PMC:1359074 / 42637-44136 JSON TXT

Annnotations TAB JSON ListView MergeView

2_test

{"project":"2_test","denotations":[{"id":"16462943-15302897-85761030","span":{"begin":37,"end":39},"obj":"15302897"},{"id":"T20377","span":{"begin":37,"end":39},"obj":"15302897"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

pmc-enju-pas

bionlp-st-ge-2016-test-proteins

{"project":"bionlp-st-ge-2016-test-proteins","denotations":[{"id":"T20360","span":{"begin":1210,"end":1212},"obj":"Protein"},{"id":"T20359","span":{"begin":1105,"end":1107},"obj":"Protein"},{"id":"T20358","span":{"begin":751,"end":755},"obj":"Protein"},{"id":"T20357","span":{"begin":580,"end":589},"obj":"Protein"}],"namespaces":[{"prefix":"_base","uri":"http://bionlp.dbcls.jp/ontology/ge.owl#"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

UBERON-AE

{"project":"UBERON-AE","denotations":[{"id":"T20340","span":{"begin":1470,"end":1479},"obj":"http://purl.obolibrary.org/obo/UBERON_2000106"},{"id":"T20339","span":{"begin":92,"end":97},"obj":"http://purl.obolibrary.org/obo/UBERON_0002107"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

GO-BP

{"project":"GO-BP","denotations":[{"id":"T20352","span":{"begin":344,"end":349},"obj":"http://purl.obolibrary.org/obo/GO_0019835"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

GO-MF

{"project":"GO-MF","denotations":[{"id":"T20361","span":{"begin":890,"end":898},"obj":"http://purl.obolibrary.org/obo/GO_0003823"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

GO-CC

{"project":"GO-CC","denotations":[{"id":"T20363","span":{"begin":98,"end":103},"obj":"http://purl.obolibrary.org/obo/GO_0005623"},{"id":"T20362","span":{"begin":67,"end":72},"obj":"http://purl.obolibrary.org/obo/GO_0005623"},{"id":"T20370","span":{"begin":890,"end":898},"obj":"http://purl.obolibrary.org/obo/GO_0042571"},{"id":"T20369","span":{"begin":890,"end":898},"obj":"http://purl.obolibrary.org/obo/GO_0019815"},{"id":"T20368","span":{"begin":880,"end":889},"obj":"http://purl.obolibrary.org/obo/GO_0000785"},{"id":"T20367","span":{"begin":426,"end":443},"obj":"http://purl.obolibrary.org/obo/GO_0043234"},{"id":"T20366","span":{"begin":422,"end":443},"obj":"http://purl.obolibrary.org/obo/GO_0097522"},{"id":"T20365","span":{"begin":422,"end":443},"obj":"http://purl.obolibrary.org/obo/GO_0032993"},{"id":"T20364","span":{"begin":422,"end":443},"obj":"http://purl.obolibrary.org/obo/GO_0001114"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

sentences

{"project":"sentences","denotations":[{"id":"T20351","span":{"begin":1356,"end":1499},"obj":"Sentence"},{"id":"T20350","span":{"begin":1306,"end":1355},"obj":"Sentence"},{"id":"T20349","span":{"begin":1080,"end":1305},"obj":"Sentence"},{"id":"T20348","span":{"begin":1000,"end":1079},"obj":"Sentence"},{"id":"T20347","span":{"begin":876,"end":999},"obj":"Sentence"},{"id":"T20346","span":{"begin":663,"end":875},"obj":"Sentence"},{"id":"T20345","span":{"begin":478,"end":662},"obj":"Sentence"},{"id":"T20344","span":{"begin":422,"end":477},"obj":"Sentence"},{"id":"T20343","span":{"begin":52,"end":421},"obj":"Sentence"},{"id":"T20342","span":{"begin":12,"end":51},"obj":"Sentence"},{"id":"T20341","span":{"begin":0,"end":11},"obj":"Sentence"},{"id":"T330","span":{"begin":0,"end":11},"obj":"Sentence"},{"id":"T331","span":{"begin":12,"end":51},"obj":"Sentence"},{"id":"T332","span":{"begin":52,"end":421},"obj":"Sentence"},{"id":"T333","span":{"begin":422,"end":477},"obj":"Sentence"},{"id":"T334","span":{"begin":478,"end":662},"obj":"Sentence"},{"id":"T335","span":{"begin":663,"end":830},"obj":"Sentence"},{"id":"T336","span":{"begin":831,"end":875},"obj":"Sentence"},{"id":"T337","span":{"begin":876,"end":999},"obj":"Sentence"},{"id":"T338","span":{"begin":1000,"end":1079},"obj":"Sentence"},{"id":"T339","span":{"begin":1080,"end":1305},"obj":"Sentence"},{"id":"T340","span":{"begin":1306,"end":1355},"obj":"Sentence"},{"id":"T341","span":{"begin":1356,"end":1499},"obj":"Sentence"}],"namespaces":[{"prefix":"_base","uri":"http://pubannotation.org/ontology/tao.owl#"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

simple1

{"project":"simple1","denotations":[{"id":"T20381","span":{"begin":1210,"end":1212},"obj":"Protein"},{"id":"T20380","span":{"begin":1105,"end":1107},"obj":"Protein"},{"id":"T20379","span":{"begin":751,"end":755},"obj":"Protein"},{"id":"T20378","span":{"begin":580,"end":589},"obj":"Protein"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

BioNLP16_DUT

{"project":"BioNLP16_DUT","denotations":[{"id":"T21019","span":{"begin":580,"end":589},"obj":"Protein"},{"id":"T21022","span":{"begin":1210,"end":1212},"obj":"Protein"},{"id":"T21021","span":{"begin":1105,"end":1107},"obj":"Protein"},{"id":"T21020","span":{"begin":751,"end":755},"obj":"Protein"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

BioNLP16_Messiy

{"project":"BioNLP16_Messiy","denotations":[{"id":"T20669","span":{"begin":1210,"end":1212},"obj":"Protein"},{"id":"T20668","span":{"begin":1105,"end":1107},"obj":"Protein"},{"id":"T20667","span":{"begin":751,"end":755},"obj":"Protein"},{"id":"T20666","span":{"begin":580,"end":589},"obj":"Protein"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

DLUT931

{"project":"DLUT931","denotations":[{"id":"T20673","span":{"begin":1210,"end":1212},"obj":"Protein"},{"id":"T20672","span":{"begin":1105,"end":1107},"obj":"Protein"},{"id":"T20671","span":{"begin":751,"end":755},"obj":"Protein"},{"id":"T20670","span":{"begin":580,"end":589},"obj":"Protein"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

bionlp-st-ge-2016-test-ihmc

{"project":"bionlp-st-ge-2016-test-ihmc","denotations":[{"id":"T21018","span":{"begin":926,"end":954},"obj":"Localization"},{"id":"T21017","span":{"begin":45,"end":57},"obj":"Entity"},{"id":"T21016","span":{"begin":1013,"end":1035},"obj":"Entity"},{"id":"T21015","span":{"begin":109,"end":131},"obj":"Protein"},{"id":"T21014","span":{"begin":995,"end":1009},"obj":"Entity"},{"id":"T21013","span":{"begin":746,"end":797},"obj":"Protein"},{"id":"T21012","span":{"begin":1176,"end":1221},"obj":"Entity"},{"id":"T21011","span":{"begin":890,"end":898},"obj":"Protein"},{"id":"T21010","span":{"begin":197,"end":205},"obj":"Entity"},{"id":"T21009","span":{"begin":403,"end":409},"obj":"Entity"},{"id":"T21008","span":{"begin":1062,"end":1078},"obj":"Protein"},{"id":"T21007","span":{"begin":150,"end":176},"obj":"Entity"},{"id":"T21006","span":{"begin":876,"end":908},"obj":"Entity"},{"id":"T21005","span":{"begin":973,"end":987},"obj":"Entity"},{"id":"T21004","span":{"begin":880,"end":889},"obj":"Entity"},{"id":"T21003","span":{"begin":930,"end":933},"obj":"Entity"},{"id":"T21002","span":{"begin":368,"end":387},"obj":"Protein"},{"id":"T21001","span":{"begin":249,"end":253},"obj":"Entity"},{"id":"T21000","span":{"begin":1080,"end":1083},"obj":"Protein"},{"id":"T20999","span":{"begin":926,"end":953},"obj":"Protein"},{"id":"T20998","span":{"begin":1306,"end":1309},"obj":"Protein"},{"id":"T20997","span":{"begin":1210,"end":1212},"obj":"Protein"},{"id":"T20996","span":{"begin":1105,"end":1107},"obj":"Protein"},{"id":"T20995","span":{"begin":1098,"end":1116},"obj":"Entity"},{"id":"T20994","span":{"begin":590,"end":599},"obj":"Entity"},{"id":"T20993","span":{"begin":338,"end":388},"obj":"Protein"},{"id":"T20992","span":{"begin":244,"end":284},"obj":"Protein"},{"id":"T20991","span":{"begin":422,"end":443},"obj":"Entity"},{"id":"T20990","span":{"begin":1206,"end":1221},"obj":"Entity"}],"relations":[{"id":"R15085","pred":"partOf","subj":"T20990","obj":"T20997"},{"id":"R15086","pred":"partOf","subj":"T20995","obj":"T20996"},{"id":"R15087","pred":"themeOf","subj":"T20999","obj":"T21018"},{"id":"R15088","pred":"locationOf","subj":"T21003","obj":"T21018"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

bionlp-st-ge-2016-spacy-parsed

bionlp-st-ge-2016-test-tees

{"project":"bionlp-st-ge-2016-test-tees","denotations":[{"id":"T20377","span":{"begin":880,"end":898},"obj":"Protein"},{"id":"T20376","span":{"begin":793,"end":796},"obj":"Protein"},{"id":"T20375","span":{"begin":751,"end":755},"obj":"Protein"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

testone

{"project":"testone","denotations":[{"id":"T20330","span":{"begin":1210,"end":1212},"obj":"Protein"},{"id":"T20329","span":{"begin":1105,"end":1107},"obj":"Protein"},{"id":"T20328","span":{"begin":751,"end":755},"obj":"Protein"},{"id":"T20327","span":{"begin":580,"end":589},"obj":"Protein"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

test3

{"project":"test3","denotations":[{"id":"T20338","span":{"begin":1210,"end":1212},"obj":"Protein"},{"id":"T20337","span":{"begin":1105,"end":1107},"obj":"Protein"},{"id":"T20336","span":{"begin":751,"end":755},"obj":"Protein"},{"id":"T20335","span":{"begin":580,"end":589},"obj":"Protein"},{"id":"T20334","span":{"begin":1210,"end":1212},"obj":"Protein"},{"id":"T20333","span":{"begin":1105,"end":1107},"obj":"Protein"},{"id":"T20332","span":{"begin":751,"end":755},"obj":"Protein"},{"id":"T20331","span":{"begin":580,"end":589},"obj":"Protein"}],"text":"ChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

PMC:1359074 / 42637-44136 JSONTXT

Annnotations TAB JSON ListView MergeView

PMC:1359074 / 42637-44136 JSON TXT