> top > docs > PMC:1359074 > spans > 43717-43942 > annotations

PMC:1359074 / 43717-43942 JSONTXT

Annnotations TAB JSON ListView MergeView

pmc-enju-pas

Id Subject Object Predicate Lexical cue
T20617 223-224 -RRB- denotes )
T20616 199-223 NN denotes 5′GCTTCACCACCAACCTCTTC3′
T20615 197-198 -COMMA- denotes ,
T20614 190-197 NN denotes MHB1689
T20613 186-189 CC denotes and
T20612 184-185 -COLON- denotes ;
T20611 160-184 NN denotes 5′CGAAGAATAAAAGGCCACCA3′
T20610 158-159 -COMMA- denotes ,
T20609 151-158 NN denotes MHB1688
T20608 143-150 NN denotes primers
T20607 142-143 -LRB- denotes (
T20606 133-141 NN denotes promoter
T20605 130-132 JJ denotes ɛy
T20604 126-129 DT denotes the
T20603 123-125 IN denotes of
T20602 118-122 CD denotes +140
T20601 115-117 TO denotes to
T20600 111-114 CD denotes −31
T20599 99-110 NN denotes nucleotides
T20598 96-98 TO denotes to
T20597 82-95 VB denotes corresponding
T20596 80-81 -COMMA- denotes ,
T20595 72-80 NN denotes amplicon
T20594 65-71 JJ denotes 172-bp
T20593 63-64 DT denotes a
T20592 55-62 VB denotes yielded
T20591 51-54 CC denotes and
T20590 41-50 VB denotes performed
T20589 37-40 VB denotes was
T20588 28-36 NN denotes promoter
T20587 25-27 JJ denotes ɛy
T20586 21-24 DT denotes the
T20585 18-20 IN denotes of
T20584 4-17 NN denotes amplification
T20583 0-3 NN denotes PCR
R14692 T20584 T20583 arg1Of amplification,PCR
R14693 T20584 T20585 arg1Of amplification,of
R14694 T20584 T20589 arg1Of amplification,was
R14695 T20584 T20590 arg2Of amplification,performed
R14696 T20584 T20592 arg1Of amplification,yielded
R14697 T20588 T20585 arg2Of promoter,of
R14698 T20588 T20586 arg1Of promoter,the
R14699 T20588 T20587 arg1Of promoter,ɛy
R14700 T20590 T20589 arg2Of performed,was
R14701 T20590 T20591 arg1Of performed,and
R14702 T20591 T20596 arg1Of and,","
R14703 T20591 T20597 arg1Of and,corresponding
R14704 T20592 T20591 arg2Of yielded,and
R14705 T20595 T20592 arg2Of amplicon,yielded
R14706 T20595 T20593 arg1Of amplicon,a
R14707 T20595 T20594 arg1Of amplicon,172-bp
R14708 T20598 T20597 arg2Of to,corresponding
R14709 T20599 T20598 arg2Of nucleotides,to
R14710 T20599 T20600 arg1Of nucleotides,−31
R14711 T20600 T20601 arg1Of −31,to
R14712 T20602 T20601 arg2Of +140,to
R14713 T20602 T20603 arg1Of +140,of
R14714 T20602 T20607 arg1Of +140,(
R14715 T20606 T20603 arg2Of promoter,of
R14716 T20606 T20604 arg1Of promoter,the
R14717 T20606 T20605 arg1Of promoter,ɛy
R14718 T20609 T20610 arg1Of MHB1688,","
R14719 T20610 T20613 arg1Of ",",and
R14720 T20611 T20610 arg2Of 5′CGAAGAATAAAAGGCCACCA3′,","
R14721 T20613 T20607 arg2Of and,(
R14722 T20613 T20608 arg1Of and,primers
R14723 T20613 T20612 arg1Of and,;
R14724 T20613 T20615 arg1Of and,","
R14725 T20614 T20613 arg2Of MHB1689,and
R14726 T20616 T20615 arg2Of 5′GCTTCACCACCAACCTCTTC3′,","
R14727 T20617 T20607 arg3Of ),(

bionlp-st-ge-2016-test-proteins

Id Subject Object Predicate Lexical cue
T20360 130-132 Protein denotes ɛy
T20359 25-27 Protein denotes ɛy

sentences

Id Subject Object Predicate Lexical cue
T20349 0-225 Sentence denotes PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′).
T339 0-225 Sentence denotes PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′).

simple1

Id Subject Object Predicate Lexical cue
T20381 130-132 Protein denotes ɛy
T20380 25-27 Protein denotes ɛy

BioNLP16_DUT

Id Subject Object Predicate Lexical cue
T21022 130-132 Protein denotes ɛy
T21021 25-27 Protein denotes ɛy

BioNLP16_Messiy

Id Subject Object Predicate Lexical cue
T20669 130-132 Protein denotes ɛy
T20668 25-27 Protein denotes ɛy

DLUT931

Id Subject Object Predicate Lexical cue
T20673 130-132 Protein denotes ɛy
T20672 25-27 Protein denotes ɛy

bionlp-st-ge-2016-test-ihmc

Id Subject Object Predicate Lexical cue
T21012 96-141 Entity denotes to nucleotides −31 to +140 of the ɛy promoter
T21000 0-3 Protein denotes PCR
T20997 130-132 Protein denotes ɛy
T20996 25-27 Protein denotes ɛy
T20995 18-36 Entity denotes of the ɛy promoter
T20990 126-141 Entity denotes the ɛy promoter
R15085 T20990 T20997 partOf the ɛy promoter,ɛy
R15086 T20995 T20996 partOf of the ɛy promoter,ɛy

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T20932 224-225 . denotes .
T20931 223-224 -RRB- denotes )
T20930 222-223 NNP denotes ′
T20929 201-222 NNP denotes GCTTCACCACCAACCTCTTC3
T20928 200-201 NN denotes ′
T20927 199-200 CD denotes 5
T20926 197-198 , denotes ,
T20925 190-197 NNP denotes MHB1689
T20924 186-189 CC denotes and
T20923 184-185 : denotes ;
T20922 183-184 NN denotes ′
T20921 162-183 CD denotes CGAAGAATAAAAGGCCACCA3
T20920 161-162 NN denotes ′
T20919 160-161 CD denotes 5
T20918 158-159 , denotes ,
T20917 151-158 NNP denotes MHB1688
T20916 143-150 NNS denotes primers
T20915 142-143 -LRB- denotes (
T20914 133-141 NN denotes promoter
T20913 130-132 JJ denotes ɛy
T20912 126-129 DT denotes the
T20911 123-125 IN denotes of
T20910 118-122 CD denotes +140
T20909 115-117 TO denotes to
T20908 112-114 CD denotes 31
T20907 111-112 VBP denotes −
T20906 99-110 NNS denotes nucleotides
T20905 96-98 TO denotes to
T20904 82-95 JJ denotes corresponding
T20903 80-81 , denotes ,
T20902 72-80 NN denotes amplicon
T20901 65-71 JJ denotes 172-bp
T20900 63-64 DT denotes a
T20899 55-62 VBD denotes yielded
T20898 51-54 CC denotes and
T20897 41-50 VBN denotes performed
T20896 37-40 VBD denotes was
T20895 28-36 NN denotes promoter
T20894 25-27 JJ denotes ɛy
T20893 21-24 DT denotes the
T20892 18-20 IN denotes of
T20891 4-17 NN denotes amplification
T20890 0-3 NNP denotes PCR
R14988 T20890 T20891 compound PCR,amplification
R14989 T20891 T20897 nsubjpass amplification,performed
R14990 T20892 T20891 prep of,amplification
R14991 T20893 T20895 det the,promoter
R14992 T20894 T20895 amod ɛy,promoter
R14993 T20895 T20892 pobj promoter,of
R14994 T20896 T20897 auxpass was,performed
R14995 T20897 T20897 ROOT performed,performed
R14996 T20898 T20897 cc and,performed
R14997 T20899 T20897 conj yielded,performed
R14998 T20900 T20902 det a,amplicon
R14999 T20901 T20902 amod 172-bp,amplicon
R15000 T20902 T20899 dobj amplicon,yielded
R15001 T20903 T20902 punct ",",amplicon
R15002 T20904 T20902 amod corresponding,amplicon
R15003 T20905 T20907 aux to,−
R15004 T20906 T20905 pobj nucleotides,to
R15005 T20907 T20904 xcomp −,corresponding
R15006 T20908 T20910 quantmod 31,+140
R15007 T20909 T20910 quantmod to,+140
R15008 T20910 T20907 dobj +140,−
R15009 T20911 T20910 prep of,+140
R15010 T20912 T20914 det the,promoter
R15011 T20913 T20914 amod ɛy,promoter
R15012 T20914 T20911 pobj promoter,of
R15013 T20915 T20916 punct (,primers
R15014 T20916 T20914 appos primers,promoter
R15015 T20917 T20922 nmod MHB1688,′
R15016 T20918 T20917 punct ",",MHB1688
R15017 T20919 T20920 nummod 5,′
R15018 T20920 T20922 nmod ′,′
R15019 T20921 T20922 nummod CGAAGAATAAAAGGCCACCA3,′
R15020 T20922 T20916 dobj ′,primers
R15021 T20923 T20916 punct ;,primers
R15022 T20924 T20916 cc and,primers
R15023 T20925 T20916 conj MHB1689,primers
R15024 T20926 T20925 punct ",",MHB1689
R15025 T20927 T20928 nummod 5,′
R15026 T20928 T20930 compound ′,′
R15027 T20929 T20930 compound GCTTCACCACCAACCTCTTC3,′
R15028 T20930 T20925 conj ′,MHB1689
R15029 T20931 T20930 punct ),′
R15030 T20932 T20897 punct .,performed

testone

Id Subject Object Predicate Lexical cue
T20330 130-132 Protein denotes ɛy
T20329 25-27 Protein denotes ɛy

test3

Id Subject Object Predicate Lexical cue
T20338 130-132 Protein denotes ɛy
T20337 25-27 Protein denotes ɛy
T20334 130-132 Protein denotes ɛy
T20333 25-27 Protein denotes ɛy