Id |
Subject |
Object |
Predicate |
Lexical cue |
T20902 |
59-66 |
VBD |
denotes |
spanned |
T20903 |
0-1 |
-LRB- |
denotes |
( |
T20904 |
1-3 |
NN |
denotes |
HG |
T20905 |
4-5 |
NN |
denotes |
F |
T20906 |
3-4 |
HYPH |
denotes |
- |
T20907 |
5-7 |
, |
denotes |
, |
T20908 |
7-26 |
NN |
denotes |
ctcctgtctgggctgtgag |
T20909 |
27-30 |
CC |
denotes |
and |
T20910 |
31-33 |
NN |
denotes |
HG |
T20911 |
34-35 |
NN |
denotes |
R |
T20912 |
33-34 |
HYPH |
denotes |
- |
T20913 |
35-37 |
, |
denotes |
, |
T20914 |
37-57 |
NN |
denotes |
caaaggcagaagtggggtaa |
T20915 |
57-58 |
-RRB- |
denotes |
) |
T20916 |
67-70 |
DT |
denotes |
the |
T20917 |
74-82 |
NN |
denotes |
deletion |
T20918 |
71-73 |
NN |
denotes |
hg |
T20919 |
83-92 |
VBG |
denotes |
producing |
T20920 |
93-94 |
DT |
denotes |
a |
T20921 |
102-109 |
NN |
denotes |
product |
T20922 |
95-98 |
CD |
denotes |
447 |
T20923 |
99-101 |
NN |
denotes |
bp |
T20924 |
110-112 |
IN |
denotes |
in |
T20925 |
113-115 |
NN |
denotes |
hg |
T20926 |
116-118 |
NN |
denotes |
hg |
T20927 |
115-116 |
HYPH |
denotes |
/ |
T20928 |
128-132 |
NNS |
denotes |
mice |
T20929 |
119-122 |
CC |
denotes |
and |
T20930 |
123-124 |
SYM |
denotes |
+ |
T20931 |
125-127 |
NN |
denotes |
hg |
T20932 |
124-125 |
HYPH |
denotes |
/ |
T20933 |
132-133 |
. |
denotes |
. |
T20935 |
134-137 |
DT |
denotes |
The |
T20936 |
144-147 |
NN |
denotes |
set |
T20937 |
138-143 |
JJ |
denotes |
other |
T20939 |
148-149 |
-LRB- |
denotes |
( |
T20940 |
149-158 |
NN |
denotes |
CRADD3a.F |
T20941 |
158-160 |
, |
denotes |
, |
T20942 |
160-180 |
NN |
denotes |
gtccatcagcattcctgaaa |
T20943 |
181-184 |
CC |
denotes |
and |
T20944 |
185-193 |
NN |
denotes |
CRADD3.R |
T20945 |
193-195 |
, |
denotes |
, |
R6504 |
T20904 |
T20905 |
compound |
HG,F |
R6506 |
T20906 |
T20905 |
punct |
-,F |
R6507 |
T20907 |
T20905 |
punct |
", ",F |
R6508 |
T20908 |
T20905 |
appos |
ctcctgtctgggctgtgag,F |
R6509 |
T20909 |
T20905 |
cc |
and,F |
R6510 |
T20910 |
T20911 |
compound |
HG,R |
R6511 |
T20911 |
T20905 |
conj |
R,F |
R6512 |
T20912 |
T20911 |
punct |
-,R |
R6513 |
T20913 |
T20911 |
punct |
", ",R |
R6514 |
T20914 |
T20911 |
appos |
caaaggcagaagtggggtaa,R |
R6515 |
T20915 |
T20902 |
punct |
),spanned |
R6516 |
T20916 |
T20917 |
det |
the,deletion |
R6517 |
T20917 |
T20902 |
dobj |
deletion,spanned |
R6518 |
T20918 |
T20917 |
compound |
hg,deletion |
R6519 |
T20919 |
T20902 |
advcl |
producing,spanned |
R6520 |
T20920 |
T20921 |
det |
a,product |
R6521 |
T20921 |
T20919 |
dobj |
product,producing |
R6522 |
T20922 |
T20923 |
nummod |
447,bp |
R6523 |
T20923 |
T20921 |
compound |
bp,product |
R6524 |
T20924 |
T20919 |
prep |
in,producing |
R6525 |
T20925 |
T20926 |
nmod |
hg,hg |
R6526 |
T20926 |
T20928 |
nmod |
hg,mice |
R6527 |
T20927 |
T20926 |
punct |
/,hg |
R6528 |
T20928 |
T20924 |
pobj |
mice,in |
R6529 |
T20929 |
T20926 |
cc |
and,hg |
R6530 |
T20930 |
T20931 |
punct |
+,hg |
R6531 |
T20931 |
T20926 |
conj |
hg,hg |
R6532 |
T20932 |
T20931 |
punct |
/,hg |
R6533 |
T20933 |
T20902 |
punct |
.,spanned |
R6534 |
T20935 |
T20936 |
det |
The,set |
R6536 |
T20937 |
T20936 |
amod |
other,set |
R6537 |
T20939 |
T20936 |
punct |
(,set |
R6538 |
T20940 |
T20936 |
appos |
CRADD3a.F,set |
R6539 |
T20941 |
T20940 |
punct |
", ",CRADD3a.F |
R6540 |
T20942 |
T20940 |
appos |
gtccatcagcattcctgaaa,CRADD3a.F |
R6541 |
T20943 |
T20940 |
cc |
and,CRADD3a.F |
R6542 |
T20944 |
T20940 |
conj |
CRADD3.R,CRADD3a.F |
R6543 |
T20945 |
T20944 |
punct |
", ",CRADD3.R |
Below, discontinuous spans are shown in the
chain model.
You can change it to the
bag model.
Id |
Subject |
Object |
Predicate |
Lexical cue |
T20762 |
4-5 |
SO:0001030 |
denotes |
F |
T20763 |
34-35 |
SO:0001031 |
denotes |
R |
T20764 |
74-82 |
SO_EXT:sequence_deletion_entity_or_process |
denotes |
deletion |
T20765 |
99-101 |
SO_EXT:0000028 |
denotes |
bp |
T20766 |
123-124 |
SO_EXT:normal_or_wild_type_or_present |
denotes |
+ |
T20767 |
128-132 |
NCBITaxon:10088 |
denotes |
mice |
T20768 |
157-158 |
SO:0001030 |
denotes |
F |
T20769 |
192-193 |
SO:0001031 |
denotes |
R |
Below, discontinuous spans are shown in the
chain model.
You can change it to the
bag model.
Id |
Subject |
Object |
Predicate |
Lexical cue |
T20738 |
4-5 |
SO:0001030 |
denotes |
F |
T20739 |
34-35 |
SO:0001031 |
denotes |
R |
T20740 |
99-101 |
SO:0000028 |
denotes |
bp |
T20741 |
128-132 |
NCBITaxon:10088 |
denotes |
mice |
T20742 |
157-158 |
SO:0001030 |
denotes |
F |
T20743 |
192-193 |
SO:0001031 |
denotes |
R |