Id |
Subject |
Object |
Predicate |
Lexical cue |
T12333 |
0-214 |
sentence |
denotes |
Homologous recombinants were selected by PCR using the following primers, AGN1: 5'-TCGTGCTTTACGGTATCGCCGCTCCCGATT-3' in the PGKneo cassette, and SGN033: 5'-GGACCCGGAAGACATTTGCACGGT-3' outside the targeting vector. |
T12334 |
1-11 |
JJ |
denotes |
Homologous |
T12335 |
12-24 |
NNS |
denotes |
recombinants |
T12336 |
30-38 |
VBN |
denotes |
selected |
T12337 |
25-29 |
VBD |
denotes |
were |
T12338 |
39-41 |
IN |
denotes |
by |
T12339 |
42-45 |
NN |
denotes |
PCR |
T12340 |
46-51 |
VBG |
denotes |
using |
T12341 |
52-55 |
DT |
denotes |
the |
T12342 |
66-73 |
NNS |
denotes |
primers |
T12343 |
56-65 |
VBG |
denotes |
following |
T12344 |
73-75 |
, |
denotes |
, |
T12345 |
75-79 |
NN |
denotes |
AGN1 |
T12346 |
79-81 |
: |
denotes |
: |
T12347 |
81-82 |
CD |
denotes |
5 |
T12348 |
82-83 |
SYM |
denotes |
' |
T12349 |
83-84 |
HYPH |
denotes |
- |
T12350 |
84-114 |
NN |
denotes |
TCGTGCTTTACGGTATCGCCGCTCCCGATT |
T12351 |
114-115 |
HYPH |
denotes |
- |
T12352 |
115-116 |
CD |
denotes |
3 |
T12353 |
116-117 |
SYM |
denotes |
' |
T12354 |
118-120 |
IN |
denotes |
in |
T12355 |
121-124 |
DT |
denotes |
the |
T12356 |
132-140 |
NN |
denotes |
cassette |
T12357 |
125-131 |
NN |
denotes |
PGKneo |
T12358 |
140-142 |
, |
denotes |
, |
T12359 |
142-145 |
CC |
denotes |
and |
T12360 |
146-152 |
NN |
denotes |
SGN033 |
T12361 |
152-154 |
: |
denotes |
: |
T12362 |
154-155 |
CD |
denotes |
5 |
T12363 |
155-156 |
SYM |
denotes |
' |
T12364 |
156-157 |
HYPH |
denotes |
- |
T12365 |
157-181 |
NN |
denotes |
GGACCCGGAAGACATTTGCACGGT |
T12366 |
181-182 |
HYPH |
denotes |
- |
T12367 |
182-183 |
CD |
denotes |
3 |
T12368 |
183-184 |
SYM |
denotes |
' |
T12369 |
185-192 |
IN |
denotes |
outside |
T12370 |
193-196 |
DT |
denotes |
the |
T12371 |
207-213 |
NN |
denotes |
vector |
T12372 |
197-206 |
NN |
denotes |
targeting |
T12373 |
213-214 |
. |
denotes |
. |
R3661 |
T12334 |
T12335 |
amod |
Homologous,recombinants |
R3662 |
T12335 |
T12336 |
nsubjpass |
recombinants,selected |
R3663 |
T12337 |
T12336 |
auxpass |
were,selected |
R3664 |
T12338 |
T12336 |
prep |
by,selected |
R3665 |
T12339 |
T12338 |
pobj |
PCR,by |
R3666 |
T12340 |
T12336 |
advcl |
using,selected |
R3667 |
T12341 |
T12342 |
det |
the,primers |
R3668 |
T12342 |
T12340 |
dobj |
primers,using |
R3669 |
T12343 |
T12342 |
amod |
following,primers |
R3670 |
T12344 |
T12342 |
punct |
", ",primers |
R3671 |
T12345 |
T12342 |
appos |
AGN1,primers |
R3672 |
T12346 |
T12345 |
punct |
: ,AGN1 |
R3673 |
T12347 |
T12345 |
appos |
5,AGN1 |
R3674 |
T12348 |
T12347 |
punct |
',5 |
R3675 |
T12349 |
T12347 |
punct |
-,5 |
R3676 |
T12350 |
T12347 |
appos |
TCGTGCTTTACGGTATCGCCGCTCCCGATT,5 |
R3677 |
T12351 |
T12347 |
punct |
-,5 |
R3678 |
T12352 |
T12347 |
nummod |
3,5 |
R3679 |
T12353 |
T12347 |
punct |
',5 |
R3680 |
T12354 |
T12345 |
prep |
in,AGN1 |
R3681 |
T12355 |
T12356 |
det |
the,cassette |
R3682 |
T12356 |
T12354 |
pobj |
cassette,in |
R3683 |
T12357 |
T12356 |
compound |
PGKneo,cassette |
R3684 |
T12358 |
T12342 |
punct |
", ",primers |
R3685 |
T12359 |
T12342 |
cc |
and,primers |
R3686 |
T12360 |
T12342 |
conj |
SGN033,primers |
R3687 |
T12361 |
T12360 |
punct |
: ,SGN033 |
R3688 |
T12362 |
T12360 |
appos |
5,SGN033 |
R3689 |
T12363 |
T12362 |
punct |
',5 |
R3690 |
T12364 |
T12362 |
punct |
-,5 |
R3691 |
T12365 |
T12362 |
appos |
GGACCCGGAAGACATTTGCACGGT,5 |
R3692 |
T12366 |
T12362 |
punct |
-,5 |
R3693 |
T12367 |
T12362 |
nummod |
3,5 |
R3694 |
T12368 |
T12362 |
punct |
',5 |
R3695 |
T12369 |
T12360 |
prep |
outside,SGN033 |
R3696 |
T12370 |
T12371 |
det |
the,vector |
R3697 |
T12371 |
T12369 |
pobj |
vector,outside |
R3698 |
T12372 |
T12371 |
compound |
targeting,vector |
R3699 |
T12373 |
T12336 |
punct |
.,selected |