Id |
Subject |
Object |
Predicate |
Lexical cue |
T13242 |
0-5 |
VBG |
denotes |
Using |
T13244 |
6-9 |
DT |
denotes |
the |
T13245 |
10-14 |
NNS |
denotes |
data |
T13246 |
15-19 |
IN |
denotes |
from |
T13247 |
20-23 |
DT |
denotes |
the |
T13248 |
24-35 |
NNS |
denotes |
experiments |
T13249 |
36-45 |
VBN |
denotes |
described |
T13250 |
46-51 |
RB |
denotes |
above |
T13251 |
52-54 |
PRP |
denotes |
we |
T13243 |
55-59 |
VBD |
denotes |
were |
T13252 |
60-64 |
JJ |
denotes |
able |
T13253 |
65-67 |
TO |
denotes |
to |
T13254 |
68-73 |
VB |
denotes |
limit |
T13255 |
74-77 |
DT |
denotes |
the |
T13256 |
78-82 |
NN |
denotes |
size |
T13257 |
83-85 |
IN |
denotes |
of |
T13258 |
86-93 |
JJ |
denotes |
unknown |
T13259 |
94-101 |
NNS |
denotes |
regions |
T13260 |
102-110 |
VBG |
denotes |
flanking |
T13261 |
111-114 |
DT |
denotes |
the |
T13262 |
115-123 |
NN |
denotes |
deletion |
T13263 |
124-126 |
IN |
denotes |
to |
T13264 |
127-128 |
SYM |
denotes |
~ |
T13265 |
128-129 |
CD |
denotes |
4 |
T13266 |
130-132 |
NN |
denotes |
kb |
T13267 |
133-135 |
IN |
denotes |
on |
T13268 |
136-139 |
DT |
denotes |
the |
T13270 |
140-149 |
JJ |
denotes |
telomeric |
T13269 |
150-154 |
NN |
denotes |
side |
T13271 |
155-158 |
CC |
denotes |
and |
T13272 |
159-160 |
CD |
denotes |
7 |
T13273 |
161-163 |
NN |
denotes |
kb |
T13274 |
164-166 |
IN |
denotes |
on |
T13275 |
167-170 |
DT |
denotes |
the |
T13277 |
171-182 |
JJ |
denotes |
centromeric |
T13276 |
183-187 |
NN |
denotes |
side |
T13278 |
187-188 |
. |
denotes |
. |
T13279 |
188-532 |
sentence |
denotes |
All combinations of forward primers from the newly defined region flanking the deletion on the telomeric side with reverse primers from the newly defined region flanking the deletion on the centromeric side were used in PCR amplification reactions performed with DNA from the three affected family members and single unaffected family members. |
T13280 |
189-192 |
DT |
denotes |
All |
T13281 |
193-205 |
NNS |
denotes |
combinations |
T13283 |
206-208 |
IN |
denotes |
of |
T13284 |
209-216 |
JJ |
denotes |
forward |
T13285 |
217-224 |
NNS |
denotes |
primers |
T13286 |
225-229 |
IN |
denotes |
from |
T13287 |
230-233 |
DT |
denotes |
the |
T13289 |
234-239 |
RB |
denotes |
newly |
T13290 |
240-247 |
VBN |
denotes |
defined |
T13288 |
248-254 |
NN |
denotes |
region |
T13291 |
255-263 |
VBG |
denotes |
flanking |
T13292 |
264-267 |
DT |
denotes |
the |
T13293 |
268-276 |
NN |
denotes |
deletion |
T13294 |
277-279 |
IN |
denotes |
on |
T13295 |
280-283 |
DT |
denotes |
the |
T13297 |
284-293 |
JJ |
denotes |
telomeric |
T13296 |
294-298 |
NN |
denotes |
side |
T13298 |
299-303 |
IN |
denotes |
with |
T13299 |
304-311 |
JJ |
denotes |
reverse |
T13300 |
312-319 |
NNS |
denotes |
primers |
T13301 |
320-324 |
IN |
denotes |
from |
T13302 |
325-328 |
DT |
denotes |
the |
T13304 |
329-334 |
RB |
denotes |
newly |
T13305 |
335-342 |
VBN |
denotes |
defined |
T13303 |
343-349 |
NN |
denotes |
region |
T13306 |
350-358 |
VBG |
denotes |
flanking |
T13307 |
359-362 |
DT |
denotes |
the |
T13308 |
363-371 |
NN |
denotes |
deletion |
T13309 |
372-374 |
IN |
denotes |
on |
T13310 |
375-378 |
DT |
denotes |
the |
T13312 |
379-390 |
JJ |
denotes |
centromeric |
T13311 |
391-395 |
NN |
denotes |
side |
T13313 |
396-400 |
VBD |
denotes |
were |
T13282 |
401-405 |
VBN |
denotes |
used |
T13314 |
406-408 |
IN |
denotes |
in |
T13315 |
409-412 |
NN |
denotes |
PCR |
T13316 |
413-426 |
NN |
denotes |
amplification |
T13317 |
427-436 |
NNS |
denotes |
reactions |
T13318 |
437-446 |
VBN |
denotes |
performed |
T13319 |
447-451 |
IN |
denotes |
with |
T13320 |
452-455 |
NN |
denotes |
DNA |
T13321 |
456-460 |
IN |
denotes |
from |
T13322 |
461-464 |
DT |
denotes |
the |
T13324 |
465-470 |
CD |
denotes |
three |
T13325 |
471-479 |
VBN |
denotes |
affected |
T13326 |
480-486 |
NN |
denotes |
family |
T13323 |
487-494 |
NNS |
denotes |
members |
T13327 |
495-498 |
CC |
denotes |
and |
T13328 |
499-505 |
JJ |
denotes |
single |
T13330 |
506-516 |
JJ |
denotes |
unaffected |
T13331 |
517-523 |
NN |
denotes |
family |
T13329 |
524-531 |
NNS |
denotes |
members |
T13332 |
531-532 |
. |
denotes |
. |
T13333 |
532-648 |
sentence |
denotes |
This experiment was performed in an attempt to amplify across the deleted fragment and define the exact breakpoint. |
T13334 |
533-537 |
DT |
denotes |
This |
T13335 |
538-548 |
NN |
denotes |
experiment |
T13337 |
549-552 |
VBD |
denotes |
was |
T13336 |
553-562 |
VBN |
denotes |
performed |
T13338 |
563-565 |
IN |
denotes |
in |
T13339 |
566-568 |
DT |
denotes |
an |
T13340 |
569-576 |
NN |
denotes |
attempt |
T13341 |
577-579 |
TO |
denotes |
to |
T13342 |
580-587 |
VB |
denotes |
amplify |
T13343 |
588-594 |
IN |
denotes |
across |
T13344 |
595-598 |
DT |
denotes |
the |
T13346 |
599-606 |
VBN |
denotes |
deleted |
T13345 |
607-615 |
NN |
denotes |
fragment |
T13347 |
616-619 |
CC |
denotes |
and |
T13348 |
620-626 |
VB |
denotes |
define |
T13349 |
627-630 |
DT |
denotes |
the |
T13351 |
631-636 |
JJ |
denotes |
exact |
T13350 |
637-647 |
NN |
denotes |
breakpoint |
T13352 |
647-648 |
. |
denotes |
. |
T13353 |
648-856 |
sentence |
denotes |
A single fragment was obtained from the third forward primer from the telomeric side (T3f 5′-TGAATGCTCAATTTTCCAGC-3′) with the 11th reverse primer from the centromeric side (C11r 5′-GGGAAAATGGATAGAGGGTG-3′). |
T13354 |
649-650 |
DT |
denotes |
A |
T13356 |
651-657 |
JJ |
denotes |
single |
T13355 |
658-666 |
NN |
denotes |
fragment |
T13358 |
667-670 |
VBD |
denotes |
was |
T13357 |
671-679 |
VBN |
denotes |
obtained |
T13359 |
680-684 |
IN |
denotes |
from |
T13360 |
685-688 |
DT |
denotes |
the |
T13362 |
689-694 |
JJ |
denotes |
third |
T13363 |
695-702 |
JJ |
denotes |
forward |
T13361 |
703-709 |
NN |
denotes |
primer |
T13364 |
710-714 |
IN |
denotes |
from |
T13365 |
715-718 |
DT |
denotes |
the |
T13367 |
719-728 |
JJ |
denotes |
telomeric |
T13366 |
729-733 |
NN |
denotes |
side |
T13368 |
734-735 |
-LRB- |
denotes |
( |
T13370 |
735-738 |
NN |
denotes |
T3f |
T13371 |
739-740 |
CD |
denotes |
5 |
T13372 |
740-741 |
SYM |
denotes |
′ |
T13373 |
741-742 |
HYPH |
denotes |
- |
T13369 |
742-762 |
NN |
denotes |
TGAATGCTCAATTTTCCAGC |
T13374 |
762-763 |
HYPH |
denotes |
- |
T13375 |
763-764 |
CD |
denotes |
3 |
T13376 |
764-765 |
SYM |
denotes |
′ |
T13377 |
765-766 |
-RRB- |
denotes |
) |
T13378 |
767-771 |
IN |
denotes |
with |
T13379 |
772-775 |
DT |
denotes |
the |
T13381 |
776-780 |
JJ |
denotes |
11th |
T13382 |
781-788 |
JJ |
denotes |
reverse |
T13380 |
789-795 |
NN |
denotes |
primer |
T13383 |
796-800 |
IN |
denotes |
from |
T13384 |
801-804 |
DT |
denotes |
the |
T13386 |
805-816 |
JJ |
denotes |
centromeric |
T13385 |
817-821 |
NN |
denotes |
side |
T13387 |
822-823 |
-LRB- |
denotes |
( |
T13389 |
823-827 |
NN |
denotes |
C11r |
T13390 |
828-829 |
CD |
denotes |
5 |
T13391 |
829-830 |
SYM |
denotes |
′ |
T13392 |
830-831 |
HYPH |
denotes |
- |
T13388 |
831-851 |
NN |
denotes |
GGGAAAATGGATAGAGGGTG |
T13393 |
851-852 |
HYPH |
denotes |
- |
T13394 |
852-853 |
CD |
denotes |
3 |
T13395 |
853-854 |
SYM |
denotes |
′ |
T13396 |
854-855 |
-RRB- |
denotes |
) |
T13397 |
855-856 |
. |
denotes |
. |
T13398 |
856-983 |
sentence |
denotes |
The fragment, which is 953 bp in size, was sequenced as described above and compared to the current build of the human genome. |
T13399 |
857-860 |
DT |
denotes |
The |
T13400 |
861-869 |
NN |
denotes |
fragment |
T13402 |
869-871 |
, |
denotes |
, |
T13403 |
871-876 |
WDT |
denotes |
which |
T13404 |
877-879 |
VBZ |
denotes |
is |
T13405 |
880-883 |
CD |
denotes |
953 |
T13406 |
884-886 |
NN |
denotes |
bp |
T13407 |
887-889 |
IN |
denotes |
in |
T13408 |
890-894 |
NN |
denotes |
size |
T13409 |
894-896 |
, |
denotes |
, |
T13410 |
896-899 |
VBD |
denotes |
was |
T13401 |
900-909 |
VBN |
denotes |
sequenced |
T13411 |
910-912 |
IN |
denotes |
as |
T13412 |
913-922 |
VBN |
denotes |
described |
T13413 |
923-928 |
RB |
denotes |
above |
T13414 |
929-932 |
CC |
denotes |
and |
T13415 |
933-941 |
VBN |
denotes |
compared |
T13416 |
942-944 |
IN |
denotes |
to |
T13417 |
945-948 |
DT |
denotes |
the |
T13419 |
949-956 |
JJ |
denotes |
current |
T13418 |
957-962 |
NN |
denotes |
build |
T13420 |
963-965 |
IN |
denotes |
of |
T13421 |
966-969 |
DT |
denotes |
the |
T13423 |
970-975 |
JJ |
denotes |
human |
T13422 |
976-982 |
NN |
denotes |
genome |
T13424 |
982-983 |
. |
denotes |
. |
T13425 |
983-1378 |
sentence |
denotes |
A similar series of experiments was performed to identify the deletion breakpoints in families H27 and H33; we were able to amplify a 369-bp PCR product across the breakpoint found in affected members of family H27 using primer pair H27-11F 5′-GACCTCAAGAAGGCATGAATAC-3′ and H27-3R 5′-ATGGTGGCCAGGTACACAAG-3′ (Figure S4), but to date we have been unable to identify the breakpoint in family H33. |
T13426 |
984-985 |
DT |
denotes |
A |
T13428 |
986-993 |
JJ |
denotes |
similar |
T13427 |
994-1000 |
NN |
denotes |
series |
T13430 |
1001-1003 |
IN |
denotes |
of |
T13431 |
1004-1015 |
NNS |
denotes |
experiments |
T13432 |
1016-1019 |
VBD |
denotes |
was |
T13429 |
1020-1029 |
VBN |
denotes |
performed |
T13434 |
1030-1032 |
TO |
denotes |
to |
T13435 |
1033-1041 |
VB |
denotes |
identify |
T13436 |
1042-1045 |
DT |
denotes |
the |
T13438 |
1046-1054 |
NN |
denotes |
deletion |
T13437 |
1055-1066 |
NNS |
denotes |
breakpoints |
T13439 |
1067-1069 |
IN |
denotes |
in |
T13440 |
1070-1078 |
NNS |
denotes |
families |
T13441 |
1079-1082 |
NN |
denotes |
H27 |
T13442 |
1083-1086 |
CC |
denotes |
and |
T13443 |
1087-1090 |
NN |
denotes |
H33 |
T13444 |
1090-1091 |
: |
denotes |
; |
T13445 |
1092-1094 |
PRP |
denotes |
we |
T13433 |
1095-1099 |
VBD |
denotes |
were |
T13446 |
1100-1104 |
JJ |
denotes |
able |
T13447 |
1105-1107 |
TO |
denotes |
to |
T13448 |
1108-1115 |
VB |
denotes |
amplify |
T13449 |
1116-1117 |
DT |
denotes |
a |
T13451 |
1118-1121 |
CD |
denotes |
369 |
T13453 |
1121-1122 |
HYPH |
denotes |
- |
T13452 |
1122-1124 |
NN |
denotes |
bp |
T13454 |
1125-1128 |
NN |
denotes |
PCR |
T13450 |
1129-1136 |
NN |
denotes |
product |
T13455 |
1137-1143 |
IN |
denotes |
across |
T13456 |
1144-1147 |
DT |
denotes |
the |
T13457 |
1148-1158 |
NN |
denotes |
breakpoint |
T13458 |
1159-1164 |
VBN |
denotes |
found |
T13459 |
1165-1167 |
IN |
denotes |
in |
T13460 |
1168-1176 |
VBN |
denotes |
affected |
T13461 |
1177-1184 |
NNS |
denotes |
members |
T13462 |
1185-1187 |
IN |
denotes |
of |
T13463 |
1188-1194 |
NN |
denotes |
family |
T13464 |
1195-1198 |
NN |
denotes |
H27 |
T13465 |
1199-1204 |
VBG |
denotes |
using |
T13466 |
1205-1211 |
NN |
denotes |
primer |
T13467 |
1212-1216 |
NN |
denotes |
pair |
T13468 |
1217-1220 |
NN |
denotes |
H27 |
T13470 |
1220-1221 |
HYPH |
denotes |
- |
T13469 |
1221-1224 |
NN |
denotes |
11F |
T13472 |
1225-1226 |
CD |
denotes |
5 |
T13473 |
1226-1227 |
SYM |
denotes |
′ |
T13474 |
1227-1228 |
HYPH |
denotes |
- |
T13471 |
1228-1250 |
NN |
denotes |
GACCTCAAGAAGGCATGAATAC |
T13475 |
1250-1251 |
HYPH |
denotes |
- |
T13476 |
1251-1252 |
CD |
denotes |
3 |
T13477 |
1252-1253 |
SYM |
denotes |
′ |
T13478 |
1254-1257 |
CC |
denotes |
and |
T13479 |
1258-1261 |
NN |
denotes |
H27 |
T13481 |
1261-1262 |
HYPH |
denotes |
- |
T13480 |
1262-1264 |
NN |
denotes |
3R |
T13483 |
1265-1266 |
CD |
denotes |
5 |
T13484 |
1266-1267 |
SYM |
denotes |
′ |
T13485 |
1267-1268 |
HYPH |
denotes |
- |
T13482 |
1268-1288 |
NN |
denotes |
ATGGTGGCCAGGTACACAAG |
T13486 |
1288-1289 |
HYPH |
denotes |
- |
T13487 |
1289-1290 |
CD |
denotes |
3 |
T13488 |
1290-1291 |
SYM |
denotes |
′ |
T13489 |
1292-1293 |
-LRB- |
denotes |
( |
T13491 |
1293-1299 |
NN |
denotes |
Figure |
T13490 |
1300-1302 |
NN |
denotes |
S4 |
T13492 |
1302-1303 |
-RRB- |
denotes |
) |
T13493 |
1303-1305 |
, |
denotes |
, |
T13494 |
1305-1308 |
CC |
denotes |
but |
T13495 |
1309-1311 |
IN |
denotes |
to |
T13497 |
1312-1316 |
NN |
denotes |
date |
T13498 |
1317-1319 |
PRP |
denotes |
we |
T13499 |
1320-1324 |
VBP |
denotes |
have |
T13496 |
1325-1329 |
VBN |
denotes |
been |
T13500 |
1330-1336 |
JJ |
denotes |
unable |
T13501 |
1337-1339 |
TO |
denotes |
to |
T13502 |
1340-1348 |
VB |
denotes |
identify |
T13503 |
1349-1352 |
DT |
denotes |
the |
T13504 |
1353-1363 |
NN |
denotes |
breakpoint |
T13505 |
1364-1366 |
IN |
denotes |
in |
T13506 |
1367-1373 |
NN |
denotes |
family |
T13507 |
1374-1377 |
NN |
denotes |
H33 |
T13508 |
1377-1378 |
. |
denotes |
. |
R3808 |
T13242 |
T13243 |
advcl |
Using,were |
R3809 |
T13244 |
T13245 |
det |
the,data |
R3810 |
T13245 |
T13242 |
dobj |
data,Using |
R3811 |
T13246 |
T13242 |
prep |
from,Using |
R3812 |
T13247 |
T13248 |
det |
the,experiments |
R3813 |
T13248 |
T13246 |
pobj |
experiments,from |
R3814 |
T13249 |
T13248 |
acl |
described,experiments |
R3815 |
T13250 |
T13249 |
advmod |
above,described |
R3816 |
T13251 |
T13243 |
nsubj |
we,were |
R3817 |
T13252 |
T13243 |
acomp |
able,were |
R3818 |
T13253 |
T13254 |
aux |
to,limit |
R3819 |
T13254 |
T13252 |
xcomp |
limit,able |
R3820 |
T13255 |
T13256 |
det |
the,size |
R3821 |
T13256 |
T13254 |
dobj |
size,limit |
R3822 |
T13257 |
T13256 |
prep |
of,size |
R3823 |
T13258 |
T13259 |
amod |
unknown,regions |
R3824 |
T13259 |
T13257 |
pobj |
regions,of |
R3825 |
T13260 |
T13259 |
acl |
flanking,regions |
R3826 |
T13261 |
T13262 |
det |
the,deletion |
R3827 |
T13262 |
T13260 |
dobj |
deletion,flanking |
R3828 |
T13263 |
T13254 |
prep |
to,limit |
R3829 |
T13264 |
T13265 |
punct |
~,4 |
R3830 |
T13265 |
T13266 |
nummod |
4,kb |
R3831 |
T13266 |
T13263 |
pobj |
kb,to |
R3832 |
T13267 |
T13266 |
prep |
on,kb |
R3833 |
T13268 |
T13269 |
det |
the,side |
R3834 |
T13269 |
T13267 |
pobj |
side,on |
R3835 |
T13270 |
T13269 |
amod |
telomeric,side |
R3836 |
T13271 |
T13266 |
cc |
and,kb |
R3837 |
T13272 |
T13273 |
nummod |
7,kb |
R3838 |
T13273 |
T13266 |
conj |
kb,kb |
R3839 |
T13274 |
T13273 |
prep |
on,kb |
R3840 |
T13275 |
T13276 |
det |
the,side |
R3841 |
T13276 |
T13274 |
pobj |
side,on |
R3842 |
T13277 |
T13276 |
amod |
centromeric,side |
R3843 |
T13278 |
T13243 |
punct |
.,were |
R3844 |
T13280 |
T13281 |
det |
All,combinations |
R3845 |
T13281 |
T13282 |
nsubjpass |
combinations,used |
R3846 |
T13283 |
T13281 |
prep |
of,combinations |
R3847 |
T13284 |
T13285 |
amod |
forward,primers |
R3848 |
T13285 |
T13283 |
pobj |
primers,of |
R3849 |
T13286 |
T13285 |
prep |
from,primers |
R3850 |
T13287 |
T13288 |
det |
the,region |
R3851 |
T13288 |
T13286 |
pobj |
region,from |
R3852 |
T13289 |
T13290 |
advmod |
newly,defined |
R3853 |
T13290 |
T13288 |
amod |
defined,region |
R3854 |
T13291 |
T13281 |
acl |
flanking,combinations |
R3855 |
T13292 |
T13293 |
det |
the,deletion |
R3856 |
T13293 |
T13291 |
dobj |
deletion,flanking |
R3857 |
T13294 |
T13291 |
prep |
on,flanking |
R3858 |
T13295 |
T13296 |
det |
the,side |
R3859 |
T13296 |
T13294 |
pobj |
side,on |
R3860 |
T13297 |
T13296 |
amod |
telomeric,side |
R3861 |
T13298 |
T13291 |
prep |
with,flanking |
R3862 |
T13299 |
T13300 |
amod |
reverse,primers |
R3863 |
T13300 |
T13298 |
pobj |
primers,with |
R3864 |
T13301 |
T13300 |
prep |
from,primers |
R3865 |
T13302 |
T13303 |
det |
the,region |
R3866 |
T13303 |
T13301 |
pobj |
region,from |
R3867 |
T13304 |
T13305 |
advmod |
newly,defined |
R3868 |
T13305 |
T13303 |
amod |
defined,region |
R3869 |
T13306 |
T13300 |
acl |
flanking,primers |
R3870 |
T13307 |
T13308 |
det |
the,deletion |
R3871 |
T13308 |
T13306 |
dobj |
deletion,flanking |
R3872 |
T13309 |
T13306 |
prep |
on,flanking |
R3873 |
T13310 |
T13311 |
det |
the,side |
R3874 |
T13311 |
T13309 |
pobj |
side,on |
R3875 |
T13312 |
T13311 |
amod |
centromeric,side |
R3876 |
T13313 |
T13282 |
auxpass |
were,used |
R3877 |
T13314 |
T13282 |
prep |
in,used |
R3878 |
T13315 |
T13316 |
compound |
PCR,amplification |
R3879 |
T13316 |
T13317 |
compound |
amplification,reactions |
R3880 |
T13317 |
T13314 |
pobj |
reactions,in |
R3881 |
T13318 |
T13317 |
acl |
performed,reactions |
R3882 |
T13319 |
T13318 |
prep |
with,performed |
R3883 |
T13320 |
T13319 |
pobj |
DNA,with |
R3884 |
T13321 |
T13320 |
prep |
from,DNA |
R3885 |
T13322 |
T13323 |
det |
the,members |
R3886 |
T13323 |
T13321 |
pobj |
members,from |
R3887 |
T13324 |
T13323 |
nummod |
three,members |
R3888 |
T13325 |
T13323 |
amod |
affected,members |
R3889 |
T13326 |
T13323 |
compound |
family,members |
R3890 |
T13327 |
T13323 |
cc |
and,members |
R3891 |
T13328 |
T13329 |
amod |
single,members |
R3892 |
T13329 |
T13323 |
conj |
members,members |
R3893 |
T13330 |
T13329 |
amod |
unaffected,members |
R3894 |
T13331 |
T13329 |
compound |
family,members |
R3895 |
T13332 |
T13282 |
punct |
.,used |
R3896 |
T13334 |
T13335 |
det |
This,experiment |
R3897 |
T13335 |
T13336 |
nsubjpass |
experiment,performed |
R3898 |
T13337 |
T13336 |
auxpass |
was,performed |
R3899 |
T13338 |
T13336 |
prep |
in,performed |
R3900 |
T13339 |
T13340 |
det |
an,attempt |
R3901 |
T13340 |
T13338 |
pobj |
attempt,in |
R3902 |
T13341 |
T13342 |
aux |
to,amplify |
R3903 |
T13342 |
T13340 |
acl |
amplify,attempt |
R3904 |
T13343 |
T13342 |
prep |
across,amplify |
R3905 |
T13344 |
T13345 |
det |
the,fragment |
R3906 |
T13345 |
T13343 |
pobj |
fragment,across |
R3907 |
T13346 |
T13345 |
amod |
deleted,fragment |
R3908 |
T13347 |
T13342 |
cc |
and,amplify |
R3909 |
T13348 |
T13342 |
conj |
define,amplify |
R3910 |
T13349 |
T13350 |
det |
the,breakpoint |
R3911 |
T13350 |
T13348 |
dobj |
breakpoint,define |
R3912 |
T13351 |
T13350 |
amod |
exact,breakpoint |
R3913 |
T13352 |
T13336 |
punct |
.,performed |
R3914 |
T13354 |
T13355 |
det |
A,fragment |
R3915 |
T13355 |
T13357 |
nsubjpass |
fragment,obtained |
R3916 |
T13356 |
T13355 |
amod |
single,fragment |
R3917 |
T13358 |
T13357 |
auxpass |
was,obtained |
R3918 |
T13359 |
T13357 |
prep |
from,obtained |
R3919 |
T13360 |
T13361 |
det |
the,primer |
R3920 |
T13361 |
T13359 |
pobj |
primer,from |
R3921 |
T13362 |
T13361 |
amod |
third,primer |
R3922 |
T13363 |
T13361 |
amod |
forward,primer |
R3923 |
T13364 |
T13361 |
prep |
from,primer |
R3924 |
T13365 |
T13366 |
det |
the,side |
R3925 |
T13366 |
T13364 |
pobj |
side,from |
R3926 |
T13367 |
T13366 |
amod |
telomeric,side |
R3927 |
T13368 |
T13369 |
punct |
(,TGAATGCTCAATTTTCCAGC |
R3928 |
T13369 |
T13361 |
parataxis |
TGAATGCTCAATTTTCCAGC,primer |
R3929 |
T13370 |
T13369 |
nmod |
T3f,TGAATGCTCAATTTTCCAGC |
R3930 |
T13371 |
T13369 |
nummod |
5,TGAATGCTCAATTTTCCAGC |
R3931 |
T13372 |
T13371 |
punct |
′,5 |
R3932 |
T13373 |
T13369 |
punct |
-,TGAATGCTCAATTTTCCAGC |
R3933 |
T13374 |
T13369 |
punct |
-,TGAATGCTCAATTTTCCAGC |
R3934 |
T13375 |
T13369 |
nummod |
3,TGAATGCTCAATTTTCCAGC |
R3935 |
T13376 |
T13369 |
punct |
′,TGAATGCTCAATTTTCCAGC |
R3936 |
T13377 |
T13369 |
punct |
),TGAATGCTCAATTTTCCAGC |
R3937 |
T13378 |
T13357 |
prep |
with,obtained |
R3938 |
T13379 |
T13380 |
det |
the,primer |
R3939 |
T13380 |
T13378 |
pobj |
primer,with |
R3940 |
T13381 |
T13380 |
amod |
11th,primer |
R3941 |
T13382 |
T13380 |
amod |
reverse,primer |
R3942 |
T13383 |
T13380 |
prep |
from,primer |
R3943 |
T13384 |
T13385 |
det |
the,side |
R3944 |
T13385 |
T13383 |
pobj |
side,from |
R3945 |
T13386 |
T13385 |
amod |
centromeric,side |
R3946 |
T13387 |
T13388 |
punct |
(,GGGAAAATGGATAGAGGGTG |
R3947 |
T13388 |
T13380 |
parataxis |
GGGAAAATGGATAGAGGGTG,primer |
R3948 |
T13389 |
T13388 |
nmod |
C11r,GGGAAAATGGATAGAGGGTG |
R3949 |
T13390 |
T13388 |
nummod |
5,GGGAAAATGGATAGAGGGTG |
R3950 |
T13391 |
T13390 |
punct |
′,5 |
R3951 |
T13392 |
T13388 |
punct |
-,GGGAAAATGGATAGAGGGTG |
R3952 |
T13393 |
T13388 |
punct |
-,GGGAAAATGGATAGAGGGTG |
R3953 |
T13394 |
T13388 |
nummod |
3,GGGAAAATGGATAGAGGGTG |
R3954 |
T13395 |
T13388 |
punct |
′,GGGAAAATGGATAGAGGGTG |
R3955 |
T13396 |
T13388 |
punct |
),GGGAAAATGGATAGAGGGTG |
R3956 |
T13397 |
T13357 |
punct |
.,obtained |
R3957 |
T13399 |
T13400 |
det |
The,fragment |
R3958 |
T13400 |
T13401 |
nsubjpass |
fragment,sequenced |
R3959 |
T13402 |
T13400 |
punct |
", ",fragment |
R3960 |
T13403 |
T13404 |
dep |
which,is |
R3961 |
T13404 |
T13400 |
relcl |
is,fragment |
R3962 |
T13405 |
T13406 |
nummod |
953,bp |
R3963 |
T13406 |
T13404 |
attr |
bp,is |
R3964 |
T13407 |
T13406 |
prep |
in,bp |
R3965 |
T13408 |
T13407 |
pobj |
size,in |
R3966 |
T13409 |
T13401 |
punct |
", ",sequenced |
R3967 |
T13410 |
T13401 |
auxpass |
was,sequenced |
R3968 |
T13411 |
T13412 |
mark |
as,described |
R3969 |
T13412 |
T13401 |
advcl |
described,sequenced |
R3970 |
T13413 |
T13412 |
advmod |
above,described |
R3971 |
T13414 |
T13412 |
cc |
and,described |
R3972 |
T13415 |
T13412 |
conj |
compared,described |
R3973 |
T13416 |
T13415 |
prep |
to,compared |
R3974 |
T13417 |
T13418 |
det |
the,build |
R3975 |
T13418 |
T13416 |
pobj |
build,to |
R3976 |
T13419 |
T13418 |
amod |
current,build |
R3977 |
T13420 |
T13418 |
prep |
of,build |
R3978 |
T13421 |
T13422 |
det |
the,genome |
R3979 |
T13422 |
T13420 |
pobj |
genome,of |
R3980 |
T13423 |
T13422 |
amod |
human,genome |
R3981 |
T13424 |
T13401 |
punct |
.,sequenced |
R3982 |
T13426 |
T13427 |
det |
A,series |
R3983 |
T13427 |
T13429 |
nsubjpass |
series,performed |
R3984 |
T13428 |
T13427 |
amod |
similar,series |
R3985 |
T13429 |
T13433 |
ccomp |
performed,were |
R3986 |
T13430 |
T13427 |
prep |
of,series |
R3987 |
T13431 |
T13430 |
pobj |
experiments,of |
R3988 |
T13432 |
T13429 |
auxpass |
was,performed |
R3989 |
T13434 |
T13435 |
aux |
to,identify |
R3990 |
T13435 |
T13429 |
advcl |
identify,performed |
R3991 |
T13436 |
T13437 |
det |
the,breakpoints |
R3992 |
T13437 |
T13435 |
dobj |
breakpoints,identify |
R3993 |
T13438 |
T13437 |
compound |
deletion,breakpoints |
R3994 |
T13439 |
T13437 |
prep |
in,breakpoints |
R3995 |
T13440 |
T13441 |
compound |
families,H27 |
R3996 |
T13441 |
T13439 |
pobj |
H27,in |
R3997 |
T13442 |
T13441 |
cc |
and,H27 |
R3998 |
T13443 |
T13441 |
conj |
H33,H27 |
R3999 |
T13444 |
T13433 |
punct |
;,were |
R4000 |
T13445 |
T13433 |
nsubj |
we,were |
R4001 |
T13446 |
T13433 |
acomp |
able,were |
R4002 |
T13447 |
T13448 |
aux |
to,amplify |
R4003 |
T13448 |
T13446 |
xcomp |
amplify,able |
R4004 |
T13449 |
T13450 |
det |
a,product |
R4005 |
T13450 |
T13448 |
dobj |
product,amplify |
R4006 |
T13451 |
T13452 |
nummod |
369,bp |
R4007 |
T13452 |
T13450 |
compound |
bp,product |
R4008 |
T13453 |
T13452 |
punct |
-,bp |
R4009 |
T13454 |
T13450 |
compound |
PCR,product |
R4010 |
T13455 |
T13448 |
prep |
across,amplify |
R4011 |
T13456 |
T13457 |
det |
the,breakpoint |
R4012 |
T13457 |
T13455 |
pobj |
breakpoint,across |
R4013 |
T13458 |
T13457 |
acl |
found,breakpoint |
R4014 |
T13459 |
T13458 |
prep |
in,found |
R4015 |
T13460 |
T13461 |
amod |
affected,members |
R4016 |
T13461 |
T13459 |
pobj |
members,in |
R4017 |
T13462 |
T13461 |
prep |
of,members |
R4018 |
T13463 |
T13464 |
compound |
family,H27 |
R4019 |
T13464 |
T13462 |
pobj |
H27,of |
R4020 |
T13465 |
T13448 |
advcl |
using,amplify |
R4021 |
T13466 |
T13467 |
compound |
primer,pair |
R4022 |
T13467 |
T13465 |
dobj |
pair,using |
R4023 |
T13468 |
T13469 |
nmod |
H27,11F |
R4024 |
T13469 |
T13471 |
nmod |
11F,GACCTCAAGAAGGCATGAATAC |
R4025 |
T13470 |
T13469 |
punct |
-,11F |
R4026 |
T13471 |
T13467 |
appos |
GACCTCAAGAAGGCATGAATAC,pair |
R4027 |
T13472 |
T13471 |
nummod |
5,GACCTCAAGAAGGCATGAATAC |
R4028 |
T13473 |
T13472 |
punct |
′,5 |
R4029 |
T13474 |
T13471 |
punct |
-,GACCTCAAGAAGGCATGAATAC |
R4030 |
T13475 |
T13471 |
punct |
-,GACCTCAAGAAGGCATGAATAC |
R4031 |
T13476 |
T13471 |
nummod |
3,GACCTCAAGAAGGCATGAATAC |
R4032 |
T13477 |
T13471 |
punct |
′,GACCTCAAGAAGGCATGAATAC |
R4033 |
T13478 |
T13471 |
cc |
and,GACCTCAAGAAGGCATGAATAC |
R4034 |
T13479 |
T13480 |
nmod |
H27,3R |
R4035 |
T13480 |
T13482 |
nmod |
3R,ATGGTGGCCAGGTACACAAG |
R4036 |
T13481 |
T13480 |
punct |
-,3R |
R4037 |
T13482 |
T13471 |
conj |
ATGGTGGCCAGGTACACAAG,GACCTCAAGAAGGCATGAATAC |
R4038 |
T13483 |
T13482 |
nummod |
5,ATGGTGGCCAGGTACACAAG |
R4039 |
T13484 |
T13483 |
punct |
′,5 |
R4040 |
T13485 |
T13482 |
punct |
-,ATGGTGGCCAGGTACACAAG |
R4041 |
T13486 |
T13482 |
punct |
-,ATGGTGGCCAGGTACACAAG |
R4042 |
T13487 |
T13482 |
nummod |
3,ATGGTGGCCAGGTACACAAG |
R4043 |
T13488 |
T13482 |
punct |
′,ATGGTGGCCAGGTACACAAG |
R4044 |
T13489 |
T13490 |
punct |
(,S4 |
R4045 |
T13490 |
T13465 |
parataxis |
S4,using |
R4046 |
T13491 |
T13490 |
compound |
Figure,S4 |
R4047 |
T13492 |
T13490 |
punct |
),S4 |
R4048 |
T13493 |
T13433 |
punct |
", ",were |
R4049 |
T13494 |
T13433 |
cc |
but,were |
R4050 |
T13495 |
T13496 |
prep |
to,been |
R4051 |
T13496 |
T13433 |
conj |
been,were |
R4052 |
T13497 |
T13495 |
pobj |
date,to |
R4053 |
T13498 |
T13496 |
nsubj |
we,been |
R4054 |
T13499 |
T13496 |
aux |
have,been |
R4055 |
T13500 |
T13496 |
acomp |
unable,been |
R4056 |
T13501 |
T13502 |
aux |
to,identify |
R4057 |
T13502 |
T13500 |
xcomp |
identify,unable |
R4058 |
T13503 |
T13504 |
det |
the,breakpoint |
R4059 |
T13504 |
T13502 |
dobj |
breakpoint,identify |
R4060 |
T13505 |
T13504 |
prep |
in,breakpoint |
R4061 |
T13506 |
T13507 |
compound |
family,H33 |
R4062 |
T13507 |
T13505 |
pobj |
H33,in |
R4063 |
T13508 |
T13433 |
punct |
.,were |