Id |
Subject |
Object |
Predicate |
Lexical cue |
T5752 |
0-8 |
NN |
denotes |
Exchange |
T5753 |
9-19 |
NNS |
denotes |
constructs |
T5754 |
19-21 |
: |
denotes |
: |
T5755 |
21-27 |
VBG |
denotes |
making |
T5756 |
28-31 |
DT |
denotes |
the |
T5757 |
32-38 |
NN |
denotes |
p53GFP |
T5758 |
52-60 |
NNS |
denotes |
plasmids |
T5759 |
39-42 |
CC |
denotes |
and |
T5760 |
43-46 |
NN |
denotes |
p53 |
T5761 |
47-51 |
NN |
denotes |
PGFP |
T5762 |
46-47 |
NN |
denotes |
Δ |
T5763 |
60-284 |
sentence |
denotes |
To make a p53-GFP fusion protein, we first subcloned a SacII-HindIII fragment of the p53 locus (corresponding to part of exon 10 to sequences downstream of the gene) into pBS, then mutated the HindIII site into a FseI site. |
T5764 |
61-63 |
TO |
denotes |
To |
T5765 |
64-68 |
VB |
denotes |
make |
T5766 |
104-113 |
VBD |
denotes |
subcloned |
T5767 |
69-70 |
DT |
denotes |
a |
T5768 |
86-93 |
NN |
denotes |
protein |
T5769 |
71-74 |
NN |
denotes |
p53 |
T5770 |
75-78 |
NN |
denotes |
GFP |
T5771 |
74-75 |
HYPH |
denotes |
- |
T5772 |
79-85 |
NN |
denotes |
fusion |
T5773 |
93-95 |
, |
denotes |
, |
T5774 |
95-97 |
PRP |
denotes |
we |
T5775 |
98-103 |
RB |
denotes |
first |
T5776 |
114-115 |
DT |
denotes |
a |
T5777 |
130-138 |
NN |
denotes |
fragment |
T5778 |
116-121 |
NN |
denotes |
SacII |
T5779 |
122-129 |
NN |
denotes |
HindIII |
T5780 |
121-122 |
HYPH |
denotes |
- |
T5781 |
139-141 |
IN |
denotes |
of |
T5782 |
142-145 |
DT |
denotes |
the |
T5783 |
150-155 |
NN |
denotes |
locus |
T5784 |
146-149 |
NN |
denotes |
p53 |
T5785 |
156-157 |
-LRB- |
denotes |
( |
T5786 |
157-170 |
VBG |
denotes |
corresponding |
T5787 |
171-173 |
IN |
denotes |
to |
T5788 |
174-178 |
NN |
denotes |
part |
T5789 |
179-181 |
IN |
denotes |
of |
T5790 |
182-186 |
NN |
denotes |
exon |
T5791 |
187-189 |
CD |
denotes |
10 |
T5792 |
190-192 |
IN |
denotes |
to |
T5793 |
193-202 |
NNS |
denotes |
sequences |
T5794 |
203-213 |
RB |
denotes |
downstream |
T5795 |
214-216 |
IN |
denotes |
of |
T5796 |
217-220 |
DT |
denotes |
the |
T5797 |
221-225 |
NN |
denotes |
gene |
T5798 |
225-226 |
-RRB- |
denotes |
) |
T5799 |
227-231 |
IN |
denotes |
into |
T5800 |
232-235 |
NN |
denotes |
pBS |
T5801 |
235-237 |
, |
denotes |
, |
T5802 |
237-241 |
RB |
denotes |
then |
T5803 |
242-249 |
VBD |
denotes |
mutated |
T5804 |
250-253 |
DT |
denotes |
the |
T5805 |
262-266 |
NN |
denotes |
site |
T5806 |
254-261 |
NN |
denotes |
HindIII |
T5807 |
267-271 |
IN |
denotes |
into |
T5808 |
272-273 |
DT |
denotes |
a |
T5809 |
279-283 |
NN |
denotes |
site |
T5810 |
274-278 |
NN |
denotes |
FseI |
T5811 |
283-284 |
. |
denotes |
. |
T5812 |
284-675 |
sentence |
denotes |
We next mutated the C-terminal part of the p53 gene in two rounds of PCR mutagenesis, first with primers 5′-GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC-3′ and 5′-GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC-3′, which removed the stop codon and introduced a BamHI site, then with primers 5′-GACGGATCCCCTCTGAATTCCGTCCCCATCACCA-3′ and 5′-TGGTGATGGGGACGGAATACAGAGGGGATCCGTC-3′, which introduced an EcoRI site. |
T5813 |
285-287 |
PRP |
denotes |
We |
T5814 |
293-300 |
VBD |
denotes |
mutated |
T5815 |
288-292 |
RB |
denotes |
next |
T5816 |
301-304 |
DT |
denotes |
the |
T5817 |
316-320 |
NN |
denotes |
part |
T5818 |
305-306 |
NN |
denotes |
C |
T5819 |
307-315 |
JJ |
denotes |
terminal |
T5820 |
306-307 |
HYPH |
denotes |
- |
T5821 |
321-323 |
IN |
denotes |
of |
T5822 |
324-327 |
DT |
denotes |
the |
T5823 |
332-336 |
NN |
denotes |
gene |
T5824 |
328-331 |
NN |
denotes |
p53 |
T5825 |
337-339 |
IN |
denotes |
in |
T5826 |
340-343 |
CD |
denotes |
two |
T5827 |
344-350 |
NNS |
denotes |
rounds |
T5828 |
351-353 |
IN |
denotes |
of |
T5829 |
354-357 |
NN |
denotes |
PCR |
T5830 |
358-369 |
NN |
denotes |
mutagenesis |
T5831 |
369-371 |
, |
denotes |
, |
T5832 |
371-376 |
RB |
denotes |
first |
T5833 |
377-381 |
IN |
denotes |
with |
T5834 |
382-389 |
NNS |
denotes |
primers |
T5835 |
393-429 |
NN |
denotes |
GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
T5836 |
390-391 |
CD |
denotes |
5 |
T5837 |
391-392 |
SYM |
denotes |
′ |
T5838 |
392-393 |
HYPH |
denotes |
- |
T5839 |
429-430 |
HYPH |
denotes |
- |
T5840 |
430-431 |
CD |
denotes |
3 |
T5841 |
431-432 |
SYM |
denotes |
′ |
T5842 |
433-436 |
CC |
denotes |
and |
T5843 |
437-438 |
CD |
denotes |
5 |
T5844 |
440-476 |
NN |
denotes |
GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
T5845 |
438-439 |
SYM |
denotes |
′ |
T5846 |
439-440 |
HYPH |
denotes |
- |
T5847 |
476-477 |
HYPH |
denotes |
- |
T5848 |
477-478 |
CD |
denotes |
3 |
T5849 |
478-479 |
SYM |
denotes |
′ |
T5850 |
479-481 |
, |
denotes |
, |
T5851 |
481-486 |
WDT |
denotes |
which |
T5852 |
487-494 |
VBD |
denotes |
removed |
T5853 |
495-498 |
DT |
denotes |
the |
T5854 |
504-509 |
NN |
denotes |
codon |
T5855 |
499-503 |
NN |
denotes |
stop |
T5856 |
510-513 |
CC |
denotes |
and |
T5857 |
514-524 |
VBD |
denotes |
introduced |
T5858 |
525-526 |
DT |
denotes |
a |
T5859 |
533-537 |
NN |
denotes |
site |
T5860 |
527-532 |
NN |
denotes |
BamHI |
T5861 |
537-539 |
, |
denotes |
, |
T5862 |
539-543 |
RB |
denotes |
then |
T5863 |
544-548 |
IN |
denotes |
with |
T5864 |
549-556 |
NNS |
denotes |
primers |
T5865 |
560-594 |
NN |
denotes |
GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
T5866 |
557-558 |
CD |
denotes |
5 |
T5867 |
558-559 |
SYM |
denotes |
′ |
T5868 |
559-560 |
HYPH |
denotes |
- |
T5869 |
594-595 |
HYPH |
denotes |
- |
T5870 |
595-596 |
CD |
denotes |
3 |
T5871 |
596-597 |
SYM |
denotes |
′ |
T5872 |
598-601 |
CC |
denotes |
and |
T5873 |
602-603 |
CD |
denotes |
5 |
T5874 |
605-639 |
NN |
denotes |
TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
T5875 |
603-604 |
SYM |
denotes |
′ |
T5876 |
604-605 |
HYPH |
denotes |
- |
T5877 |
639-640 |
HYPH |
denotes |
- |
T5878 |
640-641 |
CD |
denotes |
3 |
T5879 |
641-642 |
SYM |
denotes |
′ |
T5880 |
642-644 |
, |
denotes |
, |
T5881 |
644-649 |
WDT |
denotes |
which |
T5882 |
650-660 |
VBD |
denotes |
introduced |
T5883 |
661-663 |
DT |
denotes |
an |
T5884 |
670-674 |
NN |
denotes |
site |
T5885 |
664-669 |
NN |
denotes |
EcoRI |
T5886 |
674-675 |
. |
denotes |
. |
T5887 |
675-862 |
sentence |
denotes |
We verified the sequence from the mutated plasmid, then digested it with BamHI and EcoRI, to insert in frame GFP sequences from a Bam HI-EcoRI fragment of plasmid phr-GFP-1 (Stratagene). |
T5888 |
676-678 |
PRP |
denotes |
We |
T5889 |
679-687 |
VBD |
denotes |
verified |
T5890 |
688-691 |
DT |
denotes |
the |
T5891 |
692-700 |
NN |
denotes |
sequence |
T5892 |
701-705 |
IN |
denotes |
from |
T5893 |
706-709 |
DT |
denotes |
the |
T5894 |
718-725 |
NN |
denotes |
plasmid |
T5895 |
710-717 |
VBN |
denotes |
mutated |
T5896 |
725-727 |
, |
denotes |
, |
T5897 |
727-731 |
RB |
denotes |
then |
T5898 |
732-740 |
VBD |
denotes |
digested |
T5899 |
741-743 |
PRP |
denotes |
it |
T5900 |
744-748 |
IN |
denotes |
with |
T5901 |
749-754 |
NN |
denotes |
BamHI |
T5902 |
755-758 |
CC |
denotes |
and |
T5903 |
759-764 |
NN |
denotes |
EcoRI |
T5904 |
764-766 |
, |
denotes |
, |
T5905 |
766-768 |
TO |
denotes |
to |
T5906 |
769-775 |
VB |
denotes |
insert |
T5907 |
776-778 |
IN |
denotes |
in |
T5908 |
779-784 |
NN |
denotes |
frame |
T5909 |
785-788 |
NN |
denotes |
GFP |
T5910 |
789-798 |
NNS |
denotes |
sequences |
T5911 |
799-803 |
IN |
denotes |
from |
T5912 |
804-805 |
DT |
denotes |
a |
T5913 |
819-827 |
NN |
denotes |
fragment |
T5914 |
806-809 |
NN |
denotes |
Bam |
T5915 |
813-818 |
NN |
denotes |
EcoRI |
T5916 |
810-812 |
NN |
denotes |
HI |
T5917 |
812-813 |
HYPH |
denotes |
- |
T5918 |
828-830 |
IN |
denotes |
of |
T5919 |
831-838 |
NN |
denotes |
plasmid |
T5920 |
843-846 |
NN |
denotes |
GFP |
T5921 |
839-842 |
NN |
denotes |
phr |
T5922 |
842-843 |
HYPH |
denotes |
- |
T5923 |
846-847 |
HYPH |
denotes |
- |
T5924 |
847-848 |
CD |
denotes |
1 |
T5925 |
849-850 |
-LRB- |
denotes |
( |
T5926 |
850-860 |
NNP |
denotes |
Stratagene |
T5927 |
860-861 |
-RRB- |
denotes |
) |
T5928 |
861-862 |
. |
denotes |
. |
T5929 |
862-1105 |
sentence |
denotes |
We verified the sequence of this p53-GFP fusion fragment, then swapped it in the L3-p53PmlEagPuroΔTK-1L plasmid (see above) by HindIII and FseI digestion, resulting in the p53GFP exchange construct, the sequence which was verified before use. |
T5930 |
863-865 |
PRP |
denotes |
We |
T5931 |
866-874 |
VBD |
denotes |
verified |
T5932 |
875-878 |
DT |
denotes |
the |
T5933 |
879-887 |
NN |
denotes |
sequence |
T5934 |
888-890 |
IN |
denotes |
of |
T5935 |
891-895 |
DT |
denotes |
this |
T5936 |
911-919 |
NN |
denotes |
fragment |
T5937 |
896-899 |
NN |
denotes |
p53 |
T5938 |
900-903 |
NN |
denotes |
GFP |
T5939 |
899-900 |
HYPH |
denotes |
- |
T5940 |
904-910 |
NN |
denotes |
fusion |
T5941 |
919-921 |
, |
denotes |
, |
T5942 |
921-925 |
RB |
denotes |
then |
T5943 |
926-933 |
VBD |
denotes |
swapped |
T5944 |
934-936 |
PRP |
denotes |
it |
T5945 |
937-939 |
IN |
denotes |
in |
T5946 |
940-943 |
DT |
denotes |
the |
T5947 |
967-974 |
NN |
denotes |
plasmid |
T5948 |
944-946 |
NN |
denotes |
L3 |
T5949 |
964-966 |
NN |
denotes |
1L |
T5950 |
946-947 |
HYPH |
denotes |
- |
T5951 |
947-963 |
NN |
denotes |
p53PmlEagPuroΔTK |
T5952 |
963-964 |
HYPH |
denotes |
- |
T5953 |
975-976 |
-LRB- |
denotes |
( |
T5954 |
976-979 |
VB |
denotes |
see |
T5955 |
980-985 |
RB |
denotes |
above |
T5956 |
985-986 |
-RRB- |
denotes |
) |
T5957 |
987-989 |
IN |
denotes |
by |
T5958 |
990-997 |
NN |
denotes |
HindIII |
T5959 |
1007-1016 |
NN |
denotes |
digestion |
T5960 |
998-1001 |
CC |
denotes |
and |
T5961 |
1002-1006 |
NN |
denotes |
FseI |
T5962 |
1016-1018 |
, |
denotes |
, |
T5963 |
1018-1027 |
VBG |
denotes |
resulting |
T5964 |
1028-1030 |
IN |
denotes |
in |
T5965 |
1031-1034 |
DT |
denotes |
the |
T5966 |
1051-1060 |
NN |
denotes |
construct |
T5967 |
1035-1041 |
NN |
denotes |
p53GFP |
T5968 |
1042-1050 |
NN |
denotes |
exchange |
T5969 |
1060-1062 |
, |
denotes |
, |
T5970 |
1062-1065 |
DT |
denotes |
the |
T5971 |
1066-1074 |
NN |
denotes |
sequence |
T5972 |
1075-1080 |
WDT |
denotes |
which |
T5973 |
1085-1093 |
VBN |
denotes |
verified |
T5974 |
1081-1084 |
VBD |
denotes |
was |
T5975 |
1094-1100 |
IN |
denotes |
before |
T5976 |
1101-1104 |
NN |
denotes |
use |
T5977 |
1104-1105 |
. |
denotes |
. |
T5978 |
1105-1281 |
sentence |
denotes |
The p53ΔPGFP exchange construct was engineered by combining sequences from the p53GFP exchange plasmid and sequences from the p53ΔP targeting construct described recently (5). |
T5979 |
1106-1109 |
DT |
denotes |
The |
T5980 |
1128-1137 |
NN |
denotes |
construct |
T5981 |
1110-1118 |
NN |
denotes |
p53ΔPGFP |
T5982 |
1119-1127 |
NN |
denotes |
exchange |
T5983 |
1142-1152 |
VBN |
denotes |
engineered |
T5984 |
1138-1141 |
VBD |
denotes |
was |
T5985 |
1153-1155 |
IN |
denotes |
by |
T5986 |
1156-1165 |
VBG |
denotes |
combining |
T5987 |
1166-1175 |
NNS |
denotes |
sequences |
T5988 |
1176-1180 |
IN |
denotes |
from |
T5989 |
1181-1184 |
DT |
denotes |
the |
T5990 |
1201-1208 |
NN |
denotes |
plasmid |
T5991 |
1185-1191 |
NN |
denotes |
p53GFP |
T5992 |
1192-1200 |
NN |
denotes |
exchange |
T5993 |
1209-1212 |
CC |
denotes |
and |
T5994 |
1213-1222 |
NNS |
denotes |
sequences |
T5995 |
1223-1227 |
IN |
denotes |
from |
T5996 |
1228-1231 |
DT |
denotes |
the |
T5997 |
1248-1257 |
NN |
denotes |
construct |
T5998 |
1232-1237 |
NN |
denotes |
p53ΔP |
T5999 |
1238-1247 |
NN |
denotes |
targeting |
T6000 |
1258-1267 |
VBN |
denotes |
described |
T6001 |
1268-1276 |
RB |
denotes |
recently |
T6002 |
1277-1278 |
-LRB- |
denotes |
( |
T6003 |
1278-1279 |
CD |
denotes |
5 |
T6004 |
1279-1280 |
-RRB- |
denotes |
) |
T6005 |
1280-1281 |
. |
denotes |
. |
T6006 |
1281-1324 |
sentence |
denotes |
Its sequence was also verified before use. |
T6007 |
1282-1285 |
PRP$ |
denotes |
Its |
T6008 |
1286-1294 |
NN |
denotes |
sequence |
T6009 |
1304-1312 |
VBN |
denotes |
verified |
T6010 |
1295-1298 |
VBD |
denotes |
was |
T6011 |
1299-1303 |
RB |
denotes |
also |
T6012 |
1313-1319 |
IN |
denotes |
before |
T6013 |
1320-1323 |
NN |
denotes |
use |
T6014 |
1323-1324 |
. |
denotes |
. |
R1618 |
T5752 |
T5753 |
compound |
Exchange,constructs |
R1619 |
T5754 |
T5753 |
punct |
: ,constructs |
R1620 |
T5755 |
T5753 |
acl |
making,constructs |
R1621 |
T5756 |
T5757 |
det |
the,p53GFP |
R1622 |
T5757 |
T5758 |
nmod |
p53GFP,plasmids |
R1623 |
T5758 |
T5755 |
dobj |
plasmids,making |
R1624 |
T5759 |
T5757 |
cc |
and,p53GFP |
R1625 |
T5760 |
T5761 |
compound |
p53,PGFP |
R1626 |
T5761 |
T5757 |
conj |
PGFP,p53GFP |
R1627 |
T5762 |
T5761 |
compound |
Δ,PGFP |
R1628 |
T5764 |
T5765 |
aux |
To,make |
R1629 |
T5765 |
T5766 |
advcl |
make,subcloned |
R1630 |
T5767 |
T5768 |
det |
a,protein |
R1631 |
T5768 |
T5765 |
dobj |
protein,make |
R1632 |
T5769 |
T5770 |
compound |
p53,GFP |
R1633 |
T5770 |
T5768 |
compound |
GFP,protein |
R1634 |
T5771 |
T5770 |
punct |
-,GFP |
R1635 |
T5772 |
T5768 |
compound |
fusion,protein |
R1636 |
T5773 |
T5766 |
punct |
", ",subcloned |
R1637 |
T5774 |
T5766 |
nsubj |
we,subcloned |
R1638 |
T5775 |
T5766 |
advmod |
first,subcloned |
R1639 |
T5776 |
T5777 |
det |
a,fragment |
R1640 |
T5777 |
T5766 |
dobj |
fragment,subcloned |
R1641 |
T5778 |
T5779 |
compound |
SacII,HindIII |
R1642 |
T5779 |
T5777 |
compound |
HindIII,fragment |
R1643 |
T5780 |
T5779 |
punct |
-,HindIII |
R1644 |
T5781 |
T5777 |
prep |
of,fragment |
R1645 |
T5782 |
T5783 |
det |
the,locus |
R1646 |
T5783 |
T5781 |
pobj |
locus,of |
R1647 |
T5784 |
T5783 |
compound |
p53,locus |
R1648 |
T5785 |
T5777 |
punct |
(,fragment |
R1649 |
T5786 |
T5777 |
acl |
corresponding,fragment |
R1650 |
T5787 |
T5786 |
prep |
to,corresponding |
R1651 |
T5788 |
T5787 |
pobj |
part,to |
R1652 |
T5789 |
T5788 |
prep |
of,part |
R1653 |
T5790 |
T5789 |
pobj |
exon,of |
R1654 |
T5791 |
T5790 |
nummod |
10,exon |
R1655 |
T5792 |
T5786 |
prep |
to,corresponding |
R1656 |
T5793 |
T5792 |
pobj |
sequences,to |
R1657 |
T5794 |
T5793 |
advmod |
downstream,sequences |
R1658 |
T5795 |
T5794 |
prep |
of,downstream |
R1659 |
T5796 |
T5797 |
det |
the,gene |
R1660 |
T5797 |
T5795 |
pobj |
gene,of |
R1661 |
T5798 |
T5766 |
punct |
),subcloned |
R1662 |
T5799 |
T5766 |
prep |
into,subcloned |
R1663 |
T5800 |
T5799 |
pobj |
pBS,into |
R1664 |
T5801 |
T5766 |
punct |
", ",subcloned |
R1665 |
T5802 |
T5803 |
advmod |
then,mutated |
R1666 |
T5803 |
T5766 |
dep |
mutated,subcloned |
R1667 |
T5804 |
T5805 |
det |
the,site |
R1668 |
T5805 |
T5803 |
dobj |
site,mutated |
R1669 |
T5806 |
T5805 |
compound |
HindIII,site |
R1670 |
T5807 |
T5803 |
prep |
into,mutated |
R1671 |
T5808 |
T5809 |
det |
a,site |
R1672 |
T5809 |
T5807 |
pobj |
site,into |
R1673 |
T5810 |
T5809 |
compound |
FseI,site |
R1674 |
T5811 |
T5766 |
punct |
.,subcloned |
R1675 |
T5813 |
T5814 |
nsubj |
We,mutated |
R1676 |
T5815 |
T5814 |
advmod |
next,mutated |
R1677 |
T5816 |
T5817 |
det |
the,part |
R1678 |
T5817 |
T5814 |
dobj |
part,mutated |
R1679 |
T5818 |
T5819 |
npadvmod |
C,terminal |
R1680 |
T5819 |
T5817 |
amod |
terminal,part |
R1681 |
T5820 |
T5819 |
punct |
-,terminal |
R1682 |
T5821 |
T5817 |
prep |
of,part |
R1683 |
T5822 |
T5823 |
det |
the,gene |
R1684 |
T5823 |
T5821 |
pobj |
gene,of |
R1685 |
T5824 |
T5823 |
compound |
p53,gene |
R1686 |
T5825 |
T5814 |
prep |
in,mutated |
R1687 |
T5826 |
T5827 |
nummod |
two,rounds |
R1688 |
T5827 |
T5825 |
pobj |
rounds,in |
R1689 |
T5828 |
T5827 |
prep |
of,rounds |
R1690 |
T5829 |
T5830 |
compound |
PCR,mutagenesis |
R1691 |
T5830 |
T5828 |
pobj |
mutagenesis,of |
R1692 |
T5831 |
T5814 |
punct |
", ",mutated |
R1693 |
T5832 |
T5833 |
advmod |
first,with |
R1694 |
T5833 |
T5814 |
prep |
with,mutated |
R1695 |
T5834 |
T5835 |
nmod |
primers,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1696 |
T5835 |
T5833 |
pobj |
GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC,with |
R1697 |
T5836 |
T5835 |
nummod |
5,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1698 |
T5837 |
T5836 |
punct |
′,5 |
R1699 |
T5838 |
T5835 |
punct |
-,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1700 |
T5839 |
T5835 |
punct |
-,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1701 |
T5840 |
T5835 |
nummod |
3,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1702 |
T5841 |
T5835 |
punct |
′,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1703 |
T5842 |
T5835 |
cc |
and,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1704 |
T5843 |
T5844 |
nummod |
5,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1705 |
T5844 |
T5835 |
conj |
GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1706 |
T5845 |
T5843 |
punct |
′,5 |
R1707 |
T5846 |
T5844 |
punct |
-,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1708 |
T5847 |
T5844 |
punct |
-,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1709 |
T5848 |
T5844 |
nummod |
3,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1710 |
T5849 |
T5844 |
punct |
′,GACGGGATGCAGAGGGGATCCGTCTGAGTCAGGCCC |
R1711 |
T5850 |
T5835 |
punct |
", ",GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1712 |
T5851 |
T5852 |
dep |
which,removed |
R1713 |
T5852 |
T5835 |
relcl |
removed,GGGCCTGACTCAGACGGATCCCCTCTGCATCCCGTC |
R1714 |
T5853 |
T5854 |
det |
the,codon |
R1715 |
T5854 |
T5852 |
dobj |
codon,removed |
R1716 |
T5855 |
T5854 |
compound |
stop,codon |
R1717 |
T5856 |
T5852 |
cc |
and,removed |
R1718 |
T5857 |
T5852 |
conj |
introduced,removed |
R1719 |
T5858 |
T5859 |
det |
a,site |
R1720 |
T5859 |
T5857 |
dobj |
site,introduced |
R1721 |
T5860 |
T5859 |
compound |
BamHI,site |
R1722 |
T5861 |
T5833 |
punct |
", ",with |
R1723 |
T5862 |
T5863 |
advmod |
then,with |
R1724 |
T5863 |
T5833 |
prep |
with,with |
R1725 |
T5864 |
T5865 |
nmod |
primers,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1726 |
T5865 |
T5863 |
pobj |
GACGGATCCCCTCTGAATTCCGTCCCCATCACCA,with |
R1727 |
T5866 |
T5865 |
nummod |
5,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1728 |
T5867 |
T5866 |
punct |
′,5 |
R1729 |
T5868 |
T5865 |
punct |
-,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1730 |
T5869 |
T5865 |
punct |
-,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1731 |
T5870 |
T5865 |
nummod |
3,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1732 |
T5871 |
T5865 |
punct |
′,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1733 |
T5872 |
T5865 |
cc |
and,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1734 |
T5873 |
T5874 |
nummod |
5,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1735 |
T5874 |
T5865 |
conj |
TGGTGATGGGGACGGAATACAGAGGGGATCCGTC,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1736 |
T5875 |
T5873 |
punct |
′,5 |
R1737 |
T5876 |
T5874 |
punct |
-,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1738 |
T5877 |
T5874 |
punct |
-,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1739 |
T5878 |
T5874 |
nummod |
3,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1740 |
T5879 |
T5874 |
punct |
′,TGGTGATGGGGACGGAATACAGAGGGGATCCGTC |
R1741 |
T5880 |
T5865 |
punct |
", ",GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1742 |
T5881 |
T5882 |
dep |
which,introduced |
R1743 |
T5882 |
T5865 |
relcl |
introduced,GACGGATCCCCTCTGAATTCCGTCCCCATCACCA |
R1744 |
T5883 |
T5884 |
det |
an,site |
R1745 |
T5884 |
T5882 |
dobj |
site,introduced |
R1746 |
T5885 |
T5884 |
compound |
EcoRI,site |
R1747 |
T5886 |
T5814 |
punct |
.,mutated |
R1748 |
T5888 |
T5889 |
nsubj |
We,verified |
R1749 |
T5890 |
T5891 |
det |
the,sequence |
R1750 |
T5891 |
T5889 |
dobj |
sequence,verified |
R1751 |
T5892 |
T5891 |
prep |
from,sequence |
R1752 |
T5893 |
T5894 |
det |
the,plasmid |
R1753 |
T5894 |
T5892 |
pobj |
plasmid,from |
R1754 |
T5895 |
T5894 |
amod |
mutated,plasmid |
R1755 |
T5896 |
T5889 |
punct |
", ",verified |
R1756 |
T5897 |
T5898 |
advmod |
then,digested |
R1757 |
T5898 |
T5889 |
dep |
digested,verified |
R1758 |
T5899 |
T5898 |
dobj |
it,digested |
R1759 |
T5900 |
T5898 |
prep |
with,digested |
R1760 |
T5901 |
T5900 |
pobj |
BamHI,with |
R1761 |
T5902 |
T5901 |
cc |
and,BamHI |
R1762 |
T5903 |
T5901 |
conj |
EcoRI,BamHI |
R1763 |
T5904 |
T5889 |
punct |
", ",verified |
R1764 |
T5905 |
T5906 |
aux |
to,insert |
R1765 |
T5906 |
T5889 |
advcl |
insert,verified |
R1766 |
T5907 |
T5906 |
prep |
in,insert |
R1767 |
T5908 |
T5909 |
compound |
frame,GFP |
R1768 |
T5909 |
T5910 |
compound |
GFP,sequences |
R1769 |
T5910 |
T5907 |
pobj |
sequences,in |
R1770 |
T5911 |
T5910 |
prep |
from,sequences |
R1771 |
T5912 |
T5913 |
det |
a,fragment |
R1772 |
T5913 |
T5911 |
pobj |
fragment,from |
R1773 |
T5914 |
T5915 |
compound |
Bam,EcoRI |
R1774 |
T5915 |
T5913 |
compound |
EcoRI,fragment |
R1775 |
T5916 |
T5915 |
compound |
HI,EcoRI |
R1776 |
T5917 |
T5915 |
punct |
-,EcoRI |
R1777 |
T5918 |
T5913 |
prep |
of,fragment |
R1778 |
T5919 |
T5920 |
compound |
plasmid,GFP |
R1779 |
T5920 |
T5918 |
pobj |
GFP,of |
R1780 |
T5921 |
T5920 |
compound |
phr,GFP |
R1781 |
T5922 |
T5920 |
punct |
-,GFP |
R1782 |
T5923 |
T5920 |
punct |
-,GFP |
R1783 |
T5924 |
T5920 |
nummod |
1,GFP |
R1784 |
T5925 |
T5926 |
punct |
(,Stratagene |
R1785 |
T5926 |
T5913 |
parataxis |
Stratagene,fragment |
R1786 |
T5927 |
T5926 |
punct |
),Stratagene |
R1787 |
T5928 |
T5889 |
punct |
.,verified |
R1788 |
T5930 |
T5931 |
nsubj |
We,verified |
R1789 |
T5932 |
T5933 |
det |
the,sequence |
R1790 |
T5933 |
T5931 |
dobj |
sequence,verified |
R1791 |
T5934 |
T5933 |
prep |
of,sequence |
R1792 |
T5935 |
T5936 |
det |
this,fragment |
R1793 |
T5936 |
T5934 |
pobj |
fragment,of |
R1794 |
T5937 |
T5938 |
compound |
p53,GFP |
R1795 |
T5938 |
T5940 |
compound |
GFP,fusion |
R1796 |
T5939 |
T5938 |
punct |
-,GFP |
R1797 |
T5940 |
T5936 |
compound |
fusion,fragment |
R1798 |
T5941 |
T5931 |
punct |
", ",verified |
R1799 |
T5942 |
T5943 |
advmod |
then,swapped |
R1800 |
T5943 |
T5931 |
dep |
swapped,verified |
R1801 |
T5944 |
T5943 |
dobj |
it,swapped |
R1802 |
T5945 |
T5943 |
prep |
in,swapped |
R1803 |
T5946 |
T5947 |
det |
the,plasmid |
R1804 |
T5947 |
T5945 |
pobj |
plasmid,in |
R1805 |
T5948 |
T5949 |
compound |
L3,1L |
R1806 |
T5949 |
T5947 |
compound |
1L,plasmid |
R1807 |
T5950 |
T5949 |
punct |
-,1L |
R1808 |
T5951 |
T5949 |
compound |
p53PmlEagPuroΔTK,1L |
R1809 |
T5952 |
T5949 |
punct |
-,1L |
R1810 |
T5953 |
T5954 |
punct |
(,see |
R1811 |
T5954 |
T5943 |
parataxis |
see,swapped |
R1812 |
T5955 |
T5954 |
advmod |
above,see |
R1813 |
T5956 |
T5954 |
punct |
),see |
R1814 |
T5957 |
T5943 |
prep |
by,swapped |
R1815 |
T5958 |
T5959 |
nmod |
HindIII,digestion |
R1816 |
T5959 |
T5957 |
pobj |
digestion,by |
R1817 |
T5960 |
T5958 |
cc |
and,HindIII |
R1818 |
T5961 |
T5958 |
conj |
FseI,HindIII |
R1819 |
T5962 |
T5943 |
punct |
", ",swapped |
R1820 |
T5963 |
T5943 |
advcl |
resulting,swapped |
R1821 |
T5964 |
T5963 |
prep |
in,resulting |
R1822 |
T5965 |
T5966 |
det |
the,construct |
R1823 |
T5966 |
T5964 |
pobj |
construct,in |
R1824 |
T5967 |
T5968 |
compound |
p53GFP,exchange |
R1825 |
T5968 |
T5966 |
compound |
exchange,construct |
R1826 |
T5969 |
T5966 |
punct |
", ",construct |
R1827 |
T5970 |
T5971 |
det |
the,sequence |
R1828 |
T5971 |
T5966 |
appos |
sequence,construct |
R1829 |
T5972 |
T5973 |
dep |
which,verified |
R1830 |
T5973 |
T5971 |
relcl |
verified,sequence |
R1831 |
T5974 |
T5973 |
auxpass |
was,verified |
R1832 |
T5975 |
T5973 |
prep |
before,verified |
R1833 |
T5976 |
T5975 |
pobj |
use,before |
R1834 |
T5977 |
T5931 |
punct |
.,verified |
R1835 |
T5979 |
T5980 |
det |
The,construct |
R1836 |
T5980 |
T5983 |
nsubjpass |
construct,engineered |
R1837 |
T5981 |
T5982 |
compound |
p53ΔPGFP,exchange |
R1838 |
T5982 |
T5980 |
compound |
exchange,construct |
R1839 |
T5984 |
T5983 |
auxpass |
was,engineered |
R1840 |
T5985 |
T5983 |
prep |
by,engineered |
R1841 |
T5986 |
T5985 |
pcomp |
combining,by |
R1842 |
T5987 |
T5986 |
dobj |
sequences,combining |
R1843 |
T5988 |
T5987 |
prep |
from,sequences |
R1844 |
T5989 |
T5990 |
det |
the,plasmid |
R1845 |
T5990 |
T5988 |
pobj |
plasmid,from |
R1846 |
T5991 |
T5990 |
compound |
p53GFP,plasmid |
R1847 |
T5992 |
T5990 |
compound |
exchange,plasmid |
R1848 |
T5993 |
T5987 |
cc |
and,sequences |
R1849 |
T5994 |
T5987 |
conj |
sequences,sequences |
R1850 |
T5995 |
T5994 |
prep |
from,sequences |
R1851 |
T5996 |
T5997 |
det |
the,construct |
R1852 |
T5997 |
T5995 |
pobj |
construct,from |
R1853 |
T5998 |
T5997 |
compound |
p53ΔP,construct |
R1854 |
T5999 |
T5997 |
compound |
targeting,construct |
R1855 |
T6000 |
T5987 |
acl |
described,sequences |
R1856 |
T6001 |
T6000 |
advmod |
recently,described |
R1857 |
T6002 |
T6003 |
punct |
(,5 |
R1858 |
T6003 |
T5986 |
parataxis |
5,combining |
R1859 |
T6004 |
T6003 |
punct |
),5 |
R1860 |
T6005 |
T5983 |
punct |
.,engineered |
R1861 |
T6007 |
T6008 |
poss |
Its,sequence |
R1862 |
T6008 |
T6009 |
nsubjpass |
sequence,verified |
R1863 |
T6010 |
T6009 |
auxpass |
was,verified |
R1864 |
T6011 |
T6009 |
advmod |
also,verified |
R1865 |
T6012 |
T6009 |
prep |
before,verified |
R1866 |
T6013 |
T6012 |
pobj |
use,before |
R1867 |
T6014 |
T6009 |
punct |
.,verified |