Id |
Subject |
Object |
Predicate |
Lexical cue |
T1758 |
0-10 |
NN |
denotes |
Generation |
T1759 |
11-13 |
IN |
denotes |
of |
T1760 |
14-18 |
NN |
denotes |
Mtf1 |
T1761 |
40-44 |
NNS |
denotes |
mice |
T1762 |
19-30 |
JJ |
denotes |
conditional |
T1763 |
31-39 |
NN |
denotes |
knockout |
T1764 |
45-48 |
CC |
denotes |
and |
T1765 |
49-54 |
NN |
denotes |
liver |
T1766 |
55-63 |
JJ |
denotes |
specific |
T1767 |
54-55 |
HYPH |
denotes |
- |
T1768 |
64-72 |
NN |
denotes |
deletion |
T1769 |
72-177 |
sentence |
denotes |
Mtf1 conditional knockout mice were generated in collaboration with Dr Michael Leviten (San Carlos, CA). |
T1770 |
73-77 |
NN |
denotes |
Mtf1 |
T1771 |
99-103 |
NNS |
denotes |
mice |
T1772 |
78-89 |
JJ |
denotes |
conditional |
T1773 |
90-98 |
NN |
denotes |
knockout |
T1774 |
109-118 |
VBN |
denotes |
generated |
T1775 |
104-108 |
VBD |
denotes |
were |
T1776 |
119-121 |
IN |
denotes |
in |
T1777 |
122-135 |
NN |
denotes |
collaboration |
T1778 |
136-140 |
IN |
denotes |
with |
T1779 |
141-143 |
NNP |
denotes |
Dr |
T1780 |
152-159 |
NNP |
denotes |
Leviten |
T1781 |
144-151 |
NNP |
denotes |
Michael |
T1782 |
160-161 |
-LRB- |
denotes |
( |
T1783 |
165-171 |
NNP |
denotes |
Carlos |
T1784 |
161-164 |
NNP |
denotes |
San |
T1785 |
171-173 |
, |
denotes |
, |
T1786 |
173-175 |
NNP |
denotes |
CA |
T1787 |
175-176 |
-RRB- |
denotes |
) |
T1788 |
176-177 |
. |
denotes |
. |
T1789 |
177-326 |
sentence |
denotes |
Two genomic clones containing exons 3 to 6 of Mtf1 were used to construct a gene targeting vector for homologous recombination (Supplementary Data). |
T1790 |
178-181 |
CD |
denotes |
Two |
T1791 |
190-196 |
NNS |
denotes |
clones |
T1792 |
182-189 |
JJ |
denotes |
genomic |
T1793 |
234-238 |
VBN |
denotes |
used |
T1794 |
197-207 |
VBG |
denotes |
containing |
T1795 |
208-213 |
NNS |
denotes |
exons |
T1796 |
214-215 |
CD |
denotes |
3 |
T1797 |
216-218 |
IN |
denotes |
to |
T1798 |
219-220 |
CD |
denotes |
6 |
T1799 |
221-223 |
IN |
denotes |
of |
T1800 |
224-228 |
NN |
denotes |
Mtf1 |
T1801 |
229-233 |
VBD |
denotes |
were |
T1802 |
239-241 |
TO |
denotes |
to |
T1803 |
242-251 |
VB |
denotes |
construct |
T1804 |
252-253 |
DT |
denotes |
a |
T1805 |
269-275 |
NN |
denotes |
vector |
T1806 |
254-258 |
NN |
denotes |
gene |
T1807 |
259-268 |
NN |
denotes |
targeting |
T1808 |
276-279 |
IN |
denotes |
for |
T1809 |
280-290 |
JJ |
denotes |
homologous |
T1810 |
291-304 |
NN |
denotes |
recombination |
T1811 |
305-306 |
-LRB- |
denotes |
( |
T1812 |
320-324 |
NNS |
denotes |
Data |
T1813 |
306-319 |
JJ |
denotes |
Supplementary |
T1814 |
324-325 |
-RRB- |
denotes |
) |
T1815 |
325-326 |
. |
denotes |
. |
T1816 |
326-509 |
sentence |
denotes |
A neomycin resistance cassette (PGK-neo) flanked by two loxP sites was cloned into the SacI site 5′ of exon 3 of Mtf1, the third loxP site was cloned into the ScaI site 3′ of exon 4. |
T1817 |
327-328 |
DT |
denotes |
A |
T1818 |
349-357 |
NN |
denotes |
cassette |
T1819 |
329-337 |
NN |
denotes |
neomycin |
T1820 |
338-348 |
NN |
denotes |
resistance |
T1821 |
398-404 |
VBN |
denotes |
cloned |
T1822 |
358-359 |
-LRB- |
denotes |
( |
T1823 |
359-362 |
NN |
denotes |
PGK |
T1824 |
363-366 |
NN |
denotes |
neo |
T1825 |
362-363 |
HYPH |
denotes |
- |
T1826 |
366-367 |
-RRB- |
denotes |
) |
T1827 |
368-375 |
VBN |
denotes |
flanked |
T1828 |
376-378 |
IN |
denotes |
by |
T1829 |
379-382 |
CD |
denotes |
two |
T1830 |
388-393 |
NNS |
denotes |
sites |
T1831 |
383-387 |
NN |
denotes |
loxP |
T1832 |
394-397 |
VBD |
denotes |
was |
T1833 |
470-476 |
VBN |
denotes |
cloned |
T1834 |
405-409 |
IN |
denotes |
into |
T1835 |
410-413 |
DT |
denotes |
the |
T1836 |
419-423 |
NN |
denotes |
site |
T1837 |
414-418 |
NN |
denotes |
SacI |
T1838 |
424-425 |
CD |
denotes |
5 |
T1839 |
425-426 |
SYM |
denotes |
′ |
T1840 |
427-429 |
IN |
denotes |
of |
T1841 |
430-434 |
NN |
denotes |
exon |
T1842 |
435-436 |
CD |
denotes |
3 |
T1843 |
437-439 |
IN |
denotes |
of |
T1844 |
440-444 |
NN |
denotes |
Mtf1 |
T1845 |
444-446 |
, |
denotes |
, |
T1846 |
446-449 |
DT |
denotes |
the |
T1847 |
461-465 |
NN |
denotes |
site |
T1848 |
450-455 |
JJ |
denotes |
third |
T1849 |
456-460 |
NN |
denotes |
loxP |
T1850 |
466-469 |
VBD |
denotes |
was |
T1851 |
477-481 |
IN |
denotes |
into |
T1852 |
482-485 |
DT |
denotes |
the |
T1853 |
491-495 |
NN |
denotes |
site |
T1854 |
486-490 |
NN |
denotes |
ScaI |
T1855 |
496-497 |
CD |
denotes |
3 |
T1856 |
497-498 |
SYM |
denotes |
′ |
T1857 |
499-501 |
IN |
denotes |
of |
T1858 |
502-506 |
NN |
denotes |
exon |
T1859 |
507-508 |
CD |
denotes |
4 |
T1860 |
508-509 |
. |
denotes |
. |
T1861 |
509-586 |
sentence |
denotes |
A thymidine kinase (TK) cassette was inserted in the HpaI site 3′ of exon 6. |
T1862 |
510-511 |
DT |
denotes |
A |
T1863 |
534-542 |
NN |
denotes |
cassette |
T1864 |
512-521 |
NN |
denotes |
thymidine |
T1865 |
522-528 |
NN |
denotes |
kinase |
T1866 |
529-530 |
-LRB- |
denotes |
( |
T1867 |
530-532 |
NN |
denotes |
TK |
T1868 |
532-533 |
-RRB- |
denotes |
) |
T1869 |
547-555 |
VBN |
denotes |
inserted |
T1870 |
543-546 |
VBD |
denotes |
was |
T1871 |
556-558 |
IN |
denotes |
in |
T1872 |
559-562 |
DT |
denotes |
the |
T1873 |
568-572 |
NN |
denotes |
site |
T1874 |
563-567 |
NN |
denotes |
HpaI |
T1875 |
573-574 |
CD |
denotes |
3 |
T1876 |
574-575 |
SYM |
denotes |
′ |
T1877 |
576-578 |
IN |
denotes |
of |
T1878 |
579-583 |
NN |
denotes |
exon |
T1879 |
584-585 |
CD |
denotes |
6 |
T1880 |
585-586 |
. |
denotes |
. |
T1881 |
586-779 |
sentence |
denotes |
129 ES cells were electroporated with the linearized targeting vector, selected in the presence of G418 and FIAU, and screened for correct integration events by PCR and Southern blot analysis. |
T1882 |
587-590 |
CD |
denotes |
129 |
T1883 |
594-599 |
NNS |
denotes |
cells |
T1884 |
591-593 |
NN |
denotes |
ES |
T1885 |
605-619 |
VBN |
denotes |
electroporated |
T1886 |
600-604 |
VBD |
denotes |
were |
T1887 |
620-624 |
IN |
denotes |
with |
T1888 |
625-628 |
DT |
denotes |
the |
T1889 |
650-656 |
NN |
denotes |
vector |
T1890 |
629-639 |
VBN |
denotes |
linearized |
T1891 |
640-649 |
NN |
denotes |
targeting |
T1892 |
656-658 |
, |
denotes |
, |
T1893 |
658-666 |
VBN |
denotes |
selected |
T1894 |
667-669 |
IN |
denotes |
in |
T1895 |
670-673 |
DT |
denotes |
the |
T1896 |
674-682 |
NN |
denotes |
presence |
T1897 |
683-685 |
IN |
denotes |
of |
T1898 |
686-690 |
NN |
denotes |
G418 |
T1899 |
691-694 |
CC |
denotes |
and |
T1900 |
695-699 |
NN |
denotes |
FIAU |
T1901 |
699-701 |
, |
denotes |
, |
T1902 |
701-704 |
CC |
denotes |
and |
T1903 |
705-713 |
VBN |
denotes |
screened |
T1904 |
714-717 |
IN |
denotes |
for |
T1905 |
718-725 |
JJ |
denotes |
correct |
T1906 |
738-744 |
NNS |
denotes |
events |
T1907 |
726-737 |
NN |
denotes |
integration |
T1908 |
745-747 |
IN |
denotes |
by |
T1909 |
748-751 |
NN |
denotes |
PCR |
T1910 |
770-778 |
NN |
denotes |
analysis |
T1911 |
752-755 |
CC |
denotes |
and |
T1912 |
756-764 |
NNP |
denotes |
Southern |
T1913 |
765-769 |
NN |
denotes |
blot |
T1914 |
778-779 |
. |
denotes |
. |
T1915 |
779-1002 |
sentence |
denotes |
Transient expression of Cre recombinase led to removal of the PGK-neo cassette, and mice carrying the modified Mtf1loxP allele were generated by injection of positive clones into C57Bl/6 blastocysts and subsequent crosses. |
T1916 |
780-789 |
JJ |
denotes |
Transient |
T1917 |
790-800 |
NN |
denotes |
expression |
T1918 |
820-823 |
VBD |
denotes |
led |
T1919 |
801-803 |
IN |
denotes |
of |
T1920 |
804-807 |
NN |
denotes |
Cre |
T1921 |
808-819 |
NN |
denotes |
recombinase |
T1922 |
824-826 |
IN |
denotes |
to |
T1923 |
827-834 |
NN |
denotes |
removal |
T1924 |
835-837 |
IN |
denotes |
of |
T1925 |
838-841 |
DT |
denotes |
the |
T1926 |
850-858 |
NN |
denotes |
cassette |
T1927 |
842-845 |
NN |
denotes |
PGK |
T1928 |
846-849 |
NN |
denotes |
neo |
T1929 |
845-846 |
HYPH |
denotes |
- |
T1930 |
858-860 |
, |
denotes |
, |
T1931 |
860-863 |
CC |
denotes |
and |
T1932 |
864-868 |
NNS |
denotes |
mice |
T1933 |
912-921 |
VBN |
denotes |
generated |
T1934 |
869-877 |
VBG |
denotes |
carrying |
T1935 |
878-881 |
DT |
denotes |
the |
T1936 |
900-906 |
NN |
denotes |
allele |
T1937 |
882-890 |
VBN |
denotes |
modified |
T1938 |
891-899 |
NN |
denotes |
Mtf1loxP |
T1939 |
907-911 |
VBD |
denotes |
were |
T1940 |
922-924 |
IN |
denotes |
by |
T1941 |
925-934 |
NN |
denotes |
injection |
T1942 |
935-937 |
IN |
denotes |
of |
T1943 |
938-946 |
JJ |
denotes |
positive |
T1944 |
947-953 |
NNS |
denotes |
clones |
T1945 |
954-958 |
IN |
denotes |
into |
T1946 |
959-964 |
NN |
denotes |
C57Bl |
T1947 |
967-978 |
NNS |
denotes |
blastocysts |
T1948 |
964-965 |
HYPH |
denotes |
/ |
T1949 |
965-966 |
CD |
denotes |
6 |
T1950 |
979-982 |
CC |
denotes |
and |
T1951 |
983-993 |
JJ |
denotes |
subsequent |
T1952 |
994-1001 |
NNS |
denotes |
crosses |
T1953 |
1001-1002 |
. |
denotes |
. |
T1955 |
1003-1013 |
JJ |
denotes |
Homozygous |
T1956 |
1035-1042 |
NNS |
denotes |
animals |
T1957 |
1014-1025 |
JJ |
denotes |
conditional |
T1958 |
1026-1034 |
NN |
denotes |
knockout |
T1959 |
1064-1071 |
VBN |
denotes |
crossed |
T1960 |
1043-1044 |
-LRB- |
denotes |
( |
T1961 |
1044-1052 |
NN |
denotes |
Mtf1loxP |
T1962 |
1053-1057 |
NN |
denotes |
loxP |
T1963 |
1052-1053 |
HYPH |
denotes |
/ |
T1964 |
1057-1058 |
-RRB- |
denotes |
) |
T1965 |
1059-1063 |
VBD |
denotes |
were |
T1966 |
1072-1076 |
IN |
denotes |
with |
T1967 |
1077-1080 |
DT |
denotes |
the |
T1968 |
1108-1112 |
NN |
denotes |
line |
T2099 |
1210-1211 |
. |
denotes |
. |
T2100 |
1211-1465 |
sentence |
denotes |
The mice were genotyped by PCR using the following primers (Microsynth): Cre recombinase: 5′-CTATCCAGCAACATTTGGGCCAGC-3′; 5′-CCAGGTTACGGATATAGTTCATGAC-3′, Mtf1loxP or wild-type allele: 5′-CACACCCAGTTTGTGTATGTCTTC-3′; 5′-CAGTCACAAGCAAATTACCAAACACTGCC-3′. |
T2101 |
1212-1215 |
DT |
denotes |
The |
T2102 |
1216-1220 |
NNS |
denotes |
mice |
T2103 |
1226-1235 |
VBN |
denotes |
genotyped |
T2104 |
1221-1225 |
VBD |
denotes |
were |
T2105 |
1236-1238 |
IN |
denotes |
by |
T2106 |
1239-1242 |
NN |
denotes |
PCR |
T2107 |
1243-1248 |
VBG |
denotes |
using |
T2108 |
1249-1252 |
DT |
denotes |
the |
T2109 |
1263-1270 |
NNS |
denotes |
primers |
T2110 |
1253-1262 |
VBG |
denotes |
following |
T2111 |
1271-1272 |
-LRB- |
denotes |
( |
T2112 |
1272-1282 |
NNP |
denotes |
Microsynth |
T2113 |
1282-1283 |
-RRB- |
denotes |
) |
T2114 |
1283-1285 |
: |
denotes |
: |
T2115 |
1285-1288 |
NN |
denotes |
Cre |
T2116 |
1289-1300 |
NN |
denotes |
recombinase |
T2117 |
1337-1362 |
NN |
denotes |
CCAGGTTACGGATATAGTTCATGAC |
T2118 |
1300-1302 |
: |
denotes |
: |
T2119 |
1302-1303 |
CD |
denotes |
5 |
T2120 |
1305-1329 |
NN |
denotes |
CTATCCAGCAACATTTGGGCCAGC |
T2121 |
1303-1304 |
SYM |
denotes |
′ |
T2122 |
1304-1305 |
HYPH |
denotes |
- |
T2123 |
1329-1330 |
HYPH |
denotes |
- |
T2124 |
1330-1331 |
CD |
denotes |
3 |
T2125 |
1331-1332 |
SYM |
denotes |
′ |
T2126 |
1332-1333 |
: |
denotes |
; |
T2127 |
1334-1335 |
CD |
denotes |
5 |
T2128 |
1335-1336 |
SYM |
denotes |
′ |
T2129 |
1336-1337 |
HYPH |
denotes |
- |
T2130 |
1432-1461 |
NN |
denotes |
CAGTCACAAGCAAATTACCAAACACTGCC |
T2131 |
1362-1363 |
HYPH |
denotes |
- |
T2132 |
1363-1364 |
CD |
denotes |
3 |
T2133 |
1364-1365 |
SYM |
denotes |
′ |
T2134 |
1365-1367 |
, |
denotes |
, |
T2135 |
1367-1375 |
NN |
denotes |
Mtf1loxP |
T2136 |
1376-1378 |
CC |
denotes |
or |
T2137 |
1379-1383 |
JJ |
denotes |
wild |
T2138 |
1384-1388 |
NN |
denotes |
type |
T2139 |
1383-1384 |
HYPH |
denotes |
- |
T2140 |
1389-1395 |
NN |
denotes |
allele |
T2141 |
1395-1397 |
: |
denotes |
: |
T2142 |
1397-1398 |
CD |
denotes |
5 |
T2143 |
1400-1424 |
NN |
denotes |
CACACCCAGTTTGTGTATGTCTTC |
T2144 |
1398-1399 |
SYM |
denotes |
′ |
T2145 |
1399-1400 |
HYPH |
denotes |
- |
T2146 |
1424-1425 |
HYPH |
denotes |
- |
T2147 |
1425-1426 |
CD |
denotes |
3 |
T2148 |
1426-1427 |
SYM |
denotes |
′ |
T2149 |
1427-1428 |
: |
denotes |
; |
T2150 |
1429-1430 |
CD |
denotes |
5 |
T2151 |
1430-1431 |
SYM |
denotes |
′ |
T2152 |
1431-1432 |
HYPH |
denotes |
- |
T2153 |
1461-1462 |
HYPH |
denotes |
- |
T2154 |
1462-1463 |
CD |
denotes |
3 |
T2155 |
1463-1464 |
SYM |
denotes |
′ |
T2156 |
1464-1465 |
. |
denotes |
. |
T1954 |
1002-1211 |
sentence |
denotes |
Homozygous conditional knockout animals (Mtf1loxP/loxP) were crossed with the Cre recombinase transgenic line Mx-cre (a gift from Prof. Michel Aguet) to obtain an inducible, liver-specific Mtf1 knockout line. |
T2075 |
1085-1096 |
NN |
denotes |
recombinase |
T2076 |
1097-1107 |
JJ |
denotes |
transgenic |
T2077 |
1113-1115 |
NN |
denotes |
Mx |
T2078 |
1116-1119 |
NN |
denotes |
cre |
T2079 |
1115-1116 |
HYPH |
denotes |
- |
T2080 |
1120-1121 |
-LRB- |
denotes |
( |
T2081 |
1123-1127 |
NN |
denotes |
gift |
T2082 |
1121-1122 |
DT |
denotes |
a |
T2083 |
1128-1132 |
IN |
denotes |
from |
T2084 |
1133-1138 |
NNP |
denotes |
Prof. |
T2085 |
1146-1151 |
NNP |
denotes |
Aguet |
T2086 |
1139-1145 |
NNP |
denotes |
Michel |
T2087 |
1151-1152 |
-RRB- |
denotes |
) |
T2088 |
1153-1155 |
TO |
denotes |
to |
T2089 |
1156-1162 |
VB |
denotes |
obtain |
T2090 |
1163-1165 |
DT |
denotes |
an |
T2091 |
1206-1210 |
NN |
denotes |
line |
T2092 |
1166-1175 |
JJ |
denotes |
inducible |
T2093 |
1175-1177 |
, |
denotes |
, |
T2094 |
1177-1182 |
NN |
denotes |
liver |
T2095 |
1183-1191 |
JJ |
denotes |
specific |
T2096 |
1182-1183 |
HYPH |
denotes |
- |
T2097 |
1192-1196 |
NN |
denotes |
Mtf1 |
T2098 |
1197-1205 |
NN |
denotes |
knockout |
T2074 |
1081-1084 |
NN |
denotes |
Cre |
R1032 |
T1759 |
T1758 |
prep |
of,Generation |
R1033 |
T1760 |
T1761 |
nmod |
Mtf1,mice |
R1034 |
T1761 |
T1759 |
pobj |
mice,of |
R1035 |
T1762 |
T1763 |
amod |
conditional,knockout |
R1036 |
T1763 |
T1761 |
compound |
knockout,mice |
R1037 |
T1764 |
T1761 |
cc |
and,mice |
R1038 |
T1765 |
T1766 |
npadvmod |
liver,specific |
R1039 |
T1766 |
T1768 |
amod |
specific,deletion |
R1040 |
T1767 |
T1766 |
punct |
-,specific |
R1041 |
T1768 |
T1761 |
conj |
deletion,mice |
R1042 |
T1770 |
T1771 |
nmod |
Mtf1,mice |
R1043 |
T1771 |
T1774 |
nsubjpass |
mice,generated |
R1044 |
T1772 |
T1773 |
amod |
conditional,knockout |
R1045 |
T1773 |
T1771 |
compound |
knockout,mice |
R1046 |
T1775 |
T1774 |
auxpass |
were,generated |
R1047 |
T1776 |
T1774 |
prep |
in,generated |
R1048 |
T1777 |
T1776 |
pobj |
collaboration,in |
R1049 |
T1778 |
T1777 |
prep |
with,collaboration |
R1050 |
T1779 |
T1780 |
compound |
Dr,Leviten |
R1051 |
T1780 |
T1778 |
pobj |
Leviten,with |
R1052 |
T1781 |
T1780 |
compound |
Michael,Leviten |
R1053 |
T1782 |
T1783 |
punct |
(,Carlos |
R1054 |
T1783 |
T1780 |
parataxis |
Carlos,Leviten |
R1055 |
T1784 |
T1783 |
compound |
San,Carlos |
R1056 |
T1785 |
T1783 |
punct |
", ",Carlos |
R1057 |
T1786 |
T1783 |
npadvmod |
CA,Carlos |
R1058 |
T1787 |
T1783 |
punct |
),Carlos |
R1059 |
T1788 |
T1774 |
punct |
.,generated |
R1060 |
T1790 |
T1791 |
nummod |
Two,clones |
R1061 |
T1791 |
T1793 |
nsubjpass |
clones,used |
R1062 |
T1792 |
T1791 |
amod |
genomic,clones |
R1063 |
T1794 |
T1791 |
acl |
containing,clones |
R1064 |
T1795 |
T1796 |
nmod |
exons,3 |
R1065 |
T1796 |
T1794 |
dobj |
3,containing |
R1066 |
T1797 |
T1796 |
prep |
to,3 |
R1067 |
T1798 |
T1797 |
pobj |
6,to |
R1068 |
T1799 |
T1796 |
prep |
of,3 |
R1069 |
T1800 |
T1799 |
pobj |
Mtf1,of |
R1070 |
T1801 |
T1793 |
auxpass |
were,used |
R1071 |
T1802 |
T1803 |
aux |
to,construct |
R1072 |
T1803 |
T1793 |
advcl |
construct,used |
R1073 |
T1804 |
T1805 |
det |
a,vector |
R1074 |
T1805 |
T1803 |
dobj |
vector,construct |
R1075 |
T1806 |
T1807 |
compound |
gene,targeting |
R1076 |
T1807 |
T1805 |
compound |
targeting,vector |
R1077 |
T1808 |
T1803 |
prep |
for,construct |
R1078 |
T1809 |
T1810 |
amod |
homologous,recombination |
R1079 |
T1810 |
T1808 |
pobj |
recombination,for |
R1080 |
T1811 |
T1812 |
punct |
(,Data |
R1081 |
T1812 |
T1803 |
parataxis |
Data,construct |
R1082 |
T1813 |
T1812 |
amod |
Supplementary,Data |
R1083 |
T1814 |
T1812 |
punct |
),Data |
R1084 |
T1815 |
T1793 |
punct |
.,used |
R1085 |
T1817 |
T1818 |
det |
A,cassette |
R1086 |
T1818 |
T1821 |
nsubjpass |
cassette,cloned |
R1087 |
T1819 |
T1818 |
compound |
neomycin,cassette |
R1088 |
T1820 |
T1818 |
compound |
resistance,cassette |
R1089 |
T1821 |
T1833 |
ccomp |
cloned,cloned |
R1090 |
T1822 |
T1818 |
punct |
(,cassette |
R1091 |
T1823 |
T1824 |
compound |
PGK,neo |
R1092 |
T1824 |
T1818 |
appos |
neo,cassette |
R1093 |
T1825 |
T1824 |
punct |
-,neo |
R1094 |
T1826 |
T1818 |
punct |
),cassette |
R1095 |
T1827 |
T1818 |
acl |
flanked,cassette |
R1096 |
T1828 |
T1827 |
agent |
by,flanked |
R1097 |
T1829 |
T1830 |
nummod |
two,sites |
R1098 |
T1830 |
T1828 |
pobj |
sites,by |
R1099 |
T1831 |
T1830 |
compound |
loxP,sites |
R1100 |
T1832 |
T1821 |
auxpass |
was,cloned |
R1101 |
T1834 |
T1821 |
prep |
into,cloned |
R1102 |
T1835 |
T1836 |
det |
the,site |
R1103 |
T1836 |
T1834 |
pobj |
site,into |
R1104 |
T1837 |
T1836 |
compound |
SacI,site |
R1105 |
T1838 |
T1836 |
npadvmod |
5,site |
R1106 |
T1839 |
T1838 |
punct |
′,5 |
R1107 |
T1840 |
T1838 |
prep |
of,5 |
R1108 |
T1841 |
T1840 |
pobj |
exon,of |
R1109 |
T1842 |
T1841 |
nummod |
3,exon |
R1110 |
T1843 |
T1841 |
prep |
of,exon |
R1111 |
T1844 |
T1843 |
pobj |
Mtf1,of |
R1112 |
T1845 |
T1833 |
punct |
", ",cloned |
R1113 |
T1846 |
T1847 |
det |
the,site |
R1114 |
T1847 |
T1833 |
nsubjpass |
site,cloned |
R1115 |
T1848 |
T1847 |
amod |
third,site |
R1116 |
T1849 |
T1847 |
compound |
loxP,site |
R1117 |
T1850 |
T1833 |
auxpass |
was,cloned |
R1118 |
T1851 |
T1833 |
prep |
into,cloned |
R1119 |
T1852 |
T1853 |
det |
the,site |
R1120 |
T1853 |
T1851 |
pobj |
site,into |
R1121 |
T1854 |
T1853 |
compound |
ScaI,site |
R1122 |
T1855 |
T1853 |
npadvmod |
3,site |
R1123 |
T1856 |
T1855 |
punct |
′,3 |
R1124 |
T1857 |
T1855 |
prep |
of,3 |
R1125 |
T1858 |
T1857 |
pobj |
exon,of |
R1126 |
T1859 |
T1858 |
nummod |
4,exon |
R1127 |
T1860 |
T1833 |
punct |
.,cloned |
R1128 |
T1862 |
T1863 |
det |
A,cassette |
R1129 |
T1863 |
T1869 |
nsubjpass |
cassette,inserted |
R1130 |
T1864 |
T1865 |
nmod |
thymidine,kinase |
R1131 |
T1865 |
T1863 |
nmod |
kinase,cassette |
R1132 |
T1866 |
T1865 |
punct |
(,kinase |
R1133 |
T1867 |
T1865 |
appos |
TK,kinase |
R1134 |
T1868 |
T1863 |
punct |
),cassette |
R1135 |
T1870 |
T1869 |
auxpass |
was,inserted |
R1136 |
T1871 |
T1869 |
prep |
in,inserted |
R1137 |
T1872 |
T1873 |
det |
the,site |
R1138 |
T1873 |
T1871 |
pobj |
site,in |
R1139 |
T1874 |
T1873 |
compound |
HpaI,site |
R1140 |
T1875 |
T1873 |
npadvmod |
3,site |
R1141 |
T1876 |
T1875 |
punct |
′,3 |
R1142 |
T1877 |
T1875 |
prep |
of,3 |
R1143 |
T1878 |
T1877 |
pobj |
exon,of |
R1144 |
T1879 |
T1878 |
nummod |
6,exon |
R1145 |
T1880 |
T1869 |
punct |
.,inserted |
R1146 |
T1882 |
T1883 |
nummod |
129,cells |
R1147 |
T1883 |
T1885 |
nsubjpass |
cells,electroporated |
R1148 |
T1884 |
T1883 |
compound |
ES,cells |
R1149 |
T1886 |
T1885 |
auxpass |
were,electroporated |
R1150 |
T1887 |
T1885 |
prep |
with,electroporated |
R1151 |
T1888 |
T1889 |
det |
the,vector |
R1152 |
T1889 |
T1887 |
pobj |
vector,with |
R1153 |
T1890 |
T1889 |
amod |
linearized,vector |
R1154 |
T1891 |
T1889 |
compound |
targeting,vector |
R1155 |
T1892 |
T1889 |
punct |
", ",vector |
R1156 |
T1893 |
T1889 |
acl |
selected,vector |
R1157 |
T1894 |
T1893 |
prep |
in,selected |
R1158 |
T1895 |
T1896 |
det |
the,presence |
R1159 |
T1896 |
T1894 |
pobj |
presence,in |
R1160 |
T1897 |
T1896 |
prep |
of,presence |
R1161 |
T1898 |
T1897 |
pobj |
G418,of |
R1162 |
T1899 |
T1898 |
cc |
and,G418 |
R1163 |
T1900 |
T1898 |
conj |
FIAU,G418 |
R1164 |
T1901 |
T1885 |
punct |
", ",electroporated |
R1165 |
T1902 |
T1885 |
cc |
and,electroporated |
R1166 |
T1903 |
T1885 |
conj |
screened,electroporated |
R1167 |
T1904 |
T1903 |
prep |
for,screened |
R1168 |
T1905 |
T1906 |
amod |
correct,events |
R1169 |
T1906 |
T1904 |
pobj |
events,for |
R1170 |
T1907 |
T1906 |
compound |
integration,events |
R1171 |
T1908 |
T1903 |
prep |
by,screened |
R1172 |
T1909 |
T1910 |
nmod |
PCR,analysis |
R1173 |
T1910 |
T1908 |
pobj |
analysis,by |
R1174 |
T1911 |
T1909 |
cc |
and,PCR |
R1175 |
T1912 |
T1913 |
compound |
Southern,blot |
R1176 |
T1913 |
T1909 |
conj |
blot,PCR |
R1177 |
T1914 |
T1885 |
punct |
.,electroporated |
R1178 |
T1916 |
T1917 |
amod |
Transient,expression |
R1179 |
T1917 |
T1918 |
nsubj |
expression,led |
R1180 |
T1919 |
T1917 |
prep |
of,expression |
R1181 |
T1920 |
T1921 |
compound |
Cre,recombinase |
R1182 |
T1921 |
T1919 |
pobj |
recombinase,of |
R1183 |
T1922 |
T1918 |
prep |
to,led |
R1184 |
T1923 |
T1922 |
pobj |
removal,to |
R1185 |
T1924 |
T1923 |
prep |
of,removal |
R1186 |
T1925 |
T1926 |
det |
the,cassette |
R1187 |
T1926 |
T1924 |
pobj |
cassette,of |
R1188 |
T1927 |
T1928 |
compound |
PGK,neo |
R1189 |
T1928 |
T1926 |
compound |
neo,cassette |
R1190 |
T1929 |
T1928 |
punct |
-,neo |
R1191 |
T1930 |
T1918 |
punct |
", ",led |
R1192 |
T1931 |
T1918 |
cc |
and,led |
R1193 |
T1932 |
T1933 |
nsubjpass |
mice,generated |
R1194 |
T1933 |
T1918 |
conj |
generated,led |
R1195 |
T1934 |
T1932 |
acl |
carrying,mice |
R1196 |
T1935 |
T1936 |
det |
the,allele |
R1197 |
T1936 |
T1934 |
dobj |
allele,carrying |
R1198 |
T1937 |
T1936 |
amod |
modified,allele |
R1199 |
T1938 |
T1936 |
compound |
Mtf1loxP,allele |
R1200 |
T1939 |
T1933 |
auxpass |
were,generated |
R1201 |
T1940 |
T1933 |
prep |
by,generated |
R1202 |
T1941 |
T1940 |
pobj |
injection,by |
R1203 |
T1942 |
T1941 |
prep |
of,injection |
R1204 |
T1943 |
T1944 |
amod |
positive,clones |
R1205 |
T1944 |
T1942 |
pobj |
clones,of |
R1206 |
T1945 |
T1941 |
prep |
into,injection |
R1207 |
T1946 |
T1947 |
nmod |
C57Bl,blastocysts |
R1208 |
T1947 |
T1945 |
pobj |
blastocysts,into |
R1209 |
T1948 |
T1946 |
punct |
/,C57Bl |
R1210 |
T1949 |
T1946 |
nummod |
6,C57Bl |
R1211 |
T1950 |
T1947 |
cc |
and,blastocysts |
R1212 |
T1951 |
T1952 |
amod |
subsequent,crosses |
R1213 |
T1952 |
T1947 |
conj |
crosses,blastocysts |
R1214 |
T1953 |
T1933 |
punct |
.,generated |
R1215 |
T1955 |
T1956 |
amod |
Homozygous,animals |
R1216 |
T1956 |
T1959 |
nsubjpass |
animals,crossed |
R1217 |
T1957 |
T1958 |
amod |
conditional,knockout |
R1218 |
T1958 |
T1956 |
compound |
knockout,animals |
R1219 |
T1960 |
T1956 |
punct |
(,animals |
R1220 |
T1961 |
T1962 |
compound |
Mtf1loxP,loxP |
R1221 |
T1962 |
T1956 |
appos |
loxP,animals |
R1222 |
T1963 |
T1962 |
punct |
/,loxP |
R1223 |
T1964 |
T1959 |
punct |
),crossed |
R1224 |
T1965 |
T1959 |
auxpass |
were,crossed |
R1225 |
T1966 |
T1959 |
prep |
with,crossed |
R1226 |
T1967 |
T1968 |
det |
the,line |
R1227 |
T1968 |
T1966 |
pobj |
line,with |
R1228 |
T2074 |
T2075 |
compound |
Cre,recombinase |
R1229 |
T2075 |
T2076 |
npadvmod |
recombinase,transgenic |
R1230 |
T2076 |
T1968 |
amod |
transgenic,line |
R1231 |
T2077 |
T2078 |
compound |
Mx,cre |
R1232 |
T2078 |
T1968 |
appos |
cre,line |
R1233 |
T2079 |
T2078 |
punct |
-,cre |
R1234 |
T2080 |
T2081 |
punct |
(,gift |
R1235 |
T2081 |
T1968 |
parataxis |
gift,line |
R1236 |
T2082 |
T2081 |
det |
a,gift |
R1237 |
T2083 |
T2081 |
prep |
from,gift |
R1238 |
T2084 |
T2085 |
compound |
Prof.,Aguet |
R1239 |
T2085 |
T2083 |
pobj |
Aguet,from |
R1240 |
T2086 |
T2085 |
compound |
Michel,Aguet |
R1241 |
T2087 |
T2081 |
punct |
),gift |
R1242 |
T2088 |
T2089 |
aux |
to,obtain |
R1243 |
T2089 |
T1959 |
advcl |
obtain,crossed |
R1244 |
T2090 |
T2091 |
det |
an,line |
R1245 |
T2091 |
T2089 |
dobj |
line,obtain |
R1246 |
T2092 |
T2091 |
amod |
inducible,line |
R1247 |
T2093 |
T2091 |
punct |
", ",line |
R1248 |
T2094 |
T2095 |
npadvmod |
liver,specific |
R1249 |
T2095 |
T2091 |
amod |
specific,line |
R1250 |
T2096 |
T2095 |
punct |
-,specific |
R1251 |
T2097 |
T2098 |
compound |
Mtf1,knockout |
R1252 |
T2098 |
T2091 |
compound |
knockout,line |
R1253 |
T2099 |
T1959 |
punct |
.,crossed |
R1254 |
T2101 |
T2102 |
det |
The,mice |
R1255 |
T2102 |
T2103 |
nsubjpass |
mice,genotyped |
R1256 |
T2104 |
T2103 |
auxpass |
were,genotyped |
R1257 |
T2105 |
T2103 |
prep |
by,genotyped |
R1258 |
T2106 |
T2105 |
pobj |
PCR,by |
R1259 |
T2107 |
T2103 |
advcl |
using,genotyped |
R1260 |
T2108 |
T2109 |
det |
the,primers |
R1261 |
T2109 |
T2107 |
dobj |
primers,using |
R1262 |
T2110 |
T2109 |
amod |
following,primers |
R1263 |
T2111 |
T2112 |
punct |
(,Microsynth |
R1264 |
T2112 |
T2109 |
parataxis |
Microsynth,primers |
R1265 |
T2113 |
T2112 |
punct |
),Microsynth |
R1266 |
T2114 |
T2103 |
punct |
: ,genotyped |
R1267 |
T2115 |
T2116 |
compound |
Cre,recombinase |
R1268 |
T2116 |
T2117 |
dep |
recombinase,CCAGGTTACGGATATAGTTCATGAC |
R1269 |
T2117 |
T2130 |
dep |
CCAGGTTACGGATATAGTTCATGAC,CAGTCACAAGCAAATTACCAAACACTGCC |
R1270 |
T2118 |
T2117 |
punct |
: ,CCAGGTTACGGATATAGTTCATGAC |
R1271 |
T2119 |
T2120 |
nummod |
5,CTATCCAGCAACATTTGGGCCAGC |
R1272 |
T2120 |
T2117 |
dep |
CTATCCAGCAACATTTGGGCCAGC,CCAGGTTACGGATATAGTTCATGAC |
R1273 |
T2121 |
T2119 |
punct |
′,5 |
R1274 |
T2122 |
T2120 |
punct |
-,CTATCCAGCAACATTTGGGCCAGC |
R1275 |
T2123 |
T2120 |
punct |
-,CTATCCAGCAACATTTGGGCCAGC |
R1276 |
T2124 |
T2120 |
nummod |
3,CTATCCAGCAACATTTGGGCCAGC |
R1277 |
T2125 |
T2120 |
punct |
′,CTATCCAGCAACATTTGGGCCAGC |
R1278 |
T2126 |
T2117 |
punct |
;,CCAGGTTACGGATATAGTTCATGAC |
R1279 |
T2127 |
T2117 |
nummod |
5,CCAGGTTACGGATATAGTTCATGAC |
R1280 |
T2128 |
T2127 |
punct |
′,5 |
R1281 |
T2129 |
T2117 |
punct |
-,CCAGGTTACGGATATAGTTCATGAC |
R1282 |
T2130 |
T2103 |
dep |
CAGTCACAAGCAAATTACCAAACACTGCC,genotyped |
R1283 |
T2131 |
T2117 |
punct |
-,CCAGGTTACGGATATAGTTCATGAC |
R1284 |
T2132 |
T2117 |
nummod |
3,CCAGGTTACGGATATAGTTCATGAC |
R1285 |
T2133 |
T2117 |
punct |
′,CCAGGTTACGGATATAGTTCATGAC |
R1286 |
T2134 |
T2130 |
punct |
", ",CAGTCACAAGCAAATTACCAAACACTGCC |
R1287 |
T2135 |
T2130 |
dep |
Mtf1loxP,CAGTCACAAGCAAATTACCAAACACTGCC |
R1288 |
T2136 |
T2135 |
cc |
or,Mtf1loxP |
R1289 |
T2137 |
T2138 |
amod |
wild,type |
R1290 |
T2138 |
T2140 |
compound |
type,allele |
R1291 |
T2139 |
T2138 |
punct |
-,type |
R1292 |
T2140 |
T2135 |
conj |
allele,Mtf1loxP |
R1293 |
T2141 |
T2130 |
punct |
: ,CAGTCACAAGCAAATTACCAAACACTGCC |
R1294 |
T2142 |
T2143 |
nummod |
5,CACACCCAGTTTGTGTATGTCTTC |
R1295 |
T2143 |
T2130 |
dep |
CACACCCAGTTTGTGTATGTCTTC,CAGTCACAAGCAAATTACCAAACACTGCC |
R1296 |
T2144 |
T2142 |
punct |
′,5 |
R1297 |
T2145 |
T2143 |
punct |
-,CACACCCAGTTTGTGTATGTCTTC |
R1298 |
T2146 |
T2143 |
punct |
-,CACACCCAGTTTGTGTATGTCTTC |
R1299 |
T2147 |
T2143 |
nummod |
3,CACACCCAGTTTGTGTATGTCTTC |
R1300 |
T2148 |
T2143 |
punct |
′,CACACCCAGTTTGTGTATGTCTTC |
R1301 |
T2149 |
T2130 |
punct |
;,CAGTCACAAGCAAATTACCAAACACTGCC |
R1302 |
T2150 |
T2130 |
nummod |
5,CAGTCACAAGCAAATTACCAAACACTGCC |
R1303 |
T2151 |
T2150 |
punct |
′,5 |
R1304 |
T2152 |
T2130 |
punct |
-,CAGTCACAAGCAAATTACCAAACACTGCC |
R1305 |
T2153 |
T2130 |
punct |
-,CAGTCACAAGCAAATTACCAAACACTGCC |
R1306 |
T2154 |
T2130 |
nummod |
3,CAGTCACAAGCAAATTACCAAACACTGCC |
R1307 |
T2155 |
T2130 |
punct |
′,CAGTCACAAGCAAATTACCAAACACTGCC |
R1308 |
T2156 |
T2103 |
punct |
.,genotyped |