Id |
Subject |
Object |
Predicate |
Lexical cue |
T11864 |
9-21 |
NN |
denotes |
Construction |
T11865 |
22-24 |
IN |
denotes |
of |
T11866 |
25-27 |
DT |
denotes |
an |
T11868 |
28-34 |
NN |
denotes |
Adam11 |
T11869 |
35-39 |
NN |
denotes |
gene |
T11870 |
39-40 |
HYPH |
denotes |
- |
T11871 |
40-49 |
VBG |
denotes |
targeting |
T11867 |
50-56 |
NN |
denotes |
vector |
T11872 |
56-256 |
sentence |
denotes |
The 13.7-kb BamHI DNA fragment covering exons 2 – 20 of the Adam11 gene was amplified from C57BL/6 genomic DNA by the PCR using Expand Hi-Fidelity polymerase mix (Roche Diagnostics KK, Tokyo, Japan). |
T11873 |
57-60 |
DT |
denotes |
The |
T11875 |
61-65 |
CD |
denotes |
13.7 |
T11877 |
65-66 |
HYPH |
denotes |
- |
T11876 |
66-68 |
NN |
denotes |
kb |
T11878 |
69-74 |
NN |
denotes |
BamHI |
T11879 |
75-78 |
NN |
denotes |
DNA |
T11874 |
79-87 |
NN |
denotes |
fragment |
T11881 |
88-96 |
VBG |
denotes |
covering |
T11882 |
97-102 |
NNS |
denotes |
exons |
T11883 |
103-104 |
CD |
denotes |
2 |
T11884 |
105-106 |
SYM |
denotes |
– |
T11885 |
107-109 |
CD |
denotes |
20 |
T11886 |
110-112 |
IN |
denotes |
of |
T11887 |
113-116 |
DT |
denotes |
the |
T11889 |
117-123 |
NN |
denotes |
Adam11 |
T11888 |
124-128 |
NN |
denotes |
gene |
T11890 |
129-132 |
VBD |
denotes |
was |
T11880 |
133-142 |
VBN |
denotes |
amplified |
T11891 |
143-147 |
IN |
denotes |
from |
T11892 |
148-153 |
NN |
denotes |
C57BL |
T11894 |
153-154 |
HYPH |
denotes |
/ |
T11895 |
154-155 |
CD |
denotes |
6 |
T11896 |
156-163 |
JJ |
denotes |
genomic |
T11893 |
164-167 |
NN |
denotes |
DNA |
T11897 |
168-170 |
IN |
denotes |
by |
T11898 |
171-174 |
DT |
denotes |
the |
T11899 |
175-178 |
NN |
denotes |
PCR |
T11900 |
179-184 |
VBG |
denotes |
using |
T11901 |
185-191 |
NN |
denotes |
Expand |
T11903 |
192-194 |
NNP |
denotes |
Hi |
T11905 |
194-195 |
HYPH |
denotes |
- |
T11904 |
195-203 |
NNP |
denotes |
Fidelity |
T11906 |
204-214 |
NN |
denotes |
polymerase |
T11902 |
215-218 |
NN |
denotes |
mix |
T11907 |
219-220 |
-LRB- |
denotes |
( |
T11909 |
220-225 |
NNP |
denotes |
Roche |
T11910 |
226-237 |
NNP |
denotes |
Diagnostics |
T11908 |
238-240 |
NNP |
denotes |
KK |
T11911 |
240-242 |
, |
denotes |
, |
T11912 |
242-247 |
NNP |
denotes |
Tokyo |
T11913 |
247-249 |
, |
denotes |
, |
T11914 |
249-254 |
NNP |
denotes |
Japan |
T11915 |
254-255 |
-RRB- |
denotes |
) |
T11916 |
255-256 |
. |
denotes |
. |
T11917 |
256-372 |
sentence |
denotes |
To generate a mutation in the mouse Adam11 gene, we inserted a PGKneo cassette into exons 5 – 7 of the Adam11 gene. |
T11918 |
257-259 |
TO |
denotes |
To |
T11919 |
260-268 |
VB |
denotes |
generate |
T11921 |
269-270 |
DT |
denotes |
a |
T11922 |
271-279 |
NN |
denotes |
mutation |
T11923 |
280-282 |
IN |
denotes |
in |
T11924 |
283-286 |
DT |
denotes |
the |
T11926 |
287-292 |
NN |
denotes |
mouse |
T11927 |
293-299 |
NN |
denotes |
Adam11 |
T11925 |
300-304 |
NN |
denotes |
gene |
T11928 |
304-306 |
, |
denotes |
, |
T11929 |
306-308 |
PRP |
denotes |
we |
T11920 |
309-317 |
VBD |
denotes |
inserted |
T11930 |
318-319 |
DT |
denotes |
a |
T11932 |
320-326 |
NN |
denotes |
PGKneo |
T11931 |
327-335 |
NN |
denotes |
cassette |
T11933 |
336-340 |
IN |
denotes |
into |
T11934 |
341-346 |
NNS |
denotes |
exons |
T11935 |
347-348 |
CD |
denotes |
5 |
T11936 |
349-350 |
SYM |
denotes |
– |
T11937 |
351-352 |
CD |
denotes |
7 |
T11938 |
353-355 |
IN |
denotes |
of |
T11939 |
356-359 |
DT |
denotes |
the |
T11941 |
360-366 |
NN |
denotes |
Adam11 |
T11940 |
367-371 |
NN |
denotes |
gene |
T11942 |
371-372 |
. |
denotes |
. |
T11943 |
372-603 |
sentence |
denotes |
The final targeting construct consisted of a 10.1-kb genomic DNA fragment that was interrupted by the insertion of the PGKneo cassette and contained a MC1/TK cassette as a negative selection marker against random integration [39]. |
T11944 |
373-376 |
DT |
denotes |
The |
T11946 |
377-382 |
JJ |
denotes |
final |
T11947 |
383-392 |
NN |
denotes |
targeting |
T11945 |
393-402 |
NN |
denotes |
construct |
T11948 |
403-412 |
VBD |
denotes |
consisted |
T11949 |
413-415 |
IN |
denotes |
of |
T11950 |
416-417 |
DT |
denotes |
a |
T11952 |
418-422 |
CD |
denotes |
10.1 |
T11954 |
422-423 |
HYPH |
denotes |
- |
T11953 |
423-425 |
NN |
denotes |
kb |
T11955 |
426-433 |
JJ |
denotes |
genomic |
T11956 |
434-437 |
NN |
denotes |
DNA |
T11951 |
438-446 |
NN |
denotes |
fragment |
T11957 |
447-451 |
WDT |
denotes |
that |
T11959 |
452-455 |
VBD |
denotes |
was |
T11958 |
456-467 |
VBN |
denotes |
interrupted |
T11960 |
468-470 |
IN |
denotes |
by |
T11961 |
471-474 |
DT |
denotes |
the |
T11962 |
475-484 |
NN |
denotes |
insertion |
T11963 |
485-487 |
IN |
denotes |
of |
T11964 |
488-491 |
DT |
denotes |
the |
T11966 |
492-498 |
NN |
denotes |
PGKneo |
T11965 |
499-507 |
NN |
denotes |
cassette |
T11967 |
508-511 |
CC |
denotes |
and |
T11968 |
512-521 |
VBD |
denotes |
contained |
T11969 |
522-523 |
DT |
denotes |
a |
T11971 |
524-527 |
NN |
denotes |
MC1 |
T11973 |
527-528 |
HYPH |
denotes |
/ |
T11972 |
528-530 |
NN |
denotes |
TK |
T11970 |
531-539 |
NN |
denotes |
cassette |
T11974 |
540-542 |
IN |
denotes |
as |
T11975 |
543-544 |
DT |
denotes |
a |
T11977 |
545-553 |
JJ |
denotes |
negative |
T11978 |
554-563 |
NN |
denotes |
selection |
T11976 |
564-570 |
NN |
denotes |
marker |
T11979 |
571-578 |
IN |
denotes |
against |
T11980 |
579-585 |
JJ |
denotes |
random |
T11981 |
586-597 |
NN |
denotes |
integration |
T11982 |
598-599 |
-LRB- |
denotes |
[ |
T11983 |
599-601 |
CD |
denotes |
39 |
T11984 |
601-602 |
-RRB- |
denotes |
] |
T11985 |
602-603 |
. |
denotes |
. |
T12309 |
605-615 |
NN |
denotes |
Generation |
T12310 |
616-618 |
IN |
denotes |
of |
T12311 |
619-625 |
NN |
denotes |
Adam11 |
T12312 |
626-635 |
JJ |
denotes |
deficient |
T12313 |
636-640 |
NNS |
denotes |
mice |
T12314 |
640-732 |
sentence |
denotes |
The linearised targeting vector was electroporated into TT2 embryonic stem (ES) cells [40]. |
T12315 |
641-644 |
DT |
denotes |
The |
T12317 |
645-655 |
VBN |
denotes |
linearised |
T12318 |
656-665 |
NN |
denotes |
targeting |
T12316 |
666-672 |
NN |
denotes |
vector |
T12320 |
673-676 |
VBD |
denotes |
was |
T12319 |
677-691 |
VBN |
denotes |
electroporated |
T12321 |
692-696 |
IN |
denotes |
into |
T12322 |
697-700 |
NN |
denotes |
TT2 |
T12324 |
701-710 |
JJ |
denotes |
embryonic |
T12325 |
711-715 |
NN |
denotes |
stem |
T12326 |
716-717 |
-LRB- |
denotes |
( |
T12327 |
717-719 |
NN |
denotes |
ES |
T12328 |
719-720 |
-RRB- |
denotes |
) |
T12323 |
721-726 |
NNS |
denotes |
cells |
T12329 |
727-728 |
-LRB- |
denotes |
[ |
T12330 |
728-730 |
CD |
denotes |
40 |
T12331 |
730-731 |
-RRB- |
denotes |
] |
T12332 |
731-732 |
. |
denotes |
. |
T12333 |
732-946 |
sentence |
denotes |
Homologous recombinants were selected by PCR using the following primers, AGN1: 5'-TCGTGCTTTACGGTATCGCCGCTCCCGATT-3' in the PGKneo cassette, and SGN033: 5'-GGACCCGGAAGACATTTGCACGGT-3' outside the targeting vector. |
T12334 |
733-743 |
JJ |
denotes |
Homologous |
T12335 |
744-756 |
NNS |
denotes |
recombinants |
T12337 |
757-761 |
VBD |
denotes |
were |
T12336 |
762-770 |
VBN |
denotes |
selected |
T12338 |
771-773 |
IN |
denotes |
by |
T12339 |
774-777 |
NN |
denotes |
PCR |
T12340 |
778-783 |
VBG |
denotes |
using |
T12341 |
784-787 |
DT |
denotes |
the |
T12343 |
788-797 |
VBG |
denotes |
following |
T12342 |
798-805 |
NNS |
denotes |
primers |
T12344 |
805-807 |
, |
denotes |
, |
T12345 |
807-811 |
NN |
denotes |
AGN1 |
T12346 |
811-813 |
: |
denotes |
: |
T12347 |
813-814 |
CD |
denotes |
5 |
T12348 |
814-815 |
SYM |
denotes |
' |
T12349 |
815-816 |
HYPH |
denotes |
- |
T12350 |
816-846 |
NN |
denotes |
TCGTGCTTTACGGTATCGCCGCTCCCGATT |
T12351 |
846-847 |
HYPH |
denotes |
- |
T12352 |
847-848 |
CD |
denotes |
3 |
T12353 |
848-849 |
SYM |
denotes |
' |
T12354 |
850-852 |
IN |
denotes |
in |
T12355 |
853-856 |
DT |
denotes |
the |
T12357 |
857-863 |
NN |
denotes |
PGKneo |
T12356 |
864-872 |
NN |
denotes |
cassette |
T12358 |
872-874 |
, |
denotes |
, |
T12359 |
874-877 |
CC |
denotes |
and |
T12360 |
878-884 |
NN |
denotes |
SGN033 |
T12361 |
884-886 |
: |
denotes |
: |
T12362 |
886-887 |
CD |
denotes |
5 |
T12363 |
887-888 |
SYM |
denotes |
' |
T12364 |
888-889 |
HYPH |
denotes |
- |
T12365 |
889-913 |
NN |
denotes |
GGACCCGGAAGACATTTGCACGGT |
T12366 |
913-914 |
HYPH |
denotes |
- |
T12367 |
914-915 |
CD |
denotes |
3 |
T12368 |
915-916 |
SYM |
denotes |
' |
T12369 |
917-924 |
IN |
denotes |
outside |
T12370 |
925-928 |
DT |
denotes |
the |
T12372 |
929-938 |
NN |
denotes |
targeting |
T12371 |
939-945 |
NN |
denotes |
vector |
T12373 |
945-946 |
. |
denotes |
. |
T12374 |
946-1078 |
sentence |
denotes |
Homologous recombined DNA was efficiently amplified by 35 cycles of the following amplification steps (94°C-30 sec and 68°C-5 min). |
T12375 |
947-957 |
JJ |
denotes |
Homologous |
T12377 |
958-968 |
VBN |
denotes |
recombined |
T12376 |
969-972 |
NN |
denotes |
DNA |
T12379 |
973-976 |
VBD |
denotes |
was |
T12380 |
977-988 |
RB |
denotes |
efficiently |
T12378 |
989-998 |
VBN |
denotes |
amplified |
T12381 |
999-1001 |
IN |
denotes |
by |
T12382 |
1002-1004 |
CD |
denotes |
35 |
T12383 |
1005-1011 |
NNS |
denotes |
cycles |
T12384 |
1012-1014 |
IN |
denotes |
of |
T12385 |
1015-1018 |
DT |
denotes |
the |
T12387 |
1019-1028 |
VBG |
denotes |
following |
T12388 |
1029-1042 |
NN |
denotes |
amplification |
T12386 |
1043-1048 |
NNS |
denotes |
steps |
T12389 |
1049-1050 |
-LRB- |
denotes |
( |
T12390 |
1050-1052 |
CD |
denotes |
94 |
T12391 |
1052-1054 |
NN |
denotes |
°C |
T12392 |
1054-1055 |
SYM |
denotes |
- |
T12393 |
1055-1057 |
CD |
denotes |
30 |
T12394 |
1058-1061 |
NN |
denotes |
sec |
T12395 |
1062-1065 |
CC |
denotes |
and |
T12396 |
1066-1068 |
CD |
denotes |
68 |
T12397 |
1068-1070 |
NN |
denotes |
°C |
T12398 |
1070-1071 |
SYM |
denotes |
- |
T12399 |
1071-1072 |
CD |
denotes |
5 |
T12400 |
1073-1076 |
NN |
denotes |
min |
T12401 |
1076-1077 |
-RRB- |
denotes |
) |
T12402 |
1077-1078 |
. |
denotes |
. |
T12403 |
1078-1177 |
sentence |
denotes |
Correctly targeted ES clones were injected into fertilised ICR mouse eggs at the eight-cell stage. |
T12404 |
1079-1088 |
RB |
denotes |
Correctly |
T12405 |
1089-1097 |
VBN |
denotes |
targeted |
T12407 |
1098-1100 |
NN |
denotes |
ES |
T12406 |
1101-1107 |
NNS |
denotes |
clones |
T12409 |
1108-1112 |
VBD |
denotes |
were |
T12408 |
1113-1121 |
VBN |
denotes |
injected |
T12410 |
1122-1126 |
IN |
denotes |
into |
T12411 |
1127-1137 |
VBN |
denotes |
fertilised |
T12413 |
1138-1141 |
NN |
denotes |
ICR |
T12414 |
1142-1147 |
NN |
denotes |
mouse |
T12412 |
1148-1152 |
NNS |
denotes |
eggs |
T12415 |
1153-1155 |
IN |
denotes |
at |
T12416 |
1156-1159 |
DT |
denotes |
the |
T12418 |
1160-1165 |
CD |
denotes |
eight |
T12420 |
1165-1166 |
HYPH |
denotes |
- |
T12419 |
1166-1170 |
NN |
denotes |
cell |
T12417 |
1171-1176 |
NN |
denotes |
stage |
T12421 |
1176-1177 |
. |
denotes |
. |
T12422 |
1177-1382 |
sentence |
denotes |
The resulting male chimeras were mated with C57BL/6NCrj females (Charles River Japan, Tokyo, Japan), and resulting heterozygous (+/-) male and female mice were interbred to generate homozygous (-/-) mice. |
T12423 |
1178-1181 |
DT |
denotes |
The |
T12425 |
1182-1191 |
VBG |
denotes |
resulting |
T12426 |
1192-1196 |
JJ |
denotes |
male |
T12424 |
1197-1205 |
NNS |
denotes |
chimeras |
T12428 |
1206-1210 |
VBD |
denotes |
were |
T12427 |
1211-1216 |
VBN |
denotes |
mated |
T12429 |
1217-1221 |
IN |
denotes |
with |
T12430 |
1222-1227 |
NN |
denotes |
C57BL |
T12432 |
1227-1228 |
HYPH |
denotes |
/ |
T12431 |
1228-1233 |
NN |
denotes |
6NCrj |
T12433 |
1234-1241 |
NNS |
denotes |
females |
T12434 |
1242-1243 |
-LRB- |
denotes |
( |
T12436 |
1243-1250 |
NNP |
denotes |
Charles |
T12437 |
1251-1256 |
NNP |
denotes |
River |
T12435 |
1257-1262 |
NNP |
denotes |
Japan |
T12438 |
1262-1264 |
, |
denotes |
, |
T12439 |
1264-1269 |
NNP |
denotes |
Tokyo |
T12440 |
1269-1271 |
, |
denotes |
, |
T12441 |
1271-1276 |
NNP |
denotes |
Japan |
T12442 |
1276-1277 |
-RRB- |
denotes |
) |
T12443 |
1277-1279 |
, |
denotes |
, |
T12444 |
1279-1282 |
CC |
denotes |
and |
T12445 |
1283-1292 |
VBG |
denotes |
resulting |
T12447 |
1293-1305 |
JJ |
denotes |
heterozygous |
T12448 |
1306-1307 |
-LRB- |
denotes |
( |
T12449 |
1307-1308 |
SYM |
denotes |
+ |
T12451 |
1308-1309 |
HYPH |
denotes |
/ |
T12450 |
1309-1310 |
SYM |
denotes |
- |
T12452 |
1310-1311 |
-RRB- |
denotes |
) |
T12453 |
1312-1316 |
JJ |
denotes |
male |
T12454 |
1317-1320 |
CC |
denotes |
and |
T12455 |
1321-1327 |
JJ |
denotes |
female |
T12446 |
1328-1332 |
NNS |
denotes |
mice |
T12457 |
1333-1337 |
VBD |
denotes |
were |
T12456 |
1338-1347 |
VBN |
denotes |
interbred |
T12458 |
1348-1350 |
TO |
denotes |
to |
T12459 |
1351-1359 |
VB |
denotes |
generate |
T12460 |
1360-1370 |
JJ |
denotes |
homozygous |
T12462 |
1371-1372 |
-LRB- |
denotes |
( |
T12463 |
1372-1373 |
SYM |
denotes |
- |
T12465 |
1373-1374 |
HYPH |
denotes |
/ |
T12464 |
1374-1375 |
SYM |
denotes |
- |
T12466 |
1375-1376 |
-RRB- |
denotes |
) |
T12461 |
1377-1381 |
NNS |
denotes |
mice |
T12467 |
1381-1382 |
. |
denotes |
. |
T12588 |
1384-1392 |
NNP |
denotes |
Southern |
T12589 |
1393-1397 |
NN |
denotes |
blot |
T12590 |
1398-1406 |
NN |
denotes |
analysis |
T12591 |
1406-1503 |
sentence |
denotes |
Mouse genomic DNA used for Southern blot analysis was extracted from the liver of each genotype. |
T12592 |
1407-1412 |
NN |
denotes |
Mouse |
T12594 |
1413-1420 |
JJ |
denotes |
genomic |
T12593 |
1421-1424 |
NN |
denotes |
DNA |
T12596 |
1425-1429 |
VBN |
denotes |
used |
T12597 |
1430-1433 |
IN |
denotes |
for |
T12598 |
1434-1442 |
NNP |
denotes |
Southern |
T12599 |
1443-1447 |
NN |
denotes |
blot |
T12600 |
1448-1456 |
NN |
denotes |
analysis |
T12601 |
1457-1460 |
VBD |
denotes |
was |
T12595 |
1461-1470 |
VBN |
denotes |
extracted |
T12602 |
1471-1475 |
IN |
denotes |
from |
T12603 |
1476-1479 |
DT |
denotes |
the |
T12604 |
1480-1485 |
NN |
denotes |
liver |
T12605 |
1486-1488 |
IN |
denotes |
of |
T12606 |
1489-1493 |
DT |
denotes |
each |
T12607 |
1494-1502 |
NN |
denotes |
genotype |
T12608 |
1502-1503 |
. |
denotes |
. |
T12609 |
1503-1648 |
sentence |
denotes |
BamHI-digested genomic DNA was probed with the [32P]-labelled BE2K probe, which was a 2.0-kb BamHI – EcoRI genomic fragment located in intron 2. |
T12610 |
1504-1509 |
NN |
denotes |
BamHI |
T12612 |
1509-1510 |
HYPH |
denotes |
- |
T12611 |
1510-1518 |
VBN |
denotes |
digested |
T12614 |
1519-1526 |
JJ |
denotes |
genomic |
T12613 |
1527-1530 |
NN |
denotes |
DNA |
T12616 |
1531-1534 |
VBD |
denotes |
was |
T12615 |
1535-1541 |
VBN |
denotes |
probed |
T12617 |
1542-1546 |
IN |
denotes |
with |
T12618 |
1547-1550 |
DT |
denotes |
the |
T12620 |
1551-1552 |
-LRB- |
denotes |
[ |
T12621 |
1552-1555 |
NN |
denotes |
32P |
T12623 |
1555-1556 |
-RRB- |
denotes |
] |
T12624 |
1556-1557 |
HYPH |
denotes |
- |
T12622 |
1557-1565 |
VBN |
denotes |
labelled |
T12625 |
1566-1570 |
NN |
denotes |
BE2K |
T12619 |
1571-1576 |
NN |
denotes |
probe |
T12626 |
1576-1578 |
, |
denotes |
, |
T12627 |
1578-1583 |
WDT |
denotes |
which |
T12628 |
1584-1587 |
VBD |
denotes |
was |
T12629 |
1588-1589 |
DT |
denotes |
a |
T12631 |
1590-1593 |
CD |
denotes |
2.0 |
T12633 |
1593-1594 |
HYPH |
denotes |
- |
T12632 |
1594-1596 |
NN |
denotes |
kb |
T12634 |
1597-1602 |
NN |
denotes |
BamHI |
T12636 |
1603-1604 |
HYPH |
denotes |
– |
T12635 |
1605-1610 |
NN |
denotes |
EcoRI |
T12637 |
1611-1618 |
JJ |
denotes |
genomic |
T12630 |
1619-1627 |
NN |
denotes |
fragment |
T12638 |
1628-1635 |
VBN |
denotes |
located |
T12639 |
1636-1638 |
IN |
denotes |
in |
T12640 |
1639-1645 |
NN |
denotes |
intron |
T12641 |
1646-1647 |
CD |
denotes |
2 |
T12642 |
1647-1648 |
. |
denotes |
. |
T13011 |
1650-1657 |
NNP |
denotes |
Western |
T13012 |
1658-1662 |
NN |
denotes |
blot |
T13013 |
1663-1671 |
NN |
denotes |
analysis |
T13014 |
1671-1759 |
sentence |
denotes |
The absence of ADAM11 protein in the (-/-) mice was confirmed by Western blot analysis. |
T13015 |
1672-1675 |
DT |
denotes |
The |
T13016 |
1676-1683 |
NN |
denotes |
absence |
T13018 |
1684-1686 |
IN |
denotes |
of |
T13019 |
1687-1693 |
NN |
denotes |
ADAM11 |
T13020 |
1694-1701 |
NN |
denotes |
protein |
T13021 |
1702-1704 |
IN |
denotes |
in |
T13022 |
1705-1708 |
DT |
denotes |
the |
T13024 |
1709-1710 |
-LRB- |
denotes |
( |
T13025 |
1710-1711 |
SYM |
denotes |
- |
T13027 |
1711-1712 |
HYPH |
denotes |
/ |
T13026 |
1712-1713 |
SYM |
denotes |
- |
T13028 |
1713-1714 |
-RRB- |
denotes |
) |
T13023 |
1715-1719 |
NNS |
denotes |
mice |
T13029 |
1720-1723 |
VBD |
denotes |
was |
T13017 |
1724-1733 |
VBN |
denotes |
confirmed |
T13030 |
1734-1736 |
IN |
denotes |
by |
T13031 |
1737-1744 |
NNP |
denotes |
Western |
T13032 |
1745-1749 |
NN |
denotes |
blot |
T13033 |
1750-1758 |
NN |
denotes |
analysis |
T13034 |
1758-1759 |
. |
denotes |
. |
T13035 |
1759-1979 |
sentence |
denotes |
To be brief, the cerebellum was isolated from a six month-old mouse of each genotype and homogenised in cell lysis buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% NP-40, protease inhibitor cocktail [Roche Diagnostics]). |
T13036 |
1760-1762 |
TO |
denotes |
To |
T13037 |
1763-1765 |
VB |
denotes |
be |
T13039 |
1766-1771 |
JJ |
denotes |
brief |
T13040 |
1771-1773 |
, |
denotes |
, |
T13041 |
1773-1776 |
DT |
denotes |
the |
T13042 |
1777-1787 |
NN |
denotes |
cerebellum |
T13043 |
1788-1791 |
VBD |
denotes |
was |
T13038 |
1792-1800 |
VBN |
denotes |
isolated |
T13044 |
1801-1805 |
IN |
denotes |
from |
T13045 |
1806-1807 |
DT |
denotes |
a |
T13047 |
1808-1811 |
CD |
denotes |
six |
T13048 |
1812-1817 |
NN |
denotes |
month |
T13050 |
1817-1818 |
HYPH |
denotes |
- |
T13049 |
1818-1821 |
JJ |
denotes |
old |
T13046 |
1822-1827 |
NN |
denotes |
mouse |
T13051 |
1828-1830 |
IN |
denotes |
of |
T13052 |
1831-1835 |
DT |
denotes |
each |
T13053 |
1836-1844 |
NN |
denotes |
genotype |
T13054 |
1845-1848 |
CC |
denotes |
and |
T13055 |
1849-1860 |
VBN |
denotes |
homogenised |
T13056 |
1861-1863 |
IN |
denotes |
in |
T13057 |
1864-1868 |
NN |
denotes |
cell |
T13058 |
1869-1874 |
NN |
denotes |
lysis |
T13059 |
1875-1881 |
NN |
denotes |
buffer |
T13060 |
1882-1883 |
-LRB- |
denotes |
( |
T13062 |
1883-1885 |
CD |
denotes |
50 |
T13063 |
1886-1888 |
NN |
denotes |
mM |
T13065 |
1889-1893 |
NN |
denotes |
Tris |
T13066 |
1893-1894 |
HYPH |
denotes |
- |
T13064 |
1894-1897 |
NN |
denotes |
HCl |
T13067 |
1897-1899 |
, |
denotes |
, |
T13068 |
1899-1901 |
NN |
denotes |
pH |
T13069 |
1902-1905 |
CD |
denotes |
7.5 |
T13070 |
1905-1907 |
, |
denotes |
, |
T13071 |
1907-1910 |
CD |
denotes |
100 |
T13072 |
1911-1913 |
NN |
denotes |
mM |
T13073 |
1914-1918 |
NN |
denotes |
NaCl |
T13074 |
1918-1920 |
, |
denotes |
, |
T13075 |
1920-1921 |
CD |
denotes |
1 |
T13076 |
1921-1922 |
NN |
denotes |
% |
T13077 |
1923-1925 |
NN |
denotes |
NP |
T13078 |
1925-1926 |
HYPH |
denotes |
- |
T13079 |
1926-1928 |
CD |
denotes |
40 |
T13080 |
1928-1930 |
, |
denotes |
, |
T13081 |
1930-1938 |
NN |
denotes |
protease |
T13082 |
1939-1948 |
NN |
denotes |
inhibitor |
T13061 |
1949-1957 |
NN |
denotes |
cocktail |
T13083 |
1958-1959 |
-LRB- |
denotes |
[ |
T13085 |
1959-1964 |
NNP |
denotes |
Roche |
T13084 |
1965-1976 |
NNP |
denotes |
Diagnostics |
T13086 |
1976-1977 |
-RRB- |
denotes |
] |
T13087 |
1977-1978 |
-RRB- |
denotes |
) |
T13088 |
1978-1979 |
. |
denotes |
. |
T13089 |
1979-2176 |
sentence |
denotes |
After removal of cell debris by centrifugation, the glycosylated proteins in the supernatant were concentrated by the affinity chromatography using Con A Sepharose 4B (Amersham Biosciences Corp.). |
T13090 |
1980-1985 |
IN |
denotes |
After |
T13092 |
1986-1993 |
NN |
denotes |
removal |
T13093 |
1994-1996 |
IN |
denotes |
of |
T13094 |
1997-2001 |
NN |
denotes |
cell |
T13095 |
2002-2008 |
NN |
denotes |
debris |
T13096 |
2009-2011 |
IN |
denotes |
by |
T13097 |
2012-2026 |
NN |
denotes |
centrifugation |
T13098 |
2026-2028 |
, |
denotes |
, |
T13099 |
2028-2031 |
DT |
denotes |
the |
T13101 |
2032-2044 |
VBN |
denotes |
glycosylated |
T13100 |
2045-2053 |
NN |
denotes |
proteins |
T13102 |
2054-2056 |
IN |
denotes |
in |
T13103 |
2057-2060 |
DT |
denotes |
the |
T13104 |
2061-2072 |
NN |
denotes |
supernatant |
T13105 |
2073-2077 |
VBD |
denotes |
were |
T13091 |
2078-2090 |
VBN |
denotes |
concentrated |
T13106 |
2091-2093 |
IN |
denotes |
by |
T13107 |
2094-2097 |
DT |
denotes |
the |
T13109 |
2098-2106 |
NN |
denotes |
affinity |
T13108 |
2107-2121 |
NN |
denotes |
chromatography |
T13110 |
2122-2127 |
VBG |
denotes |
using |
T13111 |
2128-2131 |
NN |
denotes |
Con |
T13113 |
2132-2133 |
NN |
denotes |
A |
T13114 |
2134-2143 |
NN |
denotes |
Sepharose |
T13112 |
2144-2146 |
NN |
denotes |
4B |
T13115 |
2147-2148 |
-LRB- |
denotes |
( |
T13117 |
2148-2156 |
NNP |
denotes |
Amersham |
T13118 |
2157-2168 |
NNP |
denotes |
Biosciences |
T13116 |
2169-2174 |
NNP |
denotes |
Corp. |
T13119 |
2174-2175 |
-RRB- |
denotes |
) |
T13120 |
2175-2176 |
. |
denotes |
. |
T13121 |
2176-2255 |
sentence |
denotes |
Each sample was separated on 10% SDS-PAGE, and transferred to a PVDF membrane. |
T13122 |
2177-2181 |
DT |
denotes |
Each |
T13123 |
2182-2188 |
NN |
denotes |
sample |
T13125 |
2189-2192 |
VBD |
denotes |
was |
T13124 |
2193-2202 |
VBN |
denotes |
separated |
T13126 |
2203-2205 |
IN |
denotes |
on |
T13127 |
2206-2208 |
CD |
denotes |
10 |
T13128 |
2208-2209 |
NN |
denotes |
% |
T13130 |
2210-2213 |
NN |
denotes |
SDS |
T13131 |
2213-2214 |
HYPH |
denotes |
- |
T13129 |
2214-2218 |
NN |
denotes |
PAGE |
T13132 |
2218-2220 |
, |
denotes |
, |
T13133 |
2220-2223 |
CC |
denotes |
and |
T13134 |
2224-2235 |
VBN |
denotes |
transferred |
T13135 |
2236-2238 |
IN |
denotes |
to |
T13136 |
2239-2240 |
DT |
denotes |
a |
T13138 |
2241-2245 |
NN |
denotes |
PVDF |
T13137 |
2246-2254 |
NN |
denotes |
membrane |
T13139 |
2254-2255 |
. |
denotes |
. |
T13140 |
2255-2364 |
sentence |
denotes |
The blot was then incubated with monoclonal antibody against the ADAM11 (U. S. Patent 5,631,351) at 1 μg/ml. |
T13141 |
2256-2259 |
DT |
denotes |
The |
T13142 |
2260-2264 |
NN |
denotes |
blot |
T13144 |
2265-2268 |
VBD |
denotes |
was |
T13145 |
2269-2273 |
RB |
denotes |
then |
T13143 |
2274-2283 |
VBN |
denotes |
incubated |
T13146 |
2284-2288 |
IN |
denotes |
with |
T13147 |
2289-2299 |
JJ |
denotes |
monoclonal |
T13148 |
2300-2308 |
NN |
denotes |
antibody |
T13149 |
2309-2316 |
IN |
denotes |
against |
T13150 |
2317-2320 |
DT |
denotes |
the |
T13151 |
2321-2327 |
NN |
denotes |
ADAM11 |
T13152 |
2328-2329 |
-LRB- |
denotes |
( |
T13154 |
2329-2331 |
NNP |
denotes |
U. |
T13155 |
2332-2334 |
NNP |
denotes |
S. |
T13153 |
2335-2341 |
NN |
denotes |
Patent |
T13156 |
2342-2351 |
CD |
denotes |
5,631,351 |
T13157 |
2351-2352 |
-RRB- |
denotes |
) |
T13158 |
2353-2355 |
IN |
denotes |
at |
T13159 |
2356-2357 |
CD |
denotes |
1 |
T13160 |
2358-2360 |
NN |
denotes |
μg |
T13161 |
2360-2361 |
SYM |
denotes |
/ |
T13162 |
2361-2363 |
NN |
denotes |
ml |
T13163 |
2363-2364 |
. |
denotes |
. |
T13164 |
2364-2531 |
sentence |
denotes |
Bound antibodies were visualised with horseradish peroxidase-labelled second antibody and an ECL-plus chemiluminescence detection system (Amersham Biosciences Corp.). |
T13165 |
2365-2370 |
JJ |
denotes |
Bound |
T13166 |
2371-2381 |
NNS |
denotes |
antibodies |
T13168 |
2382-2386 |
VBD |
denotes |
were |
T13167 |
2387-2397 |
VBN |
denotes |
visualised |
T13169 |
2398-2402 |
IN |
denotes |
with |
T13170 |
2403-2414 |
NN |
denotes |
horseradish |
T13171 |
2415-2425 |
NN |
denotes |
peroxidase |
T13173 |
2425-2426 |
HYPH |
denotes |
- |
T13172 |
2426-2434 |
VBN |
denotes |
labelled |
T13175 |
2435-2441 |
JJ |
denotes |
second |
T13174 |
2442-2450 |
NN |
denotes |
antibody |
T13176 |
2451-2454 |
CC |
denotes |
and |
T13177 |
2455-2457 |
DT |
denotes |
an |
T13179 |
2458-2461 |
NN |
denotes |
ECL |
T13181 |
2461-2462 |
HYPH |
denotes |
- |
T13180 |
2462-2466 |
NN |
denotes |
plus |
T13182 |
2467-2484 |
NN |
denotes |
chemiluminescence |
T13183 |
2485-2494 |
NN |
denotes |
detection |
T13178 |
2495-2501 |
NN |
denotes |
system |
T13184 |
2502-2503 |
-LRB- |
denotes |
( |
T13186 |
2503-2511 |
NNP |
denotes |
Amersham |
T13187 |
2512-2523 |
NNP |
denotes |
Biosciences |
T13185 |
2524-2529 |
NNP |
denotes |
Corp. |
T13188 |
2529-2530 |
-RRB- |
denotes |
) |
T13189 |
2530-2531 |
. |
denotes |
. |
T13416 |
2533-2544 |
JJ |
denotes |
Behavioural |
T13417 |
2545-2553 |
NN |
denotes |
analysis |
T13418 |
2553-2824 |
sentence |
denotes |
All animal procedures conformed to the Japanese regulations on animal care and use, following the Guideline for Animal Experimentation of the Japanese Association for Laboratory of Animal Science, and were approved by the Animal Care and Use Committee of Eisai Co., Ltd. |
T13419 |
2554-2557 |
DT |
denotes |
All |
T13421 |
2558-2564 |
NN |
denotes |
animal |
T13420 |
2565-2575 |
NNS |
denotes |
procedures |
T13422 |
2576-2585 |
VBD |
denotes |
conformed |
T13423 |
2586-2588 |
IN |
denotes |
to |
T13424 |
2589-2592 |
DT |
denotes |
the |
T13426 |
2593-2601 |
JJ |
denotes |
Japanese |
T13425 |
2602-2613 |
NNS |
denotes |
regulations |
T13427 |
2614-2616 |
IN |
denotes |
on |
T13428 |
2617-2623 |
NN |
denotes |
animal |
T13429 |
2624-2628 |
NN |
denotes |
care |
T13430 |
2629-2632 |
CC |
denotes |
and |
T13431 |
2633-2636 |
NN |
denotes |
use |
T13432 |
2636-2638 |
, |
denotes |
, |
T13433 |
2638-2647 |
VBG |
denotes |
following |
T13434 |
2648-2651 |
DT |
denotes |
the |
T13435 |
2652-2661 |
NNP |
denotes |
Guideline |
T13436 |
2662-2665 |
IN |
denotes |
for |
T13437 |
2666-2672 |
NNP |
denotes |
Animal |
T13438 |
2673-2688 |
NNP |
denotes |
Experimentation |
T13439 |
2689-2691 |
IN |
denotes |
of |
T13440 |
2692-2695 |
DT |
denotes |
the |
T13442 |
2696-2704 |
NNP |
denotes |
Japanese |
T13441 |
2705-2716 |
NNP |
denotes |
Association |
T13443 |
2717-2720 |
IN |
denotes |
for |
T13444 |
2721-2731 |
NNP |
denotes |
Laboratory |
T13445 |
2732-2734 |
IN |
denotes |
of |
T13446 |
2735-2741 |
NNP |
denotes |
Animal |
T13447 |
2742-2749 |
NNP |
denotes |
Science |
T13448 |
2749-2751 |
, |
denotes |
, |
T13449 |
2751-2754 |
CC |
denotes |
and |
T13450 |
2755-2759 |
VBD |
denotes |
were |
T13451 |
2760-2768 |
VBN |
denotes |
approved |
T13452 |
2769-2771 |
IN |
denotes |
by |
T13453 |
2772-2775 |
DT |
denotes |
the |
T13455 |
2776-2782 |
NNP |
denotes |
Animal |
T13456 |
2783-2787 |
NNP |
denotes |
Care |
T13457 |
2788-2791 |
CC |
denotes |
and |
T13458 |
2792-2795 |
NNP |
denotes |
Use |
T13454 |
2796-2805 |
NNP |
denotes |
Committee |
T13459 |
2806-2808 |
IN |
denotes |
of |
T13460 |
2809-2814 |
NNP |
denotes |
Eisai |
T13461 |
2815-2818 |
NNP |
denotes |
Co. |
T13462 |
2818-2820 |
, |
denotes |
, |
T13463 |
2820-2823 |
NNP |
denotes |
Ltd |
T13464 |
2823-2824 |
. |
denotes |
. |
T13465 |
2824-2991 |
sentence |
denotes |
For the present experiments, ADAM11-deficient male mice (backcrossed generations into C57BL/6NCrj, n = 14) were used in all behavioural analyses (22–24 weeks of age). |
T13466 |
2825-2828 |
IN |
denotes |
For |
T13468 |
2829-2832 |
DT |
denotes |
the |
T13470 |
2833-2840 |
JJ |
denotes |
present |
T13469 |
2841-2852 |
NNS |
denotes |
experiments |
T13471 |
2852-2854 |
, |
denotes |
, |
T13472 |
2854-2860 |
NN |
denotes |
ADAM11 |
T13474 |
2860-2861 |
HYPH |
denotes |
- |
T13473 |
2861-2870 |
JJ |
denotes |
deficient |
T13476 |
2871-2875 |
JJ |
denotes |
male |
T13475 |
2876-2880 |
NNS |
denotes |
mice |
T13477 |
2881-2882 |
-LRB- |
denotes |
( |
T13479 |
2882-2893 |
VBN |
denotes |
backcrossed |
T13478 |
2894-2905 |
NNS |
denotes |
generations |
T13480 |
2906-2910 |
IN |
denotes |
into |
T13481 |
2911-2916 |
NN |
denotes |
C57BL |
T13483 |
2916-2917 |
HYPH |
denotes |
/ |
T13482 |
2917-2922 |
NN |
denotes |
6NCrj |
T13484 |
2922-2924 |
, |
denotes |
, |
T13485 |
2924-2925 |
NN |
denotes |
n |
T13487 |
2926-2927 |
SYM |
denotes |
= |
T13486 |
2928-2930 |
CD |
denotes |
14 |
T13488 |
2930-2931 |
-RRB- |
denotes |
) |
T13489 |
2932-2936 |
VBD |
denotes |
were |
T13467 |
2937-2941 |
VBN |
denotes |
used |
T13490 |
2942-2944 |
IN |
denotes |
in |
T13491 |
2945-2948 |
DT |
denotes |
all |
T13493 |
2949-2960 |
JJ |
denotes |
behavioural |
T13492 |
2961-2969 |
NNS |
denotes |
analyses |
T13494 |
2970-2971 |
-LRB- |
denotes |
( |
T13496 |
2971-2973 |
CD |
denotes |
22 |
T13498 |
2973-2974 |
SYM |
denotes |
– |
T13497 |
2974-2976 |
CD |
denotes |
24 |
T13495 |
2977-2982 |
NNS |
denotes |
weeks |
T13499 |
2983-2985 |
IN |
denotes |
of |
T13500 |
2986-2989 |
NN |
denotes |
age |
T13501 |
2989-2990 |
-RRB- |
denotes |
) |
T13502 |
2990-2991 |
. |
denotes |
. |
T13503 |
2991-3122 |
sentence |
denotes |
All of the behavioural studies were conducted between 10:00 and 16:00 by a well-trained experimenter blind to the mouse genotypes. |
T13504 |
2992-2995 |
DT |
denotes |
All |
T13506 |
2996-2998 |
IN |
denotes |
of |
T13507 |
2999-3002 |
DT |
denotes |
the |
T13509 |
3003-3014 |
JJ |
denotes |
behavioural |
T13508 |
3015-3022 |
NNS |
denotes |
studies |
T13510 |
3023-3027 |
VBD |
denotes |
were |
T13505 |
3028-3037 |
VBN |
denotes |
conducted |
T13511 |
3038-3045 |
IN |
denotes |
between |
T13512 |
3046-3048 |
CD |
denotes |
10 |
T13514 |
3048-3049 |
: |
denotes |
: |
T13513 |
3049-3051 |
CD |
denotes |
00 |
T13515 |
3052-3055 |
CC |
denotes |
and |
T13516 |
3056-3058 |
CD |
denotes |
16 |
T13518 |
3058-3059 |
: |
denotes |
: |
T13517 |
3059-3061 |
CD |
denotes |
00 |
T13519 |
3062-3064 |
IN |
denotes |
by |
T13520 |
3065-3066 |
DT |
denotes |
a |
T13522 |
3067-3071 |
RB |
denotes |
well |
T13524 |
3071-3072 |
HYPH |
denotes |
- |
T13523 |
3072-3079 |
VBN |
denotes |
trained |
T13521 |
3080-3092 |
NN |
denotes |
experimenter |
T13525 |
3093-3098 |
JJ |
denotes |
blind |
T13526 |
3099-3101 |
IN |
denotes |
to |
T13527 |
3102-3105 |
DT |
denotes |
the |
T13529 |
3106-3111 |
NN |
denotes |
mouse |
T13528 |
3112-3121 |
NNS |
denotes |
genotypes |
T13530 |
3121-3122 |
. |
denotes |
. |
T13661 |
3124-3135 |
JJ |
denotes |
Spontaneous |
T13663 |
3136-3141 |
NN |
denotes |
motor |
T13662 |
3142-3150 |
NN |
denotes |
activity |
T13664 |
3150-3393 |
sentence |
denotes |
Locomotor activity in a novel environment was measured by introducing mice (+/+, +/- and -/-; n = 8, 8 and 8, respectively) for 90 min in a Plexiglas box (30 × 20 × 13 cm) using a VERSAMAX equipment and software (Accuscan, Columbus, OH, USA). |
T13665 |
3151-3160 |
NN |
denotes |
Locomotor |
T13666 |
3161-3169 |
NN |
denotes |
activity |
T13668 |
3170-3172 |
IN |
denotes |
in |
T13669 |
3173-3174 |
DT |
denotes |
a |
T13671 |
3175-3180 |
JJ |
denotes |
novel |
T13670 |
3181-3192 |
NN |
denotes |
environment |
T13672 |
3193-3196 |
VBD |
denotes |
was |
T13667 |
3197-3205 |
VBN |
denotes |
measured |
T13673 |
3206-3208 |
IN |
denotes |
by |
T13674 |
3209-3220 |
VBG |
denotes |
introducing |
T13675 |
3221-3225 |
NNS |
denotes |
mice |
T13676 |
3226-3227 |
-LRB- |
denotes |
( |
T13678 |
3227-3228 |
SYM |
denotes |
+ |
T13679 |
3228-3229 |
HYPH |
denotes |
/ |
T13677 |
3229-3230 |
SYM |
denotes |
+ |
T13680 |
3230-3232 |
, |
denotes |
, |
T13681 |
3232-3233 |
SYM |
denotes |
+ |
T13683 |
3233-3234 |
HYPH |
denotes |
/ |
T13682 |
3234-3235 |
SYM |
denotes |
- |
T13684 |
3236-3239 |
CC |
denotes |
and |
T13685 |
3240-3241 |
SYM |
denotes |
- |
T13687 |
3241-3242 |
HYPH |
denotes |
/ |
T13686 |
3242-3243 |
SYM |
denotes |
- |
T13688 |
3243-3244 |
: |
denotes |
; |
T13689 |
3245-3246 |
NN |
denotes |
n |
T13691 |
3247-3248 |
SYM |
denotes |
= |
T13690 |
3249-3250 |
CD |
denotes |
8 |
T13692 |
3250-3252 |
, |
denotes |
, |
T13693 |
3252-3253 |
CD |
denotes |
8 |
T13694 |
3254-3257 |
CC |
denotes |
and |
T13695 |
3258-3259 |
CD |
denotes |
8 |
T13696 |
3259-3261 |
, |
denotes |
, |
T13697 |
3261-3273 |
RB |
denotes |
respectively |
T13698 |
3273-3274 |
-RRB- |
denotes |
) |
T13699 |
3275-3278 |
IN |
denotes |
for |
T13700 |
3279-3281 |
CD |
denotes |
90 |
T13701 |
3282-3285 |
NN |
denotes |
min |
T13702 |
3286-3288 |
IN |
denotes |
in |
T13703 |
3289-3290 |
DT |
denotes |
a |
T13705 |
3291-3300 |
NN |
denotes |
Plexiglas |
T13704 |
3301-3304 |
NN |
denotes |
box |
T13706 |
3305-3306 |
-LRB- |
denotes |
( |
T13708 |
3306-3308 |
CD |
denotes |
30 |
T13709 |
3309-3310 |
SYM |
denotes |
× |
T13710 |
3311-3313 |
CD |
denotes |
20 |
T13711 |
3314-3315 |
SYM |
denotes |
× |
T13712 |
3316-3318 |
CD |
denotes |
13 |
T13707 |
3319-3321 |
NN |
denotes |
cm |
T13713 |
3321-3322 |
-RRB- |
denotes |
) |
T13714 |
3323-3328 |
VBG |
denotes |
using |
T13715 |
3329-3330 |
DT |
denotes |
a |
T13717 |
3331-3339 |
NNP |
denotes |
VERSAMAX |
T13716 |
3340-3349 |
NN |
denotes |
equipment |
T13718 |
3350-3353 |
CC |
denotes |
and |
T13719 |
3354-3362 |
NN |
denotes |
software |
T13720 |
3363-3364 |
-LRB- |
denotes |
( |
T13721 |
3364-3372 |
NNP |
denotes |
Accuscan |
T13722 |
3372-3374 |
, |
denotes |
, |
T13723 |
3374-3382 |
NNP |
denotes |
Columbus |
T13724 |
3382-3384 |
, |
denotes |
, |
T13725 |
3384-3386 |
NNP |
denotes |
OH |
T13726 |
3386-3388 |
, |
denotes |
, |
T13727 |
3388-3391 |
NNP |
denotes |
USA |
T13728 |
3391-3392 |
-RRB- |
denotes |
) |
T13729 |
3392-3393 |
. |
denotes |
. |
T14364 |
3395-3400 |
NN |
denotes |
Water |
T14365 |
3401-3405 |
NN |
denotes |
maze |
T14366 |
3406-3410 |
NN |
denotes |
task |
T14367 |
3410-3511 |
sentence |
denotes |
Spatial learning was assessed by three variants of the Morris water maze task [27] adapted for mice. |
T14368 |
3411-3418 |
JJ |
denotes |
Spatial |
T14369 |
3419-3427 |
NN |
denotes |
learning |
T14371 |
3428-3431 |
VBD |
denotes |
was |
T14370 |
3432-3440 |
VBN |
denotes |
assessed |
T14372 |
3441-3443 |
IN |
denotes |
by |
T14373 |
3444-3449 |
CD |
denotes |
three |
T14374 |
3450-3458 |
NNS |
denotes |
variants |
T14375 |
3459-3461 |
IN |
denotes |
of |
T14376 |
3462-3465 |
DT |
denotes |
the |
T14378 |
3466-3472 |
NNP |
denotes |
Morris |
T14379 |
3473-3478 |
NN |
denotes |
water |
T14380 |
3479-3483 |
NN |
denotes |
maze |
T14377 |
3484-3488 |
NN |
denotes |
task |
T14381 |
3489-3490 |
-LRB- |
denotes |
[ |
T14382 |
3490-3492 |
CD |
denotes |
27 |
T14383 |
3492-3493 |
-RRB- |
denotes |
] |
T14384 |
3494-3501 |
VBN |
denotes |
adapted |
T14385 |
3502-3505 |
IN |
denotes |
for |
T14386 |
3506-3510 |
NNS |
denotes |
mice |
T14387 |
3510-3511 |
. |
denotes |
. |
T14388 |
3511-3671 |
sentence |
denotes |
Hidden platform task: The pool was divided into four quadrants with four starting locations, called north, east, south and west, at equal distances to the rim. |
T14389 |
3512-3518 |
JJ |
denotes |
Hidden |
T14391 |
3519-3527 |
NN |
denotes |
platform |
T14390 |
3528-3532 |
NN |
denotes |
task |
T14393 |
3532-3534 |
: |
denotes |
: |
T14394 |
3534-3537 |
DT |
denotes |
The |
T14395 |
3538-3542 |
NN |
denotes |
pool |
T14396 |
3543-3546 |
VBD |
denotes |
was |
T14392 |
3547-3554 |
VBN |
denotes |
divided |
T14397 |
3555-3559 |
IN |
denotes |
into |
T14398 |
3560-3564 |
CD |
denotes |
four |
T14399 |
3565-3574 |
NNS |
denotes |
quadrants |
T14400 |
3575-3579 |
IN |
denotes |
with |
T14402 |
3580-3584 |
CD |
denotes |
four |
T14404 |
3585-3593 |
NN |
denotes |
starting |
T14403 |
3594-3603 |
NNS |
denotes |
locations |
T14405 |
3603-3605 |
, |
denotes |
, |
T14406 |
3605-3611 |
VBN |
denotes |
called |
T14407 |
3612-3617 |
NN |
denotes |
north |
T14408 |
3617-3619 |
, |
denotes |
, |
T14409 |
3619-3623 |
NN |
denotes |
east |
T14410 |
3623-3625 |
, |
denotes |
, |
T14411 |
3625-3630 |
NN |
denotes |
south |
T14412 |
3631-3634 |
CC |
denotes |
and |
T14413 |
3635-3639 |
NN |
denotes |
west |
T14414 |
3639-3641 |
, |
denotes |
, |
T14401 |
3641-3643 |
IN |
denotes |
at |
T14415 |
3644-3649 |
JJ |
denotes |
equal |
T14416 |
3650-3659 |
NNS |
denotes |
distances |
T14417 |
3660-3662 |
IN |
denotes |
to |
T14418 |
3663-3666 |
DT |
denotes |
the |
T14419 |
3667-3670 |
NN |
denotes |
rim |
T14420 |
3670-3671 |
. |
denotes |
. |
T14421 |
3671-3847 |
sentence |
denotes |
A circular, transparent acrylic platform (diameter 8 cm) was submerged 1 cm below the surface of the water in the centre of the southeast quadrant for each trial of this task. |
T14422 |
3672-3673 |
DT |
denotes |
A |
T14424 |
3674-3682 |
JJ |
denotes |
circular |
T14425 |
3682-3684 |
, |
denotes |
, |
T14426 |
3684-3695 |
JJ |
denotes |
transparent |
T14427 |
3696-3703 |
JJ |
denotes |
acrylic |
T14423 |
3704-3712 |
NN |
denotes |
platform |
T14429 |
3713-3714 |
-LRB- |
denotes |
( |
T14431 |
3714-3722 |
NN |
denotes |
diameter |
T14432 |
3723-3724 |
CD |
denotes |
8 |
T14430 |
3725-3727 |
NN |
denotes |
cm |
T14433 |
3727-3728 |
-RRB- |
denotes |
) |
T14434 |
3729-3732 |
VBD |
denotes |
was |
T14428 |
3733-3742 |
VBN |
denotes |
submerged |
T14435 |
3743-3744 |
CD |
denotes |
1 |
T14436 |
3745-3747 |
NN |
denotes |
cm |
T14437 |
3748-3753 |
IN |
denotes |
below |
T14438 |
3754-3757 |
DT |
denotes |
the |
T14439 |
3758-3765 |
NN |
denotes |
surface |
T14440 |
3766-3768 |
IN |
denotes |
of |
T14441 |
3769-3772 |
DT |
denotes |
the |
T14442 |
3773-3778 |
NN |
denotes |
water |
T14443 |
3779-3781 |
IN |
denotes |
in |
T14444 |
3782-3785 |
DT |
denotes |
the |
T14445 |
3786-3792 |
NN |
denotes |
centre |
T14446 |
3793-3795 |
IN |
denotes |
of |
T14447 |
3796-3799 |
DT |
denotes |
the |
T14449 |
3800-3809 |
NN |
denotes |
southeast |
T14448 |
3810-3818 |
NN |
denotes |
quadrant |
T14450 |
3819-3822 |
IN |
denotes |
for |
T14451 |
3823-3827 |
DT |
denotes |
each |
T14452 |
3828-3833 |
NN |
denotes |
trial |
T14453 |
3834-3836 |
IN |
denotes |
of |
T14454 |
3837-3841 |
DT |
denotes |
this |
T14455 |
3842-3846 |
NN |
denotes |
task |
T14456 |
3846-3847 |
. |
denotes |
. |
T14457 |
3847-3978 |
sentence |
denotes |
Each mouse was allowed to swim for 60 sec and the time required to reach the platform (escape latency) was recorded in each trial. |
T14458 |
3848-3852 |
DT |
denotes |
Each |
T14459 |
3853-3858 |
NN |
denotes |
mouse |
T14461 |
3859-3862 |
VBD |
denotes |
was |
T14460 |
3863-3870 |
VBN |
denotes |
allowed |
T14462 |
3871-3873 |
TO |
denotes |
to |
T14463 |
3874-3878 |
VB |
denotes |
swim |
T14464 |
3879-3882 |
IN |
denotes |
for |
T14465 |
3883-3885 |
CD |
denotes |
60 |
T14466 |
3886-3889 |
NN |
denotes |
sec |
T14467 |
3890-3893 |
CC |
denotes |
and |
T14468 |
3894-3897 |
DT |
denotes |
the |
T14469 |
3898-3902 |
NN |
denotes |
time |
T14471 |
3903-3911 |
VBN |
denotes |
required |
T14472 |
3912-3914 |
TO |
denotes |
to |
T14473 |
3915-3920 |
VB |
denotes |
reach |
T14474 |
3921-3924 |
DT |
denotes |
the |
T14475 |
3925-3933 |
NN |
denotes |
platform |
T14476 |
3934-3935 |
-LRB- |
denotes |
( |
T14477 |
3935-3941 |
NN |
denotes |
escape |
T14478 |
3942-3949 |
NN |
denotes |
latency |
T14479 |
3949-3950 |
-RRB- |
denotes |
) |
T14480 |
3951-3954 |
VBD |
denotes |
was |
T14470 |
3955-3963 |
VBN |
denotes |
recorded |
T14481 |
3964-3966 |
IN |
denotes |
in |
T14482 |
3967-3971 |
DT |
denotes |
each |
T14483 |
3972-3977 |
NN |
denotes |
trial |
T14484 |
3977-3978 |
. |
denotes |
. |
T14485 |
3978-4073 |
sentence |
denotes |
In total this task consisted of four trials per day over 9 days (1 min inter-trial intervals). |
T14486 |
3979-3981 |
IN |
denotes |
In |
T14488 |
3982-3987 |
JJ |
denotes |
total |
T14489 |
3988-3992 |
DT |
denotes |
this |
T14490 |
3993-3997 |
NN |
denotes |
task |
T14487 |
3998-4007 |
VBD |
denotes |
consisted |
T14491 |
4008-4010 |
IN |
denotes |
of |
T14492 |
4011-4015 |
CD |
denotes |
four |
T14493 |
4016-4022 |
NNS |
denotes |
trials |
T14494 |
4023-4026 |
IN |
denotes |
per |
T14495 |
4027-4030 |
NN |
denotes |
day |
T14496 |
4031-4035 |
IN |
denotes |
over |
T14497 |
4036-4037 |
CD |
denotes |
9 |
T14498 |
4038-4042 |
NNS |
denotes |
days |
T14499 |
4043-4044 |
-LRB- |
denotes |
( |
T14501 |
4044-4045 |
CD |
denotes |
1 |
T14502 |
4046-4049 |
NN |
denotes |
min |
T14503 |
4050-4061 |
JJ |
denotes |
inter-trial |
T14500 |
4062-4071 |
NNS |
denotes |
intervals |
T14504 |
4071-4072 |
-RRB- |
denotes |
) |
T14505 |
4072-4073 |
. |
denotes |
. |
T14506 |
4073-4167 |
sentence |
denotes |
Each trial was initiated by randomly placing an animal in one of the four starting locations. |
T14507 |
4074-4078 |
DT |
denotes |
Each |
T14508 |
4079-4084 |
NN |
denotes |
trial |
T14510 |
4085-4088 |
VBD |
denotes |
was |
T14509 |
4089-4098 |
VBN |
denotes |
initiated |
T14511 |
4099-4101 |
IN |
denotes |
by |
T14512 |
4102-4110 |
RB |
denotes |
randomly |
T14513 |
4111-4118 |
VBG |
denotes |
placing |
T14514 |
4119-4121 |
DT |
denotes |
an |
T14515 |
4122-4128 |
NN |
denotes |
animal |
T14516 |
4129-4131 |
IN |
denotes |
in |
T14517 |
4132-4135 |
CD |
denotes |
one |
T14518 |
4136-4138 |
IN |
denotes |
of |
T14519 |
4139-4142 |
DT |
denotes |
the |
T14521 |
4143-4147 |
CD |
denotes |
four |
T14522 |
4148-4156 |
NN |
denotes |
starting |
T14520 |
4157-4166 |
NNS |
denotes |
locations |
T14523 |
4166-4167 |
. |
denotes |
. |
T14524 |
4167-4268 |
sentence |
denotes |
Probe trial: A single probe trial was carried out after the hidden platform task had been completed. |
T14525 |
4168-4173 |
NN |
denotes |
Probe |
T14526 |
4174-4179 |
NN |
denotes |
trial |
T14528 |
4179-4181 |
: |
denotes |
: |
T14529 |
4181-4182 |
DT |
denotes |
A |
T14531 |
4183-4189 |
JJ |
denotes |
single |
T14532 |
4190-4195 |
NN |
denotes |
probe |
T14530 |
4196-4201 |
NN |
denotes |
trial |
T14533 |
4202-4205 |
VBD |
denotes |
was |
T14527 |
4206-4213 |
VBN |
denotes |
carried |
T14534 |
4214-4217 |
RP |
denotes |
out |
T14535 |
4218-4223 |
IN |
denotes |
after |
T14537 |
4224-4227 |
DT |
denotes |
the |
T14539 |
4228-4234 |
JJ |
denotes |
hidden |
T14540 |
4235-4243 |
NN |
denotes |
platform |
T14538 |
4244-4248 |
NN |
denotes |
task |
T14541 |
4249-4252 |
VBD |
denotes |
had |
T14542 |
4253-4257 |
VBN |
denotes |
been |
T14536 |
4258-4267 |
VBN |
denotes |
completed |
T14543 |
4267-4268 |
. |
denotes |
. |
T14544 |
4268-4448 |
sentence |
denotes |
In this trial, the platform was removed and the movement of each mouse was monitored using a computer-based video tracking system (BTA-2; Muromachi Kikai Co., Ltd., Tokyo, Japan). |
T14545 |
4269-4271 |
IN |
denotes |
In |
T14547 |
4272-4276 |
DT |
denotes |
this |
T14548 |
4277-4282 |
NN |
denotes |
trial |
T14549 |
4282-4284 |
, |
denotes |
, |
T14550 |
4284-4287 |
DT |
denotes |
the |
T14551 |
4288-4296 |
NN |
denotes |
platform |
T14552 |
4297-4300 |
VBD |
denotes |
was |
T14546 |
4301-4308 |
VBN |
denotes |
removed |
T14553 |
4309-4312 |
CC |
denotes |
and |
T14554 |
4313-4316 |
DT |
denotes |
the |
T14555 |
4317-4325 |
NN |
denotes |
movement |
T14557 |
4326-4328 |
IN |
denotes |
of |
T14558 |
4329-4333 |
DT |
denotes |
each |
T14559 |
4334-4339 |
NN |
denotes |
mouse |
T14560 |
4340-4343 |
VBD |
denotes |
was |
T14556 |
4344-4353 |
VBN |
denotes |
monitored |
T14561 |
4354-4359 |
VBG |
denotes |
using |
T14562 |
4360-4361 |
DT |
denotes |
a |
T14564 |
4362-4370 |
NN |
denotes |
computer |
T14566 |
4370-4371 |
HYPH |
denotes |
- |
T14565 |
4371-4376 |
VBN |
denotes |
based |
T14567 |
4377-4382 |
NN |
denotes |
video |
T14568 |
4383-4391 |
NN |
denotes |
tracking |
T14563 |
4392-4398 |
NN |
denotes |
system |
T14569 |
4399-4400 |
-LRB- |
denotes |
( |
T14571 |
4400-4403 |
NN |
denotes |
BTA |
T14572 |
4403-4404 |
HYPH |
denotes |
- |
T14573 |
4404-4405 |
CD |
denotes |
2 |
T14574 |
4405-4406 |
: |
denotes |
; |
T14575 |
4407-4416 |
NNP |
denotes |
Muromachi |
T14576 |
4417-4422 |
NNP |
denotes |
Kikai |
T14570 |
4423-4426 |
NNP |
denotes |
Co. |
T14577 |
4426-4428 |
, |
denotes |
, |
T14578 |
4428-4432 |
NNP |
denotes |
Ltd. |
T14579 |
4432-4434 |
, |
denotes |
, |
T14580 |
4434-4439 |
NNP |
denotes |
Tokyo |
T14581 |
4439-4441 |
, |
denotes |
, |
T14582 |
4441-4446 |
NNP |
denotes |
Japan |
T14583 |
4446-4447 |
-RRB- |
denotes |
) |
T14584 |
4447-4448 |
. |
denotes |
. |
T14585 |
4448-4542 |
sentence |
denotes |
Each mouse was placed into the northwest quadrant of the pool and allowed to swim for 60 sec. |
T14586 |
4449-4453 |
DT |
denotes |
Each |
T14587 |
4454-4459 |
NN |
denotes |
mouse |
T14589 |
4460-4463 |
VBD |
denotes |
was |
T14588 |
4464-4470 |
VBN |
denotes |
placed |
T14590 |
4471-4475 |
IN |
denotes |
into |
T14591 |
4476-4479 |
DT |
denotes |
the |
T14593 |
4480-4489 |
NN |
denotes |
northwest |
T14592 |
4490-4498 |
NN |
denotes |
quadrant |
T14594 |
4499-4501 |
IN |
denotes |
of |
T14595 |
4502-4505 |
DT |
denotes |
the |
T14596 |
4506-4510 |
NN |
denotes |
pool |
T14597 |
4511-4514 |
CC |
denotes |
and |
T14598 |
4515-4522 |
VBN |
denotes |
allowed |
T14599 |
4523-4525 |
TO |
denotes |
to |
T14600 |
4526-4530 |
VB |
denotes |
swim |
T14601 |
4531-4534 |
IN |
denotes |
for |
T14602 |
4535-4537 |
CD |
denotes |
60 |
T14603 |
4538-4541 |
NN |
denotes |
sec |
T14604 |
4541-4542 |
. |
denotes |
. |
T14605 |
4542-4631 |
sentence |
denotes |
Swim path length and the time spent in the trained (southeast) quadrant were calculated. |
T14606 |
4543-4547 |
NN |
denotes |
Swim |
T14607 |
4548-4552 |
NN |
denotes |
path |
T14608 |
4553-4559 |
NN |
denotes |
length |
T14610 |
4560-4563 |
CC |
denotes |
and |
T14611 |
4564-4567 |
DT |
denotes |
the |
T14612 |
4568-4572 |
NN |
denotes |
time |
T14613 |
4573-4578 |
VBN |
denotes |
spent |
T14614 |
4579-4581 |
IN |
denotes |
in |
T14615 |
4582-4585 |
DT |
denotes |
the |
T14617 |
4586-4593 |
VBN |
denotes |
trained |
T14618 |
4594-4595 |
-LRB- |
denotes |
( |
T14619 |
4595-4604 |
NN |
denotes |
southeast |
T14620 |
4604-4605 |
-RRB- |
denotes |
) |
T14616 |
4606-4614 |
NN |
denotes |
quadrant |
T14621 |
4615-4619 |
VBD |
denotes |
were |
T14609 |
4620-4630 |
VBN |
denotes |
calculated |
T14622 |
4630-4631 |
. |
denotes |
. |
T14623 |
4631-4799 |
sentence |
denotes |
Visible platform task: In this task, the circular platform was made visible by attaching a black board to it and the mouse was required to locate the visible platform. |
T14624 |
4632-4639 |
JJ |
denotes |
Visible |
T14626 |
4640-4648 |
NN |
denotes |
platform |
T14625 |
4649-4653 |
NN |
denotes |
task |
T14628 |
4653-4655 |
: |
denotes |
: |
T14629 |
4655-4657 |
IN |
denotes |
In |
T14630 |
4658-4662 |
DT |
denotes |
this |
T14631 |
4663-4667 |
NN |
denotes |
task |
T14632 |
4667-4669 |
, |
denotes |
, |
T14633 |
4669-4672 |
DT |
denotes |
the |
T14635 |
4673-4681 |
JJ |
denotes |
circular |
T14634 |
4682-4690 |
NN |
denotes |
platform |
T14636 |
4691-4694 |
VBD |
denotes |
was |
T14627 |
4695-4699 |
VBN |
denotes |
made |
T14637 |
4700-4707 |
JJ |
denotes |
visible |
T14638 |
4708-4710 |
IN |
denotes |
by |
T14639 |
4711-4720 |
VBG |
denotes |
attaching |
T14640 |
4721-4722 |
DT |
denotes |
a |
T14642 |
4723-4728 |
JJ |
denotes |
black |
T14641 |
4729-4734 |
NN |
denotes |
board |
T14643 |
4735-4737 |
IN |
denotes |
to |
T14644 |
4738-4740 |
PRP |
denotes |
it |
T14645 |
4741-4744 |
CC |
denotes |
and |
T14646 |
4745-4748 |
DT |
denotes |
the |
T14647 |
4749-4754 |
NN |
denotes |
mouse |
T14649 |
4755-4758 |
VBD |
denotes |
was |
T14648 |
4759-4767 |
VBN |
denotes |
required |
T14650 |
4768-4770 |
TO |
denotes |
to |
T14651 |
4771-4777 |
VB |
denotes |
locate |
T14652 |
4778-4781 |
DT |
denotes |
the |
T14654 |
4782-4789 |
JJ |
denotes |
visible |
T14653 |
4790-4798 |
NN |
denotes |
platform |
T14655 |
4798-4799 |
. |
denotes |
. |
T14656 |
4799-4945 |
sentence |
denotes |
The mouse was allowed to swim for 60 sec and this task consisted of four trials per day for three consecutive days (1 min inter-trial intervals). |
T14657 |
4800-4803 |
DT |
denotes |
The |
T14658 |
4804-4809 |
NN |
denotes |
mouse |
T14660 |
4810-4813 |
VBD |
denotes |
was |
T14659 |
4814-4821 |
VBN |
denotes |
allowed |
T14661 |
4822-4824 |
TO |
denotes |
to |
T14662 |
4825-4829 |
VB |
denotes |
swim |
T14663 |
4830-4833 |
IN |
denotes |
for |
T14664 |
4834-4836 |
CD |
denotes |
60 |
T14665 |
4837-4840 |
NN |
denotes |
sec |
T14666 |
4841-4844 |
CC |
denotes |
and |
T14667 |
4845-4849 |
DT |
denotes |
this |
T14668 |
4850-4854 |
NN |
denotes |
task |
T14669 |
4855-4864 |
VBD |
denotes |
consisted |
T14670 |
4865-4867 |
IN |
denotes |
of |
T14671 |
4868-4872 |
CD |
denotes |
four |
T14672 |
4873-4879 |
NNS |
denotes |
trials |
T14673 |
4880-4883 |
IN |
denotes |
per |
T14674 |
4884-4887 |
NN |
denotes |
day |
T14675 |
4888-4891 |
IN |
denotes |
for |
T14676 |
4892-4897 |
CD |
denotes |
three |
T14678 |
4898-4909 |
JJ |
denotes |
consecutive |
T14677 |
4910-4914 |
NNS |
denotes |
days |
T14679 |
4915-4916 |
-LRB- |
denotes |
( |
T14681 |
4916-4917 |
CD |
denotes |
1 |
T14682 |
4918-4921 |
NN |
denotes |
min |
T14683 |
4922-4933 |
JJ |
denotes |
inter-trial |
T14680 |
4934-4943 |
NNS |
denotes |
intervals |
T14684 |
4943-4944 |
-RRB- |
denotes |
) |
T14685 |
4944-4945 |
. |
denotes |
. |
T14686 |
4945-5039 |
sentence |
denotes |
Each trial was initiated by randomly placing an animal in one of the four starting locations. |
T14687 |
4946-4950 |
DT |
denotes |
Each |
T14688 |
4951-4956 |
NN |
denotes |
trial |
T14690 |
4957-4960 |
VBD |
denotes |
was |
T14689 |
4961-4970 |
VBN |
denotes |
initiated |
T14691 |
4971-4973 |
IN |
denotes |
by |
T14692 |
4974-4982 |
RB |
denotes |
randomly |
T14693 |
4983-4990 |
VBG |
denotes |
placing |
T14694 |
4991-4993 |
DT |
denotes |
an |
T14695 |
4994-5000 |
NN |
denotes |
animal |
T14696 |
5001-5003 |
IN |
denotes |
in |
T14697 |
5004-5007 |
CD |
denotes |
one |
T14698 |
5008-5010 |
IN |
denotes |
of |
T14699 |
5011-5014 |
DT |
denotes |
the |
T14701 |
5015-5019 |
CD |
denotes |
four |
T14702 |
5020-5028 |
NN |
denotes |
starting |
T14700 |
5029-5038 |
NNS |
denotes |
locations |
T14703 |
5038-5039 |
. |
denotes |
. |
T14924 |
5041-5049 |
VBG |
denotes |
Rotating |
T14925 |
5050-5053 |
NN |
denotes |
rod |
T14926 |
5054-5058 |
NN |
denotes |
test |
T14927 |
5058-5290 |
sentence |
denotes |
Motor coordination was assessed with a rotating rod apparatus (KN-75, Natsume Seisakujo, Tokyo, Japan), which consisted of a plastic rod (3 cm diameter, 8 cm long) with a gritted surface flanked by two large discs (40 cm diameter). |
T14928 |
5059-5064 |
NN |
denotes |
Motor |
T14929 |
5065-5077 |
NN |
denotes |
coordination |
T14931 |
5078-5081 |
VBD |
denotes |
was |
T14930 |
5082-5090 |
VBN |
denotes |
assessed |
T14932 |
5091-5095 |
IN |
denotes |
with |
T14933 |
5096-5097 |
DT |
denotes |
a |
T14935 |
5098-5106 |
VBG |
denotes |
rotating |
T14936 |
5107-5110 |
NN |
denotes |
rod |
T14934 |
5111-5120 |
NN |
denotes |
apparatus |
T14937 |
5121-5122 |
-LRB- |
denotes |
( |
T14939 |
5122-5124 |
NN |
denotes |
KN |
T14940 |
5124-5125 |
HYPH |
denotes |
- |
T14941 |
5125-5127 |
CD |
denotes |
75 |
T14942 |
5127-5129 |
, |
denotes |
, |
T14943 |
5129-5136 |
NNP |
denotes |
Natsume |
T14938 |
5137-5146 |
NNP |
denotes |
Seisakujo |
T14944 |
5146-5148 |
, |
denotes |
, |
T14945 |
5148-5153 |
NNP |
denotes |
Tokyo |
T14946 |
5153-5155 |
, |
denotes |
, |
T14947 |
5155-5160 |
NNP |
denotes |
Japan |
T14948 |
5160-5161 |
-RRB- |
denotes |
) |
T14949 |
5161-5163 |
, |
denotes |
, |
T14950 |
5163-5168 |
WDT |
denotes |
which |
T14951 |
5169-5178 |
VBD |
denotes |
consisted |
T14952 |
5179-5181 |
IN |
denotes |
of |
T14953 |
5182-5183 |
DT |
denotes |
a |
T14955 |
5184-5191 |
NN |
denotes |
plastic |
T14954 |
5192-5195 |
NN |
denotes |
rod |
T14956 |
5196-5197 |
-LRB- |
denotes |
( |
T14958 |
5197-5198 |
CD |
denotes |
3 |
T14959 |
5199-5201 |
NN |
denotes |
cm |
T14957 |
5202-5210 |
NN |
denotes |
diameter |
T14960 |
5210-5212 |
, |
denotes |
, |
T14961 |
5212-5213 |
CD |
denotes |
8 |
T14962 |
5214-5216 |
NN |
denotes |
cm |
T14963 |
5217-5221 |
JJ |
denotes |
long |
T14964 |
5221-5222 |
-RRB- |
denotes |
) |
T14965 |
5223-5227 |
IN |
denotes |
with |
T14966 |
5228-5229 |
DT |
denotes |
a |
T14968 |
5230-5237 |
JJ |
denotes |
gritted |
T14967 |
5238-5245 |
NN |
denotes |
surface |
T14969 |
5246-5253 |
VBN |
denotes |
flanked |
T14970 |
5254-5256 |
IN |
denotes |
by |
T14971 |
5257-5260 |
CD |
denotes |
two |
T14973 |
5261-5266 |
JJ |
denotes |
large |
T14972 |
5267-5272 |
NNS |
denotes |
discs |
T14974 |
5273-5274 |
-LRB- |
denotes |
( |
T14976 |
5274-5276 |
CD |
denotes |
40 |
T14977 |
5277-5279 |
NN |
denotes |
cm |
T14975 |
5280-5288 |
NN |
denotes |
diameter |
T14978 |
5288-5289 |
-RRB- |
denotes |
) |
T14979 |
5289-5290 |
. |
denotes |
. |
T14980 |
5290-5474 |
sentence |
denotes |
The mice were first placed on the stationary rod for 4 successive trials, followed by 4 trials at a rotation speed of 5 rpm, 8 trials at 10 rpm, and 20 trials at 15 rpm in that order. |
T14981 |
5291-5294 |
DT |
denotes |
The |
T14982 |
5295-5299 |
NNS |
denotes |
mice |
T14984 |
5300-5304 |
VBD |
denotes |
were |
T14985 |
5305-5310 |
RB |
denotes |
first |
T14983 |
5311-5317 |
VBN |
denotes |
placed |
T14986 |
5318-5320 |
IN |
denotes |
on |
T14987 |
5321-5324 |
DT |
denotes |
the |
T14989 |
5325-5335 |
JJ |
denotes |
stationary |
T14988 |
5336-5339 |
NN |
denotes |
rod |
T14990 |
5340-5343 |
IN |
denotes |
for |
T14991 |
5344-5345 |
CD |
denotes |
4 |
T14993 |
5346-5356 |
JJ |
denotes |
successive |
T14992 |
5357-5363 |
NNS |
denotes |
trials |
T14994 |
5363-5365 |
, |
denotes |
, |
T14995 |
5365-5373 |
VBN |
denotes |
followed |
T14996 |
5374-5376 |
IN |
denotes |
by |
T14997 |
5377-5378 |
CD |
denotes |
4 |
T14998 |
5379-5385 |
NNS |
denotes |
trials |
T14999 |
5386-5388 |
IN |
denotes |
at |
T15000 |
5389-5390 |
DT |
denotes |
a |
T15002 |
5391-5399 |
NN |
denotes |
rotation |
T15001 |
5400-5405 |
NN |
denotes |
speed |
T15003 |
5406-5408 |
IN |
denotes |
of |
T15004 |
5409-5410 |
CD |
denotes |
5 |
T15005 |
5411-5414 |
NN |
denotes |
rpm |
T15006 |
5414-5416 |
, |
denotes |
, |
T15007 |
5416-5417 |
CD |
denotes |
8 |
T15008 |
5418-5424 |
NNS |
denotes |
trials |
T15009 |
5425-5427 |
IN |
denotes |
at |
T15010 |
5428-5430 |
CD |
denotes |
10 |
T15011 |
5431-5434 |
NN |
denotes |
rpm |
T15012 |
5434-5436 |
, |
denotes |
, |
T15013 |
5436-5439 |
CC |
denotes |
and |
T15014 |
5440-5442 |
CD |
denotes |
20 |
T15015 |
5443-5449 |
NNS |
denotes |
trials |
T15016 |
5450-5452 |
IN |
denotes |
at |
T15017 |
5453-5455 |
CD |
denotes |
15 |
T15018 |
5456-5459 |
NN |
denotes |
rpm |
T15019 |
5460-5462 |
IN |
denotes |
in |
T15020 |
5463-5467 |
DT |
denotes |
that |
T15021 |
5468-5473 |
NN |
denotes |
order |
T15022 |
5473-5474 |
. |
denotes |
. |
T15023 |
5474-5531 |
sentence |
denotes |
Latency until a fall occurred was monitored for 120 sec. |
T15024 |
5475-5482 |
NN |
denotes |
Latency |
T15026 |
5483-5488 |
IN |
denotes |
until |
T15028 |
5489-5490 |
DT |
denotes |
a |
T15029 |
5491-5495 |
NN |
denotes |
fall |
T15027 |
5496-5504 |
VBD |
denotes |
occurred |
T15030 |
5505-5508 |
VBD |
denotes |
was |
T15025 |
5509-5518 |
VBN |
denotes |
monitored |
T15031 |
5519-5522 |
IN |
denotes |
for |
T15032 |
5523-5526 |
CD |
denotes |
120 |
T15033 |
5527-5530 |
NN |
denotes |
sec |
T15034 |
5530-5531 |
. |
denotes |
. |
T15035 |
5531-5592 |
sentence |
denotes |
Intra-trial intervals for each animal were more than 20 min. |
T15036 |
5532-5543 |
JJ |
denotes |
Intra-trial |
T15037 |
5544-5553 |
NNS |
denotes |
intervals |
T15039 |
5554-5557 |
IN |
denotes |
for |
T15040 |
5558-5562 |
DT |
denotes |
each |
T15041 |
5563-5569 |
NN |
denotes |
animal |
T15038 |
5570-5574 |
VBD |
denotes |
were |
T15042 |
5575-5579 |
JJR |
denotes |
more |
T15044 |
5580-5584 |
IN |
denotes |
than |
T15043 |
5585-5587 |
CD |
denotes |
20 |
T15045 |
5588-5591 |
NN |
denotes |
min |
T15046 |
5591-5592 |
. |
denotes |
. |
T15164 |
5594-5602 |
NN |
denotes |
Traction |
T15165 |
5603-5607 |
NN |
denotes |
test |
T15166 |
5607-5713 |
sentence |
denotes |
The grip strength of each mouse was measured with a traction apparatus (FU-1, Muromachi Kikai Co., Ltd.). |
T15167 |
5608-5611 |
DT |
denotes |
The |
T15169 |
5612-5616 |
NN |
denotes |
grip |
T15168 |
5617-5625 |
NN |
denotes |
strength |
T15171 |
5626-5628 |
IN |
denotes |
of |
T15172 |
5629-5633 |
DT |
denotes |
each |
T15173 |
5634-5639 |
NN |
denotes |
mouse |
T15174 |
5640-5643 |
VBD |
denotes |
was |
T15170 |
5644-5652 |
VBN |
denotes |
measured |
T15175 |
5653-5657 |
IN |
denotes |
with |
T15176 |
5658-5659 |
DT |
denotes |
a |
T15178 |
5660-5668 |
NN |
denotes |
traction |
T15177 |
5669-5678 |
NN |
denotes |
apparatus |
T15179 |
5679-5680 |
-LRB- |
denotes |
( |
T15181 |
5680-5682 |
NN |
denotes |
FU |
T15182 |
5682-5683 |
HYPH |
denotes |
- |
T15183 |
5683-5684 |
CD |
denotes |
1 |
T15184 |
5684-5686 |
, |
denotes |
, |
T15185 |
5686-5695 |
NNP |
denotes |
Muromachi |
T15186 |
5696-5701 |
NNP |
denotes |
Kikai |
T15180 |
5702-5705 |
NNP |
denotes |
Co. |
T15187 |
5705-5707 |
, |
denotes |
, |
T15188 |
5707-5711 |
NNP |
denotes |
Ltd. |
T15189 |
5711-5712 |
-RRB- |
denotes |
) |
T15190 |
5712-5713 |
. |
denotes |
. |
T15191 |
5713-5833 |
sentence |
denotes |
Each mouse was made to grasp the attached bar (2 mm diameter) with the forepaws and was slowly pulled back by the tail. |
T15192 |
5714-5718 |
DT |
denotes |
Each |
T15193 |
5719-5724 |
NN |
denotes |
mouse |
T15195 |
5725-5728 |
VBD |
denotes |
was |
T15194 |
5729-5733 |
VBN |
denotes |
made |
T15196 |
5734-5736 |
TO |
denotes |
to |
T15197 |
5737-5742 |
VB |
denotes |
grasp |
T15198 |
5743-5746 |
DT |
denotes |
the |
T15200 |
5747-5755 |
VBN |
denotes |
attached |
T15199 |
5756-5759 |
NN |
denotes |
bar |
T15201 |
5760-5761 |
-LRB- |
denotes |
( |
T15203 |
5761-5762 |
CD |
denotes |
2 |
T15204 |
5763-5765 |
NN |
denotes |
mm |
T15202 |
5766-5774 |
NN |
denotes |
diameter |
T15205 |
5774-5775 |
-RRB- |
denotes |
) |
T15206 |
5776-5780 |
IN |
denotes |
with |
T15207 |
5781-5784 |
DT |
denotes |
the |
T15208 |
5785-5793 |
NNS |
denotes |
forepaws |
T15209 |
5794-5797 |
CC |
denotes |
and |
T15210 |
5798-5801 |
VBD |
denotes |
was |
T15212 |
5802-5808 |
RB |
denotes |
slowly |
T15211 |
5809-5815 |
VBN |
denotes |
pulled |
T15213 |
5816-5820 |
RB |
denotes |
back |
T15214 |
5821-5823 |
IN |
denotes |
by |
T15215 |
5824-5827 |
DT |
denotes |
the |
T15216 |
5828-5832 |
NN |
denotes |
tail |
T15217 |
5832-5833 |
. |
denotes |
. |
T15218 |
5833-5882 |
sentence |
denotes |
The maximum tension before release was recorded. |
T15219 |
5834-5837 |
DT |
denotes |
The |
T15221 |
5838-5845 |
JJ |
denotes |
maximum |
T15220 |
5846-5853 |
NN |
denotes |
tension |
T15223 |
5854-5860 |
IN |
denotes |
before |
T15224 |
5861-5868 |
NN |
denotes |
release |
T15225 |
5869-5872 |
VBD |
denotes |
was |
T15222 |
5873-5881 |
VBN |
denotes |
recorded |
T15226 |
5881-5882 |
. |
denotes |
. |
T15486 |
5884-5888 |
NN |
denotes |
Wire |
T15487 |
5889-5899 |
NN |
denotes |
suspension |
T15488 |
5900-5904 |
NN |
denotes |
test |
T15489 |
5904-6097 |
sentence |
denotes |
A mouse was placed on a stainless bar (50 cm length, 2 mm diameter, elevated up to 37 cm from a surface) at a point midway between the supports and observed for 30 sec in four separate trials. |
T15490 |
5905-5906 |
DT |
denotes |
A |
T15491 |
5907-5912 |
NN |
denotes |
mouse |
T15493 |
5913-5916 |
VBD |
denotes |
was |
T15492 |
5917-5923 |
VBN |
denotes |
placed |
T15494 |
5924-5926 |
IN |
denotes |
on |
T15495 |
5927-5928 |
DT |
denotes |
a |
T15497 |
5929-5938 |
JJ |
denotes |
stainless |
T15496 |
5939-5942 |
NN |
denotes |
bar |
T15498 |
5943-5944 |
-LRB- |
denotes |
( |
T15500 |
5944-5946 |
CD |
denotes |
50 |
T15501 |
5947-5949 |
NN |
denotes |
cm |
T15502 |
5950-5956 |
NN |
denotes |
length |
T15503 |
5956-5958 |
, |
denotes |
, |
T15504 |
5958-5959 |
CD |
denotes |
2 |
T15505 |
5960-5962 |
NN |
denotes |
mm |
T15499 |
5963-5971 |
NN |
denotes |
diameter |
T15506 |
5971-5973 |
, |
denotes |
, |
T15507 |
5973-5981 |
VBN |
denotes |
elevated |
T15508 |
5982-5984 |
RB |
denotes |
up |
T15510 |
5985-5987 |
IN |
denotes |
to |
T15509 |
5988-5990 |
CD |
denotes |
37 |
T15511 |
5991-5993 |
NN |
denotes |
cm |
T15512 |
5994-5998 |
IN |
denotes |
from |
T15513 |
5999-6000 |
DT |
denotes |
a |
T15514 |
6001-6008 |
NN |
denotes |
surface |
T15515 |
6008-6009 |
-RRB- |
denotes |
) |
T15516 |
6010-6012 |
IN |
denotes |
at |
T15517 |
6013-6014 |
DT |
denotes |
a |
T15519 |
6015-6020 |
NN |
denotes |
point |
T15518 |
6021-6027 |
NN |
denotes |
midway |
T15520 |
6028-6035 |
IN |
denotes |
between |
T15521 |
6036-6039 |
DT |
denotes |
the |
T15522 |
6040-6048 |
NNS |
denotes |
supports |
T15523 |
6049-6052 |
CC |
denotes |
and |
T15524 |
6053-6061 |
VBN |
denotes |
observed |
T15525 |
6062-6065 |
IN |
denotes |
for |
T15526 |
6066-6068 |
CD |
denotes |
30 |
T15527 |
6069-6072 |
NN |
denotes |
sec |
T15528 |
6073-6075 |
IN |
denotes |
in |
T15529 |
6076-6080 |
CD |
denotes |
four |
T15531 |
6081-6089 |
JJ |
denotes |
separate |
T15530 |
6090-6096 |
NNS |
denotes |
trials |
T15532 |
6096-6097 |
. |
denotes |
. |
T15533 |
6097-6476 |
sentence |
denotes |
The amount of time spent hanging was recorded and scored according to the following system [41]: 0, fell off; 1, hung onto the bar with two forepaws; 2, in addition to 1, attempted to climb onto the bar; 3, hung onto the bar with two forepaws and one or both hind paws; 4, hung onto the bar with all four paws with tail wrapped around the bar; 5, escaped to one of the supports. |
T15534 |
6098-6101 |
DT |
denotes |
The |
T15535 |
6102-6108 |
NN |
denotes |
amount |
T15537 |
6109-6111 |
IN |
denotes |
of |
T15538 |
6112-6116 |
NN |
denotes |
time |
T15539 |
6117-6122 |
VBN |
denotes |
spent |
T15540 |
6123-6130 |
VBG |
denotes |
hanging |
T15541 |
6131-6134 |
VBD |
denotes |
was |
T15536 |
6135-6143 |
VBN |
denotes |
recorded |
T15542 |
6144-6147 |
CC |
denotes |
and |
T15543 |
6148-6154 |
VBN |
denotes |
scored |
T15544 |
6155-6164 |
VBG |
denotes |
according |
T15545 |
6165-6167 |
IN |
denotes |
to |
T15546 |
6168-6171 |
DT |
denotes |
the |
T15548 |
6172-6181 |
VBG |
denotes |
following |
T15547 |
6182-6188 |
NN |
denotes |
system |
T15549 |
6189-6190 |
-LRB- |
denotes |
[ |
T15550 |
6190-6192 |
CD |
denotes |
41 |
T15551 |
6192-6193 |
-RRB- |
denotes |
] |
T15552 |
6193-6195 |
: |
denotes |
: |
T15553 |
6195-6196 |
CD |
denotes |
0 |
T15555 |
6196-6198 |
, |
denotes |
, |
T15554 |
6198-6202 |
VBD |
denotes |
fell |
T15557 |
6203-6206 |
RP |
denotes |
off |
T15558 |
6206-6207 |
: |
denotes |
; |
T15559 |
6208-6209 |
CD |
denotes |
1 |
T15561 |
6209-6211 |
, |
denotes |
, |
T15560 |
6211-6215 |
VBD |
denotes |
hung |
T15562 |
6216-6220 |
IN |
denotes |
onto |
T15563 |
6221-6224 |
DT |
denotes |
the |
T15564 |
6225-6228 |
NN |
denotes |
bar |
T15565 |
6229-6233 |
IN |
denotes |
with |
T15566 |
6234-6237 |
CD |
denotes |
two |
T15567 |
6238-6246 |
NNS |
denotes |
forepaws |
T15568 |
6246-6247 |
: |
denotes |
; |
T15569 |
6248-6249 |
CD |
denotes |
2 |
T15571 |
6249-6251 |
, |
denotes |
, |
T15572 |
6251-6253 |
IN |
denotes |
in |
T15573 |
6254-6262 |
NN |
denotes |
addition |
T15574 |
6263-6265 |
IN |
denotes |
to |
T15575 |
6266-6267 |
CD |
denotes |
1 |
T15576 |
6267-6269 |
, |
denotes |
, |
T15570 |
6269-6278 |
VBD |
denotes |
attempted |
T15577 |
6279-6281 |
TO |
denotes |
to |
T15578 |
6282-6287 |
VB |
denotes |
climb |
T15579 |
6288-6292 |
IN |
denotes |
onto |
T15580 |
6293-6296 |
DT |
denotes |
the |
T15581 |
6297-6300 |
NN |
denotes |
bar |
T15582 |
6300-6301 |
: |
denotes |
; |
T15583 |
6302-6303 |
CD |
denotes |
3 |
T15585 |
6303-6305 |
, |
denotes |
, |
T15584 |
6305-6309 |
VBD |
denotes |
hung |
T15586 |
6310-6314 |
IN |
denotes |
onto |
T15587 |
6315-6318 |
DT |
denotes |
the |
T15588 |
6319-6322 |
NN |
denotes |
bar |
T15589 |
6323-6327 |
IN |
denotes |
with |
T15590 |
6328-6331 |
CD |
denotes |
two |
T15591 |
6332-6340 |
NNS |
denotes |
forepaws |
T15592 |
6341-6344 |
CC |
denotes |
and |
T15593 |
6345-6348 |
CD |
denotes |
one |
T15595 |
6349-6351 |
CC |
denotes |
or |
T15596 |
6352-6356 |
CC |
denotes |
both |
T15597 |
6357-6361 |
NN |
denotes |
hind |
T15594 |
6362-6366 |
NNS |
denotes |
paws |
T15598 |
6366-6367 |
: |
denotes |
; |
T15599 |
6368-6369 |
CD |
denotes |
4 |
T15601 |
6369-6371 |
, |
denotes |
, |
T15600 |
6371-6375 |
VBD |
denotes |
hung |
T15602 |
6376-6380 |
IN |
denotes |
onto |
T15603 |
6381-6384 |
DT |
denotes |
the |
T15604 |
6385-6388 |
NN |
denotes |
bar |
T15605 |
6389-6393 |
IN |
denotes |
with |
T15606 |
6394-6397 |
DT |
denotes |
all |
T15608 |
6398-6402 |
CD |
denotes |
four |
T15607 |
6403-6407 |
NNS |
denotes |
paws |
T15609 |
6408-6412 |
IN |
denotes |
with |
T15610 |
6413-6417 |
NN |
denotes |
tail |
T15611 |
6418-6425 |
VBN |
denotes |
wrapped |
T15612 |
6426-6432 |
IN |
denotes |
around |
T15613 |
6433-6436 |
DT |
denotes |
the |
T15614 |
6437-6440 |
NN |
denotes |
bar |
T15615 |
6440-6441 |
: |
denotes |
; |
T15616 |
6442-6443 |
CD |
denotes |
5 |
T15617 |
6443-6445 |
, |
denotes |
, |
T15556 |
6445-6452 |
VBD |
denotes |
escaped |
T15618 |
6453-6455 |
IN |
denotes |
to |
T15619 |
6456-6459 |
CD |
denotes |
one |
T15620 |
6460-6462 |
IN |
denotes |
of |
T15621 |
6463-6466 |
DT |
denotes |
the |
T15622 |
6467-6475 |
NNS |
denotes |
supports |
T15623 |
6475-6476 |
. |
denotes |
. |
T15705 |
6478-6487 |
NN |
denotes |
Footprint |
T15706 |
6488-6492 |
NN |
denotes |
test |
T15707 |
6492-6621 |
sentence |
denotes |
Black ink was applied to the hind paws of each mouse and the mice were placed in a narrow alley (9 × 25 × 10 cm) on white paper. |
T15708 |
6493-6498 |
JJ |
denotes |
Black |
T15709 |
6499-6502 |
NN |
denotes |
ink |
T15711 |
6503-6506 |
VBD |
denotes |
was |
T15710 |
6507-6514 |
VBN |
denotes |
applied |
T15712 |
6515-6517 |
IN |
denotes |
to |
T15713 |
6518-6521 |
DT |
denotes |
the |
T15715 |
6522-6526 |
NN |
denotes |
hind |
T15714 |
6527-6531 |
NNS |
denotes |
paws |
T15716 |
6532-6534 |
IN |
denotes |
of |
T15717 |
6535-6539 |
DT |
denotes |
each |
T15718 |
6540-6545 |
NN |
denotes |
mouse |
T15719 |
6546-6549 |
CC |
denotes |
and |
T15720 |
6550-6553 |
DT |
denotes |
the |
T15721 |
6554-6558 |
NNS |
denotes |
mice |
T15723 |
6559-6563 |
VBD |
denotes |
were |
T15722 |
6564-6570 |
VBN |
denotes |
placed |
T15724 |
6571-6573 |
IN |
denotes |
in |
T15725 |
6574-6575 |
DT |
denotes |
a |
T15727 |
6576-6582 |
JJ |
denotes |
narrow |
T15726 |
6583-6588 |
NN |
denotes |
alley |
T15728 |
6589-6590 |
-LRB- |
denotes |
( |
T15730 |
6590-6591 |
CD |
denotes |
9 |
T15732 |
6592-6593 |
SYM |
denotes |
× |
T15733 |
6594-6596 |
CD |
denotes |
25 |
T15734 |
6597-6598 |
SYM |
denotes |
× |
T15731 |
6599-6601 |
CD |
denotes |
10 |
T15729 |
6602-6604 |
NN |
denotes |
cm |
T15735 |
6604-6605 |
-RRB- |
denotes |
) |
T15736 |
6606-6608 |
IN |
denotes |
on |
T15737 |
6609-6614 |
JJ |
denotes |
white |
T15738 |
6615-6620 |
NN |
denotes |
paper |
T15739 |
6620-6621 |
. |
denotes |
. |
T15740 |
6621-6667 |
sentence |
denotes |
Stride length and step width were calculated. |
T15741 |
6622-6628 |
NN |
denotes |
Stride |
T15742 |
6629-6635 |
NN |
denotes |
length |
T15744 |
6636-6639 |
CC |
denotes |
and |
T15745 |
6640-6644 |
NN |
denotes |
step |
T15746 |
6645-6650 |
NN |
denotes |
width |
T15747 |
6651-6655 |
VBD |
denotes |
were |
T15743 |
6656-6666 |
VBN |
denotes |
calculated |
T15748 |
6666-6667 |
. |
denotes |
. |
T15949 |
6669-6679 |
NNS |
denotes |
Statistics |
T15950 |
6679-6718 |
sentence |
denotes |
Data are expressed as the means ± SEM. |
T15951 |
6680-6684 |
NNS |
denotes |
Data |
T15953 |
6685-6688 |
VBP |
denotes |
are |
T15952 |
6689-6698 |
VBN |
denotes |
expressed |
T15954 |
6699-6701 |
IN |
denotes |
as |
T15955 |
6702-6705 |
DT |
denotes |
the |
T15957 |
6706-6711 |
NNS |
denotes |
means |
T15958 |
6712-6713 |
SYM |
denotes |
± |
T15956 |
6714-6717 |
NN |
denotes |
SEM |
T15959 |
6717-6718 |
. |
denotes |
. |
T15960 |
6718-6830 |
sentence |
denotes |
Statistical analysis was conducted using the software package SAS 8.1 (SAS Institute Japan Ltd., Tokyo, Japan). |
T15961 |
6719-6730 |
JJ |
denotes |
Statistical |
T15962 |
6731-6739 |
NN |
denotes |
analysis |
T15964 |
6740-6743 |
VBD |
denotes |
was |
T15963 |
6744-6753 |
VBN |
denotes |
conducted |
T15965 |
6754-6759 |
VBG |
denotes |
using |
T15966 |
6760-6763 |
DT |
denotes |
the |
T15968 |
6764-6772 |
NN |
denotes |
software |
T15967 |
6773-6780 |
NN |
denotes |
package |
T15969 |
6781-6784 |
NN |
denotes |
SAS |
T15970 |
6785-6788 |
CD |
denotes |
8.1 |
T15971 |
6789-6790 |
-LRB- |
denotes |
( |
T15973 |
6790-6793 |
NNP |
denotes |
SAS |
T15974 |
6794-6803 |
NNP |
denotes |
Institute |
T15972 |
6804-6809 |
NNP |
denotes |
Japan |
T15975 |
6810-6814 |
NNP |
denotes |
Ltd. |
T15976 |
6814-6816 |
, |
denotes |
, |
T15977 |
6816-6821 |
NNP |
denotes |
Tokyo |
T15978 |
6821-6823 |
, |
denotes |
, |
T15979 |
6823-6828 |
NNP |
denotes |
Japan |
T15980 |
6828-6829 |
-RRB- |
denotes |
) |
T15981 |
6829-6830 |
. |
denotes |
. |
T15982 |
6830-7046 |
sentence |
denotes |
Statistical significance was determined by analysis of variance (ANOVA) followed by the Dunnett-type multiple comparison test, and p values of less than 0.05 were considered to be significant in the water maze task. |
T15983 |
6831-6842 |
JJ |
denotes |
Statistical |
T15984 |
6843-6855 |
NN |
denotes |
significance |
T15986 |
6856-6859 |
VBD |
denotes |
was |
T15985 |
6860-6870 |
VBN |
denotes |
determined |
T15987 |
6871-6873 |
IN |
denotes |
by |
T15988 |
6874-6882 |
NN |
denotes |
analysis |
T15989 |
6883-6885 |
IN |
denotes |
of |
T15990 |
6886-6894 |
NN |
denotes |
variance |
T15991 |
6895-6896 |
-LRB- |
denotes |
( |
T15992 |
6896-6901 |
NN |
denotes |
ANOVA |
T15993 |
6901-6902 |
-RRB- |
denotes |
) |
T15994 |
6903-6911 |
VBN |
denotes |
followed |
T15995 |
6912-6914 |
IN |
denotes |
by |
T15996 |
6915-6918 |
DT |
denotes |
the |
T15998 |
6919-6926 |
NNP |
denotes |
Dunnett |
T16000 |
6926-6927 |
HYPH |
denotes |
- |
T15999 |
6927-6931 |
NN |
denotes |
type |
T16001 |
6932-6940 |
JJ |
denotes |
multiple |
T16002 |
6941-6951 |
NN |
denotes |
comparison |
T15997 |
6952-6956 |
NN |
denotes |
test |
T16003 |
6956-6958 |
, |
denotes |
, |
T16004 |
6958-6961 |
CC |
denotes |
and |
T16005 |
6962-6963 |
NN |
denotes |
p |
T16006 |
6964-6970 |
NNS |
denotes |
values |
T16008 |
6971-6973 |
IN |
denotes |
of |
T16009 |
6974-6978 |
JJR |
denotes |
less |
T16011 |
6979-6983 |
IN |
denotes |
than |
T16010 |
6984-6988 |
CD |
denotes |
0.05 |
T16012 |
6989-6993 |
VBD |
denotes |
were |
T16007 |
6994-7004 |
VBN |
denotes |
considered |
T16013 |
7005-7007 |
TO |
denotes |
to |
T16014 |
7008-7010 |
VB |
denotes |
be |
T16015 |
7011-7022 |
JJ |
denotes |
significant |
T16016 |
7023-7025 |
IN |
denotes |
in |
T16017 |
7026-7029 |
DT |
denotes |
the |
T16019 |
7030-7035 |
NN |
denotes |
water |
T16020 |
7036-7040 |
NN |
denotes |
maze |
T16018 |
7041-7045 |
NN |
denotes |
task |
T16021 |
7045-7046 |
. |
denotes |
. |
T16022 |
7046-7217 |
sentence |
denotes |
Behavioural data in the rotating rod test were analysed by one- or two-way ANOVA with repeated measures, and p values of less than 0.05 were considered to be significant. |
T16023 |
7047-7058 |
JJ |
denotes |
Behavioural |
T16024 |
7059-7063 |
NNS |
denotes |
data |
T16026 |
7064-7066 |
IN |
denotes |
in |
T16027 |
7067-7070 |
DT |
denotes |
the |
T16029 |
7071-7079 |
VBG |
denotes |
rotating |
T16030 |
7080-7083 |
NN |
denotes |
rod |
T16028 |
7084-7088 |
NN |
denotes |
test |
T16031 |
7089-7093 |
VBD |
denotes |
were |
T16025 |
7094-7102 |
VBN |
denotes |
analysed |
T16032 |
7103-7105 |
IN |
denotes |
by |
T16033 |
7106-7109 |
CD |
denotes |
one |
T16035 |
7109-7110 |
HYPH |
denotes |
- |
T16036 |
7111-7113 |
CC |
denotes |
or |
T16037 |
7114-7117 |
CD |
denotes |
two |
T16038 |
7117-7118 |
HYPH |
denotes |
- |
T16034 |
7118-7121 |
NN |
denotes |
way |
T16039 |
7122-7127 |
NN |
denotes |
ANOVA |
T16040 |
7128-7132 |
IN |
denotes |
with |
T16041 |
7133-7141 |
VBN |
denotes |
repeated |
T16042 |
7142-7150 |
NNS |
denotes |
measures |
T16043 |
7150-7152 |
, |
denotes |
, |
T16044 |
7152-7155 |
CC |
denotes |
and |
T16045 |
7156-7157 |
NN |
denotes |
p |
T16046 |
7158-7164 |
NNS |
denotes |
values |
T16048 |
7165-7167 |
IN |
denotes |
of |
T16049 |
7168-7172 |
JJR |
denotes |
less |
T16051 |
7173-7177 |
IN |
denotes |
than |
T16050 |
7178-7182 |
CD |
denotes |
0.05 |
T16052 |
7183-7187 |
VBD |
denotes |
were |
T16047 |
7188-7198 |
VBN |
denotes |
considered |
T16053 |
7199-7201 |
TO |
denotes |
to |
T16054 |
7202-7204 |
VB |
denotes |
be |
T16055 |
7205-7216 |
JJ |
denotes |
significant |
T16056 |
7216-7217 |
. |
denotes |
. |
T16221 |
7219-7233 |
NN |
denotes |
Histopathology |
T16222 |
7233-7454 |
sentence |
denotes |
Sections of tissues including the brain, spinal cord, heart, lung, liver, kidney, spleen and testis from mice (+/+, +/- and -/-; n = 7, 7 and 7, respectively) were fixed in 10% buffered formalin and embedded in paraffin. |
T16223 |
7234-7242 |
NNS |
denotes |
Sections |
T16225 |
7243-7245 |
IN |
denotes |
of |
T16226 |
7246-7253 |
NNS |
denotes |
tissues |
T16227 |
7254-7263 |
VBG |
denotes |
including |
T16228 |
7264-7267 |
DT |
denotes |
the |
T16229 |
7268-7273 |
NN |
denotes |
brain |
T16230 |
7273-7275 |
, |
denotes |
, |
T16231 |
7275-7281 |
JJ |
denotes |
spinal |
T16232 |
7282-7286 |
NN |
denotes |
cord |
T16233 |
7286-7288 |
, |
denotes |
, |
T16234 |
7288-7293 |
NN |
denotes |
heart |
T16235 |
7293-7295 |
, |
denotes |
, |
T16236 |
7295-7299 |
NN |
denotes |
lung |
T16237 |
7299-7301 |
, |
denotes |
, |
T16238 |
7301-7306 |
NN |
denotes |
liver |
T16239 |
7306-7308 |
, |
denotes |
, |
T16240 |
7308-7314 |
NN |
denotes |
kidney |
T16241 |
7314-7316 |
, |
denotes |
, |
T16242 |
7316-7322 |
NN |
denotes |
spleen |
T16243 |
7323-7326 |
CC |
denotes |
and |
T16244 |
7327-7333 |
NN |
denotes |
testis |
T16245 |
7334-7338 |
IN |
denotes |
from |
T16246 |
7339-7343 |
NNS |
denotes |
mice |
T16247 |
7344-7345 |
-LRB- |
denotes |
( |
T16249 |
7345-7346 |
SYM |
denotes |
+ |
T16250 |
7346-7347 |
HYPH |
denotes |
/ |
T16248 |
7347-7348 |
SYM |
denotes |
+ |
T16251 |
7348-7350 |
, |
denotes |
, |
T16252 |
7350-7351 |
SYM |
denotes |
+ |
T16254 |
7351-7352 |
HYPH |
denotes |
/ |
T16253 |
7352-7353 |
SYM |
denotes |
- |
T16255 |
7354-7357 |
CC |
denotes |
and |
T16256 |
7358-7359 |
SYM |
denotes |
- |
T16258 |
7359-7360 |
HYPH |
denotes |
/ |
T16257 |
7360-7361 |
SYM |
denotes |
- |
T16259 |
7361-7362 |
: |
denotes |
; |
T16260 |
7363-7364 |
NN |
denotes |
n |
T16262 |
7365-7366 |
SYM |
denotes |
= |
T16261 |
7367-7368 |
CD |
denotes |
7 |
T16263 |
7368-7370 |
, |
denotes |
, |
T16264 |
7370-7371 |
CD |
denotes |
7 |
T16265 |
7372-7375 |
CC |
denotes |
and |
T16266 |
7376-7377 |
CD |
denotes |
7 |
T16267 |
7377-7379 |
, |
denotes |
, |
T16268 |
7379-7391 |
RB |
denotes |
respectively |
T16269 |
7391-7392 |
-RRB- |
denotes |
) |
T16270 |
7393-7397 |
VBD |
denotes |
were |
T16224 |
7398-7403 |
VBN |
denotes |
fixed |
T16271 |
7404-7406 |
IN |
denotes |
in |
T16272 |
7407-7409 |
CD |
denotes |
10 |
T16273 |
7409-7410 |
NN |
denotes |
% |
T16275 |
7411-7419 |
VBN |
denotes |
buffered |
T16274 |
7420-7428 |
NN |
denotes |
formalin |
T16276 |
7429-7432 |
CC |
denotes |
and |
T16277 |
7433-7441 |
VBN |
denotes |
embedded |
T16278 |
7442-7444 |
IN |
denotes |
in |
T16279 |
7445-7453 |
NN |
denotes |
paraffin |
T16280 |
7453-7454 |
. |
denotes |
. |
T16281 |
7454-7535 |
sentence |
denotes |
Each paraffin section of thick 4 μm was stained with hematoxylin and eosin (HE). |
T16282 |
7455-7459 |
DT |
denotes |
Each |
T16284 |
7460-7468 |
NN |
denotes |
paraffin |
T16283 |
7469-7476 |
NN |
denotes |
section |
T16286 |
7477-7479 |
IN |
denotes |
of |
T16287 |
7480-7485 |
JJ |
denotes |
thick |
T16289 |
7486-7487 |
CD |
denotes |
4 |
T16288 |
7488-7490 |
NN |
denotes |
μm |
T16290 |
7491-7494 |
VBD |
denotes |
was |
T16285 |
7495-7502 |
VBN |
denotes |
stained |
T16291 |
7503-7507 |
IN |
denotes |
with |
T16292 |
7508-7519 |
NN |
denotes |
hematoxylin |
T16293 |
7520-7523 |
CC |
denotes |
and |
T16294 |
7524-7529 |
NN |
denotes |
eosin |
T16295 |
7530-7531 |
-LRB- |
denotes |
( |
T16296 |
7531-7533 |
NN |
denotes |
HE |
T16297 |
7533-7534 |
-RRB- |
denotes |
) |
T16298 |
7534-7535 |
. |
denotes |
. |
R3521 |
T11865 |
T11864 |
prep |
of,Construction |
R3522 |
T11866 |
T11867 |
det |
an,vector |
R3523 |
T11867 |
T11865 |
pobj |
vector,of |
R3524 |
T11868 |
T11867 |
nmod |
Adam11,vector |
R3525 |
T11869 |
T11867 |
nmod |
gene,vector |
R3526 |
T11870 |
T11869 |
punct |
-,gene |
R3527 |
T11871 |
T11869 |
amod |
targeting,gene |
R3528 |
T11873 |
T11874 |
det |
The,fragment |
R3529 |
T11874 |
T11880 |
nsubjpass |
fragment,amplified |
R3530 |
T11875 |
T11876 |
nummod |
13.7,kb |
R3531 |
T11876 |
T11874 |
compound |
kb,fragment |
R3532 |
T11877 |
T11876 |
punct |
-,kb |
R3533 |
T11878 |
T11874 |
compound |
BamHI,fragment |
R3534 |
T11879 |
T11874 |
compound |
DNA,fragment |
R3535 |
T11881 |
T11874 |
acl |
covering,fragment |
R3536 |
T11882 |
T11883 |
nmod |
exons,2 |
R3537 |
T11883 |
T11881 |
dobj |
2,covering |
R3538 |
T11884 |
T11885 |
punct |
–,20 |
R3539 |
T11885 |
T11883 |
prep |
20,2 |
R3540 |
T11886 |
T11883 |
prep |
of,2 |
R3541 |
T11887 |
T11888 |
det |
the,gene |
R3542 |
T11888 |
T11886 |
pobj |
gene,of |
R3543 |
T11889 |
T11888 |
compound |
Adam11,gene |
R3544 |
T11890 |
T11880 |
auxpass |
was,amplified |
R3545 |
T11891 |
T11880 |
prep |
from,amplified |
R3546 |
T11892 |
T11893 |
nmod |
C57BL,DNA |
R3547 |
T11893 |
T11891 |
pobj |
DNA,from |
R3548 |
T11894 |
T11892 |
punct |
/,C57BL |
R3549 |
T11895 |
T11892 |
nummod |
6,C57BL |
R3550 |
T11896 |
T11893 |
amod |
genomic,DNA |
R3551 |
T11897 |
T11880 |
prep |
by,amplified |
R3552 |
T11898 |
T11899 |
det |
the,PCR |
R3553 |
T11899 |
T11897 |
pobj |
PCR,by |
R3554 |
T11900 |
T11899 |
acl |
using,PCR |
R3555 |
T11901 |
T11902 |
compound |
Expand,mix |
R3556 |
T11902 |
T11900 |
dobj |
mix,using |
R3557 |
T11903 |
T11904 |
compound |
Hi,Fidelity |
R3558 |
T11904 |
T11902 |
compound |
Fidelity,mix |
R3559 |
T11905 |
T11904 |
punct |
-,Fidelity |
R3560 |
T11906 |
T11902 |
compound |
polymerase,mix |
R3561 |
T11907 |
T11908 |
punct |
(,KK |
R3562 |
T11908 |
T11902 |
parataxis |
KK,mix |
R3563 |
T11909 |
T11908 |
compound |
Roche,KK |
R3564 |
T11910 |
T11908 |
compound |
Diagnostics,KK |
R3565 |
T11911 |
T11908 |
punct |
", ",KK |
R3566 |
T11912 |
T11908 |
npadvmod |
Tokyo,KK |
R3567 |
T11913 |
T11908 |
punct |
", ",KK |
R3568 |
T11914 |
T11908 |
npadvmod |
Japan,KK |
R3569 |
T11915 |
T11908 |
punct |
),KK |
R3570 |
T11916 |
T11880 |
punct |
.,amplified |
R3571 |
T11918 |
T11919 |
aux |
To,generate |
R3572 |
T11919 |
T11920 |
advcl |
generate,inserted |
R3573 |
T11921 |
T11922 |
det |
a,mutation |
R3574 |
T11922 |
T11919 |
dobj |
mutation,generate |
R3575 |
T11923 |
T11919 |
prep |
in,generate |
R3576 |
T11924 |
T11925 |
det |
the,gene |
R3577 |
T11925 |
T11923 |
pobj |
gene,in |
R3578 |
T11926 |
T11925 |
compound |
mouse,gene |
R3579 |
T11927 |
T11925 |
compound |
Adam11,gene |
R3580 |
T11928 |
T11920 |
punct |
", ",inserted |
R3581 |
T11929 |
T11920 |
nsubj |
we,inserted |
R3582 |
T11930 |
T11931 |
det |
a,cassette |
R3583 |
T11931 |
T11920 |
dobj |
cassette,inserted |
R3584 |
T11932 |
T11931 |
compound |
PGKneo,cassette |
R3585 |
T11933 |
T11920 |
prep |
into,inserted |
R3586 |
T11934 |
T11935 |
nmod |
exons,5 |
R3587 |
T11935 |
T11933 |
pobj |
5,into |
R3588 |
T11936 |
T11937 |
punct |
–,7 |
R3589 |
T11937 |
T11935 |
prep |
7,5 |
R3590 |
T11938 |
T11935 |
prep |
of,5 |
R3591 |
T11939 |
T11940 |
det |
the,gene |
R3592 |
T11940 |
T11938 |
pobj |
gene,of |
R3593 |
T11941 |
T11940 |
compound |
Adam11,gene |
R3594 |
T11942 |
T11920 |
punct |
.,inserted |
R3595 |
T11944 |
T11945 |
det |
The,construct |
R3596 |
T11945 |
T11948 |
nsubj |
construct,consisted |
R3597 |
T11946 |
T11945 |
amod |
final,construct |
R3598 |
T11947 |
T11945 |
compound |
targeting,construct |
R3599 |
T11949 |
T11948 |
prep |
of,consisted |
R3600 |
T11950 |
T11951 |
det |
a,fragment |
R3601 |
T11951 |
T11949 |
pobj |
fragment,of |
R3602 |
T11952 |
T11953 |
nummod |
10.1,kb |
R3603 |
T11953 |
T11951 |
nmod |
kb,fragment |
R3604 |
T11954 |
T11953 |
punct |
-,kb |
R3605 |
T11955 |
T11951 |
amod |
genomic,fragment |
R3606 |
T11956 |
T11951 |
compound |
DNA,fragment |
R3607 |
T11957 |
T11958 |
dep |
that,interrupted |
R3608 |
T11958 |
T11951 |
relcl |
interrupted,fragment |
R3609 |
T11959 |
T11958 |
auxpass |
was,interrupted |
R3610 |
T11960 |
T11958 |
agent |
by,interrupted |
R3611 |
T11961 |
T11962 |
det |
the,insertion |
R3612 |
T11962 |
T11960 |
pobj |
insertion,by |
R3613 |
T11963 |
T11962 |
prep |
of,insertion |
R3614 |
T11964 |
T11965 |
det |
the,cassette |
R3615 |
T11965 |
T11963 |
pobj |
cassette,of |
R3616 |
T11966 |
T11965 |
compound |
PGKneo,cassette |
R3617 |
T11967 |
T11958 |
cc |
and,interrupted |
R3618 |
T11968 |
T11958 |
conj |
contained,interrupted |
R3619 |
T11969 |
T11970 |
det |
a,cassette |
R3620 |
T11970 |
T11968 |
dobj |
cassette,contained |
R3621 |
T11971 |
T11972 |
compound |
MC1,TK |
R3622 |
T11972 |
T11970 |
compound |
TK,cassette |
R3623 |
T11973 |
T11972 |
punct |
/,TK |
R3624 |
T11974 |
T11968 |
prep |
as,contained |
R3625 |
T11975 |
T11976 |
det |
a,marker |
R3626 |
T11976 |
T11974 |
pobj |
marker,as |
R3627 |
T11977 |
T11978 |
amod |
negative,selection |
R3628 |
T11978 |
T11976 |
compound |
selection,marker |
R3629 |
T11979 |
T11976 |
prep |
against,marker |
R3630 |
T11980 |
T11981 |
amod |
random,integration |
R3631 |
T11981 |
T11979 |
pobj |
integration,against |
R3632 |
T11982 |
T11983 |
punct |
[,39 |
R3633 |
T11983 |
T11968 |
parataxis |
39,contained |
R3634 |
T11984 |
T11983 |
punct |
],39 |
R3635 |
T11985 |
T11948 |
punct |
.,consisted |
R3640 |
T12310 |
T12309 |
prep |
of,Generation |
R3641 |
T12311 |
T12312 |
npadvmod |
Adam11,deficient |
R3642 |
T12312 |
T12313 |
amod |
deficient,mice |
R3643 |
T12313 |
T12310 |
pobj |
mice,of |
R3644 |
T12315 |
T12316 |
det |
The,vector |
R3645 |
T12316 |
T12319 |
nsubjpass |
vector,electroporated |
R3646 |
T12317 |
T12316 |
amod |
linearised,vector |
R3647 |
T12318 |
T12316 |
compound |
targeting,vector |
R3648 |
T12320 |
T12319 |
auxpass |
was,electroporated |
R3649 |
T12321 |
T12319 |
prep |
into,electroporated |
R3650 |
T12322 |
T12323 |
nmod |
TT2,cells |
R3651 |
T12323 |
T12321 |
pobj |
cells,into |
R3652 |
T12324 |
T12325 |
amod |
embryonic,stem |
R3653 |
T12325 |
T12323 |
nmod |
stem,cells |
R3654 |
T12326 |
T12325 |
punct |
(,stem |
R3655 |
T12327 |
T12325 |
appos |
ES,stem |
R3656 |
T12328 |
T12323 |
punct |
),cells |
R3657 |
T12329 |
T12330 |
punct |
[,40 |
R3658 |
T12330 |
T12319 |
parataxis |
40,electroporated |
R3659 |
T12331 |
T12330 |
punct |
],40 |
R3660 |
T12332 |
T12319 |
punct |
.,electroporated |
R3661 |
T12334 |
T12335 |
amod |
Homologous,recombinants |
R3662 |
T12335 |
T12336 |
nsubjpass |
recombinants,selected |
R3663 |
T12337 |
T12336 |
auxpass |
were,selected |
R3664 |
T12338 |
T12336 |
prep |
by,selected |
R3665 |
T12339 |
T12338 |
pobj |
PCR,by |
R3666 |
T12340 |
T12336 |
advcl |
using,selected |
R3667 |
T12341 |
T12342 |
det |
the,primers |
R3668 |
T12342 |
T12340 |
dobj |
primers,using |
R3669 |
T12343 |
T12342 |
amod |
following,primers |
R3670 |
T12344 |
T12342 |
punct |
", ",primers |
R3671 |
T12345 |
T12342 |
appos |
AGN1,primers |
R3672 |
T12346 |
T12345 |
punct |
: ,AGN1 |
R3673 |
T12347 |
T12345 |
appos |
5,AGN1 |
R3674 |
T12348 |
T12347 |
punct |
',5 |
R3675 |
T12349 |
T12347 |
punct |
-,5 |
R3676 |
T12350 |
T12347 |
appos |
TCGTGCTTTACGGTATCGCCGCTCCCGATT,5 |
R3677 |
T12351 |
T12347 |
punct |
-,5 |
R3678 |
T12352 |
T12347 |
nummod |
3,5 |
R3679 |
T12353 |
T12347 |
punct |
',5 |
R3680 |
T12354 |
T12345 |
prep |
in,AGN1 |
R3681 |
T12355 |
T12356 |
det |
the,cassette |
R3682 |
T12356 |
T12354 |
pobj |
cassette,in |
R3683 |
T12357 |
T12356 |
compound |
PGKneo,cassette |
R3684 |
T12358 |
T12342 |
punct |
", ",primers |
R3685 |
T12359 |
T12342 |
cc |
and,primers |
R3686 |
T12360 |
T12342 |
conj |
SGN033,primers |
R3687 |
T12361 |
T12360 |
punct |
: ,SGN033 |
R3688 |
T12362 |
T12360 |
appos |
5,SGN033 |
R3689 |
T12363 |
T12362 |
punct |
',5 |
R3690 |
T12364 |
T12362 |
punct |
-,5 |
R3691 |
T12365 |
T12362 |
appos |
GGACCCGGAAGACATTTGCACGGT,5 |
R3692 |
T12366 |
T12362 |
punct |
-,5 |
R3693 |
T12367 |
T12362 |
nummod |
3,5 |
R3694 |
T12368 |
T12362 |
punct |
',5 |
R3695 |
T12369 |
T12360 |
prep |
outside,SGN033 |
R3696 |
T12370 |
T12371 |
det |
the,vector |
R3697 |
T12371 |
T12369 |
pobj |
vector,outside |
R3698 |
T12372 |
T12371 |
compound |
targeting,vector |
R3699 |
T12373 |
T12336 |
punct |
.,selected |
R3700 |
T12375 |
T12376 |
amod |
Homologous,DNA |
R3701 |
T12376 |
T12378 |
nsubjpass |
DNA,amplified |
R3702 |
T12377 |
T12376 |
amod |
recombined,DNA |
R3703 |
T12379 |
T12378 |
auxpass |
was,amplified |
R3704 |
T12380 |
T12378 |
advmod |
efficiently,amplified |
R3705 |
T12381 |
T12378 |
agent |
by,amplified |
R3706 |
T12382 |
T12383 |
nummod |
35,cycles |
R3707 |
T12383 |
T12381 |
pobj |
cycles,by |
R3708 |
T12384 |
T12383 |
prep |
of,cycles |
R3709 |
T12385 |
T12386 |
det |
the,steps |
R3710 |
T12386 |
T12384 |
pobj |
steps,of |
R3711 |
T12387 |
T12386 |
amod |
following,steps |
R3712 |
T12388 |
T12386 |
compound |
amplification,steps |
R3713 |
T12389 |
T12386 |
punct |
(,steps |
R3714 |
T12390 |
T12391 |
nummod |
94,°C |
R3715 |
T12391 |
T12386 |
appos |
°C,steps |
R3716 |
T12392 |
T12391 |
punct |
-,°C |
R3717 |
T12393 |
T12394 |
nummod |
30,sec |
R3718 |
T12394 |
T12391 |
npadvmod |
sec,°C |
R3719 |
T12395 |
T12391 |
cc |
and,°C |
R3720 |
T12396 |
T12397 |
nummod |
68,°C |
R3721 |
T12397 |
T12391 |
conj |
°C,°C |
R3722 |
T12398 |
T12397 |
punct |
-,°C |
R3723 |
T12399 |
T12400 |
nummod |
5,min |
R3724 |
T12400 |
T12397 |
npadvmod |
min,°C |
R3725 |
T12401 |
T12386 |
punct |
),steps |
R3726 |
T12402 |
T12378 |
punct |
.,amplified |
R3727 |
T12404 |
T12405 |
advmod |
Correctly,targeted |
R3728 |
T12405 |
T12406 |
amod |
targeted,clones |
R3729 |
T12406 |
T12408 |
nsubjpass |
clones,injected |
R3730 |
T12407 |
T12406 |
compound |
ES,clones |
R3731 |
T12409 |
T12408 |
auxpass |
were,injected |
R3732 |
T12410 |
T12408 |
prep |
into,injected |
R3733 |
T12411 |
T12412 |
amod |
fertilised,eggs |
R3734 |
T12412 |
T12410 |
pobj |
eggs,into |
R3735 |
T12413 |
T12412 |
compound |
ICR,eggs |
R3736 |
T12414 |
T12412 |
compound |
mouse,eggs |
R3737 |
T12415 |
T12408 |
prep |
at,injected |
R3738 |
T12416 |
T12417 |
det |
the,stage |
R3739 |
T12417 |
T12415 |
pobj |
stage,at |
R3740 |
T12418 |
T12419 |
nummod |
eight,cell |
R3741 |
T12419 |
T12417 |
compound |
cell,stage |
R3742 |
T12420 |
T12419 |
punct |
-,cell |
R3743 |
T12421 |
T12408 |
punct |
.,injected |
R3744 |
T12423 |
T12424 |
det |
The,chimeras |
R3745 |
T12424 |
T12427 |
nsubjpass |
chimeras,mated |
R3746 |
T12425 |
T12424 |
amod |
resulting,chimeras |
R3747 |
T12426 |
T12424 |
amod |
male,chimeras |
R3748 |
T12428 |
T12427 |
auxpass |
were,mated |
R3749 |
T12429 |
T12427 |
prep |
with,mated |
R3750 |
T12430 |
T12431 |
compound |
C57BL,6NCrj |
R3751 |
T12431 |
T12433 |
compound |
6NCrj,females |
R3752 |
T12432 |
T12431 |
punct |
/,6NCrj |
R3753 |
T12433 |
T12429 |
pobj |
females,with |
R3754 |
T12434 |
T12435 |
punct |
(,Japan |
R3755 |
T12435 |
T12427 |
parataxis |
Japan,mated |
R3756 |
T12436 |
T12435 |
compound |
Charles,Japan |
R3757 |
T12437 |
T12435 |
compound |
River,Japan |
R3758 |
T12438 |
T12435 |
punct |
", ",Japan |
R3759 |
T12439 |
T12435 |
npadvmod |
Tokyo,Japan |
R3760 |
T12440 |
T12435 |
punct |
", ",Japan |
R3761 |
T12441 |
T12435 |
npadvmod |
Japan,Japan |
R3762 |
T12442 |
T12435 |
punct |
),Japan |
R3763 |
T12443 |
T12427 |
punct |
", ",mated |
R3764 |
T12444 |
T12427 |
cc |
and,mated |
R3765 |
T12445 |
T12446 |
amod |
resulting,mice |
R3766 |
T12446 |
T12456 |
nsubjpass |
mice,interbred |
R3767 |
T12447 |
T12446 |
amod |
heterozygous,mice |
R3768 |
T12448 |
T12446 |
punct |
(,mice |
R3769 |
T12449 |
T12450 |
punct |
+,- |
R3770 |
T12450 |
T12446 |
punct |
-,mice |
R3771 |
T12451 |
T12450 |
punct |
/,- |
R3772 |
T12452 |
T12446 |
punct |
),mice |
R3773 |
T12453 |
T12446 |
amod |
male,mice |
R3774 |
T12454 |
T12453 |
cc |
and,male |
R3775 |
T12455 |
T12453 |
conj |
female,male |
R3776 |
T12456 |
T12427 |
conj |
interbred,mated |
R3777 |
T12457 |
T12456 |
auxpass |
were,interbred |
R3778 |
T12458 |
T12459 |
aux |
to,generate |
R3779 |
T12459 |
T12456 |
advcl |
generate,interbred |
R3780 |
T12460 |
T12461 |
amod |
homozygous,mice |
R3781 |
T12461 |
T12459 |
dobj |
mice,generate |
R3782 |
T12462 |
T12461 |
punct |
(,mice |
R3783 |
T12463 |
T12464 |
punct |
-,- |
R3784 |
T12464 |
T12461 |
punct |
-,mice |
R3785 |
T12465 |
T12464 |
punct |
/,- |
R3786 |
T12466 |
T12461 |
punct |
),mice |
R3787 |
T12467 |
T12456 |
punct |
.,interbred |
R3788 |
T12588 |
T12589 |
compound |
Southern,blot |
R3789 |
T12589 |
T12590 |
compound |
blot,analysis |
R3790 |
T12592 |
T12593 |
nmod |
Mouse,DNA |
R3791 |
T12593 |
T12595 |
nsubjpass |
DNA,extracted |
R3792 |
T12594 |
T12593 |
amod |
genomic,DNA |
R3793 |
T12596 |
T12593 |
acl |
used,DNA |
R3794 |
T12597 |
T12596 |
prep |
for,used |
R3795 |
T12598 |
T12599 |
compound |
Southern,blot |
R3796 |
T12599 |
T12600 |
compound |
blot,analysis |
R3797 |
T12600 |
T12597 |
pobj |
analysis,for |
R3798 |
T12601 |
T12595 |
auxpass |
was,extracted |
R3799 |
T12602 |
T12595 |
prep |
from,extracted |
R3800 |
T12603 |
T12604 |
det |
the,liver |
R3801 |
T12604 |
T12602 |
pobj |
liver,from |
R3802 |
T12605 |
T12604 |
prep |
of,liver |
R3803 |
T12606 |
T12607 |
det |
each,genotype |
R3804 |
T12607 |
T12605 |
pobj |
genotype,of |
R3805 |
T12608 |
T12595 |
punct |
.,extracted |
R3806 |
T12610 |
T12611 |
npadvmod |
BamHI,digested |
R3807 |
T12611 |
T12613 |
amod |
digested,DNA |
R3808 |
T12612 |
T12611 |
punct |
-,digested |
R3809 |
T12613 |
T12615 |
nsubjpass |
DNA,probed |
R3810 |
T12614 |
T12613 |
amod |
genomic,DNA |
R3811 |
T12616 |
T12615 |
auxpass |
was,probed |
R3812 |
T12617 |
T12615 |
prep |
with,probed |
R3813 |
T12618 |
T12619 |
det |
the,probe |
R3814 |
T12619 |
T12617 |
pobj |
probe,with |
R3815 |
T12620 |
T12619 |
punct |
[,probe |
R3816 |
T12621 |
T12622 |
npadvmod |
32P,labelled |
R3817 |
T12622 |
T12619 |
amod |
labelled,probe |
R3818 |
T12623 |
T12622 |
punct |
],labelled |
R3819 |
T12624 |
T12622 |
punct |
-,labelled |
R3820 |
T12625 |
T12619 |
compound |
BE2K,probe |
R3821 |
T12626 |
T12619 |
punct |
", ",probe |
R3822 |
T12627 |
T12628 |
dep |
which,was |
R3823 |
T12628 |
T12619 |
relcl |
was,probe |
R3824 |
T12629 |
T12630 |
det |
a,fragment |
R3825 |
T12630 |
T12628 |
attr |
fragment,was |
R3826 |
T12631 |
T12632 |
nummod |
2.0,kb |
R3827 |
T12632 |
T12630 |
nmod |
kb,fragment |
R3828 |
T12633 |
T12632 |
punct |
-,kb |
R3829 |
T12634 |
T12635 |
nmod |
BamHI,EcoRI |
R3830 |
T12635 |
T12630 |
nmod |
EcoRI,fragment |
R3831 |
T12636 |
T12635 |
punct |
–,EcoRI |
R3832 |
T12637 |
T12630 |
amod |
genomic,fragment |
R3833 |
T12638 |
T12630 |
acl |
located,fragment |
R3834 |
T12639 |
T12638 |
prep |
in,located |
R3835 |
T12640 |
T12639 |
pobj |
intron,in |
R3836 |
T12641 |
T12640 |
nummod |
2,intron |
R3837 |
T12642 |
T12615 |
punct |
.,probed |
R3838 |
T13011 |
T13012 |
compound |
Western,blot |
R3839 |
T13012 |
T13013 |
compound |
blot,analysis |
R3840 |
T13015 |
T13016 |
det |
The,absence |
R3841 |
T13016 |
T13017 |
nsubjpass |
absence,confirmed |
R3842 |
T13018 |
T13016 |
prep |
of,absence |
R3843 |
T13019 |
T13020 |
compound |
ADAM11,protein |
R3844 |
T13020 |
T13018 |
pobj |
protein,of |
R3845 |
T13021 |
T13016 |
prep |
in,absence |
R3846 |
T13022 |
T13023 |
det |
the,mice |
R3847 |
T13023 |
T13021 |
pobj |
mice,in |
R3848 |
T13024 |
T13023 |
punct |
(,mice |
R3849 |
T13025 |
T13026 |
punct |
-,- |
R3850 |
T13026 |
T13023 |
punct |
-,mice |
R3851 |
T13027 |
T13026 |
punct |
/,- |
R3852 |
T13028 |
T13023 |
punct |
),mice |
R3853 |
T13029 |
T13017 |
auxpass |
was,confirmed |
R3854 |
T13030 |
T13017 |
agent |
by,confirmed |
R3855 |
T13031 |
T13032 |
compound |
Western,blot |
R3856 |
T13032 |
T13033 |
compound |
blot,analysis |
R3857 |
T13033 |
T13030 |
pobj |
analysis,by |
R3858 |
T13034 |
T13017 |
punct |
.,confirmed |
R3859 |
T13036 |
T13037 |
aux |
To,be |
R3860 |
T13037 |
T13038 |
advcl |
be,isolated |
R3861 |
T13039 |
T13037 |
acomp |
brief,be |
R3862 |
T13040 |
T13038 |
punct |
", ",isolated |
R3863 |
T13041 |
T13042 |
det |
the,cerebellum |
R3864 |
T13042 |
T13038 |
nsubjpass |
cerebellum,isolated |
R3865 |
T13043 |
T13038 |
auxpass |
was,isolated |
R3866 |
T13044 |
T13038 |
prep |
from,isolated |
R3867 |
T13045 |
T13046 |
det |
a,mouse |
R3868 |
T13046 |
T13044 |
pobj |
mouse,from |
R3869 |
T13047 |
T13048 |
nummod |
six,month |
R3870 |
T13048 |
T13049 |
npadvmod |
month,old |
R3871 |
T13049 |
T13046 |
amod |
old,mouse |
R3872 |
T13050 |
T13049 |
punct |
-,old |
R3873 |
T13051 |
T13046 |
prep |
of,mouse |
R3874 |
T13052 |
T13053 |
det |
each,genotype |
R3875 |
T13053 |
T13051 |
pobj |
genotype,of |
R3876 |
T13054 |
T13038 |
cc |
and,isolated |
R3877 |
T13055 |
T13038 |
conj |
homogenised,isolated |
R3878 |
T13056 |
T13055 |
prep |
in,homogenised |
R3879 |
T13057 |
T13058 |
compound |
cell,lysis |
R3880 |
T13058 |
T13059 |
compound |
lysis,buffer |
R3881 |
T13059 |
T13056 |
pobj |
buffer,in |
R3882 |
T13060 |
T13061 |
punct |
(,cocktail |
R3883 |
T13061 |
T13055 |
parataxis |
cocktail,homogenised |
R3884 |
T13062 |
T13063 |
nummod |
50,mM |
R3885 |
T13063 |
T13064 |
compound |
mM,HCl |
R3886 |
T13064 |
T13061 |
dep |
HCl,cocktail |
R3887 |
T13065 |
T13064 |
compound |
Tris,HCl |
R3888 |
T13066 |
T13064 |
punct |
-,HCl |
R3889 |
T13067 |
T13061 |
punct |
", ",cocktail |
R3890 |
T13068 |
T13061 |
dep |
pH,cocktail |
R3891 |
T13069 |
T13068 |
nummod |
7.5,pH |
R3892 |
T13070 |
T13061 |
punct |
", ",cocktail |
R3893 |
T13071 |
T13072 |
nummod |
100,mM |
R3894 |
T13072 |
T13073 |
compound |
mM,NaCl |
R3895 |
T13073 |
T13061 |
dep |
NaCl,cocktail |
R3896 |
T13074 |
T13061 |
punct |
", ",cocktail |
R3897 |
T13075 |
T13076 |
nummod |
1,% |
R3898 |
T13076 |
T13077 |
compound |
%,NP |
R3899 |
T13077 |
T13061 |
dep |
NP,cocktail |
R3900 |
T13078 |
T13077 |
punct |
-,NP |
R3901 |
T13079 |
T13077 |
nummod |
40,NP |
R3902 |
T13080 |
T13061 |
punct |
", ",cocktail |
R3903 |
T13081 |
T13082 |
compound |
protease,inhibitor |
R3904 |
T13082 |
T13061 |
compound |
inhibitor,cocktail |
R3905 |
T13083 |
T13084 |
punct |
[,Diagnostics |
R3906 |
T13084 |
T13061 |
parataxis |
Diagnostics,cocktail |
R3907 |
T13085 |
T13084 |
compound |
Roche,Diagnostics |
R3908 |
T13086 |
T13084 |
punct |
],Diagnostics |
R3909 |
T13087 |
T13061 |
punct |
),cocktail |
R3910 |
T13088 |
T13038 |
punct |
.,isolated |
R3911 |
T13090 |
T13091 |
prep |
After,concentrated |
R3912 |
T13092 |
T13090 |
pobj |
removal,After |
R3913 |
T13093 |
T13092 |
prep |
of,removal |
R3914 |
T13094 |
T13095 |
compound |
cell,debris |
R3915 |
T13095 |
T13093 |
pobj |
debris,of |
R3916 |
T13096 |
T13092 |
prep |
by,removal |
R3917 |
T13097 |
T13096 |
pobj |
centrifugation,by |
R3918 |
T13098 |
T13091 |
punct |
", ",concentrated |
R3919 |
T13099 |
T13100 |
det |
the,proteins |
R3920 |
T13100 |
T13091 |
nsubjpass |
proteins,concentrated |
R3921 |
T13101 |
T13100 |
amod |
glycosylated,proteins |
R3922 |
T13102 |
T13100 |
prep |
in,proteins |
R3923 |
T13103 |
T13104 |
det |
the,supernatant |
R3924 |
T13104 |
T13102 |
pobj |
supernatant,in |
R3925 |
T13105 |
T13091 |
auxpass |
were,concentrated |
R3926 |
T13106 |
T13091 |
prep |
by,concentrated |
R3927 |
T13107 |
T13108 |
det |
the,chromatography |
R3928 |
T13108 |
T13106 |
pobj |
chromatography,by |
R3929 |
T13109 |
T13108 |
compound |
affinity,chromatography |
R3930 |
T13110 |
T13091 |
advcl |
using,concentrated |
R3931 |
T13111 |
T13112 |
compound |
Con,4B |
R3932 |
T13112 |
T13110 |
dobj |
4B,using |
R3933 |
T13113 |
T13112 |
compound |
A,4B |
R3934 |
T13114 |
T13112 |
compound |
Sepharose,4B |
R3935 |
T13115 |
T13116 |
punct |
(,Corp. |
R3936 |
T13116 |
T13110 |
parataxis |
Corp.,using |
R3937 |
T13117 |
T13116 |
compound |
Amersham,Corp. |
R3938 |
T13118 |
T13116 |
compound |
Biosciences,Corp. |
R3939 |
T13119 |
T13116 |
punct |
),Corp. |
R3940 |
T13120 |
T13091 |
punct |
.,concentrated |
R3941 |
T13122 |
T13123 |
det |
Each,sample |
R3942 |
T13123 |
T13124 |
nsubjpass |
sample,separated |
R3943 |
T13125 |
T13124 |
auxpass |
was,separated |
R3944 |
T13126 |
T13124 |
prep |
on,separated |
R3945 |
T13127 |
T13128 |
nummod |
10,% |
R3946 |
T13128 |
T13129 |
compound |
%,PAGE |
R3947 |
T13129 |
T13126 |
pobj |
PAGE,on |
R3948 |
T13130 |
T13129 |
compound |
SDS,PAGE |
R3949 |
T13131 |
T13129 |
punct |
-,PAGE |
R3950 |
T13132 |
T13124 |
punct |
", ",separated |
R3951 |
T13133 |
T13124 |
cc |
and,separated |
R3952 |
T13134 |
T13124 |
conj |
transferred,separated |
R3953 |
T13135 |
T13134 |
prep |
to,transferred |
R3954 |
T13136 |
T13137 |
det |
a,membrane |
R3955 |
T13137 |
T13135 |
pobj |
membrane,to |
R3956 |
T13138 |
T13137 |
compound |
PVDF,membrane |
R3957 |
T13139 |
T13124 |
punct |
.,separated |
R3958 |
T13141 |
T13142 |
det |
The,blot |
R3959 |
T13142 |
T13143 |
nsubjpass |
blot,incubated |
R3960 |
T13144 |
T13143 |
auxpass |
was,incubated |
R3961 |
T13145 |
T13143 |
advmod |
then,incubated |
R3962 |
T13146 |
T13143 |
prep |
with,incubated |
R3963 |
T13147 |
T13148 |
amod |
monoclonal,antibody |
R3964 |
T13148 |
T13146 |
pobj |
antibody,with |
R3965 |
T13149 |
T13148 |
prep |
against,antibody |
R3966 |
T13150 |
T13151 |
det |
the,ADAM11 |
R3967 |
T13151 |
T13149 |
pobj |
ADAM11,against |
R3968 |
T13152 |
T13153 |
punct |
(,Patent |
R3969 |
T13153 |
T13151 |
parataxis |
Patent,ADAM11 |
R3970 |
T13154 |
T13155 |
compound |
U.,S. |
R3971 |
T13155 |
T13153 |
compound |
S.,Patent |
R3972 |
T13156 |
T13153 |
nummod |
"5,631,351",Patent |
R3973 |
T13157 |
T13153 |
punct |
),Patent |
R3974 |
T13158 |
T13148 |
prep |
at,antibody |
R3975 |
T13159 |
T13160 |
nummod |
1,μg |
R3976 |
T13160 |
T13158 |
pobj |
μg,at |
R3977 |
T13161 |
T13162 |
punct |
/,ml |
R3978 |
T13162 |
T13160 |
prep |
ml,μg |
R3979 |
T13163 |
T13143 |
punct |
.,incubated |
R3980 |
T13165 |
T13166 |
amod |
Bound,antibodies |
R3981 |
T13166 |
T13167 |
nsubjpass |
antibodies,visualised |
R3982 |
T13168 |
T13167 |
auxpass |
were,visualised |
R3983 |
T13169 |
T13167 |
prep |
with,visualised |
R3984 |
T13170 |
T13171 |
compound |
horseradish,peroxidase |
R3985 |
T13171 |
T13172 |
npadvmod |
peroxidase,labelled |
R3986 |
T13172 |
T13174 |
amod |
labelled,antibody |
R3987 |
T13173 |
T13172 |
punct |
-,labelled |
R3988 |
T13174 |
T13169 |
pobj |
antibody,with |
R3989 |
T13175 |
T13174 |
amod |
second,antibody |
R3990 |
T13176 |
T13174 |
cc |
and,antibody |
R3991 |
T13177 |
T13178 |
det |
an,system |
R3992 |
T13178 |
T13174 |
conj |
system,antibody |
R3993 |
T13179 |
T13180 |
compound |
ECL,plus |
R3994 |
T13180 |
T13178 |
compound |
plus,system |
R3995 |
T13181 |
T13180 |
punct |
-,plus |
R3996 |
T13182 |
T13183 |
compound |
chemiluminescence,detection |
R3997 |
T13183 |
T13178 |
compound |
detection,system |
R3998 |
T13184 |
T13185 |
punct |
(,Corp. |
R3999 |
T13185 |
T13167 |
parataxis |
Corp.,visualised |
R4000 |
T13186 |
T13185 |
compound |
Amersham,Corp. |
R4001 |
T13187 |
T13185 |
compound |
Biosciences,Corp. |
R4002 |
T13188 |
T13185 |
punct |
),Corp. |
R4003 |
T13189 |
T13167 |
punct |
.,visualised |
R4004 |
T13416 |
T13417 |
amod |
Behavioural,analysis |
R4005 |
T13419 |
T13420 |
det |
All,procedures |
R4006 |
T13420 |
T13422 |
nsubj |
procedures,conformed |
R4007 |
T13421 |
T13420 |
compound |
animal,procedures |
R4008 |
T13423 |
T13422 |
prep |
to,conformed |
R4009 |
T13424 |
T13425 |
det |
the,regulations |
R4010 |
T13425 |
T13423 |
pobj |
regulations,to |
R4011 |
T13426 |
T13425 |
amod |
Japanese,regulations |
R4012 |
T13427 |
T13425 |
prep |
on,regulations |
R4013 |
T13428 |
T13429 |
compound |
animal,care |
R4014 |
T13429 |
T13427 |
pobj |
care,on |
R4015 |
T13430 |
T13429 |
cc |
and,care |
R4016 |
T13431 |
T13429 |
conj |
use,care |
R4017 |
T13432 |
T13425 |
punct |
", ",regulations |
R4018 |
T13433 |
T13425 |
prep |
following,regulations |
R4019 |
T13434 |
T13435 |
det |
the,Guideline |
R4020 |
T13435 |
T13433 |
pobj |
Guideline,following |
R4021 |
T13436 |
T13435 |
prep |
for,Guideline |
R4022 |
T13437 |
T13438 |
compound |
Animal,Experimentation |
R4023 |
T13438 |
T13436 |
pobj |
Experimentation,for |
R4024 |
T13439 |
T13435 |
prep |
of,Guideline |
R4025 |
T13440 |
T13441 |
det |
the,Association |
R4026 |
T13441 |
T13439 |
pobj |
Association,of |
R4027 |
T13442 |
T13441 |
compound |
Japanese,Association |
R4028 |
T13443 |
T13441 |
prep |
for,Association |
R4029 |
T13444 |
T13443 |
pobj |
Laboratory,for |
R4030 |
T13445 |
T13444 |
prep |
of,Laboratory |
R4031 |
T13446 |
T13447 |
compound |
Animal,Science |
R4032 |
T13447 |
T13445 |
pobj |
Science,of |
R4033 |
T13448 |
T13422 |
punct |
", ",conformed |
R4034 |
T13449 |
T13422 |
cc |
and,conformed |
R4035 |
T13450 |
T13451 |
auxpass |
were,approved |
R4036 |
T13451 |
T13422 |
conj |
approved,conformed |
R4037 |
T13452 |
T13451 |
agent |
by,approved |
R4038 |
T13453 |
T13454 |
det |
the,Committee |
R4039 |
T13454 |
T13452 |
pobj |
Committee,by |
R4040 |
T13455 |
T13456 |
nmod |
Animal,Care |
R4041 |
T13456 |
T13454 |
nmod |
Care,Committee |
R4042 |
T13457 |
T13456 |
cc |
and,Care |
R4043 |
T13458 |
T13456 |
conj |
Use,Care |
R4044 |
T13459 |
T13454 |
prep |
of,Committee |
R4045 |
T13460 |
T13461 |
compound |
Eisai,Co. |
R4046 |
T13461 |
T13459 |
pobj |
Co.,of |
R4047 |
T13462 |
T13461 |
punct |
", ",Co. |
R4048 |
T13463 |
T13461 |
amod |
Ltd,Co. |
R4049 |
T13464 |
T13422 |
punct |
.,conformed |
R4050 |
T13466 |
T13467 |
prep |
For,used |
R4051 |
T13468 |
T13469 |
det |
the,experiments |
R4052 |
T13469 |
T13466 |
pobj |
experiments,For |
R4053 |
T13470 |
T13469 |
amod |
present,experiments |
R4054 |
T13471 |
T13467 |
punct |
", ",used |
R4055 |
T13472 |
T13473 |
npadvmod |
ADAM11,deficient |
R4056 |
T13473 |
T13475 |
amod |
deficient,mice |
R4057 |
T13474 |
T13473 |
punct |
-,deficient |
R4058 |
T13475 |
T13467 |
nsubjpass |
mice,used |
R4059 |
T13476 |
T13475 |
amod |
male,mice |
R4060 |
T13477 |
T13478 |
punct |
(,generations |
R4061 |
T13478 |
T13475 |
parataxis |
generations,mice |
R4062 |
T13479 |
T13478 |
amod |
backcrossed,generations |
R4063 |
T13480 |
T13478 |
prep |
into,generations |
R4064 |
T13481 |
T13482 |
compound |
C57BL,6NCrj |
R4065 |
T13482 |
T13480 |
pobj |
6NCrj,into |
R4066 |
T13483 |
T13482 |
punct |
/,6NCrj |
R4067 |
T13484 |
T13478 |
punct |
", ",generations |
R4068 |
T13485 |
T13486 |
nsubj |
n,14 |
R4069 |
T13486 |
T13478 |
ccomp |
14,generations |
R4070 |
T13487 |
T13486 |
punct |
=,14 |
R4071 |
T13488 |
T13478 |
punct |
),generations |
R4072 |
T13489 |
T13467 |
auxpass |
were,used |
R4073 |
T13490 |
T13467 |
prep |
in,used |
R4074 |
T13491 |
T13492 |
det |
all,analyses |
R4075 |
T13492 |
T13490 |
pobj |
analyses,in |
R4076 |
T13493 |
T13492 |
amod |
behavioural,analyses |
R4077 |
T13494 |
T13495 |
punct |
(,weeks |
R4078 |
T13495 |
T13467 |
parataxis |
weeks,used |
R4079 |
T13496 |
T13497 |
quantmod |
22,24 |
R4080 |
T13497 |
T13495 |
nummod |
24,weeks |
R4081 |
T13498 |
T13497 |
punct |
–,24 |
R4082 |
T13499 |
T13495 |
prep |
of,weeks |
R4083 |
T13500 |
T13499 |
pobj |
age,of |
R4084 |
T13501 |
T13495 |
punct |
),weeks |
R4085 |
T13502 |
T13467 |
punct |
.,used |
R4086 |
T13504 |
T13505 |
nsubjpass |
All,conducted |
R4087 |
T13506 |
T13504 |
prep |
of,All |
R4088 |
T13507 |
T13508 |
det |
the,studies |
R4089 |
T13508 |
T13506 |
pobj |
studies,of |
R4090 |
T13509 |
T13508 |
amod |
behavioural,studies |
R4091 |
T13510 |
T13505 |
auxpass |
were,conducted |
R4092 |
T13511 |
T13505 |
prep |
between,conducted |
R4093 |
T13512 |
T13513 |
nummod |
10,00 |
R4094 |
T13513 |
T13511 |
pobj |
00,between |
R4095 |
T13514 |
T13513 |
punct |
:,00 |
R4096 |
T13515 |
T13513 |
cc |
and,00 |
R4097 |
T13516 |
T13517 |
nummod |
16,00 |
R4098 |
T13517 |
T13513 |
conj |
00,00 |
R4099 |
T13518 |
T13517 |
punct |
:,00 |
R4100 |
T13519 |
T13505 |
agent |
by,conducted |
R4101 |
T13520 |
T13521 |
det |
a,experimenter |
R4102 |
T13521 |
T13519 |
pobj |
experimenter,by |
R4103 |
T13522 |
T13523 |
advmod |
well,trained |
R4104 |
T13523 |
T13521 |
amod |
trained,experimenter |
R4105 |
T13524 |
T13523 |
punct |
-,trained |
R4106 |
T13525 |
T13521 |
amod |
blind,experimenter |
R4107 |
T13526 |
T13525 |
prep |
to,blind |
R4108 |
T13527 |
T13528 |
det |
the,genotypes |
R4109 |
T13528 |
T13526 |
pobj |
genotypes,to |
R4110 |
T13529 |
T13528 |
compound |
mouse,genotypes |
R4111 |
T13530 |
T13505 |
punct |
.,conducted |
R4112 |
T13661 |
T13662 |
amod |
Spontaneous,activity |
R4113 |
T13663 |
T13662 |
compound |
motor,activity |
R4114 |
T13665 |
T13666 |
compound |
Locomotor,activity |
R4115 |
T13666 |
T13667 |
nsubjpass |
activity,measured |
R4116 |
T13668 |
T13666 |
prep |
in,activity |
R4117 |
T13669 |
T13670 |
det |
a,environment |
R4118 |
T13670 |
T13668 |
pobj |
environment,in |
R4119 |
T13671 |
T13670 |
amod |
novel,environment |
R4120 |
T13672 |
T13667 |
auxpass |
was,measured |
R4121 |
T13673 |
T13667 |
prep |
by,measured |
R4122 |
T13674 |
T13673 |
pcomp |
introducing,by |
R4123 |
T13675 |
T13674 |
dobj |
mice,introducing |
R4124 |
T13676 |
T13677 |
punct |
(,+ |
R4125 |
T13677 |
T13674 |
punct |
+,introducing |
R4126 |
T13678 |
T13677 |
punct |
+,+ |
R4127 |
T13679 |
T13677 |
punct |
/,+ |
R4128 |
T13680 |
T13677 |
punct |
", ",+ |
R4129 |
T13681 |
T13682 |
punct |
+,- |
R4130 |
T13682 |
T13677 |
conj |
-,+ |
R4131 |
T13683 |
T13682 |
punct |
/,- |
R4132 |
T13684 |
T13682 |
cc |
and,- |
R4133 |
T13685 |
T13686 |
punct |
-,- |
R4134 |
T13686 |
T13682 |
conj |
-,- |
R4135 |
T13687 |
T13686 |
punct |
/,- |
R4136 |
T13688 |
T13677 |
punct |
;,+ |
R4137 |
T13689 |
T13690 |
nsubj |
n,8 |
R4138 |
T13690 |
T13677 |
ccomp |
8,+ |
R4139 |
T13691 |
T13690 |
punct |
=,8 |
R4140 |
T13692 |
T13690 |
punct |
", ",8 |
R4141 |
T13693 |
T13690 |
conj |
8,8 |
R4142 |
T13694 |
T13693 |
cc |
and,8 |
R4143 |
T13695 |
T13693 |
conj |
8,8 |
R4144 |
T13696 |
T13690 |
punct |
", ",8 |
R4145 |
T13697 |
T13690 |
advmod |
respectively,8 |
R4146 |
T13698 |
T13677 |
punct |
),+ |
R4147 |
T13699 |
T13667 |
prep |
for,measured |
R4148 |
T13700 |
T13701 |
nummod |
90,min |
R4149 |
T13701 |
T13699 |
pobj |
min,for |
R4150 |
T13702 |
T13667 |
prep |
in,measured |
R4151 |
T13703 |
T13704 |
det |
a,box |
R4152 |
T13704 |
T13702 |
pobj |
box,in |
R4153 |
T13705 |
T13704 |
compound |
Plexiglas,box |
R4154 |
T13706 |
T13707 |
punct |
(,cm |
R4155 |
T13707 |
T13704 |
parataxis |
cm,box |
R4156 |
T13708 |
T13707 |
nummod |
30,cm |
R4157 |
T13709 |
T13710 |
punct |
×,20 |
R4158 |
T13710 |
T13708 |
prep |
20,30 |
R4159 |
T13711 |
T13712 |
punct |
×,13 |
R4160 |
T13712 |
T13708 |
prep |
13,30 |
R4161 |
T13713 |
T13707 |
punct |
),cm |
R4162 |
T13714 |
T13667 |
advcl |
using,measured |
R4163 |
T13715 |
T13716 |
det |
a,equipment |
R4164 |
T13716 |
T13714 |
dobj |
equipment,using |
R4165 |
T13717 |
T13716 |
compound |
VERSAMAX,equipment |
R4166 |
T13718 |
T13716 |
cc |
and,equipment |
R4167 |
T13719 |
T13716 |
conj |
software,equipment |
R4168 |
T13720 |
T13721 |
punct |
(,Accuscan |
R4169 |
T13721 |
T13716 |
parataxis |
Accuscan,equipment |
R4170 |
T13722 |
T13721 |
punct |
", ",Accuscan |
R4171 |
T13723 |
T13721 |
npadvmod |
Columbus,Accuscan |
R4172 |
T13724 |
T13721 |
punct |
", ",Accuscan |
R4173 |
T13725 |
T13721 |
npadvmod |
OH,Accuscan |
R4174 |
T13726 |
T13721 |
punct |
", ",Accuscan |
R4175 |
T13727 |
T13721 |
npadvmod |
USA,Accuscan |
R4176 |
T13728 |
T13721 |
punct |
),Accuscan |
R4177 |
T13729 |
T13667 |
punct |
.,measured |
R4178 |
T14364 |
T14365 |
compound |
Water,maze |
R4179 |
T14365 |
T14366 |
compound |
maze,task |
R4180 |
T14368 |
T14369 |
amod |
Spatial,learning |
R4181 |
T14369 |
T14370 |
nsubjpass |
learning,assessed |
R4182 |
T14371 |
T14370 |
auxpass |
was,assessed |
R4183 |
T14372 |
T14370 |
prep |
by,assessed |
R4184 |
T14373 |
T14374 |
nummod |
three,variants |
R4185 |
T14374 |
T14372 |
pobj |
variants,by |
R4186 |
T14375 |
T14374 |
prep |
of,variants |
R4187 |
T14376 |
T14377 |
det |
the,task |
R4188 |
T14377 |
T14375 |
pobj |
task,of |
R4189 |
T14378 |
T14377 |
compound |
Morris,task |
R4190 |
T14379 |
T14380 |
compound |
water,maze |
R4191 |
T14380 |
T14377 |
compound |
maze,task |
R4192 |
T14381 |
T14382 |
punct |
[,27 |
R4193 |
T14382 |
T14377 |
parataxis |
27,task |
R4194 |
T14383 |
T14382 |
punct |
],27 |
R4195 |
T14384 |
T14374 |
acl |
adapted,variants |
R4196 |
T14385 |
T14384 |
prep |
for,adapted |
R4197 |
T14386 |
T14385 |
pobj |
mice,for |
R4198 |
T14387 |
T14370 |
punct |
.,assessed |
R4199 |
T14389 |
T14390 |
amod |
Hidden,task |
R4200 |
T14390 |
T14392 |
dep |
task,divided |
R4201 |
T14391 |
T14390 |
compound |
platform,task |
R4202 |
T14393 |
T14392 |
punct |
: ,divided |
R4203 |
T14394 |
T14395 |
det |
The,pool |
R4204 |
T14395 |
T14392 |
nsubjpass |
pool,divided |
R4205 |
T14396 |
T14392 |
auxpass |
was,divided |
R4206 |
T14397 |
T14392 |
prep |
into,divided |
R4207 |
T14398 |
T14399 |
nummod |
four,quadrants |
R4208 |
T14399 |
T14397 |
pobj |
quadrants,into |
R4209 |
T14400 |
T14401 |
mark |
with,at |
R4210 |
T14401 |
T14392 |
advcl |
at,divided |
R4211 |
T14402 |
T14403 |
nummod |
four,locations |
R4212 |
T14403 |
T14401 |
nsubj |
locations,at |
R4213 |
T14404 |
T14403 |
compound |
starting,locations |
R4214 |
T14405 |
T14403 |
punct |
", ",locations |
R4215 |
T14406 |
T14403 |
acl |
called,locations |
R4216 |
T14407 |
T14406 |
oprd |
north,called |
R4217 |
T14408 |
T14407 |
punct |
", ",north |
R4218 |
T14409 |
T14407 |
conj |
east,north |
R4219 |
T14410 |
T14409 |
punct |
", ",east |
R4220 |
T14411 |
T14409 |
conj |
south,east |
R4221 |
T14412 |
T14411 |
cc |
and,south |
R4222 |
T14413 |
T14411 |
conj |
west,south |
R4223 |
T14414 |
T14401 |
punct |
", ",at |
R4224 |
T14415 |
T14416 |
amod |
equal,distances |
R4225 |
T14416 |
T14401 |
pobj |
distances,at |
R4226 |
T14417 |
T14416 |
prep |
to,distances |
R4227 |
T14418 |
T14419 |
det |
the,rim |
R4228 |
T14419 |
T14417 |
pobj |
rim,to |
R4229 |
T14420 |
T14392 |
punct |
.,divided |
R4230 |
T14422 |
T14423 |
det |
A,platform |
R4231 |
T14423 |
T14428 |
nsubjpass |
platform,submerged |
R4232 |
T14424 |
T14423 |
amod |
circular,platform |
R4233 |
T14425 |
T14423 |
punct |
", ",platform |
R4234 |
T14426 |
T14423 |
amod |
transparent,platform |
R4235 |
T14427 |
T14423 |
amod |
acrylic,platform |
R4236 |
T14429 |
T14430 |
punct |
(,cm |
R4237 |
T14430 |
T14423 |
parataxis |
cm,platform |
R4238 |
T14431 |
T14430 |
nmod |
diameter,cm |
R4239 |
T14432 |
T14430 |
nummod |
8,cm |
R4240 |
T14433 |
T14430 |
punct |
),cm |
R4241 |
T14434 |
T14428 |
auxpass |
was,submerged |
R4242 |
T14435 |
T14436 |
nummod |
1,cm |
R4243 |
T14436 |
T14437 |
npadvmod |
cm,below |
R4244 |
T14437 |
T14428 |
prep |
below,submerged |
R4245 |
T14438 |
T14439 |
det |
the,surface |
R4246 |
T14439 |
T14437 |
pobj |
surface,below |
R4247 |
T14440 |
T14439 |
prep |
of,surface |
R4248 |
T14441 |
T14442 |
det |
the,water |
R4249 |
T14442 |
T14440 |
pobj |
water,of |
R4250 |
T14443 |
T14428 |
prep |
in,submerged |
R4251 |
T14444 |
T14445 |
det |
the,centre |
R4252 |
T14445 |
T14443 |
pobj |
centre,in |
R4253 |
T14446 |
T14445 |
prep |
of,centre |
R4254 |
T14447 |
T14448 |
det |
the,quadrant |
R4255 |
T14448 |
T14446 |
pobj |
quadrant,of |
R4256 |
T14449 |
T14448 |
compound |
southeast,quadrant |
R4257 |
T14450 |
T14428 |
prep |
for,submerged |
R4258 |
T14451 |
T14452 |
det |
each,trial |
R4259 |
T14452 |
T14450 |
pobj |
trial,for |
R4260 |
T14453 |
T14452 |
prep |
of,trial |
R4261 |
T14454 |
T14455 |
det |
this,task |
R4262 |
T14455 |
T14453 |
pobj |
task,of |
R4263 |
T14456 |
T14428 |
punct |
.,submerged |
R4264 |
T14458 |
T14459 |
det |
Each,mouse |
R4265 |
T14459 |
T14460 |
nsubjpass |
mouse,allowed |
R4266 |
T14461 |
T14460 |
auxpass |
was,allowed |
R4267 |
T14462 |
T14463 |
aux |
to,swim |
R4268 |
T14463 |
T14460 |
xcomp |
swim,allowed |
R4269 |
T14464 |
T14463 |
prep |
for,swim |
R4270 |
T14465 |
T14466 |
nummod |
60,sec |
R4271 |
T14466 |
T14464 |
pobj |
sec,for |
R4272 |
T14467 |
T14460 |
cc |
and,allowed |
R4273 |
T14468 |
T14469 |
det |
the,time |
R4274 |
T14469 |
T14470 |
nsubjpass |
time,recorded |
R4275 |
T14470 |
T14460 |
conj |
recorded,allowed |
R4276 |
T14471 |
T14469 |
acl |
required,time |
R4277 |
T14472 |
T14473 |
aux |
to,reach |
R4278 |
T14473 |
T14471 |
xcomp |
reach,required |
R4279 |
T14474 |
T14475 |
det |
the,platform |
R4280 |
T14475 |
T14473 |
dobj |
platform,reach |
R4281 |
T14476 |
T14469 |
punct |
(,time |
R4282 |
T14477 |
T14478 |
compound |
escape,latency |
R4283 |
T14478 |
T14469 |
appos |
latency,time |
R4284 |
T14479 |
T14469 |
punct |
),time |
R4285 |
T14480 |
T14470 |
auxpass |
was,recorded |
R4286 |
T14481 |
T14470 |
prep |
in,recorded |
R4287 |
T14482 |
T14483 |
det |
each,trial |
R4288 |
T14483 |
T14481 |
pobj |
trial,in |
R4289 |
T14484 |
T14470 |
punct |
.,recorded |
R4290 |
T14486 |
T14487 |
prep |
In,consisted |
R4291 |
T14488 |
T14486 |
amod |
total,In |
R4292 |
T14489 |
T14490 |
det |
this,task |
R4293 |
T14490 |
T14487 |
nsubj |
task,consisted |
R4294 |
T14491 |
T14487 |
prep |
of,consisted |
R4295 |
T14492 |
T14493 |
nummod |
four,trials |
R4296 |
T14493 |
T14491 |
pobj |
trials,of |
R4297 |
T14494 |
T14493 |
prep |
per,trials |
R4298 |
T14495 |
T14494 |
pobj |
day,per |
R4299 |
T14496 |
T14487 |
prep |
over,consisted |
R4300 |
T14497 |
T14498 |
nummod |
9,days |
R4301 |
T14498 |
T14496 |
pobj |
days,over |
R4302 |
T14499 |
T14500 |
punct |
(,intervals |
R4303 |
T14500 |
T14498 |
parataxis |
intervals,days |
R4304 |
T14501 |
T14502 |
nummod |
1,min |
R4305 |
T14502 |
T14500 |
nmod |
min,intervals |
R4306 |
T14503 |
T14500 |
amod |
inter-trial,intervals |
R4307 |
T14504 |
T14500 |
punct |
),intervals |
R4308 |
T14505 |
T14487 |
punct |
.,consisted |
R4309 |
T14507 |
T14508 |
det |
Each,trial |
R4310 |
T14508 |
T14509 |
nsubjpass |
trial,initiated |
R4311 |
T14510 |
T14509 |
auxpass |
was,initiated |
R4312 |
T14511 |
T14509 |
agent |
by,initiated |
R4313 |
T14512 |
T14513 |
advmod |
randomly,placing |
R4314 |
T14513 |
T14511 |
pcomp |
placing,by |
R4315 |
T14514 |
T14515 |
det |
an,animal |
R4316 |
T14515 |
T14513 |
dobj |
animal,placing |
R4317 |
T14516 |
T14513 |
prep |
in,placing |
R4318 |
T14517 |
T14516 |
pobj |
one,in |
R4319 |
T14518 |
T14517 |
prep |
of,one |
R4320 |
T14519 |
T14520 |
det |
the,locations |
R4321 |
T14520 |
T14518 |
pobj |
locations,of |
R4322 |
T14521 |
T14520 |
nummod |
four,locations |
R4323 |
T14522 |
T14520 |
compound |
starting,locations |
R4324 |
T14523 |
T14509 |
punct |
.,initiated |
R4325 |
T14525 |
T14526 |
compound |
Probe,trial |
R4326 |
T14526 |
T14527 |
dep |
trial,carried |
R4327 |
T14528 |
T14527 |
punct |
: ,carried |
R4328 |
T14529 |
T14530 |
det |
A,trial |
R4329 |
T14530 |
T14527 |
nsubjpass |
trial,carried |
R4330 |
T14531 |
T14530 |
amod |
single,trial |
R4331 |
T14532 |
T14530 |
compound |
probe,trial |
R4332 |
T14533 |
T14527 |
auxpass |
was,carried |
R4333 |
T14534 |
T14527 |
prt |
out,carried |
R4334 |
T14535 |
T14536 |
mark |
after,completed |
R4335 |
T14536 |
T14527 |
advcl |
completed,carried |
R4336 |
T14537 |
T14538 |
det |
the,task |
R4337 |
T14538 |
T14536 |
nsubjpass |
task,completed |
R4338 |
T14539 |
T14540 |
amod |
hidden,platform |
R4339 |
T14540 |
T14538 |
compound |
platform,task |
R4340 |
T14541 |
T14536 |
aux |
had,completed |
R4341 |
T14542 |
T14536 |
auxpass |
been,completed |
R4342 |
T14543 |
T14527 |
punct |
.,carried |
R4343 |
T14545 |
T14546 |
prep |
In,removed |
R4344 |
T14547 |
T14548 |
det |
this,trial |
R4345 |
T14548 |
T14545 |
pobj |
trial,In |
R4346 |
T14549 |
T14546 |
punct |
", ",removed |
R4347 |
T14550 |
T14551 |
det |
the,platform |
R4348 |
T14551 |
T14546 |
nsubjpass |
platform,removed |
R4349 |
T14552 |
T14546 |
auxpass |
was,removed |
R4350 |
T14553 |
T14546 |
cc |
and,removed |
R4351 |
T14554 |
T14555 |
det |
the,movement |
R4352 |
T14555 |
T14556 |
nsubjpass |
movement,monitored |
R4353 |
T14556 |
T14546 |
conj |
monitored,removed |
R4354 |
T14557 |
T14555 |
prep |
of,movement |
R4355 |
T14558 |
T14559 |
det |
each,mouse |
R4356 |
T14559 |
T14557 |
pobj |
mouse,of |
R4357 |
T14560 |
T14556 |
auxpass |
was,monitored |
R4358 |
T14561 |
T14556 |
advcl |
using,monitored |
R4359 |
T14562 |
T14563 |
det |
a,system |
R4360 |
T14563 |
T14561 |
dobj |
system,using |
R4361 |
T14564 |
T14565 |
npadvmod |
computer,based |
R4362 |
T14565 |
T14563 |
amod |
based,system |
R4363 |
T14566 |
T14565 |
punct |
-,based |
R4364 |
T14567 |
T14568 |
compound |
video,tracking |
R4365 |
T14568 |
T14563 |
compound |
tracking,system |
R4366 |
T14569 |
T14570 |
punct |
(,Co. |
R4367 |
T14570 |
T14561 |
parataxis |
Co.,using |
R4368 |
T14571 |
T14570 |
dep |
BTA,Co. |
R4369 |
T14572 |
T14571 |
punct |
-,BTA |
R4370 |
T14573 |
T14571 |
nummod |
2,BTA |
R4371 |
T14574 |
T14570 |
punct |
;,Co. |
R4372 |
T14575 |
T14570 |
compound |
Muromachi,Co. |
R4373 |
T14576 |
T14570 |
compound |
Kikai,Co. |
R4374 |
T14577 |
T14570 |
punct |
", ",Co. |
R4375 |
T14578 |
T14570 |
amod |
Ltd.,Co. |
R4376 |
T14579 |
T14570 |
punct |
", ",Co. |
R4377 |
T14580 |
T14570 |
npadvmod |
Tokyo,Co. |
R4378 |
T14581 |
T14570 |
punct |
", ",Co. |
R4379 |
T14582 |
T14570 |
npadvmod |
Japan,Co. |
R4380 |
T14583 |
T14570 |
punct |
),Co. |
R4381 |
T14584 |
T14546 |
punct |
.,removed |
R4382 |
T14586 |
T14587 |
det |
Each,mouse |
R4383 |
T14587 |
T14588 |
nsubjpass |
mouse,placed |
R4384 |
T14589 |
T14588 |
auxpass |
was,placed |
R4385 |
T14590 |
T14588 |
prep |
into,placed |
R4386 |
T14591 |
T14592 |
det |
the,quadrant |
R4387 |
T14592 |
T14590 |
pobj |
quadrant,into |
R4388 |
T14593 |
T14592 |
compound |
northwest,quadrant |
R4389 |
T14594 |
T14592 |
prep |
of,quadrant |
R4390 |
T14595 |
T14596 |
det |
the,pool |
R4391 |
T14596 |
T14594 |
pobj |
pool,of |
R4392 |
T14597 |
T14588 |
cc |
and,placed |
R4393 |
T14598 |
T14588 |
conj |
allowed,placed |
R4394 |
T14599 |
T14600 |
aux |
to,swim |
R4395 |
T14600 |
T14598 |
xcomp |
swim,allowed |
R4396 |
T14601 |
T14600 |
prep |
for,swim |
R4397 |
T14602 |
T14603 |
nummod |
60,sec |
R4398 |
T14603 |
T14601 |
pobj |
sec,for |
R4399 |
T14604 |
T14588 |
punct |
.,placed |
R4400 |
T14606 |
T14607 |
compound |
Swim,path |
R4401 |
T14607 |
T14608 |
compound |
path,length |
R4402 |
T14608 |
T14609 |
nsubjpass |
length,calculated |
R4403 |
T14610 |
T14608 |
cc |
and,length |
R4404 |
T14611 |
T14612 |
det |
the,time |
R4405 |
T14612 |
T14608 |
conj |
time,length |
R4406 |
T14613 |
T14612 |
acl |
spent,time |
R4407 |
T14614 |
T14613 |
prep |
in,spent |
R4408 |
T14615 |
T14616 |
det |
the,quadrant |
R4409 |
T14616 |
T14614 |
pobj |
quadrant,in |
R4410 |
T14617 |
T14616 |
amod |
trained,quadrant |
R4411 |
T14618 |
T14616 |
punct |
(,quadrant |
R4412 |
T14619 |
T14616 |
nmod |
southeast,quadrant |
R4413 |
T14620 |
T14616 |
punct |
),quadrant |
R4414 |
T14621 |
T14609 |
auxpass |
were,calculated |
R4415 |
T14622 |
T14609 |
punct |
.,calculated |
R4416 |
T14624 |
T14625 |
amod |
Visible,task |
R4417 |
T14625 |
T14627 |
dep |
task,made |
R4418 |
T14626 |
T14625 |
compound |
platform,task |
R4419 |
T14628 |
T14627 |
punct |
: ,made |
R4420 |
T14629 |
T14627 |
prep |
In,made |
R4421 |
T14630 |
T14631 |
det |
this,task |
R4422 |
T14631 |
T14629 |
pobj |
task,In |
R4423 |
T14632 |
T14627 |
punct |
", ",made |
R4424 |
T14633 |
T14634 |
det |
the,platform |
R4425 |
T14634 |
T14627 |
nsubjpass |
platform,made |
R4426 |
T14635 |
T14634 |
amod |
circular,platform |
R4427 |
T14636 |
T14627 |
auxpass |
was,made |
R4428 |
T14637 |
T14627 |
oprd |
visible,made |
R4429 |
T14638 |
T14627 |
prep |
by,made |
R4430 |
T14639 |
T14638 |
pcomp |
attaching,by |
R4431 |
T14640 |
T14641 |
det |
a,board |
R4432 |
T14641 |
T14639 |
dobj |
board,attaching |
R4433 |
T14642 |
T14641 |
amod |
black,board |
R4434 |
T14643 |
T14639 |
prep |
to,attaching |
R4435 |
T14644 |
T14643 |
pobj |
it,to |
R4436 |
T14645 |
T14627 |
cc |
and,made |
R4437 |
T14646 |
T14647 |
det |
the,mouse |
R4438 |
T14647 |
T14648 |
nsubjpass |
mouse,required |
R4439 |
T14648 |
T14627 |
conj |
required,made |
R4440 |
T14649 |
T14648 |
auxpass |
was,required |
R4441 |
T14650 |
T14651 |
aux |
to,locate |
R4442 |
T14651 |
T14648 |
advcl |
locate,required |
R4443 |
T14652 |
T14653 |
det |
the,platform |
R4444 |
T14653 |
T14651 |
dobj |
platform,locate |
R4445 |
T14654 |
T14653 |
amod |
visible,platform |
R4446 |
T14655 |
T14627 |
punct |
.,made |
R4447 |
T14657 |
T14658 |
det |
The,mouse |
R4448 |
T14658 |
T14659 |
nsubjpass |
mouse,allowed |
R4449 |
T14660 |
T14659 |
auxpass |
was,allowed |
R4450 |
T14661 |
T14662 |
aux |
to,swim |
R4451 |
T14662 |
T14659 |
xcomp |
swim,allowed |
R4452 |
T14663 |
T14662 |
prep |
for,swim |
R4453 |
T14664 |
T14665 |
nummod |
60,sec |
R4454 |
T14665 |
T14663 |
pobj |
sec,for |
R4455 |
T14666 |
T14659 |
cc |
and,allowed |
R4456 |
T14667 |
T14668 |
det |
this,task |
R4457 |
T14668 |
T14669 |
nsubj |
task,consisted |
R4458 |
T14669 |
T14659 |
conj |
consisted,allowed |
R4459 |
T14670 |
T14669 |
prep |
of,consisted |
R4460 |
T14671 |
T14672 |
nummod |
four,trials |
R4461 |
T14672 |
T14670 |
pobj |
trials,of |
R4462 |
T14673 |
T14672 |
prep |
per,trials |
R4463 |
T14674 |
T14673 |
pobj |
day,per |
R4464 |
T14675 |
T14672 |
prep |
for,trials |
R4465 |
T14676 |
T14677 |
nummod |
three,days |
R4466 |
T14677 |
T14675 |
pobj |
days,for |
R4467 |
T14678 |
T14677 |
amod |
consecutive,days |
R4468 |
T14679 |
T14680 |
punct |
(,intervals |
R4469 |
T14680 |
T14672 |
parataxis |
intervals,trials |
R4470 |
T14681 |
T14682 |
nummod |
1,min |
R4471 |
T14682 |
T14680 |
nmod |
min,intervals |
R4472 |
T14683 |
T14680 |
amod |
inter-trial,intervals |
R4473 |
T14684 |
T14680 |
punct |
),intervals |
R4474 |
T14685 |
T14669 |
punct |
.,consisted |
R4475 |
T14687 |
T14688 |
det |
Each,trial |
R4476 |
T14688 |
T14689 |
nsubjpass |
trial,initiated |
R4477 |
T14690 |
T14689 |
auxpass |
was,initiated |
R4478 |
T14691 |
T14689 |
agent |
by,initiated |
R4479 |
T14692 |
T14693 |
advmod |
randomly,placing |
R4480 |
T14693 |
T14691 |
pcomp |
placing,by |
R4481 |
T14694 |
T14695 |
det |
an,animal |
R4482 |
T14695 |
T14693 |
dobj |
animal,placing |
R4483 |
T14696 |
T14693 |
prep |
in,placing |
R4484 |
T14697 |
T14696 |
pobj |
one,in |
R4485 |
T14698 |
T14697 |
prep |
of,one |
R4486 |
T14699 |
T14700 |
det |
the,locations |
R4487 |
T14700 |
T14698 |
pobj |
locations,of |
R4488 |
T14701 |
T14700 |
nummod |
four,locations |
R4489 |
T14702 |
T14700 |
compound |
starting,locations |
R4490 |
T14703 |
T14689 |
punct |
.,initiated |
R4491 |
T14924 |
T14925 |
amod |
Rotating,rod |
R4492 |
T14925 |
T14926 |
compound |
rod,test |
R4493 |
T14928 |
T14929 |
compound |
Motor,coordination |
R4494 |
T14929 |
T14930 |
nsubjpass |
coordination,assessed |
R4495 |
T14931 |
T14930 |
auxpass |
was,assessed |
R4496 |
T14932 |
T14930 |
prep |
with,assessed |
R4497 |
T14933 |
T14934 |
det |
a,apparatus |
R4498 |
T14934 |
T14932 |
pobj |
apparatus,with |
R4499 |
T14935 |
T14936 |
amod |
rotating,rod |
R4500 |
T14936 |
T14934 |
compound |
rod,apparatus |
R4501 |
T14937 |
T14938 |
punct |
(,Seisakujo |
R4502 |
T14938 |
T14934 |
parataxis |
Seisakujo,apparatus |
R4503 |
T14939 |
T14938 |
dep |
KN,Seisakujo |
R4504 |
T14940 |
T14939 |
punct |
-,KN |
R4505 |
T14941 |
T14939 |
nummod |
75,KN |
R4506 |
T14942 |
T14938 |
punct |
", ",Seisakujo |
R4507 |
T14943 |
T14938 |
compound |
Natsume,Seisakujo |
R4508 |
T14944 |
T14938 |
punct |
", ",Seisakujo |
R4509 |
T14945 |
T14938 |
npadvmod |
Tokyo,Seisakujo |
R4510 |
T14946 |
T14938 |
punct |
", ",Seisakujo |
R4511 |
T14947 |
T14938 |
npadvmod |
Japan,Seisakujo |
R4512 |
T14948 |
T14938 |
punct |
),Seisakujo |
R4513 |
T14949 |
T14934 |
punct |
", ",apparatus |
R4514 |
T14950 |
T14951 |
dep |
which,consisted |
R4515 |
T14951 |
T14934 |
relcl |
consisted,apparatus |
R4516 |
T14952 |
T14951 |
prep |
of,consisted |
R4517 |
T14953 |
T14954 |
det |
a,rod |
R4518 |
T14954 |
T14952 |
pobj |
rod,of |
R4519 |
T14955 |
T14954 |
compound |
plastic,rod |
R4520 |
T14956 |
T14957 |
punct |
(,diameter |
R4521 |
T14957 |
T14954 |
parataxis |
diameter,rod |
R4522 |
T14958 |
T14959 |
nummod |
3,cm |
R4523 |
T14959 |
T14957 |
compound |
cm,diameter |
R4524 |
T14960 |
T14957 |
punct |
", ",diameter |
R4525 |
T14961 |
T14962 |
nummod |
8,cm |
R4526 |
T14962 |
T14963 |
npadvmod |
cm,long |
R4527 |
T14963 |
T14957 |
amod |
long,diameter |
R4528 |
T14964 |
T14957 |
punct |
),diameter |
R4529 |
T14965 |
T14954 |
prep |
with,rod |
R4530 |
T14966 |
T14967 |
det |
a,surface |
R4531 |
T14967 |
T14965 |
pobj |
surface,with |
R4532 |
T14968 |
T14967 |
amod |
gritted,surface |
R4533 |
T14969 |
T14967 |
acl |
flanked,surface |
R4534 |
T14970 |
T14969 |
agent |
by,flanked |
R4535 |
T14971 |
T14972 |
nummod |
two,discs |
R4536 |
T14972 |
T14970 |
pobj |
discs,by |
R4537 |
T14973 |
T14972 |
amod |
large,discs |
R4538 |
T14974 |
T14975 |
punct |
(,diameter |
R4539 |
T14975 |
T14972 |
parataxis |
diameter,discs |
R4540 |
T14976 |
T14977 |
nummod |
40,cm |
R4541 |
T14977 |
T14975 |
compound |
cm,diameter |
R4542 |
T14978 |
T14975 |
punct |
),diameter |
R4543 |
T14979 |
T14930 |
punct |
.,assessed |
R4544 |
T14981 |
T14982 |
det |
The,mice |
R4545 |
T14982 |
T14983 |
nsubjpass |
mice,placed |
R4546 |
T14984 |
T14983 |
auxpass |
were,placed |
R4547 |
T14985 |
T14983 |
advmod |
first,placed |
R4548 |
T14986 |
T14983 |
prep |
on,placed |
R4549 |
T14987 |
T14988 |
det |
the,rod |
R4550 |
T14988 |
T14986 |
pobj |
rod,on |
R4551 |
T14989 |
T14988 |
amod |
stationary,rod |
R4552 |
T14990 |
T14983 |
prep |
for,placed |
R4553 |
T14991 |
T14992 |
nummod |
4,trials |
R4554 |
T14992 |
T14990 |
pobj |
trials,for |
R4555 |
T14993 |
T14992 |
amod |
successive,trials |
R4556 |
T14994 |
T14992 |
punct |
", ",trials |
R4557 |
T14995 |
T14992 |
acl |
followed,trials |
R4558 |
T14996 |
T14995 |
agent |
by,followed |
R4559 |
T14997 |
T14998 |
nummod |
4,trials |
R4560 |
T14998 |
T14996 |
pobj |
trials,by |
R4561 |
T14999 |
T14998 |
prep |
at,trials |
R4562 |
T15000 |
T15001 |
det |
a,speed |
R4563 |
T15001 |
T14999 |
pobj |
speed,at |
R4564 |
T15002 |
T15001 |
compound |
rotation,speed |
R4565 |
T15003 |
T15001 |
prep |
of,speed |
R4566 |
T15004 |
T15005 |
nummod |
5,rpm |
R4567 |
T15005 |
T15003 |
pobj |
rpm,of |
R4568 |
T15006 |
T14998 |
punct |
", ",trials |
R4569 |
T15007 |
T15008 |
nummod |
8,trials |
R4570 |
T15008 |
T14998 |
conj |
trials,trials |
R4571 |
T15009 |
T15008 |
prep |
at,trials |
R4572 |
T15010 |
T15011 |
nummod |
10,rpm |
R4573 |
T15011 |
T15009 |
pobj |
rpm,at |
R4574 |
T15012 |
T15008 |
punct |
", ",trials |
R4575 |
T15013 |
T15008 |
cc |
and,trials |
R4576 |
T15014 |
T15015 |
nummod |
20,trials |
R4577 |
T15015 |
T15008 |
conj |
trials,trials |
R4578 |
T15016 |
T15015 |
prep |
at,trials |
R4579 |
T15017 |
T15018 |
nummod |
15,rpm |
R4580 |
T15018 |
T15016 |
pobj |
rpm,at |
R4581 |
T15019 |
T14998 |
prep |
in,trials |
R4582 |
T15020 |
T15021 |
det |
that,order |
R4583 |
T15021 |
T15019 |
pobj |
order,in |
R4584 |
T15022 |
T14983 |
punct |
.,placed |
R4585 |
T15024 |
T15025 |
nsubjpass |
Latency,monitored |
R4586 |
T15026 |
T15027 |
mark |
until,occurred |
R4587 |
T15027 |
T15024 |
advcl |
occurred,Latency |
R4588 |
T15028 |
T15029 |
det |
a,fall |
R4589 |
T15029 |
T15027 |
nsubj |
fall,occurred |
R4590 |
T15030 |
T15025 |
auxpass |
was,monitored |
R4591 |
T15031 |
T15025 |
prep |
for,monitored |
R4592 |
T15032 |
T15033 |
nummod |
120,sec |
R4593 |
T15033 |
T15031 |
pobj |
sec,for |
R4594 |
T15034 |
T15025 |
punct |
.,monitored |
R4595 |
T15036 |
T15037 |
amod |
Intra-trial,intervals |
R4596 |
T15037 |
T15038 |
nsubj |
intervals,were |
R4597 |
T15039 |
T15037 |
prep |
for,intervals |
R4598 |
T15040 |
T15041 |
det |
each,animal |
R4599 |
T15041 |
T15039 |
pobj |
animal,for |
R4600 |
T15042 |
T15043 |
amod |
more,20 |
R4601 |
T15043 |
T15045 |
nummod |
20,min |
R4602 |
T15044 |
T15043 |
quantmod |
than,20 |
R4603 |
T15045 |
T15038 |
attr |
min,were |
R4604 |
T15046 |
T15038 |
punct |
.,were |
R4605 |
T15164 |
T15165 |
compound |
Traction,test |
R4606 |
T15167 |
T15168 |
det |
The,strength |
R4607 |
T15168 |
T15170 |
nsubjpass |
strength,measured |
R4608 |
T15169 |
T15168 |
compound |
grip,strength |
R4609 |
T15171 |
T15168 |
prep |
of,strength |
R4610 |
T15172 |
T15173 |
det |
each,mouse |
R4611 |
T15173 |
T15171 |
pobj |
mouse,of |
R4612 |
T15174 |
T15170 |
auxpass |
was,measured |
R4613 |
T15175 |
T15170 |
prep |
with,measured |
R4614 |
T15176 |
T15177 |
det |
a,apparatus |
R4615 |
T15177 |
T15175 |
pobj |
apparatus,with |
R4616 |
T15178 |
T15177 |
compound |
traction,apparatus |
R4617 |
T15179 |
T15180 |
punct |
(,Co. |
R4618 |
T15180 |
T15177 |
parataxis |
Co.,apparatus |
R4619 |
T15181 |
T15180 |
dep |
FU,Co. |
R4620 |
T15182 |
T15181 |
punct |
-,FU |
R4621 |
T15183 |
T15181 |
nummod |
1,FU |
R4622 |
T15184 |
T15180 |
punct |
", ",Co. |
R4623 |
T15185 |
T15180 |
compound |
Muromachi,Co. |
R4624 |
T15186 |
T15180 |
compound |
Kikai,Co. |
R4625 |
T15187 |
T15180 |
punct |
", ",Co. |
R4626 |
T15188 |
T15180 |
amod |
Ltd.,Co. |
R4627 |
T15189 |
T15180 |
punct |
),Co. |
R4628 |
T15190 |
T15170 |
punct |
.,measured |
R4629 |
T15192 |
T15193 |
det |
Each,mouse |
R4630 |
T15193 |
T15194 |
nsubjpass |
mouse,made |
R4631 |
T15195 |
T15194 |
auxpass |
was,made |
R4632 |
T15196 |
T15197 |
aux |
to,grasp |
R4633 |
T15197 |
T15194 |
xcomp |
grasp,made |
R4634 |
T15198 |
T15199 |
det |
the,bar |
R4635 |
T15199 |
T15197 |
dobj |
bar,grasp |
R4636 |
T15200 |
T15199 |
amod |
attached,bar |
R4637 |
T15201 |
T15202 |
punct |
(,diameter |
R4638 |
T15202 |
T15199 |
parataxis |
diameter,bar |
R4639 |
T15203 |
T15204 |
nummod |
2,mm |
R4640 |
T15204 |
T15202 |
compound |
mm,diameter |
R4641 |
T15205 |
T15202 |
punct |
),diameter |
R4642 |
T15206 |
T15197 |
prep |
with,grasp |
R4643 |
T15207 |
T15208 |
det |
the,forepaws |
R4644 |
T15208 |
T15206 |
pobj |
forepaws,with |
R4645 |
T15209 |
T15194 |
cc |
and,made |
R4646 |
T15210 |
T15211 |
auxpass |
was,pulled |
R4647 |
T15211 |
T15194 |
conj |
pulled,made |
R4648 |
T15212 |
T15211 |
advmod |
slowly,pulled |
R4649 |
T15213 |
T15211 |
advmod |
back,pulled |
R4650 |
T15214 |
T15211 |
prep |
by,pulled |
R4651 |
T15215 |
T15216 |
det |
the,tail |
R4652 |
T15216 |
T15214 |
pobj |
tail,by |
R4653 |
T15217 |
T15194 |
punct |
.,made |
R4654 |
T15219 |
T15220 |
det |
The,tension |
R4655 |
T15220 |
T15222 |
nsubjpass |
tension,recorded |
R4656 |
T15221 |
T15220 |
amod |
maximum,tension |
R4657 |
T15223 |
T15220 |
prep |
before,tension |
R4658 |
T15224 |
T15223 |
pobj |
release,before |
R4659 |
T15225 |
T15222 |
auxpass |
was,recorded |
R4660 |
T15226 |
T15222 |
punct |
.,recorded |
R4661 |
T15486 |
T15487 |
compound |
Wire,suspension |
R4662 |
T15487 |
T15488 |
compound |
suspension,test |
R4663 |
T15490 |
T15491 |
det |
A,mouse |
R4664 |
T15491 |
T15492 |
nsubjpass |
mouse,placed |
R4665 |
T15493 |
T15492 |
auxpass |
was,placed |
R4666 |
T15494 |
T15492 |
prep |
on,placed |
R4667 |
T15495 |
T15496 |
det |
a,bar |
R4668 |
T15496 |
T15494 |
pobj |
bar,on |
R4669 |
T15497 |
T15496 |
amod |
stainless,bar |
R4670 |
T15498 |
T15499 |
punct |
(,diameter |
R4671 |
T15499 |
T15496 |
parataxis |
diameter,bar |
R4672 |
T15500 |
T15501 |
nummod |
50,cm |
R4673 |
T15501 |
T15502 |
compound |
cm,length |
R4674 |
T15502 |
T15499 |
dep |
length,diameter |
R4675 |
T15503 |
T15499 |
punct |
", ",diameter |
R4676 |
T15504 |
T15505 |
nummod |
2,mm |
R4677 |
T15505 |
T15499 |
compound |
mm,diameter |
R4678 |
T15506 |
T15499 |
punct |
", ",diameter |
R4679 |
T15507 |
T15499 |
advcl |
elevated,diameter |
R4680 |
T15508 |
T15509 |
advmod |
up,37 |
R4681 |
T15509 |
T15511 |
nummod |
37,cm |
R4682 |
T15510 |
T15509 |
quantmod |
to,37 |
R4683 |
T15511 |
T15507 |
npadvmod |
cm,elevated |
R4684 |
T15512 |
T15511 |
prep |
from,cm |
R4685 |
T15513 |
T15514 |
det |
a,surface |
R4686 |
T15514 |
T15512 |
pobj |
surface,from |
R4687 |
T15515 |
T15499 |
punct |
),diameter |
R4688 |
T15516 |
T15492 |
prep |
at,placed |
R4689 |
T15517 |
T15518 |
det |
a,midway |
R4690 |
T15518 |
T15516 |
pobj |
midway,at |
R4691 |
T15519 |
T15518 |
compound |
point,midway |
R4692 |
T15520 |
T15518 |
prep |
between,midway |
R4693 |
T15521 |
T15522 |
det |
the,supports |
R4694 |
T15522 |
T15520 |
pobj |
supports,between |
R4695 |
T15523 |
T15492 |
cc |
and,placed |
R4696 |
T15524 |
T15492 |
conj |
observed,placed |
R4697 |
T15525 |
T15524 |
prep |
for,observed |
R4698 |
T15526 |
T15527 |
nummod |
30,sec |
R4699 |
T15527 |
T15525 |
pobj |
sec,for |
R4700 |
T15528 |
T15524 |
prep |
in,observed |
R4701 |
T15529 |
T15530 |
nummod |
four,trials |
R4702 |
T15530 |
T15528 |
pobj |
trials,in |
R4703 |
T15531 |
T15530 |
amod |
separate,trials |
R4704 |
T15532 |
T15492 |
punct |
.,placed |
R4705 |
T15534 |
T15535 |
det |
The,amount |
R4706 |
T15535 |
T15536 |
nsubjpass |
amount,recorded |
R4707 |
T15537 |
T15535 |
prep |
of,amount |
R4708 |
T15538 |
T15537 |
pobj |
time,of |
R4709 |
T15539 |
T15538 |
acl |
spent,time |
R4710 |
T15540 |
T15539 |
advcl |
hanging,spent |
R4711 |
T15541 |
T15536 |
auxpass |
was,recorded |
R4712 |
T15542 |
T15536 |
cc |
and,recorded |
R4713 |
T15543 |
T15536 |
conj |
scored,recorded |
R4714 |
T15544 |
T15543 |
prep |
according,scored |
R4715 |
T15545 |
T15544 |
prep |
to,according |
R4716 |
T15546 |
T15547 |
det |
the,system |
R4717 |
T15547 |
T15545 |
pobj |
system,to |
R4718 |
T15548 |
T15547 |
amod |
following,system |
R4719 |
T15549 |
T15550 |
punct |
[,41 |
R4720 |
T15550 |
T15543 |
parataxis |
41,scored |
R4721 |
T15551 |
T15550 |
punct |
],41 |
R4722 |
T15552 |
T15536 |
punct |
: ,recorded |
R4723 |
T15553 |
T15554 |
dep |
0,fell |
R4724 |
T15554 |
T15556 |
dep |
fell,escaped |
R4725 |
T15555 |
T15554 |
punct |
", ",fell |
R4726 |
T15556 |
T15536 |
dep |
escaped,recorded |
R4727 |
T15557 |
T15554 |
prt |
off,fell |
R4728 |
T15558 |
T15556 |
punct |
;,escaped |
R4729 |
T15559 |
T15560 |
dep |
1,hung |
R4730 |
T15560 |
T15556 |
dep |
hung,escaped |
R4731 |
T15561 |
T15560 |
punct |
", ",hung |
R4732 |
T15562 |
T15560 |
prep |
onto,hung |
R4733 |
T15563 |
T15564 |
det |
the,bar |
R4734 |
T15564 |
T15562 |
pobj |
bar,onto |
R4735 |
T15565 |
T15560 |
prep |
with,hung |
R4736 |
T15566 |
T15567 |
nummod |
two,forepaws |
R4737 |
T15567 |
T15565 |
pobj |
forepaws,with |
R4738 |
T15568 |
T15556 |
punct |
;,escaped |
R4739 |
T15569 |
T15570 |
dep |
2,attempted |
R4740 |
T15570 |
T15556 |
dep |
attempted,escaped |
R4741 |
T15571 |
T15570 |
punct |
", ",attempted |
R4742 |
T15572 |
T15570 |
prep |
in,attempted |
R4743 |
T15573 |
T15572 |
pobj |
addition,in |
R4744 |
T15574 |
T15573 |
prep |
to,addition |
R4745 |
T15575 |
T15574 |
pobj |
1,to |
R4746 |
T15576 |
T15570 |
punct |
", ",attempted |
R4747 |
T15577 |
T15578 |
aux |
to,climb |
R4748 |
T15578 |
T15570 |
xcomp |
climb,attempted |
R4749 |
T15579 |
T15578 |
prep |
onto,climb |
R4750 |
T15580 |
T15581 |
det |
the,bar |
R4751 |
T15581 |
T15579 |
pobj |
bar,onto |
R4752 |
T15582 |
T15556 |
punct |
;,escaped |
R4753 |
T15583 |
T15584 |
dep |
3,hung |
R4754 |
T15584 |
T15556 |
dep |
hung,escaped |
R4755 |
T15585 |
T15584 |
punct |
", ",hung |
R4756 |
T15586 |
T15584 |
prep |
onto,hung |
R4757 |
T15587 |
T15588 |
det |
the,bar |
R4758 |
T15588 |
T15586 |
pobj |
bar,onto |
R4759 |
T15589 |
T15584 |
prep |
with,hung |
R4760 |
T15590 |
T15591 |
nummod |
two,forepaws |
R4761 |
T15591 |
T15589 |
pobj |
forepaws,with |
R4762 |
T15592 |
T15591 |
cc |
and,forepaws |
R4763 |
T15593 |
T15594 |
nummod |
one,paws |
R4764 |
T15594 |
T15591 |
conj |
paws,forepaws |
R4765 |
T15595 |
T15593 |
cc |
or,one |
R4766 |
T15596 |
T15593 |
preconj |
both,one |
R4767 |
T15597 |
T15594 |
compound |
hind,paws |
R4768 |
T15598 |
T15556 |
punct |
;,escaped |
R4769 |
T15599 |
T15600 |
dep |
4,hung |
R4770 |
T15600 |
T15556 |
dep |
hung,escaped |
R4771 |
T15601 |
T15600 |
punct |
", ",hung |
R4772 |
T15602 |
T15600 |
prep |
onto,hung |
R4773 |
T15603 |
T15604 |
det |
the,bar |
R4774 |
T15604 |
T15602 |
pobj |
bar,onto |
R4775 |
T15605 |
T15600 |
prep |
with,hung |
R4776 |
T15606 |
T15607 |
det |
all,paws |
R4777 |
T15607 |
T15605 |
pobj |
paws,with |
R4778 |
T15608 |
T15607 |
nummod |
four,paws |
R4779 |
T15609 |
T15600 |
prep |
with,hung |
R4780 |
T15610 |
T15609 |
pobj |
tail,with |
R4781 |
T15611 |
T15610 |
acl |
wrapped,tail |
R4782 |
T15612 |
T15611 |
prep |
around,wrapped |
R4783 |
T15613 |
T15614 |
det |
the,bar |
R4784 |
T15614 |
T15612 |
pobj |
bar,around |
R4785 |
T15615 |
T15556 |
punct |
;,escaped |
R4786 |
T15616 |
T15556 |
dep |
5,escaped |
R4787 |
T15617 |
T15556 |
punct |
", ",escaped |
R4788 |
T15618 |
T15556 |
prep |
to,escaped |
R4789 |
T15619 |
T15618 |
pobj |
one,to |
R4790 |
T15620 |
T15619 |
prep |
of,one |
R4791 |
T15621 |
T15622 |
det |
the,supports |
R4792 |
T15622 |
T15620 |
pobj |
supports,of |
R4793 |
T15623 |
T15536 |
punct |
.,recorded |
R4794 |
T15705 |
T15706 |
compound |
Footprint,test |
R4795 |
T15708 |
T15709 |
amod |
Black,ink |
R4796 |
T15709 |
T15710 |
nsubjpass |
ink,applied |
R4797 |
T15711 |
T15710 |
auxpass |
was,applied |
R4798 |
T15712 |
T15710 |
prep |
to,applied |
R4799 |
T15713 |
T15714 |
det |
the,paws |
R4800 |
T15714 |
T15712 |
pobj |
paws,to |
R4801 |
T15715 |
T15714 |
compound |
hind,paws |
R4802 |
T15716 |
T15714 |
prep |
of,paws |
R4803 |
T15717 |
T15718 |
det |
each,mouse |
R4804 |
T15718 |
T15716 |
pobj |
mouse,of |
R4805 |
T15719 |
T15710 |
cc |
and,applied |
R4806 |
T15720 |
T15721 |
det |
the,mice |
R4807 |
T15721 |
T15722 |
nsubjpass |
mice,placed |
R4808 |
T15722 |
T15710 |
conj |
placed,applied |
R4809 |
T15723 |
T15722 |
auxpass |
were,placed |
R4810 |
T15724 |
T15722 |
prep |
in,placed |
R4811 |
T15725 |
T15726 |
det |
a,alley |
R4812 |
T15726 |
T15724 |
pobj |
alley,in |
R4813 |
T15727 |
T15726 |
amod |
narrow,alley |
R4814 |
T15728 |
T15729 |
punct |
(,cm |
R4815 |
T15729 |
T15726 |
parataxis |
cm,alley |
R4816 |
T15730 |
T15731 |
nummod |
9,10 |
R4817 |
T15731 |
T15729 |
nummod |
10,cm |
R4818 |
T15732 |
T15731 |
punct |
×,10 |
R4819 |
T15733 |
T15731 |
nummod |
25,10 |
R4820 |
T15734 |
T15731 |
punct |
×,10 |
R4821 |
T15735 |
T15729 |
punct |
),cm |
R4822 |
T15736 |
T15722 |
prep |
on,placed |
R4823 |
T15737 |
T15738 |
amod |
white,paper |
R4824 |
T15738 |
T15736 |
pobj |
paper,on |
R4825 |
T15739 |
T15722 |
punct |
.,placed |
R4826 |
T15741 |
T15742 |
compound |
Stride,length |
R4827 |
T15742 |
T15743 |
nsubjpass |
length,calculated |
R4828 |
T15744 |
T15742 |
cc |
and,length |
R4829 |
T15745 |
T15746 |
compound |
step,width |
R4830 |
T15746 |
T15742 |
conj |
width,length |
R4831 |
T15747 |
T15743 |
auxpass |
were,calculated |
R4832 |
T15748 |
T15743 |
punct |
.,calculated |
R4833 |
T15951 |
T15952 |
nsubjpass |
Data,expressed |
R4834 |
T15953 |
T15952 |
auxpass |
are,expressed |
R4835 |
T15954 |
T15952 |
prep |
as,expressed |
R4836 |
T15955 |
T15956 |
det |
the,SEM |
R4837 |
T15956 |
T15954 |
pobj |
SEM,as |
R4838 |
T15957 |
T15956 |
nmod |
means,SEM |
R4839 |
T15958 |
T15956 |
punct |
±,SEM |
R4840 |
T15959 |
T15952 |
punct |
.,expressed |
R4841 |
T15961 |
T15962 |
amod |
Statistical,analysis |
R4842 |
T15962 |
T15963 |
nsubjpass |
analysis,conducted |
R4843 |
T15964 |
T15963 |
auxpass |
was,conducted |
R4844 |
T15965 |
T15963 |
advcl |
using,conducted |
R4845 |
T15966 |
T15967 |
det |
the,package |
R4846 |
T15967 |
T15965 |
dobj |
package,using |
R4847 |
T15968 |
T15967 |
compound |
software,package |
R4848 |
T15969 |
T15967 |
appos |
SAS,package |
R4849 |
T15970 |
T15969 |
nummod |
8.1,SAS |
R4850 |
T15971 |
T15972 |
punct |
(,Japan |
R4851 |
T15972 |
T15967 |
parataxis |
Japan,package |
R4852 |
T15973 |
T15972 |
compound |
SAS,Japan |
R4853 |
T15974 |
T15972 |
compound |
Institute,Japan |
R4854 |
T15975 |
T15972 |
amod |
Ltd.,Japan |
R4855 |
T15976 |
T15972 |
punct |
", ",Japan |
R4856 |
T15977 |
T15972 |
npadvmod |
Tokyo,Japan |
R4857 |
T15978 |
T15972 |
punct |
", ",Japan |
R4858 |
T15979 |
T15972 |
npadvmod |
Japan,Japan |
R4859 |
T15980 |
T15972 |
punct |
),Japan |
R4860 |
T15981 |
T15963 |
punct |
.,conducted |
R4861 |
T15983 |
T15984 |
amod |
Statistical,significance |
R4862 |
T15984 |
T15985 |
nsubjpass |
significance,determined |
R4863 |
T15986 |
T15985 |
auxpass |
was,determined |
R4864 |
T15987 |
T15985 |
prep |
by,determined |
R4865 |
T15988 |
T15987 |
pobj |
analysis,by |
R4866 |
T15989 |
T15988 |
prep |
of,analysis |
R4867 |
T15990 |
T15989 |
pobj |
variance,of |
R4868 |
T15991 |
T15988 |
punct |
(,analysis |
R4869 |
T15992 |
T15988 |
appos |
ANOVA,analysis |
R4870 |
T15993 |
T15988 |
punct |
),analysis |
R4871 |
T15994 |
T15988 |
acl |
followed,analysis |
R4872 |
T15995 |
T15994 |
agent |
by,followed |
R4873 |
T15996 |
T15997 |
det |
the,test |
R4874 |
T15997 |
T15995 |
pobj |
test,by |
R4875 |
T15998 |
T15999 |
nmod |
Dunnett,type |
R4876 |
T15999 |
T15997 |
nmod |
type,test |
R4877 |
T16000 |
T15999 |
punct |
-,type |
R4878 |
T16001 |
T16002 |
amod |
multiple,comparison |
R4879 |
T16002 |
T15997 |
compound |
comparison,test |
R4880 |
T16003 |
T15985 |
punct |
", ",determined |
R4881 |
T16004 |
T15985 |
cc |
and,determined |
R4882 |
T16005 |
T16006 |
compound |
p,values |
R4883 |
T16006 |
T16007 |
nsubjpass |
values,considered |
R4884 |
T16007 |
T15985 |
conj |
considered,determined |
R4885 |
T16008 |
T16006 |
prep |
of,values |
R4886 |
T16009 |
T16010 |
amod |
less,0.05 |
R4887 |
T16010 |
T16008 |
pobj |
0.05,of |
R4888 |
T16011 |
T16010 |
quantmod |
than,0.05 |
R4889 |
T16012 |
T16007 |
auxpass |
were,considered |
R4890 |
T16013 |
T16014 |
aux |
to,be |
R4891 |
T16014 |
T16007 |
xcomp |
be,considered |
R4892 |
T16015 |
T16014 |
acomp |
significant,be |
R4893 |
T16016 |
T16014 |
prep |
in,be |
R4894 |
T16017 |
T16018 |
det |
the,task |
R4895 |
T16018 |
T16016 |
pobj |
task,in |
R4896 |
T16019 |
T16020 |
compound |
water,maze |
R4897 |
T16020 |
T16018 |
compound |
maze,task |
R4898 |
T16021 |
T16007 |
punct |
.,considered |
R4899 |
T16023 |
T16024 |
amod |
Behavioural,data |
R4900 |
T16024 |
T16025 |
nsubjpass |
data,analysed |
R4901 |
T16026 |
T16024 |
prep |
in,data |
R4902 |
T16027 |
T16028 |
det |
the,test |
R4903 |
T16028 |
T16026 |
pobj |
test,in |
R4904 |
T16029 |
T16030 |
amod |
rotating,rod |
R4905 |
T16030 |
T16028 |
compound |
rod,test |
R4906 |
T16031 |
T16025 |
auxpass |
were,analysed |
R4907 |
T16032 |
T16025 |
agent |
by,analysed |
R4908 |
T16033 |
T16034 |
nummod |
one,way |
R4909 |
T16034 |
T16039 |
compound |
way,ANOVA |
R4910 |
T16035 |
T16033 |
punct |
-,one |
R4911 |
T16036 |
T16033 |
cc |
or,one |
R4912 |
T16037 |
T16033 |
conj |
two,one |
R4913 |
T16038 |
T16034 |
punct |
-,way |
R4914 |
T16039 |
T16032 |
pobj |
ANOVA,by |
R4915 |
T16040 |
T16039 |
prep |
with,ANOVA |
R4916 |
T16041 |
T16042 |
amod |
repeated,measures |
R4917 |
T16042 |
T16040 |
pobj |
measures,with |
R4918 |
T16043 |
T16025 |
punct |
", ",analysed |
R4919 |
T16044 |
T16025 |
cc |
and,analysed |
R4920 |
T16045 |
T16046 |
compound |
p,values |
R4921 |
T16046 |
T16047 |
nsubjpass |
values,considered |
R4922 |
T16047 |
T16025 |
conj |
considered,analysed |
R4923 |
T16048 |
T16046 |
prep |
of,values |
R4924 |
T16049 |
T16050 |
amod |
less,0.05 |
R4925 |
T16050 |
T16048 |
pobj |
0.05,of |
R4926 |
T16051 |
T16050 |
quantmod |
than,0.05 |
R4927 |
T16052 |
T16047 |
auxpass |
were,considered |
R4928 |
T16053 |
T16054 |
aux |
to,be |
R4929 |
T16054 |
T16047 |
xcomp |
be,considered |
R4930 |
T16055 |
T16054 |
acomp |
significant,be |
R4931 |
T16056 |
T16047 |
punct |
.,considered |
R4932 |
T16223 |
T16224 |
nsubjpass |
Sections,fixed |
R4933 |
T16225 |
T16223 |
prep |
of,Sections |
R4934 |
T16226 |
T16225 |
pobj |
tissues,of |
R4935 |
T16227 |
T16226 |
prep |
including,tissues |
R4936 |
T16228 |
T16229 |
det |
the,brain |
R4937 |
T16229 |
T16227 |
pobj |
brain,including |
R4938 |
T16230 |
T16229 |
punct |
", ",brain |
R4939 |
T16231 |
T16232 |
amod |
spinal,cord |
R4940 |
T16232 |
T16229 |
conj |
cord,brain |
R4941 |
T16233 |
T16232 |
punct |
", ",cord |
R4942 |
T16234 |
T16232 |
conj |
heart,cord |
R4943 |
T16235 |
T16234 |
punct |
", ",heart |
R4944 |
T16236 |
T16234 |
conj |
lung,heart |
R4945 |
T16237 |
T16236 |
punct |
", ",lung |
R4946 |
T16238 |
T16236 |
conj |
liver,lung |
R4947 |
T16239 |
T16238 |
punct |
", ",liver |
R4948 |
T16240 |
T16238 |
conj |
kidney,liver |
R4949 |
T16241 |
T16240 |
punct |
", ",kidney |
R4950 |
T16242 |
T16240 |
conj |
spleen,kidney |
R4951 |
T16243 |
T16242 |
cc |
and,spleen |
R4952 |
T16244 |
T16242 |
conj |
testis,spleen |
R4953 |
T16245 |
T16223 |
prep |
from,Sections |
R4954 |
T16246 |
T16245 |
pobj |
mice,from |
R4955 |
T16247 |
T16248 |
punct |
(,+ |
R4956 |
T16248 |
T16246 |
punct |
+,mice |
R4957 |
T16249 |
T16248 |
punct |
+,+ |
R4958 |
T16250 |
T16248 |
punct |
/,+ |
R4959 |
T16251 |
T16248 |
punct |
", ",+ |
R4960 |
T16252 |
T16253 |
punct |
+,- |
R4961 |
T16253 |
T16248 |
conj |
-,+ |
R4962 |
T16254 |
T16253 |
punct |
/,- |
R4963 |
T16255 |
T16253 |
cc |
and,- |
R4964 |
T16256 |
T16257 |
punct |
-,- |
R4965 |
T16257 |
T16253 |
conj |
-,- |
R4966 |
T16258 |
T16257 |
punct |
/,- |
R4967 |
T16259 |
T16248 |
punct |
;,+ |
R4968 |
T16260 |
T16261 |
nsubj |
n,7 |
R4969 |
T16261 |
T16248 |
ccomp |
7,+ |
R4970 |
T16262 |
T16261 |
punct |
=,7 |
R4971 |
T16263 |
T16261 |
punct |
", ",7 |
R4972 |
T16264 |
T16261 |
conj |
7,7 |
R4973 |
T16265 |
T16264 |
cc |
and,7 |
R4974 |
T16266 |
T16264 |
conj |
7,7 |
R4975 |
T16267 |
T16261 |
punct |
", ",7 |
R4976 |
T16268 |
T16261 |
advmod |
respectively,7 |
R4977 |
T16269 |
T16248 |
punct |
),+ |
R4978 |
T16270 |
T16224 |
auxpass |
were,fixed |
R4979 |
T16271 |
T16224 |
prep |
in,fixed |
R4980 |
T16272 |
T16273 |
nummod |
10,% |
R4981 |
T16273 |
T16274 |
nmod |
%,formalin |
R4982 |
T16274 |
T16271 |
pobj |
formalin,in |
R4983 |
T16275 |
T16274 |
amod |
buffered,formalin |
R4984 |
T16276 |
T16224 |
cc |
and,fixed |
R4985 |
T16277 |
T16224 |
conj |
embedded,fixed |
R4986 |
T16278 |
T16277 |
prep |
in,embedded |
R4987 |
T16279 |
T16278 |
pobj |
paraffin,in |
R4988 |
T16280 |
T16224 |
punct |
.,fixed |
R4989 |
T16282 |
T16283 |
det |
Each,section |
R4990 |
T16283 |
T16285 |
nsubjpass |
section,stained |
R4991 |
T16284 |
T16283 |
compound |
paraffin,section |
R4992 |
T16286 |
T16283 |
prep |
of,section |
R4993 |
T16287 |
T16288 |
amod |
thick,μm |
R4994 |
T16288 |
T16286 |
pobj |
μm,of |
R4995 |
T16289 |
T16288 |
nummod |
4,μm |
R4996 |
T16290 |
T16285 |
auxpass |
was,stained |
R4997 |
T16291 |
T16285 |
prep |
with,stained |
R4998 |
T16292 |
T16291 |
pobj |
hematoxylin,with |
R4999 |
T16293 |
T16292 |
cc |
and,hematoxylin |
R5000 |
T16294 |
T16292 |
conj |
eosin,hematoxylin |
R5001 |
T16295 |
T16292 |
punct |
(,hematoxylin |
R5002 |
T16296 |
T16292 |
appos |
HE,hematoxylin |
R5003 |
T16297 |
T16285 |
punct |
),stained |
R5004 |
T16298 |
T16285 |
punct |
.,stained |