PMC:1420271 / 14426-21475 JSON TXT

Annnotations TAB JSON ListView MergeView

craft-ca-core-dev

Below, discontinuous spans are shown in the chain model. You can change it to the bag model.

Id	Subject	Object	Predicate	Lexical cue
T8140	40-43	SO:0000153	denotes	BAC
T8141	66-71	NCBITaxon:10088	denotes	mouse
T8142	72-76	PR:000006847	denotes	ESG1
T8143	77-81	SO:0000704	denotes	gene
T8144	94-103	NCBITaxon:2	denotes	bacterial
T8145	94-125	SO:0000153	denotes	bacterial artificial chromosome
T8146	127-130	SO:0000153	denotes	BAC
T8147	150-155	NCBITaxon:10088	denotes	mouse
T8148	156-160	PR:000006847	denotes	ESG1
T8149	161-165	SO:0000704	denotes	gene
T8150	203-208	NCBITaxon:10088	denotes	mouse
T8151	209-212	SO:0000153	denotes	BAC
T8152	261-265	PR:000006847	denotes	pH34
T8153	304-308	PR:000006847	denotes	pH34
T8154	343-350	SO:0000112	denotes	primers
T8155	431-434	SO:0000153	denotes	BAC
T8156	470-474	PR:000006847	denotes	pH34
T8157	520-524	PR:000006847	denotes	pH34
T8158	559-563	PR:000006847	denotes	pH34
T8159	609-613	PR:000006847	denotes	pH34
T8160	656-660	PR:000006847	denotes	pH34
T8161	708-721	GO:0097617	denotes	Hybridization
T8162	777-781	PR:000006847	denotes	ESG1
T8163	782-786	SO:0000704	denotes	gene
T8164	790-801	SO:0000336	denotes	pseudogenes
T8165	841-846	NCBITaxon:10088	denotes	mouse
T8166	847-851	PR:000006847	denotes	ESG1
T8167	852-856	SO:0000704	denotes	gene
T8168	865-883	SO:0001417	denotes	3' flanking region
T8169	905-907	SO:0000028	denotes	bp
T8170	944-950	SO:0000440	denotes	vector
T8171	965-972	PR:P43870	denotes	HindIII
T8172	1010-1016	SO:0000440	denotes	vector
T8173	1089-1093	PR:000006847	denotes	ESG1
T8174	1094-1104	SO:0000336	denotes	pseudogene
T8175	1113-1131	SO:0001417	denotes	3' flanking region
T8176	1139-1141	SO:0000028	denotes	bp
T8177	1196-1201	PR:P23940	denotes	BamHI
T8178	1230-1236	SO:0000440	denotes	vector
T8179	1318-1337	SO:0001416	denotes	5' flanking regions
T8180	1345-1349	PR:000006847	denotes	ESG1
T8181	1350-1354	SO:0000704	denotes	gene
T8182	1371-1382	SO:0000336	denotes	pseudogenes
T8183	1432-1436	PR:000006847	denotes	pH34
T8184	1484-1488	PR:000006847	denotes	pH34
T8185	1494-1501	SO:0000112	denotes	primers
T8186	1581-1583	SO:0000028	denotes	bp
T8187	1764-1782	SO:0001416	denotes	5' flanking region
T8188	1790-1794	PR:000006847	denotes	ESG1
T8189	1795-1799	SO:0000704	denotes	gene
T8190	1807-1809	SO:0000028	denotes	bp
T8191	1942-1950	SO:0000357	denotes	flanking
T8192	1955-1965	SO:0000336	denotes	pseudogene
T9096	1984-1988	PR:000006847	denotes	ESG1
T9097	1989-2006	SO:0001644	denotes	targeting vectors
T9098	2030-2034	PR:000006847	denotes	ESG1
T9099	2035-2040	SO:0000147	denotes	exons
T9100	2050-2067	SO:0001644	denotes	targeting vectors
T9101	2089-2093	SO:0000243	denotes	IRES
T9102	2100-2108	SO:0005853	denotes	cassette
T9103	2120-2124	SO:0000243	denotes	IRES
T9104	2130-2138	SO:0005853	denotes	cassette
T9105	2142-2150	SO:0000167	denotes	promoter
T9106	2197-2199	SO:0000028	denotes	bp
T9107	2234-2238	PR:000006847	denotes	pH34
T9108	2292-2296	PR:000006847	denotes	pH34
T9109	2350-2357	SO:0000112	denotes	primers
T9110	2376-2378	SO:0000028	denotes	bp
T9111	2404-2408	PR:000006847	denotes	pH34
T9112	2462-2466	PR:000006847	denotes	pH34
T9113	2516-2523	SO:0000112	denotes	primers
T9114	2529-2533	SO:0000243	denotes	IRES
T9115	2543-2547	SO:0000243	denotes	IRES
T9116	2553-2562	SO:0005853	denotes	cassettes
T9117	2568-2575	GO:0006266	denotes	ligated
T9118	2625-2630	CHEBI:27026	denotes	toxin
T9119	2633-2641	SO:0005853	denotes	cassette
T9120	2717-2734	SO:0001644	denotes	targeting vectors
T9121	2774-2782	CL:0002322	denotes	ES cells
T9122	2796-2800	SO:0000704	denotes	Gene
T9123	2818-2829	GO:0009294	denotes	Transfected
T9124	2865-2869	CHEBI:42768	denotes	G418
T9125	2883-2895	CHEBI:16976	denotes	hygromycin B
T9126	2911-2918	SO:0001026	denotes	Genomic
T9127	2928-2932	CHEBI:42768	denotes	G418
T9128	2937-2949	CHEBI:16976	denotes	hygromycin B
T9778	3087-3095	CL:0002322	denotes	ES cells
T9779	3096-3103	SO:0001026	denotes	genomic
T9780	3137-3147	GO:0019835	denotes	Cell Lysis
T9781	3148-3156	CHEBI:75958	denotes	Solution
T9782	3206-3213	SO:0001026	denotes	genomic
T9783	3274-3281	CHEBI:2511	denotes	agarose
T9784	3307-3312	CHEBI:25614	denotes	nylon
T9785	3347-3349	SO:0000028	denotes	bp
T9786	3469-3476	SO:0000112	denotes	primers
T9787	3516-3518	SO:0000028	denotes	bp
T9788	3556-3558	SO:0000028	denotes	bp
T9789	3596-3598	SO:0000028	denotes	bp
T9790	3625-3632	SO:0001026	denotes	Genomic
T9791	3704-3706	SO:0000028	denotes	bp
T9792	3834-3841	SO:0000112	denotes	primers
T9793	3853-3863	GO:0097617	denotes	hybridized
T9794	3876-3878	SO:0000028	denotes	bp
T9795	3918-3920	SO:0000028	denotes	bp
T9796	3959-3961	SO:0000028	denotes	bp
T10358	4008-4012	PR:000006847	denotes	ESG1
T10359	4024-4034	GO:0042571	denotes	antibodies
T10360	4058-4062	PR:000006847	denotes	Esg1
T10361	4093-4097	PR:000006847	denotes	pH34
T10362	4150-4154	PR:000006847	denotes	pH34
T10363	4203-4210	SO:0000112	denotes	primers
T10364	4231-4235	PR:000006847	denotes	pH34
T10365	4251-4262	SO:0000006	denotes	PCR product
T10366	4311-4315	PR:000006847	denotes	pH34
T10367	4414-4424	GO:0010467	denotes	expression
T10368	4425-4431	SO:0000440	denotes	vector
T10369	4440-4444	PR:000006847	denotes	pH34
T10370	4458-4465	NCBITaxon:562	denotes	E. coli
T10371	4492-4510	GO:0006412	denotes	protein production
T10372	4581-4585	PR:000006847	denotes	ESG1
T10373	4608-4629	CHEBI:44557	denotes	nitrilotriacetic acid
T10374	4630-4637	CHEBI:2511	denotes	agarose
T10375	4698-4702	CHEBI:16199	denotes	urea
T10376	4731-4735	CHEBI:16199	denotes	urea
T10377	4799-4806	NCBITaxon:9986	denotes	rabbits
T10378	4824-4828	PR:000006847	denotes	ESG1
T10379	4840-4850	GO:0042571	denotes	antibodies
T10816	4887-4894	CL:0002322	denotes	ES cell
T10817	4961-4983	CHEBI:8984	denotes	sodium dodecyl sulfate
T10818	4985-4988	CHEBI:8984	denotes	SDS
T10819	5033-5047	CHEBI:53325	denotes	nitrocellulose
T10820	5106-5110	PR:000006847	denotes	ESG1
T10821	5134-5138	PR:000013044	denotes	Oct3
T10822	5181-5185	PR:000005257	denotes	CDK4
T10823	5256-5266	GO:0042571	denotes	antibodies
T10824	5268-5279	NCBITaxon:3704	denotes	Horseradish
T10825	5291-5301	MOP:0000779	denotes	conjugated
T10826	5307-5313	NCBITaxon:9986	denotes	rabbit
T10827	5323-5328	NCBITaxon:10088	denotes	mouse
T10828	5329-5344	GO:0019814	denotes	immunoglobulins
T10829	5390-5398	GO:0042571	denotes	antibody
T10830	5428-5436	GO:0042571	denotes	antibody
T11412	5510-5514	PR:000006847	denotes	ESG1
T11413	5525-5533	CL:0002322	denotes	ES cells
T11414	5539-5550	UBERON:0000358	denotes	blastocysts
T11415	5551-5555	PR:000006847	denotes	Esg1
T11416	5561-5565	PR:000006847	denotes	ESG1
T11417	5583-5587	NCBITaxon:10088	denotes	mice
T11418	5607-5616	CHEBI:41774	denotes	Tamoxifen
T11419	5629-5641	CHEBI:6716	denotes	Depo-provera
T11420	5684-5693	GO:0007565	denotes	pregnancy
T11421	5712-5719	UBERON:0000922	denotes	embryos
T11422	5756-5762	UBERON:0000995	denotes	uterus
T11423	5887-5893	NCBITaxon:27592	denotes	Bovine
T11424	5894-5899	UBERON:0001977	denotes	Serum
T11425	5997-6007	CHEBI:17334	denotes	Penicillin
T11426	6008-6020	CHEBI:17076	denotes	Streptomysin
T11427	6047-6064	CHEBI:41218	denotes	2-mercaptoethanol
T11428	6182-6189	PR:000027795	denotes	trypsin
T11429	6334-6341	PR:000027795	denotes	trypsin
T11430	6440-6447	_FRAGMENT	denotes	primary
T11431	6451-6455	CL:0000001	denotes	cell
T11432	6448-6455	CL:0002322	denotes	ES cell
T11433	6545-6556	UBERON:0000119	denotes	cell layers
T11858	6669-6677	CL:0002322	denotes	ES cells
T11859	6682-6686	PR:000006847	denotes	ESG1
T11860	6690-6698	CL:0002322	denotes	ES cells
T11861	6716-6719	CHEBI:37987	denotes	Cy3
T11862	6724-6727	CHEBI:37989	denotes	Cy5
T11863	6760-6770	GO:0097617	denotes	hybridized
T11864	6776-6781	NCBITaxon:10088	denotes	Mouse
T11865	6930-6943	GO:0097617	denotes	Hybridization
R3166	T11431	T11430	_lexicallyChainedTo	cell,primary

craft-ca-core-ex-dev

Below, discontinuous spans are shown in the chain model. You can change it to the bag model.

Id	Subject	Object	Predicate	Lexical cue
T8193	40-43	SO_EXT:0000153	denotes	BAC
T8194	44-50	SO_EXT:sequence_cloned_entity	denotes	clones
T8195	66-71	NCBITaxon:10088	denotes	mouse
T8196	72-76	PR_EXT:000006847	denotes	ESG1
T8197	77-81	SO_EXT:0000704	denotes	gene
T8198	94-103	NCBITaxon:2	denotes	bacterial
T8199	94-125	SO_EXT:0000153	denotes	bacterial artificial chromosome
T8200	115-125	GO_SO_EXT:chromosome	denotes	chromosome
T8201	127-130	SO_EXT:0000153	denotes	BAC
T8202	132-138	SO_EXT:sequence_cloned_entity	denotes	clones
T8203	150-155	NCBITaxon:10088	denotes	mouse
T8204	156-160	PR_EXT:000006847	denotes	ESG1
T8205	161-165	SO_EXT:0000704	denotes	gene
T8206	203-208	NCBITaxon:10088	denotes	mouse
T8207	209-212	SO_EXT:0000153	denotes	BAC
T8208	221-224	CHEBI_SO_EXT:DNA	denotes	DNA
T8209	241-249	OBI_SO_EXT:gene_or_genetic_investigation_or_genetic_process	denotes	Genetics
T8210	261-265	PR_EXT:000006847	denotes	pH34
T8211	304-308	PR_EXT:000006847	denotes	pH34
T8212	343-350	SO_EXT:0000112	denotes	primers
T8213	362-380	GO_EXT:0015666	denotes	restriction enzyme
T8214	374-380	CHEBI_GO_SO_EXT:enzyme	denotes	enzyme
T8215	431-434	SO_EXT:0000153	denotes	BAC
T8216	435-441	SO_EXT:sequence_cloned_entity	denotes	clones
T8217	470-474	PR_EXT:000006847	denotes	pH34
T8218	520-524	PR_EXT:000006847	denotes	pH34
T8219	559-563	PR_EXT:000006847	denotes	pH34
T8220	609-613	PR_EXT:000006847	denotes	pH34
T8221	656-660	PR_EXT:000006847	denotes	pH34
T8222	700-706	CHEBI_SO_EXT:molecular_probe	denotes	probes
T8223	708-721	GO:0097617	denotes	Hybridization
T8224	733-739	CHEBI_SO_EXT:molecular_probe	denotes	probes
T8225	777-781	PR_EXT:000006847	denotes	ESG1
T8226	782-786	SO_EXT:0000704	denotes	gene
T8227	790-801	SO_EXT:0000336	denotes	pseudogenes
T8228	841-846	NCBITaxon:10088	denotes	mouse
T8229	847-851	PR_EXT:000006847	denotes	ESG1
T8230	852-856	SO_EXT:0000704	denotes	gene
T8231	865-883	SO_EXT:0001417	denotes	3' flanking region
T8232	905-907	SO_EXT:0000028	denotes	bp
T8233	944-950	SO_EXT:0000440	denotes	vector
T8234	965-972	PR_EXT:P43870	denotes	HindIII
T8235	1010-1016	SO_EXT:0000440	denotes	vector
T8236	1027-1033	SO_EXT:sequence_cloning_process	denotes	cloned
T8237	1089-1093	PR_EXT:000006847	denotes	ESG1
T8238	1094-1104	SO_EXT:0000336	denotes	pseudogene
T8239	1113-1131	SO_EXT:0001417	denotes	3' flanking region
T8240	1139-1141	SO_EXT:0000028	denotes	bp
T8241	1165-1171	SO_EXT:sequence_cloning_process	denotes	cloned
T8242	1196-1201	PR_EXT:P23940	denotes	BamHI
T8243	1230-1236	SO_EXT:0000440	denotes	vector
T8244	1247-1253	SO_EXT:sequence_cloning_process	denotes	cloned
T8245	1294-1302	SO_EXT:biological_sequence	denotes	sequence
T8246	1318-1337	SO_EXT:0001416	denotes	5' flanking regions
T8247	1345-1349	PR_EXT:000006847	denotes	ESG1
T8248	1350-1354	SO_EXT:0000704	denotes	gene
T8249	1371-1382	SO_EXT:0000336	denotes	pseudogenes
T8250	1432-1436	PR_EXT:000006847	denotes	pH34
T8251	1484-1488	PR_EXT:000006847	denotes	pH34
T8252	1494-1501	SO_EXT:0000112	denotes	primers
T8253	1517-1525	SO_EXT:biological_sequence	denotes	sequence
T8254	1530-1536	SO_EXT:sequence_cloning_process	denotes	cloned
T8255	1581-1583	SO_EXT:0000028	denotes	bp
T8256	1690-1696	SO_EXT:sequence_cloning_process	denotes	cloned
T8257	1764-1782	SO_EXT:0001416	denotes	5' flanking region
T8258	1790-1794	PR_EXT:000006847	denotes	ESG1
T8259	1795-1799	SO_EXT:0000704	denotes	gene
T8260	1807-1809	SO_EXT:0000028	denotes	bp
T8261	1865-1871	SO_EXT:sequence_cloning_process	denotes	cloned
T8262	1942-1950	SO:0000357	denotes	flanking
T8263	1955-1965	SO_EXT:0000336	denotes	pseudogene
T9129	1984-1988	PR_EXT:000006847	denotes	ESG1
T9130	1989-2006	SO_EXT:0001644	denotes	targeting vectors
T9131	2010-2018	SO_EXT:sequence_substitution_process	denotes	replaced
T9132	2030-2034	PR_EXT:000006847	denotes	ESG1
T9133	2035-2040	SO_EXT:0000147	denotes	exons
T9134	2050-2067	SO_EXT:0001644	denotes	targeting vectors
T9135	2089-2093	SO_EXT:0000243	denotes	IRES
T9136	2094-2099	GO_EXT:beta_geo	denotes	β-geo
T9137	2100-2108	SO_EXT:0005853	denotes	cassette
T9138	2120-2124	SO_EXT:0000243	denotes	IRES
T9139	2130-2138	SO_EXT:0005853	denotes	cassette
T9140	2142-2150	SO_EXT:0000167	denotes	promoter
T9141	2197-2199	SO_EXT:0000028	denotes	bp
T9142	2234-2238	PR_EXT:000006847	denotes	pH34
T9143	2292-2296	PR_EXT:000006847	denotes	pH34
T9144	2350-2357	SO_EXT:0000112	denotes	primers
T9145	2376-2378	SO_EXT:0000028	denotes	bp
T9146	2404-2408	PR_EXT:000006847	denotes	pH34
T9147	2462-2466	PR_EXT:000006847	denotes	pH34
T9148	2516-2523	SO_EXT:0000112	denotes	primers
T9149	2529-2533	SO_EXT:0000243	denotes	IRES
T9150	2534-2539	GO_EXT:beta_geo	denotes	β-geo
T9151	2543-2547	SO_EXT:0000243	denotes	IRES
T9152	2553-2562	SO_EXT:0005853	denotes	cassettes
T9153	2568-2575	GO:0006266	denotes	ligated
T9154	2625-2630	CHEBI_EXT:27026	denotes	toxin
T9155	2633-2641	SO_EXT:0005853	denotes	cassette
T9156	2653-2663	SO_EXT:sequence_downstreamness	denotes	downstream
T9157	2685-2698	SO_EXT:sequence_linearization	denotes	linearization
T9158	2717-2734	SO_EXT:0001644	denotes	targeting vectors
T9159	2774-2782	CL:0002322	denotes	ES cells
T9160	2777-2782	CL_GO_EXT:cell	denotes	cells
T9161	2796-2800	SO_EXT:0000704	denotes	Gene
T9162	2818-2829	GO:0009294	denotes	Transfected
T9163	2830-2835	CL_GO_EXT:cell	denotes	cells
T9164	2865-2869	CHEBI:42768	denotes	G418
T9165	2883-2895	CHEBI:16976	denotes	hygromycin B
T9166	2911-2922	SO_EXT:genomic_DNA	denotes	Genomic DNA
T9167	2919-2922	CHEBI_SO_EXT:DNA	denotes	DNA
T9168	2928-2932	CHEBI:42768	denotes	G418
T9169	2937-2949	CHEBI:16976	denotes	hygromycin B
T9170	2997-3010	GO_SO_EXT:sequence_rearrangement_process	denotes	recombination
T9797	3073-3086	GO_SO_EXT:sequence_rearrangement_process	denotes	recombination
T9798	3087-3095	CL:0002322	denotes	ES cells
T9799	3090-3095	CL_GO_EXT:cell	denotes	cells
T9800	3096-3107	SO_EXT:genomic_DNA	denotes	genomic DNA
T9801	3104-3107	CHEBI_SO_EXT:DNA	denotes	DNA
T9802	3137-3141	CL_GO_EXT:cell	denotes	Cell
T9803	3137-3147	GO:0019835	denotes	Cell Lysis
T9804	3148-3156	CHEBI:75958	denotes	Solution
T9805	3206-3217	SO_EXT:genomic_DNA	denotes	genomic DNA
T9806	3214-3217	CHEBI_SO_EXT:DNA	denotes	DNA
T9807	3274-3281	CHEBI:2511	denotes	agarose
T9808	3290-3301	GO_EXT:biological_movement_or_translocation_process	denotes	transferred
T9809	3307-3312	CHEBI:25614	denotes	nylon
T9810	3347-3349	SO_EXT:0000028	denotes	bp
T9811	3353-3358	CHEBI_SO_EXT:molecular_probe	denotes	probe
T9812	3469-3476	SO_EXT:0000112	denotes	primers
T9813	3482-3487	CHEBI_SO_EXT:molecular_probe	denotes	probe
T9814	3501-3508	CHEBI_SO_EXT:molecular_label_or_mark_or_tag_process	denotes	labeled
T9815	3516-3518	SO_EXT:0000028	denotes	bp
T9816	3533-3542	SO_EXT:wild_type_entity_or_quality	denotes	wild-type
T9817	3556-3558	SO_EXT:0000028	denotes	bp
T9818	3573-3578	GO_EXT:beta_geo	denotes	β-geo
T9819	3596-3598	SO_EXT:0000028	denotes	bp
T9820	3625-3636	SO_EXT:genomic_DNA	denotes	Genomic DNA
T9821	3633-3636	CHEBI_SO_EXT:DNA	denotes	DNA
T9822	3704-3706	SO_EXT:0000028	denotes	bp
T9823	3710-3715	CHEBI_SO_EXT:molecular_probe	denotes	probe
T9824	3834-3841	SO_EXT:0000112	denotes	primers
T9825	3847-3852	CHEBI_SO_EXT:molecular_probe	denotes	probe
T9826	3853-3863	GO:0097617	denotes	hybridized
T9827	3876-3878	SO_EXT:0000028	denotes	bp
T9828	3893-3902	SO_EXT:wild_type_entity_or_quality	denotes	wild-type
T9829	3918-3920	SO_EXT:0000028	denotes	bp
T9830	3935-3940	GO_EXT:beta_geo	denotes	β-geo
T9831	3959-3961	SO_EXT:0000028	denotes	bp
T10380	3989-4002	_FRAGMENT	denotes	Generation of
T10381	4024-4034	GO_EXT:antibody_or_immunoglobulin_biosynthesis_or_production	denotes	antibodies
T10382	4008-4012	PR_EXT:000006847	denotes	ESG1
T10383	4024-4034	GO:0042571	denotes	antibodies
T10384	4039-4054	SO_EXT:coding_sequence	denotes	coding sequence
T10385	4058-4062	PR_EXT:000006847	denotes	Esg1
T10386	4093-4097	PR_EXT:000006847	denotes	pH34
T10387	4150-4154	PR_EXT:000006847	denotes	pH34
T10388	4203-4210	SO_EXT:0000112	denotes	primers
T10389	4231-4235	PR_EXT:000006847	denotes	pH34
T10390	4251-4262	SO_EXT:0000006	denotes	PCR product
T10391	4311-4315	PR_EXT:000006847	denotes	pH34
T10392	4363-4376	GO_SO_EXT:sequence_rearrangement_process	denotes	recombination
T10393	4414-4424	GO:0010467	denotes	expression
T10394	4425-4431	SO_EXT:0000440	denotes	vector
T10395	4440-4444	PR_EXT:000006847	denotes	pH34
T10396	4458-4465	NCBITaxon:562	denotes	E. coli
T10397	4480-4491	GO_SO_EXT:sequence_rearrangement_process	denotes	recombinant
T10398	4492-4499	CHEBI_PR_EXT:protein	denotes	protein
T10399	4492-4510	GO:0006412	denotes	protein production
T10400	4564-4573	CHEBI_SO_EXT:histidine	denotes	Histidine
T10401	4574-4580	CHEBI_SO_EXT:molecular_label_or_mark_or_tag_process	denotes	tagged
T10402	4581-4585	PR_EXT:000006847	denotes	ESG1
T10403	4605-4607	CHEBI_EXT:nickel	denotes	Ni
T10404	4608-4629	CHEBI:44557	denotes	nitrilotriacetic acid
T10405	4630-4637	CHEBI:2511	denotes	agarose
T10406	4653-4663	GO_EXT:macromolecule_denaturation	denotes	denaturing
T10407	4698-4702	CHEBI:16199	denotes	urea
T10408	4731-4735	CHEBI:16199	denotes	urea
T10409	4741-4752	GO_SO_EXT:sequence_rearrangement_process	denotes	recombinant
T10410	4753-4761	CHEBI_PR_EXT:protein	denotes	proteins
T10411	4799-4806	NCBITaxon:9986	denotes	rabbits
T10412	4824-4828	PR_EXT:000006847	denotes	ESG1
T10413	4840-4850	GO:0042571	denotes	antibodies
T10831	4887-4894	CL:0002322	denotes	ES cell
T10832	4890-4894	CL_GO_EXT:cell	denotes	cell
T10833	4925-4933	CL_GO_EXT:cell	denotes	cellular
T10834	4934-4942	CHEBI_PR_EXT:protein	denotes	proteins
T10835	4961-4983	CHEBI:8984	denotes	sodium dodecyl sulfate
T10836	4985-4988	CHEBI:8984	denotes	SDS
T10837	4994-5008	CHEBI_EXT:polyacrylamide	denotes	polyacrylamide
T10838	5018-5029	GO_EXT:biological_movement_or_translocation_process	denotes	transferred
T10839	5033-5047	CHEBI:53325	denotes	nitrocellulose
T10840	5106-5110	PR_EXT:000006847	denotes	ESG1
T10841	5134-5138	PR_EXT:000013044	denotes	Oct3
T10842	5181-5185	PR_EXT:000005257	denotes	CDK4
T10843	5256-5266	GO:0042571	denotes	antibodies
T10844	5268-5279	NCBITaxon:3704	denotes	Horseradish
T10845	5280-5290	GO_EXT:0004601	denotes	peroxidase
T10846	5291-5301	MOP:0000779	denotes	conjugated
T10847	5307-5313	NCBITaxon:9986	denotes	rabbit
T10848	5323-5328	NCBITaxon:10088	denotes	mouse
T10849	5329-5344	GO:0019814	denotes	immunoglobulins
T10850	5354-5358	CL_GO_EXT:cell	denotes	Cell
T10851	5359-5368	GO_EXT:cell_communication_or_signaling_or_signal_transduction	denotes	Signaling
T10852	5390-5398	GO:0042571	denotes	antibody
T10853	5399-5406	CHEMINF_GO_EXT:chemical_binding_or_bond_formation	denotes	binding
T10854	5422-5427	CHEMINF_GO_EXT:chemical_binding_or_bond_formation	denotes	bound
T10855	5428-5436	GO:0042571	denotes	antibody
T11434	5510-5514	PR_EXT:000006847	denotes	ESG1
T11435	5525-5533	CL:0002322	denotes	ES cells
T11436	5528-5533	CL_GO_EXT:cell	denotes	cells
T11437	5539-5550	UBERON:0000358	denotes	blastocysts
T11438	5551-5555	PR_EXT:000006847	denotes	Esg1
T11439	5555-5556	SO_EXT:normal_or_wild_type_or_present	denotes	+
T11440	5557-5558	SO_EXT:sequence_nullness_or_absence	denotes	-
T11441	5561-5565	PR_EXT:000006847	denotes	ESG1
T11442	5565-5566	SO_EXT:sequence_nullness_or_absence	denotes	-
T11443	5567-5568	SO_EXT:sequence_nullness_or_absence	denotes	-
T11444	5569-5575	SO_EXT:sequence_altered_entity_or_alteration_process	denotes	mutant
T11445	5576-5582	PATO_UBERON_EXT:female_or_bearer_of_femaleness	denotes	female
T11446	5583-5587	NCBITaxon:10088	denotes	mice
T11447	5607-5616	CHEBI:41774	denotes	Tamoxifen
T11448	5629-5641	CHEBI:6716	denotes	Depo-provera
T11449	5652-5663	UBERON_EXT:zone_of_skin_or_skin_of_body	denotes	cutaneously
T11450	5684-5693	GO:0007565	denotes	pregnancy
T11451	5712-5719	UBERON:0000922	denotes	embryos
T11452	5756-5762	UBERON:0000995	denotes	uterus
T11453	5790-5795	CL_GO_EXT:cell	denotes	cells
T11454	5887-5893	NCBITaxon:27592	denotes	Bovine
T11455	5894-5899	UBERON:0001977	denotes	Serum
T11456	5932-5943	CHEBI_SO_EXT:amino_acid	denotes	Amino Acids
T11457	5963-5974	CHEBI_EXT:L_glutamine	denotes	L-glutamine
T11458	5965-5974	CHEBI_SO_EXT:glutamine	denotes	glutamine
T11459	5997-6007	CHEBI:17334	denotes	Penicillin
T11460	6008-6020	CHEBI:17076	denotes	Streptomysin
T11461	6047-6064	CHEBI:41218	denotes	2-mercaptoethanol
T11462	6182-6189	PR_EXT:000027795	denotes	trypsin
T11463	6213-6217	CL_GO_EXT:cell	denotes	cell
T11464	6213-6222	UBERON_EXT:cell_clump_or_cluster_or_group_or_mass_or_population	denotes	cell mass
T11465	6334-6341	PR_EXT:000027795	denotes	trypsin
T11466	6347-6352	CL_GO_EXT:cell	denotes	cells
T11467	6365-6375	GO_EXT:biological_movement_or_translocation_process	denotes	transfered
T11468	6440-6447	_FRAGMENT	denotes	primary
T11469	6451-6455	CL:0000001	denotes	cell
T11470	6448-6455	CL:0002322	denotes	ES cell
T11471	6451-6455	CL_GO_EXT:cell	denotes	cell
T11472	6545-6549	CL_GO_EXT:cell	denotes	cell
T11473	6545-6556	UBERON:0000119	denotes	cell layers
T11474	6570-6575	CL_GO_EXT:cell	denotes	cells
T11475	6593-6607	GO_EXT:trypsinization	denotes	trypsinization
T11866	6650-6653	CHEBI_SO_EXT:RNA	denotes	RNA
T11867	6659-6668	SO_EXT:wild_type_entity_or_quality	denotes	wild-type
T11868	6669-6677	CL:0002322	denotes	ES cells
T11869	6672-6677	CL_GO_EXT:cell	denotes	cells
T11870	6682-6686	PR_EXT:000006847	denotes	ESG1
T11871	6686-6687	SO_EXT:sequence_nullness_or_absence	denotes	-
T11872	6688-6689	SO_EXT:sequence_nullness_or_absence	denotes	-
T11873	6690-6698	CL:0002322	denotes	ES cells
T11874	6693-6698	CL_GO_EXT:cell	denotes	cells
T11875	6703-6710	CHEBI_SO_EXT:molecular_label_or_mark_or_tag_process	denotes	labeled
T11876	6716-6719	CHEBI:37987	denotes	Cy3
T11877	6724-6727	CHEBI:37989	denotes	Cy5
T11878	6760-6770	GO:0097617	denotes	hybridized
T11879	6776-6781	NCBITaxon:10088	denotes	Mouse
T11880	6930-6943	GO:0097617	denotes	Hybridization
T11881	6978-6984	SO_EXT:sequence_cloned_entity	denotes	clones
T11882	7039-7047	OBI_SO_EXT:gene_or_genetic_investigation_or_genetic_process	denotes	Genetics
R2890	T10381	T10380	_lexicallyChainedTo	antibodies,Generation of
R3167	T11469	T11468	_lexicallyChainedTo	cell,primary

craft-sa-dev

Id	Subject	Object	Predicate	Lexical cue
T8264	9-23	NN	denotes	Identification
T8265	24-27	CC	denotes	and
T8266	28-36	NNS	denotes	analyses
T8267	37-39	IN	denotes	of
T8268	40-43	NN	denotes	BAC
T8269	44-50	NNS	denotes	clones
T8270	51-61	VBG	denotes	containing
T8271	62-65	DT	denotes	the
T8272	77-81	NN	denotes	gene
T8273	66-71	NN	denotes	mouse
T8274	72-76	NN	denotes	ESG1
T8275	81-351	sentence	denotes	To identify bacterial artificial chromosome (BAC) clones containing mouse ESG1 gene, we performed PCR-based screening of mouse BAC library DNA pools (Research Genetics) using the pH34-u38 (5'-GAAGTCTGGTTCCTTGGCAGG-3') and pH34-L394 (5'-ACTCGATACACTGGCCTAGC-3') primers.
T8276	82-84	TO	denotes	To
T8277	85-93	VB	denotes	identify
T8278	170-179	VBD	denotes	performed
T8279	94-103	JJ	denotes	bacterial
T8280	115-125	NN	denotes	chromosome
T8281	104-114	JJ	denotes	artificial
T8282	132-138	NNS	denotes	clones
T8283	126-127	-LRB-	denotes	(
T8284	127-130	NN	denotes	BAC
T8285	130-131	-RRB-	denotes	)
T8286	139-149	VBG	denotes	containing
T8287	150-155	NN	denotes	mouse
T8288	161-165	NN	denotes	gene
T8289	156-160	NN	denotes	ESG1
T8290	165-167	,	denotes	,
T8291	167-169	PRP	denotes	we
T8292	180-183	NN	denotes	PCR
T8293	184-189	VBN	denotes	based
T8294	183-184	HYPH	denotes	-
T8295	190-199	NN	denotes	screening
T8296	200-202	IN	denotes	of
T8297	203-208	NN	denotes	mouse
T8298	225-230	NNS	denotes	pools
T8299	209-212	NN	denotes	BAC
T8300	213-220	NN	denotes	library
T8301	221-224	NN	denotes	DNA
T8302	231-232	-LRB-	denotes	(
T8303	241-249	NNP	denotes	Genetics
T8304	232-240	NNP	denotes	Research
T8305	249-250	-RRB-	denotes	)
T8306	251-256	VBG	denotes	using
T8307	257-260	DT	denotes	the
T8308	343-350	NNS	denotes	primers
T8309	261-265	NN	denotes	pH34
T8310	266-269	NN	denotes	u38
T8311	265-266	HYPH	denotes	-
T8312	270-271	-LRB-	denotes	(
T8313	296-297	CD	denotes	3
T8314	271-272	CD	denotes	5
T8315	272-273	SYM	denotes	'
T8316	273-274	HYPH	denotes	-
T8317	274-295	NN	denotes	GAAGTCTGGTTCCTTGGCAGG
T8318	295-296	HYPH	denotes	-
T8319	297-298	SYM	denotes	'
T8320	298-299	-RRB-	denotes	)
T8321	300-303	CC	denotes	and
T8322	304-308	NN	denotes	pH34
T8323	309-313	NN	denotes	L394
T8324	308-309	HYPH	denotes	-
T8325	314-315	-LRB-	denotes	(
T8326	339-340	CD	denotes	3
T8327	315-316	CD	denotes	5
T8328	316-317	SYM	denotes	'
T8329	317-318	HYPH	denotes	-
T8330	318-338	NN	denotes	ACTCGATACACTGGCCTAGC
T8331	338-339	HYPH	denotes	-
T8332	340-341	SYM	denotes	'
T8333	341-342	-RRB-	denotes	)
T8334	350-351	.	denotes	.
T8335	351-707	sentence	denotes	Following restriction enzyme digestion, we performed Southern blot analyses of BAC clones as described [20] using the pH34-U258 (5'-CTCGAGTGTACAGTCAAGTGGTTGCTGGGA-3'), pH34-U65 (5'-GTGACCCTCGTGACCCGTAA-3'), pH34-intron1L (5'-CTGCGTGAGAGAAACACCAAACAGGC-3'), pH34-L545 (5'-TGTGAATGGGAAGGTTACCACTCT-3') and pH34-SCL1 (5'-GCCCTCTTCTGGTTTGTCTCGAAAT-3') probes.
T8336	352-361	VBG	denotes	Following
T8337	395-404	VBD	denotes	performed
T8338	362-373	NN	denotes	restriction
T8339	374-380	NN	denotes	enzyme
T8340	381-390	NN	denotes	digestion
T8341	390-392	,	denotes	,
T8342	392-394	PRP	denotes	we
T8343	405-413	NNP	denotes	Southern
T8344	414-418	NN	denotes	blot
T8345	419-427	NNS	denotes	analyses
T8346	428-430	IN	denotes	of
T8347	431-434	NN	denotes	BAC
T8348	435-441	NNS	denotes	clones
T8349	442-444	IN	denotes	as
T8350	445-454	VBN	denotes	described
T8351	455-456	-LRB-	denotes	[
T8352	456-458	CD	denotes	20
T8353	458-459	-RRB-	denotes	]
T8354	460-465	VBG	denotes	using
T8355	466-469	DT	denotes	the
T8356	700-706	NNS	denotes	probes
T8357	470-474	NN	denotes	pH34
T8358	475-479	NN	denotes	U258
T8359	474-475	HYPH	denotes	-
T8360	480-481	-LRB-	denotes	(
T8361	484-514	NN	denotes	CTCGAGTGTACAGTCAAGTGGTTGCTGGGA
T8362	481-482	CD	denotes	5
T8363	482-483	SYM	denotes	'
T8364	483-484	HYPH	denotes	-
T8365	514-515	HYPH	denotes	-
T8366	515-516	CD	denotes	3
T8367	516-517	SYM	denotes	'
T8368	517-518	-RRB-	denotes	)
T8369	518-520	,	denotes	,
T8370	520-524	NN	denotes	pH34
T8371	525-528	NN	denotes	U65
T8372	524-525	HYPH	denotes	-
T8373	529-530	-LRB-	denotes	(
T8374	533-553	NN	denotes	GTGACCCTCGTGACCCGTAA
T8375	530-531	CD	denotes	5
T8376	531-532	SYM	denotes	'
T8377	532-533	HYPH	denotes	-
T8378	553-554	HYPH	denotes	-
T8379	554-555	CD	denotes	3
T8380	555-556	SYM	denotes	'
T8381	556-557	-RRB-	denotes	)
T8382	557-559	,	denotes	,
T8383	559-563	NN	denotes	pH34
T8384	564-572	NN	denotes	intron1L
T8385	563-564	HYPH	denotes	-
T8386	573-574	-LRB-	denotes	(
T8387	577-603	NN	denotes	CTGCGTGAGAGAAACACCAAACAGGC
T8388	574-575	CD	denotes	5
T8389	575-576	SYM	denotes	'
T8390	576-577	HYPH	denotes	-
T8391	603-604	HYPH	denotes	-
T8392	604-605	CD	denotes	3
T8393	605-606	SYM	denotes	'
T8394	606-607	-RRB-	denotes	)
T8395	607-609	,	denotes	,
T8396	609-613	NN	denotes	pH34
T8397	614-618	NN	denotes	L545
T8398	613-614	HYPH	denotes	-
T8399	619-620	-LRB-	denotes	(
T8400	623-647	NN	denotes	TGTGAATGGGAAGGTTACCACTCT
T8401	620-621	CD	denotes	5
T8402	621-622	SYM	denotes	'
T8403	622-623	HYPH	denotes	-
T8404	647-648	HYPH	denotes	-
T8405	648-649	CD	denotes	3
T8406	649-650	SYM	denotes	'
T8407	650-651	-RRB-	denotes	)
T8408	652-655	CC	denotes	and
T8409	656-660	NN	denotes	pH34
T8410	661-665	NN	denotes	SCL1
T8411	660-661	HYPH	denotes	-
T8412	666-667	-LRB-	denotes	(
T8413	670-695	NN	denotes	GCCCTCTTCTGGTTTGTCTCGAAAT
T8414	667-668	CD	denotes	5
T8415	668-669	SYM	denotes	'
T8416	669-670	HYPH	denotes	-
T8417	695-696	HYPH	denotes	-
T8418	696-697	CD	denotes	3
T8419	697-698	SYM	denotes	'
T8420	698-699	-RRB-	denotes	)
T8421	706-707	.	denotes	.
T8422	707-802	sentence	denotes	Hybridization with these probes revealed bands containing either the ESG1 gene or pseudogenes.
T8423	708-721	NN	denotes	Hybridization
T8424	740-748	VBD	denotes	revealed
T8425	722-726	IN	denotes	with
T8426	727-732	DT	denotes	these
T8427	733-739	NNS	denotes	probes
T8428	749-754	NNS	denotes	bands
T8429	755-765	VBG	denotes	containing
T8430	766-772	CC	denotes	either
T8431	782-786	NN	denotes	gene
T8432	773-776	DT	denotes	the
T8433	777-781	NN	denotes	ESG1
T8434	787-789	CC	denotes	or
T8435	790-801	NNS	denotes	pseudogenes
T8436	801-802	.	denotes	.
T8437	802-964	sentence	denotes	To sequence the region containing the mouse ESG1 gene and the 3' flanking region, we subcloned a ~15 kbp XhoI-SalI fragment into the pZERO-2 vector (Invitrogen).
T8438	803-805	TO	denotes	To
T8439	806-814	VB	denotes	sequence
T8440	888-897	VBD	denotes	subcloned
T8441	815-818	DT	denotes	the
T8442	819-825	NN	denotes	region
T8443	826-836	VBG	denotes	containing
T8444	837-840	DT	denotes	the
T8445	852-856	NN	denotes	gene
T8446	841-846	NN	denotes	mouse
T8447	847-851	NN	denotes	ESG1
T8448	857-860	CC	denotes	and
T8449	861-864	DT	denotes	the
T8450	877-883	NN	denotes	region
T8451	865-866	CD	denotes	3
T8452	866-867	SYM	denotes	'
T8453	868-876	NN	denotes	flanking
T8454	883-885	,	denotes	,
T8455	885-887	PRP	denotes	we
T8456	898-899	DT	denotes	a
T8457	918-926	NN	denotes	fragment
T8458	900-901	SYM	denotes	~
T8459	901-903	CD	denotes	15
T8460	904-907	NN	denotes	kbp
T8461	908-912	NN	denotes	XhoI
T8462	913-917	NN	denotes	SalI
T8463	912-913	HYPH	denotes	-
T8464	927-931	IN	denotes	into
T8465	932-935	DT	denotes	the
T8466	944-950	NN	denotes	vector
T8467	936-941	NN	denotes	pZERO
T8468	941-942	HYPH	denotes	-
T8469	942-943	CD	denotes	2
T8470	951-952	-LRB-	denotes	(
T8471	952-962	NNP	denotes	Invitrogen
T8472	962-963	-RRB-	denotes	)
T8473	963-964	.	denotes	.
T8474	964-1072	sentence	denotes	HindIII- or EcoRI-digested fragments of this vector were then cloned into pBluescript KS(-) for sequencing.
T8475	965-972	NN	denotes	HindIII
T8476	983-991	VBN	denotes	digested
T8477	972-973	HYPH	denotes	-
T8478	974-976	CC	denotes	or
T8479	977-982	NN	denotes	EcoRI
T8480	982-983	HYPH	denotes	-
T8481	992-1001	NNS	denotes	fragments
T8482	1027-1033	VBN	denotes	cloned
T8483	1002-1004	IN	denotes	of
T8484	1005-1009	DT	denotes	this
T8485	1010-1016	NN	denotes	vector
T8486	1017-1021	VBD	denotes	were
T8487	1022-1026	RB	denotes	then
T8488	1034-1038	IN	denotes	into
T8489	1039-1050	NN	denotes	pBluescript
T8490	1051-1053	NN	denotes	KS
T8491	1053-1054	-LRB-	denotes	(
T8492	1054-1055	SYM	denotes	-
T8493	1055-1056	-RRB-	denotes	)
T8494	1057-1060	IN	denotes	for
T8495	1061-1071	NN	denotes	sequencing
T8496	1071-1072	.	denotes	.
T8497	1072-1195	sentence	denotes	To sequence the ESG1 pseudogene and the 3' flanking region, an 8 kbp NotI/XhoI fragment was cloned into pBluescript KS(-).
T8498	1073-1075	TO	denotes	To
T8499	1076-1084	VB	denotes	sequence
T8500	1165-1171	VBN	denotes	cloned
T8501	1085-1088	DT	denotes	the
T8502	1094-1104	NN	denotes	pseudogene
T8503	1089-1093	NN	denotes	ESG1
T8504	1105-1108	CC	denotes	and
T8505	1109-1112	DT	denotes	the
T8506	1125-1131	NN	denotes	region
T8507	1113-1114	CD	denotes	3
T8508	1114-1115	SYM	denotes	'
T8509	1116-1124	NN	denotes	flanking
T8510	1131-1133	,	denotes	,
T8511	1133-1135	DT	denotes	an
T8512	1152-1160	NN	denotes	fragment
T8513	1136-1137	CD	denotes	8
T8514	1138-1141	NN	denotes	kbp
T8515	1142-1146	NN	denotes	NotI
T8516	1147-1151	NN	denotes	XhoI
T8517	1146-1147	HYPH	denotes	/
T8518	1161-1164	VBD	denotes	was
T8519	1172-1176	IN	denotes	into
T8520	1177-1188	NN	denotes	pBluescript
T8521	1189-1191	NN	denotes	KS
T8522	1191-1192	-LRB-	denotes	(
T8523	1192-1193	SYM	denotes	-
T8524	1193-1194	-RRB-	denotes	)
T8525	1194-1195	.	denotes	.
T8526	1195-1277	sentence	denotes	BamHI- or PstI- fragments of this vector were also cloned into pBluescript KS(-).
T8527	1196-1201	NN	denotes	BamHI
T8528	1212-1221	NNS	denotes	fragments
T8529	1201-1202	SYM	denotes	-
T8530	1203-1205	CC	denotes	or
T8531	1206-1210	NN	denotes	PstI
T8532	1210-1211	SYM	denotes	-
T8533	1247-1253	VBN	denotes	cloned
T8534	1222-1224	IN	denotes	of
T8535	1225-1229	DT	denotes	this
T8536	1230-1236	NN	denotes	vector
T8537	1237-1241	VBD	denotes	were
T8538	1242-1246	RB	denotes	also
T8539	1254-1258	IN	denotes	into
T8540	1259-1270	NN	denotes	pBluescript
T8541	1271-1273	NN	denotes	KS
T8542	1273-1274	-LRB-	denotes	(
T8543	1274-1275	SYM	denotes	-
T8544	1275-1276	-RRB-	denotes	)
T8545	1276-1277	.	denotes	.
T8546	1277-1502	sentence	denotes	To identify the sequence containing the 5' flanking regions of the ESG1 gene and the related pseudogenes, we used a TOPO walker kit (Invitrogen) with the pH34-T2L (5'-ACTAGTCGCAGCAGGGATCCAGGAATATCT-3') and pH34-L394 primers.
T8547	1278-1280	TO	denotes	To
T8548	1281-1289	VB	denotes	identify
T8549	1387-1391	VBD	denotes	used
T8550	1290-1293	DT	denotes	the
T8551	1294-1302	NN	denotes	sequence
T8552	1303-1313	VBG	denotes	containing
T8553	1314-1317	DT	denotes	the
T8554	1330-1337	NNS	denotes	regions
T8555	1318-1319	CD	denotes	5
T8556	1319-1320	SYM	denotes	'
T8557	1321-1329	NN	denotes	flanking
T8558	1338-1340	IN	denotes	of
T8559	1341-1344	DT	denotes	the
T8560	1350-1354	NN	denotes	gene
T8561	1345-1349	NN	denotes	ESG1
T8562	1355-1358	CC	denotes	and
T8563	1359-1362	DT	denotes	the
T8564	1371-1382	NNS	denotes	pseudogenes
T8565	1363-1370	JJ	denotes	related
T8566	1382-1384	,	denotes	,
T8567	1384-1386	PRP	denotes	we
T8568	1392-1393	DT	denotes	a
T8569	1406-1409	NN	denotes	kit
T8570	1394-1398	NN	denotes	TOPO
T8571	1399-1405	NN	denotes	walker
T8572	1410-1411	-LRB-	denotes	(
T8573	1411-1421	NNP	denotes	Invitrogen
T8574	1421-1422	-RRB-	denotes	)
T8575	1423-1427	IN	denotes	with
T8576	1428-1431	DT	denotes	the
T8577	1494-1501	NNS	denotes	primers
T8578	1432-1436	NN	denotes	pH34
T8579	1437-1440	NN	denotes	T2L
T8580	1436-1437	HYPH	denotes	-
T8581	1441-1442	-LRB-	denotes	(
T8582	1476-1477	CD	denotes	3
T8583	1442-1443	CD	denotes	5
T8584	1443-1444	SYM	denotes	'
T8585	1444-1445	HYPH	denotes	-
T8586	1445-1475	NN	denotes	ACTAGTCGCAGCAGGGATCCAGGAATATCT
T8587	1475-1476	HYPH	denotes	-
T8588	1477-1478	SYM	denotes	'
T8589	1478-1479	-RRB-	denotes	)
T8590	1480-1483	CC	denotes	and
T8591	1484-1488	NN	denotes	pH34
T8592	1489-1493	NN	denotes	L394
T8593	1488-1489	HYPH	denotes	-
T8594	1501-1502	.	denotes	.
T8595	1502-1562	sentence	denotes	The resulting sequence was cloned into pCR2.1 (Invitrogen).
T8596	1503-1506	DT	denotes	The
T8597	1517-1525	NN	denotes	sequence
T8598	1507-1516	VBG	denotes	resulting
T8599	1530-1536	VBN	denotes	cloned
T8600	1526-1529	VBD	denotes	was
T8601	1537-1541	IN	denotes	into
T8602	1542-1548	NN	denotes	pCR2.1
T8603	1549-1550	-LRB-	denotes	(
T8604	1550-1560	NNP	denotes	Invitrogen
T8605	1560-1561	-RRB-	denotes	)
T8606	1561-1562	.	denotes	.
T8607	1562-1735	sentence	denotes	We obtained a ~6 kbp band from the NsiI-digensted library; XbaI-, SpeI-, EcoRI-, and PstI-digested fragments of this band were cloned into pBluescript KS(-) for sequencing.
T8608	1563-1565	PRP	denotes	We
T8609	1566-1574	VBD	denotes	obtained
T8610	1690-1696	VBN	denotes	cloned
T8611	1575-1576	DT	denotes	a
T8612	1584-1588	NN	denotes	band
T8613	1577-1578	SYM	denotes	~
T8614	1578-1579	CD	denotes	6
T8615	1580-1583	NN	denotes	kbp
T8616	1589-1593	IN	denotes	from
T8617	1594-1597	DT	denotes	the
T8618	1613-1620	NN	denotes	library
T8619	1598-1602	NN	denotes	NsiI
T8620	1603-1612	VBN	denotes	digensted
T8621	1602-1603	HYPH	denotes	-
T8622	1620-1621	:	denotes	;
T8623	1622-1626	NN	denotes	XbaI
T8624	1653-1661	VBN	denotes	digested
T8625	1626-1627	HYPH	denotes	-
T8626	1627-1629	,	denotes	,
T8627	1629-1633	NN	denotes	SpeI
T8628	1633-1634	HYPH	denotes	-
T8629	1634-1636	,	denotes	,
T8630	1636-1641	NN	denotes	EcoRI
T8631	1641-1642	HYPH	denotes	-
T8632	1642-1644	,	denotes	,
T8633	1644-1647	CC	denotes	and
T8634	1648-1652	NN	denotes	PstI
T8635	1652-1653	HYPH	denotes	-
T8636	1662-1671	NNS	denotes	fragments
T8637	1672-1674	IN	denotes	of
T8638	1675-1679	DT	denotes	this
T8639	1680-1684	NN	denotes	band
T8640	1685-1689	VBD	denotes	were
T8641	1697-1701	IN	denotes	into
T8642	1702-1713	NN	denotes	pBluescript
T8643	1714-1716	NN	denotes	KS
T8644	1716-1717	-LRB-	denotes	(
T8645	1717-1718	SYM	denotes	-
T8646	1718-1719	-RRB-	denotes	)
T8647	1720-1723	IN	denotes	for
T8648	1724-1734	NN	denotes	sequencing
T8649	1734-1735	.	denotes	.
T8650	1735-1800	sentence	denotes	This fragment contained the 5' flanking region of the ESG1 gene.
T8651	1736-1740	DT	denotes	This
T8652	1741-1749	NN	denotes	fragment
T8653	1750-1759	VBD	denotes	contained
T8654	1760-1763	DT	denotes	the
T8655	1776-1782	NN	denotes	region
T8656	1764-1765	CD	denotes	5
T8657	1765-1766	SYM	denotes	'
T8658	1767-1775	NN	denotes	flanking
T8659	1783-1785	IN	denotes	of
T8660	1786-1789	DT	denotes	the
T8661	1795-1799	NN	denotes	gene
T8662	1790-1794	NN	denotes	ESG1
T8663	1799-1800	.	denotes	.
T8664	1800-1899	sentence	denotes	A ~3 kbp fragment, obtained from the SacI-digested library, was cloned into pCR2.1 for sequencing.
T8665	1801-1802	DT	denotes	A
T8666	1810-1818	NN	denotes	fragment
T8667	1803-1804	SYM	denotes	~
T8668	1804-1805	CD	denotes	3
T8669	1806-1809	NN	denotes	kbp
T8670	1865-1871	VBN	denotes	cloned
T8671	1818-1820	,	denotes	,
T8672	1820-1828	VBN	denotes	obtained
T8673	1829-1833	IN	denotes	from
T8674	1834-1837	DT	denotes	the
T8675	1852-1859	NN	denotes	library
T8676	1838-1842	NN	denotes	SacI
T8677	1843-1851	VBN	denotes	digested
T8678	1842-1843	HYPH	denotes	-
T8679	1859-1861	,	denotes	,
T8680	1861-1864	VBD	denotes	was
T8681	1872-1876	IN	denotes	into
T8682	1877-1883	NN	denotes	pCR2.1
T8683	1884-1887	IN	denotes	for
T8684	1888-1898	NN	denotes	sequencing
T8685	1898-1899	.	denotes	.
T8686	1899-1966	sentence	denotes	This fragment was contained the 5' region flanking the pseudogene.
T8687	1900-1904	DT	denotes	This
T8688	1905-1913	NN	denotes	fragment
T8689	1918-1927	VBN	denotes	contained
T8690	1914-1917	VBD	denotes	was
T8691	1928-1931	DT	denotes	the
T8692	1935-1941	NN	denotes	region
T8693	1932-1933	CD	denotes	5
T8694	1933-1934	SYM	denotes	'
T8695	1942-1950	VBG	denotes	flanking
T8696	1951-1954	DT	denotes	the
T8697	1955-1965	NN	denotes	pseudogene
T8698	1965-1966	.	denotes	.
T9171	1968-1980	NN	denotes	Construction
T9172	1981-1983	IN	denotes	of
T9173	1984-1988	NN	denotes	ESG1
T9174	1999-2006	NNS	denotes	vectors
T9175	1989-1998	NN	denotes	targeting
T9176	2006-2166	sentence	denotes	We replaced all of the ESG1 exons with two targeting vectors containing either an IRES-β-geo cassette [21] or an IRES-HygR cassette by promoter trap selection.
T9177	2007-2009	PRP	denotes	We
T9178	2010-2018	VBD	denotes	replaced
T9179	2019-2022	DT	denotes	all
T9180	2023-2025	IN	denotes	of
T9181	2026-2029	DT	denotes	the
T9182	2035-2040	NNS	denotes	exons
T9183	2030-2034	NN	denotes	ESG1
T9184	2041-2045	IN	denotes	with
T9185	2046-2049	CD	denotes	two
T9186	2060-2067	NNS	denotes	vectors
T9187	2050-2059	NN	denotes	targeting
T9188	2068-2078	VBG	denotes	containing
T9189	2079-2085	CC	denotes	either
T9190	2100-2108	NN	denotes	cassette
T9191	2086-2088	DT	denotes	an
T9192	2089-2093	NN	denotes	IRES
T9193	2096-2099	NN	denotes	geo
T9194	2093-2094	HYPH	denotes	-
T9195	2094-2095	NN	denotes	β
T9196	2095-2096	HYPH	denotes	-
T9197	2109-2110	-LRB-	denotes	[
T9198	2110-2112	CD	denotes	21
T9199	2112-2113	-RRB-	denotes	]
T9200	2114-2116	CC	denotes	or
T9201	2117-2119	DT	denotes	an
T9202	2125-2129	NN	denotes	HygR
T9203	2120-2124	NN	denotes	IRES
T9204	2124-2125	HYPH	denotes	-
T9205	2130-2138	NN	denotes	cassette
T9206	2139-2141	IN	denotes	by
T9207	2142-2150	NN	denotes	promoter
T9208	2151-2155	NN	denotes	trap
T9209	2156-2165	NN	denotes	selection
T9210	2165-2166	.	denotes	.
T9211	2166-2358	sentence	denotes	We amplified the 5' arm (1.8 kbp) using KOD plus (TOYOBO) with the pH34-targetpair5-U (5'-CCGCGGAAAGTCAAGAGATTGGGTGG-3') and pH34-targetpair5-L (5'-GCGGCCGCCTTTACGGGTCACGAGGGTCAC-3') primers.
T9212	2167-2169	PRP	denotes	We
T9213	2170-2179	VBD	denotes	amplified
T9214	2180-2183	DT	denotes	the
T9215	2187-2190	NN	denotes	arm
T9216	2184-2185	CD	denotes	5
T9217	2185-2186	SYM	denotes	'
T9218	2191-2192	-LRB-	denotes	(
T9219	2196-2199	NN	denotes	kbp
T9220	2192-2195	CD	denotes	1.8
T9221	2199-2200	-RRB-	denotes	)
T9222	2201-2206	VBG	denotes	using
T9223	2207-2210	NN	denotes	KOD
T9224	2211-2215	NN	denotes	plus
T9225	2216-2217	-LRB-	denotes	(
T9226	2217-2223	NN	denotes	TOYOBO
T9227	2223-2224	-RRB-	denotes	)
T9228	2225-2229	IN	denotes	with
T9229	2230-2233	DT	denotes	the
T9230	2350-2357	NNS	denotes	primers
T9231	2234-2238	NN	denotes	pH34
T9232	2251-2252	NN	denotes	U
T9233	2238-2239	HYPH	denotes	-
T9234	2239-2250	NN	denotes	targetpair5
T9235	2250-2251	HYPH	denotes	-
T9236	2253-2254	-LRB-	denotes	(
T9237	2257-2283	NN	denotes	CCGCGGAAAGTCAAGAGATTGGGTGG
T9238	2254-2255	CD	denotes	5
T9239	2255-2256	SYM	denotes	'
T9240	2256-2257	HYPH	denotes	-
T9241	2283-2284	HYPH	denotes	-
T9242	2284-2285	CD	denotes	3
T9243	2285-2286	SYM	denotes	'
T9244	2286-2287	-RRB-	denotes	)
T9245	2288-2291	CC	denotes	and
T9246	2292-2296	NN	denotes	pH34
T9247	2309-2310	NN	denotes	L
T9248	2296-2297	HYPH	denotes	-
T9249	2297-2308	NN	denotes	targetpair5
T9250	2308-2309	HYPH	denotes	-
T9251	2311-2312	-LRB-	denotes	(
T9252	2315-2345	NN	denotes	GCGGCCGCCTTTACGGGTCACGAGGGTCAC
T9253	2312-2313	CD	denotes	5
T9254	2313-2314	SYM	denotes	'
T9255	2314-2315	HYPH	denotes	-
T9256	2345-2346	HYPH	denotes	-
T9257	2346-2347	CD	denotes	3
T9258	2347-2348	SYM	denotes	'
T9259	2348-2349	-RRB-	denotes	)
T9260	2357-2358	.	denotes	.
T9261	2358-2524	sentence	denotes	The 3' arm (5.8 kbp) was amplified using the pH34-targetpair3-U (5'-TGTGGCCAGTGTTTGGTTCTGGCGGG-3') and pH34-targetpair3-L (5'-CTCGAGGACTCGCCATTCTAGCCAAG-3') primers.
T9262	2359-2362	DT	denotes	The
T9263	2366-2369	NN	denotes	arm
T9264	2363-2364	CD	denotes	3
T9265	2364-2365	SYM	denotes	'
T9266	2384-2393	VBN	denotes	amplified
T9267	2370-2371	-LRB-	denotes	(
T9268	2375-2378	NN	denotes	kbp
T9269	2371-2374	CD	denotes	5.8
T9270	2378-2379	-RRB-	denotes	)
T9271	2380-2383	VBD	denotes	was
T9272	2394-2399	VBG	denotes	using
T9273	2400-2403	DT	denotes	the
T9274	2516-2523	NNS	denotes	primers
T9275	2404-2408	NN	denotes	pH34
T9276	2421-2422	NN	denotes	U
T9277	2408-2409	HYPH	denotes	-
T9278	2409-2420	NN	denotes	targetpair3
T9279	2420-2421	HYPH	denotes	-
T9280	2423-2424	-LRB-	denotes	(
T9281	2427-2453	NN	denotes	TGTGGCCAGTGTTTGGTTCTGGCGGG
T9282	2424-2425	CD	denotes	5
T9283	2425-2426	SYM	denotes	'
T9284	2426-2427	HYPH	denotes	-
T9285	2453-2454	HYPH	denotes	-
T9286	2454-2455	CD	denotes	3
T9287	2455-2456	SYM	denotes	'
T9288	2456-2457	-RRB-	denotes	)
T9289	2458-2461	CC	denotes	and
T9290	2462-2466	NN	denotes	pH34
T9291	2479-2480	NN	denotes	L
T9292	2466-2467	HYPH	denotes	-
T9293	2467-2478	NN	denotes	targetpair3
T9294	2478-2479	HYPH	denotes	-
T9295	2481-2482	-LRB-	denotes	(
T9296	2485-2511	NN	denotes	CTCGAGGACTCGCCATTCTAGCCAAG
T9297	2482-2483	CD	denotes	5
T9298	2483-2484	SYM	denotes	'
T9299	2484-2485	HYPH	denotes	-
T9300	2511-2512	HYPH	denotes	-
T9301	2512-2513	CD	denotes	3
T9302	2513-2514	SYM	denotes	'
T9303	2514-2515	-RRB-	denotes	)
T9304	2523-2524	.	denotes	.
T9305	2524-2609	sentence	denotes	The IRES β-geo or IRES HygR cassettes were ligated in between the two PCR fragments.
T9306	2525-2528	DT	denotes	The
T9307	2553-2562	NNS	denotes	cassettes
T9308	2529-2533	NN	denotes	IRES
T9309	2536-2539	NN	denotes	geo
T9310	2534-2535	NN	denotes	β
T9311	2535-2536	HYPH	denotes	-
T9312	2540-2542	CC	denotes	or
T9313	2543-2547	NN	denotes	IRES
T9314	2548-2552	NN	denotes	HygR
T9315	2568-2575	VBN	denotes	ligated
T9316	2563-2567	VBD	denotes	were
T9317	2576-2578	IN	denotes	in
T9318	2579-2586	IN	denotes	between
T9319	2587-2590	DT	denotes	the
T9320	2599-2608	NNS	denotes	fragments
T9321	2591-2594	CD	denotes	two
T9322	2595-2598	NN	denotes	PCR
T9323	2608-2609	.	denotes	.
T9324	2609-2678	sentence	denotes	The diphtheria toxin A cassette was placed downstream of the 3' arm.
T9325	2610-2613	DT	denotes	The
T9326	2633-2641	NN	denotes	cassette
T9327	2614-2624	NN	denotes	diphtheria
T9328	2631-2632	NN	denotes	A
T9329	2625-2630	NN	denotes	toxin
T9330	2646-2652	VBN	denotes	placed
T9331	2642-2645	VBD	denotes	was
T9332	2653-2663	RB	denotes	downstream
T9333	2664-2666	IN	denotes	of
T9334	2667-2670	DT	denotes	the
T9335	2674-2677	NN	denotes	arm
T9336	2671-2672	CD	denotes	3
T9337	2672-2673	SYM	denotes	'
T9338	2677-2678	.	denotes	.
T9339	2678-2817	sentence	denotes	After linearization with SacII, these targeting vectors were electroporated into 2.0 × 107 RF8 ES cells [22] using a Gene pulser (BIORAD).
T9340	2679-2684	IN	denotes	After
T9341	2740-2754	VBN	denotes	electroporated
T9342	2685-2698	NN	denotes	linearization
T9343	2699-2703	IN	denotes	with
T9344	2704-2709	NN	denotes	SacII
T9345	2709-2711	,	denotes	,
T9346	2711-2716	DT	denotes	these
T9347	2727-2734	NNS	denotes	vectors
T9348	2717-2726	NN	denotes	targeting
T9349	2735-2739	VBD	denotes	were
T9350	2755-2759	IN	denotes	into
T9351	2760-2763	CD	denotes	2.0
T9352	2766-2769	CD	denotes	107
T9353	2764-2765	SYM	denotes	×
T9354	2777-2782	NNS	denotes	cells
T9355	2770-2773	NN	denotes	RF8
T9356	2774-2776	NN	denotes	ES
T9357	2783-2784	-LRB-	denotes	[
T9358	2784-2786	CD	denotes	22
T9359	2786-2787	-RRB-	denotes	]
T9360	2788-2793	VBG	denotes	using
T9361	2794-2795	DT	denotes	a
T9362	2801-2807	NN	denotes	pulser
T9363	2796-2800	NN	denotes	Gene
T9364	2808-2809	-LRB-	denotes	(
T9365	2809-2815	NNP	denotes	BIORAD
T9366	2815-2816	-RRB-	denotes	)
T9367	2816-2817	.	denotes	.
T9368	2817-2910	sentence	denotes	Transfected cells were selected with 250 μg/mL G418 or 100 μg/mL hygromycin B, respectively.
T9369	2818-2829	VBN	denotes	Transfected
T9370	2830-2835	NNS	denotes	cells
T9371	2841-2849	VBN	denotes	selected
T9372	2836-2840	VBD	denotes	were
T9373	2850-2854	IN	denotes	with
T9374	2855-2858	CD	denotes	250
T9375	2859-2861	NN	denotes	μg
T9376	2865-2869	NN	denotes	G418
T9377	2861-2862	SYM	denotes	/
T9378	2862-2864	NN	denotes	mL
T9379	2870-2872	CC	denotes	or
T9380	2873-2876	CD	denotes	100
T9381	2877-2879	NN	denotes	μg
T9382	2894-2895	NN	denotes	B
T9383	2879-2880	SYM	denotes	/
T9384	2880-2882	NN	denotes	mL
T9385	2883-2893	NN	denotes	hygromycin
T9386	2895-2897	,	denotes	,
T9387	2897-2909	RB	denotes	respectively
T9388	2909-2910	.	denotes	.
T9389	2910-3032	sentence	denotes	Genomic DNA from G418- or hygromycin B-resistant colonies was screened for homologous recombination by Southern blotting.
T9390	2911-2918	JJ	denotes	Genomic
T9391	2919-2922	NN	denotes	DNA
T9392	2973-2981	VBN	denotes	screened
T9393	2923-2927	IN	denotes	from
T9394	2928-2932	NN	denotes	G418
T9395	2950-2959	JJ	denotes	resistant
T9396	2932-2933	HYPH	denotes	-
T9397	2934-2936	CC	denotes	or
T9398	2937-2947	NN	denotes	hygromycin
T9399	2948-2949	NN	denotes	B
T9400	2949-2950	HYPH	denotes	-
T9401	2960-2968	NNS	denotes	colonies
T9402	2969-2972	VBD	denotes	was
T9403	2982-2985	IN	denotes	for
T9404	2986-2996	JJ	denotes	homologous
T9405	2997-3010	NN	denotes	recombination
T9406	3011-3013	IN	denotes	by
T9407	3014-3022	NNP	denotes	Southern
T9408	3023-3031	NN	denotes	blotting
T9409	3031-3032	.	denotes	.
T9832	3034-3042	NNP	denotes	Southern
T9833	3043-3047	NN	denotes	blot
T9834	3048-3057	NN	denotes	screening
T9835	3058-3061	IN	denotes	for
T9836	3062-3072	JJ	denotes	homologous
T9837	3073-3086	NN	denotes	recombination
T9838	3086-3174	sentence	denotes	ES cells genomic DNA was extracted with PUREGENE™ Cell Lysis Solution (Gentra systems).
T9839	3087-3089	NN	denotes	ES
T9840	3090-3095	NNS	denotes	cells
T9841	3104-3107	NN	denotes	DNA
T9842	3096-3103	JJ	denotes	genomic
T9843	3112-3121	VBN	denotes	extracted
T9844	3108-3111	VBD	denotes	was
T9845	3122-3126	IN	denotes	with
T9846	3127-3135	NNP	denotes	PUREGENE
T9847	3148-3156	NN	denotes	Solution
T9848	3135-3136	SYM	denotes	™
T9849	3137-3141	NN	denotes	Cell
T9850	3142-3147	NN	denotes	Lysis
T9851	3157-3158	-LRB-	denotes	(
T9852	3165-3172	NNPS	denotes	systems
T9853	3158-3164	NNP	denotes	Gentra
T9854	3172-3173	-RRB-	denotes	)
T9855	3173-3174	.	denotes	.
T9856	3174-3340	sentence	denotes	For 5' Southern blot analysis, genomic DNA was first digested with PstI, then separated on an 0.8% agarose gel and transferred to a nylon membrane as described [20].
T9857	3175-3178	IN	denotes	For
T9858	3228-3236	VBN	denotes	digested
T9859	3179-3180	CD	denotes	5
T9860	3196-3204	NN	denotes	analysis
T9861	3180-3181	SYM	denotes	'
T9862	3182-3190	NNP	denotes	Southern
T9863	3191-3195	NN	denotes	blot
T9864	3204-3206	,	denotes	,
T9865	3206-3213	JJ	denotes	genomic
T9866	3214-3217	NN	denotes	DNA
T9867	3218-3221	VBD	denotes	was
T9868	3222-3227	RB	denotes	first
T9869	3237-3241	IN	denotes	with
T9870	3242-3246	NN	denotes	PstI
T9871	3246-3248	,	denotes	,
T9872	3248-3252	RB	denotes	then
T9873	3253-3262	VBN	denotes	separated
T9874	3263-3265	IN	denotes	on
T9875	3266-3268	DT	denotes	an
T9876	3282-3285	NN	denotes	gel
T9877	3269-3272	CD	denotes	0.8
T9878	3272-3273	NN	denotes	%
T9879	3274-3281	NN	denotes	agarose
T9880	3286-3289	CC	denotes	and
T9881	3290-3301	VBN	denotes	transferred
T9882	3302-3304	IN	denotes	to
T9883	3305-3306	DT	denotes	a
T9884	3313-3321	NN	denotes	membrane
T9885	3307-3312	NN	denotes	nylon
T9886	3322-3324	IN	denotes	as
T9887	3325-3334	VBN	denotes	described
T9888	3335-3336	-LRB-	denotes	[
T9889	3336-3338	CD	denotes	20
T9890	3338-3339	-RRB-	denotes	]
T9891	3339-3340	.	denotes	.
T9892	3340-3477	sentence	denotes	A 560 bp 5' probe was amplified using the ESG1S5 (5'- GATGGTGGTGGTGACTCAGAG -3') and ESG1AS5 as (5'- CCTCCATTGCCTCTATATCAG -3') primers.
T9893	3341-3342	DT	denotes	A
T9894	3353-3358	NN	denotes	probe
T9895	3343-3346	CD	denotes	560
T9896	3347-3349	NN	denotes	bp
T9897	3350-3351	CD	denotes	5
T9898	3351-3352	SYM	denotes	'
T9899	3363-3372	VBN	denotes	amplified
T9900	3359-3362	VBD	denotes	was
T9901	3373-3378	VBG	denotes	using
T9902	3379-3382	DT	denotes	the
T9903	3383-3389	NN	denotes	ESG1S5
T9904	3390-3391	-LRB-	denotes	(
T9905	3395-3416	NN	denotes	GATGGTGGTGGTGACTCAGAG
T9906	3391-3392	CD	denotes	5
T9907	3392-3393	SYM	denotes	'
T9908	3393-3394	HYPH	denotes	-
T9909	3417-3418	HYPH	denotes	-
T9910	3418-3419	CD	denotes	3
T9911	3419-3420	SYM	denotes	'
T9912	3420-3421	-RRB-	denotes	)
T9913	3422-3425	CC	denotes	and
T9914	3426-3433	NN	denotes	ESG1AS5
T9915	3434-3436	IN	denotes	as
T9916	3437-3438	-LRB-	denotes	(
T9917	3469-3476	NNS	denotes	primers
T9918	3438-3439	CD	denotes	5
T9919	3442-3463	NN	denotes	CCTCCATTGCCTCTATATCAG
T9920	3439-3440	SYM	denotes	'
T9921	3440-3441	HYPH	denotes	-
T9922	3464-3465	HYPH	denotes	-
T9923	3465-3466	CD	denotes	3
T9924	3466-3467	SYM	denotes	'
T9925	3467-3468	-RRB-	denotes	)
T9926	3476-3477	.	denotes	.
T9927	3477-3624	sentence	denotes	The probe specifically labeled an 18 kbp band from the wild-type locus, a 15 kbp band from the β-geo locus, and a 12 kbp band from the HygR locus.
T9928	3478-3481	DT	denotes	The
T9929	3482-3487	NN	denotes	probe
T9930	3501-3508	VBD	denotes	labeled
T9931	3488-3500	RB	denotes	specifically
T9932	3509-3511	DT	denotes	an
T9933	3519-3523	NN	denotes	band
T9934	3512-3514	CD	denotes	18
T9935	3515-3518	NN	denotes	kbp
T9936	3524-3528	IN	denotes	from
T9937	3529-3532	DT	denotes	the
T9938	3543-3548	NN	denotes	locus
T9939	3533-3537	JJ	denotes	wild
T9940	3537-3538	HYPH	denotes	-
T9941	3538-3542	NN	denotes	type
T9942	3548-3550	,	denotes	,
T9943	3550-3551	DT	denotes	a
T9944	3559-3563	NN	denotes	band
T9945	3552-3554	CD	denotes	15
T9946	3555-3558	NN	denotes	kbp
T9947	3564-3568	IN	denotes	from
T9948	3569-3572	DT	denotes	the
T9949	3579-3584	NN	denotes	locus
T9950	3573-3574	NN	denotes	β
T9951	3575-3578	NN	denotes	geo
T9952	3574-3575	HYPH	denotes	-
T9953	3584-3586	,	denotes	,
T9954	3586-3589	CC	denotes	and
T9955	3590-3591	DT	denotes	a
T9956	3599-3603	NN	denotes	band
T9957	3592-3594	CD	denotes	12
T9958	3595-3598	NN	denotes	kbp
T9959	3604-3608	IN	denotes	from
T9960	3609-3612	DT	denotes	the
T9961	3618-3623	NN	denotes	locus
T9962	3613-3617	NN	denotes	HygR
T9963	3623-3624	.	denotes	.
T9964	3624-3695	sentence	denotes	Genomic DNA was also digested with SpeI for 3' Southern blot analysis.
T9965	3625-3632	JJ	denotes	Genomic
T9966	3633-3636	NN	denotes	DNA
T9967	3646-3654	VBN	denotes	digested
T9968	3637-3640	VBD	denotes	was
T9969	3641-3645	RB	denotes	also
T9970	3655-3659	IN	denotes	with
T9971	3660-3664	NN	denotes	SpeI
T9972	3665-3668	IN	denotes	for
T9973	3669-3670	CD	denotes	3
T9974	3686-3694	NN	denotes	analysis
T9975	3670-3671	SYM	denotes	'
T9976	3672-3680	NNP	denotes	Southern
T9977	3681-3685	NN	denotes	blot
T9978	3694-3695	.	denotes	.
T9979	3695-3842	sentence	denotes	A 1,010 bp 3' probe was amplified with the pH34U-8000 (5'- CCAACCAGCCAGAGTTTCAGTTAT -3') and pH34L-9000 (5'-GATAAGCTGCTGCCAAAAGACAAG -3') primers.
T9980	3696-3697	DT	denotes	A
T9981	3710-3715	NN	denotes	probe
T9982	3698-3703	CD	denotes	1,010
T9983	3704-3706	NN	denotes	bp
T9984	3707-3708	CD	denotes	3
T9985	3708-3709	SYM	denotes	'
T9986	3720-3729	VBN	denotes	amplified
T9987	3716-3719	VBD	denotes	was
T9988	3730-3734	IN	denotes	with
T9989	3735-3738	DT	denotes	the
T9990	3834-3841	NNS	denotes	primers
T9991	3739-3744	NN	denotes	pH34U
T9992	3744-3745	HYPH	denotes	-
T9993	3745-3749	CD	denotes	8000
T9994	3750-3751	-LRB-	denotes	(
T9995	3755-3779	NN	denotes	CCAACCAGCCAGAGTTTCAGTTAT
T9996	3751-3752	CD	denotes	5
T9997	3752-3753	SYM	denotes	'
T9998	3753-3754	HYPH	denotes	-
T9999	3780-3781	HYPH	denotes	-
T10000	3781-3782	CD	denotes	3
T10001	3782-3783	SYM	denotes	'
T10002	3783-3784	-RRB-	denotes	)
T10003	3785-3788	CC	denotes	and
T10004	3789-3794	NN	denotes	pH34L
T10005	3794-3795	HYPH	denotes	-
T10006	3795-3799	CD	denotes	9000
T10007	3800-3801	-LRB-	denotes	(
T10008	3804-3828	NN	denotes	GATAAGCTGCTGCCAAAAGACAAG
T10009	3801-3802	CD	denotes	5
T10010	3802-3803	SYM	denotes	'
T10011	3803-3804	HYPH	denotes	-
T10012	3829-3830	HYPH	denotes	-
T10013	3830-3831	CD	denotes	3
T10014	3831-3832	SYM	denotes	'
T10015	3832-3833	-RRB-	denotes	)
T10016	3841-3842	.	denotes	.
T10017	3842-3987	sentence	denotes	The probe hybridized to an 11.5 kbp band from the wild-type locus, a 12.5 kbp band from the β-geo locus, and a 9.5 kbp band from the HygR locus.
T10018	3843-3846	DT	denotes	The
T10019	3847-3852	NN	denotes	probe
T10020	3853-3863	VBD	denotes	hybridized
T10021	3864-3866	IN	denotes	to
T10022	3867-3869	DT	denotes	an
T10023	3879-3883	NN	denotes	band
T10024	3870-3874	CD	denotes	11.5
T10025	3875-3878	NN	denotes	kbp
T10026	3884-3888	IN	denotes	from
T10027	3889-3892	DT	denotes	the
T10028	3903-3908	NN	denotes	locus
T10029	3893-3897	JJ	denotes	wild
T10030	3898-3902	NN	denotes	type
T10031	3897-3898	HYPH	denotes	-
T10032	3908-3910	,	denotes	,
T10033	3910-3911	DT	denotes	a
T10034	3921-3925	NN	denotes	band
T10035	3912-3916	CD	denotes	12.5
T10036	3917-3920	NN	denotes	kbp
T10037	3926-3930	IN	denotes	from
T10038	3931-3934	DT	denotes	the
T10039	3941-3946	NN	denotes	locus
T10040	3935-3936	NN	denotes	β
T10041	3937-3940	NN	denotes	geo
T10042	3936-3937	HYPH	denotes	-
T10043	3946-3948	,	denotes	,
T10044	3948-3951	CC	denotes	and
T10045	3952-3953	DT	denotes	a
T10046	3962-3966	NN	denotes	band
T10047	3954-3957	CD	denotes	9.5
T10048	3958-3961	NN	denotes	kbp
T10049	3967-3971	IN	denotes	from
T10050	3972-3975	DT	denotes	the
T10051	3981-3986	NN	denotes	locus
T10052	3976-3980	NN	denotes	HygR
T10053	3986-3987	.	denotes	.
T10414	3989-3999	NN	denotes	Generation
T10415	4000-4002	IN	denotes	of
T10416	4003-4012	JJ	denotes	anti-ESG1
T10417	4024-4034	NNS	denotes	antibodies
T10418	4013-4023	JJ	denotes	polyclonal
T10419	4034-4211	sentence	denotes	The coding sequence of Esg1 was amplified by PCR with the pH34-gw-s (5'- AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA-3') and pH34-gw-as (5'- AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA-3') primers.
T10420	4035-4038	DT	denotes	The
T10421	4046-4054	NN	denotes	sequence
T10422	4039-4045	VBG	denotes	coding
T10423	4067-4076	VBN	denotes	amplified
T10424	4055-4057	IN	denotes	of
T10425	4058-4062	NN	denotes	Esg1
T10426	4063-4066	VBD	denotes	was
T10427	4077-4079	IN	denotes	by
T10428	4080-4083	NN	denotes	PCR
T10429	4084-4088	IN	denotes	with
T10430	4089-4092	DT	denotes	the
T10431	4203-4210	NNS	denotes	primers
T10432	4093-4097	NN	denotes	pH34
T10433	4101-4102	NN	denotes	s
T10434	4097-4098	HYPH	denotes	-
T10435	4098-4100	NN	denotes	gw
T10436	4100-4101	HYPH	denotes	-
T10437	4103-4104	-LRB-	denotes	(
T10438	4108-4141	NN	denotes	AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA
T10439	4104-4105	CD	denotes	5
T10440	4105-4106	SYM	denotes	'
T10441	4106-4107	HYPH	denotes	-
T10442	4141-4142	HYPH	denotes	-
T10443	4142-4143	CD	denotes	3
T10444	4143-4144	SYM	denotes	'
T10445	4144-4145	-RRB-	denotes	)
T10446	4146-4149	CC	denotes	and
T10447	4150-4154	NN	denotes	pH34
T10448	4158-4160	NN	denotes	as
T10449	4154-4155	HYPH	denotes	-
T10450	4155-4157	NN	denotes	gw
T10451	4157-4158	HYPH	denotes	-
T10452	4161-4162	-LRB-	denotes	(
T10453	4166-4198	NN	denotes	AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA
T10454	4162-4163	CD	denotes	5
T10455	4163-4164	SYM	denotes	'
T10456	4164-4165	HYPH	denotes	-
T10457	4198-4199	HYPH	denotes	-
T10458	4199-4200	CD	denotes	3
T10459	4200-4201	SYM	denotes	'
T10460	4201-4202	-RRB-	denotes	)
T10461	4210-4211	.	denotes	.
T10462	4211-4304	sentence	denotes	To construct pDONR-pH34, the resulting PCR product was subcloned into pDONR201 (Invitrogen).
T10463	4212-4214	TO	denotes	To
T10464	4215-4224	VB	denotes	construct
T10465	4267-4276	VBN	denotes	subcloned
T10466	4225-4230	NN	denotes	pDONR
T10467	4231-4235	NN	denotes	pH34
T10468	4230-4231	HYPH	denotes	-
T10469	4235-4237	,	denotes	,
T10470	4237-4240	DT	denotes	the
T10471	4255-4262	NN	denotes	product
T10472	4241-4250	VBG	denotes	resulting
T10473	4251-4254	NN	denotes	PCR
T10474	4263-4266	VBD	denotes	was
T10475	4277-4281	IN	denotes	into
T10476	4282-4290	NN	denotes	pDONR201
T10477	4291-4292	-LRB-	denotes	(
T10478	4292-4302	NNP	denotes	Invitrogen
T10479	4302-4303	-RRB-	denotes	)
T10480	4303-4304	.	denotes	.
T10481	4304-4377	sentence	denotes	pDONR-pH34 was interacted with pDEST17 (Invitrogen) by LR recombination.
T10482	4305-4310	NN	denotes	pDONR
T10483	4311-4315	NN	denotes	pH34
T10484	4310-4311	HYPH	denotes	-
T10485	4320-4330	VBN	denotes	interacted
T10486	4316-4319	VBD	denotes	was
T10487	4331-4335	IN	denotes	with
T10488	4336-4343	NN	denotes	pDEST17
T10489	4344-4345	-LRB-	denotes	(
T10490	4345-4355	NNP	denotes	Invitrogen
T10491	4355-4356	-RRB-	denotes	)
T10492	4357-4359	IN	denotes	by
T10493	4360-4362	NN	denotes	LR
T10494	4363-4376	NN	denotes	recombination
T10495	4376-4377	.	denotes	.
T10496	4377-4563	sentence	denotes	After introduction of the resulting expression vector pDEST17-pH34 into BL21-AI E. coli (Invitrogen), recombinant protein production was induced according to the manufacture's protocol.
T10497	4378-4383	IN	denotes	After
T10498	4515-4522	VBN	denotes	induced
T10499	4384-4396	NN	denotes	introduction
T10500	4397-4399	IN	denotes	of
T10501	4400-4403	DT	denotes	the
T10502	4425-4431	NN	denotes	vector
T10503	4404-4413	VBG	denotes	resulting
T10504	4414-4424	NN	denotes	expression
T10505	4432-4439	NN	denotes	pDEST17
T10506	4440-4444	NN	denotes	pH34
T10507	4439-4440	HYPH	denotes	-
T10508	4445-4449	IN	denotes	into
T10509	4450-4454	NN	denotes	BL21
T10510	4455-4457	NN	denotes	AI
T10511	4454-4455	HYPH	denotes	-
T10512	4458-4460	FW	denotes	E.
T10513	4461-4465	FW	denotes	coli
T10514	4466-4467	-LRB-	denotes	(
T10515	4467-4477	NNP	denotes	Invitrogen
T10516	4477-4478	-RRB-	denotes	)
T10517	4478-4480	,	denotes	,
T10518	4480-4491	JJ	denotes	recombinant
T10519	4492-4499	NN	denotes	protein
T10520	4500-4510	NN	denotes	production
T10521	4511-4514	VBD	denotes	was
T10522	4523-4532	VBG	denotes	according
T10523	4533-4535	IN	denotes	to
T10524	4536-4539	DT	denotes	the
T10525	4540-4551	NN	denotes	manufacture
T10526	4554-4562	NN	denotes	protocol
T10527	4551-4553	POS	denotes	's
T10528	4562-4563	.	denotes	.
T10529	4563-4703	sentence	denotes	Histidine-tagged ESG1 was purified using Ni-nitrilotriacetic acid agarose (Qiagen) under denaturing conditions in the presence of 8 M urea.
T10530	4564-4573	NN	denotes	Histidine
T10531	4574-4580	VBN	denotes	tagged
T10532	4573-4574	HYPH	denotes	-
T10533	4581-4585	NN	denotes	ESG1
T10534	4590-4598	VBN	denotes	purified
T10535	4586-4589	VBD	denotes	was
T10536	4599-4604	VBG	denotes	using
T10537	4605-4607	NN	denotes	Ni
T10538	4630-4637	NN	denotes	agarose
T10539	4607-4608	:	denotes	-
T10540	4608-4624	JJ	denotes	nitrilotriacetic
T10541	4625-4629	NN	denotes	acid
T10542	4638-4639	-LRB-	denotes	(
T10543	4639-4645	NNP	denotes	Qiagen
T10544	4645-4646	-RRB-	denotes	)
T10545	4647-4652	IN	denotes	under
T10546	4653-4663	NN	denotes	denaturing
T10547	4664-4674	NNS	denotes	conditions
T10548	4675-4677	IN	denotes	in
T10549	4678-4681	DT	denotes	the
T10550	4682-4690	NN	denotes	presence
T10551	4691-4693	IN	denotes	of
T10552	4694-4695	CD	denotes	8
T10553	4696-4697	NN	denotes	M
T10554	4698-4702	NN	denotes	urea
T10555	4702-4703	.	denotes	.
T10556	4703-4851	sentence	denotes	After dialysis against 6 M urea, the recombinant proteins were injected into New Zealand White rabbits to generate anti-ESG1 polyclonal antibodies.
T10557	4704-4709	IN	denotes	After
T10558	4767-4775	VBN	denotes	injected
T10559	4710-4718	NN	denotes	dialysis
T10560	4719-4726	IN	denotes	against
T10561	4727-4728	CD	denotes	6
T10562	4729-4730	NN	denotes	M
T10563	4731-4735	NN	denotes	urea
T10564	4735-4737	,	denotes	,
T10565	4737-4740	DT	denotes	the
T10566	4753-4761	NN	denotes	proteins
T10567	4741-4752	JJ	denotes	recombinant
T10568	4762-4766	VBD	denotes	were
T10569	4776-4780	IN	denotes	into
T10570	4781-4784	NNP	denotes	New
T10571	4785-4792	NNP	denotes	Zealand
T10572	4799-4806	NNS	denotes	rabbits
T10573	4793-4798	JJ	denotes	White
T10574	4807-4809	TO	denotes	to
T10575	4810-4818	VB	denotes	generate
T10576	4819-4828	JJ	denotes	anti-ESG1
T10577	4840-4850	NNS	denotes	antibodies
T10578	4829-4839	JJ	denotes	polyclonal
T10579	4850-4851	.	denotes	.
T10856	4853-4860	NNP	denotes	Western
T10857	4861-4865	NN	denotes	blot
T10858	4865-5070	sentence	denotes	After preparation of ES cell extracts with M-Per (Pierce), cellular proteins were separated on sodium dodecyl sulfate (SDS)-14% polyacrylamide gels and transferred to nitrocellulose membranes (Millipore).
T10859	4866-4871	IN	denotes	After
T10860	4948-4957	VBN	denotes	separated
T10861	4872-4883	NN	denotes	preparation
T10862	4884-4886	IN	denotes	of
T10863	4887-4889	NN	denotes	ES
T10864	4895-4903	NNS	denotes	extracts
T10865	4890-4894	NN	denotes	cell
T10866	4904-4908	IN	denotes	with
T10867	4909-4910	NN	denotes	M
T10868	4911-4914	NN	denotes	Per
T10869	4910-4911	HYPH	denotes	-
T10870	4915-4916	-LRB-	denotes	(
T10871	4916-4922	NNP	denotes	Pierce
T10872	4922-4923	-RRB-	denotes	)
T10873	4923-4925	,	denotes	,
T10874	4925-4933	JJ	denotes	cellular
T10875	4934-4942	NN	denotes	proteins
T10876	4943-4947	VBD	denotes	were
T10877	4958-4960	IN	denotes	on
T10878	4961-4967	NN	denotes	sodium
T10879	4976-4983	NN	denotes	sulfate
T10880	4968-4975	NN	denotes	dodecyl
T10881	5009-5013	NNS	denotes	gels
T10882	4984-4985	-LRB-	denotes	(
T10883	4985-4988	NN	denotes	SDS
T10884	4988-4989	-RRB-	denotes	)
T10885	4989-4990	HYPH	denotes	-
T10886	4990-4992	CD	denotes	14
T10887	4992-4993	NN	denotes	%
T10888	4994-5008	NN	denotes	polyacrylamide
T10889	5014-5017	CC	denotes	and
T10890	5018-5029	VBN	denotes	transferred
T10891	5030-5032	IN	denotes	to
T10892	5033-5047	NN	denotes	nitrocellulose
T10893	5048-5057	NNS	denotes	membranes
T10894	5058-5059	-LRB-	denotes	(
T10895	5059-5068	NNP	denotes	Millipore
T10896	5068-5069	-RRB-	denotes	)
T10897	5069-5070	.	denotes	.
T10898	5070-5267	sentence	denotes	Membranes were incubated with anti-ESG1 (1/500 dilution), anti-Oct3/4 (1/500; Santa Cruz Biotechnology), anti-CDK4 (1/200; Santa Cruz Biotechnology), and anti-GFP (1/1000; MBL) primary antibodies.
T10899	5071-5080	NNS	denotes	Membranes
T10900	5086-5095	VBN	denotes	incubated
T10901	5081-5085	VBD	denotes	were
T10902	5096-5100	IN	denotes	with
T10903	5101-5110	NN	denotes	anti-ESG1
T10904	5256-5266	NNS	denotes	antibodies
T10905	5111-5112	-LRB-	denotes	(
T10906	5118-5126	NN	denotes	dilution
T10907	5112-5113	CD	denotes	1
T10908	5114-5117	CD	denotes	500
T10909	5113-5114	SYM	denotes	/
T10910	5126-5127	-RRB-	denotes	)
T10911	5127-5129	,	denotes	,
T10912	5129-5138	NN	denotes	anti-Oct3
T10913	5138-5139	HYPH	denotes	/
T10914	5139-5140	CD	denotes	4
T10915	5141-5142	-LRB-	denotes	(
T10916	5160-5173	NNP	denotes	Biotechnology
T10917	5142-5143	CD	denotes	1
T10918	5144-5147	CD	denotes	500
T10919	5143-5144	SYM	denotes	/
T10920	5147-5148	:	denotes	;
T10921	5149-5154	NNP	denotes	Santa
T10922	5155-5159	NNP	denotes	Cruz
T10923	5173-5174	-RRB-	denotes	)
T10924	5174-5176	,	denotes	,
T10925	5176-5185	NN	denotes	anti-CDK4
T10926	5186-5187	-LRB-	denotes	(
T10927	5205-5218	NNP	denotes	Biotechnology
T10928	5187-5188	CD	denotes	1
T10929	5189-5192	CD	denotes	200
T10930	5188-5189	SYM	denotes	/
T10931	5192-5193	:	denotes	;
T10932	5194-5199	NNP	denotes	Santa
T10933	5200-5204	NNP	denotes	Cruz
T10934	5218-5219	-RRB-	denotes	)
T10935	5219-5221	,	denotes	,
T10936	5221-5224	CC	denotes	and
T10937	5225-5233	NN	denotes	anti-GFP
T10938	5234-5235	-LRB-	denotes	(
T10939	5243-5246	NN	denotes	MBL
T10940	5235-5236	CD	denotes	1
T10941	5237-5241	CD	denotes	1000
T10942	5236-5237	:	denotes	/
T10943	5241-5242	:	denotes	;
T10944	5246-5247	-RRB-	denotes	)
T10945	5248-5255	JJ	denotes	primary
T10946	5266-5267	.	denotes	.
T10947	5267-5407	sentence	denotes	Horseradish peroxidase-conjugated anti-rabbit and anti-mouse immunoglobulins (1/5000; Cell Signaling) were used to detect antibody binding.
T10948	5268-5279	NN	denotes	Horseradish
T10949	5280-5290	NN	denotes	peroxidase
T10950	5291-5301	VBN	denotes	conjugated
T10951	5290-5291	HYPH	denotes	-
T10952	5329-5344	NNS	denotes	immunoglobulins
T10953	5302-5313	JJ	denotes	anti-rabbit
T10954	5314-5317	CC	denotes	and
T10955	5318-5328	JJ	denotes	anti-mouse
T10956	5375-5379	VBN	denotes	used
T10957	5345-5346	-LRB-	denotes	(
T10958	5359-5368	NN	denotes	Signaling
T10959	5346-5347	CD	denotes	1
T10960	5348-5352	CD	denotes	5000
T10961	5347-5348	SYM	denotes	/
T10962	5352-5353	:	denotes	;
T10963	5354-5358	NN	denotes	Cell
T10964	5368-5369	-RRB-	denotes	)
T10965	5370-5374	VBD	denotes	were
T10966	5380-5382	TO	denotes	to
T10967	5383-5389	VB	denotes	detect
T10968	5390-5398	NN	denotes	antibody
T10969	5399-5406	NN	denotes	binding
T10970	5406-5407	.	denotes	.
T10971	5407-5494	sentence	denotes	We visualized bound antibody with an ECL Western Blotting Detection System (Amersham).
T10972	5408-5410	PRP	denotes	We
T10973	5411-5421	VBD	denotes	visualized
T10974	5422-5427	VBN	denotes	bound
T10975	5428-5436	NN	denotes	antibody
T10976	5437-5441	IN	denotes	with
T10977	5442-5444	DT	denotes	an
T10978	5476-5482	NNP	denotes	System
T10979	5445-5448	NNP	denotes	ECL
T10980	5449-5456	NNP	denotes	Western
T10981	5457-5465	NNP	denotes	Blotting
T10982	5466-5475	NNP	denotes	Detection
T10983	5483-5484	-LRB-	denotes	(
T10984	5484-5492	NNP	denotes	Amersham
T10985	5492-5493	-RRB-	denotes	)
T10986	5493-5494	.	denotes	.
T11476	5496-5506	NN	denotes	Derivation
T11477	5507-5509	IN	denotes	of
T11478	5510-5514	NN	denotes	ESG1
T11479	5515-5524	JJ	denotes	deficient
T11480	5514-5515	HYPH	denotes	-
T11481	5528-5533	NNS	denotes	cells
T11482	5525-5527	NN	denotes	ES
T11483	5534-5538	IN	denotes	from
T11484	5539-5550	NNS	denotes	blastocysts
T11485	5550-5694	sentence	denotes	Esg1+/-or ESG1-/- mutant female mice were injected with Tamoxifen (10 μg) and Depo-provera (1 mg) subcutaneously on the third day of pregnancy.
T11486	5551-5555	NN	denotes	Esg1
T11487	5583-5587	NNS	denotes	mice
T11488	5555-5556	SYM	denotes	+
T11489	5556-5557	HYPH	denotes	/
T11490	5557-5558	SYM	denotes	-
T11491	5558-5560	CC	denotes	or
T11492	5561-5565	NN	denotes	ESG1
T11493	5565-5566	SYM	denotes	-
T11494	5566-5567	HYPH	denotes	/
T11495	5567-5568	SYM	denotes	-
T11496	5569-5575	NN	denotes	mutant
T11497	5576-5582	JJ	denotes	female
T11498	5593-5601	VBN	denotes	injected
T11499	5588-5592	VBD	denotes	were
T11500	5602-5606	IN	denotes	with
T11501	5607-5616	NN	denotes	Tamoxifen
T11502	5617-5618	-LRB-	denotes	(
T11503	5621-5623	NN	denotes	μg
T11504	5618-5620	CD	denotes	10
T11505	5623-5624	-RRB-	denotes	)
T11506	5625-5628	CC	denotes	and
T11507	5629-5633	NN	denotes	Depo
T11508	5634-5641	NN	denotes	provera
T11509	5633-5634	HYPH	denotes	-
T11510	5642-5643	-LRB-	denotes	(
T11511	5645-5647	NN	denotes	mg
T11512	5643-5644	CD	denotes	1
T11513	5647-5648	-RRB-	denotes	)
T11514	5649-5663	RB	denotes	subcutaneously
T11515	5664-5666	IN	denotes	on
T11516	5667-5670	DT	denotes	the
T11517	5677-5680	NN	denotes	day
T11518	5671-5676	JJ	denotes	third
T11519	5681-5683	IN	denotes	of
T11520	5684-5693	NN	denotes	pregnancy
T11521	5693-5694	.	denotes	.
T11522	5694-6078	sentence	denotes	Four days later, embryos in diapause were flushed out of the uterus and cultured on STO feeder cells in four-well plates in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 20% Fetal Bovine Serum (Hyclone), 0.1 mM Non-Essential Amino Acids (Invitrogen), 2 mM L-glutamine (Invitrogen), 50 U/ml Penicillin-Streptomysin (Invitrogen), and 0.11 mM 2-mercaptoethanol (Invitrogen).
T11523	5695-5699	CD	denotes	Four
T11524	5700-5704	NNS	denotes	days
T11525	5705-5710	RB	denotes	later
T11526	5737-5744	VBN	denotes	flushed
T11527	5710-5712	,	denotes	,
T11528	5712-5719	NNS	denotes	embryos
T11529	5720-5722	IN	denotes	in
T11530	5723-5731	NN	denotes	diapause
T11531	5732-5736	VBD	denotes	were
T11532	5745-5748	IN	denotes	out
T11533	5749-5751	IN	denotes	of
T11534	5752-5755	DT	denotes	the
T11535	5756-5762	NN	denotes	uterus
T11536	5763-5766	CC	denotes	and
T11537	5767-5775	VBN	denotes	cultured
T11538	5776-5778	IN	denotes	on
T11539	5779-5782	NN	denotes	STO
T11540	5790-5795	NNS	denotes	cells
T11541	5783-5789	NN	denotes	feeder
T11542	5796-5798	IN	denotes	in
T11543	5799-5803	CD	denotes	four
T11544	5804-5808	NN	denotes	well
T11545	5803-5804	HYPH	denotes	-
T11546	5809-5815	NNS	denotes	plates
T11547	5816-5818	IN	denotes	in
T11548	5819-5827	NNP	denotes	Dulbecco
T11549	5845-5851	NNP	denotes	Medium
T11550	5827-5829	POS	denotes	's
T11551	5830-5838	VBN	denotes	Modified
T11552	5839-5844	NNP	denotes	Eagle
T11553	5852-5853	-LRB-	denotes	(
T11554	5853-5857	NN	denotes	DMEM
T11555	5857-5858	-RRB-	denotes	)
T11556	5859-5871	VBN	denotes	supplemented
T11557	5872-5876	IN	denotes	with
T11558	5877-5879	CD	denotes	20
T11559	5879-5880	NN	denotes	%
T11560	5894-5899	NN	denotes	Serum
T11561	5881-5886	JJ	denotes	Fetal
T11562	5887-5893	JJ	denotes	Bovine
T11563	5900-5901	-LRB-	denotes	(
T11564	5901-5908	NN	denotes	Hyclone
T11565	5908-5909	-RRB-	denotes	)
T11566	5909-5911	,	denotes	,
T11567	5911-5914	CD	denotes	0.1
T11568	5915-5917	NN	denotes	mM
T11569	5938-5943	NNS	denotes	Acids
T11570	5918-5931	JJ	denotes	Non-Essential
T11571	5932-5937	NN	denotes	Amino
T11572	5944-5945	-LRB-	denotes	(
T11573	5945-5955	NNP	denotes	Invitrogen
T11574	5955-5956	-RRB-	denotes	)
T11575	5956-5958	,	denotes	,
T11576	5958-5959	CD	denotes	2
T11577	5960-5962	NN	denotes	mM
T11578	5965-5974	NN	denotes	glutamine
T11579	5963-5964	NN	denotes	L
T11580	5964-5965	HYPH	denotes	-
T11581	5975-5976	-LRB-	denotes	(
T11582	5976-5986	NNP	denotes	Invitrogen
T11583	5986-5987	-RRB-	denotes	)
T11584	5987-5989	,	denotes	,
T11585	5989-5991	CD	denotes	50
T11586	5992-5993	NN	denotes	U
T11587	6008-6020	NN	denotes	Streptomysin
T11588	5993-5994	SYM	denotes	/
T11589	5994-5996	NN	denotes	ml
T11590	5997-6007	NN	denotes	Penicillin
T11591	6007-6008	HYPH	denotes	-
T11592	6021-6022	-LRB-	denotes	(
T11593	6022-6032	NNP	denotes	Invitrogen
T11594	6032-6033	-RRB-	denotes	)
T11595	6033-6035	,	denotes	,
T11596	6035-6038	CC	denotes	and
T11597	6039-6043	CD	denotes	0.11
T11598	6044-6046	NN	denotes	mM
T11599	6049-6064	NN	denotes	mercaptoethanol
T11600	6047-6048	CD	denotes	2
T11601	6048-6049	HYPH	denotes	-
T11602	6065-6066	-LRB-	denotes	(
T11603	6066-6076	NNP	denotes	Invitrogen
T11604	6076-6077	-RRB-	denotes	)
T11605	6077-6078	.	denotes	.
T11606	6078-6208	sentence	denotes	After six days, the central mass of each explant was harvested, rinsed in PBS, and placed in a drop of trypsin for a few minutes.
T11607	6079-6084	IN	denotes	After
T11608	6132-6141	VBN	denotes	harvested
T11609	6085-6088	CD	denotes	six
T11610	6089-6093	NNS	denotes	days
T11611	6093-6095	,	denotes	,
T11612	6095-6098	DT	denotes	the
T11613	6107-6111	NN	denotes	mass
T11614	6099-6106	JJ	denotes	central
T11615	6112-6114	IN	denotes	of
T11616	6115-6119	DT	denotes	each
T11617	6120-6127	NN	denotes	explant
T11618	6128-6131	VBD	denotes	was
T11619	6141-6143	,	denotes	,
T11620	6143-6149	VBN	denotes	rinsed
T11621	6150-6152	IN	denotes	in
T11622	6153-6156	NN	denotes	PBS
T11623	6156-6158	,	denotes	,
T11624	6158-6161	CC	denotes	and
T11625	6162-6168	VBN	denotes	placed
T11626	6169-6171	IN	denotes	in
T11627	6172-6173	DT	denotes	a
T11628	6174-6178	NN	denotes	drop
T11629	6179-6181	IN	denotes	of
T11630	6182-6189	NN	denotes	trypsin
T11631	6190-6193	IN	denotes	for
T11632	6194-6195	DT	denotes	a
T11633	6200-6207	NNS	denotes	minutes
T11634	6196-6199	JJ	denotes	few
T11635	6207-6208	.	denotes	.
T11636	6208-6342	sentence	denotes	The cell mass was collected with a finely drawn-out Pasteur pipette preloaded with medium, ensuring minimal carryover of the trypsin.
T11637	6209-6212	DT	denotes	The
T11638	6218-6222	NN	denotes	mass
T11639	6213-6217	NN	denotes	cell
T11640	6227-6236	VBN	denotes	collected
T11641	6223-6226	VBD	denotes	was
T11642	6237-6241	IN	denotes	with
T11643	6242-6243	DT	denotes	a
T11644	6269-6276	NN	denotes	pipette
T11645	6244-6250	RB	denotes	finely
T11646	6251-6256	VBN	denotes	drawn
T11647	6256-6257	HYPH	denotes	-
T11648	6257-6260	RP	denotes	out
T11649	6261-6268	NNP	denotes	Pasteur
T11650	6277-6286	VBN	denotes	preloaded
T11651	6287-6291	IN	denotes	with
T11652	6292-6298	NN	denotes	medium
T11653	6298-6300	,	denotes	,
T11654	6300-6308	VBG	denotes	ensuring
T11655	6309-6316	JJ	denotes	minimal
T11656	6317-6326	NN	denotes	carryover
T11657	6327-6329	IN	denotes	of
T11658	6330-6333	DT	denotes	the
T11659	6334-6341	NN	denotes	trypsin
T11660	6341-6342	.	denotes	.
T11661	6342-6425	sentence	denotes	The cells were gently transfered into a fresh well with 20% FBS-containing medium.
T11662	6343-6346	DT	denotes	The
T11663	6347-6352	NNS	denotes	cells
T11664	6365-6375	VBN	denotes	transfered
T11665	6353-6357	VBD	denotes	were
T11666	6358-6364	RB	denotes	gently
T11667	6376-6380	IN	denotes	into
T11668	6381-6382	DT	denotes	a
T11669	6389-6393	NN	denotes	well
T11670	6383-6388	JJ	denotes	fresh
T11671	6394-6398	IN	denotes	with
T11672	6399-6401	CD	denotes	20
T11673	6401-6402	NN	denotes	%
T11674	6418-6424	NN	denotes	medium
T11675	6403-6406	NN	denotes	FBS
T11676	6407-6417	VBG	denotes	containing
T11677	6406-6407	HYPH	denotes	-
T11678	6424-6425	.	denotes	.
T11679	6425-6557	sentence	denotes	The resulting primary ES cell colonies were individually passaged into wells of four-well plates containing STO feeder cell layers.
T11680	6426-6429	DT	denotes	The
T11681	6456-6464	NNS	denotes	colonies
T11682	6430-6439	VBG	denotes	resulting
T11683	6440-6447	JJ	denotes	primary
T11684	6448-6450	NN	denotes	ES
T11685	6451-6455	NN	denotes	cell
T11686	6483-6491	VBN	denotes	passaged
T11687	6465-6469	VBD	denotes	were
T11688	6470-6482	RB	denotes	individually
T11689	6492-6496	IN	denotes	into
T11690	6497-6502	NNS	denotes	wells
T11691	6503-6505	IN	denotes	of
T11692	6506-6510	CD	denotes	four
T11693	6511-6515	NN	denotes	well
T11694	6510-6511	HYPH	denotes	-
T11695	6516-6522	NNS	denotes	plates
T11696	6523-6533	VBG	denotes	containing
T11697	6534-6537	NN	denotes	STO
T11698	6550-6556	NNS	denotes	layers
T11699	6538-6544	NN	denotes	feeder
T11700	6545-6549	NN	denotes	cell
T11701	6556-6557	.	denotes	.
T11702	6557-6630	sentence	denotes	Thereafter, cells were expanded by trypsinization of the entire culture.
T11703	6558-6568	RB	denotes	Thereafter
T11704	6581-6589	VBN	denotes	expanded
T11705	6568-6570	,	denotes	,
T11706	6570-6575	NNS	denotes	cells
T11707	6576-6580	VBD	denotes	were
T11708	6590-6592	IN	denotes	by
T11709	6593-6607	NN	denotes	trypsinization
T11710	6608-6610	IN	denotes	of
T11711	6611-6614	DT	denotes	the
T11712	6622-6629	NN	denotes	culture
T11713	6615-6621	JJ	denotes	entire
T11714	6629-6630	.	denotes	.
T11883	6632-6643	NNS	denotes	Microarrays
T11884	6643-6742	sentence	denotes	Total RNA from wild-type ES cells and ESG1-/- ES cells was labeled with Cy3 and Cy5, respectively.
T11885	6644-6649	JJ	denotes	Total
T11886	6650-6653	NN	denotes	RNA
T11887	6703-6710	VBN	denotes	labeled
T11888	6654-6658	IN	denotes	from
T11889	6659-6663	JJ	denotes	wild
T11890	6664-6668	NN	denotes	type
T11891	6663-6664	HYPH	denotes	-
T11892	6672-6677	NNS	denotes	cells
T11893	6669-6671	NN	denotes	ES
T11894	6678-6681	CC	denotes	and
T11895	6682-6686	NN	denotes	ESG1
T11896	6693-6698	NNS	denotes	cells
T11897	6686-6687	SYM	denotes	-
T11898	6687-6688	HYPH	denotes	/
T11899	6688-6689	SYM	denotes	-
T11900	6690-6692	NN	denotes	ES
T11901	6699-6702	VBD	denotes	was
T11902	6711-6715	IN	denotes	with
T11903	6716-6719	NN	denotes	Cy3
T11904	6720-6723	CC	denotes	and
T11905	6724-6727	NN	denotes	Cy5
T11906	6727-6729	,	denotes	,
T11907	6729-6741	RB	denotes	respectively
T11908	6741-6742	.	denotes	.
T11909	6742-6857	sentence	denotes	The samples were hybridized to a Mouse Development Microarray (Algilent) according to the manufacturer's protocol.
T11910	6743-6746	DT	denotes	The
T11911	6747-6754	NNS	denotes	samples
T11912	6760-6770	VBN	denotes	hybridized
T11913	6755-6759	VBD	denotes	were
T11914	6771-6773	IN	denotes	to
T11915	6774-6775	DT	denotes	a
T11916	6794-6804	NN	denotes	Microarray
T11917	6776-6781	NN	denotes	Mouse
T11918	6782-6793	NN	denotes	Development
T11919	6805-6806	-LRB-	denotes	(
T11920	6806-6814	NNP	denotes	Algilent
T11921	6814-6815	-RRB-	denotes	)
T11922	6816-6825	VBG	denotes	according
T11923	6826-6828	IN	denotes	to
T11924	6829-6832	DT	denotes	the
T11925	6833-6845	NN	denotes	manufacturer
T11926	6848-6856	NN	denotes	protocol
T11927	6845-6847	POS	denotes	's
T11928	6856-6857	.	denotes	.
T11929	6857-6929	sentence	denotes	Arrays were scanned with a G2565BA Microarray Scanner System (Agilent).
T11930	6858-6864	NNS	denotes	Arrays
T11931	6870-6877	VBN	denotes	scanned
T11932	6865-6869	VBD	denotes	were
T11933	6878-6882	IN	denotes	with
T11934	6883-6884	DT	denotes	a
T11935	6912-6918	NN	denotes	System
T11936	6885-6892	NN	denotes	G2565BA
T11937	6893-6903	NN	denotes	Microarray
T11938	6904-6911	NN	denotes	Scanner
T11939	6919-6920	-LRB-	denotes	(
T11940	6920-6927	NNP	denotes	Agilent
T11941	6927-6928	-RRB-	denotes	)
T11942	6928-6929	.	denotes	.
T11943	6929-6985	sentence	denotes	Hybridization was repeated with two independent clones.
T11944	6930-6943	NN	denotes	Hybridization
T11945	6948-6956	VBN	denotes	repeated
T11946	6944-6947	VBD	denotes	was
T11947	6957-6961	IN	denotes	with
T11948	6962-6965	CD	denotes	two
T11949	6978-6984	NNS	denotes	clones
T11950	6966-6977	JJ	denotes	independent
T11951	6984-6985	.	denotes	.
T11952	6985-7049	sentence	denotes	Data were analyzed with GeneSprings software (Silico Genetics).
T11953	6986-6990	NNS	denotes	Data
T11954	6996-7004	VBN	denotes	analyzed
T11955	6991-6995	VBD	denotes	were
T11956	7005-7009	IN	denotes	with
T11957	7010-7021	NNP	denotes	GeneSprings
T11958	7022-7030	NN	denotes	software
T11959	7031-7032	-LRB-	denotes	(
T11960	7039-7047	NNP	denotes	Genetics
T11961	7032-7038	NNP	denotes	Silico
T11962	7047-7048	-RRB-	denotes	)
T11963	7048-7049	.	denotes	.
R2053	T8265	T8264	cc	and,Identification
R2054	T8266	T8264	conj	analyses,Identification
R2055	T8267	T8264	prep	of,Identification
R2056	T8268	T8269	compound	BAC,clones
R2057	T8269	T8267	pobj	clones,of
R2058	T8270	T8269	acl	containing,clones
R2059	T8271	T8272	det	the,gene
R2060	T8272	T8270	dobj	gene,containing
R2061	T8273	T8272	compound	mouse,gene
R2062	T8274	T8272	compound	ESG1,gene
R2063	T8276	T8277	aux	To,identify
R2064	T8277	T8278	advcl	identify,performed
R2065	T8279	T8280	amod	bacterial,chromosome
R2066	T8280	T8282	nmod	chromosome,clones
R2067	T8281	T8280	amod	artificial,chromosome
R2068	T8282	T8277	dobj	clones,identify
R2069	T8283	T8280	punct	(,chromosome
R2070	T8284	T8280	appos	BAC,chromosome
R2071	T8285	T8282	punct	),clones
R2072	T8286	T8282	acl	containing,clones
R2073	T8287	T8288	compound	mouse,gene
R2074	T8288	T8286	dobj	gene,containing
R2075	T8289	T8288	compound	ESG1,gene
R2076	T8290	T8278	punct	", ",performed
R2077	T8291	T8278	nsubj	we,performed
R2078	T8292	T8293	npadvmod	PCR,based
R2079	T8293	T8295	amod	based,screening
R2080	T8294	T8293	punct	-,based
R2081	T8295	T8278	dobj	screening,performed
R2082	T8296	T8295	prep	of,screening
R2083	T8297	T8298	compound	mouse,pools
R2084	T8298	T8296	pobj	pools,of
R2085	T8299	T8298	compound	BAC,pools
R2086	T8300	T8298	compound	library,pools
R2087	T8301	T8298	compound	DNA,pools
R2088	T8302	T8303	punct	(,Genetics
R2089	T8303	T8295	parataxis	Genetics,screening
R2090	T8304	T8303	compound	Research,Genetics
R2091	T8305	T8303	punct	),Genetics
R2092	T8306	T8278	advcl	using,performed
R2093	T8307	T8308	det	the,primers
R2094	T8308	T8306	dobj	primers,using
R2095	T8309	T8310	nmod	pH34,u38
R2096	T8310	T8308	nmod	u38,primers
R2097	T8311	T8310	punct	-,u38
R2098	T8312	T8313	punct	(,3
R2099	T8313	T8310	parataxis	3,u38
R2100	T8314	T8313	dep	5,3
R2101	T8315	T8314	punct	',5
R2102	T8316	T8313	punct	-,3
R2103	T8317	T8313	dep	GAAGTCTGGTTCCTTGGCAGG,3
R2104	T8318	T8313	punct	-,3
R2105	T8319	T8313	punct	',3
R2106	T8320	T8313	punct	),3
R2107	T8321	T8310	cc	and,u38
R2108	T8322	T8323	compound	pH34,L394
R2109	T8323	T8310	conj	L394,u38
R2110	T8324	T8323	punct	-,L394
R2111	T8325	T8326	punct	(,3
R2112	T8326	T8323	parataxis	3,L394
R2113	T8327	T8326	dep	5,3
R2114	T8328	T8327	punct	',5
R2115	T8329	T8326	punct	-,3
R2116	T8330	T8326	dep	ACTCGATACACTGGCCTAGC,3
R2117	T8331	T8326	punct	-,3
R2118	T8332	T8326	punct	',3
R2119	T8333	T8326	punct	),3
R2120	T8334	T8278	punct	.,performed
R2121	T8336	T8337	prep	Following,performed
R2122	T8338	T8339	compound	restriction,enzyme
R2123	T8339	T8340	compound	enzyme,digestion
R2124	T8340	T8336	pobj	digestion,Following
R2125	T8341	T8337	punct	", ",performed
R2126	T8342	T8337	nsubj	we,performed
R2127	T8343	T8344	compound	Southern,blot
R2128	T8344	T8345	compound	blot,analyses
R2129	T8345	T8337	dobj	analyses,performed
R2130	T8346	T8345	prep	of,analyses
R2131	T8347	T8348	compound	BAC,clones
R2132	T8348	T8346	pobj	clones,of
R2133	T8349	T8350	mark	as,described
R2134	T8350	T8337	advcl	described,performed
R2135	T8351	T8352	punct	[,20
R2136	T8352	T8350	parataxis	20,described
R2137	T8353	T8352	punct	],20
R2138	T8354	T8350	advcl	using,described
R2139	T8355	T8356	det	the,probes
R2140	T8356	T8354	dobj	probes,using
R2141	T8357	T8358	nmod	pH34,U258
R2142	T8358	T8356	nmod	U258,probes
R2143	T8359	T8358	punct	-,U258
R2144	T8360	T8361	punct	(,CTCGAGTGTACAGTCAAGTGGTTGCTGGGA
R2145	T8361	T8358	parataxis	CTCGAGTGTACAGTCAAGTGGTTGCTGGGA,U258
R2146	T8362	T8361	nummod	5,CTCGAGTGTACAGTCAAGTGGTTGCTGGGA
R2147	T8363	T8362	punct	',5
R2148	T8364	T8361	punct	-,CTCGAGTGTACAGTCAAGTGGTTGCTGGGA
R2149	T8365	T8361	punct	-,CTCGAGTGTACAGTCAAGTGGTTGCTGGGA
R2150	T8366	T8361	nummod	3,CTCGAGTGTACAGTCAAGTGGTTGCTGGGA
R2151	T8367	T8361	punct	',CTCGAGTGTACAGTCAAGTGGTTGCTGGGA
R2152	T8368	T8361	punct	),CTCGAGTGTACAGTCAAGTGGTTGCTGGGA
R2153	T8369	T8358	punct	", ",U258
R2154	T8370	T8371	compound	pH34,U65
R2155	T8371	T8358	conj	U65,U258
R2156	T8372	T8371	punct	-,U65
R2157	T8373	T8374	punct	(,GTGACCCTCGTGACCCGTAA
R2158	T8374	T8371	parataxis	GTGACCCTCGTGACCCGTAA,U65
R2159	T8375	T8374	nummod	5,GTGACCCTCGTGACCCGTAA
R2160	T8376	T8375	punct	',5
R2161	T8377	T8374	punct	-,GTGACCCTCGTGACCCGTAA
R2162	T8378	T8374	punct	-,GTGACCCTCGTGACCCGTAA
R2163	T8379	T8374	nummod	3,GTGACCCTCGTGACCCGTAA
R2164	T8380	T8374	punct	',GTGACCCTCGTGACCCGTAA
R2165	T8381	T8374	punct	),GTGACCCTCGTGACCCGTAA
R2166	T8382	T8371	punct	", ",U65
R2167	T8383	T8384	compound	pH34,intron1L
R2168	T8384	T8371	conj	intron1L,U65
R2169	T8385	T8384	punct	-,intron1L
R2170	T8386	T8387	punct	(,CTGCGTGAGAGAAACACCAAACAGGC
R2171	T8387	T8384	parataxis	CTGCGTGAGAGAAACACCAAACAGGC,intron1L
R2172	T8388	T8387	nummod	5,CTGCGTGAGAGAAACACCAAACAGGC
R2173	T8389	T8388	punct	',5
R2174	T8390	T8387	punct	-,CTGCGTGAGAGAAACACCAAACAGGC
R2175	T8391	T8387	punct	-,CTGCGTGAGAGAAACACCAAACAGGC
R2176	T8392	T8387	nummod	3,CTGCGTGAGAGAAACACCAAACAGGC
R2177	T8393	T8387	punct	',CTGCGTGAGAGAAACACCAAACAGGC
R2178	T8394	T8387	punct	),CTGCGTGAGAGAAACACCAAACAGGC
R2179	T8395	T8384	punct	", ",intron1L
R2180	T8396	T8397	compound	pH34,L545
R2181	T8397	T8384	conj	L545,intron1L
R2182	T8398	T8397	punct	-,L545
R2183	T8399	T8400	punct	(,TGTGAATGGGAAGGTTACCACTCT
R2184	T8400	T8397	parataxis	TGTGAATGGGAAGGTTACCACTCT,L545
R2185	T8401	T8400	nummod	5,TGTGAATGGGAAGGTTACCACTCT
R2186	T8402	T8401	punct	',5
R2187	T8403	T8400	punct	-,TGTGAATGGGAAGGTTACCACTCT
R2188	T8404	T8400	punct	-,TGTGAATGGGAAGGTTACCACTCT
R2189	T8405	T8400	nummod	3,TGTGAATGGGAAGGTTACCACTCT
R2190	T8406	T8400	punct	',TGTGAATGGGAAGGTTACCACTCT
R2191	T8407	T8400	punct	),TGTGAATGGGAAGGTTACCACTCT
R2192	T8408	T8397	cc	and,L545
R2193	T8409	T8410	compound	pH34,SCL1
R2194	T8410	T8397	conj	SCL1,L545
R2195	T8411	T8410	punct	-,SCL1
R2196	T8412	T8413	punct	(,GCCCTCTTCTGGTTTGTCTCGAAAT
R2197	T8413	T8410	parataxis	GCCCTCTTCTGGTTTGTCTCGAAAT,SCL1
R2198	T8414	T8413	nummod	5,GCCCTCTTCTGGTTTGTCTCGAAAT
R2199	T8415	T8414	punct	',5
R2200	T8416	T8413	punct	-,GCCCTCTTCTGGTTTGTCTCGAAAT
R2201	T8417	T8413	punct	-,GCCCTCTTCTGGTTTGTCTCGAAAT
R2202	T8418	T8413	nummod	3,GCCCTCTTCTGGTTTGTCTCGAAAT
R2203	T8419	T8413	punct	',GCCCTCTTCTGGTTTGTCTCGAAAT
R2204	T8420	T8413	punct	),GCCCTCTTCTGGTTTGTCTCGAAAT
R2205	T8421	T8337	punct	.,performed
R2206	T8423	T8424	nsubj	Hybridization,revealed
R2207	T8425	T8423	prep	with,Hybridization
R2208	T8426	T8427	det	these,probes
R2209	T8427	T8425	pobj	probes,with
R2210	T8428	T8424	dobj	bands,revealed
R2211	T8429	T8428	acl	containing,bands
R2212	T8430	T8431	preconj	either,gene
R2213	T8431	T8429	dobj	gene,containing
R2214	T8432	T8431	det	the,gene
R2215	T8433	T8431	compound	ESG1,gene
R2216	T8434	T8431	cc	or,gene
R2217	T8435	T8431	conj	pseudogenes,gene
R2218	T8436	T8424	punct	.,revealed
R2219	T8438	T8439	aux	To,sequence
R2220	T8439	T8440	advcl	sequence,subcloned
R2221	T8441	T8442	det	the,region
R2222	T8442	T8439	dobj	region,sequence
R2223	T8443	T8442	acl	containing,region
R2224	T8444	T8445	det	the,gene
R2225	T8445	T8443	dobj	gene,containing
R2226	T8446	T8445	compound	mouse,gene
R2227	T8447	T8445	compound	ESG1,gene
R2228	T8448	T8445	cc	and,gene
R2229	T8449	T8450	det	the,region
R2230	T8450	T8445	conj	region,gene
R2231	T8451	T8450	nummod	3,region
R2232	T8452	T8451	punct	',3
R2233	T8453	T8450	compound	flanking,region
R2234	T8454	T8440	punct	", ",subcloned
R2235	T8455	T8440	nsubj	we,subcloned
R2236	T8456	T8457	det	a,fragment
R2237	T8457	T8440	dobj	fragment,subcloned
R2238	T8458	T8459	punct	~,15
R2239	T8459	T8460	nummod	15,kbp
R2240	T8460	T8457	compound	kbp,fragment
R2241	T8461	T8462	compound	XhoI,SalI
R2242	T8462	T8457	compound	SalI,fragment
R2243	T8463	T8462	punct	-,SalI
R2244	T8464	T8440	prep	into,subcloned
R2245	T8465	T8466	det	the,vector
R2246	T8466	T8464	pobj	vector,into
R2247	T8467	T8466	nmod	pZERO,vector
R2248	T8468	T8467	punct	-,pZERO
R2249	T8469	T8467	nummod	2,pZERO
R2250	T8470	T8471	punct	(,Invitrogen
R2251	T8471	T8466	parataxis	Invitrogen,vector
R2252	T8472	T8471	punct	),Invitrogen
R2253	T8473	T8440	punct	.,subcloned
R2254	T8475	T8476	npadvmod	HindIII,digested
R2255	T8476	T8481	amod	digested,fragments
R2256	T8477	T8475	punct	-,HindIII
R2257	T8478	T8475	cc	or,HindIII
R2258	T8479	T8475	conj	EcoRI,HindIII
R2259	T8480	T8476	punct	-,digested
R2260	T8481	T8482	nsubjpass	fragments,cloned
R2261	T8483	T8481	prep	of,fragments
R2262	T8484	T8485	det	this,vector
R2263	T8485	T8483	pobj	vector,of
R2264	T8486	T8482	auxpass	were,cloned
R2265	T8487	T8482	advmod	then,cloned
R2266	T8488	T8482	prep	into,cloned
R2267	T8489	T8490	compound	pBluescript,KS
R2268	T8490	T8488	pobj	KS,into
R2269	T8491	T8490	punct	(,KS
R2270	T8492	T8490	punct	-,KS
R2271	T8493	T8490	punct	),KS
R2272	T8494	T8482	prep	for,cloned
R2273	T8495	T8494	pobj	sequencing,for
R2274	T8496	T8482	punct	.,cloned
R2275	T8498	T8499	aux	To,sequence
R2276	T8499	T8500	advcl	sequence,cloned
R2277	T8501	T8502	det	the,pseudogene
R2278	T8502	T8499	dobj	pseudogene,sequence
R2279	T8503	T8502	compound	ESG1,pseudogene
R2280	T8504	T8502	cc	and,pseudogene
R2281	T8505	T8506	det	the,region
R2282	T8506	T8502	conj	region,pseudogene
R2283	T8507	T8506	nummod	3,region
R2284	T8508	T8507	punct	',3
R2285	T8509	T8506	compound	flanking,region
R2286	T8510	T8500	punct	", ",cloned
R2287	T8511	T8512	det	an,fragment
R2288	T8512	T8500	nsubjpass	fragment,cloned
R2289	T8513	T8514	nummod	8,kbp
R2290	T8514	T8512	compound	kbp,fragment
R2291	T8515	T8516	compound	NotI,XhoI
R2292	T8516	T8512	compound	XhoI,fragment
R2293	T8517	T8516	punct	/,XhoI
R2294	T8518	T8500	auxpass	was,cloned
R2295	T8519	T8500	prep	into,cloned
R2296	T8520	T8521	compound	pBluescript,KS
R2297	T8521	T8519	pobj	KS,into
R2298	T8522	T8521	punct	(,KS
R2299	T8523	T8521	punct	-,KS
R2300	T8524	T8521	punct	),KS
R2301	T8525	T8500	punct	.,cloned
R2302	T8527	T8528	nmod	BamHI,fragments
R2303	T8528	T8533	nsubjpass	fragments,cloned
R2304	T8529	T8527	punct	-,BamHI
R2305	T8530	T8527	cc	or,BamHI
R2306	T8531	T8527	conj	PstI,BamHI
R2307	T8532	T8528	punct	-,fragments
R2308	T8534	T8528	prep	of,fragments
R2309	T8535	T8536	det	this,vector
R2310	T8536	T8534	pobj	vector,of
R2311	T8537	T8533	auxpass	were,cloned
R2312	T8538	T8533	advmod	also,cloned
R2313	T8539	T8533	prep	into,cloned
R2314	T8540	T8541	compound	pBluescript,KS
R2315	T8541	T8539	pobj	KS,into
R2316	T8542	T8541	punct	(,KS
R2317	T8543	T8541	punct	-,KS
R2318	T8544	T8541	punct	),KS
R2319	T8545	T8533	punct	.,cloned
R2320	T8547	T8548	aux	To,identify
R2321	T8548	T8549	advcl	identify,used
R2322	T8550	T8551	det	the,sequence
R2323	T8551	T8548	dobj	sequence,identify
R2324	T8552	T8551	acl	containing,sequence
R2325	T8553	T8554	det	the,regions
R2326	T8554	T8552	dobj	regions,containing
R2327	T8555	T8554	nummod	5,regions
R2328	T8556	T8555	punct	',5
R2329	T8557	T8554	compound	flanking,regions
R2330	T8558	T8554	prep	of,regions
R2331	T8559	T8560	det	the,gene
R2332	T8560	T8558	pobj	gene,of
R2333	T8561	T8560	compound	ESG1,gene
R2334	T8562	T8560	cc	and,gene
R2335	T8563	T8564	det	the,pseudogenes
R2336	T8564	T8560	conj	pseudogenes,gene
R2337	T8565	T8564	amod	related,pseudogenes
R2338	T8566	T8549	punct	", ",used
R2339	T8567	T8549	nsubj	we,used
R2340	T8568	T8569	det	a,kit
R2341	T8569	T8549	dobj	kit,used
R2342	T8570	T8569	compound	TOPO,kit
R2343	T8571	T8569	compound	walker,kit
R2344	T8572	T8573	punct	(,Invitrogen
R2345	T8573	T8569	parataxis	Invitrogen,kit
R2346	T8574	T8573	punct	),Invitrogen
R2347	T8575	T8549	prep	with,used
R2348	T8576	T8577	det	the,primers
R2349	T8577	T8575	pobj	primers,with
R2350	T8578	T8579	nmod	pH34,T2L
R2351	T8579	T8577	nmod	T2L,primers
R2352	T8580	T8579	punct	-,T2L
R2353	T8581	T8582	punct	(,3
R2354	T8582	T8579	parataxis	3,T2L
R2355	T8583	T8582	dep	5,3
R2356	T8584	T8583	punct	',5
R2357	T8585	T8582	punct	-,3
R2358	T8586	T8582	dep	ACTAGTCGCAGCAGGGATCCAGGAATATCT,3
R2359	T8587	T8582	punct	-,3
R2360	T8588	T8582	punct	',3
R2361	T8589	T8582	punct	),3
R2362	T8590	T8579	cc	and,T2L
R2363	T8591	T8592	compound	pH34,L394
R2364	T8592	T8579	conj	L394,T2L
R2365	T8593	T8592	punct	-,L394
R2366	T8594	T8549	punct	.,used
R2367	T8596	T8597	det	The,sequence
R2368	T8597	T8599	nsubjpass	sequence,cloned
R2369	T8598	T8597	amod	resulting,sequence
R2370	T8600	T8599	auxpass	was,cloned
R2371	T8601	T8599	prep	into,cloned
R2372	T8602	T8601	pobj	pCR2.1,into
R2373	T8603	T8604	punct	(,Invitrogen
R2374	T8604	T8602	parataxis	Invitrogen,pCR2.1
R2375	T8605	T8604	punct	),Invitrogen
R2376	T8606	T8599	punct	.,cloned
R2377	T8608	T8609	nsubj	We,obtained
R2378	T8609	T8610	ccomp	obtained,cloned
R2379	T8611	T8612	det	a,band
R2380	T8612	T8609	dobj	band,obtained
R2381	T8613	T8614	punct	~,6
R2382	T8614	T8615	nummod	6,kbp
R2383	T8615	T8612	compound	kbp,band
R2384	T8616	T8609	prep	from,obtained
R2385	T8617	T8618	det	the,library
R2386	T8618	T8616	pobj	library,from
R2387	T8619	T8620	npadvmod	NsiI,digensted
R2388	T8620	T8618	amod	digensted,library
R2389	T8621	T8620	punct	-,digensted
R2390	T8622	T8610	punct	;,cloned
R2391	T8623	T8624	npadvmod	XbaI,digested
R2392	T8624	T8636	amod	digested,fragments
R2393	T8625	T8623	punct	-,XbaI
R2394	T8626	T8623	punct	", ",XbaI
R2395	T8627	T8623	conj	SpeI,XbaI
R2396	T8628	T8627	punct	-,SpeI
R2397	T8629	T8627	punct	", ",SpeI
R2398	T8630	T8627	conj	EcoRI,SpeI
R2399	T8631	T8630	punct	-,EcoRI
R2400	T8632	T8630	punct	", ",EcoRI
R2401	T8633	T8630	cc	and,EcoRI
R2402	T8634	T8630	conj	PstI,EcoRI
R2403	T8635	T8624	punct	-,digested
R2404	T8636	T8610	nsubjpass	fragments,cloned
R2405	T8637	T8636	prep	of,fragments
R2406	T8638	T8639	det	this,band
R2407	T8639	T8637	pobj	band,of
R2408	T8640	T8610	auxpass	were,cloned
R2409	T8641	T8610	prep	into,cloned
R2410	T8642	T8643	compound	pBluescript,KS
R2411	T8643	T8641	pobj	KS,into
R2412	T8644	T8643	punct	(,KS
R2413	T8645	T8643	punct	-,KS
R2414	T8646	T8643	punct	),KS
R2415	T8647	T8610	prep	for,cloned
R2416	T8648	T8647	pobj	sequencing,for
R2417	T8649	T8610	punct	.,cloned
R2418	T8651	T8652	det	This,fragment
R2419	T8652	T8653	nsubj	fragment,contained
R2420	T8654	T8655	det	the,region
R2421	T8655	T8653	dobj	region,contained
R2422	T8656	T8655	nummod	5,region
R2423	T8657	T8656	punct	',5
R2424	T8658	T8655	compound	flanking,region
R2425	T8659	T8655	prep	of,region
R2426	T8660	T8661	det	the,gene
R2427	T8661	T8659	pobj	gene,of
R2428	T8662	T8661	compound	ESG1,gene
R2429	T8663	T8653	punct	.,contained
R2430	T8665	T8666	det	A,fragment
R2431	T8666	T8670	nsubjpass	fragment,cloned
R2432	T8667	T8668	punct	~,3
R2433	T8668	T8669	nummod	3,kbp
R2434	T8669	T8666	compound	kbp,fragment
R2435	T8671	T8666	punct	", ",fragment
R2436	T8672	T8666	acl	obtained,fragment
R2437	T8673	T8672	prep	from,obtained
R2438	T8674	T8675	det	the,library
R2439	T8675	T8673	pobj	library,from
R2440	T8676	T8677	npadvmod	SacI,digested
R2441	T8677	T8675	amod	digested,library
R2442	T8678	T8677	punct	-,digested
R2443	T8679	T8670	punct	", ",cloned
R2444	T8680	T8670	auxpass	was,cloned
R2445	T8681	T8670	prep	into,cloned
R2446	T8682	T8681	pobj	pCR2.1,into
R2447	T8683	T8670	prep	for,cloned
R2448	T8684	T8683	pobj	sequencing,for
R2449	T8685	T8670	punct	.,cloned
R2450	T8687	T8688	det	This,fragment
R2451	T8688	T8689	nsubjpass	fragment,contained
R2452	T8690	T8689	auxpass	was,contained
R2453	T8691	T8692	det	the,region
R2454	T8692	T8689	dobj	region,contained
R2455	T8693	T8692	nummod	5,region
R2456	T8694	T8693	punct	',5
R2457	T8695	T8692	acl	flanking,region
R2458	T8696	T8697	det	the,pseudogene
R2459	T8697	T8695	dobj	pseudogene,flanking
R2460	T8698	T8689	punct	.,contained
R2461	T9172	T9171	prep	of,Construction
R2462	T9173	T9174	compound	ESG1,vectors
R2463	T9174	T9172	pobj	vectors,of
R2464	T9175	T9174	compound	targeting,vectors
R2465	T9177	T9178	nsubj	We,replaced
R2466	T9179	T9178	dobj	all,replaced
R2467	T9180	T9179	prep	of,all
R2468	T9181	T9182	det	the,exons
R2469	T9182	T9180	pobj	exons,of
R2470	T9183	T9182	compound	ESG1,exons
R2471	T9184	T9178	prep	with,replaced
R2472	T9185	T9186	nummod	two,vectors
R2473	T9186	T9184	pobj	vectors,with
R2474	T9187	T9186	compound	targeting,vectors
R2475	T9188	T9186	acl	containing,vectors
R2476	T9189	T9190	preconj	either,cassette
R2477	T9190	T9188	dobj	cassette,containing
R2478	T9191	T9190	det	an,cassette
R2479	T9192	T9193	compound	IRES,geo
R2480	T9193	T9190	compound	geo,cassette
R2481	T9194	T9193	punct	-,geo
R2482	T9195	T9193	compound	β,geo
R2483	T9196	T9193	punct	-,geo
R2484	T9197	T9198	punct	[,21
R2485	T9198	T9190	parataxis	21,cassette
R2486	T9199	T9198	punct	],21
R2487	T9200	T9190	cc	or,cassette
R2488	T9201	T9202	det	an,HygR
R2489	T9202	T9205	compound	HygR,cassette
R2490	T9203	T9202	compound	IRES,HygR
R2491	T9204	T9202	punct	-,HygR
R2492	T9205	T9190	conj	cassette,cassette
R2493	T9206	T9178	prep	by,replaced
R2494	T9207	T9208	compound	promoter,trap
R2495	T9208	T9209	compound	trap,selection
R2496	T9209	T9206	pobj	selection,by
R2497	T9210	T9178	punct	.,replaced
R2498	T9212	T9213	nsubj	We,amplified
R2499	T9214	T9215	det	the,arm
R2500	T9215	T9213	dobj	arm,amplified
R2501	T9216	T9215	nummod	5,arm
R2502	T9217	T9216	punct	',5
R2503	T9218	T9219	punct	(,kbp
R2504	T9219	T9215	parataxis	kbp,arm
R2505	T9220	T9219	nummod	1.8,kbp
R2506	T9221	T9219	punct	),kbp
R2507	T9222	T9213	advcl	using,amplified
R2508	T9223	T9224	compound	KOD,plus
R2509	T9224	T9222	dobj	plus,using
R2510	T9225	T9226	punct	(,TOYOBO
R2511	T9226	T9224	parataxis	TOYOBO,plus
R2512	T9227	T9226	punct	),TOYOBO
R2513	T9228	T9224	prep	with,plus
R2514	T9229	T9230	det	the,primers
R2515	T9230	T9228	pobj	primers,with
R2516	T9231	T9232	nmod	pH34,U
R2517	T9232	T9230	nmod	U,primers
R2518	T9233	T9232	punct	-,U
R2519	T9234	T9232	nmod	targetpair5,U
R2520	T9235	T9232	punct	-,U
R2521	T9236	T9237	punct	(,CCGCGGAAAGTCAAGAGATTGGGTGG
R2522	T9237	T9232	parataxis	CCGCGGAAAGTCAAGAGATTGGGTGG,U
R2523	T9238	T9237	nummod	5,CCGCGGAAAGTCAAGAGATTGGGTGG
R2524	T9239	T9238	punct	',5
R2525	T9240	T9237	punct	-,CCGCGGAAAGTCAAGAGATTGGGTGG
R2526	T9241	T9237	punct	-,CCGCGGAAAGTCAAGAGATTGGGTGG
R2527	T9242	T9237	nummod	3,CCGCGGAAAGTCAAGAGATTGGGTGG
R2528	T9243	T9237	punct	',CCGCGGAAAGTCAAGAGATTGGGTGG
R2529	T9244	T9237	punct	),CCGCGGAAAGTCAAGAGATTGGGTGG
R2530	T9245	T9232	cc	and,U
R2531	T9246	T9247	compound	pH34,L
R2532	T9247	T9232	conj	L,U
R2533	T9248	T9247	punct	-,L
R2534	T9249	T9247	compound	targetpair5,L
R2535	T9250	T9247	punct	-,L
R2536	T9251	T9252	punct	(,GCGGCCGCCTTTACGGGTCACGAGGGTCAC
R2537	T9252	T9247	parataxis	GCGGCCGCCTTTACGGGTCACGAGGGTCAC,L
R2538	T9253	T9252	nummod	5,GCGGCCGCCTTTACGGGTCACGAGGGTCAC
R2539	T9254	T9253	punct	',5
R2540	T9255	T9252	punct	-,GCGGCCGCCTTTACGGGTCACGAGGGTCAC
R2541	T9256	T9252	punct	-,GCGGCCGCCTTTACGGGTCACGAGGGTCAC
R2542	T9257	T9252	nummod	3,GCGGCCGCCTTTACGGGTCACGAGGGTCAC
R2543	T9258	T9252	punct	',GCGGCCGCCTTTACGGGTCACGAGGGTCAC
R2544	T9259	T9252	punct	),GCGGCCGCCTTTACGGGTCACGAGGGTCAC
R2545	T9260	T9213	punct	.,amplified
R2546	T9262	T9263	det	The,arm
R2547	T9263	T9266	nsubjpass	arm,amplified
R2548	T9264	T9263	nummod	3,arm
R2549	T9265	T9264	punct	',3
R2550	T9267	T9268	punct	(,kbp
R2551	T9268	T9263	parataxis	kbp,arm
R2552	T9269	T9268	nummod	5.8,kbp
R2553	T9270	T9268	punct	),kbp
R2554	T9271	T9266	auxpass	was,amplified
R2555	T9272	T9266	advcl	using,amplified
R2556	T9273	T9274	det	the,primers
R2557	T9274	T9272	dobj	primers,using
R2558	T9275	T9276	nmod	pH34,U
R2559	T9276	T9274	nmod	U,primers
R2560	T9277	T9276	punct	-,U
R2561	T9278	T9276	nmod	targetpair3,U
R2562	T9279	T9276	punct	-,U
R2563	T9280	T9281	punct	(,TGTGGCCAGTGTTTGGTTCTGGCGGG
R2564	T9281	T9276	parataxis	TGTGGCCAGTGTTTGGTTCTGGCGGG,U
R2565	T9282	T9281	nummod	5,TGTGGCCAGTGTTTGGTTCTGGCGGG
R2566	T9283	T9282	punct	',5
R2567	T9284	T9281	punct	-,TGTGGCCAGTGTTTGGTTCTGGCGGG
R2568	T9285	T9281	punct	-,TGTGGCCAGTGTTTGGTTCTGGCGGG
R2569	T9286	T9281	nummod	3,TGTGGCCAGTGTTTGGTTCTGGCGGG
R2570	T9287	T9281	punct	',TGTGGCCAGTGTTTGGTTCTGGCGGG
R2571	T9288	T9281	punct	),TGTGGCCAGTGTTTGGTTCTGGCGGG
R2572	T9289	T9276	cc	and,U
R2573	T9290	T9291	compound	pH34,L
R2574	T9291	T9276	conj	L,U
R2575	T9292	T9291	punct	-,L
R2576	T9293	T9291	compound	targetpair3,L
R2577	T9294	T9291	punct	-,L
R2578	T9295	T9296	punct	(,CTCGAGGACTCGCCATTCTAGCCAAG
R2579	T9296	T9291	parataxis	CTCGAGGACTCGCCATTCTAGCCAAG,L
R2580	T9297	T9296	nummod	5,CTCGAGGACTCGCCATTCTAGCCAAG
R2581	T9298	T9297	punct	',5
R2582	T9299	T9296	punct	-,CTCGAGGACTCGCCATTCTAGCCAAG
R2583	T9300	T9296	punct	-,CTCGAGGACTCGCCATTCTAGCCAAG
R2584	T9301	T9296	nummod	3,CTCGAGGACTCGCCATTCTAGCCAAG
R2585	T9302	T9296	punct	',CTCGAGGACTCGCCATTCTAGCCAAG
R2586	T9303	T9296	punct	),CTCGAGGACTCGCCATTCTAGCCAAG
R2587	T9304	T9266	punct	.,amplified
R2588	T9306	T9307	det	The,cassettes
R2589	T9307	T9315	nsubjpass	cassettes,ligated
R2590	T9308	T9309	nmod	IRES,geo
R2591	T9309	T9307	nmod	geo,cassettes
R2592	T9310	T9309	nmod	β,geo
R2593	T9311	T9309	punct	-,geo
R2594	T9312	T9309	cc	or,geo
R2595	T9313	T9314	compound	IRES,HygR
R2596	T9314	T9309	conj	HygR,geo
R2597	T9316	T9315	auxpass	were,ligated
R2598	T9317	T9315	prep	in,ligated
R2599	T9318	T9317	prep	between,in
R2600	T9319	T9320	det	the,fragments
R2601	T9320	T9318	pobj	fragments,between
R2602	T9321	T9320	nummod	two,fragments
R2603	T9322	T9320	compound	PCR,fragments
R2604	T9323	T9315	punct	.,ligated
R2605	T9325	T9326	det	The,cassette
R2606	T9326	T9330	nsubjpass	cassette,placed
R2607	T9327	T9328	compound	diphtheria,A
R2608	T9328	T9326	compound	A,cassette
R2609	T9329	T9328	compound	toxin,A
R2610	T9331	T9330	auxpass	was,placed
R2611	T9332	T9330	advmod	downstream,placed
R2612	T9333	T9332	prep	of,downstream
R2613	T9334	T9335	det	the,arm
R2614	T9335	T9333	pobj	arm,of
R2615	T9336	T9335	nummod	3,arm
R2616	T9337	T9336	punct	',3
R2617	T9338	T9330	punct	.,placed
R2618	T9340	T9341	prep	After,electroporated
R2619	T9342	T9340	pobj	linearization,After
R2620	T9343	T9342	prep	with,linearization
R2621	T9344	T9343	pobj	SacII,with
R2622	T9345	T9341	punct	", ",electroporated
R2623	T9346	T9347	det	these,vectors
R2624	T9347	T9341	nsubjpass	vectors,electroporated
R2625	T9348	T9347	compound	targeting,vectors
R2626	T9349	T9341	auxpass	were,electroporated
R2627	T9350	T9341	prep	into,electroporated
R2628	T9351	T9352	quantmod	2.0,107
R2629	T9352	T9354	nummod	107,cells
R2630	T9353	T9352	punct	×,107
R2631	T9354	T9350	pobj	cells,into
R2632	T9355	T9354	compound	RF8,cells
R2633	T9356	T9354	compound	ES,cells
R2634	T9357	T9358	punct	[,22
R2635	T9358	T9354	parataxis	22,cells
R2636	T9359	T9358	punct	],22
R2637	T9360	T9341	advcl	using,electroporated
R2638	T9361	T9362	det	a,pulser
R2639	T9362	T9360	dobj	pulser,using
R2640	T9363	T9362	compound	Gene,pulser
R2641	T9364	T9365	punct	(,BIORAD
R2642	T9365	T9362	parataxis	BIORAD,pulser
R2643	T9366	T9365	punct	),BIORAD
R2644	T9367	T9341	punct	.,electroporated
R2645	T9369	T9370	amod	Transfected,cells
R2646	T9370	T9371	nsubjpass	cells,selected
R2647	T9372	T9371	auxpass	were,selected
R2648	T9373	T9371	prep	with,selected
R2649	T9374	T9375	nummod	250,μg
R2650	T9375	T9376	nmod	μg,G418
R2651	T9376	T9373	pobj	G418,with
R2652	T9377	T9378	punct	/,mL
R2653	T9378	T9375	prep	mL,μg
R2654	T9379	T9376	cc	or,G418
R2655	T9380	T9381	nummod	100,μg
R2656	T9381	T9382	nmod	μg,B
R2657	T9382	T9376	conj	B,G418
R2658	T9383	T9384	punct	/,mL
R2659	T9384	T9381	prep	mL,μg
R2660	T9385	T9382	compound	hygromycin,B
R2661	T9386	T9371	punct	", ",selected
R2662	T9387	T9371	advmod	respectively,selected
R2663	T9388	T9371	punct	.,selected
R2664	T9390	T9391	amod	Genomic,DNA
R2665	T9391	T9392	nsubjpass	DNA,screened
R2666	T9393	T9391	prep	from,DNA
R2667	T9394	T9395	npadvmod	G418,resistant
R2668	T9395	T9401	amod	resistant,colonies
R2669	T9396	T9394	punct	-,G418
R2670	T9397	T9394	cc	or,G418
R2671	T9398	T9399	compound	hygromycin,B
R2672	T9399	T9394	conj	B,G418
R2673	T9400	T9395	punct	-,resistant
R2674	T9401	T9393	pobj	colonies,from
R2675	T9402	T9392	auxpass	was,screened
R2676	T9403	T9392	prep	for,screened
R2677	T9404	T9405	amod	homologous,recombination
R2678	T9405	T9403	pobj	recombination,for
R2679	T9406	T9392	agent	by,screened
R2680	T9407	T9408	compound	Southern,blotting
R2681	T9408	T9406	pobj	blotting,by
R2682	T9409	T9392	punct	.,screened
R2683	T9832	T9833	compound	Southern,blot
R2684	T9833	T9834	compound	blot,screening
R2685	T9835	T9834	prep	for,screening
R2686	T9836	T9837	amod	homologous,recombination
R2687	T9837	T9835	pobj	recombination,for
R2688	T9839	T9840	nmod	ES,cells
R2689	T9840	T9841	nmod	cells,DNA
R2690	T9841	T9843	nsubjpass	DNA,extracted
R2691	T9842	T9841	amod	genomic,DNA
R2692	T9844	T9843	auxpass	was,extracted
R2693	T9845	T9843	prep	with,extracted
R2694	T9846	T9847	nmod	PUREGENE,Solution
R2695	T9847	T9845	pobj	Solution,with
R2696	T9848	T9846	punct	™,PUREGENE
R2697	T9849	T9850	compound	Cell,Lysis
R2698	T9850	T9847	compound	Lysis,Solution
R2699	T9851	T9852	punct	(,systems
R2700	T9852	T9847	parataxis	systems,Solution
R2701	T9853	T9852	compound	Gentra,systems
R2702	T9854	T9852	punct	),systems
R2703	T9855	T9843	punct	.,extracted
R2704	T9857	T9858	prep	For,digested
R2705	T9859	T9860	nummod	5,analysis
R2706	T9860	T9857	pobj	analysis,For
R2707	T9861	T9859	punct	',5
R2708	T9862	T9863	compound	Southern,blot
R2709	T9863	T9860	compound	blot,analysis
R2710	T9864	T9858	punct	", ",digested
R2711	T9865	T9866	amod	genomic,DNA
R2712	T9866	T9858	nsubjpass	DNA,digested
R2713	T9867	T9858	auxpass	was,digested
R2714	T9868	T9858	advmod	first,digested
R2715	T9869	T9858	prep	with,digested
R2716	T9870	T9869	pobj	PstI,with
R2717	T9871	T9858	punct	", ",digested
R2718	T9872	T9873	advmod	then,separated
R2719	T9873	T9858	conj	separated,digested
R2720	T9874	T9873	prep	on,separated
R2721	T9875	T9876	det	an,gel
R2722	T9876	T9874	pobj	gel,on
R2723	T9877	T9878	nummod	0.8,%
R2724	T9878	T9876	compound	%,gel
R2725	T9879	T9876	compound	agarose,gel
R2726	T9880	T9873	cc	and,separated
R2727	T9881	T9873	conj	transferred,separated
R2728	T9882	T9881	prep	to,transferred
R2729	T9883	T9884	det	a,membrane
R2730	T9884	T9882	pobj	membrane,to
R2731	T9885	T9884	compound	nylon,membrane
R2732	T9886	T9887	mark	as,described
R2733	T9887	T9881	advcl	described,transferred
R2734	T9888	T9889	punct	[,20
R2735	T9889	T9887	parataxis	20,described
R2736	T9890	T9889	punct	],20
R2737	T9891	T9858	punct	.,digested
R2738	T9893	T9894	det	A,probe
R2739	T9894	T9899	nsubjpass	probe,amplified
R2740	T9895	T9896	nummod	560,bp
R2741	T9896	T9894	nmod	bp,probe
R2742	T9897	T9894	nummod	5,probe
R2743	T9898	T9897	punct	',5
R2744	T9900	T9899	auxpass	was,amplified
R2745	T9901	T9899	advcl	using,amplified
R2746	T9902	T9903	det	the,ESG1S5
R2747	T9903	T9901	dobj	ESG1S5,using
R2748	T9904	T9905	punct	(,GATGGTGGTGGTGACTCAGAG
R2749	T9905	T9903	parataxis	GATGGTGGTGGTGACTCAGAG,ESG1S5
R2750	T9906	T9905	nummod	5,GATGGTGGTGGTGACTCAGAG
R2751	T9907	T9906	punct	',5
R2752	T9908	T9905	punct	-,GATGGTGGTGGTGACTCAGAG
R2753	T9909	T9905	punct	-,GATGGTGGTGGTGACTCAGAG
R2754	T9910	T9905	nummod	3,GATGGTGGTGGTGACTCAGAG
R2755	T9911	T9905	punct	',GATGGTGGTGGTGACTCAGAG
R2756	T9912	T9905	punct	),GATGGTGGTGGTGACTCAGAG
R2757	T9913	T9903	cc	and,ESG1S5
R2758	T9914	T9903	conj	ESG1AS5,ESG1S5
R2759	T9915	T9901	prep	as,using
R2760	T9916	T9917	punct	(,primers
R2761	T9917	T9915	pobj	primers,as
R2762	T9918	T9919	nummod	5,CCTCCATTGCCTCTATATCAG
R2763	T9919	T9917	nmod	CCTCCATTGCCTCTATATCAG,primers
R2764	T9920	T9918	punct	',5
R2765	T9921	T9919	punct	-,CCTCCATTGCCTCTATATCAG
R2766	T9922	T9919	punct	-,CCTCCATTGCCTCTATATCAG
R2767	T9923	T9919	nummod	3,CCTCCATTGCCTCTATATCAG
R2768	T9924	T9919	punct	',CCTCCATTGCCTCTATATCAG
R2769	T9925	T9919	punct	),CCTCCATTGCCTCTATATCAG
R2770	T9926	T9899	punct	.,amplified
R2771	T9928	T9929	det	The,probe
R2772	T9929	T9930	nsubj	probe,labeled
R2773	T9931	T9930	advmod	specifically,labeled
R2774	T9932	T9933	det	an,band
R2775	T9933	T9930	dobj	band,labeled
R2776	T9934	T9935	nummod	18,kbp
R2777	T9935	T9933	compound	kbp,band
R2778	T9936	T9933	prep	from,band
R2779	T9937	T9938	det	the,locus
R2780	T9938	T9936	pobj	locus,from
R2781	T9939	T9938	nmod	wild,locus
R2782	T9940	T9939	punct	-,wild
R2783	T9941	T9938	compound	type,locus
R2784	T9942	T9933	punct	", ",band
R2785	T9943	T9944	det	a,band
R2786	T9944	T9933	conj	band,band
R2787	T9945	T9946	nummod	15,kbp
R2788	T9946	T9944	compound	kbp,band
R2789	T9947	T9944	prep	from,band
R2790	T9948	T9949	det	the,locus
R2791	T9949	T9947	pobj	locus,from
R2792	T9950	T9951	compound	β,geo
R2793	T9951	T9949	compound	geo,locus
R2794	T9952	T9951	punct	-,geo
R2795	T9953	T9944	punct	", ",band
R2796	T9954	T9944	cc	and,band
R2797	T9955	T9956	det	a,band
R2798	T9956	T9944	conj	band,band
R2799	T9957	T9958	nummod	12,kbp
R2800	T9958	T9956	compound	kbp,band
R2801	T9959	T9956	prep	from,band
R2802	T9960	T9961	det	the,locus
R2803	T9961	T9959	pobj	locus,from
R2804	T9962	T9961	compound	HygR,locus
R2805	T9963	T9930	punct	.,labeled
R2806	T9965	T9966	amod	Genomic,DNA
R2807	T9966	T9967	nsubjpass	DNA,digested
R2808	T9968	T9967	auxpass	was,digested
R2809	T9969	T9967	advmod	also,digested
R2810	T9970	T9967	prep	with,digested
R2811	T9971	T9970	pobj	SpeI,with
R2812	T9972	T9967	prep	for,digested
R2813	T9973	T9974	nummod	3,analysis
R2814	T9974	T9972	pobj	analysis,for
R2815	T9975	T9973	punct	',3
R2816	T9976	T9977	compound	Southern,blot
R2817	T9977	T9974	compound	blot,analysis
R2818	T9978	T9967	punct	.,digested
R2819	T9980	T9981	det	A,probe
R2820	T9981	T9986	nsubjpass	probe,amplified
R2821	T9982	T9983	nummod	"1,010",bp
R2822	T9983	T9981	nmod	bp,probe
R2823	T9984	T9981	nummod	3,probe
R2824	T9985	T9984	punct	',3
R2825	T9987	T9986	auxpass	was,amplified
R2826	T9988	T9986	prep	with,amplified
R2827	T9989	T9990	det	the,primers
R2828	T9990	T9988	pobj	primers,with
R2829	T9991	T9990	nmod	pH34U,primers
R2830	T9992	T9991	punct	-,pH34U
R2831	T9993	T9991	nummod	8000,pH34U
R2832	T9994	T9995	punct	(,CCAACCAGCCAGAGTTTCAGTTAT
R2833	T9995	T9991	parataxis	CCAACCAGCCAGAGTTTCAGTTAT,pH34U
R2834	T9996	T9995	nummod	5,CCAACCAGCCAGAGTTTCAGTTAT
R2835	T9997	T9996	punct	',5
R2836	T9998	T9995	punct	-,CCAACCAGCCAGAGTTTCAGTTAT
R2837	T9999	T9995	punct	-,CCAACCAGCCAGAGTTTCAGTTAT
R2838	T10000	T9995	nummod	3,CCAACCAGCCAGAGTTTCAGTTAT
R2839	T10001	T9995	punct	',CCAACCAGCCAGAGTTTCAGTTAT
R2840	T10002	T9995	punct	),CCAACCAGCCAGAGTTTCAGTTAT
R2841	T10003	T9991	cc	and,pH34U
R2842	T10004	T9991	conj	pH34L,pH34U
R2843	T10005	T10004	punct	-,pH34L
R2844	T10006	T10004	nummod	9000,pH34L
R2845	T10007	T10008	punct	(,GATAAGCTGCTGCCAAAAGACAAG
R2846	T10008	T10004	parataxis	GATAAGCTGCTGCCAAAAGACAAG,pH34L
R2847	T10009	T10008	nummod	5,GATAAGCTGCTGCCAAAAGACAAG
R2848	T10010	T10009	punct	',5
R2849	T10011	T10008	punct	-,GATAAGCTGCTGCCAAAAGACAAG
R2850	T10012	T10008	punct	-,GATAAGCTGCTGCCAAAAGACAAG
R2851	T10013	T10008	nummod	3,GATAAGCTGCTGCCAAAAGACAAG
R2852	T10014	T10008	punct	',GATAAGCTGCTGCCAAAAGACAAG
R2853	T10015	T10008	punct	),GATAAGCTGCTGCCAAAAGACAAG
R2854	T10016	T9986	punct	.,amplified
R2855	T10018	T10019	det	The,probe
R2856	T10019	T10020	nsubj	probe,hybridized
R2857	T10021	T10020	prep	to,hybridized
R2858	T10022	T10023	det	an,band
R2859	T10023	T10021	pobj	band,to
R2860	T10024	T10025	nummod	11.5,kbp
R2861	T10025	T10023	compound	kbp,band
R2862	T10026	T10023	prep	from,band
R2863	T10027	T10028	det	the,locus
R2864	T10028	T10026	pobj	locus,from
R2865	T10029	T10030	amod	wild,type
R2866	T10030	T10028	compound	type,locus
R2867	T10031	T10030	punct	-,type
R2868	T10032	T10023	punct	", ",band
R2869	T10033	T10034	det	a,band
R2870	T10034	T10023	conj	band,band
R2871	T10035	T10036	nummod	12.5,kbp
R2872	T10036	T10034	compound	kbp,band
R2873	T10037	T10034	prep	from,band
R2874	T10038	T10039	det	the,locus
R2875	T10039	T10037	pobj	locus,from
R2876	T10040	T10041	compound	β,geo
R2877	T10041	T10039	compound	geo,locus
R2878	T10042	T10041	punct	-,geo
R2879	T10043	T10034	punct	", ",band
R2880	T10044	T10034	cc	and,band
R2881	T10045	T10046	det	a,band
R2882	T10046	T10034	conj	band,band
R2883	T10047	T10048	nummod	9.5,kbp
R2884	T10048	T10046	compound	kbp,band
R2885	T10049	T10046	prep	from,band
R2886	T10050	T10051	det	the,locus
R2887	T10051	T10049	pobj	locus,from
R2888	T10052	T10051	compound	HygR,locus
R2889	T10053	T10020	punct	.,hybridized
R2891	T10415	T10414	prep	of,Generation
R2892	T10416	T10417	amod	anti-ESG1,antibodies
R2893	T10417	T10415	pobj	antibodies,of
R2894	T10418	T10417	amod	polyclonal,antibodies
R2895	T10420	T10421	det	The,sequence
R2896	T10421	T10423	nsubjpass	sequence,amplified
R2897	T10422	T10421	amod	coding,sequence
R2898	T10424	T10421	prep	of,sequence
R2899	T10425	T10424	pobj	Esg1,of
R2900	T10426	T10423	auxpass	was,amplified
R2901	T10427	T10423	agent	by,amplified
R2902	T10428	T10427	pobj	PCR,by
R2903	T10429	T10423	prep	with,amplified
R2904	T10430	T10431	det	the,primers
R2905	T10431	T10429	pobj	primers,with
R2906	T10432	T10433	nmod	pH34,s
R2907	T10433	T10431	nmod	s,primers
R2908	T10434	T10433	punct	-,s
R2909	T10435	T10433	nmod	gw,s
R2910	T10436	T10433	punct	-,s
R2911	T10437	T10438	punct	(,AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA
R2912	T10438	T10433	parataxis	AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA,s
R2913	T10439	T10438	nummod	5,AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA
R2914	T10440	T10439	punct	',5
R2915	T10441	T10438	punct	-,AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA
R2916	T10442	T10438	punct	-,AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA
R2917	T10443	T10438	nummod	3,AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA
R2918	T10444	T10438	punct	',AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA
R2919	T10445	T10438	punct	),AAAAAGCAGGCTGGATGATGGTGACCCTCGTGA
R2920	T10446	T10433	cc	and,s
R2921	T10447	T10448	compound	pH34,as
R2922	T10448	T10433	conj	as,s
R2923	T10449	T10448	punct	-,as
R2924	T10450	T10448	compound	gw,as
R2925	T10451	T10448	punct	-,as
R2926	T10452	T10453	punct	(,AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA
R2927	T10453	T10448	parataxis	AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA,as
R2928	T10454	T10453	nummod	5,AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA
R2929	T10455	T10454	punct	',5
R2930	T10456	T10453	punct	-,AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA
R2931	T10457	T10453	punct	-,AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA
R2932	T10458	T10453	nummod	3,AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA
R2933	T10459	T10453	punct	',AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA
R2934	T10460	T10453	punct	),AGAAAGCTGGGTCTGCATCCAGGTCGGAGACA
R2935	T10461	T10423	punct	.,amplified
R2936	T10463	T10464	aux	To,construct
R2937	T10464	T10465	advcl	construct,subcloned
R2938	T10466	T10467	compound	pDONR,pH34
R2939	T10467	T10464	dobj	pH34,construct
R2940	T10468	T10467	punct	-,pH34
R2941	T10469	T10465	punct	", ",subcloned
R2942	T10470	T10471	det	the,product
R2943	T10471	T10465	nsubjpass	product,subcloned
R2944	T10472	T10471	amod	resulting,product
R2945	T10473	T10471	compound	PCR,product
R2946	T10474	T10465	auxpass	was,subcloned
R2947	T10475	T10465	prep	into,subcloned
R2948	T10476	T10475	pobj	pDONR201,into
R2949	T10477	T10478	punct	(,Invitrogen
R2950	T10478	T10476	parataxis	Invitrogen,pDONR201
R2951	T10479	T10478	punct	),Invitrogen
R2952	T10480	T10465	punct	.,subcloned
R2953	T10482	T10483	compound	pDONR,pH34
R2954	T10483	T10485	nsubjpass	pH34,interacted
R2955	T10484	T10483	punct	-,pH34
R2956	T10486	T10485	auxpass	was,interacted
R2957	T10487	T10485	prep	with,interacted
R2958	T10488	T10487	pobj	pDEST17,with
R2959	T10489	T10490	punct	(,Invitrogen
R2960	T10490	T10488	parataxis	Invitrogen,pDEST17
R2961	T10491	T10490	punct	),Invitrogen
R2962	T10492	T10485	prep	by,interacted
R2963	T10493	T10494	compound	LR,recombination
R2964	T10494	T10492	pobj	recombination,by
R2965	T10495	T10485	punct	.,interacted
R2966	T10497	T10498	prep	After,induced
R2967	T10499	T10497	pobj	introduction,After
R2968	T10500	T10499	prep	of,introduction
R2969	T10501	T10502	det	the,vector
R2970	T10502	T10500	pobj	vector,of
R2971	T10503	T10502	amod	resulting,vector
R2972	T10504	T10502	compound	expression,vector
R2973	T10505	T10506	compound	pDEST17,pH34
R2974	T10506	T10502	appos	pH34,vector
R2975	T10507	T10506	punct	-,pH34
R2976	T10508	T10499	prep	into,introduction
R2977	T10509	T10510	compound	BL21,AI
R2978	T10510	T10508	pobj	AI,into
R2979	T10511	T10510	punct	-,AI
R2980	T10512	T10510	nmod	E.,AI
R2981	T10513	T10510	nmod	coli,AI
R2982	T10514	T10515	punct	(,Invitrogen
R2983	T10515	T10499	parataxis	Invitrogen,introduction
R2984	T10516	T10515	punct	),Invitrogen
R2985	T10517	T10498	punct	", ",induced
R2986	T10518	T10519	amod	recombinant,protein
R2987	T10519	T10520	compound	protein,production
R2988	T10520	T10498	nsubjpass	production,induced
R2989	T10521	T10498	auxpass	was,induced
R2990	T10522	T10498	prep	according,induced
R2991	T10523	T10522	prep	to,according
R2992	T10524	T10525	det	the,manufacture
R2993	T10525	T10526	poss	manufacture,protocol
R2994	T10526	T10523	pobj	protocol,to
R2995	T10527	T10525	case	's,manufacture
R2996	T10528	T10498	punct	.,induced
R2997	T10530	T10531	npadvmod	Histidine,tagged
R2998	T10531	T10533	amod	tagged,ESG1
R2999	T10532	T10531	punct	-,tagged
R3000	T10533	T10534	nsubjpass	ESG1,purified
R3001	T10535	T10534	auxpass	was,purified
R3002	T10536	T10534	advcl	using,purified
R3003	T10537	T10538	nmod	Ni,agarose
R3004	T10538	T10536	dobj	agarose,using
R3005	T10539	T10537	punct	-,Ni
R3006	T10540	T10537	amod	nitrilotriacetic,Ni
R3007	T10541	T10538	compound	acid,agarose
R3008	T10542	T10543	punct	(,Qiagen
R3009	T10543	T10538	parataxis	Qiagen,agarose
R3010	T10544	T10543	punct	),Qiagen
R3011	T10545	T10536	prep	under,using
R3012	T10546	T10547	compound	denaturing,conditions
R3013	T10547	T10545	pobj	conditions,under
R3014	T10548	T10536	prep	in,using
R3015	T10549	T10550	det	the,presence
R3016	T10550	T10548	pobj	presence,in
R3017	T10551	T10550	prep	of,presence
R3018	T10552	T10553	nummod	8,M
R3019	T10553	T10554	compound	M,urea
R3020	T10554	T10551	pobj	urea,of
R3021	T10555	T10534	punct	.,purified
R3022	T10557	T10558	prep	After,injected
R3023	T10559	T10557	pobj	dialysis,After
R3024	T10560	T10559	prep	against,dialysis
R3025	T10561	T10562	nummod	6,M
R3026	T10562	T10563	compound	M,urea
R3027	T10563	T10560	pobj	urea,against
R3028	T10564	T10558	punct	", ",injected
R3029	T10565	T10566	det	the,proteins
R3030	T10566	T10558	nsubjpass	proteins,injected
R3031	T10567	T10566	amod	recombinant,proteins
R3032	T10568	T10558	auxpass	were,injected
R3033	T10569	T10558	prep	into,injected
R3034	T10570	T10571	nmod	New,Zealand
R3035	T10571	T10572	nmod	Zealand,rabbits
R3036	T10572	T10569	pobj	rabbits,into
R3037	T10573	T10572	amod	White,rabbits
R3038	T10574	T10575	aux	to,generate
R3039	T10575	T10558	advcl	generate,injected
R3040	T10576	T10577	amod	anti-ESG1,antibodies
R3041	T10577	T10575	dobj	antibodies,generate
R3042	T10578	T10577	amod	polyclonal,antibodies
R3043	T10579	T10558	punct	.,injected
R3044	T10856	T10857	compound	Western,blot
R3045	T10859	T10860	prep	After,separated
R3046	T10861	T10859	pobj	preparation,After
R3047	T10862	T10861	prep	of,preparation
R3048	T10863	T10864	compound	ES,extracts
R3049	T10864	T10862	pobj	extracts,of
R3050	T10865	T10864	compound	cell,extracts
R3051	T10866	T10861	prep	with,preparation
R3052	T10867	T10868	compound	M,Per
R3053	T10868	T10866	pobj	Per,with
R3054	T10869	T10868	punct	-,Per
R3055	T10870	T10871	punct	(,Pierce
R3056	T10871	T10868	parataxis	Pierce,Per
R3057	T10872	T10871	punct	),Pierce
R3058	T10873	T10860	punct	", ",separated
R3059	T10874	T10875	amod	cellular,proteins
R3060	T10875	T10860	nsubjpass	proteins,separated
R3061	T10876	T10860	auxpass	were,separated
R3062	T10877	T10860	prep	on,separated
R3063	T10878	T10879	nmod	sodium,sulfate
R3064	T10879	T10881	nmod	sulfate,gels
R3065	T10880	T10879	nmod	dodecyl,sulfate
R3066	T10881	T10877	pobj	gels,on
R3067	T10882	T10879	punct	(,sulfate
R3068	T10883	T10879	appos	SDS,sulfate
R3069	T10884	T10881	punct	),gels
R3070	T10885	T10881	punct	-,gels
R3071	T10886	T10887	nummod	14,%
R3072	T10887	T10881	compound	%,gels
R3073	T10888	T10881	compound	polyacrylamide,gels
R3074	T10889	T10860	cc	and,separated
R3075	T10890	T10860	conj	transferred,separated
R3076	T10891	T10890	prep	to,transferred
R3077	T10892	T10893	compound	nitrocellulose,membranes
R3078	T10893	T10891	pobj	membranes,to
R3079	T10894	T10895	punct	(,Millipore
R3080	T10895	T10890	parataxis	Millipore,transferred
R3081	T10896	T10895	punct	),Millipore
R3082	T10897	T10860	punct	.,separated
R3083	T10899	T10900	nsubjpass	Membranes,incubated
R3084	T10901	T10900	auxpass	were,incubated
R3085	T10902	T10900	prep	with,incubated
R3086	T10903	T10904	nmod	anti-ESG1,antibodies
R3087	T10904	T10902	pobj	antibodies,with
R3088	T10905	T10906	punct	(,dilution
R3089	T10906	T10903	parataxis	dilution,anti-ESG1
R3090	T10907	T10908	quantmod	1,500
R3091	T10908	T10906	nummod	500,dilution
R3092	T10909	T10908	punct	/,500
R3093	T10910	T10906	punct	),dilution
R3094	T10911	T10903	punct	", ",anti-ESG1
R3095	T10912	T10903	conj	anti-Oct3,anti-ESG1
R3096	T10913	T10912	punct	/,anti-Oct3
R3097	T10914	T10912	nummod	4,anti-Oct3
R3098	T10915	T10916	punct	(,Biotechnology
R3099	T10916	T10912	parataxis	Biotechnology,anti-Oct3
R3100	T10917	T10918	quantmod	1,500
R3101	T10918	T10916	dep	500,Biotechnology
R3102	T10919	T10918	punct	/,500
R3103	T10920	T10916	punct	;,Biotechnology
R3104	T10921	T10916	compound	Santa,Biotechnology
R3105	T10922	T10916	compound	Cruz,Biotechnology
R3106	T10923	T10916	punct	),Biotechnology
R3107	T10924	T10912	punct	", ",anti-Oct3
R3108	T10925	T10912	conj	anti-CDK4,anti-Oct3
R3109	T10926	T10927	punct	(,Biotechnology
R3110	T10927	T10925	parataxis	Biotechnology,anti-CDK4
R3111	T10928	T10929	quantmod	1,200
R3112	T10929	T10927	dep	200,Biotechnology
R3113	T10930	T10929	punct	/,200
R3114	T10931	T10927	punct	;,Biotechnology
R3115	T10932	T10927	compound	Santa,Biotechnology
R3116	T10933	T10927	compound	Cruz,Biotechnology
R3117	T10934	T10927	punct	),Biotechnology
R3118	T10935	T10925	punct	", ",anti-CDK4
R3119	T10936	T10925	cc	and,anti-CDK4
R3120	T10937	T10925	conj	anti-GFP,anti-CDK4
R3121	T10938	T10939	punct	(,MBL
R3122	T10939	T10937	parataxis	MBL,anti-GFP
R3123	T10940	T10941	quantmod	1,1000
R3124	T10941	T10939	dep	1000,MBL
R3125	T10942	T10941	punct	/,1000
R3126	T10943	T10939	punct	;,MBL
R3127	T10944	T10939	punct	),MBL
R3128	T10945	T10904	amod	primary,antibodies
R3129	T10946	T10900	punct	.,incubated
R3130	T10948	T10949	compound	Horseradish,peroxidase
R3131	T10949	T10950	npadvmod	peroxidase,conjugated
R3132	T10950	T10952	amod	conjugated,immunoglobulins
R3133	T10951	T10950	punct	-,conjugated
R3134	T10952	T10956	nsubjpass	immunoglobulins,used
R3135	T10953	T10952	amod	anti-rabbit,immunoglobulins
R3136	T10954	T10953	cc	and,anti-rabbit
R3137	T10955	T10953	conj	anti-mouse,anti-rabbit
R3138	T10957	T10958	punct	(,Signaling
R3139	T10958	T10952	parataxis	Signaling,immunoglobulins
R3140	T10959	T10960	quantmod	1,5000
R3141	T10960	T10958	dep	5000,Signaling
R3142	T10961	T10960	punct	/,5000
R3143	T10962	T10958	punct	;,Signaling
R3144	T10963	T10958	compound	Cell,Signaling
R3145	T10964	T10958	punct	),Signaling
R3146	T10965	T10956	auxpass	were,used
R3147	T10966	T10967	aux	to,detect
R3148	T10967	T10956	advcl	detect,used
R3149	T10968	T10969	compound	antibody,binding
R3150	T10969	T10967	dobj	binding,detect
R3151	T10970	T10956	punct	.,used
R3152	T10972	T10973	nsubj	We,visualized
R3153	T10974	T10975	amod	bound,antibody
R3154	T10975	T10973	dobj	antibody,visualized
R3155	T10976	T10973	prep	with,visualized
R3156	T10977	T10978	det	an,System
R3157	T10978	T10976	pobj	System,with
R3158	T10979	T10978	compound	ECL,System
R3159	T10980	T10981	compound	Western,Blotting
R3160	T10981	T10978	compound	Blotting,System
R3161	T10982	T10978	compound	Detection,System
R3162	T10983	T10984	punct	(,Amersham
R3163	T10984	T10978	parataxis	Amersham,System
R3164	T10985	T10984	punct	),Amersham
R3165	T10986	T10973	punct	.,visualized
R3168	T11477	T11476	prep	of,Derivation
R3169	T11478	T11479	npadvmod	ESG1,deficient
R3170	T11479	T11481	amod	deficient,cells
R3171	T11480	T11479	punct	-,deficient
R3172	T11481	T11477	pobj	cells,of
R3173	T11482	T11481	compound	ES,cells
R3174	T11483	T11476	prep	from,Derivation
R3175	T11484	T11483	pobj	blastocysts,from
R3176	T11486	T11487	nmod	Esg1,mice
R3177	T11487	T11498	nsubjpass	mice,injected
R3178	T11488	T11486	punct	+,Esg1
R3179	T11489	T11486	punct	/,Esg1
R3180	T11490	T11486	punct	-,Esg1
R3181	T11491	T11486	cc	or,Esg1
R3182	T11492	T11486	conj	ESG1,Esg1
R3183	T11493	T11492	punct	-,ESG1
R3184	T11494	T11492	punct	/,ESG1
R3185	T11495	T11492	punct	-,ESG1
R3186	T11496	T11487	nmod	mutant,mice
R3187	T11497	T11487	amod	female,mice
R3188	T11499	T11498	auxpass	were,injected
R3189	T11500	T11498	prep	with,injected
R3190	T11501	T11500	pobj	Tamoxifen,with
R3191	T11502	T11503	punct	(,μg
R3192	T11503	T11501	parataxis	μg,Tamoxifen
R3193	T11504	T11503	nummod	10,μg
R3194	T11505	T11503	punct	),μg
R3195	T11506	T11501	cc	and,Tamoxifen
R3196	T11507	T11508	compound	Depo,provera
R3197	T11508	T11501	conj	provera,Tamoxifen
R3198	T11509	T11508	punct	-,provera
R3199	T11510	T11511	punct	(,mg
R3200	T11511	T11508	parataxis	mg,provera
R3201	T11512	T11511	nummod	1,mg
R3202	T11513	T11511	punct	),mg
R3203	T11514	T11498	advmod	subcutaneously,injected
R3204	T11515	T11498	prep	on,injected
R3205	T11516	T11517	det	the,day
R3206	T11517	T11515	pobj	day,on
R3207	T11518	T11517	amod	third,day
R3208	T11519	T11517	prep	of,day
R3209	T11520	T11519	pobj	pregnancy,of
R3210	T11521	T11498	punct	.,injected
R3211	T11523	T11524	nummod	Four,days
R3212	T11524	T11525	npadvmod	days,later
R3213	T11525	T11526	advmod	later,flushed
R3214	T11527	T11526	punct	", ",flushed
R3215	T11528	T11526	nsubjpass	embryos,flushed
R3216	T11529	T11528	prep	in,embryos
R3217	T11530	T11529	pobj	diapause,in
R3218	T11531	T11526	auxpass	were,flushed
R3219	T11532	T11526	prep	out,flushed
R3220	T11533	T11532	prep	of,out
R3221	T11534	T11535	det	the,uterus
R3222	T11535	T11533	pobj	uterus,of
R3223	T11536	T11526	cc	and,flushed
R3224	T11537	T11526	conj	cultured,flushed
R3225	T11538	T11537	prep	on,cultured
R3226	T11539	T11540	compound	STO,cells
R3227	T11540	T11538	pobj	cells,on
R3228	T11541	T11540	compound	feeder,cells
R3229	T11542	T11537	prep	in,cultured
R3230	T11543	T11544	nummod	four,well
R3231	T11544	T11546	compound	well,plates
R3232	T11545	T11544	punct	-,well
R3233	T11546	T11542	pobj	plates,in
R3234	T11547	T11537	prep	in,cultured
R3235	T11548	T11549	poss	Dulbecco,Medium
R3236	T11549	T11547	pobj	Medium,in
R3237	T11550	T11548	case	's,Dulbecco
R3238	T11551	T11549	amod	Modified,Medium
R3239	T11552	T11549	compound	Eagle,Medium
R3240	T11553	T11549	punct	(,Medium
R3241	T11554	T11549	appos	DMEM,Medium
R3242	T11555	T11549	punct	),Medium
R3243	T11556	T11549	acl	supplemented,Medium
R3244	T11557	T11556	prep	with,supplemented
R3245	T11558	T11559	nummod	20,%
R3246	T11559	T11560	nmod	%,Serum
R3247	T11560	T11557	pobj	Serum,with
R3248	T11561	T11560	amod	Fetal,Serum
R3249	T11562	T11560	amod	Bovine,Serum
R3250	T11563	T11564	punct	(,Hyclone
R3251	T11564	T11560	parataxis	Hyclone,Serum
R3252	T11565	T11564	punct	),Hyclone
R3253	T11566	T11560	punct	", ",Serum
R3254	T11567	T11568	nummod	0.1,mM
R3255	T11568	T11569	nmod	mM,Acids
R3256	T11569	T11560	conj	Acids,Serum
R3257	T11570	T11569	amod	Non-Essential,Acids
R3258	T11571	T11569	compound	Amino,Acids
R3259	T11572	T11573	punct	(,Invitrogen
R3260	T11573	T11569	parataxis	Invitrogen,Acids
R3261	T11574	T11573	punct	),Invitrogen
R3262	T11575	T11569	punct	", ",Acids
R3263	T11576	T11577	nummod	2,mM
R3264	T11577	T11578	compound	mM,glutamine
R3265	T11578	T11569	conj	glutamine,Acids
R3266	T11579	T11578	compound	L,glutamine
R3267	T11580	T11578	punct	-,glutamine
R3268	T11581	T11582	punct	(,Invitrogen
R3269	T11582	T11578	parataxis	Invitrogen,glutamine
R3270	T11583	T11582	punct	),Invitrogen
R3271	T11584	T11578	punct	", ",glutamine
R3272	T11585	T11586	nummod	50,U
R3273	T11586	T11587	nmod	U,Streptomysin
R3274	T11587	T11578	conj	Streptomysin,glutamine
R3275	T11588	T11589	punct	/,ml
R3276	T11589	T11586	prep	ml,U
R3277	T11590	T11587	compound	Penicillin,Streptomysin
R3278	T11591	T11587	punct	-,Streptomysin
R3279	T11592	T11593	punct	(,Invitrogen
R3280	T11593	T11587	parataxis	Invitrogen,Streptomysin
R3281	T11594	T11593	punct	),Invitrogen
R3282	T11595	T11587	punct	", ",Streptomysin
R3283	T11596	T11587	cc	and,Streptomysin
R3284	T11597	T11598	nummod	0.11,mM
R3285	T11598	T11599	nmod	mM,mercaptoethanol
R3286	T11599	T11587	conj	mercaptoethanol,Streptomysin
R3287	T11600	T11599	nummod	2,mercaptoethanol
R3288	T11601	T11599	punct	-,mercaptoethanol
R3289	T11602	T11603	punct	(,Invitrogen
R3290	T11603	T11599	parataxis	Invitrogen,mercaptoethanol
R3291	T11604	T11603	punct	),Invitrogen
R3292	T11605	T11526	punct	.,flushed
R3293	T11607	T11608	prep	After,harvested
R3294	T11609	T11610	nummod	six,days
R3295	T11610	T11607	pobj	days,After
R3296	T11611	T11608	punct	", ",harvested
R3297	T11612	T11613	det	the,mass
R3298	T11613	T11608	nsubjpass	mass,harvested
R3299	T11614	T11613	amod	central,mass
R3300	T11615	T11613	prep	of,mass
R3301	T11616	T11617	det	each,explant
R3302	T11617	T11615	pobj	explant,of
R3303	T11618	T11608	auxpass	was,harvested
R3304	T11619	T11608	punct	", ",harvested
R3305	T11620	T11608	conj	rinsed,harvested
R3306	T11621	T11620	prep	in,rinsed
R3307	T11622	T11621	pobj	PBS,in
R3308	T11623	T11620	punct	", ",rinsed
R3309	T11624	T11620	cc	and,rinsed
R3310	T11625	T11620	conj	placed,rinsed
R3311	T11626	T11625	prep	in,placed
R3312	T11627	T11628	det	a,drop
R3313	T11628	T11626	pobj	drop,in
R3314	T11629	T11628	prep	of,drop
R3315	T11630	T11629	pobj	trypsin,of
R3316	T11631	T11625	prep	for,placed
R3317	T11632	T11633	det	a,minutes
R3318	T11633	T11631	pobj	minutes,for
R3319	T11634	T11633	amod	few,minutes
R3320	T11635	T11608	punct	.,harvested
R3321	T11637	T11638	det	The,mass
R3322	T11638	T11640	nsubjpass	mass,collected
R3323	T11639	T11638	compound	cell,mass
R3324	T11641	T11640	auxpass	was,collected
R3325	T11642	T11640	prep	with,collected
R3326	T11643	T11644	det	a,pipette
R3327	T11644	T11642	pobj	pipette,with
R3328	T11645	T11646	advmod	finely,drawn
R3329	T11646	T11644	amod	drawn,pipette
R3330	T11647	T11646	punct	-,drawn
R3331	T11648	T11646	prt	out,drawn
R3332	T11649	T11644	compound	Pasteur,pipette
R3333	T11650	T11644	acl	preloaded,pipette
R3334	T11651	T11650	prep	with,preloaded
R3335	T11652	T11651	pobj	medium,with
R3336	T11653	T11640	punct	", ",collected
R3337	T11654	T11640	advcl	ensuring,collected
R3338	T11655	T11656	amod	minimal,carryover
R3339	T11656	T11654	dobj	carryover,ensuring
R3340	T11657	T11656	prep	of,carryover
R3341	T11658	T11659	det	the,trypsin
R3342	T11659	T11657	pobj	trypsin,of
R3343	T11660	T11640	punct	.,collected
R3344	T11662	T11663	det	The,cells
R3345	T11663	T11664	nsubjpass	cells,transfered
R3346	T11665	T11664	auxpass	were,transfered
R3347	T11666	T11664	advmod	gently,transfered
R3348	T11667	T11664	prep	into,transfered
R3349	T11668	T11669	det	a,well
R3350	T11669	T11667	pobj	well,into
R3351	T11670	T11669	amod	fresh,well
R3352	T11671	T11664	prep	with,transfered
R3353	T11672	T11673	nummod	20,%
R3354	T11673	T11674	nmod	%,medium
R3355	T11674	T11671	pobj	medium,with
R3356	T11675	T11676	npadvmod	FBS,containing
R3357	T11676	T11674	amod	containing,medium
R3358	T11677	T11676	punct	-,containing
R3359	T11678	T11664	punct	.,transfered
R3360	T11680	T11681	det	The,colonies
R3361	T11681	T11686	nsubjpass	colonies,passaged
R3362	T11682	T11681	amod	resulting,colonies
R3363	T11683	T11681	amod	primary,colonies
R3364	T11684	T11681	compound	ES,colonies
R3365	T11685	T11681	compound	cell,colonies
R3366	T11687	T11686	auxpass	were,passaged
R3367	T11688	T11686	advmod	individually,passaged
R3368	T11689	T11686	prep	into,passaged
R3369	T11690	T11689	pobj	wells,into
R3370	T11691	T11690	prep	of,wells
R3371	T11692	T11693	nummod	four,well
R3372	T11693	T11695	compound	well,plates
R3373	T11694	T11693	punct	-,well
R3374	T11695	T11691	pobj	plates,of
R3375	T11696	T11690	acl	containing,wells
R3376	T11697	T11698	compound	STO,layers
R3377	T11698	T11696	dobj	layers,containing
R3378	T11699	T11700	compound	feeder,cell
R3379	T11700	T11698	compound	cell,layers
R3380	T11701	T11686	punct	.,passaged
R3381	T11703	T11704	advmod	Thereafter,expanded
R3382	T11705	T11704	punct	", ",expanded
R3383	T11706	T11704	nsubjpass	cells,expanded
R3384	T11707	T11704	auxpass	were,expanded
R3385	T11708	T11704	prep	by,expanded
R3386	T11709	T11708	pobj	trypsinization,by
R3387	T11710	T11709	prep	of,trypsinization
R3388	T11711	T11712	det	the,culture
R3389	T11712	T11710	pobj	culture,of
R3390	T11713	T11712	amod	entire,culture
R3391	T11714	T11704	punct	.,expanded
R3392	T11885	T11886	amod	Total,RNA
R3393	T11886	T11887	nsubjpass	RNA,labeled
R3394	T11888	T11886	prep	from,RNA
R3395	T11889	T11890	amod	wild,type
R3396	T11890	T11892	compound	type,cells
R3397	T11891	T11890	punct	-,type
R3398	T11892	T11888	pobj	cells,from
R3399	T11893	T11892	compound	ES,cells
R3400	T11894	T11892	cc	and,cells
R3401	T11895	T11896	nmod	ESG1,cells
R3402	T11896	T11892	conj	cells,cells
R3403	T11897	T11895	punct	-,ESG1
R3404	T11898	T11895	punct	/,ESG1
R3405	T11899	T11895	punct	-,ESG1
R3406	T11900	T11896	compound	ES,cells
R3407	T11901	T11887	auxpass	was,labeled
R3408	T11902	T11887	prep	with,labeled
R3409	T11903	T11902	pobj	Cy3,with
R3410	T11904	T11903	cc	and,Cy3
R3411	T11905	T11903	conj	Cy5,Cy3
R3412	T11906	T11887	punct	", ",labeled
R3413	T11907	T11887	advmod	respectively,labeled
R3414	T11908	T11887	punct	.,labeled
R3415	T11910	T11911	det	The,samples
R3416	T11911	T11912	nsubjpass	samples,hybridized
R3417	T11913	T11912	auxpass	were,hybridized
R3418	T11914	T11912	prep	to,hybridized
R3419	T11915	T11916	det	a,Microarray
R3420	T11916	T11914	pobj	Microarray,to
R3421	T11917	T11916	compound	Mouse,Microarray
R3422	T11918	T11916	compound	Development,Microarray
R3423	T11919	T11920	punct	(,Algilent
R3424	T11920	T11916	parataxis	Algilent,Microarray
R3425	T11921	T11920	punct	),Algilent
R3426	T11922	T11912	prep	according,hybridized
R3427	T11923	T11922	prep	to,according
R3428	T11924	T11925	det	the,manufacturer
R3429	T11925	T11926	poss	manufacturer,protocol
R3430	T11926	T11923	pobj	protocol,to
R3431	T11927	T11925	case	's,manufacturer
R3432	T11928	T11912	punct	.,hybridized
R3433	T11930	T11931	nsubjpass	Arrays,scanned
R3434	T11932	T11931	auxpass	were,scanned
R3435	T11933	T11931	prep	with,scanned
R3436	T11934	T11935	det	a,System
R3437	T11935	T11933	pobj	System,with
R3438	T11936	T11935	compound	G2565BA,System
R3439	T11937	T11935	compound	Microarray,System
R3440	T11938	T11935	compound	Scanner,System
R3441	T11939	T11940	punct	(,Agilent
R3442	T11940	T11935	parataxis	Agilent,System
R3443	T11941	T11940	punct	),Agilent
R3444	T11942	T11931	punct	.,scanned
R3445	T11944	T11945	nsubjpass	Hybridization,repeated
R3446	T11946	T11945	auxpass	was,repeated
R3447	T11947	T11945	prep	with,repeated
R3448	T11948	T11949	nummod	two,clones
R3449	T11949	T11947	pobj	clones,with
R3450	T11950	T11949	amod	independent,clones
R3451	T11951	T11945	punct	.,repeated
R3452	T11953	T11954	nsubjpass	Data,analyzed
R3453	T11955	T11954	auxpass	were,analyzed
R3454	T11956	T11954	prep	with,analyzed
R3455	T11957	T11958	compound	GeneSprings,software
R3456	T11958	T11956	pobj	software,with
R3457	T11959	T11960	punct	(,Genetics
R3458	T11960	T11958	parataxis	Genetics,software
R3459	T11961	T11960	compound	Silico,Genetics
R3460	T11962	T11960	punct	),Genetics
R3461	T11963	T11954	punct	.,analyzed

PMC:1420271 / 14426-21475 JSONTXT

Annnotations TAB JSON ListView MergeView

craft-ca-core-dev

craft-ca-core-ex-dev

craft-sa-dev

PMC:1420271 / 14426-21475 JSON TXT