Id |
Subject |
Object |
Predicate |
Lexical cue |
T15903 |
0-3 |
DT |
denotes |
The |
T15904 |
20-28 |
NN |
denotes |
sequence |
T15905 |
4-12 |
JJ |
denotes |
complete |
T15906 |
13-19 |
NN |
denotes |
coding |
T15907 |
67-75 |
VBN |
denotes |
digested |
T15908 |
29-31 |
IN |
denotes |
of |
T15909 |
32-37 |
NN |
denotes |
mouse |
T15910 |
38-42 |
NN |
denotes |
AQP2 |
T15911 |
43-47 |
IN |
denotes |
from |
T15912 |
48-50 |
DT |
denotes |
an |
T15913 |
57-62 |
NN |
denotes |
clone |
T15914 |
51-56 |
NN |
denotes |
IMAGE |
T15915 |
63-66 |
VBD |
denotes |
was |
T15916 |
76-80 |
IN |
denotes |
from |
T15917 |
81-84 |
DT |
denotes |
the |
T15918 |
97-104 |
NN |
denotes |
plasmid |
T15919 |
85-96 |
NN |
denotes |
pCMV⋅SPORT6 |
T15920 |
105-109 |
IN |
denotes |
with |
T15921 |
110-115 |
NN |
denotes |
EcoRI |
T15922 |
116-119 |
CC |
denotes |
and |
T15923 |
120-124 |
NN |
denotes |
NotI |
T15924 |
125-128 |
CC |
denotes |
and |
T15925 |
129-136 |
VBN |
denotes |
ligated |
T15926 |
137-141 |
IN |
denotes |
into |
T15927 |
142-150 |
NN |
denotes |
pcDNA3.1 |
T15928 |
151-152 |
-LRB- |
denotes |
( |
T15929 |
152-162 |
NNP |
denotes |
Invitrogen |
T15930 |
162-164 |
, |
denotes |
, |
T15931 |
164-172 |
NNP |
denotes |
Carlsbad |
T15932 |
172-174 |
, |
denotes |
, |
T15933 |
174-184 |
NNP |
denotes |
California |
T15934 |
184-186 |
, |
denotes |
, |
T15935 |
186-192 |
NNP |
denotes |
United |
T15936 |
193-199 |
NNP |
denotes |
States |
T15937 |
199-200 |
-RRB- |
denotes |
) |
T15938 |
200-201 |
. |
denotes |
. |
T15939 |
201-455 |
sentence |
denotes |
The F204V mutation was introduced by site-directed mutagenesis (Stratagene, La Jolla, California, United States), using the sense oligonucleotide 5′-GATGATCACTGGGTCGTCTGGATCGGACCCC-3′, and antisense oligonucleotide 5′-GGGGTCCGATCCAGACGACCCAGTGATCATC-3′. |
T15940 |
202-205 |
DT |
denotes |
The |
T15941 |
212-220 |
NN |
denotes |
mutation |
T15942 |
206-211 |
NN |
denotes |
F204V |
T15943 |
225-235 |
VBN |
denotes |
introduced |
T15944 |
221-224 |
VBD |
denotes |
was |
T15945 |
236-238 |
IN |
denotes |
by |
T15946 |
239-243 |
NN |
denotes |
site |
T15947 |
244-252 |
JJ |
denotes |
directed |
T15948 |
243-244 |
HYPH |
denotes |
- |
T15949 |
253-264 |
NN |
denotes |
mutagenesis |
T15950 |
265-266 |
-LRB- |
denotes |
( |
T15951 |
266-276 |
NNP |
denotes |
Stratagene |
T15952 |
276-278 |
, |
denotes |
, |
T15953 |
278-280 |
NNP |
denotes |
La |
T15954 |
281-286 |
NNP |
denotes |
Jolla |
T15955 |
286-288 |
, |
denotes |
, |
T15956 |
288-298 |
NNP |
denotes |
California |
T15957 |
298-300 |
, |
denotes |
, |
T15958 |
300-306 |
NNP |
denotes |
United |
T15959 |
307-313 |
NNP |
denotes |
States |
T15960 |
313-314 |
-RRB- |
denotes |
) |
T15961 |
314-316 |
, |
denotes |
, |
T15962 |
316-321 |
VBG |
denotes |
using |
T15963 |
322-325 |
DT |
denotes |
the |
T15964 |
332-347 |
NN |
denotes |
oligonucleotide |
T15965 |
326-331 |
NN |
denotes |
sense |
T15966 |
348-349 |
CD |
denotes |
5 |
T15967 |
351-382 |
NN |
denotes |
GATGATCACTGGGTCGTCTGGATCGGACCCC |
T15968 |
349-350 |
SYM |
denotes |
′ |
T15969 |
350-351 |
HYPH |
denotes |
- |
T15970 |
382-383 |
HYPH |
denotes |
- |
T15971 |
383-384 |
CD |
denotes |
3 |
T15972 |
384-385 |
SYM |
denotes |
′ |
T15973 |
385-387 |
, |
denotes |
, |
T15974 |
387-390 |
CC |
denotes |
and |
T15975 |
391-400 |
JJ |
denotes |
antisense |
T15976 |
401-416 |
NN |
denotes |
oligonucleotide |
T15977 |
417-418 |
CD |
denotes |
5 |
T15978 |
420-451 |
NN |
denotes |
GGGGTCCGATCCAGACGACCCAGTGATCATC |
T15979 |
418-419 |
SYM |
denotes |
′ |
T15980 |
419-420 |
HYPH |
denotes |
- |
T15981 |
451-452 |
HYPH |
denotes |
- |
T15982 |
452-453 |
CD |
denotes |
3 |
T15983 |
453-454 |
SYM |
denotes |
′ |
T15984 |
454-455 |
. |
denotes |
. |
T15985 |
455-644 |
sentence |
denotes |
To generate GFP fusions of AQP2, the pCMV⋅SPORT6 AQP2 construct was used in a PCR reaction with the primers Sp6 and 5′-GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG-3′ to remove the stop codon of AQP2. |
T15986 |
456-458 |
TO |
denotes |
To |
T15987 |
459-467 |
VB |
denotes |
generate |
T15988 |
524-528 |
VBN |
denotes |
used |
T15989 |
468-471 |
NN |
denotes |
GFP |
T15990 |
472-479 |
NNS |
denotes |
fusions |
T15991 |
480-482 |
IN |
denotes |
of |
T15992 |
483-487 |
NN |
denotes |
AQP2 |
T15993 |
487-489 |
, |
denotes |
, |
T15994 |
489-492 |
DT |
denotes |
the |
T15995 |
510-519 |
NN |
denotes |
construct |
T15996 |
493-504 |
NN |
denotes |
pCMV⋅SPORT6 |
T15997 |
505-509 |
NN |
denotes |
AQP2 |
T15998 |
520-523 |
VBD |
denotes |
was |
T15999 |
529-531 |
IN |
denotes |
in |
T16000 |
532-533 |
DT |
denotes |
a |
T16001 |
538-546 |
NN |
denotes |
reaction |
T16002 |
534-537 |
NN |
denotes |
PCR |
T16003 |
547-551 |
IN |
denotes |
with |
T16004 |
552-555 |
DT |
denotes |
the |
T16005 |
564-567 |
NN |
denotes |
Sp6 |
T16006 |
556-563 |
NNS |
denotes |
primers |
T16007 |
568-571 |
CC |
denotes |
and |
T16008 |
572-573 |
CD |
denotes |
5 |
T16009 |
575-607 |
NN |
denotes |
GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
T16010 |
573-574 |
SYM |
denotes |
′ |
T16011 |
574-575 |
HYPH |
denotes |
- |
T16012 |
607-608 |
HYPH |
denotes |
- |
T16013 |
608-609 |
CD |
denotes |
3 |
T16014 |
609-610 |
SYM |
denotes |
′ |
T16015 |
611-613 |
TO |
denotes |
to |
T16016 |
614-620 |
VB |
denotes |
remove |
T16017 |
621-624 |
DT |
denotes |
the |
T16018 |
630-635 |
NN |
denotes |
codon |
T16019 |
625-629 |
NN |
denotes |
stop |
T16020 |
636-638 |
IN |
denotes |
of |
T16021 |
639-643 |
NN |
denotes |
AQP2 |
T16022 |
643-644 |
. |
denotes |
. |
T16023 |
644-771 |
sentence |
denotes |
The product was digested with KpnI and BamHI and ligated into pEGFP-N2 (BD Biosciences, San Diego, California, United States). |
T16024 |
645-648 |
DT |
denotes |
The |
T16025 |
649-656 |
NN |
denotes |
product |
T16026 |
661-669 |
VBN |
denotes |
digested |
T16027 |
657-660 |
VBD |
denotes |
was |
T16028 |
670-674 |
IN |
denotes |
with |
T16029 |
675-679 |
NN |
denotes |
KpnI |
T16030 |
680-683 |
CC |
denotes |
and |
T16031 |
684-689 |
NN |
denotes |
BamHI |
T16032 |
690-693 |
CC |
denotes |
and |
T16033 |
694-701 |
VBN |
denotes |
ligated |
T16034 |
702-706 |
IN |
denotes |
into |
T16035 |
707-712 |
NN |
denotes |
pEGFP |
T16036 |
713-715 |
NN |
denotes |
N2 |
T16037 |
712-713 |
HYPH |
denotes |
- |
T16038 |
716-717 |
-LRB- |
denotes |
( |
T16039 |
720-731 |
NNP |
denotes |
Biosciences |
T16040 |
717-719 |
NN |
denotes |
BD |
T16041 |
731-733 |
, |
denotes |
, |
T16042 |
733-736 |
NNP |
denotes |
San |
T16043 |
737-742 |
NNP |
denotes |
Diego |
T16044 |
742-744 |
, |
denotes |
, |
T16045 |
744-754 |
NNP |
denotes |
California |
T16046 |
754-756 |
, |
denotes |
, |
T16047 |
756-762 |
NNP |
denotes |
United |
T16048 |
763-769 |
NNP |
denotes |
States |
T16049 |
769-770 |
-RRB- |
denotes |
) |
T16050 |
770-771 |
. |
denotes |
. |
T16051 |
771-848 |
sentence |
denotes |
The F204V mutation was introduced using the same mutagenic oligonucleotides. |
T16052 |
772-775 |
DT |
denotes |
The |
T16053 |
782-790 |
NN |
denotes |
mutation |
T16054 |
776-781 |
NN |
denotes |
F204V |
T16055 |
795-805 |
VBN |
denotes |
introduced |
T16056 |
791-794 |
VBD |
denotes |
was |
T16057 |
806-811 |
VBG |
denotes |
using |
T16058 |
812-815 |
DT |
denotes |
the |
T16059 |
831-847 |
NNS |
denotes |
oligonucleotides |
T16060 |
816-820 |
JJ |
denotes |
same |
T16061 |
821-830 |
JJ |
denotes |
mutagenic |
T16062 |
847-848 |
. |
denotes |
. |
R4549 |
T15903 |
T15904 |
det |
The,sequence |
R4550 |
T15904 |
T15907 |
nsubjpass |
sequence,digested |
R4551 |
T15905 |
T15904 |
amod |
complete,sequence |
R4552 |
T15906 |
T15904 |
compound |
coding,sequence |
R4553 |
T15908 |
T15904 |
prep |
of,sequence |
R4554 |
T15909 |
T15910 |
compound |
mouse,AQP2 |
R4555 |
T15910 |
T15908 |
pobj |
AQP2,of |
R4556 |
T15911 |
T15904 |
prep |
from,sequence |
R4557 |
T15912 |
T15913 |
det |
an,clone |
R4558 |
T15913 |
T15911 |
pobj |
clone,from |
R4559 |
T15914 |
T15913 |
compound |
IMAGE,clone |
R4560 |
T15915 |
T15907 |
auxpass |
was,digested |
R4561 |
T15916 |
T15907 |
prep |
from,digested |
R4562 |
T15917 |
T15918 |
det |
the,plasmid |
R4563 |
T15918 |
T15916 |
pobj |
plasmid,from |
R4564 |
T15919 |
T15918 |
compound |
pCMV⋅SPORT6,plasmid |
R4565 |
T15920 |
T15907 |
prep |
with,digested |
R4566 |
T15921 |
T15920 |
pobj |
EcoRI,with |
R4567 |
T15922 |
T15921 |
cc |
and,EcoRI |
R4568 |
T15923 |
T15921 |
conj |
NotI,EcoRI |
R4569 |
T15924 |
T15907 |
cc |
and,digested |
R4570 |
T15925 |
T15907 |
conj |
ligated,digested |
R4571 |
T15926 |
T15925 |
prep |
into,ligated |
R4572 |
T15927 |
T15926 |
pobj |
pcDNA3.1,into |
R4573 |
T15928 |
T15929 |
punct |
(,Invitrogen |
R4574 |
T15929 |
T15927 |
parataxis |
Invitrogen,pcDNA3.1 |
R4575 |
T15930 |
T15929 |
punct |
", ",Invitrogen |
R4576 |
T15931 |
T15929 |
npadvmod |
Carlsbad,Invitrogen |
R4577 |
T15932 |
T15929 |
punct |
", ",Invitrogen |
R4578 |
T15933 |
T15929 |
npadvmod |
California,Invitrogen |
R4579 |
T15934 |
T15929 |
punct |
", ",Invitrogen |
R4580 |
T15935 |
T15936 |
compound |
United,States |
R4581 |
T15936 |
T15929 |
npadvmod |
States,Invitrogen |
R4582 |
T15937 |
T15929 |
punct |
),Invitrogen |
R4583 |
T15938 |
T15907 |
punct |
.,digested |
R4584 |
T15940 |
T15941 |
det |
The,mutation |
R4585 |
T15941 |
T15943 |
nsubjpass |
mutation,introduced |
R4586 |
T15942 |
T15941 |
compound |
F204V,mutation |
R4587 |
T15944 |
T15943 |
auxpass |
was,introduced |
R4588 |
T15945 |
T15943 |
prep |
by,introduced |
R4589 |
T15946 |
T15947 |
npadvmod |
site,directed |
R4590 |
T15947 |
T15949 |
amod |
directed,mutagenesis |
R4591 |
T15948 |
T15947 |
punct |
-,directed |
R4592 |
T15949 |
T15945 |
pobj |
mutagenesis,by |
R4593 |
T15950 |
T15951 |
punct |
(,Stratagene |
R4594 |
T15951 |
T15949 |
parataxis |
Stratagene,mutagenesis |
R4595 |
T15952 |
T15951 |
punct |
", ",Stratagene |
R4596 |
T15953 |
T15954 |
compound |
La,Jolla |
R4597 |
T15954 |
T15951 |
npadvmod |
Jolla,Stratagene |
R4598 |
T15955 |
T15951 |
punct |
", ",Stratagene |
R4599 |
T15956 |
T15951 |
npadvmod |
California,Stratagene |
R4600 |
T15957 |
T15951 |
punct |
", ",Stratagene |
R4601 |
T15958 |
T15959 |
compound |
United,States |
R4602 |
T15959 |
T15951 |
npadvmod |
States,Stratagene |
R4603 |
T15960 |
T15951 |
punct |
),Stratagene |
R4604 |
T15961 |
T15943 |
punct |
", ",introduced |
R4605 |
T15962 |
T15943 |
advcl |
using,introduced |
R4606 |
T15963 |
T15964 |
det |
the,oligonucleotide |
R4607 |
T15964 |
T15962 |
dobj |
oligonucleotide,using |
R4608 |
T15965 |
T15964 |
compound |
sense,oligonucleotide |
R4609 |
T15966 |
T15967 |
nummod |
5,GATGATCACTGGGTCGTCTGGATCGGACCCC |
R4610 |
T15967 |
T15964 |
appos |
GATGATCACTGGGTCGTCTGGATCGGACCCC,oligonucleotide |
R4611 |
T15968 |
T15966 |
punct |
′,5 |
R4612 |
T15969 |
T15967 |
punct |
-,GATGATCACTGGGTCGTCTGGATCGGACCCC |
R4613 |
T15970 |
T15967 |
punct |
-,GATGATCACTGGGTCGTCTGGATCGGACCCC |
R4614 |
T15971 |
T15967 |
nummod |
3,GATGATCACTGGGTCGTCTGGATCGGACCCC |
R4615 |
T15972 |
T15967 |
punct |
′,GATGATCACTGGGTCGTCTGGATCGGACCCC |
R4616 |
T15973 |
T15964 |
punct |
", ",oligonucleotide |
R4617 |
T15974 |
T15964 |
cc |
and,oligonucleotide |
R4618 |
T15975 |
T15976 |
amod |
antisense,oligonucleotide |
R4619 |
T15976 |
T15964 |
conj |
oligonucleotide,oligonucleotide |
R4620 |
T15977 |
T15978 |
nummod |
5,GGGGTCCGATCCAGACGACCCAGTGATCATC |
R4621 |
T15978 |
T15976 |
appos |
GGGGTCCGATCCAGACGACCCAGTGATCATC,oligonucleotide |
R4622 |
T15979 |
T15977 |
punct |
′,5 |
R4623 |
T15980 |
T15978 |
punct |
-,GGGGTCCGATCCAGACGACCCAGTGATCATC |
R4624 |
T15981 |
T15978 |
punct |
-,GGGGTCCGATCCAGACGACCCAGTGATCATC |
R4625 |
T15982 |
T15978 |
nummod |
3,GGGGTCCGATCCAGACGACCCAGTGATCATC |
R4626 |
T15983 |
T15978 |
punct |
′,GGGGTCCGATCCAGACGACCCAGTGATCATC |
R4627 |
T15984 |
T15943 |
punct |
.,introduced |
R4628 |
T15986 |
T15987 |
aux |
To,generate |
R4629 |
T15987 |
T15988 |
advcl |
generate,used |
R4630 |
T15989 |
T15990 |
compound |
GFP,fusions |
R4631 |
T15990 |
T15987 |
dobj |
fusions,generate |
R4632 |
T15991 |
T15990 |
prep |
of,fusions |
R4633 |
T15992 |
T15991 |
pobj |
AQP2,of |
R4634 |
T15993 |
T15988 |
punct |
", ",used |
R4635 |
T15994 |
T15995 |
det |
the,construct |
R4636 |
T15995 |
T15988 |
nsubjpass |
construct,used |
R4637 |
T15996 |
T15995 |
compound |
pCMV⋅SPORT6,construct |
R4638 |
T15997 |
T15995 |
compound |
AQP2,construct |
R4639 |
T15998 |
T15988 |
auxpass |
was,used |
R4640 |
T15999 |
T15988 |
prep |
in,used |
R4641 |
T16000 |
T16001 |
det |
a,reaction |
R4642 |
T16001 |
T15999 |
pobj |
reaction,in |
R4643 |
T16002 |
T16001 |
compound |
PCR,reaction |
R4644 |
T16003 |
T16001 |
prep |
with,reaction |
R4645 |
T16004 |
T16005 |
det |
the,Sp6 |
R4646 |
T16005 |
T16003 |
pobj |
Sp6,with |
R4647 |
T16006 |
T16005 |
compound |
primers,Sp6 |
R4648 |
T16007 |
T16005 |
cc |
and,Sp6 |
R4649 |
T16008 |
T16009 |
nummod |
5,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4650 |
T16009 |
T16005 |
conj |
GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG,Sp6 |
R4651 |
T16010 |
T16008 |
punct |
′,5 |
R4652 |
T16011 |
T16009 |
punct |
-,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4653 |
T16012 |
T16009 |
punct |
-,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4654 |
T16013 |
T16009 |
nummod |
3,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4655 |
T16014 |
T16009 |
punct |
′,GACTGGATCCCGGCCTTGCTGCCGCGCGGCAG |
R4656 |
T16015 |
T16016 |
aux |
to,remove |
R4657 |
T16016 |
T15988 |
advcl |
remove,used |
R4658 |
T16017 |
T16018 |
det |
the,codon |
R4659 |
T16018 |
T16016 |
dobj |
codon,remove |
R4660 |
T16019 |
T16018 |
compound |
stop,codon |
R4661 |
T16020 |
T16018 |
prep |
of,codon |
R4662 |
T16021 |
T16020 |
pobj |
AQP2,of |
R4663 |
T16022 |
T15988 |
punct |
.,used |
R4664 |
T16024 |
T16025 |
det |
The,product |
R4665 |
T16025 |
T16026 |
nsubjpass |
product,digested |
R4666 |
T16027 |
T16026 |
auxpass |
was,digested |
R4667 |
T16028 |
T16026 |
prep |
with,digested |
R4668 |
T16029 |
T16028 |
pobj |
KpnI,with |
R4669 |
T16030 |
T16029 |
cc |
and,KpnI |
R4670 |
T16031 |
T16029 |
conj |
BamHI,KpnI |
R4671 |
T16032 |
T16026 |
cc |
and,digested |
R4672 |
T16033 |
T16026 |
conj |
ligated,digested |
R4673 |
T16034 |
T16033 |
prep |
into,ligated |
R4674 |
T16035 |
T16036 |
compound |
pEGFP,N2 |
R4675 |
T16036 |
T16034 |
pobj |
N2,into |
R4676 |
T16037 |
T16036 |
punct |
-,N2 |
R4677 |
T16038 |
T16039 |
punct |
(,Biosciences |
R4678 |
T16039 |
T16036 |
parataxis |
Biosciences,N2 |
R4679 |
T16040 |
T16039 |
compound |
BD,Biosciences |
R4680 |
T16041 |
T16039 |
punct |
", ",Biosciences |
R4681 |
T16042 |
T16043 |
compound |
San,Diego |
R4682 |
T16043 |
T16039 |
npadvmod |
Diego,Biosciences |
R4683 |
T16044 |
T16039 |
punct |
", ",Biosciences |
R4684 |
T16045 |
T16039 |
npadvmod |
California,Biosciences |
R4685 |
T16046 |
T16039 |
punct |
", ",Biosciences |
R4686 |
T16047 |
T16048 |
compound |
United,States |
R4687 |
T16048 |
T16039 |
npadvmod |
States,Biosciences |
R4688 |
T16049 |
T16039 |
punct |
),Biosciences |
R4689 |
T16050 |
T16026 |
punct |
.,digested |
R4690 |
T16052 |
T16053 |
det |
The,mutation |
R4691 |
T16053 |
T16055 |
nsubjpass |
mutation,introduced |
R4692 |
T16054 |
T16053 |
compound |
F204V,mutation |
R4693 |
T16056 |
T16055 |
auxpass |
was,introduced |
R4694 |
T16057 |
T16055 |
advcl |
using,introduced |
R4695 |
T16058 |
T16059 |
det |
the,oligonucleotides |
R4696 |
T16059 |
T16057 |
dobj |
oligonucleotides,using |
R4697 |
T16060 |
T16059 |
amod |
same,oligonucleotides |
R4698 |
T16061 |
T16059 |
amod |
mutagenic,oligonucleotides |
R4699 |
T16062 |
T16055 |
punct |
.,introduced |