R4021 |
T13466 |
T13467 |
compound |
primer,pair |
| R4022 |
T13467 |
T13465 |
dobj |
pair,using |
| R4023 |
T13468 |
T13469 |
nmod |
H27,11F |
| R4024 |
T13469 |
T13471 |
nmod |
11F,GACCTCAAGAAGGCATGAATAC |
| R4025 |
T13470 |
T13469 |
punct |
-,11F |
| R4026 |
T13471 |
T13467 |
appos |
GACCTCAAGAAGGCATGAATAC,pair |
| R4027 |
T13472 |
T13471 |
nummod |
5,GACCTCAAGAAGGCATGAATAC |
| R4028 |
T13473 |
T13472 |
punct |
′,5 |
| R4029 |
T13474 |
T13471 |
punct |
-,GACCTCAAGAAGGCATGAATAC |
| R4030 |
T13475 |
T13471 |
punct |
-,GACCTCAAGAAGGCATGAATAC |
| R4031 |
T13476 |
T13471 |
nummod |
3,GACCTCAAGAAGGCATGAATAC |
| R4032 |
T13477 |
T13471 |
punct |
′,GACCTCAAGAAGGCATGAATAC |
| R4033 |
T13478 |
T13471 |
cc |
and,GACCTCAAGAAGGCATGAATAC |
| R4034 |
T13479 |
T13480 |
nmod |
H27,3R |
| R4035 |
T13480 |
T13482 |
nmod |
3R,ATGGTGGCCAGGTACACAAG |
| R4036 |
T13481 |
T13480 |
punct |
-,3R |
| R4037 |
T13482 |
T13471 |
conj |
ATGGTGGCCAGGTACACAAG,GACCTCAAGAAGGCATGAATAC |
| R4038 |
T13483 |
T13482 |
nummod |
5,ATGGTGGCCAGGTACACAAG |
| R4039 |
T13484 |
T13483 |
punct |
′,5 |
| R4040 |
T13485 |
T13482 |
punct |
-,ATGGTGGCCAGGTACACAAG |
| R4041 |
T13486 |
T13482 |
punct |
-,ATGGTGGCCAGGTACACAAG |
| R4042 |
T13487 |
T13482 |
nummod |
3,ATGGTGGCCAGGTACACAAG |
| R4043 |
T13488 |
T13482 |
punct |
′,ATGGTGGCCAGGTACACAAG |
| R4044 |
T13489 |
T13490 |
punct |
(,S4 |
| R4045 |
T13490 |
T13465 |
parataxis |
S4,using |
| R4046 |
T13491 |
T13490 |
compound |
Figure,S4 |
| R4047 |
T13492 |
T13490 |
punct |
),S4 |
| R4048 |
T13493 |
T13433 |
punct |
", ",were |
| R4049 |
T13494 |
T13433 |
cc |
but,were |
| R4050 |
T13495 |
T13496 |
prep |
to,been |
| R4051 |
T13496 |
T13433 |
conj |
been,were |
| R4052 |
T13497 |
T13495 |
pobj |
date,to |
| R4053 |
T13498 |
T13496 |
nsubj |
we,been |
| R4054 |
T13499 |
T13496 |
aux |
have,been |
| R4055 |
T13500 |
T13496 |
acomp |
unable,been |
| R4056 |
T13501 |
T13502 |
aux |
to,identify |
| R4057 |
T13502 |
T13500 |
xcomp |
identify,unable |
| R4058 |
T13503 |
T13504 |
det |
the,breakpoint |
| R4059 |
T13504 |
T13502 |
dobj |
breakpoint,identify |
| R4060 |
T13505 |
T13504 |
prep |
in,breakpoint |
| R4061 |
T13506 |
T13507 |
compound |
family,H33 |
| R4062 |
T13507 |
T13505 |
pobj |
H33,in |
| R4063 |
T13508 |
T13433 |
punct |
.,were |
| R4064 |
T13807 |
T13808 |
compound |
Western,blot |
| R4065 |
T13808 |
T13809 |
compound |
blot,analysis |
| R4066 |
T13810 |
T13809 |
prep |
in,analysis |
| R4067 |
T13811 |
T13812 |
compound |
SCA15,patients |
| R4068 |
T13812 |
T13810 |
pobj |
patients,in |
| R4069 |
T13813 |
T13809 |
punct |
.,analysis |
| R4070 |
T13815 |
T13816 |
nmod |
EBV,lymphoblasts |
| R4071 |
T13816 |
T13818 |
nsubjpass |
lymphoblasts,used |
| R4072 |
T13817 |
T13816 |
amod |
immortalized,lymphoblasts |
| R4073 |
T13818 |
T13836 |
ccomp |
used,came |
| R4074 |
T13819 |
T13816 |
prep |
from,lymphoblasts |
| R4075 |
T13820 |
T13821 |
nummod |
three,members |
| R4076 |
T13821 |
T13819 |
pobj |
members,from |
| R4077 |
T13822 |
T13821 |
amod |
affected,members |
| R4078 |
T13823 |
T13821 |
compound |
family,members |
| R4079 |
T13824 |
T13825 |
dep |
who,carry |
| R4080 |
T13825 |
T13821 |
relcl |
carry,members |
| R4081 |
T13826 |
T13827 |
det |
the,deletion |
| R4082 |
T13827 |
T13825 |
dobj |
deletion,carry |
| R4083 |
T13828 |
T13821 |
cc |
and,members |
| R4084 |
T13829 |
T13830 |
nummod |
one,member |
| R4085 |
T13830 |
T13821 |
conj |
member,members |
| R4086 |
T13831 |
T13830 |
compound |
family,member |
| R4087 |
T13832 |
T13830 |
prep |
without,member |
| R4088 |
T13833 |
T13834 |
det |
the,mutation |
| R4089 |
T13834 |
T13832 |
pobj |
mutation,without |
| R4090 |
T13835 |
T13818 |
auxpass |
were,used |
| R4091 |
T13837 |
T13818 |
prep |
as,used |
| R4092 |
T13838 |
T13839 |
det |
a,source |
| R4093 |
T13839 |
T13837 |
pobj |
source,as |
| R4094 |
T13840 |
T13841 |
advmod |
readily,accessible |
| R4095 |
T13841 |
T13839 |
amod |
accessible,source |
| R4096 |
T13842 |
T13839 |
prep |
of,source |
| R4097 |
T13843 |
T13842 |
pobj |
protein,of |
| R4098 |
T13844 |
T13836 |
punct |
;,came |
| R4099 |
T13845 |
T13846 |
det |
all,samples |
| R4100 |
T13846 |
T13836 |
nsubj |
samples,came |
| R4101 |
T13847 |
T13836 |
prep |
from,came |
| R4102 |
T13848 |
T13847 |
pobj |
members,from |
| R4103 |
T13849 |
T13848 |
prep |
of,members |
| R4104 |
T13850 |
T13851 |
compound |
family,AUS1 |
| R4105 |
T13851 |
T13849 |
pobj |
AUS1,of |
| R4106 |
T13852 |
T13836 |
punct |
.,came |
| R4107 |
T13854 |
T13855 |
compound |
Protein,extraction |
| R4108 |
T13855 |
T13856 |
nsubjpass |
extraction,performed |
| R4109 |
T13857 |
T13856 |
auxpass |
was,performed |
| R4110 |
T13858 |
T13856 |
advcl |
using,performed |
| R4111 |
T13859 |
T13860 |
compound |
lysis,buffer |
| R4112 |
T13860 |
T13858 |
dobj |
buffer,using |
| R4113 |
T13861 |
T13860 |
acl |
containing,buffer |
| R4114 |
T13862 |
T13863 |
nummod |
1,TBS |
| R4115 |
T13863 |
T13861 |
dobj |
TBS,containing |
| R4116 |
T13864 |
T13862 |
punct |
×,1 |
| R4117 |
T13865 |
T13863 |
punct |
", ",TBS |
| R4118 |
T13866 |
T13867 |
nummod |
1,% |
| R4119 |
T13867 |
T13868 |
compound |
%,X |
| R4120 |
T13868 |
T13863 |
conj |
X,TBS |
| R4121 |
T13869 |
T13868 |
compound |
Triton,X |
| R4122 |
T13870 |
T13868 |
punct |
-,X |
| R4123 |
T13871 |
T13868 |
nummod |
100,X |
| R4124 |
T13872 |
T13868 |
punct |
", ",X |
| R4125 |
T13873 |
T13868 |
cc |
and,X |
| R4126 |
T13874 |
T13875 |
det |
a,cocktail |
| R4127 |
T13875 |
T13868 |
conj |
cocktail,X |
| R4128 |
T13876 |
T13875 |
prep |
of,cocktail |
| R4129 |
T13877 |
T13878 |
compound |
protease,inhibitors |
| R4130 |
T13878 |
T13876 |
pobj |
inhibitors,of |
| R4131 |
T13879 |
T13880 |
punct |
(,Roche |
| R4132 |
T13880 |
T13878 |
parataxis |
Roche,inhibitors |
| R4133 |
T13881 |
T13880 |
punct |
),Roche |
| R4134 |
T13882 |
T13856 |
prep |
with,performed |
| R4135 |
T13883 |
T13884 |
amod |
overnight,lysis |
| R4136 |
T13884 |
T13882 |
pobj |
lysis,with |
| R4137 |
T13885 |
T13856 |
prep |
at,performed |
| R4138 |
T13886 |
T13887 |
punct |
−,80 |
| R4139 |
T13887 |
T13888 |
nummod |
80,°C |
| R4140 |
T13888 |
T13885 |
pobj |
°C,at |
| R4141 |
T13889 |
T13856 |
punct |
.,performed |
| R4142 |
T13891 |
T13892 |
nsubjpass |
Homogenates,diluted |
| R4143 |
T13893 |
T13892 |
auxpass |
were,diluted |
| R4144 |
T13894 |
T13892 |
advmod |
appropriately,diluted |
| R4145 |
T13895 |
T13892 |
punct |
", ",diluted |
| R4146 |
T13896 |
T13892 |
conj |
mixed,diluted |
| R4147 |
T13897 |
T13896 |
prep |
with,mixed |
| R4148 |
T13898 |
T13899 |
nummod |
4,buffer |
| R4149 |
T13899 |
T13897 |
pobj |
buffer,with |
| R4150 |
T13900 |
T13898 |
punct |
×,4 |
| R4151 |
T13901 |
T13899 |
amod |
reducing,buffer |
| R4152 |
T13902 |
T13899 |
compound |
sample,buffer |
| R4153 |
T13903 |
T13896 |
punct |
", ",mixed |
| R4154 |
T13904 |
T13896 |
cc |
and,mixed |
| R4155 |
T13905 |
T13896 |
conj |
loaded,mixed |
| R4156 |
T13906 |
T13905 |
prep |
onto,loaded |
| R4157 |
T13907 |
T13908 |
nummod |
4,% |
| R4158 |
T13908 |
T13909 |
nmod |
%,gels |
| R4159 |
T13909 |
T13906 |
pobj |
gels,onto |
| R4160 |
T13910 |
T13911 |
punct |
–,% |
| R4161 |
T13911 |
T13908 |
prep |
%,% |
| R4162 |
T13912 |
T13911 |
nummod |
12,% |
| R4163 |
T13913 |
T13909 |
amod |
precast,gels |
| R4164 |
T13914 |
T13909 |
compound |
gradient,gels |
| R4165 |
T13915 |
T13916 |
punct |
(,NuPAGE |
| R4166 |
T13916 |
T13909 |
parataxis |
NuPAGE,gels |
| R4167 |
T13917 |
T13916 |
punct |
", ",NuPAGE |
| R4168 |
T13918 |
T13916 |
appos |
Invitrogen,NuPAGE |
| R4169 |
T13919 |
T13916 |
punct |
),NuPAGE |
| R4170 |
T13920 |
T13905 |
prep |
for,loaded |
| R4171 |
T13921 |
T13922 |
compound |
SDS,PAGE |
| R4172 |
T13922 |
T13920 |
pobj |
PAGE,for |
| R4173 |
T13923 |
T13922 |
punct |
-,PAGE |
| R4174 |
T13924 |
T13922 |
cc |
and,PAGE |
| R4175 |
T13925 |
T13922 |
conj |
immunoblotting,PAGE |
| R4176 |
T13926 |
T13892 |
punct |
.,diluted |
| R4177 |
T13928 |
T13929 |
det |
The,antibodies |
| R4178 |
T13929 |
T13930 |
nsubjpass |
antibodies,used |
| R4179 |
T13931 |
T13929 |
prep |
to,antibodies |
| R4180 |
T13932 |
T13931 |
pobj |
ITPR1,to |
| R4181 |
T13933 |
T13934 |
punct |
(,1 |
| R4182 |
T13934 |
T13932 |
parataxis |
1,ITPR1 |
| R4183 |
T13935 |
T13936 |
punct |
:,"1,000" |
| R4184 |
T13936 |
T13934 |
prep |
"1,000",1 |
| R4185 |
T13937 |
T13934 |
punct |
),1 |
| R4186 |
T13938 |
T13932 |
cc |
and,ITPR1 |
| R4187 |
T13939 |
T13932 |
conj |
ACTB,ITPR1 |
| R4188 |
T13940 |
T13941 |
punct |
(,1 |
| R4189 |
T13941 |
T13939 |
parataxis |
1,ACTB |
| R4190 |
T13942 |
T13943 |
punct |
:,"5,000" |
| R4191 |
T13943 |
T13941 |
prep |
"5,000",1 |
| R4192 |
T13944 |
T13941 |
punct |
),1 |
| R4193 |
T13945 |
T13930 |
auxpass |
were,used |
| R4194 |
T13946 |
T13947 |
mark |
as,recommended |
| R4195 |
T13947 |
T13930 |
advcl |
recommended,used |
| R4196 |
T13948 |
T13947 |
agent |
by,recommended |
| R4197 |
T13949 |
T13948 |
pobj |
manufacturers,by |
| R4198 |
T13950 |
T13930 |
punct |
.,used |
| R4199 |
T14400 |
T14399 |
cc |
and,Immunohistochemistry |
| R4200 |
T14401 |
T14402 |
compound |
Western,Blot |
| R4201 |
T14402 |
T14403 |
compound |
Blot,Analysis |
| R4202 |
T14403 |
T14399 |
conj |
Analysis,Immunohistochemistry |
| R4203 |
T14404 |
T14399 |
prep |
of,Immunohistochemistry |
| R4204 |
T14405 |
T14406 |
compound |
ITPR1,Levels |
| R4205 |
T14406 |
T14404 |
pobj |
Levels,of |
| R4206 |
T14407 |
T14406 |
compound |
Protein,Levels |
| R4207 |
T14408 |
T14406 |
prep |
in,Levels |
| R4208 |
T14409 |
T14410 |
compound |
Mouse,Cerebellum |
| R4209 |
T14410 |
T14408 |
pobj |
Cerebellum,in |
| R4210 |
T14412 |
T14413 |
punct |
(,A |
| R4211 |
T14413 |
T14414 |
meta |
A,Immunohistochemistry |
| R4212 |
T14415 |
T14413 |
punct |
–,A |
| R4213 |
T14416 |
T14413 |
dep |
F,A |
| R4214 |
T14417 |
T14413 |
punct |
),A |
| R4215 |
T14418 |
T14414 |
prep |
of,Immunohistochemistry |
| R4216 |
T14419 |
T14418 |
pobj |
cerebellum,of |
| R4217 |
T14420 |
T14419 |
prep |
from,cerebellum |
| R4218 |
T14421 |
T14422 |
det |
a,mouse |
| R4219 |
T14422 |
T14420 |
pobj |
mouse,from |
| R4220 |
T14423 |
T14424 |
amod |
wild,type |
| R4221 |
T14424 |
T14422 |
compound |
type,mouse |
| R4222 |
T14425 |
T14424 |
punct |
-,type |
| R4223 |
T14426 |
T14427 |
punct |
(,A |
| R4224 |
T14427 |
T14422 |
parataxis |
A,mouse |
| R4225 |
T14428 |
T14427 |
cc |
and,A |
| R4226 |
T14429 |
T14427 |
conj |
D,A |
| R4227 |
T14430 |
T14427 |
punct |
),A |
| R4228 |
T14431 |
T14422 |
punct |
", ",mouse |
| R4229 |
T14432 |
T14433 |
det |
a,mouse |
| R4230 |
T14433 |
T14422 |
conj |
mouse,mouse |
| R4231 |
T14434 |
T14433 |
amod |
heterozygous,mouse |
| R4232 |
T14435 |
T14434 |
prep |
for,heterozygous |
| R4233 |
T14436 |
T14437 |
det |
the,deletion |
| R4234 |
T14437 |
T14435 |
pobj |
deletion,for |
| R4235 |
T14438 |
T14437 |
nmod |
Itpr1,deletion |
| R4236 |
T14439 |
T14440 |
nummod |
18,bp |
| R4237 |
T14440 |
T14437 |
compound |
bp,deletion |
| R4238 |
T14441 |
T14440 |
punct |
-,bp |
| R4239 |
T14442 |
T14443 |
punct |
(,B |
| R4240 |
T14443 |
T14433 |
parataxis |
B,mouse |
| R4241 |
T14444 |
T14443 |
cc |
and,B |
| R4242 |
T14445 |
T14443 |
conj |
E,B |
| R4243 |
T14446 |
T14443 |
punct |
),B |
| R4244 |
T14447 |
T14433 |
punct |
", ",mouse |
| R4245 |
T14448 |
T14433 |
cc |
and,mouse |
| R4246 |
T14449 |
T14450 |
det |
a,mouse |
| R4247 |
T14450 |
T14433 |
conj |
mouse,mouse |
| R4248 |
T14451 |
T14450 |
amod |
homozygous,mouse |
| R4249 |
T14452 |
T14451 |
prep |
for,homozygous |
| R4250 |
T14453 |
T14454 |
det |
the,deletion |
| R4251 |
T14454 |
T14452 |
pobj |
deletion,for |
| R4252 |
T14455 |
T14456 |
nummod |
18,bp |
| R4253 |
T14456 |
T14454 |
compound |
bp,deletion |
| R4254 |
T14457 |
T14456 |
punct |
-,bp |
| R4255 |
T14458 |
T14454 |
compound |
Itpr1,deletion |
| R4256 |
T14459 |
T14460 |
punct |
(,C |
| R4257 |
T14460 |
T14450 |
parataxis |
C,mouse |
| R4258 |
T14461 |
T14460 |
cc |
and,C |
| R4259 |
T14462 |
T14460 |
conj |
F,C |
| R4260 |
T14463 |
T14460 |
punct |
),C |
| R4261 |
T14464 |
T14414 |
punct |
.,Immunohistochemistry |
| R4262 |
T14466 |
T14467 |
punct |
(,A |
| R4263 |
T14467 |
T14468 |
meta |
A,Immunohistochemistry |
| R4264 |
T14469 |
T14467 |
punct |
–,A |
| R4265 |
T14470 |
T14467 |
dep |
C,A |
| R4266 |
T14471 |
T14467 |
punct |
),A |
| R4267 |
T14472 |
T14468 |
acl |
using,Immunohistochemistry |
| R4268 |
T14473 |
T14474 |
amod |
polyclonal,antibody |
| R4269 |
T14474 |
T14472 |
dobj |
antibody,using |
| R4270 |
T14475 |
T14474 |
nmod |
Itpr1,antibody |
| R4271 |
T14476 |
T14474 |
amod |
anti-rabbit,antibody |
| R4272 |
T14477 |
T14478 |
punct |
(,Fluor |
| R4273 |
T14478 |
T14474 |
parataxis |
Fluor,antibody |
| R4274 |
T14479 |
T14478 |
dep |
1,Fluor |
| R4275 |
T14480 |
T14481 |
punct |
:,"2,000" |
| R4276 |
T14481 |
T14479 |
prep |
"2,000",1 |
| R4277 |
T14482 |
T14478 |
punct |
;,Fluor |
| R4278 |
T14483 |
T14478 |
compound |
Alexa,Fluor |
| R4279 |
T14484 |
T14478 |
nummod |
555,Fluor |
| R4280 |
T14485 |
T14478 |
punct |
),Fluor |
| R4281 |
T14486 |
T14468 |
punct |
;,Immunohistochemistry |
| R4282 |
T14487 |
T14488 |
punct |
(,D |
| R4283 |
T14488 |
T14489 |
meta |
D,immunohistochemistry |
| R4284 |
T14489 |
T14468 |
appos |
immunohistochemistry,Immunohistochemistry |
| R4285 |
T14490 |
T14488 |
punct |
–,D |
| R4286 |
T14491 |
T14488 |
dep |
F,D |
| R4287 |
T14492 |
T14488 |
punct |
),D |
| R4288 |
T14493 |
T14489 |
acl |
using,immunohistochemistry |
| R4289 |
T14494 |
T14495 |
amod |
monoclonal,antibody |
| R4290 |
T14495 |
T14493 |
dobj |
antibody,using |
| R4291 |
T14496 |
T14495 |
nmod |
Calb1,antibody |
| R4292 |
T14497 |
T14495 |
amod |
anti-mouse,antibody |
| R4293 |
T14498 |
T14499 |
punct |
(,Fluor |
| R4294 |
T14499 |
T14495 |
parataxis |
Fluor,antibody |
| R4295 |
T14500 |
T14499 |
dep |
1,Fluor |
| R4296 |
T14501 |
T14502 |
punct |
:,"6,000" |
| R4297 |
T14502 |
T14500 |
prep |
"6,000",1 |
| R4298 |
T14503 |
T14499 |
punct |
;,Fluor |
| R4299 |
T14504 |
T14499 |
compound |
Alexa,Fluor |
| R4300 |
T14505 |
T14499 |
nummod |
488,Fluor |
| R4301 |
T14506 |
T14499 |
punct |
),Fluor |
| R4302 |
T14507 |
T14468 |
punct |
.,Immunohistochemistry |
| R4303 |
T14509 |
T14510 |
compound |
Scale,bars |
| R4304 |
T14510 |
T14511 |
nsubj |
bars,denote |
| R4305 |
T14512 |
T14513 |
nummod |
100,μm |
| R4306 |
T14513 |
T14511 |
dobj |
μm,denote |
| R4307 |
T14514 |
T14511 |
punct |
.,denote |
| R4308 |
T14516 |
T14517 |
mark |
As,described |
| R4309 |
T14517 |
T14519 |
advcl |
described,expressed |
| R4310 |
T14518 |
T14517 |
advmod |
previously,described |
| R4311 |
T14520 |
T14519 |
punct |
", ",expressed |
| R4312 |
T14521 |
T14519 |
nsubjpass |
Iptr1,expressed |
| R4313 |
T14522 |
T14519 |
auxpass |
is,expressed |
| R4314 |
T14523 |
T14519 |
advmod |
highly,expressed |
| R4315 |
T14524 |
T14519 |
prep |
in,expressed |
| R4316 |
T14525 |
T14526 |
det |
the,cells |
| R4317 |
T14526 |
T14524 |
pobj |
cells,in |
| R4318 |
T14527 |
T14526 |
compound |
Purkinje,cells |
| R4319 |
T14528 |
T14519 |
punct |
.,expressed |
| R4320 |
T14530 |
T14531 |
advmod |
Notably,appears |
| R4321 |
T14532 |
T14531 |
punct |
", ",appears |
| R4322 |
T14533 |
T14531 |
expl |
there,appears |
| R4323 |
T14534 |
T14535 |
aux |
to,be |
| R4324 |
T14535 |
T14531 |
xcomp |
be,appears |
| R4325 |
T14536 |
T14537 |
amod |
decreased,immunoreactivity |
| R4326 |
T14537 |
T14535 |
attr |
immunoreactivity,be |
| R4327 |
T14538 |
T14537 |
prep |
to,immunoreactivity |
| R4328 |
T14539 |
T14538 |
pobj |
Itpr1,to |
| R4329 |
T14540 |
T14535 |
prep |
in,be |
| R4330 |
T14541 |
T14542 |
det |
the,mice |
| R4331 |
T14542 |
T14540 |
pobj |
mice,in |
| R4332 |
T14543 |
T14542 |
amod |
heterozygous,mice |
| R4333 |
T14544 |
T14543 |
cc |
and,heterozygous |
| R4334 |
T14545 |
T14543 |
conj |
homozygous,heterozygous |
| R4335 |
T14546 |
T14542 |
compound |
mutant,mice |
| R4336 |
T14547 |
T14531 |
punct |
.,appears |
| R4337 |
T14549 |
T14550 |
punct |
(,G |
| R4338 |
T14550 |
T14551 |
meta |
G,shows |
| R4339 |
T14552 |
T14550 |
punct |
),G |
| R4340 |
T14553 |
T14554 |
compound |
Western,blot |
| R4341 |
T14554 |
T14551 |
dep |
blot,shows |
| R4342 |
T14555 |
T14554 |
acl |
performed,blot |
| R4343 |
T14556 |
T14557 |
aux |
to,examine |
| R4344 |
T14557 |
T14555 |
advcl |
examine,performed |
| R4345 |
T14558 |
T14559 |
compound |
Itpr1,levels |
| R4346 |
T14559 |
T14557 |
dobj |
levels,examine |
| R4347 |
T14560 |
T14557 |
prep |
in,examine |
| R4348 |
T14561 |
T14562 |
amod |
whole,brain |
| R4349 |
T14562 |
T14560 |
pobj |
brain,in |
| R4350 |
T14563 |
T14562 |
prep |
from,brain |
| R4351 |
T14564 |
T14565 |
amod |
wild,type |
| R4352 |
T14565 |
T14567 |
nmod |
type,mice |
| R4353 |
T14566 |
T14565 |
punct |
-,type |
| R4354 |
T14567 |
T14563 |
pobj |
mice,from |
| R4355 |
T14568 |
T14565 |
punct |
", ",type |
| R4356 |
T14569 |
T14570 |
compound |
Itpr1wt,Δ18 |
| R4357 |
T14570 |
T14565 |
conj |
Δ18,type |
| R4358 |
T14571 |
T14570 |
punct |
/,Δ18 |
| R4359 |
T14572 |
T14570 |
punct |
", ",Δ18 |
| R4360 |
T14573 |
T14570 |
cc |
and,Δ18 |
| R4361 |
T14574 |
T14575 |
compound |
Itpr1Δ18,Δ18 |
| R4362 |
T14575 |
T14570 |
conj |
Δ18,Δ18 |
| R4363 |
T14576 |
T14575 |
punct |
/,Δ18 |
| R4364 |
T14577 |
T14551 |
punct |
;,shows |
| R4365 |
T14578 |
T14551 |
nsubj |
this,shows |
| R4366 |
T14579 |
T14551 |
advmod |
clearly,shows |
| R4367 |
T14580 |
T14581 |
det |
a,reduction |
| R4368 |
T14581 |
T14551 |
dobj |
reduction,shows |
| R4369 |
T14582 |
T14581 |
prep |
of,reduction |
| R4370 |
T14583 |
T14582 |
pobj |
Itpr1,of |
| R4371 |
T14584 |
T14581 |
prep |
in,reduction |
| R4372 |
T14585 |
T14586 |
compound |
brain,tissue |
| R4373 |
T14586 |
T14584 |
pobj |
tissue,in |
| R4374 |
T14587 |
T14586 |
prep |
from,tissue |
| R4375 |
T14588 |
T14589 |
compound |
Itpr1wt,Δ18 |
| R4376 |
T14589 |
T14591 |
compound |
Δ18,mice |
| R4377 |
T14590 |
T14589 |
punct |
/,Δ18 |
| R4378 |
T14591 |
T14587 |
pobj |
mice,from |
| R4379 |
T14592 |
T14581 |
cc |
and,reduction |
| R4380 |
T14593 |
T14594 |
det |
a,reduction |
| R4381 |
T14594 |
T14581 |
conj |
reduction,reduction |
| R4382 |
T14595 |
T14594 |
amod |
greater,reduction |
| R4383 |
T14596 |
T14594 |
prep |
of,reduction |
| R4384 |
T14597 |
T14596 |
pobj |
Itpr1,of |
| R4385 |
T14598 |
T14594 |
prep |
in,reduction |
| R4386 |
T14599 |
T14600 |
compound |
Itpr1Δ18,Δ18 |
| R4387 |
T14600 |
T14602 |
compound |
Δ18,mice |
| R4388 |
T14601 |
T14600 |
punct |
/,Δ18 |
| R4389 |
T14602 |
T14598 |
pobj |
mice,in |
| R4390 |
T14603 |
T14551 |
punct |
.,shows |
| R4391 |
T15070 |
T15069 |
acl |
Derived,Metrics |
| R4392 |
T15071 |
T15070 |
prep |
from,Derived |
| R4393 |
T15072 |
T15071 |
pobj |
Analysis,from |
| R4394 |
T15073 |
T15072 |
prep |
of,Analysis |
| R4395 |
T15074 |
T15073 |
pobj |
DNA,of |
| R4396 |
T15075 |
T15074 |
prep |
from,DNA |
| R4397 |
T15076 |
T15077 |
amod |
Affected,Member |
| R4398 |
T15077 |
T15075 |
pobj |
Member,from |
| R4399 |
T15078 |
T15077 |
compound |
Family,Member |
| R4400 |
T15079 |
T15077 |
nummod |
7,Member |
| R4401 |
T15080 |
T15070 |
advcl |
Using,Derived |
| R4402 |
T15081 |
T15082 |
compound |
Illumina,HumanHap550 |
| R4403 |
T15082 |
T15084 |
compound |
HumanHap550,Chips |
| R4404 |
T15083 |
T15082 |
compound |
Infinium,HumanHap550 |
| R4405 |
T15084 |
T15080 |
dobj |
Chips,Using |
| R4406 |
T15085 |
T15084 |
compound |
Genotyping,Chips |
| R4407 |
T15087 |
T15088 |
det |
The,plots |
| R4408 |
T15088 |
T15092 |
nsubj |
plots,are |
| R4409 |
T15089 |
T15088 |
amod |
upper,plots |
| R4410 |
T15090 |
T15089 |
cc |
and,upper |
| R4411 |
T15091 |
T15089 |
conj |
lower,upper |
| R4412 |
T15093 |
T15094 |
compound |
log,R |
| R4413 |
T15094 |
T15095 |
compound |
R,ratio |
| R4414 |
T15095 |
T15092 |
attr |
ratio,are |
| R4415 |
T15096 |
T15095 |
cc |
and,ratio |
| R4416 |
T15097 |
T15098 |
compound |
B,allele |
| R4417 |
T15098 |
T15099 |
compound |
allele,frequency |
| R4418 |
T15099 |
T15095 |
conj |
frequency,ratio |
| R4419 |
T15100 |
T15092 |
punct |
", ",are |
| R4420 |
T15101 |
T15092 |
advmod |
respectively,are |
| R4421 |
T15102 |
T15092 |
punct |
", ",are |
| R4422 |
T15103 |
T15092 |
prep |
at,are |
| R4423 |
T15104 |
T15105 |
det |
an,segment |
| R4424 |
T15105 |
T15103 |
pobj |
segment,at |
| R4425 |
T15106 |
T15107 |
punct |
~,800 |
| R4426 |
T15107 |
T15108 |
nummod |
800,kb |
| R4427 |
T15108 |
T15105 |
compound |
kb,segment |
| R4428 |
T15109 |
T15108 |
punct |
-,kb |
| R4429 |
T15110 |
T15105 |
prep |
on,segment |
| R4430 |
T15111 |
T15112 |
det |
the,arm |
| R4431 |
T15112 |
T15110 |
pobj |
arm,on |
| R4432 |
T15113 |
T15112 |
compound |
p,arm |
| R4433 |
T15114 |
T15112 |
prep |
of,arm |
| R4434 |
T15115 |
T15114 |
pobj |
Chromosome,of |
| R4435 |
T15116 |
T15115 |
nummod |
3,Chromosome |
| R4436 |
T15117 |
T15092 |
punct |
.,are |
| R4437 |
T15119 |
T15120 |
compound |
Log,R |
| R4438 |
T15120 |
T15121 |
compound |
R,ratio |
| R4439 |
T15121 |
T15122 |
nsubj |
ratio,is |
| R4440 |
T15123 |
T15124 |
det |
the,ratio |
| R4441 |
T15124 |
T15122 |
attr |
ratio,is |
| R4442 |
T15125 |
T15124 |
prep |
of,ratio |
| R4443 |
T15126 |
T15127 |
amod |
normalized,R |
| R4444 |
T15127 |
T15125 |
pobj |
R,of |
| R4445 |
T15128 |
T15127 |
punct |
", ",R |
| R4446 |
T15129 |
T15127 |
amod |
observed,R |
| R4447 |
T15130 |
T15124 |
prep |
to,ratio |
| R4448 |
T15131 |
T15132 |
amod |
expected,R |
| R4449 |
T15132 |
T15130 |
pobj |
R,to |
| R4450 |
T15133 |
T15124 |
prep |
for,ratio |
| R4451 |
T15134 |
T15135 |
det |
each,SNP |
| R4452 |
T15135 |
T15133 |
pobj |
SNP,for |
| R4453 |
T15136 |
T15137 |
punct |
(,is |
| R4454 |
T15137 |
T15124 |
parataxis |
is,ratio |
| R4455 |
T15138 |
T15139 |
det |
each,SNP |
| R4456 |
T15139 |
T15137 |
nsubj |
SNP,is |
| R4457 |
T15140 |
T15141 |
det |
a,dot |
| R4458 |
T15141 |
T15137 |
attr |
dot,is |
| R4459 |
T15142 |
T15141 |
amod |
blue,dot |
| R4460 |
T15143 |
T15137 |
punct |
),is |
| R4461 |
T15144 |
T15122 |
cc |
and,is |
| R4462 |
T15145 |
T15146 |
advmod |
thus,serves |
| R4463 |
T15146 |
T15122 |
conj |
serves,is |
| R4464 |
T15147 |
T15146 |
prep |
as,serves |
| R4465 |
T15148 |
T15149 |
det |
a,surrogate |
| R4466 |
T15149 |
T15147 |
pobj |
surrogate,as |
| R4467 |
T15150 |
T15149 |
prep |
of,surrogate |
| R4468 |
T15151 |
T15152 |
compound |
copy,number |
| R4469 |
T15152 |
T15150 |
pobj |
number,of |
| R4470 |
T15153 |
T15146 |
prep |
at,serves |
| R4471 |
T15154 |
T15155 |
det |
each,locus |
| R4472 |
T15155 |
T15153 |
pobj |
locus,at |
| R4473 |
T15156 |
T15122 |
punct |
.,is |
| R4474 |
T15158 |
T15159 |
compound |
B,allele |
| R4475 |
T15159 |
T15160 |
compound |
allele,frequency |
| R4476 |
T15160 |
T15161 |
nsubj |
frequency,is |
| R4477 |
T15162 |
T15163 |
det |
a,measure |
| R4478 |
T15163 |
T15161 |
attr |
measure,is |
| R4479 |
T15164 |
T15163 |
prep |
of,measure |
| R4480 |
T15165 |
T15166 |
det |
the,number |
| R4481 |
T15166 |
T15164 |
pobj |
number,of |
| R4482 |
T15167 |
T15166 |
prep |
of,number |
| R4483 |
T15168 |
T15167 |
pobj |
times,of |
| R4484 |
T15169 |
T15170 |
det |
the,alleles |
| R4485 |
T15170 |
T15174 |
nsubjpass |
alleles,detected |
| R4486 |
T15171 |
T15170 |
nmod |
A,alleles |
| R4487 |
T15172 |
T15171 |
cc |
or,A |
| R4488 |
T15173 |
T15171 |
conj |
B,A |
| R4489 |
T15174 |
T15168 |
advcl |
detected,times |
| R4490 |
T15175 |
T15174 |
auxpass |
are,detected |
| R4491 |
T15176 |
T15174 |
prep |
at,detected |
| R4492 |
T15177 |
T15178 |
det |
each,locus |
| R4493 |
T15178 |
T15176 |
pobj |
locus,at |
| R4494 |
T15179 |
T15180 |
punct |
(,denoted |
| R4495 |
T15180 |
T15161 |
parataxis |
denoted,is |
| R4496 |
T15181 |
T15182 |
det |
each,SNP |
| R4497 |
T15182 |
T15180 |
nsubjpass |
SNP,denoted |
| R4498 |
T15183 |
T15180 |
auxpass |
is,denoted |
| R4499 |
T15184 |
T15180 |
agent |
by,denoted |
| R4500 |
T15185 |
T15186 |
det |
a,dot |
| R4501 |
T15186 |
T15184 |
pobj |
dot,by |
| R4502 |
T15187 |
T15186 |
amod |
blue,dot |
| R4503 |
T15188 |
T15180 |
punct |
),denoted |
| R4504 |
T15189 |
T15161 |
punct |
.,is |
| R4505 |
T15191 |
T15192 |
advmod |
Thus,are |
| R4506 |
T15193 |
T15192 |
punct |
", ",are |
| R4507 |
T15194 |
T15195 |
nsubj |
SNPs,are |
| R4508 |
T15195 |
T15192 |
ccomp |
are,are |
| R4509 |
T15196 |
T15194 |
prep |
with,SNPs |
| R4510 |
T15197 |
T15198 |
det |
a,frequency |
| R4511 |
T15198 |
T15196 |
pobj |
frequency,with |
| R4512 |
T15199 |
T15200 |
compound |
B,allele |
| R4513 |
T15200 |
T15198 |
compound |
allele,frequency |
| R4514 |
T15201 |
T15198 |
prep |
of,frequency |
| R4515 |
T15202 |
T15201 |
pobj |
one,of |
| R4516 |
T15203 |
T15204 |
amod |
apparent,homozygotes |
| R4517 |
T15204 |
T15195 |
attr |
homozygotes,are |
| R4518 |
T15205 |
T15206 |
compound |
B,B |
| R4519 |
T15206 |
T15204 |
compound |
B,homozygotes |
| R4520 |
T15207 |
T15206 |
punct |
/,B |
| R4521 |
T15208 |
T15192 |
punct |
", ",are |
| R4522 |
T15209 |
T15192 |
nsubj |
SNPs,are |
| R4523 |
T15210 |
T15209 |
prep |
with,SNPs |
| R4524 |
T15211 |
T15212 |
det |
a,frequency |
| R4525 |
T15212 |
T15210 |
pobj |
frequency,with |
| R4526 |
T15213 |
T15214 |
compound |
B,allele |
| R4527 |
T15214 |
T15212 |
compound |
allele,frequency |
| R4528 |
T15215 |
T15212 |
prep |
of,frequency |
| R4529 |
T15216 |
T15215 |
pobj |
0.5,of |
| R4530 |
T15217 |
T15218 |
amod |
apparent,heterozygotes |
| R4531 |
T15218 |
T15192 |
attr |
heterozygotes,are |
| R4532 |
T15219 |
T15220 |
compound |
A,B |
| R4533 |
T15220 |
T15218 |
compound |
B,heterozygotes |
| R4534 |
T15221 |
T15220 |
punct |
/,B |
| R4535 |
T15222 |
T15192 |
punct |
", ",are |
| R4536 |
T15223 |
T15192 |
cc |
and,are |
| R4537 |
T15224 |
T15225 |
nsubj |
those,are |
| R4538 |
T15225 |
T15192 |
conj |
are,are |
| R4539 |
T15226 |
T15224 |
prep |
with,those |
| R4540 |
T15227 |
T15228 |
det |
a,frequency |
| R4541 |
T15228 |
T15226 |
pobj |
frequency,with |
| R4542 |
T15229 |
T15230 |
compound |
B,allele |
| R4543 |
T15230 |
T15228 |
compound |
allele,frequency |
| R4544 |
T15231 |
T15228 |
prep |
of,frequency |
| R4545 |
T15232 |
T15231 |
pobj |
zero,of |
| R4546 |
T15233 |
T15234 |
amod |
apparent,homozygotes |
| R4547 |
T15234 |
T15225 |
attr |
homozygotes,are |
| R4548 |
T15235 |
T15236 |
compound |
A,A |
| R4549 |
T15236 |
T15234 |
compound |
A,homozygotes |
| R4550 |
T15237 |
T15236 |
punct |
/,A |
| R4551 |
T15238 |
T15225 |
punct |
.,are |
| R4552 |
T15240 |
T15241 |
advmod |
Clearly,show |
| R4553 |
T15242 |
T15241 |
punct |
", ",show |
| R4554 |
T15243 |
T15244 |
det |
these,plots |
| R4555 |
T15244 |
T15241 |
nsubj |
plots,show |
| R4556 |
T15245 |
T15246 |
det |
a,region |
| R4557 |
T15246 |
T15241 |
dobj |
region,show |
| R4558 |
T15247 |
T15246 |
amod |
contiguous,region |
| R4559 |
T15248 |
T15249 |
punct |
~,200 |
| R4560 |
T15249 |
T15250 |
nummod |
200,kb |
| R4561 |
T15250 |
T15251 |
npadvmod |
kb,long |
| R4562 |
T15251 |
T15246 |
amod |
long,region |
| R4563 |
T15252 |
T15246 |
prep |
with,region |
| R4564 |
T15253 |
T15254 |
amod |
decreased,number |
| R4565 |
T15254 |
T15252 |
pobj |
number,with |
| R4566 |
T15255 |
T15254 |
compound |
copy,number |
| R4567 |
T15256 |
T15254 |
cc |
and,number |
| R4568 |
T15257 |
T15258 |
amod |
apparent,homozygosity |
| R4569 |
T15258 |
T15254 |
conj |
homozygosity,number |
| R4570 |
T15259 |
T15246 |
punct |
(,region |
| R4571 |
T15260 |
T15246 |
acl |
bounded,region |
| R4572 |
T15261 |
T15260 |
agent |
by,bounded |
| R4573 |
T15262 |
T15263 |
det |
a,box |
| R4574 |
T15263 |
T15261 |
pobj |
box,by |
| R4575 |
T15264 |
T15263 |
amod |
red,box |
| R4576 |
T15265 |
T15241 |
punct |
),show |
| R4577 |
T15266 |
T15241 |
punct |
.,show |
| R4578 |
T15268 |
T15269 |
mark |
As,demonstrated |
| R4579 |
T15269 |
T15272 |
advcl |
demonstrated,is |
| R4580 |
T15270 |
T15269 |
nsubj |
we,demonstrated |
| R4581 |
T15271 |
T15269 |
aux |
have,demonstrated |
| R4582 |
T15273 |
T15269 |
advmod |
previously,demonstrated |
| R4583 |
T15274 |
T15272 |
punct |
", ",is |
| R4584 |
T15275 |
T15272 |
nsubj |
this,is |
| R4585 |
T15276 |
T15272 |
acomp |
indicative,is |
| R4586 |
T15277 |
T15276 |
prep |
of,indicative |
| R4587 |
T15278 |
T15279 |
det |
a,deletion |
| R4588 |
T15279 |
T15277 |
pobj |
deletion,of |
| R4589 |
T15280 |
T15279 |
amod |
heterozygous,deletion |
| R4590 |
T15281 |
T15279 |
amod |
genomic,deletion |
| R4591 |
T15282 |
T15283 |
punct |
[,15 |
| R4592 |
T15283 |
T15272 |
parataxis |
15,is |
| R4593 |
T15284 |
T15283 |
punct |
],15 |
| R4594 |
T15285 |
T15272 |
punct |
.,is |
| R4595 |
T15287 |
T15288 |
prep |
Below,is |
| R4596 |
T15289 |
T15290 |
det |
these,plots |
| R4597 |
T15290 |
T15287 |
pobj |
plots,Below |
| R4598 |
T15291 |
T15292 |
det |
a,schematic |
| R4599 |
T15292 |
T15288 |
nsubj |
schematic,is |
| R4600 |
T15293 |
T15292 |
prep |
of,schematic |
| R4601 |
T15294 |
T15295 |
det |
the,genes |
| R4602 |
T15295 |
T15293 |
pobj |
genes,of |
| R4603 |
T15296 |
T15295 |
nummod |
two,genes |
| R4604 |
T15297 |
T15295 |
amod |
known,genes |
| R4605 |
T15298 |
T15295 |
acl |
affected,genes |
| R4606 |
T15299 |
T15298 |
agent |
by,affected |
| R4607 |
T15300 |
T15301 |
det |
this,deletion |
| R4608 |
T15301 |
T15299 |
pobj |
deletion,by |
| R4609 |
T15302 |
T15295 |
punct |
", ",genes |
| R4610 |
T15303 |
T15295 |
appos |
ITPR1,genes |
| R4611 |
T15304 |
T15303 |
cc |
and,ITPR1 |
| R4612 |
T15305 |
T15303 |
conj |
SUMF1,ITPR1 |
| R4613 |
T15306 |
T15288 |
punct |
.,is |
| R4614 |
T15781 |
T15782 |
compound |
Mutation,Analysis |
| R4615 |
T15783 |
T15782 |
prep |
in,Analysis |
| R4616 |
T15784 |
T15785 |
det |
the,Family |
| R4617 |
T15785 |
T15783 |
pobj |
Family,in |
| R4618 |
T15786 |
T15785 |
amod |
Australian,Family |
| R4619 |
T15787 |
T15785 |
compound |
SCA15,Family |
| R4620 |
T15789 |
T15790 |
punct |
(,Top |
| R4621 |
T15790 |
T15791 |
parataxis |
Top,Pedigree |
| R4622 |
T15792 |
T15790 |
punct |
),Top |
| R4623 |
T15793 |
T15791 |
prep |
of,Pedigree |
| R4624 |
T15794 |
T15793 |
pobj |
kindred,of |
| R4625 |
T15795 |
T15791 |
punct |
.,Pedigree |
| R4626 |
T15797 |
T15798 |
amod |
Filled,symbols |
| R4627 |
T15798 |
T15799 |
nsubj |
symbols,denote |
| R4628 |
T15799 |
T15800 |
ccomp |
denote,denotes |
| R4629 |
T15801 |
T15802 |
amod |
affected,individuals |
| R4630 |
T15802 |
T15799 |
dobj |
individuals,denote |
| R4631 |
T15803 |
T15800 |
punct |
;,denotes |
| R4632 |
T15804 |
T15805 |
amod |
open,symbols |
| R4633 |
T15805 |
T15806 |
nsubj |
symbols,individuals |
| R4634 |
T15806 |
T15800 |
ccomp |
individuals,denotes |
| R4635 |
T15807 |
T15806 |
punct |
", ",individuals |
| R4636 |
T15808 |
T15806 |
amod |
unaffected,individuals |
| R4637 |
T15809 |
T15800 |
punct |
;,denotes |
| R4638 |
T15810 |
T15811 |
amod |
grey,symbol |
| R4639 |
T15811 |
T15812 |
nsubj |
symbol,denotes |
| R4640 |
T15812 |
T15800 |
ccomp |
denotes,denotes |
| R4641 |
T15813 |
T15814 |
amod |
unknown,status |
| R4642 |
T15814 |
T15812 |
dobj |
status,denotes |
| R4643 |
T15815 |
T15814 |
compound |
disease,status |
| R4644 |
T15816 |
T15800 |
punct |
;,denotes |
| R4645 |
T15817 |
T15818 |
compound |
bulls,eye |
| R4646 |
T15818 |
T15820 |
compound |
eye,symbol |
| R4647 |
T15819 |
T15818 |
punct |
-,eye |
| R4648 |
T15820 |
T15800 |
nsubj |
symbol,denotes |
| R4649 |
T15821 |
T15822 |
amod |
obligate,carrier |
| R4650 |
T15822 |
T15800 |
dobj |
carrier,denotes |
| R4651 |
T15823 |
T15800 |
punct |
.,denotes |
| R4652 |
T15825 |
T15826 |
compound |
w,w |
| R4653 |
T15827 |
T15826 |
punct |
/,w |
| R4654 |
T15828 |
T15826 |
punct |
", ",w |
| R4655 |
T15829 |
T15830 |
amod |
wild,type |
| R4656 |
T15830 |
T15826 |
appos |
type,w |
| R4657 |
T15831 |
T15830 |
punct |
-,type |
| R4658 |
T15832 |
T15830 |
prep |
at,type |
| R4659 |
T15833 |
T15832 |
pobj |
ITPR1,at |
| R4660 |
T15834 |
T15826 |
punct |
;,w |
| R4661 |
T15835 |
T15836 |
compound |
w,m |
| R4662 |
T15836 |
T15826 |
appos |
m,w |
| R4663 |
T15837 |
T15836 |
punct |
/,m |
| R4664 |
T15838 |
T15836 |
punct |
", ",m |
| R4665 |
T15839 |
T15840 |
amod |
heterozygous,carrier |
| R4666 |
T15840 |
T15836 |
appos |
carrier,m |
| R4667 |
T15841 |
T15840 |
prep |
of,carrier |
| R4668 |
T15842 |
T15843 |
det |
the,deletion |
| R4669 |
T15843 |
T15841 |
pobj |
deletion,of |
| R4670 |
T15844 |
T15843 |
compound |
ITPR1,deletion |
| R4671 |
T15845 |
T15826 |
punct |
.,w |
| R4672 |
T15847 |
T15848 |
punct |
(,Middle |
| R4673 |
T15848 |
T15849 |
parataxis |
Middle,Schematic |
| R4674 |
T15850 |
T15848 |
punct |
),Middle |
| R4675 |
T15851 |
T15849 |
prep |
of,Schematic |
| R4676 |
T15852 |
T15853 |
compound |
primer,pairs |
| R4677 |
T15853 |
T15851 |
pobj |
pairs,of |
| R4678 |
T15854 |
T15853 |
acl |
used,pairs |
| R4679 |
T15855 |
T15856 |
aux |
to,narrow |
| R4680 |
T15856 |
T15854 |
advcl |
narrow,used |
| R4681 |
T15857 |
T15858 |
det |
the,regions |
| R4682 |
T15858 |
T15856 |
dobj |
regions,narrow |
| R4683 |
T15859 |
T15858 |
amod |
unknown,regions |
| R4684 |
T15860 |
T15858 |
prep |
between,regions |
| R4685 |
T15861 |
T15862 |
amod |
known,sequence |
| R4686 |
T15862 |
T15860 |
pobj |
sequence,between |
| R4687 |
T15863 |
T15862 |
amod |
deleted,sequence |
| R4688 |
T15864 |
T15862 |
cc |
and,sequence |
| R4689 |
T15865 |
T15866 |
amod |
known,sequence |
| R4690 |
T15866 |
T15862 |
conj |
sequence,sequence |
| R4691 |
T15867 |
T15866 |
amod |
diploid,sequence |
| R4692 |
T15868 |
T15856 |
prep |
at,narrow |
| R4693 |
T15869 |
T15870 |
det |
the,locus |
| R4694 |
T15870 |
T15868 |
pobj |
locus,at |
| R4695 |
T15871 |
T15870 |
compound |
SCA15,locus |
| R4696 |
T15872 |
T15849 |
punct |
.,Schematic |
| R4697 |
T15874 |
T15875 |
nummod |
Nine,pairs |
| R4698 |
T15875 |
T15877 |
nsubjpass |
pairs,used |
| R4699 |
T15876 |
T15875 |
compound |
primer,pairs |
| R4700 |
T15877 |
T15884 |
ccomp |
used,used |
| R4701 |
T15878 |
T15879 |
punct |
(,T1 |
| R4702 |
T15879 |
T15875 |
parataxis |
T1,pairs |
| R4703 |
T15880 |
T15881 |
punct |
–,T9 |
| R4704 |
T15881 |
T15879 |
prep |
T9,T1 |
| R4705 |
T15882 |
T15879 |
punct |
),T1 |
| R4706 |
T15883 |
T15877 |
auxpass |
were,used |
| R4707 |
T15885 |
T15886 |
aux |
to,amplify |
| R4708 |
T15886 |
T15877 |
advcl |
amplify,used |
| R4709 |
T15887 |
T15886 |
prep |
across,amplify |
| R4710 |
T15888 |
T15889 |
det |
the,region |
| R4711 |
T15889 |
T15887 |
pobj |
region,across |
| R4712 |
T15890 |
T15889 |
amod |
unknown,region |
| R4713 |
T15891 |
T15889 |
amod |
telomeric,region |
| R4714 |
T15892 |
T15891 |
prep |
to,telomeric |
| R4715 |
T15893 |
T15894 |
det |
the,region |
| R4716 |
T15894 |
T15892 |
pobj |
region,to |
| R4717 |
T15895 |
T15894 |
amod |
known,region |
| R4718 |
T15896 |
T15894 |
amod |
deleted,region |
| R4719 |
T15897 |
T15884 |
punct |
;,used |
| R4720 |
T15898 |
T15899 |
nummod |
19,pairs |
| R4721 |
T15899 |
T15884 |
nsubjpass |
pairs,used |
| R4722 |
T15900 |
T15899 |
compound |
primer,pairs |
| R4723 |
T15901 |
T15902 |
punct |
(,C1 |
| R4724 |
T15902 |
T15899 |
parataxis |
C1,pairs |
| R4725 |
T15903 |
T15904 |
punct |
–,C19 |
| R4726 |
T15904 |
T15902 |
prep |
C19,C1 |
| R4727 |
T15905 |
T15902 |
punct |
),C1 |
| R4728 |
T15906 |
T15884 |
auxpass |
were,used |
| R4729 |
T15907 |
T15908 |
aux |
to,amplify |
| R4730 |
T15908 |
T15884 |
advcl |
amplify,used |
| R4731 |
T15909 |
T15908 |
prep |
across,amplify |
| R4732 |
T15910 |
T15911 |
det |
the,region |
| R4733 |
T15911 |
T15909 |
pobj |
region,across |
| R4734 |
T15912 |
T15911 |
amod |
unknown,region |
| R4735 |
T15913 |
T15911 |
amod |
centromeric,region |
| R4736 |
T15914 |
T15908 |
prep |
to,amplify |
| R4737 |
T15915 |
T15916 |
det |
the,region |
| R4738 |
T15916 |
T15914 |
pobj |
region,to |
| R4739 |
T15917 |
T15916 |
amod |
known,region |
| R4740 |
T15918 |
T15916 |
amod |
deleted,region |
| R4741 |
T15919 |
T15884 |
punct |
.,used |
| R4742 |
T15921 |
T15922 |
det |
All,PCRs |
| R4743 |
T15922 |
T15923 |
nsubjpass |
PCRs,carried |
| R4744 |
T15924 |
T15923 |
auxpass |
were,carried |
| R4745 |
T15925 |
T15923 |
prt |
out,carried |
| R4746 |
T15926 |
T15923 |
prep |
in,carried |
| R4747 |
T15927 |
T15928 |
det |
the,members |
| R4748 |
T15928 |
T15926 |
pobj |
members,in |
| R4749 |
T15929 |
T15928 |
nummod |
three,members |
| R4750 |
T15930 |
T15928 |
amod |
affected,members |
| R4751 |
T15931 |
T15928 |
compound |
family,members |
| R4752 |
T15932 |
T15923 |
punct |
.,carried |
| R4753 |
T15934 |
T15935 |
nsubj |
Analysis,narrowed |
| R4754 |
T15936 |
T15934 |
prep |
of,Analysis |
| R4755 |
T15937 |
T15938 |
det |
these,data |
| R4756 |
T15938 |
T15936 |
pobj |
data,of |
| R4757 |
T15939 |
T15940 |
det |
the,region |
| R4758 |
T15940 |
T15935 |
dobj |
region,narrowed |
| R4759 |
T15941 |
T15940 |
amod |
unknown,region |
| R4760 |
T15942 |
T15935 |
punct |
", ",narrowed |
| R4761 |
T15943 |
T15935 |
cc |
and,narrowed |
| R4762 |
T15944 |
T15945 |
advmod |
ultimately,were |
| R4763 |
T15945 |
T15935 |
conj |
were,narrowed |
| R4764 |
T15946 |
T15945 |
nsubj |
we,were |
| R4765 |
T15947 |
T15945 |
acomp |
able,were |
| R4766 |
T15948 |
T15949 |
aux |
to,use |
| R4767 |
T15949 |
T15947 |
xcomp |
use,able |
| R4768 |
T15950 |
T15949 |
dobj |
primer,use |
| R4769 |
T15951 |
T15950 |
appos |
T3f,primer |
| R4770 |
T15952 |
T15951 |
cc |
and,T3f |
| R4771 |
T15953 |
T15951 |
conj |
C11r,T3f |
| R4772 |
T15954 |
T15955 |
aux |
to,amplify |
| R4773 |
T15955 |
T15949 |
advcl |
amplify,use |
| R4774 |
T15956 |
T15955 |
prep |
across,amplify |
| R4775 |
T15957 |
T15958 |
det |
the,breakpoint |
| R4776 |
T15958 |
T15956 |
pobj |
breakpoint,across |
| R4777 |
T15959 |
T15958 |
compound |
deletion,breakpoint |
| R4778 |
T15960 |
T15955 |
prep |
in,amplify |
| R4779 |
T15961 |
T15962 |
det |
the,members |
| R4780 |
T15962 |
T15960 |
pobj |
members,in |
| R4781 |
T15963 |
T15962 |
nummod |
three,members |
| R4782 |
T15964 |
T15962 |
amod |
affected,members |
| R4783 |
T15965 |
T15962 |
compound |
family,members |
| R4784 |
T15966 |
T15955 |
punct |
", ",amplify |
| R4785 |
T15967 |
T15955 |
advcl |
producing,amplify |
| R4786 |
T15968 |
T15969 |
det |
a,fragment |
| R4787 |
T15969 |
T15967 |
dobj |
fragment,producing |
| R4788 |
T15970 |
T15969 |
prep |
of,fragment |
| R4789 |
T15971 |
T15972 |
nummod |
953,bp |
| R4790 |
T15972 |
T15970 |
pobj |
bp,of |
| R4791 |
T15973 |
T15967 |
prep |
in,producing |
| R4792 |
T15974 |
T15975 |
amod |
affected,individuals |
| R4793 |
T15975 |
T15973 |
pobj |
individuals,in |
| R4794 |
T15976 |
T15945 |
punct |
.,were |
| R4795 |
T15978 |
T15979 |
punct |
(,Bottom |
| R4796 |
T15979 |
T15980 |
parataxis |
Bottom,Gel |
| R4797 |
T15981 |
T15979 |
punct |
),Bottom |
| R4798 |
T15982 |
T15980 |
acl |
showing,Gel |
| R4799 |
T15983 |
T15984 |
compound |
amplification,product |
| R4800 |
T15984 |
T15982 |
dobj |
product,showing |
| R4801 |
T15985 |
T15984 |
acl |
using,product |
| R4802 |
T15986 |
T15987 |
compound |
primer,pair |
| R4803 |
T15987 |
T15985 |
dobj |
pair,using |
| R4804 |
T15988 |
T15987 |
appos |
T3f,pair |
| R4805 |
T15989 |
T15988 |
cc |
and,T3f |
| R4806 |
T15990 |
T15988 |
conj |
C11r,T3f |
| R4807 |
T15991 |
T15987 |
prep |
from,pair |
| R4808 |
T15992 |
T15993 |
amod |
affected,6 |
| R4809 |
T15993 |
T15991 |
pobj |
6,from |
| R4810 |
T15994 |
T15993 |
nmod |
pedigree,6 |
| R4811 |
T15995 |
T15993 |
nmod |
members,6 |
| R4812 |
T15996 |
T15993 |
punct |
", ",6 |
| R4813 |
T15997 |
T15993 |
conj |
7,6 |
| R4814 |
T15998 |
T15997 |
punct |
", ",7 |
| R4815 |
T15999 |
T15997 |
cc |
and,7 |
| R4816 |
T16000 |
T15997 |
conj |
19,7 |
| R4817 |
T16001 |
T15991 |
punct |
;,from |
| R4818 |
T16002 |
T15991 |
conj |
in,from |
| R4819 |
T16003 |
T16004 |
compound |
pedigree,member |
| R4820 |
T16004 |
T16002 |
pobj |
member,in |
| R4821 |
T16005 |
T16004 |
nummod |
23,member |
| R4822 |
T16006 |
T16004 |
punct |
", ",member |
| R4823 |
T16007 |
T16004 |
prep |
with,member |
| R4824 |
T16008 |
T16009 |
amod |
unknown,status |
| R4825 |
T16009 |
T16007 |
pobj |
status,with |
| R4826 |
T16010 |
T16011 |
compound |
disease,affection |
| R4827 |
T16011 |
T16009 |
compound |
affection,status |
| R4828 |
T16012 |
T16002 |
punct |
;,in |
| R4829 |
T16013 |
T16002 |
conj |
in,in |
| R4830 |
T16014 |
T16015 |
det |
a,control |
| R4831 |
T16015 |
T16013 |
pobj |
control,in |
| R4832 |
T16016 |
T16017 |
advmod |
neurologically,normal |
| R4833 |
T16017 |
T16015 |
amod |
normal,control |
| R4834 |
T16018 |
T16019 |
punct |
(,C |
| R4835 |
T16019 |
T16015 |
parataxis |
C,control |
| R4836 |
T16020 |
T16019 |
punct |
),C |
| R4837 |
T16021 |
T16013 |
punct |
;,in |
| R4838 |
T16022 |
T16013 |
cc |
and,in |
| R4839 |
T16023 |
T16013 |
conj |
in,in |
| R4840 |
T16024 |
T16025 |
det |
a,control |
| R4841 |
T16025 |
T16023 |
pobj |
control,in |
| R4842 |
T16026 |
T16027 |
det |
no,template |
| R4843 |
T16027 |
T16025 |
compound |
template,control |
| R4844 |
T16028 |
T16029 |
punct |
(,NC |
| R4845 |
T16029 |
T16025 |
parataxis |
NC,control |
| R4846 |
T16030 |
T16029 |
punct |
),NC |
| R4847 |
T16031 |
T15980 |
punct |
.,Gel |
| R4848 |
T16245 |
T16246 |
compound |
Western,Blot |
| R4849 |
T16246 |
T16247 |
compound |
Blot,Analysis |
| R4850 |
T16248 |
T16247 |
prep |
of,Analysis |
| R4851 |
T16249 |
T16250 |
compound |
ITPR1,Levels |
| R4852 |
T16250 |
T16248 |
pobj |
Levels,of |
| R4853 |
T16251 |
T16250 |
compound |
Protein,Levels |
| R4854 |
T16252 |
T16247 |
prep |
in,Analysis |
| R4855 |
T16253 |
T16254 |
nmod |
EBV,Lymphoblasts |
| R4856 |
T16254 |
T16252 |
pobj |
Lymphoblasts,in |
| R4857 |
T16255 |
T16254 |
amod |
Immortalized,Lymphoblasts |
| R4858 |
T16256 |
T16254 |
prep |
from,Lymphoblasts |
| R4859 |
T16257 |
T16258 |
compound |
AUS1,Members |
| R4860 |
T16258 |
T16256 |
pobj |
Members,from |
| R4861 |
T16259 |
T16258 |
compound |
Family,Members |
| R4862 |
T16261 |
T16262 |
compound |
Western,blot |
| R4863 |
T16263 |
T16262 |
acl |
performed,blot |
| R4864 |
T16264 |
T16265 |
aux |
to,examine |
| R4865 |
T16265 |
T16263 |
advcl |
examine,performed |
| R4866 |
T16266 |
T16267 |
compound |
ITPR1,levels |
| R4867 |
T16267 |
T16265 |
dobj |
levels,examine |
| R4868 |
T16268 |
T16267 |
prep |
in,levels |
| R4869 |
T16269 |
T16270 |
nmod |
EBV,lymphocytes |
| R4870 |
T16270 |
T16268 |
pobj |
lymphocytes,in |
| R4871 |
T16271 |
T16270 |
amod |
immortalized,lymphocytes |
| R4872 |
T16272 |
T16270 |
prep |
from,lymphocytes |
| R4873 |
T16273 |
T16274 |
npadvmod |
AUS1,affected |
| R4874 |
T16274 |
T16275 |
amod |
affected,members |
| R4875 |
T16275 |
T16272 |
pobj |
members,from |
| R4876 |
T16276 |
T16275 |
compound |
family,members |
| R4877 |
T16277 |
T16275 |
acl |
carrying,members |
| R4878 |
T16278 |
T16279 |
det |
the,deletion |
| R4879 |
T16279 |
T16277 |
dobj |
deletion,carrying |
| R4880 |
T16280 |
T16279 |
compound |
ITPR1,deletion |
| R4881 |
T16281 |
T16272 |
cc |
and,from |
| R4882 |
T16282 |
T16272 |
conj |
from,from |
| R4883 |
T16283 |
T16284 |
det |
an,member |
| R4884 |
T16284 |
T16282 |
pobj |
member,from |
| R4885 |
T16285 |
T16284 |
compound |
AUS1,member |
| R4886 |
T16286 |
T16284 |
compound |
family,member |
| R4887 |
T16287 |
T16284 |
prep |
of,member |
| R4888 |
T16288 |
T16289 |
amod |
unknown,status |
| R4889 |
T16289 |
T16287 |
pobj |
status,of |
| R4890 |
T16290 |
T16289 |
compound |
disease,status |
| R4891 |
T16291 |
T16292 |
dep |
who,carry |
| R4892 |
T16292 |
T16284 |
relcl |
carry,member |
| R4893 |
T16293 |
T16292 |
aux |
does,carry |
| R4894 |
T16294 |
T16292 |
neg |
not,carry |
| R4895 |
T16295 |
T16296 |
det |
the,deletion |
| R4896 |
T16296 |
T16292 |
dobj |
deletion,carry |
| R4897 |
T16297 |
T16262 |
punct |
.,blot |
| R4898 |
T16299 |
T16300 |
advmod |
Notably,show |
| R4899 |
T16301 |
T16302 |
det |
the,samples |
| R4900 |
T16302 |
T16300 |
nsubj |
samples,show |
| R4901 |
T16303 |
T16302 |
prep |
from,samples |
| R4902 |
T16304 |
T16303 |
pobj |
patients,from |
| R4903 |
T16305 |
T16304 |
prep |
with,patients |
| R4904 |
T16306 |
T16307 |
compound |
ITPR1,deletion |
| R4905 |
T16307 |
T16305 |
pobj |
deletion,with |
| R4906 |
T16308 |
T16309 |
det |
a,decrease |
| R4907 |
T16309 |
T16300 |
dobj |
decrease,show |
| R4908 |
T16310 |
T16309 |
amod |
dramatic,decrease |
| R4909 |
T16311 |
T16309 |
prep |
in,decrease |
| R4910 |
T16312 |
T16313 |
compound |
ITPR1,levels |
| R4911 |
T16313 |
T16311 |
pobj |
levels,in |
| R4912 |
T16314 |
T16300 |
punct |
.,show |
| R4913 |
T16316 |
T16317 |
aux |
To,demonstrate |
| R4914 |
T16317 |
T16318 |
advcl |
demonstrate,diluted |
| R4915 |
T16319 |
T16320 |
amod |
equal,loading |
| R4916 |
T16320 |
T16317 |
dobj |
loading,demonstrate |
| R4917 |
T16321 |
T16318 |
punct |
", ",diluted |
| R4918 |
T16322 |
T16323 |
det |
these,samples |
| R4919 |
T16323 |
T16318 |
nsubjpass |
samples,diluted |
| R4920 |
T16324 |
T16318 |
auxpass |
were,diluted |
| R4921 |
T16325 |
T16318 |
npadvmod |
one,diluted |
| R4922 |
T16326 |
T16325 |
prep |
in,one |
| R4923 |
T16327 |
T16326 |
pobj |
five,in |
| R4924 |
T16328 |
T16318 |
punct |
", ",diluted |
| R4925 |
T16329 |
T16318 |
cc |
and,diluted |
| R4926 |
T16330 |
T16331 |
det |
the,blot |
| R4927 |
T16331 |
T16333 |
nsubjpass |
blot,repeated |
| R4928 |
T16332 |
T16331 |
compound |
Western,blot |
| R4929 |
T16333 |
T16318 |
conj |
repeated,diluted |
| R4930 |
T16334 |
T16333 |
auxpass |
was,repeated |
| R4931 |
T16335 |
T16333 |
advcl |
using,repeated |
| R4932 |
T16336 |
T16337 |
det |
an,antibody |
| R4933 |
T16337 |
T16335 |
dobj |
antibody,using |
| R4934 |
T16338 |
T16337 |
prep |
against,antibody |
| R4935 |
T16339 |
T16338 |
pobj |
ACTB,against |
| R4936 |
T16340 |
T16318 |
punct |
.,diluted |
| R59 |
T937 |
T934 |
pobj |
analysis,Through |
| R92 |
T970 |
T974 |
nummod |
5,triphosphate |
| R130 |
T1012 |
T1010 |
pobj |
level,in |
| R150 |
T1033 |
T1025 |
appos |
disorder,ataxia |