> top > docs > PMC:1420271 > spans > 17513-18413 > annotations

PMC:1420271 / 17513-18413 JSONTXT

Annnotations TAB JSON ListView MergeView

craft-ca-core-dev

Below, discontinuous spans are shown in the chain model. You can change it to the bag model.

Id Subject Object Predicate Lexical cue
T9778 0-8 CL:0002322 denotes ES cells
T9779 9-16 SO:0001026 denotes genomic
T9780 50-60 GO:0019835 denotes Cell Lysis
T9781 61-69 CHEBI:75958 denotes Solution
T9782 119-126 SO:0001026 denotes genomic
T9783 187-194 CHEBI:2511 denotes agarose
T9784 220-225 CHEBI:25614 denotes nylon
T9785 260-262 SO:0000028 denotes bp
T9786 382-389 SO:0000112 denotes primers
T9787 429-431 SO:0000028 denotes bp
T9788 469-471 SO:0000028 denotes bp
T9789 509-511 SO:0000028 denotes bp
T9790 538-545 SO:0001026 denotes Genomic
T9791 617-619 SO:0000028 denotes bp
T9792 747-754 SO:0000112 denotes primers
T9793 766-776 GO:0097617 denotes hybridized
T9794 789-791 SO:0000028 denotes bp
T9795 831-833 SO:0000028 denotes bp
T9796 872-874 SO:0000028 denotes bp

craft-ca-core-ex-dev

Below, discontinuous spans are shown in the chain model. You can change it to the bag model.

Id Subject Object Predicate Lexical cue
T9798 0-8 CL:0002322 denotes ES cells
T9799 3-8 CL_GO_EXT:cell denotes cells
T9800 9-20 SO_EXT:genomic_DNA denotes genomic DNA
T9801 17-20 CHEBI_SO_EXT:DNA denotes DNA
T9802 50-54 CL_GO_EXT:cell denotes Cell
T9803 50-60 GO:0019835 denotes Cell Lysis
T9804 61-69 CHEBI:75958 denotes Solution
T9805 119-130 SO_EXT:genomic_DNA denotes genomic DNA
T9806 127-130 CHEBI_SO_EXT:DNA denotes DNA
T9807 187-194 CHEBI:2511 denotes agarose
T9808 203-214 GO_EXT:biological_movement_or_translocation_process denotes transferred
T9809 220-225 CHEBI:25614 denotes nylon
T9810 260-262 SO_EXT:0000028 denotes bp
T9811 266-271 CHEBI_SO_EXT:molecular_probe denotes probe
T9812 382-389 SO_EXT:0000112 denotes primers
T9813 395-400 CHEBI_SO_EXT:molecular_probe denotes probe
T9814 414-421 CHEBI_SO_EXT:molecular_label_or_mark_or_tag_process denotes labeled
T9815 429-431 SO_EXT:0000028 denotes bp
T9816 446-455 SO_EXT:wild_type_entity_or_quality denotes wild-type
T9817 469-471 SO_EXT:0000028 denotes bp
T9818 486-491 GO_EXT:beta_geo denotes β-geo
T9819 509-511 SO_EXT:0000028 denotes bp
T9820 538-549 SO_EXT:genomic_DNA denotes Genomic DNA
T9821 546-549 CHEBI_SO_EXT:DNA denotes DNA
T9822 617-619 SO_EXT:0000028 denotes bp
T9823 623-628 CHEBI_SO_EXT:molecular_probe denotes probe
T9824 747-754 SO_EXT:0000112 denotes primers
T9825 760-765 CHEBI_SO_EXT:molecular_probe denotes probe
T9826 766-776 GO:0097617 denotes hybridized
T9827 789-791 SO_EXT:0000028 denotes bp
T9828 806-815 SO_EXT:wild_type_entity_or_quality denotes wild-type
T9829 831-833 SO_EXT:0000028 denotes bp
T9830 848-853 GO_EXT:beta_geo denotes β-geo
T9831 872-874 SO_EXT:0000028 denotes bp

craft-sa-dev

Id Subject Object Predicate Lexical cue
T9839 0-2 NN denotes ES
T9840 3-8 NNS denotes cells
T9841 17-20 NN denotes DNA
T9842 9-16 JJ denotes genomic
T9843 25-34 VBN denotes extracted
T9844 21-24 VBD denotes was
T9845 35-39 IN denotes with
T9846 40-48 NNP denotes PUREGENE
T9847 61-69 NN denotes Solution
T9848 48-49 SYM denotes ™
T9849 50-54 NN denotes Cell
T9850 55-60 NN denotes Lysis
T9851 70-71 -LRB- denotes (
T9852 78-85 NNPS denotes systems
T9853 71-77 NNP denotes Gentra
T9854 85-86 -RRB- denotes )
T9855 86-87 . denotes .
T9856 87-253 sentence denotes For 5' Southern blot analysis, genomic DNA was first digested with PstI, then separated on an 0.8% agarose gel and transferred to a nylon membrane as described [20].
T9857 88-91 IN denotes For
T9858 141-149 VBN denotes digested
T9859 92-93 CD denotes 5
T9860 109-117 NN denotes analysis
T9861 93-94 SYM denotes '
T9862 95-103 NNP denotes Southern
T9863 104-108 NN denotes blot
T9864 117-119 , denotes ,
T9865 119-126 JJ denotes genomic
T9866 127-130 NN denotes DNA
T9867 131-134 VBD denotes was
T9868 135-140 RB denotes first
T9869 150-154 IN denotes with
T9870 155-159 NN denotes PstI
T9871 159-161 , denotes ,
T9872 161-165 RB denotes then
T9873 166-175 VBN denotes separated
T9874 176-178 IN denotes on
T9875 179-181 DT denotes an
T9876 195-198 NN denotes gel
T9877 182-185 CD denotes 0.8
T9878 185-186 NN denotes %
T9879 187-194 NN denotes agarose
T9880 199-202 CC denotes and
T9881 203-214 VBN denotes transferred
T9882 215-217 IN denotes to
T9883 218-219 DT denotes a
T9884 226-234 NN denotes membrane
T9885 220-225 NN denotes nylon
T9886 235-237 IN denotes as
T9887 238-247 VBN denotes described
T9888 248-249 -LRB- denotes [
T9889 249-251 CD denotes 20
T9890 251-252 -RRB- denotes ]
T9891 252-253 . denotes .
T9892 253-390 sentence denotes A 560 bp 5' probe was amplified using the ESG1S5 (5'- GATGGTGGTGGTGACTCAGAG -3') and ESG1AS5 as (5'- CCTCCATTGCCTCTATATCAG -3') primers.
T9893 254-255 DT denotes A
T9894 266-271 NN denotes probe
T9895 256-259 CD denotes 560
T9896 260-262 NN denotes bp
T9897 263-264 CD denotes 5
T9898 264-265 SYM denotes '
T9899 276-285 VBN denotes amplified
T9900 272-275 VBD denotes was
T9901 286-291 VBG denotes using
T9902 292-295 DT denotes the
T9903 296-302 NN denotes ESG1S5
T9904 303-304 -LRB- denotes (
T9905 308-329 NN denotes GATGGTGGTGGTGACTCAGAG
T9906 304-305 CD denotes 5
T9907 305-306 SYM denotes '
T9908 306-307 HYPH denotes -
T9909 330-331 HYPH denotes -
T9910 331-332 CD denotes 3
T9911 332-333 SYM denotes '
T9912 333-334 -RRB- denotes )
T9913 335-338 CC denotes and
T9914 339-346 NN denotes ESG1AS5
T9915 347-349 IN denotes as
T9916 350-351 -LRB- denotes (
T9917 382-389 NNS denotes primers
T9918 351-352 CD denotes 5
T9919 355-376 NN denotes CCTCCATTGCCTCTATATCAG
T9920 352-353 SYM denotes '
T9921 353-354 HYPH denotes -
T9922 377-378 HYPH denotes -
T9923 378-379 CD denotes 3
T9924 379-380 SYM denotes '
T9925 380-381 -RRB- denotes )
T9926 389-390 . denotes .
T9927 390-537 sentence denotes The probe specifically labeled an 18 kbp band from the wild-type locus, a 15 kbp band from the β-geo locus, and a 12 kbp band from the HygR locus.
T9928 391-394 DT denotes The
T9929 395-400 NN denotes probe
T9930 414-421 VBD denotes labeled
T9931 401-413 RB denotes specifically
T9932 422-424 DT denotes an
T9933 432-436 NN denotes band
T9934 425-427 CD denotes 18
T9935 428-431 NN denotes kbp
T9936 437-441 IN denotes from
T9937 442-445 DT denotes the
T9938 456-461 NN denotes locus
T9939 446-450 JJ denotes wild
T9940 450-451 HYPH denotes -
T9941 451-455 NN denotes type
T9942 461-463 , denotes ,
T9943 463-464 DT denotes a
T9944 472-476 NN denotes band
T9945 465-467 CD denotes 15
T9946 468-471 NN denotes kbp
T9947 477-481 IN denotes from
T9948 482-485 DT denotes the
T9949 492-497 NN denotes locus
T9950 486-487 NN denotes β
T9951 488-491 NN denotes geo
T9952 487-488 HYPH denotes -
T9953 497-499 , denotes ,
T9954 499-502 CC denotes and
T9955 503-504 DT denotes a
T9956 512-516 NN denotes band
T9957 505-507 CD denotes 12
T9958 508-511 NN denotes kbp
T9959 517-521 IN denotes from
T9960 522-525 DT denotes the
T9961 531-536 NN denotes locus
T9962 526-530 NN denotes HygR
T9963 536-537 . denotes .
T9964 537-608 sentence denotes Genomic DNA was also digested with SpeI for 3' Southern blot analysis.
T9965 538-545 JJ denotes Genomic
T9966 546-549 NN denotes DNA
T9967 559-567 VBN denotes digested
T9968 550-553 VBD denotes was
T9969 554-558 RB denotes also
T9970 568-572 IN denotes with
T9971 573-577 NN denotes SpeI
T9972 578-581 IN denotes for
T9973 582-583 CD denotes 3
T9974 599-607 NN denotes analysis
T9975 583-584 SYM denotes '
T9976 585-593 NNP denotes Southern
T9977 594-598 NN denotes blot
T9978 607-608 . denotes .
T9979 608-755 sentence denotes A 1,010 bp 3' probe was amplified with the pH34U-8000 (5'- CCAACCAGCCAGAGTTTCAGTTAT -3') and pH34L-9000 (5'-GATAAGCTGCTGCCAAAAGACAAG -3') primers.
T9980 609-610 DT denotes A
T9981 623-628 NN denotes probe
T9982 611-616 CD denotes 1,010
T9983 617-619 NN denotes bp
T9984 620-621 CD denotes 3
T9985 621-622 SYM denotes '
T9986 633-642 VBN denotes amplified
T9987 629-632 VBD denotes was
T9988 643-647 IN denotes with
T9989 648-651 DT denotes the
T9990 747-754 NNS denotes primers
T9991 652-657 NN denotes pH34U
T9992 657-658 HYPH denotes -
T9993 658-662 CD denotes 8000
T9994 663-664 -LRB- denotes (
T9995 668-692 NN denotes CCAACCAGCCAGAGTTTCAGTTAT
T9996 664-665 CD denotes 5
T9997 665-666 SYM denotes '
T9998 666-667 HYPH denotes -
T9999 693-694 HYPH denotes -
T10000 694-695 CD denotes 3
T10001 695-696 SYM denotes '
T10002 696-697 -RRB- denotes )
T10003 698-701 CC denotes and
T10004 702-707 NN denotes pH34L
T10005 707-708 HYPH denotes -
T10006 708-712 CD denotes 9000
T10007 713-714 -LRB- denotes (
T10008 717-741 NN denotes GATAAGCTGCTGCCAAAAGACAAG
T10009 714-715 CD denotes 5
T10010 715-716 SYM denotes '
T10011 716-717 HYPH denotes -
T10012 742-743 HYPH denotes -
T10013 743-744 CD denotes 3
T10014 744-745 SYM denotes '
T10015 745-746 -RRB- denotes )
T10016 754-755 . denotes .
T10017 755-900 sentence denotes The probe hybridized to an 11.5 kbp band from the wild-type locus, a 12.5 kbp band from the β-geo locus, and a 9.5 kbp band from the HygR locus.
T10018 756-759 DT denotes The
T10019 760-765 NN denotes probe
T10020 766-776 VBD denotes hybridized
T10021 777-779 IN denotes to
T10022 780-782 DT denotes an
T10023 792-796 NN denotes band
T10024 783-787 CD denotes 11.5
T10025 788-791 NN denotes kbp
T10026 797-801 IN denotes from
T10027 802-805 DT denotes the
T10028 816-821 NN denotes locus
T10029 806-810 JJ denotes wild
T10030 811-815 NN denotes type
T10031 810-811 HYPH denotes -
T10032 821-823 , denotes ,
T10033 823-824 DT denotes a
T10034 834-838 NN denotes band
T10035 825-829 CD denotes 12.5
T10036 830-833 NN denotes kbp
T10037 839-843 IN denotes from
T10038 844-847 DT denotes the
T10039 854-859 NN denotes locus
T10040 848-849 NN denotes β
T10041 850-853 NN denotes geo
T10042 849-850 HYPH denotes -
T10043 859-861 , denotes ,
T10044 861-864 CC denotes and
T10045 865-866 DT denotes a
T10046 875-879 NN denotes band
T10047 867-870 CD denotes 9.5
T10048 871-874 NN denotes kbp
T10049 880-884 IN denotes from
T10050 885-888 DT denotes the
T10051 894-899 NN denotes locus
T10052 889-893 NN denotes HygR
T10053 899-900 . denotes .
R2688 T9839 T9840 nmod ES,cells
R2689 T9840 T9841 nmod cells,DNA
R2690 T9841 T9843 nsubjpass DNA,extracted
R2691 T9842 T9841 amod genomic,DNA
R2692 T9844 T9843 auxpass was,extracted
R2693 T9845 T9843 prep with,extracted
R2694 T9846 T9847 nmod PUREGENE,Solution
R2695 T9847 T9845 pobj Solution,with
R2696 T9848 T9846 punct ™,PUREGENE
R2697 T9849 T9850 compound Cell,Lysis
R2698 T9850 T9847 compound Lysis,Solution
R2699 T9851 T9852 punct (,systems
R2700 T9852 T9847 parataxis systems,Solution
R2701 T9853 T9852 compound Gentra,systems
R2702 T9854 T9852 punct ),systems
R2703 T9855 T9843 punct .,extracted
R2704 T9857 T9858 prep For,digested
R2705 T9859 T9860 nummod 5,analysis
R2706 T9860 T9857 pobj analysis,For
R2707 T9861 T9859 punct ',5
R2708 T9862 T9863 compound Southern,blot
R2709 T9863 T9860 compound blot,analysis
R2710 T9864 T9858 punct ", ",digested
R2711 T9865 T9866 amod genomic,DNA
R2712 T9866 T9858 nsubjpass DNA,digested
R2713 T9867 T9858 auxpass was,digested
R2714 T9868 T9858 advmod first,digested
R2715 T9869 T9858 prep with,digested
R2716 T9870 T9869 pobj PstI,with
R2717 T9871 T9858 punct ", ",digested
R2718 T9872 T9873 advmod then,separated
R2719 T9873 T9858 conj separated,digested
R2720 T9874 T9873 prep on,separated
R2721 T9875 T9876 det an,gel
R2722 T9876 T9874 pobj gel,on
R2723 T9877 T9878 nummod 0.8,%
R2724 T9878 T9876 compound %,gel
R2725 T9879 T9876 compound agarose,gel
R2726 T9880 T9873 cc and,separated
R2727 T9881 T9873 conj transferred,separated
R2728 T9882 T9881 prep to,transferred
R2729 T9883 T9884 det a,membrane
R2730 T9884 T9882 pobj membrane,to
R2731 T9885 T9884 compound nylon,membrane
R2732 T9886 T9887 mark as,described
R2733 T9887 T9881 advcl described,transferred
R2734 T9888 T9889 punct [,20
R2735 T9889 T9887 parataxis 20,described
R2736 T9890 T9889 punct ],20
R2737 T9891 T9858 punct .,digested
R2738 T9893 T9894 det A,probe
R2739 T9894 T9899 nsubjpass probe,amplified
R2740 T9895 T9896 nummod 560,bp
R2741 T9896 T9894 nmod bp,probe
R2742 T9897 T9894 nummod 5,probe
R2743 T9898 T9897 punct ',5
R2744 T9900 T9899 auxpass was,amplified
R2745 T9901 T9899 advcl using,amplified
R2746 T9902 T9903 det the,ESG1S5
R2747 T9903 T9901 dobj ESG1S5,using
R2748 T9904 T9905 punct (,GATGGTGGTGGTGACTCAGAG
R2749 T9905 T9903 parataxis GATGGTGGTGGTGACTCAGAG,ESG1S5
R2750 T9906 T9905 nummod 5,GATGGTGGTGGTGACTCAGAG
R2751 T9907 T9906 punct ',5
R2752 T9908 T9905 punct -,GATGGTGGTGGTGACTCAGAG
R2753 T9909 T9905 punct -,GATGGTGGTGGTGACTCAGAG
R2754 T9910 T9905 nummod 3,GATGGTGGTGGTGACTCAGAG
R2755 T9911 T9905 punct ',GATGGTGGTGGTGACTCAGAG
R2756 T9912 T9905 punct ),GATGGTGGTGGTGACTCAGAG
R2757 T9913 T9903 cc and,ESG1S5
R2758 T9914 T9903 conj ESG1AS5,ESG1S5
R2759 T9915 T9901 prep as,using
R2760 T9916 T9917 punct (,primers
R2761 T9917 T9915 pobj primers,as
R2762 T9918 T9919 nummod 5,CCTCCATTGCCTCTATATCAG
R2763 T9919 T9917 nmod CCTCCATTGCCTCTATATCAG,primers
R2764 T9920 T9918 punct ',5
R2765 T9921 T9919 punct -,CCTCCATTGCCTCTATATCAG
R2766 T9922 T9919 punct -,CCTCCATTGCCTCTATATCAG
R2767 T9923 T9919 nummod 3,CCTCCATTGCCTCTATATCAG
R2768 T9924 T9919 punct ',CCTCCATTGCCTCTATATCAG
R2769 T9925 T9919 punct ),CCTCCATTGCCTCTATATCAG
R2770 T9926 T9899 punct .,amplified
R2771 T9928 T9929 det The,probe
R2772 T9929 T9930 nsubj probe,labeled
R2773 T9931 T9930 advmod specifically,labeled
R2774 T9932 T9933 det an,band
R2775 T9933 T9930 dobj band,labeled
R2776 T9934 T9935 nummod 18,kbp
R2777 T9935 T9933 compound kbp,band
R2778 T9936 T9933 prep from,band
R2779 T9937 T9938 det the,locus
R2780 T9938 T9936 pobj locus,from
R2781 T9939 T9938 nmod wild,locus
R2782 T9940 T9939 punct -,wild
R2783 T9941 T9938 compound type,locus
R2784 T9942 T9933 punct ", ",band
R2785 T9943 T9944 det a,band
R2786 T9944 T9933 conj band,band
R2787 T9945 T9946 nummod 15,kbp
R2788 T9946 T9944 compound kbp,band
R2789 T9947 T9944 prep from,band
R2790 T9948 T9949 det the,locus
R2791 T9949 T9947 pobj locus,from
R2792 T9950 T9951 compound β,geo
R2793 T9951 T9949 compound geo,locus
R2794 T9952 T9951 punct -,geo
R2795 T9953 T9944 punct ", ",band
R2796 T9954 T9944 cc and,band
R2797 T9955 T9956 det a,band
R2798 T9956 T9944 conj band,band
R2799 T9957 T9958 nummod 12,kbp
R2800 T9958 T9956 compound kbp,band
R2801 T9959 T9956 prep from,band
R2802 T9960 T9961 det the,locus
R2803 T9961 T9959 pobj locus,from
R2804 T9962 T9961 compound HygR,locus
R2805 T9963 T9930 punct .,labeled
R2806 T9965 T9966 amod Genomic,DNA
R2807 T9966 T9967 nsubjpass DNA,digested
R2808 T9968 T9967 auxpass was,digested
R2809 T9969 T9967 advmod also,digested
R2810 T9970 T9967 prep with,digested
R2811 T9971 T9970 pobj SpeI,with
R2812 T9972 T9967 prep for,digested
R2813 T9973 T9974 nummod 3,analysis
R2814 T9974 T9972 pobj analysis,for
R2815 T9975 T9973 punct ',3
R2816 T9976 T9977 compound Southern,blot
R2817 T9977 T9974 compound blot,analysis
R2818 T9978 T9967 punct .,digested
R2819 T9980 T9981 det A,probe
R2820 T9981 T9986 nsubjpass probe,amplified
R2821 T9982 T9983 nummod "1,010",bp
R2822 T9983 T9981 nmod bp,probe
R2823 T9984 T9981 nummod 3,probe
R2824 T9985 T9984 punct ',3
R2825 T9987 T9986 auxpass was,amplified
R2826 T9988 T9986 prep with,amplified
R2827 T9989 T9990 det the,primers
R2828 T9990 T9988 pobj primers,with
R2829 T9991 T9990 nmod pH34U,primers
R2830 T9992 T9991 punct -,pH34U
R2831 T9993 T9991 nummod 8000,pH34U
R2832 T9994 T9995 punct (,CCAACCAGCCAGAGTTTCAGTTAT
R2833 T9995 T9991 parataxis CCAACCAGCCAGAGTTTCAGTTAT,pH34U
R2834 T9996 T9995 nummod 5,CCAACCAGCCAGAGTTTCAGTTAT
R2835 T9997 T9996 punct ',5
R2836 T9998 T9995 punct -,CCAACCAGCCAGAGTTTCAGTTAT
R2837 T9999 T9995 punct -,CCAACCAGCCAGAGTTTCAGTTAT
R2838 T10000 T9995 nummod 3,CCAACCAGCCAGAGTTTCAGTTAT
R2839 T10001 T9995 punct ',CCAACCAGCCAGAGTTTCAGTTAT
R2840 T10002 T9995 punct ),CCAACCAGCCAGAGTTTCAGTTAT
R2841 T10003 T9991 cc and,pH34U
R2842 T10004 T9991 conj pH34L,pH34U
R2843 T10005 T10004 punct -,pH34L
R2844 T10006 T10004 nummod 9000,pH34L
R2845 T10007 T10008 punct (,GATAAGCTGCTGCCAAAAGACAAG
R2846 T10008 T10004 parataxis GATAAGCTGCTGCCAAAAGACAAG,pH34L
R2847 T10009 T10008 nummod 5,GATAAGCTGCTGCCAAAAGACAAG
R2848 T10010 T10009 punct ',5
R2849 T10011 T10008 punct -,GATAAGCTGCTGCCAAAAGACAAG
R2850 T10012 T10008 punct -,GATAAGCTGCTGCCAAAAGACAAG
R2851 T10013 T10008 nummod 3,GATAAGCTGCTGCCAAAAGACAAG
R2852 T10014 T10008 punct ',GATAAGCTGCTGCCAAAAGACAAG
R2853 T10015 T10008 punct ),GATAAGCTGCTGCCAAAAGACAAG
R2854 T10016 T9986 punct .,amplified
R2855 T10018 T10019 det The,probe
R2856 T10019 T10020 nsubj probe,hybridized
R2857 T10021 T10020 prep to,hybridized
R2858 T10022 T10023 det an,band
R2859 T10023 T10021 pobj band,to
R2860 T10024 T10025 nummod 11.5,kbp
R2861 T10025 T10023 compound kbp,band
R2862 T10026 T10023 prep from,band
R2863 T10027 T10028 det the,locus
R2864 T10028 T10026 pobj locus,from
R2865 T10029 T10030 amod wild,type
R2866 T10030 T10028 compound type,locus
R2867 T10031 T10030 punct -,type
R2868 T10032 T10023 punct ", ",band
R2869 T10033 T10034 det a,band
R2870 T10034 T10023 conj band,band
R2871 T10035 T10036 nummod 12.5,kbp
R2872 T10036 T10034 compound kbp,band
R2873 T10037 T10034 prep from,band
R2874 T10038 T10039 det the,locus
R2875 T10039 T10037 pobj locus,from
R2876 T10040 T10041 compound β,geo
R2877 T10041 T10039 compound geo,locus
R2878 T10042 T10041 punct -,geo
R2879 T10043 T10034 punct ", ",band
R2880 T10044 T10034 cc and,band
R2881 T10045 T10046 det a,band
R2882 T10046 T10034 conj band,band
R2883 T10047 T10048 nummod 9.5,kbp
R2884 T10048 T10046 compound kbp,band
R2885 T10049 T10046 prep from,band
R2886 T10050 T10051 det the,locus
R2887 T10051 T10049 pobj locus,from
R2888 T10052 T10051 compound HygR,locus
R2889 T10053 T10020 punct .,hybridized