| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T4015 |
0-5 |
NN |
denotes |
Mouse |
| T4017 |
6-12 |
NN |
denotes |
embryo |
| T4018 |
13-21 |
JJ |
denotes |
multiple |
| T4019 |
21-22 |
HYPH |
denotes |
- |
| T4016 |
22-28 |
NN |
denotes |
tissue |
| T4021 |
29-37 |
JJ |
denotes |
northern |
| T4020 |
38-42 |
NN |
denotes |
blot |
| T4023 |
43-46 |
CC |
denotes |
and |
| T4024 |
47-52 |
NN |
denotes |
mouse |
| T4026 |
53-58 |
JJ |
denotes |
adult |
| T4027 |
59-67 |
JJ |
denotes |
multiple |
| T4028 |
67-68 |
HYPH |
denotes |
- |
| T4025 |
68-74 |
NN |
denotes |
tissue |
| T4030 |
75-83 |
JJ |
denotes |
northern |
| T4029 |
84-88 |
NN |
denotes |
blot |
| T4022 |
89-96 |
NNS |
denotes |
filters |
| T4032 |
97-101 |
VBD |
denotes |
were |
| T4031 |
102-111 |
VBN |
denotes |
purchased |
| T4033 |
112-116 |
IN |
denotes |
from |
| T4034 |
117-125 |
NNP |
denotes |
Clontech |
| T4035 |
126-138 |
NNP |
denotes |
Laboratories |
| T4036 |
139-140 |
-LRB- |
denotes |
( |
| T4038 |
140-144 |
NNP |
denotes |
Palo |
| T4037 |
145-149 |
NNP |
denotes |
Alto |
| T4039 |
149-151 |
, |
denotes |
, |
| T4040 |
151-153 |
NNP |
denotes |
CA |
| T4041 |
153-154 |
-RRB- |
denotes |
) |
| T4042 |
154-155 |
. |
denotes |
. |
| T4043 |
155-283 |
sentence |
denotes |
The filters were hybridized with the 32P-dATP labeled DNA fragment of Mcoln1 coding region corresponding to exon 2 (see above). |
| T4044 |
156-159 |
DT |
denotes |
The |
| T4045 |
160-167 |
NNS |
denotes |
filters |
| T4047 |
168-172 |
VBD |
denotes |
were |
| T4046 |
173-183 |
VBN |
denotes |
hybridized |
| T4048 |
184-188 |
IN |
denotes |
with |
| T4049 |
189-192 |
DT |
denotes |
the |
| T4051 |
193-196 |
NN |
denotes |
32P |
| T4053 |
196-197 |
HYPH |
denotes |
- |
| T4052 |
197-201 |
NN |
denotes |
dATP |
| T4054 |
202-209 |
JJ |
denotes |
labeled |
| T4055 |
210-213 |
NN |
denotes |
DNA |
| T4050 |
214-222 |
NN |
denotes |
fragment |
| T4056 |
223-225 |
IN |
denotes |
of |
| T4057 |
226-232 |
NN |
denotes |
Mcoln1 |
| T4059 |
233-239 |
NN |
denotes |
coding |
| T4058 |
240-246 |
NN |
denotes |
region |
| T4060 |
247-260 |
VBG |
denotes |
corresponding |
| T4061 |
261-263 |
IN |
denotes |
to |
| T4062 |
264-268 |
NN |
denotes |
exon |
| T4063 |
269-270 |
CD |
denotes |
2 |
| T4064 |
271-272 |
-LRB- |
denotes |
( |
| T4065 |
272-275 |
VB |
denotes |
see |
| T4066 |
276-281 |
RB |
denotes |
above |
| T4067 |
281-282 |
-RRB- |
denotes |
) |
| T4068 |
282-283 |
. |
denotes |
. |
| T4069 |
283-503 |
sentence |
denotes |
For the alternative transcript, a probe was generated in the region between exons 12 and 13 with primers 5'-GTGTCCACCACCTGAGAG-3' (forward) and 5'-GAAGTAGCATTCCTGCAGGC-3' (reverse) with an annealing temperature of 62°C. |
| T4070 |
284-287 |
IN |
denotes |
For |
| T4072 |
288-291 |
DT |
denotes |
the |
| T4074 |
292-303 |
JJ |
denotes |
alternative |
| T4073 |
304-314 |
NN |
denotes |
transcript |
| T4075 |
314-316 |
, |
denotes |
, |
| T4076 |
316-317 |
DT |
denotes |
a |
| T4077 |
318-323 |
NN |
denotes |
probe |
| T4078 |
324-327 |
VBD |
denotes |
was |
| T4071 |
328-337 |
VBN |
denotes |
generated |
| T4079 |
338-340 |
IN |
denotes |
in |
| T4080 |
341-344 |
DT |
denotes |
the |
| T4081 |
345-351 |
NN |
denotes |
region |
| T4082 |
352-359 |
IN |
denotes |
between |
| T4083 |
360-365 |
NNS |
denotes |
exons |
| T4084 |
366-368 |
CD |
denotes |
12 |
| T4085 |
369-372 |
CC |
denotes |
and |
| T4086 |
373-375 |
CD |
denotes |
13 |
| T4087 |
376-380 |
IN |
denotes |
with |
| T4088 |
381-388 |
NNS |
denotes |
primers |
| T4090 |
389-390 |
NN |
denotes |
5 |
| T4091 |
390-391 |
SYM |
denotes |
' |
| T4092 |
391-392 |
HYPH |
denotes |
- |
| T4093 |
392-410 |
NN |
denotes |
GTGTCCACCACCTGAGAG |
| T4094 |
410-411 |
HYPH |
denotes |
- |
| T4089 |
411-412 |
NN |
denotes |
3 |
| T4095 |
412-413 |
SYM |
denotes |
' |
| T4096 |
414-415 |
-LRB- |
denotes |
( |
| T4097 |
415-422 |
RB |
denotes |
forward |
| T4098 |
422-423 |
-RRB- |
denotes |
) |
| T4099 |
424-427 |
CC |
denotes |
and |
| T4100 |
428-429 |
NN |
denotes |
5 |
| T4102 |
429-430 |
SYM |
denotes |
' |
| T4103 |
430-431 |
HYPH |
denotes |
- |
| T4104 |
431-451 |
NN |
denotes |
GAAGTAGCATTCCTGCAGGC |
| T4105 |
451-452 |
HYPH |
denotes |
- |
| T4101 |
452-453 |
NN |
denotes |
3 |
| T4106 |
453-454 |
SYM |
denotes |
' |
| T4107 |
455-456 |
-LRB- |
denotes |
( |
| T4108 |
456-463 |
RB |
denotes |
reverse |
| T4109 |
463-464 |
-RRB- |
denotes |
) |
| T4110 |
465-469 |
IN |
denotes |
with |
| T4111 |
470-472 |
DT |
denotes |
an |
| T4113 |
473-482 |
JJ |
denotes |
annealing |
| T4112 |
483-494 |
NN |
denotes |
temperature |
| T4114 |
495-497 |
IN |
denotes |
of |
| T4115 |
498-500 |
CD |
denotes |
62 |
| T4116 |
500-502 |
NNS |
denotes |
°C |
| T4117 |
502-503 |
. |
denotes |
. |
| T4118 |
503-557 |
sentence |
denotes |
The filters were then hybridized with β-actin probes. |
| T4119 |
504-507 |
DT |
denotes |
The |
| T4120 |
508-515 |
NNS |
denotes |
filters |
| T4122 |
516-520 |
VBD |
denotes |
were |
| T4123 |
521-525 |
RB |
denotes |
then |
| T4121 |
526-536 |
VBN |
denotes |
hybridized |
| T4124 |
537-541 |
IN |
denotes |
with |
| T4125 |
542-543 |
NN |
denotes |
β |
| T4127 |
543-544 |
HYPH |
denotes |
- |
| T4126 |
544-549 |
NN |
denotes |
actin |
| T4128 |
550-556 |
NNS |
denotes |
probes |
| T4129 |
556-557 |
. |
denotes |
. |
| T4130 |
557-687 |
sentence |
denotes |
Hybridizations and washes were carried out in standard conditions, with the stripping of previously bound probes in between [16]. |
| T4131 |
558-572 |
NNS |
denotes |
Hybridizations |
| T4133 |
573-576 |
CC |
denotes |
and |
| T4134 |
577-583 |
NNS |
denotes |
washes |
| T4135 |
584-588 |
VBD |
denotes |
were |
| T4132 |
589-596 |
VBN |
denotes |
carried |
| T4136 |
597-600 |
RP |
denotes |
out |
| T4137 |
601-603 |
IN |
denotes |
in |
| T4138 |
604-612 |
JJ |
denotes |
standard |
| T4139 |
613-623 |
NNS |
denotes |
conditions |
| T4140 |
623-625 |
, |
denotes |
, |
| T4141 |
625-629 |
IN |
denotes |
with |
| T4142 |
630-633 |
DT |
denotes |
the |
| T4143 |
634-643 |
NN |
denotes |
stripping |
| T4144 |
644-646 |
IN |
denotes |
of |
| T4145 |
647-657 |
RB |
denotes |
previously |
| T4146 |
658-663 |
VBN |
denotes |
bound |
| T4147 |
664-670 |
NNS |
denotes |
probes |
| T4148 |
671-673 |
RB |
denotes |
in |
| T4149 |
674-681 |
RB |
denotes |
between |
| T4150 |
682-683 |
-LRB- |
denotes |
[ |
| T4151 |
683-685 |
CD |
denotes |
16 |
| T4152 |
685-686 |
-RRB- |
denotes |
] |
| T4153 |
686-687 |
. |
denotes |
. |
| R2481 |
T4015 |
T4016 |
nmod |
Mouse,tissue |
| R2482 |
T4016 |
T4020 |
nmod |
tissue,blot |
| R2483 |
T4017 |
T4016 |
nmod |
embryo,tissue |
| R2484 |
T4018 |
T4016 |
amod |
multiple,tissue |
| R2485 |
T4019 |
T4016 |
punct |
-,tissue |
| R2486 |
T4020 |
T4022 |
nmod |
blot,filters |
| R2487 |
T4021 |
T4020 |
amod |
northern,blot |
| R2488 |
T4022 |
T4031 |
nsubjpass |
filters,purchased |
| R2489 |
T4023 |
T4020 |
cc |
and,blot |
| R2490 |
T4024 |
T4025 |
nmod |
mouse,tissue |
| R2491 |
T4025 |
T4029 |
nmod |
tissue,blot |
| R2492 |
T4026 |
T4025 |
amod |
adult,tissue |
| R2493 |
T4027 |
T4025 |
amod |
multiple,tissue |
| R2494 |
T4028 |
T4025 |
punct |
-,tissue |
| R2495 |
T4029 |
T4020 |
conj |
blot,blot |
| R2496 |
T4030 |
T4029 |
amod |
northern,blot |
| R2497 |
T4032 |
T4031 |
auxpass |
were,purchased |
| R2498 |
T4033 |
T4031 |
prep |
from,purchased |
| R2499 |
T4034 |
T4035 |
compound |
Clontech,Laboratories |
| R2500 |
T4035 |
T4033 |
pobj |
Laboratories,from |
| R2501 |
T4036 |
T4037 |
punct |
(,Alto |
| R2502 |
T4037 |
T4035 |
parataxis |
Alto,Laboratories |
| R2503 |
T4038 |
T4037 |
compound |
Palo,Alto |
| R2504 |
T4039 |
T4037 |
punct |
", ",Alto |
| R2505 |
T4040 |
T4037 |
npadvmod |
CA,Alto |
| R2506 |
T4041 |
T4037 |
punct |
),Alto |
| R2507 |
T4042 |
T4031 |
punct |
.,purchased |
| R2508 |
T4044 |
T4045 |
det |
The,filters |
| R2509 |
T4045 |
T4046 |
nsubjpass |
filters,hybridized |
| R2510 |
T4047 |
T4046 |
auxpass |
were,hybridized |
| R2511 |
T4048 |
T4046 |
prep |
with,hybridized |
| R2512 |
T4049 |
T4050 |
det |
the,fragment |
| R2513 |
T4050 |
T4048 |
pobj |
fragment,with |
| R2514 |
T4051 |
T4052 |
compound |
32P,dATP |
| R2515 |
T4052 |
T4054 |
npadvmod |
dATP,labeled |
| R2516 |
T4053 |
T4052 |
punct |
-,dATP |
| R2517 |
T4054 |
T4050 |
amod |
labeled,fragment |
| R2518 |
T4055 |
T4050 |
compound |
DNA,fragment |
| R2519 |
T4056 |
T4050 |
prep |
of,fragment |
| R2520 |
T4057 |
T4058 |
compound |
Mcoln1,region |
| R2521 |
T4058 |
T4056 |
pobj |
region,of |
| R2522 |
T4059 |
T4058 |
compound |
coding,region |
| R2523 |
T4060 |
T4058 |
acl |
corresponding,region |
| R2524 |
T4061 |
T4060 |
prep |
to,corresponding |
| R2525 |
T4062 |
T4061 |
pobj |
exon,to |
| R2526 |
T4063 |
T4062 |
nummod |
2,exon |
| R2527 |
T4064 |
T4065 |
punct |
(,see |
| R2528 |
T4065 |
T4046 |
parataxis |
see,hybridized |
| R2529 |
T4066 |
T4065 |
advmod |
above,see |
| R2530 |
T4067 |
T4065 |
punct |
),see |
| R2531 |
T4068 |
T4046 |
punct |
.,hybridized |
| R2532 |
T4070 |
T4071 |
prep |
For,generated |
| R2533 |
T4072 |
T4073 |
det |
the,transcript |
| R2534 |
T4073 |
T4070 |
pobj |
transcript,For |
| R2535 |
T4074 |
T4073 |
amod |
alternative,transcript |
| R2536 |
T4075 |
T4071 |
punct |
", ",generated |
| R2537 |
T4076 |
T4077 |
det |
a,probe |
| R2538 |
T4077 |
T4071 |
nsubjpass |
probe,generated |
| R2539 |
T4078 |
T4071 |
auxpass |
was,generated |
| R2540 |
T4079 |
T4071 |
prep |
in,generated |
| R2541 |
T4080 |
T4081 |
det |
the,region |
| R2542 |
T4081 |
T4079 |
pobj |
region,in |
| R2543 |
T4082 |
T4081 |
prep |
between,region |
| R2544 |
T4083 |
T4084 |
nmod |
exons,12 |
| R2545 |
T4084 |
T4082 |
pobj |
12,between |
| R2546 |
T4085 |
T4084 |
cc |
and,12 |
| R2547 |
T4086 |
T4084 |
conj |
13,12 |
| R2548 |
T4087 |
T4071 |
prep |
with,generated |
| R2549 |
T4088 |
T4089 |
nmod |
primers,3 |
| R2550 |
T4089 |
T4087 |
pobj |
3,with |
| R2551 |
T4090 |
T4089 |
nmod |
5,3 |
| R2552 |
T4091 |
T4090 |
punct |
',5 |
| R2553 |
T4092 |
T4089 |
punct |
-,3 |
| R2554 |
T4093 |
T4089 |
compound |
GTGTCCACCACCTGAGAG,3 |
| R2555 |
T4094 |
T4089 |
punct |
-,3 |
| R2556 |
T4095 |
T4089 |
punct |
',3 |
| R2557 |
T4096 |
T4097 |
punct |
(,forward |
| R2558 |
T4097 |
T4089 |
parataxis |
forward,3 |
| R2559 |
T4098 |
T4097 |
punct |
),forward |
| R2560 |
T4099 |
T4089 |
cc |
and,3 |
| R2561 |
T4100 |
T4101 |
nmod |
5,3 |
| R2562 |
T4101 |
T4089 |
conj |
3,3 |
| R2563 |
T4102 |
T4100 |
punct |
',5 |
| R2564 |
T4103 |
T4101 |
punct |
-,3 |
| R2565 |
T4104 |
T4101 |
compound |
GAAGTAGCATTCCTGCAGGC,3 |
| R2566 |
T4105 |
T4101 |
punct |
-,3 |
| R2567 |
T4106 |
T4101 |
punct |
',3 |
| R2568 |
T4107 |
T4108 |
punct |
(,reverse |
| R2569 |
T4108 |
T4101 |
parataxis |
reverse,3 |
| R2570 |
T4109 |
T4108 |
punct |
),reverse |
| R2571 |
T4110 |
T4071 |
prep |
with,generated |
| R2572 |
T4111 |
T4112 |
det |
an,temperature |
| R2573 |
T4112 |
T4110 |
pobj |
temperature,with |
| R2574 |
T4113 |
T4112 |
amod |
annealing,temperature |
| R2575 |
T4114 |
T4112 |
prep |
of,temperature |
| R2576 |
T4115 |
T4116 |
nummod |
62,°C |
| R2577 |
T4116 |
T4114 |
pobj |
°C,of |
| R2578 |
T4117 |
T4071 |
punct |
.,generated |
| R2579 |
T4119 |
T4120 |
det |
The,filters |
| R2580 |
T4120 |
T4121 |
nsubjpass |
filters,hybridized |
| R2581 |
T4122 |
T4121 |
auxpass |
were,hybridized |
| R2582 |
T4123 |
T4121 |
advmod |
then,hybridized |
| R2583 |
T4124 |
T4121 |
prep |
with,hybridized |
| R2584 |
T4125 |
T4126 |
compound |
β,actin |
| R2585 |
T4126 |
T4128 |
compound |
actin,probes |
| R2586 |
T4127 |
T4126 |
punct |
-,actin |
| R2587 |
T4128 |
T4124 |
pobj |
probes,with |
| R2588 |
T4129 |
T4121 |
punct |
.,hybridized |
| R2589 |
T4131 |
T4132 |
nsubjpass |
Hybridizations,carried |
| R2590 |
T4133 |
T4131 |
cc |
and,Hybridizations |
| R2591 |
T4134 |
T4131 |
conj |
washes,Hybridizations |
| R2592 |
T4135 |
T4132 |
auxpass |
were,carried |
| R2593 |
T4136 |
T4132 |
prt |
out,carried |
| R2594 |
T4137 |
T4132 |
prep |
in,carried |
| R2595 |
T4138 |
T4139 |
amod |
standard,conditions |
| R2596 |
T4139 |
T4137 |
pobj |
conditions,in |
| R2597 |
T4140 |
T4132 |
punct |
", ",carried |
| R2598 |
T4141 |
T4132 |
prep |
with,carried |
| R2599 |
T4142 |
T4143 |
det |
the,stripping |
| R2600 |
T4143 |
T4141 |
pobj |
stripping,with |
| R2601 |
T4144 |
T4143 |
prep |
of,stripping |
| R2602 |
T4145 |
T4146 |
advmod |
previously,bound |
| R2603 |
T4146 |
T4147 |
amod |
bound,probes |
| R2604 |
T4147 |
T4144 |
pobj |
probes,of |
| R2605 |
T4148 |
T4149 |
advmod |
in,between |
| R2606 |
T4149 |
T4143 |
advmod |
between,stripping |
| R2607 |
T4150 |
T4151 |
punct |
[,16 |
| R2608 |
T4151 |
T4132 |
parataxis |
16,carried |
| R2609 |
T4152 |
T4151 |
punct |
],16 |
| R2610 |
T4153 |
T4132 |
punct |
.,carried |
