Id |
Subject |
Object |
Predicate |
Lexical cue |
T8264 |
0-14 |
NN |
denotes |
Identification |
T8265 |
15-18 |
CC |
denotes |
and |
T8266 |
19-27 |
NNS |
denotes |
analyses |
T8267 |
28-30 |
IN |
denotes |
of |
T8268 |
31-34 |
NN |
denotes |
BAC |
T8269 |
35-41 |
NNS |
denotes |
clones |
T8270 |
42-52 |
VBG |
denotes |
containing |
T8271 |
53-56 |
DT |
denotes |
the |
T8272 |
68-72 |
NN |
denotes |
gene |
T8273 |
57-62 |
NN |
denotes |
mouse |
T8274 |
63-67 |
NN |
denotes |
ESG1 |
T8275 |
72-342 |
sentence |
denotes |
To identify bacterial artificial chromosome (BAC) clones containing mouse ESG1 gene, we performed PCR-based screening of mouse BAC library DNA pools (Research Genetics) using the pH34-u38 (5'-GAAGTCTGGTTCCTTGGCAGG-3') and pH34-L394 (5'-ACTCGATACACTGGCCTAGC-3') primers. |
T8276 |
73-75 |
TO |
denotes |
To |
T8277 |
76-84 |
VB |
denotes |
identify |
T8278 |
161-170 |
VBD |
denotes |
performed |
T8279 |
85-94 |
JJ |
denotes |
bacterial |
T8280 |
106-116 |
NN |
denotes |
chromosome |
T8281 |
95-105 |
JJ |
denotes |
artificial |
T8282 |
123-129 |
NNS |
denotes |
clones |
T8283 |
117-118 |
-LRB- |
denotes |
( |
T8284 |
118-121 |
NN |
denotes |
BAC |
T8285 |
121-122 |
-RRB- |
denotes |
) |
T8286 |
130-140 |
VBG |
denotes |
containing |
T8287 |
141-146 |
NN |
denotes |
mouse |
T8288 |
152-156 |
NN |
denotes |
gene |
T8289 |
147-151 |
NN |
denotes |
ESG1 |
T8290 |
156-158 |
, |
denotes |
, |
T8291 |
158-160 |
PRP |
denotes |
we |
T8292 |
171-174 |
NN |
denotes |
PCR |
T8293 |
175-180 |
VBN |
denotes |
based |
T8294 |
174-175 |
HYPH |
denotes |
- |
T8295 |
181-190 |
NN |
denotes |
screening |
T8296 |
191-193 |
IN |
denotes |
of |
T8297 |
194-199 |
NN |
denotes |
mouse |
T8298 |
216-221 |
NNS |
denotes |
pools |
T8299 |
200-203 |
NN |
denotes |
BAC |
T8300 |
204-211 |
NN |
denotes |
library |
T8301 |
212-215 |
NN |
denotes |
DNA |
T8302 |
222-223 |
-LRB- |
denotes |
( |
T8303 |
232-240 |
NNP |
denotes |
Genetics |
T8304 |
223-231 |
NNP |
denotes |
Research |
T8305 |
240-241 |
-RRB- |
denotes |
) |
T8306 |
242-247 |
VBG |
denotes |
using |
T8307 |
248-251 |
DT |
denotes |
the |
T8308 |
334-341 |
NNS |
denotes |
primers |
T8309 |
252-256 |
NN |
denotes |
pH34 |
T8310 |
257-260 |
NN |
denotes |
u38 |
T8311 |
256-257 |
HYPH |
denotes |
- |
T8312 |
261-262 |
-LRB- |
denotes |
( |
T8313 |
287-288 |
CD |
denotes |
3 |
T8314 |
262-263 |
CD |
denotes |
5 |
T8315 |
263-264 |
SYM |
denotes |
' |
T8316 |
264-265 |
HYPH |
denotes |
- |
T8317 |
265-286 |
NN |
denotes |
GAAGTCTGGTTCCTTGGCAGG |
T8318 |
286-287 |
HYPH |
denotes |
- |
T8319 |
288-289 |
SYM |
denotes |
' |
T8320 |
289-290 |
-RRB- |
denotes |
) |
T8321 |
291-294 |
CC |
denotes |
and |
T8322 |
295-299 |
NN |
denotes |
pH34 |
T8323 |
300-304 |
NN |
denotes |
L394 |
T8324 |
299-300 |
HYPH |
denotes |
- |
T8325 |
305-306 |
-LRB- |
denotes |
( |
T8326 |
330-331 |
CD |
denotes |
3 |
T8327 |
306-307 |
CD |
denotes |
5 |
T8328 |
307-308 |
SYM |
denotes |
' |
T8329 |
308-309 |
HYPH |
denotes |
- |
T8330 |
309-329 |
NN |
denotes |
ACTCGATACACTGGCCTAGC |
T8331 |
329-330 |
HYPH |
denotes |
- |
T8332 |
331-332 |
SYM |
denotes |
' |
T8333 |
332-333 |
-RRB- |
denotes |
) |
T8334 |
341-342 |
. |
denotes |
. |
T8335 |
342-698 |
sentence |
denotes |
Following restriction enzyme digestion, we performed Southern blot analyses of BAC clones as described [20] using the pH34-U258 (5'-CTCGAGTGTACAGTCAAGTGGTTGCTGGGA-3'), pH34-U65 (5'-GTGACCCTCGTGACCCGTAA-3'), pH34-intron1L (5'-CTGCGTGAGAGAAACACCAAACAGGC-3'), pH34-L545 (5'-TGTGAATGGGAAGGTTACCACTCT-3') and pH34-SCL1 (5'-GCCCTCTTCTGGTTTGTCTCGAAAT-3') probes. |
T8336 |
343-352 |
VBG |
denotes |
Following |
T8337 |
386-395 |
VBD |
denotes |
performed |
T8338 |
353-364 |
NN |
denotes |
restriction |
T8339 |
365-371 |
NN |
denotes |
enzyme |
T8340 |
372-381 |
NN |
denotes |
digestion |
T8341 |
381-383 |
, |
denotes |
, |
T8342 |
383-385 |
PRP |
denotes |
we |
T8343 |
396-404 |
NNP |
denotes |
Southern |
T8344 |
405-409 |
NN |
denotes |
blot |
T8345 |
410-418 |
NNS |
denotes |
analyses |
T8346 |
419-421 |
IN |
denotes |
of |
T8347 |
422-425 |
NN |
denotes |
BAC |
T8348 |
426-432 |
NNS |
denotes |
clones |
T8349 |
433-435 |
IN |
denotes |
as |
T8350 |
436-445 |
VBN |
denotes |
described |
T8351 |
446-447 |
-LRB- |
denotes |
[ |
T8352 |
447-449 |
CD |
denotes |
20 |
T8353 |
449-450 |
-RRB- |
denotes |
] |
T8354 |
451-456 |
VBG |
denotes |
using |
T8355 |
457-460 |
DT |
denotes |
the |
T8356 |
691-697 |
NNS |
denotes |
probes |
T8357 |
461-465 |
NN |
denotes |
pH34 |
T8358 |
466-470 |
NN |
denotes |
U258 |
T8359 |
465-466 |
HYPH |
denotes |
- |
T8360 |
471-472 |
-LRB- |
denotes |
( |
T8361 |
475-505 |
NN |
denotes |
CTCGAGTGTACAGTCAAGTGGTTGCTGGGA |
T8362 |
472-473 |
CD |
denotes |
5 |
T8363 |
473-474 |
SYM |
denotes |
' |
T8364 |
474-475 |
HYPH |
denotes |
- |
T8365 |
505-506 |
HYPH |
denotes |
- |
T8366 |
506-507 |
CD |
denotes |
3 |
T8367 |
507-508 |
SYM |
denotes |
' |
T8368 |
508-509 |
-RRB- |
denotes |
) |
T8369 |
509-511 |
, |
denotes |
, |
T8370 |
511-515 |
NN |
denotes |
pH34 |
T8371 |
516-519 |
NN |
denotes |
U65 |
T8372 |
515-516 |
HYPH |
denotes |
- |
T8373 |
520-521 |
-LRB- |
denotes |
( |
T8374 |
524-544 |
NN |
denotes |
GTGACCCTCGTGACCCGTAA |
T8375 |
521-522 |
CD |
denotes |
5 |
T8376 |
522-523 |
SYM |
denotes |
' |
T8377 |
523-524 |
HYPH |
denotes |
- |
T8378 |
544-545 |
HYPH |
denotes |
- |
T8379 |
545-546 |
CD |
denotes |
3 |
T8380 |
546-547 |
SYM |
denotes |
' |
T8381 |
547-548 |
-RRB- |
denotes |
) |
T8382 |
548-550 |
, |
denotes |
, |
T8383 |
550-554 |
NN |
denotes |
pH34 |
T8384 |
555-563 |
NN |
denotes |
intron1L |
T8385 |
554-555 |
HYPH |
denotes |
- |
T8386 |
564-565 |
-LRB- |
denotes |
( |
T8387 |
568-594 |
NN |
denotes |
CTGCGTGAGAGAAACACCAAACAGGC |
T8388 |
565-566 |
CD |
denotes |
5 |
T8389 |
566-567 |
SYM |
denotes |
' |
T8390 |
567-568 |
HYPH |
denotes |
- |
T8391 |
594-595 |
HYPH |
denotes |
- |
T8392 |
595-596 |
CD |
denotes |
3 |
T8393 |
596-597 |
SYM |
denotes |
' |
T8394 |
597-598 |
-RRB- |
denotes |
) |
T8395 |
598-600 |
, |
denotes |
, |
T8396 |
600-604 |
NN |
denotes |
pH34 |
T8397 |
605-609 |
NN |
denotes |
L545 |
T8398 |
604-605 |
HYPH |
denotes |
- |
T8399 |
610-611 |
-LRB- |
denotes |
( |
T8400 |
614-638 |
NN |
denotes |
TGTGAATGGGAAGGTTACCACTCT |
T8401 |
611-612 |
CD |
denotes |
5 |
T8402 |
612-613 |
SYM |
denotes |
' |
T8403 |
613-614 |
HYPH |
denotes |
- |
T8404 |
638-639 |
HYPH |
denotes |
- |
T8405 |
639-640 |
CD |
denotes |
3 |
T8406 |
640-641 |
SYM |
denotes |
' |
T8407 |
641-642 |
-RRB- |
denotes |
) |
T8408 |
643-646 |
CC |
denotes |
and |
T8409 |
647-651 |
NN |
denotes |
pH34 |
T8410 |
652-656 |
NN |
denotes |
SCL1 |
T8411 |
651-652 |
HYPH |
denotes |
- |
T8412 |
657-658 |
-LRB- |
denotes |
( |
T8413 |
661-686 |
NN |
denotes |
GCCCTCTTCTGGTTTGTCTCGAAAT |
T8414 |
658-659 |
CD |
denotes |
5 |
T8415 |
659-660 |
SYM |
denotes |
' |
T8416 |
660-661 |
HYPH |
denotes |
- |
T8417 |
686-687 |
HYPH |
denotes |
- |
T8418 |
687-688 |
CD |
denotes |
3 |
T8419 |
688-689 |
SYM |
denotes |
' |
T8420 |
689-690 |
-RRB- |
denotes |
) |
T8421 |
697-698 |
. |
denotes |
. |
T8422 |
698-793 |
sentence |
denotes |
Hybridization with these probes revealed bands containing either the ESG1 gene or pseudogenes. |
T8423 |
699-712 |
NN |
denotes |
Hybridization |
T8424 |
731-739 |
VBD |
denotes |
revealed |
T8425 |
713-717 |
IN |
denotes |
with |
T8426 |
718-723 |
DT |
denotes |
these |
T8427 |
724-730 |
NNS |
denotes |
probes |
T8428 |
740-745 |
NNS |
denotes |
bands |
T8429 |
746-756 |
VBG |
denotes |
containing |
T8430 |
757-763 |
CC |
denotes |
either |
T8431 |
773-777 |
NN |
denotes |
gene |
T8432 |
764-767 |
DT |
denotes |
the |
T8433 |
768-772 |
NN |
denotes |
ESG1 |
T8434 |
778-780 |
CC |
denotes |
or |
T8435 |
781-792 |
NNS |
denotes |
pseudogenes |
T8436 |
792-793 |
. |
denotes |
. |
T8437 |
793-955 |
sentence |
denotes |
To sequence the region containing the mouse ESG1 gene and the 3' flanking region, we subcloned a ~15 kbp XhoI-SalI fragment into the pZERO-2 vector (Invitrogen). |
T8438 |
794-796 |
TO |
denotes |
To |
T8439 |
797-805 |
VB |
denotes |
sequence |
T8440 |
879-888 |
VBD |
denotes |
subcloned |
T8441 |
806-809 |
DT |
denotes |
the |
T8442 |
810-816 |
NN |
denotes |
region |
T8443 |
817-827 |
VBG |
denotes |
containing |
T8444 |
828-831 |
DT |
denotes |
the |
T8445 |
843-847 |
NN |
denotes |
gene |
T8446 |
832-837 |
NN |
denotes |
mouse |
T8447 |
838-842 |
NN |
denotes |
ESG1 |
T8448 |
848-851 |
CC |
denotes |
and |
T8449 |
852-855 |
DT |
denotes |
the |
T8450 |
868-874 |
NN |
denotes |
region |
T8451 |
856-857 |
CD |
denotes |
3 |
T8452 |
857-858 |
SYM |
denotes |
' |
T8453 |
859-867 |
NN |
denotes |
flanking |
T8454 |
874-876 |
, |
denotes |
, |
T8455 |
876-878 |
PRP |
denotes |
we |
T8456 |
889-890 |
DT |
denotes |
a |
T8457 |
909-917 |
NN |
denotes |
fragment |
T8458 |
891-892 |
SYM |
denotes |
~ |
T8459 |
892-894 |
CD |
denotes |
15 |
T8460 |
895-898 |
NN |
denotes |
kbp |
T8461 |
899-903 |
NN |
denotes |
XhoI |
T8462 |
904-908 |
NN |
denotes |
SalI |
T8463 |
903-904 |
HYPH |
denotes |
- |
T8464 |
918-922 |
IN |
denotes |
into |
T8465 |
923-926 |
DT |
denotes |
the |
T8466 |
935-941 |
NN |
denotes |
vector |
T8467 |
927-932 |
NN |
denotes |
pZERO |
T8468 |
932-933 |
HYPH |
denotes |
- |
T8469 |
933-934 |
CD |
denotes |
2 |
T8470 |
942-943 |
-LRB- |
denotes |
( |
T8471 |
943-953 |
NNP |
denotes |
Invitrogen |
T8472 |
953-954 |
-RRB- |
denotes |
) |
T8473 |
954-955 |
. |
denotes |
. |
T8474 |
955-1063 |
sentence |
denotes |
HindIII- or EcoRI-digested fragments of this vector were then cloned into pBluescript KS(-) for sequencing. |
T8475 |
956-963 |
NN |
denotes |
HindIII |
T8476 |
974-982 |
VBN |
denotes |
digested |
T8477 |
963-964 |
HYPH |
denotes |
- |
T8478 |
965-967 |
CC |
denotes |
or |
T8479 |
968-973 |
NN |
denotes |
EcoRI |
T8480 |
973-974 |
HYPH |
denotes |
- |
T8481 |
983-992 |
NNS |
denotes |
fragments |
T8482 |
1018-1024 |
VBN |
denotes |
cloned |
T8483 |
993-995 |
IN |
denotes |
of |
T8484 |
996-1000 |
DT |
denotes |
this |
T8485 |
1001-1007 |
NN |
denotes |
vector |
T8486 |
1008-1012 |
VBD |
denotes |
were |
T8487 |
1013-1017 |
RB |
denotes |
then |
T8488 |
1025-1029 |
IN |
denotes |
into |
T8489 |
1030-1041 |
NN |
denotes |
pBluescript |
T8490 |
1042-1044 |
NN |
denotes |
KS |
T8491 |
1044-1045 |
-LRB- |
denotes |
( |
T8492 |
1045-1046 |
SYM |
denotes |
- |
T8493 |
1046-1047 |
-RRB- |
denotes |
) |
T8494 |
1048-1051 |
IN |
denotes |
for |
T8495 |
1052-1062 |
NN |
denotes |
sequencing |
T8496 |
1062-1063 |
. |
denotes |
. |
T8497 |
1063-1186 |
sentence |
denotes |
To sequence the ESG1 pseudogene and the 3' flanking region, an 8 kbp NotI/XhoI fragment was cloned into pBluescript KS(-). |
T8498 |
1064-1066 |
TO |
denotes |
To |
T8499 |
1067-1075 |
VB |
denotes |
sequence |
T8500 |
1156-1162 |
VBN |
denotes |
cloned |
T8501 |
1076-1079 |
DT |
denotes |
the |
T8502 |
1085-1095 |
NN |
denotes |
pseudogene |
T8503 |
1080-1084 |
NN |
denotes |
ESG1 |
T8504 |
1096-1099 |
CC |
denotes |
and |
T8505 |
1100-1103 |
DT |
denotes |
the |
T8506 |
1116-1122 |
NN |
denotes |
region |
T8507 |
1104-1105 |
CD |
denotes |
3 |
T8508 |
1105-1106 |
SYM |
denotes |
' |
T8509 |
1107-1115 |
NN |
denotes |
flanking |
T8510 |
1122-1124 |
, |
denotes |
, |
T8511 |
1124-1126 |
DT |
denotes |
an |
T8512 |
1143-1151 |
NN |
denotes |
fragment |
T8513 |
1127-1128 |
CD |
denotes |
8 |
T8514 |
1129-1132 |
NN |
denotes |
kbp |
T8515 |
1133-1137 |
NN |
denotes |
NotI |
T8516 |
1138-1142 |
NN |
denotes |
XhoI |
T8517 |
1137-1138 |
HYPH |
denotes |
/ |
T8518 |
1152-1155 |
VBD |
denotes |
was |
T8519 |
1163-1167 |
IN |
denotes |
into |
T8520 |
1168-1179 |
NN |
denotes |
pBluescript |
T8521 |
1180-1182 |
NN |
denotes |
KS |
T8522 |
1182-1183 |
-LRB- |
denotes |
( |
T8523 |
1183-1184 |
SYM |
denotes |
- |
T8524 |
1184-1185 |
-RRB- |
denotes |
) |
T8525 |
1185-1186 |
. |
denotes |
. |
T8526 |
1186-1268 |
sentence |
denotes |
BamHI- or PstI- fragments of this vector were also cloned into pBluescript KS(-). |
T8527 |
1187-1192 |
NN |
denotes |
BamHI |
T8528 |
1203-1212 |
NNS |
denotes |
fragments |
T8529 |
1192-1193 |
SYM |
denotes |
- |
T8530 |
1194-1196 |
CC |
denotes |
or |
T8531 |
1197-1201 |
NN |
denotes |
PstI |
T8532 |
1201-1202 |
SYM |
denotes |
- |
T8533 |
1238-1244 |
VBN |
denotes |
cloned |
T8534 |
1213-1215 |
IN |
denotes |
of |
T8535 |
1216-1220 |
DT |
denotes |
this |
T8536 |
1221-1227 |
NN |
denotes |
vector |
T8537 |
1228-1232 |
VBD |
denotes |
were |
T8538 |
1233-1237 |
RB |
denotes |
also |
T8539 |
1245-1249 |
IN |
denotes |
into |
T8540 |
1250-1261 |
NN |
denotes |
pBluescript |
T8541 |
1262-1264 |
NN |
denotes |
KS |
T8542 |
1264-1265 |
-LRB- |
denotes |
( |
T8543 |
1265-1266 |
SYM |
denotes |
- |
T8544 |
1266-1267 |
-RRB- |
denotes |
) |
T8545 |
1267-1268 |
. |
denotes |
. |
T8546 |
1268-1493 |
sentence |
denotes |
To identify the sequence containing the 5' flanking regions of the ESG1 gene and the related pseudogenes, we used a TOPO walker kit (Invitrogen) with the pH34-T2L (5'-ACTAGTCGCAGCAGGGATCCAGGAATATCT-3') and pH34-L394 primers. |
T8547 |
1269-1271 |
TO |
denotes |
To |
T8548 |
1272-1280 |
VB |
denotes |
identify |
T8549 |
1378-1382 |
VBD |
denotes |
used |
T8550 |
1281-1284 |
DT |
denotes |
the |
T8551 |
1285-1293 |
NN |
denotes |
sequence |
T8552 |
1294-1304 |
VBG |
denotes |
containing |
T8553 |
1305-1308 |
DT |
denotes |
the |
T8554 |
1321-1328 |
NNS |
denotes |
regions |
T8555 |
1309-1310 |
CD |
denotes |
5 |
T8556 |
1310-1311 |
SYM |
denotes |
' |
T8557 |
1312-1320 |
NN |
denotes |
flanking |
T8558 |
1329-1331 |
IN |
denotes |
of |
T8559 |
1332-1335 |
DT |
denotes |
the |
T8560 |
1341-1345 |
NN |
denotes |
gene |
T8561 |
1336-1340 |
NN |
denotes |
ESG1 |
T8562 |
1346-1349 |
CC |
denotes |
and |
T8563 |
1350-1353 |
DT |
denotes |
the |
T8564 |
1362-1373 |
NNS |
denotes |
pseudogenes |
T8565 |
1354-1361 |
JJ |
denotes |
related |
T8566 |
1373-1375 |
, |
denotes |
, |
T8567 |
1375-1377 |
PRP |
denotes |
we |
T8568 |
1383-1384 |
DT |
denotes |
a |
T8569 |
1397-1400 |
NN |
denotes |
kit |
T8570 |
1385-1389 |
NN |
denotes |
TOPO |
T8571 |
1390-1396 |
NN |
denotes |
walker |
T8572 |
1401-1402 |
-LRB- |
denotes |
( |
T8573 |
1402-1412 |
NNP |
denotes |
Invitrogen |
T8574 |
1412-1413 |
-RRB- |
denotes |
) |
T8575 |
1414-1418 |
IN |
denotes |
with |
T8576 |
1419-1422 |
DT |
denotes |
the |
T8577 |
1485-1492 |
NNS |
denotes |
primers |
T8578 |
1423-1427 |
NN |
denotes |
pH34 |
T8579 |
1428-1431 |
NN |
denotes |
T2L |
T8580 |
1427-1428 |
HYPH |
denotes |
- |
T8581 |
1432-1433 |
-LRB- |
denotes |
( |
T8582 |
1467-1468 |
CD |
denotes |
3 |
T8583 |
1433-1434 |
CD |
denotes |
5 |
T8584 |
1434-1435 |
SYM |
denotes |
' |
T8585 |
1435-1436 |
HYPH |
denotes |
- |
T8586 |
1436-1466 |
NN |
denotes |
ACTAGTCGCAGCAGGGATCCAGGAATATCT |
T8587 |
1466-1467 |
HYPH |
denotes |
- |
T8588 |
1468-1469 |
SYM |
denotes |
' |
T8589 |
1469-1470 |
-RRB- |
denotes |
) |
T8590 |
1471-1474 |
CC |
denotes |
and |
T8591 |
1475-1479 |
NN |
denotes |
pH34 |
T8592 |
1480-1484 |
NN |
denotes |
L394 |
T8593 |
1479-1480 |
HYPH |
denotes |
- |
T8594 |
1492-1493 |
. |
denotes |
. |
T8595 |
1493-1553 |
sentence |
denotes |
The resulting sequence was cloned into pCR2.1 (Invitrogen). |
T8596 |
1494-1497 |
DT |
denotes |
The |
T8597 |
1508-1516 |
NN |
denotes |
sequence |
T8598 |
1498-1507 |
VBG |
denotes |
resulting |
T8599 |
1521-1527 |
VBN |
denotes |
cloned |
T8600 |
1517-1520 |
VBD |
denotes |
was |
T8601 |
1528-1532 |
IN |
denotes |
into |
T8602 |
1533-1539 |
NN |
denotes |
pCR2.1 |
T8603 |
1540-1541 |
-LRB- |
denotes |
( |
T8604 |
1541-1551 |
NNP |
denotes |
Invitrogen |
T8605 |
1551-1552 |
-RRB- |
denotes |
) |
T8606 |
1552-1553 |
. |
denotes |
. |
T8607 |
1553-1726 |
sentence |
denotes |
We obtained a ~6 kbp band from the NsiI-digensted library; XbaI-, SpeI-, EcoRI-, and PstI-digested fragments of this band were cloned into pBluescript KS(-) for sequencing. |
T8608 |
1554-1556 |
PRP |
denotes |
We |
T8609 |
1557-1565 |
VBD |
denotes |
obtained |
T8610 |
1681-1687 |
VBN |
denotes |
cloned |
T8611 |
1566-1567 |
DT |
denotes |
a |
T8612 |
1575-1579 |
NN |
denotes |
band |
T8613 |
1568-1569 |
SYM |
denotes |
~ |
T8614 |
1569-1570 |
CD |
denotes |
6 |
T8615 |
1571-1574 |
NN |
denotes |
kbp |
T8616 |
1580-1584 |
IN |
denotes |
from |
T8617 |
1585-1588 |
DT |
denotes |
the |
T8618 |
1604-1611 |
NN |
denotes |
library |
T8619 |
1589-1593 |
NN |
denotes |
NsiI |
T8620 |
1594-1603 |
VBN |
denotes |
digensted |
T8621 |
1593-1594 |
HYPH |
denotes |
- |
T8622 |
1611-1612 |
: |
denotes |
; |
T8623 |
1613-1617 |
NN |
denotes |
XbaI |
T8624 |
1644-1652 |
VBN |
denotes |
digested |
T8625 |
1617-1618 |
HYPH |
denotes |
- |
T8626 |
1618-1620 |
, |
denotes |
, |
T8627 |
1620-1624 |
NN |
denotes |
SpeI |
T8628 |
1624-1625 |
HYPH |
denotes |
- |
T8629 |
1625-1627 |
, |
denotes |
, |
T8630 |
1627-1632 |
NN |
denotes |
EcoRI |
T8631 |
1632-1633 |
HYPH |
denotes |
- |
T8632 |
1633-1635 |
, |
denotes |
, |
T8633 |
1635-1638 |
CC |
denotes |
and |
T8634 |
1639-1643 |
NN |
denotes |
PstI |
T8635 |
1643-1644 |
HYPH |
denotes |
- |
T8636 |
1653-1662 |
NNS |
denotes |
fragments |
T8637 |
1663-1665 |
IN |
denotes |
of |
T8638 |
1666-1670 |
DT |
denotes |
this |
T8639 |
1671-1675 |
NN |
denotes |
band |
T8640 |
1676-1680 |
VBD |
denotes |
were |
T8641 |
1688-1692 |
IN |
denotes |
into |
T8642 |
1693-1704 |
NN |
denotes |
pBluescript |
T8643 |
1705-1707 |
NN |
denotes |
KS |
T8644 |
1707-1708 |
-LRB- |
denotes |
( |
T8645 |
1708-1709 |
SYM |
denotes |
- |
T8646 |
1709-1710 |
-RRB- |
denotes |
) |
T8647 |
1711-1714 |
IN |
denotes |
for |
T8648 |
1715-1725 |
NN |
denotes |
sequencing |
T8649 |
1725-1726 |
. |
denotes |
. |
T8650 |
1726-1791 |
sentence |
denotes |
This fragment contained the 5' flanking region of the ESG1 gene. |
T8651 |
1727-1731 |
DT |
denotes |
This |
T8652 |
1732-1740 |
NN |
denotes |
fragment |
T8653 |
1741-1750 |
VBD |
denotes |
contained |
T8654 |
1751-1754 |
DT |
denotes |
the |
T8655 |
1767-1773 |
NN |
denotes |
region |
T8656 |
1755-1756 |
CD |
denotes |
5 |
T8657 |
1756-1757 |
SYM |
denotes |
' |
T8658 |
1758-1766 |
NN |
denotes |
flanking |
T8659 |
1774-1776 |
IN |
denotes |
of |
T8660 |
1777-1780 |
DT |
denotes |
the |
T8661 |
1786-1790 |
NN |
denotes |
gene |
T8662 |
1781-1785 |
NN |
denotes |
ESG1 |
T8663 |
1790-1791 |
. |
denotes |
. |
T8664 |
1791-1890 |
sentence |
denotes |
A ~3 kbp fragment, obtained from the SacI-digested library, was cloned into pCR2.1 for sequencing. |
T8665 |
1792-1793 |
DT |
denotes |
A |
T8666 |
1801-1809 |
NN |
denotes |
fragment |
T8667 |
1794-1795 |
SYM |
denotes |
~ |
T8668 |
1795-1796 |
CD |
denotes |
3 |
T8669 |
1797-1800 |
NN |
denotes |
kbp |
T8670 |
1856-1862 |
VBN |
denotes |
cloned |
T8671 |
1809-1811 |
, |
denotes |
, |
T8672 |
1811-1819 |
VBN |
denotes |
obtained |
T8673 |
1820-1824 |
IN |
denotes |
from |
T8674 |
1825-1828 |
DT |
denotes |
the |
T8675 |
1843-1850 |
NN |
denotes |
library |
T8676 |
1829-1833 |
NN |
denotes |
SacI |
T8677 |
1834-1842 |
VBN |
denotes |
digested |
T8678 |
1833-1834 |
HYPH |
denotes |
- |
T8679 |
1850-1852 |
, |
denotes |
, |
T8680 |
1852-1855 |
VBD |
denotes |
was |
T8681 |
1863-1867 |
IN |
denotes |
into |
T8682 |
1868-1874 |
NN |
denotes |
pCR2.1 |
T8683 |
1875-1878 |
IN |
denotes |
for |
T8684 |
1879-1889 |
NN |
denotes |
sequencing |
T8685 |
1889-1890 |
. |
denotes |
. |
T8686 |
1890-1957 |
sentence |
denotes |
This fragment was contained the 5' region flanking the pseudogene. |
T8687 |
1891-1895 |
DT |
denotes |
This |
T8688 |
1896-1904 |
NN |
denotes |
fragment |
T8689 |
1909-1918 |
VBN |
denotes |
contained |
T8690 |
1905-1908 |
VBD |
denotes |
was |
T8691 |
1919-1922 |
DT |
denotes |
the |
T8692 |
1926-1932 |
NN |
denotes |
region |
T8693 |
1923-1924 |
CD |
denotes |
5 |
T8694 |
1924-1925 |
SYM |
denotes |
' |
T8695 |
1933-1941 |
VBG |
denotes |
flanking |
T8696 |
1942-1945 |
DT |
denotes |
the |
T8697 |
1946-1956 |
NN |
denotes |
pseudogene |
T8698 |
1956-1957 |
. |
denotes |
. |
R2053 |
T8265 |
T8264 |
cc |
and,Identification |
R2054 |
T8266 |
T8264 |
conj |
analyses,Identification |
R2055 |
T8267 |
T8264 |
prep |
of,Identification |
R2056 |
T8268 |
T8269 |
compound |
BAC,clones |
R2057 |
T8269 |
T8267 |
pobj |
clones,of |
R2058 |
T8270 |
T8269 |
acl |
containing,clones |
R2059 |
T8271 |
T8272 |
det |
the,gene |
R2060 |
T8272 |
T8270 |
dobj |
gene,containing |
R2061 |
T8273 |
T8272 |
compound |
mouse,gene |
R2062 |
T8274 |
T8272 |
compound |
ESG1,gene |
R2063 |
T8276 |
T8277 |
aux |
To,identify |
R2064 |
T8277 |
T8278 |
advcl |
identify,performed |
R2065 |
T8279 |
T8280 |
amod |
bacterial,chromosome |
R2066 |
T8280 |
T8282 |
nmod |
chromosome,clones |
R2067 |
T8281 |
T8280 |
amod |
artificial,chromosome |
R2068 |
T8282 |
T8277 |
dobj |
clones,identify |
R2069 |
T8283 |
T8280 |
punct |
(,chromosome |
R2070 |
T8284 |
T8280 |
appos |
BAC,chromosome |
R2071 |
T8285 |
T8282 |
punct |
),clones |
R2072 |
T8286 |
T8282 |
acl |
containing,clones |
R2073 |
T8287 |
T8288 |
compound |
mouse,gene |
R2074 |
T8288 |
T8286 |
dobj |
gene,containing |
R2075 |
T8289 |
T8288 |
compound |
ESG1,gene |
R2076 |
T8290 |
T8278 |
punct |
", ",performed |
R2077 |
T8291 |
T8278 |
nsubj |
we,performed |
R2078 |
T8292 |
T8293 |
npadvmod |
PCR,based |
R2079 |
T8293 |
T8295 |
amod |
based,screening |
R2080 |
T8294 |
T8293 |
punct |
-,based |
R2081 |
T8295 |
T8278 |
dobj |
screening,performed |
R2082 |
T8296 |
T8295 |
prep |
of,screening |
R2083 |
T8297 |
T8298 |
compound |
mouse,pools |
R2084 |
T8298 |
T8296 |
pobj |
pools,of |
R2085 |
T8299 |
T8298 |
compound |
BAC,pools |
R2086 |
T8300 |
T8298 |
compound |
library,pools |
R2087 |
T8301 |
T8298 |
compound |
DNA,pools |
R2088 |
T8302 |
T8303 |
punct |
(,Genetics |
R2089 |
T8303 |
T8295 |
parataxis |
Genetics,screening |
R2090 |
T8304 |
T8303 |
compound |
Research,Genetics |
R2091 |
T8305 |
T8303 |
punct |
),Genetics |
R2092 |
T8306 |
T8278 |
advcl |
using,performed |
R2093 |
T8307 |
T8308 |
det |
the,primers |
R2094 |
T8308 |
T8306 |
dobj |
primers,using |
R2095 |
T8309 |
T8310 |
nmod |
pH34,u38 |
R2096 |
T8310 |
T8308 |
nmod |
u38,primers |
R2097 |
T8311 |
T8310 |
punct |
-,u38 |
R2098 |
T8312 |
T8313 |
punct |
(,3 |
R2099 |
T8313 |
T8310 |
parataxis |
3,u38 |
R2100 |
T8314 |
T8313 |
dep |
5,3 |
R2101 |
T8315 |
T8314 |
punct |
',5 |
R2102 |
T8316 |
T8313 |
punct |
-,3 |
R2103 |
T8317 |
T8313 |
dep |
GAAGTCTGGTTCCTTGGCAGG,3 |
R2104 |
T8318 |
T8313 |
punct |
-,3 |
R2105 |
T8319 |
T8313 |
punct |
',3 |
R2106 |
T8320 |
T8313 |
punct |
),3 |
R2107 |
T8321 |
T8310 |
cc |
and,u38 |
R2108 |
T8322 |
T8323 |
compound |
pH34,L394 |
R2109 |
T8323 |
T8310 |
conj |
L394,u38 |
R2110 |
T8324 |
T8323 |
punct |
-,L394 |
R2111 |
T8325 |
T8326 |
punct |
(,3 |
R2112 |
T8326 |
T8323 |
parataxis |
3,L394 |
R2113 |
T8327 |
T8326 |
dep |
5,3 |
R2114 |
T8328 |
T8327 |
punct |
',5 |
R2115 |
T8329 |
T8326 |
punct |
-,3 |
R2116 |
T8330 |
T8326 |
dep |
ACTCGATACACTGGCCTAGC,3 |
R2117 |
T8331 |
T8326 |
punct |
-,3 |
R2118 |
T8332 |
T8326 |
punct |
',3 |
R2119 |
T8333 |
T8326 |
punct |
),3 |
R2120 |
T8334 |
T8278 |
punct |
.,performed |
R2121 |
T8336 |
T8337 |
prep |
Following,performed |
R2122 |
T8338 |
T8339 |
compound |
restriction,enzyme |
R2123 |
T8339 |
T8340 |
compound |
enzyme,digestion |
R2124 |
T8340 |
T8336 |
pobj |
digestion,Following |
R2125 |
T8341 |
T8337 |
punct |
", ",performed |
R2126 |
T8342 |
T8337 |
nsubj |
we,performed |
R2127 |
T8343 |
T8344 |
compound |
Southern,blot |
R2128 |
T8344 |
T8345 |
compound |
blot,analyses |
R2129 |
T8345 |
T8337 |
dobj |
analyses,performed |
R2130 |
T8346 |
T8345 |
prep |
of,analyses |
R2131 |
T8347 |
T8348 |
compound |
BAC,clones |
R2132 |
T8348 |
T8346 |
pobj |
clones,of |
R2133 |
T8349 |
T8350 |
mark |
as,described |
R2134 |
T8350 |
T8337 |
advcl |
described,performed |
R2135 |
T8351 |
T8352 |
punct |
[,20 |
R2136 |
T8352 |
T8350 |
parataxis |
20,described |
R2137 |
T8353 |
T8352 |
punct |
],20 |
R2138 |
T8354 |
T8350 |
advcl |
using,described |
R2139 |
T8355 |
T8356 |
det |
the,probes |
R2140 |
T8356 |
T8354 |
dobj |
probes,using |
R2141 |
T8357 |
T8358 |
nmod |
pH34,U258 |
R2142 |
T8358 |
T8356 |
nmod |
U258,probes |
R2143 |
T8359 |
T8358 |
punct |
-,U258 |
R2144 |
T8360 |
T8361 |
punct |
(,CTCGAGTGTACAGTCAAGTGGTTGCTGGGA |
R2145 |
T8361 |
T8358 |
parataxis |
CTCGAGTGTACAGTCAAGTGGTTGCTGGGA,U258 |
R2146 |
T8362 |
T8361 |
nummod |
5,CTCGAGTGTACAGTCAAGTGGTTGCTGGGA |
R2147 |
T8363 |
T8362 |
punct |
',5 |
R2148 |
T8364 |
T8361 |
punct |
-,CTCGAGTGTACAGTCAAGTGGTTGCTGGGA |
R2149 |
T8365 |
T8361 |
punct |
-,CTCGAGTGTACAGTCAAGTGGTTGCTGGGA |
R2150 |
T8366 |
T8361 |
nummod |
3,CTCGAGTGTACAGTCAAGTGGTTGCTGGGA |
R2151 |
T8367 |
T8361 |
punct |
',CTCGAGTGTACAGTCAAGTGGTTGCTGGGA |
R2152 |
T8368 |
T8361 |
punct |
),CTCGAGTGTACAGTCAAGTGGTTGCTGGGA |
R2153 |
T8369 |
T8358 |
punct |
", ",U258 |
R2154 |
T8370 |
T8371 |
compound |
pH34,U65 |
R2155 |
T8371 |
T8358 |
conj |
U65,U258 |
R2156 |
T8372 |
T8371 |
punct |
-,U65 |
R2157 |
T8373 |
T8374 |
punct |
(,GTGACCCTCGTGACCCGTAA |
R2158 |
T8374 |
T8371 |
parataxis |
GTGACCCTCGTGACCCGTAA,U65 |
R2159 |
T8375 |
T8374 |
nummod |
5,GTGACCCTCGTGACCCGTAA |
R2160 |
T8376 |
T8375 |
punct |
',5 |
R2161 |
T8377 |
T8374 |
punct |
-,GTGACCCTCGTGACCCGTAA |
R2162 |
T8378 |
T8374 |
punct |
-,GTGACCCTCGTGACCCGTAA |
R2163 |
T8379 |
T8374 |
nummod |
3,GTGACCCTCGTGACCCGTAA |
R2164 |
T8380 |
T8374 |
punct |
',GTGACCCTCGTGACCCGTAA |
R2165 |
T8381 |
T8374 |
punct |
),GTGACCCTCGTGACCCGTAA |
R2166 |
T8382 |
T8371 |
punct |
", ",U65 |
R2167 |
T8383 |
T8384 |
compound |
pH34,intron1L |
R2168 |
T8384 |
T8371 |
conj |
intron1L,U65 |
R2169 |
T8385 |
T8384 |
punct |
-,intron1L |
R2170 |
T8386 |
T8387 |
punct |
(,CTGCGTGAGAGAAACACCAAACAGGC |
R2171 |
T8387 |
T8384 |
parataxis |
CTGCGTGAGAGAAACACCAAACAGGC,intron1L |
R2172 |
T8388 |
T8387 |
nummod |
5,CTGCGTGAGAGAAACACCAAACAGGC |
R2173 |
T8389 |
T8388 |
punct |
',5 |
R2174 |
T8390 |
T8387 |
punct |
-,CTGCGTGAGAGAAACACCAAACAGGC |
R2175 |
T8391 |
T8387 |
punct |
-,CTGCGTGAGAGAAACACCAAACAGGC |
R2176 |
T8392 |
T8387 |
nummod |
3,CTGCGTGAGAGAAACACCAAACAGGC |
R2177 |
T8393 |
T8387 |
punct |
',CTGCGTGAGAGAAACACCAAACAGGC |
R2178 |
T8394 |
T8387 |
punct |
),CTGCGTGAGAGAAACACCAAACAGGC |
R2179 |
T8395 |
T8384 |
punct |
", ",intron1L |
R2180 |
T8396 |
T8397 |
compound |
pH34,L545 |
R2181 |
T8397 |
T8384 |
conj |
L545,intron1L |
R2182 |
T8398 |
T8397 |
punct |
-,L545 |
R2183 |
T8399 |
T8400 |
punct |
(,TGTGAATGGGAAGGTTACCACTCT |
R2184 |
T8400 |
T8397 |
parataxis |
TGTGAATGGGAAGGTTACCACTCT,L545 |
R2185 |
T8401 |
T8400 |
nummod |
5,TGTGAATGGGAAGGTTACCACTCT |
R2186 |
T8402 |
T8401 |
punct |
',5 |
R2187 |
T8403 |
T8400 |
punct |
-,TGTGAATGGGAAGGTTACCACTCT |
R2188 |
T8404 |
T8400 |
punct |
-,TGTGAATGGGAAGGTTACCACTCT |
R2189 |
T8405 |
T8400 |
nummod |
3,TGTGAATGGGAAGGTTACCACTCT |
R2190 |
T8406 |
T8400 |
punct |
',TGTGAATGGGAAGGTTACCACTCT |
R2191 |
T8407 |
T8400 |
punct |
),TGTGAATGGGAAGGTTACCACTCT |
R2192 |
T8408 |
T8397 |
cc |
and,L545 |
R2193 |
T8409 |
T8410 |
compound |
pH34,SCL1 |
R2194 |
T8410 |
T8397 |
conj |
SCL1,L545 |
R2195 |
T8411 |
T8410 |
punct |
-,SCL1 |
R2196 |
T8412 |
T8413 |
punct |
(,GCCCTCTTCTGGTTTGTCTCGAAAT |
R2197 |
T8413 |
T8410 |
parataxis |
GCCCTCTTCTGGTTTGTCTCGAAAT,SCL1 |
R2198 |
T8414 |
T8413 |
nummod |
5,GCCCTCTTCTGGTTTGTCTCGAAAT |
R2199 |
T8415 |
T8414 |
punct |
',5 |
R2200 |
T8416 |
T8413 |
punct |
-,GCCCTCTTCTGGTTTGTCTCGAAAT |
R2201 |
T8417 |
T8413 |
punct |
-,GCCCTCTTCTGGTTTGTCTCGAAAT |
R2202 |
T8418 |
T8413 |
nummod |
3,GCCCTCTTCTGGTTTGTCTCGAAAT |
R2203 |
T8419 |
T8413 |
punct |
',GCCCTCTTCTGGTTTGTCTCGAAAT |
R2204 |
T8420 |
T8413 |
punct |
),GCCCTCTTCTGGTTTGTCTCGAAAT |
R2205 |
T8421 |
T8337 |
punct |
.,performed |
R2206 |
T8423 |
T8424 |
nsubj |
Hybridization,revealed |
R2207 |
T8425 |
T8423 |
prep |
with,Hybridization |
R2208 |
T8426 |
T8427 |
det |
these,probes |
R2209 |
T8427 |
T8425 |
pobj |
probes,with |
R2210 |
T8428 |
T8424 |
dobj |
bands,revealed |
R2211 |
T8429 |
T8428 |
acl |
containing,bands |
R2212 |
T8430 |
T8431 |
preconj |
either,gene |
R2213 |
T8431 |
T8429 |
dobj |
gene,containing |
R2214 |
T8432 |
T8431 |
det |
the,gene |
R2215 |
T8433 |
T8431 |
compound |
ESG1,gene |
R2216 |
T8434 |
T8431 |
cc |
or,gene |
R2217 |
T8435 |
T8431 |
conj |
pseudogenes,gene |
R2218 |
T8436 |
T8424 |
punct |
.,revealed |
R2219 |
T8438 |
T8439 |
aux |
To,sequence |
R2220 |
T8439 |
T8440 |
advcl |
sequence,subcloned |
R2221 |
T8441 |
T8442 |
det |
the,region |
R2222 |
T8442 |
T8439 |
dobj |
region,sequence |
R2223 |
T8443 |
T8442 |
acl |
containing,region |
R2224 |
T8444 |
T8445 |
det |
the,gene |
R2225 |
T8445 |
T8443 |
dobj |
gene,containing |
R2226 |
T8446 |
T8445 |
compound |
mouse,gene |
R2227 |
T8447 |
T8445 |
compound |
ESG1,gene |
R2228 |
T8448 |
T8445 |
cc |
and,gene |
R2229 |
T8449 |
T8450 |
det |
the,region |
R2230 |
T8450 |
T8445 |
conj |
region,gene |
R2231 |
T8451 |
T8450 |
nummod |
3,region |
R2232 |
T8452 |
T8451 |
punct |
',3 |
R2233 |
T8453 |
T8450 |
compound |
flanking,region |
R2234 |
T8454 |
T8440 |
punct |
", ",subcloned |
R2235 |
T8455 |
T8440 |
nsubj |
we,subcloned |
R2236 |
T8456 |
T8457 |
det |
a,fragment |
R2237 |
T8457 |
T8440 |
dobj |
fragment,subcloned |
R2238 |
T8458 |
T8459 |
punct |
~,15 |
R2239 |
T8459 |
T8460 |
nummod |
15,kbp |
R2240 |
T8460 |
T8457 |
compound |
kbp,fragment |
R2241 |
T8461 |
T8462 |
compound |
XhoI,SalI |
R2242 |
T8462 |
T8457 |
compound |
SalI,fragment |
R2243 |
T8463 |
T8462 |
punct |
-,SalI |
R2244 |
T8464 |
T8440 |
prep |
into,subcloned |
R2245 |
T8465 |
T8466 |
det |
the,vector |
R2246 |
T8466 |
T8464 |
pobj |
vector,into |
R2247 |
T8467 |
T8466 |
nmod |
pZERO,vector |
R2248 |
T8468 |
T8467 |
punct |
-,pZERO |
R2249 |
T8469 |
T8467 |
nummod |
2,pZERO |
R2250 |
T8470 |
T8471 |
punct |
(,Invitrogen |
R2251 |
T8471 |
T8466 |
parataxis |
Invitrogen,vector |
R2252 |
T8472 |
T8471 |
punct |
),Invitrogen |
R2253 |
T8473 |
T8440 |
punct |
.,subcloned |
R2254 |
T8475 |
T8476 |
npadvmod |
HindIII,digested |
R2255 |
T8476 |
T8481 |
amod |
digested,fragments |
R2256 |
T8477 |
T8475 |
punct |
-,HindIII |
R2257 |
T8478 |
T8475 |
cc |
or,HindIII |
R2258 |
T8479 |
T8475 |
conj |
EcoRI,HindIII |
R2259 |
T8480 |
T8476 |
punct |
-,digested |
R2260 |
T8481 |
T8482 |
nsubjpass |
fragments,cloned |
R2261 |
T8483 |
T8481 |
prep |
of,fragments |
R2262 |
T8484 |
T8485 |
det |
this,vector |
R2263 |
T8485 |
T8483 |
pobj |
vector,of |
R2264 |
T8486 |
T8482 |
auxpass |
were,cloned |
R2265 |
T8487 |
T8482 |
advmod |
then,cloned |
R2266 |
T8488 |
T8482 |
prep |
into,cloned |
R2267 |
T8489 |
T8490 |
compound |
pBluescript,KS |
R2268 |
T8490 |
T8488 |
pobj |
KS,into |
R2269 |
T8491 |
T8490 |
punct |
(,KS |
R2270 |
T8492 |
T8490 |
punct |
-,KS |
R2271 |
T8493 |
T8490 |
punct |
),KS |
R2272 |
T8494 |
T8482 |
prep |
for,cloned |
R2273 |
T8495 |
T8494 |
pobj |
sequencing,for |
R2274 |
T8496 |
T8482 |
punct |
.,cloned |
R2275 |
T8498 |
T8499 |
aux |
To,sequence |
R2276 |
T8499 |
T8500 |
advcl |
sequence,cloned |
R2277 |
T8501 |
T8502 |
det |
the,pseudogene |
R2278 |
T8502 |
T8499 |
dobj |
pseudogene,sequence |
R2279 |
T8503 |
T8502 |
compound |
ESG1,pseudogene |
R2280 |
T8504 |
T8502 |
cc |
and,pseudogene |
R2281 |
T8505 |
T8506 |
det |
the,region |
R2282 |
T8506 |
T8502 |
conj |
region,pseudogene |
R2283 |
T8507 |
T8506 |
nummod |
3,region |
R2284 |
T8508 |
T8507 |
punct |
',3 |
R2285 |
T8509 |
T8506 |
compound |
flanking,region |
R2286 |
T8510 |
T8500 |
punct |
", ",cloned |
R2287 |
T8511 |
T8512 |
det |
an,fragment |
R2288 |
T8512 |
T8500 |
nsubjpass |
fragment,cloned |
R2289 |
T8513 |
T8514 |
nummod |
8,kbp |
R2290 |
T8514 |
T8512 |
compound |
kbp,fragment |
R2291 |
T8515 |
T8516 |
compound |
NotI,XhoI |
R2292 |
T8516 |
T8512 |
compound |
XhoI,fragment |
R2293 |
T8517 |
T8516 |
punct |
/,XhoI |
R2294 |
T8518 |
T8500 |
auxpass |
was,cloned |
R2295 |
T8519 |
T8500 |
prep |
into,cloned |
R2296 |
T8520 |
T8521 |
compound |
pBluescript,KS |
R2297 |
T8521 |
T8519 |
pobj |
KS,into |
R2298 |
T8522 |
T8521 |
punct |
(,KS |
R2299 |
T8523 |
T8521 |
punct |
-,KS |
R2300 |
T8524 |
T8521 |
punct |
),KS |
R2301 |
T8525 |
T8500 |
punct |
.,cloned |
R2302 |
T8527 |
T8528 |
nmod |
BamHI,fragments |
R2303 |
T8528 |
T8533 |
nsubjpass |
fragments,cloned |
R2304 |
T8529 |
T8527 |
punct |
-,BamHI |
R2305 |
T8530 |
T8527 |
cc |
or,BamHI |
R2306 |
T8531 |
T8527 |
conj |
PstI,BamHI |
R2307 |
T8532 |
T8528 |
punct |
-,fragments |
R2308 |
T8534 |
T8528 |
prep |
of,fragments |
R2309 |
T8535 |
T8536 |
det |
this,vector |
R2310 |
T8536 |
T8534 |
pobj |
vector,of |
R2311 |
T8537 |
T8533 |
auxpass |
were,cloned |
R2312 |
T8538 |
T8533 |
advmod |
also,cloned |
R2313 |
T8539 |
T8533 |
prep |
into,cloned |
R2314 |
T8540 |
T8541 |
compound |
pBluescript,KS |
R2315 |
T8541 |
T8539 |
pobj |
KS,into |
R2316 |
T8542 |
T8541 |
punct |
(,KS |
R2317 |
T8543 |
T8541 |
punct |
-,KS |
R2318 |
T8544 |
T8541 |
punct |
),KS |
R2319 |
T8545 |
T8533 |
punct |
.,cloned |
R2320 |
T8547 |
T8548 |
aux |
To,identify |
R2321 |
T8548 |
T8549 |
advcl |
identify,used |
R2322 |
T8550 |
T8551 |
det |
the,sequence |
R2323 |
T8551 |
T8548 |
dobj |
sequence,identify |
R2324 |
T8552 |
T8551 |
acl |
containing,sequence |
R2325 |
T8553 |
T8554 |
det |
the,regions |
R2326 |
T8554 |
T8552 |
dobj |
regions,containing |
R2327 |
T8555 |
T8554 |
nummod |
5,regions |
R2328 |
T8556 |
T8555 |
punct |
',5 |
R2329 |
T8557 |
T8554 |
compound |
flanking,regions |
R2330 |
T8558 |
T8554 |
prep |
of,regions |
R2331 |
T8559 |
T8560 |
det |
the,gene |
R2332 |
T8560 |
T8558 |
pobj |
gene,of |
R2333 |
T8561 |
T8560 |
compound |
ESG1,gene |
R2334 |
T8562 |
T8560 |
cc |
and,gene |
R2335 |
T8563 |
T8564 |
det |
the,pseudogenes |
R2336 |
T8564 |
T8560 |
conj |
pseudogenes,gene |
R2337 |
T8565 |
T8564 |
amod |
related,pseudogenes |
R2338 |
T8566 |
T8549 |
punct |
", ",used |
R2339 |
T8567 |
T8549 |
nsubj |
we,used |
R2340 |
T8568 |
T8569 |
det |
a,kit |
R2341 |
T8569 |
T8549 |
dobj |
kit,used |
R2342 |
T8570 |
T8569 |
compound |
TOPO,kit |
R2343 |
T8571 |
T8569 |
compound |
walker,kit |
R2344 |
T8572 |
T8573 |
punct |
(,Invitrogen |
R2345 |
T8573 |
T8569 |
parataxis |
Invitrogen,kit |
R2346 |
T8574 |
T8573 |
punct |
),Invitrogen |
R2347 |
T8575 |
T8549 |
prep |
with,used |
R2348 |
T8576 |
T8577 |
det |
the,primers |
R2349 |
T8577 |
T8575 |
pobj |
primers,with |
R2350 |
T8578 |
T8579 |
nmod |
pH34,T2L |
R2351 |
T8579 |
T8577 |
nmod |
T2L,primers |
R2352 |
T8580 |
T8579 |
punct |
-,T2L |
R2353 |
T8581 |
T8582 |
punct |
(,3 |
R2354 |
T8582 |
T8579 |
parataxis |
3,T2L |
R2355 |
T8583 |
T8582 |
dep |
5,3 |
R2356 |
T8584 |
T8583 |
punct |
',5 |
R2357 |
T8585 |
T8582 |
punct |
-,3 |
R2358 |
T8586 |
T8582 |
dep |
ACTAGTCGCAGCAGGGATCCAGGAATATCT,3 |
R2359 |
T8587 |
T8582 |
punct |
-,3 |
R2360 |
T8588 |
T8582 |
punct |
',3 |
R2361 |
T8589 |
T8582 |
punct |
),3 |
R2362 |
T8590 |
T8579 |
cc |
and,T2L |
R2363 |
T8591 |
T8592 |
compound |
pH34,L394 |
R2364 |
T8592 |
T8579 |
conj |
L394,T2L |
R2365 |
T8593 |
T8592 |
punct |
-,L394 |
R2366 |
T8594 |
T8549 |
punct |
.,used |
R2367 |
T8596 |
T8597 |
det |
The,sequence |
R2368 |
T8597 |
T8599 |
nsubjpass |
sequence,cloned |
R2369 |
T8598 |
T8597 |
amod |
resulting,sequence |
R2370 |
T8600 |
T8599 |
auxpass |
was,cloned |
R2371 |
T8601 |
T8599 |
prep |
into,cloned |
R2372 |
T8602 |
T8601 |
pobj |
pCR2.1,into |
R2373 |
T8603 |
T8604 |
punct |
(,Invitrogen |
R2374 |
T8604 |
T8602 |
parataxis |
Invitrogen,pCR2.1 |
R2375 |
T8605 |
T8604 |
punct |
),Invitrogen |
R2376 |
T8606 |
T8599 |
punct |
.,cloned |
R2377 |
T8608 |
T8609 |
nsubj |
We,obtained |
R2378 |
T8609 |
T8610 |
ccomp |
obtained,cloned |
R2379 |
T8611 |
T8612 |
det |
a,band |
R2380 |
T8612 |
T8609 |
dobj |
band,obtained |
R2381 |
T8613 |
T8614 |
punct |
~,6 |
R2382 |
T8614 |
T8615 |
nummod |
6,kbp |
R2383 |
T8615 |
T8612 |
compound |
kbp,band |
R2384 |
T8616 |
T8609 |
prep |
from,obtained |
R2385 |
T8617 |
T8618 |
det |
the,library |
R2386 |
T8618 |
T8616 |
pobj |
library,from |
R2387 |
T8619 |
T8620 |
npadvmod |
NsiI,digensted |
R2388 |
T8620 |
T8618 |
amod |
digensted,library |
R2389 |
T8621 |
T8620 |
punct |
-,digensted |
R2390 |
T8622 |
T8610 |
punct |
;,cloned |
R2391 |
T8623 |
T8624 |
npadvmod |
XbaI,digested |
R2392 |
T8624 |
T8636 |
amod |
digested,fragments |
R2393 |
T8625 |
T8623 |
punct |
-,XbaI |
R2394 |
T8626 |
T8623 |
punct |
", ",XbaI |
R2395 |
T8627 |
T8623 |
conj |
SpeI,XbaI |
R2396 |
T8628 |
T8627 |
punct |
-,SpeI |
R2397 |
T8629 |
T8627 |
punct |
", ",SpeI |
R2398 |
T8630 |
T8627 |
conj |
EcoRI,SpeI |
R2399 |
T8631 |
T8630 |
punct |
-,EcoRI |
R2400 |
T8632 |
T8630 |
punct |
", ",EcoRI |
R2401 |
T8633 |
T8630 |
cc |
and,EcoRI |
R2402 |
T8634 |
T8630 |
conj |
PstI,EcoRI |
R2403 |
T8635 |
T8624 |
punct |
-,digested |
R2404 |
T8636 |
T8610 |
nsubjpass |
fragments,cloned |
R2405 |
T8637 |
T8636 |
prep |
of,fragments |
R2406 |
T8638 |
T8639 |
det |
this,band |
R2407 |
T8639 |
T8637 |
pobj |
band,of |
R2408 |
T8640 |
T8610 |
auxpass |
were,cloned |
R2409 |
T8641 |
T8610 |
prep |
into,cloned |
R2410 |
T8642 |
T8643 |
compound |
pBluescript,KS |
R2411 |
T8643 |
T8641 |
pobj |
KS,into |
R2412 |
T8644 |
T8643 |
punct |
(,KS |
R2413 |
T8645 |
T8643 |
punct |
-,KS |
R2414 |
T8646 |
T8643 |
punct |
),KS |
R2415 |
T8647 |
T8610 |
prep |
for,cloned |
R2416 |
T8648 |
T8647 |
pobj |
sequencing,for |
R2417 |
T8649 |
T8610 |
punct |
.,cloned |
R2418 |
T8651 |
T8652 |
det |
This,fragment |
R2419 |
T8652 |
T8653 |
nsubj |
fragment,contained |
R2420 |
T8654 |
T8655 |
det |
the,region |
R2421 |
T8655 |
T8653 |
dobj |
region,contained |
R2422 |
T8656 |
T8655 |
nummod |
5,region |
R2423 |
T8657 |
T8656 |
punct |
',5 |
R2424 |
T8658 |
T8655 |
compound |
flanking,region |
R2425 |
T8659 |
T8655 |
prep |
of,region |
R2426 |
T8660 |
T8661 |
det |
the,gene |
R2427 |
T8661 |
T8659 |
pobj |
gene,of |
R2428 |
T8662 |
T8661 |
compound |
ESG1,gene |
R2429 |
T8663 |
T8653 |
punct |
.,contained |
R2430 |
T8665 |
T8666 |
det |
A,fragment |
R2431 |
T8666 |
T8670 |
nsubjpass |
fragment,cloned |
R2432 |
T8667 |
T8668 |
punct |
~,3 |
R2433 |
T8668 |
T8669 |
nummod |
3,kbp |
R2434 |
T8669 |
T8666 |
compound |
kbp,fragment |
R2435 |
T8671 |
T8666 |
punct |
", ",fragment |
R2436 |
T8672 |
T8666 |
acl |
obtained,fragment |
R2437 |
T8673 |
T8672 |
prep |
from,obtained |
R2438 |
T8674 |
T8675 |
det |
the,library |
R2439 |
T8675 |
T8673 |
pobj |
library,from |
R2440 |
T8676 |
T8677 |
npadvmod |
SacI,digested |
R2441 |
T8677 |
T8675 |
amod |
digested,library |
R2442 |
T8678 |
T8677 |
punct |
-,digested |
R2443 |
T8679 |
T8670 |
punct |
", ",cloned |
R2444 |
T8680 |
T8670 |
auxpass |
was,cloned |
R2445 |
T8681 |
T8670 |
prep |
into,cloned |
R2446 |
T8682 |
T8681 |
pobj |
pCR2.1,into |
R2447 |
T8683 |
T8670 |
prep |
for,cloned |
R2448 |
T8684 |
T8683 |
pobj |
sequencing,for |
R2449 |
T8685 |
T8670 |
punct |
.,cloned |
R2450 |
T8687 |
T8688 |
det |
This,fragment |
R2451 |
T8688 |
T8689 |
nsubjpass |
fragment,contained |
R2452 |
T8690 |
T8689 |
auxpass |
was,contained |
R2453 |
T8691 |
T8692 |
det |
the,region |
R2454 |
T8692 |
T8689 |
dobj |
region,contained |
R2455 |
T8693 |
T8692 |
nummod |
5,region |
R2456 |
T8694 |
T8693 |
punct |
',5 |
R2457 |
T8695 |
T8692 |
acl |
flanking,region |
R2458 |
T8696 |
T8697 |
det |
the,pseudogene |
R2459 |
T8697 |
T8695 |
dobj |
pseudogene,flanking |
R2460 |
T8698 |
T8689 |
punct |
.,contained |