PMC:1564426 / 53459-53771
Annnotations
craft-ca-core-ex-dev
Below, discontinuous spans are shown in the chain model. You can change it to the bag model.
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T28230 | 1-12 | SO_EXT:genomic_DNA | denotes | Genomic DNA |
| T28231 | 9-12 | CHEBI_SO_EXT:DNA | denotes | DNA |
| T28232 | 18-25 | _FRAGMENT | denotes | tips of |
| T28233 | 32-37 | UBERON:0010162 | denotes | tails |
| T28234 | 26-31 | NCBITaxon:10088 | denotes | mouse |
| T28235 | 121-128 | SO_EXT:0000112 | denotes | primers |
| T28236 | 130-133 | PR_EXT:000004122 | denotes | Apc |
| T28237 | 171-174 | PR_EXT:000004122 | denotes | Apc |
| T28238 | 226-228 | SO_EXT:0000028 | denotes | bp |
| T28239 | 237-239 | SO_EXT:0000028 | denotes | bp |
| T28240 | 258-267 | SO_EXT:wild_type_entity_or_quality | denotes | wild-type |
| T28241 | 284-287 | PR_EXT:000004122 | denotes | Apc |
| T28242 | 291-297 | SO_EXT:0001023 | denotes | allele |
| R8501 | T28233 | T28232 | _lexicallyChainedTo | tails,tips of |
craft-ca-core-dev
Below, discontinuous spans are shown in the chain model. You can change it to the bag model.
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T28203 | 1-8 | SO:0001026 | denotes | Genomic |
| T28204 | 18-25 | _FRAGMENT | denotes | tips of |
| T28205 | 32-37 | UBERON:0010162 | denotes | tails |
| T28206 | 26-31 | NCBITaxon:10088 | denotes | mouse |
| T28207 | 121-128 | SO:0000112 | denotes | primers |
| T28208 | 130-133 | PR:000004122 | denotes | Apc |
| T28209 | 171-174 | PR:000004122 | denotes | Apc |
| T28210 | 226-228 | SO:0000028 | denotes | bp |
| T28211 | 237-239 | SO:0000028 | denotes | bp |
| T28212 | 284-287 | PR:000004122 | denotes | Apc |
| T28213 | 291-297 | SO:0001023 | denotes | allele |
| R8500 | T28205 | T28204 | _lexicallyChainedTo | tails,tips of |
craft-sa-dev
| Id | Subject | Object | Predicate | Lexical cue |
|---|---|---|---|---|
| T28266 | 0-312 | sentence | denotes | Genomic DNA from tips of mouse tails obtained at ~10 d of age was genotyped in a single PCR reaction with the following primers: Apc-Int13F2 (GAGAAACCCTGTCTCGAAAAAA) and Apc-Int13R2 (AGTGCTGTTTCTATGAGTCAAC), resulting in 320-bp and 430-bp products from the wild-type and conditional ApcCKO allele, respectively. |
| T28267 | 1-8 | JJ | denotes | Genomic |
| T28268 | 9-12 | NN | denotes | DNA |
| T28269 | 67-76 | VBN | denotes | genotyped |
| T28270 | 13-17 | IN | denotes | from |
| T28271 | 18-22 | NNS | denotes | tips |
| T28272 | 23-25 | IN | denotes | of |
| T28273 | 26-31 | NN | denotes | mouse |
| T28274 | 32-37 | NNS | denotes | tails |
| T28275 | 38-46 | VBN | denotes | obtained |
| T28276 | 47-49 | IN | denotes | at |
| T28277 | 50-51 | SYM | denotes | ~ |
| T28278 | 51-53 | CD | denotes | 10 |
| T28279 | 54-55 | NNS | denotes | d |
| T28280 | 56-58 | IN | denotes | of |
| T28281 | 59-62 | NN | denotes | age |
| T28282 | 63-66 | VBD | denotes | was |
| T28283 | 77-79 | IN | denotes | in |
| T28284 | 80-81 | DT | denotes | a |
| T28285 | 93-101 | NN | denotes | reaction |
| T28286 | 82-88 | JJ | denotes | single |
| T28287 | 89-92 | NN | denotes | PCR |
| T28288 | 102-106 | IN | denotes | with |
| T28289 | 107-110 | DT | denotes | the |
| T28290 | 121-128 | NNS | denotes | primers |
| T28291 | 111-120 | VBG | denotes | following |
| T28292 | 128-130 | : | denotes | : |
| T28293 | 130-133 | NN | denotes | Apc |
| T28294 | 134-141 | NN | denotes | Int13F2 |
| T28295 | 133-134 | HYPH | denotes | - |
| T28296 | 142-143 | -LRB- | denotes | ( |
| T28297 | 143-165 | NN | denotes | GAGAAACCCTGTCTCGAAAAAA |
| T28298 | 165-166 | -RRB- | denotes | ) |
| T28299 | 167-170 | CC | denotes | and |
| T28300 | 171-174 | NN | denotes | Apc |
| T28301 | 175-182 | NN | denotes | Int13R2 |
| T28302 | 174-175 | HYPH | denotes | - |
| T28303 | 183-184 | -LRB- | denotes | ( |
| T28304 | 184-206 | NN | denotes | AGTGCTGTTTCTATGAGTCAAC |
| T28305 | 206-207 | -RRB- | denotes | ) |
| T28306 | 207-209 | , | denotes | , |
| T28307 | 209-218 | VBG | denotes | resulting |
| T28308 | 219-221 | IN | denotes | in |
| T28309 | 222-225 | CD | denotes | 320 |
| T28310 | 226-228 | NN | denotes | bp |
| T28311 | 225-226 | HYPH | denotes | - |
| T28312 | 240-248 | NNS | denotes | products |
| T28313 | 229-232 | CC | denotes | and |
| T28314 | 233-236 | CD | denotes | 430 |
| T28315 | 237-239 | NN | denotes | bp |
| T28316 | 236-237 | HYPH | denotes | - |
| T28317 | 249-253 | IN | denotes | from |
| T28318 | 254-257 | DT | denotes | the |
| T28319 | 291-297 | NN | denotes | allele |
| T28320 | 258-262 | JJ | denotes | wild |
| T28321 | 263-267 | NN | denotes | type |
| T28322 | 262-263 | HYPH | denotes | - |
| T28323 | 268-271 | CC | denotes | and |
| T28324 | 272-283 | JJ | denotes | conditional |
| T28325 | 284-290 | NN | denotes | ApcCKO |
| T28326 | 297-299 | , | denotes | , |
| T28327 | 299-311 | RB | denotes | respectively |
| T28328 | 311-312 | . | denotes | . |
| R8505 | T28267 | T28268 | amod | Genomic,DNA |
| R8506 | T28268 | T28269 | nsubjpass | DNA,genotyped |
| R8507 | T28270 | T28268 | prep | from,DNA |
| R8508 | T28271 | T28270 | pobj | tips,from |
| R8509 | T28272 | T28271 | prep | of,tips |
| R8510 | T28273 | T28274 | compound | mouse,tails |
| R8511 | T28274 | T28272 | pobj | tails,of |
| R8512 | T28275 | T28274 | acl | obtained,tails |
| R8513 | T28276 | T28275 | prep | at,obtained |
| R8514 | T28277 | T28278 | punct | ~,10 |
| R8515 | T28278 | T28279 | nummod | 10,d |
| R8516 | T28279 | T28276 | pobj | d,at |
| R8517 | T28280 | T28279 | prep | of,d |
| R8518 | T28281 | T28280 | pobj | age,of |
| R8519 | T28282 | T28269 | auxpass | was,genotyped |
| R8520 | T28283 | T28269 | prep | in,genotyped |
| R8521 | T28284 | T28285 | det | a,reaction |
| R8522 | T28285 | T28283 | pobj | reaction,in |
| R8523 | T28286 | T28285 | amod | single,reaction |
| R8524 | T28287 | T28285 | compound | PCR,reaction |
| R8525 | T28288 | T28269 | prep | with,genotyped |
| R8526 | T28289 | T28290 | det | the,primers |
| R8527 | T28290 | T28288 | pobj | primers,with |
| R8528 | T28291 | T28290 | amod | following,primers |
| R8529 | T28292 | T28290 | punct | : ,primers |
| R8530 | T28293 | T28294 | compound | Apc,Int13F2 |
| R8531 | T28294 | T28290 | appos | Int13F2,primers |
| R8532 | T28295 | T28294 | punct | -,Int13F2 |
| R8533 | T28296 | T28297 | punct | (,GAGAAACCCTGTCTCGAAAAAA |
| R8534 | T28297 | T28294 | parataxis | GAGAAACCCTGTCTCGAAAAAA,Int13F2 |
| R8535 | T28298 | T28297 | punct | ),GAGAAACCCTGTCTCGAAAAAA |
| R8536 | T28299 | T28294 | cc | and,Int13F2 |
| R8537 | T28300 | T28301 | compound | Apc,Int13R2 |
| R8538 | T28301 | T28294 | conj | Int13R2,Int13F2 |
| R8539 | T28302 | T28301 | punct | -,Int13R2 |
| R8540 | T28303 | T28304 | punct | (,AGTGCTGTTTCTATGAGTCAAC |
| R8541 | T28304 | T28301 | parataxis | AGTGCTGTTTCTATGAGTCAAC,Int13R2 |
| R8542 | T28305 | T28304 | punct | ),AGTGCTGTTTCTATGAGTCAAC |
| R8543 | T28306 | T28269 | punct | ", ",genotyped |
| R8544 | T28307 | T28269 | advcl | resulting,genotyped |
| R8545 | T28308 | T28307 | prep | in,resulting |
| R8546 | T28309 | T28310 | nummod | 320,bp |
| R8547 | T28310 | T28312 | nmod | bp,products |
| R8548 | T28311 | T28310 | punct | -,bp |
| R8549 | T28312 | T28308 | pobj | products,in |
| R8550 | T28313 | T28310 | cc | and,bp |
| R8551 | T28314 | T28315 | nummod | 430,bp |
| R8552 | T28315 | T28310 | conj | bp,bp |
| R8553 | T28316 | T28315 | punct | -,bp |
| R8554 | T28317 | T28312 | prep | from,products |
| R8555 | T28318 | T28319 | det | the,allele |
| R8556 | T28319 | T28317 | pobj | allele,from |
| R8557 | T28320 | T28321 | amod | wild,type |
| R8558 | T28321 | T28319 | nmod | type,allele |
| R8559 | T28322 | T28321 | punct | -,type |
| R8560 | T28323 | T28321 | cc | and,type |
| R8561 | T28324 | T28325 | amod | conditional,ApcCKO |
| R8562 | T28325 | T28321 | conj | ApcCKO,type |
| R8563 | T28326 | T28307 | punct | ", ",resulting |
| R8564 | T28327 | T28307 | advmod | respectively,resulting |
| R8565 | T28328 | T28269 | punct | .,genotyped |