PMC:1482699 / 35084-35233
Annnotations
craft-sa-dev
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20898 | 0-149 | sentence | denotes | One primer set (HG-F, ctcctgtctgggctgtgag and HG-R, caaaggcagaagtggggtaa) spanned the hg deletion producing a 447 bp product in hg/hg and +/hg mice. |
T20899 | 1-4 | CD | denotes | One |
T20900 | 12-15 | NN | denotes | set |
T20901 | 5-11 | NN | denotes | primer |
T20902 | 75-82 | VBD | denotes | spanned |
T20903 | 16-17 | -LRB- | denotes | ( |
T20904 | 17-19 | NN | denotes | HG |
T20905 | 20-21 | NN | denotes | F |
T20906 | 19-20 | HYPH | denotes | - |
T20907 | 21-23 | , | denotes | , |
T20908 | 23-42 | NN | denotes | ctcctgtctgggctgtgag |
T20909 | 43-46 | CC | denotes | and |
T20910 | 47-49 | NN | denotes | HG |
T20911 | 50-51 | NN | denotes | R |
T20912 | 49-50 | HYPH | denotes | - |
T20913 | 51-53 | , | denotes | , |
T20914 | 53-73 | NN | denotes | caaaggcagaagtggggtaa |
T20915 | 73-74 | -RRB- | denotes | ) |
T20916 | 83-86 | DT | denotes | the |
T20917 | 90-98 | NN | denotes | deletion |
T20918 | 87-89 | NN | denotes | hg |
T20919 | 99-108 | VBG | denotes | producing |
T20920 | 109-110 | DT | denotes | a |
T20921 | 118-125 | NN | denotes | product |
T20922 | 111-114 | CD | denotes | 447 |
T20923 | 115-117 | NN | denotes | bp |
T20924 | 126-128 | IN | denotes | in |
T20925 | 129-131 | NN | denotes | hg |
T20926 | 132-134 | NN | denotes | hg |
T20927 | 131-132 | HYPH | denotes | / |
T20928 | 144-148 | NNS | denotes | mice |
T20929 | 135-138 | CC | denotes | and |
T20930 | 139-140 | SYM | denotes | + |
T20931 | 141-143 | NN | denotes | hg |
T20932 | 140-141 | HYPH | denotes | / |
T20933 | 148-149 | . | denotes | . |
R6500 | T20899 | T20900 | nummod | One,set |
R6501 | T20900 | T20902 | nsubj | set,spanned |
R6502 | T20901 | T20900 | compound | primer,set |
R6503 | T20903 | T20900 | punct | (,set |
R6504 | T20904 | T20905 | compound | HG,F |
R6505 | T20905 | T20900 | appos | F,set |
R6506 | T20906 | T20905 | punct | -,F |
R6507 | T20907 | T20905 | punct | ", ",F |
R6508 | T20908 | T20905 | appos | ctcctgtctgggctgtgag,F |
R6509 | T20909 | T20905 | cc | and,F |
R6510 | T20910 | T20911 | compound | HG,R |
R6511 | T20911 | T20905 | conj | R,F |
R6512 | T20912 | T20911 | punct | -,R |
R6513 | T20913 | T20911 | punct | ", ",R |
R6514 | T20914 | T20911 | appos | caaaggcagaagtggggtaa,R |
R6515 | T20915 | T20902 | punct | ),spanned |
R6516 | T20916 | T20917 | det | the,deletion |
R6517 | T20917 | T20902 | dobj | deletion,spanned |
R6518 | T20918 | T20917 | compound | hg,deletion |
R6519 | T20919 | T20902 | advcl | producing,spanned |
R6520 | T20920 | T20921 | det | a,product |
R6521 | T20921 | T20919 | dobj | product,producing |
R6522 | T20922 | T20923 | nummod | 447,bp |
R6523 | T20923 | T20921 | compound | bp,product |
R6524 | T20924 | T20919 | prep | in,producing |
R6525 | T20925 | T20926 | nmod | hg,hg |
R6526 | T20926 | T20928 | nmod | hg,mice |
R6527 | T20927 | T20926 | punct | /,hg |
R6528 | T20928 | T20924 | pobj | mice,in |
R6529 | T20929 | T20926 | cc | and,hg |
R6530 | T20930 | T20931 | punct | +,hg |
R6531 | T20931 | T20926 | conj | hg,hg |
R6532 | T20932 | T20931 | punct | /,hg |
R6533 | T20933 | T20902 | punct | .,spanned |
craft-ca-core-ex-dev
Below, discontinuous spans are shown in the chain model. You can change it to the bag model.
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20761 | 5-11 | SO_EXT:0000112 | denotes | primer |
T20762 | 20-21 | SO:0001030 | denotes | F |
T20763 | 50-51 | SO:0001031 | denotes | R |
T20764 | 90-98 | SO_EXT:sequence_deletion_entity_or_process | denotes | deletion |
T20765 | 115-117 | SO_EXT:0000028 | denotes | bp |
T20766 | 139-140 | SO_EXT:normal_or_wild_type_or_present | denotes | + |
T20767 | 144-148 | NCBITaxon:10088 | denotes | mice |
craft-ca-core-dev
Below, discontinuous spans are shown in the chain model. You can change it to the bag model.
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20737 | 5-11 | SO:0000112 | denotes | primer |
T20738 | 20-21 | SO:0001030 | denotes | F |
T20739 | 50-51 | SO:0001031 | denotes | R |
T20740 | 115-117 | SO:0000028 | denotes | bp |
T20741 | 144-148 | NCBITaxon:10088 | denotes | mice |