> top > docs > PMC:1359074 > spans > 35888-37165 > annotations

PMC:1359074 / 35888-37165 JSONTXT

Annnotations TAB JSON ListView MergeView

2_test

Id Subject Object Predicate Lexical cue
16462943-14654707-85761026 154-156 14654707 denotes 51
T25296 154-156 14654707 denotes 51

pmc-enju-pas

Id Subject Object Predicate Lexical cue
T17394 1275-1276 -RRB- denotes )
T17393 1269-1275 NNP denotes States
T17392 1262-1268 NNP denotes United
T17391 1260-1261 -COMMA- denotes ,
T17390 1250-1260 NNP denotes Washington
T17389 1248-1249 -COMMA- denotes ,
T17388 1241-1248 NNP denotes Redmond
T17387 1240-1241 -LRB- denotes (
T17386 1234-1239 NNP denotes Excel
T17385 1224-1233 NNP denotes Microsoft
T17384 1221-1223 IN denotes in
T17383 1215-1220 NN denotes GAPDH
T17382 1212-1214 TO denotes to
T17381 1201-1211 VB denotes normalized
T17380 1197-1200 CC denotes and
T17379 1195-1196 -RRB- denotes )
T17378 1185-1195 NNP denotes Biosystems
T17377 1177-1184 NNP denotes Applied
T17376 1176-1177 -LRB- denotes (
T17375 1167-1175 NNP denotes Software
T17374 1163-1166 NNP denotes SDS
T17373 1158-1162 CD denotes 7000
T17372 1152-1157 NNP denotes Prism
T17371 1148-1151 NNP denotes ABI
T17370 1144-1147 DT denotes the
T17369 1141-1143 IN denotes in
T17368 1130-1140 VB denotes calculated
T17367 1125-1129 VB denotes were
T17366 1118-1124 NN denotes values
T17365 1105-1117 JJ denotes quantitative
T17364 1096-1104 JJ denotes Relative
T17363 1086-1094 NN denotes reaction
T17362 1082-1085 NN denotes PCR
T17361 1077-1081 DT denotes each
T17360 1073-1076 IN denotes for
T17359 1068-1072 VB denotes done
T17358 1063-1067 VB denotes were
T17357 1051-1062 NN denotes Triplicates
T17356 1035-1049 NN denotes amplifications
T17355 1031-1034 DT denotes the
T17354 1028-1030 IN denotes of
T17353 1017-1027 NN denotes efficiency
T17352 1013-1016 DT denotes the
T17351 1008-1012 VB denotes test
T17350 1005-1007 TO denotes to
T17349 995-1004 VB denotes performed
T17348 990-994 VB denotes were
T17347 981-989 NN denotes analyses
T17346 975-980 NN denotes curve
T17345 966-974 JJ denotes Standard
T17344 961-964 NN denotes RNA
T17343 955-960 NN denotes input
T17342 951-954 IN denotes for
T17341 943-950 NN denotes control
T17340 940-942 IN denotes as
T17339 935-939 VB denotes used
T17338 930-934 VB denotes were
T17337 923-929 NN denotes levels
T17336 918-922 NN denotes mRNA
T17335 912-917 NN denotes GAPDH
T17334 902-910 NN denotes supermix
T17333 896-901 JJ denotes green
T17332 891-895 NN denotes SYBR
T17331 888-890 NN denotes μl
T17330 883-887 CD denotes 12.5
T17329 878-882 IN denotes with
T17328 869-877 NN denotes reaction
T17327 863-868 JJ denotes 25-μl
T17326 861-862 DT denotes a
T17325 858-860 IN denotes in
T17324 848-857 VB denotes performed
T17323 844-847 VB denotes was
T17322 840-843 NN denotes PCR
T17321 836-839 DT denotes All
T17320 826-834 NN denotes facility
T17319 821-825 NN denotes core
T17318 813-820 NNP denotes Arizona
T17317 810-812 IN denotes of
T17316 799-809 NNP denotes University
T17315 795-798 DT denotes the
T17314 792-794 IN denotes at
T17313 790-791 -RRB- denotes )
T17312 784-790 NNP denotes States
T17311 777-783 NNP denotes United
T17310 775-776 -COMMA- denotes ,
T17309 765-775 NNP denotes California
T17308 763-764 -COMMA- denotes ,
T17307 759-763 NNP denotes City
T17306 752-758 NNP denotes Foster
T17305 750-751 -COMMA- denotes ,
T17304 740-750 NNP denotes Biosystems
T17303 732-739 NNP denotes Applied
T17302 731-732 -LRB- denotes (
T17301 723-730 NN denotes ABI7000
T17300 720-722 DT denotes an
T17299 717-719 IN denotes on
T17298 713-716 VB denotes run
T17297 709-712 VB denotes was
T17296 695-708 NN denotes amplification
T17295 691-694 NN denotes PCR
T17294 689-690 -COMMA- denotes ,
T17293 688-689 -RRB- denotes )
T17292 682-688 NNP denotes States
T17291 675-681 NNP denotes United
T17290 673-674 -COMMA- denotes ,
T17289 663-673 NNP denotes California
T17288 661-662 -COMMA- denotes ,
T17287 653-661 NNP denotes Hercules
T17286 651-652 -COMMA- denotes ,
T17285 644-651 NNP denotes Bio-Rad
T17284 643-644 -LRB- denotes (
T17283 639-642 NN denotes ROX
T17282 634-638 IN denotes with
T17281 630-633 NN denotes kit
T17280 621-629 NN denotes supermix
T17279 615-620 JJ denotes green
T17278 610-614 NN denotes SYBR
T17277 606-609 DT denotes the
T17276 600-605 VB denotes Using
T17275 574-598 NN denotes 5′ACGATCATATTGCCCAGGAG3′
T17274 572-573 -COMMA- denotes ,
T17273 565-572 NN denotes MHB1675
T17272 561-564 CC denotes and
T17271 559-560 -COLON- denotes ;
T17270 535-559 NN denotes 5′ATGGCCTGAATCACTTGGAC3′
T17269 533-534 -COLON- denotes :
T17268 526-533 NN denotes MHB1674
T17267 524-525 -COLON- denotes :
T17266 518-524 NN denotes globin
T17265 509-517 NN denotes βmaj/min
T17264 505-508 IN denotes For
T17263 479-503 NN denotes 5′ACCTCTGGGGTGAATTCCTT3′
T17262 477-478 -COMMA- denotes ,
T17261 470-477 NN denotes MHB1673
T17260 466-469 CC denotes and
T17259 464-465 -COLON- denotes ;
T17258 440-464 NN denotes 5′TGGACAACCTCAAGGAGACC3′
T17257 438-439 -COMMA- denotes ,
T17256 431-438 NN denotes MHB1672
T17255 429-430 -COLON- denotes :
T17254 423-429 NN denotes globin
T17253 419-422 NN denotes βH1
T17252 415-418 IN denotes For
T17251 389-413 NN denotes 5′CTTAACCGCATCCCCTACGG3′
T17250 387-388 -COMMA- denotes ,
T17249 380-387 NN denotes MHB1669
T17248 376-379 CC denotes and
T17247 374-375 -COLON- denotes ;
T17246 349-374 NN denotes 5′CTACCCCCAGACGAAGACCTA3′
T17245 347-348 -COMMA- denotes ,
T17244 340-347 NN denotes MHB1668
T17243 338-339 -COLON- denotes :
T17242 332-338 NN denotes globin
T17241 330-331 NN denotes ζ
T17240 326-329 IN denotes For
T17239 299-324 NN denotes 5′GAAGCAGAGGACAAGTTCCCA3′
T17238 297-298 -COMMA- denotes ,
T17237 290-297 NN denotes MHB1667
T17236 286-289 CC denotes and
T17235 284-285 -COLON- denotes ;
T17234 259-284 NN denotes 5′TGGCCTGTGGAGTAAGGTCAA3′
T17233 257-258 -COMMA- denotes ,
T17232 250-257 NN denotes MHB1666
T17231 248-249 -COLON- denotes :
T17230 242-248 NN denotes globin
T17229 239-241 JJ denotes ɛy
T17228 235-238 IN denotes For
T17227 222-233 NN denotes specificity
T17226 214-221 VB denotes confirm
T17225 211-213 TO denotes to
T17224 202-210 NN denotes database
T17223 197-201 NN denotes NCBI
T17222 193-196 DT denotes the
T17221 185-192 IN denotes against
T17220 176-184 VB denotes searched
T17219 171-175 VB denotes were
T17218 163-170 NN denotes primers
T17217 159-162 DT denotes All
T17216 156-157 -RRB- denotes ]
T17215 154-156 CD denotes 51
T17214 153-154 -LRB- denotes [
T17213 142-152 NNP denotes Primerbank
T17212 137-141 IN denotes from
T17211 128-136 VB denotes obtained
T17210 123-127 VB denotes were
T17209 117-122 NN denotes genes
T17208 110-116 NN denotes globin
T17207 107-109 IN denotes of
T17206 93-106 NN denotes amplification
T17205 89-92 NN denotes PCR
T17204 84-88 NN denotes cDNA
T17203 80-83 IN denotes for
T17202 72-79 NN denotes Primers
T17201 66-70 NN denotes cDNA
T17200 63-65 TO denotes to
T17199 51-62 VB denotes transcribed
T17198 43-50 JJ denotes reverse
T17197 37-42 RB denotes first
T17196 33-36 VB denotes was
T17195 29-32 NN denotes RNA
T17194 23-27 NN denotes mRNA
T17193 16-22 NN denotes globin
T17192 13-15 IN denotes of
T17191 0-12 NN denotes Quantitation
R11937 T17191 T17192 arg1Of Quantitation,of
R11938 T17194 T17192 arg2Of mRNA,of
R11939 T17194 T17193 arg1Of mRNA,globin
R11940 T17195 T17196 arg1Of RNA,was
R11941 T17198 T17197 arg1Of reverse,first
R11942 T17201 T17196 arg2Of cDNA,was
R11943 T17201 T17198 arg1Of cDNA,reverse
R11944 T17201 T17199 arg2Of cDNA,transcribed
R11945 T17201 T17200 arg1Of cDNA,to
R11946 T17202 T17203 arg1Of Primers,for
R11947 T17202 T17210 arg1Of Primers,were
R11948 T17202 T17211 arg2Of Primers,obtained
R11949 T17206 T17203 arg2Of amplification,for
R11950 T17206 T17204 arg1Of amplification,cDNA
R11951 T17206 T17205 arg1Of amplification,PCR
R11952 T17206 T17207 arg1Of amplification,of
R11953 T17209 T17207 arg2Of genes,of
R11954 T17209 T17208 arg1Of genes,globin
R11955 T17211 T17210 arg2Of obtained,were
R11956 T17211 T17212 arg1Of obtained,from
R11957 T17213 T17212 arg2Of Primerbank,from
R11958 T17213 T17214 arg1Of Primerbank,[
R11959 T17215 T17214 arg2Of 51,[
R11960 T17216 T17214 arg3Of ],[
R11961 T17218 T17217 arg1Of primers,All
R11962 T17218 T17219 arg1Of primers,were
R11963 T17218 T17220 arg2Of primers,searched
R11964 T17220 T17219 arg2Of searched,were
R11965 T17220 T17221 arg1Of searched,against
R11966 T17220 T17225 modOf searched,to
R11967 T17224 T17221 arg2Of database,against
R11968 T17224 T17222 arg1Of database,the
R11969 T17224 T17223 arg1Of database,NCBI
R11970 T17226 T17225 arg1Of confirm,to
R11971 T17227 T17226 arg2Of specificity,confirm
R11972 T17230 T17228 arg1Of globin,For
R11973 T17230 T17229 arg1Of globin,ɛy
R11974 T17230 T17231 arg1Of globin,:
R11975 T17232 T17231 arg2Of MHB1666,:
R11976 T17232 T17233 arg1Of MHB1666,","
R11977 T17232 T17238 arg1Of MHB1666,","
R11978 T17234 T17236 arg1Of 5′TGGCCTGTGGAGTAAGGTCAA3′,and
R11979 T17236 T17233 arg2Of and,","
R11980 T17236 T17235 arg1Of and,;
R11981 T17237 T17236 arg2Of MHB1667,and
R11982 T17239 T17238 arg2Of 5′GAAGCAGAGGACAAGTTCCCA3′,","
R11983 T17242 T17240 arg1Of globin,For
R11984 T17242 T17241 arg1Of globin,ζ
R11985 T17242 T17243 arg1Of globin,:
R11986 T17244 T17243 arg2Of MHB1668,:
R11987 T17244 T17245 arg1Of MHB1668,","
R11988 T17244 T17250 arg1Of MHB1668,","
R11989 T17246 T17248 arg1Of 5′CTACCCCCAGACGAAGACCTA3′,and
R11990 T17248 T17245 arg2Of and,","
R11991 T17248 T17247 arg1Of and,;
R11992 T17249 T17248 arg2Of MHB1669,and
R11993 T17251 T17250 arg2Of 5′CTTAACCGCATCCCCTACGG3′,","
R11994 T17254 T17252 arg1Of globin,For
R11995 T17254 T17253 arg1Of globin,βH1
R11996 T17254 T17255 arg1Of globin,:
R11997 T17256 T17255 arg2Of MHB1672,:
R11998 T17256 T17257 arg1Of MHB1672,","
R11999 T17256 T17262 arg1Of MHB1672,","
R12000 T17258 T17260 arg1Of 5′TGGACAACCTCAAGGAGACC3′,and
R12001 T17260 T17257 arg2Of and,","
R12002 T17260 T17259 arg1Of and,;
R12003 T17261 T17260 arg2Of MHB1673,and
R12004 T17263 T17262 arg2Of 5′ACCTCTGGGGTGAATTCCTT3′,","
R12005 T17266 T17265 arg1Of globin,βmaj/min
R12006 T17266 T17267 arg1Of globin,:
R12007 T17267 T17264 arg1Of :,For
R12008 T17267 T17269 arg1Of :,:
R12009 T17268 T17267 arg2Of MHB1674,:
R12010 T17270 T17272 arg1Of 5′ATGGCCTGAATCACTTGGAC3′,and
R12011 T17272 T17271 arg1Of and,;
R12012 T17273 T17272 arg2Of MHB1675,and
R12013 T17273 T17274 arg1Of MHB1675,","
R12014 T17275 T17274 arg2Of 5′ACGATCATATTGCCCAGGAG3′,","
R12015 T17276 T17284 arg1Of Using,(
R12016 T17281 T17276 arg2Of kit,Using
R12017 T17281 T17277 arg1Of kit,the
R12018 T17281 T17278 arg1Of kit,SYBR
R12019 T17281 T17279 arg1Of kit,green
R12020 T17281 T17280 arg1Of kit,supermix
R12021 T17281 T17282 arg1Of kit,with
R12022 T17283 T17282 arg2Of ROX,with
R12023 T17285 T17286 arg1Of Bio-Rad,","
R12024 T17286 T17288 arg1Of ",",","
R12025 T17287 T17286 arg2Of Hercules,","
R12026 T17288 T17290 arg1Of ",",","
R12027 T17289 T17288 arg2Of California,","
R12028 T17290 T17284 arg2Of ",",(
R12029 T17292 T17290 arg2Of States,","
R12030 T17292 T17291 arg1Of States,United
R12031 T17293 T17284 arg3Of ),(
R12032 T17296 T17295 arg1Of amplification,PCR
R12033 T17296 T17297 arg1Of amplification,was
R12034 T17296 T17298 arg2Of amplification,run
R12035 T17298 T17276 modOf run,Using
R12036 T17298 T17294 arg1Of run,","
R12037 T17298 T17297 arg2Of run,was
R12038 T17298 T17299 arg1Of run,on
R12039 T17301 T17299 arg2Of ABI7000,on
R12040 T17301 T17300 arg1Of ABI7000,an
R12041 T17301 T17302 arg1Of ABI7000,(
R12042 T17301 T17314 arg1Of ABI7000,at
R12043 T17304 T17303 arg1Of Biosystems,Applied
R12044 T17304 T17305 arg1Of Biosystems,","
R12045 T17305 T17308 arg1Of ",",","
R12046 T17307 T17305 arg2Of City,","
R12047 T17307 T17306 arg1Of City,Foster
R12048 T17308 T17310 arg1Of ",",","
R12049 T17309 T17308 arg2Of California,","
R12050 T17310 T17302 arg2Of ",",(
R12051 T17312 T17310 arg2Of States,","
R12052 T17312 T17311 arg1Of States,United
R12053 T17313 T17302 arg3Of ),(
R12054 T17316 T17317 arg1Of University,of
R12055 T17318 T17317 arg2Of Arizona,of
R12056 T17320 T17314 arg2Of facility,at
R12057 T17320 T17315 arg1Of facility,the
R12058 T17320 T17316 arg1Of facility,University
R12059 T17320 T17319 arg1Of facility,core
R12060 T17322 T17321 arg1Of PCR,All
R12061 T17322 T17323 arg1Of PCR,was
R12062 T17322 T17324 arg2Of PCR,performed
R12063 T17324 T17323 arg2Of performed,was
R12064 T17324 T17325 arg1Of performed,in
R12065 T17328 T17325 arg2Of reaction,in
R12066 T17328 T17326 arg1Of reaction,a
R12067 T17328 T17327 arg1Of reaction,25-μl
R12068 T17328 T17329 arg1Of reaction,with
R12069 T17334 T17329 arg2Of supermix,with
R12070 T17334 T17330 arg1Of supermix,12.5
R12071 T17334 T17331 arg1Of supermix,μl
R12072 T17334 T17332 arg1Of supermix,SYBR
R12073 T17334 T17333 arg1Of supermix,green
R12074 T17337 T17335 arg1Of levels,GAPDH
R12075 T17337 T17336 arg1Of levels,mRNA
R12076 T17337 T17338 arg1Of levels,were
R12077 T17337 T17339 arg2Of levels,used
R12078 T17339 T17338 arg2Of used,were
R12079 T17339 T17340 arg1Of used,as
R12080 T17341 T17340 arg2Of control,as
R12081 T17341 T17342 arg1Of control,for
R12082 T17344 T17342 arg2Of RNA,for
R12083 T17344 T17343 arg1Of RNA,input
R12084 T17347 T17345 arg1Of analyses,Standard
R12085 T17347 T17346 arg1Of analyses,curve
R12086 T17347 T17348 arg1Of analyses,were
R12087 T17347 T17349 arg2Of analyses,performed
R12088 T17349 T17348 arg2Of performed,were
R12089 T17351 T17349 arg3Of test,performed
R12090 T17351 T17350 arg1Of test,to
R12091 T17353 T17351 arg2Of efficiency,test
R12092 T17353 T17352 arg1Of efficiency,the
R12093 T17353 T17354 arg1Of efficiency,of
R12094 T17356 T17354 arg2Of amplifications,of
R12095 T17356 T17355 arg1Of amplifications,the
R12096 T17357 T17358 arg1Of Triplicates,were
R12097 T17357 T17359 arg2Of Triplicates,done
R12098 T17359 T17358 arg2Of done,were
R12099 T17359 T17360 arg1Of done,for
R12100 T17363 T17360 arg2Of reaction,for
R12101 T17363 T17361 arg1Of reaction,each
R12102 T17363 T17362 arg1Of reaction,PCR
R12103 T17366 T17364 arg1Of values,Relative
R12104 T17366 T17365 arg1Of values,quantitative
R12105 T17366 T17367 arg1Of values,were
R12106 T17366 T17368 arg2Of values,calculated
R12107 T17366 T17381 arg1Of values,normalized
R12108 T17368 T17367 arg2Of calculated,were
R12109 T17368 T17369 arg1Of calculated,in
R12110 T17368 T17380 arg1Of calculated,and
R12111 T17375 T17369 arg2Of Software,in
R12112 T17375 T17370 arg1Of Software,the
R12113 T17375 T17371 arg1Of Software,ABI
R12114 T17375 T17372 arg1Of Software,Prism
R12115 T17375 T17373 arg1Of Software,7000
R12116 T17375 T17374 arg1Of Software,SDS
R12117 T17375 T17376 arg1Of Software,(
R12118 T17378 T17376 arg2Of Biosystems,(
R12119 T17378 T17377 arg1Of Biosystems,Applied
R12120 T17379 T17376 arg3Of ),(
R12121 T17381 T17380 arg2Of normalized,and
R12122 T17381 T17382 arg1Of normalized,to
R12123 T17383 T17382 arg2Of GAPDH,to
R12124 T17383 T17384 arg1Of GAPDH,in
R12125 T17386 T17384 arg2Of Excel,in
R12126 T17386 T17385 arg1Of Excel,Microsoft
R12127 T17386 T17387 arg1Of Excel,(
R12128 T17388 T17389 arg1Of Redmond,","
R12129 T17389 T17391 arg1Of ",",","
R12130 T17390 T17389 arg2Of Washington,","
R12131 T17392 T17391 arg2Of United,","
R12132 T17393 T17387 arg2Of States,(
R12133 T17393 T17388 arg1Of States,Redmond
R12134 T17393 T17390 arg1Of States,Washington
R12135 T17393 T17392 arg1Of States,United
R12136 T17394 T17387 arg3Of ),(

bionlp-st-ge-2016-test-proteins

Id Subject Object Predicate Lexical cue
T17176 1215-1220 Protein denotes GAPDH
T17175 912-917 Protein denotes GAPDH
T17174 514-524 Protein denotes min globin
T17173 509-513 Protein denotes βmaj
T17172 419-429 Protein denotes βH1 globin
T17171 330-338 Protein denotes ζ globin
T17170 239-248 Protein denotes ɛy globin

bionlp-st-ge-2016-uniprot

Id Subject Object Predicate Lexical cue
T17396 1215-1220 http://www.uniprot.org/uniprot/P04406 denotes GAPDH
T17395 912-917 http://www.uniprot.org/uniprot/P04406 denotes GAPDH

GO-BP

Id Subject Object Predicate Lexical cue
T17162 518-524 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17161 423-429 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17160 332-338 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17159 242-248 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17158 110-116 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17157 16-22 http://purl.obolibrary.org/obo/GO_0005344 denotes globin

GO-MF

Id Subject Object Predicate Lexical cue
T17182 518-524 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17181 423-429 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17180 332-338 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17179 242-248 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17178 110-116 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17177 16-22 http://purl.obolibrary.org/obo/GO_0005344 denotes globin

GO-CC

Id Subject Object Predicate Lexical cue
T17183 821-825 http://purl.obolibrary.org/obo/GO_0019013 denotes core

sentences

Id Subject Object Predicate Lexical cue
T17156 1096-1277 Sentence denotes Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States).
T17155 1051-1095 Sentence denotes Triplicates were done for each PCR reaction.
T17154 966-1050 Sentence denotes Standard curve analyses were performed to test the efficiency of the amplifications.
T17153 912-965 Sentence denotes GAPDH mRNA levels were used as control for input RNA.
T17152 836-911 Sentence denotes All PCR was performed in a 25-μl reaction with 12.5 μl SYBR green supermix.
T17151 600-835 Sentence denotes Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility.
T17150 535-599 Sentence denotes 5′ATGGCCTGAATCACTTGGAC3′; and MHB1675, 5′ACGATCATATTGCCCAGGAG3′.
T17149 505-534 Sentence denotes For βmaj/min globin: MHB1674:
T17148 415-504 Sentence denotes For βH1 globin: MHB1672, 5′TGGACAACCTCAAGGAGACC3′; and MHB1673, 5′ACCTCTGGGGTGAATTCCTT3′.
T17147 326-414 Sentence denotes For ζ globin: MHB1668, 5′CTACCCCCAGACGAAGACCTA3′; and MHB1669, 5′CTTAACCGCATCCCCTACGG3′.
T17146 235-325 Sentence denotes For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′.
T17145 159-234 Sentence denotes All primers were searched against the NCBI database to confirm specificity.
T17144 72-158 Sentence denotes Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51].
T17143 29-71 Sentence denotes RNA was first reverse transcribed to cDNA.
T17142 0-28 Sentence denotes Quantitation of globin mRNA.
T265 0-28 Sentence denotes Quantitation of globin mRNA.
T266 29-71 Sentence denotes RNA was first reverse transcribed to cDNA.
T267 72-158 Sentence denotes Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51].
T268 159-234 Sentence denotes All primers were searched against the NCBI database to confirm specificity.
T269 235-325 Sentence denotes For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′.
T270 326-414 Sentence denotes For ζ globin: MHB1668, 5′CTACCCCCAGACGAAGACCTA3′; and MHB1669, 5′CTTAACCGCATCCCCTACGG3′.
T271 415-504 Sentence denotes For βH1 globin: MHB1672, 5′TGGACAACCTCAAGGAGACC3′; and MHB1673, 5′ACCTCTGGGGTGAATTCCTT3′.
T272 505-534 Sentence denotes For βmaj/min globin: MHB1674:
T273 535-599 Sentence denotes 5′ATGGCCTGAATCACTTGGAC3′; and MHB1675, 5′ACGATCATATTGCCCAGGAG3′.
T274 600-835 Sentence denotes Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility.
T275 836-911 Sentence denotes All PCR was performed in a 25-μl reaction with 12.5 μl SYBR green supermix.
T276 912-965 Sentence denotes GAPDH mRNA levels were used as control for input RNA.
T277 966-1050 Sentence denotes Standard curve analyses were performed to test the efficiency of the amplifications.
T278 1051-1095 Sentence denotes Triplicates were done for each PCR reaction.
T279 1096-1277 Sentence denotes Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States).

simple1

Id Subject Object Predicate Lexical cue
T17190 1215-1220 Protein denotes GAPDH
T17189 912-917 Protein denotes GAPDH
T17188 514-524 Protein denotes min globin
T17187 509-513 Protein denotes βmaj
T17186 419-429 Protein denotes βH1 globin
T17185 330-338 Protein denotes ζ globin
T17184 239-248 Protein denotes ɛy globin

BioNLP16_DUT

Id Subject Object Predicate Lexical cue
T17722 1215-1220 Protein denotes GAPDH
T17721 912-917 Protein denotes GAPDH
T17720 514-524 Protein denotes min globin
T17719 509-513 Protein denotes βmaj
T17718 419-429 Protein denotes βH1 globin
T17717 330-338 Protein denotes ζ globin
T17716 239-248 Protein denotes ɛy globin

BioNLP16_Messiy

Id Subject Object Predicate Lexical cue
T17403 1215-1220 Protein denotes GAPDH
T17402 912-917 Protein denotes GAPDH
T17401 514-524 Protein denotes min globin
T17400 509-513 Protein denotes βmaj
T17399 419-429 Protein denotes βH1 globin
T17398 330-338 Protein denotes ζ globin
T17397 239-248 Protein denotes ɛy globin

DLUT931

Id Subject Object Predicate Lexical cue
T17430 1215-1220 Protein denotes GAPDH
T17429 912-917 Protein denotes GAPDH
T17428 514-524 Protein denotes min globin
T17427 509-513 Protein denotes βmaj
T17426 419-429 Protein denotes βH1 globin
T17425 330-338 Protein denotes ζ globin
T17424 239-248 Protein denotes ɛy globin

bionlp-st-ge-2016-test-ihmc

Id Subject Object Predicate Lexical cue
T17701 16-22 Protein denotes globin
T17700 107-122 Protein denotes of globin genes
T17699 419-429 Protein denotes βH1 globin
T17698 955-964 Protein denotes input RNA
T17697 1144-1157 Protein denotes the ABI Prism
T17696 795-834 Entity denotes the University of Arizona core facility
T17695 239-248 Protein denotes ɛy globin
T17715 691-716 Regulation denotes PCR amplification was run
T17714 691-694 Protein denotes PCR
T17713 912-917 Protein denotes GAPDH
T17712 1082-1085 Protein denotes PCR
T17711 330-338 Protein denotes ζ globin
T17710 639-662 Protein denotes ROX (Bio-Rad, Hercules,
T17709 518-524 Protein denotes globin
T17708 16-27 Protein denotes globin mRNA
T17707 29-32 Protein denotes RNA
T17706 84-122 Protein denotes cDNA PCR amplification of globin genes
T17705 1215-1220 Protein denotes GAPDH
T17704 836-843 Protein denotes All PCR
T17703 110-116 Protein denotes globin
T17702 1163-1166 Protein denotes SDS

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T17681 1276-1277 . denotes .
T17680 1275-1276 -RRB- denotes )
T17679 1269-1275 NNPS denotes States
T17678 1262-1268 NNP denotes United
T17677 1260-1261 , denotes ,
T17676 1250-1260 NNP denotes Washington
T17675 1248-1249 , denotes ,
T17674 1241-1248 NNP denotes Redmond
T17673 1240-1241 -LRB- denotes (
T17672 1234-1239 NNP denotes Excel
T17671 1224-1233 NNP denotes Microsoft
T17670 1221-1223 IN denotes in
T17669 1215-1220 NNP denotes GAPDH
T17668 1212-1214 TO denotes to
T17667 1201-1211 VBN denotes normalized
T17666 1197-1200 CC denotes and
T17665 1195-1196 -RRB- denotes )
T17664 1185-1195 NNPS denotes Biosystems
T17663 1177-1184 NNP denotes Applied
T17662 1176-1177 -LRB- denotes (
T17661 1167-1175 NNP denotes Software
T17660 1163-1166 NNP denotes SDS
T17659 1158-1162 CD denotes 7000
T17658 1152-1157 NNP denotes Prism
T17657 1148-1151 NNP denotes ABI
T17656 1144-1147 DT denotes the
T17655 1141-1143 IN denotes in
T17654 1130-1140 VBN denotes calculated
T17653 1125-1129 VBD denotes were
T17652 1118-1124 NNS denotes values
T17651 1105-1117 JJ denotes quantitative
T17650 1096-1104 JJ denotes Relative
T17649 1094-1095 . denotes .
T17648 1086-1094 NN denotes reaction
T17647 1082-1085 NNP denotes PCR
T17646 1077-1081 DT denotes each
T17645 1073-1076 IN denotes for
T17644 1068-1072 VBN denotes done
T17643 1063-1067 VBD denotes were
T17642 1051-1062 NNS denotes Triplicates
T17641 1049-1050 . denotes .
T17640 1035-1049 NNS denotes amplifications
T17639 1031-1034 DT denotes the
T17638 1028-1030 IN denotes of
T17637 1017-1027 NN denotes efficiency
T17636 1013-1016 DT denotes the
T17635 1008-1012 VB denotes test
T17634 1005-1007 TO denotes to
T17633 995-1004 VBN denotes performed
T17632 990-994 VBD denotes were
T17631 981-989 NNS denotes analyses
T17630 975-980 NN denotes curve
T17629 966-974 NNP denotes Standard
T17628 964-965 . denotes .
T17627 961-964 NNP denotes RNA
T17626 955-960 NN denotes input
T17625 951-954 IN denotes for
T17624 943-950 NN denotes control
T17623 940-942 IN denotes as
T17622 935-939 VBN denotes used
T17621 930-934 VBD denotes were
T17620 923-929 NNS denotes levels
T17619 918-922 NNP denotes mRNA
T17618 912-917 NNP denotes GAPDH
T17617 910-911 . denotes .
T17616 902-910 NN denotes supermix
T17615 896-901 JJ denotes green
T17614 891-895 NNP denotes SYBR
T17613 888-890 NN denotes μl
T17612 883-887 CD denotes 12.5
T17611 878-882 IN denotes with
T17610 869-877 NN denotes reaction
T17609 863-868 JJ denotes 25-μl
T17608 861-862 DT denotes a
T17607 858-860 IN denotes in
T17606 848-857 VBN denotes performed
T17605 844-847 VBD denotes was
T17604 840-843 NNP denotes PCR
T17603 836-839 DT denotes All
T17602 834-835 . denotes .
T17601 826-834 NN denotes facility
T17600 821-825 NN denotes core
T17599 813-820 NNP denotes Arizona
T17598 810-812 IN denotes of
T17597 799-809 NNP denotes University
T17596 795-798 DT denotes the
T17595 792-794 IN denotes at
T17594 790-791 -RRB- denotes )
T17593 784-790 NNPS denotes States
T17592 777-783 NNP denotes United
T17591 775-776 , denotes ,
T17590 765-775 NNP denotes California
T17589 763-764 , denotes ,
T17588 759-763 NNP denotes City
T17587 752-758 NNP denotes Foster
T17586 750-751 , denotes ,
T17585 740-750 NNPS denotes Biosystems
T17584 732-739 NNP denotes Applied
T17583 731-732 -LRB- denotes (
T17582 723-730 NNP denotes ABI7000
T17581 720-722 DT denotes an
T17580 717-719 IN denotes on
T17579 713-716 VBN denotes run
T17578 709-712 VBD denotes was
T17577 695-708 NN denotes amplification
T17576 691-694 NNP denotes PCR
T17575 689-690 , denotes ,
T17574 688-689 -RRB- denotes )
T17573 682-688 NNPS denotes States
T17572 675-681 NNP denotes United
T17571 673-674 , denotes ,
T17570 663-673 NNP denotes California
T17569 661-662 , denotes ,
T17568 653-661 NNP denotes Hercules
T17567 651-652 , denotes ,
T17566 644-651 NNP denotes Bio-Rad
T17565 643-644 -LRB- denotes (
T17564 639-642 NNP denotes ROX
T17563 634-638 IN denotes with
T17562 630-633 NN denotes kit
T17561 621-629 NN denotes supermix
T17560 615-620 JJ denotes green
T17559 610-614 NNP denotes SYBR
T17558 606-609 DT denotes the
T17557 600-605 VBG denotes Using
T17556 598-599 . denotes .
T17555 597-598 NN denotes ′
T17554 576-597 NNP denotes ACGATCATATTGCCCAGGAG3
T17553 575-576 CD denotes ′
T17552 574-575 CD denotes 5
T17551 572-573 , denotes ,
T17550 565-572 NNP denotes MHB1675
T17549 561-564 CC denotes and
T17548 559-560 : denotes ;
T17547 558-559 NN denotes ′
T17546 537-558 NNP denotes ATGGCCTGAATCACTTGGAC3
T17545 536-537 CD denotes ′
T17544 535-536 CD denotes 5
T17543 533-534 : denotes :
T17542 526-533 NNP denotes MHB1674
T17541 524-525 : denotes :
T17540 518-524 NN denotes globin
T17539 514-517 NN denotes min
T17538 513-514 NN denotes /
T17537 509-513 JJ denotes βmaj
T17536 505-508 IN denotes For
T17535 503-504 . denotes .
T17534 502-503 NN denotes ′
T17533 481-502 NNP denotes ACCTCTGGGGTGAATTCCTT3
T17532 480-481 CD denotes ′
T17531 479-480 CD denotes 5
T17530 477-478 , denotes ,
T17529 470-477 NNP denotes MHB1673
T17528 466-469 CC denotes and
T17527 464-465 : denotes ;
T17526 463-464 NN denotes ′
T17525 442-463 CD denotes TGGACAACCTCAAGGAGACC3
T17524 441-442 CD denotes ′
T17523 440-441 CD denotes 5
T17522 438-439 , denotes ,
T17521 431-438 NNP denotes MHB1672
T17520 429-430 : denotes :
T17519 423-429 NN denotes globin
T17518 419-422 JJ denotes βH1
T17517 415-418 IN denotes For
T17516 413-414 . denotes .
T17515 412-413 NN denotes ′
T17514 391-412 CD denotes CTTAACCGCATCCCCTACGG3
T17513 390-391 NN denotes ′
T17512 389-390 CD denotes 5
T17511 387-388 , denotes ,
T17510 380-387 NNP denotes MHB1669
T17509 376-379 CC denotes and
T17508 374-375 : denotes ;
T17507 373-374 NN denotes ′
T17506 351-373 CD denotes CTACCCCCAGACGAAGACCTA3
T17505 350-351 NN denotes ′
T17504 349-350 CD denotes 5
T17503 347-348 , denotes ,
T17502 340-347 CD denotes MHB1668
T17501 338-339 : denotes :
T17500 332-338 NN denotes globin
T17499 330-331 JJ denotes ζ
T17498 326-329 IN denotes For
T17497 324-325 . denotes .
T17496 323-324 NN denotes ′
T17495 301-323 NNP denotes GAAGCAGAGGACAAGTTCCCA3
T17494 300-301 CD denotes ′
T17493 299-300 CD denotes 5
T17492 297-298 , denotes ,
T17491 290-297 NNP denotes MHB1667
T17490 286-289 CC denotes and
T17489 284-285 : denotes ;
T17488 283-284 NN denotes ′
T17487 261-283 CD denotes TGGCCTGTGGAGTAAGGTCAA3
T17486 260-261 CD denotes ′
T17485 259-260 CD denotes 5
T17484 257-258 , denotes ,
T17483 250-257 NNP denotes MHB1666
T17482 248-249 : denotes :
T17481 242-248 NN denotes globin
T17480 239-241 JJ denotes ɛy
T17479 235-238 IN denotes For
T17478 233-234 . denotes .
T17477 222-233 NN denotes specificity
T17476 214-221 VB denotes confirm
T17475 211-213 TO denotes to
T17474 202-210 NN denotes database
T17473 197-201 NNP denotes NCBI
T17472 193-196 DT denotes the
T17471 185-192 IN denotes against
T17470 176-184 VBN denotes searched
T17469 171-175 VBD denotes were
T17468 163-170 NNS denotes primers
T17467 159-162 DT denotes All
T17466 157-158 . denotes .
T17465 156-157 NNP denotes ]
T17464 154-156 CD denotes 51
T17463 153-154 NNP denotes [
T17462 142-152 NNP denotes Primerbank
T17461 137-141 IN denotes from
T17460 128-136 VBN denotes obtained
T17459 123-127 VBD denotes were
T17458 117-122 NNS denotes genes
T17457 110-116 NN denotes globin
T17456 107-109 IN denotes of
T17455 93-106 NN denotes amplification
T17454 89-92 NNP denotes PCR
T17453 84-88 NNP denotes cDNA
T17452 80-83 IN denotes for
T17451 72-79 NNS denotes Primers
T17450 70-71 . denotes .
T17449 66-70 NNP denotes cDNA
T17448 63-65 TO denotes to
T17447 51-62 VBN denotes transcribed
T17446 43-50 JJ denotes reverse
T17445 37-42 JJ denotes first
T17444 33-36 VBD denotes was
T17443 29-32 NNP denotes RNA
T17442 27-28 . denotes .
T17441 23-27 NNP denotes mRNA
T17440 16-22 NN denotes globin
T17439 13-15 IN denotes of
T17438 0-12 NN denotes Quantitation
R12137 T17438 T17438 ROOT Quantitation,Quantitation
R12138 T17439 T17438 prep of,Quantitation
R12139 T17440 T17441 compound globin,mRNA
R12140 T17441 T17439 pobj mRNA,of
R12141 T17442 T17438 punct .,Quantitation
R12142 T17443 T17444 nsubj RNA,was
R12143 T17444 T17444 ROOT was,was
R12144 T17445 T17446 amod first,reverse
R12145 T17446 T17447 advmod reverse,transcribed
R12146 T17447 T17444 acomp transcribed,was
R12147 T17448 T17447 prep to,transcribed
R12148 T17449 T17448 pobj cDNA,to
R12149 T17450 T17444 punct .,was
R12150 T17451 T17460 nsubjpass Primers,obtained
R12151 T17452 T17451 prep for,Primers
R12152 T17453 T17455 compound cDNA,amplification
R12153 T17454 T17455 compound PCR,amplification
R12154 T17455 T17452 pobj amplification,for
R12155 T17456 T17455 prep of,amplification
R12156 T17457 T17458 compound globin,genes
R12157 T17458 T17456 pobj genes,of
R12158 T17459 T17460 auxpass were,obtained
R12159 T17460 T17460 ROOT obtained,obtained
R12160 T17461 T17460 prep from,obtained
R12161 T17462 T17463 compound Primerbank,[
R12162 T17463 T17461 pobj [,from
R12163 T17464 T17465 nummod 51,]
R12164 T17465 T17463 appos ],[
R12165 T17466 T17460 punct .,obtained
R12166 T17467 T17468 det All,primers
R12167 T17468 T17470 nsubjpass primers,searched
R12168 T17469 T17470 auxpass were,searched
R12169 T17470 T17470 ROOT searched,searched
R12170 T17471 T17470 prep against,searched
R12171 T17472 T17474 det the,database
R12172 T17473 T17474 compound NCBI,database
R12173 T17474 T17471 pobj database,against
R12174 T17475 T17476 aux to,confirm
R12175 T17476 T17470 advcl confirm,searched
R12176 T17477 T17476 dobj specificity,confirm
R12177 T17478 T17470 punct .,searched
R12178 T17479 T17479 ROOT For,For
R12179 T17480 T17481 amod ɛy,globin
R12180 T17481 T17479 pobj globin,For
R12181 T17482 T17481 punct :,globin
R12182 T17483 T17496 nmod MHB1666,′
R12183 T17484 T17483 punct ",",MHB1666
R12184 T17485 T17483 nummod 5,MHB1666
R12185 T17486 T17483 nummod ′,MHB1666
R12186 T17487 T17488 nummod TGGCCTGTGGAGTAAGGTCAA3,′
R12187 T17488 T17488 ROOT ′,′
R12188 T17489 T17483 punct ;,MHB1666
R12189 T17490 T17483 cc and,MHB1666
R12190 T17491 T17483 conj MHB1667,MHB1666
R12191 T17492 T17491 punct ",",MHB1667
R12192 T17493 T17496 nummod 5,′
R12193 T17494 T17496 nummod ′,′
R12194 T17495 T17496 compound GAAGCAGAGGACAAGTTCCCA3,′
R12195 T17496 T17481 appos ′,globin
R12196 T17497 T17479 punct .,For
R12197 T17498 T17498 ROOT For,For
R12198 T17499 T17500 amod ζ,globin
R12199 T17500 T17498 pobj globin,For
R12200 T17501 T17500 punct :,globin
R12201 T17502 T17515 nummod MHB1668,′
R12202 T17503 T17507 punct ",",′
R12203 T17504 T17507 nummod 5,′
R12204 T17505 T17507 nmod ′,′
R12205 T17506 T17507 nummod CTACCCCCAGACGAAGACCTA3,′
R12206 T17507 T17502 meta ′,MHB1668
R12207 T17508 T17502 punct ;,MHB1668
R12208 T17509 T17502 cc and,MHB1668
R12209 T17510 T17515 nmod MHB1669,′
R12210 T17511 T17510 punct ",",MHB1669
R12211 T17512 T17513 nummod 5,′
R12212 T17513 T17515 nmod ′,′
R12213 T17514 T17515 nummod CTTAACCGCATCCCCTACGG3,′
R12214 T17515 T17500 appos ′,globin
R12215 T17516 T17498 punct .,For
R12216 T17517 T17517 ROOT For,For
R12217 T17518 T17519 amod βH1,globin
R12218 T17519 T17517 pobj globin,For
R12219 T17520 T17519 punct :,globin
R12220 T17521 T17534 nmod MHB1672,′
R12221 T17522 T17521 punct ",",MHB1672
R12222 T17523 T17521 nummod 5,MHB1672
R12223 T17524 T17521 nummod ′,MHB1672
R12224 T17525 T17526 nummod TGGACAACCTCAAGGAGACC3,′
R12225 T17526 T17526 ROOT ′,′
R12226 T17527 T17521 punct ;,MHB1672
R12227 T17528 T17521 cc and,MHB1672
R12228 T17529 T17521 conj MHB1673,MHB1672
R12229 T17530 T17529 punct ",",MHB1673
R12230 T17531 T17534 nummod 5,′
R12231 T17532 T17534 nummod ′,′
R12232 T17533 T17534 compound ACCTCTGGGGTGAATTCCTT3,′
R12233 T17534 T17519 appos ′,globin
R12234 T17535 T17517 punct .,For
R12235 T17536 T17536 ROOT For,For
R12236 T17537 T17540 amod βmaj,globin
R12237 T17538 T17540 compound /,globin
R12238 T17539 T17540 compound min,globin
R12239 T17540 T17536 pobj globin,For
R12240 T17541 T17540 punct :,globin
R12241 T17542 T17555 nmod MHB1674,′
R12242 T17543 T17542 punct :,MHB1674
R12243 T17544 T17547 nummod 5,′
R12244 T17545 T17547 nummod ′,′
R12245 T17546 T17547 compound ATGGCCTGAATCACTTGGAC3,′
R12246 T17547 T17542 appos ′,MHB1674
R12247 T17548 T17542 punct ;,MHB1674
R12248 T17549 T17542 cc and,MHB1674
R12249 T17550 T17542 conj MHB1675,MHB1674
R12250 T17551 T17550 punct ",",MHB1675
R12251 T17552 T17555 nummod 5,′
R12252 T17553 T17555 nummod ′,′
R12253 T17554 T17555 compound ACGATCATATTGCCCAGGAG3,′
R12254 T17555 T17540 appos ′,globin
R12255 T17556 T17536 punct .,For
R12256 T17557 T17579 advcl Using,run
R12257 T17558 T17562 det the,kit
R12258 T17559 T17562 nmod SYBR,kit
R12259 T17560 T17562 amod green,kit
R12260 T17561 T17562 compound supermix,kit
R12261 T17562 T17557 dobj kit,Using
R12262 T17563 T17557 prep with,Using
R12263 T17564 T17563 pobj ROX,with
R12264 T17565 T17566 punct (,Bio-Rad
R12265 T17566 T17564 appos Bio-Rad,ROX
R12266 T17567 T17566 punct ",",Bio-Rad
R12267 T17568 T17566 conj Hercules,Bio-Rad
R12268 T17569 T17568 punct ",",Hercules
R12269 T17570 T17568 conj California,Hercules
R12270 T17571 T17570 punct ",",California
R12271 T17572 T17573 compound United,States
R12272 T17573 T17570 conj States,California
R12273 T17574 T17570 punct ),California
R12274 T17575 T17579 punct ",",run
R12275 T17576 T17577 compound PCR,amplification
R12276 T17577 T17579 nsubjpass amplification,run
R12277 T17578 T17579 auxpass was,run
R12278 T17579 T17579 ROOT run,run
R12279 T17580 T17579 prep on,run
R12280 T17581 T17585 det an,Biosystems
R12281 T17582 T17585 nmod ABI7000,Biosystems
R12282 T17583 T17585 punct (,Biosystems
R12283 T17584 T17585 compound Applied,Biosystems
R12284 T17585 T17580 pobj Biosystems,on
R12285 T17586 T17585 punct ",",Biosystems
R12286 T17587 T17588 compound Foster,City
R12287 T17588 T17585 conj City,Biosystems
R12288 T17589 T17588 punct ",",City
R12289 T17590 T17588 appos California,City
R12290 T17591 T17590 punct ",",California
R12291 T17592 T17593 compound United,States
R12292 T17593 T17590 appos States,California
R12293 T17594 T17588 punct ),City
R12294 T17595 T17585 prep at,Biosystems
R12295 T17596 T17597 det the,University
R12296 T17597 T17601 nmod University,facility
R12297 T17598 T17597 prep of,University
R12298 T17599 T17598 pobj Arizona,of
R12299 T17600 T17601 amod core,facility
R12300 T17601 T17595 pobj facility,at
R12301 T17602 T17579 punct .,run
R12302 T17603 T17604 det All,PCR
R12303 T17604 T17606 nsubjpass PCR,performed
R12304 T17605 T17606 auxpass was,performed
R12305 T17606 T17606 ROOT performed,performed
R12306 T17607 T17606 prep in,performed
R12307 T17608 T17610 det a,reaction
R12308 T17609 T17610 amod 25-μl,reaction
R12309 T17610 T17607 pobj reaction,in
R12310 T17611 T17610 prep with,reaction
R12311 T17612 T17613 nummod 12.5,μl
R12312 T17613 T17611 pobj μl,with
R12313 T17614 T17616 nmod SYBR,supermix
R12314 T17615 T17616 amod green,supermix
R12315 T17616 T17613 appos supermix,μl
R12316 T17617 T17606 punct .,performed
R12317 T17618 T17619 compound GAPDH,mRNA
R12318 T17619 T17620 compound mRNA,levels
R12319 T17620 T17622 nsubjpass levels,used
R12320 T17621 T17622 auxpass were,used
R12321 T17622 T17622 ROOT used,used
R12322 T17623 T17622 prep as,used
R12323 T17624 T17623 pobj control,as
R12324 T17625 T17624 prep for,control
R12325 T17626 T17627 compound input,RNA
R12326 T17627 T17625 pobj RNA,for
R12327 T17628 T17622 punct .,used
R12328 T17629 T17631 compound Standard,analyses
R12329 T17630 T17631 compound curve,analyses
R12330 T17631 T17633 nsubjpass analyses,performed
R12331 T17632 T17633 auxpass were,performed
R12332 T17633 T17633 ROOT performed,performed
R12333 T17634 T17635 aux to,test
R12334 T17635 T17633 xcomp test,performed
R12335 T17636 T17637 det the,efficiency
R12336 T17637 T17635 dobj efficiency,test
R12337 T17638 T17637 prep of,efficiency
R12338 T17639 T17640 det the,amplifications
R12339 T17640 T17638 pobj amplifications,of
R12340 T17641 T17633 punct .,performed
R12341 T17642 T17644 nsubjpass Triplicates,done
R12342 T17643 T17644 auxpass were,done
R12343 T17644 T17644 ROOT done,done
R12344 T17645 T17644 prep for,done
R12345 T17646 T17648 det each,reaction
R12346 T17647 T17648 compound PCR,reaction
R12347 T17648 T17645 pobj reaction,for
R12348 T17649 T17644 punct .,done
R12349 T17650 T17652 amod Relative,values
R12350 T17651 T17652 amod quantitative,values
R12351 T17652 T17654 nsubjpass values,calculated
R12352 T17653 T17654 auxpass were,calculated
R12353 T17654 T17654 ROOT calculated,calculated
R12354 T17655 T17654 prep in,calculated
R12355 T17656 T17661 det the,Software
R12356 T17657 T17658 compound ABI,Prism
R12357 T17658 T17661 nmod Prism,Software
R12358 T17659 T17661 nummod 7000,Software
R12359 T17660 T17661 compound SDS,Software
R12360 T17661 T17655 pobj Software,in
R12361 T17662 T17664 punct (,Biosystems
R12362 T17663 T17664 compound Applied,Biosystems
R12363 T17664 T17661 appos Biosystems,Software
R12364 T17665 T17664 punct ),Biosystems
R12365 T17666 T17654 cc and,calculated
R12366 T17667 T17654 conj normalized,calculated
R12367 T17668 T17667 prep to,normalized
R12368 T17669 T17668 pobj GAPDH,to
R12369 T17670 T17667 prep in,normalized
R12370 T17671 T17672 compound Microsoft,Excel
R12371 T17672 T17670 pobj Excel,in
R12372 T17673 T17674 punct (,Redmond
R12373 T17674 T17672 appos Redmond,Excel
R12374 T17675 T17674 punct ",",Redmond
R12375 T17676 T17674 conj Washington,Redmond
R12376 T17677 T17676 punct ",",Washington
R12377 T17678 T17679 compound United,States
R12378 T17679 T17674 appos States,Redmond
R12379 T17680 T17674 punct ),Redmond
R12380 T17681 T17654 punct .,calculated

bionlp-st-ge-2016-test-tees

Id Subject Object Predicate Lexical cue
T17418 509-524 Protein denotes βmaj/min globin
T17417 419-429 Protein denotes βH1 globin
T17416 340-347 Protein denotes MHB1668
T17415 330-338 Protein denotes ζ globin
T17414 250-257 Protein denotes MHB1666
T17413 239-248 Protein denotes ɛy globin
T17412 110-122 Protein denotes globin genes
T17411 16-27 Protein denotes globin mRNA
T17423 1215-1220 Protein denotes GAPDH
T17422 912-922 Protein denotes GAPDH mRNA
T17421 648-651 Protein denotes Rad
T17420 644-647 Protein denotes Bio
T17419 639-642 Protein denotes ROX

testone

Id Subject Object Predicate Lexical cue
T17127 0-12 Negative_regulation denotes Quantitation
T17126 1215-1220 Protein denotes GAPDH
T17125 912-917 Protein denotes GAPDH
T17124 514-524 Protein denotes min globin
T17123 509-513 Protein denotes βmaj
T17122 419-429 Protein denotes βH1 globin
T17121 330-338 Protein denotes ζ globin
T17120 239-248 Protein denotes ɛy globin

test3

Id Subject Object Predicate Lexical cue
T17141 1215-1220 Protein denotes GAPDH
T17140 912-917 Protein denotes GAPDH
T17139 514-524 Protein denotes min globin
T17138 509-513 Protein denotes βmaj
T17137 419-429 Protein denotes βH1 globin
T17136 330-338 Protein denotes ζ globin
T17135 239-248 Protein denotes ɛy globin
T17134 1215-1220 Protein denotes GAPDH
T17133 912-917 Protein denotes GAPDH
T17132 514-524 Protein denotes min globin
T17131 509-513 Protein denotes βmaj
T17130 419-429 Protein denotes βH1 globin
T17129 330-338 Protein denotes ζ globin
T17128 239-248 Protein denotes ɛy globin