> top > docs > PMC:1359074 > spans > 36123-36213 > annotations

PMC:1359074 / 36123-36213 JSONTXT

Annnotations TAB JSON ListView MergeView

pmc-enju-pas

Id Subject Object Predicate Lexical cue
T17239 64-89 NN denotes 5′GAAGCAGAGGACAAGTTCCCA3′
T17238 62-63 -COMMA- denotes ,
T17237 55-62 NN denotes MHB1667
T17236 51-54 CC denotes and
T17235 49-50 -COLON- denotes ;
T17234 24-49 NN denotes 5′TGGCCTGTGGAGTAAGGTCAA3′
T17233 22-23 -COMMA- denotes ,
T17232 15-22 NN denotes MHB1666
T17231 13-14 -COLON- denotes :
T17230 7-13 NN denotes globin
T17229 4-6 JJ denotes ɛy
T17228 0-3 IN denotes For
R11972 T17230 T17228 arg1Of globin,For
R11973 T17230 T17229 arg1Of globin,ɛy
R11974 T17230 T17231 arg1Of globin,:
R11975 T17232 T17231 arg2Of MHB1666,:
R11976 T17232 T17233 arg1Of MHB1666,","
R11977 T17232 T17238 arg1Of MHB1666,","
R11978 T17234 T17236 arg1Of 5′TGGCCTGTGGAGTAAGGTCAA3′,and
R11979 T17236 T17233 arg2Of and,","
R11980 T17236 T17235 arg1Of and,;
R11981 T17237 T17236 arg2Of MHB1667,and
R11982 T17239 T17238 arg2Of 5′GAAGCAGAGGACAAGTTCCCA3′,","

bionlp-st-ge-2016-test-proteins

Id Subject Object Predicate Lexical cue
T17170 4-13 Protein denotes ɛy globin

GO-BP

Id Subject Object Predicate Lexical cue
T17159 7-13 http://purl.obolibrary.org/obo/GO_0005344 denotes globin

GO-MF

Id Subject Object Predicate Lexical cue
T17179 7-13 http://purl.obolibrary.org/obo/GO_0005344 denotes globin

sentences

Id Subject Object Predicate Lexical cue
T17146 0-90 Sentence denotes For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′.
T269 0-90 Sentence denotes For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′.

simple1

Id Subject Object Predicate Lexical cue
T17184 4-13 Protein denotes ɛy globin

BioNLP16_DUT

Id Subject Object Predicate Lexical cue
T17716 4-13 Protein denotes ɛy globin

BioNLP16_Messiy

Id Subject Object Predicate Lexical cue
T17397 4-13 Protein denotes ɛy globin

DLUT931

Id Subject Object Predicate Lexical cue
T17424 4-13 Protein denotes ɛy globin

bionlp-st-ge-2016-test-ihmc

Id Subject Object Predicate Lexical cue
T17695 4-13 Protein denotes ɛy globin

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T17497 89-90 . denotes .
T17496 88-89 NN denotes ′
T17495 66-88 NNP denotes GAAGCAGAGGACAAGTTCCCA3
T17494 65-66 CD denotes ′
T17493 64-65 CD denotes 5
T17492 62-63 , denotes ,
T17491 55-62 NNP denotes MHB1667
T17490 51-54 CC denotes and
T17489 49-50 : denotes ;
T17488 48-49 NN denotes ′
T17487 26-48 CD denotes TGGCCTGTGGAGTAAGGTCAA3
T17486 25-26 CD denotes ′
T17485 24-25 CD denotes 5
T17484 22-23 , denotes ,
T17483 15-22 NNP denotes MHB1666
T17482 13-14 : denotes :
T17481 7-13 NN denotes globin
T17480 4-6 JJ denotes ɛy
T17479 0-3 IN denotes For
R12178 T17479 T17479 ROOT For,For
R12179 T17480 T17481 amod ɛy,globin
R12180 T17481 T17479 pobj globin,For
R12181 T17482 T17481 punct :,globin
R12182 T17483 T17496 nmod MHB1666,′
R12183 T17484 T17483 punct ",",MHB1666
R12184 T17485 T17483 nummod 5,MHB1666
R12185 T17486 T17483 nummod ′,MHB1666
R12186 T17487 T17488 nummod TGGCCTGTGGAGTAAGGTCAA3,′
R12187 T17488 T17488 ROOT ′,′
R12188 T17489 T17483 punct ;,MHB1666
R12189 T17490 T17483 cc and,MHB1666
R12190 T17491 T17483 conj MHB1667,MHB1666
R12191 T17492 T17491 punct ",",MHB1667
R12192 T17493 T17496 nummod 5,′
R12193 T17494 T17496 nummod ′,′
R12194 T17495 T17496 compound GAAGCAGAGGACAAGTTCCCA3,′
R12195 T17496 T17481 appos ′,globin
R12196 T17497 T17479 punct .,For

bionlp-st-ge-2016-test-tees

Id Subject Object Predicate Lexical cue
T17414 15-22 Protein denotes MHB1666
T17413 4-13 Protein denotes ɛy globin

testone

Id Subject Object Predicate Lexical cue
T17120 4-13 Protein denotes ɛy globin

test3

Id Subject Object Predicate Lexical cue
T17135 4-13 Protein denotes ɛy globin
T17128 4-13 Protein denotes ɛy globin