![Logo](/assets/logo-d3f1fdf60522f0983e71f9fcc720cb7da5b55c0b748ed5bded3d2fbf81387bf0.png)
PMC:1255741 / 55175-55287
Annnotations
craft-sa-dev
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T13745 | 0-112 | sentence | denotes | TgCre4: rspCre1 (5′- ACCAGGTTCGTTCACTCATGG-3′) and rspCre2 (5′- AGGCTAAGTGCCTTCTCTACAC-3′), 200 basepairs (bp). |
T13746 | 1-7 | NN | denotes | TgCre4 |
T13747 | 7-9 | : | denotes | : |
T13748 | 9-16 | NN | denotes | rspCre1 |
T13749 | 108-110 | NN | denotes | bp |
T13750 | 17-18 | -LRB- | denotes | ( |
T13751 | 44-45 | CD | denotes | 3 |
T13752 | 18-19 | CD | denotes | 5 |
T13753 | 19-20 | SYM | denotes | ′ |
T13754 | 20-21 | HYPH | denotes | - |
T13755 | 22-43 | NN | denotes | ACCAGGTTCGTTCACTCATGG |
T13756 | 43-44 | HYPH | denotes | - |
T13757 | 45-46 | SYM | denotes | ′ |
T13758 | 46-47 | -RRB- | denotes | ) |
T13759 | 48-51 | CC | denotes | and |
T13760 | 52-59 | NN | denotes | rspCre2 |
T13761 | 60-61 | -LRB- | denotes | ( |
T13762 | 65-87 | NN | denotes | AGGCTAAGTGCCTTCTCTACAC |
T13763 | 61-62 | CD | denotes | 5 |
T13764 | 62-63 | SYM | denotes | ′ |
T13765 | 63-64 | HYPH | denotes | - |
T13766 | 87-88 | HYPH | denotes | - |
T13767 | 88-89 | CD | denotes | 3 |
T13768 | 89-90 | SYM | denotes | ′ |
T13769 | 90-91 | -RRB- | denotes | ) |
T13770 | 91-93 | , | denotes | , |
T13771 | 93-96 | CD | denotes | 200 |
T13772 | 97-106 | NNS | denotes | basepairs |
T13773 | 107-108 | -LRB- | denotes | ( |
T13774 | 110-111 | -RRB- | denotes | ) |
T13775 | 111-112 | . | denotes | . |
R8921 | T13747 | T13746 | punct | : ,TgCre4 |
R8922 | T13748 | T13749 | dep | rspCre1,bp |
R8923 | T13749 | T13746 | dep | bp,TgCre4 |
R8924 | T13750 | T13751 | punct | (,3 |
R8925 | T13751 | T13748 | parataxis | 3,rspCre1 |
R8926 | T13752 | T13751 | dep | 5,3 |
R8927 | T13753 | T13752 | punct | ′,5 |
R8928 | T13754 | T13751 | punct | -,3 |
R8929 | T13755 | T13751 | dep | ACCAGGTTCGTTCACTCATGG,3 |
R8930 | T13756 | T13751 | punct | -,3 |
R8931 | T13757 | T13751 | punct | ′,3 |
R8932 | T13758 | T13751 | punct | ),3 |
R8933 | T13759 | T13748 | cc | and,rspCre1 |
R8934 | T13760 | T13748 | conj | rspCre2,rspCre1 |
R8935 | T13761 | T13762 | punct | (,AGGCTAAGTGCCTTCTCTACAC |
R8936 | T13762 | T13760 | parataxis | AGGCTAAGTGCCTTCTCTACAC,rspCre2 |
R8937 | T13763 | T13762 | nummod | 5,AGGCTAAGTGCCTTCTCTACAC |
R8938 | T13764 | T13763 | punct | ′,5 |
R8939 | T13765 | T13762 | punct | -,AGGCTAAGTGCCTTCTCTACAC |
R8940 | T13766 | T13762 | punct | -,AGGCTAAGTGCCTTCTCTACAC |
R8941 | T13767 | T13762 | nummod | 3,AGGCTAAGTGCCTTCTCTACAC |
R8942 | T13768 | T13762 | punct | ′,AGGCTAAGTGCCTTCTCTACAC |
R8943 | T13769 | T13762 | punct | ),AGGCTAAGTGCCTTCTCTACAC |
R8944 | T13770 | T13749 | punct | ", ",bp |
R8945 | T13771 | T13749 | nummod | 200,bp |
R8946 | T13772 | T13749 | nmod | basepairs,bp |
R8947 | T13773 | T13749 | punct | (,bp |
R8948 | T13774 | T13746 | punct | ),TgCre4 |
R8949 | T13775 | T13746 | punct | .,TgCre4 |
craft-ca-core-ex-dev
Below, discontinuous spans are shown in the bag model. You can change it to the chain model.
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T13946 | 1-3 | SO_EXT:transgenic_entity | denotes | Tg |
T13947 | 97-106 | SO_EXT:0000028 | denotes | basepairs |
T13948 | 108-110 | SO_EXT:0000028 | denotes | bp |
craft-ca-core-dev
Below, discontinuous spans are shown in the bag model. You can change it to the chain model.
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T13930 | 97-106 | SO:0000028 | denotes | basepairs |
T13931 | 108-110 | SO:0000028 | denotes | bp |