> top > docs > PMC:1359074 > annotations

PMC:1359074 JSONTXT

Annnotations TAB JSON ListView MergeView

2_test

Id Subject Object Predicate Lexical cue
16462943-15721738-85760951 3065-3066 15721738 denotes 1
16462943-1425584-85760952 3207-3208 1425584 denotes 2
16462943-8078769-85760953 3209-3210 8078769 denotes 3
16462943-8404853-85760954 3284-3285 8404853 denotes 4
16462943-11504872-85760955 3677-3678 11504872 denotes 5
16462943-9755172-85760956 3679-3680 9755172 denotes 6
16462943-11818535-85760957 3798-3799 11818535 denotes 7
16462943-11818535-85760958 4029-4030 11818535 denotes 7
16462943-7567444-85760959 4246-4247 7567444 denotes 8
16462943-14988021-85760959 4246-4247 14988021 denotes 8
16462943-15527762-85760959 4246-4247 15527762 denotes 8
16462943-15846364-85760959 4246-4247 15846364 denotes 8
16462943-9755172-85760960 4264-4265 9755172 denotes 6
16462943-11702786-85760961 4269-4271 11702786 denotes 13
16462943-10760285-85760962 4286-4288 10760285 denotes 14
16462943-14530442-85760963 4289-4291 14530442 denotes 15
16462943-10760285-85760964 4377-4379 10760285 denotes 14
16462943-10760285-85760965 4515-4517 10760285 denotes 14
16462943-10760285-85760966 4714-4716 10760285 denotes 14
16462943-11310796-85760967 4772-4774 11310796 denotes 16
16462943-11497996-85760968 5110-5112 11497996 denotes 17
16462943-10871404-85760969 5397-5399 10871404 denotes 18
16462943-8622684-85760969 5397-5399 8622684 denotes 18
16462943-9566881-85760969 5397-5399 9566881 denotes 18
16462943-10908341-85760969 5397-5399 10908341 denotes 18
16462943-9887104-85760970 5593-5595 9887104 denotes 22
16462943-12384402-85760971 5800-5802 12384402 denotes 23
16462943-9887104-85760972 6007-6009 9887104 denotes 22
16462943-9887104-85760973 6160-6162 9887104 denotes 22
16462943-2251502-85760974 6385-6387 2251502 denotes 24
16462943-12324650-85760975 6388-6390 12324650 denotes 25
16462943-10192336-85760976 6476-6478 10192336 denotes 26
16462943-2251502-85760977 6570-6572 2251502 denotes 24
16462943-12324650-85760978 6573-6575 12324650 denotes 25
16462943-15730849-85760979 6687-6689 15730849 denotes 27
16462943-15730849-85760980 6980-6982 15730849 denotes 27
16462943-15730849-85760981 7194-7196 15730849 denotes 27
16462943-7567444-85760982 7422-7423 7567444 denotes 8
16462943-14988021-85760982 7422-7423 14988021 denotes 8
16462943-15527762-85760982 7422-7423 15527762 denotes 8
16462943-15846364-85760982 7422-7423 15846364 denotes 8
16462943-9755172-85760983 7440-7441 9755172 denotes 6
16462943-11702786-85760984 7445-7447 11702786 denotes 13
16462943-10760285-85760985 7462-7464 10760285 denotes 14
16462943-14530442-85760986 7465-7467 14530442 denotes 15
16462943-15730849-85760987 7839-7841 15730849 denotes 27
16462943-11702786-85760988 8784-8786 11702786 denotes 13
16462943-10760285-85760989 9699-9701 10760285 denotes 14
16462943-1701019-85760990 10153-10155 1701019 denotes 29
16462943-1848707-85760991 11288-11290 1848707 denotes 30
16462943-2748594-85760992 11395-11397 2748594 denotes 31
16462943-12677004-85760993 11764-11766 12677004 denotes 32
16462943-11504872-85760994 13449-13450 11504872 denotes 5
16462943-11504872-85760995 13754-13755 11504872 denotes 5
16462943-11504872-85760996 14257-14258 11504872 denotes 5
16462943-283312-85760997 18319-18321 283312 denotes 33
16462943-11071752-85760998 26030-26032 11071752 denotes 34
16462943-9755172-85760999 26131-26132 9755172 denotes 6
16462943-7791783-85761000 26133-26135 7791783 denotes 35
16462943-9755172-85761001 26305-26306 9755172 denotes 6
16462943-11504872-85761002 26405-26406 11504872 denotes 5
16462943-10729834-85761003 27218-27220 10729834 denotes 36
16462943-12093744-85761004 27546-27548 12093744 denotes 37
16462943-9927428-85761005 27563-27565 9927428 denotes 38
16462943-1425584-85761006 27915-27916 1425584 denotes 2
16462943-8078769-85761006 27915-27916 8078769 denotes 2
16462943-8404853-85761006 27915-27916 8404853 denotes 2
16462943-11069894-85761007 28506-28508 11069894 denotes 39
16462943-9883803-85761008 28784-28786 9883803 denotes 40
16462943-10760285-85761009 30324-30326 10760285 denotes 14
16462943-14530442-85761010 31757-31759 14530442 denotes 15
16462943-15527762-85761011 31772-31774 15527762 denotes 10
16462943-15846364-85761012 31789-31791 15846364 denotes 11
16462943-12677004-85761013 31834-31836 12677004 denotes 32
16462943-11984693-85761014 31837-31839 11984693 denotes 41
16462943-12729559-85761014 31837-31839 12729559 denotes 41
16462943-15529345-85761014 31837-31839 15529345 denotes 41
16462943-14993235-85761014 31837-31839 14993235 denotes 41
16462943-11702786-85761015 32115-32117 11702786 denotes 13
16462943-10037800-85761016 32118-32120 10037800 denotes 45
16462943-15102707-85761017 32121-32123 15102707 denotes 46
16462943-12124399-85761018 32662-32664 12124399 denotes 47
16462943-11255018-85761019 33006-33008 11255018 denotes 48
16462943-9651319-85761020 33337-33339 9651319 denotes 49
16462943-1737096-85761021 33340-33342 1737096 denotes 50
16462943-1737096-85761022 34060-34062 1737096 denotes 50
16462943-2748594-85761023 34500-34502 2748594 denotes 31
16462943-14530442-85761024 35301-35303 14530442 denotes 15
16462943-12677004-85761025 35478-35480 12677004 denotes 32
16462943-14654707-85761026 36042-36044 14654707 denotes 51
16462943-8562047-85761027 37590-37592 8562047 denotes 52
16462943-14530442-85761028 40522-40524 14530442 denotes 15
16462943-11818535-85761029 40897-40898 11818535 denotes 7
16462943-15302897-85761030 42674-42676 15302897 denotes 53
T25472 3065-3066 15721738 denotes 1
T92399 3207-3208 1425584 denotes 2
T83652 3209-3210 8078769 denotes 3
T27842 3284-3285 8404853 denotes 4
T61683 3677-3678 11504872 denotes 5
T79059 3679-3680 9755172 denotes 6
T88037 3798-3799 11818535 denotes 7
T40137 4029-4030 11818535 denotes 7
T45738 4246-4247 7567444 denotes 8
T82032 4246-4247 14988021 denotes 8
T33694 4246-4247 15527762 denotes 8
T38280 4246-4247 15846364 denotes 8
T90351 4264-4265 9755172 denotes 6
T9372 4269-4271 11702786 denotes 13
T69328 4286-4288 10760285 denotes 14
T86458 4289-4291 14530442 denotes 15
T16581 4377-4379 10760285 denotes 14
T66355 4515-4517 10760285 denotes 14
T42 4714-4716 10760285 denotes 14
T20259 4772-4774 11310796 denotes 16
T43152 5110-5112 11497996 denotes 17
T58158 5397-5399 10871404 denotes 18
T32189 5397-5399 8622684 denotes 18
T90133 5397-5399 9566881 denotes 18
T83229 5397-5399 10908341 denotes 18
T95179 5593-5595 9887104 denotes 22
T53294 5800-5802 12384402 denotes 23
T97722 6007-6009 9887104 denotes 22
T37501 6160-6162 9887104 denotes 22
T20450 6385-6387 2251502 denotes 24
T67689 6388-6390 12324650 denotes 25
T67355 6476-6478 10192336 denotes 26
T4658 6570-6572 2251502 denotes 24
T38161 6573-6575 12324650 denotes 25
T66161 6687-6689 15730849 denotes 27
T44001 6980-6982 15730849 denotes 27
T9633 7194-7196 15730849 denotes 27
T11140 7422-7423 7567444 denotes 8
T59872 7422-7423 14988021 denotes 8
T36493 7422-7423 15527762 denotes 8
T10217 7422-7423 15846364 denotes 8
T1755 7440-7441 9755172 denotes 6
T16819 7445-7447 11702786 denotes 13
T38852 7462-7464 10760285 denotes 14
T5543 7465-7467 14530442 denotes 15
T90570 7839-7841 15730849 denotes 27
T32068 8784-8786 11702786 denotes 13
T50025 9699-9701 10760285 denotes 14
T75422 10153-10155 1701019 denotes 29
T87948 11288-11290 1848707 denotes 30
T97917 11395-11397 2748594 denotes 31
T50696 11764-11766 12677004 denotes 32
T36890 13449-13450 11504872 denotes 5
T88558 13754-13755 11504872 denotes 5
T4443 14257-14258 11504872 denotes 5
T6698 18319-18321 283312 denotes 33
T54538 26030-26032 11071752 denotes 34
T50226 26131-26132 9755172 denotes 6
T60138 26133-26135 7791783 denotes 35
T8724 26305-26306 9755172 denotes 6
T45584 26405-26406 11504872 denotes 5
T44834 27218-27220 10729834 denotes 36
T17962 27546-27548 12093744 denotes 37
T91162 27563-27565 9927428 denotes 38
T50882 27915-27916 1425584 denotes 2
T85165 27915-27916 8078769 denotes 2
T95773 27915-27916 8404853 denotes 2
T23964 28506-28508 11069894 denotes 39
T10008 28784-28786 9883803 denotes 40
T23878 30324-30326 10760285 denotes 14
T48378 31757-31759 14530442 denotes 15
T46071 31772-31774 15527762 denotes 10
T60696 31789-31791 15846364 denotes 11
T13152 31834-31836 12677004 denotes 32
T86538 31837-31839 11984693 denotes 41
T39058 31837-31839 12729559 denotes 41
T89749 31837-31839 15529345 denotes 41
T44436 31837-31839 14993235 denotes 41
T36430 32115-32117 11702786 denotes 13
T69046 32118-32120 10037800 denotes 45
T86722 32121-32123 15102707 denotes 46
T87744 32662-32664 12124399 denotes 47
T73167 33006-33008 11255018 denotes 48
T29811 33337-33339 9651319 denotes 49
T50623 33340-33342 1737096 denotes 50
T43787 34060-34062 1737096 denotes 50
T59528 34500-34502 2748594 denotes 31
T89386 35301-35303 14530442 denotes 15
T39276 35478-35480 12677004 denotes 32
T25296 36042-36044 14654707 denotes 51
T83427 37590-37592 8562047 denotes 52
T81428 40522-40524 14530442 denotes 15
T70190 40897-40898 11818535 denotes 7
T20377 42674-42676 15302897 denotes 53

pmc-enju-pas

Id Subject Object Predicate Lexical cue
T250 0-4 NN denotes Sox6
T251 5-13 NNP denotes Directly
T252 14-22 NNP denotes Silences
T253 23-30 NNP denotes Epsilon
T254 31-37 NNP denotes Globin
T255 38-48 NN denotes Expression
T256 49-51 IN denotes in
T257 52-62 JJ denotes Definitive
T258 63-77 NN denotes Erythropoiesis
T7965 19825-19830 NN denotes dimer
T19941 42507-42547 NN denotes 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′
T20665 44132-44135 NN denotes min
T20664 44130-44131 CD denotes 5
T20663 44126-44129 IN denotes for
T20662 44123-44125 NN denotes °C
T20661 44120-44122 CD denotes 72
T20660 44117-44119 IN denotes at
T20659 44107-44116 NN denotes extension
T20658 44101-44106 JJ denotes final
T20657 44099-44100 DT denotes a
T20656 44094-44098 IN denotes with
T20655 44087-44093 VB denotes ending
T20654 44085-44086 -COMMA- denotes ,
T20653 44084-44085 NN denotes s
T20652 44081-44083 CD denotes 45
T20651 44077-44080 IN denotes for
T20650 44074-44076 NN denotes °C
T20649 44071-44073 CD denotes 72
T20648 44067-44070 CC denotes and
T20647 44065-44066 -COMMA- denotes ,
T20646 44064-44065 NN denotes s
T20645 44061-44063 CD denotes 30
T20644 44057-44060 IN denotes for
T20643 44054-44056 NN denotes °C
T20642 44051-44053 CD denotes 60
T20641 44049-44050 -COMMA- denotes ,
T20640 44048-44049 NN denotes s
T20639 44045-44047 CD denotes 30
T20638 44041-44044 IN denotes for
T20637 44038-44040 NN denotes °C
T20636 44035-44037 CD denotes 95
T20635 44032-44034 IN denotes at
T20634 44025-44031 NN denotes cycles
T20633 44022-44024 CD denotes 30
T20632 44019-44021 IN denotes by
T20631 44010-44018 VB denotes followed
T20630 44006-44009 NN denotes min
T20629 44003-44005 CD denotes 15
T20628 43999-44002 IN denotes for
T20627 43996-43998 NN denotes °C
T20626 43993-43995 CD denotes 95
T20625 43991-43992 -COLON- denotes :
T20624 43981-43991 NN denotes conditions
T20623 43971-43980 JJ denotes following
T20622 43967-43970 DT denotes the
T20621 43961-43966 IN denotes under
T20620 43951-43960 VB denotes performed
T20619 43947-43950 VB denotes was
T20618 43943-43946 NN denotes PCR
T20617 43940-43941 -RRB- denotes )
T20616 43916-43940 NN denotes 5′GCTTCACCACCAACCTCTTC3′
T20615 43914-43915 -COMMA- denotes ,
T20614 43907-43914 NN denotes MHB1689
T20613 43903-43906 CC denotes and
T20612 43901-43902 -COLON- denotes ;
T20611 43877-43901 NN denotes 5′CGAAGAATAAAAGGCCACCA3′
T20610 43875-43876 -COMMA- denotes ,
T20609 43868-43875 NN denotes MHB1688
T20608 43860-43867 NN denotes primers
T20607 43859-43860 -LRB- denotes (
T20606 43850-43858 NN denotes promoter
T20605 43847-43849 JJ denotes ɛy
T20604 43843-43846 DT denotes the
T20603 43840-43842 IN denotes of
T20602 43835-43839 CD denotes +140
T20601 43832-43834 TO denotes to
T20600 43828-43831 CD denotes −31
T20599 43816-43827 NN denotes nucleotides
T20598 43813-43815 TO denotes to
T20597 43799-43812 VB denotes corresponding
T20596 43797-43798 -COMMA- denotes ,
T20595 43789-43797 NN denotes amplicon
T20594 43782-43788 JJ denotes 172-bp
T20593 43780-43781 DT denotes a
T20592 43772-43779 VB denotes yielded
T20591 43768-43771 CC denotes and
T20590 43758-43767 VB denotes performed
T20589 43754-43757 VB denotes was
T20588 43745-43753 NN denotes promoter
T20587 43742-43744 JJ denotes ɛy
T20586 43738-43741 DT denotes the
T20585 43735-43737 IN denotes of
T20584 43721-43734 NN denotes amplification
T20583 43717-43720 NN denotes PCR
T20582 43707-43715 NN denotes reaction
T20581 43703-43706 NN denotes PCR
T20580 43699-43702 DT denotes the
T20579 43696-43698 IN denotes in
T20578 43687-43695 NN denotes template
T20577 43685-43686 DT denotes a
T20576 43682-43684 IN denotes as
T20575 43677-43681 VB denotes used
T20574 43673-43676 VB denotes was
T20573 43669-43672 NN denotes DNA
T20572 43650-43668 VB denotes immunoprecipitated
T20571 43647-43649 CC denotes or
T20570 43643-43646 NN denotes DNA
T20569 43637-43642 NN denotes Input
T20568 43634-43635 NN denotes h
T20567 43632-43633 CD denotes 4
T20566 43628-43631 IN denotes for
T20565 43625-43627 NN denotes °C
T20564 43622-43624 CD denotes 65
T20563 43619-43621 IN denotes at
T20562 43614-43618 NN denotes NaCl
T20561 43612-43613 NN denotes M
T20560 43610-43611 CD denotes 5
T20559 43605-43609 IN denotes with
T20558 43596-43604 VB denotes reversed
T20557 43591-43595 VB denotes were
T20556 43579-43590 NN denotes cross-links
T20555 43571-43578 NN denotes protein
T20554 43567-43570 NN denotes DNA
T20553 43563-43566 DT denotes the
T20552 43559-43562 CC denotes and
T20551 43557-43558 -COMMA- denotes ,
T20550 43551-43557 VB denotes eluted
T20549 43546-43550 VB denotes were
T20548 43536-43545 NN denotes complexes
T20547 43517-43535 NN denotes chromatin-antibody
T20546 43513-43516 DT denotes The
T20545 43503-43511 NN denotes controls
T20544 43494-43502 JJ denotes negative
T20543 43491-43493 IN denotes as
T20542 43486-43490 VB denotes used
T20541 43481-43485 VB denotes were
T20540 43477-43480 CD denotes two
T20539 43472-43476 JJ denotes last
T20538 43468-43471 DT denotes The
T20537 43464-43467 NNP denotes Ab.
T20536 43456-43463 IN denotes without
T20535 43449-43455 NN denotes sample
T20534 43443-43448 JJ denotes third
T20533 43439-43442 DT denotes the
T20532 43435-43438 CC denotes and
T20531 43433-43434 -COMMA- denotes ,
T20530 43430-43433 NN denotes IgG
T20529 43423-43429 NN denotes rabbit
T20528 43416-43422 JJ denotes normal
T20527 43411-43415 IN denotes with
T20526 43403-43410 VB denotes treated
T20525 43396-43402 JJ denotes second
T20524 43394-43395 DT denotes a
T20523 43392-43393 -COMMA- denotes ,
T20522 43383-43392 NN denotes anti-Sox6
T20521 43378-43382 IN denotes with
T20520 43370-43377 VB denotes treated
T20519 43363-43369 NN denotes sample
T20518 43359-43362 CD denotes one
T20517 43357-43358 -COLON- denotes :
T20516 43351-43357 NN denotes thirds
T20515 43346-43350 IN denotes into
T20514 43340-43345 VB denotes split
T20513 43335-43339 VB denotes were
T20512 43327-43334 NN denotes samples
T20511 43323-43326 DT denotes the
T20510 43321-43322 -COMMA- denotes ,
T20509 43310-43321 NN denotes preclearing
T20508 43300-43309 VB denotes Following
T20507 43297-43298 -RRB- denotes )
T20506 43291-43297 NNP denotes States
T20505 43284-43290 NNP denotes United
T20504 43282-43283 -COMMA- denotes ,
T20503 43276-43282 NNP denotes Jersey
T20502 43272-43275 NNP denotes New
T20501 43270-43271 -COMMA- denotes ,
T20500 43260-43270 NNP denotes Piscataway
T20499 43258-43259 -COMMA- denotes ,
T20498 43247-43258 NNP denotes Biosciences
T20497 43238-43246 NNP denotes Amersham
T20496 43237-43238 -LRB- denotes (
T20495 43225-43236 NN denotes A-Sepharose
T20494 43217-43224 NN denotes protein
T20493 43212-43216 IN denotes with
T20492 43201-43211 VB denotes precleared
T20491 43197-43200 VB denotes was
T20490 43190-43196 NN denotes sample
T20489 43180-43189 VB denotes remaining
T20488 43176-43179 DT denotes the
T20487 43172-43175 CC denotes and
T20486 43170-43171 -COMMA- denotes ,
T20485 43163-43170 NN denotes control
T20484 43157-43162 NN denotes input
T20483 43153-43156 IN denotes for
T20482 43147-43152 RB denotes aside
T20481 43143-43146 VB denotes set
T20480 43139-43142 VB denotes was
T20479 43132-43138 NN denotes sample
T20478 43128-43131 DT denotes the
T20477 43125-43127 IN denotes of
T20476 43115-43124 NN denotes One-tenth
T20475 43111-43113 NN denotes bp
T20474 43107-43110 CD denotes 600
T20473 43103-43106 CC denotes and
T20472 43099-43102 CD denotes 200
T20471 43096-43098 TO denotes to
T20470 43086-43095 VB denotes sonicated
T20469 43081-43085 VB denotes were
T20468 43071-43080 NN denotes complexes
T20467 43059-43070 JJ denotes DNA-protein
T20466 43054-43057 NN denotes min
T20465 43051-43053 CD denotes 10
T20464 43047-43050 IN denotes for
T20463 43043-43046 NN denotes ice
T20462 43040-43042 IN denotes on
T20461 43030-43039 VB denotes incubated
T20460 43026-43029 CC denotes and
T20459 43024-43025 -COMMA- denotes ,
T20458 43014-43024 NN denotes inhibitors
T20457 43005-43013 NN denotes protease
T20456 42994-43004 VB denotes containing
T20455 42987-42993 NN denotes buffer
T20454 42981-42986 NN denotes lysis
T20453 42977-42980 NN denotes SDS
T20452 42975-42976 DT denotes a
T20451 42972-42974 IN denotes in
T20450 42960-42971 VB denotes resuspended
T20449 42958-42959 -COMMA- denotes ,
T20448 42956-42958 NN denotes °C
T20447 42954-42955 CD denotes 4
T20446 42951-42953 IN denotes at
T20445 42936-42950 NN denotes centrifugation
T20444 42933-42935 IN denotes by
T20443 42923-42932 VB denotes collected
T20442 42921-42922 -COMMA- denotes ,
T20441 42911-42921 NN denotes inhibitors
T20440 42902-42910 NN denotes protease
T20439 42891-42901 VB denotes containing
T20438 42886-42890 NN denotes EDTA
T20437 42884-42885 NN denotes %
T20436 42881-42884 CD denotes 0.1
T20435 42876-42880 IN denotes with
T20434 42867-42875 NN denotes solution
T20433 42862-42866 NN denotes salt
T20432 42853-42861 JJ denotes balanced
T20431 42851-42852 POS denotes '
T20430 42846-42851 NNP denotes Hanks
T20429 42843-42845 CD denotes 1×
T20428 42834-42842 JJ denotes ice-cold
T20427 42831-42833 IN denotes in
T20426 42824-42830 VB denotes rinsed
T20425 42822-42823 -COMMA- denotes ,
T20424 42820-42822 NN denotes °C
T20423 42817-42819 CD denotes 37
T20422 42814-42816 IN denotes at
T20421 42810-42813 NN denotes min
T20420 42807-42809 CD denotes 10
T20419 42803-42806 IN denotes for
T20418 42790-42802 NN denotes formaldehyde
T20417 42788-42789 NN denotes %
T20416 42787-42788 CD denotes 1
T20415 42782-42786 IN denotes with
T20414 42774-42781 VB denotes treated
T20413 42769-42773 VB denotes were
T20412 42764-42768 NN denotes mice
T20411 42761-42763 JJ denotes WT
T20410 42752-42760 JJ denotes 15.5-dpc
T20409 42746-42751 CD denotes three
T20408 42741-42745 IN denotes from
T20407 42735-42740 NN denotes cells
T20406 42729-42734 NN denotes liver
T20405 42723-42728 JJ denotes fetal
T20404 42720-42722 CC denotes or
T20403 42718-42719 -RRB- denotes )
T20402 42715-42718 CD denotes 107
T20401 42713-42714 NN denotes ×
T20400 42711-42712 CD denotes 4
T20399 42710-42711 -LRB- denotes (
T20398 42704-42709 NN denotes cells
T20397 42700-42703 NN denotes MEL
T20396 42695-42699 IN denotes from
T20395 42689-42694 NN denotes Cells
T20394 42687-42688 -COLON- denotes :
T20393 42682-42687 NN denotes brief
T20392 42679-42681 IN denotes in
T20391 42677-42678 -COMMA- denotes ,
T20390 42676-42677 -RRB- denotes ]
T20389 42674-42676 CD denotes 53
T20388 42673-42674 -LRB- denotes [
T20387 42665-42672 NNP denotes Nouzova
T20386 42662-42664 IN denotes by
T20385 42652-42661 VB denotes described
T20384 42649-42651 IN denotes As
T20383 42642-42647 NN denotes assay
T20382 42637-42641 NN denotes ChIP
T19957 42633-42634 -RRB- denotes )
T19956 42626-42633 NN denotes MHB1650
T19955 42625-42626 -LRB- denotes (
T19954 42584-42624 NN denotes 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′
T19953 42582-42583 -COLON- denotes :
T19952 42581-42582 -RRB- denotes )
T19951 42579-42581 NN denotes M3
T19950 42578-42579 -LRB- denotes (
T19949 42576-42577 CD denotes 3
T19948 42570-42575 NN denotes probe
T19947 42563-42569 JJ denotes mutant
T19946 42559-42562 IN denotes for
T19945 42557-42558 -COLON- denotes ;
T19944 42556-42557 -RRB- denotes )
T19943 42549-42556 NN denotes MHB1648
T19942 42548-42549 -LRB- denotes (
T19940 42505-42506 -COLON- denotes :
T19939 42504-42505 -RRB- denotes )
T19938 42502-42504 NN denotes M2
T19937 42501-42502 -LRB- denotes (
T19936 42499-42500 CD denotes 2
T19935 42493-42498 NN denotes probe
T19934 42486-42492 JJ denotes mutant
T19933 42482-42485 IN denotes for
T19932 42480-42481 -COLON- denotes ;
T19931 42479-42480 -RRB- denotes )
T19930 42472-42479 NN denotes MHB1644
T19929 42471-42472 -LRB- denotes (
T19928 42437-42470 NN denotes 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′
T19927 42435-42436 -COLON- denotes :
T19926 42434-42435 -RRB- denotes )
T19925 42432-42434 NN denotes M1
T19924 42431-42432 -LRB- denotes (
T19923 42429-42430 CD denotes 1
T19922 42423-42428 NN denotes probe
T19921 42416-42422 JJ denotes mutant
T19920 42412-42415 IN denotes for
T19919 42410-42411 -COLON- denotes ;
T19918 42409-42410 -RRB- denotes )
T19917 42402-42409 NN denotes MHB1556
T19916 42401-42402 -LRB- denotes (
T19915 42360-42400 NN denotes 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′
T19914 42358-42359 -COLON- denotes :
T19913 42353-42358 NN denotes probe
T19912 42350-42352 NN denotes WT
T19911 42344-42349 JJ denotes 36-bp
T19910 42340-42343 DT denotes the
T19909 42336-42339 IN denotes For
T19908 42334-42335 -COLON- denotes :
T19907 42333-42334 -RRB- denotes )
T19906 42327-42333 VB denotes listed
T19905 42323-42326 VB denotes are
T19904 42316-42322 NN denotes oligos
T19903 42308-42315 JJ denotes forward
T19902 42303-42307 RB denotes only
T19901 42302-42303 -LRB- denotes (
T19900 42294-42301 NN denotes follows
T19899 42291-42293 IN denotes as
T19898 42287-42290 VB denotes are
T19897 42270-42286 NN denotes oligonucleotides
T19896 42266-42269 DT denotes the
T19895 42263-42265 IN denotes of
T19894 42253-42262 NN denotes sequences
T19893 42249-42252 NN denotes DNA
T19892 42245-42248 DT denotes The
T19891 42242-42243 -RRB- denotes )
T19890 42237-42242 JJ denotes above
T19889 42234-42236 IN denotes as
T19888 42224-42233 VB denotes described
T19887 42223-42224 -LRB- denotes (
T19886 42212-42222 NN denotes antibodies
T19885 42207-42211 NN denotes Sox6
T19884 42203-42206 CC denotes and
T19883 42201-42202 -COMMA- denotes ,
T19882 42199-42201 NN denotes HA
T19881 42197-42198 -COMMA- denotes ,
T19880 42192-42197 NN denotes c-Myc
T19879 42183-42191 VB denotes included
T19878 42174-42182 NN denotes analyses
T19877 42163-42173 NN denotes supershift
T19876 42159-42162 IN denotes for
T19874 42143-42153 NN denotes Antibodies
T19873 42126-42141 NN denotes autoradiography
T19872 42123-42125 TO denotes to
T19871 42117-42122 RB denotes prior
T19870 42111-42116 VB denotes dried
T19869 42106-42110 VB denotes were
T19868 42101-42105 NN denotes gels
T19867 42097-42100 DT denotes the
T19866 42093-42096 CC denotes and
T19865 42091-42092 -COMMA- denotes ,
T19864 42080-42091 NN denotes temperature
T19863 42075-42079 NN denotes room
T19862 42072-42074 IN denotes at
T19861 42070-42071 NN denotes h
T19860 42066-42069 CD denotes 4–8
T19859 42062-42065 IN denotes for
T19858 42057-42061 NN denotes mAmp
T19857 42054-42056 CD denotes 19
T19856 42045-42053 JJ denotes constant
T19855 42043-42044 DT denotes a
T19854 42040-42042 IN denotes at
T19853 42030-42039 VB denotes performed
T19852 42026-42029 VB denotes was
T19851 42010-42025 NN denotes Electrophoresis
T19850 42005-42008 NN denotes gel
T19849 41990-42004 NN denotes polyacrylamide
T19848 41988-41989 -RRB- denotes )
T19847 41985-41988 NN denotes w/v
T19846 41984-41985 -LRB- denotes (
T19845 41982-41983 NN denotes %
T19844 41981-41982 CD denotes 6
T19843 41978-41980 CC denotes or
T19842 41976-41977 NN denotes %
T19841 41975-41976 CD denotes 4
T19840 41973-41974 DT denotes a
T19839 41970-41972 IN denotes on
T19838 41963-41969 VB denotes loaded
T19837 41959-41962 CC denotes and
T19836 41947-41958 NN denotes temperature
T19835 41942-41946 NN denotes room
T19834 41939-41941 IN denotes at
T19833 41935-41938 NN denotes min
T19832 41932-41934 CD denotes 60
T19831 41929-41931 CC denotes or
T19830 41925-41928 NN denotes min
T19829 41922-41924 CD denotes 30
T19828 41918-41921 IN denotes for
T19827 41908-41917 VB denotes incubated
T19826 41903-41907 VB denotes were
T19825 41895-41902 NN denotes samples
T19824 41891-41894 DT denotes the
T19823 41889-41890 -COMMA- denotes ,
T19822 41884-41889 NN denotes probe
T19821 41871-41883 VB denotes radiolabeled
T19820 41867-41870 DT denotes the
T19819 41864-41866 IN denotes of
T19818 41855-41863 NN denotes addition
T19817 41845-41854 VB denotes Following
T19816 41838-41843 NN denotes probe
T19815 41825-41837 VB denotes radiolabeled
T19814 41822-41824 IN denotes of
T19813 41813-41821 NN denotes addition
T19812 41810-41812 TO denotes to
T19811 41804-41809 JJ denotes prior
T19810 41800-41803 NN denotes min
T19809 41797-41799 CD denotes 60
T19808 41794-41796 TO denotes to
T19807 41790-41793 NN denotes min
T19806 41787-41789 CD denotes 30
T19805 41781-41786 VB denotes added
T19804 41777-41780 VB denotes was
T19803 41775-41776 -RRB- denotes )
T19802 41773-41775 NN denotes μl
T19801 41771-41772 CD denotes 3
T19800 41770-41771 -LRB- denotes (
T19799 41761-41769 NN denotes antibody
T19798 41758-41760 CC denotes or
T19797 41756-41757 -RRB- denotes )
T19796 41750-41756 NN denotes excess
T19795 41744-41749 JJ denotes molar
T19794 41735-41743 JJ denotes 200-fold
T19793 41734-41735 -LRB- denotes (
T19792 41723-41733 NN denotes competitor
T19791 41707-41722 NN denotes oligonucleotide
T19790 41696-41706 JJ denotes unlabelled
T19789 41686-41695 VB denotes indicated
T19788 41682-41685 DT denotes the
T19787 41680-41681 -COMMA- denotes ,
T19786 41674-41680 NN denotes assays
T19785 41663-41673 NN denotes supershift
T19784 41660-41662 CC denotes or
T19783 41648-41659 NN denotes competition
T19782 41644-41647 IN denotes For
T19781 41637-41642 NN denotes MgCl2
T19780 41634-41636 NN denotes mM
T19779 41630-41633 CD denotes 0.6
T19778 41628-41629 -COMMA- denotes ,
T19777 41625-41628 NN denotes DTT
T19776 41622-41624 NN denotes mM
T19775 41617-41621 CD denotes 0.25
T19705 41312-41313 -RRB- denotes ]
T19704 41307-41312 NN denotes γ-32P
T19703 41306-41307 -LRB- denotes [
T19702 41301-41305 IN denotes with
T19701 41289-41300 VB denotes end-labeled
T19700 41285-41288 CC denotes and
T19699 41276-41284 VB denotes annealed
T19698 41271-41275 VB denotes were
T19697 41254-41270 NN denotes oligonucleotides
T19696 41240-41253 JJ denotes complementary
T19695 41224-41239 JJ denotes Single-stranded
T19694 41218-41222 NN denotes EMSA
T19503 41214-41215 -RRB- denotes )
T19502 41208-41214 NNP denotes States
T19501 41201-41207 NNP denotes United
T19500 41199-41200 -COMMA- denotes ,
T19499 41195-41199 NNP denotes York
T19498 41191-41194 NNP denotes New
T19497 41189-41190 -COMMA- denotes ,
T19496 41183-41189 NNP denotes Placid
T19495 41178-41182 NNP denotes Lake
T19494 41177-41178 -LRB- denotes (
T19493 41163-41176 NNP denotes Biotechnology
T19492 41155-41162 NNP denotes Upstate
T19491 41150-41154 IN denotes from
T19490 41141-41149 VB denotes obtained
T19240 40759-40766 NN denotes control
T19239 40750-40758 JJ denotes negative
T19238 40748-40749 DT denotes a
T19237 40745-40747 IN denotes as
T19236 40734-40744 VB denotes translated
T19235 40729-40733 RB denotes also
T19234 40725-40728 VB denotes was
T19233 40716-40724 NN denotes sequence
T19232 40709-40715 NN denotes coding
T19231 40704-40708 NN denotes Sox6
T19230 40700-40703 DT denotes the
T19229 40692-40699 IN denotes without
T19228 40685-40691 NN denotes vector
T19227 40683-40684 DT denotes A
T19226 40680-40681 -RRB- denotes )
T19225 40673-40680 NNP denotes Promega
T19224 40671-40672 -COMMA- denotes ,
T19223 40664-40671 NNP denotes Systems
T19222 40638-40663 NNP denotes Transcription/Translation
T19221 40630-40637 NNP denotes Coupled
T19220 40624-40629 NNP denotes Quick
T19219 40619-40623 NNP denotes TNT®
T19218 40618-40619 -LRB- denotes (
T19217 40611-40617 NN denotes system
T19216 40597-40610 JJ denotes translational
T19215 40591-40596 FW denotes vitro
T19214 40588-40590 FW denotes in
T19213 40582-40587 VB denotes based
T19212 40575-40581 NN denotes lysate
T19211 40562-40574 NN denotes reticulocyte
T19210 40560-40561 DT denotes a
T19209 40557-40559 IN denotes in
T19208 40547-40556 VB denotes performed
T19207 40543-40546 VB denotes was
T19206 40531-40542 NN denotes translation
T19205 40527-40530 DT denotes The
T19204 40524-40525 -RRB- denotes ]
T19203 40522-40524 CD denotes 15
T19202 40521-40522 -LRB- denotes [
T19201 40514-40520 IN denotes before
T19199 40500-40503 VB denotes was
T19198 40498-40499 -COMMA- denotes ,
T19197 40496-40498 NN denotes HA
T19196 40492-40495 CC denotes and
T19195 40486-40491 NN denotes c-Myc
T19194 40481-40485 IN denotes with
T19193 40474-40480 VB denotes tagged
T19192 40472-40473 -COMMA- denotes ,
T19191 40466-40472 NN denotes vector
T19190 40455-40465 NN denotes expression
T19189 40443-40454 NN denotes translation
T19188 40437-40442 FW denotes vitro
T19187 40434-40436 FW denotes in
T19186 40429-40433 NN denotes Sox6
T19185 40425-40428 DT denotes The
T19184 40422-40423 -RRB- denotes )
T19183 40416-40422 NNP denotes States
T19182 40409-40415 NNP denotes United
T19181 40407-40408 -COMMA- denotes ,
T19180 40397-40407 NNP denotes California
T19179 40395-40396 -COMMA- denotes ,
T19178 40387-40395 NNP denotes Carlsbad
T19177 40385-40386 -COMMA- denotes ,
T19176 40380-40385 NNP denotes Motif
T19175 40373-40379 JJ denotes Active
T19174 40372-40373 -LRB- denotes (
T19173 40368-40371 NN denotes kit
T19172 40366-40367 DT denotes a
T19171 40360-40365 VB denotes using
T19170 40358-40359 -RRB- denotes )
T19169 40355-40358 CD denotes 107
T19168 40353-40354 CC denotes ×
T19167 40351-40352 CD denotes 2
T19166 40350-40351 -LRB- denotes (
T19165 40344-40349 NN denotes cells
T19164 40340-40343 NN denotes MEL
T19163 40335-40339 IN denotes from
T19162 40326-40334 VB denotes prepared
T19161 40321-40325 VB denotes were
T19160 40312-40320 NN denotes extracts
T19159 40304-40311 JJ denotes Nuclear
T19774 41615-41616 -COMMA- denotes ,
T19773 41611-41615 NN denotes EDTA
T19772 41608-41610 NN denotes mM
T19771 41604-41607 CD denotes 0.1
T19770 41602-41603 -COMMA- denotes ,
T19769 41601-41602 -RRB- denotes )
T19768 41600-41601 CD denotes 7
T19767 41597-41599 NN denotes pH
T19766 41596-41597 -LRB- denotes (
T19765 41590-41595 NN denotes HEPES
T19764 41587-41589 NN denotes mM
T19763 41584-41586 CD denotes 10
T19762 41582-41583 -COMMA- denotes ,
T19761 41581-41582 -RRB- denotes )
T19760 41576-41581 NN denotes dG-dC
T19759 41575-41576 -LRB- denotes (
T19758 41570-41574 NN denotes poly
T19757 41567-41569 CC denotes or
T19756 41565-41566 -RRB- denotes )
T19755 41560-41565 NN denotes dI-dC
T19754 41559-41560 -LRB- denotes (
T19753 41554-41558 NN denotes poly
T19752 41548-41553 NN denotes ng/μl
T19751 41545-41547 CD denotes 50
T19750 41543-41544 -COMMA- denotes ,
T19749 41540-41543 NN denotes BSA
T19748 41534-41539 NN denotes ng/μl
T19747 41530-41533 CD denotes 200
T19746 41528-41529 -COMMA- denotes ,
T19745 41520-41528 NN denotes glycerol
T19744 41518-41519 NN denotes %
T19743 41516-41518 CD denotes 10
T19742 41514-41515 -COMMA- denotes ,
T19741 41510-41514 NN denotes NaCl
T19740 41507-41509 NN denotes mM
T19739 41503-41506 CD denotes 100
T19738 41501-41502 -COLON- denotes :
T19737 41495-41501 NN denotes buffer
T19736 41487-41494 NN denotes binding
T19735 41484-41486 IN denotes in
T19734 41477-41483 NN denotes lysate
T19733 41464-41476 NN denotes reticulocyte
T19732 41460-41463 DT denotes the
T19731 41455-41459 IN denotes with
T19730 41449-41454 IN denotes along
T19729 41444-41448 NN denotes Sox6
T19728 41427-41443 JJ denotes vitro-translated
T19727 41424-41426 FW denotes in
T19726 41421-41423 IN denotes of
T19725 41418-41420 NN denotes μl
T19724 41416-41417 CD denotes 3
T19723 41413-41415 CC denotes or
T19722 41407-41412 NN denotes cells
T19721 41403-41406 NN denotes MEL
T19720 41398-41402 IN denotes from
T19719 41389-41397 NN denotes proteins
T19718 41381-41388 JJ denotes nuclear
T19717 41378-41380 IN denotes of
T19716 41375-41377 NN denotes μg
T19715 41373-41374 CD denotes 5
T19714 41368-41372 IN denotes with
T19713 41358-41367 VB denotes performed
T19712 41354-41357 VB denotes was
T19711 41349-41353 NN denotes EMSA
T19710 41341-41347 NN denotes kinase
T19709 41326-41340 NN denotes polynucleotide
T19708 41323-41325 NN denotes T4
T19707 41318-41322 IN denotes with
T19706 41314-41317 NN denotes ATP
T19158 40298-40302 NN denotes Sox6
T19157 40295-40297 IN denotes of
T19156 40283-40294 NN denotes translation
T19155 40277-40282 FW denotes vitro
T19154 40274-40276 FW denotes in
T19153 40270-40273 CC denotes and
T19152 40262-40269 NN denotes extract
T19151 40254-40261 NN denotes protein
T19150 40246-40253 JJ denotes Nuclear
T19463 40962-40975 NNP denotes Biotechnology
T19462 40957-40961 NNP denotes Cruz
T19461 40951-40956 NNP denotes Santa
T19460 40949-40950 -COMMA- denotes ,
T19459 40948-40949 NNP denotes X
T19458 40939-40947 NN denotes sc-17332
T19457 40935-40938 NN denotes No.
T19456 40927-40934 NNP denotes Catalog
T19455 40926-40927 -LRB- denotes (
T19454 40917-40925 VB denotes obtained
T19453 40904-40916 RB denotes commercially
T19452 40901-40903 CC denotes or
T19451 40899-40900 -RRB- denotes )
T19450 40898-40899 -RRB- denotes ]
T19449 40897-40898 CD denotes 7
T19448 40896-40897 -LRB- denotes [
T19447 40889-40895 NNP denotes France
T19446 40887-40888 -COMMA- denotes ,
T19445 40880-40887 NNP denotes Pasteur
T19444 40874-40879 NNP denotes Louis
T19443 40863-40873 NNP denotes Université
T19442 40862-40863 -LRB- denotes (
T19441 40856-40861 NNP denotes Lalli
T19440 40851-40855 NNP denotes Enzo
T19439 40847-40850 NNP denotes Dr.
T19438 40844-40846 IN denotes by
T19437 40835-40843 VB denotes provided
T19436 40828-40834 RB denotes kindly
T19435 40821-40827 CC denotes either
T19434 40816-40820 VB denotes were
T19433 40810-40815 NN denotes study
T19432 40805-40809 DT denotes this
T19431 40802-40804 IN denotes in
T19430 40797-40801 VB denotes used
T19429 40786-40796 NN denotes antibodies
T19428 40781-40785 NN denotes Sox6
T19427 40769-40779 NN denotes Antibodies
T18887 40221-40231 NN denotes ransfectio
T18886 40209-40221 NN denotes ontrol for t
T18885 40206-40209 IN denotes a c
T18884 40199-40206 NN denotes sed as
T18883 40198-40199 DT denotes u
T18882 40196-40198 IN denotes s
T18881 40192-40196 VB denotes ) wa
T18880 40189-40192 VB denotes ega
T18879 40188-40189 -RRB- denotes m
T18878 40181-40188 NN denotes ng (Pro
T18877 40180-40181 -LRB- denotes 5
T18876 40176-40180 NN denotes MV 1
T18875 40169-40176 NN denotes . pRL-C
T18874 40168-40169 -RRB- denotes )
T18873 40166-40168 NN denotes ng
T18872 40161-40165 CD denotes 1000
T18871 40157-40160 CC denotes and
T18870 40155-40156 -COMMA- denotes ,
T18869 40153-40155 NN denotes ng
T18868 40149-40152 CD denotes 500
T18867 40147-40148 -COMMA- denotes ,
T18866 40145-40147 NN denotes ng
T18865 40141-40144 CD denotes 200
T18864 40136-40140 VB denotes used
T18863 40133-40135 PRP denotes we
T18862 40131-40132 -COMMA- denotes ,
T18861 40125-40131 NN denotes effect
T18860 40118-40124 NN denotes dosage
T18859 40115-40117 IN denotes of
T18858 40108-40114 NN denotes assays
T18857 40105-40107 IN denotes In
T18856 40102-40103 -RRB- denotes )
T18855 40100-40102 NN denotes ng
T18854 40095-40099 CD denotes 1000
T18853 40094-40095 -LRB- denotes (
T18852 40087-40093 NN denotes vector
T18851 40072-40086 NN denotes overexpression
T18850 40067-40071 NN denotes Sox6
T18849 40064-40066 CC denotes or
T18848 40057-40063 NN denotes vector
T18847 40051-40056 JJ denotes empty
T18846 40044-40050 CC denotes either
T18845 40039-40043 IN denotes with
T18844 40033-40038 IN denotes along
T18843 40031-40032 -RRB- denotes )
T18842 40029-40031 NN denotes ng
T18841 40025-40028 CD denotes 500
T18840 40024-40025 -LRB- denotes (
T18839 40013-40023 NN denotes constructs
T18838 40004-40012 NN denotes reporter
T18837 39995-40003 NN denotes promoter
T18836 39992-39994 JJ denotes ɛy
T18785 39730-39731 CD denotes 2
T18784 39729-39730 -LRB- denotes (
T18783 39717-39728 NN denotes L-glutamine
T18782 39713-39716 CC denotes and
T18781 39711-39712 -COMMA- denotes ,
T18780 39710-39711 -RRB- denotes )
T18779 39705-39710 NN denotes μg/ml
T18778 39701-39704 CD denotes 100
T18777 39688-39700 NN denotes streptomycin
T18776 39686-39687 -COMMA- denotes ,
T18775 39685-39686 -RRB- denotes )
T18774 39677-39685 NN denotes units/ml
T18773 39673-39676 CD denotes 100
T18772 39672-39673 -LRB- denotes (
T18771 39661-39671 NN denotes penicillin
T18770 39659-39660 -COMMA- denotes ,
T18769 39658-39659 -RRB- denotes )
T18768 39652-39658 NNP denotes States
T18767 39645-39651 NNP denotes United
T18766 39643-39644 -COMMA- denotes ,
T18765 39633-39643 NNP denotes California
T18764 39631-39632 -COMMA- denotes ,
T18763 39623-39631 NNP denotes Carlsbad
T18762 39621-39622 -COMMA- denotes ,
T18761 39612-39621 NN denotes Ivitrogen
T18760 39611-39612 -LRB- denotes (
T18759 39605-39610 NN denotes serum
T18758 39600-39604 NN denotes calf
T18757 39594-39599 JJ denotes fetal
T18756 39592-39593 NN denotes %
T18755 39590-39592 CD denotes 10
T18754 39573-39589 JJ denotes heat-inactivated
T18753 39568-39572 IN denotes with
T18752 39555-39567 VB denotes supplemented
T18751 39543-39554 NN denotes L-glutamine
T18750 39540-39542 NN denotes mM
T18749 39538-39539 CD denotes 2
T18748 39533-39537 IN denotes with
T18747 39529-39532 NN denotes F12
T18746 39526-39528 POS denotes 's
T18745 39523-39526 NNP denotes Ham
T18744 39520-39522 IN denotes in
T18743 39511-39519 VB denotes cultured
T18742 39506-39510 VB denotes were
T18741 39504-39505 -RRB- denotes )
T18740 39498-39504 NNP denotes States
T18739 39491-39497 NNP denotes United
T18738 39489-39490 -COMMA- denotes ,
T18737 39483-39489 NNP denotes Jersey
T18736 39479-39482 NNP denotes New
T18735 39477-39478 -COMMA- denotes ,
T18734 39471-39477 NNP denotes Camden
T18733 39469-39470 -COMMA- denotes ,
T18732 39457-39469 NNP denotes Repositories
T18731 39452-39456 NNP denotes Cell
T18730 39444-39451 NNP denotes Coriell
T18729 39443-39444 -LRB- denotes (
T18728 39437-39442 NN denotes cells
T18727 39431-39436 NN denotes GM979
T18726 39417-39429 NN denotes transfection
T18725 39413-39416 CC denotes and
T18724 39405-39412 NN denotes culture
T18723 39400-39404 NN denotes Cell
T19489 41137-41140 VB denotes was
T19488 41128-41136 NN denotes antibody
T19487 41124-41127 NN denotes IgG
T19486 41117-41123 NN denotes rabbit
T19485 41110-41116 NNP denotes Normal
T19484 41098-41109 NNP denotes Invitrogen.
T19483 41093-41097 IN denotes from
T19482 41083-41092 VB denotes purchased
T19481 41079-41082 VB denotes was
T19480 41070-41078 NN denotes antibody
T19479 41064-41069 NN denotes c-Myc
T19478 41055-41063 JJ denotes results.
T19477 41047-41054 JJ denotes similar
T19476 41037-41046 VB denotes generated
T19475 41026-41036 NN denotes antibodies
T19474 41021-41025 NN denotes Sox6
T19473 41017-41020 DT denotes All
T19472 41014-41015 -RRB- denotes )
T19471 41008-41014 NNP denotes States
T19470 41001-41007 NNP denotes United
T19469 40999-41000 -COMMA- denotes ,
T19468 40989-40999 NNP denotes California
T19467 40987-40988 -COMMA- denotes ,
T19466 40983-40987 NNP denotes Cruz
T19465 40977-40982 NNP denotes Santa
T19464 40975-40976 -COMMA- denotes ,
T18301 38839-38848 JJ denotes available
T18300 38835-38838 VB denotes are
T18299 38828-38834 NN denotes images
T18298 38819-38827 JJ denotes Original
T18297 38813-38817 CD denotes 4300
T18296 38805-38812 NNP denotes Coolpix
T18295 38799-38804 NNP denotes Nikon
T18294 38797-38798 DT denotes a
T18293 38793-38796 VB denotes was
T18292 38786-38792 NN denotes camera
T18835 39987-39991 IN denotes with
T18834 39975-39986 VB denotes transfected
T18833 39970-39974 VB denotes were
T18832 39964-39969 NN denotes Cells
T18831 39961-39962 -RRB- denotes )
T18830 39955-39961 NNP denotes States
T18829 39948-39954 NNP denotes United
T18828 39946-39947 -COMMA- denotes ,
T18827 39939-39946 NNP denotes Indiana
T18826 39937-39938 -COMMA- denotes ,
T18825 39925-39937 NNP denotes Indianapolis
T18824 39923-39924 -COMMA- denotes ,
T18823 39918-39923 NNP denotes Roche
T18822 39917-39918 -LRB- denotes (
T18821 39909-39916 NN denotes FuGENE6
T18820 39906-39908 IN denotes by
T18819 39897-39905 NN denotes plasmids
T18818 39892-39896 IN denotes with
T18817 39880-39891 VB denotes transfected
T18816 39875-39879 VB denotes were
T18815 39868-39874 NN denotes growth
T18814 39865-39867 IN denotes of
T18813 39859-39864 NN denotes phase
T18812 39855-39858 NN denotes log
T18811 39852-39854 IN denotes in
T18810 39850-39851 -RRB- denotes )
T18809 39847-39850 CD denotes 105
T18808 39845-39846 NN denotes ×
T18807 39843-39844 CD denotes 4
T18806 39842-39843 -LRB- denotes (
T18805 39836-39841 NN denotes cells
T18804 39830-39835 NN denotes GM979
T18803 39827-39828 -RRB- denotes )
T18802 39822-39827 NN denotes serum
T18801 39818-39821 DT denotes the
T18800 39805-39817 VB denotes inactivating
T18799 39800-39804 NN denotes heat
T18798 39792-39799 IN denotes without
T18797 39791-39792 -LRB- denotes (
T18796 39785-39790 JJ denotes above
T18795 39782-39784 IN denotes as
T18794 39769-39781 VB denotes supplemented
T18793 39764-39768 NN denotes DMEM
T18792 39761-39763 IN denotes in
T18791 39752-39760 VB denotes cultured
T18790 39747-39751 VB denotes were
T18789 39741-39746 NN denotes cells
T18788 39737-39740 NN denotes MEL
T18787 39734-39735 -RRB- denotes )
T18786 39732-39734 NN denotes mM
T18291 38782-38785 DT denotes The
T18290 38779-38780 -RRB- denotes )
T18289 38770-38779 NN denotes objective
T18288 38765-38769 CD denotes 100×
T18287 38764-38765 -LRB- denotes (
T18286 38758-38763 NNP denotes Nikon
T18285 38749-38757 CD denotes 160/0.17
T18284 38745-38748 NN denotes oil
T18283 38736-38744 CD denotes 100/1.25
T18282 38731-38735 NNP denotes Plan
T18281 38729-38730 NN denotes E
T18280 38727-38728 -COMMA- denotes ,
T18279 38726-38727 -RRB- denotes )
T18278 38717-38726 NN denotes objective
T18277 38713-38716 CD denotes 40×
T18276 38712-38713 -LRB- denotes (
T18275 38706-38711 NNP denotes Nikon
T18274 38697-38705 CD denotes 160/0.17
T18273 38689-38696 CD denotes 40/0.65
T18272 38684-38688 NNP denotes Plan
T18271 38682-38683 NN denotes E
T18270 38677-38681 VB denotes were
T18269 38672-38676 VB denotes used
T18268 38661-38671 NN denotes Objectives
T18267 38649-38659 NN denotes microscope
T18266 38638-38648 NN denotes Labophot-2
T18265 38632-38637 NNP denotes Nikon
T18264 38627-38631 IN denotes with
T18263 38618-38626 VB denotes obtained
T18262 38613-38617 VB denotes were
T18261 38606-38612 NN denotes Images
T18260 38598-38604 NN denotes manner
T18259 38590-38597 JJ denotes similar
T18258 38588-38589 DT denotes a
T18257 38585-38587 IN denotes in
T18256 38576-38584 VB denotes prepared
T18255 38571-38575 VB denotes were
T18254 38569-38570 -RRB- denotes )
T18253 38566-38569 NN denotes dpc
T18252 38561-38565 CD denotes 18.5
T18251 38557-38560 CC denotes and
T18250 38553-38556 NN denotes dpc
T18249 38548-38552 CD denotes 14.5
T18248 38545-38547 IN denotes at
T18247 38544-38545 -LRB- denotes (
T18246 38536-38543 NN denotes samples
T18245 38530-38535 NN denotes Liver
T18244 38523-38528 NN denotes eosin
T18243 38519-38522 CC denotes and
T18242 38507-38518 NN denotes hematoxylin
T18241 38502-38506 IN denotes with
T18240 38494-38501 VB denotes stained
T18239 38490-38493 CC denotes and
T18238 38488-38489 -COMMA- denotes ,
T18237 38486-38488 NN denotes μm
T18236 38484-38485 CD denotes 5
T18235 38481-38483 IN denotes at
T18234 38471-38480 VB denotes sectioned
T18233 38469-38470 -COMMA- denotes ,
T18232 38452-38469 JJ denotes paraffin-embedded
T18231 38450-38451 -COMMA- denotes ,
T18230 38442-38450 NN denotes formalin
T18229 38440-38441 NN denotes %
T18228 38438-38440 CD denotes 10
T18227 38435-38437 IN denotes in
T18226 38429-38434 VB denotes fixed
T18225 38424-38428 VB denotes were
T18224 38419-38423 NN denotes mice
T18223 38410-38418 NN denotes day–10.5
T18222 38400-38409 JJ denotes postnatal
T18221 38396-38399 CC denotes and
T18220 38394-38395 -COMMA- denotes ,
T18219 38387-38394 NN denotes embryos
T18218 38380-38386 JJ denotes mutant
T18217 38376-38379 CC denotes and
T18216 38373-38375 NN denotes WT
T18215 38364-38372 JJ denotes 14.5-dpc
T18214 38362-38363 -COMMA- denotes ,
T18213 38354-38362 NN denotes analysis
T18212 38348-38353 NN denotes mount
T18211 38342-38347 JJ denotes whole
T18210 38338-38341 IN denotes For
T18209 38333-38336 NNP denotes DAF
T18208 38330-38332 IN denotes by
T18207 38325-38329 VB denotes read
T18206 38321-38324 CC denotes and
T18205 38306-38320 JJ denotes Wright-stained
T18204 38301-38305 VB denotes were
T18203 38294-38300 NN denotes slides
T18202 38290-38293 DT denotes The
T18201 38284-38288 NN denotes mice
T18200 38281-38283 JJ denotes WT
T18199 38277-38280 CC denotes and
T18198 38270-38276 JJ denotes mutant
T18197 38265-38269 CC denotes both
T18196 38260-38264 IN denotes from
T18195 38251-38259 VB denotes prepared
T18194 38246-38250 VB denotes were
T18193 38239-38245 NN denotes smears
T18192 38233-38238 NN denotes blood
T18191 38222-38232 JJ denotes peripheral
T17944 38159-38168 JJ denotes available
T17943 38155-38158 VB denotes are
T17942 38148-38154 NN denotes images
T17941 38139-38147 JJ denotes Original
T17940 38130-38137 NN denotes plugins
T17939 38128-38129 -RRB- denotes )
T17938 38122-38128 NNP denotes States
T17937 38115-38121 NNP denotes United
T17936 38113-38114 -COMMA- denotes ,
T17935 38105-38113 NNP denotes Carolina
T17934 38099-38104 NNP denotes North
T17933 38097-38098 -COMMA- denotes ,
T17932 38088-38097 NNP denotes Asheville
T17931 38086-38087 -COMMA- denotes ,
T17930 38078-38086 NNP denotes Graphics
T18565 39396-39397 NN denotes d
T18564 39394-39395 CD denotes 6
T18563 39390-39393 IN denotes for
T18562 39387-39389 NN denotes °C
T18561 39383-39386 CD denotes −80
T18560 39380-39382 IN denotes at
T18559 39378-39379 -RRB- denotes )
T18558 39372-39378 NNP denotes States
T18557 39365-39371 NNP denotes United
T18556 39363-39364 -COMMA- denotes ,
T18555 39359-39363 NNP denotes York
T18554 39355-39358 NNP denotes New
T18553 39353-39354 -COMMA- denotes ,
T18552 39344-39353 NNP denotes Rochester
T18551 39342-39343 -COMMA- denotes ,
T18550 39337-39342 NNP denotes Kodak
T18549 39336-39337 -LRB- denotes (
T18548 39331-39335 NN denotes film
T18547 39325-39330 NN denotes X-ray
T18546 39322-39324 TO denotes to
T18545 39313-39321 NN denotes exposure
T18544 39310-39312 TO denotes to
T18543 39304-39309 JJ denotes prior
T18542 39301-39303 NN denotes °C
T18541 39298-39300 CD denotes 60
T18540 39295-39297 IN denotes at
T18539 39291-39294 NN denotes SDS
T18538 39289-39290 NN denotes %
T18537 39288-39289 CD denotes 1
T18536 39286-39287 -COMMA- denotes ,
T18535 39283-39286 NNP denotes SSC
T18534 39278-39282 CD denotes 0.2×
T18533 39273-39277 IN denotes with
T18532 39266-39272 VB denotes washed
T18531 39261-39265 VB denotes were
T18530 39255-39260 NN denotes Blots
T18529 39245-39253 NN denotes solution
T18528 39231-39244 NN denotes hybridization
T18527 39227-39230 NN denotes SDS
T18526 39225-39226 NN denotes %
T18525 39224-39225 CD denotes 7
T18524 39215-39223 VB denotes buffered
T18523 39205-39214 NN denotes phosphate
T18522 39202-39204 IN denotes in
T18521 39192-39201 VB denotes performed
T18520 39188-39191 VB denotes was
T18519 39174-39187 NN denotes hybridization
T18518 39170-39173 DT denotes The
T18517 39167-39168 -RRB- denotes )
T18516 39160-39167 NNP denotes Kingdom
T18515 39153-39159 NNP denotes United
T18514 39151-39152 -COMMA- denotes ,
T18513 39144-39151 NNP denotes England
T18512 39142-39143 -COMMA- denotes ,
T18511 39127-39142 NNP denotes Buckinghamshire
T18510 39125-39126 -COMMA- denotes ,
T18509 39114-39125 NNP denotes Biosciences
T18508 39105-39113 NNP denotes Amersham
T18507 39103-39104 -COLON- denotes ;
T18506 39092-39103 NN denotes RediprimeII
T18505 39091-39092 -LRB- denotes (
T18504 39082-39090 NN denotes labeling
T18503 39075-39081 NN denotes primer
T18502 39068-39074 JJ denotes random
T18501 39065-39067 IN denotes by
T18500 39063-39064 -COMMA- denotes ,
T18499 39059-39063 NN denotes dCTP
T18498 39058-39059 -RRB- denotes ]
T18497 39053-39058 NN denotes α-32P
T18496 39052-39053 -LRB- denotes [
T18495 39047-39051 IN denotes with
T18494 39039-39046 VB denotes labeled
T18493 39035-39038 CC denotes and
T18492 39033-39034 -RRB- denotes )
T18491 39024-39033 CD denotes 1353–1927
T18490 39012-39023 NN denotes nucleotides
T18489 39011-39012 -LRB- denotes (
T18488 39004-39010 NN denotes RT-PCR
T18487 39001-39003 IN denotes by
T18486 38991-39000 VB denotes generated
T18485 38985-38990 NN denotes probe
T18484 38980-38984 NN denotes Sox6
T18483 38978-38979 DT denotes a
T18482 38973-38977 IN denotes with
T18481 38962-38972 VB denotes hybridized
T18480 38958-38961 VB denotes was
T18479 38956-38957 -RRB- denotes )
T18478 38950-38956 NNP denotes States
T18477 38943-38949 NNP denotes United
T18476 38941-38942 -COMMA- denotes ,
T18475 38933-38941 NNP denotes Maryland
T18474 38931-38932 -COMMA- denotes ,
T18473 38922-38931 NNP denotes Rockville
T18472 38920-38921 -COMMA- denotes ,
T18471 38913-38920 NN denotes Seegene
T18470 38912-38913 -LRB- denotes (
T18469 38905-38911 NN denotes filter
T18468 38900-38904 NN denotes blot
T18467 38891-38899 NN denotes Northern
T18466 38884-38890 NN denotes tissue
T18465 38874-38883 JJ denotes embryonic
T18464 38868-38873 NN denotes mouse
T18463 38866-38867 DT denotes A
T18462 38860-38864 NN denotes blot
T18461 38851-38859 NN denotes Northern
T17929 38069-38077 NNP denotes Reindeer
T17928 38068-38069 -LRB- denotes (
T17927 38064-38067 NNP denotes Pro
T17926 38058-38063 NNP denotes Fovea
T17925 38053-38057 IN denotes with
T17924 38044-38052 NN denotes software
T17923 38042-38043 -RRB- denotes )
T17922 38036-38042 NNP denotes States
T17921 38029-38035 NNP denotes United
T17920 38027-38028 -COMMA- denotes ,
T17919 38017-38027 NNP denotes California
T17918 38015-38016 -COMMA- denotes ,
T17917 38011-38015 NNP denotes Jose
T17916 38007-38010 NNP denotes San
T17915 38005-38006 -COMMA- denotes ,
T17914 38000-38005 NNP denotes Adobe
T17913 37999-38000 -LRB- denotes (
T17912 37989-37998 NNP denotes Photoshop
T17911 37983-37988 VB denotes using
T17910 37974-37982 VB denotes combined
T17909 37970-37973 CC denotes and
T17908 37968-37969 -COMMA- denotes ,
T17907 37955-37968 VB denotes pseudocolored
T17906 37953-37954 -COMMA- denotes ,
T17905 37944-37953 VB denotes processed
T17904 37939-37943 VB denotes were
T17903 37932-37938 NN denotes Images
T17902 37929-37930 -RRB- denotes )
T17901 37926-37929 CD denotes 0.5
T17900 37924-37925 SYM denotes =
T17899 37921-37923 NN denotes NA
T17898 37920-37921 -LRB- denotes (
T17897 37916-37919 CD denotes 10×
T17896 37912-37915 CC denotes and
T17895 37910-37911 -RRB- denotes )
T17894 37906-37910 CD denotes 0.04
T17893 37904-37905 SYM denotes =
T17892 37901-37903 NN denotes NA
T17891 37900-37901 -LRB- denotes (
T17890 37897-37899 CD denotes 1×
T17889 37892-37896 VB denotes were
T17888 37887-37891 VB denotes used
T17887 37876-37886 NN denotes Objectives
T17886 37873-37874 -RRB- denotes )
T17885 37867-37873 NNP denotes States
T17884 37860-37866 NNP denotes United
T17883 37858-37859 -COMMA- denotes ,
T17882 37850-37858 NNP denotes Michigan
T17881 37848-37849 -COMMA- denotes ,
T17880 37841-37848 NNP denotes Heights
T17879 37832-37840 NNP denotes Sterling
T17878 37830-37831 -COMMA- denotes ,
T17877 37819-37830 NNP denotes Instruments
T17876 37808-37818 JJ denotes Diagnostic
T17875 37807-37808 -LRB- denotes (
T17874 37800-37806 NN denotes camera
T17873 37792-37799 JJ denotes digital
T17872 37782-37791 NN denotes RT-Slider
T17871 37777-37781 NN denotes SPOT
T17870 37773-37776 CC denotes and
T17869 37771-37772 -RRB- denotes )
T17868 37765-37771 NNP denotes States
T17867 37758-37764 NNP denotes United
T17866 37756-37757 -COMMA- denotes ,
T17865 37752-37756 NNP denotes York
T17864 37748-37751 NNP denotes New
T17863 37746-37747 -COMMA- denotes ,
T17862 37738-37746 NNP denotes Melville
T17861 37736-37737 -COMMA- denotes ,
T17860 37731-37736 NNP denotes Nikon
T17859 37730-37731 -LRB- denotes (
T17858 37719-37729 NN denotes microscope
T17857 37710-37718 NNP denotes Optiphot
T17856 37704-37709 NNP denotes Nikon
T17855 37702-37703 DT denotes a
T17854 37697-37701 IN denotes with
T17853 37688-37696 VB denotes obtained
T17852 37683-37687 VB denotes were
T17851 37676-37682 NN denotes images
T17850 37664-37675 NN denotes brightfield
T17849 37660-37663 CC denotes and
T17848 37650-37659 NN denotes Darkfield
T17847 37645-37648 NN denotes 33P
T17846 37640-37644 IN denotes with
T17845 37632-37639 VB denotes labeled
T17844 37625-37631 NN denotes probes
T17843 37621-37624 NN denotes RNA
T17842 37609-37620 VB denotes transcribed
T17841 37603-37608 FW denotes vitro
T17840 37600-37602 FW denotes in
T17839 37594-37599 VB denotes using
T17838 37592-37593 -RRB- denotes ]
T17837 37590-37592 CD denotes 52
T17836 37589-37590 -LRB- denotes [
T17835 37579-37588 VB denotes described
T17834 37576-37578 IN denotes as
T17833 37562-37575 NN denotes hybridization
T17832 37557-37561 FW denotes situ
T17831 37554-37556 FW denotes in
T17830 37550-37553 IN denotes for
T17829 37540-37549 VB denotes processed
T18190 38218-38221 CC denotes and
T18189 38204-38217 VB denotes exsanguinated
T18188 38199-38203 VB denotes were
T18187 38191-38198 NN denotes embryos
T18186 38182-38190 JJ denotes 18.5-dpc
T18185 38171-38180 NNP denotes Histology
T17394 37163-37164 -RRB- denotes )
T17393 37157-37163 NNP denotes States
T17392 37150-37156 NNP denotes United
T17391 37148-37149 -COMMA- denotes ,
T17390 37138-37148 NNP denotes Washington
T17389 37136-37137 -COMMA- denotes ,
T17388 37129-37136 NNP denotes Redmond
T17387 37128-37129 -LRB- denotes (
T17386 37122-37127 NNP denotes Excel
T17385 37112-37121 NNP denotes Microsoft
T17384 37109-37111 IN denotes in
T17383 37103-37108 NN denotes GAPDH
T17382 37100-37102 TO denotes to
T17381 37089-37099 VB denotes normalized
T17380 37085-37088 CC denotes and
T17379 37083-37084 -RRB- denotes )
T17378 37073-37083 NNP denotes Biosystems
T17377 37065-37072 NNP denotes Applied
T17376 37064-37065 -LRB- denotes (
T17375 37055-37063 NNP denotes Software
T17374 37051-37054 NNP denotes SDS
T17373 37046-37050 CD denotes 7000
T17372 37040-37045 NNP denotes Prism
T17371 37036-37039 NNP denotes ABI
T17370 37032-37035 DT denotes the
T17369 37029-37031 IN denotes in
T17368 37018-37028 VB denotes calculated
T17367 37013-37017 VB denotes were
T17366 37006-37012 NN denotes values
T17365 36993-37005 JJ denotes quantitative
T17364 36984-36992 JJ denotes Relative
T17363 36974-36982 NN denotes reaction
T17362 36970-36973 NN denotes PCR
T17361 36965-36969 DT denotes each
T17360 36961-36964 IN denotes for
T17359 36956-36960 VB denotes done
T17358 36951-36955 VB denotes were
T17357 36939-36950 NN denotes Triplicates
T17356 36923-36937 NN denotes amplifications
T17355 36919-36922 DT denotes the
T17354 36916-36918 IN denotes of
T17353 36905-36915 NN denotes efficiency
T17352 36901-36904 DT denotes the
T17351 36896-36900 VB denotes test
T17350 36893-36895 TO denotes to
T17349 36883-36892 VB denotes performed
T17348 36878-36882 VB denotes were
T17347 36869-36877 NN denotes analyses
T17346 36863-36868 NN denotes curve
T17345 36854-36862 JJ denotes Standard
T17344 36849-36852 NN denotes RNA
T17343 36843-36848 NN denotes input
T17342 36839-36842 IN denotes for
T17341 36831-36838 NN denotes control
T17340 36828-36830 IN denotes as
T17339 36823-36827 VB denotes used
T17338 36818-36822 VB denotes were
T17337 36811-36817 NN denotes levels
T17336 36806-36810 NN denotes mRNA
T17335 36800-36805 NN denotes GAPDH
T17334 36790-36798 NN denotes supermix
T17333 36784-36789 JJ denotes green
T17332 36779-36783 NN denotes SYBR
T17331 36776-36778 NN denotes μl
T17330 36771-36775 CD denotes 12.5
T17329 36766-36770 IN denotes with
T17328 36757-36765 NN denotes reaction
T17327 36751-36756 JJ denotes 25-μl
T17326 36749-36750 DT denotes a
T17325 36746-36748 IN denotes in
T17324 36736-36745 VB denotes performed
T17323 36732-36735 VB denotes was
T17322 36728-36731 NN denotes PCR
T17321 36724-36727 DT denotes All
T17320 36714-36722 NN denotes facility
T17319 36709-36713 NN denotes core
T17318 36701-36708 NNP denotes Arizona
T17317 36698-36700 IN denotes of
T17316 36687-36697 NNP denotes University
T17315 36683-36686 DT denotes the
T17314 36680-36682 IN denotes at
T17313 36678-36679 -RRB- denotes )
T17312 36672-36678 NNP denotes States
T17311 36665-36671 NNP denotes United
T17310 36663-36664 -COMMA- denotes ,
T17309 36653-36663 NNP denotes California
T17308 36651-36652 -COMMA- denotes ,
T17307 36647-36651 NNP denotes City
T17306 36640-36646 NNP denotes Foster
T17305 36638-36639 -COMMA- denotes ,
T17304 36628-36638 NNP denotes Biosystems
T17828 37535-37539 VB denotes were
T17827 37528-37534 NN denotes Slides
T17826 37525-37526 -RRB- denotes )
T17825 37519-37525 NNP denotes States
T17824 37512-37518 NNP denotes United
T17823 37510-37511 -COMMA- denotes ,
T17822 37498-37510 NNP denotes Pennsylvania
T17821 37496-37497 -COMMA- denotes ,
T17820 37489-37496 NNP denotes Chester
T17819 37484-37488 NNP denotes West
T17818 37482-37483 -COMMA- denotes ,
T17817 37479-37482 NN denotes VWR
T17816 37478-37479 -LRB- denotes (
T17815 37471-37477 NN denotes slides
T17814 37462-37470 VB denotes modified
T17813 37455-37461 VB denotes charge
T17812 37452-37454 TO denotes to
T17811 37444-37451 VB denotes adhered
T17810 37440-37443 CC denotes and
T17809 37438-37439 -COMMA- denotes ,
T17808 37436-37438 NN denotes μm
T17807 37434-37435 CD denotes 5
T17806 37431-37433 IN denotes at
T17805 37421-37430 VB denotes sectioned
T17804 37419-37420 -COMMA- denotes ,
T17803 37411-37419 NN denotes paraffin
T17802 37408-37410 IN denotes in
T17801 37399-37407 VB denotes embedded
T17800 37397-37398 -COMMA- denotes ,
T17799 37381-37397 NN denotes paraformaldehyde
T17798 37379-37380 NN denotes %
T17797 37378-37379 CD denotes 4
T17796 37375-37377 IN denotes in
T17795 37365-37374 NN denotes immersion
T17794 37362-37364 IN denotes by
T17793 37352-37361 RB denotes overnight
T17792 37346-37351 VB denotes fixed
T17791 37341-37345 VB denotes were
T17790 37333-37340 NN denotes Embryos
T17789 37322-37331 CD denotes 1353–1927
T17788 37310-37321 NN denotes nucleotides
T17787 37305-37309 NN denotes Sox6
T17786 37299-37304 NN denotes mouse
T17785 37295-37298 CC denotes and
T17784 37293-37294 -COLON- denotes ;
T17783 37286-37293 CD denotes 458–549
T17782 37274-37285 NN denotes nucleotides
T17781 37267-37273 NN denotes globin
T17780 37262-37266 SYM denotes βmaj
T17779 37260-37261 -COLON- denotes ;
T17778 37253-37260 CD denotes 509–584
T17777 37241-37252 NN denotes nucleotides
T17776 37234-37240 NN denotes globin
T17775 37231-37233 JJ denotes ɛy
T17774 37224-37230 JJ denotes murine
T17773 37221-37223 TO denotes to
T17772 37212-37220 VB denotes designed
T17771 37207-37211 VB denotes were
T17770 37200-37206 NN denotes probes
T17769 37190-37199 JJ denotes Antisense
T17768 37175-37188 NN denotes hybridization
T17767 37170-37174 FW denotes situ
T17766 37167-37169 FW denotes In
T17303 36620-36627 NNP denotes Applied
T17302 36619-36620 -LRB- denotes (
T17301 36611-36618 NN denotes ABI7000
T17300 36608-36610 DT denotes an
T17299 36605-36607 IN denotes on
T17298 36601-36604 VB denotes run
T17297 36597-36600 VB denotes was
T17296 36583-36596 NN denotes amplification
T17295 36579-36582 NN denotes PCR
T17294 36577-36578 -COMMA- denotes ,
T17293 36576-36577 -RRB- denotes )
T17292 36570-36576 NNP denotes States
T17291 36563-36569 NNP denotes United
T17290 36561-36562 -COMMA- denotes ,
T17289 36551-36561 NNP denotes California
T17288 36549-36550 -COMMA- denotes ,
T17287 36541-36549 NNP denotes Hercules
T17286 36539-36540 -COMMA- denotes ,
T17285 36532-36539 NNP denotes Bio-Rad
T17284 36531-36532 -LRB- denotes (
T17283 36527-36530 NN denotes ROX
T17282 36522-36526 IN denotes with
T17281 36518-36521 NN denotes kit
T17280 36509-36517 NN denotes supermix
T17279 36503-36508 JJ denotes green
T17278 36498-36502 NN denotes SYBR
T17277 36494-36497 DT denotes the
T17276 36488-36493 VB denotes Using
T17275 36462-36486 NN denotes 5′ACGATCATATTGCCCAGGAG3′
T17274 36460-36461 -COMMA- denotes ,
T17273 36453-36460 NN denotes MHB1675
T17272 36449-36452 CC denotes and
T17271 36447-36448 -COLON- denotes ;
T17270 36423-36447 NN denotes 5′ATGGCCTGAATCACTTGGAC3′
T17269 36421-36422 -COLON- denotes :
T17268 36414-36421 NN denotes MHB1674
T17267 36412-36413 -COLON- denotes :
T17266 36406-36412 NN denotes globin
T17265 36397-36405 NN denotes βmaj/min
T17264 36393-36396 IN denotes For
T17263 36367-36391 NN denotes 5′ACCTCTGGGGTGAATTCCTT3′
T17262 36365-36366 -COMMA- denotes ,
T17261 36358-36365 NN denotes MHB1673
T17260 36354-36357 CC denotes and
T17259 36352-36353 -COLON- denotes ;
T17258 36328-36352 NN denotes 5′TGGACAACCTCAAGGAGACC3′
T17257 36326-36327 -COMMA- denotes ,
T17256 36319-36326 NN denotes MHB1672
T17255 36317-36318 -COLON- denotes :
T17254 36311-36317 NN denotes globin
T17253 36307-36310 NN denotes βH1
T17252 36303-36306 IN denotes For
T17251 36277-36301 NN denotes 5′CTTAACCGCATCCCCTACGG3′
T17250 36275-36276 -COMMA- denotes ,
T17249 36268-36275 NN denotes MHB1669
T17248 36264-36267 CC denotes and
T17247 36262-36263 -COLON- denotes ;
T17246 36237-36262 NN denotes 5′CTACCCCCAGACGAAGACCTA3′
T17245 36235-36236 -COMMA- denotes ,
T17244 36228-36235 NN denotes MHB1668
T17243 36226-36227 -COLON- denotes :
T17242 36220-36226 NN denotes globin
T17241 36218-36219 NN denotes ζ
T17240 36214-36217 IN denotes For
T17239 36187-36212 NN denotes 5′GAAGCAGAGGACAAGTTCCCA3′
T17238 36185-36186 -COMMA- denotes ,
T17237 36178-36185 NN denotes MHB1667
T17236 36174-36177 CC denotes and
T17235 36172-36173 -COLON- denotes ;
T17234 36147-36172 NN denotes 5′TGGCCTGTGGAGTAAGGTCAA3′
T17233 36145-36146 -COMMA- denotes ,
T17232 36138-36145 NN denotes MHB1666
T17231 36136-36137 -COLON- denotes :
T17230 36130-36136 NN denotes globin
T17229 36127-36129 JJ denotes ɛy
T17228 36123-36126 IN denotes For
T17227 36110-36121 NN denotes specificity
T17226 36102-36109 VB denotes confirm
T17225 36099-36101 TO denotes to
T17224 36090-36098 NN denotes database
T17223 36085-36089 NN denotes NCBI
T17222 36081-36084 DT denotes the
T17221 36073-36080 IN denotes against
T17220 36064-36072 VB denotes searched
T17219 36059-36063 VB denotes were
T17218 36051-36058 NN denotes primers
T17217 36047-36050 DT denotes All
T17216 36044-36045 -RRB- denotes ]
T17215 36042-36044 CD denotes 51
T17214 36041-36042 -LRB- denotes [
T17213 36030-36040 NNP denotes Primerbank
T17212 36025-36029 IN denotes from
T17211 36016-36024 VB denotes obtained
T17210 36011-36015 VB denotes were
T17209 36005-36010 NN denotes genes
T17208 35998-36004 NN denotes globin
T17207 35995-35997 IN denotes of
T17206 35981-35994 NN denotes amplification
T17205 35977-35980 NN denotes PCR
T17204 35972-35976 NN denotes cDNA
T17203 35968-35971 IN denotes for
T17202 35960-35967 NN denotes Primers
T17201 35954-35958 NN denotes cDNA
T17200 35951-35953 TO denotes to
T17199 35939-35950 VB denotes transcribed
T17198 35931-35938 JJ denotes reverse
T17197 35925-35930 RB denotes first
T17196 35921-35924 VB denotes was
T17195 35917-35920 NN denotes RNA
T17194 35911-35915 NN denotes mRNA
T17193 35904-35910 NN denotes globin
T17192 35901-35903 IN denotes of
T17191 35888-35900 NN denotes Quantitation
T16443 35884-35885 -RRB- denotes )
T16442 35881-35884 CD denotes −18
T16441 35878-35880 TO denotes to
T16440 35874-35877 CD denotes −63
T16439 35873-35874 -LRB- denotes (
T16438 35870-35872 NN denotes 3′
T16437 35821-35869 NN denotes 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA
T16436 35819-35820 -COMMA- denotes ,
T16435 35812-35819 NN denotes MHB1663
T16434 35808-35811 CC denotes and
T16433 35806-35807 -COLON- denotes ;
T16432 35805-35806 -RRB- denotes )
T16431 35802-35805 CD denotes −16
T16430 35799-35801 TO denotes to
T16429 35795-35798 CD denotes −63
T16428 35794-35795 -LRB- denotes (
T16427 35742-35793 NN denotes 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′
T16426 35740-35741 -COMMA- denotes ,
T16425 35733-35740 NN denotes MHB1662
T16424 35731-35732 -COLON- denotes ;
T16423 35730-35731 -RRB- denotes )
T16422 35727-35730 CD denotes −19
T16421 35724-35726 TO denotes to
T16420 35720-35723 CD denotes −63
T16184 34297-34301 WDT denotes that
T16183 34291-34296 NN denotes sites
T16182 34283-34290 NN denotes HindIII
T16181 34279-34282 CC denotes and
T16180 34274-34278 NN denotes XhoI
T16179 34264-34273 VB denotes contained
T16178 34256-34263 NN denotes primers
T16177 34252-34255 NN denotes PCR
T16176 34248-34251 DT denotes The
T16175 34238-34246 NN denotes database
T16174 34236-34237 -RRB- denotes )
T16173 34231-34236 NN denotes Mouse
T16172 34228-34230 IN denotes of
T16171 34217-34227 NN denotes Annotation
T16170 34206-34216 JJ denotes Functional
T16169 34205-34206 -LRB- denotes (
T16168 34198-34204 NNP denotes Fantom
T16167 34194-34197 DT denotes the
T16166 34191-34193 IN denotes in
T16165 34186-34190 NN denotes cDNA
T16164 34178-34185 JJ denotes longest
T16163 34174-34177 DT denotes the
T16162 34171-34173 IN denotes on
T16161 34165-34170 VB denotes based
T16160 34162-34164 VB denotes is
T16159 34157-34161 NN denotes site
T16158 34151-34156 NN denotes start
T16157 34135-34150 JJ denotes transcriptional
T16156 34131-34134 DT denotes The
T16155 34125-34129 NN denotes site
T16154 34119-34124 NN denotes start
T16153 34105-34118 NN denotes transcription
T16152 34101-34104 DT denotes the
T16151 34098-34100 TO denotes to
T16150 34089-34097 JJ denotes relative
T16149 34086-34088 VB denotes is
T16148 34076-34085 NN denotes numbering
T16147 34065-34075 NN denotes Nucleotide
T16146 34062-34063 -RRB- denotes ]
T16145 34060-34062 CD denotes 50
T16144 34059-34060 -LRB- denotes [
T16143 34054-34058 NN denotes site
T16142 34050-34053 NN denotes cap
T16141 34045-34049 NN denotes gene
T16140 34038-34044 NN denotes globin
T16139 34036-34037 NN denotes ɛ
T16138 34032-34035 DT denotes the
T16137 34029-34031 IN denotes of
T16136 34020-34028 RB denotes upstream
T16135 34011-34019 NN denotes sequence
T16134 34008-34010 IN denotes of
T16133 34005-34007 NN denotes kb
T16132 34003-34004 CD denotes 2
T16131 33997-34002 IN denotes about
T16130 33986-33996 VB denotes containing
T16129 33977-33985 NN denotes fragment
T16128 33971-33976 NN denotes EcoRI
T16127 33964-33970 JJ denotes 3.7-kb
T16126 33962-33963 DT denotes a
T16125 33955-33961 IN denotes within
T16124 33947-33954 JJ denotes located
T16123 33943-33946 VB denotes are
T16122 33933-33942 NN denotes silencing
T16121 33928-33932 NN denotes gene
T16120 33926-33927 NN denotes ɛ
T16119 33922-33925 IN denotes for
T16118 33913-33921 VB denotes required
T16117 33903-33912 NN denotes sequences
T16116 33899-33902 DT denotes all
T16115 33894-33898 IN denotes that
T16114 33888-33893 VB denotes shown
T16113 33883-33887 VB denotes been
T16112 33879-33882 VB denotes has
T16111 33876-33878 PRP denotes it
T16110 33868-33875 IN denotes because
T16109 33866-33867 -COMMA- denotes ,
T16108 33862-33866 VB denotes used
T16107 33858-33861 VB denotes was
T16106 33856-33857 -RRB- denotes )
T16105 33853-33856 NN denotes ATG
T16104 33852-33853 -LRB- denotes (
T16103 33846-33851 NN denotes codon
T16102 33835-33845 NN denotes initiation
T16101 33828-33834 NN denotes globin
T16100 33825-33827 JJ denotes ɛy
T16099 33821-33824 DT denotes the
T16098 33818-33820 IN denotes of
T16097 33809-33817 RB denotes upstream
T16096 33800-33808 NN denotes fragment
T16095 33793-33799 JJ denotes 2.2-kb
T16094 33791-33792 DT denotes A
T16093 33781-33789 NN denotes promoter
T16092 33772-33780 JJ denotes proximal
T16091 33769-33771 JJ denotes ɛy
T16090 33765-33768 DT denotes the
T16089 33762-33764 IN denotes of
T16088 33748-33761 NN denotes amplification
T16087 33744-33747 NN denotes PCR
T16086 33741-33743 IN denotes by
T16085 33731-33740 VB denotes generated
T16084 33727-33730 VB denotes was
T16083 33725-33726 -RRB- denotes )
T16082 33720-33725 NN denotes E-luc
T16081 33719-33720 -LRB- denotes (
T16080 33711-33718 NN denotes plasmid
T16079 33702-33710 NN denotes reporter
T16078 33693-33701 NN denotes deletion
T16077 33684-33692 NN denotes promoter
T16076 33681-33683 JJ denotes ɛy
T16075 33677-33680 DT denotes The
T16074 33663-33675 NN denotes construction
T16073 33655-33662 NN denotes Plasmid
T16374 35413-35417 WDT denotes that
T16373 35411-35412 -RRB- denotes )
T16372 35393-35411 NN denotes Sox6-ΔHMG-pcDNA3.1
T16371 35392-35393 -LRB- denotes (
T16370 35382-35391 NN denotes construct
T16369 35367-35381 NN denotes overexpression
T16368 35362-35366 NN denotes Sox6
T16367 35358-35361 DT denotes the
T16366 35355-35357 IN denotes of
T16365 35347-35354 NN denotes version
T16364 35337-35346 VB denotes truncated
T16363 35335-35336 DT denotes A
T16362 35329-35333 NN denotes Sox6
T16361 35317-35328 VB denotes overexpress
T16360 35314-35316 TO denotes to
T16359 35309-35313 VB denotes used
T16358 35305-35308 VB denotes was
T16357 35303-35304 -RRB- denotes ]
T16356 35301-35303 CD denotes 15
T16355 35300-35301 -LRB- denotes [
T16354 35286-35299 NN denotes Sox6-pcDNA3.1
T16353 35283-35284 -RRB- denotes )
T16352 35280-35283 CD denotes +20
T16351 35277-35279 TO denotes to
T16350 35273-35276 CD denotes +45
T16349 35272-35273 -LRB- denotes (
T16348 35242-35271 NN denotes 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′
T16347 35240-35241 -COMMA- denotes ,
T16346 35233-35240 NN denotes MHB1477
T16345 35231-35232 -COLON- denotes :
T16344 35227-35231 NN denotes site
T16343 35219-35226 NN denotes HindIII
T16342 35212-35218 NN denotes primer
T16341 35204-35211 JJ denotes reverse
T16340 35200-35203 DT denotes the
T16339 35195-35199 IN denotes with
T16338 35183-35194 NN denotes combination
T16337 35180-35182 IN denotes in
T16336 35175-35179 VB denotes used
T16335 35170-35174 VB denotes were
T16334 35162-35169 NN denotes primers
T16333 35154-35161 JJ denotes forward
T16332 35150-35153 DT denotes All
T16331 35147-35148 -RRB- denotes )
T16330 35145-35147 CD denotes −9
T16329 35142-35144 TO denotes to
T16328 35138-35141 CD denotes −37
T16327 35137-35138 -LRB- denotes (
T16326 35134-35136 NN denotes 3′
T16325 35102-35133 NN denotes 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC
T16324 35100-35101 -COMMA- denotes ,
T16323 35093-35100 NN denotes MHB1507
T16322 35089-35092 CC denotes and
T16321 35087-35088 -COLON- denotes ;
T16320 35086-35087 -RRB- denotes )
T16319 35083-35086 CD denotes −34
T16318 35080-35082 TO denotes to
T16317 35076-35079 CD denotes −63
T16316 35075-35076 -LRB- denotes (
T16315 35040-35074 NN denotes 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′
T16314 35038-35039 -COMMA- denotes ,
T16313 35031-35038 NN denotes MHB1532
T16312 35029-35030 -COLON- denotes ;
T16311 35028-35029 -RRB- denotes )
T16310 35025-35028 CD denotes −58
T16309 35022-35024 TO denotes to
T16308 35018-35021 CD denotes −85
T16307 35017-35018 -LRB- denotes (
T16306 34984-35016 NN denotes 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′
T16305 34982-34983 -COMMA- denotes ,
T16304 34975-34982 NN denotes MHB1506
T16303 34973-34974 -COLON- denotes ;
T16302 34972-34973 -RRB- denotes )
T16301 34968-34972 CD denotes −169
T16300 34965-34967 TO denotes to
T16299 34960-34964 CD denotes −197
T16298 34959-34960 -LRB- denotes (
T16297 34926-34958 NN denotes 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′
T16296 34924-34925 -COMMA- denotes ,
T16295 34917-34924 NN denotes MHB1505
T16294 34915-34916 -COLON- denotes ;
T16293 34914-34915 -RRB- denotes )
T16292 34910-34914 CD denotes −605
T16291 34907-34909 TO denotes to
T16290 34902-34906 CD denotes −634
T16289 34901-34902 -LRB- denotes (
T16288 34866-34900 NN denotes 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′
T16287 34864-34865 -COMMA- denotes ,
T16286 34857-34864 NN denotes MHB1503
T16285 34855-34856 -COLON- denotes ;
T16284 34854-34855 -RRB- denotes )
T16283 34849-34854 CD denotes −2052
T16282 34846-34848 TO denotes to
T16281 34840-34845 CD denotes −2077
T16280 34839-34840 -LRB- denotes (
T16279 34808-34838 NN denotes 5′CCGCTCGAGTGCTAGGCAAACACTCA3′
T16278 34806-34807 -COMMA- denotes ,
T16277 34799-34806 NN denotes MHB1457
T16276 34797-34798 -COLON- denotes :
T16275 34790-34797 VB denotes include
T16274 34785-34789 NN denotes site
T16273 34780-34784 NN denotes XhoI
T16272 34777-34779 DT denotes an
T16271 34772-34776 IN denotes with
T16270 34764-34771 NN denotes primers
T16269 34756-34763 JJ denotes Forward
T16268 34745-34754 RB denotes similarly
T16267 34735-34744 VB denotes generated
T16266 34730-34734 VB denotes were
T16265 34721-34729 NN denotes promoter
T16264 34718-34720 JJ denotes ɛy
T16263 34714-34717 DT denotes the
T16262 34711-34713 IN denotes of
T16261 34700-34710 NN denotes constructs
T16260 34691-34699 NN denotes deletion
T16259 34688-34690 IN denotes of
T16258 34681-34687 NN denotes series
T16257 34679-34680 DT denotes A
T16256 34669-34677 NN denotes promoter
T16255 34666-34668 JJ denotes ɛy
T16254 34662-34665 DT denotes the
T16253 34659-34661 IN denotes by
T16252 34652-34658 VB denotes driven
T16251 34649-34651 VB denotes is
T16250 34638-34648 NN denotes expression
T16249 34627-34637 NN denotes luciferase
T16248 34621-34626 WDT denotes which
T16247 34618-34620 IN denotes in
T16246 34608-34617 NN denotes construct
T16245 34599-34607 NN denotes reporter
T16244 34597-34598 DT denotes a
T16243 34594-34596 IN denotes in
T16242 34584-34593 VB denotes resulting
T16241 34582-34583 -COMMA- denotes ,
T16240 34575-34582 NN denotes plasmid
T16239 34569-34574 JJ denotes Basic
T16238 34564-34568 NN denotes pGL3
T16237 34558-34563 JJ denotes above
T16236 34554-34557 DT denotes the
T16235 34551-34553 IN denotes in
T16234 34542-34550 NN denotes promoter
T16233 34539-34541 JJ denotes ɛy
T16232 34535-34538 DT denotes the
T16231 34532-34534 IN denotes of
T16230 34523-34531 RB denotes upstream
T16229 34514-34522 VB denotes inserted
T16228 34509-34513 RB denotes then
T16227 34505-34508 VB denotes was
T16226 34503-34504 -RRB- denotes )
T16225 34502-34503 -RRB- denotes ]
T16224 34500-34502 CD denotes 31
T16223 34499-34500 -LRB- denotes [
T16222 34497-34498 -COLON- denotes ;
T16221 34494-34497 NN denotes LCR
T16220 34488-34493 NN denotes micro
T16219 34487-34488 -LRB- denotes (
T16218 34483-34486 CD denotes 9.3
T16217 34477-34482 NN denotes μLCRβ
T16216 34474-34476 IN denotes of
T16215 34465-34473 NN denotes fragment
T16214 34455-34464 NN denotes SstI/XhoI
T16213 34448-34454 JJ denotes 2.5-kb
T16212 34446-34447 DT denotes A
T16211 34443-34444 -RRB- denotes )
T16210 34437-34443 NNP denotes States
T16209 34430-34436 NNP denotes United
T16208 34428-34429 -COMMA- denotes ,
T16207 34419-34428 NNP denotes Wisconsin
T16206 34417-34418 -COMMA- denotes ,
T16205 34410-34417 NNP denotes Madison
T16204 34408-34409 -COMMA- denotes ,
T16203 34401-34408 NNP denotes Promega
T16202 34400-34401 -LRB- denotes (
T16201 34394-34399 JJ denotes Basic
T16200 34389-34393 NN denotes pGL3
T16199 34386-34388 IN denotes in
T16198 34381-34385 NN denotes gene
T16197 34370-34380 NN denotes luciferase
T16196 34362-34369 NN denotes firefly
T16195 34358-34361 DT denotes the
T16194 34355-34357 IN denotes of
T16193 34346-34354 RB denotes upstream
T16192 34337-34345 NN denotes fragment
T16191 34328-34336 NN denotes promoter
T16190 34325-34327 JJ denotes ɛy
T16189 34321-34324 DT denotes the
T16188 34315-34320 VB denotes clone
T16187 34312-34314 TO denotes to
T16186 34307-34311 VB denotes used
T16185 34302-34306 VB denotes were
T16419 35719-35720 -LRB- denotes (
T16418 35669-35718 NN denotes 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′
T16417 35667-35668 -COMMA- denotes ,
T16416 35660-35667 NN denotes MHB1661
T16415 35658-35659 -COLON- denotes :
T16414 35651-35658 VB denotes include
T16413 35640-35650 NN denotes constructs
T16412 35631-35639 NN denotes reporter
T16411 35622-35630 NN denotes promoter
T16410 35619-35621 NN denotes ɛy
T16409 35607-35618 VB denotes mutagenized
T16408 35601-35606 DT denotes these
T16407 35592-35600 VB denotes generate
T16406 35589-35591 TO denotes to
T16405 35584-35588 VB denotes used
T16404 35576-35583 NN denotes primers
T16403 35568-35575 JJ denotes Forward
T16402 35563-35566 NN denotes PCR
T16401 35560-35562 IN denotes by
T16400 35555-35559 VB denotes done
T16399 35550-35554 VB denotes were
T16398 35541-35549 NN denotes promoter
T16397 35538-35540 JJ denotes ɛy
T16396 35534-35537 DT denotes the
T16395 35531-35533 IN denotes of
T16394 35525-35530 NN denotes sites
T16393 35517-35524 NN denotes binding
T16392 35507-35516 NN denotes consensus
T16391 35498-35506 NN denotes Sox/Sox6
T16390 35495-35497 IN denotes of
T16389 35483-35494 NN denotes Mutagenesis
T16388 35480-35481 -RRB- denotes ]
T16387 35478-35480 CD denotes 32
T16386 35477-35478 -LRB- denotes [
T16385 35470-35476 NN denotes others
T16384 35467-35469 IN denotes by
T16383 35457-35466 VB denotes described
T16382 35454-35456 IN denotes as
T16381 35452-35453 -COMMA- denotes ,
T16380 35443-35452 VB denotes generated
T16379 35439-35442 VB denotes was
T16378 35432-35438 NN denotes domain
T16377 35428-35431 NN denotes HMG
T16376 35424-35427 DT denotes the
T16375 35418-35423 VB denotes lacks
T13246 33617-33629 NN denotes thalassemias
T13245 33615-33616 VB denotes β
T13244 33611-33614 CC denotes and
T13243 33604-33610 NN denotes anemia
T13242 33599-33603 NN denotes cell
T13241 33592-33598 JJ denotes sickle
T13240 33589-33591 IN denotes of
T13239 33579-33588 NN denotes treatment
T13238 33575-33578 DT denotes the
T13237 33571-33574 IN denotes for
T13236 33563-33570 NN denotes targets
T13235 33553-33562 JJ denotes molecular
T13234 33542-33552 JJ denotes additional
T13233 33535-33541 VB denotes reveal
T13232 33523-33534 RB denotes potentially
T13231 33519-33522 CC denotes and
T13230 33508-33518 NN denotes regulation
T13229 33501-33507 NN denotes globin
T13228 33499-33500 NN denotes ɛ
T13227 33496-33498 IN denotes of
T13226 33482-33495 NN denotes understanding
T13225 33478-33481 PRP-DOLLAR- denotes our
T13224 33470-33477 VB denotes further
T13223 33466-33469 MD denotes may
T13222 33458-33465 NN denotes complex
T13221 33442-33457 JJ denotes Sox6-containing
T13220 33438-33441 DT denotes the
T13219 33435-33437 IN denotes of
T13218 33424-33434 NN denotes components
T13217 33418-33423 JJ denotes other
T13216 33415-33417 IN denotes of
T13215 33400-33414 NN denotes identification
T13214 33396-33399 CC denotes and
T13213 33386-33395 NN denotes mechanism
T13212 33375-33385 NN denotes repression
T13211 33370-33374 NN denotes Sox6
T13210 33366-33369 DT denotes the
T13209 33363-33365 IN denotes of
T13208 33351-33362 NN denotes elucidation
T13207 33349-33350 -COMMA- denotes ,
T13206 33345-33349 RB denotes Thus
T13205 33342-33343 -RRB- denotes ]
T13204 33337-33342 CD denotes 49,50
T13203 33336-33337 -LRB- denotes [
T13202 33327-33335 VB denotes proposed
T13201 33322-33326 VB denotes been
T13200 33318-33321 VB denotes has
T13199 33313-33317 NN denotes gene
T13198 33306-33312 NN denotes globin
T13197 33304-33305 NN denotes ɛ
T13196 33298-33303 JJ denotes human
T13195 33294-33297 DT denotes the
T13194 33291-33293 IN denotes of
T13193 33282-33290 NN denotes silencer
T13192 33280-33281 DT denotes a
T13191 33277-33279 IN denotes of
T13190 33267-33276 NN denotes existence
T13189 33263-33266 DT denotes the
T13188 33261-33262 -COMMA- denotes ,
T13187 33255-33261 RB denotes Indeed
T13186 33248-33253 NN denotes sites
T13185 33240-33247 NN denotes binding
T13184 33235-33239 NN denotes Sox6
T13183 33225-33234 JJ denotes potential
T13182 33221-33224 CD denotes two
T13181 33215-33220 JJ denotes least
T13180 33212-33214 IN denotes at
T13179 33203-33211 VB denotes contains
T13178 33194-33202 NN denotes promoter
T13177 33188-33193 JJ denotes human
T13176 33184-33187 DT denotes the
T13175 33180-33183 CC denotes and
T13174 33178-33179 -COMMA- denotes ,
T13173 33171-33178 NN denotes regions
T13172 33162-33170 NN denotes promoter
T13171 33160-33161 NN denotes ɛ
T13170 33154-33159 NN denotes mouse
T13169 33150-33153 CC denotes and
T13168 33144-33149 JJ denotes human
T13167 33140-33143 DT denotes the
T13166 33132-33139 IN denotes between
T13165 33123-33131 NN denotes homology
T13164 33114-33122 NN denotes sequence
T13163 33102-33113 JJ denotes significant
T13162 33099-33101 VB denotes is
T13161 33093-33098 EX denotes There
T13160 33082-33091 NN denotes silencing
T13159 33075-33081 NN denotes globin
T13158 33073-33074 NN denotes ɛ
T13157 33067-33072 JJ denotes human
T13156 33064-33066 IN denotes in
T13155 33054-33063 JJ denotes important
T13154 33051-33053 VB denotes be
T13153 33046-33050 RB denotes also
T13152 33042-33045 MD denotes may
T13151 33037-33041 NN denotes Sox6
T13150 33031-33036 JJ denotes human
T13149 33026-33030 IN denotes that
T13148 33017-33025 JJ denotes possible
T13147 33014-33016 VB denotes is
T13146 33011-33013 PRP denotes it
T13145 33009-33010 -COMMA- denotes ,
T13144 33008-33009 -RRB- denotes ]
T13143 33006-33008 CD denotes 48
T13142 33005-33006 -LRB- denotes [
T13141 32999-33004 NN denotes level
T13140 32994-32998 NN denotes acid
T13139 32988-32993 JJ denotes amino
T13138 32984-32987 DT denotes the
T13137 32981-32983 IN denotes at
T13136 32971-32980 JJ denotes identical
T13135 32969-32970 NN denotes %
T13134 32967-32969 CD denotes 94
T13133 32963-32966 VB denotes are
T13132 32951-32962 NN denotes counterpart
T13131 32945-32950 JJ denotes human
T13130 32941-32944 PRP-DOLLAR- denotes its
T13129 32937-32940 CC denotes and
T13128 32932-32936 NN denotes Sox6
T13127 32925-32931 JJ denotes murine
T13126 32917-32924 IN denotes Because
T13125 32908-32915 NN denotes complex
T13124 32897-32907 NN denotes repression
T13123 32890-32896 JJ denotes larger
T13122 32888-32889 DT denotes a
T13121 32885-32887 IN denotes of
T13120 32880-32884 NN denotes part
T13119 32877-32879 IN denotes as
T13118 32865-32876 RB denotes potentially
T13117 32863-32864 -COMMA- denotes ,
T13116 32855-32863 NN denotes promoter
T13115 32846-32854 JJ denotes proximal
T13114 32843-32845 JJ denotes ɛy
T13113 32839-32842 DT denotes the
T13112 32836-32838 TO denotes to
T13111 32830-32835 VB denotes binds
T13110 32824-32829 WDT denotes which
T13109 32822-32823 -COMMA- denotes ,
T13108 32818-32822 NN denotes Sox6
T13107 32816-32817 -COMMA- denotes ,
T13106 32807-32816 NN denotes repressor
T13105 32801-32806 JJ denotes novel
T13104 32799-32800 DT denotes a
T13103 32788-32798 VB denotes identifies
T13102 32782-32787 NN denotes study
T13101 32774-32781 JJ denotes present
T13100 32770-32773 DT denotes The
T13099 32759-32768 NN denotes silencing
T13098 32754-32758 NN denotes gene
T13097 32745-32753 JJ denotes ɛ-globin
T13096 32742-32744 IN denotes of
T13095 32736-32741 NN denotes basis
T13094 32726-32735 JJ denotes molecular
T13093 32722-32725 DT denotes the
T13092 32717-32721 IN denotes into
T13091 32702-32716 NN denotes investigations
T13090 32693-32701 JJ denotes detailed
T13089 32689-32692 IN denotes for
T13088 32679-32688 NN denotes rationale
T13087 32677-32678 DT denotes a
T13086 32667-32676 VB denotes providing
T13085 32665-32666 -COMMA- denotes ,
T13084 32664-32665 -RRB- denotes ]
T13083 32662-32664 CD denotes 47
T13082 32661-32662 -LRB- denotes [
T13081 32653-32660 NN denotes disease
T13080 32648-32652 NN denotes cell
T13079 32641-32647 NN denotes sickle
T13078 32636-32640 IN denotes with
T13077 32629-32635 NN denotes adults
T13076 32626-32628 TO denotes to
T13075 32615-32625 JJ denotes beneficial
T13074 32599-32614 RB denotes therapeutically
T13073 32596-32598 VB denotes be
T13072 32590-32595 MD denotes would
T13071 32581-32589 NN denotes ɛ-globin
T13070 32575-32580 JJ denotes human
T13069 32572-32574 IN denotes of
T13068 32559-32571 NN denotes reactivation
T13067 32554-32558 IN denotes that
T13066 32546-32553 VB denotes suggest
T13065 32537-32545 NN denotes analyses
T13064 32531-32536 FW denotes vitro
T13063 32528-32530 FW denotes in
T13062 32524-32527 CC denotes and
T13061 32519-32523 FW denotes vivo
T13060 32516-32518 FW denotes in
T13059 32514-32515 -COMMA- denotes ,
T13058 32506-32514 RB denotes Recently
T13057 32497-32504 NN denotes process
T13056 32485-32496 NN denotes enucleation
T13055 32481-32484 DT denotes the
T13054 32477-32480 CC denotes and
T13053 32461-32476 NN denotes differentiation
T13052 32452-32460 JJ denotes terminal
T13051 32447-32451 NN denotes cell
T13050 32443-32446 JJ denotes red
T13049 32440-32442 IN denotes in
T13048 32435-32439 NN denotes Sox6
T13047 32432-32434 IN denotes of
T13046 32427-32431 NN denotes role
T13045 32423-32426 DT denotes the
T13044 32420-32422 IN denotes on
T13043 32414-32419 NN denotes light
T13042 32409-32413 VB denotes shed
T13041 32404-32408 MD denotes will
T12883 31481-31486 JJ denotes lower
T12882 31479-31480 NN denotes %
T12881 31477-31479 CD denotes 20
T12880 31472-31476 RB denotes only
T12879 31469-31471 VB denotes is
T12878 31464-31468 NN denotes mice
T12877 31457-31463 JJ denotes mutant
T12876 31448-31456 JJ denotes 18.5-dpc
T12875 31445-31447 IN denotes of
T12874 31434-31444 NN denotes hematocrit
T12873 31430-31433 DT denotes the
T12872 31428-31429 -COMMA- denotes ,
T12871 31421-31428 RB denotes However
T12870 31409-31419 NN denotes maturation
T12869 31400-31408 JJ denotes complete
T12868 31394-31399 PRP-DOLLAR- denotes their
T12867 31391-31393 TO denotes to
T12866 31385-31390 JJ denotes prior
T12865 31383-31384 -COMMA- denotes ,
T12864 31378-31383 NN denotes cells
T12863 31374-31377 JJ denotes red
T12862 31371-31373 IN denotes of
T12861 31363-31370 NN denotes release
T12860 31353-31362 JJ denotes premature
T12859 31347-31352 JJ denotes rapid
T12858 31344-31346 TO denotes to
T12857 31339-31343 VB denotes lead
T12856 31335-31338 MD denotes can
T12855 31328-31334 NN denotes anemia
T12854 31321-31327 JJ denotes Severe
T12853 31313-31319 NN denotes anemia
T12852 31306-31312 CC denotes and/or
T12851 31304-31305 -RRB- denotes )
T12850 31297-31304 NN denotes defects
T12849 31289-31296 JJ denotes cardiac
T12848 31284-31288 IN denotes from
T12847 31274-31283 VB denotes resulting
T12846 31273-31274 -LRB- denotes (
T12845 31259-31272 NN denotes proliferation
T12844 31244-31258 JJ denotes stress-induced
T12843 31241-31243 IN denotes as
T12842 31236-31240 JJ denotes such
T12841 31234-31235 -COMMA- denotes ,
T12840 31227-31234 NN denotes effects
T12839 31218-31226 JJ denotes indirect
T12838 31215-31217 IN denotes of
T12837 31208-31214 NN denotes result
T12836 31204-31207 DT denotes the
T12835 31201-31203 VB denotes be
T12834 31197-31200 MD denotes may
T12833 31192-31196 DT denotes This
T12832 31186-31190 NN denotes mice
T12831 31179-31185 JJ denotes mutant
T12830 31173-31178 NN denotes p100H
T12829 31170-31172 IN denotes in
T12828 31147-31169 NN denotes enucleation/maturation
T12827 31144-31146 IN denotes in
T12826 31138-31143 NN denotes delay
T12825 31136-31137 DT denotes a
T12824 31126-31135 VB denotes including
T12823 31124-31125 -COMMA- denotes ,
T12822 31110-31124 NN denotes erythropoiesis
T12821 31107-31109 IN denotes in
T12820 31099-31106 NN denotes effects
T12819 31093-31098 JJ denotes other
T12818 31089-31092 VB denotes has
T12817 31084-31088 NN denotes Sox6
T12816 31072-31082 VB denotes elucidated
T12815 31069-31071 VB denotes be
T12814 31066-31068 TO denotes to
T12813 31058-31065 VB denotes remains
T12812 31052-31057 NN denotes genes
T12811 31045-31051 NN denotes globin
T12810 31035-31044 JJ denotes embryonic
T12809 31029-31034 JJ denotes other
T12808 31025-31028 DT denotes the
T12807 31015-31024 VB denotes regulates
T12806 31010-31014 NN denotes Sox6
T12805 31004-31009 WDT denotes which
T12804 31001-31003 IN denotes by
T12803 30991-31000 NN denotes mechanism
T12802 30987-30990 DT denotes The
T12801 30976-30985 NN denotes ɛy-globin
T12800 30973-30975 IN denotes of
T12799 30962-30972 NN denotes regulation
T12798 30958-30961 DT denotes the
T12797 30955-30957 IN denotes in
T12796 30946-30954 NN denotes function
T12795 30939-30945 JJ denotes unique
T12794 30937-30938 DT denotes a
T12793 30933-30936 VB denotes has
T12792 30929-30932 CC denotes and
T12791 30918-30928 NN denotes expression
T12790 30911-30917 NN denotes globin
T12789 30908-30910 JJ denotes ɛy
T12788 30900-30907 NN denotes silence
T12787 30897-30899 TO denotes to
T12786 30885-30896 RB denotes postnatally
T12785 30876-30884 VB denotes function
T12784 30873-30875 TO denotes to
T12783 30863-30872 VB denotes continues
T12782 30858-30862 NN denotes Sox6
T12781 30853-30857 IN denotes that
T12780 30845-30852 VB denotes suggest
T12779 30836-30844 NN denotes findings
T12778 30830-30835 DT denotes These
T12777 30827-30828 -RRB- denotes )
T12776 30826-30827 CD denotes 1
T12775 30819-30825 NN denotes Figure
T12774 30818-30819 -LRB- denotes (
T12773 30814-30817 NN denotes dpc
T12772 30809-30813 CD denotes 18.5
T12771 30806-30808 IN denotes at
T12770 30798-30805 VB denotes observe
T12769 30795-30797 PRP denotes we
T12768 30790-30794 WP denotes what
T12767 30787-30789 TO denotes to
T12766 30779-30786 JJ denotes similar
T12765 30777-30778 -COMMA- denotes ,
T12764 30776-30777 -RRB- denotes )
T12763 30772-30776 NN denotes data
T12762 30760-30771 JJ denotes unpublished
T12761 30759-30760 -LRB- denotes (
T12760 30756-30758 NN denotes WT
T12759 30751-30755 IN denotes with
T12758 30742-30750 VB denotes compared
T12757 30738-30741 NN denotes RNA
T12756 30731-30737 JJ denotes mutant
T12755 30727-30730 DT denotes the
T12754 30724-30726 IN denotes in
T12753 30715-30723 JJ denotes elevated
T12752 30704-30714 RB denotes moderately
T12751 30699-30703 VB denotes were
T12750 30692-30698 NN denotes levels
T12749 30688-30691 NN denotes RNA
T12748 30681-30687 NN denotes globin
T12747 30674-30680 JJ denotes β-like
T12746 30668-30673 JJ denotes adult
T12745 30666-30667 -COMMA- denotes ,
T12744 30659-30666 RB denotes however
T12743 30657-30658 -COLON- denotes ;
T12742 30655-30657 NN denotes WT
T12741 30651-30654 CC denotes and
T12740 30644-30650 JJ denotes mutant
T12739 30641-30643 IN denotes in
T12738 30636-30640 CC denotes both
T12737 30623-30635 JJ denotes undetectable
T12736 30618-30622 VB denotes were
T12735 30614-30617 NN denotes RNA
T12734 30610-30613 NN denotes βh1
T12733 30606-30609 CC denotes and
T12732 30604-30605 NN denotes ζ
T12731 30601-30603 IN denotes of
T12730 30594-30600 NN denotes levels
T12729 30590-30593 DT denotes the
T12728 30588-30589 -COMMA- denotes ,
T12727 30577-30588 NN denotes development
T12726 30574-30576 IN denotes in
T12725 30568-30573 NN denotes point
T12724 30563-30567 DT denotes this
T12723 30560-30562 IN denotes At
T12722 30554-30558 NN denotes mice
T12721 30546-30553 NN denotes control
T12720 30543-30545 NN denotes WT
T12719 30540-30542 IN denotes in
T12718 30536-30539 NN denotes RNA
T12717 30533-30535 JJ denotes ɛy
T12716 30520-30532 JJ denotes undetectable
T12715 30515-30519 IN denotes with
T12714 30506-30514 VB denotes compared
T12713 30504-30505 -COMMA- denotes ,
T12712 30498-30504 NN denotes sample
T12711 30494-30497 NN denotes RNA
T12710 30489-30493 DT denotes this
T12709 30486-30488 IN denotes in
T12708 30479-30485 NN denotes globin
T12707 30476-30478 JJ denotes ɛy
T12706 30473-30475 IN denotes of
T12705 30466-30472 NN denotes levels
T12704 30461-30465 JJ denotes high
T12703 30452-30460 VB denotes detected
T12702 30448-30451 CC denotes and
T12701 30437-30447 NN denotes expression
T12700 30432-30436 NN denotes gene
T12699 30425-30431 NN denotes globin
T12698 30421-30424 IN denotes for
T12697 30416-30420 CD denotes 13.5
T12696 30412-30415 NN denotes day
T12695 30402-30411 JJ denotes postnatal
T12694 30399-30401 IN denotes on
T12693 30393-30398 NN denotes mouse
T12692 30386-30392 JJ denotes mutant
T12691 30384-30385 DT denotes a
T12690 30379-30383 IN denotes from
T12689 30375-30378 NN denotes RNA
T12688 30369-30374 NN denotes liver
T12687 30366-30368 IN denotes of
T12686 30359-30365 NN denotes sample
T12685 30350-30358 JJ denotes archived
T12684 30343-30349 JJ denotes single
T12683 30341-30342 DT denotes a
T12682 30332-30340 VB denotes examined
T12681 30329-30331 PRP denotes We
T12680 30326-30327 -RRB- denotes ]
T12679 30324-30326 CD denotes 14
T12678 30323-30324 -LRB- denotes [
T12677 30317-30322 NN denotes birth
T12676 30311-30316 IN denotes after
T12675 30308-30310 NN denotes wk
T12674 30306-30307 CD denotes 2
T12673 30301-30305 IN denotes than
T12672 30294-30300 JJ denotes longer
T12671 30289-30293 VB denotes live
T12670 30286-30288 TO denotes to
T12669 30277-30285 VB denotes observed
T12668 30272-30276 VB denotes been
T12514 29460-29462 TO denotes to
T12513 29449-29459 JJ denotes equivalent
T12512 29435-29448 RB denotes statistically
T12511 29432-29434 VB denotes is
T12510 29428-29431 NN denotes dpc
T12509 29423-29427 CD denotes 18.5
T12508 29419-29422 CC denotes and
T12507 29415-29418 NN denotes dpc
T12506 29410-29414 CD denotes 15.5
T12505 29407-29409 IN denotes at
T12504 29402-29406 NN denotes mice
T12503 29397-29401 JJ denotes null
T12502 29392-29396 NN denotes Sox6
T12501 29381-29391 JJ denotes homozygous
T12500 29378-29380 IN denotes in
T12499 29371-29377 NN denotes globin
T12498 29368-29370 JJ denotes ɛy
T12497 29365-29367 IN denotes of
T12496 29359-29364 NN denotes level
T12495 29348-29358 NN denotes expression
T12494 29344-29347 DT denotes The
T12493 29332-29342 NN denotes expression
T12492 29325-29331 NN denotes globin
T12491 29322-29324 JJ denotes ɛy
T12490 29314-29321 NN denotes silence
T12489 29311-29313 TO denotes to
T12488 29296-29310 NN denotes erythropoiesis
T12487 29285-29295 JJ denotes definitive
T12486 29282-29284 IN denotes in
T12485 29272-29281 NN denotes functions
T12484 29267-29271 NN denotes Sox6
T12483 29262-29266 IN denotes that
T12482 29250-29261 VB denotes demonstrate
T12481 29245-29249 NN denotes data
T12480 29239-29244 DT denotes these
T12479 29237-29238 -COMMA- denotes ,
T12478 29229-29237 RB denotes together
T12477 29223-29228 VB denotes Taken
T12476 29220-29221 -RRB- denotes )
T12475 29219-29220 CD denotes 5
T12474 29212-29218 NN denotes Figure
T12473 29211-29212 -LRB- denotes (
T12472 29205-29210 NN denotes liver
T12471 29201-29204 DT denotes the
T12470 29198-29200 IN denotes in
T12469 29192-29197 NN denotes place
T12468 29186-29191 VB denotes takes
T12467 29181-29185 WDT denotes that
T12466 29166-29180 NN denotes erythropoiesis
T12465 29155-29165 JJ denotes definitive
T12464 29152-29154 IN denotes of
T12463 29142-29151 NN denotes mechanism
T12462 29132-29141 NN denotes silencing
T12461 29128-29131 DT denotes the
T12460 29125-29127 IN denotes in
T12459 29117-29124 NN denotes defects
T12458 29114-29116 TO denotes to
T12457 29110-29113 IN denotes due
T12456 29107-29109 VB denotes is
T12455 29102-29106 NN denotes mice
T12454 29095-29101 JJ denotes mutant
T12453 29089-29094 NN denotes p100H
T12452 29086-29088 IN denotes in
T12451 29079-29085 NN denotes globin
T12450 29076-29078 JJ denotes ɛy
T12449 29073-29075 IN denotes of
T12448 29062-29072 NN denotes expression
T12447 29051-29061 JJ denotes persistent
T12446 29047-29050 DT denotes the
T12445 29042-29046 IN denotes that
T12444 29036-29041 VB denotes shows
T12443 29028-29035 RB denotes clearly
T12442 29014-29027 NN denotes hybridization
T12441 29009-29013 FW denotes situ
T12440 29006-29008 FW denotes in
T12439 29004-29005 -COMMA- denotes ,
T12438 28996-29004 RB denotes Moreover
T12437 28993-28994 -RRB- denotes )
T12436 28992-28993 CD denotes 2
T12435 28985-28991 NN denotes Figure
T12434 28984-28985 -LRB- denotes (
T12433 28978-28983 FW denotes vitro
T12432 28975-28977 FW denotes in
T12431 28971-28974 CC denotes and
T12430 28969-28970 -RRB- denotes )
T12429 28968-28969 CD denotes 1
T12428 28961-28967 NN denotes Figure
T12427 28960-28961 -LRB- denotes (
T12426 28955-28959 FW denotes vivo
T12425 28952-28954 FW denotes in
T12424 28947-28951 CC denotes both
T12423 28936-28946 NN denotes expression
T12422 28929-28935 NN denotes globin
T12421 28926-28928 JJ denotes ɛy
T12420 28916-28925 VB denotes represses
T12419 28911-28915 NN denotes Sox6
T12418 28907-28910 CC denotes and
T12417 28905-28906 -COMMA- denotes ,
T12416 28904-28905 -RRB- denotes )
T12415 28903-28904 CD denotes 6
T12414 28896-28902 NN denotes Figure
T12413 28895-28896 -LRB- denotes (
T12412 28880-28894 NN denotes erythropoiesis
T12411 28878-28879 -RRB- denotes )
T12410 28869-28878 JJ denotes primitive
T12409 28865-28868 RB denotes not
T12408 28861-28864 CC denotes but
T12407 28860-28861 -LRB- denotes (
T12406 28849-28859 JJ denotes definitive
T12405 28844-28848 IN denotes with
T12404 28833-28843 JJ denotes coincident
T12403 28823-28832 RB denotes spatially
T12402 28819-28822 CC denotes and
T12401 28808-28818 RB denotes temporally
T12400 28805-28807 VB denotes is
T13040 32395-32403 NN denotes proteins
T13039 32383-32394 VB denotes interacting
T13038 32379-32382 PRP-DOLLAR- denotes its
T13037 32375-32378 CC denotes and
T13036 32369-32374 NN denotes genes
T13035 32362-32368 NN denotes target
T13034 32351-32361 JJ denotes downstream
T13033 32346-32350 NN denotes Sox6
T13032 32343-32345 IN denotes of
T13031 32328-32342 NN denotes Identification
T13030 32315-32326 NN denotes enucleation
T13029 32308-32314 JJ denotes normal
T13028 32301-32307 VB denotes permit
T13027 32297-32300 MD denotes may
T13026 32286-32296 NN denotes production
T13025 32281-32285 NN denotes cell
T13024 32277-32280 JJ denotes red
T13023 32274-32276 IN denotes of
T13022 32257-32273 NN denotes microenvironment
T13021 32253-32256 DT denotes the
T13020 32250-32252 IN denotes in
T13019 32243-32249 NN denotes change
T13018 32230-32242 VB denotes accompanying
T13017 32226-32229 DT denotes The
T13016 32220-32224 CD denotes 10.5
T13015 32216-32219 NN denotes day
T13014 32206-32215 JJ denotes postnatal
T13013 32203-32205 IN denotes by
T13012 32196-32202 NN denotes marrow
T13011 32191-32195 NN denotes bone
T13010 32188-32190 TO denotes to
T13009 32182-32187 NN denotes liver
T13008 32176-32181 JJ denotes fetal
T13007 32171-32175 IN denotes from
T13006 32163-32170 VB denotes shifted
T13005 32155-32162 RB denotes already
T13004 32151-32154 VB denotes has
T13003 32136-32150 NN denotes erythropoiesis
T13002 32134-32135 -COMMA- denotes ,
T13001 32126-32134 RB denotes Moreover
T13000 32123-32124 -RRB- denotes ]
T12999 32115-32123 CD denotes 13,45,46
T12998 32114-32115 -LRB- denotes [
T12997 32105-32113 NN denotes proteins
T12996 32101-32104 NN denotes Sox
T12995 32096-32100 IN denotes with
T12994 32090-32095 NN denotes theme
T12993 32080-32089 VB denotes recurring
T12992 32078-32079 DT denotes a
T12991 32075-32077 VB denotes is
T12990 32064-32074 NN denotes redundancy
T12989 32053-32063 JJ denotes functional
T12988 32047-32052 IN denotes since
T12987 32045-32046 -COMMA- denotes ,
T12986 32044-32045 -RRB- denotes )
T12985 32038-32044 NN denotes stages
T12984 32024-32037 JJ denotes developmental
T12983 32018-32023 JJ denotes later
T12982 32015-32017 IN denotes at
T12981 32005-32014 VB denotes expressed
T12980 32004-32005 -LRB- denotes (
T12979 31995-32003 NN denotes proteins
T12978 31991-31994 NN denotes Sox
T12977 31985-31990 JJ denotes other
T12976 31982-31984 IN denotes of
T12975 31969-31981 NN denotes compensation
T12974 31958-31968 JJ denotes functional
T12973 31953-31957 IN denotes from
T12972 31946-31952 VB denotes result
T12971 31942-31945 MD denotes may
T12970 31937-31941 CD denotes 10.5
T12969 31933-31936 NN denotes day
T12968 31923-31932 JJ denotes postnatal
T12967 31920-31922 IN denotes by
T12966 31914-31919 NN denotes mouse
T12965 31899-31913 JJ denotes Sox6-deficient
T12964 31896-31898 IN denotes in
T12963 31890-31895 NN denotes cells
T12962 31886-31889 JJ denotes red
T12961 31883-31885 IN denotes of
T12960 31871-31882 NN denotes enucleation
T12959 31864-31870 JJ denotes normal
T12958 31861-31863 IN denotes of
T12957 31849-31860 NN denotes restoration
T12956 31845-31848 DT denotes The
T12955 31842-31843 -RRB- denotes ]
T12954 31834-31842 CD denotes 32,41–44
T12953 31833-31834 -LRB- denotes [
T12952 31824-31832 NN denotes programs
T12951 31808-31823 NN denotes differentiation
T12950 31798-31807 NN denotes cartilage
T12949 31794-31797 CC denotes and
T12948 31792-31793 -COMMA- denotes ,
T12947 31791-31792 -RRB- denotes ]
T12946 31789-31791 CD denotes 11
T12945 31788-31789 -LRB- denotes [
T12944 31777-31787 JJ denotes astrocytic
T12943 31775-31776 -COMMA- denotes ,
T12942 31774-31775 -RRB- denotes ]
T12941 31772-31774 CD denotes 10
T12940 31771-31772 -LRB- denotes [
T12939 31762-31770 JJ denotes neuronal
T12938 31760-31761 -COMMA- denotes ,
T12937 31759-31760 -RRB- denotes ]
T12936 31757-31759 CD denotes 15
T12935 31756-31757 -LRB- denotes [
T12934 31748-31755 JJ denotes cardiac
T12933 31745-31747 IN denotes in
T12932 31738-31744 NN denotes factor
T12931 31728-31737 JJ denotes important
T12930 31725-31727 DT denotes an
T12929 31722-31724 VB denotes be
T12928 31719-31721 TO denotes to
T12927 31713-31718 VB denotes shown
T12926 31708-31712 VB denotes been
T12925 31704-31707 VB denotes has
T12924 31701-31703 PRP denotes it
T12923 31698-31700 IN denotes as
T12922 31696-31697 -COMMA- denotes ,
T12921 31681-31696 NN denotes differentiation
T12920 31672-31680 JJ denotes terminal
T12919 31667-31671 NN denotes cell
T12918 31663-31666 JJ denotes red
T12917 31660-31662 IN denotes in
T12916 31655-31659 NN denotes role
T12915 31653-31654 DT denotes a
T12914 31648-31652 VB denotes play
T12913 31644-31647 MD denotes may
T12912 31637-31643 PRP denotes itself
T12911 31632-31636 NN denotes Sox6
T12910 31630-31631 -COMMA- denotes ,
T12909 31617-31630 RB denotes Alternatively
T12908 31610-31615 NN denotes cells
T12907 31606-31609 JJ denotes red
T12906 31596-31605 JJ denotes nucleated
T12905 31593-31595 IN denotes of
T12904 31586-31592 NN denotes extent
T12903 31582-31585 DT denotes the
T12902 31574-31581 VB denotes explain
T12901 31571-31573 TO denotes to
T12900 31560-31570 JJ denotes sufficient
T12899 31556-31559 RB denotes not
T12898 31547-31555 RB denotes probably
T12897 31544-31546 VB denotes is
T12896 31537-31543 NN denotes anemia
T12895 31532-31536 JJ denotes mild
T12894 31527-31531 DT denotes this
T12893 31523-31526 CC denotes and
T12892 31521-31522 -COMMA- denotes ,
T12891 31520-31521 -RRB- denotes )
T12890 31516-31520 NN denotes data
T12889 31504-31515 JJ denotes unpublished
T12888 31503-31504 -LRB- denotes (
T12887 31500-31502 NN denotes WT
T12886 31497-31499 IN denotes of
T12885 31492-31496 DT denotes that
T12884 31487-31491 IN denotes than
T12399 28794-28804 NN denotes expression
T12398 28789-28793 NN denotes Sox6
T12397 28786-28787 -RRB- denotes ]
T12396 28784-28786 CD denotes 40
T12395 28783-28784 -LRB- denotes [
T12394 28772-28782 NN denotes repressors
T12393 28766-28771 JJ denotes other
T12392 28763-28765 IN denotes of
T12391 28755-28762 NN denotes binding
T12390 28751-28754 DT denotes the
T12389 28738-28750 VB denotes facilitating
T12388 28736-28737 -COMMA- denotes ,
T12387 28733-28736 NN denotes DNA
T12386 28729-28732 DT denotes the
T12385 28726-28728 IN denotes of
T12384 28718-28725 VB denotes bending
T12383 28712-28717 VB denotes cause
T12382 28708-28711 CC denotes and
T12381 28706-28707 -RRB- denotes )
T12380 28704-28706 CD denotes II
T12379 28700-28703 CC denotes and
T12378 28698-28699 CD denotes I
T12377 28688-28697 NN denotes silencers
T12376 28687-28688 -LRB- denotes (
T12375 28677-28686 NN denotes silencers
T12374 28670-28676 NN denotes globin
T12373 28668-28669 NN denotes β
T12372 28662-28667 JJ denotes adult
T12371 28656-28661 JJ denotes human
T12370 28652-28655 DT denotes the
T12369 28649-28651 TO denotes to
T12368 28644-28648 VB denotes bind
T12367 28641-28643 TO denotes to
T12366 28628-28640 VB denotes demonstrated
T12365 28623-28627 VB denotes were
T12364 28621-28622 -COMMA- denotes ,
T12363 28616-28621 NN denotes HMG-Y
T12362 28612-28615 CC denotes and
T12361 28606-28611 NN denotes HMG-I
T12360 28604-28605 -COMMA- denotes ,
T12359 28603-28604 -RRB- denotes )
T12358 28596-28603 NN denotes factors
T12357 28582-28595 NN denotes transcription
T12356 28579-28581 IN denotes of
T12355 28572-28578 NN denotes family
T12354 28568-28571 NN denotes Sox
T12353 28564-28567 DT denotes the
T12352 28561-28563 TO denotes to
T12351 28553-28560 VB denotes related
T12350 28543-28552 RB denotes distantly
T12349 28542-28543 -LRB- denotes (
T12348 28533-28541 NN denotes proteins
T12347 28519-28532 JJ denotes architectural
T12346 28515-28518 NN denotes HMG
T12345 28511-28514 CD denotes Two
T12344 28508-28509 -RRB- denotes ]
T12343 28506-28508 CD denotes 39
T12342 28505-28506 -LRB- denotes [
T12341 28496-28504 NN denotes promoter
T12340 28493-28495 JJ denotes ɛy
T12339 28489-28492 DT denotes the
T12338 28486-28488 TO denotes to
T12337 28478-28485 VB denotes binding
T12336 28475-28477 IN denotes in
T12335 28473-28474 -COMMA- denotes ,
T12334 28464-28473 NN denotes activator
T12333 28461-28463 DT denotes an
T12332 28459-28460 -COMMA- denotes ,
T12331 28455-28459 NN denotes EKLF
T12330 28450-28454 IN denotes with
T12329 28439-28449 VB denotes interferes
T12328 28434-28438 VB denotes DRED
T12327 28428-28432 VB denotes DRED
T12326 28425-28427 VB denotes is
T12325 28416-28424 NN denotes promoter
T12324 28413-28415 JJ denotes ɛy
T12323 28409-28412 DT denotes the
T12322 28406-28408 IN denotes on
T12321 28396-28405 NN denotes activator
T12320 28393-28395 DT denotes an
T12319 28388-28392 IN denotes with
T12318 28377-28387 VB denotes interferes
T12317 28372-28376 WDT denotes that
T12316 28362-28371 NN denotes repressor
T12315 28360-28361 DT denotes a
T12314 28357-28359 IN denotes of
T12313 28349-28356 NN denotes example
T12312 28341-28348 DT denotes Another
T12311 28329-28339 NN denotes repressors
T12310 28323-28328 JJ denotes other
T12309 28320-28322 IN denotes of
T12308 28312-28319 NN denotes binding
T12307 28301-28311 VB denotes facilitate
T12306 28298-28300 CC denotes or
T12305 28289-28297 NN denotes promoter
T12304 28285-28288 DT denotes the
T12303 28282-28284 TO denotes to
T12302 28271-28281 NN denotes activators
T12301 28265-28270 JJ denotes other
T12300 28262-28264 IN denotes of
T12299 28254-28261 NN denotes binding
T12245 27895-27903 JJ denotes four-way
T12244 27892-27894 TO denotes to
T12243 27887-27891 VB denotes bind
T12242 27882-27886 RB denotes also
T12241 27878-27881 MD denotes can
T12240 27874-27877 CC denotes and
T12239 27872-27873 -COMMA- denotes ,
T12238 27866-27872 NN denotes groove
T12237 27860-27865 JJ denotes minor
T12236 27856-27859 DT denotes the
T12235 27853-27855 IN denotes in
T12234 27839-27852 NN denotes intercalation
T12233 27831-27838 JJ denotes partial
T12232 27828-27830 IN denotes by
T12231 27824-27827 NN denotes DNA
T12230 27817-27823 JJ denotes linear
T12229 27812-27816 VB denotes bend
T12228 27808-27811 CC denotes and
T12227 27803-27807 VB denotes bind
T12226 27794-27802 NN denotes proteins
T12225 27790-27793 NN denotes Sox
T12224 27778-27788 NN denotes repression
T12223 27775-27777 IN denotes of
T12222 27765-27774 NN denotes mechanism
T12221 27761-27764 PRP-DOLLAR- denotes its
T12220 27758-27760 IN denotes on
T12219 27752-27757 NN denotes light
T12218 27747-27751 VB denotes shed
T12217 27742-27746 MD denotes will
T12216 27733-27741 NN denotes promoter
T12215 27730-27732 JJ denotes ɛy
T12214 27726-27729 DT denotes the
T12213 27721-27725 IN denotes with
T12212 27710-27720 VB denotes associated
T12211 27702-27709 NN denotes complex
T12210 27686-27701 JJ denotes Sox6-containing
T12209 27682-27685 DT denotes the
T12208 27679-27681 IN denotes of
T12207 27668-27678 NN denotes components
T12206 27662-27667 JJ denotes other
T12205 27659-27661 IN denotes of
T12204 27644-27658 NN denotes Identification
T12203 27635-27642 NN denotes complex
T12202 27624-27634 NN denotes repression
T12201 27618-27623 JJ denotes large
T12200 27616-27617 DT denotes a
T12199 27611-27615 VB denotes form
T12198 27607-27610 CC denotes and
T12197 27599-27606 NN denotes factors
T12196 27593-27598 DT denotes these
T12195 27588-27592 IN denotes with
T12194 27579-27587 VB denotes interact
T12193 27573-27578 MD denotes might
T12192 27568-27572 NN denotes Sox6
T12191 27565-27566 -RRB- denotes ]
T12190 27563-27565 CD denotes 38
T12189 27562-27563 -LRB- denotes [
T12188 27554-27561 NN denotes COUP-TF
T12187 27550-27553 CC denotes and
T12186 27548-27549 -RRB- denotes ]
T12185 27546-27548 CD denotes 37
T12184 27545-27546 -LRB- denotes [
T12183 27537-27544 NN denotes complex
T12182 27532-27536 JJ denotes DRED
T12181 27528-27531 DT denotes the
T12180 27518-27527 VB denotes including
T12179 27516-27517 -COMMA- denotes ,
T12178 27511-27516 NN denotes sites
T12177 27501-27510 NN denotes consensus
T12176 27492-27500 NN denotes Sox/Sox6
T12175 27488-27491 DT denotes the
T12174 27483-27487 IN denotes near
T12173 27473-27482 NN denotes sequences
T12172 27469-27472 NN denotes DNA
T12171 27466-27468 TO denotes to
T12170 27461-27465 VB denotes bind
T12169 27458-27460 TO denotes to
T12168 27449-27457 VB denotes reported
T12167 27444-27448 VB denotes been
T12166 27439-27443 VB denotes have
T12165 27428-27438 NN denotes repressors
T12164 27421-27427 NN denotes globin
T12163 27418-27420 JJ denotes ɛy
T12162 27412-27417 JJ denotes other
T12161 27408-27411 JJ denotes few
T12160 27406-27407 DT denotes A
T12159 27397-27404 NN denotes complex
T12158 27390-27396 NN denotes weight
T12157 27380-27389 JJ denotes molecular
T12156 27375-27379 JJ denotes high
T12155 27373-27374 DT denotes a
T12154 27370-27372 IN denotes of
T12153 27365-27369 NN denotes part
T12152 27362-27364 VB denotes is
T12151 27357-27361 NN denotes Sox6
T12150 27352-27356 IN denotes that
T12149 27341-27351 VB denotes suggesting
T12148 27339-27340 -COMMA- denotes ,
T12147 27335-27339 NN denotes band
T12146 27319-27334 JJ denotes Sox6-associated
T12145 27315-27318 DT denotes the
T12144 27308-27314 VB denotes detect
T12143 27305-27307 TO denotes to
T12142 27303-27304 NN denotes h
T12141 27299-27302 CD denotes 4–8
T12140 27293-27298 JJ denotes least
T12139 27290-27292 IN denotes at
T12138 27286-27289 IN denotes for
T12137 27282-27285 NN denotes gel
T12136 27280-27281 NN denotes %
T12135 27278-27280 CD denotes –6
T12134 27277-27278 NN denotes %
T12133 27276-27277 CD denotes 4
T12132 27274-27275 DT denotes a
T12131 27271-27273 IN denotes on
T12667 30267-30271 VB denotes have
T12666 30262-30266 NN denotes None
T12665 30254-30260 RB denotes longer
T12664 30246-30253 NN denotes survive
T12663 30242-30245 JJ denotes few
T12662 30237-30241 JJ denotes rare
T12661 30235-30236 DT denotes a
T12660 30233-30234 -COMMA- denotes ,
T12659 30229-30233 VB denotes born
T12658 30223-30228 VB denotes being
T12657 30217-30222 IN denotes after
T12656 30212-30216 RB denotes just
T12655 30208-30211 VB denotes die
T12654 30203-30207 NN denotes mice
T12653 30196-30202 JJ denotes mutant
T12652 30190-30195 NN denotes p100H
T12651 30185-30189 JJ denotes most
T12650 30176-30184 IN denotes Although
T12649 30172-30174 NN denotes ɛy
T12648 30162-30171 VB denotes silencing
T12647 30159-30161 IN denotes in
T12646 30154-30158 NN denotes role
T12645 30145-30153 JJ denotes specific
T12644 30143-30144 DT denotes a
T12643 30140-30142 TO denotes to
T12642 30131-30139 NN denotes addition
T12641 30128-30130 IN denotes in
T12640 30126-30127 -RRB- denotes )
T12639 30116-30126 NN denotes maturation
T12638 30104-30115 NN denotes erythrocyte
T12637 30100-30103 CC denotes and
T12636 30099-30100 -LRB- denotes (
T12635 30093-30098 NN denotes genes
T12634 30086-30092 NN denotes globin
T12633 30076-30085 JJ denotes embryonic
T12632 30073-30075 IN denotes on
T12631 30066-30072 NN denotes effect
T12630 30058-30065 JJ denotes general
T12629 30056-30057 DT denotes a
T12628 30052-30055 VB denotes has
T12627 30047-30051 NN denotes Sox6
T12626 30042-30046 IN denotes that
T12625 30033-30041 JJ denotes possible
T12624 30030-30032 VB denotes is
T12623 30027-30029 PRP denotes It
T12622 30022-30025 NN denotes βh1
T12621 30018-30021 CC denotes and
T12620 30016-30017 NN denotes ζ
T12619 30011-30015 IN denotes than
T12618 29999-30010 RB denotes differently
T12617 29989-29998 VB denotes regulated
T12616 29986-29988 VB denotes is
T12615 29983-29985 NN denotes ɛy
T12614 29978-29982 IN denotes that
T12613 29967-29977 VB denotes suggesting
T12612 29965-29966 -COMMA- denotes ,
T12611 29964-29965 -RRB- denotes )
T12610 29963-29964 CD denotes 1
T12609 29956-29962 NN denotes Figure
T12608 29955-29956 -LRB- denotes (
T12607 29951-29954 NN denotes dpc
T12606 29946-29950 CD denotes 18.5
T12605 29942-29945 NN denotes day
T12604 29939-29941 IN denotes by
T12603 29928-29938 NN denotes expression
T12602 29925-29927 IN denotes in
T12601 29917-29924 NN denotes decline
T12600 29913-29916 NN denotes βh1
T12599 29909-29912 CC denotes and
T12598 29907-29908 NN denotes ζ
T12597 29905-29906 -COMMA- denotes ,
T12596 29899-29905 NN denotes globin
T12595 29896-29898 JJ denotes ɛy
T12594 29889-29895 IN denotes unlike
T12593 29887-29888 -COMMA- denotes ,
T12592 29880-29887 RB denotes However
T12591 29875-29878 NN denotes dpc
T12590 29870-29874 CD denotes 15.5
T12589 29867-29869 IN denotes at
T12588 29862-29866 NN denotes mice
T12587 29855-29861 JJ denotes mutant
T12586 29852-29854 IN denotes in
T12585 29845-29851 JJ denotes higher
T12584 29832-29844 RB denotes dramatically
T12583 29828-29831 VB denotes are
T12582 29824-29827 NN denotes βh1
T12581 29820-29823 CC denotes and
T12580 29818-29819 NN denotes ζ
T12579 29815-29817 IN denotes of
T12578 29808-29814 NN denotes levels
T12577 29806-29807 -COMMA- denotes ,
T12576 29804-29806 NN denotes ɛy
T12575 29799-29803 IN denotes Like
T12574 29795-29797 NN denotes WT
T12573 29790-29794 IN denotes with
T12572 29781-29789 VB denotes compared
T12571 29779-29780 -COMMA- denotes ,
T12570 29768-29779 NN denotes homozygotes
T12569 29762-29767 NN denotes p100H
T12568 29759-29761 IN denotes in
T12567 29752-29758 JJ denotes higher
T12566 29747-29751 RB denotes also
T12565 29743-29746 VB denotes are
T12564 29741-29742 -RRB- denotes )
T12563 29738-29741 NN denotes βh1
T12562 29734-29737 CC denotes and
T12561 29732-29733 NN denotes ζ
T12560 29731-29732 -LRB- denotes (
T12559 29725-29730 NN denotes genes
T12558 29718-29724 NN denotes globin
T12557 29708-29717 JJ denotes embryonic
T12556 29702-29707 JJ denotes other
T12555 29698-29701 CD denotes two
T12554 29695-29697 IN denotes of
T12553 29688-29694 NN denotes levels
T12552 29677-29687 NN denotes expression
T12551 29673-29676 DT denotes The
T12550 29667-29671 NN denotes mice
T12549 29660-29666 JJ denotes mutant
T12548 29649-29659 JJ denotes homozygous
T12547 29646-29648 IN denotes in
T12546 29639-29645 JJ denotes robust
T12545 29633-29638 RB denotes quite
T12544 29630-29632 VB denotes is
T12543 29625-29629 NN denotes gene
T12542 29618-29624 NN denotes globin
T12541 29615-29617 JJ denotes ɛy
T12540 29611-29614 DT denotes the
T12539 29608-29610 IN denotes of
T12538 29597-29607 NN denotes expression
T12537 29589-29596 JJ denotes ectopic
T12536 29584-29588 IN denotes that
T12535 29571-29583 VB denotes demonstrates
T12534 29566-29570 DT denotes This
T12533 29563-29564 -RRB- denotes )
T12532 29562-29563 CD denotes 1
T12531 29555-29561 NN denotes Figure
T12530 29554-29555 -LRB- denotes (
T12529 29549-29553 NN denotes mice
T12528 29546-29548 JJ denotes WT
T12527 29535-29545 JJ denotes homozygous
T12526 29526-29534 JJ denotes 18.5-dpc
T12525 29522-29525 CC denotes and
T12524 29513-29521 NN denotes 15.5-dpc
T12523 29510-29512 IN denotes of
T12522 29503-29509 NN denotes livers
T12521 29499-29502 DT denotes the
T12520 29496-29498 IN denotes in
T12519 29485-29495 NN denotes expression
T12518 29476-29484 NN denotes βmaj/min
T12517 29473-29475 IN denotes of
T12516 29467-29472 NN denotes level
T12515 29463-29466 DT denotes the
T12130 27255-27270 NN denotes electrophoresis
T12129 27251-27254 DT denotes the
T12128 27247-27250 VB denotes run
T12127 27244-27246 TO denotes to
T12126 27240-27243 VB denotes had
T12125 27237-27239 PRP denotes we
T12124 27235-27236 -COMMA- denotes ,
T12123 27230-27235 NN denotes EMSAs
T12122 27226-27229 PRP-DOLLAR- denotes our
T12121 27223-27225 IN denotes In
T12120 27220-27221 -RRB- denotes ]
T12119 27218-27220 CD denotes 36
T12118 27217-27218 -LRB- denotes [
T12117 27209-27216 NN denotes factors
T12116 27195-27208 NN denotes transcription
T12115 27189-27194 JJ denotes other
T12114 27184-27188 IN denotes with
T12113 27171-27183 NN denotes interactions
T12112 27166-27170 IN denotes upon
T12111 27161-27165 VB denotes rely
T12110 27158-27160 TO denotes to
T12109 27150-27157 VB denotes thought
T12108 27147-27149 VB denotes is
T12107 27139-27146 NN denotes actions
T12106 27133-27138 PRP-DOLLAR- denotes their
T12105 27130-27132 IN denotes of
T12104 27118-27129 NN denotes specificity
T12103 27114-27117 DT denotes the
T12102 27112-27113 -COMMA- denotes ,
T12101 27102-27112 NN denotes degeneracy
T12100 27089-27101 JJ denotes considerable
T12099 27085-27088 IN denotes for
T12098 27078-27084 VB denotes allows
T12097 27073-27077 WDT denotes that
T12096 27064-27072 NN denotes sequence
T12095 27051-27063 JJ denotes core-binding
T12094 27046-27050 JJ denotes 6-bp
T12093 27040-27045 JJ denotes short
T12092 27038-27039 DT denotes a
T12091 27028-27037 VB denotes recognize
T12090 27019-27027 NN denotes proteins
T12089 27015-27018 NN denotes Sox
T12088 27007-27014 IN denotes Because
T12087 26997-27005 NN denotes proteins
T12086 26993-26996 NN denotes Sox
T12085 26987-26992 JJ denotes other
T12084 26982-26986 IN denotes with
T12083 26970-26981 NN denotes heterodimer
T12082 26968-26969 DT denotes a
T12081 26965-26967 IN denotes as
T12080 26962-26964 CC denotes or
T12079 26952-26961 NN denotes homodimer
T12078 26950-26951 DT denotes a
T12077 26947-26949 IN denotes as
T12076 26940-26946 CC denotes either
T12075 26931-26939 NN denotes promoter
T12074 26928-26930 JJ denotes ɛy
T12073 26924-26927 DT denotes the
T12072 26921-26923 IN denotes of
T12071 26912-26920 NN denotes sequence
T12070 26907-26911 DT denotes this
T12069 26904-26906 TO denotes to
T12068 26898-26903 VB denotes binds
T12067 26893-26897 NN denotes Sox6
T12066 26888-26892 IN denotes that
T12065 26880-26887 VB denotes suggest
T12064 26867-26879 NN denotes observations
T12063 26861-26866 DT denotes These
T12062 26858-26859 -RRB- denotes )
T12061 26856-26858 NN denotes 3F
T12060 26852-26855 CC denotes and
T12059 26849-26851 NN denotes 3E
T12058 26842-26848 NN denotes Figure
T12057 26841-26842 -LRB- denotes (
T12056 26832-26840 NN denotes activity
T12055 26828-26831 PRP-DOLLAR- denotes its
T12054 26825-26827 IN denotes of
T12053 26814-26824 NN denotes repression
T12052 26810-26813 CC denotes and
T12051 26801-26809 NN denotes promoter
T12050 26798-26800 JJ denotes ɛy
T12049 26794-26797 DT denotes the
T12048 26791-26793 TO denotes to
T12047 26783-26790 NN denotes binding
T12046 26778-26782 NN denotes Sox6
T12045 26774-26777 IN denotes for
T12044 26764-26773 JJ denotes essential
T12043 26760-26763 VB denotes are
T12042 26754-26759 NN denotes sites
T12041 26749-26753 DT denotes both
T12040 26747-26748 -COMMA- denotes ,
T12039 26735-26747 RB denotes Functionally
T12038 26732-26733 -RRB- denotes )
T12037 26730-26732 NN denotes 3A
T12036 26723-26729 NN denotes Figure
T12035 26722-26723 -LRB- denotes (
T12034 26716-26721 NN denotes sites
T12033 26706-26715 NN denotes consensus
T12032 26697-26705 NN denotes Sox/Sox6
T12031 26693-26696 CD denotes two
T12030 26684-26692 VB denotes contains
T11998 26498-26504 VB denotes harbor
T11997 26489-26497 RB denotes probably
T11996 26487-26488 -COMMA- denotes ,
T11995 26483-26487 NN denotes Sox6
T11994 26480-26482 IN denotes as
T11993 26475-26479 JJ denotes such
T11992 26473-26474 -COMMA- denotes ,
T11991 26465-26473 NN denotes proteins
T11990 26461-26464 NN denotes Sox
T11989 26459-26460 NN denotes D
T11988 26453-26458 NN denotes group
T11987 26449-26452 IN denotes for
T11986 26443-26448 NN denotes genes
T11985 26436-26442 NN denotes target
T11984 26431-26435 IN denotes that
T11983 26423-26430 VB denotes appears
T11982 26420-26422 PRP denotes it
T11981 26418-26419 -COMMA- denotes ,
T11980 26409-26418 RB denotes Therefore
T11979 26406-26407 -RRB- denotes ]
T11978 26405-26406 CD denotes 5
T11977 26404-26405 -LRB- denotes [
T11976 26398-26403 NN denotes motif
T11975 26390-26397 NN denotes HMG-box
T11974 26383-26389 JJ denotes single
T11973 26381-26382 DT denotes a
T11972 26378-26380 TO denotes to
T11971 26373-26377 IN denotes than
T11970 26367-26372 NN denotes motif
T11969 26361-26366 NN denotes dimer
T11968 26353-26360 NN denotes HMG-box
T11967 26350-26352 DT denotes an
T11966 26347-26349 TO denotes to
T11965 26338-26346 RB denotes strongly
T11964 26333-26337 RB denotes more
T11963 26327-26332 VB denotes binds
T11962 26322-26326 NN denotes Sox6
T11961 26320-26321 -COMMA- denotes ,
T11960 26312-26320 NN denotes addition
T11959 26309-26311 IN denotes In
T11958 26306-26307 -RRB- denotes ]
T11957 26305-26306 CD denotes 6
T11956 26304-26305 -LRB- denotes [
T11955 26298-26303 NN denotes sites
T11954 26294-26297 NN denotes Sox
T11953 26285-26293 JJ denotes adjacent
T11952 26276-26284 VB denotes contains
T11951 26271-26275 WDT denotes that
T11950 26267-26270 NN denotes DNA
T11949 26264-26266 TO denotes to
T11948 26255-26263 NN denotes proteins
T11947 26251-26254 NN denotes Sox
T11946 26247-26250 CD denotes two
T11945 26243-26246 DT denotes the
T11944 26240-26242 IN denotes of
T11943 26229-26239 NN denotes efficiency
T11942 26221-26228 VB denotes binding
T11941 26217-26220 DT denotes the
T11940 26208-26216 VB denotes increase
T11939 26200-26207 RB denotes greatly
T11938 26197-26199 TO denotes to
T11937 26191-26196 VB denotes shown
T11936 26186-26190 VB denotes been
T11935 26182-26185 VB denotes has
T11934 26177-26181 NN denotes Sox6
T11933 26173-26176 CC denotes and
T11932 26168-26172 NN denotes Sox5
T11931 26165-26167 IN denotes of
T11930 26152-26164 NN denotes dimerization
T11929 26150-26151 -COMMA- denotes ,
T11928 26138-26150 RB denotes Functionally
T11927 26135-26136 -RRB- denotes ]
T11926 26131-26135 CD denotes 6,35
T11925 26130-26131 -LRB- denotes [
T11924 26111-26129 NN denotes heterodimerization
T11923 26107-26110 CC denotes and
T11922 26101-26106 JJ denotes homo-
T11921 26092-26100 VB denotes mediates
T11920 26087-26091 WDT denotes that
T11919 26080-26086 NN denotes domain
T11918 26066-26079 JJ denotes coiled–coiled
T11917 26064-26065 DT denotes a
T11916 26056-26063 VB denotes contain
T11915 26047-26055 NN denotes proteins
T11914 26043-26046 NNP denotes Sox
T11913 26041-26042 NNP denotes D
T11912 26035-26040 NNP denotes Group
T11911 26032-26033 -RRB- denotes ]
T11910 26030-26032 CD denotes 34
T11909 26029-26030 -LRB- denotes [
T11908 26026-26028 CD denotes 23
T11907 26022-26025 CC denotes and
T11906 26020-26021 -COMMA- denotes ,
T11905 26018-26020 CD denotes 13
T11904 26016-26017 -COMMA- denotes ,
T11903 26014-26016 CD denotes 12
T11902 26012-26013 -COMMA- denotes ,
T11901 26008-26012 NN denotes Sox5
T11900 25999-26007 VB denotes includes
T11899 25994-25998 WDT denotes that
T11898 25985-25993 NN denotes proteins
T11897 25982-25984 IN denotes of
T11896 25975-25981 NN denotes family
T11895 25971-25974 NNP denotes Sox
T11894 25967-25970 DT denotes the
T11893 25964-25966 IN denotes of
T11892 25962-25963 NN denotes D
T11891 25956-25961 NN denotes group
T11890 25953-25955 TO denotes to
T11889 25945-25952 VB denotes belongs
T11888 25940-25944 NN denotes Sox6
T11887 25924-25938 NN denotes erythropoiesis
T11886 25913-25923 JJ denotes definitive
T11885 25910-25912 IN denotes in
T11884 25905-25909 NN denotes gene
T12298 28249-28253 IN denotes with
T12297 28239-28248 VB denotes interfere
T12296 28232-28238 RB denotes either
T12295 28226-28231 MD denotes could
T12294 28221-28225 NN denotes Sox6
T12293 28219-28220 -COMMA- denotes ,
T12292 28210-28219 NN denotes structure
T12291 28200-28209 NN denotes chromatin
T12290 28194-28199 JJ denotes local
T12289 28190-28193 DT denotes the
T12288 28181-28189 VB denotes changing
T12287 28178-28180 IN denotes By
T12286 28167-28176 NN denotes complexes
T12285 28151-28166 JJ denotes transcriptional
T12284 28138-28150 NN denotes multiprotein
T12283 28127-28137 VB denotes assembling
T12282 28124-28126 IN denotes by
T12281 28120-28123 CC denotes and
T12280 28116-28119 NN denotes DNA
T12279 28108-28115 VB denotes bending
T12278 28105-28107 IN denotes by
T12277 28095-28104 NN denotes structure
T12276 28085-28094 NN denotes chromatin
T12275 28079-28084 JJ denotes local
T12274 28067-28078 VB denotes influencing
T12273 28065-28066 -COMMA- denotes ,
T12272 28062-28065 NN denotes DNA
T12271 28059-28061 TO denotes to
T12270 28053-28058 VB denotes bound
T12269 28045-28052 NN denotes factors
T12268 28031-28044 JJ denotes architectural
T12267 28028-28030 IN denotes as
T12266 28019-28027 VB denotes function
T12265 28014-28018 PRP denotes they
T12264 28009-28013 IN denotes that
T12263 28006-28008 VB denotes is
T12262 27995-28005 NN denotes expression
T12261 27990-27994 NN denotes gene
T12260 27982-27989 VB denotes control
T12259 27973-27981 NN denotes proteins
T12258 27968-27972 NN denotes Sox6
T12257 27964-27967 WRB denotes how
T12256 27956-27963 VB denotes explain
T12255 27953-27955 TO denotes to
T12254 27947-27952 NN denotes model
T12253 27936-27946 JJ denotes attractive
T12252 27932-27935 CD denotes one
T12251 27930-27931 -COMMA- denotes ,
T12250 27921-27930 RB denotes Therefore
T12249 27918-27919 -RRB- denotes ]
T12248 27915-27918 CD denotes 2–4
T12247 27914-27915 -LRB- denotes [
T12246 27904-27913 NN denotes junctions
T11883 25895-25904 JJ denotes ɛy-globin
T11882 25891-25894 DT denotes the
T11881 25881-25890 VB denotes represses
T11880 25877-25880 CC denotes and
T11879 25872-25876 NN denotes gene
T11878 25869-25871 JJ denotes ɛy
T11877 25866-25868 IN denotes of
T11876 25857-25865 NN denotes promoter
T11875 25848-25856 JJ denotes proximal
T11874 25844-25847 DT denotes the
T11873 25841-25843 TO denotes to
T11872 25835-25840 VB denotes binds
T11871 25831-25834 CC denotes and
T11870 25821-25830 VB denotes regulates
T11869 25812-25820 RB denotes directly
T11868 25807-25811 NN denotes Sox6
T11867 25801-25805 NN denotes gene
T11866 25794-25800 NN denotes globin
T11865 25791-25793 JJ denotes ɛy
T11864 25787-25790 DT denotes the
T11863 25784-25786 IN denotes of
T11862 25771-25783 NN denotes upregulation
T11861 25760-25770 JJ denotes persistent
T11860 25758-25759 DT denotes a
T11859 25754-25757 CC denotes and
T11858 25752-25753 -COMMA- denotes ,
T11857 25749-25752 NN denotes βH1
T11856 25745-25748 CC denotes and
T11855 25743-25744 NN denotes ζ
T11854 25741-25742 -COMMA- denotes ,
T11853 25736-25741 NN denotes genes
T11852 25729-25735 NN denotes globin
T11851 25719-25728 JJ denotes embryonic
T11850 25715-25718 DT denotes the
T11849 25712-25714 IN denotes on
T11848 25705-25711 NN denotes effect
T11847 25695-25704 JJ denotes transient
T11846 25693-25694 DT denotes a
T11845 25690-25692 VB denotes is
T11844 25684-25689 EX denotes there
T11843 25682-25683 -COMMA- denotes ,
T11842 25677-25682 NN denotes mouse
T11841 25672-25676 JJ denotes null
T11840 25667-25671 NN denotes Sox6
T11839 25663-25666 DT denotes the
T11838 25660-25662 IN denotes In
T11837 25653-25658 NN denotes genes
T11836 25646-25652 NN denotes globin
T11835 25643-25645 IN denotes of
T11834 25633-25642 NN denotes mechanism
T11833 25622-25632 NN denotes regulation
T11832 25610-25621 VB denotes complicated
T11831 25606-25609 DT denotes the
T11830 25603-25605 IN denotes in
T11829 25596-25602 NN denotes factor
T11828 25590-25595 JJ denotes novel
T11827 25588-25589 DT denotes a
T11826 25585-25587 VB denotes is
T11825 25580-25584 NN denotes Sox6
T11824 25575-25579 IN denotes that
T11823 25570-25574 VB denotes show
T11822 25567-25569 PRP denotes we
T11821 25565-25566 -COMMA- denotes ,
T11820 25559-25565 NN denotes report
T11819 25554-25558 DT denotes this
T11818 25551-25553 IN denotes In
T12029 26675-26683 NN denotes promoter
T12028 26672-26674 JJ denotes ɛy
T12027 26668-26671 DT denotes the
T12026 26665-26667 IN denotes of
T12025 26656-26664 NN denotes sequence
T12024 26649-26655 NN denotes target
T12023 26644-26648 NN denotes Sox6
T12022 26636-26643 VB denotes defined
T12021 26632-26635 DT denotes the
T12020 26630-26631 -COMMA- denotes ,
T12019 26625-26630 NN denotes study
T12018 26617-26624 JJ denotes present
T12017 26613-26616 DT denotes the
T12016 26610-26612 IN denotes in
T12015 26608-26609 -COMMA- denotes ,
T12014 26602-26608 RB denotes Indeed
T12013 26594-26600 NN denotes dimers
T12012 26586-26593 NN denotes protein
T12011 26580-26585 NN denotes D-Sox
T12010 26577-26579 IN denotes of
T12009 26569-26576 NN denotes binding
T12008 26564-26568 IN denotes with
T12007 26553-26563 JJ denotes compatible
T12006 26539-26552 NN denotes configuration
T12005 26537-26538 DT denotes a
T12004 26532-26536 IN denotes with
T12003 26526-26531 NN denotes sites
T12002 26518-26525 NN denotes binding
T12001 26514-26517 NN denotes HMG
T12000 26511-26513 IN denotes of
T11999 26505-26510 NN denotes pairs
T4724 9548-9556 RB denotes somewhat
T10029 23452-23466 NN denotes erythropoiesis
T10028 23441-23451 JJ denotes definitive
T10027 23438-23440 IN denotes in
T10026 23428-23437 NN denotes functions
T10025 23423-23427 NN denotes Sox6
T10024 23418-23422 IN denotes that
T10023 23406-23417 VB denotes demonstrate
T10022 23404-23405 -COMMA- denotes ,
T10021 23403-23404 -RRB- denotes )
T10020 23402-23403 CD denotes 5
T10019 23395-23401 NN denotes Figure
T10018 23394-23395 -LRB- denotes (
T10017 23389-23393 NN denotes mice
T10016 23382-23388 JJ denotes mutant
T10015 23376-23381 NN denotes p100H
T10014 23367-23375 JJ denotes 14.5-dpc
T10013 23364-23366 IN denotes of
T10012 23358-23363 NN denotes cells
T10011 23352-23357 NN denotes liver
T10010 23348-23351 DT denotes the
T10009 23345-23347 IN denotes in
T10008 23335-23344 VB denotes expressed
T10007 23328-23334 RB denotes highly
T10006 23325-23327 VB denotes is
T10005 23318-23324 NN denotes globin
T10004 23315-23317 JJ denotes ɛy
T10003 23310-23314 IN denotes that
T10002 23298-23309 NN denotes observation
T10001 23294-23297 DT denotes the
T10000 23289-23293 IN denotes with
T9999 23280-23288 RB denotes together
T9998 23274-23279 VB denotes taken
T9997 23272-23273 -COMMA- denotes ,
T9996 23268-23272 NN denotes data
T9995 23262-23267 DT denotes These
T10498 25221-25231 NN denotes maturation
T10497 25216-25220 NN denotes cell
T10496 25212-25215 JJ denotes red
T10495 25205-25211 VB denotes affect
T10494 25201-25204 MD denotes may
T10493 25196-25200 NN denotes Sox6
T10492 25194-25195 -COMMA- denotes ,
T10491 25190-25194 NN denotes gene
T10490 25183-25189 NN denotes globin
T10489 25180-25182 JJ denotes ɛy
T10488 25176-25179 DT denotes the
T10487 25166-25175 VB denotes silencing
T10486 25158-25165 IN denotes besides
T10485 25153-25157 IN denotes that
T10484 25145-25152 VB denotes suggest
T10483 25132-25144 NN denotes observations
T10482 25126-25131 DT denotes These
T10481 25121-25124 NN denotes dpc
T10480 25116-25120 CD denotes 14.5
T10479 25113-25115 IN denotes as
T10478 25107-25112 RB denotes early
T10477 25104-25106 RB denotes as
T10476 25098-25103 VB denotes noted
T10475 25095-25097 VB denotes is
T10474 25084-25094 NN denotes alteration
T10473 25079-25083 DT denotes This
T10472 25076-25077 -RRB- denotes )
T10471 25074-25076 NN denotes 7B
T10470 25067-25073 NN denotes Figure
T10469 25066-25067 -LRB- denotes (
T10468 25062-25065 NN denotes dpc
T10467 25057-25061 CD denotes 18.5
T10466 25054-25056 IN denotes at
T10465 25041-25053 NN denotes erythrocytes
T10464 25031-25040 JJ denotes nucleated
T10463 25021-25030 VB denotes including
T10462 25015-25020 NN denotes cells
T10461 25005-25014 NN denotes precursor
T10460 24991-25004 JJ denotes hematopoietic
T10459 24988-24990 IN denotes in
T10458 24979-24987 NN denotes increase
T10457 24967-24978 JJ denotes significant
T10456 24965-24966 DT denotes a
T10455 24959-24964 VB denotes shows
T10454 24953-24958 NN denotes liver
T10453 24946-24952 JJ denotes mutant
T10452 24942-24945 DT denotes the
T10451 24940-24941 -COMMA- denotes ,
T10450 24932-24940 NN denotes addition
T10449 24929-24931 IN denotes In
T10448 24921-24927 NN denotes effect
T10447 24911-24920 JJ denotes transient
T10446 24909-24910 DT denotes a
T10445 24906-24908 VB denotes be
T10444 24902-24905 MD denotes may
T10443 24897-24901 DT denotes this
T10442 24892-24896 IN denotes that
T10441 24881-24891 VB denotes suggesting
T10440 24879-24880 -COMMA- denotes ,
T10439 24875-24879 NN denotes mice
T10438 24868-24874 JJ denotes mutant
T10437 24865-24867 CC denotes or
T10436 24862-24864 NN denotes WT
T10435 24855-24861 CC denotes either
T10434 24852-24854 IN denotes in
T10433 24846-24851 NN denotes cells
T10432 24842-24845 JJ denotes red
T10431 24832-24841 JJ denotes nucleated
T10430 24820-24831 VB denotes circulating
T10429 24816-24819 VB denotes see
T10428 24812-24815 RB denotes not
T10427 24809-24811 VB denotes do
T10426 24806-24808 PRP denotes we
T10425 24804-24805 -COMMA- denotes ,
T10424 24800-24804 CD denotes 10.5
T10423 24796-24799 NN denotes day
T10422 24786-24795 JJ denotes postnatal
T10421 24783-24785 IN denotes at
T10420 24781-24782 -COMMA- denotes ,
T10419 24774-24781 RB denotes However
T10418 24771-24772 -RRB- denotes )
T10417 24769-24771 NN denotes 7A
T10416 24762-24768 NN denotes Figure
T10415 24761-24762 -LRB- denotes (
T10414 24757-24760 NN denotes dpc
T10413 24752-24756 CD denotes 18.5
T10412 24748-24751 CC denotes and
T10411 24744-24747 NN denotes dpc
T10410 24739-24743 CD denotes 14.5
T10409 24736-24738 IN denotes at
T10408 24731-24735 NN denotes mice
T10407 24728-24730 JJ denotes WT
T10406 24725-24727 IN denotes in
T10405 24720-24724 IN denotes than
T10404 24715-24719 NN denotes mice
T10403 24708-24714 JJ denotes mutant
T10402 24702-24707 NN denotes p100H
T10401 24699-24701 IN denotes in
T10400 24687-24698 VB denotes circulating
T10399 24681-24686 NN denotes cells
T10398 24675-24680 NN denotes blood
T10397 24671-24674 JJ denotes red
T10396 24661-24670 JJ denotes nucleated
T10395 24656-24660 RB denotes more
T10394 24652-24655 VB denotes are
T10393 24646-24651 EX denotes there
T10392 24641-24645 IN denotes that
T10391 24633-24640 VB denotes noticed
T10390 24628-24632 VB denotes have
T10389 24625-24627 PRP denotes we
T10388 24623-24624 -COMMA- denotes ,
T10387 24609-24623 NN denotes erythropoiesis
T10386 24606-24608 IN denotes in
T10385 24598-24605 NN denotes effects
T10384 24593-24597 NN denotes Sox6
T10383 24587-24592 JJ denotes other
T10382 24583-24586 DT denotes the
T10381 24577-24582 IN denotes Among
T10380 24571-24576 NNP denotes Cells
T10379 24567-24570 NNP denotes Red
T10378 24557-24566 NNP denotes Nucleated
T10377 24554-24556 IN denotes of
T10376 24546-24553 NNP denotes Numbers
T10375 24539-24545 NNP denotes Higher
T10374 24534-24538 NNP denotes Have
T10373 24529-24533 NNP denotes Mice
T10372 24523-24528 NN denotes p100H
T10371 24516-24522 JJ denotes Mutant
T9994 23246-23260 NN denotes erythropoiesis
T9993 23244-23245 -COMMA- denotes ,
T9992 23235-23244 JJ denotes primitive
T9991 23231-23234 RB denotes not
T9990 23227-23230 CC denotes but
T9989 23225-23226 -COMMA- denotes ,
T9988 23215-23225 JJ denotes definitive
T9987 23210-23214 IN denotes with
T9986 23199-23209 JJ denotes coincident
T9985 23189-23198 RB denotes spatially
T9984 23185-23188 CC denotes and
T9983 23174-23184 RB denotes temporally
T9982 23171-23173 VB denotes is
T9981 23160-23170 NN denotes expression
T9980 23155-23159 NN denotes Sox6
T9979 23153-23154 -COMMA- denotes ,
T9978 23144-23153 RB denotes Therefore
T9977 23141-23142 -RRB- denotes )
T9976 23139-23141 NN denotes 6B
T9975 23132-23138 NN denotes Figure
T9974 23131-23132 -LRB- denotes (
T9973 23127-23130 NN denotes dpc
T9972 23123-23126 CD denotes 7.5
T9971 23120-23122 IN denotes at
T9970 23112-23119 NN denotes islands
T9969 23106-23111 NN denotes blood
T9968 23102-23105 NN denotes sac
T9967 23097-23101 NN denotes yolk
T9966 23094-23096 IN denotes in
T9965 23090-23093 RB denotes not
T9964 23086-23089 CC denotes but
T9963 23084-23085 -COMMA- denotes ,
T9962 23079-23084 NN denotes liver
T9961 23070-23078 NN denotes 12.5-dpc
T9960 23067-23069 IN denotes in
T9959 23055-23066 VB denotes transcribed
T9958 23048-23054 RB denotes highly
T9957 23045-23047 VB denotes is
T9956 23040-23044 NN denotes Sox6
T9955 23035-23039 IN denotes that
T9954 23029-23034 VB denotes shows
T9953 23015-23028 NN denotes hybridization
T9952 23010-23014 FW denotes situ
T9951 23007-23009 FW denotes in
T9950 23005-23006 -COMMA- denotes ,
T9949 22994-23005 RB denotes Furthermore
T9948 22987-22992 NN denotes liver
T9947 22983-22986 DT denotes the
T9946 22980-22982 IN denotes in
T9945 22965-22979 NN denotes erythropoiesis
T9944 22954-22964 JJ denotes definitive
T9943 22951-22953 IN denotes of
T9942 22945-22950 NN denotes onset
T9941 22936-22944 JJ denotes temporal
T9940 22932-22935 DT denotes the
T9939 22927-22931 IN denotes with
T9938 22916-22926 JJ denotes coincident
T9937 22914-22915 -COMMA- denotes ,
T9936 22911-22914 NN denotes dpc
T9935 22906-22910 CD denotes 10.5
T9934 22903-22905 IN denotes at
T9933 22893-22902 VB denotes beginning
T9932 22888-22892 NN denotes blot
T9931 22879-22887 JJ denotes Northern
T9930 22876-22878 IN denotes by
T9929 22865-22875 JJ denotes detectable
T9928 22862-22864 VB denotes is
T9927 22857-22861 NN denotes Sox6
T9926 22855-22856 -COMMA- denotes ,
T9925 22853-22855 NN denotes 6A
T9924 22846-22852 NN denotes Figure
T9923 22843-22845 IN denotes in
T9922 22837-22842 VB denotes shown
T9921 22834-22836 IN denotes As
T9920 22824-22832 VB denotes employed
T9919 22819-22823 VB denotes were
T9918 22812-22818 NN denotes assays
T9917 22798-22811 NN denotes hybridization
T9916 22793-22797 FW denotes situ
T9915 22790-22792 FW denotes in
T9914 22786-22789 CC denotes and
T9913 22781-22785 NN denotes blot
T9912 22772-22780 NN denotes Northern
T9911 22770-22771 -COMMA- denotes ,
T9910 22766-22770 NN denotes Sox6
T9909 22763-22765 IN denotes of
T9908 22755-22762 NN denotes pattern
T9907 22744-22754 NN denotes expression
T9906 22736-22743 JJ denotes spatial
T9905 22732-22735 CC denotes and
T9904 22723-22731 JJ denotes temporal
T9903 22719-22722 DT denotes the
T9902 22709-22718 VB denotes determine
T9901 22706-22708 TO denotes To
T9900 22690-22704 NN denotes erythropoiesis
T9899 22679-22689 JJ denotes definitive
T9898 22676-22678 IN denotes in
T9897 22666-22675 NN denotes regulator
T9896 22656-22665 JJ denotes important
T9895 22653-22655 DT denotes an
T9894 22650-22652 VB denotes is
T9878 22550-22561 RB denotes ectopically
T9877 22545-22549 NN denotes mice
T9876 22530-22544 JJ denotes Sox6-deficient
T9875 22525-22529 IN denotes that
T9874 22513-22524 NN denotes observation
T9873 22509-22512 DT denotes The
T9872 22494-22508 NN denotes Erythropoiesis
T9871 22483-22493 JJ denotes Definitive
T9870 22480-22482 IN denotes in
T9869 22475-22479 NN denotes Role
T9868 22473-22474 DT denotes a
T9867 22464-22472 VB denotes Suggests
T9866 22459-22463 NN denotes Sox6
T9865 22456-22458 IN denotes of
T9864 22448-22455 NN denotes Pattern
T9863 22437-22447 NN denotes Expression
T9862 22433-22436 DT denotes The
T9893 22645-22649 NN denotes Sox6
T9892 22640-22644 IN denotes that
T9891 22631-22639 VB denotes suggests
T9890 22629-22630 -COMMA- denotes ,
T9889 22623-22629 VB denotes mature
T9888 22617-22622 NN denotes cells
T9887 22607-22616 JJ denotes erythroid
T9886 22596-22606 JJ denotes definitive
T9885 22590-22595 WRB denotes where
T9884 22588-22589 -COMMA- denotes ,
T9883 22583-22588 NN denotes liver
T9882 22580-22582 IN denotes in
T9881 22573-22579 NN denotes globin
T9880 22570-22572 JJ denotes ɛy
T9879 22562-22569 VB denotes express
T9324 21798-21802 NN denotes mice
T9323 21788-21797 JJ denotes Sox6-null
T9322 21785-21787 IN denotes in
T9321 21775-21784 NN denotes mechanism
T9320 21765-21774 NN denotes silencing
T9319 21762-21764 JJ denotes ɛy
T9318 21758-21761 DT denotes the
T9317 21755-21757 IN denotes of
T9316 21748-21754 NN denotes defect
T9315 21738-21747 JJ denotes intrinsic
T9314 21735-21737 DT denotes an
T9313 21732-21734 VB denotes is
T9312 21726-21731 EX denotes there
T9311 21721-21725 IN denotes that
T9310 21710-21720 VB denotes suggesting
T9309 21708-21709 -COMMA- denotes ,
T9308 21703-21708 NN denotes liver
T9307 21697-21702 JJ denotes fetal
T9306 21693-21696 DT denotes the
T9305 21690-21692 IN denotes in
T9304 21683-21689 VB denotes mature
T9303 21678-21682 WDT denotes that
T9302 21672-21677 NN denotes cells
T9301 21662-21671 JJ denotes erythroid
T9300 21651-21661 JJ denotes definitive
T9299 21647-21650 DT denotes the
T9298 21644-21646 IN denotes in
T9297 21633-21643 NN denotes expression
T9296 21625-21632 JJ denotes ectopic
T9295 21622-21624 TO denotes to
T9294 21618-21621 JJ denotes due
T9293 21614-21617 VB denotes are
T9292 21611-21613 NN denotes ɛy
T9291 21608-21610 IN denotes of
T9290 21601-21607 NN denotes levels
T9289 21596-21600 JJ denotes high
T9288 21585-21595 JJ denotes persistent
T9287 21581-21584 DT denotes the
T9286 21576-21580 IN denotes that
T9285 21564-21575 VB denotes demonstrate
T9284 21559-21563 NN denotes data
T9283 21553-21558 DT denotes These
T9282 21550-21551 -RRB- denotes )
T9281 21549-21550 NN denotes F
T9280 21545-21548 CC denotes and
T9279 21543-21544 NN denotes E
T9278 21541-21542 CD denotes 5
T9277 21534-21540 NN denotes Figure
T9276 21533-21534 -LRB- denotes (
T9275 21528-21532 NN denotes mice
T9274 21521-21527 JJ denotes mutant
T9273 21515-21520 NN denotes p100H
T9272 21511-21514 CC denotes and
T9271 21508-21510 NN denotes WT
T9270 21503-21507 CC denotes both
T9269 21500-21502 IN denotes in
T9268 21491-21499 JJ denotes abundant
T9267 21483-21490 RB denotes equally
T9266 21480-21482 VB denotes is
T9265 21473-21479 NN denotes globin
T9264 21464-21472 NN denotes βmaj/min
T9263 21461-21463 IN denotes of
T9262 21450-21460 NN denotes expression
T9261 21446-21449 DT denotes the
T9260 21444-21445 -COMMA- denotes ,
T9259 21437-21444 RB denotes However
T9258 21434-21435 -RRB- denotes )
T9257 21431-21434 NN denotes A–D
T9256 21429-21430 CD denotes 5
T9255 21422-21428 NN denotes Figure
T9254 21421-21422 -LRB- denotes (
T9253 21413-21420 NN denotes mutants
T9252 21404-21412 JJ denotes 14.5-dpc
T9251 21401-21403 IN denotes of
T9250 21395-21400 NN denotes liver
T9249 21391-21394 DT denotes the
T9248 21388-21390 IN denotes in
T9247 21383-21387 VB denotes seen
T9246 21380-21382 VB denotes is
T9245 21369-21379 NN denotes expression
T9244 21364-21368 NN denotes mRNA
T9243 21361-21363 JJ denotes ɛy
T9242 21353-21360 JJ denotes ectopic
T9241 21344-21352 JJ denotes abundant
T9240 21342-21343 -COMMA- denotes ,
T9239 21334-21342 NN denotes contrast
T9238 21331-21333 IN denotes In
T9237 21324-21329 NN denotes fetus
T9236 21320-21323 DT denotes the
T9235 21317-21319 IN denotes in
T9234 21302-21316 NN denotes erythropoiesis
T9233 21291-21301 JJ denotes definitive
T9232 21288-21290 IN denotes of
T9231 21283-21287 NN denotes site
T9230 21279-21282 DT denotes the
T9229 21277-21278 -COMMA- denotes ,
T9228 21272-21277 NN denotes liver
T9227 21263-21271 NN denotes 14.5-dpc
T9226 21260-21262 NN denotes WT
T9225 21256-21259 DT denotes the
T9224 21253-21255 IN denotes in
T9223 21243-21252 VB denotes expressed
T9222 21239-21242 RB denotes not
T9221 21236-21238 VB denotes is
T9220 21229-21235 NN denotes globin
T9219 21226-21228 JJ denotes ɛy
T9218 21224-21225 -COMMA- denotes ,
T9217 21216-21224 VB denotes expected
T9216 21213-21215 IN denotes As
T9215 21210-21211 -RRB- denotes )
T9214 21209-21210 CD denotes 5
T9213 21202-21208 NN denotes Figure
T9212 21201-21202 -LRB- denotes (
T9211 21187-21200 NN denotes hybridization
T9210 21182-21186 FW denotes situ
T9209 21179-21181 FW denotes in
T9208 21176-21178 IN denotes by
T9207 21168-21175 NN denotes embryos
T9206 21162-21167 NN denotes mouse
T9205 21159-21161 IN denotes in
T9204 21147-21158 NN denotes transcripts
T9203 21140-21146 NN denotes globin
T9202 21137-21139 JJ denotes ɛy
T9201 21134-21136 IN denotes of
T9200 21126-21133 NN denotes pattern
T9199 21118-21125 JJ denotes spatial
T9198 21114-21117 DT denotes the
T9197 21105-21113 VB denotes examined
T9196 21102-21104 PRP denotes we
T9195 21100-21101 -COMMA- denotes ,
T9194 21088-21100 NN denotes erythrocytes
T9193 21077-21087 JJ denotes definitive
T9192 21074-21076 IN denotes in
T9191 21067-21073 NN denotes globin
T9190 21064-21066 JJ denotes ɛy
T9189 21061-21063 IN denotes of
T9188 21050-21060 NN denotes expression
T9187 21042-21049 JJ denotes ectopic
T9186 21039-21041 TO denotes to
T9185 21035-21038 JJ denotes due
T9184 21032-21034 VB denotes is
T9183 21029-21031 CC denotes or
T9182 21016-21028 NN denotes erythrocytes
T9181 21006-21015 JJ denotes primitive
T9180 20997-21005 JJ denotes residual
T9179 20994-20996 TO denotes to
T9178 20990-20993 JJ denotes due
T9177 20987-20989 VB denotes is
T9176 20980-20986 NN denotes globin
T9175 20977-20979 JJ denotes ɛy
T9174 20974-20976 IN denotes of
T9173 20963-20973 NN denotes expression
T9172 20952-20962 JJ denotes persistent
T9171 20948-20951 DT denotes the
T9170 20940-20947 IN denotes whether
T9169 20930-20939 VB denotes determine
T9168 20927-20929 TO denotes To
T9167 20913-20925 NN denotes erythrocytes
T9166 20902-20912 JJ denotes definitive
T9165 20899-20901 IN denotes in
T9164 20890-20898 JJ denotes silenced
T9163 20886-20889 CC denotes and
T9162 20873-20885 NN denotes erythrocytes
T9161 20863-20872 JJ denotes primitive
T9160 20860-20862 IN denotes in
T9159 20850-20859 VB denotes expressed
T9158 20838-20849 RB denotes exclusively
T9157 20835-20837 VB denotes is
T9156 20830-20834 NN denotes gene
T9155 20823-20829 NN denotes globin
T9154 20820-20822 JJ denotes ɛy
T9153 20816-20819 DT denotes the
T9152 20814-20815 -COMMA- denotes ,
T9151 20806-20814 RB denotes Normally
T9150 20800-20805 NN denotes Cells
T9149 20790-20799 JJ denotes Erythroid
T9148 20779-20789 JJ denotes Definitive
T9147 20776-20778 IN denotes in
T9146 20766-20775 NN denotes Mechanism
T9145 20748-20765 JJ denotes ɛy-Gene–Silencing
T9144 20744-20747 DT denotes the
T9143 20741-20743 IN denotes in
T9142 20734-20740 NN denotes Defect
T9141 20732-20733 DT denotes a
T9140 20729-20731 TO denotes to
T9139 20725-20728 JJ denotes Due
T9138 20722-20724 VB denotes Is
T9137 20717-20721 NN denotes Mice
T9136 20702-20716 JJ denotes Sox6-Deficient
T9135 20699-20701 IN denotes in
T9134 20692-20698 NN denotes Globin
T9133 20689-20691 JJ denotes ɛy
T9132 20686-20688 IN denotes of
T9131 20675-20685 NN denotes Expression
T9130 20664-20674 JJ denotes Persistent
T9129 20660-20663 DT denotes The
T7964 19823-19824 DT denotes a
T7963 19820-19822 IN denotes as
T7962 19811-19819 RB denotes probably
T7961 19809-19810 -COMMA- denotes ,
T7960 19801-19809 NN denotes promoter
T7959 19798-19800 JJ denotes ɛy
T7958 19794-19797 DT denotes the
T7957 19791-19793 TO denotes to
T7956 19783-19790 VB denotes binding
T7955 19774-19782 RB denotes directly
T7954 19771-19773 IN denotes by
T7953 19766-19770 NN denotes gene
T7952 19763-19765 JJ denotes ɛy
T7951 19759-19762 DT denotes the
T7950 19756-19758 IN denotes of
T7949 19746-19755 NN denotes repressor
T7948 19744-19745 DT denotes a
T7947 19741-19743 IN denotes as
T7946 19736-19740 VB denotes acts
T7945 19731-19735 NN denotes Sox6
T7944 19726-19730 IN denotes that
T7943 19717-19725 VB denotes indicate
T7942 19709-19716 RB denotes clearly
T7941 19707-19708 -RRB- denotes )
T7940 19706-19707 CD denotes 4
T7939 19702-19705 CC denotes and
T7938 19700-19701 CD denotes 3
T7937 19692-19699 NN denotes Figures
T7936 19691-19692 -LRB- denotes (
T7935 19686-19690 NN denotes data
T7934 19680-19685 JJ denotes above
T7933 19676-19679 DT denotes The
T7932 19673-19674 -RRB- denotes )
T7931 19671-19673 NN denotes 4A
T7930 19664-19670 NN denotes Figure
T7929 19663-19664 -LRB- denotes (
T7928 19655-19662 NN denotes control
T7927 19646-19654 JJ denotes negative
T7926 19644-19645 DT denotes a
T7925 19641-19643 IN denotes as
T7924 19636-19640 VB denotes used
T7923 19632-19635 VB denotes was
T7922 19628-19631 NN denotes IgG
T7921 19621-19627 JJ denotes Normal
T7920 19614-19619 NN denotes cells
T7919 19608-19613 NN denotes liver
T7918 19604-19607 CC denotes and
T7917 19598-19603 NN denotes cells
T7916 19594-19597 NN denotes MEL
T7915 19589-19593 CC denotes both
T7914 19586-19588 IN denotes in
T7913 19577-19585 NN denotes antibody
T7912 19572-19576 NN denotes Sox6
T7911 19567-19571 IN denotes with
T7910 19548-19566 VB denotes immunoprecipitated
T7909 19540-19547 RB denotes readily
T7908 19537-19539 VB denotes is
T7907 19528-19536 NN denotes promoter
T7906 19519-19527 JJ denotes proximal
T7905 19516-19518 JJ denotes ɛy
T7904 19512-19515 DT denotes the
T7903 19507-19511 IN denotes that
T7902 19501-19506 NN denotes shows
T7901 19499-19500 CD denotes 4
T7900 19492-19498 NN denotes Figure
T7899 19482-19490 NN denotes antibody
T7898 19477-19481 NN denotes Sox6
T7897 19471-19476 VB denotes using
T7896 19466-19470 NN denotes mice
T7895 19463-19465 JJ denotes WT
T7894 19459-19462 NN denotes dpc
T7893 19454-19458 CD denotes 15.5
T7892 19451-19453 IN denotes of
T7891 19445-19450 NN denotes cells
T7890 19439-19444 NN denotes liver
T7889 19434-19438 IN denotes from
T7888 19431-19433 CC denotes or
T7887 19425-19430 NN denotes cells
T7886 19421-19424 NN denotes MEL
T7885 19416-19420 IN denotes from
T7884 19397-19415 VB denotes immunoprecipitated
T7883 19393-19396 VB denotes was
T7882 19385-19392 NN denotes complex
T7881 19369-19384 JJ denotes Sox6-containing
T7880 19365-19368 DT denotes The
T7879 19362-19363 -RRB- denotes )
T7878 19361-19362 CD denotes 4
T7877 19354-19360 NN denotes Figure
T7876 19353-19354 -LRB- denotes (
T7875 19351-19352 -RRB- denotes )
T7874 19347-19351 NN denotes ChIP
T7873 19346-19347 -LRB- denotes (
T7872 19326-19345 NN denotes immunoprecipitation
T7871 19316-19325 NN denotes chromatin
T7870 19310-19315 VB denotes using
T7869 19305-19309 FW denotes vivo
T7868 19302-19304 FW denotes in
T7867 19293-19301 NN denotes promoter
T7866 19290-19292 JJ denotes ɛy
T7865 19286-19289 DT denotes the
T7864 19283-19285 TO denotes to
T7863 19277-19282 VB denotes binds
T7862 19272-19276 NN denotes Sox6
T7861 19264-19271 IN denotes whether
T7860 19257-19263 VB denotes tested
T7859 19252-19256 RB denotes also
T7858 19249-19251 PRP denotes We
T7857 19241-19247 NN denotes degree
T7856 19236-19240 JJ denotes same
T7855 19232-19235 DT denotes the
T7854 19229-19231 TO denotes to
T7853 19225-19228 RB denotes not
T7852 19221-19224 CC denotes but
T7851 19219-19220 -COMMA- denotes ,
T7850 19215-19219 NN denotes Sox6
T7849 19212-19214 IN denotes by
T7848 19209-19211 NN denotes ɛy
T7847 19206-19208 IN denotes of
T7846 19195-19205 NN denotes repression
T7845 19187-19194 JJ denotes maximal
T7844 19183-19186 IN denotes for
T7843 19174-19182 VB denotes required
T7842 19170-19173 VB denotes are
T7841 19164-19169 NN denotes sites
T7840 19159-19163 DT denotes both
T7839 19157-19158 -COMMA- denotes ,
T7838 19153-19157 RB denotes Thus
T7837 19150-19151 -RRB- denotes )
T7836 19148-19150 NN denotes 3F
T7835 19141-19147 NN denotes Figure
T7834 19140-19141 -LRB- denotes (
T7833 19132-19139 NN denotes studies
T7832 19119-19131 NN denotes transfection
T7831 19116-19118 IN denotes in
T7830 19105-19115 NN denotes repression
T7829 19096-19104 NN denotes promoter
T7828 19084-19095 JJ denotes significant
T7827 19081-19083 IN denotes in
T7826 19074-19080 VB denotes result
T7825 19070-19073 RB denotes not
T7824 19067-19069 VB denotes do
T7823 19065-19066 -RRB- denotes )
T7822 19054-19065 VB denotes mutagenized
T7821 19048-19053 NN denotes sites
T7820 19040-19047 NN denotes binding
T7819 19031-19039 NN denotes Sox/Sox6
T7818 19026-19030 CC denotes both
T7817 19023-19025 CC denotes or
T7816 19019-19022 CD denotes one
T7815 19012-19018 CC denotes either
T7814 19007-19011 IN denotes with
T7813 19006-19007 -LRB- denotes (
T7812 18995-19005 NN denotes constructs
T7811 18986-18994 NN denotes reporter
T7810 18977-18985 NN denotes promoter
T7809 18974-18976 JJ denotes ɛy
T7808 18967-18973 JJ denotes mutant
T7807 18963-18966 DT denotes the
T7806 18961-18962 -COMMA- denotes ,
T7805 18954-18961 NN denotes results
T7804 18949-18953 NN denotes EMSA
T7803 18945-18948 DT denotes the
T7802 18940-18944 IN denotes with
T7801 18929-18939 JJ denotes Consistent
T7800 18922-18927 NN denotes cells
T7799 18916-18921 NN denotes GM979
T7798 18911-18915 IN denotes into
T7797 18904-18910 NN denotes vector
T7796 18889-18903 NN denotes overexpression
T7795 18884-18888 NN denotes Sox6
T7794 18880-18883 DT denotes the
T7793 18875-18879 IN denotes with
T7792 18860-18874 VB denotes co-transfected
T7791 18855-18859 VB denotes were
T7790 18849-18854 NN denotes sites
T7789 18841-18848 NN denotes binding
T7788 18832-18840 NN denotes Sox/Sox6
T7787 18820-18831 VB denotes mutagenized
T7786 18815-18819 IN denotes with
T7785 18804-18814 NN denotes constructs
T7784 18795-18803 NN denotes reporter
T7783 18786-18794 NN denotes promoter
T7782 18783-18785 JJ denotes ɛy
T7781 18779-18782 DT denotes the
T7780 18777-18778 -COMMA- denotes ,
T7779 18772-18777 NN denotes sites
T7778 18764-18771 NN denotes binding
T7777 18755-18763 NN denotes Sox/Sox6
T7776 18748-18754 JJ denotes intact
T7775 18744-18747 DT denotes the
T7774 18741-18743 IN denotes of
T7773 18728-18740 NN denotes significance
T7772 18717-18727 JJ denotes functional
T7771 18713-18716 DT denotes the
T7770 18701-18712 VB denotes investigate
T7769 18698-18700 TO denotes To
T7768 18689-18696 NN denotes binding
T7767 18686-18688 NN denotes WT
T7766 18681-18685 IN denotes with
T7765 18671-18680 RB denotes partially
T7764 18663-18670 VB denotes compete
T7763 18659-18662 MD denotes may
T7762 18653-18658 NN denotes probe
T7761 18646-18652 JJ denotes mutant
T7760 18643-18645 NN denotes M2
T7759 18639-18642 DT denotes The
T7712 18395-18401 JJ denotes intact
T7711 18391-18394 DT denotes The
T7710 18388-18389 -RRB- denotes )
T7709 18386-18388 NN denotes 3D
T7708 18379-18385 NN denotes Figure
T7707 18378-18379 -LRB- denotes (
T7706 18372-18377 NN denotes cells
T7705 18368-18371 NN denotes MEL
T7704 18365-18367 IN denotes in
T7703 18356-18364 NN denotes sequence
T7702 18352-18355 NN denotes DNA
T7701 18347-18351 DT denotes this
T7700 18344-18346 TO denotes to
T7699 18338-18343 VB denotes binds
T7698 18329-18337 RB denotes directly
T7697 18324-18328 NN denotes Sox6
T7696 18321-18322 -RRB- denotes ]
T7695 18319-18321 CD denotes 33
T7694 18318-18319 -LRB- denotes [
T7693 18315-18317 VB denotes ɛy
T7692 18311-18314 RB denotes not
T7691 18307-18310 CC denotes but
T7690 18305-18306 -COMMA- denotes ,
T7689 18298-18305 NN denotes globins
T7688 18296-18297 NN denotes β
T7687 18290-18295 JJ denotes adult
T7686 18282-18289 VB denotes express
T7685 18280-18281 -COMMA- denotes ,
T7684 18276-18280 NN denotes line
T7683 18271-18275 NN denotes cell
T7682 18255-18270 JJ denotes erythroleukemic
T7681 18248-18254 JJ denotes murine
T7680 18246-18247 DT denotes a
T7679 18244-18245 -COMMA- denotes ,
T7678 18239-18244 NN denotes cells
T7677 18235-18238 NN denotes MEL
T7676 18228-18233 NN denotes probe
T7675 18222-18227 JJ denotes 36-bp
T7674 18217-18221 JJ denotes same
T7673 18213-18216 DT denotes the
T7672 18203-18212 VB denotes employing
T7671 18198-18202 NN denotes EMSA
T7670 18195-18197 IN denotes in
T7669 18190-18194 VB denotes used
T7668 18185-18189 VB denotes were
T7667 18179-18184 NN denotes cells
T7666 18175-18178 NN denotes MEL
T7665 18170-18174 IN denotes from
T7664 18161-18169 NN denotes extracts
T7663 18153-18160 JJ denotes nuclear
T7662 18151-18152 -COMMA- denotes ,
T7661 18147-18151 RB denotes Next
T7660 18144-18145 -RRB- denotes )
T7659 18142-18144 NN denotes 3C
T7658 18135-18141 NN denotes Figure
T7657 18134-18135 -LRB- denotes (
T7656 18126-18133 NN denotes results
T7655 18120-18125 DT denotes these
T7654 18110-18119 VB denotes confirmed
T7653 18105-18109 WDT denotes that
T7652 18100-18104 NN denotes EMSA
T7651 18092-18099 DT denotes another
T7650 18089-18091 IN denotes in
T7649 18084-18088 VB denotes used
T7648 18080-18083 VB denotes was
T7647 18075-18079 NN denotes Sox6
T7646 18065-18074 JJ denotes HA-tagged
T7645 18062-18064 DT denotes an
T7644 18060-18061 -COMMA- denotes ,
T7643 18055-18060 NN denotes probe
T7642 18051-18054 DT denotes the
T7641 18048-18050 TO denotes to
T7640 18042-18047 VB denotes binds
T7639 18035-18041 PRP denotes itself
T7638 18031-18034 NN denotes tag
T7637 18025-18030 NN denotes c-Myc
T7636 18021-18024 DT denotes the
T7635 18016-18020 IN denotes that
T7634 18004-18015 NN denotes possibility
T7633 18000-18003 DT denotes the
T7632 17996-17999 RP denotes out
T7631 17991-17995 VB denotes rule
T7630 17988-17990 TO denotes To
T7629 17973-17986 JJ denotes Sox6-specific
T7628 17970-17972 VB denotes is
T7627 17962-17969 NN denotes binding
T7626 17958-17961 DT denotes the
T7625 17953-17957 IN denotes that
T7624 17942-17952 VB denotes indicating
T7623 17940-17941 -COMMA- denotes ,
T7622 17936-17940 NN denotes band
T7621 17932-17935 DT denotes the
T7620 17921-17931 VB denotes supershift
T7619 17910-17920 NN denotes antibodies
T7618 17905-17909 NN denotes Sox6
T7617 17901-17904 CC denotes and
T7616 17895-17900 NN denotes c-Myc
T7615 17890-17894 CC denotes both
T7614 17888-17889 -COMMA- denotes ,
T7613 17880-17888 RB denotes Moreover
T7612 17871-17878 NN denotes protein
T7611 17866-17870 NN denotes Sox6
T7610 17859-17865 VB denotes tagged
T7609 17855-17858 DT denotes the
T7608 17852-17854 IN denotes by
T7607 17844-17851 VB denotes shifted
T7606 17840-17843 VB denotes was
T7605 17834-17839 NN denotes probe
T7604 17828-17833 JJ denotes 36-bp
T7603 17824-17827 DT denotes The
T7602 17821-17822 -RRB- denotes )
T7601 17819-17821 NN denotes 2C
T7600 17812-17818 NN denotes Figure
T7599 17811-17812 -LRB- denotes (
T7598 17799-17810 NN denotes experiments
T7597 17790-17798 NN denotes analysis
T7596 17781-17789 NN denotes deletion
T7595 17777-17780 DT denotes the
T7594 17774-17776 IN denotes by
T7593 17766-17773 VB denotes defined
T7592 17757-17765 NN denotes promoter
T7591 17754-17756 JJ denotes ɛy
T7590 17750-17753 DT denotes the
T7589 17743-17749 IN denotes within
T7588 17741-17742 -RRB- denotes )
T7587 17739-17741 NN denotes 3B
T7586 17732-17738 NN denotes Figure
T7585 17731-17732 -LRB- denotes (
T7584 17724-17730 NN denotes region
T7583 17718-17723 JJ denotes 36-bp
T7582 17714-17717 DT denotes the
T7581 17709-17713 IN denotes with
T7580 17699-17708 VB denotes associate
T7579 17688-17698 RB denotes physically
T7578 17685-17687 TO denotes to
T7577 17680-17684 JJ denotes able
T7576 17677-17679 VB denotes is
T7575 17672-17676 NN denotes Sox6
T7574 17669-17670 -RRB- denotes )
T7573 17667-17669 NN denotes 3A
T7572 17660-17666 NN denotes Figure
T7571 17659-17660 -LRB- denotes (
T7570 17653-17658 NN denotes sites
T7569 17645-17652 NN denotes binding
T7568 17636-17644 NN denotes Sox/Sox6
T7567 17633-17635 IN denotes in
T7566 17631-17632 -RRB- denotes )
T7565 17629-17631 NN denotes M3
T7564 17625-17628 CC denotes and
T7563 17622-17624 NN denotes M2
T7562 17621-17622 -LRB- denotes (
T7561 17613-17620 VB denotes mutated
T7560 17610-17612 CC denotes or
T7559 17608-17609 -COMMA- denotes ,
T7558 17607-17608 -RRB- denotes )
T7557 17605-17607 NN denotes M1
T7556 17604-17605 -LRB- denotes (
T7555 17594-17603 VB denotes truncated
T7554 17587-17593 CC denotes either
T7553 17585-17586 -COMMA- denotes ,
T7552 17582-17585 VB denotes are
T7551 17577-17581 WDT denotes that
T7550 17570-17576 NN denotes probes
T7549 17562-17569 VB denotes mutated
T7548 17556-17561 CD denotes three
T7547 17552-17555 VB denotes are
T7546 17547-17551 NN denotes EMSA
T7545 17543-17546 PRP-DOLLAR- denotes our
T7544 17540-17542 IN denotes in
T7543 17531-17539 VB denotes included
T7542 17526-17530 RB denotes Also
T7541 17519-17524 NN denotes sites
T7540 17511-17518 NN denotes binding
T7539 17502-17510 NN denotes Sox/Sox6
T7538 17492-17501 NN denotes consensus
T7537 17488-17491 CD denotes two
T7536 17479-17487 VB denotes contains
T7535 17473-17478 NN denotes probe
T7534 17468-17472 DT denotes This
T7533 17458-17466 NN denotes analyses
T7532 17449-17457 NN denotes deletion
T7531 17440-17448 NN denotes promoter
T7530 17436-17439 PRP-DOLLAR- denotes our
T7529 17433-17435 IN denotes in
T7528 17425-17432 VB denotes defined
T7527 17416-17424 NN denotes promoter
T7526 17413-17415 JJ denotes ɛy
T7525 17409-17412 DT denotes the
T7524 17406-17408 IN denotes of
T7523 17399-17405 NN denotes region
T7522 17390-17398 JJ denotes critical
T7521 17386-17389 DT denotes the
T7520 17383-17385 TO denotes to
T7519 17371-17382 VB denotes corresponds
T7518 17365-17370 NN denotes probe
T7517 17362-17364 NN denotes WT
T7516 17360-17361 -RRB- denotes )
T7515 17358-17360 NN denotes bp
T7514 17357-17358 -LRB- denotes (
T7513 17352-17356 NN denotes pair
T7512 17344-17351 NN denotes 36–base
T7511 17340-17343 DT denotes The
T7510 17336-17338 NN denotes 3A
T7509 17329-17335 NN denotes Figure
T7508 17326-17328 IN denotes in
T7507 17319-17325 VB denotes listed
T7506 17315-17318 VB denotes are
T7505 17310-17314 VB denotes used
T7504 17303-17309 NN denotes probes
T7503 17299-17302 DT denotes The
T7502 17291-17297 NN denotes system
T7501 17285-17290 FW denotes vitro
T7500 17282-17284 FW denotes in
T7499 17256-17281 NN denotes transcription/translation
T7498 17243-17255 JJ denotes lysate-based
T7497 17230-17242 NN denotes reticulocyte
T7443 16895-16898 DT denotes the
T7442 16892-16894 TO denotes to
T7441 16886-16891 VB denotes Binds
T7440 16877-16885 RB denotes Directly
T7439 16872-16876 NN denotes Sox6
T7438 16867-16871 IN denotes that
T7437 16862-16866 NNP denotes Show
T7436 16855-16861 NNP denotes Assays
T7435 16850-16854 NNP denotes ChIP
T7434 16846-16849 CC denotes and
T7433 16841-16845 NN denotes EMSA
T7758 18636-18637 -RRB- denotes )
T7757 18634-18636 NN denotes 3E
T7756 18627-18633 NN denotes Figure
T7755 18626-18627 -LRB- denotes (
T7754 18621-18625 NN denotes EMSA
T7753 18618-18620 IN denotes in
T7752 18610-18617 VB denotes compete
T7751 18607-18609 TO denotes to
T7750 18599-18606 NN denotes ability
T7749 18593-18598 PRP-DOLLAR- denotes their
T7748 18585-18592 VB denotes abolish
T7747 18583-18584 -RRB- denotes )
T7746 18581-18583 NN denotes M3
T7745 18577-18580 CC denotes and
T7744 18574-18576 NN denotes M1
T7743 18573-18574 -LRB- denotes (
T7742 18567-18572 NN denotes sites
T7741 18559-18566 NN denotes binding
T7740 18550-18558 NN denotes Sox/Sox6
T7739 18541-18549 JJ denotes putative
T7738 18538-18540 IN denotes of
T7737 18529-18537 NN denotes Ablation
T7736 18526-18527 -RRB- denotes )
T7735 18524-18526 NN denotes 3E
T7734 18517-18523 NN denotes Figure
T7733 18516-18517 -LRB- denotes (
T7732 18510-18515 NN denotes assay
T7731 18498-18509 NN denotes competition
T7730 18494-18497 DT denotes the
T7729 18491-18493 IN denotes in
T7728 18485-18490 VB denotes shown
T7727 18482-18484 IN denotes as
T7726 18480-18481 -COMMA- denotes ,
T7725 18473-18480 NN denotes binding
T7724 18469-18472 DT denotes the
T7723 18465-18468 IN denotes for
T7722 18456-18464 VB denotes required
T7721 18452-18455 VB denotes are
T7720 18446-18451 NN denotes probe
T7719 18442-18445 NN denotes DNA
T7718 18438-18441 DT denotes the
T7717 18435-18437 IN denotes of
T7716 18429-18434 NN denotes sites
T7715 18421-18428 NN denotes binding
T7714 18412-18420 NN denotes Sox/Sox6
T7713 18402-18411 NN denotes consensus
T7466 17045-17048 DT denotes the
T7496 17228-17229 DT denotes a
T7495 17225-17227 IN denotes in
T7494 17220-17224 NN denotes Sox6
T7493 17207-17219 JJ denotes c-Myc-tagged
T7492 17205-17206 DT denotes a
T7491 17199-17204 VB denotes using
T7490 17197-17198 -RRB- denotes )
T7489 17193-17197 NN denotes EMSA
T7488 17192-17193 -LRB- denotes (
T7487 17185-17191 NN denotes assays
T7486 17179-17184 NN denotes shift
T7485 17170-17178 NN denotes mobility
T7484 17154-17169 JJ denotes electrophoretic
T7483 17144-17153 VB denotes performed
T7482 17138-17143 RB denotes first
T7481 17135-17137 PRP denotes we
T7480 17133-17134 -COMMA- denotes ,
T7479 17125-17133 NN denotes promoter
T7478 17122-17124 JJ denotes ɛy
T7477 17118-17121 DT denotes the
T7476 17113-17117 IN denotes with
T7475 17102-17112 VB denotes associated
T7474 17093-17101 RB denotes directly
T7473 17090-17092 VB denotes is
T7472 17085-17089 NN denotes Sox6
T7471 17077-17084 IN denotes whether
T7470 17065-17076 VB denotes investigate
T7469 17062-17064 TO denotes To
T7468 17052-17060 NN denotes promoter
T7467 17049-17051 JJ denotes ɛy
T7465 17035-17044 VB denotes affecting
T7464 17021-17034 NN denotes intermediates
T7463 17010-17020 VB denotes regulating
T7462 17007-17009 IN denotes by
T7461 17004-17006 CC denotes or
T7460 16995-17003 NN denotes promoter
T7459 16991-16994 DT denotes the
T7458 16986-16990 IN denotes with
T7457 16978-16985 NN denotes contact
T7456 16969-16977 JJ denotes physical
T7455 16962-16968 JJ denotes direct
T7454 16954-16961 IN denotes through
T7453 16947-16953 CC denotes either
T7452 16945-16946 -COMMA- denotes ,
T7451 16937-16945 NN denotes promoter
T7450 16934-16936 JJ denotes ɛy
T7449 16930-16933 DT denotes the
T7448 16922-16929 VB denotes repress
T7447 16916-16921 MD denotes might
T7446 16911-16915 NN denotes Sox6
T7445 16902-16910 NN denotes Promoter
T7444 16899-16901 JJ denotes ɛy
T6147 13980-13988 NN denotes promoter
T6146 13977-13979 JJ denotes ɛy
T6145 13973-13976 DT denotes the
T6144 13963-13972 VB denotes represses
T6143 13958-13962 NN denotes Sox6
T6142 13953-13957 IN denotes that
T6141 13942-13952 VB denotes indicating
T6140 13940-13941 -COMMA- denotes ,
T6139 13939-13940 -RRB- denotes )
T6138 13937-13939 NN denotes 2B
T6137 13930-13936 NN denotes Figure
T6136 13929-13930 -LRB- denotes (
T6135 13923-13928 NN denotes assay
T6134 13910-13922 NN denotes transfection
T6133 13906-13909 DT denotes the
T6132 13903-13905 IN denotes in
T6131 13894-13902 NN denotes promoter
T6130 13891-13893 JJ denotes ɛy
T6129 13887-13890 DT denotes the
T6128 13879-13886 VB denotes repress
T6127 13876-13878 TO denotes to
T6126 13868-13875 NN denotes ability
T6125 13864-13867 DT denotes the
T6124 13856-13863 VB denotes retains
T6123 13851-13855 NN denotes Sox6
T6122 13848-13850 IN denotes of
T6121 13840-13847 NN denotes version
T6120 13833-13839 JJ denotes mutant
T6119 13828-13832 DT denotes this
T6118 13826-13827 -COMMA- denotes ,
T6117 13819-13826 RB denotes However
T6116 13811-13817 NN denotes domain
T6115 13803-13810 NN denotes binding
T6114 13799-13802 NN denotes DNA
T6113 13795-13798 NN denotes HMG
T6112 13791-13794 DT denotes the
T6111 13788-13790 IN denotes in
T6110 13784-13787 RB denotes not
T6109 13781-13783 VB denotes is
T6108 13774-13780 NN denotes change
T6107 13769-13773 NN denotes acid
T6106 13763-13768 JJ denotes amino
T6105 13758-13762 DT denotes This
T6104 13755-13756 -RRB- denotes ]
T6103 13754-13755 CD denotes 5
T6102 13753-13754 -LRB- denotes [
T6101 13741-13752 NN denotes interaction
T6100 13730-13740 JJ denotes Sox6-CtBP2
T6099 13722-13729 VB denotes abolish
T6098 13719-13721 TO denotes to
T6097 13708-13718 JJ denotes sufficient
T6096 13705-13707 VB denotes be
T6095 13702-13704 TO denotes to
T6094 13693-13701 VB denotes reported
T6093 13682-13692 RB denotes previously
T6092 13677-13681 VB denotes been
T6091 13673-13676 VB denotes has
T6090 13668-13672 WDT denotes that
T6089 13660-13667 NN denotes protein
T6088 13655-13659 NN denotes Sox6
T6087 13651-13654 DT denotes the
T6086 13648-13650 IN denotes in
T6085 13646-13647 -RRB- denotes )
T6084 13641-13646 NN denotes L386H
T6083 13640-13641 -LRB- denotes (
T6082 13631-13639 NN denotes mutation
T6081 13625-13630 NN denotes point
T6080 13623-13624 DT denotes a
T6079 13612-13622 VB denotes introduced
T6078 13609-13611 PRP denotes we
T6077 13607-13608 -COMMA- denotes ,
T6076 13599-13607 NN denotes promoter
T6075 13596-13598 JJ denotes ɛy
T6074 13592-13595 DT denotes the
T6073 13589-13591 IN denotes of
T6072 13578-13588 NN denotes repression
T6071 13573-13577 NN denotes Sox6
T6070 13569-13572 IN denotes for
T6069 13560-13568 VB denotes required
T6068 13557-13559 VB denotes is
T6067 13551-13556 NN denotes CtBP2
T6066 13546-13550 IN denotes with
T6065 13534-13545 NN denotes interaction
T6064 13530-13533 DT denotes the
T6063 13522-13529 IN denotes whether
T6062 13510-13521 VB denotes investigate
T6061 13507-13509 TO denotes To
T6060 13504-13505 -RRB- denotes )
T6059 13500-13504 NN denotes data
T6058 13488-13499 JJ denotes unpublished
T6057 13487-13488 -LRB- denotes (
T6056 13481-13486 NN denotes cells
T6055 13475-13480 NN denotes GM979
T6054 13472-13474 IN denotes in
T6053 13462-13471 VB denotes expressed
T6052 13459-13461 VB denotes is
T6051 13453-13458 NN denotes CtBP2
T6050 13450-13451 -RRB- denotes ]
T6049 13449-13450 CD denotes 5
T6048 13448-13449 -LRB- denotes [
T6047 13439-13447 NN denotes promoter
T6046 13433-13438 NN denotes fgf-3
T6045 13429-13432 DT denotes the
T6044 13426-13428 IN denotes on
T6043 13424-13425 -COMMA- denotes ,
T6042 13419-13424 NN denotes CtBP2
T6041 13417-13418 -COMMA- denotes ,
T6040 13405-13417 NN denotes co-repressor
T6039 13395-13404 VB denotes expressed
T6038 13388-13394 RB denotes widely
T6037 13386-13387 DT denotes a
T6036 13381-13385 IN denotes with
T6035 13372-13380 VB denotes interact
T6034 13369-13371 TO denotes to
T6033 13365-13368 CC denotes and
T6032 13355-13364 NN denotes repressor
T6031 13353-13354 DT denotes a
T6030 13350-13352 IN denotes as
T6029 13346-13349 VB denotes act
T6028 13343-13345 TO denotes to
T6027 13337-13342 VB denotes shown
T6026 13332-13336 VB denotes been
T6025 13328-13331 VB denotes has
T6024 13323-13327 NN denotes Sox6
T6023 11935-11940 NN denotes level
T6022 11919-11934 JJ denotes transcriptional
T6021 11915-11918 DT denotes the
T6020 11912-11914 IN denotes at
T6019 11903-11911 NN denotes promoter
T6018 11900-11902 JJ denotes ɛy
T6017 11896-11899 DT denotes the
T6016 11888-11895 VB denotes repress
T6015 11885-11887 TO denotes to
T6014 11880-11884 VB denotes acts
T6013 11875-11879 NN denotes Sox6
T6012 11870-11874 IN denotes that
T6011 11861-11869 VB denotes indicate
T6010 11856-11860 NN denotes data
T6009 11850-11855 DT denotes These
T6008 11847-11848 -RRB- denotes )
T6007 11845-11847 NN denotes 2B
T6006 11838-11844 NN denotes Figure
T6005 11837-11838 -LRB- denotes (
T6004 11828-11836 NN denotes activity
T6003 11822-11827 NN denotes E-Luc
T6002 11814-11821 VB denotes repress
T6001 11811-11813 TO denotes to
T6000 11805-11810 VB denotes fails
T5999 11803-11804 -RRB- denotes )
T5998 11797-11803 NN denotes allele
T5997 11791-11796 NN denotes mouse
T5996 11784-11790 NN denotes p 100H
T5995 11780-11783 DT denotes the
T5994 11777-11779 TO denotes to
T5993 11769-11776 JJ denotes similar
T5992 11768-11769 -LRB- denotes (
T5991 11766-11767 -RRB- denotes ]
T5990 11764-11766 CD denotes 32
T5989 11763-11764 -LRB- denotes [
T5988 11756-11762 NN denotes domain
T5987 11752-11755 NN denotes HMG
T5986 11748-11751 PRP-DOLLAR- denotes its
T5985 11742-11747 VB denotes lacks
T5984 11737-11741 WDT denotes that
T5983 11729-11736 NN denotes protein
T5982 11724-11728 NN denotes Sox6
T5981 11714-11723 VB denotes truncated
T5980 11712-11713 DT denotes a
T5979 11709-11711 IN denotes of
T5978 11694-11708 NN denotes overexpression
T5977 11692-11693 -COMMA- denotes ,
T5976 11684-11692 NN denotes contrast
T5975 11681-11683 IN denotes In
T5974 11678-11679 -RRB- denotes )
T5973 11676-11678 NN denotes 2B
T5972 11669-11675 NN denotes Figure
T5971 11668-11669 -LRB- denotes (
T5970 11659-11667 NN denotes activity
T5969 11650-11658 NN denotes reporter
T5968 11644-11649 NN denotes E-Luc
T5967 11641-11643 IN denotes of
T5966 11630-11640 NN denotes repression
T5965 11613-11629 JJ denotes dosage-dependent
T5964 11611-11612 DT denotes a
T5963 11608-11610 TO denotes to
T5962 11602-11607 VB denotes leads
T5961 11589-11601 NN denotes transfection
T5960 11579-11588 JJ denotes transient
T5959 11576-11578 IN denotes by
T5958 11570-11575 NN denotes cells
T5957 11564-11569 NN denotes GM979
T5956 11561-11563 IN denotes in
T5955 11556-11560 NN denotes Sox6
T5954 11553-11555 IN denotes of
T5953 11538-11552 NN denotes Overexpression
T5952 11535-11536 -RRB- denotes )
T5951 11528-11535 NNP denotes Methods
T5950 11524-11527 CC denotes and
T5949 11514-11523 NNP denotes Materials
T5948 11511-11513 IN denotes in
T5947 11502-11510 VB denotes detailed
T5946 11501-11502 -LRB- denotes (
T5945 11498-11500 NN denotes 2A
T5944 11491-11497 NN denotes Figure
T5943 11488-11490 IN denotes in
T5942 11482-11487 VB denotes shown
T5941 11479-11481 IN denotes as
T5940 11477-11478 -COMMA- denotes ,
T5939 11473-11477 NN denotes gene
T5938 11464-11472 NN denotes reporter
T5937 11453-11463 NN denotes luciferase
T5936 11449-11452 DT denotes the
T5935 11446-11448 IN denotes by
T5934 11437-11445 VB denotes followed
T5933 11435-11436 -COMMA- denotes ,
T5932 11434-11435 -RRB- denotes )
T6201 14270-14271 -RRB- denotes )
T6200 14268-14270 NN denotes 3A
T6199 14261-14267 NN denotes Figure
T6198 14260-14261 -LRB- denotes (
T6197 14258-14259 -RRB- denotes ]
T6196 14257-14258 CD denotes 5
T6195 14256-14257 -LRB- denotes [
T6194 14250-14255 NN denotes sites
T6193 14242-14249 NN denotes binding
T6192 14232-14241 NN denotes consensus
T6191 14223-14231 NN denotes Sox/Sox6
T6190 14219-14222 CD denotes two
T6189 14211-14218 VB denotes reveals
T6188 14204-14210 NN denotes region
T6187 14198-14203 JJ denotes short
T6186 14193-14197 DT denotes this
T6185 14190-14192 IN denotes of
T6184 14181-14189 NN denotes Analysis
T6183 14169-14179 NN denotes repression
T6182 14164-14168 NN denotes Sox6
T6181 14160-14163 IN denotes for
T6180 14151-14159 JJ denotes critical
T6179 14148-14150 VB denotes is
T6178 14143-14147 WDT denotes that
T6177 14134-14142 NN denotes promoter
T6176 14125-14133 JJ denotes proximal
T6175 14122-14124 JJ denotes ɛy
T6174 14118-14121 DT denotes the
T6173 14111-14117 IN denotes within
T6172 14109-14110 -RRB- denotes )
T6171 14106-14109 CD denotes −37
T6170 14103-14105 TO denotes to
T6169 14099-14102 CD denotes −63
T6168 14098-14099 -LRB- denotes (
T6167 14091-14097 NN denotes region
T6166 14089-14090 DT denotes a
T6165 14081-14088 VB denotes defined
T6164 14079-14080 -COMMA- denotes ,
T6163 14077-14079 NN denotes 2C
T6162 14070-14076 NN denotes Figure
T6161 14067-14069 IN denotes in
T6160 14061-14066 VB denotes shown
T6159 14058-14060 IN denotes as
T6158 14056-14057 -COMMA- denotes ,
T6157 14048-14056 NN denotes promoter
T6156 14045-14047 JJ denotes ɛy
T6155 14041-14044 DT denotes the
T6154 14038-14040 IN denotes of
T6153 14029-14037 NN denotes analysis
T6152 14020-14028 NN denotes Deletion
T6151 14012-14018 NN denotes manner
T6150 13994-14011 JJ denotes CtBP2-independent
T6149 13992-13993 DT denotes a
T6148 13989-13991 IN denotes in
T5931 11432-11434 NN denotes kb
T5930 11428-11431 CD denotes 2.2
T5929 11427-11428 -LRB- denotes (
T5928 11418-11426 NN denotes promoter
T5927 11409-11417 JJ denotes proximal
T5926 11406-11408 JJ denotes ɛy
T5925 11402-11405 DT denotes the
T5924 11399-11401 TO denotes to
T5923 11397-11398 -RRB- denotes ]
T5922 11395-11397 CD denotes 31
T5921 11394-11395 -LRB- denotes [
T5920 11392-11393 -RRB- denotes )
T5919 11390-11392 NN denotes kb
T5918 11386-11389 CD denotes 2.5
T5917 11385-11386 -LRB- denotes (
T5916 11377-11384 NN denotes element
T5915 11375-11376 -RRB- denotes )
T5914 11371-11375 NN denotes μLCR
T5913 11370-11371 -LRB- denotes (
T5912 11360-11369 NN denotes micro-LCR
T5911 11358-11359 DT denotes a
T5910 11351-11357 VB denotes fusing
T5909 11348-11350 IN denotes by
T5908 11346-11347 -RRB- denotes )
T5907 11341-11346 NN denotes E-Luc
T5906 11340-11341 -LRB- denotes (
T5905 11330-11339 NN denotes construct
T5904 11321-11329 NN denotes reporter
T5903 11312-11320 NN denotes promoter
T5902 11309-11311 JJ denotes ɛy
T5901 11306-11308 DT denotes an
T5900 11296-11305 VB denotes generated
T5899 11293-11295 PRP denotes We
T5898 11290-11291 -RRB- denotes ]
T5897 11288-11290 CD denotes 30
T5896 11287-11288 -LRB- denotes [
T5895 11279-11286 NN denotes globins
T5894 11274-11278 NN denotes beta
T5893 11268-11273 JJ denotes adult
T5892 11264-11267 CC denotes and
T5891 11261-11263 JJ denotes ɛy
T5890 11256-11260 CC denotes both
T5889 11246-11255 VB denotes expresses
T5888 11241-11245 WDT denotes that
T5887 11236-11240 NN denotes line
T5886 11231-11235 NN denotes cell
T5885 11215-11230 JJ denotes erythroleukemic
T5884 11208-11214 JJ denotes murine
T5883 11206-11207 DT denotes a
T5882 11204-11205 -COMMA- denotes ,
T5881 11199-11204 NN denotes cells
T5880 11193-11198 NN denotes GM979
T5879 11189-11192 CC denotes and
T5878 11183-11188 NN denotes assay
T5877 11170-11182 NN denotes transfection
T5876 11160-11169 JJ denotes transient
T5875 11154-11159 FW denotes vitro
T5874 11151-11153 FW denotes in
T5873 11148-11150 DT denotes an
T5872 11143-11147 VB denotes used
T5871 11140-11142 PRP denotes we
T5870 11138-11139 -COMMA- denotes ,
T5869 11133-11138 NN denotes level
T5868 11117-11132 JJ denotes transcriptional
T5867 11113-11116 DT denotes the
T5866 11110-11112 IN denotes at
T5865 11101-11109 NN denotes promoter
T5864 11096-11100 NN denotes gene
T5863 11093-11095 JJ denotes ɛy
T5862 11089-11092 DT denotes the
T5861 11086-11088 IN denotes on
T5860 11081-11085 VB denotes acts
T5859 11072-11080 RB denotes directly
T5858 11067-11071 NN denotes Sox6
T5857 11059-11066 IN denotes whether
T5856 11047-11058 VB denotes investigate
T5855 11044-11046 TO denotes To
T5854 11034-11042 NN denotes promoter
T5853 11031-11033 JJ denotes ɛy
T5852 11027-11030 DT denotes the
T5851 11024-11026 IN denotes of
T5850 11015-11023 NN denotes activity
T5849 10999-11014 JJ denotes transcriptional
T5848 10995-10998 RB denotes not
T5847 10993-10994 -COMMA- denotes ,
T5846 10989-10993 NN denotes mRNA
T5845 10986-10988 JJ denotes ɛy
T5844 10983-10985 IN denotes of
T5843 10976-10982 NN denotes levels
T5842 10963-10975 JJ denotes steady-state
T5841 10955-10962 NN denotes measure
T5840 10953-10954 -RRB- denotes )
T5839 10952-10953 CD denotes 1
T5838 10945-10951 NN denotes Figure
T5837 10944-10945 -LRB- denotes (
T5836 10937-10943 NN denotes assays
T5835 10933-10936 NN denotes PCR
T5834 10923-10932 JJ denotes Real-time
T5833 10917-10922 NNP denotes Level
T5832 10901-10916 NNP denotes Transcriptional
T5831 10897-10900 DT denotes the
T5830 10894-10896 IN denotes at
T5829 10885-10893 NN denotes Promoter
T5828 10880-10884 NN denotes Gene
T5827 10877-10879 JJ denotes ɛy
T5826 10873-10876 DT denotes the
T5825 10863-10872 VB denotes Represses
T5824 10854-10862 RB denotes Directly
T5823 10849-10853 NN denotes Sox6
T5822 10844-10848 DT denotes That
T5821 10835-10843 NNP denotes Indicate
T5820 10829-10834 NNP denotes Cells
T5819 10823-10828 NN denotes GM979
T5818 10817-10822 VB denotes Using
T5817 10809-10816 NN denotes Studies
T5816 10796-10808 NN denotes Transfection
T4754 9701-9702 -RRB- denotes ]
T4753 9699-9701 CD denotes 14
T4752 9698-9699 -LRB- denotes [
T4751 9691-9697 NN denotes defect
T4750 9685-9690 NN denotes heart
T4749 9681-9684 DT denotes the
T4748 9676-9680 IN denotes from
T4747 9665-9675 RB denotes presumably
T4746 9664-9665 -LRB- denotes (
T4745 9659-9663 NN denotes mice
T4744 9652-9658 JJ denotes mutant
T4743 9649-9651 IN denotes of
T4742 9639-9648 NN denotes lethality
T4741 9629-9638 JJ denotes Perinatal
T4740 9626-9627 -RRB- denotes )
T4739 9625-9626 CD denotes 1
T4738 9618-9624 NN denotes Figure
T4737 9617-9618 -LRB- denotes (
T4736 9613-9616 NN denotes dpc
T4735 9608-9612 CD denotes 18.5
T4734 9605-9607 IN denotes at
T4733 9600-9604 NN denotes mice
T4732 9597-9599 JJ denotes WT
T4731 9594-9596 IN denotes in
T4730 9589-9593 IN denotes than
T4729 9584-9588 NN denotes mice
T4728 9573-9583 JJ denotes homozygous
T4727 9567-9572 NN denotes p100H
T4726 9564-9566 IN denotes in
T4725 9557-9563 JJ denotes higher
T4723 9543-9547 RB denotes also
T4722 9540-9542 VB denotes is
T4721 9533-9539 NN denotes globin
T4720 9531-9532 NN denotes β
T4719 9525-9530 JJ denotes adult
T4718 9522-9524 IN denotes of
T4717 9516-9521 NN denotes level
T4716 9505-9515 NN denotes expression
T4715 9501-9504 DT denotes the
T4714 9499-9500 -COMMA- denotes ,
T4713 9491-9499 RB denotes Moreover
T4712 9488-9489 -RRB- denotes )
T4711 9487-9488 CD denotes 1
T4710 9480-9486 NN denotes Figure
T4709 9479-9480 -LRB- denotes (
T4708 9475-9478 NN denotes dpc
T4707 9470-9474 CD denotes 18.5
T4706 9467-9469 IN denotes at
T4705 9460-9466 NN denotes globin
T4704 9457-9459 JJ denotes ɛy
T4703 9453-9456 IN denotes for
T4702 9448-9452 VB denotes seen
T4701 9443-9447 IN denotes than
T4700 9436-9442 NN denotes extent
T4699 9429-9435 JJ denotes lesser
T4698 9424-9428 RB denotes much
T4697 9422-9423 DT denotes a
T4696 9419-9421 TO denotes to
T4695 9415-9418 CC denotes but
T4694 9413-9414 -COMMA- denotes ,
T4693 9409-9413 NN denotes mice
T4692 9406-9408 JJ denotes WT
T4691 9401-9405 IN denotes with
T4690 9392-9400 VB denotes compared
T4689 9390-9391 -COMMA- denotes ,
T4688 9386-9390 NN denotes mice
T4687 9375-9385 JJ denotes homozygous
T4686 9369-9374 NN denotes p100H
T4685 9366-9368 IN denotes in
T4684 9359-9365 JJ denotes higher
T4683 9354-9358 RB denotes also
T4682 9350-9353 VB denotes are
T4681 9348-9349 -RRB- denotes )
T4680 9345-9348 NN denotes βh1
T4679 9341-9344 CC denotes and
T4678 9339-9340 NN denotes ζ
T4677 9338-9339 -LRB- denotes (
T4676 9332-9337 NN denotes genes
T4675 9325-9331 NN denotes globin
T4674 9315-9324 JJ denotes embryonic
T4673 9311-9314 CD denotes two
T4672 9305-9310 JJ denotes other
T4671 9301-9304 DT denotes the
T4670 9298-9300 IN denotes of
T4669 9291-9297 NN denotes levels
T4668 9280-9290 NN denotes expression
T4667 9276-9279 DT denotes the
T4666 9274-9275 -COMMA- denotes ,
T4665 9261-9274 RB denotes Interestingly
T4664 9258-9259 -RRB- denotes )
T4663 9254-9258 NN denotes data
T4662 9242-9253 JJ denotes unpublished
T4661 9241-9242 -LRB- denotes (
T4660 9236-9240 NN denotes mice
T4659 9223-9235 JJ denotes heterozygous
T4658 9219-9222 CC denotes and
T4657 9216-9218 NN denotes WT
T4656 9208-9215 IN denotes between
T4655 9203-9207 VB denotes seen
T4654 9199-9202 VB denotes was
T4653 9188-9198 NN denotes difference
T4652 9185-9187 DT denotes No
T4651 9179-9183 NN denotes mice
T4650 9176-9178 JJ denotes WT
T4649 9173-9175 IN denotes in
T4648 9164-9172 VB denotes observed
T4647 9153-9163 NN denotes expression
T4646 9150-9152 IN denotes in
T4645 9142-9149 NN denotes decline
T4644 9138-9141 DT denotes the
T4643 9135-9137 TO denotes to
T4642 9126-9134 NN denotes contrast
T4641 9123-9125 IN denotes in
T4640 9121-9122 -COMMA- denotes ,
T4639 9117-9121 NN denotes mice
T4638 9110-9116 JJ denotes mutant
T4637 9107-9109 IN denotes in
T4636 9100-9106 NN denotes points
T4635 9095-9099 NN denotes time
T4634 9090-9094 DT denotes both
T4633 9087-9089 IN denotes at
T4632 9080-9086 NN denotes levels
T4631 9075-9079 JJ denotes high
T4630 9072-9074 IN denotes at
T4629 9062-9071 VB denotes expressed
T4628 9059-9061 VB denotes is
T4627 9054-9058 NN denotes gene
T4626 9051-9053 JJ denotes ɛy
T4625 9047-9050 DT denotes the
T4624 9045-9046 -COMMA- denotes ,
T4623 9044-9045 CD denotes 1
T4622 9037-9043 NN denotes Figure
T4621 9034-9036 IN denotes in
T4620 9028-9033 VB denotes shown
T4619 9025-9027 IN denotes As
T4618 9020-9023 NN denotes dpc
T4617 9015-9019 CD denotes 18.5
T4616 9011-9014 CC denotes and
T4615 9007-9010 NN denotes dpc
T4614 9002-9006 CD denotes 15.5
T4613 9000-9001 -COMMA- denotes ,
T4612 8994-9000 NN denotes stages
T4611 8980-8993 JJ denotes developmental
T4610 8976-8979 CD denotes two
T4609 8973-8975 IN denotes at
T4608 8966-8972 NN denotes livers
T4607 8960-8965 NN denotes mouse
T4606 8957-8959 JJ denotes WT
T4605 8953-8956 CC denotes and
T4604 8946-8952 NN denotes mutant
T4603 8940-8945 NN denotes p100H
T4602 8937-8939 IN denotes in
T4601 8931-8936 NN denotes genes
T4600 8924-8930 NN denotes globin
T4599 8918-8923 JJ denotes other
T4598 8915-8917 IN denotes of
T4597 8908-8914 NN denotes levels
T4596 8897-8907 NN denotes expression
T4595 8893-8896 DT denotes the
T4594 8882-8892 VB denotes quantitate
T4593 8879-8881 TO denotes to
T4592 8874-8878 VB denotes used
T4591 8870-8873 VB denotes was
T4590 8866-8869 NN denotes PCR
T4589 8856-8865 JJ denotes Real-time
T4588 8853-8854 -RRB- denotes )
T4587 8849-8853 NN denotes data
T4586 8837-8848 JJ denotes unpublished
T4585 8836-8837 -LRB- denotes (
T4584 8834-8835 -RRB- denotes )
T4583 8831-8834 NN denotes PCR
T4582 8830-8831 -LRB- denotes (
T4581 8821-8829 NN denotes reaction
T4580 8815-8820 NN denotes chain
T4579 8804-8814 NN denotes polymerase
T4578 8794-8803 JJ denotes real-time
T4577 8788-8793 VB denotes using
T4576 8786-8787 -RRB- denotes ]
T4575 8784-8786 CD denotes 13
T4574 8783-8784 -LRB- denotes [
T4573 8778-8782 NN denotes Sox6
T4572 8775-8777 IN denotes of
T4571 8768-8774 NN denotes allele
T4570 8758-8767 JJ denotes knock-out
T4569 8746-8757 JJ denotes independent
T4568 8743-8745 DT denotes an
T4567 8740-8742 IN denotes in
T4566 8730-8739 VB denotes confirmed
T4565 8726-8729 VB denotes was
T4564 8714-8725 NN denotes observation
T4563 8706-8713 JJ denotes initial
T4562 8701-8705 DT denotes This
T4561 8692-8699 NN denotes targets
T4560 8681-8691 JJ denotes downstream
T4559 8676-8680 NN denotes Sox6
T4558 8667-8675 VB denotes identify
T4557 8664-8666 TO denotes to
T4556 8650-8663 NN denotes hybridization
T4555 8638-8649 JJ denotes subtractive
T4554 8632-8637 VB denotes using
T4553 8626-8631 NN denotes mouse
T4552 8619-8625 NN denotes p 100H
T4551 8615-8618 DT denotes the
T4550 8612-8614 IN denotes in
T4549 8601-8611 NN denotes transcript
T4548 8589-8600 VB denotes upregulated
T4547 8586-8588 DT denotes an
T4546 8583-8585 IN denotes as
T4545 8572-8582 VB denotes identified
T4544 8562-8571 RB denotes initially
T4543 8558-8561 VB denotes was
T4542 8553-8557 NN denotes gene
T4541 8546-8552 NN denotes globin
T4540 8543-8545 JJ denotes ɛy
T4539 8539-8542 DT denotes The
T4875 10377-10381 NN denotes mice
T4874 10374-10376 JJ denotes WT
T4873 10363-10373 JJ denotes homozygous
T4872 10359-10362 NN denotes dpc
T4871 10354-10358 CD denotes 18.5
T4870 10350-10353 CC denotes and
T4869 10346-10349 NN denotes dpc
T4868 10341-10345 CD denotes 15.5
T4867 10338-10340 IN denotes of
T4866 10331-10337 NN denotes livers
T4865 10327-10330 DT denotes the
T4864 10324-10326 IN denotes in
T4863 10313-10323 NN denotes expression
T4862 10304-10312 NN denotes βmaj/min
T4861 10301-10303 IN denotes of
T4860 10295-10300 NN denotes level
T4859 10291-10294 DT denotes the
T4858 10288-10290 TO denotes to
T4857 10277-10287 JJ denotes equivalent
T4856 10263-10276 RB denotes statistically
T4855 10260-10262 VB denotes is
T4854 10255-10259 NN denotes mice
T4853 10248-10254 JJ denotes mutant
T4852 10237-10247 JJ denotes homozygous
T4851 10233-10236 NN denotes dpc
T4850 10228-10232 CD denotes 18.5
T4849 10224-10227 CC denotes and
T4848 10220-10223 NN denotes dpc
T4847 10215-10219 CD denotes 15.5
T4846 10212-10214 IN denotes of
T4845 10205-10211 NN denotes livers
T4844 10201-10204 DT denotes the
T4843 10198-10200 IN denotes in
T4842 10187-10197 NN denotes expression
T4841 10184-10186 JJ denotes ɛy
T4840 10181-10183 IN denotes of
T4839 10175-10180 NN denotes level
T4838 10171-10174 DT denotes the
T4837 10166-10170 IN denotes that
T4836 10161-10165 VB denotes note
T4835 10158-10160 PRP denotes We
T4834 10155-10156 -RRB- denotes ]
T4833 10153-10155 CD denotes 29
T4832 10152-10153 -LRB- denotes [
T4831 10147-10151 NN denotes mice
T4830 10141-10146 JJ denotes fetal
T4829 10138-10140 JJ denotes WT
T4828 10134-10137 IN denotes for
T4827 10126-10133 NN denotes results
T4826 10116-10125 VB denotes published
T4825 10105-10115 RB denotes previously
T4824 10100-10104 IN denotes with
T4823 10090-10099 NN denotes agreement
T4822 10087-10089 IN denotes in
T4821 10083-10086 VB denotes are
T4820 10079-10082 CC denotes and
T4819 10071-10078 NN denotes samples
T4818 10067-10070 DT denotes all
T4817 10060-10066 IN denotes across
T4816 10049-10059 JJ denotes comparable
T4815 10044-10048 RB denotes thus
T4814 10040-10043 VB denotes are
T4813 10036-10039 CC denotes and
T4812 10029-10035 NN denotes levels
T4811 10020-10028 JJ denotes relative
T4810 10016-10019 VB denotes are
T4809 10010-10015 VB denotes shown
T4808 10003-10009 NN denotes levels
T4807 9999-10002 DT denotes the
T4806 9997-9998 -COMMA- denotes ,
T4805 9990-9997 NN denotes control
T4804 9981-9989 JJ denotes internal
T4803 9976-9980 JJ denotes same
T4802 9972-9975 DT denotes the
T4801 9967-9971 IN denotes with
T4800 9962-9966 NN denotes time
T4799 9957-9961 JJ denotes same
T4798 9953-9956 DT denotes the
T4797 9950-9952 IN denotes at
T4796 9940-9949 VB denotes performed
T4795 9935-9939 VB denotes were
T4794 9928-9934 NN denotes assays
T4793 9924-9927 DT denotes the
T4792 9921-9923 IN denotes of
T4791 9917-9920 DT denotes all
T4790 9909-9916 IN denotes Because
T4789 9906-9907 -RRB- denotes )
T4788 9902-9906 NN denotes bars
T4787 9896-9901 NN denotes error
T4786 9893-9895 IN denotes by
T4785 9887-9892 VB denotes shown
T4784 9884-9886 VB denotes is
T4783 9879-9883 NN denotes data
T4782 9875-9878 DT denotes the
T4781 9872-9874 IN denotes of
T4780 9862-9871 NN denotes deviation
T4779 9853-9861 JJ denotes standard
T4778 9852-9853 -LRB- denotes (
T4777 9841-9851 NN denotes triplicate
T4776 9838-9840 IN denotes in
T4775 9828-9837 VB denotes performed
T4774 9823-9827 VB denotes were
T4773 9818-9822 WDT denotes that
T4772 9810-9817 NN denotes results
T4771 9806-9809 NN denotes PCR
T4770 9801-9805 NN denotes time
T4769 9796-9800 JJ denotes real
T4768 9785-9795 NN denotes illustrate
T4767 9783-9784 CD denotes 1
T4766 9776-9782 NN denotes Figure
T4765 9773-9775 IN denotes in
T4764 9766-9772 NN denotes graphs
T4763 9762-9765 DT denotes The
T4762 9750-9760 NN denotes expression
T4761 9743-9749 NN denotes globin
T4760 9733-9742 JJ denotes postnatal
T4759 9722-9732 VB denotes evaluating
T4758 9717-9721 IN denotes from
T4757 9714-9716 PRP denotes us
T4756 9704-9713 VB denotes precludes
T4755 9702-9703 -RRB- denotes )
T4538 8534-8538 NN denotes Mice
T4537 8519-8533 JJ denotes Sox6-Deficient
T4536 8516-8518 IN denotes in
T4535 8514-8515 -COMMA- denotes ,
T4534 8512-8514 NNP denotes ɛy
T4533 8510-8511 -COMMA- denotes ,
T4532 8504-8510 NNP denotes Globin
T4531 8494-8503 NNP denotes Embryonic
T4530 8490-8493 DT denotes the
T4529 8487-8489 IN denotes of
T4528 8476-8486 NN denotes Expression
T4527 8465-8475 JJ denotes Persistent
T2683 8439-8453 NN denotes erythropoiesis
T2682 8428-8438 JJ denotes definitive
T2681 8425-8427 IN denotes in
T2680 8415-8424 NN denotes functions
T2679 8410-8414 NN denotes Sox6
T2678 8405-8409 IN denotes that
T2677 8391-8404 VB denotes demonstrating
T2676 8389-8390 -COMMA- denotes ,
T2675 8384-8389 NN denotes liver
T2674 8378-8383 JJ denotes fetal
T2673 8374-8377 DT denotes the
T2672 8371-8373 IN denotes in
T2671 8361-8370 VB denotes expressed
T2670 8349-8360 RB denotes ectopically
T2669 8346-8348 VB denotes is
T2668 8339-8345 NN denotes globin
T2667 8336-8338 JJ denotes ɛy
T2666 8334-8335 -COMMA- denotes ,
T2665 8330-8334 NN denotes Sox6
T2664 8327-8329 IN denotes of
T2663 8319-8326 NN denotes absence
T2662 8315-8318 DT denotes the
T2661 8312-8314 IN denotes In
T2660 8304-8310 NN denotes globin
T2659 8301-8303 JJ denotes ɛy
T2658 8298-8300 IN denotes of
T2657 8290-8297 NN denotes pattern
T2656 8279-8289 NN denotes expression
T2655 8270-8278 JJ denotes opposite
T2654 8266-8269 DT denotes the
T2653 8264-8265 -COMMA- denotes ,
T2652 8259-8264 NN denotes liver
T2651 8253-8258 JJ denotes fetal
T2650 8250-8252 IN denotes in
T2649 8240-8249 VB denotes expressed
T2648 8237-8239 VB denotes is
T2647 8233-8236 CC denotes but
T2646 8231-8232 -COMMA- denotes ,
T2645 8224-8231 NN denotes islands
T2644 8218-8223 NN denotes blood
T2643 8214-8217 NN denotes sac
T2642 8209-8213 NN denotes yolk
T2641 8206-8208 IN denotes in
T2640 8196-8205 VB denotes expressed
T2639 8192-8195 RB denotes not
T2638 8189-8191 VB denotes is
T2637 8184-8188 NN denotes Sox6
T2636 8182-8183 -COMMA- denotes ,
T2635 8178-8182 NN denotes mice
T2634 8176-8177 -RRB- denotes )
T2633 8174-8176 JJ denotes WT
T2632 8173-8174 -LRB- denotes (
T2631 8163-8172 JJ denotes wild-type
T2630 8160-8162 IN denotes In
T2629 8145-8158 NN denotes transcription
T2628 8141-8144 PRP-DOLLAR- denotes its
T2627 8131-8140 VB denotes represses
T2626 8127-8130 CC denotes and
T2625 8120-8126 NN denotes globin
T2624 8117-8119 JJ denotes ɛy
T2623 8114-8116 IN denotes of
T2622 8105-8113 NN denotes promoter
T2621 8096-8104 JJ denotes proximal
T2620 8092-8095 DT denotes the
T2619 8089-8091 TO denotes to
T2618 8083-8088 VB denotes binds
T2617 8078-8082 NN denotes Sox6
T2616 8073-8077 IN denotes that
T2615 8068-8072 VB denotes show
T2614 8065-8067 PRP denotes We
T2613 8059-8063 NN denotes gene
T2612 8052-8058 NN denotes globin
T2611 8049-8051 JJ denotes ɛy
T2610 8045-8048 DT denotes the
T2609 8042-8044 IN denotes on
T2608 8037-8041 NN denotes Sox6
T2607 8034-8036 IN denotes of
T2606 8026-8033 NN denotes effects
T2605 8022-8025 DT denotes the
T2604 8009-8021 VB denotes characterize
T2603 8005-8008 CC denotes and
T2602 7996-8004 VB denotes describe
T2601 7993-7995 PRP denotes we
T2600 7988-7992 RB denotes Here
T2599 7982-7986 NN denotes gene
T2598 7975-7981 NN denotes globin
T2597 7972-7974 JJ denotes ɛy
T2596 7962-7971 JJ denotes embryonic
T2595 7958-7961 DT denotes the
T2594 7955-7957 IN denotes of
T2593 7944-7954 NN denotes expression
T2592 7939-7943 JJ denotes high
T2591 7936-7938 IN denotes of
T2590 7924-7935 NN denotes persistence
T2589 7920-7923 DT denotes the
T2588 7917-7919 VB denotes is
T2587 7910-7916 NN denotes effect
T2586 7902-7909 JJ denotes extreme
T2585 7897-7901 RB denotes most
T2584 7893-7896 DT denotes The
T2583 7886-7891 NN denotes genes
T2582 7879-7885 NN denotes globin
T2581 7869-7878 JJ denotes embryonic
T2580 7866-7868 IN denotes of
T2579 7855-7865 NN denotes expression
T2578 7848-7854 JJ denotes higher
T2577 7844-7847 CC denotes and
T2576 7842-7843 -RRB- denotes )
T2575 7841-7842 -RRB- denotes ]
T2574 7839-7841 CD denotes 27
T2573 7838-7839 -LRB- denotes [
T2572 7826-7837 NN denotes bloodstream
T2571 7822-7825 DT denotes the
T2570 7813-7821 VB denotes entering
T2569 7810-7812 TO denotes to
T2568 7804-7809 JJ denotes prior
T2567 7794-7803 VB denotes enucleate
T2566 7785-7793 RB denotes normally
T2565 7780-7784 IN denotes that
T2564 7779-7780 -LRB- denotes (
T2563 7766-7778 NN denotes erythrocytes
T2562 7763-7765 IN denotes of
T2561 7752-7762 NN denotes maturation
T2560 7744-7751 VB denotes delayed
T2559 7736-7743 VB denotes include
T2558 7728-7735 NN denotes effects
T2557 7722-7727 DT denotes These
T2556 7706-7720 NN denotes erythropoiesis
T2555 7703-7705 IN denotes on
T2554 7695-7702 NN denotes effects
T2553 7683-7694 JJ denotes pleiotropic
T2552 7676-7682 VB denotes exerts
T2551 7671-7675 RB denotes also
T2550 7666-7670 NN denotes Sox6
T2549 7661-7665 IN denotes that
T2548 7652-7660 VB denotes describe
T2547 7649-7651 PRP denotes we
T2546 7647-7648 -COMMA- denotes ,
T2545 7642-7647 NN denotes study
T2544 7637-7641 DT denotes this
T2543 7634-7636 IN denotes In
T2542 7631-7632 -RRB- denotes ]
T2541 7629-7631 CD denotes 28
T2540 7628-7629 -LRB- denotes [
T2539 7620-7627 NN denotes lineage
T2538 7613-7619 NN denotes marrow
T2537 7608-7612 NN denotes bone
T2536 7602-7607 NN denotes mouse
T2535 7596-7601 JJ denotes adult
T2534 7593-7595 IN denotes of
T2533 7581-7592 NN denotes progenitors
T2532 7569-7580 JJ denotes multipotent
T2531 7564-7568 IN denotes with
T2530 7555-7563 VB denotes compared
T2529 7553-7554 -RRB- denotes )
T2528 7547-7553 NN denotes LT-HSC
T2527 7546-7547 -LRB- denotes (
T2526 7540-7545 NN denotes cells
T2525 7535-7539 NN denotes stem
T2524 7521-7534 NN denotes hematopoiesis
T2523 7511-7520 JJ denotes long-term
T2522 7508-7510 IN denotes in
T2521 7496-7507 VB denotes upregulated
T2520 7493-7495 VB denotes is
T2519 7488-7492 NN denotes Sox6
T2518 7483-7487 IN denotes that
T2517 7477-7482 VB denotes shown
T2516 7473-7476 VB denotes was
T2515 7470-7472 PRP denotes it
T2514 7468-7469 -COMMA- denotes ,
T2513 7467-7468 -RRB- denotes ]
T2512 7462-7467 CD denotes 14,15
T2511 7461-7462 -LRB- denotes [
T2510 7454-7460 NN denotes muscle
T2509 7450-7453 CC denotes and
T2508 7448-7449 -COMMA- denotes ,
T2507 7447-7448 -RRB- denotes ]
T2506 7440-7447 CD denotes 6,12,13
T2505 7439-7440 -LRB- denotes [
T2504 7429-7438 NN denotes cartilage
T2503 7427-7428 -COMMA- denotes ,
T2502 7426-7427 -RRB- denotes ]
T2501 7422-7426 CD denotes 8–11
T2500 7421-7422 -LRB- denotes [
T2499 7414-7420 NN denotes system
T2498 7406-7413 JJ denotes nervous
T2497 7398-7405 JJ denotes central
T2496 7394-7397 DT denotes the
T2495 7391-7393 IN denotes of
T2494 7379-7390 NN denotes development
T2493 7375-7378 DT denotes the
T2492 7372-7374 IN denotes in
T2491 7367-7371 NN denotes role
T2490 7357-7366 JJ denotes important
T2489 7354-7356 DT denotes an
T2488 7346-7353 VB denotes playing
T2470 7235-7237 IN denotes of
T2469 7225-7234 NN denotes silencing
T2468 7221-7224 DT denotes the
T2467 7216-7220 IN denotes that
T2466 7208-7215 VB denotes appears
T2465 7205-7207 PRP denotes it
T2464 7203-7204 -COMMA- denotes ,
T2463 7199-7203 RB denotes Thus
T2462 7196-7197 -RRB- denotes ]
T2461 7194-7196 CD denotes 27
T2460 7193-7194 -LRB- denotes [
T2459 7183-7192 VB denotes silencing
T2458 7181-7182 RB denotes ɛ
T2457 7172-7180 VB denotes regulate
T2456 7169-7171 TO denotes to
T2455 7167-7168 -RRB- denotes )
T2454 7158-7167 NN denotes complexes
T2453 7150-7157 NN denotes protein
T2452 7147-7149 IN denotes of
T2451 7142-7146 NN denotes part
T2450 7139-7141 IN denotes as
T2449 7138-7139 -LRB- denotes (
T2448 7129-7137 NN denotes elements
T2447 7125-7128 NN denotes DNA
T2446 7119-7124 DT denotes these
T2445 7116-7118 TO denotes to
T2444 7111-7115 VB denotes bind
T2443 7102-7110 RB denotes directly
T2442 7099-7101 TO denotes to
T2441 7093-7098 VB denotes shown
T2440 7089-7092 CC denotes and
T2439 7078-7088 VB denotes identified
T2438 7073-7077 VB denotes been
T2437 7068-7072 VB denotes have
T2436 7063-7067 NNP denotes DRED
T2435 7059-7062 CC denotes and
T2434 7057-7058 -COMMA- denotes ,
T2433 7050-7057 NN denotes COUP-TF
T2432 7048-7049 -COMMA- denotes ,
T2431 7044-7048 NN denotes YY-1
T2430 7042-7043 -COMMA- denotes ,
T2429 7036-7042 NN denotes GATA-1
T2428 7033-7035 IN denotes as
T2427 7028-7032 JJ denotes such
T2426 7026-7027 -COMMA- denotes ,
T2425 7019-7026 NN denotes factors
T2424 7005-7018 NN denotes transcription
T2423 6991-7004 JJ denotes corresponding
T2422 6985-6990 PRP-DOLLAR- denotes Their
T2421 6982-6983 -RRB- denotes ]
T2420 6980-6982 CD denotes 27
T2419 6979-6980 -LRB- denotes [
T2418 6970-6978 NN denotes promoter
T2417 6965-6969 NN denotes gene
T2416 6963-6964 NN denotes ɛ
T2415 6956-6962 JJ denotes distal
T2414 6952-6955 DT denotes the
T2413 6948-6951 CC denotes and
T2412 6939-6947 JJ denotes proximal
T2411 6935-6938 DT denotes the
T2410 6930-6934 CC denotes both
T2409 6927-6929 IN denotes in
T2408 6916-6926 VB denotes identified
T2407 6905-6915 RB denotes previously
T2406 6900-6904 VB denotes been
T2405 6895-6899 VB denotes have
T2404 6887-6894 NN denotes process
T2403 6877-6886 NN denotes silencing
T2402 6873-6876 DT denotes the
T2401 6870-6872 TO denotes to
T2400 6860-6869 JJ denotes important
T2399 6851-6859 NN denotes elements
T2398 6847-6850 NN denotes DNA
T2397 6838-6846 JJ denotes multiple
T2396 6836-6837 -COMMA- denotes ,
T2395 6830-6836 NN denotes assays
T2394 6817-6829 NN denotes transfection
T2393 6812-6816 NN denotes cell
T2392 6808-6811 CC denotes and
T2391 6801-6807 NN denotes models
T2390 6795-6800 NN denotes mouse
T2389 6784-6794 JJ denotes transgenic
T2388 6781-6783 IN denotes in
T2387 6772-6780 NN denotes analyses
T2386 6763-6771 NN denotes deletion
T2385 6754-6762 NN denotes promoter
T2384 6748-6753 VB denotes Using
T2383 6736-6746 JJ denotes autonomous
T2382 6731-6735 NN denotes gene
T2381 6721-6730 RB denotes primarily
T2380 6718-6720 VB denotes is
T2379 6708-6717 NN denotes silencing
T2378 6703-6707 IN denotes that
T2377 6692-6702 VB denotes suggesting
T2376 6690-6691 -COMMA- denotes ,
T2375 6689-6690 -RRB- denotes ]
T2374 6687-6689 CD denotes 27
T2373 6686-6687 -LRB- denotes [
T2372 6676-6685 NN denotes sequences
T2371 6667-6675 JJ denotes adjacent
T2370 6664-6666 IN denotes in
T2369 6661-6663 CC denotes or
T2368 6656-6660 NN denotes gene
T2367 6654-6655 NN denotes ɛ
T2366 6650-6653 DT denotes the
T2365 6643-6649 IN denotes within
T2364 6639-6642 VB denotes are
T2363 6634-6638 NN denotes gene
T2362 6627-6633 NN denotes globin
T2361 6625-6626 NN denotes ɛ
T2360 6621-6624 DT denotes the
T2359 6611-6620 VB denotes silencing
T2358 6607-6610 IN denotes for
T2357 6595-6606 JJ denotes responsible
T2356 6586-6594 NN denotes elements
T2355 6582-6585 DT denotes the
T2354 6578-6581 PDT denotes All
T2353 6575-6576 -RRB- denotes ]
T2352 6570-6575 CD denotes 24,25
T2351 6569-6570 -LRB- denotes [
T2350 6565-6568 NN denotes LCR
T2349 6561-6564 DT denotes the
T2348 6557-6560 IN denotes for
T2347 6545-6556 NN denotes competition
T2346 6536-6544 NN denotes promoter
T2345 6533-6535 IN denotes by
T2344 6522-6532 VB denotes controlled
T2343 6519-6521 VB denotes is
T2342 6512-6518 NN denotes switch
T2341 6503-6511 JJ denotes β-globin
T2340 6497-6502 JJ denotes adult
T2339 6494-6496 TO denotes to
T2338 6485-6493 NN denotes γ-globin
T2337 6481-6484 DT denotes The
T2336 6478-6479 -RRB- denotes ]
T2335 6476-6478 CD denotes 26
T2334 6475-6476 -LRB- denotes [
T2333 6461-6474 RB denotes competitively
T2332 6451-6460 VB denotes regulated
T2331 6448-6450 VB denotes be
T2330 6445-6447 TO denotes to
T2329 6437-6444 VB denotes appears
T2328 6432-6436 RB denotes also
T2327 6430-6431 NN denotes ɛ
T2326 6415-6429 NN denotes erythropoiesis
T2325 6405-6414 JJ denotes primitive
T2324 6402-6404 IN denotes in
T2323 6393-6401 IN denotes although
T2322 6391-6392 -COMMA- denotes ,
T2321 6390-6391 -RRB- denotes ]
T2320 6385-6390 CD denotes 24,25
T2319 6384-6385 -LRB- denotes [
T2318 6371-6383 RB denotes autonomously
T2317 6362-6370 VB denotes silenced
T2316 6358-6361 CC denotes and
T2315 6348-6357 VB denotes activated
T2314 6345-6347 VB denotes is
T2313 6343-6344 NN denotes ɛ
T2312 6341-6342 -COMMA- denotes ,
T2311 6327-6341 NN denotes erythropoiesis
T2310 6316-6326 JJ denotes definitive
T2309 6313-6315 IN denotes In
T2308 6300-6311 RB denotes extensively
T2307 6292-6299 VB denotes studied
T2306 6287-6291 VB denotes been
T2305 6283-6286 VB denotes has
T2304 6281-6282 -COMMA- denotes ,
T2303 6275-6281 NN denotes globin
T2302 6273-6274 NN denotes ɛ
T2301 6271-6272 -COMMA- denotes ,
T2300 6260-6271 NN denotes counterpart
T2299 6254-6259 JJ denotes human
T2298 6250-6253 PRP-DOLLAR- denotes its
T2297 6247-6249 IN denotes of
T2296 6237-6246 NN denotes silencing
T2295 6234-6236 IN denotes of
T2294 6224-6233 NN denotes mechanism
T2293 6220-6223 DT denotes The
T2292 6213-6218 NN denotes cells
T2291 6203-6212 JJ denotes erythroid
T2290 6192-6202 JJ denotes definitive
T2289 6189-6191 IN denotes in
T2288 6180-6188 VB denotes silenced
T2287 6177-6179 VB denotes is
T2286 6172-6176 NN denotes gene
T2285 6169-6171 JJ denotes ɛy
T2284 6165-6168 DT denotes The
T2283 6162-6163 -RRB- denotes ]
T2282 6160-6162 CD denotes 22
T2281 6159-6160 -LRB- denotes [
T2280 6157-6158 -RRB- denotes )
T2279 6152-6157 JJ denotes minor
T2278 6148-6151 CC denotes and
T2277 6142-6147 JJ denotes major
T2276 6140-6141 VB denotes β
T2275 6139-6140 -LRB- denotes (
T2274 6131-6138 NN denotes globins
T2273 6129-6130 JJ denotes β
T2272 6123-6128 JJ denotes adult
T2271 6115-6122 VB denotes express
T2270 6109-6114 NN denotes cells
T2269 6099-6108 JJ denotes erythroid
T2268 6088-6098 JJ denotes definitive
T2267 6082-6087 WRB denotes where
T2266 6076-6081 NN denotes liver
T2265 6070-6075 JJ denotes fetal
T2264 6066-6069 DT denotes the
T2263 6063-6065 TO denotes to
T2262 6056-6062 NN denotes shifts
T2261 6041-6055 NN denotes erythropoiesis
T2260 6039-6040 -COMMA- denotes ,
T2259 6038-6039 -RRB- denotes )
T2258 6035-6038 NN denotes dpc
T2257 6034-6035 -LRB- denotes (
T2256 6027-6033 NN denotes coitus
T2255 6022-6026 NN denotes post
T2230 5885-5887 IN denotes In
T2229 5876-5883 NN denotes fashion
T2228 5855-5875 JJ denotes development-specific
T2227 5851-5854 CC denotes and
T2226 5843-5850 NN denotes tissue-
T2225 5841-5842 DT denotes a
T2224 5838-5840 IN denotes in
T2223 5828-5837 VB denotes expressed
T2222 5824-5827 VB denotes are
T2221 5818-5823 NN denotes genes
T2220 5809-5817 JJ denotes β-globin
T2219 5805-5808 DT denotes The
T2218 5802-5803 -RRB- denotes ]
T2217 5800-5802 CD denotes 23
T2216 5799-5800 -LRB- denotes [
T2215 5794-5798 NN denotes gene
T2214 5791-5793 JJ denotes ɛy
T2213 5787-5790 DT denotes the
T2212 5784-5786 IN denotes of
T2211 5781-5783 NN denotes 5′
T2210 5773-5780 JJ denotes located
T2209 5770-5772 NN denotes kb
T2208 5767-5769 CD denotes 25
T2207 5762-5766 IN denotes over
T2206 5755-5761 VB denotes spread
T2205 5749-5754 NN denotes sites
T2204 5734-5748 JJ denotes hypersensitive
T2203 5725-5733 NN denotes nuclease
T2202 5722-5724 IN denotes of
T2201 5718-5721 NN denotes set
T2200 5716-5717 DT denotes a
T2199 5713-5715 IN denotes by
T2198 5699-5712 VB denotes characterized
T2197 5696-5698 VB denotes is
T2196 5691-5695 WDT denotes that
T2195 5684-5690 NN denotes region
T2194 5676-5683 NN denotes control
T2193 5670-5675 NN denotes locus
T2192 5666-5669 DT denotes the
T2191 5664-5665 -COMMA- denotes ,
T2190 5657-5664 NN denotes element
T2189 5646-5656 JJ denotes regulatory
T2188 5644-5645 DT denotes a
T2187 5635-5643 VB denotes requires
T2186 5629-5634 NN denotes genes
T2185 5623-5628 DT denotes these
T2184 5620-5622 IN denotes of
T2183 5609-5619 NN denotes expression
T2182 5598-5608 JJ denotes High-level
T2181 5595-5596 -RRB- denotes ]
T2180 5593-5595 CD denotes 22
T2179 5592-5593 -LRB- denotes [
T2178 5583-5591 NN denotes function
T2177 5579-5582 CC denotes and
T2176 5569-5578 NN denotes structure
T2175 5554-5568 JJ denotes organizational
T2174 5551-5553 IN denotes in
T2173 5538-5550 NN denotes counterparts
T2172 5532-5537 JJ denotes human
T2171 5526-5531 PRP-DOLLAR- denotes their
T2170 5523-5525 TO denotes to
T2169 5512-5522 JJ denotes homologous
T2168 5505-5511 RB denotes highly
T2167 5501-5504 VB denotes are
T2166 5496-5500 PRP denotes they
T2165 5492-5495 CC denotes and
T2164 5490-5491 CD denotes 7
T2163 5479-5489 NN denotes Chromosome
T2162 5476-5478 IN denotes on
T2161 5466-5475 VB denotes clustered
T2160 5462-5465 VB denotes are
T2159 5460-5461 -RRB- denotes }
T2158 5453-5460 JJ denotes β-minor
T2157 5449-5452 CC denotes and
T2156 5447-5448 -COMMA- denotes ,
T2155 5440-5447 JJ denotes β-major
T2154 5438-5439 -COMMA- denotes ,
T2153 5435-5438 NN denotes βh1
T2152 5433-5434 -COMMA- denotes ,
T2151 5431-5433 NN denotes ɛy
T2150 5430-5431 -LRB- denotes {
T2149 5424-5429 NN denotes genes
T2148 5415-5423 NN denotes β-globin
T2147 5409-5414 NN denotes mouse
T2146 5405-5408 DT denotes The
T2145 5402-5403 -RRB- denotes ]
T2144 5397-5402 CD denotes 18–21
T2143 5396-5397 -LRB- denotes [
T2142 5390-5395 NN denotes genes
T2141 5381-5389 JJ denotes β-globin
T2140 5372-5380 VB denotes modulate
T2139 5369-5371 TO denotes to
T2138 5363-5368 VB denotes shown
T2137 5358-5362 VB denotes been
T2136 5353-5357 VB denotes have
T2135 5344-5352 NN denotes proteins
T2134 5340-5343 NN denotes HMG
T2133 5338-5339 -COMMA- denotes ,
T2132 5326-5338 RB denotes Specifically
T2131 5317-5324 NN denotes factors
T2130 5306-5316 VB denotes associated
T2129 5302-5305 CC denotes and
T2128 5298-5301 NN denotes DNA
T2127 5295-5297 IN denotes of
T2126 5287-5294 NN denotes regions
T2125 5279-5286 JJ denotes distant
T2124 5270-5278 RB denotes together
T2123 5261-5269 VB denotes bringing
T2122 5258-5260 IN denotes by
T2121 5252-5257 NN denotes genes
T2120 5232-5251 JJ denotes chromatin-assembled
T2119 5228-5231 CC denotes and
T2118 5224-5227 NN denotes DNA
T2117 5219-5223 CC denotes both
T2116 5216-5218 IN denotes on
T2487 7343-7345 TO denotes to
T2486 7334-7342 NN denotes addition
T2485 7331-7333 IN denotes In
T2484 7321-7329 NN denotes proteins
T2483 7309-7320 VB denotes transacting
T2482 7305-7308 CC denotes and
T2481 7296-7304 NN denotes elements
T2480 7292-7295 NN denotes cis
T2479 7283-7291 JJ denotes multiple
T2478 7280-7282 IN denotes of
T2477 7272-7279 NN denotes network
T2476 7260-7271 JJ denotes complicated
T2475 7258-7259 DT denotes a
T2474 7249-7257 VB denotes involves
T2473 7244-7248 NN denotes gene
T2472 7242-7243 NN denotes ɛ
T2471 7238-7241 DT denotes the
T2115 5207-5215 NN denotes function
T2114 5198-5206 NN denotes enhancer
T2113 5187-5197 JJ denotes long-range
T2112 5179-5186 VB denotes mediate
T2111 5175-5178 MD denotes can
T2110 5166-5174 NN denotes proteins
T2109 5162-5165 NN denotes HMG
T2108 5156-5161 JJ denotes other
T2107 5152-5155 CC denotes and
T2106 5146-5151 DT denotes these
T2105 5143-5145 IN denotes by
T2104 5133-5142 NN denotes structure
T2103 5129-5132 NN denotes DNA
T2102 5126-5128 IN denotes of
T2101 5115-5125 NN denotes Modulation
T2100 5112-5113 -RRB- denotes ]
T2099 5110-5112 CD denotes 17
T2098 5109-5110 -LRB- denotes [
T2097 5100-5108 NN denotes proteins
T2096 5095-5099 NN denotes HMG2
T2095 5091-5094 CC denotes and
T2094 5086-5090 NN denotes HMG1
T2093 5076-5085 VB denotes expressed
T2092 5063-5075 RB denotes ubiquitously
T2091 5059-5062 DT denotes the
T2090 5055-5058 VB denotes are
T2089 5053-5054 -COMMA- denotes ,
T2088 5042-5053 NN denotes specificity
T2087 5033-5041 NN denotes sequence
T2086 5025-5032 IN denotes without
T2085 5021-5024 CC denotes but
T2084 5019-5020 -COMMA- denotes ,
T2083 5016-5019 NN denotes DNA
T2082 5011-5015 NN denotes bend
T2081 5007-5010 CC denotes and
T2080 5000-5006 NN denotes groove
T2079 4994-4999 JJ denotes minor
T2078 4990-4993 DT denotes the
T2077 4987-4989 TO denotes to
T2076 4982-4986 VB denotes bind
T2075 4972-4981 RB denotes similarly
T2074 4967-4971 WDT denotes that
T2073 4965-4966 -RRB- denotes )
T2072 4959-4965 NN denotes family
T2071 4952-4958 NN denotes factor
T2070 4938-4951 NN denotes transcription
T2069 4934-4937 NN denotes Sox
T2068 4930-4933 DT denotes the
T2067 4927-4929 IN denotes of
T2066 4916-4926 VB denotes identified
T2065 4909-4915 NN denotes member
T2064 4903-4908 JJ denotes first
T2063 4899-4902 DT denotes the
T2062 4898-4899 -LRB- denotes (
T2061 4894-4897 NN denotes Sry
T2060 4891-4893 TO denotes to
T2059 4883-4890 VB denotes related
T2058 4873-4882 RB denotes distantly
T2057 4864-4872 NN denotes proteins
T2056 4860-4863 NN denotes box
T2055 4856-4859 NN denotes HMG
T2054 4852-4855 DT denotes the
T2053 4846-4851 IN denotes Among
T2052 4834-4844 NN denotes phenotypes
T2051 4828-4833 JJ denotes other
T2050 4824-4827 DT denotes all
T2049 4821-4823 IN denotes in
T2048 4810-4820 VB denotes implicated
T2047 4807-4809 VB denotes is
T2046 4800-4806 NN denotes factor
T2045 4786-4799 NN denotes transcription
T2044 4781-4785 NN denotes Sox6
T2043 4777-4780 DT denotes the
T2042 4775-4776 -COMMA- denotes ,
T2041 4774-4775 -RRB- denotes ]
T2040 4772-4774 CD denotes 16
T2039 4771-4772 -LRB- denotes [
T2038 4758-4770 NN denotes pigmentation
T2037 4755-4757 IN denotes in
T2036 4748-4754 RB denotes solely
T2035 4738-4747 VB denotes functions
T2034 4733-4737 NN denotes gene
T2033 4731-4732 NN denotes p
T2032 4727-4730 DT denotes the
T2031 4719-4726 IN denotes Because
T2030 4716-4717 -RRB- denotes ]
T2029 4714-4716 CD denotes 14
T2028 4713-4714 -LRB- denotes [
T2027 4711-4712 -RRB- denotes )
T2026 4700-4711 NN denotes breakpoints
T2025 4688-4699 JJ denotes chromosomal
T2024 4684-4687 DT denotes the
T2023 4681-4683 IN denotes of
T2022 4669-4680 NN denotes nucleotides
T2021 4662-4668 CD denotes 50,000
T2020 4655-4661 IN denotes within
T2019 4650-4654 NN denotes gene
T2018 4644-4649 JJ denotes other
T2017 4641-4643 DT denotes no
T2016 4637-4640 CC denotes and
T2015 4636-4637 -LRB- denotes (
T1782 3299-3302 NN denotes Sox
T1781 3297-3298 -COMMA- denotes ,
T1780 3288-3297 RB denotes Therefore
T1779 3285-3286 -RRB- denotes ]
T1778 3284-3285 CD denotes 4
T1777 3283-3284 -LRB- denotes [
T1776 3279-3282 NN denotes DNA
T1775 3276-3278 IN denotes of
T1774 3269-3275 NN denotes groove
T1773 3263-3268 JJ denotes major
T1772 3259-3262 DT denotes the
T1771 3252-3258 VB denotes target
T1770 3244-3251 NN denotes factors
T1769 3230-3243 NN denotes transcription
T1768 3224-3229 JJ denotes other
T1767 3219-3223 JJ denotes most
T1766 3213-3218 IN denotes while
T1765 3211-3212 -COMMA- denotes ,
T1764 3210-3211 -RRB- denotes ]
T1763 3207-3210 CD denotes 2,3
T1762 3206-3207 -LRB- denotes [
T1761 3198-3205 NN denotes changes
T1760 3183-3197 JJ denotes conformational
T1759 3177-3182 JJ denotes local
T1758 3174-3176 TO denotes to
T1757 3168-3173 VB denotes leads
T1756 3163-3167 WDT denotes that
T1755 3159-3162 NN denotes DNA
T1754 3155-3158 DT denotes the
T1753 3152-3154 IN denotes of
T1752 3147-3151 NN denotes bend
T1751 3139-3146 JJ denotes 70°–85°
T1750 3137-3138 DT denotes a
T1749 3131-3136 VB denotes cause
T1748 3127-3130 CC denotes and
T1747 3123-3126 NN denotes DNA
T1746 3120-3122 IN denotes of
T1745 3113-3119 NN denotes groove
T1744 3107-3112 JJ denotes minor
T1743 3103-3106 DT denotes the
T1742 3100-3102 TO denotes to
T1741 3095-3099 VB denotes bind
T1740 3087-3094 NN denotes factors
T1739 3073-3086 NN denotes transcription
T1738 3069-3072 NN denotes Sox
T1737 3066-3067 -RRB- denotes ]
T1736 3065-3066 CD denotes 1
T1735 3064-3065 -LRB- denotes [
T1734 3056-3063 NN denotes binding
T1733 3052-3055 CC denotes and
T1732 3040-3051 NN denotes recognition
T1731 3036-3039 NN denotes DNA
T1730 3033-3035 IN denotes in
T1729 3024-3032 VB denotes involved
T1728 3018-3023 NN denotes acids
T1727 3012-3017 NN denotes amino
T1726 3009-3011 CD denotes 79
T1725 3006-3008 IN denotes of
T1724 2995-3005 VB denotes consisting
T1723 2993-2994 -COMMA- denotes ,
T1722 2987-2993 NN denotes domain
T1721 2985-2986 -RRB- denotes )
T1720 2982-2985 NN denotes HMG
T1719 2981-2982 -LRB- denotes (
T1718 2975-2980 NN denotes group
T1717 2966-2974 NN denotes mobility
T1716 2961-2965 JJ denotes high
T1715 2951-2960 VB denotes conserved
T1714 2947-2950 DT denotes the
T1713 2944-2946 IN denotes by
T1712 2930-2943 VB denotes characterized
T1711 2923-2929 NN denotes family
T1710 2916-2922 NN denotes factor
T1709 2902-2915 NN denotes transcription
T1708 2898-2901 NN denotes Sox
T1707 2894-2897 DT denotes the
T1706 2891-2893 IN denotes of
T1705 2884-2890 NN denotes member
T2254 6020-6021 NN denotes d
T2253 6015-6019 CD denotes 11.5
T2252 6012-6014 IN denotes At
T2251 6009-6010 -RRB- denotes ]
T2250 6007-6009 CD denotes 22
T2249 6006-6007 -LRB- denotes [
T2248 5998-6005 NN denotes globins
T2247 5993-5997 NN denotes βh-1
T2246 5989-5992 CC denotes and
T2245 5986-5988 JJ denotes ɛy
T2244 5978-5985 VB denotes express
T2243 5972-5977 NN denotes cells
T2242 5962-5971 JJ denotes erythroid
T2241 5952-5961 JJ denotes primitive
T2240 5946-5951 WRB denotes where
T2239 5942-5945 NN denotes sac
T2238 5937-5941 NN denotes yolk
T2237 5927-5936 JJ denotes embryonic
T2236 5923-5926 DT denotes the
T2235 5920-5922 IN denotes in
T2234 5909-5919 VB denotes originates
T2233 5894-5908 NN denotes erythropoiesis
T2232 5892-5893 -COMMA- denotes ,
T2231 5888-5892 NN denotes mice
T1972 4402-4407 NN denotes p100H
T1971 4398-4401 IN denotes for
T1970 4387-4397 JJ denotes homozygous
T1969 4382-4386 NN denotes Mice
T1968 4379-4380 -RRB- denotes ]
T1967 4377-4379 CD denotes 14
T1966 4376-4377 -LRB- denotes [
T1965 4365-4375 NN denotes laboratory
T1964 4361-4364 PRP-DOLLAR- denotes our
T1963 4358-4360 IN denotes in
T1962 4347-4357 VB denotes identified
T1961 4342-4346 VB denotes been
T1960 4331-4341 RB denotes previously
T1959 4327-4330 VB denotes has
T1958 4325-4326 -RRB- denotes )
T1957 4320-4325 NN denotes p100H
T1956 4319-4320 -LRB- denotes (
T1955 4313-4318 NN denotes mouse
T1954 4306-4312 JJ denotes mutant
T1953 4296-4305 JJ denotes Sox6-null
T1952 4294-4295 DT denotes A
T1951 4291-4292 -RRB- denotes ]
T1950 4286-4291 CD denotes 14,15
T1949 4285-4286 -LRB- denotes [
T1948 4278-4284 NN denotes muscle
T1947 4274-4277 CC denotes and
T1946 4272-4273 -COMMA- denotes ,
T1945 4271-4272 -RRB- denotes ]
T1944 4264-4271 CD denotes 6,12,13
T1943 4263-4264 -LRB- denotes [
T1942 4253-4262 NN denotes cartilage
T1941 4251-4252 -COMMA- denotes ,
T1940 4250-4251 -RRB- denotes ]
T1939 4246-4250 CD denotes 8–11
T1938 4245-4246 -LRB- denotes [
T1937 4238-4244 NN denotes system
T1936 4230-4237 JJ denotes nervous
T1935 4222-4229 JJ denotes central
T1934 4218-4221 DT denotes the
T1933 4215-4217 IN denotes of
T1932 4203-4214 NN denotes development
T1931 4199-4202 DT denotes the
T1930 4196-4198 IN denotes in
T1929 4191-4195 NN denotes role
T1928 4189-4190 DT denotes a
T1927 4183-4188 VB denotes plays
T1926 4178-4182 WDT denotes that
T1925 4169-4177 NN denotes molecule
T1924 4158-4168 JJ denotes regulatory
T1923 4148-4157 JJ denotes important
T1922 4145-4147 DT denotes an
T1921 4142-4144 VB denotes is
T1920 4137-4141 NN denotes Sox6
T1919 4132-4136 IN denotes that
T1918 4119-4131 VB denotes demonstrated
T1917 4114-4118 VB denotes have
T1916 4106-4113 NN denotes studies
T1915 4097-4105 JJ denotes previous
T1914 4095-4096 -COMMA- denotes ,
T1913 4085-4095 NN denotes expression
T1912 4080-4084 NN denotes gene
T1911 4069-4079 VB denotes regulating
T1910 4066-4068 IN denotes in
T1909 4056-4065 NN denotes functions
T1908 4051-4055 NN denotes Sox6
T1907 4047-4050 WRB denotes how
T1906 4044-4046 IN denotes of
T1905 4033-4043 RB denotes Regardless
T1904 4030-4031 -RRB- denotes ]
T1903 4029-4030 CD denotes 7
T1902 4028-4029 -LRB- denotes [
T1901 4019-4027 NN denotes proteins
T1900 4013-4018 DT denotes these
T1899 4010-4012 IN denotes of
T1898 4002-4009 NN denotes overlap
T1897 3991-4001 JJ denotes functional
T1896 3980-3990 VB denotes indicating
T1895 3978-3979 -COMMA- denotes ,
T1894 3970-3978 NN denotes splicing
T1893 3961-3969 VB denotes restored
T1892 3952-3960 NN denotes extracts
T1891 3948-3951 DT denotes the
T1890 3945-3947 IN denotes in
T1889 3941-3944 NN denotes Sry
T1888 3938-3940 CC denotes or
T1887 3936-3937 -COMMA- denotes ,
T1886 3932-3936 NN denotes Sox9
T1885 3930-3931 -COMMA- denotes ,
T1884 3926-3930 NN denotes Sox6
T1883 3919-3925 DT denotes either
T1882 3916-3918 IN denotes of
T1881 3909-3915 NN denotes domain
T1880 3905-3908 NN denotes HMG
T1879 3901-3904 DT denotes the
T1878 3898-3900 IN denotes of
T1877 3887-3897 NN denotes expression
T1876 3883-3886 CC denotes and
T1875 3881-3882 -COMMA- denotes ,
T1874 3871-3881 NN denotes substrates
T1873 3862-3870 JJ denotes multiple
T1872 3859-3861 IN denotes of
T1871 3850-3858 NN denotes splicing
T1870 3842-3849 VB denotes blocked
T1869 3833-3841 NN denotes extracts
T1868 3828-3832 NN denotes cell
T1867 3823-3827 NN denotes HeLa
T1866 3820-3822 IN denotes in
T1865 3815-3819 NN denotes Sox6
T1864 3812-3814 IN denotes of
T1863 3802-3811 NN denotes Depletion
T1862 3799-3800 -RRB- denotes ]
T1861 3798-3799 CD denotes 7
T1860 3797-3798 -LRB- denotes [
T1859 3788-3796 NN denotes splicing
T1858 3779-3787 JJ denotes pre-mRNA
T1857 3776-3778 IN denotes in
T1856 3763-3775 VB denotes participates
T1855 3758-3762 WDT denotes that
T1854 3751-3757 NN denotes factor
T1853 3742-3750 NN denotes splicing
T1852 3734-3741 JJ denotes general
T1851 3732-3733 DT denotes a
T1850 3729-3731 IN denotes as
T1849 3725-3728 VB denotes act
T1848 3722-3724 TO denotes to
T1847 3716-3721 VB denotes shown
T1846 3711-3715 VB denotes been
T1845 3706-3710 RB denotes also
T1844 3702-3705 VB denotes has
T1843 3697-3701 NN denotes Sox6
T1842 3695-3696 -COMMA- denotes ,
T1841 3683-3695 RB denotes Intriguingly
T1840 3680-3681 -RRB- denotes ]
T1839 3677-3680 CD denotes 5,6
T1838 3676-3677 -LRB- denotes [
T1837 3668-3675 NN denotes context
T1836 3659-3667 NN denotes promoter
T1835 3652-3658 NN denotes target
T1834 3648-3651 PRP-DOLLAR- denotes its
T1833 3644-3647 CC denotes and
T1832 3632-3643 NN denotes interactors
T1831 3628-3631 PRP-DOLLAR- denotes its
T1830 3625-3627 IN denotes on
T1829 3615-3624 VB denotes depending
T1828 3613-3614 -COMMA- denotes ,
T1827 3604-3613 NN denotes repressor
T1826 3602-3603 DT denotes a
T1825 3599-3601 CC denotes or
T1824 3589-3598 NN denotes activator
T1823 3586-3588 DT denotes an
T1822 3579-3585 CC denotes either
T1821 3576-3578 IN denotes as
T1820 3572-3575 VB denotes act
T1819 3569-3571 TO denotes to
T1818 3564-3568 JJ denotes able
T1817 3561-3563 VB denotes be
T1816 3558-3560 TO denotes to
T1815 3549-3557 VB denotes reported
T1814 3544-3548 VB denotes been
T1813 3540-3543 VB denotes has
T1812 3535-3539 NN denotes Sox6
T1811 3524-3533 NN denotes complexes
T1810 3511-3523 NN denotes multiprotein
T1809 3503-3510 VB denotes defined
T1808 3492-3502 RB denotes sterically
T1807 3490-3491 -COMMA- denotes ,
T1806 3484-3490 JJ denotes active
T1805 3471-3483 RB denotes biologically
T1804 3466-3470 IN denotes into
T1803 3458-3465 NN denotes factors
T1802 3444-3457 NN denotes transcription
T1801 3434-3443 JJ denotes DNA-bound
T1800 3428-3433 JJ denotes other
T1799 3417-3427 VB denotes assembling
T1798 3413-3416 CC denotes and
T1797 3403-3412 NN denotes structure
T1796 3393-3402 NN denotes chromatin
T1795 3387-3392 JJ denotes local
T1794 3376-3386 VB denotes organizing
T1793 3373-3375 IN denotes by
T1792 3364-3372 NN denotes proteins
T1791 3350-3363 JJ denotes architectural
T1790 3347-3349 IN denotes as
T1789 3338-3346 NN denotes function
T1788 3332-3337 PRP-DOLLAR- denotes their
T1787 3329-3331 IN denotes of
T1786 3324-3328 NN denotes part
T1784 3312-3315 MD denotes may
T1783 3303-3311 NN denotes proteins
T2006 4593-4601 VB denotes disrupts
T2005 4588-4592 WDT denotes that
T2004 4578-4587 NN denotes inversion
T2003 4576-4577 CD denotes 7
T2002 4565-4575 NN denotes Chromosome
T2001 4563-4564 DT denotes a
T2000 4558-4562 IN denotes with
T1999 4547-4557 VB denotes associated
T1998 4544-4546 VB denotes is
T1997 4537-4543 NN denotes allele
T1996 4530-4536 JJ denotes mutant
T1995 4524-4529 NN denotes p100H
T1994 4520-4523 DT denotes The
T1993 4517-4518 -RRB- denotes ]
T1992 4515-4517 CD denotes 14
T1991 4514-4515 -LRB- denotes [
T1990 4508-4513 NN denotes birth
T1989 4502-4507 IN denotes after
T1988 4499-4501 NN denotes wk
T1987 4497-4498 CD denotes 2
T1986 4490-4496 IN denotes within
T1985 4486-4489 VB denotes die
T1984 4482-4485 CC denotes and
T1983 4480-4481 -COMMA- denotes ,
T1982 4475-4480 NN denotes block
T1981 4469-4474 NN denotes heart
T1980 4450-4468 JJ denotes arterioventricular
T1979 4446-4449 CC denotes and
T1978 4437-4445 NN denotes myopathy
T1977 4429-4436 VB denotes develop
T1976 4427-4428 -COMMA- denotes ,
T1975 4421-4427 NN denotes growth
T1974 4413-4420 VB denotes delayed
T1973 4408-4412 VB denotes show
T2014 4631-4635 NN denotes gene
T2013 4626-4630 NN denotes Sox6
T2012 4622-4625 DT denotes the
T2011 4618-4621 CC denotes and
T2010 4613-4617 NN denotes gene
T2009 4611-4612 NN denotes p
T2008 4607-4610 DT denotes the
T2007 4602-4606 CC denotes both
T472 1421-1432 NN denotes thalassemia
T471 1417-1420 CC denotes and
T470 1410-1416 NN denotes anemia
T469 1405-1409 NN denotes cell
T468 1398-1404 JJ denotes sickle
T467 1395-1397 IN denotes as
T466 1390-1394 JJ denotes such
T465 1371-1389 NN denotes hemoglobinopathies
T464 1368-1370 IN denotes of
T463 1358-1367 NN denotes treatment
T462 1354-1357 DT denotes the
T461 1351-1353 IN denotes in
T460 1344-1350 NN denotes target
T459 1330-1343 JJ denotes therapeutical
T458 1324-1329 JJ denotes novel
T457 1322-1323 DT denotes a
T456 1314-1321 VB denotes provide
T455 1308-1313 MD denotes might
T454 1301-1307 NN denotes globin
T453 1298-1300 JJ denotes ɛy
T452 1295-1297 IN denotes of
T451 1284-1294 NN denotes regulation
T450 1279-1283 NN denotes Sox6
T449 1277-1278 -COMMA- denotes ,
T448 1273-1277 RB denotes Thus
T447 1261-1271 NN denotes maturation
T446 1256-1260 NN denotes cell
T445 1246-1255 JJ denotes erythroid
T444 1243-1245 IN denotes in
T443 1238-1242 NN denotes Sox6
T442 1234-1237 IN denotes for
T441 1229-1233 NN denotes role
T440 1227-1228 DT denotes a
T439 1218-1226 VB denotes suggests
T438 1214-1217 CC denotes and
T437 1199-1213 NN denotes erythropoiesis
T436 1188-1198 JJ denotes definitive
T435 1185-1187 IN denotes in
T434 1178-1184 NN denotes globin
T433 1175-1177 JJ denotes ɛy
T429 1149-1157 VB denotes required
T428 1146-1148 VB denotes is
T427 1141-1145 NN denotes Sox6
T426 1136-1140 IN denotes that
T425 1130-1135 VB denotes shows
T424 1124-1129 NN denotes study
T423 1116-1123 JJ denotes present
T422 1112-1115 DT denotes The
T421 1096-1110 NN denotes erythropoiesis
T420 1085-1095 JJ denotes definitive
T419 1082-1084 IN denotes in
T418 1072-1081 NN denotes functions
T417 1067-1071 NN denotes Sox6
T416 1062-1066 IN denotes that
T415 1050-1061 VB denotes demonstrate
T414 1044-1049 NN denotes liver
T413 1038-1043 JJ denotes fetal
T412 1027-1037 JJ denotes homozygous
T411 1021-1026 NN denotes p100H
T410 1018-1020 IN denotes in
T409 1015-1017 NN denotes ɛy
T408 1012-1014 IN denotes of
T407 1001-1011 NN denotes expression
T406 993-1000 JJ denotes ectopic
T405 989-992 DT denotes the
T404 985-988 CC denotes and
T403 979-984 NN denotes liver
T402 973-978 JJ denotes fetal
T401 963-972 JJ denotes wild-type
T400 960-962 IN denotes in
T399 955-959 NN denotes Sox6
T398 952-954 IN denotes of
T397 941-951 NN denotes expression
T396 934-940 JJ denotes normal
T395 930-933 DT denotes The
T394 920-928 NN denotes promoter
T393 917-919 JJ denotes ɛy
T392 913-916 DT denotes the
T391 910-912 TO denotes to
T390 902-909 VB denotes binding
T389 893-901 RB denotes directly
T388 890-892 IN denotes by
T387 880-889 NN denotes repressor
T386 878-879 DT denotes a
T385 875-877 IN denotes as
T384 870-874 VB denotes acts
T383 865-869 NN denotes Sox6
T382 860-864 IN denotes that
T381 848-859 VB denotes demonstrate
T380 841-847 NN denotes assays
T379 839-840 -RRB- denotes )
T378 835-839 NN denotes ChIP
T377 834-835 -LRB- denotes (
T376 814-833 NN denotes immunoprecipitation
T375 804-813 NN denotes chromatin
T374 800-803 CC denotes and
T373 798-799 -RRB- denotes )
T372 794-798 NN denotes EMSA
T371 793-794 -LRB- denotes (
T370 787-792 NN denotes assay
T369 781-786 NN denotes shift
T368 772-780 NN denotes mobility
T367 756-771 JJ denotes Electrophoretic
T366 744-754 NN denotes repression
T365 735-743 VB denotes mediated
T364 730-734 NN denotes Sox6
T363 726-729 IN denotes for
T362 717-725 JJ denotes critical
T361 714-716 VB denotes is
T360 709-713 WDT denotes that
T359 700-708 NN denotes promoter
T358 691-699 JJ denotes proximal
T357 688-690 JJ denotes ɛy
T356 684-687 DT denotes the
T355 681-683 IN denotes of
T354 674-680 NN denotes region
T353 669-673 NN denotes pair
T352 661-668 NN denotes 36–base
T351 659-660 DT denotes a
T350 652-658 VB denotes define
T349 646-651 NN denotes cells
T348 644-645 -RRB- denotes )
T347 629-644 JJ denotes erythroleukemic
T346 628-629 -LRB- denotes (
T345 622-627 NN denotes GM979
T344 619-621 IN denotes in
T343 612-618 NN denotes assays
T342 599-611 NN denotes Transfection
T341 586-597 NN denotes circulation
T340 580-585 JJ denotes fetal
T339 576-579 DT denotes the
T338 573-575 IN denotes in
T337 565-572 JJ denotes present
T336 561-564 VB denotes are
T335 555-560 NN denotes cells
T334 551-554 JJ denotes red
T333 541-550 JJ denotes nucleated
T332 538-540 IN denotes of
T331 530-537 NN denotes numbers
T330 520-529 VB denotes increased
T329 516-519 CC denotes and
T328 514-515 -COMMA- denotes ,
T327 505-514 VB denotes expressed
T326 492-504 RB denotes persistently
T325 489-491 VB denotes is
T324 482-488 NN denotes globin
T323 479-481 JJ denotes ɛy
T322 477-478 -COMMA- denotes ,
T321 472-477 NN denotes p100H
T320 470-471 -COMMA- denotes ,
T319 465-470 NN denotes mouse
T318 450-464 JJ denotes Sox6-deficient
T317 446-449 DT denotes the
T316 443-445 IN denotes In
T315 435-441 NN denotes muscle
T314 431-434 CC denotes and
T313 429-430 -COMMA- denotes ,
T312 420-429 NN denotes cartilage
T311 418-419 -COMMA- denotes ,
T310 412-418 NN denotes system
T309 404-411 JJ denotes nervous
T308 396-403 JJ denotes central
T307 392-395 DT denotes the
T306 389-391 IN denotes of
T305 377-388 NN denotes development
T304 373-376 DT denotes the
T303 370-372 IN denotes in
T302 365-369 NN denotes role
T301 363-364 DT denotes a
T300 357-362 VB denotes plays
T299 352-356 NN denotes Sox6
T298 347-351 IN denotes that
T297 337-346 VB denotes suggested
T296 332-336 VB denotes have
T295 324-331 NN denotes studies
T294 315-323 NNP denotes Previous
T293 310-314 NNP denotes Sry.
T292 308-309 -COMMA- denotes ,
T291 304-308 NN denotes gene
T290 292-303 VB denotes determining
T289 285-291 NN denotes testis
T288 281-284 DT denotes the
T287 278-280 IN denotes in
T286 268-277 VB denotes described
T285 262-267 RB denotes first
T284 260-261 -COMMA- denotes ,
T283 254-260 NN denotes domain
T282 246-253 NN denotes binding
T281 242-245 NN denotes DNA
T280 240-241 -RRB- denotes )
T279 237-240 NN denotes HMG
T278 236-237 -LRB- denotes (
T277 230-235 NN denotes group
T276 221-229 NN denotes mobility
T275 216-220 JJ denotes high
T274 206-215 VB denotes conserved
T273 202-205 DT denotes the
T272 199-201 IN denotes by
T271 191-198 VB denotes defined
T270 188-190 VB denotes is
T269 183-187 WDT denotes that
T268 176-182 NN denotes family
T267 169-175 NN denotes factor
T266 155-168 NN denotes transcription
T265 151-154 NN denotes Sox
T264 147-150 DT denotes the
T263 144-146 IN denotes of
T262 137-143 NN denotes member
T261 135-136 DT denotes a
T260 132-134 VB denotes is
T259 127-131 NN denotes Sox6
T431 1162-1171 NN denotes silencing
T430 1158-1161 IN denotes for
T432 1172-1174 IN denotes of
T1704 2882-2883 DT denotes a
T1703 2879-2881 VB denotes is
T1702 2877-2878 -RRB- denotes )
T1701 2873-2877 NN denotes Sox6
T1700 2872-2873 -LRB- denotes (
T1699 2868-2871 NN denotes box
T1698 2864-2867 NN denotes HMG
T1697 2859-2863 NN denotes type
T1696 2855-2858 NN denotes Sry
T1785 3316-3323 VB denotes perform
T19875 42154-42158 VB denotes used
T19200 40504-40513 VB denotes described
R42 T254 T250 arg1Of Globin,Sox6
R43 T254 T251 arg1Of Globin,Directly
R44 T254 T252 arg1Of Globin,Silences
R45 T254 T253 arg1Of Globin,Epsilon
R46 T255 T254 arg1Of Expression,Globin
R47 T255 T256 arg1Of Expression,in
R48 T258 T256 arg2Of Erythropoiesis,in
R49 T258 T257 arg1Of Erythropoiesis,Definitive
R50 T259 T260 arg1Of Sox6,is
R51 T262 T260 arg2Of member,is
R52 T262 T261 arg1Of member,a
R53 T262 T263 arg1Of member,of
R54 T262 T269 arg1Of member,that
R55 T262 T270 arg1Of member,is
R56 T262 T271 arg2Of member,defined
R57 T268 T263 arg2Of family,of
R58 T268 T264 arg1Of family,the
R59 T268 T265 arg1Of family,Sox
R60 T268 T266 arg1Of family,transcription
R61 T268 T267 arg1Of family,factor
R62 T271 T270 arg2Of defined,is
R63 T279 T278 arg2Of HMG,(
R64 T280 T278 arg3Of ),(
R65 T283 T271 arg1Of domain,defined
R66 T283 T272 arg2Of domain,by
R67 T283 T273 arg1Of domain,the
R68 T283 T274 arg2Of domain,conserved
R69 T283 T275 arg1Of domain,high
R70 T283 T276 arg1Of domain,mobility
R71 T283 T277 arg1Of domain,group
R72 T283 T278 arg1Of domain,(
R73 T283 T281 arg1Of domain,DNA
R74 T283 T282 arg1Of domain,binding
R75 T283 T284 arg1Of domain,","
R76 T283 T286 arg2Of domain,described
R77 T286 T285 arg1Of described,first
R78 T286 T287 arg1Of described,in
R79 T289 T287 arg2Of testis,in
R80 T289 T288 arg1Of testis,the
R81 T289 T290 arg1Of testis,determining
R82 T291 T290 arg2Of gene,determining
R83 T291 T296 modOf gene,have
R84 T294 T293 arg1Of Previous,Sry.
R85 T295 T294 arg1Of studies,Previous
R86 T295 T296 arg1Of studies,have
R87 T295 T297 arg1Of studies,suggested
R88 T297 T292 arg1Of suggested,","
R89 T297 T296 arg2Of suggested,have
R90 T299 T300 arg1Of Sox6,plays
R91 T300 T297 arg2Of plays,suggested
R92 T300 T298 arg1Of plays,that
R93 T300 T303 arg1Of plays,in
R94 T302 T300 arg2Of role,plays
R95 T302 T301 arg1Of role,a
R96 T305 T306 arg1Of development,of
R97 T305 T311 arg1Of development,","
R98 T310 T306 arg2Of system,of
R99 T310 T307 arg1Of system,the
R100 T310 T308 arg1Of system,central
R101 T310 T309 arg1Of system,nervous
R102 T311 T314 arg1Of ",",and
R103 T312 T311 arg2Of cartilage,","
R104 T314 T303 arg2Of and,in
R105 T314 T304 arg1Of and,the
R106 T314 T313 arg1Of and,","
R107 T315 T314 arg2Of muscle,and
R108 T319 T316 arg2Of mouse,In
R109 T319 T317 arg1Of mouse,the
R110 T319 T318 arg1Of mouse,Sox6-deficient
R111 T319 T320 arg1Of mouse,","
R112 T321 T320 arg2Of p100H,","
R113 T324 T323 arg1Of globin,ɛy
R114 T324 T325 arg1Of globin,is
R115 T324 T327 arg2Of globin,expressed
R116 T327 T325 arg2Of expressed,is
R117 T327 T326 arg1Of expressed,persistently
R118 T327 T329 arg1Of expressed,and
R119 T329 T316 arg1Of and,In
R120 T329 T322 arg1Of and,","
R121 T329 T328 arg1Of and,","
R122 T331 T330 arg2Of numbers,increased
R123 T331 T332 arg1Of numbers,of
R124 T331 T336 arg1Of numbers,are
R125 T331 T337 arg1Of numbers,present
R126 T335 T332 arg2Of cells,of
R127 T335 T333 arg1Of cells,nucleated
R128 T335 T334 arg1Of cells,red
R129 T336 T329 arg2Of are,and
R130 T337 T336 arg2Of present,are
R131 T337 T338 arg1Of present,in
R132 T341 T338 arg2Of circulation,in
R133 T341 T339 arg1Of circulation,the
R134 T341 T340 arg1Of circulation,fetal
R210 T418 T417 arg1Of functions,Sox6
R211 T421 T419 arg2Of erythropoiesis,in
R212 T421 T420 arg1Of erythropoiesis,definitive
R213 T424 T422 arg1Of study,The
R214 T424 T423 arg1Of study,present
R215 T424 T425 arg1Of study,shows
R216 T427 T428 arg1Of Sox6,is
R217 T427 T429 arg2Of Sox6,required
R218 T427 T439 arg1Of Sox6,suggests
R219 T429 T428 arg2Of required,is
R220 T429 T430 arg1Of required,for
R221 T429 T438 arg1Of required,and
R222 T431 T430 arg2Of silencing,for
R223 T431 T432 arg1Of silencing,of
R224 T431 T435 arg1Of silencing,in
R225 T434 T432 arg2Of globin,of
R226 T434 T433 arg1Of globin,ɛy
R227 T437 T435 arg2Of erythropoiesis,in
R228 T437 T436 arg1Of erythropoiesis,definitive
R229 T438 T425 arg2Of and,shows
R230 T438 T426 arg1Of and,that
R231 T439 T438 arg2Of suggests,and
R232 T441 T439 arg2Of role,suggests
R233 T441 T440 arg1Of role,a
R234 T441 T442 arg1Of role,for
R235 T441 T444 arg1Of role,in
R236 T443 T442 arg2Of Sox6,for
R237 T447 T444 arg2Of maturation,in
R238 T447 T445 arg1Of maturation,erythroid
R239 T447 T446 arg1Of maturation,cell
R240 T451 T450 arg1Of regulation,Sox6
R241 T451 T452 arg1Of regulation,of
R242 T451 T455 arg1Of regulation,might
R243 T451 T456 arg1Of regulation,provide
R244 T454 T452 arg2Of globin,of
R245 T454 T453 arg1Of globin,ɛy
R246 T456 T448 arg1Of provide,Thus
R247 T456 T449 arg1Of provide,","
R248 T456 T455 arg2Of provide,might
R249 T460 T456 arg2Of target,provide
R250 T460 T457 arg1Of target,a
R251 T460 T458 arg1Of target,novel
R252 T460 T459 arg1Of target,therapeutical
R253 T460 T461 arg1Of target,in
R254 T463 T461 arg2Of treatment,in
R255 T463 T462 arg1Of treatment,the
R256 T463 T464 arg1Of treatment,of
R257 T465 T464 arg2Of hemoglobinopathies,of
R258 T465 T467 arg1Of hemoglobinopathies,as
R259 T467 T466 arg1Of as,such
R260 T470 T471 arg1Of anemia,and
R261 T471 T467 arg2Of and,as
R262 T471 T468 arg1Of and,sickle
R135 T343 T342 arg1Of assays,Transfection
R136 T343 T344 arg1Of assays,in
R137 T343 T350 arg1Of assays,define
R138 T347 T346 arg2Of erythroleukemic,(
R139 T348 T346 arg3Of ),(
R140 T349 T344 arg2Of cells,in
R141 T349 T345 arg1Of cells,GM979
R142 T349 T346 arg1Of cells,(
R143 T354 T350 arg2Of region,define
R144 T354 T351 arg1Of region,a
R145 T354 T352 arg1Of region,36–base
R146 T354 T353 arg1Of region,pair
R147 T354 T355 arg1Of region,of
R148 T359 T355 arg2Of promoter,of
R149 T359 T356 arg1Of promoter,the
R150 T359 T357 arg1Of promoter,ɛy
R151 T359 T358 arg1Of promoter,proximal
R152 T359 T360 arg1Of promoter,that
R153 T359 T361 arg1Of promoter,is
R154 T359 T362 arg1Of promoter,critical
R155 T362 T361 arg2Of critical,is
R156 T362 T363 arg1Of critical,for
R157 T366 T363 arg2Of repression,for
R158 T366 T364 arg1Of repression,Sox6
R159 T366 T365 arg2Of repression,mediated
R160 T370 T367 arg1Of assay,Electrophoretic
R161 T370 T368 arg1Of assay,mobility
R162 T370 T369 arg1Of assay,shift
R163 T370 T371 arg1Of assay,(
R164 T370 T374 arg1Of assay,and
R165 T372 T371 arg2Of EMSA,(
R166 T373 T371 arg3Of ),(
R167 T374 T381 arg1Of and,demonstrate
R168 T378 T377 arg2Of ChIP,(
R169 T379 T377 arg3Of ),(
R170 T380 T374 arg2Of assays,and
R171 T380 T375 arg1Of assays,chromatin
R172 T380 T376 arg1Of assays,immunoprecipitation
R173 T380 T377 arg1Of assays,(
R174 T383 T384 arg1Of Sox6,acts
R175 T384 T381 arg2Of acts,demonstrate
R176 T384 T382 arg1Of acts,that
R177 T384 T385 arg1Of acts,as
R178 T384 T388 arg1Of acts,by
R179 T387 T385 arg2Of repressor,as
R180 T387 T386 arg1Of repressor,a
R181 T390 T388 arg2Of binding,by
R182 T390 T389 arg1Of binding,directly
R183 T390 T391 arg1Of binding,to
R184 T394 T391 arg2Of promoter,to
R185 T394 T392 arg1Of promoter,the
R186 T394 T393 arg1Of promoter,ɛy
R187 T397 T395 arg1Of expression,The
R188 T397 T396 arg1Of expression,normal
R189 T397 T398 arg1Of expression,of
R190 T397 T400 arg1Of expression,in
R191 T397 T404 arg1Of expression,and
R192 T399 T398 arg2Of Sox6,of
R193 T403 T400 arg2Of liver,in
R194 T403 T401 arg1Of liver,wild-type
R195 T403 T402 arg1Of liver,fetal
R196 T404 T415 arg1Of and,demonstrate
R197 T407 T404 arg2Of expression,and
R198 T407 T405 arg1Of expression,the
R199 T407 T406 arg1Of expression,ectopic
R200 T407 T408 arg1Of expression,of
R201 T407 T410 arg1Of expression,in
R202 T409 T408 arg2Of ɛy,of
R203 T414 T410 arg2Of liver,in
R204 T414 T411 arg1Of liver,p100H
R205 T414 T412 arg1Of liver,homozygous
R206 T414 T413 arg1Of liver,fetal
R207 T415 T419 arg1Of demonstrate,in
R208 T418 T415 arg2Of functions,demonstrate
R209 T418 T416 arg1Of functions,that
R811 T1705 T1704 arg1Of member,a
R812 T1705 T1706 arg1Of member,of
R813 T1711 T1706 arg2Of family,of
R814 T1711 T1707 arg1Of family,the
R815 T1711 T1708 arg1Of family,Sox
R816 T1711 T1709 arg1Of family,transcription
R817 T1711 T1710 arg1Of family,factor
R818 T1711 T1712 arg2Of family,characterized
R819 T1720 T1719 arg2Of HMG,(
R820 T1721 T1719 arg3Of ),(
R821 T1722 T1712 arg1Of domain,characterized
R822 T1722 T1713 arg2Of domain,by
R823 T1722 T1714 arg1Of domain,the
R824 T1722 T1715 arg2Of domain,conserved
R825 T1722 T1716 arg1Of domain,high
R826 T1722 T1717 arg1Of domain,mobility
R827 T1722 T1718 arg1Of domain,group
R828 T1722 T1719 arg1Of domain,(
R829 T1722 T1723 arg1Of domain,","
R830 T1722 T1724 arg1Of domain,consisting
R831 T1724 T1725 arg1Of consisting,of
R832 T1728 T1725 arg2Of acids,of
R833 T1728 T1726 arg1Of acids,79
R834 T1728 T1727 arg1Of acids,amino
R835 T1728 T1729 arg2Of acids,involved
R836 T1729 T1730 arg1Of involved,in
R837 T1729 T1735 arg1Of involved,[
R838 T1732 T1733 arg1Of recognition,and
R839 T1733 T1730 arg2Of and,in
R840 T1733 T1731 arg1Of and,DNA
R841 T1734 T1733 arg2Of binding,and
R842 T1736 T1735 arg2Of 1,[
R843 T1737 T1735 arg3Of ],[
R844 T1740 T1738 arg1Of factors,Sox
R845 T1740 T1739 arg1Of factors,transcription
R846 T1740 T1741 arg1Of factors,bind
R847 T1740 T1749 arg1Of factors,cause
R848 T1741 T1742 arg1Of bind,to
R849 T1741 T1748 arg1Of bind,and
R850 T1745 T1742 arg2Of groove,to
R851 T1745 T1743 arg1Of groove,the
R852 T1745 T1744 arg1Of groove,minor
R853 T1745 T1746 arg1Of groove,of
R854 T1747 T1746 arg2Of DNA,of
R855 T1749 T1748 arg2Of cause,and
R856 T1752 T1749 arg2Of bend,cause
R857 T1752 T1750 arg1Of bend,a
R858 T1752 T1751 arg1Of bend,70°–85°
R859 T1752 T1753 arg1Of bend,of
R860 T1755 T1753 arg2Of DNA,of
R861 T1755 T1754 arg1Of DNA,the
R862 T1755 T1756 arg1Of DNA,that
R863 T1755 T1757 arg1Of DNA,leads
R864 T1757 T1758 arg1Of leads,to
R865 T1757 T1765 arg1Of leads,","
R866 T1757 T1766 arg1Of leads,while
R867 T1761 T1758 arg2Of changes,to
R868 T1761 T1759 arg1Of changes,local
R869 T1761 T1760 arg1Of changes,conformational
R870 T1761 T1762 arg1Of changes,[
R871 T1763 T1762 arg2Of "2,3",[
R872 T1764 T1762 arg3Of ],[
R873 T1770 T1767 arg1Of factors,most
R874 T1770 T1768 arg1Of factors,other
R875 T1770 T1769 arg1Of factors,transcription
R876 T1770 T1771 arg1Of factors,target
R877 T1771 T1766 arg2Of target,while
R878 T1771 T1777 arg1Of target,[
R879 T1774 T1771 arg2Of groove,target
R880 T1774 T1772 arg1Of groove,the
R881 T1774 T1773 arg1Of groove,major
R882 T1774 T1775 arg1Of groove,of
R883 T1776 T1775 arg2Of DNA,of
R884 T1778 T1777 arg2Of 4,[
R885 T1779 T1777 arg3Of ],[
R886 T1783 T1782 arg1Of proteins,Sox
R887 T1783 T1784 arg1Of proteins,may
R888 T1783 T1785 arg1Of proteins,perform
R889 T1783 T1794 arg1Of proteins,organizing
R890 T1785 T1780 arg1Of perform,Therefore
R891 T1785 T1781 arg1Of perform,","
R892 T1785 T1784 arg2Of perform,may
R893 T1785 T1790 arg1Of perform,as
R263 T471 T469 arg1Of and,cell
R264 T472 T471 arg2Of thalassemia,and
R943 T1832 T1831 arg1Of interactors,its
R944 T1832 T1833 arg1Of interactors,and
R945 T1833 T1830 arg2Of and,on
R946 T1837 T1833 arg2Of context,and
R947 T1837 T1834 arg1Of context,its
R948 T1837 T1835 arg1Of context,target
R949 T1837 T1836 arg1Of context,promoter
R950 T1837 T1838 arg1Of context,[
R951 T1839 T1838 arg2Of "5,6",[
R952 T1840 T1838 arg3Of ],[
R953 T1843 T1844 arg1Of Sox6,has
R954 T1843 T1846 arg1Of Sox6,been
R955 T1843 T1847 arg2Of Sox6,shown
R956 T1843 T1849 arg1Of Sox6,act
R957 T1847 T1841 arg1Of shown,Intriguingly
R958 T1847 T1842 arg1Of shown,","
R959 T1847 T1844 arg2Of shown,has
R960 T1847 T1845 arg1Of shown,also
R961 T1847 T1846 arg2Of shown,been
R962 T1849 T1847 arg3Of act,shown
R963 T1849 T1848 arg1Of act,to
R964 T1849 T1850 arg1Of act,as
R965 T1854 T1850 arg2Of factor,as
R966 T1854 T1851 arg1Of factor,a
R967 T1854 T1852 arg1Of factor,general
R968 T1854 T1853 arg1Of factor,splicing
R969 T1854 T1855 arg1Of factor,that
R970 T1854 T1856 arg1Of factor,participates
R971 T1856 T1857 arg1Of participates,in
R972 T1859 T1857 arg2Of splicing,in
R973 T1859 T1858 arg1Of splicing,pre-mRNA
R974 T1859 T1860 arg1Of splicing,[
R975 T1861 T1860 arg2Of 7,[
R976 T1862 T1860 arg3Of ],[
R977 T1863 T1864 arg1Of Depletion,of
R978 T1863 T1866 arg1Of Depletion,in
R979 T1863 T1870 arg1Of Depletion,blocked
R980 T1865 T1864 arg2Of Sox6,of
R981 T1869 T1866 arg2Of extracts,in
R982 T1869 T1867 arg1Of extracts,HeLa
R983 T1869 T1868 arg1Of extracts,cell
R984 T1870 T1876 arg1Of blocked,and
R985 T1871 T1870 arg2Of splicing,blocked
R986 T1871 T1872 arg1Of splicing,of
R987 T1874 T1872 arg2Of substrates,of
R988 T1874 T1873 arg1Of substrates,multiple
R989 T1876 T1875 arg1Of and,","
R990 T1876 T1896 modOf and,indicating
R991 T1876 T1902 arg1Of and,[
R992 T1877 T1878 arg1Of expression,of
R993 T1877 T1893 arg1Of expression,restored
R994 T1881 T1878 arg2Of domain,of
R995 T1881 T1879 arg1Of domain,the
R996 T1881 T1880 arg1Of domain,HMG
R997 T1881 T1882 arg1Of domain,of
R998 T1881 T1890 arg1Of domain,in
R999 T1884 T1885 arg1Of Sox6,","
R1000 T1885 T1888 arg1Of ",",or
R1001 T1886 T1885 arg2Of Sox9,","
R1002 T1888 T1882 arg2Of or,of
R1003 T1888 T1883 arg1Of or,either
R1004 T1888 T1887 arg1Of or,","
R1005 T1889 T1888 arg2Of Sry,or
R1006 T1892 T1890 arg2Of extracts,in
R1007 T1892 T1891 arg1Of extracts,the
R1008 T1893 T1876 arg2Of restored,and
R1009 T1893 T1895 arg1Of restored,","
R1010 T1894 T1893 arg2Of splicing,restored
R1011 T1898 T1896 arg2Of overlap,indicating
R1012 T1898 T1897 arg1Of overlap,functional
R1013 T1898 T1899 arg1Of overlap,of
R1014 T1901 T1899 arg2Of proteins,of
R1015 T1901 T1900 arg1Of proteins,these
R1016 T1903 T1902 arg2Of 7,[
R1017 T1904 T1902 arg3Of ],[
R1168 T2052 T2051 arg1Of phenotypes,other
R1169 T2057 T2053 arg2Of proteins,Among
R1170 T2057 T2054 arg1Of proteins,the
R1171 T2057 T2055 arg1Of proteins,HMG
R1172 T2057 T2056 arg1Of proteins,box
R1173 T2057 T2059 arg2Of proteins,related
R1174 T2059 T2058 arg1Of related,distantly
R1175 T2059 T2060 arg1Of related,to
R1176 T2061 T2060 arg2Of Sry,to
R1177 T2061 T2062 arg1Of Sry,(
R1178 T2065 T2062 arg2Of member,(
R1179 T2065 T2063 arg1Of member,the
R1180 T2065 T2064 arg1Of member,first
R894 T1785 T1793 arg1Of perform,by
R895 T1786 T1785 arg2Of part,perform
R896 T1786 T1787 arg1Of part,of
R897 T1789 T1787 arg2Of function,of
R898 T1789 T1788 arg1Of function,their
R899 T1792 T1790 arg2Of proteins,as
R900 T1792 T1791 arg1Of proteins,architectural
R901 T1794 T1793 arg2Of organizing,by
R902 T1797 T1795 arg1Of structure,local
R903 T1797 T1796 arg1Of structure,chromatin
R904 T1797 T1798 arg1Of structure,and
R905 T1798 T1794 arg2Of and,organizing
R906 T1798 T1804 arg1Of and,into
R907 T1803 T1798 arg2Of factors,and
R908 T1803 T1799 arg1Of factors,assembling
R909 T1803 T1800 arg1Of factors,other
R910 T1803 T1801 arg1Of factors,DNA-bound
R911 T1803 T1802 arg1Of factors,transcription
R912 T1806 T1805 arg1Of active,biologically
R913 T1806 T1807 arg1Of active,","
R914 T1809 T1807 arg2Of defined,","
R915 T1809 T1808 arg1Of defined,sterically
R916 T1811 T1804 arg2Of complexes,into
R917 T1811 T1806 arg1Of complexes,active
R918 T1811 T1809 arg1Of complexes,defined
R919 T1811 T1810 arg1Of complexes,multiprotein
R920 T1812 T1813 arg1Of Sox6,has
R921 T1812 T1814 arg1Of Sox6,been
R922 T1812 T1815 arg2Of Sox6,reported
R923 T1812 T1817 arg1Of Sox6,be
R924 T1812 T1818 arg1Of Sox6,able
R925 T1812 T1820 arg1Of Sox6,act
R926 T1815 T1813 arg2Of reported,has
R927 T1815 T1814 arg2Of reported,been
R928 T1817 T1815 arg3Of be,reported
R929 T1817 T1816 arg1Of be,to
R930 T1818 T1817 arg2Of able,be
R931 T1820 T1818 arg2Of act,able
R932 T1820 T1819 arg1Of act,to
R933 T1820 T1821 arg1Of act,as
R934 T1820 T1828 arg1Of act,","
R935 T1820 T1829 arg1Of act,depending
R936 T1824 T1823 arg1Of activator,an
R937 T1824 T1825 arg1Of activator,or
R938 T1825 T1821 arg2Of or,as
R939 T1825 T1822 arg1Of or,either
R940 T1827 T1825 arg2Of repressor,or
R941 T1827 T1826 arg1Of repressor,a
R942 T1830 T1829 arg2Of on,depending
R1018 T1905 T1906 arg1Of Regardless,of
R1019 T1907 T1906 arg2Of how,of
R1020 T1909 T1908 arg1Of functions,Sox6
R1021 T1909 T1910 arg1Of functions,in
R1022 T1909 T1911 arg1Of functions,regulating
R1023 T1911 T1907 arg1Of regulating,how
R1024 T1913 T1911 arg2Of expression,regulating
R1025 T1913 T1912 arg1Of expression,gene
R1026 T1916 T1915 arg1Of studies,previous
R1027 T1916 T1917 arg1Of studies,have
R1028 T1916 T1918 arg1Of studies,demonstrated
R1029 T1918 T1905 arg1Of demonstrated,Regardless
R1030 T1918 T1914 arg1Of demonstrated,","
R1031 T1918 T1917 arg2Of demonstrated,have
R1032 T1920 T1921 arg1Of Sox6,is
R1033 T1921 T1918 arg2Of is,demonstrated
R1034 T1921 T1919 arg1Of is,that
R1035 T1925 T1921 arg2Of molecule,is
R1036 T1925 T1922 arg1Of molecule,an
R1037 T1925 T1923 arg1Of molecule,important
R1038 T1925 T1924 arg1Of molecule,regulatory
R1039 T1925 T1926 arg1Of molecule,that
R1040 T1925 T1927 arg1Of molecule,plays
R1041 T1927 T1930 arg1Of plays,in
R1042 T1929 T1927 arg2Of role,plays
R1043 T1929 T1928 arg1Of role,a
R1044 T1932 T1933 arg1Of development,of
R1045 T1932 T1941 arg1Of development,","
R1046 T1937 T1933 arg2Of system,of
R1047 T1937 T1934 arg1Of system,the
R1048 T1937 T1935 arg1Of system,central
R1049 T1937 T1936 arg1Of system,nervous
R1050 T1937 T1938 arg1Of system,[
R1051 T1939 T1938 arg2Of 8–11,[
R1052 T1940 T1938 arg3Of ],[
R1053 T1941 T1947 arg1Of ",",and
R1054 T1942 T1941 arg2Of cartilage,","
R1055 T1942 T1943 arg1Of cartilage,[
R1056 T1944 T1943 arg2Of "6,12,13",[
R1057 T1945 T1943 arg3Of ],[
R1058 T1947 T1930 arg2Of and,in
R1059 T1947 T1931 arg1Of and,the
R1060 T1947 T1946 arg1Of and,","
R1061 T1948 T1947 arg2Of muscle,and
R1062 T1948 T1949 arg1Of muscle,[
R1063 T1950 T1949 arg2Of "14,15",[
R1064 T1951 T1949 arg3Of ],[
R1065 T1955 T1952 arg1Of mouse,A
R1066 T1955 T1953 arg1Of mouse,Sox6-null
R1067 T1955 T1954 arg1Of mouse,mutant
R1068 T1955 T1956 arg1Of mouse,(
R1069 T1955 T1959 arg1Of mouse,has
R1070 T1955 T1961 arg1Of mouse,been
R1071 T1955 T1962 arg2Of mouse,identified
R1072 T1957 T1956 arg2Of p100H,(
R1073 T1958 T1956 arg3Of ),(
R1074 T1962 T1959 arg2Of identified,has
R1075 T1962 T1960 arg1Of identified,previously
R1076 T1962 T1961 arg2Of identified,been
R1077 T1962 T1963 arg1Of identified,in
R1078 T1965 T1963 arg2Of laboratory,in
R1079 T1965 T1964 arg1Of laboratory,our
R1080 T1965 T1966 arg1Of laboratory,[
R1081 T1967 T1966 arg2Of 14,[
R1082 T1968 T1966 arg3Of ],[
R1083 T1969 T1970 arg1Of Mice,homozygous
R1084 T1969 T1973 arg1Of Mice,show
R1085 T1969 T1977 arg1Of Mice,develop
R1086 T1969 T1985 arg1Of Mice,die
R1087 T1970 T1971 arg1Of homozygous,for
R1088 T1972 T1971 arg2Of p100H,for
R1089 T1973 T1976 arg1Of show,","
R1090 T1975 T1973 arg2Of growth,show
R1091 T1975 T1974 arg2Of growth,delayed
R1092 T1976 T1984 arg1Of ",",and
R1093 T1977 T1976 arg2Of develop,","
R1094 T1978 T1979 arg1Of myopathy,and
R1095 T1980 T1979 arg2Of arterioventricular,and
R1096 T1982 T1977 arg2Of block,develop
R1097 T1982 T1978 arg1Of block,myopathy
R1098 T1982 T1980 arg1Of block,arterioventricular
R1099 T1982 T1981 arg1Of block,heart
R1100 T1984 T1983 arg1Of and,","
R1101 T1984 T1991 arg1Of and,[
R1102 T1985 T1984 arg2Of die,and
R1103 T1985 T1986 arg1Of die,within
R1104 T1985 T1989 arg1Of die,after
R1105 T1988 T1986 arg2Of wk,within
R1106 T1988 T1987 arg1Of wk,2
R1107 T1990 T1989 arg2Of birth,after
R1108 T1992 T1991 arg2Of 14,[
R1109 T1993 T1991 arg3Of ],[
R1110 T1997 T1994 arg1Of allele,The
R1111 T1997 T1995 arg1Of allele,p100H
R1112 T1997 T1996 arg1Of allele,mutant
R1113 T1997 T1998 arg1Of allele,is
R1114 T1997 T1999 arg2Of allele,associated
R1115 T1999 T1998 arg2Of associated,is
R1116 T1999 T2000 arg1Of associated,with
R1117 T2004 T2000 arg2Of inversion,with
R1118 T2004 T2001 arg1Of inversion,a
R1119 T2004 T2002 arg1Of inversion,Chromosome
R1120 T2004 T2003 arg1Of inversion,7
R1121 T2004 T2005 arg1Of inversion,that
R1122 T2004 T2006 arg1Of inversion,disrupts
R1123 T2006 T2028 arg1Of disrupts,[
R1124 T2010 T2008 arg1Of gene,the
R1125 T2010 T2009 arg1Of gene,p
R1126 T2010 T2011 arg1Of gene,and
R1181 T2065 T2066 arg2Of member,identified
R1182 T2066 T2067 arg1Of identified,of
R1183 T2072 T2067 arg2Of family,of
R1184 T2072 T2068 arg1Of family,the
R1185 T2072 T2069 arg1Of family,Sox
R1186 T2072 T2070 arg1Of family,transcription
R1187 T2072 T2071 arg1Of family,factor
R1188 T2073 T2062 arg3Of ),(
R1189 T2074 T2053 arg1Of that,Among
R1190 T2074 T2076 arg1Of that,bind
R1191 T2074 T2090 arg1Of that,are
R1192 T2076 T2075 arg1Of bind,similarly
R1193 T2076 T2077 arg1Of bind,to
R1194 T2076 T2086 arg1Of bind,without
R1195 T2077 T2085 arg1Of to,but
R1196 T2080 T2081 arg1Of groove,and
R1197 T2082 T2081 arg2Of bend,and
R1198 T2083 T2077 arg2Of DNA,to
R1199 T2083 T2078 arg1Of DNA,the
R1200 T2083 T2079 arg1Of DNA,minor
R1201 T2083 T2080 arg1Of DNA,groove
R1202 T2083 T2082 arg1Of DNA,bend
R1203 T2085 T2084 arg1Of but,","
R1204 T2086 T2085 arg2Of without,but
R1205 T2088 T2086 arg2Of specificity,without
R1206 T2088 T2087 arg1Of specificity,sequence
R1207 T2090 T2089 arg1Of are,","
R1208 T2090 T2098 arg1Of are,[
R1209 T2093 T2092 arg1Of expressed,ubiquitously
R1210 T2094 T2093 arg1Of HMG1,expressed
R1211 T2094 T2095 arg1Of HMG1,and
R1212 T2095 T2090 arg2Of and,are
R1213 T2095 T2091 arg1Of and,the
R1214 T2097 T2095 arg2Of proteins,and
R1215 T2097 T2096 arg1Of proteins,HMG2
R1216 T2099 T2098 arg2Of 17,[
R1217 T2100 T2098 arg3Of ],[
R1218 T2101 T2102 arg1Of Modulation,of
R1219 T2101 T2105 arg1Of Modulation,by
R1220 T2101 T2111 arg1Of Modulation,can
R1221 T2101 T2112 arg1Of Modulation,mediate
R1222 T2101 T2123 arg1Of Modulation,bringing
R1223 T2104 T2102 arg2Of structure,of
R1224 T2104 T2103 arg1Of structure,DNA
R1225 T2110 T2105 arg2Of proteins,by
R1226 T2110 T2106 arg1Of proteins,these
R1227 T2110 T2107 arg1Of proteins,and
R1228 T2110 T2108 arg1Of proteins,other
R1229 T2110 T2109 arg1Of proteins,HMG
R1230 T2112 T2111 arg2Of mediate,can
R1231 T2112 T2116 arg1Of mediate,on
R1232 T2112 T2122 arg1Of mediate,by
R1233 T2115 T2112 arg2Of function,mediate
R1234 T2115 T2113 arg1Of function,long-range
R1235 T2115 T2114 arg1Of function,enhancer
R1236 T2118 T2119 arg1Of DNA,and
R1237 T2119 T2116 arg2Of and,on
R1238 T2119 T2117 arg1Of and,both
R1239 T2121 T2119 arg2Of genes,and
R1240 T2121 T2120 arg1Of genes,chromatin-assembled
R1241 T2123 T2122 arg2Of bringing,by
R1242 T2123 T2124 arg1Of bringing,together
R1318 T2274 T2272 arg1Of globins,adult
R1319 T2274 T2273 arg1Of globins,β
R1320 T2276 T2252 arg1Of β,At
R1321 T2276 T2260 arg1Of β,","
R1322 T2276 T2275 arg1Of β,(
R1323 T2277 T2278 arg1Of major,and
R1324 T2195 T2192 arg1Of region,the
R1325 T2195 T2193 arg1Of region,locus
R1326 T2279 T2278 arg2Of minor,and
R1327 T2195 T2194 arg1Of region,control
R1328 T2195 T2196 arg1Of region,that
R1329 T2195 T2197 arg1Of region,is
R1330 T2282 T2276 arg2Of 22,β
R1331 T2282 T2277 arg1Of 22,major
R1332 T2282 T2279 arg1Of 22,minor
R1333 T2282 T2280 arg1Of 22,)
R1334 T2282 T2281 arg2Of 22,[
R1335 T2283 T2281 arg3Of ],[
R1336 T2195 T2198 arg2Of region,characterized
R1337 T2198 T2197 arg2Of characterized,is
R1338 T2286 T2284 arg1Of gene,The
R1339 T2286 T2285 arg1Of gene,ɛy
R1340 T2286 T2287 arg1Of gene,is
R1341 T2286 T2288 arg2Of gene,silenced
R1342 T2288 T2287 arg2Of silenced,is
R1343 T2288 T2289 arg1Of silenced,in
R1344 T2201 T2198 arg1Of set,characterized
R1345 T2292 T2289 arg2Of cells,in
R1346 T2292 T2290 arg1Of cells,definitive
R1347 T2292 T2291 arg1Of cells,erythroid
R1348 T2294 T2293 arg1Of mechanism,The
R1127 T2011 T2006 arg2Of and,disrupts
R1128 T2011 T2007 arg1Of and,both
R1129 T2014 T2011 arg2Of gene,and
R1130 T2014 T2012 arg1Of gene,the
R1131 T2014 T2013 arg1Of gene,Sox6
R1132 T2014 T2015 arg1Of gene,(
R1133 T2019 T2015 arg2Of gene,(
R1134 T2019 T2016 arg1Of gene,and
R1135 T2019 T2017 arg1Of gene,no
R1136 T2019 T2018 arg1Of gene,other
R1137 T2019 T2020 arg1Of gene,within
R1138 T2022 T2020 arg2Of nucleotides,within
R1139 T2022 T2021 arg1Of nucleotides,"50,000"
R1140 T2022 T2023 arg1Of nucleotides,of
R1141 T2026 T2023 arg2Of breakpoints,of
R1142 T2026 T2024 arg1Of breakpoints,the
R1143 T2026 T2025 arg1Of breakpoints,chromosomal
R1144 T2027 T2015 arg3Of ),(
R1145 T2029 T2028 arg2Of 14,[
R1146 T2030 T2028 arg3Of ],[
R1147 T2034 T2032 arg1Of gene,the
R1148 T2034 T2033 arg1Of gene,p
R1149 T2034 T2035 arg1Of gene,functions
R1150 T2035 T2031 arg2Of functions,Because
R1151 T2035 T2036 arg1Of functions,solely
R1152 T2035 T2037 arg1Of functions,in
R1153 T2038 T2037 arg2Of pigmentation,in
R1154 T2038 T2039 arg1Of pigmentation,[
R1155 T2040 T2039 arg2Of 16,[
R1156 T2041 T2039 arg3Of ],[
R1157 T2046 T2043 arg1Of factor,the
R1158 T2046 T2044 arg1Of factor,Sox6
R1159 T2046 T2045 arg1Of factor,transcription
R1160 T2046 T2047 arg1Of factor,is
R1161 T2046 T2048 arg2Of factor,implicated
R1162 T2048 T2031 arg1Of implicated,Because
R1163 T2048 T2042 arg1Of implicated,","
R1164 T2048 T2047 arg2Of implicated,is
R1165 T2048 T2049 arg1Of implicated,in
R1166 T2052 T2049 arg2Of phenotypes,in
R1167 T2052 T2050 arg1Of phenotypes,all
R1243 T2126 T2123 arg2Of regions,bringing
R1244 T2126 T2125 arg1Of regions,distant
R1245 T2126 T2127 arg1Of regions,of
R1246 T2128 T2129 arg1Of DNA,and
R1247 T2129 T2127 arg2Of and,of
R1248 T2131 T2129 arg2Of factors,and
R1249 T2131 T2130 arg2Of factors,associated
R1250 T2135 T2134 arg1Of proteins,HMG
R1251 T2135 T2136 arg1Of proteins,have
R1252 T2135 T2137 arg1Of proteins,been
R1253 T2135 T2138 arg2Of proteins,shown
R1254 T2135 T2140 arg1Of proteins,modulate
R1255 T2138 T2132 arg1Of shown,Specifically
R1256 T2138 T2133 arg1Of shown,","
R1257 T2138 T2136 arg2Of shown,have
R1258 T2138 T2137 arg2Of shown,been
R1259 T2140 T2138 arg3Of modulate,shown
R1260 T2140 T2139 arg1Of modulate,to
R1261 T2142 T2140 arg2Of genes,modulate
R1262 T2142 T2141 arg1Of genes,β-globin
R1263 T2142 T2143 arg1Of genes,[
R1264 T2144 T2143 arg2Of 18–21,[
R1265 T2145 T2143 arg3Of ],[
R1266 T2149 T2146 arg1Of genes,The
R1267 T2149 T2147 arg1Of genes,mouse
R1268 T2149 T2148 arg1Of genes,β-globin
R1269 T2149 T2150 arg1Of genes,{
R1270 T2149 T2160 arg1Of genes,are
R1271 T2149 T2161 arg2Of genes,clustered
R1272 T2151 T2152 arg1Of ɛy,","
R1273 T2151 T2154 arg1Of ɛy,","
R1274 T2153 T2152 arg2Of βh1,","
R1275 T2154 T2150 arg2Of ",",{
R1276 T2155 T2157 arg1Of β-major,and
R1277 T2157 T2154 arg2Of and,","
R1278 T2157 T2156 arg1Of and,","
R1279 T2158 T2157 arg2Of β-minor,and
R1280 T2159 T2150 arg3Of },{
R1281 T2161 T2160 arg2Of clustered,are
R1282 T2161 T2162 arg1Of clustered,on
R1283 T2161 T2165 arg1Of clustered,and
R1284 T2163 T2162 arg2Of Chromosome,on
R1285 T2163 T2164 arg1Of Chromosome,7
R1286 T2166 T2167 arg1Of they,are
R1287 T2166 T2169 arg1Of they,homologous
R1288 T2167 T2165 arg2Of are,and
R1289 T2167 T2174 arg1Of are,in
R1290 T2167 T2179 arg1Of are,[
R1291 T2169 T2167 arg2Of homologous,are
R1292 T2169 T2168 arg1Of homologous,highly
R1293 T2169 T2170 arg1Of homologous,to
R1294 T2173 T2170 arg2Of counterparts,to
R1295 T2173 T2171 arg1Of counterparts,their
R1296 T2173 T2172 arg1Of counterparts,human
R1297 T2176 T2177 arg1Of structure,and
R1298 T2177 T2174 arg2Of and,in
R1299 T2177 T2175 arg1Of and,organizational
R1300 T2178 T2177 arg2Of function,and
R1301 T2180 T2179 arg2Of 22,[
R1302 T2181 T2179 arg3Of ],[
R1303 T2183 T2182 arg1Of expression,High-level
R1304 T2183 T2184 arg1Of expression,of
R1305 T2183 T2187 arg1Of expression,requires
R1306 T2186 T2184 arg2Of genes,of
R1307 T2186 T2185 arg1Of genes,these
R1308 T2190 T2187 arg2Of element,requires
R1309 T2190 T2188 arg1Of element,a
R1310 T2190 T2189 arg1Of element,regulatory
R1311 T2190 T2191 arg1Of element,","
R1312 T2270 T2268 arg1Of cells,definitive
R1313 T2270 T2269 arg1Of cells,erythroid
R1314 T2270 T2271 arg1Of cells,express
R1315 T2195 T2191 arg2Of region,","
R1316 T2271 T2267 arg2Of express,where
R1317 T2274 T2271 arg2Of globins,express
R1393 T2327 T2329 arg1Of ɛ,appears
R1394 T2327 T2331 arg1Of ɛ,be
R1395 T2211 T2208 arg1Of 5′,25
R1396 T2327 T2332 arg2Of ɛ,regulated
R1397 T2211 T2209 arg1Of 5′,kb
R1398 T2329 T2323 arg2Of appears,although
R1399 T2329 T2324 arg1Of appears,in
R1400 T2329 T2328 arg1Of appears,also
R1401 T2211 T2210 arg1Of 5′,located
R1402 T2211 T2212 arg1Of 5′,of
R1403 T2332 T2329 arg2Of regulated,appears
R1404 T2332 T2330 arg1Of regulated,to
R1405 T2332 T2331 arg2Of regulated,be
R1406 T2332 T2333 arg1Of regulated,competitively
R1407 T2332 T2334 arg1Of regulated,[
R1408 T2335 T2334 arg2Of 26,[
R1409 T2336 T2334 arg3Of ],[
R1410 T2215 T2212 arg2Of gene,of
R1411 T2338 T2337 arg1Of γ-globin,The
R1412 T2338 T2339 arg1Of γ-globin,to
R1413 T2338 T2343 arg1Of γ-globin,is
R1414 T2338 T2344 arg2Of γ-globin,controlled
R1415 T2342 T2339 arg2Of switch,to
R1416 T2342 T2340 arg1Of switch,adult
R1417 T2342 T2341 arg1Of switch,β-globin
R1418 T2344 T2343 arg2Of controlled,is
R1419 T2344 T2351 arg1Of controlled,[
R1420 T2215 T2213 arg1Of gene,the
R1421 T2215 T2214 arg1Of gene,ɛy
R1422 T2347 T2344 arg1Of competition,controlled
R1423 T2347 T2345 arg2Of competition,by
R1424 T2347 T2346 arg1Of competition,promoter
R1425 T2347 T2348 arg1Of competition,for
R1426 T2217 T2216 arg2Of 23,[
R1427 T2350 T2348 arg2Of LCR,for
R1428 T2350 T2349 arg1Of LCR,the
R1429 T2352 T2351 arg2Of "24,25",[
R1430 T2218 T2216 arg3Of ],[
R1431 T2353 T2351 arg3Of ],[
R1432 T2221 T2219 arg1Of genes,The
R1433 T2356 T2354 arg1Of elements,All
R1434 T2356 T2355 arg1Of elements,the
R1349 T2201 T2199 arg2Of set,by
R1350 T2201 T2200 arg1Of set,a
R1351 T2294 T2295 arg1Of mechanism,of
R1352 T2294 T2305 arg1Of mechanism,has
R1353 T2294 T2306 arg1Of mechanism,been
R1354 T2294 T2307 arg2Of mechanism,studied
R1355 T2296 T2295 arg2Of silencing,of
R1356 T2296 T2297 arg1Of silencing,of
R1357 T2300 T2297 arg2Of counterpart,of
R1358 T2300 T2298 arg1Of counterpart,its
R1359 T2300 T2299 arg1Of counterpart,human
R1360 T2300 T2301 arg1Of counterpart,","
R1361 T2201 T2202 arg1Of set,of
R1362 T2205 T2202 arg2Of sites,of
R1363 T2303 T2301 arg2Of globin,","
R1364 T2303 T2302 arg1Of globin,ɛ
R1365 T2307 T2304 arg1Of studied,","
R1366 T2307 T2305 arg2Of studied,has
R1367 T2307 T2306 arg2Of studied,been
R1368 T2307 T2308 arg1Of studied,extensively
R1369 T2205 T2203 arg1Of sites,nuclease
R1370 T2311 T2309 arg2Of erythropoiesis,In
R1371 T2311 T2310 arg1Of erythropoiesis,definitive
R1372 T2205 T2204 arg1Of sites,hypersensitive
R1373 T2205 T2206 arg2Of sites,spread
R1374 T2313 T2314 arg1Of ɛ,is
R1375 T2313 T2315 arg2Of ɛ,activated
R1376 T2313 T2317 arg2Of ɛ,silenced
R1377 T2206 T2207 arg1Of spread,over
R1378 T2315 T2316 arg1Of activated,and
R1379 T2316 T2309 arg1Of and,In
R1380 T2316 T2312 arg1Of and,","
R1381 T2316 T2314 arg2Of and,is
R1382 T2316 T2319 arg1Of and,[
R1383 T2316 T2322 arg1Of and,","
R1384 T2316 T2323 arg1Of and,although
R1385 T2317 T2316 arg2Of silenced,and
R1386 T2317 T2318 arg1Of silenced,autonomously
R1387 T2206 T2216 arg1Of spread,[
R1388 T2320 T2319 arg2Of "24,25",[
R1389 T2211 T2207 arg2Of 5′,over
R1390 T2321 T2319 arg3Of ],[
R1391 T2326 T2324 arg2Of erythropoiesis,in
R1392 T2326 T2325 arg1Of erythropoiesis,primitive
R1543 T2425 T2441 arg2Of factors,shown
R1544 T2425 T2444 arg1Of factors,bind
R1545 T2425 T2457 arg1Of factors,regulate
R1546 T2248 T2245 arg1Of globins,ɛy
R1547 T2248 T2247 arg1Of globins,βh-1
R1548 T2428 T2427 arg1Of as,such
R1549 T2250 T2249 arg2Of 22,[
R1550 T2429 T2430 arg1Of GATA-1,","
R1551 T2430 T2432 arg1Of ",",","
R1552 T2431 T2430 arg2Of YY-1,","
R1553 T2432 T2435 arg1Of ",",and
R1554 T2251 T2249 arg3Of ],[
R1555 T2433 T2432 arg2Of COUP-TF,","
R1556 T2435 T2428 arg2Of and,as
R1557 T2435 T2434 arg1Of and,","
R1558 T2436 T2435 arg2Of DRED,and
R1559 T2256 T2252 arg2Of coitus,At
R1560 T2439 T2440 arg1Of identified,and
R1561 T2440 T2437 arg2Of and,have
R1562 T2440 T2438 arg2Of and,been
R1563 T2441 T2440 arg2Of shown,and
R1564 T2444 T2441 arg3Of bind,shown
R1565 T2444 T2442 arg1Of bind,to
R1566 T2444 T2443 arg1Of bind,directly
R1567 T2444 T2445 arg1Of bind,to
R1568 T2444 T2449 arg1Of bind,(
R1569 T2444 T2456 modOf bind,to
R1570 T2444 T2459 modOf bind,silencing
R1571 T2444 T2460 arg1Of bind,[
R1572 T2256 T2253 arg1Of coitus,11.5
R1573 T2448 T2445 arg2Of elements,to
R1574 T2448 T2446 arg1Of elements,these
R1575 T2448 T2447 arg1Of elements,DNA
R1576 T2256 T2254 arg1Of coitus,d
R1577 T2450 T2449 arg2Of as,(
R1578 T2256 T2255 arg1Of coitus,post
R1579 T2451 T2450 arg2Of part,as
R1580 T2451 T2452 arg1Of part,of
R1581 T2256 T2257 arg1Of coitus,(
R1582 T2258 T2257 arg2Of dpc,(
R1583 T2454 T2452 arg2Of complexes,of
R1584 T2454 T2453 arg1Of complexes,protein
R1585 T2455 T2449 arg3Of ),(
R1586 T2457 T2456 arg1Of regulate,to
R1587 T2457 T2458 arg1Of regulate,ɛ
R1588 T2259 T2257 arg3Of ),(
R1589 T2262 T2261 arg1Of shifts,erythropoiesis
R1590 T2461 T2460 arg2Of 27,[
R1591 T2462 T2460 arg3Of ],[
R1592 T2262 T2263 arg1Of shifts,to
R1593 T2262 T2267 arg1Of shifts,where
R1594 T2262 T2276 arg1Of shifts,β
R1595 T2266 T2263 arg2Of liver,to
R1435 T2356 T2357 arg1Of elements,responsible
R1436 T2356 T2364 arg1Of elements,are
R1437 T2356 T2365 arg1Of elements,within
R1438 T2356 T2370 arg1Of elements,in
R1439 T2357 T2358 arg1Of responsible,for
R1440 T2221 T2220 arg1Of genes,β-globin
R1441 T2359 T2358 arg2Of silencing,for
R1442 T2221 T2222 arg1Of genes,are
R1443 T2221 T2223 arg2Of genes,expressed
R1444 T2223 T2222 arg2Of expressed,are
R1445 T2363 T2359 arg2Of gene,silencing
R1446 T2363 T2360 arg1Of gene,the
R1447 T2363 T2361 arg1Of gene,ɛ
R1448 T2363 T2362 arg1Of gene,globin
R1449 T2364 T2376 arg1Of are,","
R1450 T2364 T2377 modOf are,suggesting
R1451 T2365 T2369 arg1Of within,or
R1452 T2223 T2224 arg1Of expressed,in
R1453 T2226 T2227 arg1Of tissue-,and
R1454 T2228 T2227 arg2Of development-specific,and
R1455 T2368 T2365 arg2Of gene,within
R1456 T2368 T2366 arg1Of gene,the
R1457 T2368 T2367 arg1Of gene,ɛ
R1458 T2369 T2364 arg2Of or,are
R1459 T2370 T2369 arg2Of in,or
R1460 T2229 T2224 arg2Of fashion,in
R1461 T2372 T2370 arg2Of sequences,in
R1462 T2372 T2371 arg1Of sequences,adjacent
R1463 T2372 T2373 arg1Of sequences,[
R1464 T2229 T2225 arg1Of fashion,a
R1465 T2374 T2373 arg2Of 27,[
R1466 T2375 T2373 arg3Of ],[
R1467 T2229 T2226 arg1Of fashion,tissue-
R1468 T2229 T2228 arg1Of fashion,development-specific
R1469 T2231 T2230 arg2Of mice,In
R1470 T2379 T2380 arg1Of silencing,is
R1471 T2379 T2383 arg1Of silencing,autonomous
R1472 T2380 T2377 arg2Of is,suggesting
R1473 T2380 T2378 arg1Of is,that
R1474 T2380 T2381 arg1Of is,primarily
R1475 T2233 T2234 arg1Of erythropoiesis,originates
R1476 T2383 T2380 arg2Of autonomous,is
R1477 T2234 T2230 arg1Of originates,In
R1478 T2383 T2382 arg1Of autonomous,gene
R1479 T2234 T2232 arg1Of originates,","
R1480 T2234 T2235 arg1Of originates,in
R1481 T2239 T2235 arg2Of sac,in
R1482 T2387 T2384 arg2Of analyses,Using
R1483 T2387 T2385 arg1Of analyses,promoter
R1484 T2387 T2386 arg1Of analyses,deletion
R1485 T2387 T2388 arg1Of analyses,in
R1486 T2391 T2389 arg1Of models,transgenic
R1487 T2391 T2390 arg1Of models,mouse
R1488 T2391 T2392 arg1Of models,and
R1489 T2392 T2388 arg2Of and,in
R1490 T2239 T2236 arg1Of sac,the
R1491 T2395 T2392 arg2Of assays,and
R1492 T2395 T2393 arg1Of assays,cell
R1493 T2395 T2394 arg1Of assays,transfection
R1494 T2239 T2237 arg1Of sac,embryonic
R1495 T2239 T2238 arg1Of sac,yolk
R1496 T2239 T2240 arg1Of sac,where
R1497 T2399 T2384 arg1Of elements,Using
R1498 T2399 T2397 arg1Of elements,multiple
R1499 T2399 T2398 arg1Of elements,DNA
R1500 T2399 T2400 arg1Of elements,important
R1501 T2399 T2405 arg1Of elements,have
R1502 T2399 T2406 arg1Of elements,been
R1503 T2399 T2408 arg2Of elements,identified
R1504 T2400 T2401 arg1Of important,to
R1505 T2243 T2241 arg1Of cells,primitive
R1506 T2404 T2401 arg2Of process,to
R1507 T2404 T2402 arg1Of process,the
R1508 T2404 T2403 arg1Of process,silencing
R1509 T2408 T2384 modOf identified,Using
R1510 T2408 T2396 arg1Of identified,","
R1511 T2408 T2405 arg2Of identified,have
R1512 T2408 T2406 arg2Of identified,been
R1513 T2408 T2407 arg1Of identified,previously
R1514 T2408 T2409 arg1Of identified,in
R1515 T2408 T2419 arg1Of identified,[
R1516 T2412 T2413 arg1Of proximal,and
R1517 T2243 T2242 arg1Of cells,erythroid
R1518 T2243 T2244 arg1Of cells,express
R1519 T2244 T2240 arg2Of express,where
R1520 T2415 T2413 arg2Of distal,and
R1521 T2415 T2414 arg1Of distal,the
R1522 T2244 T2249 arg1Of express,[
R1523 T2418 T2409 arg2Of promoter,in
R1524 T2418 T2410 arg1Of promoter,both
R1525 T2418 T2411 arg1Of promoter,the
R1526 T2418 T2412 arg1Of promoter,proximal
R1527 T2418 T2415 arg1Of promoter,distal
R1528 T2418 T2416 arg1Of promoter,ɛ
R1529 T2418 T2417 arg1Of promoter,gene
R1530 T2420 T2419 arg2Of 27,[
R1531 T2245 T2246 arg1Of ɛy,and
R1532 T2421 T2419 arg3Of ],[
R1533 T2247 T2246 arg2Of βh-1,and
R1534 T2425 T2422 arg1Of factors,Their
R1535 T2425 T2423 arg1Of factors,corresponding
R1536 T2425 T2424 arg1Of factors,transcription
R1537 T2425 T2426 arg1Of factors,","
R1538 T2425 T2428 arg1Of factors,as
R1539 T2248 T2244 arg2Of globins,express
R1540 T2425 T2437 arg1Of factors,have
R1541 T2425 T2438 arg1Of factors,been
R1542 T2425 T2439 arg2Of factors,identified
R1618 T2481 T2480 arg1Of elements,cis
R1619 T2481 T2482 arg1Of elements,and
R1620 T2563 T2562 arg2Of erythrocytes,of
R1621 T2482 T2478 arg2Of and,of
R1622 T2484 T2482 arg2Of proteins,and
R1623 T2484 T2483 arg1Of proteins,transacting
R1624 T2486 T2487 arg1Of addition,to
R1625 T2565 T2564 arg2Of that,(
R1626 T2486 T2503 arg1Of addition,","
R1627 T2565 T2567 arg1Of that,enucleate
R1628 T2488 T2487 arg2Of playing,to
R1629 T2488 T2492 arg1Of playing,in
R1630 T2567 T2566 arg1Of enucleate,normally
R1631 T2491 T2488 arg2Of role,playing
R1632 T2491 T2489 arg1Of role,an
R1633 T2491 T2490 arg1Of role,important
R1634 T2567 T2569 arg1Of enucleate,to
R1635 T2494 T2492 arg2Of development,in
R1636 T2494 T2493 arg1Of development,the
R1637 T2494 T2495 arg1Of development,of
R1638 T2569 T2568 arg1Of to,prior
R1639 T2570 T2569 arg2Of entering,to
R1640 T2499 T2495 arg2Of system,of
R1641 T2499 T2496 arg1Of system,the
R1642 T2499 T2497 arg1Of system,central
R1643 T2499 T2498 arg1Of system,nervous
R1644 T2499 T2500 arg1Of system,[
R1645 T2501 T2500 arg2Of 8–11,[
R1646 T2572 T2570 arg2Of bloodstream,entering
R1647 T2502 T2500 arg3Of ],[
R1648 T2503 T2509 arg1Of ",",and
R1649 T2504 T2503 arg2Of cartilage,","
R1650 T2504 T2505 arg1Of cartilage,[
R1651 T2572 T2571 arg1Of bloodstream,the
R1652 T2506 T2505 arg2Of "6,12,13",[
R1653 T2507 T2505 arg3Of ],[
R1654 T2572 T2573 arg1Of bloodstream,[
R1655 T2574 T2573 arg2Of 27,[
R1656 T2509 T2485 arg2Of and,In
R1657 T2509 T2508 arg1Of and,","
R1658 T2510 T2509 arg2Of muscle,and
R1659 T2510 T2511 arg1Of muscle,[
R1660 T2512 T2511 arg2Of "14,15",[
R1661 T2513 T2511 arg3Of ],[
R1662 T2515 T2516 arg1Of it,was
R1663 T2515 T2517 arg2Of it,shown
R1664 T2575 T2573 arg3Of ],[
R1665 T2517 T2485 arg1Of shown,In
R1666 T2517 T2514 arg1Of shown,","
R1667 T2517 T2516 arg2Of shown,was
R1596 T2266 T2264 arg1Of liver,the
R1597 T2266 T2265 arg1Of liver,fetal
R1598 T2465 T2466 arg1Of it,appears
R1599 T2561 T2560 arg2Of maturation,delayed
R1600 T2466 T2463 arg1Of appears,Thus
R1601 T2466 T2464 arg1Of appears,","
R1602 T2469 T2468 arg1Of silencing,the
R1603 T2469 T2470 arg1Of silencing,of
R1604 T2469 T2474 arg1Of silencing,involves
R1605 T2473 T2470 arg2Of gene,of
R1606 T2473 T2471 arg1Of gene,the
R1607 T2473 T2472 arg1Of gene,ɛ
R1608 T2474 T2466 arg2Of involves,appears
R1609 T2474 T2467 arg1Of involves,that
R1610 T2477 T2474 arg2Of network,involves
R1611 T2477 T2475 arg1Of network,a
R1612 T2477 T2476 arg1Of network,complicated
R1613 T2477 T2478 arg1Of network,of
R1614 T2561 T2562 arg1Of maturation,of
R1615 T2561 T2564 arg1Of maturation,(
R1616 T2561 T2577 arg1Of maturation,and
R1617 T2481 T2479 arg1Of elements,multiple
R1768 T2606 T2604 arg2Of effects,characterize
R1769 T2606 T2605 arg1Of effects,the
R1770 T2606 T2607 arg1Of effects,of
R1771 T2606 T2609 arg1Of effects,on
R1772 T2608 T2607 arg2Of Sox6,of
R1773 T2613 T2609 arg2Of gene,on
R1776 T2613 T2610 arg1Of gene,the
R1777 T2613 T2611 arg1Of gene,ɛy
R1778 T2613 T2612 arg1Of gene,globin
R1779 T2614 T2615 arg1Of We,show
R1781 T2617 T2618 arg1Of Sox6,binds
R1783 T2617 T2627 arg1Of Sox6,represses
R1784 T2618 T2619 arg1Of binds,to
R1785 T2618 T2626 arg1Of binds,and
R1787 T2622 T2619 arg2Of promoter,to
R1789 T2622 T2620 arg1Of promoter,the
R1790 T2622 T2621 arg1Of promoter,proximal
R1791 T2622 T2623 arg1Of promoter,of
R1792 T2625 T2623 arg2Of globin,of
R1795 T2625 T2624 arg1Of globin,ɛy
R1796 T2626 T2615 arg2Of and,show
R1797 T2626 T2616 arg1Of and,that
R1798 T2627 T2626 arg2Of represses,and
R1799 T2629 T2627 arg2Of transcription,represses
R1800 T2629 T2628 arg1Of transcription,its
R1801 T2631 T2632 arg1Of wild-type,(
R1803 T2633 T2632 arg2Of WT,(
R1804 T2634 T2632 arg3Of ),(
R1806 T2635 T2630 arg2Of mice,In
R1807 T2635 T2631 arg1Of mice,wild-type
R1810 T2637 T2638 arg1Of Sox6,is
R1812 T2637 T2640 arg2Of Sox6,expressed
R1813 T2637 T2648 arg1Of Sox6,is
R1814 T2637 T2649 arg2Of Sox6,expressed
R1815 T2640 T2638 arg2Of expressed,is
R1817 T2640 T2639 arg1Of expressed,not
R1818 T2640 T2641 arg1Of expressed,in
R1819 T2640 T2647 arg1Of expressed,but
R1821 T2645 T2641 arg2Of islands,in
R1823 T2645 T2642 arg1Of islands,yolk
R1824 T2645 T2643 arg1Of islands,sac
R1825 T2645 T2644 arg1Of islands,blood
R1827 T2647 T2630 arg1Of but,In
R1829 T2647 T2636 arg1Of but,","
R1830 T2647 T2646 arg1Of but,","
R1831 T2649 T2647 arg2Of expressed,but
R1833 T2649 T2648 arg2Of expressed,is
R1834 T2649 T2650 arg1Of expressed,in
R1835 T2652 T2650 arg2Of liver,in
R1838 T2652 T2651 arg1Of liver,fetal
R1839 T2652 T2653 arg1Of liver,","
R3189 T4618 T4617 arg1Of dpc,18.5
R3190 T4620 T4619 arg2Of shown,As
R3191 T4620 T4621 arg1Of shown,in
R3192 T4622 T4621 arg2Of Figure,in
R3193 T4622 T4623 arg1Of Figure,1
R3194 T4627 T4625 arg1Of gene,the
R3195 T4627 T4626 arg1Of gene,ɛy
R3196 T4627 T4628 arg1Of gene,is
R3197 T4627 T4629 arg2Of gene,expressed
R3198 T4629 T4619 arg1Of expressed,As
R3199 T4629 T4624 arg1Of expressed,","
R3200 T4629 T4628 arg2Of expressed,is
R3201 T4629 T4630 arg1Of expressed,at
R3202 T4629 T4633 arg1Of expressed,at
R3203 T4629 T4637 arg1Of expressed,in
R3204 T4629 T4640 arg1Of expressed,","
R3205 T4629 T4641 arg1Of expressed,in
R3206 T4632 T4630 arg2Of levels,at
R3207 T4632 T4631 arg1Of levels,high
R3208 T4636 T4633 arg2Of points,at
R3209 T4636 T4634 arg1Of points,both
R3210 T4636 T4635 arg1Of points,time
R3211 T4639 T4637 arg2Of mice,in
R3212 T4639 T4638 arg1Of mice,mutant
R3213 T4641 T4643 arg1Of in,to
R3214 T4642 T4641 arg2Of contrast,in
R3215 T4645 T4641 arg3Of decline,in
R1668 T2519 T2520 arg1Of Sox6,is
R1669 T2519 T2521 arg2Of Sox6,upregulated
R1670 T2576 T2564 arg3Of ),(
R1671 T2521 T2517 arg3Of upregulated,shown
R1672 T2521 T2518 arg1Of upregulated,that
R1673 T2521 T2520 arg2Of upregulated,is
R1674 T2521 T2522 arg1Of upregulated,in
R1675 T2521 T2530 arg1Of upregulated,compared
R1676 T2521 T2540 arg1Of upregulated,[
R1677 T2577 T2559 arg2Of and,include
R1678 T2526 T2522 arg2Of cells,in
R1679 T2526 T2523 arg1Of cells,long-term
R1680 T2526 T2524 arg1Of cells,hematopoiesis
R1681 T2526 T2525 arg1Of cells,stem
R1682 T2526 T2527 arg1Of cells,(
R1683 T2528 T2527 arg2Of LT-HSC,(
R1684 T2579 T2577 arg2Of expression,and
R1685 T2529 T2527 arg3Of ),(
R1686 T2531 T2530 arg2Of with,compared
R1687 T2579 T2578 arg1Of expression,higher
R1688 T2579 T2580 arg1Of expression,of
R1689 T2533 T2531 arg2Of progenitors,with
R1690 T2533 T2532 arg1Of progenitors,multipotent
R1691 T2533 T2534 arg1Of progenitors,of
R1692 T2583 T2580 arg2Of genes,of
R1693 T2539 T2534 arg2Of lineage,of
R1694 T2539 T2535 arg1Of lineage,adult
R1695 T2539 T2536 arg1Of lineage,mouse
R1696 T2539 T2537 arg1Of lineage,bone
R1697 T2539 T2538 arg1Of lineage,marrow
R1698 T2583 T2581 arg1Of genes,embryonic
R1699 T2541 T2540 arg2Of 28,[
R1700 T2542 T2540 arg3Of ],[
R1701 T2583 T2582 arg1Of genes,globin
R1702 T2586 T2585 arg1Of extreme,most
R1703 T2545 T2543 arg2Of study,In
R1704 T2545 T2544 arg1Of study,this
R1705 T2547 T2548 arg2Of we,describe
R1706 T2548 T2543 arg1Of describe,In
R1707 T2548 T2546 arg1Of describe,","
R1708 T2550 T2552 arg1Of Sox6,exerts
R1709 T2587 T2584 arg1Of effect,The
R1710 T2552 T2548 arg1Of exerts,describe
R1711 T2552 T2549 arg1Of exerts,that
R1712 T2552 T2551 arg1Of exerts,also
R1713 T2552 T2555 arg1Of exerts,on
R1714 T2554 T2552 arg2Of effects,exerts
R1715 T2554 T2553 arg1Of effects,pleiotropic
R1716 T2556 T2555 arg2Of erythropoiesis,on
R1717 T2587 T2586 arg1Of effect,extreme
R1718 T2587 T2588 arg1Of effect,is
R1719 T2558 T2557 arg1Of effects,These
R1720 T2558 T2559 arg1Of effects,include
R1721 T2590 T2588 arg2Of persistence,is
R1722 T2590 T2589 arg1Of persistence,the
R1723 T2590 T2591 arg1Of persistence,of
R1724 T2593 T2591 arg2Of expression,of
R1725 T2657 T2653 arg2Of pattern,","
R1726 T2657 T2654 arg1Of pattern,the
R1727 T2657 T2655 arg1Of pattern,opposite
R1728 T2657 T2656 arg1Of pattern,expression
R1729 T2657 T2658 arg1Of pattern,of
R1730 T2660 T2658 arg2Of globin,of
R1731 T2660 T2659 arg1Of globin,ɛy
R1732 T2593 T2592 arg1Of expression,high
R1733 T2661 T2662 arg1Of In,the
R1734 T2661 T2664 arg1Of In,of
R1735 T2593 T2594 arg1Of expression,of
R1736 T2663 T2661 arg2Of absence,In
R1737 T2599 T2594 arg2Of gene,of
R1738 T2665 T2661 arg3Of Sox6,In
R1739 T2668 T2667 arg1Of globin,ɛy
R1740 T2668 T2669 arg1Of globin,is
R1741 T2668 T2671 arg2Of globin,expressed
R1742 T2671 T2661 arg1Of expressed,In
R1743 T2599 T2595 arg1Of gene,the
R1744 T2671 T2666 arg1Of expressed,","
R1745 T2671 T2669 arg2Of expressed,is
R1746 T2671 T2670 arg1Of expressed,ectopically
R1747 T2671 T2672 arg1Of expressed,in
R1748 T2671 T2676 arg1Of expressed,","
R1749 T2671 T2677 modOf expressed,demonstrating
R1750 T2599 T2596 arg1Of gene,embryonic
R1751 T2599 T2597 arg1Of gene,ɛy
R1752 T2675 T2672 arg2Of liver,in
R1753 T2675 T2673 arg1Of liver,the
R1754 T2675 T2674 arg1Of liver,fetal
R1755 T2599 T2598 arg1Of gene,globin
R1756 T2601 T2602 arg1Of we,describe
R1757 T2680 T2677 arg2Of functions,demonstrating
R1758 T2680 T2678 arg1Of functions,that
R1759 T2680 T2679 arg1Of functions,Sox6
R1760 T2680 T2681 arg1Of functions,in
R1761 T2683 T2681 arg2Of erythropoiesis,in
R1762 T2683 T2682 arg1Of erythropoiesis,definitive
R1763 T2601 T2604 arg1Of we,characterize
R1764 T2602 T2603 arg1Of describe,and
R1765 T2603 T2600 arg1Of and,Here
R1766 T2604 T2603 arg2Of characterize,and
R1767 T2606 T2602 arg2Of effects,describe
R3099 T4528 T4527 arg1Of Expression,Persistent
R3100 T4528 T4529 arg1Of Expression,of
R3101 T4528 T4535 arg1Of Expression,","
R3102 T4528 T4536 arg1Of Expression,in
R3103 T4532 T4529 arg2Of Globin,of
R3104 T4532 T4530 arg1Of Globin,the
R3105 T4532 T4531 arg1Of Globin,Embryonic
R3106 T4532 T4533 arg1Of Globin,","
R3107 T4534 T4533 arg2Of ɛy,","
R3108 T4538 T4536 arg2Of Mice,in
R3109 T4538 T4537 arg1Of Mice,Sox6-Deficient
R3110 T4542 T4539 arg1Of gene,The
R3111 T4542 T4540 arg1Of gene,ɛy
R3112 T4542 T4541 arg1Of gene,globin
R3113 T4542 T4543 arg1Of gene,was
R3114 T4542 T4545 arg2Of gene,identified
R3115 T4545 T4543 arg2Of identified,was
R3116 T4545 T4544 arg1Of identified,initially
R3117 T4545 T4546 arg1Of identified,as
R3118 T4549 T4546 arg2Of transcript,as
R3119 T4549 T4547 arg1Of transcript,an
R3120 T4549 T4548 arg2Of transcript,upregulated
R3121 T4549 T4550 arg1Of transcript,in
R3122 T4553 T4550 arg2Of mouse,in
R3123 T4553 T4551 arg1Of mouse,the
R3124 T4553 T4552 arg1Of mouse,p 100H
R3125 T4553 T4554 arg1Of mouse,using
R3126 T4554 T4557 modOf using,to
R3127 T4556 T4554 arg2Of hybridization,using
R3128 T4556 T4555 arg1Of hybridization,subtractive
R3129 T4558 T4557 arg1Of identify,to
R3130 T4561 T4558 arg2Of targets,identify
R3131 T4561 T4559 arg1Of targets,Sox6
R3132 T4561 T4560 arg1Of targets,downstream
R3133 T4564 T4562 arg1Of observation,This
R3134 T4564 T4563 arg1Of observation,initial
R3135 T4564 T4565 arg1Of observation,was
R3136 T4564 T4566 arg2Of observation,confirmed
R3137 T4566 T4565 arg2Of confirmed,was
R3138 T4566 T4567 arg1Of confirmed,in
R3139 T4566 T4574 arg1Of confirmed,[
R3140 T4571 T4567 arg2Of allele,in
R3141 T4571 T4568 arg1Of allele,an
R3142 T4571 T4569 arg1Of allele,independent
R3143 T4571 T4570 arg1Of allele,knock-out
R3144 T4571 T4572 arg1Of allele,of
R3145 T4573 T4572 arg2Of Sox6,of
R3146 T4575 T4574 arg2Of 13,[
R3147 T4576 T4574 arg3Of ],[
R3148 T4577 T4566 arg3Of using,confirmed
R3149 T4581 T4577 arg2Of reaction,using
R3150 T4581 T4578 arg1Of reaction,real-time
R3151 T4581 T4579 arg1Of reaction,polymerase
R3152 T4581 T4580 arg1Of reaction,chain
R3153 T4581 T4582 arg1Of reaction,(
R3154 T4581 T4585 arg1Of reaction,(
R3155 T4583 T4582 arg2Of PCR,(
R3156 T4584 T4582 arg3Of ),(
R3216 T4645 T4644 arg1Of decline,the
R3217 T4645 T4646 arg1Of decline,in
R3218 T4647 T4646 arg2Of expression,in
R3219 T4647 T4648 arg2Of expression,observed
R3220 T4648 T4649 arg1Of observed,in
R3221 T4651 T4649 arg2Of mice,in
R3222 T4651 T4650 arg1Of mice,WT
R3223 T4653 T4652 arg1Of difference,No
R3224 T4653 T4654 arg1Of difference,was
R3225 T4653 T4655 arg2Of difference,seen
R3226 T4655 T4654 arg2Of seen,was
R3227 T4655 T4656 arg1Of seen,between
R3228 T4657 T4658 arg1Of WT,and
R3229 T4659 T4658 arg2Of heterozygous,and
R3230 T4660 T4656 arg2Of mice,between
R3231 T4660 T4657 arg1Of mice,WT
R3232 T4660 T4659 arg1Of mice,heterozygous
R3233 T4660 T4661 arg1Of mice,(
R3234 T4663 T4661 arg2Of data,(
R3235 T4663 T4662 arg1Of data,unpublished
R3236 T4664 T4661 arg3Of ),(
R3237 T4669 T4667 arg1Of levels,the
R3238 T4669 T4668 arg1Of levels,expression
R3239 T4669 T4670 arg1Of levels,of
R3240 T4669 T4682 arg1Of levels,are
R3241 T4669 T4684 arg1Of levels,higher
R3242 T4676 T4670 arg2Of genes,of
R3243 T4676 T4671 arg1Of genes,the
R3244 T4676 T4672 arg1Of genes,other
R3245 T4676 T4673 arg1Of genes,two
R3246 T4676 T4674 arg1Of genes,embryonic
R3247 T4676 T4675 arg1Of genes,globin
R3248 T4676 T4677 arg1Of genes,(
R3249 T4678 T4679 arg1Of ζ,and
R3250 T4679 T4677 arg2Of and,(
R3251 T4680 T4679 arg2Of βh1,and
R3252 T4681 T4677 arg3Of ),(
R3253 T4682 T4665 arg1Of are,Interestingly
R3254 T4682 T4666 arg1Of are,","
R3255 T4682 T4683 arg1Of are,also
R3256 T4682 T4689 arg1Of are,","
R3257 T4682 T4690 arg1Of are,compared
R3258 T4684 T4682 arg2Of higher,are
R3259 T4684 T4685 arg1Of higher,in
R3260 T4688 T4685 arg2Of mice,in
R3261 T4688 T4686 arg1Of mice,p100H
R3262 T4688 T4687 arg1Of mice,homozygous
R3263 T4691 T4695 arg1Of with,but
R3339 T4772 T4765 arg2Of results,in
R3340 T4772 T4766 arg1Of results,Figure
R3341 T4772 T4767 arg1Of results,1
R3342 T4772 T4768 arg1Of results,illustrate
R3343 T4772 T4769 arg1Of results,real
R3344 T4772 T4770 arg1Of results,time
R3345 T4772 T4771 arg1Of results,PCR
R3346 T4775 T4774 arg2Of performed,were
R3347 T4775 T4776 arg1Of performed,in
R3348 T4777 T4776 arg2Of triplicate,in
R3349 T4777 T4778 arg1Of triplicate,(
R3350 T4780 T4779 arg1Of deviation,standard
R3351 T4780 T4781 arg1Of deviation,of
R3352 T4780 T4784 arg1Of deviation,is
R3353 T4780 T4785 arg2Of deviation,shown
R3354 T4783 T4781 arg2Of data,of
R3355 T4783 T4782 arg1Of data,the
R3356 T4785 T4778 arg2Of shown,(
R3357 T4785 T4784 arg2Of shown,is
R3358 T4788 T4785 arg1Of bars,shown
R3359 T4788 T4786 arg2Of bars,by
R3360 T4788 T4787 arg1Of bars,error
R3361 T4789 T4778 arg3Of ),(
R3362 T4791 T4792 arg1Of all,of
R3363 T4791 T4795 arg1Of all,were
R3364 T4791 T4796 arg2Of all,performed
R3365 T4794 T4792 arg2Of assays,of
R3366 T4794 T4793 arg1Of assays,the
R3367 T4796 T4790 arg2Of performed,Because
R3368 T4796 T4795 arg2Of performed,were
R3369 T4796 T4797 arg1Of performed,at
R3370 T4800 T4797 arg2Of time,at
R3371 T4800 T4798 arg1Of time,the
R3372 T4800 T4799 arg1Of time,same
R3373 T4800 T4801 arg1Of time,with
R3374 T4805 T4801 arg2Of control,with
R3375 T4805 T4802 arg1Of control,the
R3376 T4805 T4803 arg1Of control,same
R3377 T4805 T4804 arg1Of control,internal
R3378 T4808 T4807 arg1Of levels,the
R3379 T4808 T4809 arg2Of levels,shown
R3380 T4808 T4810 arg1Of levels,are
R3381 T4808 T4814 arg1Of levels,are
R3382 T4808 T4816 arg1Of levels,comparable
R3383 T4808 T4821 arg1Of levels,are
R3384 T4808 T4822 arg1Of levels,in
R3385 T4810 T4813 arg1Of are,and
R3386 T4812 T4810 arg2Of levels,are
R3387 T4812 T4811 arg1Of levels,relative
R3388 T4813 T4790 arg1Of and,Because
R3389 T4813 T4806 arg1Of and,","
R3390 T4814 T4815 arg1Of are,thus
R3391 T4814 T4817 arg1Of are,across
R3392 T4814 T4820 arg1Of are,and
R3393 T4816 T4814 arg2Of comparable,are
R3394 T4819 T4817 arg2Of samples,across
R3395 T4819 T4818 arg1Of samples,all
R3396 T4820 T4813 arg2Of and,and
R3157 T4587 T4585 arg2Of data,(
R3158 T4587 T4586 arg1Of data,unpublished
R3159 T4588 T4585 arg3Of ),(
R3160 T4590 T4589 arg1Of PCR,Real-time
R3161 T4590 T4591 arg1Of PCR,was
R3162 T4590 T4592 arg2Of PCR,used
R3163 T4592 T4591 arg2Of used,was
R3164 T4594 T4592 arg3Of quantitate,used
R3165 T4594 T4593 arg1Of quantitate,to
R3166 T4594 T4609 arg1Of quantitate,at
R3167 T4597 T4594 arg2Of levels,quantitate
R3168 T4597 T4595 arg1Of levels,the
R3169 T4597 T4596 arg1Of levels,expression
R3170 T4597 T4598 arg1Of levels,of
R3171 T4601 T4598 arg2Of genes,of
R3172 T4601 T4599 arg1Of genes,other
R3173 T4601 T4600 arg1Of genes,globin
R3174 T4601 T4602 arg1Of genes,in
R3175 T4604 T4603 arg1Of mutant,p100H
R3176 T4604 T4605 arg1Of mutant,and
R3177 T4605 T4602 arg2Of and,in
R3178 T4608 T4605 arg2Of livers,and
R3179 T4608 T4606 arg1Of livers,WT
R3180 T4608 T4607 arg1Of livers,mouse
R3181 T4612 T4610 arg1Of stages,two
R3182 T4612 T4611 arg1Of stages,developmental
R3183 T4612 T4613 arg1Of stages,","
R3184 T4613 T4616 arg1Of ",",and
R3185 T4615 T4613 arg2Of dpc,","
R3186 T4615 T4614 arg1Of dpc,15.5
R3187 T4616 T4609 arg2Of and,at
R3188 T4618 T4616 arg2Of dpc,and
R3264 T4693 T4691 arg2Of mice,with
R3265 T4693 T4692 arg1Of mice,WT
R3266 T4695 T4690 arg2Of but,compared
R3267 T4695 T4694 arg1Of but,","
R3268 T4696 T4695 arg2Of to,but
R3269 T4699 T4698 arg1Of lesser,much
R3270 T4700 T4696 arg2Of extent,to
R3271 T4700 T4697 arg1Of extent,a
R3272 T4700 T4699 arg1Of extent,lesser
R3273 T4700 T4701 arg1Of extent,than
R3274 T4702 T4701 arg2Of seen,than
R3275 T4702 T4703 arg1Of seen,for
R3276 T4702 T4706 arg1Of seen,at
R3277 T4705 T4703 arg2Of globin,for
R3278 T4705 T4704 arg1Of globin,ɛy
R3279 T4708 T4706 arg2Of dpc,at
R3280 T4708 T4707 arg1Of dpc,18.5
R3281 T4708 T4709 arg1Of dpc,(
R3282 T4710 T4709 arg2Of Figure,(
R3283 T4710 T4711 arg1Of Figure,1
R3284 T4712 T4709 arg3Of ),(
R3285 T4717 T4715 arg1Of level,the
R3286 T4717 T4716 arg1Of level,expression
R3287 T4717 T4718 arg1Of level,of
R3288 T4717 T4722 arg1Of level,is
R3289 T4717 T4725 arg1Of level,higher
R3290 T4721 T4718 arg2Of globin,of
R3291 T4721 T4719 arg1Of globin,adult
R3292 T4721 T4720 arg1Of globin,β
R3293 T4722 T4713 arg1Of is,Moreover
R3294 T4722 T4714 arg1Of is,","
R3295 T4722 T4723 arg1Of is,also
R3296 T4722 T4734 arg1Of is,at
R3297 T4725 T4722 arg2Of higher,is
R3298 T4725 T4724 arg1Of higher,somewhat
R3299 T4725 T4726 arg1Of higher,in
R3300 T4725 T4730 arg1Of higher,than
R3301 T4729 T4726 arg2Of mice,in
R3302 T4729 T4727 arg1Of mice,p100H
R3303 T4729 T4728 arg1Of mice,homozygous
R3304 T4731 T4730 arg2Of in,than
R3305 T4733 T4731 arg2Of mice,in
R3306 T4733 T4732 arg1Of mice,WT
R3307 T4736 T4734 arg2Of dpc,at
R3308 T4736 T4735 arg1Of dpc,18.5
R3309 T4736 T4737 arg1Of dpc,(
R3310 T4738 T4737 arg2Of Figure,(
R3311 T4738 T4739 arg1Of Figure,1
R3312 T4740 T4737 arg3Of ),(
R3313 T4742 T4741 arg1Of lethality,Perinatal
R3314 T4742 T4743 arg1Of lethality,of
R3315 T4742 T4746 arg1Of lethality,(
R3316 T4742 T4756 arg1Of lethality,precludes
R3317 T4745 T4743 arg2Of mice,of
R3318 T4745 T4744 arg1Of mice,mutant
R3319 T4748 T4746 arg2Of from,(
R3320 T4748 T4747 arg1Of from,presumably
R3321 T4751 T4748 arg2Of defect,from
R3322 T4751 T4749 arg1Of defect,the
R3323 T4751 T4750 arg1Of defect,heart
R3324 T4751 T4752 arg1Of defect,[
R3325 T4753 T4752 arg2Of 14,[
R3326 T4754 T4752 arg3Of ],[
R3327 T4755 T4746 arg3Of ),(
R3328 T4756 T4758 arg1Of precludes,from
R3329 T4757 T4756 arg2Of us,precludes
R3330 T4759 T4758 arg2Of evaluating,from
R3331 T4762 T4759 arg2Of expression,evaluating
R3332 T4762 T4760 arg1Of expression,postnatal
R3333 T4762 T4761 arg1Of expression,globin
R3334 T4764 T4763 arg1Of graphs,The
R3335 T4764 T4765 arg1Of graphs,in
R3336 T4764 T4773 arg1Of graphs,that
R3337 T4764 T4774 arg1Of graphs,were
R3338 T4764 T4775 arg2Of graphs,performed
R3414 T4839 T4855 arg1Of level,is
R3415 T4839 T4857 arg1Of level,equivalent
R3416 T4842 T4840 arg2Of expression,of
R3417 T4842 T4841 arg1Of expression,ɛy
R3418 T4842 T4843 arg1Of expression,in
R3419 T4845 T4843 arg2Of livers,in
R3420 T4845 T4844 arg1Of livers,the
R3421 T4845 T4846 arg1Of livers,of
R3422 T4848 T4847 arg1Of dpc,15.5
R3423 T4848 T4849 arg1Of dpc,and
R3424 T4849 T4846 arg2Of and,of
R3425 T4854 T4849 arg2Of mice,and
R3426 T4854 T4850 arg1Of mice,18.5
R3427 T4854 T4851 arg1Of mice,dpc
R3428 T4854 T4852 arg1Of mice,homozygous
R3429 T4854 T4853 arg1Of mice,mutant
R3430 T4855 T4836 arg2Of is,note
R3431 T4855 T4837 arg1Of is,that
R3432 T4857 T4855 arg2Of equivalent,is
R3433 T4857 T4856 arg1Of equivalent,statistically
R3434 T4857 T4858 arg1Of equivalent,to
R3435 T4860 T4858 arg2Of level,to
R3436 T4860 T4859 arg1Of level,the
R3437 T4860 T4861 arg1Of level,of
R3438 T4863 T4861 arg2Of expression,of
R3439 T4863 T4862 arg1Of expression,βmaj/min
R3440 T4863 T4864 arg1Of expression,in
R3441 T4866 T4864 arg2Of livers,in
R3442 T4866 T4865 arg1Of livers,the
R3443 T4866 T4867 arg1Of livers,of
R3444 T4869 T4868 arg1Of dpc,15.5
R3445 T4869 T4870 arg1Of dpc,and
R3446 T4870 T4867 arg2Of and,of
R3447 T4875 T4870 arg2Of mice,and
R3448 T4875 T4871 arg1Of mice,18.5
R3449 T4875 T4872 arg1Of mice,dpc
R3450 T4875 T4873 arg1Of mice,homozygous
R3451 T4875 T4874 arg1Of mice,WT
R3966 T5817 T5816 arg1Of Studies,Transfection
R3967 T5817 T5818 arg1Of Studies,Using
R3968 T5817 T5825 arg1Of Studies,Represses
R3969 T5821 T5819 arg1Of Indicate,GM979
R3970 T5821 T5820 arg1Of Indicate,Cells
R3971 T5823 T5818 arg2Of Sox6,Using
R3972 T5823 T5821 arg1Of Sox6,Indicate
R3973 T5823 T5822 arg1Of Sox6,That
R3974 T5825 T5824 arg1Of Represses,Directly
R3975 T5829 T5825 arg2Of Promoter,Represses
R3976 T5829 T5826 arg1Of Promoter,the
R3977 T5829 T5827 arg1Of Promoter,ɛy
R3978 T5829 T5828 arg1Of Promoter,Gene
R3397 T4821 T4820 arg2Of are,and
R3398 T4822 T4821 arg2Of in,are
R3399 T4823 T4822 arg2Of agreement,in
R3400 T4823 T4824 arg1Of agreement,with
R3401 T4826 T4825 arg1Of published,previously
R3402 T4827 T4824 arg2Of results,with
R3403 T4827 T4826 arg1Of results,published
R3404 T4827 T4828 arg1Of results,for
R3405 T4831 T4828 arg2Of mice,for
R3406 T4831 T4829 arg1Of mice,WT
R3407 T4831 T4830 arg1Of mice,fetal
R3408 T4831 T4832 arg1Of mice,[
R3409 T4833 T4832 arg2Of 29,[
R3410 T4834 T4832 arg3Of ],[
R3411 T4835 T4836 arg1Of We,note
R3412 T4839 T4838 arg1Of level,the
R3413 T4839 T4840 arg1Of level,of
R4037 T5887 T5889 arg1Of line,expresses
R4038 T5891 T5892 arg1Of ɛy,and
R4039 T5893 T5892 arg2Of adult,and
R4040 T5895 T5889 arg2Of globins,expresses
R4041 T5895 T5890 arg1Of globins,both
R4042 T5895 T5891 arg1Of globins,ɛy
R4043 T5895 T5893 arg1Of globins,adult
R4044 T5895 T5894 arg1Of globins,beta
R4045 T5895 T5896 arg1Of globins,[
R4046 T5897 T5896 arg2Of 30,[
R4047 T5898 T5896 arg3Of ],[
R4048 T5899 T5900 arg1Of We,generated
R4049 T5899 T5910 arg1Of We,fusing
R4050 T5900 T5909 arg1Of generated,by
R4051 T5900 T5940 arg1Of generated,","
R4052 T5900 T5941 arg1Of generated,as
R4053 T5905 T5900 arg2Of construct,generated
R4054 T5905 T5901 arg1Of construct,an
R4055 T5905 T5902 arg1Of construct,ɛy
R4056 T5905 T5903 arg1Of construct,promoter
R4057 T5905 T5904 arg1Of construct,reporter
R4058 T5905 T5906 arg1Of construct,(
R4059 T5907 T5906 arg2Of E-Luc,(
R4060 T5908 T5906 arg3Of ),(
R4061 T5910 T5909 arg2Of fusing,by
R4062 T5910 T5933 arg1Of fusing,","
R4063 T5910 T5934 modOf fusing,followed
R4064 T5914 T5913 arg2Of μLCR,(
R4065 T5915 T5913 arg3Of ),(
R4066 T5916 T5910 arg2Of element,fusing
R4067 T5916 T5911 arg1Of element,a
R4068 T5916 T5912 arg1Of element,micro-LCR
R4069 T5916 T5913 arg1Of element,(
R4070 T5916 T5917 arg1Of element,(
R4071 T5916 T5921 arg1Of element,[
R4072 T5916 T5924 arg1Of element,to
R4073 T5919 T5917 arg2Of kb,(
R4074 T5919 T5918 arg1Of kb,2.5
R4075 T5920 T5917 arg3Of ),(
R4076 T5922 T5921 arg2Of 31,[
R4077 T5923 T5921 arg3Of ],[
R4078 T5928 T5924 arg2Of promoter,to
R4079 T5928 T5925 arg1Of promoter,the
R4080 T5928 T5926 arg1Of promoter,ɛy
R4081 T5928 T5927 arg1Of promoter,proximal
R4082 T5928 T5929 arg1Of promoter,(
R4083 T5931 T5929 arg2Of kb,(
R4084 T5931 T5930 arg1Of kb,2.2
R4085 T5932 T5929 arg3Of ),(
R4086 T5939 T5934 arg1Of gene,followed
R4087 T5939 T5935 arg2Of gene,by
R4088 T5939 T5936 arg1Of gene,the
R4089 T5939 T5937 arg1Of gene,luciferase
R4090 T5939 T5938 arg1Of gene,reporter
R4091 T5942 T5941 arg2Of shown,as
R4092 T5942 T5943 arg1Of shown,in
R4093 T5945 T5943 arg2Of 2A,in
R4094 T5945 T5944 arg1Of 2A,Figure
R4095 T5945 T5946 arg1Of 2A,(
R4096 T5947 T5946 arg2Of detailed,(
R4097 T5947 T5948 arg1Of detailed,in
R4098 T5949 T5950 arg1Of Materials,and
R4099 T5950 T5948 arg2Of and,in
R4100 T5951 T5950 arg2Of Methods,and
R4101 T5952 T5946 arg3Of ),(
R4102 T5953 T5954 arg1Of Overexpression,of
R4103 T5953 T5956 arg1Of Overexpression,in
R4104 T5953 T5959 arg1Of Overexpression,by
R4105 T5953 T5962 arg1Of Overexpression,leads
R4106 T5955 T5954 arg2Of Sox6,of
R4107 T5958 T5956 arg2Of cells,in
R4108 T5958 T5957 arg1Of cells,GM979
R4109 T5961 T5959 arg2Of transfection,by
R4110 T5961 T5960 arg1Of transfection,transient
R4111 T5962 T5963 arg1Of leads,to
R4262 T6108 T6106 arg1Of change,amino
R4263 T6108 T6107 arg1Of change,acid
R4264 T6108 T6109 arg1Of change,is
R4265 T6108 T6111 arg1Of change,in
R4266 T6109 T6110 arg1Of is,not
R4267 T6111 T6109 arg2Of in,is
R4268 T6116 T6111 arg2Of domain,in
R4269 T6116 T6112 arg1Of domain,the
R4270 T6116 T6113 arg1Of domain,HMG
R4271 T6116 T6114 arg1Of domain,DNA
R4272 T6116 T6115 arg1Of domain,binding
R4273 T6121 T6119 arg1Of version,this
R4274 T6121 T6120 arg1Of version,mutant
R4275 T6121 T6122 arg1Of version,of
R4276 T6121 T6124 arg1Of version,retains
R3979 T5829 T5830 arg1Of Promoter,at
R3980 T5833 T5830 arg2Of Level,at
R3981 T5833 T5831 arg1Of Level,the
R3982 T5833 T5832 arg1Of Level,Transcriptional
R3983 T5838 T5837 arg2Of Figure,(
R3984 T5838 T5839 arg1Of Figure,1
R3985 T5840 T5837 arg3Of ),(
R3986 T5843 T5834 arg1Of levels,Real-time
R3987 T5843 T5835 arg1Of levels,PCR
R3988 T5843 T5836 arg1Of levels,assays
R3989 T5843 T5837 arg1Of levels,(
R3990 T5843 T5841 arg1Of levels,measure
R3991 T5843 T5842 arg1Of levels,steady-state
R3992 T5843 T5844 arg1Of levels,of
R3993 T5846 T5844 arg2Of mRNA,of
R3994 T5846 T5845 arg1Of mRNA,ɛy
R3995 T5846 T5847 arg1Of mRNA,","
R3996 T5850 T5847 arg2Of activity,","
R3997 T5850 T5848 arg1Of activity,not
R3998 T5850 T5849 arg1Of activity,transcriptional
R3999 T5850 T5851 arg1Of activity,of
R4000 T5854 T5851 arg2Of promoter,of
R4001 T5854 T5852 arg1Of promoter,the
R4002 T5854 T5853 arg1Of promoter,ɛy
R4003 T5856 T5855 arg1Of investigate,To
R4004 T5858 T5860 arg1Of Sox6,acts
R4005 T5860 T5856 arg2Of acts,investigate
R4006 T5860 T5857 arg1Of acts,whether
R4007 T5860 T5859 arg1Of acts,directly
R4008 T5860 T5861 arg1Of acts,on
R4009 T5860 T5866 arg1Of acts,at
R4010 T5865 T5861 arg2Of promoter,on
R4011 T5865 T5862 arg1Of promoter,the
R4012 T5865 T5863 arg1Of promoter,ɛy
R4013 T5865 T5864 arg1Of promoter,gene
R4014 T5869 T5866 arg2Of level,at
R4015 T5869 T5867 arg1Of level,the
R4016 T5869 T5868 arg1Of level,transcriptional
R4017 T5871 T5856 arg1Of we,investigate
R4018 T5871 T5872 arg1Of we,used
R4019 T5872 T5855 modOf used,To
R4020 T5872 T5870 arg1Of used,","
R4021 T5875 T5874 arg1Of vitro,in
R4022 T5876 T5875 arg1Of transient,vitro
R4023 T5878 T5873 arg1Of assay,an
R4024 T5878 T5876 arg1Of assay,transient
R4025 T5878 T5877 arg1Of assay,transfection
R4026 T5878 T5879 arg1Of assay,and
R4027 T5879 T5872 arg2Of and,used
R4028 T5881 T5879 arg2Of cells,and
R4029 T5881 T5880 arg1Of cells,GM979
R4030 T5881 T5882 arg1Of cells,","
R4031 T5887 T5882 arg2Of line,","
R4032 T5887 T5883 arg1Of line,a
R4033 T5887 T5884 arg1Of line,murine
R4034 T5887 T5885 arg1Of line,erythroleukemic
R4035 T5887 T5886 arg1Of line,cell
R4036 T5887 T5888 arg1Of line,that
R4112 T5966 T5963 arg2Of repression,to
R4113 T5966 T5964 arg1Of repression,a
R4114 T5966 T5965 arg1Of repression,dosage-dependent
R4115 T5966 T5967 arg1Of repression,of
R4116 T5970 T5967 arg2Of activity,of
R4117 T5970 T5968 arg1Of activity,E-Luc
R4118 T5970 T5969 arg1Of activity,reporter
R4119 T5970 T5971 arg1Of activity,(
R4120 T5973 T5971 arg2Of 2B,(
R4121 T5973 T5972 arg1Of 2B,Figure
R4122 T5974 T5971 arg3Of ),(
R4123 T5976 T5975 arg2Of contrast,In
R4124 T5978 T5979 arg1Of overexpression,of
R4125 T5978 T6000 arg1Of overexpression,fails
R4126 T5978 T6002 arg1Of overexpression,repress
R4127 T5983 T5979 arg2Of protein,of
R4128 T5983 T5980 arg1Of protein,a
R4129 T5983 T5981 arg2Of protein,truncated
R4130 T5983 T5982 arg1Of protein,Sox6
R4131 T5983 T5984 arg1Of protein,that
R4132 T5983 T5985 arg1Of protein,lacks
R4133 T5983 T5992 arg1Of protein,(
R4134 T5985 T5989 arg1Of lacks,[
R4135 T5988 T5985 arg2Of domain,lacks
R4136 T5988 T5986 arg1Of domain,its
R4137 T5988 T5987 arg1Of domain,HMG
R4138 T5990 T5989 arg2Of 32,[
R4139 T5991 T5989 arg3Of ],[
R4140 T5993 T5992 arg2Of similar,(
R4141 T5993 T5994 arg1Of similar,to
R4142 T5998 T5994 arg2Of allele,to
R4143 T5998 T5995 arg1Of allele,the
R4144 T5998 T5996 arg1Of allele,p 100H
R4145 T5998 T5997 arg1Of allele,mouse
R4146 T5999 T5992 arg3Of ),(
R4147 T6000 T5975 arg1Of fails,In
R4148 T6000 T5977 arg1Of fails,","
R4149 T6002 T6000 arg2Of repress,fails
R4150 T6002 T6001 arg1Of repress,to
R4151 T6004 T6002 arg2Of activity,repress
R4152 T6004 T6003 arg1Of activity,E-Luc
R4153 T6004 T6005 arg1Of activity,(
R4154 T6007 T6005 arg2Of 2B,(
R4155 T6007 T6006 arg1Of 2B,Figure
R4156 T6008 T6005 arg3Of ),(
R4157 T6010 T6009 arg1Of data,These
R4158 T6010 T6011 arg1Of data,indicate
R4159 T6013 T6014 arg1Of Sox6,acts
R4160 T6013 T6016 arg1Of Sox6,repress
R4161 T6014 T6011 arg2Of acts,indicate
R4162 T6014 T6012 arg1Of acts,that
R4163 T6016 T6014 arg2Of repress,acts
R4164 T6016 T6015 arg1Of repress,to
R4165 T6016 T6020 arg1Of repress,at
R4166 T6019 T6016 arg2Of promoter,repress
R4167 T6019 T6017 arg1Of promoter,the
R4168 T6019 T6018 arg1Of promoter,ɛy
R4169 T6023 T6020 arg2Of level,at
R4170 T6023 T6021 arg1Of level,the
R4171 T6023 T6022 arg1Of level,transcriptional
R4172 T6024 T6025 arg1Of Sox6,has
R4173 T6024 T6026 arg1Of Sox6,been
R4174 T6024 T6027 arg2Of Sox6,shown
R4175 T6024 T6029 arg1Of Sox6,act
R4176 T6024 T6035 arg1Of Sox6,interact
R4177 T6027 T6025 arg2Of shown,has
R4178 T6027 T6026 arg2Of shown,been
R4179 T6027 T6048 arg1Of shown,[
R4180 T6029 T6028 arg1Of act,to
R4181 T6029 T6030 arg1Of act,as
R4182 T6029 T6033 arg1Of act,and
R4183 T6032 T6030 arg2Of repressor,as
R4184 T6032 T6031 arg1Of repressor,a
R4185 T6033 T6027 arg3Of and,shown
R4186 T6035 T6033 arg2Of interact,and
R4187 T6035 T6034 arg1Of interact,to
R4188 T6035 T6036 arg1Of interact,with
R4189 T6039 T6038 arg1Of expressed,widely
R4190 T6040 T6036 arg2Of co-repressor,with
R4191 T6040 T6037 arg1Of co-repressor,a
R4192 T6040 T6039 arg1Of co-repressor,expressed
R4193 T6040 T6041 arg1Of co-repressor,","
R4194 T6040 T6043 arg1Of co-repressor,","
R4195 T6040 T6044 arg1Of co-repressor,on
R4196 T6042 T6041 arg2Of CtBP2,","
R4197 T6047 T6044 arg2Of promoter,on
R4198 T6047 T6045 arg1Of promoter,the
R4199 T6047 T6046 arg1Of promoter,fgf-3
R4200 T6049 T6048 arg2Of 5,[
R4201 T6050 T6048 arg3Of ],[
R4202 T6051 T6052 arg1Of CtBP2,is
R4203 T6051 T6053 arg2Of CtBP2,expressed
R4204 T6053 T6052 arg2Of expressed,is
R4205 T6053 T6054 arg1Of expressed,in
R4206 T6056 T6054 arg2Of cells,in
R4207 T6056 T6055 arg1Of cells,GM979
R4208 T6056 T6057 arg1Of cells,(
R4209 T6059 T6057 arg2Of data,(
R4210 T6059 T6058 arg1Of data,unpublished
R4211 T6060 T6057 arg3Of ),(
R4277 T6123 T6122 arg2Of Sox6,of
R4278 T6124 T6117 arg1Of retains,However
R4279 T6124 T6118 arg1Of retains,","
R4280 T6124 T6140 arg1Of retains,","
R4281 T6124 T6141 modOf retains,indicating
R4282 T6126 T6124 arg2Of ability,retains
R4283 T6126 T6125 arg1Of ability,the
R4284 T6126 T6127 modOf ability,to
R4285 T6128 T6127 arg1Of repress,to
R4286 T6131 T6128 arg2Of promoter,repress
R4287 T6131 T6129 arg1Of promoter,the
R4288 T6131 T6130 arg1Of promoter,ɛy
R4289 T6131 T6132 arg1Of promoter,in
R4290 T6135 T6132 arg2Of assay,in
R4291 T6135 T6133 arg1Of assay,the
R4292 T6135 T6134 arg1Of assay,transfection
R4293 T6135 T6136 arg1Of assay,(
R4294 T6138 T6136 arg2Of 2B,(
R4295 T6138 T6137 arg1Of 2B,Figure
R4296 T6139 T6136 arg3Of ),(
R4297 T6143 T6144 arg1Of Sox6,represses
R4298 T6144 T6141 arg2Of represses,indicating
R4299 T6144 T6142 arg1Of represses,that
R4300 T6144 T6148 arg1Of represses,in
R4301 T6147 T6144 arg2Of promoter,represses
R4302 T6147 T6145 arg1Of promoter,the
R4303 T6147 T6146 arg1Of promoter,ɛy
R4304 T6151 T6148 arg2Of manner,in
R4305 T6151 T6149 arg1Of manner,a
R4306 T6151 T6150 arg1Of manner,CtBP2-independent
R4307 T6153 T6152 arg1Of analysis,Deletion
R4308 T6153 T6154 arg1Of analysis,of
R4309 T6153 T6165 arg1Of analysis,defined
R4310 T6157 T6154 arg2Of promoter,of
R4311 T6157 T6155 arg1Of promoter,the
R4312 T6157 T6156 arg1Of promoter,ɛy
R4313 T6160 T6159 arg2Of shown,as
R4314 T6160 T6161 arg1Of shown,in
R4315 T6163 T6161 arg2Of 2C,in
R4316 T6163 T6162 arg1Of 2C,Figure
R4317 T6165 T6158 arg1Of defined,","
R4318 T6165 T6159 arg1Of defined,as
R4319 T6165 T6164 arg1Of defined,","
R4320 T6167 T6165 arg2Of region,defined
R4321 T6167 T6166 arg1Of region,a
R4322 T6167 T6168 arg1Of region,(
R4323 T6167 T6173 arg1Of region,within
R4324 T6171 T6168 arg2Of −37,(
R4325 T6171 T6169 arg1Of −37,−63
R4326 T6171 T6170 arg1Of −37,to
R4327 T6172 T6168 arg3Of ),(
R4328 T6177 T6173 arg2Of promoter,within
R4329 T6177 T6174 arg1Of promoter,the
R4330 T6177 T6175 arg1Of promoter,ɛy
R4331 T6177 T6176 arg1Of promoter,proximal
R4332 T6177 T6178 arg1Of promoter,that
R4333 T6177 T6179 arg1Of promoter,is
R4334 T6177 T6180 arg1Of promoter,critical
R4335 T6180 T6179 arg2Of critical,is
R4336 T6180 T6181 arg1Of critical,for
R5053 T7483 T7469 modOf performed,To
R5054 T7483 T7480 arg1Of performed,","
R5055 T7483 T7482 arg1Of performed,first
R5056 T7483 T7491 modOf performed,using
R5057 T7487 T7483 arg2Of assays,performed
R5058 T7487 T7484 arg1Of assays,electrophoretic
R5059 T7487 T7485 arg1Of assays,mobility
R5060 T7487 T7486 arg1Of assays,shift
R5061 T7487 T7488 arg1Of assays,(
R5062 T7489 T7488 arg2Of EMSA,(
R5063 T7490 T7488 arg3Of ),(
R5064 T7494 T7491 arg2Of Sox6,using
R5065 T7494 T7492 arg1Of Sox6,a
R5066 T7494 T7493 arg1Of Sox6,c-Myc-tagged
R5067 T7494 T7495 arg1Of Sox6,in
R5068 T7501 T7500 arg1Of vitro,in
R5069 T7502 T7495 arg2Of system,in
R5070 T7502 T7496 arg1Of system,a
R5071 T7502 T7497 arg1Of system,reticulocyte
R5072 T7502 T7498 arg1Of system,lysate-based
R5073 T7502 T7499 arg1Of system,transcription/translation
R5074 T7502 T7501 arg1Of system,vitro
R5075 T7504 T7503 arg1Of probes,The
R5076 T7504 T7505 arg2Of probes,used
R5077 T7504 T7506 arg1Of probes,are
R5078 T7504 T7507 arg2Of probes,listed
R5079 T7507 T7506 arg2Of listed,are
R5080 T7507 T7508 arg1Of listed,in
R5081 T7510 T7508 arg2Of 3A,in
R5082 T7510 T7509 arg1Of 3A,Figure
R5083 T7513 T7512 arg1Of pair,36–base
R5084 T7513 T7514 arg1Of pair,(
R5085 T7515 T7514 arg2Of bp,(
R5086 T7516 T7514 arg3Of ),(
R5087 T7518 T7511 arg1Of probe,The
R5088 T7518 T7513 arg1Of probe,pair
R5089 T7518 T7517 arg1Of probe,WT
R5090 T7518 T7519 arg1Of probe,corresponds
R5091 T7519 T7520 arg1Of corresponds,to
R5092 T7523 T7520 arg2Of region,to
R5093 T7523 T7521 arg1Of region,the
R4212 T6062 T6061 arg1Of investigate,To
R4213 T6065 T6064 arg1Of interaction,the
R4214 T6065 T6066 arg1Of interaction,with
R4215 T6065 T6068 arg1Of interaction,is
R4216 T6065 T6069 arg2Of interaction,required
R4217 T6067 T6066 arg2Of CtBP2,with
R4218 T6069 T6062 arg2Of required,investigate
R4219 T6069 T6063 arg1Of required,whether
R4220 T6069 T6068 arg2Of required,is
R4221 T6069 T6070 arg1Of required,for
R4222 T6072 T6070 arg2Of repression,for
R4223 T6072 T6071 arg1Of repression,Sox6
R4224 T6072 T6073 arg1Of repression,of
R4225 T6076 T6073 arg2Of promoter,of
R4226 T6076 T6074 arg1Of promoter,the
R4227 T6076 T6075 arg1Of promoter,ɛy
R4228 T6078 T6062 arg1Of we,investigate
R4229 T6078 T6079 arg1Of we,introduced
R4230 T6079 T6061 modOf introduced,To
R4231 T6079 T6077 arg1Of introduced,","
R4232 T6082 T6079 arg2Of mutation,introduced
R4233 T6082 T6080 arg1Of mutation,a
R4234 T6082 T6081 arg1Of mutation,point
R4235 T6082 T6083 arg1Of mutation,(
R4236 T6082 T6086 arg1Of mutation,in
R4237 T6084 T6083 arg2Of L386H,(
R4238 T6085 T6083 arg3Of ),(
R4239 T6089 T6086 arg2Of protein,in
R4240 T6089 T6087 arg1Of protein,the
R4241 T6089 T6088 arg1Of protein,Sox6
R4242 T6089 T6090 arg1Of protein,that
R4243 T6089 T6091 arg1Of protein,has
R4244 T6089 T6092 arg1Of protein,been
R4245 T6089 T6094 arg2Of protein,reported
R4246 T6089 T6096 arg1Of protein,be
R4247 T6089 T6097 arg1Of protein,sufficient
R4248 T6094 T6091 arg2Of reported,has
R4249 T6094 T6092 arg2Of reported,been
R4250 T6094 T6093 arg1Of reported,previously
R4251 T6096 T6094 arg3Of be,reported
R4252 T6096 T6095 arg1Of be,to
R4253 T6097 T6096 arg2Of sufficient,be
R4254 T6099 T6097 arg2Of abolish,sufficient
R4255 T6099 T6098 arg1Of abolish,to
R4256 T6101 T6099 arg2Of interaction,abolish
R4257 T6101 T6100 arg1Of interaction,Sox6-CtBP2
R4258 T6101 T6102 arg1Of interaction,[
R4259 T6103 T6102 arg2Of 5,[
R4260 T6104 T6102 arg3Of ],[
R4261 T6108 T6105 arg1Of change,This
R4337 T6183 T6181 arg2Of repression,for
R4338 T6183 T6182 arg1Of repression,Sox6
R4339 T6184 T6185 arg1Of Analysis,of
R4340 T6184 T6189 arg1Of Analysis,reveals
R4341 T6188 T6185 arg2Of region,of
R4342 T6188 T6186 arg1Of region,this
R4343 T6188 T6187 arg1Of region,short
R4344 T6194 T6189 arg2Of sites,reveals
R4345 T6194 T6190 arg1Of sites,two
R4346 T6194 T6191 arg1Of sites,Sox/Sox6
R4347 T6194 T6192 arg1Of sites,consensus
R4348 T6194 T6193 arg1Of sites,binding
R4349 T6194 T6195 arg1Of sites,[
R4350 T6194 T6198 arg1Of sites,(
R4351 T6196 T6195 arg2Of 5,[
R4352 T6197 T6195 arg3Of ],[
R4353 T6200 T6198 arg2Of 3A,(
R4354 T6200 T6199 arg1Of 3A,Figure
R4355 T6201 T6198 arg3Of ),(
R5002 T7433 T7434 arg1Of EMSA,and
R5003 T7434 T7441 arg1Of and,Binds
R5004 T7437 T7435 arg1Of Show,ChIP
R5005 T7437 T7436 arg1Of Show,Assays
R5006 T7439 T7434 arg2Of Sox6,and
R5007 T7439 T7437 arg1Of Sox6,Show
R5008 T7439 T7438 arg1Of Sox6,that
R5009 T7441 T7440 arg1Of Binds,Directly
R5010 T7441 T7442 arg1Of Binds,to
R5011 T7445 T7442 arg2Of Promoter,to
R5012 T7445 T7443 arg1Of Promoter,the
R5013 T7445 T7444 arg1Of Promoter,ɛy
R5014 T7446 T7447 arg1Of Sox6,might
R5015 T7446 T7448 arg1Of Sox6,repress
R5016 T7446 T7463 arg1Of Sox6,regulating
R5017 T7448 T7447 arg2Of repress,might
R5018 T7448 T7452 arg1Of repress,","
R5019 T7448 T7454 arg1Of repress,through
R5020 T7448 T7462 arg1Of repress,by
R5021 T7451 T7448 arg2Of promoter,repress
R5022 T7451 T7449 arg1Of promoter,the
R5023 T7451 T7450 arg1Of promoter,ɛy
R5024 T7454 T7461 arg1Of through,or
R5025 T7457 T7454 arg2Of contact,through
R5026 T7457 T7455 arg1Of contact,direct
R5027 T7457 T7456 arg1Of contact,physical
R5028 T7457 T7458 arg1Of contact,with
R5029 T7460 T7458 arg2Of promoter,with
R5030 T7460 T7459 arg1Of promoter,the
R5031 T7461 T7453 arg1Of or,either
R5032 T7462 T7461 arg2Of by,or
R5033 T7463 T7462 arg2Of regulating,by
R5034 T7464 T7463 arg2Of intermediates,regulating
R5035 T7464 T7465 arg1Of intermediates,affecting
R5036 T7468 T7465 arg2Of promoter,affecting
R5037 T7468 T7466 arg1Of promoter,the
R5038 T7468 T7467 arg1Of promoter,ɛy
R5039 T7470 T7469 arg1Of investigate,To
R5040 T7472 T7473 arg1Of Sox6,is
R5041 T7472 T7475 arg2Of Sox6,associated
R5042 T7475 T7470 arg2Of associated,investigate
R5043 T7475 T7471 arg1Of associated,whether
R5044 T7475 T7473 arg2Of associated,is
R5045 T7475 T7474 arg1Of associated,directly
R5046 T7475 T7476 arg1Of associated,with
R5047 T7479 T7476 arg2Of promoter,with
R5048 T7479 T7477 arg1Of promoter,the
R5049 T7479 T7478 arg1Of promoter,ɛy
R5050 T7481 T7470 arg1Of we,investigate
R5051 T7481 T7483 arg1Of we,performed
R5052 T7481 T7491 arg1Of we,using
R5128 T7652 T7654 arg1Of EMSA,confirmed
R5129 T7656 T7654 arg2Of results,confirmed
R5130 T7656 T7655 arg1Of results,these
R5131 T7656 T7657 arg1Of results,(
R5132 T7659 T7657 arg2Of 3C,(
R5133 T7659 T7658 arg1Of 3C,Figure
R5134 T7660 T7657 arg3Of ),(
R5135 T7664 T7663 arg1Of extracts,nuclear
R5136 T7546 T7544 arg2Of EMSA,in
R5137 T7546 T7545 arg1Of EMSA,our
R5138 T7664 T7665 arg1Of extracts,from
R5139 T7664 T7668 arg1Of extracts,were
R5140 T7664 T7669 arg2Of extracts,used
R5141 T7550 T7543 arg2Of probes,included
R5142 T7550 T7547 arg1Of probes,are
R5143 T7550 T7548 arg1Of probes,three
R5144 T7550 T7549 arg2Of probes,mutated
R5145 T7550 T7551 arg1Of probes,that
R5146 T7550 T7552 arg1Of probes,are
R5147 T7667 T7665 arg2Of cells,from
R5148 T7552 T7553 arg1Of are,","
R5149 T7552 T7554 arg1Of are,either
R5150 T7555 T7556 arg1Of truncated,(
R5151 T7555 T7560 arg1Of truncated,or
R5152 T7557 T7556 arg2Of M1,(
R5153 T7558 T7556 arg3Of ),(
R5154 T7560 T7552 arg2Of or,are
R5155 T7560 T7559 arg1Of or,","
R5156 T7560 T7567 arg1Of or,in
R5157 T7667 T7666 arg1Of cells,MEL
R5158 T7563 T7564 arg1Of M2,and
R5159 T7669 T7661 arg1Of used,Next
R5160 T7564 T7560 arg2Of and,or
R5161 T7564 T7561 arg1Of and,mutated
R5162 T7564 T7562 arg2Of and,(
R5163 T7565 T7564 arg2Of M3,and
R5164 T7566 T7562 arg3Of ),(
R5165 T7669 T7662 arg1Of used,","
R5094 T7523 T7522 arg1Of region,critical
R5095 T7523 T7524 arg1Of region,of
R5096 T7527 T7524 arg2Of promoter,of
R5097 T7527 T7525 arg1Of promoter,the
R5098 T7527 T7526 arg1Of promoter,ɛy
R5099 T7527 T7528 arg2Of promoter,defined
R5100 T7528 T7529 arg1Of defined,in
R5101 T7533 T7529 arg2Of analyses,in
R5102 T7533 T7530 arg1Of analyses,our
R5103 T7533 T7531 arg1Of analyses,promoter
R5104 T7533 T7532 arg1Of analyses,deletion
R5105 T7535 T7534 arg1Of probe,This
R5106 T7535 T7536 arg1Of probe,contains
R5107 T7541 T7536 arg2Of sites,contains
R5108 T7541 T7537 arg1Of sites,two
R5109 T7541 T7538 arg1Of sites,consensus
R5110 T7541 T7539 arg1Of sites,Sox/Sox6
R5111 T7541 T7540 arg1Of sites,binding
R5112 T7543 T7542 arg1Of included,Also
R5113 T7543 T7544 arg1Of included,in
R5114 T7543 T7547 arg2Of included,are
R5115 T7643 T7641 arg2Of probe,to
R5116 T7643 T7642 arg1Of probe,the
R5117 T7647 T7645 arg1Of Sox6,an
R5118 T7647 T7646 arg1Of Sox6,HA-tagged
R5119 T7647 T7648 arg1Of Sox6,was
R5120 T7647 T7649 arg2Of Sox6,used
R5121 T7649 T7630 modOf used,To
R5122 T7649 T7644 arg1Of used,","
R5123 T7649 T7648 arg2Of used,was
R5124 T7649 T7650 arg1Of used,in
R5125 T7652 T7650 arg2Of EMSA,in
R5126 T7652 T7651 arg1Of EMSA,another
R5127 T7652 T7653 arg1Of EMSA,that
R5278 T7744 T7745 arg1Of M1,and
R5279 T7745 T7743 arg2Of and,(
R5280 T7746 T7745 arg2Of M3,and
R5281 T7703 T7701 arg1Of sequence,this
R5282 T7747 T7743 arg3Of ),(
R5283 T7703 T7702 arg1Of sequence,DNA
R5284 T7703 T7704 arg1Of sequence,in
R5285 T7706 T7704 arg2Of cells,in
R5286 T7750 T7748 arg2Of ability,abolish
R5287 T7750 T7749 arg1Of ability,their
R5288 T7750 T7751 modOf ability,to
R5289 T7752 T7751 arg1Of compete,to
R5290 T7752 T7753 arg1Of compete,in
R5291 T7706 T7705 arg1Of cells,MEL
R5292 T7706 T7707 arg1Of cells,(
R5293 T7709 T7707 arg2Of 3D,(
R5294 T7754 T7753 arg2Of EMSA,in
R5295 T7754 T7755 arg1Of EMSA,(
R5296 T7709 T7708 arg1Of 3D,Figure
R5297 T7757 T7755 arg2Of 3E,(
R5298 T7757 T7756 arg1Of 3E,Figure
R5299 T7758 T7755 arg3Of ),(
R5300 T7710 T7707 arg3Of ),(
R5301 T7762 T7759 arg1Of probe,The
R5302 T7762 T7760 arg1Of probe,M2
R5303 T7762 T7761 arg1Of probe,mutant
R5304 T7762 T7763 arg1Of probe,may
R5305 T7762 T7764 arg1Of probe,compete
R5306 T7764 T7763 arg2Of compete,may
R5307 T7764 T7765 arg1Of compete,partially
R5308 T7764 T7766 arg1Of compete,with
R5309 T7716 T7711 arg1Of sites,The
R5310 T7768 T7766 arg2Of binding,with
R5311 T7768 T7767 arg1Of binding,WT
R5312 T7770 T7769 arg1Of investigate,To
R5313 T7773 T7770 arg2Of significance,investigate
R5314 T7773 T7771 arg1Of significance,the
R5315 T7773 T7772 arg1Of significance,functional
R5316 T7773 T7774 arg1Of significance,of
R5317 T7716 T7712 arg1Of sites,intact
R5318 T7716 T7713 arg1Of sites,consensus
R5319 T7716 T7714 arg1Of sites,Sox/Sox6
R5320 T7716 T7715 arg1Of sites,binding
R5321 T7716 T7717 arg1Of sites,of
R5322 T7779 T7774 arg2Of sites,of
R5323 T7779 T7775 arg1Of sites,the
R5324 T7779 T7776 arg1Of sites,intact
R5325 T7779 T7777 arg1Of sites,Sox/Sox6
R5326 T7779 T7778 arg1Of sites,binding
R5327 T7716 T7721 arg1Of sites,are
R5328 T7716 T7722 arg2Of sites,required
R5329 T7720 T7717 arg2Of probe,of
R5330 T7785 T7781 arg1Of constructs,the
R5331 T7785 T7782 arg1Of constructs,ɛy
R5332 T7785 T7783 arg1Of constructs,promoter
R5333 T7785 T7784 arg1Of constructs,reporter
R5334 T7785 T7786 arg1Of constructs,with
R5335 T7785 T7791 arg1Of constructs,were
R5336 T7785 T7792 arg2Of constructs,co-transfected
R5337 T7790 T7786 arg2Of sites,with
R5338 T7790 T7787 arg2Of sites,mutagenized
R5339 T7790 T7788 arg1Of sites,Sox/Sox6
R5340 T7790 T7789 arg1Of sites,binding
R5341 T7720 T7718 arg1Of probe,the
R5342 T7792 T7769 modOf co-transfected,To
R5343 T7792 T7780 arg1Of co-transfected,","
R5344 T7792 T7791 arg2Of co-transfected,were
R5345 T7792 T7793 arg1Of co-transfected,with
R5346 T7720 T7719 arg1Of probe,DNA
R5347 T7722 T7721 arg2Of required,are
R5348 T7797 T7793 arg2Of vector,with
R5349 T7797 T7794 arg1Of vector,the
R5350 T7797 T7795 arg1Of vector,Sox6
R5351 T7797 T7796 arg1Of vector,overexpression
R5352 T7797 T7798 arg1Of vector,into
R5428 T7939 T7936 arg2Of and,(
R5429 T7852 T7851 arg1Of but,","
R5430 T7939 T7937 arg1Of and,Figures
R5431 T7854 T7852 arg2Of to,but
R5432 T7854 T7853 arg1Of to,not
R5433 T7940 T7939 arg2Of 4,and
R5434 T7857 T7854 arg2Of degree,to
R5435 T7857 T7855 arg1Of degree,the
R5436 T7857 T7856 arg1Of degree,same
R5166 T7669 T7668 arg2Of used,were
R5167 T7669 T7670 arg1Of used,in
R5168 T7570 T7567 arg2Of sites,in
R5169 T7570 T7568 arg1Of sites,Sox/Sox6
R5170 T7570 T7569 arg1Of sites,binding
R5171 T7570 T7571 arg1Of sites,(
R5172 T7671 T7670 arg2Of EMSA,in
R5173 T7573 T7571 arg2Of 3A,(
R5174 T7573 T7572 arg1Of 3A,Figure
R5175 T7574 T7571 arg3Of ),(
R5176 T7575 T7576 arg1Of Sox6,is
R5177 T7575 T7577 arg1Of Sox6,able
R5178 T7575 T7580 arg1Of Sox6,associate
R5179 T7671 T7672 arg1Of EMSA,employing
R5180 T7577 T7576 arg2Of able,is
R5181 T7676 T7672 arg2Of probe,employing
R5182 T7580 T7577 arg2Of associate,able
R5183 T7580 T7578 arg1Of associate,to
R5184 T7580 T7579 arg1Of associate,physically
R5185 T7580 T7581 arg1Of associate,with
R5186 T7584 T7581 arg2Of region,with
R5187 T7584 T7582 arg1Of region,the
R5188 T7584 T7583 arg1Of region,36-bp
R5189 T7584 T7585 arg1Of region,(
R5190 T7584 T7589 arg1Of region,within
R5191 T7676 T7673 arg1Of probe,the
R5192 T7587 T7585 arg2Of 3B,(
R5193 T7587 T7586 arg1Of 3B,Figure
R5194 T7676 T7674 arg1Of probe,same
R5195 T7588 T7585 arg3Of ),(
R5196 T7676 T7675 arg1Of probe,36-bp
R5197 T7678 T7677 arg1Of cells,MEL
R5198 T7592 T7589 arg2Of promoter,within
R5199 T7592 T7590 arg1Of promoter,the
R5200 T7592 T7591 arg1Of promoter,ɛy
R5201 T7592 T7593 arg2Of promoter,defined
R5202 T7598 T7593 arg1Of experiments,defined
R5203 T7598 T7594 arg2Of experiments,by
R5204 T7598 T7595 arg1Of experiments,the
R5205 T7598 T7596 arg1Of experiments,deletion
R5206 T7598 T7597 arg1Of experiments,analysis
R5207 T7598 T7599 arg1Of experiments,(
R5208 T7678 T7679 arg1Of cells,","
R5209 T7678 T7686 arg1Of cells,express
R5210 T7601 T7599 arg2Of 2C,(
R5211 T7601 T7600 arg1Of 2C,Figure
R5212 T7602 T7599 arg3Of ),(
R5213 T7678 T7693 arg1Of cells,ɛy
R5214 T7684 T7679 arg2Of line,","
R5215 T7605 T7603 arg1Of probe,The
R5216 T7605 T7604 arg1Of probe,36-bp
R5217 T7605 T7606 arg1Of probe,was
R5218 T7605 T7607 arg2Of probe,shifted
R5219 T7607 T7606 arg2Of shifted,was
R5220 T7684 T7680 arg1Of line,a
R5221 T7684 T7681 arg1Of line,murine
R5222 T7684 T7682 arg1Of line,erythroleukemic
R5223 T7684 T7683 arg1Of line,cell
R5224 T7686 T7691 arg1Of express,but
R5225 T7612 T7607 arg1Of protein,shifted
R5226 T7612 T7608 arg2Of protein,by
R5227 T7612 T7609 arg1Of protein,the
R5228 T7612 T7610 arg2Of protein,tagged
R5229 T7612 T7611 arg1Of protein,Sox6
R5230 T7616 T7617 arg1Of c-Myc,and
R5231 T7689 T7686 arg2Of globins,express
R5232 T7617 T7615 arg1Of and,both
R5233 T7618 T7617 arg2Of Sox6,and
R5234 T7619 T7616 arg1Of antibodies,c-Myc
R5235 T7619 T7618 arg1Of antibodies,Sox6
R5236 T7619 T7620 arg1Of antibodies,supershift
R5237 T7620 T7613 arg1Of supershift,Moreover
R5238 T7620 T7614 arg1Of supershift,","
R5239 T7620 T7623 arg1Of supershift,","
R5240 T7620 T7624 modOf supershift,indicating
R5241 T7622 T7620 arg2Of band,supershift
R5242 T7622 T7621 arg1Of band,the
R5243 T7689 T7687 arg1Of globins,adult
R5244 T7689 T7688 arg1Of globins,β
R5245 T7691 T7685 arg1Of but,","
R5246 T7627 T7626 arg1Of binding,the
R5247 T7627 T7628 arg1Of binding,is
R5248 T7627 T7629 arg1Of binding,Sox6-specific
R5249 T7628 T7624 arg2Of is,indicating
R5250 T7628 T7625 arg1Of is,that
R5251 T7629 T7628 arg2Of Sox6-specific,is
R5252 T7631 T7630 arg1Of rule,To
R5253 T7631 T7632 arg1Of rule,out
R5254 T7691 T7690 arg1Of but,","
R5255 T7634 T7631 arg2Of possibility,rule
R5256 T7634 T7633 arg1Of possibility,the
R5257 T7691 T7692 arg1Of but,not
R5258 T7693 T7691 arg2Of ɛy,but
R5259 T7638 T7636 arg1Of tag,the
R5260 T7638 T7637 arg1Of tag,c-Myc
R5261 T7639 T7638 arg1Of itself,tag
R5262 T7639 T7640 arg1Of itself,binds
R5263 T7640 T7634 arg2Of binds,possibility
R5264 T7640 T7635 arg1Of binds,that
R5265 T7640 T7641 arg1Of binds,to
R5266 T7693 T7694 arg1Of ɛy,[
R5267 T7695 T7694 arg2Of 33,[
R5268 T7696 T7694 arg3Of ],[
R5269 T7697 T7699 arg1Of Sox6,binds
R5270 T7699 T7698 arg1Of binds,directly
R5271 T7699 T7700 arg1Of binds,to
R5272 T7703 T7700 arg2Of sequence,to
R5273 T7742 T7738 arg2Of sites,of
R5274 T7742 T7739 arg1Of sites,putative
R5275 T7742 T7740 arg1Of sites,Sox/Sox6
R5276 T7742 T7741 arg1Of sites,binding
R5277 T7742 T7743 arg1Of sites,(
R5353 T7800 T7798 arg2Of cells,into
R5354 T7800 T7799 arg1Of cells,GM979
R5355 T7801 T7802 arg1Of Consistent,with
R5356 T7722 T7723 arg1Of required,for
R5357 T7722 T7726 arg1Of required,","
R5358 T7805 T7802 arg2Of results,with
R5359 T7805 T7803 arg1Of results,the
R5360 T7805 T7804 arg1Of results,EMSA
R5361 T7722 T7727 arg1Of required,as
R5362 T7725 T7723 arg2Of binding,for
R5363 T7725 T7724 arg1Of binding,the
R5364 T7812 T7807 arg1Of constructs,the
R5365 T7812 T7808 arg1Of constructs,mutant
R5366 T7812 T7809 arg1Of constructs,ɛy
R5367 T7812 T7810 arg1Of constructs,promoter
R5368 T7812 T7811 arg1Of constructs,reporter
R5369 T7812 T7813 arg1Of constructs,(
R5370 T7812 T7824 arg1Of constructs,do
R5371 T7812 T7826 arg1Of constructs,result
R5372 T7814 T7813 arg2Of with,(
R5373 T7728 T7727 arg2Of shown,as
R5374 T7728 T7729 arg1Of shown,in
R5375 T7732 T7729 arg2Of assay,in
R5376 T7821 T7814 arg2Of sites,with
R5377 T7821 T7815 arg1Of sites,either
R5378 T7821 T7816 arg1Of sites,one
R5379 T7821 T7817 arg1Of sites,or
R5380 T7821 T7818 arg1Of sites,both
R5381 T7821 T7819 arg1Of sites,Sox/Sox6
R5382 T7821 T7820 arg1Of sites,binding
R5383 T7821 T7822 arg2Of sites,mutagenized
R5384 T7823 T7813 arg3Of ),(
R5385 T7826 T7801 arg1Of result,Consistent
R5386 T7826 T7806 arg1Of result,","
R5387 T7826 T7824 arg2Of result,do
R5388 T7826 T7825 arg1Of result,not
R5389 T7826 T7827 arg1Of result,in
R5390 T7830 T7827 arg2Of repression,in
R5391 T7732 T7730 arg1Of assay,the
R5392 T7732 T7731 arg1Of assay,competition
R5393 T7732 T7733 arg1Of assay,(
R5394 T7735 T7733 arg2Of 3E,(
R5395 T7830 T7828 arg1Of repression,significant
R5396 T7830 T7829 arg1Of repression,promoter
R5397 T7830 T7831 arg1Of repression,in
R5398 T7833 T7831 arg2Of studies,in
R5437 T7941 T7936 arg3Of ),(
R5438 T7858 T7860 arg1Of We,tested
R5439 T7860 T7859 arg1Of tested,also
R5440 T7943 T7942 arg1Of indicate,clearly
R5441 T7862 T7863 arg1Of Sox6,binds
R5442 T7863 T7860 arg2Of binds,tested
R5443 T7863 T7861 arg1Of binds,whether
R5444 T7945 T7946 arg1Of Sox6,acts
R5445 T7946 T7943 arg2Of acts,indicate
R5446 T7863 T7864 arg1Of binds,to
R5447 T7863 T7869 arg1Of binds,vivo
R5448 T7946 T7944 arg1Of acts,that
R5449 T7946 T7947 arg1Of acts,as
R5450 T7867 T7864 arg2Of promoter,to
R5451 T7867 T7865 arg1Of promoter,the
R5452 T7867 T7866 arg1Of promoter,ɛy
R5453 T7869 T7868 arg1Of vivo,in
R5454 T7870 T7863 arg2Of using,binds
R5455 T7872 T7870 arg2Of immunoprecipitation,using
R5456 T7872 T7871 arg1Of immunoprecipitation,chromatin
R5457 T7872 T7873 arg1Of immunoprecipitation,(
R5458 T7872 T7876 arg1Of immunoprecipitation,(
R5459 T7874 T7873 arg2Of ChIP,(
R5460 T7946 T7954 arg1Of acts,by
R5461 T7875 T7873 arg3Of ),(
R5462 T7949 T7947 arg2Of repressor,as
R5463 T7877 T7876 arg2Of Figure,(
R5464 T7877 T7878 arg1Of Figure,4
R5465 T7879 T7876 arg3Of ),(
R5466 T7949 T7948 arg1Of repressor,a
R5467 T7882 T7880 arg1Of complex,The
R5468 T7882 T7881 arg1Of complex,Sox6-containing
R5469 T7882 T7883 arg1Of complex,was
R5470 T7882 T7884 arg2Of complex,immunoprecipitated
R5471 T7884 T7883 arg2Of immunoprecipitated,was
R5472 T7884 T7885 arg1Of immunoprecipitated,from
R5473 T7884 T7889 arg1Of immunoprecipitated,from
R5474 T7949 T7950 arg1Of repressor,of
R5475 T7885 T7888 arg1Of from,or
R5476 T7953 T7950 arg2Of gene,of
R5477 T7887 T7885 arg2Of cells,from
R5478 T7887 T7886 arg1Of cells,MEL
R5479 T7889 T7888 arg2Of from,or
R5480 T7891 T7889 arg2Of cells,from
R5481 T7891 T7890 arg1Of cells,liver
R5482 T7891 T7892 arg1Of cells,of
R5483 T7953 T7951 arg1Of gene,the
R5484 T7953 T7952 arg1Of gene,ɛy
R5485 T7956 T7954 arg2Of binding,by
R5486 T7896 T7892 arg2Of mice,of
R5487 T7896 T7893 arg1Of mice,15.5
R5488 T7896 T7894 arg1Of mice,dpc
R5489 T7896 T7895 arg1Of mice,WT
R5490 T7896 T7897 arg1Of mice,using
R5491 T7956 T7955 arg1Of binding,directly
R5492 T7956 T7957 arg1Of binding,to
R5493 T7899 T7897 arg2Of antibody,using
R5494 T7899 T7898 arg1Of antibody,Sox6
R5495 T7956 T7961 arg1Of binding,","
R5496 T7956 T7963 arg1Of binding,as
R5497 T7960 T7957 arg2Of promoter,to
R5498 T7902 T7900 arg1Of shows,Figure
R5499 T7902 T7901 arg1Of shows,4
R5500 T7902 T7903 arg1Of shows,that
R5501 T7902 T7914 arg1Of shows,in
R5502 T7960 T7958 arg1Of promoter,the
R6356 T9211 T9208 arg2Of hybridization,by
R6357 T9211 T9210 arg1Of hybridization,situ
R6358 T9211 T9212 arg1Of hybridization,(
R6359 T9213 T9212 arg2Of Figure,(
R6360 T9213 T9214 arg1Of Figure,5
R6361 T9215 T9212 arg3Of ),(
R6362 T9217 T9216 arg2Of expected,As
R6363 T9220 T9219 arg1Of globin,ɛy
R6364 T9220 T9221 arg1Of globin,is
R6365 T9220 T9223 arg2Of globin,expressed
R6366 T9223 T9216 arg1Of expressed,As
R6367 T9223 T9218 arg1Of expressed,","
R6368 T9223 T9221 arg2Of expressed,is
R6369 T9223 T9222 arg1Of expressed,not
R6370 T9223 T9224 arg1Of expressed,in
R6371 T9228 T9224 arg2Of liver,in
R6372 T9228 T9225 arg1Of liver,the
R6373 T9228 T9226 arg1Of liver,WT
R6374 T9228 T9227 arg1Of liver,14.5-dpc
R6375 T9228 T9229 arg1Of liver,","
R6376 T9231 T9229 arg2Of site,","
R6377 T9231 T9230 arg1Of site,the
R6378 T9231 T9232 arg1Of site,of
R6379 T9231 T9235 arg1Of site,in
R6380 T9234 T9232 arg2Of erythropoiesis,of
R6381 T9234 T9233 arg1Of erythropoiesis,definitive
R6382 T9237 T9235 arg2Of fetus,in
R6383 T9237 T9236 arg1Of fetus,the
R6384 T9239 T9238 arg2Of contrast,In
R6385 T9245 T9241 arg1Of expression,abundant
R6386 T9245 T9242 arg1Of expression,ectopic
R6387 T9245 T9243 arg1Of expression,ɛy
R6388 T9245 T9244 arg1Of expression,mRNA
R6389 T9245 T9246 arg1Of expression,is
R6390 T9245 T9247 arg2Of expression,seen
R6391 T9247 T9238 arg1Of seen,In
R6392 T9247 T9240 arg1Of seen,","
R6393 T9247 T9246 arg2Of seen,is
R6394 T9247 T9248 arg1Of seen,in
R6395 T9250 T9248 arg2Of liver,in
R6396 T9250 T9249 arg1Of liver,the
R6397 T9250 T9251 arg1Of liver,of
R6398 T9253 T9251 arg2Of mutants,of
R6399 T9253 T9252 arg1Of mutants,14.5-dpc
R6400 T9253 T9254 arg1Of mutants,(
R6401 T9257 T9254 arg2Of A–D,(
R6402 T9257 T9255 arg1Of A–D,Figure
R6403 T9257 T9256 arg1Of A–D,5
R6404 T9258 T9254 arg3Of ),(
R6405 T9262 T9261 arg1Of expression,the
R6406 T9262 T9263 arg1Of expression,of
R6407 T9262 T9266 arg1Of expression,is
R6408 T9262 T9268 arg1Of expression,abundant
R6409 T9265 T9263 arg2Of globin,of
R5399 T7833 T7832 arg1Of studies,transfection
R5400 T7833 T7834 arg1Of studies,(
R5401 T7836 T7834 arg2Of 3F,(
R5402 T7836 T7835 arg1Of 3F,Figure
R5403 T7735 T7734 arg1Of 3E,Figure
R5404 T7736 T7733 arg3Of ),(
R5405 T7737 T7738 arg1Of Ablation,of
R5406 T7737 T7748 arg1Of Ablation,abolish
R5407 T7935 T7933 arg1Of data,The
R5408 T7837 T7834 arg3Of ),(
R5409 T7935 T7934 arg1Of data,above
R5410 T7841 T7840 arg1Of sites,both
R5411 T7841 T7842 arg1Of sites,are
R5412 T7841 T7843 arg2Of sites,required
R5413 T7935 T7936 arg1Of data,(
R5414 T7935 T7943 arg1Of data,indicate
R5415 T7843 T7838 arg1Of required,Thus
R5416 T7843 T7839 arg1Of required,","
R5417 T7843 T7842 arg2Of required,are
R5418 T7843 T7844 arg1Of required,for
R5419 T7843 T7854 arg1Of required,to
R5420 T7844 T7852 arg1Of for,but
R5421 T7938 T7939 arg1Of 3,and
R5422 T7846 T7844 arg2Of repression,for
R5423 T7846 T7845 arg1Of repression,maximal
R5424 T7846 T7847 arg1Of repression,of
R5425 T7846 T7849 arg1Of repression,by
R5426 T7848 T7847 arg2Of ɛy,of
R5427 T7850 T7849 arg2Of Sox6,by
R5503 T7907 T7904 arg1Of promoter,the
R5504 T7907 T7905 arg1Of promoter,ɛy
R5505 T7907 T7906 arg1Of promoter,proximal
R5506 T7907 T7908 arg1Of promoter,is
R5507 T7907 T7910 arg2Of promoter,immunoprecipitated
R5508 T7960 T7959 arg1Of promoter,ɛy
R5509 T7963 T7962 arg1Of as,probably
R5510 T7910 T7903 arg2Of immunoprecipitated,that
R5511 T7910 T7908 arg2Of immunoprecipitated,is
R5512 T7910 T7909 arg1Of immunoprecipitated,readily
R5513 T7910 T7911 arg1Of immunoprecipitated,with
R5514 T7913 T7911 arg2Of antibody,with
R5515 T7913 T7912 arg1Of antibody,Sox6
R5516 T7965 T7963 arg2Of dimer,as
R5517 T7917 T7916 arg1Of cells,MEL
R5518 T7917 T7918 arg1Of cells,and
R5519 T7918 T7914 arg2Of and,in
R5520 T7918 T7915 arg1Of and,both
R5521 T7920 T7918 arg2Of cells,and
R5522 T7920 T7919 arg1Of cells,liver
R5523 T7965 T7964 arg1Of dimer,a
R5524 T7922 T7921 arg1Of IgG,Normal
R5525 T7922 T7923 arg1Of IgG,was
R5526 T7922 T7924 arg2Of IgG,used
R5528 T7924 T7923 arg2Of used,was
R5529 T7924 T7925 arg1Of used,as
R5530 T7928 T7925 arg2Of control,as
R5531 T7928 T7926 arg1Of control,a
R5532 T7928 T7927 arg1Of control,negative
R5533 T7928 T7929 arg1Of control,(
R5534 T7931 T7929 arg2Of 4A,(
R5535 T7931 T7930 arg1Of 4A,Figure
R5536 T7932 T7929 arg3Of ),(
R6272 T9131 T9129 arg1Of Expression,The
R6273 T9131 T9130 arg1Of Expression,Persistent
R6274 T9131 T9132 arg1Of Expression,of
R6275 T9131 T9135 arg1Of Expression,in
R6276 T9131 T9138 arg1Of Expression,Is
R6277 T9131 T9140 arg1Of Expression,to
R6278 T9134 T9132 arg2Of Globin,of
R6279 T9134 T9133 arg1Of Globin,ɛy
R6280 T9137 T9135 arg2Of Mice,in
R6281 T9137 T9136 arg1Of Mice,Sox6-Deficient
R6282 T9140 T9138 arg2Of to,Is
R6283 T9140 T9139 arg1Of to,Due
R6284 T9142 T9140 arg2Of Defect,to
R6285 T9142 T9141 arg1Of Defect,a
R6286 T9142 T9143 arg1Of Defect,in
R6287 T9146 T9143 arg2Of Mechanism,in
R6288 T9146 T9144 arg1Of Mechanism,the
R6289 T9146 T9145 arg1Of Mechanism,ɛy-Gene–Silencing
R6290 T9146 T9147 arg1Of Mechanism,in
R6291 T9150 T9147 arg2Of Cells,in
R6292 T9150 T9148 arg1Of Cells,Definitive
R6293 T9150 T9149 arg1Of Cells,Erythroid
R6294 T9156 T9153 arg1Of gene,the
R6295 T9156 T9154 arg1Of gene,ɛy
R6296 T9156 T9155 arg1Of gene,globin
R6297 T9156 T9157 arg1Of gene,is
R6298 T9156 T9159 arg2Of gene,expressed
R6299 T9156 T9164 arg1Of gene,silenced
R6300 T9159 T9160 arg1Of expressed,in
R6301 T9159 T9163 arg1Of expressed,and
R6302 T9162 T9160 arg2Of erythrocytes,in
R6303 T9162 T9161 arg1Of erythrocytes,primitive
R6304 T9163 T9151 arg1Of and,Normally
R6305 T9163 T9152 arg1Of and,","
R6306 T9163 T9157 arg2Of and,is
R6307 T9163 T9158 arg1Of and,exclusively
R6308 T9163 T9165 arg1Of and,in
R6309 T9164 T9163 arg2Of silenced,and
R6310 T9167 T9165 arg2Of erythrocytes,in
R6311 T9167 T9166 arg1Of erythrocytes,definitive
R6312 T9169 T9168 arg1Of determine,To
R6313 T9173 T9171 arg1Of expression,the
R6314 T9173 T9172 arg1Of expression,persistent
R6315 T9173 T9174 arg1Of expression,of
R6316 T9173 T9177 arg1Of expression,is
R6317 T9173 T9178 arg1Of expression,due
R6318 T9173 T9184 arg1Of expression,is
R6319 T9173 T9185 arg1Of expression,due
R6320 T9176 T9174 arg2Of globin,of
R6321 T9176 T9175 arg1Of globin,ɛy
R6322 T9177 T9183 arg1Of is,or
R6323 T9178 T9177 arg2Of due,is
R6324 T9178 T9179 arg1Of due,to
R6325 T9182 T9179 arg2Of erythrocytes,to
R6326 T9182 T9180 arg1Of erythrocytes,residual
R6327 T9182 T9181 arg1Of erythrocytes,primitive
R6328 T9183 T9169 arg2Of or,determine
R6329 T9183 T9170 arg1Of or,whether
R6330 T9184 T9183 arg2Of is,or
R6331 T9185 T9184 arg2Of due,is
R6332 T9185 T9186 arg1Of due,to
R6333 T9188 T9186 arg2Of expression,to
R6334 T9188 T9187 arg1Of expression,ectopic
R6335 T9188 T9189 arg1Of expression,of
R6336 T9188 T9192 arg1Of expression,in
R6337 T9191 T9189 arg2Of globin,of
R6338 T9191 T9190 arg1Of globin,ɛy
R6339 T9194 T9192 arg2Of erythrocytes,in
R6340 T9194 T9193 arg1Of erythrocytes,definitive
R6341 T9196 T9197 arg1Of we,examined
R6342 T9197 T9168 modOf examined,To
R6343 T9197 T9195 arg1Of examined,","
R6344 T9197 T9205 arg1Of examined,in
R6345 T9197 T9208 arg1Of examined,by
R6346 T9200 T9197 arg2Of pattern,examined
R6347 T9200 T9198 arg1Of pattern,the
R6348 T9200 T9199 arg1Of pattern,spatial
R6349 T9200 T9201 arg1Of pattern,of
R6350 T9204 T9201 arg2Of transcripts,of
R6351 T9204 T9202 arg1Of transcripts,ɛy
R6352 T9204 T9203 arg1Of transcripts,globin
R6353 T9207 T9205 arg2Of embryos,in
R6354 T9207 T9206 arg1Of embryos,mouse
R6355 T9210 T9209 arg1Of situ,in
R6431 T9284 T9285 arg1Of data,demonstrate
R6432 T9285 T9309 arg1Of demonstrate,","
R6433 T9285 T9310 modOf demonstrate,suggesting
R6434 T9290 T9287 arg1Of levels,the
R6435 T9290 T9288 arg1Of levels,persistent
R6436 T9290 T9289 arg1Of levels,high
R6437 T9290 T9291 arg1Of levels,of
R6438 T9290 T9293 arg1Of levels,are
R6439 T9290 T9294 arg1Of levels,due
R6440 T9292 T9291 arg2Of ɛy,of
R6441 T9293 T9285 arg2Of are,demonstrate
R6442 T9293 T9286 arg1Of are,that
R6410 T9265 T9264 arg1Of globin,βmaj/min
R6411 T9266 T9259 arg1Of is,However
R6412 T9266 T9260 arg1Of is,","
R6413 T9268 T9266 arg2Of abundant,is
R6414 T9268 T9267 arg1Of abundant,equally
R6415 T9268 T9269 arg1Of abundant,in
R6416 T9271 T9272 arg1Of WT,and
R6417 T9273 T9272 arg2Of p100H,and
R6418 T9275 T9269 arg2Of mice,in
R6419 T9275 T9270 arg1Of mice,both
R6420 T9275 T9271 arg1Of mice,WT
R6421 T9275 T9273 arg1Of mice,p100H
R6422 T9275 T9274 arg1Of mice,mutant
R6423 T9275 T9276 arg1Of mice,(
R6424 T9279 T9280 arg1Of E,and
R6425 T9280 T9276 arg2Of and,(
R6426 T9280 T9277 arg1Of and,Figure
R6427 T9280 T9278 arg1Of and,5
R6428 T9281 T9280 arg2Of F,and
R6429 T9282 T9276 arg3Of ),(
R6430 T9284 T9283 arg1Of data,These
R6822 T9908 T9903 arg1Of pattern,the
R6823 T9908 T9904 arg1Of pattern,temporal
R6824 T9908 T9906 arg1Of pattern,spatial
R6825 T9908 T9907 arg1Of pattern,expression
R6826 T9908 T9909 arg1Of pattern,of
R6827 T9910 T9909 arg2Of Sox6,of
R6828 T9913 T9912 arg1Of blot,Northern
R6829 T9913 T9914 arg1Of blot,and
R6830 T9914 T9919 arg1Of and,were
R6831 T9914 T9920 arg2Of and,employed
R6832 T9916 T9915 arg1Of situ,in
R6833 T9918 T9914 arg2Of assays,and
R6834 T9918 T9916 arg1Of assays,situ
R6835 T9918 T9917 arg1Of assays,hybridization
R6836 T9920 T9901 modOf employed,To
R6837 T9920 T9911 arg1Of employed,","
R6838 T9920 T9919 arg2Of employed,were
R6839 T9922 T9921 arg2Of shown,As
R6840 T9922 T9923 arg1Of shown,in
R6841 T9925 T9923 arg2Of 6A,in
R6842 T9925 T9924 arg1Of 6A,Figure
R6843 T9927 T9928 arg1Of Sox6,is
R6844 T9927 T9929 arg1Of Sox6,detectable
R6845 T9928 T9921 arg1Of is,As
R6846 T9928 T9926 arg1Of is,","
R6847 T9928 T9937 arg1Of is,","
R6848 T9928 T9938 arg1Of is,coincident
R6849 T9929 T9928 arg2Of detectable,is
R6850 T9929 T9930 arg1Of detectable,by
R6851 T9932 T9930 arg2Of blot,by
R6852 T9932 T9931 arg1Of blot,Northern
R6853 T9932 T9933 arg1Of blot,beginning
R6854 T9933 T9934 arg1Of beginning,at
R6855 T9936 T9934 arg2Of dpc,at
R6856 T9936 T9935 arg1Of dpc,10.5
R6857 T9938 T9939 arg1Of coincident,with
R6858 T9942 T9939 arg2Of onset,with
R6859 T9942 T9940 arg1Of onset,the
R6860 T9942 T9941 arg1Of onset,temporal
R6861 T9942 T9943 arg1Of onset,of
R6862 T9942 T9946 arg1Of onset,in
R6863 T9945 T9943 arg2Of erythropoiesis,of
R6864 T9945 T9944 arg1Of erythropoiesis,definitive
R6865 T9948 T9946 arg2Of liver,in
R6866 T9948 T9947 arg1Of liver,the
R6867 T9952 T9951 arg1Of situ,in
R6868 T9953 T9952 arg1Of hybridization,situ
R6869 T9953 T9954 arg1Of hybridization,shows
R6870 T9954 T9949 arg1Of shows,Furthermore
R6871 T9954 T9950 arg1Of shows,","
R6872 T9956 T9957 arg1Of Sox6,is
R6873 T9956 T9959 arg2Of Sox6,transcribed
R6874 T9959 T9954 arg2Of transcribed,shows
R6875 T9959 T9955 arg1Of transcribed,that
R6876 T9959 T9957 arg2Of transcribed,is
R6877 T9959 T9958 arg1Of transcribed,highly
R6878 T9959 T9960 arg1Of transcribed,in
R6879 T9959 T9966 arg1Of transcribed,in
R6880 T9960 T9964 arg1Of in,but
R6881 T9962 T9960 arg2Of liver,in
R6882 T9962 T9961 arg1Of liver,12.5-dpc
R6883 T9964 T9963 arg1Of but,","
R6884 T9966 T9964 arg2Of in,but
R6885 T9966 T9965 arg1Of in,not
R6886 T9970 T9966 arg2Of islands,in
R6887 T9970 T9967 arg1Of islands,yolk
R6888 T9970 T9968 arg1Of islands,sac
R6889 T9970 T9969 arg1Of islands,blood
R6890 T9970 T9971 arg1Of islands,at
R6891 T9973 T9971 arg2Of dpc,at
R6892 T9973 T9972 arg1Of dpc,7.5
R6893 T9973 T9974 arg1Of dpc,(
R6894 T9976 T9974 arg2Of 6B,(
R6895 T9976 T9975 arg1Of 6B,Figure
R6896 T9977 T9974 arg3Of ),(
R7203 T10411 T10412 arg1Of dpc,and
R7204 T10412 T10409 arg2Of and,at
R7205 T10414 T10412 arg2Of dpc,and
R7206 T10414 T10413 arg1Of dpc,18.5
R7207 T10414 T10415 arg1Of dpc,(
R7208 T10417 T10415 arg2Of 7A,(
R7209 T10417 T10416 arg1Of 7A,Figure
R7210 T10418 T10415 arg3Of ),(
R7211 T10423 T10421 arg2Of day,at
R7212 T10423 T10422 arg1Of day,postnatal
R7213 T10423 T10424 arg1Of day,10.5
R7214 T10426 T10427 arg1Of we,do
R7215 T10426 T10429 arg1Of we,see
R7216 T10429 T10419 arg1Of see,However
R7217 T10429 T10420 arg1Of see,","
R7218 T10429 T10421 arg1Of see,at
R7219 T10429 T10425 arg1Of see,","
R7220 T10429 T10427 arg2Of see,do
R7221 T10429 T10428 arg1Of see,not
R7222 T10429 T10440 arg1Of see,","
R7223 T10429 T10441 modOf see,suggesting
R7224 T10430 T10429 arg2Of circulating,see
R7225 T10432 T10431 arg1Of red,nucleated
R7226 T10433 T10430 arg2Of cells,circulating
R7227 T10433 T10432 arg1Of cells,red
R7228 T10433 T10434 arg1Of cells,in
R6443 T9294 T9293 arg2Of due,are
R6444 T9294 T9295 arg1Of due,to
R6445 T9297 T9295 arg2Of expression,to
R6446 T9297 T9296 arg1Of expression,ectopic
R6447 T9297 T9298 arg1Of expression,in
R6448 T9302 T9298 arg2Of cells,in
R6449 T9302 T9299 arg1Of cells,the
R6450 T9302 T9300 arg1Of cells,definitive
R6451 T9302 T9301 arg1Of cells,erythroid
R6452 T9302 T9303 arg1Of cells,that
R6453 T9302 T9304 arg1Of cells,mature
R6454 T9304 T9305 arg1Of mature,in
R6455 T9308 T9305 arg2Of liver,in
R6456 T9308 T9306 arg1Of liver,the
R6457 T9308 T9307 arg1Of liver,fetal
R6458 T9312 T9313 arg1Of there,is
R6459 T9313 T9310 arg2Of is,suggesting
R6460 T9313 T9311 arg1Of is,that
R6461 T9316 T9313 arg2Of defect,is
R6462 T9316 T9314 arg1Of defect,an
R6463 T9316 T9315 arg1Of defect,intrinsic
R6464 T9316 T9317 arg1Of defect,of
R6465 T9316 T9322 arg1Of defect,in
R6466 T9321 T9317 arg2Of mechanism,of
R6467 T9321 T9318 arg1Of mechanism,the
R6468 T9321 T9319 arg1Of mechanism,ɛy
R6469 T9321 T9320 arg1Of mechanism,silencing
R6470 T9324 T9322 arg2Of mice,in
R6471 T9324 T9323 arg1Of mice,Sox6-null
R6781 T9864 T9862 arg1Of Pattern,The
R6782 T9864 T9863 arg1Of Pattern,Expression
R6783 T9864 T9865 arg1Of Pattern,of
R6784 T9864 T9867 arg1Of Pattern,Suggests
R6785 T9866 T9865 arg2Of Sox6,of
R6786 T9867 T9870 arg1Of Suggests,in
R6787 T9869 T9867 arg2Of Role,Suggests
R6788 T9869 T9868 arg1Of Role,a
R6789 T9872 T9870 arg2Of Erythropoiesis,in
R6790 T9872 T9871 arg1Of Erythropoiesis,Definitive
R6791 T9874 T9873 arg1Of observation,The
R6792 T9874 T9891 arg1Of observation,suggests
R6793 T9877 T9876 arg1Of mice,Sox6-deficient
R6794 T9877 T9879 arg1Of mice,express
R6795 T9879 T9874 arg2Of express,observation
R6796 T9879 T9875 arg1Of express,that
R6797 T9879 T9878 arg1Of express,ectopically
R6798 T9879 T9882 arg1Of express,in
R6799 T9881 T9879 arg2Of globin,express
R6800 T9881 T9880 arg1Of globin,ɛy
R6801 T9883 T9882 arg2Of liver,in
R6802 T9883 T9884 arg1Of liver,","
R6803 T9883 T9885 arg1Of liver,where
R6804 T9888 T9886 arg1Of cells,definitive
R6805 T9888 T9887 arg1Of cells,erythroid
R6806 T9888 T9889 arg1Of cells,mature
R6807 T9889 T9885 arg2Of mature,where
R6808 T9891 T9890 arg1Of suggests,","
R6809 T9893 T9894 arg1Of Sox6,is
R6810 T9894 T9891 arg2Of is,suggests
R6811 T9894 T9892 arg1Of is,that
R6812 T9897 T9894 arg2Of regulator,is
R6813 T9897 T9895 arg1Of regulator,an
R6814 T9897 T9896 arg1Of regulator,important
R6815 T9897 T9898 arg1Of regulator,in
R6816 T9900 T9898 arg2Of erythropoiesis,in
R6817 T9900 T9899 arg1Of erythropoiesis,definitive
R6818 T9902 T9901 arg1Of determine,To
R6819 T9904 T9905 arg1Of temporal,and
R6820 T9906 T9905 arg2Of spatial,and
R6821 T9908 T9902 arg2Of pattern,determine
R6897 T9981 T9980 arg1Of expression,Sox6
R6898 T9981 T9982 arg1Of expression,is
R6899 T9981 T9986 arg1Of expression,coincident
R6900 T9982 T9978 arg1Of is,Therefore
R6901 T9982 T9979 arg1Of is,","
R6902 T9983 T9984 arg1Of temporally,and
R6903 T9985 T9984 arg2Of spatially,and
R6904 T9986 T9982 arg2Of coincident,is
R6905 T9986 T9983 arg1Of coincident,temporally
R6906 T9986 T9985 arg1Of coincident,spatially
R6907 T9986 T9987 arg1Of coincident,with
R6908 T9988 T9990 arg1Of definitive,but
R6909 T9990 T9989 arg1Of but,","
R6910 T9992 T9990 arg2Of primitive,but
R6911 T9992 T9991 arg1Of primitive,not
R6912 T9994 T9987 arg2Of erythropoiesis,with
R6913 T9994 T9988 arg1Of erythropoiesis,definitive
R6914 T9994 T9992 arg1Of erythropoiesis,primitive
R6915 T9994 T9993 arg1Of erythropoiesis,","
R6916 T9996 T9995 arg1Of data,These
R6917 T9996 T9998 arg2Of data,taken
R6918 T9996 T10023 arg1Of data,demonstrate
R6919 T9998 T9997 arg1Of taken,","
R6920 T9998 T9999 arg1Of taken,together
R6921 T9998 T10000 arg1Of taken,with
R6922 T10002 T10000 arg2Of observation,with
R6923 T10002 T10001 arg1Of observation,the
R6924 T10005 T10004 arg1Of globin,ɛy
R6925 T10005 T10006 arg1Of globin,is
R6926 T10005 T10008 arg2Of globin,expressed
R6927 T10008 T10002 arg2Of expressed,observation
R6928 T10008 T10003 arg1Of expressed,that
R6929 T10008 T10006 arg2Of expressed,is
R6930 T10008 T10007 arg1Of expressed,highly
R6931 T10008 T10009 arg1Of expressed,in
R6932 T10012 T10009 arg2Of cells,in
R6933 T10012 T10010 arg1Of cells,the
R6934 T10012 T10011 arg1Of cells,liver
R6935 T10012 T10013 arg1Of cells,of
R6936 T10017 T10013 arg2Of mice,of
R6937 T10017 T10014 arg1Of mice,14.5-dpc
R6938 T10017 T10015 arg1Of mice,p100H
R6939 T10017 T10016 arg1Of mice,mutant
R6940 T10017 T10018 arg1Of mice,(
R6941 T10019 T10018 arg2Of Figure,(
R6942 T10019 T10020 arg1Of Figure,5
R6943 T10021 T10018 arg3Of ),(
R6944 T10023 T10022 arg1Of demonstrate,","
R6945 T10023 T10027 arg1Of demonstrate,in
R6946 T10026 T10023 arg2Of functions,demonstrate
R6947 T10026 T10024 arg1Of functions,that
R6948 T10026 T10025 arg1Of functions,Sox6
R6949 T10029 T10027 arg2Of erythropoiesis,in
R6950 T10029 T10028 arg1Of erythropoiesis,definitive
R7164 T10376 T10371 arg1Of Numbers,Mutant
R7165 T10376 T10372 arg1Of Numbers,p100H
R7166 T10376 T10373 arg1Of Numbers,Mice
R7167 T10376 T10374 arg1Of Numbers,Have
R7168 T10376 T10375 arg1Of Numbers,Higher
R7169 T10376 T10377 arg1Of Numbers,of
R7170 T10380 T10377 arg2Of Cells,of
R7171 T10380 T10378 arg1Of Cells,Nucleated
R7172 T10380 T10379 arg1Of Cells,Red
R7173 T10385 T10381 arg2Of effects,Among
R7174 T10385 T10382 arg1Of effects,the
R7175 T10385 T10383 arg1Of effects,other
R7176 T10385 T10384 arg1Of effects,Sox6
R7177 T10385 T10386 arg1Of effects,in
R7178 T10387 T10386 arg2Of erythropoiesis,in
R7179 T10389 T10390 arg1Of we,have
R7180 T10389 T10391 arg1Of we,noticed
R7181 T10391 T10381 arg1Of noticed,Among
R7182 T10391 T10388 arg1Of noticed,","
R7183 T10391 T10390 arg2Of noticed,have
R7184 T10393 T10394 arg1Of there,are
R7185 T10394 T10391 arg2Of are,noticed
R7186 T10394 T10392 arg1Of are,that
R7187 T10394 T10405 arg1Of are,than
R7188 T10394 T10409 arg1Of are,at
R7189 T10396 T10395 arg1Of nucleated,more
R7190 T10399 T10394 arg2Of cells,are
R7191 T10399 T10396 arg1Of cells,nucleated
R7192 T10399 T10397 arg1Of cells,red
R7193 T10399 T10398 arg1Of cells,blood
R7194 T10399 T10400 arg1Of cells,circulating
R7195 T10400 T10401 arg1Of circulating,in
R7196 T10404 T10401 arg2Of mice,in
R7197 T10404 T10402 arg1Of mice,p100H
R7229 T10436 T10437 arg1Of WT,or
R7230 T10437 T10434 arg2Of or,in
R7231 T10437 T10435 arg1Of or,either
R7232 T10439 T10437 arg2Of mice,or
R7233 T10439 T10438 arg1Of mice,mutant
R7234 T10443 T10444 arg1Of this,may
R7235 T10443 T10445 arg1Of this,be
R7236 T10445 T10441 arg2Of be,suggesting
R7237 T10445 T10442 arg1Of be,that
R7238 T10445 T10444 arg2Of be,may
R7239 T10448 T10445 arg2Of effect,be
R7240 T10448 T10446 arg1Of effect,a
R7241 T10448 T10447 arg1Of effect,transient
R7242 T10450 T10449 arg2Of addition,In
R7243 T10454 T10452 arg1Of liver,the
R7244 T10454 T10453 arg1Of liver,mutant
R7245 T10454 T10455 arg1Of liver,shows
R7246 T10455 T10449 arg1Of shows,In
R7247 T10455 T10451 arg1Of shows,","
R7248 T10458 T10455 arg2Of increase,shows
R7249 T10458 T10456 arg1Of increase,a
R7250 T10458 T10457 arg1Of increase,significant
R7251 T10458 T10459 arg1Of increase,in
R7252 T10462 T10459 arg2Of cells,in
R7253 T10462 T10460 arg1Of cells,hematopoietic
R7254 T10462 T10461 arg1Of cells,precursor
R7255 T10462 T10463 arg1Of cells,including
R7256 T10465 T10463 arg2Of erythrocytes,including
R7257 T10465 T10464 arg1Of erythrocytes,nucleated
R7258 T10465 T10466 arg1Of erythrocytes,at
R7259 T10468 T10466 arg2Of dpc,at
R7260 T10468 T10467 arg1Of dpc,18.5
R7261 T10468 T10469 arg1Of dpc,(
R7262 T10471 T10469 arg2Of 7B,(
R7263 T10471 T10470 arg1Of 7B,Figure
R7264 T10472 T10469 arg3Of ),(
R7265 T10474 T10473 arg1Of alteration,This
R7266 T10474 T10475 arg1Of alteration,is
R7267 T10474 T10476 arg2Of alteration,noted
R7268 T10476 T10475 arg2Of noted,is
R7269 T10476 T10478 arg1Of noted,early
R7270 T10478 T10477 arg1Of early,as
R7271 T10478 T10479 arg1Of early,as
R7272 T10481 T10479 arg2Of dpc,as
R7273 T10481 T10480 arg1Of dpc,14.5
R7274 T10483 T10482 arg1Of observations,These
R7275 T10483 T10484 arg1Of observations,suggest
R7276 T10487 T10486 arg2Of silencing,besides
R7277 T10491 T10487 arg2Of gene,silencing
R7816 T11943 T11944 arg1Of efficiency,of
R7817 T11943 T11949 arg1Of efficiency,to
R7818 T11943 T11951 arg1Of efficiency,that
R7819 T11943 T11952 arg1Of efficiency,contains
R7820 T11948 T11944 arg2Of proteins,of
R7821 T11948 T11945 arg1Of proteins,the
R7822 T11948 T11946 arg1Of proteins,two
R7823 T11948 T11947 arg1Of proteins,Sox
R7824 T11950 T11949 arg2Of DNA,to
R7825 T11955 T11952 arg2Of sites,contains
R7826 T11955 T11953 arg1Of sites,adjacent
R7827 T11955 T11954 arg1Of sites,Sox
R7828 T11955 T11956 arg1Of sites,[
R7829 T11957 T11956 arg2Of 6,[
R7830 T11958 T11956 arg3Of ],[
R7831 T11960 T11959 arg2Of addition,In
R7832 T11962 T11963 arg1Of Sox6,binds
R7833 T11963 T11959 arg1Of binds,In
R7834 T11963 T11961 arg1Of binds,","
R7835 T11963 T11965 arg1Of binds,strongly
R7836 T11963 T11977 arg1Of binds,[
R7837 T11965 T11964 arg1Of strongly,more
R7838 T11965 T11966 arg1Of strongly,to
R7839 T11970 T11966 arg2Of motif,to
R7840 T11970 T11967 arg1Of motif,an
R7841 T11970 T11968 arg1Of motif,HMG-box
R7842 T11970 T11969 arg1Of motif,dimer
R7843 T11970 T11971 arg1Of motif,than
R7844 T11972 T11971 arg2Of to,than
R7845 T11976 T11972 arg2Of motif,to
R7846 T11976 T11973 arg1Of motif,a
R7847 T11976 T11974 arg1Of motif,single
R7848 T11976 T11975 arg1Of motif,HMG-box
R7849 T11978 T11977 arg2Of 5,[
R7850 T11979 T11977 arg3Of ],[
R7851 T11982 T11983 arg1Of it,appears
R7852 T11983 T11980 arg1Of appears,Therefore
R7853 T11983 T11981 arg1Of appears,","
R7854 T11986 T11985 arg1Of genes,target
R7855 T11986 T11987 arg1Of genes,for
R7856 T11986 T11998 arg1Of genes,harbor
R7857 T11991 T11987 arg2Of proteins,for
R7858 T11991 T11988 arg1Of proteins,group
R7859 T11991 T11989 arg1Of proteins,D
R7860 T11991 T11990 arg1Of proteins,Sox
R7861 T11991 T11992 arg1Of proteins,","
R7862 T11991 T11994 arg1Of proteins,as
R7863 T11994 T11993 arg1Of as,such
R7864 T11995 T11994 arg2Of Sox6,as
R7865 T11998 T11983 arg2Of harbor,appears
R7866 T11998 T11984 arg1Of harbor,that
R7867 T11998 T11996 arg1Of harbor,","
R7868 T11998 T11997 arg1Of harbor,probably
R7869 T11999 T11998 arg2Of pairs,harbor
R7870 T11999 T12000 arg1Of pairs,of
R7871 T12003 T12000 arg2Of sites,of
R7872 T12003 T12001 arg1Of sites,HMG
R7873 T12003 T12002 arg1Of sites,binding
R7874 T12003 T12004 arg1Of sites,with
R7875 T12006 T12004 arg2Of configuration,with
R7876 T12006 T12005 arg1Of configuration,a
R7877 T12006 T12007 arg1Of configuration,compatible
R7878 T12007 T12008 arg1Of compatible,with
R7879 T12009 T12008 arg2Of binding,with
R7880 T12009 T12010 arg1Of binding,of
R7881 T12013 T12010 arg2Of dimers,of
R7882 T12013 T12011 arg1Of dimers,D-Sox
R7883 T12013 T12012 arg1Of dimers,protein
R7884 T12019 T12016 arg2Of study,in
R7885 T12019 T12017 arg1Of study,the
R7886 T12019 T12018 arg1Of study,present
R7887 T12025 T12021 arg1Of sequence,the
R7888 T12025 T12022 arg2Of sequence,defined
R7889 T12025 T12023 arg1Of sequence,Sox6
R7198 T10404 T10403 arg1Of mice,mutant
R7199 T10406 T10405 arg2Of in,than
R7200 T10408 T10406 arg2Of mice,in
R7201 T10408 T10407 arg1Of mice,WT
R7202 T10411 T10410 arg1Of dpc,14.5
R7278 T10491 T10488 arg1Of gene,the
R7279 T10491 T10489 arg1Of gene,ɛy
R7280 T10491 T10490 arg1Of gene,globin
R7281 T10493 T10487 arg1Of Sox6,silencing
R7282 T10493 T10494 arg1Of Sox6,may
R7283 T10493 T10495 arg1Of Sox6,affect
R7284 T10495 T10484 arg2Of affect,suggest
R7285 T10495 T10485 arg1Of affect,that
R7286 T10495 T10486 arg1Of affect,besides
R7287 T10495 T10492 arg1Of affect,","
R7288 T10495 T10494 arg2Of affect,may
R7289 T10498 T10495 arg2Of maturation,affect
R7290 T10498 T10496 arg1Of maturation,red
R7291 T10498 T10497 arg1Of maturation,cell
R7691 T11820 T11818 arg2Of report,In
R7692 T11820 T11819 arg1Of report,this
R7693 T11822 T11823 arg1Of we,show
R7694 T11823 T11818 arg1Of show,In
R7695 T11823 T11821 arg1Of show,","
R7696 T11825 T11826 arg1Of Sox6,is
R7697 T11826 T11823 arg2Of is,show
R7698 T11826 T11824 arg1Of is,that
R7699 T11829 T11826 arg2Of factor,is
R7700 T11829 T11827 arg1Of factor,a
R7701 T11829 T11828 arg1Of factor,novel
R7702 T11829 T11830 arg1Of factor,in
R7703 T11834 T11830 arg2Of mechanism,in
R7704 T11834 T11831 arg1Of mechanism,the
R7705 T11834 T11832 arg2Of mechanism,complicated
R7706 T11834 T11833 arg1Of mechanism,regulation
R7707 T11834 T11835 arg1Of mechanism,of
R7708 T11837 T11835 arg2Of genes,of
R7709 T11837 T11836 arg1Of genes,globin
R7710 T11842 T11838 arg2Of mouse,In
R7711 T11842 T11839 arg1Of mouse,the
R7712 T11842 T11840 arg1Of mouse,Sox6
R7713 T11842 T11841 arg1Of mouse,null
R7714 T11844 T11845 arg1Of there,is
R7715 T11845 T11838 arg1Of is,In
R7716 T11845 T11843 arg1Of is,","
R7717 T11848 T11845 arg2Of effect,is
R7718 T11848 T11846 arg1Of effect,a
R7719 T11848 T11847 arg1Of effect,transient
R7720 T11848 T11849 arg1Of effect,on
R7721 T11853 T11850 arg1Of genes,the
R7722 T11853 T11851 arg1Of genes,embryonic
R7723 T11853 T11852 arg1Of genes,globin
R7724 T11853 T11854 arg1Of genes,","
R7725 T11853 T11859 arg1Of genes,and
R7726 T11855 T11856 arg1Of ζ,and
R7727 T11856 T11854 arg2Of and,","
R7728 T11857 T11856 arg2Of βH1,and
R7729 T11859 T11849 arg2Of and,on
R7730 T11859 T11858 arg1Of and,","
R7731 T11862 T11859 arg2Of upregulation,and
R7732 T11862 T11860 arg1Of upregulation,a
R7733 T11862 T11861 arg1Of upregulation,persistent
R7734 T11862 T11863 arg1Of upregulation,of
R7735 T11867 T11863 arg2Of gene,of
R7736 T11867 T11864 arg1Of gene,the
R7737 T11867 T11865 arg1Of gene,ɛy
R7738 T11867 T11866 arg1Of gene,globin
R7739 T11868 T11870 arg1Of Sox6,regulates
R7740 T11868 T11872 arg1Of Sox6,binds
R7741 T11868 T11881 arg1Of Sox6,represses
R7742 T11870 T11871 arg1Of regulates,and
R7743 T11871 T11880 arg1Of and,and
R7744 T11872 T11871 arg2Of binds,and
R7745 T11872 T11873 arg1Of binds,to
R7746 T11876 T11873 arg2Of promoter,to
R7747 T11876 T11874 arg1Of promoter,the
R7748 T11876 T11875 arg1Of promoter,proximal
R7749 T11876 T11877 arg1Of promoter,of
R7750 T11879 T11877 arg2Of gene,of
R7751 T11879 T11878 arg1Of gene,ɛy
R7752 T11880 T11869 arg1Of and,directly
R7753 T11881 T11880 arg2Of represses,and
R7754 T11884 T11881 arg2Of gene,represses
R7755 T11884 T11882 arg1Of gene,the
R7756 T11884 T11883 arg1Of gene,ɛy-globin
R7757 T11884 T11885 arg1Of gene,in
R7758 T11887 T11885 arg2Of erythropoiesis,in
R7759 T11887 T11886 arg1Of erythropoiesis,definitive
R7760 T11888 T11889 arg1Of Sox6,belongs
R7761 T11889 T11890 arg1Of belongs,to
R7762 T11892 T11890 arg2Of D,to
R7763 T11892 T11891 arg1Of D,group
R7764 T11892 T11893 arg1Of D,of
R7765 T11896 T11893 arg2Of family,of
R7766 T11896 T11894 arg1Of family,the
R7767 T11896 T11895 arg1Of family,Sox
R7768 T11896 T11897 arg1Of family,of
R7769 T11896 T11899 arg1Of family,that
R7770 T11896 T11900 arg1Of family,includes
R7771 T11898 T11897 arg2Of proteins,of
R7772 T11901 T11902 arg1Of Sox5,","
R7773 T11902 T11904 arg1Of ",",","
R7774 T11903 T11902 arg2Of 12,","
R7775 T11904 T11907 arg1Of ",",and
R7776 T11905 T11904 arg2Of 13,","
R7777 T11907 T11900 arg2Of and,includes
R7778 T11907 T11906 arg1Of and,","
R7779 T11908 T11907 arg2Of 23,and
R7780 T11908 T11909 arg1Of 23,[
R7781 T11910 T11909 arg2Of 34,[
R7782 T11911 T11909 arg3Of ],[
R7783 T11914 T11912 arg1Of Sox,Group
R7784 T11914 T11913 arg1Of Sox,D
R7785 T11915 T11914 arg1Of proteins,Sox
R7786 T11915 T11916 arg1Of proteins,contain
R7787 T11919 T11916 arg2Of domain,contain
R7788 T11919 T11917 arg1Of domain,a
R7789 T11919 T11918 arg1Of domain,coiled–coiled
R7790 T11919 T11920 arg1Of domain,that
R7791 T11919 T11921 arg1Of domain,mediates
R7792 T11921 T11925 arg1Of mediates,[
R7793 T11922 T11923 arg1Of homo-,and
R7794 T11923 T11921 arg2Of and,mediates
R7795 T11924 T11923 arg2Of heterodimerization,and
R7796 T11926 T11925 arg2Of "6,35",[
R7797 T11927 T11925 arg3Of ],[
R7798 T11930 T11931 arg1Of dimerization,of
R7799 T11930 T11935 arg1Of dimerization,has
R7800 T11930 T11936 arg1Of dimerization,been
R7801 T11930 T11937 arg2Of dimerization,shown
R7802 T11930 T11940 arg1Of dimerization,increase
R7803 T11932 T11933 arg1Of Sox5,and
R7804 T11933 T11931 arg2Of and,of
R7805 T11934 T11933 arg2Of Sox6,and
R7806 T11937 T11928 arg1Of shown,Functionally
R7807 T11937 T11929 arg1Of shown,","
R7808 T11937 T11935 arg2Of shown,has
R7809 T11937 T11936 arg2Of shown,been
R7810 T11940 T11937 arg3Of increase,shown
R7811 T11940 T11938 arg1Of increase,to
R7812 T11940 T11939 arg1Of increase,greatly
R7813 T11943 T11940 arg2Of efficiency,increase
R7814 T11943 T11941 arg1Of efficiency,the
R7815 T11943 T11942 arg1Of efficiency,binding
R7891 T12025 T12026 arg1Of sequence,of
R7892 T12025 T12030 arg1Of sequence,contains
R7893 T12029 T12026 arg2Of promoter,of
R7894 T12029 T12027 arg1Of promoter,the
R7895 T12029 T12028 arg1Of promoter,ɛy
R7896 T12030 T12014 arg1Of contains,Indeed
R7897 T12030 T12015 arg1Of contains,","
R7898 T12030 T12016 arg1Of contains,in
R7899 T12030 T12020 arg1Of contains,","
R7900 T12034 T12030 arg2Of sites,contains
R7901 T12034 T12031 arg1Of sites,two
R7902 T12034 T12032 arg1Of sites,Sox/Sox6
R7903 T12034 T12033 arg1Of sites,consensus
R7904 T12034 T12035 arg1Of sites,(
R7890 T12025 T12024 arg1Of sequence,target
R7966 T12096 T12098 arg1Of sequence,allows
R7967 T12098 T12099 arg1Of allows,for
R7968 T12101 T12099 arg2Of degeneracy,for
R7969 T12101 T12100 arg1Of degeneracy,considerable
R7970 T12104 T12103 arg1Of specificity,the
R7971 T12104 T12105 arg1Of specificity,of
R7972 T12104 T12108 arg1Of specificity,is
R7973 T12104 T12109 arg2Of specificity,thought
R7974 T12104 T12111 arg1Of specificity,rely
R7975 T12107 T12105 arg2Of actions,of
R7976 T12107 T12106 arg1Of actions,their
R7977 T12109 T12088 arg1Of thought,Because
R7978 T12109 T12102 arg1Of thought,","
R7979 T12109 T12108 arg2Of thought,is
R7980 T12111 T12109 arg3Of rely,thought
R7981 T12111 T12110 arg1Of rely,to
R7982 T12111 T12112 arg1Of rely,upon
R7983 T12113 T12112 arg2Of interactions,upon
R7984 T12113 T12114 arg1Of interactions,with
R7985 T12117 T12114 arg2Of factors,with
R7986 T12117 T12115 arg1Of factors,other
R7987 T12117 T12116 arg1Of factors,transcription
R7988 T12117 T12118 arg1Of factors,[
R7989 T12119 T12118 arg2Of 36,[
R7990 T12120 T12118 arg3Of ],[
R7991 T12123 T12121 arg2Of EMSAs,In
R7992 T12123 T12122 arg1Of EMSAs,our
R7993 T12125 T12126 arg1Of we,had
R7994 T12125 T12128 arg1Of we,run
R7995 T12126 T12121 arg1Of had,In
R7996 T12126 T12124 arg1Of had,","
R7997 T12128 T12126 arg2Of run,had
R7998 T12128 T12127 arg1Of run,to
R7999 T12128 T12131 arg1Of run,on
R8000 T12128 T12138 arg1Of run,for
R8001 T12128 T12143 modOf run,to
R8002 T12128 T12148 arg1Of run,","
R8003 T12128 T12149 modOf run,suggesting
R8004 T12130 T12128 arg2Of electrophoresis,run
R8005 T12130 T12129 arg1Of electrophoresis,the
R8006 T12135 T12136 arg1Of –6,%
R8007 T12137 T12131 arg2Of gel,on
R8008 T12137 T12132 arg1Of gel,a
R8009 T12137 T12133 arg1Of gel,4
R8010 T12137 T12134 arg1Of gel,%
R8011 T12137 T12135 arg1Of gel,–6
R8012 T12141 T12139 arg1Of 4–8,at
R8013 T12141 T12140 arg1Of 4–8,least
R8014 T12142 T12138 arg2Of h,for
R8015 T12142 T12141 arg1Of h,4–8
R8016 T12144 T12143 arg1Of detect,to
R8017 T12147 T12144 arg2Of band,detect
R8018 T12147 T12145 arg1Of band,the
R8019 T12147 T12146 arg1Of band,Sox6-associated
R8020 T12151 T12152 arg1Of Sox6,is
R8021 T12152 T12149 arg2Of is,suggesting
R8022 T12152 T12150 arg1Of is,that
R8023 T12153 T12152 arg2Of part,is
R8024 T12153 T12154 arg1Of part,of
R8025 T12159 T12154 arg2Of complex,of
R8026 T12159 T12155 arg1Of complex,a
R8027 T12159 T12156 arg1Of complex,high
R8028 T12159 T12157 arg1Of complex,molecular
R8029 T12159 T12158 arg1Of complex,weight
R8030 T12165 T12160 arg1Of repressors,A
R8031 T12165 T12161 arg1Of repressors,few
R8032 T12165 T12162 arg1Of repressors,other
R8033 T12165 T12163 arg1Of repressors,ɛy
R8034 T12165 T12164 arg1Of repressors,globin
R8035 T12165 T12166 arg1Of repressors,have
R8036 T12165 T12167 arg1Of repressors,been
R8037 T12165 T12168 arg2Of repressors,reported
R8038 T12165 T12170 arg1Of repressors,bind
R8039 T12168 T12166 arg2Of reported,have
R8040 T12168 T12167 arg2Of reported,been
R8116 T12240 T12239 arg1Of and,","
R8117 T12243 T12240 arg2Of bind,and
R8118 T12243 T12241 arg2Of bind,can
R8119 T12243 T12242 arg1Of bind,also
R8120 T12243 T12244 arg1Of bind,to
R8121 T12246 T12244 arg2Of junctions,to
R8122 T12246 T12245 arg1Of junctions,four-way
R8123 T12246 T12247 arg1Of junctions,[
R8124 T12248 T12247 arg2Of 2–4,[
R8125 T12249 T12247 arg3Of ],[
R8126 T12254 T12252 arg1Of model,one
R8127 T12254 T12253 arg1Of model,attractive
R8128 T12254 T12255 modOf model,to
R8129 T12254 T12263 arg1Of model,is
R8130 T12256 T12255 arg1Of explain,to
R8131 T12257 T12256 arg2Of how,explain
R8132 T12259 T12258 arg1Of proteins,Sox6
R8133 T12259 T12260 arg1Of proteins,control
R8134 T12260 T12257 arg1Of control,how
R8135 T12262 T12260 arg2Of expression,control
R8136 T12262 T12261 arg1Of expression,gene
R8137 T12263 T12250 arg1Of is,Therefore
R8138 T12263 T12251 arg1Of is,","
R8139 T12265 T12266 arg1Of they,function
R8140 T12266 T12263 arg2Of function,is
R8141 T12266 T12264 arg1Of function,that
R8142 T12266 T12267 arg1Of function,as
R8143 T12269 T12268 arg1Of factors,architectural
R8144 T12269 T12270 arg1Of factors,bound
R8145 T12269 T12274 arg1Of factors,influencing
R8146 T12269 T12279 arg1Of factors,bending
R8147 T12270 T12267 arg2Of bound,as
R8148 T12270 T12271 arg1Of bound,to
R8149 T12270 T12273 arg1Of bound,","
R8150 T12270 T12274 modOf bound,influencing
R8151 T12272 T12271 arg2Of DNA,to
R8152 T12274 T12278 arg1Of influencing,by
R8153 T12274 T12282 arg1Of influencing,by
R8154 T12277 T12274 arg2Of structure,influencing
R8155 T12277 T12275 arg1Of structure,local
R8156 T12277 T12276 arg1Of structure,chromatin
R8157 T12278 T12281 arg1Of by,and
R8158 T12279 T12278 arg2Of bending,by
R7905 T12037 T12035 arg2Of 3A,(
R7906 T12037 T12036 arg1Of 3A,Figure
R7907 T12038 T12035 arg3Of ),(
R7908 T12042 T12041 arg1Of sites,both
R7909 T12042 T12043 arg1Of sites,are
R7910 T12042 T12044 arg1Of sites,essential
R7911 T12043 T12039 arg1Of are,Functionally
R7912 T12043 T12040 arg1Of are,","
R7913 T12044 T12043 arg2Of essential,are
R7914 T12044 T12045 arg1Of essential,for
R7915 T12047 T12045 arg2Of binding,for
R7916 T12047 T12046 arg1Of binding,Sox6
R7917 T12047 T12048 arg1Of binding,to
R7918 T12051 T12052 arg1Of promoter,and
R7919 T12052 T12048 arg2Of and,to
R7920 T12052 T12049 arg1Of and,the
R7921 T12052 T12050 arg1Of and,ɛy
R7922 T12052 T12054 arg1Of and,of
R7923 T12052 T12057 arg1Of and,(
R7924 T12053 T12052 arg2Of repression,and
R7925 T12056 T12054 arg2Of activity,of
R7926 T12056 T12055 arg1Of activity,its
R7927 T12059 T12058 arg1Of 3E,Figure
R7928 T12059 T12060 arg1Of 3E,and
R7929 T12060 T12057 arg2Of and,(
R7930 T12061 T12060 arg2Of 3F,and
R7931 T12062 T12057 arg3Of ),(
R7932 T12064 T12063 arg1Of observations,These
R7933 T12064 T12065 arg1Of observations,suggest
R7934 T12067 T12068 arg1Of Sox6,binds
R7935 T12068 T12065 arg2Of binds,suggest
R7936 T12068 T12066 arg1Of binds,that
R7937 T12068 T12069 arg1Of binds,to
R7938 T12068 T12077 arg1Of binds,as
R7939 T12068 T12081 arg1Of binds,as
R7940 T12071 T12069 arg2Of sequence,to
R7941 T12071 T12070 arg1Of sequence,this
R7942 T12071 T12072 arg1Of sequence,of
R7943 T12075 T12072 arg2Of promoter,of
R7944 T12075 T12073 arg1Of promoter,the
R7945 T12075 T12074 arg1Of promoter,ɛy
R7946 T12077 T12080 arg1Of as,or
R7947 T12079 T12077 arg2Of homodimer,as
R7948 T12079 T12078 arg1Of homodimer,a
R7949 T12080 T12076 arg1Of or,either
R7950 T12081 T12080 arg2Of as,or
R7951 T12083 T12081 arg2Of heterodimer,as
R7952 T12083 T12082 arg1Of heterodimer,a
R7953 T12083 T12084 arg1Of heterodimer,with
R7954 T12087 T12084 arg2Of proteins,with
R7955 T12087 T12085 arg1Of proteins,other
R7956 T12087 T12086 arg1Of proteins,Sox
R7957 T12090 T12089 arg1Of proteins,Sox
R7958 T12090 T12091 arg1Of proteins,recognize
R7959 T12091 T12088 arg2Of recognize,Because
R7960 T12096 T12091 arg2Of sequence,recognize
R7961 T12096 T12092 arg1Of sequence,a
R7962 T12096 T12093 arg1Of sequence,short
R7963 T12096 T12094 arg1Of sequence,6-bp
R7964 T12096 T12095 arg1Of sequence,core-binding
R7965 T12096 T12097 arg1Of sequence,that
R8041 T12170 T12168 arg3Of bind,reported
R8042 T12170 T12169 arg1Of bind,to
R8043 T12170 T12171 arg1Of bind,to
R8044 T12173 T12171 arg2Of sequences,to
R8045 T12173 T12172 arg1Of sequences,DNA
R8046 T12173 T12174 arg1Of sequences,near
R8047 T12178 T12174 arg2Of sites,near
R8048 T12178 T12175 arg1Of sites,the
R8049 T12178 T12176 arg1Of sites,Sox/Sox6
R8050 T12178 T12177 arg1Of sites,consensus
R8051 T12178 T12179 arg1Of sites,","
R8052 T12178 T12180 arg1Of sites,including
R8053 T12183 T12181 arg1Of complex,the
R8054 T12183 T12182 arg1Of complex,DRED
R8055 T12183 T12184 arg1Of complex,[
R8056 T12183 T12187 arg1Of complex,and
R8057 T12185 T12184 arg2Of 37,[
R8058 T12186 T12184 arg3Of ],[
R8059 T12187 T12180 arg2Of and,including
R8060 T12188 T12187 arg2Of COUP-TF,and
R8061 T12188 T12189 arg1Of COUP-TF,[
R8062 T12190 T12189 arg2Of 38,[
R8063 T12191 T12189 arg3Of ],[
R8064 T12192 T12193 arg1Of Sox6,might
R8065 T12192 T12194 arg1Of Sox6,interact
R8066 T12192 T12199 arg1Of Sox6,form
R8067 T12194 T12195 arg1Of interact,with
R8068 T12194 T12198 arg1Of interact,and
R8069 T12197 T12195 arg2Of factors,with
R8070 T12197 T12196 arg1Of factors,these
R8071 T12198 T12193 arg2Of and,might
R8072 T12199 T12198 arg2Of form,and
R8073 T12203 T12199 arg2Of complex,form
R8074 T12203 T12200 arg1Of complex,a
R8075 T12203 T12201 arg1Of complex,large
R8076 T12203 T12202 arg1Of complex,repression
R8077 T12204 T12205 arg1Of Identification,of
R8078 T12204 T12217 arg1Of Identification,will
R8079 T12204 T12218 arg1Of Identification,shed
R8080 T12207 T12205 arg2Of components,of
R8081 T12207 T12206 arg1Of components,other
R8082 T12207 T12208 arg1Of components,of
R8083 T12211 T12208 arg2Of complex,of
R8084 T12211 T12209 arg1Of complex,the
R8085 T12211 T12210 arg1Of complex,Sox6-containing
R8086 T12211 T12212 arg2Of complex,associated
R8087 T12212 T12213 arg1Of associated,with
R8088 T12216 T12213 arg2Of promoter,with
R8089 T12216 T12214 arg1Of promoter,the
R8090 T12216 T12215 arg1Of promoter,ɛy
R8091 T12218 T12217 arg2Of shed,will
R8092 T12218 T12220 arg1Of shed,on
R8093 T12219 T12218 arg2Of light,shed
R8094 T12222 T12220 arg2Of mechanism,on
R8095 T12222 T12221 arg1Of mechanism,its
R8096 T12222 T12223 arg1Of mechanism,of
R8097 T12224 T12223 arg2Of repression,of
R8098 T12226 T12225 arg1Of proteins,Sox
R8099 T12226 T12227 arg1Of proteins,bind
R8100 T12226 T12229 arg1Of proteins,bend
R8101 T12226 T12241 arg1Of proteins,can
R8102 T12226 T12243 arg1Of proteins,bind
R8103 T12227 T12228 arg1Of bind,and
R8104 T12228 T12240 arg1Of and,and
R8105 T12229 T12228 arg2Of bend,and
R8106 T12231 T12227 arg2Of DNA,bind
R8107 T12231 T12229 arg2Of DNA,bend
R8108 T12231 T12230 arg1Of DNA,linear
R8109 T12231 T12232 arg1Of DNA,by
R8110 T12234 T12232 arg2Of intercalation,by
R8111 T12234 T12233 arg1Of intercalation,partial
R8112 T12234 T12235 arg1Of intercalation,in
R8113 T12238 T12235 arg2Of groove,in
R8114 T12238 T12236 arg1Of groove,the
R8115 T12238 T12237 arg1Of groove,minor
R8191 T12311 T12310 arg1Of repressors,other
R8192 T12313 T12312 arg1Of example,Another
R8193 T12313 T12314 arg1Of example,of
R8194 T12313 T12326 arg1Of example,is
R8195 T12313 T12327 arg2Of example,DRED
R8196 T12316 T12314 arg2Of repressor,of
R8197 T12316 T12315 arg1Of repressor,a
R8198 T12316 T12317 arg1Of repressor,that
R8199 T12316 T12318 arg1Of repressor,interferes
R8200 T12318 T12319 arg1Of interferes,with
R8201 T12318 T12322 arg1Of interferes,on
R8202 T12321 T12319 arg2Of activator,with
R8203 T12321 T12320 arg1Of activator,an
R8204 T12325 T12322 arg2Of promoter,on
R8205 T12325 T12323 arg1Of promoter,the
R8206 T12325 T12324 arg1Of promoter,ɛy
R8207 T12327 T12326 arg2Of DRED,is
R8208 T12328 T12329 arg1Of DRED,interferes
R8209 T12328 T12337 arg1Of DRED,binding
R8210 T12329 T12330 arg1Of interferes,with
R8211 T12329 T12335 arg1Of interferes,","
R8212 T12329 T12336 arg1Of interferes,in
R8159 T12280 T12279 arg2Of DNA,bending
R8160 T12282 T12281 arg2Of by,and
R8161 T12283 T12282 arg2Of assembling,by
R8162 T12286 T12283 arg2Of complexes,assembling
R8163 T12286 T12284 arg1Of complexes,multiprotein
R8164 T12286 T12285 arg1Of complexes,transcriptional
R8165 T12288 T12287 arg2Of changing,By
R8166 T12292 T12288 arg2Of structure,changing
R8167 T12292 T12289 arg1Of structure,the
R8168 T12292 T12290 arg1Of structure,local
R8169 T12292 T12291 arg1Of structure,chromatin
R8170 T12294 T12288 arg1Of Sox6,changing
R8171 T12294 T12295 arg1Of Sox6,could
R8172 T12294 T12297 arg1Of Sox6,interfere
R8173 T12294 T12307 arg1Of Sox6,facilitate
R8174 T12297 T12298 arg1Of interfere,with
R8175 T12297 T12306 arg1Of interfere,or
R8176 T12299 T12298 arg2Of binding,with
R8177 T12299 T12300 arg1Of binding,of
R8178 T12299 T12303 arg1Of binding,to
R8179 T12302 T12300 arg2Of activators,of
R8180 T12302 T12301 arg1Of activators,other
R8181 T12305 T12303 arg2Of promoter,to
R8182 T12305 T12304 arg1Of promoter,the
R8183 T12306 T12287 arg1Of or,By
R8184 T12306 T12293 arg1Of or,","
R8185 T12306 T12295 arg2Of or,could
R8186 T12306 T12296 arg1Of or,either
R8187 T12307 T12306 arg2Of facilitate,or
R8188 T12308 T12307 arg2Of binding,facilitate
R8189 T12308 T12309 arg1Of binding,of
R8190 T12311 T12309 arg2Of repressors,of
R8341 T12458 T12457 arg1Of to,due
R8342 T12459 T12458 arg2Of defects,to
R8343 T12459 T12460 arg1Of defects,in
R8344 T12463 T12460 arg2Of mechanism,in
R8345 T12463 T12461 arg1Of mechanism,the
R8346 T12463 T12462 arg1Of mechanism,silencing
R8347 T12463 T12464 arg1Of mechanism,of
R8348 T12463 T12467 arg1Of mechanism,that
R8349 T12463 T12468 arg1Of mechanism,takes
R8350 T12466 T12464 arg2Of erythropoiesis,of
R8351 T12466 T12465 arg1Of erythropoiesis,definitive
R8352 T12468 T12470 arg1Of takes,in
R8353 T12469 T12468 arg2Of place,takes
R8354 T12472 T12470 arg2Of liver,in
R8355 T12472 T12471 arg1Of liver,the
R8356 T12472 T12473 arg1Of liver,(
R8357 T12474 T12473 arg2Of Figure,(
R8358 T12474 T12475 arg1Of Figure,5
R8359 T12476 T12473 arg3Of ),(
R8360 T12477 T12478 arg1Of Taken,together
R8361 T12481 T12480 arg1Of data,these
R8362 T12481 T12482 arg1Of data,demonstrate
R8363 T12482 T12477 modOf demonstrate,Taken
R8364 T12482 T12479 arg1Of demonstrate,","
R8365 T12485 T12482 arg2Of functions,demonstrate
R8366 T12485 T12483 arg1Of functions,that
R8367 T12485 T12484 arg1Of functions,Sox6
R8368 T12485 T12486 arg1Of functions,in
R8369 T12488 T12486 arg2Of erythropoiesis,in
R8370 T12488 T12487 arg1Of erythropoiesis,definitive
R8371 T12488 T12489 arg1Of erythropoiesis,to
R8372 T12493 T12489 arg2Of expression,to
R8373 T12493 T12490 arg1Of expression,silence
R8374 T12493 T12491 arg1Of expression,ɛy
R8375 T12493 T12492 arg1Of expression,globin
R8376 T12496 T12494 arg1Of level,The
R8377 T12496 T12495 arg1Of level,expression
R8378 T12496 T12497 arg1Of level,of
R8379 T12496 T12500 arg1Of level,in
R8380 T12496 T12511 arg1Of level,is
R8381 T12496 T12513 arg1Of level,equivalent
R8382 T12499 T12497 arg2Of globin,of
R8383 T12499 T12498 arg1Of globin,ɛy
R8384 T12504 T12500 arg2Of mice,in
R8385 T12504 T12501 arg1Of mice,homozygous
R8386 T12504 T12502 arg1Of mice,Sox6
R8387 T12504 T12503 arg1Of mice,null
R8388 T12504 T12505 arg1Of mice,at
R8389 T12507 T12506 arg1Of dpc,15.5
R8390 T12507 T12508 arg1Of dpc,and
R8391 T12508 T12505 arg2Of and,at
R8392 T12510 T12508 arg2Of dpc,and
R8393 T12510 T12509 arg1Of dpc,18.5
R8394 T12513 T12511 arg2Of equivalent,is
R8395 T12513 T12512 arg1Of equivalent,statistically
R8396 T12513 T12514 arg1Of equivalent,to
R8397 T12516 T12514 arg2Of level,to
R8398 T12516 T12515 arg1Of level,the
R8399 T12516 T12517 arg1Of level,of
R8400 T12519 T12518 arg1Of expression,βmaj/min
R8401 T12519 T12520 arg1Of expression,in
R8402 T12519 T12525 arg1Of expression,and
R8403 T12522 T12520 arg2Of livers,in
R8404 T12522 T12521 arg1Of livers,the
R8405 T12522 T12523 arg1Of livers,of
R8406 T12524 T12523 arg2Of 15.5-dpc,of
R8407 T12525 T12517 arg2Of and,of
R8408 T12529 T12525 arg2Of mice,and
R8409 T12529 T12526 arg1Of mice,18.5-dpc
R8410 T12529 T12527 arg1Of mice,homozygous
R8411 T12529 T12528 arg1Of mice,WT
R8412 T12529 T12530 arg1Of mice,(
R8413 T12531 T12530 arg2Of Figure,(
R8414 T12531 T12532 arg1Of Figure,1
R8415 T12533 T12530 arg3Of ),(
R8491 T12611 T12608 arg3Of ),(
R8492 T12613 T12592 arg1Of suggesting,However
R8493 T12613 T12593 arg1Of suggesting,","
R8494 T12613 T12594 arg1Of suggesting,unlike
R8495 T12613 T12597 arg1Of suggesting,","
R8496 T12615 T12616 arg1Of ɛy,is
R8497 T12615 T12617 arg2Of ɛy,regulated
R8498 T12617 T12613 arg2Of regulated,suggesting
R8499 T12617 T12614 arg1Of regulated,that
R8500 T12617 T12616 arg2Of regulated,is
R8501 T12617 T12618 arg1Of regulated,differently
R8502 T12618 T12619 arg1Of differently,than
R8503 T12620 T12621 arg1Of ζ,and
R8504 T12621 T12619 arg2Of and,than
R8213 T12331 T12330 arg2Of EKLF,with
R8214 T12331 T12332 arg1Of EKLF,","
R8215 T12334 T12332 arg2Of activator,","
R8216 T12334 T12333 arg1Of activator,an
R8217 T12337 T12336 arg2Of binding,in
R8218 T12337 T12338 arg1Of binding,to
R8219 T12341 T12338 arg2Of promoter,to
R8220 T12341 T12339 arg1Of promoter,the
R8221 T12341 T12340 arg1Of promoter,ɛy
R8222 T12341 T12342 arg1Of promoter,[
R8223 T12343 T12342 arg2Of 39,[
R8224 T12344 T12342 arg3Of ],[
R8225 T12348 T12345 arg1Of proteins,Two
R8226 T12348 T12346 arg1Of proteins,HMG
R8227 T12348 T12347 arg1Of proteins,architectural
R8228 T12348 T12349 arg1Of proteins,(
R8229 T12348 T12360 arg1Of proteins,","
R8230 T12351 T12349 arg2Of related,(
R8231 T12351 T12350 arg1Of related,distantly
R8232 T12351 T12352 arg1Of related,to
R8233 T12355 T12352 arg2Of family,to
R8234 T12355 T12353 arg1Of family,the
R8235 T12355 T12354 arg1Of family,Sox
R8236 T12355 T12356 arg1Of family,of
R8237 T12358 T12356 arg2Of factors,of
R8238 T12358 T12357 arg1Of factors,transcription
R8239 T12359 T12349 arg3Of ),(
R8240 T12360 T12365 arg1Of ",",were
R8241 T12360 T12366 arg2Of ",",demonstrated
R8242 T12360 T12368 arg1Of ",",bind
R8243 T12360 T12383 arg1Of ",",cause
R8244 T12361 T12362 arg1Of HMG-I,and
R8245 T12362 T12360 arg2Of and,","
R8246 T12363 T12362 arg2Of HMG-Y,and
R8247 T12366 T12365 arg2Of demonstrated,were
R8248 T12366 T12382 arg1Of demonstrated,and
R8249 T12368 T12366 arg3Of bind,demonstrated
R8250 T12368 T12367 arg1Of bind,to
R8251 T12368 T12369 arg1Of bind,to
R8252 T12375 T12369 arg2Of silencers,to
R8253 T12375 T12370 arg1Of silencers,the
R8254 T12375 T12371 arg1Of silencers,human
R8255 T12375 T12372 arg1Of silencers,adult
R8256 T12375 T12373 arg1Of silencers,β
R8257 T12375 T12374 arg1Of silencers,globin
R8258 T12375 T12376 arg1Of silencers,(
R8259 T12378 T12379 arg1Of I,and
R8260 T12379 T12376 arg2Of and,(
R8261 T12379 T12377 arg1Of and,silencers
R8262 T12380 T12379 arg2Of II,and
R8263 T12381 T12376 arg3Of ),(
R8264 T12382 T12364 arg1Of and,","
R8265 T12382 T12395 arg1Of and,[
R8266 T12383 T12382 arg2Of cause,and
R8267 T12384 T12383 arg2Of bending,cause
R8268 T12384 T12385 arg1Of bending,of
R8269 T12384 T12388 arg1Of bending,","
R8270 T12387 T12385 arg2Of DNA,of
R8271 T12387 T12386 arg1Of DNA,the
R8272 T12389 T12388 arg2Of facilitating,","
R8273 T12391 T12389 arg2Of binding,facilitating
R8274 T12391 T12390 arg1Of binding,the
R8275 T12391 T12392 arg1Of binding,of
R8276 T12394 T12392 arg2Of repressors,of
R8277 T12394 T12393 arg1Of repressors,other
R8278 T12396 T12395 arg2Of 40,[
R8279 T12397 T12395 arg3Of ],[
R8280 T12399 T12398 arg1Of expression,Sox6
R8281 T12399 T12400 arg1Of expression,is
R8282 T12399 T12404 arg1Of expression,coincident
R8283 T12400 T12418 arg1Of is,and
R8284 T12401 T12402 arg1Of temporally,and
R8285 T12403 T12402 arg2Of spatially,and
R8286 T12404 T12400 arg2Of coincident,is
R8287 T12404 T12401 arg1Of coincident,temporally
R8288 T12404 T12403 arg1Of coincident,spatially
R8289 T12404 T12405 arg1Of coincident,with
R8290 T12406 T12407 arg1Of definitive,(
R8291 T12410 T12407 arg2Of primitive,(
R8292 T12410 T12408 arg1Of primitive,but
R8293 T12410 T12409 arg1Of primitive,not
R8294 T12411 T12407 arg3Of ),(
R8295 T12412 T12405 arg2Of erythropoiesis,with
R8296 T12412 T12406 arg1Of erythropoiesis,definitive
R8297 T12412 T12413 arg1Of erythropoiesis,(
R8298 T12414 T12413 arg2Of Figure,(
R8299 T12414 T12415 arg1Of Figure,6
R8300 T12416 T12413 arg3Of ),(
R8301 T12418 T12417 arg1Of and,","
R8302 T12419 T12420 arg1Of Sox6,represses
R8303 T12420 T12418 arg2Of represses,and
R8304 T12423 T12421 arg1Of expression,ɛy
R8305 T12423 T12422 arg1Of expression,globin
R8306 T12423 T12426 arg1Of expression,vivo
R8307 T12423 T12427 arg1Of expression,(
R8308 T12423 T12431 arg1Of expression,and
R8309 T12426 T12424 arg1Of vivo,both
R8310 T12426 T12425 arg1Of vivo,in
R8311 T12428 T12427 arg2Of Figure,(
R8312 T12428 T12429 arg1Of Figure,1
R8313 T12430 T12427 arg3Of ),(
R8314 T12431 T12420 arg2Of and,represses
R8315 T12433 T12432 arg1Of vitro,in
R8316 T12435 T12431 arg2Of Figure,and
R8317 T12435 T12433 arg1Of Figure,vitro
R8318 T12435 T12434 arg2Of Figure,(
R8319 T12435 T12436 arg1Of Figure,2
R8320 T12437 T12434 arg3Of ),(
R8321 T12441 T12440 arg1Of situ,in
R8322 T12442 T12441 arg1Of hybridization,situ
R8323 T12442 T12444 arg1Of hybridization,shows
R8324 T12444 T12438 arg1Of shows,Moreover
R8325 T12444 T12439 arg1Of shows,","
R8326 T12444 T12443 arg1Of shows,clearly
R8327 T12448 T12446 arg1Of expression,the
R8328 T12448 T12447 arg1Of expression,persistent
R8329 T12448 T12449 arg1Of expression,of
R8330 T12448 T12452 arg1Of expression,in
R8331 T12448 T12456 arg1Of expression,is
R8332 T12448 T12458 arg1Of expression,to
R8333 T12451 T12449 arg2Of globin,of
R8334 T12451 T12450 arg1Of globin,ɛy
R8335 T12455 T12452 arg2Of mice,in
R8336 T12455 T12453 arg1Of mice,p100H
R8337 T12455 T12454 arg1Of mice,mutant
R8338 T12456 T12444 arg2Of is,shows
R8339 T12456 T12445 arg1Of is,that
R8340 T12458 T12456 arg2Of to,is
R8416 T12534 T12535 arg1Of This,demonstrates
R8417 T12538 T12537 arg1Of expression,ectopic
R8418 T12538 T12539 arg1Of expression,of
R8419 T12538 T12544 arg1Of expression,is
R8420 T12538 T12546 arg1Of expression,robust
R8421 T12543 T12539 arg2Of gene,of
R8422 T12543 T12540 arg1Of gene,the
R8423 T12543 T12541 arg1Of gene,ɛy
R8424 T12543 T12542 arg1Of gene,globin
R8425 T12544 T12535 arg2Of is,demonstrates
R8426 T12544 T12536 arg1Of is,that
R8427 T12546 T12544 arg2Of robust,is
R8428 T12546 T12545 arg1Of robust,quite
R8429 T12546 T12547 arg1Of robust,in
R8430 T12550 T12547 arg2Of mice,in
R8431 T12550 T12548 arg1Of mice,homozygous
R8432 T12550 T12549 arg1Of mice,mutant
R8433 T12553 T12551 arg1Of levels,The
R8434 T12553 T12552 arg1Of levels,expression
R8435 T12553 T12554 arg1Of levels,of
R8436 T12553 T12565 arg1Of levels,are
R8437 T12553 T12567 arg1Of levels,higher
R8438 T12559 T12554 arg2Of genes,of
R8439 T12559 T12555 arg1Of genes,two
R8440 T12559 T12556 arg1Of genes,other
R8441 T12559 T12557 arg1Of genes,embryonic
R8442 T12559 T12558 arg1Of genes,globin
R8443 T12559 T12560 arg1Of genes,(
R8444 T12561 T12562 arg1Of ζ,and
R8445 T12562 T12560 arg2Of and,(
R8505 T12622 T12621 arg2Of βh1,and
R8506 T12625 T12624 arg2Of possible,is
R8507 T12627 T12628 arg1Of Sox6,has
R8508 T12628 T12623 arg1Of has,It
R8509 T12628 T12624 arg1Of has,is
R8510 T12628 T12625 arg1Of has,possible
R8511 T12628 T12626 arg1Of has,that
R8512 T12628 T12632 arg1Of has,on
R8513 T12628 T12641 arg1Of has,in
R8514 T12631 T12628 arg2Of effect,has
R8515 T12631 T12629 arg1Of effect,a
R8516 T12631 T12630 arg1Of effect,general
R8517 T12635 T12632 arg2Of genes,on
R8518 T12635 T12633 arg1Of genes,embryonic
R8519 T12635 T12634 arg1Of genes,globin
R8520 T12635 T12636 arg1Of genes,(
R8521 T12639 T12636 arg2Of maturation,(
R8522 T12639 T12637 arg1Of maturation,and
R8523 T12639 T12638 arg1Of maturation,erythrocyte
R8524 T12640 T12636 arg3Of ),(
R8525 T12642 T12641 arg2Of addition,in
R8526 T12642 T12643 arg1Of addition,to
R8527 T12646 T12643 arg2Of role,to
R8528 T12646 T12644 arg1Of role,a
R8529 T12646 T12645 arg1Of role,specific
R8530 T12646 T12647 arg1Of role,in
R8531 T12648 T12647 arg2Of silencing,in
R8532 T12649 T12648 arg2Of ɛy,silencing
R8533 T12651 T12650 arg2Of most,Although
R8534 T12654 T12652 arg1Of mice,p100H
R8535 T12654 T12653 arg1Of mice,mutant
R8536 T12654 T12655 arg1Of mice,die
R8537 T12654 T12658 arg1Of mice,being
R8538 T12654 T12659 arg2Of mice,born
R8539 T12655 T12650 arg1Of die,Although
R8540 T12655 T12656 arg1Of die,just
R8541 T12655 T12657 arg1Of die,after
R8542 T12655 T12660 arg1Of die,","
R8543 T12655 T12665 arg1Of die,longer
R8544 T12659 T12657 arg2Of born,after
R8545 T12659 T12658 arg2Of born,being
R8546 T12664 T12661 arg1Of survive,a
R8547 T12664 T12662 arg1Of survive,rare
R8548 T12664 T12663 arg1Of survive,few
R8549 T12665 T12664 arg1Of longer,survive
R8550 T12666 T12667 arg1Of None,have
R8551 T12666 T12668 arg1Of None,been
R8552 T12666 T12669 arg2Of None,observed
R8553 T12666 T12671 arg1Of None,live
R8554 T12669 T12667 arg2Of observed,have
R8555 T12669 T12668 arg2Of observed,been
R8556 T12671 T12669 arg3Of live,observed
R8557 T12671 T12670 arg1Of live,to
R8558 T12671 T12676 arg1Of live,after
R8559 T12671 T12678 arg1Of live,[
R8560 T12672 T12673 arg1Of longer,than
R8561 T12674 T12673 arg2Of 2,than
R8562 T12675 T12671 arg2Of wk,live
R8563 T12675 T12672 arg1Of wk,longer
R8564 T12677 T12676 arg2Of birth,after
R8565 T12679 T12678 arg2Of 14,[
R8641 T12753 T12752 arg1Of elevated,moderately
R8642 T12753 T12754 arg1Of elevated,in
R8643 T12757 T12754 arg2Of RNA,in
R8644 T12757 T12755 arg1Of RNA,the
R8645 T12757 T12756 arg1Of RNA,mutant
R8646 T12759 T12758 arg2Of with,compared
R8647 T12760 T12759 arg2Of WT,with
R8648 T12760 T12761 arg1Of WT,(
R8649 T12760 T12765 arg1Of WT,","
R8650 T12760 T12766 arg1Of WT,similar
R8651 T12763 T12761 arg2Of data,(
R8652 T12763 T12762 arg1Of data,unpublished
R8653 T12764 T12761 arg3Of ),(
R8654 T12766 T12767 arg1Of similar,to
R8655 T12768 T12767 arg2Of what,to
R8656 T12768 T12770 arg2Of what,observe
R8657 T12769 T12770 arg1Of we,observe
R8658 T12770 T12771 arg1Of observe,at
R8659 T12773 T12771 arg2Of dpc,at
R8660 T12773 T12772 arg1Of dpc,18.5
R8661 T12773 T12774 arg1Of dpc,(
R8662 T12775 T12774 arg2Of Figure,(
R8663 T12775 T12776 arg1Of Figure,1
R8664 T12777 T12774 arg3Of ),(
R8665 T12779 T12778 arg1Of findings,These
R8666 T12779 T12780 arg1Of findings,suggest
R8667 T12782 T12783 arg1Of Sox6,continues
R8668 T12782 T12785 arg1Of Sox6,function
R8669 T12782 T12793 arg1Of Sox6,has
R8670 T12783 T12792 arg1Of continues,and
R8671 T12785 T12783 arg2Of function,continues
R8672 T12785 T12784 arg1Of function,to
R8673 T12785 T12787 arg1Of function,to
R8674 T12787 T12786 arg1Of to,postnatally
R8675 T12791 T12787 arg2Of expression,to
R8676 T12791 T12788 arg1Of expression,silence
R8677 T12791 T12789 arg1Of expression,ɛy
R8678 T12791 T12790 arg1Of expression,globin
R8679 T12792 T12780 arg2Of and,suggest
R8680 T12792 T12781 arg1Of and,that
R8681 T12793 T12792 arg2Of has,and
R8682 T12793 T12797 arg1Of has,in
R8683 T12796 T12793 arg2Of function,has
R8684 T12796 T12794 arg1Of function,a
R8685 T12796 T12795 arg1Of function,unique
R8686 T12799 T12797 arg2Of regulation,in
R8687 T12799 T12798 arg1Of regulation,the
R8688 T12799 T12800 arg1Of regulation,of
R8689 T12801 T12800 arg2Of ɛy-globin,of
R8690 T12803 T12802 arg1Of mechanism,The
R8691 T12803 T12804 arg2Of mechanism,by
R8692 T12803 T12805 arg1Of mechanism,which
R8693 T12803 T12813 arg1Of mechanism,remains
R8694 T12803 T12815 arg1Of mechanism,be
R8695 T12803 T12816 arg2Of mechanism,elucidated
R8696 T12806 T12807 arg1Of Sox6,regulates
R8697 T12807 T12804 arg1Of regulates,by
R8698 T12812 T12807 arg2Of genes,regulates
R8699 T12812 T12808 arg1Of genes,the
R8700 T12812 T12809 arg1Of genes,other
R8701 T12812 T12810 arg1Of genes,embryonic
R8702 T12812 T12811 arg1Of genes,globin
R8446 T12563 T12562 arg2Of βh1,and
R8447 T12564 T12560 arg3Of ),(
R8448 T12565 T12566 arg1Of are,also
R8449 T12565 T12571 arg1Of are,","
R8450 T12565 T12572 arg1Of are,compared
R8451 T12567 T12565 arg2Of higher,are
R8452 T12567 T12568 arg1Of higher,in
R8453 T12570 T12568 arg2Of homozygotes,in
R8454 T12570 T12569 arg1Of homozygotes,p100H
R8455 T12573 T12572 arg2Of with,compared
R8456 T12574 T12573 arg2Of WT,with
R8457 T12576 T12575 arg2Of ɛy,Like
R8458 T12578 T12579 arg1Of levels,of
R8459 T12578 T12583 arg1Of levels,are
R8460 T12578 T12585 arg1Of levels,higher
R8461 T12580 T12581 arg1Of ζ,and
R8462 T12581 T12579 arg2Of and,of
R8463 T12582 T12581 arg2Of βh1,and
R8464 T12583 T12575 arg1Of are,Like
R8465 T12583 T12577 arg1Of are,","
R8466 T12583 T12586 arg1Of are,in
R8467 T12583 T12589 arg1Of are,at
R8468 T12585 T12583 arg2Of higher,are
R8469 T12585 T12584 arg1Of higher,dramatically
R8470 T12588 T12586 arg2Of mice,in
R8471 T12588 T12587 arg1Of mice,mutant
R8472 T12591 T12589 arg2Of dpc,at
R8473 T12591 T12590 arg1Of dpc,15.5
R8474 T12596 T12594 arg2Of globin,unlike
R8475 T12596 T12595 arg1Of globin,ɛy
R8476 T12598 T12599 arg1Of ζ,and
R8477 T12600 T12599 arg2Of βh1,and
R8478 T12601 T12598 arg1Of decline,ζ
R8479 T12601 T12600 arg1Of decline,βh1
R8480 T12601 T12602 arg1Of decline,in
R8481 T12601 T12604 arg1Of decline,by
R8482 T12601 T12612 arg1Of decline,","
R8483 T12601 T12613 arg1Of decline,suggesting
R8484 T12603 T12602 arg2Of expression,in
R8485 T12607 T12604 arg2Of dpc,by
R8486 T12607 T12605 arg1Of dpc,day
R8487 T12607 T12606 arg1Of dpc,18.5
R8488 T12607 T12608 arg1Of dpc,(
R8489 T12609 T12608 arg2Of Figure,(
R8490 T12609 T12610 arg1Of Figure,1
R8566 T12680 T12678 arg3Of ],[
R8567 T12681 T12682 arg1Of We,examined
R8568 T12681 T12703 arg1Of We,detected
R8569 T12682 T12702 arg1Of examined,and
R8570 T12686 T12682 arg2Of sample,examined
R8571 T12686 T12683 arg1Of sample,a
R8572 T12686 T12684 arg1Of sample,single
R8573 T12686 T12685 arg1Of sample,archived
R8574 T12686 T12687 arg1Of sample,of
R8575 T12686 T12694 arg1Of sample,on
R8576 T12689 T12687 arg2Of RNA,of
R8577 T12689 T12688 arg1Of RNA,liver
R8578 T12689 T12690 arg1Of RNA,from
R8579 T12693 T12690 arg2Of mouse,from
R8580 T12693 T12691 arg1Of mouse,a
R8581 T12693 T12692 arg1Of mouse,mutant
R8582 T12696 T12694 arg2Of day,on
R8583 T12696 T12695 arg1Of day,postnatal
R8584 T12696 T12697 arg1Of day,13.5
R8585 T12696 T12698 arg1Of day,for
R8586 T12701 T12698 arg2Of expression,for
R8587 T12701 T12699 arg1Of expression,globin
R8588 T12701 T12700 arg1Of expression,gene
R8589 T12703 T12702 arg2Of detected,and
R8590 T12703 T12709 arg1Of detected,in
R8591 T12703 T12713 arg1Of detected,","
R8592 T12703 T12714 arg1Of detected,compared
R8593 T12705 T12703 arg2Of levels,detected
R8594 T12705 T12704 arg1Of levels,high
R8595 T12705 T12706 arg1Of levels,of
R8596 T12708 T12706 arg2Of globin,of
R8597 T12708 T12707 arg1Of globin,ɛy
R8598 T12712 T12709 arg2Of sample,in
R8599 T12712 T12710 arg1Of sample,this
R8600 T12712 T12711 arg1Of sample,RNA
R8601 T12715 T12714 arg2Of with,compared
R8602 T12718 T12715 arg2Of RNA,with
R8603 T12718 T12716 arg1Of RNA,undetectable
R8604 T12718 T12717 arg1Of RNA,ɛy
R8605 T12718 T12719 arg1Of RNA,in
R8606 T12722 T12719 arg2Of mice,in
R8607 T12722 T12720 arg1Of mice,WT
R8608 T12722 T12721 arg1Of mice,control
R8609 T12725 T12723 arg2Of point,At
R8610 T12725 T12724 arg1Of point,this
R8611 T12725 T12726 arg1Of point,in
R8612 T12727 T12726 arg2Of development,in
R8613 T12730 T12729 arg1Of levels,the
R8614 T12730 T12731 arg1Of levels,of
R8615 T12730 T12736 arg1Of levels,were
R8616 T12730 T12737 arg1Of levels,undetectable
R8617 T12732 T12733 arg1Of ζ,and
R8618 T12733 T12731 arg2Of and,of
R8619 T12735 T12733 arg2Of RNA,and
R8620 T12735 T12734 arg1Of RNA,βh1
R8621 T12736 T12723 arg1Of were,At
R8622 T12736 T12728 arg1Of were,","
R8623 T12736 T12743 arg1Of were,;
R8624 T12737 T12736 arg2Of undetectable,were
R8625 T12737 T12739 arg1Of undetectable,in
R8626 T12739 T12738 arg1Of in,both
R8627 T12740 T12741 arg1Of mutant,and
R8628 T12741 T12739 arg2Of and,in
R8629 T12742 T12741 arg2Of WT,and
R8630 T12750 T12746 arg1Of levels,adult
R8631 T12750 T12747 arg1Of levels,β-like
R8632 T12750 T12748 arg1Of levels,globin
R8633 T12750 T12749 arg1Of levels,RNA
R8634 T12750 T12751 arg1Of levels,were
R8635 T12750 T12753 arg1Of levels,elevated
R8636 T12751 T12743 arg2Of were,;
R8637 T12751 T12744 arg1Of were,however
R8638 T12751 T12745 arg1Of were,","
R8639 T12751 T12758 arg1Of were,compared
R8640 T12753 T12751 arg2Of elevated,were
R8716 T12826 T12829 arg1Of delay,in
R8717 T12828 T12827 arg2Of enucleation/maturation,in
R8718 T12832 T12829 arg2Of mice,in
R8719 T12832 T12830 arg1Of mice,p100H
R8720 T12832 T12831 arg1Of mice,mutant
R8721 T12833 T12834 arg1Of This,may
R8722 T12833 T12835 arg1Of This,be
R8723 T12835 T12834 arg2Of be,may
R8724 T12837 T12835 arg2Of result,be
R8725 T12837 T12836 arg1Of result,the
R8726 T12837 T12838 arg1Of result,of
R8727 T12840 T12838 arg2Of effects,of
R8728 T12840 T12839 arg1Of effects,indirect
R8729 T12840 T12841 arg1Of effects,","
R8730 T12840 T12843 arg1Of effects,as
R8731 T12843 T12842 arg1Of as,such
R8732 T12845 T12844 arg1Of proliferation,stress-induced
R8733 T12845 T12846 arg1Of proliferation,(
R8734 T12845 T12852 arg1Of proliferation,and/or
R8735 T12847 T12846 arg2Of resulting,(
R8736 T12847 T12848 arg1Of resulting,from
R8737 T12850 T12848 arg2Of defects,from
R8738 T12850 T12849 arg1Of defects,cardiac
R8739 T12851 T12846 arg3Of ),(
R8740 T12852 T12843 arg2Of and/or,as
R8741 T12853 T12852 arg2Of anemia,and/or
R8742 T12855 T12854 arg1Of anemia,Severe
R8743 T12855 T12856 arg1Of anemia,can
R8744 T12855 T12857 arg1Of anemia,lead
R8745 T12857 T12856 arg2Of lead,can
R8746 T12857 T12858 arg1Of lead,to
R8747 T12860 T12859 arg1Of premature,rapid
R8748 T12861 T12858 arg2Of release,to
R8749 T12861 T12860 arg1Of release,premature
R8750 T12861 T12862 arg1Of release,of
R8751 T12861 T12865 arg1Of release,","
R8752 T12861 T12866 arg1Of release,prior
R8753 T12864 T12862 arg2Of cells,of
R8703 T12816 T12813 arg2Of elucidated,remains
R8704 T12816 T12814 arg1Of elucidated,to
R8705 T12816 T12815 arg2Of elucidated,be
R8706 T12817 T12818 arg1Of Sox6,has
R8707 T12820 T12818 arg2Of effects,has
R8708 T12820 T12819 arg1Of effects,other
R8709 T12820 T12821 arg1Of effects,in
R8710 T12820 T12823 arg1Of effects,","
R8711 T12820 T12824 arg1Of effects,including
R8712 T12822 T12821 arg2Of erythropoiesis,in
R8713 T12826 T12824 arg2Of delay,including
R8714 T12826 T12825 arg1Of delay,a
R8715 T12826 T12827 arg1Of delay,in
R8791 T12902 T12901 arg1Of explain,to
R8792 T12904 T12902 arg2Of extent,explain
R8793 T12904 T12903 arg1Of extent,the
R8794 T12904 T12905 arg1Of extent,of
R8795 T12908 T12905 arg2Of cells,of
R8796 T12908 T12906 arg1Of cells,nucleated
R8797 T12908 T12907 arg1Of cells,red
R8798 T12912 T12911 arg1Of itself,Sox6
R8799 T12912 T12913 arg1Of itself,may
R8800 T12912 T12914 arg1Of itself,play
R8801 T12914 T12909 arg1Of play,Alternatively
R8802 T12914 T12910 arg1Of play,","
R8803 T12914 T12913 arg2Of play,may
R8804 T12914 T12917 arg1Of play,in
R8805 T12914 T12922 arg1Of play,","
R8806 T12914 T12923 arg1Of play,as
R8807 T12916 T12914 arg2Of role,play
R8808 T12916 T12915 arg1Of role,a
R8809 T12921 T12917 arg2Of differentiation,in
R8810 T12921 T12918 arg1Of differentiation,red
R8811 T12921 T12919 arg1Of differentiation,cell
R8812 T12921 T12920 arg1Of differentiation,terminal
R8813 T12924 T12925 arg1Of it,has
R8814 T12924 T12926 arg1Of it,been
R8815 T12924 T12927 arg2Of it,shown
R8816 T12924 T12929 arg1Of it,be
R8817 T12927 T12923 arg2Of shown,as
R8818 T12927 T12925 arg2Of shown,has
R8819 T12927 T12926 arg2Of shown,been
R8820 T12929 T12927 arg3Of be,shown
R8821 T12929 T12928 arg1Of be,to
R8822 T12932 T12929 arg2Of factor,be
R8823 T12932 T12930 arg1Of factor,an
R8824 T12932 T12931 arg1Of factor,important
R8825 T12932 T12933 arg1Of factor,in
R8826 T12934 T12935 arg1Of cardiac,[
R8827 T12934 T12938 arg1Of cardiac,","
R8828 T12936 T12935 arg2Of 15,[
R8829 T12937 T12935 arg3Of ],[
R8830 T12938 T12943 arg1Of ",",","
R8831 T12939 T12938 arg2Of neuronal,","
R8832 T12939 T12940 arg1Of neuronal,[
R8833 T12941 T12940 arg2Of 10,[
R8834 T12942 T12940 arg3Of ],[
R8835 T12943 T12949 arg1Of ",",and
R8836 T12944 T12943 arg2Of astrocytic,","
R8837 T12944 T12945 arg1Of astrocytic,[
R8838 T12946 T12945 arg2Of 11,[
R8839 T12947 T12945 arg3Of ],[
R8840 T12949 T12933 arg2Of and,in
R8841 T12949 T12948 arg1Of and,","
R8842 T12952 T12949 arg2Of programs,and
R8843 T12952 T12950 arg1Of programs,cartilage
R8844 T12952 T12951 arg1Of programs,differentiation
R8845 T12952 T12953 arg1Of programs,[
R8846 T12954 T12953 arg2Of "32,41–44",[
R8847 T12955 T12953 arg3Of ],[
R8848 T12957 T12956 arg1Of restoration,The
R8849 T12957 T12958 arg1Of restoration,of
R8850 T12957 T12964 arg1Of restoration,in
R8851 T12957 T12971 arg1Of restoration,may
R8852 T12957 T12972 arg1Of restoration,result
R8853 T12960 T12958 arg2Of enucleation,of
R8854 T12960 T12959 arg1Of enucleation,normal
R8855 T12960 T12961 arg1Of enucleation,of
R8856 T12963 T12961 arg2Of cells,of
R8857 T12963 T12962 arg1Of cells,red
R8858 T12966 T12964 arg2Of mouse,in
R8859 T12966 T12965 arg1Of mouse,Sox6-deficient
R8860 T12966 T12967 arg1Of mouse,by
R8861 T12969 T12967 arg2Of day,by
R8862 T12969 T12968 arg1Of day,postnatal
R8863 T12969 T12970 arg1Of day,10.5
R8864 T12972 T12971 arg2Of result,may
R8865 T12972 T12973 arg1Of result,from
R9016 T13125 T13122 arg1Of complex,a
R9017 T13125 T13123 arg1Of complex,larger
R9018 T13125 T13124 arg1Of complex,repression
R9019 T13128 T13127 arg1Of Sox6,murine
R9020 T13128 T13129 arg1Of Sox6,and
R9021 T13129 T13133 arg1Of and,are
R9022 T13129 T13136 arg1Of and,identical
R9023 T13132 T13129 arg2Of counterpart,and
R9024 T13132 T13130 arg1Of counterpart,its
R9025 T13132 T13131 arg1Of counterpart,human
R9026 T13133 T13126 arg2Of are,Because
R9027 T13135 T13134 arg1Of %,94
R9028 T13136 T13133 arg2Of identical,are
R9029 T13136 T13135 arg1Of identical,%
R9030 T13136 T13137 arg1Of identical,at
R9031 T13141 T13137 arg2Of level,at
R9032 T13141 T13138 arg1Of level,the
R9033 T13141 T13139 arg1Of level,amino
R9034 T13141 T13140 arg1Of level,acid
R9035 T13141 T13142 arg1Of level,[
R9036 T13143 T13142 arg2Of 48,[
R9037 T13144 T13142 arg3Of ],[
R9038 T13147 T13126 arg1Of is,Because
R9039 T13147 T13145 arg1Of is,","
R9040 T13148 T13147 arg2Of possible,is
R9041 T13151 T13150 arg1Of Sox6,human
R9042 T13151 T13152 arg1Of Sox6,may
R9043 T13151 T13154 arg1Of Sox6,be
R9044 T13151 T13155 arg1Of Sox6,important
R9045 T13154 T13146 arg1Of be,it
R9046 T13154 T13147 arg1Of be,is
R9047 T13154 T13148 arg1Of be,possible
R9048 T13154 T13149 arg1Of be,that
R9049 T13154 T13152 arg2Of be,may
R9050 T13154 T13153 arg1Of be,also
R9051 T13154 T13156 arg1Of be,in
R9052 T13155 T13154 arg2Of important,be
R9053 T13160 T13156 arg2Of silencing,in
R9054 T13160 T13157 arg1Of silencing,human
R8754 T12864 T12863 arg1Of cells,red
R8755 T12866 T12867 arg1Of prior,to
R8756 T12870 T12867 arg2Of maturation,to
R8757 T12870 T12868 arg1Of maturation,their
R8758 T12870 T12869 arg1Of maturation,complete
R8759 T12874 T12873 arg1Of hematocrit,the
R8760 T12874 T12875 arg1Of hematocrit,of
R8761 T12874 T12879 arg1Of hematocrit,is
R8762 T12874 T12883 arg1Of hematocrit,lower
R8763 T12878 T12875 arg2Of mice,of
R8764 T12878 T12876 arg1Of mice,18.5-dpc
R8765 T12878 T12877 arg1Of mice,mutant
R8766 T12879 T12871 arg1Of is,However
R8767 T12879 T12872 arg1Of is,","
R8768 T12879 T12893 arg1Of is,and
R8769 T12881 T12880 arg1Of 20,only
R8770 T12882 T12881 arg1Of %,20
R8771 T12883 T12879 arg2Of lower,is
R8772 T12883 T12882 arg1Of lower,%
R8773 T12883 T12884 arg1Of lower,than
R8774 T12885 T12884 arg2Of that,than
R8775 T12885 T12886 arg1Of that,of
R8776 T12887 T12886 arg2Of WT,of
R8777 T12887 T12888 arg1Of WT,(
R8778 T12890 T12888 arg2Of data,(
R8779 T12890 T12889 arg1Of data,unpublished
R8780 T12891 T12888 arg3Of ),(
R8781 T12893 T12892 arg1Of and,","
R8782 T12896 T12894 arg1Of anemia,this
R8783 T12896 T12895 arg1Of anemia,mild
R8784 T12896 T12897 arg1Of anemia,is
R8785 T12896 T12900 arg1Of anemia,sufficient
R8786 T12897 T12893 arg2Of is,and
R8787 T12897 T12898 arg1Of is,probably
R8788 T12897 T12899 arg1Of is,not
R8789 T12900 T12897 arg2Of sufficient,is
R8790 T12902 T12900 arg2Of explain,sufficient
R8866 T12972 T12987 arg1Of result,","
R8867 T12972 T12988 arg1Of result,since
R8868 T12975 T12973 arg2Of compensation,from
R8869 T12975 T12974 arg1Of compensation,functional
R8870 T12975 T12976 arg1Of compensation,of
R8871 T12975 T12980 arg1Of compensation,(
R8872 T12979 T12976 arg2Of proteins,of
R8873 T12979 T12977 arg1Of proteins,other
R8874 T12979 T12978 arg1Of proteins,Sox
R8875 T12981 T12980 arg2Of expressed,(
R8876 T12981 T12982 arg1Of expressed,at
R8877 T12985 T12982 arg2Of stages,at
R8878 T12985 T12983 arg1Of stages,later
R8879 T12985 T12984 arg1Of stages,developmental
R8880 T12986 T12980 arg3Of ),(
R8881 T12990 T12989 arg1Of redundancy,functional
R8882 T12990 T12991 arg1Of redundancy,is
R8883 T12991 T12988 arg2Of is,since
R8884 T12994 T12991 arg2Of theme,is
R8885 T12994 T12992 arg1Of theme,a
R8886 T12994 T12993 arg1Of theme,recurring
R8887 T12994 T12995 arg1Of theme,with
R8888 T12997 T12995 arg2Of proteins,with
R8889 T12997 T12996 arg1Of proteins,Sox
R8890 T12997 T12998 arg1Of proteins,[
R8891 T12999 T12998 arg2Of "13,45,46",[
R8892 T13000 T12998 arg3Of ],[
R8893 T13003 T13004 arg1Of erythropoiesis,has
R8894 T13003 T13006 arg1Of erythropoiesis,shifted
R8895 T13006 T13001 arg1Of shifted,Moreover
R8896 T13006 T13002 arg1Of shifted,","
R8897 T13006 T13004 arg2Of shifted,has
R8898 T13006 T13005 arg1Of shifted,already
R8899 T13006 T13007 arg1Of shifted,from
R8900 T13009 T13007 arg2Of liver,from
R8901 T13009 T13008 arg1Of liver,fetal
R8902 T13009 T13010 arg1Of liver,to
R8903 T13012 T13010 arg2Of marrow,to
R8904 T13012 T13011 arg1Of marrow,bone
R8905 T13012 T13013 arg1Of marrow,by
R8906 T13015 T13013 arg2Of day,by
R8907 T13015 T13014 arg1Of day,postnatal
R8908 T13015 T13016 arg1Of day,10.5
R8909 T13019 T13017 arg1Of change,The
R8910 T13019 T13018 arg1Of change,accompanying
R8911 T13019 T13020 arg1Of change,in
R8912 T13019 T13027 arg1Of change,may
R8913 T13019 T13028 arg1Of change,permit
R8914 T13022 T13020 arg2Of microenvironment,in
R8915 T13022 T13021 arg1Of microenvironment,the
R8916 T13022 T13023 arg1Of microenvironment,of
R8917 T13026 T13023 arg2Of production,of
R8918 T13026 T13024 arg1Of production,red
R8919 T13026 T13025 arg1Of production,cell
R8920 T13028 T13027 arg2Of permit,may
R8921 T13030 T13028 arg2Of enucleation,permit
R8922 T13030 T13029 arg1Of enucleation,normal
R8923 T13031 T13032 arg1Of Identification,of
R8924 T13031 T13041 arg1Of Identification,will
R8925 T13031 T13042 arg1Of Identification,shed
R8926 T13036 T13033 arg1Of genes,Sox6
R8927 T13036 T13034 arg1Of genes,downstream
R8928 T13036 T13035 arg1Of genes,target
R8929 T13036 T13037 arg1Of genes,and
R8930 T13037 T13032 arg2Of and,of
R8931 T13040 T13037 arg2Of proteins,and
R8932 T13040 T13038 arg1Of proteins,its
R8933 T13040 T13039 arg1Of proteins,interacting
R8934 T13042 T13041 arg2Of shed,will
R8935 T13042 T13044 arg1Of shed,on
R8936 T13043 T13042 arg2Of light,shed
R8937 T13046 T13044 arg2Of role,on
R8938 T13046 T13045 arg1Of role,the
R8939 T13046 T13047 arg1Of role,of
R8940 T13046 T13049 arg1Of role,in
R8941 T13048 T13047 arg2Of Sox6,of
R8942 T13053 T13050 arg1Of differentiation,red
R8943 T13053 T13051 arg1Of differentiation,cell
R8944 T13053 T13052 arg1Of differentiation,terminal
R8945 T13053 T13054 arg1Of differentiation,and
R8946 T13054 T13049 arg2Of and,in
R8947 T13057 T13054 arg2Of process,and
R8948 T13057 T13055 arg1Of process,the
R8949 T13057 T13056 arg1Of process,enucleation
R8950 T13061 T13060 arg1Of vivo,in
R8951 T13061 T13062 arg1Of vivo,and
R8952 T13064 T13062 arg2Of vitro,and
R8953 T13064 T13063 arg1Of vitro,in
R8954 T13065 T13061 arg1Of analyses,vivo
R8955 T13065 T13064 arg1Of analyses,vitro
R8956 T13065 T13066 arg1Of analyses,suggest
R8957 T13066 T13058 arg1Of suggest,Recently
R8958 T13066 T13059 arg1Of suggest,","
R8959 T13068 T13069 arg1Of reactivation,of
R8960 T13068 T13072 arg1Of reactivation,would
R8961 T13068 T13073 arg1Of reactivation,be
R8962 T13068 T13075 arg1Of reactivation,beneficial
R8963 T13071 T13069 arg2Of ɛ-globin,of
R8964 T13071 T13070 arg1Of ɛ-globin,human
R8965 T13073 T13066 arg2Of be,suggest
R8966 T13073 T13067 arg1Of be,that
R8967 T13073 T13072 arg2Of be,would
R8968 T13073 T13082 arg1Of be,[
R8969 T13073 T13085 arg1Of be,","
R8970 T13073 T13086 modOf be,providing
R8971 T13075 T13073 arg2Of beneficial,be
R8972 T13075 T13074 arg1Of beneficial,therapeutically
R8973 T13075 T13076 arg1Of beneficial,to
R8974 T13077 T13076 arg2Of adults,to
R8975 T13077 T13078 arg1Of adults,with
R8976 T13081 T13078 arg2Of disease,with
R8977 T13081 T13079 arg1Of disease,sickle
R8978 T13081 T13080 arg1Of disease,cell
R8979 T13083 T13082 arg2Of 47,[
R8980 T13084 T13082 arg3Of ],[
R8981 T13088 T13086 arg2Of rationale,providing
R8982 T13088 T13087 arg1Of rationale,a
R8983 T13088 T13089 arg1Of rationale,for
R8984 T13088 T13092 arg1Of rationale,into
R8985 T13091 T13089 arg2Of investigations,for
R8986 T13091 T13090 arg1Of investigations,detailed
R9055 T13160 T13158 arg1Of silencing,ɛ
R9056 T13160 T13159 arg1Of silencing,globin
R9057 T13161 T13162 arg1Of There,is
R9058 T13162 T13175 arg1Of is,and
R9059 T13165 T13162 arg2Of homology,is
R9060 T13165 T13163 arg1Of homology,significant
R9061 T13165 T13164 arg1Of homology,sequence
R9062 T13165 T13166 arg1Of homology,between
R9063 T13173 T13166 arg2Of regions,between
R9064 T13173 T13167 arg1Of regions,the
R9065 T13173 T13168 arg1Of regions,human
R9066 T13173 T13169 arg1Of regions,and
R9067 T13173 T13170 arg1Of regions,mouse
R9068 T13173 T13171 arg1Of regions,ɛ
R9069 T13173 T13172 arg1Of regions,promoter
R9070 T13175 T13174 arg1Of and,","
R9071 T13178 T13176 arg1Of promoter,the
R9072 T13178 T13177 arg1Of promoter,human
R9073 T13178 T13179 arg1Of promoter,contains
R9074 T13179 T13175 arg2Of contains,and
R9075 T13182 T13180 arg1Of two,at
R9076 T13182 T13181 arg1Of two,least
R9077 T13186 T13179 arg2Of sites,contains
R9078 T13186 T13182 arg1Of sites,two
R9079 T13186 T13183 arg1Of sites,potential
R9080 T13186 T13184 arg1Of sites,Sox6
R9081 T13186 T13185 arg1Of sites,binding
R9082 T13190 T13189 arg1Of existence,the
R9083 T13190 T13191 arg1Of existence,of
R9084 T13190 T13200 arg1Of existence,has
R9085 T13190 T13201 arg1Of existence,been
R9086 T13190 T13202 arg2Of existence,proposed
R9087 T13193 T13191 arg2Of silencer,of
R9088 T13193 T13192 arg1Of silencer,a
R9089 T13193 T13194 arg1Of silencer,of
R9090 T13199 T13194 arg2Of gene,of
R11081 T16074 T16073 arg1Of construction,Plasmid
R11082 T16080 T16075 arg1Of plasmid,The
R11083 T16080 T16076 arg1Of plasmid,ɛy
R11084 T16080 T16077 arg1Of plasmid,promoter
R11085 T16080 T16078 arg1Of plasmid,deletion
R11086 T16080 T16079 arg1Of plasmid,reporter
R11087 T16080 T16081 arg1Of plasmid,(
R11088 T16080 T16084 arg1Of plasmid,was
R11089 T16080 T16085 arg2Of plasmid,generated
R11090 T16082 T16081 arg2Of E-luc,(
R11091 T16083 T16081 arg3Of ),(
R11092 T16085 T16084 arg2Of generated,was
R11093 T16088 T16085 arg1Of amplification,generated
R11094 T16088 T16086 arg2Of amplification,by
R11095 T16088 T16087 arg1Of amplification,PCR
R11096 T16088 T16089 arg1Of amplification,of
R11097 T16093 T16089 arg2Of promoter,of
R11098 T16093 T16090 arg1Of promoter,the
R11099 T16093 T16091 arg1Of promoter,ɛy
R11100 T16093 T16092 arg1Of promoter,proximal
R11101 T16096 T16094 arg1Of fragment,A
R11102 T16096 T16095 arg1Of fragment,2.2-kb
R11103 T16096 T16097 arg1Of fragment,upstream
R11104 T16096 T16107 arg1Of fragment,was
R11105 T16096 T16108 arg2Of fragment,used
R11106 T16097 T16098 arg1Of upstream,of
R11107 T16103 T16098 arg2Of codon,of
R11108 T16103 T16099 arg1Of codon,the
R11109 T16103 T16100 arg1Of codon,ɛy
R11110 T16103 T16101 arg1Of codon,globin
R11111 T16103 T16102 arg1Of codon,initiation
R11112 T16103 T16104 arg1Of codon,(
R11113 T16105 T16104 arg2Of ATG,(
R11114 T16106 T16104 arg3Of ),(
R11115 T16108 T16107 arg2Of used,was
R11116 T16108 T16109 arg1Of used,","
R11117 T16108 T16110 arg1Of used,because
R11118 T16111 T16112 arg1Of it,has
R11119 T16111 T16113 arg1Of it,been
R11120 T16111 T16114 arg2Of it,shown
R11121 T16114 T16110 arg2Of shown,because
R11122 T16114 T16112 arg2Of shown,has
R11123 T16114 T16113 arg2Of shown,been
R11124 T16117 T16116 arg1Of sequences,all
R11125 T16117 T16118 arg2Of sequences,required
R11126 T16117 T16123 arg1Of sequences,are
R11127 T16117 T16124 arg1Of sequences,located
R11128 T16118 T16119 arg1Of required,for
R11129 T16122 T16119 arg2Of silencing,for
R11130 T16122 T16120 arg1Of silencing,ɛ
R11131 T16122 T16121 arg1Of silencing,gene
R11132 T16123 T16114 arg3Of are,shown
R11133 T16123 T16115 arg1Of are,that
R11134 T16124 T16123 arg2Of located,are
R11135 T16124 T16125 arg1Of located,within
R11211 T16201 T16200 arg1Of Basic,pGL3
R11212 T16203 T16204 arg1Of Promega,","
R11213 T16204 T16206 arg1Of ",",","
R11214 T16205 T16204 arg2Of Madison,","
R11215 T16206 T16208 arg1Of ",",","
R11216 T16207 T16206 arg2Of Wisconsin,","
R11217 T16208 T16199 arg2Of ",",in
R11218 T16208 T16201 arg1Of ",",Basic
R11219 T16208 T16202 arg2Of ",",(
R11220 T16210 T16208 arg2Of States,","
R11221 T16210 T16209 arg1Of States,United
R11222 T16211 T16202 arg3Of ),(
R11223 T16215 T16212 arg1Of fragment,A
R11224 T16215 T16213 arg1Of fragment,2.5-kb
R11225 T16215 T16214 arg1Of fragment,SstI/XhoI
R11226 T16215 T16216 arg1Of fragment,of
R11227 T16215 T16219 arg1Of fragment,(
R11228 T16215 T16227 arg1Of fragment,was
R11229 T16215 T16229 arg2Of fragment,inserted
R11230 T16217 T16216 arg2Of μLCRβ,of
R11231 T16217 T16218 arg1Of μLCRβ,9.3
R11232 T16221 T16220 arg1Of LCR,micro
R11233 T16221 T16222 arg1Of LCR,;
R11234 T16222 T16219 arg2Of ;,(
R11235 T16224 T16222 arg2Of 31,;
R11236 T16224 T16223 arg2Of 31,[
R11237 T16225 T16223 arg3Of ],[
R11238 T16226 T16219 arg3Of ),(
R11239 T16229 T16227 arg2Of inserted,was
R11240 T16229 T16228 arg1Of inserted,then
R11241 T16229 T16230 arg1Of inserted,upstream
R11242 T16229 T16235 arg1Of inserted,in
R11243 T16229 T16241 arg1Of inserted,","
R11244 T16229 T16242 modOf inserted,resulting
R11245 T16230 T16231 arg1Of upstream,of
R11246 T16234 T16231 arg2Of promoter,of
R8987 T13095 T13092 arg2Of basis,into
R8988 T13095 T13093 arg1Of basis,the
R8989 T13095 T13094 arg1Of basis,molecular
R8990 T13095 T13096 arg1Of basis,of
R8991 T13099 T13096 arg2Of silencing,of
R8992 T13099 T13097 arg1Of silencing,ɛ-globin
R8993 T13099 T13098 arg1Of silencing,gene
R8994 T13102 T13100 arg1Of study,The
R8995 T13102 T13101 arg1Of study,present
R8996 T13102 T13103 arg1Of study,identifies
R8997 T13106 T13103 arg2Of repressor,identifies
R8998 T13106 T13104 arg1Of repressor,a
R8999 T13106 T13105 arg1Of repressor,novel
R9000 T13106 T13107 arg1Of repressor,","
R9001 T13106 T13109 arg1Of repressor,","
R9002 T13106 T13110 arg1Of repressor,which
R9003 T13106 T13111 arg1Of repressor,binds
R9004 T13108 T13107 arg2Of Sox6,","
R9005 T13111 T13112 arg1Of binds,to
R9006 T13111 T13117 arg1Of binds,","
R9007 T13111 T13118 arg1Of binds,potentially
R9008 T13111 T13119 arg1Of binds,as
R9009 T13116 T13112 arg2Of promoter,to
R9010 T13116 T13113 arg1Of promoter,the
R9011 T13116 T13114 arg1Of promoter,ɛy
R9012 T13116 T13115 arg1Of promoter,proximal
R9013 T13120 T13119 arg2Of part,as
R9014 T13120 T13121 arg1Of part,of
R9015 T13125 T13121 arg2Of complex,of
R9091 T13199 T13195 arg1Of gene,the
R9092 T13199 T13196 arg1Of gene,human
R9093 T13199 T13197 arg1Of gene,ɛ
R9094 T13199 T13198 arg1Of gene,globin
R9095 T13202 T13187 arg1Of proposed,Indeed
R9096 T13202 T13188 arg1Of proposed,","
R9097 T13202 T13200 arg2Of proposed,has
R9098 T13202 T13201 arg2Of proposed,been
R9099 T13202 T13203 arg1Of proposed,[
R9100 T13204 T13203 arg2Of "49,50",[
R9101 T13205 T13203 arg3Of ],[
R9102 T13208 T13209 arg1Of elucidation,of
R9103 T13208 T13214 arg1Of elucidation,and
R9104 T13213 T13209 arg2Of mechanism,of
R9105 T13213 T13210 arg1Of mechanism,the
R9106 T13213 T13211 arg1Of mechanism,Sox6
R9107 T13213 T13212 arg1Of mechanism,repression
R9108 T13214 T13223 arg1Of and,may
R9109 T13214 T13224 arg1Of and,further
R9110 T13214 T13233 arg1Of and,reveal
R9111 T13214 T13245 arg1Of and,β
R9112 T13215 T13214 arg2Of identification,and
R9113 T13215 T13216 arg1Of identification,of
R9114 T13218 T13216 arg2Of components,of
R9115 T13218 T13217 arg1Of components,other
R9116 T13218 T13219 arg1Of components,of
R9117 T13222 T13219 arg2Of complex,of
R9119 T13222 T13220 arg1Of complex,the
R9120 T13222 T13221 arg1Of complex,Sox6-containing
R9121 T13224 T13223 arg2Of further,may
R9122 T13224 T13231 arg1Of further,and
R9123 T13226 T13224 arg2Of understanding,further
R9125 T13226 T13225 arg1Of understanding,our
R9126 T13226 T13227 arg1Of understanding,of
R9127 T13230 T13227 arg2Of regulation,of
R9128 T13230 T13228 arg1Of regulation,ɛ
R9129 T13230 T13229 arg1Of regulation,globin
R9130 T13231 T13206 arg1Of and,Thus
R9131 T13231 T13207 arg1Of and,","
R9132 T13233 T13244 arg1Of reveal,and
R9133 T13236 T13233 arg2Of targets,reveal
R9134 T13236 T13234 arg1Of targets,additional
R9135 T13236 T13235 arg1Of targets,molecular
R9136 T13236 T13237 arg1Of targets,for
R9137 T13239 T13237 arg2Of treatment,for
R9138 T13239 T13238 arg1Of treatment,the
R9139 T13239 T13240 arg1Of treatment,of
R9140 T13243 T13240 arg2Of anemia,of
R9141 T13243 T13241 arg1Of anemia,sickle
R9142 T13243 T13242 arg1Of anemia,cell
R9143 T13244 T13231 arg2Of and,and
R9144 T13244 T13232 arg1Of and,potentially
R9145 T13245 T13244 arg2Of β,and
R9146 T13246 T13245 arg2Of thalassemias,β
R11136 T16129 T16125 arg2Of fragment,within
R11137 T16129 T16126 arg1Of fragment,a
R11138 T16129 T16127 arg1Of fragment,3.7-kb
R11139 T16129 T16128 arg1Of fragment,EcoRI
R11140 T16129 T16130 arg1Of fragment,containing
R11141 T16130 T16144 arg1Of containing,[
R11142 T16132 T16131 arg1Of 2,about
R11143 T16133 T16130 arg2Of kb,containing
R11144 T16133 T16132 arg1Of kb,2
R11145 T16133 T16134 arg1Of kb,of
R11146 T16133 T16136 arg1Of kb,upstream
R11147 T16135 T16134 arg2Of sequence,of
R11148 T16136 T16137 arg1Of upstream,of
R11149 T16143 T16137 arg2Of site,of
R11150 T16143 T16138 arg1Of site,the
R11151 T16143 T16139 arg1Of site,ɛ
R11152 T16143 T16140 arg1Of site,globin
R11153 T16143 T16141 arg1Of site,gene
R11154 T16143 T16142 arg1Of site,cap
R11155 T16145 T16144 arg2Of 50,[
R11156 T16146 T16144 arg3Of ],[
R11157 T16148 T16147 arg1Of numbering,Nucleotide
R11158 T16148 T16149 arg1Of numbering,is
R11159 T16148 T16150 arg1Of numbering,relative
R11160 T16150 T16149 arg2Of relative,is
R11161 T16150 T16151 arg1Of relative,to
R11162 T16155 T16151 arg2Of site,to
R11163 T16155 T16152 arg1Of site,the
R11164 T16155 T16153 arg1Of site,transcription
R11165 T16155 T16154 arg1Of site,start
R11166 T16159 T16156 arg1Of site,The
R11167 T16159 T16157 arg1Of site,transcriptional
R11168 T16159 T16158 arg1Of site,start
R11169 T16159 T16160 arg1Of site,is
R11170 T16159 T16161 arg2Of site,based
R11171 T16161 T16160 arg2Of based,is
R11172 T16161 T16162 arg1Of based,on
R11173 T16165 T16162 arg2Of cDNA,on
R11174 T16165 T16163 arg1Of cDNA,the
R11175 T16165 T16164 arg1Of cDNA,longest
R11176 T16165 T16166 arg1Of cDNA,in
R11177 T16168 T16169 arg1Of Fantom,(
R11178 T16171 T16169 arg2Of Annotation,(
R11179 T16171 T16170 arg1Of Annotation,Functional
R11180 T16171 T16172 arg1Of Annotation,of
R11181 T16173 T16172 arg2Of Mouse,of
R11182 T16174 T16169 arg3Of ),(
R11183 T16175 T16166 arg2Of database,in
R11184 T16175 T16167 arg1Of database,the
R11185 T16175 T16168 arg1Of database,Fantom
R11186 T16178 T16176 arg1Of primers,The
R11187 T16178 T16177 arg1Of primers,PCR
R11188 T16178 T16179 arg1Of primers,contained
R11189 T16180 T16181 arg1Of XhoI,and
R11190 T16182 T16181 arg2Of HindIII,and
R11191 T16183 T16179 arg2Of sites,contained
R11192 T16183 T16180 arg1Of sites,XhoI
R11193 T16183 T16182 arg1Of sites,HindIII
R11194 T16183 T16184 arg1Of sites,that
R11195 T16183 T16185 arg1Of sites,were
R11196 T16183 T16186 arg2Of sites,used
R11197 T16186 T16185 arg2Of used,were
R11198 T16188 T16186 arg3Of clone,used
R11199 T16188 T16187 arg1Of clone,to
R11200 T16188 T16193 arg1Of clone,upstream
R11201 T16192 T16188 arg2Of fragment,clone
R11202 T16192 T16189 arg1Of fragment,the
R11203 T16192 T16190 arg1Of fragment,ɛy
R11204 T16192 T16191 arg1Of fragment,promoter
R11205 T16193 T16194 arg1Of upstream,of
R11206 T16198 T16194 arg2Of gene,of
R11207 T16198 T16195 arg1Of gene,the
R11208 T16198 T16196 arg1Of gene,firefly
R11209 T16198 T16197 arg1Of gene,luciferase
R11210 T16198 T16199 arg1Of gene,in
R11247 T16234 T16232 arg1Of promoter,the
R11248 T16234 T16233 arg1Of promoter,ɛy
R11249 T16239 T16238 arg1Of Basic,pGL3
R11250 T16240 T16235 arg2Of plasmid,in
R11251 T16240 T16236 arg1Of plasmid,the
R11252 T16240 T16237 arg1Of plasmid,above
R11253 T16240 T16239 arg1Of plasmid,Basic
R11254 T16242 T16243 arg1Of resulting,in
R11255 T16246 T16243 arg2Of construct,in
R11256 T16246 T16244 arg1Of construct,a
R11257 T16246 T16245 arg1Of construct,reporter
R11258 T16246 T16247 arg2Of construct,in
R11259 T16246 T16248 arg1Of construct,which
R11260 T16250 T16249 arg1Of expression,luciferase
R11261 T16250 T16251 arg1Of expression,is
R11262 T16250 T16252 arg2Of expression,driven
R11263 T16252 T16247 arg1Of driven,in
R11264 T16252 T16251 arg2Of driven,is
R11265 T16256 T16252 arg1Of promoter,driven
R11266 T16256 T16253 arg2Of promoter,by
R11267 T16256 T16254 arg1Of promoter,the
R11268 T16256 T16255 arg1Of promoter,ɛy
R11269 T16258 T16257 arg1Of series,A
R11270 T16258 T16259 arg1Of series,of
R11271 T16258 T16266 arg1Of series,were
R11272 T16258 T16267 arg2Of series,generated
R11273 T16261 T16259 arg2Of constructs,of
R11274 T16261 T16260 arg1Of constructs,deletion
R11275 T16261 T16262 arg1Of constructs,of
R11276 T16265 T16262 arg2Of promoter,of
R11277 T16265 T16263 arg1Of promoter,the
R11278 T16265 T16264 arg1Of promoter,ɛy
R11279 T16267 T16266 arg2Of generated,were
R11280 T16267 T16268 arg1Of generated,similarly
R11281 T16270 T16269 arg1Of primers,Forward
R11282 T16270 T16271 arg1Of primers,with
R11283 T16270 T16275 arg1Of primers,include
R11284 T16274 T16271 arg2Of site,with
R11285 T16274 T16272 arg1Of site,an
R11361 T16352 T16349 arg2Of +20,(
R11362 T16352 T16350 arg1Of +20,+45
R11363 T16352 T16351 arg1Of +20,to
R11364 T16353 T16349 arg3Of ),(
R11365 T16354 T16355 arg1Of Sox6-pcDNA3.1,[
R11366 T16354 T16358 arg1Of Sox6-pcDNA3.1,was
R11367 T16354 T16359 arg2Of Sox6-pcDNA3.1,used
R11368 T16354 T16361 arg1Of Sox6-pcDNA3.1,overexpress
R11369 T16356 T16355 arg2Of 15,[
R11370 T16357 T16355 arg3Of ],[
R11371 T16359 T16358 arg2Of used,was
R11372 T16361 T16359 arg3Of overexpress,used
R11373 T16361 T16360 arg1Of overexpress,to
R11374 T16362 T16361 arg2Of Sox6,overexpress
R11375 T16365 T16363 arg1Of version,A
R11376 T16365 T16364 arg2Of version,truncated
R11377 T16365 T16366 arg1Of version,of
R11378 T16365 T16379 arg1Of version,was
R11379 T16365 T16380 arg2Of version,generated
R11380 T16370 T16366 arg2Of construct,of
R11381 T16370 T16367 arg1Of construct,the
R11382 T16370 T16368 arg1Of construct,Sox6
R11383 T16370 T16369 arg1Of construct,overexpression
R11384 T16370 T16371 arg1Of construct,(
R11385 T16370 T16374 arg1Of construct,that
R11386 T16370 T16375 arg1Of construct,lacks
R11387 T16372 T16371 arg2Of Sox6-ΔHMG-pcDNA3.1,(
R11388 T16373 T16371 arg3Of ),(
R11389 T16378 T16375 arg2Of domain,lacks
R11390 T16378 T16376 arg1Of domain,the
R11391 T16378 T16377 arg1Of domain,HMG
R11392 T16380 T16379 arg2Of generated,was
R11393 T16380 T16381 arg1Of generated,","
R11394 T16380 T16382 arg1Of generated,as
R11395 T16383 T16382 arg2Of described,as
R11396 T16385 T16383 arg1Of others,described
R11397 T16385 T16384 arg2Of others,by
R11398 T16385 T16386 arg1Of others,[
R11399 T16387 T16386 arg2Of 32,[
R11400 T16388 T16386 arg3Of ],[
R11401 T16389 T16390 arg1Of Mutagenesis,of
R11402 T16389 T16399 arg1Of Mutagenesis,were
R11403 T16389 T16400 arg2Of Mutagenesis,done
R11404 T16394 T16390 arg2Of sites,of
R11405 T16394 T16391 arg1Of sites,Sox/Sox6
R11406 T16394 T16392 arg1Of sites,consensus
R11407 T16394 T16393 arg1Of sites,binding
R11408 T16394 T16395 arg1Of sites,of
R11409 T16398 T16395 arg2Of promoter,of
R11410 T16398 T16396 arg1Of promoter,the
R11411 T16398 T16397 arg1Of promoter,ɛy
R11412 T16400 T16399 arg2Of done,were
R11413 T16402 T16400 arg1Of PCR,done
R11414 T16402 T16401 arg2Of PCR,by
R11415 T16404 T16403 arg1Of primers,Forward
R11416 T16404 T16405 arg2Of primers,used
R11417 T16404 T16414 arg1Of primers,include
R11418 T16407 T16405 arg3Of generate,used
R11419 T16407 T16406 arg1Of generate,to
R11420 T16413 T16407 arg2Of constructs,generate
R11421 T16413 T16408 arg1Of constructs,these
R11422 T16413 T16409 arg2Of constructs,mutagenized
R11423 T16413 T16410 arg1Of constructs,ɛy
R11424 T16413 T16411 arg1Of constructs,promoter
R11425 T16413 T16412 arg1Of constructs,reporter
R11426 T16414 T16415 arg1Of include,:
R11427 T16416 T16414 arg2Of MHB1661,include
R11428 T16416 T16417 arg1Of MHB1661,","
R11429 T16416 T16424 arg1Of MHB1661,;
R11430 T16418 T16417 arg2Of 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′,","
R11431 T16418 T16419 arg1Of 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′,(
R11432 T16422 T16419 arg2Of −19,(
R11433 T16422 T16420 arg1Of −19,−63
R11434 T16422 T16421 arg1Of −19,to
R11286 T16274 T16273 arg1Of site,XhoI
R11287 T16275 T16276 arg1Of include,:
R11288 T16277 T16275 arg2Of MHB1457,include
R11289 T16277 T16278 arg1Of MHB1457,","
R11290 T16277 T16285 arg1Of MHB1457,;
R11291 T16279 T16278 arg2Of 5′CCGCTCGAGTGCTAGGCAAACACTCA3′,","
R11292 T16279 T16280 arg1Of 5′CCGCTCGAGTGCTAGGCAAACACTCA3′,(
R11293 T16283 T16280 arg2Of −2052,(
R11294 T16283 T16281 arg1Of −2052,−2077
R11295 T16283 T16282 arg1Of −2052,to
R11296 T16284 T16280 arg3Of ),(
R11297 T16286 T16285 arg2Of MHB1503,;
R11298 T16286 T16287 arg1Of MHB1503,","
R11299 T16286 T16294 arg1Of MHB1503,;
R11300 T16288 T16287 arg2Of 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′,","
R11301 T16288 T16289 arg1Of 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′,(
R11302 T16292 T16289 arg2Of −605,(
R11303 T16292 T16290 arg1Of −605,−634
R11304 T16292 T16291 arg1Of −605,to
R11305 T16293 T16289 arg3Of ),(
R11306 T16295 T16294 arg2Of MHB1505,;
R11307 T16295 T16296 arg1Of MHB1505,","
R11308 T16295 T16303 arg1Of MHB1505,;
R11309 T16297 T16296 arg2Of 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′,","
R11310 T16297 T16298 arg1Of 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′,(
R11311 T16301 T16298 arg2Of −169,(
R11312 T16301 T16299 arg1Of −169,−197
R11313 T16301 T16300 arg1Of −169,to
R11314 T16302 T16298 arg3Of ),(
R11315 T16304 T16303 arg2Of MHB1506,;
R11316 T16304 T16305 arg1Of MHB1506,","
R11317 T16304 T16312 arg1Of MHB1506,;
R11318 T16306 T16305 arg2Of 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′,","
R11319 T16306 T16307 arg1Of 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′,(
R11320 T16310 T16307 arg2Of −58,(
R11321 T16310 T16308 arg1Of −58,−85
R11322 T16310 T16309 arg1Of −58,to
R11323 T16311 T16307 arg3Of ),(
R11324 T16313 T16314 arg1Of MHB1532,","
R11325 T16313 T16322 arg1Of MHB1532,and
R11326 T16315 T16314 arg2Of 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′,","
R11327 T16315 T16316 arg1Of 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′,(
R11328 T16319 T16316 arg2Of −34,(
R11329 T16319 T16317 arg1Of −34,−63
R11330 T16319 T16318 arg1Of −34,to
R11331 T16320 T16316 arg3Of ),(
R11332 T16322 T16312 arg2Of and,;
R11333 T16322 T16321 arg1Of and,;
R11334 T16323 T16322 arg2Of MHB1507,and
R11335 T16323 T16324 arg1Of MHB1507,","
R11336 T16326 T16324 arg2Of 3′,","
R11337 T16326 T16325 arg1Of 3′,5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC
R11338 T16326 T16327 arg1Of 3′,(
R11339 T16330 T16327 arg2Of −9,(
R11340 T16330 T16328 arg1Of −9,−37
R11341 T16330 T16329 arg1Of −9,to
R11342 T16331 T16327 arg3Of ),(
R11343 T16334 T16332 arg1Of primers,All
R11344 T16334 T16333 arg1Of primers,forward
R11345 T16334 T16335 arg1Of primers,were
R11346 T16334 T16336 arg2Of primers,used
R11347 T16336 T16335 arg2Of used,were
R11348 T16336 T16337 arg1Of used,in
R11349 T16336 T16345 arg1Of used,:
R11350 T16336 T16346 arg1Of used,MHB1477
R11351 T16338 T16337 arg2Of combination,in
R11352 T16338 T16339 arg1Of combination,with
R11353 T16344 T16339 arg2Of site,with
R11354 T16344 T16340 arg1Of site,the
R11355 T16344 T16341 arg1Of site,reverse
R11356 T16344 T16342 arg1Of site,primer
R11357 T16344 T16343 arg1Of site,HindIII
R11358 T16346 T16347 arg1Of MHB1477,","
R11359 T16348 T16347 arg2Of 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′,","
R11360 T16348 T16349 arg1Of 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′,(
R11436 T16425 T16426 arg1Of MHB1662,","
R11437 T16425 T16434 arg1Of MHB1662,and
R11438 T16427 T16426 arg2Of 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′,","
R11439 T16427 T16428 arg1Of 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′,(
R11440 T16431 T16428 arg2Of −16,(
R11441 T16431 T16429 arg1Of −16,−63
R11442 T16431 T16430 arg1Of −16,to
R11443 T16432 T16428 arg3Of ),(
R11444 T16434 T16424 arg2Of and,;
R11445 T16434 T16433 arg1Of and,;
R11446 T16435 T16434 arg2Of MHB1663,and
R11447 T16435 T16436 arg1Of MHB1663,","
R11448 T16438 T16436 arg2Of 3′,","
R11449 T16438 T16437 arg1Of 3′,5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA
R11450 T16438 T16439 arg1Of 3′,(
R11451 T16442 T16439 arg2Of −18,(
R11452 T16442 T16440 arg1Of −18,−63
R11453 T16442 T16441 arg1Of −18,to
R11454 T16443 T16439 arg3Of ),(
R11937 T17191 T17192 arg1Of Quantitation,of
R11938 T17194 T17192 arg2Of mRNA,of
R11939 T17194 T17193 arg1Of mRNA,globin
R11940 T17195 T17196 arg1Of RNA,was
R11941 T17198 T17197 arg1Of reverse,first
R11942 T17201 T17196 arg2Of cDNA,was
R11943 T17201 T17198 arg1Of cDNA,reverse
R11944 T17201 T17199 arg2Of cDNA,transcribed
R11945 T17201 T17200 arg1Of cDNA,to
R11946 T17202 T17203 arg1Of Primers,for
R11947 T17202 T17210 arg1Of Primers,were
R11948 T17202 T17211 arg2Of Primers,obtained
R11949 T17206 T17203 arg2Of amplification,for
R11950 T17206 T17204 arg1Of amplification,cDNA
R11951 T17206 T17205 arg1Of amplification,PCR
R11952 T17206 T17207 arg1Of amplification,of
R11953 T17209 T17207 arg2Of genes,of
R11954 T17209 T17208 arg1Of genes,globin
R11955 T17211 T17210 arg2Of obtained,were
R11956 T17211 T17212 arg1Of obtained,from
R11957 T17213 T17212 arg2Of Primerbank,from
R11958 T17213 T17214 arg1Of Primerbank,[
R11959 T17215 T17214 arg2Of 51,[
R11960 T17216 T17214 arg3Of ],[
R11961 T17218 T17217 arg1Of primers,All
R11962 T17218 T17219 arg1Of primers,were
R11963 T17218 T17220 arg2Of primers,searched
R11964 T17220 T17219 arg2Of searched,were
R11965 T17220 T17221 arg1Of searched,against
R11966 T17220 T17225 modOf searched,to
R11967 T17224 T17221 arg2Of database,against
R11968 T17224 T17222 arg1Of database,the
R11969 T17224 T17223 arg1Of database,NCBI
R11970 T17226 T17225 arg1Of confirm,to
R11971 T17227 T17226 arg2Of specificity,confirm
R11972 T17230 T17228 arg1Of globin,For
R11973 T17230 T17229 arg1Of globin,ɛy
R11974 T17230 T17231 arg1Of globin,:
R11975 T17232 T17231 arg2Of MHB1666,:
R11976 T17232 T17233 arg1Of MHB1666,","
R11977 T17232 T17238 arg1Of MHB1666,","
R11978 T17234 T17236 arg1Of 5′TGGCCTGTGGAGTAAGGTCAA3′,and
R11979 T17236 T17233 arg2Of and,","
R11980 T17236 T17235 arg1Of and,;
R11981 T17237 T17236 arg2Of MHB1667,and
R11982 T17239 T17238 arg2Of 5′GAAGCAGAGGACAAGTTCCCA3′,","
R11983 T17242 T17240 arg1Of globin,For
R11984 T17242 T17241 arg1Of globin,ζ
R11985 T17242 T17243 arg1Of globin,:
R11986 T17244 T17243 arg2Of MHB1668,:
R11987 T17244 T17245 arg1Of MHB1668,","
R11988 T17244 T17250 arg1Of MHB1668,","
R11989 T17246 T17248 arg1Of 5′CTACCCCCAGACGAAGACCTA3′,and
R11990 T17248 T17245 arg2Of and,","
R11991 T17248 T17247 arg1Of and,;
R11992 T17249 T17248 arg2Of MHB1669,and
R11993 T17251 T17250 arg2Of 5′CTTAACCGCATCCCCTACGG3′,","
R11994 T17254 T17252 arg1Of globin,For
R11995 T17254 T17253 arg1Of globin,βH1
R11996 T17254 T17255 arg1Of globin,:
R11997 T17256 T17255 arg2Of MHB1672,:
R11998 T17256 T17257 arg1Of MHB1672,","
R11999 T17256 T17262 arg1Of MHB1672,","
R12000 T17258 T17260 arg1Of 5′TGGACAACCTCAAGGAGACC3′,and
R11435 T16423 T16419 arg3Of ),(
R12035 T17298 T17276 modOf run,Using
R12036 T17298 T17294 arg1Of run,","
R12037 T17298 T17297 arg2Of run,was
R12038 T17298 T17299 arg1Of run,on
R12039 T17301 T17299 arg2Of ABI7000,on
R12040 T17301 T17300 arg1Of ABI7000,an
R12041 T17301 T17302 arg1Of ABI7000,(
R12042 T17301 T17314 arg1Of ABI7000,at
R12043 T17304 T17303 arg1Of Biosystems,Applied
R12044 T17304 T17305 arg1Of Biosystems,","
R12045 T17305 T17308 arg1Of ",",","
R12046 T17307 T17305 arg2Of City,","
R12047 T17307 T17306 arg1Of City,Foster
R12048 T17308 T17310 arg1Of ",",","
R12049 T17309 T17308 arg2Of California,","
R12050 T17310 T17302 arg2Of ",",(
R12051 T17312 T17310 arg2Of States,","
R12052 T17312 T17311 arg1Of States,United
R12053 T17313 T17302 arg3Of ),(
R12054 T17316 T17317 arg1Of University,of
R12055 T17318 T17317 arg2Of Arizona,of
R12056 T17320 T17314 arg2Of facility,at
R12057 T17320 T17315 arg1Of facility,the
R12058 T17320 T17316 arg1Of facility,University
R12059 T17320 T17319 arg1Of facility,core
R12060 T17322 T17321 arg1Of PCR,All
R12061 T17322 T17323 arg1Of PCR,was
R12062 T17322 T17324 arg2Of PCR,performed
R12063 T17324 T17323 arg2Of performed,was
R12064 T17324 T17325 arg1Of performed,in
R12065 T17328 T17325 arg2Of reaction,in
R12066 T17328 T17326 arg1Of reaction,a
R12067 T17328 T17327 arg1Of reaction,25-μl
R12068 T17328 T17329 arg1Of reaction,with
R12069 T17334 T17329 arg2Of supermix,with
R12070 T17334 T17330 arg1Of supermix,12.5
R12071 T17334 T17331 arg1Of supermix,μl
R12072 T17334 T17332 arg1Of supermix,SYBR
R12073 T17334 T17333 arg1Of supermix,green
R12074 T17337 T17335 arg1Of levels,GAPDH
R12075 T17337 T17336 arg1Of levels,mRNA
R12076 T17337 T17338 arg1Of levels,were
R12077 T17337 T17339 arg2Of levels,used
R12078 T17339 T17338 arg2Of used,were
R12079 T17339 T17340 arg1Of used,as
R12080 T17341 T17340 arg2Of control,as
R12081 T17341 T17342 arg1Of control,for
R12082 T17344 T17342 arg2Of RNA,for
R12083 T17344 T17343 arg1Of RNA,input
R12084 T17347 T17345 arg1Of analyses,Standard
R12085 T17347 T17346 arg1Of analyses,curve
R12086 T17347 T17348 arg1Of analyses,were
R12087 T17347 T17349 arg2Of analyses,performed
R12088 T17349 T17348 arg2Of performed,were
R12089 T17351 T17349 arg3Of test,performed
R12090 T17351 T17350 arg1Of test,to
R12091 T17353 T17351 arg2Of efficiency,test
R12092 T17353 T17352 arg1Of efficiency,the
R12093 T17353 T17354 arg1Of efficiency,of
R12094 T17356 T17354 arg2Of amplifications,of
R12095 T17356 T17355 arg1Of amplifications,the
R12096 T17357 T17358 arg1Of Triplicates,were
R12097 T17357 T17359 arg2Of Triplicates,done
R12098 T17359 T17358 arg2Of done,were
R12099 T17359 T17360 arg1Of done,for
R12100 T17363 T17360 arg2Of reaction,for
R12101 T17363 T17361 arg1Of reaction,each
R12102 T17363 T17362 arg1Of reaction,PCR
R12103 T17366 T17364 arg1Of values,Relative
R12104 T17366 T17365 arg1Of values,quantitative
R12105 T17366 T17367 arg1Of values,were
R12106 T17366 T17368 arg2Of values,calculated
R12107 T17366 T17381 arg1Of values,normalized
R12108 T17368 T17367 arg2Of calculated,were
R12109 T17368 T17369 arg1Of calculated,in
R12485 T17870 T17854 arg2Of and,with
R12486 T17870 T17855 arg1Of and,a
R12487 T17870 T17875 arg1Of and,(
R12488 T17874 T17870 arg2Of camera,and
R12489 T17874 T17871 arg1Of camera,SPOT
R12490 T17874 T17872 arg1Of camera,RT-Slider
R12491 T17874 T17873 arg1Of camera,digital
R12492 T17877 T17878 arg1Of Instruments,","
R12493 T17878 T17881 arg1Of ",",","
R12494 T17880 T17878 arg2Of Heights,","
R12495 T17880 T17879 arg1Of Heights,Sterling
R12496 T17881 T17876 arg1Of ",",Diagnostic
R12497 T17881 T17883 arg1Of ",",","
R12498 T17882 T17881 arg2Of Michigan,","
R12499 T17883 T17875 arg2Of ",",(
R12500 T17885 T17883 arg2Of States,","
R12501 T17885 T17884 arg1Of States,United
R12502 T17886 T17875 arg3Of ),(
R12503 T17887 T17888 arg2Of Objectives,used
R12504 T17887 T17889 arg1Of Objectives,were
R12505 T17890 T17891 arg1Of 1×,(
R12506 T17890 T17896 arg1Of 1×,and
R12507 T17892 T17891 arg2Of NA,(
R12508 T17892 T17893 arg1Of NA,=
R12509 T17892 T17894 arg1Of NA,0.04
R12510 T17895 T17891 arg3Of ),(
R12511 T17896 T17889 arg2Of and,were
R12512 T17897 T17896 arg2Of 10×,and
R12513 T17897 T17898 arg1Of 10×,(
R12514 T17899 T17898 arg2Of NA,(
R12515 T17899 T17900 arg1Of NA,=
R12516 T17899 T17901 arg1Of NA,0.5
R12517 T17902 T17898 arg3Of ),(
R12518 T17903 T17904 arg1Of Images,were
R12519 T17903 T17905 arg2Of Images,processed
R12520 T17903 T17907 arg2Of Images,pseudocolored
R12521 T17903 T17910 arg2Of Images,combined
R12522 T17905 T17906 arg1Of processed,","
R12523 T17906 T17909 arg1Of ",",and
R12524 T17907 T17906 arg2Of pseudocolored,","
R12525 T17909 T17904 arg2Of and,were
R12526 T17909 T17908 arg1Of and,","
R12527 T17909 T17940 arg2Of and,plugins
R12528 T17910 T17909 arg2Of combined,and
R12529 T17910 T17911 modOf combined,using
R12530 T17912 T17911 arg2Of Photoshop,using
R12531 T17912 T17913 arg1Of Photoshop,(
R12001 T17260 T17257 arg2Of and,","
R12002 T17260 T17259 arg1Of and,;
R12003 T17261 T17260 arg2Of MHB1673,and
R12004 T17263 T17262 arg2Of 5′ACCTCTGGGGTGAATTCCTT3′,","
R12005 T17266 T17265 arg1Of globin,βmaj/min
R12006 T17266 T17267 arg1Of globin,:
R12007 T17267 T17264 arg1Of :,For
R12008 T17267 T17269 arg1Of :,:
R12009 T17268 T17267 arg2Of MHB1674,:
R12010 T17270 T17272 arg1Of 5′ATGGCCTGAATCACTTGGAC3′,and
R12011 T17272 T17271 arg1Of and,;
R12012 T17273 T17272 arg2Of MHB1675,and
R12013 T17273 T17274 arg1Of MHB1675,","
R12014 T17275 T17274 arg2Of 5′ACGATCATATTGCCCAGGAG3′,","
R12015 T17276 T17284 arg1Of Using,(
R12016 T17281 T17276 arg2Of kit,Using
R12017 T17281 T17277 arg1Of kit,the
R12018 T17281 T17278 arg1Of kit,SYBR
R12019 T17281 T17279 arg1Of kit,green
R12020 T17281 T17280 arg1Of kit,supermix
R12021 T17281 T17282 arg1Of kit,with
R12022 T17283 T17282 arg2Of ROX,with
R12023 T17285 T17286 arg1Of Bio-Rad,","
R12024 T17286 T17288 arg1Of ",",","
R12025 T17287 T17286 arg2Of Hercules,","
R12026 T17288 T17290 arg1Of ",",","
R12027 T17289 T17288 arg2Of California,","
R12028 T17290 T17284 arg2Of ",",(
R12029 T17292 T17290 arg2Of States,","
R12030 T17292 T17291 arg1Of States,United
R12031 T17293 T17284 arg3Of ),(
R12032 T17296 T17295 arg1Of amplification,PCR
R12033 T17296 T17297 arg1Of amplification,was
R12034 T17296 T17298 arg2Of amplification,run
R12110 T17368 T17380 arg1Of calculated,and
R12111 T17375 T17369 arg2Of Software,in
R12112 T17375 T17370 arg1Of Software,the
R12113 T17375 T17371 arg1Of Software,ABI
R12114 T17375 T17372 arg1Of Software,Prism
R12115 T17375 T17373 arg1Of Software,7000
R12116 T17375 T17374 arg1Of Software,SDS
R12117 T17375 T17376 arg1Of Software,(
R12118 T17378 T17376 arg2Of Biosystems,(
R12119 T17378 T17377 arg1Of Biosystems,Applied
R12120 T17379 T17376 arg3Of ),(
R12121 T17381 T17380 arg2Of normalized,and
R12122 T17381 T17382 arg1Of normalized,to
R12123 T17383 T17382 arg2Of GAPDH,to
R12124 T17383 T17384 arg1Of GAPDH,in
R12125 T17386 T17384 arg2Of Excel,in
R12126 T17386 T17385 arg1Of Excel,Microsoft
R12127 T17386 T17387 arg1Of Excel,(
R12128 T17388 T17389 arg1Of Redmond,","
R12129 T17389 T17391 arg1Of ",",","
R12130 T17390 T17389 arg2Of Washington,","
R12131 T17392 T17391 arg2Of United,","
R12132 T17393 T17387 arg2Of States,(
R12133 T17393 T17388 arg1Of States,Redmond
R12134 T17393 T17390 arg1Of States,Washington
R12135 T17393 T17392 arg1Of States,United
R12136 T17394 T17387 arg3Of ),(
R12381 T17767 T17766 arg1Of situ,In
R12382 T17768 T17767 arg1Of hybridization,situ
R12383 T17770 T17769 arg1Of probes,Antisense
R12384 T17770 T17771 arg1Of probes,were
R12385 T17770 T17772 arg2Of probes,designed
R12386 T17772 T17771 arg2Of designed,were
R12387 T17772 T17773 arg1Of designed,to
R12388 T17777 T17774 arg1Of nucleotides,murine
R12389 T17777 T17775 arg1Of nucleotides,ɛy
R12390 T17777 T17776 arg1Of nucleotides,globin
R12391 T17777 T17778 arg1Of nucleotides,509–584
R12392 T17777 T17779 arg1Of nucleotides,;
R12393 T17779 T17773 arg2Of ;,to
R12394 T17782 T17780 arg1Of nucleotides,βmaj
R12395 T17782 T17781 arg1Of nucleotides,globin
R12396 T17782 T17783 arg1Of nucleotides,458–549
R12397 T17782 T17785 arg1Of nucleotides,and
R12398 T17785 T17779 arg2Of and,;
R12399 T17785 T17784 arg1Of and,;
R12400 T17788 T17785 arg2Of nucleotides,and
R12401 T17788 T17786 arg1Of nucleotides,mouse
R12402 T17788 T17787 arg1Of nucleotides,Sox6
R12403 T17788 T17789 arg1Of nucleotides,1353–1927
R12404 T17790 T17791 arg1Of Embryos,were
R12405 T17790 T17792 arg2Of Embryos,fixed
R12406 T17790 T17811 arg1Of Embryos,adhered
R12407 T17792 T17791 arg2Of fixed,were
R12408 T17792 T17793 arg1Of fixed,overnight
R12409 T17792 T17810 arg1Of fixed,and
R12410 T17795 T17792 arg1Of immersion,fixed
R12411 T17795 T17794 arg2Of immersion,by
R12412 T17795 T17796 arg1Of immersion,in
R12413 T17795 T17800 arg1Of immersion,","
R12414 T17795 T17801 arg2Of immersion,embedded
R12415 T17795 T17804 arg1Of immersion,","
R12416 T17795 T17805 arg2Of immersion,sectioned
R12417 T17797 T17798 arg1Of 4,%
R12418 T17799 T17796 arg2Of paraformaldehyde,in
R12419 T17799 T17797 arg1Of paraformaldehyde,4
R12420 T17801 T17802 arg1Of embedded,in
R12421 T17803 T17802 arg2Of paraffin,in
R12422 T17805 T17806 arg1Of sectioned,at
R12423 T17808 T17806 arg2Of μm,at
R12424 T17808 T17807 arg1Of μm,5
R12425 T17810 T17809 arg1Of and,","
R12426 T17811 T17810 arg2Of adhered,and
R12427 T17813 T17811 arg2Of charge,adhered
R12428 T17813 T17812 arg1Of charge,to
R12429 T17815 T17813 arg2Of slides,charge
R12430 T17815 T17814 arg2Of slides,modified
R12431 T17815 T17816 arg1Of slides,(
R12432 T17817 T17818 arg1Of VWR,","
R12433 T17817 T17821 arg1Of VWR,","
R12434 T17820 T17818 arg2Of Chester,","
R12435 T17820 T17819 arg1Of Chester,West
R12436 T17821 T17816 arg2Of ",",(
R12437 T17821 T17823 arg1Of ",",","
R12438 T17822 T17821 arg2Of Pennsylvania,","
R12439 T17825 T17823 arg2Of States,","
R12440 T17825 T17824 arg1Of States,United
R12441 T17826 T17816 arg3Of ),(
R12442 T17827 T17828 arg1Of Slides,were
R12443 T17827 T17829 arg2Of Slides,processed
R12444 T17829 T17828 arg2Of processed,were
R12445 T17829 T17830 arg1Of processed,for
R12446 T17829 T17834 arg1Of processed,as
R12447 T17832 T17831 arg1Of situ,in
R12448 T17833 T17830 arg2Of hybridization,for
R12449 T17833 T17832 arg1Of hybridization,situ
R12450 T17835 T17834 arg2Of described,as
R12451 T17835 T17836 arg1Of described,[
R12452 T17835 T17839 modOf described,using
R12453 T17837 T17836 arg2Of 52,[
R12454 T17838 T17836 arg3Of ],[
R12455 T17841 T17840 arg1Of vitro,in
R12456 T17844 T17839 arg2Of probes,using
R12457 T17844 T17841 arg1Of probes,vitro
R12458 T17844 T17842 arg2Of probes,transcribed
R12459 T17844 T17843 arg1Of probes,RNA
R12460 T17844 T17845 arg2Of probes,labeled
R12461 T17845 T17846 arg1Of labeled,with
R12462 T17847 T17846 arg2Of 33P,with
R12463 T17848 T17849 arg1Of Darkfield,and
R12464 T17850 T17849 arg2Of brightfield,and
R12465 T17851 T17848 arg1Of images,Darkfield
R12466 T17851 T17850 arg1Of images,brightfield
R12467 T17851 T17852 arg1Of images,were
R12468 T17851 T17853 arg2Of images,obtained
R12469 T17853 T17852 arg2Of obtained,were
R12470 T17853 T17854 arg1Of obtained,with
R12471 T17857 T17856 arg1Of Optiphot,Nikon
R12472 T17858 T17857 arg1Of microscope,Optiphot
R12473 T17858 T17859 arg1Of microscope,(
R12474 T17858 T17870 arg1Of microscope,and
R12475 T17860 T17861 arg1Of Nikon,","
R12476 T17861 T17863 arg1Of ",",","
R12477 T17862 T17861 arg2Of Melville,","
R12532 T17914 T17915 arg1Of Adobe,","
R12533 T17915 T17918 arg1Of ",",","
R12534 T17917 T17915 arg2Of Jose,","
R12535 T17917 T17916 arg1Of Jose,San
R12536 T17918 T17920 arg1Of ",",","
R12537 T17919 T17918 arg2Of California,","
R12538 T17920 T17913 arg2Of ",",(
R12539 T17922 T17920 arg2Of States,","
R12540 T17922 T17921 arg1Of States,United
R12541 T17923 T17913 arg3Of ),(
R12542 T17924 T17925 arg1Of software,with
R12543 T17924 T17940 arg1Of software,plugins
R12544 T17927 T17925 arg2Of Pro,with
R12545 T17927 T17926 arg1Of Pro,Fovea
R12546 T17927 T17928 arg1Of Pro,(
R12547 T17930 T17929 arg1Of Graphics,Reindeer
R12548 T17930 T17931 arg1Of Graphics,","
R12549 T17931 T17933 arg1Of ",",","
R12550 T17932 T17931 arg2Of Asheville,","
R12551 T17933 T17936 arg1Of ",",","
R12552 T17935 T17933 arg2Of Carolina,","
R12553 T17935 T17934 arg1Of Carolina,North
R12554 T17936 T17928 arg2Of ",",(
R12555 T17938 T17936 arg2Of States,","
R12556 T17938 T17937 arg1Of States,United
R12557 T17939 T17928 arg3Of ),(
R12558 T17942 T17941 arg1Of images,Original
R12559 T17942 T17943 arg1Of images,are
R12805 T18232 T18231 arg2Of paraffin-embedded,","
R12806 T18234 T18235 arg1Of sectioned,at
R12807 T18237 T18235 arg2Of μm,at
R12808 T18237 T18236 arg1Of μm,5
R12809 T18239 T18210 arg1Of and,For
R12810 T18239 T18214 arg1Of and,","
R12811 T18239 T18225 arg2Of and,were
R12812 T18239 T18238 arg1Of and,","
R12813 T18240 T18239 arg2Of stained,and
R12814 T18240 T18241 arg1Of stained,with
R12815 T18242 T18243 arg1Of hematoxylin,and
R12816 T18243 T18241 arg2Of and,with
R12817 T18244 T18243 arg2Of eosin,and
R12818 T18246 T18245 arg1Of samples,Liver
R12819 T18246 T18247 arg1Of samples,(
R12820 T18246 T18255 arg1Of samples,were
R12821 T18246 T18256 arg2Of samples,prepared
R12822 T18248 T18247 arg2Of at,(
R12823 T18250 T18249 arg1Of dpc,14.5
R12824 T18250 T18251 arg1Of dpc,and
R12825 T18251 T18248 arg2Of and,at
R12826 T18253 T18251 arg2Of dpc,and
R12827 T18253 T18252 arg1Of dpc,18.5
R12828 T18254 T18247 arg3Of ),(
R12829 T18256 T18255 arg2Of prepared,were
R12830 T18256 T18257 arg1Of prepared,in
R12831 T18260 T18257 arg2Of manner,in
R12832 T18260 T18258 arg1Of manner,a
R12833 T18260 T18259 arg1Of manner,similar
R12834 T18261 T18262 arg1Of Images,were
R12835 T18261 T18263 arg2Of Images,obtained
R12836 T18263 T18262 arg2Of obtained,were
R12837 T18263 T18264 arg1Of obtained,with
R12838 T18267 T18264 arg2Of microscope,with
R12839 T18267 T18265 arg1Of microscope,Nikon
R12840 T18267 T18266 arg1Of microscope,Labophot-2
R12841 T18268 T18269 arg2Of Objectives,used
R12842 T18268 T18270 arg1Of Objectives,were
R12843 T18274 T18273 arg1Of 160/0.17,40/0.65
R12844 T18275 T18270 arg2Of Nikon,were
R12845 T18275 T18271 arg1Of Nikon,E
R12846 T18275 T18272 arg1Of Nikon,Plan
R12847 T18275 T18274 arg1Of Nikon,160/0.17
R12848 T18275 T18276 arg1Of Nikon,(
R12849 T18275 T18280 arg1Of Nikon,","
R12850 T18278 T18276 arg2Of objective,(
R12851 T18278 T18277 arg1Of objective,40×
R12852 T18279 T18276 arg3Of ),(
R12853 T18282 T18283 arg1Of Plan,100/1.25
R12854 T18286 T18280 arg2Of Nikon,","
R12855 T18286 T18281 arg1Of Nikon,E
R12856 T18286 T18282 arg1Of Nikon,Plan
R12857 T18286 T18284 arg1Of Nikon,oil
R12858 T18286 T18285 arg1Of Nikon,160/0.17
R12859 T18286 T18287 arg1Of Nikon,(
R12860 T18289 T18287 arg2Of objective,(
R12861 T18289 T18288 arg1Of objective,100×
R12862 T18290 T18287 arg3Of ),(
R12863 T18292 T18291 arg1Of camera,The
R12864 T18292 T18293 arg1Of camera,was
R12865 T18296 T18293 arg2Of Coolpix,was
R12866 T18296 T18294 arg1Of Coolpix,a
R12867 T18296 T18295 arg1Of Coolpix,Nikon
R12868 T18296 T18297 arg1Of Coolpix,4300
R12869 T18299 T18298 arg1Of images,Original
R12870 T18299 T18300 arg1Of images,are
R12871 T18299 T18301 arg1Of images,available
R12872 T18301 T18300 arg2Of available,are
R13105 T18558 T18557 arg1Of States,United
R13106 T18559 T18549 arg3Of ),(
R13107 T18562 T18560 arg2Of °C,at
R13108 T18562 T18561 arg1Of °C,−80
R13109 T18562 T18563 arg1Of °C,for
R13110 T18565 T18563 arg2Of d,for
R13111 T18565 T18564 arg1Of d,6
R13227 T18724 T18725 arg1Of culture,and
R13228 T18725 T18723 arg1Of and,Cell
R13229 T18726 T18725 arg2Of transfection,and
R13230 T18728 T18727 arg1Of cells,GM979
R13231 T18728 T18729 arg1Of cells,(
R13232 T18728 T18742 arg1Of cells,were
R13233 T18728 T18743 arg2Of cells,cultured
R13234 T18732 T18730 arg1Of Repositories,Coriell
R13235 T18732 T18731 arg1Of Repositories,Cell
R13236 T18732 T18733 arg1Of Repositories,","
R13237 T18733 T18735 arg1Of ",",","
R13238 T18734 T18733 arg2Of Camden,","
R13239 T18736 T18735 arg2Of New,","
R13240 T18737 T18729 arg2Of Jersey,(
R13241 T18737 T18732 arg1Of Jersey,Repositories
R13242 T18737 T18734 arg1Of Jersey,Camden
R13243 T18737 T18736 arg1Of Jersey,New
R13244 T18737 T18738 arg1Of Jersey,","
R13245 T18740 T18738 arg2Of States,","
R13246 T18740 T18739 arg1Of States,United
R13247 T18741 T18729 arg3Of ),(
R13248 T18743 T18742 arg2Of cultured,were
R13249 T18743 T18744 arg1Of cultured,in
R13250 T18745 T18746 arg2Of Ham,'s
R13251 T18747 T18744 arg2Of F12,in
R13252 T18747 T18746 arg1Of F12,'s
R13253 T18747 T18748 arg1Of F12,with
R13254 T18749 T18750 arg1Of 2,mM
R13255 T18751 T18748 arg2Of L-glutamine,with
R12478 T17863 T17866 arg1Of ",",","
R12479 T17865 T17863 arg2Of York,","
R12480 T17865 T17864 arg1Of York,New
R12481 T17866 T17859 arg2Of ",",(
R12482 T17868 T17866 arg2Of States,","
R12483 T17868 T17867 arg1Of States,United
R12484 T17869 T17859 arg3Of ),(
R12560 T17942 T17944 arg1Of images,available
R12561 T17944 T17943 arg2Of available,are
R12754 T18187 T18186 arg1Of embryos,18.5-dpc
R12755 T18187 T18188 arg1Of embryos,were
R12756 T18187 T18189 arg2Of embryos,exsanguinated
R12757 T18189 T18188 arg2Of exsanguinated,were
R12758 T18189 T18190 arg1Of exsanguinated,and
R12759 T18193 T18191 arg1Of smears,peripheral
R12760 T18193 T18192 arg1Of smears,blood
R12761 T18193 T18194 arg1Of smears,were
R12762 T18193 T18195 arg2Of smears,prepared
R12763 T18195 T18190 arg2Of prepared,and
R12764 T18195 T18194 arg2Of prepared,were
R12765 T18195 T18196 arg1Of prepared,from
R12766 T18198 T18199 arg1Of mutant,and
R12767 T18199 T18197 arg1Of and,both
R12768 T18200 T18199 arg2Of WT,and
R12769 T18201 T18196 arg2Of mice,from
R12770 T18201 T18198 arg1Of mice,mutant
R12771 T18201 T18200 arg1Of mice,WT
R12772 T18203 T18202 arg1Of slides,The
R12773 T18203 T18204 arg1Of slides,were
R12774 T18203 T18205 arg2Of slides,Wright-stained
R12775 T18203 T18207 arg2Of slides,read
R12776 T18205 T18206 arg1Of Wright-stained,and
R12777 T18206 T18204 arg2Of and,were
R12778 T18207 T18206 arg2Of read,and
R12779 T18209 T18207 arg1Of DAF,read
R12780 T18209 T18208 arg2Of DAF,by
R12781 T18213 T18210 arg2Of analysis,For
R12782 T18213 T18211 arg1Of analysis,whole
R12783 T18213 T18212 arg1Of analysis,mount
R12784 T18215 T18216 arg1Of 14.5-dpc,WT
R12785 T18215 T18217 arg1Of 14.5-dpc,and
R12786 T18218 T18217 arg2Of mutant,and
R12787 T18219 T18215 arg1Of embryos,14.5-dpc
R12788 T18219 T18218 arg1Of embryos,mutant
R12789 T18219 T18221 arg1Of embryos,and
R12790 T18221 T18220 arg1Of and,","
R12791 T18221 T18225 arg1Of and,were
R12792 T18221 T18226 arg2Of and,fixed
R12793 T18221 T18240 arg2Of and,stained
R12794 T18224 T18221 arg2Of mice,and
R12795 T18224 T18222 arg1Of mice,postnatal
R12796 T18224 T18223 arg1Of mice,day–10.5
R12797 T18226 T18227 arg1Of fixed,in
R12798 T18226 T18239 arg1Of fixed,and
R12799 T18228 T18229 arg1Of 10,%
R12800 T18230 T18227 arg2Of formalin,in
R12801 T18230 T18228 arg1Of formalin,10
R12802 T18230 T18231 arg1Of formalin,","
R12803 T18230 T18233 arg1Of formalin,","
R12804 T18230 T18234 arg2Of formalin,sectioned
R13006 T18462 T18461 arg1Of blot,Northern
R13007 T18469 T18463 arg1Of filter,A
R13008 T18469 T18464 arg1Of filter,mouse
R13009 T18469 T18465 arg1Of filter,embryonic
R13010 T18469 T18466 arg1Of filter,tissue
R13011 T18469 T18467 arg1Of filter,Northern
R13012 T18469 T18468 arg1Of filter,blot
R13013 T18469 T18470 arg1Of filter,(
R13014 T18469 T18480 arg1Of filter,was
R13015 T18469 T18481 arg2Of filter,hybridized
R13016 T18471 T18470 arg2Of Seegene,(
R13017 T18471 T18472 arg1Of Seegene,","
R13018 T18471 T18476 arg1Of Seegene,","
R13019 T18473 T18474 arg1Of Rockville,","
R13020 T18474 T18472 arg2Of ",",","
R13021 T18475 T18474 arg2Of Maryland,","
R13022 T18478 T18476 arg2Of States,","
R13023 T18478 T18477 arg1Of States,United
R13024 T18479 T18470 arg3Of ),(
R13025 T18481 T18480 arg2Of hybridized,was
R13026 T18481 T18482 arg1Of hybridized,with
R13027 T18481 T18500 arg1Of hybridized,","
R13028 T18481 T18501 arg1Of hybridized,by
R13029 T18485 T18482 arg2Of probe,with
R13030 T18485 T18483 arg1Of probe,a
R13031 T18485 T18484 arg1Of probe,Sox6
R13032 T18485 T18486 arg2Of probe,generated
R13033 T18485 T18494 arg2Of probe,labeled
R13034 T18486 T18487 arg1Of generated,by
R13035 T18486 T18493 arg1Of generated,and
R13036 T18488 T18487 arg2Of RT-PCR,by
R13037 T18488 T18489 arg1Of RT-PCR,(
R13038 T18490 T18489 arg2Of nucleotides,(
R13039 T18490 T18491 arg1Of nucleotides,1353–1927
R13040 T18492 T18489 arg3Of ),(
R13041 T18494 T18493 arg2Of labeled,and
R13042 T18494 T18495 arg1Of labeled,with
R13043 T18497 T18496 arg2Of α-32P,[
R13044 T18498 T18496 arg3Of ],[
R13045 T18499 T18495 arg2Of dCTP,with
R13046 T18499 T18496 arg1Of dCTP,[
R13047 T18504 T18501 arg2Of labeling,by
R13048 T18504 T18502 arg1Of labeling,random
R13049 T18504 T18503 arg1Of labeling,primer
R13050 T18504 T18505 arg1Of labeling,(
R13051 T18506 T18507 arg1Of RediprimeII,;
R13052 T18507 T18505 arg2Of ;,(
R13053 T18507 T18514 arg1Of ;,","
R13054 T18509 T18508 arg1Of Biosciences,Amersham
R13055 T18509 T18510 arg1Of Biosciences,","
R13056 T18510 T18512 arg1Of ",",","
R13057 T18511 T18510 arg2Of Buckinghamshire,","
R13058 T18512 T18507 arg2Of ",",;
R13059 T18513 T18512 arg2Of England,","
R13060 T18516 T18514 arg2Of Kingdom,","
R13061 T18516 T18515 arg1Of Kingdom,United
R13062 T18517 T18505 arg3Of ),(
R13063 T18519 T18518 arg1Of hybridization,The
R13064 T18519 T18520 arg1Of hybridization,was
R13065 T18519 T18521 arg2Of hybridization,performed
R13066 T18521 T18520 arg2Of performed,was
R13067 T18521 T18522 arg1Of performed,in
R13068 T18523 T18522 arg2Of phosphate,in
R13069 T18523 T18524 arg2Of phosphate,buffered
R13070 T18525 T18526 arg1Of 7,%
R13071 T18529 T18524 arg3Of solution,buffered
R13072 T18529 T18525 arg1Of solution,7
R13073 T18529 T18527 arg1Of solution,SDS
R13074 T18529 T18528 arg1Of solution,hybridization
R13075 T18530 T18531 arg1Of Blots,were
R13076 T18530 T18532 arg2Of Blots,washed
R13077 T18532 T18531 arg2Of washed,were
R13078 T18532 T18533 arg1Of washed,with
R13079 T18535 T18536 arg1Of SSC,","
R13080 T18536 T18534 arg1Of ",",0.2×
R13081 T18538 T18536 arg2Of %,","
R13082 T18538 T18537 arg1Of %,1
R13083 T18539 T18533 arg2Of SDS,with
R13084 T18539 T18535 arg1Of SDS,SSC
R13085 T18539 T18538 arg1Of SDS,%
R13086 T18539 T18540 arg1Of SDS,at
R13087 T18539 T18543 arg1Of SDS,prior
R13088 T18539 T18549 arg1Of SDS,(
R13089 T18539 T18560 arg1Of SDS,at
R13090 T18542 T18540 arg2Of °C,at
R13091 T18542 T18541 arg1Of °C,60
R13092 T18543 T18544 arg1Of prior,to
R13093 T18545 T18544 arg2Of exposure,to
R13094 T18545 T18546 arg1Of exposure,to
R13095 T18548 T18546 arg2Of film,to
R13096 T18548 T18547 arg1Of film,X-ray
R13097 T18550 T18551 arg1Of Kodak,","
R13098 T18551 T18553 arg1Of ",",","
R13099 T18552 T18551 arg2Of Rochester,","
R13100 T18553 T18556 arg1Of ",",","
R13101 T18555 T18553 arg2Of York,","
R13102 T18555 T18554 arg1Of York,New
R13103 T18556 T18549 arg2Of ",",(
R13256 T18751 T18749 arg1Of L-glutamine,2
R13257 T18751 T18752 arg2Of L-glutamine,supplemented
R13258 T18752 T18753 arg1Of supplemented,with
R13259 T18755 T18756 arg1Of 10,%
R13260 T18759 T18754 arg1Of serum,heat-inactivated
R13261 T18759 T18755 arg1Of serum,10
R13262 T18759 T18757 arg1Of serum,fetal
R13263 T18759 T18758 arg1Of serum,calf
R13264 T18759 T18760 arg1Of serum,(
R13265 T18759 T18782 arg1Of serum,and
R13266 T18761 T18762 arg1Of Ivitrogen,","
R13267 T18762 T18764 arg1Of ",",","
R13268 T18763 T18762 arg2Of Carlsbad,","
R13269 T18764 T18766 arg1Of ",",","
R13270 T18765 T18764 arg2Of California,","
R13271 T18766 T18769 arg1Of ",",)
R13272 T18766 T18770 arg1Of ",",","
R13273 T18768 T18766 arg2Of States,","
R13274 T18768 T18767 arg1Of States,United
R13275 T18770 T18776 arg1Of ",",","
R13276 T18771 T18770 arg2Of penicillin,","
R13277 T18771 T18772 arg1Of penicillin,(
R13278 T18774 T18772 arg2Of units/ml,(
R13279 T18774 T18773 arg1Of units/ml,100
R13280 T18775 T18772 arg3Of ),(
R13281 T18776 T18760 arg2Of ",",(
R13282 T18779 T18776 arg2Of μg/ml,","
R13283 T18779 T18777 arg1Of μg/ml,streptomycin
R13284 T18779 T18778 arg1Of μg/ml,100
R13285 T18780 T18760 arg3Of ),(
R13286 T18782 T18753 arg2Of and,with
R13287 T18782 T18781 arg1Of and,","
R13288 T18783 T18782 arg2Of L-glutamine,and
R13289 T18783 T18784 arg1Of L-glutamine,(
R13290 T18786 T18784 arg2Of mM,(
R13291 T18786 T18785 arg1Of mM,2
R13292 T18787 T18784 arg3Of ),(
R13293 T18789 T18788 arg1Of cells,MEL
R13294 T18789 T18790 arg1Of cells,were
R13295 T18789 T18791 arg2Of cells,cultured
R13296 T18791 T18790 arg2Of cultured,were
R13297 T18791 T18792 arg1Of cultured,in
R13298 T18793 T18792 arg2Of DMEM,in
R13299 T18793 T18794 arg2Of DMEM,supplemented
R13300 T18794 T18795 arg1Of supplemented,as
R13301 T18794 T18797 arg1Of supplemented,(
R13302 T18796 T18795 arg2Of above,as
R13303 T18798 T18797 arg2Of without,(
R13304 T18799 T18798 arg2Of heat,without
R13305 T18799 T18800 arg1Of heat,inactivating
R13306 T18802 T18800 arg2Of serum,inactivating
R13307 T18802 T18801 arg1Of serum,the
R13308 T18803 T18797 arg3Of ),(
R13309 T18805 T18804 arg1Of cells,GM979
R13310 T18805 T18806 arg1Of cells,(
R13311 T18805 T18811 arg1Of cells,in
R13312 T18805 T18816 arg1Of cells,were
R13313 T18805 T18817 arg2Of cells,transfected
R13314 T18808 T18806 arg2Of ×,(
R13315 T18808 T18807 arg1Of ×,4
R13316 T18808 T18809 arg1Of ×,105
R13317 T18810 T18806 arg3Of ),(
R13318 T18813 T18811 arg2Of phase,in
R13319 T18813 T18812 arg1Of phase,log
R13320 T18813 T18814 arg1Of phase,of
R13321 T18815 T18814 arg2Of growth,of
R13322 T18817 T18816 arg2Of transfected,were
R13323 T18817 T18818 arg1Of transfected,with
R13324 T18817 T18820 arg1Of transfected,by
R13325 T18817 T18822 arg1Of transfected,(
R13326 T18819 T18818 arg2Of plasmids,with
R13327 T18821 T18820 arg2Of FuGENE6,by
R13328 T18823 T18824 arg1Of Roche,","
R13329 T18824 T18826 arg1Of ",",","
R13772 T19429 T19428 arg1Of antibodies,Sox6
R13773 T19429 T19430 arg2Of antibodies,used
R13774 T19429 T19434 arg1Of antibodies,were
R13775 T19429 T19437 arg2Of antibodies,provided
R13776 T19429 T19454 arg2Of antibodies,obtained
R13777 T19430 T19431 arg1Of used,in
R13778 T19433 T19431 arg2Of study,in
R13779 T19433 T19432 arg1Of study,this
R13780 T19437 T19436 arg1Of provided,kindly
R13781 T19437 T19452 arg1Of provided,or
R13782 T19441 T19437 arg1Of Lalli,provided
R13783 T19441 T19438 arg2Of Lalli,by
R13784 T19441 T19439 arg1Of Lalli,Dr.
R13785 T19441 T19440 arg1Of Lalli,Enzo
R13786 T19441 T19442 arg1Of Lalli,(
R13787 T19445 T19443 arg1Of Pasteur,Université
R13104 T18558 T18556 arg2Of States,","
R13330 T18825 T18824 arg2Of Indianapolis,","
R13331 T18826 T18828 arg1Of ",",","
R13332 T18827 T18826 arg2Of Indiana,","
R13333 T18829 T18828 arg2Of United,","
R13334 T18830 T18822 arg2Of States,(
R13335 T18830 T18823 arg1Of States,Roche
R13336 T18830 T18825 arg1Of States,Indianapolis
R13337 T18830 T18827 arg1Of States,Indiana
R13338 T18830 T18829 arg1Of States,United
R13339 T18831 T18822 arg3Of ),(
R13340 T18832 T18833 arg1Of Cells,were
R13341 T18832 T18834 arg2Of Cells,transfected
R13342 T18834 T18833 arg2Of transfected,were
R13343 T18834 T18835 arg1Of transfected,with
R13344 T18834 T18844 arg1Of transfected,along
R13345 T18839 T18835 arg2Of constructs,with
R13346 T18839 T18836 arg1Of constructs,ɛy
R13347 T18839 T18837 arg1Of constructs,promoter
R13348 T18839 T18838 arg1Of constructs,reporter
R13349 T18839 T18840 arg1Of constructs,(
R13350 T18842 T18840 arg2Of ng,(
R13351 T18842 T18841 arg1Of ng,500
R13352 T18843 T18840 arg3Of ),(
R13353 T18844 T18845 arg1Of along,with
R13354 T18848 T18847 arg1Of vector,empty
R13355 T18848 T18849 arg1Of vector,or
R13356 T18849 T18845 arg2Of or,with
R13357 T18849 T18846 arg1Of or,either
R13358 T18852 T18849 arg2Of vector,or
R13359 T18852 T18850 arg1Of vector,Sox6
R13360 T18852 T18851 arg1Of vector,overexpression
R13361 T18852 T18853 arg1Of vector,(
R13362 T18855 T18853 arg2Of ng,(
R13363 T18855 T18854 arg1Of ng,1000
R13364 T18856 T18853 arg3Of ),(
R13365 T18858 T18857 arg2Of assays,In
R13366 T18858 T18859 arg1Of assays,of
R13367 T18861 T18859 arg2Of effect,of
R13368 T18861 T18860 arg1Of effect,dosage
R13369 T18863 T18864 arg1Of we,used
R13370 T18864 T18857 arg1Of used,In
R13371 T18864 T18862 arg1Of used,","
R13372 T18866 T18865 arg1Of ng,200
R13373 T18866 T18867 arg1Of ng,","
R13374 T18867 T18871 arg1Of ",",and
R13375 T18869 T18867 arg2Of ng,","
R13376 T18869 T18868 arg1Of ng,500
R13377 T18871 T18864 arg2Of and,used
R13378 T18871 T18870 arg1Of and,","
R13379 T18871 T18874 arg1Of and,)
R13380 T18871 T18880 modOf and,ega
R13381 T18873 T18871 arg2Of ng,and
R13382 T18873 T18872 arg1Of ng,1000
R13383 T18876 T18875 arg1Of MV 1,. pRL-C
R13384 T18876 T18877 arg1Of MV 1,5
R13385 T18876 T18880 arg1Of MV 1,ega
R13386 T18876 T18881 arg2Of MV 1,) wa
R13387 T18878 T18877 arg2Of ng (Pro,5
R13388 T18879 T18877 arg3Of m,5
R13389 T18881 T18880 arg2Of ) wa,ega
R13390 T18881 T18882 arg1Of ) wa,s
R13391 T18884 T18882 arg2Of sed as ,s
R13392 T18884 T18883 arg1Of sed as ,u
R13393 T18884 T18885 arg1Of sed as ,a c
R13394 T18887 T18885 arg2Of ransfectio,a c
R13395 T18887 T18886 arg1Of ransfectio,ontrol for t
R13578 T19152 T19150 arg1Of extract,Nuclear
R13579 T19152 T19151 arg1Of extract,protein
R13580 T19152 T19153 arg1Of extract,and
R13581 T19155 T19154 arg1Of vitro,in
R13582 T19156 T19153 arg2Of translation,and
R13583 T19156 T19155 arg1Of translation,vitro
R13584 T19156 T19157 arg1Of translation,of
R13585 T19158 T19157 arg2Of Sox6,of
R13586 T19160 T19159 arg1Of extracts,Nuclear
R13587 T19160 T19161 arg1Of extracts,were
R13588 T19160 T19162 arg2Of extracts,prepared
R13589 T19162 T19161 arg2Of prepared,were
R13590 T19162 T19163 arg1Of prepared,from
R13591 T19165 T19163 arg2Of cells,from
R13592 T19165 T19164 arg1Of cells,MEL
R13593 T19165 T19166 arg1Of cells,(
R13594 T19165 T19171 arg1Of cells,using
R13595 T19167 T19168 arg1Of 2,×
R13596 T19168 T19166 arg2Of ×,(
R13597 T19169 T19168 arg2Of 107,×
R13598 T19170 T19166 arg3Of ),(
R13599 T19173 T19171 arg2Of kit,using
R13600 T19173 T19172 arg1Of kit,a
R13601 T19173 T19174 arg1Of kit,(
R13602 T19176 T19177 arg1Of Motif,","
R13603 T19177 T19179 arg1Of ",",","
R13604 T19178 T19177 arg2Of Carlsbad,","
R13605 T19179 T19175 arg1Of ",",Active
R13606 T19179 T19181 arg1Of ",",","
R13607 T19180 T19179 arg2Of California,","
R13608 T19181 T19174 arg2Of ",",(
R13609 T19183 T19181 arg2Of States,","
R13610 T19183 T19182 arg1Of States,United
R13611 T19184 T19174 arg3Of ),(
R13612 T19188 T19187 arg1Of vitro,in
R13613 T19191 T19185 arg1Of vector,The
R13614 T19191 T19186 arg1Of vector,Sox6
R13615 T19191 T19188 arg1Of vector,vitro
R13616 T19191 T19189 arg1Of vector,translation
R13617 T19191 T19190 arg1Of vector,expression
R13618 T19191 T19192 arg1Of vector,","
R13619 T19191 T19193 arg2Of vector,tagged
R13620 T19191 T19199 arg1Of vector,was
R13621 T19191 T19200 arg2Of vector,described
R13622 T19193 T19194 arg1Of tagged,with
R13623 T19195 T19196 arg1Of c-Myc,and
R13624 T19196 T19194 arg2Of and,with
R13625 T19197 T19196 arg2Of HA,and
R13626 T19200 T19198 arg1Of described,","
R13627 T19200 T19199 arg2Of described,was
R13628 T19200 T19201 arg1Of described,before
R13629 T19203 T19201 arg2Of 15,before
R13630 T19203 T19202 arg2Of 15,[
R13631 T19204 T19202 arg3Of ],[
R13632 T19206 T19205 arg1Of translation,The
R13633 T19206 T19207 arg1Of translation,was
R13634 T19206 T19208 arg2Of translation,performed
R13635 T19208 T19207 arg2Of performed,was
R13636 T19208 T19209 arg1Of performed,in
R13637 T19212 T19209 arg2Of lysate,in
R13638 T19212 T19210 arg1Of lysate,a
R13639 T19212 T19211 arg1Of lysate,reticulocyte
R13640 T19212 T19213 arg2Of lysate,based
R13641 T19213 T19215 arg1Of based,vitro
R13642 T19215 T19214 arg1Of vitro,in
R13643 T19217 T19209 arg3Of system,in
R13644 T19217 T19216 arg1Of system,translational
R13645 T19217 T19218 arg1Of system,(
R13646 T19223 T19218 arg2Of Systems,(
R13647 T19223 T19219 arg1Of Systems,TNT®
R13648 T19223 T19220 arg1Of Systems,Quick
R13649 T19223 T19221 arg1Of Systems,Coupled
R13650 T19223 T19222 arg1Of Systems,Transcription/Translation
R13651 T19223 T19224 arg1Of Systems,","
R13652 T19223 T19225 arg1Of Systems,Promega
R13653 T19226 T19218 arg3Of ),(
R13654 T19228 T19227 arg1Of vector,A
R13655 T19228 T19229 arg1Of vector,without
R13656 T19228 T19234 arg1Of vector,was
R13657 T19228 T19236 arg2Of vector,translated
R13658 T19233 T19229 arg2Of sequence,without
R13659 T19233 T19230 arg1Of sequence,the
R13660 T19233 T19231 arg1Of sequence,Sox6
R13661 T19233 T19232 arg1Of sequence,coding
R13662 T19236 T19234 arg2Of translated,was
R13663 T19236 T19235 arg1Of translated,also
R13664 T19236 T19237 arg1Of translated,as
R13665 T19240 T19237 arg2Of control,as
R13666 T19240 T19238 arg1Of control,a
R13667 T19240 T19239 arg1Of control,negative
R13935 T19697 T19695 arg1Of oligonucleotides,Single-stranded
R13788 T19445 T19444 arg1Of Pasteur,Louis
R13789 T19445 T19446 arg1Of Pasteur,","
R13790 T19446 T19442 arg2Of ",",(
R13791 T19447 T19446 arg2Of France,","
R13792 T19447 T19448 arg1Of France,[
R13793 T19449 T19448 arg2Of 7,[
R13794 T19450 T19448 arg3Of ],[
R13795 T19451 T19442 arg3Of ),(
R13796 T19452 T19434 arg2Of or,were
R13797 T19452 T19435 arg1Of or,either
R13798 T19454 T19452 arg2Of obtained,or
R13799 T19454 T19453 arg1Of obtained,commercially
R13800 T19454 T19455 arg1Of obtained,(
R13801 T19459 T19455 arg2Of X,(
R13802 T19459 T19456 arg1Of X,Catalog
R13803 T19459 T19457 arg1Of X,No.
R13804 T19459 T19458 arg1Of X,sc-17332
R13805 T19459 T19460 arg1Of X,","
R13806 T19459 T19469 arg1Of X,","
R13807 T19463 T19460 arg2Of Biotechnology,","
R13808 T19463 T19461 arg1Of Biotechnology,Santa
R13809 T19463 T19462 arg1Of Biotechnology,Cruz
R13810 T19463 T19464 arg1Of Biotechnology,","
R13811 T19466 T19465 arg1Of Cruz,Santa
R13812 T19466 T19467 arg1Of Cruz,","
R13813 T19467 T19464 arg2Of ",",","
R13814 T19468 T19467 arg2Of California,","
R13815 T19471 T19469 arg2Of States,","
R13816 T19471 T19470 arg1Of States,United
R13817 T19472 T19455 arg3Of ),(
R13818 T19474 T19473 arg1Of Sox6,All
R13819 T19474 T19481 arg1Of Sox6,was
R13820 T19474 T19482 arg2Of Sox6,purchased
R13821 T19475 T19476 arg1Of antibodies,generated
R13822 T19480 T19476 arg2Of antibody,generated
R13823 T19480 T19477 arg1Of antibody,similar
R13824 T19480 T19478 arg1Of antibody,results.
R13825 T19480 T19479 arg1Of antibody,c-Myc
R13826 T19482 T19476 arg3Of purchased,generated
R13827 T19482 T19481 arg2Of purchased,was
R13828 T19482 T19483 arg1Of purchased,from
R13829 T19485 T19483 arg2Of Normal,from
R13830 T19485 T19484 arg1Of Normal,Invitrogen.
R13831 T19488 T19486 arg1Of antibody,rabbit
R13832 T19488 T19487 arg1Of antibody,IgG
R13833 T19488 T19489 arg1Of antibody,was
R13834 T19488 T19490 arg2Of antibody,obtained
R13835 T19490 T19481 modOf obtained,was
R13836 T19490 T19489 arg2Of obtained,was
R13837 T19490 T19491 arg1Of obtained,from
R13838 T19493 T19491 arg2Of Biotechnology,from
R13839 T19493 T19492 arg1Of Biotechnology,Upstate
R13840 T19493 T19494 arg1Of Biotechnology,(
R13841 T19496 T19494 arg2Of Placid,(
R13842 T19496 T19495 arg1Of Placid,Lake
R13843 T19496 T19497 arg1Of Placid,","
R13844 T19496 T19500 arg1Of Placid,","
R13845 T19499 T19497 arg2Of York,","
R13846 T19499 T19498 arg1Of York,New
R13847 T19502 T19500 arg2Of States,","
R13848 T19502 T19501 arg1Of States,United
R13849 T19503 T19494 arg3Of ),(
R14085 T19845 T19840 arg1Of %,a
R14086 T19845 T19842 arg1Of %,%
R14087 T19845 T19844 arg1Of %,6
R14088 T19847 T19846 arg2Of w/v,(
R14089 T19848 T19846 arg3Of ),(
R14090 T19850 T19838 arg3Of gel,loaded
R14091 T19850 T19846 arg1Of gel,(
R14092 T19850 T19849 arg1Of gel,polyacrylamide
R14093 T19851 T19852 arg1Of Electrophoresis,was
R14094 T19851 T19853 arg2Of Electrophoresis,performed
R14095 T19853 T19852 arg2Of performed,was
R13936 T19697 T19696 arg1Of oligonucleotides,complementary
R13937 T19697 T19698 arg1Of oligonucleotides,were
R13938 T19697 T19699 arg2Of oligonucleotides,annealed
R13939 T19697 T19701 arg2Of oligonucleotides,end-labeled
R13940 T19699 T19700 arg1Of annealed,and
R13941 T19700 T19698 arg2Of and,were
R13942 T19701 T19700 arg2Of end-labeled,and
R13943 T19701 T19702 arg1Of end-labeled,with
R13944 T19704 T19703 arg2Of γ-32P,[
R13945 T19705 T19703 arg3Of ],[
R13946 T19706 T19702 arg2Of ATP,with
R13947 T19706 T19703 arg1Of ATP,[
R13948 T19706 T19707 arg1Of ATP,with
R13949 T19710 T19707 arg2Of kinase,with
R13950 T19710 T19708 arg1Of kinase,T4
R13951 T19710 T19709 arg1Of kinase,polynucleotide
R13952 T19711 T19712 arg1Of EMSA,was
R13953 T19711 T19713 arg2Of EMSA,performed
R13954 T19713 T19712 arg2Of performed,was
R13955 T19713 T19714 arg1Of performed,with
R13956 T19713 T19738 arg1Of performed,:
R13957 T19716 T19715 arg1Of μg,5
R13958 T19716 T19717 arg1Of μg,of
R13959 T19716 T19723 arg1Of μg,or
R13960 T19719 T19717 arg2Of proteins,of
R13961 T19719 T19718 arg1Of proteins,nuclear
R13962 T19719 T19720 arg1Of proteins,from
R13963 T19722 T19720 arg2Of cells,from
R13964 T19722 T19721 arg1Of cells,MEL
R13965 T19723 T19714 arg2Of or,with
R13966 T19723 T19731 arg1Of or,with
R13967 T19725 T19723 arg2Of μl,or
R13968 T19725 T19724 arg1Of μl,3
R13969 T19725 T19726 arg1Of μl,of
R13970 T19728 T19727 arg1Of vitro-translated,in
R13971 T19729 T19726 arg2Of Sox6,of
R13972 T19729 T19728 arg1Of Sox6,vitro-translated
R13973 T19731 T19730 arg1Of with,along
R13974 T19734 T19731 arg2Of lysate,with
R13975 T19734 T19732 arg1Of lysate,the
R13976 T19734 T19733 arg1Of lysate,reticulocyte
R13977 T19734 T19735 arg1Of lysate,in
R13978 T19737 T19735 arg2Of buffer,in
R13979 T19737 T19736 arg1Of buffer,binding
R13980 T19739 T19740 arg1Of 100,mM
R13981 T19741 T19739 arg1Of NaCl,100
R13982 T19741 T19742 arg1Of NaCl,","
R13983 T19742 T19746 arg1Of ",",","
R13984 T19743 T19744 arg1Of 10,%
R13985 T19745 T19742 arg2Of glycerol,","
R13986 T19745 T19743 arg1Of glycerol,10
R13987 T19746 T19750 arg1Of ",",","
R13988 T19749 T19746 arg2Of BSA,","
R13989 T19749 T19747 arg1Of BSA,200
R13990 T19749 T19748 arg1Of BSA,ng/μl
R13991 T19750 T19757 arg1Of ",",or
R13992 T19753 T19750 arg2Of poly,","
R13993 T19753 T19751 arg1Of poly,50
R13994 T19753 T19752 arg1Of poly,ng/μl
R13995 T19753 T19754 arg1Of poly,(
R13996 T19755 T19754 arg2Of dI-dC,(
R13997 T19756 T19754 arg3Of ),(
R13998 T19757 T19770 arg1Of or,","
R13999 T19758 T19759 arg1Of poly,(
R14000 T19758 T19762 arg1Of poly,","
R14001 T19760 T19759 arg2Of dG-dC,(
R14002 T19761 T19759 arg3Of ),(
R14003 T19762 T19757 arg2Of ",",or
R14004 T19763 T19764 arg1Of 10,mM
R14005 T19765 T19762 arg2Of HEPES,","
R14006 T19765 T19763 arg1Of HEPES,10
R14007 T19765 T19766 arg1Of HEPES,(
R14008 T19767 T19766 arg2Of pH,(
R14009 T19767 T19768 arg1Of pH,7
R14010 T19769 T19766 arg3Of ),(
R14011 T19771 T19772 arg1Of 0.1,mM
R14012 T19773 T19770 arg2Of EDTA,","
R14013 T19773 T19771 arg1Of EDTA,0.1
R14014 T19773 T19774 arg1Of EDTA,","
R14015 T19773 T19778 arg1Of EDTA,","
R14016 T19775 T19776 arg1Of 0.25,mM
R14017 T19777 T19774 arg2Of DTT,","
R14018 T19777 T19775 arg1Of DTT,0.25
R14019 T19779 T19780 arg1Of 0.6,mM
R14020 T19781 T19778 arg2Of MgCl2,","
R14021 T19781 T19779 arg1Of MgCl2,0.6
R14022 T19783 T19784 arg1Of competition,or
R14023 T19784 T19782 arg2Of or,For
R14024 T19786 T19784 arg2Of assays,or
R14025 T19786 T19785 arg1Of assays,supershift
R14026 T19792 T19789 arg2Of competitor,indicated
R14027 T19792 T19790 arg1Of competitor,unlabelled
R14028 T19792 T19791 arg1Of competitor,oligonucleotide
R14029 T19792 T19793 arg1Of competitor,(
R14030 T19792 T19798 arg1Of competitor,or
R14031 T19796 T19793 arg2Of excess,(
R14032 T19796 T19794 arg1Of excess,200-fold
R14033 T19796 T19795 arg1Of excess,molar
R14034 T19797 T19793 arg3Of ),(
R14035 T19798 T19788 arg1Of or,the
R14036 T19798 T19804 arg1Of or,was
R14037 T19798 T19805 arg2Of or,added
R14038 T19799 T19798 arg2Of antibody,or
R14039 T19799 T19800 arg1Of antibody,(
R14040 T19802 T19800 arg2Of μl,(
R14041 T19802 T19801 arg1Of μl,3
R14042 T19803 T19800 arg3Of ),(
R14043 T19805 T19782 arg1Of added,For
R14044 T19805 T19787 arg1Of added,","
R14045 T19805 T19804 arg2Of added,was
R14046 T19806 T19808 arg1Of 30,to
R14047 T19808 T19807 arg1Of to,min
R14048 T19809 T19808 arg2Of 60,to
R14049 T19810 T19805 arg3Of min,added
R14050 T19810 T19806 arg1Of min,30
R14051 T19810 T19811 arg1Of min,prior
R14052 T19811 T19812 arg1Of prior,to
R14053 T19813 T19812 arg2Of addition,to
R14054 T19813 T19814 arg1Of addition,of
R14055 T19816 T19814 arg2Of probe,of
R14056 T19816 T19815 arg2Of probe,radiolabeled
R14057 T19818 T19817 arg2Of addition,Following
R14058 T19818 T19819 arg1Of addition,of
R14059 T19822 T19819 arg2Of probe,of
R14060 T19822 T19820 arg1Of probe,the
R14061 T19822 T19821 arg2Of probe,radiolabeled
R14062 T19825 T19824 arg1Of samples,the
R14063 T19825 T19826 arg1Of samples,were
R14064 T19825 T19827 arg2Of samples,incubated
R14065 T19825 T19838 arg2Of samples,loaded
R14066 T19827 T19828 arg1Of incubated,for
R14067 T19827 T19837 arg1Of incubated,and
R14068 T19830 T19829 arg1Of min,30
R14069 T19830 T19831 arg1Of min,or
R14070 T19831 T19828 arg2Of or,for
R14071 T19831 T19834 arg1Of or,at
R14072 T19833 T19831 arg2Of min,or
R14073 T19833 T19832 arg1Of min,60
R14074 T19836 T19834 arg2Of temperature,at
R14075 T19836 T19835 arg1Of temperature,room
R14076 T19837 T19817 arg1Of and,Following
R14077 T19837 T19823 arg1Of and,","
R14078 T19837 T19826 arg2Of and,were
R14079 T19838 T19837 arg2Of loaded,and
R14080 T19838 T19839 arg1Of loaded,on
R14081 T19842 T19843 arg1Of %,or
R14082 T19843 T19841 arg1Of or,4
R14083 T19844 T19843 arg2Of 6,or
R14084 T19845 T19839 arg2Of %,on
R14160 T19915 T19919 arg1Of 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′,;
R14161 T19915 T19920 arg1Of 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′,for
R14162 T19915 T19927 arg1Of 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′,:
R14163 T19917 T19916 arg2Of MHB1556,(
R14164 T19918 T19916 arg3Of ),(
R14165 T19922 T19920 arg2Of probe,for
R14166 T19922 T19921 arg1Of probe,mutant
R14167 T19922 T19923 arg1Of probe,1
R14168 T19922 T19924 arg1Of probe,(
R14096 T19853 T19854 arg1Of performed,at
R14097 T19853 T19859 arg1Of performed,for
R14098 T19853 T19862 arg1Of performed,at
R14099 T19853 T19866 arg1Of performed,and
R14100 T19858 T19854 arg2Of mAmp,at
R14101 T19858 T19855 arg1Of mAmp,a
R14102 T19858 T19856 arg1Of mAmp,constant
R14103 T19858 T19857 arg1Of mAmp,19
R14104 T19861 T19859 arg2Of h,for
R14105 T19861 T19860 arg1Of h,4–8
R14106 T19864 T19862 arg2Of temperature,at
R14107 T19864 T19863 arg1Of temperature,room
R14108 T19866 T19865 arg1Of and,","
R14109 T19868 T19867 arg1Of gels,the
R14110 T19868 T19869 arg1Of gels,were
R14111 T19868 T19870 arg2Of gels,dried
R14112 T19870 T19866 arg2Of dried,and
R14113 T19870 T19869 arg2Of dried,were
R14114 T19870 T19871 arg1Of dried,prior
R14115 T19871 T19872 arg1Of prior,to
R14116 T19873 T19872 arg2Of autoradiography,to
R14117 T19874 T19875 arg2Of Antibodies,used
R14118 T19874 T19879 arg1Of Antibodies,included
R14119 T19875 T19876 arg1Of used,for
R14120 T19878 T19876 arg2Of analyses,for
R14121 T19878 T19877 arg1Of analyses,supershift
R14122 T19880 T19881 arg1Of c-Myc,","
R14123 T19881 T19884 arg1Of ",",and
R14124 T19882 T19881 arg2Of HA,","
R14125 T19884 T19883 arg1Of and,","
R14126 T19885 T19884 arg2Of Sox6,and
R14127 T19886 T19879 arg2Of antibodies,included
R14128 T19886 T19880 arg1Of antibodies,c-Myc
R14169 T19925 T19924 arg2Of M1,(
R14170 T19926 T19924 arg3Of ),(
R14171 T19928 T19929 arg1Of 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′,(
R14172 T19928 T19932 arg1Of 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′,;
R14173 T19928 T19933 arg1Of 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′,for
R14174 T19928 T19940 arg1Of 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′,:
R14175 T19930 T19929 arg2Of MHB1644,(
R14176 T19931 T19929 arg3Of ),(
R14177 T19935 T19933 arg2Of probe,for
R14178 T19935 T19934 arg1Of probe,mutant
R14179 T19935 T19936 arg1Of probe,2
R14180 T19935 T19937 arg1Of probe,(
R14181 T19938 T19937 arg2Of M2,(
R14182 T19939 T19937 arg3Of ),(
R14183 T19941 T19942 arg1Of 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′,(
R14184 T19941 T19945 arg1Of 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′,;
R14185 T19941 T19946 arg1Of 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′,for
R14186 T19941 T19953 arg1Of 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′,:
R14187 T19943 T19942 arg2Of MHB1648,(
R14188 T19944 T19942 arg3Of ),(
R14189 T19948 T19946 arg2Of probe,for
R14190 T19948 T19947 arg1Of probe,mutant
R14191 T19948 T19949 arg1Of probe,3
R14192 T19948 T19950 arg1Of probe,(
R14193 T19951 T19950 arg2Of M3,(
R14194 T19952 T19950 arg3Of ),(
R14195 T19954 T19955 arg1Of 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′,(
R14196 T19956 T19955 arg2Of MHB1650,(
R14197 T19957 T19955 arg3Of ),(
R14488 T20383 T20382 arg1Of assay,ChIP
R14489 T20385 T20384 arg2Of described,As
R14490 T20387 T20385 arg1Of Nouzova,described
R14491 T20387 T20386 arg2Of Nouzova,by
R14492 T20387 T20388 arg1Of Nouzova,[
R14493 T20387 T20391 arg1Of Nouzova,","
R14494 T20387 T20392 arg1Of Nouzova,in
R14495 T20387 T20394 arg1Of Nouzova,:
R14496 T20389 T20388 arg2Of 53,[
R14497 T20390 T20388 arg3Of ],[
R14498 T20393 T20392 arg2Of brief,in
R14499 T20395 T20396 arg1Of Cells,from
R14500 T20395 T20413 arg1Of Cells,were
R14501 T20395 T20414 arg2Of Cells,treated
R14502 T20398 T20397 arg1Of cells,MEL
R14503 T20398 T20399 arg1Of cells,(
R14504 T20398 T20404 arg1Of cells,or
R14505 T20401 T20399 arg2Of ×,(
R14506 T20401 T20400 arg1Of ×,4
R14507 T20401 T20402 arg1Of ×,107
R14508 T20403 T20399 arg3Of ),(
R14509 T20404 T20396 arg2Of or,from
R14510 T20407 T20404 arg2Of cells,or
R14511 T20407 T20405 arg1Of cells,fetal
R14512 T20407 T20406 arg1Of cells,liver
R14513 T20407 T20408 arg1Of cells,from
R14514 T20412 T20408 arg2Of mice,from
R14515 T20412 T20409 arg1Of mice,three
R14516 T20412 T20410 arg1Of mice,15.5-dpc
R14517 T20412 T20411 arg1Of mice,WT
R14518 T20414 T20413 arg2Of treated,were
R14519 T20414 T20415 arg1Of treated,with
R14520 T20416 T20417 arg1Of 1,%
R14521 T20418 T20415 arg2Of formaldehyde,with
R14522 T20418 T20416 arg1Of formaldehyde,1
R14523 T20418 T20419 arg1Of formaldehyde,for
R14524 T20421 T20419 arg2Of min,for
R14525 T20421 T20420 arg1Of min,10
R14526 T20421 T20422 arg1Of min,at
R14527 T20421 T20425 arg1Of min,","
R14528 T20421 T20426 arg2Of min,rinsed
R14529 T20421 T20435 arg1Of min,with
R14530 T20424 T20422 arg2Of °C,at
R14531 T20424 T20423 arg1Of °C,37
R14532 T20426 T20427 arg1Of rinsed,in
R14533 T20430 T20431 arg2Of Hanks,'
R14534 T20434 T20427 arg2Of solution,in
R14535 T20434 T20428 arg1Of solution,ice-cold
R14536 T20434 T20429 arg1Of solution,1×
R14537 T20434 T20431 arg1Of solution,'
R14538 T20434 T20432 arg1Of solution,balanced
R14539 T20434 T20433 arg1Of solution,salt
R14540 T20436 T20437 arg1Of 0.1,%
R14541 T20438 T20435 arg2Of EDTA,with
R14542 T20438 T20436 arg1Of EDTA,0.1
R14543 T20438 T20439 arg1Of EDTA,containing
R14544 T20441 T20439 arg2Of inhibitors,containing
R14545 T20441 T20440 arg1Of inhibitors,protease
R14546 T20441 T20442 arg1Of inhibitors,","
R14547 T20441 T20443 arg2Of inhibitors,collected
R14548 T20441 T20450 arg2Of inhibitors,resuspended
R14549 T20441 T20461 arg2Of inhibitors,incubated
R14550 T20445 T20443 arg1Of centrifugation,collected
R14551 T20445 T20444 arg2Of centrifugation,by
R14552 T20445 T20446 arg1Of centrifugation,at
R14553 T20448 T20446 arg2Of °C,at
R14554 T20448 T20447 arg1Of °C,4
R14555 T20450 T20451 arg1Of resuspended,in
R14556 T20450 T20460 arg1Of resuspended,and
R14557 T20455 T20451 arg2Of buffer,in
R14558 T20455 T20452 arg1Of buffer,a
R14559 T20455 T20453 arg1Of buffer,SDS
R14560 T20455 T20454 arg1Of buffer,lysis
R14561 T20455 T20456 arg1Of buffer,containing
R14562 T20458 T20456 arg2Of inhibitors,containing
R14563 T20458 T20457 arg1Of inhibitors,protease
R14564 T20460 T20449 arg1Of and,","
R14565 T20460 T20459 arg1Of and,","
R14566 T20461 T20460 arg2Of incubated,and
R14567 T20461 T20462 arg1Of incubated,on
R14568 T20461 T20464 arg1Of incubated,for
R14569 T20463 T20462 arg2Of ice,on
R14570 T20466 T20464 arg2Of min,for
R14571 T20466 T20465 arg1Of min,10
R14572 T20468 T20467 arg1Of complexes,DNA-protein
R14573 T20468 T20469 arg1Of complexes,were
R14574 T20468 T20470 arg2Of complexes,sonicated
R14575 T20470 T20469 arg2Of sonicated,were
R14576 T20470 T20471 arg1Of sonicated,to
R14577 T20472 T20473 arg1Of 200,and
R14578 T20474 T20473 arg2Of 600,and
R14579 T20475 T20471 arg2Of bp,to
R14580 T20475 T20472 arg1Of bp,200
R14581 T20475 T20474 arg1Of bp,600
R14582 T20476 T20477 arg1Of One-tenth,of
R14583 T20476 T20480 arg1Of One-tenth,was
R14584 T20476 T20481 arg2Of One-tenth,set
R14585 T20479 T20477 arg2Of sample,of
R14586 T20479 T20478 arg1Of sample,the
R14587 T20481 T20480 arg2Of set,was
R14588 T20481 T20482 arg1Of set,aside
R14589 T20481 T20483 arg1Of set,for
R14590 T20481 T20487 arg1Of set,and
R14591 T20485 T20483 arg2Of control,for
R14592 T20485 T20484 arg1Of control,input
R14593 T20487 T20486 arg1Of and,","
R14594 T20487 T20496 arg1Of and,(
R14595 T20490 T20488 arg1Of sample,the
R14596 T20490 T20489 arg1Of sample,remaining
R14597 T20490 T20491 arg1Of sample,was
R14598 T20490 T20492 arg2Of sample,precleared
R14599 T20492 T20487 arg2Of precleared,and
R14600 T20492 T20491 arg2Of precleared,was
R14601 T20492 T20493 arg1Of precleared,with
R14602 T20495 T20493 arg2Of A-Sepharose,with
R14603 T20495 T20494 arg1Of A-Sepharose,protein
R14604 T20498 T20497 arg1Of Biosciences,Amersham
R14605 T20498 T20499 arg1Of Biosciences,","
R14606 T20499 T20501 arg1Of ",",","
R14607 T20500 T20499 arg2Of Piscataway,","
R14608 T20501 T20504 arg1Of ",",","
R14609 T20503 T20501 arg2Of Jersey,","
R14610 T20503 T20502 arg1Of Jersey,New
R14611 T20504 T20496 arg2Of ",",(
R14612 T20506 T20504 arg2Of States,","
R14613 T20506 T20505 arg1Of States,United
R14614 T20507 T20496 arg3Of ),(
R14615 T20509 T20508 arg2Of preclearing,Following
R14616 T20512 T20511 arg1Of samples,the
R14617 T20512 T20513 arg1Of samples,were
R14618 T20512 T20514 arg2Of samples,split
R14619 T20514 T20513 arg2Of split,were
R14620 T20514 T20515 arg1Of split,into
R14621 T20514 T20532 arg1Of split,and
R14622 T20516 T20515 arg2Of thirds,into
R14623 T20516 T20517 arg1Of thirds,:
R14624 T20519 T20517 arg2Of sample,:
R14625 T20519 T20518 arg1Of sample,one
R14626 T20519 T20520 arg2Of sample,treated
R14627 T20520 T20521 arg1Of treated,with
R14628 T20522 T20521 arg2Of anti-Sox6,with
R14629 T20522 T20523 arg1Of anti-Sox6,","
R14630 T20525 T20523 arg2Of second,","
R14631 T20525 T20524 arg1Of second,a
R14632 T20525 T20526 arg2Of second,treated
R14633 T20526 T20527 arg1Of treated,with
R14634 T20530 T20527 arg2Of IgG,with
R14635 T20530 T20528 arg1Of IgG,normal
R14636 T20530 T20529 arg1Of IgG,rabbit
R14637 T20532 T20508 arg1Of and,Following
R14638 T20532 T20510 arg1Of and,","
R14639 T20532 T20531 arg1Of and,","
R14640 T20535 T20533 arg1Of sample,the
R14641 T20535 T20534 arg1Of sample,third
R14642 T20535 T20536 arg1Of sample,without
R14643 T20535 T20541 arg1Of sample,were
R14644 T20535 T20542 arg2Of sample,used
R14645 T20540 T20536 arg2Of two,without
R14646 T20540 T20537 arg1Of two,Ab.
R14647 T20540 T20538 arg1Of two,The
R14648 T20540 T20539 arg1Of two,last
R14649 T20542 T20532 arg2Of used,and
R14650 T20542 T20541 arg2Of used,were
R14651 T20542 T20543 arg1Of used,as
R14652 T20545 T20543 arg2Of controls,as
R14653 T20545 T20544 arg1Of controls,negative
R14654 T20548 T20546 arg1Of complexes,The
R14655 T20548 T20547 arg1Of complexes,chromatin-antibody
R14656 T20548 T20549 arg1Of complexes,were
R14657 T20548 T20550 arg2Of complexes,eluted
R14658 T20550 T20549 arg2Of eluted,were
R14659 T20550 T20552 arg1Of eluted,and
R14660 T20552 T20551 arg1Of and,","
R14661 T20556 T20553 arg1Of cross-links,the
R14662 T20556 T20554 arg1Of cross-links,DNA
R14663 T20556 T20555 arg1Of cross-links,protein
R14664 T20556 T20557 arg1Of cross-links,were
R14665 T20556 T20558 arg2Of cross-links,reversed
R14666 T20558 T20552 arg2Of reversed,and
R14667 T20558 T20557 arg2Of reversed,were
R14668 T20558 T20559 arg1Of reversed,with
R14669 T20558 T20563 arg1Of reversed,at
R14670 T20560 T20561 arg1Of 5,M
R14671 T20562 T20559 arg2Of NaCl,with
R14672 T20562 T20560 arg1Of NaCl,5
R14673 T20565 T20563 arg2Of °C,at
R14674 T20565 T20564 arg1Of °C,65
R14675 T20565 T20566 arg1Of °C,for
R14676 T20568 T20566 arg2Of h,for
R14677 T20568 T20567 arg1Of h,4
R14678 T20570 T20569 arg1Of DNA,Input
R14679 T20570 T20571 arg1Of DNA,or
R14680 T20571 T20574 arg1Of or,was
R14681 T20571 T20575 arg2Of or,used
R14682 T20573 T20571 arg2Of DNA,or
R14683 T20573 T20572 arg2Of DNA,immunoprecipitated
R14684 T20575 T20574 arg2Of used,was
R14685 T20575 T20576 arg1Of used,as
R14686 T20578 T20576 arg2Of template,as
R14687 T20578 T20577 arg1Of template,a
R14688 T20578 T20579 arg1Of template,in
R14689 T20582 T20579 arg2Of reaction,in
R14690 T20582 T20580 arg1Of reaction,the
R14691 T20582 T20581 arg1Of reaction,PCR
R14692 T20584 T20583 arg1Of amplification,PCR
R14693 T20584 T20585 arg1Of amplification,of
R14694 T20584 T20589 arg1Of amplification,was
R14695 T20584 T20590 arg2Of amplification,performed
R14696 T20584 T20592 arg1Of amplification,yielded
R14697 T20588 T20585 arg2Of promoter,of
R14698 T20588 T20586 arg1Of promoter,the
R14699 T20588 T20587 arg1Of promoter,ɛy
R14700 T20590 T20589 arg2Of performed,was
R14701 T20590 T20591 arg1Of performed,and
R14702 T20591 T20596 arg1Of and,","
R14703 T20591 T20597 arg1Of and,corresponding
R14704 T20592 T20591 arg2Of yielded,and
R14705 T20595 T20592 arg2Of amplicon,yielded
R14706 T20595 T20593 arg1Of amplicon,a
R14707 T20595 T20594 arg1Of amplicon,172-bp
R14708 T20598 T20597 arg2Of to,corresponding
R14709 T20599 T20598 arg2Of nucleotides,to
R14710 T20599 T20600 arg1Of nucleotides,−31
R14711 T20600 T20601 arg1Of −31,to
R14712 T20602 T20601 arg2Of +140,to
R14713 T20602 T20603 arg1Of +140,of
R14714 T20602 T20607 arg1Of +140,(
R14715 T20606 T20603 arg2Of promoter,of
R14716 T20606 T20604 arg1Of promoter,the
R14717 T20606 T20605 arg1Of promoter,ɛy
R14718 T20609 T20610 arg1Of MHB1688,","
R14719 T20610 T20613 arg1Of ",",and
R14720 T20611 T20610 arg2Of 5′CGAAGAATAAAAGGCCACCA3′,","
R14721 T20613 T20607 arg2Of and,(
R14722 T20613 T20608 arg1Of and,primers
R14723 T20613 T20612 arg1Of and,;
R14724 T20613 T20615 arg1Of and,","
R14725 T20614 T20613 arg2Of MHB1689,and
R14726 T20616 T20615 arg2Of 5′GCTTCACCACCAACCTCTTC3′,","
R14727 T20617 T20607 arg3Of ),(
R14728 T20618 T20619 arg1Of PCR,was
R14729 T20618 T20620 arg2Of PCR,performed
R14730 T20620 T20619 arg2Of performed,was
R14731 T20620 T20621 arg1Of performed,under
R14732 T20620 T20625 arg1Of performed,:
R14733 T20624 T20621 arg2Of conditions,under
R14734 T20624 T20622 arg1Of conditions,the
R14735 T20624 T20623 arg1Of conditions,following
R14736 T20627 T20626 arg1Of °C,95
R14737 T20627 T20628 arg1Of °C,for
R14738 T20627 T20631 arg1Of °C,followed
R14739 T20627 T20655 arg1Of °C,ending
R14740 T20630 T20628 arg2Of min,for
R14741 T20630 T20629 arg1Of min,15
R14742 T20631 T20632 arg1Of followed,by
R14743 T20631 T20635 arg1Of followed,at
R14744 T20631 T20638 arg1Of followed,for
R14745 T20631 T20641 arg1Of followed,","
R14746 T20631 T20651 arg1Of followed,for
R14747 T20631 T20654 arg1Of followed,","
R14748 T20631 T20655 modOf followed,ending
R14749 T20634 T20632 arg2Of cycles,by
R14750 T20634 T20633 arg1Of cycles,30
R14751 T20637 T20635 arg2Of °C,at
R14752 T20637 T20636 arg1Of °C,95
R14753 T20640 T20638 arg2Of s,for
R14754 T20640 T20639 arg1Of s,30
R14755 T20643 T20642 arg1Of °C,60
R14756 T20643 T20644 arg1Of °C,for
R14757 T20643 T20648 arg1Of °C,and
R14758 T20646 T20644 arg2Of s,for
R14759 T20646 T20645 arg1Of s,30
R14760 T20648 T20631 arg2Of and,followed
R14761 T20648 T20647 arg1Of and,","
R14762 T20650 T20648 arg2Of °C,and
R14763 T20650 T20649 arg1Of °C,72
R14764 T20653 T20651 arg2Of s,for
R14765 T20653 T20652 arg1Of s,45
R14766 T20655 T20656 arg1Of ending,with
R14767 T20655 T20663 arg1Of ending,for
R14768 T20659 T20656 arg2Of extension,with
R14769 T20659 T20657 arg1Of extension,a
R14770 T20659 T20658 arg1Of extension,final
R14771 T20659 T20660 arg1Of extension,at
R14772 T20662 T20660 arg2Of °C,at
R14773 T20662 T20661 arg1Of °C,72
R14774 T20665 T20663 arg2Of min,for
R14129 T19886 T19882 arg1Of antibodies,HA
R14130 T19886 T19885 arg1Of antibodies,Sox6
R14131 T19886 T19887 arg1Of antibodies,(
R14132 T19888 T19887 arg2Of described,(
R14133 T19888 T19889 arg1Of described,as
R14134 T19890 T19889 arg2Of above,as
R14135 T19891 T19887 arg3Of ),(
R14136 T19894 T19892 arg1Of sequences,The
R14137 T19894 T19893 arg1Of sequences,DNA
R14138 T19894 T19895 arg1Of sequences,of
R14139 T19894 T19898 arg1Of sequences,are
R14140 T19894 T19899 arg1Of sequences,as
R14141 T19897 T19895 arg2Of oligonucleotides,of
R14142 T19897 T19896 arg1Of oligonucleotides,the
R14143 T19898 T19901 arg1Of are,(
R14144 T19898 T19908 arg1Of are,:
R14145 T19899 T19898 arg2Of as,are
R14146 T19900 T19899 arg2Of follows,as
R14147 T19904 T19902 arg1Of oligos,only
R14148 T19904 T19903 arg1Of oligos,forward
R14149 T19904 T19905 arg1Of oligos,are
R14150 T19904 T19906 arg2Of oligos,listed
R14151 T19906 T19901 arg2Of listed,(
R14152 T19906 T19905 arg2Of listed,are
R14153 T19907 T19901 arg3Of ),(
R14154 T19913 T19909 arg2Of probe,For
R14155 T19913 T19910 arg1Of probe,the
R14156 T19913 T19911 arg1Of probe,36-bp
R14157 T19913 T19912 arg1Of probe,WT
R14158 T19913 T19914 arg1Of probe,:
R14159 T19915 T19916 arg1Of 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′,(
R14775 T20665 T20664 arg1Of min,5
R803 T1699 T1696 arg1Of box,Sry
R804 T1699 T1697 arg1Of box,type
R805 T1699 T1698 arg1Of box,HMG
R806 T1699 T1700 arg1Of box,(
R807 T1699 T1703 arg1Of box,is
R808 T1701 T1700 arg2Of Sox6,(
R809 T1702 T1700 arg3Of ),(
R810 T1705 T1703 arg2Of member,is

bionlp-st-ge-2016-coref

Id Subject Object Predicate Lexical cue
T11460 29738-29741 Antecedent denotes βh1
T11459 29732-29733 Antecedent denotes ζ
T11458 29708-29730 Anaphor denotes embryonic globin genes
T11457 28704-28706 Antecedent denotes II
T11456 28688-28699 Antecedent denotes silencers I
T11455 28668-28686 Anaphor denotes β globin silencers
T11454 27733-27741 Antecedent denotes promoter
T11453 28285-28297 Anaphor denotes the promoter
T11452 27559-27561 Antecedent denotes TF
T11451 27554-27558 Antecedent denotes COUP
T11450 27532-27536 Antecedent denotes DRED
T11449 27593-27606 Anaphor denotes these factors
T11448 26177-26181 Antecedent denotes Sox6
T11447 26168-26172 Antecedent denotes Sox5
T11446 26243-26263 Anaphor denotes the two Sox proteins
T11445 25749-25752 Antecedent denotes βH1
T11444 25743-25744 Antecedent denotes ζ
T11443 25719-25741 Anaphor denotes embryonic globin genes
T1410 6129-6138 Anaphor denotes β globins
T1409 5453-5460 Antecedent denotes β-minor
T1408 5440-5447 Antecedent denotes β-major
T1407 5435-5438 Antecedent denotes βh1
T1406 5431-5433 Antecedent denotes ɛy
T1405 5623-5634 Anaphor denotes these genes
T1414 8117-8126 Antecedent denotes ɛy globin
T1413 8141-8144 Anaphor denotes its
T1412 6140-6147 Antecedent denotes β major
T1411 6152-6157 Antecedent denotes minor
T7238 19031-19053 Antecedent denotes Sox/Sox6 binding sites
T7237 19159-19169 Anaphor denotes both sites
T7236 17718-17730 Antecedent denotes 36-bp region
T7235 18347-18364 Anaphor denotes this DNA sequence
R7678 T11458 T11460 boundBy embryonic globin genes,βh1
R746 T1405 T1406 boundBy these genes,ɛy
R747 T1405 T1407 boundBy these genes,βh1
R748 T1405 T1408 boundBy these genes,β-major
R749 T1405 T1409 boundBy these genes,β-minor
R750 T1410 T1411 boundBy β globins,minor
R751 T1410 T1412 boundBy β globins,β major
R752 T1413 T1414 boundBy its,ɛy globin
R7667 T11443 T11444 boundBy embryonic globin genes,ζ
R7668 T11443 T11445 boundBy embryonic globin genes,βH1
R7669 T11446 T11447 boundBy the two Sox proteins,Sox5
R7670 T11446 T11448 boundBy the two Sox proteins,Sox6
R7671 T11449 T11450 boundBy these factors,DRED
R7672 T11449 T11451 boundBy these factors,COUP
R7673 T11449 T11452 boundBy these factors,TF
R7674 T11453 T11454 boundBy the promoter,promoter
R7675 T11455 T11456 boundBy β globin silencers,silencers I
R7676 T11455 T11457 boundBy β globin silencers,II
R7677 T11458 T11459 boundBy embryonic globin genes,ζ
R4979 T7235 T7236 boundBy this DNA sequence,36-bp region
R4980 T7237 T7238 boundBy both sites,Sox/Sox6 binding sites

bionlp-st-ge-2016-test-proteins

Id Subject Object Predicate Lexical cue
T11546 32932-32936 Protein denotes Sox6
T11545 32843-32845 Protein denotes ɛy
T11544 32818-32822 Protein denotes Sox6
T11543 32745-32753 Protein denotes ɛ-globin
T11542 32581-32589 Protein denotes ɛ-globin
T11541 32435-32439 Protein denotes Sox6
T11540 32346-32350 Protein denotes Sox6
T11539 31899-31903 Protein denotes Sox6
T11538 31632-31636 Protein denotes Sox6
T11537 31084-31088 Protein denotes Sox6
T11536 31010-31014 Protein denotes Sox6
T11535 30976-30985 Protein denotes ɛy-globin
T11534 30908-30917 Protein denotes ɛy globin
T11533 30858-30862 Protein denotes Sox6
T11532 30674-30687 Protein denotes β-like globin
T11531 30610-30613 Protein denotes βh1
T11530 30604-30605 Protein denotes ζ
T11529 30533-30535 Protein denotes ɛy
T11528 30476-30485 Protein denotes ɛy globin
T11527 30172-30174 Protein denotes ɛy
T11526 30047-30051 Protein denotes Sox6
T11525 30022-30025 Protein denotes βh1
T11524 30016-30017 Protein denotes ζ
T11523 29983-29985 Protein denotes ɛy
T11522 29913-29916 Protein denotes βh1
T11521 29907-29908 Protein denotes ζ
T11520 29896-29905 Protein denotes ɛy globin
T11519 29824-29827 Protein denotes βh1
T11518 29818-29819 Protein denotes ζ
T11517 29804-29806 Protein denotes ɛy
T11516 29738-29741 Protein denotes βh1
T11515 29732-29733 Protein denotes ζ
T11514 29615-29624 Protein denotes ɛy globin
T11513 29481-29484 Protein denotes min
T11512 29476-29480 Protein denotes βmaj
T11511 29392-29396 Protein denotes Sox6
T11510 29368-29377 Protein denotes ɛy globin
T11509 29322-29331 Protein denotes ɛy globin
T11508 29267-29271 Protein denotes Sox6
T11507 29076-29085 Protein denotes ɛy globin
T11506 28926-28935 Protein denotes ɛy globin
T11505 28911-28915 Protein denotes Sox6
T11504 28789-28793 Protein denotes Sox6
T11503 28704-28706 Protein denotes II
T11502 28688-28699 Protein denotes silencers I
T11501 28616-28621 Protein denotes HMG-Y
T11500 28606-28611 Protein denotes HMG-I
T11499 28493-28495 Protein denotes ɛy
T11498 28455-28459 Protein denotes EKLF
T11497 28434-28438 Protein denotes DRED
T11496 28428-28432 Protein denotes DRED
T11495 28413-28415 Protein denotes ɛy
T11494 28221-28225 Protein denotes Sox6
T11493 27968-27972 Protein denotes Sox6
T11492 27730-27732 Protein denotes ɛy
T11491 27686-27690 Protein denotes Sox6
T11490 27568-27572 Protein denotes Sox6
T11489 27559-27561 Protein denotes TF
T11488 27554-27558 Protein denotes COUP
T11487 27532-27536 Protein denotes DRED
T11486 27418-27427 Protein denotes ɛy globin
T11485 27357-27361 Protein denotes Sox6
T11484 27319-27323 Protein denotes Sox6
T11483 26928-26930 Protein denotes ɛy
T11482 26893-26897 Protein denotes Sox6
T11481 26798-26800 Protein denotes ɛy
T11480 26778-26782 Protein denotes Sox6
T11479 26672-26674 Protein denotes ɛy
T11478 26644-26648 Protein denotes Sox6
T11477 26483-26487 Protein denotes Sox6
T11476 26322-26326 Protein denotes Sox6
T11475 26177-26181 Protein denotes Sox6
T11474 26168-26172 Protein denotes Sox5
T11473 26026-26028 Protein denotes 23
T11472 26018-26020 Protein denotes 13
T11471 26014-26016 Protein denotes 12
T11470 26008-26012 Protein denotes Sox5
T11469 25940-25944 Protein denotes Sox6
T11468 25895-25904 Protein denotes ɛy-globin
T11467 25869-25876 Protein denotes ɛy gene
T11466 25807-25811 Protein denotes Sox6
T11465 25791-25800 Protein denotes ɛy globin
T11464 25749-25752 Protein denotes βH1
T7272 19731-19735 Protein denotes Sox6
T7271 19572-19576 Protein denotes Sox6
T7270 19516-19518 Protein denotes ɛy
T7269 19477-19481 Protein denotes Sox6
T7268 19369-19373 Protein denotes Sox6
T7267 19290-19292 Protein denotes ɛy
T7266 19272-19276 Protein denotes Sox6
T7265 19215-19219 Protein denotes Sox6
T7264 19209-19211 Protein denotes ɛy
T7263 18974-18976 Protein denotes ɛy
T7262 18884-18888 Protein denotes Sox6
T7261 18783-18785 Protein denotes ɛy
T7260 18324-18328 Protein denotes Sox6
T7259 18315-18317 Protein denotes ɛy
T7258 18296-18305 Protein denotes β globins
T7257 18075-18079 Protein denotes Sox6
T7256 18065-18067 Protein denotes HA
T7255 18025-18030 Protein denotes c-Myc
T7254 17973-17977 Protein denotes Sox6
T7253 17905-17909 Protein denotes Sox6
T7252 17895-17900 Protein denotes c-Myc
T7251 17866-17870 Protein denotes Sox6
T7250 17754-17756 Protein denotes ɛy
T7249 17672-17676 Protein denotes Sox6
T5681 13596-13598 Protein denotes ɛy
T5680 13573-13577 Protein denotes Sox6
T5679 13551-13556 Protein denotes CtBP2
T5678 13453-13458 Protein denotes CtBP2
T5677 13433-13438 Protein denotes fgf-3
T5676 13419-13424 Protein denotes CtBP2
T5675 13323-13327 Protein denotes Sox6
T5674 11900-11902 Protein denotes ɛy
T5673 11875-11879 Protein denotes Sox6
T5672 11724-11728 Protein denotes Sox6
T5671 11556-11560 Protein denotes Sox6
T5670 11453-11463 Protein denotes luciferase
T5669 11406-11408 Protein denotes ɛy
T5668 11309-11311 Protein denotes ɛy
T5667 11274-11286 Protein denotes beta globins
T5666 11261-11263 Protein denotes ɛy
T5665 11093-11095 Protein denotes ɛy
T5664 11067-11071 Protein denotes Sox6
T5663 11031-11033 Protein denotes ɛy
T5662 10986-10988 Protein denotes ɛy
T5661 10877-10879 Protein denotes ɛy
T5660 10849-10853 Protein denotes Sox6
T1468 8410-8414 Protein denotes Sox6
T1467 8336-8345 Protein denotes ɛy globin
T1466 8330-8334 Protein denotes Sox6
T1465 8301-8310 Protein denotes ɛy globin
T1464 8184-8188 Protein denotes Sox6
T1463 8117-8126 Protein denotes ɛy globin
T1462 8078-8082 Protein denotes Sox6
T1461 8049-8058 Protein denotes ɛy globin
T1460 8037-8041 Protein denotes Sox6
T1459 7972-7981 Protein denotes ɛy globin
T1458 7666-7670 Protein denotes Sox6
T1457 7488-7492 Protein denotes Sox6
T1456 7242-7243 Protein denotes ɛ
T1455 7181-7182 Protein denotes ɛ
T1454 7063-7067 Protein denotes DRED
T1453 7050-7057 Protein denotes COUP-TF
T1452 7044-7048 Protein denotes YY-1
T1451 7036-7042 Protein denotes GATA-1
T1450 6963-6964 Protein denotes ɛ
T1449 6654-6655 Protein denotes ɛ
T1448 6625-6633 Protein denotes ɛ globin
T1447 6503-6511 Protein denotes β-globin
T1446 6485-6493 Protein denotes γ-globin
T1445 6430-6431 Protein denotes ɛ
T1444 6343-6344 Protein denotes ɛ
T1443 6273-6281 Protein denotes ɛ globin
T1442 6169-6171 Protein denotes ɛy
T1441 6152-6157 Protein denotes minor
T1440 6140-6147 Protein denotes β major
T1439 5993-6005 Protein denotes βh-1 globins
T1438 5986-5988 Protein denotes ɛy
T1437 5791-5793 Protein denotes ɛy
T9085 21788-21792 Protein denotes Sox6
T9084 21762-21764 Protein denotes ɛy
T9083 21611-21613 Protein denotes ɛy
T9082 21469-21479 Protein denotes min globin
T9081 21464-21468 Protein denotes βmaj
T9080 21361-21363 Protein denotes ɛy
T9079 21226-21235 Protein denotes ɛy globin
T9078 21137-21146 Protein denotes ɛy globin
T9077 21064-21073 Protein denotes ɛy globin
T9076 20977-20986 Protein denotes ɛy globin
T9075 20820-20829 Protein denotes ɛy globin
T9074 20748-20750 Protein denotes ɛy
T9073 20702-20706 Protein denotes Sox6
T9072 20689-20698 Protein denotes ɛy Globin
T20360 43847-43849 Protein denotes ɛy
T20359 43742-43744 Protein denotes ɛy
T20358 43388-43392 Protein denotes Sox6
T20357 43217-43226 Protein denotes protein A
T19138 40704-40708 Protein denotes Sox6
T19137 40496-40498 Protein denotes HA
T19136 40486-40491 Protein denotes c-Myc
T19135 40429-40433 Protein denotes Sox6
T19134 40298-40302 Protein denotes Sox6
T17176 37103-37108 Protein denotes GAPDH
T17175 36800-36805 Protein denotes GAPDH
T17174 36402-36412 Protein denotes min globin
T17173 36397-36401 Protein denotes βmaj
T17172 36307-36317 Protein denotes βH1 globin
T17171 36218-36226 Protein denotes ζ globin
T17170 36127-36136 Protein denotes ɛy globin
T10362 25196-25200 Protein denotes Sox6
T10361 25180-25189 Protein denotes ɛy globin
T10360 24593-24597 Protein denotes Sox6
T148 127-131 Protein denotes Sox6
T149 310-313 Protein denotes Sry
T150 352-356 Protein denotes Sox6
T151 450-454 Protein denotes Sox6
T152 479-488 Protein denotes ɛy globin
T153 688-690 Protein denotes ɛy
T154 730-734 Protein denotes Sox6
T155 865-869 Protein denotes Sox6
T156 917-919 Protein denotes ɛy
T157 955-959 Protein denotes Sox6
T158 1015-1017 Protein denotes ɛy
T159 1067-1071 Protein denotes Sox6
T160 1141-1145 Protein denotes Sox6
T161 1175-1184 Protein denotes ɛy globin
T162 1238-1242 Protein denotes Sox6
T163 1279-1283 Protein denotes Sox6
T164 1298-1307 Protein denotes ɛy globin
T146 0-4 Protein denotes Sox6
T147 23-37 Protein denotes Epsilon Globin
T1436 5453-5460 Protein denotes β-minor
T1435 5440-5447 Protein denotes β-major
T1434 5435-5438 Protein denotes βh1
T1433 5431-5433 Protein denotes ɛy
T1432 5095-5099 Protein denotes HMG2
T1431 5086-5090 Protein denotes HMG1
T1430 4894-4897 Protein denotes Sry
T1429 4781-4785 Protein denotes Sox6
T1428 4731-4732 Protein denotes p
T1427 4626-4630 Protein denotes Sox6
T1426 4611-4612 Protein denotes p
T1425 4296-4300 Protein denotes Sox6
T1424 4137-4141 Protein denotes Sox6
T1423 4051-4055 Protein denotes Sox6
T1422 3941-3944 Protein denotes Sry
T1421 3932-3936 Protein denotes Sox9
T1420 3926-3930 Protein denotes Sox6
T1419 3815-3819 Protein denotes Sox6
T1418 3697-3701 Protein denotes Sox6
T1417 3535-3539 Protein denotes Sox6
T1416 2873-2877 Protein denotes Sox6
T1415 2855-2858 Protein denotes Sry
T16053 35538-35540 Protein denotes ɛy
T16052 35393-35397 Protein denotes Sox6
T16051 35362-35366 Protein denotes Sox6
T16050 35329-35333 Protein denotes Sox6
T16049 35286-35290 Protein denotes Sox6
T16048 34718-34720 Protein denotes ɛy
T16047 34666-34668 Protein denotes ɛy
T16046 34627-34637 Protein denotes luciferase
T16045 34539-34541 Protein denotes ɛy
T16044 34370-34380 Protein denotes luciferase
T16043 34325-34327 Protein denotes ɛy
T16042 34036-34044 Protein denotes ɛ globin
T16041 33926-33927 Protein denotes ɛ
T16040 33825-33834 Protein denotes ɛy globin
T16039 33769-33771 Protein denotes ɛy
T16038 33681-33683 Protein denotes ɛy
T4486 10309-10312 Protein denotes min
T4485 10304-10308 Protein denotes βmaj
T4484 10184-10186 Protein denotes ɛy
T4483 9531-9539 Protein denotes β globin
T4482 9457-9466 Protein denotes ɛy globin
T4481 9345-9348 Protein denotes βh1
T4480 9339-9340 Protein denotes ζ
T4479 9051-9053 Protein denotes ɛy
T4478 8778-8782 Protein denotes Sox6
T4477 8676-8680 Protein denotes Sox6
T4476 8543-8552 Protein denotes ɛy globin
T4475 8519-8523 Protein denotes Sox6
T4474 8512-8514 Protein denotes ɛy
T4473 8504-8510 Protein denotes Globin
T7248 17413-17415 Protein denotes ɛy
T7247 17220-17224 Protein denotes Sox6
T7246 17207-17212 Protein denotes c-Myc
T7245 17122-17124 Protein denotes ɛy
T7244 17085-17089 Protein denotes Sox6
T7243 17049-17051 Protein denotes ɛy
T7242 16934-16936 Protein denotes ɛy
T7241 16911-16915 Protein denotes Sox6
T7240 16899-16901 Protein denotes ɛy
T7239 16872-16876 Protein denotes Sox6
T18458 38980-38984 Protein denotes Sox6
T17759 37305-37309 Protein denotes Sox6
T17758 37262-37273 Protein denotes βmaj globin
T17757 37231-37240 Protein denotes ɛy globin
T11463 25743-25744 Protein denotes ζ
T11462 25667-25671 Protein denotes Sox6
T11461 25580-25584 Protein denotes Sox6
T9829 23423-23427 Protein denotes Sox6
T9828 23315-23324 Protein denotes ɛy globin
T9827 23155-23159 Protein denotes Sox6
T9826 23040-23044 Protein denotes Sox6
T9825 22857-22861 Protein denotes Sox6
T9824 22766-22770 Protein denotes Sox6
T9823 22645-22649 Protein denotes Sox6
T9822 22570-22579 Protein denotes ɛy globin
T9821 22530-22534 Protein denotes Sox6
T9820 22459-22463 Protein denotes Sox6
T5692 14164-14168 Protein denotes Sox6
T5691 14122-14124 Protein denotes ɛy
T5690 14045-14047 Protein denotes ɛy
T5689 13994-13999 Protein denotes CtBP2
T5688 13977-13979 Protein denotes ɛy
T5687 13958-13962 Protein denotes Sox6
T5686 13891-13893 Protein denotes ɛy
T5685 13851-13855 Protein denotes Sox6
T5684 13735-13740 Protein denotes CtBP2
T5683 13730-13734 Protein denotes Sox6
T5682 13655-13659 Protein denotes Sox6
T19674 42207-42211 Protein denotes Sox6
T19673 42199-42201 Protein denotes HA
T19672 42192-42197 Protein denotes c-Myc
T19671 41540-41543 Protein denotes BSA
T19670 41444-41448 Protein denotes Sox6
T19669 41323-41347 Protein denotes T4 polynucleotide kinase
T19410 41064-41069 Protein denotes c-Myc
T19409 41021-41025 Protein denotes Sox6
T19408 40781-40785 Protein denotes Sox6
T18716 40067-40071 Protein denotes Sox6
T18715 39992-39994 Protein denotes ɛy
T11553 33499-33507 Protein denotes ɛ globin
T11552 33442-33446 Protein denotes Sox6
T11551 33370-33374 Protein denotes Sox6
T11550 33304-33312 Protein denotes ɛ globin
T11549 33160-33161 Protein denotes ɛ
T11548 33073-33081 Protein denotes ɛ globin
T11547 33037-33041 Protein denotes Sox6
T7274 19798-19800 Protein denotes ɛy
T7273 19763-19765 Protein denotes ɛy

bionlp-st-ge-2016-uniprot

Id Subject Object Predicate Lexical cue
T19959 42207-42211 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T19958 41444-41448 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T19505 41021-41025 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T19504 40781-40785 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T19243 40704-40708 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T19242 40429-40433 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T19241 40298-40302 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T18888 40067-40071 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T17945 37305-37309 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T18566 38980-38984 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T17396 37103-37108 http://www.uniprot.org/uniprot/P04406 denotes GAPDH
T17395 36800-36805 http://www.uniprot.org/uniprot/P04406 denotes GAPDH
T16450 35502-35506 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T16449 35393-35397 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T16448 35362-35366 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T16447 35329-35333 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T16446 35286-35290 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T16445 34627-34637 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T16444 34370-34380 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T13284 33442-33446 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13283 33370-33374 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13282 33235-33239 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13281 33037-33041 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13280 32932-32936 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13279 32818-32822 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13278 32435-32439 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13277 32346-32350 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13276 31899-31903 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13275 31632-31636 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13274 31084-31088 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13273 31010-31014 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13272 30858-30862 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13271 30047-30051 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13270 29392-29396 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13269 29267-29271 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13268 28911-28915 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13267 28789-28793 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13266 28221-28225 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13265 27968-27972 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13264 27686-27690 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13256 26644-26648 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13255 26483-26487 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13254 26322-26326 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13253 26177-26181 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13252 25940-25944 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13251 25807-25811 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13250 25667-25671 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13249 25580-25584 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13263 27568-27572 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13262 27496-27500 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13261 27357-27361 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13260 27319-27323 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13259 26893-26897 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13258 26778-26782 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T13257 26701-26705 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T10037 23423-23427 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T10036 23155-23159 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T10035 23040-23044 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T10034 22857-22861 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T10033 22766-22770 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T10032 22645-22649 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T10031 22530-22534 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T10030 22459-22463 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T10500 25196-25200 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T10499 24593-24597 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T9326 21788-21792 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7974 17905-17909 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7973 17866-17870 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7972 17672-17676 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7971 17640-17644 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7970 17506-17510 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7969 17220-17224 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7968 17085-17089 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7967 16911-16915 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7966 16872-16876 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7989 19731-19735 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7988 19572-19576 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7987 19477-19481 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7986 19369-19373 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7985 19272-19276 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7984 19215-19219 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7983 19035-19039 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7982 18884-18888 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7981 18836-18840 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7980 18759-18763 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7979 18554-18558 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7978 18416-18420 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7977 18324-18328 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7976 18075-18079 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T7975 17973-17977 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6220 13994-13999 http://www.uniprot.org/uniprot/P56545 denotes CtBP2
T6219 13735-13740 http://www.uniprot.org/uniprot/P56545 denotes CtBP2
T6218 13551-13556 http://www.uniprot.org/uniprot/P56545 denotes CtBP2
T6217 13453-13458 http://www.uniprot.org/uniprot/P56545 denotes CtBP2
T6216 13419-13424 http://www.uniprot.org/uniprot/P56545 denotes CtBP2
T9325 20702-20706 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6212 13958-13962 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6211 13851-13855 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6210 13730-13734 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6209 13655-13659 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6208 13573-13577 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6207 13323-13327 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6206 11875-11879 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6205 11724-11728 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6204 11556-11560 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6203 11067-11071 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6202 10849-10853 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T4878 8778-8782 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T4877 8676-8680 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T4876 8519-8523 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T474 127-131 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T475 352-356 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T476 450-454 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T477 730-734 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T478 865-869 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T479 955-959 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T480 1067-1071 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T481 1141-1145 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T482 1238-1242 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T483 1279-1283 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T473 0-4 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6215 11453-11463 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T6214 14227-14231 http://www.uniprot.org/uniprot/P35712 denotes Sox6
T6213 14164-14168 http://www.uniprot.org/uniprot/P35712 denotes Sox6

UBERON-AE

Id Subject Object Predicate Lexical cue
T20340 44107-44116 http://purl.obolibrary.org/obo/UBERON_2000106 denotes extension
T20339 42729-42734 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T18703 39822-39827 http://purl.obolibrary.org/obo/UBERON_0001977 denotes serum
T18702 39605-39610 http://purl.obolibrary.org/obo/UBERON_0001977 denotes serum
T18451 38884-38890 http://purl.obolibrary.org/obo/UBERON_0000479 denotes tissue
T18450 38874-38890 http://purl.obolibrary.org/obo/UBERON_0005291 denotes embryonic tissue
T18175 38233-38238 http://purl.obolibrary.org/obo/UBERON_0000178 denotes blood
T18174 38387-38394 http://purl.obolibrary.org/obo/UBERON_0000922 denotes embryos
T18173 38191-38198 http://purl.obolibrary.org/obo/UBERON_0000922 denotes embryos
T17742 37792-37799 http://purl.obolibrary.org/obo/UBERON_0002544 denotes digital
T11148 32191-32202 http://purl.obolibrary.org/obo/UBERON_0002371 denotes bone marrow
T11147 32182-32187 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T11146 30369-30374 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T11145 29205-29210 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T10346 24953-24958 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T10345 24675-24680 http://purl.obolibrary.org/obo/UBERON_0000178 denotes blood
T9781 23106-23119 http://purl.obolibrary.org/obo/UBERON_0003061 denotes blood islands
T9780 23106-23111 http://purl.obolibrary.org/obo/UBERON_0000178 denotes blood
T9779 23102-23105 http://purl.obolibrary.org/obo/UBERON_0009856 denotes sac
T9778 23097-23119 http://purl.obolibrary.org/obo/UBERON_0011919 denotes yolk sac blood islands
T9777 23097-23105 http://purl.obolibrary.org/obo/UBERON_0001040 denotes yolk sac
T9776 23097-23101 http://purl.obolibrary.org/obo/UBERON_2000084 denotes yolk
T9775 23352-23357 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T9774 23079-23084 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T9773 22987-22992 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T9772 22583-22588 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T9023 21703-21708 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T9022 21395-21400 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T9021 21272-21277 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T9020 21168-21175 http://purl.obolibrary.org/obo/UBERON_0000922 denotes embryos
T7140 19608-19613 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T7139 19439-19444 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T4426 9685-9690 http://purl.obolibrary.org/obo/UBERON_0000948 denotes heart
T4425 10331-10337 http://purl.obolibrary.org/obo/UBERON_0002107 denotes livers
T4424 10205-10211 http://purl.obolibrary.org/obo/UBERON_0002107 denotes livers
T4423 8966-8972 http://purl.obolibrary.org/obo/UBERON_0002107 denotes livers
T1199 4469-4474 http://purl.obolibrary.org/obo/UBERON_0000948 denotes heart
T1198 4230-4244 http://purl.obolibrary.org/obo/UBERON_0001016 denotes nervous system
T1197 4222-4244 http://purl.obolibrary.org/obo/UBERON_0001017 denotes central nervous system
T1196 4222-4229 http://purl.obolibrary.org/obo/UBERON_0012131 denotes central
T86 285-291 http://purl.obolibrary.org/obo/UBERON_0000473 denotes testis
T87 396-403 http://purl.obolibrary.org/obo/UBERON_0012131 denotes central
T88 396-418 http://purl.obolibrary.org/obo/UBERON_0001017 denotes central nervous system
T89 404-418 http://purl.obolibrary.org/obo/UBERON_0001016 denotes nervous system
T90 979-984 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver
T91 1044-1049 http://purl.obolibrary.org/obo/UBERON_0002107 denotes liver

GO-BP

Id Subject Object Predicate Lexical cue
T100 31-37 http://purl.obolibrary.org/obo/GO_0005344 denotes Globin
T104 52-77 http://purl.obolibrary.org/obo/GO_0060318 denotes Definitive Erythropoiesis
T107 63-77 http://purl.obolibrary.org/obo/GO_0030218 denotes Erythropoiesis
T19662 41433-41443 http://purl.obolibrary.org/obo/GO_0006412 denotes translated
T11252 32754-32768 http://purl.obolibrary.org/obo/GO_0016458 denotes gene silencing
T11251 32452-32476 http://purl.obolibrary.org/obo/GO_0048468 denotes terminal differentiation
T11250 31672-31696 http://purl.obolibrary.org/obo/GO_0048468 denotes terminal differentiation
T11249 32485-32496 http://purl.obolibrary.org/obo/GO_0090601 denotes enucleation
T11248 32315-32326 http://purl.obolibrary.org/obo/GO_0090601 denotes enucleation
T11247 31871-31882 http://purl.obolibrary.org/obo/GO_0090601 denotes enucleation
T11246 31147-31158 http://purl.obolibrary.org/obo/GO_0090601 denotes enucleation
T11245 30577-30588 http://purl.obolibrary.org/obo/GO_0032502 denotes development
T11244 30104-30126 http://purl.obolibrary.org/obo/GO_0043249 denotes erythrocyte maturation
T11243 28869-28894 http://purl.obolibrary.org/obo/GO_0060319 denotes primitive) erythropoiesis
T11242 28464-28485 http://purl.obolibrary.org/obo/GO_0051099 denotes activator, in binding
T11241 30432-30447 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T11240 27990-28005 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T11239 28582-28595 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T11238 27195-27208 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T11237 32136-32150 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T11236 31110-31124 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T11235 29296-29310 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T11234 29166-29180 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T11233 28880-28894 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T11232 25924-25938 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T11231 29285-29310 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T11230 29155-29180 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T11229 25913-25938 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T11228 33501-33507 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11227 33306-33312 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11226 33075-33081 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11225 32747-32753 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11224 32583-32589 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11223 31045-31051 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11222 30979-30985 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11221 30911-30917 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11220 30681-30687 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11219 30479-30485 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11218 30425-30431 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11217 30086-30092 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11216 29899-29905 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11215 29718-29724 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11214 29618-29624 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11213 29371-29377 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11212 29325-29331 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11211 29079-29085 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11210 28929-28935 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11209 28670-28676 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11208 27421-27427 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11207 25898-25904 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11206 25794-25800 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11205 25729-25735 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11204 25646-25652 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11203 33508-33518 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T11202 30962-30972 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T11201 25622-25632 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T9800 23235-23260 http://purl.obolibrary.org/obo/GO_0060319 denotes primitive, erythropoiesis
T9799 23318-23324 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9798 22573-22579 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9797 23452-23466 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T9796 23246-23260 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T9795 22965-22979 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T9794 22690-22704 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T9793 22494-22508 http://purl.obolibrary.org/obo/GO_0030218 denotes Erythropoiesis
T9792 23441-23466 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T9791 22954-22979 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T9790 22679-22704 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T9789 22483-22508 http://purl.obolibrary.org/obo/GO_0060318 denotes Definitive Erythropoiesis
T9039 21302-21316 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T5610 11279-11286 http://purl.obolibrary.org/obo/GO_0005344 denotes globins
T5609 11919-11934 http://purl.obolibrary.org/obo/GO_0006351 denotes transcriptional
T5608 11117-11132 http://purl.obolibrary.org/obo/GO_0006351 denotes transcriptional
T5607 10999-11014 http://purl.obolibrary.org/obo/GO_0006351 denotes transcriptional
T5606 10989-11014 http://purl.obolibrary.org/obo/GO_0009299 denotes mRNA, not transcriptional
T1290 7752-7778 http://purl.obolibrary.org/obo/GO_0043249 denotes maturation of erythrocytes
T1289 7521-7534 http://purl.obolibrary.org/obo/GO_0030097 denotes hematopoiesis
T1288 6405-6429 http://purl.obolibrary.org/obo/GO_0060319 denotes primitive erythropoiesis
T1287 8428-8453 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T1286 6316-6341 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T1285 6172-6188 http://purl.obolibrary.org/obo/GO_0016458 denotes gene is silenced
T1284 8439-8453 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T1283 7706-7720 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T1282 6415-6429 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T1281 6327-6341 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T1280 6041-6055 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T1279 5894-5908 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T1278 5843-5866 http://purl.obolibrary.org/obo/GO_0009888 denotes tissue- and development
T1277 5734-5748 http://purl.obolibrary.org/obo/GO_0002524 denotes hypersensitive
T1276 8339-8345 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1275 8304-8310 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1274 8120-8126 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1273 8052-8058 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1272 7975-7981 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1271 7879-7885 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1270 6627-6633 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1269 6505-6511 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1268 6487-6493 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1267 6275-6281 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1266 5811-5817 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1265 5417-5423 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1264 5383-5389 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1263 4758-4770 http://purl.obolibrary.org/obo/GO_0043473 denotes pigmentation
T1262 4421-4427 http://purl.obolibrary.org/obo/GO_0040007 denotes growth
T1261 7379-7420 http://purl.obolibrary.org/obo/GO_0021954 denotes development of the central nervous system
T1260 4203-4244 http://purl.obolibrary.org/obo/GO_0021954 denotes development of the central nervous system
T1259 7379-7420 http://purl.obolibrary.org/obo/GO_0007417 denotes development of the central nervous system
T1258 4203-4244 http://purl.obolibrary.org/obo/GO_0007417 denotes development of the central nervous system
T1257 7379-7390 http://purl.obolibrary.org/obo/GO_0032502 denotes development
T1256 5855-5866 http://purl.obolibrary.org/obo/GO_0032502 denotes development
T1255 4203-4214 http://purl.obolibrary.org/obo/GO_0032502 denotes development
T1254 5609-5634 http://purl.obolibrary.org/obo/GO_0010467 denotes expression of these genes
T1253 4080-4095 http://purl.obolibrary.org/obo/GO_0010467 denotes gene expression
T1252 3783-3796 http://purl.obolibrary.org/obo/GO_0000394 denotes mRNA splicing
T1251 3783-3796 http://purl.obolibrary.org/obo/GO_0000374 denotes mRNA splicing
T1250 3783-3796 http://purl.obolibrary.org/obo/GO_0000373 denotes mRNA splicing
T1249 3783-3796 http://purl.obolibrary.org/obo/GO_0000372 denotes mRNA splicing
T1248 3783-3796 http://purl.obolibrary.org/obo/GO_0000398 denotes mRNA splicing
T1247 3779-3796 http://purl.obolibrary.org/obo/GO_0048024 denotes pre-mRNA splicing
T1246 3970-3978 http://purl.obolibrary.org/obo/GO_0045292 denotes splicing
T1245 3850-3858 http://purl.obolibrary.org/obo/GO_0045292 denotes splicing
T1244 3788-3796 http://purl.obolibrary.org/obo/GO_0045292 denotes splicing
T1243 3742-3750 http://purl.obolibrary.org/obo/GO_0045292 denotes splicing
T1242 8145-8158 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T1241 7005-7018 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T1240 4938-4951 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T1239 4786-4799 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T1238 3444-3457 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T1237 3230-3243 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T1236 3073-3086 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T1235 2902-2915 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T112 377-418 http://purl.obolibrary.org/obo/GO_0007417 denotes development of the central nervous system
T111 377-388 http://purl.obolibrary.org/obo/GO_0032502 denotes development
T110 155-168 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T109 1199-1213 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T108 1096-1110 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T106 1188-1213 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T105 1085-1110 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T103 1301-1307 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T102 1178-1184 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T101 482-488 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17753 37782-37784 http://purl.obolibrary.org/obo/GO_0003964 denotes RT
T17752 37267-37273 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17751 37234-37240 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T10355 25216-25231 http://purl.obolibrary.org/obo/GO_0048469 denotes cell maturation
T10354 25183-25189 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T10353 24609-24623 http://purl.obolibrary.org/obo/GO_0030218 denotes erythropoiesis
T9038 21291-21316 http://purl.obolibrary.org/obo/GO_0060318 denotes definitive erythropoiesis
T9037 21473-21479 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9036 21229-21235 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9035 21140-21146 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9034 21067-21073 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9033 20980-20986 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9032 20823-20829 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9031 20692-20698 http://purl.obolibrary.org/obo/GO_0005344 denotes Globin
T20352 42981-42986 http://purl.obolibrary.org/obo/GO_0019835 denotes lysis
T19128 40638-40651 http://purl.obolibrary.org/obo/GO_0006351 denotes Transcription
T19127 40734-40744 http://purl.obolibrary.org/obo/GO_0006412 denotes translated
T19126 40531-40542 http://purl.obolibrary.org/obo/GO_0006412 denotes translation
T19125 40443-40454 http://purl.obolibrary.org/obo/GO_0006412 denotes translation
T19124 40283-40294 http://purl.obolibrary.org/obo/GO_0006412 denotes translation
T18710 39868-39874 http://purl.obolibrary.org/obo/GO_0040007 denotes growth
T18456 39004-39006 http://purl.obolibrary.org/obo/GO_0003964 denotes RT
T17162 36406-36412 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17161 36311-36317 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17160 36220-36226 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17159 36130-36136 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17158 35998-36004 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17157 35904-35910 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T16013 34135-34150 http://purl.obolibrary.org/obo/GO_0006351 denotes transcriptional
T16012 34105-34118 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T16011 33928-33942 http://purl.obolibrary.org/obo/GO_0016458 denotes gene silencing
T16010 34038-34044 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T16009 33828-33834 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T7168 18298-18305 http://purl.obolibrary.org/obo/GO_0005344 denotes globins
T7167 17270-17281 http://purl.obolibrary.org/obo/GO_0006412 denotes translation
T7166 17256-17269 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T4445 9743-9749 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4444 9533-9539 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4443 9460-9466 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4442 9325-9331 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4441 8924-8930 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4440 8546-8552 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4439 8504-8510 http://purl.obolibrary.org/obo/GO_0005344 denotes Globin
T113 377-418 http://purl.obolibrary.org/obo/GO_0021954 denotes development of the central nervous system
T114 1256-1271 http://purl.obolibrary.org/obo/GO_0048469 denotes cell maturation
T115 1284-1294 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation

GO-MF

Id Subject Object Predicate Lexical cue
T11575 32747-32753 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11574 32583-32589 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11573 31045-31051 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11572 30979-30985 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11571 30911-30917 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11570 30681-30687 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11569 30479-30485 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11568 30425-30431 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11567 30086-30092 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11566 29899-29905 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17182 36406-36412 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17181 36311-36317 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17180 36220-36226 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17179 36130-36136 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17178 35998-36004 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17177 35904-35910 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T16056 35517-35524 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T16055 34038-34044 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T16054 33828-33834 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T7275 17511-17518 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7289 18298-18305 http://purl.obolibrary.org/obo/GO_0005344 denotes globins
T7288 19577-19585 http://purl.obolibrary.org/obo/GO_0003823 denotes antibody
T7287 19482-19490 http://purl.obolibrary.org/obo/GO_0003823 denotes antibody
T7286 17910-17920 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T7285 19783-19790 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7284 19040-19047 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7283 18841-18848 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7282 18764-18771 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7281 18689-18696 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7280 18559-18566 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7279 18473-18480 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7278 18421-18428 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7277 17962-17969 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7276 17645-17652 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T4493 9743-9749 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4492 9533-9539 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4491 9460-9466 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4490 9325-9331 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4489 8924-8930 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4488 8546-8552 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T4487 8504-8510 http://purl.obolibrary.org/obo/GO_0005344 denotes Globin
T1471 5417-5423 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1470 5383-5389 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1469 3056-3063 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T166 482-488 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T167 1178-1184 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T168 1301-1307 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T169 242-253 http://purl.obolibrary.org/obo/GO_0003677 denotes DNA binding
T170 242-260 http://purl.obolibrary.org/obo/GO_0050692 denotes DNA binding domain
T171 246-253 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T172 902-909 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T165 31-37 http://purl.obolibrary.org/obo/GO_0005344 denotes Globin
T11565 29718-29724 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11564 29618-29624 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11563 29371-29377 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11562 29325-29331 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11561 29079-29085 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11560 28929-28935 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11559 28670-28676 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11558 27421-27427 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11557 25898-25904 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11556 25794-25800 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11555 25729-25735 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11554 25646-25652 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9831 23318-23324 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9830 22573-22579 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T5697 14242-14249 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T5696 13803-13810 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T5695 13799-13817 http://purl.obolibrary.org/obo/GO_0050692 denotes DNA binding domain
T5694 13799-13810 http://purl.obolibrary.org/obo/GO_0003677 denotes DNA binding
T5693 11279-11286 http://purl.obolibrary.org/obo/GO_0005344 denotes globins
T1482 8339-8345 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1481 8304-8310 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1480 8120-8126 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1479 8052-8058 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1478 7975-7981 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1477 7879-7885 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1476 6627-6633 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1475 6505-6511 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1474 6487-6493 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1473 6275-6281 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T1472 5811-5817 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T20361 43527-43535 http://purl.obolibrary.org/obo/GO_0003823 denotes antibody
T19677 42212-42222 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T19676 41761-41769 http://purl.obolibrary.org/obo/GO_0003823 denotes antibody
T19675 41487-41494 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T18459 39004-39006 http://purl.obolibrary.org/obo/GO_0003964 denotes RT
T17762 37782-37784 http://purl.obolibrary.org/obo/GO_0003964 denotes RT
T17761 37267-37273 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T17760 37234-37240 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11588 33240-33247 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11587 28755-28762 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11586 28478-28485 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11585 28312-28319 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11584 28254-28261 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11583 27056-27063 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11582 26783-26790 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11581 26569-26576 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11580 26518-26525 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11579 26221-26228 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T11578 33501-33507 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11577 33306-33312 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T11576 33075-33081 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T10363 25183-25189 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9092 21473-21479 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9091 21229-21235 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9090 21140-21146 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9089 21067-21073 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9088 20980-20986 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9087 20823-20829 http://purl.obolibrary.org/obo/GO_0005344 denotes globin
T9086 20692-20698 http://purl.obolibrary.org/obo/GO_0005344 denotes Globin
T19414 41128-41136 http://purl.obolibrary.org/obo/GO_0003823 denotes antibody
T19413 41070-41078 http://purl.obolibrary.org/obo/GO_0003823 denotes antibody
T19412 41026-41036 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T19411 40786-40796 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies

GO-CC

Id Subject Object Predicate Lexical cue
T20363 42735-42740 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T20362 42704-42709 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T19682 42212-42222 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T19681 41761-41769 http://purl.obolibrary.org/obo/GO_0042571 denotes antibody
T19680 42212-42222 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T19679 41761-41769 http://purl.obolibrary.org/obo/GO_0019815 denotes antibody
T19678 41407-41412 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T17183 36709-36713 http://purl.obolibrary.org/obo/GO_0019013 denotes core
T11599 33599-33603 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T11598 32648-32652 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T11597 32447-32451 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T11596 32281-32285 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T11595 31890-31895 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T11594 31610-31615 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T11593 31378-31383 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T11592 28200-28209 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T11591 28085-28094 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T11590 27866-27872 http://purl.obolibrary.org/obo/GO_0097610 denotes groove
T11589 27051-27055 http://purl.obolibrary.org/obo/GO_0019013 denotes core
T10367 25216-25220 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T10366 25015-25020 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T10365 24846-24851 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T10364 24681-24686 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T9834 23097-23101 http://purl.obolibrary.org/obo/GO_0060417 denotes yolk
T9833 23358-23363 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T9832 22617-22622 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T9093 21672-21677 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T7304 19316-19325 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T7303 19614-19619 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T7302 19598-19603 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T7301 19445-19450 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T7300 19425-19430 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T7299 18922-18927 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T7298 18372-18377 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T7297 18239-18244 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T7296 18179-18184 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T7295 19577-19585 http://purl.obolibrary.org/obo/GO_0042571 denotes antibody
T7294 19482-19490 http://purl.obolibrary.org/obo/GO_0042571 denotes antibody
T7293 17910-17920 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T7292 19577-19585 http://purl.obolibrary.org/obo/GO_0019815 denotes antibody
T7291 19482-19490 http://purl.obolibrary.org/obo/GO_0019815 denotes antibody
T7290 17910-17920 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T5700 13481-13486 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T5699 11570-11575 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T5698 11199-11204 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T1499 7550-7553 http://purl.obolibrary.org/obo/GO_0035301 denotes HSC
T1498 7150-7167 http://purl.obolibrary.org/obo/GO_0043234 denotes protein complexes
T1497 8209-8213 http://purl.obolibrary.org/obo/GO_0060417 denotes yolk
T1496 5937-5941 http://purl.obolibrary.org/obo/GO_0060417 denotes yolk
T1495 5479-5489 http://purl.obolibrary.org/obo/GO_0005694 denotes Chromosome
T1494 4565-4575 http://purl.obolibrary.org/obo/GO_0005694 denotes Chromosome
T1493 7540-7545 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T1492 6812-6816 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T1491 3828-3832 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T1490 5232-5241 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T1489 3393-3402 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T1488 5000-5006 http://purl.obolibrary.org/obo/GO_0097610 denotes groove
T1487 3269-3275 http://purl.obolibrary.org/obo/GO_0097610 denotes groove
T1486 3113-3119 http://purl.obolibrary.org/obo/GO_0097610 denotes groove
T174 555-560 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T175 646-651 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T176 1256-1260 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T177 1405-1409 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T178 804-813 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T20370 43527-43535 http://purl.obolibrary.org/obo/GO_0042571 denotes antibody
T20369 43527-43535 http://purl.obolibrary.org/obo/GO_0019815 denotes antibody
T20368 43517-43526 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T20367 43063-43080 http://purl.obolibrary.org/obo/GO_0043234 denotes protein complexes
T20366 43059-43080 http://purl.obolibrary.org/obo/GO_0097522 denotes DNA-protein complexes
T20365 43059-43080 http://purl.obolibrary.org/obo/GO_0032993 denotes DNA-protein complexes
T20364 43059-43080 http://purl.obolibrary.org/obo/GO_0001114 denotes DNA-protein complexes
T19139 40344-40349 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T19423 41124-41136 http://purl.obolibrary.org/obo/GO_0071736 denotes IgG antibody
T19422 41128-41136 http://purl.obolibrary.org/obo/GO_0042571 denotes antibody
T19421 41070-41078 http://purl.obolibrary.org/obo/GO_0042571 denotes antibody
T19420 41026-41036 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T19419 40786-40796 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T19418 41128-41136 http://purl.obolibrary.org/obo/GO_0019815 denotes antibody
T19417 41070-41078 http://purl.obolibrary.org/obo/GO_0019815 denotes antibody
T19416 41026-41036 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T19415 40786-40796 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T18720 39836-39841 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T18719 39741-39746 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T18718 39452-39456 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T18717 39400-39404 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell

sentences

Id Subject Object Predicate Lexical cue
T92 0-77 Sentence denotes Sox6 Directly Silences Epsilon Globin Expression in Definitive Erythropoiesis
T11200 33345-33630 Sentence denotes Thus, elucidation of the Sox6 repression mechanism and identification of other components of the Sox6-containing complex may further our understanding of ɛ globin regulation and potentially reveal additional molecular targets for the treatment of sickle cell anemia and β thalassemias.
T20351 43993-44136 Sentence denotes 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min.
T20350 43943-43992 Sentence denotes PCR was performed under the following conditions:
T20349 43717-43942 Sentence denotes PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′).
T20348 43637-43716 Sentence denotes Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction.
T20347 43513-43636 Sentence denotes The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h.
T20346 43300-43512 Sentence denotes Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls.
T20345 43115-43299 Sentence denotes One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States).
T20344 43059-43114 Sentence denotes DNA-protein complexes were sonicated to 200 and 600 bp.
T20343 42689-43058 Sentence denotes Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min.
T20342 42649-42688 Sentence denotes As described by Nouzova [53], in brief:
T20341 42637-42648 Sentence denotes ChIP assay.
T19661 42584-42635 Sentence denotes 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1650).
T19660 42507-42583 Sentence denotes 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′ (MHB1648); for mutant probe 3 (M3):
T19659 42437-42506 Sentence denotes 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1644); for mutant probe 2 (M2):
T19658 42360-42436 Sentence denotes 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1556); for mutant probe 1 (M1):
T19657 42336-42359 Sentence denotes For the 36-bp WT probe:
T19656 42245-42335 Sentence denotes The DNA sequences of the oligonucleotides are as follows (only forward oligos are listed):
T19655 42143-42244 Sentence denotes Antibodies used for supershift analyses included c-Myc, HA, and Sox6 antibodies (described as above).
T19654 42010-42142 Sentence denotes Electrophoresis was performed at a constant 19 mAmp for 4–8 h at room temperature, and the gels were dried prior to autoradiography.
T19653 41845-42009 Sentence denotes Following addition of the radiolabeled probe, the samples were incubated for 30 min or 60 min at room temperature and loaded on a 4% or 6% (w/v) polyacrylamide gel.
T19652 41644-41844 Sentence denotes For competition or supershift assays, the indicated unlabelled oligonucleotide competitor (200-fold molar excess) or antibody (3 μl) was added 30 min to 60 min prior to addition of radiolabeled probe.
T19651 41503-41643 Sentence denotes 100 mM NaCl, 10% glycerol, 200 ng/μl BSA, 50 ng/μl poly (dI-dC) or poly (dG-dC), 10 mM HEPES (pH 7), 0.1 mM EDTA, 0.25 mM DTT, 0.6 mM MgCl2.
T19650 41349-41502 Sentence denotes EMSA was performed with 5 μg of nuclear proteins from MEL cells or 3 μl of in vitro-translated Sox6 along with the reticulocyte lysate in binding buffer:
T19649 41224-41348 Sentence denotes Single-stranded complementary oligonucleotides were annealed and end-labeled with [γ-32P] ATP with T4 polynucleotide kinase.
T19648 41218-41223 Sentence denotes EMSA.
T19123 40683-40767 Sentence denotes A vector without the Sox6 coding sequence was also translated as a negative control.
T19122 40527-40682 Sentence denotes The translation was performed in a reticulocyte lysate based in vitro translational system (TNT® Quick Coupled Transcription/Translation Systems, Promega).
T19121 40425-40526 Sentence denotes The Sox6 in vitro translation expression vector, tagged with c-Myc and HA, was described before [15].
T19120 40304-40424 Sentence denotes Nuclear extracts were prepared from MEL cells (2 × 107) using a kit (Active Motif, Carlsbad, California, United States).
T19119 40246-40303 Sentence denotes Nuclear protein extract and in vitro translation of Sox6.
T19404 41017-41216 Sentence denotes All Sox6 antibodies generated similar results. c-Myc antibody was purchased from Invitrogen. Normal rabbit IgG antibody was obtained from Upstate Biotechnology (Lake Placid, New York, United States).
T19403 40781-41016 Sentence denotes Sox6 antibodies used in this study were either kindly provided by Dr. Enzo Lalli (Université Louis Pasteur, France [7]) or commercially obtained (Catalog No. sc-17332 X, Santa Cruz Biotechnology, Santa Cruz, California, United States).
T19402 40769-40780 Sentence denotes Antibodies.
T18709 40105-40244 Sentence denotes In assays of dosage effect, we used 200 ng, 500 ng, and 1000 ng). pRL-CMV 15ng (Promega) was used as a control for transfection efficiency.
T18708 39964-40104 Sentence denotes Cells were transfected with ɛy promoter reporter constructs (500 ng) along with either empty vector or Sox6 overexpression vector (1000 ng).
T18707 39830-39963 Sentence denotes GM979 cells (4 × 105) in log phase of growth were transfected with plasmids by FuGENE6 (Roche, Indianapolis, Indiana, United States).
T18706 39737-39829 Sentence denotes MEL cells were cultured in DMEM supplemented as above (without heat inactivating the serum).
T18705 39431-39736 Sentence denotes GM979 cells (Coriell Cell Repositories, Camden, New Jersey, United States) were cultured in Ham's F12 with 2 mM L-glutamine supplemented with heat-inactivated 10% fetal calf serum (Ivitrogen, Carlsbad, California, United States), penicillin (100 units/ml), streptomycin 100 μg/ml), and L-glutamine (2 mM).
T18704 39400-39430 Sentence denotes Cell culture and transfection.
T18455 39255-39398 Sentence denotes Blots were washed with 0.2× SSC, 1% SDS at 60 °C prior to exposure to X-ray film (Kodak, Rochester, New York, United States) at −80 °C for 6 d.
T18454 39170-39254 Sentence denotes The hybridization was performed in phosphate buffered 7% SDS hybridization solution.
T18453 38866-39169 Sentence denotes A mouse embryonic tissue Northern blot filter (Seegene, Rockville, Maryland, United States) was hybridized with a Sox6 probe generated by RT-PCR (nucleotides 1353–1927) and labeled with [α-32P]dCTP, by random primer labeling (RediprimeII; Amersham Biosciences, Buckinghamshire, England, United Kingdom).
T18452 38851-38865 Sentence denotes Northern blot.
T17745 37333-37527 Sentence denotes Embryos were fixed overnight by immersion in 4% paraformaldehyde, embedded in paraffin, sectioned at 5 μm, and adhered to charge modified slides (VWR, West Chester, Pennsylvania, United States).
T17744 37190-37332 Sentence denotes Antisense probes were designed to murine ɛy globin nucleotides 509–584; βmaj globin nucleotides 458–549; and mouse Sox6 nucleotides 1353–1927.
T17743 37167-37189 Sentence denotes In situ hybridization.
T17156 36984-37165 Sentence denotes Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States).
T17155 36939-36983 Sentence denotes Triplicates were done for each PCR reaction.
T17154 36854-36938 Sentence denotes Standard curve analyses were performed to test the efficiency of the amplifications.
T17153 36800-36853 Sentence denotes GAPDH mRNA levels were used as control for input RNA.
T17152 36724-36799 Sentence denotes All PCR was performed in a 25-μl reaction with 12.5 μl SYBR green supermix.
T17151 36488-36723 Sentence denotes Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility.
T17150 36423-36487 Sentence denotes 5′ATGGCCTGAATCACTTGGAC3′; and MHB1675, 5′ACGATCATATTGCCCAGGAG3′.
T17149 36393-36422 Sentence denotes For βmaj/min globin: MHB1674:
T17148 36303-36392 Sentence denotes For βH1 globin: MHB1672, 5′TGGACAACCTCAAGGAGACC3′; and MHB1673, 5′ACCTCTGGGGTGAATTCCTT3′.
T17147 36214-36302 Sentence denotes For ζ globin: MHB1668, 5′CTACCCCCAGACGAAGACCTA3′; and MHB1669, 5′CTTAACCGCATCCCCTACGG3′.
T17146 36123-36213 Sentence denotes For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′.
T17145 36047-36122 Sentence denotes All primers were searched against the NCBI database to confirm specificity.
T17144 35960-36046 Sentence denotes Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51].
T17143 35917-35959 Sentence denotes RNA was first reverse transcribed to cDNA.
T17142 35888-35916 Sentence denotes Quantitation of globin mRNA.
T16008 35568-35886 Sentence denotes Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18).
T16007 35483-35567 Sentence denotes Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR.
T16006 35335-35482 Sentence denotes A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32].
T16005 35286-35334 Sentence denotes Sox6-pcDNA3.1 [15] was used to overexpress Sox6.
T16004 35150-35285 Sentence denotes All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).
T16003 34756-35149 Sentence denotes Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9).
T16002 34679-34755 Sentence denotes A series of deletion constructs of the ɛy promoter were generated similarly.
T16001 34446-34678 Sentence denotes A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter.
T16000 34248-34445 Sentence denotes The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States).
T15999 34131-34247 Sentence denotes The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database.
T15998 34065-34130 Sentence denotes Nucleotide numbering is relative to the transcription start site.
T15997 33791-34064 Sentence denotes A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50].
T15996 33677-33790 Sentence denotes The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter.
T15995 33655-33676 Sentence denotes Plasmid construction.
T11199 33255-33344 Sentence denotes Indeed, the existence of a silencer of the human ɛ globin gene has been proposed [49,50].
T11198 33093-33254 Sentence denotes There is significant sequence homology between the human and mouse ɛ promoter regions, and the human promoter contains at least two potential Sox6 binding sites.
T11197 32917-33092 Sentence denotes Because murine Sox6 and its human counterpart are 94% identical at the amino acid level [48], it is possible that human Sox6 may also be important in human ɛ globin silencing.
T11196 32770-32916 Sentence denotes The present study identifies a novel repressor, Sox6, which binds to the ɛy proximal promoter, potentially as part of a larger repression complex.
T11195 32506-32769 Sentence denotes Recently, in vivo and in vitro analyses suggest that reactivation of human ɛ-globin would be therapeutically beneficial to adults with sickle cell disease [47], providing a rationale for detailed investigations into the molecular basis of ɛ-globin gene silencing.
T11194 32328-32505 Sentence denotes Identification of Sox6 downstream target genes and its interacting proteins will shed light on the role of Sox6 in red cell terminal differentiation and the enucleation process.
T11193 32226-32327 Sentence denotes The accompanying change in the microenvironment of red cell production may permit normal enucleation.
T11192 32126-32225 Sentence denotes Moreover, erythropoiesis has already shifted from fetal liver to bone marrow by postnatal day 10.5.
T11191 31845-32125 Sentence denotes The restoration of normal enucleation of red cells in Sox6-deficient mouse by postnatal day 10.5 may result from functional compensation of other Sox proteins (expressed at later developmental stages), since functional redundancy is a recurring theme with Sox proteins [13,45,46].
T11190 31617-31844 Sentence denotes Alternatively, Sox6 itself may play a role in red cell terminal differentiation, as it has been shown to be an important factor in cardiac [15], neuronal [10], astrocytic [11], and cartilage differentiation programs [32,41–44].
T11189 31421-31616 Sentence denotes However, the hematocrit of 18.5-dpc mutant mice is only 20% lower than that of WT (unpublished data), and this mild anemia is probably not sufficient to explain the extent of nucleated red cells.
T11188 31321-31420 Sentence denotes Severe anemia can lead to rapid premature release of red cells, prior to their complete maturation.
T11187 31192-31320 Sentence denotes This may be the result of indirect effects, such as stress-induced proliferation (resulting from cardiac defects) and/or anemia.
T11186 31084-31191 Sentence denotes Sox6 has other effects in erythropoiesis, including a delay in enucleation/maturation in p100H mutant mice.
T11185 30987-31083 Sentence denotes The mechanism by which Sox6 regulates the other embryonic globin genes remains to be elucidated.
T11184 30830-30986 Sentence denotes These findings suggest that Sox6 continues to function postnatally to silence ɛy globin expression and has a unique function in the regulation of ɛy-globin.
T11183 30560-30829 Sentence denotes At this point in development, the levels of ζ and βh1 RNA were undetectable both in mutant and WT; however, adult β-like globin RNA levels were moderately elevated in the mutant RNA compared with WT (unpublished data), similar to what we observe at 18.5 dpc (Figure 1).
T11182 30329-30559 Sentence denotes We examined a single archived sample of liver RNA from a mutant mouse on postnatal day 13.5 for globin gene expression and detected high levels of ɛy globin in this RNA sample, compared with undetectable ɛy RNA in WT control mice.
T11181 30262-30328 Sentence denotes None have been observed to live longer than 2 wk after birth [14].
T11180 30176-30261 Sentence denotes Although most p100H mutant mice die just after being born, a rare few survive longer.
T11179 30027-30175 Sentence denotes It is possible that Sox6 has a general effect on embryonic globin genes (and erythrocyte maturation) in addition to a specific role in silencing ɛy.
T11178 29880-30026 Sentence denotes However, unlike ɛy globin, ζ and βh1 decline in expression by day 18.5 dpc (Figure 1), suggesting that ɛy is regulated differently than ζ and βh1.
T11177 29799-29879 Sentence denotes Like ɛy, levels of ζ and βh1 are dramatically higher in mutant mice at 15.5 dpc.
T11176 29673-29798 Sentence denotes The expression levels of two other embryonic globin genes (ζ and βh1) are also higher in p100H homozygotes, compared with WT.
T11175 29566-29672 Sentence denotes This demonstrates that ectopic expression of the ɛy globin gene is quite robust in homozygous mutant mice.
T11174 29344-29565 Sentence denotes The expression level of ɛy globin in homozygous Sox6 null mice at 15.5 dpc and 18.5 dpc is statistically equivalent to the level of βmaj/min expression in the livers of 15.5-dpc and 18.5-dpc homozygous WT mice (Figure 1).
T11173 29223-29343 Sentence denotes Taken together, these data demonstrate that Sox6 functions in definitive erythropoiesis to silence ɛy globin expression.
T11172 28996-29222 Sentence denotes Moreover, in situ hybridization clearly shows that the persistent expression of ɛy globin in p100H mutant mice is due to defects in the silencing mechanism of definitive erythropoiesis that takes place in the liver (Figure 5).
T11171 28789-28995 Sentence denotes Sox6 expression is temporally and spatially coincident with definitive (but not primitive) erythropoiesis (Figure 6), and Sox6 represses ɛy globin expression both in vivo (Figure 1) and in vitro (Figure 2).
T11170 28511-28788 Sentence denotes Two HMG architectural proteins (distantly related to the Sox family of transcription factors), HMG-I and HMG-Y, were demonstrated to bind to the human adult β globin silencers (silencers I and II) and cause bending of the DNA, facilitating the binding of other repressors [40].
T11169 28434-28510 Sentence denotes DRED interferes with EKLF, an activator, in binding to the ɛy promoter [39].
T11168 28341-28433 Sentence denotes Another example of a repressor that interferes with an activator on the ɛy promoter is DRED.
T11167 28178-28340 Sentence denotes By changing the local chromatin structure, Sox6 could either interfere with binding of other activators to the promoter or facilitate binding of other repressors.
T11166 27921-28177 Sentence denotes Therefore, one attractive model to explain how Sox6 proteins control gene expression is that they function as architectural factors bound to DNA, influencing local chromatin structure by bending DNA and by assembling multiprotein transcriptional complexes.
T11165 27790-27920 Sentence denotes Sox proteins bind and bend linear DNA by partial intercalation in the minor groove, and can also bind to four-way junctions [2–4].
T11164 27644-27789 Sentence denotes Identification of other components of the Sox6-containing complex associated with the ɛy promoter will shed light on its mechanism of repression.
T11163 27568-27643 Sentence denotes Sox6 might interact with these factors and form a large repression complex.
T11162 27406-27567 Sentence denotes A few other ɛy globin repressors have been reported to bind to DNA sequences near the Sox/Sox6 consensus sites, including the DRED complex [37] and COUP-TF [38].
T11161 27223-27405 Sentence denotes In our EMSAs, we had to run the electrophoresis on a 4%–6% gel for at least 4–8 h to detect the Sox6-associated band, suggesting that Sox6 is part of a high molecular weight complex.
T11160 27007-27222 Sentence denotes Because Sox proteins recognize a short 6-bp core-binding sequence that allows for considerable degeneracy, the specificity of their actions is thought to rely upon interactions with other transcription factors [36].
T11159 26861-27006 Sentence denotes These observations suggest that Sox6 binds to this sequence of the ɛy promoter either as a homodimer or as a heterodimer with other Sox proteins.
T11158 26735-26860 Sentence denotes Functionally, both sites are essential for Sox6 binding to the ɛy promoter and repression of its activity (Figure 3E and 3F).
T11157 26602-26734 Sentence denotes Indeed, in the present study, the defined Sox6 target sequence of the ɛy promoter contains two Sox/Sox6 consensus sites (Figure 3A).
T11156 26409-26601 Sentence denotes Therefore, it appears that target genes for group D Sox proteins, such as Sox6, probably harbor pairs of HMG binding sites with a configuration compatible with binding of D-Sox protein dimers.
T11155 26309-26408 Sentence denotes In addition, Sox6 binds more strongly to an HMG-box dimer motif than to a single HMG-box motif [5].
T11154 26138-26308 Sentence denotes Functionally, dimerization of Sox5 and Sox6 has been shown to greatly increase the binding efficiency of the two Sox proteins to DNA that contains adjacent Sox sites [6].
T11153 26035-26137 Sentence denotes Group D Sox proteins contain a coiled–coiled domain that mediates homo- and heterodimerization [6,35].
T11152 25940-26034 Sentence denotes Sox6 belongs to group D of the Sox family of proteins that includes Sox5, 12, 13, and 23 [34].
T11151 25807-25939 Sentence denotes Sox6 directly regulates and binds to the proximal promoter of ɛy gene and represses the ɛy-globin gene in definitive erythropoiesis.
T11150 25660-25806 Sentence denotes In the Sox6 null mouse, there is a transient effect on the embryonic globin genes, ζ and βH1, and a persistent upregulation of the ɛy globin gene.
T11149 25551-25659 Sentence denotes In this report, we show that Sox6 is a novel factor in the complicated regulation mechanism of globin genes.
T10352 25126-25232 Sentence denotes These observations suggest that besides silencing the ɛy globin gene, Sox6 may affect red cell maturation.
T10351 25079-25125 Sentence denotes This alteration is noted as early as 14.5 dpc.
T10350 24929-25078 Sentence denotes In addition, the mutant liver shows a significant increase in hematopoietic precursor cells including nucleated erythrocytes at 18.5 dpc (Figure 7B).
T10349 24774-24928 Sentence denotes However, at postnatal day 10.5, we do not see circulating nucleated red cells in either WT or mutant mice, suggesting that this may be a transient effect.
T10348 24577-24773 Sentence denotes Among the other Sox6 effects in erythropoiesis, we have noticed that there are more nucleated red blood cells circulating in p100H mutant mice than in WT mice at 14.5 dpc and 18.5 dpc (Figure 7A).
T10347 24516-24576 Sentence denotes Mutant p100H Mice Have Higher Numbers of Nucleated Red Cells
T9788 23262-23467 Sentence denotes These data, taken together with the observation that ɛy globin is highly expressed in the liver cells of 14.5-dpc p100H mutant mice (Figure 5), demonstrate that Sox6 functions in definitive erythropoiesis.
T9787 23144-23261 Sentence denotes Therefore, Sox6 expression is temporally and spatially coincident with definitive, but not primitive, erythropoiesis.
T9786 22994-23143 Sentence denotes Furthermore, in situ hybridization shows that Sox6 is highly transcribed in 12.5-dpc liver, but not in yolk sac blood islands at 7.5 dpc (Figure 6B).
T9785 22834-22993 Sentence denotes As shown in Figure 6A, Sox6 is detectable by Northern blot beginning at 10.5 dpc, coincident with the temporal onset of definitive erythropoiesis in the liver.
T9784 22706-22833 Sentence denotes To determine the temporal and spatial expression pattern of Sox6, Northern blot and in situ hybridization assays were employed.
T9783 22509-22705 Sentence denotes The observation that Sox6-deficient mice ectopically express ɛy globin in liver, where definitive erythroid cells mature, suggests that Sox6 is an important regulator in definitive erythropoiesis.
T9782 22433-22508 Sentence denotes The Expression Pattern of Sox6 Suggests a Role in Definitive Erythropoiesis
T9030 21553-21803 Sentence denotes These data demonstrate that the persistent high levels of ɛy are due to ectopic expression in the definitive erythroid cells that mature in the fetal liver, suggesting that there is an intrinsic defect of the ɛy silencing mechanism in Sox6-null mice.
T9029 21437-21552 Sentence denotes However, the expression of βmaj/min globin is equally abundant in both WT and p100H mutant mice (Figure 5 E and F).
T9028 21331-21436 Sentence denotes In contrast, abundant ectopic ɛy mRNA expression is seen in the liver of 14.5-dpc mutants (Figure 5 A–D).
T9027 21213-21330 Sentence denotes As expected, ɛy globin is not expressed in the WT 14.5-dpc liver, the site of definitive erythropoiesis in the fetus.
T9026 20927-21212 Sentence denotes To determine whether the persistent expression of ɛy globin is due to residual primitive erythrocytes or is due to ectopic expression of ɛy globin in definitive erythrocytes, we examined the spatial pattern of ɛy globin transcripts in mouse embryos by in situ hybridization (Figure 5).
T9025 20806-20926 Sentence denotes Normally, the ɛy globin gene is exclusively expressed in primitive erythrocytes and silenced in definitive erythrocytes.
T9024 20660-20805 Sentence denotes The Persistent Expression of ɛy Globin in Sox6-Deficient Mice Is Due to a Defect in the ɛy-Gene–Silencing Mechanism in Definitive Erythroid Cells
T7165 19676-19831 Sentence denotes The above data (Figures 3 and 4) clearly indicate that Sox6 acts as a repressor of the ɛy gene by directly binding to the ɛy promoter, probably as a dimer.
T7164 19621-19675 Sentence denotes Normal IgG was used as a negative control (Figure 4A).
T7163 19492-19620 Sentence denotes Figure 4 shows that the ɛy proximal promoter is readily immunoprecipitated with Sox6 antibody in both MEL cells and liver cells.
T7162 19365-19491 Sentence denotes The Sox6-containing complex was immunoprecipitated from MEL cells or from liver cells of 15.5 dpc WT mice using Sox6 antibody.
T7161 19249-19364 Sentence denotes We also tested whether Sox6 binds to the ɛy promoter in vivo using chromatin immunoprecipitation (ChIP) (Figure 4).
T7160 19153-19248 Sentence denotes Thus, both sites are required for maximal repression of ɛy by Sox6, but not to the same degree.
T7159 18929-19152 Sentence denotes Consistent with the EMSA results, the mutant ɛy promoter reporter constructs (with either one or both Sox/Sox6 binding sites mutagenized) do not result in significant promoter repression in transfection studies (Figure 3F).
T7158 18698-18928 Sentence denotes To investigate the functional significance of the intact Sox/Sox6 binding sites, the ɛy promoter reporter constructs with mutagenized Sox/Sox6 binding sites were co-transfected with the Sox6 overexpression vector into GM979 cells.
T7157 18639-18697 Sentence denotes The M2 mutant probe may compete partially with WT binding.
T7156 18529-18638 Sentence denotes Ablation of putative Sox/Sox6 binding sites (M1 and M3) abolish their ability to compete in EMSA (Figure 3E).
T5605 14181-14272 Sentence denotes Analysis of this short region reveals two Sox/Sox6 consensus binding sites [5] (Figure 3A).
T5604 14020-14180 Sentence denotes Deletion analysis of the ɛy promoter, as shown in Figure 2C, defined a region (−63 to −37) within the ɛy proximal promoter that is critical for Sox6 repression.
T5603 13819-14019 Sentence denotes However, this mutant version of Sox6 retains the ability to repress the ɛy promoter in the transfection assay (Figure 2B), indicating that Sox6 represses the ɛy promoter in a CtBP2-independent manner.
T5602 13758-13818 Sentence denotes This amino acid change is not in the HMG DNA binding domain.
T5601 13507-13757 Sentence denotes To investigate whether the interaction with CtBP2 is required for Sox6 repression of the ɛy promoter, we introduced a point mutation (L386H) in the Sox6 protein that has been previously reported to be sufficient to abolish Sox6-CtBP2 interaction [5].
T5600 13453-13506 Sentence denotes CtBP2 is expressed in GM979 cells (unpublished data).
T5599 13323-13452 Sentence denotes Sox6 has been shown to act as a repressor and to interact with a widely expressed co-repressor, CtBP2, on the fgf-3 promoter [5].
T5598 11850-11941 Sentence denotes These data indicate that Sox6 acts to repress the ɛy promoter at the transcriptional level.
T5597 11681-11849 Sentence denotes In contrast, overexpression of a truncated Sox6 protein that lacks its HMG domain [32] (similar to the p 100H mouse allele) fails to repress E-Luc activity (Figure 2B).
T5596 11538-11680 Sentence denotes Overexpression of Sox6 in GM979 cells by transient transfection leads to a dosage-dependent repression of E-Luc reporter activity (Figure 2B).
T5595 11293-11537 Sentence denotes We generated an ɛy promoter reporter construct (E-Luc) by fusing a micro-LCR (μLCR) element (2.5 kb) [31] to the ɛy proximal promoter (2.2 kb), followed by the luciferase reporter gene, as shown in Figure 2A (detailed in Materials and Methods).
T5594 11044-11292 Sentence denotes To investigate whether Sox6 directly acts on the ɛy gene promoter at the transcriptional level, we used an in vitro transient transfection assay and GM979 cells, a murine erythroleukemic cell line that expresses both ɛy and adult beta globins [30].
T5593 10923-11043 Sentence denotes Real-time PCR assays (Figure 1) measure steady-state levels of ɛy mRNA, not transcriptional activity of the ɛy promoter.
T5592 10796-10922 Sentence denotes Transfection Studies Using GM979 Cells Indicate That Sox6 Directly Represses the ɛy Gene Promoter at the Transcriptional Level
T4438 10158-10382 Sentence denotes We note that the level of ɛy expression in the livers of 15.5 dpc and 18.5 dpc homozygous mutant mice is statistically equivalent to the level of βmaj/min expression in the livers of 15.5 dpc and 18.5 dpc homozygous WT mice.
T1221 6313-6480 Sentence denotes In definitive erythropoiesis, ɛ is activated and silenced autonomously [24,25], although in primitive erythropoiesis ɛ also appears to be regulated competitively [26].
T1234 8312-8454 Sentence denotes In the absence of Sox6, ɛy globin is ectopically expressed in the fetal liver, demonstrating that Sox6 functions in definitive erythropoiesis.
T1233 8160-8311 Sentence denotes In wild-type (WT) mice, Sox6 is not expressed in yolk sac blood islands, but is expressed in fetal liver, the opposite expression pattern of ɛy globin.
T1232 8065-8159 Sentence denotes We show that Sox6 binds to the proximal promoter of ɛy globin and represses its transcription.
T1231 7988-8064 Sentence denotes Here we describe and characterize the effects of Sox6 on the ɛy globin gene.
T1230 7893-7987 Sentence denotes The most extreme effect is the persistence of high expression of the embryonic ɛy globin gene.
T1229 7722-7892 Sentence denotes These effects include delayed maturation of erythrocytes (that normally enucleate prior to entering the bloodstream [27]) and higher expression of embryonic globin genes.
T1228 7634-7721 Sentence denotes In this study, we describe that Sox6 also exerts pleiotropic effects on erythropoiesis.
T1227 7331-7633 Sentence denotes In addition to playing an important role in the development of the central nervous system [8–11], cartilage [6,12,13], and muscle [14,15], it was shown that Sox6 is upregulated in long-term hematopoiesis stem cells (LT-HSC) compared with multipotent progenitors of adult mouse bone marrow lineage [28].
T1226 7199-7330 Sentence denotes Thus, it appears that the silencing of the ɛ gene involves a complicated network of multiple cis elements and transacting proteins.
T1225 6985-7198 Sentence denotes Their corresponding transcription factors, such as GATA-1, YY-1, COUP-TF, and DRED have been identified and shown to directly bind to these DNA elements (as part of protein complexes) to regulate ɛ silencing [27].
T1224 6748-6984 Sentence denotes Using promoter deletion analyses in transgenic mouse models and cell transfection assays, multiple DNA elements important to the silencing process have been previously identified in both the proximal and the distal ɛ gene promoter [27].
T1223 6578-6747 Sentence denotes All the elements responsible for silencing the ɛ globin gene are within the ɛ gene or in adjacent sequences [27], suggesting that silencing is primarily gene autonomous.
T1222 6481-6577 Sentence denotes The γ-globin to adult β-globin switch is controlled by promoter competition for the LCR [24,25].
T1220 6220-6312 Sentence denotes The mechanism of silencing of its human counterpart, ɛ globin, has been studied extensively.
T1219 6165-6219 Sentence denotes The ɛy gene is silenced in definitive erythroid cells.
T1218 6012-6164 Sentence denotes At 11.5 d post coitus (dpc), erythropoiesis shifts to the fetal liver where definitive erythroid cells express adult β globins (β major and minor) [22].
T1217 5885-6011 Sentence denotes In mice, erythropoiesis originates in the embryonic yolk sac where primitive erythroid cells express ɛy and βh-1 globins [22].
T1216 5805-5884 Sentence denotes The β-globin genes are expressed in a tissue- and development-specific fashion.
T1215 5598-5804 Sentence denotes High-level expression of these genes requires a regulatory element, the locus control region that is characterized by a set of nuclease hypersensitive sites spread over 25 kb located 5′ of the ɛy gene [23].
T1214 5405-5597 Sentence denotes The mouse β-globin genes {ɛy, βh1, β-major, and β-minor} are clustered on Chromosome 7 and they are highly homologous to their human counterparts in organizational structure and function [22].
T1213 5326-5404 Sentence denotes Specifically, HMG proteins have been shown to modulate β-globin genes [18–21].
T1212 5115-5325 Sentence denotes Modulation of DNA structure by these and other HMG proteins can mediate long-range enhancer function on both DNA and chromatin-assembled genes by bringing together distant regions of DNA and associated factors.
T1211 4846-5114 Sentence denotes Among the HMG box proteins distantly related to Sry (the first member identified of the Sox transcription factor family) that similarly bind to the minor groove and bend DNA, but without sequence specificity, are the ubiquitously expressed HMG1 and HMG2 proteins [17].
T1210 4719-4845 Sentence denotes Because the p gene functions solely in pigmentation [16], the Sox6 transcription factor is implicated in all other phenotypes.
T1209 4520-4718 Sentence denotes The p100H mutant allele is associated with a Chromosome 7 inversion that disrupts both the p gene and the Sox6 gene (and no other gene within 50,000 nucleotides of the chromosomal breakpoints) [14].
T1208 4382-4519 Sentence denotes Mice homozygous for p100H show delayed growth, develop myopathy and arterioventricular heart block, and die within 2 wk after birth [14].
T1207 4294-4381 Sentence denotes A Sox6-null mutant mouse (p100H) has previously been identified in our laboratory [14].
T1206 4033-4293 Sentence denotes Regardless of how Sox6 functions in regulating gene expression, previous studies have demonstrated that Sox6 is an important regulatory molecule that plays a role in the development of the central nervous system [8–11], cartilage [6,12,13], and muscle [14,15].
T1205 3802-4032 Sentence denotes Depletion of Sox6 in HeLa cell extracts blocked splicing of multiple substrates, and expression of the HMG domain of either Sox6, Sox9, or Sry in the extracts restored splicing, indicating functional overlap of these proteins [7].
T1204 3683-3801 Sentence denotes Intriguingly, Sox6 has also been shown to act as a general splicing factor that participates in pre-mRNA splicing [7].
T1203 3535-3682 Sentence denotes Sox6 has been reported to be able to act as either an activator or a repressor, depending on its interactors and its target promoter context [5,6].
T1202 3288-3534 Sentence denotes Therefore, Sox proteins may perform part of their function as architectural proteins by organizing local chromatin structure and assembling other DNA-bound transcription factors into biologically active, sterically defined multiprotein complexes.
T1201 3069-3287 Sentence denotes Sox transcription factors bind to the minor groove of DNA and cause a 70°–85° bend of the DNA that leads to local conformational changes [2,3], while most other transcription factors target the major groove of DNA [4].
T1200 2855-3068 Sentence denotes Sry type HMG box (Sox6) is a member of the Sox transcription factor family characterized by the conserved high mobility group (HMG) domain, consisting of 79 amino acids involved in DNA recognition and binding [1].
T99 1273-1433 Sentence denotes Thus, Sox6 regulation of ɛy globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.
T98 1112-1272 Sentence denotes The present study shows that Sox6 is required for silencing of ɛy globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation.
T97 930-1111 Sentence denotes The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of ɛy in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis.
T96 756-929 Sentence denotes Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assays demonstrate that Sox6 acts as a repressor by directly binding to the ɛy promoter.
T95 599-755 Sentence denotes Transfection assays in GM979 (erythroleukemic) cells define a 36–base pair region of the ɛy proximal promoter that is critical for Sox6 mediated repression.
T94 443-598 Sentence denotes In the Sox6-deficient mouse, p100H, ɛy globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation.
T93 127-442 Sentence denotes Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG) DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle.
T7155 18391-18528 Sentence denotes The intact consensus Sox/Sox6 binding sites of the DNA probe are required for the binding, as shown in the competition assay (Figure 3E).
T7154 18324-18390 Sentence denotes Sox6 directly binds to this DNA sequence in MEL cells (Figure 3D).
T7153 18235-18323 Sentence denotes MEL cells, a murine erythroleukemic cell line, express adult β globins, but not ɛy [33].
T7152 18147-18234 Sentence denotes Next, nuclear extracts from MEL cells were used in EMSA employing the same 36-bp probe.
T7151 17988-18146 Sentence denotes To rule out the possibility that the c-Myc tag itself binds to the probe, an HA-tagged Sox6 was used in another EMSA that confirmed these results (Figure 3C).
T7150 17880-17987 Sentence denotes Moreover, both c-Myc and Sox6 antibodies supershift the band, indicating that the binding is Sox6-specific.
T7149 17824-17879 Sentence denotes The 36-bp probe was shifted by the tagged Sox6 protein.
T7148 17672-17823 Sentence denotes Sox6 is able to physically associate with the 36-bp region (Figure 3B) within the ɛy promoter defined by the deletion analysis experiments (Figure 2C).
T7147 17526-17671 Sentence denotes Also included in our EMSA are three mutated probes that are, either truncated (M1), or mutated (M2 and M3) in Sox/Sox6 binding sites (Figure 3A).
T7146 17468-17525 Sentence denotes This probe contains two consensus Sox/Sox6 binding sites.
T7145 17340-17467 Sentence denotes The 36–base pair (bp) WT probe corresponds to the critical region of the ɛy promoter defined in our promoter deletion analyses.
T7144 17299-17339 Sentence denotes The probes used are listed in Figure 3A.
T7143 17062-17298 Sentence denotes To investigate whether Sox6 is directly associated with the ɛy promoter, we first performed electrophoretic mobility shift assays (EMSA) using a c-Myc-tagged Sox6 in a reticulocyte lysate-based transcription/translation in vitro system.
T7142 16911-17061 Sentence denotes Sox6 might repress the ɛy promoter, either through direct physical contact with the promoter or by regulating intermediates affecting the ɛy promoter.
T7141 16841-16910 Sentence denotes EMSA and ChIP Assays Show that Sox6 Directly Binds to the ɛy Promoter
T4437 9909-10157 Sentence denotes Because all of the assays were performed at the same time with the same internal control, the levels shown are relative levels and are thus comparable across all samples and are in agreement with previously published results for WT fetal mice [29].
T4436 9762-9908 Sentence denotes The graphs in Figure 1 illustrate real time PCR results that were performed in triplicate (standard deviation of the data is shown by error bars).
T4435 9629-9761 Sentence denotes Perinatal lethality of mutant mice (presumably from the heart defect [14]) precludes us from evaluating postnatal globin expression.
T4434 9491-9628 Sentence denotes Moreover, the expression level of adult β globin is also somewhat higher in p100H homozygous mice than in WT mice at 18.5 dpc (Figure 1).
T4433 9261-9490 Sentence denotes Interestingly, the expression levels of the other two embryonic globin genes (ζ and βh1) are also higher in p100H homozygous mice, compared with WT mice, but to a much lesser extent than seen for ɛy globin at 18.5 dpc (Figure 1).
T4432 9185-9260 Sentence denotes No difference was seen between WT and heterozygous mice (unpublished data).
T4431 9025-9184 Sentence denotes As shown in Figure 1, the ɛy gene is expressed at high levels at both time points in mutant mice, in contrast to the decline in expression observed in WT mice.
T4430 8856-9024 Sentence denotes Real-time PCR was used to quantitate the expression levels of other globin genes in p100H mutant and WT mouse livers at two developmental stages, 15.5 dpc and 18.5 dpc.
T4429 8701-8855 Sentence denotes This initial observation was confirmed in an independent knock-out allele of Sox6 [13] using real-time polymerase chain reaction (PCR) (unpublished data).
T4428 8539-8700 Sentence denotes The ɛy globin gene was initially identified as an upregulated transcript in the p 100H mouse using subtractive hybridization to identify Sox6 downstream targets.
T4427 8465-8538 Sentence denotes Persistent Expression of the Embryonic Globin, ɛy, in Sox6-Deficient Mice
T18184 38819-38849 Sentence denotes Original images are available.
T18183 38782-38818 Sentence denotes The camera was a Nikon Coolpix 4300.
T18182 38661-38781 Sentence denotes Objectives used were E Plan 40/0.65 160/0.17 Nikon (40× objective), E Plan 100/1.25 oil 160/0.17 Nikon (100× objective).
T18181 38606-38660 Sentence denotes Images were obtained with Nikon Labophot-2 microscope.
T18180 38530-38605 Sentence denotes Liver samples (at 14.5 dpc and 18.5 dpc) were prepared in a similar manner.
T18179 38338-38529 Sentence denotes For whole mount analysis, 14.5-dpc WT and mutant embryos, and postnatal day–10.5 mice were fixed in 10% formalin, paraffin-embedded, sectioned at 5 μm, and stained with hematoxylin and eosin.
T18178 38290-38337 Sentence denotes The slides were Wright-stained and read by DAF.
T18177 38182-38289 Sentence denotes 18.5-dpc embryos were exsanguinated and peripheral blood smears were prepared from both mutant and WT mice.
T18176 38171-38181 Sentence denotes Histology.
T17750 38139-38169 Sentence denotes Original images are available.
T17749 37932-38138 Sentence denotes Images were processed, pseudocolored, and combined using Photoshop (Adobe, San Jose, California, United States) software with Fovea Pro (Reindeer Graphics, Asheville, North Carolina, United States) plugins.
T17748 37876-37931 Sentence denotes Objectives used were 1× (NA = 0.04) and 10× (NA = 0.5).
T17747 37650-37875 Sentence denotes Darkfield and brightfield images were obtained with a Nikon Optiphot microscope (Nikon, Melville, New York, United States) and SPOT RT-Slider digital camera (Diagnostic Instruments, Sterling Heights, Michigan, United States).
T17746 37528-37649 Sentence denotes Slides were processed for in situ hybridization as described [52] using in vitro transcribed RNA probes labeled with 33P.
T1 0-77 Sentence denotes Sox6 Directly Silences Epsilon Globin Expression in Definitive Erythropoiesis
T2 78-116 Sentence denotes Sox6 Silence Epsilon Globin Expression
T3 118-126 Sentence denotes Abstract
T4 127-314 Sentence denotes Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG) DNA binding domain, first described in the testis determining gene, Sry.
T5 315-442 Sentence denotes Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle.
T6 443-598 Sentence denotes In the Sox6-deficient mouse, p100H, ɛy globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation.
T7 599-755 Sentence denotes Transfection assays in GM979 (erythroleukemic) cells define a 36–base pair region of the ɛy proximal promoter that is critical for Sox6 mediated repression.
T8 756-929 Sentence denotes Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assays demonstrate that Sox6 acts as a repressor by directly binding to the ɛy promoter.
T9 930-1111 Sentence denotes The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of ɛy in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis.
T10 1112-1272 Sentence denotes The present study shows that Sox6 is required for silencing of ɛy globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation.
T11 1273-1433 Sentence denotes Thus, Sox6 regulation of ɛy globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.
T12 1435-1443 Sentence denotes Synopsis
T13 1444-1613 Sentence denotes Beta-globin gene switching—the transition from embryonic to fetal to adult synthesis of specific globin chains—results in hemoglobins with different affinity for oxygen.
T14 1614-1918 Sentence denotes This system is a longstanding paradigm for developmental biology and is directly relevant to human disease, since small amounts of normal embryonic or fetal beta-globins can “balance” the detrimental effect of abnormal or missing adult globins in diseases such as sickle cell anemia and beta-thalassemia.
T15 1919-2097 Sentence denotes In the current study, the transcription factor Sox6 was identified as a novel and crucial silencing factor of epsilon (embryonic) globin through a somewhat serendipitous pathway.
T16 2098-2285 Sentence denotes The authors had previously identified a chromosomal inversion, p100H, by virtue of its effect on the pink-eyed dilution gene and found that the same inversion also disrupts the Sox6 gene.
T17 2286-2619 Sentence denotes Using p100H mutant mice as a tool for identifying downstream targets of Sox6, the authors discovered that epsilon-globin levels were dramatically elevated, paving the way for a series of molecular genetic experiments demonstrating that Sox6 directly binds to and normally inhibits transcription from the epsilon-globin gene promoter.
T18 2620-2840 Sentence denotes This work provides fundamental new insights into regulation of globin gene transcription during development, and provides new clues for manipulating globin gene transcription as an approach to treat human blood diseases.
T19 2842-2854 Sentence denotes Introduction
T20 2855-3068 Sentence denotes Sry type HMG box (Sox6) is a member of the Sox transcription factor family characterized by the conserved high mobility group (HMG) domain, consisting of 79 amino acids involved in DNA recognition and binding [1].
T21 3069-3287 Sentence denotes Sox transcription factors bind to the minor groove of DNA and cause a 70°–85° bend of the DNA that leads to local conformational changes [2,3], while most other transcription factors target the major groove of DNA [4].
T22 3288-3534 Sentence denotes Therefore, Sox proteins may perform part of their function as architectural proteins by organizing local chromatin structure and assembling other DNA-bound transcription factors into biologically active, sterically defined multiprotein complexes.
T23 3535-3682 Sentence denotes Sox6 has been reported to be able to act as either an activator or a repressor, depending on its interactors and its target promoter context [5,6].
T24 3683-3801 Sentence denotes Intriguingly, Sox6 has also been shown to act as a general splicing factor that participates in pre-mRNA splicing [7].
T25 3802-4032 Sentence denotes Depletion of Sox6 in HeLa cell extracts blocked splicing of multiple substrates, and expression of the HMG domain of either Sox6, Sox9, or Sry in the extracts restored splicing, indicating functional overlap of these proteins [7].
T26 4033-4293 Sentence denotes Regardless of how Sox6 functions in regulating gene expression, previous studies have demonstrated that Sox6 is an important regulatory molecule that plays a role in the development of the central nervous system [8–11], cartilage [6,12,13], and muscle [14,15].
T27 4294-4381 Sentence denotes A Sox6-null mutant mouse (p100H) has previously been identified in our laboratory [14].
T28 4382-4519 Sentence denotes Mice homozygous for p100H show delayed growth, develop myopathy and arterioventricular heart block, and die within 2 wk after birth [14].
T29 4520-4718 Sentence denotes The p100H mutant allele is associated with a Chromosome 7 inversion that disrupts both the p gene and the Sox6 gene (and no other gene within 50,000 nucleotides of the chromosomal breakpoints) [14].
T30 4719-4845 Sentence denotes Because the p gene functions solely in pigmentation [16], the Sox6 transcription factor is implicated in all other phenotypes.
T31 4846-5114 Sentence denotes Among the HMG box proteins distantly related to Sry (the first member identified of the Sox transcription factor family) that similarly bind to the minor groove and bend DNA, but without sequence specificity, are the ubiquitously expressed HMG1 and HMG2 proteins [17].
T32 5115-5325 Sentence denotes Modulation of DNA structure by these and other HMG proteins can mediate long-range enhancer function on both DNA and chromatin-assembled genes by bringing together distant regions of DNA and associated factors.
T33 5326-5404 Sentence denotes Specifically, HMG proteins have been shown to modulate β-globin genes [18–21].
T34 5405-5597 Sentence denotes The mouse β-globin genes {ɛy, βh1, β-major, and β-minor} are clustered on Chromosome 7 and they are highly homologous to their human counterparts in organizational structure and function [22].
T35 5598-5804 Sentence denotes High-level expression of these genes requires a regulatory element, the locus control region that is characterized by a set of nuclease hypersensitive sites spread over 25 kb located 5′ of the ɛy gene [23].
T36 5805-5884 Sentence denotes The β-globin genes are expressed in a tissue- and development-specific fashion.
T37 5885-6011 Sentence denotes In mice, erythropoiesis originates in the embryonic yolk sac where primitive erythroid cells express ɛy and βh-1 globins [22].
T38 6012-6164 Sentence denotes At 11.5 d post coitus (dpc), erythropoiesis shifts to the fetal liver where definitive erythroid cells express adult β globins (β major and minor) [22].
T39 6165-6219 Sentence denotes The ɛy gene is silenced in definitive erythroid cells.
T40 6220-6312 Sentence denotes The mechanism of silencing of its human counterpart, ɛ globin, has been studied extensively.
T41 6313-6480 Sentence denotes In definitive erythropoiesis, ɛ is activated and silenced autonomously [24,25], although in primitive erythropoiesis ɛ also appears to be regulated competitively [26].
T42 6481-6577 Sentence denotes The γ-globin to adult β-globin switch is controlled by promoter competition for the LCR [24,25].
T43 6578-6747 Sentence denotes All the elements responsible for silencing the ɛ globin gene are within the ɛ gene or in adjacent sequences [27], suggesting that silencing is primarily gene autonomous.
T44 6748-6984 Sentence denotes Using promoter deletion analyses in transgenic mouse models and cell transfection assays, multiple DNA elements important to the silencing process have been previously identified in both the proximal and the distal ɛ gene promoter [27].
T45 6985-7198 Sentence denotes Their corresponding transcription factors, such as GATA-1, YY-1, COUP-TF, and DRED have been identified and shown to directly bind to these DNA elements (as part of protein complexes) to regulate ɛ silencing [27].
T46 7199-7330 Sentence denotes Thus, it appears that the silencing of the ɛ gene involves a complicated network of multiple cis elements and transacting proteins.
T47 7331-7633 Sentence denotes In addition to playing an important role in the development of the central nervous system [8–11], cartilage [6,12,13], and muscle [14,15], it was shown that Sox6 is upregulated in long-term hematopoiesis stem cells (LT-HSC) compared with multipotent progenitors of adult mouse bone marrow lineage [28].
T48 7634-7721 Sentence denotes In this study, we describe that Sox6 also exerts pleiotropic effects on erythropoiesis.
T49 7722-7892 Sentence denotes These effects include delayed maturation of erythrocytes (that normally enucleate prior to entering the bloodstream [27]) and higher expression of embryonic globin genes.
T50 7893-7987 Sentence denotes The most extreme effect is the persistence of high expression of the embryonic ɛy globin gene.
T51 7988-8064 Sentence denotes Here we describe and characterize the effects of Sox6 on the ɛy globin gene.
T52 8065-8159 Sentence denotes We show that Sox6 binds to the proximal promoter of ɛy globin and represses its transcription.
T53 8160-8311 Sentence denotes In wild-type (WT) mice, Sox6 is not expressed in yolk sac blood islands, but is expressed in fetal liver, the opposite expression pattern of ɛy globin.
T54 8312-8454 Sentence denotes In the absence of Sox6, ɛy globin is ectopically expressed in the fetal liver, demonstrating that Sox6 functions in definitive erythropoiesis.
T55 8456-8463 Sentence denotes Results
T56 8465-8538 Sentence denotes Persistent Expression of the Embryonic Globin, ɛy, in Sox6-Deficient Mice
T57 8539-8700 Sentence denotes The ɛy globin gene was initially identified as an upregulated transcript in the p 100H mouse using subtractive hybridization to identify Sox6 downstream targets.
T58 8701-8855 Sentence denotes This initial observation was confirmed in an independent knock-out allele of Sox6 [13] using real-time polymerase chain reaction (PCR) (unpublished data).
T59 8856-9024 Sentence denotes Real-time PCR was used to quantitate the expression levels of other globin genes in p100H mutant and WT mouse livers at two developmental stages, 15.5 dpc and 18.5 dpc.
T60 9025-9184 Sentence denotes As shown in Figure 1, the ɛy gene is expressed at high levels at both time points in mutant mice, in contrast to the decline in expression observed in WT mice.
T61 9185-9260 Sentence denotes No difference was seen between WT and heterozygous mice (unpublished data).
T62 9261-9490 Sentence denotes Interestingly, the expression levels of the other two embryonic globin genes (ζ and βh1) are also higher in p100H homozygous mice, compared with WT mice, but to a much lesser extent than seen for ɛy globin at 18.5 dpc (Figure 1).
T63 9491-9628 Sentence denotes Moreover, the expression level of adult β globin is also somewhat higher in p100H homozygous mice than in WT mice at 18.5 dpc (Figure 1).
T64 9629-9761 Sentence denotes Perinatal lethality of mutant mice (presumably from the heart defect [14]) precludes us from evaluating postnatal globin expression.
T65 9762-9908 Sentence denotes The graphs in Figure 1 illustrate real time PCR results that were performed in triplicate (standard deviation of the data is shown by error bars).
T66 9909-10157 Sentence denotes Because all of the assays were performed at the same time with the same internal control, the levels shown are relative levels and are thus comparable across all samples and are in agreement with previously published results for WT fetal mice [29].
T67 10158-10382 Sentence denotes We note that the level of ɛy expression in the livers of 15.5 dpc and 18.5 dpc homozygous mutant mice is statistically equivalent to the level of βmaj/min expression in the livers of 15.5 dpc and 18.5 dpc homozygous WT mice.
T68 10383-10422 Sentence denotes Figure 1 Real-Time PCR of Globin Genes
T69 10423-10609 Sentence denotes The levels of expression of ɛy, βh1, zeta, and βmaj/min were measured at 15.5 dpc and 18.5 dpc in homozygous WT and p100H mutant littermates by real-time PCR (see Materials and Methods).
T70 10610-10753 Sentence denotes Relative expression levels in the livers of each genotype are graphed for each globin gene (performed in triplicate and normalized with GAPDH).
T71 10754-10794 Sentence denotes Standard deviation is indicated by bars.
T72 10796-10922 Sentence denotes Transfection Studies Using GM979 Cells Indicate That Sox6 Directly Represses the ɛy Gene Promoter at the Transcriptional Level
T73 10923-11043 Sentence denotes Real-time PCR assays (Figure 1) measure steady-state levels of ɛy mRNA, not transcriptional activity of the ɛy promoter.
T74 11044-11292 Sentence denotes To investigate whether Sox6 directly acts on the ɛy gene promoter at the transcriptional level, we used an in vitro transient transfection assay and GM979 cells, a murine erythroleukemic cell line that expresses both ɛy and adult beta globins [30].
T75 11293-11537 Sentence denotes We generated an ɛy promoter reporter construct (E-Luc) by fusing a micro-LCR (μLCR) element (2.5 kb) [31] to the ɛy proximal promoter (2.2 kb), followed by the luciferase reporter gene, as shown in Figure 2A (detailed in Materials and Methods).
T76 11538-11680 Sentence denotes Overexpression of Sox6 in GM979 cells by transient transfection leads to a dosage-dependent repression of E-Luc reporter activity (Figure 2B).
T77 11681-11849 Sentence denotes In contrast, overexpression of a truncated Sox6 protein that lacks its HMG domain [32] (similar to the p 100H mouse allele) fails to repress E-Luc activity (Figure 2B).
T78 11850-11941 Sentence denotes These data indicate that Sox6 acts to repress the ɛy promoter at the transcriptional level.
T79 11942-11989 Sentence denotes Figure 2 The Effect of Sox6 on the ɛy Promoter
T80 11990-12072 Sentence denotes (A) Constructs of the ɛy promoter reporter (E-luc) and Sox6 overexpression vector.
T81 12073-12251 Sentence denotes The E-luc reporter construct consists of a 2.5-kb μLCR element, a 2.2-kb ɛy proximal promoter, and the luciferase reporter in the pGL-3 basic plasmid (see Materials and Methods).
T82 12252-12298 Sentence denotes Sox6 expression is driven by the CMV promoter.
T83 12299-12368 Sentence denotes (B) Sox6 represses ɛy promoter activity in a dosage-dependent manner.
T84 12369-12795 Sentence denotes In GM979 cells, the E-Luc ɛy promoter reporter construct was co-transfected (1) without overexpression of Sox6; (2–4) with increasing amounts of CMV-Sox6 overexpression vector; (5) with a truncated version of Sox6 that lacks its HMG domain; (6) with a mutant version of Sox6 (L386H) that has previously been shown to abolish interaction with CtBP2; or (7) with an empty reporter plasmid (without ɛy promoter and μLCR element).
T85 12796-12860 Sentence denotes (C) Promoter deletion analyses to delimit the critical sequence.
T86 12861-13186 Sentence denotes The 2.2-kb proximal promoter or deletions of it, as indicated on the left (numbering relative to +1 = the transcription start site of ɛy globin, see Materials and Methods), were engineered in reporter constructs as in (A) and were transfected along with CMV driven Sox6 to GM979 cells (see Materials and Methods for details).
T87 13187-13281 Sentence denotes The relative repression by Sox6 on the activity of the different reporter constructs is shown.
T88 13282-13322 Sentence denotes All experiments were done in triplicate.
T89 13323-13452 Sentence denotes Sox6 has been shown to act as a repressor and to interact with a widely expressed co-repressor, CtBP2, on the fgf-3 promoter [5].
T90 13453-13506 Sentence denotes CtBP2 is expressed in GM979 cells (unpublished data).
T91 13507-13757 Sentence denotes To investigate whether the interaction with CtBP2 is required for Sox6 repression of the ɛy promoter, we introduced a point mutation (L386H) in the Sox6 protein that has been previously reported to be sufficient to abolish Sox6-CtBP2 interaction [5].
T92 13758-13818 Sentence denotes This amino acid change is not in the HMG DNA binding domain.
T93 13819-14019 Sentence denotes However, this mutant version of Sox6 retains the ability to repress the ɛy promoter in the transfection assay (Figure 2B), indicating that Sox6 represses the ɛy promoter in a CtBP2-independent manner.
T94 14020-14180 Sentence denotes Deletion analysis of the ɛy promoter, as shown in Figure 2C, defined a region (−63 to −37) within the ɛy proximal promoter that is critical for Sox6 repression.
T95 14181-14272 Sentence denotes Analysis of this short region reveals two Sox/Sox6 consensus binding sites [5] (Figure 3A).
T96 14273-14368 Sentence denotes Figure 3 Analysis of the Minimal Region (36 bp) of the Proximal ɛy Promoter Responsive to Sox6
T97 14369-14445 Sentence denotes (A) The sequence of the 36-bp fragment and its mutant versions used in EMSA.
T98 14446-14591 Sentence denotes The WT 36-bp DNA sequence (−63 to −28) of the ɛy globin proximal promoter contains two Sox/Sox6 consensus binding sites, shown in bold underline.
T99 14592-14720 Sentence denotes Versions with truncation of this sequence (M1) or mutation of one of the two consensus binding sites (M2 and M3) are also shown.
T100 14721-14753 Sentence denotes (B) EMSA with c-Myc-tagged Sox6.
T101 14754-14926 Sentence denotes EMSA was performed using the 36-bp radio-labeled WT probe (as shown in (A)) and c-Myc tagged Sox6 translated in vitro using reticulocyte lysate (see Materials and Methods).
T102 14927-15312 Sentence denotes Lane 1: radio-labeled free probe (run out of the gel); Lane 2: no competition, no antibody; Lane 3: competition with 200-fold excess cold probe, no antibody; Lane 4: no competition, c-Myc antibody (producing a supershift); Lane 5: no competition, Sox6 antibody (producing a supershift); Lane 6: no competion, no antibody using in vitro translated vector containing c-Myc, but not Sox6.
T103 15313-15342 Sentence denotes (C) EMSA with HA-tagged Sox6.
T104 15343-15423 Sentence denotes EMSA was performed similarly as in (B) using HA-tagged Sox6 translated in vitro.
T105 15424-15643 Sentence denotes Lane 1: radio-labeled free probe (run out of the gel); Lane 2: no competition, no antibody; Lane 3: competition with 200-fold excess cold probe, no antibody; Lane 4: no competition, HA antibody (producing a supershift).
T106 15644-15708 Sentence denotes (D) EMSA using MEL cell nuclear extracts and the 36-bp WT probe.
T107 15709-15930 Sentence denotes Lane 1: radio-labeled free probe (run out of the gel); Lane 2: no competition, no antibody; Lane 3: competition with 200-fold excess cold probe, no antibody; Lane 4: no competition, Sox6 antibody (producing a supershift).
T108 15931-16024 Sentence denotes (E) EMSA with c-Myc-tagged Sox6, WT and mutant versions of the 36-bp fragment in competition.
T109 16025-16129 Sentence denotes EMSA was performed using the radio-labeled 36-bp WT probe and the c-Myc tagged Sox6 translated in vitro.
T110 16130-16200 Sentence denotes Lane 1: radio-labeled free probe; Lane 2: no competition, no antibody.
T111 16201-16333 Sentence denotes Competition was performed using 200-fold excess cold probes corresponding to WT (Lane 3), M1 (Lane 4), M2 (Lane 5), and M3 (Lane 6).
T112 16334-16413 Sentence denotes (F) Both consensus Sox/Sox6 binding sites are required for Sox6 responsiveness.
T113 16414-16580 Sentence denotes GM979 cells were transfected with a reporter construct (Figure 2A) containing −63 to +45 of the ɛy proximal promoter together with the CMV-Sox6 overexpression vector.
T114 16581-16669 Sentence denotes Mutations of the consensus binding sites were also tested (M3, M2, M2 plus M3, see (A)).
T115 16670-16740 Sentence denotes The fold repression of Sox6 with the WT or mutant constructs is shown.
T116 16741-16839 Sentence denotes The baseline activities of the mutagenized reporter constructs are comparable to the WT construct.
T117 16841-16910 Sentence denotes EMSA and ChIP Assays Show that Sox6 Directly Binds to the ɛy Promoter
T118 16911-17061 Sentence denotes Sox6 might repress the ɛy promoter, either through direct physical contact with the promoter or by regulating intermediates affecting the ɛy promoter.
T119 17062-17298 Sentence denotes To investigate whether Sox6 is directly associated with the ɛy promoter, we first performed electrophoretic mobility shift assays (EMSA) using a c-Myc-tagged Sox6 in a reticulocyte lysate-based transcription/translation in vitro system.
T120 17299-17339 Sentence denotes The probes used are listed in Figure 3A.
T121 17340-17467 Sentence denotes The 36–base pair (bp) WT probe corresponds to the critical region of the ɛy promoter defined in our promoter deletion analyses.
T122 17468-17525 Sentence denotes This probe contains two consensus Sox/Sox6 binding sites.
T123 17526-17671 Sentence denotes Also included in our EMSA are three mutated probes that are, either truncated (M1), or mutated (M2 and M3) in Sox/Sox6 binding sites (Figure 3A).
T124 17672-17823 Sentence denotes Sox6 is able to physically associate with the 36-bp region (Figure 3B) within the ɛy promoter defined by the deletion analysis experiments (Figure 2C).
T125 17824-17879 Sentence denotes The 36-bp probe was shifted by the tagged Sox6 protein.
T126 17880-17987 Sentence denotes Moreover, both c-Myc and Sox6 antibodies supershift the band, indicating that the binding is Sox6-specific.
T127 17988-18146 Sentence denotes To rule out the possibility that the c-Myc tag itself binds to the probe, an HA-tagged Sox6 was used in another EMSA that confirmed these results (Figure 3C).
T128 18147-18234 Sentence denotes Next, nuclear extracts from MEL cells were used in EMSA employing the same 36-bp probe.
T129 18235-18323 Sentence denotes MEL cells, a murine erythroleukemic cell line, express adult β globins, but not ɛy [33].
T130 18324-18390 Sentence denotes Sox6 directly binds to this DNA sequence in MEL cells (Figure 3D).
T131 18391-18528 Sentence denotes The intact consensus Sox/Sox6 binding sites of the DNA probe are required for the binding, as shown in the competition assay (Figure 3E).
T132 18529-18638 Sentence denotes Ablation of putative Sox/Sox6 binding sites (M1 and M3) abolish their ability to compete in EMSA (Figure 3E).
T133 18639-18697 Sentence denotes The M2 mutant probe may compete partially with WT binding.
T134 18698-18928 Sentence denotes To investigate the functional significance of the intact Sox/Sox6 binding sites, the ɛy promoter reporter constructs with mutagenized Sox/Sox6 binding sites were co-transfected with the Sox6 overexpression vector into GM979 cells.
T135 18929-19152 Sentence denotes Consistent with the EMSA results, the mutant ɛy promoter reporter constructs (with either one or both Sox/Sox6 binding sites mutagenized) do not result in significant promoter repression in transfection studies (Figure 3F).
T136 19153-19248 Sentence denotes Thus, both sites are required for maximal repression of ɛy by Sox6, but not to the same degree.
T137 19249-19364 Sentence denotes We also tested whether Sox6 binds to the ɛy promoter in vivo using chromatin immunoprecipitation (ChIP) (Figure 4).
T138 19365-19491 Sentence denotes The Sox6-containing complex was immunoprecipitated from MEL cells or from liver cells of 15.5 dpc WT mice using Sox6 antibody.
T139 19492-19620 Sentence denotes Figure 4 shows that the ɛy proximal promoter is readily immunoprecipitated with Sox6 antibody in both MEL cells and liver cells.
T140 19621-19675 Sentence denotes Normal IgG was used as a negative control (Figure 4A).
T141 19676-19831 Sentence denotes The above data (Figures 3 and 4) clearly indicate that Sox6 acts as a repressor of the ɛy gene by directly binding to the ɛy promoter, probably as a dimer.
T142 19832-19852 Sentence denotes Figure 4 ChIP Assay
T143 19853-19952 Sentence denotes MEL cells (A) and 15.5-dpc fetal liver cells (B) were treated as detailed in Materials and Methods.
T144 19953-20174 Sentence denotes 10% of the sample was saved as total input (Inp); remaining samples were divided: plus Sox6 antibody (Ab+), minus Sox6 antibody (Ab−), as well as no DNA (DNA−) and normal rabbit IgG (IgG) that served as negative controls.
T145 20175-20294 Sentence denotes Other controls for these experiments included PCR within the promoter of the α-globin gene and intron 24 of the p gene.
T146 20295-20333 Sentence denotes Both were negative (unpublished data).
T147 20334-20464 Sentence denotes PCR was carried out using primer pairs flanking the Sox/Sox6 binding sites (see Material and Methods) of the ɛy proximal promoter.
T148 20465-20554 Sentence denotes For all reactions, we used 2 μl of immuno-precipitated DNA and 2 μl of 1/100 total input.
T149 20555-20614 Sentence denotes Semiquantitative PCR was done within the exponential range.
T150 20615-20658 Sentence denotes Multiple independent experiments were done.
T151 20660-20805 Sentence denotes The Persistent Expression of ɛy Globin in Sox6-Deficient Mice Is Due to a Defect in the ɛy-Gene–Silencing Mechanism in Definitive Erythroid Cells
T152 20806-20926 Sentence denotes Normally, the ɛy globin gene is exclusively expressed in primitive erythrocytes and silenced in definitive erythrocytes.
T153 20927-21212 Sentence denotes To determine whether the persistent expression of ɛy globin is due to residual primitive erythrocytes or is due to ectopic expression of ɛy globin in definitive erythrocytes, we examined the spatial pattern of ɛy globin transcripts in mouse embryos by in situ hybridization (Figure 5).
T154 21213-21330 Sentence denotes As expected, ɛy globin is not expressed in the WT 14.5-dpc liver, the site of definitive erythropoiesis in the fetus.
T155 21331-21436 Sentence denotes In contrast, abundant ectopic ɛy mRNA expression is seen in the liver of 14.5-dpc mutants (Figure 5 A–D).
T156 21437-21552 Sentence denotes However, the expression of βmaj/min globin is equally abundant in both WT and p100H mutant mice (Figure 5 E and F).
T157 21553-21803 Sentence denotes These data demonstrate that the persistent high levels of ɛy are due to ectopic expression in the definitive erythroid cells that mature in the fetal liver, suggesting that there is an intrinsic defect of the ɛy silencing mechanism in Sox6-null mice.
T158 21804-21906 Sentence denotes Figure 5 In Situ Hybridization of ɛy and βmaj/min transcripts in WT and p100H Mutant Mice at 14.5 dpc
T159 21907-22031 Sentence denotes Expression of ɛy globin (A–D) and β globin (E and F) in sagittal sections of 14.5-dpc fetuses is shown in pseudocolor (red).
T160 22032-22045 Sentence denotes (A) WT fetus.
T161 22046-22080 Sentence denotes (B) p100H Homozygous mutant fetus.
T162 22081-22113 Sentence denotes (C and D) Inset boxes are shown.
T163 22114-22193 Sentence denotes Prominent expression of ɛy globin is only detected in the liver of mutant mice.
T164 22194-22286 Sentence denotes (E and F) In contrast, both WT and mutant mouse livers express adult βmaj/min, respectively.
T165 22287-22367 Sentence denotes No signals were detected above background using sense probes (unpublished data).
T166 22368-22431 Sentence denotes The size bars represent 1 mm for (A) and (B); 100 μm for (C–F).
T167 22433-22508 Sentence denotes The Expression Pattern of Sox6 Suggests a Role in Definitive Erythropoiesis
T168 22509-22705 Sentence denotes The observation that Sox6-deficient mice ectopically express ɛy globin in liver, where definitive erythroid cells mature, suggests that Sox6 is an important regulator in definitive erythropoiesis.
T169 22706-22833 Sentence denotes To determine the temporal and spatial expression pattern of Sox6, Northern blot and in situ hybridization assays were employed.
T170 22834-22993 Sentence denotes As shown in Figure 6A, Sox6 is detectable by Northern blot beginning at 10.5 dpc, coincident with the temporal onset of definitive erythropoiesis in the liver.
T171 22994-23143 Sentence denotes Furthermore, in situ hybridization shows that Sox6 is highly transcribed in 12.5-dpc liver, but not in yolk sac blood islands at 7.5 dpc (Figure 6B).
T172 23144-23261 Sentence denotes Therefore, Sox6 expression is temporally and spatially coincident with definitive, but not primitive, erythropoiesis.
T173 23262-23467 Sentence denotes These data, taken together with the observation that ɛy globin is highly expressed in the liver cells of 14.5-dpc p100H mutant mice (Figure 5), demonstrate that Sox6 functions in definitive erythropoiesis.
T174 23468-23540 Sentence denotes Figure 6 Expression Pattern of Sox6 by Northern Blot and In Situ Assays
T175 23541-23613 Sentence denotes (A) Sox6 expression during embryonic development shown by Northern blot.
T176 23614-23710 Sentence denotes Each lane contains 20 μg of total RNA from embryos whose ages are listed above each lane as dpc.
T177 23711-23812 Sentence denotes The filter was hybridized with a 32P-labeled 575-bp mouse Sox6 cDNA fragment (nucleotides 1353–1927).
T178 23813-23878 Sentence denotes Numbers on the left are sizes of standard marker fragments in kb.
T179 23879-23930 Sentence denotes (B) Sox6 expression shown by in situ hybridization.
T180 23931-23939 Sentence denotes Panel i:
T181 23940-24114 Sentence denotes Sagittal section through an E12.5 mouse embryo using antisense Sox6. mRNA distribution is represented by pseudocolored red signal superimposed on the counterstained specimen.
T182 24115-24237 Sentence denotes Sox6 transcripts are detected primarily in the fetal liver, developing nervous system, chondrocytes and craniofacial area.
T183 24238-24247 Sentence denotes Panel ii:
T184 24248-24305 Sentence denotes The sense control probe shows no signal above background.
T185 24306-24368 Sentence denotes Panel iii: E7.5 embryo hybridized to antisense probe for Sox6.
T186 24369-24482 Sentence denotes No signal is detected above background specifically in blood islands (or with the sense probe, unpublished data).
T187 24483-24514 Sentence denotes The size bars represent 100 μm.
T188 24516-24576 Sentence denotes Mutant p100H Mice Have Higher Numbers of Nucleated Red Cells
T189 24577-24773 Sentence denotes Among the other Sox6 effects in erythropoiesis, we have noticed that there are more nucleated red blood cells circulating in p100H mutant mice than in WT mice at 14.5 dpc and 18.5 dpc (Figure 7A).
T190 24774-24928 Sentence denotes However, at postnatal day 10.5, we do not see circulating nucleated red cells in either WT or mutant mice, suggesting that this may be a transient effect.
T191 24929-25078 Sentence denotes In addition, the mutant liver shows a significant increase in hematopoietic precursor cells including nucleated erythrocytes at 18.5 dpc (Figure 7B).
T192 25079-25125 Sentence denotes This alteration is noted as early as 14.5 dpc.
T193 25126-25232 Sentence denotes These observations suggest that besides silencing the ɛy globin gene, Sox6 may affect red cell maturation.
T194 25233-25304 Sentence denotes Figure 7 The Blood and Liver Phenotype of WT and p100H Homozygous Mice
T195 25305-25423 Sentence denotes (A) Red blood cells of WT mice (left panels) and p100H homozygous mice (right panels) are shown at the indicated ages.
T196 25424-25538 Sentence denotes (B) Liver cells of WT mice (left panels) and p100H homozygous mice (right panels) are shown at the indicated ages.
T197 25540-25550 Sentence denotes Discussion
T198 25551-25659 Sentence denotes In this report, we show that Sox6 is a novel factor in the complicated regulation mechanism of globin genes.
T199 25660-25806 Sentence denotes In the Sox6 null mouse, there is a transient effect on the embryonic globin genes, ζ and βH1, and a persistent upregulation of the ɛy globin gene.
T200 25807-25939 Sentence denotes Sox6 directly regulates and binds to the proximal promoter of ɛy gene and represses the ɛy-globin gene in definitive erythropoiesis.
T201 25940-26034 Sentence denotes Sox6 belongs to group D of the Sox family of proteins that includes Sox5, 12, 13, and 23 [34].
T202 26035-26137 Sentence denotes Group D Sox proteins contain a coiled–coiled domain that mediates homo- and heterodimerization [6,35].
T203 26138-26308 Sentence denotes Functionally, dimerization of Sox5 and Sox6 has been shown to greatly increase the binding efficiency of the two Sox proteins to DNA that contains adjacent Sox sites [6].
T204 26309-26408 Sentence denotes In addition, Sox6 binds more strongly to an HMG-box dimer motif than to a single HMG-box motif [5].
T205 26409-26601 Sentence denotes Therefore, it appears that target genes for group D Sox proteins, such as Sox6, probably harbor pairs of HMG binding sites with a configuration compatible with binding of D-Sox protein dimers.
T206 26602-26734 Sentence denotes Indeed, in the present study, the defined Sox6 target sequence of the ɛy promoter contains two Sox/Sox6 consensus sites (Figure 3A).
T207 26735-26860 Sentence denotes Functionally, both sites are essential for Sox6 binding to the ɛy promoter and repression of its activity (Figure 3E and 3F).
T208 26861-27006 Sentence denotes These observations suggest that Sox6 binds to this sequence of the ɛy promoter either as a homodimer or as a heterodimer with other Sox proteins.
T209 27007-27222 Sentence denotes Because Sox proteins recognize a short 6-bp core-binding sequence that allows for considerable degeneracy, the specificity of their actions is thought to rely upon interactions with other transcription factors [36].
T210 27223-27405 Sentence denotes In our EMSAs, we had to run the electrophoresis on a 4%–6% gel for at least 4–8 h to detect the Sox6-associated band, suggesting that Sox6 is part of a high molecular weight complex.
T211 27406-27567 Sentence denotes A few other ɛy globin repressors have been reported to bind to DNA sequences near the Sox/Sox6 consensus sites, including the DRED complex [37] and COUP-TF [38].
T212 27568-27643 Sentence denotes Sox6 might interact with these factors and form a large repression complex.
T213 27644-27789 Sentence denotes Identification of other components of the Sox6-containing complex associated with the ɛy promoter will shed light on its mechanism of repression.
T214 27790-27920 Sentence denotes Sox proteins bind and bend linear DNA by partial intercalation in the minor groove, and can also bind to four-way junctions [2–4].
T215 27921-28177 Sentence denotes Therefore, one attractive model to explain how Sox6 proteins control gene expression is that they function as architectural factors bound to DNA, influencing local chromatin structure by bending DNA and by assembling multiprotein transcriptional complexes.
T216 28178-28340 Sentence denotes By changing the local chromatin structure, Sox6 could either interfere with binding of other activators to the promoter or facilitate binding of other repressors.
T217 28341-28433 Sentence denotes Another example of a repressor that interferes with an activator on the ɛy promoter is DRED.
T218 28434-28510 Sentence denotes DRED interferes with EKLF, an activator, in binding to the ɛy promoter [39].
T219 28511-28788 Sentence denotes Two HMG architectural proteins (distantly related to the Sox family of transcription factors), HMG-I and HMG-Y, were demonstrated to bind to the human adult β globin silencers (silencers I and II) and cause bending of the DNA, facilitating the binding of other repressors [40].
T220 28789-28995 Sentence denotes Sox6 expression is temporally and spatially coincident with definitive (but not primitive) erythropoiesis (Figure 6), and Sox6 represses ɛy globin expression both in vivo (Figure 1) and in vitro (Figure 2).
T221 28996-29222 Sentence denotes Moreover, in situ hybridization clearly shows that the persistent expression of ɛy globin in p100H mutant mice is due to defects in the silencing mechanism of definitive erythropoiesis that takes place in the liver (Figure 5).
T222 29223-29343 Sentence denotes Taken together, these data demonstrate that Sox6 functions in definitive erythropoiesis to silence ɛy globin expression.
T223 29344-29565 Sentence denotes The expression level of ɛy globin in homozygous Sox6 null mice at 15.5 dpc and 18.5 dpc is statistically equivalent to the level of βmaj/min expression in the livers of 15.5-dpc and 18.5-dpc homozygous WT mice (Figure 1).
T224 29566-29672 Sentence denotes This demonstrates that ectopic expression of the ɛy globin gene is quite robust in homozygous mutant mice.
T225 29673-29798 Sentence denotes The expression levels of two other embryonic globin genes (ζ and βh1) are also higher in p100H homozygotes, compared with WT.
T226 29799-29879 Sentence denotes Like ɛy, levels of ζ and βh1 are dramatically higher in mutant mice at 15.5 dpc.
T227 29880-30026 Sentence denotes However, unlike ɛy globin, ζ and βh1 decline in expression by day 18.5 dpc (Figure 1), suggesting that ɛy is regulated differently than ζ and βh1.
T228 30027-30175 Sentence denotes It is possible that Sox6 has a general effect on embryonic globin genes (and erythrocyte maturation) in addition to a specific role in silencing ɛy.
T229 30176-30261 Sentence denotes Although most p100H mutant mice die just after being born, a rare few survive longer.
T230 30262-30328 Sentence denotes None have been observed to live longer than 2 wk after birth [14].
T231 30329-30559 Sentence denotes We examined a single archived sample of liver RNA from a mutant mouse on postnatal day 13.5 for globin gene expression and detected high levels of ɛy globin in this RNA sample, compared with undetectable ɛy RNA in WT control mice.
T232 30560-30829 Sentence denotes At this point in development, the levels of ζ and βh1 RNA were undetectable both in mutant and WT; however, adult β-like globin RNA levels were moderately elevated in the mutant RNA compared with WT (unpublished data), similar to what we observe at 18.5 dpc (Figure 1).
T233 30830-30986 Sentence denotes These findings suggest that Sox6 continues to function postnatally to silence ɛy globin expression and has a unique function in the regulation of ɛy-globin.
T234 30987-31083 Sentence denotes The mechanism by which Sox6 regulates the other embryonic globin genes remains to be elucidated.
T235 31084-31191 Sentence denotes Sox6 has other effects in erythropoiesis, including a delay in enucleation/maturation in p100H mutant mice.
T236 31192-31320 Sentence denotes This may be the result of indirect effects, such as stress-induced proliferation (resulting from cardiac defects) and/or anemia.
T237 31321-31420 Sentence denotes Severe anemia can lead to rapid premature release of red cells, prior to their complete maturation.
T238 31421-31616 Sentence denotes However, the hematocrit of 18.5-dpc mutant mice is only 20% lower than that of WT (unpublished data), and this mild anemia is probably not sufficient to explain the extent of nucleated red cells.
T239 31617-31844 Sentence denotes Alternatively, Sox6 itself may play a role in red cell terminal differentiation, as it has been shown to be an important factor in cardiac [15], neuronal [10], astrocytic [11], and cartilage differentiation programs [32,41–44].
T240 31845-32125 Sentence denotes The restoration of normal enucleation of red cells in Sox6-deficient mouse by postnatal day 10.5 may result from functional compensation of other Sox proteins (expressed at later developmental stages), since functional redundancy is a recurring theme with Sox proteins [13,45,46].
T241 32126-32225 Sentence denotes Moreover, erythropoiesis has already shifted from fetal liver to bone marrow by postnatal day 10.5.
T242 32226-32327 Sentence denotes The accompanying change in the microenvironment of red cell production may permit normal enucleation.
T243 32328-32505 Sentence denotes Identification of Sox6 downstream target genes and its interacting proteins will shed light on the role of Sox6 in red cell terminal differentiation and the enucleation process.
T244 32506-32769 Sentence denotes Recently, in vivo and in vitro analyses suggest that reactivation of human ɛ-globin would be therapeutically beneficial to adults with sickle cell disease [47], providing a rationale for detailed investigations into the molecular basis of ɛ-globin gene silencing.
T245 32770-32916 Sentence denotes The present study identifies a novel repressor, Sox6, which binds to the ɛy proximal promoter, potentially as part of a larger repression complex.
T246 32917-33092 Sentence denotes Because murine Sox6 and its human counterpart are 94% identical at the amino acid level [48], it is possible that human Sox6 may also be important in human ɛ globin silencing.
T247 33093-33254 Sentence denotes There is significant sequence homology between the human and mouse ɛ promoter regions, and the human promoter contains at least two potential Sox6 binding sites.
T248 33255-33344 Sentence denotes Indeed, the existence of a silencer of the human ɛ globin gene has been proposed [49,50].
T249 33345-33630 Sentence denotes Thus, elucidation of the Sox6 repression mechanism and identification of other components of the Sox6-containing complex may further our understanding of ɛ globin regulation and potentially reveal additional molecular targets for the treatment of sickle cell anemia and β thalassemias.
T250 33632-33653 Sentence denotes Materials and Methods
T251 33655-33676 Sentence denotes Plasmid construction.
T252 33677-33790 Sentence denotes The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter.
T253 33791-34064 Sentence denotes A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50].
T254 34065-34130 Sentence denotes Nucleotide numbering is relative to the transcription start site.
T255 34131-34247 Sentence denotes The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database.
T256 34248-34445 Sentence denotes The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States).
T257 34446-34678 Sentence denotes A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter.
T258 34679-34755 Sentence denotes A series of deletion constructs of the ɛy promoter were generated similarly.
T259 34756-35149 Sentence denotes Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9).
T260 35150-35285 Sentence denotes All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).
T261 35286-35334 Sentence denotes Sox6-pcDNA3.1 [15] was used to overexpress Sox6.
T262 35335-35482 Sentence denotes A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32].
T263 35483-35567 Sentence denotes Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR.
T264 35568-35886 Sentence denotes Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18).
T265 35888-35916 Sentence denotes Quantitation of globin mRNA.
T266 35917-35959 Sentence denotes RNA was first reverse transcribed to cDNA.
T267 35960-36046 Sentence denotes Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51].
T268 36047-36122 Sentence denotes All primers were searched against the NCBI database to confirm specificity.
T269 36123-36213 Sentence denotes For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′.
T270 36214-36302 Sentence denotes For ζ globin: MHB1668, 5′CTACCCCCAGACGAAGACCTA3′; and MHB1669, 5′CTTAACCGCATCCCCTACGG3′.
T271 36303-36392 Sentence denotes For βH1 globin: MHB1672, 5′TGGACAACCTCAAGGAGACC3′; and MHB1673, 5′ACCTCTGGGGTGAATTCCTT3′.
T272 36393-36422 Sentence denotes For βmaj/min globin: MHB1674:
T273 36423-36487 Sentence denotes 5′ATGGCCTGAATCACTTGGAC3′; and MHB1675, 5′ACGATCATATTGCCCAGGAG3′.
T274 36488-36723 Sentence denotes Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility.
T275 36724-36799 Sentence denotes All PCR was performed in a 25-μl reaction with 12.5 μl SYBR green supermix.
T276 36800-36853 Sentence denotes GAPDH mRNA levels were used as control for input RNA.
T277 36854-36938 Sentence denotes Standard curve analyses were performed to test the efficiency of the amplifications.
T278 36939-36983 Sentence denotes Triplicates were done for each PCR reaction.
T279 36984-37165 Sentence denotes Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States).
T280 37167-37189 Sentence denotes In situ hybridization.
T281 37190-37332 Sentence denotes Antisense probes were designed to murine ɛy globin nucleotides 509–584; βmaj globin nucleotides 458–549; and mouse Sox6 nucleotides 1353–1927.
T282 37333-37527 Sentence denotes Embryos were fixed overnight by immersion in 4% paraformaldehyde, embedded in paraffin, sectioned at 5 μm, and adhered to charge modified slides (VWR, West Chester, Pennsylvania, United States).
T283 37528-37649 Sentence denotes Slides were processed for in situ hybridization as described [52] using in vitro transcribed RNA probes labeled with 33P.
T284 37650-37875 Sentence denotes Darkfield and brightfield images were obtained with a Nikon Optiphot microscope (Nikon, Melville, New York, United States) and SPOT RT-Slider digital camera (Diagnostic Instruments, Sterling Heights, Michigan, United States).
T285 37876-37931 Sentence denotes Objectives used were 1× (NA = 0.04) and 10× (NA = 0.5).
T286 37932-38138 Sentence denotes Images were processed, pseudocolored, and combined using Photoshop (Adobe, San Jose, California, United States) software with Fovea Pro (Reindeer Graphics, Asheville, North Carolina, United States) plugins.
T287 38139-38169 Sentence denotes Original images are available.
T288 38171-38181 Sentence denotes Histology.
T289 38182-38289 Sentence denotes 18.5-dpc embryos were exsanguinated and peripheral blood smears were prepared from both mutant and WT mice.
T290 38290-38337 Sentence denotes The slides were Wright-stained and read by DAF.
T291 38338-38529 Sentence denotes For whole mount analysis, 14.5-dpc WT and mutant embryos, and postnatal day–10.5 mice were fixed in 10% formalin, paraffin-embedded, sectioned at 5 μm, and stained with hematoxylin and eosin.
T292 38530-38605 Sentence denotes Liver samples (at 14.5 dpc and 18.5 dpc) were prepared in a similar manner.
T293 38606-38660 Sentence denotes Images were obtained with Nikon Labophot-2 microscope.
T294 38661-38781 Sentence denotes Objectives used were E Plan 40/0.65 160/0.17 Nikon (40× objective), E Plan 100/1.25 oil 160/0.17 Nikon (100× objective).
T295 38782-38818 Sentence denotes The camera was a Nikon Coolpix 4300.
T296 38819-38849 Sentence denotes Original images are available.
T297 38851-38865 Sentence denotes Northern blot.
T298 38866-39169 Sentence denotes A mouse embryonic tissue Northern blot filter (Seegene, Rockville, Maryland, United States) was hybridized with a Sox6 probe generated by RT-PCR (nucleotides 1353–1927) and labeled with [α-32P]dCTP, by random primer labeling (RediprimeII; Amersham Biosciences, Buckinghamshire, England, United Kingdom).
T299 39170-39254 Sentence denotes The hybridization was performed in phosphate buffered 7% SDS hybridization solution.
T300 39255-39398 Sentence denotes Blots were washed with 0.2× SSC, 1% SDS at 60 °C prior to exposure to X-ray film (Kodak, Rochester, New York, United States) at −80 °C for 6 d.
T301 39400-39430 Sentence denotes Cell culture and transfection.
T302 39431-39736 Sentence denotes GM979 cells (Coriell Cell Repositories, Camden, New Jersey, United States) were cultured in Ham's F12 with 2 mM L-glutamine supplemented with heat-inactivated 10% fetal calf serum (Ivitrogen, Carlsbad, California, United States), penicillin (100 units/ml), streptomycin 100 μg/ml), and L-glutamine (2 mM).
T303 39737-39829 Sentence denotes MEL cells were cultured in DMEM supplemented as above (without heat inactivating the serum).
T304 39830-39963 Sentence denotes GM979 cells (4 × 105) in log phase of growth were transfected with plasmids by FuGENE6 (Roche, Indianapolis, Indiana, United States).
T305 39964-40104 Sentence denotes Cells were transfected with ɛy promoter reporter constructs (500 ng) along with either empty vector or Sox6 overexpression vector (1000 ng).
T306 40105-40244 Sentence denotes In assays of dosage effect, we used 200 ng, 500 ng, and 1000 ng). pRL-CMV 15ng (Promega) was used as a control for transfection efficiency.
T307 40246-40303 Sentence denotes Nuclear protein extract and in vitro translation of Sox6.
T308 40304-40424 Sentence denotes Nuclear extracts were prepared from MEL cells (2 × 107) using a kit (Active Motif, Carlsbad, California, United States).
T309 40425-40526 Sentence denotes The Sox6 in vitro translation expression vector, tagged with c-Myc and HA, was described before [15].
T310 40527-40682 Sentence denotes The translation was performed in a reticulocyte lysate based in vitro translational system (TNT® Quick Coupled Transcription/Translation Systems, Promega).
T311 40683-40767 Sentence denotes A vector without the Sox6 coding sequence was also translated as a negative control.
T312 40769-40780 Sentence denotes Antibodies.
T313 40781-41016 Sentence denotes Sox6 antibodies used in this study were either kindly provided by Dr. Enzo Lalli (Université Louis Pasteur, France [7]) or commercially obtained (Catalog No. sc-17332 X, Santa Cruz Biotechnology, Santa Cruz, California, United States).
T314 41017-41109 Sentence denotes All Sox6 antibodies generated similar results. c-Myc antibody was purchased from Invitrogen.
T315 41110-41216 Sentence denotes Normal rabbit IgG antibody was obtained from Upstate Biotechnology (Lake Placid, New York, United States).
T316 41218-41223 Sentence denotes EMSA.
T317 41224-41348 Sentence denotes Single-stranded complementary oligonucleotides were annealed and end-labeled with [γ-32P] ATP with T4 polynucleotide kinase.
T318 41349-41502 Sentence denotes EMSA was performed with 5 μg of nuclear proteins from MEL cells or 3 μl of in vitro-translated Sox6 along with the reticulocyte lysate in binding buffer:
T319 41503-41643 Sentence denotes 100 mM NaCl, 10% glycerol, 200 ng/μl BSA, 50 ng/μl poly (dI-dC) or poly (dG-dC), 10 mM HEPES (pH 7), 0.1 mM EDTA, 0.25 mM DTT, 0.6 mM MgCl2.
T320 41644-41844 Sentence denotes For competition or supershift assays, the indicated unlabelled oligonucleotide competitor (200-fold molar excess) or antibody (3 μl) was added 30 min to 60 min prior to addition of radiolabeled probe.
T321 41845-42009 Sentence denotes Following addition of the radiolabeled probe, the samples were incubated for 30 min or 60 min at room temperature and loaded on a 4% or 6% (w/v) polyacrylamide gel.
T322 42010-42142 Sentence denotes Electrophoresis was performed at a constant 19 mAmp for 4–8 h at room temperature, and the gels were dried prior to autoradiography.
T323 42143-42244 Sentence denotes Antibodies used for supershift analyses included c-Myc, HA, and Sox6 antibodies (described as above).
T324 42245-42335 Sentence denotes The DNA sequences of the oligonucleotides are as follows (only forward oligos are listed):
T325 42336-42359 Sentence denotes For the 36-bp WT probe:
T326 42360-42436 Sentence denotes 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1556); for mutant probe 1 (M1):
T327 42437-42506 Sentence denotes 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1644); for mutant probe 2 (M2):
T328 42507-42583 Sentence denotes 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′ (MHB1648); for mutant probe 3 (M3):
T329 42584-42635 Sentence denotes 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1650).
T330 42637-42648 Sentence denotes ChIP assay.
T331 42649-42688 Sentence denotes As described by Nouzova [53], in brief:
T332 42689-43058 Sentence denotes Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min.
T333 43059-43114 Sentence denotes DNA-protein complexes were sonicated to 200 and 600 bp.
T334 43115-43299 Sentence denotes One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States).
T335 43300-43467 Sentence denotes Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab.
T336 43468-43512 Sentence denotes The last two were used as negative controls.
T337 43513-43636 Sentence denotes The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h.
T338 43637-43716 Sentence denotes Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction.
T339 43717-43942 Sentence denotes PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′).
T340 43943-43992 Sentence denotes PCR was performed under the following conditions:
T341 43993-44136 Sentence denotes 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min.
T342 44138-44160 Sentence denotes Supporting Information
T343 44162-44179 Sentence denotes Accession Numbers
T344 44180-44537 Sentence denotes Accession numbers for the genes and gene products discussed in this paper are βH1 globin (GenBank NM_008219), βmaj globin (J00413) (in situ), βmaj/min globin (NM_008220) (real time PCR), ɛy globin cDNA (NM_008221) from the Fantom (Functional Annotation of Mouse) database (http://fantom2.gsc.riken.jp), ζ globin (GenBank NM_010405), and mouse Sox6 (U32614).

ICD10

Id Subject Object Predicate Lexical cue
T1485 4437-4445 http://purl.bioontology.org/ontology/ICD10/G72.9 denotes myopathy
T1484 7406-7413 http://purl.bioontology.org/ontology/ICD10/R45.0 denotes nervous
T1483 4230-4237 http://purl.bioontology.org/ontology/ICD10/R45.0 denotes nervous
T173 404-411 http://purl.bioontology.org/ontology/ICD10/R45.0 denotes nervous

simple1

Id Subject Object Predicate Lexical cue
T231 0-4 Protein denotes Sox6
T232 23-37 Protein denotes Epsilon Globin
T20381 43847-43849 Protein denotes ɛy
T20380 43742-43744 Protein denotes ɛy
T20379 43388-43392 Protein denotes Sox6
T20378 43217-43226 Protein denotes protein A
T19693 42207-42211 Protein denotes Sox6
T19692 42199-42201 Protein denotes HA
T19691 42192-42197 Protein denotes c-Myc
T19690 41540-41543 Protein denotes BSA
T19689 41444-41448 Protein denotes Sox6
T19688 41323-41347 Protein denotes T4 polynucleotide kinase
T19149 40704-40708 Protein denotes Sox6
T19148 40496-40498 Protein denotes HA
T19147 40486-40491 Protein denotes c-Myc
T19146 40429-40433 Protein denotes Sox6
T19145 40298-40302 Protein denotes Sox6
T19426 41064-41069 Protein denotes c-Myc
T19425 41021-41025 Protein denotes Sox6
T19424 40781-40785 Protein denotes Sox6
T18722 40067-40071 Protein denotes Sox6
T18721 39992-39994 Protein denotes ɛy
T18460 38980-38984 Protein denotes Sox6
T17765 37305-37309 Protein denotes Sox6
T17764 37262-37273 Protein denotes βmaj globin
T17763 37231-37240 Protein denotes ɛy globin
T17190 37103-37108 Protein denotes GAPDH
T17189 36800-36805 Protein denotes GAPDH
T17188 36402-36412 Protein denotes min globin
T17187 36397-36401 Protein denotes βmaj
T17186 36307-36317 Protein denotes βH1 globin
T17185 36218-36226 Protein denotes ζ globin
T17184 36127-36136 Protein denotes ɛy globin
T16072 35538-35540 Protein denotes ɛy
T16071 35393-35397 Protein denotes Sox6
T16070 35362-35366 Protein denotes Sox6
T16069 35329-35333 Protein denotes Sox6
T16068 35286-35290 Protein denotes Sox6
T16067 34718-34720 Protein denotes ɛy
T16066 34666-34668 Protein denotes ɛy
T16065 34627-34637 Protein denotes luciferase
T16064 34539-34541 Protein denotes ɛy
T16063 34370-34380 Protein denotes luciferase
T16062 34325-34327 Protein denotes ɛy
T16061 34036-34044 Protein denotes ɛ globin
T16060 33926-33927 Protein denotes ɛ
T16059 33825-33834 Protein denotes ɛy globin
T16058 33769-33771 Protein denotes ɛy
T16057 33681-33683 Protein denotes ɛy
T11817 33499-33507 Protein denotes ɛ globin
T11816 33442-33446 Protein denotes Sox6
T11815 33370-33374 Protein denotes Sox6
T11814 33304-33312 Protein denotes ɛ globin
T11813 33160-33161 Protein denotes ɛ
T11812 33073-33081 Protein denotes ɛ globin
T11811 33037-33041 Protein denotes Sox6
T11810 32932-32936 Protein denotes Sox6
T11809 32843-32845 Protein denotes ɛy
T11808 32818-32822 Protein denotes Sox6
T11807 32745-32753 Protein denotes ɛ-globin
T11806 32581-32589 Protein denotes ɛ-globin
T11805 32435-32439 Protein denotes Sox6
T11804 32346-32350 Protein denotes Sox6
T11803 31899-31903 Protein denotes Sox6
T11802 31632-31636 Protein denotes Sox6
T11801 31084-31088 Protein denotes Sox6
T11800 31010-31014 Protein denotes Sox6
T11799 30976-30985 Protein denotes ɛy-globin
T11798 30908-30917 Protein denotes ɛy globin
T11797 30858-30862 Protein denotes Sox6
T11796 30674-30687 Protein denotes β-like globin
T11795 30610-30613 Protein denotes βh1
T11794 30604-30605 Protein denotes ζ
T11793 30533-30535 Protein denotes ɛy
T11792 30476-30485 Protein denotes ɛy globin
T11791 30172-30174 Protein denotes ɛy
T11790 30047-30051 Protein denotes Sox6
T11789 30022-30025 Protein denotes βh1
T11788 30016-30017 Protein denotes ζ
T11787 29983-29985 Protein denotes ɛy
T11786 29913-29916 Protein denotes βh1
T11785 29907-29908 Protein denotes ζ
T11784 29896-29905 Protein denotes ɛy globin
T11783 29824-29827 Protein denotes βh1
T11782 29818-29819 Protein denotes ζ
T11781 29804-29806 Protein denotes ɛy
T11780 29738-29741 Protein denotes βh1
T11779 29732-29733 Protein denotes ζ
T11778 29615-29624 Protein denotes ɛy globin
T11777 29481-29484 Protein denotes min
T11776 29476-29480 Protein denotes βmaj
T11775 29392-29396 Protein denotes Sox6
T11774 29368-29377 Protein denotes ɛy globin
T11773 29322-29331 Protein denotes ɛy globin
T11772 29267-29271 Protein denotes Sox6
T11771 29076-29085 Protein denotes ɛy globin
T11770 28926-28935 Protein denotes ɛy globin
T11769 28911-28915 Protein denotes Sox6
T11768 28789-28793 Protein denotes Sox6
T11767 28704-28706 Protein denotes II
T11766 28688-28699 Protein denotes silencers I
T11765 28616-28621 Protein denotes HMG-Y
T11764 28606-28611 Protein denotes HMG-I
T11763 28493-28495 Protein denotes ɛy
T11762 28455-28459 Protein denotes EKLF
T11761 28434-28438 Protein denotes DRED
T11760 28428-28432 Protein denotes DRED
T11759 28413-28415 Protein denotes ɛy
T11758 28221-28225 Protein denotes Sox6
T11757 27968-27972 Protein denotes Sox6
T11756 27730-27732 Protein denotes ɛy
T11755 27686-27690 Protein denotes Sox6
T11754 27568-27572 Protein denotes Sox6
T11753 27559-27561 Protein denotes TF
T11752 27554-27558 Protein denotes COUP
T11751 27532-27536 Protein denotes DRED
T11750 27418-27427 Protein denotes ɛy globin
T11749 27357-27361 Protein denotes Sox6
T11748 27319-27323 Protein denotes Sox6
T11747 26928-26930 Protein denotes ɛy
T11746 26893-26897 Protein denotes Sox6
T11745 26798-26800 Protein denotes ɛy
T11744 26778-26782 Protein denotes Sox6
T11743 26672-26674 Protein denotes ɛy
T11742 26644-26648 Protein denotes Sox6
T11741 26483-26487 Protein denotes Sox6
T11740 26322-26326 Protein denotes Sox6
T11739 26177-26181 Protein denotes Sox6
T11738 26168-26172 Protein denotes Sox5
T11737 26026-26028 Protein denotes 23
T11736 26018-26020 Protein denotes 13
T11735 26014-26016 Protein denotes 12
T11734 26008-26012 Protein denotes Sox5
T11733 25940-25944 Protein denotes Sox6
T11732 25895-25904 Protein denotes ɛy-globin
T11731 25869-25876 Protein denotes ɛy gene
T11730 25807-25811 Protein denotes Sox6
T11729 25791-25800 Protein denotes ɛy globin
T11728 25749-25752 Protein denotes βH1
T11727 25743-25744 Protein denotes ζ
T11726 25667-25671 Protein denotes Sox6
T11725 25580-25584 Protein denotes Sox6
T10370 25196-25200 Protein denotes Sox6
T10369 25180-25189 Protein denotes ɛy globin
T10368 24593-24597 Protein denotes Sox6
T9861 23423-23427 Protein denotes Sox6
T9860 23315-23324 Protein denotes ɛy globin
T9859 23155-23159 Protein denotes Sox6
T9858 23040-23044 Protein denotes Sox6
T9857 22857-22861 Protein denotes Sox6
T9856 22766-22770 Protein denotes Sox6
T9855 22645-22649 Protein denotes Sox6
T9854 22570-22579 Protein denotes ɛy globin
T9853 22530-22534 Protein denotes Sox6
T9852 22459-22463 Protein denotes Sox6
T9128 21788-21792 Protein denotes Sox6
T9127 21762-21764 Protein denotes ɛy
T9126 21611-21613 Protein denotes ɛy
T9125 21469-21479 Protein denotes min globin
T9124 21464-21468 Protein denotes βmaj
T9123 21361-21363 Protein denotes ɛy
T9122 21226-21235 Protein denotes ɛy globin
T9121 21137-21146 Protein denotes ɛy globin
T9120 21064-21073 Protein denotes ɛy globin
T9119 20977-20986 Protein denotes ɛy globin
T9118 20820-20829 Protein denotes ɛy globin
T9117 20748-20750 Protein denotes ɛy
T9116 20702-20706 Protein denotes Sox6
T9115 20689-20698 Protein denotes ɛy Globin
T7432 19798-19800 Protein denotes ɛy
T7431 19763-19765 Protein denotes ɛy
T7430 19731-19735 Protein denotes Sox6
T7429 19572-19576 Protein denotes Sox6
T7428 19516-19518 Protein denotes ɛy
T7427 19477-19481 Protein denotes Sox6
T7426 19369-19373 Protein denotes Sox6
T7425 19290-19292 Protein denotes ɛy
T7424 19272-19276 Protein denotes Sox6
T7423 19215-19219 Protein denotes Sox6
T7422 19209-19211 Protein denotes ɛy
T7421 18974-18976 Protein denotes ɛy
T7420 18884-18888 Protein denotes Sox6
T7419 18783-18785 Protein denotes ɛy
T7418 18324-18328 Protein denotes Sox6
T7417 18315-18317 Protein denotes ɛy
T7416 18296-18305 Protein denotes β globins
T7415 18075-18079 Protein denotes Sox6
T7414 18065-18067 Protein denotes HA
T7413 18025-18030 Protein denotes c-Myc
T7412 17973-17977 Protein denotes Sox6
T7411 17905-17909 Protein denotes Sox6
T7410 17895-17900 Protein denotes c-Myc
T7409 17866-17870 Protein denotes Sox6
T7408 17754-17756 Protein denotes ɛy
T7407 17672-17676 Protein denotes Sox6
T7406 17413-17415 Protein denotes ɛy
T7405 17220-17224 Protein denotes Sox6
T7404 17207-17212 Protein denotes c-Myc
T7403 17122-17124 Protein denotes ɛy
T7402 17085-17089 Protein denotes Sox6
T7401 17049-17051 Protein denotes ɛy
T7400 16934-16936 Protein denotes ɛy
T7399 16911-16915 Protein denotes Sox6
T7398 16899-16901 Protein denotes ɛy
T7397 16872-16876 Protein denotes Sox6
T5815 14164-14168 Protein denotes Sox6
T5814 14122-14124 Protein denotes ɛy
T5813 14045-14047 Protein denotes ɛy
T5812 13994-13999 Protein denotes CtBP2
T5811 13977-13979 Protein denotes ɛy
T5810 13958-13962 Protein denotes Sox6
T5809 13891-13893 Protein denotes ɛy
T5808 13851-13855 Protein denotes Sox6
T5807 13735-13740 Protein denotes CtBP2
T5806 13730-13734 Protein denotes Sox6
T5805 13655-13659 Protein denotes Sox6
T5804 13596-13598 Protein denotes ɛy
T5803 13573-13577 Protein denotes Sox6
T5802 13551-13556 Protein denotes CtBP2
T5801 13453-13458 Protein denotes CtBP2
T5800 13433-13438 Protein denotes fgf-3
T5799 13419-13424 Protein denotes CtBP2
T5798 13323-13327 Protein denotes Sox6
T5797 11900-11902 Protein denotes ɛy
T5796 11875-11879 Protein denotes Sox6
T5795 11724-11728 Protein denotes Sox6
T5794 11556-11560 Protein denotes Sox6
T5793 11453-11463 Protein denotes luciferase
T5792 11406-11408 Protein denotes ɛy
T5791 11309-11311 Protein denotes ɛy
T5790 11274-11286 Protein denotes beta globins
T5789 11261-11263 Protein denotes ɛy
T5788 11093-11095 Protein denotes ɛy
T5787 11067-11071 Protein denotes Sox6
T5786 11031-11033 Protein denotes ɛy
T5785 10986-10988 Protein denotes ɛy
T5784 10877-10879 Protein denotes ɛy
T5783 10849-10853 Protein denotes Sox6
T4526 10309-10312 Protein denotes min
T4525 10304-10308 Protein denotes βmaj
T4524 10184-10186 Protein denotes ɛy
T4523 9531-9539 Protein denotes β globin
T4522 9457-9466 Protein denotes ɛy globin
T4521 9345-9348 Protein denotes βh1
T4520 9339-9340 Protein denotes ζ
T4519 9051-9053 Protein denotes ɛy
T4518 8778-8782 Protein denotes Sox6
T4517 8676-8680 Protein denotes Sox6
T4516 8543-8552 Protein denotes ɛy globin
T1695 8410-8414 Protein denotes Sox6
T1694 8336-8345 Protein denotes ɛy globin
T1693 8330-8334 Protein denotes Sox6
T1692 8301-8310 Protein denotes ɛy globin
T1691 8184-8188 Protein denotes Sox6
T1690 8117-8126 Protein denotes ɛy globin
T1689 8078-8082 Protein denotes Sox6
T1688 8049-8058 Protein denotes ɛy globin
T1687 8037-8041 Protein denotes Sox6
T1686 7972-7981 Protein denotes ɛy globin
T1685 7666-7670 Protein denotes Sox6
T1684 7488-7492 Protein denotes Sox6
T1683 7242-7243 Protein denotes ɛ
T1682 7181-7182 Protein denotes ɛ
T1681 7063-7067 Protein denotes DRED
T1680 7050-7057 Protein denotes COUP-TF
T1679 7044-7048 Protein denotes YY-1
T1678 7036-7042 Protein denotes GATA-1
T1677 6963-6964 Protein denotes ɛ
T1676 6654-6655 Protein denotes ɛ
T1675 6625-6633 Protein denotes ɛ globin
T1674 6503-6511 Protein denotes β-globin
T1673 6485-6493 Protein denotes γ-globin
T1672 6430-6431 Protein denotes ɛ
T1671 6343-6344 Protein denotes ɛ
T1670 6273-6281 Protein denotes ɛ globin
T1669 6169-6171 Protein denotes ɛy
T1668 6152-6157 Protein denotes minor
T1667 6140-6147 Protein denotes β major
T1666 5993-6005 Protein denotes βh-1 globins
T1665 5986-5988 Protein denotes ɛy
T1664 5791-5793 Protein denotes ɛy
T1663 5453-5460 Protein denotes β-minor
T1662 5440-5447 Protein denotes β-major
T1661 5435-5438 Protein denotes βh1
T1660 5431-5433 Protein denotes ɛy
T1659 5095-5099 Protein denotes HMG2
T1658 5086-5090 Protein denotes HMG1
T1657 4894-4897 Protein denotes Sry
T1656 4781-4785 Protein denotes Sox6
T1655 4731-4732 Protein denotes p
T1654 4626-4630 Protein denotes Sox6
T1653 4611-4612 Protein denotes p
T1652 4296-4300 Protein denotes Sox6
T1651 4137-4141 Protein denotes Sox6
T1650 4051-4055 Protein denotes Sox6
T1649 3941-3944 Protein denotes Sry
T1648 3932-3936 Protein denotes Sox9
T1647 3926-3930 Protein denotes Sox6
T1646 3815-3819 Protein denotes Sox6
T1645 3697-3701 Protein denotes Sox6
T1644 3535-3539 Protein denotes Sox6
T1643 2873-2877 Protein denotes Sox6
T1642 2855-2858 Protein denotes Sry
T249 1298-1307 Protein denotes ɛy globin
T248 1279-1283 Protein denotes Sox6
T247 1238-1242 Protein denotes Sox6
T246 1175-1184 Protein denotes ɛy globin
T245 1141-1145 Protein denotes Sox6
T244 1067-1071 Protein denotes Sox6
T243 1015-1017 Protein denotes ɛy
T242 955-959 Protein denotes Sox6
T241 917-919 Protein denotes ɛy
T240 865-869 Protein denotes Sox6
T239 730-734 Protein denotes Sox6
T238 688-690 Protein denotes ɛy
T237 479-488 Protein denotes ɛy globin
T236 450-454 Protein denotes Sox6
T235 352-356 Protein denotes Sox6
T234 310-313 Protein denotes Sry
T233 127-131 Protein denotes Sox6
T4515 8519-8523 Protein denotes Sox6
T4514 8512-8514 Protein denotes ɛy
T4513 8504-8510 Protein denotes Globin

BioNLP16_DUT

Id Subject Object Predicate Lexical cue
T21019 43217-43226 Protein denotes protein A
T21022 43847-43849 Protein denotes ɛy
T21021 43742-43744 Protein denotes ɛy
T21020 43388-43392 Protein denotes Sox6
T20316 42207-42211 Protein denotes Sox6
T20315 42199-42201 Protein denotes HA
T20314 42192-42197 Protein denotes c-Myc
T20313 41540-41543 Protein denotes BSA
T20312 41444-41448 Protein denotes Sox6
T20311 41323-41347 Protein denotes T4 polynucleotide kinase
T19620 41064-41069 Protein denotes c-Myc
T19619 41021-41025 Protein denotes Sox6
T19618 40781-40785 Protein denotes Sox6
T19096 40072-40086 Gene_expression denotes overexpression
T19095 40067-40071 Protein denotes Sox6
T19094 39992-39994 Protein denotes ɛy
T19384 40455-40465 Gene_expression denotes expression
T19383 40704-40708 Protein denotes Sox6
T19382 40496-40498 Protein denotes HA
T19381 40486-40491 Protein denotes c-Myc
T19380 40429-40433 Protein denotes Sox6
T19379 40298-40302 Protein denotes Sox6
T18692 38980-38984 Protein denotes Sox6
T18169 37305-37309 Protein denotes Sox6
T18168 37262-37273 Protein denotes βmaj globin
T18167 37231-37240 Protein denotes ɛy globin
T17722 37103-37108 Protein denotes GAPDH
T17721 36800-36805 Protein denotes GAPDH
T17720 36402-36412 Protein denotes min globin
T17719 36397-36401 Protein denotes βmaj
T17718 36307-36317 Protein denotes βH1 globin
T17717 36218-36226 Protein denotes ζ globin
T17716 36127-36136 Protein denotes ɛy globin
T17096 35317-35328 Gene_expression denotes overexpress
T17095 35317-35328 Positive_regulation denotes overexpress
T17094 34652-34658 Positive_regulation denotes driven
T17093 34638-34648 Gene_expression denotes expression
T17092 33933-33942 Negative_regulation denotes silencing
T17091 35538-35540 Protein denotes ɛy
T17090 35393-35397 Protein denotes Sox6
T17089 35362-35366 Protein denotes Sox6
T17088 35329-35333 Protein denotes Sox6
T17087 35286-35290 Protein denotes Sox6
T17086 34718-34720 Protein denotes ɛy
T17085 34627-34637 Protein denotes luciferase
T17084 34539-34541 Protein denotes ɛy
T17083 34666-34668 Protein denotes ɛy
T17082 34370-34380 Protein denotes luciferase
T17081 34325-34327 Protein denotes ɛy
T17080 34036-34044 Protein denotes ɛ globin
T17079 33926-33927 Protein denotes ɛ
T17078 33825-33834 Protein denotes ɛy globin
T17077 33769-33771 Protein denotes ɛy
T17076 33681-33683 Protein denotes ɛy
T15832 33508-33518 Regulation denotes regulation
T15831 33082-33091 Negative_regulation denotes silencing
T15830 32830-32835 Binding denotes binds
T15829 32759-32768 Negative_regulation denotes silencing
T15828 32559-32571 Positive_regulation denotes reactivation
T15827 31904-31913 Negative_regulation denotes deficient
T15826 31015-31024 Regulation denotes regulates
T15825 30962-30972 Regulation denotes regulation
T15824 30918-30928 Gene_expression denotes expression
T15823 30900-30907 Negative_regulation denotes silence
T15822 30715-30723 Positive_regulation denotes elevated
T15821 30623-30635 Gene_expression denotes undetectable
T15820 30466-30472 Positive_regulation denotes levels
T15819 29928-29938 Gene_expression denotes expression
T15818 29917-29924 Negative_regulation denotes decline
T15817 29989-29998 Regulation denotes regulated
T15816 29677-29687 Gene_expression denotes expression
T15815 29752-29758 Positive_regulation denotes higher
T15814 29597-29607 Gene_expression denotes expression
T15813 29485-29495 Gene_expression denotes expression
T15812 29348-29358 Gene_expression denotes expression
T15811 29467-29472 Negative_regulation denotes level
T15810 29332-29342 Gene_expression denotes expression
T15809 29314-29321 Negative_regulation denotes silence
T15808 29062-29072 Gene_expression denotes expression
T15807 28916-28925 Negative_regulation denotes represses
T15806 28936-28946 Gene_expression denotes expression
T15805 28794-28804 Gene_expression denotes expression
T15804 28644-28648 Binding denotes bind
T15803 28478-28485 Binding denotes binding
T15802 28439-28449 Negative_regulation denotes interferes
T15801 27579-27587 Binding denotes interact
T15800 27461-27465 Binding denotes bind
T15799 26898-26903 Binding denotes binds
T15798 26783-26790 Binding denotes binding
T15797 26814-26824 Negative_regulation denotes repression
T15796 26764-26773 Positive_regulation denotes essential
T15795 26327-26332 Binding denotes binds
T15794 26152-26164 Binding denotes dimerization
T15793 25821-25830 Regulation denotes regulates
T15792 25881-25890 Negative_regulation denotes represses
T15791 25835-25840 Binding denotes binds
T15790 25771-25783 Positive_regulation denotes upregulation
T15789 25705-25711 Regulation denotes effect
T15788 33499-33507 Protein denotes ɛ globin
T15787 33442-33446 Protein denotes Sox6
T15786 33370-33374 Protein denotes Sox6
T15785 33304-33312 Protein denotes ɛ globin
T15784 33160-33161 Protein denotes ɛ
T15783 33073-33081 Protein denotes ɛ globin
T15782 33037-33041 Protein denotes Sox6
T15781 32932-32936 Protein denotes Sox6
T15780 32843-32845 Protein denotes ɛy
T15779 32818-32822 Protein denotes Sox6
T15778 32745-32753 Protein denotes ɛ-globin
T15777 32581-32589 Protein denotes ɛ-globin
T15776 32435-32439 Protein denotes Sox6
T15775 32346-32350 Protein denotes Sox6
T15774 31899-31903 Protein denotes Sox6
T15773 31632-31636 Protein denotes Sox6
T15772 31084-31088 Protein denotes Sox6
T15771 31010-31014 Protein denotes Sox6
T15770 30976-30985 Protein denotes ɛy-globin
T15769 30908-30917 Protein denotes ɛy globin
T15768 30858-30862 Protein denotes Sox6
T15767 30674-30687 Protein denotes β-like globin
T15766 30610-30613 Protein denotes βh1
T15765 30604-30605 Protein denotes ζ
T15764 30533-30535 Protein denotes ɛy
T15763 30476-30485 Protein denotes ɛy globin
T15762 30172-30174 Protein denotes ɛy
T15761 30047-30051 Protein denotes Sox6
T15760 30022-30025 Protein denotes βh1
T15759 30016-30017 Protein denotes ζ
T15758 29983-29985 Protein denotes ɛy
T15757 29913-29916 Protein denotes βh1
T15756 29907-29908 Protein denotes ζ
T15755 29896-29905 Protein denotes ɛy globin
T15754 29824-29827 Protein denotes βh1
T15753 29818-29819 Protein denotes ζ
T15752 29804-29806 Protein denotes ɛy
T15751 29738-29741 Protein denotes βh1
T15750 29732-29733 Protein denotes ζ
T15749 29615-29624 Protein denotes ɛy globin
T15748 29481-29484 Protein denotes min
T15747 29476-29480 Protein denotes βmaj
T15746 29392-29396 Protein denotes Sox6
T15745 29368-29377 Protein denotes ɛy globin
T15744 29322-29331 Protein denotes ɛy globin
T15743 29267-29271 Protein denotes Sox6
T15742 29076-29085 Protein denotes ɛy globin
T15741 28926-28935 Protein denotes ɛy globin
T15740 28911-28915 Protein denotes Sox6
T15739 28789-28793 Protein denotes Sox6
T15738 28704-28706 Protein denotes II
T15737 28688-28699 Protein denotes silencers I
T15736 28616-28621 Protein denotes HMG-Y
T15735 28606-28611 Protein denotes HMG-I
T15734 28493-28495 Protein denotes ɛy
T15733 28455-28459 Protein denotes EKLF
T15732 28434-28438 Protein denotes DRED
T15731 28428-28432 Protein denotes DRED
T15730 28413-28415 Protein denotes ɛy
T15729 28221-28225 Protein denotes Sox6
T15728 27968-27972 Protein denotes Sox6
T15727 27730-27732 Protein denotes ɛy
T15726 27686-27690 Protein denotes Sox6
T15725 27568-27572 Protein denotes Sox6
T15724 27559-27561 Protein denotes TF
T15723 27554-27558 Protein denotes COUP
T15722 27532-27536 Protein denotes DRED
T15721 27418-27427 Protein denotes ɛy globin
T15720 27357-27361 Protein denotes Sox6
T15719 27319-27323 Protein denotes Sox6
T15718 26928-26930 Protein denotes ɛy
T15717 26893-26897 Protein denotes Sox6
T15716 26798-26800 Protein denotes ɛy
T15715 26778-26782 Protein denotes Sox6
T15714 26672-26674 Protein denotes ɛy
T15713 26644-26648 Protein denotes Sox6
T15712 26483-26487 Protein denotes Sox6
T15711 26322-26326 Protein denotes Sox6
T15710 26177-26181 Protein denotes Sox6
T15709 26168-26172 Protein denotes Sox5
T15708 25940-25944 Protein denotes Sox6
T15707 26026-26028 Protein denotes 23
T15706 26018-26020 Protein denotes 13
T15705 26014-26016 Protein denotes 12
T15704 26008-26012 Protein denotes Sox5
T15703 25895-25904 Protein denotes ɛy-globin
T15702 25869-25876 Protein denotes ɛy gene
T15701 25807-25811 Protein denotes Sox6
T15700 25791-25800 Protein denotes ɛy globin
T15699 25749-25752 Protein denotes βH1
T15698 25743-25744 Protein denotes ζ
T15697 25667-25671 Protein denotes Sox6
T15696 25580-25584 Protein denotes Sox6
T10681 25166-25175 Negative_regulation denotes silencing
T10680 25196-25200 Protein denotes Sox6
T10679 25180-25189 Protein denotes ɛy globin
T10678 24593-24597 Protein denotes Sox6
T10321 23335-23344 Gene_expression denotes expressed
T10320 23160-23170 Gene_expression denotes expression
T10319 23055-23066 Transcription denotes transcribed
T10318 22744-22754 Gene_expression denotes expression
T10317 22562-22569 Gene_expression denotes express
T10316 22535-22544 Negative_regulation denotes deficient
T10315 22437-22447 Gene_expression denotes Expression
T10314 23315-23324 Protein denotes ɛy globin
T10313 23423-23427 Protein denotes Sox6
T10312 23155-23159 Protein denotes Sox6
T10311 23040-23044 Protein denotes Sox6
T10310 22857-22861 Protein denotes Sox6
T10309 22766-22770 Protein denotes Sox6
T10308 22645-22649 Protein denotes Sox6
T10307 22570-22579 Protein denotes ɛy globin
T10306 22530-22534 Protein denotes Sox6
T10305 22459-22463 Protein denotes Sox6
T9712 21748-21754 Negative_regulation denotes defect
T9711 21633-21643 Gene_expression denotes expression
T9710 21793-21797 Negative_regulation denotes null
T9709 21450-21460 Gene_expression denotes expression
T9708 21369-21379 Transcription denotes expression
T9707 21243-21252 Gene_expression denotes expressed
T9706 20963-20973 Gene_expression denotes expression
T9705 21035-21038 Positive_regulation denotes due
T9704 21050-21060 Gene_expression denotes expression
T9703 20850-20859 Gene_expression denotes expressed
T9702 20890-20898 Negative_regulation denotes silenced
T9701 20707-20716 Negative_regulation denotes Deficient
T9700 20675-20685 Gene_expression denotes Expression
T9699 21788-21792 Protein denotes Sox6
T9698 21762-21764 Protein denotes ɛy
T9697 21611-21613 Protein denotes ɛy
T9696 21469-21479 Protein denotes min globin
T9695 21464-21468 Protein denotes βmaj
T9694 21361-21363 Protein denotes ɛy
T9693 21226-21235 Protein denotes ɛy globin
T9692 21137-21146 Protein denotes ɛy globin
T9691 21064-21073 Protein denotes ɛy globin
T9690 20977-20986 Protein denotes ɛy globin
T9689 20820-20829 Protein denotes ɛy globin
T9688 20748-20750 Protein denotes ɛy
T9687 20702-20706 Protein denotes Sox6
T9686 20689-20698 Protein denotes ɛy Globin
T8910 19746-19755 Negative_regulation denotes repressor
T8909 19783-19790 Binding denotes binding
T8908 19548-19566 Binding denotes immunoprecipitated
T8907 19277-19282 Binding denotes binds
T8906 19195-19205 Negative_regulation denotes repression
T8905 19174-19182 Positive_regulation denotes required
T8904 18889-18903 Gene_expression denotes overexpression
T8903 18338-18343 Binding denotes binds
T8902 18282-18289 Gene_expression denotes express
T8901 18042-18047 Binding denotes binds
T8900 17699-17708 Binding denotes associate
T8899 17102-17112 Binding denotes associated
T8898 17010-17020 Regulation denotes regulating
T8897 17035-17044 Regulation denotes affecting
T8896 16922-16929 Negative_regulation denotes repress
T8895 16886-16891 Binding denotes Binds
T8894 19798-19800 Protein denotes ɛy
T8893 19763-19765 Protein denotes ɛy
T8892 19731-19735 Protein denotes Sox6
T8891 19572-19576 Protein denotes Sox6
T8890 19516-19518 Protein denotes ɛy
T8889 19477-19481 Protein denotes Sox6
T8888 19369-19373 Protein denotes Sox6
T8887 19290-19292 Protein denotes ɛy
T8886 19272-19276 Protein denotes Sox6
T8885 19215-19219 Protein denotes Sox6
T8884 19209-19211 Protein denotes ɛy
T8883 18974-18976 Protein denotes ɛy
T8882 18884-18888 Protein denotes Sox6
T8881 18783-18785 Protein denotes ɛy
T8880 18324-18328 Protein denotes Sox6
T8879 18315-18317 Protein denotes ɛy
T8878 18296-18305 Protein denotes β globins
T8877 18075-18079 Protein denotes Sox6
T8876 18065-18067 Protein denotes HA
T8875 18025-18030 Protein denotes c-Myc
T8874 17973-17977 Protein denotes Sox6
T8873 17905-17909 Protein denotes Sox6
T8872 17895-17900 Protein denotes c-Myc
T8871 17866-17870 Protein denotes Sox6
T8870 17754-17756 Protein denotes ɛy
T8869 17672-17676 Protein denotes Sox6
T8868 17413-17415 Protein denotes ɛy
T8867 17220-17224 Protein denotes Sox6
T8866 17207-17212 Protein denotes c-Myc
T8865 17122-17124 Protein denotes ɛy
T8864 17085-17089 Protein denotes Sox6
T8863 17049-17051 Protein denotes ɛy
T8862 16934-16936 Protein denotes ɛy
T8861 16911-16915 Protein denotes Sox6
T8860 16899-16901 Protein denotes ɛy
T8859 16872-16876 Protein denotes Sox6
T6932 14169-14179 Negative_regulation denotes repression
T6931 13963-13972 Negative_regulation denotes represses
T6930 13879-13886 Negative_regulation denotes repress
T6929 13534-13545 Binding denotes interaction
T6928 13578-13588 Negative_regulation denotes repression
T6927 13741-13752 Binding denotes interaction
T6926 13722-13729 Negative_regulation denotes abolish
T6925 13560-13568 Positive_regulation denotes required
T6924 13462-13471 Gene_expression denotes expressed
T6923 13395-13404 Gene_expression denotes expressed
T6922 13372-13380 Binding denotes interact
T6921 11888-11895 Negative_regulation denotes repress
T6920 11694-11708 Gene_expression denotes overexpression
T6919 11694-11708 Positive_regulation denotes overexpression
T6918 11538-11552 Positive_regulation denotes Overexpression
T6917 11538-11552 Gene_expression denotes Overexpression
T6916 11081-11085 Positive_regulation denotes acts
T6915 11246-11255 Gene_expression denotes expresses
T6914 14164-14168 Protein denotes Sox6
T6913 14122-14124 Protein denotes ɛy
T6912 14045-14047 Protein denotes ɛy
T6911 13994-13999 Protein denotes CtBP2
T6910 13977-13979 Protein denotes ɛy
T6909 13958-13962 Protein denotes Sox6
T6908 13891-13893 Protein denotes ɛy
T6907 13851-13855 Protein denotes Sox6
T6906 13735-13740 Protein denotes CtBP2
T6905 13730-13734 Protein denotes Sox6
T6904 13655-13659 Protein denotes Sox6
T6903 13596-13598 Protein denotes ɛy
T6902 13573-13577 Protein denotes Sox6
T6901 13551-13556 Protein denotes CtBP2
T6900 13453-13458 Protein denotes CtBP2
T6899 13433-13438 Protein denotes fgf-3
T6898 13419-13424 Protein denotes CtBP2
T6897 13323-13327 Protein denotes Sox6
T6896 11900-11902 Protein denotes ɛy
T6895 11875-11879 Protein denotes Sox6
T6894 11724-11728 Protein denotes Sox6
T6893 11556-11560 Protein denotes Sox6
T6892 11309-11311 Protein denotes ɛy
T6891 11453-11463 Protein denotes luciferase
T6890 11406-11408 Protein denotes ɛy
T6889 11274-11286 Protein denotes beta globins
T6888 11261-11263 Protein denotes ɛy
T6887 11093-11095 Protein denotes ɛy
T6886 11067-11071 Protein denotes Sox6
T6885 11031-11033 Protein denotes ɛy
T6884 10986-10988 Protein denotes ɛy
T6883 10877-10879 Protein denotes ɛy
T6882 10849-10853 Protein denotes Sox6
T5425 10187-10197 Gene_expression denotes expression
T5424 10175-10180 Negative_regulation denotes level
T5423 10313-10323 Gene_expression denotes expression
T5422 9505-9515 Gene_expression denotes expression
T5421 9359-9365 Positive_regulation denotes higher
T5420 9280-9290 Gene_expression denotes expression
T5419 9062-9071 Gene_expression denotes expressed
T5418 8589-8600 Positive_regulation denotes upregulated
T5417 8692-8699 Regulation denotes targets
T5416 8524-8533 Negative_regulation denotes Deficient
T5415 8476-8486 Gene_expression denotes Expression
T5414 10309-10312 Protein denotes min
T5413 10304-10308 Protein denotes βmaj
T5412 10184-10186 Protein denotes ɛy
T5411 9531-9539 Protein denotes β globin
T5410 9345-9348 Protein denotes βh1
T5409 9339-9340 Protein denotes ζ
T5408 9457-9466 Protein denotes ɛy globin
T5407 9051-9053 Protein denotes ɛy
T5406 8778-8782 Protein denotes Sox6
T5405 8676-8680 Protein denotes Sox6
T5404 8543-8552 Protein denotes ɛy globin
T5403 8519-8523 Protein denotes Sox6
T5402 8512-8514 Protein denotes ɛy
T5401 8504-8510 Protein denotes Globin
T4299 8361-8370 Gene_expression denotes expressed
T4298 8319-8326 Negative_regulation denotes absence
T4297 8279-8289 Gene_expression denotes expression
T4296 8196-8205 Gene_expression denotes expressed
T4295 8240-8249 Gene_expression denotes expressed
T4294 8083-8088 Binding denotes binds
T4293 7944-7954 Gene_expression denotes expression
T4292 7496-7507 Positive_regulation denotes upregulated
T4291 7225-7234 Negative_regulation denotes silencing
T4290 7183-7192 Negative_regulation denotes silencing
T4289 7111-7115 Binding denotes bind
T4288 7172-7180 Regulation denotes regulate
T4287 6611-6620 Negative_regulation denotes silencing
T4286 6522-6532 Regulation denotes controlled
T4285 6348-6357 Positive_regulation denotes activated
T4284 6451-6460 Regulation denotes regulated
T4283 6237-6246 Negative_regulation denotes silencing
T4282 6180-6188 Negative_regulation denotes silenced
T4281 6115-6122 Gene_expression denotes express
T4280 5978-5985 Gene_expression denotes express
T4279 4982-4986 Binding denotes bind
T4278 5076-5085 Gene_expression denotes expressed
T4277 4593-4601 Negative_regulation denotes disrupts
T4276 3887-3897 Gene_expression denotes expression
T4275 3961-3969 Positive_regulation denotes restored
T4274 3802-3811 Negative_regulation denotes Depletion
T4273 8410-8414 Protein denotes Sox6
T4272 8336-8345 Protein denotes ɛy globin
T4271 8330-8334 Protein denotes Sox6
T4270 8301-8310 Protein denotes ɛy globin
T4269 8184-8188 Protein denotes Sox6
T4268 8117-8126 Protein denotes ɛy globin
T4267 8078-8082 Protein denotes Sox6
T4266 8049-8058 Protein denotes ɛy globin
T4265 8037-8041 Protein denotes Sox6
T4264 7972-7981 Protein denotes ɛy globin
T4263 7666-7670 Protein denotes Sox6
T4262 7488-7492 Protein denotes Sox6
T4261 7242-7243 Protein denotes ɛ
T4260 7181-7182 Protein denotes ɛ
T4259 7063-7067 Protein denotes DRED
T4258 7050-7057 Protein denotes COUP-TF
T4257 7044-7048 Protein denotes YY-1
T4256 7036-7042 Protein denotes GATA-1
T4255 6963-6964 Protein denotes ɛ
T4254 6654-6655 Protein denotes ɛ
T4253 6625-6633 Protein denotes ɛ globin
T4252 6503-6511 Protein denotes β-globin
T4251 6485-6493 Protein denotes γ-globin
T4250 6430-6431 Protein denotes ɛ
T4249 6343-6344 Protein denotes ɛ
T4248 6273-6281 Protein denotes ɛ globin
T4247 6169-6171 Protein denotes ɛy
T4246 6152-6157 Protein denotes minor
T4245 6140-6147 Protein denotes β major
T4244 5993-6005 Protein denotes βh-1 globins
T4243 5986-5988 Protein denotes ɛy
T4242 5791-5793 Protein denotes ɛy
T4241 5453-5460 Protein denotes β-minor
T4240 5440-5447 Protein denotes β-major
T4239 5435-5438 Protein denotes βh1
T4238 5431-5433 Protein denotes ɛy
T4237 5095-5099 Protein denotes HMG2
T4236 5086-5090 Protein denotes HMG1
T4235 4894-4897 Protein denotes Sry
T4234 4781-4785 Protein denotes Sox6
T4233 4731-4732 Protein denotes p
T4232 4626-4630 Protein denotes Sox6
T4231 4611-4612 Protein denotes p
T4230 4296-4300 Protein denotes Sox6
T4229 4051-4055 Protein denotes Sox6
T4228 4137-4141 Protein denotes Sox6
T4227 3941-3944 Protein denotes Sry
T4226 3932-3936 Protein denotes Sox9
T4225 3926-3930 Protein denotes Sox6
T4224 3815-3819 Protein denotes Sox6
T4223 3697-3701 Protein denotes Sox6
T4222 3535-3539 Protein denotes Sox6
T4221 2873-2877 Protein denotes Sox6
T4220 2855-2858 Protein denotes Sry
T878 127-131 Protein denotes Sox6
T879 310-313 Protein denotes Sry
T880 352-356 Protein denotes Sox6
T881 450-454 Protein denotes Sox6
T882 479-488 Protein denotes ɛy globin
T883 688-690 Protein denotes ɛy
T884 730-734 Protein denotes Sox6
T885 865-869 Protein denotes Sox6
T886 917-919 Protein denotes ɛy
T887 955-959 Protein denotes Sox6
T888 1015-1017 Protein denotes ɛy
T889 1067-1071 Protein denotes Sox6
T890 1141-1145 Protein denotes Sox6
T891 1175-1184 Protein denotes ɛy globin
T892 1238-1242 Protein denotes Sox6
T893 1279-1283 Protein denotes Sox6
T894 1298-1307 Protein denotes ɛy globin
T896 505-514 Gene_expression denotes expressed
T897 455-464 Negative_regulation denotes deficient
T898 744-754 Negative_regulation denotes repression
T899 902-909 Binding denotes binding
T900 1001-1011 Gene_expression denotes expression
T901 941-951 Gene_expression denotes expression
T902 1149-1157 Positive_regulation denotes required
T903 1162-1171 Negative_regulation denotes silencing
T904 1284-1294 Regulation denotes regulation
T876 0-4 Protein denotes Sox6
T877 23-37 Protein denotes Epsilon Globin
T895 38-48 Gene_expression denotes Expression
R589 T885 T899 themeOf Sox6,binding
R591 T887 T901 themeOf Sox6,expression
R592 T888 T900 themeOf ɛy,expression
R593 T891 T903 themeOf ɛy globin,silencing
R594 T893 T904 themeOf Sox6,regulation
R595 T894 T904 themeOf ɛy globin,regulation
R596 T903 T902 themeOf silencing,required
R3021 T4224 T4274 themeOf Sox6,Depletion
R3025 T4225 T4276 themeOf Sox6,expression
R3026 T4226 T4276 themeOf Sox9,expression
R3027 T4227 T4276 themeOf Sry,expression
R3029 T4231 T4277 themeOf p,disrupts
R3030 T4232 T4277 themeOf Sox6,disrupts
R3031 T4235 T4279 themeOf Sry,bind
R3032 T4236 T4278 themeOf HMG1,expressed
R3033 T4237 T4278 themeOf HMG2,expressed
R3034 T4243 T4280 themeOf ɛy,express
R3035 T4244 T4280 themeOf βh-1 globins,express
R3036 T4245 T4281 themeOf β major,express
R3037 T4246 T4281 themeOf minor,express
R3038 T4247 T4282 themeOf ɛy,silenced
R3039 T4248 T4283 themeOf ɛ globin,silencing
R3040 T4249 T4285 themeOf ɛ,activated
R3041 T4250 T4284 themeOf ɛ,regulated
R3042 T4251 T4286 themeOf γ-globin,controlled
R3043 T4253 T4287 themeOf ɛ globin,silencing
R3044 T4258 T4289 themeOf COUP-TF,bind
R3045 T4260 T4288 themeOf ɛ,regulate
R3046 T4260 T4290 themeOf ɛ,silencing
R3047 T4261 T4291 themeOf ɛ,silencing
R3048 T4262 T4292 themeOf Sox6,upregulated
R3049 T4264 T4293 themeOf ɛy globin,expression
R3050 T4267 T4294 themeOf Sox6,binds
R3051 T4268 T4294 themeOf ɛy globin,binds
R3052 T4269 T4296 themeOf Sox6,expressed
R3053 T4269 T4295 themeOf Sox6,expressed
R3054 T4270 T4295 themeOf ɛy globin,expressed
R3055 T4270 T4297 themeOf ɛy globin,expression
R3056 T4271 T4298 themeOf Sox6,absence
R3057 T4272 T4299 themeOf ɛy globin,expressed
R3058 T4272 T4298 themeOf ɛy globin,absence
R3059 T4276 T4275 themeOf expression,restored
R3060 T4276 T4275 themeOf expression,restored
R3061 T4276 T4275 themeOf expression,restored
R3870 T5401 T5415 themeOf Globin,Expression
R3871 T5402 T5415 themeOf ɛy,Expression
R3872 T5403 T5416 themeOf Sox6,Deficient
R3873 T5404 T5418 themeOf ɛy globin,upregulated
R3874 T5405 T5417 themeOf Sox6,targets
R3875 T5407 T5419 themeOf ɛy,expressed
R3876 T5409 T5421 themeOf ζ,higher
R3877 T5409 T5420 themeOf ζ,expression
R3878 T5410 T5421 themeOf βh1,higher
R3879 T5410 T5420 themeOf βh1,expression
R3880 T5411 T5422 themeOf β globin,expression
R3881 T5412 T5425 themeOf ɛy,expression
R3882 T5413 T5423 themeOf βmaj,expression
R3883 T5414 T5423 themeOf min,expression
R3884 T5425 T5424 themeOf expression,level
R4864 T6886 T6916 causeOf Sox6,acts
R4865 T6887 T6916 themeOf ɛy,acts
R4866 T6888 T6915 themeOf ɛy,expresses
R4867 T6889 T6915 themeOf beta globins,expresses
R4868 T6893 T6917 themeOf Sox6,Overexpression
R4869 T6894 T6920 themeOf Sox6,overexpression
R4870 T6895 T6921 causeOf Sox6,repress
R4871 T6896 T6921 themeOf ɛy,repress
R4872 T6898 T6922 themeOf CtBP2,interact
R4873 T6898 T6923 themeOf CtBP2,expressed
R4874 T6899 T6922 themeOf fgf-3,interact
R4875 T6899 T6923 themeOf fgf-3,expressed
R4876 T6900 T6924 themeOf CtBP2,expressed
R4877 T6901 T6929 themeOf CtBP2,interaction
R4878 T6902 T6928 themeOf Sox6,repression
R4879 T6903 T6928 themeOf ɛy,repression
R4880 T6905 T6927 themeOf Sox6,interaction
R4881 T6906 T6927 themeOf CtBP2,interaction
R4882 T6907 T6930 causeOf Sox6,repress
R4883 T6908 T6930 themeOf ɛy,repress
R4884 T6909 T6931 causeOf Sox6,represses
R4885 T6910 T6931 themeOf ɛy,represses
R4886 T6914 T6932 themeOf Sox6,repression
R4887 T6917 T6918 themeOf Overexpression,Overexpression
R4888 T6920 T6919 themeOf overexpression,overexpression
R4889 T6927 T6926 themeOf interaction,abolish
R4890 T6927 T6926 themeOf interaction,abolish
R4891 T6928 T6925 themeOf repression,required
R4892 T6928 T6925 themeOf repression,required
R4893 T6929 T6925 causeOf interaction,required
R4894 T6929 T6925 causeOf interaction,required
R6203 T8859 T8895 themeOf Sox6,Binds
R6204 T8861 T8898 causeOf Sox6,regulating
R6205 T8862 T8896 themeOf ɛy,repress
R6206 T8863 T8897 themeOf ɛy,affecting
R6207 T8864 T8899 themeOf Sox6,associated
R6208 T8869 T8900 themeOf Sox6,associate
R6209 T8870 T8900 themeOf ɛy,associate
R6210 T8875 T8901 themeOf c-Myc,binds
R6211 T8878 T8902 themeOf β globins,express
R6212 T8880 T8903 themeOf Sox6,binds
R6213 T8882 T8904 themeOf Sox6,overexpression
R6214 T8884 T8906 themeOf ɛy,repression
R6215 T8885 T8906 causeOf Sox6,repression
R6216 T8886 T8907 themeOf Sox6,binds
R6217 T8887 T8907 themeOf ɛy,binds
R6218 T8890 T8908 themeOf ɛy,immunoprecipitated
R6219 T8892 T8909 themeOf Sox6,binding
R6220 T8893 T8910 themeOf ɛy,repressor
R6221 T8893 T8909 themeOf ɛy,binding
R6222 T8894 T8909 themeOf ɛy,binding
R6223 T8894 T8909 themeOf ɛy,binding
R6224 T8897 T8898 themeOf affecting,regulating
R6225 T8906 T8905 themeOf repression,required
R6745 T9686 T9700 themeOf ɛy Globin,Expression
R6746 T9687 T9701 themeOf Sox6,Deficient
R6747 T9689 T9702 themeOf ɛy globin,silenced
R6748 T9689 T9703 themeOf ɛy globin,expressed
R6749 T9690 T9706 themeOf ɛy globin,expression
R6750 T9691 T9704 themeOf ɛy globin,expression
R6751 T9693 T9707 themeOf ɛy globin,expressed
R6752 T9694 T9708 themeOf ɛy,expression
R6753 T9695 T9709 themeOf βmaj,expression
R6754 T9696 T9709 themeOf min globin,expression
R6755 T9697 T9711 themeOf ɛy,expression
R6756 T9698 T9712 themeOf ɛy,defect
R6757 T9699 T9710 themeOf Sox6,null
R6758 T9704 T9705 themeOf expression,due
R6759 T9706 T9705 themeOf expression,due
R7152 T10305 T10315 themeOf Sox6,Expression
R7153 T10306 T10316 themeOf Sox6,deficient
R7154 T10307 T10317 themeOf ɛy globin,express
R7155 T10309 T10318 themeOf Sox6,expression
R7156 T10311 T10319 themeOf Sox6,transcribed
R7157 T10312 T10320 themeOf Sox6,expression
R7158 T10314 T10321 themeOf ɛy globin,expressed
R7159 T10317 T10316 themeOf express,deficient
R7433 T10679 T10681 themeOf ɛy globin,silencing
R10997 T15698 T15789 themeOf ζ,effect
R10998 T15699 T15789 themeOf βH1,effect
R10999 T15700 T15790 themeOf ɛy globin,upregulation
R11001 T15701 T15793 themeOf Sox6,regulates
R11002 T15701 T15791 themeOf Sox6,binds
R11003 T15702 T15791 themeOf ɛy gene,binds
R11004 T15703 T15792 themeOf ɛy-globin,represses
R11005 T15709 T15794 themeOf Sox5,dimerization
R11006 T15710 T15794 themeOf Sox6,dimerization
R11007 T15711 T15795 themeOf Sox6,binds
R11008 T15715 T15798 themeOf Sox6,binding
R11009 T15717 T15799 themeOf Sox6,binds
R11011 T15721 T15800 themeOf ɛy globin,bind
R11012 T15721 T15800 themeOf ɛy globin,bind
R11013 T15721 T15800 themeOf ɛy globin,bind
R11014 T15722 T15800 themeOf DRED,bind
R11015 T15723 T15800 themeOf COUP,bind
R11016 T15724 T15800 themeOf TF,bind
R11017 T15725 T15801 themeOf Sox6,interact
R11018 T15732 T15802 themeOf DRED,interferes
R11019 T15759 T15817 themeOf ζ,regulated
R11020 T15760 T15817 themeOf βh1,regulated
R11021 T15763 T15820 themeOf ɛy globin,levels
R11022 T15734 T15803 themeOf ɛy,binding
R11023 T15765 T15821 themeOf ζ,undetectable
R11024 T15767 T15822 themeOf β-like globin,elevated
R11025 T15735 T15804 themeOf HMG-I,bind
R11026 T15768 T15823 causeOf Sox6,silence
R11027 T15769 T15824 themeOf ɛy globin,expression
R11028 T15770 T15825 themeOf ɛy-globin,regulation
R11029 T15735 T15804 themeOf HMG-I,bind
R11030 T15771 T15826 themeOf Sox6,regulates
R11031 T15736 T15804 themeOf HMG-Y,bind
R11032 T15774 T15827 themeOf Sox6,deficient
R11033 T15736 T15804 themeOf HMG-Y,bind
R11034 T15737 T15804 themeOf silencers I,bind
R11035 T15777 T15828 themeOf ɛ-globin,reactivation
R11036 T15778 T15829 themeOf ɛ-globin,silencing
R11037 T15737 T15804 themeOf silencers I,bind
R11038 T15779 T15830 themeOf Sox6,binds
R11039 T15738 T15804 themeOf II,bind
R11040 T15780 T15830 themeOf ɛy,binds
R11041 T15738 T15804 themeOf II,bind
R11042 T15783 T15831 themeOf ɛ globin,silencing
R11043 T15739 T15805 themeOf Sox6,expression
R11044 T15740 T15807 causeOf Sox6,represses
R11045 T15788 T15832 themeOf ɛ globin,regulation
R11046 T15741 T15806 themeOf ɛy globin,expression
R11047 T15742 T15808 themeOf ɛy globin,expression
R11048 T15744 T15810 themeOf ɛy globin,expression
R11049 T15798 T15797 themeOf binding,repression
R11050 T15798 T15796 themeOf binding,essential
R11051 T15745 T15812 themeOf ɛy globin,expression
R11052 T15747 T15813 themeOf βmaj,expression
R11053 T15748 T15813 themeOf min,expression
R11054 T15806 T15807 themeOf expression,represses
R11055 T15749 T15814 themeOf ɛy globin,expression
R11056 T15750 T15816 themeOf ζ,expression
R11057 T15810 T15809 themeOf expression,silence
R11058 T15751 T15815 themeOf βh1,higher
R11059 T15813 T15811 themeOf expression,level
R11060 T15813 T15811 themeOf expression,level
R11061 T15751 T15816 themeOf βh1,expression
R11062 T15755 T15818 themeOf ɛy globin,decline
R11063 T15755 T15819 themeOf ɛy globin,expression
R11064 T15758 T15817 themeOf ɛy,regulated
R11065 T15824 T15823 themeOf expression,silence
R11932 T17079 T17092 themeOf ɛ,silencing
R11933 T17085 T17093 themeOf luciferase,expression
R11934 T17088 T17096 themeOf Sox6,overexpress
R11935 T17093 T17094 themeOf expression,driven
R11936 T17096 T17095 themeOf overexpress,overexpress
R13574 T19095 T19096 themeOf Sox6,overexpression
R13771 T19380 T19384 themeOf Sox6,expression
R585 T877 T895 themeOf Epsilon Globin,Expression
R586 T881 T897 themeOf Sox6,deficient
R587 T882 T896 themeOf ɛy globin,expressed
R588 T884 T898 themeOf Sox6,repression
R590 T886 T899 themeOf ɛy,binding

BioNLP16_Messiy

Id Subject Object Predicate Lexical cue
T20669 43847-43849 Protein denotes ɛy
T20668 43742-43744 Protein denotes ɛy
T20667 43388-43392 Protein denotes Sox6
T16456 34325-34327 Protein denotes ɛy
T16455 34036-34044 Protein denotes ɛ globin
T16454 33926-33927 Protein denotes ɛ
T16453 33825-33834 Protein denotes ɛy globin
T16452 33769-33771 Protein denotes ɛy
T16451 33681-33683 Protein denotes ɛy
T13420 33508-33518 Regulation denotes regulation
T13419 33082-33091 Negative_regulation denotes silencing
T13418 32830-32835 Binding denotes binds
T13417 32559-32571 Positive_regulation denotes reactivation
T13416 32759-32768 Negative_regulation denotes silencing
T13415 32383-32394 Binding denotes interacting
T13414 32362-32368 Binding denotes target
T13413 31904-31913 Negative_regulation denotes deficient
T13412 31015-31024 Regulation denotes regulates
T13411 30962-30972 Regulation denotes regulation
T13410 30900-30907 Negative_regulation denotes silence
T13409 30918-30928 Gene_expression denotes expression
T13408 30715-30723 Positive_regulation denotes elevated
T13407 29989-29998 Regulation denotes regulated
T13406 29677-29687 Gene_expression denotes expression
T13405 29597-29607 Gene_expression denotes expression
T13404 29348-29358 Gene_expression denotes expression
T13403 29485-29495 Gene_expression denotes expression
T13402 29397-29401 Negative_regulation denotes null
T13401 29332-29342 Gene_expression denotes expression
T13400 29314-29321 Negative_regulation denotes silence
T13399 29062-29072 Gene_expression denotes expression
T13398 28794-28804 Gene_expression denotes expression
T13397 28936-28946 Gene_expression denotes expression
T13396 28916-28925 Negative_regulation denotes represses
T13395 28644-28648 Binding denotes bind
T13394 28478-28485 Binding denotes binding
T13393 28439-28449 Negative_regulation denotes interferes
T13392 28181-28189 Regulation denotes changing
T13391 28312-28319 Binding denotes binding
T13390 28254-28261 Binding denotes binding
T13389 27579-27587 Binding denotes interact
T13388 27461-27465 Binding denotes bind
T13387 27324-27334 Binding denotes associated
T13386 26898-26903 Binding denotes binds
T13385 26764-26773 Positive_regulation denotes essential
T13384 26783-26790 Binding denotes binding
T13383 26327-26332 Binding denotes binds
T13382 26152-26164 Binding denotes dimerization
T13381 25835-25840 Binding denotes binds
T13380 25821-25830 Regulation denotes regulates
T13379 25771-25783 Positive_regulation denotes upregulation
T13378 33499-33507 Protein denotes ɛ globin
T13377 33442-33446 Protein denotes Sox6
T13376 33370-33374 Protein denotes Sox6
T13375 33304-33312 Protein denotes ɛ globin
T13374 33160-33161 Protein denotes ɛ
T13373 33073-33081 Protein denotes ɛ globin
T13372 33037-33041 Protein denotes Sox6
T13371 32932-32936 Protein denotes Sox6
T13370 32843-32845 Protein denotes ɛy
T13369 32818-32822 Protein denotes Sox6
T13368 32745-32753 Protein denotes ɛ-globin
T13367 32581-32589 Protein denotes ɛ-globin
T13366 32435-32439 Protein denotes Sox6
T13365 32346-32350 Protein denotes Sox6
T13364 31899-31903 Protein denotes Sox6
T13363 31632-31636 Protein denotes Sox6
T13362 31084-31088 Protein denotes Sox6
T13361 31010-31014 Protein denotes Sox6
T13360 30976-30985 Protein denotes ɛy-globin
T13359 30908-30917 Protein denotes ɛy globin
T13358 30858-30862 Protein denotes Sox6
T13357 30674-30687 Protein denotes β-like globin
T13356 30610-30613 Protein denotes βh1
T13355 30604-30605 Protein denotes ζ
T13354 30533-30535 Protein denotes ɛy
T13353 30476-30485 Protein denotes ɛy globin
T13352 30172-30174 Protein denotes ɛy
T13351 30047-30051 Protein denotes Sox6
T13350 30022-30025 Protein denotes βh1
T13349 30016-30017 Protein denotes ζ
T13348 29983-29985 Protein denotes ɛy
T13347 29913-29916 Protein denotes βh1
T13346 29907-29908 Protein denotes ζ
T13345 29896-29905 Protein denotes ɛy globin
T13344 29824-29827 Protein denotes βh1
T13343 29818-29819 Protein denotes ζ
T13342 29804-29806 Protein denotes ɛy
T13341 29738-29741 Protein denotes βh1
T13340 29732-29733 Protein denotes ζ
T13339 29615-29624 Protein denotes ɛy globin
T13338 29481-29484 Protein denotes min
T13337 29476-29480 Protein denotes βmaj
T13336 29392-29396 Protein denotes Sox6
T13335 29368-29377 Protein denotes ɛy globin
T13334 29322-29331 Protein denotes ɛy globin
T13333 29267-29271 Protein denotes Sox6
T13332 29076-29085 Protein denotes ɛy globin
T13331 28926-28935 Protein denotes ɛy globin
T13330 28911-28915 Protein denotes Sox6
T13329 28789-28793 Protein denotes Sox6
T13328 28704-28706 Protein denotes II
T13327 28688-28699 Protein denotes silencers I
T13326 28616-28621 Protein denotes HMG-Y
T13325 28606-28611 Protein denotes HMG-I
T13324 28493-28495 Protein denotes ɛy
T13323 28455-28459 Protein denotes EKLF
T13322 28434-28438 Protein denotes DRED
T13321 28428-28432 Protein denotes DRED
T13320 28413-28415 Protein denotes ɛy
T13319 28221-28225 Protein denotes Sox6
T13318 27968-27972 Protein denotes Sox6
T13317 27730-27732 Protein denotes ɛy
T13316 27686-27690 Protein denotes Sox6
T13315 27568-27572 Protein denotes Sox6
T13314 27559-27561 Protein denotes TF
T13313 27554-27558 Protein denotes COUP
T13312 27532-27536 Protein denotes DRED
T13311 27418-27427 Protein denotes ɛy globin
T13310 27357-27361 Protein denotes Sox6
T13309 27319-27323 Protein denotes Sox6
T13308 26928-26930 Protein denotes ɛy
T13307 26893-26897 Protein denotes Sox6
T13306 26798-26800 Protein denotes ɛy
T13305 26778-26782 Protein denotes Sox6
T13304 26672-26674 Protein denotes ɛy
T13303 26644-26648 Protein denotes Sox6
T13302 26483-26487 Protein denotes Sox6
T13301 26322-26326 Protein denotes Sox6
T13300 26177-26181 Protein denotes Sox6
T13299 26168-26172 Protein denotes Sox5
T13298 25940-25944 Protein denotes Sox6
T13297 26026-26028 Protein denotes 23
T13296 26018-26020 Protein denotes 13
T13295 26014-26016 Protein denotes 12
T13294 26008-26012 Protein denotes Sox5
T13293 25895-25904 Protein denotes ɛy-globin
T13292 25869-25876 Protein denotes ɛy gene
T13291 25807-25811 Protein denotes Sox6
T13290 25791-25800 Protein denotes ɛy globin
T13289 25749-25752 Protein denotes βH1
T13288 25743-25744 Protein denotes ζ
T13287 25667-25671 Protein denotes Sox6
T13286 25580-25584 Protein denotes Sox6
T10053 23335-23344 Gene_expression denotes expressed
T10052 23160-23170 Gene_expression denotes expression
T10051 22744-22754 Gene_expression denotes expression
T10050 22535-22544 Negative_regulation denotes deficient
T10049 22562-22569 Gene_expression denotes express
T10048 22437-22447 Gene_expression denotes Expression
T10047 23315-23324 Protein denotes ɛy globin
T10046 23423-23427 Protein denotes Sox6
T10045 23155-23159 Protein denotes Sox6
T10044 23040-23044 Protein denotes Sox6
T10043 22857-22861 Protein denotes Sox6
T10042 22766-22770 Protein denotes Sox6
T10041 22645-22649 Protein denotes Sox6
T10040 22570-22579 Protein denotes ɛy globin
T10039 22530-22534 Protein denotes Sox6
T10038 22459-22463 Protein denotes Sox6
T10505 25166-25175 Negative_regulation denotes silencing
T10504 24598-24605 Regulation denotes effects
T10503 25196-25200 Protein denotes Sox6
T10502 25180-25189 Protein denotes ɛy globin
T10501 24593-24597 Protein denotes Sox6
T9332 21064-21073 Protein denotes ɛy globin
T9331 20977-20986 Protein denotes ɛy globin
T9330 20820-20829 Protein denotes ɛy globin
T9329 20748-20750 Protein denotes ɛy
T9328 20702-20706 Protein denotes Sox6
T9327 20689-20698 Protein denotes ɛy Globin
T9352 21633-21643 Gene_expression denotes expression
T9351 21748-21754 Negative_regulation denotes defect
T9350 21793-21797 Negative_regulation denotes null
T9349 21450-21460 Gene_expression denotes expression
T9348 21369-21379 Transcription denotes expression
T9347 21243-21252 Gene_expression denotes expressed
T9346 20963-20973 Gene_expression denotes expression
T9345 21050-21060 Gene_expression denotes expression
T9344 21035-21038 Positive_regulation denotes due
T9343 20850-20859 Gene_expression denotes expressed
T9342 20707-20716 Negative_regulation denotes Deficient
T9341 20675-20685 Gene_expression denotes Expression
T9340 21788-21792 Protein denotes Sox6
T9339 21762-21764 Protein denotes ɛy
T9338 21611-21613 Protein denotes ɛy
T9337 21469-21479 Protein denotes min globin
T9336 21464-21468 Protein denotes βmaj
T9335 21361-21363 Protein denotes ɛy
T9334 21226-21235 Protein denotes ɛy globin
T9333 21137-21146 Protein denotes ɛy globin
T8038 19783-19790 Binding denotes binding
T8037 19277-19282 Binding denotes binds
T8036 19195-19205 Negative_regulation denotes repression
T8035 19174-19182 Positive_regulation denotes required
T8034 18889-18903 Positive_regulation denotes overexpression
T8033 18338-18343 Binding denotes binds
T8032 18282-18289 Gene_expression denotes express
T8031 18042-18047 Binding denotes binds
T8030 17699-17708 Binding denotes associate
T8029 17102-17112 Binding denotes associated
T8028 17010-17020 Regulation denotes regulating
T8027 17035-17044 Regulation denotes affecting
T8026 16886-16891 Binding denotes Binds
T8025 19798-19800 Protein denotes ɛy
T8024 19763-19765 Protein denotes ɛy
T8023 19731-19735 Protein denotes Sox6
T8022 19572-19576 Protein denotes Sox6
T8021 19516-19518 Protein denotes ɛy
T8020 19477-19481 Protein denotes Sox6
T8019 19369-19373 Protein denotes Sox6
T8018 19290-19292 Protein denotes ɛy
T8017 19272-19276 Protein denotes Sox6
T8016 19215-19219 Protein denotes Sox6
T8015 19209-19211 Protein denotes ɛy
T8014 18974-18976 Protein denotes ɛy
T8013 18884-18888 Protein denotes Sox6
T8012 18783-18785 Protein denotes ɛy
T8011 18324-18328 Protein denotes Sox6
T8010 18315-18317 Protein denotes ɛy
T8009 18296-18305 Protein denotes β globins
T8008 18075-18079 Protein denotes Sox6
T8007 18065-18067 Protein denotes HA
T8006 18025-18030 Protein denotes c-Myc
T8005 17973-17977 Protein denotes Sox6
T8004 17905-17909 Protein denotes Sox6
T8003 17895-17900 Protein denotes c-Myc
T8002 17866-17870 Protein denotes Sox6
T8001 17754-17756 Protein denotes ɛy
T8000 17672-17676 Protein denotes Sox6
T7999 17413-17415 Protein denotes ɛy
T7998 17220-17224 Protein denotes Sox6
T7997 17207-17212 Protein denotes c-Myc
T7996 17122-17124 Protein denotes ɛy
T7995 17085-17089 Protein denotes Sox6
T7994 17049-17051 Protein denotes ɛy
T7993 16934-16936 Protein denotes ɛy
T7992 16911-16915 Protein denotes Sox6
T7991 16899-16901 Protein denotes ɛy
T7990 16872-16876 Protein denotes Sox6
T6270 14169-14179 Negative_regulation denotes repression
T6269 13879-13886 Negative_regulation denotes repress
T6268 14000-14011 Regulation denotes independent
T6267 13963-13972 Negative_regulation denotes represses
T6266 13534-13545 Binding denotes interaction
T6265 13741-13752 Binding denotes interaction
T6264 13560-13568 Positive_regulation denotes required
T6263 13722-13729 Negative_regulation denotes abolish
T6262 13578-13588 Negative_regulation denotes repression
T6261 13462-13471 Gene_expression denotes expressed
T6260 13395-13404 Gene_expression denotes expressed
T6259 13372-13380 Binding denotes interact
T6258 11888-11895 Negative_regulation denotes repress
T6257 11694-11708 Positive_regulation denotes overexpression
T6256 11538-11552 Positive_regulation denotes Overexpression
T6255 11081-11085 Binding denotes acts
T6254 11246-11255 Gene_expression denotes expresses
T6253 14164-14168 Protein denotes Sox6
T2760 8279-8289 Gene_expression denotes expression
T2759 8240-8249 Gene_expression denotes expressed
T2758 8196-8205 Gene_expression denotes expressed
T2757 8083-8088 Binding denotes binds
T2756 8026-8033 Regulation denotes effects
T2755 7944-7954 Gene_expression denotes expression
T2754 7496-7507 Positive_regulation denotes upregulated
T2753 7225-7234 Negative_regulation denotes silencing
T2752 7183-7192 Negative_regulation denotes silencing
T2751 7172-7180 Regulation denotes regulate
T2750 7111-7115 Binding denotes bind
T2749 6611-6620 Negative_regulation denotes silencing
T2748 6348-6357 Positive_regulation denotes activated
T2747 6237-6246 Negative_regulation denotes silencing
T2746 6180-6188 Negative_regulation denotes silenced
T2745 6115-6122 Gene_expression denotes express
T2744 5978-5985 Gene_expression denotes express
T2743 4982-4986 Binding denotes bind
T2742 5076-5085 Gene_expression denotes expressed
T2741 4593-4601 Negative_regulation denotes disrupts
T2740 3802-3811 Negative_regulation denotes Depletion
T2739 3961-3969 Positive_regulation denotes restored
T2738 3887-3897 Gene_expression denotes expression
T2737 8410-8414 Protein denotes Sox6
T2736 8336-8345 Protein denotes ɛy globin
T2735 8330-8334 Protein denotes Sox6
T2734 8301-8310 Protein denotes ɛy globin
T2698 4781-4785 Protein denotes Sox6
T2697 4731-4732 Protein denotes p
T2696 4626-4630 Protein denotes Sox6
T2695 4611-4612 Protein denotes p
T2694 4296-4300 Protein denotes Sox6
T2693 4051-4055 Protein denotes Sox6
T2692 4137-4141 Protein denotes Sox6
T2691 3941-3944 Protein denotes Sry
T2690 3932-3936 Protein denotes Sox9
T2689 3926-3930 Protein denotes Sox6
T486 127-131 Protein denotes Sox6
T487 310-313 Protein denotes Sry
T488 352-356 Protein denotes Sox6
T489 450-454 Protein denotes Sox6
T490 479-488 Protein denotes ɛy globin
T491 688-690 Protein denotes ɛy
T492 730-734 Protein denotes Sox6
T493 865-869 Protein denotes Sox6
T494 917-919 Protein denotes ɛy
T495 955-959 Protein denotes Sox6
T496 1015-1017 Protein denotes ɛy
T497 1067-1071 Protein denotes Sox6
T498 1141-1145 Protein denotes Sox6
T499 1175-1184 Protein denotes ɛy globin
T500 1238-1242 Protein denotes Sox6
T501 1279-1283 Protein denotes Sox6
T502 1298-1307 Protein denotes ɛy globin
T505 455-464 Negative_regulation denotes deficient
T506 505-514 Gene_expression denotes expressed
T507 735-743 Positive_regulation denotes mediated
T484 0-4 Protein denotes Sox6
T485 23-37 Protein denotes Epsilon Globin
T503 38-48 Gene_expression denotes Expression
T504 14-22 Negative_regulation denotes Silences
T508 744-754 Negative_regulation denotes repression
T509 902-909 Binding denotes binding
T510 1001-1011 Gene_expression denotes expression
T511 941-951 Gene_expression denotes expression
T512 1162-1171 Negative_regulation denotes silencing
T513 1149-1157 Positive_regulation denotes required
T2703 5435-5438 Protein denotes βh1
T2702 5431-5433 Protein denotes ɛy
T2701 5095-5099 Protein denotes HMG2
T2700 5086-5090 Protein denotes HMG1
T2699 4894-4897 Protein denotes Sry
T2688 3815-3819 Protein denotes Sox6
T2687 3697-3701 Protein denotes Sox6
T2686 3535-3539 Protein denotes Sox6
T2685 2873-2877 Protein denotes Sox6
T2684 2855-2858 Protein denotes Sry
T514 1284-1294 Regulation denotes regulation
T2733 8184-8188 Protein denotes Sox6
T2732 8117-8126 Protein denotes ɛy globin
T2731 8078-8082 Protein denotes Sox6
T2730 8049-8058 Protein denotes ɛy globin
T2729 8037-8041 Protein denotes Sox6
T2728 7972-7981 Protein denotes ɛy globin
T2727 7666-7670 Protein denotes Sox6
T2726 7488-7492 Protein denotes Sox6
T2725 7242-7243 Protein denotes ɛ
T2724 7181-7182 Protein denotes ɛ
T2723 7063-7067 Protein denotes DRED
T2722 7050-7057 Protein denotes COUP-TF
T2721 7044-7048 Protein denotes YY-1
T2720 7036-7042 Protein denotes GATA-1
T2719 6963-6964 Protein denotes ɛ
T2718 6654-6655 Protein denotes ɛ
T2717 6625-6633 Protein denotes ɛ globin
T2716 6503-6511 Protein denotes β-globin
T2715 6485-6493 Protein denotes γ-globin
T2714 6430-6431 Protein denotes ɛ
T2713 6343-6344 Protein denotes ɛ
T2712 6273-6281 Protein denotes ɛ globin
T2711 6169-6171 Protein denotes ɛy
T2710 6152-6157 Protein denotes minor
T2709 6140-6147 Protein denotes β major
T2708 5993-6005 Protein denotes βh-1 globins
T2707 5986-5988 Protein denotes ɛy
T2706 5791-5793 Protein denotes ɛy
T2705 5453-5460 Protein denotes β-minor
T2704 5440-5447 Protein denotes β-major
T6228 11274-11286 Protein denotes beta globins
T6227 11261-11263 Protein denotes ɛy
T6226 11093-11095 Protein denotes ɛy
T6225 11067-11071 Protein denotes Sox6
T6224 11031-11033 Protein denotes ɛy
T6223 10986-10988 Protein denotes ɛy
T6222 10877-10879 Protein denotes ɛy
T6221 10849-10853 Protein denotes Sox6
T4901 10313-10323 Gene_expression denotes expression
T4900 10187-10197 Gene_expression denotes expression
T4899 9505-9515 Gene_expression denotes expression
T4898 9280-9290 Gene_expression denotes expression
T4897 9153-9163 Gene_expression denotes expression
T4896 9062-9071 Gene_expression denotes expressed
T4895 8692-8699 Regulation denotes targets
T4894 8524-8533 Negative_regulation denotes Deficient
T4893 8476-8486 Gene_expression denotes Expression
T4892 10309-10312 Protein denotes min
T4891 10304-10308 Protein denotes βmaj
T4890 10184-10186 Protein denotes ɛy
T4889 9531-9539 Protein denotes β globin
T4888 9345-9348 Protein denotes βh1
T4887 9339-9340 Protein denotes ζ
T4886 9457-9466 Protein denotes ɛy globin
T4885 9051-9053 Protein denotes ɛy
T4884 8778-8782 Protein denotes Sox6
T4883 8676-8680 Protein denotes Sox6
T4882 8543-8552 Protein denotes ɛy globin
T4881 8519-8523 Protein denotes Sox6
T4880 8512-8514 Protein denotes ɛy
T4879 8504-8510 Protein denotes Globin
T2761 8319-8326 Negative_regulation denotes absence
T6252 14122-14124 Protein denotes ɛy
T6251 14045-14047 Protein denotes ɛy
T6250 13994-13999 Protein denotes CtBP2
T6249 13977-13979 Protein denotes ɛy
T6248 13958-13962 Protein denotes Sox6
T6247 13891-13893 Protein denotes ɛy
T6246 13851-13855 Protein denotes Sox6
T6245 13735-13740 Protein denotes CtBP2
T6244 13730-13734 Protein denotes Sox6
T6243 13655-13659 Protein denotes Sox6
T6242 13596-13598 Protein denotes ɛy
T6241 13573-13577 Protein denotes Sox6
T6240 13551-13556 Protein denotes CtBP2
T6239 13453-13458 Protein denotes CtBP2
T6238 13433-13438 Protein denotes fgf-3
T6237 13419-13424 Protein denotes CtBP2
T6236 13323-13327 Protein denotes Sox6
T6235 11900-11902 Protein denotes ɛy
T6234 11875-11879 Protein denotes Sox6
T6233 11724-11728 Protein denotes Sox6
T6232 11556-11560 Protein denotes Sox6
T6231 11309-11311 Protein denotes ɛy
T6230 11453-11463 Protein denotes luciferase
T6229 11406-11408 Protein denotes ɛy
T20666 43217-43226 Protein denotes protein A
T19965 42207-42211 Protein denotes Sox6
T19964 42199-42201 Protein denotes HA
T19963 42192-42197 Protein denotes c-Myc
T19962 41540-41543 Protein denotes BSA
T19961 41444-41448 Protein denotes Sox6
T19960 41323-41347 Protein denotes T4 polynucleotide kinase
T19508 41064-41069 Protein denotes c-Myc
T19507 41021-41025 Protein denotes Sox6
T19506 40781-40785 Protein denotes Sox6
T19249 40455-40465 Gene_expression denotes expression
T19248 40704-40708 Protein denotes Sox6
T19247 40496-40498 Protein denotes HA
T19246 40486-40491 Protein denotes c-Myc
T19245 40429-40433 Protein denotes Sox6
T19244 40298-40302 Protein denotes Sox6
T18891 40072-40086 Gene_expression denotes overexpression
T18890 40067-40071 Protein denotes Sox6
T18889 39992-39994 Protein denotes ɛy
T17948 37305-37309 Protein denotes Sox6
T17947 37262-37273 Protein denotes βmaj globin
T17946 37231-37240 Protein denotes ɛy globin
T18567 38980-38984 Protein denotes Sox6
T17403 37103-37108 Protein denotes GAPDH
T17402 36800-36805 Protein denotes GAPDH
T17401 36402-36412 Protein denotes min globin
T17400 36397-36401 Protein denotes βmaj
T17399 36307-36317 Protein denotes βH1 globin
T17398 36218-36226 Protein denotes ζ globin
T17397 36127-36136 Protein denotes ɛy globin
T16472 35367-35381 Positive_regulation denotes overexpression
T16471 35317-35328 Gene_expression denotes overexpress
T16470 34638-34648 Gene_expression denotes expression
T16469 33913-33921 Positive_regulation denotes required
T16468 33933-33942 Negative_regulation denotes silencing
T16467 33693-33701 Negative_regulation denotes deletion
T16466 35538-35540 Protein denotes ɛy
T16465 35393-35397 Protein denotes Sox6
T16464 35362-35366 Protein denotes Sox6
T16463 35329-35333 Protein denotes Sox6
T16462 35286-35290 Protein denotes Sox6
T16461 34718-34720 Protein denotes ɛy
T16460 34627-34637 Protein denotes luciferase
T16459 34539-34541 Protein denotes ɛy
T16458 34666-34668 Protein denotes ɛy
T16457 34370-34380 Protein denotes luciferase
R446 T485 T503 themeOf Epsilon Globin,Expression
R447 T489 T505 themeOf Sox6,deficient
R448 T490 T506 themeOf ɛy globin,expressed
R449 T492 T508 themeOf Sox6,repression
R450 T493 T509 themeOf Sox6,binding
R451 T494 T509 themeOf ɛy,binding
R452 T495 T511 themeOf Sox6,expression
R453 T496 T510 themeOf ɛy,expression
R454 T498 T513 causeOf Sox6,required
R455 T499 T512 themeOf ɛy globin,silencing
R456 T501 T514 themeOf Sox6,regulation
R457 T502 T514 themeOf ɛy globin,regulation
R458 T503 T504 themeOf Expression,Silences
R459 T508 T507 themeOf repression,mediated
R460 T512 T513 themeOf silencing,required
R1774 T2688 T2740 themeOf Sox6,Depletion
R1775 T2689 T2738 themeOf Sox6,expression
R1780 T2690 T2738 themeOf Sox9,expression
R1782 T2691 T2738 themeOf Sry,expression
R1786 T2696 T2741 themeOf Sox6,disrupts
R1788 T2699 T2743 themeOf Sry,bind
R1793 T2700 T2742 themeOf HMG1,expressed
R1794 T2701 T2742 themeOf HMG2,expressed
R1802 T2707 T2744 themeOf ɛy,express
R1805 T2710 T2745 themeOf minor,express
R1808 T2711 T2746 themeOf ɛy,silenced
R1809 T2712 T2747 themeOf ɛ globin,silencing
R1811 T2713 T2748 themeOf ɛ,activated
R1816 T2717 T2749 themeOf ɛ globin,silencing
R1820 T2720 T2750 themeOf GATA-1,bind
R1822 T2724 T2752 themeOf ɛ,silencing
R1826 T2725 T2753 themeOf ɛ,silencing
R1828 T2726 T2754 themeOf Sox6,upregulated
R1832 T2728 T2755 themeOf ɛy globin,expression
R1836 T2729 T2756 themeOf Sox6,effects
R1837 T2731 T2757 themeOf Sox6,binds
R1841 T2732 T2757 themeOf ɛy globin,binds
R1842 T2733 T2758 themeOf Sox6,expressed
R1843 T2733 T2759 themeOf Sox6,expressed
R1845 T2734 T2760 themeOf ɛy globin,expression
R1847 T2735 T2761 themeOf Sox6,absence
R1849 T2738 T2739 themeOf expression,restored
R1851 T2738 T2739 themeOf expression,restored
R1852 T2738 T2739 themeOf expression,restored
R1859 T2752 T2751 themeOf silencing,regulate
R3452 T4880 T4893 themeOf ɛy,Expression
R3453 T4881 T4894 themeOf Sox6,Deficient
R3454 T4883 T4895 themeOf Sox6,targets
R3455 T4885 T4896 themeOf ɛy,expressed
R3456 T4885 T4897 themeOf ɛy,expression
R3457 T4887 T4898 themeOf ζ,expression
R3458 T4888 T4898 themeOf βh1,expression
R3459 T4889 T4899 themeOf β globin,expression
R3460 T4890 T4900 themeOf ɛy,expression
R3461 T4891 T4901 themeOf βmaj,expression
R3462 T4892 T4901 themeOf min,expression
R4356 T6225 T6255 themeOf Sox6,acts
R4357 T6227 T6254 themeOf ɛy,expresses
R4358 T6232 T6256 themeOf Sox6,Overexpression
R4359 T6233 T6257 themeOf Sox6,overexpression
R4360 T6234 T6258 causeOf Sox6,repress
R4361 T6235 T6258 themeOf ɛy,repress
R4362 T6236 T6259 themeOf Sox6,interact
R4363 T6236 T6259 themeOf Sox6,interact
R4364 T6237 T6259 themeOf CtBP2,interact
R4365 T6237 T6260 themeOf CtBP2,expressed
R4366 T6238 T6259 themeOf fgf-3,interact
R4367 T6238 T6260 themeOf fgf-3,expressed
R4368 T6239 T6261 themeOf CtBP2,expressed
R4369 T6240 T6266 themeOf CtBP2,interaction
R4370 T6241 T6262 themeOf Sox6,repression
R4371 T6244 T6265 themeOf Sox6,interaction
R4372 T6245 T6265 themeOf CtBP2,interaction
R4373 T6247 T6269 themeOf ɛy,repress
R4374 T6248 T6267 causeOf Sox6,represses
R4375 T6249 T6267 themeOf ɛy,represses
R4376 T6250 T6268 themeOf CtBP2,independent
R4377 T6253 T6270 themeOf Sox6,repression
R4378 T6262 T6264 themeOf repression,required
R4379 T6265 T6263 themeOf interaction,abolish
R4380 T6265 T6263 themeOf interaction,abolish
R5527 T8023 T8038 themeOf Sox6,binding
R5537 T7990 T8026 themeOf Sox6,Binds
R5538 T7992 T8028 causeOf Sox6,regulating
R5539 T8024 T8038 themeOf ɛy,binding
R5540 T8025 T8038 themeOf ɛy,binding
R5541 T7994 T8027 themeOf ɛy,affecting
R5542 T8025 T8038 themeOf ɛy,binding
R5543 T8027 T8028 themeOf affecting,regulating
R5544 T7995 T8029 themeOf Sox6,associated
R5545 T8036 T8035 themeOf repression,required
R5546 T8001 T8030 themeOf ɛy,associate
R5548 T8006 T8031 themeOf c-Myc,binds
R5551 T8010 T8032 themeOf ɛy,express
R5552 T8011 T8033 themeOf Sox6,binds
R5554 T8013 T8034 themeOf Sox6,overexpression
R5556 T8015 T8036 themeOf ɛy,repression
R5558 T8016 T8036 causeOf Sox6,repression
R5560 T8016 T8035 causeOf Sox6,required
R5562 T8017 T8037 themeOf Sox6,binds
R5564 T8018 T8037 themeOf ɛy,binds
R6472 T9327 T9341 themeOf ɛy Globin,Expression
R6473 T9328 T9342 themeOf Sox6,Deficient
R6474 T9330 T9343 themeOf ɛy globin,expressed
R6475 T9331 T9346 themeOf ɛy globin,expression
R6476 T9332 T9345 themeOf ɛy globin,expression
R6477 T9334 T9347 themeOf ɛy globin,expressed
R6478 T9335 T9348 themeOf ɛy,expression
R6479 T9336 T9349 themeOf βmaj,expression
R6480 T9337 T9349 themeOf min globin,expression
R6481 T9338 T9352 themeOf ɛy,expression
R6482 T9339 T9351 themeOf ɛy,defect
R6483 T9340 T9350 themeOf Sox6,null
R6484 T9345 T9344 themeOf expression,due
R6485 T9346 T9344 themeOf expression,due
R6951 T10038 T10048 themeOf Sox6,Expression
R6952 T10039 T10050 themeOf Sox6,deficient
R6953 T10040 T10049 themeOf ɛy globin,express
R6954 T10042 T10051 themeOf Sox6,expression
R6955 T10045 T10052 themeOf Sox6,expression
R6956 T10047 T10053 themeOf ɛy globin,expressed
R7292 T10501 T10504 themeOf Sox6,effects
R7293 T10502 T10505 themeOf ɛy globin,silencing
R9149 T13322 T13394 themeOf DRED,binding
R9150 T13322 T13393 causeOf DRED,interferes
R9151 T13323 T13394 themeOf EKLF,binding
R9152 T13323 T13393 themeOf EKLF,interferes
R9153 T13324 T13394 themeOf ɛy,binding
R9154 T13324 T13394 themeOf ɛy,binding
R9155 T13325 T13395 themeOf HMG-I,bind
R9156 T13325 T13395 themeOf HMG-I,bind
R9157 T13326 T13395 themeOf HMG-Y,bind
R9158 T13326 T13395 themeOf HMG-Y,bind
R9159 T13327 T13395 themeOf silencers I,bind
R9160 T13327 T13395 themeOf silencers I,bind
R9161 T13290 T13379 themeOf ɛy globin,upregulation
R9162 T13328 T13395 themeOf II,bind
R9163 T13291 T13380 themeOf Sox6,regulates
R9164 T13291 T13381 themeOf Sox6,binds
R9165 T13292 T13381 themeOf ɛy gene,binds
R9166 T13328 T13395 themeOf II,bind
R9167 T13329 T13398 themeOf Sox6,expression
R9168 T13330 T13396 causeOf Sox6,represses
R9169 T13331 T13397 themeOf ɛy globin,expression
R9170 T13332 T13399 themeOf ɛy globin,expression
R9171 T13300 T13382 themeOf Sox6,dimerization
R9172 T13333 T13400 causeOf Sox6,silence
R9173 T13334 T13401 themeOf ɛy globin,expression
R9174 T13301 T13383 themeOf Sox6,binds
R9175 T13335 T13404 themeOf ɛy globin,expression
R9176 T13336 T13402 themeOf Sox6,null
R9177 T13337 T13403 themeOf βmaj,expression
R9178 T13305 T13384 themeOf Sox6,binding
R9179 T13338 T13403 themeOf min,expression
R9180 T13339 T13405 themeOf ɛy globin,expression
R9181 T13306 T13384 themeOf ɛy,binding
R9182 T13307 T13386 themeOf Sox6,binds
R9183 T13340 T13406 themeOf ζ,expression
R9184 T13308 T13386 themeOf ɛy,binds
R9185 T13309 T13387 themeOf Sox6,associated
R9186 T13341 T13406 themeOf βh1,expression
R9187 T13312 T13388 themeOf DRED,bind
R9188 T13348 T13407 themeOf ɛy,regulated
R9189 T13313 T13388 themeOf COUP,bind
R9190 T13315 T13389 themeOf Sox6,interact
R9191 T13357 T13408 themeOf β-like globin,elevated
R9192 T13319 T13390 themeOf Sox6,binding
R9193 T13319 T13392 themeOf Sox6,changing
R9194 T13319 T13391 themeOf Sox6,binding
R9195 T13358 T13410 causeOf Sox6,silence
R9196 T13359 T13409 themeOf ɛy globin,expression
R9197 T13360 T13411 themeOf ɛy-globin,regulation
R9198 T13361 T13412 themeOf Sox6,regulates
R9206 T13364 T13413 themeOf Sox6,deficient
R9208 T13365 T13414 themeOf Sox6,target
R9209 T13365 T13415 themeOf Sox6,interacting
R9210 T13367 T13417 themeOf ɛ-globin,reactivation
R9211 T13368 T13416 themeOf ɛ-globin,silencing
R9213 T13369 T13418 themeOf Sox6,binds
R9214 T13370 T13418 themeOf ɛy,binds
R9215 T13373 T13419 themeOf ɛ globin,silencing
R9216 T13378 T13420 themeOf ɛ globin,regulation
R9218 T13384 T13385 themeOf binding,essential
R9222 T13397 T13396 themeOf expression,represses
R9229 T13401 T13400 themeOf expression,silence
R9231 T13403 T13402 themeOf expression,null
R9234 T13403 T13402 themeOf expression,null
R9236 T13409 T13410 themeOf expression,silence
R11455 T16451 T16467 themeOf ɛy,deletion
R11456 T16454 T16468 themeOf ɛ,silencing
R11457 T16460 T16470 themeOf luciferase,expression
R11458 T16463 T16471 themeOf Sox6,overexpress
R11459 T16464 T16472 themeOf Sox6,overexpression
R11460 T16468 T16469 themeOf silencing,required
R13396 T18890 T18891 themeOf Sox6,overexpression
R13668 T19245 T19249 themeOf Sox6,expression

DLUT931

Id Subject Object Predicate Lexical cue
T20673 43847-43849 Protein denotes ɛy
T20672 43742-43744 Protein denotes ɛy
T20671 43388-43392 Protein denotes Sox6
T20670 43217-43226 Protein denotes protein A
T19978 41487-41494 Binding denotes binding
T19977 42207-42211 Protein denotes Sox6
T19976 42199-42201 Protein denotes HA
T19975 42192-42197 Protein denotes c-Myc
T19974 41540-41543 Protein denotes BSA
T19973 41444-41448 Protein denotes Sox6
T19972 41323-41347 Protein denotes T4 polynucleotide kinase
T19518 41064-41069 Protein denotes c-Myc
T19517 41021-41025 Protein denotes Sox6
T19516 40781-40785 Protein denotes Sox6
T19260 40455-40465 Gene_expression denotes expression
T19259 40704-40708 Protein denotes Sox6
T19258 40496-40498 Protein denotes HA
T19257 40486-40491 Protein denotes c-Myc
T19256 40429-40433 Protein denotes Sox6
T19255 40298-40302 Protein denotes Sox6
T18898 40072-40086 Gene_expression denotes overexpression
T18897 40067-40071 Protein denotes Sox6
T18896 39992-39994 Protein denotes ɛy
T18570 38980-38984 Protein denotes Sox6
T17957 37305-37309 Protein denotes Sox6
T17956 37262-37273 Protein denotes βmaj globin
T17955 37231-37240 Protein denotes ɛy globin
T17430 37103-37108 Protein denotes GAPDH
T17429 36800-36805 Protein denotes GAPDH
T17428 36402-36412 Protein denotes min globin
T17427 36397-36401 Protein denotes βmaj
T17426 36307-36317 Protein denotes βH1 globin
T17425 36218-36226 Protein denotes ζ globin
T17424 36127-36136 Protein denotes ɛy globin
T16542 35367-35381 Positive_regulation denotes overexpression
T16541 35317-35328 Gene_expression denotes overexpress
T16540 34638-34648 Gene_expression denotes expression
T16539 33913-33921 Positive_regulation denotes required
T16538 33933-33942 Negative_regulation denotes silencing
T16537 33693-33701 Negative_regulation denotes deletion
T16536 35538-35540 Protein denotes ɛy
T16535 35393-35397 Protein denotes Sox6
T16534 35362-35366 Protein denotes Sox6
T16533 35329-35333 Protein denotes Sox6
T16532 35286-35290 Protein denotes Sox6
T16531 34718-34720 Protein denotes ɛy
T16530 34627-34637 Protein denotes luciferase
T16529 34539-34541 Protein denotes ɛy
T16528 34666-34668 Protein denotes ɛy
T16527 34370-34380 Protein denotes luciferase
T16526 34325-34327 Protein denotes ɛy
T16525 34036-34044 Protein denotes ɛ globin
T16524 33926-33927 Protein denotes ɛ
T16523 33825-33834 Protein denotes ɛy globin
T16522 33769-33771 Protein denotes ɛy
T16521 33681-33683 Protein denotes ɛy
T13681 33508-33518 Regulation denotes regulation
T13680 33282-33290 Negative_regulation denotes silencer
T13679 33054-33063 Positive_regulation denotes important
T13678 33082-33091 Negative_regulation denotes silencing
T13677 32830-32835 Binding denotes binds
T13676 32759-32768 Negative_regulation denotes silencing
T13675 32559-32571 Positive_regulation denotes reactivation
T13674 32383-32394 Binding denotes interacting
T13673 31904-31913 Negative_regulation denotes deficient
T13672 30900-30907 Negative_regulation denotes silence
T13671 30962-30972 Regulation denotes regulation
T13670 30918-30928 Gene_expression denotes expression
T13669 30715-30723 Positive_regulation denotes elevated
T13668 30461-30465 Positive_regulation denotes high
T13667 30162-30171 Negative_regulation denotes silencing
T13666 30066-30072 Regulation denotes effect
T13665 29989-29998 Regulation denotes regulated
T13664 29845-29851 Positive_regulation denotes higher
T13663 29752-29758 Positive_regulation denotes higher
T13662 29677-29687 Gene_expression denotes expression
T13661 29597-29607 Gene_expression denotes expression
T13660 29449-29459 Positive_regulation denotes equivalent
T13659 29485-29495 Gene_expression denotes expression
T13658 29397-29401 Negative_regulation denotes null
T13657 29381-29391 Negative_regulation denotes homozygous
T13656 29348-29358 Gene_expression denotes expression
T13655 29314-29321 Negative_regulation denotes silence
T13654 29332-29342 Gene_expression denotes expression
T13653 29110-29113 Positive_regulation denotes due
T13652 29062-29072 Gene_expression denotes expression
T13651 28916-28925 Negative_regulation denotes represses
T13650 28936-28946 Gene_expression denotes expression
T13649 28833-28843 Negative_regulation denotes coincident
T13648 28794-28804 Gene_expression denotes expression
T13647 28644-28648 Binding denotes bind
T13646 28478-28485 Binding denotes binding
T13645 28439-28449 Negative_regulation denotes interferes
T13644 28396-28405 Positive_regulation denotes activator
T13643 28239-28248 Negative_regulation denotes interfere
T13642 28312-28319 Binding denotes binding
T13641 27579-27587 Binding denotes interact
T13640 27461-27465 Binding denotes bind
T13639 27324-27334 Binding denotes associated
T13638 26970-26981 Binding denotes heterodimer
T13637 26898-26903 Binding denotes binds
T13636 26764-26773 Positive_regulation denotes essential
T13635 26814-26824 Negative_regulation denotes repression
T13634 26783-26790 Binding denotes binding
T13633 26327-26332 Binding denotes binds
T13632 26208-26216 Positive_regulation denotes increase
T13631 26152-26164 Binding denotes dimerization
T13630 25999-26007 Positive_regulation denotes includes
T13629 25881-25890 Negative_regulation denotes represses
T13628 25835-25840 Binding denotes binds
T13627 25771-25783 Positive_regulation denotes upregulation
T13626 25705-25711 Regulation denotes effect
T13625 25672-25676 Negative_regulation denotes null
T13624 33499-33507 Protein denotes ɛ globin
T13623 33442-33446 Protein denotes Sox6
T13622 33370-33374 Protein denotes Sox6
T13621 33304-33312 Protein denotes ɛ globin
T13620 33160-33161 Protein denotes ɛ
T13619 33073-33081 Protein denotes ɛ globin
T13618 33037-33041 Protein denotes Sox6
T13617 32932-32936 Protein denotes Sox6
T13616 32843-32845 Protein denotes ɛy
T13615 32818-32822 Protein denotes Sox6
T13614 32745-32753 Protein denotes ɛ-globin
T13613 32581-32589 Protein denotes ɛ-globin
T13612 32435-32439 Protein denotes Sox6
T13611 32346-32350 Protein denotes Sox6
T13610 31899-31903 Protein denotes Sox6
T13609 31632-31636 Protein denotes Sox6
T13608 31084-31088 Protein denotes Sox6
T13607 31010-31014 Protein denotes Sox6
T13606 30976-30985 Protein denotes ɛy-globin
T13605 30908-30917 Protein denotes ɛy globin
T13604 30858-30862 Protein denotes Sox6
T13603 30674-30687 Protein denotes β-like globin
T13602 30610-30613 Protein denotes βh1
T13601 30604-30605 Protein denotes ζ
T13600 30533-30535 Protein denotes ɛy
T13599 30476-30485 Protein denotes ɛy globin
T13598 30172-30174 Protein denotes ɛy
T13597 30047-30051 Protein denotes Sox6
T13596 30022-30025 Protein denotes βh1
T13595 30016-30017 Protein denotes ζ
T13594 29983-29985 Protein denotes ɛy
T13593 29913-29916 Protein denotes βh1
T13592 29907-29908 Protein denotes ζ
T13591 29896-29905 Protein denotes ɛy globin
T13590 29824-29827 Protein denotes βh1
T13589 29818-29819 Protein denotes ζ
T13588 29804-29806 Protein denotes ɛy
T13587 29738-29741 Protein denotes βh1
T13586 29732-29733 Protein denotes ζ
T13585 29615-29624 Protein denotes ɛy globin
T13584 29481-29484 Protein denotes min
T13583 29476-29480 Protein denotes βmaj
T13582 29392-29396 Protein denotes Sox6
T13581 29368-29377 Protein denotes ɛy globin
T13580 29322-29331 Protein denotes ɛy globin
T13579 29267-29271 Protein denotes Sox6
T13578 29076-29085 Protein denotes ɛy globin
T13577 28926-28935 Protein denotes ɛy globin
T13576 28911-28915 Protein denotes Sox6
T13575 28789-28793 Protein denotes Sox6
T13574 28704-28706 Protein denotes II
T13573 28688-28699 Protein denotes silencers I
T13572 28616-28621 Protein denotes HMG-Y
T13571 28606-28611 Protein denotes HMG-I
T13570 28493-28495 Protein denotes ɛy
T13569 28455-28459 Protein denotes EKLF
T13568 28434-28438 Protein denotes DRED
T13567 28428-28432 Protein denotes DRED
T13566 28413-28415 Protein denotes ɛy
T13565 28221-28225 Protein denotes Sox6
T13564 27968-27972 Protein denotes Sox6
T13563 27730-27732 Protein denotes ɛy
T13562 27686-27690 Protein denotes Sox6
T13561 27568-27572 Protein denotes Sox6
T13560 27559-27561 Protein denotes TF
T13559 27554-27558 Protein denotes COUP
T13558 27532-27536 Protein denotes DRED
T13557 27418-27427 Protein denotes ɛy globin
T13556 27357-27361 Protein denotes Sox6
T13555 27319-27323 Protein denotes Sox6
T13554 26928-26930 Protein denotes ɛy
T13553 26893-26897 Protein denotes Sox6
T13552 26798-26800 Protein denotes ɛy
T13551 26778-26782 Protein denotes Sox6
T13550 26672-26674 Protein denotes ɛy
T13549 26644-26648 Protein denotes Sox6
T13548 26483-26487 Protein denotes Sox6
T13547 26322-26326 Protein denotes Sox6
T13546 26177-26181 Protein denotes Sox6
T13545 26168-26172 Protein denotes Sox5
T13544 25940-25944 Protein denotes Sox6
T13543 26026-26028 Protein denotes 23
T13542 26018-26020 Protein denotes 13
T13541 26014-26016 Protein denotes 12
T13540 26008-26012 Protein denotes Sox5
T13539 25895-25904 Protein denotes ɛy-globin
T13538 25869-25876 Protein denotes ɛy gene
T13537 25807-25811 Protein denotes Sox6
T13536 25791-25800 Protein denotes ɛy globin
T13535 25749-25752 Protein denotes βH1
T13534 25743-25744 Protein denotes ζ
T13533 25667-25671 Protein denotes Sox6
T13532 25580-25584 Protein denotes Sox6
T10079 23335-23344 Gene_expression denotes expressed
T10078 23160-23170 Gene_expression denotes expression
T10077 22744-22754 Gene_expression denotes expression
T10076 22562-22569 Gene_expression denotes express
T10075 22535-22544 Negative_regulation denotes deficient
T10074 22437-22447 Gene_expression denotes Expression
T10073 23315-23324 Protein denotes ɛy globin
T10072 23423-23427 Protein denotes Sox6
T10071 23155-23159 Protein denotes Sox6
T10070 23040-23044 Protein denotes Sox6
T10069 22857-22861 Protein denotes Sox6
T10068 22766-22770 Protein denotes Sox6
T10067 22645-22649 Protein denotes Sox6
T10066 22570-22579 Protein denotes ɛy globin
T10065 22530-22534 Protein denotes Sox6
T10064 22459-22463 Protein denotes Sox6
T10518 25166-25175 Negative_regulation denotes silencing
T10517 24598-24605 Regulation denotes effects
T10516 25196-25200 Protein denotes Sox6
T10515 25180-25189 Protein denotes ɛy globin
T10514 24593-24597 Protein denotes Sox6
T9401 21618-21621 Positive_regulation denotes due
T9400 21793-21797 Negative_regulation denotes null
T9399 21765-21774 Negative_regulation denotes silencing
T9398 21748-21754 Negative_regulation denotes defect
T9397 21633-21643 Gene_expression denotes expression
T9396 21491-21499 Positive_regulation denotes abundant
T9395 21450-21460 Gene_expression denotes expression
T9394 21353-21360 Positive_regulation denotes ectopic
T9393 21369-21379 Transcription denotes expression
T9392 21243-21252 Gene_expression denotes expressed
T9391 21147-21158 Transcription denotes transcripts
T9390 21050-21060 Gene_expression denotes expression
T9389 21035-21038 Positive_regulation denotes due
T9388 20990-20993 Positive_regulation denotes due
T9387 20963-20973 Gene_expression denotes expression
T9386 20890-20898 Negative_regulation denotes silenced
T9385 20850-20859 Gene_expression denotes expressed
T9384 20751-20765 Gene_expression denotes Gene–Silencing
T9383 20725-20728 Positive_regulation denotes Due
T9382 20707-20716 Negative_regulation denotes Deficient
T9381 20675-20685 Gene_expression denotes Expression
T9380 21788-21792 Protein denotes Sox6
T9379 21762-21764 Protein denotes ɛy
T9378 21611-21613 Protein denotes ɛy
T9377 21469-21479 Protein denotes min globin
T9376 21464-21468 Protein denotes βmaj
T9375 21361-21363 Protein denotes ɛy
T9374 21226-21235 Protein denotes ɛy globin
T9373 21137-21146 Protein denotes ɛy globin
T9372 21064-21073 Protein denotes ɛy globin
T9371 20977-20986 Protein denotes ɛy globin
T9370 20820-20829 Protein denotes ɛy globin
T9369 20748-20750 Protein denotes ɛy
T9368 20702-20706 Protein denotes Sox6
T9367 20689-20698 Protein denotes ɛy Globin
T8092 19783-19790 Binding denotes binding
T8091 19746-19755 Negative_regulation denotes repressor
T8090 19277-19282 Binding denotes binds
T8089 19174-19182 Positive_regulation denotes required
T8088 19195-19205 Negative_regulation denotes repression
T8087 18889-18903 Gene_expression denotes overexpression
T8086 18860-18874 Gene_expression denotes co-transfected
T8085 18338-18343 Binding denotes binds
T8084 18282-18289 Gene_expression denotes express
T8083 18068-18074 Binding denotes tagged
T8082 18042-18047 Binding denotes binds
T8081 17962-17969 Binding denotes binding
T8080 17699-17708 Binding denotes associate
T8079 17102-17112 Binding denotes associated
T8078 17010-17020 Regulation denotes regulating
T8077 17035-17044 Regulation denotes affecting
T8076 16978-16985 Binding denotes contact
T8075 16886-16891 Binding denotes Binds
T8074 19798-19800 Protein denotes ɛy
T8073 19763-19765 Protein denotes ɛy
T8072 19731-19735 Protein denotes Sox6
T8071 19572-19576 Protein denotes Sox6
T8070 19516-19518 Protein denotes ɛy
T8069 19477-19481 Protein denotes Sox6
T8068 19369-19373 Protein denotes Sox6
T8067 19290-19292 Protein denotes ɛy
T8066 19272-19276 Protein denotes Sox6
T8065 19215-19219 Protein denotes Sox6
T8064 19209-19211 Protein denotes ɛy
T8063 18974-18976 Protein denotes ɛy
T8062 18884-18888 Protein denotes Sox6
T8061 18783-18785 Protein denotes ɛy
T8060 18324-18328 Protein denotes Sox6
T8059 18315-18317 Protein denotes ɛy
T8058 18296-18305 Protein denotes β globins
T8057 18075-18079 Protein denotes Sox6
T8056 18065-18067 Protein denotes HA
T8055 18025-18030 Protein denotes c-Myc
T8054 17973-17977 Protein denotes Sox6
T8053 17905-17909 Protein denotes Sox6
T8052 17895-17900 Protein denotes c-Myc
T8051 17866-17870 Protein denotes Sox6
T8050 17754-17756 Protein denotes ɛy
T8049 17672-17676 Protein denotes Sox6
T8048 17413-17415 Protein denotes ɛy
T8047 17220-17224 Protein denotes Sox6
T8046 17207-17212 Protein denotes c-Myc
T8045 17122-17124 Protein denotes ɛy
T8044 17085-17089 Protein denotes Sox6
T8043 17049-17051 Protein denotes ɛy
T8042 16934-16936 Protein denotes ɛy
T8041 16911-16915 Protein denotes Sox6
T8040 16899-16901 Protein denotes ɛy
T8039 16872-16876 Protein denotes Sox6
T6322 14169-14179 Negative_regulation denotes repression
T6321 14000-14011 Regulation denotes independent
T6320 13963-13972 Negative_regulation denotes represses
T6319 13879-13886 Negative_regulation denotes repress
T6318 13722-13729 Negative_regulation denotes abolish
T6317 13560-13568 Positive_regulation denotes required
T6316 13741-13752 Binding denotes interaction
T6315 13631-13639 Regulation denotes mutation
T6314 13578-13588 Negative_regulation denotes repression
T6313 13534-13545 Binding denotes interaction
T6312 13462-13471 Gene_expression denotes expressed
T6311 13395-13404 Gene_expression denotes expressed
T6310 13372-13380 Binding denotes interact
T6309 11888-11895 Negative_regulation denotes repress
T6308 11694-11708 Positive_regulation denotes overexpression
T6307 11538-11552 Positive_regulation denotes Overexpression
T6306 11246-11255 Gene_expression denotes expresses
T6305 11081-11085 Positive_regulation denotes acts
T6304 10863-10872 Negative_regulation denotes Represses
T6303 14164-14168 Protein denotes Sox6
T6302 14122-14124 Protein denotes ɛy
T6301 14045-14047 Protein denotes ɛy
T6300 13994-13999 Protein denotes CtBP2
T6299 13977-13979 Protein denotes ɛy
T6298 13958-13962 Protein denotes Sox6
T6297 13891-13893 Protein denotes ɛy
T6296 13851-13855 Protein denotes Sox6
T6295 13735-13740 Protein denotes CtBP2
T6294 13730-13734 Protein denotes Sox6
T6293 13655-13659 Protein denotes Sox6
T6292 13596-13598 Protein denotes ɛy
T6291 13573-13577 Protein denotes Sox6
T6290 13551-13556 Protein denotes CtBP2
T6289 13453-13458 Protein denotes CtBP2
T6288 13433-13438 Protein denotes fgf-3
T6287 13419-13424 Protein denotes CtBP2
T6286 13323-13327 Protein denotes Sox6
T6285 11900-11902 Protein denotes ɛy
T6284 11875-11879 Protein denotes Sox6
T6283 11724-11728 Protein denotes Sox6
T6282 11556-11560 Protein denotes Sox6
T6281 11309-11311 Protein denotes ɛy
T6280 11453-11463 Protein denotes luciferase
T6279 11406-11408 Protein denotes ɛy
T6278 11274-11286 Protein denotes beta globins
T6277 11261-11263 Protein denotes ɛy
T6276 11093-11095 Protein denotes ɛy
T6275 11067-11071 Protein denotes Sox6
T6274 11031-11033 Protein denotes ɛy
T6273 10986-10988 Protein denotes ɛy
T6272 10877-10879 Protein denotes ɛy
T6271 10849-10853 Protein denotes Sox6
T4943 10277-10287 Positive_regulation denotes equivalent
T4942 10175-10180 Negative_regulation denotes level
T4941 10313-10323 Gene_expression denotes expression
T4940 10187-10197 Gene_expression denotes expression
T4939 9557-9563 Positive_regulation denotes higher
T4938 9505-9515 Gene_expression denotes expression
T4937 9359-9365 Positive_regulation denotes higher
T4936 9280-9290 Gene_expression denotes expression
T4935 9153-9163 Gene_expression denotes expression
T4934 9062-9071 Gene_expression denotes expressed
T4933 8692-8699 Regulation denotes targets
T4932 8465-8475 Negative_regulation denotes Persistent
T4931 8524-8533 Negative_regulation denotes Deficient
T4930 8476-8486 Gene_expression denotes Expression
T4929 10309-10312 Protein denotes min
T4928 10304-10308 Protein denotes βmaj
T4927 10184-10186 Protein denotes ɛy
T4926 9531-9539 Protein denotes β globin
T4925 9345-9348 Protein denotes βh1
T4924 9339-9340 Protein denotes ζ
T4923 9457-9466 Protein denotes ɛy globin
T4922 9051-9053 Protein denotes ɛy
T4921 8778-8782 Protein denotes Sox6
T4920 8676-8680 Protein denotes Sox6
T4919 8543-8552 Protein denotes ɛy globin
T4918 8519-8523 Protein denotes Sox6
T4917 8512-8514 Protein denotes ɛy
T4916 8504-8510 Protein denotes Globin
T2844 8319-8326 Negative_regulation denotes absence
T2843 8279-8289 Gene_expression denotes expression
T2842 8240-8249 Gene_expression denotes expressed
T2841 8196-8205 Gene_expression denotes expressed
T2840 8131-8140 Negative_regulation denotes represses
T2839 8145-8158 Transcription denotes transcription
T2838 8083-8088 Binding denotes binds
T2837 8026-8033 Regulation denotes effects
T2836 7944-7954 Gene_expression denotes expression
T2835 7695-7702 Regulation denotes effects
T2834 7496-7507 Positive_regulation denotes upregulated
T2833 7225-7234 Negative_regulation denotes silencing
T2832 7172-7180 Regulation denotes regulate
T2831 7183-7192 Negative_regulation denotes silencing
T2830 6611-6620 Negative_regulation denotes silencing
T2829 6451-6460 Regulation denotes regulated
T2828 6362-6370 Negative_regulation denotes silenced
T2827 6348-6357 Positive_regulation denotes activated
T2826 6237-6246 Negative_regulation denotes silencing
T2825 6180-6188 Negative_regulation denotes silenced
T2824 6115-6122 Gene_expression denotes express
T2823 5978-5985 Gene_expression denotes express
T2822 5076-5085 Gene_expression denotes expressed
T2821 4982-4986 Binding denotes bind
T2820 4786-4799 Transcription denotes transcription
T2819 4593-4601 Negative_regulation denotes disrupts
T2818 3887-3897 Gene_expression denotes expression
T2817 3802-3811 Negative_regulation denotes Depletion
T2816 3056-3063 Binding denotes binding
T2815 8410-8414 Protein denotes Sox6
T2814 8336-8345 Protein denotes ɛy globin
T2813 8330-8334 Protein denotes Sox6
T2812 8301-8310 Protein denotes ɛy globin
T2811 8184-8188 Protein denotes Sox6
T2810 8117-8126 Protein denotes ɛy globin
T2809 8078-8082 Protein denotes Sox6
T2806 7972-7981 Protein denotes ɛy globin
T2805 7666-7670 Protein denotes Sox6
T2804 7488-7492 Protein denotes Sox6
T2803 7242-7243 Protein denotes ɛ
T2802 7181-7182 Protein denotes ɛ
T2801 7063-7067 Protein denotes DRED
T2800 7050-7057 Protein denotes COUP-TF
T2799 7044-7048 Protein denotes YY-1
T2798 7036-7042 Protein denotes GATA-1
T2797 6963-6964 Protein denotes ɛ
T2796 6654-6655 Protein denotes ɛ
T2795 6625-6633 Protein denotes ɛ globin
T2794 6503-6511 Protein denotes β-globin
T2793 6485-6493 Protein denotes γ-globin
T2792 6430-6431 Protein denotes ɛ
T2791 6343-6344 Protein denotes ɛ
T2790 6273-6281 Protein denotes ɛ globin
T2789 6169-6171 Protein denotes ɛy
T2788 6152-6157 Protein denotes minor
T2787 6140-6147 Protein denotes β major
T2786 5993-6005 Protein denotes βh-1 globins
T2785 5986-5988 Protein denotes ɛy
T2784 5791-5793 Protein denotes ɛy
T2783 5453-5460 Protein denotes β-minor
T2782 5440-5447 Protein denotes β-major
T2781 5435-5438 Protein denotes βh1
T2780 5431-5433 Protein denotes ɛy
T2779 5095-5099 Protein denotes HMG2
T2778 5086-5090 Protein denotes HMG1
T2777 4894-4897 Protein denotes Sry
T2776 4781-4785 Protein denotes Sox6
T2775 4731-4732 Protein denotes p
T2774 4626-4630 Protein denotes Sox6
T2773 4611-4612 Protein denotes p
T2772 4296-4300 Protein denotes Sox6
T2771 4051-4055 Protein denotes Sox6
T2770 4137-4141 Protein denotes Sox6
T2769 3941-3944 Protein denotes Sry
T2768 3932-3936 Protein denotes Sox9
T2767 3926-3930 Protein denotes Sox6
T2766 3815-3819 Protein denotes Sox6
T2765 3697-3701 Protein denotes Sox6
T2764 3535-3539 Protein denotes Sox6
T2763 2873-2877 Protein denotes Sox6
T2762 2855-2858 Protein denotes Sry
T545 1344-1350 Regulation denotes target
T544 1284-1294 Regulation denotes regulation
T543 1149-1157 Positive_regulation denotes required
T542 1162-1171 Negative_regulation denotes silencing
T541 993-1000 Negative_regulation denotes ectopic
T540 1001-1011 Gene_expression denotes expression
T539 941-951 Gene_expression denotes expression
T515 0-4 Protein denotes Sox6
T517 127-131 Protein denotes Sox6
T518 310-313 Protein denotes Sry
T519 352-356 Protein denotes Sox6
T520 450-454 Protein denotes Sox6
T521 479-488 Protein denotes ɛy globin
T522 688-690 Protein denotes ɛy
T523 730-734 Protein denotes Sox6
T524 865-869 Protein denotes Sox6
T525 917-919 Protein denotes ɛy
T526 955-959 Protein denotes Sox6
T527 1015-1017 Protein denotes ɛy
T528 1067-1071 Protein denotes Sox6
T529 1141-1145 Protein denotes Sox6
T530 1175-1184 Protein denotes ɛy globin
T531 1238-1242 Protein denotes Sox6
T532 1279-1283 Protein denotes Sox6
T533 1298-1307 Protein denotes ɛy globin
T536 455-464 Negative_regulation denotes deficient
T537 505-514 Gene_expression denotes expressed
T538 902-909 Binding denotes binding
T516 23-37 Protein denotes Epsilon Globin
T534 38-48 Gene_expression denotes Expression
T535 14-22 Negative_regulation denotes Silences
T2807 8037-8041 Protein denotes Sox6
T2808 8049-8058 Protein denotes ɛy globin
R1850 T2768 T2818 themeOf Sox9,expression
R1853 T2769 T2818 themeOf Sry,expression
R1855 T2774 T2819 themeOf Sox6,disrupts
R1860 T2779 T2822 themeOf HMG2,expressed
R1862 T2786 T2823 themeOf βh-1 globins,express
R1864 T2788 T2824 themeOf minor,express
R1866 T2807 T2837 causeOf Sox6,effects
R1869 T2791 T2828 themeOf ɛ,silenced
R1870 T2808 T2837 themeOf ɛy globin,effects
R1871 T2792 T2829 themeOf ɛ,regulated
R1872 T2809 T2838 themeOf Sox6,binds
R1873 T2809 T2840 causeOf Sox6,represses
R1874 T2810 T2838 themeOf ɛy globin,binds
R1875 T2810 T2839 themeOf ɛy globin,transcription
R1876 T2811 T2841 themeOf Sox6,expressed
R1877 T2811 T2842 themeOf Sox6,expressed
R1878 T2795 T2830 themeOf ɛ globin,silencing
R1879 T2812 T2843 themeOf ɛy globin,expression
R1880 T2812 T2842 themeOf ɛy globin,expressed
R1881 T2814 T2844 themeOf ɛy globin,absence
R1882 T2800 T2832 causeOf COUP-TF,regulate
R1883 T2802 T2831 themeOf ɛ,silencing
R1884 T2803 T2833 themeOf ɛ,silencing
R1885 T2804 T2834 themeOf Sox6,upregulated
R1886 T2831 T2832 themeOf silencing,regulate
R1887 T2805 T2835 themeOf Sox6,effects
R1888 T2806 T2836 themeOf ɛy globin,expression
R1890 T2839 T2840 themeOf transcription,represses
R3463 T4916 T4930 themeOf Globin,Expression
R3464 T4917 T4930 themeOf ɛy,Expression
R3465 T4918 T4931 themeOf Sox6,Deficient
R3466 T4920 T4933 themeOf Sox6,targets
R3467 T4922 T4934 themeOf ɛy,expressed
R3468 T4922 T4935 themeOf ɛy,expression
R3469 T4924 T4936 themeOf ζ,expression
R3470 T4924 T4937 themeOf ζ,higher
R3471 T4925 T4936 themeOf βh1,expression
R3472 T4925 T4937 themeOf βh1,higher
R3473 T4926 T4938 themeOf β globin,expression
R3474 T4927 T4940 themeOf ɛy,expression
R3475 T4928 T4941 themeOf βmaj,expression
R3476 T4929 T4941 themeOf min,expression
R3477 T4930 T4932 themeOf Expression,Persistent
R3478 T4930 T4932 themeOf Expression,Persistent
R3479 T4936 T4937 themeOf expression,higher
R3480 T4936 T4937 themeOf expression,higher
R3481 T4938 T4939 themeOf expression,higher
R3482 T4940 T4942 themeOf expression,level
R3483 T4941 T4943 themeOf expression,equivalent
R3484 T4941 T4943 themeOf expression,equivalent
R4381 T6271 T6304 causeOf Sox6,Represses
R4382 T6272 T6304 themeOf ɛy,Represses
R4383 T6275 T6305 causeOf Sox6,acts
R4384 T6276 T6305 themeOf ɛy,acts
R4385 T6277 T6306 themeOf ɛy,expresses
R4386 T6278 T6306 themeOf beta globins,expresses
R4387 T6282 T6307 themeOf Sox6,Overexpression
R4388 T6283 T6308 themeOf Sox6,overexpression
R4389 T6284 T6309 causeOf Sox6,repress
R4390 T6285 T6309 themeOf ɛy,repress
R4391 T6286 T6310 themeOf Sox6,interact
R4392 T6286 T6310 themeOf Sox6,interact
R4393 T6287 T6310 themeOf CtBP2,interact
R4394 T6287 T6310 themeOf CtBP2,interact
R4395 T6288 T6311 themeOf fgf-3,expressed
R4396 T6288 T6310 themeOf fgf-3,interact
R4397 T6288 T6310 themeOf fgf-3,interact
R4398 T6289 T6312 themeOf CtBP2,expressed
R4399 T6290 T6313 themeOf CtBP2,interaction
R4400 T6291 T6314 themeOf Sox6,repression
R4401 T6292 T6314 themeOf ɛy,repression
R4402 T6293 T6315 themeOf Sox6,mutation
R4403 T6294 T6316 themeOf Sox6,interaction
R4404 T6295 T6316 themeOf CtBP2,interaction
R4405 T6297 T6319 themeOf ɛy,repress
R4406 T6298 T6320 causeOf Sox6,represses
R4407 T6299 T6320 themeOf ɛy,represses
R4408 T6300 T6321 causeOf CtBP2,independent
R4409 T6303 T6322 themeOf Sox6,repression
R4410 T6313 T6317 causeOf interaction,required
R4411 T6313 T6317 causeOf interaction,required
R4412 T6314 T6317 themeOf repression,required
R4413 T6314 T6317 themeOf repression,required
R4414 T6316 T6318 themeOf interaction,abolish
R4415 T6320 T6321 themeOf represses,independent
R5547 T8039 T8075 themeOf Sox6,Binds
R5549 T8040 T8075 themeOf ɛy,Binds
R5550 T8042 T8076 themeOf ɛy,contact
R5553 T8043 T8077 themeOf ɛy,affecting
R5555 T8044 T8079 themeOf Sox6,associated
R5557 T8045 T8079 themeOf ɛy,associated
R5559 T8049 T8080 themeOf Sox6,associate
R5561 T8050 T8080 themeOf ɛy,associate
R5563 T8054 T8081 themeOf Sox6,binding
R5565 T8055 T8082 themeOf c-Myc,binds
R5566 T8056 T8083 themeOf HA,tagged
R5567 T8057 T8083 themeOf Sox6,tagged
R5568 T8058 T8084 themeOf β globins,express
R5569 T8059 T8084 themeOf ɛy,express
R5570 T8060 T8085 themeOf Sox6,binds
R5571 T8061 T8086 themeOf ɛy,co-transfected
R5574 T8062 T8087 themeOf Sox6,overexpression
R5575 T8062 T8086 themeOf Sox6,co-transfected
R5576 T8064 T8088 themeOf ɛy,repression
R5578 T8065 T8088 themeOf Sox6,repression
R5580 T8066 T8090 themeOf Sox6,binds
R5582 T8067 T8090 themeOf ɛy,binds
R5583 T8072 T8091 causeOf Sox6,repressor
R5584 T8072 T8092 themeOf Sox6,binding
R5585 T8073 T8091 themeOf ɛy,repressor
R5587 T8073 T8091 themeOf ɛy,repressor
R5588 T8074 T8092 themeOf ɛy,binding
R5590 T8077 T8078 themeOf affecting,regulating
R5593 T8088 T8089 themeOf repression,required
R5599 T8088 T8089 themeOf repression,required
R5601 T8092 T8091 causeOf binding,repressor
R6486 T9367 T9381 themeOf ɛy Globin,Expression
R6487 T9368 T9382 themeOf Sox6,Deficient
R6488 T9369 T9384 themeOf ɛy,Gene–Silencing
R6489 T9370 T9385 themeOf ɛy globin,expressed
R6490 T9370 T9386 themeOf ɛy globin,silenced
R6491 T9371 T9387 themeOf ɛy globin,expression
R6492 T9372 T9390 themeOf ɛy globin,expression
R6493 T9373 T9391 themeOf ɛy globin,transcripts
R6494 T9374 T9392 themeOf ɛy globin,expressed
R6495 T9375 T9393 themeOf ɛy,expression
R6496 T9376 T9395 themeOf βmaj,expression
R6497 T9377 T9395 themeOf min globin,expression
R6498 T9378 T9397 themeOf ɛy,expression
R6499 T9379 T9398 themeOf ɛy,defect
R6500 T9379 T9399 themeOf ɛy,silencing
R6501 T9380 T9400 themeOf Sox6,null
R6502 T9381 T9383 themeOf Expression,Due
R6503 T9387 T9388 themeOf expression,due
R6504 T9387 T9389 themeOf expression,due
R6505 T9390 T9389 themeOf expression,due
R6506 T9393 T9394 themeOf expression,ectopic
R6507 T9395 T9396 themeOf expression,abundant
R6508 T9395 T9396 themeOf expression,abundant
R6509 T9397 T9401 themeOf expression,due
R6510 T9399 T9398 themeOf silencing,defect
R6957 T10064 T10074 themeOf Sox6,Expression
R6958 T10065 T10075 themeOf Sox6,deficient
R6959 T10066 T10076 themeOf ɛy globin,express
R6960 T10068 T10077 themeOf Sox6,expression
R6961 T10071 T10078 themeOf Sox6,expression
R6962 T10073 T10079 themeOf ɛy globin,expressed
R7295 T10514 T10517 themeOf Sox6,effects
R7296 T10515 T10518 themeOf ɛy globin,silencing
R7297 T10516 T10518 causeOf Sox6,silencing
R9241 T13533 T13625 themeOf Sox6,null
R9248 T13534 T13626 themeOf ζ,effect
R9249 T13535 T13626 themeOf βH1,effect
R9254 T13536 T13627 themeOf ɛy globin,upregulation
R9256 T13537 T13628 themeOf Sox6,binds
R9260 T13538 T13628 themeOf ɛy gene,binds
R9261 T13539 T13629 themeOf ɛy-globin,represses
R9264 T13540 T13630 themeOf Sox5,includes
R9265 T13541 T13630 themeOf 12,includes
R9268 T13542 T13630 themeOf 13,includes
R9269 T13543 T13630 themeOf 23,includes
R9271 T13545 T13631 themeOf Sox5,dimerization
R9273 T13546 T13631 themeOf Sox6,dimerization
R9276 T13547 T13633 themeOf Sox6,binds
R9278 T13551 T13634 themeOf Sox6,binding
R9281 T13552 T13634 themeOf ɛy,binding
R9283 T13553 T13637 themeOf Sox6,binds
R9284 T13553 T13638 themeOf Sox6,heterodimer
R9285 T13554 T13637 themeOf ɛy,binds
R9286 T13554 T13638 themeOf ɛy,heterodimer
R9287 T13555 T13639 themeOf Sox6,associated
R9288 T13557 T13640 themeOf ɛy globin,bind
R9289 T13560 T13640 themeOf TF,bind
R9290 T13561 T13641 themeOf Sox6,interact
R9291 T13565 T13642 themeOf Sox6,binding
R9292 T13610 T13673 themeOf Sox6,deficient
R9293 T13611 T13674 themeOf Sox6,interacting
R9294 T13613 T13675 themeOf ɛ-globin,reactivation
R9295 T13614 T13676 themeOf ɛ-globin,silencing
R9296 T13565 T13643 causeOf Sox6,interfere
R9297 T13615 T13677 themeOf Sox6,binds
R9298 T13566 T13644 themeOf ɛy,activator
R9299 T13616 T13677 themeOf ɛy,binds
R9300 T13568 T13645 themeOf DRED,interferes
R9301 T13618 T13679 causeOf Sox6,important
R9302 T13568 T13646 themeOf DRED,binding
R9303 T13619 T13678 themeOf ɛ globin,silencing
R9304 T13569 T13645 themeOf EKLF,interferes
R9305 T13570 T13646 themeOf ɛy,binding
R9306 T13621 T13680 themeOf ɛ globin,silencer
R9307 T13571 T13647 themeOf HMG-I,bind
R9308 T13624 T13681 themeOf ɛ globin,regulation
R9309 T13571 T13647 themeOf HMG-I,bind
R9310 T13572 T13647 themeOf HMG-Y,bind
R9311 T13627 T13626 themeOf upregulation,effect
R9312 T13572 T13647 themeOf HMG-Y,bind
R9313 T13573 T13647 themeOf silencers I,bind
R9314 T13573 T13647 themeOf silencers I,bind
R9315 T13574 T13647 themeOf II,bind
R9316 T13631 T13632 themeOf dimerization,increase
R9317 T13574 T13647 themeOf II,bind
R9318 T13634 T13635 themeOf binding,repression
R9319 T13634 T13636 themeOf binding,essential
R9320 T13575 T13648 themeOf Sox6,expression
R9321 T13635 T13636 themeOf repression,essential
R9322 T13576 T13651 causeOf Sox6,represses
R9323 T13577 T13650 themeOf ɛy globin,expression
R9324 T13578 T13652 themeOf ɛy globin,expression
R9325 T13642 T13643 themeOf binding,interfere
R9326 T13579 T13655 causeOf Sox6,silence
R9327 T13580 T13654 themeOf ɛy globin,expression
R9328 T13648 T13649 themeOf expression,coincident
R9329 T13581 T13656 themeOf ɛy globin,expression
R9330 T13650 T13651 themeOf expression,represses
R9331 T13582 T13657 themeOf Sox6,homozygous
R9332 T13652 T13653 themeOf expression,due
R9333 T13582 T13658 themeOf Sox6,null
R9334 T13654 T13655 themeOf expression,silence
R9335 T13583 T13659 themeOf βmaj,expression
R9336 T13584 T13659 themeOf min,expression
R9337 T13659 T13660 themeOf expression,equivalent
R9338 T13659 T13660 themeOf expression,equivalent
R9339 T13585 T13661 themeOf ɛy globin,expression
R9340 T13662 T13663 themeOf expression,higher
R9341 T13662 T13663 themeOf expression,higher
R9342 T13586 T13662 themeOf ζ,expression
R9343 T13586 T13663 themeOf ζ,higher
R9344 T13587 T13662 themeOf βh1,expression
R9345 T13587 T13663 themeOf βh1,higher
R9346 T13588 T13664 themeOf ɛy,higher
R9347 T13670 T13672 themeOf expression,silence
R9348 T13589 T13664 themeOf ζ,higher
R9349 T13590 T13664 themeOf βh1,higher
R9350 T13594 T13665 themeOf ɛy,regulated
R9351 T13678 T13679 themeOf silencing,important
R9352 T13594 T13665 themeOf ɛy,regulated
R9353 T13595 T13665 causeOf ζ,regulated
R9354 T13596 T13665 causeOf βh1,regulated
R9355 T13597 T13666 themeOf Sox6,effect
R9356 T13598 T13667 themeOf ɛy,silencing
R9357 T13599 T13668 themeOf ɛy globin,high
R9358 T13603 T13669 themeOf β-like globin,elevated
R9360 T13604 T13672 causeOf Sox6,silence
R9363 T13605 T13670 themeOf ɛy globin,expression
R9366 T13606 T13671 themeOf ɛy-globin,regulation
R11469 T16521 T16537 themeOf ɛy,deletion
R11470 T16524 T16538 themeOf ɛ,silencing
R11471 T16530 T16540 themeOf luciferase,expression
R11472 T16533 T16541 themeOf Sox6,overexpress
R11473 T16534 T16542 themeOf Sox6,overexpression
R11474 T16538 T16539 themeOf silencing,required
R13397 T18897 T18898 themeOf Sox6,overexpression
R13669 T19256 T19260 themeOf Sox6,expression
R14198 T19973 T19978 themeOf Sox6,binding
R265 T540 T541 themeOf expression,ectopic
R266 T542 T543 themeOf silencing,required
R267 T544 T545 themeOf regulation,target
R268 T544 T545 themeOf regulation,target
R461 T515 T535 causeOf Sox6,Silences
R462 T516 T534 themeOf Epsilon Globin,Expression
R463 T520 T536 themeOf Sox6,deficient
R464 T521 T537 themeOf ɛy globin,expressed
R465 T524 T538 themeOf Sox6,binding
R466 T525 T538 themeOf ɛy,binding
R467 T526 T539 themeOf Sox6,expression
R468 T527 T540 themeOf ɛy,expression
R469 T529 T543 causeOf Sox6,required
R470 T530 T542 themeOf ɛy globin,silencing
R471 T532 T544 themeOf Sox6,regulation
R472 T533 T544 themeOf ɛy globin,regulation
R473 T534 T535 themeOf Expression,Silences
R1840 T2762 T2816 themeOf Sry,binding
R1844 T2763 T2816 themeOf Sox6,binding
R1846 T2766 T2817 themeOf Sox6,Depletion
R1848 T2767 T2818 themeOf Sox6,expression
R1854 T2773 T2819 themeOf p,disrupts
R1856 T2776 T2820 themeOf Sox6,transcription
R1857 T2777 T2821 themeOf Sry,bind
R1858 T2778 T2822 themeOf HMG1,expressed
R1861 T2785 T2823 themeOf ɛy,express
R1863 T2787 T2824 themeOf β major,express
R1865 T2789 T2825 themeOf ɛy,silenced
R1867 T2790 T2826 themeOf ɛ globin,silencing
R1868 T2791 T2827 themeOf ɛ,activated

bionlp-st-ge-2016-test-ihmc

Id Subject Object Predicate Lexical cue Negation
T868 14-77 Gene_expression denotes Silences Epsilon Globin Expression in Definitive Erythropoiesis
T21018 43563-43591 Localization denotes the DNA protein cross-links
T21017 42682-42694 Entity denotes brief: Cells
T21016 43650-43672 Entity denotes immunoprecipitated DNA
T21015 42746-42768 Protein denotes three 15.5-dpc WT mice
T21014 43632-43646 Entity denotes 4 h. Input DNA
T21013 43383-43434 Protein denotes anti-Sox6, a second treated with normal rabbit IgG,
T21012 43813-43858 Entity denotes to nucleotides −31 to +140 of the ɛy promoter
T21011 43527-43535 Protein denotes antibody
T21010 42834-42842 Entity denotes ice-cold
T21009 43040-43046 Entity denotes on ice
T21008 43699-43715 Protein denotes the PCR reaction
T21007 42787-42813 Entity denotes 1% formaldehyde for 10 min
T21006 43513-43545 Entity denotes The chromatin-antibody complexes
T21005 43610-43624 Entity denotes 5 M NaCl at 65
T21004 43517-43526 Entity denotes chromatin
T21003 43567-43570 Entity denotes DNA
T21002 43005-43024 Protein denotes protease inhibitors
T21001 42886-42890 Entity denotes EDTA
T21000 43717-43720 Protein denotes PCR
T20999 43563-43590 Protein denotes the DNA protein cross-links
T20998 43943-43946 Protein denotes PCR
T20997 43847-43849 Protein denotes ɛy
T20996 43742-43744 Protein denotes ɛy
T20995 43735-43753 Entity denotes of the ɛy promoter
T20994 43227-43236 Entity denotes Sepharose
T20993 42975-43025 Protein denotes a SDS lysis buffer containing protease inhibitors,
T20992 42881-42921 Protein denotes 0.1% EDTA containing protease inhibitors
T20991 43059-43080 Entity denotes DNA-protein complexes
T20990 43843-43858 Entity denotes the ɛy promoter
T20310 42207-42222 Entity denotes Sox6 antibodies
T20309 42199-42201 Protein denotes HA
T20308 41973-42008 Entity denotes a 4% or 6% (w/v) polyacrylamide gel
T20307 41761-41776 Protein denotes antibody (3 μl)
T20306 42143-42158 Entity denotes Antibodies used
T20305 41424-41448 Protein denotes in vitro-translated Sox6
T20304 41576-41581 Protein denotes dG-dC
T20303 42263-42286 Entity denotes of the oligonucleotides
T20302 41314-41347 Entity denotes ATP with T4 polynucleotide kinase
T20301 41323-41347 Protein denotes T4 polynucleotide kinase
T20300 41464-41476 Entity denotes reticulocyte
T20299 41973-42008 Entity denotes a 4% or 6% (w/v) polyacrylamide gel
T20298 42192-42197 Protein denotes c-Myc
T20297 41516-41528 Entity denotes 10% glycerol
T20296 41224-41270 Entity denotes Single-stranded complementary oligonucleotides
T20295 42097-42105 Entity denotes the gels
T20294 41604-41629 Entity denotes 0.1 mM EDTA, 0.25 mM DTT,
T20293 41696-41757 Entity denotes unlabelled oligonucleotide competitor (200-fold molar excess)
T20292 42432-42434 Entity denotes M1
T20291 42502-42504 Entity denotes M2
T20290 41540-41544 Protein denotes BSA,
T20289 41554-41566 Entity denotes poly (dI-dC)
T20288 42245-42301 Entity denotes The DNA sequences of the oligonucleotides are as follows
T20287 41570-41595 Entity denotes poly (dG-dC), 10 mM HEPES
T20286 41381-41412 Protein denotes nuclear proteins from MEL cells
T20285 42066-42091 Entity denotes 4–8 h at room temperature
T20284 41617-41628 Entity denotes 0.25 mM DTT
T20283 41570-41583 Entity denotes poly (dG-dC),
T20282 41503-41529 Entity denotes 100 mM NaCl, 10% glycerol,
T20281 42043-42061 Entity denotes a constant 19 mAmp
T20280 41323-41325 Entity denotes T4
T20279 42207-42211 Protein denotes Sox6
T19617 41064-41108 Binding denotes c-Myc antibody was purchased from Invitrogen
T19616 41017-41036 Entity denotes All Sox6 antibodies
T19615 41124-41136 Entity denotes IgG antibody
T19614 40769-40779 Entity denotes Antibodies
T19613 41021-41025 Protein denotes Sox6
T19612 41064-41078 Entity denotes c-Myc antibody
T19611 40781-40785 Protein denotes Sox6
T19610 40781-40815 Entity denotes Sox6 antibodies used in this study
T19609 41064-41069 Protein denotes c-Myc
T19093 40067-40093 Gene_expression denotes Sox6 overexpression vector
T19092 40067-40093 Positive_regulation denotes Sox6 overexpression vector
T19091 39661-39671 Entity denotes penicillin
T19090 39688-39700 Entity denotes streptomycin
T19089 40067-40071 Protein denotes Sox6
T19088 39523-39577 Protein denotes Ham's F12 with 2 mM L-glutamine supplemented with heat
T19087 39830-39841 Entity denotes GM979 cells
T19086 39431-39442 Entity denotes GM979 cells
T19085 39717-39735 Entity denotes L-glutamine (2 mM)
T19084 39964-39969 Entity denotes Cells
T19083 39995-40003 Entity denotes promoter
T19082 40108-40131 Entity denotes assays of dosage effect
T19081 39741-39746 Entity denotes cells
T19080 39538-39554 Entity denotes 2 mM L-glutamine
T19079 39452-39456 Entity denotes Cell
T19078 40171-40174 Protein denotes pRL
T19077 39987-39994 Protein denotes with ɛy
T19378 40274-40302 Translation denotes in vitro translation of Sox6
T19377 40562-40574 Entity denotes reticulocyte
T19376 40496-40498 Protein denotes HA
T19375 40304-40320 Entity denotes Nuclear extracts
T19374 40486-40491 Protein denotes c-Myc
T19373 40246-40269 Protein denotes Nuclear protein extract
T19372 40429-40433 Protein denotes Sox6
T19371 40295-40302 Protein denotes of Sox6
T19370 40246-40269 Entity denotes Nuclear protein extract
T19369 40704-40708 Protein denotes Sox6
T18691 39001-39034 Protein denotes by RT-PCR (nucleotides 1353–1927)
T18690 39227-39230 Protein denotes SDS
T18689 39205-39214 Entity denotes phosphate
T18688 38978-39034 Protein denotes a Sox6 probe generated by RT-PCR (nucleotides 1353–1927)
T18687 39059-39081 Entity denotes dCTP, by random primer
T18686 39288-39300 Protein denotes 1% SDS at 60
T18445 38265-38288 Protein denotes both mutant and WT mice
T18444 38507-38518 Entity denotes hematoxylin
T18443 38561-38569 Entity denotes 18.5 dpc
T18442 38400-38423 Protein denotes postnatal day–10.5 mice
T18441 38438-38470 Entity denotes 10% formalin, paraffin-embedded,
T18440 38452-38469 Entity denotes paraffin-embedded
T18439 38548-38556 Entity denotes 14.5 dpc
T17701 35904-35910 Protein denotes globin
T17700 35995-36010 Protein denotes of globin genes
T17699 36307-36317 Protein denotes βH1 globin
T17698 36843-36852 Protein denotes input RNA
T17697 37032-37045 Protein denotes the ABI Prism
T17696 36683-36722 Entity denotes the University of Arizona core facility
T17695 36127-36136 Protein denotes ɛy globin
T18166 37621-37624 Protein denotes RNA
T18165 37234-37285 Protein denotes globin nucleotides 509–584; βmaj globin nucleotides
T18164 37305-37309 Protein denotes Sox6
T18163 37528-37534 Entity denotes Slides
T18162 37234-37285 Entity denotes globin nucleotides 509–584; βmaj globin nucleotides
T18161 37411-37420 Entity denotes paraffin,
T18160 37234-37285 Entity denotes globin nucleotides 509–584; βmaj globin nucleotides
T18159 37378-37398 Entity denotes 4% paraformaldehyde,
T18158 37299-37321 Entity denotes mouse Sox6 nucleotides
T18157 38064-38129 Entity denotes Pro (Reindeer Graphics, Asheville, North Carolina, United States)
T18156 37234-37240 Protein denotes globin
T17715 36579-36604 Regulation denotes PCR amplification was run
T17714 36579-36582 Protein denotes PCR
T17713 36800-36805 Protein denotes GAPDH
T17712 36970-36973 Protein denotes PCR
T17711 36218-36226 Protein denotes ζ globin
T17710 36527-36550 Protein denotes ROX (Bio-Rad, Hercules,
T17709 36406-36412 Protein denotes globin
T17708 35904-35915 Protein denotes globin mRNA
T17707 35917-35920 Protein denotes RNA
T17706 35972-36010 Protein denotes cDNA PCR amplification of globin genes
T17705 37103-37108 Protein denotes GAPDH
T17704 36724-36731 Protein denotes All PCR
T17703 35998-36004 Protein denotes globin
T17702 37051-37054 Protein denotes SDS
T17055 33769-33771 Protein denotes ɛy
T17054 35538-35540 Protein denotes ɛy
T17053 34394-34444 Protein denotes Basic (Promega, Madison, Wisconsin, United States)
T17052 33762-33789 Entity denotes of the ɛy proximal promoter
T17051 34054-34063 Entity denotes site [50]
T17050 33828-33834 Protein denotes globin
T17049 35424-35438 Entity denotes the HMG domain
T17048 34038-34044 Protein denotes globin
T17047 34711-34729 Entity denotes of the ɛy promoter
T17046 33744-33747 Protein denotes PCR
T17045 33684-33692 Entity denotes promoter
T17044 34325-34327 Protein denotes ɛy
T17043 34274-34278 Protein denotes XhoI
T17042 35362-35366 Protein denotes Sox6
T17041 34666-34668 Protein denotes ɛy
T17040 34539-34541 Protein denotes ɛy
T17039 35619-35630 Entity denotes ɛy promoter
T17038 34321-34345 Entity denotes the ɛy promoter fragment
T17037 35329-35333 Protein denotes Sox6
T17036 33681-33683 Protein denotes ɛy
T17035 34252-34255 Protein denotes PCR
T17034 34065-34075 Entity denotes Nucleotide
T17033 34032-34053 Protein denotes the ɛ globin gene cap
T17032 33962-34007 Entity denotes a 3.7-kb EcoRI fragment containing about 2 kb
T17031 35531-35549 Entity denotes of the ɛy promoter
T17030 35560-35566 Protein denotes by PCR
T17029 34321-34345 Entity denotes the ɛy promoter fragment
T15695 25758-25805 Positive_regulation denotes a persistent upregulation of the ɛy globin gene
T15694 28911-28977 Negative_regulation denotes Sox6 represses ɛy globin expression both in vivo (Figure 1) and in
T15693 28127-28176 Binding denotes assembling multiprotein transcriptional complexes
T15692 32824-32915 Binding denotes which binds to the ɛy proximal promoter, potentially as part of a larger repression complex
T15691 30366-30379 Localization denotes of liver RNA
T15690 29476-29521 Gene_expression denotes βmaj/min expression in the livers of 15.5-dpc
T15689 32559-32589 Positive_regulation denotes reactivation of human ɛ-globin
T15688 28926-28946 Gene_expression denotes ɛy globin expression
T15687 29589-29629 Gene_expression denotes ectopic expression of the ɛy globin gene
T15686 26564-26600 Binding denotes with binding of D-Sox protein dimers
T15685 29047-29085 Gene_expression denotes the persistent expression of ɛy globin
T15684 33212-33253 Binding denotes at least two potential Sox6 binding sites
T15683 27790-27873 Binding denotes Sox proteins bind and bend linear DNA by partial intercalation in the minor groove,
T15682 33067-33091 Negative_regulation denotes human ɛ globin silencing
T15681 25807-25938 Negative_regulation denotes Sox6 directly regulates and binds to the proximal promoter of ɛy gene and represses the ɛy-globin gene in definitive erythropoiesis
T15680 25807-25876 Binding denotes Sox6 directly regulates and binds to the proximal promoter of ɛy gene
T15679 33496-33518 Regulation denotes of ɛ globin regulation
T15678 28478-28509 Binding denotes binding to the ɛy promoter [39]
T15677 26861-27005 Binding denotes These observations suggest that Sox6 binds to this sequence of the ɛy promoter either as a homodimer or as a heterodimer with other Sox proteins
T15676 30958-30985 Regulation denotes the regulation of ɛy-globin
T15675 32379-32403 Binding denotes its interacting proteins
T15674 28434-28509 Negative_regulation denotes DRED interferes with EKLF, an activator, in binding to the ɛy promoter [39]
T15601 25784-25805 Protein denotes of the ɛy globin gene
T15600 30668-30698 Protein denotes adult β-like globin RNA levels
T15599 31025-31057 Protein denotes the other embryonic globin genes
T15598 26459-26487 Protein denotes D Sox proteins, such as Sox6
T15597 29368-29370 Protein denotes ɛy
T15596 25580-25584 Protein denotes Sox6
T15595 26350-26372 Entity denotes an HMG-box dimer motif
T15594 29978-29985 Protein denotes that ɛy
T15593 30022-30025 Protein denotes βh1
T15592 30185-30207 Protein denotes most p100H mutant mice
T15591 27790-27802 Protein denotes Sox proteins
T15590 26798-26800 Protein denotes ɛy
T15589 26697-26705 Protein denotes Sox/Sox6
T15588 29804-29806 Protein denotes ɛy
T15587 30476-30485 Protein denotes ɛy globin
T15586 27496-27500 Protein denotes Sox6
T15585 30076-30127 Protein denotes embryonic globin genes (and erythrocyte maturation)
T15584 25891-25909 Protein denotes the ɛy-globin gene
T15583 28493-28495 Protein denotes ɛy
T15582 33073-33074 Protein denotes ɛ
T15581 26921-26939 Entity denotes of the ɛy promoter
T15580 29481-29484 Protein denotes min
T15579 31593-31615 Entity denotes of nucleated red cells
T15578 28085-28094 Entity denotes chromatin
T15577 30688-30691 Protein denotes RNA
T15576 31982-32003 Protein denotes of other Sox proteins
T15575 25667-25671 Protein denotes Sox6
T15574 27968-28005 Protein denotes Sox6 proteins control gene expression
T15573 26264-26307 Entity denotes to DNA that contains adjacent Sox sites [6]
T15572 28511-28541 Protein denotes Two HMG architectural proteins
T15571 25869-25876 Protein denotes ɛy gene
T15570 26577-26600 Protein denotes of D-Sox protein dimers
T15569 29423-29431 Entity denotes 18.5 dpc
T15568 30858-30862 Protein denotes Sox6
T15567 30076-30127 Protein denotes embryonic globin genes (and erythrocyte maturation)
T15566 26035-26055 Protein denotes Group D Sox proteins
T15565 26008-26012 Protein denotes Sox5
T15564 30515-30558 Protein denotes with undetectable ɛy RNA in WT control mice
T15563 28926-28946 Protein denotes ɛy globin expression
T15562 27528-27549 Protein denotes the DRED complex [37]
T15561 32572-32589 Protein denotes of human ɛ-globin
T15560 27790-27793 Protein denotes Sox
T15559 33031-33041 Protein denotes human Sox6
T15558 29608-29629 Protein denotes of the ɛy globin gene
T15557 25646-25658 Protein denotes globin genes
T15556 28461-28473 Entity denotes an activator
T15555 32843-32845 Protein denotes ɛy
T15554 33499-33507 Protein denotes ɛ globin
T15553 31663-31697 Entity denotes red cell terminal differentiation,
T15552 29314-29342 Protein denotes silence ɛy globin expression
T15551 26893-26897 Protein denotes Sox6
T15550 25715-25741 Protein denotes the embryonic globin genes
T15549 28138-28176 Entity denotes multiprotein transcriptional complexes
T15548 32572-32589 Protein denotes of human ɛ-globin
T15547 26697-26705 Protein denotes Sox/Sox6
T15546 29325-29331 Protein denotes globin
T15545 25807-25811 Protein denotes Sox6
T15544 29608-29629 Protein denotes of the ɛy globin gene
T15543 29368-29377 Entity denotes ɛy globin
T15542 26993-26996 Protein denotes Sox
T15541 25841-25876 Entity denotes to the proximal promoter of ɛy gene
T15540 26353-26360 Entity denotes HMG-box
T15539 33154-33179 Entity denotes mouse ɛ promoter regions,
T15538 30727-30741 Protein denotes the mutant RNA
T15537 32281-32285 Entity denotes cell
T15536 26152-26181 Entity denotes dimerization of Sox5 and Sox6
T15535 26064-26136 Entity denotes a coiled–coiled domain that mediates homo- and heterodimerization [6,35]
T15534 32101-32104 Protein denotes Sox
T15533 33313-33317 Protein denotes gene
T15532 32885-32915 Entity denotes of a larger repression complex
T15531 30610-30617 Protein denotes βh1 RNA
T15530 33184-33202 Entity denotes the human promoter
T15529 27015-27027 Protein denotes Sox proteins
T15528 28450-28474 Protein denotes with EKLF, an activator,
T15527 31899-31903 Protein denotes Sox6
T15526 31010-31014 Protein denotes Sox6
T15525 29476-29484 Protein denotes βmaj/min
T15524 27492-27500 Protein denotes Sox/Sox6
T15523 31371-31383 Entity denotes of red cells
T15522 25743-25744 Protein denotes ζ
T15521 30900-30928 Protein denotes silence ɛy globin expression
T15520 26251-26254 Protein denotes Sox
T15519 32742-32768 Protein denotes of ɛ-globin gene silencing
T15518 29718-29724 Protein denotes globin
T15517 28200-28209 Entity denotes chromatin
T15516 28413-28415 Protein denotes ɛy
T15515 27370-27404 Entity denotes of a high molecular weight complex
T15514 29946-29965 Entity denotes 18.5 dpc (Figure 1)
T15513 26701-26705 Protein denotes Sox6
T15512 31632-31636 Protein denotes Sox6
T15511 27528-27549 Entity denotes the DRED complex [37]
T15510 30604-30605 Protein denotes ζ
T15509 31025-31057 Protein denotes the other embryonic globin genes
T15508 29549-29564 Protein denotes mice (Figure 1)
T15507 26644-26648 Protein denotes Sox6
T15506 26749-26759 Entity denotes both sites
T15505 30047-30051 Protein denotes Sox6
T15504 26668-26683 Entity denotes the ɛy promoter
T15503 26240-26263 Protein denotes of the two Sox proteins
T15502 31045-31051 Protein denotes globin
T15501 33304-33343 Protein denotes ɛ globin gene has been proposed [49,50]
T15500 30973-30985 Protein denotes of ɛy-globin
T15499 26577-26600 Entity denotes of D-Sox protein dimers
T15498 28616-28622 Protein denotes HMG-Y,
T15497 26672-26674 Protein denotes ɛy
T15496 27038-27112 Entity denotes a short 6-bp core-binding sequence that allows for considerable degeneracy
T15495 33073-33081 Protein denotes ɛ globin
T15494 32836-32863 Entity denotes to the ɛy proximal promoter
T15493 29824-29827 Protein denotes βh1
T15492 25715-25741 Protein denotes the embryonic globin genes
T15491 28059-28066 Entity denotes to DNA,
T15490 25749-25753 Protein denotes βH1,
T15489 26035-26040 Entity denotes Group
T15488 28911-28915 Protein denotes Sox6
T15487 29698-29730 Protein denotes two other embryonic globin genes
T15486 30543-30558 Protein denotes WT control mice
T15485 27568-27572 Protein denotes Sox6
T15484 30425-30431 Protein denotes globin
T15483 28434-28438 Protein denotes DRED
T15482 27274-27285 Entity denotes a 4%–6% gel
T15481 27730-27732 Protein denotes ɛy
T15480 26322-26326 Protein denotes Sox6
T15479 30162-30174 Protein denotes silencing ɛy
T15478 29089-29106 Protein denotes p100H mutant mice
T15477 27554-27566 Protein denotes COUP-TF [38]
T15476 31448-31468 Protein denotes 18.5-dpc mutant mice
T15475 27421-27427 Protein denotes globin
T15474 30911-30917 Protein denotes globin
T15473 29818-29819 Protein denotes ζ
T15472 29855-29866 Protein denotes mutant mice
T15471 26177-26181 Protein denotes Sox6
T15470 26443-26458 Protein denotes genes for group
T15469 32379-32403 Protein denotes its interacting proteins
T15468 29267-29271 Protein denotes Sox6
T15467 29732-29733 Protein denotes ζ
T15466 26461-26482 Protein denotes Sox proteins, such as
T15465 29913-29916 Protein denotes βh1
T15464 28282-28297 Entity denotes to the promoter
T15463 26390-26397 Entity denotes HMG-box
T15462 29073-29085 Protein denotes of ɛy globin
T15461 29381-29396 Protein denotes homozygous Sox6
T15460 25940-25944 Protein denotes Sox6
T15459 28582-28603 Protein denotes transcription factors
T15458 28262-28281 Entity denotes of other activators
T15457 25794-25800 Protein denotes globin
T15456 25971-25974 Protein denotes Sox
T15455 33499-33500 Protein denotes ɛ
T15454 30610-30613 Protein denotes βh1
T15453 28138-28176 Protein denotes multiprotein transcriptional complexes
T15452 29762-29780 Entity denotes p100H homozygotes,
T15451 25646-25652 Protein denotes globin
T15450 28789-28848 Protein denotes Sox6 expression is temporally and spatially coincident with
T15449 29476-29484 Protein denotes βmaj/min
T15448 30016-30017 Protein denotes ζ
T15447 26778-26782 Protein denotes Sox6
T15446 32101-32124 Protein denotes Sox proteins [13,45,46]
T15445 29896-29905 Protein denotes ɛy globin
T15444 32443-32451 Entity denotes red cell
T15443 27511-27517 Entity denotes sites,
T15442 26928-26930 Protein denotes ɛy
T15441 26285-26307 Entity denotes adjacent Sox sites [6]
T15440 27968-27972 Protein denotes Sox6
T15439 25719-25728 Protein denotes embryonic
T15438 27686-27690 Protein denotes Sox6
T15437 29870-29878 Entity denotes 15.5 dpc
T15673 30425-30447 Gene_expression denotes globin gene expression
T15672 28606-28611 Protein denotes HMG-I
T15671 28116-28119 Entity denotes DNA
T15670 27817-27827 Entity denotes linear DNA
T15669 28688-28699 Protein denotes silencers I
T15668 26461-26464 Protein denotes Sox
T15667 27469-27472 Entity denotes DNA
T15666 32432-32439 Protein denotes of Sox6
T15665 27189-27221 Protein denotes other transcription factors [36]
T15664 25784-25805 Protein denotes of the ɛy globin gene
T15663 27352-27361 Protein denotes that Sox6
T15662 32742-32768 Protein denotes of ɛ-globin gene silencing
T15661 29618-29624 Protein denotes globin
T15660 31991-31994 Protein denotes Sox
T15659 28428-28432 Protein denotes DRED
T15658 27015-27018 Protein denotes Sox
T15657 33212-33253 Entity denotes at least two potential Sox6 binding sites
T15656 28726-28736 Entity denotes of the DNA
T15655 27492-27500 Protein denotes Sox/Sox6
T15654 27406-27438 Protein denotes A few other ɛy globin repressors
T15653 29649-29671 Protein denotes homozygous mutant mice
T15652 29397-29406 Protein denotes null mice
T15651 27293-27340 Entity denotes least 4–8 h to detect the Sox6-associated band,
T15650 33442-33465 Protein denotes Sox6-containing complex
T15649 29698-29730 Protein denotes two other embryonic globin genes
T15648 28704-28706 Protein denotes II
T15647 33154-33179 Protein denotes mouse ɛ promoter regions,
T15646 27856-27873 Entity denotes the minor groove,
T15645 28388-28405 Entity denotes with an activator
T15644 26035-26055 Protein denotes Group D Sox proteins
T15643 27319-27334 Protein denotes Sox6-associated
T15642 33589-33610 Entity denotes of sickle cell anemia
T15641 30086-30092 Protein denotes globin
T15640 31886-31895 Entity denotes red cells
T15639 26577-26600 Protein denotes of D-Sox protein dimers
T15638 26968-27005 Entity denotes a heterodimer with other Sox proteins
T15637 26982-27005 Protein denotes with other Sox proteins
T15636 33235-33239 Protein denotes Sox6
T15635 25985-25993 Protein denotes proteins
T15634 25895-25904 Protein denotes ɛy-globin
T15633 28409-28424 Entity denotes the ɛy promoter
T15632 26794-26809 Entity denotes the ɛy promoter
T15631 30809-30828 Entity denotes 18.5 dpc (Figure 1)
T15630 25895-25904 Protein denotes ɛy-globin
T15629 31173-31190 Protein denotes p100H mutant mice
T15628 32925-32936 Protein denotes murine Sox6
T15627 29907-29908 Protein denotes ζ
T15626 32641-32666 Entity denotes sickle cell disease [47],
T15625 27721-27741 Entity denotes with the ɛy promoter
T15624 28486-28509 Entity denotes to the ɛy promoter [39]
T15623 29410-29418 Entity denotes 15.5 dpc
T15622 32988-32998 Entity denotes amino acid
T15621 32346-32374 Protein denotes Sox6 downstream target genes
T15620 33304-33305 Protein denotes ɛ
T15619 32818-32822 Protein denotes Sox6
T15618 29738-29741 Protein denotes βh1
T15617 28568-28571 Protein denotes Sox
T15616 27554-27566 Protein denotes COUP-TF [38]
T15615 32346-32350 Protein denotes Sox6
T15614 30489-30505 Protein denotes this RNA sample,
T15613 28929-28935 Protein denotes globin
T15612 30533-30535 Protein denotes ɛy
T15611 26168-26172 Protein denotes Sox5
T15610 30366-30378 Protein denotes of liver RNA
T15609 28221-28225 Protein denotes Sox6
T15608 33370-33374 Protein denotes Sox6
T15607 30973-30985 Protein denotes of ɛy-globin
T15606 28670-28676 Protein denotes globin
T15605 25898-25904 Protein denotes globin
T15604 26950-26961 Entity denotes a homodimer
T15603 31084-31088 Protein denotes Sox6
T15602 26294-26297 Protein denotes Sox
T10677 25166-25195 Negative_regulation denotes silencing the ɛy globin gene,
T10676 24988-25020 Entity denotes in hematopoietic precursor cells
T10675 25031-25053 Entity denotes nucleated erythrocytes
T10674 25176-25194 Protein denotes the ɛy globin gene
T10673 25116-25124 Entity denotes 14.5 dpc
T10672 24752-24760 Entity denotes 18.5 dpc
T10671 24739-24747 Entity denotes 14.5 dpc
T10670 24702-24719 Protein denotes p100H mutant mice
T10669 24832-24851 Entity denotes nucleated red cells
T10668 24554-24576 Entity denotes of Nucleated Red Cells
T10667 24583-24624 Protein denotes the other Sox6 effects in erythropoiesis,
T10666 25196-25200 Protein denotes Sox6
T10665 24728-24772 Protein denotes WT mice at 14.5 dpc and 18.5 dpc (Figure 7A)
T10664 25062-25077 Entity denotes dpc (Figure 7B)
T10663 24868-24880 Protein denotes mutant mice,
T10662 24516-24533 Protein denotes Mutant p100H Mice
T10661 24554-24576 Protein denotes of Nucleated Red Cells
T10660 25180-25189 Protein denotes ɛy globin
T10304 23155-23170 Gene_expression denotes Sox6 expression
T10303 23007-23142 Transcription denotes in situ hybridization shows that Sox6 is highly transcribed in 12.5-dpc liver, but not in yolk sac blood islands at 7.5 dpc (Figure 6B)
T10302 23155-23159 Protein denotes Sox6
T10301 22570-22579 Protein denotes ɛy globin
T10300 22459-22463 Protein denotes Sox6
T10299 23367-23404 Protein denotes 14.5-dpc p100H mutant mice (Figure 5)
T10298 22857-22861 Protein denotes Sox6
T10297 22596-22622 Entity denotes definitive erythroid cells
T10296 23102-23105 Protein denotes sac
T10295 23310-23324 Protein denotes that ɛy globin
T10294 23423-23427 Protein denotes Sox6
T10293 23123-23142 Entity denotes 7.5 dpc (Figure 6B)
T10292 23040-23044 Protein denotes Sox6
T10291 22473-22479 Entity denotes a Role
T10290 23097-23101 Entity denotes yolk
T10289 22911-22992 Entity denotes dpc, coincident with the temporal onset of definitive erythropoiesis in the liver
T10288 22766-22770 Protein denotes Sox6
T10287 22530-22549 Protein denotes Sox6-deficient mice
T10286 22645-22649 Protein denotes Sox6
T10285 23348-23404 Entity denotes the liver cells of 14.5-dpc p100H mutant mice (Figure 5)
T9685 20816-20925 Gene_expression denotes the ɛy globin gene is exclusively expressed in primitive erythrocytes and silenced in definitive erythrocytes
T9684 21226-21278 Gene_expression denotes ɛy globin is not expressed in the WT 14.5-dpc liver, true
T9683 21061-21100 Localization denotes of ɛy globin in definitive erythrocytes
T9682 20816-20925 Negative_regulation denotes the ɛy globin gene is exclusively expressed in primitive erythrocytes and silenced in definitive erythrocytes
T9681 20660-20716 Gene_expression denotes The Persistent Expression of ɛy Globin in Sox6-Deficient
T9680 21042-21100 Gene_expression denotes ectopic expression of ɛy globin in definitive erythrocytes
T9679 20948-20986 Gene_expression denotes the persistent expression of ɛy globin
T9678 21331-21420 Transcription denotes In contrast, abundant ectopic ɛy mRNA expression is seen in the liver of 14.5-dpc mutants
T9677 21331-21420 Gene_expression denotes In contrast, abundant ectopic ɛy mRNA expression is seen in the liver of 14.5-dpc mutants
T9676 21446-21479 Gene_expression denotes the expression of βmaj/min globin
T9675 20779-20805 Entity denotes Definitive Erythroid Cells
T9674 20816-20834 Protein denotes the ɛy globin gene
T9673 20686-20698 Protein denotes of ɛy Globin
T9672 21061-21100 Protein denotes of ɛy globin in definitive erythrocytes
T9671 21611-21613 Protein denotes ɛy
T9670 20997-21028 Entity denotes residual primitive erythrocytes
T9669 20823-20829 Protein denotes globin
T9668 21788-21802 Protein denotes Sox6-null mice
T9667 20816-20834 Protein denotes the ɛy globin gene
T9666 21515-21532 Protein denotes p100H mutant mice
T9665 21140-21146 Entity denotes globin
T9664 21364-21368 Protein denotes mRNA
T9663 21549-21550 Entity denotes F
T9662 20717-20721 Protein denotes Mice
T9661 21422-21434 Entity denotes Figure 5 A–D
T9660 21137-21158 Protein denotes ɛy globin transcripts
T9659 21647-21708 Entity denotes the definitive erythroid cells that mature in the fetal liver
T9658 21226-21235 Protein denotes ɛy globin
T9657 20902-20925 Entity denotes definitive erythrocytes
T9656 21077-21100 Entity denotes definitive erythrocytes
T9655 21464-21468 Protein denotes βmaj
T9654 21461-21479 Protein denotes of βmaj/min globin
T9653 21137-21158 Protein denotes ɛy globin transcripts
T9652 20702-20716 Protein denotes Sox6-Deficient
T9651 21762-21764 Protein denotes ɛy
T9650 20974-20986 Protein denotes of ɛy globin
T9649 21344-21379 Protein denotes abundant ectopic ɛy mRNA expression
T9648 20863-20885 Entity denotes primitive erythrocytes
T8858 18541-18592 Binding denotes putative Sox/Sox6 binding sites (M1 and M3) abolish
T8857 19249-19352 Binding denotes We also tested whether Sox6 binds to the ɛy promoter in vivo using chromatin immunoprecipitation (ChIP)
T8856 19774-19800 Binding denotes directly binding to the ɛy
T8855 18391-18451 Binding denotes The intact consensus Sox/Sox6 binding sites of the DNA probe
T8854 18841-18854 Binding denotes binding sites
T8853 18324-18389 Binding denotes Sox6 directly binds to this DNA sequence in MEL cells (Figure 3D)
T8852 17852-17878 Binding denotes by the tagged Sox6 protein
T8851 17488-17524 Binding denotes two consensus Sox/Sox6 binding sites
T8850 17085-17133 Binding denotes Sox6 is directly associated with the ɛy promoter
T8849 16841-16910 Binding denotes EMSA and ChIP Assays Show that Sox6 Directly Binds to the ɛy Promoter
T8848 18681-18696 Binding denotes with WT binding
T8847 17506-17510 Protein denotes Sox6
T8846 17205-17297 Protein denotes a c-Myc-tagged Sox6 in a reticulocyte lysate-based transcription/translation in vitro system
T8845 19026-19053 Entity denotes both Sox/Sox6 binding sites
T8844 17122-17124 Protein denotes ɛy
T8843 18836-18840 Protein denotes Sox6
T8842 19316-19325 Entity denotes chromatin
T8841 17440-17448 Entity denotes promoter
T8840 18429-18434 Entity denotes sites
T8839 19791-19800 Protein denotes to the ɛy
T8838 18574-18576 Entity denotes M1
T8837 17672-17676 Protein denotes Sox6
T8836 19081-19151 Entity denotes in significant promoter repression in transfection studies (Figure 3F)
T8835 17622-17624 Entity denotes M2
T8834 17085-17089 Protein denotes Sox6
T8833 19215-19220 Protein denotes Sox6,
T8832 18550-18558 Protein denotes Sox/Sox6
T8831 18884-18888 Protein denotes Sox6
T8830 19454-19490 Protein denotes 15.5 dpc WT mice using Sox6 antibody
T8829 16872-16876 Protein denotes Sox6
T8828 19290-19292 Protein denotes ɛy
T8827 18554-18558 Protein denotes Sox6
T8826 16991-17003 Entity denotes the promoter
T8825 17413-17415 Protein denotes ɛy
T8824 18315-18322 Protein denotes ɛy [33]
T8823 18567-18584 Entity denotes sites (M1 and M3)
T8822 17895-17900 Protein denotes c-Myc
T8821 17640-17644 Protein denotes Sox6
T8820 18494-18527 Entity denotes the competition assay (Figure 3E)
T8819 18755-18763 Protein denotes Sox/Sox6
T8818 19365-19373 Protein denotes The Sox6
T8817 18841-18854 Entity denotes binding sites
T8816 18352-18355 Entity denotes DNA
T8815 17973-17986 Protein denotes Sox6-specific
T8814 18025-18030 Protein denotes c-Myc
T8813 18832-18840 Protein denotes Sox/Sox6
T8812 17890-17926 Entity denotes both c-Myc and Sox6 antibodies super
T8811 19823-19830 Entity denotes a dimer
T8810 19159-19169 Entity denotes both sites
T8809 19031-19039 Protein denotes Sox/Sox6
T8808 17629-17631 Entity denotes M3
T8807 19731-19735 Protein denotes Sox6
T8806 19589-19619 Entity denotes both MEL cells and liver cells
T8805 17488-17524 Entity denotes two consensus Sox/Sox6 binding sites
T8804 17605-17607 Entity denotes M1
T8803 19759-19770 Protein denotes the ɛy gene
T8802 17905-17909 Protein denotes Sox6
T8801 19272-19276 Protein denotes Sox6
T8800 17113-17133 Entity denotes with the ɛy promoter
T8799 19283-19352 Entity denotes to the ɛy promoter in vivo using chromatin immunoprecipitation (ChIP)
T8798 17406-17424 Entity denotes of the ɛy promoter
T8797 17502-17510 Protein denotes Sox/Sox6
T8796 18438-18451 Entity denotes the DNA probe
T8795 18391-18451 Protein denotes The intact consensus Sox/Sox6 binding sites of the DNA probe
T8794 19759-19770 Protein denotes the ɛy gene
T8793 19477-19481 Protein denotes Sox6
T8792 17230-17242 Entity denotes reticulocyte
T8791 18916-18927 Entity denotes GM979 cells
T8790 18779-18840 Entity denotes the ɛy promoter reporter constructs with mutagenized Sox/Sox6
T8789 19512-19518 Protein denotes the ɛy
T8788 18832-18840 Protein denotes Sox/Sox6
T8787 17502-17510 Protein denotes Sox/Sox6
T8786 18065-18079 Protein denotes HA-tagged Sox6
T8785 18963-19005 Entity denotes the mutant ɛy promoter reporter constructs
T8784 16892-16910 Entity denotes to the ɛy Promoter
T8783 19801-19809 Entity denotes promoter
T8782 16934-16936 Protein denotes ɛy
T8781 17021-17060 Entity denotes intermediates affecting the ɛy promoter
T8780 18759-18763 Protein denotes Sox6
T8779 19031-19039 Protein denotes Sox/Sox6
T8778 17049-17051 Protein denotes ɛy
T8777 18290-18322 Protein denotes adult β globins, but not ɛy [33]
T8776 16899-16901 Protein denotes ɛy
T8775 19567-19585 Entity denotes with Sox6 antibody
T8774 18324-18328 Protein denotes Sox6
T8773 19206-19211 Protein denotes of ɛy
T8772 18643-18645 Entity denotes M2
T8771 18974-18976 Protein denotes ɛy
T8770 17750-17822 Entity denotes the ɛy promoter defined by the deletion analysis experiments (Figure 2C)
T8769 17852-17878 Protein denotes by the tagged Sox6 protein
T8768 18783-18785 Protein denotes ɛy
T8767 19528-19536 Entity denotes promoter
T8766 19459-19462 Entity denotes dpc
T8765 19572-19576 Protein denotes Sox6
T8764 17754-17756 Protein denotes ɛy
T8763 17636-17644 Protein denotes Sox/Sox6
T8762 17045-17060 Entity denotes the ɛy promoter
T8761 18755-18763 Protein denotes Sox/Sox6
T8760 16911-16915 Protein denotes Sox6
T8759 17636-17644 Protein denotes Sox/Sox6
T8758 19477-19490 Protein denotes Sox6 antibody
T8757 18550-18558 Protein denotes Sox/Sox6
T8756 19035-19039 Protein denotes Sox6
T8755 16930-16946 Entity denotes the ɛy promoter,
T8754 17866-17870 Protein denotes Sox6
T6881 13730-13756 Binding denotes Sox6-CtBP2 interaction [5]
T6880 13530-13556 Binding denotes the interaction with CtBP2
T6879 11538-11601 Gene_expression denotes Overexpression of Sox6 in GM979 cells by transient transfection
T6878 11538-11601 Positive_regulation denotes Overexpression of Sox6 in GM979 cells by transient transfection
T6877 13453-13505 Gene_expression denotes CtBP2 is expressed in GM979 cells (unpublished data)
T6876 14045-14047 Protein denotes ɛy
T6875 14038-14056 Entity denotes of the ɛy promoter
T6874 11024-11042 Entity denotes of the ɛy promoter
T6873 13589-13607 Entity denotes of the ɛy promoter
T6872 11748-11767 Entity denotes its HMG domain [32]
T6871 14164-14168 Protein denotes Sox6
T6870 13958-13962 Protein denotes Sox6
T6869 11268-11291 Protein denotes adult beta globins [30]
T6868 10877-10879 Protein denotes ɛy
T6867 11089-11109 Entity denotes the ɛy gene promoter
T6866 10823-10834 Entity denotes GM979 Cells
T6865 11446-11478 Protein denotes by the luciferase reporter gene,
T6864 13596-13598 Protein denotes ɛy
T6863 13323-13327 Protein denotes Sox6
T6862 13655-13659 Protein denotes Sox6
T6861 11306-11329 Entity denotes an ɛy promoter reporter
T6860 13994-14011 Protein denotes CtBP2-independent
T6859 11371-11375 Protein denotes μLCR
T6858 11684-11736 Protein denotes contrast, overexpression of a truncated Sox6 protein
T6857 10986-10994 Protein denotes ɛy mRNA,
T6856 11900-11902 Protein denotes ɛy
T6855 13851-13855 Protein denotes Sox6
T6854 11193-11205 Entity denotes GM979 cells,
T6853 13651-13707 Protein denotes the Sox6 protein that has been previously reported to be
T6852 11402-11435 Entity denotes the ɛy proximal promoter (2.2 kb)
T6851 11896-11911 Entity denotes the ɛy promoter
T6850 13429-13451 Entity denotes the fgf-3 promoter [5]
T6849 11406-11408 Protein denotes ɛy
T6848 13758-13773 Entity denotes This amino acid
T6847 11309-11311 Protein denotes ɛy
T6846 13973-13988 Entity denotes the ɛy promoter
T6845 11777-11803 Protein denotes to the p 100H mouse allele
T6844 10933-10936 Protein denotes PCR
T6843 11875-11879 Protein denotes Sox6
T6842 13730-13756 Protein denotes Sox6-CtBP2 interaction [5]
T6841 13791-13817 Entity denotes the HMG DNA binding domain
T6840 13419-13424 Protein denotes CtBP2
T6839 11553-11560 Protein denotes of Sox6
T6838 14118-14142 Entity denotes the ɛy proximal promoter
T6837 13906-13940 Entity denotes the transfection assay (Figure 2B)
T6836 13887-13941 Entity denotes the ɛy promoter in the transfection assay (Figure 2B),
T6835 13735-13740 Protein denotes CtBP2
T6834 10844-10853 Protein denotes That Sox6
T6833 13977-13979 Protein denotes ɛy
T6832 13891-13893 Protein denotes ɛy
T6831 13475-13505 Entity denotes GM979 cells (unpublished data)
T6830 11089-11109 Protein denotes the ɛy gene promoter
T6829 13429-13451 Protein denotes the fgf-3 promoter [5]
T6828 11453-11463 Protein denotes luciferase
T6827 11031-11033 Protein denotes ɛy
T6826 14250-14259 Entity denotes sites [5]
T6825 13573-13577 Protein denotes Sox6
T6824 11067-11071 Protein denotes Sox6
T6823 10986-10988 Protein denotes ɛy
T6822 13453-13458 Protein denotes CtBP2
T6821 14122-14124 Protein denotes ɛy
T6820 10873-10922 Entity denotes the ɛy Gene Promoter at the Transcriptional Level
T6819 14219-14241 Protein denotes two Sox/Sox6 consensus
T6818 11261-11263 Protein denotes ɛy
T6817 11724-11728 Protein denotes Sox6
T6816 11093-11095 Protein denotes ɛy
T6815 10873-10922 Protein denotes the ɛy Gene Promoter at the Transcriptional Level
T6814 11564-11601 Entity denotes GM979 cells by transient transfection
T6813 13546-13556 Protein denotes with CtBP2
T5345 9176-9183 Protein denotes WT mice
T5400 8586-8699 Positive_regulation denotes an upregulated transcript in the p 100H mouse using subtractive hybridization to identify Sox6 downstream targets
T5399 10184-10259 Gene_expression denotes ɛy expression in the livers of 15.5 dpc and 18.5 dpc homozygous mutant mice
T5398 9138-9183 Regulation denotes the decline in expression observed in WT mice
T5397 9714-9760 Gene_expression denotes us from evaluating postnatal globin expression
T5396 9034-9086 Gene_expression denotes in Figure 1, the ɛy gene is expressed at high levels
T5395 8465-8538 Gene_expression denotes Persistent Expression of the Embryonic Globin, ɛy, in Sox6-Deficient Mice
T5394 8539-8557 Protein denotes The ɛy globin gene
T5393 9806-9809 Protein denotes PCR
T5392 10341-10349 Entity denotes 15.5 dpc
T5391 10304-10312 Protein denotes βmaj/min
T5390 9401-9413 Protein denotes with WT mice
T5389 9015-9023 Entity denotes 18.5 dpc
T5388 10138-10156 Protein denotes WT fetal mice [29]
T5387 9743-9749 Protein denotes globin
T5386 8778-8782 Protein denotes Sox6
T5385 10184-10186 Protein denotes ɛy
T5384 9525-9539 Protein denotes adult β globin
T5383 9002-9010 Entity denotes 15.5 dpc
T5382 10215-10223 Entity denotes 15.5 dpc
T5381 8856-8869 Protein denotes Real-time PCR
T5380 9649-9663 Protein denotes of mutant mice
T5379 9345-9348 Protein denotes βh1
T5378 8494-8503 Protein denotes Embryonic
T5377 9470-9489 Entity denotes 18.5 dpc (Figure 1)
T5376 9369-9414 Protein denotes p100H homozygous mice, compared with WT mice,
T5375 8512-8514 Protein denotes ɛy
T5374 10304-10312 Protein denotes βmaj/min
T5373 9608-9627 Entity denotes 18.5 dpc (Figure 1)
T5372 9597-9627 Protein denotes WT mice at 18.5 dpc (Figure 1)
T5371 9047-9058 Protein denotes the ɛy gene
T5370 10233-10236 Entity denotes dpc
T5369 8924-8930 Protein denotes globin
T5368 8546-8552 Protein denotes globin
T5367 9051-9053 Protein denotes ɛy
T5366 9223-9259 Protein denotes heterozygous mice (unpublished data)
T5365 10228-10259 Protein denotes 18.5 dpc homozygous mutant mice
T5364 10354-10381 Protein denotes 18.5 dpc homozygous WT mice
T5363 8743-8787 Protein denotes an independent knock-out allele of Sox6 [13]
T5362 10309-10312 Protein denotes min
T5361 10359-10362 Entity denotes dpc
T5360 8487-8515 Protein denotes of the Embryonic Globin, ɛy,
T5359 8831-8834 Protein denotes PCR
T5358 8519-8523 Protein denotes Sox6
T5357 8539-8557 Protein denotes The ɛy globin gene
T5356 9301-9349 Protein denotes the other two embryonic globin genes (ζ and βh1)
T5355 9110-9121 Protein denotes mutant mice
T5354 9315-9324 Protein denotes embryonic
T5353 8918-8936 Protein denotes other globin genes
T5352 9339-9340 Protein denotes ζ
T5351 9301-9349 Protein denotes the other two embryonic globin genes (ζ and βh1)
T5350 9457-9466 Protein denotes ɛy globin
T5349 8519-8538 Protein denotes Sox6-Deficient Mice
T5348 8676-8691 Protein denotes Sox6 downstream
T5347 8586-8699 Protein denotes an upregulated transcript in the p 100H mouse using subtractive hybridization to identify Sox6 downstream targets
T5346 9567-9588 Protein denotes p100H homozygous mice
T4122 5725-5748 Protein denotes nuclease hypersensitive
T4121 6273-6274 Protein denotes ɛ
T4120 7962-7971 Protein denotes embryonic
T4119 2855-2858 Protein denotes Sry
T4118 6088-6114 Entity denotes definitive erythroid cells
T4117 3898-3915 Entity denotes of the HMG domain
T4116 8037-8041 Protein denotes Sox6
T4115 3932-3936 Protein denotes Sox9
T4114 3350-3372 Protein denotes architectural proteins
T4113 5952-5977 Entity denotes primitive erythroid cells
T4112 3009-3032 Entity denotes 79 amino acids involved
T4111 8045-8063 Protein denotes the ɛy globin gene
T4110 5232-5257 Entity denotes chromatin-assembled genes
T4109 5453-5461 Protein denotes β-minor}
T4108 5620-5634 Protein denotes of these genes
T4107 6621-6638 Protein denotes the ɛ globin gene
T4106 6561-6568 Protein denotes the LCR
T4105 5095-5099 Protein denotes HMG2
T4104 4382-4428 Protein denotes Mice homozygous for p100H show delayed growth,
T4103 3123-3126 Entity denotes DNA
T4102 4137-4141 Protein denotes Sox6
T4101 8336-8345 Protein denotes ɛy globin
T4100 4727-4737 Protein denotes the p gene
T4099 8209-8231 Entity denotes yolk sac blood islands
T4098 3036-3039 Entity denotes DNA
T4097 7975-7981 Protein denotes globin
T4096 7321-7329 Protein denotes proteins
T4095 8178-8182 Protein denotes mice
T4094 7666-7670 Protein denotes Sox6
T4093 4852-4872 Protein denotes the HMG box proteins
T4092 5224-5227 Entity denotes DNA
T4091 5986-6005 Protein denotes ɛy and βh-1 globins
T4090 7547-7553 Entity denotes LT-HSC
T4089 7292-7295 Protein denotes cis
T4088 3941-3944 Protein denotes Sry
T4087 7477-7492 Protein denotes shown that Sox6
T4086 3511-3523 Protein denotes multiprotein
T4085 5435-5438 Protein denotes βh1
T4084 4051-4055 Protein denotes Sox6
T4083 4731-4732 Protein denotes p
T4082 6140-6147 Protein denotes β major
T4081 5405-5431 Protein denotes The mouse β-globin genes {
T4080 3434-3443 Entity denotes DNA-bound
T4079 3299-3311 Protein denotes Sox proteins
T4078 5381-5403 Protein denotes β-globin genes [18–21]
T4077 6963-6964 Protein denotes ɛ
T4076 8117-8126 Protein denotes ɛy globin
T4075 6497-6518 Protein denotes adult β-globin switch
T4074 5242-5257 Protein denotes assembled genes
T4073 5986-5988 Protein denotes ɛy
T4072 5000-5006 Entity denotes groove
T4071 8089-8126 Entity denotes to the proximal promoter of ɛy globin
T4070 2894-2929 Protein denotes the Sox transcription factor family
T4069 6343-6344 Protein denotes ɛ
T4068 6273-6281 Protein denotes ɛ globin
T4067 4930-4965 Protein denotes the Sox transcription factor family
T4066 4010-4031 Protein denotes of these proteins [7]
T4065 3948-3960 Entity denotes the extracts
T4064 4558-4575 Entity denotes with a Chromosome
T4063 4145-4252 Entity denotes an important regulatory molecule that plays a role in the development of the central nervous system [8–11],
T4062 5129-5132 Entity denotes DNA
T4061 3524-3533 Entity denotes complexes
T4060 3069-3072 Protein denotes Sox
T4059 3279-3282 Entity denotes DNA
T4058 5466-5489 Entity denotes clustered on Chromosome
T4057 6481-6493 Protein denotes The γ-globin
T4056 5381-5403 Protein denotes β-globin genes [18–21]
T4055 3859-3881 Entity denotes of multiple substrates
T4054 6847-6850 Entity denotes DNA
T4053 7955-7986 Protein denotes of the embryonic ɛy globin gene
T4052 4934-4937 Protein denotes Sox
T4051 5923-5936 Protein denotes the embryonic
T4050 8178-8188 Protein denotes mice, Sox6
T4049 7181-7182 Protein denotes ɛ
T4048 5431-5433 Protein denotes ɛy
T4047 8052-8058 Protein denotes globin
T4046 8301-8310 Protein denotes ɛy globin
T4045 4607-4617 Protein denotes the p gene
T4044 5937-5941 Entity denotes yolk
T4043 4641-4711 Protein denotes no other gene within 50,000 nucleotides of the chromosomal breakpoints
T4042 6035-6038 Entity denotes dpc
T4041 3648-3681 Entity denotes its target promoter context [5,6]
T4040 4402-4428 Entity denotes p100H show delayed growth,
T4039 5295-5301 Entity denotes of DNA
T4038 3299-3302 Protein denotes Sox
T4037 5787-5803 Protein denotes the ɛy gene [23]
T4036 7879-7885 Protein denotes globin
T4035 6952-6983 Entity denotes the distal ɛ gene promoter [27]
T4034 2898-2901 Protein denotes Sox
T4033 6650-6660 Protein denotes the ɛ gene
T4032 4520-4543 Protein denotes The p100H mutant allele
T4031 3586-3598 Entity denotes an activator
T4030 7763-7778 Entity denotes of erythrocytes
T4219 3941-3978 Binding denotes Sry in the extracts restored splicing
T4218 5598-5634 Gene_expression denotes High-level expression of these genes
T4217 7172-7182 Regulation denotes regulate ɛ
T4216 7939-7986 Gene_expression denotes high expression of the embryonic ɛy globin gene
T4215 5242-5257 Binding denotes assembled genes
T4214 6343-6357 Positive_regulation denotes ɛ is activated
T4213 3428-3465 Binding denotes other DNA-bound transcription factors
T4212 4520-4577 Binding denotes The p100H mutant allele is associated with a Chromosome 7
T4211 4069-4096 Regulation denotes regulating gene expression,
T4210 5340-5403 Regulation denotes HMG proteins have been shown to modulate β-globin genes [18–21]
T4209 3069-3126 Binding denotes Sox transcription factors bind to the minor groove of DNA
T4208 5466-5489 Binding denotes clustered on Chromosome
T4207 8078-8126 Binding denotes Sox6 binds to the proximal promoter of ɛy globin
T4206 6066-6158 Gene_expression denotes the fetal liver where definitive erythroid cells express adult β globins (β major and minor)
T4205 8312-8453 Gene_expression denotes In the absence of Sox6, ɛy globin is ectopically expressed in the fetal liver, demonstrating that Sox6 functions in definitive erythropoiesis
T4204 5885-5936 Positive_regulation denotes In mice, erythropoiesis originates in the embryonic
T4203 5805-5883 Gene_expression denotes The β-globin genes are expressed in a tissue- and development-specific fashion
T4202 3376-3465 Binding denotes organizing local chromatin structure and assembling other DNA-bound transcription factors
T4201 5946-6005 Gene_expression denotes where primitive erythroid cells express ɛy and βh-1 globins
T4200 6165-6218 Negative_regulation denotes The ɛy gene is silenced in definitive erythroid cells
T4199 5059-5090 Gene_expression denotes the ubiquitously expressed HMG1
T4198 8160-8231 Gene_expression denotes In wild-type (WT) mice, Sox6 is not expressed in yolk sac blood islands true
T4197 7848-7891 Gene_expression denotes higher expression of embryonic globin genes
T4196 4777-4806 Transcription denotes the Sox6 transcription factor
T4195 7477-7507 Positive_regulation denotes shown that Sox6 is upregulated
T4194 8078-8158 Negative_regulation denotes Sox6 binds to the proximal promoter of ɛy globin and represses its transcription
T4193 6607-6638 Negative_regulation denotes for silencing the ɛ globin gene
T4192 7221-7248 Negative_regulation denotes the silencing of the ɛ gene
T4191 3259-3286 Entity denotes the major groove of DNA [4]
T4190 7866-7891 Protein denotes of embryonic globin genes
T4189 4990-5020 Entity denotes the minor groove and bend DNA,
T4188 5405-5431 Protein denotes The mouse β-globin genes {
T4187 3812-3819 Protein denotes of Sox6
T4186 7063-7067 Protein denotes DRED
T4185 4852-4872 Entity denotes the HMG box proteins
T4184 3100-3126 Entity denotes to the minor groove of DNA
T4183 5232-5257 Entity denotes chromatin-assembled genes
T4182 5937-6010 Entity denotes yolk sac where primitive erythroid cells express ɛy and βh-1 globins [22]
T4181 7036-7042 Protein denotes GATA-1
T4180 6152-6157 Protein denotes minor
T4179 7511-7554 Entity denotes long-term hematopoiesis stem cells (LT-HSC)
T4178 8327-8334 Protein denotes of Sox6
T4177 5095-5108 Protein denotes HMG2 proteins
T4176 3823-3841 Entity denotes HeLa cell extracts
T4175 3428-3465 Protein denotes other DNA-bound transcription factors
T875 281-313 Localization denotes the testis determining gene, Sry
T874 1162-1213 Negative_regulation denotes silencing of ɛy globin in definitive erythropoiesis
T873 726-754 Regulation denotes for Sox6 mediated repression
T872 930-1026 Gene_expression denotes The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of ɛy in p100H
T871 479-514 Gene_expression denotes ɛy globin is persistently expressed
T870 1279-1307 Regulation denotes Sox6 regulation of ɛy globin
T869 989-1026 Gene_expression denotes the ectopic expression of ɛy in p100H
T867 893-928 Binding denotes directly binding to the ɛy promoter
T866 688-690 Protein denotes ɛy
T845 1067-1071 Protein denotes Sox6
T838 151-154 Protein denotes Sox
T839 646-651 Entity denotes cells
T840 910-928 Entity denotes to the ɛy promoter
T841 1371-1416 Entity denotes hemoglobinopathies such as sickle cell anemia
T842 1141-1145 Protein denotes Sox6
T844 127-131 Protein denotes Sox6
T846 281-313 Protein denotes the testis determining gene, Sry
T847 1279-1283 Protein denotes Sox6
T849 1012-1017 Protein denotes of ɛy
T850 472-477 Entity denotes p100H
T851 147-182 Protein denotes the Sox transcription factor family
T852 952-959 Protein denotes of Sox6
T853 479-488 Protein denotes ɛy globin
T854 1021-1026 Entity denotes p100H
T855 804-813 Entity denotes chromatin
T856 352-356 Protein denotes Sox6
T857 1172-1184 Protein denotes of ɛy globin
T858 917-919 Protein denotes ɛy
T859 681-708 Entity denotes of the ɛy proximal promoter
T860 1295-1307 Protein denotes of ɛy globin
T861 726-754 Protein denotes for Sox6 mediated repression
T862 865-869 Protein denotes Sox6
T863 1238-1242 Protein denotes Sox6
T864 281-313 Protein denotes the testis determining gene, Sry
T865 242-313 Entity denotes DNA binding domain, first described in the testis determining gene, Sry
T843 14-37 Protein denotes Silences Epsilon Globin
T848 0-4 Protein denotes Sox6
T4149 7955-7986 Protein denotes of the embryonic ɛy globin gene
T4148 5805-5823 Protein denotes The β-globin genes
T4147 2873-2877 Protein denotes Sox6
T4146 8045-8063 Protein denotes the ɛy globin gene
T4145 5993-5997 Protein denotes βh-1
T4144 3069-3094 Protein denotes Sox transcription factors
T4143 7866-7891 Protein denotes of embryonic globin genes
T4142 6654-6655 Protein denotes ɛ
T4141 5440-5447 Protein denotes β-major
T4140 6754-6762 Entity denotes promoter
T4139 4626-4630 Protein denotes Sox6
T4138 5787-5803 Protein denotes the ɛy gene [23]
T4137 3012-3017 Entity denotes amino
T4136 7044-7048 Protein denotes YY-1
T4135 6123-6138 Protein denotes adult β globins
T4134 6731-6746 Protein denotes gene autonomous
T4133 4781-4785 Protein denotes Sox6
T4132 6165-6176 Protein denotes The ɛy gene
T4131 6192-6218 Entity denotes definitive erythroid cells
T4130 2987-2994 Entity denotes domain,
T4129 5340-5352 Protein denotes HMG proteins
T4128 6621-6638 Protein denotes the ɛ globin gene
T4127 4611-4612 Protein denotes p
T4126 6533-6544 Entity denotes by promoter
T4125 7235-7248 Protein denotes of the ɛ gene
T4124 7050-7057 Protein denotes COUP-TF
T4123 4320-4325 Entity denotes p100H
T4160 3926-3937 Protein denotes Sox6, Sox9,
T4159 8410-8414 Protein denotes Sox6
T4158 7147-7167 Entity denotes of protein complexes
T4157 3697-3701 Protein denotes Sox6
T4156 6952-6983 Protein denotes the distal ɛ gene promoter [27]
T4155 5725-5761 Entity denotes nuclease hypersensitive sites spread
T4154 5156-5174 Protein denotes other HMG proteins
T4153 5805-5823 Protein denotes The β-globin genes
T4152 6497-6518 Entity denotes adult β-globin switch
T4151 8078-8082 Protein denotes Sox6
T4150 4622-4712 Protein denotes the Sox6 gene (and no other gene within 50,000 nucleotides of the chromosomal breakpoints)
T4174 7242-7243 Protein denotes ɛ
T4173 3393-3402 Entity denotes chromatin
T4172 3152-3162 Entity denotes of the DNA
T4171 2855-2878 Entity denotes Sry type HMG box (Sox6)
T4170 5059-5090 Protein denotes the ubiquitously expressed HMG1
T4169 6430-6431 Protein denotes ɛ
T4168 4662-4711 Entity denotes 50,000 nucleotides of the chromosomal breakpoints
T4167 7125-7128 Entity denotes DNA
T4166 3535-3539 Protein denotes Sox6
T4165 5888-5892 Protein denotes mice
T4164 6625-6626 Protein denotes ɛ
T4163 6169-6171 Protein denotes ɛy
T4162 4891-4966 Protein denotes to Sry (the first member identified of the Sox transcription factor family)
T4161 6812-6816 Entity denotes cell
T17075 35317-35333 Gene_expression denotes overexpress Sox6
T17074 35317-35333 Positive_regulation denotes overexpress Sox6
T17073 35355-35412 Positive_regulation denotes of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1)
T17072 35355-35412 Gene_expression denotes of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1)
T17071 33821-33857 Positive_regulation denotes the ɛy globin initiation codon (ATG)
T17070 34362-34380 Protein denotes firefly luciferase
T17069 34358-34385 Protein denotes the firefly luciferase gene
T17068 34174-34190 Entity denotes the longest cDNA
T17067 35200-35231 Entity denotes the reverse primer HindIII site
T17066 34777-34789 Entity denotes an XhoI site
T17065 34659-34677 Entity denotes by the ɛy promoter
T17064 33926-33942 Protein denotes ɛ gene silencing
T17063 34036-34037 Protein denotes ɛ
T17062 34780-34784 Protein denotes XhoI
T17061 34488-34503 Protein denotes micro LCR; [31]
T17060 35619-35621 Protein denotes ɛy
T17059 35498-35566 Protein denotes Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR
T17058 34535-34563 Entity denotes the ɛy promoter in the above
T17057 33825-33827 Protein denotes ɛy
T17056 34283-34296 Entity denotes HindIII sites
R2959 T4032 T4212 themeOf The p100H mutant allele,The p100H mutant allele is associated with a Chromosome 7
R2966 T4049 T4217 themeOf ɛ,regulate ɛ
R2978 T4050 T4198 themeOf "mice, Sox6","In wild-type (WT) mice, Sox6 is not expressed in yolk sac blood islands"
R2980 T4051 T4204 themeOf the embryonic,"In mice, erythropoiesis originates in the embryonic"
R2988 T4058 T4208 themeOf clustered on Chromosome,clustered on Chromosome
R2997 T4064 T4212 themeOf with a Chromosome,The p100H mutant allele is associated with a Chromosome 7
R3001 T4069 T4214 themeOf ɛ,ɛ is activated
R3002 T4071 T4207 themeOf to the proximal promoter of ɛy globin,Sox6 binds to the proximal promoter of ɛy globin
R3003 T4074 T4215 themeOf assembled genes,assembled genes
R3005 T4078 T4210 themeOf β-globin genes [18–21],HMG proteins have been shown to modulate β-globin genes [18–21]
R3007 T4129 T4210 causeOf HMG proteins,HMG proteins have been shown to modulate β-globin genes [18–21]
R3008 T4080 T4213 themeOf DNA-bound,other DNA-bound transcription factors
R3009 T4132 T4200 themeOf The ɛy gene,The ɛy gene is silenced in definitive erythroid cells
R3010 T4087 T4195 themeOf shown that Sox6,shown that Sox6 is upregulated
R3011 T4133 T4196 themeOf Sox6,the Sox6 transcription factor
R3012 T4135 T4206 themeOf adult β globins,the fetal liver where definitive erythroid cells express adult β globins (β major and minor)
R3013 T4088 T4219 themeOf Sry,Sry in the extracts restored splicing
R3014 T4091 T4201 themeOf ɛy and βh-1 globins,where primitive erythroid cells express ɛy and βh-1 globins
R3015 T4144 T4209 themeOf Sox transcription factors,Sox transcription factors bind to the minor groove of DNA
R3016 T4101 T4205 themeOf ɛy globin,"In the absence of Sox6, ɛy globin is ectopically expressed in the fetal liver, demonstrating that Sox6 functions in definitive erythropoiesis"
R3017 T4148 T4203 themeOf The β-globin genes,The β-globin genes are expressed in a tissue- and development-specific fashion
R3019 T4151 T4207 themeOf Sox6,Sox6 binds to the proximal promoter of ɛy globin
R3020 T4108 T4218 themeOf of these genes,High-level expression of these genes
R3022 T4170 T4199 themeOf the ubiquitously expressed HMG1,the ubiquitously expressed HMG1
R3023 T4175 T4213 themeOf other DNA-bound transcription factors,other DNA-bound transcription factors
R3024 T4184 T4209 themeOf to the minor groove of DNA,Sox transcription factors bind to the minor groove of DNA
R3028 T4190 T4197 themeOf of embryonic globin genes,higher expression of embryonic globin genes
R3865 T5347 T5400 themeOf an upregulated transcript in the p 100H mouse using subtractive hybridization to identify Sox6 downstream targets,an upregulated transcript in the p 100H mouse using subtractive hybridization to identify Sox6 downstream targets
R3866 T5360 T5395 themeOf "of the Embryonic Globin, ɛy,","Persistent Expression of the Embryonic Globin, ɛy, in Sox6-Deficient Mice"
R3867 T5371 T5396 themeOf the ɛy gene,"in Figure 1, the ɛy gene is expressed at high levels"
R3868 T5385 T5399 themeOf ɛy,ɛy expression in the livers of 15.5 dpc and 18.5 dpc homozygous mutant mice
R3869 T5387 T5397 themeOf globin,us from evaluating postnatal globin expression
R4850 T6813 T6880 themeOf with CtBP2,the interaction with CtBP2
R4851 T6822 T6877 themeOf CtBP2,CtBP2 is expressed in GM979 cells (unpublished data)
R4852 T6835 T6881 themeOf CtBP2,Sox6-CtBP2 interaction [5]
R4853 T6836 T6832 partOf "the ɛy promoter in the transfection assay (Figure 2B),",ɛy
R4854 T6838 T6821 partOf the ɛy proximal promoter,ɛy
R4855 T6839 T6878 themeOf of Sox6,Overexpression of Sox6 in GM979 cells by transient transfection
R4856 T6839 T6879 themeOf of Sox6,Overexpression of Sox6 in GM979 cells by transient transfection
R4857 T6846 T6833 partOf the ɛy promoter,ɛy
R4858 T6850 T6829 partOf the fgf-3 promoter [5],the fgf-3 promoter [5]
R4859 T6851 T6856 partOf the ɛy promoter,ɛy
R4860 T6852 T6849 partOf the ɛy proximal promoter (2.2 kb),ɛy
R4861 T6873 T6864 partOf of the ɛy promoter,ɛy
R4862 T6874 T6827 partOf of the ɛy promoter,ɛy
R4863 T6875 T6876 partOf of the ɛy promoter,ɛy
R6168 T8755 T8782 partOf "the ɛy promoter,",ɛy
R6170 T8757 T8858 themeOf Sox/Sox6,putative Sox/Sox6 binding sites (M1 and M3) abolish
R6173 T8762 T8778 partOf the ɛy promoter,ɛy
R6177 T8769 T8852 themeOf by the tagged Sox6 protein,by the tagged Sox6 protein
R6178 T8770 T8764 partOf the ɛy promoter defined by the deletion analysis experiments (Figure 2C),ɛy
R6181 T8774 T8853 themeOf Sox6,Sox6 directly binds to this DNA sequence in MEL cells (Figure 3D)
R6186 T8784 T8776 partOf to the ɛy Promoter,ɛy
R6187 T8784 T8849 themeOf to the ɛy Promoter,EMSA and ChIP Assays Show that Sox6 Directly Binds to the ɛy Promoter
R6188 T8785 T8771 partOf the mutant ɛy promoter reporter constructs,ɛy
R6190 T8817 T8854 themeOf binding sites,binding sites
R6191 T8790 T8768 partOf the ɛy promoter reporter constructs with mutagenized Sox/Sox6,ɛy
R6192 T8795 T8855 themeOf The intact consensus Sox/Sox6 binding sites of the DNA probe,The intact consensus Sox/Sox6 binding sites of the DNA probe
R6193 T8798 T8825 partOf of the ɛy promoter,ɛy
R6194 T8799 T8828 partOf to the ɛy promoter in vivo using chromatin immunoprecipitation (ChIP),ɛy
R6195 T8799 T8857 themeOf to the ɛy promoter in vivo using chromatin immunoprecipitation (ChIP),We also tested whether Sox6 binds to the ɛy promoter in vivo using chromatin immunoprecipitation (ChIP)
R6196 T8800 T8844 partOf with the ɛy promoter,ɛy
R6197 T8800 T8850 themeOf with the ɛy promoter,Sox6 is directly associated with the ɛy promoter
R6198 T8801 T8857 themeOf Sox6,We also tested whether Sox6 binds to the ɛy promoter in vivo using chromatin immunoprecipitation (ChIP)
R6199 T8829 T8849 themeOf Sox6,EMSA and ChIP Assays Show that Sox6 Directly Binds to the ɛy Promoter
R6200 T8805 T8851 themeOf two consensus Sox/Sox6 binding sites,two consensus Sox/Sox6 binding sites
R6201 T8834 T8850 themeOf Sox6,Sox6 is directly associated with the ɛy promoter
R6202 T8839 T8856 themeOf to the ɛy,directly binding to the ɛy
R6734 T9650 T9679 themeOf of ɛy globin,the persistent expression of ɛy globin
R6735 T9654 T9676 themeOf of βmaj/min globin,the expression of βmaj/min globin
R6736 T9656 T9683 locationOf definitive erythrocytes,of ɛy globin in definitive erythrocytes
R6737 T9658 T9684 themeOf ɛy globin,"ɛy globin is not expressed in the WT 14.5-dpc liver,"
R6738 T9664 T9677 themeOf mRNA,"In contrast, abundant ectopic ɛy mRNA expression is seen in the liver of 14.5-dpc mutants"
R6739 T9664 T9678 themeOf mRNA,"In contrast, abundant ectopic ɛy mRNA expression is seen in the liver of 14.5-dpc mutants"
R6740 T9667 T9682 themeOf the ɛy globin gene,the ɛy globin gene is exclusively expressed in primitive erythrocytes and silenced in definitive erythrocytes
R6741 T9667 T9685 themeOf the ɛy globin gene,the ɛy globin gene is exclusively expressed in primitive erythrocytes and silenced in definitive erythrocytes
R6742 T9672 T9680 themeOf of ɛy globin in definitive erythrocytes,ectopic expression of ɛy globin in definitive erythrocytes
R6743 T9672 T9683 themeOf of ɛy globin in definitive erythrocytes,of ɛy globin in definitive erythrocytes
R6744 T9673 T9681 themeOf of ɛy Globin,The Persistent Expression of ɛy Globin in Sox6-Deficient
R7150 T10292 T10303 themeOf Sox6,"in situ hybridization shows that Sox6 is highly transcribed in 12.5-dpc liver, but not in yolk sac blood islands at 7.5 dpc (Figure 6B)"
R7151 T10302 T10304 themeOf Sox6,Sox6 expression
R7432 T10674 T10677 themeOf the ɛy globin gene,"silencing the ɛy globin gene,"
R10965 T15525 T15690 themeOf βmaj/min,βmaj/min expression in the livers of 15.5-dpc
R10966 T15528 T15674 themeOf "with EKLF, an activator,","DRED interferes with EKLF, an activator, in binding to the ɛy promoter [39]"
R10967 T15541 T15680 themeOf to the proximal promoter of ɛy gene,Sox6 directly regulates and binds to the proximal promoter of ɛy gene
R10968 T15544 T15687 themeOf of the ɛy globin gene,ectopic expression of the ɛy globin gene
R10969 T15545 T15680 themeOf Sox6,Sox6 directly regulates and binds to the proximal promoter of ɛy gene
R10970 T15545 T15681 causeOf Sox6,Sox6 directly regulates and binds to the proximal promoter of ɛy gene and represses the ɛy-globin gene in definitive erythropoiesis
R10971 T15462 T15685 themeOf of ɛy globin,the persistent expression of ɛy globin
R10972 T15548 T15689 themeOf of human ɛ-globin,reactivation of human ɛ-globin
R10973 T15549 T15693 themeOf multiprotein transcriptional complexes,assembling multiprotein transcriptional complexes
R10974 T15551 T15677 themeOf Sox6,These observations suggest that Sox6 binds to this sequence of the ɛy promoter either as a homodimer or as a heterodimer with other Sox proteins
R10975 T15469 T15675 themeOf its interacting proteins,its interacting proteins
R10976 T15554 T15679 themeOf ɛ globin,of ɛ globin regulation
R10977 T15570 T15686 themeOf of D-Sox protein dimers,with binding of D-Sox protein dimers
R10978 T15483 T15674 causeOf DRED,"DRED interferes with EKLF, an activator, in binding to the ɛy promoter [39]"
R10979 T15484 T15673 themeOf globin,globin gene expression
R10980 T15488 T15694 causeOf Sox6,Sox6 represses ɛy globin expression both in vivo (Figure 1) and in
R10981 T15581 T15442 partOf of the ɛy promoter,ɛy
R10982 T15494 T15555 partOf to the ɛy proximal promoter,ɛy
R10983 T15494 T15692 themeOf to the ɛy proximal promoter,"which binds to the ɛy proximal promoter, potentially as part of a larger repression complex"
R10984 T15495 T15682 themeOf ɛ globin,human ɛ globin silencing
R10985 T15500 T15676 themeOf of ɛy-globin,the regulation of ɛy-globin
R10986 T15584 T15681 themeOf the ɛy-globin gene,Sox6 directly regulates and binds to the proximal promoter of ɛy gene and represses the ɛy-globin gene in definitive erythropoiesis
R10987 T15504 T15497 partOf the ɛy promoter,ɛy
R10988 T15591 T15683 themeOf Sox proteins,"Sox proteins bind and bend linear DNA by partial intercalation in the minor groove,"
R10989 T15601 T15695 themeOf of the ɛy globin gene,a persistent upregulation of the ɛy globin gene
R10990 T15610 T15691 themeOf of liver RNA,of liver RNA
R10991 T15624 T15583 partOf to the ɛy promoter [39],ɛy
R10992 T15624 T15678 themeOf to the ɛy promoter [39],binding to the ɛy promoter [39]
R10993 T15625 T15481 partOf with the ɛy promoter,ɛy
R10994 T15632 T15590 partOf the ɛy promoter,ɛy
R10995 T15633 T15516 partOf the ɛy promoter,ɛy
R10996 T15613 T15688 themeOf globin,ɛy globin expression
R11000 T15657 T15684 themeOf at least two potential Sox6 binding sites,at least two potential Sox6 binding sites
R11010 T15688 T15694 themeOf ɛy globin expression,Sox6 represses ɛy globin expression both in vivo (Figure 1) and in
R11921 T17031 T17054 partOf of the ɛy promoter,ɛy
R11922 T17037 T17074 themeOf Sox6,overexpress Sox6
R11923 T17037 T17075 themeOf Sox6,overexpress Sox6
R11924 T17038 T17044 partOf the ɛy promoter fragment,ɛy
R11925 T17039 T17060 partOf ɛy promoter,ɛy
R11926 T17042 T17072 themeOf Sox6,of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1)
R11927 T17042 T17073 themeOf Sox6,of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1)
R11928 T17050 T17071 themeOf globin,the ɛy globin initiation codon (ATG)
R11929 T17052 T17055 partOf of the ɛy proximal promoter,ɛy
R11930 T17058 T17040 partOf the ɛy promoter in the above,ɛy
R11931 T17065 T17041 partOf by the ɛy promoter,ɛy
R13572 T19089 T19092 themeOf Sox6,Sox6 overexpression vector
R13573 T19089 T19093 themeOf Sox6,Sox6 overexpression vector
R13770 T19371 T19378 themeOf of Sox6,in vitro translation of Sox6
R13933 T19612 T19617 themeOf c-Myc antibody,c-Myc antibody was purchased from Invitrogen
R15085 T20990 T20997 partOf the ɛy promoter,ɛy
R15086 T20995 T20996 partOf of the ɛy promoter,ɛy
R15087 T20999 T21018 themeOf the DNA protein cross-links,the DNA protein cross-links
R15088 T21003 T21018 locationOf DNA,the DNA protein cross-links
R573 T840 T858 partOf to the ɛy promoter,ɛy
R574 T840 T867 themeOf to the ɛy promoter,directly binding to the ɛy promoter
R575 T843 T868 themeOf Silences Epsilon Globin,Silences Epsilon Globin Expression in Definitive Erythropoiesis
R576 T846 T875 themeOf "the testis determining gene, Sry","the testis determining gene, Sry"
R577 T847 T870 causeOf Sox6,Sox6 regulation of ɛy globin
R578 T849 T869 themeOf of ɛy,the ectopic expression of ɛy in p100H
R579 T852 T872 themeOf of Sox6,The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of ɛy in p100H
R580 T853 T871 themeOf ɛy globin,ɛy globin is persistently expressed
R581 T857 T874 themeOf of ɛy globin,silencing of ɛy globin in definitive erythropoiesis
R582 T859 T866 partOf of the ɛy proximal promoter,ɛy
R583 T860 T870 themeOf of ɛy globin,Sox6 regulation of ɛy globin
R584 T861 T873 themeOf for Sox6 mediated repression,for Sox6 mediated repression
R2962 T4035 T4077 partOf the distal ɛ gene promoter [27],ɛ
R2983 T4053 T4216 themeOf of the embryonic ɛy globin gene,high expression of the embryonic ɛy globin gene
R3004 T4125 T4192 themeOf of the ɛ gene,the silencing of the ɛ gene
R3006 T4128 T4193 themeOf the ɛ globin gene,for silencing the ɛ globin gene
R3018 T4151 T4194 causeOf Sox6,Sox6 binds to the proximal promoter of ɛy globin and represses its transcription

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T573 0-4 NNP denotes Sox6
T574 5-13 RB denotes Directly
T575 14-22 NNPS denotes Silences
T576 23-30 NNP denotes Epsilon
T577 31-37 NNP denotes Globin
T578 38-48 NNP denotes Expression
T579 49-51 IN denotes in
T580 52-62 NNP denotes Definitive
T581 63-77 NNP denotes Erythropoiesis
T10267 23466-23467 . denotes .
T15290 33629-33630 . denotes .
T18080 37830-37831 , denotes ,
T20986 44135-44136 . denotes .
T20985 44132-44135 NN denotes min
T20984 44130-44131 CD denotes 5
T20983 44126-44129 IN denotes for
T20982 44124-44125 NNP denotes C
T20981 44123-44124 CD denotes °
T20980 44120-44122 CD denotes 72
T20979 44117-44119 IN denotes at
T20978 44107-44116 NN denotes extension
T20977 44101-44106 JJ denotes final
T20976 44099-44100 DT denotes a
T20975 44094-44098 IN denotes with
T20974 44087-44093 VBG denotes ending
T20973 44085-44086 , denotes ,
T20972 44084-44085 PRP denotes s
T20971 44081-44083 CD denotes 45
T20970 44077-44080 IN denotes for
T20969 44075-44076 NNP denotes C
T20968 44074-44075 NN denotes °
T20967 44071-44073 CD denotes 72
T20966 44067-44070 CC denotes and
T20965 44065-44066 , denotes ,
T20964 44064-44065 PRP denotes s
T20963 44061-44063 CD denotes 30
T20962 44057-44060 IN denotes for
T20961 44055-44056 NNP denotes C
T20960 44054-44055 NN denotes °
T20959 44051-44053 CD denotes 60
T20958 44049-44050 , denotes ,
T20957 44048-44049 PRP denotes s
T20956 44045-44047 CD denotes 30
T20955 44041-44044 IN denotes for
T20954 44039-44040 NNP denotes C
T20953 44038-44039 CD denotes °
T20952 44035-44037 CD denotes 95
T20951 44032-44034 IN denotes at
T20950 44025-44031 NNS denotes cycles
T20949 44022-44024 CD denotes 30
T20948 44019-44021 IN denotes by
T20947 44010-44018 VBN denotes followed
T20946 44006-44009 NN denotes min
T20945 44003-44005 CD denotes 15
T20944 43999-44002 IN denotes for
T20943 43997-43998 NNP denotes C
T20942 43996-43997 NN denotes °
T20941 43993-43995 CD denotes 95
T20940 43991-43992 : denotes :
T20939 43981-43991 NNS denotes conditions
T20938 43971-43980 JJ denotes following
T20937 43967-43970 DT denotes the
T20936 43961-43966 IN denotes under
T20935 43951-43960 VBN denotes performed
T20934 43947-43950 VBD denotes was
T20933 43943-43946 NNP denotes PCR
T20932 43941-43942 . denotes .
T20931 43940-43941 -RRB- denotes )
T20930 43939-43940 NNP denotes ′
T20929 43918-43939 NNP denotes GCTTCACCACCAACCTCTTC3
T20928 43917-43918 NN denotes ′
T20927 43916-43917 CD denotes 5
T20926 43914-43915 , denotes ,
T20925 43907-43914 NNP denotes MHB1689
T20924 43903-43906 CC denotes and
T20923 43901-43902 : denotes ;
T20922 43900-43901 NN denotes ′
T20921 43879-43900 CD denotes CGAAGAATAAAAGGCCACCA3
T20920 43878-43879 NN denotes ′
T20919 43877-43878 CD denotes 5
T20918 43875-43876 , denotes ,
T20917 43868-43875 NNP denotes MHB1688
T20916 43860-43867 NNS denotes primers
T20915 43859-43860 -LRB- denotes (
T20914 43850-43858 NN denotes promoter
T20913 43847-43849 JJ denotes ɛy
T20912 43843-43846 DT denotes the
T20911 43840-43842 IN denotes of
T20910 43835-43839 CD denotes +140
T20909 43832-43834 TO denotes to
T20908 43829-43831 CD denotes 31
T20907 43828-43829 VBP denotes −
T20906 43816-43827 NNS denotes nucleotides
T20905 43813-43815 TO denotes to
T20904 43799-43812 JJ denotes corresponding
T20903 43797-43798 , denotes ,
T20902 43789-43797 NN denotes amplicon
T20901 43782-43788 JJ denotes 172-bp
T20900 43780-43781 DT denotes a
T20899 43772-43779 VBD denotes yielded
T20898 43768-43771 CC denotes and
T20897 43758-43767 VBN denotes performed
T20896 43754-43757 VBD denotes was
T20895 43745-43753 NN denotes promoter
T20894 43742-43744 JJ denotes ɛy
T20893 43738-43741 DT denotes the
T20892 43735-43737 IN denotes of
T20891 43721-43734 NN denotes amplification
T20890 43717-43720 NNP denotes PCR
T20889 43715-43716 . denotes .
T20888 43707-43715 NN denotes reaction
T20887 43703-43706 NNP denotes PCR
T20886 43699-43702 DT denotes the
T20885 43696-43698 IN denotes in
T20884 43687-43695 NN denotes template
T20883 43685-43686 DT denotes a
T20882 43682-43684 IN denotes as
T20881 43677-43681 VBN denotes used
T20880 43673-43676 VBD denotes was
T20879 43669-43672 NN denotes DNA
T20878 43650-43668 JJ denotes immunoprecipitated
T20877 43647-43649 CC denotes or
T20876 43643-43646 NNP denotes DNA
T20875 43637-43642 NNP denotes Input
T20874 43634-43636 NN denotes h.
T20873 43632-43633 CD denotes 4
T20872 43628-43631 IN denotes for
T20871 43626-43627 NNP denotes C
T20870 43625-43626 CD denotes °
T20869 43622-43624 CD denotes 65
T20868 43619-43621 IN denotes at
T20867 43614-43618 NNP denotes NaCl
T20866 43612-43613 NNP denotes M
T20865 43610-43611 CD denotes 5
T20864 43605-43609 IN denotes with
T20863 43596-43604 VBN denotes reversed
T20862 43591-43595 VBD denotes were
T20861 43579-43590 NNS denotes cross-links
T20860 43571-43578 NN denotes protein
T20859 43567-43570 NNP denotes DNA
T20858 43563-43566 DT denotes the
T20857 43559-43562 CC denotes and
T20856 43557-43558 , denotes ,
T20855 43551-43557 VBN denotes eluted
T20854 43546-43550 VBD denotes were
T20853 43536-43545 NNS denotes complexes
T20852 43517-43535 JJ denotes chromatin-antibody
T20851 43513-43516 DT denotes The
T20850 43511-43512 . denotes .
T20849 43503-43511 NNS denotes controls
T20848 43494-43502 JJ denotes negative
T20847 43491-43493 IN denotes as
T20846 43486-43490 VBN denotes used
T20845 43481-43485 VBD denotes were
T20844 43477-43480 CD denotes two
T20843 43472-43476 JJ denotes last
T20842 43468-43471 DT denotes The
T20841 43466-43467 . denotes .
T20840 43464-43466 NNP denotes Ab
T20839 43456-43463 IN denotes without
T20838 43449-43455 NN denotes sample
T20837 43443-43448 JJ denotes third
T20836 43439-43442 DT denotes the
T20835 43435-43438 CC denotes and
T20834 43433-43434 , denotes ,
T20833 43430-43433 NNP denotes IgG
T20832 43423-43429 NN denotes rabbit
T20831 43416-43422 JJ denotes normal
T20830 43411-43415 IN denotes with
T20829 43403-43410 VBN denotes treated
T20828 43396-43402 JJ denotes second
T20827 43394-43395 DT denotes a
T20826 43392-43393 , denotes ,
T20825 43383-43392 JJ denotes anti-Sox6
T20824 43378-43382 IN denotes with
T20823 43370-43377 VBN denotes treated
T20822 43363-43369 NN denotes sample
T20821 43359-43362 CD denotes one
T20820 43357-43358 : denotes :
T20819 43351-43357 NNS denotes thirds
T20818 43346-43350 IN denotes into
T20817 43340-43345 VBN denotes split
T20816 43335-43339 VBD denotes were
T20815 43327-43334 NNS denotes samples
T20814 43323-43326 DT denotes the
T20813 43321-43322 , denotes ,
T20812 43310-43321 NN denotes preclearing
T20811 43300-43309 VBG denotes Following
T20810 43298-43299 . denotes .
T20809 43297-43298 -RRB- denotes )
T20808 43291-43297 NNPS denotes States
T20807 43284-43290 NNP denotes United
T20806 43282-43283 , denotes ,
T20805 43276-43282 NNP denotes Jersey
T20804 43272-43275 NNP denotes New
T20689 42679-42681 IN denotes in
T20688 42677-42678 , denotes ,
T20687 42676-42677 NNP denotes ]
T20686 42674-42676 CD denotes 53
T20685 42673-42674 NNP denotes [
T20684 42665-42672 NNP denotes Nouzova
T20683 42662-42664 IN denotes by
T20682 42652-42661 VBN denotes described
T20681 42649-42651 IN denotes As
T20680 42647-42648 . denotes .
T20679 42642-42647 NN denotes assay
T20678 42637-42641 NN denotes ChIP
T20803 43270-43271 , denotes ,
T20802 43260-43270 NNP denotes Piscataway
T20801 43258-43259 , denotes ,
T20800 43247-43258 NNP denotes Biosciences
T20799 43238-43246 NNP denotes Amersham
T20798 43237-43238 -LRB- denotes (
T20797 43225-43236 JJ denotes A-Sepharose
T20796 43217-43224 NN denotes protein
T20795 43212-43216 IN denotes with
T20794 43201-43211 VBN denotes precleared
T20793 43197-43200 VBD denotes was
T20792 43190-43196 NN denotes sample
T20791 43180-43189 VBG denotes remaining
T20790 43176-43179 DT denotes the
T20789 43172-43175 CC denotes and
T20788 43170-43171 , denotes ,
T20787 43163-43170 NN denotes control
T20786 43157-43162 NN denotes input
T20785 43153-43156 IN denotes for
T20784 43147-43152 RB denotes aside
T20783 43143-43146 VBN denotes set
T20782 43139-43142 VBD denotes was
T20781 43132-43138 NN denotes sample
T20780 43128-43131 DT denotes the
T20779 43125-43127 IN denotes of
T20778 43115-43124 NN denotes One-tenth
T20777 43113-43114 . denotes .
T20776 43111-43113 NN denotes bp
T20775 43107-43110 CD denotes 600
T20774 43103-43106 CC denotes and
T20773 43099-43102 CD denotes 200
T20772 43096-43098 TO denotes to
T20771 43086-43095 VBN denotes sonicated
T20770 43081-43085 VBD denotes were
T20769 43071-43080 NNS denotes complexes
T20768 43059-43070 JJ denotes DNA-protein
T20767 43057-43058 . denotes .
T20766 43054-43057 NN denotes min
T20765 43051-43053 CD denotes 10
T20764 43047-43050 IN denotes for
T20763 43043-43046 NN denotes ice
T20762 43040-43042 IN denotes on
T20761 43030-43039 VBD denotes incubated
T20760 43026-43029 CC denotes and
T20759 43024-43025 , denotes ,
T20758 43014-43024 NNS denotes inhibitors
T20757 43005-43013 NN denotes protease
T20756 42994-43004 VBG denotes containing
T20755 42987-42993 NN denotes buffer
T20754 42981-42986 NN denotes lysis
T20753 42977-42980 NNP denotes SDS
T20752 42975-42976 DT denotes a
T20751 42972-42974 IN denotes in
T20750 42960-42971 VBD denotes resuspended
T20749 42958-42959 , denotes ,
T20748 42957-42958 NNP denotes C
T20747 42956-42957 CD denotes °
T20746 42954-42955 CD denotes 4
T20745 42951-42953 IN denotes at
T20744 42936-42950 NN denotes centrifugation
T20743 42933-42935 IN denotes by
T20742 42923-42932 VBN denotes collected
T20741 42921-42922 , denotes ,
T20740 42911-42921 NNS denotes inhibitors
T20739 42902-42910 NN denotes protease
T20738 42891-42901 VBG denotes containing
T20737 42886-42890 NNP denotes EDTA
T20736 42884-42885 NN denotes %
T20735 42881-42884 CD denotes 0.1
T20734 42876-42880 IN denotes with
T20733 42867-42875 NN denotes solution
T20732 42862-42866 NN denotes salt
T20731 42853-42861 JJ denotes balanced
T20730 42851-42852 POS denotes '
T20729 42846-42851 NNP denotes Hanks
T20728 42844-42845 CD denotes ×
T20727 42843-42844 CD denotes 1
T20726 42834-42842 JJ denotes ice-cold
T20725 42831-42833 IN denotes in
T20724 42824-42830 VBD denotes rinsed
T20723 42822-42823 , denotes ,
T20722 42821-42822 NNP denotes C
T20721 42820-42821 CD denotes °
T20720 42817-42819 CD denotes 37
T20719 42814-42816 IN denotes at
T20718 42810-42813 NN denotes min
T20717 42807-42809 CD denotes 10
T20716 42803-42806 IN denotes for
T20715 42790-42802 NN denotes formaldehyde
T20714 42788-42789 NN denotes %
T20713 42787-42788 CD denotes 1
T20712 42782-42786 IN denotes with
T20711 42774-42781 VBN denotes treated
T20710 42769-42773 VBD denotes were
T20709 42764-42768 NNS denotes mice
T20708 42761-42763 NNP denotes WT
T20707 42752-42760 JJ denotes 15.5-dpc
T20706 42746-42751 CD denotes three
T20705 42741-42745 IN denotes from
T20704 42735-42740 NNS denotes cells
T20703 42729-42734 NN denotes liver
T20702 42723-42728 JJ denotes fetal
T20701 42720-42722 CC denotes or
T20700 42718-42719 -RRB- denotes )
T20699 42715-42718 CD denotes 107
T20698 42713-42714 CD denotes ×
T20697 42711-42712 CD denotes 4
T20696 42710-42711 -LRB- denotes (
T20695 42704-42709 NNS denotes cells
T20694 42700-42703 NNP denotes MEL
T20693 42695-42699 IN denotes from
T20692 42689-42694 NNS denotes Cells
T20691 42687-42688 : denotes :
T20690 42682-42687 NN denotes brief
T20273 42634-42635 . denotes .
T20272 42633-42634 -RRB- denotes )
T20271 42626-42633 NNP denotes MHB1650
T20270 42625-42626 -LRB- denotes (
T20269 42623-42624 NNP denotes ′
T20268 42586-42623 NNP denotes AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3
T20267 42585-42586 NN denotes ′
T20266 42584-42585 CD denotes 5
T20265 42582-42583 : denotes :
T20264 42581-42582 -RRB- denotes )
T20263 42579-42581 NN denotes M3
T20262 42578-42579 -LRB- denotes (
T20261 42576-42577 CD denotes 3
T20260 42570-42575 NN denotes probe
T20259 42563-42569 JJ denotes mutant
T20258 42559-42562 IN denotes for
T20226 42412-42415 IN denotes for
T20225 42410-42411 : denotes ;
T20224 42409-42410 -RRB- denotes )
T20223 42402-42409 NNP denotes MHB1556
T20222 42401-42402 -LRB- denotes (
T20221 42399-42400 NNP denotes ′
T20220 42362-42399 NNP denotes AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3
T20219 42361-42362 CD denotes ′
T20218 42360-42361 CD denotes 5
T20217 42358-42359 : denotes :
T20216 42353-42358 NN denotes probe
T20215 42350-42352 NNP denotes WT
T20214 42344-42349 JJ denotes 36-bp
T20213 42340-42343 DT denotes the
T20212 42336-42339 IN denotes For
T20211 42334-42335 : denotes :
T20210 42333-42334 -RRB- denotes )
T20209 42327-42333 VBN denotes listed
T20208 42323-42326 VBP denotes are
T20207 42316-42322 NNS denotes oligos
T20206 42308-42315 RB denotes forward
T20205 42303-42307 RB denotes only
T20204 42302-42303 -LRB- denotes (
T20203 42294-42301 VBZ denotes follows
T20202 42291-42293 IN denotes as
T20201 42287-42290 VBP denotes are
T20200 42270-42286 NNS denotes oligonucleotides
T20199 42266-42269 DT denotes the
T20198 42263-42265 IN denotes of
T20197 42253-42262 NNS denotes sequences
T20196 42249-42252 NNP denotes DNA
T20195 42245-42248 DT denotes The
T20194 42243-42244 . denotes .
T20193 42242-42243 -RRB- denotes )
T20192 42237-42242 IN denotes above
T20191 42234-42236 RB denotes as
T20190 42224-42233 VBN denotes described
T20189 42223-42224 -LRB- denotes (
T20188 42212-42222 NNS denotes antibodies
T20187 42207-42211 NNP denotes Sox6
T20186 42203-42206 CC denotes and
T20185 42201-42202 , denotes ,
T20184 42199-42201 NNP denotes HA
T20183 42197-42198 , denotes ,
T20182 42192-42197 NNP denotes c-Myc
T20181 42183-42191 VBD denotes included
T20180 42174-42182 NNS denotes analyses
T20179 42163-42173 NN denotes supershift
T20178 42159-42162 IN denotes for
T20177 42154-42158 VBD denotes used
T20176 42143-42153 NNS denotes Antibodies
T20175 42141-42142 . denotes .
T20174 42126-42141 NN denotes autoradiography
T20173 42123-42125 TO denotes to
T20172 42117-42122 RB denotes prior
T20171 42111-42116 VBN denotes dried
T20170 42106-42110 VBD denotes were
T20169 42101-42105 NNS denotes gels
T20168 42097-42100 DT denotes the
T20167 42093-42096 CC denotes and
T20166 42091-42092 , denotes ,
T20165 42080-42091 NN denotes temperature
T20164 42075-42079 NN denotes room
T20163 42072-42074 IN denotes at
T20162 42070-42071 NN denotes h
T20161 42068-42069 CD denotes 8
T20160 42066-42067 CD denotes 4
T20159 42062-42065 IN denotes for
T20158 42057-42061 NN denotes mAmp
T20157 42054-42056 CD denotes 19
T20156 42045-42053 JJ denotes constant
T20155 42043-42044 DT denotes a
T20154 42040-42042 IN denotes at
T20153 42030-42039 VBN denotes performed
T20152 42026-42029 VBD denotes was
T20151 42010-42025 NNP denotes Electrophoresis
T20150 42008-42009 . denotes .
T20149 42005-42008 NN denotes gel
T20148 41990-42004 NN denotes polyacrylamide
T20147 41988-41989 -RRB- denotes )
T20146 41985-41988 FW denotes w/v
T20145 41984-41985 -LRB- denotes (
T20144 41982-41983 NN denotes %
T20143 41981-41982 CD denotes 6
T20142 41978-41980 CC denotes or
T20141 41976-41977 NN denotes %
T20140 41975-41976 CD denotes 4
T20139 41973-41974 DT denotes a
T20138 41970-41972 IN denotes on
T20137 41963-41969 VBN denotes loaded
T20136 41959-41962 CC denotes and
T20135 41947-41958 NN denotes temperature
T20134 41942-41946 NN denotes room
T20133 41939-41941 IN denotes at
T20132 41935-41938 NN denotes min
T20131 41932-41934 CD denotes 60
T20130 41929-41931 CC denotes or
T20129 41925-41928 NN denotes min
T20128 41922-41924 CD denotes 30
T20127 41918-41921 IN denotes for
T20126 41908-41917 VBN denotes incubated
T20125 41903-41907 VBD denotes were
T20124 41895-41902 NNS denotes samples
T20123 41891-41894 DT denotes the
T20122 41889-41890 , denotes ,
T20121 41884-41889 NN denotes probe
T20120 41871-41883 JJ denotes radiolabeled
T20119 41867-41870 DT denotes the
T20118 41864-41866 IN denotes of
T20117 41855-41863 NN denotes addition
T20116 41845-41854 VBG denotes Following
T20115 41843-41844 . denotes .
T20114 41838-41843 NN denotes probe
T20113 41825-41837 JJ denotes radiolabeled
T20112 41822-41824 IN denotes of
T20111 41813-41821 NN denotes addition
T20110 41810-41812 TO denotes to
T20109 41804-41809 RB denotes prior
T20108 41800-41803 NN denotes min
T20107 41797-41799 CD denotes 60
T20106 41794-41796 TO denotes to
T20105 41790-41793 NN denotes min
T20104 41787-41789 CD denotes 30
T20103 41781-41786 VBN denotes added
T20102 41777-41780 VBD denotes was
T20101 41775-41776 -RRB- denotes )
T20100 41773-41775 NN denotes μl
T20099 41771-41772 CD denotes 3
T20098 41770-41771 -LRB- denotes (
T20097 41761-41769 NN denotes antibody
T20096 41758-41760 CC denotes or
T20095 41756-41757 -RRB- denotes )
T20094 41750-41756 NN denotes excess
T20093 41744-41749 NN denotes molar
T20092 41735-41743 JJ denotes 200-fold
T20091 41734-41735 -LRB- denotes (
T20090 41723-41733 NN denotes competitor
T20089 41707-41722 NN denotes oligonucleotide
T20088 41696-41706 JJ denotes unlabelled
T20087 41686-41695 VBN denotes indicated
T20086 41682-41685 DT denotes the
T20085 41680-41681 , denotes ,
T20084 41674-41680 NNS denotes assays
T20083 41663-41673 NN denotes supershift
T20082 41660-41662 CC denotes or
T20081 41648-41659 NN denotes competition
T20080 41644-41647 IN denotes For
T20079 41642-41643 . denotes .
T20078 41637-41642 NNP denotes MgCl2
T20077 41634-41636 NNP denotes mM
T20076 41630-41633 CD denotes 0.6
T20075 41628-41629 , denotes ,
T20074 41625-41628 NNP denotes DTT
T20073 41622-41624 NNP denotes mM
T20072 41617-41621 CD denotes 0.25
T20071 41615-41616 , denotes ,
T20070 41611-41615 NNP denotes EDTA
T20069 41608-41610 NNP denotes mM
T20068 41604-41607 CD denotes 0.1
T20067 41602-41603 , denotes ,
T20066 41601-41602 -RRB- denotes )
T20065 41600-41601 CD denotes 7
T20064 41597-41599 NN denotes pH
T20063 41596-41597 -LRB- denotes (
T20062 41590-41595 NNS denotes HEPES
T20061 41587-41589 NN denotes mM
T20060 41584-41586 CD denotes 10
T20059 41582-41583 , denotes ,
T20058 41581-41582 -RRB- denotes )
T20057 41576-41581 JJ denotes dG-dC
T20056 41575-41576 -LRB- denotes (
T20055 41570-41574 NN denotes poly
T20054 41567-41569 CC denotes or
T20053 41565-41566 -RRB- denotes )
T20052 41560-41565 JJ denotes dI-dC
T20051 41559-41560 -LRB- denotes (
T20050 41554-41558 NN denotes poly
T20049 41551-41553 NN denotes μl
T20048 41550-41551 NN denotes /
T20047 41548-41550 NN denotes ng
T20046 41545-41547 CD denotes 50
T20045 41543-41544 , denotes ,
T20044 41540-41543 NNP denotes BSA
T20043 41537-41539 NN denotes μl
T20042 41536-41537 NN denotes /
T20041 41534-41536 NN denotes ng
T20040 41530-41533 CD denotes 200
T20039 41528-41529 , denotes ,
T20038 41520-41528 NN denotes glycerol
T20037 41518-41519 NN denotes %
T20036 41516-41518 CD denotes 10
T20035 41514-41515 , denotes ,
T20034 41510-41514 NNP denotes NaCl
T20033 41507-41509 NNP denotes mM
T20032 41503-41506 CD denotes 100
T20031 41501-41502 : denotes :
T20030 41495-41501 NN denotes buffer
T20029 41487-41494 JJ denotes binding
T20028 41484-41486 IN denotes in
T20027 41477-41483 NN denotes lysate
T20026 41464-41476 NN denotes reticulocyte
T20025 41460-41463 DT denotes the
T20024 41455-41459 IN denotes with
T20023 41449-41454 IN denotes along
T20022 41444-41448 NNS denotes Sox6
T20021 41427-41443 JJ denotes vitro-translated
T20020 41424-41426 IN denotes in
T20019 41421-41423 IN denotes of
T20018 41418-41420 NN denotes μl
T20017 41416-41417 CD denotes 3
T20016 41413-41415 CC denotes or
T20015 41407-41412 NNS denotes cells
T20014 41403-41406 NNP denotes MEL
T20013 41398-41402 IN denotes from
T20012 41389-41397 NNS denotes proteins
T20011 41381-41388 JJ denotes nuclear
T19990 41271-41275 VBD denotes were
T19989 41254-41270 NNS denotes oligonucleotides
T19988 41240-41253 JJ denotes complementary
T19987 41224-41239 JJ denotes Single-stranded
T19986 41222-41223 . denotes .
T19985 41218-41222 NNP denotes EMSA
T20257 42557-42558 : denotes ;
T20256 42556-42557 -RRB- denotes )
T20255 42549-42556 NNP denotes MHB1648
T20254 42548-42549 -LRB- denotes (
T20253 42546-42547 NNP denotes ′
T20252 42509-42546 NNP denotes AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3
T20251 42508-42509 NN denotes ′
T20250 42507-42508 CD denotes 5
T20249 42505-42506 : denotes :
T20248 42504-42505 -RRB- denotes )
T20247 42502-42504 NN denotes M2
T20246 42501-42502 -LRB- denotes (
T20245 42499-42500 CD denotes 2
T20244 42493-42498 NN denotes probe
T20243 42486-42492 JJ denotes mutant
T20242 42482-42485 IN denotes for
T20241 42480-42481 : denotes ;
T20240 42479-42480 -RRB- denotes )
T20239 42472-42479 NNP denotes MHB1644
T20238 42471-42472 -LRB- denotes (
T20237 42469-42470 NNP denotes ′
T20236 42439-42469 NNP denotes AACAAAGGGTCAGAACATTGTCTGCGAAG3
T20235 42438-42439 CD denotes ′
T20234 42437-42438 CD denotes 5
T20233 42435-42436 : denotes :
T20232 42434-42435 -RRB- denotes )
T20231 42432-42434 NN denotes M1
T20230 42431-42432 -LRB- denotes (
T20229 42429-42430 CD denotes 1
T20228 42423-42428 NN denotes probe
T20227 42416-42422 JJ denotes mutant
T19604 41215-41216 . denotes .
T19603 41214-41215 -RRB- denotes )
T19602 41208-41214 NNPS denotes States
T19601 41201-41207 NNP denotes United
T19600 41199-41200 , denotes ,
T19599 41195-41199 NNP denotes York
T19598 41191-41194 NNP denotes New
T19597 41189-41190 , denotes ,
T19596 41183-41189 NNP denotes Placid
T19595 41178-41182 NNP denotes Lake
T19594 41177-41178 -LRB- denotes (
T19593 41163-41176 NNP denotes Biotechnology
T19592 41155-41162 NNP denotes Upstate
T19591 41150-41154 IN denotes from
T20010 41378-41380 IN denotes of
T20009 41375-41377 NN denotes μg
T20008 41373-41374 CD denotes 5
T20007 41368-41372 IN denotes with
T20006 41358-41367 VBN denotes performed
T20005 41354-41357 VBD denotes was
T20004 41349-41353 NNP denotes EMSA
T20003 41347-41348 . denotes .
T20002 41341-41347 NN denotes kinase
T20001 41326-41340 NN denotes polynucleotide
T20000 41323-41325 CD denotes T4
T19999 41318-41322 IN denotes with
T19998 41314-41317 NNP denotes ATP
T19997 41312-41313 NNP denotes ]
T19996 41307-41312 NNP denotes γ-32P
T19995 41306-41307 NNP denotes [
T19994 41301-41305 IN denotes with
T19993 41289-41300 JJ denotes end-labeled
T19992 41285-41288 CC denotes and
T19991 41276-41284 JJ denotes annealed
T19590 41141-41149 VBN denotes obtained
T19589 41137-41140 VBD denotes was
T19588 41128-41136 NN denotes antibody
T19587 41124-41127 NNP denotes IgG
T19586 41117-41123 NN denotes rabbit
T19585 41110-41116 JJ denotes Normal
T19584 41108-41109 . denotes .
T19583 41098-41108 NNP denotes Invitrogen
T19582 41093-41097 IN denotes from
T19581 41083-41092 VBN denotes purchased
T19580 41079-41082 VBD denotes was
T19579 41070-41078 NN denotes antibody
T19578 41064-41069 JJ denotes c-Myc
T19577 41062-41063 . denotes .
T19576 41055-41062 NNS denotes results
T19575 41047-41054 JJ denotes similar
T19574 41037-41046 VBD denotes generated
T19573 41026-41036 NNS denotes antibodies
T19572 41021-41025 JJ denotes Sox6
T19571 41017-41020 DT denotes All
T19570 41015-41016 . denotes .
T19569 41014-41015 -RRB- denotes )
T19568 41008-41014 NNPS denotes States
T19567 41001-41007 NNP denotes United
T19566 40999-41000 , denotes ,
T19565 40989-40999 NNP denotes California
T19564 40987-40988 , denotes ,
T19563 40983-40987 NNP denotes Cruz
T19562 40977-40982 NNP denotes Santa
T19561 40975-40976 , denotes ,
T19560 40962-40975 NNP denotes Biotechnology
T19559 40957-40961 NNP denotes Cruz
T19558 40951-40956 NNP denotes Santa
T19557 40949-40950 , denotes ,
T19556 40948-40949 NNP denotes X
T19555 40939-40947 JJ denotes sc-17332
T19554 40937-40938 . denotes .
T19553 40935-40937 UH denotes No
T19552 40927-40934 NN denotes Catalog
T19551 40926-40927 -LRB- denotes (
T19550 40917-40925 VBN denotes obtained
T19549 40904-40916 RB denotes commercially
T19548 40901-40903 CC denotes or
T19547 40899-40900 -RRB- denotes )
T19546 40898-40899 NNP denotes ]
T19545 40897-40898 CD denotes 7
T19544 40896-40897 NNP denotes [
T19543 40889-40895 NNP denotes France
T19542 40887-40888 , denotes ,
T19541 40880-40887 NNP denotes Pasteur
T19540 40874-40879 NNP denotes Louis
T19539 40863-40873 NNP denotes Université
T19538 40862-40863 -LRB- denotes (
T19537 40856-40861 NNP denotes Lalli
T19536 40851-40855 NNP denotes Enzo
T19535 40847-40850 NNP denotes Dr.
T19534 40844-40846 IN denotes by
T19533 40835-40843 VBN denotes provided
T19532 40828-40834 RB denotes kindly
T19531 40821-40827 RB denotes either
T19530 40816-40820 VBD denotes were
T19529 40810-40815 NN denotes study
T19528 40805-40809 DT denotes this
T19527 40802-40804 IN denotes in
T19526 40797-40801 VBN denotes used
T19525 40786-40796 NNS denotes antibodies
T19524 40781-40785 JJ denotes Sox6
T19523 40779-40780 . denotes .
T19522 40769-40779 NNS denotes Antibodies
T19273 40283-40294 NN denotes translation
T19272 40277-40282 NN denotes vitro
T19271 40274-40276 IN denotes in
T19270 40270-40273 CC denotes and
T19269 40262-40269 VB denotes extract
T19268 40254-40261 NN denotes protein
T19267 40246-40253 NNP denotes Nuclear
T19074 40243-40244 . denotes .
T19073 40233-40243 NN denotes efficiency
T19072 40220-40232 NN denotes transfection
T19071 40216-40219 IN denotes for
T19070 40208-40215 NN denotes control
T19069 40206-40207 DT denotes a
T19068 40203-40205 IN denotes as
T19067 40198-40202 VBN denotes used
T19066 40194-40197 VBD denotes was
T19065 40192-40193 -RRB- denotes )
T19064 40185-40192 NNP denotes Promega
T19063 40184-40185 -LRB- denotes (
T19062 40179-40183 JJ denotes 15ng
T19061 40171-40178 JJ denotes pRL-CMV
T19060 40169-40170 . denotes .
T19059 40168-40169 -RRB- denotes )
T19058 40166-40168 NN denotes ng
T19051 40145-40147 NN denotes ng
T19050 40141-40144 CD denotes 200
T19049 40136-40140 VBD denotes used
T19036 40087-40093 NN denotes vector
T19035 40072-40086 NN denotes overexpression
T19034 40067-40071 JJ denotes Sox6
T19033 40064-40066 CC denotes or
T19032 40057-40063 NN denotes vector
T19031 40051-40056 JJ denotes empty
T19030 40044-40050 DT denotes either
T19029 40039-40043 IN denotes with
T19028 40033-40038 IN denotes along
T19027 40031-40032 -RRB- denotes )
T19026 40029-40031 NN denotes ng
T19025 40025-40028 CD denotes 500
T19024 40024-40025 -LRB- denotes (
T19023 40013-40023 NNS denotes constructs
T19022 40004-40012 NN denotes reporter
T19021 39995-40003 NN denotes promoter
T19020 39992-39994 JJ denotes ɛy
T19019 39987-39991 IN denotes with
T19018 39975-39986 VBN denotes transfected
T19017 39970-39974 VBD denotes were
T19016 39964-39969 NNS denotes Cells
T19015 39962-39963 . denotes .
T19014 39961-39962 -RRB- denotes )
T19013 39955-39961 NNPS denotes States
T19012 39948-39954 NNP denotes United
T19011 39946-39947 , denotes ,
T19010 39939-39946 NNP denotes Indiana
T19009 39937-39938 , denotes ,
T19008 39925-39937 NNP denotes Indianapolis
T19007 39923-39924 , denotes ,
T19006 39918-39923 NNP denotes Roche
T19005 39917-39918 -LRB- denotes (
T19004 39909-39916 NNP denotes FuGENE6
T19003 39906-39908 IN denotes by
T19002 39897-39905 NNS denotes plasmids
T19001 39892-39896 IN denotes with
T19000 39880-39891 VBN denotes transfected
T18999 39875-39879 VBD denotes were
T18998 39868-39874 NN denotes growth
T18997 39865-39867 IN denotes of
T18996 39859-39864 NN denotes phase
T18995 39855-39858 VB denotes log
T18994 39852-39854 IN denotes in
T18993 39850-39851 -RRB- denotes )
T18992 39847-39850 CD denotes 105
T18991 39845-39846 CD denotes ×
T18990 39843-39844 CD denotes 4
T18989 39842-39843 -LRB- denotes (
T18988 39836-39841 NNS denotes cells
T18987 39830-39835 CD denotes GM979
T18986 39828-39829 . denotes .
T18985 39827-39828 -RRB- denotes )
T18984 39822-39827 NN denotes serum
T18983 39818-39821 DT denotes the
T18982 39805-39817 VBG denotes inactivating
T18981 39800-39804 NN denotes heat
T18980 39792-39799 IN denotes without
T18979 39791-39792 -LRB- denotes (
T18978 39785-39790 IN denotes above
T18977 39782-39784 IN denotes as
T18976 39769-39781 VBD denotes supplemented
T18975 39764-39768 NNP denotes DMEM
T18974 39761-39763 IN denotes in
T18973 39752-39760 VBN denotes cultured
T18972 39747-39751 VBD denotes were
T18971 39741-39746 NNS denotes cells
T18970 39737-39740 NNP denotes MEL
T18969 39735-39736 . denotes .
T18968 39734-39735 -RRB- denotes )
T18967 39732-39734 NNP denotes mM
T18966 39730-39731 CD denotes 2
T18965 39729-39730 -LRB- denotes (
T18964 39717-39728 NNP denotes L-glutamine
T18963 39713-39716 CC denotes and
T18962 39711-39712 , denotes ,
T18961 39710-39711 -RRB- denotes )
T18960 39708-39710 NN denotes ml
T18959 39707-39708 NN denotes /
T18958 39705-39707 NN denotes μg
T18957 39701-39704 CD denotes 100
T18956 39688-39700 NNP denotes streptomycin
T18955 39686-39687 , denotes ,
T18954 39685-39686 -RRB- denotes )
T18953 39677-39685 NN denotes units/ml
T18952 39673-39676 CD denotes 100
T18951 39672-39673 -LRB- denotes (
T18950 39661-39671 NN denotes penicillin
T18949 39659-39660 , denotes ,
T18948 39658-39659 -RRB- denotes )
T18947 39652-39658 NNPS denotes States
T18946 39645-39651 NNP denotes United
T18945 39643-39644 , denotes ,
T18944 39633-39643 NNP denotes California
T18943 39631-39632 , denotes ,
T18942 39623-39631 NNP denotes Carlsbad
T18941 39621-39622 , denotes ,
T18940 39612-39621 NNP denotes Ivitrogen
T18939 39611-39612 -LRB- denotes (
T18938 39605-39610 NN denotes serum
T18937 39600-39604 NN denotes calf
T19363 40766-40767 . denotes .
T19362 40759-40766 NN denotes control
T19361 40750-40758 JJ denotes negative
T19360 40748-40749 DT denotes a
T19359 40745-40747 IN denotes as
T19358 40734-40744 VBN denotes translated
T19357 40729-40733 RB denotes also
T19356 40725-40728 VBD denotes was
T19355 40716-40724 NN denotes sequence
T19354 40709-40715 NN denotes coding
T19353 40704-40708 JJ denotes Sox6
T19352 40700-40703 DT denotes the
T19351 40692-40699 IN denotes without
T19350 40685-40691 NN denotes vector
T19349 40683-40684 DT denotes A
T19348 40681-40682 . denotes .
T19347 40680-40681 -RRB- denotes )
T19346 40673-40680 NNP denotes Promega
T19345 40671-40672 , denotes ,
T19344 40664-40671 NNPS denotes Systems
T19343 40638-40663 NNP denotes Transcription/Translation
T19342 40630-40637 NNP denotes Coupled
T19341 40624-40629 NNP denotes Quick
T19340 40622-40623 CD denotes ®
T19339 40619-40622 NNP denotes TNT
T19338 40618-40619 -LRB- denotes (
T19337 40611-40617 NN denotes system
T19336 40597-40610 JJ denotes translational
T19335 40591-40596 NN denotes vitro
T19334 40588-40590 IN denotes in
T19333 40582-40587 VBN denotes based
T19332 40575-40581 NN denotes lysate
T19331 40562-40574 NN denotes reticulocyte
T19330 40560-40561 DT denotes a
T19329 40557-40559 IN denotes in
T19328 40547-40556 VBN denotes performed
T19327 40543-40546 VBD denotes was
T19314 40486-40491 JJ denotes c-Myc
T19313 40481-40485 IN denotes with
T19312 40474-40480 VBN denotes tagged
T19311 40472-40473 , denotes ,
T19310 40466-40472 NN denotes vector
T19309 40455-40465 NN denotes expression
T19308 40443-40454 NN denotes translation
T19307 40437-40442 NN denotes vitro
T19306 40434-40436 IN denotes in
T19305 40429-40433 NNP denotes Sox6
T19304 40425-40428 DT denotes The
T19303 40423-40424 . denotes .
T19302 40422-40423 -RRB- denotes )
T19301 40416-40422 NNPS denotes States
T19300 40409-40415 NNP denotes United
T19299 40407-40408 , denotes ,
T19298 40397-40407 NNP denotes California
T19297 40395-40396 , denotes ,
T19296 40387-40395 NNP denotes Carlsbad
T19295 40385-40386 , denotes ,
T19294 40380-40385 NN denotes Motif
T19293 40373-40379 JJ denotes Active
T19292 40372-40373 -LRB- denotes (
T19291 40368-40371 NN denotes kit
T19290 40366-40367 DT denotes a
T19289 40360-40365 VBG denotes using
T19288 40358-40359 -RRB- denotes )
T19287 40355-40358 CD denotes 107
T19286 40353-40354 CD denotes ×
T19285 40351-40352 CD denotes 2
T19284 40350-40351 -LRB- denotes (
T19283 40344-40349 NNS denotes cells
T19282 40340-40343 NNP denotes MEL
T19281 40335-40339 IN denotes from
T19280 40326-40334 VBN denotes prepared
T19279 40321-40325 VBD denotes were
T19278 40312-40320 NNS denotes extracts
T19277 40304-40311 NNP denotes Nuclear
T19276 40302-40303 . denotes .
T19275 40298-40302 NNP denotes Sox6
T19274 40295-40297 IN denotes of
T18936 39594-39599 JJ denotes fetal
T18935 39592-39593 NN denotes %
T18934 39590-39592 CD denotes 10
T18933 39573-39589 JJ denotes heat-inactivated
T18932 39568-39572 IN denotes with
T18931 39555-39567 VBD denotes supplemented
T18930 39543-39554 NNP denotes L-glutamine
T18929 39540-39542 NNP denotes mM
T18928 39538-39539 CD denotes 2
T18927 39533-39537 IN denotes with
T18926 39529-39532 CD denotes F12
T18925 39526-39528 POS denotes 's
T18924 39523-39526 NNP denotes Ham
T18923 39520-39522 IN denotes in
T18922 39511-39519 VBN denotes cultured
T18921 39506-39510 VBD denotes were
T18920 39504-39505 -RRB- denotes )
T18919 39498-39504 NNPS denotes States
T18918 39491-39497 NNP denotes United
T18917 39489-39490 , denotes ,
T18916 39483-39489 NNP denotes Jersey
T18915 39479-39482 NNP denotes New
T18914 39477-39478 , denotes ,
T18913 39471-39477 NNP denotes Camden
T18912 39469-39470 , denotes ,
T18911 39457-39469 NNPS denotes Repositories
T18910 39452-39456 NNP denotes Cell
T18909 39444-39451 NNP denotes Coriell
T18908 39443-39444 -LRB- denotes (
T18907 39437-39442 NNS denotes cells
T18906 39431-39436 CD denotes GM979
T18905 39429-39430 . denotes .
T18904 39417-39429 NN denotes transfection
T18903 39413-39416 CC denotes and
T18902 39405-39412 NN denotes culture
T18901 39400-39404 NNP denotes Cell
T18684 39396-39398 NN denotes d.
T18683 39394-39395 CD denotes 6
T18682 39390-39393 IN denotes for
T18681 39388-39389 NNP denotes C
T18680 39387-39388 CD denotes °
T18679 39384-39386 CD denotes 80
T18678 39383-39384 CD denotes −
T18677 39380-39382 IN denotes at
T18676 39378-39379 -RRB- denotes )
T18675 39372-39378 NNPS denotes States
T18674 39365-39371 NNP denotes United
T18673 39363-39364 , denotes ,
T18672 39359-39363 NNP denotes York
T18671 39355-39358 NNP denotes New
T19057 40161-40165 CD denotes 1000
T19056 40157-40160 CC denotes and
T19055 40155-40156 , denotes ,
T19054 40153-40155 NN denotes ng
T19053 40149-40152 CD denotes 500
T19052 40147-40148 , denotes ,
T18670 39353-39354 , denotes ,
T18669 39344-39353 NNP denotes Rochester
T18668 39342-39343 , denotes ,
T18667 39337-39342 NNP denotes Kodak
T18666 39336-39337 -LRB- denotes (
T18665 39331-39335 NN denotes film
T18664 39325-39330 NN denotes X-ray
T18663 39322-39324 TO denotes to
T18662 39313-39321 NN denotes exposure
T18661 39310-39312 TO denotes to
T18660 39304-39309 RB denotes prior
T18659 39302-39303 NNP denotes C
T18658 39301-39302 CD denotes °
T18657 39298-39300 CD denotes 60
T18656 39295-39297 IN denotes at
T18655 39291-39294 NNP denotes SDS
T18654 39289-39290 NN denotes %
T18653 39288-39289 CD denotes 1
T18652 39286-39287 , denotes ,
T18651 39283-39286 NNP denotes SSC
T18650 39281-39282 CD denotes ×
T18649 39278-39281 CD denotes 0.2
T18648 39273-39277 IN denotes with
T18647 39266-39272 VBN denotes washed
T18646 39261-39265 VBD denotes were
T18645 39255-39260 NNS denotes Blots
T18644 39253-39254 . denotes .
T18643 39245-39253 NN denotes solution
T18642 39231-39244 NN denotes hybridization
T18641 39227-39230 NNP denotes SDS
T18640 39225-39226 NN denotes %
T18639 39224-39225 CD denotes 7
T18638 39215-39223 VBD denotes buffered
T18637 39205-39214 NN denotes phosphate
T18636 39202-39204 IN denotes in
T18635 39192-39201 VBN denotes performed
T18634 39188-39191 VBD denotes was
T18633 39174-39187 NN denotes hybridization
T18632 39170-39173 DT denotes The
T18631 39168-39169 . denotes .
T18630 39167-39168 -RRB- denotes )
T18629 39160-39167 NNP denotes Kingdom
T18628 39153-39159 NNP denotes United
T18627 39151-39152 , denotes ,
T18615 39068-39074 JJ denotes random
T18614 39065-39067 IN denotes by
T18613 39063-39064 , denotes ,
T18612 39059-39063 NNP denotes dCTP
T18611 39058-39059 NNP denotes ]
T18610 39053-39058 NNP denotes α-32P
T18609 39052-39053 NNP denotes [
T18608 39047-39051 IN denotes with
T18607 39039-39046 VBN denotes labeled
T18606 39035-39038 CC denotes and
T18605 39033-39034 -RRB- denotes )
T18604 39029-39033 CD denotes 1927
T18603 39024-39028 CD denotes 1353
T18602 39012-39023 NNS denotes nucleotides
T18601 39011-39012 -LRB- denotes (
T18600 39004-39010 NNP denotes RT-PCR
T18599 39001-39003 IN denotes by
T18598 38991-39000 VBN denotes generated
T18597 38985-38990 NN denotes probe
T18596 38980-38984 JJ denotes Sox6
T18595 38978-38979 DT denotes a
T18594 38973-38977 IN denotes with
T18593 38962-38972 VBN denotes hybridized
T18592 38958-38961 VBD denotes was
T18591 38956-38957 -RRB- denotes )
T18590 38950-38956 NNPS denotes States
T18589 38943-38949 NNP denotes United
T18588 38941-38942 , denotes ,
T18587 38933-38941 NNP denotes Maryland
T18586 38931-38932 , denotes ,
T18585 38922-38931 NNP denotes Rockville
T18584 38920-38921 , denotes ,
T18583 38913-38920 NNP denotes Seegene
T18582 38912-38913 -LRB- denotes (
T18581 38905-38911 NN denotes filter
T18580 38900-38904 NN denotes blot
T18579 38891-38899 NNP denotes Northern
T18578 38884-38890 NN denotes tissue
T18577 38874-38883 JJ denotes embryonic
T18576 38868-38873 NN denotes mouse
T18575 38866-38867 DT denotes A
T18574 38864-38865 . denotes .
T18573 38860-38864 NN denotes blot
T18572 38851-38859 NNP denotes Northern
T18406 38715-38716 NN denotes ×
T18405 38713-38715 CD denotes 40
T18404 38712-38713 -LRB- denotes (
T18403 38706-38711 NNP denotes Nikon
T18402 38702-38705 CD denotes .17
T18401 38697-38702 CD denotes 160/0
T18400 38693-38696 CD denotes .65
T18399 38689-38693 CD denotes 40/0
T18398 38684-38688 NNP denotes Plan
T18397 38682-38683 NNP denotes E
T18396 38677-38681 VBD denotes were
T18395 38672-38676 VBN denotes used
T18394 38661-38671 NNS denotes Objectives
T18393 38659-38660 . denotes .
T18392 38649-38659 NN denotes microscope
T18391 38638-38648 NNP denotes Labophot-2
T18390 38632-38637 NNP denotes Nikon
T18389 38627-38631 IN denotes with
T18388 38618-38626 VBN denotes obtained
T18387 38613-38617 VBD denotes were
T18386 38606-38612 NNS denotes Images
T18385 38604-38605 . denotes .
T18384 38598-38604 NN denotes manner
T18383 38590-38597 JJ denotes similar
T18382 38588-38589 DT denotes a
T18381 38585-38587 IN denotes in
T18380 38576-38584 VBN denotes prepared
T18379 38571-38575 VBD denotes were
T18378 38569-38570 -RRB- denotes )
T18377 38566-38569 NN denotes dpc
T18376 38561-38565 CD denotes 18.5
T18375 38557-38560 CC denotes and
T18374 38553-38556 NN denotes dpc
T18373 38548-38552 CD denotes 14.5
T18372 38545-38547 IN denotes at
T18371 38544-38545 -LRB- denotes (
T18370 38536-38543 NNS denotes samples
T18369 38530-38535 NNP denotes Liver
T18368 38528-38529 . denotes .
T18367 38523-38528 NN denotes eosin
T18366 38519-38522 CC denotes and
T18365 38507-38518 NN denotes hematoxylin
T18364 38502-38506 IN denotes with
T18363 38494-38501 VBN denotes stained
T18362 38490-38493 CC denotes and
T18361 38488-38489 , denotes ,
T18360 38486-38488 NN denotes μm
T18359 38484-38485 CD denotes 5
T18358 38481-38483 IN denotes at
T18357 38471-38480 VBN denotes sectioned
T18356 38469-38470 , denotes ,
T18355 38452-38469 JJ denotes paraffin-embedded
T18354 38450-38451 , denotes ,
T18353 38442-38450 NN denotes formalin
T18352 38440-38441 NN denotes %
T18351 38438-38440 CD denotes 10
T18350 38435-38437 IN denotes in
T18349 38429-38434 VBN denotes fixed
T18348 38424-38428 VBD denotes were
T18347 38419-38423 NNS denotes mice
T18346 38414-38418 CD denotes 10.5
T18345 38410-38413 NN denotes day
T18344 38400-38409 JJ denotes postnatal
T18343 38396-38399 CC denotes and
T18342 38394-38395 , denotes ,
T18341 38387-38394 NNS denotes embryos
T18340 38380-38386 JJ denotes mutant
T18339 38376-38379 CC denotes and
T18338 38373-38375 NNP denotes WT
T18337 38364-38372 JJ denotes 14.5-dpc
T18336 38362-38363 , denotes ,
T18335 38354-38362 NN denotes analysis
T18334 38348-38353 VBP denotes mount
T18333 38342-38347 JJ denotes whole
T18332 38338-38341 IN denotes For
T18331 38336-38337 . denotes .
T18330 38333-38336 NNP denotes DAF
T18329 38330-38332 IN denotes by
T18328 38325-38329 VBN denotes read
T18327 38321-38324 CC denotes and
T18326 38306-38320 JJ denotes Wright-stained
T18325 38301-38305 VBD denotes were
T18324 38294-38300 NNS denotes slides
T18323 38290-38293 DT denotes The
T18322 38288-38289 . denotes .
T18321 38284-38288 NNS denotes mice
T18320 38281-38283 NNP denotes WT
T18319 38277-38280 CC denotes and
T18318 38270-38276 JJ denotes mutant
T18317 38265-38269 DT denotes both
T18316 38260-38264 IN denotes from
T18315 38251-38259 VBN denotes prepared
T18314 38246-38250 VBD denotes were
T18313 38239-38245 NNS denotes smears
T18312 38233-38238 NN denotes blood
T18311 38222-38232 JJ denotes peripheral
T18310 38218-38221 CC denotes and
T18309 38204-38217 VBN denotes exsanguinated
T18308 38199-38203 VBD denotes were
T18307 38191-38198 NNS denotes embryos
T18306 38182-38190 JJ denotes 18.5-dpc
T18305 38180-38181 . denotes .
T18304 38171-38180 NNP denotes Histology
T18044 37621-37624 NNP denotes RNA
T18043 37609-37620 VBN denotes transcribed
T18042 37603-37608 NN denotes vitro
T18041 37600-37602 IN denotes in
T18040 37594-37599 VBG denotes using
T18039 37592-37593 NNP denotes ]
T18038 37590-37592 CD denotes 52
T18037 37589-37590 NNP denotes [
T18036 37579-37588 VBN denotes described
T18035 37576-37578 IN denotes as
T18034 37562-37575 NN denotes hybridization
T18033 37557-37561 NN denotes situ
T18032 37554-37556 IN denotes in
T18031 37550-37553 IN denotes for
T18030 37540-37549 VBN denotes processed
T18029 37535-37539 VBD denotes were
T18028 37528-37534 NNS denotes Slides
T18027 37526-37527 . denotes .
T18026 37525-37526 -RRB- denotes )
T18025 37519-37525 NNPS denotes States
T18024 37512-37518 NNP denotes United
T18023 37510-37511 , denotes ,
T18022 37498-37510 NNP denotes Pennsylvania
T18021 37496-37497 , denotes ,
T18020 37489-37496 NNP denotes Chester
T18019 37484-37488 NNP denotes West
T18018 37482-37483 , denotes ,
T18017 37479-37482 NNP denotes VWR
T18016 37478-37479 -LRB- denotes (
T18015 37471-37477 NNS denotes slides
T18014 37462-37470 VBN denotes modified
T18013 37455-37461 VB denotes charge
T18012 37452-37454 TO denotes to
T18011 37444-37451 VBD denotes adhered
T18010 37440-37443 CC denotes and
T18436 38848-38849 . denotes .
T18435 38839-38848 JJ denotes available
T18434 38835-38838 VBP denotes are
T18433 38828-38834 NNS denotes images
T18432 38819-38827 NNP denotes Original
T18431 38817-38818 . denotes .
T18430 38813-38817 CD denotes 4300
T18429 38805-38812 NNP denotes Coolpix
T18428 38799-38804 NNP denotes Nikon
T18427 38797-38798 DT denotes a
T18426 38793-38796 VBD denotes was
T18425 38786-38792 NN denotes camera
T18424 38782-38785 DT denotes The
T18423 38780-38781 . denotes .
T18422 38779-38780 -RRB- denotes )
T18421 38770-38779 NN denotes objective
T18420 38768-38769 CD denotes ×
T18419 38765-38768 CD denotes 100
T18418 38764-38765 -LRB- denotes (
T18417 38758-38763 NNP denotes Nikon
T18416 38754-38757 CD denotes .17
T18415 38749-38754 CD denotes 160/0
T18414 38745-38748 NN denotes oil
T18413 38741-38744 CD denotes .25
T18412 38736-38741 CD denotes 100/1
T18411 38731-38735 NNP denotes Plan
T18410 38729-38730 NNP denotes E
T18409 38727-38728 , denotes ,
T18408 38726-38727 -RRB- denotes )
T18407 38717-38726 NN denotes objective
T17681 37164-37165 . denotes .
T17680 37163-37164 -RRB- denotes )
T17679 37157-37163 NNPS denotes States
T17678 37150-37156 NNP denotes United
T17677 37148-37149 , denotes ,
T17676 37138-37148 NNP denotes Washington
T17675 37136-37137 , denotes ,
T17674 37129-37136 NNP denotes Redmond
T17673 37128-37129 -LRB- denotes (
T17672 37122-37127 NNP denotes Excel
T17671 37112-37121 NNP denotes Microsoft
T17670 37109-37111 IN denotes in
T17669 37103-37108 NNP denotes GAPDH
T17668 37100-37102 TO denotes to
T17667 37089-37099 VBN denotes normalized
T17666 37085-37088 CC denotes and
T17665 37083-37084 -RRB- denotes )
T17664 37073-37083 NNPS denotes Biosystems
T17663 37065-37072 NNP denotes Applied
T17662 37064-37065 -LRB- denotes (
T17661 37055-37063 NNP denotes Software
T17660 37051-37054 NNP denotes SDS
T17659 37046-37050 CD denotes 7000
T17658 37040-37045 NNP denotes Prism
T17657 37036-37039 NNP denotes ABI
T17656 37032-37035 DT denotes the
T17655 37029-37031 IN denotes in
T17654 37018-37028 VBN denotes calculated
T17653 37013-37017 VBD denotes were
T17652 37006-37012 NNS denotes values
T17651 36993-37005 JJ denotes quantitative
T17650 36984-36992 JJ denotes Relative
T17649 36982-36983 . denotes .
T17648 36974-36982 NN denotes reaction
T17647 36970-36973 NNP denotes PCR
T17646 36965-36969 DT denotes each
T17645 36961-36964 IN denotes for
T17644 36956-36960 VBN denotes done
T17643 36951-36955 VBD denotes were
T17642 36939-36950 NNS denotes Triplicates
T17641 36937-36938 . denotes .
T17640 36923-36937 NNS denotes amplifications
T17639 36919-36922 DT denotes the
T17638 36916-36918 IN denotes of
T17637 36905-36915 NN denotes efficiency
T17636 36901-36904 DT denotes the
T17635 36896-36900 VB denotes test
T17634 36893-36895 TO denotes to
T17633 36883-36892 VBN denotes performed
T17632 36878-36882 VBD denotes were
T17631 36869-36877 NNS denotes analyses
T17630 36863-36868 NN denotes curve
T17629 36854-36862 NNP denotes Standard
T17628 36852-36853 . denotes .
T17627 36849-36852 NNP denotes RNA
T17626 36843-36848 NN denotes input
T17625 36839-36842 IN denotes for
T17624 36831-36838 NN denotes control
T17623 36828-36830 IN denotes as
T17622 36823-36827 VBN denotes used
T17621 36818-36822 VBD denotes were
T17620 36811-36817 NNS denotes levels
T17619 36806-36810 NNP denotes mRNA
T17618 36800-36805 NNP denotes GAPDH
T17617 36798-36799 . denotes .
T17616 36790-36798 NN denotes supermix
T17615 36784-36789 JJ denotes green
T17614 36779-36783 NNP denotes SYBR
T17613 36776-36778 NN denotes μl
T17612 36771-36775 CD denotes 12.5
T17611 36766-36770 IN denotes with
T17610 36757-36765 NN denotes reaction
T17609 36751-36756 JJ denotes 25-μl
T17608 36749-36750 DT denotes a
T17607 36746-36748 IN denotes in
T17606 36736-36745 VBN denotes performed
T17605 36732-36735 VBD denotes was
T17604 36728-36731 NNP denotes PCR
T17603 36724-36727 DT denotes All
T17602 36722-36723 . denotes .
T17601 36714-36722 NN denotes facility
T17600 36709-36713 NN denotes core
T17599 36701-36708 NNP denotes Arizona
T17598 36698-36700 IN denotes of
T17597 36687-36697 NNP denotes University
T17596 36683-36686 DT denotes the
T17595 36680-36682 IN denotes at
T17594 36678-36679 -RRB- denotes )
T17593 36672-36678 NNPS denotes States
T17592 36665-36671 NNP denotes United
T17591 36663-36664 , denotes ,
T17590 36653-36663 NNP denotes California
T17589 36651-36652 , denotes ,
T17588 36647-36651 NNP denotes City
T17587 36640-36646 NNP denotes Foster
T18152 38168-38169 . denotes .
T18151 38159-38168 JJ denotes available
T18150 38155-38158 VBP denotes are
T18149 38148-38154 NNS denotes images
T18148 38139-38147 NNP denotes Original
T18147 38137-38138 . denotes .
T18146 38130-38137 NNS denotes plugins
T18145 38128-38129 -RRB- denotes )
T18144 38122-38128 NNPS denotes States
T18143 38115-38121 NNP denotes United
T18142 38113-38114 , denotes ,
T18141 38105-38113 NNP denotes Carolina
T18140 38099-38104 NNP denotes North
T18139 38097-38098 , denotes ,
T18138 38088-38097 NNP denotes Asheville
T18137 38086-38087 , denotes ,
T18136 38078-38086 NNP denotes Graphics
T18135 38069-38077 NNP denotes Reindeer
T18134 38068-38069 -LRB- denotes (
T18133 38064-38067 FW denotes Pro
T18132 38058-38063 NNP denotes Fovea
T18131 38053-38057 IN denotes with
T18130 38044-38052 NN denotes software
T18129 38042-38043 -RRB- denotes )
T18128 38036-38042 NNPS denotes States
T18127 38029-38035 NNP denotes United
T18126 38027-38028 , denotes ,
T18125 38017-38027 NNP denotes California
T18124 38015-38016 , denotes ,
T18123 38011-38015 NNP denotes Jose
T18122 38007-38010 NNP denotes San
T18121 38005-38006 , denotes ,
T18120 38000-38005 NNP denotes Adobe
T18119 37999-38000 -LRB- denotes (
T18118 37989-37998 NNP denotes Photoshop
T18117 37983-37988 VBG denotes using
T18107 37929-37930 -RRB- denotes )
T18106 37926-37929 CD denotes 0.5
T18105 37924-37925 SYM denotes =
T18104 37921-37923 NNP denotes NA
T18103 37920-37921 -LRB- denotes (
T18102 37918-37919 NN denotes ×
T18101 37916-37918 CD denotes 10
T18100 37912-37915 CC denotes and
T18099 37910-37911 -RRB- denotes )
T18098 37906-37910 CD denotes 0.04
T18097 37904-37905 SYM denotes =
T18096 37901-37903 NNP denotes NA
T18095 37900-37901 -LRB- denotes (
T18094 37898-37899 NN denotes ×
T18093 37897-37898 CD denotes 1
T18092 37892-37896 VBD denotes were
T18091 37887-37891 VBN denotes used
T18090 37876-37886 NNS denotes Objectives
T18089 37874-37875 . denotes .
T18088 37873-37874 -RRB- denotes )
T18087 37867-37873 NNPS denotes States
T18086 37860-37866 NNP denotes United
T18085 37858-37859 , denotes ,
T18084 37850-37858 NNP denotes Michigan
T18083 37848-37849 , denotes ,
T18082 37841-37848 NNP denotes Heights
T18081 37832-37840 NNP denotes Sterling
T18079 37819-37830 NNP denotes Instruments
T18078 37808-37818 NNP denotes Diagnostic
T18077 37807-37808 -LRB- denotes (
T18076 37800-37806 NN denotes camera
T18075 37792-37799 JJ denotes digital
T18074 37782-37791 JJ denotes RT-Slider
T18073 37777-37781 NNP denotes SPOT
T18072 37773-37776 CC denotes and
T18071 37771-37772 -RRB- denotes )
T18070 37765-37771 NNPS denotes States
T18069 37758-37764 NNP denotes United
T18068 37756-37757 , denotes ,
T18067 37752-37756 NNP denotes York
T18066 37748-37751 NNP denotes New
T18065 37746-37747 , denotes ,
T18064 37738-37746 NNP denotes Melville
T18063 37736-37737 , denotes ,
T18062 37731-37736 NNP denotes Nikon
T18061 37730-37731 -LRB- denotes (
T18060 37719-37729 NN denotes microscope
T18059 37710-37718 NNP denotes Optiphot
T18058 37704-37709 NNP denotes Nikon
T18057 37702-37703 DT denotes a
T18056 37697-37701 IN denotes with
T18055 37688-37696 VBN denotes obtained
T18054 37683-37687 VBD denotes were
T18053 37676-37682 NNS denotes images
T18052 37664-37675 JJ denotes brightfield
T18051 37660-37663 CC denotes and
T18050 37650-37659 NNP denotes Darkfield
T18049 37648-37649 . denotes .
T18048 37645-37648 NNP denotes 33P
T18047 37640-37644 IN denotes with
T18046 37632-37639 VBN denotes labeled
T18045 37625-37631 NNS denotes probes
T17586 36638-36639 , denotes ,
T17585 36628-36638 NNPS denotes Biosystems
T17584 36620-36627 NNP denotes Applied
T17583 36619-36620 -LRB- denotes (
T17582 36611-36618 NNP denotes ABI7000
T17581 36608-36610 DT denotes an
T17580 36605-36607 IN denotes on
T17579 36601-36604 VBN denotes run
T17578 36597-36600 VBD denotes was
T17577 36583-36596 NN denotes amplification
T17576 36579-36582 NNP denotes PCR
T17575 36577-36578 , denotes ,
T17574 36576-36577 -RRB- denotes )
T17573 36570-36576 NNPS denotes States
T17572 36563-36569 NNP denotes United
T17571 36561-36562 , denotes ,
T17570 36551-36561 NNP denotes California
T17569 36549-36550 , denotes ,
T17568 36541-36549 NNP denotes Hercules
T17567 36539-36540 , denotes ,
T17566 36532-36539 NNP denotes Bio-Rad
T17565 36531-36532 -LRB- denotes (
T17564 36527-36530 NNP denotes ROX
T17563 36522-36526 IN denotes with
T17562 36518-36521 NN denotes kit
T17561 36509-36517 NN denotes supermix
T17560 36503-36508 JJ denotes green
T17559 36498-36502 NNP denotes SYBR
T17558 36494-36497 DT denotes the
T17557 36488-36493 VBG denotes Using
T17556 36486-36487 . denotes .
T17555 36485-36486 NN denotes ′
T17554 36464-36485 NNP denotes ACGATCATATTGCCCAGGAG3
T17553 36463-36464 CD denotes ′
T17552 36462-36463 CD denotes 5
T17551 36460-36461 , denotes ,
T17550 36453-36460 NNP denotes MHB1675
T17549 36449-36452 CC denotes and
T17548 36447-36448 : denotes ;
T17547 36446-36447 NN denotes ′
T17546 36425-36446 NNP denotes ATGGCCTGAATCACTTGGAC3
T17545 36424-36425 CD denotes ′
T17544 36423-36424 CD denotes 5
T17543 36421-36422 : denotes :
T17542 36414-36421 NNP denotes MHB1674
T17541 36412-36413 : denotes :
T17540 36406-36412 NN denotes globin
T17539 36402-36405 NN denotes min
T17538 36401-36402 NN denotes /
T17537 36397-36401 JJ denotes βmaj
T17536 36393-36396 IN denotes For
T17535 36391-36392 . denotes .
T17534 36390-36391 NN denotes ′
T17533 36369-36390 NNP denotes ACCTCTGGGGTGAATTCCTT3
T17532 36368-36369 CD denotes ′
T17531 36367-36368 CD denotes 5
T17530 36365-36366 , denotes ,
T17529 36358-36365 NNP denotes MHB1673
T17528 36354-36357 CC denotes and
T17527 36352-36353 : denotes ;
T17526 36351-36352 NN denotes ′
T17525 36330-36351 CD denotes TGGACAACCTCAAGGAGACC3
T17524 36329-36330 CD denotes ′
T17523 36328-36329 CD denotes 5
T17522 36326-36327 , denotes ,
T17521 36319-36326 NNP denotes MHB1672
T17520 36317-36318 : denotes :
T17519 36311-36317 NN denotes globin
T17518 36307-36310 JJ denotes βH1
T17517 36303-36306 IN denotes For
T17516 36301-36302 . denotes .
T17515 36300-36301 NN denotes ′
T17514 36279-36300 CD denotes CTTAACCGCATCCCCTACGG3
T17513 36278-36279 NN denotes ′
T17512 36277-36278 CD denotes 5
T17511 36275-36276 , denotes ,
T17510 36268-36275 NNP denotes MHB1669
T17509 36264-36267 CC denotes and
T17508 36262-36263 : denotes ;
T17507 36261-36262 NN denotes ′
T17506 36239-36261 CD denotes CTACCCCCAGACGAAGACCTA3
T17505 36238-36239 NN denotes ′
T17504 36237-36238 CD denotes 5
T17503 36235-36236 , denotes ,
T17502 36228-36235 CD denotes MHB1668
T17501 36226-36227 : denotes :
T17500 36220-36226 NN denotes globin
T17499 36218-36219 JJ denotes ζ
T17498 36214-36217 IN denotes For
T17497 36212-36213 . denotes .
T17496 36211-36212 NN denotes ′
T17495 36189-36211 NNP denotes GAAGCAGAGGACAAGTTCCCA3
T17494 36188-36189 CD denotes ′
T17493 36187-36188 CD denotes 5
T17492 36185-36186 , denotes ,
T17491 36178-36185 NNP denotes MHB1667
T17490 36174-36177 CC denotes and
T17489 36172-36173 : denotes ;
T17488 36171-36172 NN denotes ′
T17487 36149-36171 CD denotes TGGCCTGTGGAGTAAGGTCAA3
T17486 36148-36149 CD denotes ′
T16996 35885-35886 . denotes .
T16995 35884-35885 -RRB- denotes )
T16994 35882-35884 CD denotes 18
T16993 35881-35882 CD denotes −
T16992 35878-35880 TO denotes to
T16991 35875-35877 CD denotes 63
T16990 35874-35875 FW denotes −
T16989 35873-35874 -LRB- denotes (
T16988 35871-35872 NN denotes ′
T16987 35870-35871 CD denotes 3
T16986 35823-35869 NNP denotes CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA
T16985 35822-35823 NN denotes ′
T17485 36147-36148 CD denotes 5
T17484 36145-36146 , denotes ,
T17483 36138-36145 NNP denotes MHB1666
T17482 36136-36137 : denotes :
T17481 36130-36136 NN denotes globin
T17480 36127-36129 JJ denotes ɛy
T17479 36123-36126 IN denotes For
T17478 36121-36122 . denotes .
T17477 36110-36121 NN denotes specificity
T17476 36102-36109 VB denotes confirm
T17475 36099-36101 TO denotes to
T17474 36090-36098 NN denotes database
T17473 36085-36089 NNP denotes NCBI
T17472 36081-36084 DT denotes the
T17471 36073-36080 IN denotes against
T17470 36064-36072 VBN denotes searched
T17469 36059-36063 VBD denotes were
T17468 36051-36058 NNS denotes primers
T17467 36047-36050 DT denotes All
T17466 36045-36046 . denotes .
T17465 36044-36045 NNP denotes ]
T17464 36042-36044 CD denotes 51
T17463 36041-36042 NNP denotes [
T17462 36030-36040 NNP denotes Primerbank
T17461 36025-36029 IN denotes from
T17460 36016-36024 VBN denotes obtained
T17459 36011-36015 VBD denotes were
T17458 36005-36010 NNS denotes genes
T17457 35998-36004 NN denotes globin
T17456 35995-35997 IN denotes of
T17455 35981-35994 NN denotes amplification
T17454 35977-35980 NNP denotes PCR
T17453 35972-35976 NNP denotes cDNA
T17452 35968-35971 IN denotes for
T17451 35960-35967 NNS denotes Primers
T17450 35958-35959 . denotes .
T17449 35954-35958 NNP denotes cDNA
T17448 35951-35953 TO denotes to
T17447 35939-35950 VBN denotes transcribed
T17446 35931-35938 JJ denotes reverse
T17445 35925-35930 JJ denotes first
T17444 35921-35924 VBD denotes was
T17443 35917-35920 NNP denotes RNA
T17442 35915-35916 . denotes .
T17441 35911-35915 NNP denotes mRNA
T17440 35904-35910 NN denotes globin
T17439 35901-35903 IN denotes of
T17438 35888-35900 NN denotes Quantitation
T16984 35821-35822 CD denotes 5
T16983 35819-35820 , denotes ,
T16982 35812-35819 NNP denotes MHB1663
T16981 35808-35811 CC denotes and
T16980 35806-35807 : denotes ;
T16979 35805-35806 -RRB- denotes )
T16978 35803-35805 CD denotes 16
T16977 35802-35803 CD denotes −
T16976 35799-35801 TO denotes to
T16975 35796-35798 CD denotes 63
T16974 35795-35796 FW denotes −
T16973 35794-35795 -LRB- denotes (
T16972 35792-35793 NN denotes ′
T16971 35744-35792 CD denotes CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3
T16970 35743-35744 NN denotes ′
T16969 35742-35743 CD denotes 5
T16968 35740-35741 , denotes ,
T16967 35733-35740 NNP denotes MHB1662
T16966 35731-35732 : denotes ;
T16965 35730-35731 -RRB- denotes )
T16964 35728-35730 CD denotes 19
T16963 35727-35728 CD denotes −
T16962 35724-35726 TO denotes to
T16961 35721-35723 CD denotes 63
T16960 35720-35721 FW denotes −
T16959 35719-35720 -LRB- denotes (
T16958 35717-35718 NN denotes ′
T16957 35671-35717 CD denotes CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3
T16956 35670-35671 NN denotes ′
T16955 35669-35670 CD denotes 5
T16954 35667-35668 , denotes ,
T16953 35660-35667 CD denotes MHB1661
T16952 35658-35659 : denotes :
T16951 35651-35658 VBP denotes include
T16950 35640-35650 NNS denotes constructs
T16949 35631-35639 NN denotes reporter
T16948 35622-35630 NN denotes promoter
T16947 35619-35621 NN denotes ɛy
T16946 35607-35618 VBN denotes mutagenized
T16945 35601-35606 DT denotes these
T16944 35592-35600 VB denotes generate
T16943 35589-35591 TO denotes to
T16942 35584-35588 VBN denotes used
T16941 35576-35583 NNS denotes primers
T16940 35568-35575 RB denotes Forward
T16939 35566-35567 . denotes .
T16938 35563-35566 NNP denotes PCR
T16937 35560-35562 IN denotes by
T16936 35555-35559 VBN denotes done
T16935 35550-35554 VBD denotes were
T16934 35541-35549 NN denotes promoter
T16933 35538-35540 JJ denotes ɛy
T16932 35534-35537 DT denotes the
T16931 35531-35533 IN denotes of
T16930 35525-35530 NNS denotes sites
T16929 35517-35524 JJ denotes binding
T16928 35507-35516 NN denotes consensus
T16927 35498-35506 NNP denotes Sox/Sox6
T16926 35495-35497 IN denotes of
T16925 35483-35494 NNP denotes Mutagenesis
T16924 35481-35482 . denotes .
T16923 35480-35481 NNP denotes ]
T16922 35478-35480 CD denotes 32
T16921 35477-35478 NNP denotes [
T16920 35470-35476 NNS denotes others
T16919 35467-35469 IN denotes by
T16918 35457-35466 VBN denotes described
T16917 35454-35456 IN denotes as
T16916 35452-35453 , denotes ,
T16915 35443-35452 VBN denotes generated
T16914 35439-35442 VBD denotes was
T16913 35432-35438 NN denotes domain
T16912 35428-35431 NNP denotes HMG
T16911 35424-35427 DT denotes the
T16910 35418-35423 VBZ denotes lacks
T16909 35413-35417 WDT denotes that
T16908 35411-35412 -RRB- denotes )
T16907 35409-35411 CD denotes .1
T16906 35393-35409 JJ denotes Sox6-ΔHMG-pcDNA3
T16905 35392-35393 -LRB- denotes (
T16904 35382-35391 VBP denotes construct
T16903 35367-35381 NN denotes overexpression
T16902 35362-35366 JJ denotes Sox6
T16901 35358-35361 DT denotes the
T16900 35355-35357 IN denotes of
T16899 35347-35354 NN denotes version
T16898 35337-35346 VBN denotes truncated
T16897 35335-35336 DT denotes A
T16896 35333-35334 . denotes .
T16895 35329-35333 NNP denotes Sox6
T16894 35317-35328 VB denotes overexpress
T16893 35314-35316 TO denotes to
T16892 35309-35313 VBN denotes used
T16891 35305-35308 VBD denotes was
T16890 35303-35304 NNP denotes ]
T16889 35301-35303 CD denotes 15
T16888 35300-35301 NNP denotes [
T16887 35297-35299 CD denotes .1
T16886 35286-35297 JJ denotes Sox6-pcDNA3
T16885 35284-35285 . denotes .
T16884 35283-35284 -RRB- denotes )
T16873 35231-35232 : denotes :
T16872 35227-35231 NN denotes site
T16871 35219-35226 NNP denotes HindIII
T16870 35212-35218 NN denotes primer
T16869 35204-35211 NN denotes reverse
T16868 35200-35203 DT denotes the
T16867 35195-35199 IN denotes with
T16866 35183-35194 NN denotes combination
T16865 35180-35182 IN denotes in
T16864 35175-35179 VBN denotes used
T16863 35170-35174 VBD denotes were
T16862 35162-35169 NNS denotes primers
T16861 35154-35161 RB denotes forward
T16860 35150-35153 DT denotes All
T16859 35148-35149 . denotes .
T16858 35147-35148 -RRB- denotes )
T16857 35146-35147 CD denotes 9
T16856 35145-35146 CD denotes −
T16855 35142-35144 TO denotes to
T16854 35139-35141 CD denotes 37
T16853 35138-35139 FW denotes −
T16852 35137-35138 -LRB- denotes (
T16851 35135-35136 NN denotes ′
T16850 35134-35135 CD denotes 3
T16849 35104-35133 NNP denotes CCGCTCGAGGTCTGCGAAGAATAAAAGGC
T16848 35103-35104 NN denotes ′
T16847 35102-35103 CD denotes 5
T16846 35100-35101 , denotes ,
T16845 35093-35100 NNP denotes MHB1507
T16844 35089-35092 CC denotes and
T16843 35087-35088 : denotes ;
T16842 35086-35087 -RRB- denotes )
T16841 35084-35086 CD denotes 34
T16840 35083-35084 CD denotes −
T16839 35080-35082 TO denotes to
T16838 35077-35079 CD denotes 63
T16837 35076-35077 FW denotes −
T16836 35075-35076 -LRB- denotes (
T16835 35073-35074 NN denotes ′
T16834 35042-35073 CD denotes CCGCTCGAGAATGCAGAACAAAGGGTCAGA3
T16833 35041-35042 NN denotes ′
T16832 35040-35041 CD denotes 5
T16831 35038-35039 , denotes ,
T16830 35031-35038 NNP denotes MHB1532
T16829 35029-35030 : denotes ;
T16828 35028-35029 -RRB- denotes )
T16827 35026-35028 CD denotes 58
T16826 35025-35026 CD denotes −
T16825 35022-35024 TO denotes to
T16824 35019-35021 CD denotes 85
T16823 35018-35019 FW denotes −
T16822 35017-35018 -LRB- denotes (
T16821 35015-35016 NN denotes ′
T16820 34986-35015 CD denotes CCGCTCGAGCTGACCAATGGCTTCAAAG3
T16819 34985-34986 NN denotes ′
T16818 34984-34985 CD denotes 5
T16817 34982-34983 , denotes ,
T16816 34975-34982 NNP denotes MHB1506
T16815 34973-34974 : denotes ;
T16814 34972-34973 -RRB- denotes )
T16813 34969-34972 CD denotes 169
T16812 34968-34969 CD denotes −
T16811 34965-34967 TO denotes to
T16810 34961-34964 CD denotes 197
T16809 34960-34961 FW denotes −
T16808 34959-34960 -LRB- denotes (
T16807 34957-34958 NN denotes ′
T16806 34928-34957 CD denotes CCGCTCGAGGGAGCCAAAAAAAGAATGC3
T16805 34927-34928 NN denotes ′
T16804 34926-34927 CD denotes 5
T16803 34924-34925 , denotes ,
T16802 34917-34924 NNP denotes MHB1505
T16801 34915-34916 : denotes ;
T16800 34914-34915 -RRB- denotes )
T16799 34911-34914 CD denotes 605
T16798 34910-34911 CD denotes −
T16797 34907-34909 TO denotes to
T16796 34903-34906 CD denotes 634
T16795 34902-34903 FW denotes −
T16794 34901-34902 -LRB- denotes (
T16793 34899-34900 NN denotes ′
T16792 34868-34899 CD denotes CCGCTCGAGTCTCTACACTGTCACTCCCTG3
T16791 34867-34868 NN denotes ′
T16790 34866-34867 CD denotes 5
T16789 34864-34865 , denotes ,
T16788 34857-34864 NNP denotes MHB1503
T16787 34855-34856 : denotes ;
T16786 34854-34855 -RRB- denotes )
T16785 34850-34854 CD denotes 2052
T16784 34849-34850 CD denotes −
T16783 34846-34848 TO denotes to
T16782 34841-34845 CD denotes 2077
T16781 34840-34841 FW denotes −
T16780 34839-34840 -LRB- denotes (
T16779 34837-34838 NN denotes ′
T16778 34810-34837 CD denotes CCGCTCGAGTGCTAGGCAAACACTCA3
T16777 34809-34810 NN denotes ′
T16776 34808-34809 CD denotes 5
T16775 34806-34807 , denotes ,
T16774 34799-34806 NNP denotes MHB1457
T16773 34797-34798 : denotes :
T16772 34790-34797 VBP denotes include
T16771 34785-34789 NN denotes site
T16770 34780-34784 NNP denotes XhoI
T16769 34777-34779 DT denotes an
T16768 34772-34776 IN denotes with
T16767 34764-34771 NNS denotes primers
T16766 34756-34763 RB denotes Forward
T16765 34754-34755 . denotes .
T16764 34745-34754 RB denotes similarly
T16763 34735-34744 VBN denotes generated
T16762 34730-34734 VBD denotes were
T16761 34721-34729 NN denotes promoter
T16760 34718-34720 JJ denotes ɛy
T16759 34714-34717 DT denotes the
T16758 34711-34713 IN denotes of
T16757 34700-34710 NNS denotes constructs
T16756 34691-34699 NN denotes deletion
T16755 34688-34690 IN denotes of
T16754 34681-34687 NN denotes series
T16753 34679-34680 DT denotes A
T16752 34677-34678 . denotes .
T16751 34669-34677 NN denotes promoter
T16750 34666-34668 JJ denotes ɛy
T16749 34662-34665 DT denotes the
T16748 34659-34661 IN denotes by
T16747 34652-34658 VBN denotes driven
T16746 34649-34651 VBZ denotes is
T16745 34638-34648 NN denotes expression
T16744 34627-34637 NN denotes luciferase
T16743 34621-34626 WDT denotes which
T16742 34618-34620 IN denotes in
T16741 34608-34617 VB denotes construct
T16740 34599-34607 NN denotes reporter
T16739 34597-34598 DT denotes a
T16738 34594-34596 IN denotes in
T16737 34584-34593 VBG denotes resulting
T16736 34582-34583 , denotes ,
T16735 34575-34582 NN denotes plasmid
T16734 34569-34574 JJ denotes Basic
T16733 34564-34568 JJ denotes pGL3
T16732 34558-34563 JJ denotes above
T16731 34554-34557 DT denotes the
T16730 34551-34553 IN denotes in
T16729 34542-34550 NN denotes promoter
T16728 34539-34541 JJ denotes ɛy
T16727 34535-34538 DT denotes the
T16726 34532-34534 IN denotes of
T16725 34523-34531 RB denotes upstream
T16724 34514-34522 VBN denotes inserted
T16723 34509-34513 RB denotes then
T16722 34505-34508 VBD denotes was
T16721 34503-34504 -RRB- denotes )
T16720 34502-34503 NNP denotes ]
T16719 34500-34502 CD denotes 31
T16718 34499-34500 NNP denotes [
T16717 34497-34498 : denotes ;
T16716 34494-34497 NNP denotes LCR
T16715 34488-34493 NN denotes micro
T16714 34487-34488 -LRB- denotes (
T16713 34483-34486 CD denotes 9.3
T16712 34477-34482 NNP denotes μLCRβ
T16711 34474-34476 IN denotes of
T16710 34465-34473 NN denotes fragment
T16709 34455-34464 NNP denotes SstI/XhoI
T16708 34448-34454 JJ denotes 2.5-kb
T16707 34446-34447 DT denotes A
T16706 34444-34445 . denotes .
T16705 34443-34444 -RRB- denotes )
T16704 34437-34443 NNPS denotes States
T16703 34430-34436 NNP denotes United
T16702 34428-34429 , denotes ,
T16701 34419-34428 NNP denotes Wisconsin
T16700 34417-34418 , denotes ,
T16699 34410-34417 NNP denotes Madison
T16698 34408-34409 , denotes ,
T16697 34401-34408 NNP denotes Promega
T16696 34400-34401 -LRB- denotes (
T16695 34394-34399 NNP denotes Basic
T16694 34389-34393 NNP denotes pGL3
T16693 34386-34388 IN denotes in
T16692 34381-34385 NN denotes gene
T16691 34370-34380 NN denotes luciferase
T16690 34362-34369 JJ denotes firefly
T16689 34358-34361 DT denotes the
T16688 34355-34357 IN denotes of
T16687 34346-34354 RB denotes upstream
T16686 34337-34345 NN denotes fragment
T16685 34328-34336 NN denotes promoter
T16684 34325-34327 JJ denotes ɛy
T16683 34321-34324 DT denotes the
T16682 34315-34320 VB denotes clone
T16681 34312-34314 TO denotes to
T16680 34307-34311 VBN denotes used
T16679 34302-34306 VBD denotes were
T16678 34297-34301 WDT denotes that
T16677 34291-34296 NNS denotes sites
T16676 34283-34290 NNP denotes HindIII
T16675 34279-34282 CC denotes and
T16674 34274-34278 NNP denotes XhoI
T16673 34264-34273 VBD denotes contained
T16672 34256-34263 NNS denotes primers
T16671 34252-34255 NNP denotes PCR
T16670 34248-34251 DT denotes The
T16669 34246-34247 . denotes .
T16668 34238-34246 NN denotes database
T16667 34236-34237 -RRB- denotes )
T16666 34231-34236 NNP denotes Mouse
T16665 34228-34230 IN denotes of
T16664 34217-34227 NNP denotes Annotation
T16663 34206-34216 NNP denotes Functional
T16662 34205-34206 -LRB- denotes (
T16661 34198-34204 NNP denotes Fantom
T16660 34194-34197 DT denotes the
T16659 34191-34193 IN denotes in
T16658 34186-34190 NN denotes cDNA
T16635 34059-34060 NNP denotes [
T16634 34054-34058 NN denotes site
T16633 34050-34053 NN denotes cap
T16632 34045-34049 NN denotes gene
T16631 34038-34044 NN denotes globin
T16630 34036-34037 NN denotes ɛ
T16629 34032-34035 DT denotes the
T16628 34029-34031 IN denotes of
T16627 34020-34028 RB denotes upstream
T16626 34011-34019 NN denotes sequence
T16625 34008-34010 IN denotes of
T16624 34005-34007 NN denotes kb
T16623 34003-34004 CD denotes 2
T16622 33997-34002 IN denotes about
T16621 33986-33996 VBG denotes containing
T16620 33977-33985 NN denotes fragment
T16619 33971-33976 NNP denotes EcoRI
T16618 33964-33970 JJ denotes 3.7-kb
T16617 33962-33963 DT denotes a
T16616 33955-33961 IN denotes within
T16615 33947-33954 VBN denotes located
T16614 33943-33946 VBP denotes are
T16613 33933-33942 VBG denotes silencing
T16612 33928-33932 NN denotes gene
T16611 33926-33927 NN denotes ɛ
T16610 33922-33925 IN denotes for
T16609 33913-33921 VBN denotes required
T16608 33903-33912 NNS denotes sequences
T16607 33899-33902 DT denotes all
T16606 33894-33898 IN denotes that
T16605 33888-33893 VBN denotes shown
T16604 33883-33887 VBN denotes been
T16603 33879-33882 VBZ denotes has
T16602 33876-33878 PRP denotes it
T16601 33868-33875 IN denotes because
T16600 33866-33867 , denotes ,
T16599 33862-33866 VBN denotes used
T16598 33858-33861 VBD denotes was
T16597 33856-33857 -RRB- denotes )
T16596 33853-33856 NNP denotes ATG
T16595 33852-33853 -LRB- denotes (
T16594 33846-33851 NN denotes codon
T16593 33835-33845 NN denotes initiation
T16592 33828-33834 NN denotes globin
T16591 33825-33827 JJ denotes ɛy
T16590 33821-33824 DT denotes the
T16589 33818-33820 IN denotes of
T16588 33809-33817 RB denotes upstream
T16587 33800-33808 NN denotes fragment
T16586 33793-33799 JJ denotes 2.2-kb
T16585 33791-33792 DT denotes A
T16584 33789-33790 . denotes .
T16583 33781-33789 NN denotes promoter
T16582 33772-33780 JJ denotes proximal
T16581 33769-33771 JJ denotes ɛy
T16580 33765-33768 DT denotes the
T16579 33762-33764 IN denotes of
T16578 33748-33761 NN denotes amplification
T16577 33744-33747 NNP denotes PCR
T16576 33741-33743 IN denotes by
T16575 33731-33740 VBN denotes generated
T16574 33727-33730 VBD denotes was
T16573 33725-33726 -RRB- denotes )
T16572 33720-33725 JJ denotes E-luc
T16571 33719-33720 -LRB- denotes (
T16570 33711-33718 NN denotes plasmid
T16569 33702-33710 NN denotes reporter
T16568 33693-33701 NN denotes deletion
T16567 33684-33692 NN denotes promoter
T16566 33681-33683 JJ denotes ɛy
T16565 33677-33680 DT denotes The
T16564 33675-33676 . denotes .
T16563 33663-33675 NN denotes construction
T16562 33655-33662 JJ denotes Plasmid
T16883 35280-35283 CD denotes +20
T16882 35277-35279 TO denotes to
T16881 35273-35276 CD denotes +45
T16880 35272-35273 -LRB- denotes (
T16879 35270-35271 NN denotes ′
T16878 35244-35270 CD denotes CGGAAGCTTGGGAGGTTGCTGGTGA3
T16877 35243-35244 NN denotes ′
T16876 35242-35243 CD denotes 5
T16875 35240-35241 , denotes ,
T16874 35233-35240 NNP denotes MHB1477
T16657 34178-34185 JJS denotes longest
T16656 34174-34177 DT denotes the
T16655 34171-34173 IN denotes on
T16654 34165-34170 VBN denotes based
T16653 34162-34164 VBZ denotes is
T16652 34157-34161 NN denotes site
T16651 34151-34156 NN denotes start
T16650 34135-34150 JJ denotes transcriptional
T16649 34131-34134 DT denotes The
T16648 34129-34130 . denotes .
T16647 34125-34129 NN denotes site
T16646 34119-34124 VB denotes start
T16645 34105-34118 NN denotes transcription
T16644 34101-34104 DT denotes the
T16643 34098-34100 TO denotes to
T16642 34089-34097 JJ denotes relative
T16641 34086-34088 VBZ denotes is
T16640 34076-34085 NN denotes numbering
T16639 34065-34075 NNP denotes Nucleotide
T16638 34063-34064 . denotes .
T16637 34062-34063 NNP denotes ]
T16636 34060-34062 CD denotes 50
T15289 33617-33629 NNS denotes thalassemias
T15288 33615-33616 NN denotes β
T15287 33611-33614 CC denotes and
T15286 33604-33610 NN denotes anemia
T15285 33599-33603 NN denotes cell
T15284 33592-33598 NN denotes sickle
T15283 33589-33591 IN denotes of
T15282 33579-33588 NN denotes treatment
T15281 33575-33578 DT denotes the
T15280 33571-33574 IN denotes for
T15279 33563-33570 NNS denotes targets
T15278 33553-33562 JJ denotes molecular
T15277 33542-33552 JJ denotes additional
T15276 33535-33541 VB denotes reveal
T15275 33523-33534 RB denotes potentially
T15274 33519-33522 CC denotes and
T15273 33508-33518 NN denotes regulation
T15272 33501-33507 NN denotes globin
T15271 33499-33500 NN denotes ɛ
T15270 33496-33498 IN denotes of
T15269 33482-33495 NN denotes understanding
T15268 33478-33481 PRP$ denotes our
T15267 33470-33477 RB denotes further
T15266 33466-33469 MD denotes may
T15265 33458-33465 NN denotes complex
T15264 33442-33457 JJ denotes Sox6-containing
T15263 33438-33441 DT denotes the
T15262 33435-33437 IN denotes of
T15261 33424-33434 NNS denotes components
T15260 33418-33423 JJ denotes other
T15259 33415-33417 IN denotes of
T15258 33400-33414 NN denotes identification
T15257 33396-33399 CC denotes and
T15256 33386-33395 NN denotes mechanism
T15255 33375-33385 NN denotes repression
T15254 33370-33374 JJ denotes Sox6
T15253 33366-33369 DT denotes the
T15252 33363-33365 IN denotes of
T15251 33351-33362 NN denotes elucidation
T15250 33349-33350 , denotes ,
T15249 33345-33349 RB denotes Thus
T15248 33343-33344 . denotes .
T15247 33342-33343 NNP denotes ]
T15246 33337-33342 CD denotes 49,50
T15245 33336-33337 NNP denotes [
T15244 33327-33335 VBN denotes proposed
T15243 33322-33326 VBN denotes been
T15242 33318-33321 VBZ denotes has
T15241 33313-33317 NN denotes gene
T15240 33306-33312 NN denotes globin
T15239 33304-33305 NN denotes ɛ
T15238 33298-33303 JJ denotes human
T15237 33294-33297 DT denotes the
T15236 33291-33293 IN denotes of
T15235 33282-33290 NN denotes silencer
T15234 33280-33281 DT denotes a
T15233 33277-33279 IN denotes of
T15232 33267-33276 NN denotes existence
T15231 33263-33266 DT denotes the
T15230 33261-33262 , denotes ,
T15229 33255-33261 RB denotes Indeed
T15228 33253-33254 . denotes .
T15227 33248-33253 NNS denotes sites
T15226 33240-33247 JJ denotes binding
T15225 33235-33239 JJ denotes Sox6
T15224 33225-33234 JJ denotes potential
T15223 33221-33224 CD denotes two
T15222 33215-33220 JJS denotes least
T15221 33212-33214 IN denotes at
T15220 33203-33211 VBZ denotes contains
T15219 33194-33202 NN denotes promoter
T15218 33188-33193 JJ denotes human
T15217 33184-33187 DT denotes the
T15216 33180-33183 CC denotes and
T15215 33178-33179 , denotes ,
T15214 33171-33178 NNS denotes regions
T15213 33162-33170 NN denotes promoter
T15212 33160-33161 NN denotes ɛ
T15211 33154-33159 NN denotes mouse
T15210 33150-33153 CC denotes and
T15209 33144-33149 JJ denotes human
T15208 33140-33143 DT denotes the
T15207 33132-33139 IN denotes between
T15206 33123-33131 NN denotes homology
T15205 33114-33122 NN denotes sequence
T15204 33102-33113 JJ denotes significant
T15203 33099-33101 VBZ denotes is
T15202 33093-33098 EX denotes There
T15201 33091-33092 . denotes .
T15200 33082-33091 VBG denotes silencing
T15199 33075-33081 NN denotes globin
T15198 33073-33074 NN denotes ɛ
T15197 33067-33072 JJ denotes human
T15196 33064-33066 IN denotes in
T15100 32524-32527 CC denotes and
T15099 32519-32523 NN denotes vivo
T15098 32516-32518 IN denotes in
T15097 32514-32515 , denotes ,
T15096 32506-32514 RB denotes Recently
T15095 32504-32505 . denotes .
T15094 32497-32504 NN denotes process
T15093 32485-32496 NN denotes enucleation
T15092 32481-32484 DT denotes the
T15091 32477-32480 CC denotes and
T15090 32461-32476 NN denotes differentiation
T15089 32452-32460 NN denotes terminal
T15088 32447-32451 NN denotes cell
T15087 32443-32446 JJ denotes red
T15086 32440-32442 IN denotes in
T15085 32435-32439 NNP denotes Sox6
T15084 32432-32434 IN denotes of
T15083 32427-32431 NN denotes role
T15082 32423-32426 DT denotes the
T15081 32420-32422 IN denotes on
T15080 32414-32419 NN denotes light
T15079 32409-32413 VB denotes shed
T15078 32404-32408 MD denotes will
T15077 32395-32403 NNS denotes proteins
T15076 32383-32394 VBG denotes interacting
T15075 32379-32382 PRP$ denotes its
T15074 32375-32378 CC denotes and
T15073 32369-32374 NNS denotes genes
T15072 32362-32368 NN denotes target
T15071 32351-32361 JJ denotes downstream
T15070 32346-32350 JJ denotes Sox6
T15069 32343-32345 IN denotes of
T15068 32328-32342 NN denotes Identification
T15067 32326-32327 . denotes .
T15066 32315-32326 NN denotes enucleation
T15065 32308-32314 JJ denotes normal
T15064 32301-32307 VB denotes permit
T15063 32297-32300 MD denotes may
T15062 32286-32296 NN denotes production
T15061 32281-32285 NN denotes cell
T15060 32277-32280 JJ denotes red
T15059 32274-32276 IN denotes of
T15058 32257-32273 NN denotes microenvironment
T15057 32253-32256 DT denotes the
T15056 32250-32252 IN denotes in
T15055 32243-32249 NN denotes change
T15054 32230-32242 JJ denotes accompanying
T15053 32226-32229 DT denotes The
T15052 32224-32225 . denotes .
T15051 32220-32224 CD denotes 10.5
T15050 32216-32219 NN denotes day
T15049 32206-32215 JJ denotes postnatal
T15048 32203-32205 IN denotes by
T15047 32196-32202 NN denotes marrow
T15046 32191-32195 NN denotes bone
T15045 32188-32190 TO denotes to
T15044 32182-32187 NN denotes liver
T15043 32176-32181 JJ denotes fetal
T15042 32171-32175 IN denotes from
T15041 32163-32170 VBN denotes shifted
T15040 32155-32162 RB denotes already
T15039 32151-32154 VBZ denotes has
T15038 32136-32150 NN denotes erythropoiesis
T15037 32134-32135 , denotes ,
T15036 32126-32134 RB denotes Moreover
T15035 32124-32125 . denotes .
T15034 32123-32124 NNP denotes ]
T15033 32115-32123 CD denotes 13,45,46
T15032 32114-32115 NNP denotes [
T15031 32105-32113 NNS denotes proteins
T15030 32101-32104 NNP denotes Sox
T15029 32096-32100 IN denotes with
T15028 32090-32095 NN denotes theme
T15027 32080-32089 VBG denotes recurring
T15026 32078-32079 DT denotes a
T15025 32075-32077 VBZ denotes is
T15024 32064-32074 NN denotes redundancy
T15023 32053-32063 JJ denotes functional
T15022 32047-32052 IN denotes since
T15021 32045-32046 , denotes ,
T15020 32044-32045 -RRB- denotes )
T15019 32038-32044 NNS denotes stages
T15018 32024-32037 JJ denotes developmental
T15017 32018-32023 JJ denotes later
T15016 32015-32017 IN denotes at
T15015 32005-32014 VBN denotes expressed
T15014 32004-32005 -LRB- denotes (
T15013 31995-32003 NNS denotes proteins
T15012 31991-31994 NNP denotes Sox
T15011 31985-31990 JJ denotes other
T15010 31982-31984 IN denotes of
T15009 31969-31981 NN denotes compensation
T15008 31958-31968 JJ denotes functional
T15007 31953-31957 IN denotes from
T15006 31946-31952 VB denotes result
T15005 31942-31945 MD denotes may
T15004 31937-31941 CD denotes 10.5
T15003 31933-31936 NN denotes day
T15002 31923-31932 JJ denotes postnatal
T15001 31920-31922 IN denotes by
T15000 31914-31919 NN denotes mouse
T14999 31899-31913 JJ denotes Sox6-deficient
T14998 31896-31898 IN denotes in
T14997 31890-31895 NNS denotes cells
T14996 31886-31889 JJ denotes red
T14995 31883-31885 IN denotes of
T14994 31871-31882 NN denotes enucleation
T14993 31864-31870 JJ denotes normal
T14992 31861-31863 IN denotes of
T14991 31849-31860 NN denotes restoration
T14990 31845-31848 DT denotes The
T14989 31843-31844 . denotes .
T14988 31842-31843 NN denotes ]
T14987 31840-31842 CD denotes 44
T14986 31834-31839 CD denotes 32,41
T14985 31833-31834 NNP denotes [
T14984 31824-31832 NNS denotes programs
T14983 31808-31823 NN denotes differentiation
T14982 31798-31807 NN denotes cartilage
T14981 31794-31797 CC denotes and
T14980 31792-31793 , denotes ,
T14979 31791-31792 NNP denotes ]
T14978 31789-31791 CD denotes 11
T14977 31788-31789 NNP denotes [
T14976 31777-31787 JJ denotes astrocytic
T14975 31775-31776 , denotes ,
T14974 31774-31775 NNP denotes ]
T14973 31772-31774 CD denotes 10
T14972 31771-31772 NNP denotes [
T14971 31762-31770 JJ denotes neuronal
T14970 31760-31761 , denotes ,
T14969 31759-31760 NNP denotes ]
T14968 31757-31759 CD denotes 15
T14967 31756-31757 NNP denotes [
T14966 31748-31755 JJ denotes cardiac
T14965 31745-31747 IN denotes in
T14964 31738-31744 NN denotes factor
T14963 31728-31737 JJ denotes important
T14962 31725-31727 DT denotes an
T14961 31722-31724 VB denotes be
T14960 31719-31721 TO denotes to
T14959 31713-31718 VBN denotes shown
T14958 31708-31712 VBN denotes been
T14957 31704-31707 VBZ denotes has
T14956 31701-31703 PRP denotes it
T14955 31698-31700 IN denotes as
T14954 31696-31697 , denotes ,
T14953 31681-31696 NN denotes differentiation
T14952 31672-31680 NN denotes terminal
T14951 31667-31671 NN denotes cell
T14950 31663-31666 JJ denotes red
T14949 31660-31662 IN denotes in
T14948 31655-31659 NN denotes role
T14947 31653-31654 DT denotes a
T14946 31648-31652 VB denotes play
T14945 31644-31647 MD denotes may
T14944 31637-31643 PRP denotes itself
T14943 31632-31636 JJ denotes Sox6
T14942 31630-31631 , denotes ,
T14941 31617-31630 RB denotes Alternatively
T14940 31615-31616 . denotes .
T14939 31610-31615 NNS denotes cells
T14938 31606-31609 JJ denotes red
T14937 31596-31605 JJ denotes nucleated
T14936 31593-31595 IN denotes of
T14935 31586-31592 NN denotes extent
T14934 31582-31585 DT denotes the
T14933 31574-31581 VB denotes explain
T14932 31571-31573 TO denotes to
T14931 31560-31570 JJ denotes sufficient
T14930 31556-31559 RB denotes not
T14929 31547-31555 RB denotes probably
T14928 31544-31546 VBZ denotes is
T14927 31537-31543 NN denotes anemia
T14926 31532-31536 JJ denotes mild
T14925 31527-31531 DT denotes this
T14924 31523-31526 CC denotes and
T14923 31521-31522 , denotes ,
T14922 31520-31521 -RRB- denotes )
T14921 31516-31520 NNS denotes data
T14920 31504-31515 JJ denotes unpublished
T14919 31503-31504 -LRB- denotes (
T14918 31500-31502 NNP denotes WT
T14917 31497-31499 IN denotes of
T14916 31492-31496 DT denotes that
T14915 31487-31491 IN denotes than
T14801 30826-30827 CD denotes 1
T14800 30819-30825 NN denotes Figure
T14799 30818-30819 -LRB- denotes (
T14798 30814-30817 NN denotes dpc
T14797 30809-30813 CD denotes 18.5
T14796 30806-30808 IN denotes at
T14795 30798-30805 VBP denotes observe
T14794 30795-30797 PRP denotes we
T14793 30790-30794 WP denotes what
T14792 30787-30789 TO denotes to
T14791 30779-30786 JJ denotes similar
T14790 30777-30778 , denotes ,
T14789 30776-30777 -RRB- denotes )
T14788 30772-30776 NNS denotes data
T14787 30760-30771 JJ denotes unpublished
T14786 30759-30760 -LRB- denotes (
T14785 30756-30758 NNP denotes WT
T14784 30751-30755 IN denotes with
T14783 30742-30750 VBN denotes compared
T14782 30738-30741 NNP denotes RNA
T14781 30731-30737 JJ denotes mutant
T14780 30727-30730 DT denotes the
T14779 30724-30726 IN denotes in
T14778 30715-30723 VBN denotes elevated
T14777 30704-30714 RB denotes moderately
T14776 30699-30703 VBD denotes were
T14775 30692-30698 NNS denotes levels
T14774 30688-30691 NNP denotes RNA
T14773 30681-30687 NN denotes globin
T14772 30674-30680 JJ denotes β-like
T14771 30668-30673 NN denotes adult
T14770 30666-30667 , denotes ,
T14769 30659-30666 RB denotes however
T14768 30657-30658 : denotes ;
T14767 30655-30657 NNP denotes WT
T14766 30651-30654 CC denotes and
T14765 30644-30650 JJ denotes mutant
T14764 30641-30643 IN denotes in
T14763 30636-30640 DT denotes both
T14762 30623-30635 JJ denotes undetectable
T14761 30618-30622 VBD denotes were
T14760 30614-30617 NNP denotes RNA
T14759 30610-30613 CD denotes βh1
T14758 30606-30609 CC denotes and
T14757 30604-30605 NN denotes ζ
T14756 30601-30603 IN denotes of
T14755 30594-30600 NNS denotes levels
T14754 30590-30593 DT denotes the
T14753 30588-30589 , denotes ,
T14752 30577-30588 NN denotes development
T14751 30574-30576 IN denotes in
T14750 30568-30573 NN denotes point
T14749 30563-30567 DT denotes this
T14748 30560-30562 IN denotes At
T14747 30558-30559 . denotes .
T14746 30554-30558 NNS denotes mice
T14745 30546-30553 NN denotes control
T14744 30543-30545 NNP denotes WT
T14743 30540-30542 IN denotes in
T14742 30536-30539 NNP denotes RNA
T14741 30533-30535 NN denotes ɛy
T14740 30520-30532 JJ denotes undetectable
T14739 30515-30519 IN denotes with
T14738 30506-30514 VBN denotes compared
T14737 30504-30505 , denotes ,
T14736 30498-30504 NN denotes sample
T14735 30494-30497 NNP denotes RNA
T14734 30489-30493 DT denotes this
T14733 30486-30488 IN denotes in
T14732 30479-30485 NN denotes globin
T14731 30476-30478 JJ denotes ɛy
T14730 30473-30475 IN denotes of
T14729 30466-30472 NNS denotes levels
T14728 30461-30465 JJ denotes high
T14727 30452-30460 VBD denotes detected
T14726 30448-30451 CC denotes and
T14725 30437-30447 NN denotes expression
T14724 30432-30436 NN denotes gene
T14723 30425-30431 NN denotes globin
T14722 30421-30424 IN denotes for
T14721 30416-30420 CD denotes 13.5
T14720 30412-30415 NN denotes day
T14719 30402-30411 JJ denotes postnatal
T14718 30399-30401 IN denotes on
T14717 30393-30398 NN denotes mouse
T14716 30386-30392 JJ denotes mutant
T14715 30384-30385 DT denotes a
T14714 30379-30383 IN denotes from
T14713 30375-30378 NNP denotes RNA
T14712 30369-30374 NN denotes liver
T14711 30366-30368 IN denotes of
T14710 30359-30365 NN denotes sample
T14709 30350-30358 JJ denotes archived
T14708 30343-30349 JJ denotes single
T14707 30341-30342 DT denotes a
T14706 30332-30340 VBD denotes examined
T14705 30329-30331 PRP denotes We
T14704 30327-30328 . denotes .
T14703 30326-30327 NNP denotes ]
T14702 30324-30326 CD denotes 14
T14701 30323-30324 NNP denotes [
T14700 30317-30322 NN denotes birth
T14699 30311-30316 IN denotes after
T14698 30308-30310 NN denotes wk
T14697 30306-30307 CD denotes 2
T14696 30301-30305 IN denotes than
T14695 30294-30300 JJR denotes longer
T14694 30289-30293 VB denotes live
T14693 30286-30288 TO denotes to
T14692 30277-30285 VBN denotes observed
T14691 30272-30276 VBN denotes been
T14690 30267-30271 VBP denotes have
T14689 30262-30266 NN denotes None
T14688 30260-30261 . denotes .
T14687 30254-30260 RBR denotes longer
T15195 33054-33063 JJ denotes important
T15194 33051-33053 VB denotes be
T15193 33046-33050 RB denotes also
T15192 33042-33045 MD denotes may
T15191 33037-33041 NNP denotes Sox6
T15190 33031-33036 JJ denotes human
T15189 33026-33030 IN denotes that
T15188 33017-33025 JJ denotes possible
T15187 33014-33016 VBZ denotes is
T15186 33011-33013 PRP denotes it
T15185 33009-33010 , denotes ,
T15184 33008-33009 NNP denotes ]
T15183 33006-33008 CD denotes 48
T15182 33005-33006 NNP denotes [
T15181 32999-33004 NN denotes level
T15180 32994-32998 NN denotes acid
T15179 32988-32993 JJ denotes amino
T15178 32984-32987 DT denotes the
T15177 32981-32983 IN denotes at
T15176 32971-32980 JJ denotes identical
T15175 32969-32970 NN denotes %
T15174 32967-32969 CD denotes 94
T15173 32963-32966 VBP denotes are
T15172 32951-32962 NN denotes counterpart
T15171 32945-32950 JJ denotes human
T15170 32941-32944 PRP$ denotes its
T15169 32937-32940 CC denotes and
T15168 32932-32936 NNP denotes Sox6
T15167 32925-32931 JJ denotes murine
T15166 32917-32924 IN denotes Because
T15165 32915-32916 . denotes .
T15164 32908-32915 NN denotes complex
T15163 32897-32907 NN denotes repression
T15162 32890-32896 JJR denotes larger
T15161 32888-32889 DT denotes a
T15160 32885-32887 IN denotes of
T15159 32880-32884 NN denotes part
T15158 32877-32879 IN denotes as
T15157 32865-32876 RB denotes potentially
T15156 32863-32864 , denotes ,
T15155 32855-32863 NN denotes promoter
T15154 32846-32854 JJ denotes proximal
T15153 32843-32845 JJ denotes ɛy
T15152 32839-32842 DT denotes the
T15151 32836-32838 TO denotes to
T15150 32830-32835 VBZ denotes binds
T15149 32824-32829 WDT denotes which
T15148 32822-32823 , denotes ,
T15147 32818-32822 NNP denotes Sox6
T14686 30246-30253 VBP denotes survive
T14685 30242-30245 JJ denotes few
T14684 30237-30241 JJ denotes rare
T14683 30235-30236 DT denotes a
T14682 30233-30234 , denotes ,
T14681 30229-30233 VBN denotes born
T14680 30223-30228 VBG denotes being
T14679 30217-30222 IN denotes after
T14678 30212-30216 RB denotes just
T14677 30208-30211 VBP denotes die
T14676 30203-30207 NNS denotes mice
T14675 30196-30202 JJ denotes mutant
T14674 30190-30195 JJ denotes p100H
T14673 30185-30189 JJS denotes most
T14672 30176-30184 IN denotes Although
T14671 30174-30175 . denotes .
T14670 30172-30174 NN denotes ɛy
T14669 30162-30171 VBG denotes silencing
T14668 30159-30161 IN denotes in
T14667 30154-30158 NN denotes role
T14666 30145-30153 JJ denotes specific
T14665 30143-30144 DT denotes a
T14664 30140-30142 TO denotes to
T14663 30131-30139 NN denotes addition
T14662 30128-30130 IN denotes in
T14661 30126-30127 -RRB- denotes )
T14660 30116-30126 NN denotes maturation
T14659 30104-30115 JJ denotes erythrocyte
T14658 30100-30103 CC denotes and
T14657 30099-30100 -LRB- denotes (
T14656 30093-30098 NNS denotes genes
T14655 30086-30092 NN denotes globin
T14654 30076-30085 JJ denotes embryonic
T14653 30073-30075 IN denotes on
T14652 30066-30072 NN denotes effect
T14651 30058-30065 JJ denotes general
T14650 30056-30057 DT denotes a
T14649 30052-30055 VBZ denotes has
T14648 30047-30051 NNP denotes Sox6
T14647 30042-30046 IN denotes that
T14646 30033-30041 JJ denotes possible
T14645 30030-30032 VBZ denotes is
T14644 30027-30029 PRP denotes It
T14643 30025-30026 . denotes .
T14642 30022-30025 VB denotes βh1
T14641 30018-30021 CC denotes and
T14640 30016-30017 VB denotes ζ
T14639 30011-30015 IN denotes than
T14638 29999-30010 RB denotes differently
T14637 29989-29998 VBN denotes regulated
T14636 29986-29988 VBZ denotes is
T14635 29983-29985 NN denotes ɛy
T14634 29978-29982 IN denotes that
T14633 29967-29977 VBG denotes suggesting
T14632 29965-29966 , denotes ,
T14631 29964-29965 -RRB- denotes )
T14630 29963-29964 CD denotes 1
T14629 29956-29962 NN denotes Figure
T14628 29955-29956 -LRB- denotes (
T14627 29951-29954 NN denotes dpc
T14626 29946-29950 CD denotes 18.5
T14625 29942-29945 NN denotes day
T14624 29939-29941 IN denotes by
T14623 29928-29938 NN denotes expression
T14622 29925-29927 IN denotes in
T14621 29917-29924 NN denotes decline
T14620 29913-29916 JJ denotes βh1
T14619 29909-29912 CC denotes and
T14618 29907-29908 NN denotes ζ
T14617 29905-29906 , denotes ,
T14616 29899-29905 NN denotes globin
T14615 29896-29898 JJ denotes ɛy
T14614 29889-29895 IN denotes unlike
T14613 29887-29888 , denotes ,
T14612 29880-29887 RB denotes However
T14611 29878-29879 . denotes .
T14610 29875-29878 NN denotes dpc
T14609 29870-29874 CD denotes 15.5
T14608 29867-29869 IN denotes at
T14607 29862-29866 NNS denotes mice
T14606 29855-29861 JJ denotes mutant
T14605 29852-29854 IN denotes in
T14604 29845-29851 JJR denotes higher
T14603 29832-29844 RB denotes dramatically
T14602 29828-29831 VBP denotes are
T14601 29824-29827 CD denotes βh1
T14600 29820-29823 CC denotes and
T14599 29818-29819 NN denotes ζ
T14598 29815-29817 IN denotes of
T14597 29808-29814 NNS denotes levels
T14596 29806-29807 , denotes ,
T14595 29804-29806 VB denotes ɛy
T14594 29799-29803 IN denotes Like
T14593 29797-29798 . denotes .
T14592 29795-29797 NNP denotes WT
T14591 29790-29794 IN denotes with
T14590 29781-29789 VBN denotes compared
T14589 29779-29780 , denotes ,
T14588 29768-29779 NNS denotes homozygotes
T14587 29762-29767 JJ denotes p100H
T14586 29759-29761 IN denotes in
T14499 29282-29284 IN denotes in
T14498 29272-29281 NNS denotes functions
T14497 29267-29271 JJ denotes Sox6
T14496 29262-29266 IN denotes that
T14495 29250-29261 VBP denotes demonstrate
T14494 29245-29249 NNS denotes data
T14493 29239-29244 DT denotes these
T14492 29237-29238 , denotes ,
T14491 29229-29237 RB denotes together
T14490 29223-29228 VBN denotes Taken
T14489 29221-29222 . denotes .
T14488 29220-29221 -RRB- denotes )
T14487 29219-29220 CD denotes 5
T14486 29212-29218 NN denotes Figure
T14485 29211-29212 -LRB- denotes (
T14484 29205-29210 NN denotes liver
T14483 29201-29204 DT denotes the
T14482 29198-29200 IN denotes in
T14481 29192-29197 NN denotes place
T14480 29186-29191 VBZ denotes takes
T14479 29181-29185 WDT denotes that
T14478 29166-29180 NNS denotes erythropoiesis
T14477 29155-29165 JJ denotes definitive
T14476 29152-29154 IN denotes of
T14475 29142-29151 NN denotes mechanism
T14474 29132-29141 VBG denotes silencing
T14473 29128-29131 DT denotes the
T14472 29125-29127 IN denotes in
T14471 29117-29124 NNS denotes defects
T14470 29114-29116 TO denotes to
T14469 29110-29113 JJ denotes due
T14468 29107-29109 VBZ denotes is
T14467 29102-29106 NNS denotes mice
T14466 29095-29101 JJ denotes mutant
T14465 29089-29094 JJ denotes p100H
T14464 29086-29088 IN denotes in
T14463 29079-29085 NN denotes globin
T14462 29076-29078 JJ denotes ɛy
T14461 29073-29075 IN denotes of
T14460 29062-29072 NN denotes expression
T14459 29051-29061 JJ denotes persistent
T14458 29047-29050 DT denotes the
T14457 29042-29046 IN denotes that
T14456 29036-29041 VBZ denotes shows
T14455 29028-29035 RB denotes clearly
T14454 29014-29027 NN denotes hybridization
T14453 29009-29013 NN denotes situ
T14452 29006-29008 IN denotes in
T14451 29004-29005 , denotes ,
T14450 28996-29004 RB denotes Moreover
T14449 28994-28995 . denotes .
T14448 28993-28994 -RRB- denotes )
T14447 28992-28993 CD denotes 2
T14446 28985-28991 NN denotes Figure
T14445 28984-28985 -LRB- denotes (
T14444 28978-28983 NN denotes vitro
T14443 28975-28977 IN denotes in
T14442 28971-28974 CC denotes and
T14441 28969-28970 -RRB- denotes )
T14440 28968-28969 CD denotes 1
T14439 28961-28967 NN denotes Figure
T14438 28960-28961 -LRB- denotes (
T14437 28955-28959 NN denotes vivo
T14436 28952-28954 IN denotes in
T14435 28947-28951 DT denotes both
T14434 28936-28946 NN denotes expression
T14433 28929-28935 NN denotes globin
T14432 28926-28928 JJ denotes ɛy
T14431 28916-28925 VBZ denotes represses
T14430 28911-28915 NNP denotes Sox6
T14429 28907-28910 CC denotes and
T14428 28905-28906 , denotes ,
T14427 28904-28905 -RRB- denotes )
T14426 28903-28904 CD denotes 6
T14425 28896-28902 NN denotes Figure
T14424 28895-28896 -LRB- denotes (
T14423 28880-28894 VBZ denotes erythropoiesis
T14422 28878-28879 -RRB- denotes )
T14421 28869-28878 JJ denotes primitive
T14420 28865-28868 RB denotes not
T14419 28861-28864 CC denotes but
T14418 28860-28861 -LRB- denotes (
T14417 28849-28859 JJ denotes definitive
T14416 28844-28848 IN denotes with
T14415 28833-28843 JJ denotes coincident
T14414 28823-28832 RB denotes spatially
T14413 28819-28822 CC denotes and
T14412 28808-28818 RB denotes temporally
T14411 28805-28807 VBZ denotes is
T14410 28794-28804 NN denotes expression
T14409 28789-28793 JJ denotes Sox6
T14408 28787-28788 . denotes .
T14407 28786-28787 NNP denotes ]
T14406 28784-28786 CD denotes 40
T14405 28783-28784 NNP denotes [
T14404 28772-28782 NNS denotes repressors
T14403 28766-28771 JJ denotes other
T14402 28763-28765 IN denotes of
T14401 28755-28762 JJ denotes binding
T14400 28751-28754 DT denotes the
T14399 28738-28750 VBG denotes facilitating
T14398 28736-28737 , denotes ,
T14397 28733-28736 NNP denotes DNA
T14396 28729-28732 DT denotes the
T14395 28726-28728 IN denotes of
T14394 28718-28725 VBG denotes bending
T14393 28712-28717 VB denotes cause
T14392 28708-28711 CC denotes and
T14391 28706-28707 -RRB- denotes )
T14390 28704-28706 NNP denotes II
T14389 28700-28703 CC denotes and
T14388 28698-28699 PRP denotes I
T14387 28688-28697 NNS denotes silencers
T14386 28687-28688 -LRB- denotes (
T14385 28677-28686 NNS denotes silencers
T14914 31481-31486 JJR denotes lower
T14913 31479-31480 NN denotes %
T14912 31477-31479 CD denotes 20
T14911 31472-31476 RB denotes only
T14910 31469-31471 VBZ denotes is
T14909 31464-31468 NNS denotes mice
T14908 31457-31463 JJ denotes mutant
T14907 31448-31456 JJ denotes 18.5-dpc
T14906 31445-31447 IN denotes of
T14905 31434-31444 NN denotes hematocrit
T14904 31430-31433 DT denotes the
T14903 31428-31429 , denotes ,
T14902 31421-31428 RB denotes However
T14901 31419-31420 . denotes .
T14900 31409-31419 NN denotes maturation
T14899 31400-31408 JJ denotes complete
T14898 31394-31399 PRP$ denotes their
T14897 31391-31393 TO denotes to
T14896 31385-31390 RB denotes prior
T14895 31383-31384 , denotes ,
T14894 31378-31383 NNS denotes cells
T14893 31374-31377 JJ denotes red
T14892 31371-31373 IN denotes of
T14891 31363-31370 NN denotes release
T14890 31353-31362 JJ denotes premature
T14889 31347-31352 JJ denotes rapid
T14888 31344-31346 TO denotes to
T14887 31339-31343 VB denotes lead
T14886 31335-31338 MD denotes can
T14885 31328-31334 NN denotes anemia
T14884 31321-31327 JJ denotes Severe
T14883 31319-31320 . denotes .
T14882 31313-31319 NN denotes anemia
T14881 31306-31312 CC denotes and/or
T14880 31304-31305 -RRB- denotes )
T14879 31297-31304 NNS denotes defects
T14878 31289-31296 JJ denotes cardiac
T14877 31284-31288 IN denotes from
T14876 31274-31283 VBG denotes resulting
T14875 31273-31274 -LRB- denotes (
T14874 31259-31272 NN denotes proliferation
T14873 31244-31258 JJ denotes stress-induced
T14872 31241-31243 IN denotes as
T14871 31236-31240 JJ denotes such
T14870 31234-31235 , denotes ,
T14869 31227-31234 NNS denotes effects
T14868 31218-31226 JJ denotes indirect
T14867 31215-31217 IN denotes of
T14866 31208-31214 NN denotes result
T14865 31204-31207 DT denotes the
T14864 31201-31203 VB denotes be
T14863 31197-31200 MD denotes may
T14862 31192-31196 DT denotes This
T14861 31190-31191 . denotes .
T14860 31186-31190 NNS denotes mice
T14859 31179-31185 JJ denotes mutant
T14858 31173-31178 JJ denotes p100H
T14857 31170-31172 IN denotes in
T14856 31147-31169 NN denotes enucleation/maturation
T14855 31144-31146 IN denotes in
T14854 31138-31143 NN denotes delay
T14853 31136-31137 DT denotes a
T14852 31126-31135 VBG denotes including
T14851 31124-31125 , denotes ,
T14850 31110-31124 NN denotes erythropoiesis
T14849 31107-31109 IN denotes in
T14848 31099-31106 NNS denotes effects
T14847 31093-31098 JJ denotes other
T14846 31089-31092 VBZ denotes has
T14845 31084-31088 NNP denotes Sox6
T14844 31082-31083 . denotes .
T14843 31072-31082 VBN denotes elucidated
T14842 31069-31071 VB denotes be
T14841 31066-31068 TO denotes to
T14840 31058-31065 VBZ denotes remains
T14839 31052-31057 NNS denotes genes
T14838 31045-31051 NN denotes globin
T14837 31035-31044 JJ denotes embryonic
T14836 31029-31034 JJ denotes other
T14835 31025-31028 DT denotes the
T14834 31015-31024 VBZ denotes regulates
T14833 31010-31014 NNP denotes Sox6
T14832 31004-31009 WDT denotes which
T14831 31001-31003 IN denotes by
T14830 30991-31000 NN denotes mechanism
T14829 30987-30990 DT denotes The
T14828 30985-30986 . denotes .
T14827 30976-30985 NN denotes ɛy-globin
T14826 30973-30975 IN denotes of
T14825 30962-30972 NN denotes regulation
T14824 30958-30961 DT denotes the
T14823 30955-30957 IN denotes in
T14822 30946-30954 NN denotes function
T14821 30939-30945 JJ denotes unique
T14820 30937-30938 DT denotes a
T14819 30933-30936 VBZ denotes has
T14818 30929-30932 CC denotes and
T14817 30918-30928 NN denotes expression
T14816 30911-30917 NN denotes globin
T14815 30908-30910 NN denotes ɛy
T14814 30900-30907 NN denotes silence
T14813 30897-30899 TO denotes to
T14812 30885-30896 RB denotes postnatally
T14811 30876-30884 VB denotes function
T14810 30873-30875 TO denotes to
T14809 30863-30872 VBZ denotes continues
T14808 30858-30862 JJ denotes Sox6
T14807 30853-30857 IN denotes that
T14806 30845-30852 VBP denotes suggest
T14805 30836-30844 NNS denotes findings
T14804 30830-30835 DT denotes These
T14803 30828-30829 . denotes .
T14802 30827-30828 -RRB- denotes )
T14384 28670-28676 NN denotes globin
T14383 28668-28669 NN denotes β
T14382 28662-28667 NN denotes adult
T14381 28656-28661 JJ denotes human
T14380 28652-28655 DT denotes the
T14379 28649-28651 TO denotes to
T14378 28644-28648 NN denotes bind
T14377 28641-28643 TO denotes to
T14376 28628-28640 VBN denotes demonstrated
T14375 28623-28627 VBD denotes were
T14374 28621-28622 , denotes ,
T14373 28616-28621 NNP denotes HMG-Y
T14372 28612-28615 CC denotes and
T14371 28606-28611 NNP denotes HMG-I
T14370 28604-28605 , denotes ,
T14369 28603-28604 -RRB- denotes )
T14368 28596-28603 NNS denotes factors
T14367 28582-28595 NN denotes transcription
T14366 28579-28581 IN denotes of
T14365 28572-28578 NN denotes family
T14364 28568-28571 NNP denotes Sox
T14363 28564-28567 DT denotes the
T14362 28561-28563 TO denotes to
T14361 28553-28560 VBN denotes related
T14360 28543-28552 RB denotes distantly
T14359 28542-28543 -LRB- denotes (
T14358 28533-28541 NNS denotes proteins
T14357 28519-28532 JJ denotes architectural
T14356 28515-28518 NNP denotes HMG
T14355 28511-28514 CD denotes Two
T14354 28509-28510 . denotes .
T14353 28508-28509 NNP denotes ]
T14352 28506-28508 CD denotes 39
T14351 28505-28506 NNP denotes [
T14350 28496-28504 NN denotes promoter
T14349 28493-28495 JJ denotes ɛy
T14348 28489-28492 DT denotes the
T14347 28486-28488 TO denotes to
T14346 28478-28485 JJ denotes binding
T14345 28475-28477 IN denotes in
T14344 28473-28474 , denotes ,
T14343 28464-28473 NN denotes activator
T14342 28461-28463 DT denotes an
T14341 28459-28460 , denotes ,
T14340 28455-28459 NNP denotes EKLF
T14339 28450-28454 IN denotes with
T14338 28439-28449 VBZ denotes interferes
T14337 28434-28438 NNP denotes DRED
T14336 28432-28433 . denotes .
T14335 28428-28432 NNP denotes DRED
T14334 28425-28427 VBZ denotes is
T14333 28416-28424 NN denotes promoter
T14332 28413-28415 JJ denotes ɛy
T14331 28409-28412 DT denotes the
T14330 28406-28408 IN denotes on
T14329 28396-28405 NN denotes activator
T14328 28393-28395 DT denotes an
T14327 28388-28392 IN denotes with
T14326 28377-28387 VBZ denotes interferes
T14325 28372-28376 WDT denotes that
T14324 28362-28371 NN denotes repressor
T14323 28360-28361 DT denotes a
T14322 28357-28359 IN denotes of
T14321 28349-28356 NN denotes example
T14320 28341-28348 DT denotes Another
T14319 28339-28340 . denotes .
T14318 28329-28339 NNS denotes repressors
T14317 28323-28328 JJ denotes other
T14316 28320-28322 IN denotes of
T14315 28312-28319 JJ denotes binding
T14314 28301-28311 VB denotes facilitate
T14313 28298-28300 CC denotes or
T14312 28289-28297 NN denotes promoter
T14311 28285-28288 DT denotes the
T14310 28282-28284 TO denotes to
T14309 28271-28281 NNS denotes activators
T14308 28265-28270 JJ denotes other
T14307 28262-28264 IN denotes of
T14306 28254-28261 JJ denotes binding
T14305 28249-28253 IN denotes with
T14304 28239-28248 VB denotes interfere
T14303 28232-28238 RB denotes either
T14302 28226-28231 MD denotes could
T14301 28221-28225 NNP denotes Sox6
T14300 28219-28220 , denotes ,
T14299 28210-28219 NN denotes structure
T14298 28200-28209 NN denotes chromatin
T14297 28194-28199 JJ denotes local
T14296 28190-28193 DT denotes the
T14295 28181-28189 VBG denotes changing
T14294 28178-28180 IN denotes By
T14293 28176-28177 . denotes .
T14292 28167-28176 NNS denotes complexes
T14291 28151-28166 JJ denotes transcriptional
T14290 28138-28150 JJ denotes multiprotein
T14289 28127-28137 VBG denotes assembling
T14288 28124-28126 IN denotes by
T14287 28120-28123 CC denotes and
T14286 28116-28119 NNP denotes DNA
T14285 28108-28115 VBG denotes bending
T14284 28105-28107 IN denotes by
T14081 26982-26986 IN denotes with
T14080 26970-26981 NN denotes heterodimer
T14079 26968-26969 DT denotes a
T14078 26965-26967 IN denotes as
T14077 26962-26964 CC denotes or
T14076 26952-26961 NN denotes homodimer
T14075 26950-26951 DT denotes a
T14074 26947-26949 IN denotes as
T14073 26940-26946 CC denotes either
T14072 26931-26939 NN denotes promoter
T14070 26924-26927 DT denotes the
T14069 26921-26923 IN denotes of
T14068 26912-26920 NN denotes sequence
T14067 26907-26911 DT denotes this
T14066 26904-26906 TO denotes to
T14065 26898-26903 NNS denotes binds
T14064 26893-26897 JJ denotes Sox6
T14063 26888-26892 IN denotes that
T14062 26880-26887 VBP denotes suggest
T14061 26867-26879 NNS denotes observations
T14060 26861-26866 DT denotes These
T14059 26859-26860 . denotes .
T14058 26858-26859 -RRB- denotes )
T14057 26856-26858 CD denotes 3F
T14056 26852-26855 CC denotes and
T14055 26849-26851 CD denotes 3E
T14054 26842-26848 NN denotes Figure
T14053 26841-26842 -LRB- denotes (
T14052 26832-26840 NN denotes activity
T14051 26828-26831 PRP$ denotes its
T14050 26825-26827 IN denotes of
T14049 26814-26824 NN denotes repression
T14048 26810-26813 CC denotes and
T14047 26801-26809 NN denotes promoter
T14046 26798-26800 JJ denotes ɛy
T14045 26794-26797 DT denotes the
T14044 26791-26793 TO denotes to
T14043 26783-26790 JJ denotes binding
T14042 26778-26782 JJ denotes Sox6
T14041 26774-26777 IN denotes for
T14040 26764-26773 JJ denotes essential
T14039 26760-26763 VBP denotes are
T14038 26754-26759 NNS denotes sites
T14037 26749-26753 DT denotes both
T14036 26747-26748 , denotes ,
T14035 26735-26747 RB denotes Functionally
T14034 26733-26734 . denotes .
T14033 26732-26733 -RRB- denotes )
T14032 26730-26732 NN denotes 3A
T14031 26723-26729 NN denotes Figure
T14030 26722-26723 -LRB- denotes (
T14029 26716-26721 NNS denotes sites
T14028 26706-26715 NN denotes consensus
T14027 26697-26705 JJ denotes Sox/Sox6
T14026 26693-26696 CD denotes two
T14025 26684-26692 VBZ denotes contains
T14024 26675-26683 NN denotes promoter
T14023 26672-26674 JJ denotes ɛy
T14022 26668-26671 DT denotes the
T14021 26665-26667 IN denotes of
T14020 26656-26664 NN denotes sequence
T14019 26649-26655 NN denotes target
T14018 26644-26648 NNP denotes Sox6
T14017 26636-26643 VBN denotes defined
T14016 26632-26635 DT denotes the
T14015 26630-26631 , denotes ,
T14014 26625-26630 NN denotes study
T14013 26617-26624 JJ denotes present
T14012 26613-26616 DT denotes the
T14011 26610-26612 IN denotes in
T14010 26608-26609 , denotes ,
T14009 26602-26608 RB denotes Indeed
T14008 26600-26601 . denotes .
T14007 26594-26600 NNS denotes dimers
T14006 26586-26593 NN denotes protein
T14005 26580-26585 JJ denotes D-Sox
T14004 26577-26579 IN denotes of
T14003 26569-26576 JJ denotes binding
T14002 26564-26568 IN denotes with
T14001 26553-26563 JJ denotes compatible
T14000 26539-26552 NN denotes configuration
T13999 26537-26538 DT denotes a
T13998 26532-26536 IN denotes with
T13997 26526-26531 NNS denotes sites
T13996 26518-26525 JJ denotes binding
T13995 26514-26517 NNP denotes HMG
T13994 26511-26513 IN denotes of
T13993 26505-26510 NNS denotes pairs
T13992 26498-26504 NN denotes harbor
T13991 26489-26497 RB denotes probably
T13990 26487-26488 , denotes ,
T13989 26483-26487 NNP denotes Sox6
T13988 26480-26482 IN denotes as
T13987 26475-26479 JJ denotes such
T13986 26473-26474 , denotes ,
T13985 26465-26473 NNS denotes proteins
T13984 26461-26464 NNP denotes Sox
T13983 26459-26460 NNP denotes D
T13982 26453-26458 NN denotes group
T13981 26449-26452 IN denotes for
T13980 26443-26448 NNS denotes genes
T13979 26436-26442 NN denotes target
T13978 26431-26435 IN denotes that
T13977 26423-26430 VBZ denotes appears
T13976 26420-26422 PRP denotes it
T13975 26418-26419 , denotes ,
T13974 26409-26418 RB denotes Therefore
T13973 26407-26408 . denotes .
T13972 26406-26407 NNP denotes ]
T13971 26405-26406 CD denotes 5
T13970 26404-26405 NN denotes [
T13969 26398-26403 NN denotes motif
T13968 26390-26397 JJ denotes HMG-box
T13967 26383-26389 JJ denotes single
T14585 29752-29758 JJR denotes higher
T14584 29747-29751 RB denotes also
T14583 29743-29746 VBP denotes are
T14582 29741-29742 -RRB- denotes )
T14581 29738-29741 CD denotes βh1
T14580 29734-29737 CC denotes and
T14579 29732-29733 NN denotes ζ
T14578 29731-29732 -LRB- denotes (
T14577 29725-29730 NNS denotes genes
T14576 29718-29724 NN denotes globin
T14575 29708-29717 JJ denotes embryonic
T14574 29702-29707 JJ denotes other
T14573 29698-29701 CD denotes two
T14572 29695-29697 IN denotes of
T14571 29688-29694 NNS denotes levels
T14570 29677-29687 NN denotes expression
T14569 29673-29676 DT denotes The
T14568 29671-29672 . denotes .
T14567 29667-29671 NNS denotes mice
T14566 29660-29666 JJ denotes mutant
T14565 29649-29659 JJ denotes homozygous
T14564 29646-29648 IN denotes in
T14563 29639-29645 JJ denotes robust
T14562 29633-29638 RB denotes quite
T14561 29630-29632 VBZ denotes is
T14560 29625-29629 NN denotes gene
T14559 29618-29624 NN denotes globin
T14558 29615-29617 JJ denotes ɛy
T14557 29611-29614 DT denotes the
T14556 29608-29610 IN denotes of
T14555 29597-29607 NN denotes expression
T14554 29589-29596 JJ denotes ectopic
T14553 29584-29588 IN denotes that
T14552 29571-29583 VBZ denotes demonstrates
T14551 29566-29570 DT denotes This
T14550 29564-29565 . denotes .
T14549 29563-29564 -RRB- denotes )
T14548 29562-29563 CD denotes 1
T14547 29555-29561 NN denotes Figure
T14546 29554-29555 -LRB- denotes (
T14545 29549-29553 NNS denotes mice
T14544 29546-29548 NNP denotes WT
T14543 29535-29545 JJ denotes homozygous
T14542 29526-29534 JJ denotes 18.5-dpc
T14541 29522-29525 CC denotes and
T14540 29513-29521 JJ denotes 15.5-dpc
T14539 29510-29512 IN denotes of
T14538 29503-29509 NNS denotes livers
T14537 29499-29502 DT denotes the
T14536 29496-29498 IN denotes in
T14535 29485-29495 NN denotes expression
T14534 29481-29484 NN denotes min
T14533 29480-29481 NN denotes /
T14532 29476-29480 NN denotes βmaj
T14531 29473-29475 IN denotes of
T14530 29467-29472 NN denotes level
T14529 29463-29466 DT denotes the
T14528 29460-29462 TO denotes to
T14527 29449-29459 JJ denotes equivalent
T14526 29435-29448 RB denotes statistically
T14525 29432-29434 VBZ denotes is
T14524 29428-29431 NN denotes dpc
T14523 29423-29427 CD denotes 18.5
T14522 29419-29422 CC denotes and
T14521 29415-29418 NN denotes dpc
T14520 29410-29414 CD denotes 15.5
T14519 29407-29409 IN denotes at
T14518 29402-29406 NNS denotes mice
T14517 29397-29401 NN denotes null
T14516 29392-29396 JJ denotes Sox6
T14515 29381-29391 JJ denotes homozygous
T14514 29378-29380 IN denotes in
T14513 29371-29377 NN denotes globin
T14512 29368-29370 JJ denotes ɛy
T14511 29365-29367 IN denotes of
T14510 29359-29364 NN denotes level
T14509 29348-29358 NN denotes expression
T14508 29344-29347 DT denotes The
T14507 29342-29343 . denotes .
T14506 29332-29342 NN denotes expression
T14505 29325-29331 NN denotes globin
T14504 29322-29324 NN denotes ɛy
T14503 29314-29321 NN denotes silence
T14502 29311-29313 TO denotes to
T14501 29296-29310 NNS denotes erythropoiesis
T14500 29285-29295 JJ denotes definitive
T13966 26381-26382 DT denotes a
T13965 26378-26380 TO denotes to
T13964 26373-26377 IN denotes than
T13963 26367-26372 NN denotes motif
T13962 26361-26366 NN denotes dimer
T13961 26353-26360 JJ denotes HMG-box
T13960 26350-26352 DT denotes an
T13959 26347-26349 TO denotes to
T13958 26338-26346 RB denotes strongly
T13957 26333-26337 RBR denotes more
T13956 26327-26332 NNS denotes binds
T13955 26322-26326 JJ denotes Sox6
T13954 26320-26321 , denotes ,
T13953 26312-26320 NN denotes addition
T13952 26309-26311 IN denotes In
T13951 26307-26308 . denotes .
T13950 26306-26307 NNP denotes ]
T13949 26305-26306 CD denotes 6
T13948 26304-26305 NNP denotes [
T13947 26298-26303 NNS denotes sites
T13946 26294-26297 NNP denotes Sox
T13945 26285-26293 JJ denotes adjacent
T13944 26276-26284 VBZ denotes contains
T13943 26271-26275 IN denotes that
T13942 26267-26270 NNP denotes DNA
T13941 26264-26266 TO denotes to
T13940 26255-26263 NNS denotes proteins
T13939 26251-26254 NNP denotes Sox
T13938 26247-26250 CD denotes two
T13937 26243-26246 DT denotes the
T13936 26240-26242 IN denotes of
T13935 26229-26239 NN denotes efficiency
T13934 26221-26228 JJ denotes binding
T13933 26217-26220 DT denotes the
T13932 26208-26216 VB denotes increase
T13931 26200-26207 RB denotes greatly
T13930 26197-26199 TO denotes to
T13929 26191-26196 VBN denotes shown
T13928 26186-26190 VBN denotes been
T13927 26182-26185 VBZ denotes has
T13926 26177-26181 NNP denotes Sox6
T13925 26173-26176 CC denotes and
T13924 26168-26172 NNS denotes Sox5
T13923 26165-26167 IN denotes of
T13922 26152-26164 NN denotes dimerization
T13921 26150-26151 , denotes ,
T13920 26138-26150 RB denotes Functionally
T13919 26136-26137 . denotes .
T13918 26135-26136 NNP denotes ]
T13917 26131-26135 CD denotes 6,35
T13916 26130-26131 NNP denotes [
T13915 26111-26129 NN denotes heterodimerization
T13914 26107-26110 CC denotes and
T13913 26105-26106 : denotes -
T13912 26101-26105 NN denotes homo
T13911 26092-26100 VBZ denotes mediates
T13910 26087-26091 WDT denotes that
T13909 26080-26086 NN denotes domain
T13908 26073-26079 VBN denotes coiled
T13907 26066-26072 VBN denotes coiled
T13906 26064-26065 DT denotes a
T13905 26056-26063 VBP denotes contain
T13904 26047-26055 NNS denotes proteins
T13903 26043-26046 NNP denotes Sox
T13902 26041-26042 NNP denotes D
T13901 26035-26040 NNP denotes Group
T13900 26033-26034 . denotes .
T13899 26032-26033 NNP denotes ]
T13898 26030-26032 CD denotes 34
T13897 26029-26030 NNP denotes [
T13896 26026-26028 CD denotes 23
T13895 26022-26025 CC denotes and
T13894 26020-26021 , denotes ,
T13893 26018-26020 CD denotes 13
T13892 26016-26017 , denotes ,
T13891 26014-26016 CD denotes 12
T13890 26012-26013 , denotes ,
T13889 26008-26012 NNS denotes Sox5
T13888 25999-26007 VBZ denotes includes
T13887 25994-25998 WDT denotes that
T13886 25985-25993 NNS denotes proteins
T13885 25982-25984 IN denotes of
T13884 25975-25981 NN denotes family
T13883 25971-25974 NNP denotes Sox
T13882 25967-25970 DT denotes the
T13881 25964-25966 IN denotes of
T13880 25962-25963 NNP denotes D
T13879 25956-25961 NN denotes group
T13878 25953-25955 TO denotes to
T13877 25945-25952 VBZ denotes belongs
T13876 25940-25944 JJ denotes Sox6
T13875 25938-25939 . denotes .
T13874 25924-25938 NNS denotes erythropoiesis
T13873 25913-25923 JJ denotes definitive
T13872 25910-25912 IN denotes in
T13871 25905-25909 NN denotes gene
T13870 25895-25904 JJ denotes ɛy-globin
T13869 25891-25894 DT denotes the
T13868 25881-25890 VBZ denotes represses
T13867 25877-25880 CC denotes and
T13866 25872-25876 NN denotes gene
T14271 28014-28018 PRP denotes they
T14270 28009-28013 IN denotes that
T14269 28006-28008 VBZ denotes is
T14268 27995-28005 NN denotes expression
T14267 27990-27994 NN denotes gene
T14266 27982-27989 VBP denotes control
T14265 27973-27981 NNS denotes proteins
T14264 27968-27972 JJ denotes Sox6
T14263 27964-27967 WRB denotes how
T14262 27956-27963 VB denotes explain
T14261 27953-27955 TO denotes to
T14260 27947-27952 NN denotes model
T14259 27936-27946 JJ denotes attractive
T14258 27932-27935 CD denotes one
T14257 27930-27931 , denotes ,
T14256 27921-27930 RB denotes Therefore
T14255 27919-27920 . denotes .
T14254 27918-27919 NNP denotes ]
T14253 27917-27918 CD denotes 4
T14252 27915-27916 CD denotes 2
T14251 27914-27915 VBP denotes [
T14250 27904-27913 NNS denotes junctions
T14249 27895-27903 JJ denotes four-way
T14248 27892-27894 TO denotes to
T14247 27887-27891 NN denotes bind
T14246 27882-27886 RB denotes also
T14245 27878-27881 MD denotes can
T14244 27874-27877 CC denotes and
T14243 27872-27873 , denotes ,
T14242 27866-27872 NN denotes groove
T14241 27860-27865 JJ denotes minor
T14240 27856-27859 DT denotes the
T14239 27853-27855 IN denotes in
T14238 27839-27852 NN denotes intercalation
T14237 27831-27838 JJ denotes partial
T14236 27828-27830 IN denotes by
T14235 27824-27827 NN denotes DNA
T14234 27817-27823 JJ denotes linear
T14233 27812-27816 VB denotes bend
T14232 27808-27811 CC denotes and
T14231 27803-27807 NN denotes bind
T14230 27794-27802 NNS denotes proteins
T14229 27790-27793 NNP denotes Sox
T14228 27788-27789 . denotes .
T14227 27778-27788 NN denotes repression
T14226 27775-27777 IN denotes of
T14225 27765-27774 NN denotes mechanism
T14224 27761-27764 PRP$ denotes its
T14223 27758-27760 IN denotes on
T14222 27752-27757 NN denotes light
T14221 27747-27751 VB denotes shed
T14220 27742-27746 MD denotes will
T14219 27733-27741 NN denotes promoter
T14218 27730-27732 JJ denotes ɛy
T14217 27726-27729 DT denotes the
T14216 27721-27725 IN denotes with
T14215 27710-27720 VBN denotes associated
T14214 27702-27709 JJ denotes complex
T14213 27686-27701 JJ denotes Sox6-containing
T14212 27682-27685 DT denotes the
T14211 27679-27681 IN denotes of
T14210 27668-27678 NNS denotes components
T14209 27662-27667 JJ denotes other
T14208 27659-27661 IN denotes of
T14207 27644-27658 NN denotes Identification
T14206 27642-27643 . denotes .
T14205 27635-27642 NN denotes complex
T14204 27624-27634 NN denotes repression
T14203 27618-27623 JJ denotes large
T14202 27616-27617 DT denotes a
T14201 27611-27615 VB denotes form
T14200 27607-27610 CC denotes and
T14199 27599-27606 NNS denotes factors
T14198 27593-27598 DT denotes these
T14197 27588-27592 IN denotes with
T14196 27579-27587 VB denotes interact
T14195 27573-27578 MD denotes might
T14194 27568-27572 NNS denotes Sox6
T14193 27566-27567 . denotes .
T14192 27565-27566 NNP denotes ]
T14191 27563-27565 CD denotes 38
T14190 27562-27563 NNP denotes [
T14189 27554-27561 NNP denotes COUP-TF
T14188 27550-27553 CC denotes and
T14187 27548-27549 NNP denotes ]
T14186 27546-27548 CD denotes 37
T14185 27545-27546 NNP denotes [
T14184 27537-27544 JJ denotes complex
T14183 27532-27536 NNP denotes DRED
T14182 27528-27531 DT denotes the
T14181 27518-27527 VBG denotes including
T14180 27516-27517 , denotes ,
T14179 27511-27516 NNS denotes sites
T14178 27501-27510 NN denotes consensus
T14177 27492-27500 NNP denotes Sox/Sox6
T14176 27488-27491 DT denotes the
T14175 27483-27487 IN denotes near
T14174 27473-27482 NNS denotes sequences
T14173 27469-27472 NNP denotes DNA
T14172 27466-27468 TO denotes to
T14171 27461-27465 NN denotes bind
T14170 27458-27460 TO denotes to
T14169 27449-27457 VBN denotes reported
T14168 27444-27448 VBN denotes been
T14167 27439-27443 VBP denotes have
T14166 27428-27438 NNS denotes repressors
T14165 27421-27427 NN denotes globin
T14164 27418-27420 JJ denotes ɛy
T14163 27412-27417 JJ denotes other
T14162 27408-27411 JJ denotes few
T14161 27406-27407 DT denotes A
T14160 27404-27405 . denotes .
T14159 27397-27404 NN denotes complex
T14158 27390-27396 NN denotes weight
T14157 27380-27389 JJ denotes molecular
T14156 27375-27379 JJ denotes high
T14155 27373-27374 DT denotes a
T14154 27370-27372 IN denotes of
T14153 27365-27369 NN denotes part
T14152 27362-27364 VBZ denotes is
T14151 27357-27361 NNP denotes Sox6
T14150 27352-27356 IN denotes that
T14149 27341-27351 VBG denotes suggesting
T14148 27339-27340 , denotes ,
T14147 27335-27339 NN denotes band
T14146 27319-27334 JJ denotes Sox6-associated
T14145 27315-27318 DT denotes the
T14144 27308-27314 VB denotes detect
T14143 27305-27307 TO denotes to
T14142 27303-27304 NN denotes h
T14141 27301-27302 CD denotes 8
T14140 27299-27300 CD denotes 4
T14139 27293-27298 JJS denotes least
T14138 27290-27292 IN denotes at
T14137 27286-27289 IN denotes for
T14136 27282-27285 NN denotes gel
T14135 27280-27281 NN denotes %
T14134 27279-27280 CD denotes 6
T14133 27277-27278 NN denotes %
T14132 27276-27277 CD denotes 4
T14131 27274-27275 DT denotes a
T14130 27271-27273 IN denotes on
T14129 27255-27270 NN denotes electrophoresis
T14128 27251-27254 DT denotes the
T14127 27247-27250 VB denotes run
T14126 27244-27246 TO denotes to
T14125 27240-27243 VBD denotes had
T14124 27237-27239 PRP denotes we
T14123 27235-27236 , denotes ,
T14122 27230-27235 NNS denotes EMSAs
T14121 27226-27229 PRP$ denotes our
T14120 27223-27225 IN denotes In
T14119 27221-27222 . denotes .
T14118 27220-27221 NNP denotes ]
T14117 27218-27220 CD denotes 36
T14116 27217-27218 NNP denotes [
T14115 27209-27216 NNS denotes factors
T14114 27195-27208 NN denotes transcription
T14113 27189-27194 JJ denotes other
T14112 27184-27188 IN denotes with
T14111 27171-27183 NNS denotes interactions
T14110 27166-27170 IN denotes upon
T14109 27161-27165 VB denotes rely
T14108 27158-27160 TO denotes to
T14107 27150-27157 VBN denotes thought
T14106 27147-27149 VBZ denotes is
T14105 27139-27146 NNS denotes actions
T14104 27133-27138 PRP$ denotes their
T14103 27130-27132 IN denotes of
T14102 27118-27129 NN denotes specificity
T14101 27114-27117 DT denotes the
T14100 27112-27113 , denotes ,
T14099 27102-27112 NN denotes degeneracy
T14098 27089-27101 JJ denotes considerable
T14097 27085-27088 IN denotes for
T14096 27078-27084 VBZ denotes allows
T14095 27073-27077 WDT denotes that
T14094 27064-27072 NN denotes sequence
T14093 27051-27063 JJ denotes core-binding
T14092 27046-27050 JJ denotes 6-bp
T14091 27040-27045 JJ denotes short
T14090 27038-27039 DT denotes a
T14089 27028-27037 VBP denotes recognize
T14088 27019-27027 NNS denotes proteins
T14087 27015-27018 NNP denotes Sox
T14086 27007-27014 IN denotes Because
T14085 27005-27006 . denotes .
T14084 26997-27005 NNS denotes proteins
T14083 26993-26996 NNP denotes Sox
T14082 26987-26992 JJ denotes other
T14283 28095-28104 NN denotes structure
T14282 28085-28094 NN denotes chromatin
T14281 28079-28084 JJ denotes local
T14280 28067-28078 VBG denotes influencing
T14279 28065-28066 , denotes ,
T14278 28062-28065 NNP denotes DNA
T14277 28059-28061 TO denotes to
T14276 28053-28058 VBN denotes bound
T14275 28045-28052 NNS denotes factors
T14274 28031-28044 JJ denotes architectural
T14273 28028-28030 IN denotes as
T14272 28019-28027 VBP denotes function
T13865 25869-25871 JJ denotes ɛy
T13864 25866-25868 IN denotes of
T13863 25857-25865 NN denotes promoter
T13862 25848-25856 JJ denotes proximal
T13861 25844-25847 DT denotes the
T13860 25841-25843 TO denotes to
T13859 25835-25840 VBZ denotes binds
T13858 25831-25834 CC denotes and
T13857 25821-25830 VBZ denotes regulates
T13856 25812-25820 RB denotes directly
T13855 25807-25811 JJ denotes Sox6
T13854 25805-25806 . denotes .
T13853 25801-25805 NN denotes gene
T13852 25794-25800 NN denotes globin
T13851 25791-25793 JJ denotes ɛy
T13850 25787-25790 DT denotes the
T13849 25784-25786 IN denotes of
T13848 25771-25783 NN denotes upregulation
T13847 25760-25770 JJ denotes persistent
T13846 25758-25759 DT denotes a
T13845 25754-25757 CC denotes and
T13844 25752-25753 , denotes ,
T13843 25749-25752 NNP denotes βH1
T13842 25745-25748 CC denotes and
T13841 25743-25744 NN denotes ζ
T13840 25741-25742 , denotes ,
T13839 25736-25741 NNS denotes genes
T13838 25729-25735 NN denotes globin
T13837 25719-25728 JJ denotes embryonic
T13836 25715-25718 DT denotes the
T13835 25712-25714 IN denotes on
T13834 25705-25711 NN denotes effect
T13833 25695-25704 JJ denotes transient
T13832 25693-25694 DT denotes a
T13831 25690-25692 VBZ denotes is
T13830 25684-25689 EX denotes there
T13829 25682-25683 , denotes ,
T13828 25677-25682 NN denotes mouse
T13827 25672-25676 NN denotes null
T13826 25667-25671 NNP denotes Sox6
T13825 25663-25666 DT denotes the
T13824 25660-25662 IN denotes In
T13823 25658-25659 . denotes .
T13822 25653-25658 NNS denotes genes
T13821 25646-25652 NN denotes globin
T13820 25643-25645 IN denotes of
T13819 25633-25642 NN denotes mechanism
T13818 25622-25632 NN denotes regulation
T13817 25610-25621 JJ denotes complicated
T13816 25606-25609 DT denotes the
T13815 25603-25605 IN denotes in
T13814 25596-25602 NN denotes factor
T13813 25590-25595 JJ denotes novel
T13812 25588-25589 DT denotes a
T13811 25585-25587 VBZ denotes is
T13810 25580-25584 NNP denotes Sox6
T13809 25575-25579 IN denotes that
T13808 25570-25574 VBP denotes show
T13807 25567-25569 PRP denotes we
T13806 25565-25566 , denotes ,
T13805 25559-25565 NN denotes report
T13804 25554-25558 DT denotes this
T13803 25551-25553 IN denotes In
T10654 25231-25232 . denotes .
T10653 25221-25231 NN denotes maturation
T10652 25216-25220 NN denotes cell
T10651 25212-25215 JJ denotes red
T10266 23452-23466 NNS denotes erythropoiesis
T10265 23441-23451 JJ denotes definitive
T10264 23438-23440 IN denotes in
T10263 23428-23437 NNS denotes functions
T10262 23423-23427 JJ denotes Sox6
T10261 23418-23422 IN denotes that
T10260 23406-23417 VBP denotes demonstrate
T10259 23404-23405 , denotes ,
T10258 23403-23404 -RRB- denotes )
T10257 23402-23403 CD denotes 5
T10256 23395-23401 NN denotes Figure
T10255 23394-23395 -LRB- denotes (
T10254 23389-23393 NNS denotes mice
T10253 23382-23388 JJ denotes mutant
T10252 23376-23381 JJ denotes p100H
T10251 23367-23375 JJ denotes 14.5-dpc
T10250 23364-23366 IN denotes of
T10249 23358-23363 NNS denotes cells
T10248 23352-23357 NN denotes liver
T10247 23348-23351 DT denotes the
T10246 23345-23347 IN denotes in
T10245 23335-23344 VBN denotes expressed
T10244 23328-23334 RB denotes highly
T10243 23325-23327 VBZ denotes is
T10242 23318-23324 NN denotes globin
T10241 23315-23317 JJ denotes ɛy
T10240 23310-23314 IN denotes that
T10239 23298-23309 NN denotes observation
T10238 23294-23297 DT denotes the
T10237 23289-23293 IN denotes with
T10236 23280-23288 RB denotes together
T10235 23274-23279 VBN denotes taken
T10234 23272-23273 , denotes ,
T10233 23268-23272 NNS denotes data
T10232 23262-23267 DT denotes These
T10231 23260-23261 . denotes .
T10230 23246-23260 NNS denotes erythropoiesis
T10229 23244-23245 , denotes ,
T10228 23235-23244 JJ denotes primitive
T10227 23231-23234 RB denotes not
T10226 23227-23230 CC denotes but
T10225 23225-23226 , denotes ,
T10224 23215-23225 JJ denotes definitive
T10223 23210-23214 IN denotes with
T10222 23199-23209 JJ denotes coincident
T10221 23189-23198 RB denotes spatially
T10220 23185-23188 CC denotes and
T10219 23174-23184 RB denotes temporally
T10218 23171-23173 VBZ denotes is
T10217 23160-23170 NN denotes expression
T10216 23155-23159 JJ denotes Sox6
T10215 23153-23154 , denotes ,
T10214 23144-23153 RB denotes Therefore
T10213 23142-23143 . denotes .
T10212 23141-23142 -RRB- denotes )
T10211 23139-23141 NN denotes 6B
T10210 23132-23138 NN denotes Figure
T10209 23131-23132 -LRB- denotes (
T10208 23127-23130 NN denotes dpc
T10207 23123-23126 CD denotes 7.5
T10206 23120-23122 IN denotes at
T10205 23112-23119 NNS denotes islands
T10204 23106-23111 NN denotes blood
T10203 23102-23105 NN denotes sac
T10202 23097-23101 NN denotes yolk
T10201 23094-23096 IN denotes in
T10200 23090-23093 RB denotes not
T10199 23086-23089 CC denotes but
T10198 23084-23085 , denotes ,
T10197 23079-23084 NN denotes liver
T10196 23070-23078 JJ denotes 12.5-dpc
T10195 23067-23069 IN denotes in
T10194 23055-23066 VBN denotes transcribed
T10193 23048-23054 RB denotes highly
T10192 23045-23047 VBZ denotes is
T10191 23040-23044 NNP denotes Sox6
T10190 23035-23039 IN denotes that
T10189 23029-23034 VBZ denotes shows
T10188 23015-23028 NN denotes hybridization
T10187 23010-23014 NN denotes situ
T10186 23007-23009 IN denotes in
T10185 23005-23006 , denotes ,
T10184 22994-23005 RB denotes Furthermore
T10183 22992-22993 . denotes .
T10182 22987-22992 NN denotes liver
T10181 22983-22986 DT denotes the
T10180 22980-22982 IN denotes in
T10179 22965-22979 NNS denotes erythropoiesis
T10178 22954-22964 JJ denotes definitive
T10177 22951-22953 IN denotes of
T10176 22945-22950 NN denotes onset
T10175 22936-22944 JJ denotes temporal
T10174 22932-22935 DT denotes the
T10173 22927-22931 IN denotes with
T10172 22916-22926 JJ denotes coincident
T10171 22914-22915 , denotes ,
T10170 22911-22914 NN denotes dpc
T10169 22906-22910 CD denotes 10.5
T10168 22903-22905 IN denotes at
T10167 22893-22902 NN denotes beginning
T10166 22888-22892 NN denotes blot
T10165 22879-22887 NNP denotes Northern
T10164 22876-22878 IN denotes by
T10163 22865-22875 JJ denotes detectable
T10162 22862-22864 VBZ denotes is
T10161 22857-22861 NNP denotes Sox6
T10160 22855-22856 , denotes ,
T10159 22853-22855 CD denotes 6A
T10158 22846-22852 NN denotes Figure
T10157 22843-22845 IN denotes in
T10156 22837-22842 VBN denotes shown
T10155 22834-22836 IN denotes As
T10154 22832-22833 . denotes .
T10153 22824-22832 VBN denotes employed
T10152 22819-22823 VBD denotes were
T10151 22812-22818 NNS denotes assays
T10150 22798-22811 NN denotes hybridization
T10149 22793-22797 NN denotes situ
T10148 22790-22792 IN denotes in
T10147 22786-22789 CC denotes and
T10146 22781-22785 NN denotes blot
T10145 22772-22780 NNP denotes Northern
T10144 22770-22771 , denotes ,
T10143 22766-22770 NNP denotes Sox6
T10142 22763-22765 IN denotes of
T10109 22545-22549 NNS denotes mice
T10108 22530-22544 JJ denotes Sox6-deficient
T10107 22525-22529 WDT denotes that
T10106 22513-22524 NN denotes observation
T10105 22509-22512 DT denotes The
T10104 22494-22508 NNPS denotes Erythropoiesis
T10103 22483-22493 JJ denotes Definitive
T10102 22480-22482 IN denotes in
T10101 22475-22479 NN denotes Role
T10100 22473-22474 DT denotes a
T10099 22464-22472 VBZ denotes Suggests
T10098 22459-22463 NNP denotes Sox6
T10097 22456-22458 IN denotes of
T10096 22448-22455 NNP denotes Pattern
T10095 22437-22447 NNP denotes Expression
T10094 22433-22436 DT denotes The
T10650 25205-25211 VB denotes affect
T10649 25201-25204 MD denotes may
T10648 25196-25200 NNP denotes Sox6
T10647 25194-25195 , denotes ,
T10646 25190-25194 NN denotes gene
T10645 25183-25189 NN denotes globin
T10644 25180-25182 JJ denotes ɛy
T10643 25176-25179 DT denotes the
T10642 25166-25175 VBG denotes silencing
T10641 25158-25165 IN denotes besides
T10640 25153-25157 IN denotes that
T10639 25145-25152 VBP denotes suggest
T10638 25132-25144 NNS denotes observations
T10637 25126-25131 DT denotes These
T10636 25124-25125 . denotes .
T10635 25121-25124 NN denotes dpc
T10634 25116-25120 CD denotes 14.5
T10633 25113-25115 IN denotes as
T10632 25107-25112 JJ denotes early
T10631 25104-25106 IN denotes as
T10630 25098-25103 VBN denotes noted
T10629 25095-25097 VBZ denotes is
T10628 25084-25094 NN denotes alteration
T10627 25079-25083 DT denotes This
T10626 25077-25078 . denotes .
T10625 25076-25077 -RRB- denotes )
T10624 25074-25076 NN denotes 7B
T10623 25067-25073 NN denotes Figure
T10622 25066-25067 -LRB- denotes (
T10621 25062-25065 NN denotes dpc
T10620 25057-25061 CD denotes 18.5
T10619 25054-25056 IN denotes at
T10618 25041-25053 NNS denotes erythrocytes
T10617 25031-25040 JJ denotes nucleated
T10616 25021-25030 VBG denotes including
T10615 25015-25020 NNS denotes cells
T10614 25005-25014 NN denotes precursor
T10613 24991-25004 JJ denotes hematopoietic
T10612 24988-24990 IN denotes in
T10611 24979-24987 NN denotes increase
T10610 24967-24978 JJ denotes significant
T10609 24965-24966 DT denotes a
T10608 24959-24964 VBZ denotes shows
T10607 24953-24958 NN denotes liver
T10606 24946-24952 JJ denotes mutant
T10605 24942-24945 DT denotes the
T10604 24940-24941 , denotes ,
T10603 24932-24940 NN denotes addition
T10602 24929-24931 IN denotes In
T10601 24927-24928 . denotes .
T10600 24921-24927 NN denotes effect
T10599 24911-24920 JJ denotes transient
T10598 24909-24910 DT denotes a
T10597 24906-24908 VB denotes be
T10596 24902-24905 MD denotes may
T10595 24897-24901 DT denotes this
T10594 24892-24896 IN denotes that
T10593 24881-24891 VBG denotes suggesting
T10592 24879-24880 , denotes ,
T10591 24875-24879 NNS denotes mice
T10590 24868-24874 JJ denotes mutant
T10589 24865-24867 CC denotes or
T10588 24862-24864 NNP denotes WT
T10587 24855-24861 DT denotes either
T10586 24852-24854 IN denotes in
T10585 24846-24851 NNS denotes cells
T10584 24842-24845 JJ denotes red
T10547 24661-24670 JJ denotes nucleated
T10546 24656-24660 RBR denotes more
T10545 24652-24655 VBP denotes are
T10544 24646-24651 EX denotes there
T10543 24641-24645 IN denotes that
T10542 24633-24640 VBN denotes noticed
T10541 24628-24632 VBP denotes have
T10540 24625-24627 PRP denotes we
T10539 24623-24624 , denotes ,
T10538 24609-24623 NN denotes erythropoiesis
T10537 24606-24608 IN denotes in
T10536 24598-24605 NNS denotes effects
T10535 24593-24597 JJ denotes Sox6
T10534 24587-24592 JJ denotes other
T10533 24583-24586 DT denotes the
T10532 24577-24582 IN denotes Among
T10531 24571-24576 NNP denotes Cells
T10530 24567-24570 NNP denotes Red
T10529 24557-24566 NNP denotes Nucleated
T10528 24554-24556 IN denotes of
T10527 24546-24553 NNS denotes Numbers
T10526 24539-24545 JJR denotes Higher
T10525 24534-24538 NNP denotes Have
T10524 24529-24533 NNP denotes Mice
T10523 24523-24528 NNP denotes p100H
T10522 24516-24522 JJ denotes Mutant
T10583 24832-24841 JJ denotes nucleated
T10582 24820-24831 VBG denotes circulating
T10581 24816-24819 VB denotes see
T10580 24812-24815 RB denotes not
T10579 24809-24811 VBP denotes do
T10578 24806-24808 PRP denotes we
T10577 24804-24805 , denotes ,
T10576 24800-24804 CD denotes 10.5
T10575 24796-24799 NN denotes day
T10574 24786-24795 JJ denotes postnatal
T10573 24783-24785 IN denotes at
T10572 24781-24782 , denotes ,
T10571 24774-24781 RB denotes However
T10570 24772-24773 . denotes .
T10569 24771-24772 -RRB- denotes )
T10568 24769-24771 NN denotes 7A
T10567 24762-24768 NN denotes Figure
T10566 24761-24762 -LRB- denotes (
T10565 24757-24760 NN denotes dpc
T10564 24752-24756 CD denotes 18.5
T10563 24748-24751 CC denotes and
T10562 24744-24747 NN denotes dpc
T10561 24739-24743 CD denotes 14.5
T10560 24736-24738 IN denotes at
T10559 24731-24735 NNS denotes mice
T10558 24728-24730 NNP denotes WT
T10557 24725-24727 IN denotes in
T10556 24720-24724 IN denotes than
T10555 24715-24719 NNS denotes mice
T10554 24708-24714 JJ denotes mutant
T10553 24702-24707 JJ denotes p100H
T10552 24699-24701 IN denotes in
T10551 24687-24698 VBG denotes circulating
T10550 24681-24686 NNS denotes cells
T10549 24675-24680 NN denotes blood
T10548 24671-24674 JJ denotes red
T10141 22755-22762 NN denotes pattern
T10140 22744-22754 NN denotes expression
T10139 22736-22743 JJ denotes spatial
T10138 22732-22735 CC denotes and
T10137 22723-22731 JJ denotes temporal
T10136 22719-22722 DT denotes the
T10135 22709-22718 VB denotes determine
T10134 22706-22708 TO denotes To
T10133 22704-22705 . denotes .
T10132 22690-22704 NNS denotes erythropoiesis
T10131 22679-22689 JJ denotes definitive
T10130 22676-22678 IN denotes in
T10129 22666-22675 NN denotes regulator
T10128 22656-22665 JJ denotes important
T10127 22653-22655 DT denotes an
T10126 22650-22652 VBZ denotes is
T10125 22645-22649 NNP denotes Sox6
T10124 22640-22644 IN denotes that
T10123 22631-22639 VBZ denotes suggests
T10122 22629-22630 , denotes ,
T10121 22623-22629 VBP denotes mature
T10120 22617-22622 NNS denotes cells
T10119 22607-22616 JJ denotes erythroid
T10118 22596-22606 JJ denotes definitive
T10117 22590-22595 WRB denotes where
T10116 22588-22589 , denotes ,
T10115 22583-22588 NN denotes liver
T10114 22580-22582 IN denotes in
T10113 22573-22579 NN denotes globin
T10112 22570-22572 JJ denotes ɛy
T10111 22562-22569 VBP denotes express
T10110 22550-22561 RB denotes ectopically
T9586 21564-21575 VBP denotes demonstrate
T9585 21559-21563 NNS denotes data
T9584 21553-21558 DT denotes These
T9583 21551-21552 . denotes .
T9582 21550-21551 -RRB- denotes )
T9581 21549-21550 NN denotes F
T9580 21545-21548 CC denotes and
T9579 21543-21544 NNP denotes E
T9578 21541-21542 CD denotes 5
T9577 21534-21540 NN denotes Figure
T9576 21533-21534 -LRB- denotes (
T9575 21528-21532 NNS denotes mice
T9574 21521-21527 JJ denotes mutant
T9573 21515-21520 NNP denotes p100H
T9572 21511-21514 CC denotes and
T9571 21508-21510 NNP denotes WT
T9570 21503-21507 DT denotes both
T9569 21500-21502 IN denotes in
T9568 21491-21499 JJ denotes abundant
T9567 21483-21490 RB denotes equally
T9566 21480-21482 VBZ denotes is
T9565 21473-21479 NN denotes globin
T9564 21469-21472 NN denotes min
T9563 21468-21469 NN denotes /
T9562 21464-21468 NN denotes βmaj
T9561 21461-21463 IN denotes of
T9560 21450-21460 NN denotes expression
T9559 21446-21449 DT denotes the
T9558 21444-21445 , denotes ,
T9557 21437-21444 RB denotes However
T9556 21435-21436 . denotes .
T9555 21434-21435 -RRB- denotes )
T9554 21433-21434 NNP denotes D
T9553 21431-21432 DT denotes A
T9552 21429-21430 CD denotes 5
T9551 21422-21428 NN denotes Figure
T9550 21421-21422 -LRB- denotes (
T9549 21413-21420 NNS denotes mutants
T9548 21404-21412 JJ denotes 14.5-dpc
T9547 21401-21403 IN denotes of
T9546 21395-21400 NN denotes liver
T9545 21391-21394 DT denotes the
T9544 21388-21390 IN denotes in
T9543 21383-21387 VBN denotes seen
T9542 21380-21382 VBZ denotes is
T9541 21369-21379 NN denotes expression
T9540 21364-21368 NNP denotes mRNA
T9539 21361-21363 NN denotes ɛy
T9538 21353-21360 JJ denotes ectopic
T9537 21344-21352 JJ denotes abundant
T9536 21342-21343 , denotes ,
T9535 21334-21342 NN denotes contrast
T9534 21331-21333 IN denotes In
T9533 21329-21330 . denotes .
T9532 21324-21329 NN denotes fetus
T9531 21320-21323 DT denotes the
T9530 21317-21319 IN denotes in
T9529 21302-21316 NNS denotes erythropoiesis
T9528 21291-21301 JJ denotes definitive
T9527 21288-21290 IN denotes of
T9526 21283-21287 NN denotes site
T9525 21279-21282 DT denotes the
T9524 21277-21278 , denotes ,
T9523 21272-21277 NN denotes liver
T9522 21263-21271 JJ denotes 14.5-dpc
T9521 21260-21262 NNP denotes WT
T9520 21256-21259 DT denotes the
T9519 21253-21255 IN denotes in
T9518 21243-21252 VBN denotes expressed
T9517 21239-21242 RB denotes not
T9516 21236-21238 VBZ denotes is
T9515 21229-21235 NN denotes globin
T9514 21226-21228 JJ denotes ɛy
T9513 21224-21225 , denotes ,
T9512 21216-21224 VBN denotes expected
T9511 21213-21215 IN denotes As
T9510 21211-21212 . denotes .
T9509 21210-21211 -RRB- denotes )
T9508 21209-21210 CD denotes 5
T9507 21202-21208 NN denotes Figure
T9506 21201-21202 -LRB- denotes (
T9505 21187-21200 NN denotes hybridization
T9504 21182-21186 NN denotes situ
T9503 21179-21181 IN denotes in
T9502 21176-21178 IN denotes by
T9501 21168-21175 NNS denotes embryos
T9500 21162-21167 NN denotes mouse
T9499 21159-21161 IN denotes in
T9498 21147-21158 NNS denotes transcripts
T9497 21140-21146 NN denotes globin
T9496 21137-21139 JJ denotes ɛy
T9495 21134-21136 IN denotes of
T9494 21126-21133 NN denotes pattern
T9493 21118-21125 JJ denotes spatial
T9492 21114-21117 DT denotes the
T9491 21105-21113 VBD denotes examined
T9490 21102-21104 PRP denotes we
T9489 21100-21101 , denotes ,
T9488 21088-21100 NNS denotes erythrocytes
T9487 21077-21087 JJ denotes definitive
T9486 21074-21076 IN denotes in
T9485 21067-21073 NN denotes globin
T9484 21064-21066 JJ denotes ɛy
T9483 21061-21063 IN denotes of
T9482 21050-21060 NN denotes expression
T9481 21042-21049 JJ denotes ectopic
T9480 21039-21041 TO denotes to
T9479 21035-21038 JJ denotes due
T9478 21032-21034 VBZ denotes is
T9477 21029-21031 CC denotes or
T9476 21016-21028 NNS denotes erythrocytes
T9475 21006-21015 JJ denotes primitive
T9474 20997-21005 JJ denotes residual
T9473 20994-20996 TO denotes to
T9472 20990-20993 JJ denotes due
T9471 20987-20989 VBZ denotes is
T9470 20980-20986 NN denotes globin
T9469 20977-20979 JJ denotes ɛy
T9468 20974-20976 IN denotes of
T9467 20963-20973 NN denotes expression
T9466 20952-20962 JJ denotes persistent
T9465 20948-20951 DT denotes the
T9464 20940-20947 IN denotes whether
T9463 20930-20939 VB denotes determine
T9462 20927-20929 TO denotes To
T9461 20925-20926 . denotes .
T9460 20913-20925 NNS denotes erythrocytes
T9459 20902-20912 JJ denotes definitive
T9458 20899-20901 IN denotes in
T9457 20890-20898 VBN denotes silenced
T9456 20886-20889 CC denotes and
T9455 20873-20885 NNS denotes erythrocytes
T9454 20863-20872 JJ denotes primitive
T9453 20860-20862 IN denotes in
T9452 20850-20859 VBN denotes expressed
T9451 20838-20849 RB denotes exclusively
T9450 20835-20837 VBZ denotes is
T9449 20830-20834 NN denotes gene
T9448 20823-20829 NN denotes globin
T9447 20820-20822 JJ denotes ɛy
T9446 20816-20819 DT denotes the
T9445 20814-20815 , denotes ,
T9444 20806-20814 NNP denotes Normally
T9443 20800-20805 NNP denotes Cells
T9442 20790-20799 NNP denotes Erythroid
T9441 20779-20789 NNP denotes Definitive
T9440 20776-20778 IN denotes in
T9439 20766-20775 NNP denotes Mechanism
T9438 20756-20765 VBG denotes Silencing
T9437 20748-20755 JJ denotes ɛy-Gene
T9436 20744-20747 DT denotes the
T9435 20741-20743 IN denotes in
T9434 20734-20740 NN denotes Defect
T9433 20732-20733 DT denotes a
T9432 20729-20731 TO denotes to
T9431 20725-20728 JJ denotes Due
T9430 20722-20724 VBZ denotes Is
T9429 20717-20721 NNP denotes Mice
T9428 20702-20716 NNP denotes Sox6-Deficient
T9427 20699-20701 IN denotes in
T9426 20692-20698 NNP denotes Globin
T9425 20689-20691 NNP denotes ɛy
T9424 20686-20688 IN denotes of
T9423 20675-20685 NNP denotes Expression
T9422 20664-20674 NNP denotes Persistent
T9421 20660-20663 DT denotes The
T9626 21802-21803 . denotes .
T9625 21798-21802 NNS denotes mice
T9624 21788-21797 JJ denotes Sox6-null
T9623 21785-21787 IN denotes in
T9622 21775-21784 NN denotes mechanism
T9621 21765-21774 VBG denotes silencing
T9620 21762-21764 NN denotes ɛy
T9619 21758-21761 DT denotes the
T9618 21755-21757 IN denotes of
T9617 21748-21754 NN denotes defect
T9616 21738-21747 JJ denotes intrinsic
T9615 21735-21737 DT denotes an
T9614 21732-21734 VBZ denotes is
T9613 21726-21731 EX denotes there
T9612 21721-21725 IN denotes that
T9611 21710-21720 VBG denotes suggesting
T9610 21708-21709 , denotes ,
T9609 21703-21708 NN denotes liver
T9608 21697-21702 JJ denotes fetal
T9607 21693-21696 DT denotes the
T9606 21690-21692 IN denotes in
T9605 21683-21689 VBP denotes mature
T9604 21678-21682 WDT denotes that
T9603 21672-21677 NNS denotes cells
T9602 21662-21671 JJ denotes erythroid
T9601 21651-21661 JJ denotes definitive
T9600 21647-21650 DT denotes the
T9599 21644-21646 IN denotes in
T9598 21633-21643 NN denotes expression
T9597 21625-21632 JJ denotes ectopic
T9596 21622-21624 TO denotes to
T9595 21618-21621 JJ denotes due
T9594 21614-21617 VBP denotes are
T9593 21611-21613 NN denotes ɛy
T9592 21608-21610 IN denotes of
T9591 21601-21607 NNS denotes levels
T9590 21596-21600 JJ denotes high
T9589 21585-21595 JJ denotes persistent
T9588 21581-21584 DT denotes the
T9587 21576-21580 IN denotes that
T8697 19830-19831 . denotes .
T8696 19825-19830 NN denotes dimer
T8695 19823-19824 DT denotes a
T8694 19820-19822 IN denotes as
T8693 19811-19819 RB denotes probably
T8692 19809-19810 , denotes ,
T8691 19801-19809 NN denotes promoter
T8690 19798-19800 JJ denotes ɛy
T8689 19794-19797 DT denotes the
T8688 19791-19793 TO denotes to
T8687 19783-19790 JJ denotes binding
T8686 19774-19782 RB denotes directly
T8685 19771-19773 IN denotes by
T8684 19766-19770 NN denotes gene
T8683 19763-19765 JJ denotes ɛy
T8682 19759-19762 DT denotes the
T8681 19756-19758 IN denotes of
T8680 19746-19755 NN denotes repressor
T8679 19744-19745 DT denotes a
T8678 19741-19743 IN denotes as
T8677 19736-19740 NNS denotes acts
T8676 19731-19735 JJ denotes Sox6
T8675 19726-19730 IN denotes that
T8674 19717-19725 VBP denotes indicate
T8673 19709-19716 RB denotes clearly
T8672 19707-19708 -RRB- denotes )
T8671 19706-19707 CD denotes 4
T8670 19702-19705 CC denotes and
T8669 19700-19701 CD denotes 3
T8668 19692-19699 NNS denotes Figures
T8667 19691-19692 -LRB- denotes (
T8666 19686-19690 NNS denotes data
T8665 19680-19685 IN denotes above
T8664 19676-19679 DT denotes The
T8663 19674-19675 . denotes .
T8662 19673-19674 -RRB- denotes )
T8661 19671-19673 NN denotes 4A
T8660 19664-19670 NN denotes Figure
T8659 19663-19664 -LRB- denotes (
T8658 19655-19662 NN denotes control
T8657 19646-19654 JJ denotes negative
T8656 19644-19645 DT denotes a
T8655 19641-19643 IN denotes as
T8654 19636-19640 VBN denotes used
T8653 19632-19635 VBD denotes was
T8652 19628-19631 NNP denotes IgG
T8651 19621-19627 JJ denotes Normal
T8650 19619-19620 . denotes .
T8649 19614-19619 NNS denotes cells
T8648 19608-19613 NN denotes liver
T8647 19604-19607 CC denotes and
T8646 19598-19603 NNS denotes cells
T8645 19594-19597 NNP denotes MEL
T8644 19589-19593 DT denotes both
T8643 19586-19588 IN denotes in
T8642 19577-19585 NN denotes antibody
T8641 19572-19576 JJ denotes Sox6
T8640 19567-19571 IN denotes with
T8639 19548-19566 VBN denotes immunoprecipitated
T8638 19540-19547 RB denotes readily
T8637 19537-19539 VBZ denotes is
T8636 19528-19536 NN denotes promoter
T8635 19519-19527 JJ denotes proximal
T8634 19516-19518 JJ denotes ɛy
T8633 19512-19515 DT denotes the
T8632 19507-19511 IN denotes that
T8631 19501-19506 NNS denotes shows
T8630 19499-19500 CD denotes 4
T8629 19492-19498 NN denotes Figure
T8628 19490-19491 . denotes .
T8627 19482-19490 NN denotes antibody
T8626 19477-19481 JJ denotes Sox6
T8625 19471-19476 VBG denotes using
T8624 19466-19470 NNS denotes mice
T8623 19463-19465 NNP denotes WT
T8622 19459-19462 NN denotes dpc
T8621 19454-19458 CD denotes 15.5
T8620 19451-19453 IN denotes of
T8619 19445-19450 NNS denotes cells
T8618 19439-19444 NN denotes liver
T8617 19434-19438 IN denotes from
T8616 19431-19433 CC denotes or
T8615 19425-19430 NNS denotes cells
T8614 19421-19424 NNP denotes MEL
T8613 19416-19420 IN denotes from
T8612 19397-19415 VBN denotes immunoprecipitated
T8611 19393-19396 VBD denotes was
T8610 19385-19392 NN denotes complex
T8609 19369-19384 JJ denotes Sox6-containing
T8608 19365-19368 DT denotes The
T8607 19363-19364 . denotes .
T8606 19362-19363 -RRB- denotes )
T8605 19361-19362 CD denotes 4
T8604 19354-19360 NN denotes Figure
T8603 19353-19354 -LRB- denotes (
T8602 19351-19352 -RRB- denotes )
T8601 19347-19351 NNP denotes ChIP
T8600 19346-19347 -LRB- denotes (
T8599 19326-19345 NN denotes immunoprecipitation
T8598 19316-19325 NN denotes chromatin
T8597 19310-19315 VBG denotes using
T8596 19305-19309 NN denotes vivo
T8595 19302-19304 IN denotes in
T8594 19293-19301 NN denotes promoter
T8593 19290-19292 JJ denotes ɛy
T8592 19286-19289 DT denotes the
T8591 19283-19285 TO denotes to
T8590 19277-19282 NNS denotes binds
T8589 19272-19276 JJ denotes Sox6
T8588 19264-19271 IN denotes whether
T8587 19257-19263 VBD denotes tested
T8586 19252-19256 RB denotes also
T8585 19249-19251 PRP denotes We
T8584 19247-19248 . denotes .
T8583 19241-19247 NN denotes degree
T8582 19236-19240 JJ denotes same
T8581 19232-19235 DT denotes the
T8580 19229-19231 TO denotes to
T8579 19225-19228 RB denotes not
T8578 19221-19224 CC denotes but
T8577 19219-19220 , denotes ,
T8576 19215-19219 NNP denotes Sox6
T8575 19212-19214 IN denotes by
T8574 19209-19211 NN denotes ɛy
T8573 19206-19208 IN denotes of
T8572 19195-19205 NN denotes repression
T8571 19187-19194 JJ denotes maximal
T8570 19183-19186 IN denotes for
T8569 19174-19182 VBN denotes required
T8568 19170-19173 VBP denotes are
T8567 19164-19169 NNS denotes sites
T8566 19159-19163 DT denotes both
T8565 19157-19158 , denotes ,
T8564 19153-19157 RB denotes Thus
T8563 19151-19152 . denotes .
T8562 19150-19151 -RRB- denotes )
T8561 19148-19150 CD denotes 3F
T8560 19141-19147 NN denotes Figure
T8559 19140-19141 -LRB- denotes (
T8558 19132-19139 NNS denotes studies
T8557 19119-19131 NN denotes transfection
T8556 19116-19118 IN denotes in
T8555 19105-19115 NN denotes repression
T8554 19096-19104 NN denotes promoter
T8553 19084-19095 JJ denotes significant
T8552 19081-19083 IN denotes in
T8551 19074-19080 VB denotes result
T8550 19070-19073 RB denotes not
T8549 19067-19069 VBP denotes do
T8548 19065-19066 -RRB- denotes )
T8547 19054-19065 VBN denotes mutagenized
T8546 19048-19053 NNS denotes sites
T8545 19040-19047 JJ denotes binding
T8544 19031-19039 JJ denotes Sox/Sox6
T8543 19026-19030 DT denotes both
T8542 19023-19025 CC denotes or
T8541 19019-19022 CD denotes one
T8540 19012-19018 DT denotes either
T8539 19007-19011 IN denotes with
T8538 19006-19007 -LRB- denotes (
T8537 18995-19005 NNS denotes constructs
T8536 18986-18994 NN denotes reporter
T8535 18977-18985 NN denotes promoter
T8534 18974-18976 NN denotes ɛy
T8533 18967-18973 JJ denotes mutant
T8532 18963-18966 DT denotes the
T8531 18961-18962 , denotes ,
T8530 18954-18961 NNS denotes results
T8529 18949-18953 NNP denotes EMSA
T8528 18945-18948 DT denotes the
T8527 18940-18944 IN denotes with
T8526 18929-18939 JJ denotes Consistent
T8525 18927-18928 . denotes .
T8524 18922-18927 NNS denotes cells
T8523 18916-18921 NNP denotes GM979
T8522 18911-18915 IN denotes into
T8521 18904-18910 NN denotes vector
T8520 18889-18903 NN denotes overexpression
T8519 18884-18888 JJ denotes Sox6
T8518 18880-18883 DT denotes the
T8517 18875-18879 IN denotes with
T8516 18860-18874 VBN denotes co-transfected
T8515 18855-18859 VBD denotes were
T8514 18849-18854 NNS denotes sites
T8513 18841-18848 JJ denotes binding
T8512 18832-18840 NNP denotes Sox/Sox6
T8511 18820-18831 VBN denotes mutagenized
T8510 18815-18819 IN denotes with
T8509 18804-18814 NNS denotes constructs
T8508 18795-18803 NN denotes reporter
T8507 18786-18794 NN denotes promoter
T8506 18783-18785 JJ denotes ɛy
T8505 18779-18782 DT denotes the
T8504 18777-18778 , denotes ,
T8503 18772-18777 NNS denotes sites
T8502 18764-18771 JJ denotes binding
T8501 18755-18763 NNP denotes Sox/Sox6
T8500 18748-18754 JJ denotes intact
T8499 18744-18747 DT denotes the
T8498 18741-18743 IN denotes of
T8497 18728-18740 NN denotes significance
T8496 18717-18727 JJ denotes functional
T8495 18713-18716 DT denotes the
T8494 18701-18712 VB denotes investigate
T8493 18698-18700 TO denotes To
T8492 18696-18697 . denotes .
T8491 18689-18696 JJ denotes binding
T8490 18686-18688 NNP denotes WT
T8489 18681-18685 IN denotes with
T8488 18671-18680 RB denotes partially
T8487 18663-18670 VB denotes compete
T8486 18659-18662 MD denotes may
T8221 17340-17343 DT denotes The
T8220 17338-17339 . denotes .
T8219 17336-17338 NN denotes 3A
T8218 17329-17335 NN denotes Figure
T8217 17326-17328 IN denotes in
T8216 17319-17325 VBN denotes listed
T8215 17315-17318 VBP denotes are
T8214 17310-17314 VBN denotes used
T8213 17303-17309 NNS denotes probes
T8212 17299-17302 DT denotes The
T8211 17297-17298 . denotes .
T8210 17291-17297 NN denotes system
T8209 17285-17290 NN denotes vitro
T8208 17282-17284 IN denotes in
T8207 17256-17281 NN denotes transcription/translation
T8206 17243-17255 JJ denotes lysate-based
T8205 17230-17242 NN denotes reticulocyte
T8204 17228-17229 DT denotes a
T8203 17225-17227 IN denotes in
T8202 17220-17224 NN denotes Sox6
T8201 17207-17219 JJ denotes c-Myc-tagged
T8200 17205-17206 DT denotes a
T8199 17199-17204 VBG denotes using
T8198 17197-17198 -RRB- denotes )
T8197 17193-17197 NNP denotes EMSA
T8196 17192-17193 -LRB- denotes (
T8195 17185-17191 NNS denotes assays
T8194 17179-17184 NN denotes shift
T8193 17170-17178 NN denotes mobility
T8192 17154-17169 JJ denotes electrophoretic
T8191 17144-17153 VBD denotes performed
T8190 17138-17143 RB denotes first
T8189 17135-17137 PRP denotes we
T8188 17133-17134 , denotes ,
T8187 17125-17133 NN denotes promoter
T8186 17122-17124 JJ denotes ɛy
T8185 17118-17121 DT denotes the
T8184 17113-17117 IN denotes with
T8183 17102-17112 VBN denotes associated
T8182 17093-17101 RB denotes directly
T8181 17090-17092 VBZ denotes is
T8180 17085-17089 NNP denotes Sox6
T8179 17077-17084 IN denotes whether
T8178 17065-17076 VB denotes investigate
T8177 17062-17064 TO denotes To
T8176 17060-17061 . denotes .
T8175 17052-17060 NN denotes promoter
T8174 17049-17051 JJ denotes ɛy
T8173 17045-17048 DT denotes the
T8172 17035-17044 VBG denotes affecting
T8171 17021-17034 NNS denotes intermediates
T8170 17010-17020 VBG denotes regulating
T8169 17007-17009 IN denotes by
T8168 17004-17006 CC denotes or
T8167 16995-17003 NN denotes promoter
T8166 16991-16994 DT denotes the
T8165 16986-16990 IN denotes with
T8164 16978-16985 NN denotes contact
T8163 16969-16977 JJ denotes physical
T8162 16962-16968 JJ denotes direct
T8161 16954-16961 IN denotes through
T8160 16947-16953 CC denotes either
T8159 16945-16946 , denotes ,
T8158 16937-16945 NN denotes promoter
T8157 16934-16936 JJ denotes ɛy
T8156 16930-16933 DT denotes the
T8155 16922-16929 VB denotes repress
T8154 16916-16921 MD denotes might
T8153 16911-16915 NNP denotes Sox6
T8152 16902-16910 NNP denotes Promoter
T8151 16899-16901 NN denotes ɛy
T8150 16895-16898 DT denotes the
T8149 16892-16894 TO denotes to
T8148 16886-16891 VBZ denotes Binds
T8147 16877-16885 RB denotes Directly
T8146 16872-16876 NNP denotes Sox6
T8145 16867-16871 IN denotes that
T8144 16862-16866 NNP denotes Show
T8143 16855-16861 NNP denotes Assays
T8142 16850-16854 NNP denotes ChIP
T8141 16846-16849 CC denotes and
T8140 16841-16845 NNP denotes EMSA
T8411 18311-18314 RB denotes not
T8410 18307-18310 CC denotes but
T8409 18305-18306 , denotes ,
T8408 18298-18305 NNS denotes globins
T8407 18296-18297 NN denotes β
T8406 18290-18295 NN denotes adult
T8405 18282-18289 JJ denotes express
T8404 18280-18281 , denotes ,
T8403 18276-18280 NN denotes line
T8402 18271-18275 NN denotes cell
T8401 18255-18270 JJ denotes erythroleukemic
T8400 18248-18254 JJ denotes murine
T8399 18246-18247 DT denotes a
T8398 18244-18245 , denotes ,
T8397 18239-18244 NNS denotes cells
T8396 18235-18238 NNP denotes MEL
T8395 18233-18234 . denotes .
T8394 18228-18233 NN denotes probe
T8393 18222-18227 JJ denotes 36-bp
T8392 18217-18221 JJ denotes same
T8391 18213-18216 DT denotes the
T8390 18203-18212 VBG denotes employing
T8389 18198-18202 NNP denotes EMSA
T8388 18195-18197 IN denotes in
T8387 18190-18194 VBN denotes used
T8386 18185-18189 VBD denotes were
T8385 18179-18184 NNS denotes cells
T8384 18175-18178 NNP denotes MEL
T8383 18170-18174 IN denotes from
T8382 18161-18169 NNS denotes extracts
T8381 18153-18160 JJ denotes nuclear
T8380 18151-18152 , denotes ,
T8379 18147-18151 JJ denotes Next
T8378 18145-18146 . denotes .
T8377 18144-18145 -RRB- denotes )
T8376 18142-18144 NN denotes 3C
T8375 18135-18141 NN denotes Figure
T8374 18134-18135 -LRB- denotes (
T8373 18126-18133 NNS denotes results
T8372 18120-18125 DT denotes these
T8371 18110-18119 VBD denotes confirmed
T8370 18105-18109 WDT denotes that
T8369 18100-18104 NNP denotes EMSA
T8368 18092-18099 DT denotes another
T8367 18089-18091 IN denotes in
T8366 18084-18088 VBN denotes used
T8365 18080-18083 VBD denotes was
T8364 18075-18079 NN denotes Sox6
T8363 18065-18074 JJ denotes HA-tagged
T8362 18062-18064 DT denotes an
T8361 18060-18061 , denotes ,
T8360 18055-18060 NN denotes probe
T8359 18051-18054 DT denotes the
T8358 18048-18050 TO denotes to
T8357 18042-18047 VBZ denotes binds
T8356 18035-18041 PRP denotes itself
T8355 18031-18034 NN denotes tag
T8354 18025-18030 JJ denotes c-Myc
T8353 18021-18024 DT denotes the
T8352 18016-18020 IN denotes that
T8351 18004-18015 NN denotes possibility
T8350 18000-18003 DT denotes the
T8349 17996-17999 RP denotes out
T8348 17991-17995 VB denotes rule
T8347 17988-17990 TO denotes To
T8346 17986-17987 . denotes .
T8345 17973-17986 JJ denotes Sox6-specific
T8344 17970-17972 VBZ denotes is
T8343 17962-17969 JJ denotes binding
T8342 17958-17961 DT denotes the
T8341 17953-17957 IN denotes that
T8340 17942-17952 VBG denotes indicating
T8339 17940-17941 , denotes ,
T8338 17936-17940 NN denotes band
T8337 17932-17935 DT denotes the
T8336 17921-17931 VBP denotes supershift
T8335 17910-17920 NNS denotes antibodies
T8334 17905-17909 JJ denotes Sox6
T8333 17901-17904 CC denotes and
T8332 17895-17900 JJ denotes c-Myc
T8331 17890-17894 DT denotes both
T8330 17888-17889 , denotes ,
T8329 17880-17888 RB denotes Moreover
T8328 17878-17879 . denotes .
T8327 17871-17878 NN denotes protein
T8326 17866-17870 NNP denotes Sox6
T8325 17859-17865 VBN denotes tagged
T8324 17855-17858 DT denotes the
T8323 17852-17854 IN denotes by
T8322 17844-17851 VBN denotes shifted
T8321 17840-17843 VBD denotes was
T8320 17834-17839 NN denotes probe
T8319 17828-17833 JJ denotes 36-bp
T8318 17824-17827 DT denotes The
T8317 17822-17823 . denotes .
T8316 17821-17822 -RRB- denotes )
T8315 17819-17821 CD denotes 2C
T8314 17812-17818 NN denotes Figure
T8313 17811-17812 -LRB- denotes (
T8312 17799-17810 NNS denotes experiments
T8311 17790-17798 NN denotes analysis
T8310 17781-17789 NN denotes deletion
T8309 17777-17780 DT denotes the
T8308 17774-17776 IN denotes by
T8307 17766-17773 VBN denotes defined
T8306 17757-17765 NN denotes promoter
T8305 17754-17756 JJ denotes ɛy
T8304 17750-17753 DT denotes the
T8303 17743-17749 IN denotes within
T8302 17741-17742 -RRB- denotes )
T8301 17739-17741 NN denotes 3B
T8300 17732-17738 NN denotes Figure
T8299 17731-17732 -LRB- denotes (
T8298 17724-17730 NN denotes region
T8297 17718-17723 JJ denotes 36-bp
T8296 17714-17717 DT denotes the
T8295 17709-17713 IN denotes with
T8294 17699-17708 JJ denotes associate
T8293 17688-17698 RB denotes physically
T8292 17685-17687 TO denotes to
T8291 17680-17684 JJ denotes able
T8290 17677-17679 VBZ denotes is
T8289 17672-17676 NNP denotes Sox6
T8288 17670-17671 . denotes .
T8287 17669-17670 -RRB- denotes )
T8286 17667-17669 NN denotes 3A
T8285 17660-17666 NN denotes Figure
T8284 17659-17660 -LRB- denotes (
T8283 17653-17658 NNS denotes sites
T8282 17645-17652 JJ denotes binding
T8281 17636-17644 NNP denotes Sox/Sox6
T8280 17633-17635 IN denotes in
T8279 17631-17632 -RRB- denotes )
T8278 17629-17631 CD denotes M3
T8277 17625-17628 CC denotes and
T8276 17622-17624 CD denotes M2
T8275 17621-17622 -LRB- denotes (
T8274 17613-17620 VBN denotes mutated
T8273 17610-17612 CC denotes or
T8272 17608-17609 , denotes ,
T8271 17607-17608 -RRB- denotes )
T8270 17605-17607 CD denotes M1
T8269 17604-17605 -LRB- denotes (
T8268 17594-17603 VBN denotes truncated
T8267 17587-17593 CC denotes either
T8266 17585-17586 , denotes ,
T8265 17582-17585 VBP denotes are
T8264 17577-17581 WDT denotes that
T8263 17570-17576 NNS denotes probes
T8262 17562-17569 VBN denotes mutated
T8261 17556-17561 CD denotes three
T8260 17552-17555 VBP denotes are
T8259 17547-17551 NNP denotes EMSA
T8258 17543-17546 PRP$ denotes our
T8257 17540-17542 IN denotes in
T8256 17531-17539 VBN denotes included
T8255 17526-17530 RB denotes Also
T8254 17524-17525 . denotes .
T8253 17519-17524 NNS denotes sites
T8252 17511-17518 JJ denotes binding
T8251 17502-17510 NNP denotes Sox/Sox6
T8250 17492-17501 NN denotes consensus
T8249 17488-17491 CD denotes two
T8248 17479-17487 VBZ denotes contains
T8247 17473-17478 NN denotes probe
T8246 17468-17472 DT denotes This
T8245 17466-17467 . denotes .
T8244 17458-17466 NNS denotes analyses
T8243 17449-17457 NN denotes deletion
T8242 17440-17448 NN denotes promoter
T8241 17436-17439 PRP$ denotes our
T8240 17433-17435 IN denotes in
T8239 17425-17432 VBN denotes defined
T8238 17416-17424 NN denotes promoter
T8237 17413-17415 JJ denotes ɛy
T8236 17409-17412 DT denotes the
T8235 17406-17408 IN denotes of
T8234 17399-17405 NN denotes region
T8233 17390-17398 JJ denotes critical
T8232 17386-17389 DT denotes the
T8231 17383-17385 TO denotes to
T8230 17371-17382 NNS denotes corresponds
T8229 17365-17370 NN denotes probe
T8228 17362-17364 NN denotes WT
T8227 17360-17361 -RRB- denotes )
T8226 17358-17360 NN denotes bp
T8225 17357-17358 -LRB- denotes (
T8224 17352-17356 NN denotes pair
T8223 17347-17351 NN denotes base
T8222 17344-17346 CD denotes 36
T8485 18653-18658 NN denotes probe
T8484 18646-18652 JJ denotes mutant
T8483 18643-18645 NNP denotes M2
T8482 18639-18642 DT denotes The
T8481 18637-18638 . denotes .
T8480 18636-18637 -RRB- denotes )
T8479 18634-18636 NNP denotes 3E
T8478 18627-18633 NNP denotes Figure
T8477 18626-18627 -LRB- denotes (
T8476 18621-18625 NNP denotes EMSA
T8475 18618-18620 IN denotes in
T8474 18610-18617 VB denotes compete
T8473 18607-18609 TO denotes to
T8472 18599-18606 NN denotes ability
T8471 18593-18598 PRP$ denotes their
T8470 18585-18592 VBP denotes abolish
T8469 18583-18584 -RRB- denotes )
T8468 18581-18583 CD denotes M3
T8467 18577-18580 CC denotes and
T8466 18574-18576 CD denotes M1
T8465 18573-18574 -LRB- denotes (
T8464 18567-18572 NNS denotes sites
T8463 18559-18566 JJ denotes binding
T8462 18550-18558 NNP denotes Sox/Sox6
T8461 18541-18549 JJ denotes putative
T8460 18538-18540 IN denotes of
T8459 18529-18537 NNP denotes Ablation
T8458 18527-18528 . denotes .
T8457 18526-18527 -RRB- denotes )
T8456 18524-18526 CD denotes 3E
T8455 18517-18523 NN denotes Figure
T8454 18516-18517 -LRB- denotes (
T8453 18510-18515 NN denotes assay
T8452 18498-18509 NN denotes competition
T8451 18494-18497 DT denotes the
T8450 18491-18493 IN denotes in
T8449 18485-18490 VBN denotes shown
T8448 18482-18484 IN denotes as
T8447 18480-18481 , denotes ,
T8446 18473-18480 JJ denotes binding
T8445 18469-18472 DT denotes the
T8444 18465-18468 IN denotes for
T8443 18456-18464 VBN denotes required
T8442 18452-18455 VBP denotes are
T8441 18446-18451 NN denotes probe
T8440 18442-18445 NNP denotes DNA
T8439 18438-18441 DT denotes the
T8438 18435-18437 IN denotes of
T8437 18429-18434 NNS denotes sites
T8436 18421-18428 JJ denotes binding
T8435 18412-18420 NNP denotes Sox/Sox6
T8434 18402-18411 NN denotes consensus
T8433 18395-18401 JJ denotes intact
T8432 18391-18394 DT denotes The
T8431 18389-18390 . denotes .
T8430 18388-18389 -RRB- denotes )
T8429 18386-18388 CD denotes 3D
T8428 18379-18385 NN denotes Figure
T8427 18378-18379 -LRB- denotes (
T8426 18372-18377 NNS denotes cells
T8425 18368-18371 NNP denotes MEL
T8424 18365-18367 IN denotes in
T8423 18356-18364 NN denotes sequence
T8422 18352-18355 NN denotes DNA
T8421 18347-18351 DT denotes this
T8420 18344-18346 TO denotes to
T8419 18338-18343 VBZ denotes binds
T8418 18329-18337 RB denotes directly
T8417 18324-18328 JJ denotes Sox6
T8416 18322-18323 . denotes .
T8415 18321-18322 NNP denotes ]
T8414 18319-18321 CD denotes 33
T8413 18318-18319 NNP denotes [
T8412 18315-18317 VB denotes ɛy
T6763 14271-14272 . denotes .
T6762 14270-14271 -RRB- denotes )
T6761 14268-14270 NNP denotes 3A
T6760 14261-14267 NNP denotes Figure
T6759 14260-14261 -LRB- denotes (
T6758 14258-14259 NNP denotes ]
T6757 14257-14258 CD denotes 5
T6756 14256-14257 VBP denotes [
T6755 14250-14255 NNS denotes sites
T6754 14242-14249 JJ denotes binding
T6753 14232-14241 NN denotes consensus
T6752 14223-14231 JJ denotes Sox/Sox6
T6751 14219-14222 CD denotes two
T6750 14211-14218 VBZ denotes reveals
T6749 14204-14210 NN denotes region
T6748 14198-14203 JJ denotes short
T6747 14193-14197 DT denotes this
T6746 14190-14192 IN denotes of
T6745 14181-14189 NN denotes Analysis
T6744 14179-14180 . denotes .
T6743 14169-14179 NN denotes repression
T6742 14164-14168 JJ denotes Sox6
T6741 14160-14163 IN denotes for
T6740 14151-14159 JJ denotes critical
T6739 14148-14150 VBZ denotes is
T6738 14143-14147 WDT denotes that
T6737 14134-14142 NN denotes promoter
T6736 14125-14133 JJ denotes proximal
T6735 14122-14124 JJ denotes ɛy
T6734 14118-14121 DT denotes the
T6733 14111-14117 IN denotes within
T6732 14109-14110 -RRB- denotes )
T6731 14107-14109 CD denotes 37
T6730 14106-14107 CD denotes −
T6729 14103-14105 TO denotes to
T6728 14100-14102 CD denotes 63
T6727 14099-14100 FW denotes −
T6726 14098-14099 -LRB- denotes (
T6725 14091-14097 NN denotes region
T6724 14089-14090 DT denotes a
T6723 14081-14088 VBD denotes defined
T6722 14079-14080 , denotes ,
T6721 14077-14079 CD denotes 2C
T6720 14070-14076 NN denotes Figure
T6719 14067-14069 IN denotes in
T6718 14061-14066 VBN denotes shown
T6717 14058-14060 IN denotes as
T6716 14056-14057 , denotes ,
T6715 14048-14056 NN denotes promoter
T6714 14045-14047 JJ denotes ɛy
T6713 14041-14044 DT denotes the
T6712 14038-14040 IN denotes of
T6711 14029-14037 NN denotes analysis
T6710 14020-14028 NN denotes Deletion
T6709 14018-14019 . denotes .
T6708 14012-14018 NN denotes manner
T6707 13994-14011 JJ denotes CtBP2-independent
T6706 13992-13993 DT denotes a
T6705 13989-13991 IN denotes in
T6704 13980-13988 NN denotes promoter
T6703 13977-13979 JJ denotes ɛy
T6702 13973-13976 DT denotes the
T6701 13963-13972 NNS denotes represses
T6700 13958-13962 JJ denotes Sox6
T6699 13953-13957 IN denotes that
T6698 13942-13952 VBG denotes indicating
T6697 13940-13941 , denotes ,
T6696 13939-13940 -RRB- denotes )
T6695 13937-13939 NN denotes 2B
T6694 13930-13936 NN denotes Figure
T6693 13929-13930 -LRB- denotes (
T6692 13923-13928 NN denotes assay
T6691 13910-13922 NN denotes transfection
T6690 13906-13909 DT denotes the
T6689 13903-13905 IN denotes in
T6688 13894-13902 NN denotes promoter
T6687 13891-13893 JJ denotes ɛy
T6686 13887-13890 DT denotes the
T6685 13879-13886 VB denotes repress
T6684 13876-13878 TO denotes to
T6683 13868-13875 NN denotes ability
T6682 13864-13867 DT denotes the
T6681 13856-13863 VBZ denotes retains
T6680 13851-13855 JJ denotes Sox6
T6679 13848-13850 IN denotes of
T6678 13840-13847 NN denotes version
T6677 13833-13839 JJ denotes mutant
T6676 13828-13832 DT denotes this
T6675 13826-13827 , denotes ,
T6674 13819-13826 RB denotes However
T6673 13817-13818 . denotes .
T6672 13811-13817 NN denotes domain
T6671 13803-13810 JJ denotes binding
T6670 13799-13802 NNP denotes DNA
T6669 13795-13798 NNP denotes HMG
T6668 13791-13794 DT denotes the
T6667 13788-13790 IN denotes in
T6666 13784-13787 RB denotes not
T6665 13781-13783 VBZ denotes is
T6664 13774-13780 NN denotes change
T6663 13769-13773 NN denotes acid
T6662 13763-13768 JJ denotes amino
T6661 13758-13762 DT denotes This
T6660 13756-13757 . denotes .
T6659 13755-13756 NNP denotes ]
T6658 13754-13755 CD denotes 5
T6657 13753-13754 NN denotes [
T6656 13741-13752 NN denotes interaction
T6655 13730-13740 JJ denotes Sox6-CtBP2
T6654 13722-13729 VB denotes abolish
T6653 13719-13721 TO denotes to
T6652 13708-13718 JJ denotes sufficient
T6651 13705-13707 VB denotes be
T6650 13702-13704 TO denotes to
T6649 13693-13701 VBN denotes reported
T6648 13682-13692 RB denotes previously
T6647 13677-13681 VBN denotes been
T6646 13673-13676 VBZ denotes has
T6645 13668-13672 WDT denotes that
T6644 13660-13667 NN denotes protein
T6643 13655-13659 JJ denotes Sox6
T6642 13651-13654 DT denotes the
T6641 13648-13650 IN denotes in
T6640 13646-13647 -RRB- denotes )
T6639 13641-13646 NNP denotes L386H
T6638 13640-13641 -LRB- denotes (
T6637 13631-13639 NN denotes mutation
T6636 13625-13630 NN denotes point
T6635 13623-13624 DT denotes a
T6634 13612-13622 VBD denotes introduced
T6633 13609-13611 PRP denotes we
T6632 13607-13608 , denotes ,
T6631 13599-13607 NN denotes promoter
T6630 13596-13598 JJ denotes ɛy
T6629 13592-13595 DT denotes the
T6628 13589-13591 IN denotes of
T6627 13578-13588 NN denotes repression
T6626 13573-13577 JJ denotes Sox6
T6625 13569-13572 IN denotes for
T6624 13560-13568 VBN denotes required
T6623 13557-13559 VBZ denotes is
T6622 13551-13556 NNP denotes CtBP2
T6621 13546-13550 IN denotes with
T6620 13534-13545 NN denotes interaction
T6619 13530-13533 DT denotes the
T6618 13522-13529 IN denotes whether
T6617 13510-13521 VB denotes investigate
T6616 13507-13509 TO denotes To
T6615 13505-13506 . denotes .
T6614 13504-13505 -RRB- denotes )
T6613 13500-13504 NNS denotes data
T6612 13488-13499 JJ denotes unpublished
T6611 13487-13488 -LRB- denotes (
T6610 13481-13486 NNS denotes cells
T6609 13475-13480 NNP denotes GM979
T6608 13472-13474 IN denotes in
T6607 13462-13471 VBN denotes expressed
T6606 13459-13461 VBZ denotes is
T6605 13453-13458 NNP denotes CtBP2
T6604 13451-13452 . denotes .
T6603 13450-13451 NNP denotes ]
T6602 13449-13450 CD denotes 5
T6601 13448-13449 NN denotes [
T6600 13439-13447 NN denotes promoter
T6599 13433-13438 JJ denotes fgf-3
T6598 13429-13432 DT denotes the
T6597 13426-13428 IN denotes on
T6596 13424-13425 , denotes ,
T6595 13419-13424 NNP denotes CtBP2
T6594 13417-13418 , denotes ,
T6593 13405-13417 NN denotes co-repressor
T6592 13395-13404 VBN denotes expressed
T6591 13388-13394 RB denotes widely
T6590 13386-13387 DT denotes a
T6589 13381-13385 IN denotes with
T6588 13372-13380 VB denotes interact
T6587 13369-13371 TO denotes to
T6586 13365-13368 CC denotes and
T6585 13355-13364 NN denotes repressor
T6584 13353-13354 DT denotes a
T6583 13350-13352 IN denotes as
T6582 13346-13349 VB denotes act
T6581 13343-13345 TO denotes to
T6580 13337-13342 VBN denotes shown
T6579 13332-13336 VBN denotes been
T6578 13328-13331 VBZ denotes has
T6577 13323-13327 NNP denotes Sox6
T6576 11940-11941 . denotes .
T6575 11935-11940 NN denotes level
T6574 11919-11934 JJ denotes transcriptional
T6573 11915-11918 DT denotes the
T6572 11912-11914 IN denotes at
T6571 11903-11911 NN denotes promoter
T6570 11900-11902 JJ denotes ɛy
T6569 11896-11899 DT denotes the
T6447 11291-11292 . denotes .
T6446 11290-11291 NNP denotes ]
T6445 11288-11290 CD denotes 30
T6444 11287-11288 NNP denotes [
T6443 11279-11286 NNS denotes globins
T6442 11274-11278 JJ denotes beta
T6441 11268-11273 NN denotes adult
T6440 11264-11267 CC denotes and
T6439 11261-11263 NN denotes ɛy
T6438 11256-11260 DT denotes both
T6437 11246-11255 VBZ denotes expresses
T6436 11241-11245 WDT denotes that
T6435 11236-11240 NN denotes line
T6434 11231-11235 NN denotes cell
T6433 11215-11230 JJ denotes erythroleukemic
T6432 11208-11214 JJ denotes murine
T6431 11206-11207 DT denotes a
T6430 11204-11205 , denotes ,
T6429 11199-11204 NNS denotes cells
T6428 11193-11198 NNP denotes GM979
T6427 11189-11192 CC denotes and
T6426 11183-11188 NN denotes assay
T6425 11170-11182 NN denotes transfection
T6424 11160-11169 NN denotes transient
T6423 11154-11159 NN denotes vitro
T6422 11151-11153 IN denotes in
T6421 11148-11150 DT denotes an
T6420 11143-11147 VBD denotes used
T6419 11140-11142 PRP denotes we
T6418 11138-11139 , denotes ,
T6417 11133-11138 NN denotes level
T6416 11117-11132 JJ denotes transcriptional
T6415 11113-11116 DT denotes the
T6414 11110-11112 IN denotes at
T6413 11101-11109 NN denotes promoter
T6412 11096-11100 NN denotes gene
T6411 11093-11095 JJ denotes ɛy
T6410 11089-11092 DT denotes the
T6409 11086-11088 IN denotes on
T6408 11081-11085 VBZ denotes acts
T6407 11072-11080 RB denotes directly
T6406 11067-11071 JJ denotes Sox6
T6405 11059-11066 IN denotes whether
T6404 11047-11058 VB denotes investigate
T6403 11044-11046 TO denotes To
T6402 11042-11043 . denotes .
T6401 11034-11042 NN denotes promoter
T6400 11031-11033 JJ denotes ɛy
T6399 11027-11030 DT denotes the
T6398 11024-11026 IN denotes of
T6397 11015-11023 NN denotes activity
T6396 10999-11014 JJ denotes transcriptional
T6395 10995-10998 RB denotes not
T6394 10993-10994 , denotes ,
T6393 10989-10993 NNP denotes mRNA
T6392 10986-10988 JJ denotes ɛy
T6391 10983-10985 IN denotes of
T6390 10976-10982 NNS denotes levels
T6389 10963-10975 JJ denotes steady-state
T6388 10955-10962 NN denotes measure
T6387 10953-10954 -RRB- denotes )
T6386 10952-10953 CD denotes 1
T6385 10945-10951 NN denotes Figure
T6384 10944-10945 -LRB- denotes (
T6383 10937-10943 NNS denotes assays
T6382 10933-10936 NNP denotes PCR
T6381 10923-10932 JJ denotes Real-time
T6380 10917-10922 NNP denotes Level
T6379 10901-10916 NNP denotes Transcriptional
T6378 10897-10900 DT denotes the
T6377 10894-10896 IN denotes at
T6376 10885-10893 NNP denotes Promoter
T6375 10880-10884 NNP denotes Gene
T6374 10877-10879 NN denotes ɛy
T6373 10873-10876 DT denotes the
T6372 10863-10872 NNPS denotes Represses
T6371 10854-10862 RB denotes Directly
T6370 10849-10853 NNP denotes Sox6
T6369 10844-10848 WDT denotes That
T6368 10835-10843 NNP denotes Indicate
T6367 10829-10834 NNP denotes Cells
T6366 10823-10828 NNP denotes GM979
T6365 10817-10822 VBG denotes Using
T6364 10809-10816 NNP denotes Studies
T6363 10796-10808 NNP denotes Transfection
T6568 11888-11895 VB denotes repress
T6567 11885-11887 TO denotes to
T6566 11880-11884 NNS denotes acts
T6565 11875-11879 JJ denotes Sox6
T6564 11870-11874 IN denotes that
T6563 11861-11869 VBP denotes indicate
T6562 11856-11860 NNS denotes data
T6561 11850-11855 DT denotes These
T6560 11848-11849 . denotes .
T6559 11847-11848 -RRB- denotes )
T6558 11845-11847 NN denotes 2B
T6557 11838-11844 NN denotes Figure
T6556 11837-11838 -LRB- denotes (
T6555 11828-11836 NN denotes activity
T6554 11822-11827 JJ denotes E-Luc
T6553 11814-11821 VB denotes repress
T6552 11811-11813 TO denotes to
T6551 11805-11810 VBZ denotes fails
T6550 11803-11804 -RRB- denotes )
T6549 11797-11803 NN denotes allele
T6548 11791-11796 NN denotes mouse
T6547 11784-11790 JJ denotes p 100H
T6546 11780-11783 DT denotes the
T6545 11777-11779 TO denotes to
T6544 11769-11776 JJ denotes similar
T6543 11768-11769 -LRB- denotes (
T6542 11766-11767 NNP denotes ]
T6541 11764-11766 CD denotes 32
T6540 11763-11764 NNP denotes [
T6539 11756-11762 NN denotes domain
T6538 11752-11755 NNP denotes HMG
T6537 11748-11751 PRP$ denotes its
T6536 11742-11747 VBZ denotes lacks
T6535 11737-11741 WDT denotes that
T6534 11729-11736 NN denotes protein
T6533 11724-11728 NNP denotes Sox6
T6532 11714-11723 VBN denotes truncated
T6531 11712-11713 DT denotes a
T6530 11709-11711 IN denotes of
T6529 11694-11708 NN denotes overexpression
T6528 11692-11693 , denotes ,
T6527 11684-11692 NN denotes contrast
T6526 11681-11683 IN denotes In
T6525 11679-11680 . denotes .
T6524 11678-11679 -RRB- denotes )
T6523 11676-11678 NN denotes 2B
T6522 11669-11675 NN denotes Figure
T6521 11668-11669 -LRB- denotes (
T6520 11659-11667 NN denotes activity
T6519 11650-11658 NN denotes reporter
T6518 11644-11649 JJ denotes E-Luc
T6517 11641-11643 IN denotes of
T6516 11630-11640 NN denotes repression
T6515 11613-11629 JJ denotes dosage-dependent
T6514 11611-11612 DT denotes a
T6513 11608-11610 TO denotes to
T6512 11602-11607 VBZ denotes leads
T6511 11589-11601 NN denotes transfection
T6510 11579-11588 JJ denotes transient
T6509 11576-11578 IN denotes by
T6508 11570-11575 NNS denotes cells
T6507 11564-11569 NNP denotes GM979
T6506 11561-11563 IN denotes in
T6505 11556-11560 NNP denotes Sox6
T6504 11553-11555 IN denotes of
T6503 11538-11552 NNP denotes Overexpression
T6502 11536-11537 . denotes .
T6501 11535-11536 -RRB- denotes )
T6500 11528-11535 NNPS denotes Methods
T6499 11524-11527 CC denotes and
T6498 11514-11523 NNPS denotes Materials
T6497 11511-11513 IN denotes in
T6496 11502-11510 VBN denotes detailed
T6495 11501-11502 -LRB- denotes (
T6494 11498-11500 CD denotes 2A
T6493 11491-11497 NN denotes Figure
T6492 11488-11490 IN denotes in
T6491 11482-11487 VBN denotes shown
T6490 11479-11481 IN denotes as
T6489 11477-11478 , denotes ,
T6488 11473-11477 NN denotes gene
T6487 11464-11472 NN denotes reporter
T6486 11453-11463 NN denotes luciferase
T6485 11449-11452 DT denotes the
T6484 11446-11448 IN denotes by
T6483 11437-11445 VBN denotes followed
T6482 11435-11436 , denotes ,
T6481 11434-11435 -RRB- denotes )
T6480 11432-11434 NN denotes kb
T6479 11428-11431 CD denotes 2.2
T6478 11427-11428 -LRB- denotes (
T6477 11418-11426 NN denotes promoter
T6476 11409-11417 JJ denotes proximal
T6475 11406-11408 JJ denotes ɛy
T6474 11402-11405 DT denotes the
T6473 11399-11401 TO denotes to
T6472 11397-11398 NNP denotes ]
T6471 11395-11397 CD denotes 31
T6470 11394-11395 NNP denotes [
T6469 11392-11393 -RRB- denotes )
T6468 11390-11392 NN denotes kb
T6467 11386-11389 CD denotes 2.5
T6466 11385-11386 -LRB- denotes (
T6465 11377-11384 NN denotes element
T6464 11375-11376 -RRB- denotes )
T6463 11371-11375 NNP denotes μLCR
T6462 11370-11371 -LRB- denotes (
T6461 11360-11369 NN denotes micro-LCR
T6460 11358-11359 DT denotes a
T6459 11351-11357 NN denotes fusing
T6458 11348-11350 IN denotes by
T6457 11346-11347 -RRB- denotes )
T6456 11341-11346 JJ denotes E-Luc
T6455 11340-11341 -LRB- denotes (
T6454 11330-11339 VBP denotes construct
T6453 11321-11329 NN denotes reporter
T6452 11312-11320 NN denotes promoter
T6451 11309-11311 JJ denotes ɛy
T6450 11306-11308 DT denotes an
T6449 11296-11305 VBD denotes generated
T6448 11293-11295 PRP denotes We
T5325 10381-10382 . denotes .
T5324 10377-10381 NNS denotes mice
T5323 10374-10376 NNP denotes WT
T5322 10363-10373 JJ denotes homozygous
T5321 10359-10362 NN denotes dpc
T5320 10354-10358 CD denotes 18.5
T5319 10350-10353 CC denotes and
T5318 10346-10349 NN denotes dpc
T5317 10341-10345 CD denotes 15.5
T5316 10338-10340 IN denotes of
T5315 10331-10337 NNS denotes livers
T5314 10327-10330 DT denotes the
T5313 10324-10326 IN denotes in
T5312 10313-10323 NN denotes expression
T5311 10309-10312 NN denotes min
T5310 10308-10309 NN denotes /
T5309 10304-10308 NN denotes βmaj
T5308 10301-10303 IN denotes of
T5307 10295-10300 NN denotes level
T5306 10291-10294 DT denotes the
T5305 10288-10290 TO denotes to
T5304 10277-10287 JJ denotes equivalent
T5303 10263-10276 RB denotes statistically
T5302 10260-10262 VBZ denotes is
T5301 10255-10259 NNS denotes mice
T5300 10248-10254 JJ denotes mutant
T5299 10237-10247 JJ denotes homozygous
T5298 10233-10236 NN denotes dpc
T5297 10228-10232 CD denotes 18.5
T5296 10224-10227 CC denotes and
T5295 10220-10223 NN denotes dpc
T5294 10215-10219 CD denotes 15.5
T5293 10212-10214 IN denotes of
T5292 10205-10211 NNS denotes livers
T5291 10201-10204 DT denotes the
T5290 10198-10200 IN denotes in
T5289 10187-10197 NN denotes expression
T5288 10184-10186 JJ denotes ɛy
T5287 10181-10183 IN denotes of
T5286 10175-10180 NN denotes level
T5285 10171-10174 DT denotes the
T5284 10166-10170 IN denotes that
T5283 10161-10165 VBP denotes note
T5282 10158-10160 PRP denotes We
T5281 10156-10157 . denotes .
T5280 10155-10156 NNP denotes ]
T5279 10153-10155 CD denotes 29
T5278 10152-10153 NNP denotes [
T5277 10147-10151 NNS denotes mice
T5276 10141-10146 JJ denotes fetal
T5275 10138-10140 NNP denotes WT
T5274 10134-10137 IN denotes for
T5273 10126-10133 NNS denotes results
T5272 10116-10125 VBN denotes published
T5271 10105-10115 RB denotes previously
T5270 10100-10104 IN denotes with
T5269 10090-10099 NN denotes agreement
T5268 10087-10089 IN denotes in
T5267 10083-10086 VBP denotes are
T5266 10079-10082 CC denotes and
T5265 10071-10078 NNS denotes samples
T5264 10067-10070 DT denotes all
T5263 10060-10066 IN denotes across
T5262 10049-10059 JJ denotes comparable
T5261 10044-10048 RB denotes thus
T5260 10040-10043 VBP denotes are
T5259 10036-10039 CC denotes and
T5258 10029-10035 NNS denotes levels
T5257 10020-10028 JJ denotes relative
T5256 10016-10019 VBP denotes are
T5255 10010-10015 VBN denotes shown
T5254 10003-10009 NNS denotes levels
T5253 9999-10002 DT denotes the
T5252 9997-9998 , denotes ,
T5251 9990-9997 NN denotes control
T5250 9981-9989 JJ denotes internal
T5249 9976-9980 JJ denotes same
T5248 9972-9975 DT denotes the
T5247 9967-9971 IN denotes with
T5246 9962-9966 NN denotes time
T5245 9957-9961 JJ denotes same
T5244 9953-9956 DT denotes the
T5243 9950-9952 IN denotes at
T5242 9940-9949 VBN denotes performed
T5241 9935-9939 VBD denotes were
T5240 9928-9934 NNS denotes assays
T5239 9924-9927 DT denotes the
T5238 9921-9923 IN denotes of
T5237 9917-9920 DT denotes all
T5236 9909-9916 IN denotes Because
T5235 9907-9908 . denotes .
T5234 9906-9907 -RRB- denotes )
T5233 9902-9906 NNS denotes bars
T5232 9896-9901 NN denotes error
T5231 9893-9895 IN denotes by
T5230 9887-9892 VBN denotes shown
T5229 9884-9886 VBZ denotes is
T5228 9879-9883 NN denotes data
T5227 9875-9878 DT denotes the
T5226 9872-9874 IN denotes of
T5225 9862-9871 NN denotes deviation
T5224 9853-9861 JJ denotes standard
T5223 9852-9853 -LRB- denotes (
T5222 9841-9851 NN denotes triplicate
T5221 9838-9840 IN denotes in
T5220 9828-9837 VBN denotes performed
T5219 9823-9827 VBD denotes were
T5218 9818-9822 WDT denotes that
T5217 9810-9817 NNS denotes results
T5216 9806-9809 NNP denotes PCR
T5215 9801-9805 NN denotes time
T5214 9796-9800 JJ denotes real
T5213 9785-9795 VBP denotes illustrate
T5212 9783-9784 CD denotes 1
T5211 9776-9782 NN denotes Figure
T5210 9773-9775 IN denotes in
T5209 9766-9772 NNS denotes graphs
T5208 9762-9765 DT denotes The
T5207 9760-9761 . denotes .
T5206 9750-9760 NN denotes expression
T5205 9743-9749 NN denotes globin
T5204 9733-9742 JJ denotes postnatal
T5203 9722-9732 VBG denotes evaluating
T5202 9717-9721 IN denotes from
T5201 9714-9716 PRP denotes us
T5200 9704-9713 VBZ denotes precludes
T5199 9702-9703 -RRB- denotes )
T5198 9701-9702 NNP denotes ]
T5197 9699-9701 CD denotes 14
T5196 9698-9699 NNP denotes [
T5195 9691-9697 NN denotes defect
T5194 9685-9690 NN denotes heart
T5193 9681-9684 DT denotes the
T5192 9676-9680 IN denotes from
T5191 9665-9675 RB denotes presumably
T5190 9664-9665 -LRB- denotes (
T5189 9659-9663 NNS denotes mice
T5188 9652-9658 JJ denotes mutant
T5187 9649-9651 IN denotes of
T5186 9639-9648 NN denotes lethality
T5185 9629-9638 JJ denotes Perinatal
T5184 9627-9628 . denotes .
T5183 9626-9627 -RRB- denotes )
T5182 9625-9626 CD denotes 1
T5181 9618-9624 NN denotes Figure
T5180 9617-9618 -LRB- denotes (
T5179 9613-9616 NN denotes dpc
T5178 9608-9612 CD denotes 18.5
T5177 9605-9607 IN denotes at
T5176 9600-9604 NNS denotes mice
T5175 9597-9599 NNP denotes WT
T5174 9594-9596 IN denotes in
T5173 9589-9593 IN denotes than
T5172 9584-9588 NNS denotes mice
T5171 9573-9583 JJ denotes homozygous
T5170 9567-9572 JJ denotes p100H
T5169 9564-9566 IN denotes in
T5168 9557-9563 JJR denotes higher
T5167 9548-9556 RB denotes somewhat
T5166 9543-9547 RB denotes also
T5165 9540-9542 VBZ denotes is
T5164 9533-9539 NN denotes globin
T5163 9531-9532 NN denotes β
T5162 9525-9530 NN denotes adult
T5161 9522-9524 IN denotes of
T5160 9516-9521 NN denotes level
T5159 9505-9515 NN denotes expression
T5158 9501-9504 DT denotes the
T5157 9499-9500 , denotes ,
T5156 9491-9499 RB denotes Moreover
T5155 9489-9490 . denotes .
T5154 9488-9489 -RRB- denotes )
T5153 9487-9488 CD denotes 1
T5152 9480-9486 NN denotes Figure
T5151 9479-9480 -LRB- denotes (
T5150 9475-9478 NN denotes dpc
T5149 9470-9474 CD denotes 18.5
T5148 9467-9469 IN denotes at
T5147 9460-9466 NN denotes globin
T5146 9457-9459 JJ denotes ɛy
T5145 9453-9456 IN denotes for
T5144 9448-9452 VBN denotes seen
T5143 9443-9447 IN denotes than
T5142 9436-9442 NN denotes extent
T5141 9429-9435 JJR denotes lesser
T5140 9424-9428 JJ denotes much
T5139 9422-9423 DT denotes a
T5138 9419-9421 TO denotes to
T5137 9415-9418 CC denotes but
T5136 9413-9414 , denotes ,
T5135 9409-9413 NNS denotes mice
T5134 9406-9408 NNP denotes WT
T5133 9401-9405 IN denotes with
T5132 9392-9400 VBN denotes compared
T5131 9390-9391 , denotes ,
T5130 9386-9390 NNS denotes mice
T5129 9375-9385 JJ denotes homozygous
T5128 9369-9374 JJ denotes p100H
T5127 9366-9368 IN denotes in
T5126 9359-9365 JJR denotes higher
T5125 9354-9358 RB denotes also
T5124 9350-9353 VBP denotes are
T5123 9348-9349 -RRB- denotes )
T5122 9345-9348 CD denotes βh1
T5121 9341-9344 CC denotes and
T5120 9339-9340 NN denotes ζ
T5119 9338-9339 -LRB- denotes (
T5118 9332-9337 NNS denotes genes
T5117 9325-9331 NN denotes globin
T5116 9315-9324 JJ denotes embryonic
T5115 9311-9314 CD denotes two
T5114 9305-9310 JJ denotes other
T5113 9301-9304 DT denotes the
T5112 9298-9300 IN denotes of
T5111 9291-9297 NNS denotes levels
T5110 9280-9290 NN denotes expression
T5109 9276-9279 DT denotes the
T5108 9274-9275 , denotes ,
T5107 9261-9274 RB denotes Interestingly
T5106 9259-9260 . denotes .
T5105 9258-9259 -RRB- denotes )
T5104 9254-9258 NNS denotes data
T5103 9242-9253 JJ denotes unpublished
T5102 9241-9242 -LRB- denotes (
T5101 9236-9240 NNS denotes mice
T5100 9223-9235 JJ denotes heterozygous
T5099 9219-9222 CC denotes and
T5098 9216-9218 NNP denotes WT
T5097 9208-9215 IN denotes between
T5096 9203-9207 VBN denotes seen
T5095 9199-9202 VBD denotes was
T5094 9188-9198 NN denotes difference
T5093 9185-9187 DT denotes No
T5092 9183-9184 . denotes .
T5091 9179-9183 NNS denotes mice
T5090 9176-9178 NNP denotes WT
T5089 9173-9175 IN denotes in
T5088 9164-9172 VBN denotes observed
T5087 9153-9163 NN denotes expression
T5086 9150-9152 IN denotes in
T5085 9142-9149 NN denotes decline
T5084 9138-9141 DT denotes the
T5083 9135-9137 TO denotes to
T5082 9126-9134 NN denotes contrast
T5081 9123-9125 IN denotes in
T5080 9121-9122 , denotes ,
T5079 9117-9121 NNS denotes mice
T5078 9110-9116 JJ denotes mutant
T5077 9107-9109 IN denotes in
T5076 9100-9106 NNS denotes points
T5075 9095-9099 NN denotes time
T5074 9090-9094 DT denotes both
T5073 9087-9089 IN denotes at
T5072 9080-9086 NNS denotes levels
T5071 9075-9079 JJ denotes high
T5070 9072-9074 IN denotes at
T5069 9062-9071 VBN denotes expressed
T5068 9059-9061 VBZ denotes is
T5067 9054-9058 NN denotes gene
T5066 9051-9053 JJ denotes ɛy
T5065 9047-9050 DT denotes the
T5064 9045-9046 , denotes ,
T5063 9044-9045 CD denotes 1
T5062 9037-9043 NN denotes Figure
T5061 9034-9036 IN denotes in
T5060 9028-9033 VBN denotes shown
T5059 9025-9027 IN denotes As
T5058 9023-9024 . denotes .
T5057 9020-9023 NN denotes dpc
T5056 9015-9019 CD denotes 18.5
T5055 9011-9014 CC denotes and
T5054 9007-9010 NN denotes dpc
T5053 9002-9006 CD denotes 15.5
T5052 9000-9001 , denotes ,
T5051 8994-9000 NNS denotes stages
T5050 8980-8993 JJ denotes developmental
T5049 8976-8979 CD denotes two
T5048 8973-8975 IN denotes at
T5047 8966-8972 NNS denotes livers
T5046 8960-8965 NN denotes mouse
T5045 8957-8959 NNP denotes WT
T5044 8953-8956 CC denotes and
T5043 8946-8952 JJ denotes mutant
T5042 8940-8945 JJ denotes p100H
T5041 8937-8939 IN denotes in
T5040 8931-8936 NNS denotes genes
T5039 8924-8930 NN denotes globin
T5038 8918-8923 JJ denotes other
T5037 8915-8917 IN denotes of
T5036 8908-8914 NNS denotes levels
T5035 8897-8907 NN denotes expression
T5034 8893-8896 DT denotes the
T5033 8882-8892 VB denotes quantitate
T5032 8879-8881 TO denotes to
T5031 8874-8878 VBN denotes used
T5030 8870-8873 VBD denotes was
T5029 8866-8869 NNP denotes PCR
T5028 8856-8865 JJ denotes Real-time
T5027 8854-8855 . denotes .
T5026 8853-8854 -RRB- denotes )
T5025 8849-8853 NNS denotes data
T5024 8837-8848 JJ denotes unpublished
T5023 8836-8837 -LRB- denotes (
T5022 8834-8835 -RRB- denotes )
T5021 8831-8834 NNP denotes PCR
T5020 8830-8831 -LRB- denotes (
T5019 8821-8829 NN denotes reaction
T5018 8815-8820 NN denotes chain
T5017 8804-8814 NN denotes polymerase
T5016 8794-8803 JJ denotes real-time
T5015 8788-8793 VBG denotes using
T5014 8786-8787 NNP denotes ]
T5013 8784-8786 CD denotes 13
T5012 8783-8784 NNP denotes [
T5011 8778-8782 NNP denotes Sox6
T5010 8775-8777 IN denotes of
T5009 8768-8774 NN denotes allele
T5008 8758-8767 JJ denotes knock-out
T5007 8746-8757 JJ denotes independent
T5006 8743-8745 DT denotes an
T5005 8740-8742 IN denotes in
T5004 8730-8739 VBN denotes confirmed
T5003 8726-8729 VBD denotes was
T5002 8714-8725 NN denotes observation
T5001 8706-8713 JJ denotes initial
T5000 8701-8705 DT denotes This
T4999 8699-8700 . denotes .
T4998 8692-8699 NNS denotes targets
T4997 8681-8691 JJ denotes downstream
T4996 8676-8680 JJ denotes Sox6
T4995 8667-8675 VB denotes identify
T4994 8664-8666 TO denotes to
T4993 8650-8663 NN denotes hybridization
T4992 8638-8649 JJ denotes subtractive
T4991 8632-8637 VBG denotes using
T4990 8626-8631 NN denotes mouse
T4989 8619-8625 JJ denotes p 100H
T4988 8615-8618 DT denotes the
T4987 8612-8614 IN denotes in
T4986 8601-8611 NN denotes transcript
T4985 8589-8600 JJ denotes upregulated
T4984 8586-8588 DT denotes an
T4983 8583-8585 IN denotes as
T4982 8572-8582 VBN denotes identified
T4981 8562-8571 RB denotes initially
T4980 8558-8561 VBD denotes was
T4979 8553-8557 NN denotes gene
T4978 8546-8552 NN denotes globin
T4977 8543-8545 JJ denotes ɛy
T4976 8539-8542 DT denotes The
T4975 8534-8538 NNP denotes Mice
T4974 8519-8533 JJ denotes Sox6-Deficient
T4973 8516-8518 IN denotes in
T4972 8514-8515 , denotes ,
T4971 8512-8514 NN denotes ɛy
T4970 8510-8511 , denotes ,
T4969 8504-8510 NNP denotes Globin
T4968 8494-8503 NNP denotes Embryonic
T4967 8490-8493 DT denotes the
T4966 8487-8489 IN denotes of
T4965 8476-8486 NN denotes Expression
T4964 8465-8475 JJ denotes Persistent
T3499 6038-6039 -RRB- denotes )
T3498 6035-6038 FW denotes dpc
T3497 6034-6035 -LRB- denotes (
T3496 6027-6033 NN denotes coitus
T3495 6022-6026 NN denotes post
T3494 6020-6021 LS denotes d
T3493 6015-6019 CD denotes 11.5
T3492 6012-6014 IN denotes At
T3491 6010-6011 . denotes .
T3490 6009-6010 NNP denotes ]
T3489 6007-6009 CD denotes 22
T3488 6006-6007 NNP denotes [
T3487 5998-6005 NNS denotes globins
T3486 5993-5997 JJ denotes βh-1
T3485 5989-5992 CC denotes and
T3484 5986-5988 NN denotes ɛy
T3483 5978-5985 VBP denotes express
T3482 5972-5977 NNS denotes cells
T3481 5962-5971 JJ denotes erythroid
T3480 5952-5961 JJ denotes primitive
T3479 5946-5951 WRB denotes where
T3478 5942-5945 NN denotes sac
T3477 5937-5941 NN denotes yolk
T3476 5927-5936 JJ denotes embryonic
T3475 5923-5926 DT denotes the
T3474 5920-5922 IN denotes in
T3473 5909-5919 VBZ denotes originates
T3472 5894-5908 VBZ denotes erythropoiesis
T3471 5892-5893 , denotes ,
T3470 5888-5892 NNS denotes mice
T3469 5885-5887 IN denotes In
T3468 5883-5884 . denotes .
T3467 5876-5883 NN denotes fashion
T3466 5855-5875 JJ denotes development-specific
T3465 5851-5854 CC denotes and
T3464 5849-5850 : denotes -
T3463 5843-5849 NN denotes tissue
T3462 5841-5842 DT denotes a
T3461 5838-5840 IN denotes in
T3460 5828-5837 VBN denotes expressed
T3459 5824-5827 VBP denotes are
T3458 5818-5823 NNS denotes genes
T3457 5809-5817 JJ denotes β-globin
T3456 5805-5808 DT denotes The
T3455 5803-5804 . denotes .
T3454 5802-5803 NNP denotes ]
T3453 5800-5802 CD denotes 23
T3452 5799-5800 NNP denotes [
T3451 5794-5798 NN denotes gene
T3450 5791-5793 JJ denotes ɛy
T3449 5787-5790 DT denotes the
T3448 5784-5786 IN denotes of
T3447 5782-5783 NN denotes ′
T3446 5781-5782 CD denotes 5
T3445 5773-5780 VBN denotes located
T3444 5770-5772 NN denotes kb
T3443 5767-5769 CD denotes 25
T3442 5762-5766 IN denotes over
T3441 5755-5761 VBN denotes spread
T3440 5749-5754 NNS denotes sites
T3439 5734-5748 JJ denotes hypersensitive
T3438 5725-5733 NN denotes nuclease
T3437 5722-5724 IN denotes of
T3436 5718-5721 NN denotes set
T3435 5716-5717 DT denotes a
T3434 5713-5715 IN denotes by
T3433 5699-5712 VBN denotes characterized
T3432 5696-5698 VBZ denotes is
T3431 5691-5695 WDT denotes that
T3430 5684-5690 NN denotes region
T3429 5676-5683 NN denotes control
T3428 5670-5675 NN denotes locus
T3427 5666-5669 DT denotes the
T3426 5664-5665 , denotes ,
T3425 5657-5664 NN denotes element
T3424 5646-5656 JJ denotes regulatory
T3423 5644-5645 DT denotes a
T3422 5635-5643 VBZ denotes requires
T3421 5629-5634 NNS denotes genes
T3420 5623-5628 DT denotes these
T3419 5620-5622 IN denotes of
T3418 5609-5619 NN denotes expression
T3417 5598-5608 JJ denotes High-level
T3416 5596-5597 . denotes .
T3415 5595-5596 NNP denotes ]
T3414 5593-5595 CD denotes 22
T3413 5592-5593 NNP denotes [
T3412 5583-5591 NN denotes function
T3411 5579-5582 CC denotes and
T3410 5569-5578 NN denotes structure
T3409 5554-5568 JJ denotes organizational
T3408 5551-5553 IN denotes in
T3407 5538-5550 NNS denotes counterparts
T3406 5532-5537 JJ denotes human
T3405 5526-5531 PRP$ denotes their
T3404 5523-5525 TO denotes to
T3403 5512-5522 RB denotes homologous
T3402 5505-5511 RB denotes highly
T3401 5501-5504 VBP denotes are
T3400 5496-5500 PRP denotes they
T3399 5492-5495 CC denotes and
T3398 5490-5491 CD denotes 7
T3397 5479-5489 NN denotes Chromosome
T3396 5476-5478 IN denotes on
T3395 5466-5475 VBN denotes clustered
T3394 5462-5465 VBP denotes are
T3393 5453-5460 JJ denotes β-minor
T3392 5449-5452 CC denotes and
T3391 5447-5448 , denotes ,
T3390 5440-5447 NN denotes β-major
T3389 5438-5439 , denotes ,
T3388 5435-5438 CD denotes βh1
T3387 5433-5434 , denotes ,
T3386 5431-5433 NN denotes ɛy
T3385 5424-5429 NNS denotes genes
T3384 5415-5423 NN denotes β-globin
T3383 5409-5414 NN denotes mouse
T3382 5405-5408 DT denotes The
T3381 5403-5404 . denotes .
T3380 5402-5403 NN denotes ]
T3379 5400-5402 CD denotes 21
T3378 5397-5399 CD denotes 18
T3377 5396-5397 NNP denotes [
T3376 5390-5395 NNS denotes genes
T3375 5381-5389 JJ denotes β-globin
T3374 5372-5380 VB denotes modulate
T3373 5369-5371 TO denotes to
T3372 5363-5368 VBN denotes shown
T3371 5358-5362 VBN denotes been
T3370 5353-5357 VBP denotes have
T3369 5344-5352 NNS denotes proteins
T3368 5340-5343 NNP denotes HMG
T3367 5338-5339 , denotes ,
T3366 5326-5338 RB denotes Specifically
T3365 5324-5325 . denotes .
T3364 5317-5324 NNS denotes factors
T3363 5306-5316 VBN denotes associated
T3362 5302-5305 CC denotes and
T3361 5298-5301 NNP denotes DNA
T3360 5295-5297 IN denotes of
T3359 5287-5294 NNS denotes regions
T3358 5279-5286 JJ denotes distant
T3357 5270-5278 RB denotes together
T3356 5261-5269 VBG denotes bringing
T3355 5258-5260 IN denotes by
T3354 5252-5257 NNS denotes genes
T3353 5232-5251 JJ denotes chromatin-assembled
T3352 5228-5231 CC denotes and
T3351 5224-5227 NNP denotes DNA
T3350 5219-5223 DT denotes both
T3349 5216-5218 IN denotes on
T3348 5207-5215 NN denotes function
T3347 5198-5206 NN denotes enhancer
T3346 5187-5197 JJ denotes long-range
T3345 5179-5186 VB denotes mediate
T3344 5175-5178 MD denotes can
T3343 5166-5174 NNS denotes proteins
T3342 5162-5165 NNP denotes HMG
T3341 5156-5161 JJ denotes other
T3340 5152-5155 CC denotes and
T3339 5146-5151 DT denotes these
T3338 5143-5145 IN denotes by
T3337 5133-5142 NN denotes structure
T3336 5129-5132 NNP denotes DNA
T3335 5126-5128 IN denotes of
T3334 5115-5125 NNP denotes Modulation
T3333 5113-5114 . denotes .
T3332 5112-5113 NNP denotes ]
T3331 5110-5112 CD denotes 17
T3330 5109-5110 NNP denotes [
T3329 5100-5108 NNS denotes proteins
T3328 5095-5099 NNP denotes HMG2
T3327 5091-5094 CC denotes and
T3326 5086-5090 NNP denotes HMG1
T3325 5076-5085 VBN denotes expressed
T3324 5063-5075 RB denotes ubiquitously
T3323 5059-5062 DT denotes the
T3322 5055-5058 VBP denotes are
T3321 5053-5054 , denotes ,
T3320 5042-5053 NN denotes specificity
T3319 5033-5041 NN denotes sequence
T3318 5025-5032 IN denotes without
T3317 5021-5024 CC denotes but
T3316 5019-5020 , denotes ,
T3315 5016-5019 NNP denotes DNA
T3314 5011-5015 VB denotes bend
T3313 5007-5010 CC denotes and
T3312 5000-5006 NN denotes groove
T3311 4994-4999 JJ denotes minor
T3310 4990-4993 DT denotes the
T3309 4987-4989 TO denotes to
T3308 4982-4986 NN denotes bind
T3307 4972-4981 RB denotes similarly
T3306 4967-4971 WDT denotes that
T3305 4965-4966 -RRB- denotes )
T3304 4959-4965 NN denotes family
T3303 4952-4958 NN denotes factor
T3302 4938-4951 NN denotes transcription
T3301 4934-4937 NNPS denotes Sox
T3300 4930-4933 DT denotes the
T3299 4927-4929 IN denotes of
T3298 4916-4926 VBN denotes identified
T3297 4909-4915 NN denotes member
T3296 4903-4908 JJ denotes first
T3295 4899-4902 DT denotes the
T3294 4898-4899 -LRB- denotes (
T3293 4894-4897 NNP denotes Sry
T3292 4891-4893 TO denotes to
T3291 4883-4890 VBN denotes related
T3290 4873-4882 RB denotes distantly
T3289 4864-4872 NNS denotes proteins
T3288 4860-4863 NN denotes box
T3287 4856-4859 NNP denotes HMG
T3286 4852-4855 DT denotes the
T3285 4846-4851 IN denotes Among
T3284 4844-4845 . denotes .
T3247 4641-4643 DT denotes no
T3246 4637-4640 CC denotes and
T3245 4636-4637 -LRB- denotes (
T3244 4631-4635 NN denotes gene
T3243 4626-4630 NNP denotes Sox6
T3242 4622-4625 DT denotes the
T3241 4618-4621 CC denotes and
T3240 4613-4617 NN denotes gene
T3239 4611-4612 NN denotes p
T3238 4607-4610 DT denotes the
T3237 4602-4606 CC denotes both
T3236 4593-4601 VBZ denotes disrupts
T3235 4588-4592 WDT denotes that
T3234 4578-4587 NN denotes inversion
T3233 4576-4577 CD denotes 7
T3232 4565-4575 NN denotes Chromosome
T3231 4563-4564 DT denotes a
T3230 4558-4562 IN denotes with
T3229 4547-4557 VBN denotes associated
T3228 4544-4546 VBZ denotes is
T3227 4537-4543 NN denotes allele
T3226 4530-4536 JJ denotes mutant
T3225 4524-4529 JJ denotes p100H
T3224 4520-4523 DT denotes The
T3223 4518-4519 . denotes .
T3222 4517-4518 NNP denotes ]
T3221 4515-4517 CD denotes 14
T3220 4514-4515 NNP denotes [
T3219 4508-4513 NN denotes birth
T3218 4502-4507 IN denotes after
T3217 4499-4501 NN denotes wk
T3216 4497-4498 CD denotes 2
T3215 4490-4496 IN denotes within
T3214 4486-4489 VB denotes die
T3213 4482-4485 CC denotes and
T3212 4480-4481 , denotes ,
T3211 4475-4480 NN denotes block
T3210 4469-4474 NN denotes heart
T3209 4450-4468 JJ denotes arterioventricular
T3208 4446-4449 CC denotes and
T3207 4437-4445 NN denotes myopathy
T3206 4429-4436 VB denotes develop
T3205 4427-4428 , denotes ,
T3204 4421-4427 NN denotes growth
T3203 4413-4420 VBN denotes delayed
T3202 4408-4412 NN denotes show
T3201 4402-4407 JJ denotes p100H
T3200 4398-4401 IN denotes for
T3199 4387-4397 NNS denotes homozygous
T3198 4382-4386 NN denotes Mice
T3197 4380-4381 . denotes .
T3196 4379-4380 NNP denotes ]
T3195 4377-4379 CD denotes 14
T3194 4376-4377 NNP denotes [
T3193 4365-4375 NN denotes laboratory
T3192 4361-4364 PRP$ denotes our
T3191 4358-4360 IN denotes in
T3190 4347-4357 VBN denotes identified
T3189 4342-4346 VBN denotes been
T3188 4331-4341 RB denotes previously
T3187 4327-4330 VBZ denotes has
T3186 4325-4326 -RRB- denotes )
T3185 4320-4325 JJ denotes p100H
T3184 4319-4320 -LRB- denotes (
T3183 4313-4318 NN denotes mouse
T3182 4306-4312 JJ denotes mutant
T3181 4296-4305 JJ denotes Sox6-null
T3180 4294-4295 DT denotes A
T3179 4292-4293 . denotes .
T3178 4291-4292 NNP denotes ]
T3177 4286-4291 CD denotes 14,15
T3176 4285-4286 NNP denotes [
T3175 4278-4284 NN denotes muscle
T3174 4274-4277 CC denotes and
T3173 4272-4273 , denotes ,
T3172 4271-4272 NNP denotes ]
T3171 4264-4271 CD denotes 6,12,13
T3170 4263-4264 NNP denotes [
T3169 4253-4262 NN denotes cartilage
T3168 4251-4252 , denotes ,
T3167 4250-4251 NNP denotes ]
T3166 4248-4250 CD denotes 11
T3165 4246-4247 CD denotes 8
T3164 4245-4246 NN denotes [
T3163 4238-4244 NN denotes system
T3162 4230-4237 JJ denotes nervous
T3161 4222-4229 JJ denotes central
T3160 4218-4221 DT denotes the
T3159 4215-4217 IN denotes of
T3158 4203-4214 NN denotes development
T3157 4199-4202 DT denotes the
T3156 4196-4198 IN denotes in
T3155 4191-4195 NN denotes role
T3154 4189-4190 DT denotes a
T3153 4183-4188 VBZ denotes plays
T3152 4178-4182 WDT denotes that
T3151 4169-4177 NN denotes molecule
T3150 4158-4168 JJ denotes regulatory
T3149 4148-4157 JJ denotes important
T3148 4145-4147 DT denotes an
T3147 4142-4144 VBZ denotes is
T3146 4137-4141 NNP denotes Sox6
T3145 4132-4136 IN denotes that
T3144 4119-4131 VBN denotes demonstrated
T3143 4114-4118 VBP denotes have
T3142 4106-4113 NNS denotes studies
T3141 4097-4105 JJ denotes previous
T3140 4095-4096 , denotes ,
T3139 4085-4095 NN denotes expression
T3138 4080-4084 NN denotes gene
T3137 4069-4079 VBG denotes regulating
T3136 4066-4068 IN denotes in
T3135 4056-4065 NNS denotes functions
T3134 4051-4055 JJ denotes Sox6
T3133 4047-4050 WRB denotes how
T3941 8453-8454 . denotes .
T3940 8439-8453 NNS denotes erythropoiesis
T3939 8428-8438 JJ denotes definitive
T3938 8425-8427 IN denotes in
T3937 8415-8424 NNS denotes functions
T3936 8410-8414 JJ denotes Sox6
T3935 8405-8409 IN denotes that
T3934 8391-8404 VBG denotes demonstrating
T3933 8389-8390 , denotes ,
T3932 8384-8389 NN denotes liver
T3931 8378-8383 JJ denotes fetal
T3930 8374-8377 DT denotes the
T3929 8371-8373 IN denotes in
T3928 8361-8370 VBN denotes expressed
T3927 8349-8360 RB denotes ectopically
T3926 8346-8348 VBZ denotes is
T3925 8339-8345 NN denotes globin
T3924 8336-8338 JJ denotes ɛy
T3923 8334-8335 , denotes ,
T3922 8330-8334 NNP denotes Sox6
T3921 8327-8329 IN denotes of
T3920 8319-8326 NN denotes absence
T3919 8315-8318 DT denotes the
T3918 8312-8314 IN denotes In
T3917 8310-8311 . denotes .
T3916 8304-8310 NN denotes globin
T3915 8301-8303 JJ denotes ɛy
T3914 8298-8300 IN denotes of
T3913 8290-8297 NN denotes pattern
T3912 8279-8289 NN denotes expression
T3911 8270-8278 JJ denotes opposite
T3910 8266-8269 DT denotes the
T3909 8264-8265 , denotes ,
T3908 8259-8264 NN denotes liver
T3907 8253-8258 JJ denotes fetal
T3906 8250-8252 IN denotes in
T3905 8240-8249 VBN denotes expressed
T3904 8237-8239 VBZ denotes is
T3903 8233-8236 CC denotes but
T3902 8231-8232 , denotes ,
T3901 8224-8231 NNS denotes islands
T3900 8218-8223 NN denotes blood
T3899 8214-8217 NN denotes sac
T3898 8209-8213 NN denotes yolk
T3897 8206-8208 IN denotes in
T3896 8196-8205 VBN denotes expressed
T3895 8192-8195 RB denotes not
T3894 8189-8191 VBZ denotes is
T3893 8184-8188 NNP denotes Sox6
T3892 8182-8183 , denotes ,
T3891 8178-8182 NNS denotes mice
T3890 8176-8177 -RRB- denotes )
T3889 8174-8176 NNP denotes WT
T3888 8173-8174 -LRB- denotes (
T3887 8163-8172 JJ denotes wild-type
T3886 8160-8162 IN denotes In
T3885 8158-8159 . denotes .
T3884 8145-8158 NN denotes transcription
T3883 8141-8144 PRP$ denotes its
T3882 8131-8140 VBZ denotes represses
T3881 8127-8130 CC denotes and
T3880 8120-8126 NN denotes globin
T3879 8117-8119 JJ denotes ɛy
T3878 8114-8116 IN denotes of
T3877 8105-8113 NN denotes promoter
T3876 8096-8104 JJ denotes proximal
T3875 8092-8095 DT denotes the
T3874 8089-8091 TO denotes to
T3873 8083-8088 NNS denotes binds
T3872 8078-8082 JJ denotes Sox6
T3871 8073-8077 IN denotes that
T3870 8068-8072 VBP denotes show
T3869 8065-8067 PRP denotes We
T3868 8063-8064 . denotes .
T3867 8059-8063 NN denotes gene
T3866 8052-8058 NN denotes globin
T3865 8049-8051 JJ denotes ɛy
T3864 8045-8048 DT denotes the
T3863 8042-8044 IN denotes on
T3862 8037-8041 NNP denotes Sox6
T3861 8034-8036 IN denotes of
T3860 8026-8033 NNS denotes effects
T3859 8022-8025 DT denotes the
T3858 8009-8021 VBP denotes characterize
T3857 8005-8008 CC denotes and
T3856 7996-8004 VBP denotes describe
T3855 7993-7995 PRP denotes we
T3854 7988-7992 RB denotes Here
T3853 7986-7987 . denotes .
T3852 7982-7986 NN denotes gene
T3851 7975-7981 NN denotes globin
T3850 7972-7974 NN denotes ɛy
T3849 7962-7971 JJ denotes embryonic
T3848 7958-7961 DT denotes the
T3847 7955-7957 IN denotes of
T3846 7944-7954 NN denotes expression
T3845 7939-7943 JJ denotes high
T3844 7936-7938 IN denotes of
T3843 7924-7935 NN denotes persistence
T3842 7920-7923 DT denotes the
T3841 7917-7919 VBZ denotes is
T3840 7910-7916 NN denotes effect
T3839 7902-7909 JJ denotes extreme
T3838 7897-7901 RBS denotes most
T3837 7893-7896 DT denotes The
T3836 7891-7892 . denotes .
T3835 7886-7891 NNS denotes genes
T3834 7879-7885 NN denotes globin
T3833 7869-7878 JJ denotes embryonic
T3832 7866-7868 IN denotes of
T3831 7855-7865 NN denotes expression
T3830 7848-7854 JJR denotes higher
T3829 7844-7847 CC denotes and
T3828 7842-7843 -RRB- denotes )
T3827 7841-7842 NNP denotes ]
T3826 7839-7841 CD denotes 27
T3825 7838-7839 NNP denotes [
T3824 7826-7837 NN denotes bloodstream
T3823 7822-7825 DT denotes the
T3822 7813-7821 VBG denotes entering
T3821 7810-7812 TO denotes to
T3820 7804-7809 RB denotes prior
T3819 7794-7803 JJ denotes enucleate
T3818 7785-7793 RB denotes normally
T3817 7780-7784 IN denotes that
T3816 7779-7780 -LRB- denotes (
T3815 7766-7778 NNS denotes erythrocytes
T3814 7763-7765 IN denotes of
T3813 7752-7762 NN denotes maturation
T3812 7744-7751 VBN denotes delayed
T3811 7736-7743 VBP denotes include
T3810 7728-7735 NNS denotes effects
T3809 7722-7727 DT denotes These
T3808 7720-7721 . denotes .
T3807 7706-7720 NN denotes erythropoiesis
T3806 7703-7705 IN denotes on
T3805 7695-7702 NNS denotes effects
T3804 7683-7694 JJ denotes pleiotropic
T3803 7676-7682 VBZ denotes exerts
T3802 7671-7675 RB denotes also
T3801 7666-7670 NNP denotes Sox6
T3800 7661-7665 IN denotes that
T3799 7652-7660 VBP denotes describe
T3798 7649-7651 PRP denotes we
T3797 7647-7648 , denotes ,
T3796 7642-7647 NN denotes study
T3795 7637-7641 DT denotes this
T3794 7634-7636 IN denotes In
T3793 7632-7633 . denotes .
T3792 7631-7632 NNP denotes ]
T3791 7629-7631 CD denotes 28
T3790 7628-7629 NNP denotes [
T3789 7620-7627 NN denotes lineage
T3788 7613-7619 NN denotes marrow
T3787 7608-7612 NN denotes bone
T3786 7602-7607 NN denotes mouse
T3785 7596-7601 NN denotes adult
T3784 7593-7595 IN denotes of
T3783 7581-7592 NNS denotes progenitors
T3782 7569-7580 JJ denotes multipotent
T3781 7564-7568 IN denotes with
T3780 7555-7563 VBN denotes compared
T3779 7553-7554 -RRB- denotes )
T3778 7547-7553 NNP denotes LT-HSC
T3777 7546-7547 -LRB- denotes (
T3776 7540-7545 NNS denotes cells
T3775 7535-7539 NN denotes stem
T3774 7521-7534 NN denotes hematopoiesis
T3773 7511-7520 JJ denotes long-term
T3772 7508-7510 IN denotes in
T3771 7496-7507 VBN denotes upregulated
T3770 7493-7495 VBZ denotes is
T3769 7488-7492 NNP denotes Sox6
T3768 7483-7487 IN denotes that
T3767 7477-7482 VBN denotes shown
T3766 7473-7476 VBD denotes was
T3765 7470-7472 PRP denotes it
T3764 7468-7469 , denotes ,
T3763 7467-7468 NNP denotes ]
T3762 7462-7467 CD denotes 14,15
T3761 7461-7462 NNP denotes [
T3760 7454-7460 NN denotes muscle
T3759 7450-7453 CC denotes and
T3758 7448-7449 , denotes ,
T3757 7447-7448 NNP denotes ]
T3756 7440-7447 CD denotes 6,12,13
T3755 7439-7440 NNP denotes [
T3754 7429-7438 NN denotes cartilage
T3753 7427-7428 , denotes ,
T3752 7426-7427 NNP denotes ]
T3689 7099-7101 TO denotes to
T3688 7093-7098 VBN denotes shown
T3687 7089-7092 CC denotes and
T3686 7078-7088 VBN denotes identified
T3685 7073-7077 VBN denotes been
T3684 7068-7072 VBP denotes have
T3683 7063-7067 NNP denotes DRED
T3682 7059-7062 CC denotes and
T3681 7057-7058 , denotes ,
T3680 7050-7057 NNP denotes COUP-TF
T3679 7048-7049 , denotes ,
T3678 7044-7048 NNP denotes YY-1
T3677 7042-7043 , denotes ,
T3676 7036-7042 NNP denotes GATA-1
T3675 7033-7035 IN denotes as
T3674 7028-7032 JJ denotes such
T3673 7026-7027 , denotes ,
T3672 7019-7026 NNS denotes factors
T3671 7005-7018 NN denotes transcription
T3670 6991-7004 JJ denotes corresponding
T3669 6985-6990 PRP$ denotes Their
T3668 6983-6984 . denotes .
T3667 6982-6983 NNP denotes ]
T3666 6980-6982 CD denotes 27
T3665 6979-6980 NNP denotes [
T3664 6970-6978 NN denotes promoter
T3663 6965-6969 NN denotes gene
T3662 6963-6964 NN denotes ɛ
T3661 6956-6962 JJ denotes distal
T3660 6952-6955 DT denotes the
T3659 6948-6951 CC denotes and
T3658 6939-6947 NN denotes proximal
T3657 6935-6938 DT denotes the
T3656 6930-6934 DT denotes both
T3655 6927-6929 IN denotes in
T3654 6916-6926 VBN denotes identified
T3653 6905-6915 RB denotes previously
T3652 6900-6904 VBN denotes been
T3651 6895-6899 VBP denotes have
T3650 6887-6894 NN denotes process
T3649 6877-6886 VBG denotes silencing
T3648 6873-6876 DT denotes the
T3647 6870-6872 TO denotes to
T3646 6860-6869 JJ denotes important
T3645 6851-6859 NNS denotes elements
T3644 6847-6850 NNP denotes DNA
T3643 6838-6846 JJ denotes multiple
T3642 6836-6837 , denotes ,
T3641 6830-6836 NNS denotes assays
T3640 6817-6829 NN denotes transfection
T3639 6812-6816 NN denotes cell
T3638 6808-6811 CC denotes and
T3637 6801-6807 NNS denotes models
T3636 6795-6800 NN denotes mouse
T3635 6784-6794 JJ denotes transgenic
T3634 6781-6783 IN denotes in
T3633 6772-6780 NNS denotes analyses
T3632 6763-6771 NN denotes deletion
T3631 6754-6762 NN denotes promoter
T3630 6748-6753 VBG denotes Using
T3629 6746-6747 . denotes .
T3628 6736-6746 JJ denotes autonomous
T3627 6731-6735 NN denotes gene
T3626 6721-6730 RB denotes primarily
T3625 6718-6720 VBZ denotes is
T3624 6708-6717 VBG denotes silencing
T3623 6703-6707 IN denotes that
T3622 6692-6702 VBG denotes suggesting
T3621 6690-6691 , denotes ,
T3620 6689-6690 NNP denotes ]
T3619 6687-6689 CD denotes 27
T3618 6686-6687 NNP denotes [
T3617 6676-6685 NNS denotes sequences
T3616 6667-6675 JJ denotes adjacent
T3615 6664-6666 IN denotes in
T3614 6661-6663 CC denotes or
T3613 6656-6660 NN denotes gene
T3612 6654-6655 NN denotes ɛ
T3611 6650-6653 DT denotes the
T3610 6643-6649 IN denotes within
T3609 6639-6642 VBP denotes are
T3608 6634-6638 NN denotes gene
T3607 6627-6633 NN denotes globin
T3606 6625-6626 NN denotes ɛ
T3605 6621-6624 DT denotes the
T3604 6611-6620 VBG denotes silencing
T3603 6607-6610 IN denotes for
T3602 6595-6606 JJ denotes responsible
T3601 6586-6594 NNS denotes elements
T3600 6582-6585 DT denotes the
T3599 6578-6581 PDT denotes All
T3598 6576-6577 . denotes .
T3597 6575-6576 NNP denotes ]
T3596 6570-6575 CD denotes 24,25
T3595 6569-6570 NNP denotes [
T3594 6565-6568 NNP denotes LCR
T3593 6561-6564 DT denotes the
T3592 6557-6560 IN denotes for
T3591 6545-6556 NN denotes competition
T3590 6536-6544 NN denotes promoter
T3589 6533-6535 IN denotes by
T3588 6522-6532 VBN denotes controlled
T3587 6519-6521 VBZ denotes is
T3586 6512-6518 NN denotes switch
T3585 6503-6511 NN denotes β-globin
T3584 6497-6502 NN denotes adult
T3583 6494-6496 TO denotes to
T3582 6485-6493 NN denotes γ-globin
T3581 6481-6484 DT denotes The
T3580 6479-6480 . denotes .
T3579 6478-6479 NNP denotes ]
T3578 6476-6478 CD denotes 26
T3577 6475-6476 NNP denotes [
T3576 6461-6474 RB denotes competitively
T3575 6451-6460 VBN denotes regulated
T3574 6448-6450 VB denotes be
T3573 6445-6447 TO denotes to
T3572 6437-6444 VBZ denotes appears
T3571 6432-6436 RB denotes also
T3570 6430-6431 NN denotes ɛ
T3569 6415-6429 NN denotes erythropoiesis
T3568 6405-6414 JJ denotes primitive
T3567 6402-6404 IN denotes in
T3566 6393-6401 IN denotes although
T3565 6391-6392 , denotes ,
T3564 6390-6391 NNP denotes ]
T3563 6385-6390 CD denotes 24,25
T3562 6384-6385 NNP denotes [
T3561 6371-6383 RB denotes autonomously
T3560 6362-6370 VBN denotes silenced
T3559 6358-6361 CC denotes and
T3558 6348-6357 VBN denotes activated
T3557 6345-6347 VBZ denotes is
T3556 6343-6344 NN denotes ɛ
T3555 6341-6342 , denotes ,
T3554 6327-6341 NNS denotes erythropoiesis
T3553 6316-6326 JJ denotes definitive
T3552 6313-6315 IN denotes In
T3551 6311-6312 . denotes .
T3550 6300-6311 RB denotes extensively
T3549 6292-6299 VBN denotes studied
T3548 6287-6291 VBN denotes been
T3547 6283-6286 VBZ denotes has
T3546 6281-6282 , denotes ,
T3545 6275-6281 NN denotes globin
T3544 6273-6274 NN denotes ɛ
T3543 6271-6272 , denotes ,
T3542 6260-6271 NN denotes counterpart
T3541 6254-6259 JJ denotes human
T3540 6250-6253 PRP$ denotes its
T3539 6247-6249 IN denotes of
T3538 6237-6246 VBG denotes silencing
T3537 6234-6236 IN denotes of
T3536 6224-6233 NN denotes mechanism
T3535 6220-6223 DT denotes The
T3534 6218-6219 . denotes .
T3533 6213-6218 NNS denotes cells
T3532 6203-6212 JJ denotes erythroid
T3531 6192-6202 JJ denotes definitive
T3530 6189-6191 IN denotes in
T3529 6180-6188 VBN denotes silenced
T3528 6177-6179 VBZ denotes is
T3527 6172-6176 NN denotes gene
T3526 6169-6171 JJ denotes ɛy
T3525 6165-6168 DT denotes The
T3524 6163-6164 . denotes .
T3523 6162-6163 NNP denotes ]
T3522 6160-6162 CD denotes 22
T3521 6159-6160 NNP denotes [
T3520 6157-6158 -RRB- denotes )
T3519 6152-6157 JJ denotes minor
T3518 6148-6151 CC denotes and
T3517 6142-6147 JJ denotes major
T3516 6140-6141 FW denotes β
T3515 6139-6140 -LRB- denotes (
T3514 6131-6138 NNS denotes globins
T3513 6129-6130 NN denotes β
T3512 6123-6128 NN denotes adult
T3511 6115-6122 VBP denotes express
T3510 6109-6114 NNS denotes cells
T3509 6099-6108 JJ denotes erythroid
T3508 6088-6098 JJ denotes definitive
T3507 6082-6087 WRB denotes where
T3506 6076-6081 NN denotes liver
T3505 6070-6075 JJ denotes fetal
T3504 6066-6069 DT denotes the
T3503 6063-6065 TO denotes to
T3502 6056-6062 NNS denotes shifts
T3501 6041-6055 VBZ denotes erythropoiesis
T3500 6039-6040 , denotes ,
T3132 4044-4046 IN denotes of
T3131 4033-4043 RB denotes Regardless
T3130 4031-4032 . denotes .
T3129 4030-4031 NNP denotes ]
T3128 4029-4030 CD denotes 7
T3127 4028-4029 VBP denotes [
T3126 4019-4027 NNS denotes proteins
T3125 4013-4018 DT denotes these
T3124 4010-4012 IN denotes of
T3123 4002-4009 VBP denotes overlap
T3122 3991-4001 JJ denotes functional
T3121 3980-3990 VBG denotes indicating
T3120 3978-3979 , denotes ,
T3119 3970-3978 NN denotes splicing
T3118 3961-3969 VBD denotes restored
T3117 3952-3960 NNS denotes extracts
T3116 3948-3951 DT denotes the
T3115 3945-3947 IN denotes in
T3114 3941-3944 NNP denotes Sry
T3113 3938-3940 CC denotes or
T3112 3936-3937 , denotes ,
T3111 3932-3936 NNP denotes Sox9
T3110 3930-3931 , denotes ,
T3109 3926-3930 NNP denotes Sox6
T3108 3919-3925 DT denotes either
T3107 3916-3918 IN denotes of
T3106 3909-3915 NN denotes domain
T3105 3905-3908 NNP denotes HMG
T3104 3901-3904 DT denotes the
T3103 3898-3900 IN denotes of
T3102 3887-3897 NN denotes expression
T3101 3883-3886 CC denotes and
T3100 3881-3882 , denotes ,
T3099 3871-3881 NNS denotes substrates
T3098 3862-3870 JJ denotes multiple
T3097 3859-3861 IN denotes of
T3096 3850-3858 NN denotes splicing
T3095 3842-3849 VBN denotes blocked
T3094 3833-3841 VBZ denotes extracts
T3093 3828-3832 NN denotes cell
T3092 3823-3827 NNP denotes HeLa
T3091 3820-3822 IN denotes in
T3090 3815-3819 NNP denotes Sox6
T3089 3812-3814 IN denotes of
T3088 3802-3811 NN denotes Depletion
T3087 3800-3801 . denotes .
T3086 3799-3800 NNP denotes ]
T3085 3798-3799 CD denotes 7
T3084 3797-3798 NN denotes [
T3083 3788-3796 NN denotes splicing
T3082 3779-3787 JJ denotes pre-mRNA
T3081 3776-3778 IN denotes in
T3080 3763-3775 VBZ denotes participates
T3079 3758-3762 WDT denotes that
T3078 3751-3757 NN denotes factor
T3077 3742-3750 NN denotes splicing
T3076 3734-3741 JJ denotes general
T3075 3732-3733 DT denotes a
T3074 3729-3731 IN denotes as
T3073 3725-3728 VB denotes act
T3072 3722-3724 TO denotes to
T3071 3716-3721 VBN denotes shown
T3070 3711-3715 VBN denotes been
T3069 3706-3710 RB denotes also
T3068 3702-3705 VBZ denotes has
T3067 3697-3701 NNP denotes Sox6
T3066 3695-3696 , denotes ,
T3065 3683-3695 RB denotes Intriguingly
T3064 3681-3682 . denotes .
T3063 3680-3681 NNP denotes ]
T3062 3677-3680 CD denotes 5,6
T3061 3676-3677 NNP denotes [
T3060 3668-3675 NN denotes context
T3059 3659-3667 NN denotes promoter
T3058 3652-3658 NN denotes target
T3057 3648-3651 PRP$ denotes its
T3056 3644-3647 CC denotes and
T3055 3632-3643 NNS denotes interactors
T3054 3628-3631 PRP$ denotes its
T3053 3625-3627 IN denotes on
T3052 3615-3624 VBG denotes depending
T3051 3613-3614 , denotes ,
T3050 3604-3613 NN denotes repressor
T3049 3602-3603 DT denotes a
T3048 3599-3601 CC denotes or
T3047 3589-3598 NN denotes activator
T3046 3586-3588 DT denotes an
T3045 3579-3585 DT denotes either
T3044 3576-3578 IN denotes as
T3043 3572-3575 VB denotes act
T3042 3569-3571 TO denotes to
T3041 3564-3568 JJ denotes able
T3040 3561-3563 VB denotes be
T3039 3558-3560 TO denotes to
T3038 3549-3557 VBN denotes reported
T3037 3544-3548 VBN denotes been
T3036 3540-3543 VBZ denotes has
T3035 3535-3539 NNP denotes Sox6
T3034 3533-3534 . denotes .
T3033 3524-3533 NNS denotes complexes
T3032 3511-3523 NN denotes multiprotein
T2967 3131-3136 VB denotes cause
T2966 3127-3130 CC denotes and
T2965 3123-3126 NNP denotes DNA
T2964 3120-3122 IN denotes of
T2963 3113-3119 NN denotes groove
T2962 3107-3112 JJ denotes minor
T2961 3103-3106 DT denotes the
T2960 3100-3102 TO denotes to
T2959 3095-3099 NN denotes bind
T2958 3087-3094 NNS denotes factors
T2957 3073-3086 NN denotes transcription
T2956 3069-3072 NNP denotes Sox
T2955 3067-3068 . denotes .
T2954 3066-3067 NNP denotes ]
T2953 3065-3066 CD denotes 1
T2952 3064-3065 NN denotes [
T2951 3056-3063 JJ denotes binding
T2950 3052-3055 CC denotes and
T2949 3040-3051 NN denotes recognition
T2948 3036-3039 NNP denotes DNA
T2947 3033-3035 IN denotes in
T2946 3024-3032 VBN denotes involved
T2945 3018-3023 NNS denotes acids
T2944 3012-3017 JJ denotes amino
T2943 3009-3011 CD denotes 79
T2942 3006-3008 IN denotes of
T2941 2995-3005 VBG denotes consisting
T2940 2993-2994 , denotes ,
T2939 2987-2993 NN denotes domain
T2938 2985-2986 -RRB- denotes )
T2937 2982-2985 NNP denotes HMG
T2936 2981-2982 -LRB- denotes (
T2935 2975-2980 NN denotes group
T2934 2966-2974 NN denotes mobility
T2933 2961-2965 JJ denotes high
T2932 2951-2960 JJ denotes conserved
T2931 2947-2950 DT denotes the
T2930 2944-2946 IN denotes by
T2929 2930-2943 VBN denotes characterized
T2928 2923-2929 NN denotes family
T2927 2916-2922 NN denotes factor
T2926 2902-2915 NN denotes transcription
T3751 7424-7426 CD denotes 11
T3750 7422-7423 CD denotes 8
T3749 7421-7422 NN denotes [
T3748 7414-7420 NN denotes system
T3747 7406-7413 JJ denotes nervous
T3746 7398-7405 JJ denotes central
T3745 7394-7397 DT denotes the
T3744 7391-7393 IN denotes of
T3743 7379-7390 NN denotes development
T3742 7375-7378 DT denotes the
T3741 7372-7374 IN denotes in
T3740 7367-7371 NN denotes role
T3739 7357-7366 JJ denotes important
T3738 7354-7356 DT denotes an
T3737 7346-7353 VBG denotes playing
T3736 7343-7345 TO denotes to
T3735 7334-7342 NN denotes addition
T3734 7331-7333 IN denotes In
T3733 7329-7330 . denotes .
T3732 7321-7329 NNS denotes proteins
T3731 7309-7320 VBG denotes transacting
T3730 7305-7308 CC denotes and
T3729 7296-7304 NNS denotes elements
T3728 7292-7295 NN denotes cis
T3727 7283-7291 JJ denotes multiple
T3726 7280-7282 IN denotes of
T3725 7272-7279 NN denotes network
T3724 7260-7271 JJ denotes complicated
T3723 7258-7259 DT denotes a
T3722 7249-7257 VBZ denotes involves
T3721 7244-7248 NN denotes gene
T3720 7242-7243 NN denotes ɛ
T3719 7238-7241 DT denotes the
T3718 7235-7237 IN denotes of
T3717 7225-7234 NN denotes silencing
T3716 7221-7224 DT denotes the
T3715 7216-7220 IN denotes that
T3714 7208-7215 VBZ denotes appears
T3713 7205-7207 PRP denotes it
T3712 7203-7204 , denotes ,
T3711 7199-7203 RB denotes Thus
T3710 7197-7198 . denotes .
T3709 7196-7197 NNP denotes ]
T3708 7194-7196 CD denotes 27
T3707 7193-7194 NNP denotes [
T3706 7183-7192 VBG denotes silencing
T3705 7181-7182 NN denotes ɛ
T3704 7172-7180 VB denotes regulate
T3703 7169-7171 TO denotes to
T3702 7167-7168 -RRB- denotes )
T3701 7158-7167 NNS denotes complexes
T3700 7150-7157 NN denotes protein
T3699 7147-7149 IN denotes of
T3698 7142-7146 NN denotes part
T3697 7139-7141 IN denotes as
T3696 7138-7139 -LRB- denotes (
T3695 7129-7137 NNS denotes elements
T3694 7125-7128 NNP denotes DNA
T3693 7119-7124 DT denotes these
T3692 7116-7118 TO denotes to
T3691 7111-7115 NN denotes bind
T3690 7102-7110 RB denotes directly
T3283 4834-4844 NNS denotes phenotypes
T3282 4828-4833 JJ denotes other
T3281 4824-4827 DT denotes all
T3280 4821-4823 IN denotes in
T3279 4810-4820 VBN denotes implicated
T3278 4807-4809 VBZ denotes is
T3277 4800-4806 NN denotes factor
T3276 4786-4799 NN denotes transcription
T3275 4781-4785 NNP denotes Sox6
T3274 4777-4780 DT denotes the
T3273 4775-4776 , denotes ,
T3272 4774-4775 NNP denotes ]
T3271 4772-4774 CD denotes 16
T3270 4771-4772 NNP denotes [
T3269 4758-4770 NN denotes pigmentation
T3268 4755-4757 IN denotes in
T3267 4748-4754 RB denotes solely
T3266 4738-4747 NNS denotes functions
T3265 4733-4737 NN denotes gene
T3264 4731-4732 NN denotes p
T3263 4727-4730 DT denotes the
T3262 4719-4726 IN denotes Because
T3261 4717-4718 . denotes .
T3260 4716-4717 NNP denotes ]
T3259 4714-4716 CD denotes 14
T3258 4713-4714 NNP denotes [
T3257 4711-4712 -RRB- denotes )
T3256 4700-4711 NNS denotes breakpoints
T3255 4688-4699 JJ denotes chromosomal
T3254 4684-4687 DT denotes the
T3253 4681-4683 IN denotes of
T3252 4669-4680 NNS denotes nucleotides
T3251 4662-4668 CD denotes 50,000
T3250 4655-4661 IN denotes within
T3249 4650-4654 NN denotes gene
T3248 4644-4649 JJ denotes other
T3031 3503-3510 VBN denotes defined
T3030 3492-3502 RB denotes sterically
T3029 3490-3491 , denotes ,
T3028 3484-3490 JJ denotes active
T3027 3471-3483 RB denotes biologically
T3026 3466-3470 IN denotes into
T3025 3458-3465 NNS denotes factors
T3024 3444-3457 NN denotes transcription
T3023 3434-3443 JJ denotes DNA-bound
T3022 3428-3433 JJ denotes other
T3021 3417-3427 VBG denotes assembling
T3020 3413-3416 CC denotes and
T3019 3403-3412 NN denotes structure
T3018 3393-3402 NN denotes chromatin
T3017 3387-3392 JJ denotes local
T3016 3376-3386 VBG denotes organizing
T3015 3373-3375 IN denotes by
T3014 3364-3372 NNS denotes proteins
T3013 3350-3363 JJ denotes architectural
T3012 3347-3349 IN denotes as
T3011 3338-3346 NN denotes function
T3010 3332-3337 PRP$ denotes their
T3009 3329-3331 IN denotes of
T3008 3324-3328 NN denotes part
T3007 3316-3323 VB denotes perform
T3006 3312-3315 MD denotes may
T3005 3303-3311 NNS denotes proteins
T3004 3299-3302 NNP denotes Sox
T3003 3297-3298 , denotes ,
T3002 3288-3297 RB denotes Therefore
T3001 3286-3287 . denotes .
T3000 3285-3286 NNP denotes ]
T2999 3284-3285 CD denotes 4
T2998 3283-3284 NNP denotes [
T2997 3279-3282 NNP denotes DNA
T2996 3276-3278 IN denotes of
T2995 3269-3275 NN denotes groove
T2994 3263-3268 JJ denotes major
T2993 3259-3262 DT denotes the
T2992 3252-3258 VBP denotes target
T2991 3244-3251 NNS denotes factors
T2990 3230-3243 NN denotes transcription
T2989 3224-3229 JJ denotes other
T2988 3219-3223 RBS denotes most
T2987 3213-3218 IN denotes while
T2986 3211-3212 , denotes ,
T2985 3210-3211 NNP denotes ]
T2984 3207-3210 CD denotes 2,3
T2983 3206-3207 NNP denotes [
T2982 3198-3205 NNS denotes changes
T2981 3183-3197 JJ denotes conformational
T2980 3177-3182 JJ denotes local
T2979 3174-3176 TO denotes to
T2978 3168-3173 VBZ denotes leads
T2977 3163-3167 WDT denotes that
T2976 3159-3162 NN denotes DNA
T2975 3155-3158 DT denotes the
T2974 3152-3154 IN denotes of
T2973 3147-3151 VB denotes bend
T2972 3145-3146 NN denotes °
T2971 3143-3145 CD denotes 85
T2970 3141-3142 NN denotes °
T2969 3139-3141 CD denotes 70
T2968 3137-3138 DT denotes a
T719 910-912 TO denotes to
T718 902-909 JJ denotes binding
T717 893-901 RB denotes directly
T716 890-892 IN denotes by
T715 880-889 NN denotes repressor
T714 878-879 DT denotes a
T713 875-877 IN denotes as
T712 870-874 NNS denotes acts
T711 865-869 JJ denotes Sox6
T710 860-864 IN denotes that
T709 848-859 VBP denotes demonstrate
T708 841-847 NNS denotes assays
T707 839-840 -RRB- denotes )
T706 835-839 NNP denotes ChIP
T705 834-835 -LRB- denotes (
T704 814-833 NN denotes immunoprecipitation
T703 804-813 NN denotes chromatin
T702 800-803 CC denotes and
T701 798-799 -RRB- denotes )
T700 794-798 NNP denotes EMSA
T699 793-794 -LRB- denotes (
T698 787-792 NN denotes assay
T697 781-786 NN denotes shift
T696 772-780 NN denotes mobility
T695 756-771 JJ denotes Electrophoretic
T694 754-755 . denotes .
T693 744-754 NN denotes repression
T692 735-743 VBN denotes mediated
T691 730-734 JJ denotes Sox6
T690 726-729 IN denotes for
T689 717-725 JJ denotes critical
T688 714-716 VBZ denotes is
T687 709-713 WDT denotes that
T686 700-708 NN denotes promoter
T685 691-699 JJ denotes proximal
T684 688-690 JJ denotes ɛy
T683 684-687 DT denotes the
T682 681-683 IN denotes of
T681 674-680 NN denotes region
T680 669-673 NN denotes pair
T679 664-668 JJ denotes base
T678 661-663 CD denotes 36
T677 659-660 DT denotes a
T676 652-658 VBP denotes define
T675 646-651 NNS denotes cells
T674 644-645 -RRB- denotes )
T673 629-644 JJ denotes erythroleukemic
T672 628-629 -LRB- denotes (
T671 622-627 NNP denotes GM979
T670 619-621 IN denotes in
T669 612-618 NNS denotes assays
T668 599-611 NNP denotes Transfection
T667 597-598 . denotes .
T666 586-597 NN denotes circulation
T665 580-585 JJ denotes fetal
T664 576-579 DT denotes the
T663 573-575 IN denotes in
T662 565-572 JJ denotes present
T661 561-564 VBP denotes are
T660 555-560 NNS denotes cells
T659 551-554 JJ denotes red
T658 541-550 JJ denotes nucleated
T657 538-540 IN denotes of
T656 530-537 NNS denotes numbers
T655 520-529 VBD denotes increased
T654 516-519 CC denotes and
T653 514-515 , denotes ,
T652 505-514 VBN denotes expressed
T651 492-504 RB denotes persistently
T650 489-491 VBZ denotes is
T649 482-488 NN denotes globin
T648 479-481 JJ denotes ɛy
T647 477-478 , denotes ,
T646 472-477 NNP denotes p100H
T645 470-471 , denotes ,
T644 465-470 NN denotes mouse
T643 450-464 JJ denotes Sox6-deficient
T642 446-449 DT denotes the
T641 443-445 IN denotes In
T640 441-442 . denotes .
T639 435-441 NN denotes muscle
T638 431-434 CC denotes and
T637 429-430 , denotes ,
T636 420-429 NN denotes cartilage
T635 418-419 , denotes ,
T634 412-418 NN denotes system
T633 404-411 JJ denotes nervous
T632 396-403 JJ denotes central
T631 392-395 DT denotes the
T630 389-391 IN denotes of
T629 377-388 NN denotes development
T628 373-376 DT denotes the
T627 370-372 IN denotes in
T626 365-369 NN denotes role
T625 363-364 DT denotes a
T624 357-362 NNS denotes plays
T623 352-356 JJ denotes Sox6
T622 347-351 IN denotes that
T621 337-346 VBN denotes suggested
T620 332-336 VBP denotes have
T619 324-331 NNS denotes studies
T618 315-323 JJ denotes Previous
T617 313-314 . denotes .
T616 310-313 NNP denotes Sry
T615 308-309 , denotes ,
T614 304-308 NN denotes gene
T613 292-303 VBG denotes determining
T612 285-291 NN denotes testis
T611 281-284 DT denotes the
T610 278-280 IN denotes in
T609 268-277 VBN denotes described
T608 262-267 JJ denotes first
T607 260-261 , denotes ,
T606 254-260 NN denotes domain
T605 246-253 JJ denotes binding
T604 242-245 NNP denotes DNA
T603 240-241 -RRB- denotes )
T602 237-240 NNP denotes HMG
T601 236-237 -LRB- denotes (
T600 230-235 NN denotes group
T599 221-229 NN denotes mobility
T598 216-220 JJ denotes high
T597 206-215 JJ denotes conserved
T596 202-205 DT denotes the
T595 199-201 IN denotes by
T594 191-198 VBN denotes defined
T593 188-190 VBZ denotes is
T592 183-187 WDT denotes that
T591 176-182 NN denotes family
T590 169-175 NN denotes factor
T589 155-168 NN denotes transcription
T588 151-154 NNPS denotes Sox
T587 147-150 DT denotes the
T586 144-146 IN denotes of
T585 137-143 NN denotes member
T584 135-136 DT denotes a
T583 132-134 VBZ denotes is
T582 127-131 NNP denotes Sox6
T18002 37408-37410 IN denotes in
T18001 37399-37407 VBN denotes embedded
T18009 37438-37439 , denotes ,
T18008 37436-37438 NN denotes μm
T18007 37434-37435 CD denotes 5
T18006 37431-37433 IN denotes at
T18005 37421-37430 VBN denotes sectioned
T18004 37419-37420 , denotes ,
T18003 37411-37419 NN denotes paraffin
T18000 37397-37398 , denotes ,
T17999 37381-37397 NN denotes paraformaldehyde
T17998 37379-37380 NN denotes %
T17997 37378-37379 CD denotes 4
T17996 37375-37377 IN denotes in
T17995 37365-37374 NN denotes immersion
T17994 37362-37364 IN denotes by
T17993 37352-37361 RB denotes overnight
T17992 37346-37351 VBN denotes fixed
T17991 37341-37345 VBD denotes were
T17990 37333-37340 NNS denotes Embryos
T17989 37331-37332 . denotes .
T17988 37327-37331 CD denotes 1927
T17987 37322-37326 CD denotes 1353
T17986 37310-37321 NNS denotes nucleotides
T17985 37305-37309 JJ denotes Sox6
T17984 37299-37304 NN denotes mouse
T17983 37295-37298 CC denotes and
T17982 37293-37294 : denotes ;
T17981 37290-37293 CD denotes 549
T17980 37286-37289 CD denotes 458
T17979 37274-37285 NNS denotes nucleotides
T17978 37267-37273 NN denotes globin
T17977 37262-37266 NN denotes βmaj
T17976 37260-37261 : denotes ;
T17975 37257-37260 CD denotes 584
T17974 37253-37256 CD denotes 509
T17973 37241-37252 NNS denotes nucleotides
T17972 37234-37240 NN denotes globin
T17971 37231-37233 JJ denotes ɛy
T17970 37224-37230 VB denotes murine
T17969 37221-37223 TO denotes to
T17968 37212-37220 VBN denotes designed
T17967 37207-37211 VBD denotes were
T17966 37200-37206 NNS denotes probes
T17965 37190-37199 JJ denotes Antisense
T17964 37188-37189 . denotes .
T17963 37175-37188 NN denotes hybridization
T17962 37170-37174 NN denotes situ
T17961 37167-37169 IN denotes In
T18116 37974-37982 VBN denotes combined
T18115 37970-37973 CC denotes and
T18114 37968-37969 , denotes ,
T18113 37955-37968 VBN denotes pseudocolored
T18112 37953-37954 , denotes ,
T18111 37944-37953 VBN denotes processed
T18110 37939-37943 VBD denotes were
T18109 37932-37938 NNS denotes Images
T18108 37930-37931 . denotes .
T18626 39144-39151 NNP denotes England
T18625 39142-39143 , denotes ,
T18624 39127-39142 NNP denotes Buckinghamshire
T18623 39125-39126 , denotes ,
T18622 39114-39125 NNP denotes Biosciences
T18621 39105-39113 NNP denotes Amersham
T18620 39103-39104 : denotes ;
T18619 39092-39103 NNP denotes RediprimeII
T18618 39091-39092 -LRB- denotes (
T18617 39082-39090 VBG denotes labeling
T18616 39075-39081 NN denotes primer
T19048 40133-40135 PRP denotes we
T19047 40131-40132 , denotes ,
T19046 40125-40131 NN denotes effect
T19045 40118-40124 NN denotes dosage
T19044 40115-40117 IN denotes of
T19043 40108-40114 NNS denotes assays
T19042 40105-40107 IN denotes In
T19041 40103-40104 . denotes .
T19040 40102-40103 -RRB- denotes )
T19039 40100-40102 NN denotes ng
T19038 40095-40099 CD denotes 1000
T19037 40094-40095 -LRB- denotes (
T19326 40531-40542 NN denotes translation
T19325 40527-40530 DT denotes The
T19324 40525-40526 . denotes .
T19323 40524-40525 NNP denotes ]
T19322 40522-40524 CD denotes 15
T19321 40521-40522 NNP denotes [
T19320 40514-40520 IN denotes before
T19319 40504-40513 VBN denotes described
T19318 40500-40503 VBD denotes was
T19317 40498-40499 , denotes ,
T19316 40496-40498 NNP denotes HA
T19315 40492-40495 CC denotes and
T14071 26928-26930 JJ denotes ɛy
T15145 32807-32816 NN denotes repressor
T15144 32801-32806 NN denotes novel
T15143 32799-32800 DT denotes a
T15142 32788-32798 VBZ denotes identifies
T15141 32782-32787 NN denotes study
T15140 32774-32781 JJ denotes present
T15139 32770-32773 DT denotes The
T15130 32717-32721 IN denotes into
T15129 32702-32716 NNS denotes investigations
T15128 32693-32701 JJ denotes detailed
T15127 32689-32692 IN denotes for
T15126 32679-32688 NN denotes rationale
T15125 32677-32678 DT denotes a
T15124 32667-32676 VBG denotes providing
T15123 32665-32666 , denotes ,
T15122 32664-32665 NNP denotes ]
T15121 32662-32664 CD denotes 47
T15120 32661-32662 NNP denotes [
T15119 32653-32660 NN denotes disease
T15118 32648-32652 NN denotes cell
T15117 32641-32647 JJ denotes sickle
T15116 32636-32640 IN denotes with
T15115 32629-32635 NNS denotes adults
T15114 32626-32628 TO denotes to
T15113 32615-32625 JJ denotes beneficial
T15112 32599-32614 RB denotes therapeutically
T15111 32596-32598 VB denotes be
T15110 32590-32595 MD denotes would
T15109 32581-32589 NN denotes ɛ-globin
T15108 32575-32580 JJ denotes human
T15107 32572-32574 IN denotes of
T15106 32559-32571 NN denotes reactivation
T15105 32554-32558 IN denotes that
T15104 32546-32553 VBP denotes suggest
T15103 32537-32545 NNS denotes analyses
T15102 32531-32536 NN denotes vitro
T15101 32528-32530 IN denotes in
T15146 32816-32817 , denotes ,
T15138 32768-32769 . denotes .
T15137 32759-32768 VBG denotes silencing
T15136 32754-32758 NN denotes gene
T15135 32745-32753 JJ denotes ɛ-globin
T15134 32742-32744 IN denotes of
T15133 32736-32741 NN denotes basis
T15132 32726-32735 JJ denotes molecular
T15131 32722-32725 DT denotes the
T798 1395-1397 IN denotes as
T799 1398-1404 JJ denotes sickle
T720 913-916 DT denotes the
T721 917-919 JJ denotes ɛy
T722 920-928 NN denotes promoter
T723 928-929 . denotes .
T724 930-933 DT denotes The
T725 934-940 JJ denotes normal
T726 941-951 NN denotes expression
T727 952-954 IN denotes of
T728 955-959 NNP denotes Sox6
T729 960-962 IN denotes in
T730 963-972 JJ denotes wild-type
T731 973-978 JJ denotes fetal
T732 979-984 NN denotes liver
T733 985-988 CC denotes and
T734 989-992 DT denotes the
T735 993-1000 JJ denotes ectopic
T736 1001-1011 NN denotes expression
T737 1012-1014 IN denotes of
T738 1015-1017 NN denotes ɛy
T739 1018-1020 IN denotes in
T740 1021-1026 JJ denotes p100H
T741 1027-1037 JJ denotes homozygous
T742 1038-1043 JJ denotes fetal
T743 1044-1049 NN denotes liver
T744 1050-1061 VBP denotes demonstrate
T745 1062-1066 IN denotes that
T746 1067-1071 JJ denotes Sox6
T747 1072-1081 NNS denotes functions
T748 1082-1084 IN denotes in
T749 1085-1095 JJ denotes definitive
T750 1096-1110 NNS denotes erythropoiesis
T751 1110-1111 . denotes .
T752 1112-1115 DT denotes The
T753 1116-1123 JJ denotes present
T754 1124-1129 NN denotes study
T755 1130-1135 VBZ denotes shows
T756 1136-1140 IN denotes that
T757 1141-1145 NNP denotes Sox6
T758 1146-1148 VBZ denotes is
T759 1149-1157 VBN denotes required
T760 1158-1161 IN denotes for
T761 1162-1171 VBG denotes silencing
T762 1172-1174 IN denotes of
T763 1175-1177 JJ denotes ɛy
T764 1178-1184 NN denotes globin
T765 1185-1187 IN denotes in
T766 1188-1198 JJ denotes definitive
T767 1199-1213 NNS denotes erythropoiesis
T768 1214-1217 CC denotes and
T800 1405-1409 NN denotes cell
T2925 2898-2901 NNPS denotes Sox
T2924 2894-2897 DT denotes the
T2923 2891-2893 IN denotes of
T2922 2884-2890 NN denotes member
T2921 2882-2883 DT denotes a
T2920 2879-2881 VBZ denotes is
T2919 2877-2878 -RRB- denotes )
T2918 2873-2877 NNP denotes Sox6
T2917 2872-2873 -LRB- denotes (
T2916 2868-2871 NN denotes box
T2915 2864-2867 NNP denotes HMG
T2914 2859-2863 NN denotes type
T2913 2855-2858 NNP denotes Sry
T769 1218-1226 VBZ denotes suggests
T770 1227-1228 DT denotes a
T771 1229-1233 NN denotes role
T772 1234-1237 IN denotes for
T773 1238-1242 NNP denotes Sox6
T774 1243-1245 IN denotes in
T775 1246-1255 JJ denotes erythroid
T776 1256-1260 NN denotes cell
T777 1261-1271 NN denotes maturation
T778 1271-1272 . denotes .
T779 1273-1277 RB denotes Thus
T780 1277-1278 , denotes ,
T781 1279-1283 JJ denotes Sox6
T782 1284-1294 NN denotes regulation
T783 1295-1297 IN denotes of
T784 1298-1300 JJ denotes ɛy
T785 1301-1307 NN denotes globin
T786 1308-1313 MD denotes might
T787 1314-1321 VB denotes provide
T788 1322-1323 DT denotes a
T789 1324-1329 NN denotes novel
T790 1330-1343 JJ denotes therapeutical
T791 1344-1350 NN denotes target
T792 1351-1353 IN denotes in
T793 1354-1357 DT denotes the
T794 1358-1367 NN denotes treatment
T795 1368-1370 IN denotes of
T796 1371-1389 NNS denotes hemoglobinopathies
T797 1390-1394 JJ denotes such
T801 1410-1416 NN denotes anemia
T802 1417-1420 CC denotes and
T803 1421-1432 NN denotes thalassemia
T804 1432-1433 . denotes .
R269 T573 T575 nsubj Sox6,Silences
R270 T574 T575 advmod Directly,Silences
R271 T575 T583 nsubj Silences,is
R272 T576 T578 compound Epsilon,Expression
R273 T577 T578 compound Globin,Expression
R274 T578 T583 nsubj Expression,is
R275 T579 T578 prep in,Expression
R276 T580 T582 compound Definitive,Sox6
R277 T581 T582 compound Erythropoiesis,Sox6
R278 T582 T579 pobj Sox6,in
R279 T583 T583 ROOT is,is
R280 T584 T585 det a,member
R281 T585 T583 attr member,is
R282 T586 T585 prep of,member
R283 T587 T591 det the,family
R284 T588 T591 compound Sox,family
R285 T589 T590 compound transcription,factor
R286 T590 T591 compound factor,family
R287 T591 T586 pobj family,of
R288 T592 T594 nsubjpass that,defined
R289 T593 T594 auxpass is,defined
R290 T594 T585 relcl defined,member
R291 T595 T594 agent by,defined
R292 T596 T600 det the,group
R293 T597 T600 amod conserved,group
R294 T598 T600 amod high,group
R295 T599 T600 compound mobility,group
R296 T600 T595 pobj group,by
R297 T601 T602 punct (,HMG
R298 T602 T600 appos HMG,group
R299 T603 T602 punct ),HMG
R300 T604 T606 compound DNA,domain
R301 T605 T606 amod binding,domain
R302 T606 T600 conj domain,group
R303 T607 T606 punct ",",domain
R304 T608 T609 advmod first,described
R305 T609 T600 acl described,group
R306 T610 T609 prep in,described
R307 T611 T614 det the,gene
R308 T612 T614 amod testis,gene
R309 T613 T614 amod determining,gene
R310 T614 T610 pobj gene,in
R311 T615 T614 punct ",",gene
R312 T616 T614 appos Sry,gene
R313 T617 T583 punct .,is
R314 T618 T619 amod Previous,studies
R315 T619 T621 nsubj studies,suggested
R316 T620 T621 aux have,suggested
R317 T621 T621 ROOT suggested,suggested
R318 T622 T624 mark that,plays
R319 T623 T624 nsubj Sox6,plays
R320 T624 T621 ccomp plays,suggested
R321 T625 T626 det a,role
R322 T626 T624 dobj role,plays
R323 T627 T626 prep in,role
R324 T628 T629 det the,development
R325 T629 T627 pobj development,in
R326 T630 T629 prep of,development
R327 T631 T634 det the,system
R328 T632 T634 amod central,system
R329 T633 T634 amod nervous,system
R330 T634 T630 pobj system,of
R331 T635 T634 punct ",",system
R332 T636 T634 conj cartilage,system
R333 T637 T636 punct ",",cartilage
R334 T638 T636 cc and,cartilage
R335 T639 T636 conj muscle,cartilage
R336 T640 T621 punct .,suggested
R337 T641 T652 prep In,expressed
R338 T642 T644 det the,mouse
R339 T643 T644 amod Sox6-deficient,mouse
R340 T644 T641 pobj mouse,In
R341 T645 T652 punct ",",expressed
R342 T646 T652 nsubjpass p100H,expressed
R343 T647 T652 punct ",",expressed
R344 T648 T649 amod ɛy,globin
R345 T649 T652 nsubjpass globin,expressed
R346 T650 T652 auxpass is,expressed
R347 T651 T652 advmod persistently,expressed
R348 T652 T652 ROOT expressed,expressed
R349 T653 T652 punct ",",expressed
R350 T654 T652 cc and,expressed
R351 T655 T656 amod increased,numbers
R352 T656 T661 nsubj numbers,are
R353 T657 T656 prep of,numbers
R354 T658 T660 amod nucleated,cells
R355 T659 T660 amod red,cells
R356 T660 T657 pobj cells,of
R357 T661 T652 conj are,expressed
R358 T662 T661 acomp present,are
R359 T663 T662 prep in,present
R360 T664 T666 det the,circulation
R361 T665 T666 amod fetal,circulation
R362 T666 T663 pobj circulation,in
R363 T667 T661 punct .,are
R364 T668 T669 compound Transfection,assays
R365 T669 T676 nsubj assays,define
R366 T670 T669 prep in,assays
R367 T671 T670 pobj GM979,in
R368 T672 T673 punct (,erythroleukemic
R369 T673 T671 appos erythroleukemic,GM979
R370 T674 T673 punct ),erythroleukemic
R371 T675 T676 nsubj cells,define
R372 T676 T676 ROOT define,define
R373 T677 T681 det a,region
R374 T678 T681 nummod 36,region
R375 T679 T681 compound base,region
R376 T680 T681 compound pair,region
R377 T681 T676 dobj region,define
R378 T682 T681 prep of,region
R379 T683 T686 det the,promoter
R380 T684 T686 amod ɛy,promoter
R381 T685 T686 amod proximal,promoter
R382 T686 T682 pobj promoter,of
R383 T687 T688 nsubj that,is
R384 T688 T686 relcl is,promoter
R385 T689 T688 acomp critical,is
R386 T690 T689 prep for,critical
R387 T691 T693 amod Sox6,repression
R388 T692 T693 amod mediated,repression
R389 T693 T690 pobj repression,for
R390 T694 T676 punct .,define
R391 T695 T698 amod Electrophoretic,assay
R392 T696 T698 compound mobility,assay
R393 T697 T698 compound shift,assay
R394 T698 T708 nmod assay,assays
R395 T699 T700 punct (,EMSA
R396 T700 T698 appos EMSA,assay
R397 T701 T700 punct ),EMSA
R398 T702 T698 cc and,assay
R399 T703 T704 compound chromatin,immunoprecipitation
R400 T704 T698 conj immunoprecipitation,assay
R401 T705 T704 punct (,immunoprecipitation
R402 T706 T704 appos ChIP,immunoprecipitation
R403 T707 T704 punct ),immunoprecipitation
R404 T708 T709 nsubj assays,demonstrate
R405 T709 T709 ROOT demonstrate,demonstrate
R406 T710 T718 mark that,binding
R407 T711 T712 amod Sox6,acts
R408 T712 T718 nsubj acts,binding
R409 T713 T712 prep as,acts
R410 T714 T715 det a,repressor
R411 T715 T713 pobj repressor,as
R412 T716 T712 prep by,acts
R413 T717 T718 advmod directly,binding
R414 T718 T709 ccomp binding,demonstrate
R415 T719 T718 prep to,binding
R488 T720 T722 det the,promoter
R489 T721 T722 amod ɛy,promoter
R490 T722 T719 pobj promoter,to
R491 T723 T709 punct .,demonstrate
R492 T724 T726 det The,expression
R493 T725 T726 amod normal,expression
R494 T726 T744 nsubj expression,demonstrate
R495 T727 T726 prep of,expression
R496 T728 T727 pobj Sox6,of
R497 T729 T726 prep in,expression
R498 T730 T732 amod wild-type,liver
R499 T731 T732 amod fetal,liver
R500 T732 T729 pobj liver,in
R501 T733 T732 cc and,liver
R502 T734 T736 det the,expression
R503 T735 T736 amod ectopic,expression
R504 T736 T732 conj expression,liver
R505 T737 T736 prep of,expression
R506 T738 T737 pobj ɛy,of
R507 T739 T738 prep in,ɛy
R508 T740 T743 amod p100H,liver
R509 T741 T743 amod homozygous,liver
R510 T742 T743 amod fetal,liver
R511 T743 T739 pobj liver,in
R512 T744 T744 ROOT demonstrate,demonstrate
R513 T745 T744 dobj that,demonstrate
R514 T746 T747 amod Sox6,functions
R515 T747 T745 conj functions,that
R516 T748 T747 prep in,functions
R517 T749 T750 amod definitive,erythropoiesis
R518 T750 T748 pobj erythropoiesis,in
R519 T751 T744 punct .,demonstrate
R520 T752 T754 det The,study
R521 T753 T754 amod present,study
R522 T754 T755 nsubj study,shows
R523 T755 T755 ROOT shows,shows
R524 T756 T759 mark that,required
R525 T757 T759 nsubjpass Sox6,required
R526 T758 T759 auxpass is,required
R527 T759 T755 ccomp required,shows
R528 T760 T759 prep for,required
R529 T761 T760 pcomp silencing,for
R530 T762 T761 prep of,silencing
R531 T763 T764 amod ɛy,globin
R532 T764 T762 pobj globin,of
R533 T765 T761 prep in,silencing
R534 T766 T767 amod definitive,erythropoiesis
R535 T767 T765 pobj erythropoiesis,in
R536 T768 T759 cc and,required
R537 T769 T755 conj suggests,shows
R538 T770 T771 det a,role
R539 T771 T769 dobj role,suggests
R540 T772 T771 prep for,role
R541 T773 T772 pobj Sox6,for
R542 T774 T771 prep in,role
R543 T775 T777 amod erythroid,maturation
R544 T776 T777 compound cell,maturation
R545 T777 T774 pobj maturation,in
R546 T778 T755 punct .,shows
R547 T779 T787 advmod Thus,provide
R548 T780 T787 punct ",",provide
R549 T781 T782 amod Sox6,regulation
R550 T782 T787 nsubj regulation,provide
R551 T783 T782 prep of,regulation
R552 T784 T785 amod ɛy,globin
R553 T785 T783 pobj globin,of
R554 T786 T787 aux might,provide
R555 T787 T787 ROOT provide,provide
R556 T788 T789 det a,novel
R557 T789 T787 dobj novel,provide
R558 T790 T791 amod therapeutical,target
R559 T791 T789 appos target,novel
R560 T792 T787 prep in,provide
R561 T793 T794 det the,treatment
R562 T794 T792 pobj treatment,in
R563 T795 T794 prep of,treatment
R564 T796 T795 pobj hemoglobinopathies,of
R565 T797 T798 amod such,as
R566 T798 T796 prep as,hemoglobinopathies
R567 T799 T800 compound sickle,cell
R568 T800 T801 compound cell,anemia
R569 T801 T798 pobj anemia,as
R570 T802 T801 cc and,anemia
R571 T803 T801 conj thalassemia,anemia
R572 T804 T787 punct .,provide
R1907 T2913 T2916 compound Sry,box
R1909 T2914 T2916 compound type,box
R1914 T2915 T2916 compound HMG,box
R1918 T2916 T2920 nsubj box,is
R1921 T2917 T2918 punct (,Sox6
R1922 T2918 T2916 appos Sox6,box
R1923 T2919 T2916 punct ),box
R1924 T2920 T2920 ROOT is,is
R1925 T2921 T2922 det a,member
R1926 T2922 T2920 attr member,is
R1927 T2926 T2927 compound transcription,factor
R1928 T2923 T2922 prep of,member
R1929 T2927 T2928 compound factor,family
R1930 T2928 T2923 pobj family,of
R1931 T2929 T2922 acl characterized,member
R1932 T2924 T2928 det the,family
R1933 T2930 T2929 agent by,characterized
R1934 T2931 T2935 det the,group
R1935 T2925 T2928 compound Sox,family
R1936 T2932 T2935 amod conserved,group
R1937 T2933 T2935 amod high,group
R1938 T2934 T2935 compound mobility,group
R1939 T3023 T3025 amod DNA-bound,factors
R1940 T2935 T2930 pobj group,by
R1941 T2936 T2937 punct (,HMG
R1942 T2937 T2935 appos HMG,group
R1943 T2938 T2937 punct ),HMG
R1944 T3024 T3025 compound transcription,factors
R1945 T2939 T2935 conj domain,group
R1946 T2940 T2935 punct ",",group
R1947 T2941 T2935 acl consisting,group
R1948 T3025 T3021 dobj factors,assembling
R1949 T2942 T2941 prep of,consisting
R1950 T2943 T2945 nummod 79,acids
R1951 T3026 T3021 prep into,assembling
R1952 T2944 T2945 compound amino,acids
R1953 T2945 T2942 pobj acids,of
R1954 T2946 T2945 acl involved,acids
R1955 T3027 T3028 advmod biologically,active
R1956 T2947 T2946 prep in,involved
R1957 T2948 T2949 compound DNA,recognition
R1958 T2949 T2947 pobj recognition,in
R1959 T3028 T3033 amod active,complexes
R1960 T2950 T2949 cc and,recognition
R1961 T2951 T2952 amod binding,[
R1962 T2952 T2949 conj [,recognition
R1963 T2953 T2954 nummod 1,]
R1964 T3029 T3033 punct ",",complexes
R1965 T2954 T2952 appos ],[
R1966 T2955 T2920 punct .,is
R1967 T3030 T3031 advmod sterically,defined
R1968 T2956 T2959 nsubj Sox,bind
R1969 T2957 T2958 compound transcription,factors
R1970 T2958 T2959 nsubj factors,bind
R1971 T3031 T3033 amod defined,complexes
R1972 T2959 T2959 ROOT bind,bind
R1973 T2960 T2959 prep to,bind
R1974 T3032 T3033 compound multiprotein,complexes
R1975 T2961 T2963 det the,groove
R1976 T2962 T2963 amod minor,groove
R1977 T3033 T3026 pobj complexes,into
R1978 T2963 T2960 pobj groove,to
R1979 T2964 T2963 prep of,groove
R1980 T2965 T2964 pobj DNA,of
R1981 T2966 T2959 cc and,bind
R1982 T2967 T2959 conj cause,bind
R1983 T2968 T2970 det a,°
R1984 T3034 T3007 punct .,perform
R1985 T2969 T2970 nummod 70,°
R1986 T2970 T2967 dobj °,cause
R1987 T2971 T2973 nummod 85,bend
R1988 T3035 T3038 nsubjpass Sox6,reported
R1989 T2972 T2973 compound °,bend
R1990 T2973 T2970 appos bend,°
R1991 T2974 T2973 prep of,bend
R1992 T3036 T3038 aux has,reported
R1993 T2975 T2976 det the,DNA
R1994 T2976 T2974 pobj DNA,of
R1995 T2977 T2978 nsubj that,leads
R1996 T3037 T3038 auxpass been,reported
R1997 T2978 T2976 relcl leads,DNA
R1998 T2979 T2978 prep to,leads
R1999 T2980 T2982 amod local,changes
R2000 T2981 T2982 amod conformational,changes
R2001 T3038 T3038 ROOT reported,reported
R2002 T2982 T2979 pobj changes,to
R2003 T2983 T2985 compound [,]
R2004 T3039 T3040 aux to,be
R2005 T2984 T2985 compound "2,3",]
R2006 T2985 T2982 appos ],changes
R2007 T2986 T2973 punct ",",bend
R2008 T3040 T3038 xcomp be,reported
R2009 T2987 T2992 mark while,target
R2010 T2988 T2991 amod most,factors
R2011 T2989 T2991 amod other,factors
R2012 T3041 T3040 acomp able,be
R2013 T2990 T2991 compound transcription,factors
R2014 T2991 T2992 nsubj factors,target
R2015 T2992 T2973 advcl target,bend
R2016 T2993 T2995 det the,groove
R2017 T2994 T2995 amod major,groove
R2018 T2995 T2992 dobj groove,target
R2019 T2996 T2995 prep of,groove
R2020 T2997 T3000 compound DNA,]
R2021 T3042 T3043 aux to,act
R2022 T2998 T3000 nmod [,]
R2023 T2999 T3000 nummod 4,]
R2024 T3000 T2996 pobj ],of
R2025 T3043 T3041 xcomp act,able
R2026 T3001 T2959 punct .,bind
R2027 T3002 T3007 advmod Therefore,perform
R2028 T3044 T3043 prep as,act
R2029 T3003 T3007 punct ",",perform
R2030 T3004 T3005 compound Sox,proteins
R2031 T3005 T3007 nsubj proteins,perform
R2032 T3045 T3047 preconj either,activator
R2033 T3006 T3007 aux may,perform
R2034 T3007 T3007 ROOT perform,perform
R2035 T3008 T3007 dobj part,perform
R2036 T3046 T3047 det an,activator
R2037 T3009 T3008 prep of,part
R2038 T3010 T3011 poss their,function
R2039 T3047 T3044 pobj activator,as
R2040 T3011 T3009 pobj function,of
R2041 T3012 T3007 prep as,perform
R2042 T3013 T3014 amod architectural,proteins
R2043 T3048 T3047 cc or,activator
R2044 T3014 T3012 pobj proteins,as
R2045 T3015 T3007 prep by,perform
R2046 T3016 T3015 pcomp organizing,by
R2047 T3049 T3050 det a,repressor
R2048 T3017 T3019 amod local,structure
R2049 T3018 T3019 compound chromatin,structure
R2050 T3050 T3047 conj repressor,activator
R2051 T3019 T3016 dobj structure,organizing
R2052 T3020 T3016 cc and,organizing
R2053 T3021 T3016 conj assembling,organizing
R2054 T3051 T3050 punct ",",repressor
R2055 T3022 T3025 amod other,factors
R2056 T3052 T3043 prep depending,act
R2057 T3053 T3052 prep on,depending
R2058 T3054 T3055 poss its,interactors
R2059 T3055 T3053 pobj interactors,on
R2060 T3056 T3055 cc and,interactors
R2061 T3120 T3118 punct ",",restored
R2062 T3057 T3060 poss its,context
R2063 T3121 T3118 advcl indicating,restored
R2064 T3122 T3123 amod functional,overlap
R2065 T3123 T3121 dobj overlap,indicating
R2066 T3124 T3123 prep of,overlap
R2067 T3125 T3126 det these,proteins
R2068 T3058 T3059 compound target,promoter
R2069 T3126 T3124 pobj proteins,of
R2070 T3127 T3123 conj [,overlap
R2071 T3128 T3129 nummod 7,]
R2072 T3059 T3060 compound promoter,context
R2073 T3129 T3127 dobj ],[
R2074 T3130 T3118 punct .,restored
R2075 T3131 T3131 ROOT Regardless,Regardless
R2076 T3060 T3052 conj context,depending
R2077 T3132 T3131 prep of,Regardless
R2078 T3133 T3144 advmod how,demonstrated
R2079 T3134 T3135 amod Sox6,functions
R2080 T3061 T3063 compound [,]
R2081 T3135 T3144 nsubj functions,demonstrated
R2082 T3136 T3135 prep in,functions
R2083 T3062 T3063 compound "5,6",]
R2084 T3137 T3136 pcomp regulating,in
R2085 T3138 T3139 compound gene,expression
R2086 T3063 T3060 appos ],context
R2087 T3139 T3137 dobj expression,regulating
R2088 T3140 T3144 punct ",",demonstrated
R2089 T3141 T3142 amod previous,studies
R2090 T3064 T3038 punct .,reported
R2091 T3142 T3144 nsubj studies,demonstrated
R2092 T3143 T3144 aux have,demonstrated
R2093 T3144 T3132 pcomp demonstrated,of
R2094 T3065 T3071 advmod Intriguingly,shown
R2095 T3145 T3147 mark that,is
R2096 T3146 T3147 nsubj Sox6,is
R2097 T3147 T3144 ccomp is,demonstrated
R2098 T3066 T3071 punct ",",shown
R2099 T3148 T3151 det an,molecule
R2100 T3149 T3151 amod important,molecule
R2101 T3150 T3151 amod regulatory,molecule
R2102 T3067 T3071 nsubj Sox6,shown
R2103 T3151 T3147 attr molecule,is
R2104 T3152 T3153 nsubj that,plays
R2105 T3068 T3071 aux has,shown
R2106 T3153 T3151 relcl plays,molecule
R2107 T3154 T3155 det a,role
R2108 T3155 T3153 dobj role,plays
R2109 T3156 T3155 prep in,role
R2110 T3069 T3071 advmod also,shown
R2111 T3157 T3158 det the,development
R2112 T3158 T3156 pobj development,in
R2113 T3159 T3158 prep of,development
R2114 T3160 T3163 det the,system
R2115 T3161 T3163 amod central,system
R2116 T3162 T3163 amod nervous,system
R2117 T3070 T3071 auxpass been,shown
R2118 T3163 T3159 pobj system,of
R2119 T3164 T3172 nmod [,]
R2120 T3165 T3164 nummod 8,[
R2121 T3071 T3071 ROOT shown,shown
R2122 T3166 T3167 nummod 11,]
R2123 T3167 T3164 appos ],[
R2124 T3168 T3169 punct ",",cartilage
R2125 T3169 T3164 conj cartilage,[
R2126 T3072 T3073 aux to,act
R2127 T3170 T3172 compound [,]
R2128 T3171 T3172 compound "6,12,13",]
R2129 T3172 T3153 npadvmod ],plays
R2130 T3073 T3071 xcomp act,shown
R2131 T3173 T3172 punct ",",]
R2132 T3174 T3172 cc and,]
R2133 T3074 T3073 prep as,act
R2134 T3175 T3178 compound muscle,]
R2135 T3176 T3178 compound [,]
R2136 T3075 T3078 det a,factor
R2137 T3177 T3178 compound "14,15",]
R2138 T3178 T3172 conj ],]
R2139 T3179 T3131 punct .,Regardless
R2140 T3076 T3078 amod general,factor
R2141 T3180 T3183 det A,mouse
R2142 T3181 T3183 amod Sox6-null,mouse
R2143 T3182 T3183 amod mutant,mouse
R2144 T3077 T3078 compound splicing,factor
R2145 T3183 T3190 nsubjpass mouse,identified
R2146 T3184 T3185 punct (,p100H
R2147 T3185 T3183 appos p100H,mouse
R2148 T3078 T3074 pobj factor,as
R2149 T3186 T3185 punct ),p100H
R2150 T3187 T3190 aux has,identified
R2151 T3188 T3190 advmod previously,identified
R2152 T3079 T3080 nsubj that,participates
R2153 T3080 T3078 relcl participates,factor
R2154 T3189 T3190 auxpass been,identified
R2155 T3190 T3190 ROOT identified,identified
R2156 T3191 T3190 prep in,identified
R2157 T3081 T3080 prep in,participates
R2158 T3192 T3193 poss our,laboratory
R2159 T3193 T3191 pobj laboratory,in
R2160 T3082 T3084 amod pre-mRNA,[
R2161 T3194 T3196 nmod [,]
R2162 T3195 T3196 nummod 14,]
R2163 T3196 T3190 dobj ],identified
R2164 T3197 T3190 punct .,identified
R2165 T3198 T3199 compound Mice,homozygous
R2166 T3199 T3206 nsubj homozygous,develop
R2167 T3083 T3084 compound splicing,[
R2168 T3200 T3199 prep for,homozygous
R2169 T3201 T3202 amod p100H,show
R2170 T3202 T3200 pobj show,for
R2171 T3084 T3086 nmod [,]
R2172 T3203 T3204 amod delayed,growth
R2173 T3204 T3202 dobj growth,show
R2174 T3085 T3086 nummod 7,]
R2175 T3205 T3202 punct ",",show
R2176 T3206 T3206 ROOT develop,develop
R2177 T3207 T3211 nmod myopathy,block
R2178 T3086 T3081 pobj ],in
R2179 T3208 T3207 cc and,myopathy
R2180 T3209 T3207 conj arterioventricular,myopathy
R2181 T3210 T3211 compound heart,block
R2182 T3211 T3206 dobj block,develop
R2183 T3087 T3071 punct .,shown
R2184 T3212 T3206 punct ",",develop
R2185 T3213 T3206 cc and,develop
R2186 T3214 T3206 conj die,develop
R2187 T3088 T3095 nsubj Depletion,blocked
R2188 T3215 T3214 prep within,die
R2189 T3216 T3217 nummod 2,wk
R2190 T3089 T3088 prep of,Depletion
R2191 T3090 T3089 pobj Sox6,of
R2192 T3091 T3090 prep in,Sox6
R2193 T3217 T3215 pobj wk,within
R2194 T3218 T3214 prep after,die
R2195 T3219 T3218 pobj birth,after
R2196 T3092 T3093 compound HeLa,cell
R2197 T3220 T3222 nmod [,]
R2198 T3221 T3222 nummod 14,]
R2199 T3093 T3094 compound cell,extracts
R2200 T3222 T3214 conj ],die
R2201 T3223 T3206 punct .,develop
R2202 T3224 T3227 det The,allele
R2203 T3094 T3095 nsubj extracts,blocked
R2204 T3225 T3227 amod p100H,allele
R2205 T3226 T3227 amod mutant,allele
R2206 T3227 T3229 nsubjpass allele,associated
R2207 T3095 T3095 ROOT blocked,blocked
R2208 T3228 T3229 auxpass is,associated
R2209 T3229 T3229 ROOT associated,associated
R2210 T3096 T3095 dobj splicing,blocked
R2211 T3230 T3229 prep with,associated
R2212 T3231 T3234 det a,inversion
R2213 T3232 T3234 nmod Chromosome,inversion
R2214 T3233 T3232 nummod 7,Chromosome
R2215 T3234 T3230 pobj inversion,with
R2216 T3235 T3236 nsubj that,disrupts
R2217 T3097 T3096 prep of,splicing
R2218 T3236 T3234 relcl disrupts,inversion
R2219 T3237 T3240 preconj both,gene
R2220 T3238 T3240 det the,gene
R2221 T3098 T3099 amod multiple,substrates
R2222 T3239 T3240 compound p,gene
R2223 T3240 T3236 dobj gene,disrupts
R2224 T3241 T3240 cc and,gene
R2225 T3099 T3097 pobj substrates,of
R2226 T3242 T3244 det the,gene
R2227 T3243 T3244 compound Sox6,gene
R2228 T3244 T3240 conj gene,gene
R2229 T3100 T3095 punct ",",blocked
R2230 T3245 T3244 punct (,gene
R2231 T3246 T3244 cc and,gene
R2232 T3247 T3249 det no,gene
R2233 T3101 T3095 cc and,blocked
R2234 T3248 T3249 amod other,gene
R2235 T3249 T3244 conj gene,gene
R2236 T3250 T3249 prep within,gene
R2237 T3102 T3095 conj expression,blocked
R2238 T3251 T3252 nummod "50,000",nucleotides
R2239 T3252 T3250 pobj nucleotides,within
R2240 T3103 T3102 prep of,expression
R2241 T3253 T3252 prep of,nucleotides
R2242 T3254 T3256 det the,breakpoints
R2243 T3255 T3256 amod chromosomal,breakpoints
R2244 T3104 T3106 det the,domain
R2245 T3256 T3253 pobj breakpoints,of
R2246 T3257 T3229 punct ),associated
R2247 T3105 T3106 compound HMG,domain
R2248 T3258 T3260 nmod [,]
R2249 T3259 T3260 nummod 14,]
R2250 T3260 T3260 ROOT ],]
R2251 T3261 T3260 punct .,]
R2252 T3106 T3103 pobj domain,of
R2253 T3262 T3279 mark Because,implicated
R2254 T3263 T3266 det the,functions
R2255 T3107 T3106 prep of,domain
R2256 T3264 T3265 compound p,gene
R2257 T3265 T3266 compound gene,functions
R2258 T3266 T3279 advcl functions,implicated
R2259 T3108 T3118 preconj either,restored
R2260 T3267 T3268 advmod solely,in
R2261 T3268 T3266 prep in,functions
R2262 T3109 T3118 nsubj Sox6,restored
R2263 T3269 T3268 pobj pigmentation,in
R2264 T3110 T3109 punct ",",Sox6
R2265 T3270 T3272 nmod [,]
R2266 T3271 T3272 nummod 16,]
R2267 T3272 T3266 appos ],functions
R2268 T3273 T3279 punct ",",implicated
R2269 T3274 T3277 det the,factor
R2270 T3111 T3109 conj Sox9,Sox6
R2271 T3275 T3277 compound Sox6,factor
R2272 T3276 T3277 compound transcription,factor
R2273 T3112 T3111 punct ",",Sox9
R2274 T3277 T3279 nsubjpass factor,implicated
R2275 T3278 T3279 auxpass is,implicated
R2276 T3279 T3279 ROOT implicated,implicated
R2277 T3280 T3279 prep in,implicated
R2278 T3113 T3111 cc or,Sox9
R2279 T3281 T3283 det all,phenotypes
R2280 T3282 T3283 amod other,phenotypes
R2281 T3283 T3280 pobj phenotypes,in
R2282 T3114 T3111 conj Sry,Sox9
R2283 T3284 T3279 punct .,implicated
R2284 T3285 T3322 prep Among,are
R2285 T3286 T3289 det the,proteins
R2286 T3115 T3109 prep in,Sox6
R2287 T3287 T3289 compound HMG,proteins
R2288 T3288 T3289 compound box,proteins
R2289 T3289 T3285 pobj proteins,Among
R2290 T3116 T3117 det the,extracts
R2291 T3290 T3291 advmod distantly,related
R2292 T3291 T3289 acl related,proteins
R2293 T3292 T3291 prep to,related
R2294 T3117 T3115 pobj extracts,in
R2295 T3293 T3292 pobj Sry,to
R2296 T3294 T3293 punct (,Sry
R2297 T3295 T3297 det the,member
R2298 T3118 T3095 conj restored,blocked
R2299 T3296 T3297 amod first,member
R2300 T3297 T3293 appos member,Sry
R2301 T3298 T3297 acl identified,member
R2302 T3119 T3118 dobj splicing,restored
R2303 T3299 T3298 prep of,identified
R2304 T3300 T3304 det the,family
R2305 T3314 T3308 conj bend,bind
R2306 T3301 T3303 compound Sox,factor
R2307 T3302 T3303 compound transcription,factor
R2308 T3303 T3304 compound factor,family
R2309 T3304 T3299 pobj family,of
R2310 T3315 T3314 dobj DNA,bend
R2311 T3305 T3293 punct ),Sry
R2312 T3306 T3308 nsubj that,bind
R2313 T3307 T3308 advmod similarly,bind
R2314 T3316 T3314 punct ",",bend
R2315 T3308 T3289 relcl bind,proteins
R2316 T3309 T3308 prep to,bind
R2317 T3310 T3312 det the,groove
R2318 T3311 T3312 amod minor,groove
R2319 T3312 T3309 pobj groove,to
R2320 T3313 T3308 cc and,bind
R2321 T3317 T3314 cc but,bend
R2322 T3318 T3308 prep without,bind
R2323 T3319 T3320 compound sequence,specificity
R2324 T3411 T3401 cc and,are
R2325 T3320 T3318 pobj specificity,without
R2326 T3412 T3401 conj function,are
R2327 T3413 T3415 nmod [,]
R2328 T3321 T3322 punct ",",are
R2329 T3414 T3415 nummod 22,]
R2330 T3415 T3412 dobj ],function
R2331 T3416 T3401 punct .,are
R2332 T3322 T3322 ROOT are,are
R2333 T3417 T3418 amod High-level,expression
R2334 T3418 T3422 nsubj expression,requires
R2335 T3419 T3418 prep of,expression
R2336 T3323 T3329 det the,proteins
R2337 T3420 T3421 det these,genes
R2338 T3421 T3419 pobj genes,of
R2339 T3422 T3422 ROOT requires,requires
R2340 T3324 T3325 nsubj ubiquitously,expressed
R2341 T3423 T3425 det a,element
R2342 T3424 T3425 amod regulatory,element
R2343 T3325 T3329 amod expressed,proteins
R2344 T3425 T3422 dobj element,requires
R2345 T3426 T3425 punct ",",element
R2346 T3326 T3329 nmod HMG1,proteins
R2347 T3427 T3430 det the,region
R2348 T3428 T3429 compound locus,control
R2349 T3327 T3326 cc and,HMG1
R2350 T3429 T3430 compound control,region
R2351 T3430 T3425 appos region,element
R2352 T3328 T3326 conj HMG2,HMG1
R2353 T3431 T3433 nsubjpass that,characterized
R2354 T3432 T3433 auxpass is,characterized
R2355 T3433 T3430 relcl characterized,region
R2356 T3329 T3322 attr proteins,are
R2357 T3330 T3332 nmod [,]
R2358 T3434 T3433 agent by,characterized
R2359 T3331 T3332 nummod 17,]
R2360 T3435 T3436 det a,set
R2361 T3436 T3434 pobj set,by
R2362 T3332 T3329 appos ],proteins
R2363 T3437 T3436 prep of,set
R2364 T3438 T3440 amod nuclease,sites
R2365 T3439 T3440 amod hypersensitive,sites
R2366 T3440 T3437 pobj sites,of
R2367 T3441 T3436 acl spread,set
R2368 T3442 T3441 prep over,spread
R2369 T3333 T3322 punct .,are
R2370 T3443 T3444 nummod 25,kb
R2371 T3444 T3445 npadvmod kb,located
R2372 T3445 T3436 acl located,set
R2373 T3334 T3345 nsubj Modulation,mediate
R2374 T3446 T3447 nummod 5,′
R2375 T3447 T3445 dobj ′,located
R2376 T3448 T3447 prep of,′
R2377 T3335 T3334 prep of,Modulation
R2378 T3449 T3451 det the,gene
R2379 T3450 T3451 amod ɛy,gene
R2380 T3451 T3448 pobj gene,of
R2381 T3336 T3337 compound DNA,structure
R2382 T3452 T3447 conj [,′
R2383 T3453 T3454 nummod 23,]
R2384 T3454 T3447 conj ],′
R2385 T3337 T3335 pobj structure,of
R2386 T3455 T3422 punct .,requires
R2387 T3456 T3458 det The,genes
R2388 T3457 T3458 amod β-globin,genes
R2389 T3338 T3334 agent by,Modulation
R2390 T3458 T3460 nsubjpass genes,expressed
R2391 T3459 T3460 auxpass are,expressed
R2392 T3460 T3460 ROOT expressed,expressed
R2393 T3339 T3343 det these,proteins
R2394 T3461 T3460 prep in,expressed
R2395 T3462 T3463 det a,tissue
R2396 T3463 T3461 pobj tissue,in
R2397 T3340 T3339 cc and,these
R2398 T3464 T3460 punct -,expressed
R2399 T3465 T3460 cc and,expressed
R2400 T3466 T3467 amod development-specific,fashion
R2401 T3341 T3343 amod other,proteins
R2402 T3467 T3460 conj fashion,expressed
R2403 T3468 T3460 punct .,expressed
R2404 T3469 T3473 prep In,originates
R2405 T3342 T3343 compound HMG,proteins
R2406 T3470 T3469 pobj mice,In
R2407 T3471 T3472 punct ",",erythropoiesis
R2408 T3472 T3473 nsubj erythropoiesis,originates
R2409 T3343 T3338 pobj proteins,by
R2410 T3473 T3473 ROOT originates,originates
R2411 T3474 T3473 prep in,originates
R2412 T3344 T3345 aux can,mediate
R2413 T3475 T3478 det the,sac
R2414 T3476 T3477 amod embryonic,yolk
R2415 T3477 T3478 compound yolk,sac
R2416 T3478 T3474 pobj sac,in
R2417 T3479 T3483 advmod where,express
R2418 T3480 T3482 amod primitive,cells
R2419 T3345 T3345 ROOT mediate,mediate
R2420 T3481 T3482 amod erythroid,cells
R2421 T3482 T3483 nsubj cells,express
R2422 T3483 T3478 relcl express,sac
R2423 T3346 T3348 amod long-range,function
R2424 T3484 T3483 dobj ɛy,express
R2425 T3485 T3484 cc and,ɛy
R2426 T3486 T3487 amod βh-1,globins
R2427 T3487 T3484 conj globins,ɛy
R2428 T3347 T3348 compound enhancer,function
R2429 T3488 T3490 nmod [,]
R2430 T3489 T3490 nummod 22,]
R2431 T3490 T3490 ROOT ],]
R2432 T3348 T3345 dobj function,mediate
R2433 T3491 T3490 punct .,]
R2434 T3492 T3523 prep At,]
R2435 T3493 T3502 nummod 11.5,shifts
R2436 T3349 T3348 prep on,function
R2437 T3494 T3502 nmod d,shifts
R2438 T3495 T3496 compound post,coitus
R2439 T3350 T3351 det both,DNA
R2440 T3496 T3502 dep coitus,shifts
R2441 T3497 T3498 punct (,dpc
R2442 T3498 T3496 parataxis dpc,coitus
R2443 T3351 T3349 pobj DNA,on
R2444 T3499 T3498 punct ),dpc
R2445 T3500 T3501 punct ",",erythropoiesis
R2446 T3501 T3502 compound erythropoiesis,shifts
R2447 T3352 T3351 cc and,DNA
R2448 T3502 T3492 pobj shifts,At
R2449 T3503 T3502 prep to,shifts
R2450 T3353 T3354 amod chromatin-assembled,genes
R2451 T3504 T3506 det the,liver
R2452 T3505 T3506 amod fetal,liver
R2453 T3354 T3351 conj genes,DNA
R2454 T3506 T3503 pobj liver,to
R2455 T3355 T3345 prep by,mediate
R2456 T3507 T3511 advmod where,express
R2457 T3356 T3355 pcomp bringing,by
R2458 T3357 T3356 advmod together,bringing
R2459 T3508 T3510 amod definitive,cells
R2460 T3358 T3359 amod distant,regions
R2461 T3509 T3510 amod erythroid,cells
R2462 T3510 T3511 nsubj cells,express
R2463 T3359 T3356 dobj regions,bringing
R2464 T3511 T3506 relcl express,liver
R2465 T3512 T3514 compound adult,globins
R2466 T3513 T3514 compound β,globins
R2467 T3514 T3511 dobj globins,express
R2468 T3515 T3514 punct (,globins
R2469 T3360 T3359 prep of,regions
R2470 T3516 T3517 advmod β,major
R2471 T3517 T3514 amod major,globins
R2472 T3518 T3517 cc and,major
R2473 T3361 T3360 pobj DNA,of
R2474 T3519 T3517 conj minor,major
R2475 T3520 T3492 punct ),At
R2476 T3521 T3523 nmod [,]
R2477 T3362 T3356 cc and,bringing
R2478 T3522 T3523 nummod 22,]
R2479 T3523 T3523 ROOT ],]
R2480 T3363 T3364 amod associated,factors
R2481 T3524 T3523 punct .,]
R2482 T3525 T3527 det The,gene
R2483 T3526 T3527 amod ɛy,gene
R2484 T3364 T3356 dobj factors,bringing
R2485 T3527 T3529 nsubjpass gene,silenced
R2486 T3528 T3529 auxpass is,silenced
R2487 T3365 T3345 punct .,mediate
R2488 T3529 T3529 ROOT silenced,silenced
R2489 T3530 T3529 prep in,silenced
R2490 T3531 T3533 amod definitive,cells
R2491 T3366 T3372 advmod Specifically,shown
R2492 T3532 T3533 amod erythroid,cells
R2493 T3533 T3530 pobj cells,in
R2494 T3367 T3372 punct ",",shown
R2495 T3534 T3529 punct .,silenced
R2496 T3535 T3536 det The,mechanism
R2497 T3536 T3549 nsubj mechanism,studied
R2498 T3368 T3369 compound HMG,proteins
R2499 T3537 T3536 prep of,mechanism
R2500 T3538 T3537 pcomp silencing,of
R2501 T3539 T3538 prep of,silencing
R2502 T3369 T3372 nsubjpass proteins,shown
R2503 T3540 T3542 poss its,counterpart
R2504 T3541 T3542 amod human,counterpart
R2505 T3542 T3539 pobj counterpart,of
R2506 T3370 T3372 aux have,shown
R2507 T3543 T3542 punct ",",counterpart
R2508 T3544 T3545 compound ɛ,globin
R2509 T3545 T3542 appos globin,counterpart
R2510 T3371 T3372 auxpass been,shown
R2511 T3546 T3549 punct ",",studied
R2512 T3547 T3549 aux has,studied
R2513 T3372 T3372 ROOT shown,shown
R2514 T3548 T3549 auxpass been,studied
R2515 T3549 T3549 ROOT studied,studied
R2516 T3550 T3549 advmod extensively,studied
R2517 T3551 T3549 punct .,studied
R2518 T3552 T3558 prep In,activated
R2519 T3553 T3554 amod definitive,erythropoiesis
R2520 T3554 T3552 pobj erythropoiesis,In
R2521 T3373 T3374 aux to,modulate
R2522 T3555 T3558 punct ",",activated
R2523 T3556 T3558 nsubjpass ɛ,activated
R2524 T3374 T3372 xcomp modulate,shown
R2525 T3557 T3558 auxpass is,activated
R2526 T3558 T3558 ROOT activated,activated
R2527 T3559 T3558 cc and,activated
R2528 T3375 T3376 amod β-globin,genes
R2529 T3560 T3558 conj silenced,activated
R2530 T3561 T3564 advmod autonomously,]
R2531 T3562 T3564 compound [,]
R2532 T3376 T3374 dobj genes,modulate
R2533 T3563 T3564 compound "24,25",]
R2534 T3564 T3560 dobj ],silenced
R2535 T3377 T3374 npadvmod [,modulate
R2536 T3565 T3560 punct ",",silenced
R2537 T3566 T3572 mark although,appears
R2538 T3567 T3572 prep in,appears
R2539 T3378 T3377 nummod 18,[
R2540 T3568 T3570 amod primitive,ɛ
R2541 T3569 T3570 compound erythropoiesis,ɛ
R2542 T3570 T3567 pobj ɛ,in
R2543 T3379 T3380 nummod 21,]
R2544 T3571 T3572 advmod also,appears
R2545 T3572 T3558 conj appears,activated
R2546 T3380 T3377 appos ],[
R2547 T3573 T3575 aux to,regulated
R2548 T3574 T3575 auxpass be,regulated
R2549 T3575 T3572 xcomp regulated,appears
R2550 T3381 T3372 punct .,shown
R2551 T3576 T3575 advmod competitively,regulated
R2552 T3577 T3579 nmod [,]
R2553 T3382 T3385 det The,genes
R2554 T3578 T3579 nummod 26,]
R2555 T3579 T3572 dep ],appears
R2556 T3580 T3572 punct .,appears
R2557 T3383 T3385 compound mouse,genes
R2558 T3581 T3582 det The,γ-globin
R2559 T3582 T3588 nsubjpass γ-globin,controlled
R2560 T3583 T3584 aux to,adult
R2561 T3384 T3385 compound β-globin,genes
R2562 T3385 T3395 nsubjpass genes,clustered
R2563 T3584 T3582 acl adult,γ-globin
R2564 T3585 T3586 compound β-globin,switch
R2565 T3386 T3385 appos ɛy,genes
R2566 T3586 T3588 nsubjpass switch,controlled
R2567 T3587 T3588 auxpass is,controlled
R2568 T3588 T3588 ROOT controlled,controlled
R2569 T3589 T3588 agent by,controlled
R2570 T3590 T3591 compound promoter,competition
R2571 T3591 T3589 pobj competition,by
R2572 T3387 T3386 punct ",",ɛy
R2573 T3592 T3591 prep for,competition
R2574 T3593 T3597 det the,]
R2575 T3388 T3386 appos βh1,ɛy
R2576 T3594 T3595 compound LCR,[
R2577 T3595 T3597 nmod [,]
R2578 T3389 T3386 punct ",",ɛy
R2579 T3596 T3597 nummod "24,25",]
R2580 T3597 T3592 pobj ],for
R2581 T3598 T3588 punct .,controlled
R2582 T3599 T3601 predet All,elements
R2583 T3390 T3386 conj β-major,ɛy
R2584 T3600 T3601 det the,elements
R2585 T3601 T3609 nsubj elements,are
R2586 T3391 T3390 punct ",",β-major
R2587 T3602 T3601 amod responsible,elements
R2588 T3603 T3602 prep for,responsible
R2589 T3604 T3603 pcomp silencing,for
R2590 T3392 T3390 cc and,β-major
R2591 T3393 T3390 conj β-minor,β-major
R2592 T3394 T3395 auxpass are,clustered
R2593 T3605 T3608 det the,gene
R2594 T3606 T3608 nmod ɛ,gene
R2595 T3395 T3395 ROOT clustered,clustered
R2596 T3607 T3608 compound globin,gene
R2597 T3608 T3604 dobj gene,silencing
R2598 T3396 T3395 prep on,clustered
R2599 T3609 T3609 ROOT are,are
R2600 T3610 T3609 prep within,are
R2601 T3611 T3613 det the,gene
R2602 T3397 T3396 pobj Chromosome,on
R2603 T3612 T3613 compound ɛ,gene
R2604 T3613 T3610 pobj gene,within
R2605 T3614 T3610 cc or,within
R2606 T3398 T3397 nummod 7,Chromosome
R2607 T3615 T3610 conj in,within
R2608 T3616 T3617 amod adjacent,sequences
R2609 T3399 T3395 cc and,clustered
R2610 T3617 T3615 pobj sequences,in
R2611 T3618 T3620 nmod [,]
R2612 T3400 T3401 nsubj they,are
R2613 T3619 T3620 nummod 27,]
R2614 T3620 T3609 attr ],are
R2615 T3621 T3609 punct ",",are
R2616 T3401 T3395 conj are,clustered
R2617 T3622 T3609 advcl suggesting,are
R2618 T3623 T3625 mark that,is
R2619 T3624 T3625 csubj silencing,is
R2620 T3625 T3622 ccomp is,suggesting
R2621 T3626 T3627 advmod primarily,gene
R2622 T3627 T3625 attr gene,is
R2623 T3402 T3403 advmod highly,homologous
R2624 T3628 T3627 amod autonomous,gene
R2625 T3629 T3609 punct .,are
R2626 T3630 T3654 csubj Using,identified
R2627 T3403 T3401 acomp homologous,are
R2628 T3631 T3632 compound promoter,deletion
R2629 T3632 T3633 compound deletion,analyses
R2630 T3633 T3630 dobj analyses,Using
R2631 T3404 T3403 prep to,homologous
R2632 T3634 T3633 prep in,analyses
R2633 T3635 T3637 amod transgenic,models
R2634 T3405 T3407 poss their,counterparts
R2635 T3636 T3637 compound mouse,models
R2636 T3637 T3634 pobj models,in
R2637 T3638 T3637 cc and,models
R2638 T3406 T3407 amod human,counterparts
R2639 T3639 T3640 compound cell,transfection
R2640 T3640 T3641 compound transfection,assays
R2641 T3641 T3637 conj assays,models
R2642 T3407 T3404 pobj counterparts,to
R2643 T3642 T3641 punct ",",assays
R2644 T3643 T3645 amod multiple,elements
R2645 T3408 T3407 prep in,counterparts
R2646 T3644 T3645 compound DNA,elements
R2647 T3645 T3641 conj elements,assays
R2648 T3646 T3645 amod important,elements
R2649 T3409 T3410 amod organizational,structure
R2650 T3647 T3646 prep to,important
R2651 T3648 T3650 det the,process
R2652 T3649 T3650 amod silencing,process
R2653 T3410 T3408 pobj structure,in
R2654 T3650 T3647 pobj process,to
R2655 T3651 T3654 aux have,identified
R2656 T3652 T3654 auxpass been,identified
R2657 T3702 T3688 punct ),shown
R2658 T3653 T3654 advmod previously,identified
R2659 T3654 T3654 ROOT identified,identified
R2660 T3655 T3654 prep in,identified
R2661 T3656 T3658 preconj both,proximal
R2662 T3703 T3704 aux to,regulate
R2663 T3657 T3658 det the,proximal
R2664 T3658 T3655 pobj proximal,in
R2665 T3659 T3658 cc and,proximal
R2666 T3704 T3688 advcl regulate,shown
R2667 T3660 T3664 det the,promoter
R2668 T3661 T3664 amod distal,promoter
R2669 T3662 T3664 compound ɛ,promoter
R2670 T3705 T3704 dobj ɛ,regulate
R2671 T3663 T3664 compound gene,promoter
R2672 T3664 T3658 conj promoter,proximal
R2673 T3665 T3667 nmod [,]
R2674 T3706 T3705 acl silencing,ɛ
R2675 T3666 T3667 nummod 27,]
R2676 T3667 T3664 appos ],promoter
R2677 T3707 T3709 nmod [,]
R2678 T3668 T3654 punct .,identified
R2679 T3669 T3672 poss Their,factors
R2680 T3670 T3672 amod corresponding,factors
R2681 T3708 T3709 nummod 27,]
R2682 T3671 T3672 compound transcription,factors
R2683 T3709 T3706 dobj ],silencing
R2684 T3672 T3686 nsubjpass factors,identified
R2685 T3673 T3672 punct ",",factors
R2686 T3674 T3675 amod such,as
R2687 T3710 T3686 punct .,identified
R2688 T3675 T3672 prep as,factors
R2689 T3676 T3675 pobj GATA-1,as
R2690 T3677 T3676 punct ",",GATA-1
R2691 T3711 T3714 advmod Thus,appears
R2692 T3678 T3676 conj YY-1,GATA-1
R2693 T3679 T3678 punct ",",YY-1
R2694 T3712 T3714 punct ",",appears
R2695 T3680 T3678 conj COUP-TF,YY-1
R2696 T3681 T3680 punct ",",COUP-TF
R2697 T3682 T3680 cc and,COUP-TF
R2698 T3713 T3714 nsubj it,appears
R2699 T3683 T3680 conj DRED,COUP-TF
R2700 T3684 T3686 aux have,identified
R2701 T3685 T3686 auxpass been,identified
R2702 T3714 T3714 ROOT appears,appears
R2703 T3686 T3686 ROOT identified,identified
R2704 T3687 T3686 cc and,identified
R2705 T3688 T3686 conj shown,identified
R2706 T3715 T3722 mark that,involves
R2707 T3689 T3691 aux to,bind
R2708 T3690 T3691 advmod directly,bind
R2709 T3691 T3688 xcomp bind,shown
R2710 T3716 T3717 det the,silencing
R2711 T3692 T3691 prep to,bind
R2712 T3693 T3695 det these,elements
R2713 T3694 T3695 compound DNA,elements
R2714 T3717 T3722 nsubj silencing,involves
R2715 T3695 T3692 pobj elements,to
R2716 T3696 T3695 punct (,elements
R2717 T3697 T3688 prep as,shown
R2718 T3698 T3697 pobj part,as
R2719 T3699 T3698 prep of,part
R2720 T3700 T3701 compound protein,complexes
R2721 T3718 T3717 prep of,silencing
R2722 T3701 T3699 pobj complexes,of
R2723 T3719 T3721 det the,gene
R2724 T3720 T3721 compound ɛ,gene
R2725 T3721 T3718 pobj gene,of
R2726 T3799 T3799 ROOT describe,describe
R2727 T3722 T3714 ccomp involves,appears
R2728 T3723 T3725 det a,network
R2729 T3800 T3803 mark that,exerts
R2730 T3801 T3803 nsubj Sox6,exerts
R2731 T3724 T3725 amod complicated,network
R2732 T3802 T3803 advmod also,exerts
R2733 T3803 T3799 ccomp exerts,describe
R2734 T3725 T3722 dobj network,involves
R2735 T3804 T3805 amod pleiotropic,effects
R2736 T3805 T3803 dobj effects,exerts
R2737 T3726 T3725 prep of,network
R2738 T3806 T3805 prep on,effects
R2739 T3807 T3806 pobj erythropoiesis,on
R2740 T3808 T3799 punct .,describe
R2741 T3727 T3729 amod multiple,elements
R2742 T3809 T3810 det These,effects
R2743 T3810 T3811 nsubj effects,include
R2744 T3728 T3729 compound cis,elements
R2745 T3811 T3811 ROOT include,include
R2746 T3812 T3813 amod delayed,maturation
R2747 T3813 T3811 dobj maturation,include
R2748 T3729 T3726 pobj elements,of
R2749 T3814 T3813 prep of,maturation
R2750 T3815 T3814 pobj erythrocytes,of
R2751 T3816 T3819 punct (,enucleate
R2752 T3730 T3729 cc and,elements
R2753 T3817 T3819 nsubj that,enucleate
R2754 T3818 T3819 advmod normally,enucleate
R2755 T3731 T3732 amod transacting,proteins
R2756 T3819 T3813 appos enucleate,maturation
R2757 T3732 T3729 conj proteins,elements
R2758 T3820 T3819 advmod prior,enucleate
R2759 T3733 T3714 punct .,appears
R2760 T3821 T3820 prep to,prior
R2761 T3822 T3821 pcomp entering,to
R2762 T3823 T3824 det the,bloodstream
R2763 T3734 T3767 prep In,shown
R2764 T3824 T3822 dobj bloodstream,entering
R2765 T3825 T3827 nmod [,]
R2766 T3826 T3827 nummod 27,]
R2767 T3735 T3734 pobj addition,In
R2768 T3827 T3824 appos ],bloodstream
R2769 T3828 T3827 punct ),]
R2770 T3829 T3824 cc and,bloodstream
R2771 T3830 T3831 amod higher,expression
R2772 T3831 T3821 pobj expression,to
R2773 T3832 T3831 prep of,expression
R2774 T3736 T3735 prep to,addition
R2775 T3833 T3835 amod embryonic,genes
R2776 T3834 T3835 compound globin,genes
R2777 T3835 T3832 pobj genes,of
R2778 T3836 T3811 punct .,include
R2779 T3737 T3736 pcomp playing,to
R2780 T3837 T3840 det The,effect
R2781 T3838 T3839 advmod most,extreme
R2782 T3738 T3740 det an,role
R2783 T3839 T3840 amod extreme,effect
R2784 T3840 T3841 nsubj effect,is
R2785 T3841 T3841 ROOT is,is
R2786 T3739 T3740 amod important,role
R2787 T3842 T3843 det the,persistence
R2788 T3843 T3841 attr persistence,is
R2789 T3844 T3843 prep of,persistence
R2790 T3740 T3737 dobj role,playing
R2791 T3845 T3846 amod high,expression
R2792 T3846 T3844 pobj expression,of
R2793 T3847 T3846 prep of,expression
R2794 T3741 T3740 prep in,role
R2795 T3848 T3852 det the,gene
R2796 T3849 T3852 amod embryonic,gene
R2797 T3742 T3743 det the,development
R2798 T3850 T3852 compound ɛy,gene
R2799 T3851 T3852 compound globin,gene
R2800 T3852 T3847 pobj gene,of
R2801 T3743 T3741 pobj development,in
R2802 T3853 T3841 punct .,is
R2803 T3854 T3856 advmod Here,describe
R2804 T3855 T3856 nsubj we,describe
R2805 T3744 T3743 prep of,development
R2806 T3856 T3856 ROOT describe,describe
R2807 T3857 T3856 cc and,describe
R2808 T3745 T3748 det the,system
R2809 T3858 T3856 conj characterize,describe
R2810 T3859 T3860 det the,effects
R2811 T3860 T3858 dobj effects,characterize
R2812 T3746 T3748 amod central,system
R2813 T3861 T3860 prep of,effects
R2814 T3862 T3861 pobj Sox6,of
R2815 T3863 T3860 prep on,effects
R2816 T3747 T3748 amod nervous,system
R2817 T3864 T3867 det the,gene
R2818 T3865 T3867 amod ɛy,gene
R2819 T3866 T3867 compound globin,gene
R2820 T3867 T3863 pobj gene,on
R2821 T3868 T3856 punct .,describe
R2822 T3869 T3870 nsubj We,show
R2823 T3748 T3744 pobj system,of
R2824 T3870 T3870 ROOT show,show
R2825 T3871 T3882 mark that,represses
R2826 T3872 T3873 amod Sox6,binds
R2827 T3749 T3767 advcl [,shown
R2828 T3873 T3882 nsubj binds,represses
R2829 T3874 T3873 prep to,binds
R2830 T3875 T3877 det the,promoter
R2831 T3750 T3749 nummod 8,[
R2832 T3876 T3877 amod proximal,promoter
R2833 T3877 T3874 pobj promoter,to
R2834 T3878 T3877 prep of,promoter
R2835 T3751 T3752 nummod 11,]
R2836 T3879 T3880 amod ɛy,globin
R2837 T3880 T3878 pobj globin,of
R2838 T3881 T3877 cc and,promoter
R2839 T3752 T3749 appos ],[
R2840 T3882 T3870 ccomp represses,show
R2841 T3883 T3884 poss its,transcription
R2842 T3884 T3882 dobj transcription,represses
R2843 T3753 T3752 punct ",",]
R2844 T3885 T3870 punct .,show
R2845 T3886 T3896 prep In,expressed
R2846 T3754 T3757 compound cartilage,]
R2847 T3887 T3891 nmod wild-type,mice
R2848 T3888 T3889 punct (,WT
R2849 T3889 T3887 appos WT,wild-type
R2850 T3755 T3757 compound [,]
R2851 T3890 T3889 punct ),WT
R2852 T3891 T3886 pobj mice,In
R2853 T3892 T3896 punct ",",expressed
R2854 T3756 T3757 compound "6,12,13",]
R2855 T3893 T3896 nsubjpass Sox6,expressed
R2856 T3894 T3896 auxpass is,expressed
R2857 T3895 T3896 neg not,expressed
R2858 T3757 T3749 conj ],[
R2859 T3758 T3757 punct ",",]
R2860 T3896 T3896 ROOT expressed,expressed
R2861 T3759 T3757 cc and,]
R2862 T3897 T3896 prep in,expressed
R2863 T3898 T3901 compound yolk,islands
R2864 T3760 T3763 compound muscle,]
R2865 T3761 T3763 compound [,]
R2866 T3899 T3901 compound sac,islands
R2867 T3900 T3901 compound blood,islands
R2868 T3762 T3763 compound "14,15",]
R2869 T3901 T3897 pobj islands,in
R2870 T3902 T3896 punct ",",expressed
R2871 T3903 T3896 cc but,expressed
R2872 T3904 T3905 auxpass is,expressed
R2873 T3905 T3896 conj expressed,expressed
R2874 T3906 T3905 prep in,expressed
R2875 T3763 T3757 conj ],]
R2876 T3907 T3908 amod fetal,liver
R2877 T3908 T3906 pobj liver,in
R2878 T3764 T3767 punct ",",shown
R2879 T3909 T3905 punct ",",expressed
R2880 T3910 T3913 det the,pattern
R2881 T3765 T3767 nsubjpass it,shown
R2882 T3911 T3913 amod opposite,pattern
R2883 T3912 T3913 compound expression,pattern
R2884 T3913 T3905 conj pattern,expressed
R2885 T3766 T3767 auxpass was,shown
R2886 T3914 T3913 prep of,pattern
R2887 T3915 T3916 amod ɛy,globin
R2888 T3767 T3767 ROOT shown,shown
R2889 T3916 T3914 pobj globin,of
R2890 T3917 T3896 punct .,expressed
R2891 T3918 T3928 prep In,expressed
R2892 T3768 T3770 mark that,is
R2893 T3919 T3920 det the,absence
R2894 T3920 T3918 pobj absence,In
R2895 T3921 T3920 prep of,absence
R2896 T3769 T3770 nsubj Sox6,is
R2897 T3922 T3921 pobj Sox6,of
R2898 T3923 T3928 punct ",",expressed
R2899 T3924 T3925 amod ɛy,globin
R2900 T3770 T3767 ccomp is,shown
R2901 T3925 T3928 nsubjpass globin,expressed
R2902 T3926 T3928 auxpass is,expressed
R2903 T3771 T3770 acomp upregulated,is
R2904 T3927 T3928 advmod ectopically,expressed
R2905 T3928 T3928 ROOT expressed,expressed
R2906 T3929 T3928 prep in,expressed
R2907 T3772 T3771 prep in,upregulated
R2908 T3930 T3932 det the,liver
R2909 T3931 T3932 amod fetal,liver
R2910 T3932 T3929 pobj liver,in
R2911 T3773 T3776 amod long-term,cells
R2912 T3933 T3928 punct ",",expressed
R2913 T3934 T3928 advcl demonstrating,expressed
R2914 T3935 T3934 dobj that,demonstrating
R2915 T3774 T3776 compound hematopoiesis,cells
R2916 T3936 T3937 amod Sox6,functions
R2917 T3937 T3935 nsubj functions,that
R2918 T3775 T3776 compound stem,cells
R2919 T3938 T3937 prep in,functions
R2920 T3939 T3940 amod definitive,erythropoiesis
R2921 T3940 T3938 pobj erythropoiesis,in
R2922 T3941 T3928 punct .,expressed
R2923 T3776 T3772 pobj cells,in
R2924 T3777 T3778 punct (,LT-HSC
R2925 T3778 T3771 appos LT-HSC,upregulated
R2926 T3779 T3771 punct ),upregulated
R2927 T3780 T3771 prep compared,upregulated
R2928 T3781 T3780 prep with,compared
R2929 T3782 T3783 amod multipotent,progenitors
R2933 T3783 T3781 pobj progenitors,with
R2934 T3784 T3783 prep of,progenitors
R2938 T3785 T3788 compound adult,marrow
R2939 T3786 T3788 compound mouse,marrow
R2940 T3787 T3788 compound bone,marrow
R2941 T3788 T3789 compound marrow,lineage
R2943 T3789 T3784 pobj lineage,of
R2944 T3790 T3792 nmod [,]
R2945 T3791 T3792 nummod 28,]
R2946 T3792 T3783 appos ],progenitors
R2948 T3793 T3767 punct .,shown
R2952 T3794 T3799 prep In,describe
R2953 T3795 T3796 det this,study
R2954 T3796 T3794 pobj study,In
R2956 T3797 T3799 punct ",",describe
R2957 T3798 T3799 nsubj we,describe
R3495 T4964 T4965 amod Persistent,Expression
R3496 T4965 T4965 ROOT Expression,Expression
R3497 T4966 T4965 prep of,Expression
R3498 T4967 T4969 det the,Globin
R3499 T4968 T4969 compound Embryonic,Globin
R3500 T4969 T4966 pobj Globin,of
R3501 T4970 T4969 punct ",",Globin
R3502 T4971 T4965 intj ɛy,Expression
R3503 T4972 T4965 punct ",",Expression
R3504 T4973 T4965 prep in,Expression
R3505 T4974 T4975 amod Sox6-Deficient,Mice
R3506 T4975 T4973 pobj Mice,in
R3507 T4976 T4979 det The,gene
R3508 T4977 T4979 amod ɛy,gene
R3509 T4978 T4979 compound globin,gene
R3510 T4979 T4982 nsubjpass gene,identified
R3511 T4980 T4982 auxpass was,identified
R3512 T4981 T4982 advmod initially,identified
R3513 T4982 T4982 ROOT identified,identified
R3514 T4983 T4982 prep as,identified
R3515 T4984 T4986 det an,transcript
R3516 T4985 T4986 amod upregulated,transcript
R3517 T4986 T4983 pobj transcript,as
R3518 T4987 T4986 prep in,transcript
R3519 T4988 T4990 det the,mouse
R3520 T4989 T4990 amod p 100H,mouse
R3521 T4990 T4987 pobj mouse,in
R3522 T4991 T4986 acl using,transcript
R3523 T4992 T4993 amod subtractive,hybridization
R3524 T4993 T4991 dobj hybridization,using
R3525 T4994 T4995 aux to,identify
R3526 T4995 T4991 xcomp identify,using
R3527 T4996 T4998 amod Sox6,targets
R3528 T4997 T4998 amod downstream,targets
R3529 T4998 T4995 dobj targets,identify
R3530 T4999 T4982 punct .,identified
R3531 T5000 T5002 det This,observation
R3532 T5001 T5002 amod initial,observation
R3533 T5002 T5004 nsubjpass observation,confirmed
R3534 T5003 T5004 auxpass was,confirmed
R3535 T5004 T5004 ROOT confirmed,confirmed
R3536 T5005 T5004 prep in,confirmed
R3537 T5006 T5009 det an,allele
R3538 T5007 T5009 amod independent,allele
R3539 T5008 T5009 amod knock-out,allele
R3540 T5009 T5005 pobj allele,in
R3541 T5010 T5009 prep of,allele
R3542 T5011 T5012 compound Sox6,[
R3543 T5012 T5010 pobj [,of
R3544 T5013 T5014 nummod 13,]
R3545 T5014 T5009 appos ],allele
R3546 T5015 T5004 advcl using,confirmed
R3547 T5016 T5019 amod real-time,reaction
R3548 T5017 T5019 compound polymerase,reaction
R3549 T5018 T5019 compound chain,reaction
R3550 T5019 T5015 dobj reaction,using
R3551 T5020 T5019 punct (,reaction
R3552 T5021 T5019 appos PCR,reaction
R3553 T5022 T5019 punct ),reaction
R3554 T5023 T5019 punct (,reaction
R3555 T5024 T5025 amod unpublished,data
R3556 T5025 T5019 appos data,reaction
R3557 T5026 T5019 punct ),reaction
R3558 T5027 T5004 punct .,confirmed
R3559 T5028 T5029 compound Real-time,PCR
R3560 T5029 T5031 nsubjpass PCR,used
R3561 T5030 T5031 auxpass was,used
R3562 T5031 T5031 ROOT used,used
R3563 T5032 T5033 aux to,quantitate
R3564 T5033 T5031 xcomp quantitate,used
R3565 T5034 T5036 det the,levels
R3566 T5035 T5036 compound expression,levels
R3567 T5036 T5033 dobj levels,quantitate
R3568 T5037 T5036 prep of,levels
R3569 T5038 T5040 amod other,genes
R3570 T5039 T5040 compound globin,genes
R3571 T5040 T5037 pobj genes,of
R3572 T5041 T5040 prep in,genes
R3573 T5042 T5043 amod p100H,mutant
R3574 T5043 T5047 amod mutant,livers
R3575 T5044 T5043 cc and,mutant
R3576 T5045 T5047 compound WT,livers
R3577 T5046 T5047 compound mouse,livers
R3578 T5047 T5041 pobj livers,in
R3579 T5048 T5033 prep at,quantitate
R3580 T5049 T5051 nummod two,stages
R3581 T5050 T5051 amod developmental,stages
R3582 T5051 T5048 pobj stages,at
R3583 T5052 T5051 punct ",",stages
R3584 T5053 T5057 nummod 15.5,dpc
R3585 T5054 T5057 nmod dpc,dpc
R3586 T5055 T5054 cc and,dpc
R3587 T5056 T5057 nummod 18.5,dpc
R3588 T5057 T5051 appos dpc,stages
R3589 T5058 T5031 punct .,used
R3590 T5059 T5060 mark As,shown
R3591 T5060 T5069 advcl shown,expressed
R3592 T5061 T5060 prep in,shown
R3593 T5062 T5061 pobj Figure,in
R3594 T5063 T5062 nummod 1,Figure
R3595 T5064 T5069 punct ",",expressed
R3596 T5065 T5067 det the,gene
R3597 T5066 T5067 amod ɛy,gene
R3598 T5067 T5069 nsubjpass gene,expressed
R3599 T5068 T5069 auxpass is,expressed
R3600 T5069 T5069 ROOT expressed,expressed
R3601 T5070 T5069 prep at,expressed
R3602 T5071 T5072 amod high,levels
R3603 T5072 T5070 pobj levels,at
R3604 T5073 T5072 prep at,levels
R3605 T5074 T5075 det both,time
R3606 T5075 T5076 compound time,points
R3607 T5076 T5073 pobj points,at
R3608 T5077 T5072 prep in,levels
R3609 T5078 T5079 amod mutant,mice
R3610 T5079 T5077 pobj mice,in
R3611 T5080 T5069 punct ",",expressed
R3612 T5081 T5069 prep in,expressed
R3613 T5082 T5081 pobj contrast,in
R3614 T5083 T5082 prep to,contrast
R3615 T5084 T5085 det the,decline
R3616 T5085 T5083 pobj decline,to
R3617 T5086 T5085 prep in,decline
R3618 T5087 T5086 pobj expression,in
R3619 T5088 T5085 acl observed,decline
R3620 T5089 T5088 prep in,observed
R3621 T5090 T5091 compound WT,mice
R3622 T5091 T5089 pobj mice,in
R3623 T5092 T5069 punct .,expressed
R3624 T5093 T5094 det No,difference
R3625 T5094 T5096 nsubjpass difference,seen
R3626 T5095 T5096 auxpass was,seen
R3627 T5096 T5096 ROOT seen,seen
R3628 T5097 T5096 prep between,seen
R3629 T5098 T5101 nmod WT,mice
R3630 T5099 T5098 cc and,WT
R3631 T5100 T5098 conj heterozygous,WT
R3632 T5101 T5097 pobj mice,between
R3633 T5102 T5104 punct (,data
R3634 T5103 T5104 amod unpublished,data
R3635 T5104 T5101 appos data,mice
R3636 T5105 T5101 punct ),mice
R3637 T5106 T5096 punct .,seen
R3638 T5107 T5124 advmod Interestingly,are
R3639 T5108 T5124 punct ",",are
R3640 T5109 T5111 det the,levels
R3641 T5110 T5111 compound expression,levels
R3642 T5111 T5124 nsubj levels,are
R3643 T5112 T5111 prep of,levels
R3644 T5113 T5118 det the,genes
R3645 T5114 T5118 amod other,genes
R3646 T5115 T5118 nummod two,genes
R3647 T5116 T5118 amod embryonic,genes
R3648 T5117 T5118 compound globin,genes
R3649 T5118 T5112 pobj genes,of
R3650 T5119 T5118 punct (,genes
R3651 T5120 T5118 appos ζ,genes
R3652 T5121 T5120 cc and,ζ
R3653 T5122 T5120 conj βh1,ζ
R3654 T5123 T5118 punct ),genes
R3655 T5124 T5124 ROOT are,are
R3656 T5125 T5124 advmod also,are
R3657 T5126 T5124 acomp higher,are
R3658 T5127 T5126 prep in,higher
R3659 T5128 T5130 amod p100H,mice
R3660 T5129 T5130 amod homozygous,mice
R3661 T5130 T5127 pobj mice,in
R3662 T5131 T5124 punct ",",are
R3663 T5132 T5124 prep compared,are
R3664 T5133 T5132 prep with,compared
R3665 T5134 T5135 compound WT,mice
R3666 T5135 T5133 pobj mice,with
R3667 T5136 T5124 punct ",",are
R3668 T5137 T5124 cc but,are
R3669 T5138 T5144 prep to,seen
R3670 T5139 T5142 det a,extent
R3671 T5140 T5141 advmod much,lesser
R3672 T5141 T5142 amod lesser,extent
R3673 T5142 T5138 pobj extent,to
R3674 T5143 T5144 mark than,seen
R3675 T5144 T5124 conj seen,are
R3676 T5145 T5144 prep for,seen
R3677 T5146 T5147 amod ɛy,globin
R3678 T5147 T5145 pobj globin,for
R3679 T5148 T5144 prep at,seen
R3680 T5149 T5150 nummod 18.5,dpc
R3681 T5150 T5148 pobj dpc,at
R3682 T5151 T5152 punct (,Figure
R3683 T5152 T5144 conj Figure,seen
R3684 T5153 T5152 nummod 1,Figure
R3685 T5154 T5152 punct ),Figure
R3686 T5155 T5124 punct .,are
R3687 T5156 T5165 advmod Moreover,is
R3688 T5157 T5165 punct ",",is
R3689 T5158 T5160 det the,level
R3690 T5159 T5160 compound expression,level
R3691 T5160 T5165 nsubj level,is
R3692 T5161 T5160 prep of,level
R3693 T5162 T5164 amod adult,globin
R3694 T5163 T5164 compound β,globin
R3695 T5164 T5161 pobj globin,of
R3696 T5165 T5165 ROOT is,is
R3697 T5166 T5165 advmod also,is
R3698 T5167 T5168 advmod somewhat,higher
R3699 T5168 T5165 acomp higher,is
R3700 T5169 T5168 prep in,higher
R3701 T5170 T5172 amod p100H,mice
R3702 T5171 T5172 amod homozygous,mice
R3703 T5172 T5169 pobj mice,in
R3704 T5173 T5168 prep than,higher
R3705 T5174 T5173 prep in,than
R3706 T5175 T5176 compound WT,mice
R3707 T5176 T5174 pobj mice,in
R3708 T5177 T5165 prep at,is
R3709 T5178 T5179 nummod 18.5,dpc
R3710 T5179 T5177 pobj dpc,at
R3711 T5180 T5181 punct (,Figure
R3712 T5181 T5165 npadvmod Figure,is
R3713 T5182 T5181 nummod 1,Figure
R3714 T5183 T5181 punct ),Figure
R3715 T5184 T5165 punct .,is
R3716 T5185 T5186 amod Perinatal,lethality
R3717 T5186 T5200 nsubj lethality,precludes
R3718 T5187 T5186 prep of,lethality
R3719 T5188 T5189 amod mutant,mice
R3720 T5189 T5187 pobj mice,of
R3721 T5190 T5192 punct (,from
R3722 T5191 T5192 advmod presumably,from
R3723 T5192 T5186 prep from,lethality
R3724 T5193 T5195 det the,defect
R3725 T5194 T5195 compound heart,defect
R3726 T5195 T5192 pobj defect,from
R3727 T5196 T5200 nsubj [,precludes
R3728 T5197 T5198 nummod 14,]
R3729 T5198 T5196 appos ],[
R3730 T5199 T5196 punct ),[
R3731 T5200 T5200 ROOT precludes,precludes
R3732 T5201 T5200 dobj us,precludes
R3733 T5202 T5200 prep from,precludes
R3734 T5203 T5202 pcomp evaluating,from
R3735 T5204 T5206 amod postnatal,expression
R3736 T5205 T5206 compound globin,expression
R3737 T5206 T5203 dobj expression,evaluating
R3738 T5207 T5200 punct .,precludes
R3739 T5208 T5209 det The,graphs
R3740 T5209 T5213 nsubj graphs,illustrate
R3741 T5210 T5209 prep in,graphs
R3742 T5211 T5210 pobj Figure,in
R3743 T5212 T5211 nummod 1,Figure
R3744 T5213 T5213 ROOT illustrate,illustrate
R3745 T5214 T5215 amod real,time
R3746 T5215 T5217 compound time,results
R3747 T5216 T5217 compound PCR,results
R3748 T5217 T5213 dobj results,illustrate
R3749 T5218 T5220 nsubjpass that,performed
R3750 T5219 T5220 auxpass were,performed
R3751 T5220 T5217 relcl performed,results
R3752 T5221 T5220 prep in,performed
R3753 T5222 T5221 pobj triplicate,in
R3754 T5223 T5222 punct (,triplicate
R3755 T5224 T5225 amod standard,deviation
R3756 T5225 T5230 nsubjpass deviation,shown
R3757 T5226 T5225 prep of,deviation
R3758 T5227 T5228 det the,data
R3759 T5228 T5226 pobj data,of
R3760 T5229 T5230 auxpass is,shown
R3761 T5230 T5213 ccomp shown,illustrate
R3762 T5231 T5230 agent by,shown
R3763 T5232 T5233 compound error,bars
R3764 T5233 T5231 pobj bars,by
R3765 T5234 T5230 punct ),shown
R3766 T5235 T5213 punct .,illustrate
R3767 T5236 T5242 mark Because,performed
R3768 T5237 T5242 nsubjpass all,performed
R3769 T5238 T5237 prep of,all
R3770 T5239 T5240 det the,assays
R3771 T5240 T5238 pobj assays,of
R3772 T5241 T5242 auxpass were,performed
R3773 T5242 T5256 advcl performed,are
R3774 T5243 T5242 prep at,performed
R3775 T5244 T5246 det the,time
R3776 T5245 T5246 amod same,time
R3777 T5246 T5243 pobj time,at
R3778 T5247 T5242 prep with,performed
R3779 T5248 T5251 det the,control
R3780 T5249 T5251 amod same,control
R3781 T5250 T5251 amod internal,control
R3782 T5251 T5247 pobj control,with
R3783 T5252 T5256 punct ",",are
R3784 T5253 T5254 det the,levels
R3785 T5254 T5256 nsubj levels,are
R3786 T5255 T5254 acl shown,levels
R3787 T5256 T5256 ROOT are,are
R3788 T5257 T5258 amod relative,levels
R3789 T5258 T5256 attr levels,are
R3790 T5259 T5256 cc and,are
R3791 T5260 T5256 conj are,are
R3792 T5261 T5262 advmod thus,comparable
R3793 T5262 T5260 acomp comparable,are
R3794 T5263 T5260 prep across,are
R3795 T5264 T5265 det all,samples
R3796 T5265 T5263 pobj samples,across
R3797 T5266 T5260 cc and,are
R3798 T5267 T5260 conj are,are
R3799 T5268 T5267 prep in,are
R3800 T5269 T5268 pobj agreement,in
R3801 T5270 T5269 prep with,agreement
R3802 T5271 T5272 advmod previously,published
R3803 T5272 T5273 amod published,results
R3804 T5273 T5270 pobj results,with
R3805 T5274 T5273 prep for,results
R3806 T5275 T5277 nmod WT,mice
R3807 T5276 T5277 amod fetal,mice
R3808 T5277 T5274 pobj mice,for
R3809 T5278 T5280 nmod [,]
R3810 T5279 T5280 nummod 29,]
R3811 T5280 T5277 appos ],mice
R3812 T5281 T5256 punct .,are
R3813 T5282 T5283 nsubj We,note
R3814 T5283 T5283 ROOT note,note
R3815 T5284 T5302 mark that,is
R3816 T5285 T5286 det the,level
R3817 T5286 T5302 nsubj level,is
R3818 T5287 T5286 prep of,level
R3819 T5288 T5289 amod ɛy,expression
R3820 T5289 T5287 pobj expression,of
R3821 T5290 T5286 prep in,level
R3822 T5291 T5292 det the,livers
R3823 T5292 T5290 pobj livers,in
R3824 T5293 T5292 prep of,livers
R3825 T5294 T5301 nummod 15.5,mice
R3826 T5295 T5301 nmod dpc,mice
R3827 T5296 T5295 cc and,dpc
R3828 T5297 T5298 nummod 18.5,dpc
R3829 T5298 T5301 nmod dpc,mice
R3830 T5299 T5301 amod homozygous,mice
R3831 T5300 T5301 amod mutant,mice
R3832 T5301 T5293 pobj mice,of
R3833 T5302 T5283 ccomp is,note
R3834 T5303 T5304 advmod statistically,equivalent
R3835 T5304 T5302 acomp equivalent,is
R3836 T5305 T5304 prep to,equivalent
R3837 T5306 T5307 det the,level
R3838 T5307 T5305 pobj level,to
R3839 T5308 T5307 prep of,level
R3840 T5309 T5312 compound βmaj,expression
R3841 T5310 T5312 compound /,expression
R3842 T5311 T5312 compound min,expression
R3843 T5312 T5308 pobj expression,of
R3844 T5313 T5307 prep in,level
R3845 T5314 T5315 det the,livers
R3846 T5315 T5313 pobj livers,in
R3847 T5316 T5315 prep of,livers
R3848 T5317 T5324 nummod 15.5,mice
R3849 T5318 T5324 nmod dpc,mice
R3850 T5319 T5318 cc and,dpc
R3851 T5320 T5321 nummod 18.5,dpc
R3852 T5321 T5324 nmod dpc,mice
R3853 T5322 T5324 amod homozygous,mice
R3854 T5323 T5324 compound WT,mice
R3855 T5324 T5316 pobj mice,of
R3856 T5325 T5283 punct .,note
R4427 T6364 T6365 compound Studies,Using
R4428 T6365 T6365 ROOT Using,Using
R4429 T6366 T6368 compound GM979,Indicate
R4430 T6367 T6368 compound Cells,Indicate
R4431 T6368 T6365 dobj Indicate,Using
R4432 T6369 T6365 nsubj That,Using
R4433 T6370 T6372 nsubj Sox6,Represses
R4434 T6371 T6372 advmod Directly,Represses
R4435 T6372 T6369 nsubj Represses,That
R4436 T6373 T6374 det the,ɛy
R4437 T6374 T6376 compound ɛy,Promoter
R4438 T6375 T6376 compound Gene,Promoter
R4439 T6376 T6372 dobj Promoter,Represses
R4440 T6377 T6376 prep at,Promoter
R4441 T6378 T6383 det the,assays
R4442 T6379 T6380 compound Transcriptional,Level
R4443 T6380 T6383 nmod Level,assays
R4444 T6381 T6383 amod Real-time,assays
R4445 T6382 T6383 compound PCR,assays
R4446 T6383 T6377 pobj assays,at
R4447 T6384 T6383 punct (,assays
R4448 T6385 T6383 appos Figure,assays
R4449 T6386 T6385 nummod 1,Figure
R4450 T6387 T6385 punct ),Figure
R4451 T6388 T6397 nmod measure,activity
R4452 T6389 T6390 amod steady-state,levels
R4453 T6390 T6388 dobj levels,measure
R4454 T6391 T6390 prep of,levels
R4455 T6392 T6393 compound ɛy,mRNA
R4456 T6393 T6391 pobj mRNA,of
R4457 T6394 T6393 punct ",",mRNA
R4458 T6395 T6397 neg not,activity
R4459 T6396 T6397 amod transcriptional,activity
R4460 T6397 T6383 appos activity,assays
R4461 T6398 T6397 prep of,activity
R4462 T6399 T6401 det the,promoter
R4463 T6400 T6401 amod ɛy,promoter
R4464 T6401 T6398 pobj promoter,of
R4465 T6402 T6365 punct .,Using
R4466 T6403 T6404 aux To,investigate
R4467 T6404 T6420 advcl investigate,used
R4468 T6405 T6408 mark whether,acts
R4469 T6406 T6408 nsubj Sox6,acts
R4470 T6407 T6408 advmod directly,acts
R4471 T6408 T6404 ccomp acts,investigate
R4472 T6409 T6408 prep on,acts
R4473 T6410 T6413 det the,promoter
R4474 T6411 T6413 amod ɛy,promoter
R4475 T6412 T6413 compound gene,promoter
R4476 T6413 T6409 pobj promoter,on
R4477 T6414 T6413 prep at,promoter
R4478 T6415 T6417 det the,level
R4479 T6416 T6417 amod transcriptional,level
R4480 T6417 T6414 pobj level,at
R4481 T6418 T6420 punct ",",used
R4482 T6419 T6420 nsubj we,used
R4483 T6420 T6420 ROOT used,used
R4484 T6421 T6426 det an,assay
R4485 T6422 T6426 nmod in,assay
R4486 T6423 T6426 amod vitro,assay
R4487 T6424 T6426 nmod transient,assay
R4488 T6425 T6426 compound transfection,assay
R4489 T6426 T6420 dobj assay,used
R4490 T6427 T6426 cc and,assay
R4491 T6428 T6429 compound GM979,cells
R4492 T6429 T6426 conj cells,assay
R4493 T6430 T6420 punct ",",used
R4494 T6431 T6435 det a,line
R4495 T6432 T6435 amod murine,line
R4496 T6433 T6435 amod erythroleukemic,line
R4497 T6434 T6435 compound cell,line
R4498 T6435 T6420 dobj line,used
R4499 T6436 T6437 nsubj that,expresses
R4500 T6437 T6435 relcl expresses,line
R4501 T6438 T6439 det both,ɛy
R4502 T6439 T6437 dobj ɛy,expresses
R4503 T6440 T6439 cc and,ɛy
R4504 T6441 T6443 amod adult,globins
R4505 T6442 T6443 compound beta,globins
R4506 T6443 T6446 dep globins,]
R4507 T6444 T6446 nmod [,]
R4508 T6445 T6446 nummod 30,]
R4509 T6446 T6439 conj ],ɛy
R4510 T6447 T6420 punct .,used
R4511 T6448 T6449 nsubj We,generated
R4512 T6449 T6449 ROOT generated,generated
R4513 T6450 T6453 det an,reporter
R4514 T6451 T6453 amod ɛy,reporter
R4515 T6452 T6453 compound promoter,reporter
R4516 T6453 T6454 nsubj reporter,construct
R4517 T6454 T6449 ccomp construct,generated
R4518 T6455 T6456 punct (,E-Luc
R4519 T6456 T6454 dep E-Luc,construct
R4520 T6457 T6456 punct ),E-Luc
R4521 T6458 T6454 prep by,construct
R4522 T6459 T6458 pcomp fusing,by
R4523 T6460 T6461 det a,micro-LCR
R4524 T6461 T6459 dobj micro-LCR,fusing
R4525 T6462 T6463 punct (,μLCR
R4526 T6463 T6461 appos μLCR,micro-LCR
R4527 T6464 T6463 punct ),μLCR
R4528 T6465 T6461 conj element,micro-LCR
R4529 T6466 T6465 punct (,element
R4530 T6467 T6468 nummod 2.5,kb
R4531 T6468 T6465 appos kb,element
R4532 T6469 T6465 punct ),element
R4533 T6470 T6472 nmod [,]
R4534 T6471 T6472 nummod 31,]
R4535 T6472 T6461 appos ],micro-LCR
R4536 T6473 T6459 prep to,fusing
R4537 T6474 T6477 det the,promoter
R4538 T6475 T6477 amod ɛy,promoter
R4539 T6476 T6477 amod proximal,promoter
R4540 T6477 T6473 pobj promoter,to
R4541 T6478 T6477 punct (,promoter
R4542 T6479 T6480 nummod 2.2,kb
R4543 T6480 T6477 appos kb,promoter
R4544 T6481 T6477 punct ),promoter
R4545 T6482 T6459 punct ",",fusing
R4546 T6483 T6454 advcl followed,construct
R4547 T6484 T6483 agent by,followed
R4548 T6485 T6488 det the,gene
R4549 T6486 T6488 compound luciferase,gene
R4550 T6487 T6488 compound reporter,gene
R4551 T6488 T6484 pobj gene,by
R4552 T6489 T6483 punct ",",followed
R4553 T6490 T6491 mark as,shown
R4554 T6491 T6454 advcl shown,construct
R4555 T6492 T6491 prep in,shown
R4556 T6493 T6492 pobj Figure,in
R4557 T6494 T6493 nummod 2A,Figure
R4558 T6495 T6496 punct (,detailed
R4559 T6496 T6454 advcl detailed,construct
R4560 T6497 T6496 prep in,detailed
R4561 T6498 T6497 pobj Materials,in
R4562 T6499 T6498 cc and,Materials
R4563 T6500 T6498 conj Methods,Materials
R4564 T6501 T6496 punct ),detailed
R4565 T6502 T6449 punct .,generated
R4566 T6503 T6512 nsubj Overexpression,leads
R4567 T6504 T6503 prep of,Overexpression
R4568 T6505 T6504 pobj Sox6,of
R4569 T6506 T6503 prep in,Overexpression
R4570 T6507 T6508 compound GM979,cells
R4571 T6508 T6506 pobj cells,in
R4572 T6509 T6503 agent by,Overexpression
R4573 T6510 T6511 amod transient,transfection
R4574 T6511 T6509 pobj transfection,by
R4575 T6512 T6512 ROOT leads,leads
R4576 T6513 T6512 prep to,leads
R4577 T6514 T6516 det a,repression
R4578 T6515 T6516 amod dosage-dependent,repression
R4579 T6516 T6513 pobj repression,to
R4580 T6517 T6516 prep of,repression
R4581 T6518 T6520 amod E-Luc,activity
R4582 T6519 T6520 compound reporter,activity
R4583 T6520 T6517 pobj activity,of
R4584 T6521 T6523 punct (,2B
R4585 T6522 T6523 compound Figure,2B
R4586 T6523 T6520 appos 2B,activity
R4587 T6524 T6520 punct ),activity
R4588 T6525 T6512 punct .,leads
R4589 T6526 T6551 prep In,fails
R4590 T6527 T6526 pobj contrast,In
R4591 T6528 T6551 punct ",",fails
R4592 T6529 T6551 nsubj overexpression,fails
R4593 T6530 T6529 prep of,overexpression
R4594 T6531 T6534 det a,protein
R4595 T6532 T6534 amod truncated,protein
R4596 T6533 T6534 compound Sox6,protein
R4597 T6534 T6530 pobj protein,of
R4598 T6535 T6536 nsubj that,lacks
R4599 T6536 T6534 relcl lacks,protein
R4600 T6537 T6539 poss its,domain
R4601 T6538 T6539 compound HMG,domain
R4602 T6539 T6536 dobj domain,lacks
R4603 T6540 T6542 nmod [,]
R4604 T6541 T6542 nummod 32,]
R4605 T6542 T6539 appos ],domain
R4606 T6543 T6542 punct (,]
R4607 T6544 T6542 amod similar,]
R4608 T6545 T6544 prep to,similar
R4609 T6546 T6549 det the,allele
R4610 T6547 T6549 amod p 100H,allele
R4611 T6548 T6549 compound mouse,allele
R4612 T6549 T6545 pobj allele,to
R4613 T6550 T6542 punct ),]
R4614 T6551 T6551 ROOT fails,fails
R4615 T6552 T6553 aux to,repress
R4616 T6553 T6551 xcomp repress,fails
R4617 T6554 T6555 amod E-Luc,activity
R4618 T6555 T6553 dobj activity,repress
R4619 T6556 T6558 punct (,2B
R4620 T6557 T6558 compound Figure,2B
R4621 T6558 T6555 appos 2B,activity
R4622 T6559 T6558 punct ),2B
R4623 T6560 T6551 punct .,fails
R4624 T6561 T6562 det These,data
R4625 T6562 T6563 nsubj data,indicate
R4626 T6563 T6563 ROOT indicate,indicate
R4627 T6564 T6568 mark that,repress
R4628 T6565 T6566 amod Sox6,acts
R4629 T6566 T6568 nsubj acts,repress
R4630 T6567 T6568 aux to,repress
R4631 T6568 T6563 ccomp repress,indicate
R4632 T6569 T6571 det the,promoter
R4633 T6570 T6571 amod ɛy,promoter
R4634 T6571 T6568 dobj promoter,repress
R4635 T6572 T6571 prep at,promoter
R4636 T6573 T6575 det the,level
R4637 T6574 T6575 amod transcriptional,level
R4638 T6575 T6572 pobj level,at
R4639 T6576 T6563 punct .,indicate
R4640 T6577 T6580 nsubjpass Sox6,shown
R4641 T6578 T6580 aux has,shown
R4642 T6579 T6580 auxpass been,shown
R4643 T6580 T6580 ROOT shown,shown
R4644 T6581 T6582 aux to,act
R4645 T6582 T6580 xcomp act,shown
R4646 T6583 T6582 prep as,act
R4647 T6584 T6585 det a,repressor
R4648 T6585 T6583 pobj repressor,as
R4649 T6586 T6582 cc and,act
R4650 T6587 T6588 aux to,interact
R4651 T6588 T6582 conj interact,act
R4652 T6589 T6588 prep with,interact
R4653 T6590 T6593 det a,co-repressor
R4654 T6591 T6592 advmod widely,expressed
R4655 T6592 T6593 amod expressed,co-repressor
R4656 T6593 T6589 pobj co-repressor,with
R4657 T6594 T6593 punct ",",co-repressor
R4658 T6595 T6593 appos CtBP2,co-repressor
R4659 T6596 T6588 punct ",",interact
R4660 T6597 T6588 prep on,interact
R4661 T6598 T6600 det the,promoter
R4662 T6599 T6600 amod fgf-3,promoter
R4663 T6600 T6597 pobj promoter,on
R4664 T6601 T6603 nmod [,]
R4665 T6602 T6601 nummod 5,[
R4666 T6603 T6600 appos ],promoter
R4667 T6604 T6580 punct .,shown
R4668 T6605 T6607 nsubjpass CtBP2,expressed
R4669 T6606 T6607 auxpass is,expressed
R4670 T6607 T6607 ROOT expressed,expressed
R4671 T6608 T6607 prep in,expressed
R4672 T6609 T6610 compound GM979,cells
R4673 T6610 T6608 pobj cells,in
R4674 T6611 T6613 punct (,data
R4675 T6612 T6613 amod unpublished,data
R4676 T6613 T6610 appos data,cells
R4677 T6614 T6607 punct ),expressed
R4678 T6615 T6607 punct .,expressed
R4679 T6616 T6617 aux To,investigate
R4680 T6617 T6634 advcl investigate,introduced
R4681 T6618 T6624 mark whether,required
R4682 T6619 T6620 det the,interaction
R4683 T6620 T6624 nsubjpass interaction,required
R4684 T6621 T6620 prep with,interaction
R4685 T6622 T6621 pobj CtBP2,with
R4686 T6623 T6624 auxpass is,required
R4687 T6624 T6617 ccomp required,investigate
R4688 T6625 T6624 prep for,required
R4689 T6626 T6627 amod Sox6,repression
R4690 T6627 T6625 pobj repression,for
R4691 T6628 T6627 prep of,repression
R4692 T6629 T6631 det the,promoter
R4693 T6630 T6631 amod ɛy,promoter
R4694 T6631 T6628 pobj promoter,of
R4695 T6632 T6634 punct ",",introduced
R4696 T6633 T6634 nsubj we,introduced
R4697 T6634 T6634 ROOT introduced,introduced
R4698 T6635 T6637 det a,mutation
R4699 T6636 T6637 compound point,mutation
R4700 T6637 T6634 dobj mutation,introduced
R4701 T6638 T6637 punct (,mutation
R4702 T6639 T6637 appos L386H,mutation
R4703 T6640 T6637 punct ),mutation
R4704 T6641 T6634 prep in,introduced
R4705 T6642 T6644 det the,protein
R4706 T6643 T6644 amod Sox6,protein
R4707 T6644 T6641 pobj protein,in
R4708 T6645 T6649 nsubjpass that,reported
R4709 T6646 T6649 aux has,reported
R4710 T6647 T6649 auxpass been,reported
R4711 T6648 T6649 advmod previously,reported
R4712 T6649 T6644 relcl reported,protein
R4713 T6650 T6651 aux to,be
R4714 T6651 T6649 xcomp be,reported
R4715 T6652 T6651 acomp sufficient,be
R4716 T6653 T6654 aux to,abolish
R4717 T6654 T6652 xcomp abolish,sufficient
R4718 T6655 T6656 amod Sox6-CtBP2,interaction
R4719 T6656 T6654 dobj interaction,abolish
R4720 T6657 T6659 nmod [,]
R4721 T6658 T6657 nummod 5,[
R4722 T6659 T6644 appos ],protein
R4723 T6660 T6634 punct .,introduced
R4724 T6661 T6664 det This,change
R4725 T6662 T6664 amod amino,change
R4726 T6663 T6664 compound acid,change
R4727 T6664 T6665 nsubj change,is
R4728 T6665 T6665 ROOT is,is
R4729 T6666 T6665 neg not,is
R4730 T6667 T6665 prep in,is
R4731 T6668 T6672 det the,domain
R4732 T6669 T6670 compound HMG,DNA
R4733 T6670 T6672 compound DNA,domain
R4734 T6671 T6672 amod binding,domain
R4735 T6672 T6667 pobj domain,in
R4736 T6673 T6665 punct .,is
R4737 T6674 T6681 advmod However,retains
R4738 T6675 T6681 punct ",",retains
R4739 T6676 T6678 det this,version
R4740 T6677 T6678 amod mutant,version
R4741 T6678 T6681 nsubj version,retains
R4742 T6679 T6678 prep of,version
R4743 T6680 T6679 pobj Sox6,of
R4744 T6681 T6681 ROOT retains,retains
R4745 T6682 T6683 det the,ability
R4746 T6683 T6681 dobj ability,retains
R4747 T6684 T6685 aux to,repress
R4748 T6685 T6683 acl repress,ability
R4749 T6686 T6688 det the,promoter
R4750 T6687 T6688 amod ɛy,promoter
R4751 T6688 T6685 dobj promoter,repress
R4752 T6689 T6688 prep in,promoter
R4753 T6690 T6692 det the,assay
R4754 T6691 T6692 compound transfection,assay
R4755 T6692 T6689 pobj assay,in
R4756 T6693 T6695 punct (,2B
R4757 T6694 T6695 compound Figure,2B
R4758 T6695 T6692 appos 2B,assay
R4759 T6696 T6692 punct ),assay
R4760 T6697 T6681 punct ",",retains
R4761 T6698 T6681 advcl indicating,retains
R4762 T6699 T6701 mark that,represses
R4763 T6700 T6701 nsubj Sox6,represses
R4764 T6701 T6698 ccomp represses,indicating
R4765 T6702 T6704 det the,promoter
R4766 T6703 T6704 amod ɛy,promoter
R4767 T6704 T6701 dobj promoter,represses
R4768 T6705 T6704 prep in,promoter
R4769 T6706 T6708 det a,manner
R4770 T6707 T6708 amod CtBP2-independent,manner
R4771 T6708 T6705 pobj manner,in
R4772 T6709 T6681 punct .,retains
R4773 T6710 T6711 compound Deletion,analysis
R4774 T6711 T6723 nsubj analysis,defined
R4775 T6712 T6711 prep of,analysis
R4776 T6713 T6715 det the,promoter
R4777 T6714 T6715 amod ɛy,promoter
R4778 T6715 T6712 pobj promoter,of
R4779 T6716 T6711 punct ",",analysis
R4780 T6717 T6718 mark as,shown
R4781 T6718 T6711 advcl shown,analysis
R4782 T6719 T6718 prep in,shown
R4783 T6720 T6719 pobj Figure,in
R4784 T6721 T6720 nummod 2C,Figure
R4785 T6722 T6723 punct ",",defined
R4786 T6723 T6723 ROOT defined,defined
R4787 T6724 T6725 det a,region
R4788 T6725 T6723 dobj region,defined
R4789 T6726 T6727 punct (,−
R4790 T6727 T6728 amod −,63
R4791 T6728 T6723 npadvmod 63,defined
R4792 T6729 T6728 prep to,63
R4793 T6730 T6729 pobj −,to
R4794 T6731 T6730 appos 37,−
R4795 T6732 T6730 punct ),−
R4796 T6733 T6729 prep within,to
R4797 T6734 T6737 det the,promoter
R4798 T6735 T6737 amod ɛy,promoter
R4799 T6736 T6737 amod proximal,promoter
R4800 T6737 T6733 pobj promoter,within
R4801 T6738 T6739 nsubj that,is
R4802 T6739 T6737 relcl is,promoter
R4803 T6740 T6739 acomp critical,is
R4804 T6741 T6740 prep for,critical
R4805 T6742 T6743 amod Sox6,repression
R4806 T6743 T6741 pobj repression,for
R4807 T6744 T6723 punct .,defined
R4808 T6745 T6750 nsubj Analysis,reveals
R4809 T6746 T6745 prep of,Analysis
R4810 T6747 T6749 det this,region
R4811 T6748 T6749 amod short,region
R4812 T6749 T6746 pobj region,of
R4813 T6750 T6750 ROOT reveals,reveals
R4814 T6751 T6755 nummod two,sites
R4815 T6752 T6755 amod Sox/Sox6,sites
R4816 T6753 T6755 nmod consensus,sites
R4817 T6754 T6755 amod binding,sites
R4818 T6755 T6750 dobj sites,reveals
R4819 T6756 T6758 nmod [,]
R4820 T6757 T6758 nummod 5,]
R4821 T6758 T6761 compound ],3A
R4822 T6759 T6760 punct (,Figure
R4823 T6760 T6761 compound Figure,3A
R4824 T6761 T6750 oprd 3A,reveals
R4825 T6762 T6750 punct ),reveals
R4826 T6763 T6750 punct .,reveals
R5604 T8230 T8230 ROOT corresponds,corresponds
R5605 T8231 T8230 prep to,corresponds
R5606 T8232 T8234 det the,region
R5607 T8233 T8234 amod critical,region
R5608 T8234 T8231 pobj region,to
R5609 T8140 T8155 nsubj EMSA,repress
R5610 T8141 T8140 cc and,EMSA
R5611 T8142 T8144 compound ChIP,Show
R5612 T8235 T8234 prep of,region
R5613 T8143 T8144 compound Assays,Show
R5614 T8144 T8140 conj Show,EMSA
R5615 T8145 T8148 mark that,Binds
R5616 T8236 T8238 det the,promoter
R5617 T8146 T8148 nsubj Sox6,Binds
R5618 T8147 T8148 advmod Directly,Binds
R5619 T8148 T8155 advcl Binds,repress
R5620 T8149 T8148 prep to,Binds
R5621 T8237 T8238 amod ɛy,promoter
R5622 T8150 T8151 det the,ɛy
R5623 T8151 T8155 nsubj ɛy,repress
R5624 T8152 T8153 compound Promoter,Sox6
R5625 T8153 T8151 appos Sox6,ɛy
R5626 T8238 T8235 pobj promoter,of
R5627 T8154 T8155 aux might,repress
R5628 T8155 T8155 ROOT repress,repress
R5629 T8239 T8238 acl defined,promoter
R5630 T8156 T8158 det the,promoter
R5631 T8157 T8158 amod ɛy,promoter
R5632 T8158 T8155 dobj promoter,repress
R5633 T8240 T8239 prep in,defined
R5634 T8159 T8155 punct ",",repress
R5635 T8160 T8161 preconj either,through
R5636 T8161 T8155 prep through,repress
R5637 T8162 T8164 amod direct,contact
R5638 T8241 T8244 poss our,analyses
R5639 T8163 T8164 amod physical,contact
R5640 T8164 T8161 pobj contact,through
R5641 T8165 T8164 prep with,contact
R5642 T8242 T8243 compound promoter,deletion
R5643 T8166 T8167 det the,promoter
R5644 T8167 T8165 pobj promoter,with
R5645 T8168 T8165 cc or,with
R5646 T8243 T8244 compound deletion,analyses
R5647 T8169 T8155 prep by,repress
R5648 T8170 T8169 pcomp regulating,by
R5649 T8171 T8170 dobj intermediates,regulating
R5650 T8244 T8240 pobj analyses,in
R5651 T8172 T8171 acl affecting,intermediates
R5652 T8173 T8175 det the,promoter
R5653 T8245 T8230 punct .,corresponds
R5654 T8174 T8175 amod ɛy,promoter
R5655 T8175 T8172 dobj promoter,affecting
R5656 T8176 T8155 punct .,repress
R5657 T8177 T8178 aux To,investigate
R5658 T8178 T8191 advcl investigate,performed
R5659 T8179 T8183 mark whether,associated
R5660 T8180 T8183 nsubjpass Sox6,associated
R5661 T8181 T8183 auxpass is,associated
R5662 T8246 T8247 det This,probe
R5663 T8182 T8183 advmod directly,associated
R5664 T8183 T8178 ccomp associated,investigate
R5665 T8184 T8183 prep with,associated
R5666 T8185 T8187 det the,promoter
R5667 T8247 T8248 nsubj probe,contains
R5668 T8186 T8187 amod ɛy,promoter
R5669 T8187 T8184 pobj promoter,with
R5670 T8188 T8191 punct ",",performed
R5671 T8189 T8191 nsubj we,performed
R5672 T8248 T8248 ROOT contains,contains
R5673 T8190 T8191 advmod first,performed
R5674 T8191 T8191 ROOT performed,performed
R5675 T8192 T8194 amod electrophoretic,shift
R5676 T8193 T8194 compound mobility,shift
R5677 T8194 T8195 compound shift,assays
R5678 T8195 T8191 dobj assays,performed
R5679 T8249 T8253 nummod two,sites
R5680 T8196 T8195 punct (,assays
R5681 T8197 T8195 appos EMSA,assays
R5682 T8198 T8195 punct ),assays
R5683 T8199 T8191 advcl using,performed
R5684 T8200 T8202 det a,Sox6
R5685 T8250 T8253 compound consensus,sites
R5686 T8201 T8202 amod c-Myc-tagged,Sox6
R5687 T8251 T8253 nmod Sox/Sox6,sites
R5688 T8202 T8199 dobj Sox6,using
R5689 T8203 T8199 prep in,using
R5690 T8204 T8207 det a,transcription/translation
R5691 T8252 T8253 amod binding,sites
R5692 T8205 T8207 nmod reticulocyte,transcription/translation
R5693 T8206 T8207 amod lysate-based,transcription/translation
R5694 T8207 T8203 pobj transcription/translation,in
R5695 T8253 T8248 dobj sites,contains
R5696 T8208 T8207 prep in,transcription/translation
R5697 T8209 T8210 amod vitro,system
R5698 T8254 T8248 punct .,contains
R5699 T8210 T8208 pobj system,in
R5700 T8211 T8191 punct .,performed
R5701 T8255 T8256 advmod Also,included
R5702 T8212 T8213 det The,probes
R5703 T8213 T8216 nsubjpass probes,listed
R5704 T8214 T8213 acl used,probes
R5705 T8215 T8216 auxpass are,listed
R5706 T8216 T8216 ROOT listed,listed
R5707 T8217 T8216 prep in,listed
R5708 T8256 T8256 ROOT included,included
R5709 T8218 T8219 compound Figure,3A
R5710 T8219 T8217 pobj 3A,in
R5711 T8220 T8216 punct .,listed
R5712 T8257 T8256 prep in,included
R5713 T8221 T8224 det The,pair
R5714 T8222 T8223 nummod 36,base
R5715 T8223 T8224 compound base,pair
R5716 T8258 T8259 poss our,EMSA
R5717 T8224 T8224 ROOT pair,pair
R5718 T8225 T8224 punct (,pair
R5719 T8226 T8224 appos bp,pair
R5720 T8259 T8257 pobj EMSA,in
R5721 T8227 T8224 punct ),pair
R5722 T8228 T8229 compound WT,probe
R5723 T8229 T8230 nsubj probe,corresponds
R5724 T8260 T8256 auxpass are,included
R5725 T8261 T8263 nummod three,probes
R5726 T8262 T8263 amod mutated,probes
R5727 T8263 T8256 nsubjpass probes,included
R5728 T8327 T8323 pobj protein,by
R5729 T8264 T8265 nsubj that,are
R5730 T8328 T8322 punct .,shifted
R5731 T8329 T8336 advmod Moreover,supershift
R5732 T8330 T8336 punct ",",supershift
R5733 T8265 T8263 relcl are,probes
R5734 T8331 T8332 preconj both,c-Myc
R5735 T8332 T8336 nsubj c-Myc,supershift
R5736 T8266 T8265 punct ",",are
R5737 T8333 T8332 cc and,c-Myc
R5738 T8334 T8332 conj Sox6,c-Myc
R5739 T8335 T8332 conj antibodies,c-Myc
R5740 T8267 T8268 preconj either,truncated
R5741 T8336 T8336 ROOT supershift,supershift
R5742 T8337 T8338 det the,band
R5743 T8268 T8265 acomp truncated,are
R5744 T8338 T8336 dobj band,supershift
R5745 T8339 T8336 punct ",",supershift
R5746 T8340 T8336 advcl indicating,supershift
R5747 T8269 T8268 punct (,truncated
R5748 T8341 T8344 mark that,is
R5749 T8342 T8343 det the,binding
R5750 T8343 T8344 nsubj binding,is
R5751 T8270 T8268 npadvmod M1,truncated
R5752 T8344 T8340 ccomp is,indicating
R5753 T8345 T8344 acomp Sox6-specific,is
R5754 T8346 T8336 punct .,supershift
R5755 T8347 T8348 aux To,rule
R5756 T8348 T8366 advcl rule,used
R5757 T8349 T8348 prt out,rule
R5758 T8271 T8268 punct ),truncated
R5759 T8350 T8351 det the,possibility
R5760 T8351 T8348 dobj possibility,rule
R5761 T8352 T8357 mark that,binds
R5762 T8272 T8265 punct ",",are
R5763 T8353 T8355 det the,tag
R5764 T8354 T8355 amod c-Myc,tag
R5765 T8355 T8357 nsubj tag,binds
R5766 T8273 T8265 cc or,are
R5767 T8356 T8355 appos itself,tag
R5768 T8357 T8351 acl binds,possibility
R5769 T8274 T8265 conj mutated,are
R5770 T8275 T8274 punct (,mutated
R5771 T8358 T8357 prep to,binds
R5772 T8276 T8274 dobj M2,mutated
R5773 T8359 T8360 det the,probe
R5774 T8360 T8358 pobj probe,to
R5775 T8361 T8366 punct ",",used
R5776 T8277 T8276 cc and,M2
R5777 T8362 T8364 det an,Sox6
R5778 T8363 T8364 amod HA-tagged,Sox6
R5779 T8364 T8366 nsubjpass Sox6,used
R5780 T8278 T8276 conj M3,M2
R5781 T8365 T8366 auxpass was,used
R5782 T8366 T8366 ROOT used,used
R5783 T8279 T8276 punct ),M2
R5784 T8367 T8366 prep in,used
R5785 T8368 T8369 det another,EMSA
R5786 T8369 T8367 pobj EMSA,in
R5787 T8280 T8274 prep in,mutated
R5788 T8370 T8371 nsubj that,confirmed
R5789 T8371 T8366 ccomp confirmed,used
R5790 T8372 T8373 det these,results
R5791 T8281 T8280 pobj Sox/Sox6,in
R5792 T8373 T8371 dobj results,confirmed
R5793 T8374 T8376 punct (,3C
R5794 T8375 T8376 compound Figure,3C
R5795 T8282 T8283 amod binding,sites
R5796 T8376 T8373 appos 3C,results
R5797 T8377 T8376 punct ),3C
R5798 T8378 T8366 punct .,used
R5799 T8283 T8280 pobj sites,in
R5800 T8379 T8382 advmod Next,extracts
R5801 T8380 T8382 punct ",",extracts
R5802 T8284 T8286 punct (,3A
R5803 T8381 T8382 amod nuclear,extracts
R5804 T8382 T8387 nsubjpass extracts,used
R5805 T8383 T8382 prep from,extracts
R5806 T8384 T8385 compound MEL,cells
R5807 T8385 T8383 pobj cells,from
R5808 T8386 T8387 auxpass were,used
R5809 T8387 T8387 ROOT used,used
R5810 T8285 T8286 compound Figure,3A
R5811 T8388 T8387 prep in,used
R5812 T8389 T8388 pobj EMSA,in
R5813 T8390 T8387 advcl employing,used
R5814 T8286 T8274 npadvmod 3A,mutated
R5815 T8391 T8394 det the,probe
R5816 T8392 T8394 amod same,probe
R5817 T8393 T8394 amod 36-bp,probe
R5818 T8287 T8263 punct ),probes
R5819 T8394 T8390 dobj probe,employing
R5820 T8395 T8387 punct .,used
R5821 T8396 T8397 compound MEL,cells
R5822 T8288 T8256 punct .,included
R5823 T8397 T8397 ROOT cells,cells
R5824 T8398 T8397 punct ",",cells
R5825 T8399 T8403 det a,line
R5826 T8289 T8290 nsubj Sox6,is
R5827 T8400 T8403 amod murine,line
R5828 T8401 T8402 compound erythroleukemic,cell
R5829 T8402 T8403 compound cell,line
R5830 T8290 T8290 ROOT is,is
R5831 T8403 T8397 appos line,cells
R5832 T8404 T8403 punct ",",line
R5833 T8405 T8408 amod express,globins
R5834 T8291 T8290 acomp able,is
R5835 T8406 T8408 compound adult,globins
R5836 T8407 T8408 compound β,globins
R5837 T8408 T8403 conj globins,line
R5838 T8292 T8294 aux to,associate
R5839 T8409 T8408 punct ",",globins
R5840 T8410 T8408 cc but,globins
R5841 T8411 T8412 neg not,ɛy
R5842 T8293 T8294 advmod physically,associate
R5843 T8412 T8408 conj ɛy,globins
R5844 T8413 T8415 nmod [,]
R5845 T8414 T8415 nummod 33,]
R5846 T8294 T8291 xcomp associate,able
R5847 T8415 T8415 ROOT ],]
R5848 T8416 T8415 punct .,]
R5849 T8417 T8419 amod Sox6,binds
R5850 T8295 T8294 prep with,associate
R5851 T8418 T8419 advmod directly,binds
R5852 T8419 T8419 ROOT binds,binds
R5853 T8420 T8419 prep to,binds
R5854 T8296 T8298 det the,region
R5855 T8421 T8423 det this,sequence
R5856 T8422 T8423 compound DNA,sequence
R5857 T8423 T8420 pobj sequence,to
R5858 T8297 T8298 amod 36-bp,region
R5859 T8298 T8295 pobj region,with
R5860 T8424 T8423 prep in,sequence
R5861 T8299 T8301 punct (,3B
R5862 T8300 T8301 compound Figure,3B
R5863 T8425 T8426 compound MEL,cells
R5864 T8301 T8298 appos 3B,region
R5865 T8426 T8424 pobj cells,in
R5866 T8302 T8298 punct ),region
R5867 T8427 T8428 punct (,Figure
R5868 T8428 T8426 appos Figure,cells
R5869 T8303 T8294 prep within,associate
R5870 T8429 T8428 nummod 3D,Figure
R5871 T8430 T8428 punct ),Figure
R5872 T8431 T8419 punct .,binds
R5873 T8304 T8306 det the,promoter
R5874 T8432 T8434 det The,consensus
R5875 T8433 T8434 amod intact,consensus
R5876 T8434 T8434 ROOT consensus,consensus
R5877 T8305 T8306 amod ɛy,promoter
R5878 T8435 T8434 appos Sox/Sox6,consensus
R5879 T8306 T8303 pobj promoter,within
R5880 T8436 T8437 amod binding,sites
R5881 T8307 T8306 acl defined,promoter
R5882 T8437 T8443 nsubjpass sites,required
R5883 T8438 T8437 prep of,sites
R5884 T8308 T8307 agent by,defined
R5885 T8439 T8441 det the,probe
R5886 T8440 T8441 compound DNA,probe
R5887 T8309 T8312 det the,experiments
R5888 T8441 T8438 pobj probe,of
R5889 T8442 T8443 auxpass are,required
R5890 T8443 T8434 relcl required,consensus
R5891 T8310 T8312 compound deletion,experiments
R5892 T8444 T8443 prep for,required
R5893 T8445 T8446 det the,binding
R5894 T8311 T8312 compound analysis,experiments
R5895 T8446 T8444 pobj binding,for
R5896 T8447 T8443 punct ",",required
R5897 T8312 T8308 pobj experiments,by
R5898 T8448 T8449 mark as,shown
R5899 T8449 T8443 advcl shown,required
R5900 T8450 T8449 prep in,shown
R5901 T8313 T8314 punct (,Figure
R5902 T8451 T8453 det the,assay
R5903 T8452 T8453 compound competition,assay
R5904 T8314 T8312 appos Figure,experiments
R5905 T8453 T8450 pobj assay,in
R5906 T8454 T8455 punct (,Figure
R5907 T8455 T8453 appos Figure,assay
R5908 T8456 T8455 nummod 3E,Figure
R5909 T8457 T8455 punct ),Figure
R5910 T8458 T8443 punct .,required
R5911 T8459 T8470 nsubj Ablation,abolish
R5912 T8315 T8314 nummod 2C,Figure
R5913 T8460 T8459 prep of,Ablation
R5914 T8461 T8464 amod putative,sites
R5915 T8462 T8464 nmod Sox/Sox6,sites
R5916 T8316 T8314 punct ),Figure
R5917 T8463 T8464 amod binding,sites
R5918 T8464 T8460 pobj sites,of
R5919 T8317 T8290 punct .,is
R5920 T8465 T8464 punct (,sites
R5921 T8466 T8464 appos M1,sites
R5922 T8467 T8466 cc and,M1
R5923 T8468 T8466 conj M3,M1
R5924 T8318 T8320 det The,probe
R5925 T8469 T8464 punct ),sites
R5926 T8470 T8470 ROOT abolish,abolish
R5927 T8319 T8320 compound 36-bp,probe
R5928 T8471 T8472 poss their,ability
R5929 T8472 T8470 dobj ability,abolish
R5930 T8473 T8474 aux to,compete
R5931 T8320 T8322 nsubjpass probe,shifted
R5932 T8474 T8472 acl compete,ability
R5933 T8475 T8474 prep in,compete
R5934 T8476 T8475 pobj EMSA,in
R5935 T8321 T8322 auxpass was,shifted
R5936 T8477 T8479 punct (,3E
R5937 T8478 T8479 compound Figure,3E
R5938 T8479 T8476 appos 3E,EMSA
R5939 T8322 T8322 ROOT shifted,shifted
R5940 T8480 T8479 punct ),3E
R5941 T8481 T8470 punct .,abolish
R5942 T8482 T8485 det The,probe
R5943 T8323 T8322 agent by,shifted
R5944 T8483 T8485 compound M2,probe
R5945 T8484 T8485 amod mutant,probe
R5946 T8485 T8487 nsubj probe,compete
R5947 T8324 T8327 det the,protein
R5948 T8486 T8487 aux may,compete
R5949 T8487 T8487 ROOT compete,compete
R5950 T8488 T8487 advmod partially,compete
R5951 T8325 T8327 amod tagged,protein
R5952 T8489 T8487 prep with,compete
R5953 T8490 T8489 pobj WT,with
R5954 T8491 T8487 advcl binding,compete
R5955 T8326 T8327 compound Sox6,protein
R5956 T8492 T8487 punct .,compete
R5957 T8493 T8494 aux To,investigate
R5958 T8494 T8516 advcl investigate,co-transfected
R5959 T8495 T8497 det the,significance
R5960 T8496 T8497 amod functional,significance
R5961 T8497 T8494 dobj significance,investigate
R5962 T8521 T8517 pobj vector,with
R5963 T8498 T8497 prep of,significance
R5964 T8499 T8503 det the,sites
R5965 T8500 T8503 amod intact,sites
R5966 T8522 T8521 prep into,vector
R5967 T8501 T8503 nmod Sox/Sox6,sites
R5968 T8502 T8503 amod binding,sites
R5969 T8503 T8498 pobj sites,of
R5970 T8523 T8524 compound GM979,cells
R5971 T8504 T8503 punct ",",sites
R5972 T8505 T8508 det the,reporter
R5973 T8506 T8508 amod ɛy,reporter
R5974 T8524 T8522 pobj cells,into
R5975 T8507 T8508 compound promoter,reporter
R5976 T8508 T8509 nsubj reporter,constructs
R5977 T8509 T8494 dobj constructs,investigate
R5978 T8525 T8516 punct .,co-transfected
R5979 T8510 T8509 prep with,constructs
R5980 T8511 T8512 compound mutagenized,Sox/Sox6
R5981 T8512 T8514 nmod Sox/Sox6,sites
R5982 T8526 T8537 advmod Consistent,constructs
R5983 T8513 T8514 amod binding,sites
R5984 T8514 T8510 pobj sites,with
R5985 T8527 T8526 prep with,Consistent
R5986 T8515 T8516 auxpass were,co-transfected
R5987 T8528 T8530 det the,results
R5988 T8516 T8516 ROOT co-transfected,co-transfected
R5989 T8517 T8516 prep with,co-transfected
R5990 T8529 T8530 compound EMSA,results
R5991 T8518 T8521 det the,vector
R5992 T8519 T8521 amod Sox6,vector
R5993 T8520 T8521 compound overexpression,vector
R5994 T8530 T8527 pobj results,with
R5995 T8531 T8537 punct ",",constructs
R5996 T8532 T8536 det the,reporter
R5997 T8533 T8536 amod mutant,reporter
R5998 T8534 T8536 compound ɛy,reporter
R5999 T8618 T8619 compound liver,cells
R6000 T8535 T8536 compound promoter,reporter
R6001 T8619 T8617 pobj cells,from
R6002 T8620 T8619 prep of,cells
R6003 T8536 T8537 nsubj reporter,constructs
R6004 T8621 T8624 nummod 15.5,mice
R6005 T8622 T8623 compound dpc,WT
R6006 T8537 T8551 nsubj constructs,result
R6007 T8623 T8624 compound WT,mice
R6008 T8624 T8620 pobj mice,of
R6009 T8625 T8612 advcl using,immunoprecipitated
R6010 T8626 T8627 amod Sox6,antibody
R6011 T8627 T8625 dobj antibody,using
R6012 T8628 T8612 punct .,immunoprecipitated
R6013 T8629 T8631 nsubj Figure,shows
R6014 T8538 T8539 punct (,with
R6015 T8630 T8629 nummod 4,Figure
R6016 T8631 T8631 ROOT shows,shows
R6017 T8539 T8537 prep with,constructs
R6018 T8632 T8639 mark that,immunoprecipitated
R6019 T8633 T8636 det the,promoter
R6020 T8540 T8541 det either,one
R6021 T8634 T8636 amod ɛy,promoter
R6022 T8635 T8636 amod proximal,promoter
R6023 T8541 T8539 pobj one,with
R6024 T8636 T8639 nsubjpass promoter,immunoprecipitated
R6025 T8637 T8639 auxpass is,immunoprecipitated
R6026 T8638 T8639 advmod readily,immunoprecipitated
R6027 T8542 T8541 cc or,one
R6028 T8639 T8631 ccomp immunoprecipitated,shows
R6029 T8640 T8639 prep with,immunoprecipitated
R6030 T8641 T8642 amod Sox6,antibody
R6031 T8543 T8546 det both,sites
R6032 T8642 T8640 pobj antibody,with
R6033 T8643 T8639 prep in,immunoprecipitated
R6034 T8644 T8646 det both,cells
R6035 T8544 T8546 amod Sox/Sox6,sites
R6036 T8645 T8646 compound MEL,cells
R6037 T8646 T8643 pobj cells,in
R6038 T8545 T8546 amod binding,sites
R6039 T8647 T8646 cc and,cells
R6040 T8648 T8649 compound liver,cells
R6041 T8649 T8646 conj cells,cells
R6042 T8650 T8631 punct .,shows
R6043 T8546 T8541 conj sites,one
R6044 T8651 T8652 compound Normal,IgG
R6045 T8652 T8654 nsubjpass IgG,used
R6046 T8547 T8541 amod mutagenized,one
R6047 T8653 T8654 auxpass was,used
R6048 T8654 T8654 ROOT used,used
R6049 T8655 T8654 prep as,used
R6050 T8548 T8539 punct ),with
R6051 T8656 T8658 det a,control
R6052 T8657 T8658 amod negative,control
R6053 T8658 T8655 pobj control,as
R6054 T8549 T8551 aux do,result
R6055 T8659 T8661 punct (,4A
R6056 T8660 T8661 compound Figure,4A
R6057 T8661 T8658 appos 4A,control
R6058 T8662 T8661 punct ),4A
R6059 T8663 T8654 punct .,used
R6060 T8664 T8666 det The,data
R6061 T8665 T8666 amod above,data
R6062 T8550 T8551 neg not,result
R6063 T8666 T8674 nsubj data,indicate
R6064 T8667 T8668 punct (,Figures
R6065 T8551 T8551 ROOT result,result
R6066 T8668 T8674 nsubj Figures,indicate
R6067 T8669 T8668 nummod 3,Figures
R6068 T8670 T8669 cc and,3
R6069 T8671 T8668 appos 4,Figures
R6070 T8552 T8551 prep in,result
R6071 T8553 T8555 amod significant,repression
R6072 T8672 T8668 punct ),Figures
R6073 T8673 T8674 advmod clearly,indicate
R6074 T8554 T8555 compound promoter,repression
R6075 T8674 T8674 ROOT indicate,indicate
R6076 T8675 T8687 mark that,binding
R6077 T8676 T8677 amod Sox6,acts
R6078 T8555 T8552 pobj repression,in
R6079 T8677 T8687 nsubj acts,binding
R6080 T8678 T8677 prep as,acts
R6081 T8556 T8555 prep in,repression
R6082 T8679 T8680 det a,repressor
R6083 T8680 T8678 pobj repressor,as
R6084 T8681 T8680 prep of,repressor
R6085 T8557 T8558 compound transfection,studies
R6086 T8682 T8684 det the,gene
R6087 T8683 T8684 compound ɛy,gene
R6088 T8684 T8681 pobj gene,of
R6089 T8558 T8556 pobj studies,in
R6090 T8685 T8677 prep by,acts
R6091 T8686 T8687 advmod directly,binding
R6092 T8687 T8674 ccomp binding,indicate
R6093 T8559 T8560 punct (,Figure
R6094 T8688 T8687 prep to,binding
R6095 T8689 T8691 det the,promoter
R6096 T8560 T8558 appos Figure,studies
R6097 T8690 T8691 amod ɛy,promoter
R6098 T8691 T8688 pobj promoter,to
R6099 T8692 T8674 punct ",",indicate
R6100 T8561 T8560 nummod 3F,Figure
R6101 T8693 T8694 advmod probably,as
R6102 T8694 T8674 prep as,indicate
R6103 T8695 T8696 det a,dimer
R6104 T8562 T8560 punct ),Figure
R6105 T8696 T8694 pobj dimer,as
R6106 T8697 T8674 punct .,indicate
R6107 T8563 T8551 punct .,result
R6108 T8564 T8569 advmod Thus,required
R6109 T8565 T8569 punct ",",required
R6110 T8566 T8567 det both,sites
R6111 T8567 T8569 nsubjpass sites,required
R6112 T8568 T8569 auxpass are,required
R6113 T8569 T8569 ROOT required,required
R6114 T8570 T8569 prep for,required
R6115 T8571 T8572 amod maximal,repression
R6116 T8572 T8570 pobj repression,for
R6119 T8573 T8572 prep of,repression
R6120 T8574 T8573 pobj ɛy,of
R6122 T8575 T8569 agent by,required
R6123 T8576 T8575 pobj Sox6,by
R6124 T8577 T8569 punct ",",required
R6126 T8578 T8569 cc but,required
R6127 T8579 T8580 neg not,to
R6129 T8580 T8569 xcomp to,required
R6131 T8581 T8583 det the,degree
R6133 T8582 T8583 amod same,degree
R6136 T8583 T8580 pobj degree,to
R6139 T8584 T8569 punct .,required
R6141 T8585 T8587 nsubj We,tested
R6142 T8586 T8587 advmod also,tested
R6143 T8587 T8587 ROOT tested,tested
R6145 T8588 T8590 nmod whether,binds
R6146 T8589 T8590 amod Sox6,binds
R6149 T8590 T8587 dobj binds,tested
R6151 T8591 T8590 prep to,binds
R6152 T8592 T8594 det the,promoter
R6153 T8593 T8594 amod ɛy,promoter
R6154 T8594 T8591 pobj promoter,to
R6157 T8595 T8594 prep in,promoter
R6159 T8596 T8595 pobj vivo,in
R6160 T8597 T8590 acl using,binds
R6161 T8598 T8599 compound chromatin,immunoprecipitation
R6162 T8599 T8597 dobj immunoprecipitation,using
R6163 T8600 T8599 punct (,immunoprecipitation
R6164 T8601 T8599 appos ChIP,immunoprecipitation
R6165 T8602 T8599 punct ),immunoprecipitation
R6166 T8603 T8604 punct (,Figure
R6167 T8604 T8590 appos Figure,binds
R6169 T8605 T8604 nummod 4,Figure
R6171 T8606 T8604 punct ),Figure
R6172 T8607 T8587 punct .,tested
R6174 T8608 T8610 det The,complex
R6175 T8609 T8610 amod Sox6-containing,complex
R6176 T8610 T8612 nsubjpass complex,immunoprecipitated
R6179 T8611 T8612 auxpass was,immunoprecipitated
R6180 T8612 T8612 ROOT immunoprecipitated,immunoprecipitated
R6182 T8613 T8612 prep from,immunoprecipitated
R6183 T8614 T8615 compound MEL,cells
R6184 T8615 T8613 pobj cells,from
R6185 T8616 T8613 cc or,from
R6189 T8617 T8613 conj from,from
R6518 T9421 T9423 det The,Expression
R6519 T9422 T9423 compound Persistent,Expression
R6520 T9423 T9423 ROOT Expression,Expression
R6521 T9424 T9423 prep of,Expression
R6522 T9425 T9426 compound ɛy,Globin
R6523 T9426 T9424 pobj Globin,of
R6524 T9427 T9423 prep in,Expression
R6525 T9428 T9427 pobj Sox6-Deficient,in
R6526 T9429 T9430 nsubj Mice,Is
R6527 T9430 T9430 ROOT Is,Is
R6528 T9431 T9430 acomp Due,Is
R6529 T9432 T9431 prep to,Due
R6530 T9433 T9434 det a,Defect
R6531 T9434 T9432 pobj Defect,to
R6532 T9435 T9434 prep in,Defect
R6533 T9436 T9437 det the,ɛy-Gene
R6534 T9437 T9435 pobj ɛy-Gene,in
R6535 T9438 T9431 xcomp Silencing,Due
R6536 T9439 T9438 dobj Mechanism,Silencing
R6537 T9440 T9438 prep in,Silencing
R6538 T9441 T9444 compound Definitive,Normally
R6539 T9442 T9444 compound Erythroid,Normally
R6540 T9443 T9444 compound Cells,Normally
R6541 T9444 T9440 pobj Normally,in
R6542 T9445 T9452 punct ",",expressed
R6543 T9446 T9449 det the,gene
R6544 T9447 T9449 amod ɛy,gene
R6545 T9448 T9449 compound globin,gene
R6546 T9449 T9452 nsubjpass gene,expressed
R6547 T9450 T9452 auxpass is,expressed
R6548 T9451 T9452 advmod exclusively,expressed
R6549 T9452 T9430 ccomp expressed,Is
R6550 T9453 T9452 prep in,expressed
R6551 T9454 T9455 amod primitive,erythrocytes
R6552 T9455 T9453 pobj erythrocytes,in
R6553 T9456 T9452 cc and,expressed
R6554 T9457 T9452 conj silenced,expressed
R6555 T9458 T9457 prep in,silenced
R6556 T9459 T9460 amod definitive,erythrocytes
R6557 T9460 T9458 pobj erythrocytes,in
R6558 T9461 T9452 punct .,expressed
R6559 T9462 T9463 aux To,determine
R6560 T9463 T9463 ROOT determine,determine
R6561 T9464 T9471 mark whether,is
R6562 T9465 T9467 det the,expression
R6563 T9466 T9467 amod persistent,expression
R6564 T9467 T9471 nsubj expression,is
R6565 T9468 T9467 prep of,expression
R6566 T9469 T9470 amod ɛy,globin
R6567 T9470 T9468 pobj globin,of
R6568 T9471 T9463 ccomp is,determine
R6569 T9472 T9471 acomp due,is
R6570 T9473 T9472 prep to,due
R6571 T9474 T9476 amod residual,erythrocytes
R6572 T9475 T9476 amod primitive,erythrocytes
R6573 T9476 T9473 pobj erythrocytes,to
R6574 T9477 T9471 cc or,is
R6575 T9478 T9471 conj is,is
R6576 T9479 T9478 acomp due,is
R6577 T9480 T9479 prep to,due
R6578 T9481 T9482 amod ectopic,expression
R6579 T9482 T9480 pobj expression,to
R6580 T9483 T9482 prep of,expression
R6581 T9484 T9485 amod ɛy,globin
R6582 T9485 T9483 pobj globin,of
R6583 T9486 T9479 prep in,due
R6584 T9487 T9488 amod definitive,erythrocytes
R6585 T9488 T9486 pobj erythrocytes,in
R6586 T9489 T9491 punct ",",examined
R6587 T9490 T9491 nsubj we,examined
R6588 T9491 T9478 ccomp examined,is
R6589 T9492 T9494 det the,pattern
R6590 T9493 T9494 amod spatial,pattern
R6591 T9494 T9491 dobj pattern,examined
R6592 T9495 T9494 prep of,pattern
R6593 T9496 T9498 amod ɛy,transcripts
R6594 T9497 T9498 compound globin,transcripts
R6595 T9498 T9495 pobj transcripts,of
R6596 T9499 T9491 prep in,examined
R6597 T9500 T9501 compound mouse,embryos
R6598 T9501 T9499 pobj embryos,in
R6599 T9502 T9491 prep by,examined
R6600 T9503 T9491 prep in,examined
R6601 T9504 T9505 compound situ,hybridization
R6602 T9505 T9503 pobj hybridization,in
R6603 T9506 T9507 punct (,Figure
R6604 T9507 T9491 parataxis Figure,examined
R6605 T9508 T9507 nummod 5,Figure
R6606 T9509 T9507 punct ),Figure
R6607 T9510 T9463 punct .,determine
R6608 T9511 T9512 mark As,expected
R6609 T9512 T9518 advcl expected,expressed
R6610 T9513 T9518 punct ",",expressed
R6611 T9514 T9515 amod ɛy,globin
R6612 T9515 T9518 nsubjpass globin,expressed
R6613 T9516 T9518 auxpass is,expressed
R6614 T9517 T9518 neg not,expressed
R6615 T9518 T9518 ROOT expressed,expressed
R6616 T9519 T9518 prep in,expressed
R6617 T9520 T9523 det the,liver
R6618 T9521 T9523 nmod WT,liver
R6619 T9522 T9523 amod 14.5-dpc,liver
R6620 T9523 T9519 pobj liver,in
R6621 T9524 T9523 punct ",",liver
R6622 T9525 T9526 det the,site
R6623 T9526 T9523 appos site,liver
R6624 T9527 T9526 prep of,site
R6625 T9528 T9529 amod definitive,erythropoiesis
R6626 T9529 T9527 pobj erythropoiesis,of
R6627 T9530 T9526 prep in,site
R6628 T9531 T9532 det the,fetus
R6629 T9532 T9530 pobj fetus,in
R6630 T9533 T9518 punct .,expressed
R6631 T9534 T9543 prep In,seen
R6632 T9535 T9534 pobj contrast,In
R6633 T9536 T9543 punct ",",seen
R6634 T9537 T9541 amod abundant,expression
R6635 T9538 T9539 amod ectopic,ɛy
R6636 T9539 T9541 compound ɛy,expression
R6637 T9540 T9541 compound mRNA,expression
R6638 T9541 T9543 nsubjpass expression,seen
R6639 T9542 T9543 auxpass is,seen
R6640 T9543 T9543 ROOT seen,seen
R6641 T9544 T9543 prep in,seen
R6642 T9545 T9546 det the,liver
R6643 T9546 T9544 pobj liver,in
R6644 T9547 T9546 prep of,liver
R6645 T9548 T9549 amod 14.5-dpc,mutants
R6646 T9549 T9547 pobj mutants,of
R6647 T9550 T9551 punct (,Figure
R6648 T9551 T9543 dobj Figure,seen
R6649 T9552 T9551 nummod 5,Figure
R6650 T9553 T9551 appos A,Figure
R6651 T9554 T9553 appos D,A
R6652 T9555 T9551 punct ),Figure
R6653 T9556 T9543 punct .,seen
R6654 T9557 T9566 advmod However,is
R6655 T9558 T9566 punct ",",is
R6657 T9560 T9566 nsubj expression,is
R6658 T9561 T9560 prep of,expression
R6659 T9562 T9565 compound βmaj,globin
R6660 T9563 T9565 compound /,globin
R6661 T9564 T9565 compound min,globin
R6662 T9565 T9561 pobj globin,of
R6663 T9566 T9566 ROOT is,is
R6664 T9567 T9568 advmod equally,abundant
R6665 T9568 T9566 acomp abundant,is
R6666 T9569 T9568 prep in,abundant
R6667 T9570 T9571 preconj both,WT
R6668 T9571 T9575 nmod WT,mice
R6669 T9572 T9571 cc and,WT
R6670 T9573 T9571 conj p100H,WT
R6671 T9574 T9575 amod mutant,mice
R6672 T9575 T9569 pobj mice,in
R6673 T9576 T9577 punct (,Figure
R6674 T9577 T9575 appos Figure,mice
R6675 T9578 T9577 nummod 5,Figure
R6676 T9579 T9577 appos E,Figure
R6677 T9580 T9579 cc and,E
R6678 T9581 T9579 conj F,E
R6679 T9582 T9581 punct ),F
R6680 T9583 T9566 punct .,is
R6681 T9584 T9585 det These,data
R6682 T9585 T9586 nsubj data,demonstrate
R6683 T9586 T9586 ROOT demonstrate,demonstrate
R6684 T9587 T9594 mark that,are
R6685 T9588 T9591 det the,levels
R6686 T9589 T9591 amod persistent,levels
R6687 T9590 T9591 amod high,levels
R6688 T9591 T9594 nsubj levels,are
R6689 T9592 T9591 prep of,levels
R6690 T9593 T9592 pobj ɛy,of
R6691 T9594 T9586 ccomp are,demonstrate
R6692 T9595 T9594 acomp due,are
R6693 T9596 T9597 aux to,ectopic
R6694 T9597 T9595 xcomp ectopic,due
R6695 T9598 T9597 dobj expression,ectopic
R6696 T9599 T9597 prep in,ectopic
R6697 T9600 T9603 det the,cells
R6698 T9601 T9603 amod definitive,cells
R6699 T9602 T9603 amod erythroid,cells
R6700 T9603 T9599 pobj cells,in
R6701 T9604 T9605 nsubj that,mature
R6702 T9605 T9603 relcl mature,cells
R6703 T9606 T9605 prep in,mature
R6704 T9607 T9609 det the,liver
R6705 T9608 T9609 amod fetal,liver
R6706 T9609 T9606 pobj liver,in
R6707 T9610 T9586 punct ",",demonstrate
R6708 T9611 T9586 advcl suggesting,demonstrate
R6709 T9612 T9614 mark that,is
R6710 T9613 T9614 expl there,is
R6711 T9614 T9611 ccomp is,suggesting
R6712 T9615 T9617 det an,defect
R6713 T9616 T9617 amod intrinsic,defect
R6714 T9617 T9614 attr defect,is
R6715 T9618 T9617 prep of,defect
R6716 T9619 T9620 det the,ɛy
R6717 T9620 T9618 pobj ɛy,of
R6718 T9621 T9617 acl silencing,defect
R6719 T9622 T9621 dobj mechanism,silencing
R6720 T9623 T9621 prep in,silencing
R6721 T9624 T9625 amod Sox6-null,mice
R6722 T9625 T9623 pobj mice,in
R6723 T9626 T9586 punct .,demonstrate
R6969 T10094 T10096 det The,Pattern
R6970 T10095 T10096 compound Expression,Pattern
R6971 T10096 T10099 nsubj Pattern,Suggests
R6972 T10097 T10096 prep of,Pattern
R6973 T10098 T10097 pobj Sox6,of
R6974 T10099 T10099 ROOT Suggests,Suggests
R6975 T10100 T10101 det a,Role
R6976 T10101 T10099 dobj Role,Suggests
R6977 T10102 T10101 prep in,Role
R6978 T10103 T10104 amod Definitive,Erythropoiesis
R6979 T10104 T10102 pobj Erythropoiesis,in
R6980 T10105 T10106 det The,observation
R6981 T10106 T10123 nsubj observation,suggests
R6982 T10107 T10111 mark that,express
R6983 T10108 T10109 amod Sox6-deficient,mice
R6984 T10109 T10111 nsubj mice,express
R6985 T10110 T10111 advmod ectopically,express
R6986 T10111 T10106 acl express,observation
R6987 T10112 T10113 amod ɛy,globin
R6988 T10113 T10111 dobj globin,express
R6989 T10114 T10113 prep in,globin
R6990 T10115 T10114 pobj liver,in
R6991 T10116 T10115 punct ",",liver
R6992 T10117 T10121 advmod where,mature
R6993 T10118 T10120 amod definitive,cells
R6994 T10119 T10120 amod erythroid,cells
R6995 T10120 T10121 nsubj cells,mature
R6996 T10121 T10115 relcl mature,liver
R6997 T10122 T10123 punct ",",suggests
R6998 T10123 T10123 ROOT suggests,suggests
R6999 T10124 T10126 mark that,is
R7000 T10125 T10126 nsubj Sox6,is
R7001 T10126 T10123 ccomp is,suggests
R7002 T10127 T10129 det an,regulator
R7003 T10128 T10129 amod important,regulator
R7004 T10129 T10126 attr regulator,is
R7005 T10130 T10129 prep in,regulator
R7006 T10131 T10132 amod definitive,erythropoiesis
R7007 T10132 T10130 pobj erythropoiesis,in
R7008 T10133 T10123 punct .,suggests
R7009 T10134 T10135 aux To,determine
R7010 T10135 T10153 advcl determine,employed
R7011 T10136 T10141 det the,pattern
R7012 T10137 T10141 amod temporal,pattern
R7013 T10138 T10137 cc and,temporal
R7014 T10139 T10137 conj spatial,temporal
R7015 T10140 T10141 compound expression,pattern
R7016 T10141 T10135 dobj pattern,determine
R7017 T10142 T10141 prep of,pattern
R7018 T10143 T10142 pobj Sox6,of
R7019 T10144 T10143 punct ",",Sox6
R7020 T10145 T10146 compound Northern,blot
R7021 T10146 T10141 conj blot,pattern
R7022 T10147 T10146 cc and,blot
R7023 T10148 T10146 conj in,blot
R7024 T10149 T10151 compound situ,assays
R7025 T10150 T10151 compound hybridization,assays
R7026 T10151 T10148 pobj assays,in
R7027 T10152 T10153 auxpass were,employed
R7028 T10153 T10153 ROOT employed,employed
R7029 T10154 T10153 punct .,employed
R7030 T10155 T10156 mark As,shown
R7031 T10156 T10162 advcl shown,is
R7032 T10157 T10156 prep in,shown
R7033 T10158 T10157 pobj Figure,in
R7034 T10159 T10158 nummod 6A,Figure
R7035 T10160 T10162 punct ",",is
R7036 T10161 T10162 nsubj Sox6,is
R7037 T10162 T10162 ROOT is,is
R7038 T10163 T10162 acomp detectable,is
R7039 T10164 T10163 prep by,detectable
R7040 T10165 T10166 compound Northern,blot
R7041 T10166 T10164 pobj blot,by
R7042 T10167 T10162 advcl beginning,is
R7043 T10168 T10167 prep at,beginning
R7044 T10169 T10170 nummod 10.5,dpc
R7045 T10170 T10168 pobj dpc,at
R7046 T10171 T10170 punct ",",dpc
R7047 T10172 T10170 amod coincident,dpc
R7048 T10173 T10172 prep with,coincident
R7049 T10174 T10176 det the,onset
R7050 T10175 T10176 amod temporal,onset
R7051 T10176 T10173 pobj onset,with
R7052 T10177 T10176 prep of,onset
R7053 T10178 T10179 amod definitive,erythropoiesis
R7054 T10179 T10177 pobj erythropoiesis,of
R7055 T10180 T10179 prep in,erythropoiesis
R7056 T10181 T10182 det the,liver
R7057 T10182 T10180 pobj liver,in
R7058 T10183 T10162 punct .,is
R7059 T10184 T10189 advmod Furthermore,shows
R7060 T10185 T10189 punct ",",shows
R7061 T10186 T10189 prep in,shows
R7062 T10187 T10188 compound situ,hybridization
R7063 T10188 T10189 compound hybridization,shows
R7064 T10189 T10189 ROOT shows,shows
R7065 T10190 T10194 mark that,transcribed
R7066 T10191 T10194 nsubjpass Sox6,transcribed
R7067 T10192 T10194 auxpass is,transcribed
R7068 T10193 T10194 advmod highly,transcribed
R7069 T10194 T10189 ccomp transcribed,shows
R7070 T10195 T10194 prep in,transcribed
R7071 T10196 T10197 amod 12.5-dpc,liver
R7072 T10197 T10195 pobj liver,in
R7073 T10198 T10194 punct ",",transcribed
R7074 T10199 T10194 cc but,transcribed
R7075 T10200 T10201 neg not,in
R7076 T10201 T10206 prep in,at
R7077 T10202 T10203 compound yolk,sac
R7078 T10203 T10205 compound sac,islands
R7079 T10204 T10205 compound blood,islands
R7080 T10205 T10201 pobj islands,in
R7081 T10206 T10194 conj at,transcribed
R7082 T10207 T10208 nummod 7.5,dpc
R7083 T10208 T10206 pobj dpc,at
R7084 T10209 T10211 punct (,6B
R7085 T10210 T10211 compound Figure,6B
R7086 T10211 T10208 appos 6B,dpc
R7087 T10212 T10211 punct ),6B
R7088 T10213 T10189 punct .,shows
R7089 T10214 T10218 advmod Therefore,is
R7090 T10215 T10218 punct ",",is
R7091 T10216 T10217 amod Sox6,expression
R7092 T10217 T10218 nsubj expression,is
R7093 T10218 T10218 ROOT is,is
R7094 T10219 T10222 advmod temporally,coincident
R7095 T10220 T10219 cc and,temporally
R7096 T10221 T10219 conj spatially,temporally
R7097 T10222 T10218 acomp coincident,is
R7098 T10223 T10222 prep with,coincident
R7099 T10224 T10223 pobj definitive,with
R7100 T10225 T10222 punct ",",coincident
R7101 T10226 T10222 cc but,coincident
R7102 T10227 T10228 neg not,primitive
R7103 T10228 T10222 conj primitive,coincident
R7104 T10229 T10228 punct ",",primitive
R7105 T10230 T10228 conj erythropoiesis,primitive
R7106 T10231 T10218 punct .,is
R7107 T10232 T10233 det These,data
R7108 T10233 T10260 nsubj data,demonstrate
R7109 T10234 T10233 punct ",",data
R7110 T10235 T10233 acl taken,data
R7111 T10236 T10235 advmod together,taken
R7112 T10237 T10235 prep with,taken
R7113 T10238 T10239 det the,observation
R7114 T10239 T10237 pobj observation,with
R7115 T10240 T10245 mark that,expressed
R7116 T10241 T10242 amod ɛy,globin
R7117 T10242 T10245 nsubjpass globin,expressed
R7118 T10243 T10245 auxpass is,expressed
R7119 T10244 T10245 advmod highly,expressed
R7120 T10245 T10239 acl expressed,observation
R7121 T10246 T10245 prep in,expressed
R7122 T10247 T10249 det the,cells
R7123 T10248 T10249 compound liver,cells
R7124 T10249 T10246 pobj cells,in
R7125 T10250 T10249 prep of,cells
R7126 T10251 T10254 amod 14.5-dpc,mice
R7127 T10252 T10254 amod p100H,mice
R7128 T10253 T10254 amod mutant,mice
R7129 T10254 T10250 pobj mice,of
R7130 T10255 T10256 punct (,Figure
R7131 T10256 T10249 appos Figure,cells
R7132 T10257 T10256 nummod 5,Figure
R7133 T10258 T10256 punct ),Figure
R7134 T10259 T10260 punct ",",demonstrate
R7135 T10260 T10260 ROOT demonstrate,demonstrate
R7136 T10261 T10263 mark that,functions
R7137 T10262 T10263 amod Sox6,functions
R7138 T10263 T10260 ccomp functions,demonstrate
R7139 T10264 T10263 prep in,functions
R7140 T10265 T10266 amod definitive,erythropoiesis
R7141 T10266 T10264 pobj erythropoiesis,in
R7142 T10267 T10260 punct .,demonstrate
R7298 T10522 T10523 compound Mutant,p100H
R7299 T10523 T10523 ROOT p100H,p100H
R7300 T10524 T10542 nsubj Mice,noticed
R7301 T10525 T10532 preconj Have,Among
R7302 T10526 T10527 amod Higher,Numbers
R7303 T10527 T10525 dobj Numbers,Have
R7304 T10528 T10527 prep of,Numbers
R7305 T10529 T10531 compound Nucleated,Cells
R7306 T10530 T10531 compound Red,Cells
R7307 T10531 T10528 pobj Cells,of
R7308 T10532 T10542 prep Among,noticed
R7309 T10533 T10536 det the,effects
R7310 T10534 T10536 amod other,effects
R7311 T10535 T10536 amod Sox6,effects
R7312 T10536 T10532 pobj effects,Among
R7313 T10537 T10536 prep in,effects
R7314 T10538 T10537 pobj erythropoiesis,in
R7315 T10539 T10542 punct ",",noticed
R7316 T10540 T10542 nsubj we,noticed
R7317 T10541 T10542 aux have,noticed
R7318 T10542 T10542 ROOT noticed,noticed
R7319 T10543 T10545 mark that,are
R7320 T10544 T10545 expl there,are
R7321 T10545 T10542 ccomp are,noticed
R7322 T10546 T10547 advmod more,nucleated
R7323 T10547 T10550 amod nucleated,cells
R7324 T10548 T10550 amod red,cells
R7325 T10549 T10550 compound blood,cells
R7326 T10550 T10545 attr cells,are
R7327 T10551 T10550 acl circulating,cells
R7328 T10552 T10551 prep in,circulating
R7329 T10553 T10555 amod p100H,mice
R7330 T10554 T10555 amod mutant,mice
R7331 T10555 T10552 pobj mice,in
R7332 T10556 T10550 prep than,cells
R7333 T10557 T10556 prep in,than
R7334 T10558 T10559 compound WT,mice
R7335 T10559 T10557 pobj mice,in
R7336 T10560 T10545 prep at,are
R7337 T10561 T10560 pobj 14.5,at
R7338 T10562 T10569 nmod dpc,)
R7339 T10563 T10562 cc and,dpc
R7340 T10564 T10565 nummod 18.5,dpc
R7341 T10565 T10569 nmod dpc,)
R7342 T10566 T10568 punct (,7A
R7343 T10567 T10568 compound Figure,7A
R7344 T10568 T10565 appos 7A,dpc
R7345 T10569 T10545 punct ),are
R7346 T10570 T10542 punct .,noticed
R7347 T10571 T10581 advmod However,see
R7348 T10572 T10581 punct ",",see
R7349 T10573 T10581 prep at,see
R7350 T10574 T10575 amod postnatal,day
R7351 T10575 T10573 pobj day,at
R7352 T10576 T10575 nummod 10.5,day
R7353 T10577 T10581 punct ",",see
R7354 T10578 T10581 nsubj we,see
R7355 T10579 T10581 aux do,see
R7356 T10580 T10581 neg not,see
R7357 T10581 T10581 ROOT see,see
R7358 T10582 T10581 ccomp circulating,see
R7359 T10583 T10585 amod nucleated,cells
R7360 T10584 T10585 amod red,cells
R7361 T10585 T10582 dobj cells,circulating
R7362 T10586 T10582 prep in,circulating
R7363 T10587 T10588 det either,WT
R7364 T10588 T10586 pobj WT,in
R7365 T10589 T10588 cc or,WT
R7366 T10590 T10591 amod mutant,mice
R7367 T10591 T10588 conj mice,WT
R7368 T10592 T10582 punct ",",circulating
R7369 T10593 T10582 advcl suggesting,circulating
R7370 T10594 T10597 mark that,be
R7371 T10595 T10597 nsubj this,be
R7372 T10596 T10597 aux may,be
R7373 T10597 T10593 ccomp be,suggesting
R7374 T10598 T10600 det a,effect
R7375 T10599 T10600 amod transient,effect
R7376 T10600 T10597 attr effect,be
R7377 T10601 T10581 punct .,see
R7378 T10602 T10608 prep In,shows
R7379 T10603 T10602 pobj addition,In
R7380 T10604 T10608 punct ",",shows
R7381 T10605 T10607 det the,liver
R7382 T10606 T10607 amod mutant,liver
R7383 T10607 T10608 nsubj liver,shows
R7384 T10608 T10608 ROOT shows,shows
R7385 T10609 T10611 det a,increase
R7386 T10610 T10611 amod significant,increase
R7387 T10611 T10608 dobj increase,shows
R7388 T10612 T10611 prep in,increase
R7389 T10613 T10615 amod hematopoietic,cells
R7390 T10614 T10615 compound precursor,cells
R7391 T10615 T10612 pobj cells,in
R7392 T10616 T10615 prep including,cells
R7393 T10617 T10618 amod nucleated,erythrocytes
R7394 T10618 T10616 pobj erythrocytes,including
R7395 T10619 T10618 prep at,erythrocytes
R7396 T10620 T10621 nummod 18.5,dpc
R7397 T10621 T10619 pobj dpc,at
R7398 T10622 T10624 punct (,7B
R7399 T10623 T10624 compound Figure,7B
R7400 T10624 T10621 appos 7B,dpc
R7401 T10625 T10624 punct ),7B
R7402 T10626 T10608 punct .,shows
R7403 T10627 T10628 det This,alteration
R7404 T10628 T10630 nsubjpass alteration,noted
R7405 T10629 T10630 auxpass is,noted
R7406 T10630 T10630 ROOT noted,noted
R7407 T10631 T10632 advmod as,early
R7408 T10632 T10630 advmod early,noted
R7409 T10633 T10632 prep as,early
R7410 T10634 T10635 nummod 14.5,dpc
R7411 T10635 T10633 pobj dpc,as
R7412 T10636 T10630 punct .,noted
R7413 T10637 T10638 det These,observations
R7414 T10638 T10639 nsubj observations,suggest
R7415 T10639 T10639 ROOT suggest,suggest
R7416 T10640 T10650 mark that,affect
R7417 T10641 T10650 prep besides,affect
R7418 T10642 T10641 pcomp silencing,besides
R7419 T10643 T10646 det the,gene
R7420 T10644 T10646 amod ɛy,gene
R7421 T10645 T10646 compound globin,gene
R7422 T10646 T10642 dobj gene,silencing
R7423 T10647 T10650 punct ",",affect
R7424 T10648 T10650 nsubj Sox6,affect
R7425 T10649 T10650 aux may,affect
R7426 T10650 T10639 ccomp affect,suggest
R7427 T10651 T10652 amod red,cell
R7428 T10652 T10653 compound cell,maturation
R7429 T10653 T10650 dobj maturation,affect
R7430 T10654 T10639 punct .,suggest
R9403 T13803 T13808 prep In,show
R9404 T13804 T13805 det this,report
R9405 T13805 T13803 pobj report,In
R9406 T13806 T13808 punct ",",show
R9407 T13807 T13808 nsubj we,show
R9408 T13808 T13808 ROOT show,show
R9409 T13809 T13811 mark that,is
R9410 T13810 T13811 nsubj Sox6,is
R9411 T13811 T13808 ccomp is,show
R9412 T13812 T13814 det a,factor
R9413 T13813 T13814 amod novel,factor
R9414 T13814 T13811 attr factor,is
R9415 T13815 T13814 prep in,factor
R9416 T13816 T13819 det the,mechanism
R9417 T13817 T13819 amod complicated,mechanism
R9419 T13818 T13819 compound regulation,mechanism
R9420 T13819 T13815 pobj mechanism,in
R9421 T13820 T13819 prep of,mechanism
R9422 T13821 T13822 compound globin,genes
R9423 T13822 T13820 pobj genes,of
R9424 T13823 T13808 punct .,show
R9425 T13824 T13831 prep In,is
R9426 T13825 T13828 det the,mouse
R9428 T13826 T13828 compound Sox6,mouse
R9429 T13827 T13828 amod null,mouse
R9430 T13828 T13824 pobj mouse,In
R9431 T13829 T13831 punct ",",is
R9433 T13830 T13831 expl there,is
R9434 T13831 T13831 ROOT is,is
R9436 T13832 T13834 det a,effect
R9438 T13833 T13834 amod transient,effect
R9439 T13834 T13831 attr effect,is
R9441 T13846 T13848 det a,upregulation
R9442 T13835 T13834 prep on,effect
R9443 T13836 T13839 det the,genes
R9444 T13837 T13839 amod embryonic,genes
R9445 T13838 T13839 compound globin,genes
R9446 T13839 T13835 pobj genes,on
R9447 T13840 T13839 punct ",",genes
R9448 T13841 T13839 conj ζ,genes
R9449 T13842 T13841 cc and,ζ
R9450 T13843 T13841 conj βH1,ζ
R9451 T13844 T13843 punct ",",βH1
R9452 T13845 T13843 cc and,βH1
R9453 T13847 T13848 amod persistent,upregulation
R9454 T13848 T13843 conj upregulation,βH1
R9455 T13849 T13848 prep of,upregulation
R9456 T13850 T13853 det the,gene
R9457 T13877 T13877 ROOT belongs,belongs
R9458 T13851 T13853 amod ɛy,gene
R9459 T13878 T13879 aux to,group
R9460 T13879 T13877 xcomp group,belongs
R9461 T13852 T13853 compound globin,gene
R9462 T13880 T13879 dobj D,group
R9463 T13881 T13880 prep of,D
R9464 T13882 T13884 det the,family
R9465 T13853 T13849 pobj gene,of
R9466 T13883 T13884 compound Sox,family
R9467 T13884 T13881 pobj family,of
R9468 T13854 T13831 punct .,is
R9469 T13885 T13884 prep of,family
R9470 T13886 T13885 pobj proteins,of
R9471 T13887 T13888 nsubj that,includes
R9472 T13855 T13857 nsubj Sox6,regulates
R9473 T13888 T13884 relcl includes,family
R9474 T13889 T13888 dobj Sox5,includes
R9475 T13856 T13857 advmod directly,regulates
R9476 T13890 T13889 punct ",",Sox5
R9477 T13891 T13888 npadvmod 12,includes
R9478 T13892 T13893 punct ",",13
R9479 T13893 T13891 prep 13,12
R9480 T13857 T13857 ROOT regulates,regulates
R9481 T13894 T13891 punct ",",12
R9482 T13895 T13891 cc and,12
R9483 T13858 T13857 cc and,regulates
R9484 T13896 T13899 nummod 23,]
R9485 T13897 T13899 nmod [,]
R9486 T13859 T13857 conj binds,regulates
R9487 T13898 T13899 nummod 34,]
R9488 T13899 T13891 conj ],12
R9489 T13900 T13877 punct .,belongs
R9490 T13860 T13859 prep to,binds
R9491 T13901 T13904 compound Group,proteins
R9492 T13902 T13904 compound D,proteins
R9493 T13903 T13904 compound Sox,proteins
R9494 T13861 T13863 det the,promoter
R9495 T13904 T13905 nsubj proteins,contain
R9496 T13905 T13905 ROOT contain,contain
R9497 T13906 T13907 det a,coiled
R9498 T13862 T13863 amod proximal,promoter
R9499 T13907 T13909 amod coiled,domain
R9500 T13908 T13909 compound coiled,domain
R9501 T13909 T13905 dobj domain,contain
R9502 T13863 T13860 pobj promoter,to
R9503 T13864 T13863 prep of,promoter
R9504 T13910 T13911 nsubj that,mediates
R9505 T13911 T13909 relcl mediates,domain
R9506 T13912 T13916 nmod homo,[
R9507 T13913 T13912 punct -,homo
R9508 T13914 T13912 cc and,homo
R9509 T13915 T13912 conj heterodimerization,homo
R9510 T13865 T13866 amod ɛy,gene
R9511 T13916 T13918 compound [,]
R9512 T13917 T13918 compound "6,35",]
R9513 T13866 T13864 pobj gene,of
R9514 T13918 T13911 dobj ],mediates
R9515 T13919 T13905 punct .,contain
R9516 T13867 T13863 cc and,promoter
R9517 T13920 T13929 advmod Functionally,shown
R9518 T13921 T13929 punct ",",shown
R9519 T13868 T13857 conj represses,regulates
R9520 T13922 T13929 nsubjpass dimerization,shown
R9521 T13923 T13922 prep of,dimerization
R9522 T13924 T13923 pobj Sox5,of
R9523 T13869 T13871 det the,gene
R9524 T13925 T13922 cc and,dimerization
R9525 T13926 T13922 conj Sox6,dimerization
R9526 T13927 T13929 aux has,shown
R9527 T13928 T13929 auxpass been,shown
R9528 T13870 T13871 amod ɛy-globin,gene
R9529 T13929 T13929 ROOT shown,shown
R9530 T13930 T13932 aux to,increase
R9531 T13931 T13932 advmod greatly,increase
R9532 T13871 T13868 dobj gene,represses
R9533 T13932 T13929 xcomp increase,shown
R9534 T13933 T13935 det the,efficiency
R9535 T13934 T13935 amod binding,efficiency
R9536 T13872 T13871 prep in,gene
R9537 T13935 T13932 dobj efficiency,increase
R9538 T13873 T13874 amod definitive,erythropoiesis
R9539 T13936 T13935 prep of,efficiency
R9540 T13937 T13940 det the,proteins
R9541 T13938 T13940 nummod two,proteins
R9542 T13939 T13940 compound Sox,proteins
R9543 T13874 T13872 pobj erythropoiesis,in
R9544 T13940 T13936 pobj proteins,of
R9545 T13941 T13932 prep to,increase
R9546 T13942 T13941 pobj DNA,to
R9547 T13875 T13857 punct .,regulates
R9548 T13943 T13944 nsubj that,contains
R9549 T13944 T13929 conj contains,shown
R9550 T13876 T13877 nsubj Sox6,belongs
R9551 T13945 T13947 amod adjacent,sites
R9552 T13946 T13947 compound Sox,sites
R9553 T13947 T13944 dobj sites,contains
R9554 T13948 T13950 nmod [,]
R9555 T13974 T13977 advmod Therefore,appears
R9556 T13949 T13950 nummod 6,]
R9557 T13950 T13947 appos ],sites
R9558 T13951 T13929 punct .,shown
R9559 T13952 T13956 prep In,binds
R9560 T13953 T13952 pobj addition,In
R9561 T13954 T13956 punct ",",binds
R9562 T13955 T13956 amod Sox6,binds
R9563 T13975 T13977 punct ",",appears
R9564 T13956 T13956 ROOT binds,binds
R9565 T13957 T13958 advmod more,strongly
R9566 T13958 T13959 advmod strongly,to
R9567 T13959 T13956 prep to,binds
R9568 T13976 T13977 nsubj it,appears
R9569 T13960 T13963 det an,motif
R9570 T13961 T13963 amod HMG-box,motif
R9571 T13962 T13963 compound dimer,motif
R9572 T13977 T13977 ROOT appears,appears
R9573 T13963 T13959 pobj motif,to
R9574 T13964 T13964 ROOT than,than
R9575 T13978 T13992 mark that,harbor
R9576 T13965 T13964 prep to,than
R9577 T13966 T13969 det a,motif
R9578 T13967 T13969 amod single,motif
R9579 T13979 T13980 compound target,genes
R9580 T13968 T13969 compound HMG-box,motif
R9581 T13969 T13965 pobj motif,to
R9582 T13970 T13956 advcl [,binds
R9583 T13980 T13992 nsubj genes,harbor
R9584 T13971 T13970 nummod 5,[
R9585 T13972 T13970 dobj ],[
R9586 T13973 T13956 punct .,binds
R9587 T13981 T13980 prep for,genes
R9588 T13982 T13985 nmod group,proteins
R9589 T13983 T13985 amod D,proteins
R9590 T13984 T13985 compound Sox,proteins
R9591 T13985 T13992 nsubj proteins,harbor
R9592 T14071 T14072 amod ɛy,promoter
R9593 T13986 T13985 punct ",",proteins
R9594 T14072 T14069 pobj promoter,of
R9595 T14073 T14074 preconj either,as
R9596 T14074 T14065 prep as,binds
R9597 T13987 T13988 amod such,as
R9598 T14075 T14076 det a,homodimer
R9599 T14076 T14074 pobj homodimer,as
R9600 T13988 T13985 prep as,proteins
R9601 T14077 T14074 cc or,as
R9602 T14078 T14074 conj as,as
R9603 T13989 T13988 pobj Sox6,as
R9604 T14079 T14080 det a,heterodimer
R9605 T14080 T14078 pobj heterodimer,as
R9606 T14081 T14080 prep with,heterodimer
R9607 T14082 T14084 amod other,proteins
R9608 T14083 T14084 compound Sox,proteins
R9609 T14084 T14081 pobj proteins,with
R9610 T13990 T13989 punct ",",Sox6
R9611 T14085 T14062 punct .,suggest
R9612 T14086 T14089 mark Because,recognize
R9613 T14087 T14088 compound Sox,proteins
R9614 T14088 T14089 nsubj proteins,recognize
R9615 T13991 T13992 advmod probably,harbor
R9616 T14089 T14107 advcl recognize,thought
R9617 T14090 T14094 det a,sequence
R9618 T13992 T13977 oprd harbor,appears
R9619 T14091 T14094 amod short,sequence
R9620 T14092 T14094 amod 6-bp,sequence
R9621 T14093 T14094 compound core-binding,sequence
R9622 T13993 T13992 dobj pairs,harbor
R9623 T14094 T14089 dobj sequence,recognize
R9624 T14095 T14096 nsubj that,allows
R9625 T14096 T14094 relcl allows,sequence
R9626 T13994 T13993 prep of,pairs
R9627 T14097 T14096 prep for,allows
R9628 T14098 T14099 amod considerable,degeneracy
R9629 T14099 T14097 pobj degeneracy,for
R9630 T13995 T13997 nmod HMG,sites
R9631 T14100 T14099 punct ",",degeneracy
R9632 T13996 T13997 amod binding,sites
R9633 T14101 T14102 det the,specificity
R9634 T14102 T14099 appos specificity,degeneracy
R9635 T14103 T14102 prep of,specificity
R9636 T13997 T13994 pobj sites,of
R9637 T14104 T14105 poss their,actions
R9638 T14105 T14103 pobj actions,of
R9639 T14106 T14107 auxpass is,thought
R9640 T13998 T13997 prep with,sites
R9641 T14107 T14107 ROOT thought,thought
R9642 T14108 T14109 aux to,rely
R9643 T13999 T14000 det a,configuration
R9644 T14109 T14107 xcomp rely,thought
R9645 T14110 T14109 prep upon,rely
R9646 T14111 T14110 pobj interactions,upon
R9647 T14000 T13998 pobj configuration,with
R9648 T14112 T14111 prep with,interactions
R9649 T14113 T14115 amod other,factors
R9650 T14114 T14115 compound transcription,factors
R9651 T14001 T14000 amod compatible,configuration
R9652 T14115 T14112 pobj factors,with
R9653 T14116 T14118 nmod [,]
R9654 T14002 T14001 prep with,compatible
R9655 T14117 T14118 nummod 36,]
R9656 T14118 T14115 appos ],factors
R9657 T14119 T14107 punct .,thought
R9658 T14120 T14125 prep In,had
R9659 T14121 T14122 poss our,EMSAs
R9660 T14122 T14120 pobj EMSAs,In
R9661 T14123 T14125 punct ",",had
R9662 T14003 T14002 pobj binding,with
R9663 T14124 T14125 nsubj we,had
R9664 T14125 T14125 ROOT had,had
R9665 T14004 T14003 prep of,binding
R9666 T14126 T14127 aux to,run
R9667 T14127 T14125 xcomp run,had
R9668 T14128 T14129 det the,electrophoresis
R9669 T14129 T14127 dobj electrophoresis,run
R9670 T14005 T14007 amod D-Sox,dimers
R9671 T14130 T14127 prep on,run
R9672 T14131 T14133 det a,%
R9673 T14006 T14007 compound protein,dimers
R9674 T14132 T14133 nummod 4,%
R9675 T14133 T14136 nmod %,gel
R9676 T14134 T14135 nummod 6,%
R9677 T14007 T14004 pobj dimers,of
R9678 T14135 T14136 compound %,gel
R9679 T14008 T13977 punct .,appears
R9680 T14009 T14025 advmod Indeed,contains
R9681 T14136 T14130 pobj gel,on
R9682 T14137 T14127 prep for,run
R9683 T14010 T14025 punct ",",contains
R9684 T14138 T14139 advmod at,least
R9685 T14139 T14140 advmod least,4
R9686 T14011 T14025 prep in,contains
R9687 T14140 T14137 pobj 4,for
R9688 T14141 T14142 nummod 8,h
R9689 T14142 T14140 appos h,4
R9690 T14012 T14014 det the,study
R9691 T14143 T14144 aux to,detect
R9692 T14144 T14127 advcl detect,run
R9693 T14013 T14014 amod present,study
R9694 T14014 T14011 pobj study,in
R9695 T14015 T14025 punct ",",contains
R9696 T14145 T14147 det the,band
R9697 T14146 T14147 amod Sox6-associated,band
R9698 T14016 T14020 det the,sequence
R9699 T14147 T14144 dobj band,detect
R9700 T14017 T14020 amod defined,sequence
R9701 T14148 T14125 punct ",",had
R9702 T14149 T14125 advcl suggesting,had
R9703 T14150 T14152 mark that,is
R9704 T14151 T14152 nsubj Sox6,is
R9705 T14018 T14020 compound Sox6,sequence
R9706 T14152 T14149 ccomp is,suggesting
R9707 T14153 T14152 attr part,is
R9708 T14154 T14153 prep of,part
R9709 T14155 T14159 det a,complex
R9710 T14156 T14158 amod high,weight
R9711 T14019 T14020 compound target,sequence
R9712 T14157 T14158 amod molecular,weight
R9713 T14158 T14159 compound weight,complex
R9714 T14159 T14154 pobj complex,of
R9715 T14020 T14025 nsubj sequence,contains
R9716 T14160 T14125 punct .,had
R9717 T14161 T14166 det A,repressors
R9718 T14162 T14166 amod few,repressors
R9719 T14021 T14020 prep of,sequence
R9720 T14163 T14166 amod other,repressors
R9721 T14164 T14166 amod ɛy,repressors
R9722 T14022 T14024 det the,promoter
R9723 T14165 T14166 compound globin,repressors
R9724 T14166 T14169 nsubjpass repressors,reported
R9725 T14167 T14169 aux have,reported
R9726 T14168 T14169 auxpass been,reported
R9727 T14023 T14024 amod ɛy,promoter
R9728 T14169 T14169 ROOT reported,reported
R9729 T14170 T14171 aux to,bind
R9730 T14024 T14021 pobj promoter,of
R9731 T14171 T14169 xcomp bind,reported
R9732 T14025 T14025 ROOT contains,contains
R9733 T14026 T14029 nummod two,sites
R9734 T14027 T14029 amod Sox/Sox6,sites
R9735 T14028 T14029 compound consensus,sites
R9736 T14172 T14171 prep to,bind
R9737 T14029 T14025 dobj sites,contains
R9738 T14173 T14174 compound DNA,sequences
R9739 T14174 T14172 pobj sequences,to
R9740 T14175 T14174 prep near,sequences
R9741 T14030 T14029 punct (,sites
R9742 T14176 T14179 det the,sites
R9743 T14177 T14179 compound Sox/Sox6,sites
R9744 T14031 T14032 compound Figure,3A
R9745 T14178 T14179 compound consensus,sites
R9746 T14179 T14175 pobj sites,near
R9747 T14180 T14179 punct ",",sites
R9748 T14032 T14029 appos 3A,sites
R9749 T14181 T14179 prep including,sites
R9750 T14182 T14187 det the,]
R9751 T14183 T14187 nmod DRED,]
R9752 T14033 T14029 punct ),sites
R9753 T14184 T14187 amod complex,]
R9754 T14185 T14187 nmod [,]
R9755 T14034 T14025 punct .,contains
R9756 T14186 T14187 nummod 37,]
R9757 T14187 T14181 pobj ],including
R9758 T14035 T14039 advmod Functionally,are
R9759 T14188 T14187 cc and,]
R9760 T14189 T14190 compound COUP-TF,[
R9761 T14190 T14187 conj [,]
R9762 T14191 T14192 nummod 38,]
R9763 T14192 T14187 conj ],]
R9764 T14036 T14039 punct ",",are
R9765 T14193 T14169 punct .,reported
R9766 T14194 T14196 nsubj Sox6,interact
R9767 T14195 T14196 aux might,interact
R9768 T14196 T14196 ROOT interact,interact
R9769 T14037 T14038 det both,sites
R9770 T14197 T14196 prep with,interact
R9771 T14198 T14199 det these,factors
R9772 T14038 T14039 nsubj sites,are
R9773 T14199 T14197 pobj factors,with
R9774 T14200 T14196 cc and,interact
R9775 T14201 T14196 conj form,interact
R9776 T14039 T14039 ROOT are,are
R9777 T14202 T14205 det a,complex
R9778 T14203 T14205 amod large,complex
R9779 T14204 T14205 compound repression,complex
R9780 T14040 T14039 acomp essential,are
R9781 T14205 T14201 dobj complex,form
R9782 T14206 T14196 punct .,interact
R9783 T14207 T14215 nsubjpass Identification,associated
R9784 T14041 T14040 prep for,essential
R9785 T14208 T14207 prep of,Identification
R9786 T14209 T14210 amod other,components
R9787 T14210 T14208 pobj components,of
R9788 T14042 T14043 amod Sox6,binding
R9789 T14211 T14210 prep of,components
R9790 T14212 T14215 det the,associated
R9791 T14213 T14215 amod Sox6-containing,associated
R9792 T14043 T14041 amod binding,for
R9793 T14044 T14043 prep to,binding
R9794 T14045 T14047 det the,promoter
R9795 T14214 T14215 amod complex,associated
R9796 T14046 T14047 amod ɛy,promoter
R9797 T14215 T14215 ROOT associated,associated
R9798 T14216 T14215 prep with,associated
R9799 T14217 T14219 det the,promoter
R9800 T14047 T14044 pobj promoter,to
R9801 T14218 T14219 amod ɛy,promoter
R9802 T14219 T14216 pobj promoter,with
R9803 T14220 T14221 aux will,shed
R9804 T14048 T14047 cc and,promoter
R9805 T14221 T14215 conj shed,associated
R9806 T14222 T14221 dobj light,shed
R9807 T14223 T14221 prep on,shed
R9808 T14049 T14047 conj repression,promoter
R9809 T14224 T14225 poss its,mechanism
R9810 T14050 T14047 prep of,promoter
R9811 T14225 T14223 pobj mechanism,on
R9812 T14226 T14225 prep of,mechanism
R9813 T14227 T14226 pobj repression,of
R9814 T14228 T14215 punct .,associated
R9815 T14051 T14052 poss its,activity
R9816 T14229 T14230 compound Sox,proteins
R9817 T14230 T14231 nsubj proteins,bind
R9818 T14052 T14050 pobj activity,of
R9819 T14231 T14231 ROOT bind,bind
R9820 T14232 T14231 cc and,bind
R9821 T14233 T14231 conj bend,bind
R9822 T14053 T14054 punct (,Figure
R9823 T14234 T14235 compound linear,DNA
R9824 T14235 T14233 dobj DNA,bend
R9825 T14236 T14233 prep by,bend
R9826 T14054 T14047 appos Figure,promoter
R9827 T14237 T14238 amod partial,intercalation
R9828 T14238 T14236 pobj intercalation,by
R9829 T14239 T14233 prep in,bend
R9830 T14055 T14054 nummod 3E,Figure
R9831 T14240 T14242 det the,groove
R9832 T14241 T14242 amod minor,groove
R9833 T14242 T14239 pobj groove,in
R9834 T14056 T14054 cc and,Figure
R9835 T14243 T14233 punct ",",bend
R9836 T14244 T14233 cc and,bend
R9837 T14245 T14247 aux can,bind
R9838 T14057 T14054 conj 3F,Figure
R9839 T14246 T14247 advmod also,bind
R9840 T14247 T14231 conj bind,bind
R9841 T14248 T14247 prep to,bind
R9842 T14058 T14039 punct ),are
R9843 T14249 T14250 amod four-way,junctions
R9844 T14250 T14248 pobj junctions,to
R9845 T14251 T14231 conj [,bind
R9846 T14059 T14039 punct .,are
R9847 T14252 T14251 nummod 2,[
R9848 T14253 T14254 nummod 4,]
R9849 T14254 T14251 appos ],[
R9850 T14060 T14061 det These,observations
R9851 T14255 T14251 punct .,[
R9852 T14256 T14269 advmod Therefore,is
R9853 T14257 T14269 punct ",",is
R9854 T14061 T14062 nsubj observations,suggest
R9855 T14258 T14260 nummod one,model
R9856 T14259 T14260 amod attractive,model
R9857 T14260 T14269 nsubj model,is
R9858 T14062 T14062 ROOT suggest,suggest
R9859 T14261 T14262 aux to,explain
R9860 T14262 T14260 relcl explain,model
R9861 T14263 T14266 advmod how,control
R9862 T14264 T14266 acomp Sox6,control
R9863 T14265 T14266 nsubj proteins,control
R9864 T14063 T14065 mark that,binds
R9865 T14266 T14268 compound control,expression
R9866 T14267 T14268 compound gene,expression
R9867 T14268 T14262 dobj expression,explain
R9868 T14064 T14065 amod Sox6,binds
R9869 T14065 T14062 ccomp binds,suggest
R9870 T14066 T14065 prep to,binds
R9871 T14067 T14068 det this,sequence
R9872 T14269 T14269 ROOT is,is
R9873 T14270 T14272 mark that,function
R9874 T14271 T14272 nsubj they,function
R9875 T14272 T14269 ccomp function,is
R9876 T14068 T14066 pobj sequence,to
R9877 T14273 T14272 prep as,function
R9878 T14274 T14275 amod architectural,factors
R9879 T14275 T14273 pobj factors,as
R9880 T14069 T14068 prep of,sequence
R9881 T14276 T14275 acl bound,factors
R9882 T14277 T14276 prep to,bound
R9883 T14070 T14072 det the,promoter
R9884 T14278 T14277 pobj DNA,to
R9885 T14279 T14272 punct ",",function
R9886 T14280 T14272 advcl influencing,function
R9887 T14366 T14365 prep of,family
R9888 T14281 T14283 amod local,structure
R9889 T14367 T14368 compound transcription,factors
R9890 T14282 T14283 compound chromatin,structure
R9891 T14283 T14280 dobj structure,influencing
R9892 T14284 T14280 prep by,influencing
R9893 T14285 T14284 pcomp bending,by
R9894 T14368 T14366 pobj factors,of
R9895 T14286 T14285 dobj DNA,bending
R9896 T14287 T14284 cc and,by
R9897 T14288 T14284 conj by,by
R9898 T14369 T14365 punct ),family
R9899 T14289 T14288 pcomp assembling,by
R9900 T14290 T14292 amod multiprotein,complexes
R9901 T14291 T14292 amod transcriptional,complexes
R9902 T14370 T14365 punct ",",family
R9903 T14292 T14289 dobj complexes,assembling
R9904 T14293 T14269 punct .,is
R9905 T14294 T14304 prep By,interfere
R9906 T14371 T14365 appos HMG-I,family
R9907 T14295 T14294 pcomp changing,By
R9908 T14296 T14299 det the,structure
R9909 T14297 T14299 amod local,structure
R9910 T14298 T14299 compound chromatin,structure
R9911 T14299 T14295 dobj structure,changing
R9912 T14300 T14304 punct ",",interfere
R9913 T14372 T14371 cc and,HMG-I
R9914 T14301 T14304 nsubj Sox6,interfere
R9915 T14302 T14304 aux could,interfere
R9916 T14373 T14371 conj HMG-Y,HMG-I
R9917 T14303 T14304 preconj either,interfere
R9918 T14374 T14376 punct ",",demonstrated
R9919 T14304 T14304 ROOT interfere,interfere
R9920 T14305 T14304 prep with,interfere
R9921 T14375 T14376 auxpass were,demonstrated
R9922 T14306 T14305 pobj binding,with
R9923 T14307 T14306 prep of,binding
R9924 T14308 T14309 amod other,activators
R9925 T14376 T14376 ROOT demonstrated,demonstrated
R9926 T14309 T14307 pobj activators,of
R9927 T14310 T14309 prep to,activators
R9928 T14311 T14312 det the,promoter
R9929 T14377 T14378 aux to,bind
R9930 T14312 T14310 pobj promoter,to
R9931 T14313 T14304 cc or,interfere
R9932 T14378 T14376 xcomp bind,demonstrated
R9933 T14314 T14304 conj facilitate,interfere
R9934 T14315 T14314 dobj binding,facilitate
R9935 T14379 T14378 prep to,bind
R9936 T14316 T14315 prep of,binding
R9937 T14317 T14318 amod other,repressors
R9938 T14318 T14316 pobj repressors,of
R9939 T14380 T14385 det the,silencers
R9940 T14319 T14304 punct .,interfere
R9941 T14320 T14321 det Another,example
R9942 T14321 T14334 nsubj example,is
R9943 T14381 T14382 amod human,adult
R9944 T14322 T14321 prep of,example
R9945 T14323 T14324 det a,repressor
R9946 T14324 T14322 pobj repressor,of
R9947 T14382 T14385 nmod adult,silencers
R9948 T14325 T14326 nsubj that,interferes
R9949 T14326 T14324 relcl interferes,repressor
R9950 T14327 T14326 prep with,interferes
R9951 T14328 T14329 det an,activator
R9952 T14329 T14327 pobj activator,with
R9953 T14330 T14329 prep on,activator
R9954 T14383 T14385 nmod β,silencers
R9955 T14331 T14333 det the,promoter
R9956 T14332 T14333 amod ɛy,promoter
R9957 T14333 T14330 pobj promoter,on
R9958 T14384 T14385 compound globin,silencers
R9959 T14334 T14334 ROOT is,is
R9960 T14335 T14334 attr DRED,is
R9961 T14336 T14334 punct .,is
R9962 T14337 T14338 nsubj DRED,interferes
R9963 T14338 T14338 ROOT interferes,interferes
R9964 T14339 T14338 prep with,interferes
R9965 T14385 T14379 pobj silencers,to
R9966 T14340 T14339 pobj EKLF,with
R9967 T14341 T14340 punct ",",EKLF
R9968 T14342 T14343 det an,activator
R9969 T14386 T14385 punct (,silencers
R9970 T14343 T14340 appos activator,EKLF
R9971 T14344 T14340 punct ",",EKLF
R9972 T14345 T14338 prep in,interferes
R9973 T14346 T14345 amod binding,in
R9974 T14387 T14385 appos silencers,silencers
R9975 T14347 T14346 prep to,binding
R9976 T14348 T14350 det the,promoter
R9977 T14349 T14350 amod ɛy,promoter
R9978 T14388 T14387 advmod I,silencers
R9979 T14350 T14347 pobj promoter,to
R9980 T14351 T14350 appos [,promoter
R9981 T14352 T14353 nummod 39,]
R9982 T14389 T14388 cc and,I
R9983 T14353 T14350 appos ],promoter
R9984 T14354 T14338 punct .,interferes
R9985 T14355 T14358 nummod Two,proteins
R9986 T14390 T14388 conj II,I
R9987 T14356 T14358 nmod HMG,proteins
R9988 T14357 T14358 amod architectural,proteins
R9989 T14358 T14376 nsubjpass proteins,demonstrated
R9990 T14391 T14388 punct ),I
R9991 T14359 T14358 punct (,proteins
R9992 T14360 T14361 advmod distantly,related
R9993 T14361 T14358 acl related,proteins
R9994 T14362 T14361 prep to,related
R9995 T14392 T14378 cc and,bind
R9996 T14363 T14365 det the,family
R9997 T14364 T14365 compound Sox,family
R9998 T14365 T14362 pobj family,to
R9999 T14393 T14378 conj cause,bind
R10000 T14394 T14393 xcomp bending,cause
R10001 T14395 T14394 prep of,bending
R10002 T14396 T14397 det the,DNA
R10003 T14463 T14461 pobj globin,of
R10004 T14397 T14395 pobj DNA,of
R10005 T14464 T14463 prep in,globin
R10006 T14465 T14467 amod p100H,mice
R10007 T14398 T14394 punct ",",bending
R10008 T14466 T14467 amod mutant,mice
R10009 T14467 T14464 pobj mice,in
R10010 T14468 T14456 ccomp is,shows
R10011 T14469 T14468 acomp due,is
R10012 T14470 T14469 prep to,due
R10013 T14399 T14394 conj facilitating,bending
R10014 T14471 T14470 pobj defects,to
R10015 T14472 T14471 prep in,defects
R10016 T14473 T14475 det the,mechanism
R10017 T14400 T14401 det the,binding
R10018 T14474 T14475 amod silencing,mechanism
R10019 T14475 T14472 pobj mechanism,in
R10020 T14401 T14399 dobj binding,facilitating
R10021 T14476 T14475 prep of,mechanism
R10022 T14477 T14478 amod definitive,erythropoiesis
R10023 T14478 T14476 pobj erythropoiesis,of
R10024 T14402 T14401 prep of,binding
R10025 T14479 T14480 nsubj that,takes
R10026 T14480 T14475 relcl takes,mechanism
R10027 T14481 T14480 dobj place,takes
R10028 T14482 T14480 prep in,takes
R10029 T14403 T14404 amod other,repressors
R10030 T14483 T14484 det the,liver
R10031 T14484 T14482 pobj liver,in
R10032 T14404 T14405 compound repressors,[
R10033 T14485 T14486 punct (,Figure
R10034 T14486 T14480 npadvmod Figure,takes
R10035 T14487 T14486 nummod 5,Figure
R10036 T14488 T14486 punct ),Figure
R10037 T14405 T14402 pobj [,of
R10038 T14489 T14456 punct .,shows
R10039 T14490 T14495 advcl Taken,demonstrate
R10040 T14406 T14407 nummod 40,]
R10041 T14491 T14490 advmod together,Taken
R10042 T14492 T14495 punct ",",demonstrate
R10043 T14493 T14494 det these,data
R10044 T14407 T14405 appos ],[
R10045 T14494 T14495 nsubj data,demonstrate
R10046 T14495 T14495 ROOT demonstrate,demonstrate
R10047 T14408 T14376 punct .,demonstrated
R10048 T14496 T14506 det that,expression
R10049 T14497 T14498 amod Sox6,functions
R10050 T14498 T14503 nsubj functions,silence
R10051 T14409 T14410 amod Sox6,expression
R10052 T14499 T14498 prep in,functions
R10053 T14500 T14501 amod definitive,erythropoiesis
R10054 T14501 T14499 pobj erythropoiesis,in
R10055 T14502 T14503 aux to,silence
R10056 T14410 T14411 nsubj expression,is
R10057 T14503 T14506 nmod silence,expression
R10058 T14504 T14506 nmod ɛy,expression
R10059 T14505 T14506 compound globin,expression
R10060 T14411 T14411 ROOT is,is
R10061 T14506 T14495 dobj expression,demonstrate
R10062 T14507 T14495 punct .,demonstrate
R10063 T14508 T14510 det The,level
R10064 T14509 T14510 compound expression,level
R10065 T14510 T14525 nsubj level,is
R10066 T14412 T14411 acomp temporally,is
R10067 T14511 T14510 prep of,level
R10068 T14512 T14513 amod ɛy,globin
R10069 T14513 T14511 pobj globin,of
R10070 T14413 T14412 cc and,temporally
R10071 T14514 T14513 prep in,globin
R10072 T14515 T14518 amod homozygous,mice
R10073 T14414 T14412 conj spatially,temporally
R10074 T14516 T14518 amod Sox6,mice
R10075 T14517 T14518 amod null,mice
R10076 T14518 T14514 pobj mice,in
R10077 T14415 T14412 conj coincident,temporally
R10078 T14519 T14510 prep at,level
R10079 T14520 T14524 nummod 15.5,dpc
R10080 T14521 T14520 npadvmod dpc,15.5
R10081 T14416 T14411 prep with,is
R10082 T14522 T14520 cc and,15.5
R10083 T14523 T14520 conj 18.5,15.5
R10084 T14417 T14416 pobj definitive,with
R10085 T14524 T14519 pobj dpc,at
R10086 T14525 T14525 ROOT is,is
R10087 T14526 T14527 advmod statistically,equivalent
R10088 T14418 T14417 punct (,definitive
R10089 T14527 T14525 acomp equivalent,is
R10090 T14528 T14527 prep to,equivalent
R10091 T14529 T14530 det the,level
R10092 T14419 T14417 cc but,definitive
R10093 T14530 T14528 pobj level,to
R10094 T14531 T14530 prep of,level
R10095 T14420 T14421 neg not,primitive
R10096 T14532 T14535 amod βmaj,expression
R10097 T14533 T14534 compound /,min
R10098 T14534 T14535 compound min,expression
R10099 T14535 T14531 pobj expression,of
R10100 T14421 T14417 conj primitive,definitive
R10101 T14536 T14530 prep in,level
R10102 T14537 T14538 det the,livers
R10103 T14422 T14411 punct ),is
R10104 T14538 T14536 pobj livers,in
R10105 T14423 T14423 ROOT erythropoiesis,erythropoiesis
R10106 T14539 T14538 prep of,livers
R10107 T14424 T14425 punct (,Figure
R10108 T14540 T14545 amod 15.5-dpc,mice
R10109 T14541 T14540 cc and,15.5-dpc
R10110 T14542 T14540 conj 18.5-dpc,15.5-dpc
R10111 T14425 T14423 parataxis Figure,erythropoiesis
R10112 T14543 T14545 amod homozygous,mice
R10113 T14544 T14545 compound WT,mice
R10114 T14545 T14539 pobj mice,of
R10115 T14546 T14547 punct (,Figure
R10116 T14547 T14538 appos Figure,livers
R10117 T14426 T14425 nummod 6,Figure
R10118 T14548 T14547 nummod 1,Figure
R10119 T14549 T14547 punct ),Figure
R10120 T14550 T14525 punct .,is
R10121 T14427 T14425 punct ),Figure
R10122 T14551 T14552 nsubj This,demonstrates
R10123 T14552 T14552 ROOT demonstrates,demonstrates
R10124 T14553 T14561 mark that,is
R10125 T14554 T14555 amod ectopic,expression
R10126 T14428 T14423 punct ",",erythropoiesis
R10127 T14555 T14561 nsubj expression,is
R10128 T14556 T14555 prep of,expression
R10129 T14557 T14560 det the,gene
R10130 T14429 T14423 cc and,erythropoiesis
R10131 T14558 T14560 amod ɛy,gene
R10132 T14559 T14560 compound globin,gene
R10133 T14430 T14431 nsubj Sox6,represses
R10134 T14431 T14423 conj represses,erythropoiesis
R10135 T14432 T14434 amod ɛy,expression
R10136 T14433 T14434 compound globin,expression
R10137 T14560 T14556 pobj gene,of
R10138 T14561 T14552 ccomp is,demonstrates
R10139 T14562 T14563 advmod quite,robust
R10140 T14434 T14431 dobj expression,represses
R10141 T14563 T14561 acomp robust,is
R10142 T14564 T14563 prep in,robust
R10143 T14435 T14436 preconj both,in
R10144 T14565 T14567 amod homozygous,mice
R10145 T14566 T14567 amod mutant,mice
R10146 T14567 T14564 pobj mice,in
R10147 T14568 T14552 punct .,demonstrates
R10148 T14436 T14434 prep in,expression
R10149 T14569 T14571 det The,levels
R10150 T14570 T14571 compound expression,levels
R10151 T14437 T14436 pobj vivo,in
R10152 T14571 T14583 nsubj levels,are
R10153 T14572 T14571 prep of,levels
R10154 T14573 T14577 nummod two,genes
R10155 T14438 T14439 punct (,Figure
R10156 T14574 T14577 amod other,genes
R10157 T14575 T14577 amod embryonic,genes
R10158 T14576 T14577 compound globin,genes
R10159 T14439 T14434 appos Figure,expression
R10160 T14577 T14572 pobj genes,of
R10161 T14578 T14577 punct (,genes
R10162 T14440 T14439 nummod 1,Figure
R10163 T14579 T14577 appos ζ,genes
R10164 T14580 T14579 cc and,ζ
R10165 T14441 T14439 punct ),Figure
R10166 T14581 T14579 conj βh1,ζ
R10167 T14582 T14577 punct ),genes
R10168 T14442 T14431 cc and,represses
R10169 T14583 T14583 ROOT are,are
R10170 T14584 T14583 advmod also,are
R10171 T14443 T14431 conj in,represses
R10172 T14585 T14583 acomp higher,are
R10173 T14586 T14585 prep in,higher
R10174 T14587 T14588 amod p100H,homozygotes
R10175 T14444 T14446 amod vitro,Figure
R10176 T14588 T14586 pobj homozygotes,in
R10177 T14589 T14583 punct ",",are
R10178 T14590 T14583 prep compared,are
R10179 T14445 T14446 punct (,Figure
R10180 T14591 T14590 prep with,compared
R10181 T14592 T14591 pobj WT,with
R10182 T14593 T14583 punct .,are
R10183 T14446 T14443 pobj Figure,in
R10184 T14594 T14602 prep Like,are
R10185 T14595 T14594 pobj ɛy,Like
R10186 T14596 T14602 punct ",",are
R10187 T14447 T14446 nummod 2,Figure
R10188 T14597 T14602 nsubj levels,are
R10189 T14598 T14597 prep of,levels
R10190 T14448 T14446 punct ),Figure
R10191 T14599 T14598 pobj ζ,of
R10192 T14600 T14597 cc and,levels
R10193 T14601 T14597 conj βh1,levels
R10194 T14449 T14431 punct .,represses
R10195 T14602 T14602 ROOT are,are
R10196 T14603 T14604 advmod dramatically,higher
R10197 T14604 T14602 acomp higher,are
R10198 T14450 T14456 advmod Moreover,shows
R10199 T14605 T14604 prep in,higher
R10200 T14606 T14607 amod mutant,mice
R10201 T14451 T14456 punct ",",shows
R10202 T14607 T14605 pobj mice,in
R10203 T14608 T14602 prep at,are
R10204 T14609 T14610 nummod 15.5,dpc
R10205 T14452 T14456 prep in,shows
R10206 T14610 T14608 pobj dpc,at
R10207 T14611 T14602 punct .,are
R10208 T14612 T14612 ROOT However,However
R10209 T14453 T14454 compound situ,hybridization
R10210 T14613 T14612 pobj ",",However
R10211 T14614 T14613 xcomp unlike,","
R10212 T14454 T14456 nsubj hybridization,shows
R10213 T14615 T14616 amod ɛy,globin
R10214 T14616 T14614 pobj globin,unlike
R10215 T14617 T14616 punct ",",globin
R10216 T14455 T14456 advmod clearly,shows
R10217 T14618 T14616 conj ζ,globin
R10218 T14619 T14618 cc and,ζ
R10219 T14456 T14456 ROOT shows,shows
R10220 T14620 T14621 amod βh1,decline
R10221 T14621 T14618 conj decline,ζ
R10222 T14622 T14621 prep in,decline
R10223 T14457 T14468 mark that,is
R10224 T14623 T14622 pobj expression,in
R10225 T14624 T14621 prep by,decline
R10226 T14625 T14624 pobj day,by
R10227 T14458 T14460 det the,expression
R10228 T14626 T14625 nummod 18.5,day
R10229 T14459 T14460 amod persistent,expression
R10230 T14627 T14627 ROOT dpc,dpc
R10231 T14628 T14629 punct (,Figure
R10232 T14629 T14627 appos Figure,dpc
R10233 T14460 T14468 nsubj expression,is
R10234 T14630 T14629 nummod 1,Figure
R10235 T14631 T14629 punct ),Figure
R10236 T14632 T14627 punct ",",dpc
R10237 T14461 T14460 prep of,expression
R10238 T14633 T14627 acl suggesting,dpc
R10239 T14634 T14637 mark that,regulated
R10240 T14635 T14637 nsubjpass ɛy,regulated
R10241 T14462 T14463 amod ɛy,globin
R10242 T14636 T14637 auxpass is,regulated
R10243 T14637 T14633 ccomp regulated,suggesting
R10244 T14657 T14656 punct (,genes
R10245 T14638 T14637 advmod differently,regulated
R10246 T14658 T14656 cc and,genes
R10247 T14639 T14638 prep than,differently
R10248 T14640 T14639 pobj ζ,than
R10249 T14659 T14660 amod erythrocyte,maturation
R10250 T14641 T14640 cc and,ζ
R10251 T14642 T14640 conj βh1,ζ
R10252 T14643 T14627 punct .,dpc
R10253 T14660 T14656 conj maturation,genes
R10254 T14644 T14645 nsubj It,is
R10255 T14645 T14645 ROOT is,is
R10256 T14646 T14645 acomp possible,is
R10257 T14661 T14652 punct ),effect
R10258 T14647 T14649 mark that,has
R10259 T14648 T14649 nsubj Sox6,has
R10260 T14649 T14645 ccomp has,is
R10261 T14662 T14649 prep in,has
R10262 T14650 T14652 det a,effect
R10263 T14651 T14652 amod general,effect
R10264 T14652 T14649 dobj effect,has
R10265 T14653 T14652 prep on,effect
R10266 T14654 T14656 amod embryonic,genes
R10267 T14655 T14656 compound globin,genes
R10268 T14663 T14662 pobj addition,in
R10269 T14656 T14653 pobj genes,on
R10270 T14664 T14663 prep to,addition
R10271 T14665 T14667 det a,role
R10272 T14666 T14667 amod specific,role
R10273 T14667 T14664 pobj role,to
R10274 T14754 T14755 det the,levels
R10275 T14668 T14667 prep in,role
R10276 T14755 T14761 nsubj levels,were
R10277 T14756 T14755 prep of,levels
R10278 T14757 T14756 pobj ζ,of
R10279 T14669 T14668 pcomp silencing,in
R10280 T14758 T14757 cc and,ζ
R10281 T14759 T14760 nummod βh1,RNA
R10282 T14760 T14757 conj RNA,ζ
R10283 T14670 T14669 dobj ɛy,silencing
R10284 T14761 T14778 ccomp were,elevated
R10285 T14762 T14761 acomp undetectable,were
R10286 T14671 T14645 punct .,is
R10287 T14763 T14764 advmod both,in
R10288 T14764 T14762 prep in,undetectable
R10289 T14672 T14677 mark Although,die
R10290 T14765 T14764 pobj mutant,in
R10291 T14766 T14765 cc and,mutant
R10292 T14767 T14765 conj WT,mutant
R10293 T14673 T14676 amod most,mice
R10294 T14768 T14778 punct ;,elevated
R10295 T14769 T14778 advmod however,elevated
R10296 T14770 T14778 punct ",",elevated
R10297 T14674 T14676 amod p100H,mice
R10298 T14771 T14775 nmod adult,levels
R10299 T14772 T14775 amod β-like,levels
R10300 T14773 T14775 compound globin,levels
R10301 T14675 T14676 amod mutant,mice
R10302 T14774 T14775 compound RNA,levels
R10303 T14775 T14776 nsubj levels,were
R10304 T14676 T14677 nsubj mice,die
R10305 T14677 T14686 advcl die,survive
R10306 T14776 T14778 auxpass were,elevated
R10307 T14678 T14679 advmod just,after
R10308 T14777 T14778 advmod moderately,elevated
R10309 T14778 T14778 ROOT elevated,elevated
R10310 T14779 T14778 prep in,elevated
R10311 T14679 T14677 prep after,die
R10312 T14780 T14782 det the,RNA
R10313 T14781 T14782 amod mutant,RNA
R10314 T14782 T14779 pobj RNA,in
R10315 T14783 T14778 prep compared,elevated
R10316 T14784 T14783 prep with,compared
R10317 T14680 T14681 auxpass being,born
R10318 T14785 T14784 pobj WT,with
R10319 T14786 T14785 punct (,WT
R10320 T14681 T14679 pcomp born,after
R10321 T14787 T14788 amod unpublished,data
R10322 T14788 T14785 appos data,WT
R10323 T14789 T14785 punct ),WT
R10324 T14682 T14686 punct ",",survive
R10325 T14790 T14785 punct ",",WT
R10326 T14791 T14778 conj similar,elevated
R10327 T14683 T14686 det a,survive
R10328 T14792 T14791 prep to,similar
R10329 T14793 T14795 dobj what,observe
R10330 T14794 T14795 nsubj we,observe
R10331 T14684 T14686 amod rare,survive
R10332 T14795 T14792 pcomp observe,to
R10333 T14796 T14795 prep at,observe
R10334 T14797 T14798 nummod 18.5,dpc
R10335 T14685 T14686 nsubj few,survive
R10336 T14798 T14796 pobj dpc,at
R10337 T14799 T14800 punct (,Figure
R10338 T14800 T14792 pobj Figure,to
R10339 T14686 T14686 ROOT survive,survive
R10340 T14801 T14800 nummod 1,Figure
R10341 T14802 T14800 punct ),Figure
R10342 T14803 T14778 punct .,elevated
R10343 T14687 T14686 advmod longer,survive
R10344 T14804 T14805 det These,findings
R10345 T14805 T14806 nsubj findings,suggest
R10346 T14806 T14806 ROOT suggest,suggest
R10347 T14807 T14809 mark that,continues
R10348 T14688 T14686 punct .,survive
R10349 T14808 T14809 nsubj Sox6,continues
R10350 T14809 T14806 ccomp continues,suggest
R10351 T14810 T14811 aux to,function
R10352 T14689 T14692 nsubjpass None,observed
R10353 T14811 T14809 xcomp function,continues
R10354 T14812 T14811 advmod postnatally,function
R10355 T14690 T14692 aux have,observed
R10356 T14813 T14811 prep to,function
R10357 T14814 T14817 nmod silence,expression
R10358 T14815 T14817 nmod ɛy,expression
R10359 T14691 T14692 auxpass been,observed
R10360 T14816 T14817 compound globin,expression
R10361 T14817 T14813 pobj expression,to
R10362 T14818 T14809 cc and,continues
R10363 T14692 T14692 ROOT observed,observed
R10364 T14819 T14809 conj has,continues
R10365 T14820 T14822 det a,function
R10366 T14821 T14822 amod unique,function
R10367 T14822 T14819 dobj function,has
R10368 T14823 T14822 prep in,function
R10369 T14824 T14825 det the,regulation
R10370 T14693 T14694 aux to,live
R10371 T14825 T14823 pobj regulation,in
R10372 T14826 T14825 prep of,regulation
R10373 T14827 T14826 pobj ɛy-globin,of
R10374 T14694 T14692 xcomp live,observed
R10375 T14828 T14806 punct .,suggest
R10376 T14829 T14830 det The,mechanism
R10377 T14830 T14840 nsubj mechanism,remains
R10378 T14695 T14698 amod longer,wk
R10379 T14831 T14834 prep by,regulates
R10380 T14832 T14831 pobj which,by
R10381 T14696 T14698 quantmod than,wk
R10382 T14833 T14834 nsubj Sox6,regulates
R10383 T14834 T14830 relcl regulates,mechanism
R10384 T14697 T14698 nummod 2,wk
R10385 T14835 T14839 det the,genes
R10386 T14836 T14839 amod other,genes
R10387 T14837 T14839 amod embryonic,genes
R10388 T14698 T14694 dobj wk,live
R10389 T14838 T14839 compound globin,genes
R10390 T14839 T14834 dobj genes,regulates
R10391 T14840 T14840 ROOT remains,remains
R10392 T14699 T14694 prep after,live
R10393 T14841 T14843 aux to,elucidated
R10394 T14842 T14843 auxpass be,elucidated
R10395 T14843 T14840 xcomp elucidated,remains
R10396 T14700 T14703 nsubjpass birth,]
R10397 T14844 T14840 punct .,remains
R10398 T14845 T14846 nsubj Sox6,has
R10399 T14846 T14846 ROOT has,has
R10400 T14701 T14703 nmod [,]
R10401 T14847 T14848 amod other,effects
R10402 T14848 T14846 dobj effects,has
R10403 T14849 T14848 prep in,effects
R10404 T14702 T14703 nummod 14,]
R10405 T14850 T14849 pobj erythropoiesis,in
R10406 T14703 T14699 pobj ],after
R10407 T14704 T14692 punct .,observed
R10408 T14705 T14706 nsubj We,examined
R10409 T14851 T14848 punct ",",effects
R10410 T14706 T14706 ROOT examined,examined
R10411 T14852 T14848 prep including,effects
R10412 T14853 T14854 det a,delay
R10413 T14854 T14852 pobj delay,including
R10414 T14707 T14710 det a,sample
R10415 T14708 T14710 amod single,sample
R10416 T14855 T14854 prep in,delay
R10417 T14709 T14710 amod archived,sample
R10418 T14856 T14855 pobj enucleation/maturation,in
R10419 T14857 T14854 prep in,delay
R10420 T14710 T14706 dobj sample,examined
R10421 T14858 T14860 amod p100H,mice
R10422 T14859 T14860 amod mutant,mice
R10423 T14711 T14710 prep of,sample
R10424 T14860 T14857 pobj mice,in
R10425 T14861 T14846 punct .,has
R10426 T14862 T14864 nsubj This,be
R10427 T14712 T14713 compound liver,RNA
R10428 T14863 T14864 aux may,be
R10429 T14713 T14711 pobj RNA,of
R10430 T14864 T14864 ROOT be,be
R10431 T14865 T14866 det the,result
R10432 T14866 T14864 attr result,be
R10433 T14714 T14710 prep from,sample
R10434 T14867 T14866 prep of,result
R10435 T14868 T14869 amod indirect,effects
R10436 T14715 T14717 det a,mouse
R10437 T14869 T14867 pobj effects,of
R10438 T14870 T14869 punct ",",effects
R10439 T14716 T14717 amod mutant,mouse
R10440 T14871 T14872 amod such,as
R10441 T14872 T14869 prep as,effects
R10442 T14873 T14874 compound stress-induced,proliferation
R10443 T14717 T14714 pobj mouse,from
R10444 T14874 T14872 pobj proliferation,as
R10445 T14875 T14874 punct (,proliferation
R10446 T14876 T14874 acl resulting,proliferation
R10447 T14718 T14717 prep on,mouse
R10448 T14877 T14876 prep from,resulting
R10449 T14878 T14879 amod cardiac,defects
R10450 T14879 T14877 pobj defects,from
R10451 T14719 T14720 amod postnatal,day
R10452 T14880 T14874 punct ),proliferation
R10453 T14881 T14874 cc and/or,proliferation
R10454 T14882 T14874 conj anemia,proliferation
R10455 T14720 T14718 pobj day,on
R10456 T14883 T14864 punct .,be
R10457 T14884 T14885 amod Severe,anemia
R10458 T14721 T14720 nummod 13.5,day
R10459 T14885 T14887 nsubj anemia,lead
R10460 T14886 T14887 aux can,lead
R10461 T14887 T14887 ROOT lead,lead
R10462 T14722 T14710 prep for,sample
R10463 T14888 T14887 prep to,lead
R10464 T14889 T14891 amod rapid,release
R10465 T14890 T14891 amod premature,release
R10466 T14891 T14888 pobj release,to
R10467 T14892 T14891 prep of,release
R10468 T14893 T14894 amod red,cells
R10469 T14723 T14725 amod globin,expression
R10470 T14894 T14892 pobj cells,of
R10471 T14895 T14887 punct ",",lead
R10472 T14724 T14725 compound gene,expression
R10473 T14896 T14887 advmod prior,lead
R10474 T14897 T14896 prep to,prior
R10475 T14898 T14900 poss their,maturation
R10476 T14725 T14722 pobj expression,for
R10477 T14899 T14900 amod complete,maturation
R10478 T14900 T14897 pobj maturation,to
R10479 T14901 T14887 punct .,lead
R10480 T14726 T14706 cc and,examined
R10481 T14902 T14910 advmod However,is
R10482 T14903 T14910 punct ",",is
R10483 T14727 T14706 conj detected,examined
R10484 T14904 T14905 det the,hematocrit
R10485 T14905 T14910 nsubj hematocrit,is
R10486 T14906 T14905 prep of,hematocrit
R10487 T14728 T14729 amod high,levels
R10488 T14729 T14727 dobj levels,detected
R10489 T14730 T14729 prep of,levels
R10490 T14907 T14909 amod 18.5-dpc,mice
R10491 T14731 T14732 amod ɛy,globin
R10492 T14908 T14909 amod mutant,mice
R10493 T14909 T14906 pobj mice,of
R10494 T14910 T14910 ROOT is,is
R10495 T14732 T14730 pobj globin,of
R10496 T14911 T14912 advmod only,20
R10497 T14912 T14913 nummod 20,%
R10498 T14733 T14727 prep in,detected
R10499 T14913 T14914 npadvmod %,lower
R10500 T14914 T14910 acomp lower,is
R10501 T14915 T14914 prep than,lower
R10502 T14734 T14736 det this,sample
R10503 T14916 T14915 pobj that,than
R10504 T14917 T14916 prep of,that
R10505 T14918 T14917 pobj WT,of
R10506 T14735 T14736 compound RNA,sample
R10507 T14919 T14918 punct (,WT
R10508 T14920 T14921 amod unpublished,data
R10509 T14921 T14918 appos data,WT
R10510 T14736 T14733 pobj sample,in
R10511 T14922 T14918 punct ),WT
R10512 T14923 T14910 punct ",",is
R10513 T14737 T14727 punct ",",detected
R10514 T14924 T14910 cc and,is
R10515 T14925 T14927 det this,anemia
R10516 T14926 T14927 amod mild,anemia
R10517 T14927 T14928 nsubj anemia,is
R10518 T14928 T14910 conj is,is
R10519 T14738 T14727 prep compared,detected
R10520 T14929 T14928 advmod probably,is
R10521 T14930 T14928 neg not,is
R10522 T14931 T14928 acomp sufficient,is
R10523 T14739 T14738 prep with,compared
R10524 T14932 T14933 aux to,explain
R10525 T14933 T14931 xcomp explain,sufficient
R10526 T14740 T14742 amod undetectable,RNA
R10527 T14741 T14742 compound ɛy,RNA
R10528 T14934 T14935 det the,extent
R10529 T14742 T14739 pobj RNA,with
R10530 T14935 T14933 dobj extent,explain
R10531 T14936 T14935 prep of,extent
R10532 T14743 T14742 prep in,RNA
R10533 T14937 T14939 amod nucleated,cells
R10534 T14938 T14939 amod red,cells
R10535 T14939 T14936 pobj cells,of
R10536 T14744 T14745 compound WT,control
R10537 T14940 T14928 punct .,is
R10538 T14941 T14946 advmod Alternatively,play
R10539 T14745 T14746 compound control,mice
R10540 T14942 T14946 punct ",",play
R10541 T14943 T14946 nsubj Sox6,play
R10542 T14944 T14943 nmod itself,Sox6
R10543 T14746 T14743 pobj mice,in
R10544 T14945 T14946 aux may,play
R10545 T14747 T14706 punct .,examined
R10546 T14748 T14761 prep At,were
R10547 T14749 T14750 det this,point
R10548 T14946 T14946 ROOT play,play
R10549 T14750 T14748 pobj point,At
R10550 T14947 T14948 det a,role
R10551 T14948 T14946 dobj role,play
R10552 T14751 T14750 prep in,point
R10553 T14949 T14948 prep in,role
R10554 T14752 T14751 pobj development,in
R10555 T14753 T14761 punct ",",were
R10556 T15047 T15045 pobj marrow,to
R10557 T14950 T14952 amod red,terminal
R10558 T14951 T14952 compound cell,terminal
R10559 T14952 T14953 compound terminal,differentiation
R10560 T15048 T15047 prep by,marrow
R10561 T14953 T14949 pobj differentiation,in
R10562 T14954 T14946 punct ",",play
R10563 T14955 T14959 mark as,shown
R10564 T15049 T15050 amod postnatal,day
R10565 T14956 T14959 nsubjpass it,shown
R10566 T14957 T14959 aux has,shown
R10567 T14958 T14959 auxpass been,shown
R10568 T14959 T14946 advcl shown,play
R10569 T14960 T14961 aux to,be
R10570 T14961 T14959 xcomp be,shown
R10571 T15050 T15048 pobj day,by
R10572 T14962 T14964 det an,factor
R10573 T14963 T14964 amod important,factor
R10574 T14964 T14961 attr factor,be
R10575 T15051 T15050 nummod 10.5,day
R10576 T14965 T14964 prep in,factor
R10577 T14966 T14967 amod cardiac,[
R10578 T14967 T14969 nmod [,]
R10579 T15052 T15041 punct .,shifted
R10580 T14968 T14969 nummod 15,]
R10581 T14969 T14965 pobj ],in
R10582 T15053 T15055 det The,change
R10583 T14970 T14969 punct ",",]
R10584 T14971 T14972 compound neuronal,[
R10585 T14972 T14974 nmod [,]
R10586 T15054 T15055 amod accompanying,change
R10587 T14973 T14974 nummod 10,]
R10588 T14974 T14969 appos ],]
R10589 T14975 T14974 punct ",",]
R10590 T15055 T15064 nsubj change,permit
R10591 T14976 T14977 compound astrocytic,[
R10592 T14977 T14964 appos [,factor
R10593 T15056 T15055 prep in,change
R10594 T14978 T14979 nummod 11,]
R10595 T14979 T14964 conj ],factor
R10596 T14980 T14979 punct ",",]
R10597 T15057 T15058 det the,microenvironment
R10598 T14981 T14979 cc and,]
R10599 T14982 T14984 compound cartilage,programs
R10600 T15058 T15056 pobj microenvironment,in
R10601 T14983 T14984 compound differentiation,programs
R10602 T14984 T14979 conj programs,]
R10603 T15059 T15058 prep of,microenvironment
R10604 T14985 T14986 compound [,"32,41"
R10605 T14986 T14984 appos "32,41",programs
R10606 T14987 T14988 nummod 44,]
R10607 T14988 T14979 npadvmod ],]
R10608 T15060 T15062 amod red,production
R10609 T14989 T14946 punct .,play
R10610 T14990 T14991 det The,restoration
R10611 T14991 T15006 nsubj restoration,result
R10612 T15061 T15062 compound cell,production
R10613 T14992 T14991 prep of,restoration
R10614 T14993 T14994 amod normal,enucleation
R10615 T14994 T14992 pobj enucleation,of
R10616 T14995 T14994 prep of,enucleation
R10617 T14996 T14997 amod red,cells
R10618 T15062 T15059 pobj production,of
R10619 T14997 T14995 pobj cells,of
R10620 T14998 T14994 prep in,enucleation
R10621 T15063 T15064 aux may,permit
R10622 T14999 T15000 amod Sox6-deficient,mouse
R10623 T15000 T14998 pobj mouse,in
R10624 T15001 T14991 prep by,restoration
R10625 T15002 T15003 amod postnatal,day
R10626 T15064 T15064 ROOT permit,permit
R10627 T15003 T15001 pobj day,by
R10628 T15004 T15003 nummod 10.5,day
R10629 T15065 T15066 amod normal,enucleation
R10630 T15005 T15006 aux may,result
R10631 T15006 T15006 ROOT result,result
R10632 T15007 T15006 prep from,result
R10633 T15066 T15064 dobj enucleation,permit
R10634 T15008 T15009 amod functional,compensation
R10635 T15009 T15007 pobj compensation,from
R10636 T15010 T15009 prep of,compensation
R10637 T15011 T15013 amod other,proteins
R10638 T15067 T15064 punct .,permit
R10639 T15012 T15013 compound Sox,proteins
R10640 T15068 T15079 nsubj Identification,shed
R10641 T15013 T15010 pobj proteins,of
R10642 T15069 T15068 prep of,Identification
R10643 T15014 T15015 punct (,expressed
R10644 T15015 T15006 advcl expressed,result
R10645 T15070 T15073 amod Sox6,genes
R10646 T15016 T15015 prep at,expressed
R10647 T15017 T15019 amod later,stages
R10648 T15018 T15019 amod developmental,stages
R10649 T15071 T15073 amod downstream,genes
R10650 T15019 T15016 pobj stages,at
R10651 T15020 T15006 punct ),result
R10652 T15072 T15073 compound target,genes
R10653 T15021 T15006 punct ",",result
R10654 T15022 T15025 mark since,is
R10655 T15073 T15069 pobj genes,of
R10656 T15023 T15024 amod functional,redundancy
R10657 T15024 T15025 nsubj redundancy,is
R10658 T15025 T15006 advcl is,result
R10659 T15026 T15028 det a,theme
R10660 T15074 T15073 cc and,genes
R10661 T15027 T15028 amod recurring,theme
R10662 T15028 T15025 attr theme,is
R10663 T15075 T15077 poss its,proteins
R10664 T15029 T15028 prep with,theme
R10665 T15030 T15031 compound Sox,proteins
R10666 T15031 T15029 pobj proteins,with
R10667 T15032 T15034 compound [,]
R10668 T15033 T15034 compound "13,45,46",]
R10669 T15034 T15031 appos ],proteins
R10670 T15076 T15077 amod interacting,proteins
R10671 T15035 T15006 punct .,result
R10672 T15036 T15041 advmod Moreover,shifted
R10673 T15077 T15073 conj proteins,genes
R10674 T15037 T15041 punct ",",shifted
R10675 T15038 T15041 nsubj erythropoiesis,shifted
R10676 T15039 T15041 aux has,shifted
R10677 T15078 T15079 aux will,shed
R10678 T15040 T15041 advmod already,shifted
R10679 T15041 T15041 ROOT shifted,shifted
R10680 T15042 T15041 prep from,shifted
R10681 T15079 T15079 ROOT shed,shed
R10682 T15043 T15044 amod fetal,liver
R10683 T15044 T15042 pobj liver,from
R10684 T15045 T15041 prep to,shifted
R10685 T15080 T15079 dobj light,shed
R10686 T15046 T15047 compound bone,marrow
R10687 T15081 T15079 prep on,shed
R10688 T15082 T15083 det the,role
R10689 T15083 T15081 pobj role,on
R10690 T15084 T15083 prep of,role
R10691 T15101 T15098 conj in,in
R10692 T15102 T15103 amod vitro,analyses
R10693 T15085 T15084 pobj Sox6,of
R10694 T15103 T15101 pobj analyses,in
R10695 T15104 T15104 ROOT suggest,suggest
R10696 T15105 T15111 mark that,be
R10697 T15086 T15083 prep in,role
R10698 T15106 T15111 nsubj reactivation,be
R10699 T15107 T15106 prep of,reactivation
R10700 T15087 T15089 amod red,terminal
R10701 T15108 T15109 amod human,ɛ-globin
R10702 T15109 T15107 pobj ɛ-globin,of
R10703 T15088 T15089 compound cell,terminal
R10704 T15110 T15111 aux would,be
R10705 T15111 T15104 ccomp be,suggest
R10706 T15112 T15113 advmod therapeutically,beneficial
R10707 T15089 T15090 compound terminal,differentiation
R10708 T15113 T15111 acomp beneficial,be
R10709 T15114 T15113 prep to,beneficial
R10710 T15115 T15114 pobj adults,to
R10711 T15090 T15086 pobj differentiation,in
R10712 T15116 T15115 prep with,adults
R10713 T15117 T15119 amod sickle,disease
R10714 T15118 T15119 compound cell,disease
R10715 T15091 T15090 cc and,differentiation
R10716 T15119 T15116 pobj disease,with
R10717 T15120 T15122 nmod [,]
R10718 T15121 T15122 nummod 47,]
R10719 T15122 T15115 appos ],adults
R10720 T15123 T15111 punct ",",be
R10721 T15124 T15111 advcl providing,be
R10722 T15092 T15094 det the,process
R10723 T15125 T15126 det a,rationale
R10724 T15126 T15124 dobj rationale,providing
R10725 T15127 T15126 prep for,rationale
R10726 T15128 T15129 amod detailed,investigations
R10727 T15093 T15094 compound enucleation,process
R10728 T15129 T15127 pobj investigations,for
R10729 T15130 T15129 prep into,investigations
R10730 T15131 T15133 det the,basis
R10731 T15094 T15090 conj process,differentiation
R10732 T15132 T15133 amod molecular,basis
R10733 T15133 T15130 pobj basis,into
R10734 T15134 T15133 prep of,basis
R10735 T15095 T15079 punct .,shed
R10736 T15135 T15136 compound ɛ-globin,gene
R10737 T15136 T15137 compound gene,silencing
R10738 T15137 T15134 pobj silencing,of
R10739 T15096 T15104 advmod Recently,suggest
R10740 T15138 T15104 punct .,suggest
R10741 T15139 T15141 det The,study
R10742 T15140 T15141 amod present,study
R10743 T15097 T15104 punct ",",suggest
R10744 T15141 T15142 nsubj study,identifies
R10745 T15142 T15142 ROOT identifies,identifies
R10746 T15098 T15104 prep in,suggest
R10747 T15143 T15145 det a,repressor
R10748 T15144 T15145 compound novel,repressor
R10749 T15099 T15098 pobj vivo,in
R10750 T15145 T15142 dobj repressor,identifies
R10751 T15146 T15145 punct ",",repressor
R10752 T15100 T15098 cc and,in
R10753 T15244 T15244 ROOT proposed,proposed
R10754 T15245 T15247 compound [,]
R10755 T15147 T15145 appos Sox6,repressor
R10756 T15246 T15247 compound "49,50",]
R10757 T15148 T15145 punct ",",repressor
R10758 T15149 T15150 nsubj which,binds
R10759 T15247 T15244 dobj ],proposed
R10760 T15150 T15145 relcl binds,repressor
R10761 T15151 T15150 prep to,binds
R10762 T15248 T15244 punct .,proposed
R10763 T15152 T15155 det the,promoter
R10764 T15153 T15155 amod ɛy,promoter
R10765 T15154 T15155 amod proximal,promoter
R10766 T15155 T15151 pobj promoter,to
R10767 T15156 T15145 punct ",",repressor
R10768 T15157 T15142 advmod potentially,identifies
R10769 T15249 T15276 advmod Thus,reveal
R10770 T15158 T15142 prep as,identifies
R10771 T15159 T15158 pobj part,as
R10772 T15160 T15159 prep of,part
R10773 T15161 T15164 det a,complex
R10774 T15250 T15276 punct ",",reveal
R10775 T15162 T15164 amod larger,complex
R10776 T15163 T15164 compound repression,complex
R10777 T15164 T15160 pobj complex,of
R10778 T15251 T15276 nsubj elucidation,reveal
R10779 T15165 T15142 punct .,identifies
R10780 T15166 T15173 mark Because,are
R10781 T15252 T15251 prep of,elucidation
R10782 T15167 T15168 compound murine,Sox6
R10783 T15168 T15173 nsubj Sox6,are
R10784 T15169 T15168 cc and,Sox6
R10785 T15253 T15256 det the,mechanism
R10786 T15170 T15172 poss its,counterpart
R10787 T15254 T15256 amod Sox6,mechanism
R10788 T15255 T15256 compound repression,mechanism
R10789 T15171 T15172 amod human,counterpart
R10790 T15172 T15168 conj counterpart,Sox6
R10791 T15256 T15252 pobj mechanism,of
R10792 T15173 T15187 advcl are,is
R10793 T15174 T15175 nummod 94,%
R10794 T15175 T15176 npadvmod %,identical
R10795 T15257 T15256 cc and,mechanism
R10796 T15176 T15173 acomp identical,are
R10797 T15177 T15176 prep at,identical
R10798 T15178 T15181 det the,level
R10799 T15258 T15256 conj identification,mechanism
R10800 T15179 T15181 amod amino,level
R10801 T15180 T15181 compound acid,level
R10802 T15259 T15258 prep of,identification
R10803 T15181 T15177 pobj level,at
R10804 T15182 T15184 nmod [,]
R10805 T15260 T15261 amod other,components
R10806 T15183 T15184 nummod 48,]
R10807 T15184 T15181 appos ],level
R10808 T15185 T15187 punct ",",is
R10809 T15186 T15187 nsubj it,is
R10810 T15261 T15259 pobj components,of
R10811 T15187 T15187 ROOT is,is
R10812 T15188 T15187 acomp possible,is
R10813 T15189 T15194 mark that,be
R10814 T15262 T15261 prep of,components
R10815 T15190 T15191 compound human,Sox6
R10816 T15191 T15194 nsubj Sox6,be
R10817 T15192 T15194 aux may,be
R10818 T15193 T15194 advmod also,be
R10819 T15194 T15187 ccomp be,is
R10820 T15263 T15265 det the,complex
R10821 T15195 T15194 acomp important,be
R10822 T15196 T15194 prep in,be
R10823 T15197 T15198 amod human,ɛ
R10824 T15264 T15265 compound Sox6-containing,complex
R10825 T15198 T15199 compound ɛ,globin
R10826 T15199 T15200 compound globin,silencing
R10827 T15200 T15196 pobj silencing,in
R10828 T15265 T15262 pobj complex,of
R10829 T15201 T15187 punct .,is
R10830 T15202 T15203 expl There,is
R10831 T15203 T15203 ROOT is,is
R10832 T15266 T15267 aux may,further
R10833 T15204 T15206 amod significant,homology
R10834 T15267 T15269 advmod further,understanding
R10835 T15205 T15206 compound sequence,homology
R10836 T15206 T15203 attr homology,is
R10837 T15207 T15206 prep between,homology
R10838 T15208 T15214 det the,regions
R10839 T15268 T15269 poss our,understanding
R10840 T15209 T15214 amod human,regions
R10841 T15210 T15209 cc and,human
R10842 T15269 T15256 appos understanding,mechanism
R10843 T15211 T15209 conj mouse,human
R10844 T15212 T15214 compound ɛ,regions
R10845 T15213 T15214 compound promoter,regions
R10846 T15214 T15207 pobj regions,between
R10847 T15270 T15269 prep of,understanding
R10848 T15215 T15203 punct ",",is
R10849 T15216 T15203 cc and,is
R10850 T15271 T15273 compound ɛ,regulation
R10851 T15217 T15219 det the,promoter
R10852 T15218 T15219 amod human,promoter
R10853 T15219 T15220 nsubj promoter,contains
R10854 T15272 T15273 compound globin,regulation
R10855 T15220 T15203 conj contains,is
R10856 T15221 T15222 advmod at,least
R10857 T15222 T15223 advmod least,two
R10858 T15273 T15270 pobj regulation,of
R10859 T15223 T15227 nummod two,sites
R10860 T15224 T15227 amod potential,sites
R10861 T15274 T15269 cc and,understanding
R10862 T15225 T15227 amod Sox6,sites
R10863 T15226 T15227 amod binding,sites
R10864 T15227 T15220 dobj sites,contains
R10865 T15275 T15276 advmod potentially,reveal
R10866 T15228 T15220 punct .,contains
R10867 T15229 T15244 advmod Indeed,proposed
R10868 T15230 T15244 punct ",",proposed
R10869 T15231 T15232 det the,existence
R10870 T15232 T15244 nsubjpass existence,proposed
R10871 T15233 T15232 prep of,existence
R10872 T15276 T15276 ROOT reveal,reveal
R10873 T15234 T15235 det a,silencer
R10874 T15235 T15233 pobj silencer,of
R10875 T15236 T15235 prep of,silencer
R10876 T15237 T15241 det the,gene
R10877 T15277 T15279 amod additional,targets
R10878 T15238 T15239 amod human,ɛ
R10879 T15239 T15241 compound ɛ,gene
R10880 T15278 T15279 amod molecular,targets
R10881 T15240 T15241 compound globin,gene
R10882 T15241 T15236 pobj gene,of
R10883 T15242 T15244 aux has,proposed
R10884 T15279 T15276 dobj targets,reveal
R10885 T15243 T15244 auxpass been,proposed
R10886 T15280 T15279 prep for,targets
R10887 T15281 T15282 det the,treatment
R10888 T15282 T15280 pobj treatment,for
R10889 T15283 T15282 prep of,treatment
R10890 T15284 T15285 compound sickle,cell
R10891 T15285 T15286 compound cell,anemia
R10892 T15286 T15283 pobj anemia,of
R10893 T15287 T15286 cc and,anemia
R10894 T15288 T15289 compound β,thalassemias
R10895 T15289 T15286 conj thalassemias,anemia
R10897 T15290 T15276 punct .,reveal
R11478 T16562 T16563 amod Plasmid,construction
R11479 T16563 T16563 ROOT construction,construction
R11480 T16564 T16563 punct .,construction
R11481 T16565 T16570 det The,plasmid
R11482 T16566 T16567 amod ɛy,promoter
R11483 T16567 T16570 compound promoter,plasmid
R11484 T16568 T16570 compound deletion,plasmid
R11485 T16569 T16570 compound reporter,plasmid
R11486 T16570 T16575 nsubjpass plasmid,generated
R11487 T16571 T16570 punct (,plasmid
R11488 T16572 T16570 appos E-luc,plasmid
R11489 T16573 T16570 punct ),plasmid
R11490 T16574 T16575 auxpass was,generated
R11491 T16575 T16575 ROOT generated,generated
R11492 T16576 T16575 agent by,generated
R11493 T16577 T16578 compound PCR,amplification
R11494 T16578 T16576 pobj amplification,by
R11495 T16579 T16578 prep of,amplification
R11496 T16580 T16583 det the,promoter
R11497 T16581 T16583 amod ɛy,promoter
R11498 T16582 T16583 amod proximal,promoter
R11499 T16583 T16579 pobj promoter,of
R11500 T16584 T16575 punct .,generated
R11501 T16585 T16587 det A,fragment
R11502 T16586 T16587 compound 2.2-kb,fragment
R11503 T16587 T16588 compound fragment,upstream
R11504 T16588 T16599 nsubjpass upstream,used
R11505 T16589 T16588 prep of,upstream
R11506 T16590 T16593 det the,initiation
R11507 T16591 T16593 amod ɛy,initiation
R11508 T16592 T16593 compound globin,initiation
R11509 T16593 T16594 compound initiation,codon
R11510 T16594 T16589 pobj codon,of
R11511 T16595 T16596 punct (,ATG
R11512 T16596 T16594 appos ATG,codon
R11513 T16597 T16594 punct ),codon
R11514 T16598 T16599 auxpass was,used
R11515 T16599 T16599 ROOT used,used
R11516 T16600 T16599 punct ",",used
R11517 T16601 T16605 mark because,shown
R11518 T16602 T16605 nsubjpass it,shown
R11519 T16603 T16605 aux has,shown
R11520 T16604 T16605 auxpass been,shown
R11521 T16605 T16599 advcl shown,used
R11522 T16606 T16615 mark that,located
R11523 T16607 T16608 det all,sequences
R11524 T16608 T16615 nsubjpass sequences,located
R11525 T16609 T16608 acl required,sequences
R11526 T16610 T16609 prep for,required
R11527 T16611 T16612 compound ɛ,gene
R11528 T16612 T16610 pobj gene,for
R11529 T16613 T16612 acl silencing,gene
R11530 T16614 T16615 auxpass are,located
R11531 T16615 T16605 ccomp located,shown
R11532 T16616 T16615 prep within,located
R11533 T16617 T16620 det a,fragment
R11534 T16618 T16620 compound 3.7-kb,fragment
R11535 T16619 T16620 compound EcoRI,fragment
R11536 T16620 T16616 pobj fragment,within
R11537 T16621 T16620 acl containing,fragment
R11538 T16622 T16624 quantmod about,kb
R11539 T16623 T16624 nummod 2,kb
R11540 T16624 T16621 dobj kb,containing
R11541 T16625 T16624 prep of,kb
R11542 T16626 T16625 pobj sequence,of
R11543 T16627 T16621 advmod upstream,containing
R11544 T16628 T16627 prep of,upstream
R11545 T16629 T16634 det the,site
R11546 T16630 T16634 nmod ɛ,site
R11547 T16631 T16634 compound globin,site
R11548 T16632 T16633 compound gene,cap
R11549 T16633 T16634 compound cap,site
R11550 T16634 T16628 pobj site,of
R11551 T16635 T16634 appos [,site
R11552 T16636 T16637 nummod 50,]
R11553 T16637 T16634 appos ],site
R11554 T16638 T16599 punct .,used
R11555 T16639 T16640 compound Nucleotide,numbering
R11556 T16640 T16641 nsubj numbering,is
R11557 T16641 T16641 ROOT is,is
R11558 T16642 T16641 acomp relative,is
R11559 T16643 T16642 prep to,relative
R11560 T16644 T16645 det the,transcription
R11561 T16645 T16646 nsubj transcription,start
R11562 T16646 T16641 conj start,is
R11563 T16647 T16646 dobj site,start
R11564 T16648 T16641 punct .,is
R11565 T16649 T16652 det The,site
R11566 T16650 T16652 amod transcriptional,site
R11567 T16651 T16652 compound start,site
R11568 T16652 T16654 nsubjpass site,based
R11569 T16653 T16654 auxpass is,based
R11570 T16654 T16654 ROOT based,based
R11571 T16655 T16654 prep on,based
R11572 T16656 T16658 det the,cDNA
R11573 T16657 T16658 amod longest,cDNA
R11574 T16658 T16655 pobj cDNA,on
R11575 T16659 T16658 prep in,cDNA
R11576 T16660 T16661 det the,Fantom
R11577 T16661 T16659 pobj Fantom,in
R11578 T16662 T16661 punct (,Fantom
R11579 T16663 T16664 compound Functional,Annotation
R11580 T16664 T16661 appos Annotation,Fantom
R11581 T16665 T16664 prep of,Annotation
R11582 T16666 T16665 pobj Mouse,of
R11583 T16667 T16661 punct ),Fantom
R11584 T16668 T16658 conj database,cDNA
R11585 T16669 T16654 punct .,based
R11586 T16670 T16672 det The,primers
R11587 T16671 T16672 compound PCR,primers
R11588 T16672 T16673 nsubj primers,contained
R11589 T16673 T16673 ROOT contained,contained
R11590 T16674 T16677 nmod XhoI,sites
R11591 T16675 T16674 cc and,XhoI
R11592 T16676 T16674 conj HindIII,XhoI
R11593 T16677 T16673 dobj sites,contained
R11594 T16678 T16680 nsubjpass that,used
R11595 T16679 T16680 auxpass were,used
R11596 T16680 T16677 relcl used,sites
R11597 T16681 T16682 aux to,clone
R11598 T16682 T16680 xcomp clone,used
R11599 T16683 T16686 det the,fragment
R11600 T16684 T16686 amod ɛy,fragment
R11601 T16685 T16686 compound promoter,fragment
R11602 T16686 T16682 dobj fragment,clone
R11603 T16687 T16682 advmod upstream,clone
R11604 T16688 T16687 prep of,upstream
R11605 T16689 T16692 det the,gene
R11606 T16690 T16692 amod firefly,gene
R11607 T16691 T16692 compound luciferase,gene
R11608 T16692 T16688 pobj gene,of
R11609 T16693 T16692 prep in,gene
R11610 T16694 T16695 compound pGL3,Basic
R11611 T16695 T16693 pobj Basic,in
R11612 T16696 T16699 punct (,Madison
R11613 T16697 T16699 nmod Promega,Madison
R11614 T16698 T16697 punct ",",Promega
R11615 T16699 T16692 appos Madison,gene
R11616 T16700 T16699 punct ",",Madison
R11617 T16701 T16699 npadvmod Wisconsin,Madison
R11618 T16702 T16701 punct ",",Wisconsin
R11619 T16703 T16704 compound United,States
R11620 T16704 T16701 appos States,Wisconsin
R11621 T16705 T16699 punct ),Madison
R11622 T16706 T16673 punct .,contained
R11623 T16707 T16710 det A,fragment
R11624 T16708 T16710 amod 2.5-kb,fragment
R11625 T16709 T16710 compound SstI/XhoI,fragment
R11626 T16710 T16724 nsubjpass fragment,inserted
R11627 T16711 T16710 prep of,fragment
R11628 T16712 T16713 quantmod μLCRβ,9.3
R11629 T16713 T16711 pobj 9.3,of
R11630 T16714 T16724 punct (,inserted
R11631 T16715 T16716 compound micro,LCR
R11632 T16716 T16724 nsubjpass LCR,inserted
R11633 T16717 T16720 punct ;,]
R11634 T16718 T16720 compound [,]
R11635 T16719 T16720 nummod 31,]
R11636 T16720 T16716 appos ],LCR
R11637 T16721 T16720 punct ),]
R11638 T16722 T16724 auxpass was,inserted
R11639 T16723 T16724 advmod then,inserted
R11640 T16724 T16724 ROOT inserted,inserted
R11641 T16725 T16724 advmod upstream,inserted
R11642 T16726 T16725 prep of,upstream
R11643 T16727 T16729 det the,promoter
R11644 T16728 T16729 amod ɛy,promoter
R11645 T16729 T16726 pobj promoter,of
R11646 T16730 T16729 prep in,promoter
R11647 T16731 T16735 det the,plasmid
R11648 T16732 T16735 amod above,plasmid
R11649 T16733 T16735 amod pGL3,plasmid
R11650 T16734 T16735 amod Basic,plasmid
R11651 T16735 T16730 pobj plasmid,in
R11652 T16736 T16724 punct ",",inserted
R11653 T16737 T16724 advcl resulting,inserted
R11654 T16738 T16737 prep in,resulting
R11655 T16739 T16740 det a,reporter
R11656 T16740 T16738 pobj reporter,in
R11657 T16741 T16724 punct construct,inserted
R11658 T16742 T16747 prep in,driven
R11659 T16743 T16742 pobj which,in
R11660 T16744 T16745 amod luciferase,expression
R11661 T16745 T16747 nsubjpass expression,driven
R11662 T16746 T16747 auxpass is,driven
R11663 T16747 T16724 advcl driven,inserted
R11664 T16748 T16747 agent by,driven
R11665 T16749 T16751 det the,promoter
R11666 T16750 T16751 amod ɛy,promoter
R11667 T16751 T16748 pobj promoter,by
R11668 T16752 T16724 punct .,inserted
R11669 T16753 T16754 det A,series
R11670 T16754 T16763 nsubjpass series,generated
R11671 T16755 T16754 prep of,series
R11672 T16756 T16757 compound deletion,constructs
R11673 T16757 T16755 pobj constructs,of
R11674 T16758 T16757 prep of,constructs
R11675 T16759 T16761 det the,promoter
R11676 T16760 T16761 amod ɛy,promoter
R11677 T16761 T16758 pobj promoter,of
R11678 T16762 T16763 auxpass were,generated
R11679 T16763 T16763 ROOT generated,generated
R11680 T16764 T16763 advmod similarly,generated
R11681 T16765 T16763 punct .,generated
R11682 T16766 T16767 amod Forward,primers
R11683 T16767 T16772 nsubj primers,include
R11684 T16768 T16767 prep with,primers
R11685 T16769 T16771 det an,site
R11686 T16770 T16771 compound XhoI,site
R11687 T16771 T16768 pobj site,with
R11688 T16772 T16772 ROOT include,include
R11689 T16773 T16772 punct :,include
R11690 T16774 T16772 dobj MHB1457,include
R11691 T16775 T16774 punct ",",MHB1457
R11692 T16776 T16779 nummod 5,′
R11693 T16777 T16778 quantmod ′,CCGCTCGAGTGCTAGGCAAACACTCA3
R11694 T16778 T16779 nummod CCGCTCGAGTGCTAGGCAAACACTCA3,′
R11695 T16779 T16774 appos ′,MHB1457
R11696 T16780 T16779 punct (,′
R11697 T16781 T16779 nmod −,′
R11698 T16782 T16781 pobj 2077,−
R11699 T16783 T16779 prep to,′
R11700 T16784 T16783 pobj −,to
R11701 T16785 T16784 appos 2052,−
R11702 T16786 T16784 punct ),−
R11703 T16787 T16783 punct ;,to
R11704 T16788 T16783 pobj MHB1503,to
R11705 T16789 T16788 punct ",",MHB1503
R11706 T16790 T16791 nummod 5,′
R11707 T16791 T16788 appos ′,MHB1503
R11708 T16792 T16793 nummod CCGCTCGAGTCTCTACACTGTCACTCCCTG3,′
R11709 T16793 T16791 appos ′,′
R11710 T16794 T16795 punct (,−
R11711 T16795 T16793 appos −,′
R11712 T16796 T16795 nummod 634,−
R11713 T16797 T16796 prep to,634
R11714 T16798 T16797 pobj −,to
R11715 T16799 T16798 appos 605,−
R11716 T16800 T16798 punct ),−
R11717 T16801 T16802 punct ;,MHB1505
R11718 T16802 T16793 appos MHB1505,′
R11719 T16803 T16802 punct ",",MHB1505
R11720 T16804 T16805 nummod 5,′
R11721 T16805 T16807 dep ′,′
R11722 T16806 T16807 nummod CCGCTCGAGGGAGCCAAAAAAAGAATGC3,′
R11723 T16807 T16802 appos ′,MHB1505
R11724 T16808 T16809 punct (,−
R11725 T16809 T16816 nmod −,MHB1506
R11726 T16810 T16809 nummod 197,−
R11727 T16811 T16815 quantmod to,;
R11728 T16812 T16811 pobj −,to
R11729 T16813 T16812 appos 169,−
R11730 T16814 T16812 punct ),−
R11731 T16815 T16816 punct ;,MHB1506
R11732 T16816 T16830 nmod MHB1506,MHB1532
R11733 T16817 T16816 punct ",",MHB1506
R11734 T16818 T16819 nummod 5,′
R11735 T16819 T16830 nmod ′,MHB1532
R11736 T16820 T16821 nummod CCGCTCGAGCTGACCAATGGCTTCAAAG3,′
R11737 T16821 T16819 appos ′,′
R11738 T16822 T16823 punct (,−
R11739 T16823 T16821 appos −,′
R11740 T16824 T16823 nummod 85,−
R11741 T16825 T16824 prep to,85
R11742 T16826 T16825 pobj −,to
R11743 T16827 T16826 appos 58,−
R11744 T16828 T16826 punct ),−
R11745 T16829 T16830 punct ;,MHB1532
R11746 T16830 T16807 appos MHB1532,′
R11747 T16831 T16830 punct ",",MHB1532
R11748 T16832 T16833 nummod 5,′
R11749 T16833 T16835 dep ′,′
R11750 T16834 T16835 nummod CCGCTCGAGAATGCAGAACAAAGGGTCAGA3,′
R11751 T16835 T16830 appos ′,MHB1532
R11752 T16836 T16837 punct (,−
R11753 T16837 T16835 appos −,′
R11754 T16838 T16837 nummod 63,−
R11755 T16839 T16838 prep to,63
R11756 T16840 T16839 pobj −,to
R11757 T16841 T16840 appos 34,−
R11758 T16842 T16840 punct ),−
R11759 T16843 T16837 punct ;,−
R11760 T16844 T16837 cc and,−
R11761 T16845 T16835 appos MHB1507,′
R11762 T16846 T16845 punct ",",MHB1507
R11763 T16847 T16848 nummod 5,′
R11764 T16848 T16849 compound ′,CCGCTCGAGGTCTGCGAAGAATAAAAGGC
R11765 T16849 T16851 quantmod CCGCTCGAGGTCTGCGAAGAATAAAAGGC,′
R11766 T16850 T16851 nummod 3,′
R11767 T16851 T16835 appos ′,′
R11768 T16852 T16853 punct (,−
R11769 T16853 T16851 appos −,′
R11770 T16854 T16853 dobj 37,−
R11771 T16855 T16853 prep to,−
R11772 T16856 T16855 pobj −,to
R11773 T16857 T16856 appos 9,−
R11774 T16858 T16856 punct ),−
R11775 T16859 T16772 punct .,include
R11776 T16860 T16862 det All,primers
R11777 T16861 T16862 amod forward,primers
R11778 T16862 T16864 nsubjpass primers,used
R11779 T16863 T16864 auxpass were,used
R11780 T16864 T16864 ROOT used,used
R11781 T16865 T16864 prep in,used
R11782 T16866 T16865 pobj combination,in
R11783 T16867 T16864 prep with,used
R11784 T16868 T16872 det the,site
R11785 T16869 T16870 compound reverse,primer
R11786 T16870 T16872 compound primer,site
R11787 T16871 T16872 compound HindIII,site
R11788 T16872 T16867 pobj site,with
R11789 T16873 T16872 punct :,site
R11790 T16874 T16872 appos MHB1477,site
R11791 T16875 T16874 punct ",",MHB1477
R11792 T16876 T16877 nummod 5,′
R11793 T16877 T16874 appos ′,MHB1477
R11794 T16878 T16879 nummod CGGAAGCTTGGGAGGTTGCTGGTGA3,′
R11795 T16879 T16877 appos ′,′
R11796 T16880 T16881 punct (,+45
R11797 T16881 T16879 appos +45,′
R11798 T16882 T16881 prep to,+45
R11799 T16883 T16882 pobj +20,to
R11800 T16884 T16881 punct ),+45
R11801 T16885 T16864 punct .,used
R11802 T16886 T16890 amod Sox6-pcDNA3,]
R11803 T16887 T16890 nummod .1,]
R11804 T16888 T16890 nmod [,]
R11805 T16889 T16890 nummod 15,]
R11806 T16890 T16892 nsubjpass ],used
R11807 T16891 T16892 auxpass was,used
R11808 T16892 T16892 ROOT used,used
R11809 T16893 T16894 aux to,overexpress
R11810 T16894 T16892 xcomp overexpress,used
R11811 T16895 T16894 dobj Sox6,overexpress
R11812 T16896 T16892 punct .,used
R11813 T16897 T16899 det A,version
R11877 T16961 T16960 nummod 63,−
R11878 T16962 T16961 prep to,63
R11879 T16963 T16962 pobj −,to
R11880 T16964 T16963 appos 19,−
R11881 T16965 T16963 punct ),−
R11882 T16966 T16967 punct ;,MHB1662
R11883 T16967 T16951 dobj MHB1662,include
R11884 T16968 T16967 punct ",",MHB1662
R11885 T16969 T16970 nummod 5,′
R11886 T16970 T16986 nmod ′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA
R11887 T16971 T16972 nummod CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3,′
R11888 T16972 T16970 appos ′,′
R11889 T16973 T16974 punct (,−
R11890 T16974 T16972 appos −,′
R11891 T16975 T16974 nummod 63,−
R11892 T16976 T16975 prep to,63
R11893 T16977 T16976 pobj −,to
R11894 T16978 T16977 appos 16,−
R11895 T16979 T16977 punct ),−
R11896 T16980 T16970 punct ;,′
R11897 T16981 T16970 cc and,′
R11898 T16982 T16970 conj MHB1663,′
R11899 T16983 T16982 punct ",",MHB1663
R11900 T16984 T16985 nummod 5,′
R11901 T16985 T16986 compound ′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA
R11902 T16986 T16967 conj CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA,MHB1662
R11903 T16987 T16988 nummod 3,′
R11904 T16988 T16986 appos ′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA
R11905 T16989 T16990 punct (,−
R11906 T16990 T16988 appos −,′
R11907 T16991 T16990 nummod 63,−
R11908 T16992 T16990 prep to,−
R11909 T16993 T16992 pobj −,to
R11910 T16994 T16993 appos 18,−
R11911 T16995 T16993 punct ),−
R11912 T16996 T16951 punct .,include
R12137 T17438 T17438 ROOT Quantitation,Quantitation
R12138 T17439 T17438 prep of,Quantitation
R12139 T17440 T17441 compound globin,mRNA
R12140 T17441 T17439 pobj mRNA,of
R12141 T17442 T17438 punct .,Quantitation
R12142 T17443 T17444 nsubj RNA,was
R12143 T17444 T17444 ROOT was,was
R12144 T17445 T17446 amod first,reverse
R12145 T17446 T17447 advmod reverse,transcribed
R12146 T17447 T17444 acomp transcribed,was
R12147 T17448 T17447 prep to,transcribed
R12148 T17449 T17448 pobj cDNA,to
R12149 T17450 T17444 punct .,was
R12150 T17451 T17460 nsubjpass Primers,obtained
R12151 T17452 T17451 prep for,Primers
R12152 T17453 T17455 compound cDNA,amplification
R12153 T17454 T17455 compound PCR,amplification
R12154 T17455 T17452 pobj amplification,for
R12155 T17456 T17455 prep of,amplification
R12156 T17457 T17458 compound globin,genes
R12157 T17458 T17456 pobj genes,of
R12158 T17459 T17460 auxpass were,obtained
R12159 T17460 T17460 ROOT obtained,obtained
R12160 T17461 T17460 prep from,obtained
R12161 T17462 T17463 compound Primerbank,[
R12162 T17463 T17461 pobj [,from
R12163 T17464 T17465 nummod 51,]
R12164 T17465 T17463 appos ],[
R12165 T17466 T17460 punct .,obtained
R12166 T17467 T17468 det All,primers
R12167 T17468 T17470 nsubjpass primers,searched
R12168 T17469 T17470 auxpass were,searched
R12169 T17470 T17470 ROOT searched,searched
R12170 T17471 T17470 prep against,searched
R12171 T17472 T17474 det the,database
R12172 T17473 T17474 compound NCBI,database
R12173 T17474 T17471 pobj database,against
R12174 T17475 T17476 aux to,confirm
R12175 T17476 T17470 advcl confirm,searched
R12176 T17477 T17476 dobj specificity,confirm
R12177 T17478 T17470 punct .,searched
R12178 T17479 T17479 ROOT For,For
R12179 T17480 T17481 amod ɛy,globin
R12180 T17481 T17479 pobj globin,For
R12181 T17482 T17481 punct :,globin
R12182 T17483 T17496 nmod MHB1666,′
R12183 T17484 T17483 punct ",",MHB1666
R12184 T17485 T17483 nummod 5,MHB1666
R12185 T17486 T17483 nummod ′,MHB1666
R12186 T17487 T17488 nummod TGGCCTGTGGAGTAAGGTCAA3,′
R12187 T17488 T17488 ROOT ′,′
R12188 T17489 T17483 punct ;,MHB1666
R12189 T17490 T17483 cc and,MHB1666
R12190 T17491 T17483 conj MHB1667,MHB1666
R12191 T17492 T17491 punct ",",MHB1667
R12192 T17493 T17496 nummod 5,′
R12193 T17494 T17496 nummod ′,′
R12194 T17495 T17496 compound GAAGCAGAGGACAAGTTCCCA3,′
R12195 T17496 T17481 appos ′,globin
R12196 T17497 T17479 punct .,For
R12197 T17498 T17498 ROOT For,For
R12198 T17499 T17500 amod ζ,globin
R12199 T17500 T17498 pobj globin,For
R12200 T17501 T17500 punct :,globin
R12201 T17502 T17515 nummod MHB1668,′
R12202 T17503 T17507 punct ",",′
R12203 T17504 T17507 nummod 5,′
R12204 T17505 T17507 nmod ′,′
R12205 T17506 T17507 nummod CTACCCCCAGACGAAGACCTA3,′
R12206 T17507 T17502 meta ′,MHB1668
R12207 T17508 T17502 punct ;,MHB1668
R12208 T17509 T17502 cc and,MHB1668
R12209 T17510 T17515 nmod MHB1669,′
R12210 T17511 T17510 punct ",",MHB1669
R12211 T17512 T17513 nummod 5,′
R12212 T17513 T17515 nmod ′,′
R12213 T17514 T17515 nummod CTTAACCGCATCCCCTACGG3,′
R12214 T17515 T17500 appos ′,globin
R12215 T17516 T17498 punct .,For
R12216 T17517 T17517 ROOT For,For
R12217 T17518 T17519 amod βH1,globin
R12218 T17519 T17517 pobj globin,For
R12219 T17520 T17519 punct :,globin
R12220 T17521 T17534 nmod MHB1672,′
R12221 T17522 T17521 punct ",",MHB1672
R12222 T17523 T17521 nummod 5,MHB1672
R12223 T17524 T17521 nummod ′,MHB1672
R12224 T17525 T17526 nummod TGGACAACCTCAAGGAGACC3,′
R12225 T17526 T17526 ROOT ′,′
R12226 T17527 T17521 punct ;,MHB1672
R12227 T17528 T17521 cc and,MHB1672
R12228 T17529 T17521 conj MHB1673,MHB1672
R12229 T17530 T17529 punct ",",MHB1673
R12230 T17531 T17534 nummod 5,′
R12231 T17532 T17534 nummod ′,′
R12232 T17533 T17534 compound ACCTCTGGGGTGAATTCCTT3,′
R12233 T17534 T17519 appos ′,globin
R12234 T17535 T17517 punct .,For
R12235 T17536 T17536 ROOT For,For
R12236 T17537 T17540 amod βmaj,globin
R12237 T17538 T17540 compound /,globin
R12238 T17539 T17540 compound min,globin
R12239 T17540 T17536 pobj globin,For
R12240 T17541 T17540 punct :,globin
R12241 T17542 T17555 nmod MHB1674,′
R12242 T17543 T17542 punct :,MHB1674
R12243 T17544 T17547 nummod 5,′
R12244 T17545 T17547 nummod ′,′
R12245 T17546 T17547 compound ATGGCCTGAATCACTTGGAC3,′
R12246 T17547 T17542 appos ′,MHB1674
R12247 T17548 T17542 punct ;,MHB1674
R12248 T17549 T17542 cc and,MHB1674
R12249 T17550 T17542 conj MHB1675,MHB1674
R12250 T17551 T17550 punct ",",MHB1675
R12251 T17552 T17555 nummod 5,′
R12252 T17553 T17555 nummod ′,′
R12253 T17554 T17555 compound ACGATCATATTGCCCAGGAG3,′
R12254 T17555 T17540 appos ′,globin
R12255 T17556 T17536 punct .,For
R12256 T17557 T17579 advcl Using,run
R12257 T17558 T17562 det the,kit
R12258 T17559 T17562 nmod SYBR,kit
R12259 T17560 T17562 amod green,kit
R12260 T17561 T17562 compound supermix,kit
R12261 T17562 T17557 dobj kit,Using
R12262 T17563 T17557 prep with,Using
R12263 T17564 T17563 pobj ROX,with
R12264 T17565 T17566 punct (,Bio-Rad
R12265 T17566 T17564 appos Bio-Rad,ROX
R12266 T17567 T17566 punct ",",Bio-Rad
R12267 T17568 T17566 conj Hercules,Bio-Rad
R12268 T17569 T17568 punct ",",Hercules
R12269 T17570 T17568 conj California,Hercules
R12270 T17571 T17570 punct ",",California
R12271 T17572 T17573 compound United,States
R12272 T17573 T17570 conj States,California
R12273 T17574 T17570 punct ),California
R12274 T17575 T17579 punct ",",run
R12275 T17576 T17577 compound PCR,amplification
R12276 T17577 T17579 nsubjpass amplification,run
R12277 T17578 T17579 auxpass was,run
R12278 T17579 T17579 ROOT run,run
R12279 T17580 T17579 prep on,run
R12280 T17581 T17585 det an,Biosystems
R12281 T17582 T17585 nmod ABI7000,Biosystems
R12282 T17583 T17585 punct (,Biosystems
R12283 T17584 T17585 compound Applied,Biosystems
R12284 T17585 T17580 pobj Biosystems,on
R12285 T17586 T17585 punct ",",Biosystems
R12286 T17587 T17588 compound Foster,City
R12287 T17588 T17585 conj City,Biosystems
R12288 T17589 T17588 punct ",",City
R12289 T17590 T17588 appos California,City
R12290 T17591 T17590 punct ",",California
R12291 T17592 T17593 compound United,States
R12292 T17593 T17590 appos States,California
R12293 T17594 T17588 punct ),City
R12294 T17595 T17585 prep at,Biosystems
R12295 T17596 T17597 det the,University
R12296 T17597 T17601 nmod University,facility
R12297 T17598 T17597 prep of,University
R12298 T17599 T17598 pobj Arizona,of
R12299 T17600 T17601 amod core,facility
R12300 T17601 T17595 pobj facility,at
R12301 T17602 T17579 punct .,run
R12302 T17603 T17604 det All,PCR
R12303 T17604 T17606 nsubjpass PCR,performed
R12304 T17605 T17606 auxpass was,performed
R12305 T17606 T17606 ROOT performed,performed
R12306 T17607 T17606 prep in,performed
R12307 T17608 T17610 det a,reaction
R12308 T17609 T17610 amod 25-μl,reaction
R12309 T17610 T17607 pobj reaction,in
R12310 T17611 T17610 prep with,reaction
R12311 T17612 T17613 nummod 12.5,μl
R12312 T17613 T17611 pobj μl,with
R12313 T17614 T17616 nmod SYBR,supermix
R12314 T17615 T17616 amod green,supermix
R12315 T17616 T17613 appos supermix,μl
R12316 T17617 T17606 punct .,performed
R12317 T17618 T17619 compound GAPDH,mRNA
R12318 T17619 T17620 compound mRNA,levels
R12319 T17620 T17622 nsubjpass levels,used
R12320 T17621 T17622 auxpass were,used
R12321 T17622 T17622 ROOT used,used
R12322 T17623 T17622 prep as,used
R12323 T17624 T17623 pobj control,as
R12324 T17625 T17624 prep for,control
R12325 T17626 T17627 compound input,RNA
R12326 T17627 T17625 pobj RNA,for
R12327 T17628 T17622 punct .,used
R12328 T17629 T17631 compound Standard,analyses
R12329 T17630 T17631 compound curve,analyses
R12330 T17631 T17633 nsubjpass analyses,performed
R12331 T17632 T17633 auxpass were,performed
R12332 T17633 T17633 ROOT performed,performed
R12333 T17634 T17635 aux to,test
R12334 T17635 T17633 xcomp test,performed
R12335 T17636 T17637 det the,efficiency
R12336 T17637 T17635 dobj efficiency,test
R12337 T17638 T17637 prep of,efficiency
R12338 T17639 T17640 det the,amplifications
R12339 T17640 T17638 pobj amplifications,of
R12340 T17641 T17633 punct .,performed
R12341 T17642 T17644 nsubjpass Triplicates,done
R12342 T17643 T17644 auxpass were,done
R12343 T17644 T17644 ROOT done,done
R12344 T17645 T17644 prep for,done
R12345 T17646 T17648 det each,reaction
R12346 T17647 T17648 compound PCR,reaction
R12347 T17648 T17645 pobj reaction,for
R12348 T17649 T17644 punct .,done
R12349 T17650 T17652 amod Relative,values
R12350 T17651 T17652 amod quantitative,values
R12351 T17652 T17654 nsubjpass values,calculated
R12352 T17653 T17654 auxpass were,calculated
R12353 T17654 T17654 ROOT calculated,calculated
R12354 T17655 T17654 prep in,calculated
R12355 T17656 T17661 det the,Software
R12356 T17657 T17658 compound ABI,Prism
R12357 T17658 T17661 nmod Prism,Software
R12358 T17659 T17661 nummod 7000,Software
R12359 T17660 T17661 compound SDS,Software
R12360 T17661 T17655 pobj Software,in
R12361 T17662 T17664 punct (,Biosystems
R12362 T17663 T17664 compound Applied,Biosystems
R12363 T17664 T17661 appos Biosystems,Software
R12364 T17665 T17664 punct ),Biosystems
R12365 T17666 T17654 cc and,calculated
R12366 T17667 T17654 conj normalized,calculated
R12367 T17668 T17667 prep to,normalized
R12368 T17669 T17668 pobj GAPDH,to
R12369 T17670 T17667 prep in,normalized
R12370 T17671 T17672 compound Microsoft,Excel
R12371 T17672 T17670 pobj Excel,in
R12372 T17673 T17674 punct (,Redmond
R12373 T17674 T17672 appos Redmond,Excel
R12374 T17675 T17674 punct ",",Redmond
R12375 T17676 T17674 conj Washington,Redmond
R12376 T17677 T17676 punct ",",Washington
R12377 T17678 T17679 compound United,States
R12378 T17679 T17674 appos States,Redmond
R12379 T17680 T17674 punct ),Redmond
R12380 T17681 T17654 punct .,calculated
R12582 T17981 T17979 dep 549,nucleotides
R12583 T17982 T17979 punct ;,nucleotides
R12584 T17983 T17979 cc and,nucleotides
R12585 T17984 T17986 nmod mouse,nucleotides
R12586 T17985 T17986 compound Sox6,nucleotides
R12587 T17986 T17979 conj nucleotides,nucleotides
R12588 T17987 T17979 dep 1353,nucleotides
R12589 T17988 T17979 appos 1927,nucleotides
R12590 T17989 T17977 punct .,βmaj
R12591 T17990 T17992 nsubjpass Embryos,fixed
R12592 T17991 T17992 auxpass were,fixed
R12593 T17992 T17992 ROOT fixed,fixed
R12594 T17993 T17992 advmod overnight,fixed
R12595 T17994 T17992 agent by,fixed
R12596 T17995 T17994 pobj immersion,by
R12597 T17996 T17992 prep in,fixed
R12598 T17997 T17998 nummod 4,%
R12599 T17998 T17999 compound %,paraformaldehyde
R12600 T17999 T17996 pobj paraformaldehyde,in
R12601 T18000 T17992 punct ",",fixed
R12602 T18001 T17992 conj embedded,fixed
R12603 T18002 T18001 prep in,embedded
R12604 T18003 T18002 pobj paraffin,in
R12605 T18004 T17992 punct ",",fixed
R12606 T18005 T17992 conj sectioned,fixed
R12607 T18006 T18005 prep at,sectioned
R12608 T18007 T18008 nummod 5,μm
R12609 T18008 T18006 pobj μm,at
R12610 T18009 T17992 punct ",",fixed
R12611 T18010 T17992 cc and,fixed
R12612 T18011 T17992 conj adhered,fixed
R12613 T18012 T18013 aux to,charge
R12614 T18013 T18011 xcomp charge,adhered
R12615 T18014 T18015 amod modified,slides
R12616 T18015 T18013 dobj slides,charge
R12617 T18016 T18017 punct (,VWR
R12618 T18017 T18015 appos VWR,slides
R12619 T18018 T18017 punct ",",VWR
R12620 T18019 T18020 compound West,Chester
R12621 T18020 T18017 conj Chester,VWR
R12622 T18021 T18020 punct ",",Chester
R12623 T18022 T18020 conj Pennsylvania,Chester
R12624 T18023 T18022 punct ",",Pennsylvania
R12625 T18024 T18025 compound United,States
R12626 T18025 T18022 conj States,Pennsylvania
R12627 T18026 T18015 punct ),slides
R12628 T18027 T17992 punct .,fixed
R12629 T18028 T18030 nsubjpass Slides,processed
R12630 T18029 T18030 auxpass were,processed
R12631 T18030 T18030 ROOT processed,processed
R12632 T18031 T18030 prep for,processed
R12633 T18032 T18030 prep in,processed
R12634 T18033 T18034 compound situ,hybridization
R12635 T18034 T18032 pobj hybridization,in
R12636 T18035 T18036 mark as,described
R12637 T18036 T18030 advcl described,processed
R12638 T18037 T18039 nmod [,]
R12639 T18038 T18039 nummod 52,]
R12640 T18039 T18036 dobj ],described
R12641 T18040 T18036 advcl using,described
R12642 T18041 T18040 prep in,using
R12643 T18042 T18041 pobj vitro,in
R12644 T18043 T18045 amod transcribed,probes
R12645 T18044 T18045 compound RNA,probes
R12646 T18045 T18040 dobj probes,using
R12647 T18046 T18045 acl labeled,probes
R12648 T18047 T18046 prep with,labeled
R12649 T18048 T18047 pobj 33P,with
R12650 T18049 T18030 punct .,processed
R12651 T18050 T18053 nmod Darkfield,images
R12652 T18051 T18050 cc and,Darkfield
R12653 T18052 T18050 conj brightfield,Darkfield
R12654 T18053 T18055 nsubjpass images,obtained
R12655 T18054 T18055 auxpass were,obtained
R12656 T18055 T18055 ROOT obtained,obtained
R12657 T18056 T18055 prep with,obtained
R12658 T18057 T18060 det a,microscope
R12659 T18058 T18060 compound Nikon,microscope
R12660 T18059 T18060 compound Optiphot,microscope
R12661 T18060 T18056 pobj microscope,with
R12662 T18061 T18062 punct (,Nikon
R12663 T18062 T18076 nmod Nikon,camera
R12664 T18063 T18062 punct ",",Nikon
R12665 T18064 T18062 conj Melville,Nikon
R12666 T18065 T18064 punct ",",Melville
R12667 T18066 T18067 compound New,York
R12668 T18067 T18064 conj York,Melville
R12669 T18068 T18067 punct ",",York
R12670 T18069 T18070 compound United,States
R12671 T18070 T18067 conj States,York
R12672 T18071 T18070 punct ),States
R12673 T18072 T18070 cc and,States
R12674 T18073 T18076 nmod SPOT,camera
R12675 T18074 T18076 amod RT-Slider,camera
R12676 T18075 T18076 amod digital,camera
R12677 T18076 T18060 appos camera,microscope
R12678 T18077 T18079 punct (,Instruments
R12679 T18078 T18079 compound Diagnostic,Instruments
R12680 T18079 T18076 appos Instruments,camera
R12681 T18080 T18079 punct ",",Instruments
R12682 T18081 T18082 compound Sterling,Heights
R12683 T18082 T18079 conj Heights,Instruments
R12684 T18083 T18082 punct ",",Heights
R12685 T18084 T18082 conj Michigan,Heights
R12686 T18085 T18084 punct ",",Michigan
R12687 T18086 T18087 compound United,States
R12688 T18087 T18084 conj States,Michigan
R12689 T18088 T18079 punct ),Instruments
R12690 T18089 T18055 punct .,obtained
R12691 T18090 T18092 nsubj Objectives,were
R12692 T18091 T18090 acl used,Objectives
R12693 T18092 T18092 ROOT were,were
R12694 T18093 T18094 nummod 1,×
R12695 T18094 T18092 attr ×,were
R12696 T18095 T18098 punct (,0.04
R12697 T18096 T18098 dep NA,0.04
R12698 T18097 T18098 punct =,0.04
R12699 T18098 T18094 parataxis 0.04,×
R12700 T18099 T18098 punct ),0.04
R12701 T18100 T18098 cc and,0.04
R12702 T18101 T18102 nummod 10,×
R12703 T18102 T18098 conj ×,0.04
R12704 T18103 T18102 punct (,×
R12705 T18104 T18107 nmod NA,)
R12706 T18105 T18106 punct =,0.5
R12707 T18106 T18104 nummod 0.5,NA
R12708 T18107 T18102 punct ),×
R12709 T18108 T18092 punct .,were
R12710 T18109 T18111 nsubjpass Images,processed
R12711 T18110 T18111 auxpass were,processed
R12712 T18111 T18111 ROOT processed,processed
R12713 T18112 T18111 punct ",",processed
R12714 T18113 T18111 conj pseudocolored,processed
R12715 T18114 T18113 punct ",",pseudocolored
R12716 T18115 T18113 cc and,pseudocolored
R12717 T18116 T18113 conj combined,pseudocolored
R12718 T18117 T18116 advcl using,combined
R12719 T18118 T18117 dobj Photoshop,using
R12720 T18119 T18120 punct (,Adobe
R12721 T18120 T18118 appos Adobe,Photoshop
R12722 T18121 T18120 punct ",",Adobe
R12723 T18122 T18123 compound San,Jose
R12724 T18123 T18120 npadvmod Jose,Adobe
R12725 T18124 T18123 punct ",",Jose
R12726 T18125 T18123 conj California,Jose
R12727 T18126 T18125 punct ",",California
R12728 T18127 T18128 compound United,States
R12729 T18128 T18125 appos States,California
R12730 T18129 T18125 punct ),California
R12731 T18130 T18118 conj software,Photoshop
R12732 T18131 T18117 prep with,using
R12733 T18132 T18136 nmod Fovea,Graphics
R12734 T18133 T18136 nmod Pro,Graphics
R12735 T18134 T18136 punct (,Graphics
R12736 T18135 T18136 compound Reindeer,Graphics
R12737 T18136 T18146 nmod Graphics,plugins
R12738 T18137 T18136 punct ",",Graphics
R12739 T18138 T18146 nmod Asheville,plugins
R12740 T18139 T18138 punct ",",Asheville
R12741 T18140 T18141 compound North,Carolina
R12742 T18141 T18138 conj Carolina,Asheville
R12743 T18142 T18141 punct ",",Carolina
R12744 T18143 T18144 compound United,States
R12745 T18144 T18141 appos States,Carolina
R12746 T18145 T18146 punct ),plugins
R12747 T18146 T18131 pobj plugins,with
R12748 T18147 T18111 punct .,processed
R12749 T18148 T18149 amod Original,images
R12750 T18149 T18150 nsubj images,are
R12751 T18150 T18150 ROOT are,are
R12752 T18151 T18150 acomp available,are
R12753 T18152 T18150 punct .,are
R12873 T18304 T18304 ROOT Histology,Histology
R12874 T18305 T18304 punct .,Histology
R12875 T18306 T18307 amod 18.5-dpc,embryos
R12876 T18307 T18309 nsubjpass embryos,exsanguinated
R12877 T18308 T18309 auxpass were,exsanguinated
R12878 T18309 T18309 ROOT exsanguinated,exsanguinated
R12879 T18310 T18309 cc and,exsanguinated
R12880 T18311 T18309 conj peripheral,exsanguinated
R12881 T18312 T18313 compound blood,smears
R12882 T18313 T18314 nsubj smears,were
R12883 T18314 T18315 auxpass were,prepared
R12884 T18315 T18309 conj prepared,exsanguinated
R12885 T18316 T18315 prep from,prepared
R12886 T18317 T18318 preconj both,mutant
R12887 T18318 T18321 amod mutant,mice
R12888 T18319 T18318 cc and,mutant
R12889 T18320 T18318 conj WT,mutant
R12890 T18321 T18316 pobj mice,from
R12891 T18322 T18309 punct .,exsanguinated
R12892 T18323 T18324 det The,slides
R12893 T18324 T18325 nsubj slides,were
R12894 T18325 T18325 ROOT were,were
R12895 T18326 T18325 acomp Wright-stained,were
R12896 T18327 T18325 cc and,were
R12897 T18328 T18325 conj read,were
R12898 T18329 T18328 agent by,read
R12899 T18330 T18329 pobj DAF,by
R12900 T18331 T18325 punct .,were
R12901 T18332 T18349 prep For,fixed
R12902 T18333 T18335 amod whole,analysis
R12903 T18334 T18335 compound mount,analysis
R12904 T18335 T18332 pobj analysis,For
R12905 T18336 T18349 punct ",",fixed
R12906 T18337 T18338 compound 14.5-dpc,WT
R12907 T18338 T18349 nsubjpass WT,fixed
R12908 T18339 T18338 cc and,WT
R12909 T18340 T18341 amod mutant,embryos
R12910 T18341 T18338 conj embryos,WT
R12911 T18342 T18341 punct ",",embryos
R12912 T18343 T18341 cc and,embryos
R12913 T18344 T18345 amod postnatal,day
R12914 T18345 T18349 npadvmod day,fixed
R12915 T18346 T18347 nummod 10.5,mice
R12916 T18347 T18349 nsubjpass mice,fixed
R12917 T18348 T18349 auxpass were,fixed
R12918 T18349 T18349 ROOT fixed,fixed
R12919 T18350 T18349 prep in,fixed
R12920 T18351 T18352 nummod 10,%
R12921 T18352 T18353 compound %,formalin
R12922 T18353 T18350 pobj formalin,in
R12923 T18354 T18353 punct ",",formalin
R12924 T18355 T18357 amod paraffin-embedded,sectioned
R12925 T18356 T18355 punct ",",paraffin-embedded
R12926 T18357 T18349 conj sectioned,fixed
R12927 T18358 T18357 prep at,sectioned
R12928 T18359 T18360 nummod 5,μm
R12929 T18360 T18358 pobj μm,at
R12930 T18361 T18357 punct ",",sectioned
R12931 T18362 T18357 cc and,sectioned
R12932 T18363 T18357 conj stained,sectioned
R12933 T18364 T18363 prep with,stained
R12934 T18365 T18364 pobj hematoxylin,with
R12935 T18366 T18365 cc and,hematoxylin
R12936 T18367 T18365 conj eosin,hematoxylin
R12937 T18368 T18349 punct .,fixed
R12938 T18369 T18370 compound Liver,samples
R12939 T18370 T18380 nsubjpass samples,prepared
R12940 T18371 T18372 punct (,at
R12941 T18372 T18370 prep at,samples
R12942 T18373 T18372 pobj 14.5,at
R12943 T18374 T18380 nsubjpass dpc,prepared
R12944 T18375 T18374 cc and,dpc
R12945 T18376 T18377 nummod 18.5,dpc
R12946 T18377 T18374 conj dpc,dpc
R12947 T18378 T18374 punct ),dpc
R12948 T18379 T18380 auxpass were,prepared
R12949 T18380 T18380 ROOT prepared,prepared
R12950 T18381 T18380 prep in,prepared
R12951 T18382 T18384 det a,manner
R12952 T18383 T18384 amod similar,manner
R12953 T18384 T18381 pobj manner,in
R12954 T18385 T18380 punct .,prepared
R12955 T18386 T18388 nsubjpass Images,obtained
R12956 T18387 T18388 auxpass were,obtained
R12957 T18388 T18388 ROOT obtained,obtained
R12958 T18389 T18388 prep with,obtained
R12959 T18390 T18392 compound Nikon,microscope
R12960 T18391 T18392 compound Labophot-2,microscope
R12961 T18392 T18389 pobj microscope,with
R12962 T18393 T18388 punct .,obtained
R12963 T18394 T18396 nsubj Objectives,were
R12964 T18395 T18394 acl used,Objectives
R12965 T18396 T18396 ROOT were,were
R12966 T18397 T18398 compound E,Plan
R12967 T18398 T18396 attr Plan,were
R12968 T18399 T18398 nummod 40/0,Plan
R12969 T18400 T18398 nummod .65,Plan
R12970 T18401 T18398 appos 160/0,Plan
R12971 T18402 T18403 nummod .17,Nikon
R12972 T18403 T18398 conj Nikon,Plan
R12973 T18404 T18403 punct (,Nikon
R12974 T18405 T18406 nummod 40,×
R12975 T18406 T18407 compound ×,objective
R12976 T18407 T18403 appos objective,Nikon
R12977 T18408 T18403 punct ),Nikon
R12978 T18409 T18403 punct ",",Nikon
R12979 T18410 T18411 compound E,Plan
R12980 T18411 T18398 conj Plan,Plan
R12981 T18412 T18411 nummod 100/1,Plan
R12982 T18413 T18398 appos .25,Plan
R12983 T18414 T18415 compound oil,160/0
R12984 T18415 T18417 nmod 160/0,Nikon
R12985 T18416 T18417 nummod .17,Nikon
R12986 T18417 T18398 conj Nikon,Plan
R12987 T18418 T18417 punct (,Nikon
R12988 T18419 T18421 nummod 100,objective
R12989 T18420 T18421 nummod ×,objective
R12990 T18421 T18417 appos objective,Nikon
R12991 T18422 T18417 punct ),Nikon
R12992 T18423 T18396 punct .,were
R12993 T18424 T18425 det The,camera
R12994 T18425 T18426 nsubj camera,was
R12995 T18426 T18426 ROOT was,was
R12996 T18427 T18429 det a,Coolpix
R12997 T18428 T18429 compound Nikon,Coolpix
R12998 T18429 T18430 compound Coolpix,4300
R12999 T18430 T18426 attr 4300,was
R13000 T18431 T18426 punct .,was
R13001 T18432 T18433 amod Original,images
R13002 T18433 T18434 nsubj images,are
R13003 T18434 T18434 ROOT are,are
R13004 T18435 T18434 acomp available,are
R13005 T18436 T18434 punct .,are
R13112 T18572 T18573 compound Northern,blot
R13113 T18573 T18573 ROOT blot,blot
R13114 T18574 T18573 punct .,blot
R13115 T18575 T18581 det A,filter
R13116 T18576 T18581 compound mouse,filter
R13117 T18577 T18578 amod embryonic,tissue
R13118 T18578 T18581 compound tissue,filter
R13119 T18579 T18580 compound Northern,blot
R13120 T18580 T18581 compound blot,filter
R13121 T18581 T18593 nsubjpass filter,hybridized
R13122 T18582 T18581 punct (,filter
R13123 T18583 T18581 appos Seegene,filter
R13124 T18584 T18583 punct ",",Seegene
R13125 T18585 T18583 conj Rockville,Seegene
R13126 T18586 T18585 punct ",",Rockville
R13127 T18587 T18585 conj Maryland,Rockville
R13128 T18588 T18587 punct ",",Maryland
R13129 T18589 T18590 compound United,States
R13130 T18590 T18587 appos States,Maryland
R13131 T18591 T18587 punct ),Maryland
R13132 T18592 T18593 auxpass was,hybridized
R13133 T18593 T18593 ROOT hybridized,hybridized
R13134 T18594 T18593 prep with,hybridized
R13135 T18595 T18597 det a,probe
R13136 T18596 T18597 amod Sox6,probe
R13137 T18597 T18594 pobj probe,with
R13138 T18598 T18597 acl generated,probe
R13139 T18599 T18598 agent by,generated
R13140 T18600 T18599 pobj RT-PCR,by
R13141 T18601 T18602 punct (,nucleotides
R13142 T18602 T18597 appos nucleotides,probe
R13143 T18603 T18602 nummod 1353,nucleotides
R13144 T18604 T18602 npadvmod 1927,nucleotides
R13145 T18605 T18602 punct ),nucleotides
R13146 T18606 T18593 cc and,hybridized
R13147 T18607 T18593 conj labeled,hybridized
R13148 T18608 T18607 prep with,labeled
R13149 T18609 T18612 compound [,dCTP
R13150 T18610 T18612 compound α-32P,dCTP
R13151 T18611 T18612 compound ],dCTP
R13152 T18612 T18608 pobj dCTP,with
R13153 T18613 T18612 punct ",",dCTP
R13154 T18614 T18607 agent by,labeled
R13155 T18615 T18616 amod random,primer
R13156 T18616 T18614 pobj primer,by
R13157 T18617 T18616 acl labeling,primer
R13158 T18618 T18619 punct (,RediprimeII
R13159 T18619 T18617 ccomp RediprimeII,labeling
R13160 T18620 T18619 punct ;,RediprimeII
R13161 T18621 T18622 compound Amersham,Biosciences
R13162 T18622 T18619 conj Biosciences,RediprimeII
R13163 T18623 T18622 punct ",",Biosciences
R13164 T18624 T18622 conj Buckinghamshire,Biosciences
R13165 T18625 T18624 punct ",",Buckinghamshire
R13166 T18626 T18624 conj England,Buckinghamshire
R13167 T18627 T18626 punct ",",England
R13168 T18628 T18629 compound United,Kingdom
R13169 T18629 T18619 npadvmod Kingdom,RediprimeII
R13170 T18630 T18619 punct ),RediprimeII
R13171 T18631 T18593 punct .,hybridized
R13172 T18632 T18633 det The,hybridization
R13173 T18633 T18635 nsubjpass hybridization,performed
R13174 T18634 T18635 auxpass was,performed
R13175 T18635 T18635 ROOT performed,performed
R13176 T18636 T18635 prep in,performed
R13177 T18637 T18636 pobj phosphate,in
R13178 T18638 T18635 advcl buffered,performed
R13179 T18639 T18640 nummod 7,%
R13180 T18640 T18643 compound %,solution
R13181 T18641 T18643 compound SDS,solution
R13182 T18642 T18643 compound hybridization,solution
R13183 T18643 T18638 dobj solution,buffered
R13184 T18644 T18635 punct .,performed
R13185 T18645 T18647 nsubjpass Blots,washed
R13186 T18646 T18647 auxpass were,washed
R13187 T18647 T18647 ROOT washed,washed
R13188 T18648 T18647 prep with,washed
R13189 T18649 T18651 nummod 0.2,SSC
R13190 T18650 T18651 nummod ×,SSC
R13191 T18651 T18648 pobj SSC,with
R13192 T18652 T18651 punct ",",SSC
R13193 T18653 T18654 nummod 1,%
R13194 T18654 T18655 compound %,SDS
R13195 T18655 T18651 appos SDS,SSC
R13196 T18656 T18647 prep at,washed
R13197 T18657 T18658 nummod 60,°
R13198 T18658 T18656 pobj °,at
R13199 T18659 T18660 compound C,prior
R13200 T18660 T18647 advmod prior,washed
R13201 T18661 T18660 prep to,prior
R13202 T18662 T18661 pobj exposure,to
R13203 T18663 T18662 prep to,exposure
R13204 T18664 T18665 compound X-ray,film
R13205 T18665 T18663 pobj film,to
R13206 T18666 T18667 punct (,Kodak
R13207 T18667 T18665 appos Kodak,film
R13208 T18668 T18667 punct ",",Kodak
R13209 T18669 T18667 conj Rochester,Kodak
R13210 T18670 T18669 punct ",",Rochester
R13211 T18671 T18672 compound New,York
R13212 T18672 T18669 conj York,Rochester
R13213 T18673 T18672 punct ",",York
R13214 T18674 T18675 compound United,States
R13215 T18675 T18672 appos States,York
R13216 T18676 T18672 punct ),York
R13217 T18677 T18660 prep at,prior
R13218 T18678 T18680 nummod −,°
R13219 T18679 T18680 nummod 80,°
R13220 T18680 T18677 pobj °,at
R13221 T18681 T18660 npadvmod C,prior
R13222 T18682 T18660 prep for,prior
R13223 T18683 T18684 nummod 6,d.
R13224 T18684 T18682 pobj d.,for
R13398 T18901 T18902 compound Cell,culture
R13399 T18902 T18902 ROOT culture,culture
R13400 T18903 T18902 cc and,culture
R13401 T18904 T18902 conj transfection,culture
R13402 T18905 T18902 punct .,culture
R13403 T18906 T18907 nummod GM979,cells
R13404 T18907 T18922 nsubjpass cells,cultured
R13405 T18908 T18907 punct (,cells
R13406 T18909 T18911 compound Coriell,Repositories
R13407 T18910 T18911 compound Cell,Repositories
R13408 T18911 T18907 appos Repositories,cells
R13409 T18912 T18911 punct ",",Repositories
R13410 T18913 T18911 conj Camden,Repositories
R13411 T18914 T18913 punct ",",Camden
R13412 T18915 T18916 compound New,Jersey
R13413 T18916 T18913 conj Jersey,Camden
R13414 T18917 T18916 punct ",",Jersey
R13415 T18918 T18919 compound United,States
R13416 T18919 T18916 appos States,Jersey
R13417 T18920 T18916 punct ),Jersey
R13418 T18921 T18922 auxpass were,cultured
R13419 T18922 T18922 ROOT cultured,cultured
R13420 T18923 T18922 prep in,cultured
R13421 T18924 T18926 poss Ham,F12
R13422 T18925 T18924 case 's,Ham
R13423 T18926 T18923 pobj F12,in
R13424 T18927 T18931 mark with,supplemented
R13425 T18928 T18930 nummod 2,L-glutamine
R13426 T18929 T18930 compound mM,L-glutamine
R13427 T18930 T18931 nsubj L-glutamine,supplemented
R13428 T18931 T18922 advcl supplemented,cultured
R13429 T18932 T18931 prep with,supplemented
R13430 T18933 T18938 amod heat-inactivated,serum
R13431 T18934 T18935 nummod 10,%
R13432 T18935 T18938 compound %,serum
R13433 T18936 T18937 amod fetal,calf
R13434 T18937 T18938 compound calf,serum
R13435 T18938 T18932 pobj serum,with
R13436 T18939 T18938 punct (,serum
R13437 T18940 T18968 nmod Ivitrogen,)
R13438 T18941 T18940 punct ",",Ivitrogen
R13439 T18942 T18940 conj Carlsbad,Ivitrogen
R13440 T18943 T18942 punct ",",Carlsbad
R13441 T18944 T18942 conj California,Carlsbad
R13442 T18945 T18944 punct ",",California
R13443 T18946 T18947 compound United,States
R13444 T18947 T18944 conj States,California
R13445 T18948 T18944 punct ),California
R13446 T18949 T18940 punct ",",Ivitrogen
R13447 T18950 T18967 nmod penicillin,mM
R13448 T18951 T18953 punct (,units/ml
R13449 T18952 T18953 nummod 100,units/ml
R13450 T18953 T18950 appos units/ml,penicillin
R13451 T18954 T18953 punct ),units/ml
R13452 T18955 T18950 punct ",",penicillin
R13453 T18956 T18960 nmod streptomycin,ml
R13454 T18957 T18956 nummod 100,streptomycin
R13455 T18958 T18960 compound μg,ml
R13456 T18959 T18960 compound /,ml
R13457 T18960 T18950 appos ml,penicillin
R13458 T18961 T18960 punct ),ml
R13459 T18962 T18950 punct ",",penicillin
R13460 T18963 T18950 cc and,penicillin
R13461 T18964 T18950 conj L-glutamine,penicillin
R13462 T18965 T18966 punct (,2
R13463 T18966 T18967 nummod 2,mM
R13464 T18967 T18940 appos mM,Ivitrogen
R13465 T18968 T18938 punct ),serum
R13466 T18969 T18922 punct .,cultured
R13467 T18970 T18971 compound MEL,cells
R13468 T18971 T18976 nsubjpass cells,supplemented
R13469 T18972 T18976 auxpass were,supplemented
R13470 T18973 T18972 acomp cultured,were
R13471 T18974 T18973 prep in,cultured
R13472 T18975 T18974 pobj DMEM,in
R13473 T18976 T18976 ROOT supplemented,supplemented
R13474 T18977 T18976 prep as,supplemented
R13475 T18978 T18977 prep above,as
R13476 T18979 T18978 punct (,above
R13477 T18980 T18978 prep without,above
R13478 T18981 T18980 pobj heat,without
R13479 T18982 T18978 pcomp inactivating,above
R13480 T18983 T18984 det the,serum
R13481 T18984 T18982 dobj serum,inactivating
R13482 T18985 T18977 punct ),as
R13483 T18986 T18976 punct .,supplemented
R13484 T18987 T18988 nummod GM979,cells
R13485 T18988 T19000 nsubjpass cells,transfected
R13486 T18989 T18988 punct (,cells
R13487 T18990 T18992 nummod 4,105
R13488 T18991 T18992 nummod ×,105
R13489 T18992 T18988 appos 105,cells
R13490 T18993 T18988 punct ),cells
R13491 T18994 T18988 prep in,cells
R13492 T18995 T18996 compound log,phase
R13493 T18996 T18994 pobj phase,in
R13494 T18997 T18996 prep of,phase
R13495 T18998 T18997 pobj growth,of
R13496 T18999 T19000 auxpass were,transfected
R13497 T19000 T19000 ROOT transfected,transfected
R13498 T19001 T19000 prep with,transfected
R13499 T19002 T19001 pobj plasmids,with
R13500 T19003 T19000 agent by,transfected
R13501 T19004 T19003 pobj FuGENE6,by
R13502 T19005 T19006 punct (,Roche
R13503 T19006 T19004 appos Roche,FuGENE6
R13504 T19007 T19006 punct ",",Roche
R13505 T19008 T19013 nmod Indianapolis,States
R13506 T19009 T19008 punct ",",Indianapolis
R13507 T19010 T19008 conj Indiana,Indianapolis
R13508 T19011 T19010 punct ",",Indiana
R13509 T19012 T19013 compound United,States
R13510 T19013 T19006 conj States,Roche
R13511 T19014 T19006 punct ),Roche
R13512 T19015 T19000 punct .,transfected
R13513 T19016 T19018 nsubjpass Cells,transfected
R13514 T19017 T19018 auxpass were,transfected
R13515 T19018 T19018 ROOT transfected,transfected
R13516 T19019 T19018 prep with,transfected
R13517 T19020 T19022 amod ɛy,reporter
R13518 T19021 T19022 compound promoter,reporter
R13519 T19022 T19023 compound reporter,constructs
R13520 T19023 T19019 pobj constructs,with
R13521 T19024 T19023 punct (,constructs
R13522 T19025 T19026 nummod 500,ng
R13523 T19026 T19023 appos ng,constructs
R13524 T19027 T19023 punct ),constructs
R13525 T19028 T19018 prep along,transfected
R13526 T19029 T19028 prep with,along
R13527 T19030 T19032 preconj either,vector
R13528 T19031 T19032 amod empty,vector
R13529 T19032 T19029 pobj vector,with
R13530 T19033 T19032 cc or,vector
R13531 T19034 T19036 amod Sox6,vector
R13532 T19035 T19036 compound overexpression,vector
R13533 T19036 T19032 conj vector,vector
R13534 T19037 T19036 punct (,vector
R13535 T19038 T19039 nummod 1000,ng
R13536 T19039 T19036 appos ng,vector
R13537 T19040 T19036 punct ),vector
R13538 T19041 T19018 punct .,transfected
R13539 T19042 T19049 prep In,used
R13540 T19043 T19042 pobj assays,In
R13541 T19044 T19043 prep of,assays
R13542 T19045 T19046 compound dosage,effect
R13543 T19046 T19044 pobj effect,of
R13544 T19047 T19049 punct ",",used
R13545 T19048 T19049 nsubj we,used
R13546 T19049 T19049 ROOT used,used
R13547 T19050 T19051 nummod 200,ng
R13548 T19051 T19049 dobj ng,used
R13549 T19052 T19051 punct ",",ng
R13550 T19053 T19054 nummod 500,ng
R13551 T19054 T19051 appos ng,ng
R13552 T19055 T19054 punct ",",ng
R13553 T19056 T19054 cc and,ng
R13554 T19057 T19058 nummod 1000,ng
R13555 T19058 T19054 conj ng,ng
R13556 T19059 T19051 punct ),ng
R13557 T19060 T19049 punct .,used
R13558 T19061 T19062 amod pRL-CMV,15ng
R13559 T19062 T19067 nsubjpass 15ng,used
R13560 T19063 T19064 punct (,Promega
R13561 T19064 T19062 appos Promega,15ng
R13562 T19065 T19064 punct ),Promega
R13563 T19066 T19067 auxpass was,used
R13564 T19067 T19067 ROOT used,used
R13565 T19068 T19067 prep as,used
R13566 T19069 T19070 det a,control
R13567 T19070 T19068 pobj control,as
R13568 T19071 T19070 prep for,control
R13569 T19072 T19073 compound transfection,efficiency
R13570 T19073 T19071 pobj efficiency,for
R13571 T19074 T19067 punct .,used
R13673 T19267 T19268 compound Nuclear,protein
R13674 T19268 T19269 nsubj protein,extract
R13675 T19269 T19269 ROOT extract,extract
R13676 T19270 T19269 cc and,extract
R13677 T19271 T19269 prep in,extract
R13678 T19272 T19273 amod vitro,translation
R13679 T19273 T19271 pobj translation,in
R13680 T19274 T19273 prep of,translation
R13681 T19275 T19274 pobj Sox6,of
R13682 T19276 T19269 punct .,extract
R13683 T19277 T19278 compound Nuclear,extracts
R13684 T19278 T19280 nsubjpass extracts,prepared
R13685 T19279 T19280 auxpass were,prepared
R13686 T19280 T19280 ROOT prepared,prepared
R13687 T19281 T19280 prep from,prepared
R13688 T19282 T19283 compound MEL,cells
R13689 T19283 T19281 pobj cells,from
R13690 T19284 T19283 punct (,cells
R13691 T19285 T19286 nummod 2,×
R13692 T19286 T19287 nummod ×,107
R13693 T19287 T19283 appos 107,cells
R13694 T19288 T19283 punct ),cells
R13695 T19289 T19280 advcl using,prepared
R13696 T19290 T19291 det a,kit
R13697 T19291 T19289 dobj kit,using
R13698 T19292 T19291 punct (,kit
R13699 T19293 T19294 amod Active,Motif
R13700 T19294 T19291 appos Motif,kit
R13701 T19295 T19294 punct ",",Motif
R13702 T19296 T19294 conj Carlsbad,Motif
R13703 T19297 T19296 punct ",",Carlsbad
R13704 T19298 T19296 conj California,Carlsbad
R13705 T19299 T19298 punct ",",California
R13706 T19300 T19301 compound United,States
R13707 T19301 T19298 conj States,California
R13708 T19302 T19296 punct ),Carlsbad
R13709 T19303 T19280 punct .,prepared
R13710 T19304 T19305 det The,Sox6
R13711 T19305 T19312 nsubjpass Sox6,tagged
R13712 T19306 T19312 prep in,tagged
R13713 T19307 T19309 amod vitro,expression
R13714 T19308 T19309 compound translation,expression
R13715 T19309 T19310 compound expression,vector
R13716 T19310 T19306 pobj vector,in
R13717 T19311 T19312 punct ",",tagged
R13718 T19312 T19312 ROOT tagged,tagged
R13719 T19313 T19312 prep with,tagged
R13720 T19314 T19313 pobj c-Myc,with
R13721 T19315 T19314 cc and,c-Myc
R13722 T19316 T19314 conj HA,c-Myc
R13723 T19317 T19319 punct ",",described
R13724 T19318 T19319 auxpass was,described
R13725 T19319 T19312 conj described,tagged
R13726 T19320 T19319 prep before,described
R13727 T19321 T19323 nmod [,]
R13728 T19322 T19321 nummod 15,[
R13729 T19323 T19320 pobj ],before
R13730 T19324 T19319 punct .,described
R13731 T19325 T19326 det The,translation
R13732 T19326 T19328 nsubjpass translation,performed
R13733 T19327 T19328 auxpass was,performed
R13734 T19328 T19328 ROOT performed,performed
R13735 T19329 T19328 prep in,performed
R13736 T19330 T19332 det a,lysate
R13737 T19331 T19332 amod reticulocyte,lysate
R13738 T19332 T19329 pobj lysate,in
R13739 T19333 T19332 acl based,lysate
R13740 T19334 T19333 prep in,based
R13741 T19335 T19337 amod vitro,system
R13742 T19336 T19337 amod translational,system
R13743 T19337 T19334 pobj system,in
R13744 T19338 T19337 punct (,system
R13745 T19339 T19344 nmod TNT,Systems
R13746 T19340 T19339 nummod ®,TNT
R13747 T19341 T19344 compound Quick,Systems
R13748 T19342 T19344 compound Coupled,Systems
R13749 T19343 T19344 compound Transcription/Translation,Systems
R13750 T19344 T19337 appos Systems,system
R13751 T19345 T19344 punct ",",Systems
R13752 T19346 T19344 appos Promega,Systems
R13753 T19347 T19337 punct ),system
R13754 T19348 T19328 punct .,performed
R13755 T19349 T19350 det A,vector
R13756 T19350 T19358 nsubjpass vector,translated
R13757 T19351 T19350 prep without,vector
R13758 T19352 T19355 det the,sequence
R13759 T19353 T19355 amod Sox6,sequence
R13760 T19354 T19355 compound coding,sequence
R13761 T19355 T19351 pobj sequence,without
R13762 T19356 T19358 auxpass was,translated
R13763 T19357 T19358 advmod also,translated
R13764 T19358 T19358 ROOT translated,translated
R13765 T19359 T19358 prep as,translated
R13766 T19360 T19362 det a,control
R13767 T19361 T19362 amod negative,control
R13768 T19362 T19359 pobj control,as
R13769 T19363 T19358 punct .,translated
R13850 T19522 T19522 ROOT Antibodies,Antibodies
R13851 T19523 T19522 punct .,Antibodies
R13852 T19524 T19525 amod Sox6,antibodies
R13853 T19525 T19530 nsubj antibodies,were
R13854 T19526 T19525 acl used,antibodies
R13855 T19527 T19526 prep in,used
R13856 T19528 T19529 det this,study
R13857 T19529 T19527 pobj study,in
R13858 T19530 T19533 auxpass were,provided
R13859 T19531 T19533 preconj either,provided
R13860 T19532 T19533 advmod kindly,provided
R13861 T19533 T19533 ROOT provided,provided
R13862 T19534 T19533 agent by,provided
R13863 T19535 T19537 compound Dr.,Lalli
R13864 T19536 T19537 compound Enzo,Lalli
R13865 T19537 T19534 pobj Lalli,by
R13866 T19538 T19541 punct (,Pasteur
R13867 T19539 T19541 compound Université,Pasteur
R13868 T19540 T19541 compound Louis,Pasteur
R13869 T19541 T19537 appos Pasteur,Lalli
R13870 T19542 T19541 punct ",",Pasteur
R13871 T19543 T19550 nsubj France,obtained
R13872 T19544 T19546 nmod [,]
R13873 T19545 T19546 nummod 7,]
R13874 T19546 T19543 nmod ],France
R13875 T19547 T19546 punct ),]
R13876 T19548 T19543 cc or,France
R13877 T19549 T19550 advmod commercially,obtained
R13878 T19550 T19533 conj obtained,provided
R13879 T19551 T19556 punct (,X
R13880 T19552 T19553 compound Catalog,No
R13881 T19553 T19556 nmod No,X
R13882 T19554 T19556 punct .,X
R13883 T19555 T19556 compound sc-17332,X
R13884 T19556 T19550 dobj X,obtained
R13885 T19557 T19556 punct ",",X
R13886 T19558 T19559 compound Santa,Cruz
R13887 T19559 T19560 compound Cruz,Biotechnology
R13888 T19560 T19556 conj Biotechnology,X
R13889 T19561 T19560 punct ",",Biotechnology
R13890 T19562 T19563 compound Santa,Cruz
R13891 T19563 T19560 conj Cruz,Biotechnology
R13892 T19564 T19563 punct ",",Cruz
R13893 T19565 T19563 conj California,Cruz
R13894 T19566 T19565 punct ",",California
R13895 T19567 T19568 compound United,States
R13896 T19568 T19565 conj States,California
R13897 T19569 T19550 punct ),obtained
R13898 T19570 T19533 punct .,provided
R13899 T19571 T19573 det All,antibodies
R13900 T19572 T19573 amod Sox6,antibodies
R13901 T19573 T19574 nsubj antibodies,generated
R13902 T19574 T19574 ROOT generated,generated
R13903 T19575 T19576 amod similar,results
R13904 T19576 T19574 dobj results,generated
R13905 T19577 T19574 punct .,generated
R13906 T19578 T19579 amod c-Myc,antibody
R13907 T19579 T19581 nsubjpass antibody,purchased
R13908 T19580 T19581 auxpass was,purchased
R13909 T19581 T19581 ROOT purchased,purchased
R13911 T19583 T19582 pobj Invitrogen,from
R13912 T19584 T19581 punct .,purchased
R13913 T19585 T19588 amod Normal,antibody
R13914 T19586 T19588 compound rabbit,antibody
R13915 T19587 T19588 compound IgG,antibody
R13916 T19588 T19590 nsubjpass antibody,obtained
R13917 T19589 T19590 auxpass was,obtained
R13918 T19590 T19590 ROOT obtained,obtained
R13919 T19591 T19590 prep from,obtained
R13920 T19592 T19593 compound Upstate,Biotechnology
R13921 T19593 T19591 pobj Biotechnology,from
R13922 T19594 T19596 punct (,Placid
R13923 T19595 T19596 compound Lake,Placid
R13924 T19596 T19593 appos Placid,Biotechnology
R13925 T19597 T19596 punct ",",Placid
R13926 T19598 T19599 compound New,York
R13927 T19599 T19596 npadvmod York,Placid
R13928 T19600 T19599 punct ",",York
R13929 T19601 T19602 compound United,States
R13930 T19602 T19599 appos States,York
R13931 T19603 T19596 punct ),Placid
R13932 T19604 T19590 punct .,obtained
R14199 T19985 T19985 ROOT EMSA,EMSA
R14200 T19986 T19985 punct .,EMSA
R14201 T19987 T19989 amod Single-stranded,oligonucleotides
R14202 T19988 T19989 amod complementary,oligonucleotides
R14203 T19989 T19990 nsubj oligonucleotides,were
R14204 T19990 T19990 ROOT were,were
R14205 T19991 T19990 acomp annealed,were
R14206 T19992 T19991 cc and,annealed
R14207 T19993 T19991 conj end-labeled,annealed
R14208 T19994 T19991 prep with,annealed
R14209 T19995 T19998 compound [,ATP
R14210 T19996 T19998 compound γ-32P,ATP
R14211 T19997 T19998 compound ],ATP
R14212 T19998 T19994 pobj ATP,with
R14213 T19999 T19994 prep with,with
R14214 T20000 T20002 nummod T4,kinase
R14215 T20001 T20002 compound polynucleotide,kinase
R14216 T20002 T19999 pobj kinase,with
R14217 T20003 T19990 punct .,were
R14218 T20004 T20006 nsubjpass EMSA,performed
R14219 T20005 T20006 auxpass was,performed
R14220 T20006 T20006 ROOT performed,performed
R14221 T20007 T20006 prep with,performed
R14222 T20008 T20009 nummod 5,μg
R14223 T20009 T20007 pobj μg,with
R14224 T20010 T20009 prep of,μg
R14225 T20011 T20012 amod nuclear,proteins
R14226 T20012 T20010 pobj proteins,of
R14227 T20013 T20009 prep from,μg
R14228 T20014 T20015 compound MEL,cells
R14229 T20015 T20013 pobj cells,from
R14230 T20016 T20015 cc or,cells
R14231 T20017 T20018 nummod 3,μl
R14232 T20018 T20015 conj μl,cells
R14233 T20019 T20018 prep of,μl
R14234 T20020 T20018 prep in,μl
R14235 T20021 T20022 amod vitro-translated,Sox6
R14236 T20022 T20020 pobj Sox6,in
R14237 T20023 T20009 prep along,μg
R14238 T20024 T20023 prep with,along
R14239 T20025 T20027 det the,lysate
R14240 T20026 T20027 compound reticulocyte,lysate
R14241 T20027 T20024 pobj lysate,with
R14242 T20028 T20027 prep in,lysate
R14243 T20029 T20030 amod binding,buffer
R14244 T20030 T20028 pobj buffer,in
R14245 T20031 T20009 punct :,μg
R14246 T20032 T20034 nummod 100,NaCl
R14247 T20033 T20034 compound mM,NaCl
R14248 T20034 T20009 appos NaCl,μg
R14249 T20035 T20034 punct ",",NaCl
R14250 T20036 T20037 nummod 10,%
R14251 T20037 T20038 compound %,glycerol
R14252 T20038 T20034 appos glycerol,NaCl
R14253 T20039 T20038 punct ",",glycerol
R14254 T20040 T20041 nummod 200,ng
R14255 T20041 T20050 npadvmod ng,poly
R14256 T20042 T20044 nmod /,BSA
R14257 T20043 T20044 compound μl,BSA
R14258 T20044 T20050 nmod BSA,poly
R14259 T20045 T20050 punct ",",poly
R14260 T20046 T20047 nummod 50,ng
R14261 T20047 T20050 compound ng,poly
R14262 T20048 T20050 compound /,poly
R14263 T20049 T20050 compound μl,poly
R14264 T20050 T20009 appos poly,μg
R14265 T20051 T20050 punct (,poly
R14266 T20052 T20050 appos dI-dC,poly
R14267 T20053 T20052 punct ),dI-dC
R14268 T20054 T20052 cc or,dI-dC
R14269 T20055 T20055 ROOT poly,poly
R14270 T20056 T20057 punct (,dG-dC
R14271 T20057 T20055 appos dG-dC,poly
R14272 T20058 T20057 punct ),dG-dC
R14273 T20059 T20055 punct ",",poly
R14274 T20060 T20062 nummod 10,HEPES
R14275 T20061 T20062 compound mM,HEPES
R14276 T20062 T20055 appos HEPES,poly
R14277 T20063 T20064 punct (,pH
R14278 T20064 T20062 parataxis pH,HEPES
R14279 T20065 T20064 nummod 7,pH
R14280 T20066 T20064 punct ),pH
R14281 T20067 T20064 punct ",",pH
R14282 T20068 T20070 nummod 0.1,EDTA
R14283 T20069 T20070 compound mM,EDTA
R14284 T20070 T20064 appos EDTA,pH
R14285 T20071 T20070 punct ",",EDTA
R14286 T20072 T20074 nummod 0.25,DTT
R14287 T20073 T20074 compound mM,DTT
R14288 T20074 T20070 appos DTT,EDTA
R14289 T20075 T20074 punct ",",DTT
R14290 T20076 T20078 nummod 0.6,MgCl2
R14291 T20077 T20078 compound mM,MgCl2
R14292 T20078 T20074 appos MgCl2,DTT
R14293 T20079 T20006 punct .,performed
R14294 T20080 T20103 prep For,added
R14295 T20081 T20080 pobj competition,For
R14296 T20082 T20081 cc or,competition
R14297 T20083 T20084 compound supershift,assays
R14298 T20084 T20081 conj assays,competition
R14299 T20085 T20084 punct ",",assays
R14300 T20086 T20090 det the,competitor
R14301 T20087 T20090 amod indicated,competitor
R14302 T20088 T20090 amod unlabelled,competitor
R14303 T20089 T20090 compound oligonucleotide,competitor
R14304 T20090 T20084 conj competitor,assays
R14305 T20091 T20090 punct (,competitor
R14306 T20092 T20094 amod 200-fold,excess
R14307 T20093 T20094 compound molar,excess
R14308 T20094 T20090 appos excess,competitor
R14309 T20095 T20090 punct ),competitor
R14310 T20096 T20090 cc or,competitor
R14311 T20097 T20090 conj antibody,competitor
R14312 T20098 T20097 punct (,antibody
R14313 T20099 T20100 nummod 3,μl
R14314 T20100 T20097 appos μl,antibody
R14315 T20101 T20097 punct ),antibody
R14316 T20102 T20103 auxpass was,added
R14317 T20103 T20103 ROOT added,added
R14318 T20104 T20107 quantmod 30,60
R14319 T20105 T20107 quantmod min,60
R14320 T20106 T20107 quantmod to,60
R14321 T20107 T20103 dobj 60,added
R14322 T20108 T20107 quantmod min,60
R14323 T20109 T20103 advmod prior,added
R14324 T20110 T20103 prep to,added
R14325 T20111 T20110 pobj addition,to
R14326 T20112 T20111 prep of,addition
R14327 T20113 T20114 amod radiolabeled,probe
R14328 T20114 T20112 pobj probe,of
R14329 T20115 T20103 punct .,added
R14330 T20116 T20126 prep Following,incubated
R14331 T20117 T20116 pobj addition,Following
R14332 T20118 T20117 prep of,addition
R14333 T20119 T20121 det the,probe
R14334 T20120 T20121 compound radiolabeled,probe
R14335 T20121 T20118 pobj probe,of
R14336 T20122 T20126 punct ",",incubated
R14337 T20123 T20124 det the,samples
R14338 T20124 T20126 nsubjpass samples,incubated
R14339 T20125 T20126 auxpass were,incubated
R14340 T20126 T20126 ROOT incubated,incubated
R14341 T20127 T20126 prep for,incubated
R14342 T20128 T20129 nummod 30,min
R14343 T20129 T20127 pobj min,for
R14344 T20130 T20129 cc or,min
R14345 T20131 T20132 nummod 60,min
R14346 T20132 T20129 conj min,min
R14347 T20133 T20132 prep at,min
R14348 T20134 T20135 compound room,temperature
R14349 T20135 T20133 pobj temperature,at
R14350 T20136 T20132 cc and,min
R14351 T20137 T20129 acl loaded,min
R14352 T20138 T20137 prep on,loaded
R14353 T20139 T20141 det a,%
R14354 T20140 T20141 nummod 4,%
R14355 T20141 T20138 pobj %,on
R14356 T20142 T20141 cc or,%
R14357 T20143 T20144 nummod 6,%
R14358 T20144 T20141 conj %,%
R14359 T20145 T20146 punct (,w/v
R14360 T20146 T20144 appos w/v,%
R14361 T20147 T20126 punct ),incubated
R14362 T20148 T20149 compound polyacrylamide,gel
R14363 T20149 T20149 ROOT gel,gel
R14364 T20150 T20149 punct .,gel
R14365 T20151 T20153 nsubjpass Electrophoresis,performed
R14366 T20152 T20153 auxpass was,performed
R14367 T20153 T20153 ROOT performed,performed
R14368 T20154 T20153 prep at,performed
R14369 T20155 T20158 det a,mAmp
R14370 T20156 T20158 amod constant,mAmp
R14371 T20157 T20158 nummod 19,mAmp
R14372 T20158 T20154 pobj mAmp,at
R14373 T20159 T20153 prep for,performed
R14374 T20160 T20159 pobj 4,for
R14375 T20161 T20162 nummod 8,h
R14376 T20162 T20171 nsubjpass h,dried
R14377 T20163 T20162 prep at,h
R14378 T20164 T20165 compound room,temperature
R14379 T20165 T20163 pobj temperature,at
R14380 T20166 T20162 punct ",",h
R14381 T20167 T20162 cc and,h
R14382 T20168 T20169 det the,gels
R14383 T20169 T20162 conj gels,h
R14384 T20170 T20171 auxpass were,dried
R14385 T20171 T20153 conj dried,performed
R14386 T20172 T20171 advmod prior,dried
R14387 T20173 T20172 prep to,prior
R14388 T20174 T20173 pobj autoradiography,to
R14389 T20175 T20171 punct .,dried
R14390 T20176 T20177 nsubj Antibodies,used
R14391 T20177 T20177 ROOT used,used
R14392 T20178 T20177 prep for,used
R14393 T20179 T20180 compound supershift,analyses
R14394 T20180 T20178 pobj analyses,for
R14395 T20181 T20177 conj included,used
R14396 T20182 T20188 nmod c-Myc,antibodies
R14397 T20183 T20182 punct ",",c-Myc
R14398 T20184 T20182 conj HA,c-Myc
R14399 T20185 T20184 punct ",",HA
R14400 T20186 T20184 cc and,HA
R14401 T20187 T20184 conj Sox6,HA
R14402 T20188 T20181 dobj antibodies,included
R14403 T20189 T20188 punct (,antibodies
R14404 T20190 T20188 acl described,antibodies
R14405 T20191 T20190 prep as,described
R14406 T20192 T20191 pcomp above,as
R14407 T20193 T20188 punct ),antibodies
R14408 T20194 T20177 punct .,used
R14409 T20195 T20197 det The,sequences
R14410 T20196 T20197 compound DNA,sequences
R14411 T20197 T20201 nsubj sequences,are
R14412 T20198 T20197 prep of,sequences
R14413 T20199 T20200 det the,oligonucleotides
R14414 T20200 T20198 pobj oligonucleotides,of
R14415 T20201 T20201 ROOT are,are
R14416 T20202 T20203 mark as,follows
R14417 T20203 T20201 advcl follows,are
R14418 T20204 T20209 punct (,listed
R14419 T20205 T20206 advmod only,forward
R14420 T20206 T20209 advmod forward,listed
R14421 T20207 T20209 nsubjpass oligos,listed
R14422 T20208 T20209 auxpass are,listed
R14423 T20209 T20201 advcl listed,are
R14424 T20210 T20209 punct ),listed
R14425 T20211 T20237 punct :,′
R14426 T20212 T20237 prep For,′
R14427 T20213 T20216 det the,probe
R14428 T20214 T20216 amod 36-bp,probe
R14429 T20215 T20216 compound WT,probe
R14430 T20216 T20212 pobj probe,For
R14431 T20217 T20237 punct :,′
R14432 T20218 T20221 nummod 5,′
R14433 T20219 T20221 nummod ′,′
R14434 T20220 T20221 compound AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3,′
R14435 T20221 T20237 npadvmod ′,′
R14436 T20222 T20223 punct (,MHB1556
R14437 T20223 T20221 appos MHB1556,′
R14438 T20224 T20223 punct ),MHB1556
R14439 T20225 T20237 punct ;,′
R14440 T20226 T20237 prep for,′
R14441 T20227 T20228 amod mutant,probe
R14442 T20228 T20226 pobj probe,for
R14443 T20229 T20228 nummod 1,probe
R14444 T20230 T20228 punct (,probe
R14445 T20231 T20228 appos M1,probe
R14446 T20232 T20228 punct ),probe
R14447 T20233 T20237 punct :,′
R14448 T20234 T20237 nummod 5,′
R14449 T20235 T20237 nummod ′,′
R14450 T20236 T20237 compound AACAAAGGGTCAGAACATTGTCTGCGAAG3,′
R14451 T20237 T20237 ROOT ′,′
R14452 T20238 T20239 punct (,MHB1644
R14453 T20239 T20237 appos MHB1644,′
R14454 T20240 T20239 punct ),MHB1644
R14455 T20241 T20253 punct ;,′
R14456 T20242 T20253 prep for,′
R14457 T20243 T20244 amod mutant,probe
R14458 T20244 T20242 pobj probe,for
R14459 T20245 T20244 nummod 2,probe
R14460 T20246 T20244 punct (,probe
R14461 T20247 T20244 appos M2,probe
R14462 T20248 T20244 punct ),probe
R14463 T20249 T20253 punct :,′
R14464 T20250 T20251 nummod 5,′
R14465 T20251 T20253 compound ′,′
R14466 T20252 T20253 compound AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3,′
R14467 T20253 T20237 conj ′,′
R14468 T20254 T20253 punct (,′
R14469 T20255 T20253 appos MHB1648,′
R14470 T20256 T20253 punct ),′
R14471 T20257 T20253 punct ;,′
R14472 T20258 T20258 ROOT for,for
R14473 T20259 T20260 amod mutant,probe
R14474 T20260 T20258 pobj probe,for
R14475 T20261 T20260 nummod 3,probe
R14476 T20262 T20260 punct (,probe
R14477 T20263 T20260 appos M3,probe
R14478 T20264 T20260 punct ),probe
R14479 T20265 T20258 punct :,for
R14480 T20266 T20267 nummod 5,′
R14481 T20267 T20269 compound ′,′
R14482 T20268 T20269 compound AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3,′
R14483 T20269 T20269 ROOT ′,′
R14484 T20270 T20269 punct (,′
R14485 T20271 T20269 appos MHB1650,′
R14486 T20272 T20269 punct ),′
R14487 T20273 T20237 punct .,′
R14776 T20678 T20679 compound ChIP,assay
R14777 T20679 T20679 ROOT assay,assay
R14778 T20680 T20679 punct .,assay
R14779 T20681 T20682 mark As,described
R14780 T20682 T20711 advcl described,treated
R14781 T20683 T20682 agent by,described
R14782 T20684 T20685 compound Nouzova,[
R14783 T20685 T20687 nmod [,]
R14784 T20686 T20687 nummod 53,]
R14785 T20687 T20683 pobj ],by
R14786 T20688 T20682 punct ",",described
R14787 T20689 T20682 prep in,described
R14788 T20690 T20689 pobj brief,in
R14789 T20691 T20711 punct :,treated
R14790 T20692 T20711 nsubjpass Cells,treated
R14791 T20693 T20692 prep from,Cells
R14792 T20694 T20695 compound MEL,cells
R14793 T20695 T20693 pobj cells,from
R14794 T20696 T20695 punct (,cells
R14795 T20697 T20699 nummod 4,107
R14796 T20698 T20699 nummod ×,107
R14797 T20699 T20695 appos 107,cells
R14798 T20700 T20699 punct ),107
R14799 T20701 T20699 cc or,107
R14800 T20702 T20704 amod fetal,cells
R14801 T20703 T20704 compound liver,cells
R14802 T20704 T20711 nsubjpass cells,treated
R14803 T20705 T20704 prep from,cells
R14804 T20706 T20709 nummod three,mice
R14805 T20707 T20709 amod 15.5-dpc,mice
R14806 T20708 T20709 compound WT,mice
R14807 T20709 T20705 pobj mice,from
R14808 T20710 T20711 auxpass were,treated
R14809 T20711 T20711 ROOT treated,treated
R14810 T20712 T20711 prep with,treated
R14811 T20713 T20714 nummod 1,%
R14812 T20714 T20715 compound %,formaldehyde
R14813 T20715 T20712 pobj formaldehyde,with
R14814 T20716 T20711 prep for,treated
R14815 T20717 T20718 nummod 10,min
R14816 T20718 T20716 pobj min,for
R14817 T20719 T20711 prep at,treated
R14818 T20720 T20721 nummod 37,°
R14819 T20721 T20722 nummod °,C
R14820 T20722 T20719 pobj C,at
R14821 T20723 T20711 punct ",",treated
R14822 T20724 T20711 conj rinsed,treated
R14823 T20725 T20724 prep in,rinsed
R14824 T20726 T20729 amod ice-cold,Hanks
R14825 T20727 T20728 nummod 1,×
R14826 T20728 T20729 compound ×,Hanks
R14827 T20729 T20733 poss Hanks,solution
R14828 T20730 T20729 case ',Hanks
R14829 T20731 T20733 amod balanced,solution
R14830 T20732 T20733 compound salt,solution
R14831 T20733 T20725 pobj solution,in
R14832 T20734 T20733 prep with,solution
R14833 T20735 T20736 nummod 0.1,%
R14834 T20736 T20737 compound %,EDTA
R14835 T20737 T20738 nsubj EDTA,containing
R14836 T20738 T20734 pcomp containing,with
R14837 T20739 T20740 compound protease,inhibitors
R14838 T20740 T20738 dobj inhibitors,containing
R14839 T20741 T20740 punct ",",inhibitors
R14840 T20742 T20740 acl collected,inhibitors
R14841 T20743 T20742 agent by,collected
R14842 T20744 T20743 pobj centrifugation,by
R14843 T20745 T20742 prep at,collected
R14844 T20746 T20747 nummod 4,°
R14845 T20747 T20748 nummod °,C
R14846 T20748 T20745 pobj C,at
R14847 T20749 T20748 punct ",",C
R14848 T20750 T20724 conj resuspended,rinsed
R14849 T20751 T20750 prep in,resuspended
R14850 T20752 T20755 det a,buffer
R14851 T20753 T20755 compound SDS,buffer
R14852 T20754 T20755 compound lysis,buffer
R14853 T20755 T20751 pobj buffer,in
R14854 T20756 T20755 acl containing,buffer
R14855 T20757 T20758 compound protease,inhibitors
R14856 T20758 T20756 dobj inhibitors,containing
R14857 T20759 T20750 punct ",",resuspended
R14858 T20760 T20750 cc and,resuspended
R14859 T20761 T20750 conj incubated,resuspended
R14860 T20762 T20761 prep on,incubated
R14861 T20763 T20762 pobj ice,on
R14862 T20764 T20761 prep for,incubated
R14863 T20765 T20766 nummod 10,min
R14864 T20766 T20764 pobj min,for
R14865 T20767 T20711 punct .,treated
R14866 T20768 T20769 amod DNA-protein,complexes
R14867 T20769 T20771 nsubjpass complexes,sonicated
R14868 T20770 T20771 auxpass were,sonicated
R14869 T20771 T20771 ROOT sonicated,sonicated
R14870 T20772 T20771 prep to,sonicated
R14871 T20773 T20776 nummod 200,bp
R14872 T20774 T20773 cc and,200
R14873 T20775 T20773 conj 600,200
R14874 T20776 T20772 pobj bp,to
R14875 T20777 T20771 punct .,sonicated
R14876 T20778 T20783 nsubjpass One-tenth,set
R14877 T20779 T20778 prep of,One-tenth
R14878 T20780 T20781 det the,sample
R14879 T20781 T20779 pobj sample,of
R14880 T20782 T20783 auxpass was,set
R14881 T20783 T20783 ROOT set,set
R14882 T20784 T20783 advmod aside,set
R14883 T20785 T20783 prep for,set
R14884 T20786 T20787 compound input,control
R14885 T20787 T20785 pobj control,for
R14886 T20788 T20783 punct ",",set
R14887 T20789 T20783 cc and,set
R14888 T20790 T20792 det the,sample
R14889 T20791 T20792 amod remaining,sample
R14890 T20792 T20794 nsubjpass sample,precleared
R14891 T20793 T20794 auxpass was,precleared
R14892 T20794 T20783 conj precleared,set
R14893 T20795 T20794 prep with,precleared
R14894 T20796 T20797 compound protein,A-Sepharose
R14895 T20797 T20795 pobj A-Sepharose,with
R14896 T20798 T20800 punct (,Biosciences
R14897 T20799 T20800 compound Amersham,Biosciences
R14898 T20800 T20797 appos Biosciences,A-Sepharose
R14899 T20801 T20800 punct ",",Biosciences
R14900 T20802 T20800 npadvmod Piscataway,Biosciences
R14901 T20803 T20802 punct ",",Piscataway
R14902 T20804 T20805 compound New,Jersey
R14903 T20805 T20802 conj Jersey,Piscataway
R14904 T20806 T20805 punct ",",Jersey
R14905 T20807 T20808 compound United,States
R14906 T20808 T20802 appos States,Piscataway
R14907 T20809 T20802 punct ),Piscataway
R14908 T20810 T20794 punct .,precleared
R14909 T20811 T20817 prep Following,split
R14910 T20812 T20811 pobj preclearing,Following
R14911 T20813 T20817 punct ",",split
R14912 T20814 T20815 det the,samples
R14913 T20815 T20817 nsubjpass samples,split
R14914 T20816 T20817 auxpass were,split
R14915 T20817 T20817 ROOT split,split
R14916 T20818 T20817 prep into,split
R14917 T20819 T20818 pobj thirds,into
R14918 T20820 T20817 punct :,split
R14919 T20821 T20822 nummod one,sample
R14920 T20822 T20829 nsubjpass sample,treated
R14921 T20823 T20822 acl treated,sample
R14922 T20824 T20823 prep with,treated
R14923 T20825 T20824 pobj anti-Sox6,with
R14924 T20826 T20825 punct ",",anti-Sox6
R14925 T20827 T20828 det a,second
R14926 T20828 T20829 amod second,treated
R14927 T20829 T20817 conj treated,split
R14928 T20830 T20829 prep with,treated
R14929 T20831 T20832 amod normal,rabbit
R14930 T20832 T20833 compound rabbit,IgG
R14931 T20833 T20830 pobj IgG,with
R14932 T20834 T20829 punct ",",treated
R14933 T20835 T20829 cc and,treated
R14934 T20836 T20838 det the,sample
R14935 T20837 T20838 amod third,sample
R14936 T20838 T20829 conj sample,treated
R14937 T20839 T20838 prep without,sample
R14938 T20840 T20839 pobj Ab,without
R14939 T20841 T20829 punct .,treated
R14940 T20842 T20844 det The,two
R14941 T20843 T20844 amod last,two
R14942 T20844 T20846 nsubjpass two,used
R14943 T20845 T20846 auxpass were,used
R14944 T20846 T20846 ROOT used,used
R14945 T20847 T20846 prep as,used
R14946 T20848 T20849 amod negative,controls
R14947 T20849 T20847 pobj controls,as
R14948 T20850 T20846 punct .,used
R14949 T20851 T20853 det The,complexes
R14950 T20852 T20853 amod chromatin-antibody,complexes
R14951 T20853 T20855 nsubjpass complexes,eluted
R14952 T20854 T20855 auxpass were,eluted
R14953 T20855 T20855 ROOT eluted,eluted
R14954 T20856 T20855 punct ",",eluted
R14955 T20857 T20855 cc and,eluted
R14956 T20858 T20860 det the,protein
R14957 T20859 T20860 compound DNA,protein
R14958 T20860 T20861 compound protein,cross-links
R14959 T20861 T20863 nsubjpass cross-links,reversed
R14960 T20862 T20863 auxpass were,reversed
R14961 T20863 T20855 conj reversed,eluted
R14962 T20864 T20863 prep with,reversed
R14963 T20865 T20867 nummod 5,NaCl
R14964 T20866 T20867 compound M,NaCl
R14965 T20867 T20864 pobj NaCl,with
R14966 T20868 T20863 prep at,reversed
R14967 T20869 T20871 nummod 65,C
R14968 T20870 T20871 nummod °,C
R14969 T20871 T20868 pobj C,at
R14970 T20872 T20863 prep for,reversed
R14971 T20873 T20874 nummod 4,h.
R14972 T20874 T20876 compound h.,DNA
R14973 T20875 T20876 compound Input,DNA
R14974 T20876 T20872 pobj DNA,for
R14975 T20877 T20876 cc or,DNA
R14976 T20878 T20879 amod immunoprecipitated,DNA
R14977 T20879 T20876 conj DNA,DNA
R14978 T20880 T20881 auxpass was,used
R14979 T20881 T20863 conj used,reversed
R14980 T20882 T20881 prep as,used
R14981 T20883 T20884 det a,template
R14982 T20884 T20882 pobj template,as
R14983 T20885 T20884 prep in,template
R14984 T20886 T20888 det the,reaction
R14985 T20887 T20888 compound PCR,reaction
R14986 T20888 T20885 pobj reaction,in
R14987 T20889 T20863 punct .,reversed
R14988 T20890 T20891 compound PCR,amplification
R14989 T20891 T20897 nsubjpass amplification,performed
R14990 T20892 T20891 prep of,amplification
R14991 T20893 T20895 det the,promoter
R14992 T20894 T20895 amod ɛy,promoter
R14993 T20895 T20892 pobj promoter,of
R14994 T20896 T20897 auxpass was,performed
R14995 T20897 T20897 ROOT performed,performed
R14996 T20898 T20897 cc and,performed
R14997 T20899 T20897 conj yielded,performed
R14998 T20900 T20902 det a,amplicon
R14999 T20901 T20902 amod 172-bp,amplicon
R15000 T20902 T20899 dobj amplicon,yielded
R15001 T20903 T20902 punct ",",amplicon
R15002 T20904 T20902 amod corresponding,amplicon
R15003 T20905 T20907 aux to,−
R15004 T20906 T20905 pobj nucleotides,to
R15005 T20907 T20904 xcomp −,corresponding
R15006 T20908 T20910 quantmod 31,+140
R15007 T20909 T20910 quantmod to,+140
R15008 T20910 T20907 dobj +140,−
R15009 T20911 T20910 prep of,+140
R15010 T20912 T20914 det the,promoter
R15011 T20913 T20914 amod ɛy,promoter
R15012 T20914 T20911 pobj promoter,of
R15013 T20915 T20916 punct (,primers
R15014 T20916 T20914 appos primers,promoter
R15015 T20917 T20922 nmod MHB1688,′
R15016 T20918 T20917 punct ",",MHB1688
R15017 T20919 T20920 nummod 5,′
R15018 T20920 T20922 nmod ′,′
R15019 T20921 T20922 nummod CGAAGAATAAAAGGCCACCA3,′
R15020 T20922 T20916 dobj ′,primers
R15021 T20923 T20916 punct ;,primers
R15022 T20924 T20916 cc and,primers
R15023 T20925 T20916 conj MHB1689,primers
R15024 T20926 T20925 punct ",",MHB1689
R15025 T20927 T20928 nummod 5,′
R15026 T20928 T20930 compound ′,′
R15027 T20929 T20930 compound GCTTCACCACCAACCTCTTC3,′
R15028 T20930 T20925 conj ′,MHB1689
R15029 T20931 T20930 punct ),′
R15030 T20932 T20897 punct .,performed
R15031 T20933 T20935 nsubjpass PCR,performed
R15032 T20934 T20935 auxpass was,performed
R15033 T20935 T20935 ROOT performed,performed
R15034 T20936 T20935 prep under,performed
R15035 T20937 T20939 det the,conditions
R15036 T20938 T20939 amod following,conditions
R15037 T20939 T20936 pobj conditions,under
R15038 T20940 T20939 punct :,conditions
R15039 T20941 T20942 nummod 95,°
R15040 T20942 T20943 compound °,C
R15041 T20943 T20939 appos C,conditions
R15042 T20944 T20943 prep for,C
R15043 T20945 T20946 nummod 15,min
R15044 T20946 T20944 pobj min,for
R15045 T20947 T20939 acl followed,conditions
R15046 T20948 T20947 agent by,followed
R15047 T20949 T20950 nummod 30,cycles
R15048 T20950 T20948 pobj cycles,by
R15049 T20951 T20950 prep at,cycles
R15050 T20952 T20951 pobj 95,at
R15051 T20953 T20954 nummod °,C
R15052 T20954 T20950 conj C,cycles
R15053 T20955 T20947 prep for,followed
R15054 T20956 T20955 pobj 30,for
R15055 T20957 T20939 appos s,conditions
R15056 T20958 T20935 punct ",",performed
R15057 T20959 T20960 nummod 60,°
R15058 T20960 T20961 compound °,C
R15059 T20961 T20935 npadvmod C,performed
R15060 T20962 T20935 prep for,performed
R15061 T20963 T20962 pobj 30,for
R15062 T20964 T20935 dep s,performed
R15063 T20965 T20935 punct ",",performed
R15064 T20966 T20935 cc and,performed
R15065 T20967 T20969 nummod 72,C
R15066 T20968 T20969 compound °,C
R15067 T20969 T20935 conj C,performed
R15068 T20970 T20969 prep for,C
R15069 T20971 T20970 pobj 45,for
R15070 T20972 T20969 appos s,C
R15071 T20973 T20969 punct ",",C
R15072 T20974 T20935 advcl ending,performed
R15073 T20975 T20974 prep with,ending
R15074 T20976 T20978 det a,extension
R15075 T20977 T20978 amod final,extension
R15076 T20978 T20975 pobj extension,with
R15077 T20979 T20978 prep at,extension
R15078 T20980 T20981 nummod 72,°
R15079 T20981 T20979 pobj °,at
R15080 T20982 T20978 npadvmod C,extension
R15081 T20983 T20978 prep for,extension
R15082 T20984 T20985 nummod 5,min
R15083 T20985 T20983 pobj min,for
R15084 T20986 T20935 punct .,performed
R12562 T17961 T17961 ROOT In,In
R12563 T17962 T17963 compound situ,hybridization
R12564 T17963 T17961 pobj hybridization,In
R12565 T17964 T17963 punct .,hybridization
R12566 T17965 T17966 compound Antisense,probes
R12567 T17966 T17968 nsubjpass probes,designed
R12568 T17967 T17968 auxpass were,designed
R12569 T17968 T17968 ROOT designed,designed
R12570 T17969 T17970 aux to,murine
R12571 T17970 T17968 xcomp murine,designed
R12572 T17971 T17973 amod ɛy,nucleotides
R12573 T17972 T17973 compound globin,nucleotides
R12574 T17973 T17970 dobj nucleotides,murine
R12575 T17974 T17970 npadvmod 509,murine
R12576 T17975 T17970 meta 584,murine
R12577 T17976 T17968 punct ;,designed
R12578 T17977 T17968 conj βmaj,designed
R12579 T17978 T17979 compound globin,nucleotides
R12580 T17979 T17977 dobj nucleotides,βmaj
R12581 T17980 T17979 nummod 458,nucleotides
R11814 T16898 T16899 amod truncated,version
R11815 T16899 T16904 nsubj version,construct
R11816 T16900 T16899 prep of,version
R11817 T16901 T16903 det the,overexpression
R11818 T16902 T16903 amod Sox6,overexpression
R11819 T16903 T16900 pobj overexpression,of
R11820 T16904 T16904 ROOT construct,construct
R11821 T16905 T16908 punct (,)
R11822 T16906 T16908 nmod Sox6-ΔHMG-pcDNA3,)
R11823 T16907 T16906 nummod .1,Sox6-ΔHMG-pcDNA3
R11824 T16908 T16904 punct ),construct
R11825 T16909 T16910 nsubj that,lacks
R11826 T16910 T16904 ccomp lacks,construct
R11827 T16911 T16913 det the,domain
R11828 T16912 T16913 compound HMG,domain
R11829 T16913 T16915 nsubjpass domain,generated
R11830 T16914 T16915 auxpass was,generated
R11831 T16915 T16910 ccomp generated,lacks
R11832 T16916 T16915 punct ",",generated
R11833 T16917 T16918 mark as,described
R11834 T16918 T16915 advcl described,generated
R11835 T16919 T16918 agent by,described
R11836 T16920 T16919 pobj others,by
R11837 T16921 T16923 nmod [,]
R11838 T16922 T16923 nummod 32,]
R11839 T16923 T16920 appos ],others
R11840 T16924 T16904 punct .,construct
R11841 T16925 T16936 nsubjpass Mutagenesis,done
R11842 T16926 T16925 prep of,Mutagenesis
R11843 T16927 T16928 compound Sox/Sox6,consensus
R11844 T16928 T16930 nmod consensus,sites
R11845 T16929 T16930 amod binding,sites
R11846 T16930 T16926 pobj sites,of
R11847 T16931 T16930 prep of,sites
R11848 T16932 T16934 det the,promoter
R11849 T16933 T16934 amod ɛy,promoter
R11850 T16934 T16931 pobj promoter,of
R11851 T16935 T16936 auxpass were,done
R11852 T16936 T16936 ROOT done,done
R11853 T16937 T16936 agent by,done
R11854 T16938 T16937 pobj PCR,by
R11855 T16939 T16936 punct .,done
R11856 T16940 T16941 amod Forward,primers
R11857 T16941 T16951 nsubj primers,include
R11858 T16942 T16941 acl used,primers
R11859 T16943 T16944 aux to,generate
R11860 T16944 T16942 xcomp generate,used
R11861 T16945 T16950 det these,constructs
R11862 T16946 T16950 amod mutagenized,constructs
R11863 T16947 T16950 compound ɛy,constructs
R11864 T16948 T16949 compound promoter,reporter
R11865 T16949 T16950 compound reporter,constructs
R11866 T16950 T16951 nsubj constructs,include
R11867 T16951 T16951 ROOT include,include
R11868 T16952 T16951 punct :,include
R11869 T16953 T16967 nummod MHB1661,MHB1662
R11870 T16954 T16956 punct ",",′
R11871 T16955 T16956 nummod 5,′
R11872 T16956 T16967 nmod ′,MHB1662
R11873 T16957 T16958 nummod CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3,′
R11874 T16958 T16956 appos ′,′
R11875 T16959 T16960 punct (,−
R11876 T16960 T16958 appos −,′
R6656 T9559 T9560 det the,expression
R4426 T6363 T6364 compound Transfection,Studies
R13910 T19582 T19581 prep from,purchased

bionlp-st-ge-2016-test-tees

Id Subject Object Predicate Lexical cue
T198 0-4 Protein denotes Sox6
T199 23-37 Protein denotes Epsilon Globin
T200 38-48 Gene_expression denotes Expression
T201 14-22 Negative_regulation denotes Silences
T20377 43517-43535 Protein denotes chromatin-antibody
T20376 43430-43433 Protein denotes IgG
T20375 43388-43392 Protein denotes Sox6
T19687 42207-42211 Protein denotes Sox6
T19686 42199-42201 Protein denotes HA
T19685 42192-42197 Protein denotes c-Myc
T19684 41444-41448 Protein denotes Sox6
T19683 41323-41347 Protein denotes T4 polynucleotide kinase
T19515 41117-41136 Protein denotes rabbit IgG antibody
T19514 41064-41078 Protein denotes c-Myc antibody
T19513 41021-41025 Protein denotes Sox6
T19512 40781-40785 Protein denotes Sox6
T19254 40704-40724 Protein denotes Sox6 coding sequence
T19253 40496-40498 Protein denotes HA
T19252 40486-40491 Protein denotes c-Myc
T19251 40429-40433 Protein denotes Sox6
T19250 40298-40302 Protein denotes Sox6
T17954 37777-37784 Protein denotes SPOT RT
T17953 37305-37309 Protein denotes Sox6
T17952 37224-37273 Protein denotes murine ɛy globin nucleotides 509–584; βmaj globin
T17418 36397-36412 Protein denotes βmaj/min globin
T17417 36307-36317 Protein denotes βH1 globin
T17416 36228-36235 Protein denotes MHB1668
T17415 36218-36226 Protein denotes ζ globin
T17414 36138-36145 Protein denotes MHB1666
T17413 36127-36136 Protein denotes ɛy globin
T17412 35998-36010 Protein denotes globin genes
T17411 35904-35915 Protein denotes globin mRNA
T17423 37103-37108 Protein denotes GAPDH
T17422 36800-36810 Protein denotes GAPDH mRNA
T17421 36536-36539 Protein denotes Rad
T17420 36532-36535 Protein denotes Bio
T17419 36527-36530 Protein denotes ROX
T16499 34455-34459 Protein denotes SstI
T16498 34264-34273 Gene_expression denotes contained
T16497 34264-34273 Gene_expression denotes contained
T16496 34389-34393 Protein denotes pGL3
T16495 34362-34385 Protein denotes firefly luciferase gene
T16494 34283-34296 Protein denotes HindIII sites
T16493 34274-34278 Protein denotes XhoI
T16492 34036-34049 Protein denotes ɛ globin gene
T16491 33971-33976 Protein denotes EcoRI
T16490 33825-33834 Protein denotes ɛy globin
T16489 33769-33789 Protein denotes ɛy proximal promoter
T13479 29677-29687 Gene_expression denotes expression
T13478 29677-29687 Gene_expression denotes expression
T13477 29795-29797 Protein denotes WT
T13476 29762-29779 Protein denotes p100H homozygotes
T13475 29732-29741 Protein denotes ζ and βh1
T13474 29718-29730 Protein denotes globin genes
T13473 29597-29607 Gene_expression denotes expression
T13472 29618-29629 Protein denotes globin gene
T13471 29348-29358 Gene_expression denotes expression
T13470 29392-29396 Protein denotes Sox6
T13469 29368-29377 Protein denotes ɛy globin
T13468 29314-29321 Negative_regulation denotes silence
T13467 29332-29342 Gene_expression denotes expression
T13466 29325-29331 Protein denotes globin
T13465 29267-29271 Protein denotes Sox6
T13464 29110-29113 Positive_regulation denotes due
T13463 29062-29072 Gene_expression denotes expression
T13462 29076-29085 Protein denotes ɛy globin
T13461 28916-28925 Negative_regulation denotes represses
T13460 28936-28946 Gene_expression denotes expression
T13459 28794-28804 Gene_expression denotes expression
T13458 28926-28935 Protein denotes ɛy globin
T13457 28911-28915 Protein denotes Sox6
T13456 28789-28793 Protein denotes Sox6
T13455 28644-28648 Binding denotes bind
T13454 28644-28648 Binding denotes bind
T13453 28668-28686 Protein denotes β globin silencers
T13452 28616-28621 Protein denotes HMG-Y
T13451 28606-28611 Protein denotes HMG-I
T13450 28568-28578 Protein denotes Sox family
T13449 28515-28518 Protein denotes HMG
T13448 28478-28485 Binding denotes binding
T13447 28455-28459 Protein denotes EKLF
T13446 28312-28319 Binding denotes binding
T13445 28254-28261 Binding denotes binding
T13444 28221-28225 Protein denotes Sox6
T13443 27968-27981 Protein denotes Sox6 proteins
T13442 27887-27891 Binding denotes bind
T13441 27803-27807 Binding denotes bind
T13440 27790-27793 Protein denotes Sox
T13437 27568-27572 Protein denotes Sox6
T13436 27461-27465 Binding denotes bind
T13435 27496-27500 Protein denotes Sox6
T13434 27492-27495 Protein denotes Sox
T13433 27421-27438 Protein denotes globin repressors
T13432 27357-27361 Protein denotes Sox6
T13431 27319-27323 Protein denotes Sox6
T13430 27171-27183 Binding denotes interactions
T13429 27015-27018 Protein denotes Sox
T13428 26970-26981 Binding denotes heterodimer
T13427 26952-26961 Binding denotes homodimer
T13426 26952-26961 Binding denotes homodimer
T13425 26898-26903 Binding denotes binds
T13424 26993-27005 Protein denotes Sox proteins
T13423 26893-26897 Protein denotes Sox6
T13422 26764-26773 Positive_regulation denotes essential
T13421 26814-26824 Negative_regulation denotes repression
T13285 26783-26790 Binding denotes binding
T13531 33508-33518 Regulation denotes regulation
T13530 33499-33507 Protein denotes ɛ globin
T13529 33442-33446 Protein denotes Sox6
T13528 33370-33374 Protein denotes Sox6
T13527 33298-33317 Protein denotes human ɛ globin gene
T13526 33235-33239 Protein denotes Sox6
T13525 33054-33063 Positive_regulation denotes important
T13524 33082-33091 Negative_regulation denotes silencing
T13523 33067-33081 Protein denotes human ɛ globin
T13522 33037-33041 Protein denotes Sox6
T13521 32932-32936 Protein denotes Sox6
T13520 32830-32835 Binding denotes binds
T13519 32855-32863 Entity denotes promoter
T13518 32818-32822 Protein denotes Sox6
T13517 32759-32768 Negative_regulation denotes silencing
T13516 32559-32571 Positive_regulation denotes reactivation
T13515 32745-32753 Protein denotes ɛ-globin
T13514 32575-32589 Protein denotes human ɛ-globin
T13513 32435-32439 Protein denotes Sox6
T13512 32346-32350 Protein denotes Sox6
T13511 32005-32014 Gene_expression denotes expressed
T13510 31904-31913 Negative_regulation denotes deficient
T13509 32101-32104 Protein denotes Sox
T13508 31991-32003 Protein denotes Sox proteins
T13507 31899-31903 Protein denotes Sox6
T13506 31632-31636 Protein denotes Sox6
T13505 31173-31178 Protein denotes p100H
T13504 31084-31088 Protein denotes Sox6
T13503 31015-31024 Regulation denotes regulates
T13502 31045-31057 Protein denotes globin genes
T13501 31010-31014 Protein denotes Sox6
T13500 30900-30907 Negative_regulation denotes silence
T13499 30962-30972 Regulation denotes regulation
T13498 30918-30928 Gene_expression denotes expression
T13497 30976-30985 Protein denotes ɛy-globin
T13496 30911-30917 Protein denotes globin
T13495 30858-30862 Protein denotes Sox6
T13494 30715-30723 Positive_regulation denotes elevated
T13493 30623-30635 Positive_regulation denotes undetectable
T13492 30681-30691 Protein denotes globin RNA
T13491 30604-30617 Protein denotes ζ and βh1 RNA
T13490 30466-30472 Positive_regulation denotes levels
T13489 30437-30447 Gene_expression denotes expression
T13488 30476-30485 Protein denotes ɛy globin
T13487 30425-30436 Protein denotes globin gene
T13486 30086-30098 Protein denotes globin genes
T13485 30047-30051 Protein denotes Sox6
T13484 29928-29938 Gene_expression denotes expression
T13483 29896-29905 Protein denotes ɛy globin
T13482 29818-29827 Protein denotes ζ and βh1
T13481 29688-29694 Positive_regulation denotes levels
T13480 29688-29694 Positive_regulation denotes levels
T11627 26498-26504 Binding denotes harbor
T11626 26498-26504 Binding denotes harbor
T11625 26580-26593 Protein denotes D-Sox protein
T11624 26514-26517 Protein denotes HMG
T11623 26483-26487 Protein denotes Sox6
T11622 26453-26473 Protein denotes group D Sox proteins
T11621 26327-26332 Binding denotes binds
T11620 26322-26326 Protein denotes Sox6
T11619 26251-26263 Protein denotes Sox proteins
T11618 26177-26181 Protein denotes Sox6
T11617 26168-26172 Protein denotes Sox5
T11616 26035-26055 Protein denotes Group D Sox proteins
T11615 26008-26012 Protein denotes Sox5
T11614 25971-25981 Protein denotes Sox family
T11613 25940-25944 Protein denotes Sox6
T9851 23335-23344 Gene_expression denotes expressed
T9850 23423-23427 Protein denotes Sox6
T9849 23315-23324 Protein denotes ɛy globin
T9848 23160-23170 Gene_expression denotes expression
T9847 23155-23159 Protein denotes Sox6
T9846 23055-23066 Transcription denotes transcribed
T9845 23040-23044 Protein denotes Sox6
T9844 22857-22861 Protein denotes Sox6
T9843 22744-22754 Gene_expression denotes expression
T9842 22766-22770 Protein denotes Sox6
T9841 22562-22569 Gene_expression denotes express
T9840 22535-22544 Negative_regulation denotes deficient
T9839 22645-22649 Protein denotes Sox6
T9838 22573-22579 Protein denotes globin
T9837 22530-22534 Protein denotes Sox6
T9836 22437-22447 Gene_expression denotes Expression
T9835 22459-22463 Protein denotes Sox6
T9114 21788-21792 Protein denotes Sox6
T9113 21450-21460 Gene_expression denotes expression
T9112 21508-21510 Protein denotes WT
T9111 21473-21479 Protein denotes globin
T9110 21369-21379 Gene_expression denotes expression
T9109 21361-21368 Protein denotes ɛy mRNA
T9108 21243-21252 Gene_expression denotes expressed
T9107 21226-21235 Protein denotes ɛy globin
T9106 21050-21060 Gene_expression denotes expression
T9105 20990-20993 Positive_regulation denotes due
T9104 20963-20973 Gene_expression denotes expression
T9103 21140-21158 Protein denotes globin transcripts
T9102 21067-21073 Protein denotes globin
T9101 20977-20986 Protein denotes ɛy globin
T9100 20890-20898 Positive_regulation denotes silenced
T9099 20850-20859 Gene_expression denotes expressed
T9098 20820-20834 Protein denotes ɛy globin gene
T9097 20707-20716 Negative_regulation denotes Deficient
T9096 20675-20685 Gene_expression denotes Expression
T9095 20702-20706 Protein denotes Sox6
T9094 20692-20698 Protein denotes Globin
T7371 18550-18553 Protein denotes Sox
T7370 18456-18464 Positive_regulation denotes required
T7369 18456-18464 Positive_regulation denotes required
T7368 18473-18480 Binding denotes binding
T7367 18473-18480 Binding denotes binding
T7366 18416-18420 Protein denotes Sox6
T7365 18412-18415 Protein denotes Sox
T7364 18338-18343 Binding denotes binds
T7363 18324-18328 Protein denotes Sox6
T7362 18282-18289 Gene_expression denotes express
T7361 18290-18305 Protein denotes adult β globins
T7360 18042-18047 Binding denotes binds
T7359 18075-18079 Protein denotes Sox6
T7358 18027-18030 Protein denotes Myc
T7357 17973-17977 Protein denotes Sox6
T7356 17905-17909 Protein denotes Sox6
T7355 17895-17900 Protein denotes c-Myc
T7354 17866-17870 Protein denotes Sox6
T7353 17699-17708 Binding denotes associate
T7352 17672-17676 Protein denotes Sox6
T7351 17640-17644 Protein denotes Sox6
T7350 17636-17639 Protein denotes Sox
T7349 17506-17510 Protein denotes Sox6
T7348 17502-17505 Protein denotes Sox
T7347 17102-17112 Binding denotes associated
T7346 17220-17224 Protein denotes Sox6
T7345 17085-17089 Protein denotes Sox6
T7344 16911-16915 Protein denotes Sox6
T7343 16886-16891 Binding denotes Binds
T7342 16902-16910 Entity denotes Promoter
T7341 16872-16876 Protein denotes Sox6
T5742 13851-13855 Protein denotes Sox6
T5741 13795-13798 Protein denotes HMG
T5740 13722-13729 Negative_regulation denotes abolish
T5739 13560-13568 Positive_regulation denotes required
T5738 13741-13752 Binding denotes interaction
T5737 13578-13588 Gene_expression denotes repression
T5736 13534-13545 Binding denotes interaction
T5735 13735-13740 Protein denotes CtBP2
T5734 13730-13734 Protein denotes Sox6
T5733 13655-13667 Protein denotes Sox6 protein
T5732 13573-13577 Protein denotes Sox6
T5731 13551-13556 Protein denotes CtBP2
T5730 13462-13471 Gene_expression denotes expressed
T5729 13453-13458 Protein denotes CtBP2
T5728 13395-13404 Gene_expression denotes expressed
T5727 13372-13380 Binding denotes interact
T5726 13372-13380 Binding denotes interact
T5725 13433-13451 Protein denotes fgf-3 promoter [5]
T5724 13419-13424 Protein denotes CtBP2
T5723 13323-13327 Protein denotes Sox6
T5722 11875-11879 Protein denotes Sox6
T5721 11756-11762 Entity denotes domain
T5720 11694-11708 Positive_regulation denotes overexpression
T5719 11694-11708 Gene_expression denotes overexpression
T5718 11824-11827 Protein denotes Luc
T5717 11784-11803 Protein denotes p 100H mouse allele
T5716 11752-11755 Protein denotes HMG
T5715 11724-11728 Protein denotes Sox6
T5714 11630-11640 Negative_regulation denotes repression
T5713 11538-11552 Positive_regulation denotes Overexpression
T5712 11538-11552 Gene_expression denotes Overexpression
T5711 11644-11658 Protein denotes E-Luc reporter
T5710 11556-11560 Protein denotes Sox6
T5709 11453-11477 Protein denotes luciferase reporter gene
T5708 11343-11346 Protein denotes Luc
T5707 11246-11255 Gene_expression denotes expresses
T5706 11101-11109 Entity denotes promoter
T5705 11274-11286 Protein denotes beta globins
T5704 11067-11071 Protein denotes Sox6
T5703 10986-10993 Protein denotes ɛy mRNA
T5702 10885-10893 Entity denotes Promoter
T5701 10849-10853 Protein denotes Sox6
T5749 14227-14231 Protein denotes Sox6
T5748 14223-14226 Protein denotes Sox
T5747 14169-14179 Gene_expression denotes repression
T5746 14164-14168 Protein denotes Sox6
T5745 13980-13988 Entity denotes promoter
T5744 13994-13999 Protein denotes CtBP2
T5743 13958-13962 Protein denotes Sox6
T4512 10313-10323 Gene_expression denotes expression
T4511 10374-10381 Protein denotes WT mice
T4510 9750-9760 Gene_expression denotes expression
T4509 9743-9749 Protein denotes globin
T4508 9505-9515 Gene_expression denotes expression
T4507 9525-9539 Protein denotes adult β globin
T4506 9457-9466 Protein denotes ɛy globin
T4505 8897-8907 Gene_expression denotes expression
T4504 8897-8907 Gene_expression denotes expression
T4503 8940-8945 Protein denotes p100H
T4502 8924-8936 Protein denotes globin genes
T4501 8778-8782 Protein denotes Sox6
T1587 8319-8326 Negative_regulation denotes absence
T1586 8410-8414 Protein denotes Sox6
T1585 8336-8345 Protein denotes ɛy globin
T1584 8330-8334 Protein denotes Sox6
T1583 8279-8289 Gene_expression denotes expression
T1582 8240-8249 Gene_expression denotes expressed
T1581 8240-8249 Gene_expression denotes expressed
T1580 8196-8205 Gene_expression denotes expressed
T1579 8301-8310 Protein denotes ɛy globin
T1578 8184-8188 Protein denotes Sox6
T1577 8131-8140 Negative_regulation denotes represses
T1576 8083-8088 Binding denotes binds
T1575 8083-8088 Binding denotes binds
T1574 8145-8158 Transcription denotes transcription
T1573 8105-8113 Entity denotes promoter
T1572 8117-8126 Protein denotes ɛy globin
T1571 8078-8082 Protein denotes Sox6
T1570 8026-8033 Regulation denotes effects
T1569 8049-8063 Protein denotes ɛy globin gene
T1568 8037-8041 Protein denotes Sox6
T1567 7944-7954 Gene_expression denotes expression
T1566 7975-7986 Protein denotes globin gene
T1565 7855-7865 Gene_expression denotes expression
T1564 7879-7891 Protein denotes globin genes
T1563 7666-7670 Protein denotes Sox6
T1562 7496-7507 Positive_regulation denotes upregulated
T1561 7488-7492 Protein denotes Sox6
T1560 7111-7115 Binding denotes bind
T1559 7050-7057 Protein denotes COUP-TF
T1558 7044-7048 Protein denotes YY-1
T1557 7036-7042 Protein denotes GATA-1
T1556 6611-6620 Negative_regulation denotes silencing
T1555 6625-6638 Protein denotes ɛ globin gene
T1554 6522-6532 Regulation denotes controlled
T1553 6522-6532 Regulation denotes controlled
T1552 6512-6518 Entity denotes switch
T1551 6497-6511 Protein denotes adult β-globin
T1550 6485-6493 Protein denotes γ-globin
T1549 6237-6246 Negative_regulation denotes silencing
T1548 6273-6281 Protein denotes ɛ globin
T1547 6115-6122 Gene_expression denotes express
T1546 6123-6138 Protein denotes adult β globins
T1545 5927-5945 Protein denotes embryonic yolk sac
T1544 5828-5837 Gene_expression denotes expressed
T1543 5809-5823 Protein denotes β-globin genes
T1542 5409-5423 Protein denotes mouse β-globin
T1541 5372-5380 Regulation denotes modulate
T1540 5381-5389 Protein denotes β-globin
T1539 5340-5352 Protein denotes HMG proteins
T1538 5162-5174 Protein denotes HMG proteins
T1537 5076-5085 Gene_expression denotes expressed
T1536 5076-5085 Gene_expression denotes expressed
T1535 4982-4986 Binding denotes bind
T1534 5095-5108 Protein denotes HMG2 proteins
T1533 5086-5090 Protein denotes HMG1
T1532 4934-4965 Protein denotes Sox transcription factor family
T1531 4894-4897 Protein denotes Sry
T1530 4856-4872 Protein denotes HMG box proteins
T1529 4781-4806 Protein denotes Sox6 transcription factor
T1528 4731-4737 Protein denotes p gene
T1527 4593-4601 Positive_regulation denotes disrupts
T1526 4626-4635 Protein denotes Sox6 gene
T1525 4524-4529 Protein denotes p100H
T1524 4402-4407 Protein denotes p100H
T1523 4296-4300 Protein denotes Sox6
T1522 4137-4141 Protein denotes Sox6
T1521 4051-4055 Protein denotes Sox6
T1520 3887-3897 Gene_expression denotes expression
T1519 3887-3897 Gene_expression denotes expression
T1518 3887-3897 Gene_expression denotes expression
T1517 3887-3897 Gene_expression denotes expression
T1516 3802-3811 Localization denotes Depletion
T1515 3941-3944 Protein denotes Sry
T1514 3932-3936 Protein denotes Sox9
T1513 3926-3930 Protein denotes Sox6
T1512 3905-3915 Protein denotes HMG domain
T1511 3815-3819 Protein denotes Sox6
T1510 3697-3701 Protein denotes Sox6
T1509 3535-3539 Protein denotes Sox6
T1508 3299-3311 Protein denotes Sox proteins
T1507 3095-3099 Binding denotes bind
T1506 3069-3072 Protein denotes Sox
T1505 2884-2890 Binding denotes member
T1504 2884-2890 Binding denotes member
T1503 2884-2890 Binding denotes member
T1502 2898-2929 Protein denotes Sox transcription factor family
T1501 2873-2877 Protein denotes Sox6
T1500 2855-2871 Protein denotes Sry type HMG box
T230 1284-1294 Regulation denotes regulation
T229 1298-1307 Protein denotes ɛy globin
T228 1279-1283 Protein denotes Sox6
T227 1149-1157 Positive_regulation denotes required
T225 1238-1242 Protein denotes Sox6
T224 1178-1184 Protein denotes globin
T223 1141-1145 Protein denotes Sox6
T222 941-951 Gene_expression denotes expression
T221 1067-1071 Protein denotes Sox6
T220 1021-1026 Protein denotes p100H
T219 955-959 Protein denotes Sox6
T218 902-909 Binding denotes binding
T217 920-928 Entity denotes promoter
T216 865-869 Protein denotes Sox6
T215 730-734 Protein denotes Sox6
T214 505-514 Gene_expression denotes expressed
T213 505-514 Gene_expression denotes expressed
T212 455-464 Negative_regulation denotes deficient
T211 479-488 Protein denotes ɛy globin
T210 472-477 Protein denotes p100H
T209 450-454 Protein denotes Sox6
T208 352-356 Protein denotes Sox6
T207 191-198 Negative_regulation denotes defined
T206 191-198 Negative_regulation denotes defined
T205 254-260 Entity denotes domain
T204 310-313 Protein denotes Sry
T203 151-182 Protein denotes Sox transcription factor family
T202 127-131 Protein denotes Sox6
T11611 25881-25890 Negative_regulation denotes represses
T11610 25857-25865 Entity denotes promoter
T11609 25895-25909 Protein denotes ɛy-globin gene
T11608 25807-25811 Protein denotes Sox6
T4500 8589-8600 Positive_regulation denotes upregulated
T4499 8676-8699 Protein denotes Sox6 downstream targets
T4498 8546-8557 Protein denotes globin gene
T4497 8524-8533 Negative_regulation denotes Deficient
T4496 8476-8486 Gene_expression denotes Expression
T4495 8519-8523 Protein denotes Sox6
T4494 8494-8510 Protein denotes Embryonic Globin
T11607 25705-25711 Regulation denotes effect
T226 1162-1171 Negative_regulation denotes silencing
T11606 25771-25783 Positive_regulation denotes upregulation
T11612 25835-25840 Binding denotes binds
T11605 25791-25805 Protein denotes ɛy globin gene
T11604 25729-25741 Protein denotes globin genes
T11603 25667-25671 Protein denotes Sox6
T11602 25622-25632 Regulation denotes regulation
T11601 25646-25658 Protein denotes globin genes
T11600 25580-25584 Protein denotes Sox6
T7396 19783-19790 Binding denotes binding
T7395 19731-19735 Protein denotes Sox6
T7394 19628-19631 Protein denotes IgG
T7393 19572-19576 Protein denotes Sox6
T7392 19477-19490 Protein denotes Sox6 antibody
T7391 19369-19373 Protein denotes Sox6
T7390 19277-19282 Binding denotes binds
T7389 19293-19301 Entity denotes promoter
T7388 19272-19276 Protein denotes Sox6
T7387 19215-19219 Protein denotes Sox6
T7386 19035-19039 Protein denotes Sox6
T7385 19031-19034 Protein denotes Sox
T7384 18967-19005 Protein denotes mutant ɛy promoter reporter constructs
T7383 18884-18888 Protein denotes Sox6
T7382 18836-18840 Protein denotes Sox6
T7381 18832-18835 Protein denotes Sox
T7380 18759-18763 Protein denotes Sox6
T7379 18755-18758 Protein denotes Sox
T7378 18689-18696 Binding denotes binding
T7377 18686-18688 Protein denotes WT
T7376 18585-18592 Negative_regulation denotes abolish
T7375 18585-18592 Negative_regulation denotes abolish
T7374 18610-18617 Binding denotes compete
T7373 18610-18617 Binding denotes compete
T7372 18554-18558 Protein denotes Sox6
T11631 26701-26705 Protein denotes Sox6
T11630 26697-26700 Protein denotes Sox
T11629 26644-26648 Protein denotes Sox6
T11628 26569-26576 Binding denotes binding
T13247 26778-26782 Protein denotes Sox6
T13248 26801-26809 Entity denotes promoter
T13438 27579-27587 Binding denotes interact
T13439 27686-27690 Protein denotes Sox6
T18895 40067-40071 Protein denotes Sox6
T18894 39909-39916 Protein denotes FuGENE6
T18303 38523-38528 Protein denotes eosin
T18302 38507-38518 Protein denotes hematoxylin
T18569 38980-38984 Protein denotes Sox6
T16520 35607-35650 Protein denotes mutagenized ɛy promoter reporter constructs
T16519 35502-35506 Protein denotes Sox6
T16518 35498-35501 Protein denotes Sox
T16517 35418-35423 Negative_regulation denotes lacks
T16516 35428-35438 Protein denotes HMG domain
T16515 35393-35397 Protein denotes Sox6
T16514 35362-35366 Protein denotes Sox6
T16513 35317-35328 Positive_regulation denotes overexpress
T16512 35317-35328 Positive_regulation denotes overexpress
T16511 35317-35328 Gene_expression denotes overexpress
T16510 35317-35328 Gene_expression denotes overexpress
T16509 35329-35333 Protein denotes Sox6
T16508 35286-35290 Protein denotes Sox6
T16507 35233-35240 Protein denotes MHB1477
T16506 35219-35231 Protein denotes HindIII site
T16505 35093-35100 Protein denotes MHB1507
T16504 34780-34789 Protein denotes XhoI site
T16503 34638-34648 Gene_expression denotes expression
T16502 34627-34637 Protein denotes luciferase
T16501 34477-34486 Protein denotes μLCRβ 9.3
T16500 34460-34464 Protein denotes XhoI
T10513 25166-25175 Negative_regulation denotes silencing
T10512 25196-25200 Protein denotes Sox6
T10511 25180-25194 Protein denotes ɛy globin gene
T10510 24702-24707 Protein denotes p100H
T10509 24593-24597 Protein denotes Sox6
R25 T198 T201 causeOf Sox6,Silences
R26 T199 T200 themeOf Epsilon Globin,Expression
R27 T200 T201 themeOf Expression,Silences
R28 T202 T206 themeOf Sox6,defined
R29 T203 T207 themeOf Sox transcription factor family,defined
R30 T204 T205 partOf Sry,domain
R31 T205 T206 Site domain,defined
R32 T205 T207 Site domain,defined
R33 T209 T212 themeOf Sox6,deficient
R34 T210 T213 themeOf p100H,expressed
R35 T211 T214 themeOf ɛy globin,expressed
R36 T216 T218 themeOf Sox6,binding
R37 T217 T218 Site promoter,binding
R38 T219 T222 themeOf Sox6,expression
R39 T223 T227 causeOf Sox6,required
R40 T224 T226 themeOf globin,silencing
R41 T228 T230 themeOf Sox6,regulation
R445 T226 T227 themeOf silencing,required
R753 T1500 T1504 themeOf Sry type HMG box,member
R754 T1501 T1503 themeOf Sox6,member
R755 T1501 T1505 themeOf Sox6,member
R756 T1502 T1504 themeOf Sox transcription factor family,member
R757 T1502 T1505 themeOf Sox transcription factor family,member
R758 T1506 T1507 themeOf Sox,bind
R759 T1511 T1516 themeOf Sox6,Depletion
R760 T1512 T1517 themeOf HMG domain,expression
R761 T1513 T1518 themeOf Sox6,expression
R762 T1514 T1519 themeOf Sox9,expression
R763 T1515 T1520 themeOf Sry,expression
R764 T1526 T1527 themeOf Sox6 gene,disrupts
R765 T1531 T1535 themeOf Sry,bind
R766 T1533 T1536 themeOf HMG1,expressed
R767 T1534 T1537 themeOf HMG2 proteins,expressed
R768 T1539 T1541 causeOf HMG proteins,modulate
R769 T1540 T1541 themeOf β-globin,modulate
R770 T1543 T1544 themeOf β-globin genes,expressed
R771 T1546 T1547 themeOf adult β globins,express
R772 T1548 T1549 themeOf ɛ globin,silencing
R773 T1550 T1553 themeOf γ-globin,controlled
R774 T1550 T1552 partOf γ-globin,switch
R775 T1551 T1554 themeOf adult β-globin,controlled
R776 T1551 T1552 partOf adult β-globin,switch
R777 T1552 T1553 Site switch,controlled
R778 T1552 T1554 Site switch,controlled
R779 T1555 T1556 themeOf ɛ globin gene,silencing
R780 T1558 T1560 themeOf YY-1,bind
R781 T1561 T1562 themeOf Sox6,upregulated
R782 T1564 T1565 themeOf globin genes,expression
R783 T1566 T1567 themeOf globin gene,expression
R784 T1568 T1570 causeOf Sox6,effects
R785 T1569 T1570 themeOf ɛy globin gene,effects
R786 T1571 T1575 themeOf Sox6,binds
R787 T1571 T1576 themeOf Sox6,binds
R788 T1571 T1577 causeOf Sox6,represses
R789 T1572 T1574 themeOf ɛy globin,transcription
R790 T1572 T1576 themeOf ɛy globin,binds
R791 T1572 T1573 partOf ɛy globin,promoter
R792 T1573 T1575 Site promoter,binds
R793 T1573 T1576 Site promoter,binds
R794 T1574 T1577 themeOf transcription,represses
R795 T1578 T1580 themeOf Sox6,expressed
R796 T1578 T1581 themeOf Sox6,expressed
R797 T1579 T1582 themeOf ɛy globin,expressed
R798 T1579 T1583 themeOf ɛy globin,expression
R799 T1585 T1587 themeOf ɛy globin,absence
R3938 T5701 T5702 partOf Sox6,Promoter
R3939 T5705 T5707 themeOf beta globins,expresses
R3940 T5710 T5712 themeOf Sox6,Overexpression
R3941 T5711 T5714 themeOf E-Luc reporter,repression
R3942 T5712 T5713 themeOf Overexpression,Overexpression
R3943 T5713 T5714 causeOf Overexpression,repression
R3944 T5715 T5719 themeOf Sox6,overexpression
R3945 T5716 T5721 partOf HMG,domain
R3946 T5719 T5720 themeOf overexpression,overexpression
R3947 T5723 T5726 themeOf Sox6,interact
R3948 T5723 T5727 themeOf Sox6,interact
R3949 T5724 T5726 themeOf CtBP2,interact
R3950 T5724 T5728 themeOf CtBP2,expressed
R3951 T5725 T5727 themeOf fgf-3 promoter [5],interact
R3952 T5729 T5730 themeOf CtBP2,expressed
R3953 T5731 T5736 themeOf CtBP2,interaction
R3954 T5732 T5737 themeOf Sox6,repression
R3955 T5734 T5738 themeOf Sox6,interaction
R3956 T5735 T5738 themeOf CtBP2,interaction
R3957 T5736 T5739 causeOf interaction,required
R3958 T5737 T5739 themeOf repression,required
R3959 T5738 T5740 themeOf interaction,abolish
R3960 T5746 T5747 themeOf Sox6,repression
R4983 T7341 T7343 themeOf Sox6,Binds
R4984 T7342 T7343 Site Promoter,Binds
R4985 T7345 T7347 themeOf Sox6,associated
R4986 T7352 T7353 themeOf Sox6,associate
R4987 T7358 T7360 themeOf Myc,binds
R4988 T7361 T7362 themeOf adult β globins,express
R4989 T7363 T7364 themeOf Sox6,binds
R4990 T7365 T7367 themeOf Sox,binding
R4991 T7366 T7368 themeOf Sox6,binding
R4992 T7367 T7369 themeOf binding,required
R4993 T7368 T7370 themeOf binding,required
R4994 T7371 T7373 themeOf Sox,compete
R4995 T7372 T7374 themeOf Sox6,compete
R4996 T7373 T7375 themeOf compete,abolish
R4997 T7374 T7376 themeOf compete,abolish
R4998 T7377 T7378 themeOf WT,binding
R4999 T7388 T7390 themeOf Sox6,binds
R5000 T7389 T7390 Site promoter,binds
R5001 T7395 T7396 themeOf Sox6,binding
R6263 T9095 T9097 themeOf Sox6,Deficient
R6264 T9098 T9099 themeOf ɛy globin gene,expressed
R6265 T9098 T9100 themeOf ɛy globin gene,silenced
R6266 T9101 T9104 themeOf ɛy globin,expression
R6267 T9102 T9106 themeOf globin,expression
R6268 T9104 T9105 themeOf expression,due
R6269 T9107 T9108 themeOf ɛy globin,expressed
R6270 T9109 T9110 themeOf ɛy mRNA,expression
R6271 T9111 T9113 themeOf globin,expression
R6774 T9835 T9836 themeOf Sox6,Expression
R6775 T9837 T9840 themeOf Sox6,deficient
R6776 T9838 T9841 themeOf globin,express
R6777 T9842 T9843 themeOf Sox6,expression
R6778 T9845 T9846 themeOf Sox6,transcribed
R6779 T9847 T9848 themeOf Sox6,expression
R6780 T9849 T9851 themeOf ɛy globin,expressed
R7679 T11601 T11602 themeOf globin genes,regulation
R7680 T11604 T11607 causeOf globin genes,effect
R7681 T11605 T11606 themeOf ɛy globin gene,upregulation
R7682 T11606 T11607 themeOf upregulation,effect
R7683 T11608 T11612 themeOf Sox6,binds
R7684 T11609 T11611 themeOf ɛy-globin gene,represses
R7685 T11610 T11612 Site promoter,binds
R7686 T11620 T11621 themeOf Sox6,binds
R7687 T11622 T11626 themeOf group D Sox proteins,harbor
R7688 T11623 T11627 themeOf Sox6,harbor
R7689 T11625 T11628 themeOf D-Sox protein,binding
R9118 T13247 T13285 themeOf Sox6,binding
R9124 T13248 T13285 Site promoter,binding
R9147 T13285 T13421 themeOf binding,repression
R9148 T13285 T13422 themeOf binding,essential
R9199 T13423 T13425 themeOf Sox6,binds
R9200 T13423 T13426 themeOf Sox6,homodimer
R9201 T13423 T13427 themeOf Sox6,homodimer
R9202 T13423 T13428 themeOf Sox6,heterodimer
R9203 T13424 T13427 themeOf Sox proteins,homodimer
R9204 T13424 T13428 themeOf Sox proteins,heterodimer
R9205 T13429 T13430 themeOf Sox,interactions
R9207 T13433 T13436 themeOf globin repressors,bind
R9212 T13437 T13438 themeOf Sox6,interact
R9217 T13440 T13441 themeOf Sox,bind
R9219 T13440 T13442 themeOf Sox,bind
R9220 T13444 T13445 themeOf Sox6,binding
R9270 T13514 T13516 themeOf human ɛ-globin,reactivation
R9272 T13515 T13517 themeOf ɛ-globin,silencing
R9274 T13518 T13520 themeOf Sox6,binds
R9275 T13519 T13520 Site promoter,binds
R9277 T13522 T13525 causeOf Sox6,important
R9279 T13523 T13524 themeOf human ɛ globin,silencing
R9280 T13524 T13525 themeOf silencing,important
R9282 T13530 T13531 themeOf ɛ globin,regulation
R11461 T16493 T16497 themeOf XhoI,contained
R11462 T16494 T16498 themeOf HindIII sites,contained
R11463 T16502 T16503 themeOf luciferase,expression
R11464 T16508 T16510 themeOf Sox6,overexpress
R7294 T10511 T10513 themeOf ɛy globin gene,silencing
R11465 T16509 T16511 themeOf Sox6,overexpress
R11466 T16510 T16512 themeOf overexpress,overexpress
R11467 T16511 T16513 themeOf overexpress,overexpress
R11468 T16516 T16517 themeOf HMG domain,lacks
R3091 T4494 T4496 themeOf Embryonic Globin,Expression
R3092 T4495 T4497 themeOf Sox6,Deficient
R3093 T4498 T4500 themeOf globin gene,upregulated
R3094 T4502 T4504 themeOf globin genes,expression
R3095 T4503 T4505 themeOf p100H,expression
R3096 T4507 T4508 themeOf adult β globin,expression
R3097 T4509 T4510 themeOf globin,expression
R3098 T4511 T4512 themeOf WT mice,expression
R6262 T9094 T9096 themeOf Globin,Expression
R9221 T13444 T13446 themeOf Sox6,binding
R9223 T13447 T13448 themeOf EKLF,binding
R9224 T13449 T13454 themeOf HMG,bind
R9225 T13449 T13455 themeOf HMG,bind
R9226 T13453 T13455 themeOf β globin silencers,bind
R9227 T13456 T13459 themeOf Sox6,expression
R9228 T13457 T13461 causeOf Sox6,represses
R9230 T13458 T13460 themeOf ɛy globin,expression
R9232 T13460 T13461 themeOf expression,represses
R9233 T13462 T13463 themeOf ɛy globin,expression
R9235 T13463 T13464 themeOf expression,due
R9237 T13465 T13468 causeOf Sox6,silence
R9238 T13466 T13467 themeOf globin,expression
R9239 T13467 T13468 themeOf expression,silence
R9240 T13469 T13471 themeOf ɛy globin,expression
R9242 T13472 T13473 themeOf globin gene,expression
R9243 T13474 T13478 themeOf globin genes,expression
R9244 T13475 T13479 themeOf ζ and βh1,expression
R9245 T13478 T13480 themeOf expression,levels
R9246 T13479 T13481 themeOf expression,levels
R9247 T13483 T13484 themeOf ɛy globin,expression
R9250 T13487 T13489 themeOf globin gene,expression
R9251 T13488 T13490 themeOf ɛy globin,levels
R9252 T13491 T13493 themeOf ζ and βh1 RNA,undetectable
R9253 T13492 T13494 themeOf globin RNA,elevated
R9255 T13495 T13500 causeOf Sox6,silence
R9257 T13496 T13498 themeOf globin,expression
R9258 T13497 T13499 themeOf ɛy-globin,regulation
R9259 T13498 T13500 themeOf expression,silence
R9262 T13501 T13503 causeOf Sox6,regulates
R9263 T13502 T13503 themeOf globin genes,regulates
R9266 T13507 T13510 themeOf Sox6,deficient
R9267 T13508 T13511 themeOf Sox proteins,expressed

testone

Id Subject Object Predicate Lexical cue
T22 127-131 Protein denotes Sox6
T20 0-4 Protein denotes Sox6
T21 23-37 Protein denotes Epsilon Globin
T39 38-48 Gene_expression denotes Expression
T20330 43847-43849 Protein denotes ɛy
T20329 43742-43744 Protein denotes ɛy
T20328 43388-43392 Protein denotes Sox6
T20327 43217-43226 Protein denotes protein A
T19635 42207-42211 Protein denotes Sox6
T19634 42199-42201 Protein denotes HA
T19633 42192-42197 Protein denotes c-Myc
T19632 41540-41543 Protein denotes BSA
T19631 41444-41448 Protein denotes Sox6
T19630 41323-41347 Protein denotes T4 polynucleotide kinase
T19108 40704-40708 Protein denotes Sox6
T19107 40496-40498 Protein denotes HA
T19106 40486-40491 Protein denotes c-Myc
T19105 40429-40433 Protein denotes Sox6
T19104 40298-40302 Protein denotes Sox6
T19395 41064-41069 Protein denotes c-Myc
T19394 41021-41025 Protein denotes Sox6
T19393 40781-40785 Protein denotes Sox6
T18697 40067-40071 Protein denotes Sox6
T18696 39992-39994 Protein denotes ɛy
T18447 38980-38984 Protein denotes Sox6
T17735 37305-37309 Protein denotes Sox6
T17734 37262-37273 Protein denotes βmaj globin
T17733 37231-37240 Protein denotes ɛy globin
T17127 35888-35900 Negative_regulation denotes Quantitation
T17126 37103-37108 Protein denotes GAPDH
T17125 36800-36805 Protein denotes GAPDH
T17124 36402-36412 Protein denotes min globin
T17123 36397-36401 Protein denotes βmaj
T17122 36307-36317 Protein denotes βH1 globin
T17121 36218-36226 Protein denotes ζ globin
T17120 36127-36136 Protein denotes ɛy globin
T15960 34652-34658 Positive_regulation denotes driven
T15959 34638-34648 Gene_expression denotes expression
T15958 33933-33942 Negative_regulation denotes silencing
T15957 35538-35540 Protein denotes ɛy
T15956 35393-35397 Protein denotes Sox6
T15955 35362-35366 Protein denotes Sox6
T15954 35329-35333 Protein denotes Sox6
T15953 35286-35290 Protein denotes Sox6
T15952 34718-34720 Protein denotes ɛy
T15951 34666-34668 Protein denotes ɛy
T15950 34627-34637 Protein denotes luciferase
T15949 34539-34541 Protein denotes ɛy
T15948 34370-34380 Protein denotes luciferase
T15947 34325-34327 Protein denotes ɛy
T15946 34036-34044 Protein denotes ɛ globin
T15945 33926-33927 Protein denotes ɛ
T15944 33825-33834 Protein denotes ɛy globin
T15943 33769-33771 Protein denotes ɛy
T15942 33681-33683 Protein denotes ɛy
T10922 33082-33091 Negative_regulation denotes silencing
T10921 32855-32863 Entity denotes promoter
T10920 32846-32854 Entity denotes proximal
T10866 33160-33161 Protein denotes ɛ
T10865 33073-33081 Protein denotes ɛ globin
T10864 33037-33041 Protein denotes Sox6
T10863 32932-32936 Protein denotes Sox6
T10862 32843-32845 Protein denotes ɛy
T10861 32818-32822 Protein denotes Sox6
T10860 32745-32753 Protein denotes ɛ-globin
T10859 32581-32589 Protein denotes ɛ-globin
T10858 32435-32439 Protein denotes Sox6
T10857 32346-32350 Protein denotes Sox6
T10856 31899-31903 Protein denotes Sox6
T10855 31632-31636 Protein denotes Sox6
T10854 31084-31088 Protein denotes Sox6
T10853 31010-31014 Protein denotes Sox6
T10852 30976-30985 Protein denotes ɛy-globin
T10851 30908-30917 Protein denotes ɛy globin
T10850 30858-30862 Protein denotes Sox6
T10849 30674-30687 Protein denotes β-like globin
T10848 30610-30613 Protein denotes βh1
T10847 30604-30605 Protein denotes ζ
T10846 30533-30535 Protein denotes ɛy
T10845 30476-30485 Protein denotes ɛy globin
T10844 30172-30174 Protein denotes ɛy
T10843 30047-30051 Protein denotes Sox6
T10842 30022-30025 Protein denotes βh1
T10841 30016-30017 Protein denotes ζ
T10840 29983-29985 Protein denotes ɛy
T10839 29913-29916 Protein denotes βh1
T10838 29907-29908 Protein denotes ζ
T10837 29896-29905 Protein denotes ɛy globin
T10836 29824-29827 Protein denotes βh1
T10835 29818-29819 Protein denotes ζ
T10834 29804-29806 Protein denotes ɛy
T10833 29738-29741 Protein denotes βh1
T10832 29732-29733 Protein denotes ζ
T10831 29615-29624 Protein denotes ɛy globin
T10830 29481-29484 Protein denotes min
T10829 29476-29480 Protein denotes βmaj
T10828 29392-29396 Protein denotes Sox6
T10827 29368-29377 Protein denotes ɛy globin
T10826 29322-29331 Protein denotes ɛy globin
T10825 29267-29271 Protein denotes Sox6
T10824 29076-29085 Protein denotes ɛy globin
T10823 28926-28935 Protein denotes ɛy globin
T10822 28911-28915 Protein denotes Sox6
T10821 28789-28793 Protein denotes Sox6
T10820 28704-28706 Protein denotes II
T10819 28688-28699 Protein denotes silencers I
T10818 28616-28621 Protein denotes HMG-Y
T10817 28606-28611 Protein denotes HMG-I
T10816 28493-28495 Protein denotes ɛy
T10815 28455-28459 Protein denotes EKLF
T10814 28434-28438 Protein denotes DRED
T10813 28428-28432 Protein denotes DRED
T10812 28413-28415 Protein denotes ɛy
T10811 28221-28225 Protein denotes Sox6
T10810 27968-27972 Protein denotes Sox6
T10809 27730-27732 Protein denotes ɛy
T10808 27686-27690 Protein denotes Sox6
T10807 27568-27572 Protein denotes Sox6
T10806 27559-27561 Protein denotes TF
T10805 27554-27558 Protein denotes COUP
T10804 27532-27536 Protein denotes DRED
T10803 27418-27427 Protein denotes ɛy globin
T10802 27357-27361 Protein denotes Sox6
T10801 27319-27323 Protein denotes Sox6
T10800 26928-26930 Protein denotes ɛy
T10799 26893-26897 Protein denotes Sox6
T10798 26798-26800 Protein denotes ɛy
T10797 26778-26782 Protein denotes Sox6
T10796 26672-26674 Protein denotes ɛy
T10795 26644-26648 Protein denotes Sox6
T10794 26483-26487 Protein denotes Sox6
T10793 26322-26326 Protein denotes Sox6
T10792 26177-26181 Protein denotes Sox6
T10791 26168-26172 Protein denotes Sox5
T10790 26026-26028 Protein denotes 23
T10789 26018-26020 Protein denotes 13
T10788 26014-26016 Protein denotes 12
T10787 26008-26012 Protein denotes Sox5
T10786 25940-25944 Protein denotes Sox6
T10785 25895-25904 Protein denotes ɛy-globin
T10784 25869-25876 Protein denotes ɛy gene
T10783 25807-25811 Protein denotes Sox6
T10782 25791-25800 Protein denotes ɛy globin
T10781 25749-25752 Protein denotes βH1
T10780 25743-25744 Protein denotes ζ
T10779 25667-25671 Protein denotes Sox6
T10778 25580-25584 Protein denotes Sox6
T10338 25166-25175 Negative_regulation denotes silencing
T10337 25196-25200 Protein denotes Sox6
T10336 25180-25189 Protein denotes ɛy globin
T10335 24593-24597 Protein denotes Sox6
T10919 32830-32835 Binding denotes binds
T10918 32759-32768 Negative_regulation denotes silencing
T10917 32559-32571 Negative_regulation denotes reactivation
T10916 31904-31913 Negative_regulation denotes deficient
T10915 30962-30972 Regulation denotes regulation
T10914 30918-30928 Gene_expression denotes expression
T10913 30900-30907 Negative_regulation denotes silence
T10912 30715-30723 Positive_regulation denotes elevated
T10911 30437-30447 Gene_expression denotes expression
T10910 29989-29998 Regulation denotes regulated
T10909 29928-29938 Gene_expression denotes expression
T10908 29677-29687 Gene_expression denotes expression
T10907 29597-29607 Gene_expression denotes expression
T10906 29589-29596 Negative_regulation denotes ectopic
T10905 29485-29495 Gene_expression denotes expression
T10904 29332-29342 Gene_expression denotes expression
T10903 29314-29321 Negative_regulation denotes silence
T10902 28936-28946 Gene_expression denotes expression
T10901 28755-28762 Binding denotes binding
T10900 28644-28648 Binding denotes bind
T10899 28478-28485 Binding denotes binding
T10898 28312-28319 Binding denotes binding
T10897 28289-28297 Entity denotes promoter
T10896 28254-28261 Binding denotes binding
T10895 28239-28248 Negative_regulation denotes interfere
T10894 27887-27891 Binding denotes bind
T10893 27803-27807 Binding denotes bind
T10892 27579-27587 Binding denotes interact
T10891 27461-27465 Binding denotes bind
T10890 27171-27183 Binding denotes interactions
T10889 27028-27037 Binding denotes recognize
T10888 26912-26920 Entity denotes sequence
T10887 26898-26903 Binding denotes binds
T10886 26783-26790 Binding denotes binding
T10885 26569-26576 Binding denotes binding
T10884 26526-26531 Entity denotes sites
T10883 26367-26372 Entity denotes motif
T10882 26356-26360 Entity denotes -box
T10881 26327-26332 Binding denotes binds
T10880 26221-26228 Binding denotes binding
T10879 26208-26216 Positive_regulation denotes increase
T10878 26152-26164 Binding denotes dimerization
T10877 25881-25890 Negative_regulation denotes represses
T10876 25857-25865 Entity denotes promoter
T10875 25848-25856 Entity denotes proximal
T10874 25835-25840 Binding denotes binds
T10873 25821-25830 Regulation denotes regulates
T10872 25771-25783 Positive_regulation denotes upregulation
T10871 25705-25711 Regulation denotes effect
T10870 33499-33507 Protein denotes ɛ globin
T10869 33442-33446 Protein denotes Sox6
T10868 33370-33374 Protein denotes Sox6
T10867 33304-33312 Protein denotes ɛ globin
T9750 23335-23344 Gene_expression denotes expressed
T9749 23160-23170 Gene_expression denotes expression
T9748 22562-22569 Gene_expression denotes express
T9747 22535-22544 Negative_regulation denotes deficient
T9746 23423-23427 Protein denotes Sox6
T9745 23315-23324 Protein denotes ɛy globin
T9744 23155-23159 Protein denotes Sox6
T9743 23040-23044 Protein denotes Sox6
T9742 22857-22861 Protein denotes Sox6
T9741 22766-22770 Protein denotes Sox6
T9740 22645-22649 Protein denotes Sox6
T9739 22570-22579 Protein denotes ɛy globin
T9738 22530-22534 Protein denotes Sox6
T9737 22459-22463 Protein denotes Sox6
T8982 21748-21754 Negative_regulation denotes defect
T8981 21450-21460 Gene_expression denotes expression
T8980 21364-21368 Transcription denotes mRNA
T8979 21243-21252 Gene_expression denotes expressed
T8978 20963-20973 Gene_expression denotes expression
T8977 20850-20859 Gene_expression denotes expressed
T8976 20707-20716 Negative_regulation denotes Deficient
T8975 20675-20685 Gene_expression denotes Expression
T8974 21788-21792 Protein denotes Sox6
T8973 21762-21764 Protein denotes ɛy
T8972 21611-21613 Protein denotes ɛy
T8971 21469-21479 Protein denotes min globin
T8970 21464-21468 Protein denotes βmaj
T8969 21361-21363 Protein denotes ɛy
T8968 21226-21235 Protein denotes ɛy globin
T8967 21137-21146 Protein denotes ɛy globin
T8966 21064-21073 Protein denotes ɛy globin
T8965 20977-20986 Protein denotes ɛy globin
T8964 20820-20829 Protein denotes ɛy globin
T8963 20748-20750 Protein denotes ɛy
T8962 20702-20706 Protein denotes Sox6
T8961 20689-20698 Protein denotes ɛy Globin
T7057 19801-19809 Entity denotes promoter
T7056 19798-19800 Entity denotes ɛy
T7055 19783-19790 Binding denotes binding
T7054 19293-19301 Entity denotes promoter
T7053 19277-19282 Binding denotes binds
T7052 18689-18696 Binding denotes binding
T7051 18473-18480 Binding denotes binding
T7050 18456-18464 Positive_regulation denotes required
T7049 18338-18343 Binding denotes binds
T7048 18282-18289 Gene_expression denotes express
T7047 18042-18047 Binding denotes binds
T7046 17962-17969 Binding denotes binding
T7045 17721-17723 Entity denotes bp
T7044 17718-17720 Entity denotes 36
T7043 17699-17708 Binding denotes associate
T7042 17102-17112 Binding denotes associated
T7041 17035-17044 Regulation denotes affecting
T7040 16922-16929 Negative_regulation denotes repress
T7039 16902-16910 Entity denotes Promoter
T7038 16886-16891 Binding denotes Binds
T7037 19798-19800 Protein denotes ɛy
T7036 19763-19765 Protein denotes ɛy
T7035 19731-19735 Protein denotes Sox6
T7034 19572-19576 Protein denotes Sox6
T7033 19516-19518 Protein denotes ɛy
T7032 19477-19481 Protein denotes Sox6
T7031 19369-19373 Protein denotes Sox6
T7030 19290-19292 Protein denotes ɛy
T7029 19272-19276 Protein denotes Sox6
T7028 19215-19219 Protein denotes Sox6
T7027 19209-19211 Protein denotes ɛy
T7026 18974-18976 Protein denotes ɛy
T7025 18884-18888 Protein denotes Sox6
T7024 18783-18785 Protein denotes ɛy
T7023 18324-18328 Protein denotes Sox6
T7022 18315-18317 Protein denotes ɛy
T7021 18296-18305 Protein denotes β globins
T7020 18075-18079 Protein denotes Sox6
T7019 18065-18067 Protein denotes HA
T7018 18025-18030 Protein denotes c-Myc
T7017 17973-17977 Protein denotes Sox6
T7016 17905-17909 Protein denotes Sox6
T7015 17895-17900 Protein denotes c-Myc
T7014 17866-17870 Protein denotes Sox6
T7013 17754-17756 Protein denotes ɛy
T7012 17672-17676 Protein denotes Sox6
T7011 17413-17415 Protein denotes ɛy
T7010 17220-17224 Protein denotes Sox6
T7009 17207-17212 Protein denotes c-Myc
T7008 17122-17124 Protein denotes ɛy
T7007 17085-17089 Protein denotes Sox6
T7006 17049-17051 Protein denotes ɛy
T7005 16934-16936 Protein denotes ɛy
T7004 16911-16915 Protein denotes Sox6
T7003 16899-16901 Protein denotes ɛy
T7002 16872-16876 Protein denotes Sox6
T5517 14020-14028 Negative_regulation denotes Deletion
T5516 13963-13972 Negative_regulation denotes represses
T5515 13741-13752 Binding denotes interaction
T5514 13722-13729 Negative_regulation denotes abolish
T5513 13578-13588 Negative_regulation denotes repression
T5512 13534-13545 Binding denotes interaction
T5511 13462-13471 Gene_expression denotes expressed
T5510 13372-13380 Binding denotes interact
T5509 11903-11911 Entity denotes promoter
T5508 11888-11895 Negative_regulation denotes repress
T5507 10999-11014 Transcription denotes transcriptional
T5506 10863-10872 Negative_regulation denotes Represses
T5505 14164-14168 Protein denotes Sox6
T5504 14122-14124 Protein denotes ɛy
T5503 14045-14047 Protein denotes ɛy
T5502 13994-13999 Protein denotes CtBP2
T5501 13977-13979 Protein denotes ɛy
T5500 13958-13962 Protein denotes Sox6
T5499 13891-13893 Protein denotes ɛy
T5498 13851-13855 Protein denotes Sox6
T5497 13735-13740 Protein denotes CtBP2
T5496 13730-13734 Protein denotes Sox6
T5495 13655-13659 Protein denotes Sox6
T5494 13596-13598 Protein denotes ɛy
T5493 13573-13577 Protein denotes Sox6
T5492 13551-13556 Protein denotes CtBP2
T5491 13453-13458 Protein denotes CtBP2
T5490 13433-13438 Protein denotes fgf-3
T5489 13419-13424 Protein denotes CtBP2
T5488 13323-13327 Protein denotes Sox6
T5487 11900-11902 Protein denotes ɛy
T5486 11875-11879 Protein denotes Sox6
T5485 11724-11728 Protein denotes Sox6
T5484 11556-11560 Protein denotes Sox6
T5483 11453-11463 Protein denotes luciferase
T5482 11406-11408 Protein denotes ɛy
T5481 11309-11311 Protein denotes ɛy
T5480 11274-11286 Protein denotes beta globins
T5479 11261-11263 Protein denotes ɛy
T5478 11093-11095 Protein denotes ɛy
T5477 11067-11071 Protein denotes Sox6
T5476 11031-11033 Protein denotes ɛy
T5475 10986-10988 Protein denotes ɛy
T5474 10877-10879 Protein denotes ɛy
T5473 10849-10853 Protein denotes Sox6
T4390 10313-10323 Gene_expression denotes expression
T4389 10187-10197 Gene_expression denotes expression
T4388 9505-9515 Gene_expression denotes expression
T4387 9280-9290 Gene_expression denotes expression
T4386 9153-9163 Gene_expression denotes expression
T4385 9062-9071 Gene_expression denotes expressed
T4384 8897-8907 Gene_expression denotes expression
T4383 8524-8533 Negative_regulation denotes Deficient
T4382 8476-8486 Gene_expression denotes Expression
T4381 10309-10312 Protein denotes min
T4380 10304-10308 Protein denotes βmaj
T4379 10184-10186 Protein denotes ɛy
T4378 9531-9539 Protein denotes β globin
T4377 9457-9466 Protein denotes ɛy globin
T4376 9345-9348 Protein denotes βh1
T4375 9339-9340 Protein denotes ζ
T4374 9051-9053 Protein denotes ɛy
T4373 8778-8782 Protein denotes Sox6
T4372 8676-8680 Protein denotes Sox6
T4371 8543-8552 Protein denotes ɛy globin
T4370 8519-8523 Protein denotes Sox6
T4369 8512-8514 Protein denotes ɛy
T4368 8504-8510 Protein denotes Globin
T1065 8361-8370 Gene_expression denotes expressed
T1064 8319-8326 Negative_regulation denotes absence
T1063 8279-8289 Gene_expression denotes expression
T1062 8240-8249 Gene_expression denotes expressed
T1061 8196-8205 Gene_expression denotes expressed
T1060 8131-8140 Negative_regulation denotes represses
T1059 8105-8113 Entity denotes promoter
T1058 8096-8104 Entity denotes proximal
T1057 8083-8088 Binding denotes binds
T1056 8026-8033 Regulation denotes effects
T1055 7944-7954 Gene_expression denotes expression
T1054 7496-7507 Positive_regulation denotes upregulated
T1053 7225-7234 Negative_regulation denotes silencing
T1052 7183-7192 Negative_regulation denotes silencing
T1051 7172-7180 Regulation denotes regulate
T1050 7111-7115 Binding denotes bind
T1049 6708-6717 Negative_regulation denotes silencing
T1048 6611-6620 Negative_regulation denotes silencing
T1047 6545-6556 Negative_regulation denotes competition
T1046 6536-6544 Entity denotes promoter
T1045 6522-6532 Regulation denotes controlled
T1044 6451-6460 Regulation denotes regulated
T1043 6348-6357 Positive_regulation denotes activated
T1042 6237-6246 Negative_regulation denotes silencing
T1041 6115-6122 Gene_expression denotes express
T1040 5978-5985 Gene_expression denotes express
T1039 5828-5837 Gene_expression denotes expressed
T1038 5372-5380 Regulation denotes modulate
T1037 5076-5085 Gene_expression denotes expressed
T1036 4982-4986 Binding denotes bind
T1035 4593-4601 Negative_regulation denotes disrupts
T1034 3887-3897 Gene_expression denotes expression
T1033 3095-3099 Binding denotes bind
T1032 3056-3063 Binding denotes binding
T1031 8410-8414 Protein denotes Sox6
T1030 8336-8345 Protein denotes ɛy globin
T1029 8330-8334 Protein denotes Sox6
T1028 8301-8310 Protein denotes ɛy globin
T1027 8184-8188 Protein denotes Sox6
T1026 8117-8126 Protein denotes ɛy globin
T1025 8078-8082 Protein denotes Sox6
T1024 8049-8058 Protein denotes ɛy globin
T1023 8037-8041 Protein denotes Sox6
T1022 7972-7981 Protein denotes ɛy globin
T1021 7666-7670 Protein denotes Sox6
T1020 7488-7492 Protein denotes Sox6
T1019 7242-7243 Protein denotes ɛ
T1018 7181-7182 Protein denotes ɛ
T1017 7063-7067 Protein denotes DRED
T1016 7050-7057 Protein denotes COUP-TF
T1015 7044-7048 Protein denotes YY-1
T1014 7036-7042 Protein denotes GATA-1
T1013 6963-6964 Protein denotes ɛ
T1012 6654-6655 Protein denotes ɛ
T1011 6625-6633 Protein denotes ɛ globin
T1010 6503-6511 Protein denotes β-globin
T1009 6485-6493 Protein denotes γ-globin
T1008 6430-6431 Protein denotes ɛ
T1007 6343-6344 Protein denotes ɛ
T1006 6273-6281 Protein denotes ɛ globin
T1005 6169-6171 Protein denotes ɛy
T1004 6152-6157 Protein denotes minor
T1003 6140-6147 Protein denotes β major
T1002 5993-6005 Protein denotes βh-1 globins
T1001 5986-5988 Protein denotes ɛy
T1000 5791-5793 Protein denotes ɛy
T999 5453-5460 Protein denotes β-minor
T998 5440-5447 Protein denotes β-major
T997 5435-5438 Protein denotes βh1
T996 5431-5433 Protein denotes ɛy
T995 5095-5099 Protein denotes HMG2
T994 5086-5090 Protein denotes HMG1
T993 4894-4897 Protein denotes Sry
T992 4781-4785 Protein denotes Sox6
T991 4731-4732 Protein denotes p
T990 4626-4630 Protein denotes Sox6
T989 4611-4612 Protein denotes p
T988 4296-4300 Protein denotes Sox6
T987 4137-4141 Protein denotes Sox6
T986 4051-4055 Protein denotes Sox6
T985 3941-3944 Protein denotes Sry
T984 3932-3936 Protein denotes Sox9
T983 3926-3930 Protein denotes Sox6
T982 3815-3819 Protein denotes Sox6
T981 3697-3701 Protein denotes Sox6
T980 3535-3539 Protein denotes Sox6
T979 2873-2877 Protein denotes Sox6
T978 2855-2858 Protein denotes Sry
T23 310-313 Protein denotes Sry
T24 352-356 Protein denotes Sox6
T25 450-454 Protein denotes Sox6
T26 479-488 Protein denotes ɛy globin
T27 688-690 Protein denotes ɛy
T28 730-734 Protein denotes Sox6
T29 865-869 Protein denotes Sox6
T30 917-919 Protein denotes ɛy
T31 955-959 Protein denotes Sox6
T32 1015-1017 Protein denotes ɛy
T33 1067-1071 Protein denotes Sox6
T34 1141-1145 Protein denotes Sox6
T35 1175-1184 Protein denotes ɛy globin
T36 1238-1242 Protein denotes Sox6
T37 1279-1283 Protein denotes Sox6
T38 1298-1307 Protein denotes ɛy globin
T40 455-464 Negative_regulation denotes deficient
T41 505-514 Gene_expression denotes expressed
T42 902-909 Binding denotes binding
T43 920-928 Entity denotes promoter
T44 1284-1294 Regulation denotes regulation
R5 T37 T44 causeOf Sox6,regulation
R6 T38 T44 themeOf ɛy globin,regulation
R7 T43 T30 partOf promoter,ɛy
R8 T43 T42 themeOf promoter,binding
R597 T978 T1032 themeOf Sry,binding
R598 T979 T978 equivalentTo Sox6,Sry
R599 T983 T1034 themeOf Sox6,expression
R600 T984 T1034 themeOf Sox9,expression
R601 T985 T1034 themeOf Sry,expression
R602 T989 T1035 themeOf p,disrupts
R603 T990 T1035 themeOf Sox6,disrupts
R604 T993 T1036 themeOf Sry,bind
R605 T994 T1037 themeOf HMG1,expressed
R606 T995 T1037 themeOf HMG2,expressed
R607 T1001 T1040 themeOf ɛy,express
R608 T1002 T1040 themeOf βh-1 globins,express
R609 T1003 T1041 themeOf β major,express
R610 T1006 T1042 themeOf ɛ globin,silencing
R611 T1007 T1044 themeOf ɛ,regulated
R612 T1007 T1043 themeOf ɛ,activated
R613 T1008 T1044 themeOf ɛ,regulated
R614 T1011 T1048 themeOf ɛ globin,silencing
R615 T1014 T1050 themeOf GATA-1,bind
R616 T1015 T1050 themeOf YY-1,bind
R617 T1016 T1050 themeOf COUP-TF,bind
R618 T1017 T1050 themeOf DRED,bind
R619 T1018 T1052 themeOf ɛ,silencing
R620 T1019 T1053 themeOf ɛ,silencing
R621 T1020 T1054 themeOf Sox6,upregulated
R622 T1022 T1055 themeOf ɛy globin,expression
R623 T1024 T1056 themeOf ɛy globin,effects
R624 T1025 T1057 themeOf Sox6,binds
R625 T1026 T1057 themeOf ɛy globin,binds
R626 T1027 T1062 themeOf Sox6,expressed
R627 T1027 T1063 themeOf Sox6,expression
R628 T1027 T1061 themeOf Sox6,expressed
R629 T1028 T1063 themeOf ɛy globin,expression
R630 T1029 T1064 themeOf Sox6,absence
R631 T1029 T1065 themeOf Sox6,expressed
R632 T1030 T1065 themeOf ɛy globin,expressed
R633 T1030 T1064 themeOf ɛy globin,absence
R634 T1046 T1045 causeOf promoter,controlled
R635 T1050 T1051 causeOf bind,regulate
R636 T1052 T1051 themeOf silencing,regulate
R637 T1057 T1060 causeOf binds,represses
R638 T1059 T1057 themeOf promoter,binds
R3062 T4368 T4382 themeOf Globin,Expression
R3063 T4369 T4382 themeOf ɛy,Expression
R3064 T4370 T4383 themeOf Sox6,Deficient
R3065 T4374 T4386 themeOf ɛy,expression
R3066 T4374 T4385 themeOf ɛy,expressed
R3067 T4375 T4387 themeOf ζ,expression
R3068 T4376 T4387 themeOf βh1,expression
R3069 T4378 T4388 themeOf β globin,expression
R3070 T4379 T4389 themeOf ɛy,expression
R3071 T4380 T4390 themeOf βmaj,expression
R3072 T4381 T4390 themeOf min,expression
R3885 T5473 T5506 causeOf Sox6,Represses
R3886 T5486 T5508 causeOf Sox6,repress
R3887 T5488 T5510 themeOf Sox6,interact
R3888 T5489 T5510 themeOf CtBP2,interact
R3889 T5491 T5511 themeOf CtBP2,expressed
R3890 T5492 T5512 themeOf CtBP2,interaction
R3891 T5496 T5515 themeOf Sox6,interaction
R3892 T5497 T5515 themeOf CtBP2,interaction
R3893 T5500 T5516 causeOf Sox6,represses
R3894 T5509 T5487 partOf promoter,ɛy
R3895 T5509 T5508 themeOf promoter,repress
R3896 T5515 T5514 themeOf interaction,abolish
R4895 T7002 T7038 themeOf Sox6,Binds
R4896 T7004 T7040 causeOf Sox6,repress
R4897 T7007 T7042 themeOf Sox6,associated
R4898 T7012 T7043 themeOf Sox6,associate
R4899 T7015 T7046 themeOf c-Myc,binding
R4900 T7017 T7046 themeOf Sox6,binding
R4901 T7018 T7047 themeOf c-Myc,binds
R4902 T7019 T7047 themeOf HA,binds
R4903 T7020 T7047 themeOf Sox6,binds
R4904 T7021 T7048 themeOf β globins,express
R4905 T7022 T7048 themeOf ɛy,express
R4906 T7023 T7049 themeOf Sox6,binds
R4907 T7029 T7053 themeOf Sox6,binds
R4908 T7035 T7055 themeOf Sox6,binding
R4909 T7036 T7055 themeOf ɛy,binding
R4910 T7039 T7003 partOf Promoter,ɛy
R4911 T7039 T7038 themeOf Promoter,Binds
R4912 T7051 T7050 themeOf binding,required
R4913 T7054 T7053 themeOf promoter,binds
R4914 T7054 T7030 partOf promoter,ɛy
R4915 T7057 T7056 partOf promoter,ɛy
R4916 T7057 T7055 themeOf promoter,binding
R6226 T8961 T8975 themeOf ɛy Globin,Expression
R6227 T8962 T8976 themeOf Sox6,Deficient
R6228 T8964 T8977 themeOf ɛy globin,expressed
R6229 T8965 T8978 themeOf ɛy globin,expression
R6230 T8968 T8979 themeOf ɛy globin,expressed
R6231 T8970 T8981 themeOf βmaj,expression
R6232 T8971 T8981 themeOf min globin,expression
R6760 T9738 T9747 themeOf Sox6,deficient
R6761 T9739 T9748 themeOf ɛy globin,express
R6762 T9744 T9749 themeOf Sox6,expression
R6763 T9745 T9750 themeOf ɛy globin,expressed
R7160 T10336 T10338 themeOf ɛy globin,silencing
R7161 T10337 T10338 themeOf Sox6,silencing
R7434 T10782 T10872 themeOf ɛy globin,upregulation
R7435 T10783 T10873 causeOf Sox6,regulates
R7436 T10783 T10874 themeOf Sox6,binds
R7437 T10784 T10874 themeOf ɛy gene,binds
R7438 T10785 T10877 themeOf ɛy-globin,represses
R7439 T10791 T10878 themeOf Sox5,dimerization
R7440 T10792 T10878 themeOf Sox6,dimerization
R7441 T10793 T10881 themeOf Sox6,binds
R7442 T10797 T10886 themeOf Sox6,binding
R7443 T10799 T10887 themeOf Sox6,binds
R7444 T10803 T10891 themeOf ɛy globin,bind
R7445 T10804 T10891 themeOf DRED,bind
R7446 T10805 T10891 themeOf COUP,bind
R7447 T10806 T10891 themeOf TF,bind
R7448 T10807 T10892 themeOf Sox6,interact
R7449 T10811 T10895 causeOf Sox6,interfere
R7450 T10811 T10896 themeOf Sox6,binding
R7451 T10811 T10898 themeOf Sox6,binding
R7452 T10814 T10899 themeOf DRED,binding
R7453 T10815 T10899 themeOf EKLF,binding
R7454 T10817 T10901 themeOf HMG-I,binding
R7455 T10817 T10900 themeOf HMG-I,bind
R7456 T10818 T10900 themeOf HMG-Y,bind
R7457 T10818 T10901 themeOf HMG-Y,binding
R7458 T10820 T10900 themeOf II,bind
R7459 T10823 T10902 themeOf ɛy globin,expression
R7460 T10825 T10903 causeOf Sox6,silence
R7461 T10826 T10904 themeOf ɛy globin,expression
R7462 T10829 T10905 themeOf βmaj,expression
R7463 T10830 T10905 themeOf min,expression
R7464 T10831 T10907 themeOf ɛy globin,expression
R7465 T10833 T10908 themeOf βh1,expression
R7466 T10837 T10909 themeOf ɛy globin,expression
R7467 T10838 T10909 themeOf ζ,expression
R7468 T10839 T10909 themeOf βh1,expression
R7469 T10840 T10910 themeOf ɛy,regulated
R7470 T10841 T10910 causeOf ζ,regulated
R7471 T10842 T10910 causeOf βh1,regulated
R7472 T10849 T10912 themeOf β-like globin,elevated
R7473 T10850 T10913 causeOf Sox6,silence
R7474 T10851 T10914 themeOf ɛy globin,expression
R7475 T10852 T10915 themeOf ɛy-globin,regulation
R7476 T10856 T10916 themeOf Sox6,deficient
R7477 T10859 T10917 themeOf ɛ-globin,reactivation
R7478 T10860 T10918 themeOf ɛ-globin,silencing
R7479 T10861 T10919 themeOf Sox6,binds
R7480 T10865 T10922 themeOf ɛ globin,silencing
R7481 T10874 T10873 themeOf binds,regulates
R7482 T10876 T10874 themeOf promoter,binds
R7483 T10878 T10879 causeOf dimerization,increase
R7484 T10880 T10879 themeOf binding,increase
R7485 T10896 T10895 themeOf binding,interfere
R7486 T10897 T10896 themeOf promoter,binding
R7487 T10898 T10895 themeOf binding,interfere
R7488 T10904 T10903 themeOf expression,silence
R7489 T10907 T10906 themeOf expression,ectopic
R7490 T10914 T10913 themeOf expression,silence
R7491 T10921 T10919 themeOf promoter,binds
R11066 T15945 T15958 themeOf ɛ,silencing
R11067 T15950 T15959 themeOf luciferase,expression
R11068 T15959 T15960 themeOf expression,driven
R1 T21 T39 themeOf Epsilon Globin,Expression
R2 T25 T40 themeOf Sox6,deficient
R3 T26 T41 themeOf ɛy globin,expressed
R4 T29 T42 themeOf Sox6,binding

test3

Id Subject Object Predicate Lexical cue
T47 127-131 Protein denotes Sox6
T45 0-4 Protein denotes Sox6
T46 23-37 Protein denotes Epsilon Globin
T64 0-4 Protein denotes Sox6
T65 23-37 Protein denotes Epsilon Globin
T66 38-48 Gene_expression denotes Expression
T20338 43847-43849 Protein denotes ɛy
T20337 43742-43744 Protein denotes ɛy
T20336 43388-43392 Protein denotes Sox6
T20335 43217-43226 Protein denotes protein A
T20334 43847-43849 Protein denotes ɛy
T20333 43742-43744 Protein denotes ɛy
T20332 43388-43392 Protein denotes Sox6
T20331 43217-43226 Protein denotes protein A
T19647 42207-42211 Protein denotes Sox6
T19646 42199-42201 Protein denotes HA
T19645 42192-42197 Protein denotes c-Myc
T19644 41540-41543 Protein denotes BSA
T19643 41444-41448 Protein denotes Sox6
T19642 41323-41347 Protein denotes T4 polynucleotide kinase
T19641 42207-42211 Protein denotes Sox6
T19640 42199-42201 Protein denotes HA
T19639 42192-42197 Protein denotes c-Myc
T19638 41540-41543 Protein denotes BSA
T19637 41444-41448 Protein denotes Sox6
T19636 41323-41347 Protein denotes T4 polynucleotide kinase
T19118 40704-40708 Protein denotes Sox6
T19117 40496-40498 Protein denotes HA
T19116 40486-40491 Protein denotes c-Myc
T19115 40429-40433 Protein denotes Sox6
T19114 40298-40302 Protein denotes Sox6
T19113 40704-40708 Protein denotes Sox6
T19112 40496-40498 Protein denotes HA
T19111 40486-40491 Protein denotes c-Myc
T19110 40429-40433 Protein denotes Sox6
T19109 40298-40302 Protein denotes Sox6
T19401 41064-41069 Protein denotes c-Myc
T19400 41021-41025 Protein denotes Sox6
T19399 40781-40785 Protein denotes Sox6
T19398 41064-41069 Protein denotes c-Myc
T19397 41021-41025 Protein denotes Sox6
T19396 40781-40785 Protein denotes Sox6
T18701 40067-40071 Protein denotes Sox6
T18700 39992-39994 Protein denotes ɛy
T18699 40067-40071 Protein denotes Sox6
T18698 39992-39994 Protein denotes ɛy
T18449 38980-38984 Protein denotes Sox6
T18448 38980-38984 Protein denotes Sox6
T17741 37305-37309 Protein denotes Sox6
T17740 37262-37273 Protein denotes βmaj globin
T17739 37231-37240 Protein denotes ɛy globin
T17738 37305-37309 Protein denotes Sox6
T17737 37262-37273 Protein denotes βmaj globin
T17736 37231-37240 Protein denotes ɛy globin
T17141 37103-37108 Protein denotes GAPDH
T17140 36800-36805 Protein denotes GAPDH
T17139 36402-36412 Protein denotes min globin
T17138 36397-36401 Protein denotes βmaj
T17137 36307-36317 Protein denotes βH1 globin
T17136 36218-36226 Protein denotes ζ globin
T17135 36127-36136 Protein denotes ɛy globin
T17134 37103-37108 Protein denotes GAPDH
T17133 36800-36805 Protein denotes GAPDH
T17132 36402-36412 Protein denotes min globin
T17131 36397-36401 Protein denotes βmaj
T17130 36307-36317 Protein denotes βH1 globin
T17129 36218-36226 Protein denotes ζ globin
T17128 36127-36136 Protein denotes ɛy globin
T15994 35538-35540 Protein denotes ɛy
T15993 35393-35397 Protein denotes Sox6
T15992 35362-35366 Protein denotes Sox6
T15991 35329-35333 Protein denotes Sox6
T15990 35286-35290 Protein denotes Sox6
T15989 34718-34720 Protein denotes ɛy
T15988 34666-34668 Protein denotes ɛy
T15987 34652-34658 Positive_regulation denotes driven
T15986 34638-34648 Gene_expression denotes expression
T15985 34627-34637 Protein denotes luciferase
T15984 34539-34541 Protein denotes ɛy
T15983 34370-34380 Protein denotes luciferase
T15982 34325-34327 Protein denotes ɛy
T15981 34036-34044 Protein denotes ɛ globin
T15980 33926-33927 Protein denotes ɛ
T15979 33825-33834 Protein denotes ɛy globin
T15978 33769-33771 Protein denotes ɛy
T15977 33681-33683 Protein denotes ɛy
T15976 35538-35540 Protein denotes ɛy
T15975 35393-35397 Protein denotes Sox6
T15974 35362-35366 Protein denotes Sox6
T15973 35329-35333 Protein denotes Sox6
T15972 35286-35290 Protein denotes Sox6
T15971 34718-34720 Protein denotes ɛy
T15970 34666-34668 Protein denotes ɛy
T15969 34627-34637 Protein denotes luciferase
T15968 34539-34541 Protein denotes ɛy
T15967 34370-34380 Protein denotes luciferase
T15966 34325-34327 Protein denotes ɛy
T15965 34036-34044 Protein denotes ɛ globin
T15964 33926-33927 Protein denotes ɛ
T15963 33825-33834 Protein denotes ɛy globin
T15962 33769-33771 Protein denotes ɛy
T15961 33681-33683 Protein denotes ɛy
T11135 32843-32845 Protein denotes ɛy
T11134 32830-32835 Binding denotes binds
T11133 32818-32822 Protein denotes Sox6
T11132 32745-32753 Protein denotes ɛ-globin
T11131 32581-32589 Protein denotes ɛ-globin
T11130 32435-32439 Protein denotes Sox6
T11129 32346-32350 Protein denotes Sox6
T11128 31904-31913 Negative_regulation denotes deficient
T11127 31899-31903 Protein denotes Sox6
T11126 31632-31636 Protein denotes Sox6
T11125 31084-31088 Protein denotes Sox6
T11124 31010-31014 Protein denotes Sox6
T11123 30976-30985 Protein denotes ɛy-globin
T11122 30918-30928 Gene_expression denotes expression
T11121 30908-30917 Protein denotes ɛy globin
T11120 30858-30862 Protein denotes Sox6
T11119 30715-30723 Positive_regulation denotes elevated
T11118 30674-30687 Protein denotes β-like globin
T11117 30610-30613 Protein denotes βh1
T11116 30604-30605 Protein denotes ζ
T11115 30533-30535 Protein denotes ɛy
T11114 30476-30485 Protein denotes ɛy globin
T11113 30172-30174 Protein denotes ɛy
T11112 30047-30051 Protein denotes Sox6
T11111 30022-30025 Protein denotes βh1
T11110 30016-30017 Protein denotes ζ
T11109 29989-29998 Regulation denotes regulated
T11108 29983-29985 Protein denotes ɛy
T11107 29928-29938 Gene_expression denotes expression
T11106 29913-29916 Protein denotes βh1
T11105 29907-29908 Protein denotes ζ
T11104 29896-29905 Protein denotes ɛy globin
T11103 29824-29827 Protein denotes βh1
T11102 29818-29819 Protein denotes ζ
T11101 29804-29806 Protein denotes ɛy
T11100 29738-29741 Protein denotes βh1
T11099 29732-29733 Protein denotes ζ
T11098 29615-29624 Protein denotes ɛy globin
T11097 29597-29607 Gene_expression denotes expression
T11096 29485-29495 Gene_expression denotes expression
T11095 29481-29484 Protein denotes min
T11094 29476-29480 Protein denotes βmaj
T11093 29392-29396 Protein denotes Sox6
T11092 29368-29377 Protein denotes ɛy globin
T11091 29348-29358 Gene_expression denotes expression
T11090 29332-29342 Gene_expression denotes expression
T11089 29322-29331 Protein denotes ɛy globin
T11088 29267-29271 Protein denotes Sox6
T11087 29076-29085 Protein denotes ɛy globin
T11086 29062-29072 Gene_expression denotes expression
T11085 28936-28946 Gene_expression denotes expression
T11084 28926-28935 Protein denotes ɛy globin
T11083 28911-28915 Protein denotes Sox6
T11082 28789-28793 Protein denotes Sox6
T11081 28704-28706 Protein denotes II
T11080 28688-28699 Protein denotes silencers I
T11079 28644-28648 Binding denotes bind
T11078 28616-28621 Protein denotes HMG-Y
T11077 28606-28611 Protein denotes HMG-I
T11076 28496-28504 Entity denotes promoter
T11075 28493-28495 Protein denotes ɛy
T11074 28478-28485 Binding denotes binding
T11073 28455-28459 Protein denotes EKLF
T11072 28434-28438 Protein denotes DRED
T11071 28428-28432 Protein denotes DRED
T11070 28413-28415 Protein denotes ɛy
T11069 28377-28387 Negative_regulation denotes interferes
T11068 28312-28319 Binding denotes binding
T11067 28289-28297 Entity denotes promoter
T11066 28254-28261 Binding denotes binding
T11065 28221-28225 Protein denotes Sox6
T11064 28053-28058 Binding denotes bound
T11063 27968-27972 Protein denotes Sox6
T11062 27887-27891 Binding denotes bind
T11061 27803-27807 Binding denotes bind
T11060 27730-27732 Protein denotes ɛy
T11059 27686-27690 Protein denotes Sox6
T11058 27568-27572 Protein denotes Sox6
T11057 27559-27561 Protein denotes TF
T11056 27554-27558 Protein denotes COUP
T11055 27532-27536 Protein denotes DRED
T11054 27461-27465 Binding denotes bind
T11053 27418-27427 Protein denotes ɛy globin
T11052 27357-27361 Protein denotes Sox6
T11051 27319-27323 Protein denotes Sox6
T11050 26928-26930 Protein denotes ɛy
T11049 26898-26903 Binding denotes binds
T11048 26893-26897 Protein denotes Sox6
T11047 26798-26800 Protein denotes ɛy
T11046 26783-26790 Binding denotes binding
T11045 26778-26782 Protein denotes Sox6
T11044 26672-26674 Protein denotes ɛy
T11043 26644-26648 Protein denotes Sox6
T11042 26569-26576 Binding denotes binding
T11041 26518-26525 Entity denotes binding
T11040 26483-26487 Protein denotes Sox6
T11039 26327-26332 Binding denotes binds
T11038 26322-26326 Protein denotes Sox6
T11037 26221-26228 Binding denotes binding
T11036 26208-26216 Positive_regulation denotes increase
T11035 26177-26181 Protein denotes Sox6
T11034 26168-26172 Protein denotes Sox5
T11033 26026-26028 Protein denotes 23
T11032 26018-26020 Protein denotes 13
T11031 26014-26016 Protein denotes 12
T11030 26008-26012 Protein denotes Sox5
T11029 25940-25944 Protein denotes Sox6
T11028 25895-25904 Protein denotes ɛy-globin
T11027 25881-25890 Negative_regulation denotes represses
T11026 25869-25876 Protein denotes ɛy gene
T11025 25857-25865 Entity denotes promoter
T11024 25835-25840 Binding denotes binds
T11023 25821-25830 Regulation denotes regulates
T11022 25807-25811 Protein denotes Sox6
T11021 25791-25800 Protein denotes ɛy globin
T11020 25771-25783 Positive_regulation denotes upregulation
T11019 25749-25752 Protein denotes βH1
T11018 25743-25744 Protein denotes ζ
T11017 25667-25671 Protein denotes Sox6
T11016 25580-25584 Protein denotes Sox6
T11015 33499-33507 Protein denotes ɛ globin
T11014 33442-33446 Protein denotes Sox6
T11013 33370-33374 Protein denotes Sox6
T11012 33304-33312 Protein denotes ɛ globin
T11011 33160-33161 Protein denotes ɛ
T11010 33073-33081 Protein denotes ɛ globin
T11009 33037-33041 Protein denotes Sox6
T11008 32932-32936 Protein denotes Sox6
T11007 32843-32845 Protein denotes ɛy
T11006 32818-32822 Protein denotes Sox6
T11005 32745-32753 Protein denotes ɛ-globin
T11004 32581-32589 Protein denotes ɛ-globin
T11003 32435-32439 Protein denotes Sox6
T11002 32346-32350 Protein denotes Sox6
T11001 31899-31903 Protein denotes Sox6
T11000 31632-31636 Protein denotes Sox6
T10999 31084-31088 Protein denotes Sox6
T10998 31010-31014 Protein denotes Sox6
T10997 30976-30985 Protein denotes ɛy-globin
T10996 30908-30917 Protein denotes ɛy globin
T10995 30858-30862 Protein denotes Sox6
T10994 30674-30687 Protein denotes β-like globin
T10993 30610-30613 Protein denotes βh1
T10992 30604-30605 Protein denotes ζ
T10991 30533-30535 Protein denotes ɛy
T10990 30476-30485 Protein denotes ɛy globin
T10989 30172-30174 Protein denotes ɛy
T10988 30047-30051 Protein denotes Sox6
T10987 30022-30025 Protein denotes βh1
T10986 30016-30017 Protein denotes ζ
T10985 29983-29985 Protein denotes ɛy
T10984 29913-29916 Protein denotes βh1
T10983 29907-29908 Protein denotes ζ
T10982 29896-29905 Protein denotes ɛy globin
T10981 29824-29827 Protein denotes βh1
T10980 29818-29819 Protein denotes ζ
T10979 29804-29806 Protein denotes ɛy
T10978 29738-29741 Protein denotes βh1
T10977 29732-29733 Protein denotes ζ
T10976 29615-29624 Protein denotes ɛy globin
T10975 29481-29484 Protein denotes min
T10974 29476-29480 Protein denotes βmaj
T10973 29392-29396 Protein denotes Sox6
T10972 29368-29377 Protein denotes ɛy globin
T10971 29322-29331 Protein denotes ɛy globin
T10970 29267-29271 Protein denotes Sox6
T10969 29076-29085 Protein denotes ɛy globin
T10968 28926-28935 Protein denotes ɛy globin
T10967 28911-28915 Protein denotes Sox6
T10966 28789-28793 Protein denotes Sox6
T10965 28704-28706 Protein denotes II
T10964 28688-28699 Protein denotes silencers I
T10963 28616-28621 Protein denotes HMG-Y
T10962 28606-28611 Protein denotes HMG-I
T10961 28493-28495 Protein denotes ɛy
T10960 28455-28459 Protein denotes EKLF
T10959 28434-28438 Protein denotes DRED
T10958 28428-28432 Protein denotes DRED
T10957 28413-28415 Protein denotes ɛy
T10956 28221-28225 Protein denotes Sox6
T10955 27968-27972 Protein denotes Sox6
T10954 27730-27732 Protein denotes ɛy
T10953 27686-27690 Protein denotes Sox6
T10952 27568-27572 Protein denotes Sox6
T10951 27559-27561 Protein denotes TF
T10950 27554-27558 Protein denotes COUP
T10949 27532-27536 Protein denotes DRED
T10948 27418-27427 Protein denotes ɛy globin
T10947 27357-27361 Protein denotes Sox6
T10946 27319-27323 Protein denotes Sox6
T10945 26928-26930 Protein denotes ɛy
T10944 26893-26897 Protein denotes Sox6
T10943 26798-26800 Protein denotes ɛy
T10942 26778-26782 Protein denotes Sox6
T10941 26672-26674 Protein denotes ɛy
T10940 26644-26648 Protein denotes Sox6
T10939 26483-26487 Protein denotes Sox6
T10938 26322-26326 Protein denotes Sox6
T10937 26177-26181 Protein denotes Sox6
T10936 26168-26172 Protein denotes Sox5
T10935 26026-26028 Protein denotes 23
T10934 26018-26020 Protein denotes 13
T10933 26014-26016 Protein denotes 12
T10932 26008-26012 Protein denotes Sox5
T10931 25940-25944 Protein denotes Sox6
T10930 25895-25904 Protein denotes ɛy-globin
T10929 25869-25876 Protein denotes ɛy gene
T10928 25807-25811 Protein denotes Sox6
T10927 25791-25800 Protein denotes ɛy globin
T10926 25749-25752 Protein denotes βH1
T10925 25743-25744 Protein denotes ζ
T10924 25667-25671 Protein denotes Sox6
T10923 25580-25584 Protein denotes Sox6
T11144 33499-33507 Protein denotes ɛ globin
T11143 33442-33446 Protein denotes Sox6
T11142 33370-33374 Protein denotes Sox6
T11141 33304-33312 Protein denotes ɛ globin
T11140 33160-33161 Protein denotes ɛ
T11139 33073-33081 Protein denotes ɛ globin
T11138 33037-33041 Protein denotes Sox6
T11137 32932-32936 Protein denotes Sox6
T11136 32855-32863 Entity denotes promoter
T10344 25196-25200 Protein denotes Sox6
T10343 25180-25189 Protein denotes ɛy globin
T10342 24593-24597 Protein denotes Sox6
T10341 25196-25200 Protein denotes Sox6
T10340 25180-25189 Protein denotes ɛy globin
T10339 24593-24597 Protein denotes Sox6
T9771 23423-23427 Protein denotes Sox6
T9770 23315-23324 Protein denotes ɛy globin
T9769 23160-23170 Gene_expression denotes expression
T9768 23155-23159 Protein denotes Sox6
T9767 23040-23044 Protein denotes Sox6
T9766 22857-22861 Protein denotes Sox6
T9765 22766-22770 Protein denotes Sox6
T9764 22645-22649 Protein denotes Sox6
T9763 22570-22579 Protein denotes ɛy globin
T9762 22530-22534 Protein denotes Sox6
T9761 22459-22463 Protein denotes Sox6
T9760 23423-23427 Protein denotes Sox6
T9759 23315-23324 Protein denotes ɛy globin
T9758 23155-23159 Protein denotes Sox6
T9757 23040-23044 Protein denotes Sox6
T9756 22857-22861 Protein denotes Sox6
T9755 22766-22770 Protein denotes Sox6
T9754 22645-22649 Protein denotes Sox6
T9753 22570-22579 Protein denotes ɛy globin
T9752 22530-22534 Protein denotes Sox6
T9751 22459-22463 Protein denotes Sox6
T9019 21788-21792 Protein denotes Sox6
T9018 21762-21764 Protein denotes ɛy
T9017 21611-21613 Protein denotes ɛy
T9016 21469-21479 Protein denotes min globin
T9015 21464-21468 Protein denotes βmaj
T9014 21450-21460 Gene_expression denotes expression
T9013 21364-21379 Transcription denotes mRNA expression
T9012 21361-21363 Protein denotes ɛy
T9011 21243-21252 Gene_expression denotes expressed
T9010 21226-21235 Protein denotes ɛy globin
T9009 21137-21146 Protein denotes ɛy globin
T9008 21064-21073 Protein denotes ɛy globin
T9007 21050-21060 Gene_expression denotes expression
T9006 21035-21038 Positive_regulation denotes due
T9005 20977-20986 Protein denotes ɛy globin
T9004 20963-20973 Gene_expression denotes expression
T9003 20850-20859 Gene_expression denotes expressed
T9002 20820-20829 Protein denotes ɛy globin
T9001 20748-20750 Protein denotes ɛy
T9000 20707-20716 Negative_regulation denotes Deficient
T8999 20702-20706 Protein denotes Sox6
T8998 20689-20698 Protein denotes ɛy Globin
T8997 20675-20685 Gene_expression denotes Expression
T8996 21788-21792 Protein denotes Sox6
T8995 21762-21764 Protein denotes ɛy
T8994 21611-21613 Protein denotes ɛy
T8993 21469-21479 Protein denotes min globin
T8992 21464-21468 Protein denotes βmaj
T8991 21361-21363 Protein denotes ɛy
T8990 21226-21235 Protein denotes ɛy globin
T8989 21137-21146 Protein denotes ɛy globin
T8988 21064-21073 Protein denotes ɛy globin
T8987 20977-20986 Protein denotes ɛy globin
T8986 20820-20829 Protein denotes ɛy globin
T8985 20748-20750 Protein denotes ɛy
T8984 20702-20706 Protein denotes Sox6
T8983 20689-20698 Protein denotes ɛy Globin
T7138 19798-19800 Protein denotes ɛy
T7137 19783-19790 Binding denotes binding
T7136 19763-19765 Protein denotes ɛy
T7135 19731-19735 Protein denotes Sox6
T7134 19572-19576 Protein denotes Sox6
T7133 19516-19518 Protein denotes ɛy
T7132 19477-19481 Protein denotes Sox6
T7131 19369-19373 Protein denotes Sox6
T7130 19293-19301 Entity denotes promoter
T7129 19290-19292 Protein denotes ɛy
T7128 19277-19282 Binding denotes binds
T7127 19272-19276 Protein denotes Sox6
T7126 19215-19219 Protein denotes Sox6
T7125 19209-19211 Protein denotes ɛy
T7124 18974-18976 Protein denotes ɛy
T7123 18884-18888 Protein denotes Sox6
T7122 18783-18785 Protein denotes ɛy
T7121 18338-18343 Binding denotes binds
T7120 18324-18328 Protein denotes Sox6
T7119 18315-18317 Protein denotes ɛy
T7118 18296-18305 Protein denotes β globins
T7117 18075-18079 Protein denotes Sox6
T7116 18065-18067 Protein denotes HA
T7115 18042-18047 Binding denotes binds
T7114 18025-18030 Protein denotes c-Myc
T7113 17973-17977 Protein denotes Sox6
T7112 17962-17969 Binding denotes binding
T7111 17905-17909 Protein denotes Sox6
T7110 17895-17900 Protein denotes c-Myc
T7109 17866-17870 Protein denotes Sox6
T7108 17754-17756 Protein denotes ɛy
T7107 17672-17676 Protein denotes Sox6
T7106 17413-17415 Protein denotes ɛy
T7105 17220-17224 Protein denotes Sox6
T7104 17207-17212 Protein denotes c-Myc
T7103 17122-17124 Protein denotes ɛy
T7102 17085-17089 Protein denotes Sox6
T7101 17049-17051 Protein denotes ɛy
T7100 17035-17044 Regulation denotes affecting
T7099 16934-16936 Protein denotes ɛy
T7098 16922-16929 Negative_regulation denotes repress
T7097 16911-16915 Protein denotes Sox6
T7096 16899-16901 Protein denotes ɛy
T7095 16886-16891 Binding denotes Binds
T7094 16872-16876 Protein denotes Sox6
T7093 19798-19800 Protein denotes ɛy
T7092 19763-19765 Protein denotes ɛy
T7091 19731-19735 Protein denotes Sox6
T7090 19572-19576 Protein denotes Sox6
T7089 19516-19518 Protein denotes ɛy
T7088 19477-19481 Protein denotes Sox6
T7087 19369-19373 Protein denotes Sox6
T7086 19290-19292 Protein denotes ɛy
T7085 19272-19276 Protein denotes Sox6
T7084 19215-19219 Protein denotes Sox6
T7083 19209-19211 Protein denotes ɛy
T7082 18974-18976 Protein denotes ɛy
T7081 18884-18888 Protein denotes Sox6
T7080 18783-18785 Protein denotes ɛy
T7079 18324-18328 Protein denotes Sox6
T7078 18315-18317 Protein denotes ɛy
T7077 18296-18305 Protein denotes β globins
T7076 18075-18079 Protein denotes Sox6
T7075 18065-18067 Protein denotes HA
T7074 18025-18030 Protein denotes c-Myc
T7073 17973-17977 Protein denotes Sox6
T7072 17905-17909 Protein denotes Sox6
T7071 17895-17900 Protein denotes c-Myc
T7070 17866-17870 Protein denotes Sox6
T7069 17754-17756 Protein denotes ɛy
T7068 17672-17676 Protein denotes Sox6
T7067 17413-17415 Protein denotes ɛy
T7066 17220-17224 Protein denotes Sox6
T7065 17207-17212 Protein denotes c-Myc
T7064 17122-17124 Protein denotes ɛy
T7063 17085-17089 Protein denotes Sox6
T7062 17049-17051 Protein denotes ɛy
T7061 16934-16936 Protein denotes ɛy
T7060 16911-16915 Protein denotes Sox6
T7059 16899-16901 Protein denotes ɛy
T7058 16872-16876 Protein denotes Sox6
T5591 14164-14168 Protein denotes Sox6
T5590 14122-14124 Protein denotes ɛy
T5589 14045-14047 Protein denotes ɛy
T5588 13994-13999 Protein denotes CtBP2
T5587 13977-13979 Protein denotes ɛy
T5586 13958-13962 Protein denotes Sox6
T5585 13891-13893 Protein denotes ɛy
T5584 13851-13855 Protein denotes Sox6
T5583 13741-13752 Binding denotes interaction
T5582 13735-13740 Protein denotes CtBP2
T5581 13730-13734 Protein denotes Sox6
T5580 13655-13659 Protein denotes Sox6
T5579 13596-13598 Protein denotes ɛy
T5578 13578-13588 Negative_regulation denotes repression
T5577 13573-13577 Protein denotes Sox6
T5576 13560-13568 Positive_regulation denotes required
T5575 13551-13556 Protein denotes CtBP2
T5574 13534-13545 Binding denotes interaction
T5573 13462-13471 Gene_expression denotes expressed
T5572 13453-13458 Protein denotes CtBP2
T5571 13433-13438 Protein denotes fgf-3
T5570 13419-13424 Protein denotes CtBP2
T5569 13395-13404 Gene_expression denotes expressed
T5568 13323-13327 Protein denotes Sox6
T5567 11900-11902 Protein denotes ɛy
T5566 11888-11895 Negative_regulation denotes repress
T5565 11875-11879 Protein denotes Sox6
T5564 11724-11728 Protein denotes Sox6
T5563 11556-11560 Protein denotes Sox6
T5562 11453-11463 Protein denotes luciferase
T5561 11406-11408 Protein denotes ɛy
T5560 11309-11311 Protein denotes ɛy
T5559 11274-11286 Protein denotes beta globins
T5558 11261-11263 Protein denotes ɛy
T5557 11093-11095 Protein denotes ɛy
T5556 11067-11071 Protein denotes Sox6
T5555 11031-11033 Protein denotes ɛy
T5554 10986-10988 Protein denotes ɛy
T5553 10877-10879 Protein denotes ɛy
T5552 10863-10872 Negative_regulation denotes Represses
T5551 10849-10853 Protein denotes Sox6
T5550 14164-14168 Protein denotes Sox6
T5549 14122-14124 Protein denotes ɛy
T5548 14045-14047 Protein denotes ɛy
T5547 13994-13999 Protein denotes CtBP2
T5546 13977-13979 Protein denotes ɛy
T5545 13958-13962 Protein denotes Sox6
T5544 13891-13893 Protein denotes ɛy
T5543 13851-13855 Protein denotes Sox6
T5542 13735-13740 Protein denotes CtBP2
T5541 13730-13734 Protein denotes Sox6
T5540 13655-13659 Protein denotes Sox6
T5539 13596-13598 Protein denotes ɛy
T5538 13573-13577 Protein denotes Sox6
T5537 13551-13556 Protein denotes CtBP2
T5536 13453-13458 Protein denotes CtBP2
T5535 13433-13438 Protein denotes fgf-3
T5534 13419-13424 Protein denotes CtBP2
T5533 13323-13327 Protein denotes Sox6
T5532 11900-11902 Protein denotes ɛy
T5531 11875-11879 Protein denotes Sox6
T5530 11724-11728 Protein denotes Sox6
T5529 11556-11560 Protein denotes Sox6
T5528 11453-11463 Protein denotes luciferase
T5527 11406-11408 Protein denotes ɛy
T5526 11309-11311 Protein denotes ɛy
T5525 11274-11286 Protein denotes beta globins
T5524 11261-11263 Protein denotes ɛy
T5523 11093-11095 Protein denotes ɛy
T5522 11067-11071 Protein denotes Sox6
T5521 11031-11033 Protein denotes ɛy
T5520 10986-10988 Protein denotes ɛy
T5519 10877-10879 Protein denotes ɛy
T5518 10849-10853 Protein denotes Sox6
T4422 10313-10323 Gene_expression denotes expression
T4421 10309-10312 Protein denotes min
T4420 10304-10308 Protein denotes βmaj
T4419 10187-10197 Gene_expression denotes expression
T4418 10184-10186 Protein denotes ɛy
T4417 9531-9539 Protein denotes β globin
T4416 9505-9515 Gene_expression denotes expression
T4415 9457-9466 Protein denotes ɛy globin
T4414 9345-9348 Protein denotes βh1
T4413 9339-9340 Protein denotes ζ
T4412 9051-9053 Protein denotes ɛy
T4411 8778-8782 Protein denotes Sox6
T4410 8676-8680 Protein denotes Sox6
T4409 8543-8552 Protein denotes ɛy globin
T4408 8524-8533 Negative_regulation denotes Deficient
T4407 8519-8523 Protein denotes Sox6
T4406 8512-8514 Protein denotes ɛy
T4405 8504-8510 Protein denotes Globin
T4404 10309-10312 Protein denotes min
T4403 10304-10308 Protein denotes βmaj
T4402 10184-10186 Protein denotes ɛy
T4401 9531-9539 Protein denotes β globin
T4400 9457-9466 Protein denotes ɛy globin
T4399 9345-9348 Protein denotes βh1
T4398 9339-9340 Protein denotes ζ
T4397 9051-9053 Protein denotes ɛy
T4396 8778-8782 Protein denotes Sox6
T4395 8676-8680 Protein denotes Sox6
T4394 8543-8552 Protein denotes ɛy globin
T4393 8519-8523 Protein denotes Sox6
T4392 8512-8514 Protein denotes ɛy
T4391 8504-8510 Protein denotes Globin
T1195 8410-8414 Protein denotes Sox6
T1168 6654-6655 Protein denotes ɛ
T1167 6625-6633 Protein denotes ɛ globin
T1166 6611-6620 Negative_regulation denotes silencing
T1165 6522-6532 Regulation denotes controlled
T1164 6503-6511 Protein denotes β-globin
T1163 6485-6493 Protein denotes γ-globin
T1162 6451-6460 Regulation denotes regulated
T1161 6430-6431 Protein denotes ɛ
T1160 6348-6357 Positive_regulation denotes activated
T1159 6343-6344 Protein denotes ɛ
T1158 6273-6281 Protein denotes ɛ globin
T1157 6237-6246 Negative_regulation denotes silencing
T1156 6169-6171 Protein denotes ɛy
T1155 6152-6157 Protein denotes minor
T1154 6140-6147 Protein denotes β major
T1153 6115-6122 Gene_expression denotes express
T1152 5993-6005 Protein denotes βh-1 globins
T1151 5986-5988 Protein denotes ɛy
T1150 5978-5985 Gene_expression denotes express
T1149 5828-5837 Gene_expression denotes expressed
T1148 5791-5793 Protein denotes ɛy
T1147 5453-5460 Protein denotes β-minor
T1146 5440-5447 Protein denotes β-major
T1145 5435-5438 Protein denotes βh1
T1144 5431-5433 Protein denotes ɛy
T1143 5372-5380 Regulation denotes modulate
T1142 5095-5099 Protein denotes HMG2
T1141 5086-5090 Protein denotes HMG1
T1140 5076-5085 Gene_expression denotes expressed
T1139 4982-4986 Binding denotes bind
T1138 4894-4897 Protein denotes Sry
T1137 4781-4785 Protein denotes Sox6
T1136 4731-4732 Protein denotes p
T1135 4626-4630 Protein denotes Sox6
T1134 4611-4612 Protein denotes p
T1133 4296-4300 Protein denotes Sox6
T1132 4137-4141 Protein denotes Sox6
T1131 4051-4055 Protein denotes Sox6
T1130 3941-3944 Protein denotes Sry
T1129 3932-3936 Protein denotes Sox9
T1128 3926-3930 Protein denotes Sox6
T1127 3909-3915 Entity denotes domain
T1126 3887-3897 Gene_expression denotes expression
T1125 3815-3819 Protein denotes Sox6
T1124 3697-3701 Protein denotes Sox6
T1123 3535-3539 Protein denotes Sox6
T1122 3095-3099 Binding denotes bind
T1121 2873-2877 Protein denotes Sox6
T1120 2855-2858 Protein denotes Sry
T1119 8410-8414 Protein denotes Sox6
T1118 8336-8345 Protein denotes ɛy globin
T1117 8330-8334 Protein denotes Sox6
T1116 8301-8310 Protein denotes ɛy globin
T1115 8184-8188 Protein denotes Sox6
T1114 8117-8126 Protein denotes ɛy globin
T1113 8078-8082 Protein denotes Sox6
T1112 8049-8058 Protein denotes ɛy globin
T1111 8037-8041 Protein denotes Sox6
T1110 7972-7981 Protein denotes ɛy globin
T1109 7666-7670 Protein denotes Sox6
T1108 7488-7492 Protein denotes Sox6
T1107 7242-7243 Protein denotes ɛ
T1106 7181-7182 Protein denotes ɛ
T1105 7063-7067 Protein denotes DRED
T1104 7050-7057 Protein denotes COUP-TF
T1103 7044-7048 Protein denotes YY-1
T1102 7036-7042 Protein denotes GATA-1
T1101 6963-6964 Protein denotes ɛ
T1100 6654-6655 Protein denotes ɛ
T1099 6625-6633 Protein denotes ɛ globin
T1098 6503-6511 Protein denotes β-globin
T1097 6485-6493 Protein denotes γ-globin
T1096 6430-6431 Protein denotes ɛ
T1095 6343-6344 Protein denotes ɛ
T1094 6273-6281 Protein denotes ɛ globin
T1093 6169-6171 Protein denotes ɛy
T1092 6152-6157 Protein denotes minor
T1091 6140-6147 Protein denotes β major
T1090 5993-6005 Protein denotes βh-1 globins
T1089 5986-5988 Protein denotes ɛy
T1088 5791-5793 Protein denotes ɛy
T1087 5453-5460 Protein denotes β-minor
T1086 5440-5447 Protein denotes β-major
T1085 5435-5438 Protein denotes βh1
T1084 5431-5433 Protein denotes ɛy
T1083 5095-5099 Protein denotes HMG2
T1082 5086-5090 Protein denotes HMG1
T1081 4894-4897 Protein denotes Sry
T1080 4781-4785 Protein denotes Sox6
T1079 4731-4732 Protein denotes p
T1078 4626-4630 Protein denotes Sox6
T1077 4611-4612 Protein denotes p
T1076 4296-4300 Protein denotes Sox6
T1075 4137-4141 Protein denotes Sox6
T1074 4051-4055 Protein denotes Sox6
T1073 3941-3944 Protein denotes Sry
T1072 3932-3936 Protein denotes Sox9
T1071 3926-3930 Protein denotes Sox6
T1070 3815-3819 Protein denotes Sox6
T1069 3697-3701 Protein denotes Sox6
T1068 3535-3539 Protein denotes Sox6
T1067 2873-2877 Protein denotes Sox6
T1066 2855-2858 Protein denotes Sry
T1194 8361-8370 Gene_expression denotes expressed
T1193 8336-8345 Protein denotes ɛy globin
T1192 8330-8334 Protein denotes Sox6
T1191 8301-8310 Protein denotes ɛy globin
T1190 8184-8188 Protein denotes Sox6
T1189 8117-8126 Protein denotes ɛy globin
T1188 8105-8113 Entity denotes promoter
T1187 8096-8104 Entity denotes proximal
T1186 8083-8088 Binding denotes binds
T1185 8078-8082 Protein denotes Sox6
T1184 8049-8058 Protein denotes ɛy globin
T1183 8037-8041 Protein denotes Sox6
T1182 7972-7981 Protein denotes ɛy globin
T1181 7666-7670 Protein denotes Sox6
T1180 7488-7492 Protein denotes Sox6
T1179 7242-7243 Protein denotes ɛ
T1178 7225-7234 Negative_regulation denotes silencing
T1177 7183-7192 Negative_regulation denotes silencing
T1176 7181-7182 Protein denotes ɛ
T1175 7172-7180 Regulation denotes regulate
T1174 7111-7115 Binding denotes bind
T1173 7063-7067 Protein denotes DRED
T1172 7050-7057 Protein denotes COUP-TF
T1171 7044-7048 Protein denotes YY-1
T1170 7036-7042 Protein denotes GATA-1
T1169 6963-6964 Protein denotes ɛ
T85 1298-1307 Protein denotes ɛy globin
T84 1279-1283 Protein denotes Sox6
T83 1238-1242 Protein denotes Sox6
T82 1175-1184 Protein denotes ɛy globin
T48 310-313 Protein denotes Sry
T49 352-356 Protein denotes Sox6
T50 450-454 Protein denotes Sox6
T51 479-488 Protein denotes ɛy globin
T52 688-690 Protein denotes ɛy
T53 730-734 Protein denotes Sox6
T54 865-869 Protein denotes Sox6
T55 917-919 Protein denotes ɛy
T56 955-959 Protein denotes Sox6
T57 1015-1017 Protein denotes ɛy
T58 1067-1071 Protein denotes Sox6
T59 1141-1145 Protein denotes Sox6
T60 1175-1184 Protein denotes ɛy globin
T61 1238-1242 Protein denotes Sox6
T62 1279-1283 Protein denotes Sox6
T63 1298-1307 Protein denotes ɛy globin
T67 127-131 Protein denotes Sox6
T68 310-313 Protein denotes Sry
T69 352-356 Protein denotes Sox6
T70 450-454 Protein denotes Sox6
T71 479-488 Protein denotes ɛy globin
T72 505-514 Gene_expression denotes expressed
T73 688-690 Protein denotes ɛy
T74 730-734 Protein denotes Sox6
T75 865-869 Protein denotes Sox6
T76 902-909 Binding denotes binding
T77 917-919 Protein denotes ɛy
T78 955-959 Protein denotes Sox6
T79 1015-1017 Protein denotes ɛy
T80 1067-1071 Protein denotes Sox6
T81 1141-1145 Protein denotes Sox6
R662 T1173 T1174 themeOf DRED,bind
R663 T1173 T1175 causeOf DRED,regulate
R664 T1174 T1175 causeOf bind,regulate
R665 T1176 T1177 themeOf ɛ,silencing
R666 T1177 T1175 themeOf silencing,regulate
R667 T1179 T1178 themeOf ɛ,silencing
R668 T1185 T1186 themeOf Sox6,binds
R669 T1188 T1186 themeOf promoter,binds
R670 T1192 T1194 themeOf Sox6,expressed
R671 T1193 T1194 themeOf ɛy globin,expressed
R672 T1193 T1195 themeOf ɛy globin,Sox6
R3073 T4407 T4408 themeOf Sox6,Deficient
R3074 T4417 T4416 themeOf β globin,expression
R3075 T4418 T4419 themeOf ɛy,expression
R3076 T4420 T4422 themeOf βmaj,expression
R3077 T4421 T4422 themeOf min,expression
R3897 T5551 T5552 causeOf Sox6,Represses
R3898 T5553 T5551 themeOf ɛy,Sox6
R3899 T5557 T5556 themeOf ɛy,Sox6
R3900 T5558 T5556 themeOf ɛy,Sox6
R3901 T5559 T5556 themeOf beta globins,Sox6
R3902 T5565 T5566 causeOf Sox6,repress
R3903 T5568 T5569 themeOf Sox6,expressed
R3904 T5570 T5568 themeOf CtBP2,Sox6
R3905 T5570 T5569 themeOf CtBP2,expressed
R3906 T5572 T5573 themeOf CtBP2,expressed
R3907 T5574 T5576 causeOf interaction,required
R3908 T5575 T5574 themeOf CtBP2,interaction
R3909 T5578 T5576 themeOf repression,required
R3910 T5578 T5577 themeOf repression,Sox6
R3911 T5579 T5577 themeOf ɛy,Sox6
R3912 T5581 T5583 themeOf Sox6,interaction
R3913 T5582 T5583 themeOf CtBP2,interaction
R3914 T5587 T5586 themeOf ɛy,Sox6
R3915 T5588 T5586 themeOf CtBP2,Sox6
R3916 T5591 T5590 themeOf Sox6,ɛy
R4917 T7094 T7095 themeOf Sox6,Binds
R4918 T7096 T7095 themeOf ɛy,Binds
R4919 T7097 T7098 causeOf Sox6,repress
R4920 T7097 T7100 causeOf Sox6,affecting
R4921 T7099 T7097 themeOf ɛy,Sox6
R4922 T7103 T7102 themeOf ɛy,Sox6
R4923 T7105 T7102 themeOf Sox6,Sox6
R4924 T7110 T7112 themeOf c-Myc,binding
R4925 T7111 T7112 themeOf Sox6,binding
R4926 T7113 T7112 themeOf Sox6,binding
R4927 T7114 T7115 themeOf c-Myc,binds
R4928 T7116 T7115 themeOf HA,binds
R4929 T7117 T7115 themeOf Sox6,binds
R4930 T7120 T7121 themeOf Sox6,binds
R4931 T7127 T7128 themeOf Sox6,binds
R4932 T7130 T7128 themeOf promoter,binds
R4933 T7130 T7129 partOf promoter,ɛy
R4934 T7135 T7137 themeOf Sox6,binding
R4935 T7136 T7135 themeOf ɛy,Sox6
R4936 T7136 T7137 themeOf ɛy,binding
R4937 T7138 T7137 themeOf ɛy,binding
R6233 T8998 T8997 themeOf ɛy Globin,Expression
R6234 T8999 T9000 themeOf Sox6,Deficient
R6235 T9002 T9003 themeOf ɛy globin,expressed
R6236 T9004 T9006 themeOf expression,due
R6237 T9005 T9004 themeOf ɛy globin,expression
R6238 T9008 T9007 themeOf ɛy globin,expression
R6239 T9010 T9011 themeOf ɛy globin,expressed
R6240 T9012 T9013 themeOf ɛy,mRNA expression
R6241 T9015 T9014 themeOf βmaj,expression
R6242 T9016 T9014 themeOf min globin,expression
R6764 T9768 T9769 themeOf Sox6,expression
R7492 T11021 T11020 themeOf ɛy globin,upregulation
R7493 T11022 T11023 themeOf Sox6,regulates
R7494 T11022 T11027 causeOf Sox6,represses
R7495 T11022 T11024 themeOf Sox6,binds
R7496 T11024 T11027 causeOf binds,represses
R7497 T11025 T11024 themeOf promoter,binds
R7498 T11028 T11027 themeOf ɛy-globin,represses
R7499 T11037 T11036 themeOf binding,increase
R7500 T11038 T11039 themeOf Sox6,binds
R7501 T11040 T11042 themeOf Sox6,binding
R7502 T11045 T11046 themeOf Sox6,binding
R7503 T11048 T11049 themeOf Sox6,binds
R7504 T11053 T11054 themeOf ɛy globin,bind
R7505 T11053 T11056 themeOf ɛy globin,COUP
R7506 T11055 T11056 themeOf DRED,COUP
R7507 T11055 T11054 themeOf DRED,bind
R7508 T11057 T11054 themeOf TF,bind
R7509 T11063 T11064 themeOf Sox6,bound
R7510 T11065 T11066 themeOf Sox6,binding
R7511 T11067 T11066 themeOf promoter,binding
R7512 T11071 T11069 themeOf DRED,interferes
R7513 T11072 T11074 themeOf DRED,binding
R7514 T11073 T11074 themeOf EKLF,binding
R7515 T11076 T11074 themeOf promoter,binding
R7516 T11076 T11075 partOf promoter,ɛy
R7517 T11077 T11079 themeOf HMG-I,bind
R7518 T11078 T11079 themeOf HMG-Y,bind
R7519 T11081 T11079 themeOf II,bind
R7520 T11084 T11085 themeOf ɛy globin,expression
R7521 T11085 T11083 themeOf expression,Sox6
R7522 T11087 T11086 themeOf ɛy globin,expression
R7523 T11089 T11090 themeOf ɛy globin,expression
R7524 T11090 T11088 themeOf expression,Sox6
R7525 T11092 T11091 themeOf ɛy globin,expression
R7526 T11094 T11096 themeOf βmaj,expression
R7527 T11095 T11096 themeOf min,expression
R7528 T11098 T11097 themeOf ɛy globin,expression
R7529 T11104 T11107 themeOf ɛy globin,expression
R7530 T11105 T11107 themeOf ζ,expression
R7531 T11108 T11109 themeOf ɛy,regulated
R7532 T11113 T11112 themeOf ɛy,Sox6
R7533 T11121 T11122 themeOf ɛy globin,expression
R7534 T11123 T11120 themeOf ɛy-globin,Sox6
R7535 T11127 T11128 themeOf Sox6,deficient
R7536 T11130 T11129 themeOf Sox6,Sox6
R7537 T11133 T11134 themeOf Sox6,binds
R7538 T11136 T11134 themeOf promoter,binds
R11069 T15985 T15986 themeOf luciferase,expression
R11070 T15986 T15987 themeOf expression,driven
R13575 T19116 T19115 themeOf c-Myc,Sox6
R13576 T19117 T19115 themeOf HA,Sox6
R13934 T19644 T19643 themeOf BSA,Sox6
R9 T65 T66 themeOf Epsilon Globin,Expression
R10 T65 T64 themeOf Epsilon Globin,Sox6
R11 T66 T64 themeOf Expression,Sox6
R12 T71 T72 themeOf ɛy globin,expressed
R13 T74 T73 themeOf Sox6,ɛy
R14 T75 T76 themeOf Sox6,binding
R15 T77 T76 themeOf ɛy,binding
R16 T82 T81 themeOf ɛy globin,Sox6
R17 T83 T81 themeOf Sox6,Sox6
R18 T85 T84 themeOf ɛy globin,Sox6
R639 T1128 T1126 themeOf Sox6,expression
R640 T1129 T1126 themeOf Sox9,expression
R641 T1130 T1126 themeOf Sry,expression
R642 T1132 T1131 themeOf Sox6,Sox6
R643 T1138 T1140 themeOf Sry,expressed
R644 T1138 T1139 themeOf Sry,bind
R645 T1141 T1139 themeOf HMG1,bind
R646 T1141 T1140 themeOf HMG1,expressed
R647 T1142 T1139 themeOf HMG2,bind
R648 T1142 T1140 themeOf HMG2,expressed
R649 T1151 T1150 themeOf ɛy,express
R650 T1152 T1150 themeOf βh-1 globins,express
R651 T1153 T1155 themeOf express,minor
R652 T1154 T1155 themeOf β major,minor
R653 T1158 T1157 themeOf ɛ globin,silencing
R654 T1159 T1160 themeOf ɛ,activated
R655 T1160 T1162 themeOf activated,regulated
R656 T1167 T1166 themeOf ɛ globin,silencing
R657 T1168 T1166 themeOf ɛ,silencing
R658 T1170 T1174 themeOf GATA-1,bind
R659 T1171 T1174 themeOf YY-1,bind
R660 T1172 T1174 themeOf COUP-TF,bind
R661 T1172 T1175 causeOf COUP-TF,regulate